#   1PUF 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.281 
PDB   1PUF         
NDB   PD0455       
RCSB  RCSB019574   
WWPDB D_1000019574 
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.entry_id                        1PUF 
_pdbx_database_status.recvd_initial_deposition_date   2003-06-24 
_pdbx_database_status.deposit_site                    RCSB 
_pdbx_database_status.process_site                    RCSB 
_pdbx_database_status.status_code_sf                  REL 
_pdbx_database_status.SG_entry                        . 
_pdbx_database_status.pdb_format_compatible           Y 
_pdbx_database_status.status_code_mr                  ? 
_pdbx_database_status.status_code_cs                  ? 
'Laronde-Leblanc, N.A.' 1 
'Wolberger, C.'         2 
#                        primary 
_citation.journal_abbrev            'Genes Dev.' 
_citation.journal_volume            17 
_citation.page_first                2060 
_citation.page_last                 2072 
_citation.year                      2003 
_citation.journal_id_ASTM           GEDEEP                   US 
_citation.journal_id_ISSN           0890-9369 
_citation.journal_id_CSD            2056 
_citation.book_publisher            ? 
_citation.pdbx_database_id_PubMed   12923056 
_citation.pdbx_database_id_DOI      10.1101/gad.1103303 
primary 'LARONDE-LEBLANC, N.A.' 1 
primary 'Wolberger, C.'         2 
_cell.entry_id           1PUF 
_cell.length_a           60.769 
_cell.length_b           114.853 
_cell.length_c           108.170 
_cell.angle_alpha        90.00 
_cell.angle_beta         90.00 
_cell.angle_gamma        90.00 
_cell.Z_PDB              8 
_cell.pdbx_unique_axis   ? 
_symmetry.entry_id                         1PUF 
_symmetry.space_group_name_H-M             'C 2 2 21' 
_symmetry.pdbx_full_space_group_name_H-M   ? 
_symmetry.cell_setting                     ? 
_symmetry.Int_Tables_number                20 
1 polymer syn "5'-D(*AP*CP*TP*CP*TP*AP*TP*GP*AP*TP*TP*TP*AP*CP*GP*AP*CP*GP*CP*T)-3'" 6083.953 1   ? ? ?                  ? 
2 polymer syn "5'-D(*TP*AP*GP*CP*GP*TP*CP*GP*TP*AP*AP*AP*TP*CP*AP*TP*AP*GP*AP*G)-3'" 6182.029 1   ? ? ?                  ? 
3 polymer man 'Homeobox protein Hox-A9'                                              9646.336 1   ? ? 'residues 193-269' 
4 polymer man 'Pre-B-cell leukemia transcription factor-1'                           8747.872 1   ? ? 'residues 233-305' 
5 water   nat water                                                                  18.015   247 ? ? ?                  ? 
3 Hox-1.7                                       
4 'Homeobox protein PBX1, Homeobox protein PRL' 
1 polydeoxyribonucleotide no no '(DA)(DC)(DT)(DC)(DT)(DA)(DT)(DG)(DA)(DT)(DT)(DT)(DA)(DC)(DG)(DA)(DC)(DG)(DC)(DT)' 
ACTCTATGATTTACGACGCT                                                          D ? 
2 polydeoxyribonucleotide no no '(DT)(DA)(DG)(DC)(DG)(DT)(DC)(DG)(DT)(DA)(DA)(DA)(DT)(DC)(DA)(DT)(DA)(DG)(DA)(DG)' 
TAGCGTCGTAAATCATAGAG                                                          E ? 
1 1  DA  n 
1 2  DC  n 
1 3  DT  n 
1 4  DC  n 
1 5  DT  n 
1 6  DA  n 
1 7  DT  n 
1 8  DG  n 
1 9  DA  n 
1 10 DT  n 
1 11 DT  n 
1 12 DT  n 
1 13 DA  n 
1 14 DC  n 
1 15 DG  n 
1 16 DA  n 
1 17 DC  n 
1 18 DG  n 
1 19 DC  n 
1 20 DT  n 
2 1  DT  n 
2 2  DA  n 
2 3  DG  n 
2 4  DC  n 
2 5  DG  n 
2 6  DT  n 
2 7  DC  n 
2 8  DG  n 
2 9  DT  n 
2 10 DA  n 
2 11 DA  n 
2 12 DA  n 
2 13 DT  n 
2 14 DC  n 
2 15 DA  n 
2 16 DT  n 
2 17 DA  n 
2 18 DG  n 
2 19 DA  n 
2 20 DG  n 
3 1  ASN n 
3 2  ASN n 
3 3  PRO n 
3 4  ALA n 
3 5  ALA n 
3 6  ASN n 
3 7  TRP n 
3 8  LEU n 
3 9  HIS n 
3 10 ALA n 
3 11 ARG n 
3 12 SER n 
3 13 THR n 
3 14 ARG n 
3 15 LYS n 
3 16 LYS n 
3 17 ARG n 
3 18 CYS n 
3 19 PRO n 
3 20 TYR n 
3 21 THR n 
3 22 LYS n 
3 23 HIS n 
3 24 GLN n 
3 25 THR n 
3 26 LEU n 
3 27 GLU n 
3 28 LEU n 
3 29 GLU n 
3 30 LYS n 
3 31 GLU n 
3 32 PHE n 
3 33 LEU n 
3 34 PHE n 
3 35 ASN n 
3 36 MET n 
3 37 TYR n 
3 38 LEU n 
3 39 THR n 
3 40 ARG n 
3 41 ASP n 
3 42 ARG n 
3 43 ARG n 
3 44 TYR n 
3 45 GLU n 
3 46 VAL n 
3 47 ALA n 
3 48 ARG n 
3 49 LEU n 
3 50 LEU n 
3 51 ASN n 
3 52 LEU n 
3 53 THR n 
3 54 GLU n 
3 55 ARG n 
3 56 GLN n 
3 57 VAL n 
3 58 LYS n 
3 59 ILE n 
3 60 TRP n 
3 61 PHE n 
3 62 GLN n 
3 63 ASN n 
3 64 ARG n 
3 65 ARG n 
3 66 MET n 
3 67 LYS n 
3 68 MET n 
3 69 LYS n 
3 70 LYS n 
3 71 ILE n 
3 72 ASN n 
3 73 LYS n 
3 74 ASP n 
3 75 ARG n 
3 76 ALA n 
3 77 LYS n 
4 1  ALA n 
4 2  ARG n 
4 3  ARG n 
4 4  LYS n 
4 5  ARG n 
4 6  ARG n 
4 7  ASN n 
4 8  PHE n 
4 9  ASN n 
4 10 LYS n 
4 11 GLN n 
4 12 ALA n 
4 13 THR n 
4 14 GLU n 
4 15 ILE n 
4 16 LEU n 
4 17 ASN n 
4 18 GLU n 
4 19 TYR n 
4 20 PHE n 
4 21 TYR n 
4 22 SER n 
4 23 HIS n 
4 24 LEU n 
4 25 SER n 
4 26 ASN n 
4 27 PRO n 
4 28 TYR n 
4 29 PRO n 
4 30 SER n 
4 31 GLU n 
4 32 GLU n 
4 33 ALA n 
4 34 LYS n 
4 35 GLU n 
4 36 GLU n 
4 37 LEU n 
4 38 ALA n 
4 39 LYS n 
4 40 LYS n 
4 41 CYS n 
4 42 GLY n 
4 43 ILE n 
4 44 THR n 
4 45 VAL n 
4 46 SER n 
4 47 GLN n 
4 48 VAL n 
4 49 SER n 
4 50 ASN n 
4 51 TRP n 
4 52 PHE n 
4 53 GLY n 
4 54 ASN n 
4 55 LYS n 
4 56 ARG n 
4 57 ILE n 
4 58 ARG n 
4 59 TYR n 
4 60 LYS n 
4 61 LYS n 
4 62 ASN n 
4 63 ILE n 
4 64 GLY n 
4 65 LYS n 
4 66 PHE n 
4 67 GLN n 
4 68 GLU n 
4 69 GLU n 
4 70 ALA n 
4 71 ASN n 
4 72 ILE n 
4 73 TYR n 
3 1 sample ? ? ? 'house mouse' Mus  HOXA9 ? ? ? ? ? ? 'Mus musculus' 10090 ? ? ? ? ? ? ? ? 'Escherichia coli'           562    
Escherichia ? ? ?                  ? ? 'Bl21(DE3) Codon + -RIL' ? ? ? ? ? ? ? PLASMID ? ? ? pET28a+ ? ? 
