data_1EHZ
# 
_entry.id   1EHZ 
# 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.281 
_audit_conform.dict_location   http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic 
# 
loop_
_database_2.database_id 
_database_2.database_code 
PDB   1EHZ         
NDB   TR0001       
RCSB  RCSB010591   
WWPDB D_1000010591 
# 
loop_
_pdbx_database_related.db_name 
_pdbx_database_related.db_id 
_pdbx_database_related.details 
_pdbx_database_related.content_type 
PDB 4tna 'contains the same tRNA' unspecified 
PDB 1tra 'contains the same tRNA' unspecified 
PDB 4tra 'contains the same tRNA' unspecified 
PDB 6tna 'contains the same tRNA' unspecified 
# 
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.entry_id                        1EHZ 
_pdbx_database_status.recvd_initial_deposition_date   2000-02-23 
_pdbx_database_status.deposit_site                    NDB 
_pdbx_database_status.process_site                    NDB 
_pdbx_database_status.status_code_sf                  REL 
_pdbx_database_status.status_code_mr                  ? 
_pdbx_database_status.SG_entry                        N 
_pdbx_database_status.status_code_cs                  ? 
_pdbx_database_status.methods_development_category    ? 
_pdbx_database_status.pdb_format_compatible           Y 
# 
loop_
_audit_author.name 
_audit_author.pdbx_ordinal 
'Shi, H.'     1 
'Moore, P.B.' 2 
# 
_citation.id                        primary 
_citation.title                     
'The crystal structure of yeast phenylalanine tRNA at 1.93 A resolution: a classic structure revisited' 
_citation.journal_abbrev            RNA 
_citation.journal_volume            6 
_citation.page_first                1091 
_citation.page_last                 1105 
_citation.year                      2000 
_citation.journal_id_ASTM           RNARFU 
_citation.country                   UK 
_citation.journal_id_ISSN           1355-8382 
_citation.journal_id_CSD            2122 
_citation.book_publisher            ? 
_citation.pdbx_database_id_PubMed   10943889 
_citation.pdbx_database_id_DOI      10.1017/S1355838200000364 
# 
loop_
_citation_author.citation_id 
_citation_author.name 
_citation_author.ordinal 
primary 'Shi, H.'     1 
primary 'Moore, P.B.' 2 
# 
_cell.entry_id           1EHZ 
_cell.length_a           54.981 
_cell.length_b           33.389 
_cell.length_c           61.921 
_cell.angle_alpha        90.00 
_cell.angle_beta         90.20 
_cell.angle_gamma        90.00 
_cell.Z_PDB              2 
_cell.pdbx_unique_axis   ? 
_cell.length_a_esd       ? 
_cell.length_b_esd       ? 
_cell.length_c_esd       ? 
_cell.angle_alpha_esd    ? 
_cell.angle_beta_esd     ? 
_cell.angle_gamma_esd    ? 
# 
_symmetry.entry_id                         1EHZ 
_symmetry.space_group_name_H-M             'P 1 21 1' 
_symmetry.pdbx_full_space_group_name_H-M   ? 
_symmetry.cell_setting                     monoclinic 
_symmetry.Int_Tables_number                4 
_symmetry.space_group_name_Hall            ? 
# 
loop_
_entity.id 
_entity.type 
_entity.src_method 
_entity.pdbx_description 
_entity.formula_weight 
_entity.pdbx_number_of_molecules 
_entity.pdbx_ec 
_entity.pdbx_mutation 
_entity.pdbx_fragment 
_entity.details 
1 polymer     nat 'TRANSFER RNA (PHE)' 24890.121 1   ? ? ? ? 
2 non-polymer syn 'MAGNESIUM ION'      24.305    6   ? ? ? ? 
3 non-polymer syn 'MANGANESE (II) ION' 54.938    3   ? ? ? ? 
4 water       nat water                18.015    160 ? ? ? ? 
# 
_entity_poly.entity_id                      1 
_entity_poly.type                           polyribonucleotide 
_entity_poly.nstd_linkage                   no 
_entity_poly.nstd_monomer                   yes 
_entity_poly.pdbx_seq_one_letter_code       
;GCGGAUUUA(2MG)CUCAG(H2U)(H2U)GGGAGAGC(M2G)CCAGA(OMC)U(OMG)AA(YYG)A(PSU)(5MC)UGGA
G(7MG)UC(5MC)UGUG(5MU)(PSU)CG(1MA)UCCACAGAAUUCGCACCA
;
_entity_poly.pdbx_seq_one_letter_code_can   GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA 
_entity_poly.pdbx_strand_id                 A 
_entity_poly.pdbx_target_identifier         ? 
# 
loop_
_entity_poly_seq.entity_id 
_entity_poly_seq.num 
_entity_poly_seq.mon_id 
_entity_poly_seq.hetero 
1 1  G   n 
1 2  C   n 
1 3  G   n 
1 4  G   n 
1 5  A   n 
1 6  U   n 
1 7  U   n 
1 8  U   n 
1 9  A   n 
1 10 2MG n 
1 11 C   n 
1 12 U   n 
1 13 C   n 
1 14 A   n 
1 15 G   n 
1 16 H2U n 
1 17 H2U n 
1 18 G   n 
1 19 G   n 
1 20 G   n 
1 21 A   n 
1 22 G   n 
1 23 A   n 
1 24 G   n 
1 25 C   n 
1 26 M2G n 
1 27 C   n 
1 28 C   n 
1 29 A   n 
1 30 G   n 
1 31 A   n 
1 32 OMC n 
1 33 U   n 
1 34 OMG n 
1 35 A   n 
1 36 A   n 
1 37 YYG n 
1 38 A   n 
1 39 PSU n 
1 40 5MC n 
1 41 U   n 
1 42 G   n 
1 43 G   n 
1 44 A   n 
1 45 G   n 
1 46 7MG n 
1 47 U   n 
1 48 C   n 
1 49 5MC n 
1 50 U   n 
1 51 G   n 
1 52 U   n 
1 53 G   n 
1 54 5MU n 
1 55 PSU n 
1 56 C   n 
1 57 G   n 
1 58 1MA n 
1 59 U   n 
1 60 C   n 
1 61 C   n 
1 62 A   n 
1 63 C   n 
1 64 A   n 
1 65 G   n 
1 66 A   n 
1 67 A   n 
1 68 U   n 
1 69 U   n 
1 70 C   n 
1 71 G   n 
1 72 C   n 
1 73 A   n 
1 74 C   n 
1 75 C   n 
1 76 A   n 
# 
_entity_src_nat.entity_id                  1 
_entity_src_nat.pdbx_src_id                1 
_entity_src_nat.pdbx_alt_source_flag       sample 
_entity_src_nat.pdbx_beg_seq_num           ? 
_entity_src_nat.pdbx_end_seq_num           ? 
_entity_src_nat.common_name                yeast 
_entity_src_nat.pdbx_organism_scientific   'Saccharomyces cerevisiae' 
_entity_src_nat.pdbx_ncbi_taxonomy_id      4932 
_entity_src_nat.genus                      ? 
_entity_src_nat.species                    ? 
_entity_src_nat.strain                     ? 
_entity_src_nat.tissue                     ? 
_entity_src_nat.tissue_fraction            ? 
_entity_src_nat.pdbx_secretion             ? 
_entity_src_nat.pdbx_fragment              ? 
_entity_src_nat.pdbx_variant               ? 
_entity_src_nat.pdbx_cell_line             ? 
_entity_src_nat.pdbx_atcc                  ? 
_entity_src_nat.pdbx_cellular_location     ? 
_entity_src_nat.pdbx_organ                 ? 
_entity_src_nat.pdbx_organelle             ? 
_entity_src_nat.pdbx_cell                  ? 
_entity_src_nat.pdbx_plasmid_name          ? 
_entity_src_nat.pdbx_plasmid_details       ? 
_entity_src_nat.details                    'abundant form, purified from the natural mixture by electrophoresis' 
# 
_struct_ref.id                         1 
_struct_ref.db_name                    GB 
_struct_ref.db_code                    M10263 
_struct_ref.entity_id                  1 
_struct_ref.pdbx_db_accession          M10263 
_struct_ref.pdbx_align_begin           1 
_struct_ref.pdbx_seq_one_letter_code   GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA 
_struct_ref.pdbx_db_isoform            ? 
# 
_struct_ref_seq.align_id                      1 
_struct_ref_seq.ref_id                        1 
_struct_ref_seq.pdbx_PDB_id_code              1EHZ 
_struct_ref_seq.pdbx_strand_id                A 
_struct_ref_seq.seq_align_beg                 1 
_struct_ref_seq.pdbx_seq_align_beg_ins_code   ? 
_struct_ref_seq.seq_align_end                 76 
_struct_ref_seq.pdbx_seq_align_end_ins_code   ? 
_struct_ref_seq.pdbx_db_accession             M10263 
_struct_ref_seq.db_align_beg                  1 
_struct_ref_seq.pdbx_db_align_beg_ins_code    ? 
_struct_ref_seq.db_align_end                  76 
_struct_ref_seq.pdbx_db_align_end_ins_code    ? 
_struct_ref_seq.pdbx_auth_seq_align_beg       1 
_struct_ref_seq.pdbx_auth_seq_align_end       76 
# 
loop_
_struct_ref_seq_dif.align_id 
_struct_ref_seq_dif.pdbx_pdb_id_code 
_struct_ref_seq_dif.mon_id 
_struct_ref_seq_dif.pdbx_pdb_strand_id 
_struct_ref_seq_dif.seq_num 
_struct_ref_seq_dif.pdbx_pdb_ins_code 
_struct_ref_seq_dif.pdbx_seq_db_name 
_struct_ref_seq_dif.pdbx_seq_db_accession_code 
_struct_ref_seq_dif.db_mon_id 
_struct_ref_seq_dif.pdbx_seq_db_seq_num 
_struct_ref_seq_dif.details 
_struct_ref_seq_dif.pdbx_auth_seq_num 
_struct_ref_seq_dif.pdbx_ordinal 
1 1EHZ 2MG A 10 ? GB M10263 G 10 TRNA 10 1  
1 1EHZ H2U A 16 ? GB M10263 U 16 TRNA 16 2  
1 1EHZ H2U A 17 ? GB M10263 U 17 TRNA 17 3  
1 1EHZ M2G A 26 ? GB M10263 G 26 TRNA 26 4  
1 1EHZ OMC A 32 ? GB M10263 C 32 TRNA 32 5  
1 1EHZ OMG A 34 ? GB M10263 G 34 TRNA 34 6  
1 1EHZ YYG A 37 ? GB M10263 G 37 TRNA 37 7  
1 1EHZ PSU A 39 ? GB M10263 U 39 TRNA 39 8  
1 1EHZ 5MC A 40 ? GB M10263 C 40 TRNA 40 9  
1 1EHZ 7MG A 46 ? GB M10263 G 46 TRNA 46 10 
1 1EHZ 5MC A 49 ? GB M10263 C 49 TRNA 49 11 
1 1EHZ 5MU A 54 ? GB M10263 U 54 TRNA 54 12 
1 1EHZ PSU A 55 ? GB M10263 U 55 TRNA 55 13 
1 1EHZ 1MA A 58 ? GB M10263 A 58 TRNA 58 14 
# 
loop_
_chem_comp.id 
_chem_comp.type 
_chem_comp.mon_nstd_flag 
_chem_comp.name 
_chem_comp.pdbx_synonyms 
_chem_comp.formula 
_chem_comp.formula_weight 
1MA 'RNA linking' n "6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE" ?                                 'C11 H16 N5 O7 P'  361.248 
2MG 'RNA linking' n "2N-METHYLGUANOSINE-5'-MONOPHOSPHATE" ?                                 'C11 H16 N5 O8 P'  377.247 
5MC 'RNA linking' n "5-METHYLCYTIDINE-5'-MONOPHOSPHATE" ?                                 'C10 H16 N3 O8 P'  337.223 
5MU 'RNA linking' n 
;5-METHYLURIDINE 5'-MONOPHOSPHATE
;
?                                 'C10 H15 N2 O9 P'  338.208 
7MG 'RNA linking' n "7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE" ?                                 'C11 H18 N5 O8 P'  379.263 
A   'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ?                                 'C10 H14 N5 O7 P'  347.221 
C   'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ?                                 'C9 H14 N3 O8 P'   323.197 
G   'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ?                                 'C10 H14 N5 O8 P'  363.221 
H2U 'RNA linking' n "5,6-DIHYDROURIDINE-5'-MONOPHOSPHATE" ?                                 'C9 H15 N2 O9 P'   326.197 
HOH non-polymer   . WATER ?                                 'H2 O'             18.015  
M2G 'RNA linking' n "N2-DIMETHYLGUANOSINE-5'-MONOPHOSPHATE" ?                                 'C12 H18 N5 O8 P'  391.274 
MG  non-polymer   . 'MAGNESIUM ION' ?                                 'Mg 2'             24.305  
MN  non-polymer   . 'MANGANESE (II) ION' ?                                 'Mn 2'             54.938  
OMC 'RNA linking' n "O2'-METHYLYCYTIDINE-5'-MONOPHOSPHATE" ?                                 'C10 H16 N3 O8 P'  337.223 
OMG 'RNA linking' n "O2'-METHYLGUANOSINE-5'-MONOPHOSPHATE" ?                                 'C11 H16 N5 O8 P'  377.247 
PSU 'RNA linking' n "PSEUDOURIDINE-5'-MONOPHOSPHATE" ?                                 'C9 H13 N2 O9 P'   324.181 
U   'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ?                                 'C9 H13 N2 O9 P'   324.181 
YYG 'RNA linking' n 
'4-(3-[5-O-PHOSPHONORIBOFURANOSYL]-4,6-DIMETHYL-8-OXO-4,8-DIHYDRO-3H-1,3,4,5,7A-PENTAAZA-S-INDACEN-YLAMINO-BUTYRIC ACID METHYL ESTER' 
;MODIFIED GUANOSINE-5'-PHOSPHATE
;
'C21 H29 N6 O12 P' 588.462 
# 
_exptl.entry_id          1EHZ 
_exptl.method            'X-RAY DIFFRACTION' 
_exptl.crystals_number   1 
# 
_exptl_crystal.id                    1 
_exptl_crystal.density_meas          ? 
_exptl_crystal.density_Matthews      2.28 
_exptl_crystal.density_percent_sol   46.13 
_exptl_crystal.description           ? 
_exptl_crystal.F_000                 ? 
_exptl_crystal.preparation           ? 
# 
_exptl_crystal_grow.crystal_id      1 
_exptl_crystal_grow.method          'VAPOR DIFFUSION, HANGING DROP' 
_exptl_crystal_grow.temp            277 
_exptl_crystal_grow.temp_details    ? 
_exptl_crystal_grow.pH              6.5 
_exptl_crystal_grow.pdbx_details    
'isopropanol, MgCl2, spermine, cacodylate, pH 6 to 7, pH 6.5, VAPOR DIFFUSION, HANGING DROP, temperature 277K' 
_exptl_crystal_grow.pdbx_pH_range   . 
# 
loop_
_exptl_crystal_grow_comp.crystal_id 
_exptl_crystal_grow_comp.id 
_exptl_crystal_grow_comp.sol_id 
_exptl_crystal_grow_comp.name 
_exptl_crystal_grow_comp.volume 
_exptl_crystal_grow_comp.conc 
_exptl_crystal_grow_comp.details 
1 1 1 MgCl2       ? ? ? 
1 2 1 spermine    ? ? ? 
1 3 1 cacodylate  ? ? ? 
1 4 1 isopropanol ? ? ? 
1 5 2 isopropanol ? ? ? 
# 
_diffrn.id                     1 
_diffrn.ambient_temp           80 
_diffrn.ambient_temp_details   ? 
_diffrn.crystal_id             1 
# 
_diffrn_detector.diffrn_id              1 
_diffrn_detector.detector               CCD 
_diffrn_detector.type                   ? 
_diffrn_detector.pdbx_collection_date   ? 
_diffrn_detector.details                ? 
# 
_diffrn_radiation.diffrn_id                        1 
_diffrn_radiation.wavelength_id                    1 
_diffrn_radiation.pdbx_monochromatic_or_laue_m_l   M 
_diffrn_radiation.monochromator                    ? 
_diffrn_radiation.pdbx_diffrn_protocol             'SINGLE WAVELENGTH' 
_diffrn_radiation.pdbx_scattering_type             x-ray 
# 
_diffrn_radiation_wavelength.id           1 
_diffrn_radiation_wavelength.wavelength   0.913 
_diffrn_radiation_wavelength.wt           1.0 
# 
_diffrn_source.diffrn_id                   1 
_diffrn_source.source                      SYNCHROTRON 
_diffrn_source.type                        'CHESS BEAMLINE A1' 
_diffrn_source.pdbx_synchrotron_site       CHESS 
_diffrn_source.pdbx_synchrotron_beamline   A1 
_diffrn_source.pdbx_wavelength             0.913 
_diffrn_source.pdbx_wavelength_list        ? 
# 
_reflns.entry_id                     1EHZ 
_reflns.observed_criterion_sigma_I   ? 
_reflns.observed_criterion_sigma_F   ? 
_reflns.d_resolution_low             40 
_reflns.d_resolution_high            1.80 
_reflns.number_obs                   19877 
_reflns.number_all                   20604 
_reflns.percent_possible_obs         96.5 
_reflns.pdbx_Rmerge_I_obs            0.057 
_reflns.pdbx_Rsym_value              ? 
_reflns.pdbx_netI_over_sigmaI        22.4 
_reflns.B_iso_Wilson_estimate        47.9 
_reflns.pdbx_redundancy              14.0 
_reflns.R_free_details               ? 
_reflns.pdbx_chi_squared             ? 
_reflns.pdbx_scaling_rejects         ? 
_reflns.pdbx_ordinal                 1 
_reflns.pdbx_diffrn_id               1 
# 
_refine.entry_id                                 1EHZ 
_refine.ls_number_reflns_obs                     15371 
_refine.ls_number_reflns_all                     15371 
_refine.pdbx_ls_sigma_I                          ? 
_refine.pdbx_ls_sigma_F                          0 
_refine.pdbx_data_cutoff_high_absF               ? 
_refine.pdbx_data_cutoff_low_absF                ? 
_refine.ls_d_res_low                             40 
_refine.ls_d_res_high                            1.93 
_refine.ls_percent_reflns_obs                    88.9 
_refine.ls_R_factor_obs                          ? 
_refine.ls_R_factor_all                          ? 
_refine.ls_R_factor_R_work                       0.2334 
_refine.ls_R_factor_R_free                       0.253 
_refine.ls_R_factor_R_free_error                 ? 
_refine.ls_R_factor_R_free_error_details         ? 
_refine.ls_percent_reflns_R_free                 10. 
_refine.ls_number_reflns_R_free                  1525 
_refine.ls_number_parameters                     ? 
_refine.ls_number_restraints                     ? 
_refine.occupancy_min                            ? 
_refine.occupancy_max                            ? 
_refine.B_iso_mean                               ? 
_refine.aniso_B[1][1]                            -0.186 
_refine.aniso_B[2][2]                            -2.157 
_refine.aniso_B[3][3]                            2.343 
_refine.aniso_B[1][2]                            0.000 
_refine.aniso_B[1][3]                            -1.147 
_refine.aniso_B[2][3]                            0.000 
_refine.solvent_model_details                    ? 
_refine.solvent_model_param_ksol                 ? 
_refine.solvent_model_param_bsol                 ? 
_refine.pdbx_ls_cross_valid_method               THROUGHOUT 
_refine.details                                  ? 
_refine.pdbx_starting_model                      ? 
_refine.pdbx_method_to_determine_struct          ? 
_refine.pdbx_isotropic_thermal_model             ? 
_refine.pdbx_stereochemistry_target_values       'Parkinson et al.' 
_refine.pdbx_stereochem_target_val_spec_case     ? 
_refine.pdbx_R_Free_selection_details            RANDOM 
_refine.pdbx_overall_ESU_R_Free                  ? 
_refine.overall_SU_B                             ? 
_refine.ls_redundancy_reflns_obs                 ? 
_refine.overall_SU_ML                            ? 
_refine.pdbx_overall_ESU_R                       ? 
_refine.pdbx_data_cutoff_high_rms_absF           ? 
_refine.correlation_coeff_Fo_to_Fc               ? 
_refine.correlation_coeff_Fo_to_Fc_free          ? 
_refine.pdbx_solvent_vdw_probe_radii             ? 
_refine.pdbx_solvent_ion_probe_radii             ? 
_refine.pdbx_solvent_shrinkage_radii             ? 
_refine.overall_SU_R_Cruickshank_DPI             ? 
_refine.overall_SU_R_free                        ? 
_refine.ls_wR_factor_R_free                      ? 
_refine.ls_wR_factor_R_work                      ? 
_refine.overall_FOM_free_R_set                   ? 
_refine.overall_FOM_work_R_set                   ? 
_refine.pdbx_refine_id                           'X-RAY DIFFRACTION' 
_refine.pdbx_diffrn_id                           1 
_refine.pdbx_overall_phase_error                 ? 
_refine.pdbx_TLS_residual_ADP_flag               ? 
_refine.pdbx_overall_SU_R_free_Cruickshank_DPI   ? 
_refine.pdbx_overall_SU_R_Blow_DPI               ? 
_refine.pdbx_overall_SU_R_free_Blow_DPI          ? 
# 
_refine_hist.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_refine_hist.cycle_id                         LAST 
_refine_hist.pdbx_number_atoms_protein        0 
_refine_hist.pdbx_number_atoms_nucleic_acid   1652 
_refine_hist.pdbx_number_atoms_ligand         9 
_refine_hist.number_atoms_solvent             160 
_refine_hist.number_atoms_total               1821 
_refine_hist.d_res_high                       1.93 
_refine_hist.d_res_low                        40 
# 
loop_
_refine_ls_restr.type 
_refine_ls_restr.dev_ideal 
_refine_ls_restr.dev_ideal_target 
_refine_ls_restr.weight 
_refine_ls_restr.number 
_refine_ls_restr.pdbx_refine_id 
_refine_ls_restr.pdbx_restraint_function 
c_bond_d    0.0124 ? ? ? 'X-RAY DIFFRACTION' ? 
c_angle_deg 1.605  ? ? ? 'X-RAY DIFFRACTION' ? 
# 
_struct.entry_id                  1EHZ 
_struct.title                     'The crystal structure of yeast phenylalanine tRNA at 1.93 A resolution' 
_struct.pdbx_descriptor           'TRANSFER RNA (PHE)' 
_struct.pdbx_model_details        ? 
_struct.pdbx_CASP_flag            ? 
_struct.pdbx_model_type_details   ? 
# 
_struct_keywords.entry_id        1EHZ 
_struct_keywords.pdbx_keywords   RNA 
_struct_keywords.text            'tRNA, yeast, phenylalanine, RNA' 
# 
loop_
_struct_asym.id 
_struct_asym.pdbx_blank_PDB_chainid_flag 
_struct_asym.pdbx_modified 
_struct_asym.entity_id 
_struct_asym.details 
A N N 1 ? 
B N N 2 ? 
C N N 3 ? 
D N N 2 ? 
E N N 3 ? 
F N N 2 ? 
G N N 2 ? 
H N N 2 ? 
I N N 2 ? 
J N N 3 ? 
K N N 4 ? 
# 
_struct_biol.id                    1 
_struct_biol.details               'The biological assembly is a monomer.' 
_struct_biol.pdbx_parent_biol_id   ? 
# 
loop_
_struct_conn.id 
_struct_conn.conn_type_id 
_struct_conn.pdbx_leaving_atom_flag 
_struct_conn.pdbx_PDB_id 
_struct_conn.ptnr1_label_asym_id 
_struct_conn.ptnr1_label_comp_id 
_struct_conn.ptnr1_label_seq_id 
_struct_conn.ptnr1_label_atom_id 
_struct_conn.pdbx_ptnr1_label_alt_id 
_struct_conn.pdbx_ptnr1_PDB_ins_code 
_struct_conn.pdbx_ptnr1_standard_comp_id 
_struct_conn.ptnr1_symmetry 
_struct_conn.ptnr2_label_asym_id 
_struct_conn.ptnr2_label_comp_id 
_struct_conn.ptnr2_label_seq_id 
_struct_conn.ptnr2_label_atom_id 
_struct_conn.pdbx_ptnr2_label_alt_id 
_struct_conn.pdbx_ptnr2_PDB_ins_code 
_struct_conn.ptnr1_auth_asym_id 
_struct_conn.ptnr1_auth_comp_id 
_struct_conn.ptnr1_auth_seq_id 
_struct_conn.ptnr2_auth_asym_id 
_struct_conn.ptnr2_auth_comp_id 
_struct_conn.ptnr2_auth_seq_id 
_struct_conn.ptnr2_symmetry 
_struct_conn.pdbx_ptnr3_label_atom_id 
_struct_conn.pdbx_ptnr3_label_seq_id 
_struct_conn.pdbx_ptnr3_label_comp_id 
_struct_conn.pdbx_ptnr3_label_asym_id 
_struct_conn.pdbx_ptnr3_label_alt_id 
_struct_conn.pdbx_ptnr3_PDB_ins_code 
_struct_conn.details 
_struct_conn.pdbx_dist_value 
_struct_conn.pdbx_value_order 
covale1  covale ? ? A A   9  "O3'" ? ? ? 1_555 A 2MG 10 P     ? ? A A   9   A 2MG 10  1_555 ? ? ? ? ? ? ?                       
1.643 ? 
covale2  covale ? ? A 2MG 10 "O3'" ? ? ? 1_555 A C   11 P     ? ? A 2MG 10  A C   11  1_555 ? ? ? ? ? ? ?                       
1.596 ? 
covale3  covale ? ? A G   15 "O3'" ? ? ? 1_555 A H2U 16 P     ? ? A G   15  A H2U 16  1_555 ? ? ? ? ? ? ?                       
1.598 ? 
covale4  covale ? ? A H2U 16 "O3'" ? ? ? 1_555 A H2U 17 P     ? ? A H2U 16  A H2U 17  1_555 ? ? ? ? ? ? ?                       
1.630 ? 
covale5  covale ? ? A H2U 17 "O3'" ? ? ? 1_555 A G   18 P     ? ? A H2U 17  A G   18  1_555 ? ? ? ? ? ? ?                       
1.601 ? 
covale6  covale ? ? A C   25 "O3'" ? ? ? 1_555 A M2G 26 P     ? ? A C   25  A M2G 26  1_555 ? ? ? ? ? ? ?                       
1.602 ? 
covale7  covale ? ? A M2G 26 "O3'" ? ? ? 1_555 A C   27 P     ? ? A M2G 26  A C   27  1_555 ? ? ? ? ? ? ?                       
1.593 ? 
covale8  covale ? ? A A   31 "O3'" ? ? ? 1_555 A OMC 32 P     ? ? A A   31  A OMC 32  1_555 ? ? ? ? ? ? ?                       
1.616 ? 
covale9  covale ? ? A OMC 32 "O3'" ? ? ? 1_555 A U   33 P     ? ? A OMC 32  A U   33  1_555 ? ? ? ? ? ? ?                       
1.618 ? 
covale10 covale ? ? A U   33 "O3'" ? ? ? 1_555 A OMG 34 P     ? ? A U   33  A OMG 34  1_555 ? ? ? ? ? ? ?                       
1.612 ? 
covale11 covale ? ? A OMG 34 "O3'" ? ? ? 1_555 A A   35 P     ? ? A OMG 34  A A   35  1_555 ? ? ? ? ? ? ?                       
1.620 ? 
covale12 covale ? ? A A   36 "O3'" ? ? ? 1_555 A YYG 37 P     ? ? A A   36  A YYG 37  1_555 ? ? ? ? ? ? ?                       
1.618 ? 
covale13 covale ? ? A YYG 37 "O3'" ? ? ? 1_555 A A   38 P     ? ? A YYG 37  A A   38  1_555 ? ? ? ? ? ? ?                       
1.608 ? 
covale14 covale ? ? A A   38 "O3'" ? ? ? 1_555 A PSU 39 P     ? ? A A   38  A PSU 39  1_555 ? ? ? ? ? ? ?                       
1.604 ? 
covale15 covale ? ? A PSU 39 "O3'" ? ? ? 1_555 A 5MC 40 P     ? ? A PSU 39  A 5MC 40  1_555 ? ? ? ? ? ? ?                       
1.602 ? 
covale16 covale ? ? A 5MC 40 "O3'" ? ? ? 1_555 A U   41 P     ? ? A 5MC 40  A U   41  1_555 ? ? ? ? ? ? ?                       
1.611 ? 
covale17 covale ? ? A G   45 "O3'" ? ? ? 1_555 A 7MG 46 P     ? ? A G   45  A 7MG 46  1_555 ? ? ? ? ? ? ?                       
1.610 ? 
covale18 covale ? ? A 7MG 46 "O3'" ? ? ? 1_555 A U   47 P     ? ? A 7MG 46  A U   47  1_555 ? ? ? ? ? ? ?                       
1.635 ? 
covale19 covale ? ? A C   48 "O3'" ? ? ? 1_555 A 5MC 49 P     ? ? A C   48  A 5MC 49  1_555 ? ? ? ? ? ? ?                       
1.578 ? 
covale20 covale ? ? A 5MC 49 "O3'" ? ? ? 1_555 A U   50 P     ? ? A 5MC 49  A U   50  1_555 ? ? ? ? ? ? ?                       
1.638 ? 
covale21 covale ? ? A G   53 "O3'" ? ? ? 1_555 A 5MU 54 P     ? ? A G   53  A 5MU 54  1_555 ? ? ? ? ? ? ?                       
1.624 ? 
covale22 covale ? ? A 5MU 54 "O3'" ? ? ? 1_555 A PSU 55 P     ? ? A 5MU 54  A PSU 55  1_555 ? ? ? ? ? ? ?                       
1.615 ? 
covale23 covale ? ? A PSU 55 "O3'" ? ? ? 1_555 A C   56 P     ? ? A PSU 55  A C   56  1_555 ? ? ? ? ? ? ?                       
1.598 ? 
covale24 covale ? ? A G   57 "O3'" ? ? ? 1_555 A 1MA 58 P     ? ? A G   57  A 1MA 58  1_555 ? ? ? ? ? ? ?                       
1.584 ? 
covale25 covale ? ? A 1MA 58 "O3'" ? ? ? 1_555 A U   59 P     ? ? A 1MA 58  A U   59  1_555 ? ? ? ? ? ? ?                       
1.646 ? 
metalc1  metalc ? ? D MG  .  MG    ? ? ? 1_555 K HOH .  O     ? ? A MG  510 A HOH 714 1_555 ? ? ? ? ? ? ?                       
2.003 ? 
metalc2  metalc ? ? D MG  .  MG    ? ? ? 1_555 K HOH .  O     ? ? A MG  510 A HOH 716 1_555 ? ? ? ? ? ? ?                       
2.005 ? 
metalc3  metalc ? ? D MG  .  MG    ? ? ? 1_555 K HOH .  O     ? ? A MG  510 A HOH 715 1_555 ? ? ? ? ? ? ?                       
2.004 ? 
metalc4  metalc ? ? D MG  .  MG    ? ? ? 1_555 K HOH .  O     ? ? A MG  510 A HOH 712 1_555 ? ? ? ? ? ? ?                       
2.001 ? 
metalc5  metalc ? ? D MG  .  MG    ? ? ? 1_555 K HOH .  O     ? ? A MG  510 A HOH 713 1_555 ? ? ? ? ? ? ?                       
1.999 ? 
metalc6  metalc ? ? E MN  .  MN    ? ? ? 1_555 K HOH .  O     ? ? A MN  520 A HOH 717 1_555 ? ? ? ? ? ? ?                       
2.000 ? 
metalc7  metalc ? ? E MN  .  MN    ? ? ? 1_555 K HOH .  O     ? ? A MN  520 A HOH 718 1_555 ? ? ? ? ? ? ?                       
2.000 ? 
metalc8  metalc ? ? E MN  .  MN    ? ? ? 1_555 K HOH .  O     ? ? A MN  520 A HOH 719 1_555 ? ? ? ? ? ? ?                       
1.999 ? 
metalc9  metalc ? ? E MN  .  MN    ? ? ? 1_555 K HOH .  O     ? ? A MN  520 A HOH 720 1_555 ? ? ? ? ? ? ?                       
2.001 ? 
metalc10 metalc ? ? E MN  .  MN    ? ? ? 1_555 K HOH .  O     ? ? A MN  520 A HOH 721 1_555 ? ? ? ? ? ? ?                       
2.000 ? 
metalc11 metalc ? ? C MN  .  MN    ? ? ? 1_555 K HOH .  O     ? ? A MN  530 A HOH 708 1_555 ? ? ? ? ? ? ?                       
2.001 ? 
metalc12 metalc ? ? C MN  .  MN    ? ? ? 1_555 K HOH .  O     ? ? A MN  530 A HOH 709 1_555 ? ? ? ? ? ? ?                       
2.005 ? 
metalc13 metalc ? ? C MN  .  MN    ? ? ? 1_555 K HOH .  O     ? ? A MN  530 A HOH 710 1_555 ? ? ? ? ? ? ?                       
1.997 ? 
metalc14 metalc ? ? C MN  .  MN    ? ? ? 1_555 K HOH .  O     ? ? A MN  530 A HOH 711 1_555 ? ? ? ? ? ? ?                       
2.008 ? 
metalc15 metalc ? ? F MG  .  MG    ? ? ? 1_555 K HOH .  O     ? ? A MG  540 A HOH 723 1_555 ? ? ? ? ? ? ?                       
2.000 ? 
metalc16 metalc ? ? F MG  .  MG    ? ? ? 1_555 K HOH .  O     ? ? A MG  540 A HOH 722 1_555 ? ? ? ? ? ? ?                       
2.002 ? 
metalc17 metalc ? ? F MG  .  MG    ? ? ? 1_555 K HOH .  O     ? ? A MG  540 A HOH 724 1_555 ? ? ? ? ? ? ?                       
2.002 ? 
metalc18 metalc ? ? J MN  .  MN    ? ? ? 1_555 K HOH .  O     ? ? A MN  550 A HOH 738 1_555 ? ? ? ? ? ? ?                       
2.002 ? 
metalc19 metalc ? ? J MN  .  MN    ? ? ? 1_555 K HOH .  O     ? ? A MN  550 A HOH 739 1_555 ? ? ? ? ? ? ?                       
2.001 ? 
metalc20 metalc ? ? J MN  .  MN    ? ? ? 1_555 K HOH .  O     ? ? A MN  550 A HOH 740 1_555 ? ? ? ? ? ? ?                       
1.996 ? 
metalc21 metalc ? ? J MN  .  MN    ? ? ? 1_555 K HOH .  O     ? ? A MN  550 A HOH 741 1_555 ? ? ? ? ? ? ?                       
2.006 ? 
metalc22 metalc ? ? J MN  .  MN    ? ? ? 1_555 K HOH .  O     ? ? A MN  550 A HOH 742 1_555 ? ? ? ? ? ? ?                       
1.998 ? 
metalc23 metalc ? ? G MG  .  MG    ? ? ? 1_555 K HOH .  O     ? ? A MG  560 A HOH 728 1_555 ? ? ? ? ? ? ?                       
1.999 ? 
metalc24 metalc ? ? G MG  .  MG    ? ? ? 1_555 K HOH .  O     ? ? A MG  560 A HOH 725 1_555 ? ? ? ? ? ? ?                       
2.004 ? 
metalc25 metalc ? ? G MG  .  MG    ? ? ? 1_555 K HOH .  O     ? ? A MG  560 A HOH 730 1_555 ? ? ? ? ? ? ?                       
1.999 ? 
metalc26 metalc ? ? G MG  .  MG    ? ? ? 1_555 K HOH .  O     ? ? A MG  560 A HOH 727 1_555 ? ? ? ? ? ? ?                       
2.003 ? 
metalc27 metalc ? ? G MG  .  MG    ? ? ? 1_555 K HOH .  O     ? ? A MG  560 A HOH 729 1_555 ? ? ? ? ? ? ?                       
2.005 ? 
metalc28 metalc ? ? G MG  .  MG    ? ? ? 1_555 K HOH .  O     ? ? A MG  560 A HOH 726 1_555 ? ? ? ? ? ? ?                       
2.004 ? 
metalc29 metalc ? ? H MG  .  MG    ? ? ? 1_555 K HOH .  O     ? ? A MG  570 A HOH 731 1_555 ? ? ? ? ? ? ?                       
2.001 ? 
metalc30 metalc ? ? H MG  .  MG    ? ? ? 1_555 K HOH .  O     ? ? A MG  570 A HOH 733 1_555 ? ? ? ? ? ? ?                       
2.002 ? 
metalc31 metalc ? ? H MG  .  MG    ? ? ? 1_555 K HOH .  O     ? ? A MG  570 A HOH 734 1_555 ? ? ? ? ? ? ?                       
2.001 ? 
metalc32 metalc ? ? H MG  .  MG    ? ? ? 1_555 K HOH .  O     ? ? A MG  570 A HOH 736 1_555 ? ? ? ? ? ? ?                       
2.001 ? 
metalc33 metalc ? ? H MG  .  MG    ? ? ? 1_555 K HOH .  O     ? ? A MG  570 A HOH 735 1_555 ? ? ? ? ? ? ?                       
1.996 ? 
metalc34 metalc ? ? H MG  .  MG    ? ? ? 1_555 K HOH .  O     ? ? A MG  570 A HOH 732 1_555 ? ? ? ? ? ? ?                       
2.009 ? 
metalc35 metalc ? ? I MG  .  MG    ? ? ? 1_555 K HOH .  O     ? ? A MG  580 A HOH 737 1_555 ? ? ? ? ? ? ?                       
2.003 ? 
metalc36 metalc ? ? E MN  .  MN    ? ? ? 1_555 A G   1  N7    ? ? A MN  520 A G   1   1_555 ? ? ? ? ? ? ?                       
2.302 ? 
metalc37 metalc ? ? C MN  .  MN    ? ? ? 1_555 A H2U 16 "O2'" ? ? A MN  530 A H2U 16  1_555 ? ? ? ? ? ? ?                       
2.338 ? 
metalc38 metalc ? ? C MN  .  MN    ? ? ? 1_555 A G   19 OP1   ? ? A MN  530 A G   19  1_555 ? ? ? ? ? ? ?                       
2.187 ? 
metalc39 metalc ? ? F MG  .  MG    ? ? ? 1_555 A G   20 OP1   ? ? A MG  540 A G   20  1_555 ? ? ? ? ? ? ?                       
2.072 ? 
metalc40 metalc ? ? F MG  .  MG    ? ? ? 1_555 A A   21 OP2   ? ? A MG  540 A A   21  1_555 ? ? ? ? ? ? ?                       
2.109 ? 
metalc41 metalc ? ? J MN  .  MN    ? ? ? 1_555 A G   15 N7    ? ? A MN  550 A G   15  1_555 ? ? ? ? ? ? ?                       
2.477 ? 
metalc42 metalc ? ? I MG  .  MG    ? ? ? 1_555 A U   7  OP1   ? ? A MG  580 A U   7   1_555 ? ? ? ? ? ? ?                       
2.605 ? 
metalc43 metalc ? ? I MG  .  MG    ? ? ? 1_555 K HOH .  O     ? ? A MG  580 A HOH 611 1_555 ? ? ? ? ? ? ?                       
2.775 ? 
metalc44 metalc ? ? I MG  .  MG    ? ? ? 1_555 A A   14 OP2   ? ? A MG  580 A A   14  1_555 ? ? ? ? ? ? ?                       
1.929 ? 
metalc45 metalc ? ? B MG  .  MG    ? ? ? 1_555 A A   38 N7    ? ? A MG  590 A A   38  1_555 ? ? ? ? ? ? ?                       
3.093 ? 
metalc46 metalc ? ? B MG  .  MG    ? ? ? 1_555 A A   38 N6    ? ? A MG  590 A A   38  1_555 ? ? ? ? ? ? ?                       
3.000 ? 
metalc47 metalc ? ? B MG  .  MG    ? ? ? 1_555 A YYG 37 OP2   ? ? A MG  590 A YYG 37  1_555 ? ? ? ? ? ? ?                       
2.531 ? 
hydrog1  hydrog ? ? A G   1  N1    ? ? ? 1_555 A C   72 N3    ? ? A G   1   A C   72  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog2  hydrog ? ? A G   1  N2    ? ? ? 1_555 A C   72 O2    ? ? A G   1   A C   72  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog3  hydrog ? ? A G   1  O6    ? ? ? 1_555 A C   72 N4    ? ? A G   1   A C   72  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog4  hydrog ? ? A C   2  N3    ? ? ? 1_555 A G   71 N1    ? ? A C   2   A G   71  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog5  hydrog ? ? A C   2  N4    ? ? ? 1_555 A G   71 O6    ? ? A C   2   A G   71  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog6  hydrog ? ? A C   2  O2    ? ? ? 1_555 A G   71 N2    ? ? A C   2   A G   71  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog7  hydrog ? ? A G   3  N1    ? ? ? 1_555 A C   70 N3    ? ? A G   3   A C   70  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog8  hydrog ? ? A G   3  N2    ? ? ? 1_555 A C   70 O2    ? ? A G   3   A C   70  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog9  hydrog ? ? A G   3  O6    ? ? ? 1_555 A C   70 N4    ? ? A G   3   A C   70  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog10 hydrog ? ? A G   4  N1    ? ? ? 1_555 A U   69 O2    ? ? A G   4   A U   69  1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? 
? 
hydrog11 hydrog ? ? A G   4  O6    ? ? ? 1_555 A U   69 N3    ? ? A G   4   A U   69  1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? 
? 
hydrog12 hydrog ? ? A A   5  N1    ? ? ? 1_555 A U   68 N3    ? ? A A   5   A U   68  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog13 hydrog ? ? A A   5  N6    ? ? ? 1_555 A U   68 O4    ? ? A A   5   A U   68  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog14 hydrog ? ? A U   6  N3    ? ? ? 1_555 A A   67 N1    ? ? A U   6   A A   67  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog15 hydrog ? ? A U   6  O4    ? ? ? 1_555 A A   67 N6    ? ? A U   6   A A   67  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog16 hydrog ? ? A U   7  N3    ? ? ? 1_555 A A   66 N1    ? ? A U   7   A A   66  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog17 hydrog ? ? A U   7  O4    ? ? ? 1_555 A A   66 N6    ? ? A U   7   A A   66  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog18 hydrog ? ? A U   8  N3    ? ? ? 1_555 A A   14 N7    ? ? A U   8   A A   14  1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN'    ? 
? 
hydrog19 hydrog ? ? A U   8  O2    ? ? ? 1_555 A A   14 N6    ? ? A U   8   A A   14  1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN'    ? 
? 
hydrog20 hydrog ? ? A A   9  N6    ? ? ? 1_555 A A   23 N7    ? ? A A   9   A A   23  1_555 ? ? ? ? ? ? TYPE_2_PAIR             ? 
? 
hydrog21 hydrog ? ? A A   9  N7    ? ? ? 1_555 A A   23 N6    ? ? A A   9   A A   23  1_555 ? ? ? ? ? ? TYPE_2_PAIR             ? 
? 
hydrog22 hydrog ? ? A 2MG 10 N1    ? ? ? 1_555 A C   25 N3    ? ? A 2MG 10  A C   25  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog23 hydrog ? ? A 2MG 10 N2    ? ? ? 1_555 A C   25 O2    ? ? A 2MG 10  A C   25  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog24 hydrog ? ? A 2MG 10 O6    ? ? ? 1_555 A C   25 N4    ? ? A 2MG 10  A C   25  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog25 hydrog ? ? A 2MG 10 O6    ? ? ? 1_555 A G   45 N2    ? ? A 2MG 10  A G   45  1_555 ? ? ? ? ? ? '2MG-G MISPAIR'         ? 
? 
hydrog26 hydrog ? ? A C   11 N3    ? ? ? 1_555 A G   24 N1    ? ? A C   11  A G   24  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog27 hydrog ? ? A C   11 N4    ? ? ? 1_555 A G   24 O6    ? ? A C   11  A G   24  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog28 hydrog ? ? A C   11 O2    ? ? ? 1_555 A G   24 N2    ? ? A C   11  A G   24  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog29 hydrog ? ? A U   12 N3    ? ? ? 1_555 A A   23 N1    ? ? A U   12  A A   23  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog30 hydrog ? ? A U   12 O4    ? ? ? 1_555 A A   23 N6    ? ? A U   12  A A   23  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog31 hydrog ? ? A C   13 N3    ? ? ? 1_555 A G   22 N1    ? ? A C   13  A G   22  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog32 hydrog ? ? A C   13 N4    ? ? ? 1_555 A G   22 O6    ? ? A C   13  A G   22  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog33 hydrog ? ? A C   13 O2    ? ? ? 1_555 A G   22 N2    ? ? A C   13  A G   22  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog34 hydrog ? ? A G   15 N1    ? ? ? 1_555 A C   48 O2    ? ? A G   15  A C   48  1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? 
? 
hydrog35 hydrog ? ? A G   15 N2    ? ? ? 1_555 A C   48 N3    ? ? A G   15  A C   48  1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? 
? 
hydrog36 hydrog ? ? A G   18 N1    ? ? ? 1_555 A PSU 55 O4    ? ? A G   18  A PSU 55  1_555 ? ? ? ? ? ? 'G-PSU MISPAIR'         ? 
? 
hydrog37 hydrog ? ? A G   19 N1    ? ? ? 1_555 A C   56 N3    ? ? A G   19  A C   56  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog38 hydrog ? ? A G   19 N2    ? ? ? 1_555 A C   56 O2    ? ? A G   19  A C   56  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog39 hydrog ? ? A G   19 O6    ? ? ? 1_555 A C   56 N4    ? ? A G   19  A C   56  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog40 hydrog ? ? A G   22 N7    ? ? ? 1_555 A 7MG 46 N1    ? ? A G   22  A 7MG 46  1_555 ? ? ? ? ? ? TYPE_7_PAIR             ? 
? 
hydrog41 hydrog ? ? A G   22 O6    ? ? ? 1_555 A 7MG 46 N2    ? ? A G   22  A 7MG 46  1_555 ? ? ? ? ? ? TYPE_7_PAIR             ? 
? 
hydrog42 hydrog ? ? A M2G 26 N1    ? ? ? 1_555 A A   44 N1    ? ? A M2G 26  A A   44  1_555 ? ? ? ? ? ? TYPE_8_PAIR             ? 
? 
hydrog43 hydrog ? ? A M2G 26 O6    ? ? ? 1_555 A A   44 N6    ? ? A M2G 26  A A   44  1_555 ? ? ? ? ? ? TYPE_8_PAIR             ? 
? 
hydrog44 hydrog ? ? A C   27 N3    ? ? ? 1_555 A G   43 N1    ? ? A C   27  A G   43  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog45 hydrog ? ? A C   27 N4    ? ? ? 1_555 A G   43 O6    ? ? A C   27  A G   43  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog46 hydrog ? ? A C   27 O2    ? ? ? 1_555 A G   43 N2    ? ? A C   27  A G   43  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog47 hydrog ? ? A C   28 N3    ? ? ? 1_555 A G   42 N1    ? ? A C   28  A G   42  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog48 hydrog ? ? A C   28 N4    ? ? ? 1_555 A G   42 O6    ? ? A C   28  A G   42  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog49 hydrog ? ? A C   28 O2    ? ? ? 1_555 A G   42 N2    ? ? A C   28  A G   42  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog50 hydrog ? ? A A   29 N1    ? ? ? 1_555 A U   41 N3    ? ? A A   29  A U   41  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog51 hydrog ? ? A A   29 N6    ? ? ? 1_555 A U   41 O4    ? ? A A   29  A U   41  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog52 hydrog ? ? A G   30 N1    ? ? ? 1_555 A 5MC 40 N3    ? ? A G   30  A 5MC 40  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog53 hydrog ? ? A G   30 N2    ? ? ? 1_555 A 5MC 40 O2    ? ? A G   30  A 5MC 40  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog54 hydrog ? ? A G   30 O6    ? ? ? 1_555 A 5MC 40 N4    ? ? A G   30  A 5MC 40  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog55 hydrog ? ? A OMC 32 O2    ? ? ? 1_555 A A   38 N6    ? ? A OMC 32  A A   38  1_555 ? ? ? ? ? ? 'OMC-A MISPAIR'         ? 
