#   1K6O 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.289 
PDB   1K6O         
NDB   PD0258       
RCSB  RCSB014627   
WWPDB D_1000014627 
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.entry_id                        1K6O 
_pdbx_database_status.recvd_initial_deposition_date   2001-10-16 
_pdbx_database_status.deposit_site                    RCSB 
_pdbx_database_status.process_site                    RCSB 
_pdbx_database_status.SG_entry                        . 
_pdbx_database_status.pdb_format_compatible           Y 
_pdbx_database_status.status_code_mr                  ? 
_pdbx_database_status.status_code_sf                  ? 
_pdbx_database_status.status_code_cs                  ? 
_pdbx_database_status.methods_development_category    ? 
'Mo, Y.'          1 
'Ho, W.'          2 
'Johnston, K.'    3 
'Marmorstein, R.' 4 
#                        primary 
_citation.title                     'Crystal structure of a ternary SAP-1/SRF/c-fos SRE DNA complex.' 
_citation.journal_abbrev            J.Mol.Biol. 
_citation.journal_volume            314 
_citation.page_first                495 
_citation.page_last                 506 
_citation.year                      2001 
_citation.journal_id_ASTM           JMOBAK                   UK 
_citation.journal_id_ISSN           0022-2836 
_citation.journal_id_CSD            0070 
_citation.book_publisher            ? 
_citation.pdbx_database_id_PubMed   11846562 
_citation.pdbx_database_id_DOI      10.1006/jmbi.2001.5138 
primary 'Mo, Y.'          1 
primary 'Ho, W.'          2 
primary 'Johnston, K.'    3 
primary 'Marmorstein, R.' 4 
_cell.entry_id           1K6O 
_cell.length_a           161.784 
_cell.length_b           161.784 
_cell.length_c           41.224 
_cell.angle_alpha        90.00 
_cell.angle_beta         90.00 
_cell.angle_gamma        120.00 
_cell.Z_PDB              12 
_cell.pdbx_unique_axis   ? 
_symmetry.entry_id                         1K6O 
_symmetry.space_group_name_H-M             'P 63' 
_symmetry.pdbx_full_space_group_name_H-M   ? 
_symmetry.cell_setting                     ? 
_symmetry.Int_Tables_number                173 
1 polymer syn "5'-D(*CP*AP*CP*AP*GP*GP*AP*TP*GP*TP*CP*CP*AP*TP*AP*TP*TP*AP*GP*GP*AP*CP*A)-3'" 7073.600  1 ? ? ?       
'c-fos SRE sequence strand 1' 
2 polymer syn "5'-D(*TP*GP*TP*CP*CP*TP*AP*AP*TP*AP*TP*GP*GP*AP*CP*AP*TP*CP*CP*TP*GP*TP*G)-3'" 7046.557  1 ? ? ?       
'c-fos SRE sequence strand 2' 
3 polymer man 'ETS-domain protein ELK-4'                                                      11219.207 1 ? ? 1-93    ? 
4 polymer man 'Serum response factor'                                                         11553.439 2 ? ? 133-235 ? 
3 'Serum Response Factor Accessory Protein 1, SAP-1' 
4 SRF                                                
1 polydeoxyribonucleotide no no 
CACAGGATGTCCATATTAGGACA                                                                                    D   ? 
2 polydeoxyribonucleotide no no 
TGTCCTAATATGGACATCCTGTG                                                                                    E   ? 
3 'polypeptide(L)'        no no 
A   ? 
4 'polypeptide(L)'        no no 
B,C ? 
1 1   DC  n 
1 2   DA  n 
1 3   DC  n 
1 4   DA  n 
1 5   DG  n 
1 6   DG  n 
1 7   DA  n 
1 8   DT  n 
1 9   DG  n 
1 10  DT  n 
1 11  DC  n 
1 12  DC  n 
1 13  DA  n 
1 14  DT  n 
1 15  DA  n 
1 16  DT  n 
1 17  DT  n 
1 18  DA  n 
1 19  DG  n 
1 20  DG  n 
1 21  DA  n 
1 22  DC  n 
1 23  DA  n 
2 1   DT  n 
2 2   DG  n 
2 3   DT  n 
2 4   DC  n 
2 5   DC  n 
2 6   DT  n 
2 7   DA  n 
2 8   DA  n 
2 9   DT  n 
2 10  DA  n 
2 11  DT  n 
2 12  DG  n 
2 13  DG  n 
2 14  DA  n 
2 15  DC  n 
2 16  DA  n 
2 17  DT  n 
2 18  DC  n 
2 19  DC  n 
2 20  DT  n 
2 21  DG  n 
2 22  DT  n 
2 23  DG  n 
3 1   MET n 
3 2   ASP n 
3 3   SER n 
3 4   ALA n 
3 5   ILE n 
3 6   THR n 
3 7   LEU n 
3 8   TRP n 
3 9   GLN n 
3 10  PHE n 
3 11  LEU n 
3 12  LEU n 
3 13  GLN n 
3 14  LEU n 
3 15  LEU n 
3 16  GLN n 
3 17  LYS n 
3 18  PRO n 
3 19  GLN n 
3 20  ASN n 
3 21  LYS n 
3 22  HIS n 
3 23  MET n 
3 24  ILE n 
3 25  CYS n 
3 26  TRP n 
3 27  THR n 
3 28  SER n 
3 29  ASN n 
3 30  ASP n 
3 31  GLY n 
3 32  GLN n 
3 33  PHE n 
3 34  LYS n 
3 35  LEU n 
3 36  LEU n 
3 37  GLN n 
3 38  ALA n 
3 39  GLU n 
3 40  GLU n 
3 41  VAL n 
3 42  ALA n 
3 43  ARG n 
3 44  LEU n 
3 45  TRP n 
3 46  GLY n 
3 47  ILE n 
3 48  ARG n 
3 49  LYS n 
3 50  ASN n 
3 51  LYS n 
3 52  PRO n 
3 53  ASN n 
3 54  MET n 
3 55  ASN n 
3 56  TYR n 
3 57  ASP n 
3 58  LYS n 
3 59  LEU n 
3 60  SER n 
3 61  ARG n 
3 62  ALA n 
3 63  LEU n 
3 64  ARG n 
3 65  TYR n 
3 66  TYR n 
3 67  TYR n 
3 68  VAL n 
3 69  LYS n 
3 70  ASN n 
3 71  ILE n 
3 72  ILE n 
3 73  LYS n 
3 74  LYS n 
3 75  VAL n 
3 76  ASN n 
3 77  GLY n 
3 78  GLN n 
3 79  LYS n 
3 80  PHE n 
3 81  VAL n 
3 82  TYR n 
3 83  LYS n 
3 84  PHE n 
3 85  VAL n 
3 86  SER n 
3 87  TYR n 
3 88  PRO n 
3 89  GLU n 
3 90  ILE n 
3 91  LEU n 
3 92  ASN n 
3 93  MET n 
4 1   GLY n 
4 2   ALA n 
4 3   LYS n 
4 4   PRO n 
4 5   GLY n 
4 6   LYS n 
4 7   LYS n 
4 8   THR n 
4 9   ARG n 
4 10  GLY n 
4 11  ARG n 
4 12  VAL n 
4 13  LYS n 
4 14  ILE n 
4 15  LYS n 
4 16  MET n 
4 17  GLU n 
4 18  PHE n 
4 19  ILE n 
4 20  ASP n 
4 21  ASN n 
4 22  LYS n 
4 23  LEU n 
4 24  ARG n 
4 25  ARG n 
4 26  TYR n 
4 27  THR n 
4 28  THR n 
4 29  PHE n 
4 30  SER n 
4 31  LYS n 
4 32  ARG n 
4 33  LYS n 
4 34  THR n 
4 35  GLY n 
4 36  ILE n 
4 37  MET n 
4 38  LYS n 
4 39  LYS n 
4 40  ALA n 
4 41  TYR n 
4 42  GLU n 
4 43  LEU n 
4 44  SER n 
4 45  THR n 
4 46  LEU n 
4 47  THR n 
4 48  GLY n 
4 49  THR n 
4 50  GLN n 
4 51  VAL n 
4 52  LEU n 
4 53  LEU n 
4 54  LEU n 
4 55  VAL n 
4 56  ALA n 
4 57  SER n 
4 58  GLU n 
4 59  THR n 
4 60  GLY n 
4 61  HIS n 
4 62  VAL n 
4 63  TYR n 
4 64  THR n 
4 65  PHE n 
4 66  ALA n 
4 67  THR n 
4 68  ARG n 
4 69  LYS n 
4 70  LEU n 
4 71  GLN n 
4 72  PRO n 
4 73  MET n 
4 74  ILE n 
4 75  THR n 
4 76  SER n 
4 77  GLU n 
4 78  THR n 
4 79  GLY n 
4 80  LYS n 
4 81  ALA n 
4 82  LEU n 
4 83  ILE n 
4 84  GLN n 
4 85  THR n 
4 86  CYS n 
4 87  LEU n 
4 88  ASN n 
4 89  SER n 
4 90  PRO n 
4 91  ASP n 
4 92  SER n 
4 93  PRO n 
4 94  PRO n 
4 95  ARG n 
4 96  SER n 
4 97  ASP n 
4 98  PRO n 
4 99  THR n 
4 100 THR n 
4 101 ASP n 
4 102 GLN n 
4 103 ARG n 
3 1 sample ? ? ? human Homo Sap ? ? ? ? ? ? 'Homo sapiens' 9606 ? ? ? ? ? ? ? ? 'Escherichia coli' 562 Escherichia ? ? ? ? ? 
'BL21(DE3)/LysS' ? ? ? ? ? ? ? PLASMID ? ? ? PRSETA ? ? 
4 1 sample ? ? ? human Homo SRF ? ? ? ? ? ? 'Homo sapiens' 9606 ? ? ? ? ? ? ? ? 'Escherichia coli' 562 Escherichia ? ? ? ? ? 
'BL21(DE3)/LysS' ? ? ? ? ? ? ? PLASMID ? ? ? PRESTA ? ? 
1 UNP ELK4_HUMAN P28324 3 1   ? ? 
2 UNP SRF_HUMAN  P11831 4 133 ? ? 
3 PDB 1K6O       1K6O   1 ?   ? ? 
4 PDB 1K6O       1K6O   2 ?   ? ? 
1 1 1K6O A 1 ? 93  ? P28324 1   ? 93  ? 301 393 
2 2 1K6O B 1 ? 103 ? P11831 133 ? 235 ? 133 235 
3 2 1K6O C 1 ? 103 ? P11831 133 ? 235 ? 133 235 
4 3 1K6O D 1 ? 23  ? 1K6O   101 ? 123 ? 101 123 
5 4 1K6O E 1 ? 23  ? 1K6O   201 ? 223 ? 201 223 
ALA 'L-peptide linking' y ALANINE                              ? 'C3 H7 N O2'      89.093  
ARG 'L-peptide linking' y ARGININE                             ? 'C6 H15 N4 O2 1'  175.209 
ASN 'L-peptide linking' y ASPARAGINE                           ? 'C4 H8 N2 O3'     132.118 
ASP 'L-peptide linking' y 'ASPARTIC ACID'                      ? 'C4 H7 N O4'      133.103 
CYS 'L-peptide linking' y CYSTEINE                             ? 'C3 H7 N O2 S'    121.158 
DA  'DNA linking'       y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 
DC  'DNA linking'       y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE"  ? 'C9 H14 N3 O7 P'  307.197 
DG  'DNA linking'       y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 
DT  'DNA linking'       y "THYMIDINE-5'-MONOPHOSPHATE"         ? 'C10 H15 N2 O8 P' 322.208 
GLN 'L-peptide linking' y GLUTAMINE                            ? 'C5 H10 N2 O3'    146.144 
GLU 'L-peptide linking' y 'GLUTAMIC ACID'                      ? 'C5 H9 N O4'      147.129 
GLY 'peptide linking'   y GLYCINE                              ? 'C2 H5 N O2'      75.067  
HIS 'L-peptide linking' y HISTIDINE                            ? 'C6 H10 N3 O2 1'  156.162 
ILE 'L-peptide linking' y ISOLEUCINE                           ? 'C6 H13 N O2'     131.173 
LEU 'L-peptide linking' y LEUCINE                              ? 'C6 H13 N O2'     131.173 
LYS 'L-peptide linking' y LYSINE                               ? 'C6 H15 N2 O2 1'  147.195 
MET 'L-peptide linking' y METHIONINE                           ? 'C5 H11 N O2 S'   149.211 
PHE 'L-peptide linking' y PHENYLALANINE                        ? 'C9 H11 N O2'     165.189 
PRO 'L-peptide linking' y PROLINE                              ? 'C5 H9 N O2'      115.130 
SER 'L-peptide linking' y SERINE                               ? 'C3 H7 N O3'      105.093 
THR 'L-peptide linking' y THREONINE                            ? 'C4 H9 N O3'      119.119 
TRP 'L-peptide linking' y TRYPTOPHAN                           ? 'C11 H12 N2 O2'   204.225 
TYR 'L-peptide linking' y TYROSINE                             ? 'C9 H11 N O3'     181.189 
VAL 'L-peptide linking' y VALINE                               ? 'C5 H11 N O2'     117.146 
_exptl.entry_id          1K6O 
_exptl.method            'X-RAY DIFFRACTION' 
_exptl.crystals_number   1 
#                    1 
_exptl_crystal.density_meas          ? 
_exptl_crystal.density_Matthews      3.18 
_exptl_crystal.density_percent_sol   61.31 
_exptl_crystal.description           ? 
_exptl_crystal_grow.crystal_id      1 
_exptl_crystal_grow.method          'VAPOR DIFFUSION, HANGING DROP' 
_exptl_crystal_grow.temp            293.0 
_exptl_crystal_grow.temp_details    ? 
_exptl_crystal_grow.pH              6.0 
_exptl_crystal_grow.pdbx_details    'PEG 2000, pH 6.0, VAPOR DIFFUSION, HANGING DROP' 
_exptl_crystal_grow.pdbx_pH_range   ? 
_exptl_crystal_grow_comp.crystal_id   1           1 
_exptl_crystal_grow_comp.sol_id       1         'PEG 2000' 
_exptl_crystal_grow_comp.volume       ? 
_exptl_crystal_grow_comp.conc         ? 
_exptl_crystal_grow_comp.details      ? 
#                     1 
_diffrn.ambient_temp           110 
_diffrn.ambient_temp_details   ? 
_diffrn.crystal_id             1 
_diffrn_detector.diffrn_id              1 
_diffrn_detector.detector               CCD 
_diffrn_detector.type                   'ADSC QUANTUM 4' 
_diffrn_detector.pdbx_collection_date   1999-11-05 
_diffrn_detector.details                ? 
_diffrn_radiation.diffrn_id                        1 
_diffrn_radiation.wavelength_id                    1 
_diffrn_radiation.pdbx_monochromatic_or_laue_m_l   M 
_diffrn_radiation.monochromator                    'Si 111' 
_diffrn_radiation.pdbx_diffrn_protocol             'SINGLE WAVELENGTH' 
_diffrn_radiation.pdbx_scattering_type             x-ray 
#           1 
_diffrn_radiation_wavelength.wavelength   1.0722 
_diffrn_radiation_wavelength.wt           1.0 
_diffrn_source.diffrn_id                   1 
_diffrn_source.source                      SYNCHROTRON 
_diffrn_source.type                        'NSLS BEAMLINE X8C' 
_diffrn_source.pdbx_synchrotron_site       NSLS 
_diffrn_source.pdbx_synchrotron_beamline   X8C 
_diffrn_source.pdbx_wavelength             ? 
_diffrn_source.pdbx_wavelength_list        1.0722 
_reflns.entry_id                     1K6O 
_reflns.observed_criterion_sigma_I   -1.0 
_reflns.observed_criterion_sigma_F   ? 
_reflns.d_resolution_low             50 
_reflns.d_resolution_high            3.19 
_reflns.number_obs                   10302 
_reflns.number_all                   10616 
_reflns.percent_possible_obs         97.1 
_reflns.pdbx_Rmerge_I_obs            ? 
_reflns.pdbx_Rsym_value              ? 
_reflns.pdbx_netI_over_sigmaI        ? 
_reflns.B_iso_Wilson_estimate        ? 
_reflns.pdbx_redundancy              ? 
_reflns.R_free_details               ? 
_reflns.pdbx_diffrn_id               1 
_reflns.pdbx_ordinal                 1 
_reflns_shell.d_res_high             3.19 
_reflns_shell.d_res_low              50 
_reflns_shell.percent_possible_all   97.1 
_reflns_shell.Rmerge_I_obs           ? 
_reflns_shell.pdbx_Rsym_value        ? 
_reflns_shell.meanI_over_sigI_obs    ? 
_reflns_shell.pdbx_redundancy        ? 
_reflns_shell.percent_possible_obs   ? 
_reflns_shell.number_unique_all      ? 
_reflns_shell.pdbx_diffrn_id         ? 
_reflns_shell.pdbx_ordinal           1 
_refine.entry_id                                 1K6O 
_refine.ls_number_reflns_obs                     10302 
_refine.ls_number_reflns_all                     10616 
_refine.pdbx_ls_sigma_I                          ? 
_refine.pdbx_ls_sigma_F                          0 
_refine.pdbx_data_cutoff_high_absF               ? 
_refine.pdbx_data_cutoff_low_absF                ? 
_refine.ls_d_res_low                             50 
_refine.ls_d_res_high                            3.19 
_refine.ls_percent_reflns_obs                    ? 
_refine.ls_R_factor_obs                          0.2700000 
_refine.ls_R_factor_all                          0.2200000 
_refine.ls_R_factor_R_work                       0.2204000 
_refine.ls_R_factor_R_free                       0.2757000 
_refine.ls_R_factor_R_free_error                 ? 
_refine.ls_R_factor_R_free_error_details         ? 
_refine.ls_percent_reflns_R_free                 ? 
_refine.ls_number_reflns_R_free                  ? 
_refine.ls_number_parameters                     ? 
_refine.ls_number_restraints                     ? 
_refine.occupancy_min                            ? 
_refine.occupancy_max                            ? 
_refine.B_iso_mean                               ? 
_refine.aniso_B[1][1]                            ? 
_refine.aniso_B[2][2]                            ? 
_refine.aniso_B[3][3]                            ? 
_refine.aniso_B[1][2]                            ? 
_refine.aniso_B[1][3]                            ? 
_refine.aniso_B[2][3]                            ? 
_refine.solvent_model_details                    ? 
_refine.solvent_model_param_ksol                 ? 
_refine.solvent_model_param_bsol                 ? 
_refine.pdbx_ls_cross_valid_method               ? 
_refine.details                                  ? 
_refine.pdbx_starting_model                      ? 
_refine.pdbx_method_to_determine_struct          'MOLECULAR REPLACEMENT' 
_refine.pdbx_isotropic_thermal_model             ? 
_refine.pdbx_stereochemistry_target_values       'Engh and Huber' 
_refine.pdbx_stereochem_target_val_spec_case     ? 
_refine.pdbx_R_Free_selection_details            '10% of data' 
_refine.pdbx_overall_ESU_R_Free                  ? 
_refine.overall_SU_B                             ? 
_refine.ls_redundancy_reflns_obs                 ? 
_refine.correlation_coeff_Fo_to_Fc               ? 
_refine.overall_SU_R_Cruickshank_DPI             ? 
_refine.overall_SU_R_free                        ? 
_refine.overall_SU_ML                            ? 
_refine.pdbx_overall_ESU_R                       ? 
_refine.pdbx_data_cutoff_high_rms_absF           ? 
_refine.correlation_coeff_Fo_to_Fc_free          ? 
_refine.pdbx_solvent_vdw_probe_radii             ? 
_refine.pdbx_solvent_ion_probe_radii             ? 
_refine.pdbx_solvent_shrinkage_radii             ? 
_refine.pdbx_refine_id                           'X-RAY DIFFRACTION' 
_refine.pdbx_diffrn_id                           1 
_refine.pdbx_TLS_residual_ADP_flag               ? 
_refine.pdbx_overall_phase_error                 ? 
_refine.pdbx_overall_SU_R_free_Cruickshank_DPI   ? 
_refine.pdbx_overall_SU_R_Blow_DPI               ? 
_refine.pdbx_overall_SU_R_free_Blow_DPI          ? 
_refine_hist.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_refine_hist.cycle_id                         LAST 
_refine_hist.pdbx_number_atoms_protein        2020 
_refine_hist.pdbx_number_atoms_nucleic_acid   937 
_refine_hist.pdbx_number_atoms_ligand         0 
_refine_hist.number_atoms_solvent             0 
_refine_hist.number_atoms_total               2957 
_refine_hist.d_res_high                       3.19 
_refine_hist.d_res_low                        50 
c_angle_d 1.1746   ? ? ? 'X-RAY DIFFRACTION' ? 
c_bond_d  0.007045 ? ? ? 'X-RAY DIFFRACTION' ? 
_struct.entry_id                  1K6O 
_struct.title                     'Crystal Structure of a Ternary SAP-1/SRF/c-fos SRE DNA Complex' 
_struct.pdbx_descriptor           'ETS-domain protein ELK-4/Serum response factor/DNA Complex' 
_struct.pdbx_model_details        ? 
_struct.pdbx_CASP_flag            ? 
_struct.pdbx_model_type_details   ? 
_struct_keywords.entry_id        1K6O 
_struct_keywords.pdbx_keywords   TRANSCRIPTION/DNA 
A N N 1 ? 
B N N 2 ? 
C N N 3 ? 
D N N 4 ? 
E N N 4 ? 
#                    1 
_struct_biol.pdbx_parent_biol_id   ? 
_struct_biol.details               ? 
HELX_P HELX_P1  1  THR C 6  ? LEU C 15 ? THR A 306 LEU A 315 1 ? 10 
HELX_P HELX_P2  2  GLN C 37 ? LYS C 49 ? GLN A 337 LYS A 349 1 ? 13 
HELX_P HELX_P3  3  ASN C 55 ? LYS C 69 ? ASN A 355 LYS A 369 1 ? 15 
HELX_P HELX_P4  4  ASN D 21 ? THR D 47 ? ASN B 153 THR B 179 1 ? 27 
HELX_P HELX_P5  5  ARG D 68 ? ILE D 74 ? ARG B 200 ILE B 206 5 ? 7  
HELX_P HELX_P6  6  SER D 76 ? CYS D 86 ? SER B 208 CYS B 218 1 ? 11 
HELX_P HELX_P7  7  ASN E 21 ? GLY E 48 ? ASN C 153 GLY C 180 1 ? 28 
HELX_P HELX_P8  8  ARG E 68 ? LEU E 70 ? ARG C 200 LEU C 202 5 ? 3  
HELX_P HELX_P9  9  GLN E 71 ? SER E 76 ? GLN C 203 SER C 208 1 ? 6  
HELX_P HELX_P10 10 SER E 76 ? LEU E 87 ? SER C 208 LEU C 219 1 ? 12 
#          HELX_P 
_struct_conf_type.criteria    ? 
_struct_conf_type.reference   ? 
hydrog1  hydrog ? ? A DC 1  N3 ? ? ? 1_555 B DG 23 N1 ? ? D DC 101 E DG 223 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog2  hydrog ? ? A DC 1  N4 ? ? ? 1_555 B DG 23 O6 ? ? D DC 101 E DG 223 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog3  hydrog ? ? A DC 1  O2 ? ? ? 1_555 B DG 23 N2 ? ? D DC 101 E DG 223 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog4  hydrog ? ? A DA 2  N1 ? ? ? 1_555 B DT 22 N3 ? ? D DA 102 E DT 222 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog5  hydrog ? ? A DA 2  N6 ? ? ? 1_555 B DT 22 O4 ? ? D DA 102 E DT 222 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog6  hydrog ? ? A DC 3  N3 ? ? ? 1_555 B DG 21 N1 ? ? D DC 103 E DG 221 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog7  hydrog ? ? A DC 3  N4 ? ? ? 1_555 B DG 21 O6 ? ? D DC 103 E DG 221 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog8  hydrog ? ? A DC 3  O2 ? ? ? 1_555 B DG 21 N2 ? ? D DC 103 E DG 221 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog9  hydrog ? ? A DA 4  N1 ? ? ? 1_555 B DT 20 N3 ? ? D DA 104 E DT 220 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog10 hydrog ? ? A DA 4  N6 ? ? ? 1_555 B DT 20 O4 ? ? D DA 104 E DT 220 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog11 hydrog ? ? A DG 5  N1 ? ? ? 1_555 B DC 19 N3 ? ? D DG 105 E DC 219 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog12 hydrog ? ? A DG 5  N2 ? ? ? 1_555 B DC 19 O2 ? ? D DG 105 E DC 219 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog13 hydrog ? ? A DG 5  O6 ? ? ? 1_555 B DC 19 N4 ? ? D DG 105 E DC 219 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog14 hydrog ? ? A DG 6  N1 ? ? ? 1_555 B DC 18 N3 ? ? D DG 106 E DC 218 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog15 hydrog ? ? A DG 6  N2 ? ? ? 1_555 B DC 18 O2 ? ? D DG 106 E DC 218 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog16 hydrog ? ? A DG 6  O6 ? ? ? 1_555 B DC 18 N4 ? ? D DG 106 E DC 218 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog17 hydrog ? ? A DA 7  N1 ? ? ? 1_555 B DT 17 N3 ? ? D DA 107 E DT 217 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog18 hydrog ? ? A DA 7  N6 ? ? ? 1_555 B DT 17 O4 ? ? D DA 107 E DT 217 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog19 hydrog ? ? A DT 8  N3 ? ? ? 1_555 B DA 16 N1 ? ? D DT 108 E DA 216 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog20 hydrog ? ? A DT 8  O4 ? ? ? 1_555 B DA 16 N6 ? ? D DT 108 E DA 216 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog21 hydrog ? ? A DG 9  N1 ? ? ? 1_555 B DC 15 N3 ? ? D DG 109 E DC 215 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog22 hydrog ? ? A DG 9  N2 ? ? ? 1_555 B DC 15 O2 ? ? D DG 109 E DC 215 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog23 hydrog ? ? A DG 9  O6 ? ? ? 1_555 B DC 15 N4 ? ? D DG 109 E DC 215 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog24 hydrog ? ? A DT 10 N3 ? ? ? 1_555 B DA 14 N1 ? ? D DT 110 E DA 214 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog25 hydrog ? ? A DT 10 O4 ? ? ? 1_555 B DA 14 N6 ? ? D DT 110 E DA 214 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog26 hydrog ? ? A DC 11 N3 ? ? ? 1_555 B DG 13 N1 ? ? D DC 111 E DG 213 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog27 hydrog ? ? A DC 11 N4 ? ? ? 1_555 B DG 13 O6 ? ? D DC 111 E DG 213 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog28 hydrog ? ? A DC 11 O2 ? ? ? 1_555 B DG 13 N2 ? ? D DC 111 E DG 213 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog29 hydrog ? ? A DC 12 N3 ? ? ? 1_555 B DG 12 N1 ? ? D DC 112 E DG 212 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog30 hydrog ? ? A DC 12 N4 ? ? ? 1_555 B DG 12 O6 ? ? D DC 112 E DG 212 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog31 hydrog ? ? A DC 12 O2 ? ? ? 1_555 B DG 12 N2 ? ? D DC 112 E DG 212 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog32 hydrog ? ? A DA 13 N1 ? ? ? 1_555 B DT 11 N3 ? ? D DA 113 E DT 211 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog33 hydrog ? ? A DA 13 N6 ? ? ? 1_555 B DT 11 O4 ? ? D DA 113 E DT 211 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog34 hydrog ? ? A DT 14 N3 ? ? ? 1_555 B DA 10 N1 ? ? D DT 114 E DA 210 1_555 ? ? ? ? ? ? 'DT-DA PAIR' ? ? 
hydrog35 hydrog ? ? A DA 15 N1 ? ? ? 1_555 B DT 9  N3 ? ? D DA 115 E DT 209 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog36 hydrog ? ? A DA 15 N6 ? ? ? 1_555 B DT 9  O4 ? ? D DA 115 E DT 209 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog37 hydrog ? ? A DT 16 N3 ? ? ? 1_555 B DA 8  N1 ? ? D DT 116 E DA 208 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog38 hydrog ? ? A DT 16 O4 ? ? ? 1_555 B DA 8  N6 ? ? D DT 116 E DA 208 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog39 hydrog ? ? A DT 17 N3 ? ? ? 1_555 B DA 7  N1 ? ? D DT 117 E DA 207 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog40 hydrog ? ? A DT 17 O4 ? ? ? 1_555 B DA 7  N6 ? ? D DT 117 E DA 207 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog41 hydrog ? ? A DA 18 N1 ? ? ? 1_555 B DT 6  N3 ? ? D DA 118 E DT 206 1_555 ? ? ? ? ? ? 'DA-DT PAIR' ? ? 
hydrog42 hydrog ? ? A DG 19 N1 ? ? ? 1_555 B DC 5  N3 ? ? D DG 119 E DC 205 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog43 hydrog ? ? A DG 19 N2 ? ? ? 1_555 B DC 5  O2 ? ? D DG 119 E DC 205 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog44 hydrog ? ? A DG 19 O6 ? ? ? 1_555 B DC 5  N4 ? ? D DG 119 E DC 205 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog45 hydrog ? ? A DG 20 N1 ? ? ? 1_555 B DC 4  N3 ? ? D DG 120 E DC 204 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog46 hydrog ? ? A DG 20 N2 ? ? ? 1_555 B DC 4  O2 ? ? D DG 120 E DC 204 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog47 hydrog ? ? A DG 20 O6 ? ? ? 1_555 B DC 4  N4 ? ? D DG 120 E DC 204 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog48 hydrog ? ? A DA 21 N1 ? ? ? 1_555 B DT 3  N3 ? ? D DA 121 E DT 203 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog49 hydrog ? ? A DA 21 N6 ? ? ? 1_555 B DT 3  O4 ? ? D DA 121 E DT 203 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog50 hydrog ? ? A DC 22 N3 ? ? ? 1_555 B DG 2  N1 ? ? D DC 122 E DG 202 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog51 hydrog ? ? A DC 22 N4 ? ? ? 1_555 B DG 2  O6 ? ? D DC 122 E DG 202 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog52 hydrog ? ? A DC 22 O2 ? ? ? 1_555 B DG 2  N2 ? ? D DC 122 E DG 202 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog53 hydrog ? ? A DA 23 N1 ? ? ? 1_555 B DT 1  N3 ? ? D DA 123 E DT 201 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog54 hydrog ? ? A DA 23 N6 ? ? ? 1_555 B DT 1  O4 ? ? D DA 123 E DT 201 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
#          hydrog 
_struct_conn_type.criteria    ? 
_struct_conn_type.reference   ? 
_struct_mon_prot_cis.pdbx_id                1 
_struct_mon_prot_cis.label_comp_id          TYR 
_struct_mon_prot_cis.label_seq_id           87 
_struct_mon_prot_cis.label_asym_id          C 
_struct_mon_prot_cis.label_alt_id           . 
_struct_mon_prot_cis.pdbx_PDB_ins_code      ? 
_struct_mon_prot_cis.auth_comp_id           TYR 
_struct_mon_prot_cis.auth_seq_id            387 
_struct_mon_prot_cis.auth_asym_id           A 
_struct_mon_prot_cis.pdbx_label_comp_id_2   PRO 
_struct_mon_prot_cis.pdbx_label_seq_id_2    88 
_struct_mon_prot_cis.pdbx_label_asym_id_2   C 
_struct_mon_prot_cis.pdbx_PDB_ins_code_2    ? 
_struct_mon_prot_cis.pdbx_auth_comp_id_2    PRO 
_struct_mon_prot_cis.pdbx_auth_seq_id_2     388 
_struct_mon_prot_cis.pdbx_auth_asym_id_2    A 
_struct_mon_prot_cis.pdbx_PDB_model_num     1 
_struct_mon_prot_cis.pdbx_omega_angle       0.65 
A ? 4 ? 
B ? 4 ? 
A 1 2 ? anti-parallel 
A 2 3 ? anti-parallel 
A 3 4 ? anti-parallel 
B 1 2 ? anti-parallel 
B 2 3 ? anti-parallel 
B 3 4 ? anti-parallel 
A 1 CYS C 25 ? TRP C 26 ? CYS A 325 TRP A 326 
A 2 GLN C 32 ? LYS C 34 ? GLN A 332 LYS A 334 
A 3 VAL C 81 ? PHE C 84 ? VAL A 381 PHE A 384 
A 4 ILE C 72 ? LYS C 74 ? ILE A 372 LYS A 374 
B 1 VAL D 62 ? ALA D 66 ? VAL B 194 ALA B 198 
B 2 GLN D 50 ? ALA D 56 ? GLN B 182 ALA B 188 
B 3 VAL E 51 ? ALA E 56 ? VAL C 183 ALA C 188 
B 4 VAL E 62 ? ALA E 66 ? VAL C 194 ALA C 198 
A 1 2 N CYS C 25 ? N CYS A 325 O LYS C 34 ? O LYS A 334 
A 2 3 N PHE C 33 ? N PHE A 333 O TYR C 82 ? O TYR A 382 
A 3 4 O LYS C 83 ? O LYS A 383 N LYS C 73 ? N LYS A 373 
B 1 2 O PHE D 65 ? O PHE B 197 N LEU D 53 ? N LEU B 185 
B 2 3 N LEU D 52 ? N LEU B 184 O LEU E 54 ? O LEU C 186 
B 3 4 N VAL E 55 ? N VAL C 187 O TYR E 63 ? O TYR C 195 
_database_PDB_matrix.entry_id          1K6O 
_database_PDB_matrix.origx[1][1]       1.000000 
_database_PDB_matrix.origx[1][2]       0.000000 
_database_PDB_matrix.origx[1][3]       0.000000 
_database_PDB_matrix.origx[2][1]       0.000000 
_database_PDB_matrix.origx[2][2]       1.000000 
_database_PDB_matrix.origx[2][3]       0.000000 
_database_PDB_matrix.origx[3][1]       0.000000 
_database_PDB_matrix.origx[3][2]       0.000000 
_database_PDB_matrix.origx[3][3]       1.000000 
_database_PDB_matrix.origx_vector[1]   0.00000 
_database_PDB_matrix.origx_vector[2]   0.00000 
_database_PDB_matrix.origx_vector[3]   0.00000 
_atom_sites.entry_id                    1K6O 
_atom_sites.fract_transf_matrix[1][1]   0.006181 
_atom_sites.fract_transf_matrix[1][2]   0.003569 
_atom_sites.fract_transf_matrix[1][3]   0.000000 
_atom_sites.fract_transf_matrix[2][1]   0.000000 
_atom_sites.fract_transf_matrix[2][2]   0.007137 
_atom_sites.fract_transf_matrix[2][3]   0.000000 
_atom_sites.fract_transf_matrix[3][1]   0.000000 
_atom_sites.fract_transf_matrix[3][2]   0.000000 
_atom_sites.fract_transf_matrix[3][3]   0.024258 
_atom_sites.fract_transf_vector[1]      0.00000 
_atom_sites.fract_transf_vector[2]      0.00000 
_atom_sites.fract_transf_vector[3]      0.00000 
ATOM 1    O "O5'" . DC  A 1 1  ? -54.266 78.545  -7.349  1.00 39.28 ? 101 DC  D "O5'" 1 
ATOM 2    C "C5'" . DC  A 1 1  ? -54.714 79.400  -8.404  1.00 39.28 ? 101 DC  D "C5'" 1 
ATOM 3    C "C4'" . DC  A 1 1  ? -54.807 78.659  -9.719  1.00 39.28 ? 101 DC  D "C4'" 1 
ATOM 4    O "O4'" . DC  A 1 1  ? -55.915 79.172  -10.494 1.00 39.28 ? 101 DC  D "O4'" 1 
ATOM 5    C "C3'" . DC  A 1 1  ? -53.583 78.774  -10.625 1.00 39.28 ? 101 DC  D "C3'" 1 
ATOM 6    O "O3'" . DC  A 1 1  ? -53.414 77.564  -11.370 1.00 39.28 ? 101 DC  D "O3'" 1 
ATOM 7    C "C2'" . DC  A 1 1  ? -53.956 79.908  -11.561 1.00 39.28 ? 101 DC  D "C2'" 1 
ATOM 8    C "C1'" . DC  A 1 1  ? -55.458 79.746  -11.708 1.00 39.28 ? 101 DC  D "C1'" 1 
ATOM 9    N N1    . DC  A 1 1  ? -56.162 81.020  -11.869 1.00 21.55 ? 101 DC  D N1    1 
ATOM 10   C C2    . DC  A 1 1  ? -56.280 81.568  -13.137 1.00 21.55 ? 101 DC  D C2    1 
ATOM 11   O O2    . DC  A 1 1  ? -55.812 80.947  -14.096 1.00 21.55 ? 101 DC  D O2    1 
ATOM 12   N N3    . DC  A 1 1  ? -56.904 82.753  -13.290 1.00 21.55 ? 101 DC  D N3    1 
ATOM 13   C C4    . DC  A 1 1  ? -57.420 83.369  -12.228 1.00 21.55 ? 101 DC  D C4    1 
ATOM 14   N N4    . DC  A 1 1  ? -58.048 84.518  -12.417 1.00 21.55 ? 101 DC  D N4    1 
ATOM 15   C C5    . DC  A 1 1  ? -57.322 82.826  -10.920 1.00 21.55 ? 101 DC  D C5    1 
ATOM 16   C C6    . DC  A 1 1  ? -56.690 81.662  -10.786 1.00 21.55 ? 101 DC  D C6    1 
ATOM 17   P P     . DA  A 1 2  ? -52.019 77.275  -12.117 1.00 68.31 ? 102 DA  D P     1 
ATOM 18   O OP1   . DA  A 1 2  ? -52.203 76.039  -12.929 1.00 37.09 ? 102 DA  D OP1   1 
ATOM 19   O OP2   . DA  A 1 2  ? -50.922 77.345  -11.103 1.00 37.09 ? 102 DA  D OP2   1 
ATOM 20   O "O5'" . DA  A 1 2  ? -51.850 78.496  -13.128 1.00 68.31 ? 102 DA  D "O5'" 1 
ATOM 21   C "C5'" . DA  A 1 2  ? -52.132 78.328  -14.515 1.00 68.31 ? 102 DA  D "C5'" 1 
ATOM 22   C "C4'" . DA  A 1 2  ? -51.506 79.439  -15.327 1.00 68.31 ? 102 DA  D "C4'" 1 
ATOM 23   O "O4'" . DA  A 1 2  ? -52.196 80.680  -15.067 1.00 68.31 ? 102 DA  D "O4'" 1 
ATOM 24   C "C3'" . DA  A 1 2  ? -50.022 79.717  -15.091 1.00 68.31 ? 102 DA  D "C3'" 1 
ATOM 25   O "O3'" . DA  A 1 2  ? -49.388 79.923  -16.361 1.00 68.31 ? 102 DA  D "O3'" 1 
ATOM 26   C "C2'" . DA  A 1 2  ? -50.028 80.959  -14.213 1.00 68.31 ? 102 DA  D "C2'" 1 
ATOM 27   C "C1'" . DA  A 1 2  ? -51.281 81.687  -14.668 1.00 68.31 ? 102 DA  D "C1'" 1 
ATOM 28   N N9    . DA  A 1 2  ? -51.952 82.507  -13.654 1.00 37.09 ? 102 DA  D N9    1 
ATOM 29   C C8    . DA  A 1 2  ? -51.786 82.496  -12.288 1.00 37.09 ? 102 DA  D C8    1 
ATOM 30   N N7    . DA  A 1 2  ? -52.568 83.340  -11.653 1.00 37.09 ? 102 DA  D N7    1 
ATOM 31   C C5    . DA  A 1 2  ? -53.294 83.955  -12.667 1.00 37.09 ? 102 DA  D C5    1 
ATOM 32   C C6    . DA  A 1 2  ? -54.297 84.956  -12.656 1.00 37.09 ? 102 DA  D C6    1 
ATOM 33   N N6    . DA  A 1 2  ? -54.745 85.556  -11.545 1.00 37.09 ? 102 DA  D N6    1 
ATOM 34   N N1    . DA  A 1 2  ? -54.821 85.330  -13.844 1.00 37.09 ? 102 DA  D N1    1 
ATOM 35   C C2    . DA  A 1 2  ? -54.353 84.759  -14.960 1.00 37.09 ? 102 DA  D C2    1 
ATOM 36   N N3    . DA  A 1 2  ? -53.412 83.825  -15.103 1.00 37.09 ? 102 DA  D N3    1 
ATOM 37   C C4    . DA  A 1 2  ? -52.920 83.456  -13.905 1.00 37.09 ? 102 DA  D C4    1 
ATOM 38   P P     . DC  A 1 3  ? -47.973 80.674  -16.448 1.00 33.73 ? 103 DC  D P     1 
ATOM 39   O OP1   . DC  A 1 3  ? -47.252 80.258  -17.680 1.00 19.16 ? 103 DC  D OP1   1 
ATOM 40   O OP2   . DC  A 1 3  ? -47.305 80.553  -15.134 1.00 19.16 ? 103 DC  D OP2   1 
ATOM 41   O "O5'" . DC  A 1 3  ? -48.414 82.185  -16.657 1.00 33.73 ? 103 DC  D "O5'" 1 
ATOM 42   C "C5'" . DC  A 1 3  ? -49.380 82.496  -17.656 1.00 33.73 ? 103 DC  D "C5'" 1 
ATOM 43   C "C4'" . DC  A 1 3  ? -49.428 83.982  -17.909 1.00 33.73 ? 103 DC  D "C4'" 1 
ATOM 44   O "O4'" . DC  A 1 3  ? -50.298 84.637  -16.955 1.00 33.73 ? 103 DC  D "O4'" 1 
ATOM 45   C "C3'" . DC  A 1 3  ? -48.079 84.698  -17.848 1.00 33.73 ? 103 DC  D "C3'" 1 
ATOM 46   O "O3'" . DC  A 1 3  ? -47.919 85.529  -18.990 1.00 33.73 ? 103 DC  D "O3'" 1 
ATOM 47   C "C2'" . DC  A 1 3  ? -48.170 85.540  -16.589 1.00 33.73 ? 103 DC  D "C2'" 1 
ATOM 48   C "C1'" . DC  A 1 3  ? -49.660 85.789  -16.440 1.00 33.73 ? 103 DC  D "C1'" 1 
ATOM 49   N N1    . DC  A 1 3  ? -50.104 85.947  -15.053 1.00 19.16 ? 103 DC  D N1    1 
ATOM 50   C C2    . DC  A 1 3  ? -51.244 86.698  -14.795 1.00 19.16 ? 103 DC  D C2    1 
ATOM 51   O O2    . DC  A 1 3  ? -51.848 87.207  -15.748 1.00 19.16 ? 103 DC  D O2    1 
ATOM 52   N N3    . DC  A 1 3  ? -51.667 86.851  -13.513 1.00 19.16 ? 103 DC  D N3    1 
ATOM 53   C C4    . DC  A 1 3  ? -50.989 86.275  -12.515 1.00 19.16 ? 103 DC  D C4    1 
ATOM 54   N N4    . DC  A 1 3  ? -51.441 86.436  -11.264 1.00 19.16 ? 103 DC  D N4    1 
ATOM 55   C C5    . DC  A 1 3  ? -49.816 85.502  -12.754 1.00 19.16 ? 103 DC  D C5    1 
ATOM 56   C C6    . DC  A 1 3  ? -49.414 85.365  -14.028 1.00 19.16 ? 103 DC  D C6    1 
ATOM 57   P P     . DA  A 1 4  ? -46.543 86.306  -19.211 1.00 16.72 ? 104 DA  D P     1 
ATOM 58   O OP1   . DA  A 1 4  ? -45.888 85.872  -20.465 1.00 22.92 ? 104 DA  D OP1   1 
ATOM 59   O OP2   . DA  A 1 4  ? -45.806 86.205  -17.937 1.00 22.92 ? 104 DA  D OP2   1 
ATOM 60   O "O5'" . DA  A 1 4  ? -47.041 87.796  -19.449 1.00 16.72 ? 104 DA  D "O5'" 1 
ATOM 61   C "C5'" . DA  A 1 4  ? -48.073 88.360  -18.635 1.00 16.72 ? 104 DA  D "C5'" 1 
ATOM 62   C "C4'" . DA  A 1 4  ? -48.288 89.815  -18.994 1.00 16.72 ? 104 DA  D "C4'" 1 
ATOM 63   O "O4'" . DA  A 1 4  ? -49.259 90.382  -18.091 1.00 16.72 ? 104 DA  D "O4'" 1 
ATOM 64   C "C3'" . DA  A 1 4  ? -47.052 90.686  -18.839 1.00 16.72 ? 104 DA  D "C3'" 1 
ATOM 65   O "O3'" . DA  A 1 4  ? -47.124 91.770  -19.759 1.00 16.72 ? 104 DA  D "O3'" 1 
ATOM 66   C "C2'" . DA  A 1 4  ? -47.125 91.148  -17.397 1.00 16.72 ? 104 DA  D "C2'" 1 
ATOM 67   C "C1'" . DA  A 1 4  ? -48.618 91.128  -17.066 1.00 16.72 ? 104 DA  D "C1'" 1 
ATOM 68   N N9    . DA  A 1 4  ? -48.900 90.449  -15.800 1.00 22.92 ? 104 DA  D N9    1 
ATOM 69   C C8    . DA  A 1 4  ? -48.475 89.197  -15.427 1.00 22.92 ? 104 DA  D C8    1 
ATOM 70   N N7    . DA  A 1 4  ? -48.831 88.857  -14.215 1.00 22.92 ? 104 DA  D N7    1 
ATOM 71   C C5    . DA  A 1 4  ? -49.546 89.954  -13.759 1.00 22.92 ? 104 DA  D C5    1 
ATOM 72   C C6    . DA  A 1 4  ? -50.177 90.234  -12.518 1.00 22.92 ? 104 DA  D C6    1 
ATOM 73   N N6    . DA  A 1 4  ? -50.153 89.410  -11.466 1.00 22.92 ? 104 DA  D N6    1 
ATOM 74   N N1    . DA  A 1 4  ? -50.823 91.416  -12.395 1.00 22.92 ? 104 DA  D N1    1 
ATOM 75   C C2    . DA  A 1 4  ? -50.808 92.259  -13.442 1.00 22.92 ? 104 DA  D C2    1 
ATOM 76   N N3    . DA  A 1 4  ? -50.232 92.115  -14.646 1.00 22.92 ? 104 DA  D N3    1 
ATOM 77   C C4    . DA  A 1 4  ? -49.614 90.931  -14.736 1.00 22.92 ? 104 DA  D C4    1 
ATOM 78   P P     . DG  A 1 5  ? -45.872 92.757  -19.921 1.00 48.35 ? 105 DG  D P     1 
ATOM 79   O OP1   . DG  A 1 5  ? -45.929 93.367  -21.278 1.00 40.67 ? 105 DG  D OP1   1 
ATOM 80   O OP2   . DG  A 1 5  ? -44.656 92.035  -19.481 1.00 40.67 ? 105 DG  D OP2   1 
ATOM 81   O "O5'" . DG  A 1 5  ? -46.120 93.873  -18.816 1.00 48.35 ? 105 DG  D "O5'" 1 
ATOM 82   C "C5'" . DG  A 1 5  ? -47.321 94.625  -18.793 1.00 48.35 ? 105 DG  D "C5'" 1 
ATOM 83   C "C4'" . DG  A 1 5  ? -47.398 95.421  -17.514 1.00 48.35 ? 105 DG  D "C4'" 1 
ATOM 84   O "O4'" . DG  A 1 5  ? -47.648 94.536  -16.396 1.00 48.35 ? 105 DG  D "O4'" 1 
ATOM 85   C "C3'" . DG  A 1 5  ? -46.124 96.195  -17.161 1.00 48.35 ? 105 DG  D "C3'" 1 
ATOM 86   O "O3'" . DG  A 1 5  ? -46.485 97.485  -16.657 1.00 48.35 ? 105 DG  D "O3'" 1 
ATOM 87   C "C2'" . DG  A 1 5  ? -45.522 95.369  -16.038 1.00 48.35 ? 105 DG  D "C2'" 1 
ATOM 88   C "C1'" . DG  A 1 5  ? -46.778 94.904  -15.347 1.00 48.35 ? 105 DG  D "C1'" 1 
ATOM 89   N N9    . DG  A 1 5  ? -46.650 93.781  -14.424 1.00 40.67 ? 105 DG  D N9    1 
ATOM 90   C C8    . DG  A 1 5  ? -45.905 92.640  -14.573 1.00 40.67 ? 105 DG  D C8    1 
ATOM 91   N N7    . DG  A 1 5  ? -46.000 91.832  -13.551 1.00 40.67 ? 105 DG  D N7    1 
ATOM 92   C C5    . DG  A 1 5  ? -46.863 92.482  -12.680 1.00 40.67 ? 105 DG  D C5    1 
ATOM 93   C C6    . DG  A 1 5  ? -47.358 92.094  -11.402 1.00 40.67 ? 105 DG  D C6    1 
ATOM 94   O O6    . DG  A 1 5  ? -47.135 91.062  -10.768 1.00 40.67 ? 105 DG  D O6    1 
ATOM 95   N N1    . DG  A 1 5  ? -48.205 93.054  -10.870 1.00 40.67 ? 105 DG  D N1    1 
ATOM 96   C C2    . DG  A 1 5  ? -48.544 94.231  -11.485 1.00 40.67 ? 105 DG  D C2    1 
ATOM 97   N N2    . DG  A 1 5  ? -49.381 95.035  -10.811 1.00 40.67 ? 105 DG  D N2    1 
ATOM 98   N N3    . DG  A 1 5  ? -48.100 94.599  -12.673 1.00 40.67 ? 105 DG  D N3    1 
ATOM 99   C C4    . DG  A 1 5  ? -47.270 93.684  -13.207 1.00 40.67 ? 105 DG  D C4    1 
ATOM 100  P P     . DG  A 1 6  ? -45.373 98.643  -16.510 1.00 35.08 ? 106 DG  D P     1 
ATOM 101  O OP1   . DG  A 1 6  ? -45.708 99.674  -17.525 1.00 35.83 ? 106 DG  D OP1   1 
ATOM 102  O OP2   . DG  A 1 6  ? -43.991 98.064  -16.475 1.00 35.83 ? 106 DG  D OP2   1 
ATOM 103  O "O5'" . DG  A 1 6  ? -45.730 99.241  -15.084 1.00 35.08 ? 106 DG  D "O5'" 1 
ATOM 104  C "C5'" . DG  A 1 6  ? -47.081 99.518  -14.773 1.00 35.08 ? 106 DG  D "C5'" 1 
ATOM 105  C "C4'" . DG  A 1 6  ? -47.216 99.909  -13.325 1.00 35.08 ? 106 DG  D "C4'" 1 
ATOM 106  O "O4'" . DG  A 1 6  ? -47.354 98.761  -12.455 1.00 35.08 ? 106 DG  D "O4'" 1 
ATOM 107  C "C3'" . DG  A 1 6  ? -46.036 100.718 -12.800 1.00 35.08 ? 106 DG  D "C3'" 1 
ATOM 108  O "O3'" . DG  A 1 6  ? -46.530 101.777 -11.972 1.00 35.08 ? 106 DG  D "O3'" 1 
ATOM 109  C "C2'" . DG  A 1 6  ? -45.259 99.696  -11.993 1.00 35.08 ? 106 DG  D "C2'" 1 
ATOM 110  C "C1'" . DG  A 1 6  ? -46.370 98.818  -11.443 1.00 35.08 ? 106 DG  D "C1'" 1 
ATOM 111  N N9    . DG  A 1 6  ? -45.948 97.456  -11.158 1.00 35.83 ? 106 DG  D N9    1 
ATOM 112  C C8    . DG  A 1 6  ? -45.314 96.586  -12.012 1.00 35.83 ? 106 DG  D C8    1 
ATOM 113  N N7    . DG  A 1 6  ? -45.054 95.431  -11.465 1.00 35.83 ? 106 DG  D N7    1 
ATOM 114  C C5    . DG  A 1 6  ? -45.545 95.548  -10.174 1.00 35.83 ? 106 DG  D C5    1 
ATOM 115  C C6    . DG  A 1 6  ? -45.546 94.621  -9.112  1.00 35.83 ? 106 DG  D C6    1 
ATOM 116  O O6    . DG  A 1 6  ? -45.082 93.473  -9.092  1.00 35.83 ? 106 DG  D O6    1 
ATOM 117  N N1    . DG  A 1 6  ? -46.161 95.144  -7.981  1.00 35.83 ? 106 DG  D N1    1 
ATOM 118  C C2    . DG  A 1 6  ? -46.697 96.401  -7.887  1.00 35.83 ? 106 DG  D C2    1 
ATOM 119  N N2    . DG  A 1 6  ? -47.253 96.709  -6.717  1.00 35.83 ? 106 DG  D N2    1 
ATOM 120  N N3    . DG  A 1 6  ? -46.689 97.283  -8.865  1.00 35.83 ? 106 DG  D N3    1 
ATOM 121  C C4    . DG  A 1 6  ? -46.104 96.792  -9.972  1.00 35.83 ? 106 DG  D C4    1 
ATOM 122  P P     . DA  A 1 7  ? -45.611 103.056 -11.676 1.00 39.16 ? 107 DA  D P     1 
ATOM 123  O OP1   . DA  A 1 7  ? -46.388 104.251 -12.093 1.00 36.30 ? 107 DA  D OP1   1 
ATOM 124  O OP2   . DA  A 1 7  ? -44.258 102.819 -12.252 1.00 36.30 ? 107 DA  D OP2   1 
ATOM 125  O "O5'" . DA  A 1 7  ? -45.525 103.014 -10.090 1.00 39.16 ? 107 DA  D "O5'" 1 
ATOM 126  C "C5'" . DA  A 1 7  ? -46.709 102.846 -9.328  1.00 39.16 ? 107 DA  D "C5'" 1 
ATOM 127  C "C4'" . DA  A 1 7  ? -46.368 102.467 -7.909  1.00 39.16 ? 107 DA  D "C4'" 1 
ATOM 128  O "O4'" . DA  A 1 7  ? -46.056 101.058 -7.797  1.00 39.16 ? 107 DA  D "O4'" 1 
ATOM 129  C "C3'" . DA  A 1 7  ? -45.186 103.220 -7.299  1.00 39.16 ? 107 DA  D "C3'" 1 
ATOM 130  O "O3'" . DA  A 1 7  ? -45.546 103.609 -5.964  1.00 39.16 ? 107 DA  D "O3'" 1 
ATOM 131  C "C2'" . DA  A 1 7  ? -44.070 102.187 -7.314  1.00 39.16 ? 107 DA  D "C2'" 1 
ATOM 132  C "C1'" . DA  A 1 7  ? -44.840 100.895 -7.088  1.00 39.16 ? 107 DA  D "C1'" 1 
ATOM 133  N N9    . DA  A 1 7  ? -44.191 99.679  -7.581  1.00 36.30 ? 107 DA  D N9    1 
ATOM 134  C C8    . DA  A 1 7  ? -43.652 99.468  -8.820  1.00 36.30 ? 107 DA  D C8    1 
ATOM 135  N N7    . DA  A 1 7  ? -43.143 98.271  -8.977  1.00 36.30 ? 107 DA  D N7    1 
ATOM 136  C C5    . DA  A 1 7  ? -43.359 97.651  -7.757  1.00 36.30 ? 107 DA  D C5    1 
ATOM 137  C C6    . DA  A 1 7  ? -43.049 96.360  -7.281  1.00 36.30 ? 107 DA  D C6    1 
ATOM 138  N N6    . DA  A 1 7  ? -42.430 95.429  -8.014  1.00 36.30 ? 107 DA  D N6    1 
ATOM 139  N N1    . DA  A 1 7  ? -43.400 96.055  -6.012  1.00 36.30 ? 107 DA  D N1    1 
