#   1A6Y 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.281 
PDB   1A6Y         
RCSB  PD0008       
WWPDB D_1000170469 
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.entry_id                        1A6Y 
_pdbx_database_status.recvd_initial_deposition_date   1998-03-04 
_pdbx_database_status.deposit_site                    NDB 
_pdbx_database_status.process_site                    NDB 
_pdbx_database_status.status_code_sf                  REL 
_pdbx_database_status.status_code_mr                  ? 
_pdbx_database_status.SG_entry                        ? 
_pdbx_database_status.pdb_format_compatible           Y 
_pdbx_database_status.status_code_cs                  ? 
'Zhao, Q.'           1 
'Khorasanizadeh, S.' 2 
'Rastinejad, F.'     3 
#                        primary 
_citation.title                     'Structural elements of an orphan nuclear receptor-DNA complex.' 
_citation.journal_abbrev            Mol.Cell 
_citation.journal_volume            1 
_citation.page_first                849 
_citation.page_last                 861 
_citation.year                      1998 
_citation.journal_id_ASTM           MOCEFL                   US 
_citation.journal_id_ISSN           1097-2765 
_citation.journal_id_CSD            2168 
_citation.book_publisher            ? 
_citation.pdbx_database_id_PubMed   9660968 
_citation.pdbx_database_id_DOI      '10.1016/S1097-2765(00)80084-2' 
primary 'Zhao, Q.'           1 
primary 'Khorasanizadeh, S.' 2 
primary 'Miyoshi, Y.'        3 
primary 'Lazar, M.A.'        4 
primary 'Rastinejad, F.'     5 
_cell.entry_id           1A6Y 
_cell.length_a           38.670 
_cell.length_b           45.690 
_cell.length_c           47.950 
_cell.angle_alpha        75.16 
_cell.angle_beta         80.64 
_cell.angle_gamma        85.58 
_cell.Z_PDB              2 
_cell.pdbx_unique_axis   ? 
_symmetry.entry_id                         1A6Y 
_symmetry.space_group_name_H-M             'P 1' 
_symmetry.pdbx_full_space_group_name_H-M   ? 
_symmetry.cell_setting                     triclinic 
_symmetry.Int_Tables_number                1 
1 polymer     syn 
6254.863  1   ? ?     ?                                                                        ? 
2 polymer     syn 
6124.965  1   ? ?     ?                                                                        ? 
3 polymer     man 'ORPHAN NUCLEAR RECEPTOR NR1D1'                                                  10902.009 2   ? H116L 
4 non-polymer syn 'ZINC ION'                                                                       65.409    4   ? ?     ? ? 
5 water       nat water                                                                            18.015    234 ? ?     ? ? 
_entity_name_com.entity_id   3        
1 polydeoxyribonucleotide no yes 
CAACTAGGTCACUAGGTCAG                                                                              C   ? 
2 polydeoxyribonucleotide no no  '(DC)(DT)(DG)(DA)(DC)(DC)(DT)(DA)(DG)(DT)(DG)(DA)(DC)(DC)(DT)(DA)(DG)(DT)(DT)(DG)'                
CTGACCTAGTGACCTAGTTG                                                                              D   ? 
3 'polypeptide(L)'        no no  
A,B ? 
1 1  DC  n 
1 2  DA  n 
1 3  DA  n 
1 4  DC  n 
1 5  DT  n 
1 6  DA  n 
1 7  DG  n 
1 8  DG  n 
1 9  DT  n 
1 10 DC  n 
1 11 DA  n 
1 12 DC  n 
1 13 5IU n 
1 14 DA  n 
1 15 DG  n 
1 16 DG  n 
1 17 DT  n 
1 18 DC  n 
1 19 DA  n 
1 20 DG  n 
2 1  DC  n 
2 2  DT  n 
2 3  DG  n 
2 4  DA  n 
2 5  DC  n 
2 6  DC  n 
2 7  DT  n 
2 8  DA  n 
2 9  DG  n 
2 10 DT  n 
2 11 DG  n 
2 12 DA  n 
2 13 DC  n 
2 14 DC  n 
2 15 DT  n 
2 16 DA  n 
2 17 DG  n 
2 18 DT  n 
2 19 DT  n 
2 20 DG  n 
3 1  THR n 
3 2  LYS n 
3 3  LEU n 
3 4  ASN n 
3 5  GLY n 
3 6  MET n 
3 7  VAL n 
3 8  LEU n 
3 9  LEU n 
3 10 CYS n 
3 11 LYS n 
3 12 VAL n 
3 13 CYS n 
3 14 GLY n 
3 15 ASP n 
3 16 VAL n 
3 17 ALA n 
3 18 SER n 
3 19 GLY n 
3 20 PHE n 
3 21 HIS n 
3 22 TYR n 
3 23 GLY n 
3 24 VAL n 
3 25 LEU n 
3 26 ALA n 
3 27 CYS n 
3 28 GLU n 
3 29 GLY n 
3 30 CYS n 
3 31 LYS n 
3 32 GLY n 
3 33 PHE n 
3 34 PHE n 
3 35 ARG n 
3 36 ARG n 
3 37 SER n 
3 38 ILE n 
3 39 GLN n 
3 40 GLN n 
3 41 ASN n 
3 42 ILE n 
3 43 GLN n 
3 44 TYR n 
3 45 LYS n 
3 46 ARG n 
3 47 CYS n 
3 48 LEU n 
3 49 LYS n 
3 50 ASN n 
3 51 GLU n 
3 52 ASN n 
3 53 CYS n 
3 54 SER n 
3 55 ILE n 
3 56 VAL n 
3 57 ARG n 
3 58 ILE n 
3 59 ASN n 
3 60 ARG n 
3 61 ASN n 
3 62 ARG n 
3 63 CYS n 
3 64 GLN n 
3 65 GLN n 
3 66 CYS n 
3 67 ARG n 
3 68 PHE n 
3 69 LYS n 
3 70 LYS n 
3 71 CYS n 
3 72 LEU n 
3 73 SER n 
3 74 VAL n 
3 75 GLY n 
3 76 MET n 
3 77 SER n 
3 78 ARG n 
3 79 ASP n 
3 80 ALA n 
3 81 VAL n 
3 82 ARG n 
3 83 PHE n 
3 84 GLY n 
3 85 ARG n 
3 86 ILE n 
3 87 PRO n 
3 88 LYS n 
3 89 ARG n 
3 90 GLU n 
3 91 LYS n 
3 92 GLN n 
3 93 ARG n 
3 94 MET n 
_entity_src_gen.entity_id                          3 
_entity_src_gen.pdbx_src_id                        1 
_entity_src_gen.pdbx_alt_source_flag               sample 
_entity_src_gen.pdbx_seq_type                      ? 
_entity_src_gen.pdbx_beg_seq_num                   ? 
_entity_src_gen.pdbx_end_seq_num                   ? 
_entity_src_gen.gene_src_common_name               human 
_entity_src_gen.gene_src_genus                     Homo 
_entity_src_gen.pdbx_gene_src_gene                 ? 
_entity_src_gen.gene_src_species                   ? 
_entity_src_gen.gene_src_strain                    ? 
_entity_src_gen.gene_src_tissue                    ? 
_entity_src_gen.gene_src_tissue_fraction           ? 
_entity_src_gen.gene_src_details                   ? 
_entity_src_gen.pdbx_gene_src_fragment             ? 
_entity_src_gen.pdbx_gene_src_scientific_name      'Homo sapiens' 
_entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id     9606 
_entity_src_gen.pdbx_gene_src_variant              ? 
_entity_src_gen.pdbx_gene_src_cell_line            ? 
_entity_src_gen.pdbx_gene_src_atcc                 ? 
_entity_src_gen.pdbx_gene_src_organ                ? 
_entity_src_gen.pdbx_gene_src_organelle            ? 
_entity_src_gen.pdbx_gene_src_cell                 ? 
_entity_src_gen.pdbx_gene_src_cellular_location    ? 
_entity_src_gen.host_org_common_name               ? 
_entity_src_gen.pdbx_host_org_scientific_name      'Escherichia coli BL21' 
_entity_src_gen.pdbx_host_org_ncbi_taxonomy_id     511693 
_entity_src_gen.host_org_genus                     Escherichia 
_entity_src_gen.pdbx_host_org_gene                 ? 
_entity_src_gen.pdbx_host_org_organ                ? 
_entity_src_gen.host_org_species                   'Escherichia coli' 
_entity_src_gen.pdbx_host_org_tissue               ? 
_entity_src_gen.pdbx_host_org_tissue_fraction      ? 
_entity_src_gen.pdbx_host_org_strain               BL21 
_entity_src_gen.pdbx_host_org_variant              ? 
_entity_src_gen.pdbx_host_org_cell_line            ? 
_entity_src_gen.pdbx_host_org_atcc                 ? 
_entity_src_gen.pdbx_host_org_culture_collection   ? 
_entity_src_gen.pdbx_host_org_cell                 ? 
_entity_src_gen.pdbx_host_org_organelle            ? 
_entity_src_gen.pdbx_host_org_cellular_location    ? 
_entity_src_gen.pdbx_host_org_vector_type          ? 
_entity_src_gen.pdbx_host_org_vector               ? 
_entity_src_gen.host_org_details                   ? 
_entity_src_gen.expression_system_id               ? 
_entity_src_gen.plasmid_name                       PGEX 
_entity_src_gen.plasmid_details                    ? 
_entity_src_gen.pdbx_description                   ? 
1 UNP NR1D1_HUMAN P20393 3 123 ? ? 
2 PDB 1A6Y        1A6Y   1 ?   ? ? 
3 PDB 1A6Y        1A6Y   2 ?   ? ? 
1 1 1A6Y A 1 ? 94 ? P20393 123 ? 216 ? 92  184 
2 1 1A6Y B 1 ? 94 ? P20393 123 ? 216 ? 92  184 
3 2 1A6Y C 1 ? 20 ? 1A6Y   600 ? 619 ? 600 619 
4 3 1A6Y D 1 ? 20 ? 1A6Y   621 ? 640 ? 621 640 
1 1A6Y LEU A 25 ? UNP P20393 HIS 147 'CLONING ARTIFACT' 116 1 
2 1A6Y LEU B 25 ? UNP P20393 HIS 147 'CLONING ARTIFACT' 116 2 
5IU 'DNA linking'       n "5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE" ? 'C9 H12 I N2 O8 P' 434.078 
ALA 'L-peptide linking' y ALANINE                                   ? 'C3 H7 N O2'       89.093  
ARG 'L-peptide linking' y ARGININE                                  ? 'C6 H15 N4 O2 1'   175.209 
ASN 'L-peptide linking' y ASPARAGINE                                ? 'C4 H8 N2 O3'      132.118 
ASP 'L-peptide linking' y 'ASPARTIC ACID'                           ? 'C4 H7 N O4'       133.103 
CYS 'L-peptide linking' y CYSTEINE                                  ? 'C3 H7 N O2 S'     121.158 
DA  'DNA linking'       y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE"      ? 'C10 H14 N5 O6 P'  331.222 
DC  'DNA linking'       y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE"       ? 'C9 H14 N3 O7 P'   307.197 
DG  'DNA linking'       y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE"      ? 'C10 H14 N5 O7 P'  347.221 
DT  'DNA linking'       y "THYMIDINE-5'-MONOPHOSPHATE"              ? 'C10 H15 N2 O8 P'  322.208 
GLN 'L-peptide linking' y GLUTAMINE                                 ? 'C5 H10 N2 O3'     146.144 
GLU 'L-peptide linking' y 'GLUTAMIC ACID'                           ? 'C5 H9 N O4'       147.129 
GLY 'peptide linking'   y GLYCINE                                   ? 'C2 H5 N O2'       75.067  
HIS 'L-peptide linking' y HISTIDINE                                 ? 'C6 H10 N3 O2 1'   156.162 
HOH non-polymer         . WATER                                     ? 'H2 O'             18.015  
ILE 'L-peptide linking' y ISOLEUCINE                                ? 'C6 H13 N O2'      131.173 
LEU 'L-peptide linking' y LEUCINE                                   ? 'C6 H13 N O2'      131.173 
LYS 'L-peptide linking' y LYSINE                                    ? 'C6 H15 N2 O2 1'   147.195 
MET 'L-peptide linking' y METHIONINE                                ? 'C5 H11 N O2 S'    149.211 
PHE 'L-peptide linking' y PHENYLALANINE                             ? 'C9 H11 N O2'      165.189 
PRO 'L-peptide linking' y PROLINE                                   ? 'C5 H9 N O2'       115.130 
SER 'L-peptide linking' y SERINE                                    ? 'C3 H7 N O3'       105.093 
THR 'L-peptide linking' y THREONINE                                 ? 'C4 H9 N O3'       119.119 
TYR 'L-peptide linking' y TYROSINE                                  ? 'C9 H11 N O3'      181.189 
VAL 'L-peptide linking' y VALINE                                    ? 'C5 H11 N O2'      117.146 
ZN  non-polymer         . 'ZINC ION'                                ? 'Zn 2'             65.409  
_exptl.entry_id          1A6Y 
_exptl.method            'X-RAY DIFFRACTION' 
_exptl.crystals_number   1 
#                    1 
_exptl_crystal.density_meas          ? 
_exptl_crystal.density_Matthews      2.58 
_exptl_crystal.density_percent_sol   53.4 
_exptl_crystal.description           ? 
_exptl_crystal_grow.crystal_id      1 
_exptl_crystal_grow.method          'VAPOR DIFFUSION, HANGING DROP' 
_exptl_crystal_grow.temp            ? 
_exptl_crystal_grow.temp_details    ? 
_exptl_crystal_grow.pH              7.5 
_exptl_crystal_grow.pdbx_pH_range   ? 
1 1 1 NACL       ? ? ? 
1 2 1 MGCL2      ? ? ? 
1 3 1 TRIS       ? ? ? 
1 4 1 'PEG 8000' ? ? ? 
1 5 2 'PEG 8000' ? ? ? 
#                     1 
_diffrn.ambient_temp           100 
_diffrn.ambient_temp_details   ? 
_diffrn.crystal_id             1 
_diffrn_detector.diffrn_id              1 
_diffrn_detector.detector               'IMAGE PLATE' 
_diffrn_detector.type                   MARRESEARCH 
_diffrn_detector.pdbx_collection_date   1996-12-15 
_diffrn_detector.details                NONE 
_diffrn_radiation.diffrn_id                        1 
_diffrn_radiation.wavelength_id                    1 
_diffrn_radiation.pdbx_monochromatic_or_laue_m_l   M 
_diffrn_radiation.monochromator                    'NI FILTER' 
_diffrn_radiation.pdbx_diffrn_protocol             'SINGLE WAVELENGTH' 
_diffrn_radiation.pdbx_scattering_type             x-ray 
#           1 
_diffrn_radiation_wavelength.wavelength   . 
_diffrn_radiation_wavelength.wt           1.0 
_diffrn_source.diffrn_id                   1 
_diffrn_source.source                      SYNCHROTRON 
_diffrn_source.type                        'EMBL/DESY, HAMBURG BEAMLINE X11' 
_diffrn_source.pdbx_synchrotron_site       'EMBL/DESY, Hamburg' 
_diffrn_source.pdbx_synchrotron_beamline   X11 
_diffrn_source.pdbx_wavelength             ? 
_diffrn_source.pdbx_wavelength_list        ? 
_reflns.entry_id                     1A6Y 
_reflns.observed_criterion_sigma_I   2 
_reflns.observed_criterion_sigma_F   ? 
_reflns.d_resolution_low             19.4 
_reflns.d_resolution_high            2.3 
_reflns.number_obs                   13482 
_reflns.number_all                   ? 
_reflns.percent_possible_obs         97.3 
_reflns.pdbx_Rmerge_I_obs            ? 
_reflns.pdbx_Rsym_value              0.088 
_reflns.pdbx_netI_over_sigmaI        15.1 
_reflns.B_iso_Wilson_estimate        ? 
_reflns.pdbx_redundancy              3.6 
_reflns.R_free_details               ? 
_reflns.pdbx_diffrn_id               1 
_reflns.pdbx_ordinal                 1 
_reflns_shell.d_res_high             2.3 
_reflns_shell.d_res_low              2.38 
_reflns_shell.percent_possible_all   94 
_reflns_shell.Rmerge_I_obs           ? 
_reflns_shell.pdbx_Rsym_value        0.492 
_reflns_shell.meanI_over_sigI_obs    2.8 
_reflns_shell.pdbx_redundancy        ? 
_reflns_shell.percent_possible_obs   ? 
_reflns_shell.number_unique_all      ? 
_reflns_shell.pdbx_diffrn_id         ? 
_reflns_shell.pdbx_ordinal           1 
_refine.entry_id                                 1A6Y 
_refine.ls_number_reflns_obs                     10614 
_refine.ls_number_reflns_all                     ? 
_refine.pdbx_ls_sigma_I                          ? 
_refine.pdbx_ls_sigma_F                          2 
_refine.pdbx_data_cutoff_high_absF               10000000.00 
_refine.pdbx_data_cutoff_low_absF                0.001 
_refine.ls_d_res_low                             6.0 
_refine.ls_d_res_high                            2.3 
_refine.ls_percent_reflns_obs                    97.2 
_refine.ls_R_factor_obs                          ? 
_refine.ls_R_factor_all                          ? 
_refine.ls_R_factor_R_work                       0.1921 
_refine.ls_R_factor_R_free                       0.288 
_refine.ls_R_factor_R_free_error                 ? 
_refine.ls_R_factor_R_free_error_details         ? 
_refine.ls_percent_reflns_R_free                 5 
_refine.ls_number_reflns_R_free                  674 
_refine.ls_number_parameters                     ? 
_refine.ls_number_restraints                     ? 
_refine.occupancy_min                            ? 
_refine.occupancy_max                            ? 
_refine.B_iso_mean                               31.1 
_refine.aniso_B[1][1]                            ? 
_refine.aniso_B[2][2]                            ? 
_refine.aniso_B[3][3]                            ? 
_refine.aniso_B[1][2]                            ? 
_refine.aniso_B[1][3]                            ? 
_refine.aniso_B[2][3]                            ? 
_refine.solvent_model_details                    ? 
_refine.solvent_model_param_ksol                 ? 
_refine.solvent_model_param_bsol                 ? 
_refine.pdbx_ls_cross_valid_method               THROUGHOUT 
_refine.details                                  'THERE IS AN INSERT GLN 133A IN BOTH CHAIN A AND B' 
_refine.pdbx_starting_model                      'PDB ENTRY 2NLL (TR PORTION)' 
_refine.pdbx_method_to_determine_struct          'MOLECULAR REPLACEMENT' 
_refine.pdbx_isotropic_thermal_model             RESTRAINED 
_refine.pdbx_stereochemistry_target_values       ? 
_refine.pdbx_stereochem_target_val_spec_case     ? 
_refine.pdbx_R_Free_selection_details            RANDOM 
_refine.ls_redundancy_reflns_obs                 ? 
_refine.overall_SU_B                             ? 
_refine.overall_SU_ML                            ? 
_refine.pdbx_overall_ESU_R                       ? 
_refine.pdbx_overall_ESU_R_Free                  ? 
_refine.pdbx_data_cutoff_high_rms_absF           ? 
_refine.pdbx_refine_id                           'X-RAY DIFFRACTION' 
_refine.pdbx_diffrn_id                           1 
_refine.pdbx_TLS_residual_ADP_flag               ? 
_refine.correlation_coeff_Fo_to_Fc               ? 
_refine.correlation_coeff_Fo_to_Fc_free          ? 
_refine.pdbx_solvent_vdw_probe_radii             ? 
_refine.pdbx_solvent_ion_probe_radii             ? 
_refine.pdbx_solvent_shrinkage_radii             ? 
_refine.pdbx_overall_phase_error                 ? 
_refine.overall_SU_R_Cruickshank_DPI             ? 
_refine.pdbx_overall_SU_R_free_Cruickshank_DPI   ? 
_refine.pdbx_overall_SU_R_Blow_DPI               ? 
_refine.pdbx_overall_SU_R_free_Blow_DPI          ? 
_refine_hist.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_refine_hist.cycle_id                         LAST 
_refine_hist.pdbx_number_atoms_protein        1282 
_refine_hist.pdbx_number_atoms_nucleic_acid   813 
_refine_hist.pdbx_number_atoms_ligand         5 
_refine_hist.number_atoms_solvent             234 
_refine_hist.number_atoms_total               2334 
_refine_hist.d_res_high                       2.3 
_refine_hist.d_res_low                        6.0 
x_bond_d                0.011 ? ? ? 'X-RAY DIFFRACTION' ? 
x_bond_d_na             ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_bond_d_prot           ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_angle_d               ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_angle_d_na            ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_angle_d_prot          ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_angle_deg             1.805 ? ? ? 'X-RAY DIFFRACTION' ? 
x_angle_deg_na          ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_angle_deg_prot        ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_dihedral_angle_d      22.08 ? ? ? 'X-RAY DIFFRACTION' ? 
x_dihedral_angle_d_na   ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_dihedral_angle_d_prot ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_improper_angle_d      0.995 ? ? ? 'X-RAY DIFFRACTION' ? 
x_improper_angle_d_na   ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_improper_angle_d_prot ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_mcbond_it             ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_mcangle_it            ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_scbond_it             ?     ? ? ? 'X-RAY DIFFRACTION' ? 
x_scangle_it            ?     ? ? ? 'X-RAY DIFFRACTION' ? 
_refine_ls_shell.pdbx_total_number_of_bins_used   8 
_refine_ls_shell.d_res_high                       2.3 
_refine_ls_shell.d_res_low                        2.4 
_refine_ls_shell.number_reflns_R_work             966 
_refine_ls_shell.R_factor_R_work                  0.2864 
_refine_ls_shell.percent_reflns_obs               94.1 
_refine_ls_shell.R_factor_R_free                  0.313 
_refine_ls_shell.R_factor_R_free_error            ? 
_refine_ls_shell.percent_reflns_R_free            4.6 
_refine_ls_shell.number_reflns_R_free             47 
_refine_ls_shell.redundancy_reflns_obs            ? 
_refine_ls_shell.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_refine_ls_shell.number_reflns_all                ? 
_refine_ls_shell.R_factor_all                     ? 
_struct.entry_id                  1A6Y 
_struct.title                     'REVERBA ORPHAN NUCLEAR RECEPTOR/DNA COMPLEX' 
_struct.pdbx_descriptor           'REVERBA ORPHAN NUCLEAR RECEPTOR/DNA COMPLEX' 
_struct.pdbx_model_details        ? 
_struct.pdbx_CASP_flag            ? 
_struct.pdbx_model_type_details   ? 
_struct_keywords.entry_id        1A6Y 
_struct_keywords.pdbx_keywords   TRANSCRIPTION/DNA 
A N N 1 ? 
B N N 2 ? 
C N N 3 ? 
D N N 3 ? 
E N N 4 ? 
F N N 4 ? 
G N N 4 ? 
H N N 4 ? 
I N N 5 ? 
J N N 5 ? 
K N N 5 ? 
L N N 5 ? 
#   1 
HELX_P HELX_P1 1 GLU C 28 ? ILE C 38 ? GLU A 119 ILE A 129 1 ? 11 
HELX_P HELX_P2 2 GLN C 64 ? SER C 73 ? GLN A 154 SER A 163 1 ? 10 
HELX_P HELX_P3 3 GLU D 28 ? ILE D 38 ? GLU B 119 ILE B 129 1 ? 11 
HELX_P HELX_P4 4 GLN D 64 ? VAL D 74 ? GLN B 154 VAL B 164 1 ? 11 
#          HELX_P 
_struct_conf_type.criteria    ? 
_struct_conf_type.reference   ? 
metalc1  metalc ? ? E ZN  .  ZN    ? ? ? 1_555 C CYS 10 SG ? ? A ZN  550 A CYS 101 1_555 ? ? ? ? ? ? ?            2.342 ? 
metalc2  metalc ? ? E ZN  .  ZN    ? ? ? 1_555 C CYS 13 SG ? ? A ZN  550 A CYS 104 1_555 ? ? ? ? ? ? ?            2.406 ? 
metalc3  metalc ? ? E ZN  .  ZN    ? ? ? 1_555 C CYS 27 SG ? ? A ZN  550 A CYS 118 1_555 ? ? ? ? ? ? ?            2.315 ? 
metalc4  metalc ? ? E ZN  .  ZN    ? ? ? 1_555 C CYS 30 SG ? ? A ZN  550 A CYS 121 1_555 ? ? ? ? ? ? ?            2.181 ? 
metalc5  metalc ? ? F ZN  .  ZN    ? ? ? 1_555 C CYS 47 SG ? ? A ZN  551 A CYS 137 1_555 ? ? ? ? ? ? ?            2.252 ? 
metalc6  metalc ? ? F ZN  .  ZN    ? ? ? 1_555 C CYS 53 SG ? ? A ZN  551 A CYS 143 1_555 ? ? ? ? ? ? ?            2.168 ? 
metalc7  metalc ? ? F ZN  .  ZN    ? ? ? 1_555 C CYS 63 SG ? ? A ZN  551 A CYS 153 1_555 ? ? ? ? ? ? ?            2.342 ? 
metalc8  metalc ? ? F ZN  .  ZN    ? ? ? 1_555 C CYS 66 SG ? ? A ZN  551 A CYS 156 1_555 ? ? ? ? ? ? ?            2.400 ? 
metalc9  metalc ? ? G ZN  .  ZN    ? ? ? 1_555 D CYS 10 SG ? ? B ZN  450 B CYS 101 1_555 ? ? ? ? ? ? ?            2.214 ? 
metalc10 metalc ? ? G ZN  .  ZN    ? ? ? 1_555 D CYS 13 SG ? ? B ZN  450 B CYS 104 1_555 ? ? ? ? ? ? ?            2.351 ? 
metalc11 metalc ? ? G ZN  .  ZN    ? ? ? 1_555 D CYS 27 SG ? ? B ZN  450 B CYS 118 1_555 ? ? ? ? ? ? ?            2.276 ? 
metalc12 metalc ? ? G ZN  .  ZN    ? ? ? 1_555 D CYS 30 SG ? ? B ZN  450 B CYS 121 1_555 ? ? ? ? ? ? ?            2.336 ? 
metalc13 metalc ? ? H ZN  .  ZN    ? ? ? 1_555 D CYS 47 SG ? ? B ZN  451 B CYS 137 1_555 ? ? ? ? ? ? ?            2.338 ? 
metalc14 metalc ? ? H ZN  .  ZN    ? ? ? 1_555 D CYS 53 SG ? ? B ZN  451 B CYS 143 1_555 ? ? ? ? ? ? ?            2.291 ? 
metalc15 metalc ? ? H ZN  .  ZN    ? ? ? 1_555 D CYS 63 SG ? ? B ZN  451 B CYS 153 1_555 ? ? ? ? ? ? ?            2.177 ? 
metalc16 metalc ? ? H ZN  .  ZN    ? ? ? 1_555 D CYS 66 SG ? ? B ZN  451 B CYS 156 1_555 ? ? ? ? ? ? ?            2.315 ? 
covale1  covale ? ? A DC  12 "O3'" ? ? ? 1_555 A 5IU 13 P  ? ? C DC  611 C 5IU 612 1_555 ? ? ? ? ? ? ?            1.617 ? 
covale2  covale ? ? A 5IU 13 "O3'" ? ? ? 1_555 A DA  14 P  ? ? C 5IU 612 C DA  613 1_555 ? ? ? ? ? ? ?            1.618 ? 
hydrog1  hydrog ? ? A DC  1  N3    ? ? ? 1_555 B DG  20 N1 ? ? C DC  600 D DG  640 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog2  hydrog ? ? A DC  1  N4    ? ? ? 1_555 B DG  20 O6 ? ? C DC  600 D DG  640 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog3  hydrog ? ? A DC  1  O2    ? ? ? 1_555 B DG  20 N2 ? ? C DC  600 D DG  640 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog4  hydrog ? ? A DA  2  N1    ? ? ? 1_555 B DT  19 N3 ? ? C DA  601 D DT  639 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog5  hydrog ? ? A DA  2  N6    ? ? ? 1_555 B DT  19 O4 ? ? C DA  601 D DT  639 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog6  hydrog ? ? A DA  3  N1    ? ? ? 1_555 B DT  18 N3 ? ? C DA  602 D DT  638 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog7  hydrog ? ? A DA  3  N6    ? ? ? 1_555 B DT  18 O4 ? ? C DA  602 D DT  638 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog8  hydrog ? ? A DC  4  N3    ? ? ? 1_555 B DG  17 N1 ? ? C DC  603 D DG  637 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog9  hydrog ? ? A DC  4  N4    ? ? ? 1_555 B DG  17 O6 ? ? C DC  603 D DG  637 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog10 hydrog ? ? A DC  4  O2    ? ? ? 1_555 B DG  17 N2 ? ? C DC  603 D DG  637 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog11 hydrog ? ? A DT  5  N3    ? ? ? 1_555 B DA  16 N1 ? ? C DT  604 D DA  636 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog12 hydrog ? ? A DT  5  O4    ? ? ? 1_555 B DA  16 N6 ? ? C DT  604 D DA  636 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog13 hydrog ? ? A DA  6  N1    ? ? ? 1_555 B DT  15 N3 ? ? C DA  605 D DT  635 1_555 ? ? ? ? ? ? 'DA-DT PAIR' ?     ? 
hydrog14 hydrog ? ? A DG  7  N1    ? ? ? 1_555 B DC  14 N3 ? ? C DG  606 D DC  634 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog15 hydrog ? ? A DG  7  N2    ? ? ? 1_555 B DC  14 O2 ? ? C DG  606 D DC  634 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog16 hydrog ? ? A DG  7  O6    ? ? ? 1_555 B DC  14 N4 ? ? C DG  606 D DC  634 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog17 hydrog ? ? A DG  8  N1    ? ? ? 1_555 B DC  13 N3 ? ? C DG  607 D DC  633 1_555 ? ? ? ? ? ? 'DG-DC PAIR' ?     ? 
hydrog18 hydrog ? ? A DT  9  N3    ? ? ? 1_555 B DA  12 N1 ? ? C DT  608 D DA  632 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog19 hydrog ? ? A DT  9  O4    ? ? ? 1_555 B DA  12 N6 ? ? C DT  608 D DA  632 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog20 hydrog ? ? A DC  10 N3    ? ? ? 1_555 B DG  11 N1 ? ? C DC  609 D DG  631 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog21 hydrog ? ? A DC  10 N4    ? ? ? 1_555 B DG  11 O6 ? ? C DC  609 D DG  631 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog22 hydrog ? ? A DC  10 O2    ? ? ? 1_555 B DG  11 N2 ? ? C DC  609 D DG  631 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog23 hydrog ? ? A DA  11 N1    ? ? ? 1_555 B DT  10 N3 ? ? C DA  610 D DT  630 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog24 hydrog ? ? A DA  11 N6    ? ? ? 1_555 B DT  10 O4 ? ? C DA  610 D DT  630 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog25 hydrog ? ? A DC  12 N3    ? ? ? 1_555 B DG  9  N1 ? ? C DC  611 D DG  629 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog26 hydrog ? ? A DC  12 N4    ? ? ? 1_555 B DG  9  O6 ? ? C DC  611 D DG  629 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog27 hydrog ? ? A DC  12 O2    ? ? ? 1_555 B DG  9  N2 ? ? C DC  611 D DG  629 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog28 hydrog ? ? A 5IU 13 N3    ? ? ? 1_555 B DA  8  N1 ? ? C 5IU 612 D DA  628 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog29 hydrog ? ? A 5IU 13 O4    ? ? ? 1_555 B DA  8  N6 ? ? C 5IU 612 D DA  628 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog30 hydrog ? ? A DA  14 N1    ? ? ? 1_555 B DT  7  N3 ? ? C DA  613 D DT  627 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog31 hydrog ? ? A DA  14 N6    ? ? ? 1_555 B DT  7  O4 ? ? C DA  613 D DT  627 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog32 hydrog ? ? A DG  15 N1    ? ? ? 1_555 B DC  6  N3 ? ? C DG  614 D DC  626 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog33 hydrog ? ? A DG  15 N2    ? ? ? 1_555 B DC  6  O2 ? ? C DG  614 D DC  626 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog34 hydrog ? ? A DG  15 O6    ? ? ? 1_555 B DC  6  N4 ? ? C DG  614 D DC  626 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog35 hydrog ? ? A DG  16 N1    ? ? ? 1_555 B DC  5  N3 ? ? C DG  615 D DC  625 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog36 hydrog ? ? A DG  16 N2    ? ? ? 1_555 B DC  5  O2 ? ? C DG  615 D DC  625 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog37 hydrog ? ? A DG  16 O6    ? ? ? 1_555 B DC  5  N4 ? ? C DG  615 D DC  625 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog38 hydrog ? ? A DT  17 N3    ? ? ? 1_555 B DA  4  N1 ? ? C DT  616 D DA  624 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog39 hydrog ? ? A DT  17 O4    ? ? ? 1_555 B DA  4  N6 ? ? C DT  616 D DA  624 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog40 hydrog ? ? A DC  18 N3    ? ? ? 1_555 B DG  3  N1 ? ? C DC  617 D DG  623 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog41 hydrog ? ? A DC  18 N4    ? ? ? 1_555 B DG  3  O6 ? ? C DC  617 D DG  623 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog42 hydrog ? ? A DC  18 O2    ? ? ? 1_555 B DG  3  N2 ? ? C DC  617 D DG  623 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog43 hydrog ? ? A DA  19 N1    ? ? ? 1_555 B DT  2  N3 ? ? C DA  618 D DT  622 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog44 hydrog ? ? A DA  19 N6    ? ? ? 1_555 B DT  2  O4 ? ? C DA  618 D DT  622 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog45 hydrog ? ? A DG  20 N1    ? ? ? 1_555 B DC  1  N3 ? ? C DG  619 D DC  621 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog46 hydrog ? ? A DG  20 N2    ? ? ? 1_555 B DC  1  O2 ? ? C DG  619 D DC  621 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog47 hydrog ? ? A DG  20 O6    ? ? ? 1_555 B DC  1  N4 ? ? C DG  619 D DC  621 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
metalc ? ? 
covale ? ? 
hydrog ? ? 
#               A 
_struct_sheet.type             ? 
_struct_sheet.number_strands   2 
_struct_sheet.details          ? 
_struct_sheet_order.sheet_id     A 
_struct_sheet_order.range_id_1   1 
_struct_sheet_order.range_id_2   2 
_struct_sheet_order.offset       ? 
_struct_sheet_order.sense        anti-parallel 
A 1 GLY C 19 ? HIS C 21 ? GLY A 110 HIS A 112 
A 2 VAL C 24 ? ALA C 26 ? VAL A 115 ALA A 117 
_pdbx_struct_sheet_hbond.sheet_id                A 
_pdbx_struct_sheet_hbond.range_id_1              1 
_pdbx_struct_sheet_hbond.range_id_2              2 
_pdbx_struct_sheet_hbond.range_1_label_atom_id   O 
_pdbx_struct_sheet_hbond.range_1_label_comp_id   GLY 
_pdbx_struct_sheet_hbond.range_1_label_asym_id   C 
_pdbx_struct_sheet_hbond.range_1_label_seq_id    19 
_pdbx_struct_sheet_hbond.range_1_PDB_ins_code    ? 
_pdbx_struct_sheet_hbond.range_1_auth_atom_id    O 
_pdbx_struct_sheet_hbond.range_1_auth_comp_id    GLY 
_pdbx_struct_sheet_hbond.range_1_auth_asym_id    A 
_pdbx_struct_sheet_hbond.range_1_auth_seq_id     110 
_pdbx_struct_sheet_hbond.range_2_label_atom_id   N 
_pdbx_struct_sheet_hbond.range_2_label_comp_id   ALA 
_pdbx_struct_sheet_hbond.range_2_label_asym_id   C 
_pdbx_struct_sheet_hbond.range_2_label_seq_id    26 
_pdbx_struct_sheet_hbond.range_2_PDB_ins_code    ? 
_pdbx_struct_sheet_hbond.range_2_auth_atom_id    N 
_pdbx_struct_sheet_hbond.range_2_auth_comp_id    ALA 
_pdbx_struct_sheet_hbond.range_2_auth_asym_id    A 
_pdbx_struct_sheet_hbond.range_2_auth_seq_id     117 
AC1 Software ? ? ? ? 4 'BINDING SITE FOR RESIDUE ZN A 550' 
AC2 Software ? ? ? ? 4 'BINDING SITE FOR RESIDUE ZN A 551' 
AC3 Software ? ? ? ? 4 'BINDING SITE FOR RESIDUE ZN B 450' 
AC4 Software ? ? ? ? 4 'BINDING SITE FOR RESIDUE ZN B 451' 
1  AC1 4 CYS C 10 ? CYS A 101 . ? 1_555 ? 
2  AC1 4 CYS C 13 ? CYS A 104 . ? 1_555 ? 
3  AC1 4 CYS C 27 ? CYS A 118 . ? 1_555 ? 
4  AC1 4 CYS C 30 ? CYS A 121 . ? 1_555 ? 
5  AC2 4 CYS C 47 ? CYS A 137 . ? 1_555 ? 
6  AC2 4 CYS C 53 ? CYS A 143 . ? 1_555 ? 
7  AC2 4 CYS C 63 ? CYS A 153 . ? 1_555 ? 
8  AC2 4 CYS C 66 ? CYS A 156 . ? 1_555 ? 
9  AC3 4 CYS D 10 ? CYS B 101 . ? 1_555 ? 
10 AC3 4 CYS D 13 ? CYS B 104 . ? 1_555 ? 
11 AC3 4 CYS D 27 ? CYS B 118 . ? 1_555 ? 
12 AC3 4 CYS D 30 ? CYS B 121 . ? 1_555 ? 
13 AC4 4 CYS D 47 ? CYS B 137 . ? 1_555 ? 
14 AC4 4 CYS D 53 ? CYS B 143 . ? 1_555 ? 
15 AC4 4 CYS D 63 ? CYS B 153 . ? 1_555 ? 
16 AC4 4 CYS D 66 ? CYS B 156 . ? 1_555 ? 
_database_PDB_matrix.entry_id          1A6Y 
_database_PDB_matrix.origx[1][1]       1.000000 
_database_PDB_matrix.origx[1][2]       0.000000 
_database_PDB_matrix.origx[1][3]       0.000000 
_database_PDB_matrix.origx[2][1]       0.000000 
_database_PDB_matrix.origx[2][2]       1.000000 
_database_PDB_matrix.origx[2][3]       0.000000 
_database_PDB_matrix.origx[3][1]       0.000000 
_database_PDB_matrix.origx[3][2]       0.000000 
_database_PDB_matrix.origx[3][3]       1.000000 
_database_PDB_matrix.origx_vector[1]   0.00000 
_database_PDB_matrix.origx_vector[2]   0.00000 
_database_PDB_matrix.origx_vector[3]   0.00000 
_atom_sites.entry_id                    1A6Y 
_atom_sites.fract_transf_matrix[1][1]   0.025860 
_atom_sites.fract_transf_matrix[1][2]   -0.001999 
_atom_sites.fract_transf_matrix[1][3]   -0.003889 
_atom_sites.fract_transf_matrix[2][1]   0.000000 
_atom_sites.fract_transf_matrix[2][2]   0.021952 
_atom_sites.fract_transf_matrix[2][3]   -0.005610 
_atom_sites.fract_transf_matrix[3][1]   0.000000 
_atom_sites.fract_transf_matrix[3][2]   0.000000 
_atom_sites.fract_transf_matrix[3][3]   0.021816 
_atom_sites.fract_transf_vector[1]      0.00000 
_atom_sites.fract_transf_vector[2]      0.00000 
_atom_sites.fract_transf_vector[3]      0.00000 
ATOM   1    O  "O5'" . DC  A 1 1  ? 38.304  19.130  -21.471 1.00 48.18 ? 600 DC  C "O5'" 1 
ATOM   2    C  "C5'" . DC  A 1 1  ? 38.362  20.490  -21.009 1.00 51.76 ? 600 DC  C "C5'" 1 
ATOM   3    C  "C4'" . DC  A 1 1  ? 36.979  21.089  -20.905 1.00 53.01 ? 600 DC  C "C4'" 1 
ATOM   4    O  "O4'" . DC  A 1 1  ? 36.137  20.502  -21.929 1.00 53.98 ? 600 DC  C "O4'" 1 
ATOM   5    C  "C3'" . DC  A 1 1  ? 36.279  20.807  -19.576 1.00 55.11 ? 600 DC  C "C3'" 1 
ATOM   6    O  "O3'" . DC  A 1 1  ? 35.409  21.898  -19.268 1.00 60.91 ? 600 DC  C "O3'" 1 
ATOM   7    C  "C2'" . DC  A 1 1  ? 35.500  19.537  -19.859 1.00 49.44 ? 600 DC  C "C2'" 1 
ATOM   8    C  "C1'" . DC  A 1 1  ? 35.131  19.685  -21.334 1.00 52.32 ? 600 DC  C "C1'" 1 
ATOM   9    N  N1    . DC  A 1 1  ? 35.083  18.411  -22.077 1.00 38.56 ? 600 DC  C N1    1 
ATOM   10   C  C2    . DC  A 1 1  ? 34.360  18.350  -23.259 1.00 33.25 ? 600 DC  C C2    1 
ATOM   11   O  O2    . DC  A 1 1  ? 33.798  19.377  -23.661 1.00 33.66 ? 600 DC  C O2    1 
ATOM   12   N  N3    . DC  A 1 1  ? 34.294  17.178  -23.939 1.00 21.33 ? 600 DC  C N3    1 
ATOM   13   C  C4    . DC  A 1 1  ? 34.931  16.104  -23.474 1.00 17.84 ? 600 DC  C C4    1 
ATOM   14   N  N4    . DC  A 1 1  ? 34.855  14.967  -24.169 1.00 10.37 ? 600 DC  C N4    1 
ATOM   15   C  C5    . DC  A 1 1  ? 35.680  16.142  -22.270 1.00 35.34 ? 600 DC  C C5    1 
ATOM   16   C  C6    . DC  A 1 1  ? 35.732  17.304  -21.609 1.00 43.17 ? 600 DC  C C6    1 
ATOM   17   P  P     . DA  A 1 2  ? 34.605  21.923  -17.876 1.00 64.61 ? 601 DA  C P     1 
ATOM   18   O  OP1   . DA  A 1 2  ? 34.883  23.240  -17.243 1.00 53.71 ? 601 DA  C OP1   1 
ATOM   19   O  OP2   . DA  A 1 2  ? 34.892  20.670  -17.129 1.00 62.79 ? 601 DA  C OP2   1 
ATOM   20   O  "O5'" . DA  A 1 2  ? 33.078  21.929  -18.340 1.00 61.87 ? 601 DA  C "O5'" 1 
ATOM   21   C  "C5'" . DA  A 1 2  ? 32.585  22.988  -19.164 1.00 57.07 ? 601 DA  C "C5'" 1 
ATOM   22   C  "C4'" . DA  A 1 2  ? 31.265  22.614  -19.799 1.00 59.31 ? 601 DA  C "C4'" 1 
ATOM   23   O  "O4'" . DA  A 1 2  ? 31.424  21.407  -20.582 1.00 61.79 ? 601 DA  C "O4'" 1 