4 1 sample ? ? ? human         Homo PBX1  ? ? ? ? ? ? 'Homo sapiens' 9606  ? ? ? ? ? ? ? ? 'Escherichia coli BL21(DE3)' 469008 
Escherichia ? ? 'Escherichia coli' ? ? 'Bl21(DE3)'              ? ? ? ? ? ? ? PLASMID ? ? ? pET11d  ? ? 
3 PDB 1PUF       1PUF   1 ?                                                                             ?   ? 
4 PDB 1PUF       1PUF   2 ?                                                                             ?   ? 
1 1 1PUF A 1 ? 77 ? P09631 193 ? 269 ? 193 269 
2 2 1PUF B 1 ? 73 ? P40424 233 ? 305 ? 233 305 
3 3 1PUF D 1 ? 20 ? 1PUF   1   ? 20  ? 1   20  
4 4 1PUF E 1 ? 20 ? 1PUF   21  ? 40  ? 21  40  
ALA 'L-peptide linking' y ALANINE                              ? 'C3 H7 N O2'      89.093  
ARG 'L-peptide linking' y ARGININE                             ? 'C6 H15 N4 O2 1'  175.209 
ASN 'L-peptide linking' y ASPARAGINE                           ? 'C4 H8 N2 O3'     132.118 
ASP 'L-peptide linking' y 'ASPARTIC ACID'                      ? 'C4 H7 N O4'      133.103 
CYS 'L-peptide linking' y CYSTEINE                             ? 'C3 H7 N O2 S'    121.158 
DA  'DNA linking'       y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 
DC  'DNA linking'       y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE"  ? 'C9 H14 N3 O7 P'  307.197 
DG  'DNA linking'       y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 
DT  'DNA linking'       y "THYMIDINE-5'-MONOPHOSPHATE"         ? 'C10 H15 N2 O8 P' 322.208 
GLN 'L-peptide linking' y GLUTAMINE                            ? 'C5 H10 N2 O3'    146.144 
GLU 'L-peptide linking' y 'GLUTAMIC ACID'                      ? 'C5 H9 N O4'      147.129 
GLY 'peptide linking'   y GLYCINE                              ? 'C2 H5 N O2'      75.067  
HIS 'L-peptide linking' y HISTIDINE                            ? 'C6 H10 N3 O2 1'  156.162 
HOH non-polymer         . WATER                                ? 'H2 O'            18.015  
ILE 'L-peptide linking' y ISOLEUCINE                           ? 'C6 H13 N O2'     131.173 
LEU 'L-peptide linking' y LEUCINE                              ? 'C6 H13 N O2'     131.173 
LYS 'L-peptide linking' y LYSINE                               ? 'C6 H15 N2 O2 1'  147.195 
MET 'L-peptide linking' y METHIONINE                           ? 'C5 H11 N O2 S'   149.211 
PHE 'L-peptide linking' y PHENYLALANINE                        ? 'C9 H11 N O2'     165.189 
PRO 'L-peptide linking' y PROLINE                              ? 'C5 H9 N O2'      115.130 
SER 'L-peptide linking' y SERINE                               ? 'C3 H7 N O3'      105.093 
THR 'L-peptide linking' y THREONINE                            ? 'C4 H9 N O3'      119.119 
TRP 'L-peptide linking' y TRYPTOPHAN                           ? 'C11 H12 N2 O2'   204.225 
TYR 'L-peptide linking' y TYROSINE                             ? 'C9 H11 N O3'     181.189 
VAL 'L-peptide linking' y VALINE                               ? 'C5 H11 N O2'     117.146 
_exptl.entry_id          1PUF 
_exptl.method            'X-RAY DIFFRACTION' 
_exptl.crystals_number   1 
#                    1 
_exptl_crystal.density_meas          ? 
_exptl_crystal.density_Matthews      3.03 
_exptl_crystal.density_percent_sol   59.45 
_exptl_crystal.description           ? 
_exptl_crystal_grow.crystal_id      1 
_exptl_crystal_grow.method          ? 
_exptl_crystal_grow.temp            292 
_exptl_crystal_grow.temp_details    ? 
_exptl_crystal_grow.pH              7.50 
'PEG 4000, hepes, cobaltic hexamine, dithiothrietol, EDTA, pH 7.5, VAPOR DIFFUSION, HANGING DROP, temperature 292K, pH 7.50' 
_exptl_crystal_grow.pdbx_pH_range   . 
1 1  1 'PEG 4000'          ? ? ? 
1 2  1 hepes               ? ? ? 
1 3  1 'cobaltic hexamine' ? ? ? 
1 4  1 dithiothrietol      ? ? ? 
1 5  1 EDTA                ? ? ? 
1 6  1 H2O                 ? ? ? 
1 7  2 'PEG 4000'          ? ? ? 
1 8  2 hepes               ? ? ? 
1 9  2 'cobaltic hexamine' ? ? ? 
1 10 2 EDTA                ? ? ? 
1 11 2 dithiothrietol      ? ? ? 
1 12 2 H2O                 ? ? ? 
#                     1 
_diffrn.ambient_temp           100.0 
_diffrn.ambient_temp_details   ? 
_diffrn.crystal_id             1 
_diffrn_detector.diffrn_id              1 
_diffrn_detector.detector               CCD 
_diffrn_detector.type                   'ADSC QUANTUM 4' 
_diffrn_detector.pdbx_collection_date   2000-09-27 
_diffrn_detector.details                ? 
_diffrn_radiation.diffrn_id                        1 
_diffrn_radiation.wavelength_id                    1 
_diffrn_radiation.pdbx_monochromatic_or_laue_m_l   M 
_diffrn_radiation.monochromator                    'SI(111)' 
_diffrn_radiation.pdbx_diffrn_protocol             'SINGLE WAVELENGTH' 
_diffrn_radiation.pdbx_scattering_type             x-ray 
#           1 
_diffrn_radiation_wavelength.wavelength   0.9116 
_diffrn_radiation_wavelength.wt           1.0 
_diffrn_source.diffrn_id                   1 
_diffrn_source.source                      SYNCHROTRON 
_diffrn_source.type                        'NSLS BEAMLINE X4A' 
_diffrn_source.pdbx_synchrotron_site       NSLS 
_diffrn_source.pdbx_synchrotron_beamline   X4A 
_diffrn_source.pdbx_wavelength             0.9116 
_diffrn_source.pdbx_wavelength_list        ? 
_reflns.entry_id                     1PUF 
_reflns.observed_criterion_sigma_I   0.000 
_reflns.observed_criterion_sigma_F   ? 
_reflns.d_resolution_low             20.000 
_reflns.d_resolution_high            1.900 
_reflns.number_obs                   28839 
_reflns.number_all                   ? 
_reflns.percent_possible_obs         95.6 
_reflns.pdbx_Rmerge_I_obs            ? 
_reflns.pdbx_Rsym_value              0.065 
_reflns.pdbx_netI_over_sigmaI        22.3000 
_reflns.B_iso_Wilson_estimate        31.6 
_reflns.pdbx_redundancy              4.300 
_reflns.R_free_details               ? 
_reflns.pdbx_diffrn_id               1 
_reflns.pdbx_ordinal                 1 
_reflns_shell.d_res_high             1.90 
_reflns_shell.d_res_low              20.00 
_reflns_shell.percent_possible_all   94.1 
_reflns_shell.Rmerge_I_obs           ? 
_reflns_shell.pdbx_Rsym_value        0.26 
_reflns_shell.meanI_over_sigI_obs    4.900 
_reflns_shell.pdbx_redundancy        3.80 
_reflns_shell.percent_possible_obs   ? 
_reflns_shell.number_unique_all      ? 
_reflns_shell.pdbx_diffrn_id         ? 
_reflns_shell.pdbx_ordinal           1 
_refine.entry_id                                 1PUF 
_refine.ls_number_reflns_obs                     28839 
_refine.ls_number_reflns_all                     30169 
_refine.pdbx_ls_sigma_I                          ? 
_refine.pdbx_ls_sigma_F                          0.000 
_refine.pdbx_data_cutoff_high_absF               1537852.39 
_refine.pdbx_data_cutoff_low_absF                0.000000 
_refine.pdbx_data_cutoff_high_rms_absF           1537852.39 
_refine.ls_d_res_low                             19.97 
_refine.ls_d_res_high                            1.90 
_refine.ls_percent_reflns_obs                    95.6 
_refine.ls_R_factor_obs                          0.233 
_refine.ls_R_factor_all                          ? 
_refine.ls_R_factor_R_work                       0.233 
_refine.ls_R_factor_R_free                       0.268 
_refine.ls_R_factor_R_free_error                 0.005 
_refine.ls_R_factor_R_free_error_details         ? 
_refine.ls_percent_reflns_R_free                 10.0 
_refine.ls_number_reflns_R_free                  2873 
_refine.ls_number_parameters                     ? 