? 
hydrog56 hydrog ? ? A 5MC 49 N3    ? ? ? 1_555 A G   65 N1    ? ? A 5MC 49  A G   65  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog57 hydrog ? ? A 5MC 49 N4    ? ? ? 1_555 A G   65 O6    ? ? A 5MC 49  A G   65  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog58 hydrog ? ? A 5MC 49 O2    ? ? ? 1_555 A G   65 N2    ? ? A 5MC 49  A G   65  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog59 hydrog ? ? A U   50 N3    ? ? ? 1_555 A A   64 N1    ? ? A U   50  A A   64  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog60 hydrog ? ? A U   50 O4    ? ? ? 1_555 A A   64 N6    ? ? A U   50  A A   64  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog61 hydrog ? ? A G   51 N1    ? ? ? 1_555 A C   63 N3    ? ? A G   51  A C   63  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog62 hydrog ? ? A G   51 N2    ? ? ? 1_555 A C   63 O2    ? ? A G   51  A C   63  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog63 hydrog ? ? A G   51 O6    ? ? ? 1_555 A C   63 N4    ? ? A G   51  A C   63  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog64 hydrog ? ? A U   52 N3    ? ? ? 1_555 A A   62 N1    ? ? A U   52  A A   62  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog65 hydrog ? ? A U   52 O4    ? ? ? 1_555 A A   62 N6    ? ? A U   52  A A   62  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog66 hydrog ? ? A G   53 N1    ? ? ? 1_555 A C   61 N3    ? ? A G   53  A C   61  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog67 hydrog ? ? A G   53 N2    ? ? ? 1_555 A C   61 O2    ? ? A G   53  A C   61  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog68 hydrog ? ? A G   53 O6    ? ? ? 1_555 A C   61 N4    ? ? A G   53  A C   61  1_555 ? ? ? ? ? ? WATSON-CRICK            ? 
? 
hydrog69 hydrog ? ? A 5MU 54 N3    ? ? ? 1_555 A 1MA 58 N7    ? ? A 5MU 54  A 1MA 58  1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN'    ? 
? 
hydrog70 hydrog ? ? A 5MU 54 O2    ? ? ? 1_555 A 1MA 58 N6    ? ? A 5MU 54  A 1MA 58  1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN'    ? 
? 
# 
loop_
_struct_conn_type.id 
_struct_conn_type.criteria 
_struct_conn_type.reference 
covale ? ? 
metalc ? ? 
hydrog ? ? 
# 
loop_
_struct_site.id 
_struct_site.pdbx_evidence_code 
_struct_site.pdbx_auth_asym_id 
_struct_site.pdbx_auth_comp_id 
_struct_site.pdbx_auth_seq_id 
_struct_site.pdbx_auth_ins_code 
_struct_site.pdbx_num_residues 
_struct_site.details 
AC1 Software ? ? ? ? 2 'BINDING SITE FOR RESIDUE MG A 590' 
AC2 Software ? ? ? ? 6 'BINDING SITE FOR RESIDUE MN A 530' 
AC3 Software ? ? ? ? 5 'BINDING SITE FOR RESIDUE MG A 510' 
AC4 Software ? ? ? ? 6 'BINDING SITE FOR RESIDUE MN A 520' 
AC5 Software ? ? ? ? 5 'BINDING SITE FOR RESIDUE MG A 540' 
AC6 Software ? ? ? ? 8 'BINDING SITE FOR RESIDUE MG A 560' 
AC7 Software ? ? ? ? 6 'BINDING SITE FOR RESIDUE MG A 570' 
AC8 Software ? ? ? ? 4 'BINDING SITE FOR RESIDUE MG A 580' 
AC9 Software ? ? ? ? 6 'BINDING SITE FOR RESIDUE MN A 550' 
# 
loop_
_struct_site_gen.id 
_struct_site_gen.site_id 
_struct_site_gen.pdbx_num_res 
_struct_site_gen.label_comp_id 
_struct_site_gen.label_asym_id 
_struct_site_gen.label_seq_id 
_struct_site_gen.pdbx_auth_ins_code 
_struct_site_gen.auth_comp_id 
_struct_site_gen.auth_asym_id 
_struct_site_gen.auth_seq_id 
_struct_site_gen.label_atom_id 
_struct_site_gen.label_alt_id 
_struct_site_gen.symmetry 
_struct_site_gen.details 
1  AC1 2 YYG A 37 ? YYG A 37  . ? 1_555 ? 
2  AC1 2 A   A 38 ? A   A 38  . ? 1_555 ? 
3  AC2 6 H2U A 16 ? H2U A 16  . ? 1_555 ? 
4  AC2 6 G   A 19 ? G   A 19  . ? 1_555 ? 
5  AC2 6 HOH K .  ? HOH A 708 . ? 1_555 ? 
6  AC2 6 HOH K .  ? HOH A 709 . ? 1_555 ? 
7  AC2 6 HOH K .  ? HOH A 710 . ? 1_555 ? 
8  AC2 6 HOH K .  ? HOH A 711 . ? 1_555 ? 
9  AC3 5 HOH K .  ? HOH A 712 . ? 1_555 ? 
10 AC3 5 HOH K .  ? HOH A 713 . ? 1_555 ? 
11 AC3 5 HOH K .  ? HOH A 714 . ? 1_555 ? 
12 AC3 5 HOH K .  ? HOH A 715 . ? 1_555 ? 
13 AC3 5 HOH K .  ? HOH A 716 . ? 1_555 ? 
14 AC4 6 G   A 1  ? G   A 1   . ? 1_555 ? 
15 AC4 6 HOH K .  ? HOH A 717 . ? 1_555 ? 
16 AC4 6 HOH K .  ? HOH A 718 . ? 1_555 ? 
17 AC4 6 HOH K .  ? HOH A 719 . ? 1_555 ? 
18 AC4 6 HOH K .  ? HOH A 720 . ? 1_555 ? 
19 AC4 6 HOH K .  ? HOH A 721 . ? 1_555 ? 
20 AC5 5 G   A 20 ? G   A 20  . ? 1_555 ? 
21 AC5 5 A   A 21 ? A   A 21  . ? 1_555 ? 
22 AC5 5 HOH K .  ? HOH A 722 . ? 1_555 ? 
23 AC5 5 HOH K .  ? HOH A 723 . ? 1_555 ? 
24 AC5 5 HOH K .  ? HOH A 724 . ? 1_555 ? 
25 AC6 8 U   A 8  ? U   A 8   . ? 1_555 ? 
26 AC6 8 U   A 12 ? U   A 12  . ? 1_555 ? 
27 AC6 8 HOH K .  ? HOH A 725 . ? 1_555 ? 
28 AC6 8 HOH K .  ? HOH A 726 . ? 1_555 ? 
29 AC6 8 HOH K .  ? HOH A 727 . ? 1_555 ? 
30 AC6 8 HOH K .  ? HOH A 728 . ? 1_555 ? 
31 AC6 8 HOH K .  ? HOH A 729 . ? 1_555 ? 
32 AC6 8 HOH K .  ? HOH A 730 . ? 1_555 ? 
33 AC7 6 HOH K .  ? HOH A 731 . ? 1_555 ? 
34 AC7 6 HOH K .  ? HOH A 732 . ? 1_555 ? 
35 AC7 6 HOH K .  ? HOH A 733 . ? 1_555 ? 
36 AC7 6 HOH K .  ? HOH A 734 . ? 1_555 ? 
37 AC7 6 HOH K .  ? HOH A 735 . ? 1_555 ? 
38 AC7 6 HOH K .  ? HOH A 736 . ? 1_555 ? 
39 AC8 4 U   A 7  ? U   A 7   . ? 1_555 ? 
40 AC8 4 A   A 14 ? A   A 14  . ? 1_555 ? 
41 AC8 4 HOH K .  ? HOH A 611 . ? 1_555 ? 
42 AC8 4 HOH K .  ? HOH A 737 . ? 1_555 ? 
43 AC9 6 G   A 15 ? G   A 15  . ? 1_555 ? 
44 AC9 6 HOH K .  ? HOH A 738 . ? 1_555 ? 
45 AC9 6 HOH K .  ? HOH A 739 . ? 1_555 ? 
46 AC9 6 HOH K .  ? HOH A 740 . ? 1_555 ? 
47 AC9 6 HOH K .  ? HOH A 741 . ? 1_555 ? 
48 AC9 6 HOH K .  ? HOH A 742 . ? 1_555 ? 
# 
_database_PDB_matrix.entry_id          1EHZ 
_database_PDB_matrix.origx[1][1]       1.000000 
_database_PDB_matrix.origx[1][2]       0.000000 
_database_PDB_matrix.origx[1][3]       0.000000 
_database_PDB_matrix.origx[2][1]       0.000000 
_database_PDB_matrix.origx[2][2]       1.000000 
_database_PDB_matrix.origx[2][3]       0.000000 
_database_PDB_matrix.origx[3][1]       0.000000 
_database_PDB_matrix.origx[3][2]       0.000000 
_database_PDB_matrix.origx[3][3]       1.000000 
_database_PDB_matrix.origx_vector[1]   0.00000 
_database_PDB_matrix.origx_vector[2]   0.00000 
_database_PDB_matrix.origx_vector[3]   0.00000 
# 
_atom_sites.entry_id                    1EHZ 
_atom_sites.fract_transf_matrix[1][1]   0.018188 
_atom_sites.fract_transf_matrix[1][2]   0.000000 
_atom_sites.fract_transf_matrix[1][3]   0.000063 
_atom_sites.fract_transf_matrix[2][1]   0.000000 
_atom_sites.fract_transf_matrix[2][2]   0.029950 
_atom_sites.fract_transf_matrix[2][3]   0.000000 
_atom_sites.fract_transf_matrix[3][1]   0.000000 
_atom_sites.fract_transf_matrix[3][2]   0.000000 
_atom_sites.fract_transf_matrix[3][3]   0.016150 
_atom_sites.fract_transf_vector[1]      0.00000 
_atom_sites.fract_transf_vector[2]      0.00000 
_atom_sites.fract_transf_vector[3]      0.00000 
# 
loop_
_atom_type.symbol 
C  
MG 
MN 
N  
O  
P  
# 
loop_
_atom_site.group_PDB 
_atom_site.id 
_atom_site.type_symbol 
_atom_site.label_atom_id 
_atom_site.label_alt_id 
_atom_site.label_comp_id 
_atom_site.label_asym_id 
_atom_site.label_entity_id 
_atom_site.label_seq_id 
_atom_site.pdbx_PDB_ins_code 
_atom_site.Cartn_x 
_atom_site.Cartn_y 
_atom_site.Cartn_z 
_atom_site.occupancy 
_atom_site.B_iso_or_equiv 
_atom_site.pdbx_formal_charge 
_atom_site.auth_seq_id 
_atom_site.auth_comp_id 
_atom_site.auth_asym_id 
_atom_site.auth_atom_id 
_atom_site.pdbx_PDB_model_num 
ATOM   1    O  OP3   . G   A 1 1  ? 50.193 51.190 50.534  1.00 99.85  ? 1   G   A OP3   1 
ATOM   2    P  P     . G   A 1 1  ? 50.626 49.730 50.573  1.00 100.19 ? 1   G   A P     1 
ATOM   3    O  OP1   . G   A 1 1  ? 49.854 48.893 49.562  1.00 100.19 ? 1   G   A OP1   1 
ATOM   4    O  OP2   . G   A 1 1  ? 52.137 49.542 50.511  1.00 99.21  ? 1   G   A OP2   1 
ATOM   5    O  "O5'" . G   A 1 1  ? 50.161 49.136 52.023  1.00 99.82  ? 1   G   A "O5'" 1 
ATOM   6    C  "C5'" . G   A 1 1  ? 50.216 49.948 53.210  1.00 98.63  ? 1   G   A "C5'" 1 
ATOM   7    C  "C4'" . G   A 1 1  ? 50.968 49.231 54.309  1.00 97.84  ? 1   G   A "C4'" 1 
ATOM   8    O  "O4'" . G   A 1 1  ? 50.450 47.888 54.472  1.00 97.10  ? 1   G   A "O4'" 1 
ATOM   9    C  "C3'" . G   A 1 1  ? 52.454 49.030 54.074  1.00 98.07  ? 1   G   A "C3'" 1 
ATOM   10   O  "O3'" . G   A 1 1  ? 53.203 50.177 54.425  1.00 99.39  ? 1   G   A "O3'" 1 
ATOM   11   C  "C2'" . G   A 1 1  ? 52.781 47.831 54.957  1.00 96.96  ? 1   G   A "C2'" 1 
ATOM   12   O  "O2'" . G   A 1 1  ? 53.018 48.156 56.313  1.00 96.77  ? 1   G   A "O2'" 1 
ATOM   13   C  "C1'" . G   A 1 1  ? 51.502 47.007 54.836  1.00 95.70  ? 1   G   A "C1'" 1 
ATOM   14   N  N9    . G   A 1 1  ? 51.628 45.992 53.798  1.00 93.67  ? 1   G   A N9    1 
ATOM   15   C  C8    . G   A 1 1  ? 51.064 46.007 52.547  1.00 92.60  ? 1   G   A C8    1 
ATOM   16   N  N7    . G   A 1 1  ? 51.379 44.966 51.831  1.00 91.19  ? 1   G   A N7    1 
ATOM   17   C  C5    . G   A 1 1  ? 52.197 44.218 52.658  1.00 91.47  ? 1   G   A C5    1 
ATOM   18   C  C6    . G   A 1 1  ? 52.848 42.992 52.425  1.00 90.68  ? 1   G   A C6    1 
ATOM   19   O  O6    . G   A 1 1  ? 52.826 42.291 51.404  1.00 90.38  ? 1   G   A O6    1 
ATOM   20   N  N1    . G   A 1 1  ? 53.588 42.588 53.534  1.00 90.71  ? 1   G   A N1    1 
ATOM   21   C  C2    . G   A 1 1  ? 53.685 43.282 54.716  1.00 91.21  ? 1   G   A C2    1 
ATOM   22   N  N2    . G   A 1 1  ? 54.452 42.733 55.671  1.00 91.23  ? 1   G   A N2    1 
ATOM   23   N  N3    . G   A 1 1  ? 53.077 44.429 54.946  1.00 91.92  ? 1   G   A N3    1 
ATOM   24   C  C4    . G   A 1 1  ? 52.356 44.836 53.879  1.00 92.62  ? 1   G   A C4    1 
ATOM   25   P  P     . C   A 1 2  ? 54.635 50.420 53.741  1.00 100.19 ? 2   C   A P     1 
ATOM   26   O  OP1   . C   A 1 2  ? 55.145 51.726 54.238  1.00 100.19 ? 2   C   A OP1   1 
ATOM   27   O  OP2   . C   A 1 2  ? 54.465 50.204 52.269  1.00 100.19 ? 2   C   A OP2   1 
ATOM   28   O  "O5'" . C   A 1 2  ? 55.563 49.261 54.342  1.00 98.27  ? 2   C   A "O5'" 1 
ATOM   29   C  "C5'" . C   A 1 2  ? 55.925 49.246 55.742  1.00 95.40  ? 2   C   A "C5'" 1 
ATOM   30   C  "C4'" . C   A 1 2  ? 56.836 48.075 56.049  1.00 93.33  ? 2   C   A "C4'" 1 
ATOM   31   O  "O4'" . C   A 1 2  ? 56.122 46.828 55.830  1.00 92.18  ? 2   C   A "O4'" 1 
ATOM   32   C  "C3'" . C   A 1 2  ? 58.090 47.947 55.197  1.00 92.75  ? 2   C   A "C3'" 1 
ATOM   33   O  "O3'" . C   A 1 2  ? 59.174 48.753 55.651  1.00 92.89  ? 2   C   A "O3'" 1 
ATOM   34   C  "C2'" . C   A 1 2  ? 58.416 46.463 55.298  1.00 91.81  ? 2   C   A "C2'" 1 
ATOM   35   O  "O2'" . C   A 1 2  ? 59.140 46.136 56.466  1.00 91.36  ? 2   C   A "O2'" 1 
ATOM   36   C  "C1'" . C   A 1 2  ? 57.022 45.836 55.356  1.00 90.59  ? 2   C   A "C1'" 1 
ATOM   37   N  N1    . C   A 1 2  ? 56.570 45.364 54.029  1.00 88.84  ? 2   C   A N1    1 
ATOM   38   C  C2    . C   A 1 2  ? 57.094 44.157 53.520  1.00 88.64  ? 2   C   A C2    1 
ATOM   39   O  O2    . C   A 1 2  ? 57.921 43.516 54.198  1.00 88.97  ? 2   C   A O2    1 
ATOM   40   N  N3    . C   A 1 2  ? 56.686 43.721 52.301  1.00 87.36  ? 2   C   A N3    1 
ATOM   41   C  C4    . C   A 1 2  ? 55.802 44.437 51.597  1.00 87.11  ? 2   C   A C4    1 
ATOM   42   N  N4    . C   A 1 2  ? 55.430 43.972 50.397  1.00 86.30  ? 2   C   A N4    1 
ATOM   43   C  C5    . C   A 1 2  ? 55.259 45.660 52.089  1.00 86.87  ? 2   C   A C5    1 
ATOM   44   C  C6    . C   A 1 2  ? 55.663 46.080 53.296  1.00 88.01  ? 2   C   A C6    1 
ATOM   45   P  P     . G   A 1 3  ? 60.184 49.419 54.574  1.00 92.31  ? 3   G   A P     1 
ATOM   46   O  OP1   . G   A 1 3  ? 61.015 50.422 55.295  1.00 92.97  ? 3   G   A OP1   1 
ATOM   47   O  OP2   . G   A 1 3  ? 59.371 49.857 53.404  1.00 91.56  ? 3   G   A OP2   1 
ATOM   48   O  "O5'" . G   A 1 3  ? 61.137 48.219 54.105  1.00 88.57  ? 3   G   A "O5'" 1 
ATOM   49   C  "C5'" . G   A 1 3  ? 62.175 47.724 54.969  1.00 83.44  ? 3   G   A "C5'" 1 
ATOM   50   C  "C4'" . G   A 1 3  ? 62.769 46.443 54.422  1.00 79.87  ? 3   G   A "C4'" 1 
ATOM   51   O  "O4'" . G   A 1 3  ? 61.734 45.427 54.299  1.00 78.36  ? 3   G   A "O4'" 1 
ATOM   52   C  "C3'" . G   A 1 3  ? 63.405 46.499 53.040  1.00 78.97  ? 3   G   A "C3'" 1 
ATOM   53   O  "O3'" . G   A 1 3  ? 64.741 47.029 53.060  1.00 79.76  ? 3   G   A "O3'" 1 
ATOM   54   C  "C2'" . G   A 1 3  ? 63.359 45.032 52.608  1.00 77.19  ? 3   G   A "C2'" 1 
ATOM   55   O  "O2'" . G   A 1 3  ? 64.411 44.256 53.155  1.00 77.80  ? 3   G   A "O2'" 1 
ATOM   56   C  "C1'" . G   A 1 3  ? 62.018 44.572 53.194  1.00 73.98  ? 3   G   A "C1'" 1 
ATOM   57   N  N9    . G   A 1 3  ? 60.934 44.675 52.202  1.00 68.20  ? 3   G   A N9    1 
ATOM   58   C  C8    . G   A 1 3  ? 60.024 45.702 52.050  1.00 65.03  ? 3   G   A C8    1 
ATOM   59   N  N7    . G   A 1 3  ? 59.252 45.556 51.003  1.00 62.99  ? 3   G   A N7    1 
ATOM   60   C  C5    . G   A 1 3  ? 59.655 44.348 50.447  1.00 59.95  ? 3   G   A C5    1 
ATOM   61   C  C6    . G   A 1 3  ? 59.189 43.675 49.292  1.00 55.65  ? 3   G   A C6    1 
ATOM   62   O  O6    . G   A 1 3  ? 58.287 44.013 48.522  1.00 53.32  ? 3   G   A O6    1 
ATOM   63   N  N1    . G   A 1 3  ? 59.893 42.491 49.072  1.00 54.00  ? 3   G   A N1    1 
ATOM   64   C  C2    . G   A 1 3  ? 60.906 42.006 49.876  1.00 55.46  ? 3   G   A C2    1 
ATOM   65   N  N2    . G   A 1 3  ? 61.512 40.873 49.479  1.00 48.16  ? 3   G   A N2    1 
ATOM   66   N  N3    . G   A 1 3  ? 61.312 42.605 50.983  1.00 56.69  ? 3   G   A N3    1 
ATOM   67   C  C4    . G   A 1 3  ? 60.666 43.774 51.193  1.00 61.76  ? 3   G   A C4    1 
ATOM   68   P  P     . G   A 1 4  ? 65.295 47.868 51.793  1.00 79.34  ? 4   G   A P     1 
ATOM   69   O  OP1   . G   A 1 4  ? 66.538 48.562 52.246  1.00 80.87  ? 4   G   A OP1   1 
ATOM   70   O  OP2   . G   A 1 4  ? 64.193 48.679 51.209  1.00 79.00  ? 4   G   A OP2   1 
ATOM   71   O  "O5'" . G   A 1 4  ? 65.720 46.752 50.724  1.00 75.17  ? 4   G   A "O5'" 1 
ATOM   72   C  "C5'" . G   A 1 4  ? 66.789 45.843 51.019  1.00 68.95  ? 4   G   A "C5'" 1 
ATOM   73   C  "C4'" . G   A 1 4  ? 66.749 44.634 50.114  1.00 65.13  ? 4   G   A "C4'" 1 
ATOM   74   O  "O4'" . G   A 1 4  ? 65.484 43.939 50.258  1.00 61.83  ? 4   G   A "O4'" 1 
ATOM   75   C  "C3'" . G   A 1 4  ? 66.881 44.840 48.611  1.00 62.79  ? 4   G   A "C3'" 1 
ATOM   76   O  "O3'" . G   A 1 4  ? 68.230 44.977 48.176  1.00 61.75  ? 4   G   A "O3'" 1 
ATOM   77   C  "C2'" . G   A 1 4  ? 66.318 43.538 48.064  1.00 60.58  ? 4   G   A "C2'" 1 
ATOM   78   O  "O2'" . G   A 1 4  ? 67.283 42.514 48.122  1.00 59.59  ? 4   G   A "O2'" 1 
ATOM   79   C  "C1'" . G   A 1 4  ? 65.192 43.241 49.051  1.00 58.29  ? 4   G   A "C1'" 1 
ATOM   80   N  N9    . G   A 1 4  ? 63.923 43.716 48.500  1.00 53.36  ? 4   G   A N9    1 
ATOM   81   C  C8    . G   A 1 4  ? 63.204 44.843 48.842  1.00 49.19  ? 4   G   A C8    1 
ATOM   82   N  N7    . G   A 1 4  ? 62.140 45.013 48.107  1.00 46.88  ? 4   G   A N7    1 
ATOM   83   C  C5    . G   A 1 4  ? 62.144 43.926 47.243  1.00 45.95  ? 4   G   A C5    1 
ATOM   84   C  C6    . G   A 1 4  ? 61.246 43.573 46.206  1.00 43.95  ? 4   G   A C6    1 
ATOM   85   O  O6    . G   A 1 4  ? 60.182 44.136 45.874  1.00 42.46  ? 4   G   A O6    1 
ATOM   86   N  N1    . G   A 1 4  ? 61.672 42.428 45.540  1.00 40.34  ? 4   G   A N1    1 
ATOM   87   C  C2    . G   A 1 4  ? 62.788 41.686 45.867  1.00 42.60  ? 4   G   A C2    1 
ATOM   88   N  N2    . G   A 1 4  ? 63.034 40.588 45.135  1.00 38.91  ? 4   G   A N2    1 
ATOM   89   N  N3    . G   A 1 4  ? 63.612 41.994 46.850  1.00 44.40  ? 4   G   A N3    1 
ATOM   90   C  C4    . G   A 1 4  ? 63.239 43.117 47.480  1.00 48.65  ? 4   G   A C4    1 
ATOM   91   P  P     . A   A 1 5  ? 68.530 45.722 46.789  1.00 59.03  ? 5   A   A P     1 
ATOM   92   O  OP1   . A   A 1 5  ? 69.991 45.842 46.548  1.00 60.84  ? 5   A   A OP1   1 
ATOM   93   O  OP2   . A   A 1 5  ? 67.685 46.959 46.834  1.00 60.64  ? 5   A   A OP2   1 
ATOM   94   O  "O5'" . A   A 1 5  ? 67.957 44.735 45.675  1.00 57.14  ? 5   A   A "O5'" 1 
ATOM   95   C  "C5'" . A   A 1 5  ? 68.648 43.529 45.323  1.00 53.41  ? 5   A   A "C5'" 1 
ATOM   96   C  "C4'" . A   A 1 5  ? 67.927 42.844 44.191  1.00 50.63  ? 5   A   A "C4'" 1 
ATOM   97   O  "O4'" . A   A 1 5  ? 66.589 42.480 44.646  1.00 48.70  ? 5   A   A "O4'" 1 
ATOM   98   C  "C3'" . A   A 1 5  ? 67.665 43.715 42.964  1.00 50.77  ? 5   A   A "C3'" 1 
ATOM   99   O  "O3'" . A   A 1 5  ? 68.747 43.769 42.051  1.00 52.86  ? 5   A   A "O3'" 1 
ATOM   100  C  "C2'" . A   A 1 5  ? 66.455 43.024 42.355  1.00 48.94  ? 5   A   A "C2'" 1 
ATOM   101  O  "O2'" . A   A 1 5  ? 66.864 41.798 41.731  1.00 48.54  ? 5   A   A "O2'" 1 
ATOM   102  C  "C1'" . A   A 1 5  ? 65.646 42.719 43.615  1.00 44.50  ? 5   A   A "C1'" 1 
ATOM   103  N  N9    . A   A 1 5  ? 64.779 43.843 44.021  1.00 42.01  ? 5   A   A N9    1 
ATOM   104  C  C8    . A   A 1 5  ? 64.938 44.803 45.016  1.00 39.75  ? 5   A   A C8    1 
ATOM   105  N  N7    . A   A 1 5  ? 63.925 45.649 45.113  1.00 41.58  ? 5   A   A N7    1 
ATOM   106  C  C5    . A   A 1 5  ? 63.049 45.220 44.115  1.00 38.26  ? 5   A   A C5    1 
ATOM   107  C  C6    . A   A 1 5  ? 61.796 45.688 43.683  1.00 35.83  ? 5   A   A C6    1 
ATOM   108  N  N6    . A   A 1 5  ? 61.110 46.688 44.232  1.00 32.66  ? 5   A   A N6    1 
ATOM   109  N  N1    . A   A 1 5  ? 61.233 45.057 42.644  1.00 35.14  ? 5   A   A N1    1 
ATOM   110  C  C2    . A   A 1 5  ? 61.870 44.017 42.074  1.00 38.97  ? 5   A   A C2    1 
ATOM   111  N  N3    . A   A 1 5  ? 63.024 43.467 42.399  1.00 36.02  ? 5   A   A N3    1 
ATOM   112  C  C4    . A   A 1 5  ? 63.571 44.119 43.437  1.00 39.04  ? 5   A   A C4    1 
ATOM   113  P  P     . U   A 1 6  ? 69.150 45.179 41.392  1.00 55.09  ? 6   U   A P     1 
ATOM   114  O  OP1   . U   A 1 6  ? 70.511 44.926 40.836  1.00 56.37  ? 6   U   A OP1   1 
ATOM   115  O  OP2   . U   A 1 6  ? 68.953 46.283 42.381  1.00 51.00  ? 6   U   A OP2   1 
ATOM   116  O  "O5'" . U   A 1 6  ? 68.119 45.358 40.184  1.00 50.38  ? 6   U   A "O5'" 1 
ATOM   117  C  "C5'" . U   A 1 6  ? 67.912 44.271 39.258  1.00 48.10  ? 6   U   A "C5'" 1 
ATOM   118  C  "C4'" . U   A 1 6  ? 66.579 44.400 38.565  1.00 47.17  ? 6   U   A "C4'" 1 
ATOM   119  O  "O4'" . U   A 1 6  ? 65.486 44.324 39.513  1.00 46.61  ? 6   U   A "O4'" 1 
ATOM   120  C  "C3'" . U   A 1 6  ? 66.344 45.708 37.850  1.00 45.27  ? 6   U   A "C3'" 1 
ATOM   121  O  "O3'" . U   A 1 6  ? 66.964 45.696 36.590  1.00 45.77  ? 6   U   A "O3'" 1 
ATOM   122  C  "C2'" . U   A 1 6  ? 64.833 45.733 37.727  1.00 45.88  ? 6   U   A "C2'" 1 
ATOM   123  O  "O2'" . U   A 1 6  ? 64.431 44.864 36.684  1.00 44.33  ? 6   U   A "O2'" 1 
ATOM   124  C  "C1'" . U   A 1 6  ? 64.413 45.113 39.057  1.00 41.32  ? 6   U   A "C1'" 1 
ATOM   125  N  N1    . U   A 1 6  ? 64.065 46.111 40.079  1.00 39.88  ? 6   U   A N1    1 
ATOM   126  C  C2    . U   A 1 6  ? 62.798 46.658 39.977  1.00 36.06  ? 6   U   A C2    1 
ATOM   127  O  O2    . U   A 1 6  ? 62.021 46.333 39.099  1.00 38.25  ? 6   U   A O2    1 
ATOM   128  N  N3    . U   A 1 6  ? 62.487 47.582 40.924  1.00 34.15  ? 6   U   A N3    1 
ATOM   129  C  C4    . U   A 1 6  ? 63.272 48.002 41.975  1.00 37.36  ? 6   U   A C4    1 
ATOM   130  O  O4    . U   A 1 6  ? 62.822 48.829 42.752  1.00 39.30  ? 6   U   A O4    1 
ATOM   131  C  C5    . U   A 1 6  ? 64.583 47.395 42.032  1.00 39.23  ? 6   U   A C5    1 
ATOM   132  C  C6    . U   A 1 6  ? 64.926 46.497 41.084  1.00 35.72  ? 6   U   A C6    1 
ATOM   133  P  P     . U   A 1 7  ? 67.463 47.074 35.969  1.00 44.37  ? 7   U   A P     1 
ATOM   134  O  OP1   . U   A 1 7  ? 68.318 46.756 34.822  1.00 48.09  ? 7   U   A OP1   1 
ATOM   135  O  OP2   . U   A 1 7  ? 67.945 47.948 37.077  1.00 45.68  ? 7   U   A OP2   1 
ATOM   136  O  "O5'" . U   A 1 7  ? 66.104 47.724 35.455  1.00 40.88  ? 7   U   A "O5'" 1 
ATOM   137  C  "C5'" . U   A 1 7  ? 65.285 47.024 34.459  1.00 37.89  ? 7   U   A "C5'" 1 
ATOM   138  C  "C4'" . U   A 1 7  ? 64.055 47.852 34.101  1.00 35.74  ? 7   U   A "C4'" 1 
ATOM   139  O  "O4'" . U   A 1 7  ? 63.297 48.107 35.326  1.00 38.13  ? 7   U   A "O4'" 1 
ATOM   140  C  "C3'" . U   A 1 7  ? 64.317 49.197 33.459  1.00 36.87  ? 7   U   A "C3'" 1 
ATOM   141  O  "O3'" . U   A 1 7  ? 63.402 49.394 32.378  1.00 37.45  ? 7   U   A "O3'" 1 
ATOM   142  C  "C2'" . U   A 1 7  ? 64.097 50.171 34.624  1.00 36.55  ? 7   U   A "C2'" 1 
ATOM   143  O  "O2'" . U   A 1 7  ? 63.595 51.417 34.246  1.00 35.54  ? 7   U   A "O2'" 1 
ATOM   144  C  "C1'" . U   A 1 7  ? 63.015 49.475 35.442  1.00 37.23  ? 7   U   A "C1'" 1 
ATOM   145  N  N1    . U   A 1 7  ? 63.056 49.858 36.864  1.00 36.91  ? 7   U   A N1    1 
ATOM   146  C  C2    . U   A 1 7  ? 62.011 50.628 37.343  1.00 34.52  ? 7   U   A C2    1 
ATOM   147  O  O2    . U   A 1 7  ? 61.087 50.966 36.653  1.00 34.65  ? 7   U   A O2    1 
ATOM   148  N  N3    . U   A 1 7  ? 62.112 50.993 38.659  1.00 37.03  ? 7   U   A N3    1 
ATOM   149  C  C4    . U   A 1 7  ? 63.131 50.684 39.541  1.00 40.15  ? 7   U   A C4    1 
ATOM   150  O  O4    . U   A 1 7  ? 63.105 51.143 40.699  1.00 36.62  ? 7   U   A O4    1 
ATOM   151  C  C5    . U   A 1 7  ? 64.179 49.865 38.971  1.00 36.52  ? 7   U   A C5    1 
ATOM   152  C  C6    . U   A 1 7  ? 64.106 49.490 37.691  1.00 36.25  ? 7   U   A C6    1 
ATOM   153  P  P     . U   A 1 8  ? 63.884 49.282 30.858  1.00 36.77  ? 8   U   A P     1 
ATOM   154  O  OP1   . U   A 1 8  ? 62.852 49.899 29.952  1.00 38.95  ? 8   U   A OP1   1 
ATOM   155  O  OP2   . U   A 1 8  ? 64.442 47.955 30.547  1.00 38.70  ? 8   U   A OP2   1 
ATOM   156  O  "O5'" . U   A 1 8  ? 65.171 50.254 30.733  1.00 35.95  ? 8   U   A "O5'" 1 
ATOM   157  C  "C5'" . U   A 1 8  ? 64.994 51.676 30.500  1.00 33.53  ? 8   U   A "C5'" 1 
ATOM   158  C  "C4'" . U   A 1 8  ? 66.105 52.236 29.628  1.00 34.33  ? 8   U   A "C4'" 1 
ATOM   159  O  "O4'" . U   A 1 8  ? 67.428 52.119 30.261  1.00 31.81  ? 8   U   A "O4'" 1 
ATOM   160  C  "C3'" . U   A 1 8  ? 66.269 51.519 28.297  1.00 30.21  ? 8   U   A "C3'" 1 
ATOM   161  O  "O3'" . U   A 1 8  ? 65.321 51.887 27.314  1.00 32.41  ? 8   U   A "O3'" 1 
ATOM   162  C  "C2'" . U   A 1 8  ? 67.685 51.906 27.900  1.00 31.37  ? 8   U   A "C2'" 1 
ATOM   163  O  "O2'" . U   A 1 8  ? 67.743 53.224 27.433  1.00 27.02  ? 8   U   A "O2'" 1 
ATOM   164  C  "C1'" . U   A 1 8  ? 68.407 51.830 29.255  1.00 30.28  ? 8   U   A "C1'" 1 
ATOM   165  N  N1    . U   A 1 8  ? 68.914 50.469 29.501  1.00 28.11  ? 8   U   A N1    1 
ATOM   166  C  C2    . U   A 1 8  ? 70.125 50.078 28.931  1.00 29.25  ? 8   U   A C2    1 
ATOM   167  O  O2    . U   A 1 8  ? 70.835 50.819 28.278  1.00 27.81  ? 8   U   A O2    1 
ATOM   168  N  N3    . U   A 1 8  ? 70.481 48.778 29.170  1.00 25.94  ? 8   U   A N3    1 
ATOM   169  C  C4    . U   A 1 8  ? 69.808 47.856 29.922  1.00 27.37  ? 8   U   A C4    1 
ATOM   170  O  O4    . U   A 1 8  ? 70.215 46.704 29.963  1.00 32.58  ? 8   U   A O4    1 
ATOM   171  C  C5    . U   A 1 8  ? 68.612 48.328 30.490  1.00 29.58  ? 8   U   A C5    1 
ATOM   172  C  C6    . U   A 1 8  ? 68.214 49.592 30.265  1.00 30.40  ? 8   U   A C6    1 
ATOM   173  P  P     . A   A 1 9  ? 64.755 50.731 26.311  1.00 32.05  ? 9   A   A P     1 
ATOM   174  O  OP1   . A   A 1 9  ? 63.287 50.736 26.312  1.00 36.52  ? 9   A   A OP1   1 
ATOM   175  O  OP2   . A   A 1 9  ? 65.447 49.415 26.519  1.00 31.33  ? 9   A   A OP2   1 
ATOM   176  O  "O5'" . A   A 1 9  ? 65.221 51.270 24.948  1.00 28.22  ? 9   A   A "O5'" 1 
ATOM   177  C  "C5'" . A   A 1 9  ? 64.646 52.433 24.369  1.00 32.91  ? 9   A   A "C5'" 1 
ATOM   178  C  "C4'" . A   A 1 9  ? 64.531 52.215 22.904  1.00 32.49  ? 9   A   A "C4'" 1 
ATOM   179  O  "O4'" . A   A 1 9  ? 65.887 52.090 22.406  1.00 35.09  ? 9   A   A "O4'" 1 
ATOM   180  C  "C3'" . A   A 1 9  ? 63.820 50.923 22.466  1.00 34.41  ? 9   A   A "C3'" 1 
ATOM   181  O  "O3'" . A   A 1 9  ? 63.140 51.180 21.236  1.00 36.11  ? 9   A   A "O3'" 1 
ATOM   182  C  "C2'" . A   A 1 9  ? 64.979 49.997 22.155  1.00 32.37  ? 9   A   A "C2'" 1 
ATOM   183  O  "O2'" . A   A 1 9  ? 64.686 49.016 21.194  1.00 35.87  ? 9   A   A "O2'" 1 
ATOM   184  C  "C1'" . A   A 1 9  ? 65.985 50.969 21.571  1.00 28.79  ? 9   A   A "C1'" 1 
ATOM   185  N  N9    . A   A 1 9  ? 67.376 50.497 21.585  1.00 23.84  ? 9   A   A N9    1 
ATOM   186  C  C8    . A   A 1 9  ? 67.851 49.356 22.159  1.00 25.84  ? 9   A   A C8    1 
ATOM   187  N  N7    . A   A 1 9  ? 69.149 49.195 22.010  1.00 26.83  ? 9   A   A N7    1 
ATOM   188  C  C5    . A   A 1 9  ? 69.527 50.298 21.288  1.00 23.87  ? 9   A   A C5    1 
ATOM   189  C  C6    . A   A 1 9  ? 70.730 50.663 20.793  1.00 30.26  ? 9   A   A C6    1 
ATOM   190  N  N6    . A   A 1 9  ? 71.797 49.922 20.994  1.00 30.95  ? 9   A   A N6    1 
ATOM   191  N  N1    . A   A 1 9  ? 70.817 51.794 20.072  1.00 28.29  ? 9   A   A N1    1 
ATOM   192  C  C2    . A   A 1 9  ? 69.701 52.547 19.932  1.00 32.68  ? 9   A   A C2    1 
ATOM   193  N  N3    . A   A 1 9  ? 68.469 52.287 20.369  1.00 25.13  ? 9   A   A N3    1 
ATOM   194  C  C4    . A   A 1 9  ? 68.446 51.117 21.026  1.00 26.68  ? 9   A   A C4    1 
HETATM 195  P  P     . 2MG A 1 10 ? 61.504 51.328 21.232  1.00 44.21  ? 10  2MG A P     1 
HETATM 196  O  OP1   . 2MG A 1 10 ? 61.216 51.946 19.892  1.00 41.97  ? 10  2MG A OP1   1 
HETATM 197  O  OP2   . 2MG A 1 10 ? 61.165 52.038 22.473  1.00 41.39  ? 10  2MG A OP2   1 
HETATM 198  O  "O5'" . 2MG A 1 10 ? 60.903 49.858 21.330  1.00 38.75  ? 10  2MG A "O5'" 1 
HETATM 199  C  "C5'" . 2MG A 1 10 ? 59.437 49.660 21.397  1.00 42.74  ? 10  2MG A "C5'" 1 
HETATM 200  C  "C4'" . 2MG A 1 10 ? 59.058 48.375 20.709  1.00 42.88  ? 10  2MG A "C4'" 1 
HETATM 201  O  "O4'" . 2MG A 1 10 ? 59.575 48.416 19.351  1.00 44.02  ? 10  2MG A "O4'" 1 
HETATM 202  C  "C3'" . 2MG A 1 10 ? 59.701 47.161 21.326  1.00 43.31  ? 10  2MG A "C3'" 1 
HETATM 203  O  "O3'" . 2MG A 1 10 ? 58.874 46.647 22.357  1.00 45.12  ? 10  2MG A "O3'" 1 
HETATM 204  C  "C2'" . 2MG A 1 10 ? 59.822 46.215 20.154  1.00 46.04  ? 10  2MG A "C2'" 1 
HETATM 205  O  "O2'" . 2MG A 1 10 ? 58.533 45.637 19.943  1.00 47.96  ? 10  2MG A "O2'" 1 
HETATM 206  C  "C1'" . 2MG A 1 10 ? 60.152 47.173 19.012  1.00 44.62  ? 10  2MG A "C1'" 1 
HETATM 207  N  N9    . 2MG A 1 10 ? 61.581 47.402 18.752  1.00 42.14  ? 10  2MG A N9    1 
HETATM 208  C  C8    . 2MG A 1 10 ? 62.199 48.621 18.635  1.00 40.38  ? 10  2MG A C8    1 
HETATM 209  N  N7    . 2MG A 1 10 ? 63.494 48.534 18.422  1.00 40.70  ? 10  2MG A N7    1 
HETATM 210  C  C5    . 2MG A 1 10 ? 63.745 47.167 18.395  1.00 43.82  ? 10  2MG A C5    1 
HETATM 211  C  C6    . 2MG A 1 10 ? 64.965 46.449 18.205  1.00 43.45  ? 10  2MG A C6    1 
HETATM 212  O  O6    . 2MG A 1 10 ? 66.097 46.891 17.963  1.00 44.87  ? 10  2MG A O6    1 
HETATM 213  N  N1    . 2MG A 1 10 ? 64.767 45.086 18.293  1.00 44.71  ? 10  2MG A N1    1 
HETATM 214  C  C2    . 2MG A 1 10 ? 63.541 44.482 18.486  1.00 47.21  ? 10  2MG A C2    1 
HETATM 215  N  N2    . 2MG A 1 10 ? 63.532 43.164 18.551  1.00 49.27  ? 10  2MG A N2    1 
HETATM 216  C  CM2   . 2MG A 1 10 ? 62.220 42.454 18.591  1.00 52.10  ? 10  2MG A CM2   1 
HETATM 217  N  N3    . 2MG A 1 10 ? 62.411 45.125 18.614  1.00 45.85  ? 10  2MG A N3    1 
HETATM 218  C  C4    . 2MG A 1 10 ? 62.574 46.451 18.582  1.00 43.27  ? 10  2MG A C4    1 
ATOM   219  P  P     . C   A 1 11 ? 59.474 46.418 23.818  1.00 50.75  ? 11  C   A P     1 
ATOM   220  O  OP1   . C   A 1 11 ? 58.367 46.417 24.802  1.00 49.46  ? 11  C   A OP1   1 
ATOM   221  O  OP2   . C   A 1 11 ? 60.585 47.425 23.967  1.00 44.94  ? 11  C   A OP2   1 
ATOM   222  O  "O5'" . C   A 1 11 ? 60.064 44.937 23.797  1.00 49.65  ? 11  C   A "O5'" 1 
ATOM   223  C  "C5'" . C   A 1 11 ? 59.234 43.814 23.447  1.00 49.66  ? 11  C   A "C5'" 1 
ATOM   224  C  "C4'" . C   A 1 11 ? 60.091 42.608 23.221  1.00 50.13  ? 11  C   A "C4'" 1 
ATOM   225  O  "O4'" . C   A 1 11 ? 60.886 42.801 22.028  1.00 47.40  ? 11  C   A "O4'" 1 
ATOM   226  C  "C3'" . C   A 1 11 ? 61.091 42.406 24.335  1.00 52.64  ? 11  C   A "C3'" 1 
ATOM   227  O  "O3'" . C   A 1 11 ? 60.498 41.644 25.372  1.00 54.31  ? 11  C   A "O3'" 1 
ATOM   228  C  "C2'" . C   A 1 11 ? 62.252 41.701 23.640  1.00 51.51  ? 11  C   A "C2'" 1 
ATOM   229  O  "O2'" . C   A 1 11 ? 62.072 40.314 23.587  1.00 53.58  ? 11  C   A "O2'" 1 
ATOM   230  C  "C1'" . C   A 1 11 ? 62.189 42.294 22.230  1.00 48.88  ? 11  C   A "C1'" 1 
ATOM   231  N  N1    . C   A 1 11 ? 63.145 43.397 21.999  1.00 46.21  ? 11  C   A N1    1 
ATOM   232  C  C2    . C   A 1 11 ? 64.484 43.091 21.738  1.00 45.74  ? 11  C   A C2    1 
ATOM   233  O  O2    . C   A 1 11 ? 64.833 41.895 21.708  1.00 47.49  ? 11  C   A O2    1 
ATOM   234  N  N3    . C   A 1 11 ? 65.365 44.106 21.527  1.00 42.07  ? 11  C   A N3    1 
ATOM   235  C  C4    . C   A 1 11 ? 64.941 45.376 21.555  1.00 42.69  ? 11  C   A C4    1 
ATOM   236  N  N4    . C   A 1 11 ? 65.829 46.353 21.301  1.00 38.00  ? 11  C   A N4    1 
ATOM   237  C  C5    . C   A 1 11 ? 63.586 45.709 21.822  1.00 43.75  ? 11  C   A C5    1 
ATOM   238  C  C6    . C   A 1 11 ? 62.732 44.698 22.035  1.00 45.15  ? 11  C   A C6    1 
ATOM   239  P  P     . U   A 1 12 ? 60.976 41.853 26.874  1.00 57.65  ? 12  U   A P     1 
ATOM   240  O  OP1   . U   A 1 12 ? 60.123 41.039 27.783  1.00 59.26  ? 12  U   A OP1   1 
ATOM   241  O  OP2   . U   A 1 12 ? 61.080 43.316 27.117  1.00 59.70  ? 12  U   A OP2   1 
ATOM   242  O  "O5'" . U   A 1 12 ? 62.441 41.244 26.886  1.00 55.93  ? 12  U   A "O5'" 1 
ATOM   243  C  "C5'" . U   A 1 12 ? 62.652 39.837 26.718  1.00 52.43  ? 12  U   A "C5'" 1 
ATOM   244  C  "C4'" . U   A 1 12 ? 64.121 39.544 26.594  1.00 48.54  ? 12  U   A "C4'" 1 
ATOM   245  O  "O4'" . U   A 1 12 ? 64.635 40.154 25.385  1.00 43.89  ? 12  U   A "O4'" 1 
ATOM   246  C  "C3'" . U   A 1 12 ? 65.015 40.119 27.684  1.00 50.30  ? 12  U   A "C3'" 1 
ATOM   247  O  "O3'" . U   A 1 12 ? 65.044 39.362 28.898  1.00 48.54  ? 12  U   A "O3'" 1 
ATOM   248  C  "C2'" . U   A 1 12 ? 66.384 40.159 27.007  1.00 48.05  ? 12  U   A "C2'" 1 
ATOM   249  O  "O2'" . U   A 1 12 ? 67.072 38.922 27.081  1.00 51.04  ? 12  U   A "O2'" 1 
ATOM   250  C  "C1'" . U   A 1 12 ? 66.013 40.478 25.565  1.00 47.40  ? 12  U   A "C1'" 1 
ATOM   251  N  N1    . U   A 1 12 ? 66.260 41.889 25.203  1.00 42.96  ? 12  U   A N1    1 
ATOM   252  C  C2    . U   A 1 12 ? 67.565 42.250 24.872  1.00 43.65  ? 12  U   A C2    1 
ATOM   253  O  O2    . U   A 1 12 ? 68.512 41.462 24.914  1.00 41.62  ? 12  U   A O2    1 
ATOM   254  N  N3    . U   A 1 12 ? 67.736 43.577 24.520  1.00 45.49  ? 12  U   A N3    1 
ATOM   255  C  C4    . U   A 1 12 ? 66.755 44.567 24.497  1.00 41.58  ? 12  U   A C4    1 
ATOM   256  O  O4    . U   A 1 12 ? 67.069 45.722 24.203  1.00 41.28  ? 12  U   A O4    1 
ATOM   257  C  C5    . U   A 1 12 ? 65.436 44.114 24.864  1.00 40.07  ? 12  U   A C5    1 
ATOM   258  C  C6    . U   A 1 12 ? 65.241 42.831 25.193  1.00 44.32  ? 12  U   A C6    1 