ATOM   24   C  "C3'" . DA  A 1 2  ? 30.124  22.328  -18.824 1.00 64.58 ? 601 DA  C "C3'" 1 
ATOM   25   O  "O3'" . DA  A 1 2  ? 28.885  22.784  -19.379 1.00 64.77 ? 601 DA  C "O3'" 1 
ATOM   26   C  "C2'" . DA  A 1 2  ? 30.126  20.815  -18.723 1.00 60.02 ? 601 DA  C "C2'" 1 
ATOM   27   C  "C1'" . DA  A 1 2  ? 30.528  20.405  -20.125 1.00 55.03 ? 601 DA  C "C1'" 1 
ATOM   28   N  N9    . DA  A 1 2  ? 31.231  19.129  -20.161 1.00 49.03 ? 601 DA  C N9    1 
ATOM   29   C  C8    . DA  A 1 2  ? 32.132  18.646  -19.245 1.00 51.36 ? 601 DA  C C8    1 
ATOM   30   N  N7    . DA  A 1 2  ? 32.582  17.448  -19.528 1.00 50.25 ? 601 DA  C N7    1 
ATOM   31   C  C5    . DA  A 1 2  ? 31.939  17.124  -20.713 1.00 44.37 ? 601 DA  C C5    1 
ATOM   32   C  C6    . DA  A 1 2  ? 31.981  15.980  -21.524 1.00 46.91 ? 601 DA  C C6    1 
ATOM   33   N  N6    . DA  A 1 2  ? 32.733  14.912  -21.250 1.00 40.92 ? 601 DA  C N6    1 
ATOM   34   N  N1    . DA  A 1 2  ? 31.213  15.970  -22.639 1.00 47.73 ? 601 DA  C N1    1 
ATOM   35   C  C2    . DA  A 1 2  ? 30.461  17.049  -22.906 1.00 46.16 ? 601 DA  C C2    1 
ATOM   36   N  N3    . DA  A 1 2  ? 30.340  18.187  -22.215 1.00 39.63 ? 601 DA  C N3    1 
ATOM   37   C  C4    . DA  A 1 2  ? 31.112  18.156  -21.119 1.00 38.68 ? 601 DA  C C4    1 
ATOM   38   P  P     . DA  A 1 3  ? 27.592  22.917  -18.435 1.00 63.44 ? 602 DA  C P     1 
ATOM   39   O  OP1   . DA  A 1 3  ? 27.141  24.331  -18.519 1.00 58.56 ? 602 DA  C OP1   1 
ATOM   40   O  OP2   . DA  A 1 3  ? 27.913  22.328  -17.107 1.00 64.04 ? 602 DA  C OP2   1 
ATOM   41   O  "O5'" . DA  A 1 3  ? 26.516  21.974  -19.143 1.00 60.56 ? 602 DA  C "O5'" 1 
ATOM   42   C  "C5'" . DA  A 1 3  ? 26.080  22.220  -20.482 1.00 51.22 ? 602 DA  C "C5'" 1 
ATOM   43   C  "C4'" . DA  A 1 3  ? 25.366  21.004  -21.028 1.00 51.84 ? 602 DA  C "C4'" 1 
ATOM   44   O  "O4'" . DA  A 1 3  ? 26.312  19.918  -21.159 1.00 46.15 ? 602 DA  C "O4'" 1 
ATOM   45   C  "C3'" . DA  A 1 3  ? 24.240  20.461  -20.144 1.00 56.24 ? 602 DA  C "C3'" 1 
ATOM   46   O  "O3'" . DA  A 1 3  ? 23.202  19.896  -20.966 1.00 57.10 ? 602 DA  C "O3'" 1 
ATOM   47   C  "C2'" . DA  A 1 3  ? 24.930  19.365  -19.354 1.00 50.57 ? 602 DA  C "C2'" 1 
ATOM   48   C  "C1'" . DA  A 1 3  ? 25.866  18.801  -20.403 1.00 43.93 ? 602 DA  C "C1'" 1 
ATOM   49   N  N9    . DA  A 1 3  ? 27.041  18.096  -19.885 1.00 31.64 ? 602 DA  C N9    1 
ATOM   50   C  C8    . DA  A 1 3  ? 27.947  18.529  -18.952 1.00 27.12 ? 602 DA  C C8    1 
ATOM   51   N  N7    . DA  A 1 3  ? 28.883  17.652  -18.681 1.00 32.02 ? 602 DA  C N7    1 
ATOM   52   C  C5    . DA  A 1 3  ? 28.569  16.571  -19.492 1.00 21.95 ? 602 DA  C C5    1 
ATOM   53   C  C6    . DA  A 1 3  ? 29.159  15.318  -19.657 1.00 25.08 ? 602 DA  C C6    1 
ATOM   54   N  N6    . DA  A 1 3  ? 30.250  14.923  -19.000 1.00 38.42 ? 602 DA  C N6    1 
ATOM   55   N  N1    . DA  A 1 3  ? 28.588  14.465  -20.532 1.00 33.33 ? 602 DA  C N1    1 
ATOM   56   C  C2    . DA  A 1 3  ? 27.514  14.863  -21.198 1.00 20.66 ? 602 DA  C C2    1 
ATOM   57   N  N3    . DA  A 1 3  ? 26.871  16.019  -21.135 1.00 28.79 ? 602 DA  C N3    1 
ATOM   58   C  C4    . DA  A 1 3  ? 27.448  16.836  -20.245 1.00 14.69 ? 602 DA  C C4    1 
ATOM   59   P  P     . DC  A 1 4  ? 21.795  19.465  -20.307 1.00 55.13 ? 603 DC  C P     1 
ATOM   60   O  OP1   . DC  A 1 4  ? 20.763  19.683  -21.354 1.00 54.09 ? 603 DC  C OP1   1 
ATOM   61   O  OP2   . DC  A 1 4  ? 21.664  20.114  -18.969 1.00 46.07 ? 603 DC  C OP2   1 
ATOM   62   O  "O5'" . DC  A 1 4  ? 21.934  17.902  -20.088 1.00 41.17 ? 603 DC  C "O5'" 1 
ATOM   63   C  "C5'" . DC  A 1 4  ? 22.605  17.121  -21.060 1.00 51.85 ? 603 DC  C "C5'" 1 
ATOM   64   C  "C4'" . DC  A 1 4  ? 22.639  15.672  -20.647 1.00 44.61 ? 603 DC  C "C4'" 1 
ATOM   65   O  "O4'" . DC  A 1 4  ? 23.971  15.335  -20.186 1.00 46.10 ? 603 DC  C "O4'" 1 
ATOM   66   C  "C3'" . DC  A 1 4  ? 21.691  15.315  -19.503 1.00 40.91 ? 603 DC  C "C3'" 1 
ATOM   67   O  "O3'" . DC  A 1 4  ? 21.226  13.977  -19.709 1.00 38.88 ? 603 DC  C "O3'" 1 
ATOM   68   C  "C2'" . DC  A 1 4  ? 22.614  15.349  -18.301 1.00 47.56 ? 603 DC  C "C2'" 1 
ATOM   69   C  "C1'" . DC  A 1 4  ? 23.860  14.740  -18.915 1.00 42.12 ? 603 DC  C "C1'" 1 
ATOM   70   N  N1    . DC  A 1 4  ? 25.124  14.921  -18.182 1.00 29.63 ? 603 DC  C N1    1 
ATOM   71   C  C2    . DC  A 1 4  ? 26.096  13.941  -18.319 1.00 31.53 ? 603 DC  C C2    1 
ATOM   72   O  O2    . DC  A 1 4  ? 25.923  13.048  -19.161 1.00 30.39 ? 603 DC  C O2    1 
ATOM   73   N  N3    . DC  A 1 4  ? 27.205  13.989  -17.550 1.00 33.21 ? 603 DC  C N3    1 
ATOM   74   C  C4    . DC  A 1 4  ? 27.380  14.998  -16.701 1.00 35.19 ? 603 DC  C C4    1 
ATOM   75   N  N4    . DC  A 1 4  ? 28.477  14.982  -15.941 1.00 30.00 ? 603 DC  C N4    1 
ATOM   76   C  C5    . DC  A 1 4  ? 26.434  16.063  -16.591 1.00 30.32 ? 603 DC  C C5    1 
ATOM   77   C  C6    . DC  A 1 4  ? 25.330  15.985  -17.348 1.00 32.11 ? 603 DC  C C6    1 
ATOM   78   P  P     . DT  A 1 5  ? 19.947  13.444  -18.902 1.00 28.62 ? 604 DT  C P     1 
ATOM   79   O  OP1   . DT  A 1 5  ? 18.792  13.583  -19.815 1.00 30.03 ? 604 DT  C OP1   1 
ATOM   80   O  OP2   . DT  A 1 5  ? 19.944  14.088  -17.567 1.00 8.84  ? 604 DT  C OP2   1 
ATOM   81   O  "O5'" . DT  A 1 5  ? 20.201  11.894  -18.755 1.00 11.92 ? 604 DT  C "O5'" 1 
ATOM   82   C  "C5'" . DT  A 1 5  ? 20.502  11.130  -19.909 1.00 11.75 ? 604 DT  C "C5'" 1 
ATOM   83   C  "C4'" . DT  A 1 5  ? 21.402  9.978   -19.542 1.00 14.08 ? 604 DT  C "C4'" 1 
ATOM   84   O  "O4'" . DT  A 1 5  ? 22.578  10.507  -18.869 1.00 17.68 ? 604 DT  C "O4'" 1 
ATOM   85   C  "C3'" . DT  A 1 5  ? 20.778  8.974   -18.575 1.00 12.23 ? 604 DT  C "C3'" 1 
ATOM   86   O  "O3'" . DT  A 1 5  ? 21.226  7.688   -18.931 1.00 14.31 ? 604 DT  C "O3'" 1 
ATOM   87   C  "C2'" . DT  A 1 5  ? 21.395  9.351   -17.238 1.00 12.12 ? 604 DT  C "C2'" 1 
ATOM   88   C  "C1'" . DT  A 1 5  ? 22.776  9.809   -17.647 1.00 14.50 ? 604 DT  C "C1'" 1 
ATOM   89   N  N1    . DT  A 1 5  ? 23.468  10.712  -16.693 1.00 16.16 ? 604 DT  C N1    1 
ATOM   90   C  C2    . DT  A 1 5  ? 24.698  10.307  -16.221 1.00 14.76 ? 604 DT  C C2    1 
ATOM   91   O  O2    . DT  A 1 5  ? 25.199  9.237   -16.524 1.00 14.60 ? 604 DT  C O2    1 
ATOM   92   N  N3    . DT  A 1 5  ? 25.324  11.200  -15.377 1.00 6.08  ? 604 DT  C N3    1 
ATOM   93   C  C4    . DT  A 1 5  ? 24.854  12.428  -14.977 1.00 11.22 ? 604 DT  C C4    1 
ATOM   94   O  O4    . DT  A 1 5  ? 25.548  13.156  -14.258 1.00 5.52  ? 604 DT  C O4    1 
ATOM   95   C  C5    . DT  A 1 5  ? 23.535  12.772  -15.471 1.00 15.78 ? 604 DT  C C5    1 
ATOM   96   C  C7    . DT  A 1 5  ? 22.922  14.064  -15.027 1.00 12.45 ? 604 DT  C C7    1 
ATOM   97   C  C6    . DT  A 1 5  ? 22.918  11.910  -16.298 1.00 18.33 ? 604 DT  C C6    1 
ATOM   98   P  P     . DA  A 1 6  ? 20.232  6.442   -18.848 1.00 23.67 ? 605 DA  C P     1 
ATOM   99   O  OP1   . DA  A 1 6  ? 19.608  6.216   -20.175 1.00 28.49 ? 605 DA  C OP1   1 
ATOM   100  O  OP2   . DA  A 1 6  ? 19.381  6.632   -17.655 1.00 37.49 ? 605 DA  C OP2   1 
ATOM   101  O  "O5'" . DA  A 1 6  ? 21.202  5.205   -18.572 1.00 32.70 ? 605 DA  C "O5'" 1 
ATOM   102  C  "C5'" . DA  A 1 6  ? 22.302  4.916   -19.438 1.00 23.35 ? 605 DA  C "C5'" 1 
ATOM   103  C  "C4'" . DA  A 1 6  ? 23.285  3.990   -18.757 1.00 13.48 ? 605 DA  C "C4'" 1 
ATOM   104  O  "O4'" . DA  A 1 6  ? 23.947  4.669   -17.673 1.00 16.11 ? 605 DA  C "O4'" 1 
ATOM   105  C  "C3'" . DA  A 1 6  ? 22.690  2.737   -18.144 1.00 18.60 ? 605 DA  C "C3'" 1 
ATOM   106  O  "O3'" . DA  A 1 6  ? 23.677  1.719   -18.230 1.00 18.03 ? 605 DA  C "O3'" 1 
ATOM   107  C  "C2'" . DA  A 1 6  ? 22.390  3.165   -16.715 1.00 16.14 ? 605 DA  C "C2'" 1 
ATOM   108  C  "C1'" . DA  A 1 6  ? 23.469  4.199   -16.414 1.00 21.70 ? 605 DA  C "C1'" 1 
ATOM   109  N  N9    . DA  A 1 6  ? 23.019  5.380   -15.674 1.00 16.71 ? 605 DA  C N9    1 
ATOM   110  C  C8    . DA  A 1 6  ? 21.780  5.966   -15.693 1.00 23.96 ? 605 DA  C C8    1 
ATOM   111  N  N7    . DA  A 1 6  ? 21.715  7.087   -15.000 1.00 28.81 ? 605 DA  C N7    1 
ATOM   112  C  C5    . DA  A 1 6  ? 22.989  7.229   -14.472 1.00 14.10 ? 605 DA  C C5    1 
ATOM   113  C  C6    . DA  A 1 6  ? 23.573  8.204   -13.640 1.00 16.87 ? 605 DA  C C6    1 
ATOM   114  N  N6    . DA  A 1 6  ? 22.947  9.288   -13.181 1.00 12.91 ? 605 DA  C N6    1 
ATOM   115  N  N1    . DA  A 1 6  ? 24.857  8.030   -13.290 1.00 24.17 ? 605 DA  C N1    1 
ATOM   116  C  C2    . DA  A 1 6  ? 25.503  6.952   -13.742 1.00 26.15 ? 605 DA  C C2    1 
ATOM   117  N  N3    . DA  A 1 6  ? 25.067  5.971   -14.516 1.00 25.36 ? 605 DA  C N3    1 
ATOM   118  C  C4    . DA  A 1 6  ? 23.792  6.170   -14.857 1.00 15.81 ? 605 DA  C C4    1 
ATOM   119  P  P     . DG  A 1 7  ? 23.356  0.242   -17.696 1.00 40.97 ? 606 DG  C P     1 
ATOM   120  O  OP1   . DG  A 1 7  ? 23.784  -0.765  -18.690 1.00 30.92 ? 606 DG  C OP1   1 
ATOM   121  O  OP2   . DG  A 1 7  ? 21.952  0.234   -17.221 1.00 36.77 ? 606 DG  C OP2   1 
ATOM   122  O  "O5'" . DG  A 1 7  ? 24.353  0.123   -16.459 1.00 42.17 ? 606 DG  C "O5'" 1 
ATOM   123  C  "C5'" . DG  A 1 7  ? 24.645  1.278   -15.668 1.00 42.14 ? 606 DG  C "C5'" 1 
ATOM   124  C  "C4'" . DG  A 1 7  ? 25.570  0.934   -14.526 1.00 27.09 ? 606 DG  C "C4'" 1 
ATOM   125  O  "O4'" . DG  A 1 7  ? 25.619  2.096   -13.669 1.00 21.45 ? 606 DG  C "O4'" 1 
ATOM   126  C  "C3'" . DG  A 1 7  ? 25.074  -0.214  -13.650 1.00 31.43 ? 606 DG  C "C3'" 1 
ATOM   127  O  "O3'" . DG  A 1 7  ? 26.175  -0.988  -13.150 1.00 40.95 ? 606 DG  C "O3'" 1 
ATOM   128  C  "C2'" . DG  A 1 7  ? 24.293  0.478   -12.550 1.00 23.36 ? 606 DG  C "C2'" 1 
ATOM   129  C  "C1'" . DG  A 1 7  ? 24.964  1.836   -12.422 1.00 28.45 ? 606 DG  C "C1'" 1 
ATOM   130  N  N9    . DG  A 1 7  ? 24.017  2.925   -12.179 1.00 28.86 ? 606 DG  C N9    1 
ATOM   131  C  C8    . DG  A 1 7  ? 22.707  2.987   -12.597 1.00 21.53 ? 606 DG  C C8    1 
ATOM   132  N  N7    . DG  A 1 7  ? 22.128  4.127   -12.304 1.00 19.81 ? 606 DG  C N7    1 
ATOM   133  C  C5    . DG  A 1 7  ? 23.106  4.855   -11.639 1.00 8.23  ? 606 DG  C C5    1 
ATOM   134  C  C6    . DG  A 1 7  ? 23.073  6.165   -11.120 1.00 18.90 ? 606 DG  C C6    1 
ATOM   135  O  O6    . DG  A 1 7  ? 22.155  6.997   -11.173 1.00 33.94 ? 606 DG  C O6    1 
ATOM   136  N  N1    . DG  A 1 7  ? 24.275  6.500   -10.503 1.00 29.55 ? 606 DG  C N1    1 
ATOM   137  C  C2    . DG  A 1 7  ? 25.377  5.685   -10.420 1.00 29.12 ? 606 DG  C C2    1 
ATOM   138  N  N2    . DG  A 1 7  ? 26.450  6.198   -9.783  1.00 27.15 ? 606 DG  C N2    1 
ATOM   139  N  N3    . DG  A 1 7  ? 25.427  4.463   -10.925 1.00 21.56 ? 606 DG  C N3    1 
ATOM   140  C  C4    . DG  A 1 7  ? 24.269  4.116   -11.519 1.00 23.00 ? 606 DG  C C4    1 
ATOM   141  P  P     . DG  A 1 8  ? 25.918  -2.136  -12.050 1.00 35.26 ? 607 DG  C P     1 
ATOM   142  O  OP1   . DG  A 1 8  ? 26.842  -3.253  -12.312 1.00 33.48 ? 607 DG  C OP1   1 
ATOM   143  O  OP2   . DG  A 1 8  ? 24.468  -2.422  -12.008 1.00 42.29 ? 607 DG  C OP2   1 
ATOM   144  O  "O5'" . DG  A 1 8  ? 26.377  -1.377  -10.731 1.00 28.43 ? 607 DG  C "O5'" 1 
ATOM   145  C  "C5'" . DG  A 1 8  ? 27.578  -0.618  -10.757 1.00 35.49 ? 607 DG  C "C5'" 1 
ATOM   146  C  "C4'" . DG  A 1 8  ? 27.867  -0.005  -9.407  1.00 33.24 ? 607 DG  C "C4'" 1 
ATOM   147  O  "O4'" . DG  A 1 8  ? 27.083  1.188   -9.203  1.00 39.96 ? 607 DG  C "O4'" 1 
ATOM   148  C  "C3'" . DG  A 1 8  ? 27.626  -0.891  -8.189  1.00 36.39 ? 607 DG  C "C3'" 1 
ATOM   149  O  "O3'" . DG  A 1 8  ? 28.656  -0.624  -7.238  1.00 26.89 ? 607 DG  C "O3'" 1 
ATOM   150  C  "C2'" . DG  A 1 8  ? 26.281  -0.412  -7.676  1.00 34.89 ? 607 DG  C "C2'" 1 
ATOM   151  C  "C1'" . DG  A 1 8  ? 26.293  1.071   -8.027  1.00 29.44 ? 607 DG  C "C1'" 1 
ATOM   152  N  N9    . DG  A 1 8  ? 24.976  1.595   -8.360  1.00 26.58 ? 607 DG  C N9    1 
ATOM   153  C  C8    . DG  A 1 8  ? 24.023  0.971   -9.127  1.00 20.18 ? 607 DG  C C8    1 
ATOM   154  N  N7    . DG  A 1 8  ? 22.955  1.696   -9.300  1.00 25.57 ? 607 DG  C N7    1 
ATOM   155  C  C5    . DG  A 1 8  ? 23.208  2.856   -8.584  1.00 20.73 ? 607 DG  C C5    1 
ATOM   156  C  C6    . DG  A 1 8  ? 22.390  3.996   -8.371  1.00 23.89 ? 607 DG  C C6    1 
ATOM   157  O  O6    . DG  A 1 8  ? 21.236  4.195   -8.770  1.00 42.56 ? 607 DG  C O6    1 
ATOM   158  N  N1    . DG  A 1 8  ? 23.039  4.957   -7.593  1.00 25.67 ? 607 DG  C N1    1 
ATOM   159  C  C2    . DG  A 1 8  ? 24.313  4.809   -7.067  1.00 25.49 ? 607 DG  C C2    1 
ATOM   160  N  N2    . DG  A 1 8  ? 24.799  5.842   -6.364  1.00 26.33 ? 607 DG  C N2    1 
ATOM   161  N  N3    . DG  A 1 8  ? 25.058  3.726   -7.229  1.00 9.91  ? 607 DG  C N3    1 
ATOM   162  C  C4    . DG  A 1 8  ? 24.454  2.805   -7.997  1.00 13.97 ? 607 DG  C C4    1 
ATOM   163  P  P     . DT  A 1 9  ? 28.668  -1.389  -5.834  1.00 30.18 ? 608 DT  C P     1 
ATOM   164  O  OP1   . DT  A 1 9  ? 30.085  -1.527  -5.444  1.00 35.08 ? 608 DT  C OP1   1 
ATOM   165  O  OP2   . DT  A 1 9  ? 27.811  -2.590  -5.904  1.00 23.75 ? 608 DT  C OP2   1 
ATOM   166  O  "O5'" . DT  A 1 9  ? 28.068  -0.277  -4.880  1.00 19.92 ? 608 DT  C "O5'" 1 
ATOM   167  C  "C5'" . DT  A 1 9  ? 28.624  1.018   -4.947  1.00 28.50 ? 608 DT  C "C5'" 1 
ATOM   168  C  "C4'" . DT  A 1 9  ? 28.028  1.901   -3.884  1.00 27.52 ? 608 DT  C "C4'" 1 
ATOM   169  O  "O4'" . DT  A 1 9  ? 26.763  2.450   -4.309  1.00 28.74 ? 608 DT  C "O4'" 1 
ATOM   170  C  "C3'" . DT  A 1 9  ? 27.757  1.172   -2.580  1.00 27.35 ? 608 DT  C "C3'" 1 
ATOM   171  O  "O3'" . DT  A 1 9  ? 27.987  2.092   -1.518  1.00 31.15 ? 608 DT  C "O3'" 1 
ATOM   172  C  "C2'" . DT  A 1 9  ? 26.279  0.861   -2.685  1.00 34.70 ? 608 DT  C "C2'" 1 
ATOM   173  C  "C1'" . DT  A 1 9  ? 25.775  2.132   -3.344  1.00 34.87 ? 608 DT  C "C1'" 1 
ATOM   174  N  N1    . DT  A 1 9  ? 24.485  2.022   -4.051  1.00 25.81 ? 608 DT  C N1    1 
ATOM   175  C  C2    . DT  A 1 9  ? 23.626  3.099   -4.014  1.00 12.71 ? 608 DT  C C2    1 
ATOM   176  O  O2    . DT  A 1 9  ? 23.853  4.132   -3.362  1.00 13.57 ? 608 DT  C O2    1 
ATOM   177  N  N3    . DT  A 1 9  ? 22.497  2.932   -4.772  1.00 21.18 ? 608 DT  C N3    1 
ATOM   178  C  C4    . DT  A 1 9  ? 22.154  1.826   -5.542  1.00 22.18 ? 608 DT  C C4    1 
ATOM   179  O  O4    . DT  A 1 9  ? 21.124  1.837   -6.210  1.00 28.37 ? 608 DT  C O4    1 
ATOM   180  C  C5    . DT  A 1 9  ? 23.081  0.732   -5.495  1.00 8.05  ? 608 DT  C C5    1 
ATOM   181  C  C7    . DT  A 1 9  ? 22.783  -0.511  -6.272  1.00 16.10 ? 608 DT  C C7    1 
ATOM   182  C  C6    . DT  A 1 9  ? 24.180  0.877   -4.758  1.00 21.63 ? 608 DT  C C6    1 
ATOM   183  P  P     . DC  A 1 10 ? 28.300  1.537   -0.057  1.00 28.23 ? 609 DC  C P     1 
ATOM   184  O  OP1   . DC  A 1 10 ? 29.403  2.358   0.508   1.00 33.86 ? 609 DC  C OP1   1 
ATOM   185  O  OP2   . DC  A 1 10 ? 28.433  0.061   -0.162  1.00 14.19 ? 609 DC  C OP2   1 
ATOM   186  O  "O5'" . DC  A 1 10 ? 26.960  1.847   0.735   1.00 23.11 ? 609 DC  C "O5'" 1 
ATOM   187  C  "C5'" . DC  A 1 10 ? 26.461  3.172   0.827   1.00 30.20 ? 609 DC  C "C5'" 1 
ATOM   188  C  "C4'" . DC  A 1 10 ? 25.041  3.139   1.343   1.00 27.98 ? 609 DC  C "C4'" 1 
ATOM   189  O  "O4'" . DC  A 1 10 ? 24.135  2.759   0.277   1.00 27.36 ? 609 DC  C "O4'" 1 
ATOM   190  C  "C3'" . DC  A 1 10 ? 24.817  2.111   2.457   1.00 14.11 ? 609 DC  C "C3'" 1 
ATOM   191  O  "O3'" . DC  A 1 10 ? 23.885  2.654   3.363   1.00 20.20 ? 609 DC  C "O3'" 1 
ATOM   192  C  "C2'" . DC  A 1 10 ? 24.194  0.933   1.734   1.00 10.94 ? 609 DC  C "C2'" 1 
ATOM   193  C  "C1'" . DC  A 1 10 ? 23.335  1.691   0.751   1.00 18.28 ? 609 DC  C "C1'" 1 
ATOM   194  N  N1    . DC  A 1 10 ? 22.777  0.969   -0.394  1.00 7.78  ? 609 DC  C N1    1 
ATOM   195  C  C2    . DC  A 1 10 ? 21.799  1.614   -1.130  1.00 3.52  ? 609 DC  C C2    1 
ATOM   196  O  O2    . DC  A 1 10 ? 21.504  2.789   -0.827  1.00 9.99  ? 609 DC  C O2    1 
ATOM   197  N  N3    . DC  A 1 10 ? 21.192  0.968   -2.135  1.00 2.00  ? 609 DC  C N3    1 
ATOM   198  C  C4    . DC  A 1 10 ? 21.514  -0.289  -2.404  1.00 6.29  ? 609 DC  C C4    1 
ATOM   199  N  N4    . DC  A 1 10 ? 20.839  -0.895  -3.374  1.00 2.08  ? 609 DC  C N4    1 
ATOM   200  C  C5    . DC  A 1 10 ? 22.542  -0.978  -1.686  1.00 6.92  ? 609 DC  C C5    1 
ATOM   201  C  C6    . DC  A 1 10 ? 23.158  -0.306  -0.707  1.00 2.00  ? 609 DC  C C6    1 
ATOM   202  P  P     . DA  A 1 11 ? 24.414  3.414   4.658   1.00 34.03 ? 610 DA  C P     1 
ATOM   203  O  OP1   . DA  A 1 11 ? 25.533  4.293   4.217   1.00 25.27 ? 610 DA  C OP1   1 
ATOM   204  O  OP2   . DA  A 1 11 ? 24.646  2.345   5.660   1.00 17.67 ? 610 DA  C OP2   1 
ATOM   205  O  "O5'" . DA  A 1 11 ? 23.206  4.358   5.077   1.00 31.71 ? 610 DA  C "O5'" 1 
ATOM   206  C  "C5'" . DA  A 1 11 ? 23.101  5.691   4.557   1.00 32.27 ? 610 DA  C "C5'" 1 
ATOM   207  C  "C4'" . DA  A 1 11 ? 21.652  6.043   4.296   1.00 24.01 ? 610 DA  C "C4'" 1 
ATOM   208  O  "O4'" . DA  A 1 11 ? 21.134  5.159   3.272   1.00 20.43 ? 610 DA  C "O4'" 1 
ATOM   209  C  "C3'" . DA  A 1 11 ? 20.710  5.880   5.490   1.00 15.94 ? 610 DA  C "C3'" 1 
ATOM   210  O  "O3'" . DA  A 1 11 ? 19.634  6.812   5.325   1.00 23.87 ? 610 DA  C "O3'" 1 
ATOM   211  C  "C2'" . DA  A 1 11 ? 20.245  4.452   5.317   1.00 9.17  ? 610 DA  C "C2'" 1 
ATOM   212  C  "C1'" . DA  A 1 11 ? 20.104  4.359   3.805   1.00 12.70 ? 610 DA  C "C1'" 1 
ATOM   213  N  N9    . DA  A 1 11 ? 20.248  3.009   3.257   1.00 6.50  ? 610 DA  C N9    1 
ATOM   214  C  C8    . DA  A 1 11 ? 21.048  1.978   3.692   1.00 6.80  ? 610 DA  C C8    1 
ATOM   215  N  N7    . DA  A 1 11 ? 20.899  0.859   3.000   1.00 3.50  ? 610 DA  C N7    1 
ATOM   216  C  C5    . DA  A 1 11 ? 19.943  1.194   2.042   1.00 2.00  ? 610 DA  C C5    1 
ATOM   217  C  C6    . DA  A 1 11 ? 19.327  0.453   1.034   1.00 2.00  ? 610 DA  C C6    1 
ATOM   218  N  N6    . DA  A 1 11 ? 19.557  -0.840  0.818   1.00 13.31 ? 610 DA  C N6    1 
ATOM   219  N  N1    . DA  A 1 11 ? 18.428  1.073   0.257   1.00 8.28  ? 610 DA  C N1    1 
ATOM   220  C  C2    . DA  A 1 11 ? 18.147  2.353   0.508   1.00 5.14  ? 610 DA  C C2    1 
ATOM   221  N  N3    . DA  A 1 11 ? 18.635  3.153   1.448   1.00 14.83 ? 610 DA  C N3    1 
ATOM   222  C  C4    . DA  A 1 11 ? 19.543  2.508   2.186   1.00 4.25  ? 610 DA  C C4    1 
ATOM   223  P  P     . DC  A 1 12 ? 18.512  7.013   6.478   1.00 21.61 ? 611 DC  C P     1 
ATOM   224  O  OP1   . DC  A 1 12 ? 18.224  8.472   6.602   1.00 3.22  ? 611 DC  C OP1   1 
ATOM   225  O  OP2   . DC  A 1 12 ? 18.807  6.194   7.681   1.00 18.91 ? 611 DC  C OP2   1 
ATOM   226  O  "O5'" . DC  A 1 12 ? 17.210  6.364   5.859   1.00 16.20 ? 611 DC  C "O5'" 1 
ATOM   227  C  "C5'" . DC  A 1 12 ? 17.035  4.974   5.970   1.00 20.55 ? 611 DC  C "C5'" 1 
ATOM   228  C  "C4'" . DC  A 1 12 ? 15.805  4.553   5.223   1.00 20.22 ? 611 DC  C "C4'" 1 
ATOM   229  O  "O4'" . DC  A 1 12 ? 16.257  3.621   4.222   1.00 15.04 ? 611 DC  C "O4'" 1 
ATOM   230  C  "C3'" . DC  A 1 12 ? 14.826  3.801   6.127   1.00 30.42 ? 611 DC  C "C3'" 1 
ATOM   231  O  "O3'" . DC  A 1 12 ? 13.466  4.227   5.996   1.00 29.51 ? 611 DC  C "O3'" 1 
ATOM   232  C  "C2'" . DC  A 1 12 ? 14.965  2.359   5.695   1.00 34.57 ? 611 DC  C "C2'" 1 
ATOM   233  C  "C1'" . DC  A 1 12 ? 15.505  2.442   4.284   1.00 23.65 ? 611 DC  C "C1'" 1 
ATOM   234  N  N1    . DC  A 1 12 ? 16.393  1.314   3.995   1.00 28.15 ? 611 DC  C N1    1 
ATOM   235  C  C2    . DC  A 1 12 ? 16.128  0.545   2.886   1.00 32.47 ? 611 DC  C C2    1 
ATOM   236  O  O2    . DC  A 1 12 ? 15.284  0.951   2.078   1.00 38.18 ? 611 DC  C O2    1 
ATOM   237  N  N3    . DC  A 1 12 ? 16.811  -0.613  2.702   1.00 32.01 ? 611 DC  C N3    1 
ATOM   238  C  C4    . DC  A 1 12 ? 17.767  -0.965  3.559   1.00 23.48 ? 611 DC  C C4    1 
ATOM   239  N  N4    . DC  A 1 12 ? 18.407  -2.121  3.342   1.00 16.75 ? 611 DC  C N4    1 
ATOM   240  C  C5    . DC  A 1 12 ? 18.112  -0.148  4.664   1.00 16.42 ? 611 DC  C C5    1 
ATOM   241  C  C6    . DC  A 1 12 ? 17.418  0.981   4.837   1.00 17.90 ? 611 DC  C C6    1 
HETATM 242  N  N1    . 5IU A 1 13 ? 12.225  -0.615  4.849   1.00 29.37 ? 612 5IU C N1    1 
HETATM 243  C  C2    . 5IU A 1 13 ? 12.460  -1.721  4.095   1.00 32.63 ? 612 5IU C C2    1 
HETATM 244  N  N3    . 5IU A 1 13 ? 13.609  -2.405  4.407   1.00 33.57 ? 612 5IU C N3    1 
HETATM 245  C  C4    . 5IU A 1 13 ? 14.548  -2.091  5.363   1.00 27.68 ? 612 5IU C C4    1 
HETATM 246  C  C5    . 5IU A 1 13 ? 14.308  -0.890  6.107   1.00 37.49 ? 612 5IU C C5    1 
HETATM 247  C  C6    . 5IU A 1 13 ? 13.150  -0.201  5.824   1.00 38.50 ? 612 5IU C C6    1 
HETATM 248  O  O2    . 5IU A 1 13 ? 11.705  -2.070  3.204   1.00 33.64 ? 612 5IU C O2    1 
HETATM 249  O  O4    . 5IU A 1 13 ? 15.503  -2.822  5.526   1.00 55.06 ? 612 5IU C O4    1 
HETATM 250  I  I5    . 5IU A 1 13 ? 15.283  -0.501  7.003   1.00 41.13 ? 612 5IU C I5    1 
HETATM 251  C  "C1'" . 5IU A 1 13 ? 10.908  0.039   4.522   1.00 27.82 ? 612 5IU C "C1'" 1 
HETATM 252  C  "C2'" . 5IU A 1 13 ? 9.956   0.387   5.660   1.00 21.52 ? 612 5IU C "C2'" 1 
HETATM 253  C  "C3'" . 5IU A 1 13 ? 9.155   1.535   5.069   1.00 19.28 ? 612 5IU C "C3'" 1 
HETATM 254  C  "C4'" . 5IU A 1 13 ? 10.180  2.242   4.192   1.00 18.07 ? 612 5IU C "C4'" 1 
HETATM 255  O  "O3'" . 5IU A 1 13 ? 8.085   1.049   4.255   1.00 30.98 ? 612 5IU C "O3'" 1 
HETATM 256  O  "O4'" . 5IU A 1 13 ? 11.159  1.241   3.844   1.00 17.94 ? 612 5IU C "O4'" 1 
HETATM 257  C  "C5'" . 5IU A 1 13 ? 10.905  3.342   4.916   1.00 6.64  ? 612 5IU C "C5'" 1 
HETATM 258  O  "O5'" . 5IU A 1 13 ? 11.348  2.856   6.171   1.00 6.42  ? 612 5IU C "O5'" 1 
HETATM 259  P  P     . 5IU A 1 13 ? 12.360  3.697   7.050   1.00 24.90 ? 612 5IU C P     1 
HETATM 260  O  OP1   . 5IU A 1 13 ? 11.743  4.929   7.590   1.00 2.68  ? 612 5IU C OP1   1 
HETATM 261  O  OP2   . 5IU A 1 13 ? 12.923  2.663   7.952   1.00 10.62 ? 612 5IU C OP2   1 
ATOM   262  P  P     . DA  A 1 14 ? 6.647   0.723   4.920   1.00 18.06 ? 613 DA  C P     1 
ATOM   263  O  OP1   . DA  A 1 14 ? 5.873   1.991   4.768   1.00 10.24 ? 613 DA  C OP1   1 
ATOM   264  O  OP2   . DA  A 1 14 ? 6.841   0.133   6.264   1.00 23.94 ? 613 DA  C OP2   1 
ATOM   265  O  "O5'" . DA  A 1 14 ? 6.101   -0.442  3.992   1.00 2.00  ? 613 DA  C "O5'" 1 
ATOM   266  C  "C5'" . DA  A 1 14 ? 5.768   -0.156  2.637   1.00 17.12 ? 613 DA  C "C5'" 1 
ATOM   267  C  "C4'" . DA  A 1 14 ? 5.504   -1.438  1.890   1.00 11.19 ? 613 DA  C "C4'" 1 
ATOM   268  O  "O4'" . DA  A 1 14 ? 6.706   -2.228  1.970   1.00 19.67 ? 613 DA  C "O4'" 1 
ATOM   269  C  "C3'" . DA  A 1 14 ? 4.402   -2.313  2.469   1.00 20.93 ? 613 DA  C "C3'" 1 
ATOM   270  O  "O3'" . DA  A 1 14 ? 3.803   -3.065  1.396   1.00 31.87 ? 613 DA  C "O3'" 1 
ATOM   271  C  "C2'" . DA  A 1 14 ? 5.170   -3.201  3.430   1.00 27.01 ? 613 DA  C "C2'" 1 
ATOM   272  C  "C1'" . DA  A 1 14 ? 6.500   -3.395  2.724   1.00 23.31 ? 613 DA  C "C1'" 1 
ATOM   273  N  N9    . DA  A 1 14 ? 7.651   -3.519  3.615   1.00 32.04 ? 613 DA  C N9    1 
ATOM   274  C  C8    . DA  A 1 14 ? 8.019   -2.650  4.609   1.00 32.43 ? 613 DA  C C8    1 
ATOM   275  N  N7    . DA  A 1 14 ? 9.114   -3.004  5.241   1.00 34.50 ? 613 DA  C N7    1 
ATOM   276  C  C5    . DA  A 1 14 ? 9.487   -4.189  4.623   1.00 20.94 ? 613 DA  C C5    1 
ATOM   277  C  C6    . DA  A 1 14 ? 10.555  -5.059  4.841   1.00 32.63 ? 613 DA  C C6    1 
ATOM   278  N  N6    . DA  A 1 14 ? 11.481  -4.861  5.789   1.00 26.58 ? 613 DA  C N6    1 
ATOM   279  N  N1    . DA  A 1 14 ? 10.646  -6.157  4.052   1.00 32.74 ? 613 DA  C N1    1 
ATOM   280  C  C2    . DA  A 1 14 ? 9.714   -6.347  3.111   1.00 21.88 ? 613 DA  C C2    1 
ATOM   281  N  N3    . DA  A 1 14 ? 8.660   -5.593  2.811   1.00 23.17 ? 613 DA  C N3    1 
ATOM   282  C  C4    . DA  A 1 14 ? 8.601   -4.519  3.618   1.00 25.46 ? 613 DA  C C4    1 
ATOM   283  P  P     . DG  A 1 15 ? 2.462   -3.913  1.648   1.00 31.94 ? 614 DG  C P     1 
ATOM   284  O  OP1   . DG  A 1 15 ? 1.594   -3.862  0.453   1.00 46.04 ? 614 DG  C OP1   1 
ATOM   285  O  OP2   . DG  A 1 15 ? 1.935   -3.474  2.958   1.00 44.53 ? 614 DG  C OP2   1 
ATOM   286  O  "O5'" . DG  A 1 15 ? 2.987   -5.401  1.751   1.00 28.86 ? 614 DG  C "O5'" 1 
ATOM   287  C  "C5'" . DG  A 1 15 ? 4.233   -5.647  2.362   1.00 32.96 ? 614 DG  C "C5'" 1 
ATOM   288  C  "C4'" . DG  A 1 15 ? 4.660   -7.075  2.151   1.00 36.18 ? 614 DG  C "C4'" 1 
ATOM   289  O  "O4'" . DG  A 1 15 ? 5.949   -7.184  2.786   1.00 34.68 ? 614 DG  C "O4'" 1 
ATOM   290  C  "C3'" . DG  A 1 15 ? 3.774   -8.114  2.833   1.00 31.46 ? 614 DG  C "C3'" 1 
ATOM   291  O  "O3'" . DG  A 1 15 ? 3.869   -9.345  2.125   1.00 37.11 ? 614 DG  C "O3'" 1 
ATOM   292  C  "C2'" . DG  A 1 15 ? 4.380   -8.226  4.216   1.00 28.06 ? 614 DG  C "C2'" 1 
ATOM   293  C  "C1'" . DG  A 1 15 ? 5.855   -7.959  3.964   1.00 33.75 ? 614 DG  C "C1'" 1 
ATOM   294  N  N9    . DG  A 1 15 ? 6.539   -7.225  5.022   1.00 18.54 ? 614 DG  C N9    1 
ATOM   295  C  C8    . DG  A 1 15 ? 6.134   -6.082  5.651   1.00 10.18 ? 614 DG  C C8    1 
ATOM   296  N  N7    . DG  A 1 15 ? 6.989   -5.657  6.535   1.00 13.69 ? 614 DG  C N7    1 
ATOM   297  C  C5    . DG  A 1 15 ? 8.015   -6.592  6.485   1.00 18.66 ? 614 DG  C C5    1 
ATOM   298  C  C6    . DG  A 1 15 ? 9.223   -6.670  7.210   1.00 20.16 ? 614 DG  C C6    1 
ATOM   299  O  O6    . DG  A 1 15 ? 9.637   -5.908  8.093   1.00 35.89 ? 614 DG  C O6    1 
ATOM   300  N  N1    . DG  A 1 15 ? 9.976   -7.776  6.837   1.00 20.79 ? 614 DG  C N1    1 
ATOM   301  C  C2    . DG  A 1 15 ? 9.594   -8.708  5.904   1.00 24.95 ? 614 DG  C C2    1 
ATOM   302  N  N2    . DG  A 1 15 ? 10.412  -9.750  5.704   1.00 25.29 ? 614 DG  C N2    1 
ATOM   303  N  N3    . DG  A 1 15 ? 8.476   -8.638  5.219   1.00 30.47 ? 614 DG  C N3    1 
ATOM   304  C  C4    . DG  A 1 15 ? 7.742   -7.562  5.560   1.00 22.32 ? 614 DG  C C4    1 
ATOM   305  P  P     . DG  A 1 16 ? 3.244   -10.670 2.751   1.00 36.51 ? 615 DG  C P     1 
ATOM   306  O  OP1   . DG  A 1 16 ? 2.632   -11.483 1.676   1.00 30.77 ? 615 DG  C OP1   1 
ATOM   307  O  OP2   . DG  A 1 16 ? 2.437   -10.275 3.932   1.00 51.07 ? 615 DG  C OP2   1 
ATOM   308  O  "O5'" . DG  A 1 16 ? 4.513   -11.484 3.256   1.00 44.04 ? 615 DG  C "O5'" 1 
ATOM   309  C  "C5'" . DG  A 1 16 ? 5.237   -12.317 2.359   1.00 33.09 ? 615 DG  C "C5'" 1 
ATOM   310  C  "C4'" . DG  A 1 16 ? 6.157   -13.238 3.125   1.00 31.58 ? 615 DG  C "C4'" 1 
ATOM   311  O  "O4'" . DG  A 1 16 ? 6.853   -12.453 4.115   1.00 33.03 ? 615 DG  C "O4'" 1 
ATOM   312  C  "C3'" . DG  A 1 16 ? 5.507   -14.379 3.898   1.00 33.78 ? 615 DG  C "C3'" 1 
ATOM   313  O  "O3'" . DG  A 1 16 ? 6.416   -15.483 3.863   1.00 44.81 ? 615 DG  C "O3'" 1 
ATOM   314  C  "C2'" . DG  A 1 16 ? 5.379   -13.812 5.305   1.00 35.77 ? 615 DG  C "C2'" 1 
ATOM   315  C  "C1'" . DG  A 1 16 ? 6.629   -12.963 5.415   1.00 23.85 ? 615 DG  C "C1'" 1 
ATOM   316  N  N9    . DG  A 1 16 ? 6.587   -11.813 6.313   1.00 18.58 ? 615 DG  C N9    1 
ATOM   317  C  C8    . DG  A 1 16 ? 5.713   -10.761 6.253   1.00 27.07 ? 615 DG  C C8    1 
ATOM   318  N  N7    . DG  A 1 16 ? 5.986   -9.820  7.117   1.00 20.76 ? 615 DG  C N7    1 
ATOM   319  C  C5    . DG  A 1 16 ? 7.091   -10.294 7.804   1.00 5.50  ? 615 DG  C C5    1 
ATOM   320  C  C6    . DG  A 1 16 ? 7.833   -9.707  8.850   1.00 14.95 ? 615 DG  C C6    1 
ATOM   321  O  O6    . DG  A 1 16 ? 7.667   -8.605  9.390   1.00 19.74 ? 615 DG  C O6    1 
ATOM   322  N  N1    . DG  A 1 16 ? 8.870   -10.530 9.266   1.00 19.96 ? 615 DG  C N1    1 
ATOM   323  C  C2    . DG  A 1 16 ? 9.160   -11.761 8.730   1.00 30.24 ? 615 DG  C C2    1 
ATOM   324  N  N2    . DG  A 1 16 ? 10.210  -12.414 9.255   1.00 41.47 ? 615 DG  C N2    1 
ATOM   325  N  N3    . DG  A 1 16 ? 8.474   -12.314 7.750   1.00 29.62 ? 615 DG  C N3    1 
ATOM   326  C  C4    . DG  A 1 16 ? 7.460   -11.532 7.337   1.00 15.05 ? 615 DG  C C4    1 
ATOM   327  P  P     . DT  A 1 17 ? 5.891   -16.967 4.169   1.00 49.91 ? 616 DT  C P     1 
ATOM   328  O  OP1   . DT  A 1 17 ? 6.565   -17.915 3.245   1.00 50.40 ? 616 DT  C OP1   1 
ATOM   329  O  OP2   . DT  A 1 17 ? 4.407   -16.924 4.237   1.00 49.21 ? 616 DT  C OP2   1 
ATOM   330  O  "O5'" . DT  A 1 17 ? 6.464   -17.238 5.619   1.00 47.05 ? 616 DT  C "O5'" 1 
ATOM   331  C  "C5'" . DT  A 1 17 ? 6.891   -16.150 6.417   1.00 44.19 ? 616 DT  C "C5'" 1 
ATOM   332  C  "C4'" . DT  A 1 17 ? 7.954   -16.603 7.380   1.00 40.86 ? 616 DT  C "C4'" 1 
ATOM   333  O  "O4'" . DT  A 1 17 ? 8.264   -15.489 8.243   1.00 40.99 ? 616 DT  C "O4'" 1 
ATOM   334  C  "C3'" . DT  A 1 17 ? 7.477   -17.724 8.291   1.00 38.70 ? 616 DT  C "C3'" 1 
ATOM   335  O  "O3'" . DT  A 1 17 ? 8.587   -18.566 8.598   1.00 43.08 ? 616 DT  C "O3'" 1 
ATOM   336  C  "C2'" . DT  A 1 17 ? 6.930   -16.978 9.494   1.00 38.84 ? 616 DT  C "C2'" 1 
ATOM   337  C  "C1'" . DT  A 1 17 ? 7.780   -15.715 9.551   1.00 34.28 ? 616 DT  C "C1'" 1 
ATOM   338  N  N1    . DT  A 1 17 ? 7.087   -14.483 9.975   1.00 34.87 ? 616 DT  C N1    1 
ATOM   339  C  C2    . DT  A 1 17 ? 7.692   -13.738 10.950  1.00 41.18 ? 616 DT  C C2    1 
ATOM   340  O  O2    . DT  A 1 17 ? 8.718   -14.083 11.499  1.00 48.10 ? 616 DT  C O2    1 
ATOM   341  N  N3    . DT  A 1 17 ? 7.047   -12.565 11.264  1.00 39.07 ? 616 DT  C N3    1 
ATOM   342  C  C4    . DT  A 1 17 ? 5.879   -12.083 10.711  1.00 32.44 ? 616 DT  C C4    1 
ATOM   343  O  O4    . DT  A 1 17 ? 5.437   -10.994 11.064  1.00 23.31 ? 616 DT  C O4    1 
ATOM   344  C  C5    . DT  A 1 17 ? 5.273   -12.933 9.724   1.00 29.59 ? 616 DT  C C5    1 
ATOM   345  C  C7    . DT  A 1 17 ? 3.983   -12.503 9.107   1.00 44.11 ? 616 DT  C C7    1 
ATOM   346  C  C6    . DT  A 1 17 ? 5.898   -14.078 9.403   1.00 34.14 ? 616 DT  C C6    1 
ATOM   347  P  P     . DC  A 1 18 ? 8.346   -20.107 8.967   1.00 39.09 ? 617 DC  C P     1 
ATOM   348  O  OP1   . DC  A 1 18 ? 9.529   -20.867 8.506   1.00 46.93 ? 617 DC  C OP1   1 
ATOM   349  O  OP2   . DC  A 1 18 ? 7.007   -20.535 8.530   1.00 37.32 ? 617 DC  C OP2   1 
ATOM   350  O  "O5'" . DC  A 1 18 ? 8.396   -20.057 10.550  1.00 40.80 ? 617 DC  C "O5'" 1 
ATOM   351  C  "C5'" . DC  A 1 18 ? 9.144   -19.033 11.206  1.00 38.70 ? 617 DC  C "C5'" 1 
ATOM   352  C  "C4'" . DC  A 1 18 ? 8.746   -18.946 12.661  1.00 41.64 ? 617 DC  C "C4'" 1 
ATOM   353  O  "O4'" . DC  A 1 18 ? 7.910   -17.783 12.873  1.00 38.72 ? 617 DC  C "O4'" 1 
ATOM   354  C  "C3'" . DC  A 1 18 ? 7.934   -20.136 13.178  1.00 37.48 ? 617 DC  C "C3'" 1 
ATOM   355  O  "O3'" . DC  A 1 18 ? 8.198   -20.265 14.576  1.00 43.15 ? 617 DC  C "O3'" 1 
ATOM   356  C  "C2'" . DC  A 1 18 ? 6.506   -19.659 12.994  1.00 29.18 ? 617 DC  C "C2'" 1 
ATOM   357  C  "C1'" . DC  A 1 18 ? 6.650   -18.197 13.390  1.00 28.98 ? 617 DC  C "C1'" 1 
ATOM   358  N  N1    . DC  A 1 18 ? 5.630   -17.275 12.869  1.00 18.95 ? 617 DC  C N1    1 
ATOM   359  C  C2    . DC  A 1 18 ? 5.633   -15.972 13.344  1.00 17.11 ? 617 DC  C C2    1 
ATOM   360  O  O2    . DC  A 1 18 ? 6.517   -15.635 14.164  1.00 17.17 ? 617 DC  C O2    1 
ATOM   361  N  N3    . DC  A 1 18 ? 4.706   -15.104 12.899  1.00 15.71 ? 617 DC  C N3    1 
ATOM   362  C  C4    . DC  A 1 18 ? 3.817   -15.490 11.980  1.00 25.72 ? 617 DC  C C4    1 
ATOM   363  N  N4    . DC  A 1 18 ? 2.942   -14.578 11.537  1.00 20.78 ? 617 DC  C N4    1 
ATOM   364  C  C5    . DC  A 1 18 ? 3.792   -16.817 11.469  1.00 18.57 ? 617 DC  C C5    1 
ATOM   365  C  C6    . DC  A 1 18 ? 4.708   -17.674 11.942  1.00 15.46 ? 617 DC  C C6    1 
ATOM   366  P  P     . DA  A 1 19 ? 8.454   -21.709 15.228  1.00 45.90 ? 618 DA  C P     1 
ATOM   367  O  OP1   . DA  A 1 19 ? 9.630   -22.328 14.554  1.00 39.82 ? 618 DA  C OP1   1 
ATOM   368  O  OP2   . DA  A 1 19 ? 7.165   -22.457 15.273  1.00 35.29 ? 618 DA  C OP2   1 
ATOM   369  O  "O5'" . DA  A 1 19 ? 8.907   -21.291 16.691  1.00 34.20 ? 618 DA  C "O5'" 1 
ATOM   370  C  "C5'" . DA  A 1 19 ? 9.989   -20.383 16.856  1.00 28.40 ? 618 DA  C "C5'" 1 
ATOM   371  C  "C4'" . DA  A 1 19 ? 9.630   -19.312 17.860  1.00 38.49 ? 618 DA  C "C4'" 1 
ATOM   372  O  "O4'" . DA  A 1 19 ? 8.559   -18.472 17.364  1.00 38.77 ? 618 DA  C "O4'" 1 
ATOM   373  C  "C3'" . DA  A 1 19 ? 9.148   -19.835 19.208  1.00 42.38 ? 618 DA  C "C3'" 1 
ATOM   374  O  "O3'" . DA  A 1 19 ? 9.601   -18.941 20.230  1.00 48.88 ? 618 DA  C "O3'" 1 
ATOM   375  C  "C2'" . DA  A 1 19 ? 7.637   -19.774 19.080  1.00 40.30 ? 618 DA  C "C2'" 1 
ATOM   376  C  "C1'" . DA  A 1 19 ? 7.448   -18.507 18.263  1.00 34.73 ? 618 DA  C "C1'" 1 
ATOM   377  N  N9    . DA  A 1 19 ? 6.228   -18.467 17.454  1.00 11.31 ? 618 DA  C N9    1 
ATOM   378  C  C8    . DA  A 1 19 ? 5.638   -19.496 16.758  1.00 12.18 ? 618 DA  C C8    1 
ATOM   379  N  N7    . DA  A 1 19 ? 4.584   -19.134 16.072  1.00 16.08 ? 618 DA  C N7    1 
ATOM   380  C  C5    . DA  A 1 19 ? 4.467   -17.775 16.344  1.00 17.77 ? 618 DA  C C5    1 
ATOM   381  C  C6    . DA  A 1 19 ? 3.525   -16.802 15.934  1.00 23.85 ? 618 DA  C C6    1 
ATOM   382  N  N6    . DA  A 1 19 ? 2.499   -17.068 15.125  1.00 13.37 ? 618 DA  C N6    1 
ATOM   383  N  N1    . DA  A 1 19 ? 3.675   -15.543 16.401  1.00 17.16 ? 618 DA  C N1    1 
ATOM   384  C  C2    . DA  A 1 19 ? 4.695   -15.294 17.232  1.00 23.57 ? 618 DA  C C2    1 
ATOM   385  N  N3    . DA  A 1 19 ? 5.639   -16.125 17.692  1.00 14.89 ? 618 DA  C N3    1 
ATOM   386  C  C4    . DA  A 1 19 ? 5.465   -17.359 17.202  1.00 8.11  ? 618 DA  C C4    1 
ATOM   387  P  P     . DG  A 1 20 ? 9.456   -19.361 21.770  1.00 48.09 ? 619 DG  C P     1 
ATOM   388  O  OP1   . DG  A 1 20 ? 10.724  -19.008 22.465  1.00 43.28 ? 619 DG  C OP1   1 
ATOM   389  O  OP2   . DG  A 1 20 ? 8.960   -20.758 21.787  1.00 40.73 ? 619 DG  C OP2   1 
ATOM   390  O  "O5'" . DG  A 1 20 ? 8.322   -18.387 22.315  1.00 46.39 ? 619 DG  C "O5'" 1 
ATOM   391  C  "C5'" . DG  A 1 20 ? 8.556   -16.985 22.384  1.00 42.97 ? 619 DG  C "C5'" 1 
ATOM   392  C  "C4'" . DG  A 1 20 ? 7.307   -16.272 22.837  1.00 42.69 ? 619 DG  C "C4'" 1 
ATOM   393  O  "O4'" . DG  A 1 20 ? 6.295   -16.370 21.803  1.00 41.74 ? 619 DG  C "O4'" 1 
ATOM   394  C  "C3'" . DG  A 1 20 ? 6.675   -16.859 24.098  1.00 50.87 ? 619 DG  C "C3'" 1 
ATOM   395  O  "O3'" . DG  A 1 20 ? 6.117   -15.789 24.878  1.00 50.24 ? 619 DG  C "O3'" 1 
ATOM   396  C  "C2'" . DG  A 1 20 ? 5.574   -17.748 23.541  1.00 38.12 ? 619 DG  C "C2'" 1 
ATOM   397  C  "C1'" . DG  A 1 20 ? 5.115   -16.936 22.348  1.00 35.59 ? 619 DG  C "C1'" 1 
ATOM   398  N  N9    . DG  A 1 20 ? 4.429   -17.686 21.299  1.00 20.93 ? 619 DG  C N9    1 
ATOM   399  C  C8    . DG  A 1 20 ? 4.561   -19.020 20.994  1.00 26.59 ? 619 DG  C C8    1 