ATOM 140  C C2    . DA  A 1 7  ? -44.021 96.991  -5.281  1.00 36.30 ? 107 DA  D C2    1 
ATOM 141  N N3    . DA  A 1 7  ? -44.367 98.237  -5.618  1.00 36.30 ? 107 DA  D N3    1 
ATOM 142  C C4    . DA  A 1 7  ? -44.002 98.506  -6.885  1.00 36.30 ? 107 DA  D C4    1 
ATOM 143  P P     . DT  A 1 8  ? -44.485 104.365 -5.027  1.00 47.73 ? 108 DT  D P     1 
ATOM 144  O OP1   . DT  A 1 8  ? -45.300 105.233 -4.146  1.00 26.43 ? 108 DT  D OP1   1 
ATOM 145  O OP2   . DT  A 1 8  ? -43.404 104.959 -5.871  1.00 26.43 ? 108 DT  D OP2   1 
ATOM 146  O "O5'" . DT  A 1 8  ? -43.876 103.179 -4.152  1.00 47.73 ? 108 DT  D "O5'" 1 
ATOM 147  C "C5'" . DT  A 1 8  ? -44.741 102.344 -3.379  1.00 47.73 ? 108 DT  D "C5'" 1 
ATOM 148  C "C4'" . DT  A 1 8  ? -43.942 101.413 -2.496  1.00 47.73 ? 108 DT  D "C4'" 1 
ATOM 149  O "O4'" . DT  A 1 8  ? -43.433 100.295 -3.251  1.00 47.73 ? 108 DT  D "O4'" 1 
ATOM 150  C "C3'" . DT  A 1 8  ? -42.732 102.021 -1.787  1.00 47.73 ? 108 DT  D "C3'" 1 
ATOM 151  O "O3'" . DT  A 1 8  ? -42.654 101.446 -0.481  1.00 47.73 ? 108 DT  D "O3'" 1 
ATOM 152  C "C2'" . DT  A 1 8  ? -41.571 101.546 -2.640  1.00 47.73 ? 108 DT  D "C2'" 1 
ATOM 153  C "C1'" . DT  A 1 8  ? -42.049 100.162 -3.001  1.00 47.73 ? 108 DT  D "C1'" 1 
ATOM 154  N N1    . DT  A 1 8  ? -41.439 99.535  -4.178  1.00 26.43 ? 108 DT  D N1    1 
ATOM 155  C C2    . DT  A 1 8  ? -41.132 98.206  -4.060  1.00 26.43 ? 108 DT  D C2    1 
ATOM 156  O O2    . DT  A 1 8  ? -41.327 97.574  -3.029  1.00 26.43 ? 108 DT  D O2    1 
ATOM 157  N N3    . DT  A 1 8  ? -40.583 97.640  -5.189  1.00 26.43 ? 108 DT  D N3    1 
ATOM 158  C C4    . DT  A 1 8  ? -40.310 98.272  -6.387  1.00 26.43 ? 108 DT  D C4    1 
ATOM 159  O O4    . DT  A 1 8  ? -39.810 97.644  -7.315  1.00 26.43 ? 108 DT  D O4    1 
ATOM 160  C C5    . DT  A 1 8  ? -40.648 99.667  -6.435  1.00 26.43 ? 108 DT  D C5    1 
ATOM 161  C C7    . DT  A 1 8  ? -40.375 100.422 -7.692  1.00 26.43 ? 108 DT  D C7    1 
ATOM 162  C C6    . DT  A 1 8  ? -41.191 100.228 -5.344  1.00 26.43 ? 108 DT  D C6    1 
ATOM 163  P P     . DG  A 1 9  ? -41.429 101.814 0.489   1.00 34.96 ? 109 DG  D P     1 
ATOM 164  O OP1   . DG  A 1 9  ? -41.984 102.496 1.678   1.00 21.19 ? 109 DG  D OP1   1 
ATOM 165  O OP2   . DG  A 1 9  ? -40.342 102.453 -0.300  1.00 21.19 ? 109 DG  D OP2   1 
ATOM 166  O "O5'" . DG  A 1 9  ? -40.895 100.397 0.965   1.00 34.96 ? 109 DG  D "O5'" 1 
ATOM 167  C "C5'" . DG  A 1 9  ? -41.809 99.360  1.297   1.00 34.96 ? 109 DG  D "C5'" 1 
ATOM 168  C "C4'" . DG  A 1 9  ? -41.056 98.071  1.495   1.00 34.96 ? 109 DG  D "C4'" 1 
ATOM 169  O "O4'" . DG  A 1 9  ? -40.623 97.541  0.221   1.00 34.96 ? 109 DG  D "O4'" 1 
ATOM 170  C "C3'" . DG  A 1 9  ? -39.798 98.250  2.336   1.00 34.96 ? 109 DG  D "C3'" 1 
ATOM 171  O "O3'" . DG  A 1 9  ? -39.695 97.170  3.253   1.00 34.96 ? 109 DG  D "O3'" 1 
ATOM 172  C "C2'" . DG  A 1 9  ? -38.675 98.230  1.315   1.00 34.96 ? 109 DG  D "C2'" 1 
ATOM 173  C "C1'" . DG  A 1 9  ? -39.225 97.323  0.232   1.00 34.96 ? 109 DG  D "C1'" 1 
ATOM 174  N N9    . DG  A 1 9  ? -38.734 97.620  -1.107  1.00 21.19 ? 109 DG  D N9    1 
ATOM 175  C C8    . DG  A 1 9  ? -38.835 98.818  -1.767  1.00 21.19 ? 109 DG  D C8    1 
ATOM 176  N N7    . DG  A 1 9  ? -38.330 98.786  -2.968  1.00 21.19 ? 109 DG  D N7    1 
ATOM 177  C C5    . DG  A 1 9  ? -37.864 97.488  -3.111  1.00 21.19 ? 109 DG  D C5    1 
ATOM 178  C C6    . DG  A 1 9  ? -37.239 96.859  -4.211  1.00 21.19 ? 109 DG  D C6    1 
ATOM 179  O O6    . DG  A 1 9  ? -36.998 97.328  -5.331  1.00 21.19 ? 109 DG  D O6    1 
ATOM 180  N N1    . DG  A 1 9  ? -36.906 95.537  -3.925  1.00 21.19 ? 109 DG  D N1    1 
ATOM 181  C C2    . DG  A 1 9  ? -37.178 94.891  -2.753  1.00 21.19 ? 109 DG  D C2    1 
ATOM 182  N N2    . DG  A 1 9  ? -36.798 93.616  -2.697  1.00 21.19 ? 109 DG  D N2    1 
ATOM 183  N N3    . DG  A 1 9  ? -37.786 95.459  -1.720  1.00 21.19 ? 109 DG  D N3    1 
ATOM 184  C C4    . DG  A 1 9  ? -38.095 96.755  -1.968  1.00 21.19 ? 109 DG  D C4    1 
ATOM 185  P P     . DT  A 1 10 ? -38.442 97.091  4.238   1.00 41.48 ? 110 DT  D P     1 
ATOM 186  O OP1   . DT  A 1 10 ? -38.948 96.543  5.541   1.00 18.80 ? 110 DT  D OP1   1 
ATOM 187  O OP2   . DT  A 1 10 ? -37.757 98.420  4.200   1.00 18.80 ? 110 DT  D OP2   1 
ATOM 188  O "O5'" . DT  A 1 10 ? -37.509 96.021  3.516   1.00 41.48 ? 110 DT  D "O5'" 1 
ATOM 189  C "C5'" . DT  A 1 10 ? -38.032 94.751  3.147   1.00 41.48 ? 110 DT  D "C5'" 1 
ATOM 190  C "C4'" . DT  A 1 10 ? -36.918 93.837  2.705   1.00 41.48 ? 110 DT  D "C4'" 1 
ATOM 191  O "O4'" . DT  A 1 10 ? -36.549 94.095  1.330   1.00 41.48 ? 110 DT  D "O4'" 1 
ATOM 192  C "C3'" . DT  A 1 10 ? -35.636 93.965  3.523   1.00 41.48 ? 110 DT  D "C3'" 1 
ATOM 193  O "O3'" . DT  A 1 10 ? -35.104 92.665  3.765   1.00 41.48 ? 110 DT  D "O3'" 1 
ATOM 194  C "C2'" . DT  A 1 10 ? -34.712 94.747  2.605   1.00 41.48 ? 110 DT  D "C2'" 1 
ATOM 195  C "C1'" . DT  A 1 10 ? -35.146 94.257  1.238   1.00 41.48 ? 110 DT  D "C1'" 1 
ATOM 196  N N1    . DT  A 1 10 ? -34.881 95.195  0.139   1.00 18.80 ? 110 DT  D N1    1 
ATOM 197  C C2    . DT  A 1 10 ? -34.231 94.735  -0.995  1.00 18.80 ? 110 DT  D C2    1 
ATOM 198  O O2    . DT  A 1 10 ? -33.846 93.583  -1.135  1.00 18.80 ? 110 DT  D O2    1 
ATOM 199  N N3    . DT  A 1 10 ? -34.046 95.685  -1.970  1.00 18.80 ? 110 DT  D N3    1 
ATOM 200  C C4    . DT  A 1 10 ? -34.432 97.010  -1.934  1.00 18.80 ? 110 DT  D C4    1 
ATOM 201  O O4    . DT  A 1 10 ? -34.186 97.742  -2.889  1.00 18.80 ? 110 DT  D O4    1 
ATOM 202  C C5    . DT  A 1 10 ? -35.111 97.421  -0.720  1.00 18.80 ? 110 DT  D C5    1 
ATOM 203  C C7    . DT  A 1 10 ? -35.588 98.832  -0.592  1.00 18.80 ? 110 DT  D C7    1 
ATOM 204  C C6    . DT  A 1 10 ? -35.291 96.506  0.244   1.00 18.80 ? 110 DT  D C6    1 
ATOM 205  P P     . DC  A 1 11 ? -34.092 92.430  4.991   1.00 30.00 ? 111 DC  D P     1 
ATOM 206  O OP1   . DC  A 1 11 ? -34.562 91.205  5.683   1.00 28.82 ? 111 DC  D OP1   1 
ATOM 207  O OP2   . DC  A 1 11 ? -33.946 93.697  5.759   1.00 28.82 ? 111 DC  D OP2   1 
ATOM 208  O "O5'" . DC  A 1 11 ? -32.719 92.105  4.259   1.00 30.00 ? 111 DC  D "O5'" 1 
ATOM 209  C "C5'" . DC  A 1 11 ? -32.659 91.036  3.323   1.00 30.00 ? 111 DC  D "C5'" 1 
ATOM 210  C "C4'" . DC  A 1 11 ? -31.319 91.016  2.630   1.00 30.00 ? 111 DC  D "C4'" 1 
ATOM 211  O "O4'" . DC  A 1 11 ? -31.317 91.874  1.465   1.00 30.00 ? 111 DC  D "O4'" 1 
ATOM 212  C "C3'" . DC  A 1 11 ? -30.165 91.478  3.516   1.00 30.00 ? 111 DC  D "C3'" 1 
ATOM 213  O "O3'" . DC  A 1 11 ? -29.051 90.605  3.334   1.00 30.00 ? 111 DC  D "O3'" 1 
ATOM 214  C "C2'" . DC  A 1 11 ? -29.866 92.878  3.005   1.00 30.00 ? 111 DC  D "C2'" 1 
ATOM 215  C "C1'" . DC  A 1 11 ? -30.202 92.754  1.526   1.00 30.00 ? 111 DC  D "C1'" 1 
ATOM 216  N N1    . DC  A 1 11 ? -30.569 94.014  0.840   1.00 28.82 ? 111 DC  D N1    1 
ATOM 217  C C2    . DC  A 1 11 ? -30.213 94.182  -0.515  1.00 28.82 ? 111 DC  D C2    1 
ATOM 218  O O2    . DC  A 1 11 ? -29.582 93.276  -1.095  1.00 28.82 ? 111 DC  D O2    1 
ATOM 219  N N3    . DC  A 1 11 ? -30.566 95.321  -1.154  1.00 28.82 ? 111 DC  D N3    1 
ATOM 220  C C4    . DC  A 1 11 ? -31.245 96.265  -0.503  1.00 28.82 ? 111 DC  D C4    1 
ATOM 221  N N4    . DC  A 1 11 ? -31.592 97.355  -1.177  1.00 28.82 ? 111 DC  D N4    1 
ATOM 222  C C5    . DC  A 1 11 ? -31.605 96.130  0.869   1.00 28.82 ? 111 DC  D C5    1 
ATOM 223  C C6    . DC  A 1 11 ? -31.248 95.001  1.497   1.00 28.82 ? 111 DC  D C6    1 
ATOM 224  P P     . DC  A 1 12 ? -27.703 90.852  4.167   1.00 50.21 ? 112 DC  D P     1 
ATOM 225  O OP1   . DC  A 1 12 ? -27.269 89.549  4.747   1.00 40.13 ? 112 DC  D OP1   1 
ATOM 226  O OP2   . DC  A 1 12 ? -27.909 92.028  5.062   1.00 40.13 ? 112 DC  D OP2   1 
ATOM 227  O "O5'" . DC  A 1 12 ? -26.688 91.281  3.021   1.00 50.21 ? 112 DC  D "O5'" 1 
ATOM 228  C "C5'" . DC  A 1 12 ? -26.635 90.536  1.813   1.00 50.21 ? 112 DC  D "C5'" 1 
ATOM 229  C "C4'" . DC  A 1 12 ? -25.608 91.122  0.875   1.00 50.21 ? 112 DC  D "C4'" 1 
ATOM 230  O "O4'" . DC  A 1 12 ? -26.131 92.293  0.210   1.00 50.21 ? 112 DC  D "O4'" 1 
ATOM 231  C "C3'" . DC  A 1 12 ? -24.302 91.553  1.534   1.00 50.21 ? 112 DC  D "C3'" 1 
ATOM 232  O "O3'" . DC  A 1 12 ? -23.207 91.189  0.697   1.00 50.21 ? 112 DC  D "O3'" 1 
ATOM 233  C "C2'" . DC  A 1 12 ? -24.430 93.063  1.608   1.00 50.21 ? 112 DC  D "C2'" 1 
ATOM 234  C "C1'" . DC  A 1 12 ? -25.232 93.374  0.360   1.00 50.21 ? 112 DC  D "C1'" 1 
ATOM 235  N N1    . DC  A 1 12 ? -26.034 94.600  0.429   1.00 40.13 ? 112 DC  D N1    1 
ATOM 236  C C2    . DC  A 1 12 ? -26.152 95.380  -0.713  1.00 40.13 ? 112 DC  D C2    1 
ATOM 237  O O2    . DC  A 1 12 ? -25.560 95.018  -1.744  1.00 40.13 ? 112 DC  D O2    1 
ATOM 238  N N3    . DC  A 1 12 ? -26.907 96.504  -0.675  1.00 40.13 ? 112 DC  D N3    1 
ATOM 239  C C4    . DC  A 1 12 ? -27.532 96.848  0.454   1.00 40.13 ? 112 DC  D C4    1 
ATOM 240  N N4    . DC  A 1 12 ? -28.275 97.964  0.448   1.00 40.13 ? 112 DC  D N4    1 
ATOM 241  C C5    . DC  A 1 12 ? -27.425 96.067  1.638   1.00 40.13 ? 112 DC  D C5    1 
ATOM 242  C C6    . DC  A 1 12 ? -26.668 94.965  1.583   1.00 40.13 ? 112 DC  D C6    1 
ATOM 243  P P     . DA  A 1 13 ? -21.717 91.609  1.115   1.00 51.86 ? 113 DA  D P     1 
ATOM 244  O OP1   . DA  A 1 13 ? -20.763 90.676  0.423   1.00 23.32 ? 113 DA  D OP1   1 
ATOM 245  O OP2   . DA  A 1 13 ? -21.702 91.721  2.613   1.00 23.32 ? 113 DA  D OP2   1 
ATOM 246  O "O5'" . DA  A 1 13 ? -21.571 93.067  0.483   1.00 51.86 ? 113 DA  D "O5'" 1 
ATOM 247  C "C5'" . DA  A 1 13 ? -21.612 93.238  -0.926  1.00 51.86 ? 113 DA  D "C5'" 1 
ATOM 248  C "C4'" . DA  A 1 13 ? -21.079 94.597  -1.301  1.00 51.86 ? 113 DA  D "C4'" 1 
ATOM 249  O "O4'" . DA  A 1 13 ? -22.056 95.613  -0.991  1.00 51.86 ? 113 DA  D "O4'" 1 
ATOM 250  C "C3'" . DA  A 1 13 ? -19.803 94.999  -0.572  1.00 51.86 ? 113 DA  D "C3'" 1 
ATOM 251  O "O3'" . DA  A 1 13 ? -18.984 95.726  -1.483  1.00 51.86 ? 113 DA  D "O3'" 1 
ATOM 252  C "C2'" . DA  A 1 13 ? -20.315 95.893  0.543   1.00 51.86 ? 113 DA  D "C2'" 1 
ATOM 253  C "C1'" . DA  A 1 13 ? -21.494 96.583  -0.122  1.00 51.86 ? 113 DA  D "C1'" 1 
ATOM 254  N N9    . DA  A 1 13 ? -22.553 97.027  0.791   1.00 23.32 ? 113 DA  D N9    1 
ATOM 255  C C8    . DA  A 1 13 ? -22.792 96.582  2.074   1.00 23.32 ? 113 DA  D C8    1 
ATOM 256  N N7    . DA  A 1 13 ? -23.835 97.136  2.646   1.00 23.32 ? 113 DA  D N7    1 
ATOM 257  C C5    . DA  A 1 13 ? -24.311 98.015  1.686   1.00 23.32 ? 113 DA  D C5    1 
ATOM 258  C C6    . DA  A 1 13 ? -25.400 98.902  1.686   1.00 23.32 ? 113 DA  D C6    1 
ATOM 259  N N6    . DA  A 1 13 ? -26.225 99.054  2.730   1.00 23.32 ? 113 DA  D N6    1 
ATOM 260  N N1    . DA  A 1 13 ? -25.616 99.631  0.566   1.00 23.32 ? 113 DA  D N1    1 
ATOM 261  C C2    . DA  A 1 13 ? -24.776 99.475  -0.478  1.00 23.32 ? 113 DA  D C2    1 
ATOM 262  N N3    . DA  A 1 13 ? -23.710 98.679  -0.594  1.00 23.32 ? 113 DA  D N3    1 
ATOM 263  C C4    . DA  A 1 13 ? -23.530 97.965  0.536   1.00 23.32 ? 113 DA  D C4    1 
ATOM 264  P P     . DT  A 1 14 ? -17.596 96.363  -0.987  1.00 38.29 ? 114 DT  D P     1 
ATOM 265  O OP1   . DT  A 1 14 ? -16.497 95.636  -1.674  1.00 38.46 ? 114 DT  D OP1   1 
ATOM 266  O OP2   . DT  A 1 14 ? -17.590 96.483  0.501   1.00 38.46 ? 114 DT  D OP2   1 
ATOM 267  O "O5'" . DT  A 1 14 ? -17.641 97.828  -1.600  1.00 38.29 ? 114 DT  D "O5'" 1 
ATOM 268  C "C5'" . DT  A 1 14 ? -18.303 98.071  -2.837  1.00 38.29 ? 114 DT  D "C5'" 1 
ATOM 269  C "C4'" . DT  A 1 14 ? -18.987 99.420  -2.806  1.00 38.29 ? 114 DT  D "C4'" 1 
ATOM 270  O "O4'" . DT  A 1 14 ? -20.063 99.442  -1.834  1.00 38.29 ? 114 DT  D "O4'" 1 
ATOM 271  C "C3'" . DT  A 1 14 ? -18.090 100.602 -2.436  1.00 38.29 ? 114 DT  D "C3'" 1 
ATOM 272  O "O3'" . DT  A 1 14 ? -18.474 101.710 -3.237  1.00 38.29 ? 114 DT  D "O3'" 1 
ATOM 273  C "C2'" . DT  A 1 14 ? -18.469 100.895 -0.996  1.00 38.29 ? 114 DT  D "C2'" 1 
ATOM 274  C "C1'" . DT  A 1 14 ? -19.950 100.640 -1.089  1.00 38.29 ? 114 DT  D "C1'" 1 
ATOM 275  N N1    . DT  A 1 14 ? -20.693 100.491 0.167   1.00 38.46 ? 114 DT  D N1    1 
ATOM 276  C C2    . DT  A 1 14 ? -21.892 101.174 0.258   1.00 38.46 ? 114 DT  D C2    1 
ATOM 277  O O2    . DT  A 1 14 ? -22.362 101.825 -0.661  1.00 38.46 ? 114 DT  D O2    1 
ATOM 278  N N3    . DT  A 1 14 ? -22.527 101.059 1.465   1.00 38.46 ? 114 DT  D N3    1 
ATOM 279  C C4    . DT  A 1 14 ? -22.104 100.338 2.568   1.00 38.46 ? 114 DT  D C4    1 
ATOM 280  O O4    . DT  A 1 14 ? -22.772 100.356 3.605   1.00 38.46 ? 114 DT  D O4    1 
ATOM 281  C C5    . DT  A 1 14 ? -20.857 99.609  2.392   1.00 38.46 ? 114 DT  D C5    1 
ATOM 282  C C7    . DT  A 1 14 ? -20.343 98.769  3.522   1.00 38.46 ? 114 DT  D C7    1 
ATOM 283  C C6    . DT  A 1 14 ? -20.219 99.724  1.213   1.00 38.46 ? 114 DT  D C6    1 
ATOM 284  P P     . DA  A 1 15 ? -17.347 102.627 -3.902  1.00 42.60 ? 115 DA  D P     1 
ATOM 285  O OP1   . DA  A 1 15 ? -16.799 101.968 -5.120  1.00 46.22 ? 115 DA  D OP1   1 
ATOM 286  O OP2   . DA  A 1 15 ? -16.440 102.978 -2.774  1.00 46.22 ? 115 DA  D OP2   1 
ATOM 287  O "O5'" . DA  A 1 15 ? -18.125 103.942 -4.357  1.00 42.60 ? 115 DA  D "O5'" 1 
ATOM 288  C "C5'" . DA  A 1 15 ? -19.209 103.875 -5.277  1.00 42.60 ? 115 DA  D "C5'" 1 
ATOM 289  C "C4'" . DA  A 1 15 ? -20.269 104.878 -4.891  1.00 42.60 ? 115 DA  D "C4'" 1 
ATOM 290  O "O4'" . DA  A 1 15 ? -20.790 104.537 -3.586  1.00 42.60 ? 115 DA  D "O4'" 1 
ATOM 291  C "C3'" . DA  A 1 15 ? -19.774 106.318 -4.773  1.00 42.60 ? 115 DA  D "C3'" 1 
ATOM 292  O "O3'" . DA  A 1 15 ? -20.809 107.206 -5.200  1.00 42.60 ? 115 DA  D "O3'" 1 
ATOM 293  C "C2'" . DA  A 1 15 ? -19.546 106.482 -3.282  1.00 42.60 ? 115 DA  D "C2'" 1 
ATOM 294  C "C1'" . DA  A 1 15 ? -20.667 105.647 -2.711  1.00 42.60 ? 115 DA  D "C1'" 1 
ATOM 295  N N9    . DA  A 1 15 ? -20.398 105.139 -1.367  1.00 46.22 ? 115 DA  D N9    1 
ATOM 296  C C8    . DA  A 1 15 ? -19.321 104.391 -0.977  1.00 46.22 ? 115 DA  D C8    1 
ATOM 297  N N7    . DA  A 1 15 ? -19.332 104.073 0.297   1.00 46.22 ? 115 DA  D N7    1 
ATOM 298  C C5    . DA  A 1 15 ? -20.494 104.656 0.777   1.00 46.22 ? 115 DA  D C5    1 
ATOM 299  C C6    . DA  A 1 15 ? -21.069 104.691 2.054   1.00 46.22 ? 115 DA  D C6    1 
ATOM 300  N N6    . DA  A 1 15 ? -20.520 104.119 3.125   1.00 46.22 ? 115 DA  D N6    1 
ATOM 301  N N1    . DA  A 1 15 ? -22.237 105.348 2.201   1.00 46.22 ? 115 DA  D N1    1 
ATOM 302  C C2    . DA  A 1 15 ? -22.771 105.936 1.132   1.00 46.22 ? 115 DA  D C2    1 
ATOM 303  N N3    . DA  A 1 15 ? -22.321 105.982 -0.120  1.00 46.22 ? 115 DA  D N3    1 
ATOM 304  C C4    . DA  A 1 15 ? -21.163 105.313 -0.234  1.00 46.22 ? 115 DA  D C4    1 
ATOM 305  P P     . DT  A 1 16 ? -20.435 108.640 -5.815  1.00 36.16 ? 116 DT  D P     1 
ATOM 306  O OP1   . DT  A 1 16 ? -21.231 108.898 -7.050  1.00 43.01 ? 116 DT  D OP1   1 
ATOM 307  O OP2   . DT  A 1 16 ? -18.959 108.768 -5.852  1.00 43.01 ? 116 DT  D OP2   1 
ATOM 308  O "O5'" . DT  A 1 16 ? -20.948 109.635 -4.701  1.00 36.16 ? 116 DT  D "O5'" 1 
ATOM 309  C "C5'" . DT  A 1 16 ? -21.200 109.165 -3.405  1.00 36.16 ? 116 DT  D "C5'" 1 
ATOM 310  C "C4'" . DT  A 1 16 ? -22.408 109.866 -2.848  1.00 36.16 ? 116 DT  D "C4'" 1 
ATOM 311  O "O4'" . DT  A 1 16 ? -22.727 109.248 -1.589  1.00 36.16 ? 116 DT  D "O4'" 1 
ATOM 312  C "C3'" . DT  A 1 16 ? -22.187 111.348 -2.558  1.00 36.16 ? 116 DT  D "C3'" 1 
ATOM 313  O "O3'" . DT  A 1 16 ? -23.393 112.079 -2.825  1.00 36.16 ? 116 DT  D "O3'" 1 
ATOM 314  C "C2'" . DT  A 1 16 ? -21.792 111.367 -1.093  1.00 36.16 ? 116 DT  D "C2'" 1 
ATOM 315  C "C1'" . DT  A 1 16 ? -22.446 110.116 -0.510  1.00 36.16 ? 116 DT  D "C1'" 1 
ATOM 316  N N1    . DT  A 1 16 ? -21.550 109.390 0.381   1.00 43.01 ? 116 DT  D N1    1 
ATOM 317  C C2    . DT  A 1 16 ? -21.930 109.200 1.686   1.00 43.01 ? 116 DT  D C2    1 
ATOM 318  O O2    . DT  A 1 16 ? -23.005 109.576 2.126   1.00 43.01 ? 116 DT  D O2    1 
ATOM 319  N N3    . DT  A 1 16 ? -21.008 108.544 2.458   1.00 43.01 ? 116 DT  D N3    1 
ATOM 320  C C4    . DT  A 1 16 ? -19.780 108.055 2.050   1.00 43.01 ? 116 DT  D C4    1 
ATOM 321  O O4    . DT  A 1 16 ? -19.054 107.482 2.860   1.00 43.01 ? 116 DT  D O4    1 
ATOM 322  C C5    . DT  A 1 16 ? -19.458 108.275 0.646   1.00 43.01 ? 116 DT  D C5    1 
ATOM 323  C C7    . DT  A 1 16 ? -18.161 107.768 0.097   1.00 43.01 ? 116 DT  D C7    1 
ATOM 324  C C6    . DT  A 1 16 ? -20.349 108.925 -0.101  1.00 43.01 ? 116 DT  D C6    1 
ATOM 325  P P     . DT  A 1 17 ? -23.570 113.573 -2.268  1.00 29.71 ? 117 DT  D P     1 
ATOM 326  O OP1   . DT  A 1 17 ? -24.837 114.124 -2.823  1.00 21.15 ? 117 DT  D OP1   1 
ATOM 327  O OP2   . DT  A 1 17 ? -22.300 114.326 -2.451  1.00 21.15 ? 117 DT  D OP2   1 
ATOM 328  O "O5'" . DT  A 1 17 ? -23.782 113.328 -0.718  1.00 29.71 ? 117 DT  D "O5'" 1 
ATOM 329  C "C5'" . DT  A 1 17 ? -24.390 114.318 0.064   1.00 29.71 ? 117 DT  D "C5'" 1 
ATOM 330  C "C4'" . DT  A 1 17 ? -25.047 113.687 1.260   1.00 29.71 ? 117 DT  D "C4'" 1 
ATOM 331  O "O4'" . DT  A 1 17 ? -24.175 112.634 1.724   1.00 29.71 ? 117 DT  D "O4'" 1 
ATOM 332  C "C3'" . DT  A 1 17 ? -25.154 114.695 2.398   1.00 29.71 ? 117 DT  D "C3'" 1 
ATOM 333  O "O3'" . DT  A 1 17 ? -26.390 114.623 3.090   1.00 29.71 ? 117 DT  D "O3'" 1 
ATOM 334  C "C2'" . DT  A 1 17 ? -23.971 114.380 3.289   1.00 29.71 ? 117 DT  D "C2'" 1 
ATOM 335  C "C1'" . DT  A 1 17 ? -23.780 112.893 3.066   1.00 29.71 ? 117 DT  D "C1'" 1 
ATOM 336  N N1    . DT  A 1 17 ? -22.392 112.427 3.234   1.00 21.15 ? 117 DT  D N1    1 
ATOM 337  C C2    . DT  A 1 17 ? -22.083 111.718 4.381   1.00 21.15 ? 117 DT  D C2    1 
ATOM 338  O O2    . DT  A 1 17 ? -22.893 111.495 5.280   1.00 21.15 ? 117 DT  D O2    1 
ATOM 339  N N3    . DT  A 1 17 ? -20.784 111.276 4.441   1.00 21.15 ? 117 DT  D N3    1 
ATOM 340  C C4    . DT  A 1 17 ? -19.792 111.467 3.497   1.00 21.15 ? 117 DT  D C4    1 
ATOM 341  O O4    . DT  A 1 17 ? -18.671 110.989 3.683   1.00 21.15 ? 117 DT  D O4    1 
ATOM 342  C C5    . DT  A 1 17 ? -20.186 112.235 2.332   1.00 21.15 ? 117 DT  D C5    1 
ATOM 343  C C7    . DT  A 1 17 ? -19.180 112.493 1.255   1.00 21.15 ? 117 DT  D C7    1 
ATOM 344  C C6    . DT  A 1 17 ? -21.446 112.677 2.266   1.00 21.15 ? 117 DT  D C6    1 
ATOM 345  P P     . DA  A 1 18 ? -27.001 115.973 3.690   1.00 21.79 ? 118 DA  D P     1 
ATOM 346  O OP1   . DA  A 1 18 ? -28.470 115.832 3.888   1.00 43.09 ? 118 DA  D OP1   1 
ATOM 347  O OP2   . DA  A 1 18 ? -26.487 117.050 2.802   1.00 43.09 ? 118 DA  D OP2   1 
ATOM 348  O "O5'" . DA  A 1 18 ? -26.271 116.102 5.109   1.00 21.79 ? 118 DA  D "O5'" 1 
ATOM 349  C "C5'" . DA  A 1 18 ? -26.691 115.307 6.225   1.00 21.79 ? 118 DA  D "C5'" 1 
ATOM 350  C "C4'" . DA  A 1 18 ? -25.713 115.412 7.374   1.00 21.79 ? 118 DA  D "C4'" 1 
ATOM 351  O "O4'" . DA  A 1 18 ? -24.431 114.885 6.967   1.00 21.79 ? 118 DA  D "O4'" 1 
ATOM 352  C "C3'" . DA  A 1 18 ? -25.433 116.817 7.920   1.00 21.79 ? 118 DA  D "C3'" 1 
ATOM 353  O "O3'" . DA  A 1 18 ? -25.181 116.729 9.332   1.00 21.79 ? 118 DA  D "O3'" 1 
ATOM 354  C "C2'" . DA  A 1 18 ? -24.131 117.186 7.232   1.00 21.79 ? 118 DA  D "C2'" 1 
ATOM 355  C "C1'" . DA  A 1 18 ? -23.423 115.842 7.260   1.00 21.79 ? 118 DA  D "C1'" 1 
ATOM 356  N N9    . DA  A 1 18 ? -22.324 115.658 6.309   1.00 43.09 ? 118 DA  D N9    1 
ATOM 357  C C8    . DA  A 1 18 ? -22.140 116.242 5.080   1.00 43.09 ? 118 DA  D C8    1 
ATOM 358  N N7    . DA  A 1 18 ? -21.018 115.899 4.495   1.00 43.09 ? 118 DA  D N7    1 
ATOM 359  C C5    . DA  A 1 18 ? -20.428 115.025 5.395   1.00 43.09 ? 118 DA  D C5    1 
ATOM 360  C C6    . DA  A 1 18 ? -19.204 114.327 5.372   1.00 43.09 ? 118 DA  D C6    1 
ATOM 361  N N6    . DA  A 1 18 ? -18.314 114.418 4.376   1.00 43.09 ? 118 DA  D N6    1 
ATOM 362  N N1    . DA  A 1 18 ? -18.917 113.530 6.425   1.00 43.09 ? 118 DA  D N1    1 
ATOM 363  C C2    . DA  A 1 18 ? -19.804 113.457 7.432   1.00 43.09 ? 118 DA  D C2    1 
ATOM 364  N N3    . DA  A 1 18 ? -20.978 114.074 7.571   1.00 43.09 ? 118 DA  D N3    1 
ATOM 365  C C4    . DA  A 1 18 ? -21.230 114.853 6.507   1.00 43.09 ? 118 DA  D C4    1 
ATOM 366  P P     . DG  A 1 19 ? -26.245 117.326 10.388  1.00 54.78 ? 119 DG  D P     1 
ATOM 367  O OP1   . DG  A 1 19 ? -27.445 116.456 10.478  1.00 33.09 ? 119 DG  D OP1   1 
ATOM 368  O OP2   . DG  A 1 19 ? -26.420 118.773 10.086  1.00 33.09 ? 119 DG  D OP2   1 
ATOM 369  O "O5'" . DG  A 1 19 ? -25.494 117.173 11.784  1.00 54.78 ? 119 DG  D "O5'" 1 
ATOM 370  C "C5'" . DG  A 1 19 ? -25.863 116.142 12.697  1.00 54.78 ? 119 DG  D "C5'" 1 
ATOM 371  C "C4'" . DG  A 1 19 ? -24.752 115.901 13.691  1.00 54.78 ? 119 DG  D "C4'" 1 
ATOM 372  O "O4'" . DG  A 1 19 ? -23.572 115.469 12.977  1.00 54.78 ? 119 DG  D "O4'" 1 
ATOM 373  C "C3'" . DG  A 1 19 ? -24.320 117.113 14.510  1.00 54.78 ? 119 DG  D "C3'" 1 
ATOM 374  O "O3'" . DG  A 1 19 ? -24.003 116.672 15.832  1.00 54.78 ? 119 DG  D "O3'" 1 
ATOM 375  C "C2'" . DG  A 1 19 ? -23.096 117.625 13.767  1.00 54.78 ? 119 DG  D "C2'" 1 
ATOM 376  C "C1'" . DG  A 1 19 ? -22.486 116.356 13.194  1.00 54.78 ? 119 DG  D "C1'" 1 
ATOM 377  N N9    . DG  A 1 19 ? -21.824 116.541 11.906  1.00 33.09 ? 119 DG  D N9    1 
ATOM 378  C C8    . DG  A 1 19 ? -22.389 117.090 10.783  1.00 33.09 ? 119 DG  D C8    1 
ATOM 379  N N7    . DG  A 1 19 ? -21.575 117.125 9.760   1.00 33.09 ? 119 DG  D N7    1 
ATOM 380  C C5    . DG  A 1 19 ? -20.395 116.566 10.232  1.00 33.09 ? 119 DG  D C5    1 
ATOM 381  C C6    . DG  A 1 19 ? -19.156 116.340 9.566   1.00 33.09 ? 119 DG  D C6    1 
ATOM 382  O O6    . DG  A 1 19 ? -18.850 116.617 8.395   1.00 33.09 ? 119 DG  D O6    1 
ATOM 383  N N1    . DG  A 1 19 ? -18.221 115.739 10.407  1.00 33.09 ? 119 DG  D N1    1 
ATOM 384  C C2    . DG  A 1 19 ? -18.440 115.413 11.728  1.00 33.09 ? 119 DG  D C2    1 
ATOM 385  N N2    . DG  A 1 19 ? -17.399 114.843 12.376  1.00 33.09 ? 119 DG  D N2    1 
ATOM 386  N N3    . DG  A 1 19 ? -19.594 115.629 12.367  1.00 33.09 ? 119 DG  D N3    1 
ATOM 387  C C4    . DG  A 1 19 ? -20.522 116.199 11.559  1.00 33.09 ? 119 DG  D C4    1 
ATOM 388  P P     . DG  A 1 20 ? -24.060 117.703 17.065  1.00 74.82 ? 120 DG  D P     1 
ATOM 389  O OP1   . DG  A 1 20 ? -24.697 117.045 18.253  1.00 47.39 ? 120 DG  D OP1   1 
ATOM 390  O OP2   . DG  A 1 20 ? -24.601 118.990 16.553  1.00 47.39 ? 120 DG  D OP2   1 
ATOM 391  O "O5'" . DG  A 1 20 ? -22.523 117.912 17.390  1.00 74.82 ? 120 DG  D "O5'" 1 
ATOM 392  C "C5'" . DG  A 1 20 ? -21.566 117.686 16.375  1.00 74.82 ? 120 DG  D "C5'" 1 
ATOM 393  C "C4'" . DG  A 1 20 ? -20.183 117.650 16.963  1.00 74.82 ? 120 DG  D "C4'" 1 
ATOM 394  O "O4'" . DG  A 1 20 ? -19.264 117.366 15.884  1.00 74.82 ? 120 DG  D "O4'" 1 
ATOM 395  C "C3'" . DG  A 1 20 ? -19.755 118.987 17.560  1.00 74.82 ? 120 DG  D "C3'" 1 
ATOM 396  O "O3'" . DG  A 1 20 ? -18.977 118.794 18.746  1.00 74.82 ? 120 DG  D "O3'" 1 
ATOM 397  C "C2'" . DG  A 1 20 ? -18.968 119.643 16.444  1.00 74.82 ? 120 DG  D "C2'" 1 
ATOM 398  C "C1'" . DG  A 1 20 ? -18.419 118.479 15.633  1.00 74.82 ? 120 DG  D "C1'" 1 
ATOM 399  N N9    . DG  A 1 20 ? -18.469 118.745 14.202  1.00 47.39 ? 120 DG  D N9    1 
ATOM 400  C C8    . DG  A 1 20 ? -19.554 119.206 13.504  1.00 47.39 ? 120 DG  D C8    1 
ATOM 401  N N7    . DG  A 1 20 ? -19.315 119.361 12.232  1.00 47.39 ? 120 DG  D N7    1 
ATOM 402  C C5    . DG  A 1 20 ? -17.992 118.973 12.079  1.00 47.39 ? 120 DG  D C5    1 
ATOM 403  C C6    . DG  A 1 20 ? -17.181 118.922 10.919  1.00 47.39 ? 120 DG  D C6    1 
ATOM 404  O O6    . DG  A 1 20 ? -17.479 119.221 9.770   1.00 47.39 ? 120 DG  D O6    1 
ATOM 405  N N1    . DG  A 1 20 ? -15.899 118.473 11.206  1.00 47.39 ? 120 DG  D N1    1 
ATOM 406  C C2    . DG  A 1 20 ? -15.448 118.122 12.455  1.00 47.39 ? 120 DG  D C2    1 
ATOM 407  N N2    . DG  A 1 20 ? -14.164 117.728 12.532  1.00 47.39 ? 120 DG  D N2    1 
ATOM 408  N N3    . DG  A 1 20 ? -16.200 118.161 13.550  1.00 47.39 ? 120 DG  D N3    1 
ATOM 409  C C4    . DG  A 1 20 ? -17.453 118.593 13.287  1.00 47.39 ? 120 DG  D C4    1 
ATOM 410  P P     . DA  A 1 21 ? -18.208 120.039 19.416  1.00 76.37 ? 121 DA  D P     1 
ATOM 411  O OP1   . DA  A 1 21 ? -17.623 119.558 20.700  1.00 57.23 ? 121 DA  D OP1   1 
ATOM 412  O OP2   . DA  A 1 21 ? -19.106 121.225 19.423  1.00 57.23 ? 121 DA  D OP2   1 
ATOM 413  O "O5'" . DA  A 1 21 ? -17.017 120.301 18.395  1.00 76.37 ? 121 DA  D "O5'" 1 
ATOM 414  C "C5'" . DA  A 1 21 ? -15.977 119.343 18.247  1.00 76.37 ? 121 DA  D "C5'" 1 
ATOM 415  C "C4'" . DA  A 1 21 ? -14.750 120.013 17.684  1.00 76.37 ? 121 DA  D "C4'" 1 
ATOM 416  O "O4'" . DA  A 1 21 ? -14.877 120.149 16.251  1.00 76.37 ? 121 DA  D "O4'" 1 
ATOM 417  C "C3'" . DA  A 1 21 ? -14.532 121.426 18.224  1.00 76.37 ? 121 DA  D "C3'" 1 
ATOM 418  O "O3'" . DA  A 1 21 ? -13.130 121.663 18.412  1.00 76.37 ? 121 DA  D "O3'" 1 
ATOM 419  C "C2'" . DA  A 1 21 ? -15.118 122.305 17.131  1.00 76.37 ? 121 DA  D "C2'" 1 
ATOM 420  C "C1'" . DA  A 1 21 ? -14.772 121.517 15.880  1.00 76.37 ? 121 DA  D "C1'" 1 
ATOM 421  N N9    . DA  A 1 21 ? -15.659 121.735 14.740  1.00 57.23 ? 121 DA  D N9    1 
ATOM 422  C C8    . DA  A 1 21 ? -17.026 121.857 14.740  1.00 57.23 ? 121 DA  D C8    1 
ATOM 423  N N7    . DA  A 1 21 ? -17.544 121.994 13.543  1.00 57.23 ? 121 DA  D N7    1 
ATOM 424  C C5    . DA  A 1 21 ? -16.443 121.973 12.696  1.00 57.23 ? 121 DA  D C5    1 
ATOM 425  C C6    . DA  A 1 21 ? -16.319 122.068 11.290  1.00 57.23 ? 121 DA  D C6    1 
ATOM 426  N N6    . DA  A 1 21 ? -17.356 122.204 10.458  1.00 57.23 ? 121 DA  D N6    1 
ATOM 427  N N1    . DA  A 1 21 ? -15.075 122.014 10.764  1.00 57.23 ? 121 DA  D N1    1 
ATOM 428  C C2    . DA  A 1 21 ? -14.033 121.872 11.599  1.00 57.23 ? 121 DA  D C2    1 
ATOM 429  N N3    . DA  A 1 21 ? -14.021 121.769 12.933  1.00 57.23 ? 121 DA  D N3    1 
ATOM 430  C C4    . DA  A 1 21 ? -15.274 121.827 13.423  1.00 57.23 ? 121 DA  D C4    1 
ATOM 431  P P     . DC  A 1 22 ? -12.606 123.133 18.803  1.00 82.90 ? 122 DC  D P     1 
ATOM 432  O OP1   . DC  A 1 22 ? -11.364 122.950 19.601  1.00 47.60 ? 122 DC  D OP1   1 
ATOM 433  O OP2   . DC  A 1 22 ? -13.746 123.903 19.381  1.00 47.60 ? 122 DC  D OP2   1 
ATOM 434  O "O5'" . DC  A 1 22 ? -12.205 123.755 17.390  1.00 82.90 ? 122 DC  D "O5'" 1 
ATOM 435  C "C5'" . DC  A 1 22 ? -11.302 123.059 16.529  1.00 82.90 ? 122 DC  D "C5'" 1 
ATOM 436  C "C4'" . DC  A 1 22 ? -10.992 123.887 15.304  1.00 82.90 ? 122 DC  D "C4'" 1 
ATOM 437  O "O4'" . DC  A 1 22 ? -12.041 123.781 14.301  1.00 82.90 ? 122 DC  D "O4'" 1 
ATOM 438  C "C3'" . DC  A 1 22 ? -10.818 125.382 15.587  1.00 82.90 ? 122 DC  D "C3'" 1 
ATOM 439  O "O3'" . DC  A 1 22 ? -9.690  125.896 14.881  1.00 82.90 ? 122 DC  D "O3'" 1 
ATOM 440  C "C2'" . DC  A 1 22 ? -12.077 126.000 15.007  1.00 82.90 ? 122 DC  D "C2'" 1 
ATOM 441  C "C1'" . DC  A 1 22 ? -12.340 125.087 13.826  1.00 82.90 ? 122 DC  D "C1'" 1 
ATOM 442  N N1    . DC  A 1 22 ? -13.729 125.121 13.328  1.00 47.60 ? 122 DC  D N1    1 
ATOM 443  C C2    . DC  A 1 22 ? -13.953 125.145 11.939  1.00 47.60 ? 122 DC  D C2    1 
ATOM 444  O O2    . DC  A 1 22 ? -12.979 125.053 11.167  1.00 47.60 ? 122 DC  D O2    1 
ATOM 445  N N3    . DC  A 1 22 ? -15.219 125.263 11.476  1.00 47.60 ? 122 DC  D N3    1 
ATOM 446  C C4    . DC  A 1 22 ? -16.237 125.345 12.335  1.00 47.60 ? 122 DC  D C4    1 
ATOM 447  N N4    . DC  A 1 22 ? -17.462 125.496 11.837  1.00 47.60 ? 122 DC  D N4    1 
ATOM 448  C C5    . DC  A 1 22 ? -16.043 125.284 13.746  1.00 47.60 ? 122 DC  D C5    1 
ATOM 449  C C6    . DC  A 1 22 ? -14.785 125.167 14.195  1.00 47.60 ? 122 DC  D C6    1 
ATOM 450  P P     . DA  A 1 23 ? -9.176  127.388 15.186  1.00 82.90 ? 123 DA  D P     1 
ATOM 451  O OP1   . DA  A 1 23 ? -7.795  127.279 15.754  1.00 48.95 ? 123 DA  D OP1   1 
ATOM 452  O OP2   . DA  A 1 23 ? -10.250 128.097 15.953  1.00 48.95 ? 123 DA  D OP2   1 
ATOM 453  O "O5'" . DA  A 1 23 ? -9.099  128.054 13.743  1.00 82.90 ? 123 DA  D "O5'" 1 
ATOM 454  C "C5'" . DA  A 1 23 ? -10.173 127.892 12.827  1.00 82.90 ? 123 DA  D "C5'" 1 
ATOM 455  C "C4'" . DA  A 1 23 ? -9.663  127.945 11.407  1.00 82.90 ? 123 DA  D "C4'" 1 
ATOM 456  O "O4'" . DA  A 1 23 ? -10.723 127.495 10.536  1.00 82.90 ? 123 DA  D "O4'" 1 
ATOM 457  C "C3'" . DA  A 1 23 ? -9.303  129.344 10.917  1.00 82.90 ? 123 DA  D "C3'" 1 
ATOM 458  O "O3'" . DA  A 1 23 ? -8.457  129.268 9.763   1.00 82.90 ? 123 DA  D "O3'" 1 
ATOM 459  C "C2'" . DA  A 1 23 ? -10.641 129.862 10.426  1.00 82.90 ? 123 DA  D "C2'" 1 
ATOM 460  C "C1'" . DA  A 1 23 ? -11.307 128.605 9.865   1.00 82.90 ? 123 DA  D "C1'" 1 
ATOM 461  N N9    . DA  A 1 23 ? -12.750 128.545 10.100  1.00 48.95 ? 123 DA  D N9    1 
ATOM 462  C C8    . DA  A 1 23 ? -13.402 128.421 11.304  1.00 48.95 ? 123 DA  D C8    1 
ATOM 463  N N7    . DA  A 1 23 ? -14.707 128.399 11.198  1.00 48.95 ? 123 DA  D N7    1 
ATOM 464  C C5    . DA  A 1 23 ? -14.930 128.516 9.835   1.00 48.95 ? 123 DA  D C5    1 
ATOM 465  C C6    . DA  A 1 23 ? -16.105 128.575 9.080   1.00 48.95 ? 123 DA  D C6    1 
ATOM 466  N N6    . DA  A 1 23 ? -17.328 128.512 9.616   1.00 48.95 ? 123 DA  D N6    1 
ATOM 467  N N1    . DA  A 1 23 ? -15.985 128.708 7.739   1.00 48.95 ? 123 DA  D N1    1 
ATOM 468  C C2    . DA  A 1 23 ? -14.755 128.779 7.207   1.00 48.95 ? 123 DA  D C2    1 
ATOM 469  N N3    . DA  A 1 23 ? -13.574 128.736 7.815   1.00 48.95 ? 123 DA  D N3    1 
ATOM 470  C C4    . DA  A 1 23 ? -13.735 128.604 9.146   1.00 48.95 ? 123 DA  D C4    1 
ATOM 471  O "O5'" . DT  B 2 1  ? -23.041 127.400 3.308   1.00 72.47 ? 201 DT  E "O5'" 1 
ATOM 472  C "C5'" . DT  B 2 1  ? -23.067 128.279 2.184   1.00 72.47 ? 201 DT  E "C5'" 1 
ATOM 473  C "C4'" . DT  B 2 1  ? -21.695 128.806 1.838   1.00 72.47 ? 201 DT  E "C4'" 1 
ATOM 474  O "O4'" . DT  B 2 1  ? -21.149 129.467 3.002   1.00 72.47 ? 201 DT  E "O4'" 1 
ATOM 475  C "C3'" . DT  B 2 1  ? -20.691 127.718 1.466   1.00 72.47 ? 201 DT  E "C3'" 1 
ATOM 476  O "O3'" . DT  B 2 1  ? -19.777 128.168 0.467   1.00 72.47 ? 201 DT  E "O3'" 1 
ATOM 477  C "C2'" . DT  B 2 1  ? -19.940 127.481 2.756   1.00 72.47 ? 201 DT  E "C2'" 1 
ATOM 478  C "C1'" . DT  B 2 1  ? -19.925 128.863 3.370   1.00 72.47 ? 201 DT  E "C1'" 1 
ATOM 479  N N1    . DT  B 2 1  ? -19.874 128.811 4.826   1.00 38.51 ? 201 DT  E N1    1 
ATOM 480  C C2    . DT  B 2 1  ? -18.654 128.987 5.432   1.00 38.51 ? 201 DT  E C2    1 
ATOM 481  O O2    . DT  B 2 1  ? -17.635 129.246 4.810   1.00 38.51 ? 201 DT  E O2    1 
ATOM 482  N N3    . DT  B 2 1  ? -18.669 128.857 6.800   1.00 38.51 ? 201 DT  E N3    1 
ATOM 483  C C4    . DT  B 2 1  ? -19.762 128.590 7.600   1.00 38.51 ? 201 DT  E C4    1 
ATOM 484  O O4    . DT  B 2 1  ? -19.617 128.480 8.816   1.00 38.51 ? 201 DT  E O4    1 
ATOM 485  C C5    . DT  B 2 1  ? -21.022 128.454 6.893   1.00 38.51 ? 201 DT  E C5    1 
ATOM 486  C C7    . DT  B 2 1  ? -22.269 128.192 7.675   1.00 38.51 ? 201 DT  E C7    1 
ATOM 487  C C6    . DT  B 2 1  ? -21.012 128.570 5.559   1.00 38.51 ? 201 DT  E C6    1 
ATOM 488  P P     . DG  B 2 2  ? -18.712 127.128 -0.140  1.00 82.90 ? 202 DG  E P     1 
ATOM 489  O OP1   . DG  B 2 2  ? -18.177 127.695 -1.414  1.00 43.34 ? 202 DG  E OP1   1 
ATOM 490  O OP2   . DG  B 2 2  ? -19.390 125.793 -0.143  1.00 43.34 ? 202 DG  E OP2   1 
ATOM 491  O "O5'" . DG  B 2 2  ? -17.549 127.088 0.951   1.00 82.90 ? 202 DG  E "O5'" 1 
ATOM 492  C "C5'" . DG  B 2 2  ? -16.534 128.089 0.973   1.00 82.90 ? 202 DG  E "C5'" 1 
ATOM 493  C "C4'" . DG  B 2 2  ? -15.235 127.501 1.475   1.00 82.90 ? 202 DG  E "C4'" 1 
ATOM 494  O "O4'" . DG  B 2 2  ? -15.246 127.361 2.916   1.00 82.90 ? 202 DG  E "O4'" 1 
ATOM 495  C "C3'" . DG  B 2 2  ? -14.919 126.114 0.926   1.00 82.90 ? 202 DG  E "C3'" 1 
ATOM 496  O "O3'" . DG  B 2 2  ? -13.509 125.996 0.704   1.00 82.90 ? 202 DG  E "O3'" 1 
ATOM 497  C "C2'" . DG  B 2 2  ? -15.374 125.193 2.046   1.00 82.90 ? 202 DG  E "C2'" 1 
ATOM 498  C "C1'" . DG  B 2 2  ? -15.051 126.003 3.287   1.00 82.90 ? 202 DG  E "C1'" 1 
ATOM 499  N N9    . DG  B 2 2  ? -15.946 125.731 4.402   1.00 43.34 ? 202 DG  E N9    1 
ATOM 500  C C8    . DG  B 2 2  ? -17.315 125.643 4.336   1.00 43.34 ? 202 DG  E C8    1 
ATOM 501  N N7    . DG  B 2 2  ? -17.876 125.461 5.501   1.00 43.34 ? 202 DG  E N7    1 
ATOM 502  C C5    . DG  B 2 2  ? -16.814 125.411 6.393   1.00 43.34 ? 202 DG  E C5    1 
ATOM 503  C C6    . DG  B 2 2  ? -16.811 125.256 7.803   1.00 43.34 ? 202 DG  E C6    1 
ATOM 504  O O6    . DG  B 2 2  ? -17.779 125.130 8.564   1.00 43.34 ? 202 DG  E O6    1 
ATOM 505  N N1    . DG  B 2 2  ? -15.518 125.263 8.318   1.00 43.34 ? 202 DG  E N1    1 
ATOM 506  C C2    . DG  B 2 2  ? -14.372 125.403 7.572   1.00 43.34 ? 202 DG  E C2    1 
ATOM 507  N N2    . DG  B 2 2  ? -13.220 125.399 8.259   1.00 43.34 ? 202 DG  E N2    1 
ATOM 508  N N3    . DG  B 2 2  ? -14.360 125.545 6.249   1.00 43.34 ? 202 DG  E N3    1 
ATOM 509  C C4    . DG  B 2 2  ? -15.610 125.550 5.730   1.00 43.34 ? 202 DG  E C4    1 
ATOM 510  P P     . DT  B 2 3  ? -12.902 124.602 0.188   1.00 82.90 ? 203 DT  E P     1 
ATOM 511  O OP1   . DT  B 2 3  ? -11.466 124.556 0.587   1.00 58.55 ? 203 DT  E OP1   1 
ATOM 512  O OP2   . DT  B 2 3  ? -13.280 124.433 -1.244  1.00 58.55 ? 203 DT  E OP2   1 
ATOM 513  O "O5'" . DT  B 2 3  ? -13.699 123.523 1.050   1.00 82.90 ? 203 DT  E "O5'" 1 
ATOM 514  C "C5'" . DT  B 2 3  ? -13.158 122.238 1.302   1.00 82.90 ? 203 DT  E "C5'" 1 
ATOM 515  C "C4'" . DT  B 2 3  ? -12.106 122.324 2.384   1.00 82.90 ? 203 DT  E "C4'" 1 
ATOM 516  O "O4'" . DT  B 2 3  ? -12.680 122.889 3.591   1.00 82.90 ? 203 DT  E "O4'" 1 
ATOM 517  C "C3'" . DT  B 2 3  ? -11.570 120.950 2.775   1.00 82.90 ? 203 DT  E "C3'" 1 
ATOM 518  O "O3'" . DT  B 2 3  ? -10.168 120.966 3.028   1.00 82.90 ? 203 DT  E "O3'" 1 
ATOM 519  C "C2'" . DT  B 2 3  ? -12.320 120.623 4.047   1.00 82.90 ? 203 DT  E "C2'" 1 
ATOM 520  C "C1'" . DT  B 2 3  ? -12.503 121.986 4.675   1.00 82.90 ? 203 DT  E "C1'" 1 
ATOM 521  N N1    . DT  B 2 3  ? -13.707 122.021 5.509   1.00 58.55 ? 203 DT  E N1    1 
ATOM 522  C C2    . DT  B 2 3  ? -13.539 122.032 6.874   1.00 58.55 ? 203 DT  E C2    1 
ATOM 523  O O2    . DT  B 2 3  ? -12.442 122.052 7.405   1.00 58.55 ? 203 DT  E O2    1 
ATOM 524  N N3    . DT  B 2 3  ? -14.711 122.012 7.598   1.00 58.55 ? 203 DT  E N3    1 
ATOM 525  C C4    . DT  B 2 3  ? -16.004 121.988 7.094   1.00 58.55 ? 203 DT  E C4    1 
ATOM 526  O O4    . DT  B 2 3  ? -16.962 121.957 7.864   1.00 58.55 ? 203 DT  E O4    1 
ATOM 527  C C5    . DT  B 2 3  ? -16.102 122.001 5.644   1.00 58.55 ? 203 DT  E C5    1 
ATOM 528  C C7    . DT  B 2 3  ? -17.450 122.003 5.003   1.00 58.55 ? 203 DT  E C7    1 
ATOM 529  C C6    . DT  B 2 3  ? -14.965 122.016 4.937   1.00 58.55 ? 203 DT  E C6    1 
ATOM 530  P P     . DC  B 2 4  ? -9.380  119.575 3.110   1.00 63.55 ? 204 DC  E P     1 
ATOM 531  O OP1   . DC  B 2 4  ? -8.253  119.624 2.137   1.00 49.79 ? 204 DC  E OP1   1 
ATOM 532  O OP2   . DC  B 2 4  ? -10.418 118.516 2.993   1.00 49.79 ? 204 DC  E OP2   1 
ATOM 533  O "O5'" . DC  B 2 4  ? -8.821  119.543 4.598   1.00 63.55 ? 204 DC  E "O5'" 1 
ATOM 534  C "C5'" . DC  B 2 4  ? -9.708  119.724 5.688   1.00 63.55 ? 204 DC  E "C5'" 1 
ATOM 535  C "C4'" . DC  B 2 4  ? -9.293  118.866 6.857   1.00 63.55 ? 204 DC  E "C4'" 1 
ATOM 536  O "O4'" . DC  B 2 4  ? -10.327 119.010 7.857   1.00 63.55 ? 204 DC  E "O4'" 1 
ATOM 537  C "C3'" . DC  B 2 4  ? -9.231  117.376 6.539   1.00 63.55 ? 204 DC  E "C3'" 1 
ATOM 538  O "O3'" . DC  B 2 4  ? -8.255  116.725 7.366   1.00 63.55 ? 204 DC  E "O3'" 1 
ATOM 539  C "C2'" . DC  B 2 4  ? -10.633 116.895 6.856   1.00 63.55 ? 204 DC  E "C2'" 1 
ATOM 540  C "C1'" . DC  B 2 4  ? -11.079 117.810 7.986   1.00 63.55 ? 204 DC  E "C1'" 1 
ATOM 541  N N1    . DC  B 2 4  ? -12.509 118.156 7.901   1.00 49.79 ? 204 DC  E N1    1 
ATOM 542  C C2    . DC  B 2 4  ? -13.252 118.334 9.086   1.00 49.79 ? 204 DC  E C2    1 
ATOM 543  O O2    . DC  B 2 4  ? -12.682 118.225 10.180  1.00 49.79 ? 204 DC  E O2    1 
ATOM 544  N N3    . DC  B 2 4  ? -14.570 118.617 9.001   1.00 49.79 ? 204 DC  E N3    1 
ATOM 545  C C4    . DC  B 2 4  ? -15.153 118.717 7.806   1.00 49.79 ? 204 DC  E C4    1 
ATOM 546  N N4    . DC  B 2 4  ? -16.456 118.962 7.772   1.00 49.79 ? 204 DC  E N4    1 
ATOM 547  C C5    . DC  B 2 4  ? -14.420 118.560 6.587   1.00 49.79 ? 204 DC  E C5    1 
ATOM 548  C C6    . DC  B 2 4  ? -13.115 118.287 6.681   1.00 49.79 ? 204 DC  E C6    1 
ATOM 549  P P     . DC  B 2 5  ? -8.157  115.114 7.381   1.00 77.49 ? 205 DC  E P     1 
ATOM 550  O OP1   . DC  B 2 5  ? -6.773  114.761 7.792   1.00 81.49 ? 205 DC  E OP1   1 
ATOM 551  O OP2   . DC  B 2 5  ? -8.692  114.597 6.093   1.00 81.49 ? 205 DC  E OP2   1 
ATOM 552  O "O5'" . DC  B 2 5  ? -9.153  114.680 8.548   1.00 77.49 ? 205 DC  E "O5'" 1 
ATOM 553  C "C5'" . DC  B 2 5  ? -8.879  115.032 9.901   1.00 77.49 ? 205 DC  E "C5'" 1 
ATOM 554  C "C4'" . DC  B 2 5  ? -9.828  114.311 10.827  1.00 77.49 ? 205 DC  E "C4'" 1 
ATOM 555  O "O4'" . DC  B 2 5  ? -11.169 114.834 10.658  1.00 77.49 ? 205 DC  E "O4'" 1 
ATOM 556  C "C3'" . DC  B 2 5  ? -9.931  112.806 10.570  1.00 77.49 ? 205 DC  E "C3'" 1 
ATOM 557  O "O3'" . DC  B 2 5  ? -10.098 112.103 11.815  1.00 77.49 ? 205 DC  E "O3'" 1 
ATOM 558  C "C2'" . DC  B 2 5  ? -11.185 112.691 9.723   1.00 77.49 ? 205 DC  E "C2'" 1 
ATOM 559  C "C1'" . DC  B 2 5  ? -12.056 113.770 10.337  1.00 77.49 ? 205 DC  E "C1'" 1 
ATOM 560  N N1    . DC  B 2 5  ? -13.118 114.294 9.458   1.00 81.49 ? 205 DC  E N1    1 
ATOM 561  C C2    . DC  B 2 5  ? -14.412 114.461 9.984   1.00 81.49 ? 205 DC  E C2    1 
ATOM 562  O O2    . DC  B 2 5  ? -14.619 114.181 11.178  1.00 81.49 ? 205 DC  E O2    1 
ATOM 563  N N3    . DC  B 2 5  ? -15.401 114.922 9.177   1.00 81.49 ? 205 DC  E N3    1 
ATOM 564  C C4    . DC  B 2 5  ? -15.138 115.214 7.897   1.00 81.49 ? 205 DC  E C4    1 
ATOM 565  N N4    . DC  B 2 5  ? -16.142 115.660 7.136   1.00 81.49 ? 205 DC  E N4    1 
ATOM 566  C C5    . DC  B 2 5  ? -13.830 115.061 7.341   1.00 81.49 ? 205 DC  E C5    1 
ATOM 567  C C6    . DC  B 2 5  ? -12.860 114.604 8.150   1.00 81.49 ? 205 DC  E C6    1 
ATOM 568  P P     . DT  B 2 6  ? -10.536 110.551 11.808  1.00 82.90 ? 206 DT  E P     1 
ATOM 569  O OP1   . DT  B 2 6  ? -10.094 109.908 13.082  1.00 46.30 ? 206 DT  E OP1   1 
ATOM 570  O OP2   . DT  B 2 6  ? -10.099 109.977 10.503  1.00 46.30 ? 206 DT  E OP2   1 
ATOM 571  O "O5'" . DT  B 2 6  ? -12.129 110.614 11.823  1.00 82.90 ? 206 DT  E "O5'" 1 
ATOM 572  C "C5'" . DT  B 2 6  ? -12.833 110.946 13.025  1.00 82.90 ? 206 DT  E "C5'" 1 
ATOM 573  C "C4'" . DT  B 2 6  ? -14.245 110.406 12.971  1.00 82.90 ? 206 DT  E "C4'" 1 
ATOM 574  O "O4'" . DT  B 2 6  ? -14.996 111.094 11.934  1.00 82.90 ? 206 DT  E "O4'" 1 
ATOM 575  C "C3'" . DT  B 2 6  ? -14.300 108.921 12.617  1.00 82.90 ? 206 DT  E "C3'" 1 
ATOM 576  O "O3'" . DT  B 2 6  ? -15.372 108.263 13.288  1.00 82.90 ? 206 DT  E "O3'" 1 
ATOM 577  C "C2'" . DT  B 2 6  ? -14.586 108.930 11.130  1.00 82.90 ? 206 DT  E "C2'" 1 
ATOM 578  C "C1'" . DT  B 2 6  ? -15.482 110.145 10.990  1.00 82.90 ? 206 DT  E "C1'" 1 
ATOM 579  N N1    . DT  B 2 6  ? -15.449 110.754 9.645   1.00 46.30 ? 206 DT  E N1    1 
ATOM 580  C C2    . DT  B 2 6  ? -16.572 111.431 9.213   1.00 46.30 ? 206 DT  E C2    1 
ATOM 581  O O2    . DT  B 2 6  ? -17.577 111.579 9.909   1.00 46.30 ? 206 DT  E O2    1 
ATOM 582  N N3    . DT  B 2 6  ? -16.474 111.939 7.931   1.00 46.30 ? 206 DT  E N3    1 
ATOM 583  C C4    . DT  B 2 6  ? -15.386 111.846 7.075   1.00 46.30 ? 206 DT  E C4    1 
ATOM 584  O O4    . DT  B 2 6  ? -15.439 112.349 5.953   1.00 46.30 ? 206 DT  E O4    1 
ATOM 585  C C5    . DT  B 2 6  ? -14.246 111.136 7.603   1.00 46.30 ? 206 DT  E C5    1 
ATOM 586  C C7    . DT  B 2 6  ? -13.030 110.991 6.746   1.00 46.30 ? 206 DT  E C7    1 
ATOM 587  C C6    . DT  B 2 6  ? -14.330 110.635 8.843   1.00 46.30 ? 206 DT  E C6    1 