ATOM   259  P  P     . C   A 1 13 ? 65.498 40.095 30.251  1.00 51.82  ? 13  C   A P     1 
ATOM   260  O  OP1   . C   A 1 13 ? 65.477 39.159 31.399  1.00 52.57  ? 13  C   A OP1   1 
ATOM   261  O  OP2   . C   A 1 13 ? 64.709 41.323 30.314  1.00 51.61  ? 13  C   A OP2   1 
ATOM   262  O  "O5'" . C   A 1 13 ? 67.010 40.399 29.846  1.00 48.38  ? 13  C   A "O5'" 1 
ATOM   263  C  "C5'" . C   A 1 13 ? 67.843 41.283 30.558  1.00 46.61  ? 13  C   A "C5'" 1 
ATOM   264  C  "C4'" . C   A 1 13 ? 69.102 41.516 29.762  1.00 43.48  ? 13  C   A "C4'" 1 
ATOM   265  O  "O4'" . C   A 1 13 ? 68.818 42.103 28.459  1.00 41.66  ? 13  C   A "O4'" 1 
ATOM   266  C  "C3'" . C   A 1 13 ? 70.084 42.477 30.389  1.00 46.01  ? 13  C   A "C3'" 1 
ATOM   267  O  "O3'" . C   A 1 13 ? 70.867 41.784 31.351  1.00 49.09  ? 13  C   A "O3'" 1 
ATOM   268  C  "C2'" . C   A 1 13 ? 70.925 42.922 29.204  1.00 42.77  ? 13  C   A "C2'" 1 
ATOM   269  O  "O2'" . C   A 1 13 ? 71.950 41.978 29.004  1.00 45.11  ? 13  C   A "O2'" 1 
ATOM   270  C  "C1'" . C   A 1 13 ? 69.909 42.919 28.054  1.00 39.03  ? 13  C   A "C1'" 1 
ATOM   271  N  N1    . C   A 1 13 ? 69.390 44.256 27.668  1.00 36.14  ? 13  C   A N1    1 
ATOM   272  C  C2    . C   A 1 13 ? 70.236 45.162 26.999  1.00 31.39  ? 13  C   A C2    1 
ATOM   273  O  O2    . C   A 1 13 ? 71.429 44.834 26.781  1.00 33.97  ? 13  C   A O2    1 
ATOM   274  N  N3    . C   A 1 13 ? 69.736 46.376 26.604  1.00 30.71  ? 13  C   A N3    1 
ATOM   275  C  C4    . C   A 1 13 ? 68.478 46.702 26.907  1.00 27.53  ? 13  C   A C4    1 
ATOM   276  N  N4    . C   A 1 13 ? 68.050 47.913 26.576  1.00 29.33  ? 13  C   A N4    1 
ATOM   277  C  C5    . C   A 1 13 ? 67.596 45.795 27.581  1.00 30.21  ? 13  C   A C5    1 
ATOM   278  C  C6    . C   A 1 13 ? 68.085 44.602 27.937  1.00 31.74  ? 13  C   A C6    1 
ATOM   279  P  P     . A   A 1 14 ? 71.499 42.582 32.585  1.00 52.69  ? 14  A   A P     1 
ATOM   280  O  OP1   . A   A 1 14 ? 71.592 41.647 33.723  1.00 56.81  ? 14  A   A OP1   1 
ATOM   281  O  OP2   . A   A 1 14 ? 70.795 43.877 32.732  1.00 54.35  ? 14  A   A OP2   1 
ATOM   282  O  "O5'" . A   A 1 14 ? 72.996 42.894 32.143  1.00 52.44  ? 14  A   A "O5'" 1 
ATOM   283  C  "C5'" . A   A 1 14 ? 73.291 44.004 31.337  1.00 44.62  ? 14  A   A "C5'" 1 
ATOM   284  C  "C4'" . A   A 1 14 ? 74.612 43.815 30.626  1.00 38.21  ? 14  A   A "C4'" 1 
ATOM   285  O  "O4'" . A   A 1 14 ? 74.372 44.178 29.229  1.00 37.15  ? 14  A   A "O4'" 1 
ATOM   286  C  "C3'" . A   A 1 14 ? 75.617 44.841 31.120  1.00 39.31  ? 14  A   A "C3'" 1 
ATOM   287  O  "O3'" . A   A 1 14 ? 76.409 44.373 32.214  1.00 35.14  ? 14  A   A "O3'" 1 
ATOM   288  C  "C2'" . A   A 1 14 ? 76.410 45.187 29.878  1.00 35.42  ? 14  A   A "C2'" 1 
ATOM   289  O  "O2'" . A   A 1 14 ? 77.406 44.222 29.562  1.00 37.00  ? 14  A   A "O2'" 1 
ATOM   290  C  "C1'" . A   A 1 14 ? 75.325 45.147 28.805  1.00 32.12  ? 14  A   A "C1'" 1 
ATOM   291  N  N9    . A   A 1 14 ? 74.639 46.437 28.568  1.00 30.32  ? 14  A   A N9    1 
ATOM   292  C  C8    . A   A 1 14 ? 73.332 46.800 28.850  1.00 28.83  ? 14  A   A C8    1 
ATOM   293  N  N7    . A   A 1 14 ? 73.030 48.029 28.495  1.00 27.89  ? 14  A   A N7    1 
ATOM   294  C  C5    . A   A 1 14 ? 74.205 48.496 27.963  1.00 28.40  ? 14  A   A C5    1 
ATOM   295  C  C6    . A   A 1 14 ? 74.551 49.722 27.451  1.00 28.49  ? 14  A   A C6    1 
ATOM   296  N  N6    . A   A 1 14 ? 73.715 50.778 27.422  1.00 27.62  ? 14  A   A N6    1 
ATOM   297  N  N1    . A   A 1 14 ? 75.820 49.867 26.972  1.00 28.90  ? 14  A   A N1    1 
ATOM   298  C  C2    . A   A 1 14 ? 76.658 48.824 27.058  1.00 26.09  ? 14  A   A C2    1 
ATOM   299  N  N3    . A   A 1 14 ? 76.449 47.633 27.546  1.00 34.21  ? 14  A   A N3    1 
ATOM   300  C  C4    . A   A 1 14 ? 75.194 47.523 27.993  1.00 28.42  ? 14  A   A C4    1 
ATOM   301  P  P     . G   A 1 15 ? 76.463 45.227 33.560  1.00 38.35  ? 15  G   A P     1 
ATOM   302  O  OP1   . G   A 1 15 ? 77.577 44.561 34.373  1.00 36.34  ? 15  G   A OP1   1 
ATOM   303  O  OP2   . G   A 1 15 ? 75.020 45.308 34.127  1.00 36.07  ? 15  G   A OP2   1 
ATOM   304  O  "O5'" . G   A 1 15 ? 76.977 46.682 33.179  1.00 34.17  ? 15  G   A "O5'" 1 
ATOM   305  C  "C5'" . G   A 1 15 ? 78.216 46.873 32.475  1.00 37.95  ? 15  G   A "C5'" 1 
ATOM   306  C  "C4'" . G   A 1 15 ? 78.274 48.248 31.867  1.00 34.05  ? 15  G   A "C4'" 1 
ATOM   307  O  "O4'" . G   A 1 15 ? 77.353 48.424 30.762  1.00 36.42  ? 15  G   A "O4'" 1 
ATOM   308  C  "C3'" . G   A 1 15 ? 77.992 49.400 32.793  1.00 41.25  ? 15  G   A "C3'" 1 
ATOM   309  O  "O3'" . G   A 1 15 ? 79.176 49.641 33.526  1.00 55.04  ? 15  G   A "O3'" 1 
ATOM   310  C  "C2'" . G   A 1 15 ? 77.696 50.528 31.803  1.00 37.22  ? 15  G   A "C2'" 1 
ATOM   311  O  "O2'" . G   A 1 15 ? 78.880 51.102 31.276  1.00 33.49  ? 15  G   A "O2'" 1 
ATOM   312  C  "C1'" . G   A 1 15 ? 76.941 49.779 30.686  1.00 33.07  ? 15  G   A "C1'" 1 
ATOM   313  N  N9    . G   A 1 15 ? 75.505 49.813 30.961  1.00 30.40  ? 15  G   A N9    1 
ATOM   314  C  C8    . G   A 1 15 ? 74.775 48.836 31.612  1.00 30.39  ? 15  G   A C8    1 
ATOM   315  N  N7    . G   A 1 15 ? 73.537 49.203 31.861  1.00 28.29  ? 15  G   A N7    1 
ATOM   316  C  C5    . G   A 1 15 ? 73.439 50.464 31.298  1.00 27.38  ? 15  G   A C5    1 
ATOM   317  C  C6    . G   A 1 15 ? 72.351 51.383 31.271  1.00 24.88  ? 15  G   A C6    1 
ATOM   318  O  O6    . G   A 1 15 ? 71.261 51.260 31.756  1.00 26.54  ? 15  G   A O6    1 
ATOM   319  N  N1    . G   A 1 15 ? 72.683 52.569 30.607  1.00 23.73  ? 15  G   A N1    1 
ATOM   320  C  C2    . G   A 1 15 ? 73.896 52.858 30.094  1.00 29.75  ? 15  G   A C2    1 
ATOM   321  N  N2    . G   A 1 15 ? 74.047 54.083 29.581  1.00 27.02  ? 15  G   A N2    1 
ATOM   322  N  N3    . G   A 1 15 ? 74.925 52.008 30.089  1.00 28.46  ? 15  G   A N3    1 
ATOM   323  C  C4    . G   A 1 15 ? 74.632 50.842 30.714  1.00 29.28  ? 15  G   A C4    1 
HETATM 324  P  P     . H2U A 1 16 ? 79.106 49.914 35.099  1.00 64.01  ? 16  H2U A P     1 
HETATM 325  O  OP1   . H2U A 1 16 ? 79.533 48.676 35.816  1.00 67.91  ? 16  H2U A OP1   1 
HETATM 326  O  OP2   . H2U A 1 16 ? 77.803 50.520 35.400  1.00 58.28  ? 16  H2U A OP2   1 
HETATM 327  O  "O5'" . H2U A 1 16 ? 80.270 50.994 35.265  1.00 70.49  ? 16  H2U A "O5'" 1 
HETATM 328  C  "C5'" . H2U A 1 16 ? 81.110 51.317 34.115  1.00 77.82  ? 16  H2U A "C5'" 1 
HETATM 329  C  "C4'" . H2U A 1 16 ? 80.514 52.486 33.353  1.00 82.34  ? 16  H2U A "C4'" 1 
HETATM 330  O  "O4'" . H2U A 1 16 ? 79.081 52.313 33.356  1.00 85.70  ? 16  H2U A "O4'" 1 
HETATM 331  C  "C3'" . H2U A 1 16 ? 80.758 53.821 34.030  1.00 84.30  ? 16  H2U A "C3'" 1 
HETATM 332  O  "O3'" . H2U A 1 16 ? 81.907 54.422 33.414  1.00 84.12  ? 16  H2U A "O3'" 1 
HETATM 333  C  "C1'" . H2U A 1 16 ? 78.428 53.548 33.551  1.00 88.13  ? 16  H2U A "C1'" 1 
HETATM 334  C  "C2'" . H2U A 1 16 ? 79.505 54.639 33.690  1.00 86.71  ? 16  H2U A "C2'" 1 
HETATM 335  O  "O2'" . H2U A 1 16 ? 79.637 55.391 32.493  1.00 88.25  ? 16  H2U A "O2'" 1 
HETATM 336  N  N1    . H2U A 1 16 ? 77.347 53.323 34.582  1.00 91.19  ? 16  H2U A N1    1 
HETATM 337  C  C2    . H2U A 1 16 ? 76.119 52.865 34.160  1.00 92.39  ? 16  H2U A C2    1 
HETATM 338  O  O2    . H2U A 1 16 ? 75.885 52.463 33.033  1.00 92.20  ? 16  H2U A O2    1 
HETATM 339  N  N3    . H2U A 1 16 ? 75.123 52.894 35.107  1.00 93.28  ? 16  H2U A N3    1 
HETATM 340  C  C4    . H2U A 1 16 ? 75.289 52.711 36.458  1.00 93.34  ? 16  H2U A C4    1 
HETATM 341  O  O4    . H2U A 1 16 ? 74.309 52.695 37.208  1.00 92.66  ? 16  H2U A O4    1 
HETATM 342  C  C5    . H2U A 1 16 ? 76.696 52.479 36.909  1.00 93.77  ? 16  H2U A C5    1 
HETATM 343  C  C6    . H2U A 1 16 ? 77.717 53.238 36.039  1.00 93.22  ? 16  H2U A C6    1 
HETATM 344  P  P     . H2U A 1 17 ? 83.371 53.708 33.472  1.00 82.84  ? 17  H2U A P     1 
HETATM 345  O  OP1   . H2U A 1 17 ? 83.746 53.377 32.068  1.00 83.70  ? 17  H2U A OP1   1 
HETATM 346  O  OP2   . H2U A 1 17 ? 83.498 52.655 34.529  1.00 83.82  ? 17  H2U A OP2   1 
HETATM 347  O  "O5'" . H2U A 1 17 ? 84.277 54.923 33.943  1.00 81.72  ? 17  H2U A "O5'" 1 
HETATM 348  C  "C5'" . H2U A 1 17 ? 83.692 55.978 34.736  1.00 76.14  ? 17  H2U A "C5'" 1 
HETATM 349  C  "C4'" . H2U A 1 17 ? 84.176 55.886 36.150  1.00 71.56  ? 17  H2U A "C4'" 1 
HETATM 350  O  "O4'" . H2U A 1 17 ? 85.622 55.872 36.137  1.00 71.61  ? 17  H2U A "O4'" 1 
HETATM 351  C  "C3'" . H2U A 1 17 ? 83.738 57.031 37.055  1.00 67.99  ? 17  H2U A "C3'" 1 
HETATM 352  O  "O3'" . H2U A 1 17 ? 82.553 56.582 37.718  1.00 60.02  ? 17  H2U A "O3'" 1 
HETATM 353  C  "C1'" . H2U A 1 17 ? 86.102 56.903 36.958  1.00 71.64  ? 17  H2U A "C1'" 1 
HETATM 354  C  "C2'" . H2U A 1 17 ? 84.964 57.213 37.948  1.00 71.27  ? 17  H2U A "C2'" 1 
HETATM 355  O  "O2'" . H2U A 1 17 ? 85.004 56.273 39.021  1.00 73.23  ? 17  H2U A "O2'" 1 
HETATM 356  N  N1    . H2U A 1 17 ? 86.579 57.954 36.004  1.00 72.27  ? 17  H2U A N1    1 
HETATM 357  C  C2    . H2U A 1 17 ? 87.702 58.662 36.301  1.00 71.21  ? 17  H2U A C2    1 
HETATM 358  O  O2    . H2U A 1 17 ? 87.834 59.359 37.287  1.00 72.68  ? 17  H2U A O2    1 
HETATM 359  N  N3    . H2U A 1 17 ? 88.693 58.585 35.358  1.00 69.04  ? 17  H2U A N3    1 
HETATM 360  C  C4    . H2U A 1 17 ? 88.711 57.779 34.244  1.00 68.89  ? 17  H2U A C4    1 
HETATM 361  O  O4    . H2U A 1 17 ? 89.766 57.616 33.620  1.00 64.81  ? 17  H2U A O4    1 
HETATM 362  C  C5    . H2U A 1 17 ? 87.401 57.154 33.864  1.00 69.36  ? 17  H2U A C5    1 
HETATM 363  C  C6    . H2U A 1 17 ? 86.257 57.828 34.577  1.00 71.72  ? 17  H2U A C6    1 
ATOM   364  P  P     . G   A 1 18 ? 81.804 57.491 38.803  1.00 53.35  ? 18  G   A P     1 
ATOM   365  O  OP1   . G   A 1 18 ? 82.773 58.100 39.715  1.00 56.70  ? 18  G   A OP1   1 
ATOM   366  O  OP2   . G   A 1 18 ? 80.724 56.638 39.368  1.00 56.95  ? 18  G   A OP2   1 
ATOM   367  O  "O5'" . G   A 1 18 ? 81.038 58.580 37.950  1.00 45.07  ? 18  G   A "O5'" 1 
ATOM   368  C  "C5'" . G   A 1 18 ? 80.288 58.201 36.778  1.00 37.17  ? 18  G   A "C5'" 1 
ATOM   369  C  "C4'" . G   A 1 18 ? 80.100 59.412 35.902  1.00 33.24  ? 18  G   A "C4'" 1 
ATOM   370  O  "O4'" . G   A 1 18 ? 79.417 60.430 36.705  1.00 29.49  ? 18  G   A "O4'" 1 
ATOM   371  C  "C3'" . G   A 1 18 ? 81.426 60.038 35.456  1.00 29.19  ? 18  G   A "C3'" 1 
ATOM   372  O  "O3'" . G   A 1 18 ? 81.313 60.691 34.173  1.00 27.98  ? 18  G   A "O3'" 1 
ATOM   373  C  "C2'" . G   A 1 18 ? 81.638 61.165 36.437  1.00 26.61  ? 18  G   A "C2'" 1 
ATOM   374  O  "O2'" . G   A 1 18 ? 82.417 62.205 35.773  1.00 31.88  ? 18  G   A "O2'" 1 
ATOM   375  C  "C1'" . G   A 1 18 ? 80.191 61.615 36.658  1.00 31.24  ? 18  G   A "C1'" 1 
ATOM   376  N  N9    . G   A 1 18 ? 79.893 62.457 37.818  1.00 25.73  ? 18  G   A N9    1 
ATOM   377  C  C8    . G   A 1 18 ? 80.399 62.361 39.094  1.00 29.39  ? 18  G   A C8    1 
ATOM   378  N  N7    . G   A 1 18 ? 79.992 63.332 39.883  1.00 29.66  ? 18  G   A N7    1 
ATOM   379  C  C5    . G   A 1 18 ? 79.165 64.095 39.074  1.00 26.03  ? 18  G   A C5    1 
ATOM   380  C  C6    . G   A 1 18 ? 78.469 65.259 39.359  1.00 29.73  ? 18  G   A C6    1 
ATOM   381  O  O6    . G   A 1 18 ? 78.491 65.889 40.411  1.00 31.10  ? 18  G   A O6    1 
ATOM   382  N  N1    . G   A 1 18 ? 77.698 65.711 38.257  1.00 25.44  ? 18  G   A N1    1 
ATOM   383  C  C2    . G   A 1 18 ? 77.634 65.077 37.076  1.00 25.15  ? 18  G   A C2    1 
ATOM   384  N  N2    . G   A 1 18 ? 76.850 65.605 36.127  1.00 28.06  ? 18  G   A N2    1 
ATOM   385  N  N3    . G   A 1 18 ? 78.312 63.960 36.797  1.00 31.81  ? 18  G   A N3    1 
ATOM   386  C  C4    . G   A 1 18 ? 79.053 63.539 37.817  1.00 27.46  ? 18  G   A C4    1 
ATOM   387  P  P     . G   A 1 19 ? 81.705 59.935 32.855  1.00 34.61  ? 19  G   A P     1 
ATOM   388  O  OP1   . G   A 1 19 ? 80.751 58.780 32.632  1.00 31.49  ? 19  G   A OP1   1 
ATOM   389  O  OP2   . G   A 1 19 ? 83.185 59.683 32.792  1.00 35.14  ? 19  G   A OP2   1 
ATOM   390  O  "O5'" . G   A 1 19 ? 81.429 61.065 31.780  1.00 30.92  ? 19  G   A "O5'" 1 
ATOM   391  C  "C5'" . G   A 1 19 ? 80.053 61.459 31.456  1.00 35.49  ? 19  G   A "C5'" 1 
ATOM   392  C  "C4'" . G   A 1 19 ? 80.105 62.508 30.407  1.00 32.28  ? 19  G   A "C4'" 1 
ATOM   393  O  "O4'" . G   A 1 19 ? 80.779 63.631 30.991  1.00 33.92  ? 19  G   A "O4'" 1 
ATOM   394  C  "C3'" . G   A 1 19 ? 80.907 62.116 29.171  1.00 34.56  ? 19  G   A "C3'" 1 
ATOM   395  O  "O3'" . G   A 1 19 ? 80.389 62.868 28.083  1.00 33.76  ? 19  G   A "O3'" 1 
ATOM   396  C  "C2'" . G   A 1 19 ? 82.305 62.679 29.462  1.00 35.83  ? 19  G   A "C2'" 1 
ATOM   397  O  "O2'" . G   A 1 19 ? 82.892 63.160 28.284  1.00 36.38  ? 19  G   A "O2'" 1 
ATOM   398  C  "C1'" . G   A 1 19 ? 81.965 63.912 30.283  1.00 31.26  ? 19  G   A "C1'" 1 
ATOM   399  N  N9    . G   A 1 19 ? 82.922 64.301 31.303  1.00 34.09  ? 19  G   A N9    1 
ATOM   400  C  C8    . G   A 1 19 ? 83.808 63.510 32.002  1.00 34.35  ? 19  G   A C8    1 
ATOM   401  N  N7    . G   A 1 19 ? 84.330 64.135 33.026  1.00 29.97  ? 19  G   A N7    1 
ATOM   402  C  C5    . G   A 1 19 ? 83.803 65.412 32.954  1.00 30.15  ? 19  G   A C5    1 
ATOM   403  C  C6    . G   A 1 19 ? 83.998 66.553 33.810  1.00 30.28  ? 19  G   A C6    1 
ATOM   404  O  O6    . G   A 1 19 ? 84.715 66.645 34.861  1.00 30.49  ? 19  G   A O6    1 
ATOM   405  N  N1    . G   A 1 19 ? 83.246 67.654 33.362  1.00 30.06  ? 19  G   A N1    1 
ATOM   406  C  C2    . G   A 1 19 ? 82.438 67.667 32.262  1.00 28.68  ? 19  G   A C2    1 
ATOM   407  N  N2    . G   A 1 19 ? 81.753 68.812 32.044  1.00 31.69  ? 19  G   A N2    1 
ATOM   408  N  N3    . G   A 1 19 ? 82.279 66.621 31.443  1.00 33.35  ? 19  G   A N3    1 
ATOM   409  C  C4    . G   A 1 19 ? 82.976 65.537 31.862  1.00 29.77  ? 19  G   A C4    1 
ATOM   410  P  P     . G   A 1 20 ? 79.212 62.270 27.169  1.00 37.57  ? 20  G   A P     1 
ATOM   411  O  OP1   . G   A 1 20 ? 78.632 63.435 26.460  1.00 37.48  ? 20  G   A OP1   1 
ATOM   412  O  OP2   . G   A 1 20 ? 78.418 61.535 28.129  1.00 34.93  ? 20  G   A OP2   1 
ATOM   413  O  "O5'" . G   A 1 20 ? 79.952 61.358 26.110  1.00 35.27  ? 20  G   A "O5'" 1 
ATOM   414  C  "C5'" . G   A 1 20 ? 80.561 61.904 24.945  1.00 34.78  ? 20  G   A "C5'" 1 
ATOM   415  C  "C4'" . G   A 1 20 ? 80.529 60.879 23.849  1.00 33.56  ? 20  G   A "C4'" 1 
ATOM   416  O  "O4'" . G   A 1 20 ? 81.420 59.808 24.203  1.00 34.69  ? 20  G   A "O4'" 1 
ATOM   417  C  "C3'" . G   A 1 20 ? 79.164 60.229 23.679  1.00 34.55  ? 20  G   A "C3'" 1 
ATOM   418  O  "O3'" . G   A 1 20 ? 78.373 60.964 22.748  1.00 32.07  ? 20  G   A "O3'" 1 
ATOM   419  C  "C2'" . G   A 1 20 ? 79.540 58.879 23.115  1.00 31.94  ? 20  G   A "C2'" 1 
ATOM   420  O  "O2'" . G   A 1 20 ? 79.935 59.005 21.776  1.00 29.14  ? 20  G   A "O2'" 1 
ATOM   421  C  "C1'" . G   A 1 20 ? 80.836 58.580 23.876  1.00 33.29  ? 20  G   A "C1'" 1 
ATOM   422  N  N9    . G   A 1 20 ? 80.557 57.879 25.128  1.00 28.16  ? 20  G   A N9    1 
ATOM   423  C  C8    . G   A 1 20 ? 80.808 58.309 26.413  1.00 28.17  ? 20  G   A C8    1 
ATOM   424  N  N7    . G   A 1 20 ? 80.362 57.471 27.316  1.00 27.62  ? 20  G   A N7    1 
ATOM   425  C  C5    . G   A 1 20 ? 79.819 56.431 26.576  1.00 26.85  ? 20  G   A C5    1 
ATOM   426  C  C6    . G   A 1 20 ? 79.214 55.251 26.985  1.00 29.07  ? 20  G   A C6    1 
ATOM   427  O  O6    . G   A 1 20 ? 79.010 54.845 28.141  1.00 30.12  ? 20  G   A O6    1 
ATOM   428  N  N1    . G   A 1 20 ? 78.811 54.474 25.894  1.00 26.18  ? 20  G   A N1    1 
ATOM   429  C  C2    . G   A 1 20 ? 78.993 54.795 24.576  1.00 28.16  ? 20  G   A C2    1 
ATOM   430  N  N2    . G   A 1 20 ? 78.546 53.879 23.648  1.00 24.71  ? 20  G   A N2    1 
ATOM   431  N  N3    . G   A 1 20 ? 79.567 55.902 24.177  1.00 25.02  ? 20  G   A N3    1 
ATOM   432  C  C4    . G   A 1 20 ? 79.951 56.671 25.225  1.00 27.86  ? 20  G   A C4    1 
ATOM   433  P  P     . A   A 1 21 ? 76.960 61.541 23.213  1.00 35.97  ? 21  A   A P     1 
ATOM   434  O  OP1   . A   A 1 21 ? 76.324 62.054 21.989  1.00 35.07  ? 21  A   A OP1   1 
ATOM   435  O  OP2   . A   A 1 21 ? 77.193 62.456 24.350  1.00 35.45  ? 21  A   A OP2   1 
ATOM   436  O  "O5'" . A   A 1 21 ? 76.166 60.289 23.790  1.00 34.57  ? 21  A   A "O5'" 1 
ATOM   437  C  "C5'" . A   A 1 21 ? 75.604 59.329 22.914  1.00 33.17  ? 21  A   A "C5'" 1 
ATOM   438  C  "C4'" . A   A 1 21 ? 75.622 58.001 23.580  1.00 34.52  ? 21  A   A "C4'" 1 
ATOM   439  O  "O4'" . A   A 1 21 ? 74.864 57.958 24.808  1.00 29.25  ? 21  A   A "O4'" 1 
ATOM   440  C  "C3'" . A   A 1 21 ? 75.125 56.852 22.735  1.00 33.11  ? 21  A   A "C3'" 1 
ATOM   441  O  "O3'" . A   A 1 21 ? 76.250 56.581 21.883  1.00 36.69  ? 21  A   A "O3'" 1 
ATOM   442  C  "C2'" . A   A 1 21 ? 74.815 55.806 23.788  1.00 33.65  ? 21  A   A "C2'" 1 
ATOM   443  O  "O2'" . A   A 1 21 ? 76.034 55.158 24.220  1.00 30.39  ? 21  A   A "O2'" 1 
ATOM   444  C  "C1'" . A   A 1 21 ? 74.304 56.666 24.955  1.00 30.28  ? 21  A   A "C1'" 1 
ATOM   445  N  N9    . A   A 1 21 ? 72.843 56.834 25.065  1.00 28.13  ? 21  A   A N9    1 
ATOM   446  C  C8    . A   A 1 21 ? 72.122 57.968 24.720  1.00 24.90  ? 21  A   A C8    1 
ATOM   447  N  N7    . A   A 1 21 ? 70.828 57.864 24.968  1.00 27.77  ? 21  A   A N7    1 
ATOM   448  C  C5    . A   A 1 21 ? 70.695 56.581 25.516  1.00 25.63  ? 21  A   A C5    1 
ATOM   449  C  C6    . A   A 1 21 ? 69.596 55.872 26.031  1.00 28.10  ? 21  A   A C6    1 
ATOM   450  N  N6    . A   A 1 21 ? 68.327 56.341 26.073  1.00 24.98  ? 21  A   A N6    1 
ATOM   451  N  N1    . A   A 1 21 ? 69.817 54.668 26.536  1.00 27.40  ? 21  A   A N1    1 
ATOM   452  C  C2    . A   A 1 21 ? 71.064 54.186 26.531  1.00 26.83  ? 21  A   A C2    1 
ATOM   453  N  N3    . A   A 1 21 ? 72.169 54.734 26.097  1.00 26.24  ? 21  A   A N3    1 
ATOM   454  C  C4    . A   A 1 21 ? 71.927 55.948 25.580  1.00 28.94  ? 21  A   A C4    1 
ATOM   455  P  P     . G   A 1 22 ? 76.122 55.607 20.624  1.00 36.77  ? 22  G   A P     1 
ATOM   456  O  OP1   . G   A 1 22 ? 77.347 55.811 19.853  1.00 34.15  ? 22  G   A OP1   1 
ATOM   457  O  OP2   . G   A 1 22 ? 74.796 55.966 20.020  1.00 38.21  ? 22  G   A OP2   1 
ATOM   458  O  "O5'" . G   A 1 22 ? 76.107 54.255 21.420  1.00 39.67  ? 22  G   A "O5'" 1 
ATOM   459  C  "C5'" . G   A 1 22 ? 75.588 53.058 20.896  1.00 33.77  ? 22  G   A "C5'" 1 
ATOM   460  C  "C4'" . G   A 1 22 ? 76.292 51.916 21.581  1.00 33.57  ? 22  G   A "C4'" 1 
ATOM   461  O  "O4'" . G   A 1 22 ? 76.032 51.934 23.018  1.00 28.98  ? 22  G   A "O4'" 1 
ATOM   462  C  "C3'" . G   A 1 22 ? 75.794 50.585 21.102  1.00 31.27  ? 22  G   A "C3'" 1 
ATOM   463  O  "O3'" . G   A 1 22 ? 76.427 50.216 19.874  1.00 36.07  ? 22  G   A "O3'" 1 
ATOM   464  C  "C2'" . G   A 1 22 ? 75.986 49.707 22.315  1.00 30.09  ? 22  G   A "C2'" 1 
ATOM   465  O  "O2'" . G   A 1 22 ? 77.321 49.252 22.478  1.00 29.86  ? 22  G   A "O2'" 1 
ATOM   466  C  "C1'" . G   A 1 22 ? 75.605 50.671 23.444  1.00 25.75  ? 22  G   A "C1'" 1 
ATOM   467  N  N9    . G   A 1 22 ? 74.157 50.722 23.757  1.00 27.25  ? 22  G   A N9    1 
ATOM   468  C  C8    . G   A 1 22 ? 73.306 51.785 23.618  1.00 27.24  ? 22  G   A C8    1 
ATOM   469  N  N7    . G   A 1 22 ? 72.095 51.529 24.052  1.00 28.94  ? 22  G   A N7    1 
ATOM   470  C  C5    . G   A 1 22 ? 72.147 50.220 24.476  1.00 28.23  ? 22  G   A C5    1 
ATOM   471  C  C6    . G   A 1 22 ? 71.138 49.385 25.011  1.00 28.84  ? 22  G   A C6    1 
ATOM   472  O  O6    . G   A 1 22 ? 69.936 49.648 25.252  1.00 29.10  ? 22  G   A O6    1 
ATOM   473  N  N1    . G   A 1 22 ? 71.624 48.128 25.270  1.00 27.83  ? 22  G   A N1    1 
ATOM   474  C  C2    . G   A 1 22 ? 72.899 47.703 25.050  1.00 30.21  ? 22  G   A C2    1 
ATOM   475  N  N2    . G   A 1 22 ? 73.158 46.409 25.364  1.00 27.00  ? 22  G   A N2    1 
ATOM   476  N  N3    . G   A 1 22 ? 73.837 48.454 24.566  1.00 29.25  ? 22  G   A N3    1 
ATOM   477  C  C4    . G   A 1 22 ? 73.400 49.695 24.288  1.00 25.81  ? 22  G   A C4    1 
ATOM   478  P  P     . A   A 1 23 ? 75.571 49.404 18.784  1.00 38.64  ? 23  A   A P     1 
ATOM   479  O  OP1   . A   A 1 23 ? 76.230 49.559 17.497  1.00 35.37  ? 23  A   A OP1   1 
ATOM   480  O  OP2   . A   A 1 23 ? 74.080 49.759 18.881  1.00 35.35  ? 23  A   A OP2   1 
ATOM   481  O  "O5'" . A   A 1 23 ? 75.636 47.938 19.332  1.00 37.83  ? 23  A   A "O5'" 1 
ATOM   482  C  "C5'" . A   A 1 23 ? 76.912 47.318 19.633  1.00 37.02  ? 23  A   A "C5'" 1 
ATOM   483  C  "C4'" . A   A 1 23 ? 76.705 45.975 20.257  1.00 39.13  ? 23  A   A "C4'" 1 
ATOM   484  O  "O4'" . A   A 1 23 ? 76.089 46.103 21.547  1.00 38.15  ? 23  A   A "O4'" 1 
ATOM   485  C  "C3'" . A   A 1 23 ? 75.794 45.028 19.486  1.00 40.14  ? 23  A   A "C3'" 1 
ATOM   486  O  "O3'" . A   A 1 23 ? 76.500 44.368 18.446  1.00 42.27  ? 23  A   A "O3'" 1 
ATOM   487  C  "C2'" . A   A 1 23 ? 75.356 44.060 20.563  1.00 39.45  ? 23  A   A "C2'" 1 
ATOM   488  O  "O2'" . A   A 1 23 ? 76.423 43.125 20.754  1.00 42.00  ? 23  A   A "O2'" 1 
ATOM   489  C  "C1'" . A   A 1 23 ? 75.210 45.010 21.771  1.00 37.98  ? 23  A   A "C1'" 1 
ATOM   490  N  N9    . A   A 1 23 ? 73.858 45.578 21.885  1.00 35.38  ? 23  A   A N9    1 
ATOM   491  C  C8    . A   A 1 23 ? 73.461 46.822 21.439  1.00 35.25  ? 23  A   A C8    1 
ATOM   492  N  N7    . A   A 1 23 ? 72.234 47.140 21.772  1.00 33.59  ? 23  A   A N7    1 
ATOM   493  C  C5    . A   A 1 23 ? 71.772 46.017 22.438  1.00 34.26  ? 23  A   A C5    1 
ATOM   494  C  C6    . A   A 1 23 ? 70.529 45.710 23.019  1.00 32.33  ? 23  A   A C6    1 
ATOM   495  N  N6    . A   A 1 23 ? 69.521 46.594 23.138  1.00 34.94  ? 23  A   A N6    1 
ATOM   496  N  N1    . A   A 1 23 ? 70.368 44.470 23.517  1.00 35.35  ? 23  A   A N1    1 
ATOM   497  C  C2    . A   A 1 23 ? 71.405 43.615 23.470  1.00 31.66  ? 23  A   A C2    1 
ATOM   498  N  N3    . A   A 1 23 ? 72.643 43.811 23.008  1.00 32.48  ? 23  A   A N3    1 
ATOM   499  C  C4    . A   A 1 23 ? 72.758 45.035 22.487  1.00 34.85  ? 23  A   A C4    1 
ATOM   500  P  P     . G   A 1 24 ? 75.691 43.814 17.170  1.00 44.02  ? 24  G   A P     1 
ATOM   501  O  OP1   . G   A 1 24 ? 76.744 43.269 16.286  1.00 46.42  ? 24  G   A OP1   1 
ATOM   502  O  OP2   . G   A 1 24 ? 74.752 44.889 16.691  1.00 43.05  ? 24  G   A OP2   1 
ATOM   503  O  "O5'" . G   A 1 24 ? 74.795 42.670 17.756  1.00 40.73  ? 24  G   A "O5'" 1 
ATOM   504  C  "C5'" . G   A 1 24 ? 75.378 41.492 18.218  1.00 46.30  ? 24  G   A "C5'" 1 
ATOM   505  C  "C4'" . G   A 1 24 ? 74.313 40.622 18.747  1.00 47.22  ? 24  G   A "C4'" 1 
ATOM   506  O  "O4'" . G   A 1 24 ? 73.799 41.198 19.975  1.00 46.23  ? 24  G   A "O4'" 1 
ATOM   507  C  "C3'" . G   A 1 24 ? 73.094 40.484 17.855  1.00 47.23  ? 24  G   A "C3'" 1 
ATOM   508  O  "O3'" . G   A 1 24 ? 73.287 39.486 16.850  1.00 51.92  ? 24  G   A "O3'" 1 
ATOM   509  C  "C2'" . G   A 1 24 ? 72.056 40.037 18.867  1.00 47.49  ? 24  G   A "C2'" 1 
ATOM   510  O  "O2'" . G   A 1 24 ? 72.324 38.676 19.169  1.00 46.29  ? 24  G   A "O2'" 1 
ATOM   511  C  "C1'" . G   A 1 24 ? 72.412 40.925 20.073  1.00 45.11  ? 24  G   A "C1'" 1 
ATOM   512  N  N9    . G   A 1 24 ? 71.687 42.195 20.013  1.00 42.04  ? 24  G   A N9    1 
ATOM   513  C  C8    . G   A 1 24 ? 72.126 43.377 19.471  1.00 42.70  ? 24  G   A C8    1 
ATOM   514  N  N7    . G   A 1 24 ? 71.218 44.315 19.472  1.00 40.83  ? 24  G   A N7    1 
ATOM   515  C  C5    . G   A 1 24 ? 70.114 43.715 20.070  1.00 42.41  ? 24  G   A C5    1 
ATOM   516  C  C6    . G   A 1 24 ? 68.831 44.242 20.336  1.00 44.36  ? 24  G   A C6    1 
ATOM   517  O  O6    . G   A 1 24 ? 68.390 45.396 20.057  1.00 44.29  ? 24  G   A O6    1 
ATOM   518  N  N1    . G   A 1 24 ? 68.011 43.299 20.965  1.00 42.61  ? 24  G   A N1    1 
ATOM   519  C  C2    . G   A 1 24 ? 68.390 42.013 21.284  1.00 44.44  ? 24  G   A C2    1 
ATOM   520  N  N2    . G   A 1 24 ? 67.446 41.234 21.843  1.00 42.33  ? 24  G   A N2    1 
ATOM   521  N  N3    . G   A 1 24 ? 69.599 41.521 21.050  1.00 41.16  ? 24  G   A N3    1 
ATOM   522  C  C4    . G   A 1 24 ? 70.396 42.419 20.435  1.00 42.35  ? 24  G   A C4    1 
ATOM   523  P  P     . C   A 1 25 ? 72.660 39.699 15.392  1.00 49.58  ? 25  C   A P     1 
ATOM   524  O  OP1   . C   A 1 25 ? 73.082 38.530 14.539  1.00 54.65  ? 25  C   A OP1   1 
ATOM   525  O  OP2   . C   A 1 25 ? 72.897 41.067 14.886  1.00 47.78  ? 25  C   A OP2   1 
ATOM   526  O  "O5'" . C   A 1 25 ? 71.110 39.469 15.645  1.00 48.69  ? 25  C   A "O5'" 1 
ATOM   527  C  "C5'" . C   A 1 25 ? 70.619 38.180 16.052  1.00 50.80  ? 25  C   A "C5'" 1 
ATOM   528  C  "C4'" . C   A 1 25 ? 69.170 38.275 16.491  1.00 50.78  ? 25  C   A "C4'" 1 
ATOM   529  O  "O4'" . C   A 1 25 ? 69.098 39.152 17.653  1.00 55.06  ? 25  C   A "O4'" 1 
ATOM   530  C  "C3'" . C   A 1 25 ? 68.156 38.899 15.531  1.00 53.87  ? 25  C   A "C3'" 1 
ATOM   531  O  "O3'" . C   A 1 25 ? 67.629 38.012 14.533  1.00 52.62  ? 25  C   A "O3'" 1 
ATOM   532  C  "C2'" . C   A 1 25 ? 67.045 39.336 16.481  1.00 54.24  ? 25  C   A "C2'" 1 
ATOM   533  O  "O2'" . C   A 1 25 ? 66.276 38.238 16.922  1.00 56.92  ? 25  C   A "O2'" 1 
ATOM   534  C  "C1'" . C   A 1 25 ? 67.844 39.818 17.685  1.00 51.93  ? 25  C   A "C1'" 1 
ATOM   535  N  N1    . C   A 1 25 ? 68.040 41.263 17.589  1.00 51.02  ? 25  C   A N1    1 
ATOM   536  C  C2    . C   A 1 25 ? 67.005 42.092 18.016  1.00 51.02  ? 25  C   A C2    1 
ATOM   537  O  O2    . C   A 1 25 ? 65.989 41.579 18.475  1.00 49.40  ? 25  C   A O2    1 
ATOM   538  N  N3    . C   A 1 25 ? 67.136 43.428 17.897  1.00 50.42  ? 25  C   A N3    1 
ATOM   539  C  C4    . C   A 1 25 ? 68.240 43.949 17.341  1.00 50.86  ? 25  C   A C4    1 
ATOM   540  N  N4    . C   A 1 25 ? 68.316 45.287 17.212  1.00 46.56  ? 25  C   A N4    1 
ATOM   541  C  C5    . C   A 1 25 ? 69.316 43.129 16.899  1.00 48.98  ? 25  C   A C5    1 
ATOM   542  C  C6    . C   A 1 25 ? 69.185 41.802 17.062  1.00 50.79  ? 25  C   A C6    1 
HETATM 543  P  P     . M2G A 1 26 ? 67.297 38.593 13.077  1.00 53.21  ? 26  M2G A P     1 
HETATM 544  O  OP1   . M2G A 1 26 ? 66.835 37.487 12.148  1.00 56.89  ? 26  M2G A OP1   1 
HETATM 545  O  OP2   . M2G A 1 26 ? 68.469 39.430 12.691  1.00 53.23  ? 26  M2G A OP2   1 
HETATM 546  O  "O5'" . M2G A 1 26 ? 66.058 39.572 13.258  1.00 49.44  ? 26  M2G A "O5'" 1 
HETATM 547  C  "C5'" . M2G A 1 26 ? 64.865 39.112 13.893  1.00 49.64  ? 26  M2G A "C5'" 1 
HETATM 548  C  "C4'" . M2G A 1 26 ? 63.938 40.267 14.143  1.00 49.36  ? 26  M2G A "C4'" 1 
HETATM 549  O  "O4'" . M2G A 1 26 ? 64.443 41.119 15.209  1.00 48.17  ? 26  M2G A "O4'" 1 
HETATM 550  C  "C3'" . M2G A 1 26 ? 63.719 41.196 12.968  1.00 48.54  ? 26  M2G A "C3'" 1 
HETATM 551  O  "O3'" . M2G A 1 26 ? 62.681 40.699 12.152  1.00 52.14  ? 26  M2G A "O3'" 1 
HETATM 552  C  "C2'" . M2G A 1 26 ? 63.273 42.477 13.644  1.00 47.40  ? 26  M2G A "C2'" 1 
HETATM 553  O  "O2'" . M2G A 1 26 ? 61.905 42.387 14.025  1.00 47.93  ? 26  M2G A "O2'" 1 
HETATM 554  C  "C1'" . M2G A 1 26 ? 64.147 42.470 14.901  1.00 46.92  ? 26  M2G A "C1'" 1 
HETATM 555  N  N9    . M2G A 1 26 ? 65.403 43.195 14.677  1.00 41.61  ? 26  M2G A N9    1 
HETATM 556  C  C8    . M2G A 1 26 ? 66.657 42.687 14.400  1.00 45.40  ? 26  M2G A C8    1 
HETATM 557  N  N7    . M2G A 1 26 ? 67.543 43.618 14.188  1.00 44.60  ? 26  M2G A N7    1 
HETATM 558  C  C5    . M2G A 1 26 ? 66.836 44.807 14.371  1.00 43.23  ? 26  M2G A C5    1 
HETATM 559  C  C6    . M2G A 1 26 ? 67.253 46.174 14.285  1.00 41.77  ? 26  M2G A C6    1 
HETATM 560  O  O6    . M2G A 1 26 ? 68.372 46.637 14.008  1.00 45.23  ? 26  M2G A O6    1 
HETATM 561  N  N1    . M2G A 1 26 ? 66.209 47.048 14.544  1.00 42.85  ? 26  M2G A N1    1 
HETATM 562  C  C2    . M2G A 1 26 ? 64.926 46.678 14.840  1.00 42.16  ? 26  M2G A C2    1 
HETATM 563  N  N2    . M2G A 1 26 ? 64.015 47.663 15.061  1.00 41.43  ? 26  M2G A N2    1 
HETATM 564  N  N3    . M2G A 1 26 ? 64.531 45.410 14.927  1.00 42.18  ? 26  M2G A N3    1 
HETATM 565  C  C4    . M2G A 1 26 ? 65.524 44.546 14.680  1.00 43.64  ? 26  M2G A C4    1 
HETATM 566  C  CM1   . M2G A 1 26 ? 64.404 49.075 15.158  1.00 44.51  ? 26  M2G A CM1   1 
HETATM 567  C  CM2   . M2G A 1 26 ? 62.594 47.288 15.283  1.00 41.28  ? 26  M2G A CM2   1 
ATOM   568  P  P     . C   A 1 27 ? 62.860 40.709 10.569  1.00 53.96  ? 27  C   A P     1 
ATOM   569  O  OP1   . C   A 1 27 ? 61.690 39.909 10.056  1.00 58.78  ? 27  C   A OP1   1 
ATOM   570  O  OP2   . C   A 1 27 ? 64.244 40.343 10.165  1.00 54.14  ? 27  C   A OP2   1 
ATOM   571  O  "O5'" . C   A 1 27 ? 62.614 42.218 10.155  1.00 53.83  ? 27  C   A "O5'" 1 
ATOM   572  C  "C5'" . C   A 1 27 ? 61.437 42.899 10.561  1.00 51.71  ? 27  C   A "C5'" 1 
ATOM   573  C  "C4'" . C   A 1 27 ? 61.594 44.378 10.321  1.00 53.47  ? 27  C   A "C4'" 1 
ATOM   574  O  "O4'" . C   A 1 27 ? 62.476 44.955 11.330  1.00 51.31  ? 27  C   A "O4'" 1 
ATOM   575  C  "C3'" . C   A 1 27 ? 62.210 44.814 9.004   1.00 54.38  ? 27  C   A "C3'" 1 
ATOM   576  O  "O3'" . C   A 1 27 ? 61.256 44.865 7.943   1.00 60.47  ? 27  C   A "O3'" 1 
ATOM   577  C  "C2'" . C   A 1 27 ? 62.693 46.223 9.339   1.00 51.78  ? 27  C   A "C2'" 1 
ATOM   578  O  "O2'" . C   A 1 27 ? 61.640 47.167 9.301   1.00 51.18  ? 27  C   A "O2'" 1 
ATOM   579  C  "C1'" . C   A 1 27 ? 63.159 46.064 10.787  1.00 48.68  ? 27  C   A "C1'" 1 
ATOM   580  N  N1    . C   A 1 27 ? 64.612 45.818 10.877  1.00 42.59  ? 27  C   A N1    1 
ATOM   581  C  C2    . C   A 1 27 ? 65.472 46.868 10.634  1.00 44.48  ? 27  C   A C2    1 
ATOM   582  O  O2    . C   A 1 27 ? 64.981 47.978 10.348  1.00 42.73  ? 27  C   A O2    1 
ATOM   583  N  N3    . C   A 1 27 ? 66.821 46.659 10.722  1.00 42.28  ? 27  C   A N3    1 
ATOM   584  C  C4    . C   A 1 27 ? 67.275 45.452 11.056  1.00 43.75  ? 27  C   A C4    1 
ATOM   585  N  N4    . C   A 1 27 ? 68.586 45.272 11.180  1.00 44.57  ? 27  C   A N4    1 
ATOM   586  C  C5    . C   A 1 27 ? 66.402 44.364 11.291  1.00 44.20  ? 27  C   A C5    1 
ATOM   587  C  C6    . C   A 1 27 ? 65.095 44.589 11.192  1.00 44.33  ? 27  C   A C6    1 
ATOM   588  P  P     . C   A 1 28 ? 61.715 44.551 6.429   1.00 61.60  ? 28  C   A P     1 
ATOM   589  O  OP1   . C   A 1 28 ? 60.464 44.441 5.640   1.00 62.15  ? 28  C   A OP1   1 
ATOM   590  O  OP2   . C   A 1 28 ? 62.648 43.401 6.479   1.00 61.61  ? 28  C   A OP2   1 
ATOM   591  O  "O5'" . C   A 1 28 ? 62.553 45.816 5.941   1.00 56.70  ? 28  C   A "O5'" 1 
ATOM   592  C  "C5'" . C   A 1 28 ? 61.910 47.047 5.647   1.00 57.75  ? 28  C   A "C5'" 1 
ATOM   593  C  "C4'" . C   A 1 28 ? 62.918 48.099 5.246   1.00 58.29  ? 28  C   A "C4'" 1 
ATOM   594  O  "O4'" . C   A 1 28 ? 63.719 48.476 6.402   1.00 56.80  ? 28  C   A "O4'" 1 
ATOM   595  C  "C3'" . C   A 1 28 ? 63.942 47.721 4.187   1.00 60.32  ? 28  C   A "C3'" 1 
ATOM   596  O  "O3'" . C   A 1 28 ? 63.466 47.779 2.838   1.00 64.19  ? 28  C   A "O3'" 1 
ATOM   597  C  "C2'" . C   A 1 28 ? 65.056 48.727 4.461   1.00 57.91  ? 28  C   A "C2'" 1 