ATOM   400  N  N7    . DG  A 1 20 ? 3.742   -19.412 20.047  1.00 20.88 ? 619 DG  C N7    1 
ATOM   401  C  C5    . DG  A 1 20 ? 3.046   -18.264 19.699  1.00 16.29 ? 619 DG  C C5    1 
ATOM   402  C  C6    . DG  A 1 20 ? 2.019   -18.072 18.748  1.00 23.38 ? 619 DG  C C6    1 
ATOM   403  O  O6    . DG  A 1 20 ? 1.512   -18.904 17.984  1.00 43.15 ? 619 DG  C O6    1 
ATOM   404  N  N1    . DG  A 1 20 ? 1.572   -16.754 18.732  1.00 14.42 ? 619 DG  C N1    1 
ATOM   405  C  C2    . DG  A 1 20 ? 2.061   -15.751 19.531  1.00 22.84 ? 619 DG  C C2    1 
ATOM   406  N  N2    . DG  A 1 20 ? 1.478   -14.546 19.408  1.00 27.74 ? 619 DG  C N2    1 
ATOM   407  N  N3    . DG  A 1 20 ? 3.040   -15.912 20.403  1.00 25.25 ? 619 DG  C N3    1 
ATOM   408  C  C4    . DG  A 1 20 ? 3.473   -17.188 20.444  1.00 21.09 ? 619 DG  C C4    1 
ATOM   409  O  "O5'" . DC  B 2 1  ? -6.281  -11.693 13.725  1.00 42.61 ? 621 DC  D "O5'" 1 
ATOM   410  C  "C5'" . DC  B 2 1  ? -6.331  -12.637 14.799  1.00 37.63 ? 621 DC  D "C5'" 1 
ATOM   411  C  "C4'" . DC  B 2 1  ? -5.655  -12.138 16.056  1.00 18.87 ? 621 DC  D "C4'" 1 
ATOM   412  O  "O4'" . DC  B 2 1  ? -4.938  -13.235 16.662  1.00 34.34 ? 621 DC  D "O4'" 1 
ATOM   413  C  "C3'" . DC  B 2 1  ? -4.624  -11.041 15.829  1.00 21.66 ? 621 DC  D "C3'" 1 
ATOM   414  O  "O3'" . DC  B 2 1  ? -4.672  -10.094 16.882  1.00 10.49 ? 621 DC  D "O3'" 1 
ATOM   415  C  "C2'" . DC  B 2 1  ? -3.294  -11.778 15.852  1.00 31.85 ? 621 DC  D "C2'" 1 
ATOM   416  C  "C1'" . DC  B 2 1  ? -3.565  -12.910 16.815  1.00 25.31 ? 621 DC  D "C1'" 1 
ATOM   417  N  N1    . DC  B 2 1  ? -2.782  -14.141 16.610  1.00 12.78 ? 621 DC  D N1    1 
ATOM   418  C  C2    . DC  B 2 1  ? -1.687  -14.365 17.427  1.00 13.86 ? 621 DC  D C2    1 
ATOM   419  O  O2    . DC  B 2 1  ? -1.381  -13.501 18.251  1.00 36.05 ? 621 DC  D O2    1 
ATOM   420  N  N3    . DC  B 2 1  ? -0.983  -15.512 17.308  1.00 7.91  ? 621 DC  D N3    1 
ATOM   421  C  C4    . DC  B 2 1  ? -1.329  -16.410 16.389  1.00 10.27 ? 621 DC  D C4    1 
ATOM   422  N  N4    . DC  B 2 1  ? -0.595  -17.529 16.307  1.00 16.34 ? 621 DC  D N4    1 
ATOM   423  C  C5    . DC  B 2 1  ? -2.432  -16.203 15.518  1.00 14.21 ? 621 DC  D C5    1 
ATOM   424  C  C6    . DC  B 2 1  ? -3.129  -15.059 15.663  1.00 19.65 ? 621 DC  D C6    1 
ATOM   425  P  P     . DT  B 2 2  ? -3.821  -8.763  16.744  1.00 18.63 ? 622 DT  D P     1 
ATOM   426  O  OP1   . DT  B 2 2  ? -4.304  -7.581  17.531  1.00 12.04 ? 622 DT  D OP1   1 
ATOM   427  O  OP2   . DT  B 2 2  ? -3.718  -8.649  15.263  1.00 30.59 ? 622 DT  D OP2   1 
ATOM   428  O  "O5'" . DT  B 2 2  ? -2.413  -9.207  17.338  1.00 32.81 ? 622 DT  D "O5'" 1 
ATOM   429  C  "C5'" . DT  B 2 2  ? -2.224  -9.361  18.734  1.00 27.51 ? 622 DT  D "C5'" 1 
ATOM   430  C  "C4'" . DT  B 2 2  ? -0.749  -9.371  19.073  1.00 26.37 ? 622 DT  D "C4'" 1 
ATOM   431  O  "O4'" . DT  B 2 2  ? -0.145  -10.583 18.571  1.00 20.83 ? 622 DT  D "O4'" 1 
ATOM   432  C  "C3'" . DT  B 2 2  ? 0.052   -8.217  18.482  1.00 25.24 ? 622 DT  D "C3'" 1 
ATOM   433  O  "O3'" . DT  B 2 2  ? 0.949   -7.693  19.465  1.00 13.67 ? 622 DT  D "O3'" 1 
ATOM   434  C  "C2'" . DT  B 2 2  ? 0.765   -8.840  17.286  1.00 25.47 ? 622 DT  D "C2'" 1 
ATOM   435  C  "C1'" . DT  B 2 2  ? 0.948   -10.282 17.713  1.00 21.82 ? 622 DT  D "C1'" 1 
ATOM   436  N  N1    . DT  B 2 2  ? 1.000   -11.339 16.666  1.00 15.61 ? 622 DT  D N1    1 
ATOM   437  C  C2    . DT  B 2 2  ? 1.926   -12.329 16.861  1.00 22.36 ? 622 DT  D C2    1 
ATOM   438  O  O2    . DT  B 2 2  ? 2.727   -12.313 17.789  1.00 28.67 ? 622 DT  D O2    1 
ATOM   439  N  N3    . DT  B 2 2  ? 1.890   -13.347 15.936  1.00 13.82 ? 622 DT  D N3    1 
ATOM   440  C  C4    . DT  B 2 2  ? 1.055   -13.459 14.853  1.00 16.55 ? 622 DT  D C4    1 
ATOM   441  O  O4    . DT  B 2 2  ? 1.113   -14.456 14.115  1.00 17.77 ? 622 DT  D O4    1 
ATOM   442  C  C5    . DT  B 2 2  ? 0.149   -12.366 14.674  1.00 18.87 ? 622 DT  D C5    1 
ATOM   443  C  C7    . DT  B 2 2  ? -0.746  -12.385 13.474  1.00 22.17 ? 622 DT  D C7    1 
ATOM   444  C  C6    . DT  B 2 2  ? 0.157   -11.368 15.580  1.00 18.10 ? 622 DT  D C6    1 
ATOM   445  P  P     . DG  B 2 3  ? 1.569   -6.234  19.252  1.00 24.26 ? 623 DG  D P     1 
ATOM   446  O  OP1   . DG  B 2 3  ? 1.599   -5.469  20.498  1.00 5.63  ? 623 DG  D OP1   1 
ATOM   447  O  OP2   . DG  B 2 3  ? 0.877   -5.647  18.079  1.00 30.79 ? 623 DG  D OP2   1 
ATOM   448  O  "O5'" . DG  B 2 3  ? 3.077   -6.568  18.858  1.00 35.03 ? 623 DG  D "O5'" 1 
ATOM   449  C  "C5'" . DG  B 2 3  ? 3.902   -7.342  19.728  1.00 25.53 ? 623 DG  D "C5'" 1 
ATOM   450  C  "C4'" . DG  B 2 3  ? 5.144   -7.815  19.007  1.00 12.46 ? 623 DG  D "C4'" 1 
ATOM   451  O  "O4'" . DG  B 2 3  ? 4.816   -8.860  18.051  1.00 15.34 ? 623 DG  D "O4'" 1 
ATOM   452  C  "C3'" . DG  B 2 3  ? 5.872   -6.723  18.215  1.00 17.28 ? 623 DG  D "C3'" 1 
ATOM   453  O  "O3'" . DG  B 2 3  ? 7.294   -6.941  18.264  1.00 28.16 ? 623 DG  D "O3'" 1 
ATOM   454  C  "C2'" . DG  B 2 3  ? 5.419   -7.003  16.789  1.00 4.78  ? 623 DG  D "C2'" 1 
ATOM   455  C  "C1'" . DG  B 2 3  ? 5.387   -8.513  16.792  1.00 10.80 ? 623 DG  D "C1'" 1 
ATOM   456  N  N9    . DG  B 2 3  ? 4.623   -9.167  15.731  1.00 10.25 ? 623 DG  D N9    1 
ATOM   457  C  C8    . DG  B 2 3  ? 3.591   -8.643  15.000  1.00 5.08  ? 623 DG  D C8    1 
ATOM   458  N  N7    . DG  B 2 3  ? 3.079   -9.499  14.144  1.00 20.34 ? 623 DG  D N7    1 
ATOM   459  C  C5    . DG  B 2 3  ? 3.819   -10.657 14.317  1.00 2.00  ? 623 DG  D C5    1 
ATOM   460  C  C6    . DG  B 2 3  ? 3.720   -11.934 13.682  1.00 24.82 ? 623 DG  D C6    1 
ATOM   461  O  O6    . DG  B 2 3  ? 2.921   -12.314 12.823  1.00 18.38 ? 623 DG  D O6    1 
ATOM   462  N  N1    . DG  B 2 3  ? 4.690   -12.818 14.154  1.00 25.83 ? 623 DG  D N1    1 
ATOM   463  C  C2    . DG  B 2 3  ? 5.626   -12.524 15.115  1.00 25.91 ? 623 DG  D C2    1 
ATOM   464  N  N2    . DG  B 2 3  ? 6.465   -13.514 15.446  1.00 30.88 ? 623 DG  D N2    1 
ATOM   465  N  N3    . DG  B 2 3  ? 5.728   -11.347 15.715  1.00 29.51 ? 623 DG  D N3    1 
ATOM   466  C  C4    . DG  B 2 3  ? 4.797   -10.468 15.275  1.00 16.28 ? 623 DG  D C4    1 
ATOM   467  P  P     . DA  B 2 4  ? 8.247   -6.034  19.199  1.00 30.23 ? 624 DA  D P     1 
ATOM   468  O  OP1   . DA  B 2 4  ? 7.831   -6.228  20.623  1.00 36.79 ? 624 DA  D OP1   1 
ATOM   469  O  OP2   . DA  B 2 4  ? 8.393   -4.658  18.683  1.00 21.67 ? 624 DA  D OP2   1 
ATOM   470  O  "O5'" . DA  B 2 4  ? 9.643   -6.782  19.013  1.00 34.47 ? 624 DA  D "O5'" 1 
ATOM   471  C  "C5'" . DA  B 2 4  ? 9.963   -7.905  19.832  1.00 34.83 ? 624 DA  D "C5'" 1 
ATOM   472  C  "C4'" . DA  B 2 4  ? 10.927  -8.823  19.125  1.00 35.57 ? 624 DA  D "C4'" 1 
ATOM   473  O  "O4'" . DA  B 2 4  ? 10.260  -9.457  18.006  1.00 35.76 ? 624 DA  D "O4'" 1 
ATOM   474  C  "C3'" . DA  B 2 4  ? 12.154  -8.109  18.555  1.00 39.61 ? 624 DA  D "C3'" 1 
ATOM   475  O  "O3'" . DA  B 2 4  ? 13.309  -8.951  18.698  1.00 39.40 ? 624 DA  D "O3'" 1 
ATOM   476  C  "C2'" . DA  B 2 4  ? 11.778  -7.883  17.101  1.00 30.82 ? 624 DA  D "C2'" 1 
ATOM   477  C  "C1'" . DA  B 2 4  ? 10.899  -9.093  16.783  1.00 33.59 ? 624 DA  D "C1'" 1 
ATOM   478  N  N9    . DA  B 2 4  ? 9.853   -8.802  15.801  1.00 20.22 ? 624 DA  D N9    1 
ATOM   479  C  C8    . DA  B 2 4  ? 9.191   -7.602  15.638  1.00 15.95 ? 624 DA  D C8    1 
ATOM   480  N  N7    . DA  B 2 4  ? 8.281   -7.634  14.697  1.00 22.19 ? 624 DA  D N7    1 
ATOM   481  C  C5    . DA  B 2 4  ? 8.349   -8.938  14.208  1.00 6.60  ? 624 DA  D C5    1 
ATOM   482  C  C6    . DA  B 2 4  ? 7.614   -9.606  13.226  1.00 20.04 ? 624 DA  D C6    1 
ATOM   483  N  N6    . DA  B 2 4  ? 6.619   -9.041  12.542  1.00 22.30 ? 624 DA  D N6    1 
ATOM   484  N  N1    . DA  B 2 4  ? 7.922   -10.898 12.975  1.00 25.47 ? 624 DA  D N1    1 
ATOM   485  C  C2    . DA  B 2 4  ? 8.895   -11.466 13.683  1.00 2.00  ? 624 DA  D C2    1 
ATOM   486  N  N3    . DA  B 2 4  ? 9.653   -10.936 14.644  1.00 14.84 ? 624 DA  D N3    1 
ATOM   487  C  C4    . DA  B 2 4  ? 9.321   -9.658  14.862  1.00 2.00  ? 624 DA  D C4    1 
ATOM   488  P  P     . DC  B 2 5  ? 14.727  -8.499  18.076  1.00 33.37 ? 625 DC  D P     1 
ATOM   489  O  OP1   . DC  B 2 5  ? 15.752  -9.079  18.974  1.00 31.93 ? 625 DC  D OP1   1 
ATOM   490  O  OP2   . DC  B 2 5  ? 14.744  -7.040  17.796  1.00 30.87 ? 625 DC  D OP2   1 
ATOM   491  O  "O5'" . DC  B 2 5  ? 14.741  -9.338  16.728  1.00 26.57 ? 625 DC  D "O5'" 1 
ATOM   492  C  "C5'" . DC  B 2 5  ? 14.484  -10.732 16.799  1.00 27.53 ? 625 DC  D "C5'" 1 
ATOM   493  C  "C4'" . DC  B 2 5  ? 14.548  -11.362 15.430  1.00 42.76 ? 625 DC  D "C4'" 1 
ATOM   494  O  "O4'" . DC  B 2 5  ? 13.301  -11.120 14.734  1.00 44.15 ? 625 DC  D "O4'" 1 
ATOM   495  C  "C3'" . DC  B 2 5  ? 15.672  -10.913 14.485  1.00 42.27 ? 625 DC  D "C3'" 1 
ATOM   496  O  "O3'" . DC  B 2 5  ? 16.250  -12.087 13.887  1.00 48.46 ? 625 DC  D "O3'" 1 
ATOM   497  C  "C2'" . DC  B 2 5  ? 14.939  -10.087 13.440  1.00 41.88 ? 625 DC  D "C2'" 1 
ATOM   498  C  "C1'" . DC  B 2 5  ? 13.574  -10.760 13.399  1.00 42.66 ? 625 DC  D "C1'" 1 
ATOM   499  N  N1    . DC  B 2 5  ? 12.468  -9.913  12.916  1.00 38.02 ? 625 DC  D N1    1 
ATOM   500  C  C2    . DC  B 2 5  ? 11.552  -10.460 12.010  1.00 36.12 ? 625 DC  D C2    1 
ATOM   501  O  O2    . DC  B 2 5  ? 11.651  -11.670 11.717  1.00 38.26 ? 625 DC  D O2    1 
ATOM   502  N  N3    . DC  B 2 5  ? 10.586  -9.666  11.488  1.00 17.69 ? 625 DC  D N3    1 
ATOM   503  C  C4    . DC  B 2 5  ? 10.509  -8.382  11.859  1.00 27.33 ? 625 DC  D C4    1 
ATOM   504  N  N4    . DC  B 2 5  ? 9.573   -7.618  11.299  1.00 25.39 ? 625 DC  D N4    1 
ATOM   505  C  C5    . DC  B 2 5  ? 11.396  -7.818  12.817  1.00 26.63 ? 625 DC  D C5    1 
ATOM   506  C  C6    . DC  B 2 5  ? 12.349  -8.610  13.317  1.00 32.96 ? 625 DC  D C6    1 
ATOM   507  P  P     . DC  B 2 6  ? 17.538  -11.976 12.920  1.00 42.81 ? 626 DC  D P     1 
ATOM   508  O  OP1   . DC  B 2 6  ? 18.618  -12.812 13.506  1.00 45.03 ? 626 DC  D OP1   1 
ATOM   509  O  OP2   . DC  B 2 6  ? 17.822  -10.569 12.536  1.00 26.92 ? 626 DC  D OP2   1 
ATOM   510  O  "O5'" . DC  B 2 6  ? 17.023  -12.705 11.618  1.00 23.83 ? 626 DC  D "O5'" 1 
ATOM   511  C  "C5'" . DC  B 2 6  ? 16.484  -11.934 10.563  1.00 44.10 ? 626 DC  D "C5'" 1 
ATOM   512  C  "C4'" . DC  B 2 6  ? 15.987  -12.831 9.459   1.00 49.22 ? 626 DC  D "C4'" 1 
ATOM   513  O  "O4'" . DC  B 2 6  ? 14.591  -12.531 9.249   1.00 50.58 ? 626 DC  D "O4'" 1 
ATOM   514  C  "C3'" . DC  B 2 6  ? 16.678  -12.564 8.128   1.00 54.31 ? 626 DC  D "C3'" 1 
ATOM   515  O  "O3'" . DC  B 2 6  ? 16.756  -13.756 7.344   1.00 59.05 ? 626 DC  D "O3'" 1 
ATOM   516  C  "C2'" . DC  B 2 6  ? 15.799  -11.515 7.477   1.00 52.94 ? 626 DC  D "C2'" 1 
ATOM   517  C  "C1'" . DC  B 2 6  ? 14.416  -11.740 8.082   1.00 48.58 ? 626 DC  D "C1'" 1 
ATOM   518  N  N1    . DC  B 2 6  ? 13.804  -10.462 8.492   1.00 40.91 ? 626 DC  D N1    1 
ATOM   519  C  C2    . DC  B 2 6  ? 12.620  -10.058 7.884   1.00 38.50 ? 626 DC  D C2    1 
ATOM   520  O  O2    . DC  B 2 6  ? 12.039  -10.854 7.133   1.00 33.47 ? 626 DC  D O2    1 
ATOM   521  N  N3    . DC  B 2 6  ? 12.125  -8.824  8.150   1.00 24.60 ? 626 DC  D N3    1 
ATOM   522  C  C4    . DC  B 2 6  ? 12.740  -8.041  9.035   1.00 30.84 ? 626 DC  D C4    1 
ATOM   523  N  N4    . DC  B 2 6  ? 12.234  -6.826  9.256   1.00 31.50 ? 626 DC  D N4    1 
ATOM   524  C  C5    . DC  B 2 6  ? 13.909  -8.465  9.730   1.00 38.23 ? 626 DC  D C5    1 
ATOM   525  C  C6    . DC  B 2 6  ? 14.406  -9.666  9.425   1.00 33.79 ? 626 DC  D C6    1 
ATOM   526  P  P     . DT  B 2 7  ? 17.590  -13.750 5.974   1.00 56.28 ? 627 DT  D P     1 
ATOM   527  O  OP1   . DT  B 2 7  ? 18.074  -15.133 5.712   1.00 56.17 ? 627 DT  D OP1   1 
ATOM   528  O  OP2   . DT  B 2 7  ? 18.555  -12.623 6.045   1.00 47.03 ? 627 DT  D OP2   1 
ATOM   529  O  "O5'" . DT  B 2 7  ? 16.497  -13.405 4.872   1.00 48.28 ? 627 DT  D "O5'" 1 
ATOM   530  C  "C5'" . DT  B 2 7  ? 15.275  -14.126 4.831   1.00 49.51 ? 627 DT  D "C5'" 1 
ATOM   531  C  "C4'" . DT  B 2 7  ? 14.357  -13.529 3.795   1.00 49.37 ? 627 DT  D "C4'" 1 
ATOM   532  O  "O4'" . DT  B 2 7  ? 13.803  -12.275 4.262   1.00 44.46 ? 627 DT  D "O4'" 1 
ATOM   533  C  "C3'" . DT  B 2 7  ? 15.036  -13.225 2.457   1.00 52.82 ? 627 DT  D "C3'" 1 
ATOM   534  O  "O3'" . DT  B 2 7  ? 14.173  -13.630 1.393   1.00 50.21 ? 627 DT  D "O3'" 1 
ATOM   535  C  "C2'" . DT  B 2 7  ? 15.190  -11.714 2.471   1.00 49.75 ? 627 DT  D "C2'" 1 
ATOM   536  C  "C1'" . DT  B 2 7  ? 13.953  -11.295 3.249   1.00 42.93 ? 627 DT  D "C1'" 1 
ATOM   537  N  N1    . DT  B 2 7  ? 14.006  -9.960  3.891   1.00 34.34 ? 627 DT  D N1    1 
ATOM   538  C  C2    . DT  B 2 7  ? 12.969  -9.093  3.635   1.00 28.92 ? 627 DT  D C2    1 
ATOM   539  O  O2    . DT  B 2 7  ? 12.043  -9.364  2.900   1.00 40.63 ? 627 DT  D O2    1 
ATOM   540  N  N3    . DT  B 2 7  ? 13.061  -7.888  4.268   1.00 26.16 ? 627 DT  D N3    1 
ATOM   541  C  C4    . DT  B 2 7  ? 14.065  -7.465  5.106   1.00 33.42 ? 627 DT  D C4    1 
ATOM   542  O  O4    . DT  B 2 7  ? 14.014  -6.349  5.611   1.00 32.85 ? 627 DT  D O4    1 
ATOM   543  C  C5    . DT  B 2 7  ? 15.125  -8.408  5.320   1.00 31.75 ? 627 DT  D C5    1 
ATOM   544  C  C7    . DT  B 2 7  ? 16.255  -8.013  6.207   1.00 31.45 ? 627 DT  D C7    1 
ATOM   545  C  C6    . DT  B 2 7  ? 15.048  -9.596  4.712   1.00 24.06 ? 627 DT  D C6    1 
ATOM   546  P  P     . DA  B 2 8  ? 14.727  -13.680 -0.111  1.00 44.11 ? 628 DA  D P     1 
ATOM   547  O  OP1   . DA  B 2 8  ? 14.027  -14.824 -0.751  1.00 18.97 ? 628 DA  D OP1   1 
ATOM   548  O  OP2   . DA  B 2 8  ? 16.219  -13.625 -0.090  1.00 39.18 ? 628 DA  D OP2   1 
ATOM   549  O  "O5'" . DA  B 2 8  ? 14.174  -12.330 -0.741  1.00 39.12 ? 628 DA  D "O5'" 1 
ATOM   550  C  "C5'" . DA  B 2 8  ? 12.801  -12.201 -1.089  1.00 35.44 ? 628 DA  D "C5'" 1 
ATOM   551  C  "C4'" . DA  B 2 8  ? 12.475  -10.762 -1.416  1.00 30.38 ? 628 DA  D "C4'" 1 
ATOM   552  O  "O4'" . DA  B 2 8  ? 12.882  -9.938  -0.295  1.00 33.89 ? 628 DA  D "O4'" 1 
ATOM   553  C  "C3'" . DA  B 2 8  ? 13.157  -10.150 -2.645  1.00 34.36 ? 628 DA  D "C3'" 1 
ATOM   554  O  "O3'" . DA  B 2 8  ? 12.226  -9.284  -3.332  1.00 42.93 ? 628 DA  D "O3'" 1 
ATOM   555  C  "C2'" . DA  B 2 8  ? 14.228  -9.273  -2.021  1.00 33.51 ? 628 DA  D "C2'" 1 
ATOM   556  C  "C1'" . DA  B 2 8  ? 13.477  -8.784  -0.813  1.00 21.37 ? 628 DA  D "C1'" 1 
ATOM   557  N  N9    . DA  B 2 8  ? 14.242  -8.121  0.240   1.00 27.28 ? 628 DA  D N9    1 
ATOM   558  C  C8    . DA  B 2 8  ? 15.494  -8.378  0.721   1.00 26.87 ? 628 DA  D C8    1 
ATOM   559  N  N7    . DA  B 2 8  ? 15.914  -7.498  1.606   1.00 28.03 ? 628 DA  D N7    1 
ATOM   560  C  C5    . DA  B 2 8  ? 14.853  -6.620  1.731   1.00 24.52 ? 628 DA  D C5    1 
ATOM   561  C  C6    . DA  B 2 8  ? 14.668  -5.444  2.490   1.00 29.49 ? 628 DA  D C6    1 
ATOM   562  N  N6    . DA  B 2 8  ? 15.579  -4.923  3.314   1.00 20.55 ? 628 DA  D N6    1 
ATOM   563  N  N1    . DA  B 2 8  ? 13.486  -4.810  2.373   1.00 21.77 ? 628 DA  D N1    1 
ATOM   564  C  C2    . DA  B 2 8  ? 12.557  -5.328  1.566   1.00 34.24 ? 628 DA  D C2    1 
ATOM   565  N  N3    . DA  B 2 8  ? 12.609  -6.417  0.806   1.00 30.34 ? 628 DA  D N3    1 
ATOM   566  C  C4    . DA  B 2 8  ? 13.801  -7.015  0.924   1.00 32.12 ? 628 DA  D C4    1 
ATOM   567  P  P     . DG  B 2 9  ? 12.076  -9.362  -4.937  1.00 31.03 ? 629 DG  D P     1 
ATOM   568  O  OP1   . DG  B 2 9  ? 10.695  -8.926  -5.267  1.00 40.33 ? 629 DG  D OP1   1 
ATOM   569  O  OP2   . DG  B 2 9  ? 12.554  -10.683 -5.410  1.00 35.84 ? 629 DG  D OP2   1 
ATOM   570  O  "O5'" . DG  B 2 9  ? 13.057  -8.237  -5.492  1.00 31.93 ? 629 DG  D "O5'" 1 
ATOM   571  C  "C5'" . DG  B 2 9  ? 13.728  -7.368  -4.607  1.00 29.16 ? 629 DG  D "C5'" 1 
ATOM   572  C  "C4'" . DG  B 2 9  ? 12.787  -6.291  -4.130  1.00 30.24 ? 629 DG  D "C4'" 1 
ATOM   573  O  "O4'" . DG  B 2 9  ? 13.089  -6.035  -2.744  1.00 25.67 ? 629 DG  D "O4'" 1 
ATOM   574  C  "C3'" . DG  B 2 9  ? 12.879  -4.945  -4.849  1.00 29.44 ? 629 DG  D "C3'" 1 
ATOM   575  O  "O3'" . DG  B 2 9  ? 11.597  -4.304  -4.890  1.00 22.06 ? 629 DG  D "O3'" 1 
ATOM   576  C  "C2'" . DG  B 2 9  ? 13.783  -4.139  -3.936  1.00 36.34 ? 629 DG  D "C2'" 1 
ATOM   577  C  "C1'" . DG  B 2 9  ? 13.486  -4.693  -2.557  1.00 13.34 ? 629 DG  D "C1'" 1 
ATOM   578  N  N9    . DG  B 2 9  ? 14.659  -4.711  -1.688  1.00 30.77 ? 629 DG  D N9    1 
ATOM   579  C  C8    . DG  B 2 9  ? 15.649  -5.669  -1.631  1.00 25.34 ? 629 DG  D C8    1 
ATOM   580  N  N7    . DG  B 2 9  ? 16.581  -5.387  -0.756  1.00 18.25 ? 629 DG  D N7    1 
ATOM   581  C  C5    . DG  B 2 9  ? 16.182  -4.179  -0.209  1.00 7.56  ? 629 DG  D C5    1 
ATOM   582  C  C6    . DG  B 2 9  ? 16.789  -3.378  0.771   1.00 20.53 ? 629 DG  D C6    1 
ATOM   583  O  O6    . DG  B 2 9  ? 17.834  -3.582  1.393   1.00 21.18 ? 629 DG  D O6    1 
ATOM   584  N  N1    . DG  B 2 9  ? 16.040  -2.230  1.020   1.00 25.56 ? 629 DG  D N1    1 
ATOM   585  C  C2    . DG  B 2 9  ? 14.844  -1.913  0.413   1.00 16.86 ? 629 DG  D C2    1 
ATOM   586  N  N2    . DG  B 2 9  ? 14.231  -0.790  0.814   1.00 27.65 ? 629 DG  D N2    1 
ATOM   587  N  N3    . DG  B 2 9  ? 14.283  -2.646  -0.506  1.00 18.90 ? 629 DG  D N3    1 
ATOM   588  C  C4    . DG  B 2 9  ? 14.993  -3.755  -0.769  1.00 17.46 ? 629 DG  D C4    1 
ATOM   589  P  P     . DT  B 2 10 ? 11.324  -3.115  -5.926  1.00 24.87 ? 630 DT  D P     1 
ATOM   590  O  OP1   . DT  B 2 10 ? 9.896   -3.249  -6.312  1.00 9.07  ? 630 DT  D OP1   1 
ATOM   591  O  OP2   . DT  B 2 10 ? 12.384  -3.122  -6.963  1.00 26.00 ? 630 DT  D OP2   1 
ATOM   592  O  "O5'" . DT  B 2 10 ? 11.527  -1.785  -5.102  1.00 8.41  ? 630 DT  D "O5'" 1 
ATOM   593  C  "C5'" . DT  B 2 10 ? 10.643  -1.449  -4.071  1.00 17.01 ? 630 DT  D "C5'" 1 
ATOM   594  C  "C4'" . DT  B 2 10 ? 10.993  -0.091  -3.534  1.00 16.74 ? 630 DT  D "C4'" 1 
ATOM   595  O  "O4'" . DT  B 2 10 ? 12.213  -0.216  -2.752  1.00 26.85 ? 630 DT  D "O4'" 1 
ATOM   596  C  "C3'" . DT  B 2 10 ? 11.273  0.935   -4.636  1.00 26.76 ? 630 DT  D "C3'" 1 
ATOM   597  O  "O3'" . DT  B 2 10 ? 10.618  2.181   -4.321  1.00 16.43 ? 630 DT  D "O3'" 1 
ATOM   598  C  "C2'" . DT  B 2 10 ? 12.801  1.034   -4.649  1.00 30.73 ? 630 DT  D "C2'" 1 
ATOM   599  C  "C1'" . DT  B 2 10 ? 13.180  0.723   -3.199  1.00 29.41 ? 630 DT  D "C1'" 1 
ATOM   600  N  N1    . DT  B 2 10 ? 14.543  0.155   -2.942  1.00 20.16 ? 630 DT  D N1    1 
ATOM   601  C  C2    . DT  B 2 10 ? 15.392  0.854   -2.100  1.00 15.31 ? 630 DT  D C2    1 
ATOM   602  O  O2    . DT  B 2 10 ? 15.116  1.929   -1.595  1.00 33.94 ? 630 DT  D O2    1 
ATOM   603  N  N3    . DT  B 2 10 ? 16.589  0.246   -1.868  1.00 16.83 ? 630 DT  D N3    1 
ATOM   604  C  C4    . DT  B 2 10 ? 17.033  -0.949  -2.387  1.00 23.56 ? 630 DT  D C4    1 
ATOM   605  O  O4    . DT  B 2 10 ? 18.129  -1.380  -2.067  1.00 34.78 ? 630 DT  D O4    1 
ATOM   606  C  C5    . DT  B 2 10 ? 16.132  -1.603  -3.287  1.00 23.96 ? 630 DT  D C5    1 
ATOM   607  C  C7    . DT  B 2 10 ? 16.577  -2.873  -3.938  1.00 28.74 ? 630 DT  D C7    1 
ATOM   608  C  C6    . DT  B 2 10 ? 14.938  -1.036  -3.512  1.00 10.76 ? 630 DT  D C6    1 
ATOM   609  P  P     . DG  B 2 11 ? 10.453  3.317   -5.447  1.00 21.21 ? 631 DG  D P     1 
ATOM   610  O  OP1   . DG  B 2 11 ? 9.324   4.235   -5.145  1.00 22.39 ? 631 DG  D OP1   1 
ATOM   611  O  OP2   . DG  B 2 11 ? 10.526  2.671   -6.799  1.00 21.36 ? 631 DG  D OP2   1 
ATOM   612  O  "O5'" . DG  B 2 11 ? 11.717  4.239   -5.181  1.00 20.08 ? 631 DG  D "O5'" 1 
ATOM   613  C  "C5'" . DG  B 2 11 ? 11.733  5.096   -4.052  1.00 15.46 ? 631 DG  D "C5'" 1 
ATOM   614  C  "C4'" . DG  B 2 11 ? 13.032  5.865   -3.984  1.00 13.78 ? 631 DG  D "C4'" 1 
ATOM   615  O  "O4'" . DG  B 2 11 ? 14.153  4.965   -3.871  1.00 25.85 ? 631 DG  D "O4'" 1 
ATOM   616  C  "C3'" . DG  B 2 11 ? 13.331  6.708   -5.214  1.00 15.82 ? 631 DG  D "C3'" 1 
ATOM   617  O  "O3'" . DG  B 2 11 ? 14.113  7.781   -4.750  1.00 7.11  ? 631 DG  D "O3'" 1 
ATOM   618  C  "C2'" . DG  B 2 11 ? 14.198  5.778   -6.048  1.00 9.69  ? 631 DG  D "C2'" 1 
ATOM   619  C  "C1'" . DG  B 2 11 ? 15.044  5.172   -4.965  1.00 3.20  ? 631 DG  D "C1'" 1 
ATOM   620  N  N9    . DG  B 2 11 ? 15.745  3.908   -5.210  1.00 2.00  ? 631 DG  D N9    1 
ATOM   621  C  C8    . DG  B 2 11 ? 15.465  2.900   -6.099  1.00 9.08  ? 631 DG  D C8    1 
ATOM   622  N  N7    . DG  B 2 11 ? 16.194  1.830   -5.906  1.00 2.00  ? 631 DG  D N7    1 
ATOM   623  C  C5    . DG  B 2 11 ? 17.035  2.189   -4.867  1.00 2.00  ? 631 DG  D C5    1 
ATOM   624  C  C6    . DG  B 2 11 ? 18.040  1.453   -4.205  1.00 4.14  ? 631 DG  D C6    1 
ATOM   625  O  O6    . DG  B 2 11 ? 18.398  0.293   -4.415  1.00 17.57 ? 631 DG  D O6    1 
ATOM   626  N  N1    . DG  B 2 11 ? 18.656  2.205   -3.201  1.00 2.00  ? 631 DG  D N1    1 
ATOM   627  C  C2    . DG  B 2 11 ? 18.357  3.513   -2.903  1.00 7.42  ? 631 DG  D C2    1 
ATOM   628  N  N2    . DG  B 2 11 ? 19.073  4.103   -1.939  1.00 2.72  ? 631 DG  D N2    1 
ATOM   629  N  N3    . DG  B 2 11 ? 17.420  4.206   -3.520  1.00 8.29  ? 631 DG  D N3    1 
ATOM   630  C  C4    . DG  B 2 11 ? 16.800  3.484   -4.472  1.00 2.00  ? 631 DG  D C4    1 
ATOM   631  P  P     . DA  B 2 12 ? 13.519  9.245   -4.739  1.00 22.32 ? 632 DA  D P     1 
ATOM   632  O  OP1   . DA  B 2 12 ? 12.293  9.174   -3.915  1.00 40.46 ? 632 DA  D OP1   1 
ATOM   633  O  OP2   . DA  B 2 12 ? 13.424  9.712   -6.150  1.00 33.51 ? 632 DA  D OP2   1 
ATOM   634  O  "O5'" . DA  B 2 12 ? 14.622  10.076  -3.936  1.00 15.67 ? 632 DA  D "O5'" 1 
ATOM   635  C  "C5'" . DA  B 2 12 ? 14.708  9.987   -2.499  1.00 20.05 ? 632 DA  D "C5'" 1 
ATOM   636  C  "C4'" . DA  B 2 12 ? 16.126  10.212  -2.014  1.00 20.52 ? 632 DA  D "C4'" 1 
ATOM   637  O  "O4'" . DA  B 2 12 ? 16.973  9.108   -2.408  1.00 27.50 ? 632 DA  D "O4'" 1 
ATOM   638  C  "C3'" . DA  B 2 12 ? 16.827  11.462  -2.538  1.00 22.84 ? 632 DA  D "C3'" 1 
ATOM   639  O  "O3'" . DA  B 2 12 ? 17.758  11.917  -1.544  1.00 13.10 ? 632 DA  D "O3'" 1 
ATOM   640  C  "C2'" . DA  B 2 12 ? 17.534  10.931  -3.774  1.00 24.04 ? 632 DA  D "C2'" 1 
ATOM   641  C  "C1'" . DA  B 2 12 ? 17.965  9.548   -3.323  1.00 14.53 ? 632 DA  D "C1'" 1 
ATOM   642  N  N9    . DA  B 2 12 ? 18.087  8.521   -4.359  1.00 14.30 ? 632 DA  D N9    1 
ATOM   643  C  C8    . DA  B 2 12 ? 17.330  8.324   -5.479  1.00 19.26 ? 632 DA  D C8    1 
ATOM   644  N  N7    . DA  B 2 12 ? 17.630  7.221   -6.136  1.00 19.25 ? 632 DA  D N7    1 
ATOM   645  C  C5    . DA  B 2 12 ? 18.676  6.676   -5.409  1.00 10.86 ? 632 DA  D C5    1 
ATOM   646  C  C6    . DA  B 2 12 ? 19.433  5.499   -5.564  1.00 11.15 ? 632 DA  D C6    1 
ATOM   647  N  N6    . DA  B 2 12 ? 19.213  4.584   -6.509  1.00 15.85 ? 632 DA  D N6    1 
ATOM   648  N  N1    . DA  B 2 12 ? 20.427  5.275   -4.682  1.00 10.66 ? 632 DA  D N1    1 
ATOM   649  C  C2    . DA  B 2 12 ? 20.624  6.157   -3.706  1.00 7.23  ? 632 DA  D C2    1 
ATOM   650  N  N3    . DA  B 2 12 ? 19.968  7.280   -3.439  1.00 15.66 ? 632 DA  D N3    1 
ATOM   651  C  C4    . DA  B 2 12 ? 18.994  7.486   -4.337  1.00 14.34 ? 632 DA  D C4    1 
ATOM   652  P  P     . DC  B 2 13 ? 18.387  13.389  -1.646  1.00 20.98 ? 633 DC  D P     1 
ATOM   653  O  OP1   . DC  B 2 13 ? 18.622  13.938  -0.291  1.00 21.30 ? 633 DC  D OP1   1 
ATOM   654  O  OP2   . DC  B 2 13 ? 17.670  14.209  -2.647  1.00 26.39 ? 633 DC  D OP2   1 
ATOM   655  O  "O5'" . DC  B 2 13 ? 19.840  13.094  -2.214  1.00 42.29 ? 633 DC  D "O5'" 1 
ATOM   656  C  "C5'" . DC  B 2 13 ? 20.168  11.799  -2.689  1.00 37.20 ? 633 DC  D "C5'" 1 
ATOM   657  C  "C4'" . DC  B 2 13 ? 21.653  11.559  -2.593  1.00 31.41 ? 633 DC  D "C4'" 1 
ATOM   658  O  "O4'" . DC  B 2 13 ? 21.947  10.291  -3.223  1.00 33.78 ? 633 DC  D "O4'" 1 
ATOM   659  C  "C3'" . DC  B 2 13 ? 22.501  12.590  -3.326  1.00 28.59 ? 633 DC  D "C3'" 1 
ATOM   660  O  "O3'" . DC  B 2 13 ? 23.765  12.637  -2.666  1.00 36.78 ? 633 DC  D "O3'" 1 
ATOM   661  C  "C2'" . DC  B 2 13 ? 22.605  12.005  -4.720  1.00 26.16 ? 633 DC  D "C2'" 1 
ATOM   662  C  "C1'" . DC  B 2 13 ? 22.589  10.497  -4.472  1.00 26.67 ? 633 DC  D "C1'" 1 
ATOM   663  N  N1    . DC  B 2 13 ? 21.842  9.735   -5.488  1.00 16.15 ? 633 DC  D N1    1 
ATOM   664  C  C2    . DC  B 2 13 ? 22.212  8.442   -5.739  1.00 14.19 ? 633 DC  D C2    1 
ATOM   665  O  O2    . DC  B 2 13 ? 23.105  7.951   -5.070  1.00 40.13 ? 633 DC  D O2    1 
ATOM   666  N  N3    . DC  B 2 13 ? 21.591  7.745   -6.696  1.00 22.86 ? 633 DC  D N3    1 
ATOM   667  C  C4    . DC  B 2 13 ? 20.606  8.304   -7.388  1.00 13.66 ? 633 DC  D C4    1 
ATOM   668  N  N4    . DC  B 2 13 ? 20.023  7.574   -8.336  1.00 25.03 ? 633 DC  D N4    1 
ATOM   669  C  C5    . DC  B 2 13 ? 20.176  9.627   -7.140  1.00 18.98 ? 633 DC  D C5    1 
ATOM   670  C  C6    . DC  B 2 13 ? 20.815  10.303  -6.182  1.00 21.99 ? 633 DC  D C6    1 
ATOM   671  P  P     . DC  B 2 14 ? 24.854  13.749  -3.062  1.00 35.44 ? 634 DC  D P     1 
ATOM   672  O  OP1   . DC  B 2 14 ? 25.404  14.267  -1.789  1.00 28.69 ? 634 DC  D OP1   1 
ATOM   673  O  OP2   . DC  B 2 14 ? 24.310  14.707  -4.046  1.00 26.38 ? 634 DC  D OP2   1 
ATOM   674  O  "O5'" . DC  B 2 14 ? 25.951  12.826  -3.759  1.00 36.36 ? 634 DC  D "O5'" 1 
ATOM   675  C  "C5'" . DC  B 2 14 ? 26.312  11.582  -3.163  1.00 24.91 ? 634 DC  D "C5'" 1 
ATOM   676  C  "C4'" . DC  B 2 14 ? 27.352  10.876  -3.998  1.00 35.22 ? 634 DC  D "C4'" 1 
ATOM   677  O  "O4'" . DC  B 2 14 ? 26.680  9.961   -4.897  1.00 33.97 ? 634 DC  D "O4'" 1 
ATOM   678  C  "C3'" . DC  B 2 14 ? 28.259  11.763  -4.864  1.00 33.95 ? 634 DC  D "C3'" 1 
ATOM   679  O  "O3'" . DC  B 2 14 ? 29.643  11.360  -4.708  1.00 35.80 ? 634 DC  D "O3'" 1 
ATOM   680  C  "C2'" . DC  B 2 14 ? 27.721  11.568  -6.280  1.00 17.21 ? 634 DC  D "C2'" 1 
ATOM   681  C  "C1'" . DC  B 2 14 ? 27.100  10.172  -6.241  1.00 36.02 ? 634 DC  D "C1'" 1 
ATOM   682  N  N1    . DC  B 2 14 ? 25.920  9.970   -7.104  1.00 30.70 ? 634 DC  D N1    1 
ATOM   683  C  C2    . DC  B 2 14 ? 25.780  8.756   -7.814  1.00 37.38 ? 634 DC  D C2    1 
ATOM   684  O  O2    . DC  B 2 14 ? 26.674  7.898   -7.750  1.00 31.99 ? 634 DC  D O2    1 
ATOM   685  N  N3    . DC  B 2 14 ? 24.671  8.554   -8.559  1.00 36.56 ? 634 DC  D N3    1 
ATOM   686  C  C4    . DC  B 2 14 ? 23.742  9.505   -8.646  1.00 28.34 ? 634 DC  D C4    1 
ATOM   687  N  N4    . DC  B 2 14 ? 22.681  9.262   -9.413  1.00 26.97 ? 634 DC  D N4    1 
ATOM   688  C  C5    . DC  B 2 14 ? 23.865  10.746  -7.957  1.00 21.75 ? 634 DC  D C5    1 
ATOM   689  C  C6    . DC  B 2 14 ? 24.959  10.935  -7.203  1.00 37.64 ? 634 DC  D C6    1 
ATOM   690  P  P     . DT  B 2 15 ? 30.829  12.210  -5.412  1.00 22.28 ? 635 DT  D P     1 
ATOM   691  O  OP1   . DT  B 2 15 ? 32.008  11.929  -4.596  1.00 31.92 ? 635 DT  D OP1   1 
ATOM   692  O  OP2   . DT  B 2 15 ? 30.426  13.634  -5.639  1.00 7.78  ? 635 DT  D OP2   1 
ATOM   693  O  "O5'" . DT  B 2 15 ? 30.975  11.440  -6.801  1.00 8.76  ? 635 DT  D "O5'" 1 
ATOM   694  C  "C5'" . DT  B 2 15 ? 31.136  10.019  -6.794  1.00 22.46 ? 635 DT  D "C5'" 1 
ATOM   695  C  "C4'" . DT  B 2 15 ? 31.237  9.467   -8.198  1.00 29.42 ? 635 DT  D "C4'" 1 
ATOM   696  O  "O4'" . DT  B 2 15 ? 29.953  9.319   -8.854  1.00 36.42 ? 635 DT  D "O4'" 1 
ATOM   697  C  "C3'" . DT  B 2 15 ? 32.093  10.285  -9.157  1.00 34.39 ? 635 DT  D "C3'" 1 
ATOM   698  O  "O3'" . DT  B 2 15 ? 32.636  9.363   -10.101 1.00 42.30 ? 635 DT  D "O3'" 1 
ATOM   699  C  "C2'" . DT  B 2 15 ? 31.050  11.117  -9.874  1.00 29.55 ? 635 DT  D "C2'" 1 
ATOM   700  C  "C1'" . DT  B 2 15 ? 29.999  10.037  -10.079 1.00 33.11 ? 635 DT  D "C1'" 1 
ATOM   701  N  N1    . DT  B 2 15 ? 28.648  10.520  -10.400 1.00 26.77 ? 635 DT  D N1    1 
ATOM   702  C  C2    . DT  B 2 15 ? 27.816  9.681   -11.095 1.00 21.00 ? 635 DT  D C2    1 
ATOM   703  O  O2    . DT  B 2 15 ? 28.132  8.552   -11.425 1.00 17.58 ? 635 DT  D O2    1 
ATOM   704  N  N3    . DT  B 2 15 ? 26.594  10.210  -11.389 1.00 32.98 ? 635 DT  D N3    1 
ATOM   705  C  C4    . DT  B 2 15 ? 26.135  11.473  -11.068 1.00 39.33 ? 635 DT  D C4    1 
ATOM   706  O  O4    . DT  B 2 15 ? 25.010  11.821  -11.420 1.00 50.72 ? 635 DT  D O4    1 
ATOM   707  C  C5    . DT  B 2 15 ? 27.060  12.296  -10.327 1.00 31.32 ? 635 DT  D C5    1 
ATOM   708  C  C7    . DT  B 2 15 ? 26.658  13.682  -9.942  1.00 20.57 ? 635 DT  D C7    1 
ATOM   709  C  C6    . DT  B 2 15 ? 28.250  11.781  -10.025 1.00 30.12 ? 635 DT  D C6    1 
ATOM   710  P  P     . DA  B 2 16 ? 34.208  9.066   -10.121 1.00 33.01 ? 636 DA  D P     1 
ATOM   711  O  OP1   . DA  B 2 16 ? 34.585  8.333   -8.895  1.00 24.03 ? 636 DA  D OP1   1 
ATOM   712  O  OP2   . DA  B 2 16 ? 34.895  10.338  -10.473 1.00 28.90 ? 636 DA  D OP2   1 
ATOM   713  O  "O5'" . DA  B 2 16 ? 34.315  7.980   -11.254 1.00 15.29 ? 636 DA  D "O5'" 1 
ATOM   714  C  "C5'" . DA  B 2 16 ? 34.036  6.635   -10.936 1.00 11.35 ? 636 DA  D "C5'" 1 
ATOM   715  C  "C4'" . DA  B 2 16 ? 33.380  5.969   -12.117 1.00 30.47 ? 636 DA  D "C4'" 1 
ATOM   716  O  "O4'" . DA  B 2 16 ? 32.201  6.737   -12.455 1.00 37.20 ? 636 DA  D "O4'" 1 
ATOM   717  C  "C3'" . DA  B 2 16 ? 34.216  5.918   -13.398 1.00 31.36 ? 636 DA  D "C3'" 1 
ATOM   718  O  "O3'" . DA  B 2 16 ? 33.848  4.719   -14.083 1.00 40.39 ? 636 DA  D "O3'" 1 
ATOM   719  C  "C2'" . DA  B 2 16 ? 33.754  7.150   -14.156 1.00 32.54 ? 636 DA  D "C2'" 1 
ATOM   720  C  "C1'" . DA  B 2 16 ? 32.278  7.205   -13.788 1.00 30.82 ? 636 DA  D "C1'" 1 
ATOM   721  N  N9    . DA  B 2 16 ? 31.644  8.521   -13.816 1.00 24.52 ? 636 DA  D N9    1 
ATOM   722  C  C8    . DA  B 2 16 ? 32.119  9.735   -13.370 1.00 23.09 ? 636 DA  D C8    1 
ATOM   723  N  N7    . DA  B 2 16 ? 31.251  10.718  -13.484 1.00 22.95 ? 636 DA  D N7    1 
ATOM   724  C  C5    . DA  B 2 16 ? 30.136  10.108  -14.045 1.00 8.52  ? 636 DA  D C5    1 
ATOM   725  C  C6    . DA  B 2 16 ? 28.859  10.599  -14.378 1.00 22.00 ? 636 DA  D C6    1 
ATOM   726  N  N6    . DA  B 2 16 ? 28.466  11.862  -14.152 1.00 18.72 ? 636 DA  D N6    1 
ATOM   727  N  N1    . DA  B 2 16 ? 27.984  9.738   -14.943 1.00 7.52  ? 636 DA  D N1    1 
ATOM   728  C  C2    . DA  B 2 16 ? 28.368  8.457   -15.133 1.00 24.29 ? 636 DA  D C2    1 
ATOM   729  N  N3    . DA  B 2 16 ? 29.533  7.868   -14.832 1.00 13.01 ? 636 DA  D N3    1 
ATOM   730  C  C4    . DA  B 2 16 ? 30.378  8.763   -14.284 1.00 12.36 ? 636 DA  D C4    1 
ATOM   731  P  P     . DG  B 2 17 ? 34.707  4.210   -15.322 1.00 35.45 ? 637 DG  D P     1 
ATOM   732  O  OP1   . DG  B 2 17 ? 34.860  2.743   -15.187 1.00 37.55 ? 637 DG  D OP1   1 
ATOM   733  O  OP2   . DG  B 2 17 ? 35.890  5.094   -15.402 1.00 34.54 ? 637 DG  D OP2   1 
ATOM   734  O  "O5'" . DG  B 2 17 ? 33.754  4.470   -16.558 1.00 41.83 ? 637 DG  D "O5'" 1 
ATOM   735  C  "C5'" . DG  B 2 17 ? 32.854  5.551   -16.506 1.00 47.22 ? 637 DG  D "C5'" 1 
ATOM   736  C  "C4'" . DG  B 2 17 ? 31.962  5.558   -17.717 1.00 43.02 ? 637 DG  D "C4'" 1 
ATOM   737  O  "O4'" . DG  B 2 17 ? 31.119  6.719   -17.568 1.00 46.45 ? 637 DG  D "O4'" 1 
ATOM   738  C  "C3'" . DG  B 2 17 ? 32.721  5.752   -19.025 1.00 46.51 ? 637 DG  D "C3'" 1 
ATOM   739  O  "O3'" . DG  B 2 17 ? 32.035  5.078   -20.074 1.00 37.86 ? 637 DG  D "O3'" 1 
ATOM   740  C  "C2'" . DG  B 2 17 ? 32.734  7.258   -19.206 1.00 42.29 ? 637 DG  D "C2'" 1 
ATOM   741  C  "C1'" . DG  B 2 17 ? 31.432  7.691   -18.547 1.00 43.48 ? 637 DG  D "C1'" 1 
ATOM   742  N  N9    . DG  B 2 17 ? 31.490  8.984   -17.878 1.00 33.92 ? 637 DG  D N9    1 
ATOM   743  C  C8    . DG  B 2 17 ? 32.526  9.497   -17.142 1.00 34.21 ? 637 DG  D C8    1 
ATOM   744  N  N7    . DG  B 2 17 ? 32.297  10.711  -16.711 1.00 27.48 ? 637 DG  D N7    1 
ATOM   745  C  C5    . DG  B 2 17 ? 31.032  11.008  -17.185 1.00 22.21 ? 637 DG  D C5    1 
ATOM   746  C  C6    . DG  B 2 17 ? 30.266  12.178  -17.052 1.00 18.48 ? 637 DG  D C6    1 
ATOM   747  O  O6    . DG  B 2 17 ? 30.560  13.232  -16.467 1.00 16.60 ? 637 DG  D O6    1 
ATOM   748  N  N1    . DG  B 2 17 ? 29.036  12.050  -17.679 1.00 17.16 ? 637 DG  D N1    1 
ATOM   749  C  C2    . DG  B 2 17 ? 28.588  10.918  -18.327 1.00 29.28 ? 637 DG  D C2    1 
ATOM   750  N  N2    . DG  B 2 17 ? 27.330  10.949  -18.799 1.00 33.72 ? 637 DG  D N2    1 
ATOM   751  N  N3    . DG  B 2 17 ? 29.309  9.827   -18.479 1.00 29.06 ? 637 DG  D N3    1 
ATOM   752  C  C4    . DG  B 2 17 ? 30.511  9.942   -17.889 1.00 31.73 ? 637 DG  D C4    1 
ATOM   753  P  P     . DT  B 2 18 ? 32.557  5.212   -21.584 1.00 41.96 ? 638 DT  D P     1 
ATOM   754  O  OP1   . DT  B 2 18 ? 32.539  3.843   -22.172 1.00 25.42 ? 638 DT  D OP1   1 
ATOM   755  O  OP2   . DT  B 2 18 ? 33.791  6.054   -21.637 1.00 30.00 ? 638 DT  D OP2   1 
ATOM   756  O  "O5'" . DT  B 2 18 ? 31.405  6.024   -22.312 1.00 42.98 ? 638 DT  D "O5'" 1 
ATOM   757  C  "C5'" . DT  B 2 18 ? 30.069  5.566   -22.256 1.00 28.22 ? 638 DT  D "C5'" 1 
ATOM   758  C  "C4'" . DT  B 2 18 ? 29.145  6.632   -22.778 1.00 31.42 ? 638 DT  D "C4'" 1 
ATOM   759  O  "O4'" . DT  B 2 18 ? 29.243  7.806   -21.936 1.00 26.88 ? 638 DT  D "O4'" 1 
ATOM   760  C  "C3'" . DT  B 2 18 ? 29.502  7.098   -24.184 1.00 43.01 ? 638 DT  D "C3'" 1 
ATOM   761  O  "O3'" . DT  B 2 18 ? 28.363  7.032   -25.027 1.00 51.14 ? 638 DT  D "O3'" 1 
ATOM   762  C  "C2'" . DT  B 2 18 ? 29.960  8.539   -24.006 1.00 38.99 ? 638 DT  D "C2'" 1 
ATOM   763  C  "C1'" . DT  B 2 18 ? 29.256  8.963   -22.740 1.00 22.10 ? 638 DT  D "C1'" 1 
ATOM   764  N  N1    . DT  B 2 18 ? 29.932  10.034  -21.988 1.00 26.21 ? 638 DT  D N1    1 
ATOM   765  C  C2    . DT  B 2 18 ? 29.191  11.144  -21.661 1.00 32.53 ? 638 DT  D C2    1 
ATOM   766  O  O2    . DT  B 2 18 ? 28.005  11.256  -21.927 1.00 31.29 ? 638 DT  D O2    1 
ATOM   767  N  N3    . DT  B 2 18 ? 29.891  12.122  -20.991 1.00 36.71 ? 638 DT  D N3    1 
ATOM   768  C  C4    . DT  B 2 18 ? 31.222  12.091  -20.607 1.00 34.11 ? 638 DT  D C4    1 
ATOM   769  O  O4    . DT  B 2 18 ? 31.713  13.034  -19.985 1.00 32.24 ? 638 DT  D O4    1 
ATOM   770  C  C5    . DT  B 2 18 ? 31.936  10.907  -20.974 1.00 41.30 ? 638 DT  D C5    1 
ATOM   771  C  C7    . DT  B 2 18 ? 33.389  10.816  -20.610 1.00 36.74 ? 638 DT  D C7    1 
ATOM   772  C  C6    . DT  B 2 18 ? 31.266  9.940   -21.634 1.00 39.73 ? 638 DT  D C6    1 
ATOM   773  P  P     . DT  B 2 19 ? 28.568  7.003   -26.617 1.00 49.31 ? 639 DT  D P     1 
ATOM   774  O  OP1   . DT  B 2 19 ? 28.316  5.619   -27.111 1.00 28.54 ? 639 DT  D OP1   1 
ATOM   775  O  OP2   . DT  B 2 19 ? 29.867  7.658   -26.904 1.00 45.50 ? 639 DT  D OP2   1 