_refine.ls_number_restraints                     ? 
_refine.occupancy_min                            ? 
_refine.occupancy_max                            ? 
_refine.correlation_coeff_Fo_to_Fc               ? 
_refine.correlation_coeff_Fo_to_Fc_free          ? 
_refine.B_iso_mean                               48.7 
_refine.aniso_B[1][1]                            -2.44 
_refine.aniso_B[2][2]                            -8.53 
_refine.aniso_B[3][3]                            10.98 
_refine.aniso_B[1][2]                            0.00 
_refine.aniso_B[1][3]                            0.00 
_refine.aniso_B[2][3]                            0.00 
_refine.solvent_model_details                    ? 
_refine.solvent_model_param_ksol                 ? 
_refine.solvent_model_param_bsol                 ? 
_refine.pdbx_solvent_vdw_probe_radii             ? 
_refine.pdbx_solvent_ion_probe_radii             ? 
_refine.pdbx_solvent_shrinkage_radii             ? 
_refine.pdbx_ls_cross_valid_method               THROUGHOUT 
_refine.details                                  ? 
_refine.pdbx_starting_model                      'PDB ENTRY 1B72' 
_refine.pdbx_method_to_determine_struct          'MOLECULAR REPLACEMENT' 
_refine.pdbx_isotropic_thermal_model             ? 
_refine.pdbx_stereochemistry_target_values       'ENGH & HUBER' 
_refine.pdbx_stereochem_target_val_spec_case     ? 
_refine.pdbx_R_Free_selection_details            'RANDOM IN CNS' 
_refine.pdbx_overall_ESU_R                       ? 
_refine.pdbx_overall_ESU_R_Free                  ? 
_refine.overall_SU_ML                            ? 
_refine.overall_SU_B                             ? 
_refine.ls_redundancy_reflns_obs                 ? 
_refine.overall_SU_R_Cruickshank_DPI             ? 
_refine.overall_SU_R_free                        ? 
_refine.pdbx_refine_id                           'X-RAY DIFFRACTION' 
_refine.pdbx_diffrn_id                           1 
_refine.pdbx_TLS_residual_ADP_flag               ? 
_refine.pdbx_overall_phase_error                 ? 
_refine.pdbx_overall_SU_R_free_Cruickshank_DPI   ? 
_refine.pdbx_overall_SU_R_Blow_DPI               ? 
_refine.pdbx_overall_SU_R_free_Blow_DPI          ? 
_refine_analyze.entry_id                        1PUF 
_refine_analyze.Luzzati_coordinate_error_obs    0.29 
_refine_analyze.Luzzati_sigma_a_obs             0.26 
_refine_analyze.Luzzati_d_res_low_obs           5.00 
_refine_analyze.Luzzati_coordinate_error_free   0.35 
_refine_analyze.Luzzati_sigma_a_free            0.28 
_refine_analyze.Luzzati_d_res_low_free          ? 
_refine_analyze.number_disordered_residues      ? 
_refine_analyze.occupancy_sum_hydrogen          ? 
_refine_analyze.occupancy_sum_non_hydrogen      ? 
_refine_analyze.pdbx_refine_id                  'X-RAY DIFFRACTION' 
_refine_hist.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_refine_hist.cycle_id                         LAST 
_refine_hist.pdbx_number_atoms_protein        1268 
_refine_hist.pdbx_number_atoms_nucleic_acid   814 
_refine_hist.pdbx_number_atoms_ligand         0 
_refine_hist.number_atoms_solvent             247 
_refine_hist.number_atoms_total               2329 
_refine_hist.d_res_high                       1.90 
_refine_hist.d_res_low                        19.97 
c_bond_d                0.010 ?    ? ? 'X-RAY DIFFRACTION' ? 
c_bond_d_na             ?     ?    ? ? 'X-RAY DIFFRACTION' ? 
c_bond_d_prot           ?     ?    ? ? 'X-RAY DIFFRACTION' ? 
c_angle_d               ?     ?    ? ? 'X-RAY DIFFRACTION' ? 
c_angle_d_na            ?     ?    ? ? 'X-RAY DIFFRACTION' ? 
c_angle_d_prot          ?     ?    ? ? 'X-RAY DIFFRACTION' ? 
c_angle_deg             1.43  ?    ? ? 'X-RAY DIFFRACTION' ? 
c_angle_deg_na          ?     ?    ? ? 'X-RAY DIFFRACTION' ? 
c_angle_deg_prot        ?     ?    ? ? 'X-RAY DIFFRACTION' ? 
c_dihedral_angle_d      18.5  ?    ? ? 'X-RAY DIFFRACTION' ? 
c_dihedral_angle_d_na   ?     ?    ? ? 'X-RAY DIFFRACTION' ? 
c_dihedral_angle_d_prot ?     ?    ? ? 'X-RAY DIFFRACTION' ? 
c_improper_angle_d      1.37  ?    ? ? 'X-RAY DIFFRACTION' ? 
c_improper_angle_d_na   ?     ?    ? ? 'X-RAY DIFFRACTION' ? 
c_improper_angle_d_prot ?     ?    ? ? 'X-RAY DIFFRACTION' ? 
c_mcbond_it             1.54  1.50 ? ? 'X-RAY DIFFRACTION' ? 
c_mcangle_it            2.48  2.00 ? ? 'X-RAY DIFFRACTION' ? 
c_scbond_it             1.97  2.00 ? ? 'X-RAY DIFFRACTION' ? 
c_scangle_it            2.98  2.50 ? ? 'X-RAY DIFFRACTION' ? 
_refine_ls_shell.pdbx_total_number_of_bins_used   6 
_refine_ls_shell.d_res_high                       1.90 
_refine_ls_shell.d_res_low                        2.02 
_refine_ls_shell.number_reflns_R_work             4155 
_refine_ls_shell.R_factor_R_work                  0.322 
_refine_ls_shell.percent_reflns_obs               93.5 
_refine_ls_shell.R_factor_R_free                  0.355 
_refine_ls_shell.R_factor_R_free_error            0.017 
_refine_ls_shell.percent_reflns_R_free            9.9 
_refine_ls_shell.number_reflns_R_free             456 
_refine_ls_shell.redundancy_reflns_obs            ? 
_refine_ls_shell.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_refine_ls_shell.number_reflns_all                ? 
_refine_ls_shell.R_factor_all                     ? 
_struct.entry_id                  1PUF 
_struct.title                     'Crystal Structure of HoxA9 and Pbx1 homeodomains bound to DNA' 
_struct.pdbx_descriptor           'Homeobox protein Hox-A9, Pre-B-cell leukemia transcription factor-1/DNA Complex' 
_struct.pdbx_model_details        ? 
_struct.pdbx_CASP_flag            ? 
_struct.pdbx_model_type_details   ? 
_struct_keywords.entry_id        1PUF 
_struct_keywords.pdbx_keywords   Transcription/DNA 
'Homeodomian, Protein-DNA complex, Hox Hexapeptide, TALE homeodomain, Homeodomain interaction, Transcription-DNA COMPLEX' 
A N N 1 ? 
B N N 2 ? 
C N N 3 ? 
D N N 4 ? 
E N N 5 ? 
F N N 5 ? 
G N N 5 ? 
H N N 5 ? 
#                    1 
_struct_biol.pdbx_parent_biol_id   ? 
_struct_biol.details               ? 
HELX_P HELX_P1 1 THR C 21 ? ASN C 35 ? THR A 213 ASN A 227 1 ? 15 
HELX_P HELX_P2 2 THR C 39 ? ASN C 51 ? THR A 231 ASN A 243 1 ? 13 
HELX_P HELX_P3 3 THR C 53 ? ALA C 76 ? THR A 245 ALA A 268 1 ? 24 
HELX_P HELX_P4 4 ASN D 9  ? HIS D 23 ? ASN B 241 HIS B 255 1 ? 15 
HELX_P HELX_P5 5 SER D 30 ? GLY D 42 ? SER B 262 GLY B 274 1 ? 13 
HELX_P HELX_P6 6 THR D 44 ? ASN D 62 ? THR B 276 ASN B 294 1 ? 19 
HELX_P HELX_P7 7 GLU D 68 ? TYR D 73 ? GLU B 300 TYR B 305 1 ? 6  
#          HELX_P 
_struct_conf_type.criteria    ? 