ATOM   598  O  "O2'" . C   A 1 28 ? 64.774 50.025 3.952   1.00 56.60  ? 28  C   A "O2'" 1 
ATOM   599  C  "C1'" . C   A 1 28 ? 65.046 48.767 5.987   1.00 56.20  ? 28  C   A "C1'" 1 
ATOM   600  N  N1    . C   A 1 28 ? 65.958 47.725 6.532   1.00 51.41  ? 28  C   A N1    1 
ATOM   601  C  C2    . C   A 1 28 ? 67.338 47.999 6.616   1.00 49.26  ? 28  C   A C2    1 
ATOM   602  O  O2    . C   A 1 28 ? 67.761 49.119 6.240   1.00 45.60  ? 28  C   A O2    1 
ATOM   603  N  N3    . C   A 1 28 ? 68.175 47.034 7.101   1.00 50.25  ? 28  C   A N3    1 
ATOM   604  C  C4    . C   A 1 28 ? 67.676 45.854 7.493   1.00 50.21  ? 28  C   A C4    1 
ATOM   605  N  N4    . C   A 1 28 ? 68.515 44.934 7.978   1.00 50.49  ? 28  C   A N4    1 
ATOM   606  C  C5    . C   A 1 28 ? 66.284 45.560 7.412   1.00 50.83  ? 28  C   A C5    1 
ATOM   607  C  C6    . C   A 1 28 ? 65.473 46.516 6.936   1.00 50.67  ? 28  C   A C6    1 
ATOM   608  P  P     . A   A 1 29 ? 64.134 46.810 1.715   1.00 65.77  ? 29  A   A P     1 
ATOM   609  O  OP1   . A   A 1 29 ? 63.389 47.109 0.457   1.00 67.04  ? 29  A   A OP1   1 
ATOM   610  O  OP2   . A   A 1 29 ? 64.179 45.395 2.219   1.00 63.95  ? 29  A   A OP2   1 
ATOM   611  O  "O5'" . A   A 1 29 ? 65.641 47.328 1.540   1.00 62.83  ? 29  A   A "O5'" 1 
ATOM   612  C  "C5'" . A   A 1 29 ? 65.903 48.647 0.972   1.00 63.87  ? 29  A   A "C5'" 1 
ATOM   613  C  "C4'" . A   A 1 29 ? 67.384 49.009 1.027   1.00 63.27  ? 29  A   A "C4'" 1 
ATOM   614  O  "O4'" . A   A 1 29 ? 67.815 49.121 2.412   1.00 62.56  ? 29  A   A "O4'" 1 
ATOM   615  C  "C3'" . A   A 1 29 ? 68.423 48.084 0.399   1.00 63.00  ? 29  A   A "C3'" 1 
ATOM   616  O  "O3'" . A   A 1 29 ? 68.576 48.226 -1.003  1.00 65.01  ? 29  A   A "O3'" 1 
ATOM   617  C  "C2'" . A   A 1 29 ? 69.702 48.526 1.092   1.00 61.38  ? 29  A   A "C2'" 1 
ATOM   618  O  "O2'" . A   A 1 29 ? 70.234 49.721 0.530   1.00 61.02  ? 29  A   A "O2'" 1 
ATOM   619  C  "C1'" . A   A 1 29 ? 69.196 48.789 2.509   1.00 59.63  ? 29  A   A "C1'" 1 
ATOM   620  N  N9    . A   A 1 29 ? 69.335 47.576 3.315   1.00 54.19  ? 29  A   A N9    1 
ATOM   621  C  C8    . A   A 1 29 ? 68.378 46.647 3.653   1.00 54.48  ? 29  A   A C8    1 
ATOM   622  N  N7    . A   A 1 29 ? 68.847 45.630 4.321   1.00 53.76  ? 29  A   A N7    1 
ATOM   623  C  C5    . A   A 1 29 ? 70.198 45.923 4.448   1.00 52.14  ? 29  A   A C5    1 
ATOM   624  C  C6    . A   A 1 29 ? 71.245 45.231 5.038   1.00 50.79  ? 29  A   A C6    1 
ATOM   625  N  N6    . A   A 1 29 ? 71.082 44.066 5.687   1.00 50.54  ? 29  A   A N6    1 
ATOM   626  N  N1    . A   A 1 29 ? 72.481 45.776 4.952   1.00 48.83  ? 29  A   A N1    1 
ATOM   627  C  C2    . A   A 1 29 ? 72.620 46.942 4.329   1.00 48.49  ? 29  A   A C2    1 
ATOM   628  N  N3    . A   A 1 29 ? 71.699 47.698 3.751   1.00 51.37  ? 29  A   A N3    1 
ATOM   629  C  C4    . A   A 1 29 ? 70.502 47.119 3.845   1.00 50.75  ? 29  A   A C4    1 
ATOM   630  P  P     . G   A 1 30 ? 69.148 46.986 -1.875  1.00 63.15  ? 30  G   A P     1 
ATOM   631  O  OP1   . G   A 1 30 ? 68.830 47.365 -3.277  1.00 64.99  ? 30  G   A OP1   1 
ATOM   632  O  OP2   . G   A 1 30 ? 68.659 45.688 -1.323  1.00 61.44  ? 30  G   A OP2   1 
ATOM   633  O  "O5'" . G   A 1 30 ? 70.738 46.979 -1.648  1.00 64.00  ? 30  G   A "O5'" 1 
ATOM   634  C  "C5'" . G   A 1 30 ? 71.552 48.159 -1.889  1.00 63.25  ? 30  G   A "C5'" 1 
ATOM   635  C  "C4'" . G   A 1 30 ? 72.933 47.996 -1.281  1.00 63.56  ? 30  G   A "C4'" 1 
ATOM   636  O  "O4'" . G   A 1 30 ? 72.830 47.805 0.157   1.00 62.05  ? 30  G   A "O4'" 1 
ATOM   637  C  "C3'" . G   A 1 30 ? 73.716 46.785 -1.754  1.00 65.21  ? 30  G   A "C3'" 1 
ATOM   638  O  "O3'" . G   A 1 30 ? 74.380 47.055 -2.978  1.00 68.93  ? 30  G   A "O3'" 1 
ATOM   639  C  "C2'" . G   A 1 30 ? 74.690 46.532 -0.603  1.00 63.90  ? 30  G   A "C2'" 1 
ATOM   640  O  "O2'" . G   A 1 30 ? 75.815 47.379 -0.636  1.00 66.48  ? 30  G   A "O2'" 1 
ATOM   641  C  "C1'" . G   A 1 30 ? 73.839 46.903 0.605   1.00 60.48  ? 30  G   A "C1'" 1 
ATOM   642  N  N9    . G   A 1 30 ? 73.204 45.719 1.184   1.00 56.62  ? 30  G   A N9    1 
ATOM   643  C  C8    . G   A 1 30 ? 71.872 45.376 1.155   1.00 55.59  ? 30  G   A C8    1 
ATOM   644  N  N7    . G   A 1 30 ? 71.623 44.235 1.750   1.00 54.28  ? 30  G   A N7    1 
ATOM   645  C  C5    . G   A 1 30 ? 72.868 43.798 2.203   1.00 52.26  ? 30  G   A C5    1 
ATOM   646  C  C6    . G   A 1 30 ? 73.238 42.611 2.909   1.00 51.92  ? 30  G   A C6    1 
ATOM   647  O  O6    . G   A 1 30 ? 72.512 41.677 3.315   1.00 48.72  ? 30  G   A O6    1 
ATOM   648  N  N1    . G   A 1 30 ? 74.614 42.562 3.133   1.00 53.22  ? 30  G   A N1    1 
ATOM   649  C  C2    . G   A 1 30 ? 75.513 43.524 2.738   1.00 52.55  ? 30  G   A C2    1 
ATOM   650  N  N2    . G   A 1 30 ? 76.797 43.282 3.015   1.00 52.61  ? 30  G   A N2    1 
ATOM   651  N  N3    . G   A 1 30 ? 75.180 44.635 2.106   1.00 52.73  ? 30  G   A N3    1 
ATOM   652  C  C4    . G   A 1 30 ? 73.853 44.703 1.866   1.00 53.73  ? 30  G   A C4    1 
ATOM   653  P  P     . A   A 1 31 ? 74.530 45.886 -4.075  1.00 69.42  ? 31  A   A P     1 
ATOM   654  O  OP1   . A   A 1 31 ? 75.319 46.471 -5.195  1.00 71.00  ? 31  A   A OP1   1 
ATOM   655  O  OP2   . A   A 1 31 ? 73.193 45.303 -4.337  1.00 68.84  ? 31  A   A OP2   1 
ATOM   656  O  "O5'" . A   A 1 31 ? 75.405 44.785 -3.333  1.00 67.81  ? 31  A   A "O5'" 1 
ATOM   657  C  "C5'" . A   A 1 31 ? 76.782 45.018 -3.047  1.00 66.34  ? 31  A   A "C5'" 1 
ATOM   658  C  "C4'" . A   A 1 31 ? 77.346 43.848 -2.300  1.00 65.86  ? 31  A   A "C4'" 1 
ATOM   659  O  "O4'" . A   A 1 31 ? 76.688 43.760 -1.020  1.00 64.48  ? 31  A   A "O4'" 1 
ATOM   660  C  "C3'" . A   A 1 31 ? 77.123 42.485 -2.938  1.00 67.80  ? 31  A   A "C3'" 1 
ATOM   661  O  "O3'" . A   A 1 31 ? 78.102 42.185 -3.933  1.00 69.43  ? 31  A   A "O3'" 1 
ATOM   662  C  "C2'" . A   A 1 31 ? 77.166 41.543 -1.735  1.00 66.49  ? 31  A   A "C2'" 1 
ATOM   663  O  "O2'" . A   A 1 31 ? 78.476 41.202 -1.324  1.00 70.09  ? 31  A   A "O2'" 1 
ATOM   664  C  "C1'" . A   A 1 31 ? 76.518 42.403 -0.649  1.00 62.06  ? 31  A   A "C1'" 1 
ATOM   665  N  N9    . A   A 1 31 ? 75.083 42.164 -0.541  1.00 56.88  ? 31  A   A N9    1 
ATOM   666  C  C8    . A   A 1 31 ? 74.083 42.881 -1.152  1.00 56.22  ? 31  A   A C8    1 
ATOM   667  N  N7    . A   A 1 31 ? 72.877 42.454 -0.869  1.00 55.69  ? 31  A   A N7    1 
ATOM   668  C  C5    . A   A 1 31 ? 73.093 41.379 -0.019  1.00 52.78  ? 31  A   A C5    1 
ATOM   669  C  C6    . A   A 1 31 ? 72.210 40.498 0.642   1.00 53.56  ? 31  A   A C6    1 
ATOM   670  N  N6    . A   A 1 31 ? 70.867 40.568 0.536   1.00 51.52  ? 31  A   A N6    1 
ATOM   671  N  N1    . A   A 1 31 ? 72.757 39.533 1.428   1.00 53.95  ? 31  A   A N1    1 
ATOM   672  C  C2    . A   A 1 31 ? 74.103 39.473 1.530   1.00 54.22  ? 31  A   A C2    1 
ATOM   673  N  N3    . A   A 1 31 ? 75.027 40.244 0.958   1.00 53.01  ? 31  A   A N3    1 
ATOM   674  C  C4    . A   A 1 31 ? 74.453 41.186 0.189   1.00 54.24  ? 31  A   A C4    1 
HETATM 675  N  N1    . OMC A 1 32 ? 74.486 38.301 -2.478  1.00 64.48  ? 32  OMC A N1    1 
HETATM 676  C  C2    . OMC A 1 32 ? 73.347 37.833 -1.784  1.00 63.86  ? 32  OMC A C2    1 
HETATM 677  N  N3    . OMC A 1 32 ? 72.174 38.492 -1.928  1.00 62.03  ? 32  OMC A N3    1 
HETATM 678  C  C4    . OMC A 1 32 ? 72.103 39.570 -2.726  1.00 62.91  ? 32  OMC A C4    1 
HETATM 679  C  C5    . OMC A 1 32 ? 73.242 40.067 -3.425  1.00 63.75  ? 32  OMC A C5    1 
HETATM 680  C  C6    . OMC A 1 32 ? 74.401 39.413 -3.269  1.00 64.43  ? 32  OMC A C6    1 
HETATM 681  O  O2    . OMC A 1 32 ? 73.450 36.817 -1.056  1.00 63.74  ? 32  OMC A O2    1 
HETATM 682  N  N4    . OMC A 1 32 ? 70.914 40.189 -2.874  1.00 60.56  ? 32  OMC A N4    1 
HETATM 683  C  "C1'" . OMC A 1 32 ? 75.756 37.560 -2.358  1.00 68.30  ? 32  OMC A "C1'" 1 
HETATM 684  C  "C2'" . OMC A 1 32 ? 75.912 36.485 -3.446  1.00 68.41  ? 32  OMC A "C2'" 1 
HETATM 685  O  "O2'" . OMC A 1 32 ? 76.521 35.341 -2.874  1.00 68.27  ? 32  OMC A "O2'" 1 
HETATM 686  C  CM2   . OMC A 1 32 ? 75.491 34.476 -2.439  1.00 68.09  ? 32  OMC A CM2   1 
HETATM 687  C  "C3'" . OMC A 1 32 ? 76.801 37.196 -4.464  1.00 69.68  ? 32  OMC A "C3'" 1 
HETATM 688  C  "C4'" . OMC A 1 32 ? 77.712 38.038 -3.579  1.00 69.87  ? 32  OMC A "C4'" 1 
HETATM 689  O  "O4'" . OMC A 1 32 ? 76.843 38.468 -2.493  1.00 69.46  ? 32  OMC A "O4'" 1 
HETATM 690  O  "O3'" . OMC A 1 32 ? 77.529 36.305 -5.304  1.00 71.71  ? 32  OMC A "O3'" 1 
HETATM 691  C  "C5'" . OMC A 1 32 ? 78.349 39.239 -4.237  1.00 68.92  ? 32  OMC A "C5'" 1 
HETATM 692  O  "O5'" . OMC A 1 32 ? 77.359 40.004 -4.930  1.00 69.40  ? 32  OMC A "O5'" 1 
HETATM 693  P  P     . OMC A 1 32 ? 77.644 41.515 -5.330  1.00 70.88  ? 32  OMC A P     1 
HETATM 694  O  OP1   . OMC A 1 32 ? 78.813 41.581 -6.239  1.00 71.33  ? 32  OMC A OP1   1 
HETATM 695  O  OP2   . OMC A 1 32 ? 76.360 42.128 -5.750  1.00 69.87  ? 32  OMC A OP2   1 
ATOM   696  P  P     . U   A 1 33 ? 76.971 35.962 -6.783  1.00 72.91  ? 33  U   A P     1 
ATOM   697  O  OP1   . U   A 1 33 ? 78.044 35.151 -7.420  1.00 73.35  ? 33  U   A OP1   1 
ATOM   698  O  OP2   . U   A 1 33 ? 76.437 37.170 -7.490  1.00 71.97  ? 33  U   A OP2   1 
ATOM   699  O  "O5'" . U   A 1 33 ? 75.699 35.053 -6.505  1.00 71.09  ? 33  U   A "O5'" 1 
ATOM   700  C  "C5'" . U   A 1 33 ? 75.822 33.741 -5.951  1.00 71.16  ? 33  U   A "C5'" 1 
ATOM   701  C  "C4'" . U   A 1 33 ? 74.457 33.095 -5.870  1.00 72.48  ? 33  U   A "C4'" 1 
ATOM   702  O  "O4'" . U   A 1 33 ? 73.655 33.729 -4.828  1.00 73.47  ? 33  U   A "O4'" 1 
ATOM   703  C  "C3'" . U   A 1 33 ? 73.601 33.208 -7.129  1.00 72.70  ? 33  U   A "C3'" 1 
ATOM   704  O  "O3'" . U   A 1 33 ? 73.935 32.212 -8.110  1.00 70.79  ? 33  U   A "O3'" 1 
ATOM   705  C  "C2'" . U   A 1 33 ? 72.190 33.041 -6.575  1.00 72.85  ? 33  U   A "C2'" 1 
ATOM   706  O  "O2'" . U   A 1 33 ? 71.917 31.668 -6.340  1.00 73.80  ? 33  U   A "O2'" 1 
ATOM   707  C  "C1'" . U   A 1 33 ? 72.289 33.769 -5.226  1.00 72.04  ? 33  U   A "C1'" 1 
ATOM   708  N  N1    . U   A 1 33 ? 71.847 35.177 -5.291  1.00 69.22  ? 33  U   A N1    1 
ATOM   709  C  C2    . U   A 1 33 ? 70.504 35.476 -4.990  1.00 67.66  ? 33  U   A C2    1 
ATOM   710  O  O2    . U   A 1 33 ? 69.696 34.637 -4.613  1.00 66.73  ? 33  U   A O2    1 
ATOM   711  N  N3    . U   A 1 33 ? 70.155 36.799 -5.139  1.00 64.32  ? 33  U   A N3    1 
ATOM   712  C  C4    . U   A 1 33 ? 70.975 37.841 -5.535  1.00 64.94  ? 33  U   A C4    1 
ATOM   713  O  O4    . U   A 1 33 ? 70.494 38.966 -5.720  1.00 60.96  ? 33  U   A O4    1 
ATOM   714  C  C5    . U   A 1 33 ? 72.339 37.462 -5.787  1.00 65.88  ? 33  U   A C5    1 
ATOM   715  C  C6    . U   A 1 33 ? 72.718 36.181 -5.660  1.00 68.66  ? 33  U   A C6    1 
HETATM 716  P  P     . OMG A 1 34 ? 73.785 32.556 -9.678  1.00 71.12  ? 34  OMG A P     1 
HETATM 717  O  OP1   . OMG A 1 34 ? 73.921 31.249 -10.387 1.00 68.06  ? 34  OMG A OP1   1 
HETATM 718  O  OP2   . OMG A 1 34 ? 74.725 33.685 -10.014 1.00 67.66  ? 34  OMG A OP2   1 
HETATM 719  O  "O5'" . OMG A 1 34 ? 72.274 33.065 -9.810  1.00 65.26  ? 34  OMG A "O5'" 1 
HETATM 720  C  "C5'" . OMG A 1 34 ? 71.764 33.656 -11.016 1.00 64.26  ? 34  OMG A "C5'" 1 
HETATM 721  C  "C4'" . OMG A 1 34 ? 70.295 33.326 -11.163 1.00 64.62  ? 34  OMG A "C4'" 1 
HETATM 722  O  "O4'" . OMG A 1 34 ? 70.126 31.890 -11.328 1.00 63.80  ? 34  OMG A "O4'" 1 
HETATM 723  C  "C3'" . OMG A 1 34 ? 69.463 33.672 -9.939  1.00 65.81  ? 34  OMG A "C3'" 1 
HETATM 724  O  "O3'" . OMG A 1 34 ? 69.094 35.051 -9.965  1.00 67.70  ? 34  OMG A "O3'" 1 
HETATM 725  C  "C2'" . OMG A 1 34 ? 68.311 32.644 -9.969  1.00 64.60  ? 34  OMG A "C2'" 1 
HETATM 726  O  "O2'" . OMG A 1 34 ? 67.083 32.909 -10.666 1.00 63.66  ? 34  OMG A "O2'" 1 
HETATM 727  C  CM2   . OMG A 1 34 ? 67.294 33.412 -11.976 1.00 64.30  ? 34  OMG A CM2   1 
HETATM 728  C  "C1'" . OMG A 1 34 ? 68.999 31.433 -10.593 1.00 61.80  ? 34  OMG A "C1'" 1 
HETATM 729  N  N9    . OMG A 1 34 ? 69.429 30.396 -9.649  1.00 59.16  ? 34  OMG A N9    1 
HETATM 730  C  C8    . OMG A 1 34 ? 70.718 29.977 -9.388  1.00 57.76  ? 34  OMG A C8    1 
HETATM 731  N  N7    . OMG A 1 34 ? 70.774 28.948 -8.579  1.00 56.91  ? 34  OMG A N7    1 
HETATM 732  C  C5    . OMG A 1 34 ? 69.441 28.691 -8.266  1.00 58.76  ? 34  OMG A C5    1 
HETATM 733  C  C6    . OMG A 1 34 ? 68.866 27.676 -7.438  1.00 60.12  ? 34  OMG A C6    1 
HETATM 734  O  O6    . OMG A 1 34 ? 69.451 26.785 -6.793  1.00 60.12  ? 34  OMG A O6    1 
HETATM 735  N  N1    . OMG A 1 34 ? 67.469 27.777 -7.395  1.00 59.19  ? 34  OMG A N1    1 
HETATM 736  C  C2    . OMG A 1 34 ? 66.720 28.751 -8.040  1.00 59.35  ? 34  OMG A C2    1 
HETATM 737  N  N2    . OMG A 1 34 ? 65.376 28.719 -7.843  1.00 56.71  ? 34  OMG A N2    1 
HETATM 738  N  N3    . OMG A 1 34 ? 67.250 29.698 -8.816  1.00 58.06  ? 34  OMG A N3    1 
HETATM 739  C  C4    . OMG A 1 34 ? 68.602 29.600 -8.889  1.00 58.63  ? 34  OMG A C4    1 
ATOM   740  P  P     . A   A 1 35 ? 69.287 35.959 -8.637  1.00 69.94  ? 35  A   A P     1 
ATOM   741  O  OP1   . A   A 1 35 ? 68.963 37.372 -8.988  1.00 66.80  ? 35  A   A OP1   1 
ATOM   742  O  OP2   . A   A 1 35 ? 70.613 35.629 -8.027  1.00 67.49  ? 35  A   A OP2   1 
ATOM   743  O  "O5'" . A   A 1 35 ? 68.138 35.409 -7.674  1.00 69.12  ? 35  A   A "O5'" 1 
ATOM   744  C  "C5'" . A   A 1 35 ? 66.791 35.233 -8.158  1.00 71.95  ? 35  A   A "C5'" 1 
ATOM   745  C  "C4'" . A   A 1 35 ? 65.999 34.348 -7.216  1.00 73.29  ? 35  A   A "C4'" 1 
ATOM   746  O  "O4'" . A   A 1 35 ? 66.330 32.957 -7.426  1.00 71.52  ? 35  A   A "O4'" 1 
ATOM   747  C  "C3'" . A   A 1 35 ? 66.228 34.575 -5.733  1.00 75.03  ? 35  A   A "C3'" 1 
ATOM   748  O  "O3'" . A   A 1 35 ? 65.477 35.689 -5.246  1.00 79.27  ? 35  A   A "O3'" 1 
ATOM   749  C  "C2'" . A   A 1 35 ? 65.806 33.241 -5.122  1.00 73.35  ? 35  A   A "C2'" 1 
ATOM   750  O  "O2'" . A   A 1 35 ? 64.415 33.130 -4.902  1.00 73.82  ? 35  A   A "O2'" 1 
ATOM   751  C  "C1'" . A   A 1 35 ? 66.202 32.251 -6.217  1.00 69.82  ? 35  A   A "C1'" 1 
ATOM   752  N  N9    . A   A 1 35 ? 67.458 31.568 -5.953  1.00 66.95  ? 35  A   A N9    1 
ATOM   753  C  C8    . A   A 1 35 ? 68.714 31.908 -6.382  1.00 65.90  ? 35  A   A C8    1 
ATOM   754  N  N7    . A   A 1 35 ? 69.650 31.095 -5.969  1.00 63.58  ? 35  A   A N7    1 
ATOM   755  C  C5    . A   A 1 35 ? 68.964 30.158 -5.217  1.00 64.51  ? 35  A   A C5    1 
ATOM   756  C  C6    . A   A 1 35 ? 69.394 29.030 -4.505  1.00 64.64  ? 35  A   A C6    1 
ATOM   757  N  N6    . A   A 1 35 ? 70.676 28.646 -4.442  1.00 64.41  ? 35  A   A N6    1 
ATOM   758  N  N1    . A   A 1 35 ? 68.454 28.302 -3.853  1.00 64.67  ? 35  A   A N1    1 
ATOM   759  C  C2    . A   A 1 35 ? 67.173 28.694 -3.936  1.00 64.93  ? 35  A   A C2    1 
ATOM   760  N  N3    . A   A 1 35 ? 66.650 29.737 -4.582  1.00 64.37  ? 35  A   A N3    1 
ATOM   761  C  C4    . A   A 1 35 ? 67.612 30.435 -5.203  1.00 64.99  ? 35  A   A C4    1 
ATOM   762  P  P     . A   A 1 36 ? 66.113 36.647 -4.115  1.00 81.67  ? 36  A   A P     1 
ATOM   763  O  OP1   . A   A 1 36 ? 65.045 37.623 -3.738  1.00 81.59  ? 36  A   A OP1   1 
ATOM   764  O  OP2   . A   A 1 36 ? 67.432 37.156 -4.600  1.00 82.66  ? 36  A   A OP2   1 
ATOM   765  O  "O5'" . A   A 1 36 ? 66.374 35.639 -2.911  1.00 83.98  ? 36  A   A "O5'" 1 
ATOM   766  C  "C5'" . A   A 1 36 ? 65.302 34.813 -2.451  1.00 87.71  ? 36  A   A "C5'" 1 
ATOM   767  C  "C4'" . A   A 1 36 ? 65.801 33.698 -1.565  1.00 90.67  ? 36  A   A "C4'" 1 
ATOM   768  O  "O4'" . A   A 1 36 ? 66.568 32.696 -2.288  1.00 89.82  ? 36  A   A "O4'" 1 
ATOM   769  C  "C3'" . A   A 1 36 ? 66.712 33.999 -0.388  1.00 92.78  ? 36  A   A "C3'" 1 
ATOM   770  O  "O3'" . A   A 1 36 ? 66.031 34.644 0.701   1.00 97.07  ? 36  A   A "O3'" 1 
ATOM   771  C  "C2'" . A   A 1 36 ? 67.162 32.587 0.010   1.00 91.11  ? 36  A   A "C2'" 1 
ATOM   772  O  "O2'" . A   A 1 36 ? 66.278 31.932 0.896   1.00 92.17  ? 36  A   A "O2'" 1 
ATOM   773  C  "C1'" . A   A 1 36 ? 67.143 31.833 -1.328  1.00 88.90  ? 36  A   A "C1'" 1 
ATOM   774  N  N9    . A   A 1 36 ? 68.488 31.414 -1.719  1.00 85.94  ? 36  A   A N9    1 
ATOM   775  C  C8    . A   A 1 36 ? 69.437 32.000 -2.530  1.00 84.74  ? 36  A   A C8    1 
ATOM   776  N  N7    . A   A 1 36 ? 70.588 31.361 -2.537  1.00 83.82  ? 36  A   A N7    1 
ATOM   777  C  C5    . A   A 1 36 ? 70.369 30.267 -1.700  1.00 84.29  ? 36  A   A C5    1 
ATOM   778  C  C6    . A   A 1 36 ? 71.195 29.192 -1.278  1.00 84.05  ? 36  A   A C6    1 
ATOM   779  N  N6    . A   A 1 36 ? 72.462 29.017 -1.673  1.00 85.59  ? 36  A   A N6    1 
ATOM   780  N  N1    . A   A 1 36 ? 70.658 28.283 -0.430  1.00 83.44  ? 36  A   A N1    1 
ATOM   781  C  C2    . A   A 1 36 ? 69.385 28.429 -0.052  1.00 82.14  ? 36  A   A C2    1 
ATOM   782  N  N3    . A   A 1 36 ? 68.512 29.376 -0.383  1.00 82.89  ? 36  A   A N3    1 
ATOM   783  C  C4    . A   A 1 36 ? 69.074 30.277 -1.213  1.00 84.44  ? 36  A   A C4    1 
HETATM 784  P  P     . YYG A 1 37 ? 66.875 35.460 1.815   1.00 99.01  ? 37  YYG A P     1 
HETATM 785  O  OP1   . YYG A 1 37 ? 65.932 36.421 2.473   1.00 99.27  ? 37  YYG A OP1   1 
HETATM 786  O  OP2   . YYG A 1 37 ? 68.123 35.981 1.180   1.00 99.22  ? 37  YYG A OP2   1 
HETATM 787  O  "O5'" . YYG A 1 37 ? 67.311 34.330 2.856   1.00 96.96  ? 37  YYG A "O5'" 1 
HETATM 788  C  "C5'" . YYG A 1 37 ? 66.323 33.509 3.519   1.00 95.27  ? 37  YYG A "C5'" 1 
HETATM 789  C  "C4'" . YYG A 1 37 ? 66.976 32.279 4.107   1.00 94.30  ? 37  YYG A "C4'" 1 
HETATM 790  O  "O4'" . YYG A 1 37 ? 67.424 31.399 3.039   1.00 94.11  ? 37  YYG A "O4'" 1 
HETATM 791  C  "C3'" . YYG A 1 37 ? 68.238 32.545 4.908   1.00 94.74  ? 37  YYG A "C3'" 1 
HETATM 792  O  "O3'" . YYG A 1 37 ? 68.016 32.978 6.242   1.00 95.58  ? 37  YYG A "O3'" 1 
HETATM 793  C  "C2'" . YYG A 1 37 ? 68.983 31.220 4.830   1.00 94.21  ? 37  YYG A "C2'" 1 
HETATM 794  O  "O2'" . YYG A 1 37 ? 68.545 30.264 5.774   1.00 94.06  ? 37  YYG A "O2'" 1 
HETATM 795  C  "C1'" . YYG A 1 37 ? 68.645 30.761 3.410   1.00 93.08  ? 37  YYG A "C1'" 1 
HETATM 796  N  N9    . YYG A 1 37 ? 69.698 31.144 2.464   1.00 90.90  ? 37  YYG A N9    1 
HETATM 797  C  C8    . YYG A 1 37 ? 69.640 32.153 1.532   1.00 89.85  ? 37  YYG A C8    1 
HETATM 798  N  N7    . YYG A 1 37 ? 70.739 32.287 0.844   1.00 89.86  ? 37  YYG A N7    1 
HETATM 799  C  C5    . YYG A 1 37 ? 71.580 31.301 1.340   1.00 89.89  ? 37  YYG A C5    1 
HETATM 800  C  C6    . YYG A 1 37 ? 72.913 30.962 0.974   1.00 90.32  ? 37  YYG A C6    1 
HETATM 801  O  O6    . YYG A 1 37 ? 73.618 31.473 0.097   1.00 89.77  ? 37  YYG A O6    1 
HETATM 802  N  N1    . YYG A 1 37 ? 73.405 29.912 1.754   1.00 91.04  ? 37  YYG A N1    1 
HETATM 803  C  C2    . YYG A 1 37 ? 72.723 29.290 2.751   1.00 90.80  ? 37  YYG A C2    1 
HETATM 804  N  N2    . YYG A 1 37 ? 73.444 28.355 3.405   1.00 90.89  ? 37  YYG A N2    1 
HETATM 805  N  N3    . YYG A 1 37 ? 71.471 29.563 3.082   1.00 90.20  ? 37  YYG A N3    1 
HETATM 806  C  C3    . YYG A 1 37 ? 70.758 28.811 4.134   1.00 89.88  ? 37  YYG A C3    1 
HETATM 807  C  C4    . YYG A 1 37 ? 70.959 30.583 2.344   1.00 90.19  ? 37  YYG A C4    1 
HETATM 808  C  C10   . YYG A 1 37 ? 75.897 27.876 3.472   1.00 91.27  ? 37  YYG A C10   1 
HETATM 809  C  C11   . YYG A 1 37 ? 74.717 28.526 2.928   1.00 92.18  ? 37  YYG A C11   1 
HETATM 810  C  C12   . YYG A 1 37 ? 74.703 29.466 1.794   1.00 92.82  ? 37  YYG A C12   1 
HETATM 811  C  C13   . YYG A 1 37 ? 75.894 29.679 0.821   1.00 95.17  ? 37  YYG A C13   1 
HETATM 812  C  C14   . YYG A 1 37 ? 75.821 28.497 -0.184  1.00 98.02  ? 37  YYG A C14   1 
HETATM 813  C  C15   . YYG A 1 37 ? 76.173 28.762 -1.668  1.00 99.84  ? 37  YYG A C15   1 
HETATM 814  C  C16   . YYG A 1 37 ? 75.991 27.380 -2.269  1.00 99.97  ? 37  YYG A C16   1 
HETATM 815  O  O17   . YYG A 1 37 ? 74.838 26.920 -2.376  1.00 100.19 ? 37  YYG A O17   1 
HETATM 816  O  O18   . YYG A 1 37 ? 76.976 26.693 -2.657  1.00 100.19 ? 37  YYG A O18   1 
HETATM 817  C  C19   . YYG A 1 37 ? 77.769 27.170 -3.764  1.00 99.79  ? 37  YYG A C19   1 
HETATM 818  N  N20   . YYG A 1 37 ? 75.234 29.792 -2.267  1.00 100.19 ? 37  YYG A N20   1 
HETATM 819  C  C21   . YYG A 1 37 ? 75.173 30.151 -3.610  1.00 100.19 ? 37  YYG A C21   1 
HETATM 820  O  O22   . YYG A 1 37 ? 74.112 30.084 -4.264  1.00 100.19 ? 37  YYG A O22   1 
HETATM 821  O  O23   . YYG A 1 37 ? 76.221 30.547 -4.170  1.00 100.19 ? 37  YYG A O23   1 
HETATM 822  C  C24   . YYG A 1 37 ? 76.863 31.711 -3.637  1.00 99.34  ? 37  YYG A C24   1 
ATOM   823  P  P     . A   A 1 38 ? 69.075 33.984 6.915   1.00 95.95  ? 38  A   A P     1 
ATOM   824  O  OP1   . A   A 1 38 ? 68.607 34.325 8.279   1.00 96.86  ? 38  A   A OP1   1 
ATOM   825  O  OP2   . A   A 1 38 ? 69.344 35.071 5.940   1.00 96.06  ? 38  A   A OP2   1 
ATOM   826  O  "O5'" . A   A 1 38 ? 70.393 33.112 7.051   1.00 93.01  ? 38  A   A "O5'" 1 
ATOM   827  C  "C5'" . A   A 1 38 ? 70.417 31.929 7.859   1.00 91.33  ? 38  A   A "C5'" 1 
ATOM   828  C  "C4'" . A   A 1 38 ? 71.783 31.310 7.804   1.00 90.73  ? 38  A   A "C4'" 1 
ATOM   829  O  "O4'" . A   A 1 38 ? 72.019 30.786 6.472   1.00 89.61  ? 38  A   A "O4'" 1 
ATOM   830  C  "C3'" . A   A 1 38 ? 72.876 32.339 8.008   1.00 90.95  ? 38  A   A "C3'" 1 
ATOM   831  O  "O3'" . A   A 1 38 ? 73.107 32.623 9.369   1.00 92.09  ? 38  A   A "O3'" 1 
ATOM   832  C  "C2'" . A   A 1 38 ? 74.046 31.768 7.218   1.00 90.07  ? 38  A   A "C2'" 1 
ATOM   833  O  "O2'" . A   A 1 38 ? 74.791 30.775 7.903   1.00 89.63  ? 38  A   A "O2'" 1 
ATOM   834  C  "C1'" . A   A 1 38 ? 73.308 31.178 6.015   1.00 88.20  ? 38  A   A "C1'" 1 
ATOM   835  N  N9    . A   A 1 38 ? 73.101 32.188 4.971   1.00 84.93  ? 38  A   A N9    1 
ATOM   836  C  C8    . A   A 1 38 ? 71.911 32.814 4.660   1.00 83.84  ? 38  A   A C8    1 
ATOM   837  N  N7    . A   A 1 38 ? 72.004 33.675 3.679   1.00 82.59  ? 38  A   A N7    1 
ATOM   838  C  C5    . A   A 1 38 ? 73.344 33.617 3.312   1.00 82.67  ? 38  A   A C5    1 
ATOM   839  C  C6    . A   A 1 38 ? 74.081 34.292 2.315   1.00 81.67  ? 38  A   A C6    1 
ATOM   840  N  N6    . A   A 1 38 ? 73.539 35.181 1.471   1.00 80.44  ? 38  A   A N6    1 
ATOM   841  N  N1    . A   A 1 38 ? 75.404 34.015 2.214   1.00 80.84  ? 38  A   A N1    1 
ATOM   842  C  C2    . A   A 1 38 ? 75.938 33.108 3.055   1.00 81.31  ? 38  A   A C2    1 
ATOM   843  N  N3    . A   A 1 38 ? 75.346 32.402 4.026   1.00 82.09  ? 38  A   A N3    1 
ATOM   844  C  C4    . A   A 1 38 ? 74.035 32.708 4.104   1.00 83.08  ? 38  A   A C4    1 
HETATM 845  N  N1    . PSU A 1 39 ? 74.080 36.066 5.459   1.00 75.82  ? 39  PSU A N1    1 
HETATM 846  C  C2    . PSU A 1 39 ? 74.415 36.835 4.354   1.00 75.59  ? 39  PSU A C2    1 
HETATM 847  N  N3    . PSU A 1 39 ? 75.735 36.769 3.984   1.00 76.29  ? 39  PSU A N3    1 
HETATM 848  C  C4    . PSU A 1 39 ? 76.728 36.038 4.591   1.00 77.28  ? 39  PSU A C4    1 
HETATM 849  C  C5    . PSU A 1 39 ? 76.307 35.280 5.732   1.00 77.93  ? 39  PSU A C5    1 
HETATM 850  C  C6    . PSU A 1 39 ? 75.025 35.316 6.112   1.00 76.07  ? 39  PSU A C6    1 
HETATM 851  O  O2    . PSU A 1 39 ? 73.605 37.525 3.749   1.00 75.80  ? 39  PSU A O2    1 
HETATM 852  O  O4    . PSU A 1 39 ? 77.875 36.079 4.134   1.00 77.81  ? 39  PSU A O4    1 
HETATM 853  C  "C1'" . PSU A 1 39 ? 77.325 34.455 6.488   1.00 79.85  ? 39  PSU A "C1'" 1 
HETATM 854  C  "C2'" . PSU A 1 39 ? 78.240 35.315 7.366   1.00 80.79  ? 39  PSU A "C2'" 1 
HETATM 855  O  "O2'" . PSU A 1 39 ? 79.550 34.775 7.399   1.00 79.82  ? 39  PSU A "O2'" 1 
HETATM 856  C  "C3'" . PSU A 1 39 ? 77.509 35.235 8.700   1.00 81.32  ? 39  PSU A "C3'" 1 
HETATM 857  C  "C4'" . PSU A 1 39 ? 77.034 33.800 8.726   1.00 83.30  ? 39  PSU A "C4'" 1 
HETATM 858  O  "O3'" . PSU A 1 39 ? 78.312 35.525 9.823   1.00 80.38  ? 39  PSU A "O3'" 1 
HETATM 859  O  "O4'" . PSU A 1 39 ? 76.648 33.545 7.349   1.00 81.10  ? 39  PSU A "O4'" 1 
HETATM 860  C  "C5'" . PSU A 1 39 ? 75.867 33.557 9.646   1.00 86.38  ? 39  PSU A "C5'" 1 
HETATM 861  O  "O5'" . PSU A 1 39 ? 74.796 34.470 9.341   1.00 90.31  ? 39  PSU A "O5'" 1 
HETATM 862  P  P     . PSU A 1 39 ? 73.308 34.151 9.814   1.00 92.76  ? 39  PSU A P     1 
HETATM 863  O  OP1   . PSU A 1 39 ? 73.270 34.200 11.303  1.00 93.12  ? 39  PSU A OP1   1 
HETATM 864  O  OP2   . PSU A 1 39 ? 72.370 34.998 9.024   1.00 92.11  ? 39  PSU A OP2   1 
HETATM 865  P  P     . 5MC A 1 40 ? 78.152 36.942 10.553  1.00 79.24  ? 40  5MC A P     1 
HETATM 866  O  OP1   . 5MC A 1 40 ? 79.021 36.942 11.759  1.00 78.31  ? 40  5MC A OP1   1 
HETATM 867  O  OP2   . 5MC A 1 40 ? 76.685 37.167 10.693  1.00 80.02  ? 40  5MC A OP2   1 
HETATM 868  O  "O5'" . 5MC A 1 40 ? 78.720 37.994 9.494   1.00 76.52  ? 40  5MC A "O5'" 1 
HETATM 869  C  "C5'" . 5MC A 1 40 ? 80.116 38.022 9.141   1.00 72.60  ? 40  5MC A "C5'" 1 
HETATM 870  C  "C4'" . 5MC A 1 40 ? 80.351 38.970 7.985   1.00 69.92  ? 40  5MC A "C4'" 1 
HETATM 871  O  "O4'" . 5MC A 1 40 ? 79.612 38.525 6.814   1.00 68.54  ? 40  5MC A "O4'" 1 
HETATM 872  C  "C3'" . 5MC A 1 40 ? 79.877 40.397 8.200   1.00 68.47  ? 40  5MC A "C3'" 1 
HETATM 873  O  "O3'" . 5MC A 1 40 ? 80.825 41.181 8.913   1.00 66.73  ? 40  5MC A "O3'" 1 
HETATM 874  C  "C2'" . 5MC A 1 40 ? 79.663 40.906 6.778   1.00 69.16  ? 40  5MC A "C2'" 1 
HETATM 875  O  "O2'" . 5MC A 1 40 ? 80.841 41.385 6.165   1.00 68.77  ? 40  5MC A "O2'" 1 
HETATM 876  C  "C1'" . 5MC A 1 40 ? 79.168 39.648 6.065   1.00 67.58  ? 40  5MC A "C1'" 1 
HETATM 877  N  N1    . 5MC A 1 40 ? 77.695 39.634 6.019   1.00 65.59  ? 40  5MC A N1    1 
HETATM 878  C  C2    . 5MC A 1 40 ? 77.041 40.408 5.050   1.00 63.72  ? 40  5MC A C2    1 
HETATM 879  O  O2    . 5MC A 1 40 ? 77.718 41.074 4.247   1.00 61.25  ? 40  5MC A O2    1 
HETATM 880  N  N3    . 5MC A 1 40 ? 75.695 40.421 5.017   1.00 63.28  ? 40  5MC A N3    1 
HETATM 881  C  C4    . 5MC A 1 40 ? 74.995 39.705 5.898   1.00 62.84  ? 40  5MC A C4    1 
HETATM 882  N  N4    . 5MC A 1 40 ? 73.662 39.740 5.803   1.00 62.95  ? 40  5MC A N4    1 
HETATM 883  C  C5    . 5MC A 1 40 ? 75.630 38.920 6.903   1.00 63.44  ? 40  5MC A C5    1 
HETATM 884  C  C6    . 5MC A 1 40 ? 76.968 38.900 6.919   1.00 64.81  ? 40  5MC A C6    1 
HETATM 885  C  CM5   . 5MC A 1 40 ? 74.837 38.153 7.923   1.00 63.46  ? 40  5MC A CM5   1 
ATOM   886  P  P     . U   A 1 41 ? 80.313 42.447 9.767   1.00 63.29  ? 41  U   A P     1 
ATOM   887  O  OP1   . U   A 1 41 ? 81.427 42.965 10.609  1.00 65.66  ? 41  U   A OP1   1 
ATOM   888  O  OP2   . U   A 1 41 ? 79.049 42.016 10.412  1.00 63.65  ? 41  U   A OP2   1 
ATOM   889  O  "O5'" . U   A 1 41 ? 79.984 43.552 8.669   1.00 62.24  ? 41  U   A "O5'" 1 
ATOM   890  C  "C5'" . U   A 1 41 ? 81.036 44.143 7.918   1.00 56.79  ? 41  U   A "C5'" 1 
ATOM   891  C  "C4'" . U   A 1 41 ? 80.498 45.168 6.953   1.00 56.45  ? 41  U   A "C4'" 1 
ATOM   892  O  "O4'" . U   A 1 41 ? 79.680 44.526 5.942   1.00 53.37  ? 41  U   A "O4'" 1 
ATOM   893  C  "C3'" . U   A 1 41 ? 79.592 46.251 7.508   1.00 54.69  ? 41  U   A "C3'" 1 
ATOM   894  O  "O3'" . U   A 1 41 ? 80.283 47.292 8.160   1.00 55.80  ? 41  U   A "O3'" 1 
ATOM   895  C  "C2'" . U   A 1 41 ? 78.887 46.737 6.251   1.00 52.98  ? 41  U   A "C2'" 1 
ATOM   896  O  "O2'" . U   A 1 41 ? 79.686 47.539 5.407   1.00 54.28  ? 41  U   A "O2'" 1 
ATOM   897  C  "C1'" . U   A 1 41 ? 78.651 45.424 5.527   1.00 49.85  ? 41  U   A "C1'" 1 
ATOM   898  N  N1    . U   A 1 41 ? 77.358 44.851 5.928   1.00 45.19  ? 41  U   A N1    1 
ATOM   899  C  C2    . U   A 1 41 ? 76.197 45.430 5.430   1.00 41.52  ? 41  U   A C2    1 
ATOM   900  O  O2    . U   A 1 41 ? 76.190 46.418 4.723   1.00 42.41  ? 41  U   A O2    1 
ATOM   901  N  N3    . U   A 1 41 ? 75.046 44.808 5.803   1.00 41.65  ? 41  U   A N3    1 
ATOM   902  C  C4    . U   A 1 41 ? 74.928 43.710 6.596   1.00 40.75  ? 41  U   A C4    1 
ATOM   903  O  O4    . U   A 1 41 ? 73.826 43.203 6.735   1.00 49.24  ? 41  U   A O4    1 
ATOM   904  C  C5    . U   A 1 41 ? 76.154 43.186 7.099   1.00 43.67  ? 41  U   A C5    1 
ATOM   905  C  C6    . U   A 1 41 ? 77.302 43.767 6.753   1.00 41.90  ? 41  U   A C6    1 
ATOM   906  P  P     . G   A 1 42 ? 79.705 47.861 9.545   1.00 53.54  ? 42  G   A P     1 
ATOM   907  O  OP1   . G   A 1 42 ? 80.846 48.577 10.148  1.00 56.88  ? 42  G   A OP1   1 
ATOM   908  O  OP2   . G   A 1 42 ? 79.060 46.769 10.292  1.00 47.65  ? 42  G   A OP2   1 
ATOM   909  O  "O5'" . G   A 1 42 ? 78.638 48.930 9.059   1.00 51.64  ? 42  G   A "O5'" 1 
ATOM   910  C  "C5'" . G   A 1 42 ? 79.001 49.877 8.054   1.00 51.41  ? 42  G   A "C5'" 1 
ATOM   911  C  "C4'" . G   A 1 42 ? 77.769 50.433 7.372   1.00 54.00  ? 42  G   A "C4'" 1 
ATOM   912  O  "O4'" . G   A 1 42 ? 77.032 49.365 6.704   1.00 51.14  ? 42  G   A "O4'" 1 
ATOM   913  C  "C3'" . G   A 1 42 ? 76.726 51.067 8.272   1.00 53.82  ? 42  G   A "C3'" 1 
ATOM   914  O  "O3'" . G   A 1 42 ? 77.060 52.389 8.660   1.00 57.90  ? 42  G   A "O3'" 1 
ATOM   915  C  "C2'" . G   A 1 42 ? 75.480 51.029 7.397   1.00 53.12  ? 42  G   A "C2'" 1 
ATOM   916  O  "O2'" . G   A 1 42 ? 75.444 52.122 6.489   1.00 55.26  ? 42  G   A "O2'" 1 
ATOM   917  C  "C1'" . G   A 1 42 ? 75.657 49.688 6.671   1.00 49.13  ? 42  G   A "C1'" 1 
ATOM   918  N  N9    . G   A 1 42 ? 74.906 48.601 7.302   1.00 44.46  ? 42  G   A N9    1 
ATOM   919  C  C8    . G   A 1 42 ? 75.381 47.535 8.030   1.00 41.11  ? 42  G   A C8    1 
ATOM   920  N  N7    . G   A 1 42 ? 74.431 46.730 8.433   1.00 41.58  ? 42  G   A N7    1 
ATOM   921  C  C5    . G   A 1 42 ? 73.265 47.311 7.951   1.00 42.30  ? 42  G   A C5    1 
ATOM   922  C  C6    . G   A 1 42 ? 71.901 46.887 8.049   1.00 39.56  ? 42  G   A C6    1 
ATOM   923  O  O6    . G   A 1 42 ? 71.457 45.892 8.572   1.00 41.46  ? 42  G   A O6    1 
ATOM   924  N  N1    . G   A 1 42 ? 71.044 47.776 7.421   1.00 40.73  ? 42  G   A N1    1 
ATOM   925  C  C2    . G   A 1 42 ? 71.439 48.906 6.760   1.00 39.14  ? 42  G   A C2    1 
ATOM   926  N  N2    . G   A 1 42 ? 70.481 49.648 6.204   1.00 43.75  ? 42  G   A N2    1 
ATOM   927  N  N3    . G   A 1 42 ? 72.696 49.297 6.643   1.00 42.69  ? 42  G   A N3    1 
ATOM   928  C  C4    . G   A 1 42 ? 73.544 48.463 7.263   1.00 41.15  ? 42  G   A C4    1 
ATOM   929  P  P     . G   A 1 43 ? 76.348 53.024 9.953   1.00 59.25  ? 43  G   A P     1 
ATOM   930  O  OP1   . G   A 1 43 ? 76.997 54.350 10.246  1.00 56.83  ? 43  G   A OP1   1 
ATOM   931  O  OP2   . G   A 1 43 ? 76.330 51.946 10.985  1.00 53.33  ? 43  G   A OP2   1 
ATOM   932  O  "O5'" . G   A 1 43 ? 74.844 53.245 9.472   1.00 55.31  ? 43  G   A "O5'" 1 
ATOM   933  C  "C5'" . G   A 1 43 ? 74.543 54.211 8.454   1.00 54.14  ? 43  G   A "C5'" 1 
ATOM   934  C  "C4'" . G   A 1 43 ? 73.059 54.264 8.204   1.00 51.95  ? 43  G   A "C4'" 1 
ATOM   935  O  "O4'" . G   A 1 43 ? 72.595 52.976 7.736   1.00 49.20  ? 43  G   A "O4'" 1 
ATOM   936  C  "C3'" . G   A 1 43 ? 72.190 54.541 9.414   1.00 53.09  ? 43  G   A "C3'" 1 