ATOM   776  O  "O5'" . DT  B 2 19 ? 27.452  8.012   -27.110 1.00 41.22 ? 639 DT  D "O5'" 1 
ATOM   777  C  "C5'" . DT  B 2 19 ? 27.813  9.149   -27.861 1.00 37.21 ? 639 DT  D "C5'" 1 
ATOM   778  C  "C4'" . DT  B 2 19 ? 27.144  10.375  -27.300 1.00 34.07 ? 639 DT  D "C4'" 1 
ATOM   779  O  "O4'" . DT  B 2 19 ? 27.825  10.809  -26.098 1.00 31.57 ? 639 DT  D "O4'" 1 
ATOM   780  C  "C3'" . DT  B 2 19 ? 27.241  11.541  -28.278 1.00 49.48 ? 639 DT  D "C3'" 1 
ATOM   781  O  "O3'" . DT  B 2 19 ? 26.000  12.234  -28.353 1.00 58.67 ? 639 DT  D "O3'" 1 
ATOM   782  C  "C2'" . DT  B 2 19 ? 28.330  12.424  -27.700 1.00 41.39 ? 639 DT  D "C2'" 1 
ATOM   783  C  "C1'" . DT  B 2 19 ? 28.182  12.185  -26.223 1.00 30.45 ? 639 DT  D "C1'" 1 
ATOM   784  N  N1    . DT  B 2 19 ? 29.428  12.428  -25.483 1.00 23.63 ? 639 DT  D N1    1 
ATOM   785  C  C2    . DT  B 2 19 ? 29.542  13.617  -24.808 1.00 30.80 ? 639 DT  D C2    1 
ATOM   786  O  O2    . DT  B 2 19 ? 28.698  14.488  -24.850 1.00 46.18 ? 639 DT  D O2    1 
ATOM   787  N  N3    . DT  B 2 19 ? 30.694  13.761  -24.086 1.00 37.34 ? 639 DT  D N3    1 
ATOM   788  C  C4    . DT  B 2 19 ? 31.739  12.868  -24.000 1.00 36.54 ? 639 DT  D C4    1 
ATOM   789  O  O4    . DT  B 2 19 ? 32.699  13.125  -23.286 1.00 44.27 ? 639 DT  D O4    1 
ATOM   790  C  C5    . DT  B 2 19 ? 31.585  11.670  -24.782 1.00 34.97 ? 639 DT  D C5    1 
ATOM   791  C  C7    . DT  B 2 19 ? 32.707  10.683  -24.818 1.00 43.51 ? 639 DT  D C7    1 
ATOM   792  C  C6    . DT  B 2 19 ? 30.442  11.502  -25.461 1.00 30.58 ? 639 DT  D C6    1 
ATOM   793  P  P     . DG  B 2 20 ? 25.572  12.921  -29.734 1.00 66.40 ? 640 DG  D P     1 
ATOM   794  O  OP1   . DG  B 2 20 ? 24.094  13.050  -29.689 1.00 68.00 ? 640 DG  D OP1   1 
ATOM   795  O  OP2   . DG  B 2 20 ? 26.200  12.164  -30.837 1.00 52.20 ? 640 DG  D OP2   1 
ATOM   796  O  "O5'" . DG  B 2 20 ? 26.218  14.374  -29.645 1.00 49.07 ? 640 DG  D "O5'" 1 
ATOM   797  C  "C5'" . DG  B 2 20 ? 25.511  15.434  -29.001 1.00 49.36 ? 640 DG  D "C5'" 1 
ATOM   798  C  "C4'" . DG  B 2 20 ? 26.208  16.749  -29.253 1.00 52.46 ? 640 DG  D "C4'" 1 
ATOM   799  O  "O4'" . DG  B 2 20 ? 27.424  16.812  -28.469 1.00 47.83 ? 640 DG  D "O4'" 1 
ATOM   800  C  "C3'" . DG  B 2 20 ? 26.648  16.924  -30.703 1.00 57.70 ? 640 DG  D "C3'" 1 
ATOM   801  O  "O3'" . DG  B 2 20 ? 26.784  18.321  -30.968 1.00 66.31 ? 640 DG  D "O3'" 1 
ATOM   802  C  "C2'" . DG  B 2 20 ? 28.051  16.344  -30.684 1.00 53.32 ? 640 DG  D "C2'" 1 
ATOM   803  C  "C1'" . DG  B 2 20 ? 28.547  16.839  -29.335 1.00 44.36 ? 640 DG  D "C1'" 1 
ATOM   804  N  N9    . DG  B 2 20 ? 29.611  16.054  -28.717 1.00 33.13 ? 640 DG  D N9    1 
ATOM   805  C  C8    . DG  B 2 20 ? 29.995  14.780  -29.038 1.00 23.22 ? 640 DG  D C8    1 
ATOM   806  N  N7    . DG  B 2 20 ? 30.975  14.344  -28.289 1.00 34.24 ? 640 DG  D N7    1 
ATOM   807  C  C5    . DG  B 2 20 ? 31.255  15.401  -27.430 1.00 19.60 ? 640 DG  D C5    1 
ATOM   808  C  C6    . DG  B 2 20 ? 32.224  15.520  -26.395 1.00 29.25 ? 640 DG  D C6    1 
ATOM   809  O  O6    . DG  B 2 20 ? 33.070  14.681  -26.019 1.00 32.74 ? 640 DG  D O6    1 
ATOM   810  N  N1    . DG  B 2 20 ? 32.162  16.767  -25.779 1.00 19.68 ? 640 DG  D N1    1 
ATOM   811  C  C2    . DG  B 2 20 ? 31.297  17.767  -26.123 1.00 21.94 ? 640 DG  D C2    1 
ATOM   812  N  N2    . DG  B 2 20 ? 31.413  18.924  -25.441 1.00 28.27 ? 640 DG  D N2    1 
ATOM   813  N  N3    . DG  B 2 20 ? 30.389  17.660  -27.075 1.00 29.01 ? 640 DG  D N3    1 
ATOM   814  C  C4    . DG  B 2 20 ? 30.428  16.462  -27.683 1.00 22.14 ? 640 DG  D C4    1 
ATOM   815  N  N     . LEU C 3 8  ? 9.508   18.148  -16.072 1.00 24.89 ? 99  LEU A N     1 
ATOM   816  C  CA    . LEU C 3 8  ? 9.144   16.900  -16.797 1.00 24.62 ? 99  LEU A CA    1 
ATOM   817  C  C     . LEU C 3 8  ? 8.532   15.902  -15.822 1.00 28.59 ? 99  LEU A C     1 
ATOM   818  O  O     . LEU C 3 8  ? 8.717   16.014  -14.616 1.00 30.60 ? 99  LEU A O     1 
ATOM   819  C  CB    . LEU C 3 8  ? 10.382  16.297  -17.449 1.00 33.40 ? 99  LEU A CB    1 
ATOM   820  C  CG    . LEU C 3 8  ? 11.209  17.195  -18.386 1.00 41.20 ? 99  LEU A CG    1 
ATOM   821  C  CD1   . LEU C 3 8  ? 12.337  16.350  -18.964 1.00 43.39 ? 99  LEU A CD1   1 
ATOM   822  C  CD2   . LEU C 3 8  ? 10.361  17.770  -19.521 1.00 32.91 ? 99  LEU A CD2   1 
ATOM   823  N  N     . LEU C 3 9  ? 7.819   14.913  -16.344 1.00 23.11 ? 100 LEU A N     1 
ATOM   824  C  CA    . LEU C 3 9  ? 7.166   13.933  -15.498 1.00 26.60 ? 100 LEU A CA    1 
ATOM   825  C  C     . LEU C 3 9  ? 7.552   12.524  -15.850 1.00 25.50 ? 100 LEU A C     1 
ATOM   826  O  O     . LEU C 3 9  ? 7.598   12.159  -17.018 1.00 24.51 ? 100 LEU A O     1 
ATOM   827  C  CB    . LEU C 3 9  ? 5.640   14.075  -15.599 1.00 20.11 ? 100 LEU A CB    1 
ATOM   828  C  CG    . LEU C 3 9  ? 5.093   15.407  -15.085 1.00 19.16 ? 100 LEU A CG    1 
ATOM   829  C  CD1   . LEU C 3 9  ? 3.558   15.321  -15.028 1.00 31.43 ? 100 LEU A CD1   1 
ATOM   830  C  CD2   . LEU C 3 9  ? 5.646   15.712  -13.701 1.00 21.32 ? 100 LEU A CD2   1 
ATOM   831  N  N     . CYS C 3 10 ? 7.842   11.725  -14.835 1.00 27.02 ? 101 CYS A N     1 
ATOM   832  C  CA    . CYS C 3 10 ? 8.208   10.357  -15.105 1.00 22.11 ? 101 CYS A CA    1 
ATOM   833  C  C     . CYS C 3 10 ? 7.129   9.897   -16.054 1.00 26.59 ? 101 CYS A C     1 
ATOM   834  O  O     . CYS C 3 10 ? 5.956   9.946   -15.729 1.00 26.08 ? 101 CYS A O     1 
ATOM   835  C  CB    . CYS C 3 10 ? 8.190   9.537   -13.823 1.00 20.46 ? 101 CYS A CB    1 
ATOM   836  S  SG    . CYS C 3 10 ? 8.408   7.760   -14.107 1.00 24.53 ? 101 CYS A SG    1 
ATOM   837  N  N     . LYS C 3 11 ? 7.518   9.478   -17.244 1.00 28.13 ? 102 LYS A N     1 
ATOM   838  C  CA    . LYS C 3 11 ? 6.538   9.043   -18.225 1.00 32.66 ? 102 LYS A CA    1 
ATOM   839  C  C     . LYS C 3 11 ? 6.024   7.677   -17.827 1.00 33.33 ? 102 LYS A C     1 
ATOM   840  O  O     . LYS C 3 11 ? 5.505   6.932   -18.652 1.00 43.16 ? 102 LYS A O     1 
ATOM   841  C  CB    . LYS C 3 11 ? 7.194   9.008   -19.608 1.00 30.74 ? 102 LYS A CB    1 
ATOM   842  C  CG    . LYS C 3 11 ? 6.262   9.130   -20.804 1.00 34.71 ? 102 LYS A CG    1 
ATOM   843  C  CD    . LYS C 3 11 ? 5.689   7.798   -21.272 1.00 38.69 ? 102 LYS A CD    1 
ATOM   844  C  CE    . LYS C 3 11 ? 4.926   7.987   -22.597 1.00 37.45 ? 102 LYS A CE    1 
ATOM   845  N  NZ    . LYS C 3 11 ? 4.455   6.703   -23.206 1.00 43.44 ? 102 LYS A NZ    1 
ATOM   846  N  N     . VAL C 3 12 ? 6.169   7.342   -16.552 1.00 30.17 ? 103 VAL A N     1 
ATOM   847  C  CA    . VAL C 3 12 ? 5.715   6.033   -16.083 1.00 32.12 ? 103 VAL A CA    1 
ATOM   848  C  C     . VAL C 3 12 ? 4.839   6.018   -14.827 1.00 20.04 ? 103 VAL A C     1 
ATOM   849  O  O     . VAL C 3 12 ? 4.009   5.140   -14.676 1.00 22.79 ? 103 VAL A O     1 
ATOM   850  C  CB    . VAL C 3 12 ? 6.912   5.099   -15.812 1.00 23.56 ? 103 VAL A CB    1 
ATOM   851  C  CG1   . VAL C 3 12 ? 6.420   3.747   -15.288 1.00 18.86 ? 103 VAL A CG1   1 
ATOM   852  C  CG2   . VAL C 3 12 ? 7.701   4.901   -17.090 1.00 30.89 ? 103 VAL A CG2   1 
ATOM   853  N  N     . CYS C 3 13 ? 5.018   6.989   -13.946 1.00 14.72 ? 104 CYS A N     1 
ATOM   854  C  CA    . CYS C 3 13 ? 4.277   7.027   -12.692 1.00 18.68 ? 104 CYS A CA    1 
ATOM   855  C  C     . CYS C 3 13 ? 4.077   8.488   -12.338 1.00 15.97 ? 104 CYS A C     1 
ATOM   856  O  O     . CYS C 3 13 ? 4.042   8.852   -11.175 1.00 24.94 ? 104 CYS A O     1 
ATOM   857  C  CB    . CYS C 3 13 ? 5.103   6.347   -11.575 1.00 11.66 ? 104 CYS A CB    1 
ATOM   858  S  SG    . CYS C 3 13 ? 6.428   7.413   -10.893 1.00 30.03 ? 104 CYS A SG    1 
ATOM   859  N  N     . GLY C 3 14 ? 4.004   9.337   -13.350 1.00 9.79  ? 105 GLY A N     1 
ATOM   860  C  CA    . GLY C 3 14 ? 3.786   10.749  -13.104 1.00 2.00  ? 105 GLY A CA    1 
ATOM   861  C  C     . GLY C 3 14 ? 4.576   11.402  -12.006 1.00 14.16 ? 105 GLY A C     1 
ATOM   862  O  O     . GLY C 3 14 ? 4.342   12.574  -11.724 1.00 20.47 ? 105 GLY A O     1 
ATOM   863  N  N     . ASP C 3 15 ? 5.498   10.669  -11.378 1.00 20.82 ? 106 ASP A N     1 
ATOM   864  C  CA    . ASP C 3 15 ? 6.352   11.229  -10.314 1.00 18.12 ? 106 ASP A CA    1 
ATOM   865  C  C     . ASP C 3 15 ? 7.306   12.161  -11.076 1.00 20.74 ? 106 ASP A C     1 
ATOM   866  O  O     . ASP C 3 15 ? 7.498   11.965  -12.276 1.00 21.51 ? 106 ASP A O     1 
ATOM   867  C  CB    . ASP C 3 15 ? 7.148   10.085  -9.651  1.00 23.97 ? 106 ASP A CB    1 
ATOM   868  C  CG    . ASP C 3 15 ? 7.971   10.536  -8.441  1.00 27.08 ? 106 ASP A CG    1 
ATOM   869  O  OD1   . ASP C 3 15 ? 8.168   11.763  -8.259  1.00 18.93 ? 106 ASP A OD1   1 
ATOM   870  O  OD2   . ASP C 3 15 ? 8.433   9.643   -7.677  1.00 17.44 ? 106 ASP A OD2   1 
ATOM   871  N  N     . VAL C 3 16 ? 7.888   13.162  -10.415 1.00 20.77 ? 107 VAL A N     1 
ATOM   872  C  CA    . VAL C 3 16 ? 8.821   14.061  -11.088 1.00 18.64 ? 107 VAL A CA    1 
ATOM   873  C  C     . VAL C 3 16 ? 9.980   13.306  -11.705 1.00 28.59 ? 107 VAL A C     1 
ATOM   874  O  O     . VAL C 3 16 ? 10.519  12.397  -11.094 1.00 36.79 ? 107 VAL A O     1 
ATOM   875  C  CB    . VAL C 3 16 ? 9.434   15.069  -10.162 1.00 20.50 ? 107 VAL A CB    1 
ATOM   876  C  CG1   . VAL C 3 16 ? 10.472  15.840  -10.921 1.00 22.52 ? 107 VAL A CG1   1 
ATOM   877  C  CG2   . VAL C 3 16 ? 8.364   16.035  -9.656  1.00 25.18 ? 107 VAL A CG2   1 
ATOM   878  N  N     . ALA C 3 17 ? 10.374  13.696  -12.916 1.00 33.52 ? 108 ALA A N     1 
ATOM   879  C  CA    . ALA C 3 17 ? 11.446  13.014  -13.627 1.00 26.73 ? 108 ALA A CA    1 
ATOM   880  C  C     . ALA C 3 17 ? 12.819  13.602  -13.334 1.00 27.62 ? 108 ALA A C     1 
ATOM   881  O  O     . ALA C 3 17 ? 12.985  14.818  -13.291 1.00 26.75 ? 108 ALA A O     1 
ATOM   882  C  CB    . ALA C 3 17 ? 11.166  13.046  -15.106 1.00 29.57 ? 108 ALA A CB    1 
ATOM   883  N  N     . SER C 3 18 ? 13.799  12.724  -13.129 1.00 24.00 ? 109 SER A N     1 
ATOM   884  C  CA    . SER C 3 18 ? 15.170  13.142  -12.836 1.00 22.99 ? 109 SER A CA    1 
ATOM   885  C  C     . SER C 3 18 ? 15.950  13.369  -14.136 1.00 22.09 ? 109 SER A C     1 
ATOM   886  O  O     . SER C 3 18 ? 16.894  14.172  -14.174 1.00 21.57 ? 109 SER A O     1 
ATOM   887  C  CB    . SER C 3 18 ? 15.870  12.077  -11.978 1.00 15.98 ? 109 SER A CB    1 
ATOM   888  O  OG    . SER C 3 18 ? 15.879  10.832  -12.667 1.00 20.56 ? 109 SER A OG    1 
ATOM   889  N  N     . GLY C 3 19 ? 15.551  12.658  -15.188 1.00 17.16 ? 110 GLY A N     1 
ATOM   890  C  CA    . GLY C 3 19 ? 16.191  12.822  -16.482 1.00 25.37 ? 110 GLY A CA    1 
ATOM   891  C  C     . GLY C 3 19 ? 15.605  11.928  -17.561 1.00 25.82 ? 110 GLY A C     1 
ATOM   892  O  O     . GLY C 3 19 ? 14.584  11.278  -17.344 1.00 21.60 ? 110 GLY A O     1 
ATOM   893  N  N     . PHE C 3 20 ? 16.256  11.895  -18.723 1.00 19.93 ? 111 PHE A N     1 
ATOM   894  C  CA    . PHE C 3 20 ? 15.824  11.070  -19.845 1.00 18.87 ? 111 PHE A CA    1 
ATOM   895  C  C     . PHE C 3 20 ? 16.482  9.736   -19.567 1.00 21.42 ? 111 PHE A C     1 
ATOM   896  O  O     . PHE C 3 20 ? 17.701  9.652   -19.542 1.00 31.49 ? 111 PHE A O     1 
ATOM   897  C  CB    . PHE C 3 20 ? 16.356  11.675  -21.154 1.00 26.49 ? 111 PHE A CB    1 
ATOM   898  C  CG    . PHE C 3 20 ? 15.798  11.043  -22.401 1.00 28.30 ? 111 PHE A CG    1 
ATOM   899  C  CD1   . PHE C 3 20 ? 14.488  11.279  -22.792 1.00 28.89 ? 111 PHE A CD1   1 
ATOM   900  C  CD2   . PHE C 3 20 ? 16.583  10.198  -23.181 1.00 27.68 ? 111 PHE A CD2   1 
ATOM   901  C  CE1   . PHE C 3 20 ? 13.975  10.681  -23.939 1.00 25.95 ? 111 PHE A CE1   1 
ATOM   902  C  CE2   . PHE C 3 20 ? 16.071  9.598   -24.328 1.00 24.40 ? 111 PHE A CE2   1 
ATOM   903  C  CZ    . PHE C 3 20 ? 14.773  9.837   -24.705 1.00 17.07 ? 111 PHE A CZ    1 
ATOM   904  N  N     . HIS C 3 21 ? 15.688  8.692   -19.361 1.00 27.43 ? 112 HIS A N     1 
ATOM   905  C  CA    . HIS C 3 21 ? 16.227  7.371   -19.017 1.00 17.72 ? 112 HIS A CA    1 
ATOM   906  C  C     . HIS C 3 21 ? 15.714  6.230   -19.870 1.00 20.48 ? 112 HIS A C     1 
ATOM   907  O  O     . HIS C 3 21 ? 14.515  6.099   -20.085 1.00 21.75 ? 112 HIS A O     1 
ATOM   908  C  CB    . HIS C 3 21 ? 15.880  7.051   -17.575 1.00 24.08 ? 112 HIS A CB    1 
ATOM   909  C  CG    . HIS C 3 21 ? 16.581  7.955   -16.627 1.00 22.97 ? 112 HIS A CG    1 
ATOM   910  N  ND1   . HIS C 3 21 ? 15.943  8.990   -15.987 1.00 18.18 ? 112 HIS A ND1   1 
ATOM   911  C  CD2   . HIS C 3 21 ? 17.860  7.961   -16.180 1.00 26.75 ? 112 HIS A CD2   1 
ATOM   912  C  CE1   . HIS C 3 21 ? 16.797  9.594   -15.187 1.00 22.69 ? 112 HIS A CE1   1 
ATOM   913  N  NE2   . HIS C 3 21 ? 17.969  8.990   -15.280 1.00 15.20 ? 112 HIS A NE2   1 
ATOM   914  N  N     . TYR C 3 22 ? 16.624  5.377   -20.317 1.00 11.96 ? 113 TYR A N     1 
ATOM   915  C  CA    . TYR C 3 22 ? 16.278  4.228   -21.151 1.00 8.19  ? 113 TYR A CA    1 
ATOM   916  C  C     . TYR C 3 22 ? 15.276  4.506   -22.246 1.00 10.39 ? 113 TYR A C     1 
ATOM   917  O  O     . TYR C 3 22 ? 14.538  3.612   -22.655 1.00 9.44  ? 113 TYR A O     1 
ATOM   918  C  CB    . TYR C 3 22 ? 15.764  3.094   -20.288 1.00 25.18 ? 113 TYR A CB    1 
ATOM   919  C  CG    . TYR C 3 22 ? 16.788  2.587   -19.316 1.00 26.75 ? 113 TYR A CG    1 
ATOM   920  C  CD1   . TYR C 3 22 ? 17.788  1.712   -19.719 1.00 23.57 ? 113 TYR A CD1   1 
ATOM   921  C  CD2   . TYR C 3 22 ? 16.741  2.971   -17.978 1.00 30.54 ? 113 TYR A CD2   1 
ATOM   922  C  CE1   . TYR C 3 22 ? 18.707  1.221   -18.809 1.00 30.46 ? 113 TYR A CE1   1 
ATOM   923  C  CE2   . TYR C 3 22 ? 17.649  2.491   -17.065 1.00 29.97 ? 113 TYR A CE2   1 
ATOM   924  C  CZ    . TYR C 3 22 ? 18.622  1.614   -17.481 1.00 29.67 ? 113 TYR A CZ    1 
ATOM   925  O  OH    . TYR C 3 22 ? 19.466  1.099   -16.546 1.00 30.23 ? 113 TYR A OH    1 
ATOM   926  N  N     . GLY C 3 23 ? 15.263  5.749   -22.710 1.00 2.00  ? 114 GLY A N     1 
ATOM   927  C  CA    . GLY C 3 23 ? 14.379  6.146   -23.797 1.00 26.49 ? 114 GLY A CA    1 
ATOM   928  C  C     . GLY C 3 23 ? 13.067  6.769   -23.361 1.00 24.68 ? 114 GLY A C     1 
ATOM   929  O  O     . GLY C 3 23 ? 12.055  6.684   -24.075 1.00 36.18 ? 114 GLY A O     1 
ATOM   930  N  N     . VAL C 3 24 ? 13.103  7.408   -22.231 1.00 19.14 ? 115 VAL A N     1 
ATOM   931  C  CA    . VAL C 3 24 ? 11.909  8.024   -21.667 1.00 14.06 ? 115 VAL A CA    1 
ATOM   932  C  C     . VAL C 3 24 ? 12.285  8.918   -20.511 1.00 16.04 ? 115 VAL A C     1 
ATOM   933  O  O     . VAL C 3 24 ? 13.258  8.664   -19.798 1.00 22.15 ? 115 VAL A O     1 
ATOM   934  C  CB    . VAL C 3 24 ? 11.003  6.928   -21.098 1.00 17.94 ? 115 VAL A CB    1 
ATOM   935  C  CG1   . VAL C 3 24 ? 9.974   7.466   -20.103 1.00 6.50  ? 115 VAL A CG1   1 
ATOM   936  C  CG2   . VAL C 3 24 ? 10.218  6.177   -22.169 1.00 10.34 ? 115 VAL A CG2   1 
ATOM   937  N  N     . LEU C 3 25 ? 11.523  9.965   -20.333 1.00 16.85 ? 116 LEU A N     1 
ATOM   938  C  CA    . LEU C 3 25 ? 11.720  10.821  -19.171 1.00 15.98 ? 116 LEU A CA    1 
ATOM   939  C  C     . LEU C 3 25 ? 11.254  9.985   -17.991 1.00 21.89 ? 116 LEU A C     1 
ATOM   940  O  O     . LEU C 3 25 ? 10.209  9.325   -18.052 1.00 8.94  ? 116 LEU A O     1 
ATOM   941  C  CB    . LEU C 3 25 ? 10.909  12.097  -19.340 1.00 14.02 ? 116 LEU A CB    1 
ATOM   942  C  CG    . LEU C 3 25 ? 11.092  12.718  -20.720 1.00 27.71 ? 116 LEU A CG    1 
ATOM   943  C  CD1   . LEU C 3 25 ? 9.809   13.341  -21.264 1.00 38.77 ? 116 LEU A CD1   1 
ATOM   944  C  CD2   . LEU C 3 25 ? 12.150  13.822  -20.733 1.00 25.01 ? 116 LEU A CD2   1 
ATOM   945  N  N     . ALA C 3 26 ? 12.012  9.969   -16.914 1.00 19.87 ? 117 ALA A N     1 
ATOM   946  C  CA    . ALA C 3 26 ? 11.618  9.115   -15.791 1.00 10.96 ? 117 ALA A CA    1 
ATOM   947  C  C     . ALA C 3 26 ? 12.170  9.545   -14.460 1.00 22.61 ? 117 ALA A C     1 
ATOM   948  O  O     . ALA C 3 26 ? 13.089  10.364  -14.397 1.00 18.03 ? 117 ALA A O     1 
ATOM   949  C  CB    . ALA C 3 26 ? 12.092  7.682   -16.033 1.00 2.00  ? 117 ALA A CB    1 
ATOM   950  N  N     . CYS C 3 27 ? 11.592  9.009   -13.381 1.00 21.85 ? 118 CYS A N     1 
ATOM   951  C  CA    . CYS C 3 27 ? 12.055  9.377   -12.044 1.00 19.38 ? 118 CYS A CA    1 
ATOM   952  C  C     . CYS C 3 27 ? 13.079  8.348   -11.545 1.00 13.31 ? 118 CYS A C     1 
ATOM   953  O  O     . CYS C 3 27 ? 13.136  7.207   -12.043 1.00 8.88  ? 118 CYS A O     1 
ATOM   954  C  CB    . CYS C 3 27 ? 10.857  9.480   -11.074 1.00 17.09 ? 118 CYS A CB    1 
ATOM   955  S  SG    . CYS C 3 27 ? 9.984   7.911   -10.766 1.00 12.67 ? 118 CYS A SG    1 
ATOM   956  N  N     . GLU C 3 28 ? 13.874  8.726   -10.550 1.00 9.74  ? 119 GLU A N     1 
ATOM   957  C  CA    . GLU C 3 28 ? 14.878  7.780   -10.062 1.00 5.61  ? 119 GLU A CA    1 
ATOM   958  C  C     . GLU C 3 28 ? 14.316  6.390   -9.792  1.00 12.89 ? 119 GLU A C     1 
ATOM   959  O  O     . GLU C 3 28 ? 14.937  5.368   -10.129 1.00 18.04 ? 119 GLU A O     1 
ATOM   960  C  CB    . GLU C 3 28 ? 15.565  8.332   -8.813  1.00 7.11  ? 119 GLU A CB    1 
ATOM   961  C  CG    . GLU C 3 28 ? 16.392  9.601   -9.026  1.00 8.28  ? 119 GLU A CG    1 
ATOM   962  C  CD    . GLU C 3 28 ? 17.575  9.390   -9.994  1.00 25.24 ? 119 GLU A CD    1 
ATOM   963  O  OE1   . GLU C 3 28 ? 18.161  8.288   -10.015 1.00 14.14 ? 119 GLU A OE1   1 
ATOM   964  O  OE2   . GLU C 3 28 ? 17.937  10.339  -10.717 1.00 30.93 ? 119 GLU A OE2   1 
ATOM   965  N  N     . GLY C 3 29 ? 13.112  6.327   -9.229  1.00 13.92 ? 120 GLY A N     1 
ATOM   966  C  CA    . GLY C 3 29 ? 12.536  5.032   -8.917  1.00 2.00  ? 120 GLY A CA    1 
ATOM   967  C  C     . GLY C 3 29 ? 12.210  4.149   -10.087 1.00 2.00  ? 120 GLY A C     1 
ATOM   968  O  O     . GLY C 3 29 ? 12.340  2.916   -10.031 1.00 3.66  ? 120 GLY A O     1 
ATOM   969  N  N     . CYS C 3 30 ? 11.770  4.731   -11.184 1.00 7.61  ? 121 CYS A N     1 
ATOM   970  C  CA    . CYS C 3 30 ? 11.446  3.842   -12.300 1.00 9.72  ? 121 CYS A CA    1 
ATOM   971  C  C     . CYS C 3 30 ? 12.747  3.541   -13.116 1.00 14.26 ? 121 CYS A C     1 
ATOM   972  O  O     . CYS C 3 30 ? 12.865  2.486   -13.744 1.00 7.06  ? 121 CYS A O     1 
ATOM   973  C  CB    . CYS C 3 30 ? 10.266  4.411   -13.146 1.00 17.57 ? 121 CYS A CB    1 
ATOM   974  S  SG    . CYS C 3 30 ? 8.598   4.560   -12.311 1.00 12.51 ? 121 CYS A SG    1 
ATOM   975  N  N     . LYS C 3 31 ? 13.732  4.439   -13.083 1.00 8.74  ? 122 LYS A N     1 
ATOM   976  C  CA    . LYS C 3 31 ? 15.018  4.136   -13.765 1.00 16.14 ? 122 LYS A CA    1 
ATOM   977  C  C     . LYS C 3 31 ? 15.618  2.902   -13.049 1.00 14.89 ? 122 LYS A C     1 
ATOM   978  O  O     . LYS C 3 31 ? 15.728  1.805   -13.643 1.00 8.91  ? 122 LYS A O     1 
ATOM   979  C  CB    . LYS C 3 31 ? 16.001  5.313   -13.655 1.00 8.56  ? 122 LYS A CB    1 
ATOM   980  C  CG    . LYS C 3 31 ? 17.356  4.990   -14.268 1.00 27.41 ? 122 LYS A CG    1 
ATOM   981  C  CD    . LYS C 3 31 ? 18.371  6.112   -14.094 1.00 31.30 ? 122 LYS A CD    1 
ATOM   982  C  CE    . LYS C 3 31 ? 18.675  6.426   -12.626 1.00 34.40 ? 122 LYS A CE    1 
ATOM   983  N  NZ    . LYS C 3 31 ? 19.715  7.492   -12.446 1.00 32.28 ? 122 LYS A NZ    1 
ATOM   984  N  N     . GLY C 3 32 ? 15.945  3.084   -11.756 1.00 14.90 ? 123 GLY A N     1 
ATOM   985  C  CA    . GLY C 3 32 ? 16.492  2.007   -10.934 1.00 4.55  ? 123 GLY A CA    1 
ATOM   986  C  C     . GLY C 3 32 ? 15.623  0.766   -11.013 1.00 14.39 ? 123 GLY A C     1 
ATOM   987  O  O     . GLY C 3 32 ? 16.113  -0.353  -11.201 1.00 22.75 ? 123 GLY A O     1 
ATOM   988  N  N     . PHE C 3 33 ? 14.315  0.940   -10.866 1.00 10.88 ? 124 PHE A N     1 
ATOM   989  C  CA    . PHE C 3 33 ? 13.441  -0.212  -10.964 1.00 7.41  ? 124 PHE A CA    1 
ATOM   990  C  C     . PHE C 3 33 ? 13.539  -0.847  -12.351 1.00 12.06 ? 124 PHE A C     1 
ATOM   991  O  O     . PHE C 3 33 ? 13.242  -2.032  -12.516 1.00 14.11 ? 124 PHE A O     1 
ATOM   992  C  CB    . PHE C 3 33 ? 11.968  0.176   -10.677 1.00 11.19 ? 124 PHE A CB    1 
ATOM   993  C  CG    . PHE C 3 33 ? 11.068  -1.002  -11.004 1.00 2.00  ? 124 PHE A CG    1 
ATOM   994  C  CD1   . PHE C 3 33 ? 10.979  -2.064  -10.104 1.00 2.00  ? 124 PHE A CD1   1 
ATOM   995  C  CD2   . PHE C 3 33 ? 10.361  -1.029  -12.207 1.00 8.25  ? 124 PHE A CD2   1 
ATOM   996  C  CE1   . PHE C 3 33 ? 10.214  -3.188  -10.431 1.00 11.63 ? 124 PHE A CE1   1 
ATOM   997  C  CE2   . PHE C 3 33 ? 9.584   -2.147  -12.528 1.00 8.16  ? 124 PHE A CE2   1 
ATOM   998  C  CZ    . PHE C 3 33 ? 9.520   -3.232  -11.645 1.00 11.74 ? 124 PHE A CZ    1 
ATOM   999  N  N     . PHE C 3 34 ? 13.932  -0.075  -13.368 1.00 15.00 ? 125 PHE A N     1 
ATOM   1000 C  CA    . PHE C 3 34 ? 14.024  -0.678  -14.686 1.00 17.73 ? 125 PHE A CA    1 
ATOM   1001 C  C     . PHE C 3 34 ? 15.307  -1.478  -14.828 1.00 19.71 ? 125 PHE A C     1 
ATOM   1002 O  O     . PHE C 3 34 ? 15.250  -2.663  -15.149 1.00 19.69 ? 125 PHE A O     1 
ATOM   1003 C  CB    . PHE C 3 34 ? 13.908  0.367   -15.826 1.00 26.43 ? 125 PHE A CB    1 
ATOM   1004 C  CG    . PHE C 3 34 ? 13.835  -0.258  -17.218 1.00 8.81  ? 125 PHE A CG    1 
ATOM   1005 C  CD1   . PHE C 3 34 ? 12.881  -1.228  -17.509 1.00 19.64 ? 125 PHE A CD1   1 
ATOM   1006 C  CD2   . PHE C 3 34 ? 14.768  0.056   -18.190 1.00 23.58 ? 125 PHE A CD2   1 
ATOM   1007 C  CE1   . PHE C 3 34 ? 12.862  -1.881  -18.728 1.00 17.74 ? 125 PHE A CE1   1 
ATOM   1008 C  CE2   . PHE C 3 34 ? 14.754  -0.600  -19.420 1.00 18.99 ? 125 PHE A CE2   1 
ATOM   1009 C  CZ    . PHE C 3 34 ? 13.799  -1.571  -19.680 1.00 18.58 ? 125 PHE A CZ    1 
ATOM   1010 N  N     . ARG C 3 35 ? 16.454  -0.851  -14.565 1.00 24.76 ? 126 ARG A N     1 
ATOM   1011 C  CA    . ARG C 3 35 ? 17.743  -1.547  -14.694 1.00 30.27 ? 126 ARG A CA    1 
ATOM   1012 C  C     . ARG C 3 35 ? 17.724  -2.827  -13.877 1.00 25.83 ? 126 ARG A C     1 
ATOM   1013 O  O     . ARG C 3 35 ? 18.224  -3.884  -14.291 1.00 18.85 ? 126 ARG A O     1 
ATOM   1014 C  CB    . ARG C 3 35 ? 18.918  -0.660  -14.240 1.00 28.85 ? 126 ARG A CB    1 
ATOM   1015 C  CG    . ARG C 3 35 ? 18.922  -0.290  -12.760 1.00 42.85 ? 126 ARG A CG    1 
ATOM   1016 C  CD    . ARG C 3 35 ? 20.268  -0.634  -12.063 1.00 43.35 ? 126 ARG A CD    1 
ATOM   1017 N  NE    . ARG C 3 35 ? 20.276  -0.205  -10.662 1.00 29.94 ? 126 ARG A NE    1 
ATOM   1018 C  CZ    . ARG C 3 35 ? 20.076  1.054   -10.274 1.00 32.45 ? 126 ARG A CZ    1 
ATOM   1019 N  NH1   . ARG C 3 35 ? 19.857  2.010   -11.181 1.00 21.15 ? 126 ARG A NH1   1 
ATOM   1020 N  NH2   . ARG C 3 35 ? 20.065  1.360   -8.982  1.00 11.57 ? 126 ARG A NH2   1 
ATOM   1021 N  N     . ARG C 3 36 ? 17.090  -2.741  -12.727 1.00 21.37 ? 127 ARG A N     1 
ATOM   1022 C  CA    . ARG C 3 36 ? 17.009  -3.888  -11.842 1.00 23.93 ? 127 ARG A CA    1 
ATOM   1023 C  C     . ARG C 3 36 ? 16.200  -5.022  -12.499 1.00 13.97 ? 127 ARG A C     1 
ATOM   1024 O  O     . ARG C 3 36 ? 16.489  -6.208  -12.323 1.00 16.70 ? 127 ARG A O     1 
ATOM   1025 C  CB    . ARG C 3 36 ? 16.383  -3.393  -10.528 1.00 16.59 ? 127 ARG A CB    1 
ATOM   1026 C  CG    . ARG C 3 36 ? 16.515  -4.244  -9.297  1.00 18.80 ? 127 ARG A CG    1 
ATOM   1027 C  CD    . ARG C 3 36 ? 15.757  -3.512  -8.192  1.00 16.26 ? 127 ARG A CD    1 
ATOM   1028 N  NE    . ARG C 3 36 ? 16.283  -2.163  -8.051  1.00 11.44 ? 127 ARG A NE    1 
ATOM   1029 C  CZ    . ARG C 3 36 ? 15.561  -1.099  -7.697  1.00 8.09  ? 127 ARG A CZ    1 
ATOM   1030 N  NH1   . ARG C 3 36 ? 14.266  -1.217  -7.449  1.00 14.10 ? 127 ARG A NH1   1 
ATOM   1031 N  NH2   . ARG C 3 36 ? 16.143  0.098   -7.558  1.00 9.85  ? 127 ARG A NH2   1 
ATOM   1032 N  N     . SER C 3 37 ? 15.216  -4.664  -13.308 1.00 15.72 ? 128 SER A N     1 
ATOM   1033 C  CA    . SER C 3 37 ? 14.345  -5.670  -13.922 1.00 21.72 ? 128 SER A CA    1 
ATOM   1034 C  C     . SER C 3 37 ? 14.951  -6.382  -15.113 1.00 32.55 ? 128 SER A C     1 
ATOM   1035 O  O     . SER C 3 37 ? 14.625  -7.549  -15.361 1.00 34.05 ? 128 SER A O     1 
ATOM   1036 C  CB    . SER C 3 37 ? 13.021  -5.029  -14.376 1.00 22.15 ? 128 SER A CB    1 
ATOM   1037 O  OG    . SER C 3 37 ? 12.434  -4.219  -13.363 1.00 18.83 ? 128 SER A OG    1 
ATOM   1038 N  N     . ILE C 3 38 ? 15.792  -5.672  -15.871 1.00 34.40 ? 129 ILE A N     1 
ATOM   1039 C  CA    . ILE C 3 38 ? 16.434  -6.238  -17.066 1.00 38.25 ? 129 ILE A CA    1 
ATOM   1040 C  C     . ILE C 3 38 ? 17.811  -6.795  -16.725 1.00 45.36 ? 129 ILE A C     1 
ATOM   1041 O  O     . ILE C 3 38 ? 18.267  -7.778  -17.326 1.00 52.33 ? 129 ILE A O     1 
ATOM   1042 C  CB    . ILE C 3 38 ? 16.679  -5.184  -18.185 1.00 27.75 ? 129 ILE A CB    1 
ATOM   1043 C  CG1   . ILE C 3 38 ? 17.542  -4.021  -17.688 1.00 24.37 ? 129 ILE A CG1   1 
ATOM   1044 C  CG2   . ILE C 3 38 ? 15.384  -4.568  -18.719 1.00 16.97 ? 129 ILE A CG2   1 
ATOM   1045 C  CD1   . ILE C 3 38 ? 17.746  -2.928  -18.732 1.00 29.81 ? 129 ILE A CD1   1 
ATOM   1046 N  N     . GLN C 3 39 ? 18.440  -6.150  -15.759 1.00 46.44 ? 130 GLN A N     1 
ATOM   1047 C  CA    . GLN C 3 39 ? 19.808  -6.499  -15.359 1.00 47.29 ? 130 GLN A CA    1 
ATOM   1048 C  C     . GLN C 3 39 ? 19.863  -7.718  -14.430 1.00 46.70 ? 130 GLN A C     1 
ATOM   1049 O  O     . GLN C 3 39 ? 20.722  -7.805  -13.541 1.00 50.59 ? 130 GLN A O     1 
ATOM   1050 C  CB    . GLN C 3 39 ? 20.499  -5.332  -14.673 1.00 50.29 ? 130 GLN A CB    1 
ATOM   1051 C  CG    . GLN C 3 39 ? 22.022  -5.462  -14.744 1.00 58.38 ? 130 GLN A CG    1 
ATOM   1052 C  CD    . GLN C 3 39 ? 22.594  -6.240  -13.562 1.00 64.09 ? 130 GLN A CD    1 
ATOM   1053 O  OE1   . GLN C 3 39 ? 23.064  -7.365  -13.727 1.00 67.41 ? 130 GLN A OE1   1 
ATOM   1054 N  NE2   . GLN C 3 39 ? 22.579  -5.698  -12.359 1.00 66.52 ? 130 GLN A NE2   1 
ATOM   1055 N  N     . GLN C 3 40 ? 18.951  -8.622  -14.680 1.00 50.99 ? 131 GLN A N     1 
ATOM   1056 C  CA    . GLN C 3 40 ? 18.897  -9.928  -14.004 1.00 63.34 ? 131 GLN A CA    1 
ATOM   1057 C  C     . GLN C 3 40 ? 17.743  -10.736 -14.609 1.00 67.43 ? 131 GLN A C     1 
ATOM   1058 O  O     . GLN C 3 40 ? 16.878  -10.182 -15.298 1.00 63.25 ? 131 GLN A O     1 
ATOM   1059 C  CB    . GLN C 3 40 ? 18.711  -9.753  -12.506 1.00 68.91 ? 131 GLN A CB    1 
ATOM   1060 C  CG    . GLN C 3 40 ? 17.539  -8.851  -12.166 1.00 68.19 ? 131 GLN A CG    1 
ATOM   1061 C  CD    . GLN C 3 40 ? 17.495  -8.493  -10.690 1.00 71.02 ? 131 GLN A CD    1 
ATOM   1062 O  OE1   . GLN C 3 40 ? 17.380  -9.382  -9.851  1.00 77.99 ? 131 GLN A OE1   1 
ATOM   1063 N  NE2   . GLN C 3 40 ? 17.584  -7.232  -10.320 1.00 68.18 ? 131 GLN A NE2   1 
ATOM   1064 N  N     . ASN C 3 41 ? 17.750  -12.045 -14.360 1.00 69.60 ? 132 ASN A N     1 
ATOM   1065 C  CA    . ASN C 3 41 ? 16.686  -12.953 -14.868 1.00 72.11 ? 132 ASN A CA    1 
ATOM   1066 C  C     . ASN C 3 41 ? 15.617  -13.248 -13.735 1.00 72.50 ? 132 ASN A C     1 
ATOM   1067 O  O     . ASN C 3 41 ? 15.158  -14.384 -13.570 1.00 72.97 ? 132 ASN A O     1 
ATOM   1068 C  CB    . ASN C 3 41 ? 17.284  -14.268 -15.366 1.00 71.75 ? 132 ASN A CB    1 
ATOM   1069 C  CG    . ASN C 3 41 ? 17.171  -14.422 -16.885 1.00 71.76 ? 132 ASN A CG    1 
ATOM   1070 O  OD1   . ASN C 3 41 ? 17.508  -15.473 -17.426 1.00 70.17 ? 132 ASN A OD1   1 
ATOM   1071 N  ND2   . ASN C 3 41 ? 16.709  -13.423 -17.617 1.00 69.01 ? 132 ASN A ND2   1 
ATOM   1072 N  N     . ILE C 3 42 ? 15.218  -12.201 -12.950 1.00 70.92 ? 133 ILE A N     1 
ATOM   1073 C  CA    . ILE C 3 42 ? 14.173  -12.309 -11.833 1.00 68.40 ? 133 ILE A CA    1 
ATOM   1074 C  C     . ILE C 3 42 ? 12.830  -12.677 -12.450 1.00 67.74 ? 133 ILE A C     1 
ATOM   1075 O  O     . ILE C 3 42 ? 12.540  -12.300 -13.580 1.00 68.12 ? 133 ILE A O     1 
ATOM   1076 C  CB    . ILE C 3 42 ? 14.049  -10.978 -11.091 1.00 66.15 ? 133 ILE A CB    1 
ATOM   1077 C  CG1   . ILE C 3 42 ? 14.352  -9.770  -11.977 1.00 62.62 ? 133 ILE A CG1   1 
ATOM   1078 C  CG2   . ILE C 3 42 ? 15.001  -10.871 -9.897  1.00 64.44 ? 133 ILE A CG2   1 
ATOM   1079 C  CD1   . ILE C 3 42 ? 14.277  -8.442  -11.221 1.00 67.38 ? 133 ILE A CD1   1 
ATOM   1080 N  N     . GLN C 3 43 A 12.050  -13.363 -11.698 1.00 68.35 ? 133 GLN A N     1 
ATOM   1081 C  CA    . GLN C 3 43 A 10.742  -13.802 -12.174 1.00 66.27 ? 133 GLN A CA    1 
ATOM   1082 C  C     . GLN C 3 43 A 9.602   -13.127 -11.411 1.00 64.14 ? 133 GLN A C     1 
ATOM   1083 O  O     . GLN C 3 43 A 8.815   -13.818 -10.763 1.00 72.24 ? 133 GLN A O     1 
ATOM   1084 C  CB    . GLN C 3 43 A 10.571  -15.314 -11.991 1.00 69.42 ? 133 GLN A CB    1 
ATOM   1085 C  CG    . GLN C 3 43 A 11.509  -16.218 -12.757 1.00 73.98 ? 133 GLN A CG    1 
ATOM   1086 C  CD    . GLN C 3 43 A 11.270  -17.705 -12.475 1.00 75.78 ? 133 GLN A CD    1 
ATOM   1087 O  OE1   . GLN C 3 43 A 10.911  -18.468 -13.374 1.00 75.63 ? 133 GLN A OE1   1 
ATOM   1088 N  NE2   . GLN C 3 43 A 11.474  -18.117 -11.224 1.00 75.79 ? 133 GLN A NE2   1 
ATOM   1089 N  N     . TYR C 3 44 ? 9.505   -11.802 -11.470 1.00 55.98 ? 134 TYR A N     1 
ATOM   1090 C  CA    . TYR C 3 44 ? 8.422   -11.098 -10.780 1.00 47.14 ? 134 TYR A CA    1 
ATOM   1091 C  C     . TYR C 3 44 ? 7.169   -11.981 -10.684 1.00 46.75 ? 134 TYR A C     1 
ATOM   1092 O  O     . TYR C 3 44 ? 6.674   -12.477 -11.693 1.00 44.99 ? 134 TYR A O     1 
ATOM   1093 C  CB    . TYR C 3 44 ? 8.103   -9.802  -11.531 1.00 41.04 ? 134 TYR A CB    1 
ATOM   1094 C  CG    . TYR C 3 44 ? 9.146   -8.708  -11.364 1.00 42.65 ? 134 TYR A CG    1 
ATOM   1095 C  CD1   . TYR C 3 44 ? 9.979   -8.684  -10.252 1.00 36.78 ? 134 TYR A CD1   1 
ATOM   1096 C  CD2   . TYR C 3 44 ? 9.268   -7.665  -12.296 1.00 40.46 ? 134 TYR A CD2   1 
ATOM   1097 C  CE1   . TYR C 3 44 ? 10.899  -7.665  -10.065 1.00 30.32 ? 134 TYR A CE1   1 
ATOM   1098 C  CE2   . TYR C 3 44 ? 10.198  -6.629  -12.111 1.00 29.69 ? 134 TYR A CE2   1 
ATOM   1099 C  CZ    . TYR C 3 44 ? 11.002  -6.649  -10.985 1.00 31.37 ? 134 TYR A CZ    1 
ATOM   1100 O  OH    . TYR C 3 44 ? 11.891  -5.649  -10.733 1.00 21.21 ? 134 TYR A OH    1 
ATOM   1101 N  N     . LYS C 3 45 ? 6.679   -12.199 -9.465  1.00 52.29 ? 135 LYS A N     1 
ATOM   1102 C  CA    . LYS C 3 45 ? 5.485   -13.028 -9.233  1.00 57.05 ? 135 LYS A CA    1 
ATOM   1103 C  C     . LYS C 3 45 ? 4.304   -12.635 -10.129 1.00 52.97 ? 135 LYS A C     1 
ATOM   1104 O  O     . LYS C 3 45 ? 4.099   -11.450 -10.397 1.00 53.12 ? 135 LYS A O     1 
ATOM   1105 C  CB    . LYS C 3 45 ? 5.072   -12.934 -7.757  1.00 62.91 ? 135 LYS A CB    1 
ATOM   1106 C  CG    . LYS C 3 45 ? 5.014   -11.501 -7.218  1.00 64.18 ? 135 LYS A CG    1 
ATOM   1107 C  CD    . LYS C 3 45 ? 4.477   -11.419 -5.785  1.00 61.20 ? 135 LYS A CD    1 
ATOM   1108 C  CE    . LYS C 3 45 ? 3.012   -11.818 -5.724  1.00 62.83 ? 135 LYS A CE    1 
ATOM   1109 N  NZ    . LYS C 3 45 ? 2.438   -11.661 -4.363  1.00 61.57 ? 135 LYS A NZ    1 
ATOM   1110 N  N     . ARG C 3 46 ? 3.527   -13.619 -10.585 1.00 51.19 ? 136 ARG A N     1 
ATOM   1111 C  CA    . ARG C 3 46 ? 2.378   -13.344 -11.461 1.00 53.65 ? 136 ARG A CA    1 
ATOM   1112 C  C     . ARG C 3 46 ? 1.593   -12.142 -10.929 1.00 52.71 ? 136 ARG A C     1 
ATOM   1113 O  O     . ARG C 3 46 ? 1.799   -11.718 -9.789  1.00 57.78 ? 136 ARG A O     1 
ATOM   1114 C  CB    . ARG C 3 46 ? 1.402   -14.527 -11.508 1.00 61.49 ? 136 ARG A CB    1 
ATOM   1115 C  CG    . ARG C 3 46 ? 1.942   -15.914 -11.857 1.00 61.36 ? 136 ARG A CG    1 
ATOM   1116 C  CD    . ARG C 3 46 ? 0.728   -16.837 -12.083 1.00 64.98 ? 136 ARG A CD    1 
ATOM   1117 N  NE    . ARG C 3 46 ? 1.043   -18.252 -12.285 1.00 62.84 ? 136 ARG A NE    1 
ATOM   1118 C  CZ    . ARG C 3 46 ? 0.189   -19.128 -12.811 1.00 60.71 ? 136 ARG A CZ    1 
ATOM   1119 N  NH1   . ARG C 3 46 ? -1.019  -18.728 -13.187 1.00 60.39 ? 136 ARG A NH1   1 
ATOM   1120 N  NH2   . ARG C 3 46 ? 0.534   -20.399 -12.963 1.00 62.32 ? 136 ARG A NH2   1 
ATOM   1121 N  N     . CYS C 3 47 ? 0.677   -11.599 -11.728 1.00 44.77 ? 137 CYS A N     1 
ATOM   1122 C  CA    . CYS C 3 47 ? -0.108  -10.468 -11.241 1.00 32.16 ? 137 CYS A CA    1 
ATOM   1123 C  C     . CYS C 3 47 ? -1.320  -10.930 -10.465 1.00 32.83 ? 137 CYS A C     1 
ATOM   1124 O  O     . CYS C 3 47 ? -1.895  -11.993 -10.726 1.00 22.05 ? 137 CYS A O     1 
ATOM   1125 C  CB    . CYS C 3 47 ? -0.580  -9.576  -12.374 1.00 35.88 ? 137 CYS A CB    1 
ATOM   1126 S  SG    . CYS C 3 47 ? -1.646  -8.220  -11.799 1.00 29.73 ? 137 CYS A SG    1 
ATOM   1127 N  N     . LEU C 3 48 ? -1.704  -10.127 -9.487  1.00 37.77 ? 138 LEU A N     1 
ATOM   1128 C  CA    . LEU C 3 48 ? -2.862  -10.455 -8.674  1.00 42.44 ? 138 LEU A CA    1 
ATOM   1129 C  C     . LEU C 3 48 ? -4.112  -9.914  -9.369  1.00 42.01 ? 138 LEU A C     1 
ATOM   1130 O  O     . LEU C 3 48 ? -4.927  -10.680 -9.880  1.00 48.12 ? 138 LEU A O     1 
ATOM   1131 C  CB    . LEU C 3 48 ? -2.710  -9.851  -7.261  1.00 41.53 ? 138 LEU A CB    1 
ATOM   1132 C  CG    . LEU C 3 48 ? -1.499  -10.320 -6.426  1.00 37.88 ? 138 LEU A CG    1 
ATOM   1133 C  CD1   . LEU C 3 48 ? -1.441  -9.600  -5.094  1.00 28.02 ? 138 LEU A CD1   1 
ATOM   1134 C  CD2   . LEU C 3 48 ? -1.576  -11.814 -6.217  1.00 33.65 ? 138 LEU A CD2   1 
ATOM   1135 N  N     . LYS C 3 49 ? -4.221  -8.593  -9.430  1.00 35.63 ? 139 LYS A N     1 
ATOM   1136 C  CA    . LYS C 3 49 ? -5.369  -7.927  -10.017 1.00 33.89 ? 139 LYS A CA    1 
ATOM   1137 C  C     . LYS C 3 49 ? -5.534  -7.981  -11.550 1.00 35.85 ? 139 LYS A C     1 
ATOM   1138 O  O     . LYS C 3 49 ? -5.623  -6.946  -12.217 1.00 34.72 ? 139 LYS A O     1 
ATOM   1139 C  CB    . LYS C 3 49 ? -5.374  -6.478  -9.520  1.00 33.26 ? 139 LYS A CB    1 
ATOM   1140 C  CG    . LYS C 3 49 ? -4.919  -6.387  -8.070  1.00 33.87 ? 139 LYS A CG    1 
ATOM   1141 C  CD    . LYS C 3 49 ? -5.179  -5.037  -7.421  1.00 40.04 ? 139 LYS A CD    1 
ATOM   1142 C  CE    . LYS C 3 49 ? -6.626  -4.918  -6.950  1.00 51.89 ? 139 LYS A CE    1 
ATOM   1143 N  NZ    . LYS C 3 49 ? -7.643  -5.062  -8.042  1.00 47.31 ? 139 LYS A NZ    1 
ATOM   1144 N  N     . ASN C 3 50 ? -5.599  -9.180  -12.115 1.00 31.50 ? 140 ASN A N     1 
ATOM   1145 C  CA    . ASN C 3 50 ? -5.778  -9.324  -13.563 1.00 42.62 ? 140 ASN A CA    1 
ATOM   1146 C  C     . ASN C 3 50 ? -4.907  -8.427  -14.509 1.00 45.80 ? 140 ASN A C     1 
ATOM   1147 O  O     . ASN C 3 50 ? -5.423  -7.794  -15.441 1.00 48.49 ? 140 ASN A O     1 
ATOM   1148 C  CB    . ASN C 3 50 ? -7.243  -9.087  -13.936 1.00 43.29 ? 140 ASN A CB    1 
ATOM   1149 C  CG    . ASN C 3 50 ? -7.704  -7.667  -13.621 1.00 51.22 ? 140 ASN A CG    1 
ATOM   1150 O  OD1   . ASN C 3 50 ? -8.557  -7.477  -12.757 1.00 57.76 ? 140 ASN A OD1   1 
ATOM   1151 N  ND2   . ASN C 3 50 ? -7.178  -6.649  -14.275 1.00 41.71 ? 140 ASN A ND2   1 
ATOM   1152 N  N     . GLU C 3 51 ? -3.605  -8.431  -14.273 1.00 42.38 ? 141 GLU A N     1 