_struct_conf_type.reference   ? 
hydrog1  hydrog ? ? A DC 2  N3 ? ? ? 1_555 B DG 20 N1 ? ? D DC 2  E DG 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog2  hydrog ? ? A DC 2  N4 ? ? ? 1_555 B DG 20 O6 ? ? D DC 2  E DG 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog3  hydrog ? ? A DC 2  O2 ? ? ? 1_555 B DG 20 N2 ? ? D DC 2  E DG 40 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog4  hydrog ? ? A DT 3  N3 ? ? ? 1_555 B DA 19 N1 ? ? D DT 3  E DA 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog5  hydrog ? ? A DT 3  O4 ? ? ? 1_555 B DA 19 N6 ? ? D DT 3  E DA 39 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog6  hydrog ? ? A DC 4  N3 ? ? ? 1_555 B DG 18 N1 ? ? D DC 4  E DG 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog7  hydrog ? ? A DC 4  N4 ? ? ? 1_555 B DG 18 O6 ? ? D DC 4  E DG 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog8  hydrog ? ? A DC 4  O2 ? ? ? 1_555 B DG 18 N2 ? ? D DC 4  E DG 38 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog9  hydrog ? ? A DT 5  N3 ? ? ? 1_555 B DA 17 N1 ? ? D DT 5  E DA 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog10 hydrog ? ? A DT 5  O4 ? ? ? 1_555 B DA 17 N6 ? ? D DT 5  E DA 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog11 hydrog ? ? A DA 6  N1 ? ? ? 1_555 B DT 16 N3 ? ? D DA 6  E DT 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog12 hydrog ? ? A DA 6  N6 ? ? ? 1_555 B DT 16 O4 ? ? D DA 6  E DT 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog13 hydrog ? ? A DT 7  N3 ? ? ? 1_555 B DA 15 N1 ? ? D DT 7  E DA 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog14 hydrog ? ? A DT 7  O4 ? ? ? 1_555 B DA 15 N6 ? ? D DT 7  E DA 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog15 hydrog ? ? A DG 8  N1 ? ? ? 1_555 B DC 14 N3 ? ? D DG 8  E DC 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog16 hydrog ? ? A DG 8  N2 ? ? ? 1_555 B DC 14 O2 ? ? D DG 8  E DC 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog17 hydrog ? ? A DG 8  O6 ? ? ? 1_555 B DC 14 N4 ? ? D DG 8  E DC 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog18 hydrog ? ? A DA 9  N1 ? ? ? 1_555 B DT 13 N3 ? ? D DA 9  E DT 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog19 hydrog ? ? A DA 9  N6 ? ? ? 1_555 B DT 13 O4 ? ? D DA 9  E DT 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog20 hydrog ? ? A DT 10 N3 ? ? ? 1_555 B DA 12 N1 ? ? D DT 10 E DA 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog21 hydrog ? ? A DT 10 O4 ? ? ? 1_555 B DA 12 N6 ? ? D DT 10 E DA 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog22 hydrog ? ? A DT 11 N3 ? ? ? 1_555 B DA 11 N1 ? ? D DT 11 E DA 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog23 hydrog ? ? A DT 11 O4 ? ? ? 1_555 B DA 11 N6 ? ? D DT 11 E DA 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog24 hydrog ? ? A DT 12 N3 ? ? ? 1_555 B DA 10 N1 ? ? D DT 12 E DA 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog25 hydrog ? ? A DT 12 O4 ? ? ? 1_555 B DA 10 N6 ? ? D DT 12 E DA 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog26 hydrog ? ? A DA 13 N1 ? ? ? 1_555 B DT 9  N3 ? ? D DA 13 E DT 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog27 hydrog ? ? A DA 13 N6 ? ? ? 1_555 B DT 9  O4 ? ? D DA 13 E DT 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog28 hydrog ? ? A DC 14 N3 ? ? ? 1_555 B DG 8  N1 ? ? D DC 14 E DG 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog29 hydrog ? ? A DC 14 N4 ? ? ? 1_555 B DG 8  O6 ? ? D DC 14 E DG 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog30 hydrog ? ? A DC 14 O2 ? ? ? 1_555 B DG 8  N2 ? ? D DC 14 E DG 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog31 hydrog ? ? A DG 15 N1 ? ? ? 1_555 B DC 7  N3 ? ? D DG 15 E DC 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog32 hydrog ? ? A DG 15 N2 ? ? ? 1_555 B DC 7  O2 ? ? D DG 15 E DC 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog33 hydrog ? ? A DG 15 O6 ? ? ? 1_555 B DC 7  N4 ? ? D DG 15 E DC 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog34 hydrog ? ? A DA 16 N1 ? ? ? 1_555 B DT 6  N3 ? ? D DA 16 E DT 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog35 hydrog ? ? A DA 16 N6 ? ? ? 1_555 B DT 6  O4 ? ? D DA 16 E DT 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog36 hydrog ? ? A DC 17 N3 ? ? ? 1_555 B DG 5  N1 ? ? D DC 17 E DG 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog37 hydrog ? ? A DC 17 N4 ? ? ? 1_555 B DG 5  O6 ? ? D DC 17 E DG 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog38 hydrog ? ? A DC 17 O2 ? ? ? 1_555 B DG 5  N2 ? ? D DC 17 E DG 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog39 hydrog ? ? A DG 18 N1 ? ? ? 1_555 B DC 4  N3 ? ? D DG 18 E DC 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog40 hydrog ? ? A DG 18 N2 ? ? ? 1_555 B DC 4  O2 ? ? D DG 18 E DC 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog41 hydrog ? ? A DG 18 O6 ? ? ? 1_555 B DC 4  N4 ? ? D DG 18 E DC 24 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog42 hydrog ? ? A DC 19 N3 ? ? ? 1_555 B DG 3  N1 ? ? D DC 19 E DG 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog43 hydrog ? ? A DC 19 N4 ? ? ? 1_555 B DG 3  O6 ? ? D DC 19 E DG 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog44 hydrog ? ? A DC 19 O2 ? ? ? 1_555 B DG 3  N2 ? ? D DC 19 E DG 23 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog45 hydrog ? ? A DT 20 N3 ? ? ? 1_555 B DA 2  N1 ? ? D DT 20 E DA 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
hydrog46 hydrog ? ? A DT 20 O4 ? ? ? 1_555 B DA 2  N6 ? ? D DT 20 E DA 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? 
#          hydrog 
_struct_conn_type.criteria    ? 
_struct_conn_type.reference   ? 