ATOM 588  P P     . DA  B 2 7  ? -15.404 106.659 13.326  1.00 62.22 ? 207 DA  E P     1 
ATOM 589  O OP1   . DA  B 2 7  ? -14.742 106.248 14.598  1.00 43.73 ? 207 DA  E OP1   1 
ATOM 590  O OP2   . DA  B 2 7  ? -14.889 106.153 12.016  1.00 43.73 ? 207 DA  E OP2   1 
ATOM 591  O "O5'" . DA  B 2 7  ? -16.950 106.310 13.437  1.00 62.22 ? 207 DA  E "O5'" 1 
ATOM 592  C "C5'" . DA  B 2 7  ? -17.730 106.924 14.440  1.00 62.22 ? 207 DA  E "C5'" 1 
ATOM 593  C "C4'" . DA  B 2 7  ? -18.985 107.509 13.839  1.00 62.22 ? 207 DA  E "C4'" 1 
ATOM 594  O "O4'" . DA  B 2 7  ? -18.649 108.220 12.626  1.00 62.22 ? 207 DA  E "O4'" 1 
ATOM 595  C "C3'" . DA  B 2 7  ? -20.075 106.517 13.448  1.00 62.22 ? 207 DA  E "C3'" 1 
ATOM 596  O "O3'" . DA  B 2 7  ? -21.316 107.094 13.841  1.00 62.22 ? 207 DA  E "O3'" 1 
ATOM 597  C "C2'" . DA  B 2 7  ? -19.980 106.446 11.933  1.00 62.22 ? 207 DA  E "C2'" 1 
ATOM 598  C "C1'" . DA  B 2 7  ? -19.547 107.852 11.594  1.00 62.22 ? 207 DA  E "C1'" 1 
ATOM 599  N N9    . DA  B 2 7  ? -18.839 107.981 10.326  1.00 43.73 ? 207 DA  E N9    1 
ATOM 600  C C8    . DA  B 2 7  ? -17.635 107.427 9.982   1.00 43.73 ? 207 DA  E C8    1 
ATOM 601  N N7    . DA  B 2 7  ? -17.237 107.733 8.770   1.00 43.73 ? 207 DA  E N7    1 
ATOM 602  C C5    . DA  B 2 7  ? -18.253 108.539 8.279   1.00 43.73 ? 207 DA  E C5    1 
ATOM 603  C C6    . DA  B 2 7  ? -18.432 109.189 7.042   1.00 43.73 ? 207 DA  E C6    1 
ATOM 604  N N6    . DA  B 2 7  ? -17.548 109.130 6.044   1.00 43.73 ? 207 DA  E N6    1 
ATOM 605  N N1    . DA  B 2 7  ? -19.560 109.914 6.867   1.00 43.73 ? 207 DA  E N1    1 
ATOM 606  C C2    . DA  B 2 7  ? -20.440 109.982 7.878   1.00 43.73 ? 207 DA  E C2    1 
ATOM 607  N N3    . DA  B 2 7  ? -20.381 109.418 9.091   1.00 43.73 ? 207 DA  E N3    1 
ATOM 608  C C4    . DA  B 2 7  ? -19.249 108.700 9.226   1.00 43.73 ? 207 DA  E C4    1 
ATOM 609  P P     . DA  B 2 8  ? -22.636 106.192 13.886  1.00 53.13 ? 208 DA  E P     1 
ATOM 610  O OP1   . DA  B 2 8  ? -23.351 106.407 15.183  1.00 40.59 ? 208 DA  E OP1   1 
ATOM 611  O OP2   . DA  B 2 8  ? -22.239 104.814 13.485  1.00 40.59 ? 208 DA  E OP2   1 
ATOM 612  O "O5'" . DA  B 2 8  ? -23.511 106.852 12.730  1.00 53.13 ? 208 DA  E "O5'" 1 
ATOM 613  C "C5'" . DA  B 2 8  ? -23.914 108.219 12.831  1.00 53.13 ? 208 DA  E "C5'" 1 
ATOM 614  C "C4'" . DA  B 2 8  ? -24.739 108.616 11.631  1.00 53.13 ? 208 DA  E "C4'" 1 
ATOM 615  O "O4'" . DA  B 2 8  ? -23.900 108.684 10.458  1.00 53.13 ? 208 DA  E "O4'" 1 
ATOM 616  C "C3'" . DA  B 2 8  ? -25.860 107.643 11.293  1.00 53.13 ? 208 DA  E "C3'" 1 
ATOM 617  O "O3'" . DA  B 2 8  ? -27.006 108.385 10.868  1.00 53.13 ? 208 DA  E "O3'" 1 
ATOM 618  C "C2'" . DA  B 2 8  ? -25.261 106.806 10.176  1.00 53.13 ? 208 DA  E "C2'" 1 
ATOM 619  C "C1'" . DA  B 2 8  ? -24.379 107.807 9.460   1.00 53.13 ? 208 DA  E "C1'" 1 
ATOM 620  N N9    . DA  B 2 8  ? -23.210 107.245 8.791   1.00 40.59 ? 208 DA  E N9    1 
ATOM 621  C C8    . DA  B 2 8  ? -22.286 106.374 9.305   1.00 40.59 ? 208 DA  E C8    1 
ATOM 622  N N7    . DA  B 2 8  ? -21.309 106.091 8.475   1.00 40.59 ? 208 DA  E N7    1 
ATOM 623  C C5    . DA  B 2 8  ? -21.619 106.819 7.329   1.00 40.59 ? 208 DA  E C5    1 
ATOM 624  C C6    . DA  B 2 8  ? -20.968 106.964 6.076   1.00 40.59 ? 208 DA  E C6    1 
ATOM 625  N N6    . DA  B 2 8  ? -19.826 106.358 5.753   1.00 40.59 ? 208 DA  E N6    1 
ATOM 626  N N1    . DA  B 2 8  ? -21.544 107.766 5.158   1.00 40.59 ? 208 DA  E N1    1 
ATOM 627  C C2    . DA  B 2 8  ? -22.687 108.370 5.472   1.00 40.59 ? 208 DA  E C2    1 
ATOM 628  N N3    . DA  B 2 8  ? -23.394 108.316 6.605   1.00 40.59 ? 208 DA  E N3    1 
ATOM 629  C C4    . DA  B 2 8  ? -22.796 107.518 7.506   1.00 40.59 ? 208 DA  E C4    1 
ATOM 630  P P     . DT  B 2 9  ? -28.469 107.719 10.955  1.00 49.91 ? 209 DT  E P     1 
ATOM 631  O OP1   . DT  B 2 9  ? -29.459 108.721 11.457  1.00 48.04 ? 209 DT  E OP1   1 
ATOM 632  O OP2   . DT  B 2 9  ? -28.346 106.398 11.631  1.00 48.04 ? 209 DT  E OP2   1 
ATOM 633  O "O5'" . DT  B 2 9  ? -28.791 107.419 9.431   1.00 49.91 ? 209 DT  E "O5'" 1 
ATOM 634  C "C5'" . DT  B 2 9  ? -27.728 107.151 8.537   1.00 49.91 ? 209 DT  E "C5'" 1 
ATOM 635  C "C4'" . DT  B 2 9  ? -27.871 107.987 7.293   1.00 49.91 ? 209 DT  E "C4'" 1 
ATOM 636  O "O4'" . DT  B 2 9  ? -26.624 107.935 6.575   1.00 49.91 ? 209 DT  E "O4'" 1 
ATOM 637  C "C3'" . DT  B 2 9  ? -28.923 107.442 6.339   1.00 49.91 ? 209 DT  E "C3'" 1 
ATOM 638  O "O3'" . DT  B 2 9  ? -29.469 108.504 5.557   1.00 49.91 ? 209 DT  E "O3'" 1 
ATOM 639  C "C2'" . DT  B 2 9  ? -28.125 106.476 5.490   1.00 49.91 ? 209 DT  E "C2'" 1 
ATOM 640  C "C1'" . DT  B 2 9  ? -26.742 107.107 5.435   1.00 49.91 ? 209 DT  E "C1'" 1 
ATOM 641  N N1    . DT  B 2 9  ? -25.659 106.129 5.517   1.00 48.04 ? 209 DT  E N1    1 
ATOM 642  C C2    . DT  B 2 9  ? -24.719 106.105 4.513   1.00 48.04 ? 209 DT  E C2    1 
ATOM 643  O O2    . DT  B 2 9  ? -24.751 106.855 3.554   1.00 48.04 ? 209 DT  E O2    1 
ATOM 644  N N3    . DT  B 2 9  ? -23.732 105.165 4.677   1.00 48.04 ? 209 DT  E N3    1 
ATOM 645  C C4    . DT  B 2 9  ? -23.598 104.271 5.724   1.00 48.04 ? 209 DT  E C4    1 
ATOM 646  O O4    . DT  B 2 9  ? -22.659 103.491 5.738   1.00 48.04 ? 209 DT  E O4    1 
ATOM 647  C C5    . DT  B 2 9  ? -24.620 104.351 6.743   1.00 48.04 ? 209 DT  E C5    1 
ATOM 648  C C7    . DT  B 2 9  ? -24.550 103.428 7.918   1.00 48.04 ? 209 DT  E C7    1 
ATOM 649  C C6    . DT  B 2 9  ? -25.590 105.261 6.587   1.00 48.04 ? 209 DT  E C6    1 
ATOM 650  P P     . DA  B 2 10 ? -30.894 108.316 4.848   1.00 42.32 ? 210 DA  E P     1 
ATOM 651  O OP1   . DA  B 2 10 ? -31.755 109.485 5.198   1.00 34.48 ? 210 DA  E OP1   1 
ATOM 652  O OP2   . DA  B 2 10 ? -31.343 106.932 5.181   1.00 34.48 ? 210 DA  E OP2   1 
ATOM 653  O "O5'" . DA  B 2 10 ? -30.537 108.376 3.297   1.00 42.32 ? 210 DA  E "O5'" 1 
ATOM 654  C "C5'" . DA  B 2 10 ? -29.814 109.480 2.777   1.00 42.32 ? 210 DA  E "C5'" 1 
ATOM 655  C "C4'" . DA  B 2 10 ? -29.137 109.116 1.477   1.00 42.32 ? 210 DA  E "C4'" 1 
ATOM 656  O "O4'" . DA  B 2 10 ? -28.088 108.144 1.697   1.00 42.32 ? 210 DA  E "O4'" 1 
ATOM 657  C "C3'" . DA  B 2 10 ? -30.056 108.522 0.416   1.00 42.32 ? 210 DA  E "C3'" 1 
ATOM 658  O "O3'" . DA  B 2 10 ? -29.677 109.013 -0.867  1.00 42.32 ? 210 DA  E "O3'" 1 
ATOM 659  C "C2'" . DA  B 2 10 ? -29.778 107.034 0.506   1.00 42.32 ? 210 DA  E "C2'" 1 
ATOM 660  C "C1'" . DA  B 2 10 ? -28.306 106.991 0.888   1.00 42.32 ? 210 DA  E "C1'" 1 
ATOM 661  N N9    . DA  B 2 10 ? -27.952 105.820 1.688   1.00 34.48 ? 210 DA  E N9    1 
ATOM 662  C C8    . DA  B 2 10 ? -28.608 105.396 2.808   1.00 34.48 ? 210 DA  E C8    1 
ATOM 663  N N7    . DA  B 2 10 ? -28.075 104.341 3.370   1.00 34.48 ? 210 DA  E N7    1 
ATOM 664  C C5    . DA  B 2 10 ? -26.994 104.046 2.560   1.00 34.48 ? 210 DA  E C5    1 
ATOM 665  C C6    . DA  B 2 10 ? -26.023 103.045 2.632   1.00 34.48 ? 210 DA  E C6    1 
ATOM 666  N N6    . DA  B 2 10 ? -25.968 102.149 3.623   1.00 34.48 ? 210 DA  E N6    1 
ATOM 667  N N1    . DA  B 2 10 ? -25.092 102.998 1.651   1.00 34.48 ? 210 DA  E N1    1 
ATOM 668  C C2    . DA  B 2 10 ? -25.142 103.921 0.683   1.00 34.48 ? 210 DA  E C2    1 
ATOM 669  N N3    . DA  B 2 10 ? -25.999 104.929 0.523   1.00 34.48 ? 210 DA  E N3    1 
ATOM 670  C C4    . DA  B 2 10 ? -26.914 104.935 1.507   1.00 34.48 ? 210 DA  E C4    1 
ATOM 671  P P     . DT  B 2 11 ? -30.559 108.633 -2.143  1.00 21.34 ? 211 DT  E P     1 
ATOM 672  O OP1   . DT  B 2 11 ? -30.392 109.669 -3.206  1.00 21.26 ? 211 DT  E OP1   1 
ATOM 673  O OP2   . DT  B 2 11 ? -31.911 108.356 -1.584  1.00 21.26 ? 211 DT  E OP2   1 
ATOM 674  O "O5'" . DT  B 2 11 ? -29.920 107.264 -2.658  1.00 21.34 ? 211 DT  E "O5'" 1 
ATOM 675  C "C5'" . DT  B 2 11 ? -28.764 107.262 -3.503  1.00 21.34 ? 211 DT  E "C5'" 1 
ATOM 676  C "C4'" . DT  B 2 11 ? -28.442 105.854 -3.965  1.00 21.34 ? 211 DT  E "C4'" 1 
ATOM 677  O "O4'" . DT  B 2 11 ? -27.985 105.033 -2.864  1.00 21.34 ? 211 DT  E "O4'" 1 
ATOM 678  C "C3'" . DT  B 2 11 ? -29.623 105.097 -4.579  1.00 21.34 ? 211 DT  E "C3'" 1 
ATOM 679  O "O3'" . DT  B 2 11 ? -29.165 104.303 -5.670  1.00 21.34 ? 211 DT  E "O3'" 1 
ATOM 680  C "C2'" . DT  B 2 11 ? -30.049 104.161 -3.465  1.00 21.34 ? 211 DT  E "C2'" 1 
ATOM 681  C "C1'" . DT  B 2 11 ? -28.697 103.809 -2.905  1.00 21.34 ? 211 DT  E "C1'" 1 
ATOM 682  N N1    . DT  B 2 11 ? -28.706 103.224 -1.570  1.00 21.26 ? 211 DT  E N1    1 
ATOM 683  C C2    . DT  B 2 11 ? -27.725 102.305 -1.293  1.00 21.26 ? 211 DT  E C2    1 
ATOM 684  O O2    . DT  B 2 11 ? -26.819 102.048 -2.071  1.00 21.26 ? 211 DT  E O2    1 
ATOM 685  N N3    . DT  B 2 11 ? -27.828 101.705 -0.064  1.00 21.26 ? 211 DT  E N3    1 
ATOM 686  C C4    . DT  B 2 11 ? -28.783 101.947 0.901   1.00 21.26 ? 211 DT  E C4    1 
ATOM 687  O O4    . DT  B 2 11 ? -28.774 101.294 1.947   1.00 21.26 ? 211 DT  E O4    1 
ATOM 688  C C5    . DT  B 2 11 ? -29.751 102.981 0.561   1.00 21.26 ? 211 DT  E C5    1 
ATOM 689  C C7    . DT  B 2 11 ? -30.795 103.360 1.563   1.00 21.26 ? 211 DT  E C7    1 
ATOM 690  C C6    . DT  B 2 11 ? -29.665 103.553 -0.646  1.00 21.26 ? 211 DT  E C6    1 
ATOM 691  P P     . DG  B 2 12 ? -29.118 104.934 -7.144  1.00 14.68 ? 212 DG  E P     1 
ATOM 692  O OP1   . DG  B 2 12 ? -29.235 106.406 -6.999  1.00 29.35 ? 212 DG  E OP1   1 
ATOM 693  O OP2   . DG  B 2 12 ? -30.080 104.213 -8.021  1.00 29.35 ? 212 DG  E OP2   1 
ATOM 694  O "O5'" . DG  B 2 12 ? -27.639 104.570 -7.616  1.00 14.68 ? 212 DG  E "O5'" 1 
ATOM 695  C "C5'" . DG  B 2 12 ? -27.425 103.951 -8.875  1.00 14.68 ? 212 DG  E "C5'" 1 
ATOM 696  C "C4'" . DG  B 2 12 ? -26.550 102.723 -8.747  1.00 14.68 ? 212 DG  E "C4'" 1 
ATOM 697  O "O4'" . DG  B 2 12 ? -26.449 102.246 -7.386  1.00 14.68 ? 212 DG  E "O4'" 1 
ATOM 698  C "C3'" . DG  B 2 12 ? -27.146 101.576 -9.554  1.00 14.68 ? 212 DG  E "C3'" 1 
ATOM 699  O "O3'" . DG  B 2 12 ? -26.186 100.893 -10.319 1.00 14.68 ? 212 DG  E "O3'" 1 
ATOM 700  C "C2'" . DG  B 2 12 ? -27.742 100.651 -8.520  1.00 14.68 ? 212 DG  E "C2'" 1 
ATOM 701  C "C1'" . DG  B 2 12 ? -26.876 100.891 -7.311  1.00 14.68 ? 212 DG  E "C1'" 1 
ATOM 702  N N9    . DG  B 2 12 ? -27.619 100.729 -6.069  1.00 29.35 ? 212 DG  E N9    1 
ATOM 703  C C8    . DG  B 2 12 ? -28.616 101.545 -5.602  1.00 29.35 ? 212 DG  E C8    1 
ATOM 704  N N7    . DG  B 2 12 ? -29.074 101.176 -4.439  1.00 29.35 ? 212 DG  E N7    1 
ATOM 705  C C5    . DG  B 2 12 ? -28.337 100.042 -4.123  1.00 29.35 ? 212 DG  E C5    1 
ATOM 706  C C6    . DG  B 2 12 ? -28.373 99.226  -2.975  1.00 29.35 ? 212 DG  E C6    1 
ATOM 707  O O6    . DG  B 2 12 ? -29.090 99.337  -1.977  1.00 29.35 ? 212 DG  E O6    1 
ATOM 708  N N1    . DG  B 2 12 ? -27.457 98.190  -3.058  1.00 29.35 ? 212 DG  E N1    1 
ATOM 709  C C2    . DG  B 2 12 ? -26.617 97.966  -4.116  1.00 29.35 ? 212 DG  E C2    1 
ATOM 710  N N2    . DG  B 2 12 ? -25.809 96.905  -4.010  1.00 29.35 ? 212 DG  E N2    1 
ATOM 711  N N3    . DG  B 2 12 ? -26.572 98.723  -5.196  1.00 29.35 ? 212 DG  E N3    1 
ATOM 712  C C4    . DG  B 2 12 ? -27.449 99.741  -5.128  1.00 29.35 ? 212 DG  E C4    1 
ATOM 713  P P     . DG  B 2 13 ? -26.654 100.195 -11.674 1.00 18.68 ? 213 DG  E P     1 
ATOM 714  O OP1   . DG  B 2 13 ? -25.555 100.267 -12.685 1.00 25.05 ? 213 DG  E OP1   1 
ATOM 715  O OP2   . DG  B 2 13 ? -27.988 100.764 -11.990 1.00 25.05 ? 213 DG  E OP2   1 
ATOM 716  O "O5'" . DG  B 2 13 ? -26.822 98.687  -11.217 1.00 18.68 ? 213 DG  E "O5'" 1 
ATOM 717  C "C5'" . DG  B 2 13 ? -25.726 98.009  -10.623 1.00 18.68 ? 213 DG  E "C5'" 1 
ATOM 718  C "C4'" . DG  B 2 13 ? -26.182 96.706  -10.020 1.00 18.68 ? 213 DG  E "C4'" 1 
ATOM 719  O "O4'" . DG  B 2 13 ? -26.820 96.895  -8.737  1.00 18.68 ? 213 DG  E "O4'" 1 
ATOM 720  C "C3'" . DG  B 2 13 ? -27.174 95.917  -10.869 1.00 18.68 ? 213 DG  E "C3'" 1 
ATOM 721  O "O3'" . DG  B 2 13 ? -26.838 94.547  -10.690 1.00 18.68 ? 213 DG  E "O3'" 1 
ATOM 722  C "C2'" . DG  B 2 13 ? -28.498 96.191  -10.181 1.00 18.68 ? 213 DG  E "C2'" 1 
ATOM 723  C "C1'" . DG  B 2 13 ? -28.041 96.183  -8.741  1.00 18.68 ? 213 DG  E "C1'" 1 
ATOM 724  N N9    . DG  B 2 13 ? -28.929 96.788  -7.758  1.00 25.05 ? 213 DG  E N9    1 
ATOM 725  C C8    . DG  B 2 13 ? -29.754 97.871  -7.920  1.00 25.05 ? 213 DG  E C8    1 
ATOM 726  N N7    . DG  B 2 13 ? -30.412 98.180  -6.835  1.00 25.05 ? 213 DG  E N7    1 
ATOM 727  C C5    . DG  B 2 13 ? -29.995 97.239  -5.902  1.00 25.05 ? 213 DG  E C5    1 
ATOM 728  C C6    . DG  B 2 13 ? -30.352 97.069  -4.530  1.00 25.05 ? 213 DG  E C6    1 
ATOM 729  O O6    . DG  B 2 13 ? -31.134 97.742  -3.849  1.00 25.05 ? 213 DG  E O6    1 
ATOM 730  N N1    . DG  B 2 13 ? -29.686 95.987  -3.958  1.00 25.05 ? 213 DG  E N1    1 
ATOM 731  C C2    . DG  B 2 13 ? -28.796 95.176  -4.617  1.00 25.05 ? 213 DG  E C2    1 
ATOM 732  N N2    . DG  B 2 13 ? -28.247 94.196  -3.900  1.00 25.05 ? 213 DG  E N2    1 
ATOM 733  N N3    . DG  B 2 13 ? -28.462 95.320  -5.889  1.00 25.05 ? 213 DG  E N3    1 
ATOM 734  C C4    . DG  B 2 13 ? -29.088 96.367  -6.462  1.00 25.05 ? 213 DG  E C4    1 
ATOM 735  P P     . DA  B 2 14 ? -27.251 93.458  -11.788 1.00 25.72 ? 214 DA  E P     1 
ATOM 736  O OP1   . DA  B 2 14 ? -25.983 92.742  -12.134 1.00 13.75 ? 214 DA  E OP1   1 
ATOM 737  O OP2   . DA  B 2 14 ? -28.067 94.075  -12.876 1.00 13.75 ? 214 DA  E OP2   1 
ATOM 738  O "O5'" . DA  B 2 14 ? -28.206 92.520  -10.925 1.00 25.72 ? 214 DA  E "O5'" 1 
ATOM 739  C "C5'" . DA  B 2 14 ? -27.734 91.906  -9.734  1.00 25.72 ? 214 DA  E "C5'" 1 
ATOM 740  C "C4'" . DA  B 2 14 ? -28.880 91.240  -9.014  1.00 25.72 ? 214 DA  E "C4'" 1 
ATOM 741  O "O4'" . DA  B 2 14 ? -29.510 92.158  -8.091  1.00 25.72 ? 214 DA  E "O4'" 1 
ATOM 742  C "C3'" . DA  B 2 14 ? -29.992 90.722  -9.929  1.00 25.72 ? 214 DA  E "C3'" 1 
ATOM 743  O "O3'" . DA  B 2 14 ? -30.442 89.447  -9.478  1.00 25.72 ? 214 DA  E "O3'" 1 
ATOM 744  C "C2'" . DA  B 2 14 ? -31.096 91.743  -9.744  1.00 25.72 ? 214 DA  E "C2'" 1 
ATOM 745  C "C1'" . DA  B 2 14 ? -30.909 92.102  -8.288  1.00 25.72 ? 214 DA  E "C1'" 1 
ATOM 746  N N9    . DA  B 2 14 ? -31.502 93.372  -7.864  1.00 13.75 ? 214 DA  E N9    1 
ATOM 747  C C8    . DA  B 2 14 ? -31.806 94.488  -8.610  1.00 13.75 ? 214 DA  E C8    1 
ATOM 748  N N7    . DA  B 2 14 ? -32.427 95.418  -7.928  1.00 13.75 ? 214 DA  E N7    1 
ATOM 749  C C5    . DA  B 2 14 ? -32.519 94.887  -6.644  1.00 13.75 ? 214 DA  E C5    1 
ATOM 750  C C6    . DA  B 2 14 ? -33.099 95.362  -5.456  1.00 13.75 ? 214 DA  E C6    1 
ATOM 751  N N6    . DA  B 2 14 ? -33.709 96.547  -5.343  1.00 13.75 ? 214 DA  E N6    1 
ATOM 752  N N1    . DA  B 2 14 ? -33.031 94.571  -4.366  1.00 13.75 ? 214 DA  E N1    1 
ATOM 753  C C2    . DA  B 2 14 ? -32.407 93.402  -4.462  1.00 13.75 ? 214 DA  E C2    1 
ATOM 754  N N3    . DA  B 2 14 ? -31.821 92.852  -5.508  1.00 13.75 ? 214 DA  E N3    1 
ATOM 755  C C4    . DA  B 2 14 ? -31.925 93.647  -6.585  1.00 13.75 ? 214 DA  E C4    1 
ATOM 756  P P     . DC  B 2 15 ? -31.341 88.529  -10.445 1.00 13.04 ? 215 DC  E P     1 
ATOM 757  O OP1   . DC  B 2 15 ? -31.440 87.202  -9.782  1.00 22.38 ? 215 DC  E OP1   1 
ATOM 758  O OP2   . DC  B 2 15 ? -30.820 88.621  -11.838 1.00 22.38 ? 215 DC  E OP2   1 
ATOM 759  O "O5'" . DC  B 2 15 ? -32.774 89.218  -10.384 1.00 13.04 ? 215 DC  E "O5'" 1 
ATOM 760  C "C5'" . DC  B 2 15 ? -33.850 88.586  -9.700  1.00 13.04 ? 215 DC  E "C5'" 1 
ATOM 761  C "C4'" . DC  B 2 15 ? -33.744 88.834  -8.214  1.00 13.04 ? 215 DC  E "C4'" 1 
ATOM 762  O "O4'" . DC  B 2 15 ? -33.712 90.262  -7.982  1.00 13.04 ? 215 DC  E "O4'" 1 
ATOM 763  C "C3'" . DC  B 2 15 ? -34.935 88.313  -7.410  1.00 13.04 ? 215 DC  E "C3'" 1 
ATOM 764  O "O3'" . DC  B 2 15 ? -34.518 87.698  -6.191  1.00 13.04 ? 215 DC  E "O3'" 1 
ATOM 765  C "C2'" . DC  B 2 15 ? -35.733 89.565  -7.093  1.00 13.04 ? 215 DC  E "C2'" 1 
ATOM 766  C "C1'" . DC  B 2 15 ? -34.625 90.576  -6.946  1.00 13.04 ? 215 DC  E "C1'" 1 
ATOM 767  N N1    . DC  B 2 15 ? -35.019 91.985  -7.081  1.00 22.38 ? 215 DC  E N1    1 
ATOM 768  C C2    . DC  B 2 15 ? -35.402 92.689  -5.930  1.00 22.38 ? 215 DC  E C2    1 
ATOM 769  O O2    . DC  B 2 15 ? -35.399 92.099  -4.831  1.00 22.38 ? 215 DC  E O2    1 
ATOM 770  N N3    . DC  B 2 15 ? -35.767 93.986  -6.041  1.00 22.38 ? 215 DC  E N3    1 
ATOM 771  C C4    . DC  B 2 15 ? -35.771 94.575  -7.238  1.00 22.38 ? 215 DC  E C4    1 
ATOM 772  N N4    . DC  B 2 15 ? -36.155 95.852  -7.307  1.00 22.38 ? 215 DC  E N4    1 
ATOM 773  C C5    . DC  B 2 15 ? -35.385 93.883  -8.419  1.00 22.38 ? 215 DC  E C5    1 
ATOM 774  C C6    . DC  B 2 15 ? -35.017 92.603  -8.297  1.00 22.38 ? 215 DC  E C6    1 
ATOM 775  P P     . DA  B 2 16 ? -35.594 86.879  -5.327  1.00 18.37 ? 216 DA  E P     1 
ATOM 776  O OP1   . DA  B 2 16 ? -34.887 85.896  -4.470  1.00 18.62 ? 216 DA  E OP1   1 
ATOM 777  O OP2   . DA  B 2 16 ? -36.640 86.420  -6.279  1.00 18.62 ? 216 DA  E OP2   1 
ATOM 778  O "O5'" . DA  B 2 16 ? -36.277 87.964  -4.385  1.00 18.37 ? 216 DA  E "O5'" 1 
ATOM 779  C "C5'" . DA  B 2 16 ? -35.868 88.083  -3.035  1.00 18.37 ? 216 DA  E "C5'" 1 
ATOM 780  C "C4'" . DA  B 2 16 ? -36.920 88.785  -2.213  1.00 18.37 ? 216 DA  E "C4'" 1 
ATOM 781  O "O4'" . DA  B 2 16 ? -37.235 90.040  -2.838  1.00 18.37 ? 216 DA  E "O4'" 1 
ATOM 782  C "C3'" . DA  B 2 16 ? -38.259 88.084  -1.995  1.00 18.37 ? 216 DA  E "C3'" 1 
ATOM 783  O "O3'" . DA  B 2 16 ? -38.685 88.446  -0.685  1.00 18.37 ? 216 DA  E "O3'" 1 
ATOM 784  C "C2'" . DA  B 2 16 ? -39.169 88.742  -3.013  1.00 18.37 ? 216 DA  E "C2'" 1 
ATOM 785  C "C1'" . DA  B 2 16 ? -38.643 90.158  -2.992  1.00 18.37 ? 216 DA  E "C1'" 1 
ATOM 786  N N9    . DA  B 2 16 ? -38.874 90.975  -4.179  1.00 18.62 ? 216 DA  E N9    1 
ATOM 787  C C8    . DA  B 2 16 ? -38.615 90.676  -5.488  1.00 18.62 ? 216 DA  E C8    1 
ATOM 788  N N7    . DA  B 2 16 ? -38.836 91.670  -6.310  1.00 18.62 ? 216 DA  E N7    1 
ATOM 789  C C5    . DA  B 2 16 ? -39.289 92.691  -5.487  1.00 18.62 ? 216 DA  E C5    1 
ATOM 790  C C6    . DA  B 2 16 ? -39.695 94.032  -5.747  1.00 18.62 ? 216 DA  E C6    1 
ATOM 791  N N6    . DA  B 2 16 ? -39.661 94.598  -6.956  1.00 18.62 ? 216 DA  E N6    1 
ATOM 792  N N1    . DA  B 2 16 ? -40.132 94.773  -4.698  1.00 18.62 ? 216 DA  E N1    1 
ATOM 793  C C2    . DA  B 2 16 ? -40.137 94.209  -3.473  1.00 18.62 ? 216 DA  E C2    1 
ATOM 794  N N3    . DA  B 2 16 ? -39.760 92.973  -3.105  1.00 18.62 ? 216 DA  E N3    1 
ATOM 795  C C4    . DA  B 2 16 ? -39.346 92.262  -4.173  1.00 18.62 ? 216 DA  E C4    1 
ATOM 796  P P     . DT  B 2 17 ? -39.915 87.688  0.006   1.00 17.25 ? 217 DT  E P     1 
ATOM 797  O OP1   . DT  B 2 17 ? -39.542 87.468  1.436   1.00 26.03 ? 217 DT  E OP1   1 
ATOM 798  O OP2   . DT  B 2 17 ? -40.345 86.539  -0.833  1.00 26.03 ? 217 DT  E OP2   1 
ATOM 799  O "O5'" . DT  B 2 17 ? -41.082 88.762  -0.056  1.00 17.25 ? 217 DT  E "O5'" 1 
ATOM 800  C "C5'" . DT  B 2 17 ? -40.929 89.996  0.623   1.00 17.25 ? 217 DT  E "C5'" 1 
ATOM 801  C "C4'" . DT  B 2 17 ? -42.045 90.948  0.269   1.00 17.25 ? 217 DT  E "C4'" 1 
ATOM 802  O "O4'" . DT  B 2 17 ? -41.857 91.559  -1.030  1.00 17.25 ? 217 DT  E "O4'" 1 
ATOM 803  C "C3'" . DT  B 2 17 ? -43.450 90.362  0.274   1.00 17.25 ? 217 DT  E "C3'" 1 
ATOM 804  O "O3'" . DT  B 2 17 ? -44.245 91.172  1.139   1.00 17.25 ? 217 DT  E "O3'" 1 
ATOM 805  C "C2'" . DT  B 2 17 ? -43.887 90.481  -1.182  1.00 17.25 ? 217 DT  E "C2'" 1 
ATOM 806  C "C1'" . DT  B 2 17 ? -43.116 91.702  -1.634  1.00 17.25 ? 217 DT  E "C1'" 1 
ATOM 807  N N1    . DT  B 2 17 ? -42.910 91.915  -3.084  1.00 26.03 ? 217 DT  E N1    1 
ATOM 808  C C2    . DT  B 2 17 ? -43.258 93.144  -3.596  1.00 26.03 ? 217 DT  E C2    1 
ATOM 809  O O2    . DT  B 2 17 ? -43.734 94.037  -2.916  1.00 26.03 ? 217 DT  E O2    1 
ATOM 810  N N3    . DT  B 2 17 ? -43.038 93.289  -4.945  1.00 26.03 ? 217 DT  E N3    1 
ATOM 811  C C4    . DT  B 2 17 ? -42.538 92.339  -5.818  1.00 26.03 ? 217 DT  E C4    1 
ATOM 812  O O4    . DT  B 2 17 ? -42.424 92.591  -7.016  1.00 26.03 ? 217 DT  E O4    1 
ATOM 813  C C5    . DT  B 2 17 ? -42.196 91.085  -5.222  1.00 26.03 ? 217 DT  E C5    1 
ATOM 814  C C7    . DT  B 2 17 ? -41.647 90.010  -6.106  1.00 26.03 ? 217 DT  E C7    1 
ATOM 815  C C6    . DT  B 2 17 ? -42.389 90.933  -3.898  1.00 26.03 ? 217 DT  E C6    1 
ATOM 816  P P     . DC  B 2 18 ? -45.503 90.531  1.908   1.00 33.69 ? 218 DC  E P     1 
ATOM 817  O OP1   . DC  B 2 18 ? -45.531 91.033  3.313   1.00 22.12 ? 218 DC  E OP1   1 
ATOM 818  O OP2   . DC  B 2 18 ? -45.501 89.057  1.643   1.00 22.12 ? 218 DC  E OP2   1 
ATOM 819  O "O5'" . DC  B 2 18 ? -46.701 91.201  1.123   1.00 33.69 ? 218 DC  E "O5'" 1 
ATOM 820  C "C5'" . DC  B 2 18 ? -46.413 91.920  -0.057  1.00 33.69 ? 218 DC  E "C5'" 1 
ATOM 821  C "C4'" . DC  B 2 18 ? -47.456 92.975  -0.286  1.00 33.69 ? 218 DC  E "C4'" 1 
ATOM 822  O "O4'" . DC  B 2 18 ? -47.091 93.668  -1.496  1.00 33.69 ? 218 DC  E "O4'" 1 
ATOM 823  C "C3'" . DC  B 2 18 ? -48.831 92.371  -0.533  1.00 33.69 ? 218 DC  E "C3'" 1 
ATOM 824  O "O3'" . DC  B 2 18 ? -49.862 93.180  0.034   1.00 33.69 ? 218 DC  E "O3'" 1 
ATOM 825  C "C2'" . DC  B 2 18 ? -48.913 92.264  -2.044  1.00 33.69 ? 218 DC  E "C2'" 1 
ATOM 826  C "C1'" . DC  B 2 18 ? -47.974 93.348  -2.552  1.00 33.69 ? 218 DC  E "C1'" 1 
ATOM 827  N N1    . DC  B 2 18 ? -47.151 92.902  -3.683  1.00 22.12 ? 218 DC  E N1    1 
ATOM 828  C C2    . DC  B 2 18 ? -46.877 93.803  -4.708  1.00 22.12 ? 218 DC  E C2    1 
ATOM 829  O O2    . DC  B 2 18 ? -47.272 94.975  -4.601  1.00 22.12 ? 218 DC  E O2    1 
ATOM 830  N N3    . DC  B 2 18 ? -46.180 93.389  -5.780  1.00 22.12 ? 218 DC  E N3    1 
ATOM 831  C C4    . DC  B 2 18 ? -45.738 92.137  -5.839  1.00 22.12 ? 218 DC  E C4    1 
ATOM 832  N N4    . DC  B 2 18 ? -45.055 91.774  -6.931  1.00 22.12 ? 218 DC  E N4    1 
ATOM 833  C C5    . DC  B 2 18 ? -45.972 91.204  -4.788  1.00 22.12 ? 218 DC  E C5    1 
ATOM 834  C C6    . DC  B 2 18 ? -46.676 91.625  -3.741  1.00 22.12 ? 218 DC  E C6    1 
ATOM 835  P P     . DC  B 2 19 ? -51.371 92.982  -0.455  1.00 61.64 ? 219 DC  E P     1 
ATOM 836  O OP1   . DC  B 2 19 ? -52.240 93.845  0.377   1.00 41.87 ? 219 DC  E OP1   1 
ATOM 837  O OP2   . DC  B 2 19 ? -51.644 91.526  -0.536  1.00 41.87 ? 219 DC  E OP2   1 
ATOM 838  O "O5'" . DC  B 2 19 ? -51.322 93.616  -1.911  1.00 61.64 ? 219 DC  E "O5'" 1 
ATOM 839  C "C5'" . DC  B 2 19 ? -50.870 94.963  -2.086  1.00 61.64 ? 219 DC  E "C5'" 1 
ATOM 840  C "C4'" . DC  B 2 19 ? -51.331 95.496  -3.421  1.00 61.64 ? 219 DC  E "C4'" 1 
ATOM 841  O "O4'" . DC  B 2 19 ? -50.404 95.108  -4.466  1.00 61.64 ? 219 DC  E "O4'" 1 
ATOM 842  C "C3'" . DC  B 2 19 ? -52.692 94.935  -3.825  1.00 61.64 ? 219 DC  E "C3'" 1 
ATOM 843  O "O3'" . DC  B 2 19 ? -53.529 95.938  -4.379  1.00 61.64 ? 219 DC  E "O3'" 1 
ATOM 844  C "C2'" . DC  B 2 19 ? -52.354 93.912  -4.890  1.00 61.64 ? 219 DC  E "C2'" 1 
ATOM 845  C "C1'" . DC  B 2 19 ? -51.122 94.515  -5.528  1.00 61.64 ? 219 DC  E "C1'" 1 
ATOM 846  N N1    . DC  B 2 19 ? -50.260 93.521  -6.186  1.00 41.87 ? 219 DC  E N1    1 
ATOM 847  C C2    . DC  B 2 19 ? -49.740 93.822  -7.442  1.00 41.87 ? 219 DC  E C2    1 
ATOM 848  O O2    . DC  B 2 19 ? -49.914 94.961  -7.900  1.00 41.87 ? 219 DC  E O2    1 
ATOM 849  N N3    . DC  B 2 19 ? -49.058 92.875  -8.123  1.00 41.87 ? 219 DC  E N3    1 
ATOM 850  C C4    . DC  B 2 19 ? -48.870 91.674  -7.581  1.00 41.87 ? 219 DC  E C4    1 
ATOM 851  N N4    . DC  B 2 19 ? -48.242 90.756  -8.311  1.00 41.87 ? 219 DC  E N4    1 
ATOM 852  C C5    . DC  B 2 19 ? -49.330 91.359  -6.271  1.00 41.87 ? 219 DC  E C5    1 
ATOM 853  C C6    . DC  B 2 19 ? -50.011 92.306  -5.611  1.00 41.87 ? 219 DC  E C6    1 
ATOM 854  P P     . DT  B 2 20 ? -55.099 95.642  -4.552  1.00 55.27 ? 220 DT  E P     1 
ATOM 855  O OP1   . DT  B 2 20 ? -55.865 96.438  -3.550  1.00 38.14 ? 220 DT  E OP1   1 
ATOM 856  O OP2   . DT  B 2 20 ? -55.308 94.168  -4.631  1.00 38.14 ? 220 DT  E OP2   1 
ATOM 857  O "O5'" . DT  B 2 20 ? -55.390 96.235  -5.991  1.00 55.27 ? 220 DT  E "O5'" 1 
ATOM 858  C "C5'" . DT  B 2 20 ? -54.708 97.393  -6.433  1.00 55.27 ? 220 DT  E "C5'" 1 
ATOM 859  C "C4'" . DT  B 2 20 ? -54.704 97.420  -7.938  1.00 55.27 ? 220 DT  E "C4'" 1 
ATOM 860  O "O4'" . DT  B 2 20 ? -53.753 96.448  -8.431  1.00 55.27 ? 220 DT  E "O4'" 1 
ATOM 861  C "C3'" . DT  B 2 20 ? -56.060 97.026  -8.517  1.00 55.27 ? 220 DT  E "C3'" 1 
ATOM 862  O "O3'" . DT  B 2 20 ? -56.410 97.910  -9.585  1.00 55.27 ? 220 DT  E "O3'" 1 
ATOM 863  C "C2'" . DT  B 2 20 ? -55.856 95.587  -8.968  1.00 55.27 ? 220 DT  E "C2'" 1 
ATOM 864  C "C1'" . DT  B 2 20 ? -54.385 95.569  -9.341  1.00 55.27 ? 220 DT  E "C1'" 1 
ATOM 865  N N1    . DT  B 2 20 ? -53.711 94.259  -9.240  1.00 38.14 ? 220 DT  E N1    1 
ATOM 866  C C2    . DT  B 2 20 ? -52.915 93.845  -10.292 1.00 38.14 ? 220 DT  E C2    1 
ATOM 867  O O2    . DT  B 2 20 ? -52.752 94.501  -11.310 1.00 38.14 ? 220 DT  E O2    1 
ATOM 868  N N3    . DT  B 2 20 ? -52.308 92.632  -10.107 1.00 38.14 ? 220 DT  E N3    1 
ATOM 869  C C4    . DT  B 2 20 ? -52.410 91.815  -9.008  1.00 38.14 ? 220 DT  E C4    1 
ATOM 870  O O4    . DT  B 2 20 ? -51.783 90.775  -8.968  1.00 38.14 ? 220 DT  E O4    1 
ATOM 871  C C5    . DT  B 2 20 ? -53.270 92.292  -7.959  1.00 38.14 ? 220 DT  E C5    1 
ATOM 872  C C7    . DT  B 2 20 ? -53.463 91.442  -6.743  1.00 38.14 ? 220 DT  E C7    1 
ATOM 873  C C6    . DT  B 2 20 ? -53.868 93.479  -8.122  1.00 38.14 ? 220 DT  E C6    1 
ATOM 874  P P     . DG  B 2 21 ? -57.853 97.786  -10.277 1.00 56.58 ? 221 DG  E P     1 
ATOM 875  O OP1   . DG  B 2 21 ? -58.260 99.133  -10.775 1.00 23.17 ? 221 DG  E OP1   1 
ATOM 876  O OP2   . DG  B 2 21 ? -58.758 97.032  -9.344  1.00 23.17 ? 221 DG  E OP2   1 
ATOM 877  O "O5'" . DG  B 2 21 ? -57.525 96.878  -11.542 1.00 56.58 ? 221 DG  E "O5'" 1 
ATOM 878  C "C5'" . DG  B 2 21 ? -56.468 97.242  -12.421 1.00 56.58 ? 221 DG  E "C5'" 1 
ATOM 879  C "C4'" . DG  B 2 21 ? -56.286 96.196  -13.494 1.00 56.58 ? 221 DG  E "C4'" 1 
ATOM 880  O "O4'" . DG  B 2 21 ? -55.464 95.090  -13.034 1.00 56.58 ? 221 DG  E "O4'" 1 
ATOM 881  C "C3'" . DG  B 2 21 ? -57.582 95.585  -14.028 1.00 56.58 ? 221 DG  E "C3'" 1 
ATOM 882  O "O3'" . DG  B 2 21 ? -57.594 95.640  -15.456 1.00 56.58 ? 221 DG  E "O3'" 1 
ATOM 883  C "C2'" . DG  B 2 21 ? -57.525 94.148  -13.535 1.00 56.58 ? 221 DG  E "C2'" 1 
ATOM 884  C "C1'" . DG  B 2 21 ? -56.029 93.886  -13.515 1.00 56.58 ? 221 DG  E "C1'" 1 
ATOM 885  N N9    . DG  B 2 21 ? -55.570 92.763  -12.685 1.00 23.17 ? 221 DG  E N9    1 
ATOM 886  C C8    . DG  B 2 21 ? -55.829 92.533  -11.351 1.00 23.17 ? 221 DG  E C8    1 
ATOM 887  N N7    . DG  B 2 21 ? -55.318 91.409  -10.911 1.00 23.17 ? 221 DG  E N7    1 
ATOM 888  C C5    . DG  B 2 21 ? -54.676 90.867  -12.015 1.00 23.17 ? 221 DG  E C5    1 
ATOM 889  C C6    . DG  B 2 21 ? -53.955 89.655  -12.155 1.00 23.17 ? 221 DG  E C6    1 
ATOM 890  O O6    . DG  B 2 21 ? -53.734 88.780  -11.300 1.00 23.17 ? 221 DG  E O6    1 
ATOM 891  N N1    . DG  B 2 21 ? -53.468 89.498  -13.447 1.00 23.17 ? 221 DG  E N1    1 
ATOM 892  C C2    . DG  B 2 21 ? -53.646 90.387  -14.467 1.00 23.17 ? 221 DG  E C2    1 
ATOM 893  N N2    . DG  B 2 21 ? -53.087 90.058  -15.634 1.00 23.17 ? 221 DG  E N2    1 
ATOM 894  N N3    . DG  B 2 21 ? -54.317 91.515  -14.356 1.00 23.17 ? 221 DG  E N3    1 
ATOM 895  C C4    . DG  B 2 21 ? -54.805 91.692  -13.113 1.00 23.17 ? 221 DG  E C4    1 
ATOM 896  P P     . DT  B 2 22 ? -58.774 94.922  -16.272 1.00 40.40 ? 222 DT  E P     1 
ATOM 897  O OP1   . DT  B 2 22 ? -59.001 95.647  -17.551 1.00 21.59 ? 222 DT  E OP1   1 
ATOM 898  O OP2   . DT  B 2 22 ? -59.899 94.731  -15.340 1.00 21.59 ? 222 DT  E OP2   1 
ATOM 899  O "O5'" . DT  B 2 22 ? -58.134 93.513  -16.635 1.00 40.40 ? 222 DT  E "O5'" 1 
ATOM 900  C "C5'" . DT  B 2 22 ? -57.032 93.458  -17.537 1.00 40.40 ? 222 DT  E "C5'" 1 
ATOM 901  C "C4'" . DT  B 2 22 ? -56.978 92.114  -18.222 1.00 40.40 ? 222 DT  E "C4'" 1 
ATOM 902  O "O4'" . DT  B 2 22 ? -56.322 91.137  -17.377 1.00 40.40 ? 222 DT  E "O4'" 1 
ATOM 903  C "C3'" . DT  B 2 22 ? -58.352 91.543  -18.563 1.00 40.40 ? 222 DT  E "C3'" 1 
ATOM 904  O "O3'" . DT  B 2 22 ? -58.354 90.942  -19.859 1.00 40.40 ? 222 DT  E "O3'" 1 
ATOM 905  C "C2'" . DT  B 2 22 ? -58.562 90.485  -17.499 1.00 40.40 ? 222 DT  E "C2'" 1 
ATOM 906  C "C1'" . DT  B 2 22 ? -57.143 90.001  -17.243 1.00 40.40 ? 222 DT  E "C1'" 1 
ATOM 907  N N1    . DT  B 2 22 ? -56.967 89.484  -15.891 1.00 21.59 ? 222 DT  E N1    1 
ATOM 908  C C2    . DT  B 2 22 ? -56.220 88.354  -15.713 1.00 21.59 ? 222 DT  E C2    1 
ATOM 909  O O2    . DT  B 2 22 ? -55.616 87.808  -16.620 1.00 21.59 ? 222 DT  E O2    1 
ATOM 910  N N3    . DT  B 2 22 ? -56.201 87.886  -14.428 1.00 21.59 ? 222 DT  E N3    1 
ATOM 911  C C4    . DT  B 2 22 ? -56.834 88.444  -13.329 1.00 21.59 ? 222 DT  E C4    1 
ATOM 912  O O4    . DT  B 2 22 ? -56.768 87.900  -12.230 1.00 21.59 ? 222 DT  E O4    1 
ATOM 913  C C5    . DT  B 2 22 ? -57.551 89.653  -13.585 1.00 21.59 ? 222 DT  E C5    1 
ATOM 914  C C7    . DT  B 2 22 ? -58.238 90.339  -12.447 1.00 21.59 ? 222 DT  E C7    1 
ATOM 915  C C6    . DT  B 2 22 ? -57.577 90.113  -14.836 1.00 21.59 ? 222 DT  E C6    1 
ATOM 916  P P     . DG  B 2 23 ? -59.752 90.659  -20.586 1.00 49.06 ? 223 DG  E P     1 
ATOM 917  O OP1   . DG  B 2 23 ? -59.952 91.633  -21.688 1.00 28.48 ? 223 DG  E OP1   1 
ATOM 918  O OP2   . DG  B 2 23 ? -60.744 90.585  -19.482 1.00 28.48 ? 223 DG  E OP2   1 
ATOM 919  O "O5'" . DG  B 2 23 ? -59.558 89.218  -21.231 1.00 49.06 ? 223 DG  E "O5'" 1 
ATOM 920  C "C5'" . DG  B 2 23 ? -58.424 88.930  -22.041 1.00 49.06 ? 223 DG  E "C5'" 1 
ATOM 921  C "C4'" . DG  B 2 23 ? -58.094 87.458  -21.965 1.00 49.06 ? 223 DG  E "C4'" 1 
ATOM 922  O "O4'" . DG  B 2 23 ? -57.755 87.119  -20.596 1.00 49.06 ? 223 DG  E "O4'" 1 
ATOM 923  C "C3'" . DG  B 2 23 ? -59.244 86.527  -22.353 1.00 49.06 ? 223 DG  E "C3'" 1 
ATOM 924  O "O3'" . DG  B 2 23 ? -58.780 85.274  -22.857 1.00 49.06 ? 223 DG  E "O3'" 1 
ATOM 925  C "C2'" . DG  B 2 23 ? -59.849 86.168  -21.012 1.00 49.06 ? 223 DG  E "C2'" 1 
ATOM 926  C "C1'" . DG  B 2 23 ? -58.615 86.096  -20.132 1.00 49.06 ? 223 DG  E "C1'" 1 
ATOM 927  N N9    . DG  B 2 23 ? -58.908 86.356  -18.730 1.00 28.48 ? 223 DG  E N9    1 
ATOM 928  C C8    . DG  B 2 23 ? -59.738 87.329  -18.240 1.00 28.48 ? 223 DG  E C8    1 
ATOM 929  N N7    . DG  B 2 23 ? -59.862 87.291  -16.945 1.00 28.48 ? 223 DG  E N7    1 
ATOM 930  C C5    . DG  B 2 23 ? -59.052 86.239  -16.556 1.00 28.48 ? 223 DG  E C5    1 
ATOM 931  C C6    . DG  B 2 23 ? -58.793 85.731  -15.280 1.00 28.48 ? 223 DG  E C6    1 
ATOM 932  O O6    . DG  B 2 23 ? -59.261 86.109  -14.200 1.00 28.48 ? 223 DG  E O6    1 
ATOM 933  N N1    . DG  B 2 23 ? -57.898 84.668  -15.322 1.00 28.48 ? 223 DG  E N1    1 
ATOM 934  C C2    . DG  B 2 23 ? -57.337 84.157  -16.457 1.00 28.48 ? 223 DG  E C2    1 
ATOM 935  N N2    . DG  B 2 23 ? -56.503 83.127  -16.285 1.00 28.48 ? 223 DG  E N2    1 
ATOM 936  N N3    . DG  B 2 23 ? -57.580 84.623  -17.671 1.00 28.48 ? 223 DG  E N3    1 
ATOM 937  C C4    . DG  B 2 23 ? -58.443 85.660  -17.644 1.00 28.48 ? 223 DG  E C4    1 
ATOM 938  N N     . SER C 3 3  ? -21.007 83.479  -2.826  1.00 59.33 ? 303 SER A N     1 
ATOM 939  C CA    . SER C 3 3  ? -22.409 82.992  -2.899  1.00 59.33 ? 303 SER A CA    1 
ATOM 940  C C     . SER C 3 3  ? -23.248 83.940  -3.758  1.00 59.33 ? 303 SER A C     1 
ATOM 941  O O     . SER C 3 3  ? -24.474 83.969  -3.644  1.00 59.33 ? 303 SER A O     1 
ATOM 942  C CB    . SER C 3 3  ? -23.018 82.901  -1.488  1.00 65.69 ? 303 SER A CB    1 
ATOM 943  O OG    . SER C 3 3  ? -22.324 81.983  -0.653  1.00 65.69 ? 303 SER A OG    1 
ATOM 944  N N     . ALA C 3 4  ? -22.587 84.712  -4.616  1.00 63.42 ? 304 ALA A N     1 
ATOM 945  C CA    . ALA C 3 4  ? -23.281 85.668  -5.484  1.00 63.42 ? 304 ALA A CA    1 
ATOM 946  C C     . ALA C 3 4  ? -23.929 84.970  -6.678  1.00 63.42 ? 304 ALA A C     1 
ATOM 947  O O     . ALA C 3 4  ? -23.254 84.662  -7.668  1.00 63.42 ? 304 ALA A O     1 
ATOM 948  C CB    . ALA C 3 4  ? -22.302 86.742  -5.968  1.00 62.96 ? 304 ALA A CB    1 
ATOM 949  N N     . ILE C 3 5  ? -25.244 84.755  -6.585  1.00 31.56 ? 305 ILE A N     1 
ATOM 950  C CA    . ILE C 3 5  ? -25.995 84.059  -7.631  1.00 31.56 ? 305 ILE A CA    1 
ATOM 951  C C     . ILE C 3 5  ? -27.292 84.712  -8.060  1.00 31.56 ? 305 ILE A C     1 
ATOM 952  O O     . ILE C 3 5  ? -28.014 85.284  -7.243  1.00 31.56 ? 305 ILE A O     1 
ATOM 953  C CB    . ILE C 3 5  ? -26.393 82.664  -7.181  1.00 22.76 ? 305 ILE A CB    1 
ATOM 954  C CG1   . ILE C 3 5  ? -27.028 81.898  -8.347  1.00 22.76 ? 305 ILE A CG1   1 
ATOM 955  C CG2   . ILE C 3 5  ? -27.387 82.787  -6.025  1.00 22.76 ? 305 ILE A CG2   1 
ATOM 956  C CD1   . ILE C 3 5  ? -27.211 80.402  -8.086  1.00 22.76 ? 305 ILE A CD1   1 
ATOM 957  N N     . THR C 3 6  ? -27.605 84.580  -9.342  1.00 21.79 ? 306 THR A N     1 
ATOM 958  C CA    . THR C 3 6  ? -28.839 85.133  -9.860  1.00 21.79 ? 306 THR A CA    1 
ATOM 959  C C     . THR C 3 6  ? -29.738 84.025  -10.384 1.00 21.79 ? 306 THR A C     1 
ATOM 960  O O     . THR C 3 6  ? -29.268 82.966  -10.808 1.00 21.79 ? 306 THR A O     1 
ATOM 961  C CB    . THR C 3 6  ? -28.590 86.123  -10.989 1.00 11.88 ? 306 THR A CB    1 
ATOM 962  O OG1   . THR C 3 6  ? -27.774 85.515  -11.994 1.00 11.88 ? 306 THR A OG1   1 
ATOM 963  C CG2   . THR C 3 6  ? -27.899 87.343  -10.459 1.00 11.88 ? 306 THR A CG2   1 
ATOM 964  N N     . LEU C 3 7  ? -31.038 84.294  -10.344 1.00 23.64 ? 307 LEU A N     1 
ATOM 965  C CA    . LEU C 3 7  ? -32.061 83.372  -10.789 1.00 23.64 ? 307 LEU A CA    1 
ATOM 966  C C     . LEU C 3 7  ? -31.645 82.622  -12.042 1.00 23.64 ? 307 LEU A C     1 
ATOM 967  O O     . LEU C 3 7  ? -31.380 81.414  -11.984 1.00 23.64 ? 307 LEU A O     1 
ATOM 968  C CB    . LEU C 3 7  ? -33.363 84.149  -11.023 1.00 7.09  ? 307 LEU A CB    1 
ATOM 969  C CG    . LEU C 3 7  ? -34.621 83.403  -11.487 1.00 7.09  ? 307 LEU A CG    1 
ATOM 970  C CD1   . LEU C 3 7  ? -34.593 81.973  -11.004 1.00 7.09  ? 307 LEU A CD1   1 
ATOM 971  C CD2   . LEU C 3 7  ? -35.857 84.107  -10.943 1.00 7.09  ? 307 LEU A CD2   1 
ATOM 972  N N     . TRP C 3 8  ? -31.565 83.337  -13.162 1.00 19.51 ? 308 TRP A N     1 
ATOM 973  C CA    . TRP C 3 8  ? -31.195 82.711  -14.419 1.00 19.51 ? 308 TRP A CA    1 
ATOM 974  C C     . TRP C 3 8  ? -29.974 81.782  -14.279 1.00 19.51 ? 308 TRP A C     1 
ATOM 975  O O     . TRP C 3 8  ? -29.867 80.782  -14.985 1.00 19.51 ? 308 TRP A O     1 
ATOM 976  C CB    . TRP C 3 8  ? -30.945 83.770  -15.488 1.00 44.79 ? 308 TRP A CB    1 
ATOM 977  C CG    . TRP C 3 8  ? -29.652 84.446  -15.343 1.00 44.79 ? 308 TRP A CG    1 
ATOM 978  C CD1   . TRP C 3 8  ? -29.328 85.424  -14.452 1.00 44.79 ? 308 TRP A CD1   1 
ATOM 979  C CD2   . TRP C 3 8  ? -28.464 84.143  -16.064 1.00 44.79 ? 308 TRP A CD2   1 
ATOM 980  N NE1   . TRP C 3 8  ? -28.001 85.749  -14.569 1.00 44.79 ? 308 TRP A NE1   1 
ATOM 981  C CE2   . TRP C 3 8  ? -27.444 84.974  -15.553 1.00 44.79 ? 308 TRP A CE2   1 
ATOM 982  C CE3   . TRP C 3 8  ? -28.156 83.243  -17.095 1.00 44.79 ? 308 TRP A CE3   1 
ATOM 983  C CZ2   . TRP C 3 8  ? -26.133 84.932  -16.039 1.00 44.79 ? 308 TRP A CZ2   1 
ATOM 984  C CZ3   . TRP C 3 8  ? -26.853 83.201  -17.579 1.00 44.79 ? 308 TRP A CZ3   1 
ATOM 985  C CH2   . TRP C 3 8  ? -25.856 84.043  -17.048 1.00 44.79 ? 308 TRP A CH2   1 
ATOM 986  N N     . GLN C 3 9  ? -29.050 82.095  -13.376 1.00 23.04 ? 309 GLN A N     1 
ATOM 987  C CA    . GLN C 3 9  ? -27.909 81.209  -13.186 1.00 23.04 ? 309 GLN A CA    1 
ATOM 988  C C     . GLN C 3 9  ? -28.477 79.952  -12.550 1.00 23.04 ? 309 GLN A C     1 
ATOM 989  O O     . GLN C 3 9  ? -28.434 78.872  -13.135 1.00 23.04 ? 309 GLN A O     1 
ATOM 990  C CB    . GLN C 3 9  ? -26.867 81.827  -12.257 1.00 79.46 ? 309 GLN A CB    1 
ATOM 991  C CG    . GLN C 3 9  ? -26.129 83.022  -12.839 1.00 79.46 ? 309 GLN A CG    1 
ATOM 992  C CD    . GLN C 3 9  ? -24.891 83.379  -12.034 1.00 79.46 ? 309 GLN A CD    1 
ATOM 993  O OE1   . GLN C 3 9  ? -23.957 82.580  -11.933 1.00 79.46 ? 309 GLN A OE1   1 
ATOM 994  N NE2   . GLN C 3 9  ? -24.880 84.577  -11.451 1.00 79.46 ? 309 GLN A NE2   1 
ATOM 995  N N     . PHE C 3 10 ? -29.031 80.122  -11.356 1.00 18.55 ? 310 PHE A N     1 
ATOM 996  C CA    . PHE C 3 10 ? -29.654 79.048  -10.577 1.00 18.55 ? 310 PHE A CA    1 
ATOM 997  C C     . PHE C 3 10 ? -30.574 78.160  -11.405 1.00 18.55 ? 310 PHE A C     1 
ATOM 998  O O     . PHE C 3 10 ? -30.465 76.936  -11.357 1.00 18.55 ? 310 PHE A O     1 
ATOM 999  C CB    . PHE C 3 10 ? -30.462 79.661  -9.441  1.00 5.80  ? 310 PHE A CB    1 
ATOM 1000 C CG    . PHE C 3 10 ? -31.269 78.679  -8.665  1.00 5.80  ? 310 PHE A CG    1 
ATOM 1001 C CD1   . PHE C 3 10 ? -30.682 77.901  -7.687  1.00 5.80  ? 310 PHE A CD1   1 
ATOM 1002 C CD2   . PHE C 3 10 ? -32.639 78.575  -8.880  1.00 5.80  ? 310 PHE A CD2   1 
ATOM 1003 C CE1   . PHE C 3 10 ? -31.446 77.023  -6.918  1.00 5.80  ? 310 PHE A CE1   1 
ATOM 1004 C CE2   . PHE C 3 10 ? -33.423 77.700  -8.118  1.00 5.80  ? 310 PHE A CE2   1 
ATOM 1005 C CZ    . PHE C 3 10 ? -32.827 76.922  -7.130  1.00 5.80  ? 310 PHE A CZ    1 
ATOM 1006 N N     . LEU C 3 11 ? -31.497 78.767  -12.144 1.00 18.49 ? 311 LEU A N     1 
ATOM 1007 C CA    . LEU C 3 11 ? -32.401 77.980  -12.975 1.00 18.49 ? 311 LEU A CA    1 
ATOM 1008 C C     . LEU C 3 11 ? -31.607 77.082  -13.911 1.00 18.49 ? 311 LEU A C     1 
ATOM 1009 O O     . LEU C 3 11 ? -31.869 75.892  -14.010 1.00 18.49 ? 311 LEU A O     1 
ATOM 1010 C CB    . LEU C 3 11 ? -33.313 78.887  -13.801 1.00 7.76  ? 311 LEU A CB    1 
ATOM 1011 C CG    . LEU C 3 11 ? -34.465 79.556  -13.050 1.00 7.76  ? 311 LEU A CG    1 
ATOM 1012 C CD1   . LEU C 3 11 ? -35.470 80.145  -14.029 1.00 7.76  ? 311 LEU A CD1   1 
ATOM 1013 C CD2   . LEU C 3 11 ? -35.141 78.519  -12.179 1.00 7.76  ? 311 LEU A CD2   1 
ATOM 1014 N N     . LEU C 3 12 ? -30.634 77.658  -14.597 1.00 30.65 ? 312 LEU A N     1 
ATOM 1015 C CA    . LEU C 3 12 ? -29.807 76.889  -15.506 1.00 30.65 ? 312 LEU A CA    1 
ATOM 1016 C C     . LEU C 3 12 ? -29.124 75.738  -14.750 1.00 30.65 ? 312 LEU A C     1 
ATOM 1017 O O     . LEU C 3 12 ? -29.072 74.597  -15.232 1.00 30.65 ? 312 LEU A O     1 
ATOM 1018 C CB    . LEU C 3 12 ? -28.748 77.793  -16.113 1.00 41.74 ? 312 LEU A CB    1 
ATOM 1019 C CG    . LEU C 3 12 ? -28.181 77.295  -17.431 1.00 41.74 ? 312 LEU A CG    1 
ATOM 1020 C CD1   . LEU C 3 12 ? -29.277 77.371  -18.477 1.00 41.74 ? 312 LEU A CD1   1 
ATOM 1021 C CD2   . LEU C 3 12 ? -26.993 78.145  -17.839 1.00 41.74 ? 312 LEU A CD2   1 
ATOM 1022 N N     . GLN C 3 13 ? -28.594 76.042  -13.567 1.00 30.21 ? 313 GLN A N     1 
ATOM 1023 C CA    . GLN C 3 13 ? -27.921 75.038  -12.738 1.00 30.21 ? 313 GLN A CA    1 
ATOM 1024 C C     . GLN C 3 13 ? -28.822 73.848  -12.467 1.00 30.21 ? 313 GLN A C     1 
ATOM 1025 O O     . GLN C 3 13 ? -28.352 72.764  -12.151 1.00 30.21 ? 313 GLN A O     1 
ATOM 1026 C CB    . GLN C 3 13 ? -27.511 75.635  -11.398 1.00 51.19 ? 313 GLN A CB    1 
ATOM 1027 C CG    . GLN C 3 13 ? -26.282 76.499  -11.444 1.00 51.19 ? 313 GLN A CG    1 
ATOM 1028 C CD    . GLN C 3 13 ? -26.170 77.365  -10.211 1.00 51.19 ? 313 GLN A CD    1 
ATOM 1029 O OE1   . GLN C 3 13 ? -26.534 76.945  -9.107  1.00 51.19 ? 313 GLN A OE1   1 
ATOM 1030 N NE2   . GLN C 3 13 ? -25.660 78.579  -10.385 1.00 51.19 ? 313 GLN A NE2   1 
ATOM 1031 N N     . LEU C 3 14 ? -30.123 74.062  -12.570 1.00 30.44 ? 314 LEU A N     1 
ATOM 1032 C CA    . LEU C 3 14 ? -31.066 72.995  -12.321 1.00 30.44 ? 314 LEU A CA    1 
ATOM 1033 C C     . LEU C 3 14 ? -31.296 72.228  -13.604 1.00 30.44 ? 314 LEU A C     1 
ATOM 1034 O O     . LEU C 3 14 ? -31.604 71.036  -13.578 1.00 30.44 ? 314 LEU A O     1 
ATOM 1035 C CB    . LEU C 3 14 ? -32.395 73.561  -11.817 1.00 13.01 ? 314 LEU A CB    1 