ATOM   1153 C  CA    . GLU C 3 51 ? -2.560  -7.764  -15.122 1.00 33.31 ? 141 GLU A CA    1 
ATOM   1154 C  C     . GLU C 3 51 ? -2.907  -6.357  -15.706 1.00 32.94 ? 141 GLU A C     1 
ATOM   1155 O  O     . GLU C 3 51 ? -2.275  -5.885  -16.665 1.00 33.42 ? 141 GLU A O     1 
ATOM   1156 C  CB    . GLU C 3 51 ? -2.246  -8.635  -16.345 1.00 25.63 ? 141 GLU A CB    1 
ATOM   1157 C  CG    . GLU C 3 51 ? -1.521  -9.928  -15.973 1.00 27.60 ? 141 GLU A CG    1 
ATOM   1158 C  CD    . GLU C 3 51 ? -1.641  -11.008 -17.043 1.00 37.41 ? 141 GLU A CD    1 
ATOM   1159 O  OE1   . GLU C 3 51 ? -1.511  -10.695 -18.285 1.00 49.48 ? 141 GLU A OE1   1 
ATOM   1160 O  OE2   . GLU C 3 51 ? -1.869  -12.229 -16.700 1.00 34.53 ? 141 GLU A OE2   1 
ATOM   1161 N  N     . ASN C 3 52 ? -3.880  -5.645  -15.150 1.00 32.30 ? 142 ASN A N     1 
ATOM   1162 C  CA    . ASN C 3 52 ? -4.234  -4.286  -15.668 1.00 35.29 ? 142 ASN A CA    1 
ATOM   1163 C  C     . ASN C 3 52 ? -3.996  -3.241  -14.614 1.00 33.75 ? 142 ASN A C     1 
ATOM   1164 O  O     . ASN C 3 52 ? -4.828  -2.348  -14.407 1.00 36.12 ? 142 ASN A O     1 
ATOM   1165 C  CB    . ASN C 3 52 ? -5.696  -4.250  -16.096 1.00 45.18 ? 142 ASN A CB    1 
ATOM   1166 C  CG    . ASN C 3 52 ? -5.979  -5.197  -17.256 1.00 52.01 ? 142 ASN A CG    1 
ATOM   1167 O  OD1   . ASN C 3 52 ? -5.106  -5.980  -17.633 1.00 62.08 ? 142 ASN A OD1   1 
ATOM   1168 N  ND2   . ASN C 3 52 ? -7.156  -5.178  -17.848 1.00 62.38 ? 142 ASN A ND2   1 
ATOM   1169 N  N     . CYS C 3 53 ? -2.855  -3.341  -13.951 1.00 33.92 ? 143 CYS A N     1 
ATOM   1170 C  CA    . CYS C 3 53 ? -2.535  -2.406  -12.885 1.00 29.07 ? 143 CYS A CA    1 
ATOM   1171 C  C     . CYS C 3 53 ? -2.186  -0.996  -13.296 1.00 26.89 ? 143 CYS A C     1 
ATOM   1172 O  O     . CYS C 3 53 ? -1.409  -0.763  -14.217 1.00 32.61 ? 143 CYS A O     1 
ATOM   1173 C  CB    . CYS C 3 53 ? -1.400  -2.940  -12.025 1.00 32.25 ? 143 CYS A CB    1 
ATOM   1174 S  SG    . CYS C 3 53 ? -1.823  -4.327  -10.946 1.00 18.24 ? 143 CYS A SG    1 
ATOM   1175 N  N     . SER C 3 54 ? -2.798  -0.061  -12.595 1.00 16.13 ? 144 SER A N     1 
ATOM   1176 C  CA    . SER C 3 54 ? -2.565  1.347   -12.767 1.00 16.81 ? 144 SER A CA    1 
ATOM   1177 C  C     . SER C 3 54 ? -1.145  1.497   -12.213 1.00 20.55 ? 144 SER A C     1 
ATOM   1178 O  O     . SER C 3 54 ? -0.657  0.584   -11.553 1.00 33.88 ? 144 SER A O     1 
ATOM   1179 C  CB    . SER C 3 54 ? -3.576  2.106   -11.891 1.00 10.05 ? 144 SER A CB    1 
ATOM   1180 O  OG    . SER C 3 54 ? -3.232  3.468   -11.699 1.00 26.80 ? 144 SER A OG    1 
ATOM   1181 N  N     . ILE C 3 55 ? -0.482  2.621   -12.475 1.00 20.08 ? 145 ILE A N     1 
ATOM   1182 C  CA    . ILE C 3 55 ? 0.875   2.868   -11.957 1.00 13.57 ? 145 ILE A CA    1 
ATOM   1183 C  C     . ILE C 3 55 ? 1.047   4.363   -11.780 1.00 5.23  ? 145 ILE A C     1 
ATOM   1184 O  O     . ILE C 3 55 ? 1.131   5.101   -12.750 1.00 14.21 ? 145 ILE A O     1 
ATOM   1185 C  CB    . ILE C 3 55 ? 1.994   2.424   -12.912 1.00 15.12 ? 145 ILE A CB    1 
ATOM   1186 C  CG1   . ILE C 3 55 ? 1.948   0.917   -13.193 1.00 5.04  ? 145 ILE A CG1   1 
ATOM   1187 C  CG2   . ILE C 3 55 ? 3.320   2.761   -12.282 1.00 14.12 ? 145 ILE A CG2   1 
ATOM   1188 C  CD1   . ILE C 3 55 ? 2.294   0.099   -12.015 1.00 14.61 ? 145 ILE A CD1   1 
ATOM   1189 N  N     . VAL C 3 56 ? 1.122   4.815   -10.540 1.00 4.51  ? 146 VAL A N     1 
ATOM   1190 C  CA    . VAL C 3 56 ? 1.252   6.228   -10.276 1.00 2.00  ? 146 VAL A CA    1 
ATOM   1191 C  C     . VAL C 3 56 ? 2.185   6.402   -9.080  1.00 2.00  ? 146 VAL A C     1 
ATOM   1192 O  O     . VAL C 3 56 ? 2.541   5.426   -8.418  1.00 20.47 ? 146 VAL A O     1 
ATOM   1193 C  CB    . VAL C 3 56 ? -0.159  6.812   -9.997  1.00 19.42 ? 146 VAL A CB    1 
ATOM   1194 C  CG1   . VAL C 3 56 ? -0.163  8.296   -10.158 1.00 21.40 ? 146 VAL A CG1   1 
ATOM   1195 C  CG2   . VAL C 3 56 ? -1.162  6.199   -10.947 1.00 13.21 ? 146 VAL A CG2   1 
ATOM   1196 N  N     . ARG C 3 57 ? 2.563   7.636   -8.779  1.00 7.86  ? 147 ARG A N     1 
ATOM   1197 C  CA    . ARG C 3 57 ? 3.488   7.896   -7.685  1.00 26.84 ? 147 ARG A CA    1 
ATOM   1198 C  C     . ARG C 3 57 ? 3.065   7.371   -6.315  1.00 32.78 ? 147 ARG A C     1 
ATOM   1199 O  O     . ARG C 3 57 ? 3.910   7.162   -5.444  1.00 41.11 ? 147 ARG A O     1 
ATOM   1200 C  CB    . ARG C 3 57 ? 3.761   9.396   -7.580  1.00 28.51 ? 147 ARG A CB    1 
ATOM   1201 C  CG    . ARG C 3 57 ? 4.770   9.796   -6.502  1.00 28.70 ? 147 ARG A CG    1 
ATOM   1202 C  CD    . ARG C 3 57 ? 4.731   11.294  -6.341  1.00 34.51 ? 147 ARG A CD    1 
ATOM   1203 N  NE    . ARG C 3 57 ? 5.584   11.793  -5.274  1.00 47.01 ? 147 ARG A NE    1 
ATOM   1204 C  CZ    . ARG C 3 57 ? 5.684   13.084  -4.953  1.00 58.08 ? 147 ARG A CZ    1 
ATOM   1205 N  NH1   . ARG C 3 57 ? 4.980   13.998  -5.620  1.00 56.55 ? 147 ARG A NH1   1 
ATOM   1206 N  NH2   . ARG C 3 57 ? 6.495   13.470  -3.971  1.00 60.68 ? 147 ARG A NH2   1 
ATOM   1207 N  N     . ILE C 3 58 ? 1.770   7.148   -6.131  1.00 31.43 ? 148 ILE A N     1 
ATOM   1208 C  CA    . ILE C 3 58 ? 1.240   6.687   -4.859  1.00 15.77 ? 148 ILE A CA    1 
ATOM   1209 C  C     . ILE C 3 58 ? 1.181   5.148   -4.778  1.00 8.06  ? 148 ILE A C     1 
ATOM   1210 O  O     . ILE C 3 58 ? 1.366   4.557   -3.717  1.00 12.46 ? 148 ILE A O     1 
ATOM   1211 C  CB    . ILE C 3 58 ? -0.157  7.404   -4.630  1.00 21.29 ? 148 ILE A CB    1 
ATOM   1212 C  CG1   . ILE C 3 58 ? -0.111  8.159   -3.315  1.00 19.32 ? 148 ILE A CG1   1 
ATOM   1213 C  CG2   . ILE C 3 58 ? -1.339  6.429   -4.696  1.00 7.05  ? 148 ILE A CG2   1 
ATOM   1214 C  CD1   . ILE C 3 58 ? 1.017   9.188   -3.207  1.00 19.62 ? 148 ILE A CD1   1 
ATOM   1215 N  N     . ASN C 3 59 ? 0.940   4.475   -5.889  1.00 8.23  ? 149 ASN A N     1 
ATOM   1216 C  CA    . ASN C 3 59 ? 0.899   3.021   -5.817  1.00 8.32  ? 149 ASN A CA    1 
ATOM   1217 C  C     . ASN C 3 59 ? 1.869   2.321   -6.785  1.00 20.05 ? 149 ASN A C     1 
ATOM   1218 O  O     . ASN C 3 59 ? 1.625   1.157   -7.142  1.00 14.12 ? 149 ASN A O     1 
ATOM   1219 C  CB    . ASN C 3 59 ? -0.501  2.500   -6.107  1.00 11.98 ? 149 ASN A CB    1 
ATOM   1220 C  CG    . ASN C 3 59 ? -0.891  2.619   -7.581  1.00 13.39 ? 149 ASN A CG    1 
ATOM   1221 O  OD1   . ASN C 3 59 ? -1.280  1.627   -8.222  1.00 20.58 ? 149 ASN A OD1   1 
ATOM   1222 N  ND2   . ASN C 3 59 ? -0.818  3.828   -8.115  1.00 23.17 ? 149 ASN A ND2   1 
ATOM   1223 N  N     . ARG C 3 60 ? 2.964   2.983   -7.188  1.00 12.02 ? 150 ARG A N     1 
ATOM   1224 C  CA    . ARG C 3 60 ? 3.885   2.348   -8.158  1.00 20.18 ? 150 ARG A CA    1 
ATOM   1225 C  C     . ARG C 3 60 ? 4.509   1.045   -7.683  1.00 13.83 ? 150 ARG A C     1 
ATOM   1226 O  O     . ARG C 3 60 ? 4.821   0.190   -8.502  1.00 17.18 ? 150 ARG A O     1 
ATOM   1227 C  CB    . ARG C 3 60 ? 4.995   3.322   -8.639  1.00 12.75 ? 150 ARG A CB    1 
ATOM   1228 C  CG    . ARG C 3 60 ? 6.105   3.657   -7.646  1.00 8.71  ? 150 ARG A CG    1 
ATOM   1229 C  CD    . ARG C 3 60 ? 6.854   4.920   -8.080  1.00 8.94  ? 150 ARG A CD    1 
ATOM   1230 N  NE    . ARG C 3 60 ? 7.752   5.395   -7.042  1.00 2.00  ? 150 ARG A NE    1 
ATOM   1231 C  CZ    . ARG C 3 60 ? 8.230   6.619   -6.993  1.00 2.00  ? 150 ARG A CZ    1 
ATOM   1232 N  NH1   . ARG C 3 60 ? 7.897   7.477   -7.923  1.00 2.00  ? 150 ARG A NH1   1 
ATOM   1233 N  NH2   . ARG C 3 60 ? 8.992   7.001   -5.975  1.00 4.39  ? 150 ARG A NH2   1 
ATOM   1234 N  N     . ASN C 3 61 ? 4.632   0.841   -6.374  1.00 16.69 ? 151 ASN A N     1 
ATOM   1235 C  CA    . ASN C 3 61 ? 5.253   -0.404  -5.901  1.00 19.00 ? 151 ASN A CA    1 
ATOM   1236 C  C     . ASN C 3 61 ? 4.395   -1.618  -5.612  1.00 22.08 ? 151 ASN A C     1 
ATOM   1237 O  O     . ASN C 3 61 ? 4.935   -2.642  -5.184  1.00 20.48 ? 151 ASN A O     1 
ATOM   1238 C  CB    . ASN C 3 61 ? 6.070   -0.153  -4.648  1.00 6.78  ? 151 ASN A CB    1 
ATOM   1239 C  CG    . ASN C 3 61 ? 7.106   0.890   -4.894  1.00 19.80 ? 151 ASN A CG    1 
ATOM   1240 O  OD1   . ASN C 3 61 ? 8.091   0.657   -5.600  1.00 9.37  ? 151 ASN A OD1   1 
ATOM   1241 N  ND2   . ASN C 3 61 ? 6.908   2.064   -4.297  1.00 20.45 ? 151 ASN A ND2   1 
ATOM   1242 N  N     . ARG C 3 62 ? 3.092   -1.542  -5.859  1.00 20.73 ? 152 ARG A N     1 
ATOM   1243 C  CA    . ARG C 3 62 ? 2.205   -2.647  -5.519  1.00 11.48 ? 152 ARG A CA    1 
ATOM   1244 C  C     . ARG C 3 62 ? 2.286   -3.834  -6.435  1.00 16.32 ? 152 ARG A C     1 
ATOM   1245 O  O     . ARG C 3 62 ? 2.249   -4.963  -5.976  1.00 23.54 ? 152 ARG A O     1 
ATOM   1246 C  CB    . ARG C 3 62 ? 0.757   -2.117  -5.383  1.00 7.04  ? 152 ARG A CB    1 
ATOM   1247 C  CG    . ARG C 3 62 ? 0.719   -0.933  -4.397  1.00 16.84 ? 152 ARG A CG    1 
ATOM   1248 C  CD    . ARG C 3 62 ? -0.632  -0.376  -3.997  1.00 20.06 ? 152 ARG A CD    1 
ATOM   1249 N  NE    . ARG C 3 62 ? -0.459  0.776   -3.101  1.00 17.42 ? 152 ARG A NE    1 
ATOM   1250 C  CZ    . ARG C 3 62 ? -1.415  1.648   -2.767  1.00 22.15 ? 152 ARG A CZ    1 
ATOM   1251 N  NH1   . ARG C 3 62 ? -2.646  1.524   -3.240  1.00 23.06 ? 152 ARG A NH1   1 
ATOM   1252 N  NH2   . ARG C 3 62 ? -1.132  2.689   -1.996  1.00 20.42 ? 152 ARG A NH2   1 
ATOM   1253 N  N     . CYS C 3 63 ? 2.380   -3.611  -7.739  1.00 21.30 ? 153 CYS A N     1 
ATOM   1254 C  CA    . CYS C 3 63 ? 2.481   -4.747  -8.650  1.00 25.84 ? 153 CYS A CA    1 
ATOM   1255 C  C     . CYS C 3 63 ? 3.797   -4.579  -9.410  1.00 32.66 ? 153 CYS A C     1 
ATOM   1256 O  O     . CYS C 3 63 ? 4.015   -3.545  -10.050 1.00 33.67 ? 153 CYS A O     1 
ATOM   1257 C  CB    . CYS C 3 63 ? 1.307   -4.772  -9.629  1.00 17.16 ? 153 CYS A CB    1 
ATOM   1258 S  SG    . CYS C 3 63 ? 1.295   -6.263  -10.661 1.00 15.72 ? 153 CYS A SG    1 
ATOM   1259 N  N     . GLN C 3 64 ? 4.679   -5.573  -9.335  1.00 24.86 ? 154 GLN A N     1 
ATOM   1260 C  CA    . GLN C 3 64 ? 5.961   -5.439  -10.022 1.00 29.00 ? 154 GLN A CA    1 
ATOM   1261 C  C     . GLN C 3 64 ? 5.889   -5.843  -11.484 1.00 26.14 ? 154 GLN A C     1 
ATOM   1262 O  O     . GLN C 3 64 ? 6.627   -5.314  -12.299 1.00 22.86 ? 154 GLN A O     1 
ATOM   1263 C  CB    . GLN C 3 64 ? 7.053   -6.249  -9.316  1.00 18.04 ? 154 GLN A CB    1 
ATOM   1264 C  CG    . GLN C 3 64 ? 7.290   -5.827  -7.899  1.00 12.03 ? 154 GLN A CG    1 
ATOM   1265 C  CD    . GLN C 3 64 ? 8.321   -6.701  -7.196  1.00 14.52 ? 154 GLN A CD    1 
ATOM   1266 O  OE1   . GLN C 3 64 ? 8.274   -7.945  -7.291  1.00 2.00  ? 154 GLN A OE1   1 
ATOM   1267 N  NE2   . GLN C 3 64 ? 9.243   -6.055  -6.455  1.00 12.35 ? 154 GLN A NE2   1 
ATOM   1268 N  N     . GLN C 3 65 ? 5.003   -6.773  -11.810 1.00 22.53 ? 155 GLN A N     1 
ATOM   1269 C  CA    . GLN C 3 65 ? 4.867   -7.213  -13.183 1.00 25.78 ? 155 GLN A CA    1 
ATOM   1270 C  C     . GLN C 3 65 ? 4.271   -6.051  -13.966 1.00 30.95 ? 155 GLN A C     1 
ATOM   1271 O  O     . GLN C 3 65 ? 4.689   -5.776  -15.088 1.00 31.71 ? 155 GLN A O     1 
ATOM   1272 C  CB    . GLN C 3 65 ? 3.938   -8.420  -13.258 1.00 31.50 ? 155 GLN A CB    1 
ATOM   1273 C  CG    . GLN C 3 65 ? 4.079   -9.263  -14.510 1.00 34.84 ? 155 GLN A CG    1 
ATOM   1274 C  CD    . GLN C 3 65 ? 3.009   -10.349 -14.512 1.00 35.79 ? 155 GLN A CD    1 
ATOM   1275 O  OE1   . GLN C 3 65 ? 1.967   -10.212 -13.875 1.00 41.50 ? 155 GLN A OE1   1 
ATOM   1276 N  NE2   . GLN C 3 65 ? 3.279   -11.444 -15.206 1.00 35.32 ? 155 GLN A NE2   1 
ATOM   1277 N  N     . CYS C 3 66 ? 3.304   -5.356  -13.369 1.00 23.67 ? 156 CYS A N     1 
ATOM   1278 C  CA    . CYS C 3 66 ? 2.670   -4.230  -14.047 1.00 24.14 ? 156 CYS A CA    1 
ATOM   1279 C  C     . CYS C 3 66 ? 3.536   -2.961  -14.104 1.00 24.33 ? 156 CYS A C     1 
ATOM   1280 O  O     . CYS C 3 66 ? 3.408   -2.158  -15.048 1.00 22.97 ? 156 CYS A O     1 
ATOM   1281 C  CB    . CYS C 3 66 ? 1.298   -3.887  -13.420 1.00 16.31 ? 156 CYS A CB    1 
ATOM   1282 S  SG    . CYS C 3 66 ? -0.065  -5.089  -13.659 1.00 39.26 ? 156 CYS A SG    1 
ATOM   1283 N  N     . ARG C 3 67 ? 4.387   -2.731  -13.106 1.00 13.24 ? 157 ARG A N     1 
ATOM   1284 C  CA    . ARG C 3 67 ? 5.208   -1.528  -13.192 1.00 22.93 ? 157 ARG A CA    1 
ATOM   1285 C  C     . ARG C 3 67 ? 6.260   -1.728  -14.300 1.00 33.23 ? 157 ARG A C     1 
ATOM   1286 O  O     . ARG C 3 67 ? 6.660   -0.780  -14.979 1.00 35.82 ? 157 ARG A O     1 
ATOM   1287 C  CB    . ARG C 3 67 ? 5.934   -1.236  -11.889 1.00 16.62 ? 157 ARG A CB    1 
ATOM   1288 C  CG    . ARG C 3 67 ? 6.869   -0.038  -12.014 1.00 14.35 ? 157 ARG A CG    1 
ATOM   1289 C  CD    . ARG C 3 67 ? 7.758   0.128   -10.805 1.00 3.11  ? 157 ARG A CD    1 
ATOM   1290 N  NE    . ARG C 3 67 ? 8.288   1.489   -10.746 1.00 3.50  ? 157 ARG A NE    1 
ATOM   1291 C  CZ    . ARG C 3 67 ? 8.888   1.988   -9.679  1.00 3.40  ? 157 ARG A CZ    1 
ATOM   1292 N  NH1   . ARG C 3 67 ? 9.032   1.215   -8.600  1.00 3.33  ? 157 ARG A NH1   1 
ATOM   1293 N  NH2   . ARG C 3 67 ? 9.269   3.254   -9.655  1.00 2.00  ? 157 ARG A NH2   1 
ATOM   1294 N  N     . PHE C 3 68 ? 6.697   -2.972  -14.475 1.00 27.32 ? 158 PHE A N     1 
ATOM   1295 C  CA    . PHE C 3 68 ? 7.687   -3.296  -15.477 1.00 33.88 ? 158 PHE A CA    1 
ATOM   1296 C  C     . PHE C 3 68 ? 7.059   -3.285  -16.854 1.00 34.98 ? 158 PHE A C     1 
ATOM   1297 O  O     . PHE C 3 68 ? 7.580   -2.639  -17.759 1.00 43.03 ? 158 PHE A O     1 
ATOM   1298 C  CB    . PHE C 3 68 ? 8.291   -4.667  -15.196 1.00 30.79 ? 158 PHE A CB    1 
ATOM   1299 C  CG    . PHE C 3 68 ? 9.423   -5.019  -16.099 1.00 34.51 ? 158 PHE A CG    1 
ATOM   1300 C  CD1   . PHE C 3 68 ? 10.417  -4.084  -16.379 1.00 30.84 ? 158 PHE A CD1   1 
ATOM   1301 C  CD2   . PHE C 3 68 ? 9.522   -6.288  -16.646 1.00 33.08 ? 158 PHE A CD2   1 
ATOM   1302 C  CE1   . PHE C 3 68 ? 11.482  -4.407  -17.183 1.00 24.36 ? 158 PHE A CE1   1 
ATOM   1303 C  CE2   . PHE C 3 68 ? 10.600  -6.622  -17.460 1.00 34.52 ? 158 PHE A CE2   1 
ATOM   1304 C  CZ    . PHE C 3 68 ? 11.577  -5.678  -17.726 1.00 30.52 ? 158 PHE A CZ    1 
ATOM   1305 N  N     . LYS C 3 69 ? 5.941   -3.997  -16.995 1.00 32.80 ? 159 LYS A N     1 
ATOM   1306 C  CA    . LYS C 3 69 ? 5.191   -4.092  -18.256 1.00 27.24 ? 159 LYS A CA    1 
ATOM   1307 C  C     . LYS C 3 69 ? 4.897   -2.674  -18.732 1.00 22.42 ? 159 LYS A C     1 
ATOM   1308 O  O     . LYS C 3 69 ? 4.959   -2.354  -19.922 1.00 22.67 ? 159 LYS A O     1 
ATOM   1309 C  CB    . LYS C 3 69 ? 3.873   -4.824  -18.022 1.00 13.20 ? 159 LYS A CB    1 
ATOM   1310 C  CG    . LYS C 3 69 ? 3.190   -5.364  -19.247 1.00 29.06 ? 159 LYS A CG    1 
ATOM   1311 C  CD    . LYS C 3 69 ? 1.690   -5.445  -19.015 1.00 22.93 ? 159 LYS A CD    1 
ATOM   1312 C  CE    . LYS C 3 69 ? 1.100   -4.030  -18.903 1.00 38.90 ? 159 LYS A CE    1 
ATOM   1313 N  NZ    . LYS C 3 69 ? 1.718   -3.164  -17.839 1.00 29.76 ? 159 LYS A NZ    1 
ATOM   1314 N  N     . LYS C 3 70 ? 4.584   -1.815  -17.783 1.00 13.41 ? 160 LYS A N     1 
ATOM   1315 C  CA    . LYS C 3 70 ? 4.309   -0.428  -18.117 1.00 19.74 ? 160 LYS A CA    1 
ATOM   1316 C  C     . LYS C 3 70 ? 5.601   0.198   -18.641 1.00 21.43 ? 160 LYS A C     1 
ATOM   1317 O  O     . LYS C 3 70 ? 5.595   0.909   -19.652 1.00 30.41 ? 160 LYS A O     1 
ATOM   1318 C  CB    . LYS C 3 70 ? 3.825   0.327   -16.874 1.00 2.00  ? 160 LYS A CB    1 
ATOM   1319 C  CG    . LYS C 3 70 ? 3.499   1.791   -17.104 1.00 12.63 ? 160 LYS A CG    1 
ATOM   1320 C  CD    . LYS C 3 70 ? 2.288   1.972   -17.975 1.00 17.33 ? 160 LYS A CD    1 
ATOM   1321 C  CE    . LYS C 3 70 ? 1.974   3.459   -18.122 1.00 21.35 ? 160 LYS A CE    1 
ATOM   1322 N  NZ    . LYS C 3 70 ? 1.664   4.122   -16.809 1.00 20.00 ? 160 LYS A NZ    1 
ATOM   1323 N  N     . CYS C 3 71 ? 6.705   -0.030  -17.933 1.00 22.97 ? 161 CYS A N     1 
ATOM   1324 C  CA    . CYS C 3 71 ? 8.000   0.501   -18.373 1.00 17.11 ? 161 CYS A CA    1 
ATOM   1325 C  C     . CYS C 3 71 ? 8.199   0.081   -19.834 1.00 12.78 ? 161 CYS A C     1 
ATOM   1326 O  O     . CYS C 3 71 ? 8.526   0.910   -20.683 1.00 13.29 ? 161 CYS A O     1 
ATOM   1327 C  CB    . CYS C 3 71 ? 9.135   -0.033  -17.490 1.00 11.97 ? 161 CYS A CB    1 
ATOM   1328 S  SG    . CYS C 3 71 ? 9.393   0.912   -15.972 1.00 22.31 ? 161 CYS A SG    1 
ATOM   1329 N  N     . LEU C 3 72 ? 7.955   -1.196  -20.123 1.00 12.57 ? 162 LEU A N     1 
ATOM   1330 C  CA    . LEU C 3 72 ? 8.084   -1.701  -21.473 1.00 9.43  ? 162 LEU A CA    1 
ATOM   1331 C  C     . LEU C 3 72 ? 6.915   -1.304  -22.357 1.00 19.91 ? 162 LEU A C     1 
ATOM   1332 O  O     . LEU C 3 72 ? 6.442   -2.125  -23.150 1.00 32.55 ? 162 LEU A O     1 
ATOM   1333 C  CB    . LEU C 3 72 ? 8.117   -3.213  -21.502 1.00 2.00  ? 162 LEU A CB    1 
ATOM   1334 C  CG    . LEU C 3 72 ? 9.091   -3.998  -20.680 1.00 18.49 ? 162 LEU A CG    1 
ATOM   1335 C  CD1   . LEU C 3 72 ? 8.923   -5.444  -21.120 1.00 18.06 ? 162 LEU A CD1   1 
ATOM   1336 C  CD2   . LEU C 3 72 ? 10.496  -3.501  -20.892 1.00 25.70 ? 162 LEU A CD2   1 
ATOM   1337 N  N     . SER C 3 73 ? 6.406   -0.092  -22.231 1.00 24.51 ? 163 SER A N     1 
ATOM   1338 C  CA    . SER C 3 73 ? 5.298   0.292   -23.095 1.00 24.84 ? 163 SER A CA    1 
ATOM   1339 C  C     . SER C 3 73 ? 5.429   1.748   -23.387 1.00 26.59 ? 163 SER A C     1 
ATOM   1340 O  O     . SER C 3 73 ? 4.931   2.243   -24.405 1.00 34.80 ? 163 SER A O     1 
ATOM   1341 C  CB    . SER C 3 73 ? 3.945   0.034   -22.457 1.00 22.64 ? 163 SER A CB    1 
ATOM   1342 O  OG    . SER C 3 73 ? 3.658   -1.334  -22.291 1.00 35.63 ? 163 SER A OG    1 
ATOM   1343 N  N     . VAL C 3 74 ? 6.096   2.452   -22.488 1.00 10.26 ? 164 VAL A N     1 
ATOM   1344 C  CA    . VAL C 3 74 ? 6.295   3.849   -22.739 1.00 16.94 ? 164 VAL A CA    1 
ATOM   1345 C  C     . VAL C 3 74 ? 7.599   3.910   -23.534 1.00 12.64 ? 164 VAL A C     1 
ATOM   1346 O  O     . VAL C 3 74 ? 8.167   4.962   -23.756 1.00 16.30 ? 164 VAL A O     1 
ATOM   1347 C  CB    . VAL C 3 74 ? 6.365   4.618   -21.430 1.00 22.64 ? 164 VAL A CB    1 
ATOM   1348 C  CG1   . VAL C 3 74 ? 5.019   4.497   -20.704 1.00 17.50 ? 164 VAL A CG1   1 
ATOM   1349 C  CG2   . VAL C 3 74 ? 7.486   4.072   -20.571 1.00 26.03 ? 164 VAL A CG2   1 
ATOM   1350 N  N     . GLY C 3 75 ? 8.051   2.738   -23.954 1.00 13.62 ? 165 GLY A N     1 
ATOM   1351 C  CA    . GLY C 3 75 ? 9.265   2.633   -24.733 1.00 19.96 ? 165 GLY A CA    1 
ATOM   1352 C  C     . GLY C 3 75 ? 10.590  2.629   -23.998 1.00 30.30 ? 165 GLY A C     1 
ATOM   1353 O  O     . GLY C 3 75 ? 11.609  2.960   -24.608 1.00 23.79 ? 165 GLY A O     1 
ATOM   1354 N  N     . MET C 3 76 ? 10.608  2.283   -22.706 1.00 31.61 ? 166 MET A N     1 
ATOM   1355 C  CA    . MET C 3 76 ? 11.881  2.246   -21.995 1.00 20.44 ? 166 MET A CA    1 
ATOM   1356 C  C     . MET C 3 76 ? 12.681  1.094   -22.547 1.00 16.51 ? 166 MET A C     1 
ATOM   1357 O  O     . MET C 3 76 ? 12.116  0.052   -22.869 1.00 11.22 ? 166 MET A O     1 
ATOM   1358 C  CB    . MET C 3 76 ? 11.704  2.073   -20.486 1.00 22.01 ? 166 MET A CB    1 
ATOM   1359 C  CG    . MET C 3 76 ? 11.344  3.345   -19.724 1.00 22.78 ? 166 MET A CG    1 
ATOM   1360 S  SD    . MET C 3 76 ? 11.357  3.021   -17.955 1.00 21.66 ? 166 MET A SD    1 
ATOM   1361 C  CE    . MET C 3 76 ? 12.853  3.858   -17.356 1.00 7.74  ? 166 MET A CE    1 
ATOM   1362 N  N     . SER C 3 77 ? 13.993  1.309   -22.691 1.00 24.62 ? 167 SER A N     1 
ATOM   1363 C  CA    . SER C 3 77 ? 14.930  0.289   -23.213 1.00 29.93 ? 167 SER A CA    1 
ATOM   1364 C  C     . SER C 3 77 ? 16.374  0.794   -23.189 1.00 25.13 ? 167 SER A C     1 
ATOM   1365 O  O     . SER C 3 77 ? 16.620  2.010   -23.102 1.00 15.64 ? 167 SER A O     1 
ATOM   1366 C  CB    . SER C 3 77 ? 14.564  -0.119  -24.653 1.00 33.45 ? 167 SER A CB    1 
ATOM   1367 O  OG    . SER C 3 77 ? 14.669  0.969   -25.564 1.00 33.09 ? 167 SER A OG    1 
ATOM   1368 N  N     . ARG C 3 78 ? 17.335  -0.128  -23.231 1.00 23.80 ? 168 ARG A N     1 
ATOM   1369 C  CA    . ARG C 3 78 ? 18.717  0.322   -23.242 1.00 30.72 ? 168 ARG A CA    1 
ATOM   1370 C  C     . ARG C 3 78 ? 19.086  0.673   -24.664 1.00 33.75 ? 168 ARG A C     1 
ATOM   1371 O  O     . ARG C 3 78 ? 19.919  1.554   -24.872 1.00 36.94 ? 168 ARG A O     1 
ATOM   1372 C  CB    . ARG C 3 78 ? 19.703  -0.715  -22.676 1.00 28.60 ? 168 ARG A CB    1 
ATOM   1373 C  CG    . ARG C 3 78 ? 19.785  -2.025  -23.399 1.00 30.20 ? 168 ARG A CG    1 
ATOM   1374 C  CD    . ARG C 3 78 ? 20.977  -2.896  -22.934 1.00 20.58 ? 168 ARG A CD    1 
ATOM   1375 N  NE    . ARG C 3 78 ? 20.996  -3.240  -21.509 1.00 21.82 ? 168 ARG A NE    1 
ATOM   1376 C  CZ    . ARG C 3 78 ? 21.468  -2.465  -20.534 1.00 19.17 ? 168 ARG A CZ    1 
ATOM   1377 N  NH1   . ARG C 3 78 ? 21.974  -1.277  -20.812 1.00 29.27 ? 168 ARG A NH1   1 
ATOM   1378 N  NH2   . ARG C 3 78 ? 21.431  -2.878  -19.268 1.00 20.83 ? 168 ARG A NH2   1 
ATOM   1379 N  N     . ASP C 3 79 ? 18.459  0.019   -25.649 1.00 29.82 ? 169 ASP A N     1 
ATOM   1380 C  CA    . ASP C 3 79 ? 18.776  0.357   -27.034 1.00 27.70 ? 169 ASP A CA    1 
ATOM   1381 C  C     . ASP C 3 79 ? 18.139  1.691   -27.383 1.00 27.89 ? 169 ASP A C     1 
ATOM   1382 O  O     . ASP C 3 79 ? 18.192  2.133   -28.524 1.00 38.64 ? 169 ASP A O     1 
ATOM   1383 C  CB    . ASP C 3 79 ? 18.333  -0.728  -28.039 1.00 14.91 ? 169 ASP A CB    1 
ATOM   1384 C  CG    . ASP C 3 79 ? 16.861  -0.664  -28.388 1.00 32.51 ? 169 ASP A CG    1 
ATOM   1385 O  OD1   . ASP C 3 79 ? 16.344  0.448   -28.592 1.00 44.55 ? 169 ASP A OD1   1 
ATOM   1386 O  OD2   . ASP C 3 79 ? 16.217  -1.730  -28.516 1.00 33.92 ? 169 ASP A OD2   1 
ATOM   1387 N  N     . ALA C 3 80 ? 17.520  2.325   -26.392 1.00 24.06 ? 170 ALA A N     1 
ATOM   1388 C  CA    . ALA C 3 80 ? 16.899  3.630   -26.581 1.00 8.05  ? 170 ALA A CA    1 
ATOM   1389 C  C     . ALA C 3 80 ? 17.607  4.632   -25.708 1.00 12.15 ? 170 ALA A C     1 
ATOM   1390 O  O     . ALA C 3 80 ? 17.216  5.790   -25.666 1.00 12.96 ? 170 ALA A O     1 
ATOM   1391 C  CB    . ALA C 3 80 ? 15.414  3.583   -26.212 1.00 25.51 ? 170 ALA A CB    1 
ATOM   1392 N  N     . VAL C 3 81 ? 18.653  4.191   -24.999 1.00 23.99 ? 171 VAL A N     1 
ATOM   1393 C  CA    . VAL C 3 81 ? 19.422  5.081   -24.113 1.00 24.82 ? 171 VAL A CA    1 
ATOM   1394 C  C     . VAL C 3 81 ? 19.999  6.240   -24.910 1.00 26.65 ? 171 VAL A C     1 
ATOM   1395 O  O     . VAL C 3 81 ? 20.269  6.116   -26.101 1.00 33.62 ? 171 VAL A O     1 
ATOM   1396 C  CB    . VAL C 3 81 ? 20.603  4.337   -23.389 1.00 25.04 ? 171 VAL A CB    1 
ATOM   1397 C  CG1   . VAL C 3 81 ? 21.441  5.335   -22.559 1.00 17.97 ? 171 VAL A CG1   1 
ATOM   1398 C  CG2   . VAL C 3 81 ? 20.060  3.245   -22.472 1.00 24.52 ? 171 VAL A CG2   1 
ATOM   1399 N  N     . ARG C 3 82 ? 20.213  7.358   -24.241 1.00 25.49 ? 172 ARG A N     1 
ATOM   1400 C  CA    . ARG C 3 82 ? 20.727  8.522   -24.899 1.00 21.84 ? 172 ARG A CA    1 
ATOM   1401 C  C     . ARG C 3 82 ? 21.615  9.373   -24.005 1.00 34.82 ? 172 ARG A C     1 
ATOM   1402 O  O     . ARG C 3 82 ? 21.105  10.163  -23.209 1.00 36.95 ? 172 ARG A O     1 
ATOM   1403 C  CB    . ARG C 3 82 ? 19.563  9.366   -25.379 1.00 28.62 ? 172 ARG A CB    1 
ATOM   1404 C  CG    . ARG C 3 82 ? 19.961  10.736  -25.940 1.00 39.51 ? 172 ARG A CG    1 
ATOM   1405 C  CD    . ARG C 3 82 ? 18.727  11.597  -26.179 1.00 43.97 ? 172 ARG A CD    1 
ATOM   1406 N  NE    . ARG C 3 82 ? 18.610  12.682  -25.212 1.00 43.98 ? 172 ARG A NE    1 
ATOM   1407 C  CZ    . ARG C 3 82 ? 17.533  13.450  -25.079 1.00 40.14 ? 172 ARG A CZ    1 
ATOM   1408 N  NH1   . ARG C 3 82 ? 16.475  13.247  -25.848 1.00 38.56 ? 172 ARG A NH1   1 
ATOM   1409 N  NH2   . ARG C 3 82 ? 17.527  14.445  -24.198 1.00 38.11 ? 172 ARG A NH2   1 
ATOM   1410 N  N     . PHE C 3 83 ? 22.936  9.240   -24.145 1.00 39.80 ? 173 PHE A N     1 
ATOM   1411 C  CA    . PHE C 3 83 ? 23.860  10.058  -23.346 1.00 36.78 ? 173 PHE A CA    1 
ATOM   1412 C  C     . PHE C 3 83 ? 24.054  11.417  -24.015 1.00 30.19 ? 173 PHE A C     1 
ATOM   1413 O  O     . PHE C 3 83 ? 23.782  11.566  -25.201 1.00 35.02 ? 173 PHE A O     1 
ATOM   1414 C  CB    . PHE C 3 83 ? 25.237  9.392   -23.203 1.00 31.11 ? 173 PHE A CB    1 
ATOM   1415 C  CG    . PHE C 3 83 ? 25.274  8.059   -22.463 1.00 31.40 ? 173 PHE A CG    1 
ATOM   1416 C  CD1   . PHE C 3 83 ? 25.033  6.869   -23.156 1.00 22.16 ? 173 PHE A CD1   1 
ATOM   1417 C  CD2   . PHE C 3 83 ? 25.575  8.031   -21.098 1.00 19.10 ? 173 PHE A CD2   1 
ATOM   1418 C  CE1   . PHE C 3 83 ? 25.114  5.645   -22.485 1.00 24.99 ? 173 PHE A CE1   1 
ATOM   1419 C  CE2   . PHE C 3 83 ? 25.664  6.806   -20.429 1.00 18.07 ? 173 PHE A CE2   1 
ATOM   1420 C  CZ    . PHE C 3 83 ? 25.436  5.612   -21.123 1.00 18.39 ? 173 PHE A CZ    1 
ATOM   1421 N  N     . GLY C 3 84 ? 24.506  12.404  -23.247 1.00 31.61 ? 174 GLY A N     1 
ATOM   1422 C  CA    . GLY C 3 84 ? 24.753  13.738  -23.784 1.00 37.87 ? 174 GLY A CA    1 
ATOM   1423 C  C     . GLY C 3 84 ? 23.558  14.657  -24.009 1.00 45.03 ? 174 GLY A C     1 
ATOM   1424 O  O     . GLY C 3 84 ? 22.442  14.193  -24.210 1.00 45.27 ? 174 GLY A O     1 
ATOM   1425 N  N     . ARG C 3 85 ? 23.807  15.967  -24.000 1.00 45.75 ? 175 ARG A N     1 
ATOM   1426 C  CA    . ARG C 3 85 ? 22.766  16.984  -24.196 1.00 53.46 ? 175 ARG A CA    1 
ATOM   1427 C  C     . ARG C 3 85 ? 22.178  17.014  -25.607 1.00 57.66 ? 175 ARG A C     1 
ATOM   1428 O  O     . ARG C 3 85 ? 22.183  18.093  -26.234 1.00 59.20 ? 175 ARG A O     1 
ATOM   1429 C  CB    . ARG C 3 85 ? 23.344  18.362  -23.833 1.00 59.76 ? 175 ARG A CB    1 
ATOM   1430 C  CG    . ARG C 3 85 ? 22.455  19.595  -24.034 1.00 61.19 ? 175 ARG A CG    1 
ATOM   1431 C  CD    . ARG C 3 85 ? 23.201  20.813  -23.487 1.00 60.60 ? 175 ARG A CD    1 
ATOM   1432 N  NE    . ARG C 3 85 ? 22.775  22.103  -24.025 1.00 61.32 ? 175 ARG A NE    1 
ATOM   1433 C  CZ    . ARG C 3 85 ? 23.262  23.273  -23.607 1.00 63.00 ? 175 ARG A CZ    1 
ATOM   1434 N  NH1   . ARG C 3 85 ? 24.181  23.307  -22.647 1.00 63.51 ? 175 ARG A NH1   1 
ATOM   1435 N  NH2   . ARG C 3 85 ? 22.859  24.408  -24.166 1.00 61.57 ? 175 ARG A NH2   1 
ATOM   1436 N  N     . GLY D 3 5  ? 15.109  11.348  13.683  1.00 53.55 ? 96  GLY B N     1 
ATOM   1437 C  CA    . GLY D 3 5  ? 15.629  11.578  15.035  1.00 59.33 ? 96  GLY B CA    1 
ATOM   1438 C  C     . GLY D 3 5  ? 16.168  10.324  15.709  1.00 56.33 ? 96  GLY B C     1 
ATOM   1439 O  O     . GLY D 3 5  ? 15.762  9.204   15.378  1.00 54.48 ? 96  GLY B O     1 
ATOM   1440 N  N     . MET D 3 6  ? 17.085  10.508  16.658  1.00 54.23 ? 97  MET B N     1 
ATOM   1441 C  CA    . MET D 3 6  ? 17.678  9.378   17.362  1.00 54.77 ? 97  MET B CA    1 
ATOM   1442 C  C     . MET D 3 6  ? 16.589  8.401   17.804  1.00 53.95 ? 97  MET B C     1 
ATOM   1443 O  O     . MET D 3 6  ? 16.665  7.211   17.494  1.00 57.43 ? 97  MET B O     1 
ATOM   1444 C  CB    . MET D 3 6  ? 18.494  9.862   18.564  1.00 57.89 ? 97  MET B CB    1 
ATOM   1445 N  N     . VAL D 3 7  ? 15.583  8.888   18.529  1.00 49.03 ? 98  VAL B N     1 
ATOM   1446 C  CA    . VAL D 3 7  ? 14.480  8.009   18.947  1.00 51.48 ? 98  VAL B CA    1 
ATOM   1447 C  C     . VAL D 3 7  ? 13.132  8.697   18.736  1.00 44.16 ? 98  VAL B C     1 
ATOM   1448 O  O     . VAL D 3 7  ? 12.824  9.688   19.387  1.00 45.29 ? 98  VAL B O     1 
ATOM   1449 C  CB    . VAL D 3 7  ? 14.591  7.567   20.441  1.00 51.76 ? 98  VAL B CB    1 
ATOM   1450 C  CG1   . VAL D 3 7  ? 13.442  6.633   20.796  1.00 41.54 ? 98  VAL B CG1   1 
ATOM   1451 C  CG2   . VAL D 3 7  ? 15.909  6.852   20.684  1.00 57.65 ? 98  VAL B CG2   1 
ATOM   1452 N  N     . LEU D 3 8  ? 12.356  8.188   17.789  1.00 40.96 ? 99  LEU B N     1 
ATOM   1453 C  CA    . LEU D 3 8  ? 11.030  8.725   17.497  1.00 45.34 ? 99  LEU B CA    1 
ATOM   1454 C  C     . LEU D 3 8  ? 10.027  7.682   18.001  1.00 47.38 ? 99  LEU B C     1 
ATOM   1455 O  O     . LEU D 3 8  ? 10.230  6.478   17.801  1.00 49.62 ? 99  LEU B O     1 
ATOM   1456 C  CB    . LEU D 3 8  ? 10.854  8.938   15.983  1.00 45.47 ? 99  LEU B CB    1 
ATOM   1457 C  CG    . LEU D 3 8  ? 11.277  10.228  15.249  1.00 41.29 ? 99  LEU B CG    1 
ATOM   1458 C  CD1   . LEU D 3 8  ? 10.297  11.364  15.520  1.00 27.76 ? 99  LEU B CD1   1 
ATOM   1459 C  CD2   . LEU D 3 8  ? 12.679  10.613  15.663  1.00 47.34 ? 99  LEU B CD2   1 
ATOM   1460 N  N     . LEU D 3 9  ? 8.948   8.121   18.649  1.00 41.90 ? 100 LEU B N     1 
ATOM   1461 C  CA    . LEU D 3 9  ? 7.975   7.158   19.168  1.00 39.15 ? 100 LEU B CA    1 
ATOM   1462 C  C     . LEU D 3 9  ? 6.754   6.940   18.236  1.00 34.99 ? 100 LEU B C     1 
ATOM   1463 O  O     . LEU D 3 9  ? 6.321   7.852   17.525  1.00 25.07 ? 100 LEU B O     1 
ATOM   1464 C  CB    . LEU D 3 9  ? 7.524   7.595   20.577  1.00 41.96 ? 100 LEU B CB    1 
ATOM   1465 C  CG    . LEU D 3 9  ? 8.621   7.936   21.608  1.00 34.34 ? 100 LEU B CG    1 
ATOM   1466 C  CD1   . LEU D 3 9  ? 7.991   8.437   22.889  1.00 27.30 ? 100 LEU B CD1   1 
ATOM   1467 C  CD2   . LEU D 3 9  ? 9.497   6.724   21.896  1.00 37.51 ? 100 LEU B CD2   1 
ATOM   1468 N  N     . CYS D 3 10 ? 6.235   5.711   18.234  1.00 30.60 ? 101 CYS B N     1 
ATOM   1469 C  CA    . CYS D 3 10 ? 5.068   5.322   17.436  1.00 28.68 ? 101 CYS B CA    1 
ATOM   1470 C  C     . CYS D 3 10 ? 3.909   6.274   17.646  1.00 31.28 ? 101 CYS B C     1 
ATOM   1471 O  O     . CYS D 3 10 ? 3.421   6.424   18.762  1.00 40.53 ? 101 CYS B O     1 
ATOM   1472 C  CB    . CYS D 3 10 ? 4.613   3.936   17.837  1.00 30.73 ? 101 CYS B CB    1 
ATOM   1473 S  SG    . CYS D 3 10 ? 3.042   3.410   17.092  1.00 16.10 ? 101 CYS B SG    1 
ATOM   1474 N  N     . LYS D 3 11 ? 3.444   6.894   16.575  1.00 23.19 ? 102 LYS B N     1 
ATOM   1475 C  CA    . LYS D 3 11 ? 2.369   7.867   16.691  1.00 27.76 ? 102 LYS B CA    1 
ATOM   1476 C  C     . LYS D 3 11 ? 1.011   7.222   17.061  1.00 27.36 ? 102 LYS B C     1 
ATOM   1477 O  O     . LYS D 3 11 ? 0.060   7.904   17.453  1.00 26.66 ? 102 LYS B O     1 
ATOM   1478 C  CB    . LYS D 3 11 ? 2.277   8.678   15.385  1.00 10.46 ? 102 LYS B CB    1 
ATOM   1479 C  CG    . LYS D 3 11 ? 1.402   9.909   15.497  1.00 33.51 ? 102 LYS B CG    1 
ATOM   1480 C  CD    . LYS D 3 11 ? 1.211   10.625  14.159  1.00 31.32 ? 102 LYS B CD    1 
ATOM   1481 C  CE    . LYS D 3 11 ? 0.053   11.636  14.238  1.00 37.24 ? 102 LYS B CE    1 
ATOM   1482 N  NZ    . LYS D 3 11 ? 0.222   12.715  15.271  1.00 42.27 ? 102 LYS B NZ    1 
ATOM   1483 N  N     . VAL D 3 12 ? 0.937   5.903   16.952  1.00 24.14 ? 103 VAL B N     1 
ATOM   1484 C  CA    . VAL D 3 12 ? -0.286  5.177   17.272  1.00 28.64 ? 103 VAL B CA    1 
ATOM   1485 C  C     . VAL D 3 12 ? -0.394  4.750   18.738  1.00 35.93 ? 103 VAL B C     1 
ATOM   1486 O  O     . VAL D 3 12 ? -1.480  4.812   19.313  1.00 44.22 ? 103 VAL B O     1 
ATOM   1487 C  CB    . VAL D 3 12 ? -0.418  3.905   16.420  1.00 17.51 ? 103 VAL B CB    1 
ATOM   1488 C  CG1   . VAL D 3 12 ? -1.516  3.037   16.957  1.00 13.01 ? 103 VAL B CG1   1 
ATOM   1489 C  CG2   . VAL D 3 12 ? -0.720  4.271   14.985  1.00 30.95 ? 103 VAL B CG2   1 
ATOM   1490 N  N     . CYS D 3 13 ? 0.723   4.335   19.336  1.00 29.90 ? 104 CYS B N     1 
ATOM   1491 C  CA    . CYS D 3 13 ? 0.744   3.854   20.711  1.00 23.39 ? 104 CYS B CA    1 
ATOM   1492 C  C     . CYS D 3 13 ? 1.915   4.327   21.588  1.00 33.27 ? 104 CYS B C     1 
ATOM   1493 O  O     . CYS D 3 13 ? 2.111   3.789   22.670  1.00 39.97 ? 104 CYS B O     1 
ATOM   1494 C  CB    . CYS D 3 13 ? 0.803   2.344   20.696  1.00 19.99 ? 104 CYS B CB    1 
ATOM   1495 S  SG    . CYS D 3 13 ? 2.485   1.817   20.262  1.00 35.35 ? 104 CYS B SG    1 
ATOM   1496 N  N     . GLY D 3 14 ? 2.725   5.281   21.141  1.00 30.71 ? 105 GLY B N     1 
ATOM   1497 C  CA    . GLY D 3 14 ? 3.813   5.733   21.992  1.00 20.42 ? 105 GLY B CA    1 
ATOM   1498 C  C     . GLY D 3 14 ? 4.979   4.760   22.203  1.00 24.55 ? 105 GLY B C     1 
ATOM   1499 O  O     . GLY D 3 14 ? 5.900   5.075   22.953  1.00 18.15 ? 105 GLY B O     1 
ATOM   1500 N  N     . ASP D 3 15 ? 4.960   3.586   21.576  1.00 19.62 ? 106 ASP B N     1 
ATOM   1501 C  CA    . ASP D 3 15 ? 6.076   2.646   21.721  1.00 23.37 ? 106 ASP B CA    1 
ATOM   1502 C  C     . ASP D 3 15 ? 7.244   3.255   20.919  1.00 34.35 ? 106 ASP B C     1 
ATOM   1503 O  O     . ASP D 3 15 ? 7.072   4.301   20.266  1.00 38.41 ? 106 ASP B O     1 
ATOM   1504 C  CB    . ASP D 3 15 ? 5.685   1.291   21.121  1.00 25.53 ? 106 ASP B CB    1 
ATOM   1505 C  CG    . ASP D 3 15 ? 6.617   0.192   21.534  1.00 9.18  ? 106 ASP B CG    1 
ATOM   1506 O  OD1   . ASP D 3 15 ? 7.618   0.561   22.148  1.00 15.07 ? 106 ASP B OD1   1 
ATOM   1507 O  OD2   . ASP D 3 15 ? 6.360   -1.014  21.262  1.00 3.64  ? 106 ASP B OD2   1 
ATOM   1508 N  N     . VAL D 3 16 ? 8.428   2.646   20.944  1.00 30.63 ? 107 VAL B N     1 
ATOM   1509 C  CA    . VAL D 3 16 ? 9.520   3.230   20.156  1.00 35.47 ? 107 VAL B CA    1 
ATOM   1510 C  C     . VAL D 3 16 ? 9.207   2.885   18.712  1.00 35.17 ? 107 VAL B C     1 
ATOM   1511 O  O     . VAL D 3 16 ? 8.717   1.786   18.435  1.00 39.81 ? 107 VAL B O     1 
ATOM   1512 C  CB    . VAL D 3 16 ? 10.925  2.648   20.499  1.00 37.86 ? 107 VAL B CB    1 
ATOM   1513 C  CG1   . VAL D 3 16 ? 11.127  2.617   21.999  1.00 40.72 ? 107 VAL B CG1   1 
ATOM   1514 C  CG2   . VAL D 3 16 ? 11.117  1.287   19.868  1.00 35.70 ? 107 VAL B CG2   1 
ATOM   1515 N  N     . ALA D 3 17 ? 9.464   3.812   17.794  1.00 23.96 ? 108 ALA B N     1 
ATOM   1516 C  CA    . ALA D 3 17 ? 9.189   3.550   16.379  1.00 20.99 ? 108 ALA B CA    1 
ATOM   1517 C  C     . ALA D 3 17 ? 10.368  2.857   15.717  1.00 24.40 ? 108 ALA B C     1 
ATOM   1518 O  O     . ALA D 3 17 ? 11.511  3.236   15.963  1.00 11.55 ? 108 ALA B O     1 
ATOM   1519 C  CB    . ALA D 3 17 ? 8.919   4.855   15.656  1.00 22.53 ? 108 ALA B CB    1 
ATOM   1520 N  N     . SER D 3 18 ? 10.099  1.855   14.881  1.00 20.27 ? 109 SER B N     1 
ATOM   1521 C  CA    . SER D 3 18 ? 11.169  1.170   14.156  1.00 22.28 ? 109 SER B CA    1 
ATOM   1522 C  C     . SER D 3 18 ? 11.325  1.803   12.769  1.00 27.54 ? 109 SER B C     1 
ATOM   1523 O  O     . SER D 3 18 ? 12.036  1.273   11.915  1.00 30.14 ? 109 SER B O     1 
ATOM   1524 C  CB    . SER D 3 18 ? 10.836  -0.307  13.941  1.00 29.08 ? 109 SER B CB    1 
ATOM   1525 O  OG    . SER D 3 18 ? 9.949   -0.457  12.847  1.00 18.45 ? 109 SER B OG    1 
ATOM   1526 N  N     . GLY D 3 19 ? 10.631  2.909   12.531  1.00 30.85 ? 110 GLY B N     1 
ATOM   1527 C  CA    . GLY D 3 19 ? 10.706  3.555   11.239  1.00 31.39 ? 110 GLY B CA    1 
ATOM   1528 C  C     . GLY D 3 19 ? 9.575   4.528   10.895  1.00 41.46 ? 110 GLY B C     1 