_database_PDB_matrix.entry_id          1PUF 
_database_PDB_matrix.origx[1][1]       1.000000 
_database_PDB_matrix.origx[1][2]       0.000000 
_database_PDB_matrix.origx[1][3]       0.000000 
_database_PDB_matrix.origx[2][1]       0.000000 
_database_PDB_matrix.origx[2][2]       1.000000 
_database_PDB_matrix.origx[2][3]       0.000000 
_database_PDB_matrix.origx[3][1]       0.000000 
_database_PDB_matrix.origx[3][2]       0.000000 
_database_PDB_matrix.origx[3][3]       1.000000 
_database_PDB_matrix.origx_vector[1]   0.00000 
_database_PDB_matrix.origx_vector[2]   0.00000 
_database_PDB_matrix.origx_vector[3]   0.00000 
_atom_sites.entry_id                    1PUF 
_atom_sites.fract_transf_matrix[1][1]   0.016456 
_atom_sites.fract_transf_matrix[1][2]   0.000000 
_atom_sites.fract_transf_matrix[1][3]   0.000000 
_atom_sites.fract_transf_matrix[2][1]   0.000000 
_atom_sites.fract_transf_matrix[2][2]   0.008707 
_atom_sites.fract_transf_matrix[2][3]   0.000000 
_atom_sites.fract_transf_matrix[3][1]   0.000000 
_atom_sites.fract_transf_matrix[3][2]   0.000000 
_atom_sites.fract_transf_matrix[3][3]   0.009245 
_atom_sites.fract_transf_vector[1]      0.00000 
_atom_sites.fract_transf_vector[2]      0.00000 
_atom_sites.fract_transf_vector[3]      0.00000 
ATOM   1    O "O5'" . DA  A 1 1  ? -19.900 1.955  8.394   1.00 99.10  ? 1   DA  D "O5'" 1 
ATOM   2    C "C5'" . DA  A 1 1  ? -21.169 1.521  8.895   1.00 99.23  ? 1   DA  D "C5'" 1 
ATOM   3    C "C4'" . DA  A 1 1  ? -21.074 0.824  10.234  1.00 99.04  ? 1   DA  D "C4'" 1 
ATOM   4    O "O4'" . DA  A 1 1  ? -20.249 -0.359 10.107  1.00 98.27  ? 1   DA  D "O4'" 1 
ATOM   5    C "C3'" . DA  A 1 1  ? -20.442 1.657  11.351  1.00 99.24  ? 1   DA  D "C3'" 1 
ATOM   6    O "O3'" . DA  A 1 1  ? -21.082 1.403  12.605  1.00 99.98  ? 1   DA  D "O3'" 1 
ATOM   7    C "C2'" . DA  A 1 1  ? -19.014 1.153  11.401  1.00 98.37  ? 1   DA  D "C2'" 1 
ATOM   8    C "C1'" . DA  A 1 1  ? -19.165 -0.304 11.021  1.00 96.83  ? 1   DA  D "C1'" 1 
ATOM   9    N N9    . DA  A 1 1  ? -17.986 -0.830 10.345  1.00 94.87  ? 1   DA  D N9    1 
ATOM   10   C C8    . DA  A 1 1  ? -17.640 -0.724 9.021   1.00 94.21  ? 1   DA  D C8    1 
ATOM   11   N N7    . DA  A 1 1  ? -16.501 -1.299 8.724   1.00 93.43  ? 1   DA  D N7    1 
ATOM   12   C C5    . DA  A 1 1  ? -16.070 -1.820 9.934   1.00 93.20  ? 1   DA  D C5    1 
ATOM   13   C C6    . DA  A 1 1  ? -14.926 -2.550 10.297  1.00 93.01  ? 1   DA  D C6    1 
ATOM   14   N N6    . DA  A 1 1  ? -13.961 -2.901 9.442   1.00 92.69  ? 1   DA  D N6    1 
ATOM   15   N N1    . DA  A 1 1  ? -14.806 -2.916 11.590  1.00 93.03  ? 1   DA  D N1    1 
ATOM   16   C C2    . DA  A 1 1  ? -15.772 -2.565 12.451  1.00 92.73  ? 1   DA  D C2    1 
ATOM   17   N N3    . DA  A 1 1  ? -16.888 -1.883 12.232  1.00 92.72  ? 1   DA  D N3    1 
ATOM   18   C C4    . DA  A 1 1  ? -16.977 -1.538 10.939  1.00 93.62  ? 1   DA  D C4    1 
ATOM   19   P P     . DC  A 1 2  ? -20.785 2.372  13.857  1.00 100.63 ? 2   DC  D P     1 
ATOM   20   O OP1   . DC  A 1 2  ? -21.810 2.087  14.897  1.00 100.22 ? 2   DC  D OP1   1 
ATOM   21   O OP2   . DC  A 1 2  ? -20.613 3.764  13.349  1.00 100.20 ? 2   DC  D OP2   1 
ATOM   22   O "O5'" . DC  A 1 2  ? -19.383 1.859  14.406  1.00 98.81  ? 2   DC  D "O5'" 1 
ATOM   23   C "C5'" . DC  A 1 2  ? -19.321 0.765  15.310  1.00 96.30  ? 2   DC  D "C5'" 1 
ATOM   24   C "C4'" . DC  A 1 2  ? -17.987 0.760  16.014  1.00 94.39  ? 2   DC  D "C4'" 1 
ATOM   25   O "O4'" . DC  A 1 2  ? -16.966 0.265  15.115  1.00 93.53  ? 2   DC  D "O4'" 1 
ATOM   26   C "C3'" . DC  A 1 2  ? -17.534 2.148  16.462  1.00 93.32  ? 2   DC  D "C3'" 1 
ATOM   27   O "O3'" . DC  A 1 2  ? -16.929 2.093  17.755  1.00 92.38  ? 2   DC  D "O3'" 1 
ATOM   28   C "C2'" . DC  A 1 2  ? -16.511 2.540  15.413  1.00 93.25  ? 2   DC  D "C2'" 1 
ATOM   29   C "C1'" . DC  A 1 2  ? -15.906 1.200  15.025  1.00 92.42  ? 2   DC  D "C1'" 1 
ATOM   30   N N1    . DC  A 1 2  ? -15.373 1.151  13.653  1.00 90.69  ? 2   DC  D N1    1 
ATOM   31   C C2    . DC  A 1 2  ? -14.200 0.434  13.407  1.00 89.55  ? 2   DC  D C2    1 
ATOM   32   O O2    . DC  A 1 2  ? -13.647 -0.156 14.347  1.00 88.34  ? 2   DC  D O2    1 
ATOM   33   N N3    . DC  A 1 2  ? -13.699 0.403  12.152  1.00 88.98  ? 2   DC  D N3    1 
ATOM   34   C C4    . DC  A 1 2  ? -14.324 1.053  11.167  1.00 88.97  ? 2   DC  D C4    1 
ATOM   35   N N4    . DC  A 1 2  ? -13.791 1.004  9.948   1.00 88.99  ? 2   DC  D N4    1 
ATOM   36   C C5    . DC  A 1 2  ? -15.522 1.785  11.390  1.00 89.14  ? 2   DC  D C5    1 
ATOM   37   C C6    . DC  A 1 2  ? -16.009 1.805  12.634  1.00 90.09  ? 2   DC  D C6    1 
ATOM   38   P P     . DT  A 1 3  ? -16.794 3.438  18.623  1.00 91.47  ? 3   DT  D P     1 
ATOM   39   O OP1   . DT  A 1 3  ? -16.402 3.059  20.006  1.00 92.00  ? 3   DT  D OP1   1 
ATOM   40   O OP2   . DT  A 1 3  ? -18.010 4.263  18.403  1.00 91.68  ? 3   DT  D OP2   1 
ATOM   41   O "O5'" . DT  A 1 3  ? -15.556 4.181  17.967  1.00 89.35  ? 3   DT  D "O5'" 1 
ATOM   42   C "C5'" . DT  A 1 3  ? -14.406 4.476  18.740  1.00 86.22  ? 3   DT  D "C5'" 1 
ATOM   43   C "C4'" . DT  A 1 3  ? -13.622 3.213  19.003  1.00 83.56  ? 3   DT  D "C4'" 1 
ATOM   44   O "O4'" . DT  A 1 3  ? -13.468 2.468  17.775  1.00 82.33  ? 3   DT  D "O4'" 1 
ATOM   45   C "C3'" . DT  A 1 3  ? -12.211 3.501  19.487  1.00 82.45  ? 3   DT  D "C3'" 1 
ATOM   46   O "O3'" . DT  A 1 3  ? -11.756 2.468  20.352  1.00 81.09  ? 3   DT  D "O3'" 1 
ATOM   47   C "C2'" . DT  A 1 3  ? -11.405 3.530  18.203  1.00 81.95  ? 3   DT  D "C2'" 1 
ATOM   48   C "C1'" . DT  A 1 3  ? -12.115 2.509  17.329  1.00 80.68  ? 3   DT  D "C1'" 1 