ATOM   937  O  "O3'" . G   A 1 43 ? 72.143 55.927 9.696   1.00 58.30  ? 43  G   A "O3'" 1 
ATOM   938  C  "C2'" . G   A 1 43 ? 70.852 53.982 8.963   1.00 50.69  ? 43  G   A "C2'" 1 
ATOM   939  O  "O2'" . G   A 1 43 ? 70.277 54.842 8.008   1.00 55.19  ? 43  G   A "O2'" 1 
ATOM   940  C  "C1'" . G   A 1 43 ? 71.295 52.730 8.219   1.00 46.94  ? 43  G   A "C1'" 1 
ATOM   941  N  N9    . G   A 1 43 ? 71.350 51.546 9.071   1.00 44.87  ? 43  G   A N9    1 
ATOM   942  C  C8    . G   A 1 43 ? 72.451 50.993 9.658   1.00 41.57  ? 43  G   A C8    1 
ATOM   943  N  N7    . G   A 1 43 ? 72.182 49.898 10.321  1.00 41.08  ? 43  G   A N7    1 
ATOM   944  C  C5    . G   A 1 43 ? 70.826 49.729 10.161  1.00 40.57  ? 43  G   A C5    1 
ATOM   945  C  C6    . G   A 1 43 ? 69.965 48.713 10.615  1.00 40.78  ? 43  G   A C6    1 
ATOM   946  O  O6    . G   A 1 43 ? 70.230 47.688 11.221  1.00 38.22  ? 43  G   A O6    1 
ATOM   947  N  N1    . G   A 1 43 ? 68.652 48.964 10.259  1.00 41.30  ? 43  G   A N1    1 
ATOM   948  C  C2    . G   A 1 43 ? 68.217 50.037 9.555   1.00 42.51  ? 43  G   A C2    1 
ATOM   949  N  N2    . G   A 1 43 ? 66.869 50.119 9.354   1.00 42.42  ? 43  G   A N2    1 
ATOM   950  N  N3    . G   A 1 43 ? 69.008 50.969 9.090   1.00 44.65  ? 43  G   A N3    1 
ATOM   951  C  C4    . G   A 1 43 ? 70.291 50.756 9.425   1.00 44.20  ? 43  G   A C4    1 
ATOM   952  P  P     . A   A 1 44 ? 71.830 56.434 11.191  1.00 59.72  ? 44  A   A P     1 
ATOM   953  O  OP1   . A   A 1 44 ? 72.143 57.887 11.179  1.00 60.18  ? 44  A   A OP1   1 
ATOM   954  O  OP2   . A   A 1 44 ? 72.477 55.542 12.203  1.00 59.03  ? 44  A   A OP2   1 
ATOM   955  O  "O5'" . A   A 1 44 ? 70.251 56.220 11.341  1.00 61.19  ? 44  A   A "O5'" 1 
ATOM   956  C  "C5'" . A   A 1 44 ? 69.317 56.879 10.465  1.00 59.15  ? 44  A   A "C5'" 1 
ATOM   957  C  "C4'" . A   A 1 44 ? 67.971 56.191 10.523  1.00 58.59  ? 44  A   A "C4'" 1 
ATOM   958  O  "O4'" . A   A 1 44 ? 68.135 54.794 10.173  1.00 58.70  ? 44  A   A "O4'" 1 
ATOM   959  C  "C3'" . A   A 1 44 ? 67.277 56.140 11.871  1.00 58.67  ? 44  A   A "C3'" 1 
ATOM   960  O  "O3'" . A   A 1 44 ? 66.523 57.316 12.123  1.00 60.86  ? 44  A   A "O3'" 1 
ATOM   961  C  "C2'" . A   A 1 44 ? 66.365 54.931 11.744  1.00 56.86  ? 44  A   A "C2'" 1 
ATOM   962  O  "O2'" . A   A 1 44 ? 65.162 55.206 11.061  1.00 56.94  ? 44  A   A "O2'" 1 
ATOM   963  C  "C1'" . A   A 1 44 ? 67.208 53.996 10.887  1.00 54.14  ? 44  A   A "C1'" 1 
ATOM   964  N  N9    . A   A 1 44 ? 67.970 53.042 11.685  1.00 47.88  ? 44  A   A N9    1 
ATOM   965  C  C8    . A   A 1 44 ? 69.290 53.122 12.063  1.00 44.83  ? 44  A   A C8    1 
ATOM   966  N  N7    . A   A 1 44 ? 69.697 52.091 12.767  1.00 43.37  ? 44  A   A N7    1 
ATOM   967  C  C5    . A   A 1 44 ? 68.570 51.276 12.856  1.00 41.45  ? 44  A   A C5    1 
ATOM   968  C  C6    . A   A 1 44 ? 68.345 50.029 13.433  1.00 42.09  ? 44  A   A C6    1 
ATOM   969  N  N6    . A   A 1 44 ? 69.278 49.331 14.092  1.00 45.08  ? 44  A   A N6    1 
ATOM   970  N  N1    . A   A 1 44 ? 67.101 49.482 13.313  1.00 42.78  ? 44  A   A N1    1 
ATOM   971  C  C2    . A   A 1 44 ? 66.176 50.170 12.653  1.00 41.91  ? 44  A   A C2    1 
ATOM   972  N  N3    . A   A 1 44 ? 66.268 51.351 12.075  1.00 40.34  ? 44  A   A N3    1 
ATOM   973  C  C4    . A   A 1 44 ? 67.500 51.858 12.203  1.00 45.75  ? 44  A   A C4    1 
ATOM   974  P  P     . G   A 1 45 ? 66.470 57.914 13.620  1.00 58.58  ? 45  G   A P     1 
ATOM   975  O  OP1   . G   A 1 45 ? 65.444 58.996 13.659  1.00 60.46  ? 45  G   A OP1   1 
ATOM   976  O  OP2   . G   A 1 45 ? 67.862 58.228 14.011  1.00 57.19  ? 45  G   A OP2   1 
ATOM   977  O  "O5'" . G   A 1 45 ? 65.905 56.683 14.444  1.00 57.67  ? 45  G   A "O5'" 1 
ATOM   978  C  "C5'" . G   A 1 45 ? 64.533 56.287 14.311  1.00 52.30  ? 45  G   A "C5'" 1 
ATOM   979  C  "C4'" . G   A 1 45 ? 64.255 55.158 15.248  1.00 50.49  ? 45  G   A "C4'" 1 
ATOM   980  O  "O4'" . G   A 1 45 ? 65.017 54.002 14.829  1.00 50.44  ? 45  G   A "O4'" 1 
ATOM   981  C  "C3'" . G   A 1 45 ? 64.685 55.408 16.681  1.00 49.36  ? 45  G   A "C3'" 1 
ATOM   982  O  "O3'" . G   A 1 45 ? 63.616 56.059 17.359  1.00 51.42  ? 45  G   A "O3'" 1 
ATOM   983  C  "C2'" . G   A 1 45 ? 64.894 53.991 17.190  1.00 48.83  ? 45  G   A "C2'" 1 
ATOM   984  O  "O2'" . G   A 1 45 ? 63.645 53.382 17.453  1.00 45.60  ? 45  G   A "O2'" 1 
ATOM   985  C  "C1'" . G   A 1 45 ? 65.456 53.277 15.954  1.00 45.24  ? 45  G   A "C1'" 1 
ATOM   986  N  N9    . G   A 1 45 ? 66.920 53.202 15.909  1.00 41.15  ? 45  G   A N9    1 
ATOM   987  C  C8    . G   A 1 45 ? 67.772 54.149 15.386  1.00 40.45  ? 45  G   A C8    1 
ATOM   988  N  N7    . G   A 1 45 ? 69.031 53.833 15.507  1.00 39.19  ? 45  G   A N7    1 
ATOM   989  C  C5    . G   A 1 45 ? 69.014 52.601 16.134  1.00 35.16  ? 45  G   A C5    1 
ATOM   990  C  C6    . G   A 1 45 ? 70.070 51.816 16.551  1.00 38.09  ? 45  G   A C6    1 
ATOM   991  O  O6    . G   A 1 45 ? 71.292 52.028 16.410  1.00 39.62  ? 45  G   A O6    1 
ATOM   992  N  N1    . G   A 1 45 ? 69.636 50.685 17.196  1.00 37.05  ? 45  G   A N1    1 
ATOM   993  C  C2    . G   A 1 45 ? 68.338 50.332 17.390  1.00 38.47  ? 45  G   A C2    1 
ATOM   994  N  N2    . G   A 1 45 ? 68.164 49.150 17.996  1.00 39.48  ? 45  G   A N2    1 
ATOM   995  N  N3    . G   A 1 45 ? 67.301 51.072 17.004  1.00 37.37  ? 45  G   A N3    1 
ATOM   996  C  C4    . G   A 1 45 ? 67.719 52.193 16.390  1.00 36.46  ? 45  G   A C4    1 
HETATM 997  P  P     . 7MG A 1 46 ? 63.905 57.326 18.310  1.00 53.01  ? 46  7MG A P     1 
HETATM 998  O  OP1   . 7MG A 1 46 ? 62.558 57.883 18.619  1.00 54.84  ? 46  7MG A OP1   1 
HETATM 999  O  OP2   . 7MG A 1 46 ? 64.951 58.232 17.766  1.00 52.60  ? 46  7MG A OP2   1 
HETATM 1000 O  "O5'" . 7MG A 1 46 ? 64.457 56.673 19.662  1.00 50.92  ? 46  7MG A "O5'" 1 
HETATM 1001 C  "C5'" . 7MG A 1 46 ? 63.673 55.697 20.380  1.00 47.09  ? 46  7MG A "C5'" 1 
HETATM 1002 C  "C4'" . 7MG A 1 46 ? 63.911 55.833 21.859  1.00 45.87  ? 46  7MG A "C4'" 1 
HETATM 1003 O  "O4'" . 7MG A 1 46 ? 65.276 55.388 22.160  1.00 44.37  ? 46  7MG A "O4'" 1 
HETATM 1004 C  "C3'" . 7MG A 1 46 ? 63.810 57.269 22.378  1.00 44.64  ? 46  7MG A "C3'" 1 
HETATM 1005 O  "O3'" . 7MG A 1 46 ? 63.177 57.259 23.652  1.00 47.38  ? 46  7MG A "O3'" 1 
HETATM 1006 C  "C2'" . 7MG A 1 46 ? 65.280 57.700 22.484  1.00 44.78  ? 46  7MG A "C2'" 1 
HETATM 1007 O  "O2'" . 7MG A 1 46 ? 65.577 58.744 23.387  1.00 43.73  ? 46  7MG A "O2'" 1 
HETATM 1008 C  "C1'" . 7MG A 1 46 ? 65.949 56.384 22.900  1.00 39.69  ? 46  7MG A "C1'" 1 
HETATM 1009 N  N9    . 7MG A 1 46 ? 67.386 56.266 22.628  1.00 35.94  ? 46  7MG A N9    1 
HETATM 1010 C  C8    . 7MG A 1 46 ? 68.201 57.146 21.945  1.00 35.57  ? 46  7MG A C8    1 
HETATM 1011 N  N7    . 7MG A 1 46 ? 69.429 56.680 21.823  1.00 35.71  ? 46  7MG A N7    1 
HETATM 1012 C  C5    . 7MG A 1 46 ? 69.423 55.456 22.475  1.00 30.85  ? 46  7MG A C5    1 
HETATM 1013 C  C6    . 7MG A 1 46 ? 70.472 54.529 22.704  1.00 32.44  ? 46  7MG A C6    1 
HETATM 1014 O  O6    . 7MG A 1 46 ? 71.653 54.665 22.404  1.00 34.18  ? 46  7MG A O6    1 
HETATM 1015 N  N1    . 7MG A 1 46 ? 70.035 53.405 23.371  1.00 27.06  ? 46  7MG A N1    1 
HETATM 1016 C  C2    . 7MG A 1 46 ? 68.726 53.216 23.821  1.00 28.72  ? 46  7MG A C2    1 
HETATM 1017 N  N2    . 7MG A 1 46 ? 68.413 52.076 24.386  1.00 30.51  ? 46  7MG A N2    1 
HETATM 1018 N  N3    . 7MG A 1 46 ? 67.782 54.113 23.692  1.00 29.24  ? 46  7MG A N3    1 
HETATM 1019 C  C4    . 7MG A 1 46 ? 68.183 55.188 22.989  1.00 30.11  ? 46  7MG A C4    1 
HETATM 1020 C  CM7   . 7MG A 1 46 ? 70.529 57.362 21.130  1.00 35.54  ? 46  7MG A CM7   1 
ATOM   1021 P  P     . U   A 1 47 ? 61.607 57.698 23.777  1.00 47.19  ? 47  U   A P     1 
ATOM   1022 O  OP1   . U   A 1 47 ? 60.804 56.464 23.970  1.00 48.54  ? 47  U   A OP1   1 
ATOM   1023 O  OP2   . U   A 1 47 ? 61.264 58.639 22.661  1.00 50.14  ? 47  U   A OP2   1 
ATOM   1024 O  "O5'" . U   A 1 47 ? 61.587 58.598 25.089  1.00 45.96  ? 47  U   A "O5'" 1 
ATOM   1025 C  "C5'" . U   A 1 47 ? 62.341 59.800 25.124  1.00 48.85  ? 47  U   A "C5'" 1 
ATOM   1026 C  "C4'" . U   A 1 47 ? 62.482 60.255 26.545  1.00 50.43  ? 47  U   A "C4'" 1 
ATOM   1027 O  "O4'" . U   A 1 47 ? 61.241 60.814 27.040  1.00 50.06  ? 47  U   A "O4'" 1 
ATOM   1028 C  "C3'" . U   A 1 47 ? 62.833 59.116 27.493  1.00 49.46  ? 47  U   A "C3'" 1 
ATOM   1029 O  "O3'" . U   A 1 47 ? 63.658 59.705 28.465  1.00 50.38  ? 47  U   A "O3'" 1 
ATOM   1030 C  "C2'" . U   A 1 47 ? 61.488 58.710 28.088  1.00 48.84  ? 47  U   A "C2'" 1 
ATOM   1031 O  "O2'" . U   A 1 47 ? 61.620 58.065 29.342  1.00 41.07  ? 47  U   A "O2'" 1 
ATOM   1032 C  "C1'" . U   A 1 47 ? 60.798 60.075 28.167  1.00 50.55  ? 47  U   A "C1'" 1 
ATOM   1033 N  N1    . U   A 1 47 ? 59.332 60.087 28.149  1.00 54.98  ? 47  U   A N1    1 
ATOM   1034 C  C2    . U   A 1 47 ? 58.686 60.797 29.157  1.00 56.81  ? 47  U   A C2    1 
ATOM   1035 O  O2    . U   A 1 47 ? 59.281 61.400 30.035  1.00 56.24  ? 47  U   A O2    1 
ATOM   1036 N  N3    . U   A 1 47 ? 57.319 60.784 29.079  1.00 58.14  ? 47  U   A N3    1 
ATOM   1037 C  C4    . U   A 1 47 ? 56.552 60.165 28.123  1.00 58.07  ? 47  U   A C4    1 
ATOM   1038 O  O4    . U   A 1 47 ? 55.332 60.325 28.140  1.00 59.44  ? 47  U   A O4    1 
ATOM   1039 C  C5    . U   A 1 47 ? 57.289 59.452 27.121  1.00 57.49  ? 47  U   A C5    1 
ATOM   1040 C  C6    . U   A 1 47 ? 58.613 59.436 27.164  1.00 55.97  ? 47  U   A C6    1 
ATOM   1041 P  P     . C   A 1 48 ? 65.235 59.648 28.260  1.00 51.91  ? 48  C   A P     1 
ATOM   1042 O  OP1   . C   A 1 48 ? 65.823 60.627 29.208  1.00 48.27  ? 48  C   A OP1   1 
ATOM   1043 O  OP2   . C   A 1 48 ? 65.455 59.769 26.780  1.00 53.23  ? 48  C   A OP2   1 
ATOM   1044 O  "O5'" . C   A 1 48 ? 65.585 58.155 28.696  1.00 48.16  ? 48  C   A "O5'" 1 
ATOM   1045 C  "C5'" . C   A 1 48 ? 65.553 57.821 30.068  1.00 37.25  ? 48  C   A "C5'" 1 
ATOM   1046 C  "C4'" . C   A 1 48 ? 66.046 56.424 30.251  1.00 33.96  ? 48  C   A "C4'" 1 
ATOM   1047 O  "O4'" . C   A 1 48 ? 67.242 56.203 29.430  1.00 33.29  ? 48  C   A "O4'" 1 
ATOM   1048 C  "C3'" . C   A 1 48 ? 66.457 56.168 31.682  1.00 32.27  ? 48  C   A "C3'" 1 
ATOM   1049 O  "O3'" . C   A 1 48 ? 66.149 54.821 32.011  1.00 29.89  ? 48  C   A "O3'" 1 
ATOM   1050 C  "C2'" . C   A 1 48 ? 67.972 56.366 31.634  1.00 27.98  ? 48  C   A "C2'" 1 
ATOM   1051 O  "O2'" . C   A 1 48 ? 68.646 55.696 32.665  1.00 27.27  ? 48  C   A "O2'" 1 
ATOM   1052 C  "C1'" . C   A 1 48 ? 68.291 55.799 30.245  1.00 27.98  ? 48  C   A "C1'" 1 
ATOM   1053 N  N1    . C   A 1 48 ? 69.554 56.279 29.660  1.00 23.61  ? 48  C   A N1    1 
ATOM   1054 C  C2    . C   A 1 48 ? 70.690 55.421 29.693  1.00 24.90  ? 48  C   A C2    1 
ATOM   1055 O  O2    . C   A 1 48 ? 70.567 54.326 30.181  1.00 24.38  ? 48  C   A O2    1 
ATOM   1056 N  N3    . C   A 1 48 ? 71.884 55.875 29.215  1.00 23.05  ? 48  C   A N3    1 
ATOM   1057 C  C4    . C   A 1 48 ? 71.964 57.127 28.722  1.00 24.65  ? 48  C   A C4    1 
ATOM   1058 N  N4    . C   A 1 48 ? 73.163 57.592 28.288  1.00 21.79  ? 48  C   A N4    1 
ATOM   1059 C  C5    . C   A 1 48 ? 70.843 57.978 28.653  1.00 27.10  ? 48  C   A C5    1 
ATOM   1060 C  C6    . C   A 1 48 ? 69.665 57.518 29.131  1.00 23.05  ? 48  C   A C6    1 
HETATM 1061 P  P     . 5MC A 1 49 ? 65.638 54.464 33.461  1.00 31.61  ? 49  5MC A P     1 
HETATM 1062 O  OP1   . 5MC A 1 49 ? 66.252 55.251 34.624  1.00 26.54  ? 49  5MC A OP1   1 
HETATM 1063 O  OP2   . 5MC A 1 49 ? 65.643 52.989 33.540  1.00 33.43  ? 49  5MC A OP2   1 
HETATM 1064 O  "O5'" . 5MC A 1 49 ? 64.126 54.972 33.441  1.00 31.88  ? 49  5MC A "O5'" 1 
HETATM 1065 C  "C5'" . 5MC A 1 49 ? 63.204 54.605 32.392  1.00 32.68  ? 49  5MC A "C5'" 1 
HETATM 1066 C  "C4'" . 5MC A 1 49 ? 61.796 55.006 32.810  1.00 30.80  ? 49  5MC A "C4'" 1 
HETATM 1067 O  "O4'" . 5MC A 1 49 ? 61.292 54.110 33.848  1.00 32.40  ? 49  5MC A "O4'" 1 
HETATM 1068 C  "C3'" . 5MC A 1 49 ? 61.745 56.381 33.468  1.00 31.44  ? 49  5MC A "C3'" 1 
HETATM 1069 O  "O3'" . 5MC A 1 49 ? 61.666 57.398 32.483  1.00 31.25  ? 49  5MC A "O3'" 1 
HETATM 1070 C  "C2'" . 5MC A 1 49 ? 60.485 56.287 34.312  1.00 34.62  ? 49  5MC A "C2'" 1 
HETATM 1071 O  "O2'" . 5MC A 1 49 ? 59.414 56.469 33.417  1.00 35.41  ? 49  5MC A "O2'" 1 
HETATM 1072 C  "C1'" . 5MC A 1 49 ? 60.568 54.849 34.825  1.00 33.10  ? 49  5MC A "C1'" 1 
HETATM 1073 N  N1    . 5MC A 1 49 ? 61.331 54.787 36.102  1.00 32.34  ? 49  5MC A N1    1 
HETATM 1074 C  C2    . 5MC A 1 49 ? 60.737 55.340 37.271  1.00 32.42  ? 49  5MC A C2    1 
HETATM 1075 O  O2    . 5MC A 1 49 ? 59.568 55.832 37.197  1.00 28.24  ? 49  5MC A O2    1 
HETATM 1076 N  N3    . 5MC A 1 49 ? 61.420 55.348 38.428  1.00 29.50  ? 49  5MC A N3    1 
HETATM 1077 C  C4    . 5MC A 1 49 ? 62.626 54.785 38.503  1.00 32.97  ? 49  5MC A C4    1 
HETATM 1078 N  N4    . 5MC A 1 49 ? 63.188 54.744 39.702  1.00 28.75  ? 49  5MC A N4    1 
HETATM 1079 C  C5    . 5MC A 1 49 ? 63.270 54.215 37.358  1.00 34.81  ? 49  5MC A C5    1 
HETATM 1080 C  C6    . 5MC A 1 49 ? 62.583 54.243 36.161  1.00 33.69  ? 49  5MC A C6    1 
HETATM 1081 C  CM5   . 5MC A 1 49 ? 64.655 53.581 37.465  1.00 34.52  ? 49  5MC A CM5   1 
ATOM   1082 P  P     . U   A 1 50 ? 62.421 58.828 32.744  1.00 33.43  ? 50  U   A P     1 
ATOM   1083 O  OP1   . U   A 1 50 ? 62.480 59.502 31.468  1.00 33.78  ? 50  U   A OP1   1 
ATOM   1084 O  OP2   . U   A 1 50 ? 63.651 58.683 33.637  1.00 30.15  ? 50  U   A OP2   1 
ATOM   1085 O  "O5'" . U   A 1 50 ? 61.374 59.605 33.659  1.00 33.34  ? 50  U   A "O5'" 1 
ATOM   1086 C  "C5'" . U   A 1 50 ? 60.011 59.728 33.268  1.00 34.47  ? 50  U   A "C5'" 1 
ATOM   1087 C  "C4'" . U   A 1 50 ? 59.218 60.444 34.331  1.00 31.72  ? 50  U   A "C4'" 1 
ATOM   1088 O  "O4'" . U   A 1 50 ? 58.928 59.552 35.438  1.00 29.81  ? 50  U   A "O4'" 1 
ATOM   1089 C  "C3'" . U   A 1 50 ? 59.871 61.655 34.983  1.00 32.89  ? 50  U   A "C3'" 1 
ATOM   1090 O  "O3'" . U   A 1 50 ? 59.731 62.817 34.131  1.00 33.31  ? 50  U   A "O3'" 1 
ATOM   1091 C  "C2'" . U   A 1 50 ? 59.066 61.725 36.279  1.00 33.15  ? 50  U   A "C2'" 1 
ATOM   1092 O  "O2'" . U   A 1 50 ? 57.727 62.115 35.997  1.00 35.03  ? 50  U   A "O2'" 1 
ATOM   1093 C  "C1'" . U   A 1 50 ? 58.966 60.259 36.646  1.00 31.45  ? 50  U   A "C1'" 1 
ATOM   1094 N  N1    . U   A 1 50 ? 60.113 59.812 37.453  1.00 31.52  ? 50  U   A N1    1 
ATOM   1095 C  C2    . U   A 1 50 ? 60.106 60.183 38.793  1.00 30.82  ? 50  U   A C2    1 
ATOM   1096 O  O2    . U   A 1 50 ? 59.256 60.941 39.253  1.00 30.94  ? 50  U   A O2    1 
ATOM   1097 N  N3    . U   A 1 50 ? 61.128 59.648 39.560  1.00 28.21  ? 50  U   A N3    1 
ATOM   1098 C  C4    . U   A 1 50 ? 62.143 58.831 39.099  1.00 27.57  ? 50  U   A C4    1 
ATOM   1099 O  O4    . U   A 1 50 ? 62.938 58.308 39.924  1.00 33.33  ? 50  U   A O4    1 
ATOM   1100 C  C5    . U   A 1 50 ? 62.120 58.581 37.684  1.00 29.31  ? 50  U   A C5    1 
ATOM   1101 C  C6    . U   A 1 50 ? 61.140 59.068 36.927  1.00 31.19  ? 50  U   A C6    1 
ATOM   1102 P  P     . G   A 1 51 ? 60.854 63.992 34.167  1.00 39.01  ? 51  G   A P     1 
ATOM   1103 O  OP1   . G   A 1 51 ? 60.476 64.987 33.121  1.00 35.87  ? 51  G   A OP1   1 
ATOM   1104 O  OP2   . G   A 1 51 ? 62.217 63.402 34.134  1.00 37.91  ? 51  G   A OP2   1 
ATOM   1105 O  "O5'" . G   A 1 51 ? 60.648 64.595 35.600  1.00 36.58  ? 51  G   A "O5'" 1 
ATOM   1106 C  "C5'" . G   A 1 51 ? 59.391 65.231 35.906  1.00 40.92  ? 51  G   A "C5'" 1 
ATOM   1107 C  "C4'" . G   A 1 51 ? 59.365 65.668 37.334  1.00 38.83  ? 51  G   A "C4'" 1 
ATOM   1108 O  "O4'" . G   A 1 51 ? 59.409 64.501 38.203  1.00 38.03  ? 51  G   A "O4'" 1 
ATOM   1109 C  "C3'" . G   A 1 51 ? 60.529 66.527 37.797  1.00 40.34  ? 51  G   A "C3'" 1 
ATOM   1110 O  "O3'" . G   A 1 51 ? 60.383 67.887 37.400  1.00 41.89  ? 51  G   A "O3'" 1 
ATOM   1111 C  "C2'" . G   A 1 51 ? 60.488 66.292 39.298  1.00 38.39  ? 51  G   A "C2'" 1 
ATOM   1112 O  "O2'" . G   A 1 51 ? 59.369 66.938 39.873  1.00 35.78  ? 51  G   A "O2'" 1 
ATOM   1113 C  "C1'" . G   A 1 51 ? 60.143 64.799 39.378  1.00 37.87  ? 51  G   A "C1'" 1 
ATOM   1114 N  N9    . G   A 1 51 ? 61.303 63.902 39.460  1.00 32.83  ? 51  G   A N9    1 
ATOM   1115 C  C8    . G   A 1 51 ? 61.915 63.238 38.424  1.00 33.29  ? 51  G   A C8    1 
ATOM   1116 N  N7    . G   A 1 51 ? 62.917 62.483 38.830  1.00 36.76  ? 51  G   A N7    1 
ATOM   1117 C  C5    . G   A 1 51 ? 62.986 62.690 40.208  1.00 35.57  ? 51  G   A C5    1 
ATOM   1118 C  C6    . G   A 1 51 ? 63.913 62.188 41.197  1.00 34.80  ? 51  G   A C6    1 
ATOM   1119 O  O6    . G   A 1 51 ? 64.846 61.404 41.049  1.00 35.08  ? 51  G   A O6    1 
ATOM   1120 N  N1    . G   A 1 51 ? 63.653 62.706 42.466  1.00 36.79  ? 51  G   A N1    1 
ATOM   1121 C  C2    . G   A 1 51 ? 62.620 63.573 42.759  1.00 37.65  ? 51  G   A C2    1 
ATOM   1122 N  N2    . G   A 1 51 ? 62.530 63.985 44.032  1.00 35.39  ? 51  G   A N2    1 
ATOM   1123 N  N3    . G   A 1 51 ? 61.746 64.007 41.868  1.00 36.74  ? 51  G   A N3    1 
ATOM   1124 C  C4    . G   A 1 51 ? 61.996 63.548 40.619  1.00 35.55  ? 51  G   A C4    1 
ATOM   1125 P  P     . U   A 1 52 ? 61.706 68.803 37.121  1.00 42.84  ? 52  U   A P     1 
ATOM   1126 O  OP1   . U   A 1 52 ? 61.321 70.142 36.563  1.00 41.91  ? 52  U   A OP1   1 
ATOM   1127 O  OP2   . U   A 1 52 ? 62.726 68.025 36.369  1.00 41.76  ? 52  U   A OP2   1 
ATOM   1128 O  "O5'" . U   A 1 52 ? 62.224 68.978 38.598  1.00 36.07  ? 52  U   A "O5'" 1 
ATOM   1129 C  "C5'" . U   A 1 52 ? 61.477 69.672 39.558  1.00 34.35  ? 52  U   A "C5'" 1 
ATOM   1130 C  "C4'" . U   A 1 52 ? 62.118 69.559 40.905  1.00 33.37  ? 52  U   A "C4'" 1 
ATOM   1131 O  "O4'" . U   A 1 52 ? 62.012 68.190 41.401  1.00 32.65  ? 52  U   A "O4'" 1 
ATOM   1132 C  "C3'" . U   A 1 52 ? 63.616 69.845 41.000  1.00 33.39  ? 52  U   A "C3'" 1 
ATOM   1133 O  "O3'" . U   A 1 52 ? 63.932 71.237 41.043  1.00 39.74  ? 52  U   A "O3'" 1 
ATOM   1134 C  "C2'" . U   A 1 52 ? 63.939 69.176 42.335  1.00 30.75  ? 52  U   A "C2'" 1 
ATOM   1135 O  "O2'" . U   A 1 52 ? 63.396 69.967 43.391  1.00 32.96  ? 52  U   A "O2'" 1 
ATOM   1136 C  "C1'" . U   A 1 52 ? 63.119 67.888 42.237  1.00 31.31  ? 52  U   A "C1'" 1 
ATOM   1137 N  N1    . U   A 1 52 ? 63.946 66.845 41.579  1.00 30.44  ? 52  U   A N1    1 
ATOM   1138 C  C2    . U   A 1 52 ? 64.863 66.182 42.369  1.00 30.06  ? 52  U   A C2    1 
ATOM   1139 O  O2    . U   A 1 52 ? 65.009 66.454 43.550  1.00 29.26  ? 52  U   A O2    1 
ATOM   1140 N  N3    . U   A 1 52 ? 65.623 65.231 41.729  1.00 29.70  ? 52  U   A N3    1 
ATOM   1141 C  C4    . U   A 1 52 ? 65.587 64.922 40.408  1.00 34.08  ? 52  U   A C4    1 
ATOM   1142 O  O4    . U   A 1 52 ? 66.347 64.036 39.967  1.00 34.26  ? 52  U   A O4    1 
ATOM   1143 C  C5    . U   A 1 52 ? 64.622 65.680 39.641  1.00 33.07  ? 52  U   A C5    1 
ATOM   1144 C  C6    . U   A 1 52 ? 63.831 66.587 40.266  1.00 26.53  ? 52  U   A C6    1 
ATOM   1145 P  P     . G   A 1 53 ? 65.414 71.746 40.572  1.00 37.07  ? 53  G   A P     1 
ATOM   1146 O  OP1   . G   A 1 53 ? 65.308 73.211 40.502  1.00 37.71  ? 53  G   A OP1   1 
ATOM   1147 O  OP2   . G   A 1 53 ? 65.813 70.998 39.374  1.00 30.94  ? 53  G   A OP2   1 
ATOM   1148 O  "O5'" . G   A 1 53 ? 66.393 71.211 41.694  1.00 32.28  ? 53  G   A "O5'" 1 
ATOM   1149 C  "C5'" . G   A 1 53 ? 66.229 71.538 43.081  1.00 34.99  ? 53  G   A "C5'" 1 
ATOM   1150 C  "C4'" . G   A 1 53 ? 67.174 70.724 43.912  1.00 34.42  ? 53  G   A "C4'" 1 
ATOM   1151 O  "O4'" . G   A 1 53 ? 66.864 69.323 43.765  1.00 35.23  ? 53  G   A "O4'" 1 
ATOM   1152 C  "C3'" . G   A 1 53 ? 68.665 70.782 43.620  1.00 34.67  ? 53  G   A "C3'" 1 
ATOM   1153 O  "O3'" . G   A 1 53 ? 69.247 71.895 44.262  1.00 38.95  ? 53  G   A "O3'" 1 
ATOM   1154 C  "C2'" . G   A 1 53 ? 69.164 69.500 44.283  1.00 34.61  ? 53  G   A "C2'" 1 
ATOM   1155 O  "O2'" . G   A 1 53 ? 69.182 69.612 45.688  1.00 34.19  ? 53  G   A "O2'" 1 
ATOM   1156 C  "C1'" . G   A 1 53 ? 68.019 68.537 43.991  1.00 32.96  ? 53  G   A "C1'" 1 
ATOM   1157 N  N9    . G   A 1 53 ? 68.320 67.761 42.786  1.00 28.24  ? 53  G   A N9    1 
ATOM   1158 C  C8    . G   A 1 53 ? 67.793 67.893 41.556  1.00 31.68  ? 53  G   A C8    1 
ATOM   1159 N  N7    . G   A 1 53 ? 68.284 67.042 40.701  1.00 26.28  ? 53  G   A N7    1 
ATOM   1160 C  C5    . G   A 1 53 ? 69.196 66.319 41.426  1.00 28.92  ? 53  G   A C5    1 
ATOM   1161 C  C6    . G   A 1 53 ? 70.091 65.297 41.013  1.00 25.46  ? 53  G   A C6    1 
ATOM   1162 O  O6    . G   A 1 53 ? 70.220 64.815 39.895  1.00 28.07  ? 53  G   A O6    1 
ATOM   1163 N  N1    . G   A 1 53 ? 70.897 64.869 42.059  1.00 29.47  ? 53  G   A N1    1 
ATOM   1164 C  C2    . G   A 1 53 ? 70.866 65.396 43.328  1.00 26.11  ? 53  G   A C2    1 
ATOM   1165 N  N2    . G   A 1 53 ? 71.750 64.920 44.203  1.00 30.39  ? 53  G   A N2    1 
ATOM   1166 N  N3    . G   A 1 53 ? 70.033 66.332 43.705  1.00 30.28  ? 53  G   A N3    1 
ATOM   1167 C  C4    . G   A 1 53 ? 69.234 66.743 42.708  1.00 26.13  ? 53  G   A C4    1 
HETATM 1168 N  N1    . 5MU A 1 54 ? 73.251 67.803 42.694  1.00 35.32  ? 54  5MU A N1    1 
HETATM 1169 C  C2    . 5MU A 1 54 ? 73.839 66.792 41.983  1.00 34.56  ? 54  5MU A C2    1 
HETATM 1170 N  N3    . 5MU A 1 54 ? 73.442 66.712 40.672  1.00 35.04  ? 54  5MU A N3    1 
HETATM 1171 C  C4    . 5MU A 1 54 ? 72.524 67.496 40.026  1.00 33.29  ? 54  5MU A C4    1 
HETATM 1172 C  C5    . 5MU A 1 54 ? 71.922 68.529 40.835  1.00 31.37  ? 54  5MU A C5    1 
HETATM 1173 C  C5M   . 5MU A 1 54 ? 70.918 69.466 40.203  1.00 28.02  ? 54  5MU A C5M   1 
HETATM 1174 C  C6    . 5MU A 1 54 ? 72.301 68.618 42.113  1.00 33.12  ? 54  5MU A C6    1 
HETATM 1175 O  O2    . 5MU A 1 54 ? 74.649 66.016 42.473  1.00 42.24  ? 54  5MU A O2    1 
HETATM 1176 O  O4    . 5MU A 1 54 ? 72.257 67.283 38.828  1.00 36.52  ? 54  5MU A O4    1 
HETATM 1177 C  "C1'" . 5MU A 1 54 ? 73.711 68.026 44.082  1.00 37.46  ? 54  5MU A "C1'" 1 
HETATM 1178 C  "C2'" . 5MU A 1 54 ? 75.024 68.864 44.109  1.00 40.51  ? 54  5MU A "C2'" 1 
HETATM 1179 O  "O2'" . 5MU A 1 54 ? 75.836 68.430 45.180  1.00 39.54  ? 54  5MU A "O2'" 1 
HETATM 1180 C  "C3'" . 5MU A 1 54 ? 74.485 70.281 44.321  1.00 42.37  ? 54  5MU A "C3'" 1 
HETATM 1181 C  "C4'" . 5MU A 1 54 ? 73.295 70.030 45.246  1.00 39.47  ? 54  5MU A "C4'" 1 
HETATM 1182 O  "O3'" . 5MU A 1 54 ? 75.448 71.209 44.879  1.00 44.31  ? 54  5MU A "O3'" 1 
HETATM 1183 O  "O4'" . 5MU A 1 54 ? 72.728 68.779 44.751  1.00 36.92  ? 54  5MU A "O4'" 1 
HETATM 1184 C  "C5'" . 5MU A 1 54 ? 72.225 71.084 45.312  1.00 38.24  ? 54  5MU A "C5'" 1 
HETATM 1185 O  "O5'" . 5MU A 1 54 ? 71.693 71.314 44.026  1.00 36.39  ? 54  5MU A "O5'" 1 
HETATM 1186 P  P     . 5MU A 1 54 ? 70.668 72.485 43.743  1.00 37.08  ? 54  5MU A P     1 
HETATM 1187 O  OP1   . 5MU A 1 54 ? 70.866 73.636 44.695  1.00 39.97  ? 54  5MU A OP1   1 
HETATM 1188 O  OP2   . 5MU A 1 54 ? 70.657 72.754 42.270  1.00 33.03  ? 54  5MU A OP2   1 
HETATM 1189 N  N1    . PSU A 1 55 ? 74.158 70.927 39.519  1.00 35.82  ? 55  PSU A N1    1 
HETATM 1190 C  C2    . PSU A 1 55 ? 73.717 70.455 38.323  1.00 38.30  ? 55  PSU A C2    1 
HETATM 1191 N  N3    . PSU A 1 55 ? 74.479 69.441 37.783  1.00 35.34  ? 55  PSU A N3    1 
HETATM 1192 C  C4    . PSU A 1 55 ? 75.687 68.934 38.291  1.00 36.07  ? 55  PSU A C4    1 
HETATM 1193 C  C5    . PSU A 1 55 ? 76.107 69.537 39.499  1.00 33.56  ? 55  PSU A C5    1 
HETATM 1194 C  C6    . PSU A 1 55 ? 75.337 70.458 40.076  1.00 35.52  ? 55  PSU A C6    1 
HETATM 1195 O  O2    . PSU A 1 55 ? 72.728 70.924 37.738  1.00 37.13  ? 55  PSU A O2    1 
HETATM 1196 O  O4    . PSU A 1 55 ? 76.304 68.043 37.675  1.00 32.17  ? 55  PSU A O4    1 
HETATM 1197 C  "C1'" . PSU A 1 55 ? 77.461 69.118 40.100  1.00 34.24  ? 55  PSU A "C1'" 1 
HETATM 1198 C  "C2'" . PSU A 1 55 ? 78.634 70.014 39.665  1.00 37.02  ? 55  PSU A "C2'" 1 
HETATM 1199 O  "O2'" . PSU A 1 55 ? 79.793 69.181 39.668  1.00 37.99  ? 55  PSU A "O2'" 1 
HETATM 1200 C  "C3'" . PSU A 1 55 ? 78.650 71.033 40.796  1.00 38.47  ? 55  PSU A "C3'" 1 
HETATM 1201 C  "C4'" . PSU A 1 55 ? 78.398 70.137 41.999  1.00 35.54  ? 55  PSU A "C4'" 1 
HETATM 1202 O  "O3'" . PSU A 1 55 ? 79.864 71.807 40.930  1.00 37.81  ? 55  PSU A "O3'" 1 
HETATM 1203 O  "O4'" . PSU A 1 55 ? 77.424 69.161 41.505  1.00 34.94  ? 55  PSU A "O4'" 1 
HETATM 1204 C  "C5'" . PSU A 1 55 ? 77.870 70.849 43.223  1.00 36.16  ? 55  PSU A "C5'" 1 
HETATM 1205 O  "O5'" . PSU A 1 55 ? 76.820 71.796 42.859  1.00 39.91  ? 55  PSU A "O5'" 1 
HETATM 1206 P  P     . PSU A 1 55 ? 75.925 72.471 43.991  1.00 43.83  ? 55  PSU A P     1 
HETATM 1207 O  OP1   . PSU A 1 55 ? 76.844 73.293 44.834  1.00 45.38  ? 55  PSU A OP1   1 
HETATM 1208 O  OP2   . PSU A 1 55 ? 74.766 73.172 43.306  1.00 46.32  ? 55  PSU A OP2   1 
ATOM   1209 P  P     . C   A 1 56 ? 79.893 73.323 40.427  1.00 37.81  ? 56  C   A P     1 
ATOM   1210 O  OP1   . C   A 1 56 ? 81.372 73.714 40.748  1.00 37.74  ? 56  C   A OP1   1 
ATOM   1211 O  OP2   . C   A 1 56 ? 78.768 74.121 41.003  1.00 35.29  ? 56  C   A OP2   1 
ATOM   1212 O  "O5'" . C   A 1 56 ? 79.825 73.304 38.871  1.00 33.59  ? 56  C   A "O5'" 1 
ATOM   1213 C  "C5'" . C   A 1 56 ? 79.545 74.494 38.135  1.00 33.82  ? 56  C   A "C5'" 1 
ATOM   1214 C  "C4'" . C   A 1 56 ? 79.735 74.239 36.678  1.00 32.83  ? 56  C   A "C4'" 1 
ATOM   1215 O  "O4'" . C   A 1 56 ? 81.120 73.946 36.360  1.00 33.52  ? 56  C   A "O4'" 1 
ATOM   1216 C  "C3'" . C   A 1 56 ? 78.954 73.036 36.142  1.00 30.99  ? 56  C   A "C3'" 1 
ATOM   1217 O  "O3'" . C   A 1 56 ? 77.596 73.405 35.829  1.00 31.77  ? 56  C   A "O3'" 1 
ATOM   1218 C  "C2'" . C   A 1 56 ? 79.739 72.659 34.901  1.00 31.94  ? 56  C   A "C2'" 1 
ATOM   1219 O  "O2'" . C   A 1 56 ? 79.480 73.400 33.725  1.00 29.83  ? 56  C   A "O2'" 1 
ATOM   1220 C  "C1'" . C   A 1 56 ? 81.174 72.955 35.333  1.00 33.49  ? 56  C   A "C1'" 1 
ATOM   1221 N  N1    . C   A 1 56 ? 81.800 71.739 35.857  1.00 29.51  ? 56  C   A N1    1 
ATOM   1222 C  C2    . C   A 1 56 ? 82.298 70.818 34.956  1.00 28.07  ? 56  C   A C2    1 
ATOM   1223 O  O2    . C   A 1 56 ? 82.160 71.013 33.755  1.00 29.82  ? 56  C   A O2    1 
ATOM   1224 N  N3    . C   A 1 56 ? 82.907 69.716 35.412  1.00 27.72  ? 56  C   A N3    1 
ATOM   1225 C  C4    . C   A 1 56 ? 83.035 69.503 36.720  1.00 32.68  ? 56  C   A C4    1 
ATOM   1226 N  N4    . C   A 1 56 ? 83.675 68.399 37.102  1.00 29.93  ? 56  C   A N4    1 
ATOM   1227 C  C5    . C   A 1 56 ? 82.515 70.397 37.674  1.00 30.58  ? 56  C   A C5    1 
ATOM   1228 C  C6    . C   A 1 56 ? 81.894 71.503 37.204  1.00 29.09  ? 56  C   A C6    1 
ATOM   1229 P  P     . G   A 1 57 ? 76.379 72.458 36.349  1.00 32.12  ? 57  G   A P     1 
ATOM   1230 O  OP1   . G   A 1 57 ? 75.189 73.231 35.952  1.00 34.27  ? 57  G   A OP1   1 
ATOM   1231 O  OP2   . G   A 1 57 ? 76.558 72.064 37.745  1.00 22.22  ? 57  G   A OP2   1 
ATOM   1232 O  "O5'" . G   A 1 57 ? 76.529 71.173 35.451  1.00 28.84  ? 57  G   A "O5'" 1 
ATOM   1233 C  "C5'" . G   A 1 57 ? 76.321 71.233 34.052  1.00 30.38  ? 57  G   A "C5'" 1 
ATOM   1234 C  "C4'" . G   A 1 57 ? 76.829 69.964 33.385  1.00 32.75  ? 57  G   A "C4'" 1 
ATOM   1235 O  "O4'" . G   A 1 57 ? 78.284 69.786 33.566  1.00 34.57  ? 57  G   A "O4'" 1 
ATOM   1236 C  "C3'" . G   A 1 57 ? 76.221 68.672 33.883  1.00 29.11  ? 57  G   A "C3'" 1 
ATOM   1237 O  "O3'" . G   A 1 57 ? 74.937 68.457 33.239  1.00 27.73  ? 57  G   A "O3'" 1 
ATOM   1238 C  "C2'" . G   A 1 57 ? 77.251 67.650 33.423  1.00 28.35  ? 57  G   A "C2'" 1 
ATOM   1239 O  "O2'" . G   A 1 57 ? 77.136 67.492 32.013  1.00 34.71  ? 57  G   A "O2'" 1 
ATOM   1240 C  "C1'" . G   A 1 57 ? 78.571 68.404 33.655  1.00 32.37  ? 57  G   A "C1'" 1 
ATOM   1241 N  N9    . G   A 1 57 ? 79.153 68.106 34.968  1.00 26.80  ? 57  G   A N9    1 
ATOM   1242 C  C8    . G   A 1 57 ? 79.113 68.840 36.137  1.00 26.67  ? 57  G   A C8    1 
ATOM   1243 N  N7    . G   A 1 57 ? 79.792 68.266 37.110  1.00 27.09  ? 57  G   A N7    1 
ATOM   1244 C  C5    . G   A 1 57 ? 80.280 67.087 36.529  1.00 28.66  ? 57  G   A C5    1 
ATOM   1245 C  C6    . G   A 1 57 ? 81.103 66.037 37.080  1.00 28.50  ? 57  G   A C6    1 
ATOM   1246 O  O6    . G   A 1 57 ? 81.588 65.974 38.203  1.00 28.04  ? 57  G   A O6    1 
ATOM   1247 N  N1    . G   A 1 57 ? 81.358 65.033 36.153  1.00 27.23  ? 57  G   A N1    1 
ATOM   1248 C  C2    . G   A 1 57 ? 80.910 65.036 34.858  1.00 27.75  ? 57  G   A C2    1 
ATOM   1249 N  N2    . G   A 1 57 ? 81.215 63.982 34.112  1.00 25.22  ? 57  G   A N2    1 
ATOM   1250 N  N3    . G   A 1 57 ? 80.185 66.017 34.328  1.00 27.62  ? 57  G   A N3    1 
ATOM   1251 C  C4    . G   A 1 57 ? 79.901 66.989 35.227  1.00 25.05  ? 57  G   A C4    1 
HETATM 1252 P  P     . 1MA A 1 58 ? 73.770 67.765 34.057  1.00 30.65  ? 58  1MA A P     1 
HETATM 1253 O  OP1   . 1MA A 1 58 ? 72.638 67.886 33.105  1.00 32.84  ? 58  1MA A OP1   1 
HETATM 1254 O  OP2   . 1MA A 1 58 ? 73.621 68.229 35.450  1.00 29.49  ? 58  1MA A OP2   1 
HETATM 1255 O  "O5'" . 1MA A 1 58 ? 74.315 66.273 34.254  1.00 28.81  ? 58  1MA A "O5'" 1 
HETATM 1256 C  "C5'" . 1MA A 1 58 ? 74.592 65.439 33.080  1.00 29.42  ? 58  1MA A "C5'" 1 
HETATM 1257 C  "C4'" . 1MA A 1 58 ? 74.279 63.972 33.383  1.00 33.42  ? 58  1MA A "C4'" 1 
HETATM 1258 O  "O4'" . 1MA A 1 58 ? 74.880 63.685 34.667  1.00 32.36  ? 58  1MA A "O4'" 1 
HETATM 1259 C  "C3'" . 1MA A 1 58 ? 72.789 63.573 33.509  1.00 35.13  ? 58  1MA A "C3'" 1 
HETATM 1260 O  "O3'" . 1MA A 1 58 ? 72.625 62.168 33.250  1.00 36.80  ? 58  1MA A "O3'" 1 
HETATM 1261 C  "C2'" . 1MA A 1 58 ? 72.560 63.667 35.012  1.00 34.80  ? 58  1MA A "C2'" 1 
HETATM 1262 O  "O2'" . 1MA A 1 58 ? 71.525 62.828 35.506  1.00 36.27  ? 58  1MA A "O2'" 1 
HETATM 1263 C  "C1'" . 1MA A 1 58 ? 73.908 63.150 35.551  1.00 33.62  ? 58  1MA A "C1'" 1 
HETATM 1264 N  N9    . 1MA A 1 58 ? 74.284 63.494 36.930  1.00 30.36  ? 58  1MA A N9    1 
HETATM 1265 C  C8    . 1MA A 1 58 ? 73.887 64.574 37.688  1.00 34.55  ? 58  1MA A C8    1 
HETATM 1266 N  N7    . 1MA A 1 58 ? 74.415 64.610 38.899  1.00 33.32  ? 58  1MA A N7    1 
HETATM 1267 C  C5    . 1MA A 1 58 ? 75.204 63.469 38.953  1.00 33.37  ? 58  1MA A C5    1 
HETATM 1268 C  C6    . 1MA A 1 58 ? 76.031 62.941 39.948  1.00 33.58  ? 58  1MA A C6    1 
HETATM 1269 N  N6    . 1MA A 1 58 ? 76.184 63.488 41.134  1.00 41.19  ? 58  1MA A N6    1 
HETATM 1270 N  N1    . 1MA A 1 58 ? 76.708 61.803 39.669  1.00 34.48  ? 58  1MA A N1    1 
HETATM 1271 C  CM1   . 1MA A 1 58 ? 77.649 61.222 40.626  1.00 31.43  ? 58  1MA A CM1   1 
HETATM 1272 C  C2    . 1MA A 1 58 ? 76.527 61.216 38.479  1.00 28.43  ? 58  1MA A C2    1 
HETATM 1273 N  N3    . 1MA A 1 58 ? 75.793 61.624 37.453  1.00 31.67  ? 58  1MA A N3    1 
HETATM 1274 C  C4    . 1MA A 1 58 ? 75.142 62.771 37.747  1.00 33.02  ? 58  1MA A C4    1 
ATOM   1275 P  P     . U   A 1 59 ? 72.617 61.530 31.733  1.00 41.00  ? 59  U   A P     1 