ATOM   1529 O  O     . GLY D 3 19 ? 8.969   5.176   11.760  1.00 44.70 ? 110 GLY B O     1 
ATOM   1530 N  N     . PHE D 3 20 ? 9.310   4.627   9.598   1.00 33.17 ? 111 PHE B N     1 
ATOM   1531 C  CA    . PHE D 3 20 ? 8.305   5.511   9.028   1.00 24.78 ? 111 PHE B CA    1 
ATOM   1532 C  C     . PHE D 3 20 ? 7.494   4.541   8.192   1.00 28.62 ? 111 PHE B C     1 
ATOM   1533 O  O     . PHE D 3 20 ? 7.847   4.305   7.038   1.00 41.71 ? 111 PHE B O     1 
ATOM   1534 C  CB    . PHE D 3 20 ? 8.999   6.519   8.099   1.00 17.67 ? 111 PHE B CB    1 
ATOM   1535 C  CG    . PHE D 3 20 ? 8.083   7.538   7.499   1.00 27.71 ? 111 PHE B CG    1 
ATOM   1536 C  CD1   . PHE D 3 20 ? 7.492   8.529   8.298   1.00 21.41 ? 111 PHE B CD1   1 
ATOM   1537 C  CD2   . PHE D 3 20 ? 7.803   7.517   6.136   1.00 16.46 ? 111 PHE B CD2   1 
ATOM   1538 C  CE1   . PHE D 3 20 ? 6.642   9.481   7.752   1.00 13.53 ? 111 PHE B CE1   1 
ATOM   1539 C  CE2   . PHE D 3 20 ? 6.944   8.470   5.578   1.00 24.12 ? 111 PHE B CE2   1 
ATOM   1540 C  CZ    . PHE D 3 20 ? 6.361   9.456   6.385   1.00 18.16 ? 111 PHE B CZ    1 
ATOM   1541 N  N     . HIS D 3 21 ? 6.431   3.967   8.758   1.00 15.31 ? 112 HIS B N     1 
ATOM   1542 C  CA    . HIS D 3 21 ? 5.627   3.002   8.022   1.00 14.29 ? 112 HIS B CA    1 
ATOM   1543 C  C     . HIS D 3 21 ? 4.259   3.563   7.602   1.00 22.64 ? 112 HIS B C     1 
ATOM   1544 O  O     . HIS D 3 21 ? 3.654   4.373   8.316   1.00 22.67 ? 112 HIS B O     1 
ATOM   1545 C  CB    . HIS D 3 21 ? 5.456   1.748   8.867   1.00 15.70 ? 112 HIS B CB    1 
ATOM   1546 C  CG    . HIS D 3 21 ? 6.747   1.180   9.371   1.00 27.33 ? 112 HIS B CG    1 
ATOM   1547 N  ND1   . HIS D 3 21 ? 7.551   0.355   8.613   1.00 20.30 ? 112 HIS B ND1   1 
ATOM   1548 C  CD2   . HIS D 3 21 ? 7.395   1.356   10.548  1.00 32.74 ? 112 HIS B CD2   1 
ATOM   1549 C  CE1   . HIS D 3 21 ? 8.635   0.046   9.301   1.00 27.24 ? 112 HIS B CE1   1 
ATOM   1550 N  NE2   . HIS D 3 21 ? 8.565   0.642   10.478  1.00 37.47 ? 112 HIS B NE2   1 
ATOM   1551 N  N     . TYR D 3 22 ? 3.810   3.158   6.416   1.00 16.31 ? 113 TYR B N     1 
ATOM   1552 C  CA    . TYR D 3 22 ? 2.534   3.580   5.875   1.00 16.98 ? 113 TYR B CA    1 
ATOM   1553 C  C     . TYR D 3 22 ? 2.300   5.066   5.970   1.00 14.06 ? 113 TYR B C     1 
ATOM   1554 O  O     . TYR D 3 22 ? 1.158   5.520   5.937   1.00 26.00 ? 113 TYR B O     1 
ATOM   1555 C  CB    . TYR D 3 22 ? 1.408   2.815   6.576   1.00 3.99  ? 113 TYR B CB    1 
ATOM   1556 C  CG    . TYR D 3 22 ? 1.506   1.356   6.294   1.00 2.00  ? 113 TYR B CG    1 
ATOM   1557 C  CD1   . TYR D 3 22 ? 1.215   0.851   5.054   1.00 2.00  ? 113 TYR B CD1   1 
ATOM   1558 C  CD2   . TYR D 3 22 ? 1.980   0.482   7.254   1.00 7.25  ? 113 TYR B CD2   1 
ATOM   1559 C  CE1   . TYR D 3 22 ? 1.406   -0.513  4.778   1.00 2.00  ? 113 TYR B CE1   1 
ATOM   1560 C  CE2   . TYR D 3 22 ? 2.174   -0.856  6.977   1.00 2.00  ? 113 TYR B CE2   1 
ATOM   1561 C  CZ    . TYR D 3 22 ? 1.891   -1.339  5.750   1.00 2.00  ? 113 TYR B CZ    1 
ATOM   1562 O  OH    . TYR D 3 22 ? 2.096   -2.682  5.510   1.00 3.30  ? 113 TYR B OH    1 
ATOM   1563 N  N     . GLY D 3 23 ? 3.362   5.840   6.134   1.00 7.65  ? 114 GLY B N     1 
ATOM   1564 C  CA    . GLY D 3 23 ? 3.155   7.276   6.177   1.00 5.68  ? 114 GLY B CA    1 
ATOM   1565 C  C     . GLY D 3 23 ? 3.468   7.984   7.457   1.00 8.57  ? 114 GLY B C     1 
ATOM   1566 O  O     . GLY D 3 23 ? 3.455   9.230   7.516   1.00 12.60 ? 114 GLY B O     1 
ATOM   1567 N  N     . VAL D 3 24 ? 3.738   7.207   8.496   1.00 9.60  ? 115 VAL B N     1 
ATOM   1568 C  CA    . VAL D 3 24 ? 4.022   7.803   9.792   1.00 5.92  ? 115 VAL B CA    1 
ATOM   1569 C  C     . VAL D 3 24 ? 4.923   6.925   10.664  1.00 4.35  ? 115 VAL B C     1 
ATOM   1570 O  O     . VAL D 3 24 ? 5.059   5.716   10.469  1.00 2.16  ? 115 VAL B O     1 
ATOM   1571 C  CB    . VAL D 3 24 ? 2.670   8.170   10.529  1.00 20.09 ? 115 VAL B CB    1 
ATOM   1572 C  CG1   . VAL D 3 24 ? 1.628   7.097   10.302  1.00 14.14 ? 115 VAL B CG1   1 
ATOM   1573 C  CG2   . VAL D 3 24 ? 2.890   8.317   12.002  1.00 20.66 ? 115 VAL B CG2   1 
ATOM   1574 N  N     . LEU D 3 25 ? 5.556   7.567   11.622  1.00 5.52  ? 116 LEU B N     1 
ATOM   1575 C  CA    . LEU D 3 25 ? 6.447   6.892   12.532  1.00 20.44 ? 116 LEU B CA    1 
ATOM   1576 C  C     . LEU D 3 25 ? 5.633   5.980   13.460  1.00 23.92 ? 116 LEU B C     1 
ATOM   1577 O  O     . LEU D 3 25 ? 4.994   6.451   14.385  1.00 33.27 ? 116 LEU B O     1 
ATOM   1578 C  CB    . LEU D 3 25 ? 7.229   7.980   13.290  1.00 18.31 ? 116 LEU B CB    1 
ATOM   1579 C  CG    . LEU D 3 25 ? 7.963   8.883   12.273  1.00 22.03 ? 116 LEU B CG    1 
ATOM   1580 C  CD1   . LEU D 3 25 ? 8.427   10.180  12.863  1.00 21.77 ? 116 LEU B CD1   1 
ATOM   1581 C  CD2   . LEU D 3 25 ? 9.125   8.112   11.690  1.00 21.49 ? 116 LEU B CD2   1 
ATOM   1582 N  N     . ALA D 3 26 ? 5.665   4.679   13.193  1.00 22.02 ? 117 ALA B N     1 
ATOM   1583 C  CA    . ALA D 3 26 ? 4.949   3.674   13.975  1.00 24.93 ? 117 ALA B CA    1 
ATOM   1584 C  C     . ALA D 3 26 ? 5.874   2.597   14.557  1.00 29.02 ? 117 ALA B C     1 
ATOM   1585 O  O     . ALA D 3 26 ? 6.913   2.295   13.976  1.00 33.48 ? 117 ALA B O     1 
ATOM   1586 C  CB    . ALA D 3 26 ? 3.905   3.001   13.093  1.00 28.47 ? 117 ALA B CB    1 
ATOM   1587 N  N     . CYS D 3 27 ? 5.489   1.998   15.685  1.00 19.49 ? 118 CYS B N     1 
ATOM   1588 C  CA    . CYS D 3 27 ? 6.295   0.949   16.305  1.00 15.67 ? 118 CYS B CA    1 
ATOM   1589 C  C     . CYS D 3 27 ? 6.128   -0.192  15.352  1.00 12.48 ? 118 CYS B C     1 
ATOM   1590 O  O     . CYS D 3 27 ? 5.383   -0.072  14.380  1.00 10.53 ? 118 CYS B O     1 
ATOM   1591 C  CB    . CYS D 3 27 ? 5.742   0.520   17.680  1.00 22.37 ? 118 CYS B CB    1 
ATOM   1592 S  SG    . CYS D 3 27 ? 4.149   -0.401  17.662  1.00 25.58 ? 118 CYS B SG    1 
ATOM   1593 N  N     . GLU D 3 28 ? 6.748   -1.323  15.665  1.00 14.21 ? 119 GLU B N     1 
ATOM   1594 C  CA    . GLU D 3 28 ? 6.683   -2.474  14.779  1.00 14.19 ? 119 GLU B CA    1 
ATOM   1595 C  C     . GLU D 3 28 ? 5.407   -3.307  14.948  1.00 24.73 ? 119 GLU B C     1 
ATOM   1596 O  O     . GLU D 3 28 ? 5.093   -4.163  14.101  1.00 27.36 ? 119 GLU B O     1 
ATOM   1597 C  CB    . GLU D 3 28 ? 7.961   -3.325  14.975  1.00 24.75 ? 119 GLU B CB    1 
ATOM   1598 C  CG    . GLU D 3 28 ? 8.280   -4.394  13.881  1.00 21.97 ? 119 GLU B CG    1 
ATOM   1599 C  CD    . GLU D 3 28 ? 8.882   -3.848  12.566  1.00 20.07 ? 119 GLU B CD    1 
ATOM   1600 O  OE1   . GLU D 3 28 ? 9.326   -2.671  12.464  1.00 6.21  ? 119 GLU B OE1   1 
ATOM   1601 O  OE2   . GLU D 3 28 ? 8.925   -4.637  11.608  1.00 28.69 ? 119 GLU B OE2   1 
ATOM   1602 N  N     . GLY D 3 29 ? 4.664   -3.069  16.031  1.00 22.37 ? 120 GLY B N     1 
ATOM   1603 C  CA    . GLY D 3 29 ? 3.440   -3.828  16.242  1.00 11.58 ? 120 GLY B CA    1 
ATOM   1604 C  C     . GLY D 3 29 ? 2.285   -3.240  15.436  1.00 13.09 ? 120 GLY B C     1 
ATOM   1605 O  O     . GLY D 3 29 ? 1.553   -3.961  14.752  1.00 11.13 ? 120 GLY B O     1 
ATOM   1606 N  N     . CYS D 3 30 ? 2.114   -1.923  15.521  1.00 2.00  ? 121 CYS B N     1 
ATOM   1607 C  CA    . CYS D 3 30 ? 1.063   -1.261  14.777  1.00 21.16 ? 121 CYS B CA    1 
ATOM   1608 C  C     . CYS D 3 30 ? 1.324   -1.500  13.296  1.00 28.91 ? 121 CYS B C     1 
ATOM   1609 O  O     . CYS D 3 30 ? 0.403   -1.783  12.525  1.00 35.13 ? 121 CYS B O     1 
ATOM   1610 C  CB    . CYS D 3 30 ? 1.067   0.226   15.091  1.00 17.76 ? 121 CYS B CB    1 
ATOM   1611 S  SG    . CYS D 3 30 ? 0.914   0.517   16.877  1.00 25.08 ? 121 CYS B SG    1 
ATOM   1612 N  N     . LYS D 3 31 ? 2.588   -1.391  12.903  1.00 28.24 ? 122 LYS B N     1 
ATOM   1613 C  CA    . LYS D 3 31 ? 2.969   -1.621  11.526  1.00 16.96 ? 122 LYS B CA    1 
ATOM   1614 C  C     . LYS D 3 31 ? 2.415   -2.958  11.056  1.00 7.70  ? 122 LYS B C     1 
ATOM   1615 O  O     . LYS D 3 31 ? 1.730   -3.046  10.042  1.00 16.63 ? 122 LYS B O     1 
ATOM   1616 C  CB    . LYS D 3 31 ? 4.487   -1.611  11.421  1.00 27.55 ? 122 LYS B CB    1 
ATOM   1617 C  CG    . LYS D 3 31 ? 5.056   -2.279  10.188  1.00 18.38 ? 122 LYS B CG    1 
ATOM   1618 C  CD    . LYS D 3 31 ? 6.569   -2.194  10.265  1.00 28.09 ? 122 LYS B CD    1 
ATOM   1619 C  CE    . LYS D 3 31 ? 7.257   -2.926  9.120   1.00 23.60 ? 122 LYS B CE    1 
ATOM   1620 N  NZ    . LYS D 3 31 ? 7.189   -4.403  9.167   1.00 15.42 ? 122 LYS B NZ    1 
ATOM   1621 N  N     . GLY D 3 32 ? 2.738   -4.014  11.775  1.00 10.06 ? 123 GLY B N     1 
ATOM   1622 C  CA    . GLY D 3 32 ? 2.237   -5.316  11.383  1.00 16.68 ? 123 GLY B CA    1 
ATOM   1623 C  C     . GLY D 3 32 ? 0.735   -5.438  11.617  1.00 19.10 ? 123 GLY B C     1 
ATOM   1624 O  O     . GLY D 3 32 ? 0.059   -6.272  10.985  1.00 9.69  ? 123 GLY B O     1 
ATOM   1625 N  N     . PHE D 3 33 ? 0.217   -4.618  12.530  1.00 14.34 ? 124 PHE B N     1 
ATOM   1626 C  CA    . PHE D 3 33 ? -1.204  -4.634  12.817  1.00 24.21 ? 124 PHE B CA    1 
ATOM   1627 C  C     . PHE D 3 33 ? -1.923  -3.903  11.700  1.00 20.92 ? 124 PHE B C     1 
ATOM   1628 O  O     . PHE D 3 33 ? -2.848  -4.450  11.107  1.00 27.28 ? 124 PHE B O     1 
ATOM   1629 C  CB    . PHE D 3 33 ? -1.523  -3.991  14.174  1.00 30.58 ? 124 PHE B CB    1 
ATOM   1630 C  CG    . PHE D 3 33 ? -2.999  -3.922  14.466  1.00 17.41 ? 124 PHE B CG    1 
ATOM   1631 C  CD1   . PHE D 3 33 ? -3.713  -5.080  14.767  1.00 20.63 ? 124 PHE B CD1   1 
ATOM   1632 C  CD2   . PHE D 3 33 ? -3.676  -2.717  14.389  1.00 21.07 ? 124 PHE B CD2   1 
ATOM   1633 C  CE1   . PHE D 3 33 ? -5.081  -5.039  14.990  1.00 31.54 ? 124 PHE B CE1   1 
ATOM   1634 C  CE2   . PHE D 3 33 ? -5.052  -2.653  14.611  1.00 23.65 ? 124 PHE B CE2   1 
ATOM   1635 C  CZ    . PHE D 3 33 ? -5.757  -3.816  14.912  1.00 22.63 ? 124 PHE B CZ    1 
ATOM   1636 N  N     . PHE D 3 34 ? -1.517  -2.675  11.405  1.00 7.31  ? 125 PHE B N     1 
ATOM   1637 C  CA    . PHE D 3 34 ? -2.146  -1.969  10.296  1.00 16.42 ? 125 PHE B CA    1 
ATOM   1638 C  C     . PHE D 3 34 ? -2.129  -2.857  9.040   1.00 24.38 ? 125 PHE B C     1 
ATOM   1639 O  O     . PHE D 3 34 ? -3.177  -3.166  8.472   1.00 29.12 ? 125 PHE B O     1 
ATOM   1640 C  CB    . PHE D 3 34 ? -1.409  -0.700  9.973   1.00 18.27 ? 125 PHE B CB    1 
ATOM   1641 C  CG    . PHE D 3 34 ? -2.089  0.140   8.949   1.00 27.17 ? 125 PHE B CG    1 
ATOM   1642 C  CD1   . PHE D 3 34 ? -1.817  -0.025  7.603   1.00 38.53 ? 125 PHE B CD1   1 
ATOM   1643 C  CD2   . PHE D 3 34 ? -3.008  1.105   9.324   1.00 35.62 ? 125 PHE B CD2   1 
ATOM   1644 C  CE1   . PHE D 3 34 ? -2.446  0.762   6.650   1.00 36.28 ? 125 PHE B CE1   1 
ATOM   1645 C  CE2   . PHE D 3 34 ? -3.642  1.898   8.373   1.00 30.57 ? 125 PHE B CE2   1 
ATOM   1646 C  CZ    . PHE D 3 34 ? -3.361  1.728   7.043   1.00 31.03 ? 125 PHE B CZ    1 
ATOM   1647 N  N     . ARG D 3 35 ? -0.951  -3.296  8.610   1.00 23.52 ? 126 ARG B N     1 
ATOM   1648 C  CA    . ARG D 3 35 ? -0.893  -4.131  7.416   1.00 23.93 ? 126 ARG B CA    1 
ATOM   1649 C  C     . ARG D 3 35 ? -1.888  -5.255  7.458   1.00 25.22 ? 126 ARG B C     1 
ATOM   1650 O  O     . ARG D 3 35 ? -2.610  -5.481  6.506   1.00 31.83 ? 126 ARG B O     1 
ATOM   1651 C  CB    . ARG D 3 35 ? 0.475   -4.778  7.218   1.00 33.58 ? 126 ARG B CB    1 
ATOM   1652 C  CG    . ARG D 3 35 ? 0.551   -5.645  5.945   1.00 29.66 ? 126 ARG B CG    1 
ATOM   1653 C  CD    . ARG D 3 35 ? 1.853   -6.468  5.886   1.00 33.13 ? 126 ARG B CD    1 
ATOM   1654 N  NE    . ARG D 3 35 ? 1.794   -7.736  6.616   1.00 23.34 ? 126 ARG B NE    1 
ATOM   1655 C  CZ    . ARG D 3 35 ? 2.644   -8.097  7.587   1.00 37.46 ? 126 ARG B CZ    1 
ATOM   1656 N  NH1   . ARG D 3 35 ? 3.640   -7.297  7.976   1.00 20.56 ? 126 ARG B NH1   1 
ATOM   1657 N  NH2   . ARG D 3 35 ? 2.514   -9.286  8.168   1.00 41.48 ? 126 ARG B NH2   1 
ATOM   1658 N  N     . ARG D 3 36 ? -1.916  -5.973  8.566   1.00 24.60 ? 127 ARG B N     1 
ATOM   1659 C  CA    . ARG D 3 36 ? -2.790  -7.134  8.683   1.00 24.53 ? 127 ARG B CA    1 
ATOM   1660 C  C     . ARG D 3 36 ? -4.270  -6.713  8.623   1.00 28.36 ? 127 ARG B C     1 
ATOM   1661 O  O     . ARG D 3 36 ? -5.119  -7.429  8.090   1.00 17.72 ? 127 ARG B O     1 
ATOM   1662 C  CB    . ARG D 3 36 ? -2.470  -7.853  9.991   1.00 17.22 ? 127 ARG B CB    1 
ATOM   1663 C  CG    . ARG D 3 36 ? -2.712  -9.335  9.973   1.00 27.33 ? 127 ARG B CG    1 
ATOM   1664 C  CD    . ARG D 3 36 ? -2.536  -9.977  11.370  1.00 27.61 ? 127 ARG B CD    1 
ATOM   1665 N  NE    . ARG D 3 36 ? -1.238  -9.751  12.009  1.00 29.93 ? 127 ARG B NE    1 
ATOM   1666 C  CZ    . ARG D 3 36 ? -0.877  -8.618  12.604  1.00 37.80 ? 127 ARG B CZ    1 
ATOM   1667 N  NH1   . ARG D 3 36 ? -1.713  -7.595  12.650  1.00 44.84 ? 127 ARG B NH1   1 
ATOM   1668 N  NH2   . ARG D 3 36 ? 0.322   -8.497  13.149  1.00 34.18 ? 127 ARG B NH2   1 
ATOM   1669 N  N     . SER D 3 37 ? -4.544  -5.525  9.144   1.00 25.89 ? 128 SER B N     1 
ATOM   1670 C  CA    . SER D 3 37 ? -5.877  -4.977  9.188   1.00 31.20 ? 128 SER B CA    1 
ATOM   1671 C  C     . SER D 3 37 ? -6.436  -4.613  7.827   1.00 39.14 ? 128 SER B C     1 
ATOM   1672 O  O     . SER D 3 37 ? -7.580  -4.936  7.535   1.00 49.25 ? 128 SER B O     1 
ATOM   1673 C  CB    . SER D 3 37 ? -5.890  -3.741  10.080  1.00 28.17 ? 128 SER B CB    1 
ATOM   1674 O  OG    . SER D 3 37 ? -5.526  -4.084  11.407  1.00 33.32 ? 128 SER B OG    1 
ATOM   1675 N  N     . ILE D 3 38 ? -5.648  -3.925  7.000   1.00 37.04 ? 129 ILE B N     1 
ATOM   1676 C  CA    . ILE D 3 38 ? -6.117  -3.527  5.679   1.00 28.09 ? 129 ILE B CA    1 
ATOM   1677 C  C     . ILE D 3 38 ? -5.957  -4.627  4.653   1.00 31.05 ? 129 ILE B C     1 
ATOM   1678 O  O     . ILE D 3 38 ? -6.633  -4.633  3.637   1.00 40.84 ? 129 ILE B O     1 
ATOM   1679 C  CB    . ILE D 3 38 ? -5.354  -2.312  5.132   1.00 27.48 ? 129 ILE B CB    1 
ATOM   1680 C  CG1   . ILE D 3 38 ? -3.866  -2.629  5.009   1.00 25.49 ? 129 ILE B CG1   1 
ATOM   1681 C  CG2   . ILE D 3 38 ? -5.542  -1.124  6.015   1.00 26.18 ? 129 ILE B CG2   1 
ATOM   1682 C  CD1   . ILE D 3 38 ? -3.079  -1.461  4.446   1.00 20.38 ? 129 ILE B CD1   1 
ATOM   1683 N  N     . GLN D 3 39 ? -5.080  -5.573  4.929   1.00 36.38 ? 130 GLN B N     1 
ATOM   1684 C  CA    . GLN D 3 39 ? -4.785  -6.630  3.979   1.00 44.33 ? 130 GLN B CA    1 
ATOM   1685 C  C     . GLN D 3 39 ? -5.742  -7.787  3.948   1.00 46.82 ? 130 GLN B C     1 
ATOM   1686 O  O     . GLN D 3 39 ? -5.399  -8.839  3.421   1.00 55.70 ? 130 GLN B O     1 
ATOM   1687 C  CB    . GLN D 3 39 ? -3.372  -7.162  4.226   1.00 44.46 ? 130 GLN B CB    1 
ATOM   1688 C  CG    . GLN D 3 39 ? -2.760  -7.906  3.059   1.00 49.32 ? 130 GLN B CG    1 
ATOM   1689 C  CD    . GLN D 3 39 ? -1.298  -8.239  3.305   1.00 54.62 ? 130 GLN B CD    1 
ATOM   1690 O  OE1   . GLN D 3 39 ? -0.503  -7.358  3.650   1.00 53.73 ? 130 GLN B OE1   1 
ATOM   1691 N  NE2   . GLN D 3 39 ? -0.930  -9.510  3.116   1.00 46.02 ? 130 GLN B NE2   1 
ATOM   1692 N  N     . GLN D 3 40 ? -6.940  -7.606  4.492   1.00 54.93 ? 131 GLN B N     1 
ATOM   1693 C  CA    . GLN D 3 40 ? -7.936  -8.684  4.508   1.00 57.75 ? 131 GLN B CA    1 
ATOM   1694 C  C     . GLN D 3 40 ? -9.354  -8.177  4.750   1.00 59.32 ? 131 GLN B C     1 
ATOM   1695 O  O     . GLN D 3 40 ? -9.588  -6.970  4.908   1.00 56.74 ? 131 GLN B O     1 
ATOM   1696 C  CB    . GLN D 3 40 ? -7.565  -9.731  5.575   1.00 53.97 ? 131 GLN B CB    1 
ATOM   1697 C  CG    . GLN D 3 40 ? -6.364  -10.594 5.200   1.00 52.34 ? 131 GLN B CG    1 
ATOM   1698 C  CD    . GLN D 3 40 ? -5.691  -11.321 6.349   1.00 49.07 ? 131 GLN B CD    1 
ATOM   1699 O  OE1   . GLN D 3 40 ? -5.665  -12.554 6.388   1.00 49.07 ? 131 GLN B OE1   1 
ATOM   1700 N  NE2   . GLN D 3 40 ? -5.154  -10.562 7.296   1.00 43.48 ? 131 GLN B NE2   1 
ATOM   1701 N  N     . ASN D 3 41 ? -10.304 -9.107  4.754   1.00 61.41 ? 132 ASN B N     1 
ATOM   1702 C  CA    . ASN D 3 41 ? -11.698 -8.763  4.996   1.00 64.38 ? 132 ASN B CA    1 
ATOM   1703 C  C     . ASN D 3 41 ? -11.835 -8.685  6.517   1.00 65.95 ? 132 ASN B C     1 
ATOM   1704 O  O     . ASN D 3 41 ? -12.930 -8.819  7.089   1.00 62.46 ? 132 ASN B O     1 
ATOM   1705 C  CB    . ASN D 3 41 ? -12.620 -9.840  4.417   1.00 61.03 ? 132 ASN B CB    1 
ATOM   1706 C  CG    . ASN D 3 41 ? -12.371 -11.196 5.020   1.00 58.19 ? 132 ASN B CG    1 
ATOM   1707 O  OD1   . ASN D 3 41 ? -11.277 -11.732 4.927   1.00 60.01 ? 132 ASN B OD1   1 
ATOM   1708 N  ND2   . ASN D 3 41 ? -13.390 -11.761 5.645   1.00 70.10 ? 132 ASN B ND2   1 
ATOM   1709 N  N     . ILE D 3 42 ? -10.687 -8.453  7.151   1.00 61.95 ? 133 ILE B N     1 
ATOM   1710 C  CA    . ILE D 3 42 ? -10.584 -8.347  8.591   1.00 58.82 ? 133 ILE B CA    1 
ATOM   1711 C  C     . ILE D 3 42 ? -11.403 -7.227  9.223   1.00 57.54 ? 133 ILE B C     1 
ATOM   1712 O  O     . ILE D 3 42 ? -10.987 -6.069  9.235   1.00 47.91 ? 133 ILE B O     1 
ATOM   1713 C  CB    . ILE D 3 42 ? -9.115  -8.189  9.013   1.00 57.55 ? 133 ILE B CB    1 
ATOM   1714 C  CG1   . ILE D 3 42 ? -8.364  -9.488  8.733   1.00 59.85 ? 133 ILE B CG1   1 
ATOM   1715 C  CG2   . ILE D 3 42 ? -9.020  -7.857  10.480  1.00 62.52 ? 133 ILE B CG2   1 
ATOM   1716 C  CD1   . ILE D 3 42 ? -6.930  -9.468  9.189   1.00 55.15 ? 133 ILE B CD1   1 
ATOM   1717 N  N     . GLN D 3 43 A -12.574 -7.595  9.744   1.00 60.28 ? 133 GLN B N     1 
ATOM   1718 C  CA    . GLN D 3 43 A -13.456 -6.658  10.433  1.00 58.46 ? 133 GLN B CA    1 
ATOM   1719 C  C     . GLN D 3 43 A -13.555 -7.097  11.892  1.00 53.54 ? 133 GLN B C     1 
ATOM   1720 O  O     . GLN D 3 43 A -14.120 -8.137  12.221  1.00 48.79 ? 133 GLN B O     1 
ATOM   1721 C  CB    . GLN D 3 43 A -14.836 -6.592  9.759   1.00 60.98 ? 133 GLN B CB    1 
ATOM   1722 C  CG    . GLN D 3 43 A -14.797 -5.818  8.437   1.00 62.33 ? 133 GLN B CG    1 
ATOM   1723 C  CD    . GLN D 3 43 A -16.134 -5.624  7.740   1.00 65.79 ? 133 GLN B CD    1 
ATOM   1724 O  OE1   . GLN D 3 43 A -16.298 -5.979  6.573   1.00 71.62 ? 133 GLN B OE1   1 
ATOM   1725 N  NE2   . GLN D 3 43 A -17.108 -5.083  8.467   1.00 71.28 ? 133 GLN B NE2   1 
ATOM   1726 N  N     . TYR D 3 44 ? -12.957 -6.275  12.745  1.00 52.08 ? 134 TYR B N     1 
ATOM   1727 C  CA    . TYR D 3 44 ? -12.869 -6.487  14.182  1.00 48.80 ? 134 TYR B CA    1 
ATOM   1728 C  C     . TYR D 3 44 ? -14.186 -6.282  14.901  1.00 49.22 ? 134 TYR B C     1 
ATOM   1729 O  O     . TYR D 3 44 ? -15.077 -5.604  14.393  1.00 53.43 ? 134 TYR B O     1 
ATOM   1730 C  CB    . TYR D 3 44 ? -11.821 -5.523  14.754  1.00 46.87 ? 134 TYR B CB    1 
ATOM   1731 C  CG    . TYR D 3 44 ? -10.447 -5.671  14.127  1.00 43.61 ? 134 TYR B CG    1 
ATOM   1732 C  CD1   . TYR D 3 44 ? -9.756  -6.879  14.196  1.00 41.78 ? 134 TYR B CD1   1 
ATOM   1733 C  CD2   . TYR D 3 44 ? -9.849  -4.611  13.454  1.00 36.66 ? 134 TYR B CD2   1 
ATOM   1734 C  CE1   . TYR D 3 44 ? -8.507  -7.030  13.613  1.00 40.37 ? 134 TYR B CE1   1 
ATOM   1735 C  CE2   . TYR D 3 44 ? -8.597  -4.752  12.865  1.00 37.46 ? 134 TYR B CE2   1 
ATOM   1736 C  CZ    . TYR D 3 44 ? -7.933  -5.962  12.949  1.00 38.95 ? 134 TYR B CZ    1 
ATOM   1737 O  OH    . TYR D 3 44 ? -6.698  -6.116  12.367  1.00 36.96 ? 134 TYR B OH    1 
ATOM   1738 N  N     . LYS D 3 45 ? -14.312 -6.870  16.087  1.00 49.25 ? 135 LYS B N     1 
ATOM   1739 C  CA    . LYS D 3 45 ? -15.533 -6.696  16.863  1.00 51.65 ? 135 LYS B CA    1 
ATOM   1740 C  C     . LYS D 3 45 ? -15.675 -5.212  17.096  1.00 53.20 ? 135 LYS B C     1 
ATOM   1741 O  O     . LYS D 3 45 ? -14.713 -4.467  16.922  1.00 57.27 ? 135 LYS B O     1 
ATOM   1742 C  CB    . LYS D 3 45 ? -15.459 -7.395  18.226  1.00 47.33 ? 135 LYS B CB    1 
ATOM   1743 C  CG    . LYS D 3 45 ? -15.420 -8.904  18.166  1.00 47.07 ? 135 LYS B CG    1 
ATOM   1744 C  CD    . LYS D 3 45 ? -14.025 -9.420  17.930  1.00 57.20 ? 135 LYS B CD    1 
ATOM   1745 C  CE    . LYS D 3 45 ? -13.127 -9.071  19.108  1.00 63.56 ? 135 LYS B CE    1 
ATOM   1746 N  NZ    . LYS D 3 45 ? -13.651 -9.661  20.365  1.00 58.63 ? 135 LYS B NZ    1 
ATOM   1747 N  N     . ARG D 3 46 ? -16.866 -4.774  17.486  1.00 53.47 ? 136 ARG B N     1 
ATOM   1748 C  CA    . ARG D 3 46 ? -17.076 -3.363  17.748  1.00 50.43 ? 136 ARG B CA    1 
ATOM   1749 C  C     . ARG D 3 46 ? -16.304 -3.017  19.003  1.00 48.00 ? 136 ARG B C     1 
ATOM   1750 O  O     . ARG D 3 46 ? -15.573 -3.839  19.550  1.00 52.31 ? 136 ARG B O     1 
ATOM   1751 C  CB    . ARG D 3 46 ? -18.555 -3.065  17.977  1.00 53.77 ? 136 ARG B CB    1 
ATOM   1752 C  CG    . ARG D 3 46 ? -19.442 -3.589  16.882  1.00 62.00 ? 136 ARG B CG    1 
ATOM   1753 C  CD    . ARG D 3 46 ? -20.881 -3.175  17.057  1.00 63.78 ? 136 ARG B CD    1 
ATOM   1754 N  NE    . ARG D 3 46 ? -21.726 -3.817  16.058  1.00 64.22 ? 136 ARG B NE    1 
ATOM   1755 C  CZ    . ARG D 3 46 ? -23.030 -3.597  15.938  1.00 68.81 ? 136 ARG B CZ    1 
ATOM   1756 N  NH1   . ARG D 3 46 ? -23.636 -2.745  16.757  1.00 71.08 ? 136 ARG B NH1   1 
ATOM   1757 N  NH2   . ARG D 3 46 ? -23.729 -4.242  15.013  1.00 68.15 ? 136 ARG B NH2   1 
ATOM   1758 N  N     . CYS D 3 47 ? -16.486 -1.795  19.466  1.00 46.39 ? 137 CYS B N     1 
ATOM   1759 C  CA    . CYS D 3 47 ? -15.814 -1.336  20.654  1.00 42.21 ? 137 CYS B CA    1 
ATOM   1760 C  C     . CYS D 3 47 ? -16.795 -1.034  21.791  1.00 44.71 ? 137 CYS B C     1 
ATOM   1761 O  O     . CYS D 3 47 ? -17.544 -0.057  21.754  1.00 50.09 ? 137 CYS B O     1 
ATOM   1762 C  CB    . CYS D 3 47 ? -14.997 -0.105  20.306  1.00 33.36 ? 137 CYS B CB    1 
ATOM   1763 S  SG    . CYS D 3 47 ? -14.376 0.815   21.738  1.00 44.24 ? 137 CYS B SG    1 
ATOM   1764 N  N     . LEU D 3 48 ? -16.775 -1.889  22.806  1.00 45.23 ? 138 LEU B N     1 
ATOM   1765 C  CA    . LEU D 3 48 ? -17.629 -1.756  23.985  1.00 40.25 ? 138 LEU B CA    1 
ATOM   1766 C  C     . LEU D 3 48 ? -17.705 -0.340  24.550  1.00 36.73 ? 138 LEU B C     1 
ATOM   1767 O  O     . LEU D 3 48 ? -18.520 -0.068  25.427  1.00 41.59 ? 138 LEU B O     1 
ATOM   1768 C  CB    . LEU D 3 48 ? -17.132 -2.701  25.082  1.00 40.45 ? 138 LEU B CB    1 
ATOM   1769 C  CG    . LEU D 3 48 ? -17.343 -4.218  24.984  1.00 44.49 ? 138 LEU B CG    1 
ATOM   1770 C  CD1   . LEU D 3 48 ? -17.287 -4.721  23.541  1.00 43.83 ? 138 LEU B CD1   1 
ATOM   1771 C  CD2   . LEU D 3 48 ? -16.277 -4.881  25.865  1.00 44.18 ? 138 LEU B CD2   1 
ATOM   1772 N  N     . LYS D 3 49 ? -16.865 0.564   24.074  1.00 21.44 ? 139 LYS B N     1 
ATOM   1773 C  CA    . LYS D 3 49 ? -16.915 1.931   24.585  1.00 25.96 ? 139 LYS B CA    1 
ATOM   1774 C  C     . LYS D 3 49 ? -17.233 2.970   23.524  1.00 25.25 ? 139 LYS B C     1 
ATOM   1775 O  O     . LYS D 3 49 ? -16.956 4.167   23.694  1.00 26.01 ? 139 LYS B O     1 
ATOM   1776 C  CB    . LYS D 3 49 ? -15.595 2.276   25.263  1.00 29.99 ? 139 LYS B CB    1 
ATOM   1777 C  CG    . LYS D 3 49 ? -15.386 1.530   26.551  1.00 43.30 ? 139 LYS B CG    1 
ATOM   1778 C  CD    . LYS D 3 49 ? -16.434 1.922   27.560  1.00 46.03 ? 139 LYS B CD    1 
ATOM   1779 C  CE    . LYS D 3 49 ? -16.266 1.146   28.849  1.00 53.83 ? 139 LYS B CE    1 
ATOM   1780 N  NZ    . LYS D 3 49 ? -17.115 2.053   29.673  1.00 53.30 ? 139 LYS B NZ    1 
ATOM   1781 N  N     . ASN D 3 50 ? -17.833 2.523   22.428  1.00 25.62 ? 140 ASN B N     1 
ATOM   1782 C  CA    . ASN D 3 50 ? -18.147 3.455   21.356  1.00 33.87 ? 140 ASN B CA    1 
ATOM   1783 C  C     . ASN D 3 50 ? -16.849 4.159   20.889  1.00 26.64 ? 140 ASN B C     1 
ATOM   1784 O  O     . ASN D 3 50 ? -16.833 5.383   20.747  1.00 14.42 ? 140 ASN B O     1 
ATOM   1785 C  CB    . ASN D 3 50 ? -19.140 4.511   21.866  1.00 44.66 ? 140 ASN B CB    1 
ATOM   1786 C  CG    . ASN D 3 50 ? -20.293 3.899   22.663  1.00 49.56 ? 140 ASN B CG    1 
ATOM   1787 O  OD1   . ASN D 3 50 ? -21.171 3.234   22.112  1.00 47.56 ? 140 ASN B OD1   1 
ATOM   1788 N  ND2   . ASN D 3 50 ? -20.272 4.105   23.974  1.00 45.44 ? 140 ASN B ND2   1 
ATOM   1789 N  N     . GLU D 3 51 ? -15.767 3.389   20.719  1.00 19.17 ? 141 GLU B N     1 
ATOM   1790 C  CA    . GLU D 3 51 ? -14.458 3.896   20.223  1.00 16.26 ? 141 GLU B CA    1 
ATOM   1791 C  C     . GLU D 3 51 ? -13.881 5.165   20.831  1.00 15.22 ? 141 GLU B C     1 
ATOM   1792 O  O     . GLU D 3 51 ? -13.664 6.140   20.110  1.00 13.05 ? 141 GLU B O     1 
ATOM   1793 C  CB    . GLU D 3 51 ? -14.552 4.125   18.720  1.00 6.56  ? 141 GLU B CB    1 
ATOM   1794 C  CG    . GLU D 3 51 ? -15.309 3.003   18.042  1.00 12.18 ? 141 GLU B CG    1 
ATOM   1795 C  CD    . GLU D 3 51 ? -15.600 3.317   16.619  1.00 14.82 ? 141 GLU B CD    1 
ATOM   1796 O  OE1   . GLU D 3 51 ? -15.610 4.516   16.284  1.00 19.88 ? 141 GLU B OE1   1 
ATOM   1797 O  OE2   . GLU D 3 51 ? -15.847 2.367   15.856  1.00 19.21 ? 141 GLU B OE2   1 
ATOM   1798 N  N     . ASN D 3 52 ? -13.631 5.162   22.140  1.00 19.25 ? 142 ASN B N     1 
ATOM   1799 C  CA    . ASN D 3 52 ? -13.055 6.320   22.829  1.00 22.22 ? 142 ASN B CA    1 
ATOM   1800 C  C     . ASN D 3 52 ? -11.788 5.885   23.562  1.00 13.20 ? 142 ASN B C     1 
ATOM   1801 O  O     . ASN D 3 52 ? -11.144 6.671   24.264  1.00 12.84 ? 142 ASN B O     1 
ATOM   1802 C  CB    . ASN D 3 52 ? -14.053 6.902   23.837  1.00 16.20 ? 142 ASN B CB    1 
ATOM   1803 C  CG    . ASN D 3 52 ? -15.262 7.527   23.169  1.00 19.97 ? 142 ASN B CG    1 
ATOM   1804 O  OD1   . ASN D 3 52 ? -15.287 8.740   22.892  1.00 17.98 ? 142 ASN B OD1   1 
ATOM   1805 N  ND2   . ASN D 3 52 ? -16.267 6.707   22.893  1.00 24.10 ? 142 ASN B ND2   1 
ATOM   1806 N  N     . CYS D 3 53 ? -11.437 4.620   23.412  1.00 16.13 ? 143 CYS B N     1 
ATOM   1807 C  CA    . CYS D 3 53 ? -10.245 4.106   24.060  1.00 19.68 ? 143 CYS B CA    1 
ATOM   1808 C  C     . CYS D 3 53 ? -9.044  5.008   23.785  1.00 22.60 ? 143 CYS B C     1 
ATOM   1809 O  O     . CYS D 3 53 ? -9.094  5.908   22.948  1.00 28.73 ? 143 CYS B O     1 
ATOM   1810 C  CB    . CYS D 3 53 ? -9.966  2.716   23.541  1.00 23.31 ? 143 CYS B CB    1 
ATOM   1811 S  SG    . CYS D 3 53 ? -11.364 1.579   23.743  1.00 33.53 ? 143 CYS B SG    1 
ATOM   1812 N  N     . SER D 3 54 ? -7.972  4.795   24.525  1.00 23.52 ? 144 SER B N     1 
ATOM   1813 C  CA    . SER D 3 54 ? -6.754  5.565   24.321  1.00 25.47 ? 144 SER B CA    1 
ATOM   1814 C  C     . SER D 3 54 ? -5.721  4.498   23.967  1.00 22.59 ? 144 SER B C     1 
ATOM   1815 O  O     . SER D 3 54 ? -5.950  3.315   24.217  1.00 22.46 ? 144 SER B O     1 
ATOM   1816 C  CB    . SER D 3 54 ? -6.351  6.265   25.604  1.00 23.93 ? 144 SER B CB    1 
ATOM   1817 O  OG    . SER D 3 54 ? -6.046  5.288   26.578  1.00 33.51 ? 144 SER B OG    1 
ATOM   1818 N  N     . ILE D 3 55 ? -4.594  4.885   23.376  1.00 33.74 ? 145 ILE B N     1 
ATOM   1819 C  CA    . ILE D 3 55 ? -3.580  3.884   23.018  1.00 26.43 ? 145 ILE B CA    1 
ATOM   1820 C  C     . ILE D 3 55 ? -2.211  4.221   23.596  1.00 22.91 ? 145 ILE B C     1 
ATOM   1821 O  O     . ILE D 3 55 ? -1.715  5.346   23.464  1.00 16.53 ? 145 ILE B O     1 
ATOM   1822 C  CB    . ILE D 3 55 ? -3.410  3.750   21.515  1.00 23.79 ? 145 ILE B CB    1 
ATOM   1823 C  CG1   . ILE D 3 55 ? -4.733  3.495   20.789  1.00 9.16  ? 145 ILE B CG1   1 
ATOM   1824 C  CG2   . ILE D 3 55 ? -2.488  2.592   21.131  1.00 28.81 ? 145 ILE B CG2   1 
ATOM   1825 C  CD1   . ILE D 3 55 ? -5.264  2.073   20.991  1.00 16.44 ? 145 ILE B CD1   1 
ATOM   1826 N  N     . VAL D 3 56 ? -1.678  3.201   24.213  1.00 25.14 ? 146 VAL B N     1 
ATOM   1827 C  CA    . VAL D 3 56 ? -0.349  3.195   24.810  1.00 19.48 ? 146 VAL B CA    1 
ATOM   1828 C  C     . VAL D 3 56 ? 0.157   1.780   24.652  1.00 21.50 ? 146 VAL B C     1 
ATOM   1829 O  O     . VAL D 3 56 ? -0.591  0.886   24.243  1.00 16.92 ? 146 VAL B O     1 
ATOM   1830 C  CB    . VAL D 3 56 ? -0.424  3.615   26.274  1.00 26.29 ? 146 VAL B CB    1 
ATOM   1831 C  CG1   . VAL D 3 56 ? 0.955   3.736   26.926  1.00 31.66 ? 146 VAL B CG1   1 
ATOM   1832 C  CG2   . VAL D 3 56 ? -1.099  4.973   26.466  1.00 23.22 ? 146 VAL B CG2   1 
ATOM   1833 N  N     . ARG D 3 57 ? 1.393   1.569   24.980  1.00 26.28 ? 147 ARG B N     1 
ATOM   1834 C  CA    . ARG D 3 57 ? 2.004   0.262   24.754  1.00 23.58 ? 147 ARG B CA    1 
ATOM   1835 C  C     . ARG D 3 57 ? 1.290   -0.903  25.442  1.00 24.25 ? 147 ARG B C     1 
ATOM   1836 O  O     . ARG D 3 57 ? 1.085   -1.959  24.830  1.00 21.58 ? 147 ARG B O     1 
ATOM   1837 C  CB    . ARG D 3 57 ? 3.452   0.233   25.216  1.00 18.82 ? 147 ARG B CB    1 
ATOM   1838 C  CG    . ARG D 3 57 ? 4.259   -0.852  24.499  1.00 29.27 ? 147 ARG B CG    1 
ATOM   1839 C  CD    . ARG D 3 57 ? 5.692   -0.944  25.002  1.00 34.50 ? 147 ARG B CD    1 
ATOM   1840 N  NE    . ARG D 3 57 ? 5.768   -1.321  26.412  1.00 44.67 ? 147 ARG B NE    1 
ATOM   1841 C  CZ    . ARG D 3 57 ? 5.568   -2.563  26.854  1.00 53.82 ? 147 ARG B CZ    1 
ATOM   1842 N  NH1   . ARG D 3 57 ? 5.293   -3.559  26.001  1.00 43.53 ? 147 ARG B NH1   1 
ATOM   1843 N  NH2   . ARG D 3 57 ? 5.620   -2.908  28.145  1.00 57.99 ? 147 ARG B NH2   1 
ATOM   1844 N  N     . ILE D 3 58 ? 0.908   -0.712  26.705  1.00 28.64 ? 148 ILE B N     1 
ATOM   1845 C  CA    . ILE D 3 58 ? 0.269   -1.765  27.493  1.00 26.57 ? 148 ILE B CA    1 
ATOM   1846 C  C     . ILE D 3 58 ? -1.147  -2.179  27.111  1.00 24.99 ? 148 ILE B C     1 
ATOM   1847 O  O     . ILE D 3 58 ? -1.491  -3.359  27.222  1.00 15.64 ? 148 ILE B O     1 
ATOM   1848 C  CB    . ILE D 3 58 ? 0.286   -1.421  29.002  1.00 35.16 ? 148 ILE B CB    1 
ATOM   1849 C  CG1   . ILE D 3 58 ? -0.523  -0.154  29.270  1.00 41.44 ? 148 ILE B CG1   1 
ATOM   1850 C  CG2   . ILE D 3 58 ? 1.720   -1.223  29.473  1.00 33.64 ? 148 ILE B CG2   1 
ATOM   1851 C  CD1   . ILE D 3 58 ? -0.020  1.087   28.572  1.00 44.15 ? 148 ILE B CD1   1 
ATOM   1852 N  N     . ASN D 3 59 ? -1.963  -1.243  26.634  1.00 25.99 ? 149 ASN B N     1 
ATOM   1853 C  CA    . ASN D 3 59 ? -3.341  -1.592  26.272  1.00 32.12 ? 149 ASN B CA    1 
ATOM   1854 C  C     . ASN D 3 59 ? -3.618  -1.590  24.768  1.00 35.48 ? 149 ASN B C     1 
ATOM   1855 O  O     . ASN D 3 59 ? -4.761  -1.814  24.342  1.00 27.20 ? 149 ASN B O     1 
ATOM   1856 C  CB    . ASN D 3 59 ? -4.317  -0.613  26.925  1.00 32.97 ? 149 ASN B CB    1 
ATOM   1857 C  CG    . ASN D 3 59 ? -4.326  0.749   26.276  1.00 31.31 ? 149 ASN B CG    1 
ATOM   1858 O  OD1   . ASN D 3 59 ? -4.183  1.752   26.956  1.00 35.56 ? 149 ASN B OD1   1 
ATOM   1859 N  ND2   . ASN D 3 59 ? -4.477  0.793   24.957  1.00 34.96 ? 149 ASN B ND2   1 
ATOM   1860 N  N     . ARG D 3 60 ? -2.575  -1.342  23.975  1.00 33.23 ? 150 ARG B N     1 
ATOM   1861 C  CA    . ARG D 3 60 ? -2.693  -1.247  22.517  1.00 16.25 ? 150 ARG B CA    1 
ATOM   1862 C  C     . ARG D 3 60 ? -3.295  -2.478  21.854  1.00 7.00  ? 150 ARG B C     1 
ATOM   1863 O  O     . ARG D 3 60 ? -3.669  -2.428  20.699  1.00 23.01 ? 150 ARG B O     1 
ATOM   1864 C  CB    . ARG D 3 60 ? -1.318  -0.928  21.907  1.00 20.59 ? 150 ARG B CB    1 
ATOM   1865 C  CG    . ARG D 3 60 ? -0.387  -2.124  21.846  1.00 6.77  ? 150 ARG B CG    1 
ATOM   1866 C  CD    . ARG D 3 60 ? 1.014   -1.766  21.366  1.00 18.73 ? 150 ARG B CD    1 
ATOM   1867 N  NE    . ARG D 3 60 ? 1.737   -3.003  21.029  1.00 22.44 ? 150 ARG B NE    1 
ATOM   1868 C  CZ    . ARG D 3 60 ? 3.039   -3.074  20.769  1.00 19.44 ? 150 ARG B CZ    1 
ATOM   1869 N  NH1   . ARG D 3 60 ? 3.787   -1.976  20.805  1.00 16.65 ? 150 ARG B NH1   1 
ATOM   1870 N  NH2   . ARG D 3 60 ? 3.590   -4.246  20.470  1.00 24.65 ? 150 ARG B NH2   1 
ATOM   1871 N  N     . ASN D 3 61 ? -3.389  -3.592  22.565  1.00 11.13 ? 151 ASN B N     1 
ATOM   1872 C  CA    . ASN D 3 61 ? -3.984  -4.799  21.980  1.00 15.96 ? 151 ASN B CA    1 
ATOM   1873 C  C     . ASN D 3 61 ? -5.358  -5.084  22.634  1.00 22.66 ? 151 ASN B C     1 
ATOM   1874 O  O     . ASN D 3 61 ? -6.038  -6.067  22.287  1.00 10.60 ? 151 ASN B O     1 
ATOM   1875 C  CB    . ASN D 3 61 ? -3.088  -6.022  22.205  1.00 20.25 ? 151 ASN B CB    1 
ATOM   1876 C  CG    . ASN D 3 61 ? -1.670  -5.728  21.710  1.00 34.84 ? 151 ASN B CG    1 
ATOM   1877 O  OD1   . ASN D 3 61 ? -1.424  -4.713  21.019  1.00 22.53 ? 151 ASN B OD1   1 
ATOM   1878 N  ND2   . ASN D 3 61 ? -0.734  -6.607  22.055  1.00 27.81 ? 151 ASN B ND2   1 
ATOM   1879 N  N     . ARG D 3 62 ? -5.764  -4.245  23.588  1.00 20.07 ? 152 ARG B N     1 
ATOM   1880 C  CA    . ARG D 3 62 ? -7.066  -4.475  24.223  1.00 34.41 ? 152 ARG B CA    1 
ATOM   1881 C  C     . ARG D 3 62 ? -8.186  -4.235  23.210  1.00 30.03 ? 152 ARG B C     1 
ATOM   1882 O  O     . ARG D 3 62 ? -8.890  -5.165  22.828  1.00 37.31 ? 152 ARG B O     1 
ATOM   1883 C  CB    . ARG D 3 62 ? -7.255  -3.593  25.454  1.00 35.63 ? 152 ARG B CB    1 
ATOM   1884 C  CG    . ARG D 3 62 ? -6.173  -3.779  26.530  1.00 44.84 ? 152 ARG B CG    1 
ATOM   1885 C  CD    . ARG D 3 62 ? -6.664  -3.231  27.871  1.00 58.11 ? 152 ARG B CD    1 
ATOM   1886 N  NE    . ARG D 3 62 ? -5.593  -2.949  28.826  1.00 60.86 ? 152 ARG B NE    1 
ATOM   1887 C  CZ    . ARG D 3 62 ? -4.648  -3.809  29.187  1.00 55.87 ? 152 ARG B CZ    1 
ATOM   1888 N  NH1   . ARG D 3 62 ? -4.630  -5.031  28.668  1.00 51.79 ? 152 ARG B NH1   1 
ATOM   1889 N  NH2   . ARG D 3 62 ? -3.724  -3.439  30.070  1.00 45.38 ? 152 ARG B NH2   1 
ATOM   1890 N  N     . CYS D 3 63 ? -8.355  -3.009  22.743  1.00 26.26 ? 153 CYS B N     1 
ATOM   1891 C  CA    . CYS D 3 63 ? -9.398  -2.793  21.749  1.00 21.68 ? 153 CYS B CA    1 
ATOM   1892 C  C     . CYS D 3 63 ? -8.791  -2.620  20.352  1.00 21.15 ? 153 CYS B C     1 
ATOM   1893 O  O     . CYS D 3 63 ? -8.217  -1.570  20.031  1.00 20.02 ? 153 CYS B O     1 
ATOM   1894 C  CB    . CYS D 3 63 ? -10.246 -1.559  22.100  1.00 25.55 ? 153 CYS B CB    1 
ATOM   1895 S  SG    . CYS D 3 63 ? -11.722 -1.315  21.030  1.00 18.90 ? 153 CYS B SG    1 
ATOM   1896 N  N     . GLN D 3 64 ? -8.924  -3.643  19.514  1.00 10.28 ? 154 GLN B N     1 
ATOM   1897 C  CA    . GLN D 3 64 ? -8.393  -3.543  18.171  1.00 16.41 ? 154 GLN B CA    1 
ATOM   1898 C  C     . GLN D 3 64 ? -9.042  -2.351  17.479  1.00 26.36 ? 154 GLN B C     1 
ATOM   1899 O  O     . GLN D 3 64 ? -8.403  -1.323  17.285  1.00 34.32 ? 154 GLN B O     1 
ATOM   1900 C  CB    . GLN D 3 64 ? -8.657  -4.837  17.430  1.00 4.50  ? 154 GLN B CB    1 
ATOM   1901 C  CG    . GLN D 3 64 ? -8.128  -5.976  18.227  1.00 10.41 ? 154 GLN B CG    1 
ATOM   1902 C  CD    . GLN D 3 64 ? -8.291  -7.292  17.552  1.00 25.05 ? 154 GLN B CD    1 
ATOM   1903 O  OE1   . GLN D 3 64 ? -9.336  -7.574  16.985  1.00 24.61 ? 154 GLN B OE1   1 
ATOM   1904 N  NE2   . GLN D 3 64 ? -7.264  -8.138  17.637  1.00 22.87 ? 154 GLN B NE2   1 