ATOM 1036 C CG    . LEU C 3 14 ? -32.455 74.360  -10.505 1.00 13.01 ? 314 LEU A CG    1 
ATOM 1037 C CD1   . LEU C 3 14 ? -33.888 74.779  -10.246 1.00 13.01 ? 314 LEU A CD1   1 
ATOM 1038 C CD2   . LEU C 3 14 ? -31.954 73.532  -9.346  1.00 13.01 ? 314 LEU A CD2   1 
ATOM 1039 N N     . LEU C 3 15 ? -31.140 72.918  -14.726 1.00 33.93 ? 315 LEU A N     1 
ATOM 1040 C CA    . LEU C 3 15 ? -31.347 72.303  -16.031 1.00 33.93 ? 315 LEU A CA    1 
ATOM 1041 C C     . LEU C 3 15 ? -30.144 71.513  -16.534 1.00 33.93 ? 315 LEU A C     1 
ATOM 1042 O O     . LEU C 3 15 ? -30.149 70.992  -17.651 1.00 33.93 ? 315 LEU A O     1 
ATOM 1043 C CB    . LEU C 3 15 ? -31.729 73.372  -17.055 1.00 26.15 ? 315 LEU A CB    1 
ATOM 1044 C CG    . LEU C 3 15 ? -33.152 73.892  -16.914 1.00 26.15 ? 315 LEU A CG    1 
ATOM 1045 C CD1   . LEU C 3 15 ? -33.363 75.100  -17.805 1.00 26.15 ? 315 LEU A CD1   1 
ATOM 1046 C CD2   . LEU C 3 15 ? -34.104 72.784  -17.283 1.00 26.15 ? 315 LEU A CD2   1 
ATOM 1047 N N     . GLN C 3 16 ? -29.107 71.433  -15.719 1.00 56.45 ? 316 GLN A N     1 
ATOM 1048 C CA    . GLN C 3 16 ? -27.936 70.683  -16.121 1.00 56.45 ? 316 GLN A CA    1 
ATOM 1049 C C     . GLN C 3 16 ? -27.795 69.452  -15.243 1.00 56.45 ? 316 GLN A C     1 
ATOM 1050 O O     . GLN C 3 16 ? -26.931 68.610  -15.481 1.00 56.45 ? 316 GLN A O     1 
ATOM 1051 C CB    . GLN C 3 16 ? -26.690 71.556  -16.032 1.00 82.90 ? 316 GLN A CB    1 
ATOM 1052 C CG    . GLN C 3 16 ? -26.606 72.584  -17.137 1.00 82.90 ? 316 GLN A CG    1 
ATOM 1053 C CD    . GLN C 3 16 ? -25.624 73.691  -16.828 1.00 82.90 ? 316 GLN A CD    1 
ATOM 1054 O OE1   . GLN C 3 16 ? -25.316 74.516  -17.689 1.00 82.90 ? 316 GLN A OE1   1 
ATOM 1055 N NE2   . GLN C 3 16 ? -25.132 73.723  -15.590 1.00 82.90 ? 316 GLN A NE2   1 
ATOM 1056 N N     . LYS C 3 17 ? -28.654 69.347  -14.231 1.00 61.67 ? 317 LYS A N     1 
ATOM 1057 C CA    . LYS C 3 17 ? -28.634 68.205  -13.320 1.00 61.67 ? 317 LYS A CA    1 
ATOM 1058 C C     . LYS C 3 17 ? -29.818 67.299  -13.653 1.00 61.67 ? 317 LYS A C     1 
ATOM 1059 O O     . LYS C 3 17 ? -30.976 67.684  -13.476 1.00 61.67 ? 317 LYS A O     1 
ATOM 1060 C CB    . LYS C 3 17 ? -28.740 68.667  -11.864 1.00 73.46 ? 317 LYS A CB    1 
ATOM 1061 C CG    . LYS C 3 17 ? -27.757 69.766  -11.443 1.00 73.46 ? 317 LYS A CG    1 
ATOM 1062 C CD    . LYS C 3 17 ? -26.294 69.348  -11.557 1.00 73.46 ? 317 LYS A CD    1 
ATOM 1063 C CE    . LYS C 3 17 ? -25.610 70.003  -12.762 1.00 73.46 ? 317 LYS A CE    1 
ATOM 1064 N NZ    . LYS C 3 17 ? -25.595 71.502  -12.699 1.00 73.46 ? 317 LYS A NZ    1 
ATOM 1065 N N     . PRO C 3 18 ? -29.542 66.079  -14.144 1.00 38.79 ? 318 PRO A N     1 
ATOM 1066 C CA    . PRO C 3 18 ? -30.589 65.117  -14.505 1.00 38.79 ? 318 PRO A CA    1 
ATOM 1067 C C     . PRO C 3 18 ? -31.569 64.877  -13.355 1.00 38.79 ? 318 PRO A C     1 
ATOM 1068 O O     . PRO C 3 18 ? -32.778 64.864  -13.564 1.00 38.79 ? 318 PRO A O     1 
ATOM 1069 C CB    . PRO C 3 18 ? -29.793 63.860  -14.857 1.00 64.71 ? 318 PRO A CB    1 
ATOM 1070 C CG    . PRO C 3 18 ? -28.479 64.405  -15.331 1.00 64.71 ? 318 PRO A CG    1 
ATOM 1071 C CD    . PRO C 3 18 ? -28.207 65.481  -14.316 1.00 64.71 ? 318 PRO A CD    1 
ATOM 1072 N N     . GLN C 3 19 ? -31.036 64.697  -12.147 1.00 71.49 ? 319 GLN A N     1 
ATOM 1073 C CA    . GLN C 3 19 ? -31.849 64.459  -10.950 1.00 71.49 ? 319 GLN A CA    1 
ATOM 1074 C C     . GLN C 3 19 ? -33.056 65.398  -10.868 1.00 71.49 ? 319 GLN A C     1 
ATOM 1075 O O     . GLN C 3 19 ? -34.035 65.121  -10.171 1.00 71.49 ? 319 GLN A O     1 
ATOM 1076 C CB    . GLN C 3 19 ? -30.985 64.608  -9.688  1.00 73.71 ? 319 GLN A CB    1 
ATOM 1077 C CG    . GLN C 3 19 ? -30.280 65.955  -9.559  1.00 73.71 ? 319 GLN A CG    1 
ATOM 1078 C CD    . GLN C 3 19 ? -28.769 65.864  -9.730  1.00 73.71 ? 319 GLN A CD    1 
ATOM 1079 O OE1   . GLN C 3 19 ? -28.270 65.372  -10.749 1.00 73.71 ? 319 GLN A OE1   1 
ATOM 1080 N NE2   . GLN C 3 19 ? -28.030 66.348  -8.729  1.00 73.71 ? 319 GLN A NE2   1 
ATOM 1081 N N     . ASN C 3 20 ? -32.972 66.512  -11.588 1.00 43.90 ? 320 ASN A N     1 
ATOM 1082 C CA    . ASN C 3 20 ? -34.040 67.500  -11.628 1.00 43.90 ? 320 ASN A CA    1 
ATOM 1083 C C     . ASN C 3 20 ? -34.593 67.532  -13.041 1.00 43.90 ? 320 ASN A C     1 
ATOM 1084 O O     . ASN C 3 20 ? -34.281 68.437  -13.810 1.00 43.90 ? 320 ASN A O     1 
ATOM 1085 C CB    . ASN C 3 20 ? -33.493 68.879  -11.274 1.00 47.75 ? 320 ASN A CB    1 
ATOM 1086 C CG    . ASN C 3 20 ? -32.669 68.863  -10.012 1.00 47.75 ? 320 ASN A CG    1 
ATOM 1087 O OD1   . ASN C 3 20 ? -33.077 68.281  -9.001  1.00 47.75 ? 320 ASN A OD1   1 
ATOM 1088 N ND2   . ASN C 3 20 ? -31.501 69.507  -10.055 1.00 47.75 ? 320 ASN A ND2   1 
ATOM 1089 N N     . LYS C 3 21 ? -35.413 66.542  -13.377 1.00 20.65 ? 321 LYS A N     1 
ATOM 1090 C CA    . LYS C 3 21 ? -35.992 66.444  -14.716 1.00 20.65 ? 321 LYS A CA    1 
ATOM 1091 C C     . LYS C 3 21 ? -37.514 66.483  -14.643 1.00 20.65 ? 321 LYS A C     1 
ATOM 1092 O O     . LYS C 3 21 ? -38.185 66.867  -15.598 1.00 20.65 ? 321 LYS A O     1 
ATOM 1093 C CB    . LYS C 3 21 ? -35.553 65.133  -15.376 1.00 76.34 ? 321 LYS A CB    1 
ATOM 1094 C CG    . LYS C 3 21 ? -35.803 65.065  -16.874 1.00 76.34 ? 321 LYS A CG    1 
ATOM 1095 C CD    . LYS C 3 21 ? -34.692 65.760  -17.658 1.00 76.34 ? 321 LYS A CD    1 
ATOM 1096 C CE    . LYS C 3 21 ? -33.354 65.028  -17.507 1.00 76.34 ? 321 LYS A CE    1 
ATOM 1097 N NZ    . LYS C 3 21 ? -32.221 65.731  -18.183 1.00 76.34 ? 321 LYS A NZ    1 
ATOM 1098 N N     . HIS C 3 22 ? -38.048 66.070  -13.500 1.00 45.00 ? 322 HIS A N     1 
ATOM 1099 C CA    . HIS C 3 22 ? -39.487 66.034  -13.289 1.00 45.00 ? 322 HIS A CA    1 
ATOM 1100 C C     . HIS C 3 22 ? -39.908 67.154  -12.361 1.00 45.00 ? 322 HIS A C     1 
ATOM 1101 O O     . HIS C 3 22 ? -40.908 67.061  -11.640 1.00 45.00 ? 322 HIS A O     1 
ATOM 1102 C CB    . HIS C 3 22 ? -39.892 64.674  -12.718 1.00 82.90 ? 322 HIS A CB    1 
ATOM 1103 C CG    . HIS C 3 22 ? -39.858 63.570  -13.730 1.00 82.90 ? 322 HIS A CG    1 
ATOM 1104 N ND1   . HIS C 3 22 ? -40.750 63.494  -14.779 1.00 82.90 ? 322 HIS A ND1   1 
ATOM 1105 C CD2   . HIS C 3 22 ? -39.020 62.515  -13.869 1.00 82.90 ? 322 HIS A CD2   1 
ATOM 1106 C CE1   . HIS C 3 22 ? -40.465 62.440  -15.521 1.00 82.90 ? 322 HIS A CE1   1 
ATOM 1107 N NE2   . HIS C 3 22 ? -39.420 61.828  -14.992 1.00 82.90 ? 322 HIS A NE2   1 
ATOM 1108 N N     . MET C 3 23 ? -39.116 68.216  -12.398 1.00 53.26 ? 323 MET A N     1 
ATOM 1109 C CA    . MET C 3 23 ? -39.340 69.409  -11.603 1.00 53.26 ? 323 MET A CA    1 
ATOM 1110 C C     . MET C 3 23 ? -39.145 70.574  -12.551 1.00 53.26 ? 323 MET A C     1 
ATOM 1111 O O     . MET C 3 23 ? -39.924 71.519  -12.570 1.00 53.26 ? 323 MET A O     1 
ATOM 1112 C CB    . MET C 3 23 ? -38.324 69.465  -10.476 1.00 32.03 ? 323 MET A CB    1 
ATOM 1113 C CG    . MET C 3 23 ? -38.009 70.841  -9.978  1.00 32.03 ? 323 MET A CG    1 
ATOM 1114 S SD    . MET C 3 23 ? -37.151 70.734  -8.395  1.00 32.03 ? 323 MET A SD    1 
ATOM 1115 C CE    . MET C 3 23 ? -35.436 71.045  -8.839  1.00 32.03 ? 323 MET A CE    1 
ATOM 1116 N N     . ILE C 3 24 ? -38.090 70.472  -13.347 1.00 25.43 ? 324 ILE A N     1 
ATOM 1117 C CA    . ILE C 3 24 ? -37.730 71.471  -14.345 1.00 25.43 ? 324 ILE A CA    1 
ATOM 1118 C C     . ILE C 3 24 ? -36.924 70.709  -15.395 1.00 25.43 ? 324 ILE A C     1 
ATOM 1119 O O     . ILE C 3 24 ? -35.973 70.001  -15.062 1.00 25.43 ? 324 ILE A O     1 
ATOM 1120 C CB    . ILE C 3 24 ? -36.861 72.605  -13.736 1.00 46.36 ? 324 ILE A CB    1 
ATOM 1121 C CG1   . ILE C 3 24 ? -36.505 73.634  -14.814 1.00 46.36 ? 324 ILE A CG1   1 
ATOM 1122 C CG2   . ILE C 3 24 ? -35.608 72.024  -13.109 1.00 46.36 ? 324 ILE A CG2   1 
ATOM 1123 C CD1   . ILE C 3 24 ? -35.550 74.714  -14.342 1.00 46.36 ? 324 ILE A CD1   1 
ATOM 1124 N N     . CYS C 3 25 ? -37.305 70.868  -16.658 1.00 12.09 ? 325 CYS A N     1 
ATOM 1125 C CA    . CYS C 3 25 ? -36.666 70.153  -17.755 1.00 12.09 ? 325 CYS A CA    1 
ATOM 1126 C C     . CYS C 3 25 ? -36.671 70.960  -19.040 1.00 12.09 ? 325 CYS A C     1 
ATOM 1127 O O     . CYS C 3 25 ? -37.530 71.818  -19.238 1.00 12.09 ? 325 CYS A O     1 
ATOM 1128 C CB    . CYS C 3 25 ? -37.453 68.875  -18.019 1.00 28.43 ? 325 CYS A CB    1 
ATOM 1129 S SG    . CYS C 3 25 ? -39.177 69.239  -18.561 1.00 28.43 ? 325 CYS A SG    1 
ATOM 1130 N N     . TRP C 3 26 ? -35.734 70.661  -19.931 1.00 26.98 ? 326 TRP A N     1 
ATOM 1131 C CA    . TRP C 3 26 ? -35.704 71.352  -21.208 1.00 26.98 ? 326 TRP A CA    1 
ATOM 1132 C C     . TRP C 3 26 ? -36.918 70.886  -22.009 1.00 26.98 ? 326 TRP A C     1 
ATOM 1133 O O     . TRP C 3 26 ? -37.281 69.711  -21.947 1.00 26.98 ? 326 TRP A O     1 
ATOM 1134 C CB    . TRP C 3 26 ? -34.419 71.017  -21.965 1.00 30.02 ? 326 TRP A CB    1 
ATOM 1135 C CG    . TRP C 3 26 ? -33.207 71.676  -21.379 1.00 30.02 ? 326 TRP A CG    1 
ATOM 1136 C CD1   . TRP C 3 26 ? -32.099 71.062  -20.859 1.00 30.02 ? 326 TRP A CD1   1 
ATOM 1137 C CD2   . TRP C 3 26 ? -32.980 73.085  -21.252 1.00 30.02 ? 326 TRP A CD2   1 
ATOM 1138 N NE1   . TRP C 3 26 ? -31.197 72.003  -20.416 1.00 30.02 ? 326 TRP A NE1   1 
ATOM 1139 C CE2   . TRP C 3 26 ? -31.715 73.252  -20.645 1.00 30.02 ? 326 TRP A CE2   1 
ATOM 1140 C CE3   . TRP C 3 26 ? -33.726 74.225  -21.590 1.00 30.02 ? 326 TRP A CE3   1 
ATOM 1141 C CZ2   . TRP C 3 26 ? -31.179 74.515  -20.373 1.00 30.02 ? 326 TRP A CZ2   1 
ATOM 1142 C CZ3   . TRP C 3 26 ? -33.193 75.474  -21.318 1.00 30.02 ? 326 TRP A CZ3   1 
ATOM 1143 C CH2   . TRP C 3 26 ? -31.932 75.611  -20.715 1.00 30.02 ? 326 TRP A CH2   1 
ATOM 1144 N N     . THR C 3 27 ? -37.570 71.795  -22.732 1.00 21.55 ? 327 THR A N     1 
ATOM 1145 C CA    . THR C 3 27 ? -38.719 71.400  -23.551 1.00 21.55 ? 327 THR A CA    1 
ATOM 1146 C C     . THR C 3 27 ? -38.356 71.590  -25.021 1.00 21.55 ? 327 THR A C     1 
ATOM 1147 O O     . THR C 3 27 ? -39.218 71.591  -25.900 1.00 21.55 ? 327 THR A O     1 
ATOM 1148 C CB    . THR C 3 27 ? -39.971 72.215  -23.226 1.00 48.40 ? 327 THR A CB    1 
ATOM 1149 O OG1   . THR C 3 27 ? -39.815 73.561  -23.691 1.00 48.40 ? 327 THR A OG1   1 
ATOM 1150 C CG2   . THR C 3 27 ? -40.202 72.218  -21.738 1.00 48.40 ? 327 THR A CG2   1 
ATOM 1151 N N     . SER C 3 28 ? -37.061 71.762  -25.265 1.00 22.05 ? 328 SER A N     1 
ATOM 1152 C CA    . SER C 3 28 ? -36.519 71.927  -26.603 1.00 22.05 ? 328 SER A CA    1 
ATOM 1153 C C     . SER C 3 28 ? -35.019 72.018  -26.411 1.00 22.05 ? 328 SER A C     1 
ATOM 1154 O O     . SER C 3 28 ? -34.535 72.147  -25.279 1.00 22.05 ? 328 SER A O     1 
ATOM 1155 C CB    . SER C 3 28 ? -37.028 73.201  -27.276 1.00 31.30 ? 328 SER A CB    1 
ATOM 1156 O OG    . SER C 3 28 ? -36.234 74.308  -26.910 1.00 31.30 ? 328 SER A OG    1 
ATOM 1157 N N     . ASN C 3 29 ? -34.289 71.952  -27.515 1.00 23.99 ? 329 ASN A N     1 
ATOM 1158 C CA    . ASN C 3 29 ? -32.840 72.002  -27.461 1.00 23.99 ? 329 ASN A CA    1 
ATOM 1159 C C     . ASN C 3 29 ? -32.301 73.408  -27.671 1.00 23.99 ? 329 ASN A C     1 
ATOM 1160 O O     . ASN C 3 29 ? -31.118 73.654  -27.454 1.00 23.99 ? 329 ASN A O     1 
ATOM 1161 C CB    . ASN C 3 29 ? -32.255 71.082  -28.526 1.00 47.57 ? 329 ASN A CB    1 
ATOM 1162 C CG    . ASN C 3 29 ? -32.670 71.489  -29.921 1.00 47.57 ? 329 ASN A CG    1 
ATOM 1163 O OD1   . ASN C 3 29 ? -33.858 71.592  -30.216 1.00 47.57 ? 329 ASN A OD1   1 
ATOM 1164 N ND2   . ASN C 3 29 ? -31.694 71.728  -30.786 1.00 47.57 ? 329 ASN A ND2   1 
ATOM 1165 N N     . ASP C 3 30 ? -33.161 74.330  -28.099 1.00 38.48 ? 330 ASP A N     1 
ATOM 1166 C CA    . ASP C 3 30 ? -32.723 75.696  -28.338 1.00 38.48 ? 330 ASP A CA    1 
ATOM 1167 C C     . ASP C 3 30 ? -33.111 76.677  -27.233 1.00 38.48 ? 330 ASP A C     1 
ATOM 1168 O O     . ASP C 3 30 ? -33.481 77.817  -27.506 1.00 38.48 ? 330 ASP A O     1 
ATOM 1169 C CB    . ASP C 3 30 ? -33.254 76.191  -29.681 1.00 46.14 ? 330 ASP A CB    1 
ATOM 1170 C CG    . ASP C 3 30 ? -34.734 76.453  -29.653 1.00 46.14 ? 330 ASP A CG    1 
ATOM 1171 O OD1   . ASP C 3 30 ? -35.470 75.570  -29.163 1.00 46.14 ? 330 ASP A OD1   1 
ATOM 1172 O OD2   . ASP C 3 30 ? -35.160 77.537  -30.124 1.00 46.14 ? 330 ASP A OD2   1 
ATOM 1173 N N     . GLY C 3 31 ? -33.041 76.229  -25.984 1.00 30.46 ? 331 GLY A N     1 
ATOM 1174 C CA    . GLY C 3 31 ? -33.334 77.119  -24.879 1.00 30.46 ? 331 GLY A CA    1 
ATOM 1175 C C     . GLY C 3 31 ? -34.632 77.007  -24.110 1.00 30.46 ? 331 GLY A C     1 
ATOM 1176 O O     . GLY C 3 31 ? -34.645 77.236  -22.908 1.00 30.46 ? 331 GLY A O     1 
ATOM 1177 N N     . GLN C 3 32 ? -35.731 76.678  -24.765 1.00 36.58 ? 332 GLN A N     1 
ATOM 1178 C CA    . GLN C 3 32 ? -36.987 76.591  -24.035 1.00 36.58 ? 332 GLN A CA    1 
ATOM 1179 C C     . GLN C 3 32 ? -36.945 75.527  -22.930 1.00 36.58 ? 332 GLN A C     1 
ATOM 1180 O O     . GLN C 3 32 ? -36.364 74.455  -23.110 1.00 36.58 ? 332 GLN A O     1 
ATOM 1181 C CB    . GLN C 3 32 ? -38.108 76.307  -25.011 1.00 25.21 ? 332 GLN A CB    1 
ATOM 1182 C CG    . GLN C 3 32 ? -38.013 77.154  -26.240 1.00 25.21 ? 332 GLN A CG    1 
ATOM 1183 C CD    . GLN C 3 32 ? -38.957 76.672  -27.297 1.00 25.21 ? 332 GLN A CD    1 
ATOM 1184 O OE1   . GLN C 3 32 ? -40.178 76.777  -27.145 1.00 25.21 ? 332 GLN A OE1   1 
ATOM 1185 N NE2   . GLN C 3 32 ? -38.409 76.116  -28.379 1.00 25.21 ? 332 GLN A NE2   1 
ATOM 1186 N N     . PHE C 3 33 ? -37.560 75.838  -21.788 1.00 4.90  ? 333 PHE A N     1 
ATOM 1187 C CA    . PHE C 3 33 ? -37.589 74.938  -20.641 1.00 4.90  ? 333 PHE A CA    1 
ATOM 1188 C C     . PHE C 3 33 ? -38.899 75.091  -19.867 1.00 4.90  ? 333 PHE A C     1 
ATOM 1189 O O     . PHE C 3 33 ? -39.582 76.105  -19.975 1.00 4.90  ? 333 PHE A O     1 
ATOM 1190 C CB    . PHE C 3 33 ? -36.402 75.240  -19.737 1.00 23.87 ? 333 PHE A CB    1 
ATOM 1191 C CG    . PHE C 3 33 ? -36.496 76.561  -19.032 1.00 23.87 ? 333 PHE A CG    1 
ATOM 1192 C CD1   . PHE C 3 33 ? -37.250 76.690  -17.870 1.00 23.87 ? 333 PHE A CD1   1 
ATOM 1193 C CD2   . PHE C 3 33 ? -35.832 77.679  -19.522 1.00 23.87 ? 333 PHE A CD2   1 
ATOM 1194 C CE1   . PHE C 3 33 ? -37.335 77.913  -17.205 1.00 23.87 ? 333 PHE A CE1   1 
ATOM 1195 C CE2   . PHE C 3 33 ? -35.912 78.902  -18.865 1.00 23.87 ? 333 PHE A CE2   1 
ATOM 1196 C CZ    . PHE C 3 33 ? -36.664 79.020  -17.705 1.00 23.87 ? 333 PHE A CZ    1 
ATOM 1197 N N     . LYS C 3 34 ? -39.259 74.096  -19.071 1.00 5.95  ? 334 LYS A N     1 
ATOM 1198 C CA    . LYS C 3 34 ? -40.523 74.181  -18.359 1.00 5.95  ? 334 LYS A CA    1 
ATOM 1199 C C     . LYS C 3 34 ? -40.438 73.939  -16.872 1.00 5.95  ? 334 LYS A C     1 
ATOM 1200 O O     . LYS C 3 34 ? -39.698 73.067  -16.416 1.00 5.95  ? 334 LYS A O     1 
ATOM 1201 C CB    . LYS C 3 34 ? -41.531 73.190  -18.957 1.00 21.95 ? 334 LYS A CB    1 
ATOM 1202 C CG    . LYS C 3 34 ? -42.897 73.198  -18.275 1.00 21.95 ? 334 LYS A CG    1 
ATOM 1203 C CD    . LYS C 3 34 ? -43.901 72.328  -18.993 1.00 21.95 ? 334 LYS A CD    1 
ATOM 1204 C CE    . LYS C 3 34 ? -45.311 72.593  -18.477 1.00 21.95 ? 334 LYS A CE    1 
ATOM 1205 N NZ    . LYS C 3 34 ? -46.385 71.780  -19.158 1.00 21.95 ? 334 LYS A NZ    1 
ATOM 1206 N N     . LEU C 3 35 ? -41.209 74.703  -16.109 1.00 41.19 ? 335 LEU A N     1 
ATOM 1207 C CA    . LEU C 3 35 ? -41.226 74.523  -14.670 1.00 41.19 ? 335 LEU A CA    1 
ATOM 1208 C C     . LEU C 3 35 ? -42.320 73.535  -14.305 1.00 41.19 ? 335 LEU A C     1 
ATOM 1209 O O     . LEU C 3 35 ? -43.423 73.927  -13.922 1.00 41.19 ? 335 LEU A O     1 
ATOM 1210 C CB    . LEU C 3 35 ? -41.441 75.859  -13.971 1.00 14.67 ? 335 LEU A CB    1 
ATOM 1211 C CG    . LEU C 3 35 ? -40.123 76.630  -13.776 1.00 14.67 ? 335 LEU A CG    1 
ATOM 1212 C CD1   . LEU C 3 35 ? -39.527 77.006  -15.119 1.00 14.67 ? 335 LEU A CD1   1 
ATOM 1213 C CD2   . LEU C 3 35 ? -40.377 77.876  -12.948 1.00 14.67 ? 335 LEU A CD2   1 
ATOM 1214 N N     . LEU C 3 36 ? -41.993 72.248  -14.440 1.00 20.67 ? 336 LEU A N     1 
ATOM 1215 C CA    . LEU C 3 36 ? -42.915 71.155  -14.159 1.00 20.67 ? 336 LEU A CA    1 
ATOM 1216 C C     . LEU C 3 36 ? -43.481 71.290  -12.769 1.00 20.67 ? 336 LEU A C     1 
ATOM 1217 O O     . LEU C 3 36 ? -44.695 71.305  -12.608 1.00 20.67 ? 336 LEU A O     1 
ATOM 1218 C CB    . LEU C 3 36 ? -42.202 69.813  -14.289 1.00 5.90  ? 336 LEU A CB    1 
ATOM 1219 C CG    . LEU C 3 36 ? -41.486 69.461  -15.597 1.00 5.90  ? 336 LEU A CG    1 
ATOM 1220 C CD1   . LEU C 3 36 ? -40.795 68.126  -15.433 1.00 5.90  ? 336 LEU A CD1   1 
ATOM 1221 C CD2   . LEU C 3 36 ? -42.474 69.394  -16.754 1.00 5.90  ? 336 LEU A CD2   1 
ATOM 1222 N N     . GLN C 3 37 ? -42.602 71.370  -11.767 1.00 28.73 ? 337 GLN A N     1 
ATOM 1223 C CA    . GLN C 3 37 ? -43.015 71.533  -10.365 1.00 28.73 ? 337 GLN A CA    1 
ATOM 1224 C C     . GLN C 3 37 ? -42.592 72.936  -9.927  1.00 28.73 ? 337 GLN A C     1 
ATOM 1225 O O     . GLN C 3 37 ? -41.728 73.117  -9.064  1.00 28.73 ? 337 GLN A O     1 
ATOM 1226 C CB    . GLN C 3 37 ? -42.359 70.474  -9.469  1.00 31.09 ? 337 GLN A CB    1 
ATOM 1227 C CG    . GLN C 3 37 ? -42.706 69.033  -9.836  1.00 31.09 ? 337 GLN A CG    1 
ATOM 1228 C CD    . GLN C 3 37 ? -44.202 68.747  -9.792  1.00 31.09 ? 337 GLN A CD    1 
ATOM 1229 O OE1   . GLN C 3 37 ? -44.773 68.229  -10.751 1.00 31.09 ? 337 GLN A OE1   1 
ATOM 1230 N NE2   . GLN C 3 37 ? -44.838 69.075  -8.674  1.00 31.09 ? 337 GLN A NE2   1 
ATOM 1231 N N     . ALA C 3 38 ? -43.220 73.920  -10.558 1.00 32.66 ? 338 ALA A N     1 
ATOM 1232 C CA    . ALA C 3 38 ? -42.950 75.324  -10.322 1.00 32.66 ? 338 ALA A CA    1 
ATOM 1233 C C     . ALA C 3 38 ? -42.767 75.698  -8.871  1.00 32.66 ? 338 ALA A C     1 
ATOM 1234 O O     . ALA C 3 38 ? -41.720 76.209  -8.485  1.00 32.66 ? 338 ALA A O     1 
ATOM 1235 C CB    . ALA C 3 38 ? -44.045 76.147  -10.913 1.00 16.41 ? 338 ALA A CB    1 
ATOM 1236 N N     . GLU C 3 39 ? -43.788 75.454  -8.065  1.00 21.34 ? 339 GLU A N     1 
ATOM 1237 C CA    . GLU C 3 39 ? -43.731 75.792  -6.648  1.00 21.34 ? 339 GLU A CA    1 
ATOM 1238 C C     . GLU C 3 39 ? -42.513 75.232  -5.905  1.00 21.34 ? 339 GLU A C     1 
ATOM 1239 O O     . GLU C 3 39 ? -42.034 75.840  -4.940  1.00 21.34 ? 339 GLU A O     1 
ATOM 1240 C CB    . GLU C 3 39 ? -45.011 75.323  -5.964  1.00 48.10 ? 339 GLU A CB    1 
ATOM 1241 C CG    . GLU C 3 39 ? -46.238 76.141  -6.326  1.00 48.10 ? 339 GLU A CG    1 
ATOM 1242 C CD    . GLU C 3 39 ? -46.095 77.584  -5.904  1.00 48.10 ? 339 GLU A CD    1 
ATOM 1243 O OE1   . GLU C 3 39 ? -45.346 77.825  -4.930  1.00 48.10 ? 339 GLU A OE1   1 
ATOM 1244 O OE2   . GLU C 3 39 ? -46.732 78.467  -6.528  1.00 48.10 ? 339 GLU A OE2   1 
ATOM 1245 N N     . GLU C 3 40 ? -42.006 74.087  -6.361  1.00 22.96 ? 340 GLU A N     1 
ATOM 1246 C CA    . GLU C 3 40 ? -40.873 73.463  -5.706  1.00 22.96 ? 340 GLU A CA    1 
ATOM 1247 C C     . GLU C 3 40 ? -39.631 74.244  -6.024  1.00 22.96 ? 340 GLU A C     1 
ATOM 1248 O O     . GLU C 3 40 ? -38.865 74.606  -5.129  1.00 22.96 ? 340 GLU A O     1 
ATOM 1249 C CB    . GLU C 3 40 ? -40.718 72.019  -6.159  1.00 28.61 ? 340 GLU A CB    1 
ATOM 1250 C CG    . GLU C 3 40 ? -39.708 71.225  -5.343  1.00 28.61 ? 340 GLU A CG    1 
ATOM 1251 C CD    . GLU C 3 40 ? -39.953 71.299  -3.832  1.00 28.61 ? 340 GLU A CD    1 
ATOM 1252 O OE1   . GLU C 3 40 ? -41.085 71.643  -3.404  1.00 28.61 ? 340 GLU A OE1   1 
ATOM 1253 O OE2   . GLU C 3 40 ? -39.003 70.996  -3.074  1.00 28.61 ? 340 GLU A OE2   1 
ATOM 1254 N N     . VAL C 3 41 ? -39.423 74.506  -7.304  1.00 34.92 ? 341 VAL A N     1 
ATOM 1255 C CA    . VAL C 3 41 ? -38.265 75.281  -7.708  1.00 34.92 ? 341 VAL A CA    1 
ATOM 1256 C C     . VAL C 3 41 ? -38.240 76.500  -6.808  1.00 34.92 ? 341 VAL A C     1 
ATOM 1257 O O     . VAL C 3 41 ? -37.228 76.815  -6.190  1.00 34.92 ? 341 VAL A O     1 
ATOM 1258 C CB    . VAL C 3 41 ? -38.403 75.754  -9.142  1.00 9.47  ? 341 VAL A CB    1 
ATOM 1259 C CG1   . VAL C 3 41 ? -37.207 76.569  -9.527  1.00 9.47  ? 341 VAL A CG1   1 
ATOM 1260 C CG2   . VAL C 3 41 ? -38.552 74.570  -10.051 1.00 9.47  ? 341 VAL A CG2   1 
ATOM 1261 N N     . ALA C 3 42 ? -39.381 77.174  -6.733  1.00 7.58  ? 342 ALA A N     1 
ATOM 1262 C CA    . ALA C 3 42 ? -39.515 78.356  -5.907  1.00 7.58  ? 342 ALA A CA    1 
ATOM 1263 C C     . ALA C 3 42 ? -39.067 78.013  -4.497  1.00 7.58  ? 342 ALA A C     1 
ATOM 1264 O O     . ALA C 3 42 ? -38.273 78.739  -3.907  1.00 7.58  ? 342 ALA A O     1 
ATOM 1265 C CB    . ALA C 3 42 ? -40.957 78.836  -5.911  1.00 28.60 ? 342 ALA A CB    1 
ATOM 1266 N N     . ARG C 3 43 ? -39.559 76.898  -3.968  1.00 21.63 ? 343 ARG A N     1 
ATOM 1267 C CA    . ARG C 3 43 ? -39.192 76.487  -2.619  1.00 21.63 ? 343 ARG A CA    1 
ATOM 1268 C C     . ARG C 3 43 ? -37.679 76.475  -2.481  1.00 21.63 ? 343 ARG A C     1 
ATOM 1269 O O     . ARG C 3 43 ? -37.137 77.068  -1.547  1.00 21.63 ? 343 ARG A O     1 
ATOM 1270 C CB    . ARG C 3 43 ? -39.742 75.102  -2.311  1.00 29.70 ? 343 ARG A CB    1 
ATOM 1271 C CG    . ARG C 3 43 ? -39.759 74.755  -0.842  1.00 29.70 ? 343 ARG A CG    1 
ATOM 1272 C CD    . ARG C 3 43 ? -40.087 73.273  -0.653  1.00 29.70 ? 343 ARG A CD    1 
ATOM 1273 N NE    . ARG C 3 43 ? -38.949 72.410  -0.981  1.00 29.70 ? 343 ARG A NE    1 
ATOM 1274 C CZ    . ARG C 3 43 ? -37.963 72.107  -0.135  1.00 29.70 ? 343 ARG A CZ    1 
ATOM 1275 N NH1   . ARG C 3 43 ? -37.980 72.586  1.105   1.00 29.70 ? 343 ARG A NH1   1 
ATOM 1276 N NH2   . ARG C 3 43 ? -36.941 71.356  -0.538  1.00 29.70 ? 343 ARG A NH2   1 
ATOM 1277 N N     . LEU C 3 44 ? -37.001 75.819  -3.421  1.00 18.17 ? 344 LEU A N     1 
ATOM 1278 C CA    . LEU C 3 44 ? -35.536 75.724  -3.418  1.00 18.17 ? 344 LEU A CA    1 
ATOM 1279 C C     . LEU C 3 44 ? -34.835 77.051  -3.637  1.00 18.17 ? 344 LEU A C     1 
ATOM 1280 O O     . LEU C 3 44 ? -33.841 77.338  -2.966  1.00 18.17 ? 344 LEU A O     1 
ATOM 1281 C CB    . LEU C 3 44 ? -35.049 74.755  -4.497  1.00 16.71 ? 344 LEU A CB    1 
ATOM 1282 C CG    . LEU C 3 44 ? -35.176 73.256  -4.243  1.00 16.71 ? 344 LEU A CG    1 
ATOM 1283 C CD1   . LEU C 3 44 ? -36.568 72.965  -3.729  1.00 16.71 ? 344 LEU A CD1   1 
ATOM 1284 C CD2   . LEU C 3 44 ? -34.898 72.476  -5.525  1.00 16.71 ? 344 LEU A CD2   1 
ATOM 1285 N N     . TRP C 3 45 ? -35.337 77.841  -4.589  1.00 29.31 ? 345 TRP A N     1 
ATOM 1286 C CA    . TRP C 3 45 ? -34.763 79.150  -4.909  1.00 29.31 ? 345 TRP A CA    1 
ATOM 1287 C C     . TRP C 3 45 ? -34.875 80.123  -3.740  1.00 29.31 ? 345 TRP A C     1 
ATOM 1288 O O     . TRP C 3 45 ? -34.096 81.067  -3.630  1.00 29.31 ? 345 TRP A O     1 
ATOM 1289 C CB    . TRP C 3 45 ? -35.442 79.736  -6.150  1.00 47.66 ? 345 TRP A CB    1 
ATOM 1290 C CG    . TRP C 3 45 ? -35.246 81.217  -6.320  1.00 47.66 ? 345 TRP A CG    1 
ATOM 1291 C CD1   . TRP C 3 45 ? -36.146 82.201  -6.023  1.00 47.66 ? 345 TRP A CD1   1 
ATOM 1292 C CD2   . TRP C 3 45 ? -34.071 81.884  -6.800  1.00 47.66 ? 345 TRP A CD2   1 
ATOM 1293 N NE1   . TRP C 3 45 ? -35.605 83.437  -6.291  1.00 47.66 ? 345 TRP A NE1   1 
ATOM 1294 C CE2   . TRP C 3 45 ? -34.335 83.269  -6.772  1.00 47.66 ? 345 TRP A CE2   1 
ATOM 1295 C CE3   . TRP C 3 45 ? -32.824 81.446  -7.258  1.00 47.66 ? 345 TRP A CE3   1 
ATOM 1296 C CZ2   . TRP C 3 45 ? -33.398 84.214  -7.169  1.00 47.66 ? 345 TRP A CZ2   1 
ATOM 1297 C CZ3   . TRP C 3 45 ? -31.888 82.393  -7.655  1.00 47.66 ? 345 TRP A CZ3   1 
ATOM 1298 C CH2   . TRP C 3 45 ? -32.184 83.758  -7.610  1.00 47.66 ? 345 TRP A CH2   1 
ATOM 1299 N N     . GLY C 3 46 ? -35.846 79.887  -2.869  1.00 51.25 ? 346 GLY A N     1 
ATOM 1300 C CA    . GLY C 3 46 ? -36.013 80.745  -1.714  1.00 51.25 ? 346 GLY A CA    1 
ATOM 1301 C C     . GLY C 3 46 ? -35.119 80.240  -0.603  1.00 51.25 ? 346 GLY A C     1 
ATOM 1302 O O     . GLY C 3 46 ? -35.034 80.833  0.468   1.00 51.25 ? 346 GLY A O     1 
ATOM 1303 N N     . ILE C 3 47 ? -34.456 79.121  -0.867  1.00 49.96 ? 347 ILE A N     1 
ATOM 1304 C CA    . ILE C 3 47 ? -33.544 78.517  0.097   1.00 49.96 ? 347 ILE A CA    1 
ATOM 1305 C C     . ILE C 3 47 ? -32.130 78.886  -0.311  1.00 49.96 ? 347 ILE A C     1 
ATOM 1306 O O     . ILE C 3 47 ? -31.212 78.934  0.515   1.00 49.96 ? 347 ILE A O     1 
ATOM 1307 C CB    . ILE C 3 47 ? -33.707 76.961  0.135   1.00 17.23 ? 347 ILE A CB    1 
ATOM 1308 C CG1   . ILE C 3 47 ? -34.950 76.601  0.950   1.00 17.23 ? 347 ILE A CG1   1 
ATOM 1309 C CG2   . ILE C 3 47 ? -32.491 76.313  0.759   1.00 17.23 ? 347 ILE A CG2   1 
ATOM 1310 C CD1   . ILE C 3 47 ? -35.083 75.148  1.264   1.00 17.23 ? 347 ILE A CD1   1 
ATOM 1311 N N     . ARG C 3 48 ? -31.978 79.160  -1.601  1.00 47.38 ? 348 ARG A N     1 
ATOM 1312 C CA    . ARG C 3 48 ? -30.692 79.529  -2.167  1.00 47.38 ? 348 ARG A CA    1 
ATOM 1313 C C     . ARG C 3 48 ? -30.388 80.976  -1.859  1.00 47.38 ? 348 ARG A C     1 
ATOM 1314 O O     . ARG C 3 48 ? -29.225 81.362  -1.770  1.00 47.38 ? 348 ARG A O     1 
ATOM 1315 C CB    . ARG C 3 48 ? -30.704 79.354  -3.679  1.00 46.89 ? 348 ARG A CB    1 
ATOM 1316 C CG    . ARG C 3 48 ? -29.412 79.786  -4.344  1.00 46.89 ? 348 ARG A CG    1 
ATOM 1317 C CD    . ARG C 3 48 ? -28.392 78.677  -4.315  1.00 46.89 ? 348 ARG A CD    1 
ATOM 1318 N NE    . ARG C 3 48 ? -27.130 79.087  -4.916  1.00 46.89 ? 348 ARG A NE    1 
ATOM 1319 C CZ    . ARG C 3 48 ? -26.354 80.050  -4.425  1.00 46.89 ? 348 ARG A CZ    1 
ATOM 1320 N NH1   . ARG C 3 48 ? -26.726 80.698  -3.328  1.00 46.89 ? 348 ARG A NH1   1 
ATOM 1321 N NH2   . ARG C 3 48 ? -25.202 80.352  -5.020  1.00 46.89 ? 348 ARG A NH2   1 
ATOM 1322 N N     . LYS C 3 49 ? -31.449 81.767  -1.716  1.00 19.44 ? 349 LYS A N     1 
ATOM 1323 C CA    . LYS C 3 49 ? -31.346 83.188  -1.432  1.00 19.44 ? 349 LYS A CA    1 
ATOM 1324 C C     . LYS C 3 49 ? -31.776 83.435  0.005   1.00 19.44 ? 349 LYS A C     1 
ATOM 1325 O O     . LYS C 3 49 ? -31.794 84.558  0.485   1.00 19.44 ? 349 LYS A O     1 
ATOM 1326 C CB    . LYS C 3 49 ? -32.250 83.970  -2.381  1.00 23.38 ? 349 LYS A CB    1 
ATOM 1327 C CG    . LYS C 3 49 ? -31.948 83.769  -3.858  1.00 23.38 ? 349 LYS A CG    1 
ATOM 1328 C CD    . LYS C 3 49 ? -30.731 84.572  -4.292  1.00 23.38 ? 349 LYS A CD    1 
ATOM 1329 C CE    . LYS C 3 49 ? -30.899 86.079  -4.003  1.00 23.38 ? 349 LYS A CE    1 
ATOM 1330 N NZ    . LYS C 3 49 ? -32.031 86.758  -4.735  1.00 23.38 ? 349 LYS A NZ    1 
ATOM 1331 N N     . ASN C 3 50 ? -32.114 82.372  0.706   1.00 19.37 ? 350 ASN A N     1 
ATOM 1332 C CA    . ASN C 3 50 ? -32.549 82.510  2.086   1.00 19.37 ? 350 ASN A CA    1 
ATOM 1333 C C     . ASN C 3 50 ? -33.729 83.449  2.110   1.00 19.37 ? 350 ASN A C     1 
ATOM 1334 O O     . ASN C 3 50 ? -33.685 84.511  2.715   1.00 19.37 ? 350 ASN A O     1 
ATOM 1335 C CB    . ASN C 3 50 ? -31.439 83.061  2.988   1.00 53.30 ? 350 ASN A CB    1 
ATOM 1336 C CG    . ASN C 3 50 ? -31.802 82.975  4.468   1.00 53.30 ? 350 ASN A CG    1 
ATOM 1337 O OD1   . ASN C 3 50 ? -32.004 83.990  5.138   1.00 53.30 ? 350 ASN A OD1   1 
ATOM 1338 N ND2   . ASN C 3 50 ? -31.901 81.748  4.980   1.00 53.30 ? 350 ASN A ND2   1 
ATOM 1339 N N     . LYS C 3 51 ? -34.779 83.038  1.417   1.00 22.48 ? 351 LYS A N     1 
ATOM 1340 C CA    . LYS C 3 51 ? -36.008 83.797  1.349   1.00 22.48 ? 351 LYS A CA    1 
ATOM 1341 C C     . LYS C 3 51 ? -37.147 82.823  1.611   1.00 22.48 ? 351 LYS A C     1 
ATOM 1342 O O     . LYS C 3 51 ? -37.861 82.421  0.708   1.00 22.48 ? 351 LYS A O     1 
ATOM 1343 C CB    . LYS C 3 51 ? -36.141 84.456  -0.024  1.00 20.06 ? 351 LYS A CB    1 
ATOM 1344 C CG    . LYS C 3 51 ? -35.138 85.592  -0.244  1.00 20.06 ? 351 LYS A CG    1 
ATOM 1345 C CD    . LYS C 3 51 ? -35.522 86.815  0.578   1.00 20.06 ? 351 LYS A CD    1 
ATOM 1346 C CE    . LYS C 3 51 ? -34.386 87.815  0.716   1.00 20.06 ? 351 LYS A CE    1 
ATOM 1347 N NZ    . LYS C 3 51 ? -33.302 87.350  1.638   1.00 20.06 ? 351 LYS A NZ    1 
ATOM 1348 N N     . PRO C 3 52 ? -37.306 82.415  2.871   1.00 19.04 ? 352 PRO A N     1 
ATOM 1349 C CA    . PRO C 3 52 ? -38.350 81.484  3.277   1.00 19.04 ? 352 PRO A CA    1 
ATOM 1350 C C     . PRO C 3 52 ? -39.698 81.621  2.570   1.00 19.04 ? 352 PRO A C     1 
ATOM 1351 O O     . PRO C 3 52 ? -40.114 80.716  1.853   1.00 19.04 ? 352 PRO A O     1 
ATOM 1352 C CB    . PRO C 3 52 ? -38.446 81.727  4.779   1.00 80.56 ? 352 PRO A CB    1 
ATOM 1353 C CG    . PRO C 3 52 ? -37.004 81.921  5.144   1.00 80.56 ? 352 PRO A CG    1 
ATOM 1354 C CD    . PRO C 3 52 ? -36.506 82.842  4.035   1.00 80.56 ? 352 PRO A CD    1 
ATOM 1355 N N     . ASN C 3 53 ? -40.385 82.738  2.749   1.00 31.06 ? 353 ASN A N     1 
ATOM 1356 C CA    . ASN C 3 53 ? -41.688 82.871  2.130   1.00 31.06 ? 353 ASN A CA    1 
ATOM 1357 C C     . ASN C 3 53 ? -41.725 82.960  0.603   1.00 31.06 ? 353 ASN A C     1 
ATOM 1358 O O     . ASN C 3 53 ? -42.652 83.541  0.044   1.00 31.06 ? 353 ASN A O     1 
ATOM 1359 C CB    . ASN C 3 53 ? -42.423 84.061  2.740   1.00 70.71 ? 353 ASN A CB    1 
ATOM 1360 C CG    . ASN C 3 53 ? -42.504 83.977  4.244   1.00 70.71 ? 353 ASN A CG    1 
ATOM 1361 O OD1   . ASN C 3 53 ? -42.697 82.898  4.808   1.00 70.71 ? 353 ASN A OD1   1 
ATOM 1362 N ND2   . ASN C 3 53 ? -42.365 85.119  4.908   1.00 70.71 ? 353 ASN A ND2   1 
ATOM 1363 N N     . MET C 3 54 ? -40.741 82.377  -0.077  1.00 32.75 ? 354 MET A N     1 
ATOM 1364 C CA    . MET C 3 54 ? -40.694 82.400  -1.547  1.00 32.75 ? 354 MET A CA    1 
ATOM 1365 C C     . MET C 3 54 ? -41.725 81.473  -2.182  1.00 32.75 ? 354 MET A C     1 
ATOM 1366 O O     . MET C 3 54 ? -42.096 80.460  -1.598  1.00 32.75 ? 354 MET A O     1 
ATOM 1367 C CB    . MET C 3 54 ? -39.324 81.969  -2.030  1.00 23.50 ? 354 MET A CB    1 
ATOM 1368 C CG    . MET C 3 54 ? -38.634 82.955  -2.950  1.00 23.50 ? 354 MET A CG    1 
ATOM 1369 S SD    . MET C 3 54 ? -39.603 83.401  -4.397  1.00 23.50 ? 354 MET A SD    1 
ATOM 1370 C CE    . MET C 3 54 ? -39.145 85.126  -4.556  1.00 23.50 ? 354 MET A CE    1 
ATOM 1371 N N     . ASN C 3 55 ? -42.173 81.821  -3.384  1.00 14.32 ? 355 ASN A N     1 
ATOM 1372 C CA    . ASN C 3 55 ? -43.152 81.023  -4.128  1.00 14.32 ? 355 ASN A CA    1 
ATOM 1373 C C     . ASN C 3 55 ? -43.140 81.415  -5.617  1.00 14.32 ? 355 ASN A C     1 
ATOM 1374 O O     . ASN C 3 55 ? -42.518 82.411  -5.992  1.00 14.32 ? 355 ASN A O     1 
ATOM 1375 C CB    . ASN C 3 55 ? -44.553 81.189  -3.528  1.00 24.00 ? 355 ASN A CB    1 
ATOM 1376 C CG    . ASN C 3 55 ? -45.060 82.619  -3.594  1.00 24.00 ? 355 ASN A CG    1 
ATOM 1377 O OD1   . ASN C 3 55 ? -45.105 83.225  -4.669  1.00 24.00 ? 355 ASN A OD1   1 
ATOM 1378 N ND2   . ASN C 3 55 ? -45.458 83.165  -2.444  1.00 24.00 ? 355 ASN A ND2   1 
ATOM 1379 N N     . TYR C 3 56 ? -43.816 80.641  -6.465  1.00 30.07 ? 356 TYR A N     1 
ATOM 1380 C CA    . TYR C 3 56 ? -43.826 80.921  -7.901  1.00 30.07 ? 356 TYR A CA    1 
ATOM 1381 C C     . TYR C 3 56 ? -44.398 82.281  -8.272  1.00 30.07 ? 356 TYR A C     1 
ATOM 1382 O O     . TYR C 3 56 ? -43.974 82.876  -9.259  1.00 30.07 ? 356 TYR A O     1 
ATOM 1383 C CB    . TYR C 3 56 ? -44.587 79.828  -8.657  1.00 4.90  ? 356 TYR A CB    1 
ATOM 1384 C CG    . TYR C 3 56 ? -44.563 79.958  -10.168 1.00 4.90  ? 356 TYR A CG    1 
ATOM 1385 C CD1   . TYR C 3 56 ? -43.387 79.796  -10.888 1.00 4.90  ? 356 TYR A CD1   1 
ATOM 1386 C CD2   . TYR C 3 56 ? -45.717 80.281  -10.871 1.00 4.90  ? 356 TYR A CD2   1 
ATOM 1387 C CE1   . TYR C 3 56 ? -43.363 79.964  -12.283 1.00 4.90  ? 356 TYR A CE1   1 
ATOM 1388 C CE2   . TYR C 3 56 ? -45.714 80.450  -12.253 1.00 4.90  ? 356 TYR A CE2   1 
ATOM 1389 C CZ    . TYR C 3 56 ? -44.537 80.300  -12.952 1.00 4.90  ? 356 TYR A CZ    1 
ATOM 1390 O OH    . TYR C 3 56 ? -44.528 80.547  -14.307 1.00 4.90  ? 356 TYR A OH    1 
ATOM 1391 N N     . ASP C 3 57 ? -45.352 82.787  -7.496  1.00 41.24 ? 357 ASP A N     1 
ATOM 1392 C CA    . ASP C 3 57 ? -45.944 84.090  -7.810  1.00 41.24 ? 357 ASP A CA    1 
ATOM 1393 C C     . ASP C 3 57 ? -44.951 85.229  -7.594  1.00 41.24 ? 357 ASP A C     1 
ATOM 1394 O O     . ASP C 3 57 ? -45.187 86.352  -8.026  1.00 41.24 ? 357 ASP A O     1 
ATOM 1395 C CB    . ASP C 3 57 ? -47.219 84.321  -6.983  1.00 15.39 ? 357 ASP A CB    1 
ATOM 1396 N N     . LYS C 3 58 ? -43.841 84.944  -6.924  1.00 31.87 ? 358 LYS A N     1 
ATOM 1397 C CA    . LYS C 3 58 ? -42.817 85.961  -6.695  1.00 31.87 ? 358 LYS A CA    1 
ATOM 1398 C C     . LYS C 3 58 ? -41.650 85.696  -7.656  1.00 31.87 ? 358 LYS A C     1 
ATOM 1399 O O     . LYS C 3 58 ? -41.061 86.622  -8.219  1.00 31.87 ? 358 LYS A O     1 
ATOM 1400 C CB    . LYS C 3 58 ? -42.327 85.919  -5.236  1.00 27.22 ? 358 LYS A CB    1 
ATOM 1401 C CG    . LYS C 3 58 ? -43.342 86.407  -4.212  1.00 27.22 ? 358 LYS A CG    1 
ATOM 1402 C CD    . LYS C 3 58 ? -42.872 86.210  -2.775  1.00 27.22 ? 358 LYS A CD    1 
ATOM 1403 C CE    . LYS C 3 58 ? -43.986 86.591  -1.798  1.00 27.22 ? 358 LYS A CE    1 
ATOM 1404 N NZ    . LYS C 3 58 ? -43.608 86.499  -0.349  1.00 27.22 ? 358 LYS A NZ    1 
ATOM 1405 N N     . LEU C 3 59 ? -41.336 84.420  -7.844  1.00 4.90  ? 359 LEU A N     1 
ATOM 1406 C CA    . LEU C 3 59 ? -40.254 84.002  -8.719  1.00 4.90  ? 359 LEU A CA    1 
ATOM 1407 C C     . LEU C 3 59 ? -40.544 84.388  -10.163 1.00 4.90  ? 359 LEU A C     1 
ATOM 1408 O O     . LEU C 3 59 ? -39.664 84.859  -10.881 1.00 4.90  ? 359 LEU A O     1 
ATOM 1409 C CB    . LEU C 3 59 ? -40.080 82.486  -8.620  1.00 5.14  ? 359 LEU A CB    1 
ATOM 1410 C CG    . LEU C 3 59 ? -38.869 81.839  -9.302  1.00 5.14  ? 359 LEU A CG    1 
ATOM 1411 C CD1   . LEU C 3 59 ? -38.805 80.375  -8.924  1.00 5.14  ? 359 LEU A CD1   1 
ATOM 1412 C CD2   . LEU C 3 59 ? -38.960 81.980  -10.797 1.00 5.14  ? 359 LEU A CD2   1 
ATOM 1413 N N     . SER C 3 60 ? -41.779 84.155  -10.590 1.00 23.38 ? 360 SER A N     1 
ATOM 1414 C CA    . SER C 3 60 ? -42.186 84.471  -11.944 1.00 23.38 ? 360 SER A CA    1 
ATOM 1415 C C     . SER C 3 60 ? -42.035 85.972  -12.188 1.00 23.38 ? 360 SER A C     1 
ATOM 1416 O O     . SER C 3 60 ? -41.672 86.401  -13.291 1.00 23.38 ? 360 SER A O     1 
ATOM 1417 C CB    . SER C 3 60 ? -43.638 84.041  -12.168 1.00 17.57 ? 360 SER A CB    1 
ATOM 1418 O OG    . SER C 3 60 ? -44.546 84.760  -11.348 1.00 17.57 ? 360 SER A OG    1 
ATOM 1419 N N     . ARG C 3 61 ? -42.305 86.774  -11.158 1.00 23.50 ? 361 ARG A N     1 
ATOM 1420 C CA    . ARG C 3 61 ? -42.191 88.224  -11.292 1.00 23.50 ? 361 ARG A CA    1 
ATOM 1421 C C     . ARG C 3 61 ? -40.764 88.604  -11.651 1.00 23.50 ? 361 ARG A C     1 
ATOM 1422 O O     . ARG C 3 61 ? -40.538 89.561  -12.386 1.00 23.50 ? 361 ARG A O     1 
ATOM 1423 C CB    . ARG C 3 61 ? -42.597 88.925  -10.003 1.00 14.76 ? 361 ARG A CB    1 
ATOM 1424 C CG    . ARG C 3 61 ? -42.573 90.431  -10.112 1.00 14.76 ? 361 ARG A CG    1 
ATOM 1425 C CD    . ARG C 3 61 ? -43.739 90.949  -10.937 1.00 14.76 ? 361 ARG A CD    1 
ATOM 1426 N NE    . ARG C 3 61 ? -43.608 92.371  -11.250 1.00 14.76 ? 361 ARG A NE    1 
ATOM 1427 C CZ    . ARG C 3 61 ? -43.098 92.849  -12.378 1.00 14.76 ? 361 ARG A CZ    1 
ATOM 1428 N NH1   . ARG C 3 61 ? -42.669 92.033  -13.326 1.00 14.76 ? 361 ARG A NH1   1 
ATOM 1429 N NH2   . ARG C 3 61 ? -43.006 94.152  -12.547 1.00 14.76 ? 361 ARG A NH2   1 
ATOM 1430 N N     . ALA C 3 62 ? -39.802 87.853  -11.121 1.00 14.80 ? 362 ALA A N     1 
ATOM 1431 C CA    . ALA C 3 62 ? -38.399 88.099  -11.425 1.00 14.80 ? 362 ALA A CA    1 
ATOM 1432 C C     . ALA C 3 62 ? -38.226 87.694  -12.867 1.00 14.80 ? 362 ALA A C     1 
ATOM 1433 O O     . ALA C 3 62 ? -37.490 88.332  -13.608 1.00 14.80 ? 362 ALA A O     1 
ATOM 1434 C CB    . ALA C 3 62 ? -37.497 87.258  -10.541 1.00 4.90  ? 362 ALA A CB    1 
ATOM 1435 N N     . LEU C 3 63 ? -38.920 86.629  -13.262 1.00 5.58  ? 363 LEU A N     1 
ATOM 1436 C CA    . LEU C 3 63 ? -38.833 86.149  -14.629 1.00 5.58  ? 363 LEU A CA    1 
ATOM 1437 C C     . LEU C 3 63 ? -39.372 87.183  -15.573 1.00 5.58  ? 363 LEU A C     1 
ATOM 1438 O O     . LEU C 3 63 ? -38.756 87.464  -16.601 1.00 5.58  ? 363 LEU A O     1 
ATOM 1439 C CB    . LEU C 3 63 ? -39.597 84.847  -14.818 1.00 18.59 ? 363 LEU A CB    1 
ATOM 1440 C CG    . LEU C 3 63 ? -38.909 83.627  -14.205 1.00 18.59 ? 363 LEU A CG    1 
ATOM 1441 C CD1   . LEU C 3 63 ? -39.495 82.378  -14.836 1.00 18.59 ? 363 LEU A CD1   1 
ATOM 1442 C CD2   . LEU C 3 63 ? -37.405 83.666  -14.464 1.00 18.59 ? 363 LEU A CD2   1 
ATOM 1443 N N     . ARG C 3 64 ? -40.516 87.765  -15.230 1.00 23.50 ? 364 ARG A N     1 
ATOM 1444 C CA    . ARG C 3 64 ? -41.092 88.776  -16.091 1.00 23.50 ? 364 ARG A CA    1 
ATOM 1445 C C     . ARG C 3 64 ? -40.144 89.977  -16.199 1.00 23.50 ? 364 ARG A C     1 
ATOM 1446 O O     . ARG C 3 64 ? -40.059 90.585  -17.255 1.00 23.50 ? 364 ARG A O     1 
ATOM 1447 C CB    . ARG C 3 64 ? -42.462 89.207  -15.579 1.00 18.89 ? 364 ARG A CB    1 
ATOM 1448 C CG    . ARG C 3 64 ? -43.432 88.075  -15.300 1.00 18.89 ? 364 ARG A CG    1 
ATOM 1449 C CD    . ARG C 3 64 ? -44.850 88.602  -15.402 1.00 18.89 ? 364 ARG A CD    1 
ATOM 1450 N NE    . ARG C 3 64 ? -45.763 88.038  -14.412 1.00 18.89 ? 364 ARG A NE    1 
ATOM 1451 C CZ    . ARG C 3 64 ? -45.633 88.197  -13.094 1.00 18.89 ? 364 ARG A CZ    1 
ATOM 1452 N NH1   . ARG C 3 64 ? -44.615 88.894  -12.619 1.00 18.89 ? 364 ARG A NH1   1 
ATOM 1453 N NH2   . ARG C 3 64 ? -46.532 87.699  -12.243 1.00 18.89 ? 364 ARG A NH2   1 
ATOM 1454 N N     . TYR C 3 65 ? -39.423 90.327  -15.131 1.00 17.25 ? 365 TYR A N     1 
ATOM 1455 C CA    . TYR C 3 65 ? -38.478 91.448  -15.219 1.00 17.25 ? 365 TYR A CA    1 
ATOM 1456 C C     . TYR C 3 65 ? -37.390 91.097  -16.236 1.00 17.25 ? 365 TYR A C     1 
ATOM 1457 O O     . TYR C 3 65 ? -36.896 91.967  -16.957 1.00 17.25 ? 365 TYR A O     1 
ATOM 1458 C CB    . TYR C 3 65 ? -37.826 91.751  -13.866 1.00 40.99 ? 365 TYR A CB    1 
ATOM 1459 C CG    . TYR C 3 65 ? -38.681 92.588  -12.938 1.00 40.99 ? 365 TYR A CG    1 
ATOM 1460 C CD1   . TYR C 3 65 ? -39.266 93.773  -13.375 1.00 40.99 ? 365 TYR A CD1   1 
ATOM 1461 C CD2   . TYR C 3 65 ? -38.904 92.200  -11.618 1.00 40.99 ? 365 TYR A CD2   1 
ATOM 1462 C CE1   . TYR C 3 65 ? -40.054 94.547  -12.523 1.00 40.99 ? 365 TYR A CE1   1 
ATOM 1463 C CE2   . TYR C 3 65 ? -39.691 92.971  -10.758 1.00 40.99 ? 365 TYR A CE2   1 
ATOM 1464 C CZ    . TYR C 3 65 ? -40.262 94.140  -11.216 1.00 40.99 ? 365 TYR A CZ    1 
ATOM 1465 O OH    . TYR C 3 65 ? -41.046 94.901  -10.368 1.00 40.99 ? 365 TYR A OH    1 
ATOM 1466 N N     . TYR C 3 66 ? -37.024 89.815  -16.290 1.00 22.63 ? 366 TYR A N     1 
ATOM 1467 C CA    . TYR C 3 66 ? -36.013 89.343  -17.228 1.00 22.63 ? 366 TYR A CA    1 
ATOM 1468 C C     . TYR C 3 66 ? -36.493 89.539  -18.657 1.00 22.63 ? 366 TYR A C     1 
ATOM 1469 O O     . TYR C 3 66 ? -35.681 89.587  -19.580 1.00 22.63 ? 366 TYR A O     1 
ATOM 1470 C CB    . TYR C 3 66 ? -35.723 87.853  -17.027 1.00 24.94 ? 366 TYR A CB    1 
ATOM 1471 C CG    . TYR C 3 66 ? -34.746 87.520  -15.926 1.00 24.94 ? 366 TYR A CG    1 
ATOM 1472 C CD1   . TYR C 3 66 ? -33.550 88.213  -15.793 1.00 24.94 ? 366 TYR A CD1   1 
ATOM 1473 C CD2   . TYR C 3 66 ? -35.009 86.496  -15.027 1.00 24.94 ? 366 TYR A CD2   1 
ATOM 1474 C CE1   . TYR C 3 66 ? -32.641 87.900  -14.784 1.00 24.94 ? 366 TYR A CE1   1 
ATOM 1475 C CE2   . TYR C 3 66 ? -34.105 86.171  -14.016 1.00 24.94 ? 366 TYR A CE2   1 
ATOM 1476 C CZ    . TYR C 3 66 ? -32.925 86.880  -13.894 1.00 24.94 ? 366 TYR A CZ    1 
ATOM 1477 O OH    . TYR C 3 66 ? -32.052 86.600  -12.856 1.00 24.94 ? 366 TYR A OH    1 
ATOM 1478 N N     . TYR C 3 67 ? -37.812 89.631  -18.835 1.00 25.92 ? 367 TYR A N     1 
ATOM 1479 C CA    . TYR C 3 67 ? -38.398 89.805  -20.164 1.00 25.92 ? 367 TYR A CA    1 
ATOM 1480 C C     . TYR C 3 67 ? -37.775 90.989  -20.886 1.00 25.92 ? 367 TYR A C     1 
ATOM 1481 O O     . TYR C 3 67 ? -37.156 90.835  -21.942 1.00 25.92 ? 367 TYR A O     1 
ATOM 1482 C CB    . TYR C 3 67 ? -39.909 90.041  -20.081 1.00 55.91 ? 367 TYR A CB    1 
ATOM 1483 C CG    . TYR C 3 67 ? -40.766 88.838  -19.746 1.00 55.91 ? 367 TYR A CG    1 