ATOM   1276 O  OP1   . U   A 1 59 ? 73.971 61.410 31.109  1.00 33.02  ? 59  U   A OP1   1 
ATOM   1277 O  OP2   . U   A 1 59 ? 71.557 62.222 31.005  1.00 41.76  ? 59  U   A OP2   1 
ATOM   1278 O  "O5'" . U   A 1 59 ? 72.130 60.048 31.994  1.00 39.14  ? 59  U   A "O5'" 1 
ATOM   1279 C  "C5'" . U   A 1 59 ? 70.719 59.794 32.346  1.00 35.32  ? 59  U   A "C5'" 1 
ATOM   1280 C  "C4'" . U   A 1 59 ? 70.618 58.472 33.026  1.00 29.87  ? 59  U   A "C4'" 1 
ATOM   1281 O  "O4'" . U   A 1 59 ? 71.242 57.502 32.161  1.00 30.33  ? 59  U   A "O4'" 1 
ATOM   1282 C  "C3'" . U   A 1 59 ? 71.352 58.357 34.366  1.00 30.46  ? 59  U   A "C3'" 1 
ATOM   1283 O  "O3'" . U   A 1 59 ? 70.546 58.855 35.497  1.00 31.17  ? 59  U   A "O3'" 1 
ATOM   1284 C  "C2'" . U   A 1 59 ? 71.629 56.872 34.435  1.00 34.51  ? 59  U   A "C2'" 1 
ATOM   1285 O  "O2'" . U   A 1 59 ? 70.529 56.200 35.034  1.00 33.82  ? 59  U   A "O2'" 1 
ATOM   1286 C  "C1'" . U   A 1 59 ? 71.808 56.483 32.934  1.00 34.05  ? 59  U   A "C1'" 1 
ATOM   1287 N  N1    . U   A 1 59 ? 73.191 56.244 32.453  1.00 30.28  ? 59  U   A N1    1 
ATOM   1288 C  C2    . U   A 1 59 ? 73.828 55.055 32.883  1.00 33.87  ? 59  U   A C2    1 
ATOM   1289 O  O2    . U   A 1 59 ? 73.232 54.201 33.510  1.00 40.51  ? 59  U   A O2    1 
ATOM   1290 N  N3    . U   A 1 59 ? 75.160 54.920 32.534  1.00 31.37  ? 59  U   A N3    1 
ATOM   1291 C  C4    . U   A 1 59 ? 75.886 55.811 31.767  1.00 33.85  ? 59  U   A C4    1 
ATOM   1292 O  O4    . U   A 1 59 ? 76.986 55.468 31.336  1.00 34.46  ? 59  U   A O4    1 
ATOM   1293 C  C5    . U   A 1 59 ? 75.128 57.004 31.315  1.00 30.62  ? 59  U   A C5    1 
ATOM   1294 C  C6    . U   A 1 59 ? 73.842 57.148 31.666  1.00 24.94  ? 59  U   A C6    1 
ATOM   1295 P  P     . C   A 1 60 ? 71.267 59.539 36.803  1.00 33.56  ? 60  C   A P     1 
ATOM   1296 O  OP1   . C   A 1 60 ? 70.297 59.837 37.820  1.00 32.77  ? 60  C   A OP1   1 
ATOM   1297 O  OP2   . C   A 1 60 ? 72.180 60.638 36.294  1.00 34.80  ? 60  C   A OP2   1 
ATOM   1298 O  "O5'" . C   A 1 60 ? 72.351 58.459 37.303  1.00 29.47  ? 60  C   A "O5'" 1 
ATOM   1299 C  "C5'" . C   A 1 60 ? 71.983 57.223 37.962  1.00 31.76  ? 60  C   A "C5'" 1 
ATOM   1300 C  "C4'" . C   A 1 60 ? 73.252 56.436 38.285  1.00 32.79  ? 60  C   A "C4'" 1 
ATOM   1301 O  "O4'" . C   A 1 60 ? 74.024 56.360 37.069  1.00 34.84  ? 60  C   A "O4'" 1 
ATOM   1302 C  "C3'" . C   A 1 60 ? 74.192 57.080 39.322  1.00 35.07  ? 60  C   A "C3'" 1 
ATOM   1303 O  "O3'" . C   A 1 60 ? 74.832 56.043 40.028  1.00 38.94  ? 60  C   A "O3'" 1 
ATOM   1304 C  "C2'" . C   A 1 60 ? 75.220 57.789 38.455  1.00 34.97  ? 60  C   A "C2'" 1 
ATOM   1305 O  "O2'" . C   A 1 60 ? 76.489 58.039 39.019  1.00 36.28  ? 60  C   A "O2'" 1 
ATOM   1306 C  "C1'" . C   A 1 60 ? 75.336 56.786 37.306  1.00 32.64  ? 60  C   A "C1'" 1 
ATOM   1307 N  N1    . C   A 1 60 ? 75.849 57.370 36.090  1.00 32.74  ? 60  C   A N1    1 
ATOM   1308 C  C2    . C   A 1 60 ? 76.958 56.775 35.475  1.00 33.30  ? 60  C   A C2    1 
ATOM   1309 O  O2    . C   A 1 60 ? 77.484 55.783 36.004  1.00 37.02  ? 60  C   A O2    1 
ATOM   1310 N  N3    . C   A 1 60 ? 77.445 57.308 34.368  1.00 27.75  ? 60  C   A N3    1 
ATOM   1311 C  C4    . C   A 1 60 ? 76.919 58.410 33.866  1.00 31.44  ? 60  C   A C4    1 
ATOM   1312 N  N4    . C   A 1 60 ? 77.491 58.943 32.854  1.00 31.16  ? 60  C   A N4    1 
ATOM   1313 C  C5    . C   A 1 60 ? 75.767 59.040 34.441  1.00 31.34  ? 60  C   A C5    1 
ATOM   1314 C  C6    . C   A 1 60 ? 75.274 58.489 35.549  1.00 34.59  ? 60  C   A C6    1 
ATOM   1315 P  P     . C   A 1 61 ? 74.243 55.584 41.447  1.00 42.61  ? 61  C   A P     1 
ATOM   1316 O  OP1   . C   A 1 61 ? 75.151 54.490 41.830  1.00 44.00  ? 61  C   A OP1   1 
ATOM   1317 O  OP2   . C   A 1 61 ? 72.781 55.398 41.440  1.00 37.71  ? 61  C   A OP2   1 
ATOM   1318 O  "O5'" . C   A 1 61 ? 74.477 56.853 42.390  1.00 39.76  ? 61  C   A "O5'" 1 
ATOM   1319 C  "C5'" . C   A 1 61 ? 75.717 57.059 43.037  1.00 43.07  ? 61  C   A "C5'" 1 
ATOM   1320 C  "C4'" . C   A 1 61 ? 75.643 58.316 43.840  1.00 39.59  ? 61  C   A "C4'" 1 
ATOM   1321 O  "O4'" . C   A 1 61 ? 75.807 59.456 42.959  1.00 37.14  ? 61  C   A "O4'" 1 
ATOM   1322 C  "C3'" . C   A 1 61 ? 74.297 58.531 44.524  1.00 38.59  ? 61  C   A "C3'" 1 
ATOM   1323 O  "O3'" . C   A 1 61 ? 74.209 57.799 45.784  1.00 39.28  ? 61  C   A "O3'" 1 
ATOM   1324 C  "C2'" . C   A 1 61 ? 74.292 60.040 44.702  1.00 37.97  ? 61  C   A "C2'" 1 
ATOM   1325 O  "O2'" . C   A 1 61 ? 75.174 60.397 45.747  1.00 38.59  ? 61  C   A "O2'" 1 
ATOM   1326 C  "C1'" . C   A 1 61 ? 74.974 60.515 43.421  1.00 36.12  ? 61  C   A "C1'" 1 
ATOM   1327 N  N1    . C   A 1 61 ? 74.069 60.960 42.325  1.00 33.98  ? 61  C   A N1    1 
ATOM   1328 C  C2    . C   A 1 61 ? 73.361 62.180 42.471  1.00 33.04  ? 61  C   A C2    1 
ATOM   1329 O  O2    . C   A 1 61 ? 73.490 62.839 43.524  1.00 35.58  ? 61  C   A O2    1 
ATOM   1330 N  N3    . C   A 1 61 ? 72.551 62.600 41.455  1.00 35.45  ? 61  C   A N3    1 
ATOM   1331 C  C4    . C   A 1 61 ? 72.421 61.838 40.349  1.00 35.34  ? 61  C   A C4    1 
ATOM   1332 N  N4    . C   A 1 61 ? 71.550 62.237 39.373  1.00 32.83  ? 61  C   A N4    1 
ATOM   1333 C  C5    . C   A 1 61 ? 73.147 60.623 40.187  1.00 35.42  ? 61  C   A C5    1 
ATOM   1334 C  C6    . C   A 1 61 ? 73.938 60.221 41.188  1.00 31.03  ? 61  C   A C6    1 
ATOM   1335 P  P     . A   A 1 62 ? 72.777 57.319 46.334  1.00 42.33  ? 62  A   A P     1 
ATOM   1336 O  OP1   . A   A 1 62 ? 73.023 56.390 47.455  1.00 41.97  ? 62  A   A OP1   1 
ATOM   1337 O  OP2   . A   A 1 62 ? 71.960 56.820 45.161  1.00 42.66  ? 62  A   A OP2   1 
ATOM   1338 O  "O5'" . A   A 1 62 ? 72.104 58.670 46.874  1.00 43.04  ? 62  A   A "O5'" 1 
ATOM   1339 C  "C5'" . A   A 1 62 ? 72.719 59.460 47.936  1.00 39.06  ? 62  A   A "C5'" 1 
ATOM   1340 C  "C4'" . A   A 1 62 ? 71.882 60.684 48.244  1.00 39.69  ? 62  A   A "C4'" 1 
ATOM   1341 O  "O4'" . A   A 1 62 ? 71.968 61.660 47.165  1.00 39.39  ? 62  A   A "O4'" 1 
ATOM   1342 C  "C3'" . A   A 1 62 ? 70.391 60.442 48.405  1.00 40.80  ? 62  A   A "C3'" 1 
ATOM   1343 O  "O3'" . A   A 1 62 ? 70.103 59.945 49.700  1.00 43.31  ? 62  A   A "O3'" 1 
ATOM   1344 C  "C2'" . A   A 1 62 ? 69.808 61.827 48.120  1.00 41.10  ? 62  A   A "C2'" 1 
ATOM   1345 O  "O2'" . A   A 1 62 ? 70.016 62.793 49.130  1.00 43.43  ? 62  A   A "O2'" 1 
ATOM   1346 C  "C1'" . A   A 1 62 ? 70.711 62.312 46.995  1.00 38.85  ? 62  A   A "C1'" 1 
ATOM   1347 N  N9    . A   A 1 62 ? 70.182 62.021 45.654  1.00 32.58  ? 62  A   A N9    1 
ATOM   1348 C  C8    . A   A 1 62 ? 70.560 61.004 44.827  1.00 33.66  ? 62  A   A C8    1 
ATOM   1349 N  N7    . A   A 1 62 ? 70.002 61.038 43.650  1.00 32.82  ? 62  A   A N7    1 
ATOM   1350 C  C5    . A   A 1 62 ? 69.158 62.140 43.707  1.00 31.78  ? 62  A   A C5    1 
ATOM   1351 C  C6    . A   A 1 62 ? 68.304 62.715 42.759  1.00 29.57  ? 62  A   A C6    1 
ATOM   1352 N  N6    . A   A 1 62 ? 68.170 62.255 41.478  1.00 29.13  ? 62  A   A N6    1 
ATOM   1353 N  N1    . A   A 1 62 ? 67.590 63.788 43.135  1.00 31.96  ? 62  A   A N1    1 
ATOM   1354 C  C2    . A   A 1 62 ? 67.754 64.268 44.373  1.00 33.29  ? 62  A   A C2    1 
ATOM   1355 N  N3    . A   A 1 62 ? 68.548 63.835 45.349  1.00 32.89  ? 62  A   A N3    1 
ATOM   1356 C  C4    . A   A 1 62 ? 69.239 62.747 44.945  1.00 35.51  ? 62  A   A C4    1 
ATOM   1357 P  P     . C   A 1 63 ? 68.913 58.881 49.918  1.00 43.35  ? 63  C   A P     1 
ATOM   1358 O  OP1   . C   A 1 63 ? 69.009 58.532 51.351  1.00 49.74  ? 63  C   A OP1   1 
ATOM   1359 O  OP2   . C   A 1 63 ? 68.970 57.790 48.905  1.00 46.77  ? 63  C   A OP2   1 
ATOM   1360 O  "O5'" . C   A 1 63 ? 67.599 59.762 49.769  1.00 45.50  ? 63  C   A "O5'" 1 
ATOM   1361 C  "C5'" . C   A 1 63 ? 67.371 60.836 50.703  1.00 44.28  ? 63  C   A "C5'" 1 
ATOM   1362 C  "C4'" . C   A 1 63 ? 66.263 61.750 50.244  1.00 44.77  ? 63  C   A "C4'" 1 
ATOM   1363 O  "O4'" . C   A 1 63 ? 66.669 62.512 49.079  1.00 41.48  ? 63  C   A "O4'" 1 
ATOM   1364 C  "C3'" . C   A 1 63 ? 64.958 61.089 49.850  1.00 46.16  ? 63  C   A "C3'" 1 
ATOM   1365 O  "O3'" . C   A 1 63 ? 64.160 60.771 51.005  1.00 51.01  ? 63  C   A "O3'" 1 
ATOM   1366 C  "C2'" . C   A 1 63 ? 64.325 62.154 48.972  1.00 43.55  ? 63  C   A "C2'" 1 
ATOM   1367 O  "O2'" . C   A 1 63 ? 63.764 63.209 49.763  1.00 48.54  ? 63  C   A "O2'" 1 
ATOM   1368 C  "C1'" . C   A 1 63 ? 65.541 62.713 48.233  1.00 39.95  ? 63  C   A "C1'" 1 
ATOM   1369 N  N1    . C   A 1 63 ? 65.788 62.041 46.918  1.00 35.72  ? 63  C   A N1    1 
ATOM   1370 C  C2    . C   A 1 63 ? 65.155 62.553 45.793  1.00 32.68  ? 63  C   A C2    1 
ATOM   1371 O  O2    . C   A 1 63 ? 64.440 63.541 45.950  1.00 36.07  ? 63  C   A O2    1 
ATOM   1372 N  N3    . C   A 1 63 ? 65.328 61.946 44.571  1.00 34.10  ? 63  C   A N3    1 
ATOM   1373 C  C4    . C   A 1 63 ? 66.113 60.839 44.485  1.00 31.53  ? 63  C   A C4    1 
ATOM   1374 N  N4    . C   A 1 63 ? 66.253 60.229 43.282  1.00 34.07  ? 63  C   A N4    1 
ATOM   1375 C  C5    . C   A 1 63 ? 66.783 60.308 45.617  1.00 35.81  ? 63  C   A C5    1 
ATOM   1376 C  C6    . C   A 1 63 ? 66.603 60.941 46.809  1.00 36.37  ? 63  C   A C6    1 
ATOM   1377 P  P     . A   A 1 64 ? 63.129 59.542 50.943  1.00 57.75  ? 64  A   A P     1 
ATOM   1378 O  OP1   . A   A 1 64 ? 62.528 59.402 52.300  1.00 58.22  ? 64  A   A OP1   1 
ATOM   1379 O  OP2   . A   A 1 64 ? 63.807 58.359 50.338  1.00 54.03  ? 64  A   A OP2   1 
ATOM   1380 O  "O5'" . A   A 1 64 ? 62.008 60.100 49.971  1.00 54.48  ? 64  A   A "O5'" 1 
ATOM   1381 C  "C5'" . A   A 1 64 ? 61.194 61.198 50.398  1.00 56.10  ? 64  A   A "C5'" 1 
ATOM   1382 C  "C4'" . A   A 1 64 ? 60.204 61.569 49.339  1.00 54.58  ? 64  A   A "C4'" 1 
ATOM   1383 O  "O4'" . A   A 1 64 ? 60.917 62.255 48.276  1.00 53.92  ? 64  A   A "O4'" 1 
ATOM   1384 C  "C3'" . A   A 1 64 ? 59.459 60.433 48.632  1.00 56.48  ? 64  A   A "C3'" 1 
ATOM   1385 O  "O3'" . A   A 1 64 ? 58.374 59.780 49.384  1.00 56.71  ? 64  A   A "O3'" 1 
ATOM   1386 C  "C2'" . A   A 1 64 ? 59.036 61.152 47.349  1.00 53.00  ? 64  A   A "C2'" 1 
ATOM   1387 O  "O2'" . A   A 1 64 ? 57.994 62.076 47.565  1.00 56.42  ? 64  A   A "O2'" 1 
ATOM   1388 C  "C1'" . A   A 1 64 ? 60.283 61.983 47.026  1.00 51.87  ? 64  A   A "C1'" 1 
ATOM   1389 N  N9    . A   A 1 64 ? 61.176 61.174 46.178  1.00 45.48  ? 64  A   A N9    1 
ATOM   1390 C  C8    . A   A 1 64 ? 62.220 60.374 46.567  1.00 42.54  ? 64  A   A C8    1 
ATOM   1391 N  N7    . A   A 1 64 ? 62.766 59.702 45.585  1.00 42.30  ? 64  A   A N7    1 
ATOM   1392 C  C5    . A   A 1 64 ? 62.051 60.122 44.466  1.00 40.22  ? 64  A   A C5    1 
ATOM   1393 C  C6    . A   A 1 64 ? 62.152 59.783 43.119  1.00 36.50  ? 64  A   A C6    1 
ATOM   1394 N  N6    . A   A 1 64 ? 63.082 58.963 42.657  1.00 34.41  ? 64  A   A N6    1 
ATOM   1395 N  N1    . A   A 1 64 ? 61.261 60.326 42.262  1.00 37.69  ? 64  A   A N1    1 
ATOM   1396 C  C2    . A   A 1 64 ? 60.346 61.178 42.745  1.00 36.62  ? 64  A   A C2    1 
ATOM   1397 N  N3    . A   A 1 64 ? 60.169 61.600 43.991  1.00 36.71  ? 64  A   A N3    1 
ATOM   1398 C  C4    . A   A 1 64 ? 61.070 61.018 44.815  1.00 39.74  ? 64  A   A C4    1 
ATOM   1399 P  P     . G   A 1 65 ? 58.068 58.186 49.152  1.00 58.45  ? 65  G   A P     1 
ATOM   1400 O  OP1   . G   A 1 65 ? 57.104 57.682 50.155  1.00 62.97  ? 65  G   A OP1   1 
ATOM   1401 O  OP2   . G   A 1 65 ? 59.328 57.423 48.941  1.00 61.74  ? 65  G   A OP2   1 
ATOM   1402 O  "O5'" . G   A 1 65 ? 57.302 58.169 47.766  1.00 57.06  ? 65  G   A "O5'" 1 
ATOM   1403 C  "C5'" . G   A 1 65 ? 56.297 59.121 47.518  1.00 49.45  ? 65  G   A "C5'" 1 
ATOM   1404 C  "C4'" . G   A 1 65 ? 55.988 59.170 46.060  1.00 45.91  ? 65  G   A "C4'" 1 
ATOM   1405 O  "O4'" . G   A 1 65 ? 57.113 59.757 45.358  1.00 43.81  ? 65  G   A "O4'" 1 
ATOM   1406 C  "C3'" . G   A 1 65 ? 55.711 57.868 45.316  1.00 45.00  ? 65  G   A "C3'" 1 
ATOM   1407 O  "O3'" . G   A 1 65 ? 54.366 57.370 45.509  1.00 47.48  ? 65  G   A "O3'" 1 
ATOM   1408 C  "C2'" . G   A 1 65 ? 55.920 58.322 43.886  1.00 41.79  ? 65  G   A "C2'" 1 
ATOM   1409 O  "O2'" . G   A 1 65 ? 54.776 59.084 43.491  1.00 39.93  ? 65  G   A "O2'" 1 
ATOM   1410 C  "C1'" . G   A 1 65 ? 57.142 59.262 44.032  1.00 42.23  ? 65  G   A "C1'" 1 
ATOM   1411 N  N9    . G   A 1 65 ? 58.373 58.489 43.875  1.00 39.23  ? 65  G   A N9    1 
ATOM   1412 C  C8    . G   A 1 65 ? 59.245 58.086 44.861  1.00 37.65  ? 65  G   A C8    1 
ATOM   1413 N  N7    . G   A 1 65 ? 60.189 57.305 44.420  1.00 35.71  ? 65  G   A N7    1 
ATOM   1414 C  C5    . G   A 1 65 ? 59.942 57.213 43.050  1.00 38.74  ? 65  G   A C5    1 
ATOM   1415 C  C6    . G   A 1 65 ? 60.647 56.509 42.009  1.00 36.19  ? 65  G   A C6    1 
ATOM   1416 O  O6    . G   A 1 65 ? 61.690 55.776 42.101  1.00 38.10  ? 65  G   A O6    1 
ATOM   1417 N  N1    . G   A 1 65 ? 60.040 56.710 40.766  1.00 37.09  ? 65  G   A N1    1 
ATOM   1418 C  C2    . G   A 1 65 ? 58.920 57.482 40.550  1.00 37.20  ? 65  G   A C2    1 
ATOM   1419 N  N2    . G   A 1 65 ? 58.460 57.534 39.290  1.00 36.90  ? 65  G   A N2    1 
ATOM   1420 N  N3    . G   A 1 65 ? 58.288 58.152 41.498  1.00 33.44  ? 65  G   A N3    1 
ATOM   1421 C  C4    . G   A 1 65 ? 58.838 57.965 42.703  1.00 36.71  ? 65  G   A C4    1 
ATOM   1422 P  P     . A   A 1 66 ? 54.074 55.782 45.410  1.00 48.51  ? 66  A   A P     1 
ATOM   1423 O  OP1   . A   A 1 66 ? 52.701 55.474 45.862  1.00 50.89  ? 66  A   A OP1   1 
ATOM   1424 O  OP2   . A   A 1 66 ? 55.214 55.033 46.008  1.00 48.73  ? 66  A   A OP2   1 
ATOM   1425 O  "O5'" . A   A 1 66 ? 54.173 55.469 43.863  1.00 45.90  ? 66  A   A "O5'" 1 
ATOM   1426 C  "C5'" . A   A 1 66 ? 53.339 56.143 42.940  1.00 46.19  ? 66  A   A "C5'" 1 
ATOM   1427 C  "C4'" . A   A 1 66 ? 53.671 55.677 41.542  1.00 46.27  ? 66  A   A "C4'" 1 
ATOM   1428 O  "O4'" . A   A 1 66 ? 55.037 56.058 41.206  1.00 44.63  ? 66  A   A "O4'" 1 
ATOM   1429 C  "C3'" . A   A 1 66 ? 53.666 54.171 41.354  1.00 44.76  ? 66  A   A "C3'" 1 
ATOM   1430 O  "O3'" . A   A 1 66 ? 52.326 53.680 41.155  1.00 46.57  ? 66  A   A "O3'" 1 
ATOM   1431 C  "C2'" . A   A 1 66 ? 54.535 54.017 40.112  1.00 42.31  ? 66  A   A "C2'" 1 
ATOM   1432 O  "O2'" . A   A 1 66 ? 53.773 54.358 38.980  1.00 44.56  ? 66  A   A "O2'" 1 
ATOM   1433 C  "C1'" . A   A 1 66 ? 55.595 55.117 40.311  1.00 40.50  ? 66  A   A "C1'" 1 
ATOM   1434 N  N9    . A   A 1 66 ? 56.838 54.618 40.902  1.00 38.52  ? 66  A   A N9    1 
ATOM   1435 C  C8    . A   A 1 66 ? 57.216 54.722 42.216  1.00 37.83  ? 66  A   A C8    1 
ATOM   1436 N  N7    . A   A 1 66 ? 58.365 54.141 42.488  1.00 38.64  ? 66  A   A N7    1 
ATOM   1437 C  C5    . A   A 1 66 ? 58.784 53.639 41.260  1.00 37.61  ? 66  A   A C5    1 
ATOM   1438 C  C6    . A   A 1 66 ? 59.943 52.898 40.877  1.00 36.94  ? 66  A   A C6    1 
ATOM   1439 N  N6    . A   A 1 66 ? 60.924 52.566 41.728  1.00 34.85  ? 66  A   A N6    1 
ATOM   1440 N  N1    . A   A 1 66 ? 60.042 52.511 39.596  1.00 36.33  ? 66  A   A N1    1 
ATOM   1441 C  C2    . A   A 1 66 ? 59.056 52.850 38.752  1.00 37.97  ? 66  A   A C2    1 
ATOM   1442 N  N3    . A   A 1 66 ? 57.922 53.552 38.986  1.00 38.42  ? 66  A   A N3    1 
ATOM   1443 C  C4    . A   A 1 66 ? 57.850 53.916 40.276  1.00 37.28  ? 66  A   A C4    1 
ATOM   1444 P  P     . A   A 1 67 ? 51.950 52.180 41.620  1.00 46.84  ? 67  A   A P     1 
ATOM   1445 O  OP1   . A   A 1 67 ? 50.472 52.017 41.466  1.00 50.38  ? 67  A   A OP1   1 
ATOM   1446 O  OP2   . A   A 1 67 ? 52.569 51.904 42.938  1.00 43.27  ? 67  A   A OP2   1 
ATOM   1447 O  "O5'" . A   A 1 67 ? 52.644 51.252 40.553  1.00 44.33  ? 67  A   A "O5'" 1 
ATOM   1448 C  "C5'" . A   A 1 67 ? 52.276 51.321 39.167  1.00 45.20  ? 67  A   A "C5'" 1 
ATOM   1449 C  "C4'" . A   A 1 67 ? 53.319 50.645 38.320  1.00 43.61  ? 67  A   A "C4'" 1 
ATOM   1450 O  "O4'" . A   A 1 67 ? 54.601 51.353 38.446  1.00 42.36  ? 67  A   A "O4'" 1 
ATOM   1451 C  "C3'" . A   A 1 67 ? 53.636 49.208 38.725  1.00 41.30  ? 67  A   A "C3'" 1 
ATOM   1452 O  "O3'" . A   A 1 67 ? 52.690 48.291 38.163  1.00 46.52  ? 67  A   A "O3'" 1 
ATOM   1453 C  "C2'" . A   A 1 67 ? 55.053 49.024 38.157  1.00 42.21  ? 67  A   A "C2'" 1 
ATOM   1454 O  "O2'" . A   A 1 67 ? 55.039 48.819 36.759  1.00 41.99  ? 67  A   A "O2'" 1 
ATOM   1455 C  "C1'" . A   A 1 67 ? 55.669 50.417 38.391  1.00 41.64  ? 67  A   A "C1'" 1 
ATOM   1456 N  N9    . A   A 1 67 ? 56.441 50.432 39.643  1.00 39.97  ? 67  A   A N9    1 
ATOM   1457 C  C8    . A   A 1 67 ? 56.129 50.866 40.893  1.00 40.04  ? 67  A   A C8    1 
ATOM   1458 N  N7    . A   A 1 67 ? 57.062 50.618 41.788  1.00 37.46  ? 67  A   A N7    1 
ATOM   1459 C  C5    . A   A 1 67 ? 58.077 50.015 41.060  1.00 37.07  ? 67  A   A C5    1 
ATOM   1460 C  C6    . A   A 1 67 ? 59.348 49.481 41.435  1.00 37.10  ? 67  A   A C6    1 
ATOM   1461 N  N6    . A   A 1 67 ? 59.864 49.515 42.677  1.00 37.48  ? 67  A   A N6    1 
ATOM   1462 N  N1    . A   A 1 67 ? 60.076 48.895 40.483  1.00 37.12  ? 67  A   A N1    1 
ATOM   1463 C  C2    . A   A 1 67 ? 59.577 48.842 39.230  1.00 42.46  ? 67  A   A C2    1 
ATOM   1464 N  N3    . A   A 1 67 ? 58.415 49.313 38.758  1.00 39.78  ? 67  A   A N3    1 
ATOM   1465 C  C4    . A   A 1 67 ? 57.712 49.894 39.743  1.00 37.61  ? 67  A   A C4    1 
ATOM   1466 P  P     . U   A 1 68 ? 52.371 46.894 38.917  1.00 42.45  ? 68  U   A P     1 
ATOM   1467 O  OP1   . U   A 1 68 ? 51.176 46.256 38.300  1.00 49.18  ? 68  U   A OP1   1 
ATOM   1468 O  OP2   . U   A 1 68 ? 52.399 47.127 40.381  1.00 41.13  ? 68  U   A OP2   1 
ATOM   1469 O  "O5'" . U   A 1 68 ? 53.625 45.986 38.529  1.00 44.81  ? 68  U   A "O5'" 1 
ATOM   1470 C  "C5'" . U   A 1 68 ? 53.889 45.709 37.150  1.00 43.19  ? 68  U   A "C5'" 1 
ATOM   1471 C  "C4'" . U   A 1 68 ? 55.168 44.940 37.012  1.00 43.76  ? 68  U   A "C4'" 1 
ATOM   1472 O  "O4'" . U   A 1 68 ? 56.296 45.792 37.351  1.00 42.13  ? 68  U   A "O4'" 1 
ATOM   1473 C  "C3'" . U   A 1 68 ? 55.315 43.758 37.955  1.00 41.59  ? 68  U   A "C3'" 1 
ATOM   1474 O  "O3'" . U   A 1 68 ? 54.653 42.598 37.490  1.00 42.60  ? 68  U   A "O3'" 1 
ATOM   1475 C  "C2'" . U   A 1 68 ? 56.825 43.573 37.996  1.00 38.55  ? 68  U   A "C2'" 1 
ATOM   1476 O  "O2'" . U   A 1 68 ? 57.255 43.012 36.776  1.00 36.20  ? 68  U   A "O2'" 1 
ATOM   1477 C  "C1'" . U   A 1 68 ? 57.286 45.028 38.018  1.00 40.75  ? 68  U   A "C1'" 1 
ATOM   1478 N  N1    . U   A 1 68 ? 57.451 45.543 39.385  1.00 40.94  ? 68  U   A N1    1 
ATOM   1479 C  C2    . U   A 1 68 ? 58.636 45.212 40.015  1.00 38.74  ? 68  U   A C2    1 
ATOM   1480 O  O2    . U   A 1 68 ? 59.470 44.485 39.490  1.00 38.70  ? 68  U   A O2    1 
ATOM   1481 N  N3    . U   A 1 68 ? 58.804 45.747 41.261  1.00 37.87  ? 68  U   A N3    1 
ATOM   1482 C  C4    . U   A 1 68 ? 57.924 46.564 41.939  1.00 41.13  ? 68  U   A C4    1 
ATOM   1483 O  O4    . U   A 1 68 ? 58.175 46.857 43.097  1.00 38.53  ? 68  U   A O4    1 
ATOM   1484 C  C5    . U   A 1 68 ? 56.693 46.846 41.241  1.00 42.38  ? 68  U   A C5    1 
ATOM   1485 C  C6    . U   A 1 68 ? 56.502 46.326 40.013  1.00 41.40  ? 68  U   A C6    1 
ATOM   1486 P  P     . U   A 1 69 ? 54.151 41.542 38.559  1.00 39.53  ? 69  U   A P     1 
ATOM   1487 O  OP1   . U   A 1 69 ? 53.485 40.463 37.781  1.00 45.74  ? 69  U   A OP1   1 
ATOM   1488 O  OP2   . U   A 1 69 ? 53.441 42.272 39.591  1.00 36.81  ? 69  U   A OP2   1 
ATOM   1489 O  "O5'" . U   A 1 69 ? 55.409 40.901 39.291  1.00 37.79  ? 69  U   A "O5'" 1 
ATOM   1490 C  "C5'" . U   A 1 69 ? 56.364 40.117 38.558  1.00 37.34  ? 69  U   A "C5'" 1 
ATOM   1491 C  "C4'" . U   A 1 69 ? 57.582 39.880 39.400  1.00 37.79  ? 69  U   A "C4'" 1 
ATOM   1492 O  "O4'" . U   A 1 69 ? 58.241 41.150 39.731  1.00 36.27  ? 69  U   A "O4'" 1 
ATOM   1493 C  "C3'" . U   A 1 69 ? 57.300 39.247 40.746  1.00 37.91  ? 69  U   A "C3'" 1 
ATOM   1494 O  "O3'" . U   A 1 69 ? 57.092 37.832 40.625  1.00 37.28  ? 69  U   A "O3'" 1 
ATOM   1495 C  "C2'" . U   A 1 69 ? 58.553 39.630 41.533  1.00 35.61  ? 69  U   A "C2'" 1 
ATOM   1496 O  "O2'" . U   A 1 69 ? 59.645 38.794 41.156  1.00 34.07  ? 69  U   A "O2'" 1 
ATOM   1497 C  "C1'" . U   A 1 69 ? 58.796 41.050 41.019  1.00 34.46  ? 69  U   A "C1'" 1 
ATOM   1498 N  N1    . U   A 1 69 ? 58.186 42.082 41.876  1.00 33.94  ? 69  U   A N1    1 
ATOM   1499 C  C2    . U   A 1 69 ? 58.871 42.410 43.052  1.00 34.89  ? 69  U   A C2    1 
ATOM   1500 O  O2    . U   A 1 69 ? 59.947 41.899 43.373  1.00 36.74  ? 69  U   A O2    1 
ATOM   1501 N  N3    . U   A 1 69 ? 58.261 43.334 43.836  1.00 35.12  ? 69  U   A N3    1 
ATOM   1502 C  C4    . U   A 1 69 ? 57.071 43.985 43.603  1.00 37.89  ? 69  U   A C4    1 
ATOM   1503 O  O4    . U   A 1 69 ? 56.665 44.808 44.432  1.00 37.56  ? 69  U   A O4    1 
ATOM   1504 C  C5    . U   A 1 69 ? 56.419 43.627 42.355  1.00 38.56  ? 69  U   A C5    1 
ATOM   1505 C  C6    . U   A 1 69 ? 56.991 42.702 41.549  1.00 35.52  ? 69  U   A C6    1 
ATOM   1506 P  P     . C   A 1 70 ? 56.232 37.065 41.726  1.00 41.13  ? 70  C   A P     1 
ATOM   1507 O  OP1   . C   A 1 70 ? 55.792 35.757 41.056  1.00 42.55  ? 70  C   A OP1   1 
ATOM   1508 O  OP2   . C   A 1 70 ? 55.233 37.976 42.338  1.00 39.43  ? 70  C   A OP2   1 
ATOM   1509 O  "O5'" . C   A 1 70 ? 57.233 36.693 42.902  1.00 36.56  ? 70  C   A "O5'" 1 
ATOM   1510 C  "C5'" . C   A 1 70 ? 58.371 35.817 42.663  1.00 39.97  ? 70  C   A "C5'" 1 
ATOM   1511 C  "C4'" . C   A 1 70 ? 59.348 35.925 43.805  1.00 42.01  ? 70  C   A "C4'" 1 
ATOM   1512 O  "O4'" . C   A 1 70 ? 59.923 37.260 43.909  1.00 41.84  ? 70  C   A "O4'" 1 
ATOM   1513 C  "C3'" . C   A 1 70 ? 58.743 35.702 45.172  1.00 41.90  ? 70  C   A "C3'" 1 
ATOM   1514 O  "O3'" . C   A 1 70 ? 58.575 34.329 45.408  1.00 45.51  ? 70  C   A "O3'" 1 
ATOM   1515 C  "C2'" . C   A 1 70 ? 59.765 36.355 46.087  1.00 41.68  ? 70  C   A "C2'" 1 
ATOM   1516 O  "O2'" . C   A 1 70 ? 60.879 35.486 46.166  1.00 42.55  ? 70  C   A "O2'" 1 
ATOM   1517 C  "C1'" . C   A 1 70 ? 60.163 37.591 45.267  1.00 36.50  ? 70  C   A "C1'" 1 
ATOM   1518 N  N1    . C   A 1 70 ? 59.360 38.780 45.597  1.00 39.49  ? 70  C   A N1    1 
ATOM   1519 C  C2    . C   A 1 70 ? 59.805 39.676 46.617  1.00 39.47  ? 70  C   A C2    1 
ATOM   1520 O  O2    . C   A 1 70 ? 60.879 39.451 47.194  1.00 41.25  ? 70  C   A O2    1 
ATOM   1521 N  N3    . C   A 1 70 ? 59.047 40.767 46.935  1.00 37.96  ? 70  C   A N3    1 
ATOM   1522 C  C4    . C   A 1 70 ? 57.901 40.982 46.285  1.00 40.08  ? 70  C   A C4    1 
ATOM   1523 N  N4    . C   A 1 70 ? 57.169 42.038 46.653  1.00 40.99  ? 70  C   A N4    1 
ATOM   1524 C  C5    . C   A 1 70 ? 57.445 40.109 45.229  1.00 39.06  ? 70  C   A C5    1 
ATOM   1525 C  C6    . C   A 1 70 ? 58.187 39.026 44.934  1.00 35.59  ? 70  C   A C6    1 
ATOM   1526 P  P     . G   A 1 71 ? 57.514 33.856 46.509  1.00 51.79  ? 71  G   A P     1 
ATOM   1527 O  OP1   . G   A 1 71 ? 57.674 32.367 46.524  1.00 50.10  ? 71  G   A OP1   1 
ATOM   1528 O  OP2   . G   A 1 71 ? 56.203 34.485 46.254  1.00 46.01  ? 71  G   A OP2   1 
ATOM   1529 O  "O5'" . G   A 1 71 ? 58.085 34.416 47.884  1.00 49.09  ? 71  G   A "O5'" 1 
ATOM   1530 C  "C5'" . G   A 1 71 ? 59.164 33.703 48.505  1.00 56.68  ? 71  G   A "C5'" 1 
ATOM   1531 C  "C4'" . G   A 1 71 ? 59.688 34.434 49.701  1.00 58.95  ? 71  G   A "C4'" 1 
ATOM   1532 O  "O4'" . G   A 1 71 ? 60.125 35.757 49.305  1.00 57.94  ? 71  G   A "O4'" 1 
ATOM   1533 C  "C3'" . G   A 1 71 ? 58.716 34.693 50.839  1.00 63.78  ? 71  G   A "C3'" 1 
ATOM   1534 O  "O3'" . G   A 1 71 ? 58.514 33.580 51.699  1.00 70.59  ? 71  G   A "O3'" 1 
ATOM   1535 C  "C2'" . G   A 1 71 ? 59.392 35.845 51.559  1.00 63.20  ? 71  G   A "C2'" 1 
ATOM   1536 O  "O2'" . G   A 1 71 ? 60.455 35.370 52.375  1.00 64.19  ? 71  G   A "O2'" 1 
ATOM   1537 C  "C1'" . G   A 1 71 ? 59.915 36.661 50.374  1.00 59.19  ? 71  G   A "C1'" 1 
ATOM   1538 N  N9    . G   A 1 71 ? 58.897 37.620 49.946  1.00 58.54  ? 71  G   A N9    1 
ATOM   1539 C  C8    . G   A 1 71 ? 58.004 37.488 48.897  1.00 56.09  ? 71  G   A C8    1 
ATOM   1540 N  N7    . G   A 1 71 ? 57.207 38.519 48.769  1.00 54.09  ? 71  G   A N7    1 
ATOM   1541 C  C5    . G   A 1 71 ? 57.597 39.383 49.788  1.00 53.61  ? 71  G   A C5    1 
ATOM   1542 C  C6    . G   A 1 71 ? 57.114 40.666 50.148  1.00 52.69  ? 71  G   A C6    1 
ATOM   1543 O  O6    . G   A 1 71 ? 56.184 41.315 49.653  1.00 52.69  ? 71  G   A O6    1 
ATOM   1544 N  N1    . G   A 1 71 ? 57.827 41.196 51.223  1.00 52.34  ? 71  G   A N1    1 
ATOM   1545 C  C2    . G   A 1 71 ? 58.844 40.566 51.884  1.00 53.05  ? 71  G   A C2    1 
ATOM   1546 N  N2    . G   A 1 71 ? 59.399 41.251 52.885  1.00 55.23  ? 71  G   A N2    1 
ATOM   1547 N  N3    . G   A 1 71 ? 59.291 39.360 51.585  1.00 54.72  ? 71  G   A N3    1 
ATOM   1548 C  C4    . G   A 1 71 ? 58.636 38.835 50.526  1.00 55.38  ? 71  G   A C4    1 
ATOM   1549 P  P     . C   A 1 72 ? 57.094 33.402 52.426  1.00 73.67  ? 72  C   A P     1 
ATOM   1550 O  OP1   . C   A 1 72 ? 57.177 32.132 53.187  1.00 76.79  ? 72  C   A OP1   1 
ATOM   1551 O  OP2   . C   A 1 72 ? 56.011 33.588 51.427  1.00 75.72  ? 72  C   A OP2   1 
ATOM   1552 O  "O5'" . C   A 1 72 ? 57.017 34.599 53.469  1.00 74.00  ? 72  C   A "O5'" 1 
ATOM   1553 C  "C5'" . C   A 1 72 ? 57.817 34.563 54.660  1.00 75.03  ? 72  C   A "C5'" 1 
ATOM   1554 C  "C4'" . C   A 1 72 ? 57.653 35.834 55.450  1.00 74.38  ? 72  C   A "C4'" 1 
ATOM   1555 O  "O4'" . C   A 1 72 ? 57.964 36.953 54.582  1.00 74.64  ? 72  C   A "O4'" 1 
ATOM   1556 C  "C3'" . C   A 1 72 ? 56.261 36.155 55.979  1.00 76.09  ? 72  C   A "C3'" 1 
ATOM   1557 O  "O3'" . C   A 1 72 ? 55.932 35.502 57.209  1.00 78.85  ? 72  C   A "O3'" 1 
ATOM   1558 C  "C2'" . C   A 1 72 ? 56.302 37.671 56.139  1.00 74.55  ? 72  C   A "C2'" 1 
ATOM   1559 O  "O2'" . C   A 1 72 ? 56.872 38.146 57.338  1.00 75.06  ? 72  C   A "O2'" 1 
ATOM   1560 C  "C1'" . C   A 1 72 ? 57.184 38.082 54.963  1.00 72.55  ? 72  C   A "C1'" 1 
ATOM   1561 N  N1    . C   A 1 72 ? 56.343 38.502 53.829  1.00 68.80  ? 72  C   A N1    1 
ATOM   1562 C  C2    . C   A 1 72 ? 55.796 39.801 53.838  1.00 66.61  ? 72  C   A C2    1 
ATOM   1563 O  O2    . C   A 1 72 ? 56.063 40.568 54.791  1.00 63.14  ? 72  C   A O2    1 
ATOM   1564 N  N3    . C   A 1 72 ? 54.993 40.180 52.815  1.00 64.67  ? 72  C   A N3    1 
ATOM   1565 C  C4    . C   A 1 72 ? 54.734 39.331 51.818  1.00 64.57  ? 72  C   A C4    1 
ATOM   1566 N  N4    . C   A 1 72 ? 53.935 39.749 50.832  1.00 63.54  ? 72  C   A N4    1 
ATOM   1567 C  C5    . C   A 1 72 ? 55.283 38.015 51.780  1.00 64.77  ? 72  C   A C5    1 
ATOM   1568 C  C6    . C   A 1 72 ? 56.077 37.647 52.792  1.00 67.37  ? 72  C   A C6    1 
ATOM   1569 P  P     . A   A 1 73 ? 54.383 35.178 57.550  1.00 79.81  ? 73  A   A P     1 
ATOM   1570 O  OP1   . A   A 1 73 ? 54.333 34.483 58.872  1.00 81.24  ? 73  A   A OP1   1 
ATOM   1571 O  OP2   . A   A 1 73 ? 53.785 34.517 56.355  1.00 79.38  ? 73  A   A OP2   1 
ATOM   1572 O  "O5'" . A   A 1 73 ? 53.739 36.617 57.766  1.00 77.14  ? 73  A   A "O5'" 1 
ATOM   1573 C  "C5'" . A   A 1 73 ? 54.204 37.443 58.849  1.00 75.83  ? 73  A   A "C5'" 1 
ATOM   1574 C  "C4'" . A   A 1 73 ? 53.508 38.772 58.837  1.00 74.32  ? 73  A   A "C4'" 1 
ATOM   1575 O  "O4'" . A   A 1 73 ? 53.912 39.514 57.654  1.00 72.81  ? 73  A   A "O4'" 1 
ATOM   1576 C  "C3'" . A   A 1 73 ? 51.987 38.727 58.750  1.00 73.77  ? 73  A   A "C3'" 1 
ATOM   1577 O  "O3'" . A   A 1 73 ? 51.332 38.492 59.999  1.00 76.93  ? 73  A   A "O3'" 1 
ATOM   1578 C  "C2'" . A   A 1 73 ? 51.667 40.101 58.178  1.00 71.67  ? 73  A   A "C2'" 1 
ATOM   1579 O  "O2'" . A   A 1 73 ? 51.704 41.127 59.141  1.00 70.42  ? 73  A   A "O2'" 1 
ATOM   1580 C  "C1'" . A   A 1 73 ? 52.823 40.304 57.196  1.00 69.17  ? 73  A   A "C1'" 1 
ATOM   1581 N  N9    . A   A 1 73 ? 52.434 39.853 55.856  1.00 64.04  ? 73  A   A N9    1 
ATOM   1582 C  C8    . A   A 1 73 ? 52.792 38.695 55.206  1.00 60.25  ? 73  A   A C8    1 
ATOM   1583 N  N7    . A   A 1 73 ? 52.256 38.571 54.016  1.00 58.41  ? 73  A   A N7    1 
ATOM   1584 C  C5    . A   A 1 73 ? 51.493 39.729 53.869  1.00 57.85  ? 73  A   A C5    1 
ATOM   1585 C  C6    . A   A 1 73 ? 50.683 40.203 52.812  1.00 56.02  ? 73  A   A C6    1 
ATOM   1586 N  N6    . A   A 1 73 ? 50.516 39.541 51.654  1.00 55.49  ? 73  A   A N6    1 
ATOM   1587 N  N1    . A   A 1 73 ? 50.052 41.388 52.979  1.00 53.67  ? 73  A   A N1    1 
ATOM   1588 C  C2    . A   A 1 73 ? 50.233 42.052 54.136  1.00 55.48  ? 73  A   A C2    1 
ATOM   1589 N  N3    . A   A 1 73 ? 50.975 41.713 55.198  1.00 59.62  ? 73  A   A N3    1 
ATOM   1590 C  C4    . A   A 1 73 ? 51.589 40.525 54.993  1.00 59.80  ? 73  A   A C4    1 
ATOM   1591 P  P     . C   A 1 74 ? 49.934 37.680 60.030  1.00 78.48  ? 74  C   A P     1 
ATOM   1592 O  OP1   . C   A 1 74 ? 49.485 37.580 61.446  1.00 80.11  ? 74  C   A OP1   1 
ATOM   1593 O  OP2   . C   A 1 74 ? 50.090 36.441 59.222  1.00 77.06  ? 74  C   A OP2   1 
ATOM   1594 O  "O5'" . C   A 1 74 ? 48.914 38.636 59.275  1.00 77.54  ? 74  C   A "O5'" 1 
ATOM   1595 C  "C5'" . C   A 1 74 ? 48.529 39.898 59.843  1.00 79.25  ? 74  C   A "C5'" 1 
ATOM   1596 C  "C4'" . C   A 1 74 ? 47.463 40.541 58.985  1.00 80.49  ? 74  C   A "C4'" 1 
ATOM   1597 O  "O4'" . C   A 1 74 ? 48.030 40.879 57.690  1.00 79.75  ? 74  C   A "O4'" 1 
ATOM   1598 C  "C3'" . C   A 1 74 ? 46.291 39.627 58.660  1.00 81.62  ? 74  C   A "C3'" 1 
ATOM   1599 O  "O3'" . C   A 1 74 ? 45.292 39.640 59.669  1.00 82.15  ? 74  C   A "O3'" 1 
ATOM   1600 C  "C2'" . C   A 1 74 ? 45.778 40.187 57.340  1.00 80.42  ? 74  C   A "C2'" 1 
ATOM   1601 O  "O2'" . C   A 1 74 ? 44.932 41.302 57.547  1.00 82.05  ? 74  C   A "O2'" 1 
ATOM   1602 C  "C1'" . C   A 1 74 ? 47.080 40.621 56.662  1.00 79.08  ? 74  C   A "C1'" 1 
ATOM   1603 N  N1    . C   A 1 74 ? 47.631 39.588 55.748  1.00 76.36  ? 74  C   A N1    1 
ATOM   1604 C  C2    . C   A 1 74 ? 47.204 39.557 54.400  1.00 74.77  ? 74  C   A C2    1 
ATOM   1605 O  O2    . C   A 1 74 ? 46.399 40.404 54.002  1.00 75.12  ? 74  C   A O2    1 
ATOM   1606 N  N3    . C   A 1 74 ? 47.694 38.606 53.571  1.00 73.87  ? 74  C   A N3    1 
ATOM   1607 C  C4    . C   A 1 74 ? 48.588 37.723 54.024  1.00 73.03  ? 74  C   A C4    1 
ATOM   1608 N  N4    . C   A 1 74 ? 49.055 36.813 53.167  1.00 72.80  ? 74  C   A N4    1 
ATOM   1609 C  C5    . C   A 1 74 ? 49.046 37.734 55.376  1.00 73.50  ? 74  C   A C5    1 
ATOM   1610 C  C6    . C   A 1 74 ? 48.543 38.671 56.196  1.00 74.97  ? 74  C   A C6    1 
ATOM   1611 P  P     . C   A 1 75 ? 44.492 38.295 59.994  1.00 83.00  ? 75  C   A P     1 
ATOM   1612 O  OP1   . C   A 1 75 ? 43.435 38.637 60.974  1.00 84.71  ? 75  C   A OP1   1 
ATOM   1613 O  OP2   . C   A 1 75 ? 45.478 37.229 60.303  1.00 81.99  ? 75  C   A OP2   1 