ATOM   1905 N  N     . GLN D 3 65 ? -10.317 -2.483  17.135  1.00 26.99 ? 155 GLN B N     1 
ATOM   1906 C  CA    . GLN D 3 65 ? -11.072 -1.411  16.490  1.00 22.95 ? 155 GLN B CA    1 
ATOM   1907 C  C     . GLN D 3 65 ? -10.515 -0.027  16.755  1.00 23.66 ? 155 GLN B C     1 
ATOM   1908 O  O     . GLN D 3 65 ? -10.349 0.768   15.839  1.00 28.21 ? 155 GLN B O     1 
ATOM   1909 C  CB    . GLN D 3 65 ? -12.519 -1.430  16.979  1.00 30.50 ? 155 GLN B CB    1 
ATOM   1910 C  CG    . GLN D 3 65 ? -13.537 -1.883  15.963  1.00 29.93 ? 155 GLN B CG    1 
ATOM   1911 C  CD    . GLN D 3 65 ? -13.581 -0.967  14.760  1.00 24.14 ? 155 GLN B CD    1 
ATOM   1912 O  OE1   . GLN D 3 65 ? -13.509 0.254   14.889  1.00 22.60 ? 155 GLN B OE1   1 
ATOM   1913 N  NE2   . GLN D 3 65 ? -13.723 -1.552  13.586  1.00 31.62 ? 155 GLN B NE2   1 
ATOM   1914 N  N     . CYS D 3 66 ? -10.243 0.280   18.015  1.00 21.26 ? 156 CYS B N     1 
ATOM   1915 C  CA    . CYS D 3 66 ? -9.747  1.609   18.323  1.00 26.26 ? 156 CYS B CA    1 
ATOM   1916 C  C     . CYS D 3 66 ? -8.313  1.855   17.888  1.00 24.83 ? 156 CYS B C     1 
ATOM   1917 O  O     . CYS D 3 66 ? -7.977  2.979   17.578  1.00 20.23 ? 156 CYS B O     1 
ATOM   1918 C  CB    . CYS D 3 66 ? -9.902  1.930   19.819  1.00 26.89 ? 156 CYS B CB    1 
ATOM   1919 S  SG    . CYS D 3 66 ? -11.552 2.541   20.382  1.00 34.17 ? 156 CYS B SG    1 
ATOM   1920 N  N     . ARG D 3 67 ? -7.475  0.818   17.891  1.00 12.91 ? 157 ARG B N     1 
ATOM   1921 C  CA    . ARG D 3 67 ? -6.090  0.955   17.464  1.00 26.25 ? 157 ARG B CA    1 
ATOM   1922 C  C     . ARG D 3 67 ? -6.139  1.268   15.957  1.00 28.92 ? 157 ARG B C     1 
ATOM   1923 O  O     . ARG D 3 67 ? -5.570  2.271   15.494  1.00 23.49 ? 157 ARG B O     1 
ATOM   1924 C  CB    . ARG D 3 67 ? -5.323  -0.361  17.698  1.00 23.46 ? 157 ARG B CB    1 
ATOM   1925 C  CG    . ARG D 3 67 ? -3.792  -0.313  17.452  1.00 30.35 ? 157 ARG B CG    1 
ATOM   1926 C  CD    . ARG D 3 67 ? -3.194  -1.740  17.501  1.00 25.14 ? 157 ARG B CD    1 
ATOM   1927 N  NE    . ARG D 3 67 ? -1.737  -1.774  17.655  1.00 20.27 ? 157 ARG B NE    1 
ATOM   1928 C  CZ    . ARG D 3 67 ? -1.042  -2.894  17.817  1.00 18.63 ? 157 ARG B CZ    1 
ATOM   1929 N  NH1   . ARG D 3 67 ? -1.656  -4.055  17.845  1.00 7.82  ? 157 ARG B NH1   1 
ATOM   1930 N  NH2   . ARG D 3 67 ? 0.270   -2.868  17.960  1.00 21.73 ? 157 ARG B NH2   1 
ATOM   1931 N  N     . PHE D 3 68 ? -6.834  0.417   15.199  1.00 24.72 ? 158 PHE B N     1 
ATOM   1932 C  CA    . PHE D 3 68 ? -6.925  0.623   13.761  1.00 29.19 ? 158 PHE B CA    1 
ATOM   1933 C  C     . PHE D 3 68 ? -7.444  2.011   13.457  1.00 31.81 ? 158 PHE B C     1 
ATOM   1934 O  O     . PHE D 3 68 ? -6.916  2.699   12.583  1.00 35.05 ? 158 PHE B O     1 
ATOM   1935 C  CB    . PHE D 3 68 ? -7.817  -0.420  13.100  1.00 16.20 ? 158 PHE B CB    1 
ATOM   1936 C  CG    . PHE D 3 68 ? -7.903  -0.266  11.603  1.00 35.87 ? 158 PHE B CG    1 
ATOM   1937 C  CD1   . PHE D 3 68 ? -6.775  0.084   10.863  1.00 38.05 ? 158 PHE B CD1   1 
ATOM   1938 C  CD2   . PHE D 3 68 ? -9.092  -0.497  10.924  1.00 36.18 ? 158 PHE B CD2   1 
ATOM   1939 C  CE1   . PHE D 3 68 ? -6.831  0.201   9.477   1.00 32.30 ? 158 PHE B CE1   1 
ATOM   1940 C  CE2   . PHE D 3 68 ? -9.154  -0.383  9.532   1.00 39.96 ? 158 PHE B CE2   1 
ATOM   1941 C  CZ    . PHE D 3 68 ? -8.022  -0.033  8.811   1.00 36.00 ? 158 PHE B CZ    1 
ATOM   1942 N  N     . LYS D 3 69 ? -8.477  2.416   14.188  1.00 24.74 ? 159 LYS B N     1 
ATOM   1943 C  CA    . LYS D 3 69 ? -9.060  3.738   14.025  1.00 23.66 ? 159 LYS B CA    1 
ATOM   1944 C  C     . LYS D 3 69 ? -8.033  4.781   14.393  1.00 20.03 ? 159 LYS B C     1 
ATOM   1945 O  O     . LYS D 3 69 ? -8.153  5.943   14.016  1.00 31.10 ? 159 LYS B O     1 
ATOM   1946 C  CB    . LYS D 3 69 ? -10.276 3.916   14.951  1.00 34.19 ? 159 LYS B CB    1 
ATOM   1947 C  CG    . LYS D 3 69 ? -10.645 5.390   15.198  1.00 29.11 ? 159 LYS B CG    1 
ATOM   1948 C  CD    . LYS D 3 69 ? -11.855 5.561   16.104  1.00 36.48 ? 159 LYS B CD    1 
ATOM   1949 C  CE    . LYS D 3 69 ? -12.137 7.047   16.309  1.00 41.40 ? 159 LYS B CE    1 
ATOM   1950 N  NZ    . LYS D 3 69 ? -13.378 7.355   17.074  1.00 27.10 ? 159 LYS B NZ    1 
ATOM   1951 N  N     . LYS D 3 70 ? -7.034  4.369   15.165  1.00 19.72 ? 160 LYS B N     1 
ATOM   1952 C  CA    . LYS D 3 70 ? -5.996  5.283   15.626  1.00 16.79 ? 160 LYS B CA    1 
ATOM   1953 C  C     . LYS D 3 70 ? -4.978  5.350   14.485  1.00 22.09 ? 160 LYS B C     1 
ATOM   1954 O  O     . LYS D 3 70 ? -4.532  6.435   14.086  1.00 20.64 ? 160 LYS B O     1 
ATOM   1955 C  CB    . LYS D 3 70 ? -5.397  4.740   16.938  1.00 11.62 ? 160 LYS B CB    1 
ATOM   1956 C  CG    . LYS D 3 70 ? -4.347  5.603   17.578  1.00 18.33 ? 160 LYS B CG    1 
ATOM   1957 C  CD    . LYS D 3 70 ? -4.839  6.979   17.884  1.00 25.03 ? 160 LYS B CD    1 
ATOM   1958 C  CE    . LYS D 3 70 ? -3.709  7.836   18.450  1.00 22.29 ? 160 LYS B CE    1 
ATOM   1959 N  NZ    . LYS D 3 70 ? -3.024  7.179   19.596  1.00 26.29 ? 160 LYS B NZ    1 
ATOM   1960 N  N     . CYS D 3 71 ? -4.637  4.189   13.937  1.00 18.57 ? 161 CYS B N     1 
ATOM   1961 C  CA    . CYS D 3 71 ? -3.724  4.162   12.823  1.00 19.08 ? 161 CYS B CA    1 
ATOM   1962 C  C     . CYS D 3 71 ? -4.255  5.087   11.733  1.00 25.54 ? 161 CYS B C     1 
ATOM   1963 O  O     . CYS D 3 71 ? -3.565  6.014   11.320  1.00 33.44 ? 161 CYS B O     1 
ATOM   1964 C  CB    . CYS D 3 71 ? -3.613  2.771   12.242  1.00 12.78 ? 161 CYS B CB    1 
ATOM   1965 S  SG    . CYS D 3 71 ? -2.873  1.553   13.296  1.00 19.10 ? 161 CYS B SG    1 
ATOM   1966 N  N     . LEU D 3 72 ? -5.482  4.847   11.269  1.00 26.04 ? 162 LEU B N     1 
ATOM   1967 C  CA    . LEU D 3 72 ? -6.051  5.668   10.199  1.00 9.95  ? 162 LEU B CA    1 
ATOM   1968 C  C     . LEU D 3 72 ? -6.139  7.100   10.659  1.00 17.49 ? 162 LEU B C     1 
ATOM   1969 O  O     . LEU D 3 72 ? -5.943  8.028   9.883   1.00 26.82 ? 162 LEU B O     1 
ATOM   1970 C  CB    . LEU D 3 72 ? -7.429  5.157   9.808   1.00 7.51  ? 162 LEU B CB    1 
ATOM   1971 C  CG    . LEU D 3 72 ? -7.489  3.680   9.401   1.00 26.50 ? 162 LEU B CG    1 
ATOM   1972 C  CD1   . LEU D 3 72 ? -8.923  3.213   9.284   1.00 16.23 ? 162 LEU B CD1   1 
ATOM   1973 C  CD2   . LEU D 3 72 ? -6.734  3.469   8.107   1.00 25.57 ? 162 LEU B CD2   1 
ATOM   1974 N  N     . SER D 3 73 ? -6.392  7.281   11.945  1.00 20.69 ? 163 SER B N     1 
ATOM   1975 C  CA    . SER D 3 73 ? -6.533  8.608   12.517  1.00 18.35 ? 163 SER B CA    1 
ATOM   1976 C  C     . SER D 3 73 ? -5.284  9.440   12.362  1.00 24.70 ? 163 SER B C     1 
ATOM   1977 O  O     . SER D 3 73 ? -5.357  10.660  12.239  1.00 28.51 ? 163 SER B O     1 
ATOM   1978 C  CB    . SER D 3 73 ? -6.880  8.502   14.013  1.00 30.01 ? 163 SER B CB    1 
ATOM   1979 O  OG    . SER D 3 73 ? -6.851  9.777   14.658  1.00 30.74 ? 163 SER B OG    1 
ATOM   1980 N  N     . VAL D 3 74 ? -4.133  8.784   12.386  1.00 22.92 ? 164 VAL B N     1 
ATOM   1981 C  CA    . VAL D 3 74 ? -2.856  9.489   12.290  1.00 26.07 ? 164 VAL B CA    1 
ATOM   1982 C  C     . VAL D 3 74 ? -2.309  9.649   10.846  1.00 29.57 ? 164 VAL B C     1 
ATOM   1983 O  O     . VAL D 3 74 ? -1.511  10.539  10.581  1.00 27.51 ? 164 VAL B O     1 
ATOM   1984 C  CB    . VAL D 3 74 ? -1.796  8.798   13.209  1.00 25.58 ? 164 VAL B CB    1 
ATOM   1985 C  CG1   . VAL D 3 74 ? -2.233  8.880   14.694  1.00 11.58 ? 164 VAL B CG1   1 
ATOM   1986 C  CG2   . VAL D 3 74 ? -1.656  7.349   12.828  1.00 9.52  ? 164 VAL B CG2   1 
ATOM   1987 N  N     . GLY D 3 75 ? -2.737  8.796   9.919   1.00 25.11 ? 165 GLY B N     1 
ATOM   1988 C  CA    . GLY D 3 75 ? -2.287  8.939   8.549   1.00 15.20 ? 165 GLY B CA    1 
ATOM   1989 C  C     . GLY D 3 75 ? -1.909  7.654   7.848   1.00 19.53 ? 165 GLY B C     1 
ATOM   1990 O  O     . GLY D 3 75 ? -1.737  7.615   6.632   1.00 23.25 ? 165 GLY B O     1 
ATOM   1991 N  N     . MET D 3 76 ? -1.782  6.578   8.598   1.00 10.56 ? 166 MET B N     1 
ATOM   1992 C  CA    . MET D 3 76 ? -1.370  5.355   7.970   1.00 15.61 ? 166 MET B CA    1 
ATOM   1993 C  C     . MET D 3 76 ? -2.165  4.953   6.750   1.00 19.84 ? 166 MET B C     1 
ATOM   1994 O  O     . MET D 3 76 ? -3.314  4.538   6.842   1.00 29.52 ? 166 MET B O     1 
ATOM   1995 C  CB    . MET D 3 76 ? -1.301  4.244   9.012   1.00 15.43 ? 166 MET B CB    1 
ATOM   1996 C  CG    . MET D 3 76 ? -0.272  4.617   10.049  1.00 18.55 ? 166 MET B CG    1 
ATOM   1997 S  SD    . MET D 3 76 ? 0.042   3.499   11.345  1.00 20.86 ? 166 MET B SD    1 
ATOM   1998 C  CE    . MET D 3 76 ? 0.247   1.977   10.535  1.00 2.89  ? 166 MET B CE    1 
ATOM   1999 N  N     . SER D 3 77 ? -1.514  5.073   5.595   1.00 22.41 ? 167 SER B N     1 
ATOM   2000 C  CA    . SER D 3 77 ? -2.109  4.724   4.313   1.00 18.03 ? 167 SER B CA    1 
ATOM   2001 C  C     . SER D 3 77 ? -1.127  4.017   3.406   1.00 29.56 ? 167 SER B C     1 
ATOM   2002 O  O     . SER D 3 77 ? 0.072   4.312   3.420   1.00 31.67 ? 167 SER B O     1 
ATOM   2003 C  CB    . SER D 3 77 ? -2.557  5.981   3.569   1.00 13.59 ? 167 SER B CB    1 
ATOM   2004 O  OG    . SER D 3 77 ? -3.029  5.615   2.275   1.00 16.04 ? 167 SER B OG    1 
ATOM   2005 N  N     . ARG D 3 78 ? -1.632  3.101   2.592   1.00 29.58 ? 168 ARG B N     1 
ATOM   2006 C  CA    . ARG D 3 78 ? -0.770  2.428   1.638   1.00 28.25 ? 168 ARG B CA    1 
ATOM   2007 C  C     . ARG D 3 78 ? -0.349  3.473   0.613   1.00 32.77 ? 168 ARG B C     1 
ATOM   2008 O  O     . ARG D 3 78 ? 0.623   3.293   -0.104  1.00 42.51 ? 168 ARG B O     1 
ATOM   2009 C  CB    . ARG D 3 78 ? -1.521  1.349   0.890   1.00 33.89 ? 168 ARG B CB    1 
ATOM   2010 C  CG    . ARG D 3 78 ? -1.796  0.067   1.618   1.00 29.09 ? 168 ARG B CG    1 
ATOM   2011 C  CD    . ARG D 3 78 ? -2.453  -0.852  0.605   1.00 24.64 ? 168 ARG B CD    1 
ATOM   2012 N  NE    . ARG D 3 78 ? -2.173  -2.247  0.864   1.00 25.15 ? 168 ARG B NE    1 
ATOM   2013 C  CZ    . ARG D 3 78 ? -1.966  -3.136  -0.097  1.00 39.62 ? 168 ARG B CZ    1 
ATOM   2014 N  NH1   . ARG D 3 78 ? -2.007  -2.761  -1.373  1.00 30.72 ? 168 ARG B NH1   1 
ATOM   2015 N  NH2   . ARG D 3 78 ? -1.729  -4.400  0.218   1.00 40.78 ? 168 ARG B NH2   1 
ATOM   2016 N  N     . ASP D 3 79 ? -1.107  4.560   0.545   1.00 26.13 ? 169 ASP B N     1 
ATOM   2017 C  CA    . ASP D 3 79 ? -0.867  5.651   -0.397  1.00 14.64 ? 169 ASP B CA    1 
ATOM   2018 C  C     . ASP D 3 79 ? 0.066   6.698   0.205   1.00 16.28 ? 169 ASP B C     1 
ATOM   2019 O  O     . ASP D 3 79 ? 0.234   7.783   -0.368  1.00 9.79  ? 169 ASP B O     1 
ATOM   2020 C  CB    . ASP D 3 79 ? -2.207  6.335   -0.742  1.00 21.94 ? 169 ASP B CB    1 
ATOM   2021 C  CG    . ASP D 3 79 ? -3.168  5.438   -1.531  1.00 22.73 ? 169 ASP B CG    1 
ATOM   2022 O  OD1   . ASP D 3 79 ? -3.248  4.222   -1.276  1.00 38.55 ? 169 ASP B OD1   1 
ATOM   2023 O  OD2   . ASP D 3 79 ? -3.883  5.965   -2.407  1.00 26.49 ? 169 ASP B OD2   1 
ATOM   2024 N  N     . ALA D 3 80 ? 0.660   6.413   1.365   1.00 16.99 ? 170 ALA B N     1 
ATOM   2025 C  CA    . ALA D 3 80 ? 1.543   7.410   1.996   1.00 16.31 ? 170 ALA B CA    1 
ATOM   2026 C  C     . ALA D 3 80 ? 2.942   6.882   2.304   1.00 9.72  ? 170 ALA B C     1 
ATOM   2027 O  O     . ALA D 3 80 ? 3.756   7.559   2.923   1.00 9.46  ? 170 ALA B O     1 
ATOM   2028 C  CB    . ALA D 3 80 ? 0.914   7.948   3.258   1.00 6.66  ? 170 ALA B CB    1 
ATOM   2029 N  N     . VAL D 3 81 ? 3.169   5.658   1.872   1.00 5.05  ? 171 VAL B N     1 
ATOM   2030 C  CA    . VAL D 3 81 ? 4.427   4.947   1.994   1.00 15.94 ? 171 VAL B CA    1 
ATOM   2031 C  C     . VAL D 3 81 ? 5.575   5.705   1.342   1.00 14.71 ? 171 VAL B C     1 
ATOM   2032 O  O     . VAL D 3 81 ? 5.440   6.191   0.232   1.00 20.80 ? 171 VAL B O     1 
ATOM   2033 C  CB    . VAL D 3 81 ? 4.331   3.615   1.270   1.00 5.67  ? 171 VAL B CB    1 
ATOM   2034 C  CG1   . VAL D 3 81 ? 5.680   2.938   1.265   1.00 24.10 ? 171 VAL B CG1   1 
ATOM   2035 C  CG2   . VAL D 3 81 ? 3.306   2.732   1.961   1.00 2.00  ? 171 VAL B CG2   1 
ATOM   2036 N  N     . ARG D 3 82 ? 6.701   5.784   2.034   1.00 17.25 ? 172 ARG B N     1 
ATOM   2037 C  CA    . ARG D 3 82 ? 7.911   6.463   1.531   1.00 22.67 ? 172 ARG B CA    1 
ATOM   2038 C  C     . ARG D 3 82 ? 9.028   5.423   1.470   1.00 17.91 ? 172 ARG B C     1 
ATOM   2039 O  O     . ARG D 3 82 ? 9.714   5.182   2.472   1.00 18.30 ? 172 ARG B O     1 
ATOM   2040 C  CB    . ARG D 3 82 ? 8.334   7.575   2.495   1.00 21.10 ? 172 ARG B CB    1 
ATOM   2041 C  CG    . ARG D 3 82 ? 9.600   8.364   2.118   1.00 27.77 ? 172 ARG B CG    1 
ATOM   2042 C  CD    . ARG D 3 82 ? 10.193  9.059   3.383   1.00 22.70 ? 172 ARG B CD    1 
ATOM   2043 N  NE    . ARG D 3 82 ? 10.689  8.017   4.292   1.00 27.79 ? 172 ARG B NE    1 
ATOM   2044 C  CZ    . ARG D 3 82 ? 11.090  8.200   5.550   1.00 20.90 ? 172 ARG B CZ    1 
ATOM   2045 N  NH1   . ARG D 3 82 ? 11.066  9.415   6.108   1.00 22.84 ? 172 ARG B NH1   1 
ATOM   2046 N  NH2   . ARG D 3 82 ? 11.518  7.152   6.255   1.00 24.35 ? 172 ARG B NH2   1 
ATOM   2047 N  N     . PHE D 3 83 ? 9.181   4.759   0.334   1.00 14.33 ? 173 PHE B N     1 
ATOM   2048 C  CA    . PHE D 3 83 ? 10.260  3.787   0.217   1.00 21.57 ? 173 PHE B CA    1 
ATOM   2049 C  C     . PHE D 3 83 ? 11.638  4.475   0.049   1.00 23.44 ? 173 PHE B C     1 
ATOM   2050 O  O     . PHE D 3 83 ? 11.746  5.701   -0.193  1.00 11.93 ? 173 PHE B O     1 
ATOM   2051 C  CB    . PHE D 3 83 ? 10.051  2.892   -0.973  1.00 16.18 ? 173 PHE B CB    1 
ATOM   2052 C  CG    . PHE D 3 83 ? 9.280   1.602   -0.789  1.00 13.96 ? 173 PHE B CG    1 
ATOM   2053 C  CD1   . PHE D 3 83 ? 9.891   0.515   -0.176  1.00 3.47  ? 173 PHE B CD1   1 
ATOM   2054 C  CD2   . PHE D 3 83 ? 7.975   1.509   -1.279  1.00 12.66 ? 173 PHE B CD2   1 
ATOM   2055 C  CE1   . PHE D 3 83 ? 9.213   -0.704  -0.103  1.00 8.07  ? 173 PHE B CE1   1 
ATOM   2056 C  CE2   . PHE D 3 83 ? 7.290   0.298   -1.191  1.00 8.26  ? 173 PHE B CE2   1 
ATOM   2057 C  CZ    . PHE D 3 83 ? 7.913   -0.814  -0.616  1.00 13.93 ? 173 PHE B CZ    1 
ATOM   2058 N  N     . GLY D 3 84 ? 12.688  3.676   0.196   1.00 19.63 ? 174 GLY B N     1 
ATOM   2059 C  CA    . GLY D 3 84 ? 14.043  4.189   0.043   1.00 32.19 ? 174 GLY B CA    1 
ATOM   2060 C  C     . GLY D 3 84 ? 14.521  5.325   0.937   1.00 31.61 ? 174 GLY B C     1 
ATOM   2061 O  O     . GLY D 3 84 ? 13.740  6.093   1.462   1.00 37.82 ? 174 GLY B O     1 
ATOM   2062 N  N     . ARG D 3 85 ? 15.837  5.402   1.107   1.00 34.82 ? 175 ARG B N     1 
ATOM   2063 C  CA    . ARG D 3 85 ? 16.514  6.423   1.905   1.00 30.14 ? 175 ARG B CA    1 
ATOM   2064 C  C     . ARG D 3 85 ? 15.698  7.674   2.212   1.00 33.56 ? 175 ARG B C     1 
ATOM   2065 O  O     . ARG D 3 85 ? 14.937  8.136   1.378   1.00 35.45 ? 175 ARG B O     1 
ATOM   2066 C  CB    . ARG D 3 85 ? 17.801  6.836   1.185   1.00 28.16 ? 175 ARG B CB    1 
ATOM   2067 C  CG    . ARG D 3 85 ? 18.512  8.040   1.774   1.00 28.13 ? 175 ARG B CG    1 
ATOM   2068 C  CD    . ARG D 3 85 ? 19.698  8.462   0.881   1.00 25.04 ? 175 ARG B CD    1 
ATOM   2069 N  NE    . ARG D 3 85 ? 20.351  9.673   1.377   1.00 29.45 ? 175 ARG B NE    1 
ATOM   2070 C  CZ    . ARG D 3 85 ? 21.159  9.721   2.429   1.00 28.08 ? 175 ARG B CZ    1 
ATOM   2071 N  NH1   . ARG D 3 85 ? 21.433  8.621   3.110   1.00 36.92 ? 175 ARG B NH1   1 
ATOM   2072 N  NH2   . ARG D 3 85 ? 21.656  10.880  2.829   1.00 34.68 ? 175 ARG B NH2   1 
ATOM   2073 N  N     . ILE D 3 86 ? 15.853  8.225   3.415   1.00 36.53 ? 176 ILE B N     1 
ATOM   2074 C  CA    . ILE D 3 86 ? 15.149  9.459   3.754   1.00 36.43 ? 176 ILE B CA    1 
ATOM   2075 C  C     . ILE D 3 86 ? 15.849  10.548  2.969   1.00 39.76 ? 176 ILE B C     1 
ATOM   2076 O  O     . ILE D 3 86 ? 17.074  10.569  2.886   1.00 40.89 ? 176 ILE B O     1 
ATOM   2077 C  CB    . ILE D 3 86 ? 15.293  9.860   5.236   1.00 36.24 ? 176 ILE B CB    1 
ATOM   2078 C  CG1   . ILE D 3 86 ? 14.521  8.908   6.136   1.00 33.68 ? 176 ILE B CG1   1 
ATOM   2079 C  CG2   . ILE D 3 86 ? 14.765  11.273  5.427   1.00 32.46 ? 176 ILE B CG2   1 
ATOM   2080 C  CD1   . ILE D 3 86 ? 14.890  9.011   7.586   1.00 37.57 ? 176 ILE B CD1   1 
ATOM   2081 N  N     . PRO D 3 87 ? 15.085  11.444  2.351   1.00 40.41 ? 177 PRO B N     1 
ATOM   2082 C  CA    . PRO D 3 87 ? 15.662  12.545  1.575   1.00 39.31 ? 177 PRO B CA    1 
ATOM   2083 C  C     . PRO D 3 87 ? 16.374  13.530  2.503   1.00 38.74 ? 177 PRO B C     1 
ATOM   2084 O  O     . PRO D 3 87 ? 17.112  13.114  3.391   1.00 41.37 ? 177 PRO B O     1 
ATOM   2085 C  CB    . PRO D 3 87 ? 14.435  13.141  0.908   1.00 38.27 ? 177 PRO B CB    1 
ATOM   2086 C  CG    . PRO D 3 87 ? 13.379  12.939  1.966   1.00 44.90 ? 177 PRO B CG    1 
ATOM   2087 C  CD    . PRO D 3 87 ? 13.619  11.467  2.243   1.00 43.30 ? 177 PRO B CD    1 
ATOM   2088 N  N     . LYS D 3 88 ? 16.167  14.825  2.276   1.00 38.51 ? 178 LYS B N     1 
ATOM   2089 C  CA    . LYS D 3 88 ? 16.741  15.893  3.103   1.00 40.41 ? 178 LYS B CA    1 
ATOM   2090 C  C     . LYS D 3 88 ? 15.948  17.161  2.813   1.00 46.67 ? 178 LYS B C     1 
ATOM   2091 O  O     . LYS D 3 88 ? 15.606  17.903  3.765   1.00 50.55 ? 178 LYS B O     1 
ATOM   2092 C  CB    . LYS D 3 88 ? 18.213  16.139  2.784   1.00 46.81 ? 178 LYS B CB    1 
ATOM   2093 C  CG    . LYS D 3 88 ? 19.119  14.951  3.034   1.00 52.97 ? 178 LYS B CG    1 
ATOM   2094 C  CD    . LYS D 3 88 ? 20.488  15.161  2.388   1.00 54.16 ? 178 LYS B CD    1 
ATOM   2095 C  CE    . LYS D 3 88 ? 21.324  13.901  2.491   1.00 55.56 ? 178 LYS B CE    1 
ATOM   2096 N  NZ    . LYS D 3 88 ? 22.591  14.018  1.726   1.00 57.99 ? 178 LYS B NZ    1 
HETATM 2097 ZN ZN    . ZN  E 4 .  ? 8.441   6.715   -12.011 1.00 15.30 ? 550 ZN  A ZN    1 
HETATM 2098 ZN ZN    . ZN  F 4 .  ? -0.831  -6.127  -11.635 1.00 33.39 ? 551 ZN  A ZN    1 
HETATM 2099 ZN ZN    . ZN  G 4 .  ? 2.784   1.394   17.969  1.00 18.47 ? 450 ZN  B ZN    1 
HETATM 2100 ZN ZN    . ZN  H 4 .  ? -12.040 0.722   21.729  1.00 23.15 ? 451 ZN  B ZN    1 
HETATM 2101 O  O     . HOH I 5 .  ? 3.153   -3.760  -2.058  1.00 35.35 ? 704 HOH C O     1 
HETATM 2102 O  O     . HOH I 5 .  ? 26.182  6.880   3.349   1.00 46.37 ? 719 HOH C O     1 
HETATM 2103 O  O     . HOH I 5 .  ? 6.313   4.465   4.535   1.00 8.78  ? 722 HOH C O     1 
HETATM 2104 O  O     . HOH I 5 .  ? 17.339  -3.614  6.788   1.00 32.38 ? 734 HOH C O     1 
HETATM 2105 O  O     . HOH I 5 .  ? 14.153  -3.195  9.637   1.00 30.55 ? 735 HOH C O     1 
HETATM 2106 O  O     . HOH I 5 .  ? -0.126  -16.041 3.875   1.00 65.75 ? 737 HOH C O     1 
HETATM 2107 O  O     . HOH I 5 .  ? 34.758  24.150  -15.077 1.00 37.65 ? 742 HOH C O     1 
HETATM 2108 O  O     . HOH I 5 .  ? 25.319  -4.103  -7.481  1.00 48.75 ? 743 HOH C O     1 
HETATM 2109 O  O     . HOH I 5 .  ? 25.195  3.351   8.284   1.00 58.57 ? 749 HOH C O     1 
HETATM 2110 O  O     . HOH I 5 .  ? 21.579  -1.408  2.133   1.00 17.54 ? 750 HOH C O     1 
HETATM 2111 O  O     . HOH I 5 .  ? 2.311   -12.767 5.721   1.00 39.24 ? 753 HOH C O     1 
HETATM 2112 O  O     . HOH I 5 .  ? 23.864  -2.303  -8.661  1.00 67.18 ? 777 HOH C O     1 
HETATM 2113 O  O     . HOH I 5 .  ? 20.825  -2.996  -3.498  1.00 38.85 ? 778 HOH C O     1 
HETATM 2114 O  O     . HOH I 5 .  ? 7.094   -13.869 21.738  1.00 51.74 ? 782 HOH C O     1 
HETATM 2115 O  O     . HOH I 5 .  ? 8.828   -20.165 3.072   1.00 49.34 ? 783 HOH C O     1 
HETATM 2116 O  O     . HOH I 5 .  ? 11.408  -0.057  8.863   1.00 46.12 ? 789 HOH C O     1 
HETATM 2117 O  O     . HOH I 5 .  ? 22.015  -2.432  -15.710 1.00 39.67 ? 792 HOH C O     1 
HETATM 2118 O  O     . HOH I 5 .  ? 9.270   -15.919 13.015  1.00 41.89 ? 798 HOH C O     1 
HETATM 2119 O  O     . HOH I 5 .  ? 20.469  10.467  -12.834 1.00 47.01 ? 801 HOH C O     1 
HETATM 2120 O  O     . HOH I 5 .  ? 32.549  24.562  -21.245 1.00 38.63 ? 805 HOH C O     1 
HETATM 2121 O  O     . HOH I 5 .  ? 14.174  -23.030 18.640  1.00 34.14 ? 806 HOH C O     1 
HETATM 2122 O  O     . HOH I 5 .  ? 11.306  -15.809 18.862  1.00 52.79 ? 807 HOH C O     1 
HETATM 2123 O  O     . HOH I 5 .  ? 11.589  -2.966  8.215   1.00 47.88 ? 809 HOH C O     1 
HETATM 2124 O  O     . HOH I 5 .  ? 20.174  -6.154  0.898   1.00 35.50 ? 811 HOH C O     1 
HETATM 2125 O  O     . HOH I 5 .  ? 20.385  -3.258  5.168   1.00 55.39 ? 814 HOH C O     1 
HETATM 2126 O  O     . HOH I 5 .  ? 26.041  6.419   -2.913  1.00 50.21 ? 815 HOH C O     1 
HETATM 2127 O  O     . HOH I 5 .  ? 24.938  -8.780  -5.786  1.00 28.96 ? 817 HOH C O     1 
HETATM 2128 O  O     . HOH I 5 .  ? 25.442  -2.417  -4.105  1.00 26.35 ? 818 HOH C O     1 
HETATM 2129 O  O     . HOH I 5 .  ? 28.975  4.456   -11.550 1.00 27.73 ? 821 HOH C O     1 
HETATM 2130 O  O     . HOH I 5 .  ? 26.004  -8.270  -9.072  1.00 49.18 ? 823 HOH C O     1 
HETATM 2131 O  O     . HOH I 5 .  ? 31.367  3.356   -1.452  1.00 56.06 ? 825 HOH C O     1 
HETATM 2132 O  O     . HOH I 5 .  ? 34.525  13.826  -19.221 1.00 56.97 ? 840 HOH C O     1 
HETATM 2133 O  O     . HOH I 5 .  ? 7.203   -22.752 21.191  1.00 47.91 ? 847 HOH C O     1 
HETATM 2134 O  O     . HOH I 5 .  ? 4.448   -10.381 -0.896  1.00 47.37 ? 849 HOH C O     1 
HETATM 2135 O  O     . HOH I 5 .  ? 2.328   -15.064 5.435   1.00 45.21 ? 850 HOH C O     1 
HETATM 2136 O  O     . HOH I 5 .  ? 4.078   -18.898 8.219   1.00 55.30 ? 851 HOH C O     1 
HETATM 2137 O  O     . HOH I 5 .  ? 14.100  6.581   5.933   1.00 39.87 ? 857 HOH C O     1 
HETATM 2138 O  O     . HOH I 5 .  ? 4.980   -12.894 20.814  1.00 51.03 ? 858 HOH C O     1 
HETATM 2139 O  O     . HOH I 5 .  ? 20.513  -3.187  0.670   1.00 51.37 ? 861 HOH C O     1 
HETATM 2140 O  O     . HOH I 5 .  ? 25.523  15.326  -13.618 1.00 34.91 ? 866 HOH C O     1 
HETATM 2141 O  O     . HOH I 5 .  ? 29.827  16.888  -16.202 1.00 52.23 ? 867 HOH C O     1 
HETATM 2142 O  O     . HOH I 5 .  ? 31.588  -2.354  -7.037  1.00 50.17 ? 868 HOH C O     1 
HETATM 2143 O  O     . HOH I 5 .  ? 19.706  15.921  -15.809 1.00 49.22 ? 872 HOH C O     1 
HETATM 2144 O  O     . HOH I 5 .  ? 28.992  23.758  -15.224 1.00 43.36 ? 875 HOH C O     1 
HETATM 2145 O  O     . HOH I 5 .  ? 20.603  -4.853  -1.723  1.00 51.37 ? 876 HOH C O     1 
HETATM 2146 O  O     . HOH I 5 .  ? 36.404  12.418  -22.770 1.00 54.32 ? 877 HOH C O     1 
HETATM 2147 O  O     . HOH I 5 .  ? 4.783   -21.654 11.782  1.00 50.50 ? 878 HOH C O     1 
HETATM 2148 O  O     . HOH I 5 .  ? 1.216   -14.741 9.128   1.00 52.52 ? 880 HOH C O     1 
HETATM 2149 O  O     . HOH I 5 .  ? 37.753  24.675  -17.471 1.00 46.49 ? 881 HOH C O     1 
HETATM 2150 O  O     . HOH I 5 .  ? -0.644  -11.489 -0.094  1.00 50.41 ? 882 HOH C O     1 
HETATM 2151 O  O     . HOH I 5 .  ? 4.461   -1.696  -1.459  1.00 42.18 ? 887 HOH C O     1 
HETATM 2152 O  O     . HOH I 5 .  ? 12.718  6.943   9.724   1.00 40.36 ? 893 HOH C O     1 
HETATM 2153 O  O     . HOH I 5 .  ? 12.018  9.139   9.508   1.00 55.50 ? 895 HOH C O     1 
HETATM 2154 O  O     . HOH I 5 .  ? 28.692  6.092   1.586   1.00 40.42 ? 917 HOH C O     1 
HETATM 2155 O  O     . HOH I 5 .  ? 22.860  -3.965  -4.461  1.00 37.43 ? 919 HOH C O     1 
HETATM 2156 O  O     . HOH I 5 .  ? 25.860  17.980  -22.780 1.00 54.54 ? 926 HOH C O     1 
HETATM 2157 O  O     . HOH I 5 .  ? 33.440  18.880  -15.630 1.00 48.45 ? 929 HOH C O     1 
HETATM 2158 O  O     . HOH I 5 .  ? 30.974  8.512   2.250   1.00 48.02 ? 932 HOH C O     1 
HETATM 2159 O  O     . HOH J 5 .  ? 6.400   -2.720  18.470  1.00 28.66 ? 701 HOH D O     1 
HETATM 2160 O  O     . HOH J 5 .  ? 33.947  10.216  -4.479  1.00 30.97 ? 702 HOH D O     1 
HETATM 2161 O  O     . HOH J 5 .  ? 29.790  14.669  -12.585 1.00 46.12 ? 703 HOH D O     1 
HETATM 2162 O  O     . HOH J 5 .  ? 36.306  12.577  -8.303  1.00 49.77 ? 706 HOH D O     1 
HETATM 2163 O  O     . HOH J 5 .  ? 19.575  -11.572 7.645   1.00 39.03 ? 712 HOH D O     1 
HETATM 2164 O  O     . HOH J 5 .  ? 19.672  -11.581 -2.937  1.00 34.14 ? 713 HOH D O     1 
HETATM 2165 O  O     . HOH J 5 .  ? 21.284  -14.507 -2.555  1.00 40.21 ? 714 HOH D O     1 
HETATM 2166 O  O     . HOH J 5 .  ? 12.139  -14.221 11.108  1.00 34.36 ? 715 HOH D O     1 
HETATM 2167 O  O     . HOH J 5 .  ? 19.180  -0.654  -6.823  1.00 28.80 ? 716 HOH D O     1 
HETATM 2168 O  O     . HOH J 5 .  ? 28.003  11.873  -31.549 1.00 39.05 ? 720 HOH D O     1 
HETATM 2169 O  O     . HOH J 5 .  ? 18.101  4.234   -9.247  1.00 39.69 ? 723 HOH D O     1 
HETATM 2170 O  O     . HOH J 5 .  ? 24.553  16.916  -0.213  1.00 44.66 ? 726 HOH D O     1 
HETATM 2171 O  O     . HOH J 5 .  ? 8.230   -1.402  -7.421  1.00 27.50 ? 728 HOH D O     1 
HETATM 2172 O  O     . HOH J 5 .  ? 9.166   -7.976  -3.552  1.00 38.59 ? 731 HOH D O     1 
HETATM 2173 O  O     . HOH J 5 .  ? 36.741  7.317   -20.941 1.00 38.02 ? 738 HOH D O     1 
HETATM 2174 O  O     . HOH J 5 .  ? 38.153  2.876   -15.096 1.00 33.75 ? 739 HOH D O     1 
HETATM 2175 O  O     . HOH J 5 .  ? 15.296  -5.368  7.607   1.00 29.59 ? 740 HOH D O     1 
HETATM 2176 O  O     . HOH J 5 .  ? 26.444  15.668  -26.325 1.00 36.05 ? 744 HOH D O     1 
HETATM 2177 O  O     . HOH J 5 .  ? 28.657  5.687   -6.160  1.00 36.83 ? 745 HOH D O     1 
HETATM 2178 O  O     . HOH J 5 .  ? 31.131  4.346   -7.886  1.00 44.76 ? 746 HOH D O     1 
HETATM 2179 O  O     . HOH J 5 .  ? -4.521  -4.902  18.578  1.00 27.04 ? 757 HOH D O     1 
HETATM 2180 O  O     . HOH J 5 .  ? -0.188  -15.809 12.227  1.00 32.58 ? 758 HOH D O     1 
HETATM 2181 O  O     . HOH J 5 .  ? 5.714   -6.317  12.082  1.00 33.06 ? 759 HOH D O     1 
HETATM 2182 O  O     . HOH J 5 .  ? 9.551   9.643   -4.785  1.00 45.26 ? 761 HOH D O     1 
HETATM 2183 O  O     . HOH J 5 .  ? 17.583  12.015  -6.491  1.00 67.50 ? 776 HOH D O     1 
HETATM 2184 O  O     . HOH J 5 .  ? 11.057  -13.303 16.247  1.00 46.80 ? 781 HOH D O     1 
HETATM 2185 O  O     . HOH J 5 .  ? 26.371  18.287  -5.834  1.00 48.80 ? 791 HOH D O     1 
HETATM 2186 O  O     . HOH J 5 .  ? 7.740   -4.073  -4.289  1.00 42.86 ? 794 HOH D O     1 
HETATM 2187 O  O     . HOH J 5 .  ? 10.817  -12.701 6.229   1.00 29.35 ? 796 HOH D O     1 
HETATM 2188 O  O     . HOH J 5 .  ? 18.016  -18.739 14.836  1.00 50.98 ? 803 HOH D O     1 
HETATM 2189 O  O     . HOH J 5 .  ? 0.243   -6.566  15.842  1.00 53.75 ? 804 HOH D O     1 
HETATM 2190 O  O     . HOH J 5 .  ? 13.811  -12.812 19.687  1.00 54.64 ? 808 HOH D O     1 
HETATM 2191 O  O     . HOH J 5 .  ? 11.196  -15.073 1.977   1.00 51.22 ? 810 HOH D O     1 
HETATM 2192 O  O     . HOH J 5 .  ? 16.170  16.469  -1.388  1.00 55.53 ? 819 HOH D O     1 
HETATM 2193 O  O     . HOH J 5 .  ? 18.430  -5.058  -5.724  1.00 36.53 ? 820 HOH D O     1 
HETATM 2194 O  O     . HOH J 5 .  ? 28.426  5.473   -15.303 1.00 23.73 ? 822 HOH D O     1 
HETATM 2195 O  O     . HOH J 5 .  ? 28.370  6.837   -18.876 1.00 31.56 ? 824 HOH D O     1 
HETATM 2196 O  O     . HOH J 5 .  ? 6.540   -11.150 18.620  1.00 62.23 ? 827 HOH D O     1 
HETATM 2197 O  O     . HOH J 5 .  ? 15.685  -16.645 13.916  1.00 39.27 ? 828 HOH D O     1 
HETATM 2198 O  O     . HOH J 5 .  ? 12.191  -16.342 -1.515  1.00 47.97 ? 829 HOH D O     1 
HETATM 2199 O  O     . HOH J 5 .  ? 14.591  14.506  -1.341  1.00 59.07 ? 830 HOH D O     1 
HETATM 2200 O  O     . HOH J 5 .  ? 33.679  13.337  -9.571  1.00 58.43 ? 831 HOH D O     1 
HETATM 2201 O  O     . HOH J 5 .  ? 16.108  -16.546 1.307   1.00 41.02 ? 832 HOH D O     1 
HETATM 2202 O  O     . HOH J 5 .  ? 33.627  14.612  -14.523 1.00 47.64 ? 833 HOH D O     1 
HETATM 2203 O  O     . HOH J 5 .  ? 35.915  15.297  -11.599 1.00 56.59 ? 834 HOH D O     1 
HETATM 2204 O  O     . HOH J 5 .  ? 29.640  14.469  -8.348  1.00 39.51 ? 835 HOH D O     1 
HETATM 2205 O  O     . HOH J 5 .  ? 22.284  12.256  -27.919 1.00 51.79 ? 836 HOH D O     1 
HETATM 2206 O  O     . HOH J 5 .  ? 33.160  6.836   -31.622 1.00 55.65 ? 837 HOH D O     1 
HETATM 2207 O  O     . HOH J 5 .  ? 30.567  21.766  -25.470 1.00 70.59 ? 838 HOH D O     1 
HETATM 2208 O  O     . HOH J 5 .  ? 12.821  -14.753 8.539   1.00 43.17 ? 839 HOH D O     1 
HETATM 2209 O  O     . HOH J 5 .  ? 22.684  -11.229 -6.428  1.00 50.55 ? 841 HOH D O     1 
HETATM 2210 O  O     . HOH J 5 .  ? -6.283  -14.945 18.055  1.00 39.81 ? 845 HOH D O     1 
HETATM 2211 O  O     . HOH J 5 .  ? 8.048   -9.322  21.990  1.00 56.96 ? 860 HOH D O     1 
HETATM 2212 O  O     . HOH J 5 .  ? 24.210  10.480  0.089   1.00 53.10 ? 863 HOH D O     1 
HETATM 2213 O  O     . HOH J 5 .  ? 27.884  17.093  -12.509 1.00 37.26 ? 865 HOH D O     1 
HETATM 2214 O  O     . HOH J 5 .  ? 35.048  12.272  -14.363 1.00 29.52 ? 869 HOH D O     1 
HETATM 2215 O  O     . HOH J 5 .  ? 21.699  11.656  -9.774  1.00 46.26 ? 870 HOH D O     1 
HETATM 2216 O  O     . HOH J 5 .  ? 16.478  -13.903 17.136  1.00 51.65 ? 871 HOH D O     1 
HETATM 2217 O  O     . HOH J 5 .  ? 23.024  13.769  -11.148 1.00 39.70 ? 873 HOH D O     1 
HETATM 2218 O  O     . HOH J 5 .  ? 18.990  -11.541 1.162   1.00 50.53 ? 874 HOH D O     1 
HETATM 2219 O  O     . HOH J 5 .  ? -0.860  -21.167 9.776   1.00 45.95 ? 879 HOH D O     1 
HETATM 2220 O  O     . HOH J 5 .  ? 11.810  7.990   -7.220  1.00 32.74 ? 891 HOH D O     1 
HETATM 2221 O  O     . HOH J 5 .  ? 10.848  15.276  -1.456  1.00 55.16 ? 897 HOH D O     1 
HETATM 2222 O  O     . HOH J 5 .  ? 20.272  -2.784  -7.219  1.00 48.11 ? 898 HOH D O     1 
HETATM 2223 O  O     . HOH J 5 .  ? 33.241  14.562  -2.973  1.00 58.62 ? 906 HOH D O     1 
HETATM 2224 O  O     . HOH J 5 .  ? 21.341  -11.512 12.150  1.00 45.35 ? 907 HOH D O     1 
HETATM 2225 O  O     . HOH J 5 .  ? 32.648  13.479  1.552   1.00 50.49 ? 908 HOH D O     1 
HETATM 2226 O  O     . HOH J 5 .  ? 29.068  16.214  -4.990  1.00 52.88 ? 909 HOH D O     1 
HETATM 2227 O  O     . HOH J 5 .  ? 35.875  9.543   -6.945  1.00 24.32 ? 910 HOH D O     1 
HETATM 2228 O  O     . HOH J 5 .  ? 29.559  9.767   -30.864 1.00 52.93 ? 911 HOH D O     1 
HETATM 2229 O  O     . HOH J 5 .  ? 27.003  7.950   -31.737 1.00 38.30 ? 912 HOH D O     1 
HETATM 2230 O  O     . HOH J 5 .  ? 24.197  6.785   -27.024 1.00 40.32 ? 916 HOH D O     1 
HETATM 2231 O  O     . HOH J 5 .  ? 13.255  -7.711  21.853  1.00 47.24 ? 920 HOH D O     1 
HETATM 2232 O  O     . HOH J 5 .  ? 17.705  -5.968  16.964  1.00 48.21 ? 922 HOH D O     1 
HETATM 2233 O  O     . HOH J 5 .  ? 33.931  8.910   -22.199 1.00 50.95 ? 930 HOH D O     1 
HETATM 2234 O  O     . HOH J 5 .  ? 30.784  7.940   -3.649  1.00 49.99 ? 931 HOH D O     1 
HETATM 2235 O  O     . HOH J 5 .  ? 22.324  16.254  -3.815  1.00 49.67 ? 933 HOH D O     1 
HETATM 2236 O  O     . HOH K 5 .  ? 18.140  8.130   -21.710 1.00 17.90 ? 709 HOH A O     1 
HETATM 2237 O  O     . HOH K 5 .  ? 13.486  -5.151  -8.534  1.00 23.92 ? 710 HOH A O     1 
HETATM 2238 O  O     . HOH K 5 .  ? 4.011   -8.865  -9.802  1.00 44.79 ? 711 HOH A O     1 
HETATM 2239 O  O     . HOH K 5 .  ? 6.340   -16.100 -12.100 1.00 60.82 ? 721 HOH A O     1 
HETATM 2240 O  O     . HOH K 5 .  ? 7.692   -19.390 -12.901 1.00 64.75 ? 724 HOH A O     1 
HETATM 2241 O  O     . HOH K 5 .  ? 1.925   -14.063 -7.706  1.00 60.07 ? 725 HOH A O     1 
HETATM 2242 O  O     . HOH K 5 .  ? -3.043  -14.892 -10.136 1.00 28.12 ? 727 HOH A O     1 
HETATM 2243 O  O     . HOH K 5 .  ? -7.761  -11.267 -6.172  1.00 54.82 ? 729 HOH A O     1 
HETATM 2244 O  O     . HOH K 5 .  ? 15.792  7.871   -27.623 1.00 26.66 ? 730 HOH A O     1 
HETATM 2245 O  O     . HOH K 5 .  ? 3.844   2.041   -3.816  1.00 10.27 ? 733 HOH A O     1 
HETATM 2246 O  O     . HOH K 5 .  ? 2.585   0.963   -20.991 1.00 38.75 ? 747 HOH A O     1 
HETATM 2247 O  O     . HOH K 5 .  ? -3.255  -0.834  -3.177  1.00 41.69 ? 762 HOH A O     1 
HETATM 2248 O  O     . HOH K 5 .  ? 1.021   -7.532  -15.559 1.00 47.98 ? 770 HOH A O     1 
HETATM 2249 O  O     . HOH K 5 .  ? 0.182   -2.055  -15.770 1.00 48.36 ? 771 HOH A O     1 
HETATM 2250 O  O     . HOH K 5 .  ? 6.015   8.885   -4.141  1.00 31.58 ? 772 HOH A O     1 
HETATM 2251 O  O     . HOH K 5 .  ? 3.165   5.824   -1.776  1.00 43.25 ? 774 HOH A O     1 
HETATM 2252 O  O     . HOH K 5 .  ? -2.370  -13.057 -12.826 1.00 54.96 ? 775 HOH A O     1 
HETATM 2253 O  O     . HOH K 5 .  ? 9.301   10.472  -22.367 1.00 30.58 ? 787 HOH A O     1 
HETATM 2254 O  O     . HOH K 5 .  ? 19.474  10.473  -14.803 1.00 39.66 ? 788 HOH A O     1 
HETATM 2255 O  O     . HOH K 5 .  ? 13.001  1.392   -7.694  1.00 22.71 ? 790 HOH A O     1 
HETATM 2256 O  O     . HOH K 5 .  ? 19.506  -12.636 -12.550 1.00 52.24 ? 812 HOH A O     1 
HETATM 2257 O  O     . HOH K 5 .  ? -6.937  -0.133  -9.798  1.00 37.83 ? 826 HOH A O     1 
HETATM 2258 O  O     . HOH K 5 .  ? 21.796  -9.328  -15.226 1.00 35.93 ? 842 HOH A O     1 
HETATM 2259 O  O     . HOH K 5 .  ? 20.383  -12.238 -16.388 1.00 34.63 ? 843 HOH A O     1 
HETATM 2260 O  O     . HOH K 5 .  ? 12.657  -14.457 -17.103 1.00 49.47 ? 844 HOH A O     1 
HETATM 2261 O  O     . HOH K 5 .  ? 9.432   -10.634 -15.068 1.00 50.61 ? 846 HOH A O     1 
HETATM 2262 O  O     . HOH K 5 .  ? 12.999  11.254  -9.630  1.00 39.18 ? 864 HOH A O     1 
HETATM 2263 O  O     . HOH K 5 .  ? 20.221  13.240  -23.209 1.00 42.85 ? 883 HOH A O     1 
HETATM 2264 O  O     . HOH K 5 .  ? 1.640   -13.346 -2.750  1.00 55.01 ? 884 HOH A O     1 
HETATM 2265 O  O     . HOH K 5 .  ? 5.410   -4.898  -5.326  1.00 22.89 ? 885 HOH A O     1 
HETATM 2266 O  O     . HOH K 5 .  ? 0.019   15.849  -13.999 1.00 34.01 ? 900 HOH A O     1 
HETATM 2267 O  O     . HOH K 5 .  ? -0.303  9.225   -7.340  1.00 37.87 ? 903 HOH A O     1 
HETATM 2268 O  O     . HOH K 5 .  ? 20.732  4.282   -28.525 1.00 66.18 ? 915 HOH A O     1 
HETATM 2269 O  O     . HOH K 5 .  ? -11.625 -11.528 -8.980  1.00 53.81 ? 918 HOH A O     1 
HETATM 2270 O  O     . HOH K 5 .  ? -7.250  -0.870  -12.830 1.00 28.97 ? 924 HOH A O     1 
HETATM 2271 O  O     . HOH K 5 .  ? -4.190  0.740   -6.740  1.00 44.83 ? 925 HOH A O     1 
HETATM 2272 O  O     . HOH K 5 .  ? 11.796  -9.356  -13.960 1.00 49.27 ? 927 HOH A O     1 
HETATM 2273 O  O     . HOH K 5 .  ? 14.033  13.799  -25.388 1.00 53.11 ? 928 HOH A O     1 
HETATM 2274 O  O     . HOH L 5 .  ? 11.750  6.204   3.162   1.00 31.89 ? 700 HOH B O     1 
HETATM 2275 O  O     . HOH L 5 .  ? 5.952   2.948   25.730  1.00 32.33 ? 705 HOH B O     1 
HETATM 2276 O  O     . HOH L 5 .  ? -0.711  -6.024  29.194  1.00 41.04 ? 707 HOH B O     1 
HETATM 2277 O  O     . HOH L 5 .  ? -6.600  -0.530  23.720  1.00 45.17 ? 708 HOH B O     1 
HETATM 2278 O  O     . HOH L 5 .  ? 16.524  5.686   -1.059  1.00 25.83 ? 717 HOH B O     1 
HETATM 2279 O  O     . HOH L 5 .  ? 4.146   10.222  3.325   1.00 28.15 ? 718 HOH B O     1 
HETATM 2280 O  O     . HOH L 5 .  ? 5.062   -5.740  23.661  1.00 62.98 ? 732 HOH B O     1 