ATOM 1484 C CD1   . TYR C 3 67 ? -40.237 87.715  -19.113 1.00 55.91 ? 367 TYR A CD1   1 
ATOM 1485 C CD2   . TYR C 3 67 ? -42.139 88.869  -19.984 1.00 55.91 ? 367 TYR A CD2   1 
ATOM 1486 C CE1   . TYR C 3 67 ? -41.063 86.655  -18.715 1.00 55.91 ? 367 TYR A CE1   1 
ATOM 1487 C CE2   . TYR C 3 67 ? -42.974 87.821  -19.591 1.00 55.91 ? 367 TYR A CE2   1 
ATOM 1488 C CZ    . TYR C 3 67 ? -42.436 86.719  -18.955 1.00 55.91 ? 367 TYR A CZ    1 
ATOM 1489 O OH    . TYR C 3 67 ? -43.281 85.706  -18.542 1.00 55.91 ? 367 TYR A OH    1 
ATOM 1490 N N     . VAL C 3 68 ? -37.939 92.172  -20.310 1.00 40.91 ? 368 VAL A N     1 
ATOM 1491 C CA    . VAL C 3 68 ? -37.410 93.380  -20.920 1.00 40.91 ? 368 VAL A CA    1 
ATOM 1492 C C     . VAL C 3 68 ? -35.885 93.462  -20.896 1.00 40.91 ? 368 VAL A C     1 
ATOM 1493 O O     . VAL C 3 68 ? -35.293 94.142  -21.730 1.00 40.91 ? 368 VAL A O     1 
ATOM 1494 C CB    . VAL C 3 68 ? -38.000 94.629  -20.249 1.00 39.51 ? 368 VAL A CB    1 
ATOM 1495 C CG1   . VAL C 3 68 ? -37.584 94.682  -18.789 1.00 39.51 ? 368 VAL A CG1   1 
ATOM 1496 C CG2   . VAL C 3 68 ? -37.566 95.874  -21.008 1.00 39.51 ? 368 VAL A CG2   1 
ATOM 1497 N N     . LYS C 3 69 ? -35.256 92.769  -19.945 1.00 22.35 ? 369 LYS A N     1 
ATOM 1498 C CA    . LYS C 3 69 ? -33.793 92.755  -19.823 1.00 22.35 ? 369 LYS A CA    1 
ATOM 1499 C C     . LYS C 3 69 ? -33.194 91.802  -20.878 1.00 22.35 ? 369 LYS A C     1 
ATOM 1500 O O     . LYS C 3 69 ? -31.989 91.549  -20.906 1.00 22.35 ? 369 LYS A O     1 
ATOM 1501 C CB    . LYS C 3 69 ? -33.382 92.336  -18.384 1.00 4.90  ? 369 LYS A CB    1 
ATOM 1502 N N     . ASN C 3 70 ? -34.068 91.282  -21.740 1.00 25.54 ? 370 ASN A N     1 
ATOM 1503 C CA    . ASN C 3 70 ? -33.700 90.386  -22.836 1.00 25.54 ? 370 ASN A CA    1 
ATOM 1504 C C     . ASN C 3 70 ? -32.841 89.198  -22.407 1.00 25.54 ? 370 ASN A C     1 
ATOM 1505 O O     . ASN C 3 70 ? -31.736 88.986  -22.908 1.00 25.54 ? 370 ASN A O     1 
ATOM 1506 C CB    . ASN C 3 70 ? -32.980 91.186  -23.932 1.00 69.69 ? 370 ASN A CB    1 
ATOM 1507 C CG    . ASN C 3 70 ? -33.214 90.620  -25.325 1.00 69.69 ? 370 ASN A CG    1 
ATOM 1508 O OD1   . ASN C 3 70 ? -34.357 90.448  -25.755 1.00 69.69 ? 370 ASN A OD1   1 
ATOM 1509 N ND2   . ASN C 3 70 ? -32.130 90.342  -26.040 1.00 69.69 ? 370 ASN A ND2   1 
ATOM 1510 N N     . ILE C 3 71 ? -33.366 88.414  -21.479 1.00 45.59 ? 371 ILE A N     1 
ATOM 1511 C CA    . ILE C 3 71 ? -32.662 87.246  -20.992 1.00 45.59 ? 371 ILE A CA    1 
ATOM 1512 C C     . ILE C 3 71 ? -33.571 86.042  -21.070 1.00 45.59 ? 371 ILE A C     1 
ATOM 1513 O O     . ILE C 3 71 ? -33.208 85.020  -21.637 1.00 45.59 ? 371 ILE A O     1 
ATOM 1514 C CB    . ILE C 3 71 ? -32.218 87.436  -19.539 1.00 21.81 ? 371 ILE A CB    1 
ATOM 1515 C CG1   . ILE C 3 71 ? -31.024 88.395  -19.490 1.00 21.81 ? 371 ILE A CG1   1 
ATOM 1516 C CG2   . ILE C 3 71 ? -31.905 86.093  -18.911 1.00 21.81 ? 371 ILE A CG2   1 
ATOM 1517 C CD1   . ILE C 3 71 ? -30.488 88.658  -18.086 1.00 21.81 ? 371 ILE A CD1   1 
ATOM 1518 N N     . ILE C 3 72 ? -34.759 86.171  -20.501 1.00 44.74 ? 372 ILE A N     1 
ATOM 1519 C CA    . ILE C 3 72 ? -35.716 85.080  -20.502 1.00 44.74 ? 372 ILE A CA    1 
ATOM 1520 C C     . ILE C 3 72 ? -37.107 85.548  -20.908 1.00 44.74 ? 372 ILE A C     1 
ATOM 1521 O O     . ILE C 3 72 ? -37.690 86.432  -20.282 1.00 44.74 ? 372 ILE A O     1 
ATOM 1522 C CB    . ILE C 3 72 ? -35.762 84.416  -19.108 1.00 4.90  ? 372 ILE A CB    1 
ATOM 1523 C CG1   . ILE C 3 72 ? -34.444 83.668  -18.874 1.00 4.90  ? 372 ILE A CG1   1 
ATOM 1524 C CG2   . ILE C 3 72 ? -36.973 83.484  -18.990 1.00 4.90  ? 372 ILE A CG2   1 
ATOM 1525 C CD1   . ILE C 3 72 ? -34.158 83.355  -17.431 1.00 4.90  ? 372 ILE A CD1   1 
ATOM 1526 N N     . LYS C 3 73 ? -37.634 84.964  -21.975 1.00 24.86 ? 373 LYS A N     1 
ATOM 1527 C CA    . LYS C 3 73 ? -38.954 85.335  -22.421 1.00 24.86 ? 373 LYS A CA    1 
ATOM 1528 C C     . LYS C 3 73 ? -39.908 84.166  -22.208 1.00 24.86 ? 373 LYS A C     1 
ATOM 1529 O O     . LYS C 3 73 ? -39.505 82.999  -22.141 1.00 24.86 ? 373 LYS A O     1 
ATOM 1530 C CB    . LYS C 3 73 ? -38.933 85.745  -23.896 1.00 81.20 ? 373 LYS A CB    1 
ATOM 1531 C CG    . LYS C 3 73 ? -39.780 86.982  -24.208 1.00 81.20 ? 373 LYS A CG    1 
ATOM 1532 C CD    . LYS C 3 73 ? -41.286 86.768  -23.990 1.00 81.20 ? 373 LYS A CD    1 
ATOM 1533 C CE    . LYS C 3 73 ? -41.925 85.988  -25.140 1.00 81.20 ? 373 LYS A CE    1 
ATOM 1534 N NZ    . LYS C 3 73 ? -43.418 85.953  -25.072 1.00 81.20 ? 373 LYS A NZ    1 
ATOM 1535 N N     . LYS C 3 74 ? -41.183 84.505  -22.076 1.00 38.33 ? 374 LYS A N     1 
ATOM 1536 C CA    . LYS C 3 74 ? -42.227 83.523  -21.891 1.00 38.33 ? 374 LYS A CA    1 
ATOM 1537 C C     . LYS C 3 74 ? -42.416 82.847  -23.245 1.00 38.33 ? 374 LYS A C     1 
ATOM 1538 O O     . LYS C 3 74 ? -41.685 83.115  -24.205 1.00 38.33 ? 374 LYS A O     1 
ATOM 1539 C CB    . LYS C 3 74 ? -43.517 84.232  -21.469 1.00 29.45 ? 374 LYS A CB    1 
ATOM 1540 C CG    . LYS C 3 74 ? -44.695 83.322  -21.165 1.00 29.45 ? 374 LYS A CG    1 
ATOM 1541 C CD    . LYS C 3 74 ? -44.513 82.581  -19.856 1.00 29.45 ? 374 LYS A CD    1 
ATOM 1542 C CE    . LYS C 3 74 ? -45.675 81.645  -19.597 1.00 29.45 ? 374 LYS A CE    1 
ATOM 1543 N NZ    . LYS C 3 74 ? -45.785 80.661  -20.703 1.00 29.45 ? 374 LYS A NZ    1 
ATOM 1544 N N     . VAL C 3 75 ? -43.389 81.949  -23.303 1.00 37.93 ? 375 VAL A N     1 
ATOM 1545 C CA    . VAL C 3 75 ? -43.728 81.244  -24.524 1.00 37.93 ? 375 VAL A CA    1 
ATOM 1546 C C     . VAL C 3 75 ? -45.232 81.271  -24.441 1.00 37.93 ? 375 VAL A C     1 
ATOM 1547 O O     . VAL C 3 75 ? -45.825 80.555  -23.647 1.00 37.93 ? 375 VAL A O     1 
ATOM 1548 C CB    . VAL C 3 75 ? -43.226 79.777  -24.522 1.00 29.70 ? 375 VAL A CB    1 
ATOM 1549 C CG1   . VAL C 3 75 ? -43.729 79.072  -25.748 1.00 29.70 ? 375 VAL A CG1   1 
ATOM 1550 C CG2   . VAL C 3 75 ? -41.700 79.727  -24.521 1.00 29.70 ? 375 VAL A CG2   1 
ATOM 1551 N N     . ASN C 3 76 ? -45.839 82.145  -25.229 1.00 52.32 ? 376 ASN A N     1 
ATOM 1552 C CA    . ASN C 3 76 ? -47.284 82.289  -25.233 1.00 52.32 ? 376 ASN A CA    1 
ATOM 1553 C C     . ASN C 3 76 ? -47.977 80.944  -25.374 1.00 52.32 ? 376 ASN A C     1 
ATOM 1554 O O     . ASN C 3 76 ? -47.579 80.113  -26.193 1.00 52.32 ? 376 ASN A O     1 
ATOM 1555 C CB    . ASN C 3 76 ? -47.693 83.225  -26.366 1.00 77.94 ? 376 ASN A CB    1 
ATOM 1556 C CG    . ASN C 3 76 ? -47.063 84.590  -26.229 1.00 77.94 ? 376 ASN A CG    1 
ATOM 1557 O OD1   . ASN C 3 76 ? -47.424 85.362  -25.342 1.00 77.94 ? 376 ASN A OD1   1 
ATOM 1558 N ND2   . ASN C 3 76 ? -46.096 84.889  -27.093 1.00 77.94 ? 376 ASN A ND2   1 
ATOM 1559 N N     . GLY C 3 77 ? -49.005 80.734  -24.555 1.00 45.27 ? 377 GLY A N     1 
ATOM 1560 C CA    . GLY C 3 77 ? -49.758 79.493  -24.601 1.00 45.27 ? 377 GLY A CA    1 
ATOM 1561 C C     . GLY C 3 77 ? -49.293 78.425  -23.627 1.00 45.27 ? 377 GLY A C     1 
ATOM 1562 O O     . GLY C 3 77 ? -50.023 78.043  -22.706 1.00 45.27 ? 377 GLY A O     1 
ATOM 1563 N N     . GLN C 3 78 ? -48.070 77.948  -23.833 1.00 33.19 ? 378 GLN A N     1 
ATOM 1564 C CA    . GLN C 3 78 ? -47.479 76.909  -23.003 1.00 33.19 ? 378 GLN A CA    1 
ATOM 1565 C C     . GLN C 3 78 ? -47.243 77.261  -21.527 1.00 33.19 ? 378 GLN A C     1 
ATOM 1566 O O     . GLN C 3 78 ? -46.325 78.012  -21.206 1.00 33.19 ? 378 GLN A O     1 
ATOM 1567 C CB    . GLN C 3 78 ? -46.164 76.464  -23.639 1.00 32.93 ? 378 GLN A CB    1 
ATOM 1568 C CG    . GLN C 3 78 ? -46.350 75.678  -24.920 1.00 32.93 ? 378 GLN A CG    1 
ATOM 1569 C CD    . GLN C 3 78 ? -45.078 74.978  -25.363 1.00 32.93 ? 378 GLN A CD    1 
ATOM 1570 O OE1   . GLN C 3 78 ? -44.344 74.405  -24.545 1.00 32.93 ? 378 GLN A OE1   1 
ATOM 1571 N NE2   . GLN C 3 78 ? -44.815 75.003  -26.669 1.00 32.93 ? 378 GLN A NE2   1 
ATOM 1572 N N     . LYS C 3 79 ? -48.055 76.696  -20.631 1.00 37.58 ? 379 LYS A N     1 
ATOM 1573 C CA    . LYS C 3 79 ? -47.921 76.945  -19.191 1.00 37.58 ? 379 LYS A CA    1 
ATOM 1574 C C     . LYS C 3 79 ? -46.540 76.578  -18.635 1.00 37.58 ? 379 LYS A C     1 
ATOM 1575 O O     . LYS C 3 79 ? -45.939 75.577  -19.027 1.00 37.58 ? 379 LYS A O     1 
ATOM 1576 C CB    . LYS C 3 79 ? -48.993 76.182  -18.423 1.00 4.90  ? 379 LYS A CB    1 
ATOM 1577 N N     . PHE C 3 80 ? -46.054 77.401  -17.713 1.00 30.67 ? 380 PHE A N     1 
ATOM 1578 C CA    . PHE C 3 80 ? -44.760 77.212  -17.061 1.00 30.67 ? 380 PHE A CA    1 
ATOM 1579 C C     . PHE C 3 80 ? -43.591 77.023  -18.012 1.00 30.67 ? 380 PHE A C     1 
ATOM 1580 O O     . PHE C 3 80 ? -42.535 76.539  -17.607 1.00 30.67 ? 380 PHE A O     1 
ATOM 1581 C CB    . PHE C 3 80 ? -44.808 76.025  -16.096 1.00 29.01 ? 380 PHE A CB    1 
ATOM 1582 C CG    . PHE C 3 80 ? -45.904 76.114  -15.076 1.00 29.01 ? 380 PHE A CG    1 
ATOM 1583 C CD1   . PHE C 3 80 ? -46.025 77.230  -14.259 1.00 29.01 ? 380 PHE A CD1   1 
ATOM 1584 C CD2   . PHE C 3 80 ? -46.824 75.079  -14.932 1.00 29.01 ? 380 PHE A CD2   1 
ATOM 1585 C CE1   . PHE C 3 80 ? -47.049 77.317  -13.308 1.00 29.01 ? 380 PHE A CE1   1 
ATOM 1586 C CE2   . PHE C 3 80 ? -47.850 75.158  -13.985 1.00 29.01 ? 380 PHE A CE2   1 
ATOM 1587 C CZ    . PHE C 3 80 ? -47.964 76.280  -13.171 1.00 29.01 ? 380 PHE A CZ    1 
ATOM 1588 N N     . VAL C 3 81 ? -43.763 77.403  -19.270 1.00 29.79 ? 381 VAL A N     1 
ATOM 1589 C CA    . VAL C 3 81 ? -42.680 77.263  -20.228 1.00 29.79 ? 381 VAL A CA    1 
ATOM 1590 C C     . VAL C 3 81 ? -42.049 78.623  -20.553 1.00 29.79 ? 381 VAL A C     1 
ATOM 1591 O O     . VAL C 3 81 ? -42.744 79.578  -20.934 1.00 29.79 ? 381 VAL A O     1 
ATOM 1592 C CB    . VAL C 3 81 ? -43.179 76.624  -21.525 1.00 38.31 ? 381 VAL A CB    1 
ATOM 1593 C CG1   . VAL C 3 81 ? -41.995 76.205  -22.386 1.00 38.31 ? 381 VAL A CG1   1 
ATOM 1594 C CG2   . VAL C 3 81 ? -44.065 75.440  -21.203 1.00 38.31 ? 381 VAL A CG2   1 
ATOM 1595 N N     . TYR C 3 82 ? -40.731 78.702  -20.392 1.00 36.71 ? 382 TYR A N     1 
ATOM 1596 C CA    . TYR C 3 82 ? -39.973 79.918  -20.669 1.00 36.71 ? 382 TYR A CA    1 
ATOM 1597 C C     . TYR C 3 82 ? -38.816 79.557  -21.575 1.00 36.71 ? 382 TYR A C     1 
ATOM 1598 O O     . TYR C 3 82 ? -38.711 78.422  -22.031 1.00 36.71 ? 382 TYR A O     1 
ATOM 1599 C CB    . TYR C 3 82 ? -39.430 80.504  -19.376 1.00 25.08 ? 382 TYR A CB    1 
ATOM 1600 C CG    . TYR C 3 82 ? -40.504 80.994  -18.441 1.00 25.08 ? 382 TYR A CG    1 
ATOM 1601 C CD1   . TYR C 3 82 ? -41.189 82.172  -18.693 1.00 25.08 ? 382 TYR A CD1   1 
ATOM 1602 C CD2   . TYR C 3 82 ? -40.825 80.291  -17.294 1.00 25.08 ? 382 TYR A CD2   1 
ATOM 1603 C CE1   . TYR C 3 82 ? -42.160 82.634  -17.816 1.00 25.08 ? 382 TYR A CE1   1 
ATOM 1604 C CE2   . TYR C 3 82 ? -41.795 80.745  -16.419 1.00 25.08 ? 382 TYR A CE2   1 
ATOM 1605 C CZ    . TYR C 3 82 ? -42.452 81.913  -16.687 1.00 25.08 ? 382 TYR A CZ    1 
ATOM 1606 O OH    . TYR C 3 82 ? -43.399 82.365  -15.817 1.00 25.08 ? 382 TYR A OH    1 
ATOM 1607 N N     . LYS C 3 83 ? -37.936 80.513  -21.834 1.00 36.38 ? 383 LYS A N     1 
ATOM 1608 C CA    . LYS C 3 83 ? -36.798 80.244  -22.702 1.00 36.38 ? 383 LYS A CA    1 
ATOM 1609 C C     . LYS C 3 83 ? -35.738 81.316  -22.603 1.00 36.38 ? 383 LYS A C     1 
ATOM 1610 O O     . LYS C 3 83 ? -36.044 82.487  -22.419 1.00 36.38 ? 383 LYS A O     1 
ATOM 1611 C CB    . LYS C 3 83 ? -37.239 80.156  -24.165 1.00 30.59 ? 383 LYS A CB    1 
ATOM 1612 C CG    . LYS C 3 83 ? -37.780 81.467  -24.712 1.00 30.59 ? 383 LYS A CG    1 
ATOM 1613 C CD    . LYS C 3 83 ? -37.966 81.429  -26.215 1.00 30.59 ? 383 LYS A CD    1 
ATOM 1614 C CE    . LYS C 3 83 ? -36.627 81.332  -26.959 1.00 30.59 ? 383 LYS A CE    1 
ATOM 1615 N NZ    . LYS C 3 83 ? -35.907 80.039  -26.757 1.00 30.59 ? 383 LYS A NZ    1 
ATOM 1616 N N     . PHE C 3 84 ? -34.488 80.904  -22.713 1.00 31.03 ? 384 PHE A N     1 
ATOM 1617 C CA    . PHE C 3 84 ? -33.408 81.849  -22.696 1.00 31.03 ? 384 PHE A CA    1 
ATOM 1618 C C     . PHE C 3 84 ? -33.342 82.327  -24.145 1.00 31.03 ? 384 PHE A C     1 
ATOM 1619 O O     . PHE C 3 84 ? -33.545 81.532  -25.068 1.00 31.03 ? 384 PHE A O     1 
ATOM 1620 C CB    . PHE C 3 84 ? -32.126 81.155  -22.288 1.00 27.12 ? 384 PHE A CB    1 
ATOM 1621 C CG    . PHE C 3 84 ? -32.189 80.542  -20.929 1.00 27.12 ? 384 PHE A CG    1 
ATOM 1622 C CD1   . PHE C 3 84 ? -32.823 79.328  -20.729 1.00 27.12 ? 384 PHE A CD1   1 
ATOM 1623 C CD2   . PHE C 3 84 ? -31.588 81.175  -19.843 1.00 27.12 ? 384 PHE A CD2   1 
ATOM 1624 C CE1   . PHE C 3 84 ? -32.850 78.754  -19.469 1.00 27.12 ? 384 PHE A CE1   1 
ATOM 1625 C CE2   . PHE C 3 84 ? -31.610 80.609  -18.576 1.00 27.12 ? 384 PHE A CE2   1 
ATOM 1626 C CZ    . PHE C 3 84 ? -32.238 79.399  -18.388 1.00 27.12 ? 384 PHE A CZ    1 
ATOM 1627 N N     . VAL C 3 85 ? -33.081 83.617  -24.350 1.00 51.96 ? 385 VAL A N     1 
ATOM 1628 C CA    . VAL C 3 85 ? -33.035 84.171  -25.700 1.00 51.96 ? 385 VAL A CA    1 
ATOM 1629 C C     . VAL C 3 85 ? -31.654 84.152  -26.321 1.00 51.96 ? 385 VAL A C     1 
ATOM 1630 O O     . VAL C 3 85 ? -31.515 84.258  -27.537 1.00 51.96 ? 385 VAL A O     1 
ATOM 1631 C CB    . VAL C 3 85 ? -33.591 85.631  -25.746 1.00 29.94 ? 385 VAL A CB    1 
ATOM 1632 C CG1   . VAL C 3 85 ? -35.119 85.606  -25.832 1.00 29.94 ? 385 VAL A CG1   1 
ATOM 1633 C CG2   . VAL C 3 85 ? -33.150 86.415  -24.511 1.00 29.94 ? 385 VAL A CG2   1 
ATOM 1634 N N     . SER C 3 86 ? -30.630 84.013  -25.493 1.00 32.30 ? 386 SER A N     1 
ATOM 1635 C CA    . SER C 3 86 ? -29.265 83.980  -26.011 1.00 32.30 ? 386 SER A CA    1 
ATOM 1636 C C     . SER C 3 86 ? -28.652 82.626  -25.699 1.00 32.30 ? 386 SER A C     1 
ATOM 1637 O O     . SER C 3 86 ? -27.530 82.533  -25.188 1.00 32.30 ? 386 SER A O     1 
ATOM 1638 C CB    . SER C 3 86 ? -28.419 85.103  -25.390 1.00 54.34 ? 386 SER A CB    1 
ATOM 1639 N N     . TYR C 3 87 ? -29.409 81.579  -26.008 1.00 41.82 ? 387 TYR A N     1 
ATOM 1640 C CA    . TYR C 3 87 ? -28.964 80.220  -25.771 1.00 41.82 ? 387 TYR A CA    1 
ATOM 1641 C C     . TYR C 3 87 ? -28.531 79.598  -27.100 1.00 41.82 ? 387 TYR A C     1 
ATOM 1642 O O     . TYR C 3 87 ? -29.129 79.865  -28.148 1.00 41.82 ? 387 TYR A O     1 
ATOM 1643 C CB    . TYR C 3 87 ? -30.113 79.415  -25.144 1.00 63.33 ? 387 TYR A CB    1 
ATOM 1644 C CG    . TYR C 3 87 ? -29.742 78.025  -24.681 1.00 63.33 ? 387 TYR A CG    1 
ATOM 1645 C CD1   . TYR C 3 87 ? -29.443 77.021  -25.597 1.00 63.33 ? 387 TYR A CD1   1 
ATOM 1646 C CD2   . TYR C 3 87 ? -29.702 77.714  -23.324 1.00 63.33 ? 387 TYR A CD2   1 
ATOM 1647 C CE1   . TYR C 3 87 ? -29.115 75.743  -25.174 1.00 63.33 ? 387 TYR A CE1   1 
ATOM 1648 C CE2   . TYR C 3 87 ? -29.377 76.439  -22.888 1.00 63.33 ? 387 TYR A CE2   1 
ATOM 1649 C CZ    . TYR C 3 87 ? -29.086 75.455  -23.817 1.00 63.33 ? 387 TYR A CZ    1 
ATOM 1650 O OH    . TYR C 3 87 ? -28.784 74.176  -23.394 1.00 63.33 ? 387 TYR A OH    1 
ATOM 1651 N N     . PRO C 3 88 ? -27.463 78.784  -27.078 1.00 48.91 ? 388 PRO A N     1 
ATOM 1652 C CA    . PRO C 3 88 ? -26.666 78.412  -25.905 1.00 48.91 ? 388 PRO A CA    1 
ATOM 1653 C C     . PRO C 3 88 ? -25.542 79.402  -25.630 1.00 48.91 ? 388 PRO A C     1 
ATOM 1654 O O     . PRO C 3 88 ? -24.496 79.029  -25.088 1.00 48.91 ? 388 PRO A O     1 
ATOM 1655 C CB    . PRO C 3 88 ? -26.123 77.053  -26.284 1.00 60.17 ? 388 PRO A CB    1 
ATOM 1656 C CG    . PRO C 3 88 ? -25.825 77.254  -27.736 1.00 60.17 ? 388 PRO A CG    1 
ATOM 1657 C CD    . PRO C 3 88 ? -27.088 77.949  -28.234 1.00 60.17 ? 388 PRO A CD    1 
ATOM 1658 N N     . GLU C 3 89 ? -25.749 80.658  -26.010 1.00 52.11 ? 389 GLU A N     1 
ATOM 1659 C CA    . GLU C 3 89 ? -24.734 81.673  -25.783 1.00 52.11 ? 389 GLU A CA    1 
ATOM 1660 C C     . GLU C 3 89 ? -24.519 81.901  -24.291 1.00 52.11 ? 389 GLU A C     1 
ATOM 1661 O O     . GLU C 3 89 ? -23.386 81.872  -23.820 1.00 52.11 ? 389 GLU A O     1 
ATOM 1662 C CB    . GLU C 3 89 ? -25.114 82.989  -26.478 1.00 82.23 ? 389 GLU A CB    1 
ATOM 1663 C CG    . GLU C 3 89 ? -24.973 82.958  -28.008 1.00 82.23 ? 389 GLU A CG    1 
ATOM 1664 C CD    . GLU C 3 89 ? -26.300 82.818  -28.742 1.00 82.23 ? 389 GLU A CD    1 
ATOM 1665 O OE1   . GLU C 3 89 ? -27.062 83.808  -28.767 1.00 82.23 ? 389 GLU A OE1   1 
ATOM 1666 O OE2   . GLU C 3 89 ? -26.584 81.726  -29.288 1.00 82.23 ? 389 GLU A OE2   1 
ATOM 1667 N N     . ILE C 3 90 ? -25.607 82.095  -23.548 1.00 65.50 ? 390 ILE A N     1 
ATOM 1668 C CA    . ILE C 3 90 ? -25.533 82.345  -22.106 1.00 65.50 ? 390 ILE A CA    1 
ATOM 1669 C C     . ILE C 3 90 ? -24.465 81.538  -21.376 1.00 65.50 ? 390 ILE A C     1 
ATOM 1670 O O     . ILE C 3 90 ? -23.751 82.080  -20.524 1.00 65.50 ? 390 ILE A O     1 
ATOM 1671 C CB    . ILE C 3 90 ? -26.876 82.066  -21.399 1.00 48.08 ? 390 ILE A CB    1 
ATOM 1672 C CG1   . ILE C 3 90 ? -27.320 80.640  -21.703 1.00 48.08 ? 390 ILE A CG1   1 
ATOM 1673 C CG2   . ILE C 3 90 ? -27.924 83.085  -21.827 1.00 48.08 ? 390 ILE A CG2   1 
ATOM 1674 C CD1   . ILE C 3 90 ? -28.599 80.239  -21.019 1.00 48.08 ? 390 ILE A CD1   1 
ATOM 1675 N N     . LEU C 3 91 ? -24.354 80.251  -21.703 1.00 77.01 ? 391 LEU A N     1 
ATOM 1676 C CA    . LEU C 3 91 ? -23.378 79.373  -21.052 1.00 77.01 ? 391 LEU A CA    1 
ATOM 1677 C C     . LEU C 3 91 ? -21.955 79.942  -21.017 1.00 77.01 ? 391 LEU A C     1 
ATOM 1678 O O     . LEU C 3 91 ? -21.429 80.156  -19.899 1.00 77.01 ? 391 LEU A O     1 
ATOM 1679 C CB    . LEU C 3 91 ? -23.367 78.007  -21.738 1.00 74.28 ? 391 LEU A CB    1 
ATOM 1680 C CG    . LEU C 3 91 ? -24.671 77.213  -21.684 1.00 74.28 ? 391 LEU A CG    1 
ATOM 1681 C CD1   . LEU C 3 91 ? -24.528 75.954  -22.519 1.00 74.28 ? 391 LEU A CD1   1 
ATOM 1682 C CD2   . LEU C 3 91 ? -25.010 76.862  -20.247 1.00 74.28 ? 391 LEU A CD2   1 
ATOM 1683 N N     . GLY D 4 5  ? -15.979 86.392  -4.237  1.00 82.90 ? 137 GLY B N     1 
ATOM 1684 C CA    . GLY D 4 5  ? -15.714 87.626  -3.433  1.00 82.90 ? 137 GLY B CA    1 
ATOM 1685 C C     . GLY D 4 5  ? -16.881 87.976  -2.531  1.00 82.90 ? 137 GLY B C     1 
ATOM 1686 O O     . GLY D 4 5  ? -17.307 87.157  -1.711  1.00 82.90 ? 137 GLY B O     1 
ATOM 1687 N N     . LYS D 4 6  ? -17.399 89.194  -2.674  1.00 66.98 ? 138 LYS B N     1 
ATOM 1688 C CA    . LYS D 4 6  ? -18.537 89.636  -1.871  1.00 66.98 ? 138 LYS B CA    1 
ATOM 1689 C C     . LYS D 4 6  ? -19.831 89.175  -2.558  1.00 66.98 ? 138 LYS B C     1 
ATOM 1690 O O     . LYS D 4 6  ? -19.812 88.752  -3.718  1.00 66.98 ? 138 LYS B O     1 
ATOM 1691 C CB    . LYS D 4 6  ? -18.511 91.164  -1.709  1.00 38.65 ? 138 LYS B CB    1 
ATOM 1692 N N     . LYS D 4 7  ? -20.952 89.253  -1.847  1.00 51.60 ? 139 LYS B N     1 
ATOM 1693 C CA    . LYS D 4 7  ? -22.226 88.805  -2.404  1.00 51.60 ? 139 LYS B CA    1 
ATOM 1694 C C     . LYS D 4 7  ? -22.759 89.697  -3.517  1.00 51.60 ? 139 LYS B C     1 
ATOM 1695 O O     . LYS D 4 7  ? -23.357 89.205  -4.477  1.00 51.60 ? 139 LYS B O     1 
ATOM 1696 C CB    . LYS D 4 7  ? -23.266 88.675  -1.298  1.00 8.20  ? 139 LYS B CB    1 
ATOM 1697 N N     . THR D 4 8  ? -22.552 91.005  -3.389  1.00 61.37 ? 140 THR B N     1 
ATOM 1698 C CA    . THR D 4 8  ? -23.016 91.956  -4.399  1.00 61.37 ? 140 THR B CA    1 
ATOM 1699 C C     . THR D 4 8  ? -21.930 92.964  -4.684  1.00 61.37 ? 140 THR B C     1 
ATOM 1700 O O     . THR D 4 8  ? -20.957 93.079  -3.945  1.00 61.37 ? 140 THR B O     1 
ATOM 1701 C CB    . THR D 4 8  ? -24.223 92.767  -3.927  1.00 40.12 ? 140 THR B CB    1 
ATOM 1702 O OG1   . THR D 4 8  ? -23.779 93.789  -3.029  1.00 40.12 ? 140 THR B OG1   1 
ATOM 1703 C CG2   . THR D 4 8  ? -25.216 91.880  -3.213  1.00 40.12 ? 140 THR B CG2   1 
ATOM 1704 N N     . ARG D 4 9  ? -22.102 93.714  -5.757  1.00 38.05 ? 141 ARG B N     1 
ATOM 1705 C CA    . ARG D 4 9  ? -21.116 94.721  -6.084  1.00 38.05 ? 141 ARG B CA    1 
ATOM 1706 C C     . ARG D 4 9  ? -21.218 95.874  -5.106  1.00 38.05 ? 141 ARG B C     1 
ATOM 1707 O O     . ARG D 4 9  ? -20.307 96.686  -5.013  1.00 38.05 ? 141 ARG B O     1 
ATOM 1708 C CB    . ARG D 4 9  ? -21.332 95.236  -7.498  1.00 33.28 ? 141 ARG B CB    1 
ATOM 1709 C CG    . ARG D 4 9  ? -21.073 94.192  -8.539  1.00 33.28 ? 141 ARG B CG    1 
ATOM 1710 C CD    . ARG D 4 9  ? -20.669 94.854  -9.821  1.00 33.28 ? 141 ARG B CD    1 
ATOM 1711 N NE    . ARG D 4 9  ? -21.799 95.433  -10.536 1.00 33.28 ? 141 ARG B NE    1 
ATOM 1712 C CZ    . ARG D 4 9  ? -21.725 96.552  -11.249 1.00 33.28 ? 141 ARG B CZ    1 
ATOM 1713 N NH1   . ARG D 4 9  ? -20.575 97.222  -11.328 1.00 33.28 ? 141 ARG B NH1   1 
ATOM 1714 N NH2   . ARG D 4 9  ? -22.787 96.985  -11.914 1.00 33.28 ? 141 ARG B NH2   1 
ATOM 1715 N N     . GLY D 4 10 ? -22.320 95.928  -4.364  1.00 44.23 ? 142 GLY B N     1 
ATOM 1716 C CA    . GLY D 4 10 ? -22.522 97.017  -3.426  1.00 44.23 ? 142 GLY B CA    1 
ATOM 1717 C C     . GLY D 4 10 ? -23.017 98.213  -4.220  1.00 44.23 ? 142 GLY B C     1 
ATOM 1718 O O     . GLY D 4 10 ? -23.398 98.045  -5.386  1.00 44.23 ? 142 GLY B O     1 
ATOM 1719 N N     . ARG D 4 11 ? -23.016 99.407  -3.624  1.00 28.25 ? 143 ARG B N     1 
ATOM 1720 C CA    . ARG D 4 11 ? -23.480 100.599 -4.341  1.00 28.25 ? 143 ARG B CA    1 
ATOM 1721 C C     . ARG D 4 11 ? -22.463 101.039 -5.396  1.00 28.25 ? 143 ARG B C     1 
ATOM 1722 O O     . ARG D 4 11 ? -21.312 101.300 -5.063  1.00 28.25 ? 143 ARG B O     1 
ATOM 1723 C CB    . ARG D 4 11 ? -23.733 101.743 -3.359  1.00 21.96 ? 143 ARG B CB    1 
ATOM 1724 C CG    . ARG D 4 11 ? -24.167 103.030 -4.048  1.00 21.96 ? 143 ARG B CG    1 
ATOM 1725 C CD    . ARG D 4 11 ? -24.436 104.174 -3.069  1.00 21.96 ? 143 ARG B CD    1 
ATOM 1726 N NE    . ARG D 4 11 ? -24.627 105.433 -3.793  1.00 21.96 ? 143 ARG B NE    1 
ATOM 1727 C CZ    . ARG D 4 11 ? -25.020 106.575 -3.234  1.00 21.96 ? 143 ARG B CZ    1 
ATOM 1728 N NH1   . ARG D 4 11 ? -25.270 106.631 -1.933  1.00 21.96 ? 143 ARG B NH1   1 
ATOM 1729 N NH2   . ARG D 4 11 ? -25.159 107.666 -3.975  1.00 21.96 ? 143 ARG B NH2   1 
ATOM 1730 N N     . VAL D 4 12 ? -22.867 101.135 -6.662  1.00 16.31 ? 144 VAL B N     1 
ATOM 1731 C CA    . VAL D 4 12 ? -21.909 101.530 -7.698  1.00 16.31 ? 144 VAL B CA    1 
ATOM 1732 C C     . VAL D 4 12 ? -22.115 102.915 -8.298  1.00 16.31 ? 144 VAL B C     1 
ATOM 1733 O O     . VAL D 4 12 ? -23.218 103.265 -8.745  1.00 16.31 ? 144 VAL B O     1 
ATOM 1734 C CB    . VAL D 4 12 ? -21.882 100.531 -8.855  1.00 41.44 ? 144 VAL B CB    1 
ATOM 1735 C CG1   . VAL D 4 12 ? -21.528 99.150  -8.337  1.00 41.44 ? 144 VAL B CG1   1 
ATOM 1736 C CG2   . VAL D 4 12 ? -23.223 100.529 -9.568  1.00 41.44 ? 144 VAL B CG2   1 
ATOM 1737 N N     . LYS D 4 13 ? -21.027 103.686 -8.319  1.00 35.65 ? 145 LYS B N     1 
ATOM 1738 C CA    . LYS D 4 13 ? -21.001 105.053 -8.843  1.00 35.65 ? 145 LYS B CA    1 
ATOM 1739 C C     . LYS D 4 13 ? -21.475 105.167 -10.297 1.00 35.65 ? 145 LYS B C     1 
ATOM 1740 O O     . LYS D 4 13 ? -21.041 104.416 -11.179 1.00 35.65 ? 145 LYS B O     1 
ATOM 1741 C CB    . LYS D 4 13 ? -19.566 105.640 -8.695  1.00 20.84 ? 145 LYS B CB    1 
ATOM 1742 N N     . ILE D 4 14 ? -22.355 106.128 -10.550 1.00 48.78 ? 146 ILE B N     1 
ATOM 1743 C CA    . ILE D 4 14 ? -22.876 106.316 -11.897 1.00 48.78 ? 146 ILE B CA    1 
ATOM 1744 C C     . ILE D 4 14 ? -22.614 107.712 -12.495 1.00 48.78 ? 146 ILE B C     1 
ATOM 1745 O O     . ILE D 4 14 ? -22.452 108.706 -11.778 1.00 48.78 ? 146 ILE B O     1 
ATOM 1746 C CB    . ILE D 4 14 ? -24.415 105.985 -11.940 1.00 40.11 ? 146 ILE B CB    1 
ATOM 1747 C CG1   . ILE D 4 14 ? -24.892 105.932 -13.393 1.00 40.11 ? 146 ILE B CG1   1 
ATOM 1748 C CG2   . ILE D 4 14 ? -25.225 107.030 -11.167 1.00 40.11 ? 146 ILE B CG2   1 
ATOM 1749 C CD1   . ILE D 4 14 ? -24.048 105.017 -14.302 1.00 40.11 ? 146 ILE B CD1   1 
ATOM 1750 N N     . LYS D 4 15 ? -22.541 107.758 -13.823 1.00 64.23 ? 147 LYS B N     1 
ATOM 1751 C CA    . LYS D 4 15 ? -22.339 109.004 -14.541 1.00 64.23 ? 147 LYS B CA    1 
ATOM 1752 C C     . LYS D 4 15 ? -23.558 109.851 -14.174 1.00 64.23 ? 147 LYS B C     1 
ATOM 1753 O O     . LYS D 4 15 ? -24.654 109.324 -14.011 1.00 64.23 ? 147 LYS B O     1 
ATOM 1754 C CB    . LYS D 4 15 ? -22.289 108.741 -16.052 1.00 13.69 ? 147 LYS B CB    1 
ATOM 1755 N N     . MET D 4 16 ? -23.381 111.159 -14.052 1.00 42.96 ? 148 MET B N     1 
ATOM 1756 C CA    . MET D 4 16 ? -24.481 112.027 -13.652 1.00 42.96 ? 148 MET B CA    1 
ATOM 1757 C C     . MET D 4 16 ? -25.325 112.569 -14.797 1.00 42.96 ? 148 MET B C     1 
ATOM 1758 O O     . MET D 4 16 ? -25.913 113.639 -14.688 1.00 42.96 ? 148 MET B O     1 
ATOM 1759 C CB    . MET D 4 16 ? -23.917 113.178 -12.818 1.00 51.01 ? 148 MET B CB    1 
ATOM 1760 C CG    . MET D 4 16 ? -24.943 114.061 -12.138 1.00 51.01 ? 148 MET B CG    1 
ATOM 1761 S SD    . MET D 4 16 ? -26.035 113.214 -10.998 1.00 51.01 ? 148 MET B SD    1 
ATOM 1762 C CE    . MET D 4 16 ? -27.580 113.682 -11.730 1.00 51.01 ? 148 MET B CE    1 
ATOM 1763 N N     . GLU D 4 17 ? -25.394 111.822 -15.889 1.00 20.97 ? 149 GLU B N     1 
ATOM 1764 C CA    . GLU D 4 17 ? -26.180 112.230 -17.045 1.00 20.97 ? 149 GLU B CA    1 
ATOM 1765 C C     . GLU D 4 17 ? -27.525 111.499 -17.072 1.00 20.97 ? 149 GLU B C     1 
ATOM 1766 O O     . GLU D 4 17 ? -27.863 110.796 -16.124 1.00 20.97 ? 149 GLU B O     1 
ATOM 1767 C CB    . GLU D 4 17 ? -25.408 111.919 -18.322 1.00 82.90 ? 149 GLU B CB    1 
ATOM 1768 C CG    . GLU D 4 17 ? -25.089 110.448 -18.508 1.00 82.90 ? 149 GLU B CG    1 
ATOM 1769 C CD    . GLU D 4 17 ? -24.251 110.199 -19.738 1.00 82.90 ? 149 GLU B CD    1 
ATOM 1770 O OE1   . GLU D 4 17 ? -23.114 110.711 -19.787 1.00 82.90 ? 149 GLU B OE1   1 
ATOM 1771 O OE2   . GLU D 4 17 ? -24.731 109.504 -20.657 1.00 82.90 ? 149 GLU B OE2   1 
ATOM 1772 N N     . PHE D 4 18 ? -28.281 111.658 -18.162 1.00 53.10 ? 150 PHE B N     1 
ATOM 1773 C CA    . PHE D 4 18 ? -29.592 111.013 -18.310 1.00 53.10 ? 150 PHE B CA    1 
ATOM 1774 C C     . PHE D 4 18 ? -29.483 109.513 -18.478 1.00 53.10 ? 150 PHE B C     1 
ATOM 1775 O O     . PHE D 4 18 ? -28.616 109.025 -19.198 1.00 53.10 ? 150 PHE B O     1 
ATOM 1776 C CB    . PHE D 4 18 ? -30.337 111.570 -19.518 1.00 35.68 ? 150 PHE B CB    1 
ATOM 1777 C CG    . PHE D 4 18 ? -31.689 110.937 -19.750 1.00 35.68 ? 150 PHE B CG    1 
ATOM 1778 C CD1   . PHE D 4 18 ? -32.675 110.986 -18.768 1.00 35.68 ? 150 PHE B CD1   1 
ATOM 1779 C CD2   . PHE D 4 18 ? -31.990 110.328 -20.967 1.00 35.68 ? 150 PHE B CD2   1 
ATOM 1780 C CE1   . PHE D 4 18 ? -33.944 110.437 -19.001 1.00 35.68 ? 150 PHE B CE1   1 
ATOM 1781 C CE2   . PHE D 4 18 ? -33.258 109.778 -21.205 1.00 35.68 ? 150 PHE B CE2   1 
ATOM 1782 C CZ    . PHE D 4 18 ? -34.232 109.834 -20.223 1.00 35.68 ? 150 PHE B CZ    1 
ATOM 1783 N N     . ILE D 4 19 ? -30.385 108.785 -17.829 1.00 24.00 ? 151 ILE B N     1 
ATOM 1784 C CA    . ILE D 4 19 ? -30.383 107.328 -17.899 1.00 24.00 ? 151 ILE B CA    1 
ATOM 1785 C C     . ILE D 4 19 ? -31.203 106.845 -19.076 1.00 24.00 ? 151 ILE B C     1 
ATOM 1786 O O     . ILE D 4 19 ? -32.439 106.895 -19.049 1.00 24.00 ? 151 ILE B O     1 
ATOM 1787 C CB    . ILE D 4 19 ? -30.947 106.706 -16.611 1.00 33.78 ? 151 ILE B CB    1 
ATOM 1788 C CG1   . ILE D 4 19 ? -29.988 106.973 -15.451 1.00 33.78 ? 151 ILE B CG1   1 
ATOM 1789 C CG2   . ILE D 4 19 ? -31.143 105.212 -16.796 1.00 33.78 ? 151 ILE B CG2   1 
ATOM 1790 C CD1   . ILE D 4 19 ? -30.436 106.385 -14.149 1.00 33.78 ? 151 ILE B CD1   1 
ATOM 1791 N N     . ASP D 4 20 ? -30.509 106.366 -20.105 1.00 57.46 ? 152 ASP B N     1 
ATOM 1792 C CA    . ASP D 4 20 ? -31.177 105.892 -21.302 1.00 57.46 ? 152 ASP B CA    1 
ATOM 1793 C C     . ASP D 4 20 ? -32.027 104.642 -21.060 1.00 57.46 ? 152 ASP B C     1 
ATOM 1794 O O     . ASP D 4 20 ? -33.052 104.455 -21.721 1.00 57.46 ? 152 ASP B O     1 
ATOM 1795 C CB    . ASP D 4 20 ? -30.155 105.634 -22.407 1.00 58.13 ? 152 ASP B CB    1 
ATOM 1796 C CG    . ASP D 4 20 ? -30.813 105.358 -23.744 1.00 58.13 ? 152 ASP B CG    1 
ATOM 1797 O OD1   . ASP D 4 20 ? -31.619 106.203 -24.199 1.00 58.13 ? 152 ASP B OD1   1 
ATOM 1798 O OD2   . ASP D 4 20 ? -30.526 104.295 -24.337 1.00 58.13 ? 152 ASP B OD2   1 
ATOM 1799 N N     . ASN D 4 21 ? -31.615 103.796 -20.113 1.00 53.26 ? 153 ASN B N     1 
ATOM 1800 C CA    . ASN D 4 21 ? -32.375 102.581 -19.811 1.00 53.26 ? 153 ASN B CA    1 
ATOM 1801 C C     . ASN D 4 21 ? -33.667 102.863 -19.039 1.00 53.26 ? 153 ASN B C     1 
ATOM 1802 O O     . ASN D 4 21 ? -33.645 103.282 -17.876 1.00 53.26 ? 153 ASN B O     1 
ATOM 1803 C CB    . ASN D 4 21 ? -31.536 101.584 -19.009 1.00 78.05 ? 153 ASN B CB    1 
ATOM 1804 C CG    . ASN D 4 21 ? -32.295 100.295 -18.718 1.00 78.05 ? 153 ASN B CG    1 
ATOM 1805 O OD1   . ASN D 4 21 ? -31.837 99.450  -17.955 1.00 78.05 ? 153 ASN B OD1   1 
ATOM 1806 N ND2   . ASN D 4 21 ? -33.465 100.142 -19.336 1.00 78.05 ? 153 ASN B ND2   1 
ATOM 1807 N N     . LYS D 4 22 ? -34.791 102.600 -19.693 1.00 41.35 ? 154 LYS B N     1 
ATOM 1808 C CA    . LYS D 4 22 ? -36.095 102.829 -19.097 1.00 41.35 ? 154 LYS B CA    1 
ATOM 1809 C C     . LYS D 4 22 ? -36.292 102.096 -17.770 1.00 41.35 ? 154 LYS B C     1 
ATOM 1810 O O     . LYS D 4 22 ? -37.089 102.533 -16.938 1.00 41.35 ? 154 LYS B O     1 
ATOM 1811 C CB    . LYS D 4 22 ? -37.200 102.436 -20.088 1.00 52.41 ? 154 LYS B CB    1 
ATOM 1812 C CG    . LYS D 4 22 ? -38.625 102.567 -19.546 1.00 52.41 ? 154 LYS B CG    1 
ATOM 1813 C CD    . LYS D 4 22 ? -39.676 102.238 -20.616 1.00 52.41 ? 154 LYS B CD    1 
ATOM 1814 C CE    . LYS D 4 22 ? -41.107 102.382 -20.079 1.00 52.41 ? 154 LYS B CE    1 
ATOM 1815 N NZ    . LYS D 4 22 ? -42.166 102.089 -21.098 1.00 52.41 ? 154 LYS B NZ    1 
ATOM 1816 N N     . LEU D 4 23 ? -35.580 100.992 -17.547 1.00 17.08 ? 155 LEU B N     1 
ATOM 1817 C CA    . LEU D 4 23 ? -35.773 100.285 -16.278 1.00 17.08 ? 155 LEU B CA    1 
ATOM 1818 C C     . LEU D 4 23 ? -34.810 100.715 -15.190 1.00 17.08 ? 155 LEU B C     1 
ATOM 1819 O O     . LEU D 4 23 ? -35.210 100.885 -14.041 1.00 17.08 ? 155 LEU B O     1 
ATOM 1820 C CB    . LEU D 4 23 ? -35.697 98.764  -16.452 1.00 28.47 ? 155 LEU B CB    1 
ATOM 1821 C CG    . LEU D 4 23 ? -36.246 98.010  -15.225 1.00 28.47 ? 155 LEU B CG    1 
ATOM 1822 C CD1   . LEU D 4 23 ? -37.631 98.543  -14.865 1.00 28.47 ? 155 LEU B CD1   1 
ATOM 1823 C CD2   . LEU D 4 23 ? -36.326 96.524  -15.520 1.00 28.47 ? 155 LEU B CD2   1 
ATOM 1824 N N     . ARG D 4 24 ? -33.542 100.888 -15.542 1.00 35.30 ? 156 ARG B N     1 
ATOM 1825 C CA    . ARG D 4 24 ? -32.583 101.320 -14.546 1.00 35.30 ? 156 ARG B CA    1 
ATOM 1826 C C     . ARG D 4 24 ? -33.029 102.700 -14.099 1.00 35.30 ? 156 ARG B C     1 
ATOM 1827 O O     . ARG D 4 24 ? -32.978 103.033 -12.907 1.00 35.30 ? 156 ARG B O     1 
ATOM 1828 C CB    . ARG D 4 24 ? -31.180 101.371 -15.132 1.00 82.90 ? 156 ARG B CB    1 
ATOM 1829 C CG    . ARG D 4 24 ? -30.593 100.005 -15.387 1.00 82.90 ? 156 ARG B CG    1 
ATOM 1830 C CD    . ARG D 4 24 ? -29.132 100.118 -15.706 1.00 82.90 ? 156 ARG B CD    1 
ATOM 1831 N NE    . ARG D 4 24 ? -28.508 101.051 -14.783 1.00 82.90 ? 156 ARG B NE    1 
ATOM 1832 C CZ    . ARG D 4 24 ? -28.069 102.254 -15.127 1.00 82.90 ? 156 ARG B CZ    1 
ATOM 1833 N NH1   . ARG D 4 24 ? -28.176 102.676 -16.383 1.00 82.90 ? 156 ARG B NH1   1 
ATOM 1834 N NH2   . ARG D 4 24 ? -27.533 103.040 -14.205 1.00 82.90 ? 156 ARG B NH2   1 
ATOM 1835 N N     . ARG D 4 25 ? -33.492 103.496 -15.062 1.00 16.96 ? 157 ARG B N     1 
ATOM 1836 C CA    . ARG D 4 25 ? -33.966 104.840 -14.756 1.00 16.96 ? 157 ARG B CA    1 
ATOM 1837 C C     . ARG D 4 25 ? -35.158 104.753 -13.813 1.00 16.96 ? 157 ARG B C     1 
ATOM 1838 O O     . ARG D 4 25 ? -35.134 105.339 -12.732 1.00 16.96 ? 157 ARG B O     1 
ATOM 1839 C CB    . ARG D 4 25 ? -34.382 105.563 -16.033 1.00 26.72 ? 157 ARG B CB    1 
ATOM 1840 C CG    . ARG D 4 25 ? -34.852 107.002 -15.841 1.00 26.72 ? 157 ARG B CG    1 
ATOM 1841 C CD    . ARG D 4 25 ? -35.648 107.419 -17.068 1.00 26.72 ? 157 ARG B CD    1 
ATOM 1842 N NE    . ARG D 4 25 ? -35.042 106.868 -18.281 1.00 26.72 ? 157 ARG B NE    1 
ATOM 1843 C CZ    . ARG D 4 25 ? -35.713 106.573 -19.388 1.00 26.72 ? 157 ARG B CZ    1 
ATOM 1844 N NH1   . ARG D 4 25 ? -37.022 106.778 -19.447 1.00 26.72 ? 157 ARG B NH1   1 
ATOM 1845 N NH2   . ARG D 4 25 ? -35.078 106.052 -20.432 1.00 26.72 ? 157 ARG B NH2   1 
ATOM 1846 N N     . TYR D 4 26 ? -36.189 104.011 -14.221 1.00 17.05 ? 158 TYR B N     1 
ATOM 1847 C CA    . TYR D 4 26 ? -37.395 103.866 -13.409 1.00 17.05 ? 158 TYR B CA    1 
ATOM 1848 C C     . TYR D 4 26 ? -37.107 103.397 -11.991 1.00 17.05 ? 158 TYR B C     1 
ATOM 1849 O O     . TYR D 4 26 ? -37.688 103.894 -11.024 1.00 17.05 ? 158 TYR B O     1 
ATOM 1850 C CB    . TYR D 4 26 ? -38.381 102.905 -14.076 1.00 82.90 ? 158 TYR B CB    1 
ATOM 1851 C CG    . TYR D 4 26 ? -39.357 103.591 -15.010 1.00 82.90 ? 158 TYR B CG    1 
ATOM 1852 C CD1   . TYR D 4 26 ? -38.905 104.395 -16.063 1.00 82.90 ? 158 TYR B CD1   1 
ATOM 1853 C CD2   . TYR D 4 26 ? -40.736 103.439 -14.846 1.00 82.90 ? 158 TYR B CD2   1 
ATOM 1854 C CE1   . TYR D 4 26 ? -39.802 105.031 -16.932 1.00 82.90 ? 158 TYR B CE1   1 
ATOM 1855 C CE2   . TYR D 4 26 ? -41.642 104.074 -15.713 1.00 82.90 ? 158 TYR B CE2   1 
ATOM 1856 C CZ    . TYR D 4 26 ? -41.165 104.868 -16.753 1.00 82.90 ? 158 TYR B CZ    1 
ATOM 1857 O OH    . TYR D 4 26 ? -42.040 105.502 -17.609 1.00 82.90 ? 158 TYR B OH    1 
ATOM 1858 N N     . THR D 4 27 ? -36.210 102.430 -11.869 1.00 23.06 ? 159 THR B N     1 
ATOM 1859 C CA    . THR D 4 27 ? -35.850 101.916 -10.558 1.00 23.06 ? 159 THR B CA    1 
ATOM 1860 C C     . THR D 4 27 ? -35.204 103.040 -9.750  1.00 23.06 ? 159 THR B C     1 
ATOM 1861 O O     . THR D 4 27 ? -35.605 103.321 -8.616  1.00 23.06 ? 159 THR B O     1 
ATOM 1862 C CB    . THR D 4 27 ? -34.853 100.752 -10.681 1.00 64.21 ? 159 THR B CB    1 
ATOM 1863 O OG1   . THR D 4 27 ? -33.763 101.153 -11.522 1.00 64.21 ? 159 THR B OG1   1 
ATOM 1864 C CG2   . THR D 4 27 ? -35.530 99.518  -11.266 1.00 64.21 ? 159 THR B CG2   1 
ATOM 1865 N N     . THR D 4 28 ? -34.212 103.686 -10.357 1.00 38.92 ? 160 THR B N     1 
ATOM 1866 C CA    . THR D 4 28 ? -33.488 104.778 -9.714  1.00 38.92 ? 160 THR B CA    1 
ATOM 1867 C C     . THR D 4 28 ? -34.386 105.932 -9.289  1.00 38.92 ? 160 THR B C     1 
ATOM 1868 O O     . THR D 4 28 ? -34.151 106.569 -8.261  1.00 38.92 ? 160 THR B O     1 
ATOM 1869 C CB    . THR D 4 28 ? -32.398 105.328 -10.634 1.00 42.27 ? 160 THR B CB    1 
ATOM 1870 O OG1   . THR D 4 28 ? -31.486 104.273 -10.971 1.00 42.27 ? 160 THR B OG1   1 
ATOM 1871 C CG2   . THR D 4 28 ? -31.639 106.440 -9.940  1.00 42.27 ? 160 THR B CG2   1 
ATOM 1872 N N     . PHE D 4 29 ? -35.411 106.204 -10.088 1.00 9.63  ? 161 PHE B N     1 
ATOM 1873 C CA    . PHE D 4 29 ? -36.328 107.273 -9.773  1.00 9.63  ? 161 PHE B CA    1 
ATOM 1874 C C     . PHE D 4 29 ? -37.019 106.994 -8.451  1.00 9.63  ? 161 PHE B C     1 
ATOM 1875 O O     . PHE D 4 29 ? -37.218 107.892 -7.650  1.00 9.63  ? 161 PHE B O     1 
ATOM 1876 C CB    . PHE D 4 29 ? -37.372 107.421 -10.872 1.00 7.27  ? 161 PHE B CB    1 
ATOM 1877 C CG    . PHE D 4 29 ? -38.506 108.322 -10.491 1.00 7.27  ? 161 PHE B CG    1 
ATOM 1878 C CD1   . PHE D 4 29 ? -39.513 107.874 -9.638  1.00 7.27  ? 161 PHE B CD1   1 
ATOM 1879 C CD2   . PHE D 4 29 ? -38.536 109.640 -10.927 1.00 7.27  ? 161 PHE B CD2   1 
ATOM 1880 C CE1   . PHE D 4 29 ? -40.532 108.724 -9.216  1.00 7.27  ? 161 PHE B CE1   1 
ATOM 1881 C CE2   . PHE D 4 29 ? -39.551 110.505 -10.512 1.00 7.27  ? 161 PHE B CE2   1 
ATOM 1882 C CZ    . PHE D 4 29 ? -40.555 110.046 -9.652  1.00 7.27  ? 161 PHE B CZ    1 
ATOM 1883 N N     . SER D 4 30 ? -37.400 105.746 -8.223  1.00 28.86 ? 162 SER B N     1 
ATOM 1884 C CA    . SER D 4 30 ? -38.085 105.404 -6.992  1.00 28.86 ? 162 SER B CA    1 
ATOM 1885 C C     . SER D 4 30 ? -37.132 105.546 -5.816  1.00 28.86 ? 162 SER B C     1 
ATOM 1886 O O     . SER D 4 30 ? -37.397 106.295 -4.863  1.00 28.86 ? 162 SER B O     1 
ATOM 1887 C CB    . SER D 4 30 ? -38.612 103.976 -7.077  1.00 41.03 ? 162 SER B CB    1 
ATOM 1888 O OG    . SER D 4 30 ? -39.346 103.790 -8.277  1.00 41.03 ? 162 SER B OG    1 
ATOM 1889 N N     . LYS D 4 31 ? -36.016 104.826 -5.901  1.00 27.26 ? 163 LYS B N     1 
ATOM 1890 C CA    . LYS D 4 31 ? -34.987 104.836 -4.862  1.00 27.26 ? 163 LYS B CA    1 
ATOM 1891 C C     . LYS D 4 31 ? -34.676 106.252 -4.382  1.00 27.26 ? 163 LYS B C     1 
ATOM 1892 O O     . LYS D 4 31 ? -34.616 106.510 -3.184  1.00 27.26 ? 163 LYS B O     1 
ATOM 1893 C CB    . LYS D 4 31 ? -33.687 104.181 -5.378  1.00 24.92 ? 163 LYS B CB    1 
ATOM 1894 C CG    . LYS D 4 31 ? -33.653 102.634 -5.405  1.00 24.92 ? 163 LYS B CG    1 
ATOM 1895 C CD    . LYS D 4 31 ? -34.088 102.014 -4.065  1.00 24.92 ? 163 LYS B CD    1 
ATOM 1896 C CE    . LYS D 4 31 ? -33.576 100.592 -3.875  1.00 24.92 ? 163 LYS B CE    1 
ATOM 1897 N NZ    . LYS D 4 31 ? -32.187 100.595 -3.322  1.00 24.92 ? 163 LYS B NZ    1 
ATOM 1898 N N     . ARG D 4 32 ? -34.467 107.165 -5.322  1.00 39.72 ? 164 ARG B N     1 
ATOM 1899 C CA    . ARG D 4 32 ? -34.155 108.543 -4.981  1.00 39.72 ? 164 ARG B CA    1 
ATOM 1900 C C     . ARG D 4 32 ? -35.355 109.262 -4.391  1.00 39.72 ? 164 ARG B C     1 
ATOM 1901 O O     . ARG D 4 32 ? -35.327 109.672 -3.229  1.00 39.72 ? 164 ARG B O     1 
ATOM 1902 C CB    . ARG D 4 32 ? -33.678 109.280 -6.219  1.00 20.46 ? 164 ARG B CB    1 
ATOM 1903 C CG    . ARG D 4 32 ? -32.366 108.774 -6.738  1.00 20.46 ? 164 ARG B CG    1 
ATOM 1904 C CD    . ARG D 4 32 ? -31.304 109.818 -6.555  1.00 20.46 ? 164 ARG B CD    1 
ATOM 1905 N NE    . ARG D 4 32 ? -29.991 109.324 -6.947  1.00 20.46 ? 164 ARG B NE    1 
ATOM 1906 C CZ    . ARG D 4 32 ? -28.865 110.022 -6.820  1.00 20.46 ? 164 ARG B CZ    1 
ATOM 1907 N NH1   . ARG D 4 32 ? -28.890 111.259 -6.314  1.00 20.46 ? 164 ARG B NH1   1 
ATOM 1908 N NH2   . ARG D 4 32 ? -27.709 109.476 -7.179  1.00 20.46 ? 164 ARG B NH2   1 
ATOM 1909 N N     . LYS D 4 33 ? -36.400 109.423 -5.202  1.00 5.23  ? 165 LYS B N     1 
ATOM 1910 C CA    . LYS D 4 33 ? -37.619 110.082 -4.770  1.00 5.23  ? 165 LYS B CA    1 
ATOM 1911 C C     . LYS D 4 33 ? -37.976 109.612 -3.361  1.00 5.23  ? 165 LYS B C     1 
ATOM 1912 O O     . LYS D 4 33 ? -38.579 110.352 -2.571  1.00 5.23  ? 165 LYS B O     1 
ATOM 1913 C CB    . LYS D 4 33 ? -38.758 109.745 -5.725  1.00 34.60 ? 165 LYS B CB    1 
ATOM 1914 C CG    . LYS D 4 33 ? -40.068 110.424 -5.391  1.00 34.60 ? 165 LYS B CG    1 
ATOM 1915 C CD    . LYS D 4 33 ? -41.232 109.485 -5.671  1.00 34.60 ? 165 LYS B CD    1 
ATOM 1916 C CE    . LYS D 4 33 ? -41.213 108.293 -4.715  1.00 34.60 ? 165 LYS B CE    1 
ATOM 1917 N NZ    . LYS D 4 33 ? -42.284 107.285 -4.966  1.00 34.60 ? 165 LYS B NZ    1 
ATOM 1918 N N     . THR D 4 34 ? -37.599 108.377 -3.050  1.00 38.04 ? 166 THR B N     1 
ATOM 1919 C CA    . THR D 4 34 ? -37.874 107.827 -1.734  1.00 38.04 ? 166 THR B CA    1 
ATOM 1920 C C     . THR D 4 34 ? -37.014 108.539 -0.697  1.00 38.04 ? 166 THR B C     1 
ATOM 1921 O O     . THR D 4 34 ? -37.467 108.794 0.420   1.00 38.04 ? 166 THR B O     1 
ATOM 1922 C CB    . THR D 4 34 ? -37.591 106.327 -1.718  1.00 37.42 ? 166 THR B CB    1 
ATOM 1923 N N     . GLY D 4 35 ? -35.783 108.873 -1.082  1.00 43.82 ? 167 GLY B N     1 
ATOM 1924 C CA    . GLY D 4 35 ? -34.860 109.545 -0.179  1.00 43.82 ? 167 GLY B CA    1 
ATOM 1925 C C     . GLY D 4 35 ? -34.957 111.061 -0.109  1.00 43.82 ? 167 GLY B C     1 
ATOM 1926 O O     . GLY D 4 35 ? -34.837 111.646 0.974   1.00 43.82 ? 167 GLY B O     1 
ATOM 1927 N N     . ILE D 4 36 ? -35.159 111.699 -1.262  1.00 29.22 ? 168 ILE B N     1 
ATOM 1928 C CA    . ILE D 4 36 ? -35.275 113.155 -1.331  1.00 29.22 ? 168 ILE B CA    1 
ATOM 1929 C C     . ILE D 4 36 ? -36.438 113.598 -0.457  1.00 29.22 ? 168 ILE B C     1 
ATOM 1930 O O     . ILE D 4 36 ? -36.307 114.529 0.331   1.00 29.22 ? 168 ILE B O     1 