ATOM   49   N N1    . DT  A 1 3  ? -12.141 2.869  15.900  1.00 77.99  ? 3   DT  D N1    1 
ATOM   50   C C2    . DT  A 1 3  ? -11.189 2.356  15.048  1.00 76.28  ? 3   DT  D C2    1 
ATOM   51   O O2    . DT  A 1 3  ? -10.259 1.661  15.419  1.00 75.15  ? 3   DT  D O2    1 
ATOM   52   N N3    . DT  A 1 3  ? -11.363 2.701  13.735  1.00 75.06  ? 3   DT  D N3    1 
ATOM   53   C C4    . DT  A 1 3  ? -12.354 3.504  13.204  1.00 75.43  ? 3   DT  D C4    1 
ATOM   54   O O4    . DT  A 1 3  ? -12.403 3.700  11.996  1.00 74.80  ? 3   DT  D O4    1 
ATOM   55   C C5    . DT  A 1 3  ? -13.282 4.047  14.162  1.00 76.44  ? 3   DT  D C5    1 
ATOM   56   C C7    . DT  A 1 3  ? -14.359 4.972  13.689  1.00 76.67  ? 3   DT  D C7    1 
ATOM   57   C C6    . DT  A 1 3  ? -13.134 3.701  15.441  1.00 77.14  ? 3   DT  D C6    1 
ATOM   58   P P     . DC  A 1 4  ? -10.419 2.702  21.195  1.00 80.50  ? 4   DC  D P     1 
ATOM   59   O OP1   . DC  A 1 4  ? -10.236 1.607  22.179  1.00 81.71  ? 4   DC  D OP1   1 
ATOM   60   O OP2   . DC  A 1 4  ? -10.417 4.113  21.656  1.00 80.89  ? 4   DC  D OP2   1 
ATOM   61   O "O5'" . DC  A 1 4  ? -9.280  2.566  20.102  1.00 80.05  ? 4   DC  D "O5'" 1 
ATOM   62   C "C5'" . DC  A 1 4  ? -8.223  3.493  20.082  1.00 77.84  ? 4   DC  D "C5'" 1 
ATOM   63   C "C4'" . DC  A 1 4  ? -7.160  3.054  19.108  1.00 76.39  ? 4   DC  D "C4'" 1 
ATOM   64   O "O4'" . DC  A 1 4  ? -7.689  3.070  17.758  1.00 74.71  ? 4   DC  D "O4'" 1 
ATOM   65   C "C3'" . DC  A 1 4  ? -5.996  4.031  19.116  1.00 75.84  ? 4   DC  D "C3'" 1 
ATOM   66   O "O3'" . DC  A 1 4  ? -4.775  3.315  18.968  1.00 76.69  ? 4   DC  D "O3'" 1 
ATOM   67   C "C2'" . DC  A 1 4  ? -6.303  4.972  17.965  1.00 74.22  ? 4   DC  D "C2'" 1 
ATOM   68   C "C1'" . DC  A 1 4  ? -7.081  4.103  16.991  1.00 72.68  ? 4   DC  D "C1'" 1 
ATOM   69   N N1    . DC  A 1 4  ? -8.152  4.808  16.251  1.00 69.79  ? 4   DC  D N1    1 
ATOM   70   C C2    . DC  A 1 4  ? -8.134  4.768  14.861  1.00 67.58  ? 4   DC  D C2    1 
ATOM   71   O O2    . DC  A 1 4  ? -7.215  4.173  14.301  1.00 67.28  ? 4   DC  D O2    1 
ATOM   72   N N3    . DC  A 1 4  ? -9.117  5.374  14.163  1.00 66.33  ? 4   DC  D N3    1 
ATOM   73   C C4    . DC  A 1 4  ? -10.094 6.009  14.807  1.00 66.51  ? 4   DC  D C4    1 
ATOM   74   N N4    . DC  A 1 4  ? -11.052 6.584  14.075  1.00 66.03  ? 4   DC  D N4    1 
ATOM   75   C C5    . DC  A 1 4  ? -10.133 6.082  16.229  1.00 66.95  ? 4   DC  D C5    1 
ATOM   76   C C6    . DC  A 1 4  ? -9.148  5.475  16.906  1.00 68.23  ? 4   DC  D C6    1 
ATOM   77   P P     . DT  A 1 5  ? -3.430  3.927  19.575  1.00 76.47  ? 5   DT  D P     1 
ATOM   78   O OP1   . DT  A 1 5  ? -2.625  2.830  20.181  1.00 76.72  ? 5   DT  D OP1   1 
ATOM   79   O OP2   . DT  A 1 5  ? -3.818  5.105  20.398  1.00 76.70  ? 5   DT  D OP2   1 
ATOM   80   O "O5'" . DT  A 1 5  ? -2.671  4.420  18.268  1.00 75.01  ? 5   DT  D "O5'" 1 
ATOM   81   C "C5'" . DT  A 1 5  ? -2.532  3.540  17.156  1.00 71.85  ? 5   DT  D "C5'" 1 
ATOM   82   C "C4'" . DT  A 1 5  ? -2.372  4.326  15.878  1.00 69.18  ? 5   DT  D "C4'" 1 
ATOM   83   O "O4'" . DT  A 1 5  ? -3.622  4.938  15.463  1.00 67.23  ? 5   DT  D "O4'" 1 
ATOM   84   C "C3'" . DT  A 1 5  ? -1.352  5.461  15.967  1.00 68.20  ? 5   DT  D "C3'" 1 
ATOM   85   O "O3'" . DT  A 1 5  ? -0.647  5.501  14.732  1.00 69.12  ? 5   DT  D "O3'" 1 
ATOM   86   C "C2'" . DT  A 1 5  ? -2.233  6.696  16.066  1.00 66.67  ? 5   DT  D "C2'" 1 
ATOM   87   C "C1'" . DT  A 1 5  ? -3.353  6.286  15.128  1.00 65.41  ? 5   DT  D "C1'" 1 
ATOM   88   N N1    . DT  A 1 5  ? -4.617  7.057  15.167  1.00 62.89  ? 5   DT  D N1    1 
ATOM   89   C C2    . DT  A 1 5  ? -5.283  7.228  13.968  1.00 61.33  ? 5   DT  D C2    1 
ATOM   90   O O2    . DT  A 1 5  ? -4.870  6.799  12.905  1.00 60.13  ? 5   DT  D O2    1 
ATOM   91   N N3    . DT  A 1 5  ? -6.450  7.926  14.057  1.00 60.31  ? 5   DT  D N3    1 
ATOM   92   C C4    . DT  A 1 5  ? -7.008  8.474  15.185  1.00 61.69  ? 5   DT  D C4    1 
ATOM   93   O O4    . DT  A 1 5  ? -8.085  9.053  15.109  1.00 62.23  ? 5   DT  D O4    1 
ATOM   94   C C5    . DT  A 1 5  ? -6.247  8.294  16.403  1.00 61.84  ? 5   DT  D C5    1 
ATOM   95   C C7    . DT  A 1 5  ? -6.753  8.914  17.666  1.00 62.02  ? 5   DT  D C7    1 
ATOM   96   C C6    . DT  A 1 5  ? -5.111  7.589  16.338  1.00 62.34  ? 5   DT  D C6    1 
ATOM   97   P P     . DA  A 1 6  ? 0.931   5.200  14.684  1.00 68.90  ? 6   DA  D P     1 
ATOM   98   O OP1   . DA  A 1 6  ? 1.156   3.751  14.916  1.00 69.25  ? 6   DA  D OP1   1 
ATOM   99   O OP2   . DA  A 1 6  ? 1.641   6.202  15.521  1.00 69.82  ? 6   DA  D OP2   1 
ATOM   100  O "O5'" . DA  A 1 6  ? 1.271   5.476  13.161  1.00 66.02  ? 6   DA  D "O5'" 1 
ATOM   101  C "C5'" . DA  A 1 6  ? 0.591   4.750  12.149  1.00 61.16  ? 6   DA  D "C5'" 1 
ATOM   102  C "C4'" . DA  A 1 6  ? 0.214   5.656  11.003  1.00 56.35  ? 6   DA  D "C4'" 1 
ATOM   103  O "O4'" . DA  A 1 6  ? -0.968  6.450  11.260  1.00 54.22  ? 6   DA  D "O4'" 1 
ATOM   104  C "C3'" . DA  A 1 6  ? 1.296   6.626  10.554  1.00 55.31  ? 6   DA  D "C3'" 1 
ATOM   105  O "O3'" . DA  A 1 6  ? 1.318   6.566  9.140   1.00 54.33  ? 6   DA  D "O3'" 1 
ATOM   106  C "C2'" . DA  A 1 6  ? 0.803   7.982  11.046  1.00 52.91  ? 6   DA  D "C2'" 1 
ATOM   107  C "C1'" . DA  A 1 6  ? -0.713  7.830  11.017  1.00 50.78  ? 6   DA  D "C1'" 1 
ATOM   108  N N9    . DA  A 1 6  ? -1.413  8.573  12.062  1.00 47.75  ? 6   DA  D N9    1 
ATOM   109  C C8    . DA  A 1 6  ? -1.071  8.649  13.392  1.00 46.36  ? 6   DA  D C8    1 
ATOM   110  N N7    . DA  A 1 6  ? -1.931  9.310  14.119  1.00 46.32  ? 6   DA  D N7    1 