ATOM   1614 O  "O5'" . C   A 1 75 ? 43.802 37.890 58.618  1.00 84.55  ? 75  C   A "O5'" 1 
ATOM   1615 C  "C5'" . C   A 1 75 ? 42.993 38.825 57.874  1.00 85.33  ? 75  C   A "C5'" 1 
ATOM   1616 C  "C4'" . C   A 1 75 ? 42.564 38.194 56.568  1.00 86.51  ? 75  C   A "C4'" 1 
ATOM   1617 O  "O4'" . C   A 1 75 ? 43.667 38.149 55.630  1.00 84.68  ? 75  C   A "O4'" 1 
ATOM   1618 C  "C3'" . C   A 1 75 ? 42.136 36.747 56.733  1.00 88.27  ? 75  C   A "C3'" 1 
ATOM   1619 O  "O3'" . C   A 1 75 ? 40.778 36.695 57.104  1.00 95.04  ? 75  C   A "O3'" 1 
ATOM   1620 C  "C2'" . C   A 1 75 ? 42.402 36.136 55.366  1.00 85.58  ? 75  C   A "C2'" 1 
ATOM   1621 O  "O2'" . C   A 1 75 ? 41.337 36.317 54.459  1.00 84.94  ? 75  C   A "O2'" 1 
ATOM   1622 C  "C1'" . C   A 1 75 ? 43.631 36.926 54.915  1.00 82.57  ? 75  C   A "C1'" 1 
ATOM   1623 N  N1    . C   A 1 75 ? 44.883 36.201 55.170  1.00 78.44  ? 75  C   A N1    1 
ATOM   1624 C  C2    . C   A 1 75 ? 45.365 35.327 54.193  1.00 75.98  ? 75  C   A C2    1 
ATOM   1625 O  O2    . C   A 1 75 ? 44.719 35.169 53.149  1.00 74.80  ? 75  C   A O2    1 
ATOM   1626 N  N3    . C   A 1 75 ? 46.512 34.673 54.406  1.00 74.76  ? 75  C   A N3    1 
ATOM   1627 C  C4    . C   A 1 75 ? 47.176 34.846 55.543  1.00 75.41  ? 75  C   A C4    1 
ATOM   1628 N  N4    . C   A 1 75 ? 48.311 34.161 55.705  1.00 75.90  ? 75  C   A N4    1 
ATOM   1629 C  C5    . C   A 1 75 ? 46.709 35.719 56.563  1.00 75.64  ? 75  C   A C5    1 
ATOM   1630 C  C6    . C   A 1 75 ? 45.570 36.373 56.337  1.00 77.27  ? 75  C   A C6    1 
ATOM   1631 P  P     . A   A 1 76 ? 40.334 35.770 58.330  1.00 99.54  ? 76  A   A P     1 
ATOM   1632 O  OP1   . A   A 1 76 ? 41.267 36.020 59.481  1.00 99.74  ? 76  A   A OP1   1 
ATOM   1633 O  OP2   . A   A 1 76 ? 40.226 34.405 57.758  1.00 99.88  ? 76  A   A OP2   1 
ATOM   1634 O  "O5'" . A   A 1 76 ? 38.872 36.304 58.697  1.00 100.19 ? 76  A   A "O5'" 1 
ATOM   1635 C  "C5'" . A   A 1 76 ? 38.666 37.596 59.323  1.00 100.18 ? 76  A   A "C5'" 1 
ATOM   1636 C  "C4'" . A   A 1 76 ? 37.607 38.379 58.569  1.00 100.19 ? 76  A   A "C4'" 1 
ATOM   1637 O  "O4'" . A   A 1 76 ? 36.479 37.500 58.278  1.00 100.19 ? 76  A   A "O4'" 1 
ATOM   1638 C  "C3'" . A   A 1 76 ? 37.025 39.585 59.305  1.00 100.19 ? 76  A   A "C3'" 1 
ATOM   1639 O  "O3'" . A   A 1 76 ? 36.428 40.400 58.274  1.00 100.19 ? 76  A   A "O3'" 1 
ATOM   1640 C  "C2'" . A   A 1 76 ? 35.785 38.991 59.981  1.00 100.19 ? 76  A   A "C2'" 1 
ATOM   1641 O  "O2'" . A   A 1 76 ? 34.780 39.945 60.283  1.00 100.19 ? 76  A   A "O2'" 1 
ATOM   1642 C  "C1'" . A   A 1 76 ? 35.314 37.959 58.950  1.00 100.19 ? 76  A   A "C1'" 1 
ATOM   1643 N  N9    . A   A 1 76 ? 34.598 36.785 59.488  1.00 100.19 ? 76  A   A N9    1 
ATOM   1644 C  C8    . A   A 1 76 ? 34.399 35.586 58.829  1.00 100.19 ? 76  A   A C8    1 
ATOM   1645 N  N7    . A   A 1 76 ? 33.715 34.701 59.522  1.00 100.19 ? 76  A   A N7    1 
ATOM   1646 C  C5    . A   A 1 76 ? 33.440 35.352 60.719  1.00 100.19 ? 76  A   A C5    1 
ATOM   1647 C  C6    . A   A 1 76 ? 32.739 34.948 61.881  1.00 100.19 ? 76  A   A C6    1 
ATOM   1648 N  N6    . A   A 1 76 ? 32.161 33.747 62.024  1.00 100.19 ? 76  A   A N6    1 
ATOM   1649 N  N1    . A   A 1 76 ? 32.652 35.835 62.902  1.00 100.19 ? 76  A   A N1    1 
ATOM   1650 C  C2    . A   A 1 76 ? 33.230 37.042 62.758  1.00 100.19 ? 76  A   A C2    1 
ATOM   1651 N  N3    . A   A 1 76 ? 33.911 37.538 61.720  1.00 100.19 ? 76  A   A N3    1 
ATOM   1652 C  C4    . A   A 1 76 ? 33.982 36.637 60.719  1.00 100.19 ? 76  A   A C4    1 
HETATM 1653 MG MG    . MG  B 2 .  ? 70.566 35.530 1.665   1.00 65.44  ? 590 MG  A MG    1 
HETATM 1654 MN MN    . MN  C 3 .  ? 80.714 57.068 31.271  1.00 34.23  ? 530 MN  A MN    1 
HETATM 1655 MG MG    . MG  D 2 .  ? 57.346 47.575 47.279  1.00 62.77  ? 510 MG  A MG    1 
HETATM 1656 MN MN    . MN  E 3 .  ? 49.923 44.427 50.131  1.00 89.20  ? 520 MN  A MN    1 
HETATM 1657 MG MG    . MG  F 2 .  ? 77.110 64.307 25.357  1.00 40.08  ? 540 MG  A MG    1 
HETATM 1658 MG MG    . MG  G 2 .  ? 62.649 46.629 27.595  1.00 47.02  ? 560 MG  A MG    1 
HETATM 1659 MG MG    . MG  H 2 .  ? 73.331 43.321 11.207  1.00 50.39  ? 570 MG  A MG    1 
HETATM 1660 MG MG    . MG  I 2 .  ? 69.222 44.815 33.339  1.00 61.74  ? 580 MG  A MG    1 
HETATM 1661 MN MN    . MN  J 3 .  ? 72.301 48.513 33.894  1.00 56.51  ? 550 MN  A MN    1 
HETATM 1662 O  O     . HOH K 4 .  ? 65.235 47.736 24.306  1.00 29.97  ? 101 HOH A O     1 
HETATM 1663 O  O     . HOH K 4 .  ? 74.678 53.324 26.387  1.00 29.43  ? 102 HOH A O     1 
HETATM 1664 O  O     . HOH K 4 .  ? 79.647 66.543 30.502  1.00 36.21  ? 103 HOH A O     1 
HETATM 1665 O  O     . HOH K 4 .  ? 69.474 53.115 32.762  1.00 35.08  ? 104 HOH A O     1 
HETATM 1666 O  O     . HOH K 4 .  ? 77.803 59.348 29.070  1.00 34.91  ? 105 HOH A O     1 
HETATM 1667 O  O     . HOH K 4 .  ? 86.312 62.508 34.397  1.00 36.87  ? 106 HOH A O     1 
HETATM 1668 O  O     . HOH K 4 .  ? 69.798 47.380 19.420  1.00 35.43  ? 107 HOH A O     1 
HETATM 1669 O  O     . HOH K 4 .  ? 77.715 51.787 26.254  1.00 25.88  ? 108 HOH A O     1 
HETATM 1670 O  O     . HOH K 4 .  ? 66.697 54.043 19.991  1.00 38.52  ? 109 HOH A O     1 
HETATM 1671 O  O     . HOH K 4 .  ? 73.012 72.799 41.306  1.00 35.46  ? 110 HOH A O     1 
HETATM 1672 O  O     . HOH K 4 .  ? 84.966 51.999 36.727  1.00 48.17  ? 111 HOH A O     1 
HETATM 1673 O  O     . HOH K 4 .  ? 75.699 47.326 15.656  1.00 43.55  ? 112 HOH A O     1 
HETATM 1674 O  O     . HOH K 4 .  ? 61.911 39.313 42.834  1.00 38.72  ? 113 HOH A O     1 
HETATM 1675 O  O     . HOH K 4 .  ? 72.538 65.567 46.811  1.00 39.71  ? 114 HOH A O     1 
HETATM 1676 O  O     . HOH K 4 .  ? 64.957 57.362 35.588  1.00 36.28  ? 115 HOH A O     1 
HETATM 1677 O  O     . HOH K 4 .  ? 88.913 61.884 36.666  1.00 33.38  ? 116 HOH A O     1 
HETATM 1678 O  O     . HOH K 4 .  ? 77.430 47.049 24.346  1.00 38.25  ? 117 HOH A O     1 
HETATM 1679 O  O     . HOH K 4 .  ? 85.080 55.471 30.753  1.00 42.06  ? 118 HOH A O     1 
HETATM 1680 O  O     . HOH K 4 .  ? 73.126 42.774 26.088  1.00 39.89  ? 119 HOH A O     1 
HETATM 1681 O  O     . HOH K 4 .  ? 79.541 54.130 20.639  1.00 41.26  ? 120 HOH A O     1 
HETATM 1682 O  O     . HOH K 4 .  ? 75.971 56.472 28.176  1.00 40.47  ? 121 HOH A O     1 
HETATM 1683 O  O     . HOH K 4 .  ? 78.750 74.856 43.549  1.00 41.10  ? 123 HOH A O     1 
HETATM 1684 O  O     . HOH K 4 .  ? 59.778 66.139 42.613  1.00 45.92  ? 124 HOH A O     1 
HETATM 1685 O  O     . HOH K 4 .  ? 72.198 49.756 14.319  1.00 52.62  ? 125 HOH A O     1 
HETATM 1686 O  O     . HOH K 4 .  ? 68.821 65.008 47.959  1.00 45.12  ? 126 HOH A O     1 
HETATM 1687 O  O     . HOH K 4 .  ? 67.849 57.944 43.472  1.00 49.89  ? 127 HOH A O     1 
HETATM 1688 O  O     . HOH K 4 .  ? 67.631 51.090 33.685  1.00 39.79  ? 128 HOH A O     1 
HETATM 1689 O  O     . HOH K 4 .  ? 72.804 72.294 34.649  1.00 52.66  ? 129 HOH A O     1 
HETATM 1690 O  O     . HOH K 4 .  ? 71.861 49.100 17.322  1.00 38.23  ? 130 HOH A O     1 
HETATM 1691 O  O     . HOH K 4 .  ? 65.908 53.779 40.692  1.00 47.68  ? 131 HOH A O     1 
HETATM 1692 O  O     . HOH K 4 .  ? 54.150 42.092 45.268  1.00 43.73  ? 132 HOH A O     1 
HETATM 1693 O  O     . HOH K 4 .  ? 89.825 58.582 38.826  1.00 50.13  ? 133 HOH A O     1 
HETATM 1694 O  O     . HOH K 4 .  ? 84.722 60.865 36.177  1.00 45.21  ? 134 HOH A O     1 
HETATM 1695 O  O     . HOH K 4 .  ? 76.181 73.948 39.594  1.00 36.60  ? 135 HOH A O     1 
HETATM 1696 O  O     . HOH K 4 .  ? 77.944 64.645 31.617  1.00 50.38  ? 136 HOH A O     1 
HETATM 1697 O  O     . HOH K 4 .  ? 63.795 30.172 -8.994  1.00 51.48  ? 137 HOH A O     1 
HETATM 1698 O  O     . HOH K 4 .  ? 79.187 54.860 37.993  1.00 53.51  ? 138 HOH A O     1 
HETATM 1699 O  O     . HOH K 4 .  ? 65.438 43.393 28.966  1.00 49.20  ? 139 HOH A O     1 
HETATM 1700 O  O     . HOH K 4 .  ? 76.458 61.362 31.941  1.00 41.25  ? 140 HOH A O     1 
HETATM 1701 O  O     . HOH K 4 .  ? 65.955 45.704 31.155  1.00 37.31  ? 141 HOH A O     1 
HETATM 1702 O  O     . HOH K 4 .  ? 76.497 48.574 12.986  1.00 52.62  ? 142 HOH A O     1 
HETATM 1703 O  O     . HOH K 4 .  ? 77.696 63.153 34.024  1.00 41.50  ? 143 HOH A O     1 
HETATM 1704 O  O     . HOH K 4 .  ? 83.868 72.752 40.256  1.00 49.29  ? 144 HOH A O     1 
HETATM 1705 O  O     . HOH K 4 .  ? 83.766 59.152 28.946  1.00 39.50  ? 145 HOH A O     1 
HETATM 1706 O  O     . HOH K 4 .  ? 80.216 39.612 12.437  1.00 58.96  ? 146 HOH A O     1 
HETATM 1707 O  O     . HOH K 4 .  ? 74.386 47.570 12.387  1.00 53.73  ? 147 HOH A O     1 
HETATM 1708 O  O     . HOH K 4 .  ? 76.514 45.163 13.466  1.00 52.76  ? 148 HOH A O     1 
HETATM 1709 O  O     . HOH K 4 .  ? 63.032 41.158 41.088  1.00 48.34  ? 149 HOH A O     1 
HETATM 1710 O  O     . HOH K 4 .  ? 71.118 68.217 36.794  1.00 51.89  ? 150 HOH A O     1 
HETATM 1711 O  O     . HOH K 4 .  ? 81.091 65.399 26.812  1.00 44.48  ? 152 HOH A O     1 
HETATM 1712 O  O     . HOH K 4 .  ? 77.519 52.631 29.605  1.00 48.97  ? 153 HOH A O     1 
HETATM 1713 O  O     . HOH K 4 .  ? 59.968 42.360 37.108  1.00 49.01  ? 155 HOH A O     1 
HETATM 1714 O  O     . HOH K 4 .  ? 65.613 68.667 37.929  1.00 45.40  ? 156 HOH A O     1 
HETATM 1715 O  O     . HOH K 4 .  ? 56.060 63.049 38.179  1.00 49.08  ? 157 HOH A O     1 
HETATM 1716 O  O     . HOH K 4 .  ? 65.177 33.333 7.613   1.00 55.31  ? 158 HOH A O     1 
HETATM 1717 O  O     . HOH K 4 .  ? 75.172 67.087 29.927  1.00 54.05  ? 159 HOH A O     1 
HETATM 1718 O  O     . HOH K 4 .  ? 84.839 64.460 36.543  1.00 47.37  ? 160 HOH A O     1 
HETATM 1719 O  O     . HOH K 4 .  ? 84.226 60.935 26.655  1.00 51.90  ? 161 HOH A O     1 
HETATM 1720 O  O     . HOH K 4 .  ? 65.528 66.128 32.712  1.00 58.08  ? 162 HOH A O     1 
HETATM 1721 O  O     . HOH K 4 .  ? 54.801 39.353 47.303  1.00 50.47  ? 163 HOH A O     1 
HETATM 1722 O  O     . HOH K 4 .  ? 82.124 69.432 40.965  1.00 44.14  ? 164 HOH A O     1 
HETATM 1723 O  O     . HOH K 4 .  ? 76.820 63.025 29.658  1.00 45.12  ? 166 HOH A O     1 
HETATM 1724 O  O     . HOH K 4 .  ? 66.938 41.242 10.226  1.00 51.21  ? 167 HOH A O     1 
HETATM 1725 O  O     . HOH K 4 .  ? 85.023 60.379 30.965  1.00 38.68  ? 168 HOH A O     1 
HETATM 1726 O  O     . HOH K 4 .  ? 81.568 67.018 41.474  1.00 54.90  ? 170 HOH A O     1 
HETATM 1727 O  O     . HOH K 4 .  ? 83.672 64.839 39.206  1.00 48.85  ? 171 HOH A O     1 
HETATM 1728 O  O     . HOH K 4 .  ? 69.358 59.813 40.447  1.00 56.32  ? 172 HOH A O     1 
HETATM 1729 O  O     . HOH K 4 .  ? 65.402 39.517 46.250  1.00 42.43  ? 173 HOH A O     1 
HETATM 1730 O  O     . HOH K 4 .  ? 78.025 56.354 40.203  1.00 44.75  ? 174 HOH A O     1 
HETATM 1731 O  O     . HOH K 4 .  ? 72.640 54.075 19.103  1.00 56.38  ? 175 HOH A O     1 
HETATM 1732 O  O     . HOH K 4 .  ? 62.561 49.577 9.243   1.00 59.11  ? 178 HOH A O     1 
HETATM 1733 O  O     . HOH K 4 .  ? 67.851 57.255 35.234  1.00 39.17  ? 181 HOH A O     1 
HETATM 1734 O  O     . HOH K 4 .  ? 65.609 57.383 39.390  1.00 56.16  ? 183 HOH A O     1 
HETATM 1735 O  O     . HOH K 4 .  ? 77.652 63.370 43.463  1.00 46.31  ? 184 HOH A O     1 
HETATM 1736 O  O     . HOH K 4 .  ? 56.156 59.761 40.881  1.00 54.01  ? 185 HOH A O     1 
HETATM 1737 O  O     . HOH K 4 .  ? 68.030 57.904 37.829  1.00 54.73  ? 186 HOH A O     1 
HETATM 1738 O  O     . HOH K 4 .  ? 64.948 50.726 18.484  1.00 45.40  ? 189 HOH A O     1 
HETATM 1739 O  O     . HOH K 4 .  ? 58.581 70.881 37.367  1.00 43.35  ? 191 HOH A O     1 
HETATM 1740 O  O     . HOH K 4 .  ? 69.329 73.815 40.546  1.00 45.81  ? 195 HOH A O     1 
HETATM 1741 O  O     . HOH K 4 .  ? 71.092 44.843 13.706  1.00 46.18  ? 196 HOH A O     1 
HETATM 1742 O  O     . HOH K 4 .  ? 63.773 67.421 46.112  1.00 52.13  ? 197 HOH A O     1 
HETATM 1743 O  O     . HOH K 4 .  ? 79.526 44.399 2.237   1.00 56.28  ? 200 HOH A O     1 
HETATM 1744 O  O     . HOH K 4 .  ? 61.159 66.141 44.876  1.00 49.57  ? 204 HOH A O     1 
HETATM 1745 O  O     . HOH K 4 .  ? 55.921 58.490 38.100  1.00 52.97  ? 205 HOH A O     1 
HETATM 1746 O  O     . HOH K 4 .  ? 61.370 44.287 30.748  1.00 53.06  ? 206 HOH A O     1 
HETATM 1747 O  O     . HOH K 4 .  ? 72.463 66.452 30.831  1.00 58.61  ? 208 HOH A O     1 
HETATM 1748 O  O     . HOH K 4 .  ? 60.953 51.071 33.259  1.00 44.43  ? 210 HOH A O     1 
HETATM 1749 O  O     . HOH K 4 .  ? 55.561 30.912 50.683  1.00 57.65  ? 214 HOH A O     1 
HETATM 1750 O  O     . HOH K 4 .  ? 72.422 43.667 15.579  1.00 52.11  ? 219 HOH A O     1 
HETATM 1751 O  O     . HOH K 4 .  ? 65.477 55.377 26.488  1.00 40.16  ? 222 HOH A O     1 
HETATM 1752 O  O     . HOH K 4 .  ? 62.090 56.194 45.841  1.00 48.80  ? 223 HOH A O     1 
HETATM 1753 O  O     . HOH K 4 .  ? 60.948 49.649 25.176  1.00 34.03  ? 226 HOH A O     1 
HETATM 1754 O  O     . HOH K 4 .  ? 69.381 66.644 35.818  1.00 46.90  ? 228 HOH A O     1 
HETATM 1755 O  O     . HOH K 4 .  ? 66.314 66.119 35.359  1.00 45.34  ? 230 HOH A O     1 
HETATM 1756 O  O     . HOH K 4 .  ? 69.248 64.196 37.425  1.00 39.82  ? 231 HOH A O     1 
HETATM 1757 O  O     . HOH K 4 .  ? 67.490 67.214 38.107  1.00 42.96  ? 233 HOH A O     1 
HETATM 1758 O  O     . HOH K 4 .  ? 70.315 63.256 32.948  1.00 48.78  ? 591 HOH A O     1 
HETATM 1759 O  O     . HOH K 4 .  ? 70.278 67.253 46.788  1.00 49.58  ? 592 HOH A O     1 
HETATM 1760 O  O     . HOH K 4 .  ? 59.221 51.476 25.337  1.00 53.13  ? 593 HOH A O     1 
HETATM 1761 O  O     . HOH K 4 .  ? 36.759 35.239 56.874  1.00 54.15  ? 596 HOH A O     1 
HETATM 1762 O  O     . HOH K 4 .  ? 72.226 76.169 43.785  1.00 56.77  ? 598 HOH A O     1 
HETATM 1763 O  O     . HOH K 4 .  ? 79.271 66.367 28.116  1.00 57.39  ? 602 HOH A O     1 
HETATM 1764 O  O     . HOH K 4 .  ? 68.045 43.077 4.648   1.00 58.94  ? 603 HOH A O     1 
HETATM 1765 O  O     . HOH K 4 .  ? 52.188 37.918 39.395  1.00 56.79  ? 608 HOH A O     1 
HETATM 1766 O  O     . HOH K 4 .  ? 53.895 62.874 28.494  1.00 55.33  ? 610 HOH A O     1 
HETATM 1767 O  O     . HOH K 4 .  ? 70.166 44.500 35.929  1.00 59.11  ? 611 HOH A O     1 
HETATM 1768 O  O     . HOH K 4 .  ? 65.815 56.418 41.681  1.00 63.02  ? 612 HOH A O     1 
HETATM 1769 O  O     . HOH K 4 .  ? 84.445 61.099 24.272  1.00 53.13  ? 613 HOH A O     1 
HETATM 1770 O  O     . HOH K 4 .  ? 62.869 55.003 26.332  1.00 48.50  ? 616 HOH A O     1 
HETATM 1771 O  O     . HOH K 4 .  ? 50.840 53.124 44.965  1.00 59.63  ? 618 HOH A O     1 
HETATM 1772 O  O     . HOH K 4 .  ? 59.036 51.116 45.301  1.00 57.70  ? 626 HOH A O     1 
HETATM 1773 O  O     . HOH K 4 .  ? 51.263 39.619 37.323  1.00 55.93  ? 627 HOH A O     1 
HETATM 1774 O  O     . HOH K 4 .  ? 59.499 57.746 20.958  1.00 59.69  ? 633 HOH A O     1 
HETATM 1775 O  O     . HOH K 4 .  ? 77.328 58.675 26.658  1.00 51.93  ? 635 HOH A O     1 
HETATM 1776 O  O     . HOH K 4 .  ? 72.884 27.349 -8.052  1.00 57.57  ? 644 HOH A O     1 
HETATM 1777 O  O     . HOH K 4 .  ? 63.777 65.450 36.414  1.00 42.27  ? 648 HOH A O     1 
HETATM 1778 O  O     . HOH K 4 .  ? 72.947 30.361 -12.545 1.00 50.16  ? 657 HOH A O     1 
HETATM 1779 O  O     . HOH K 4 .  ? 57.486 68.555 38.998  1.00 41.15  ? 662 HOH A O     1 
HETATM 1780 O  O     . HOH K 4 .  ? 72.917 73.923 36.977  1.00 53.90  ? 670 HOH A O     1 
HETATM 1781 O  O     . HOH K 4 .  ? 82.577 50.441 36.557  1.00 57.25  ? 671 HOH A O     1 
HETATM 1782 O  O     . HOH K 4 .  ? 68.361 55.414 38.613  1.00 58.70  ? 675 HOH A O     1 
HETATM 1783 O  O     . HOH K 4 .  ? 64.284 30.562 -4.413  1.00 56.07  ? 688 HOH A O     1 
HETATM 1784 O  O     . HOH K 4 .  ? 69.590 42.478 12.375  1.00 58.33  ? 690 HOH A O     1 
HETATM 1785 O  O     . HOH K 4 .  ? 83.889 61.714 39.991  1.00 53.01  ? 693 HOH A O     1 
HETATM 1786 O  O     . HOH K 4 .  ? 61.422 49.192 45.932  1.00 56.92  ? 707 HOH A O     1 
HETATM 1787 O  O     . HOH K 4 .  ? 78.882 57.524 30.607  1.00 37.65  ? 708 HOH A O     1 
HETATM 1788 O  O     . HOH K 4 .  ? 82.554 56.601 31.916  1.00 40.13  ? 709 HOH A O     1 
HETATM 1789 O  O     . HOH K 4 .  ? 81.503 58.060 29.728  1.00 34.54  ? 710 HOH A O     1 
HETATM 1790 O  O     . HOH K 4 .  ? 80.684 55.382 30.181  1.00 37.94  ? 711 HOH A O     1 
HETATM 1791 O  O     . HOH K 4 .  ? 59.121 46.716 46.939  1.00 61.12  ? 712 HOH A O     1 
HETATM 1792 O  O     . HOH K 4 .  ? 55.569 48.426 47.617  1.00 62.44  ? 713 HOH A O     1 
HETATM 1793 O  O     . HOH K 4 .  ? 57.139 47.928 45.318  1.00 62.18  ? 714 HOH A O     1 
HETATM 1794 O  O     . HOH K 4 .  ? 57.549 47.218 49.240  1.00 63.71  ? 715 HOH A O     1 
HETATM 1795 O  O     . HOH K 4 .  ? 56.451 45.796 47.050  1.00 64.69  ? 716 HOH A O     1 
HETATM 1796 O  O     . HOH K 4 .  ? 50.566 42.548 49.894  1.00 90.06  ? 717 HOH A O     1 
HETATM 1797 O  O     . HOH K 4 .  ? 49.279 46.306 50.367  1.00 88.19  ? 718 HOH A O     1 
HETATM 1798 O  O     . HOH K 4 .  ? 48.828 43.854 51.702  1.00 89.34  ? 719 HOH A O     1 
HETATM 1799 O  O     . HOH K 4 .  ? 51.020 45.000 48.559  1.00 89.35  ? 720 HOH A O     1 
HETATM 1800 O  O     . HOH K 4 .  ? 48.379 44.049 48.917  1.00 88.93  ? 721 HOH A O     1 
HETATM 1801 O  O     . HOH K 4 .  ? 75.884 64.949 23.911  1.00 42.31  ? 722 HOH A O     1 
HETATM 1802 O  O     . HOH K 4 .  ? 75.591 63.324 26.209  1.00 42.77  ? 723 HOH A O     1 
HETATM 1803 O  O     . HOH K 4 .  ? 78.628 65.295 24.504  1.00 43.67  ? 724 HOH A O     1 
HETATM 1804 O  O     . HOH K 4 .  ? 63.354 44.755 27.511  1.00 43.55  ? 725 HOH A O     1 
HETATM 1805 O  O     . HOH K 4 .  ? 61.942 48.502 27.674  1.00 41.87  ? 726 HOH A O     1 
HETATM 1806 O  O     . HOH K 4 .  ? 62.352 46.432 29.566  1.00 44.71  ? 727 HOH A O     1 
HETATM 1807 O  O     . HOH K 4 .  ? 62.949 46.821 25.628  1.00 43.68  ? 728 HOH A O     1 
HETATM 1808 O  O     . HOH K 4 .  ? 64.498 47.320 27.946  1.00 41.71  ? 729 HOH A O     1 
HETATM 1809 O  O     . HOH K 4 .  ? 60.803 45.945 27.247  1.00 46.26  ? 730 HOH A O     1 
HETATM 1810 O  O     . HOH K 4 .  ? 72.795 42.398 9.514   1.00 50.20  ? 731 HOH A O     1 
HETATM 1811 O  O     . HOH K 4 .  ? 73.865 44.246 12.908  1.00 49.37  ? 732 HOH A O     1 
HETATM 1812 O  O     . HOH K 4 .  ? 74.746 41.940 11.519  1.00 51.45  ? 733 HOH A O     1 
HETATM 1813 O  O     . HOH K 4 .  ? 71.918 44.704 10.896  1.00 48.14  ? 734 HOH A O     1 
HETATM 1814 O  O     . HOH K 4 .  ? 72.020 42.211 12.224  1.00 47.02  ? 735 HOH A O     1 
HETATM 1815 O  O     . HOH K 4 .  ? 74.644 44.433 10.185  1.00 47.69  ? 736 HOH A O     1 
HETATM 1816 O  O     . HOH K 4 .  ? 68.372 45.072 31.544  1.00 46.52  ? 737 HOH A O     1 
HETATM 1817 O  O     . HOH K 4 .  ? 70.576 49.247 33.191  1.00 58.54  ? 738 HOH A O     1 
HETATM 1818 O  O     . HOH K 4 .  ? 74.024 47.784 34.605  1.00 58.71  ? 739 HOH A O     1 
HETATM 1819 O  O     . HOH K 4 .  ? 71.834 46.713 33.168  1.00 61.51  ? 740 HOH A O     1 
HETATM 1820 O  O     . HOH K 4 .  ? 72.774 50.321 34.622  1.00 60.62  ? 741 HOH A O     1 
HETATM 1821 O  O     . HOH K 4 .  ? 71.401 48.057 35.619  1.00 60.95  ? 742 HOH A O     1 
# 
loop_
_pdbx_poly_seq_scheme.asym_id 
_pdbx_poly_seq_scheme.entity_id 
_pdbx_poly_seq_scheme.seq_id 
_pdbx_poly_seq_scheme.mon_id 
_pdbx_poly_seq_scheme.ndb_seq_num 
_pdbx_poly_seq_scheme.pdb_seq_num 
_pdbx_poly_seq_scheme.auth_seq_num 
_pdbx_poly_seq_scheme.pdb_mon_id 
_pdbx_poly_seq_scheme.auth_mon_id 
_pdbx_poly_seq_scheme.pdb_strand_id 
_pdbx_poly_seq_scheme.pdb_ins_code 
_pdbx_poly_seq_scheme.hetero 
A 1 1  G   1  1  1  G   G   A . n 
A 1 2  C   2  2  2  C   C   A . n 
A 1 3  G   3  3  3  G   G   A . n 
A 1 4  G   4  4  4  G   G   A . n 
A 1 5  A   5  5  5  A   A   A . n 
A 1 6  U   6  6  6  U   U   A . n 
A 1 7  U   7  7  7  U   U   A . n 
A 1 8  U   8  8  8  U   U   A . n 
A 1 9  A   9  9  9  A   A   A . n 
A 1 10 2MG 10 10 10 2MG 2MG A . n 
A 1 11 C   11 11 11 C   C   A . n 
A 1 12 U   12 12 12 U   U   A . n 
A 1 13 C   13 13 13 C   C   A . n 
A 1 14 A   14 14 14 A   A   A . n 
A 1 15 G   15 15 15 G   G   A . n 
A 1 16 H2U 16 16 16 H2U H2U A . n 
A 1 17 H2U 17 17 17 H2U H2U A . n 
A 1 18 G   18 18 18 G   G   A . n 
A 1 19 G   19 19 19 G   G   A . n 
A 1 20 G   20 20 20 G   G   A . n 
A 1 21 A   21 21 21 A   A   A . n 
A 1 22 G   22 22 22 G   G   A . n 
A 1 23 A   23 23 23 A   A   A . n 
A 1 24 G   24 24 24 G   G   A . n 
A 1 25 C   25 25 25 C   C   A . n 
A 1 26 M2G 26 26 26 M2G M2G A . n 
A 1 27 C   27 27 27 C   C   A . n 
A 1 28 C   28 28 28 C   C   A . n 
A 1 29 A   29 29 29 A   A   A . n 
A 1 30 G   30 30 30 G   G   A . n 
A 1 31 A   31 31 31 A   A   A . n 
A 1 32 OMC 32 32 32 OMC OMC A . n 
A 1 33 U   33 33 33 U   U   A . n 
A 1 34 OMG 34 34 34 OMG OMG A . n 
A 1 35 A   35 35 35 A   A   A . n 
A 1 36 A   36 36 36 A   A   A . n 
A 1 37 YYG 37 37 37 YYG YG  A . n 
A 1 38 A   38 38 38 A   A   A . n 
A 1 39 PSU 39 39 39 PSU PSU A . n 
A 1 40 5MC 40 40 40 5MC 5MC A . n 
A 1 41 U   41 41 41 U   U   A . n 
A 1 42 G   42 42 42 G   G   A . n 
A 1 43 G   43 43 43 G   G   A . n 
A 1 44 A   44 44 44 A   A   A . n 
A 1 45 G   45 45 45 G   G   A . n 
A 1 46 7MG 46 46 46 7MG 7MG A . n 
A 1 47 U   47 47 47 U   U   A . n 
A 1 48 C   48 48 48 C   C   A . n 
A 1 49 5MC 49 49 49 5MC 5MC A . n 
A 1 50 U   50 50 50 U   U   A . n 
A 1 51 G   51 51 51 G   G   A . n 
A 1 52 U   52 52 52 U   U   A . n 
A 1 53 G   53 53 53 G   G   A . n 
A 1 54 5MU 54 54 54 5MU 5MU A . n 
A 1 55 PSU 55 55 55 PSU PSU A . n 
A 1 56 C   56 56 56 C   C   A . n 
A 1 57 G   57 57 57 G   G   A . n 
A 1 58 1MA 58 58 58 1MA 1MA A . n 
A 1 59 U   59 59 59 U   U   A . n 
A 1 60 C   60 60 60 C   C   A . n 
A 1 61 C   61 61 61 C   C   A . n 
A 1 62 A   62 62 62 A   A   A . n 
A 1 63 C   63 63 63 C   C   A . n 
A 1 64 A   64 64 64 A   A   A . n 
A 1 65 G   65 65 65 G   G   A . n 
A 1 66 A   66 66 66 A   A   A . n 
A 1 67 A   67 67 67 A   A   A . n 
A 1 68 U   68 68 68 U   U   A . n 
A 1 69 U   69 69 69 U   U   A . n 
A 1 70 C   70 70 70 C   C   A . n 
A 1 71 G   71 71 71 G   G   A . n 
A 1 72 C   72 72 72 C   C   A . n 
A 1 73 A   73 73 73 A   A   A . n 
A 1 74 C   74 74 74 C   C   A . n 
A 1 75 C   75 75 75 C   C   A . n 
A 1 76 A   76 76 76 A   A   A . n 
# 
loop_
_pdbx_struct_mod_residue.id 
_pdbx_struct_mod_residue.label_asym_id 
_pdbx_struct_mod_residue.label_comp_id 
_pdbx_struct_mod_residue.label_seq_id 
_pdbx_struct_mod_residue.auth_asym_id 
_pdbx_struct_mod_residue.auth_comp_id 
_pdbx_struct_mod_residue.auth_seq_id 
_pdbx_struct_mod_residue.PDB_ins_code 
_pdbx_struct_mod_residue.parent_comp_id 
_pdbx_struct_mod_residue.details 
1  A 2MG 10 A 2MG 10 ? G "2N-METHYLGUANOSINE-5'-MONOPHOSPHATE"   
2  A H2U 16 A H2U 16 ? U "5,6-DIHYDROURIDINE-5'-MONOPHOSPHATE"   
3  A H2U 17 A H2U 17 ? U "5,6-DIHYDROURIDINE-5'-MONOPHOSPHATE"   
4  A M2G 26 A M2G 26 ? G "N2-DIMETHYLGUANOSINE-5'-MONOPHOSPHATE" 
5  A OMC 32 A OMC 32 ? C "O2'-METHYLYCYTIDINE-5'-MONOPHOSPHATE"  
6  A OMG 34 A OMG 34 ? G "O2'-METHYLGUANOSINE-5'-MONOPHOSPHATE"  
7  A YYG 37 A YYG 37 ? G ?                                       
8  A PSU 39 A PSU 39 ? U "PSEUDOURIDINE-5'-MONOPHOSPHATE"        
9  A 5MC 40 A 5MC 40 ? C "5-METHYLCYTIDINE-5'-MONOPHOSPHATE"     
10 A 7MG 46 A 7MG 46 ? G ?                                       
11 A 5MC 49 A 5MC 49 ? C "5-METHYLCYTIDINE-5'-MONOPHOSPHATE"     
12 A 5MU 54 A 5MU 54 ? U 
;5-METHYLURIDINE 5'-MONOPHOSPHATE
;
13 A PSU 55 A PSU 55 ? U "PSEUDOURIDINE-5'-MONOPHOSPHATE"        
14 A 1MA 58 A 1MA 58 ? A ?                                       
# 
_pdbx_struct_assembly.id                   1 
_pdbx_struct_assembly.details              author_defined_assembly 
_pdbx_struct_assembly.method_details       ? 
_pdbx_struct_assembly.oligomeric_details   monomeric 
_pdbx_struct_assembly.oligomeric_count     1 
# 
_pdbx_struct_assembly_gen.assembly_id       1 
_pdbx_struct_assembly_gen.oper_expression   1 
_pdbx_struct_assembly_gen.asym_id_list      A,B,C,D,E,F,G,H,I,J,K 
# 
_pdbx_struct_oper_list.id                   1 
_pdbx_struct_oper_list.type                 'identity operation' 
_pdbx_struct_oper_list.name                 1_555 
_pdbx_struct_oper_list.symmetry_operation   x,y,z 
_pdbx_struct_oper_list.matrix[1][1]         1.0000000000 
_pdbx_struct_oper_list.matrix[1][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[1][3]         0.0000000000 
_pdbx_struct_oper_list.vector[1]            0.0000000000 
_pdbx_struct_oper_list.matrix[2][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[2][2]         1.0000000000 
_pdbx_struct_oper_list.matrix[2][3]         0.0000000000 
_pdbx_struct_oper_list.vector[2]            0.0000000000 
_pdbx_struct_oper_list.matrix[3][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][3]         1.0000000000 
_pdbx_struct_oper_list.vector[3]            0.0000000000 
# 
loop_
_pdbx_struct_conn_angle.id 
_pdbx_struct_conn_angle.ptnr1_label_atom_id 
_pdbx_struct_conn_angle.ptnr1_label_alt_id 
_pdbx_struct_conn_angle.ptnr1_label_asym_id 
_pdbx_struct_conn_angle.ptnr1_label_comp_id 
_pdbx_struct_conn_angle.ptnr1_label_seq_id 
_pdbx_struct_conn_angle.ptnr1_auth_atom_id 
_pdbx_struct_conn_angle.ptnr1_auth_asym_id 
_pdbx_struct_conn_angle.ptnr1_auth_comp_id 
_pdbx_struct_conn_angle.ptnr1_auth_seq_id 
_pdbx_struct_conn_angle.ptnr1_PDB_ins_code 
_pdbx_struct_conn_angle.ptnr1_symmetry 
_pdbx_struct_conn_angle.ptnr2_label_atom_id 
_pdbx_struct_conn_angle.ptnr2_label_alt_id 
_pdbx_struct_conn_angle.ptnr2_label_asym_id 
_pdbx_struct_conn_angle.ptnr2_label_comp_id 
_pdbx_struct_conn_angle.ptnr2_label_seq_id 
_pdbx_struct_conn_angle.ptnr2_auth_atom_id 
_pdbx_struct_conn_angle.ptnr2_auth_asym_id 
_pdbx_struct_conn_angle.ptnr2_auth_comp_id 
_pdbx_struct_conn_angle.ptnr2_auth_seq_id 
_pdbx_struct_conn_angle.ptnr2_PDB_ins_code 
_pdbx_struct_conn_angle.ptnr2_symmetry 
_pdbx_struct_conn_angle.ptnr3_label_atom_id 
_pdbx_struct_conn_angle.ptnr3_label_alt_id 
_pdbx_struct_conn_angle.ptnr3_label_asym_id 
_pdbx_struct_conn_angle.ptnr3_label_comp_id 
_pdbx_struct_conn_angle.ptnr3_label_seq_id 
_pdbx_struct_conn_angle.ptnr3_auth_atom_id 
_pdbx_struct_conn_angle.ptnr3_auth_asym_id 
_pdbx_struct_conn_angle.ptnr3_auth_comp_id 
_pdbx_struct_conn_angle.ptnr3_auth_seq_id 
_pdbx_struct_conn_angle.ptnr3_PDB_ins_code 
_pdbx_struct_conn_angle.ptnr3_symmetry 
_pdbx_struct_conn_angle.value 
_pdbx_struct_conn_angle.value_esd 
1   O     ? K HOH .  ? A HOH 714 ? 1_555 MG ? D MG . ? A MG 510 ? 1_555 O     ? K HOH .  ? A HOH 716 ? 1_555 89.9  ? 
2   O     ? K HOH .  ? A HOH 714 ? 1_555 MG ? D MG . ? A MG 510 ? 1_555 O     ? K HOH .  ? A HOH 715 ? 1_555 179.8 ? 
3   O     ? K HOH .  ? A HOH 716 ? 1_555 MG ? D MG . ? A MG 510 ? 1_555 O     ? K HOH .  ? A HOH 715 ? 1_555 89.9  ? 
4   O     ? K HOH .  ? A HOH 714 ? 1_555 MG ? D MG . ? A MG 510 ? 1_555 O     ? K HOH .  ? A HOH 712 ? 1_555 90.1  ? 
5   O     ? K HOH .  ? A HOH 716 ? 1_555 MG ? D MG . ? A MG 510 ? 1_555 O     ? K HOH .  ? A HOH 712 ? 1_555 89.8  ? 
6   O     ? K HOH .  ? A HOH 715 ? 1_555 MG ? D MG . ? A MG 510 ? 1_555 O     ? K HOH .  ? A HOH 712 ? 1_555 90.0  ? 
7   O     ? K HOH .  ? A HOH 714 ? 1_555 MG ? D MG . ? A MG 510 ? 1_555 O     ? K HOH .  ? A HOH 713 ? 1_555 89.9  ? 
8   O     ? K HOH .  ? A HOH 716 ? 1_555 MG ? D MG . ? A MG 510 ? 1_555 O     ? K HOH .  ? A HOH 713 ? 1_555 90.0  ? 
9   O     ? K HOH .  ? A HOH 715 ? 1_555 MG ? D MG . ? A MG 510 ? 1_555 O     ? K HOH .  ? A HOH 713 ? 1_555 90.0  ? 
10  O     ? K HOH .  ? A HOH 712 ? 1_555 MG ? D MG . ? A MG 510 ? 1_555 O     ? K HOH .  ? A HOH 713 ? 1_555 179.8 ? 
11  O     ? K HOH .  ? A HOH 717 ? 1_555 MN ? E MN . ? A MN 520 ? 1_555 O     ? K HOH .  ? A HOH 718 ? 1_555 180.0 ? 
12  O     ? K HOH .  ? A HOH 717 ? 1_555 MN ? E MN . ? A MN 520 ? 1_555 O     ? K HOH .  ? A HOH 719 ? 1_555 90.0  ? 
13  O     ? K HOH .  ? A HOH 718 ? 1_555 MN ? E MN . ? A MN 520 ? 1_555 O     ? K HOH .  ? A HOH 719 ? 1_555 90.0  ? 
14  O     ? K HOH .  ? A HOH 717 ? 1_555 MN ? E MN . ? A MN 520 ? 1_555 O     ? K HOH .  ? A HOH 720 ? 1_555 90.0  ? 
15  O     ? K HOH .  ? A HOH 718 ? 1_555 MN ? E MN . ? A MN 520 ? 1_555 O     ? K HOH .  ? A HOH 720 ? 1_555 90.0  ? 
16  O     ? K HOH .  ? A HOH 719 ? 1_555 MN ? E MN . ? A MN 520 ? 1_555 O     ? K HOH .  ? A HOH 720 ? 1_555 180.0 ? 
17  O     ? K HOH .  ? A HOH 717 ? 1_555 MN ? E MN . ? A MN 520 ? 1_555 O     ? K HOH .  ? A HOH 721 ? 1_555 89.9  ? 
18  O     ? K HOH .  ? A HOH 718 ? 1_555 MN ? E MN . ? A MN 520 ? 1_555 O     ? K HOH .  ? A HOH 721 ? 1_555 90.0  ? 
19  O     ? K HOH .  ? A HOH 719 ? 1_555 MN ? E MN . ? A MN 520 ? 1_555 O     ? K HOH .  ? A HOH 721 ? 1_555 90.0  ? 
20  O     ? K HOH .  ? A HOH 720 ? 1_555 MN ? E MN . ? A MN 520 ? 1_555 O     ? K HOH .  ? A HOH 721 ? 1_555 90.0  ? 
21  O     ? K HOH .  ? A HOH 717 ? 1_555 MN ? E MN . ? A MN 520 ? 1_555 N7    ? A G   1  ? A G   1   ? 1_555 96.0  ? 
22  O     ? K HOH .  ? A HOH 718 ? 1_555 MN ? E MN . ? A MN 520 ? 1_555 N7    ? A G   1  ? A G   1   ? 1_555 84.1  ? 
23  O     ? K HOH .  ? A HOH 719 ? 1_555 MN ? E MN . ? A MN 520 ? 1_555 N7    ? A G   1  ? A G   1   ? 1_555 80.4  ? 
24  O     ? K HOH .  ? A HOH 720 ? 1_555 MN ? E MN . ? A MN 520 ? 1_555 N7    ? A G   1  ? A G   1   ? 1_555 99.6  ? 
25  O     ? K HOH .  ? A HOH 721 ? 1_555 MN ? E MN . ? A MN 520 ? 1_555 N7    ? A G   1  ? A G   1   ? 1_555 168.7 ? 
26  O     ? K HOH .  ? A HOH 708 ? 1_555 MN ? C MN . ? A MN 530 ? 1_555 O     ? K HOH .  ? A HOH 709 ? 1_555 179.3 ? 
27  O     ? K HOH .  ? A HOH 708 ? 1_555 MN ? C MN . ? A MN 530 ? 1_555 O     ? K HOH .  ? A HOH 710 ? 1_555 89.5  ? 
28  O     ? K HOH .  ? A HOH 709 ? 1_555 MN ? C MN . ? A MN 530 ? 1_555 O     ? K HOH .  ? A HOH 710 ? 1_555 90.1  ? 
29  O     ? K HOH .  ? A HOH 708 ? 1_555 MN ? C MN . ? A MN 530 ? 1_555 O     ? K HOH .  ? A HOH 711 ? 1_555 89.9  ? 
30  O     ? K HOH .  ? A HOH 709 ? 1_555 MN ? C MN . ? A MN 530 ? 1_555 O     ? K HOH .  ? A HOH 711 ? 1_555 89.6  ? 
31  O     ? K HOH .  ? A HOH 710 ? 1_555 MN ? C MN . ? A MN 530 ? 1_555 O     ? K HOH .  ? A HOH 711 ? 1_555 90.2  ? 
32  O     ? K HOH .  ? A HOH 708 ? 1_555 MN ? C MN . ? A MN 530 ? 1_555 "O2'" ? A H2U 16 ? A H2U 16  ? 1_555 85.1  ? 
33  O     ? K HOH .  ? A HOH 709 ? 1_555 MN ? C MN . ? A MN 530 ? 1_555 "O2'" ? A H2U 16 ? A H2U 16  ? 1_555 95.0  ? 
34  O     ? K HOH .  ? A HOH 710 ? 1_555 MN ? C MN . ? A MN 530 ? 1_555 "O2'" ? A H2U 16 ? A H2U 16  ? 1_555 160.4 ? 
35  O     ? K HOH .  ? A HOH 711 ? 1_555 MN ? C MN . ? A MN 530 ? 1_555 "O2'" ? A H2U 16 ? A H2U 16  ? 1_555 71.0  ? 
36  O     ? K HOH .  ? A HOH 708 ? 1_555 MN ? C MN . ? A MN 530 ? 1_555 OP1   ? A G   19 ? A G   19  ? 1_555 92.5  ? 
37  O     ? K HOH .  ? A HOH 709 ? 1_555 MN ? C MN . ? A MN 530 ? 1_555 OP1   ? A G   19 ? A G   19  ? 1_555 88.1  ? 
38  O     ? K HOH .  ? A HOH 710 ? 1_555 MN ? C MN . ? A MN 530 ? 1_555 OP1   ? A G   19 ? A G   19  ? 1_555 94.9  ? 
39  O     ? K HOH .  ? A HOH 711 ? 1_555 MN ? C MN . ? A MN 530 ? 1_555 OP1   ? A G   19 ? A G   19  ? 1_555 174.4 ? 
40  "O2'" ? A H2U 16 ? A H2U 16  ? 1_555 MN ? C MN . ? A MN 530 ? 1_555 OP1   ? A G   19 ? A G   19  ? 1_555 104.1 ? 