ATOM 1931 C CB    . ILE D 4 36 ? -35.497 113.634 -2.797  1.00 8.87  ? 168 ILE B CB    1 
ATOM 1932 C CG1   . ILE D 4 36 ? -35.637 115.156 -2.855  1.00 8.87  ? 168 ILE B CG1   1 
ATOM 1933 C CG2   . ILE D 4 36 ? -36.729 112.991 -3.374  1.00 8.87  ? 168 ILE B CG2   1 
ATOM 1934 C CD1   . ILE D 4 36 ? -34.355 115.919 -2.632  1.00 8.87  ? 168 ILE B CD1   1 
ATOM 1935 N N     . MET D 4 37 ? -37.573 112.924 -0.586  1.00 30.66 ? 169 MET B N     1 
ATOM 1936 C CA    . MET D 4 37 ? -38.724 113.267 0.231   1.00 30.66 ? 169 MET B CA    1 
ATOM 1937 C C     . MET D 4 37 ? -38.299 113.200 1.694   1.00 30.66 ? 169 MET B C     1 
ATOM 1938 O O     . MET D 4 37 ? -38.695 114.032 2.516   1.00 30.66 ? 169 MET B O     1 
ATOM 1939 C CB    . MET D 4 37 ? -39.872 112.289 -0.016  1.00 29.16 ? 169 MET B CB    1 
ATOM 1940 C CG    . MET D 4 37 ? -40.449 112.347 -1.410  1.00 29.16 ? 169 MET B CG    1 
ATOM 1941 S SD    . MET D 4 37 ? -41.390 113.850 -1.691  1.00 29.16 ? 169 MET B SD    1 
ATOM 1942 C CE    . MET D 4 37 ? -43.035 113.262 -1.319  1.00 29.16 ? 169 MET B CE    1 
ATOM 1943 N N     . LYS D 4 38 ? -37.479 112.206 2.013   1.00 36.16 ? 170 LYS B N     1 
ATOM 1944 C CA    . LYS D 4 38 ? -37.019 112.046 3.380   1.00 36.16 ? 170 LYS B CA    1 
ATOM 1945 C C     . LYS D 4 38 ? -36.281 113.317 3.809   1.00 36.16 ? 170 LYS B C     1 
ATOM 1946 O O     . LYS D 4 38 ? -36.644 113.940 4.813   1.00 36.16 ? 170 LYS B O     1 
ATOM 1947 C CB    . LYS D 4 38 ? -36.119 110.805 3.495   1.00 49.86 ? 170 LYS B CB    1 
ATOM 1948 C CG    . LYS D 4 38 ? -35.845 110.397 4.934   1.00 49.86 ? 170 LYS B CG    1 
ATOM 1949 C CD    . LYS D 4 38 ? -35.171 109.029 5.048   1.00 49.86 ? 170 LYS B CD    1 
ATOM 1950 C CE    . LYS D 4 38 ? -34.669 108.773 6.482   1.00 49.86 ? 170 LYS B CE    1 
ATOM 1951 N NZ    . LYS D 4 38 ? -34.149 107.391 6.721   1.00 49.86 ? 170 LYS B NZ    1 
ATOM 1952 N N     . LYS D 4 39 ? -35.272 113.708 3.027   1.00 23.97 ? 171 LYS B N     1 
ATOM 1953 C CA    . LYS D 4 39 ? -34.479 114.902 3.311   1.00 23.97 ? 171 LYS B CA    1 
ATOM 1954 C C     . LYS D 4 39 ? -35.373 116.103 3.562   1.00 23.97 ? 171 LYS B C     1 
ATOM 1955 O O     . LYS D 4 39 ? -35.177 116.831 4.530   1.00 23.97 ? 171 LYS B O     1 
ATOM 1956 C CB    . LYS D 4 39 ? -33.571 115.235 2.139   1.00 21.87 ? 171 LYS B CB    1 
ATOM 1957 C CG    . LYS D 4 39 ? -32.529 114.201 1.816   1.00 21.87 ? 171 LYS B CG    1 
ATOM 1958 C CD    . LYS D 4 39 ? -31.394 114.229 2.823   1.00 21.87 ? 171 LYS B CD    1 
ATOM 1959 C CE    . LYS D 4 39 ? -30.172 113.483 2.291   1.00 21.87 ? 171 LYS B CE    1 
ATOM 1960 N NZ    . LYS D 4 39 ? -29.080 113.378 3.304   1.00 21.87 ? 171 LYS B NZ    1 
ATOM 1961 N N     . ALA D 4 40 ? -36.345 116.309 2.677   1.00 12.44 ? 172 ALA B N     1 
ATOM 1962 C CA    . ALA D 4 40 ? -37.269 117.430 2.794   1.00 12.44 ? 172 ALA B CA    1 
ATOM 1963 C C     . ALA D 4 40 ? -37.867 117.472 4.181   1.00 12.44 ? 172 ALA B C     1 
ATOM 1964 O O     . ALA D 4 40 ? -37.887 118.508 4.834   1.00 12.44 ? 172 ALA B O     1 
ATOM 1965 C CB    . ALA D 4 40 ? -38.361 117.301 1.776   1.00 13.16 ? 172 ALA B CB    1 
ATOM 1966 N N     . TYR D 4 41 ? -38.357 116.325 4.625   1.00 25.05 ? 173 TYR B N     1 
ATOM 1967 C CA    . TYR D 4 41 ? -38.959 116.198 5.946   1.00 25.05 ? 173 TYR B CA    1 
ATOM 1968 C C     . TYR D 4 41 ? -37.939 116.591 6.987   1.00 25.05 ? 173 TYR B C     1 
ATOM 1969 O O     . TYR D 4 41 ? -38.184 117.462 7.815   1.00 25.05 ? 173 TYR B O     1 
ATOM 1970 C CB    . TYR D 4 41 ? -39.389 114.746 6.170   1.00 24.97 ? 173 TYR B CB    1 
ATOM 1971 C CG    . TYR D 4 41 ? -39.572 114.345 7.614   1.00 24.97 ? 173 TYR B CG    1 
ATOM 1972 C CD1   . TYR D 4 41 ? -40.593 114.880 8.382   1.00 24.97 ? 173 TYR B CD1   1 
ATOM 1973 C CD2   . TYR D 4 41 ? -38.736 113.403 8.199   1.00 24.97 ? 173 TYR B CD2   1 
ATOM 1974 C CE1   . TYR D 4 41 ? -40.787 114.486 9.699   1.00 24.97 ? 173 TYR B CE1   1 
ATOM 1975 C CE2   . TYR D 4 41 ? -38.916 113.001 9.514   1.00 24.97 ? 173 TYR B CE2   1 
ATOM 1976 C CZ    . TYR D 4 41 ? -39.948 113.543 10.259  1.00 24.97 ? 173 TYR B CZ    1 
ATOM 1977 O OH    . TYR D 4 41 ? -40.160 113.104 11.553  1.00 24.97 ? 173 TYR B OH    1 
ATOM 1978 N N     . GLU D 4 42 ? -36.791 115.929 6.922   1.00 17.39 ? 174 GLU B N     1 
ATOM 1979 C CA    . GLU D 4 42 ? -35.703 116.164 7.853   1.00 17.39 ? 174 GLU B CA    1 
ATOM 1980 C C     . GLU D 4 42 ? -35.386 117.647 7.944   1.00 17.39 ? 174 GLU B C     1 
ATOM 1981 O O     . GLU D 4 42 ? -35.548 118.264 8.989   1.00 17.39 ? 174 GLU B O     1 
ATOM 1982 C CB    . GLU D 4 42 ? -34.479 115.365 7.415   1.00 37.24 ? 174 GLU B CB    1 
ATOM 1983 C CG    . GLU D 4 42 ? -34.841 113.937 7.068   1.00 37.24 ? 174 GLU B CG    1 
ATOM 1984 C CD    . GLU D 4 42 ? -33.846 112.929 7.587   1.00 37.24 ? 174 GLU B CD    1 
ATOM 1985 O OE1   . GLU D 4 42 ? -32.721 112.844 7.040   1.00 37.24 ? 174 GLU B OE1   1 
ATOM 1986 O OE2   . GLU D 4 42 ? -34.198 112.222 8.554   1.00 37.24 ? 174 GLU B OE2   1 
ATOM 1987 N N     . LEU D 4 43 ? -34.931 118.225 6.844   1.00 24.58 ? 175 LEU B N     1 
ATOM 1988 C CA    . LEU D 4 43 ? -34.627 119.646 6.818   1.00 24.58 ? 175 LEU B CA    1 
ATOM 1989 C C     . LEU D 4 43 ? -35.807 120.384 7.423   1.00 24.58 ? 175 LEU B C     1 
ATOM 1990 O O     . LEU D 4 43 ? -35.675 121.108 8.394   1.00 24.58 ? 175 LEU B O     1 
ATOM 1991 C CB    . LEU D 4 43 ? -34.424 120.095 5.376   1.00 20.18 ? 175 LEU B CB    1 
ATOM 1992 C CG    . LEU D 4 43 ? -34.349 121.590 5.112   1.00 20.18 ? 175 LEU B CG    1 
ATOM 1993 C CD1   . LEU D 4 43 ? -33.221 122.189 5.938   1.00 20.18 ? 175 LEU B CD1   1 
ATOM 1994 C CD2   . LEU D 4 43 ? -34.123 121.821 3.629   1.00 20.18 ? 175 LEU B CD2   1 
ATOM 1995 N N     . SER D 4 44 ? -36.973 120.174 6.839   1.00 32.67 ? 176 SER B N     1 
ATOM 1996 C CA    . SER D 4 44 ? -38.178 120.812 7.325   1.00 32.67 ? 176 SER B CA    1 
ATOM 1997 C C     . SER D 4 44 ? -38.236 120.786 8.849   1.00 32.67 ? 176 SER B C     1 
ATOM 1998 O O     . SER D 4 44 ? -38.151 121.824 9.491   1.00 32.67 ? 176 SER B O     1 
ATOM 1999 C CB    . SER D 4 44 ? -39.407 120.105 6.748   1.00 46.37 ? 176 SER B CB    1 
ATOM 2000 O OG    . SER D 4 44 ? -40.605 120.749 7.141   1.00 46.37 ? 176 SER B OG    1 
ATOM 2001 N N     . THR D 4 45 ? -38.360 119.595 9.426   1.00 65.12 ? 177 THR B N     1 
ATOM 2002 C CA    . THR D 4 45 ? -38.465 119.450 10.878  1.00 65.12 ? 177 THR B CA    1 
ATOM 2003 C C     . THR D 4 45 ? -37.181 119.700 11.670  1.00 65.12 ? 177 THR B C     1 
ATOM 2004 O O     . THR D 4 45 ? -37.221 120.249 12.769  1.00 65.12 ? 177 THR B O     1 
ATOM 2005 C CB    . THR D 4 45 ? -39.018 118.044 11.251  1.00 41.99 ? 177 THR B CB    1 
ATOM 2006 O OG1   . THR D 4 45 ? -38.143 117.028 10.754  1.00 41.99 ? 177 THR B OG1   1 
ATOM 2007 C CG2   . THR D 4 45 ? -40.394 117.839 10.643  1.00 41.99 ? 177 THR B CG2   1 
ATOM 2008 N N     . LEU D 4 46 ? -36.047 119.299 11.114  1.00 34.42 ? 178 LEU B N     1 
ATOM 2009 C CA    . LEU D 4 46 ? -34.766 119.473 11.784  1.00 34.42 ? 178 LEU B CA    1 
ATOM 2010 C C     . LEU D 4 46 ? -34.482 120.950 12.060  1.00 34.42 ? 178 LEU B C     1 
ATOM 2011 O O     . LEU D 4 46 ? -33.981 121.306 13.126  1.00 34.42 ? 178 LEU B O     1 
ATOM 2012 C CB    . LEU D 4 46 ? -33.644 118.864 10.933  1.00 4.90  ? 178 LEU B CB    1 
ATOM 2013 C CG    . LEU D 4 46 ? -32.499 118.175 11.682  1.00 4.90  ? 178 LEU B CG    1 
ATOM 2014 C CD1   . LEU D 4 46 ? -33.061 117.184 12.692  1.00 4.90  ? 178 LEU B CD1   1 
ATOM 2015 C CD2   . LEU D 4 46 ? -31.589 117.466 10.691  1.00 4.90  ? 178 LEU B CD2   1 
ATOM 2016 N N     . THR D 4 47 ? -34.808 121.812 11.103  1.00 49.99 ? 179 THR B N     1 
ATOM 2017 C CA    . THR D 4 47 ? -34.592 123.249 11.270  1.00 49.99 ? 179 THR B CA    1 
ATOM 2018 C C     . THR D 4 47 ? -35.909 124.028 11.283  1.00 49.99 ? 179 THR B C     1 
ATOM 2019 O O     . THR D 4 47 ? -35.920 125.241 11.089  1.00 49.99 ? 179 THR B O     1 
ATOM 2020 C CB    . THR D 4 47 ? -33.683 123.828 10.155  1.00 26.18 ? 179 THR B CB    1 
ATOM 2021 O OG1   . THR D 4 47 ? -34.253 123.557 8.871   1.00 26.18 ? 179 THR B OG1   1 
ATOM 2022 C CG2   . THR D 4 47 ? -32.307 123.216 10.223  1.00 26.18 ? 179 THR B CG2   1 
ATOM 2023 N N     . GLY D 4 48 ? -37.012 123.320 11.515  1.00 64.82 ? 180 GLY B N     1 
ATOM 2024 C CA    . GLY D 4 48 ? -38.323 123.948 11.563  1.00 64.82 ? 180 GLY B CA    1 
ATOM 2025 C C     . GLY D 4 48 ? -38.552 125.002 10.499  1.00 64.82 ? 180 GLY B C     1 
ATOM 2026 O O     . GLY D 4 48 ? -38.764 126.175 10.809  1.00 64.82 ? 180 GLY B O     1 
ATOM 2027 N N     . THR D 4 49 ? -38.512 124.586 9.238   1.00 39.13 ? 181 THR B N     1 
ATOM 2028 C CA    . THR D 4 49 ? -38.717 125.512 8.134   1.00 39.13 ? 181 THR B CA    1 
ATOM 2029 C C     . THR D 4 49 ? -39.698 124.945 7.109   1.00 39.13 ? 181 THR B C     1 
ATOM 2030 O O     . THR D 4 49 ? -39.904 123.734 7.040   1.00 39.13 ? 181 THR B O     1 
ATOM 2031 C CB    . THR D 4 49 ? -37.382 125.832 7.432   1.00 28.23 ? 181 THR B CB    1 
ATOM 2032 O OG1   . THR D 4 49 ? -36.886 124.655 6.794   1.00 28.23 ? 181 THR B OG1   1 
ATOM 2033 C CG2   . THR D 4 49 ? -36.353 126.304 8.436   1.00 28.23 ? 181 THR B CG2   1 
ATOM 2034 N N     . GLN D 4 50 ? -40.305 125.831 6.324   1.00 23.70 ? 182 GLN B N     1 
ATOM 2035 C CA    . GLN D 4 50 ? -41.256 125.423 5.299   1.00 23.70 ? 182 GLN B CA    1 
ATOM 2036 C C     . GLN D 4 50 ? -40.509 124.866 4.096   1.00 23.70 ? 182 GLN B C     1 
ATOM 2037 O O     . GLN D 4 50 ? -39.560 125.475 3.602   1.00 23.70 ? 182 GLN B O     1 
ATOM 2038 C CB    . GLN D 4 50 ? -42.107 126.614 4.856   1.00 55.98 ? 182 GLN B CB    1 
ATOM 2039 C CG    . GLN D 4 50 ? -42.918 127.271 5.967   1.00 55.98 ? 182 GLN B CG    1 
ATOM 2040 C CD    . GLN D 4 50 ? -43.809 126.290 6.691   1.00 55.98 ? 182 GLN B CD    1 
ATOM 2041 O OE1   . GLN D 4 50 ? -44.446 125.443 6.066   1.00 55.98 ? 182 GLN B OE1   1 
ATOM 2042 N NE2   . GLN D 4 50 ? -43.870 126.403 8.014   1.00 55.98 ? 182 GLN B NE2   1 
ATOM 2043 N N     . VAL D 4 51 ? -40.932 123.705 3.618   1.00 21.50 ? 183 VAL B N     1 
ATOM 2044 C CA    . VAL D 4 51 ? -40.264 123.106 2.475   1.00 21.50 ? 183 VAL B CA    1 
ATOM 2045 C C     . VAL D 4 51 ? -41.283 122.535 1.514   1.00 21.50 ? 183 VAL B C     1 
ATOM 2046 O O     . VAL D 4 51 ? -42.185 121.819 1.921   1.00 21.50 ? 183 VAL B O     1 
ATOM 2047 C CB    . VAL D 4 51 ? -39.308 121.981 2.926   1.00 21.43 ? 183 VAL B CB    1 
ATOM 2048 C CG1   . VAL D 4 51 ? -38.533 121.421 1.734   1.00 21.43 ? 183 VAL B CG1   1 
ATOM 2049 C CG2   . VAL D 4 51 ? -38.354 122.516 3.968   1.00 21.43 ? 183 VAL B CG2   1 
ATOM 2050 N N     . LEU D 4 52 ? -41.155 122.876 0.240   1.00 42.27 ? 184 LEU B N     1 
ATOM 2051 C CA    . LEU D 4 52 ? -42.072 122.353 -0.754  1.00 42.27 ? 184 LEU B CA    1 
ATOM 2052 C C     . LEU D 4 52 ? -41.284 121.545 -1.761  1.00 42.27 ? 184 LEU B C     1 
ATOM 2053 O O     . LEU D 4 52 ? -40.420 122.068 -2.473  1.00 42.27 ? 184 LEU B O     1 
ATOM 2054 C CB    . LEU D 4 52 ? -42.824 123.473 -1.481  1.00 13.57 ? 184 LEU B CB    1 
ATOM 2055 C CG    . LEU D 4 52 ? -43.667 122.950 -2.652  1.00 13.57 ? 184 LEU B CG    1 
ATOM 2056 C CD1   . LEU D 4 52 ? -44.759 122.049 -2.112  1.00 13.57 ? 184 LEU B CD1   1 
ATOM 2057 C CD2   . LEU D 4 52 ? -44.263 124.095 -3.440  1.00 13.57 ? 184 LEU B CD2   1 
ATOM 2058 N N     . LEU D 4 53 ? -41.574 120.256 -1.803  1.00 21.86 ? 185 LEU B N     1 
ATOM 2059 C CA    . LEU D 4 53 ? -40.902 119.387 -2.735  1.00 21.86 ? 185 LEU B CA    1 
ATOM 2060 C C     . LEU D 4 53 ? -41.982 118.932 -3.689  1.00 21.86 ? 185 LEU B C     1 
ATOM 2061 O O     . LEU D 4 53 ? -43.113 118.716 -3.268  1.00 21.86 ? 185 LEU B O     1 
ATOM 2062 C CB    . LEU D 4 53 ? -40.301 118.198 -2.005  1.00 7.72  ? 185 LEU B CB    1 
ATOM 2063 C CG    . LEU D 4 53 ? -39.536 117.333 -2.991  1.00 7.72  ? 185 LEU B CG    1 
ATOM 2064 C CD1   . LEU D 4 53 ? -38.479 118.178 -3.677  1.00 7.72  ? 185 LEU B CD1   1 
ATOM 2065 C CD2   . LEU D 4 53 ? -38.921 116.154 -2.280  1.00 7.72  ? 185 LEU B CD2   1 
ATOM 2066 N N     . LEU D 4 54 ? -41.651 118.783 -4.964  1.00 19.00 ? 186 LEU B N     1 
ATOM 2067 C CA    . LEU D 4 54 ? -42.646 118.372 -5.943  1.00 19.00 ? 186 LEU B CA    1 
ATOM 2068 C C     . LEU D 4 54 ? -42.025 117.534 -7.051  1.00 19.00 ? 186 LEU B C     1 
ATOM 2069 O O     . LEU D 4 54 ? -41.403 118.076 -7.970  1.00 19.00 ? 186 LEU B O     1 
ATOM 2070 C CB    . LEU D 4 54 ? -43.276 119.609 -6.551  1.00 44.57 ? 186 LEU B CB    1 
ATOM 2071 C CG    . LEU D 4 54 ? -44.402 119.271 -7.505  1.00 44.57 ? 186 LEU B CG    1 
ATOM 2072 C CD1   . LEU D 4 54 ? -45.638 118.991 -6.688  1.00 44.57 ? 186 LEU B CD1   1 
ATOM 2073 C CD2   . LEU D 4 54 ? -44.646 120.424 -8.457  1.00 44.57 ? 186 LEU B CD2   1 
ATOM 2074 N N     . VAL D 4 55 ? -42.197 116.217 -6.979  1.00 28.17 ? 187 VAL B N     1 
ATOM 2075 C CA    . VAL D 4 55 ? -41.629 115.324 -7.989  1.00 28.17 ? 187 VAL B CA    1 
ATOM 2076 C C     . VAL D 4 55 ? -42.685 114.749 -8.931  1.00 28.17 ? 187 VAL B C     1 
ATOM 2077 O O     . VAL D 4 55 ? -43.667 114.161 -8.484  1.00 28.17 ? 187 VAL B O     1 
ATOM 2078 C CB    . VAL D 4 55 ? -40.864 114.160 -7.332  1.00 11.89 ? 187 VAL B CB    1 
ATOM 2079 C CG1   . VAL D 4 55 ? -40.381 113.195 -8.394  1.00 11.89 ? 187 VAL B CG1   1 
ATOM 2080 C CG2   . VAL D 4 55 ? -39.677 114.694 -6.559  1.00 11.89 ? 187 VAL B CG2   1 
ATOM 2081 N N     . ALA D 4 56 ? -42.468 114.908 -10.235 1.00 32.82 ? 188 ALA B N     1 
ATOM 2082 C CA    . ALA D 4 56 ? -43.407 114.424 -11.248 1.00 32.82 ? 188 ALA B CA    1 
ATOM 2083 C C     . ALA D 4 56 ? -42.917 113.177 -11.983 1.00 32.82 ? 188 ALA B C     1 
ATOM 2084 O O     . ALA D 4 56 ? -41.957 113.233 -12.759 1.00 32.82 ? 188 ALA B O     1 
ATOM 2085 C CB    . ALA D 4 56 ? -43.689 115.529 -12.253 1.00 32.93 ? 188 ALA B CB    1 
ATOM 2086 N N     . SER D 4 57 ? -43.598 112.059 -11.759 1.00 29.47 ? 189 SER B N     1 
ATOM 2087 C CA    . SER D 4 57 ? -43.217 110.801 -12.392 1.00 29.47 ? 189 SER B CA    1 
ATOM 2088 C C     . SER D 4 57 ? -43.196 110.890 -13.916 1.00 29.47 ? 189 SER B C     1 
ATOM 2089 O O     . SER D 4 57 ? -43.951 111.658 -14.521 1.00 29.47 ? 189 SER B O     1 
ATOM 2090 C CB    . SER D 4 57 ? -44.153 109.681 -11.942 1.00 37.26 ? 189 SER B CB    1 
ATOM 2091 N N     . GLU D 4 58 ? -42.315 110.095 -14.522 1.00 68.41 ? 190 GLU B N     1 
ATOM 2092 C CA    . GLU D 4 58 ? -42.164 110.051 -15.973 1.00 68.41 ? 190 GLU B CA    1 
ATOM 2093 C C     . GLU D 4 58 ? -43.491 109.625 -16.585 1.00 68.41 ? 190 GLU B C     1 
ATOM 2094 O O     . GLU D 4 58 ? -43.801 109.951 -17.732 1.00 68.41 ? 190 GLU B O     1 
ATOM 2095 C CB    . GLU D 4 58 ? -41.062 109.054 -16.365 1.00 82.90 ? 190 GLU B CB    1 
ATOM 2096 C CG    . GLU D 4 58 ? -40.755 108.993 -17.866 1.00 82.90 ? 190 GLU B CG    1 
ATOM 2097 C CD    . GLU D 4 58 ? -39.773 107.883 -18.233 1.00 82.90 ? 190 GLU B CD    1 
ATOM 2098 O OE1   . GLU D 4 58 ? -38.648 107.871 -17.688 1.00 82.90 ? 190 GLU B OE1   1 
ATOM 2099 O OE2   . GLU D 4 58 ? -40.126 107.023 -19.072 1.00 82.90 ? 190 GLU B OE2   1 
ATOM 2100 N N     . THR D 4 59 ? -44.272 108.890 -15.806 1.00 79.15 ? 191 THR B N     1 
ATOM 2101 C CA    . THR D 4 59 ? -45.566 108.427 -16.266 1.00 79.15 ? 191 THR B CA    1 
ATOM 2102 C C     . THR D 4 59 ? -46.637 109.478 -16.022 1.00 79.15 ? 191 THR B C     1 
ATOM 2103 O O     . THR D 4 59 ? -47.232 109.981 -16.975 1.00 79.15 ? 191 THR B O     1 
ATOM 2104 C CB    . THR D 4 59 ? -45.973 107.118 -15.571 1.00 72.72 ? 191 THR B CB    1 
ATOM 2105 O OG1   . THR D 4 59 ? -45.420 107.087 -14.249 1.00 72.72 ? 191 THR B OG1   1 
ATOM 2106 C CG2   . THR D 4 59 ? -45.489 105.911 -16.377 1.00 72.72 ? 191 THR B CG2   1 
ATOM 2107 N N     . GLY D 4 60 ? -46.882 109.817 -14.758 1.00 46.16 ? 192 GLY B N     1 
ATOM 2108 C CA    . GLY D 4 60 ? -47.897 110.815 -14.465 1.00 46.16 ? 192 GLY B CA    1 
ATOM 2109 C C     . GLY D 4 60 ? -48.137 111.151 -13.004 1.00 46.16 ? 192 GLY B C     1 
ATOM 2110 O O     . GLY D 4 60 ? -48.744 112.182 -12.704 1.00 46.16 ? 192 GLY B O     1 
ATOM 2111 N N     . HIS D 4 61 ? -47.676 110.294 -12.094 1.00 76.43 ? 193 HIS B N     1 
ATOM 2112 C CA    . HIS D 4 61 ? -47.858 110.528 -10.660 1.00 76.43 ? 193 HIS B CA    1 
ATOM 2113 C C     . HIS D 4 61 ? -47.000 111.695 -10.168 1.00 76.43 ? 193 HIS B C     1 
ATOM 2114 O O     . HIS D 4 61 ? -45.825 111.823 -10.522 1.00 76.43 ? 193 HIS B O     1 
ATOM 2115 C CB    . HIS D 4 61 ? -47.533 109.262 -9.871  1.00 43.20 ? 193 HIS B CB    1 
ATOM 2116 N N     . VAL D 4 62 ? -47.606 112.540 -9.342  1.00 25.56 ? 194 VAL B N     1 
ATOM 2117 C CA    . VAL D 4 62 ? -46.942 113.719 -8.798  1.00 25.56 ? 194 VAL B CA    1 
ATOM 2118 C C     . VAL D 4 62 ? -46.728 113.583 -7.300  1.00 25.56 ? 194 VAL B C     1 
ATOM 2119 O O     . VAL D 4 62 ? -47.588 113.967 -6.516  1.00 25.56 ? 194 VAL B O     1 
ATOM 2120 C CB    . VAL D 4 62 ? -47.794 114.975 -9.050  1.00 40.18 ? 194 VAL B CB    1 
ATOM 2121 C CG1   . VAL D 4 62 ? -47.059 116.200 -8.573  1.00 40.18 ? 194 VAL B CG1   1 
ATOM 2122 C CG2   . VAL D 4 62 ? -48.125 115.091 -10.521 1.00 40.18 ? 194 VAL B CG2   1 
ATOM 2123 N N     . TYR D 4 63 ? -45.583 113.049 -6.896  1.00 41.03 ? 195 TYR B N     1 
ATOM 2124 C CA    . TYR D 4 63 ? -45.315 112.877 -5.477  1.00 41.03 ? 195 TYR B CA    1 
ATOM 2125 C C     . TYR D 4 63 ? -44.953 114.219 -4.861  1.00 41.03 ? 195 TYR B C     1 
ATOM 2126 O O     . TYR D 4 63 ? -44.272 115.036 -5.488  1.00 41.03 ? 195 TYR B O     1 
ATOM 2127 C CB    . TYR D 4 63 ? -44.194 111.860 -5.277  1.00 35.81 ? 195 TYR B CB    1 
ATOM 2128 C CG    . TYR D 4 63 ? -44.450 110.549 -5.991  1.00 35.81 ? 195 TYR B CG    1 
ATOM 2129 C CD1   . TYR D 4 63 ? -44.301 110.441 -7.375  1.00 35.81 ? 195 TYR B CD1   1 
ATOM 2130 C CD2   . TYR D 4 63 ? -44.884 109.428 -5.293  1.00 35.81 ? 195 TYR B CD2   1 
ATOM 2131 C CE1   . TYR D 4 63 ? -44.580 109.247 -8.049  1.00 35.81 ? 195 TYR B CE1   1 
ATOM 2132 C CE2   . TYR D 4 63 ? -45.170 108.232 -5.954  1.00 35.81 ? 195 TYR B CE2   1 
ATOM 2133 C CZ    . TYR D 4 63 ? -45.016 108.147 -7.331  1.00 35.81 ? 195 TYR B CZ    1 
ATOM 2134 O OH    . TYR D 4 63 ? -45.301 106.964 -7.980  1.00 35.81 ? 195 TYR B OH    1 
ATOM 2135 N N     . THR D 4 64 ? -45.413 114.462 -3.637  1.00 16.68 ? 196 THR B N     1 
ATOM 2136 C CA    . THR D 4 64 ? -45.132 115.740 -3.006  1.00 16.68 ? 196 THR B CA    1 
ATOM 2137 C C     . THR D 4 64 ? -45.067 115.703 -1.497  1.00 16.68 ? 196 THR B C     1 
ATOM 2138 O O     . THR D 4 64 ? -45.799 114.947 -0.850  1.00 16.68 ? 196 THR B O     1 
ATOM 2139 C CB    . THR D 4 64 ? -46.225 116.766 -3.308  1.00 9.80  ? 196 THR B CB    1 
ATOM 2140 O OG1   . THR D 4 64 ? -47.323 116.549 -2.411  1.00 9.80  ? 196 THR B OG1   1 
ATOM 2141 C CG2   . THR D 4 64 ? -46.719 116.634 -4.737  1.00 9.80  ? 196 THR B CG2   1 
ATOM 2142 N N     . PHE D 4 65 ? -44.199 116.550 -0.947  1.00 14.70 ? 197 PHE B N     1 
ATOM 2143 C CA    . PHE D 4 65 ? -44.056 116.727 0.498   1.00 14.70 ? 197 PHE B CA    1 
ATOM 2144 C C     . PHE D 4 65 ? -44.137 118.234 0.686   1.00 14.70 ? 197 PHE B C     1 
ATOM 2145 O O     . PHE D 4 65 ? -43.525 118.990 -0.081  1.00 14.70 ? 197 PHE B O     1 
ATOM 2146 C CB    . PHE D 4 65 ? -42.700 116.248 1.015   1.00 45.80 ? 197 PHE B CB    1 
ATOM 2147 C CG    . PHE D 4 65 ? -42.320 116.843 2.353   1.00 45.80 ? 197 PHE B CG    1 
ATOM 2148 C CD1   . PHE D 4 65 ? -42.989 116.474 3.515   1.00 45.80 ? 197 PHE B CD1   1 
ATOM 2149 C CD2   . PHE D 4 65 ? -41.306 117.796 2.444   1.00 45.80 ? 197 PHE B CD2   1 
ATOM 2150 C CE1   . PHE D 4 65 ? -42.651 117.046 4.746   1.00 45.80 ? 197 PHE B CE1   1 
ATOM 2151 C CE2   . PHE D 4 65 ? -40.962 118.373 3.665   1.00 45.80 ? 197 PHE B CE2   1 
ATOM 2152 C CZ    . PHE D 4 65 ? -41.634 117.998 4.817   1.00 45.80 ? 197 PHE B CZ    1 
ATOM 2153 N N     . ALA D 4 66 ? -44.899 118.664 1.689   1.00 43.45 ? 198 ALA B N     1 
ATOM 2154 C CA    . ALA D 4 66 ? -45.059 120.084 1.983   1.00 43.45 ? 198 ALA B CA    1 
ATOM 2155 C C     . ALA D 4 66 ? -45.481 120.330 3.426   1.00 43.45 ? 198 ALA B C     1 
ATOM 2156 O O     . ALA D 4 66 ? -46.435 119.735 3.925   1.00 43.45 ? 198 ALA B O     1 
ATOM 2157 C CB    . ALA D 4 66 ? -46.071 120.703 1.038   1.00 20.42 ? 198 ALA B CB    1 
ATOM 2158 N N     . THR D 4 67 ? -44.761 121.217 4.093   1.00 37.84 ? 199 THR B N     1 
ATOM 2159 C CA    . THR D 4 67 ? -45.059 121.553 5.474   1.00 37.84 ? 199 THR B CA    1 
ATOM 2160 C C     . THR D 4 67 ? -46.425 122.255 5.546   1.00 37.84 ? 199 THR B C     1 
ATOM 2161 O O     . THR D 4 67 ? -46.887 122.825 4.555   1.00 37.84 ? 199 THR B O     1 
ATOM 2162 C CB    . THR D 4 67 ? -43.952 122.465 6.046   1.00 39.12 ? 199 THR B CB    1 
ATOM 2163 O OG1   . THR D 4 67 ? -42.767 122.350 5.238   1.00 39.12 ? 199 THR B OG1   1 
ATOM 2164 C CG2   . THR D 4 67 ? -43.627 122.052 7.492   1.00 39.12 ? 199 THR B CG2   1 
ATOM 2165 N N     . ARG D 4 68 ? -47.055 122.219 6.719   1.00 43.26 ? 200 ARG B N     1 
ATOM 2166 C CA    . ARG D 4 68 ? -48.380 122.810 6.932   1.00 43.26 ? 200 ARG B CA    1 
ATOM 2167 C C     . ARG D 4 68 ? -48.691 124.063 6.123   1.00 43.26 ? 200 ARG B C     1 
ATOM 2168 O O     . ARG D 4 68 ? -49.573 124.034 5.270   1.00 43.26 ? 200 ARG B O     1 
ATOM 2169 C CB    . ARG D 4 68 ? -48.598 123.095 8.421   1.00 82.90 ? 200 ARG B CB    1 
ATOM 2170 C CG    . ARG D 4 68 ? -50.060 123.324 8.817   1.00 82.90 ? 200 ARG B CG    1 
ATOM 2171 C CD    . ARG D 4 68 ? -50.969 122.111 8.526   1.00 82.90 ? 200 ARG B CD    1 
ATOM 2172 N NE    . ARG D 4 68 ? -50.440 120.843 9.046   1.00 82.90 ? 200 ARG B NE    1 
ATOM 2173 C CZ    . ARG D 4 68 ? -51.169 119.745 9.255   1.00 82.90 ? 200 ARG B CZ    1 
ATOM 2174 N NH1   . ARG D 4 68 ? -52.474 119.742 8.998   1.00 82.90 ? 200 ARG B NH1   1 
ATOM 2175 N NH2   . ARG D 4 68 ? -50.593 118.639 9.715   1.00 82.90 ? 200 ARG B NH2   1 
ATOM 2176 N N     . LYS D 4 69 ? -47.976 125.156 6.382   1.00 39.36 ? 201 LYS B N     1 
ATOM 2177 C CA    . LYS D 4 69 ? -48.199 126.424 5.669   1.00 39.36 ? 201 LYS B CA    1 
ATOM 2178 C C     . LYS D 4 69 ? -48.100 126.346 4.143   1.00 39.36 ? 201 LYS B C     1 
ATOM 2179 O O     . LYS D 4 69 ? -48.689 127.170 3.440   1.00 39.36 ? 201 LYS B O     1 
ATOM 2180 C CB    . LYS D 4 69 ? -47.213 127.496 6.140   1.00 76.32 ? 201 LYS B CB    1 
ATOM 2181 C CG    . LYS D 4 69 ? -47.474 128.091 7.511   1.00 76.32 ? 201 LYS B CG    1 
ATOM 2182 C CD    . LYS D 4 69 ? -46.460 129.200 7.776   1.00 76.32 ? 201 LYS B CD    1 
ATOM 2183 C CE    . LYS D 4 69 ? -46.563 129.781 9.176   1.00 76.32 ? 201 LYS B CE    1 
ATOM 2184 N NZ    . LYS D 4 69 ? -45.551 130.860 9.376   1.00 76.32 ? 201 LYS B NZ    1 
ATOM 2185 N N     . LEU D 4 70 ? -47.342 125.382 3.626   1.00 40.33 ? 202 LEU B N     1 
ATOM 2186 C CA    . LEU D 4 70 ? -47.187 125.248 2.179   1.00 40.33 ? 202 LEU B CA    1 
ATOM 2187 C C     . LEU D 4 70 ? -48.266 124.366 1.572   1.00 40.33 ? 202 LEU B C     1 
ATOM 2188 O O     . LEU D 4 70 ? -48.591 124.504 0.390   1.00 40.33 ? 202 LEU B O     1 
ATOM 2189 C CB    . LEU D 4 70 ? -45.802 124.690 1.839   1.00 50.44 ? 202 LEU B CB    1 
ATOM 2190 C CG    . LEU D 4 70 ? -44.626 125.650 2.046   1.00 50.44 ? 202 LEU B CG    1 
ATOM 2191 C CD1   . LEU D 4 70 ? -43.300 124.933 1.808   1.00 50.44 ? 202 LEU B CD1   1 
ATOM 2192 C CD2   . LEU D 4 70 ? -44.787 126.827 1.100   1.00 50.44 ? 202 LEU B CD2   1 
ATOM 2193 N N     . GLN D 4 71 ? -48.813 123.465 2.391   1.00 38.48 ? 203 GLN B N     1 
ATOM 2194 C CA    . GLN D 4 71 ? -49.871 122.544 1.969   1.00 38.48 ? 203 GLN B CA    1 
ATOM 2195 C C     . GLN D 4 71 ? -50.868 123.227 1.040   1.00 38.48 ? 203 GLN B C     1 
ATOM 2196 O O     . GLN D 4 71 ? -51.228 122.684 -0.002  1.00 38.48 ? 203 GLN B O     1 
ATOM 2197 C CB    . GLN D 4 71 ? -50.603 121.977 3.195   1.00 45.36 ? 203 GLN B CB    1 
ATOM 2198 C CG    . GLN D 4 71 ? -49.937 120.753 3.814   1.00 45.36 ? 203 GLN B CG    1 
ATOM 2199 C CD    . GLN D 4 71 ? -50.003 119.530 2.905   1.00 45.36 ? 203 GLN B CD    1 
ATOM 2200 O OE1   . GLN D 4 71 ? -51.067 118.925 2.719   1.00 45.36 ? 203 GLN B OE1   1 
ATOM 2201 N NE2   . GLN D 4 71 ? -48.863 119.166 2.326   1.00 45.36 ? 203 GLN B NE2   1 
ATOM 2202 N N     . PRO D 4 72 ? -51.331 124.429 1.412   1.00 82.90 ? 204 PRO B N     1 
ATOM 2203 C CA    . PRO D 4 72 ? -52.288 125.169 0.588   1.00 82.90 ? 204 PRO B CA    1 
ATOM 2204 C C     . PRO D 4 72 ? -51.786 125.445 -0.828  1.00 82.90 ? 204 PRO B C     1 
ATOM 2205 O O     . PRO D 4 72 ? -52.370 126.251 -1.548  1.00 82.90 ? 204 PRO B O     1 
ATOM 2206 C CB    . PRO D 4 72 ? -52.489 126.455 1.381   1.00 78.87 ? 204 PRO B CB    1 
ATOM 2207 C CG    . PRO D 4 72 ? -52.375 125.983 2.789   1.00 78.87 ? 204 PRO B CG    1 
ATOM 2208 C CD    . PRO D 4 72 ? -51.167 125.083 2.723   1.00 78.87 ? 204 PRO B CD    1 
ATOM 2209 N N     . MET D 4 73 ? -50.710 124.781 -1.235  1.00 44.36 ? 205 MET B N     1 
ATOM 2210 C CA    . MET D 4 73 ? -50.169 125.006 -2.572  1.00 44.36 ? 205 MET B CA    1 
ATOM 2211 C C     . MET D 4 73 ? -50.267 123.762 -3.458  1.00 44.36 ? 205 MET B C     1 
ATOM 2212 O O     . MET D 4 73 ? -49.948 123.802 -4.647  1.00 44.36 ? 205 MET B O     1 
ATOM 2213 C CB    . MET D 4 73 ? -48.721 125.479 -2.454  1.00 59.74 ? 205 MET B CB    1 
ATOM 2214 C CG    . MET D 4 73 ? -48.146 126.025 -3.732  1.00 59.74 ? 205 MET B CG    1 
ATOM 2215 S SD    . MET D 4 73 ? -46.767 127.141 -3.397  1.00 59.74 ? 205 MET B SD    1 
ATOM 2216 C CE    . MET D 4 73 ? -47.087 128.433 -4.591  1.00 59.74 ? 205 MET B CE    1 
ATOM 2217 N N     . ILE D 4 74 ? -50.709 122.660 -2.859  1.00 48.33 ? 206 ILE B N     1 
ATOM 2218 C CA    . ILE D 4 74 ? -50.883 121.391 -3.557  1.00 48.33 ? 206 ILE B CA    1 
ATOM 2219 C C     . ILE D 4 74 ? -52.225 120.830 -3.111  1.00 48.33 ? 206 ILE B C     1 
ATOM 2220 O O     . ILE D 4 74 ? -52.604 119.713 -3.458  1.00 48.33 ? 206 ILE B O     1 
ATOM 2221 C CB    . ILE D 4 74 ? -49.782 120.375 -3.188  1.00 60.07 ? 206 ILE B CB    1 
ATOM 2222 C CG1   . ILE D 4 74 ? -49.724 120.179 -1.672  1.00 60.07 ? 206 ILE B CG1   1 
ATOM 2223 C CG2   . ILE D 4 74 ? -48.441 120.852 -3.697  1.00 60.07 ? 206 ILE B CG2   1 
ATOM 2224 C CD1   . ILE D 4 74 ? -48.710 119.132 -1.236  1.00 60.07 ? 206 ILE B CD1   1 
ATOM 2225 N N     . THR D 4 75 ? -52.942 121.634 -2.338  1.00 70.61 ? 207 THR B N     1 
ATOM 2226 C CA    . THR D 4 75 ? -54.234 121.248 -1.806  1.00 70.61 ? 207 THR B CA    1 
ATOM 2227 C C     . THR D 4 75 ? -55.298 122.260 -2.215  1.00 70.61 ? 207 THR B C     1 
ATOM 2228 O O     . THR D 4 75 ? -56.490 121.960 -2.213  1.00 70.61 ? 207 THR B O     1 
ATOM 2229 C CB    . THR D 4 75 ? -54.145 121.138 -0.266  1.00 39.67 ? 207 THR B CB    1 
ATOM 2230 O OG1   . THR D 4 75 ? -53.443 119.934 0.079   1.00 39.67 ? 207 THR B OG1   1 
ATOM 2231 C CG2   . THR D 4 75 ? -55.535 121.142 0.373   1.00 39.67 ? 207 THR B CG2   1 
ATOM 2232 N N     . SER D 4 76 ? -54.856 123.456 -2.585  1.00 66.15 ? 208 SER B N     1 
ATOM 2233 C CA    . SER D 4 76 ? -55.773 124.511 -2.994  1.00 66.15 ? 208 SER B CA    1 
ATOM 2234 C C     . SER D 4 76 ? -56.128 124.399 -4.471  1.00 66.15 ? 208 SER B C     1 
ATOM 2235 O O     . SER D 4 76 ? -55.369 123.829 -5.260  1.00 66.15 ? 208 SER B O     1 
ATOM 2236 C CB    . SER D 4 76 ? -55.139 125.870 -2.747  1.00 51.86 ? 208 SER B CB    1 
ATOM 2237 O OG    . SER D 4 76 ? -53.982 126.009 -3.554  1.00 51.86 ? 208 SER B OG    1 
ATOM 2238 N N     . GLU D 4 77 ? -57.278 124.963 -4.836  1.00 75.87 ? 209 GLU B N     1 
ATOM 2239 C CA    . GLU D 4 77 ? -57.764 124.944 -6.214  1.00 75.87 ? 209 GLU B CA    1 
ATOM 2240 C C     . GLU D 4 77 ? -56.752 125.576 -7.161  1.00 75.87 ? 209 GLU B C     1 
ATOM 2241 O O     . GLU D 4 77 ? -56.408 124.997 -8.189  1.00 75.87 ? 209 GLU B O     1 
ATOM 2242 C CB    . GLU D 4 77 ? -59.101 125.689 -6.310  1.00 35.98 ? 209 GLU B CB    1 
ATOM 2243 N N     . THR D 4 78 ? -56.281 126.765 -6.798  1.00 40.53 ? 210 THR B N     1 
ATOM 2244 C CA    . THR D 4 78 ? -55.313 127.511 -7.605  1.00 40.53 ? 210 THR B CA    1 
ATOM 2245 C C     . THR D 4 78 ? -54.020 126.729 -7.805  1.00 40.53 ? 210 THR B C     1 
ATOM 2246 O O     . THR D 4 78 ? -53.475 126.647 -8.916  1.00 40.53 ? 210 THR B O     1 
ATOM 2247 C CB    . THR D 4 78 ? -54.956 128.869 -6.939  1.00 82.90 ? 210 THR B CB    1 
ATOM 2248 O OG1   . THR D 4 78 ? -56.154 129.631 -6.730  1.00 82.90 ? 210 THR B OG1   1 
ATOM 2249 C CG2   . THR D 4 78 ? -53.987 129.670 -7.822  1.00 82.90 ? 210 THR B CG2   1 
ATOM 2250 N N     . GLY D 4 79 ? -53.521 126.174 -6.710  1.00 65.28 ? 211 GLY B N     1 
ATOM 2251 C CA    . GLY D 4 79 ? -52.299 125.408 -6.784  1.00 65.28 ? 211 GLY B CA    1 
ATOM 2252 C C     . GLY D 4 79 ? -52.479 124.284 -7.773  1.00 65.28 ? 211 GLY B C     1 
ATOM 2253 O O     . GLY D 4 79 ? -51.729 124.185 -8.742  1.00 65.28 ? 211 GLY B O     1 
ATOM 2254 N N     . LYS D 4 80 ? -53.492 123.454 -7.533  1.00 35.39 ? 212 LYS B N     1 
ATOM 2255 C CA    . LYS D 4 80 ? -53.786 122.312 -8.388  1.00 35.39 ? 212 LYS B CA    1 
ATOM 2256 C C     . LYS D 4 80 ? -53.870 122.681 -9.877  1.00 35.39 ? 212 LYS B C     1 
ATOM 2257 O O     . LYS D 4 80 ? -53.292 121.996 -10.731 1.00 35.39 ? 212 LYS B O     1 
ATOM 2258 C CB    . LYS D 4 80 ? -55.078 121.649 -7.916  1.00 63.71 ? 212 LYS B CB    1 
ATOM 2259 C CG    . LYS D 4 80 ? -55.000 121.119 -6.491  1.00 63.71 ? 212 LYS B CG    1 
ATOM 2260 C CD    . LYS D 4 80 ? -56.315 120.472 -6.085  1.00 63.71 ? 212 LYS B CD    1 
ATOM 2261 C CE    . LYS D 4 80 ? -56.244 119.842 -4.698  1.00 63.71 ? 212 LYS B CE    1 
ATOM 2262 N NZ    . LYS D 4 80 ? -57.507 119.110 -4.356  1.00 63.71 ? 212 LYS B NZ    1 
ATOM 2263 N N     . ALA D 4 81 ? -54.579 123.760 -10.194 1.00 46.95 ? 213 ALA B N     1 
ATOM 2264 C CA    . ALA D 4 81 ? -54.680 124.187 -11.587 1.00 46.95 ? 213 ALA B CA    1 
ATOM 2265 C C     . ALA D 4 81 ? -53.286 124.634 -12.034 1.00 46.95 ? 213 ALA B C     1 
ATOM 2266 O O     . ALA D 4 81 ? -52.798 124.229 -13.086 1.00 46.95 ? 213 ALA B O     1 
ATOM 2267 C CB    . ALA D 4 81 ? -55.690 125.341 -11.727 1.00 22.94 ? 213 ALA B CB    1 
ATOM 2268 N N     . LEU D 4 82 ? -52.643 125.458 -11.216 1.00 36.64 ? 214 LEU B N     1 
ATOM 2269 C CA    . LEU D 4 82 ? -51.306 125.950 -11.529 1.00 36.64 ? 214 LEU B CA    1 
ATOM 2270 C C     . LEU D 4 82 ? -50.293 124.819 -11.734 1.00 36.64 ? 214 LEU B C     1 
ATOM 2271 O O     . LEU D 4 82 ? -49.516 124.827 -12.687 1.00 36.64 ? 214 LEU B O     1 
ATOM 2272 C CB    . LEU D 4 82 ? -50.823 126.884 -10.419 1.00 51.02 ? 214 LEU B CB    1 
ATOM 2273 C CG    . LEU D 4 82 ? -49.387 127.378 -10.621 1.00 51.02 ? 214 LEU B CG    1 
ATOM 2274 C CD1   . LEU D 4 82 ? -49.189 127.823 -12.067 1.00 51.02 ? 214 LEU B CD1   1 
ATOM 2275 C CD2   . LEU D 4 82 ? -49.091 128.515 -9.649  1.00 51.02 ? 214 LEU B CD2   1 
ATOM 2276 N N     . ILE D 4 83 ? -50.285 123.863 -10.815 1.00 46.00 ? 215 ILE B N     1 
ATOM 2277 C CA    . ILE D 4 83 ? -49.395 122.725 -10.932 1.00 46.00 ? 215 ILE B CA    1 
ATOM 2278 C C     . ILE D 4 83 ? -49.804 122.052 -12.235 1.00 46.00 ? 215 ILE B C     1 
ATOM 2279 O O     . ILE D 4 83 ? -48.974 121.831 -13.118 1.00 46.00 ? 215 ILE B O     1 
ATOM 2280 C CB    . ILE D 4 83 ? -49.594 121.736 -9.755  1.00 53.50 ? 215 ILE B CB    1 
ATOM 2281 C CG1   . ILE D 4 83 ? -49.112 122.376 -8.453  1.00 53.50 ? 215 ILE B CG1   1 
ATOM 2282 C CG2   . ILE D 4 83 ? -48.856 120.431 -10.022 1.00 53.50 ? 215 ILE B CG2   1 
ATOM 2283 C CD1   . ILE D 4 83 ? -49.220 121.470 -7.244  1.00 53.50 ? 215 ILE B CD1   1 
ATOM 2284 N N     . GLN D 4 84 ? -51.098 121.755 -12.356 1.00 37.03 ? 216 GLN B N     1 
ATOM 2285 C CA    . GLN D 4 84 ? -51.632 121.114 -13.550 1.00 37.03 ? 216 GLN B CA    1 
ATOM 2286 C C     . GLN D 4 84 ? -51.306 121.889 -14.832 1.00 37.03 ? 216 GLN B C     1 
ATOM 2287 O O     . GLN D 4 84 ? -50.915 121.295 -15.832 1.00 37.03 ? 216 GLN B O     1 
ATOM 2288 C CB    . GLN D 4 84 ? -53.141 120.932 -13.414 1.00 43.80 ? 216 GLN B CB    1 
ATOM 2289 N N     . THR D 4 85 ? -51.467 123.208 -14.808 1.00 52.36 ? 217 THR B N     1 
ATOM 2290 C CA    . THR D 4 85 ? -51.172 124.025 -15.986 1.00 52.36 ? 217 THR B CA    1 
ATOM 2291 C C     . THR D 4 85 ? -49.704 123.866 -16.376 1.00 52.36 ? 217 THR B C     1 
ATOM 2292 O O     . THR D 4 85 ? -49.356 123.849 -17.562 1.00 52.36 ? 217 THR B O     1 
ATOM 2293 C CB    . THR D 4 85 ? -51.426 125.533 -15.722 1.00 42.94 ? 217 THR B CB    1 
ATOM 2294 O OG1   . THR D 4 85 ? -52.786 125.733 -15.322 1.00 42.94 ? 217 THR B OG1   1 
ATOM 2295 C CG2   . THR D 4 85 ? -51.137 126.355 -16.982 1.00 42.94 ? 217 THR B CG2   1 
ATOM 2296 N N     . CYS D 4 86 ? -48.853 123.749 -15.362 1.00 51.68 ? 218 CYS B N     1 
ATOM 2297 C CA    . CYS D 4 86 ? -47.421 123.612 -15.557 1.00 51.68 ? 218 CYS B CA    1 
ATOM 2298 C C     . CYS D 4 86 ? -46.981 122.271 -16.117 1.00 51.68 ? 218 CYS B C     1 
ATOM 2299 O O     . CYS D 4 86 ? -45.786 121.987 -16.136 1.00 51.68 ? 218 CYS B O     1 
ATOM 2300 C CB    . CYS D 4 86 ? -46.691 123.834 -14.234 1.00 49.73 ? 218 CYS B CB    1 
ATOM 2301 S SG    . CYS D 4 86 ? -46.743 125.508 -13.599 1.00 49.73 ? 218 CYS B SG    1 
ATOM 2302 N N     . LEU D 4 87 ? -47.912 121.448 -16.589 1.00 82.28 ? 219 LEU B N     1 
ATOM 2303 C CA    . LEU D 4 87 ? -47.513 120.139 -17.091 1.00 82.28 ? 219 LEU B CA    1 
ATOM 2304 C C     . LEU D 4 87 ? -48.138 119.644 -18.405 1.00 82.28 ? 219 LEU B C     1 
ATOM 2305 O O     . LEU D 4 87 ? -48.329 118.439 -18.575 1.00 82.28 ? 219 LEU B O     1 
ATOM 2306 C CB    . LEU D 4 87 ? -47.755 119.102 -15.989 1.00 37.78 ? 219 LEU B CB    1 
ATOM 2307 C CG    . LEU D 4 87 ? -47.026 119.329 -14.652 1.00 37.78 ? 219 LEU B CG    1 
ATOM 2308 C CD1   . LEU D 4 87 ? -47.476 118.301 -13.607 1.00 37.78 ? 219 LEU B CD1   1 
ATOM 2309 C CD2   . LEU D 4 87 ? -45.527 119.229 -14.869 1.00 37.78 ? 219 LEU B CD2   1 
ATOM 2310 N N     . ASN D 4 88 ? -48.432 120.544 -19.343 1.00 82.90 ? 220 ASN B N     1 
ATOM 2311 C CA    . ASN D 4 88 ? -49.031 120.118 -20.607 1.00 82.90 ? 220 ASN B CA    1 
ATOM 2312 C C     . ASN D 4 88 ? -48.647 120.970 -21.824 1.00 82.90 ? 220 ASN B C     1 
ATOM 2313 O O     . ASN D 4 88 ? -48.995 120.627 -22.961 1.00 82.90 ? 220 ASN B O     1 
ATOM 2314 C CB    . ASN D 4 88 ? -50.559 120.072 -20.465 1.00 82.90 ? 220 ASN B CB    1 
ATOM 2315 C CG    . ASN D 4 88 ? -51.020 119.071 -19.412 1.00 82.90 ? 220 ASN B CG    1 
ATOM 2316 O OD1   . ASN D 4 88 ? -50.772 117.872 -19.531 1.00 82.90 ? 220 ASN B OD1   1 
ATOM 2317 N ND2   . ASN D 4 88 ? -51.691 119.562 -18.375 1.00 82.90 ? 220 ASN B ND2   1 
ATOM 2318 N N     . SER D 4 89 ? -47.920 122.063 -21.589 1.00 82.90 ? 221 SER B N     1 
ATOM 2319 C CA    . SER D 4 89 ? -47.489 122.971 -22.665 1.00 82.90 ? 221 SER B CA    1 
ATOM 2320 C C     . SER D 4 89 ? -46.269 122.469 -23.453 1.00 82.90 ? 221 SER B C     1 
ATOM 2321 O O     . SER D 4 89 ? -45.640 121.479 -23.015 1.00 82.90 ? 221 SER B O     1 
ATOM 2322 C CB    . SER D 4 89 ? -47.164 124.357 -22.088 1.00 82.49 ? 221 SER B CB    1 
ATOM 2323 O OG    . SER D 4 89 ? -46.061 124.301 -21.195 1.00 82.49 ? 221 SER B OG    1 
ATOM 2324 N N     . LYS E 4 6  ? -11.207 108.217 16.845  1.00 81.73 ? 138 LYS C N     1 
ATOM 2325 C CA    . LYS E 4 6  ? -10.103 108.674 17.742  1.00 81.73 ? 138 LYS C CA    1 
ATOM 2326 C C     . LYS E 4 6  ? -9.956  110.192 17.737  1.00 81.73 ? 138 LYS C C     1 
ATOM 2327 O O     . LYS E 4 6  ? -10.123 110.844 18.767  1.00 81.73 ? 138 LYS C O     1 
ATOM 2328 C CB    . LYS E 4 6  ? -8.780  108.031 17.320  1.00 40.94 ? 138 LYS C CB    1 
ATOM 2329 N N     . LYS E 4 7  ? -9.645  110.745 16.567  1.00 82.90 ? 139 LYS C N     1 
ATOM 2330 C CA    . LYS E 4 7  ? -9.451  112.188 16.401  1.00 82.90 ? 139 LYS C CA    1 
ATOM 2331 C C     . LYS E 4 7  ? -10.754 112.979 16.588  1.00 82.90 ? 139 LYS C C     1 
ATOM 2332 O O     . LYS E 4 7  ? -10.930 113.671 17.596  1.00 82.90 ? 139 LYS C O     1 
ATOM 2333 C CB    . LYS E 4 7  ? -8.847  112.457 15.019  1.00 78.65 ? 139 LYS C CB    1 
ATOM 2334 C CG    . LYS E 4 7  ? -7.990  113.702 14.942  1.00 78.65 ? 139 LYS C CG    1 
ATOM 2335 C CD    . LYS E 4 7  ? -7.274  113.796 13.603  1.00 78.65 ? 139 LYS C CD    1 
ATOM 2336 C CE    . LYS E 4 7  ? -6.525  115.117 13.478  1.00 78.65 ? 139 LYS C CE    1 
ATOM 2337 N NZ    . LYS E 4 7  ? -5.940  115.308 12.119  1.00 78.65 ? 139 LYS C NZ    1 
ATOM 2338 N N     . THR E 4 8  ? -11.657 112.885 15.612  1.00 82.90 ? 140 THR C N     1 
ATOM 2339 C CA    . THR E 4 8  ? -12.951 113.568 15.695  1.00 82.90 ? 140 THR C CA    1 
ATOM 2340 C C     . THR E 4 8  ? -14.008 112.521 16.056  1.00 82.90 ? 140 THR C C     1 
ATOM 2341 O O     . THR E 4 8  ? -13.844 111.332 15.769  1.00 82.90 ? 140 THR C O     1 
ATOM 2342 C CB    . THR E 4 8  ? -13.347 114.245 14.347  1.00 82.90 ? 140 THR C CB    1 
ATOM 2343 O OG1   . THR E 4 8  ? -14.282 113.415 13.640  1.00 82.90 ? 140 THR C OG1   1 
ATOM 2344 C CG2   . THR E 4 8  ? -12.108 114.480 13.480  1.00 82.90 ? 140 THR C CG2   1 
ATOM 2345 N N     . ARG E 4 9  ? -15.088 112.962 16.686  1.00 82.90 ? 141 ARG C N     1 
ATOM 2346 C CA    . ARG E 4 9  ? -16.144 112.050 17.098  1.00 82.90 ? 141 ARG C CA    1 
ATOM 2347 C C     . ARG E 4 9  ? -16.892 111.442 15.909  1.00 82.90 ? 141 ARG C C     1 
ATOM 2348 O O     . ARG E 4 9  ? -17.520 110.383 16.035  1.00 82.90 ? 141 ARG C O     1 
ATOM 2349 C CB    . ARG E 4 9  ? -17.122 112.780 18.027  1.00 82.90 ? 141 ARG C CB    1 
ATOM 2350 C CG    . ARG E 4 9  ? -18.157 111.872 18.658  1.00 82.90 ? 141 ARG C CG    1 
ATOM 2351 C CD    . ARG E 4 9  ? -18.826 112.496 19.882  1.00 82.90 ? 141 ARG C CD    1 
ATOM 2352 N NE    . ARG E 4 9  ? -19.666 113.653 19.577  1.00 82.90 ? 141 ARG C NE    1 
ATOM 2353 C CZ    . ARG E 4 9  ? -20.611 114.118 20.393  1.00 82.90 ? 141 ARG C CZ    1 
ATOM 2354 N NH1   . ARG E 4 9  ? -20.837 113.523 21.559  1.00 82.90 ? 141 ARG C NH1   1 
ATOM 2355 N NH2   . ARG E 4 9  ? -21.330 115.181 20.052  1.00 82.90 ? 141 ARG C NH2   1 
ATOM 2356 N N     . GLY E 4 10 ? -16.813 112.105 14.756  1.00 82.90 ? 142 GLY C N     1 
ATOM 2357 C CA    . GLY E 4 10 ? -17.500 111.622 13.569  1.00 82.90 ? 142 GLY C CA    1 
ATOM 2358 C C     . GLY E 4 10 ? -18.905 112.193 13.485  1.00 82.90 ? 142 GLY C C     1 
ATOM 2359 O O     . GLY E 4 10 ? -19.321 112.968 14.355  1.00 82.90 ? 142 GLY C O     1 
ATOM 2360 N N     . ARG E 4 11 ? -19.647 111.821 12.446  1.00 46.39 ? 143 ARG C N     1 
ATOM 2361 C CA    . ARG E 4 11 ? -21.004 112.333 12.295  1.00 46.39 ? 143 ARG C CA    1 
ATOM 2362 C C     . ARG E 4 11 ? -21.956 111.812 13.367  1.00 46.39 ? 143 ARG C C     1 
ATOM 2363 O O     . ARG E 4 11 ? -22.361 110.657 13.337  1.00 46.39 ? 143 ARG C O     1 
ATOM 2364 C CB    . ARG E 4 11 ? -21.560 111.986 10.912  1.00 36.95 ? 143 ARG C CB    1 
ATOM 2365 C CG    . ARG E 4 11 ? -23.042 112.363 10.757  1.00 36.95 ? 143 ARG C CG    1 
ATOM 2366 C CD    . ARG E 4 11 ? -23.553 112.060 9.354   1.00 36.95 ? 143 ARG C CD    1 
ATOM 2367 N NE    . ARG E 4 11 ? -24.987 112.313 9.202   1.00 36.95 ? 143 ARG C NE    1 
ATOM 2368 C CZ    . ARG E 4 11 ? -25.647 112.178 8.054   1.00 36.95 ? 143 ARG C CZ    1 
ATOM 2369 N NH1   . ARG E 4 11 ? -25.009 111.792 6.951   1.00 36.95 ? 143 ARG C NH1   1 
ATOM 2370 N NH2   . ARG E 4 11 ? -26.948 112.431 8.012   1.00 36.95 ? 143 ARG C NH2   1 
ATOM 2371 N N     . VAL E 4 12 ? -22.324 112.666 14.311  1.00 32.57 ? 144 VAL C N     1 
ATOM 2372 C CA    . VAL E 4 12 ? -23.241 112.258 15.375  1.00 32.57 ? 144 VAL C CA    1 
ATOM 2373 C C     . VAL E 4 12 ? -24.677 111.985 14.906  1.00 32.57 ? 144 VAL C C     1 
ATOM 2374 O O     . VAL E 4 12 ? -25.261 112.765 14.147  1.00 32.57 ? 144 VAL C O     1 
ATOM 2375 C CB    . VAL E 4 12 ? -23.299 113.319 16.513  1.00 50.20 ? 144 VAL C CB    1 
ATOM 2376 C CG1   . VAL E 4 12 ? -24.505 113.052 17.434  1.00 50.20 ? 144 VAL C CG1   1 
ATOM 2377 C CG2   . VAL E 4 12 ? -22.008 113.276 17.321  1.00 50.20 ? 144 VAL C CG2   1 
ATOM 2378 N N     . LYS E 4 13 ? -25.239 110.875 15.375  1.00 67.46 ? 145 LYS C N     1 