ATOM   111  C C5    . DA  A 1 6  ? -2.896  9.712  13.207  1.00 45.10  ? 6   DA  D C5    1 
ATOM   112  C C6    . DA  A 1 6  ? -4.085  10.425 13.356  1.00 43.32  ? 6   DA  D C6    1 
ATOM   113  N N6    . DA  A 1 6  ? -4.540  10.862 14.526  1.00 44.76  ? 6   DA  D N6    1 
ATOM   114  N N1    . DA  A 1 6  ? -4.815  10.668 12.248  1.00 42.97  ? 6   DA  D N1    1 
ATOM   115  C C2    . DA  A 1 6  ? -4.372  10.199 11.075  1.00 42.03  ? 6   DA  D C2    1 
ATOM   116  N N3    . DA  A 1 6  ? -3.275  9.499  10.809  1.00 44.45  ? 6   DA  D N3    1 
ATOM   117  C C4    . DA  A 1 6  ? -2.572  9.287  11.932  1.00 45.04  ? 6   DA  D C4    1 
ATOM   118  P P     . DT  A 1 7  ? 2.495   7.276  8.336   1.00 54.57  ? 7   DT  D P     1 
ATOM   119  O OP1   . DT  A 1 7  ? 2.747   6.399  7.164   1.00 53.93  ? 7   DT  D OP1   1 
ATOM   120  O OP2   . DT  A 1 7  ? 3.609   7.624  9.261   1.00 52.58  ? 7   DT  D OP2   1 
ATOM   121  O "O5'" . DT  A 1 7  ? 1.774   8.591  7.826   1.00 51.06  ? 7   DT  D "O5'" 1 
ATOM   122  C "C5'" . DT  A 1 7  ? 0.663   8.473  6.957   1.00 49.97  ? 7   DT  D "C5'" 1 
ATOM   123  C "C4'" . DT  A 1 7  ? 0.043   9.823  6.716   1.00 48.22  ? 7   DT  D "C4'" 1 
ATOM   124  O "O4'" . DT  A 1 7  ? -0.671  10.257 7.896   1.00 46.15  ? 7   DT  D "O4'" 1 
ATOM   125  C "C3'" . DT  A 1 7  ? 1.046   10.930 6.388   1.00 48.00  ? 7   DT  D "C3'" 1 
ATOM   126  O "O3'" . DT  A 1 7  ? 0.476   11.761 5.394   1.00 48.32  ? 7   DT  D "O3'" 1 
ATOM   127  C "C2'" . DT  A 1 7  ? 1.093   11.737 7.674   1.00 46.55  ? 7   DT  D "C2'" 1 
ATOM   128  C "C1'" . DT  A 1 7  ? -0.351  11.611 8.116   1.00 45.71  ? 7   DT  D "C1'" 1 
ATOM   129  N N1    . DT  A 1 7  ? -0.625  11.942 9.520   1.00 42.30  ? 7   DT  D N1    1 
ATOM   130  C C2    . DT  A 1 7  ? -1.827  12.533 9.817   1.00 40.59  ? 7   DT  D C2    1 
ATOM   131  O O2    . DT  A 1 7  ? -2.658  12.819 8.974   1.00 41.02  ? 7   DT  D O2    1 
ATOM   132  N N3    . DT  A 1 7  ? -2.012  12.818 11.144  1.00 40.25  ? 7   DT  D N3    1 
ATOM   133  C C4    . DT  A 1 7  ? -1.112  12.614 12.172  1.00 41.47  ? 7   DT  D C4    1 
ATOM   134  O O4    . DT  A 1 7  ? -1.399  12.961 13.315  1.00 40.31  ? 7   DT  D O4    1 
ATOM   135  C C5    . DT  A 1 7  ? 0.130   12.002 11.790  1.00 42.75  ? 7   DT  D C5    1 
ATOM   136  C C7    . DT  A 1 7  ? 1.165   11.752 12.842  1.00 43.87  ? 7   DT  D C7    1 
ATOM   137  C C6    . DT  A 1 7  ? 0.307   11.686 10.500  1.00 43.71  ? 7   DT  D C6    1 
ATOM   138  P P     . DG  A 1 8  ? 1.319   12.139 4.089   1.00 47.92  ? 8   DG  D P     1 
ATOM   139  O OP1   . DG  A 1 8  ? 1.018   11.073 3.094   1.00 49.07  ? 8   DG  D OP1   1 
ATOM   140  O OP2   . DG  A 1 8  ? 2.731   12.388 4.478   1.00 47.36  ? 8   DG  D OP2   1 
ATOM   141  O "O5'" . DG  A 1 8  ? 0.577   13.465 3.623   1.00 46.97  ? 8   DG  D "O5'" 1 
ATOM   142  C "C5'" . DG  A 1 8  ? -0.792  13.395 3.218   1.00 40.63  ? 8   DG  D "C5'" 1 
ATOM   143  C "C4'" . DG  A 1 8  ? -1.552  14.626 3.642   1.00 38.35  ? 8   DG  D "C4'" 1 
ATOM   144  O "O4'" . DG  A 1 8  ? -1.828  14.644 5.070   1.00 37.48  ? 8   DG  D "O4'" 1 
ATOM   145  C "C3'" . DG  A 1 8  ? -0.895  15.967 3.304   1.00 38.74  ? 8   DG  D "C3'" 1 
ATOM   146  O "O3'" . DG  A 1 8  ? -1.927  16.788 2.774   1.00 35.57  ? 8   DG  D "O3'" 1 
ATOM   147  C "C2'" . DG  A 1 8  ? -0.351  16.427 4.648   1.00 36.86  ? 8   DG  D "C2'" 1 
ATOM   148  C "C1'" . DG  A 1 8  ? -1.413  15.891 5.616   1.00 36.46  ? 8   DG  D "C1'" 1 
ATOM   149  N N9    . DG  A 1 8  ? -0.946  15.657 6.982   1.00 35.43  ? 8   DG  D N9    1 
ATOM   150  C C8    . DG  A 1 8  ? 0.216   15.042 7.379   1.00 36.04  ? 8   DG  D C8    1 
ATOM   151  N N7    . DG  A 1 8  ? 0.366   15.020 8.681   1.00 36.42  ? 8   DG  D N7    1 
ATOM   152  C C5    . DG  A 1 8  ? -0.763  15.661 9.170   1.00 34.37  ? 8   DG  D C5    1 
ATOM   153  C C6    . DG  A 1 8  ? -1.139  15.976 10.507  1.00 33.15  ? 8   DG  D C6    1 
ATOM   154  O O6    . DG  A 1 8  ? -0.527  15.743 11.567  1.00 34.88  ? 8   DG  D O6    1 
ATOM   155  N N1    . DG  A 1 8  ? -2.350  16.646 10.546  1.00 31.92  ? 8   DG  D N1    1 
ATOM   156  C C2    . DG  A 1 8  ? -3.099  16.980 9.443   1.00 35.79  ? 8   DG  D C2    1 
ATOM   157  N N2    . DG  A 1 8  ? -4.223  17.661 9.667   1.00 34.84  ? 8   DG  D N2    1 
ATOM   158  N N3    . DG  A 1 8  ? -2.761  16.682 8.194   1.00 35.15  ? 8   DG  D N3    1 
ATOM   159  C C4    . DG  A 1 8  ? -1.592  16.040 8.135   1.00 33.84  ? 8   DG  D C4    1 
ATOM   160  P P     . DA  A 1 9  ? -1.790  18.369 2.760   1.00 37.50  ? 9   DA  D P     1 
ATOM   161  O OP1   . DA  A 1 9  ? -2.738  18.846 1.746   1.00 38.35  ? 9   DA  D OP1   1 
ATOM   162  O OP2   . DA  A 1 9  ? -0.360  18.738 2.661   1.00 39.16  ? 9   DA  D OP2   1 
ATOM   163  O "O5'" . DA  A 1 9  ? -2.370  18.831 4.167   1.00 37.49  ? 9   DA  D "O5'" 1 
ATOM   164  C "C5'" . DA  A 1 9  ? -3.757  18.720 4.403   1.00 37.77  ? 9   DA  D "C5'" 1 
ATOM   165  C "C4'" . DA  A 1 9  ? -4.207  19.779 5.374   1.00 37.37  ? 9   DA  D "C4'" 1 
ATOM   166  O "O4'" . DA  A 1 9  ? -3.619  19.495 6.663   1.00 35.70  ? 9   DA  D "O4'" 1 
ATOM   167  C "C3'" . DA  A 1 9  ? -3.839  21.222 5.022   1.00 37.07  ? 9   DA  D "C3'" 1 
ATOM   168  O "O3'" . DA  A 1 9  ? -5.015  22.018 5.258   1.00 35.92  ? 9   DA  D "O3'" 1 
ATOM   169  C "C2'" . DA  A 1 9  ? -2.659  21.529 5.943   1.00 35.71  ? 9   DA  D "C2'" 1 
ATOM   170  C "C1'" . DA  A 1 9  ? -2.901  20.624 7.145   1.00 34.85  ? 9   DA  D "C1'" 1 
ATOM   171  N N9    . DA  A 1 9  ? -1.720  20.092 7.826   1.00 31.31  ? 9   DA  D N9    1 
ATOM   172  C C8    . DA  A 1 9  ? -0.639  19.473 7.269   1.00 32.86  ? 9   DA  D C8    1 
ATOM   173  N N7    . DA  A 1 9  ? 0.226   19.021 8.149   1.00 32.36  ? 9   DA  D N7    1 