41  O     ? K HOH .  ? A HOH 723 ? 1_555 MG ? F MG . ? A MG 540 ? 1_555 O     ? K HOH .  ? A HOH 722 ? 1_555 90.0  ? 
42  O     ? K HOH .  ? A HOH 723 ? 1_555 MG ? F MG . ? A MG 540 ? 1_555 O     ? K HOH .  ? A HOH 724 ? 1_555 179.9 ? 
43  O     ? K HOH .  ? A HOH 722 ? 1_555 MG ? F MG . ? A MG 540 ? 1_555 O     ? K HOH .  ? A HOH 724 ? 1_555 89.9  ? 
44  O     ? K HOH .  ? A HOH 723 ? 1_555 MG ? F MG . ? A MG 540 ? 1_555 OP1   ? A G   20 ? A G   20  ? 1_555 97.1  ? 
45  O     ? K HOH .  ? A HOH 722 ? 1_555 MG ? F MG . ? A MG 540 ? 1_555 OP1   ? A G   20 ? A G   20  ? 1_555 165.8 ? 
46  O     ? K HOH .  ? A HOH 724 ? 1_555 MG ? F MG . ? A MG 540 ? 1_555 OP1   ? A G   20 ? A G   20  ? 1_555 83.0  ? 
47  O     ? K HOH .  ? A HOH 723 ? 1_555 MG ? F MG . ? A MG 540 ? 1_555 OP2   ? A A   21 ? A A   21  ? 1_555 78.6  ? 
48  O     ? K HOH .  ? A HOH 722 ? 1_555 MG ? F MG . ? A MG 540 ? 1_555 OP2   ? A A   21 ? A A   21  ? 1_555 87.7  ? 
49  O     ? K HOH .  ? A HOH 724 ? 1_555 MG ? F MG . ? A MG 540 ? 1_555 OP2   ? A A   21 ? A A   21  ? 1_555 101.5 ? 
50  OP1   ? A G   20 ? A G   20  ? 1_555 MG ? F MG . ? A MG 540 ? 1_555 OP2   ? A A   21 ? A A   21  ? 1_555 81.7  ? 
51  O     ? K HOH .  ? A HOH 738 ? 1_555 MN ? J MN . ? A MN 550 ? 1_555 O     ? K HOH .  ? A HOH 739 ? 1_555 179.7 ? 
52  O     ? K HOH .  ? A HOH 738 ? 1_555 MN ? J MN . ? A MN 550 ? 1_555 O     ? K HOH .  ? A HOH 740 ? 1_555 90.1  ? 
53  O     ? K HOH .  ? A HOH 739 ? 1_555 MN ? J MN . ? A MN 550 ? 1_555 O     ? K HOH .  ? A HOH 740 ? 1_555 90.1  ? 
54  O     ? K HOH .  ? A HOH 738 ? 1_555 MN ? J MN . ? A MN 550 ? 1_555 O     ? K HOH .  ? A HOH 741 ? 1_555 90.0  ? 
55  O     ? K HOH .  ? A HOH 739 ? 1_555 MN ? J MN . ? A MN 550 ? 1_555 O     ? K HOH .  ? A HOH 741 ? 1_555 89.8  ? 
56  O     ? K HOH .  ? A HOH 740 ? 1_555 MN ? J MN . ? A MN 550 ? 1_555 O     ? K HOH .  ? A HOH 741 ? 1_555 179.9 ? 
57  O     ? K HOH .  ? A HOH 738 ? 1_555 MN ? J MN . ? A MN 550 ? 1_555 O     ? K HOH .  ? A HOH 742 ? 1_555 89.9  ? 
58  O     ? K HOH .  ? A HOH 739 ? 1_555 MN ? J MN . ? A MN 550 ? 1_555 O     ? K HOH .  ? A HOH 742 ? 1_555 89.9  ? 
59  O     ? K HOH .  ? A HOH 740 ? 1_555 MN ? J MN . ? A MN 550 ? 1_555 O     ? K HOH .  ? A HOH 742 ? 1_555 90.2  ? 
60  O     ? K HOH .  ? A HOH 741 ? 1_555 MN ? J MN . ? A MN 550 ? 1_555 O     ? K HOH .  ? A HOH 742 ? 1_555 89.9  ? 
61  O     ? K HOH .  ? A HOH 738 ? 1_555 MN ? J MN . ? A MN 550 ? 1_555 N7    ? A G   15 ? A G   15  ? 1_555 92.3  ? 
62  O     ? K HOH .  ? A HOH 739 ? 1_555 MN ? J MN . ? A MN 550 ? 1_555 N7    ? A G   15 ? A G   15  ? 1_555 87.9  ? 
63  O     ? K HOH .  ? A HOH 740 ? 1_555 MN ? J MN . ? A MN 550 ? 1_555 N7    ? A G   15 ? A G   15  ? 1_555 94.0  ? 
64  O     ? K HOH .  ? A HOH 741 ? 1_555 MN ? J MN . ? A MN 550 ? 1_555 N7    ? A G   15 ? A G   15  ? 1_555 85.9  ? 
65  O     ? K HOH .  ? A HOH 742 ? 1_555 MN ? J MN . ? A MN 550 ? 1_555 N7    ? A G   15 ? A G   15  ? 1_555 175.3 ? 
66  O     ? K HOH .  ? A HOH 728 ? 1_555 MG ? G MG . ? A MG 560 ? 1_555 O     ? K HOH .  ? A HOH 725 ? 1_555 89.8  ? 
67  O     ? K HOH .  ? A HOH 728 ? 1_555 MG ? G MG . ? A MG 560 ? 1_555 O     ? K HOH .  ? A HOH 730 ? 1_555 90.0  ? 
68  O     ? K HOH .  ? A HOH 725 ? 1_555 MG ? G MG . ? A MG 560 ? 1_555 O     ? K HOH .  ? A HOH 730 ? 1_555 89.9  ? 
69  O     ? K HOH .  ? A HOH 728 ? 1_555 MG ? G MG . ? A MG 560 ? 1_555 O     ? K HOH .  ? A HOH 727 ? 1_555 179.8 ? 
70  O     ? K HOH .  ? A HOH 725 ? 1_555 MG ? G MG . ? A MG 560 ? 1_555 O     ? K HOH .  ? A HOH 727 ? 1_555 90.1  ? 
71  O     ? K HOH .  ? A HOH 730 ? 1_555 MG ? G MG . ? A MG 560 ? 1_555 O     ? K HOH .  ? A HOH 727 ? 1_555 90.0  ? 
72  O     ? K HOH .  ? A HOH 728 ? 1_555 MG ? G MG . ? A MG 560 ? 1_555 O     ? K HOH .  ? A HOH 729 ? 1_555 90.0  ? 
73  O     ? K HOH .  ? A HOH 725 ? 1_555 MG ? G MG . ? A MG 560 ? 1_555 O     ? K HOH .  ? A HOH 729 ? 1_555 90.3  ? 
74  O     ? K HOH .  ? A HOH 730 ? 1_555 MG ? G MG . ? A MG 560 ? 1_555 O     ? K HOH .  ? A HOH 729 ? 1_555 179.8 ? 
75  O     ? K HOH .  ? A HOH 727 ? 1_555 MG ? G MG . ? A MG 560 ? 1_555 O     ? K HOH .  ? A HOH 729 ? 1_555 89.9  ? 
76  O     ? K HOH .  ? A HOH 728 ? 1_555 MG ? G MG . ? A MG 560 ? 1_555 O     ? K HOH .  ? A HOH 726 ? 1_555 90.1  ? 
77  O     ? K HOH .  ? A HOH 725 ? 1_555 MG ? G MG . ? A MG 560 ? 1_555 O     ? K HOH .  ? A HOH 726 ? 1_555 179.8 ? 
78  O     ? K HOH .  ? A HOH 730 ? 1_555 MG ? G MG . ? A MG 560 ? 1_555 O     ? K HOH .  ? A HOH 726 ? 1_555 90.1  ? 
79  O     ? K HOH .  ? A HOH 727 ? 1_555 MG ? G MG . ? A MG 560 ? 1_555 O     ? K HOH .  ? A HOH 726 ? 1_555 90.0  ? 
80  O     ? K HOH .  ? A HOH 729 ? 1_555 MG ? G MG . ? A MG 560 ? 1_555 O     ? K HOH .  ? A HOH 726 ? 1_555 89.8  ? 
81  O     ? K HOH .  ? A HOH 731 ? 1_555 MG ? H MG . ? A MG 570 ? 1_555 O     ? K HOH .  ? A HOH 733 ? 1_555 90.2  ? 
82  O     ? K HOH .  ? A HOH 731 ? 1_555 MG ? H MG . ? A MG 570 ? 1_555 O     ? K HOH .  ? A HOH 734 ? 1_555 89.9  ? 
83  O     ? K HOH .  ? A HOH 733 ? 1_555 MG ? H MG . ? A MG 570 ? 1_555 O     ? K HOH .  ? A HOH 734 ? 1_555 179.9 ? 
84  O     ? K HOH .  ? A HOH 731 ? 1_555 MG ? H MG . ? A MG 570 ? 1_555 O     ? K HOH .  ? A HOH 736 ? 1_555 90.0  ? 
85  O     ? K HOH .  ? A HOH 733 ? 1_555 MG ? H MG . ? A MG 570 ? 1_555 O     ? K HOH .  ? A HOH 736 ? 1_555 90.0  ? 
86  O     ? K HOH .  ? A HOH 734 ? 1_555 MG ? H MG . ? A MG 570 ? 1_555 O     ? K HOH .  ? A HOH 736 ? 1_555 90.0  ? 
87  O     ? K HOH .  ? A HOH 731 ? 1_555 MG ? H MG . ? A MG 570 ? 1_555 O     ? K HOH .  ? A HOH 735 ? 1_555 89.9  ? 
88  O     ? K HOH .  ? A HOH 733 ? 1_555 MG ? H MG . ? A MG 570 ? 1_555 O     ? K HOH .  ? A HOH 735 ? 1_555 90.1  ? 
89  O     ? K HOH .  ? A HOH 734 ? 1_555 MG ? H MG . ? A MG 570 ? 1_555 O     ? K HOH .  ? A HOH 735 ? 1_555 90.0  ? 
90  O     ? K HOH .  ? A HOH 736 ? 1_555 MG ? H MG . ? A MG 570 ? 1_555 O     ? K HOH .  ? A HOH 735 ? 1_555 179.9 ? 
91  O     ? K HOH .  ? A HOH 731 ? 1_555 MG ? H MG . ? A MG 570 ? 1_555 O     ? K HOH .  ? A HOH 732 ? 1_555 179.9 ? 
92  O     ? K HOH .  ? A HOH 733 ? 1_555 MG ? H MG . ? A MG 570 ? 1_555 O     ? K HOH .  ? A HOH 732 ? 1_555 89.9  ? 
93  O     ? K HOH .  ? A HOH 734 ? 1_555 MG ? H MG . ? A MG 570 ? 1_555 O     ? K HOH .  ? A HOH 732 ? 1_555 90.1  ? 
94  O     ? K HOH .  ? A HOH 736 ? 1_555 MG ? H MG . ? A MG 570 ? 1_555 O     ? K HOH .  ? A HOH 732 ? 1_555 90.1  ? 
95  O     ? K HOH .  ? A HOH 735 ? 1_555 MG ? H MG . ? A MG 570 ? 1_555 O     ? K HOH .  ? A HOH 732 ? 1_555 90.0  ? 
96  O     ? K HOH .  ? A HOH 737 ? 1_555 MG ? I MG . ? A MG 580 ? 1_555 OP1   ? A U   7  ? A U   7   ? 1_555 105.5 ? 
97  O     ? K HOH .  ? A HOH 737 ? 1_555 MG ? I MG . ? A MG 580 ? 1_555 O     ? K HOH .  ? A HOH 611 ? 1_555 174.7 ? 
98  OP1   ? A U   7  ? A U   7   ? 1_555 MG ? I MG . ? A MG 580 ? 1_555 O     ? K HOH .  ? A HOH 611 ? 1_555 70.8  ? 
99  O     ? K HOH .  ? A HOH 737 ? 1_555 MG ? I MG . ? A MG 580 ? 1_555 OP2   ? A A   14 ? A A   14  ? 1_555 97.3  ? 
100 OP1   ? A U   7  ? A U   7   ? 1_555 MG ? I MG . ? A MG 580 ? 1_555 OP2   ? A A   14 ? A A   14  ? 1_555 145.5 ? 
101 O     ? K HOH .  ? A HOH 611 ? 1_555 MG ? I MG . ? A MG 580 ? 1_555 OP2   ? A A   14 ? A A   14  ? 1_555 87.8  ? 
102 N7    ? A A   38 ? A A   38  ? 1_555 MG ? B MG . ? A MG 590 ? 1_555 N6    ? A A   38 ? A A   38  ? 1_555 60.8  ? 
103 N7    ? A A   38 ? A A   38  ? 1_555 MG ? B MG . ? A MG 590 ? 1_555 OP2   ? A YYG 37 ? A YYG 37  ? 1_555 132.9 ? 
104 N6    ? A A   38 ? A A   38  ? 1_555 MG ? B MG . ? A MG 590 ? 1_555 OP2   ? A YYG 37 ? A YYG 37  ? 1_555 164.8 ? 
# 
loop_
_pdbx_audit_revision_history.ordinal 
_pdbx_audit_revision_history.data_content_type 
_pdbx_audit_revision_history.major_revision 
_pdbx_audit_revision_history.minor_revision 
_pdbx_audit_revision_history.revision_date 
1 'Structure model' 1 0 2000-10-02 
2 'Structure model' 1 1 2008-04-27 
3 'Structure model' 1 2 2011-07-13 
4 'Structure model' 1 3 2011-12-21 
# 
_pdbx_audit_revision_details.ordinal             1 
_pdbx_audit_revision_details.revision_ordinal    1 
_pdbx_audit_revision_details.data_content_type   'Structure model' 
_pdbx_audit_revision_details.provider            repository 
_pdbx_audit_revision_details.type                'Initial release' 
_pdbx_audit_revision_details.description         ? 
# 
loop_
_pdbx_audit_revision_group.ordinal 
_pdbx_audit_revision_group.revision_ordinal 
_pdbx_audit_revision_group.data_content_type 
_pdbx_audit_revision_group.group 
1 2 'Structure model' 'Version format compliance' 
2 3 'Structure model' 'Non-polymer description'   
3 3 'Structure model' 'Version format compliance' 
4 4 'Structure model' 'Source and taxonomy'       
# 
loop_
_software.name 
_software.classification 
_software.version 
_software.citation_id 
_software.pdbx_ordinal 
DENZO     'data reduction' . ? 1 
SCALEPACK 'data scaling'   . ? 2 
CNS       refinement       . ? 3 
CNS       phasing          . ? 4 
# 
loop_
_pdbx_validate_rmsd_bond.id 
_pdbx_validate_rmsd_bond.PDB_model_num 
_pdbx_validate_rmsd_bond.auth_atom_id_1 
_pdbx_validate_rmsd_bond.auth_asym_id_1 
_pdbx_validate_rmsd_bond.auth_comp_id_1 
_pdbx_validate_rmsd_bond.auth_seq_id_1 
_pdbx_validate_rmsd_bond.PDB_ins_code_1 
_pdbx_validate_rmsd_bond.label_alt_id_1 
_pdbx_validate_rmsd_bond.auth_atom_id_2 
_pdbx_validate_rmsd_bond.auth_asym_id_2 
_pdbx_validate_rmsd_bond.auth_comp_id_2 
_pdbx_validate_rmsd_bond.auth_seq_id_2 
_pdbx_validate_rmsd_bond.PDB_ins_code_2 
_pdbx_validate_rmsd_bond.label_alt_id_2 
_pdbx_validate_rmsd_bond.bond_value 
_pdbx_validate_rmsd_bond.bond_target_value 
_pdbx_validate_rmsd_bond.bond_deviation 
_pdbx_validate_rmsd_bond.bond_standard_deviation 
_pdbx_validate_rmsd_bond.linker_flag 
1 1 P  A G 1  ? ? OP3 A G 1  ? ? 1.523 1.607 -0.084 0.012 N 
2 1 C5 A A 9  ? ? C6  A A 9  ? ? 1.351 1.406 -0.055 0.009 N 
3 1 C4 A C 60 ? ? N4  A C 60 ? ? 1.279 1.335 -0.056 0.009 N 
# 
loop_
_pdbx_validate_planes.id 
_pdbx_validate_planes.PDB_model_num 
_pdbx_validate_planes.auth_comp_id 
_pdbx_validate_planes.auth_asym_id 
_pdbx_validate_planes.auth_seq_id 
_pdbx_validate_planes.PDB_ins_code 
_pdbx_validate_planes.label_alt_id 
_pdbx_validate_planes.rmsd 
_pdbx_validate_planes.type 
1 1 G A 15 ? ? 0.057 'SIDE CHAIN' 
2 1 G A 19 ? ? 0.077 'SIDE CHAIN' 
3 1 U A 50 ? ? 0.074 'SIDE CHAIN' 
# 
loop_
_ndb_struct_conf_na.entry_id 
_ndb_struct_conf_na.feature 
1EHZ 'double helix'         
1EHZ 'a-form double helix'  
1EHZ 'parallel strands'     
1EHZ 'hairpin loop'         
1EHZ 'mismatched base pair' 
1EHZ 'four-way junction'    
# 
loop_
_ndb_struct_na_base_pair.model_number 
_ndb_struct_na_base_pair.i_label_asym_id 
_ndb_struct_na_base_pair.i_label_comp_id 
_ndb_struct_na_base_pair.i_label_seq_id 
_ndb_struct_na_base_pair.i_symmetry 
_ndb_struct_na_base_pair.j_label_asym_id 
_ndb_struct_na_base_pair.j_label_comp_id 
_ndb_struct_na_base_pair.j_label_seq_id 
_ndb_struct_na_base_pair.j_symmetry 
_ndb_struct_na_base_pair.shear 
_ndb_struct_na_base_pair.stretch 
_ndb_struct_na_base_pair.stagger 
_ndb_struct_na_base_pair.buckle 
_ndb_struct_na_base_pair.propeller 
_ndb_struct_na_base_pair.opening 
_ndb_struct_na_base_pair.pair_number 
_ndb_struct_na_base_pair.pair_name 
_ndb_struct_na_base_pair.i_auth_asym_id 
_ndb_struct_na_base_pair.i_auth_seq_id 
_ndb_struct_na_base_pair.i_PDB_ins_code 
_ndb_struct_na_base_pair.j_auth_asym_id 
_ndb_struct_na_base_pair.j_auth_seq_id 
_ndb_struct_na_base_pair.j_PDB_ins_code 
_ndb_struct_na_base_pair.hbond_type_28 
_ndb_struct_na_base_pair.hbond_type_12 
1 A G   1  1_555 A C   72 1_555 -0.553 -0.280 -0.429 -6.298  -9.830  -0.698   1  A_G1:C72_A      A 1  ? A 72 ? 19 1 
1 A C   2  1_555 A G   71 1_555 0.128  -0.078 0.027  -7.959  -10.304 -2.672   2  A_C2:G71_A      A 2  ? A 71 ? 19 1 
1 A G   3  1_555 A C   70 1_555 -0.085 -0.113 0.082  -4.802  -11.890 0.281    3  A_G3:C70_A      A 3  ? A 70 ? 19 1 
1 A G   4  1_555 A U   69 1_555 -2.556 -0.513 0.458  11.053  -9.694  -1.554   4  A_G4:U69_A      A 4  ? A 69 ? 28 ? 
1 A A   5  1_555 A U   68 1_555 0.103  -0.019 0.065  3.411   -17.395 5.568    5  A_A5:U68_A      A 5  ? A 68 ? 20 1 
1 A U   6  1_555 A A   67 1_555 0.063  -0.127 -0.080 -0.631  -23.712 5.504    6  A_U6:A67_A      A 6  ? A 67 ? 20 1 
1 A U   7  1_555 A A   66 1_555 -0.006 -0.197 0.018  -3.188  -2.376  0.303    7  A_U7:A66_A      A 7  ? A 66 ? 20 1 
1 A 5MC 49 1_555 A G   65 1_555 0.274  0.021  0.040  1.609   -11.935 0.871    8  A_5MC49:G65_A   A 49 ? A 65 ? 19 1 
1 A U   50 1_555 A A   64 1_555 -0.132 -0.165 -0.106 -1.832  -6.147  -2.402   9  A_U50:A64_A     A 50 ? A 64 ? 20 1 
1 A G   51 1_555 A C   63 1_555 -0.140 -0.172 -0.264 -6.201  -13.769 2.268    10 A_G51:C63_A     A 51 ? A 63 ? 19 1 
1 A U   52 1_555 A A   62 1_555 -0.267 -0.093 0.030  -1.472  -10.842 2.546    11 A_U52:A62_A     A 52 ? A 62 ? 20 1 
1 A G   53 1_555 A C   61 1_555 -0.279 -0.146 -0.139 -10.859 -9.916  0.242    12 A_G53:C61_A     A 53 ? A 61 ? 19 1 
1 A 5MU 54 1_555 A 1MA 58 1_555 4.209  -1.633 0.237  -5.066  6.430   -103.975 13 A_5MU54:1MA58_A A 54 ? A 58 ? 24 4 
1 A PSU 55 1_555 A G   18 1_555 0.684  -5.633 0.205  20.117  2.802   -90.538  14 A_PSU55:G18_A   A 55 ? A 18 ? ?  2 
1 A G   15 1_555 A C   48 1_555 0.120  3.745  0.169  4.744   -0.971  155.684  15 A_G15:C48_A     A 15 ? A 48 ? 22 2 
1 A U   8  1_555 A A   14 1_555 4.137  -1.910 0.766  -4.615  12.117  -103.091 16 A_U8:A14_A      A 8  ? A 14 ? 24 4 
1 A G   22 1_555 A C   13 1_555 -0.251 -0.147 0.004  -5.908  1.200   0.477    17 A_G22:C13_A     A 22 ? A 13 ? 19 1 
1 A A   23 1_555 A U   12 1_555 0.143  -0.013 0.191  10.594  -4.257  -5.875   18 A_A23:U12_A     A 23 ? A 12 ? 20 1 
1 A G   24 1_555 A C   11 1_555 -0.234 -0.185 0.234  6.245   -17.055 2.131    19 A_G24:C11_A     A 24 ? A 11 ? 19 1 
1 A C   25 1_555 A 2MG 10 1_555 0.167  -0.115 -0.278 9.560   -12.565 -0.800   20 A_C25:2MG10_A   A 25 ? A 10 ? 19 1 
1 A M2G 26 1_555 A A   44 1_555 -0.314 1.433  -0.301 22.176  -34.084 -17.601  21 A_M2G26:A44_A   A 26 ? A 44 ? 8  ? 
1 A C   27 1_555 A G   43 1_555 0.165  -0.122 0.368  6.667   -17.676 -4.272   22 A_C27:G43_A     A 27 ? A 43 ? 19 1 
1 A C   28 1_555 A G   42 1_555 0.149  -0.015 0.370  2.465   -10.657 2.457    23 A_C28:G42_A     A 28 ? A 42 ? 19 1 
1 A A   29 1_555 A U   41 1_555 0.359  -0.059 -0.010 2.362   -9.480  2.555    24 A_A29:U41_A     A 29 ? A 41 ? 20 1 
1 A G   30 1_555 A 5MC 40 1_555 -0.428 0.114  -0.044 -15.015 -18.344 7.481    25 A_G30:5MC40_A   A 30 ? A 40 ? 19 1 
1 A OMC 32 1_555 A A   38 1_555 6.787  -1.660 0.712  -5.434  9.640   16.624   26 A_OMC32:A38_A   A 32 ? A 38 ? ?  ? 
1 A G   19 1_555 A C   56 1_555 -0.456 -0.052 -0.074 -25.996 -24.904 0.728    27 A_G19:C56_A     A 19 ? A 56 ? 19 1 
# 
loop_
_ndb_struct_na_base_pair_step.model_number 
_ndb_struct_na_base_pair_step.i_label_asym_id_1 
_ndb_struct_na_base_pair_step.i_label_comp_id_1 
_ndb_struct_na_base_pair_step.i_label_seq_id_1 
_ndb_struct_na_base_pair_step.i_symmetry_1 
_ndb_struct_na_base_pair_step.j_label_asym_id_1 
_ndb_struct_na_base_pair_step.j_label_comp_id_1 
_ndb_struct_na_base_pair_step.j_label_seq_id_1 
_ndb_struct_na_base_pair_step.j_symmetry_1 
_ndb_struct_na_base_pair_step.i_label_asym_id_2 
_ndb_struct_na_base_pair_step.i_label_comp_id_2 
_ndb_struct_na_base_pair_step.i_label_seq_id_2 
_ndb_struct_na_base_pair_step.i_symmetry_2 
_ndb_struct_na_base_pair_step.j_label_asym_id_2 
_ndb_struct_na_base_pair_step.j_label_comp_id_2 
_ndb_struct_na_base_pair_step.j_label_seq_id_2 
_ndb_struct_na_base_pair_step.j_symmetry_2 
_ndb_struct_na_base_pair_step.shift 
_ndb_struct_na_base_pair_step.slide 
_ndb_struct_na_base_pair_step.rise 
_ndb_struct_na_base_pair_step.tilt 
_ndb_struct_na_base_pair_step.roll 
_ndb_struct_na_base_pair_step.twist 
_ndb_struct_na_base_pair_step.x_displacement 
_ndb_struct_na_base_pair_step.y_displacement 
_ndb_struct_na_base_pair_step.helical_rise 
_ndb_struct_na_base_pair_step.inclination 
_ndb_struct_na_base_pair_step.tip 
_ndb_struct_na_base_pair_step.helical_twist 
_ndb_struct_na_base_pair_step.step_number 
_ndb_struct_na_base_pair_step.step_name 
_ndb_struct_na_base_pair_step.i_auth_asym_id_1 
_ndb_struct_na_base_pair_step.i_auth_seq_id_1 
_ndb_struct_na_base_pair_step.i_PDB_ins_code_1 
_ndb_struct_na_base_pair_step.j_auth_asym_id_1 
_ndb_struct_na_base_pair_step.j_auth_seq_id_1 
_ndb_struct_na_base_pair_step.j_PDB_ins_code_1 
_ndb_struct_na_base_pair_step.i_auth_asym_id_2 
_ndb_struct_na_base_pair_step.i_auth_seq_id_2 
_ndb_struct_na_base_pair_step.i_PDB_ins_code_2 
_ndb_struct_na_base_pair_step.j_auth_asym_id_2 
_ndb_struct_na_base_pair_step.j_auth_seq_id_2 
_ndb_struct_na_base_pair_step.j_PDB_ins_code_2 
1 A G   1  1_555 A C   72 1_555 A C   2  1_555 A G   71 1_555 -0.385 -1.786 3.288  -3.431  7.629  35.075  -3.922 0.157  2.873  
12.441 5.595   36.028  1  AA_G1C2:G71C72_AA         A 1  ? A 72 ? A 2  ? A 71 ? 
1 A C   2  1_555 A G   71 1_555 A G   3  1_555 A C   70 1_555 0.046  -1.178 3.144  0.919   9.118  30.567  -3.659 0.069  2.690  
16.826 -1.695  31.880  2  AA_C2G3:C70G71_AA         A 2  ? A 71 ? A 3  ? A 70 ? 
1 A G   3  1_555 A C   70 1_555 A G   4  1_555 A U   69 1_555 0.385  -1.600 2.634  -5.031  7.037  22.515  -5.457 -2.083 1.923  
17.227 12.316  24.099  3  AA_G3G4:U69C70_AA         A 3  ? A 70 ? A 4  ? A 69 ? 
1 A G   4  1_555 A U   69 1_555 A A   5  1_555 A U   68 1_555 0.035  -1.247 3.323  0.912   6.798  44.573  -2.231 0.035  3.110  
8.900  -1.194  45.071  4  AA_G4A5:U68U69_AA         A 4  ? A 69 ? A 5  ? A 68 ? 
1 A A   5  1_555 A U   68 1_555 A U   6  1_555 A A   67 1_555 0.389  -1.632 3.192  2.243   9.710  32.343  -4.235 -0.339 2.627  
16.936 -3.913  33.805  5  AA_A5U6:A67U68_AA         A 5  ? A 68 ? A 6  ? A 67 ? 
1 A U   6  1_555 A A   67 1_555 A U   7  1_555 A A   66 1_555 -0.513 -1.377 3.349  -1.467  10.254 30.177  -4.305 0.678  2.766  
19.004 2.719   31.866  6  AA_U6U7:A66A67_AA         A 6  ? A 67 ? A 7  ? A 66 ? 
1 A U   7  1_555 A A   66 1_555 A 5MC 49 1_555 A G   65 1_555 -0.290 -2.188 3.210  1.858   2.403  34.519  -4.027 0.760  3.036  
4.040  -3.123  34.648  7  AA_U75MC49:G65A66_AA      A 7  ? A 66 ? A 49 ? A 65 ? 
1 A 5MC 49 1_555 A G   65 1_555 A U   50 1_555 A A   64 1_555 -0.967 -2.115 3.271  -0.279  6.567  27.973  -5.636 1.891  2.722  
13.352 0.567   28.720  8  AA_5MC49U50:A64G65_AA     A 49 ? A 65 ? A 50 ? A 64 ? 
1 A U   50 1_555 A A   64 1_555 A G   51 1_555 A C   63 1_555 0.239  -1.381 3.457  1.618   8.545  31.580  -3.934 -0.143 2.999  
15.340 -2.905  32.727  9  AA_U50G51:C63A64_AA       A 50 ? A 64 ? A 51 ? A 63 ? 
1 A G   51 1_555 A C   63 1_555 A U   52 1_555 A A   62 1_555 0.129  -1.064 3.066  -2.262  5.142  30.350  -2.909 -0.642 2.835  
9.717  4.274   30.854  10 AA_G51U52:A62C63_AA       A 51 ? A 63 ? A 52 ? A 62 ? 
1 A U   52 1_555 A A   62 1_555 A G   53 1_555 A C   61 1_555 0.724  -1.884 3.547  2.012   4.854  32.418  -4.207 -0.919 3.276  
8.623  -3.574  32.830  11 AA_U52G53:C61A62_AA       A 52 ? A 62 ? A 53 ? A 61 ? 
1 A G   53 1_555 A C   61 1_555 A 5MU 54 1_555 A 1MA 58 1_555 -2.102 -2.661 3.269  -0.217  -1.680 90.933  -1.833 1.470  3.311  
-1.178 0.152   90.945  12 AA_G535MU54:1MA58C61_AA   A 53 ? A 61 ? A 54 ? A 58 ? 
1 A 5MU 54 1_555 A 1MA 58 1_555 A PSU 55 1_555 A G   18 1_555 2.310  -2.425 3.243  8.102   3.090  42.330  -3.609 -2.319 3.431  
4.226  -11.081 43.169  13 AA_5MU54PSU55:G181MA58_AA A 54 ? A 58 ? A 55 ? A 18 ? 
1 A G   15 1_555 A C   48 1_555 A U   8  1_555 A A   14 1_555 3.948  -1.455 -3.372 145.058 90.809 153.806 -0.543 -2.269 -2.703 
45.465 -72.626 177.994 14 AA_G15U8:A14C48_AA        A 15 ? A 48 ? A 8  ? A 14 ? 
1 A U   8  1_555 A A   14 1_555 A G   22 1_555 A C   13 1_555 2.359  -0.337 3.261  0.439   -7.665 56.703  0.071  -2.441 3.294  
-8.030 -0.460  57.178  15 AA_U8G22:C13A14_AA        A 8  ? A 14 ? A 22 ? A 13 ? 
1 A G   22 1_555 A C   13 1_555 A A   23 1_555 A U   12 1_555 -1.759 -1.959 2.933  -3.032  1.549  27.987  -4.352 2.968  2.992  
3.188  6.240   28.189  16 AA_G22A23:U12C13_AA       A 22 ? A 13 ? A 23 ? A 12 ? 
1 A A   23 1_555 A U   12 1_555 A G   24 1_555 A C   11 1_555 0.374  -1.252 3.298  -0.826  6.453  30.796  -3.478 -0.840 2.970  
11.983 1.534   31.459  17 AA_A23G24:C11U12_AA       A 23 ? A 12 ? A 24 ? A 11 ? 
1 A G   24 1_555 A C   11 1_555 A C   25 1_555 A 2MG 10 1_555 0.844  -1.480 2.991  4.642   7.077  37.771  -3.009 -0.766 2.761  
10.768 -7.062  38.674  18 AA_G24C25:2MG10C11_AA     A 24 ? A 11 ? A 25 ? A 10 ? 
1 A C   25 1_555 A 2MG 10 1_555 A M2G 26 1_555 A A   44 1_555 2.982  -2.782 3.478  -16.505 13.484 58.746  -3.235 -3.550 2.034  
13.278 16.254  62.167  19 AA_C25M2G26:A442MG10_AA   A 25 ? A 10 ? A 26 ? A 44 ? 
1 A M2G 26 1_555 A A   44 1_555 A C   27 1_555 A G   43 1_555 0.647  -1.400 3.431  -6.184  7.910  38.009  -3.019 -1.695 2.956  
11.893 9.298   39.265  20 AA_M2G26C27:G43A44_AA     A 26 ? A 44 ? A 27 ? A 43 ? 
1 A C   27 1_555 A G   43 1_555 A C   28 1_555 A G   42 1_555 0.282  -1.477 3.322  -0.164  3.714  38.462  -2.687 -0.447 3.170  
5.622  0.248   38.634  21 AA_C27C28:G42G43_AA       A 27 ? A 43 ? A 28 ? A 42 ? 
1 A C   28 1_555 A G   42 1_555 A A   29 1_555 A U   41 1_555 -0.031 -1.932 3.125  1.865   6.175  28.011  -5.133 0.436  2.639  
12.548 -3.789  28.730  22 AA_C28A29:U41G42_AA       A 28 ? A 42 ? A 29 ? A 41 ? 
1 A A   29 1_555 A U   41 1_555 A G   30 1_555 A 5MC 40 1_555 0.624  -2.092 3.624  2.868   6.903  30.393  -5.249 -0.588 3.129  
12.922 -5.369  31.278  23 AA_A29G30:5MC40U41_AA     A 29 ? A 41 ? A 30 ? A 40 ? 
1 A G   30 1_555 A 5MC 40 1_555 A OMC 32 1_555 A A   38 1_555 0.742  -1.861 6.052  5.545   16.073 86.454  -1.970 -0.318 5.742  
11.639 -4.015  87.785  24 AA_G30OMC32:A385MC40_AA   A 30 ? A 40 ? A 32 ? A 38 ? 
# 
loop_
_pdbx_entity_nonpoly.entity_id 
_pdbx_entity_nonpoly.name 
_pdbx_entity_nonpoly.comp_id 
2 'MAGNESIUM ION'      MG  
3 'MANGANESE (II) ION' MN  
4 water                HOH 
# 
loop_
_pdbx_nonpoly_scheme.asym_id 
_pdbx_nonpoly_scheme.entity_id 
_pdbx_nonpoly_scheme.mon_id 
_pdbx_nonpoly_scheme.ndb_seq_num 
_pdbx_nonpoly_scheme.pdb_seq_num 
_pdbx_nonpoly_scheme.auth_seq_num 
_pdbx_nonpoly_scheme.pdb_mon_id 
_pdbx_nonpoly_scheme.auth_mon_id 
_pdbx_nonpoly_scheme.pdb_strand_id 
_pdbx_nonpoly_scheme.pdb_ins_code 
B 2 MG  1   590 590 MG  MG  A . 
C 3 MN  1   530 530 MN  O4M A . 
D 2 MG  1   510 510 MG  MO5 A . 
E 3 MN  1   520 520 MN  MN5 A . 
F 2 MG  1   540 540 MG  MO3 A . 
G 2 MG  1   560 560 MG  MO6 A . 
H 2 MG  1   570 570 MG  MO6 A . 
I 2 MG  1   580 580 MG  MO1 A . 
J 3 MN  1   550 550 MN  MN5 A . 
K 4 HOH 1   101 101 HOH HOH A . 
K 4 HOH 2   102 102 HOH HOH A . 
K 4 HOH 3   103 103 HOH HOH A . 
K 4 HOH 4   104 104 HOH HOH A . 
K 4 HOH 5   105 105 HOH HOH A . 
K 4 HOH 6   106 106 HOH HOH A . 
K 4 HOH 7   107 107 HOH HOH A . 
K 4 HOH 8   108 108 HOH HOH A . 
K 4 HOH 9   109 109 HOH HOH A . 
K 4 HOH 10  110 110 HOH HOH A . 
K 4 HOH 11  111 111 HOH HOH A . 
K 4 HOH 12  112 112 HOH HOH A . 
K 4 HOH 13  113 113 HOH HOH A . 
K 4 HOH 14  114 114 HOH HOH A . 
K 4 HOH 15  115 115 HOH HOH A . 
K 4 HOH 16  116 116 HOH HOH A . 
K 4 HOH 17  117 117 HOH HOH A . 
K 4 HOH 18  118 118 HOH HOH A . 
K 4 HOH 19  119 119 HOH HOH A . 
K 4 HOH 20  120 120 HOH HOH A . 
K 4 HOH 21  121 121 HOH HOH A . 
K 4 HOH 22  123 123 HOH HOH A . 
K 4 HOH 23  124 124 HOH HOH A . 
K 4 HOH 24  125 125 HOH HOH A . 
K 4 HOH 25  126 126 HOH HOH A . 
K 4 HOH 26  127 127 HOH HOH A . 
K 4 HOH 27  128 128 HOH HOH A . 
K 4 HOH 28  129 129 HOH HOH A . 
K 4 HOH 29  130 130 HOH HOH A . 
K 4 HOH 30  131 131 HOH HOH A . 
K 4 HOH 31  132 132 HOH HOH A . 
K 4 HOH 32  133 133 HOH HOH A . 
K 4 HOH 33  134 134 HOH HOH A . 
K 4 HOH 34  135 135 HOH HOH A . 
K 4 HOH 35  136 136 HOH HOH A . 
K 4 HOH 36  137 137 HOH HOH A . 
K 4 HOH 37  138 138 HOH HOH A . 
K 4 HOH 38  139 139 HOH HOH A . 
K 4 HOH 39  140 140 HOH HOH A . 
K 4 HOH 40  141 141 HOH HOH A . 
K 4 HOH 41  142 142 HOH HOH A . 
K 4 HOH 42  143 143 HOH HOH A . 
K 4 HOH 43  144 144 HOH HOH A . 
K 4 HOH 44  145 145 HOH HOH A . 
K 4 HOH 45  146 146 HOH HOH A . 
K 4 HOH 46  147 147 HOH HOH A . 
K 4 HOH 47  148 148 HOH HOH A . 
K 4 HOH 48  149 149 HOH HOH A . 
K 4 HOH 49  150 150 HOH HOH A . 
K 4 HOH 50  152 152 HOH HOH A . 
K 4 HOH 51  153 153 HOH HOH A . 
K 4 HOH 52  155 155 HOH HOH A . 
K 4 HOH 53  156 156 HOH HOH A . 
K 4 HOH 54  157 157 HOH HOH A . 
K 4 HOH 55  158 158 HOH HOH A . 
K 4 HOH 56  159 159 HOH HOH A . 
K 4 HOH 57  160 160 HOH HOH A . 
K 4 HOH 58  161 161 HOH HOH A . 
K 4 HOH 59  162 162 HOH HOH A . 
K 4 HOH 60  163 163 HOH HOH A . 
K 4 HOH 61  164 164 HOH HOH A . 
K 4 HOH 62  166 166 HOH HOH A . 
K 4 HOH 63  167 167 HOH HOH A . 
K 4 HOH 64  168 168 HOH HOH A . 
K 4 HOH 65  170 170 HOH HOH A . 
K 4 HOH 66  171 171 HOH HOH A . 
K 4 HOH 67  172 172 HOH HOH A . 
K 4 HOH 68  173 173 HOH HOH A . 
K 4 HOH 69  174 174 HOH HOH A . 
K 4 HOH 70  175 175 HOH HOH A . 
K 4 HOH 71  178 178 HOH HOH A . 
K 4 HOH 72  181 181 HOH HOH A . 
K 4 HOH 73  183 183 HOH HOH A . 
K 4 HOH 74  184 184 HOH HOH A . 
K 4 HOH 75  185 185 HOH HOH A . 
K 4 HOH 76  186 186 HOH HOH A . 
K 4 HOH 77  189 189 HOH HOH A . 
K 4 HOH 78  191 191 HOH HOH A . 
K 4 HOH 79  195 195 HOH HOH A . 
K 4 HOH 80  196 196 HOH HOH A . 
K 4 HOH 81  197 197 HOH HOH A . 
K 4 HOH 82  200 200 HOH HOH A . 
K 4 HOH 83  204 204 HOH HOH A . 
K 4 HOH 84  205 205 HOH HOH A . 
K 4 HOH 85  206 206 HOH HOH A . 
K 4 HOH 86  208 208 HOH HOH A . 
K 4 HOH 87  210 210 HOH HOH A . 
K 4 HOH 88  214 214 HOH HOH A . 
K 4 HOH 89  219 219 HOH HOH A . 
K 4 HOH 90  222 222 HOH HOH A . 
K 4 HOH 91  223 223 HOH HOH A . 
K 4 HOH 92  226 226 HOH HOH A . 
K 4 HOH 93  228 228 HOH HOH A . 
K 4 HOH 94  230 230 HOH HOH A . 
K 4 HOH 95  231 231 HOH HOH A . 
K 4 HOH 96  233 233 HOH HOH A . 
K 4 HOH 97  591 591 HOH HOH A . 
K 4 HOH 98  592 592 HOH HOH A . 
K 4 HOH 99  593 593 HOH HOH A . 
K 4 HOH 100 596 596 HOH HOH A . 
K 4 HOH 101 598 598 HOH HOH A . 
K 4 HOH 102 602 602 HOH HOH A . 
K 4 HOH 103 603 603 HOH HOH A . 
K 4 HOH 104 608 608 HOH HOH A . 
K 4 HOH 105 610 610 HOH HOH A . 
K 4 HOH 106 611 611 HOH HOH A . 
K 4 HOH 107 612 612 HOH HOH A . 
K 4 HOH 108 613 613 HOH HOH A . 
K 4 HOH 109 616 616 HOH HOH A . 
K 4 HOH 110 618 618 HOH HOH A . 
K 4 HOH 111 626 626 HOH HOH A . 
K 4 HOH 112 627 627 HOH HOH A . 
K 4 HOH 113 633 633 HOH HOH A . 
K 4 HOH 114 635 635 HOH HOH A . 
K 4 HOH 115 644 644 HOH HOH A . 
K 4 HOH 116 648 648 HOH HOH A . 
K 4 HOH 117 657 657 HOH HOH A . 
K 4 HOH 118 662 662 HOH HOH A . 
K 4 HOH 119 670 670 HOH HOH A . 
K 4 HOH 120 671 671 HOH HOH A . 
K 4 HOH 121 675 675 HOH HOH A . 
K 4 HOH 122 688 688 HOH HOH A . 
K 4 HOH 123 690 690 HOH HOH A . 
K 4 HOH 124 693 693 HOH HOH A . 
K 4 HOH 125 707 707 HOH HOH A . 
K 4 HOH 126 708 530 HOH O4M A . 
K 4 HOH 127 709 530 HOH O4M A . 
K 4 HOH 128 710 530 HOH O4M A . 
K 4 HOH 129 711 530 HOH O4M A . 
K 4 HOH 130 712 510 HOH MO5 A . 
K 4 HOH 131 713 510 HOH MO5 A . 
K 4 HOH 132 714 510 HOH MO5 A . 
K 4 HOH 133 715 510 HOH MO5 A . 
K 4 HOH 134 716 510 HOH MO5 A . 
K 4 HOH 135 717 520 HOH MN5 A . 
K 4 HOH 136 718 520 HOH MN5 A . 
K 4 HOH 137 719 520 HOH MN5 A . 
K 4 HOH 138 720 520 HOH MN5 A . 
K 4 HOH 139 721 520 HOH MN5 A . 
K 4 HOH 140 722 540 HOH MO3 A . 
K 4 HOH 141 723 540 HOH MO3 A . 
K 4 HOH 142 724 540 HOH MO3 A . 
K 4 HOH 143 725 560 HOH MO6 A . 
K 4 HOH 144 726 560 HOH MO6 A . 
K 4 HOH 145 727 560 HOH MO6 A . 
K 4 HOH 146 728 560 HOH MO6 A . 
K 4 HOH 147 729 560 HOH MO6 A . 
K 4 HOH 148 730 560 HOH MO6 A . 
K 4 HOH 149 731 570 HOH MO6 A . 
K 4 HOH 150 732 570 HOH MO6 A . 
K 4 HOH 151 733 570 HOH MO6 A . 
K 4 HOH 152 734 570 HOH MO6 A . 
K 4 HOH 153 735 570 HOH MO6 A . 
K 4 HOH 154 736 570 HOH MO6 A . 
K 4 HOH 155 737 580 HOH MO1 A . 
K 4 HOH 156 738 550 HOH MN5 A . 
K 4 HOH 157 739 550 HOH MN5 A . 
K 4 HOH 158 740 550 HOH MN5 A . 
K 4 HOH 159 741 550 HOH MN5 A . 
K 4 HOH 160 742 550 HOH MN5 A . 
#