ATOM 2379 C CA    . LYS E 4 13 ? -26.605 110.499 15.033  1.00 67.46 ? 145 LYS C CA    1 
ATOM 2380 C C     . LYS E 4 13 ? -27.530 111.388 15.867  1.00 67.46 ? 145 LYS C C     1 
ATOM 2381 O O     . LYS E 4 13 ? -27.879 111.047 16.994  1.00 67.46 ? 145 LYS C O     1 
ATOM 2382 C CB    . LYS E 4 13 ? -26.832 109.011 15.358  1.00 63.22 ? 145 LYS C CB    1 
ATOM 2383 C CG    . LYS E 4 13 ? -28.124 108.392 14.810  1.00 63.22 ? 145 LYS C CG    1 
ATOM 2384 C CD    . LYS E 4 13 ? -29.376 108.898 15.514  1.00 63.22 ? 145 LYS C CD    1 
ATOM 2385 C CE    . LYS E 4 13 ? -30.629 108.283 14.904  1.00 63.22 ? 145 LYS C CE    1 
ATOM 2386 N NZ    . LYS E 4 13 ? -31.891 108.851 15.469  1.00 63.22 ? 145 LYS C NZ    1 
ATOM 2387 N N     . ILE E 4 14 ? -27.911 112.535 15.315  1.00 58.25 ? 146 ILE C N     1 
ATOM 2388 C CA    . ILE E 4 14 ? -28.786 113.471 16.014  1.00 58.25 ? 146 ILE C CA    1 
ATOM 2389 C C     . ILE E 4 14 ? -30.264 113.091 15.890  1.00 58.25 ? 146 ILE C C     1 
ATOM 2390 O O     . ILE E 4 14 ? -30.682 112.503 14.889  1.00 58.25 ? 146 ILE C O     1 
ATOM 2391 C CB    . ILE E 4 14 ? -28.606 114.895 15.471  1.00 82.90 ? 146 ILE C CB    1 
ATOM 2392 C CG1   . ILE E 4 14 ? -29.692 115.807 16.051  1.00 82.90 ? 146 ILE C CG1   1 
ATOM 2393 C CG2   . ILE E 4 14 ? -28.636 114.875 13.950  1.00 82.90 ? 146 ILE C CG2   1 
ATOM 2394 C CD1   . ILE E 4 14 ? -29.749 117.191 15.443  1.00 82.90 ? 146 ILE C CD1   1 
ATOM 2395 N N     . LYS E 4 15 ? -31.051 113.442 16.906  1.00 39.86 ? 147 LYS C N     1 
ATOM 2396 C CA    . LYS E 4 15 ? -32.482 113.136 16.919  1.00 39.86 ? 147 LYS C CA    1 
ATOM 2397 C C     . LYS E 4 15 ? -33.289 113.993 15.945  1.00 39.86 ? 147 LYS C C     1 
ATOM 2398 O O     . LYS E 4 15 ? -33.122 115.209 15.889  1.00 39.86 ? 147 LYS C O     1 
ATOM 2399 C CB    . LYS E 4 15 ? -33.065 113.322 18.328  1.00 53.51 ? 147 LYS C CB    1 
ATOM 2400 C CG    . LYS E 4 15 ? -34.577 113.079 18.380  1.00 53.51 ? 147 LYS C CG    1 
ATOM 2401 C CD    . LYS E 4 15 ? -35.214 113.477 19.707  1.00 53.51 ? 147 LYS C CD    1 
ATOM 2402 C CE    . LYS E 4 15 ? -36.731 113.278 19.656  1.00 53.51 ? 147 LYS C CE    1 
ATOM 2403 N NZ    . LYS E 4 15 ? -37.439 113.677 20.904  1.00 53.51 ? 147 LYS C NZ    1 
ATOM 2404 N N     . MET E 4 16 ? -34.182 113.356 15.194  1.00 24.43 ? 148 MET C N     1 
ATOM 2405 C CA    . MET E 4 16 ? -35.010 114.088 14.249  1.00 24.43 ? 148 MET C CA    1 
ATOM 2406 C C     . MET E 4 16 ? -36.070 114.932 14.927  1.00 24.43 ? 148 MET C C     1 
ATOM 2407 O O     . MET E 4 16 ? -37.275 114.672 14.825  1.00 24.43 ? 148 MET C O     1 
ATOM 2408 C CB    . MET E 4 16 ? -35.658 113.142 13.243  1.00 41.83 ? 148 MET C CB    1 
ATOM 2409 C CG    . MET E 4 16 ? -34.849 113.012 11.949  1.00 41.83 ? 148 MET C CG    1 
ATOM 2410 S SD    . MET E 4 16 ? -34.699 114.593 11.081  1.00 41.83 ? 148 MET C SD    1 
ATOM 2411 C CE    . MET E 4 16 ? -36.337 115.242 11.353  1.00 41.83 ? 148 MET C CE    1 
ATOM 2412 N N     . GLU E 4 17 ? -35.588 115.953 15.622  1.00 67.68 ? 149 GLU C N     1 
ATOM 2413 C CA    . GLU E 4 17 ? -36.434 116.899 16.321  1.00 67.68 ? 149 GLU C CA    1 
ATOM 2414 C C     . GLU E 4 17 ? -35.775 118.264 16.147  1.00 67.68 ? 149 GLU C C     1 
ATOM 2415 O O     . GLU E 4 17 ? -34.550 118.349 16.025  1.00 67.68 ? 149 GLU C O     1 
ATOM 2416 C CB    . GLU E 4 17 ? -36.525 116.543 17.807  1.00 64.06 ? 149 GLU C CB    1 
ATOM 2417 C CG    . GLU E 4 17 ? -37.374 117.511 18.621  1.00 64.06 ? 149 GLU C CG    1 
ATOM 2418 C CD    . GLU E 4 17 ? -37.492 117.104 20.071  1.00 64.06 ? 149 GLU C CD    1 
ATOM 2419 O OE1   . GLU E 4 17 ? -36.446 116.892 20.717  1.00 64.06 ? 149 GLU C OE1   1 
ATOM 2420 O OE2   . GLU E 4 17 ? -38.632 117.002 20.566  1.00 64.06 ? 149 GLU C OE2   1 
ATOM 2421 N N     . PHE E 4 18 ? -36.587 119.320 16.127  1.00 55.26 ? 150 PHE C N     1 
ATOM 2422 C CA    . PHE E 4 18 ? -36.083 120.681 15.966  1.00 55.26 ? 150 PHE C CA    1 
ATOM 2423 C C     . PHE E 4 18 ? -34.898 120.996 16.863  1.00 55.26 ? 150 PHE C C     1 
ATOM 2424 O O     . PHE E 4 18 ? -34.994 120.930 18.089  1.00 55.26 ? 150 PHE C O     1 
ATOM 2425 C CB    . PHE E 4 18 ? -37.195 121.696 16.245  1.00 68.93 ? 150 PHE C CB    1 
ATOM 2426 C CG    . PHE E 4 18 ? -36.706 123.122 16.368  1.00 68.93 ? 150 PHE C CG    1 
ATOM 2427 C CD1   . PHE E 4 18 ? -35.931 123.701 15.370  1.00 68.93 ? 150 PHE C CD1   1 
ATOM 2428 C CD2   . PHE E 4 18 ? -37.038 123.892 17.480  1.00 68.93 ? 150 PHE C CD2   1 
ATOM 2429 C CE1   . PHE E 4 18 ? -35.497 125.018 15.478  1.00 68.93 ? 150 PHE C CE1   1 
ATOM 2430 C CE2   . PHE E 4 18 ? -36.606 125.211 17.593  1.00 68.93 ? 150 PHE C CE2   1 
ATOM 2431 C CZ    . PHE E 4 18 ? -35.836 125.771 16.590  1.00 68.93 ? 150 PHE C CZ    1 
ATOM 2432 N N     . ILE E 4 19 ? -33.779 121.339 16.238  1.00 47.92 ? 151 ILE C N     1 
ATOM 2433 C CA    . ILE E 4 19 ? -32.575 121.700 16.967  1.00 47.92 ? 151 ILE C CA    1 
ATOM 2434 C C     . ILE E 4 19 ? -32.872 122.948 17.787  1.00 47.92 ? 151 ILE C C     1 
ATOM 2435 O O     . ILE E 4 19 ? -33.576 123.844 17.313  1.00 47.92 ? 151 ILE C O     1 
ATOM 2436 C CB    . ILE E 4 19 ? -31.441 122.026 16.006  1.00 40.96 ? 151 ILE C CB    1 
ATOM 2437 C CG1   . ILE E 4 19 ? -31.040 120.764 15.234  1.00 40.96 ? 151 ILE C CG1   1 
ATOM 2438 C CG2   . ILE E 4 19 ? -30.285 122.649 16.773  1.00 40.96 ? 151 ILE C CG2   1 
ATOM 2439 C CD1   . ILE E 4 19 ? -29.974 120.998 14.174  1.00 40.96 ? 151 ILE C CD1   1 
ATOM 2440 N N     . ASP E 4 20 ? -32.337 123.033 19.002  1.00 68.97 ? 152 ASP C N     1 
ATOM 2441 C CA    . ASP E 4 20 ? -32.625 124.204 19.814  1.00 68.97 ? 152 ASP C CA    1 
ATOM 2442 C C     . ASP E 4 20 ? -31.503 125.221 19.881  1.00 68.97 ? 152 ASP C C     1 
ATOM 2443 O O     . ASP E 4 20 ? -31.739 126.385 20.205  1.00 68.97 ? 152 ASP C O     1 
ATOM 2444 C CB    . ASP E 4 20 ? -33.036 123.794 21.227  1.00 43.84 ? 152 ASP C CB    1 
ATOM 2445 C CG    . ASP E 4 20 ? -33.944 124.826 21.879  1.00 43.84 ? 152 ASP C CG    1 
ATOM 2446 O OD1   . ASP E 4 20 ? -33.478 125.955 22.131  1.00 43.84 ? 152 ASP C OD1   1 
ATOM 2447 O OD2   . ASP E 4 20 ? -35.130 124.521 22.120  1.00 43.84 ? 152 ASP C OD2   1 
ATOM 2448 N N     . ASN E 4 21 ? -30.290 124.794 19.559  1.00 47.27 ? 153 ASN C N     1 
ATOM 2449 C CA    . ASN E 4 21 ? -29.136 125.691 19.599  1.00 47.27 ? 153 ASN C CA    1 
ATOM 2450 C C     . ASN E 4 21 ? -29.055 126.606 18.371  1.00 47.27 ? 153 ASN C C     1 
ATOM 2451 O O     . ASN E 4 21 ? -28.431 126.256 17.373  1.00 47.27 ? 153 ASN C O     1 
ATOM 2452 C CB    . ASN E 4 21 ? -27.851 124.870 19.718  1.00 63.31 ? 153 ASN C CB    1 
ATOM 2453 C CG    . ASN E 4 21 ? -26.606 125.728 19.709  1.00 63.31 ? 153 ASN C CG    1 
ATOM 2454 O OD1   . ASN E 4 21 ? -26.358 126.474 18.761  1.00 63.31 ? 153 ASN C OD1   1 
ATOM 2455 N ND2   . ASN E 4 21 ? -25.809 125.624 20.768  1.00 63.31 ? 153 ASN C ND2   1 
ATOM 2456 N N     . LYS E 4 22 ? -29.676 127.781 18.460  1.00 79.75 ? 154 LYS C N     1 
ATOM 2457 C CA    . LYS E 4 22 ? -29.692 128.751 17.362  1.00 79.75 ? 154 LYS C CA    1 
ATOM 2458 C C     . LYS E 4 22 ? -28.553 128.589 16.350  1.00 79.75 ? 154 LYS C C     1 
ATOM 2459 O O     . LYS E 4 22 ? -28.785 128.639 15.143  1.00 79.75 ? 154 LYS C O     1 
ATOM 2460 C CB    . LYS E 4 22 ? -29.689 130.171 17.924  1.00 38.13 ? 154 LYS C CB    1 
ATOM 2461 N N     . LEU E 4 23 ? -27.330 128.392 16.842  1.00 62.88 ? 155 LEU C N     1 
ATOM 2462 C CA    . LEU E 4 23 ? -26.164 128.228 15.975  1.00 62.88 ? 155 LEU C CA    1 
ATOM 2463 C C     . LEU E 4 23 ? -26.187 126.935 15.155  1.00 62.88 ? 155 LEU C C     1 
ATOM 2464 O O     . LEU E 4 23 ? -26.328 126.979 13.930  1.00 62.88 ? 155 LEU C O     1 
ATOM 2465 C CB    . LEU E 4 23 ? -24.886 128.294 16.802  1.00 38.68 ? 155 LEU C CB    1 
ATOM 2466 N N     . ARG E 4 24 ? -26.038 125.790 15.826  1.00 54.07 ? 156 ARG C N     1 
ATOM 2467 C CA    . ARG E 4 24 ? -26.038 124.485 15.152  1.00 54.07 ? 156 ARG C CA    1 
ATOM 2468 C C     . ARG E 4 24 ? -27.090 124.474 14.059  1.00 54.07 ? 156 ARG C C     1 
ATOM 2469 O O     . ARG E 4 24 ? -26.768 124.417 12.879  1.00 54.07 ? 156 ARG C O     1 
ATOM 2470 C CB    . ARG E 4 24 ? -26.319 123.377 16.146  1.00 35.96 ? 156 ARG C CB    1 
ATOM 2471 N N     . ARG E 4 25 ? -28.350 124.533 14.469  1.00 46.05 ? 157 ARG C N     1 
ATOM 2472 C CA    . ARG E 4 25 ? -29.477 124.566 13.544  1.00 46.05 ? 157 ARG C CA    1 
ATOM 2473 C C     . ARG E 4 25 ? -29.037 125.199 12.221  1.00 46.05 ? 157 ARG C C     1 
ATOM 2474 O O     . ARG E 4 25 ? -28.988 124.540 11.178  1.00 46.05 ? 157 ARG C O     1 
ATOM 2475 C CB    . ARG E 4 25 ? -30.602 125.398 14.161  1.00 71.97 ? 157 ARG C CB    1 
ATOM 2476 C CG    . ARG E 4 25 ? -31.908 125.382 13.400  1.00 71.97 ? 157 ARG C CG    1 
ATOM 2477 C CD    . ARG E 4 25 ? -32.755 126.573 13.802  1.00 71.97 ? 157 ARG C CD    1 
ATOM 2478 N NE    . ARG E 4 25 ? -32.755 126.766 15.249  1.00 71.97 ? 157 ARG C NE    1 
ATOM 2479 C CZ    . ARG E 4 25 ? -33.230 127.847 15.859  1.00 71.97 ? 157 ARG C CZ    1 
ATOM 2480 N NH1   . ARG E 4 25 ? -33.748 128.835 15.144  1.00 71.97 ? 157 ARG C NH1   1 
ATOM 2481 N NH2   . ARG E 4 25 ? -33.178 127.946 17.184  1.00 71.97 ? 157 ARG C NH2   1 
ATOM 2482 N N     . TYR E 4 26 ? -28.705 126.484 12.288  1.00 21.17 ? 158 TYR C N     1 
ATOM 2483 C CA    . TYR E 4 26 ? -28.266 127.227 11.119  1.00 21.17 ? 158 TYR C CA    1 
ATOM 2484 C C     . TYR E 4 26 ? -27.219 126.462 10.323  1.00 21.17 ? 158 TYR C C     1 
ATOM 2485 O O     . TYR E 4 26 ? -27.331 126.326 9.095   1.00 21.17 ? 158 TYR C O     1 
ATOM 2486 C CB    . TYR E 4 26 ? -27.676 128.589 11.527  1.00 36.06 ? 158 TYR C CB    1 
ATOM 2487 C CG    . TYR E 4 26 ? -27.123 129.381 10.350  1.00 36.06 ? 158 TYR C CG    1 
ATOM 2488 C CD1   . TYR E 4 26 ? -27.972 129.899 9.382   1.00 36.06 ? 158 TYR C CD1   1 
ATOM 2489 C CD2   . TYR E 4 26 ? -25.752 129.567 10.183  1.00 36.06 ? 158 TYR C CD2   1 
ATOM 2490 C CE1   . TYR E 4 26 ? -27.477 130.583 8.271   1.00 36.06 ? 158 TYR C CE1   1 
ATOM 2491 C CE2   . TYR E 4 26 ? -25.241 130.255 9.069   1.00 36.06 ? 158 TYR C CE2   1 
ATOM 2492 C CZ    . TYR E 4 26 ? -26.115 130.760 8.116   1.00 36.06 ? 158 TYR C CZ    1 
ATOM 2493 O OH    . TYR E 4 26 ? -25.652 131.444 7.009   1.00 36.06 ? 158 TYR C OH    1 
ATOM 2494 N N     . THR E 4 27 ? -26.196 125.987 11.026  1.00 29.20 ? 159 THR C N     1 
ATOM 2495 C CA    . THR E 4 27 ? -25.110 125.248 10.390  1.00 29.20 ? 159 THR C CA    1 
ATOM 2496 C C     . THR E 4 27 ? -25.666 124.046 9.627   1.00 29.20 ? 159 THR C C     1 
ATOM 2497 O O     . THR E 4 27 ? -25.240 123.764 8.500   1.00 29.20 ? 159 THR C O     1 
ATOM 2498 C CB    . THR E 4 27 ? -24.087 124.773 11.431  1.00 42.87 ? 159 THR C CB    1 
ATOM 2499 O OG1   . THR E 4 27 ? -24.283 125.500 12.652  1.00 42.87 ? 159 THR C OG1   1 
ATOM 2500 C CG2   . THR E 4 27 ? -22.659 125.018 10.924  1.00 42.87 ? 159 THR C CG2   1 
ATOM 2501 N N     . THR E 4 28 ? -26.625 123.352 10.245  1.00 33.95 ? 160 THR C N     1 
ATOM 2502 C CA    . THR E 4 28 ? -27.276 122.202 9.621   1.00 33.95 ? 160 THR C CA    1 
ATOM 2503 C C     . THR E 4 28 ? -28.082 122.706 8.434   1.00 33.95 ? 160 THR C C     1 
ATOM 2504 O O     . THR E 4 28 ? -27.909 122.239 7.306   1.00 33.95 ? 160 THR C O     1 
ATOM 2505 C CB    . THR E 4 28 ? -28.245 121.491 10.583  1.00 11.74 ? 160 THR C CB    1 
ATOM 2506 O OG1   . THR E 4 28 ? -27.512 120.915 11.663  1.00 11.74 ? 160 THR C OG1   1 
ATOM 2507 C CG2   . THR E 4 28 ? -28.949 120.373 9.882   1.00 11.74 ? 160 THR C CG2   1 
ATOM 2508 N N     . PHE E 4 29 ? -28.950 123.679 8.693   1.00 25.38 ? 161 PHE C N     1 
ATOM 2509 C CA    . PHE E 4 29 ? -29.781 124.235 7.639   1.00 25.38 ? 161 PHE C CA    1 
ATOM 2510 C C     . PHE E 4 29 ? -29.031 124.528 6.346   1.00 25.38 ? 161 PHE C C     1 
ATOM 2511 O O     . PHE E 4 29 ? -29.487 124.169 5.259   1.00 25.38 ? 161 PHE C O     1 
ATOM 2512 C CB    . PHE E 4 29 ? -30.476 125.513 8.111   1.00 26.95 ? 161 PHE C CB    1 
ATOM 2513 C CG    . PHE E 4 29 ? -31.344 126.150 7.054   1.00 26.95 ? 161 PHE C CG    1 
ATOM 2514 C CD1   . PHE E 4 29 ? -30.776 126.889 6.014   1.00 26.95 ? 161 PHE C CD1   1 
ATOM 2515 C CD2   . PHE E 4 29 ? -32.720 125.971 7.067   1.00 26.95 ? 161 PHE C CD2   1 
ATOM 2516 C CE1   . PHE E 4 29 ? -31.559 127.440 4.999   1.00 26.95 ? 161 PHE C CE1   1 
ATOM 2517 C CE2   . PHE E 4 29 ? -33.518 126.515 6.057   1.00 26.95 ? 161 PHE C CE2   1 
ATOM 2518 C CZ    . PHE E 4 29 ? -32.928 127.253 5.018   1.00 26.95 ? 161 PHE C CZ    1 
ATOM 2519 N N     . SER E 4 30 ? -27.885 125.182 6.458   1.00 28.59 ? 162 SER C N     1 
ATOM 2520 C CA    . SER E 4 30 ? -27.124 125.538 5.269   1.00 28.59 ? 162 SER C CA    1 
ATOM 2521 C C     . SER E 4 30 ? -26.524 124.344 4.557   1.00 28.59 ? 162 SER C C     1 
ATOM 2522 O O     . SER E 4 30 ? -26.398 124.346 3.329   1.00 28.59 ? 162 SER C O     1 
ATOM 2523 C CB    . SER E 4 30 ? -26.020 126.524 5.637   1.00 62.06 ? 162 SER C CB    1 
ATOM 2524 O OG    . SER E 4 30 ? -26.570 127.643 6.304   1.00 62.06 ? 162 SER C OG    1 
ATOM 2525 N N     . LYS E 4 31 ? -26.154 123.324 5.325   1.00 27.68 ? 163 LYS C N     1 
ATOM 2526 C CA    . LYS E 4 31 ? -25.545 122.140 4.741   1.00 27.68 ? 163 LYS C CA    1 
ATOM 2527 C C     . LYS E 4 31 ? -26.558 121.252 4.062   1.00 27.68 ? 163 LYS C C     1 
ATOM 2528 O O     . LYS E 4 31 ? -26.405 120.923 2.889   1.00 27.68 ? 163 LYS C O     1 
ATOM 2529 C CB    . LYS E 4 31 ? -24.756 121.363 5.801   1.00 26.14 ? 163 LYS C CB    1 
ATOM 2530 C CG    . LYS E 4 31 ? -23.333 121.900 5.978   1.00 26.14 ? 163 LYS C CG    1 
ATOM 2531 C CD    . LYS E 4 31 ? -22.503 121.095 6.959   1.00 26.14 ? 163 LYS C CD    1 
ATOM 2532 C CE    . LYS E 4 31 ? -20.998 121.360 6.762   1.00 26.14 ? 163 LYS C CE    1 
ATOM 2533 N NZ    . LYS E 4 31 ? -20.109 120.739 7.814   1.00 26.14 ? 163 LYS C NZ    1 
ATOM 2534 N N     . ARG E 4 32 ? -27.601 120.877 4.789   1.00 33.04 ? 164 ARG C N     1 
ATOM 2535 C CA    . ARG E 4 32 ? -28.636 120.028 4.226   1.00 33.04 ? 164 ARG C CA    1 
ATOM 2536 C C     . ARG E 4 32 ? -29.218 120.722 2.996   1.00 33.04 ? 164 ARG C C     1 
ATOM 2537 O O     . ARG E 4 32 ? -29.532 120.073 1.993   1.00 33.04 ? 164 ARG C O     1 
ATOM 2538 C CB    . ARG E 4 32 ? -29.728 119.781 5.264   1.00 29.36 ? 164 ARG C CB    1 
ATOM 2539 C CG    . ARG E 4 32 ? -29.199 119.312 6.615   1.00 29.36 ? 164 ARG C CG    1 
ATOM 2540 C CD    . ARG E 4 32 ? -28.898 117.820 6.681   1.00 29.36 ? 164 ARG C CD    1 
ATOM 2541 N NE    . ARG E 4 32 ? -30.075 117.072 7.100   1.00 29.36 ? 164 ARG C NE    1 
ATOM 2542 C CZ    . ARG E 4 32 ? -30.040 115.882 7.690   1.00 29.36 ? 164 ARG C CZ    1 
ATOM 2543 N NH1   . ARG E 4 32 ? -28.885 115.288 7.938   1.00 29.36 ? 164 ARG C NH1   1 
ATOM 2544 N NH2   . ARG E 4 32 ? -31.165 115.281 8.039   1.00 29.36 ? 164 ARG C NH2   1 
ATOM 2545 N N     . LYS E 4 33 ? -29.347 122.045 3.065   1.00 15.31 ? 165 LYS C N     1 
ATOM 2546 C CA    . LYS E 4 33 ? -29.883 122.795 1.942   1.00 15.31 ? 165 LYS C CA    1 
ATOM 2547 C C     . LYS E 4 33 ? -29.040 122.573 0.697   1.00 15.31 ? 165 LYS C C     1 
ATOM 2548 O O     . LYS E 4 33 ? -29.559 122.170 -0.332  1.00 15.31 ? 165 LYS C O     1 
ATOM 2549 C CB    . LYS E 4 33 ? -29.947 124.288 2.258   1.00 16.82 ? 165 LYS C CB    1 
ATOM 2550 C CG    . LYS E 4 33 ? -30.836 125.079 1.299   1.00 16.82 ? 165 LYS C CG    1 
ATOM 2551 C CD    . LYS E 4 33 ? -30.842 126.557 1.652   1.00 16.82 ? 165 LYS C CD    1 
ATOM 2552 C CE    . LYS E 4 33 ? -29.874 127.353 0.793   1.00 16.82 ? 165 LYS C CE    1 
ATOM 2553 N NZ    . LYS E 4 33 ? -30.431 127.570 -0.578  1.00 16.82 ? 165 LYS C NZ    1 
ATOM 2554 N N     . THR E 4 34 ? -27.744 122.829 0.776   1.00 23.71 ? 166 THR C N     1 
ATOM 2555 C CA    . THR E 4 34 ? -26.915 122.611 -0.394  1.00 23.71 ? 166 THR C CA    1 
ATOM 2556 C C     . THR E 4 34 ? -27.065 121.161 -0.813  1.00 23.71 ? 166 THR C C     1 
ATOM 2557 O O     . THR E 4 34 ? -27.131 120.861 -1.998  1.00 23.71 ? 166 THR C O     1 
ATOM 2558 C CB    . THR E 4 34 ? -25.425 122.870 -0.120  1.00 34.75 ? 166 THR C CB    1 
ATOM 2559 O OG1   . THR E 4 34 ? -25.251 124.228 0.291   1.00 34.75 ? 166 THR C OG1   1 
ATOM 2560 C CG2   . THR E 4 34 ? -24.596 122.625 -1.385  1.00 34.75 ? 166 THR C CG2   1 
ATOM 2561 N N     . GLY E 4 35 ? -27.123 120.263 0.162   1.00 20.28 ? 167 GLY C N     1 
ATOM 2562 C CA    . GLY E 4 35 ? -27.269 118.856 -0.153  1.00 20.28 ? 167 GLY C CA    1 
ATOM 2563 C C     . GLY E 4 35 ? -28.564 118.487 -0.863  1.00 20.28 ? 167 GLY C C     1 
ATOM 2564 O O     . GLY E 4 35 ? -28.537 117.872 -1.934  1.00 20.28 ? 167 GLY C O     1 
ATOM 2565 N N     . ILE E 4 36 ? -29.702 118.860 -0.283  1.00 12.54 ? 168 ILE C N     1 
ATOM 2566 C CA    . ILE E 4 36 ? -30.985 118.527 -0.888  1.00 12.54 ? 168 ILE C CA    1 
ATOM 2567 C C     . ILE E 4 36 ? -31.139 119.136 -2.282  1.00 12.54 ? 168 ILE C C     1 
ATOM 2568 O O     . ILE E 4 36 ? -31.701 118.511 -3.184  1.00 12.54 ? 168 ILE C O     1 
ATOM 2569 C CB    . ILE E 4 36 ? -32.153 118.991 -0.005  1.00 9.33  ? 168 ILE C CB    1 
ATOM 2570 C CG1   . ILE E 4 36 ? -33.441 118.286 -0.450  1.00 9.33  ? 168 ILE C CG1   1 
ATOM 2571 C CG2   . ILE E 4 36 ? -32.280 120.520 -0.068  1.00 9.33  ? 168 ILE C CG2   1 
ATOM 2572 C CD1   . ILE E 4 36 ? -34.588 118.442 0.512   1.00 9.33  ? 168 ILE C CD1   1 
ATOM 2573 N N     . MET E 4 37 ? -30.658 120.364 -2.450  1.00 29.64 ? 169 MET C N     1 
ATOM 2574 C CA    . MET E 4 37 ? -30.724 121.017 -3.746  1.00 29.64 ? 169 MET C CA    1 
ATOM 2575 C C     . MET E 4 37 ? -29.864 120.186 -4.684  1.00 29.64 ? 169 MET C C     1 
ATOM 2576 O O     . MET E 4 37 ? -30.189 120.026 -5.853  1.00 29.64 ? 169 MET C O     1 
ATOM 2577 C CB    . MET E 4 37 ? -30.163 122.434 -3.675  1.00 19.26 ? 169 MET C CB    1 
ATOM 2578 C CG    . MET E 4 37 ? -30.958 123.408 -2.817  1.00 19.26 ? 169 MET C CG    1 
ATOM 2579 S SD    . MET E 4 37 ? -32.366 124.142 -3.655  1.00 19.26 ? 169 MET C SD    1 
ATOM 2580 C CE    . MET E 4 37 ? -33.457 124.390 -2.287  1.00 19.26 ? 169 MET C CE    1 
ATOM 2581 N N     . LYS E 4 38 ? -28.759 119.656 -4.170  1.00 24.54 ? 170 LYS C N     1 
ATOM 2582 C CA    . LYS E 4 38 ? -27.889 118.840 -4.997  1.00 24.54 ? 170 LYS C CA    1 
ATOM 2583 C C     . LYS E 4 38 ? -28.749 117.701 -5.493  1.00 24.54 ? 170 LYS C C     1 
ATOM 2584 O O     . LYS E 4 38 ? -28.731 117.368 -6.678  1.00 24.54 ? 170 LYS C O     1 
ATOM 2585 C CB    . LYS E 4 38 ? -26.717 118.285 -4.192  1.00 54.38 ? 170 LYS C CB    1 
ATOM 2586 C CG    . LYS E 4 38 ? -25.555 117.814 -5.059  1.00 54.38 ? 170 LYS C CG    1 
ATOM 2587 C CD    . LYS E 4 38 ? -24.339 117.392 -4.225  1.00 54.38 ? 170 LYS C CD    1 
ATOM 2588 C CE    . LYS E 4 38 ? -23.052 117.319 -5.065  1.00 54.38 ? 170 LYS C CE    1 
ATOM 2589 N NZ    . LYS E 4 38 ? -22.608 118.652 -5.619  1.00 54.38 ? 170 LYS C NZ    1 
ATOM 2590 N N     . LYS E 4 39 ? -29.524 117.120 -4.580  1.00 17.23 ? 171 LYS C N     1 
ATOM 2591 C CA    . LYS E 4 39 ? -30.405 116.005 -4.905  1.00 17.23 ? 171 LYS C CA    1 
ATOM 2592 C C     . LYS E 4 39 ? -31.451 116.362 -5.957  1.00 17.23 ? 171 LYS C C     1 
ATOM 2593 O O     . LYS E 4 39 ? -31.551 115.718 -6.993  1.00 17.23 ? 171 LYS C O     1 
ATOM 2594 C CB    . LYS E 4 39 ? -31.079 115.514 -3.635  1.00 21.43 ? 171 LYS C CB    1 
ATOM 2595 C CG    . LYS E 4 39 ? -30.119 114.845 -2.695  1.00 21.43 ? 171 LYS C CG    1 
ATOM 2596 C CD    . LYS E 4 39 ? -30.412 113.358 -2.619  1.00 21.43 ? 171 LYS C CD    1 
ATOM 2597 C CE    . LYS E 4 39 ? -29.230 112.579 -2.047  1.00 21.43 ? 171 LYS C CE    1 
ATOM 2598 N NZ    . LYS E 4 39 ? -28.028 112.585 -2.960  1.00 21.43 ? 171 LYS C NZ    1 
ATOM 2599 N N     . ALA E 4 40 ? -32.232 117.395 -5.697  1.00 22.55 ? 172 ALA C N     1 
ATOM 2600 C CA    . ALA E 4 40 ? -33.247 117.803 -6.654  1.00 22.55 ? 172 ALA C CA    1 
ATOM 2601 C C     . ALA E 4 40 ? -32.638 117.907 -8.056  1.00 22.55 ? 172 ALA C C     1 
ATOM 2602 O O     . ALA E 4 40 ? -33.320 117.735 -9.063  1.00 22.55 ? 172 ALA C O     1 
ATOM 2603 C CB    . ALA E 4 40 ? -33.837 119.134 -6.236  1.00 28.39 ? 172 ALA C CB    1 
ATOM 2604 N N     . TYR E 4 41 ? -31.346 118.187 -8.117  1.00 20.69 ? 173 TYR C N     1 
ATOM 2605 C CA    . TYR E 4 41 ? -30.676 118.319 -9.397  1.00 20.69 ? 173 TYR C CA    1 
ATOM 2606 C C     . TYR E 4 41 ? -30.338 116.943 -9.934  1.00 20.69 ? 173 TYR C C     1 
ATOM 2607 O O     . TYR E 4 41 ? -30.503 116.661 -11.120 1.00 20.69 ? 173 TYR C O     1 
ATOM 2608 C CB    . TYR E 4 41 ? -29.402 119.143 -9.237  1.00 37.18 ? 173 TYR C CB    1 
ATOM 2609 C CG    . TYR E 4 41 ? -28.557 119.149 -10.474 1.00 37.18 ? 173 TYR C CG    1 
ATOM 2610 C CD1   . TYR E 4 41 ? -29.062 119.625 -11.675 1.00 37.18 ? 173 TYR C CD1   1 
ATOM 2611 C CD2   . TYR E 4 41 ? -27.270 118.626 -10.458 1.00 37.18 ? 173 TYR C CD2   1 
ATOM 2612 C CE1   . TYR E 4 41 ? -28.308 119.574 -12.841 1.00 37.18 ? 173 TYR C CE1   1 
ATOM 2613 C CE2   . TYR E 4 41 ? -26.502 118.566 -11.611 1.00 37.18 ? 173 TYR C CE2   1 
ATOM 2614 C CZ    . TYR E 4 41 ? -27.025 119.039 -12.805 1.00 37.18 ? 173 TYR C CZ    1 
ATOM 2615 O OH    . TYR E 4 41 ? -26.272 118.954 -13.963 1.00 37.18 ? 173 TYR C OH    1 
ATOM 2616 N N     . GLU E 4 42 ? -29.855 116.084 -9.048  1.00 20.43 ? 174 GLU C N     1 
ATOM 2617 C CA    . GLU E 4 42 ? -29.499 114.733 -9.437  1.00 20.43 ? 174 GLU C CA    1 
ATOM 2618 C C     . GLU E 4 42 ? -30.775 113.994 -9.873  1.00 20.43 ? 174 GLU C C     1 
ATOM 2619 O O     . GLU E 4 42 ? -30.814 113.385 -10.944 1.00 20.43 ? 174 GLU C O     1 
ATOM 2620 C CB    . GLU E 4 42 ? -28.807 114.027 -8.261  1.00 17.06 ? 174 GLU C CB    1 
ATOM 2621 C CG    . GLU E 4 42 ? -27.704 114.866 -7.652  1.00 17.06 ? 174 GLU C CG    1 
ATOM 2622 C CD    . GLU E 4 42 ? -26.399 114.101 -7.433  1.00 17.06 ? 174 GLU C CD    1 
ATOM 2623 O OE1   . GLU E 4 42 ? -26.349 113.226 -6.532  1.00 17.06 ? 174 GLU C OE1   1 
ATOM 2624 O OE2   . GLU E 4 42 ? -25.415 114.382 -8.161  1.00 17.06 ? 174 GLU C OE2   1 
ATOM 2625 N N     . LEU E 4 43 ? -31.821 114.075 -9.049  1.00 11.66 ? 175 LEU C N     1 
ATOM 2626 C CA    . LEU E 4 43 ? -33.095 113.428 -9.347  1.00 11.66 ? 175 LEU C CA    1 
ATOM 2627 C C     . LEU E 4 43 ? -33.645 113.977 -10.658 1.00 11.66 ? 175 LEU C C     1 
ATOM 2628 O O     . LEU E 4 43 ? -34.042 113.226 -11.551 1.00 11.66 ? 175 LEU C O     1 
ATOM 2629 C CB    . LEU E 4 43 ? -34.100 113.692 -8.232  1.00 4.90  ? 175 LEU C CB    1 
ATOM 2630 C CG    . LEU E 4 43 ? -35.494 113.134 -8.525  1.00 4.90  ? 175 LEU C CG    1 
ATOM 2631 C CD1   . LEU E 4 43 ? -35.376 111.614 -8.608  1.00 4.90  ? 175 LEU C CD1   1 
ATOM 2632 C CD2   . LEU E 4 43 ? -36.507 113.539 -7.442  1.00 4.90  ? 175 LEU C CD2   1 
ATOM 2633 N N     . SER E 4 44 ? -33.669 115.301 -10.757 1.00 27.78 ? 176 SER C N     1 
ATOM 2634 C CA    . SER E 4 44 ? -34.145 115.971 -11.957 1.00 27.78 ? 176 SER C CA    1 
ATOM 2635 C C     . SER E 4 44 ? -33.399 115.426 -13.157 1.00 27.78 ? 176 SER C C     1 
ATOM 2636 O O     . SER E 4 44 ? -33.978 114.785 -14.025 1.00 27.78 ? 176 SER C O     1 
ATOM 2637 C CB    . SER E 4 44 ? -33.882 117.472 -11.864 1.00 29.34 ? 176 SER C CB    1 
ATOM 2638 O OG    . SER E 4 44 ? -33.481 117.978 -13.128 1.00 29.34 ? 176 SER C OG    1 
ATOM 2639 N N     . THR E 4 45 ? -32.099 115.700 -13.178 1.00 24.99 ? 177 THR C N     1 
ATOM 2640 C CA    . THR E 4 45 ? -31.202 115.283 -14.247 1.00 24.99 ? 177 THR C CA    1 
ATOM 2641 C C     . THR E 4 45 ? -31.244 113.802 -14.620 1.00 24.99 ? 177 THR C C     1 
ATOM 2642 O O     . THR E 4 45 ? -31.667 113.461 -15.726 1.00 24.99 ? 177 THR C O     1 
ATOM 2643 C CB    . THR E 4 45 ? -29.751 115.632 -13.899 1.00 25.94 ? 177 THR C CB    1 
ATOM 2644 O OG1   . THR E 4 45 ? -29.581 117.053 -13.897 1.00 25.94 ? 177 THR C OG1   1 
ATOM 2645 C CG2   . THR E 4 45 ? -28.818 115.021 -14.912 1.00 25.94 ? 177 THR C CG2   1 
ATOM 2646 N N     . LEU E 4 46 ? -30.784 112.943 -13.703 1.00 31.43 ? 178 LEU C N     1 
ATOM 2647 C CA    . LEU E 4 46 ? -30.727 111.490 -13.913 1.00 31.43 ? 178 LEU C CA    1 
ATOM 2648 C C     . LEU E 4 46 ? -31.965 110.915 -14.570 1.00 31.43 ? 178 LEU C C     1 
ATOM 2649 O O     . LEU E 4 46 ? -31.879 110.285 -15.622 1.00 31.43 ? 178 LEU C O     1 
ATOM 2650 C CB    . LEU E 4 46 ? -30.516 110.746 -12.592 1.00 4.90  ? 178 LEU C CB    1 
ATOM 2651 C CG    . LEU E 4 46 ? -29.205 110.868 -11.801 1.00 4.90  ? 178 LEU C CG    1 
ATOM 2652 C CD1   . LEU E 4 46 ? -29.333 110.206 -10.424 1.00 4.90  ? 178 LEU C CD1   1 
ATOM 2653 C CD2   . LEU E 4 46 ? -28.074 110.243 -12.601 1.00 4.90  ? 178 LEU C CD2   1 
ATOM 2654 N N     . THR E 4 47 ? -33.117 111.130 -13.942 1.00 17.39 ? 179 THR C N     1 
ATOM 2655 C CA    . THR E 4 47 ? -34.380 110.606 -14.450 1.00 17.39 ? 179 THR C CA    1 
ATOM 2656 C C     . THR E 4 47 ? -35.125 111.570 -15.383 1.00 17.39 ? 179 THR C C     1 
ATOM 2657 O O     . THR E 4 47 ? -36.156 111.221 -15.956 1.00 17.39 ? 179 THR C O     1 
ATOM 2658 C CB    . THR E 4 47 ? -35.296 110.234 -13.275 1.00 18.50 ? 179 THR C CB    1 
ATOM 2659 O OG1   . THR E 4 47 ? -35.919 111.415 -12.745 1.00 18.50 ? 179 THR C OG1   1 
ATOM 2660 C CG2   . THR E 4 47 ? -34.477 109.592 -12.175 1.00 18.50 ? 179 THR C CG2   1 
ATOM 2661 N N     . GLY E 4 48 ? -34.610 112.787 -15.527 1.00 43.04 ? 180 GLY C N     1 
ATOM 2662 C CA    . GLY E 4 48 ? -35.247 113.767 -16.396 1.00 43.04 ? 180 GLY C CA    1 
ATOM 2663 C C     . GLY E 4 48 ? -36.713 113.979 -16.094 1.00 43.04 ? 180 GLY C C     1 
ATOM 2664 O O     . GLY E 4 48 ? -37.558 113.955 -16.982 1.00 43.04 ? 180 GLY C O     1 
ATOM 2665 N N     . THR E 4 49 ? -37.017 114.192 -14.825 1.00 22.55 ? 181 THR C N     1 
ATOM 2666 C CA    . THR E 4 49 ? -38.393 114.404 -14.410 1.00 22.55 ? 181 THR C CA    1 
ATOM 2667 C C     . THR E 4 49 ? -38.556 115.796 -13.790 1.00 22.55 ? 181 THR C C     1 
ATOM 2668 O O     . THR E 4 49 ? -37.630 116.341 -13.186 1.00 22.55 ? 181 THR C O     1 
ATOM 2669 C CB    . THR E 4 49 ? -38.840 113.297 -13.403 1.00 17.20 ? 181 THR C CB    1 
ATOM 2670 O OG1   . THR E 4 49 ? -38.088 113.394 -12.189 1.00 17.20 ? 181 THR C OG1   1 
ATOM 2671 C CG2   . THR E 4 49 ? -38.579 111.918 -13.993 1.00 17.20 ? 181 THR C CG2   1 
ATOM 2672 N N     . GLN E 4 50 ? -39.727 116.390 -13.962 1.00 26.53 ? 182 GLN C N     1 
ATOM 2673 C CA    . GLN E 4 50 ? -39.962 117.707 -13.395 1.00 26.53 ? 182 GLN C CA    1 
ATOM 2674 C C     . GLN E 4 50 ? -39.834 117.608 -11.880 1.00 26.53 ? 182 GLN C C     1 
ATOM 2675 O O     . GLN E 4 50 ? -40.277 116.639 -11.272 1.00 26.53 ? 182 GLN C O     1 
ATOM 2676 C CB    . GLN E 4 50 ? -41.359 118.206 -13.770 1.00 64.16 ? 182 GLN C CB    1 
ATOM 2677 C CG    . GLN E 4 50 ? -41.590 118.347 -15.262 1.00 64.16 ? 182 GLN C CG    1 
ATOM 2678 C CD    . GLN E 4 50 ? -40.454 119.072 -15.955 1.00 64.16 ? 182 GLN C CD    1 
ATOM 2679 O OE1   . GLN E 4 50 ? -39.841 119.975 -15.388 1.00 64.16 ? 182 GLN C OE1   1 
ATOM 2680 N NE2   . GLN E 4 50 ? -40.176 118.688 -17.192 1.00 64.16 ? 182 GLN C NE2   1 
ATOM 2681 N N     . VAL E 4 51 ? -39.224 118.613 -11.276 1.00 12.41 ? 183 VAL C N     1 
ATOM 2682 C CA    . VAL E 4 51 ? -39.030 118.644 -9.834  1.00 12.41 ? 183 VAL C CA    1 
ATOM 2683 C C     . VAL E 4 51 ? -39.034 120.087 -9.373  1.00 12.41 ? 183 VAL C C     1 
ATOM 2684 O O     . VAL E 4 51 ? -38.457 120.959 -10.029 1.00 12.41 ? 183 VAL C O     1 
ATOM 2685 C CB    . VAL E 4 51 ? -37.663 118.050 -9.427  1.00 23.70 ? 183 VAL C CB    1 
ATOM 2686 C CG1   . VAL E 4 51 ? -37.374 118.376 -7.979  1.00 23.70 ? 183 VAL C CG1   1 
ATOM 2687 C CG2   . VAL E 4 51 ? -37.650 116.556 -9.642  1.00 23.70 ? 183 VAL C CG2   1 
ATOM 2688 N N     . LEU E 4 52 ? -39.687 120.343 -8.250  1.00 28.62 ? 184 LEU C N     1 
ATOM 2689 C CA    . LEU E 4 52 ? -39.718 121.685 -7.699  1.00 28.62 ? 184 LEU C CA    1 
ATOM 2690 C C     . LEU E 4 52 ? -39.309 121.606 -6.238  1.00 28.62 ? 184 LEU C C     1 
ATOM 2691 O O     . LEU E 4 52 ? -39.789 120.755 -5.480  1.00 28.62 ? 184 LEU C O     1 
ATOM 2692 C CB    . LEU E 4 52 ? -41.117 122.300 -7.804  1.00 22.09 ? 184 LEU C CB    1 
ATOM 2693 C CG    . LEU E 4 52 ? -41.261 123.646 -7.069  1.00 22.09 ? 184 LEU C CG    1 
ATOM 2694 C CD1   . LEU E 4 52 ? -40.913 124.808 -7.991  1.00 22.09 ? 184 LEU C CD1   1 
ATOM 2695 C CD2   . LEU E 4 52 ? -42.677 123.790 -6.566  1.00 22.09 ? 184 LEU C CD2   1 
ATOM 2696 N N     . LEU E 4 53 ? -38.400 122.482 -5.845  1.00 30.90 ? 185 LEU C N     1 
ATOM 2697 C CA    . LEU E 4 53 ? -37.975 122.502 -4.465  1.00 30.90 ? 185 LEU C CA    1 
ATOM 2698 C C     . LEU E 4 53 ? -37.963 123.940 -3.980  1.00 30.90 ? 185 LEU C C     1 
ATOM 2699 O O     . LEU E 4 53 ? -37.440 124.835 -4.644  1.00 30.90 ? 185 LEU C O     1 
ATOM 2700 C CB    . LEU E 4 53 ? -36.597 121.865 -4.314  1.00 19.01 ? 185 LEU C CB    1 
ATOM 2701 C CG    . LEU E 4 53 ? -36.013 121.992 -2.906  1.00 19.01 ? 185 LEU C CG    1 
ATOM 2702 C CD1   . LEU E 4 53 ? -37.029 121.535 -1.880  1.00 19.01 ? 185 LEU C CD1   1 
ATOM 2703 C CD2   . LEU E 4 53 ? -34.724 121.185 -2.806  1.00 19.01 ? 185 LEU C CD2   1 
ATOM 2704 N N     . LEU E 4 54 ? -38.573 124.158 -2.824  1.00 24.36 ? 186 LEU C N     1 
ATOM 2705 C CA    . LEU E 4 54 ? -38.646 125.485 -2.249  1.00 24.36 ? 186 LEU C CA    1 
ATOM 2706 C C     . LEU E 4 54 ? -38.380 125.397 -0.761  1.00 24.36 ? 186 LEU C C     1 
ATOM 2707 O O     . LEU E 4 54 ? -39.056 124.658 -0.042  1.00 24.36 ? 186 LEU C O     1 
ATOM 2708 C CB    . LEU E 4 54 ? -40.023 126.089 -2.492  1.00 23.37 ? 186 LEU C CB    1 
ATOM 2709 C CG    . LEU E 4 54 ? -40.187 127.516 -1.968  1.00 23.37 ? 186 LEU C CG    1 
ATOM 2710 C CD1   . LEU E 4 54 ? -41.395 128.175 -2.597  1.00 23.37 ? 186 LEU C CD1   1 
ATOM 2711 C CD2   . LEU E 4 54 ? -40.329 127.492 -0.471  1.00 23.37 ? 186 LEU C CD2   1 
ATOM 2712 N N     . VAL E 4 55 ? -37.393 126.162 -0.308  1.00 19.09 ? 187 VAL C N     1 
ATOM 2713 C CA    . VAL E 4 55 ? -37.004 126.192 1.095   1.00 19.09 ? 187 VAL C CA    1 
ATOM 2714 C C     . VAL E 4 55 ? -36.949 127.642 1.526   1.00 19.09 ? 187 VAL C C     1 
ATOM 2715 O O     . VAL E 4 55 ? -36.445 128.482 0.786   1.00 19.09 ? 187 VAL C O     1 
ATOM 2716 C CB    . VAL E 4 55 ? -35.614 125.563 1.294   1.00 32.04 ? 187 VAL C CB    1 
ATOM 2717 C CG1   . VAL E 4 55 ? -35.114 125.818 2.707   1.00 32.04 ? 187 VAL C CG1   1 
ATOM 2718 C CG2   . VAL E 4 55 ? -35.686 124.077 1.023   1.00 32.04 ? 187 VAL C CG2   1 
ATOM 2719 N N     . ALA E 4 56 ? -37.460 127.928 2.722   1.00 47.36 ? 188 ALA C N     1 
ATOM 2720 C CA    . ALA E 4 56 ? -37.479 129.290 3.252   1.00 47.36 ? 188 ALA C CA    1 
ATOM 2721 C C     . ALA E 4 56 ? -36.935 129.349 4.679   1.00 47.36 ? 188 ALA C C     1 
ATOM 2722 O O     . ALA E 4 56 ? -37.512 128.758 5.593   1.00 47.36 ? 188 ALA C O     1 
ATOM 2723 C CB    . ALA E 4 56 ? -38.892 129.828 3.214   1.00 6.69  ? 188 ALA C CB    1 
ATOM 2724 N N     . SER E 4 57 ? -35.834 130.080 4.856   1.00 58.77 ? 189 SER C N     1 
ATOM 2725 C CA    . SER E 4 57 ? -35.171 130.231 6.153   1.00 58.77 ? 189 SER C CA    1 
ATOM 2726 C C     . SER E 4 57 ? -35.945 131.116 7.109   1.00 58.77 ? 189 SER C C     1 
ATOM 2727 O O     . SER E 4 57 ? -36.802 131.884 6.687   1.00 58.77 ? 189 SER C O     1 
ATOM 2728 C CB    . SER E 4 57 ? -33.796 130.849 5.967   1.00 48.38 ? 189 SER C CB    1 
ATOM 2729 O OG    . SER E 4 57 ? -33.927 132.167 5.463   1.00 48.38 ? 189 SER C OG    1 
ATOM 2730 N N     . GLU E 4 58 ? -35.616 131.023 8.396   1.00 42.63 ? 190 GLU C N     1 
ATOM 2731 C CA    . GLU E 4 58 ? -36.274 131.826 9.425   1.00 42.63 ? 190 GLU C CA    1 
ATOM 2732 C C     . GLU E 4 58 ? -36.264 133.308 9.085   1.00 42.63 ? 190 GLU C C     1 
ATOM 2733 O O     . GLU E 4 58 ? -37.165 134.050 9.480   1.00 42.63 ? 190 GLU C O     1 
ATOM 2734 C CB    . GLU E 4 58 ? -35.596 131.614 10.773  1.00 57.27 ? 190 GLU C CB    1 
ATOM 2735 C CG    . GLU E 4 58 ? -36.019 130.341 11.454  1.00 57.27 ? 190 GLU C CG    1 
ATOM 2736 C CD    . GLU E 4 58 ? -35.094 129.956 12.584  1.00 57.27 ? 190 GLU C CD    1 
ATOM 2737 O OE1   . GLU E 4 58 ? -33.975 129.479 12.294  1.00 57.27 ? 190 GLU C OE1   1 
ATOM 2738 O OE2   . GLU E 4 58 ? -35.488 130.133 13.758  1.00 57.27 ? 190 GLU C OE2   1 
ATOM 2739 N N     . THR E 4 59 ? -35.243 133.739 8.353   1.00 49.96 ? 191 THR C N     1 
ATOM 2740 C CA    . THR E 4 59 ? -35.148 135.138 7.963   1.00 49.96 ? 191 THR C CA    1 
ATOM 2741 C C     . THR E 4 59 ? -36.276 135.423 6.982   1.00 49.96 ? 191 THR C C     1 
ATOM 2742 O O     . THR E 4 59 ? -36.803 136.535 6.907   1.00 49.96 ? 191 THR C O     1 
ATOM 2743 C CB    . THR E 4 59 ? -33.820 135.433 7.260   1.00 36.15 ? 191 THR C CB    1 
ATOM 2744 O OG1   . THR E 4 59 ? -33.838 134.866 5.944   1.00 36.15 ? 191 THR C OG1   1 
ATOM 2745 C CG2   . THR E 4 59 ? -32.659 134.843 8.053   1.00 36.15 ? 191 THR C CG2   1 
ATOM 2746 N N     . GLY E 4 60 ? -36.647 134.395 6.235   1.00 56.30 ? 192 GLY C N     1 
ATOM 2747 C CA    . GLY E 4 60 ? -37.698 134.544 5.256   1.00 56.30 ? 192 GLY C CA    1 
ATOM 2748 C C     . GLY E 4 60 ? -37.109 134.432 3.869   1.00 56.30 ? 192 GLY C C     1 
ATOM 2749 O O     . GLY E 4 60 ? -37.839 134.469 2.884   1.00 56.30 ? 192 GLY C O     1 
ATOM 2750 N N     . HIS E 4 61 ? -35.788 134.295 3.784   1.00 29.29 ? 193 HIS C N     1 
ATOM 2751 C CA    . HIS E 4 61 ? -35.140 134.177 2.488   1.00 29.29 ? 193 HIS C CA    1 
ATOM 2752 C C     . HIS E 4 61 ? -35.602 132.868 1.879   1.00 29.29 ? 193 HIS C C     1 
ATOM 2753 O O     . HIS E 4 61 ? -35.478 131.807 2.485   1.00 29.29 ? 193 HIS C O     1 
ATOM 2754 C CB    . HIS E 4 61 ? -33.618 134.191 2.625   1.00 46.23 ? 193 HIS C CB    1 
ATOM 2755 C CG    . HIS E 4 61 ? -32.902 134.270 1.311   1.00 46.23 ? 193 HIS C CG    1 
ATOM 2756 N ND1   . HIS E 4 61 ? -31.943 135.223 1.039   1.00 46.23 ? 193 HIS C ND1   1 
ATOM 2757 C CD2   . HIS E 4 61 ? -32.999 133.508 0.194   1.00 46.23 ? 193 HIS C CD2   1 
ATOM 2758 C CE1   . HIS E 4 61 ? -31.479 135.043 -0.186  1.00 46.23 ? 193 HIS C CE1   1 
ATOM 2759 N NE2   . HIS E 4 61 ? -32.103 134.008 -0.721  1.00 46.23 ? 193 HIS C NE2   1 
ATOM 2760 N N     . VAL E 4 62 ? -36.147 132.948 0.677   1.00 43.86 ? 194 VAL C N     1 
ATOM 2761 C CA    . VAL E 4 62 ? -36.645 131.768 0.020   1.00 43.86 ? 194 VAL C CA    1 
ATOM 2762 C C     . VAL E 4 62 ? -35.723 131.258 -1.069  1.00 43.86 ? 194 VAL C C     1 
ATOM 2763 O O     . VAL E 4 62 ? -35.352 131.997 -1.978  1.00 43.86 ? 194 VAL C O     1 
ATOM 2764 C CB    . VAL E 4 62 ? -37.993 132.046 -0.588  1.00 19.67 ? 194 VAL C CB    1 
ATOM 2765 C CG1   . VAL E 4 62 ? -38.502 130.811 -1.316  1.00 19.67 ? 194 VAL C CG1   1 
ATOM 2766 C CG2   . VAL E 4 62 ? -38.949 132.459 0.493   1.00 19.67 ? 194 VAL C CG2   1 
ATOM 2767 N N     . TYR E 4 63 ? -35.381 129.977 -0.975  1.00 16.75 ? 195 TYR C N     1 
ATOM 2768 C CA    . TYR E 4 63 ? -34.502 129.309 -1.926  1.00 16.75 ? 195 TYR C CA    1 
ATOM 2769 C C     . TYR E 4 63 ? -35.304 128.309 -2.743  1.00 16.75 ? 195 TYR C C     1 
ATOM 2770 O O     . TYR E 4 63 ? -36.171 127.616 -2.210  1.00 16.75 ? 195 TYR C O     1 
ATOM 2771 C CB    . TYR E 4 63 ? -33.413 128.580 -1.153  1.00 25.11 ? 195 TYR C CB    1 
ATOM 2772 C CG    . TYR E 4 63 ? -32.573 129.493 -0.301  1.00 25.11 ? 195 TYR C CG    1 
ATOM 2773 C CD1   . TYR E 4 63 ? -31.549 130.245 -0.862  1.00 25.11 ? 195 TYR C CD1   1 
ATOM 2774 C CD2   . TYR E 4 63 ? -32.792 129.597 1.063   1.00 25.11 ? 195 TYR C CD2   1 
ATOM 2775 C CE1   . TYR E 4 63 ? -30.760 131.071 -0.088  1.00 25.11 ? 195 TYR C CE1   1 
ATOM 2776 C CE2   . TYR E 4 63 ? -32.006 130.422 1.848   1.00 25.11 ? 195 TYR C CE2   1 
ATOM 2777 C CZ    . TYR E 4 63 ? -30.992 131.150 1.263   1.00 25.11 ? 195 TYR C CZ    1 
ATOM 2778 O OH    . TYR E 4 63 ? -30.183 131.939 2.030   1.00 25.11 ? 195 TYR C OH    1 
ATOM 2779 N N     . THR E 4 64 ? -35.001 128.209 -4.031  1.00 33.60 ? 196 THR C N     1 
ATOM 2780 C CA    . THR E 4 64 ? -35.741 127.289 -4.883  1.00 33.60 ? 196 THR C CA    1 
ATOM 2781 C C     . THR E 4 64 ? -34.987 126.636 -6.014  1.00 33.60 ? 196 THR C C     1 
ATOM 2782 O O     . THR E 4 64 ? -34.018 127.168 -6.547  1.00 33.60 ? 196 THR C O     1 
ATOM 2783 C CB    . THR E 4 64 ? -36.900 127.976 -5.581  1.00 27.32 ? 196 THR C CB    1 
ATOM 2784 O OG1   . THR E 4 64 ? -36.372 128.975 -6.473  1.00 27.32 ? 196 THR C OG1   1 
ATOM 2785 C CG2   . THR E 4 64 ? -37.857 128.595 -4.570  1.00 27.32 ? 196 THR C CG2   1 
ATOM 2786 N N     . PHE E 4 65 ? -35.491 125.471 -6.385  1.00 29.89 ? 197 PHE C N     1 
ATOM 2787 C CA    . PHE E 4 65 ? -34.982 124.709 -7.501  1.00 29.89 ? 197 PHE C CA    1 
ATOM 2788 C C     . PHE E 4 65 ? -36.244 124.318 -8.236  1.00 29.89 ? 197 PHE C C     1 
ATOM 2789 O O     . PHE E 4 65 ? -37.221 123.876 -7.613  1.00 29.89 ? 197 PHE C O     1 
ATOM 2790 C CB    . PHE E 4 65 ? -34.254 123.453 -7.058  1.00 27.23 ? 197 PHE C CB    1 
ATOM 2791 C CG    . PHE E 4 65 ? -33.826 122.593 -8.204  1.00 27.23 ? 197 PHE C CG    1 
ATOM 2792 C CD1   . PHE E 4 65 ? -34.758 121.845 -8.910  1.00 27.23 ? 197 PHE C CD1   1 
ATOM 2793 C CD2   . PHE E 4 65 ? -32.496 122.573 -8.618  1.00 27.23 ? 197 PHE C CD2   1 
ATOM 2794 C CE1   . PHE E 4 65 ? -34.374 121.089 -10.016 1.00 27.23 ? 197 PHE C CE1   1 
ATOM 2795 C CE2   . PHE E 4 65 ? -32.096 121.824 -9.722  1.00 27.23 ? 197 PHE C CE2   1 
ATOM 2796 C CZ    . PHE E 4 65 ? -33.031 121.079 -10.425 1.00 27.23 ? 197 PHE C CZ    1 
ATOM 2797 N N     . ALA E 4 66 ? -36.236 124.496 -9.551  1.00 18.53 ? 198 ALA C N     1 
ATOM 2798 C CA    . ALA E 4 66 ? -37.405 124.159 -10.352 1.00 18.53 ? 198 ALA C CA    1 
ATOM 2799 C C     . ALA E 4 66 ? -37.000 123.770 -11.760 1.00 18.53 ? 198 ALA C C     1 
ATOM 2800 O O     . ALA E 4 66 ? -36.358 124.547 -12.462 1.00 18.53 ? 198 ALA C O     1 
ATOM 2801 C CB    . ALA E 4 66 ? -38.364 125.333 -10.389 1.00 4.90  ? 198 ALA C CB    1 
ATOM 2802 N N     . THR E 4 67 ? -37.360 122.561 -12.172 1.00 26.53 ? 199 THR C N     1 
ATOM 2803 C CA    . THR E 4 67 ? -37.018 122.119 -13.511 1.00 26.53 ? 199 THR C CA    1 
ATOM 2804 C C     . THR E 4 67 ? -37.762 122.953 -14.536 1.00 26.53 ? 199 THR C C     1 
ATOM 2805 O O     . THR E 4 67 ? -38.846 123.475 -14.265 1.00 26.53 ? 199 THR C O     1 
ATOM 2806 C CB    . THR E 4 67 ? -37.365 120.659 -13.719 1.00 27.83 ? 199 THR C CB    1 
ATOM 2807 O OG1   . THR E 4 67 ? -38.657 120.394 -13.153 1.00 27.83 ? 199 THR C OG1   1 
ATOM 2808 C CG2   . THR E 4 67 ? -36.308 119.781 -13.072 1.00 27.83 ? 199 THR C CG2   1 
ATOM 2809 N N     . ARG E 4 68 ? -37.154 123.075 -15.710 1.00 53.13 ? 200 ARG C N     1 
ATOM 2810 C CA    . ARG E 4 68 ? -37.687 123.859 -16.819 1.00 53.13 ? 200 ARG C CA    1 
ATOM 2811 C C     . ARG E 4 68 ? -39.185 124.138 -16.760 1.00 53.13 ? 200 ARG C C     1 
ATOM 2812 O O     . ARG E 4 68 ? -39.611 125.279 -16.610 1.00 53.13 ? 200 ARG C O     1 
ATOM 2813 C CB    . ARG E 4 68 ? -37.339 123.171 -18.137 1.00 52.63 ? 200 ARG C CB    1 
ATOM 2814 N N     . LYS E 4 69 ? -39.974 123.079 -16.866 1.00 44.98 ? 201 LYS C N     1 
ATOM 2815 C CA    . LYS E 4 69 ? -41.424 123.189 -16.872 1.00 44.98 ? 201 LYS C CA    1 
ATOM 2816 C C     . LYS E 4 69 ? -42.072 123.789 -15.615 1.00 44.98 ? 201 LYS C C     1 
ATOM 2817 O O     . LYS E 4 69 ? -42.932 124.658 -15.726 1.00 44.98 ? 201 LYS C O     1 
ATOM 2818 C CB    . LYS E 4 69 ? -42.041 121.805 -17.199 1.00 6.28  ? 201 LYS C CB    1 
ATOM 2819 N N     . LEU E 4 70 ? -41.671 123.339 -14.431 1.00 23.99 ? 202 LEU C N     1 
ATOM 2820 C CA    . LEU E 4 70 ? -42.254 123.857 -13.196 1.00 23.99 ? 202 LEU C CA    1 
ATOM 2821 C C     . LEU E 4 70 ? -41.861 125.291 -12.856 1.00 23.99 ? 202 LEU C C     1 
ATOM 2822 O O     . LEU E 4 70 ? -42.422 125.880 -11.939 1.00 23.99 ? 202 LEU C O     1 
ATOM 2823 C CB    . LEU E 4 70 ? -41.879 122.966 -12.023 1.00 9.83  ? 202 LEU C CB    1 
ATOM 2824 C CG    . LEU E 4 70 ? -42.476 121.570 -12.091 1.00 9.83  ? 202 LEU C CG    1 
ATOM 2825 C CD1   . LEU E 4 70 ? -41.961 120.748 -10.916 1.00 9.83  ? 202 LEU C CD1   1 
ATOM 2826 C CD2   . LEU E 4 70 ? -43.990 121.653 -12.054 1.00 9.83  ? 202 LEU C CD2   1 