HETATM 2281 O  O     . HOH L 5 .  ? -0.257  -5.198  -3.254  1.00 46.90 ? 736 HOH B O     1 
HETATM 2282 O  O     . HOH L 5 .  ? 13.089  8.216   0.002   1.00 16.02 ? 741 HOH B O     1 
HETATM 2283 O  O     . HOH L 5 .  ? 21.634  16.590  -0.343  1.00 32.36 ? 748 HOH B O     1 
HETATM 2284 O  O     . HOH L 5 .  ? -10.236 -6.290  20.487  1.00 35.55 ? 751 HOH B O     1 
HETATM 2285 O  O     . HOH L 5 .  ? -4.300  1.610   3.320   1.00 33.29 ? 752 HOH B O     1 
HETATM 2286 O  O     . HOH L 5 .  ? -7.034  1.931   27.268  1.00 42.35 ? 754 HOH B O     1 
HETATM 2287 O  O     . HOH L 5 .  ? -2.183  7.142   25.241  1.00 37.41 ? 755 HOH B O     1 
HETATM 2288 O  O     . HOH L 5 .  ? -5.368  -8.097  24.613  1.00 36.18 ? 756 HOH B O     1 
HETATM 2289 O  O     . HOH L 5 .  ? 9.972   -0.898  20.547  1.00 38.65 ? 760 HOH B O     1 
HETATM 2290 O  O     . HOH L 5 .  ? 6.690   10.340  16.500  1.00 46.90 ? 763 HOH B O     1 
HETATM 2291 O  O     . HOH L 5 .  ? 4.795   10.337  11.859  1.00 29.70 ? 764 HOH B O     1 
HETATM 2292 O  O     . HOH L 5 .  ? 1.395   -10.663 10.517  1.00 26.16 ? 765 HOH B O     1 
HETATM 2293 O  O     . HOH L 5 .  ? 3.564   4.005   25.291  1.00 23.62 ? 766 HOH B O     1 
HETATM 2294 O  O     . HOH L 5 .  ? -4.665  4.109   30.433  1.00 45.66 ? 767 HOH B O     1 
HETATM 2295 O  O     . HOH L 5 .  ? -8.732  11.624  15.848  1.00 40.28 ? 768 HOH B O     1 
HETATM 2296 O  O     . HOH L 5 .  ? 0.222   11.476  11.653  1.00 48.43 ? 769 HOH B O     1 
HETATM 2297 O  O     . HOH L 5 .  ? -16.116 -4.452  11.054  1.00 48.04 ? 773 HOH B O     1 
HETATM 2298 O  O     . HOH L 5 .  ? 6.669   -3.364  21.993  1.00 20.41 ? 779 HOH B O     1 
HETATM 2299 O  O     . HOH L 5 .  ? 1.237   -5.108  24.754  1.00 53.38 ? 780 HOH B O     1 
HETATM 2300 O  O     . HOH L 5 .  ? 0.326   6.755   22.395  1.00 33.20 ? 784 HOH B O     1 
HETATM 2301 O  O     . HOH L 5 .  ? -9.358  -12.078 6.438   1.00 33.88 ? 785 HOH B O     1 
HETATM 2302 O  O     . HOH L 5 .  ? 12.579  1.537   1.510   1.00 2.57  ? 786 HOH B O     1 
HETATM 2303 O  O     . HOH L 5 .  ? 0.628   11.143  6.623   1.00 41.80 ? 793 HOH B O     1 
HETATM 2304 O  O     . HOH L 5 .  ? 11.558  0.298   23.713  1.00 51.49 ? 795 HOH B O     1 
HETATM 2305 O  O     . HOH L 5 .  ? 9.092   -2.518  24.627  1.00 48.17 ? 797 HOH B O     1 
HETATM 2306 O  O     . HOH L 5 .  ? -5.183  -8.430  20.493  1.00 28.20 ? 799 HOH B O     1 
HETATM 2307 O  O     . HOH L 5 .  ? -8.130  -7.751  21.553  1.00 33.34 ? 800 HOH B O     1 
HETATM 2308 O  O     . HOH L 5 .  ? -2.433  -4.803  25.240  1.00 19.44 ? 802 HOH B O     1 
HETATM 2309 O  O     . HOH L 5 .  ? -11.831 -4.536  5.147   1.00 61.74 ? 813 HOH B O     1 
HETATM 2310 O  O     . HOH L 5 .  ? -15.445 -10.956 0.672   1.00 49.70 ? 816 HOH B O     1 
HETATM 2311 O  O     . HOH L 5 .  ? -8.806  -0.323  25.657  1.00 40.33 ? 848 HOH B O     1 
HETATM 2312 O  O     . HOH L 5 .  ? -2.217  -18.764 5.382   1.00 60.49 ? 852 HOH B O     1 
HETATM 2313 O  O     . HOH L 5 .  ? -1.633  -16.574 7.523   1.00 49.95 ? 853 HOH B O     1 
HETATM 2314 O  O     . HOH L 5 .  ? -3.052  -14.413 6.343   1.00 42.04 ? 854 HOH B O     1 
HETATM 2315 O  O     . HOH L 5 .  ? 4.774   -3.488  7.495   1.00 66.39 ? 855 HOH B O     1 
HETATM 2316 O  O     . HOH L 5 .  ? -0.310  -11.527 7.779   1.00 34.25 ? 856 HOH B O     1 
HETATM 2317 O  O     . HOH L 5 .  ? -3.692  -6.825  26.067  1.00 33.83 ? 859 HOH B O     1 
HETATM 2318 O  O     . HOH L 5 .  ? 19.107  9.688   4.100   1.00 38.97 ? 862 HOH B O     1 
HETATM 2319 O  O     . HOH L 5 .  ? -1.214  -4.544  2.783   1.00 52.19 ? 886 HOH B O     1 
HETATM 2320 O  O     . HOH L 5 .  ? -8.427  5.178   17.993  1.00 31.01 ? 888 HOH B O     1 
HETATM 2321 O  O     . HOH L 5 .  ? -15.844 -12.674 20.916  1.00 48.82 ? 889 HOH B O     1 
HETATM 2322 O  O     . HOH L 5 .  ? -12.257 -4.951  19.105  1.00 80.64 ? 890 HOH B O     1 
HETATM 2323 O  O     . HOH L 5 .  ? 14.010  15.543  1.122   1.00 27.24 ? 892 HOH B O     1 
HETATM 2324 O  O     . HOH L 5 .  ? -8.454  8.235   16.938  1.00 32.31 ? 894 HOH B O     1 
HETATM 2325 O  O     . HOH L 5 .  ? -11.393 9.869   14.677  1.00 47.12 ? 896 HOH B O     1 
HETATM 2326 O  O     . HOH L 5 .  ? 3.535   11.350  5.273   1.00 53.27 ? 899 HOH B O     1 
HETATM 2327 O  O     . HOH L 5 .  ? 7.929   13.060  5.401   1.00 30.93 ? 901 HOH B O     1 
HETATM 2328 O  O     . HOH L 5 .  ? -0.453  11.440  2.390   1.00 53.57 ? 902 HOH B O     1 
HETATM 2329 O  O     . HOH L 5 .  ? 6.516   11.167  2.388   1.00 42.11 ? 904 HOH B O     1 
HETATM 2330 O  O     . HOH L 5 .  ? -18.447 -5.030  14.802  1.00 54.21 ? 905 HOH B O     1 
HETATM 2331 O  O     . HOH L 5 .  ? 9.122   -0.424  17.482  1.00 34.24 ? 913 HOH B O     1 
HETATM 2332 O  O     . HOH L 5 .  ? 8.376   -5.841  25.016  1.00 45.24 ? 914 HOH B O     1 
HETATM 2333 O  O     . HOH L 5 .  ? 4.510   11.350  15.800  1.00 60.50 ? 921 HOH B O     1 
HETATM 2334 O  O     . HOH L 5 .  ? 6.797   13.836  13.431  1.00 36.46 ? 923 HOH B O     1 
A 1 1  DC  1  600 600 DC  C   C . n 
A 1 2  DA  2  601 601 DA  A   C . n 
A 1 3  DA  3  602 602 DA  A   C . n 
A 1 4  DC  4  603 603 DC  C   C . n 
A 1 5  DT  5  604 604 DT  T   C . n 
A 1 6  DA  6  605 605 DA  A   C . n 
A 1 7  DG  7  606 606 DG  G   C . n 
A 1 8  DG  8  607 607 DG  G   C . n 
A 1 9  DT  9  608 608 DT  T   C . n 
A 1 10 DC  10 609 609 DC  C   C . n 
A 1 11 DA  11 610 610 DA  A   C . n 
A 1 12 DC  12 611 611 DC  C   C . n 
A 1 13 5IU 13 612 612 5IU +U  C . n 
A 1 14 DA  14 613 613 DA  A   C . n 
A 1 15 DG  15 614 614 DG  G   C . n 
A 1 16 DG  16 615 615 DG  G   C . n 
A 1 17 DT  17 616 616 DT  T   C . n 
A 1 18 DC  18 617 617 DC  C   C . n 
A 1 19 DA  19 618 618 DA  A   C . n 
A 1 20 DG  20 619 619 DG  G   C . n 
B 2 1  DC  1  621 621 DC  C   D . n 
B 2 2  DT  2  622 622 DT  T   D . n 
B 2 3  DG  3  623 623 DG  G   D . n 
B 2 4  DA  4  624 624 DA  A   D . n 
B 2 5  DC  5  625 625 DC  C   D . n 
B 2 6  DC  6  626 626 DC  C   D . n 
B 2 7  DT  7  627 627 DT  T   D . n 
B 2 8  DA  8  628 628 DA  A   D . n 
B 2 9  DG  9  629 629 DG  G   D . n 
B 2 10 DT  10 630 630 DT  T   D . n 
B 2 11 DG  11 631 631 DG  G   D . n 
B 2 12 DA  12 632 632 DA  A   D . n 
B 2 13 DC  13 633 633 DC  C   D . n 
B 2 14 DC  14 634 634 DC  C   D . n 
B 2 15 DT  15 635 635 DT  T   D . n 
B 2 16 DA  16 636 636 DA  A   D . n 
B 2 17 DG  17 637 637 DG  G   D . n 
B 2 18 DT  18 638 638 DT  T   D . n 
B 2 19 DT  19 639 639 DT  T   D . n 
B 2 20 DG  20 640 640 DG  G   D . n 
C 3 1  THR 1  92  ?   ?   ?   A . n 
C 3 2  LYS 2  93  ?   ?   ?   A . n 
C 3 3  LEU 3  94  ?   ?   ?   A . n 
C 3 4  ASN 4  95  ?   ?   ?   A . n 
C 3 5  GLY 5  96  ?   ?   ?   A . n 
C 3 6  MET 6  97  ?   ?   ?   A . n 
C 3 7  VAL 7  98  ?   ?   ?   A . n 
C 3 8  LEU 8  99  99  LEU LEU A . n 
C 3 9  LEU 9  100 100 LEU LEU A . n 
C 3 10 CYS 10 101 101 CYS CYS A . n 
C 3 11 LYS 11 102 102 LYS LYS A . n 
C 3 12 VAL 12 103 103 VAL VAL A . n 
C 3 13 CYS 13 104 104 CYS CYS A . n 
C 3 14 GLY 14 105 105 GLY GLY A . n 
C 3 15 ASP 15 106 106 ASP ASP A . n 
C 3 16 VAL 16 107 107 VAL VAL A . n 
C 3 17 ALA 17 108 108 ALA ALA A . n 
C 3 18 SER 18 109 109 SER SER A . n 
C 3 19 GLY 19 110 110 GLY GLY A . n 
C 3 20 PHE 20 111 111 PHE PHE A . n 
C 3 21 HIS 21 112 112 HIS HIS A . n 
C 3 22 TYR 22 113 113 TYR TYR A . n 
C 3 23 GLY 23 114 114 GLY GLY A . n 
C 3 24 VAL 24 115 115 VAL VAL A . n 
C 3 25 LEU 25 116 116 LEU LEU A . n 
C 3 26 ALA 26 117 117 ALA ALA A . n 
C 3 27 CYS 27 118 118 CYS CYS A . n 
C 3 28 GLU 28 119 119 GLU GLU A . n 
C 3 29 GLY 29 120 120 GLY GLY A . n 
C 3 30 CYS 30 121 121 CYS CYS A . n 
C 3 31 LYS 31 122 122 LYS LYS A . n 
C 3 32 GLY 32 123 123 GLY GLY A . n 
C 3 33 PHE 33 124 124 PHE PHE A . n 
C 3 34 PHE 34 125 125 PHE PHE A . n 
C 3 35 ARG 35 126 126 ARG ARG A . n 
C 3 36 ARG 36 127 127 ARG ARG A . n 
C 3 37 SER 37 128 128 SER SER A . n 
C 3 38 ILE 38 129 129 ILE ILE A . n 
C 3 39 GLN 39 130 130 GLN GLN A . n 
C 3 40 GLN 40 131 131 GLN GLN A . n 
C 3 41 ASN 41 132 132 ASN ASN A . n 
C 3 42 ILE 42 133 133 ILE ILE A . n 
C 3 43 GLN 43 133 133 GLN GLN A A n 
C 3 44 TYR 44 134 134 TYR TYR A . n 
C 3 45 LYS 45 135 135 LYS LYS A . n 
C 3 46 ARG 46 136 136 ARG ARG A . n 
C 3 47 CYS 47 137 137 CYS CYS A . n 
C 3 48 LEU 48 138 138 LEU LEU A . n 
C 3 49 LYS 49 139 139 LYS LYS A . n 
C 3 50 ASN 50 140 140 ASN ASN A . n 
C 3 51 GLU 51 141 141 GLU GLU A . n 
C 3 52 ASN 52 142 142 ASN ASN A . n 
C 3 53 CYS 53 143 143 CYS CYS A . n 
C 3 54 SER 54 144 144 SER SER A . n 
C 3 55 ILE 55 145 145 ILE ILE A . n 
C 3 56 VAL 56 146 146 VAL VAL A . n 
C 3 57 ARG 57 147 147 ARG ARG A . n 
C 3 58 ILE 58 148 148 ILE ILE A . n 
C 3 59 ASN 59 149 149 ASN ASN A . n 
C 3 60 ARG 60 150 150 ARG ARG A . n 
C 3 61 ASN 61 151 151 ASN ASN A . n 
C 3 62 ARG 62 152 152 ARG ARG A . n 
C 3 63 CYS 63 153 153 CYS CYS A . n 
C 3 64 GLN 64 154 154 GLN GLN A . n 
C 3 65 GLN 65 155 155 GLN GLN A . n 
C 3 66 CYS 66 156 156 CYS CYS A . n 
C 3 67 ARG 67 157 157 ARG ARG A . n 
C 3 68 PHE 68 158 158 PHE PHE A . n 
C 3 69 LYS 69 159 159 LYS LYS A . n 
C 3 70 LYS 70 160 160 LYS LYS A . n 
C 3 71 CYS 71 161 161 CYS CYS A . n 
C 3 72 LEU 72 162 162 LEU LEU A . n 
C 3 73 SER 73 163 163 SER SER A . n 
C 3 74 VAL 74 164 164 VAL VAL A . n 
C 3 75 GLY 75 165 165 GLY GLY A . n 
C 3 76 MET 76 166 166 MET MET A . n 
C 3 77 SER 77 167 167 SER SER A . n 
C 3 78 ARG 78 168 168 ARG ARG A . n 
C 3 79 ASP 79 169 169 ASP ASP A . n 
C 3 80 ALA 80 170 170 ALA ALA A . n 
C 3 81 VAL 81 171 171 VAL VAL A . n 
C 3 82 ARG 82 172 172 ARG ARG A . n 
C 3 83 PHE 83 173 173 PHE PHE A . n 
C 3 84 GLY 84 174 174 GLY GLY A . n 
C 3 85 ARG 85 175 175 ARG ARG A . n 
C 3 86 ILE 86 176 ?   ?   ?   A . n 
C 3 87 PRO 87 177 ?   ?   ?   A . n 
C 3 88 LYS 88 178 ?   ?   ?   A . n 
C 3 89 ARG 89 179 ?   ?   ?   A . n 
C 3 90 GLU 90 180 ?   ?   ?   A . n 
C 3 91 LYS 91 181 ?   ?   ?   A . n 
C 3 92 GLN 92 182 ?   ?   ?   A . n 
C 3 93 ARG 93 183 ?   ?   ?   A . n 
C 3 94 MET 94 184 ?   ?   ?   A . n 
D 3 1  THR 1  92  ?   ?   ?   B . n 
D 3 2  LYS 2  93  ?   ?   ?   B . n 
D 3 3  LEU 3  94  ?   ?   ?   B . n 
D 3 4  ASN 4  95  ?   ?   ?   B . n 
D 3 5  GLY 5  96  96  GLY GLY B . n 
D 3 6  MET 6  97  97  MET MET B . n 
D 3 7  VAL 7  98  98  VAL VAL B . n 
D 3 8  LEU 8  99  99  LEU LEU B . n 
D 3 9  LEU 9  100 100 LEU LEU B . n 
D 3 10 CYS 10 101 101 CYS CYS B . n 
D 3 11 LYS 11 102 102 LYS LYS B . n 
D 3 12 VAL 12 103 103 VAL VAL B . n 
D 3 13 CYS 13 104 104 CYS CYS B . n 
D 3 14 GLY 14 105 105 GLY GLY B . n 
D 3 15 ASP 15 106 106 ASP ASP B . n 
D 3 16 VAL 16 107 107 VAL VAL B . n 
D 3 17 ALA 17 108 108 ALA ALA B . n 
D 3 18 SER 18 109 109 SER SER B . n 
D 3 19 GLY 19 110 110 GLY GLY B . n 
D 3 20 PHE 20 111 111 PHE PHE B . n 
D 3 21 HIS 21 112 112 HIS HIS B . n 
D 3 22 TYR 22 113 113 TYR TYR B . n 
D 3 23 GLY 23 114 114 GLY GLY B . n 
D 3 24 VAL 24 115 115 VAL VAL B . n 
D 3 25 LEU 25 116 116 LEU LEU B . n 
D 3 26 ALA 26 117 117 ALA ALA B . n 
D 3 27 CYS 27 118 118 CYS CYS B . n 
D 3 28 GLU 28 119 119 GLU GLU B . n 
D 3 29 GLY 29 120 120 GLY GLY B . n 
D 3 30 CYS 30 121 121 CYS CYS B . n 
D 3 31 LYS 31 122 122 LYS LYS B . n 
D 3 32 GLY 32 123 123 GLY GLY B . n 
D 3 33 PHE 33 124 124 PHE PHE B . n 
D 3 34 PHE 34 125 125 PHE PHE B . n 
D 3 35 ARG 35 126 126 ARG ARG B . n 
D 3 36 ARG 36 127 127 ARG ARG B . n 
D 3 37 SER 37 128 128 SER SER B . n 
D 3 38 ILE 38 129 129 ILE ILE B . n 
D 3 39 GLN 39 130 130 GLN GLN B . n 
D 3 40 GLN 40 131 131 GLN GLN B . n 
D 3 41 ASN 41 132 132 ASN ASN B . n 
D 3 42 ILE 42 133 133 ILE ILE B . n 
D 3 43 GLN 43 133 133 GLN GLN B A n 
D 3 44 TYR 44 134 134 TYR TYR B . n 
D 3 45 LYS 45 135 135 LYS LYS B . n 
D 3 46 ARG 46 136 136 ARG ARG B . n 
D 3 47 CYS 47 137 137 CYS CYS B . n 
D 3 48 LEU 48 138 138 LEU LEU B . n 
D 3 49 LYS 49 139 139 LYS LYS B . n 
D 3 50 ASN 50 140 140 ASN ASN B . n 
D 3 51 GLU 51 141 141 GLU GLU B . n 
D 3 52 ASN 52 142 142 ASN ASN B . n 
D 3 53 CYS 53 143 143 CYS CYS B . n 
D 3 54 SER 54 144 144 SER SER B . n 
D 3 55 ILE 55 145 145 ILE ILE B . n 
D 3 56 VAL 56 146 146 VAL VAL B . n 
D 3 57 ARG 57 147 147 ARG ARG B . n 
D 3 58 ILE 58 148 148 ILE ILE B . n 
D 3 59 ASN 59 149 149 ASN ASN B . n 
D 3 60 ARG 60 150 150 ARG ARG B . n 
D 3 61 ASN 61 151 151 ASN ASN B . n 
D 3 62 ARG 62 152 152 ARG ARG B . n 
D 3 63 CYS 63 153 153 CYS CYS B . n 
D 3 64 GLN 64 154 154 GLN GLN B . n 
D 3 65 GLN 65 155 155 GLN GLN B . n 
D 3 66 CYS 66 156 156 CYS CYS B . n 
D 3 67 ARG 67 157 157 ARG ARG B . n 
D 3 68 PHE 68 158 158 PHE PHE B . n 
D 3 69 LYS 69 159 159 LYS LYS B . n 
D 3 70 LYS 70 160 160 LYS LYS B . n 
D 3 71 CYS 71 161 161 CYS CYS B . n 
D 3 72 LEU 72 162 162 LEU LEU B . n 
D 3 73 SER 73 163 163 SER SER B . n 
D 3 74 VAL 74 164 164 VAL VAL B . n 
D 3 75 GLY 75 165 165 GLY GLY B . n 
D 3 76 MET 76 166 166 MET MET B . n 
D 3 77 SER 77 167 167 SER SER B . n 
D 3 78 ARG 78 168 168 ARG ARG B . n 
D 3 79 ASP 79 169 169 ASP ASP B . n 
D 3 80 ALA 80 170 170 ALA ALA B . n 
D 3 81 VAL 81 171 171 VAL VAL B . n 
D 3 82 ARG 82 172 172 ARG ARG B . n 
D 3 83 PHE 83 173 173 PHE PHE B . n 
D 3 84 GLY 84 174 174 GLY GLY B . n 
D 3 85 ARG 85 175 175 ARG ARG B . n 
D 3 86 ILE 86 176 176 ILE ILE B . n 
D 3 87 PRO 87 177 177 PRO PRO B . n 
D 3 88 LYS 88 178 178 LYS LYS B . n 
D 3 89 ARG 89 179 ?   ?   ?   B . n 
D 3 90 GLU 90 180 ?   ?   ?   B . n 
D 3 91 LYS 91 181 ?   ?   ?   B . n 
D 3 92 GLN 92 182 ?   ?   ?   B . n 
D 3 93 ARG 93 183 ?   ?   ?   B . n 
D 3 94 MET 94 184 ?   ?   ?   B . n 
#               1 
_pdbx_struct_mod_residue.label_asym_id    A 
_pdbx_struct_mod_residue.label_comp_id    5IU 
_pdbx_struct_mod_residue.label_seq_id     13 
_pdbx_struct_mod_residue.auth_asym_id     C 
_pdbx_struct_mod_residue.auth_comp_id     5IU 
_pdbx_struct_mod_residue.auth_seq_id      612 
_pdbx_struct_mod_residue.PDB_ins_code     ? 
_pdbx_struct_mod_residue.parent_comp_id   DU 
_pdbx_struct_mod_residue.details          "5-IODO-2'-DEOXYURIDINE-5'-MONOPHOSPHATE" 
#                   1 
_pdbx_struct_assembly.details              author_defined_assembly 
_pdbx_struct_assembly.method_details       ? 
_pdbx_struct_assembly.oligomeric_details   tetrameric 
_pdbx_struct_assembly.oligomeric_count     4 
_pdbx_struct_assembly_gen.assembly_id       1 
_pdbx_struct_assembly_gen.oper_expression   1 
_pdbx_struct_assembly_gen.asym_id_list      A,B,C,D,E,F,G,H,I,J,K,L 
#                   1 
_pdbx_struct_oper_list.type                 'identity operation'                 1_555 
_pdbx_struct_oper_list.symmetry_operation   x,y,z 
_pdbx_struct_oper_list.matrix[1][1]         1.0000000000 
_pdbx_struct_oper_list.matrix[1][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[1][3]         0.0000000000 
_pdbx_struct_oper_list.vector[1]            0.0000000000 
_pdbx_struct_oper_list.matrix[2][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[2][2]         1.0000000000 
_pdbx_struct_oper_list.matrix[2][3]         0.0000000000 
_pdbx_struct_oper_list.vector[2]            0.0000000000 
_pdbx_struct_oper_list.matrix[3][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][3]         1.0000000000 
_pdbx_struct_oper_list.vector[3]            0.0000000000 
1  SG ? C CYS 10 ? A CYS 101 ? 1_555 ZN ? E ZN . ? A ZN 550 ? 1_555 SG ? C CYS 13 ? A CYS 104 ? 1_555 105.9 ? 
2  SG ? C CYS 10 ? A CYS 101 ? 1_555 ZN ? E ZN . ? A ZN 550 ? 1_555 SG ? C CYS 27 ? A CYS 118 ? 1_555 105.1 ? 
3  SG ? C CYS 13 ? A CYS 104 ? 1_555 ZN ? E ZN . ? A ZN 550 ? 1_555 SG ? C CYS 27 ? A CYS 118 ? 1_555 99.1  ? 
4  SG ? C CYS 10 ? A CYS 101 ? 1_555 ZN ? E ZN . ? A ZN 550 ? 1_555 SG ? C CYS 30 ? A CYS 121 ? 1_555 108.6 ? 
5  SG ? C CYS 13 ? A CYS 104 ? 1_555 ZN ? E ZN . ? A ZN 550 ? 1_555 SG ? C CYS 30 ? A CYS 121 ? 1_555 114.2 ? 
6  SG ? C CYS 27 ? A CYS 118 ? 1_555 ZN ? E ZN . ? A ZN 550 ? 1_555 SG ? C CYS 30 ? A CYS 121 ? 1_555 122.4 ? 
7  SG ? C CYS 47 ? A CYS 137 ? 1_555 ZN ? F ZN . ? A ZN 551 ? 1_555 SG ? C CYS 53 ? A CYS 143 ? 1_555 129.0 ? 
8  SG ? C CYS 47 ? A CYS 137 ? 1_555 ZN ? F ZN . ? A ZN 551 ? 1_555 SG ? C CYS 63 ? A CYS 153 ? 1_555 107.7 ? 
9  SG ? C CYS 53 ? A CYS 143 ? 1_555 ZN ? F ZN . ? A ZN 551 ? 1_555 SG ? C CYS 63 ? A CYS 153 ? 1_555 109.4 ? 
10 SG ? C CYS 47 ? A CYS 137 ? 1_555 ZN ? F ZN . ? A ZN 551 ? 1_555 SG ? C CYS 66 ? A CYS 156 ? 1_555 117.1 ? 
11 SG ? C CYS 53 ? A CYS 143 ? 1_555 ZN ? F ZN . ? A ZN 551 ? 1_555 SG ? C CYS 66 ? A CYS 156 ? 1_555 93.2  ? 
12 SG ? C CYS 63 ? A CYS 153 ? 1_555 ZN ? F ZN . ? A ZN 551 ? 1_555 SG ? C CYS 66 ? A CYS 156 ? 1_555 94.9  ? 
13 SG ? D CYS 10 ? B CYS 101 ? 1_555 ZN ? G ZN . ? B ZN 450 ? 1_555 SG ? D CYS 13 ? B CYS 104 ? 1_555 103.7 ? 
14 SG ? D CYS 10 ? B CYS 101 ? 1_555 ZN ? G ZN . ? B ZN 450 ? 1_555 SG ? D CYS 27 ? B CYS 118 ? 1_555 126.5 ? 
15 SG ? D CYS 13 ? B CYS 104 ? 1_555 ZN ? G ZN . ? B ZN 450 ? 1_555 SG ? D CYS 27 ? B CYS 118 ? 1_555 110.5 ? 
16 SG ? D CYS 10 ? B CYS 101 ? 1_555 ZN ? G ZN . ? B ZN 450 ? 1_555 SG ? D CYS 30 ? B CYS 121 ? 1_555 104.5 ? 
17 SG ? D CYS 13 ? B CYS 104 ? 1_555 ZN ? G ZN . ? B ZN 450 ? 1_555 SG ? D CYS 30 ? B CYS 121 ? 1_555 114.9 ? 
18 SG ? D CYS 27 ? B CYS 118 ? 1_555 ZN ? G ZN . ? B ZN 450 ? 1_555 SG ? D CYS 30 ? B CYS 121 ? 1_555 96.9  ? 
19 SG ? D CYS 47 ? B CYS 137 ? 1_555 ZN ? H ZN . ? B ZN 451 ? 1_555 SG ? D CYS 53 ? B CYS 143 ? 1_555 106.1 ? 
20 SG ? D CYS 47 ? B CYS 137 ? 1_555 ZN ? H ZN . ? B ZN 451 ? 1_555 SG ? D CYS 63 ? B CYS 153 ? 1_555 100.6 ? 
21 SG ? D CYS 53 ? B CYS 143 ? 1_555 ZN ? H ZN . ? B ZN 451 ? 1_555 SG ? D CYS 63 ? B CYS 153 ? 1_555 126.1 ? 
22 SG ? D CYS 47 ? B CYS 137 ? 1_555 ZN ? H ZN . ? B ZN 451 ? 1_555 SG ? D CYS 66 ? B CYS 156 ? 1_555 100.5 ? 
23 SG ? D CYS 53 ? B CYS 143 ? 1_555 ZN ? H ZN . ? B ZN 451 ? 1_555 SG ? D CYS 66 ? B CYS 156 ? 1_555 98.9  ? 
24 SG ? D CYS 63 ? B CYS 153 ? 1_555 ZN ? H ZN . ? B ZN 451 ? 1_555 SG ? D CYS 66 ? B CYS 156 ? 1_555 121.2 ? 
1 'Structure model' 1 0 1998-10-21 
2 'Structure model' 1 1 2008-05-22 
3 'Structure model' 1 2 2011-07-13 
_pdbx_audit_revision_details.ordinal             1 
_pdbx_audit_revision_details.revision_ordinal    1 
_pdbx_audit_revision_details.data_content_type   'Structure model' 
_pdbx_audit_revision_details.provider            repository 
_pdbx_audit_revision_details.type                'Initial release' 
_pdbx_audit_revision_details.description         ? 
1 2 'Structure model' 'Version format compliance' 
2 3 'Structure model' 'Version format compliance' 
AMoRE     phasing          .    ? 1 
X-PLOR    refinement       3.84 ? 2 
DENZO     'data reduction' .    ? 3 
SCALEPACK 'data scaling'   .    ? 4 
1 1 OP2 D DG  640 ? ? O D HOH 720 ? ? 1.96 
2 1 N4  C DC  609 ? ? O C HOH 778 ? ? 2.10 
3 1 NE2 A HIS 112 ? ? O A HOH 788 ? ? 2.17 
4 1 OP2 D DT  627 ? ? O D HOH 712 ? ? 2.17 
1 1 CD B LYS 139 ? ? CE B LYS 139 ? ? NZ  B LYS 139 ? ? 95.48  111.70 -16.22 2.30 N 
2 1 NE B ARG 147 ? ? CZ B ARG 147 ? ? NH2 B ARG 147 ? ? 123.67 120.30 3.37   0.50 N 
1  1 LYS A 102 ? ? -74.89  21.40   
2  1 CYS A 104 ? ? -148.03 29.48   
3  1 TYR A 113 ? ? 43.04   28.17   
4  1 GLN A 130 ? ? -80.27  34.19   
5  1 ASN A 132 ? ? -99.13  41.85   
6  1 GLN A 133 A ? -113.57 61.06   
7  1 TYR A 134 ? ? -29.49  123.80  
8  1 ARG A 136 ? ? -44.11  167.56  
9  1 GLU A 141 ? ? 40.06   19.49   
10 1 LEU A 162 ? ? -76.59  39.14   
11 1 SER A 163 ? ? -146.51 -24.91  
12 1 TYR B 113 ? ? 47.53   19.70   
13 1 ILE B 133 ? ? -60.53  98.57   
14 1 ARG B 136 ? ? -69.48  -173.68 
15 1 LEU B 138 ? ? -44.66  -10.02  
16 1 GLN B 154 ? ? -58.42  -71.96  
17 1 GLN B 155 ? ? -23.79  -48.69  
18 1 MET B 166 ? ? -51.35  108.73  
19 1 ARG B 175 ? ? -18.10  142.65  
20 1 PRO B 177 ? ? -68.11  -136.17 
1 1 DC C 603 ? ? 0.062 'SIDE CHAIN' 
2 1 DC C 611 ? ? 0.073 'SIDE CHAIN' 
3 1 DG D 631 ? ? 0.066 'SIDE CHAIN' 
4 1 DA D 632 ? ? 0.057 'SIDE CHAIN' 
1 1 Y 1 B MET 97 ? CG ? D MET 6 CG 
2 1 Y 1 B MET 97 ? SD ? D MET 6 SD 
3 1 Y 1 B MET 97 ? CE ? D MET 6 CE 
1  1 Y 1 A THR 92  ? C THR 1  
2  1 Y 1 A LYS 93  ? C LYS 2  
3  1 Y 1 A LEU 94  ? C LEU 3  
4  1 Y 1 A ASN 95  ? C ASN 4  
5  1 Y 1 A GLY 96  ? C GLY 5  
6  1 Y 1 A MET 97  ? C MET 6  
7  1 Y 1 A VAL 98  ? C VAL 7  
8  1 Y 1 A ILE 176 ? C ILE 86 
9  1 Y 1 A PRO 177 ? C PRO 87 
10 1 Y 1 A LYS 178 ? C LYS 88 
11 1 Y 1 A ARG 179 ? C ARG 89 
12 1 Y 1 A GLU 180 ? C GLU 90 
13 1 Y 1 A LYS 181 ? C LYS 91 
14 1 Y 1 A GLN 182 ? C GLN 92 
15 1 Y 1 A ARG 183 ? C ARG 93 
16 1 Y 1 A MET 184 ? C MET 94 
17 1 Y 1 B THR 92  ? D THR 1  
18 1 Y 1 B LYS 93  ? D LYS 2  
19 1 Y 1 B LEU 94  ? D LEU 3  
20 1 Y 1 B ASN 95  ? D ASN 4  
21 1 Y 1 B ARG 179 ? D ARG 89 
22 1 Y 1 B GLU 180 ? D GLU 90 
23 1 Y 1 B LYS 181 ? D LYS 91 
24 1 Y 1 B GLN 182 ? D GLN 92 
25 1 Y 1 B ARG 183 ? D ARG 93 
26 1 Y 1 B MET 184 ? D MET 94 
1A6Y 'double helix'        
1A6Y 'b-form double helix' 
1 A DC  1  1_555 B DG 20 1_555 0.098  -0.285 -0.696 10.082 -8.866  -5.294 1  C_DC600:DG640_D  C 600 ? D 640 ? 19 1 
1 A DA  2  1_555 B DT 19 1_555 0.342  -0.280 0.061  11.415 -21.955 -3.096 2  C_DA601:DT639_D  C 601 ? D 639 ? 20 1 
1 A DA  3  1_555 B DT 18 1_555 0.044  -0.320 -0.019 -6.683 -19.344 -7.798 3  C_DA602:DT638_D  C 602 ? D 638 ? 20 1 
1 A DC  4  1_555 B DG 17 1_555 -0.010 -0.327 0.093  2.543  -11.514 1.742  4  C_DC603:DG637_D  C 603 ? D 637 ? 19 1 
1 A DT  5  1_555 B DA 16 1_555 0.770  -0.090 0.378  -4.807 -14.273 0.033  5  C_DT604:DA636_D  C 604 ? D 636 ? 20 1 
1 A DA  6  1_555 B DT 15 1_555 -0.301 0.451  -0.013 -3.743 -9.908  7.113  6  C_DA605:DT635_D  C 605 ? D 635 ? ?  ? 
1 A DG  7  1_555 B DC 14 1_555 0.341  -0.179 -0.495 4.978  -8.116  2.971  7  C_DG606:DC634_D  C 606 ? D 634 ? 19 1 
1 A DG  8  1_555 B DC 13 1_555 -0.286 0.318  -0.296 -6.287 -16.637 8.904  8  C_DG607:DC633_D  C 607 ? D 633 ? ?  1 
1 A DT  9  1_555 B DA 12 1_555 -0.071 0.200  0.016  -1.984 -17.335 3.450  9  C_DT608:DA632_D  C 608 ? D 632 ? 20 1 
1 A DC  10 1_555 B DG 11 1_555 0.204  -0.114 -0.599 1.608  0.951   -2.193 10 C_DC609:DG631_D  C 609 ? D 631 ? 19 1 
1 A DA  11 1_555 B DT 10 1_555 0.578  0.005  0.545  13.434 -20.089 2.491  11 C_DA610:DT630_D  C 610 ? D 630 ? 20 1 
1 A DC  12 1_555 B DG 9  1_555 0.008  -0.551 -0.227 8.147  -9.663  1.740  12 C_DC611:DG629_D  C 611 ? D 629 ? 19 1 
1 A 5IU 13 1_555 B DA 8  1_555 0.757  -0.054 0.140  -1.194 -8.382  -3.748 13 C_5IU612:DA628_D C 612 ? D 628 ? 20 1 
1 A DA  14 1_555 B DT 7  1_555 0.014  -0.066 0.473  3.475  -11.189 -5.805 14 C_DA613:DT627_D  C 613 ? D 627 ? 20 1 
1 A DG  15 1_555 B DC 6  1_555 0.164  -0.212 -0.167 6.749  -6.844  7.086  15 C_DG614:DC626_D  C 614 ? D 626 ? 19 1 
1 A DG  16 1_555 B DC 5  1_555 0.034  -0.088 -0.206 -5.276 -9.475  -1.930 16 C_DG615:DC625_D  C 615 ? D 625 ? 19 1 
1 A DT  17 1_555 B DA 4  1_555 -0.441 -0.393 0.137  -2.425 -13.835 0.841  17 C_DT616:DA624_D  C 616 ? D 624 ? 20 1 
1 A DC  18 1_555 B DG 3  1_555 0.263  -0.442 -0.278 2.560  -1.241  0.435  18 C_DC617:DG623_D  C 617 ? D 623 ? 19 1 
1 A DA  19 1_555 B DT 2  1_555 0.127  -0.055 0.273  8.012  -19.605 2.071  19 C_DA618:DT622_D  C 618 ? D 622 ? 20 1 
1 A DG  20 1_555 B DC 1  1_555 0.709  0.131  -0.067 7.294  -12.480 -3.501 20 C_DG619:DC621_D  C 619 ? D 621 ? 19 1 
1 A DC  1  1_555 B DG 20 1_555 A DA  2  1_555 B DT 19 1_555 0.399  1.025  3.287 -2.822 11.124 39.213 0.188  -0.898 3.407 16.159 
4.099   40.795 1  CC_DC600DA601:DT639DG640_DD  C 600 ? D 640 ? C 601 ? D 639 ? 
1 A DA  2  1_555 B DT 19 1_555 A DA  3  1_555 B DT 18 1_555 -0.532 0.148  3.576 -3.946 12.542 37.456 -1.414 0.272  3.485 18.835 
5.926   39.618 2  CC_DA601DA602:DT638DT639_DD  C 601 ? D 639 ? C 602 ? D 638 ? 
1 A DA  3  1_555 B DT 18 1_555 A DC  4  1_555 B DG 17 1_555 1.098  -0.643 2.970 1.675  -1.703 30.552 -0.906 -1.774 3.055 -3.226 
-3.173  30.643 3  CC_DA602DC603:DG637DT638_DD  C 602 ? D 638 ? C 603 ? D 637 ? 
1 A DC  4  1_555 B DG 17 1_555 A DT  5  1_555 B DA 16 1_555 -0.707 -0.170 3.624 -0.108 7.367  37.386 -1.292 1.069  3.530 11.357 
0.167   38.079 4  CC_DC603DT604:DA636DG637_DD  C 603 ? D 637 ? C 604 ? D 636 ? 
1 A DT  5  1_555 B DA 16 1_555 A DA  6  1_555 B DT 15 1_555 -0.064 1.919  3.291 1.345  -7.003 46.180 2.984  0.190  2.983 -8.865 
-1.703  46.698 5  CC_DT604DA605:DT635DA636_DD  C 604 ? D 636 ? C 605 ? D 635 ? 
1 A DA  6  1_555 B DT 15 1_555 A DG  7  1_555 B DC 14 1_555 -0.556 0.362  3.299 0.228  5.202  30.181 -0.361 1.099  3.309 9.897  
-0.434  30.617 6  CC_DA605DG606:DC634DT635_DD  C 605 ? D 635 ? C 606 ? D 634 ? 
1 A DG  7  1_555 B DC 14 1_555 A DG  8  1_555 B DC 13 1_555 0.266  0.354  3.402 -1.079 8.625  31.856 -0.920 -0.662 3.370 15.359 
1.921   32.991 7  CC_DG606DG607:DC633DC634_DD  C 606 ? D 634 ? C 607 ? D 633 ? 
1 A DG  8  1_555 B DC 13 1_555 A DT  9  1_555 B DA 12 1_555 -0.504 -0.194 2.989 -3.127 5.145  31.688 -1.190 0.398  2.957 9.317  
5.663   32.241 8  CC_DG607DT608:DA632DC633_DD  C 607 ? D 633 ? C 608 ? D 632 ? 
1 A DT  9  1_555 B DA 12 1_555 A DC  10 1_555 B DG 11 1_555 1.440  1.449  3.202 9.293  -2.100 38.154 2.411  -1.014 3.367 -3.153 
-13.952 39.282 9  CC_DT608DC609:DG631DA632_DD  C 608 ? D 632 ? C 609 ? D 631 ? 
1 A DC  10 1_555 B DG 11 1_555 A DA  11 1_555 B DT 10 1_555 -0.314 1.479  3.000 -6.803 4.182  41.369 1.649  -0.229 3.139 5.854  
9.523   42.100 10 CC_DC609DA610:DT630DG631_DD  C 609 ? D 631 ? C 610 ? D 630 ? 
1 A DA  11 1_555 B DT 10 1_555 A DC  12 1_555 B DG 9  1_555 1.102  -1.087 3.374 7.044  2.654  30.780 -2.509 -0.647 3.433 4.908  
-13.027 31.666 11 CC_DA610DC611:DG629DT630_DD  C 610 ? D 630 ? C 611 ? D 629 ? 
1 A DC  12 1_555 B DG 9  1_555 A 5IU 13 1_555 B DA 8  1_555 -0.854 -0.525 3.693 0.136  10.560 31.883 -2.827 1.505  3.351 18.596 
-0.239  33.543 12 CC_DC6115IU612:DA628DG629_DD C 611 ? D 629 ? C 612 ? D 628 ? 
1 A 5IU 13 1_555 B DA 8  1_555 A DA  14 1_555 B DT 7  1_555 -1.638 0.270  3.045 -7.863 -1.904 37.728 0.639  1.528  3.291 -2.903 
11.991  38.554 13 CC_5IU612DA613:DT627DA628_DD C 612 ? D 628 ? C 613 ? D 627 ? 
1 A DA  14 1_555 B DT 7  1_555 A DG  15 1_555 B DC 6  1_555 0.805  -0.598 3.395 1.631  -0.899 31.034 -0.935 -1.176 3.447 -1.679 
-3.045  31.089 14 CC_DA613DG614:DC626DT627_DD  C 613 ? D 627 ? C 614 ? D 626 ? 
1 A DG  15 1_555 B DC 6  1_555 A DG  16 1_555 B DC 5  1_555 -0.981 -0.380 3.561 -5.647 7.203  39.412 -1.441 0.723  3.542 10.510 
8.238   40.420 15 CC_DG614DG615:DC625DC626_DD  C 614 ? D 626 ? C 615 ? D 625 ? 
1 A DG  16 1_555 B DC 5  1_555 A DT  17 1_555 B DA 4  1_555 -0.159 -0.740 3.137 -0.897 -1.964 29.448 -1.047 0.128  3.182 -3.858 
1.762   29.525 16 CC_DG615DT616:DA624DC625_DD  C 615 ? D 625 ? C 616 ? D 624 ? 
1 A DT  17 1_555 B DA 4  1_555 A DC  18 1_555 B DG 3  1_555 1.263  1.959  3.332 5.008  3.028  40.632 2.445  -1.222 3.587 4.333  
-7.167  41.034 17 CC_DT616DC617:DG623DA624_DD  C 616 ? D 624 ? C 617 ? D 623 ? 
1 A DC  18 1_555 B DG 3  1_555 A DA  19 1_555 B DT 2  1_555 -0.559 1.518  3.183 -3.736 2.619  36.194 2.063  0.377  3.320 4.194  
5.984   36.471 18 CC_DC617DA618:DT622DG623_DD  C 617 ? D 623 ? C 618 ? D 622 ? 
1 A DA  19 1_555 B DT 2  1_555 A DG  20 1_555 B DC 1  1_555 0.141  0.172  3.467 1.454  -1.016 39.879 0.376  -0.029 3.465 -1.488 
-2.131  39.917 19 CC_DA618DG619:DC621DT622_DD  C 618 ? D 622 ? C 619 ? D 621 ? 
5 water      HOH 
E 4 ZN  1  550 550 ZN  ZN  A . 
F 4 ZN  1  551 551 ZN  ZN  A . 
G 4 ZN  1  450 450 ZN  ZN  B . 
H 4 ZN  1  451 451 ZN  ZN  B . 
I 5 HOH 1  704 704 HOH HOH C . 
I 5 HOH 2  719 719 HOH HOH C . 
I 5 HOH 3  722 722 HOH HOH C . 
I 5 HOH 4  734 734 HOH HOH C . 
I 5 HOH 5  735 735 HOH HOH C . 
I 5 HOH 6  737 737 HOH HOH C . 
I 5 HOH 7  742 742 HOH HOH C . 
I 5 HOH 8  743 743 HOH HOH C . 
I 5 HOH 9  749 749 HOH HOH C . 
I 5 HOH 10 750 750 HOH HOH C . 
I 5 HOH 11 753 753 HOH HOH C . 
I 5 HOH 12 777 777 HOH HOH C . 
I 5 HOH 13 778 778 HOH HOH C . 
I 5 HOH 14 782 782 HOH HOH C . 
I 5 HOH 15 783 783 HOH HOH C . 
I 5 HOH 16 789 789 HOH HOH C . 
I 5 HOH 17 792 792 HOH HOH C . 
I 5 HOH 18 798 798 HOH HOH C . 
I 5 HOH 19 801 801 HOH HOH C . 
I 5 HOH 20 805 805 HOH HOH C . 
I 5 HOH 21 806 806 HOH HOH C . 
I 5 HOH 22 807 807 HOH HOH C . 
I 5 HOH 23 809 809 HOH HOH C . 
I 5 HOH 24 811 811 HOH HOH C . 
I 5 HOH 25 814 814 HOH HOH C . 
I 5 HOH 26 815 815 HOH HOH C . 
I 5 HOH 27 817 817 HOH HOH C . 
I 5 HOH 28 818 818 HOH HOH C . 
I 5 HOH 29 821 821 HOH HOH C . 
I 5 HOH 30 823 823 HOH HOH C . 
I 5 HOH 31 825 825 HOH HOH C . 
I 5 HOH 32 840 840 HOH HOH C . 
I 5 HOH 33 847 847 HOH HOH C . 
I 5 HOH 34 849 849 HOH HOH C . 
I 5 HOH 35 850 850 HOH HOH C . 
I 5 HOH 36 851 851 HOH HOH C . 
I 5 HOH 37 857 857 HOH HOH C . 
I 5 HOH 38 858 858 HOH HOH C . 
I 5 HOH 39 861 861 HOH HOH C . 
I 5 HOH 40 866 866 HOH HOH C . 
I 5 HOH 41 867 867 HOH HOH C . 
I 5 HOH 42 868 868 HOH HOH C . 
I 5 HOH 43 872 872 HOH HOH C . 
I 5 HOH 44 875 875 HOH HOH C . 
I 5 HOH 45 876 876 HOH HOH C . 
I 5 HOH 46 877 877 HOH HOH C . 
I 5 HOH 47 878 878 HOH HOH C . 
I 5 HOH 48 880 880 HOH HOH C . 
I 5 HOH 49 881 881 HOH HOH C . 
I 5 HOH 50 882 882 HOH HOH C . 
I 5 HOH 51 887 887 HOH HOH C . 
I 5 HOH 52 893 893 HOH HOH C . 
I 5 HOH 53 895 895 HOH HOH C . 
I 5 HOH 54 917 917 HOH HOH C . 
I 5 HOH 55 919 919 HOH HOH C . 
I 5 HOH 56 926 926 HOH HOH C . 
I 5 HOH 57 929 929 HOH HOH C . 
I 5 HOH 58 932 932 HOH HOH C . 
J 5 HOH 1  701 701 HOH HOH D . 
J 5 HOH 2  702 702 HOH HOH D . 
J 5 HOH 3  703 703 HOH HOH D . 
J 5 HOH 4  706 706 HOH HOH D . 
J 5 HOH 5  712 712 HOH HOH D . 
J 5 HOH 6  713 713 HOH HOH D . 
J 5 HOH 7  714 714 HOH HOH D . 
J 5 HOH 8  715 715 HOH HOH D . 
J 5 HOH 9  716 716 HOH HOH D . 
J 5 HOH 10 720 720 HOH HOH D . 
J 5 HOH 11 723 723 HOH HOH D . 
J 5 HOH 12 726 726 HOH HOH D . 
J 5 HOH 13 728 728 HOH HOH D . 
J 5 HOH 14 731 731 HOH HOH D . 
J 5 HOH 15 738 738 HOH HOH D . 
J 5 HOH 16 739 739 HOH HOH D . 
J 5 HOH 17 740 740 HOH HOH D . 
J 5 HOH 18 744 744 HOH HOH D . 
J 5 HOH 19 745 745 HOH HOH D . 
J 5 HOH 20 746 746 HOH HOH D . 
J 5 HOH 21 757 757 HOH HOH D . 
J 5 HOH 22 758 758 HOH HOH D . 
J 5 HOH 23 759 759 HOH HOH D . 
J 5 HOH 24 761 761 HOH HOH D . 
J 5 HOH 25 776 776 HOH HOH D . 
J 5 HOH 26 781 781 HOH HOH D . 
J 5 HOH 27 791 791 HOH HOH D . 
J 5 HOH 28 794 794 HOH HOH D . 
J 5 HOH 29 796 796 HOH HOH D . 
J 5 HOH 30 803 803 HOH HOH D . 
J 5 HOH 31 804 804 HOH HOH D . 
J 5 HOH 32 808 808 HOH HOH D . 
J 5 HOH 33 810 810 HOH HOH D . 
J 5 HOH 34 819 819 HOH HOH D . 
J 5 HOH 35 820 820 HOH HOH D . 
J 5 HOH 36 822 822 HOH HOH D . 
J 5 HOH 37 824 824 HOH HOH D . 
J 5 HOH 38 827 827 HOH HOH D . 
J 5 HOH 39 828 828 HOH HOH D . 
J 5 HOH 40 829 829 HOH HOH D . 
J 5 HOH 41 830 830 HOH HOH D . 
J 5 HOH 42 831 831 HOH HOH D . 
J 5 HOH 43 832 832 HOH HOH D . 
J 5 HOH 44 833 833 HOH HOH D . 
J 5 HOH 45 834 834 HOH HOH D . 
J 5 HOH 46 835 835 HOH HOH D . 
J 5 HOH 47 836 836 HOH HOH D . 
J 5 HOH 48 837 837 HOH HOH D . 
J 5 HOH 49 838 838 HOH HOH D . 
J 5 HOH 50 839 839 HOH HOH D . 
J 5 HOH 51 841 841 HOH HOH D . 
J 5 HOH 52 845 845 HOH HOH D . 
J 5 HOH 53 860 860 HOH HOH D . 
J 5 HOH 54 863 863 HOH HOH D . 
J 5 HOH 55 865 865 HOH HOH D . 
J 5 HOH 56 869 869 HOH HOH D . 
J 5 HOH 57 870 870 HOH HOH D . 
J 5 HOH 58 871 871 HOH HOH D . 
J 5 HOH 59 873 873 HOH HOH D . 
J 5 HOH 60 874 874 HOH HOH D . 
J 5 HOH 61 879 879 HOH HOH D . 
J 5 HOH 62 891 891 HOH HOH D . 
J 5 HOH 63 897 897 HOH HOH D . 
J 5 HOH 64 898 898 HOH HOH D . 
J 5 HOH 65 906 906 HOH HOH D . 
J 5 HOH 66 907 907 HOH HOH D . 
J 5 HOH 67 908 908 HOH HOH D . 
J 5 HOH 68 909 909 HOH HOH D . 
J 5 HOH 69 910 910 HOH HOH D . 
J 5 HOH 70 911 911 HOH HOH D . 
J 5 HOH 71 912 912 HOH HOH D . 
J 5 HOH 72 916 916 HOH HOH D . 
J 5 HOH 73 920 920 HOH HOH D . 
J 5 HOH 74 922 922 HOH HOH D . 
J 5 HOH 75 930 930 HOH HOH D . 
J 5 HOH 76 931 931 HOH HOH D . 
J 5 HOH 77 933 933 HOH HOH D . 
K 5 HOH 1  709 709 HOH HOH A . 
K 5 HOH 2  710 710 HOH HOH A . 
K 5 HOH 3  711 711 HOH HOH A . 
K 5 HOH 4  721 721 HOH HOH A . 
K 5 HOH 5  724 724 HOH HOH A . 
K 5 HOH 6  725 725 HOH HOH A . 
K 5 HOH 7  727 727 HOH HOH A . 
K 5 HOH 8  729 729 HOH HOH A . 
K 5 HOH 9  730 730 HOH HOH A . 
K 5 HOH 10 733 733 HOH HOH A . 
K 5 HOH 11 747 747 HOH HOH A . 
K 5 HOH 12 762 762 HOH HOH A . 
K 5 HOH 13 770 770 HOH HOH A . 
K 5 HOH 14 771 771 HOH HOH A . 
K 5 HOH 15 772 772 HOH HOH A . 
K 5 HOH 16 774 774 HOH HOH A . 
K 5 HOH 17 775 775 HOH HOH A . 
K 5 HOH 18 787 787 HOH HOH A . 
K 5 HOH 19 788 788 HOH HOH A . 
K 5 HOH 20 790 790 HOH HOH A . 
K 5 HOH 21 812 812 HOH HOH A . 
K 5 HOH 22 826 826 HOH HOH A . 
K 5 HOH 23 842 842 HOH HOH A . 
K 5 HOH 24 843 843 HOH HOH A . 
K 5 HOH 25 844 844 HOH HOH A . 
K 5 HOH 26 846 846 HOH HOH A . 
K 5 HOH 27 864 864 HOH HOH A . 
K 5 HOH 28 883 883 HOH HOH A . 
K 5 HOH 29 884 884 HOH HOH A . 
K 5 HOH 30 885 885 HOH HOH A . 
K 5 HOH 31 900 900 HOH HOH A . 
K 5 HOH 32 903 903 HOH HOH A . 
K 5 HOH 33 915 915 HOH HOH A . 
K 5 HOH 34 918 918 HOH HOH A . 
K 5 HOH 35 924 924 HOH HOH A . 
K 5 HOH 36 925 925 HOH HOH A . 
K 5 HOH 37 927 927 HOH HOH A . 
K 5 HOH 38 928 928 HOH HOH A . 
L 5 HOH 1  700 700 HOH HOH B . 
L 5 HOH 2  705 705 HOH HOH B . 
L 5 HOH 3  707 707 HOH HOH B . 
L 5 HOH 4  708 708 HOH HOH B . 
L 5 HOH 5  717 717 HOH HOH B . 
L 5 HOH 6  718 718 HOH HOH B . 
L 5 HOH 7  732 732 HOH HOH B . 
L 5 HOH 8  736 736 HOH HOH B . 
L 5 HOH 9  741 741 HOH HOH B . 
L 5 HOH 10 748 748 HOH HOH B . 
L 5 HOH 11 751 751 HOH HOH B . 
L 5 HOH 12 752 752 HOH HOH B . 
L 5 HOH 13 754 754 HOH HOH B . 
L 5 HOH 14 755 755 HOH HOH B . 
L 5 HOH 15 756 756 HOH HOH B . 
L 5 HOH 16 760 760 HOH HOH B . 
L 5 HOH 17 763 763 HOH HOH B . 
L 5 HOH 18 764 764 HOH HOH B . 
L 5 HOH 19 765 765 HOH HOH B . 
L 5 HOH 20 766 766 HOH HOH B . 
L 5 HOH 21 767 767 HOH HOH B . 
L 5 HOH 22 768 768 HOH HOH B . 
L 5 HOH 23 769 769 HOH HOH B . 
L 5 HOH 24 773 773 HOH HOH B . 
L 5 HOH 25 779 779 HOH HOH B . 
L 5 HOH 26 780 780 HOH HOH B . 
L 5 HOH 27 784 784 HOH HOH B . 
L 5 HOH 28 785 785 HOH HOH B . 
L 5 HOH 29 786 786 HOH HOH B . 
L 5 HOH 30 793 793 HOH HOH B . 
L 5 HOH 31 795 795 HOH HOH B . 
L 5 HOH 32 797 797 HOH HOH B . 
L 5 HOH 33 799 799 HOH HOH B . 
L 5 HOH 34 800 800 HOH HOH B . 
L 5 HOH 35 802 802 HOH HOH B . 
L 5 HOH 36 813 813 HOH HOH B . 
L 5 HOH 37 816 816 HOH HOH B . 
L 5 HOH 38 848 848 HOH HOH B . 
L 5 HOH 39 852 852 HOH HOH B . 
L 5 HOH 40 853 853 HOH HOH B . 
L 5 HOH 41 854 854 HOH HOH B . 
L 5 HOH 42 855 855 HOH HOH B . 
L 5 HOH 43 856 856 HOH HOH B . 
L 5 HOH 44 859 859 HOH HOH B . 
L 5 HOH 45 862 862 HOH HOH B . 
L 5 HOH 46 886 886 HOH HOH B . 
L 5 HOH 47 888 888 HOH HOH B . 
L 5 HOH 48 889 889 HOH HOH B . 
L 5 HOH 49 890 890 HOH HOH B . 
L 5 HOH 50 892 892 HOH HOH B . 
L 5 HOH 51 894 894 HOH HOH B . 
L 5 HOH 52 896 896 HOH HOH B . 
L 5 HOH 53 899 899 HOH HOH B . 
L 5 HOH 54 901 901 HOH HOH B . 
L 5 HOH 55 902 902 HOH HOH B . 
L 5 HOH 56 904 904 HOH HOH B . 
L 5 HOH 57 905 905 HOH HOH B . 
L 5 HOH 58 913 913 HOH HOH B . 
L 5 HOH 59 914 914 HOH HOH B . 
L 5 HOH 60 921 921 HOH HOH B . 
L 5 HOH 61 923 923 HOH HOH B . 