ATOM 2827 N N     . GLN E 4 71 ? -40.902 125.852 -13.586 1.00 26.82 ? 203 GLN C N     1 
ATOM 2828 C CA    . GLN E 4 71 ? -40.440 127.210 -13.310 1.00 26.82 ? 203 GLN C CA    1 
ATOM 2829 C C     . GLN E 4 71 ? -41.599 128.162 -13.014 1.00 26.82 ? 203 GLN C C     1 
ATOM 2830 O O     . GLN E 4 71 ? -41.595 128.844 -11.991 1.00 26.82 ? 203 GLN C O     1 
ATOM 2831 C CB    . GLN E 4 71 ? -39.607 127.743 -14.485 1.00 74.93 ? 203 GLN C CB    1 
ATOM 2832 C CG    . GLN E 4 71 ? -38.817 129.019 -14.188 1.00 74.93 ? 203 GLN C CG    1 
ATOM 2833 C CD    . GLN E 4 71 ? -37.708 128.803 -13.170 1.00 74.93 ? 203 GLN C CD    1 
ATOM 2834 O OE1   . GLN E 4 71 ? -36.930 127.860 -13.281 1.00 74.93 ? 203 GLN C OE1   1 
ATOM 2835 N NE2   . GLN E 4 71 ? -37.625 129.683 -12.180 1.00 74.93 ? 203 GLN C NE2   1 
ATOM 2836 N N     . PRO E 4 72 ? -42.612 128.209 -13.894 1.00 45.80 ? 204 PRO C N     1 
ATOM 2837 C CA    . PRO E 4 72 ? -43.771 129.090 -13.709 1.00 45.80 ? 204 PRO C CA    1 
ATOM 2838 C C     . PRO E 4 72 ? -44.296 129.102 -12.280 1.00 45.80 ? 204 PRO C C     1 
ATOM 2839 O O     . PRO E 4 72 ? -44.742 130.132 -11.778 1.00 45.80 ? 204 PRO C O     1 
ATOM 2840 C CB    . PRO E 4 72 ? -44.779 128.524 -14.693 1.00 76.69 ? 204 PRO C CB    1 
ATOM 2841 C CG    . PRO E 4 72 ? -43.903 128.105 -15.821 1.00 76.69 ? 204 PRO C CG    1 
ATOM 2842 C CD    . PRO E 4 72 ? -42.779 127.390 -15.105 1.00 76.69 ? 204 PRO C CD    1 
ATOM 2843 N N     . MET E 4 73 ? -44.241 127.943 -11.635 1.00 45.02 ? 205 MET C N     1 
ATOM 2844 C CA    . MET E 4 73 ? -44.679 127.791 -10.252 1.00 45.02 ? 205 MET C CA    1 
ATOM 2845 C C     . MET E 4 73 ? -44.069 128.831 -9.318  1.00 45.02 ? 205 MET C C     1 
ATOM 2846 O O     . MET E 4 73 ? -44.617 129.084 -8.253  1.00 45.02 ? 205 MET C O     1 
ATOM 2847 C CB    . MET E 4 73 ? -44.290 126.409 -9.730  1.00 70.30 ? 205 MET C CB    1 
ATOM 2848 C CG    . MET E 4 73 ? -45.167 125.275 -10.192 1.00 70.30 ? 205 MET C CG    1 
ATOM 2849 S SD    . MET E 4 73 ? -46.675 125.228 -9.234  1.00 70.30 ? 205 MET C SD    1 
ATOM 2850 C CE    . MET E 4 73 ? -46.182 124.231 -7.889  1.00 70.30 ? 205 MET C CE    1 
ATOM 2851 N N     . ILE E 4 74 ? -42.936 129.419 -9.704  1.00 44.22 ? 206 ILE C N     1 
ATOM 2852 C CA    . ILE E 4 74 ? -42.258 130.405 -8.864  1.00 44.22 ? 206 ILE C CA    1 
ATOM 2853 C C     . ILE E 4 74 ? -41.797 131.665 -9.590  1.00 44.22 ? 206 ILE C C     1 
ATOM 2854 O O     . ILE E 4 74 ? -41.116 132.510 -9.001  1.00 44.22 ? 206 ILE C O     1 
ATOM 2855 C CB    . ILE E 4 74 ? -41.024 129.797 -8.205  1.00 26.35 ? 206 ILE C CB    1 
ATOM 2856 C CG1   . ILE E 4 74 ? -40.136 129.169 -9.287  1.00 26.35 ? 206 ILE C CG1   1 
ATOM 2857 C CG2   . ILE E 4 74 ? -41.441 128.778 -7.164  1.00 26.35 ? 206 ILE C CG2   1 
ATOM 2858 C CD1   . ILE E 4 74 ? -38.838 128.587 -8.784  1.00 26.35 ? 206 ILE C CD1   1 
ATOM 2859 N N     . THR E 4 75 ? -42.146 131.788 -10.865 1.00 51.76 ? 207 THR C N     1 
ATOM 2860 C CA    . THR E 4 75 ? -41.760 132.963 -11.636 1.00 51.76 ? 207 THR C CA    1 
ATOM 2861 C C     . THR E 4 75 ? -42.974 133.851 -11.867 1.00 51.76 ? 207 THR C C     1 
ATOM 2862 O O     . THR E 4 75 ? -42.925 135.062 -11.640 1.00 51.76 ? 207 THR C O     1 
ATOM 2863 C CB    . THR E 4 75 ? -41.164 132.564 -12.999 1.00 45.77 ? 207 THR C CB    1 
ATOM 2864 O OG1   . THR E 4 75 ? -41.895 131.451 -13.530 1.00 45.77 ? 207 THR C OG1   1 
ATOM 2865 C CG2   . THR E 4 75 ? -39.705 132.199 -12.859 1.00 45.77 ? 207 THR C CG2   1 
ATOM 2866 N N     . SER E 4 76 ? -44.066 133.238 -12.309 1.00 39.95 ? 208 SER C N     1 
ATOM 2867 C CA    . SER E 4 76 ? -45.298 133.969 -12.573 1.00 39.95 ? 208 SER C CA    1 
ATOM 2868 C C     . SER E 4 76 ? -45.775 134.722 -11.335 1.00 39.95 ? 208 SER C C     1 
ATOM 2869 O O     . SER E 4 76 ? -45.392 134.401 -10.205 1.00 39.95 ? 208 SER C O     1 
ATOM 2870 C CB    . SER E 4 76 ? -46.410 133.014 -13.030 1.00 48.00 ? 208 SER C CB    1 
ATOM 2871 O OG    . SER E 4 76 ? -46.885 132.230 -11.945 1.00 48.00 ? 208 SER C OG    1 
ATOM 2872 N N     . GLU E 4 77 ? -46.616 135.725 -11.563 1.00 82.90 ? 209 GLU C N     1 
ATOM 2873 C CA    . GLU E 4 77 ? -47.159 136.520 -10.476 1.00 82.90 ? 209 GLU C CA    1 
ATOM 2874 C C     . GLU E 4 77 ? -48.255 135.739 -9.762  1.00 82.90 ? 209 GLU C C     1 
ATOM 2875 O O     . GLU E 4 77 ? -48.473 135.926 -8.567  1.00 82.90 ? 209 GLU C O     1 
ATOM 2876 C CB    . GLU E 4 77 ? -47.718 137.845 -11.006 1.00 82.90 ? 209 GLU C CB    1 
ATOM 2877 C CG    . GLU E 4 77 ? -46.661 138.837 -11.515 1.00 82.90 ? 209 GLU C CG    1 
ATOM 2878 C CD    . GLU E 4 77 ? -45.605 139.196 -10.465 1.00 82.90 ? 209 GLU C CD    1 
ATOM 2879 O OE1   . GLU E 4 77 ? -45.972 139.447 -9.294  1.00 82.90 ? 209 GLU C OE1   1 
ATOM 2880 O OE2   . GLU E 4 77 ? -44.404 139.239 -10.818 1.00 82.90 ? 209 GLU C OE2   1 
ATOM 2881 N N     . THR E 4 78 ? -48.939 134.863 -10.496 1.00 69.06 ? 210 THR C N     1 
ATOM 2882 C CA    . THR E 4 78 ? -50.011 134.046 -9.918  1.00 69.06 ? 210 THR C CA    1 
ATOM 2883 C C     . THR E 4 78 ? -49.412 133.081 -8.899  1.00 69.06 ? 210 THR C C     1 
ATOM 2884 O O     . THR E 4 78 ? -50.043 132.741 -7.899  1.00 69.06 ? 210 THR C O     1 
ATOM 2885 C CB    . THR E 4 78 ? -50.771 133.234 -11.011 1.00 77.43 ? 210 THR C CB    1 
ATOM 2886 O OG1   . THR E 4 78 ? -51.864 132.522 -10.416 1.00 77.43 ? 210 THR C OG1   1 
ATOM 2887 C CG2   . THR E 4 78 ? -49.843 132.240 -11.688 1.00 77.43 ? 210 THR C CG2   1 
ATOM 2888 N N     . GLY E 4 79 ? -48.182 132.651 -9.165  1.00 55.04 ? 211 GLY C N     1 
ATOM 2889 C CA    . GLY E 4 79 ? -47.496 131.745 -8.262  1.00 55.04 ? 211 GLY C CA    1 
ATOM 2890 C C     . GLY E 4 79 ? -46.756 132.506 -7.174  1.00 55.04 ? 211 GLY C C     1 
ATOM 2891 O O     . GLY E 4 79 ? -47.008 132.299 -5.986  1.00 55.04 ? 211 GLY C O     1 
ATOM 2892 N N     . LYS E 4 80 ? -45.844 133.389 -7.581  1.00 70.53 ? 212 LYS C N     1 
ATOM 2893 C CA    . LYS E 4 80 ? -45.068 134.193 -6.636  1.00 70.53 ? 212 LYS C CA    1 
ATOM 2894 C C     . LYS E 4 80 ? -46.004 134.774 -5.579  1.00 70.53 ? 212 LYS C C     1 
ATOM 2895 O O     . LYS E 4 80 ? -45.585 135.124 -4.474  1.00 70.53 ? 212 LYS C O     1 
ATOM 2896 C CB    . LYS E 4 80 ? -44.338 135.321 -7.379  1.00 38.18 ? 212 LYS C CB    1 
ATOM 2897 N N     . ALA E 4 81 ? -47.278 134.870 -5.938  1.00 62.31 ? 213 ALA C N     1 
ATOM 2898 C CA    . ALA E 4 81 ? -48.295 135.388 -5.041  1.00 62.31 ? 213 ALA C CA    1 
ATOM 2899 C C     . ALA E 4 81 ? -48.702 134.310 -4.047  1.00 62.31 ? 213 ALA C C     1 
ATOM 2900 O O     . ALA E 4 81 ? -48.488 134.460 -2.844  1.00 62.31 ? 213 ALA C O     1 
ATOM 2901 C CB    . ALA E 4 81 ? -49.510 135.847 -5.840  1.00 46.08 ? 213 ALA C CB    1 
ATOM 2902 N N     . LEU E 4 82 ? -49.286 133.226 -4.556  1.00 61.87 ? 214 LEU C N     1 
ATOM 2903 C CA    . LEU E 4 82 ? -49.733 132.116 -3.717  1.00 61.87 ? 214 LEU C CA    1 
ATOM 2904 C C     . LEU E 4 82 ? -48.692 131.728 -2.666  1.00 61.87 ? 214 LEU C C     1 
ATOM 2905 O O     . LEU E 4 82 ? -49.036 131.243 -1.584  1.00 61.87 ? 214 LEU C O     1 
ATOM 2906 C CB    . LEU E 4 82 ? -50.056 130.890 -4.575  1.00 68.95 ? 214 LEU C CB    1 
ATOM 2907 C CG    . LEU E 4 82 ? -50.671 129.730 -3.776  1.00 68.95 ? 214 LEU C CG    1 
ATOM 2908 C CD1   . LEU E 4 82 ? -52.080 130.118 -3.354  1.00 68.95 ? 214 LEU C CD1   1 
ATOM 2909 C CD2   . LEU E 4 82 ? -50.709 128.449 -4.603  1.00 68.95 ? 214 LEU C CD2   1 
ATOM 2910 N N     . ILE E 4 83 ? -47.420 131.939 -2.989  1.00 66.06 ? 215 ILE C N     1 
ATOM 2911 C CA    . ILE E 4 83 ? -46.337 131.612 -2.068  1.00 66.06 ? 215 ILE C CA    1 
ATOM 2912 C C     . ILE E 4 83 ? -46.264 132.575 -0.883  1.00 66.06 ? 215 ILE C C     1 
ATOM 2913 O O     . ILE E 4 83 ? -46.489 132.173 0.257   1.00 66.06 ? 215 ILE C O     1 
ATOM 2914 C CB    . ILE E 4 83 ? -44.984 131.630 -2.774  1.00 22.02 ? 215 ILE C CB    1 
ATOM 2915 C CG1   . ILE E 4 83 ? -44.955 130.575 -3.878  1.00 22.02 ? 215 ILE C CG1   1 
ATOM 2916 C CG2   . ILE E 4 83 ? -43.896 131.400 -1.763  1.00 22.02 ? 215 ILE C CG2   1 
ATOM 2917 C CD1   . ILE E 4 83 ? -43.638 130.481 -4.609  1.00 22.02 ? 215 ILE C CD1   1 
ATOM 2918 N N     . GLN E 4 84 ? -45.931 133.839 -1.150  1.00 55.82 ? 216 GLN C N     1 
ATOM 2919 C CA    . GLN E 4 84 ? -45.854 134.842 -0.090  1.00 55.82 ? 216 GLN C CA    1 
ATOM 2920 C C     . GLN E 4 84 ? -47.056 134.622 0.818   1.00 55.82 ? 216 GLN C C     1 
ATOM 2921 O O     . GLN E 4 84 ? -46.966 134.722 2.045   1.00 55.82 ? 216 GLN C O     1 
ATOM 2922 C CB    . GLN E 4 84 ? -45.899 136.252 -0.689  1.00 18.81 ? 216 GLN C CB    1 
ATOM 2923 N N     . THR E 4 85 ? -48.176 134.289 0.184   1.00 29.56 ? 217 THR C N     1 
ATOM 2924 C CA    . THR E 4 85 ? -49.434 134.047 0.870   1.00 29.56 ? 217 THR C CA    1 
ATOM 2925 C C     . THR E 4 85 ? -49.412 132.914 1.886   1.00 29.56 ? 217 THR C C     1 
ATOM 2926 O O     . THR E 4 85 ? -50.048 133.024 2.939   1.00 29.56 ? 217 THR C O     1 
ATOM 2927 C CB    . THR E 4 85 ? -50.559 133.746 -0.130  1.00 66.63 ? 217 THR C CB    1 
ATOM 2928 O OG1   . THR E 4 85 ? -50.671 134.822 -1.071  1.00 66.63 ? 217 THR C OG1   1 
ATOM 2929 C CG2   . THR E 4 85 ? -51.881 133.582 0.604   1.00 66.63 ? 217 THR C CG2   1 
ATOM 2930 N N     . CYS E 4 86 ? -48.699 131.830 1.573   1.00 49.85 ? 218 CYS C N     1 
ATOM 2931 C CA    . CYS E 4 86 ? -48.625 130.670 2.465   1.00 49.85 ? 218 CYS C CA    1 
ATOM 2932 C C     . CYS E 4 86 ? -47.770 130.883 3.703   1.00 49.85 ? 218 CYS C C     1 
ATOM 2933 O O     . CYS E 4 86 ? -48.109 130.414 4.784   1.00 49.85 ? 218 CYS C O     1 
ATOM 2934 C CB    . CYS E 4 86 ? -48.098 129.444 1.720   1.00 56.61 ? 218 CYS C CB    1 
ATOM 2935 S SG    . CYS E 4 86 ? -49.284 128.634 0.640   1.00 56.61 ? 218 CYS C SG    1 
ATOM 2936 N N     . LEU E 4 87 ? -46.658 131.587 3.546   1.00 48.14 ? 219 LEU C N     1 
ATOM 2937 C CA    . LEU E 4 87 ? -45.765 131.825 4.668   1.00 48.14 ? 219 LEU C CA    1 
ATOM 2938 C C     . LEU E 4 87 ? -46.312 132.972 5.503   1.00 48.14 ? 219 LEU C C     1 
ATOM 2939 O O     . LEU E 4 87 ? -45.759 134.071 5.502   1.00 48.14 ? 219 LEU C O     1 
ATOM 2940 C CB    . LEU E 4 87 ? -44.351 132.143 4.156   1.00 73.29 ? 219 LEU C CB    1 
ATOM 2941 C CG    . LEU E 4 87 ? -43.665 131.146 3.202   1.00 73.29 ? 219 LEU C CG    1 
ATOM 2942 C CD1   . LEU E 4 87 ? -42.306 131.663 2.755   1.00 73.29 ? 219 LEU C CD1   1 
ATOM 2943 C CD2   . LEU E 4 87 ? -43.502 129.813 3.895   1.00 73.29 ? 219 LEU C CD2   1 
ATOM 2944 N N     . ASN E 4 88 ? -47.399 132.706 6.228   1.00 82.90 ? 220 ASN C N     1 
ATOM 2945 C CA    . ASN E 4 88 ? -48.031 133.743 7.040   1.00 82.90 ? 220 ASN C CA    1 
ATOM 2946 C C     . ASN E 4 88 ? -48.344 133.422 8.513   1.00 82.90 ? 220 ASN C C     1 
ATOM 2947 O O     . ASN E 4 88 ? -47.522 133.711 9.385   1.00 82.90 ? 220 ASN C O     1 
ATOM 2948 C CB    . ASN E 4 88 ? -49.296 134.244 6.323   1.00 82.90 ? 220 ASN C CB    1 
ATOM 2949 C CG    . ASN E 4 88 ? -50.426 133.215 6.316   1.00 82.90 ? 220 ASN C CG    1 
ATOM 2950 O OD1   . ASN E 4 88 ? -50.203 132.008 6.133   1.00 82.90 ? 220 ASN C OD1   1 
ATOM 2951 N ND2   . ASN E 4 88 ? -51.649 133.693 6.502   1.00 82.90 ? 220 ASN C ND2   1 
ATOM 2952 N N     . SER E 4 89 ? -49.512 132.837 8.792   1.00 82.90 ? 221 SER C N     1 
ATOM 2953 C CA    . SER E 4 89 ? -49.920 132.541 10.174  1.00 82.90 ? 221 SER C CA    1 
ATOM 2954 C C     . SER E 4 89 ? -49.740 131.091 10.632  1.00 82.90 ? 221 SER C C     1 
ATOM 2955 O O     . SER E 4 89 ? -49.339 130.256 9.792   1.00 82.90 ? 221 SER C O     1 
ATOM 2956 C CB    . SER E 4 89 ? -51.387 132.942 10.375  1.00 82.90 ? 221 SER C CB    1 
ATOM 2957 O OG    . SER E 4 89 ? -51.837 132.628 11.685  1.00 82.90 ? 221 SER C OG    1 
A 1 1   DC  1   101 101 DC  C   D . n 
A 1 2   DA  2   102 102 DA  A   D . n 
A 1 3   DC  3   103 103 DC  C   D . n 
A 1 4   DA  4   104 104 DA  A   D . n 
A 1 5   DG  5   105 105 DG  G   D . n 
A 1 6   DG  6   106 106 DG  G   D . n 
A 1 7   DA  7   107 107 DA  A   D . n 
A 1 8   DT  8   108 108 DT  T   D . n 
A 1 9   DG  9   109 109 DG  G   D . n 
A 1 10  DT  10  110 110 DT  T   D . n 
A 1 11  DC  11  111 111 DC  C   D . n 
A 1 12  DC  12  112 112 DC  C   D . n 
A 1 13  DA  13  113 113 DA  A   D . n 
A 1 14  DT  14  114 114 DT  T   D . n 
A 1 15  DA  15  115 115 DA  A   D . n 
A 1 16  DT  16  116 116 DT  T   D . n 
A 1 17  DT  17  117 117 DT  T   D . n 
A 1 18  DA  18  118 118 DA  A   D . n 
A 1 19  DG  19  119 119 DG  G   D . n 
A 1 20  DG  20  120 120 DG  G   D . n 
A 1 21  DA  21  121 121 DA  A   D . n 
A 1 22  DC  22  122 122 DC  C   D . n 
A 1 23  DA  23  123 123 DA  A   D . n 
B 2 1   DT  1   201 201 DT  T   E . n 
B 2 2   DG  2   202 202 DG  G   E . n 
B 2 3   DT  3   203 203 DT  T   E . n 
B 2 4   DC  4   204 204 DC  C   E . n 
B 2 5   DC  5   205 205 DC  C   E . n 
B 2 6   DT  6   206 206 DT  T   E . n 
B 2 7   DA  7   207 207 DA  A   E . n 
B 2 8   DA  8   208 208 DA  A   E . n 
B 2 9   DT  9   209 209 DT  T   E . n 
B 2 10  DA  10  210 210 DA  A   E . n 
B 2 11  DT  11  211 211 DT  T   E . n 
B 2 12  DG  12  212 212 DG  G   E . n 
B 2 13  DG  13  213 213 DG  G   E . n 
B 2 14  DA  14  214 214 DA  A   E . n 
B 2 15  DC  15  215 215 DC  C   E . n 
B 2 16  DA  16  216 216 DA  A   E . n 
B 2 17  DT  17  217 217 DT  T   E . n 
B 2 18  DC  18  218 218 DC  C   E . n 
B 2 19  DC  19  219 219 DC  C   E . n 
B 2 20  DT  20  220 220 DT  T   E . n 
B 2 21  DG  21  221 221 DG  G   E . n 
B 2 22  DT  22  222 222 DT  T   E . n 
B 2 23  DG  23  223 223 DG  G   E . n 
C 3 1   MET 1   301 ?   ?   ?   A . n 
C 3 2   ASP 2   302 ?   ?   ?   A . n 
C 3 3   SER 3   303 303 SER SER A . n 
C 3 4   ALA 4   304 304 ALA ALA A . n 
C 3 5   ILE 5   305 305 ILE ILE A . n 
C 3 6   THR 6   306 306 THR THR A . n 
C 3 7   LEU 7   307 307 LEU LEU A . n 
C 3 8   TRP 8   308 308 TRP TRP A . n 
C 3 9   GLN 9   309 309 GLN GLN A . n 
C 3 10  PHE 10  310 310 PHE PHE A . n 
C 3 11  LEU 11  311 311 LEU LEU A . n 
C 3 12  LEU 12  312 312 LEU LEU A . n 
C 3 13  GLN 13  313 313 GLN GLN A . n 
C 3 14  LEU 14  314 314 LEU LEU A . n 
C 3 15  LEU 15  315 315 LEU LEU A . n 
C 3 16  GLN 16  316 316 GLN GLN A . n 
C 3 17  LYS 17  317 317 LYS LYS A . n 
C 3 18  PRO 18  318 318 PRO PRO A . n 
C 3 19  GLN 19  319 319 GLN GLN A . n 
C 3 20  ASN 20  320 320 ASN ASN A . n 
C 3 21  LYS 21  321 321 LYS LYS A . n 
C 3 22  HIS 22  322 322 HIS HIS A . n 
C 3 23  MET 23  323 323 MET MET A . n 
C 3 24  ILE 24  324 324 ILE ILE A . n 
C 3 25  CYS 25  325 325 CYS CYS A . n 
C 3 26  TRP 26  326 326 TRP TRP A . n 
C 3 27  THR 27  327 327 THR THR A . n 
C 3 28  SER 28  328 328 SER SER A . n 
C 3 29  ASN 29  329 329 ASN ASN A . n 
C 3 30  ASP 30  330 330 ASP ASP A . n 
C 3 31  GLY 31  331 331 GLY GLY A . n 
C 3 32  GLN 32  332 332 GLN GLN A . n 
C 3 33  PHE 33  333 333 PHE PHE A . n 
C 3 34  LYS 34  334 334 LYS LYS A . n 
C 3 35  LEU 35  335 335 LEU LEU A . n 
C 3 36  LEU 36  336 336 LEU LEU A . n 
C 3 37  GLN 37  337 337 GLN GLN A . n 
C 3 38  ALA 38  338 338 ALA ALA A . n 
C 3 39  GLU 39  339 339 GLU GLU A . n 
C 3 40  GLU 40  340 340 GLU GLU A . n 
C 3 41  VAL 41  341 341 VAL VAL A . n 
C 3 42  ALA 42  342 342 ALA ALA A . n 
C 3 43  ARG 43  343 343 ARG ARG A . n 
C 3 44  LEU 44  344 344 LEU LEU A . n 
C 3 45  TRP 45  345 345 TRP TRP A . n 
C 3 46  GLY 46  346 346 GLY GLY A . n 
C 3 47  ILE 47  347 347 ILE ILE A . n 
C 3 48  ARG 48  348 348 ARG ARG A . n 
C 3 49  LYS 49  349 349 LYS LYS A . n 
C 3 50  ASN 50  350 350 ASN ASN A . n 
C 3 51  LYS 51  351 351 LYS LYS A . n 
C 3 52  PRO 52  352 352 PRO PRO A . n 
C 3 53  ASN 53  353 353 ASN ASN A . n 
C 3 54  MET 54  354 354 MET MET A . n 
C 3 55  ASN 55  355 355 ASN ASN A . n 
C 3 56  TYR 56  356 356 TYR TYR A . n 
C 3 57  ASP 57  357 357 ASP ALA A . n 
C 3 58  LYS 58  358 358 LYS LYS A . n 
C 3 59  LEU 59  359 359 LEU LEU A . n 
C 3 60  SER 60  360 360 SER SER A . n 
C 3 61  ARG 61  361 361 ARG ARG A . n 
C 3 62  ALA 62  362 362 ALA ALA A . n 
C 3 63  LEU 63  363 363 LEU LEU A . n 
C 3 64  ARG 64  364 364 ARG ARG A . n 
C 3 65  TYR 65  365 365 TYR TYR A . n 
C 3 66  TYR 66  366 366 TYR TYR A . n 
C 3 67  TYR 67  367 367 TYR TYR A . n 
C 3 68  VAL 68  368 368 VAL VAL A . n 
C 3 69  LYS 69  369 369 LYS ALA A . n 
C 3 70  ASN 70  370 370 ASN ASN A . n 
C 3 71  ILE 71  371 371 ILE ILE A . n 
C 3 72  ILE 72  372 372 ILE ILE A . n 
C 3 73  LYS 73  373 373 LYS LYS A . n 
C 3 74  LYS 74  374 374 LYS LYS A . n 
C 3 75  VAL 75  375 375 VAL VAL A . n 
C 3 76  ASN 76  376 376 ASN ASN A . n 
C 3 77  GLY 77  377 377 GLY GLY A . n 
C 3 78  GLN 78  378 378 GLN GLN A . n 
C 3 79  LYS 79  379 379 LYS ALA A . n 
C 3 80  PHE 80  380 380 PHE PHE A . n 
C 3 81  VAL 81  381 381 VAL VAL A . n 
C 3 82  TYR 82  382 382 TYR TYR A . n 
C 3 83  LYS 83  383 383 LYS LYS A . n 
C 3 84  PHE 84  384 384 PHE PHE A . n 
C 3 85  VAL 85  385 385 VAL VAL A . n 
C 3 86  SER 86  386 386 SER ALA A . n 
C 3 87  TYR 87  387 387 TYR TYR A . n 
C 3 88  PRO 88  388 388 PRO PRO A . n 
C 3 89  GLU 89  389 389 GLU GLU A . n 
C 3 90  ILE 90  390 390 ILE ILE A . n 
C 3 91  LEU 91  391 391 LEU LEU A . n 
C 3 92  ASN 92  392 ?   ?   ?   A . n 
C 3 93  MET 93  393 ?   ?   ?   A . n 
D 4 1   GLY 1   133 ?   ?   ?   B . n 
D 4 2   ALA 2   134 ?   ?   ?   B . n 
D 4 3   LYS 3   135 ?   ?   ?   B . n 
D 4 4   PRO 4   136 ?   ?   ?   B . n 
D 4 5   GLY 5   137 137 GLY GLY B . n 
D 4 6   LYS 6   138 138 LYS ALA B . n 
D 4 7   LYS 7   139 139 LYS ALA B . n 
D 4 8   THR 8   140 140 THR THR B . n 
D 4 9   ARG 9   141 141 ARG ARG B . n 
D 4 10  GLY 10  142 142 GLY GLY B . n 
D 4 11  ARG 11  143 143 ARG ARG B . n 
D 4 12  VAL 12  144 144 VAL VAL B . n 
D 4 13  LYS 13  145 145 LYS ALA B . n 
D 4 14  ILE 14  146 146 ILE ILE B . n 
D 4 15  LYS 15  147 147 LYS ALA B . n 
D 4 16  MET 16  148 148 MET MET B . n 
D 4 17  GLU 17  149 149 GLU GLU B . n 
D 4 18  PHE 18  150 150 PHE PHE B . n 
D 4 19  ILE 19  151 151 ILE ILE B . n 
D 4 20  ASP 20  152 152 ASP ASP B . n 
D 4 21  ASN 21  153 153 ASN ASN B . n 
D 4 22  LYS 22  154 154 LYS LYS B . n 
D 4 23  LEU 23  155 155 LEU LEU B . n 
D 4 24  ARG 24  156 156 ARG ARG B . n 
D 4 25  ARG 25  157 157 ARG ARG B . n 
D 4 26  TYR 26  158 158 TYR TYR B . n 
D 4 27  THR 27  159 159 THR THR B . n 
D 4 28  THR 28  160 160 THR THR B . n 
D 4 29  PHE 29  161 161 PHE PHE B . n 
D 4 30  SER 30  162 162 SER SER B . n 
D 4 31  LYS 31  163 163 LYS LYS B . n 
D 4 32  ARG 32  164 164 ARG ARG B . n 
D 4 33  LYS 33  165 165 LYS LYS B . n 
D 4 34  THR 34  166 166 THR ALA B . n 
D 4 35  GLY 35  167 167 GLY GLY B . n 
D 4 36  ILE 36  168 168 ILE ILE B . n 
D 4 37  MET 37  169 169 MET MET B . n 
D 4 38  LYS 38  170 170 LYS LYS B . n 
D 4 39  LYS 39  171 171 LYS LYS B . n 
D 4 40  ALA 40  172 172 ALA ALA B . n 
D 4 41  TYR 41  173 173 TYR TYR B . n 
D 4 42  GLU 42  174 174 GLU GLU B . n 
D 4 43  LEU 43  175 175 LEU LEU B . n 
D 4 44  SER 44  176 176 SER SER B . n 
D 4 45  THR 45  177 177 THR THR B . n 
D 4 46  LEU 46  178 178 LEU LEU B . n 
D 4 47  THR 47  179 179 THR THR B . n 
D 4 48  GLY 48  180 180 GLY GLY B . n 
D 4 49  THR 49  181 181 THR THR B . n 
D 4 50  GLN 50  182 182 GLN GLN B . n 
D 4 51  VAL 51  183 183 VAL VAL B . n 
D 4 52  LEU 52  184 184 LEU LEU B . n 
D 4 53  LEU 53  185 185 LEU LEU B . n 
D 4 54  LEU 54  186 186 LEU LEU B . n 
D 4 55  VAL 55  187 187 VAL VAL B . n 
D 4 56  ALA 56  188 188 ALA ALA B . n 
D 4 57  SER 57  189 189 SER ALA B . n 
D 4 58  GLU 58  190 190 GLU GLU B . n 
D 4 59  THR 59  191 191 THR THR B . n 
D 4 60  GLY 60  192 192 GLY GLY B . n 
D 4 61  HIS 61  193 193 HIS ALA B . n 
D 4 62  VAL 62  194 194 VAL VAL B . n 
D 4 63  TYR 63  195 195 TYR TYR B . n 
D 4 64  THR 64  196 196 THR THR B . n 
D 4 65  PHE 65  197 197 PHE PHE B . n 
D 4 66  ALA 66  198 198 ALA ALA B . n 
D 4 67  THR 67  199 199 THR THR B . n 
D 4 68  ARG 68  200 200 ARG ARG B . n 
D 4 69  LYS 69  201 201 LYS LYS B . n 
D 4 70  LEU 70  202 202 LEU LEU B . n 
D 4 71  GLN 71  203 203 GLN GLN B . n 
D 4 72  PRO 72  204 204 PRO PRO B . n 
D 4 73  MET 73  205 205 MET MET B . n 
D 4 74  ILE 74  206 206 ILE ILE B . n 
D 4 75  THR 75  207 207 THR THR B . n 
D 4 76  SER 76  208 208 SER SER B . n 
D 4 77  GLU 77  209 209 GLU ALA B . n 
D 4 78  THR 78  210 210 THR THR B . n 
D 4 79  GLY 79  211 211 GLY GLY B . n 
D 4 80  LYS 80  212 212 LYS LYS B . n 
D 4 81  ALA 81  213 213 ALA ALA B . n 
D 4 82  LEU 82  214 214 LEU LEU B . n 
D 4 83  ILE 83  215 215 ILE ILE B . n 
D 4 84  GLN 84  216 216 GLN ALA B . n 
D 4 85  THR 85  217 217 THR THR B . n 
D 4 86  CYS 86  218 218 CYS CYS B . n 
D 4 87  LEU 87  219 219 LEU LEU B . n 
D 4 88  ASN 88  220 220 ASN ASN B . n 
D 4 89  SER 89  221 221 SER SER B . n 
D 4 90  PRO 90  222 ?   ?   ?   B . n 
D 4 91  ASP 91  223 ?   ?   ?   B . n 
D 4 92  SER 92  224 ?   ?   ?   B . n 
D 4 93  PRO 93  225 ?   ?   ?   B . n 
D 4 94  PRO 94  226 ?   ?   ?   B . n 
D 4 95  ARG 95  227 ?   ?   ?   B . n 
D 4 96  SER 96  228 ?   ?   ?   B . n 
D 4 97  ASP 97  229 ?   ?   ?   B . n 
D 4 98  PRO 98  230 ?   ?   ?   B . n 
D 4 99  THR 99  231 ?   ?   ?   B . n 
D 4 100 THR 100 232 ?   ?   ?   B . n 
D 4 101 ASP 101 233 ?   ?   ?   B . n 
D 4 102 GLN 102 234 ?   ?   ?   B . n 
D 4 103 ARG 103 235 ?   ?   ?   B . n 
E 4 1   GLY 1   133 ?   ?   ?   C . n 
E 4 2   ALA 2   134 ?   ?   ?   C . n 
E 4 3   LYS 3   135 ?   ?   ?   C . n 
E 4 4   PRO 4   136 ?   ?   ?   C . n 
E 4 5   GLY 5   137 ?   ?   ?   C . n 
E 4 6   LYS 6   138 138 LYS ALA C . n 
E 4 7   LYS 7   139 139 LYS LYS C . n 
E 4 8   THR 8   140 140 THR THR C . n 
E 4 9   ARG 9   141 141 ARG ARG C . n 
E 4 10  GLY 10  142 142 GLY GLY C . n 
E 4 11  ARG 11  143 143 ARG ARG C . n 
E 4 12  VAL 12  144 144 VAL VAL C . n 
E 4 13  LYS 13  145 145 LYS LYS C . n 
E 4 14  ILE 14  146 146 ILE ILE C . n 
E 4 15  LYS 15  147 147 LYS LYS C . n 
E 4 16  MET 16  148 148 MET MET C . n 
E 4 17  GLU 17  149 149 GLU GLU C . n 
E 4 18  PHE 18  150 150 PHE PHE C . n 
E 4 19  ILE 19  151 151 ILE ILE C . n 
E 4 20  ASP 20  152 152 ASP ASP C . n 
E 4 21  ASN 21  153 153 ASN ASN C . n 
E 4 22  LYS 22  154 154 LYS ALA C . n 
E 4 23  LEU 23  155 155 LEU ALA C . n 
E 4 24  ARG 24  156 156 ARG ALA C . n 
E 4 25  ARG 25  157 157 ARG ARG C . n 
E 4 26  TYR 26  158 158 TYR TYR C . n 
E 4 27  THR 27  159 159 THR THR C . n 
E 4 28  THR 28  160 160 THR THR C . n 
E 4 29  PHE 29  161 161 PHE PHE C . n 
E 4 30  SER 30  162 162 SER SER C . n 
E 4 31  LYS 31  163 163 LYS LYS C . n 
E 4 32  ARG 32  164 164 ARG ARG C . n 
E 4 33  LYS 33  165 165 LYS LYS C . n 
E 4 34  THR 34  166 166 THR THR C . n 
E 4 35  GLY 35  167 167 GLY GLY C . n 
E 4 36  ILE 36  168 168 ILE ILE C . n 
E 4 37  MET 37  169 169 MET MET C . n 
E 4 38  LYS 38  170 170 LYS LYS C . n 
E 4 39  LYS 39  171 171 LYS LYS C . n 
E 4 40  ALA 40  172 172 ALA ALA C . n 
E 4 41  TYR 41  173 173 TYR TYR C . n 
E 4 42  GLU 42  174 174 GLU GLU C . n 
E 4 43  LEU 43  175 175 LEU LEU C . n 
E 4 44  SER 44  176 176 SER SER C . n 
E 4 45  THR 45  177 177 THR THR C . n 
E 4 46  LEU 46  178 178 LEU LEU C . n 
E 4 47  THR 47  179 179 THR THR C . n 
E 4 48  GLY 48  180 180 GLY GLY C . n 
E 4 49  THR 49  181 181 THR THR C . n 
E 4 50  GLN 50  182 182 GLN GLN C . n 
E 4 51  VAL 51  183 183 VAL VAL C . n 
E 4 52  LEU 52  184 184 LEU LEU C . n 
E 4 53  LEU 53  185 185 LEU LEU C . n 
E 4 54  LEU 54  186 186 LEU LEU C . n 
E 4 55  VAL 55  187 187 VAL VAL C . n 
E 4 56  ALA 56  188 188 ALA ALA C . n 
E 4 57  SER 57  189 189 SER SER C . n 
E 4 58  GLU 58  190 190 GLU GLU C . n 
E 4 59  THR 59  191 191 THR THR C . n 
E 4 60  GLY 60  192 192 GLY GLY C . n 
E 4 61  HIS 61  193 193 HIS HIS C . n 
E 4 62  VAL 62  194 194 VAL VAL C . n 
E 4 63  TYR 63  195 195 TYR TYR C . n 
E 4 64  THR 64  196 196 THR THR C . n 
E 4 65  PHE 65  197 197 PHE PHE C . n 
E 4 66  ALA 66  198 198 ALA ALA C . n 
E 4 67  THR 67  199 199 THR THR C . n 
E 4 68  ARG 68  200 200 ARG ALA C . n 
E 4 69  LYS 69  201 201 LYS ALA C . n 
E 4 70  LEU 70  202 202 LEU LEU C . n 
E 4 71  GLN 71  203 203 GLN GLN C . n 
E 4 72  PRO 72  204 204 PRO PRO C . n 
E 4 73  MET 73  205 205 MET MET C . n 
E 4 74  ILE 74  206 206 ILE ILE C . n 
E 4 75  THR 75  207 207 THR THR C . n 
E 4 76  SER 76  208 208 SER SER C . n 
E 4 77  GLU 77  209 209 GLU GLU C . n 
E 4 78  THR 78  210 210 THR THR C . n 
E 4 79  GLY 79  211 211 GLY GLY C . n 
E 4 80  LYS 80  212 212 LYS ALA C . n 
E 4 81  ALA 81  213 213 ALA ALA C . n 
E 4 82  LEU 82  214 214 LEU LEU C . n 
E 4 83  ILE 83  215 215 ILE ILE C . n 
E 4 84  GLN 84  216 216 GLN ALA C . n 
E 4 85  THR 85  217 217 THR THR C . n 
E 4 86  CYS 86  218 218 CYS CYS C . n 
E 4 87  LEU 87  219 219 LEU LEU C . n 
E 4 88  ASN 88  220 220 ASN ASN C . n 
E 4 89  SER 89  221 221 SER SER C . n 
E 4 90  PRO 90  222 ?   ?   ?   C . n 
E 4 91  ASP 91  223 ?   ?   ?   C . n 
E 4 92  SER 92  224 ?   ?   ?   C . n 
E 4 93  PRO 93  225 ?   ?   ?   C . n 
E 4 94  PRO 94  226 ?   ?   ?   C . n 
E 4 95  ARG 95  227 ?   ?   ?   C . n 
E 4 96  SER 96  228 ?   ?   ?   C . n 
E 4 97  ASP 97  229 ?   ?   ?   C . n 
E 4 98  PRO 98  230 ?   ?   ?   C . n 
E 4 99  THR 99  231 ?   ?   ?   C . n 
E 4 100 THR 100 232 ?   ?   ?   C . n 
E 4 101 ASP 101 233 ?   ?   ?   C . n 
E 4 102 GLN 102 234 ?   ?   ?   C . n 
E 4 103 ARG 103 235 ?   ?   ?   C . n 
#                   1 
_pdbx_struct_assembly.details              author_defined_assembly 
_pdbx_struct_assembly.method_details       ? 
_pdbx_struct_assembly.oligomeric_details   pentameric 
_pdbx_struct_assembly.oligomeric_count     5 
_pdbx_struct_assembly_gen.assembly_id       1 
_pdbx_struct_assembly_gen.oper_expression   1 
_pdbx_struct_assembly_gen.asym_id_list      A,B,C,D,E 
#                   1 
_pdbx_struct_oper_list.type                 'identity operation'                 1_555 
_pdbx_struct_oper_list.symmetry_operation   x,y,z 
_pdbx_struct_oper_list.matrix[1][1]         1.0000000000 
_pdbx_struct_oper_list.matrix[1][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[1][3]         0.0000000000 
_pdbx_struct_oper_list.vector[1]            0.0000000000 
_pdbx_struct_oper_list.matrix[2][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[2][2]         1.0000000000 
_pdbx_struct_oper_list.matrix[2][3]         0.0000000000 
_pdbx_struct_oper_list.vector[2]            0.0000000000 
_pdbx_struct_oper_list.matrix[3][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][3]         1.0000000000 
_pdbx_struct_oper_list.vector[3]            0.0000000000 
1 'Structure model' 1 0 2002-01-17 
2 'Structure model' 1 1 2008-04-27 
3 'Structure model' 1 2 2011-07-13 
4 'Structure model' 1 3 2018-01-31 
_pdbx_audit_revision_details.ordinal             1 
_pdbx_audit_revision_details.revision_ordinal    1 
_pdbx_audit_revision_details.data_content_type   'Structure model' 
_pdbx_audit_revision_details.provider            repository 
_pdbx_audit_revision_details.type                'Initial release' 
_pdbx_audit_revision_details.description         ? 
1 2 'Structure model' 'Version format compliance' 
2 3 'Structure model' 'Version format compliance' 
3 4 'Structure model' 'Experimental preparation'  
_pdbx_audit_revision_category.ordinal             1 
_pdbx_audit_revision_category.revision_ordinal    4 
_pdbx_audit_revision_category.data_content_type   'Structure model' 
_pdbx_audit_revision_category.category            exptl_crystal_grow 
_pdbx_audit_revision_item.ordinal             1 
_pdbx_audit_revision_item.revision_ordinal    4 
_pdbx_audit_revision_item.data_content_type   'Structure model' 
_pdbx_audit_revision_item.item                '_exptl_crystal_grow.temp' 
AMoRE     phasing          . ? 1 
CNS       refinement       . ? 2 
DENZO     'data reduction' . ? 3 
SCALEPACK 'data scaling'   . ? 4 
1  1 ASN A 320 ? ? -114.58 77.63  
2  1 MET A 323 ? ? -134.40 -44.07 
3  1 GLN A 337 ? ? -111.28 65.47  
4  1 ASN A 353 ? ? -67.82  27.58  
5  1 ILE A 371 ? ? -128.51 -52.37 
6  1 PHE A 380 ? ? 52.37   18.03  
7  1 PRO B 204 ? ? -57.77  13.15  
8  1 ASN B 220 ? ? -148.18 -5.90  
9  1 LYS C 139 ? ? -67.57  -72.57 
10 1 LYS C 154 ? ? -22.24  -44.90 
11 1 ARG C 157 ? ? -27.72  -65.97 
12 1 ARG C 200 ? ? -20.59  -65.49 
13 1 ASN C 220 ? ? -129.89 -87.23 
1  1 Y 1 A ASP 357 ? CG  ? C ASP 57 CG  
2  1 Y 1 A ASP 357 ? OD1 ? C ASP 57 OD1 
3  1 Y 1 A ASP 357 ? OD2 ? C ASP 57 OD2 
4  1 Y 1 A LYS 369 ? CG  ? C LYS 69 CG  
5  1 Y 1 A LYS 369 ? CD  ? C LYS 69 CD  
6  1 Y 1 A LYS 369 ? CE  ? C LYS 69 CE  
7  1 Y 1 A LYS 369 ? NZ  ? C LYS 69 NZ  
8  1 Y 1 A LYS 379 ? CG  ? C LYS 79 CG  
9  1 Y 1 A LYS 379 ? CD  ? C LYS 79 CD  
10 1 Y 1 A LYS 379 ? CE  ? C LYS 79 CE  
11 1 Y 1 A LYS 379 ? NZ  ? C LYS 79 NZ  
12 1 Y 1 A SER 386 ? OG  ? C SER 86 OG  
13 1 Y 1 B LYS 138 ? CG  ? D LYS 6  CG  
14 1 Y 1 B LYS 138 ? CD  ? D LYS 6  CD  
15 1 Y 1 B LYS 138 ? CE  ? D LYS 6  CE  
16 1 Y 1 B LYS 138 ? NZ  ? D LYS 6  NZ  
17 1 Y 1 B LYS 139 ? CG  ? D LYS 7  CG  
18 1 Y 1 B LYS 139 ? CD  ? D LYS 7  CD  
19 1 Y 1 B LYS 139 ? CE  ? D LYS 7  CE  
20 1 Y 1 B LYS 139 ? NZ  ? D LYS 7  NZ  
21 1 Y 1 B LYS 145 ? CG  ? D LYS 13 CG  
22 1 Y 1 B LYS 145 ? CD  ? D LYS 13 CD  
23 1 Y 1 B LYS 145 ? CE  ? D LYS 13 CE  
24 1 Y 1 B LYS 145 ? NZ  ? D LYS 13 NZ  
25 1 Y 1 B LYS 147 ? CG  ? D LYS 15 CG  
26 1 Y 1 B LYS 147 ? CD  ? D LYS 15 CD  
27 1 Y 1 B LYS 147 ? CE  ? D LYS 15 CE  
28 1 Y 1 B LYS 147 ? NZ  ? D LYS 15 NZ  
29 1 Y 1 B THR 166 ? OG1 ? D THR 34 OG1 
30 1 Y 1 B THR 166 ? CG2 ? D THR 34 CG2 
31 1 Y 1 B SER 189 ? OG  ? D SER 57 OG  
32 1 Y 1 B HIS 193 ? CG  ? D HIS 61 CG  
33 1 Y 1 B HIS 193 ? ND1 ? D HIS 61 ND1 
34 1 Y 1 B HIS 193 ? CD2 ? D HIS 61 CD2 
35 1 Y 1 B HIS 193 ? CE1 ? D HIS 61 CE1 
36 1 Y 1 B HIS 193 ? NE2 ? D HIS 61 NE2 
37 1 Y 1 B GLU 209 ? CG  ? D GLU 77 CG  
38 1 Y 1 B GLU 209 ? CD  ? D GLU 77 CD  
39 1 Y 1 B GLU 209 ? OE1 ? D GLU 77 OE1 
40 1 Y 1 B GLU 209 ? OE2 ? D GLU 77 OE2 
41 1 Y 1 B GLN 216 ? CG  ? D GLN 84 CG  
42 1 Y 1 B GLN 216 ? CD  ? D GLN 84 CD  
43 1 Y 1 B GLN 216 ? OE1 ? D GLN 84 OE1 
44 1 Y 1 B GLN 216 ? NE2 ? D GLN 84 NE2 
45 1 Y 1 C LYS 138 ? CG  ? E LYS 6  CG  
46 1 Y 1 C LYS 138 ? CD  ? E LYS 6  CD  
47 1 Y 1 C LYS 138 ? CE  ? E LYS 6  CE  
48 1 Y 1 C LYS 138 ? NZ  ? E LYS 6  NZ  
49 1 Y 1 C LYS 154 ? CG  ? E LYS 22 CG  
50 1 Y 1 C LYS 154 ? CD  ? E LYS 22 CD  
51 1 Y 1 C LYS 154 ? CE  ? E LYS 22 CE  
52 1 Y 1 C LYS 154 ? NZ  ? E LYS 22 NZ  
53 1 Y 1 C LEU 155 ? CG  ? E LEU 23 CG  
54 1 Y 1 C LEU 155 ? CD1 ? E LEU 23 CD1 
55 1 Y 1 C LEU 155 ? CD2 ? E LEU 23 CD2 
56 1 Y 1 C ARG 156 ? CG  ? E ARG 24 CG  
57 1 Y 1 C ARG 156 ? CD  ? E ARG 24 CD  
58 1 Y 1 C ARG 156 ? NE  ? E ARG 24 NE  
59 1 Y 1 C ARG 156 ? CZ  ? E ARG 24 CZ  
60 1 Y 1 C ARG 156 ? NH1 ? E ARG 24 NH1 
61 1 Y 1 C ARG 156 ? NH2 ? E ARG 24 NH2 
62 1 Y 1 C ARG 200 ? CG  ? E ARG 68 CG  
63 1 Y 1 C ARG 200 ? CD  ? E ARG 68 CD  
64 1 Y 1 C ARG 200 ? NE  ? E ARG 68 NE  
65 1 Y 1 C ARG 200 ? CZ  ? E ARG 68 CZ  
66 1 Y 1 C ARG 200 ? NH1 ? E ARG 68 NH1 
67 1 Y 1 C ARG 200 ? NH2 ? E ARG 68 NH2 
68 1 Y 1 C LYS 201 ? CG  ? E LYS 69 CG  
69 1 Y 1 C LYS 201 ? CD  ? E LYS 69 CD  
70 1 Y 1 C LYS 201 ? CE  ? E LYS 69 CE  
71 1 Y 1 C LYS 201 ? NZ  ? E LYS 69 NZ  
72 1 Y 1 C LYS 212 ? CG  ? E LYS 80 CG  
73 1 Y 1 C LYS 212 ? CD  ? E LYS 80 CD  
74 1 Y 1 C LYS 212 ? CE  ? E LYS 80 CE  
75 1 Y 1 C LYS 212 ? NZ  ? E LYS 80 NZ  
76 1 Y 1 C GLN 216 ? CG  ? E GLN 84 CG  
77 1 Y 1 C GLN 216 ? CD  ? E GLN 84 CD  
78 1 Y 1 C GLN 216 ? OE1 ? E GLN 84 OE1 
79 1 Y 1 C GLN 216 ? NE2 ? E GLN 84 NE2 
1  1 Y 1 A MET 301 ? C MET 1   
2  1 Y 1 A ASP 302 ? C ASP 2   
3  1 Y 1 A ASN 392 ? C ASN 92  
4  1 Y 1 A MET 393 ? C MET 93  
5  1 Y 1 B GLY 133 ? D GLY 1   
6  1 Y 1 B ALA 134 ? D ALA 2   
7  1 Y 1 B LYS 135 ? D LYS 3   
8  1 Y 1 B PRO 136 ? D PRO 4   
9  1 Y 1 B PRO 222 ? D PRO 90  
10 1 Y 1 B ASP 223 ? D ASP 91  
11 1 Y 1 B SER 224 ? D SER 92  
12 1 Y 1 B PRO 225 ? D PRO 93  
13 1 Y 1 B PRO 226 ? D PRO 94  
14 1 Y 1 B ARG 227 ? D ARG 95  
15 1 Y 1 B SER 228 ? D SER 96  
16 1 Y 1 B ASP 229 ? D ASP 97  
17 1 Y 1 B PRO 230 ? D PRO 98  
18 1 Y 1 B THR 231 ? D THR 99  
19 1 Y 1 B THR 232 ? D THR 100 
20 1 Y 1 B ASP 233 ? D ASP 101 
21 1 Y 1 B GLN 234 ? D GLN 102 
22 1 Y 1 B ARG 235 ? D ARG 103 
23 1 Y 1 C GLY 133 ? E GLY 1   
24 1 Y 1 C ALA 134 ? E ALA 2   
25 1 Y 1 C LYS 135 ? E LYS 3   
26 1 Y 1 C PRO 136 ? E PRO 4   
27 1 Y 1 C GLY 137 ? E GLY 5   
28 1 Y 1 C PRO 222 ? E PRO 90  
29 1 Y 1 C ASP 223 ? E ASP 91  
30 1 Y 1 C SER 224 ? E SER 92  
31 1 Y 1 C PRO 225 ? E PRO 93  
32 1 Y 1 C PRO 226 ? E PRO 94  
33 1 Y 1 C ARG 227 ? E ARG 95  
34 1 Y 1 C SER 228 ? E SER 96  
35 1 Y 1 C ASP 229 ? E ASP 97  
36 1 Y 1 C PRO 230 ? E PRO 98  
37 1 Y 1 C THR 231 ? E THR 99  
38 1 Y 1 C THR 232 ? E THR 100 
39 1 Y 1 C ASP 233 ? E ASP 101 
40 1 Y 1 C GLN 234 ? E GLN 102 
41 1 Y 1 C ARG 235 ? E ARG 103 
1K6O 'double helix'        
1K6O 'b-form double helix' 
1 A DC 1  1_555 B DG 23 1_555 -1.059 -0.173 0.136  -7.899 -7.096  -8.872  1  D_DC101:DG223_E D 101 ? E 223 ? 19 1 
1 A DA 2  1_555 B DT 22 1_555 0.238  0.036  -0.157 14.842 -11.462 4.063   2  D_DA102:DT222_E D 102 ? E 222 ? 20 1 
1 A DC 3  1_555 B DG 21 1_555 0.809  0.086  -0.622 21.008 -17.654 2.974   3  D_DC103:DG221_E D 103 ? E 221 ? 19 1 
1 A DA 4  1_555 B DT 20 1_555 0.251  0.098  -0.314 -5.780 0.459   4.779   4  D_DA104:DT220_E D 104 ? E 220 ? 20 1 
1 A DG 5  1_555 B DC 19 1_555 0.210  -0.165 -0.266 3.026  -7.556  -3.255  5  D_DG105:DC219_E D 105 ? E 219 ? 19 1 
1 A DG 6  1_555 B DC 18 1_555 -0.227 -0.257 -0.415 -9.151 1.052   -1.452  6  D_DG106:DC218_E D 106 ? E 218 ? 19 1 
1 A DA 7  1_555 B DT 17 1_555 0.036  -0.020 0.460  3.913  -7.825  -3.604  7  D_DA107:DT217_E D 107 ? E 217 ? 20 1 
1 A DT 8  1_555 B DA 16 1_555 0.290  -0.066 0.295  4.066  -11.329 -0.240  8  D_DT108:DA216_E D 108 ? E 216 ? 20 1 
1 A DG 9  1_555 B DC 15 1_555 0.119  -0.188 -0.154 -9.897 -8.471  -6.477  9  D_DG109:DC215_E D 109 ? E 215 ? 19 1 
1 A DT 10 1_555 B DA 14 1_555 0.086  -0.219 0.430  -6.472 -12.564 -5.404  10 D_DT110:DA214_E D 110 ? E 214 ? 20 1 
1 A DC 11 1_555 B DG 13 1_555 -0.032 -0.060 -0.158 -1.846 -12.137 -6.782  11 D_DC111:DG213_E D 111 ? E 213 ? 19 1 
1 A DC 12 1_555 B DG 12 1_555 -0.104 -0.084 0.380  4.224  -10.680 -3.539  12 D_DC112:DG212_E D 112 ? E 212 ? 19 1 
1 A DA 13 1_555 B DT 11 1_555 0.041  0.224  0.088  0.972  -1.087  7.266   13 D_DA113:DT211_E D 113 ? E 211 ? 20 1 
1 A DT 14 1_555 B DA 10 1_555 0.160  0.347  -0.030 8.731  -14.949 8.040   14 D_DT114:DA210_E D 114 ? E 210 ? ?  ? 
1 A DA 15 1_555 B DT 9  1_555 -0.536 -0.031 0.068  -9.600 -17.116 9.502   15 D_DA115:DT209_E D 115 ? E 209 ? 20 1 
1 A DT 16 1_555 B DA 8  1_555 -0.453 -0.013 0.277  -6.009 -7.629  6.145   16 D_DT116:DA208_E D 116 ? E 208 ? 20 1 
1 A DT 17 1_555 B DA 7  1_555 -0.469 0.109  -0.204 -0.130 -13.312 2.136   17 D_DT117:DA207_E D 117 ? E 207 ? 20 1 
1 A DA 18 1_555 B DT 6  1_555 0.610  0.440  -0.175 8.421  -2.310  13.288  18 D_DA118:DT206_E D 118 ? E 206 ? ?  ? 
1 A DG 19 1_555 B DC 5  1_555 -0.062 0.155  0.432  5.218  -2.482  -2.081  19 D_DG119:DC205_E D 119 ? E 205 ? 19 1 
1 A DG 20 1_555 B DC 4  1_555 -0.255 -0.580 -0.260 -3.483 -10.724 -8.319  20 D_DG120:DC204_E D 120 ? E 204 ? 19 1 
1 A DA 21 1_555 B DT 3  1_555 0.508  0.151  0.096  -3.534 -5.796  -16.621 21 D_DA121:DT203_E D 121 ? E 203 ? 20 1 
1 A DC 22 1_555 B DG 2  1_555 0.293  0.155  0.280  3.437  -8.893  1.939   22 D_DC122:DG202_E D 122 ? E 202 ? 19 1 
1 A DA 23 1_555 B DT 1  1_555 -0.378 -0.353 -0.397 -6.881 -5.099  -12.319 23 D_DA123:DT201_E D 123 ? E 201 ? 20 1 
1 A DC 1  1_555 B DG 23 1_555 A DA 2  1_555 B DT 22 1_555 0.648  0.963  3.002 6.092   0.042  42.457 1.314  -0.321 3.063 0.057   
-8.361  42.872 1  DD_DC101DA102:DT222DG223_EE D 101 ? E 223 ? D 102 ? E 222 ? 
1 A DA 2  1_555 B DT 22 1_555 A DC 3  1_555 B DG 21 1_555 0.311  -0.639 3.092 3.732   7.105  32.797 -2.174 0.028  2.910 12.353  
-6.488  33.738 2  DD_DA102DC103:DG221DT222_EE D 102 ? E 222 ? D 103 ? E 221 ? 
1 A DC 3  1_555 B DG 21 1_555 A DA 4  1_555 B DT 20 1_555 -0.556 -0.783 3.822 -4.242  18.343 29.775 -4.379 0.209  2.921 31.990  
7.397   35.114 3  DD_DC103DA104:DT220DG221_EE D 103 ? E 221 ? D 104 ? E 220 ? 
1 A DA 4  1_555 B DT 20 1_555 A DG 5  1_555 B DC 19 1_555 0.110  -0.003 3.378 0.986   2.700  29.080 -0.611 0.003  3.365 5.360   
-1.958  29.218 4  DD_DA104DG105:DC219DT220_EE D 104 ? E 220 ? D 105 ? E 219 ? 
1 A DG 5  1_555 B DC 19 1_555 A DG 6  1_555 B DC 18 1_555 -0.831 -0.972 3.673 -1.435  5.524  29.383 -3.144 1.283  3.472 10.763  
2.795   29.921 5  DD_DG105DG106:DC218DC219_EE D 105 ? E 219 ? D 106 ? E 218 ? 
1 A DG 6  1_555 B DC 18 1_555 A DA 7  1_555 B DT 17 1_555 -0.403 -0.348 2.919 -6.035  5.049  34.381 -1.247 -0.138 2.868 8.406   
10.047  35.243 6  DD_DG106DA107:DT217DC218_EE D 106 ? E 218 ? D 107 ? E 217 ? 
1 A DA 7  1_555 B DT 17 1_555 A DT 8  1_555 B DA 16 1_555 0.165  -0.956 3.184 3.069   1.706  32.164 -2.007 0.230  3.132 3.069   
-5.519  32.350 7  DD_DA107DT108:DA216DT217_EE D 107 ? E 217 ? D 108 ? E 216 ? 
1 A DT 8  1_555 B DA 16 1_555 A DG 9  1_555 B DC 15 1_555 -0.179 -0.690 3.521 -0.695  -0.659 43.289 -0.866 0.170  3.533 -0.893  
0.942   43.299 8  DD_DT108DG109:DC215DA216_EE D 108 ? E 216 ? D 109 ? E 215 ? 
1 A DG 9  1_555 B DC 15 1_555 A DT 10 1_555 B DA 14 1_555 -1.002 -0.984 3.095 -5.571  0.900  27.821 -2.208 0.796  3.197 1.848   
11.438  28.376 9  DD_DG109DT110:DA214DC215_EE D 109 ? E 215 ? D 110 ? E 214 ? 
1 A DT 10 1_555 B DA 14 1_555 A DC 11 1_555 B DG 13 1_555 -0.518 -0.186 3.135 2.014   11.114 30.832 -2.139 1.246  2.860 20.078  
-3.639  32.789 10 DD_DT110DC111:DG213DA214_EE D 110 ? E 214 ? D 111 ? E 213 ? 
1 A DC 11 1_555 B DG 13 1_555 A DC 12 1_555 B DG 12 1_555 0.079  -0.023 3.351 -3.162  5.564  31.813 -1.042 -0.710 3.277 10.024  
5.697   32.434 11 DD_DC111DC112:DG212DG213_EE D 111 ? E 213 ? D 112 ? E 212 ? 
1 A DC 12 1_555 B DG 12 1_555 A DA 13 1_555 B DT 11 1_555 2.014  0.840  3.270 10.517  7.906  39.654 0.260  -1.606 3.757 11.284  
-15.010 41.696 12 DD_DC112DA113:DT211DG212_EE D 112 ? E 212 ? D 113 ? E 211 ? 
1 A DA 13 1_555 B DT 11 1_555 A DT 14 1_555 B DA 10 1_555 -0.069 -0.155 2.989 1.095   4.800  26.642 -1.436 0.398  2.912 10.304  
-2.350  27.085 13 DD_DA113DT114:DA210DT211_EE D 113 ? E 211 ? D 114 ? E 210 ? 
1 A DT 14 1_555 B DA 10 1_555 A DA 15 1_555 B DT 9  1_555 -0.240 0.887  3.863 -0.635  -6.204 43.918 1.846  0.249  3.713 -8.246  
0.844   44.337 14 DD_DT114DA115:DT209DA210_EE D 114 ? E 210 ? D 115 ? E 209 ? 
1 A DA 15 1_555 B DT 9  1_555 A DT 16 1_555 B DA 8  1_555 -0.428 -0.804 3.308 -1.795  -5.973 33.778 -0.392 0.434  3.414 -10.171 
3.057   34.332 15 DD_DA115DT116:DA208DT209_EE D 115 ? E 209 ? D 116 ? E 208 ? 
1 A DT 16 1_555 B DA 8  1_555 A DT 17 1_555 B DA 7  1_555 0.267  -0.377 3.050 5.591   -6.866 38.184 0.219  0.237  3.078 -10.327 
-8.409  39.160 16 DD_DT116DT117:DA207DA208_EE D 116 ? E 208 ? D 117 ? E 207 ? 
1 A DT 17 1_555 B DA 7  1_555 A DA 18 1_555 B DT 6  1_555 0.840  1.049  3.267 2.064   1.689  38.575 1.374  -1.011 3.347 2.554   
-3.120  38.663 17 DD_DT117DA118:DT206DA207_EE D 117 ? E 207 ? D 118 ? E 206 ? 
1 A DA 18 1_555 B DT 6  1_555 A DG 19 1_555 B DC 5  1_555 -2.233 0.330  3.286 -10.245 8.081  37.713 -0.550 1.966  3.736 12.068  
15.300  39.828 18 DD_DA118DG119:DC205DT206_EE D 118 ? E 206 ? D 119 ? E 205 ? 
1 A DG 19 1_555 B DC 5  1_555 A DG 20 1_555 B DC 4  1_555 -0.587 -0.491 3.617 4.150   10.631 30.984 -2.804 1.791  3.178 19.106  
-7.459  32.971 19 DD_DG119DG120:DC204DC205_EE D 119 ? E 205 ? D 120 ? E 204 ? 
1 A DG 20 1_555 B DC 4  1_555 A DA 21 1_555 B DT 3  1_555 -0.038 -0.651 3.296 -3.777  12.346 36.550 -2.468 -0.398 2.923 18.972  
5.804   38.690 20 DD_DG120DA121:DT203DC204_EE D 120 ? E 204 ? D 121 ? E 203 ? 
1 A DA 21 1_555 B DT 3  1_555 A DC 22 1_555 B DG 2  1_555 0.868  -1.040 3.138 -1.655  1.042  24.534 -2.741 -2.517 3.028 2.447   
3.887   24.611 21 DD_DA121DC122:DG202DT203_EE D 121 ? E 203 ? D 122 ? E 202 ? 
1 A DC 22 1_555 B DG 2  1_555 A DA 23 1_555 B DT 1  1_555 -0.312 -1.482 3.511 2.470   5.837  35.304 -3.274 0.873  3.205 9.529   
-4.032  35.851 22 DD_DC122DA123:DT201DG202_EE D 122 ? E 202 ? D 123 ? E 201 ? 