ATOM   174  C C5    . DA  A 1 9  ? -0.317  19.383 9.361   1.00 29.78  ? 9   DA  D C5    1 
ATOM   175  C C6    . DA  A 1 9  ? 0.118   19.181 10.672  1.00 30.86  ? 9   DA  D C6    1 
ATOM   176  N N6    . DA  A 1 9  ? 1.242   18.533 10.977  1.00 29.73  ? 9   DA  D N6    1 
ATOM   177  N N1    . DA  A 1 9  ? -0.648  19.666 11.667  1.00 31.75  ? 9   DA  D N1    1 
ATOM   178  C C2    . DA  A 1 9  ? -1.796  20.284 11.350  1.00 32.14  ? 9   DA  D C2    1 
ATOM   179  N N3    . DA  A 1 9  ? -2.319  20.525 10.143  1.00 31.04  ? 9   DA  D N3    1 
ATOM   180  C C4    . DA  A 1 9  ? -1.512  20.054 9.183   1.00 31.77  ? 9   DA  D C4    1 
ATOM   181  P P     . DT  A 1 10 ? -4.952  23.611 5.235   1.00 38.46  ? 10  DT  D P     1 
ATOM   182  O OP1   . DT  A 1 10 ? -6.305  24.078 4.871   1.00 40.30  ? 10  DT  D OP1   1 
ATOM   183  O OP2   . DT  A 1 10 ? -3.773  24.098 4.453   1.00 36.18  ? 10  DT  D OP2   1 
ATOM   184  O "O5'" . DT  A 1 10 ? -4.743  23.983 6.764   1.00 35.25  ? 10  DT  D "O5'" 1 
ATOM   185  C "C5'" . DT  A 1 10 ? -5.649  23.507 7.755   1.00 35.08  ? 10  DT  D "C5'" 1 
ATOM   186  C "C4'" . DT  A 1 10 ? -5.296  24.089 9.103   1.00 32.55  ? 10  DT  D "C4'" 1 
ATOM   187  O "O4'" . DT  A 1 10 ? -4.100  23.448 9.591   1.00 34.07  ? 10  DT  D "O4'" 1 
ATOM   188  C "C3'" . DT  A 1 10 ? -5.014  25.592 9.103   1.00 33.42  ? 10  DT  D "C3'" 1 
ATOM   189  O "O3'" . DT  A 1 10 ? -5.894  26.240 10.023  1.00 40.45  ? 10  DT  D "O3'" 1 
ATOM   190  C "C2'" . DT  A 1 10 ? -3.555  25.713 9.544   1.00 33.56  ? 10  DT  D "C2'" 1 
ATOM   191  C "C1'" . DT  A 1 10 ? -3.289  24.405 10.267  1.00 31.95  ? 10  DT  D "C1'" 1 
ATOM   192  N N1    . DT  A 1 10 ? -1.896  23.900 10.214  1.00 30.81  ? 10  DT  D N1    1 
ATOM   193  C C2    . DT  A 1 10 ? -1.226  23.670 11.392  1.00 28.09  ? 10  DT  D C2    1 
ATOM   194  O O2    . DT  A 1 10 ? -1.683  23.925 12.494  1.00 28.56  ? 10  DT  D O2    1 
ATOM   195  N N3    . DT  A 1 10 ? 0.002   23.134 11.240  1.00 29.50  ? 10  DT  D N3    1 
ATOM   196  C C4    . DT  A 1 10 ? 0.633   22.803 10.061  1.00 27.84  ? 10  DT  D C4    1 
ATOM   197  O O4    . DT  A 1 10 ? 1.701   22.236 10.093  1.00 29.79  ? 10  DT  D O4    1 
ATOM   198  C C5    . DT  A 1 10 ? -0.082  23.132 8.868   1.00 29.07  ? 10  DT  D C5    1 
ATOM   199  C C7    . DT  A 1 10 ? 0.573   22.900 7.542   1.00 27.94  ? 10  DT  D C7    1 
ATOM   200  C C6    . DT  A 1 10 ? -1.300  23.646 8.995   1.00 27.99  ? 10  DT  D C6    1 
ATOM   201  P P     . DT  A 1 11 ? -5.773  27.822 10.270  1.00 42.11  ? 11  DT  D P     1 
ATOM   202  O OP1   . DT  A 1 11 ? -7.151  28.286 10.486  1.00 46.61  ? 11  DT  D OP1   1 
ATOM   203  O OP2   . DT  A 1 11 ? -4.914  28.483 9.245   1.00 45.55  ? 11  DT  D OP2   1 
ATOM   204  O "O5'" . DT  A 1 11 ? -4.997  27.881 11.656  1.00 39.48  ? 11  DT  D "O5'" 1 
ATOM   205  C "C5'" . DT  A 1 11 ? -5.335  26.956 12.686  1.00 39.38  ? 11  DT  D "C5'" 1 
ATOM   206  C "C4'" . DT  A 1 11 ? -4.358  27.057 13.835  1.00 35.94  ? 11  DT  D "C4'" 1 
ATOM   207  O "O4'" . DT  A 1 11 ? -3.081  26.459 13.500  1.00 36.25  ? 11  DT  D "O4'" 1 
ATOM   208  C "C3'" . DT  A 1 11 ? -4.053  28.443 14.385  1.00 34.96  ? 11  DT  D "C3'" 1 
ATOM   209  O "O3'" . DT  A 1 11 ? -4.190  28.359 15.805  1.00 32.63  ? 11  DT  D "O3'" 1 
ATOM   210  C "C2'" . DT  A 1 11 ? -2.603  28.687 13.984  1.00 33.43  ? 11  DT  D "C2'" 1 
ATOM   211  C "C1'" . DT  A 1 11 ? -2.024  27.280 13.958  1.00 34.44  ? 11  DT  D "C1'" 1 
ATOM   212  N N1    . DT  A 1 11 ? -0.874  27.039 13.039  1.00 33.44  ? 11  DT  D N1    1 
ATOM   213  C C2    . DT  A 1 11 ? 0.301   26.550 13.571  1.00 31.11  ? 11  DT  D C2    1 
ATOM   214  O O2    . DT  A 1 11 ? 0.488   26.451 14.791  1.00 31.46  ? 11  DT  D O2    1 
ATOM   215  N N3    . DT  A 1 11 ? 1.261   26.203 12.622  1.00 29.37  ? 11  DT  D N3    1 
ATOM   216  C C4    . DT  A 1 11 ? 1.144   26.345 11.234  1.00 29.79  ? 11  DT  D C4    1 
ATOM   217  O O4    . DT  A 1 11 ? 2.020   25.921 10.489  1.00 28.95  ? 11  DT  D O4    1 
ATOM   218  C C5    . DT  A 1 11 ? -0.078  26.965 10.779  1.00 31.99  ? 11  DT  D C5    1 
ATOM   219  C C7    . DT  A 1 11 ? -0.247  27.261 9.321   1.00 31.75  ? 11  DT  D C7    1 
ATOM   220  C C6    . DT  A 1 11 ? -1.015  27.257 11.687  1.00 31.27  ? 11  DT  D C6    1 
ATOM   221  P P     . DT  A 1 12 ? -4.089  29.661 16.689  1.00 33.28  ? 12  DT  D P     1 
ATOM   222  O OP1   . DT  A 1 12 ? -4.975  29.386 17.883  1.00 40.21  ? 12  DT  D OP1   1 
ATOM   223  O OP2   . DT  A 1 12 ? -4.174  30.985 16.033  1.00 33.09  ? 12  DT  D OP2   1 
ATOM   224  O "O5'" . DT  A 1 12 ? -2.592  29.534 17.240  1.00 31.93  ? 12  DT  D "O5'" 1 
ATOM   225  C "C5'" . DT  A 1 12 ? -1.873  30.669 17.685  1.00 29.48  ? 12  DT  D "C5'" 1 
ATOM   226  C "C4'" . DT  A 1 12 ? -0.587  30.224 18.340  1.00 30.76  ? 12  DT  D "C4'" 1 
ATOM   227  O "O4'" . DT  A 1 12 ? 0.194   29.465 17.382  1.00 28.56  ? 12  DT  D "O4'" 1 
ATOM   228  C "C3'" . DT  A 1 12 ? 0.301   31.368 18.808  1.00 30.96  ? 12  DT  D "C3'" 1 
ATOM   229  O "O3'" . DT  A 1 12 ? 0.969   30.942 19.986  1.00 33.22  ? 12  DT  D "O3'" 1 
ATOM   230  C "C2'" . DT  A 1 12 ? 1.275   31.540 17.651  1.00 27.91  ? 12  DT  D "C2'" 1 
ATOM   231  C "C1'" . DT  A 1 12 ? 1.433   30.117 17.153  1.00 27.76  ? 12  DT  D "C1'" 1 
ATOM   232  N N1    . DT  A 1 12 ? 1.741   29.945 15.716  1.00 27.51  ? 12  DT  D N1    1 
ATOM   233  C C2    . DT  A 1 12 ? 2.881   29.262 15.390  1.00 27.23  ? 12  DT  D C2    1 
ATOM   234  O O2    . DT  A 1 12 ? 3.670   28.859 16.223  1.00 28.85  ? 12  DT  D O2    1 
ATOM   235  N N3    . DT  A 1 12 ? 3.068   29.057 14.039  1.00 26.48  ? 12  DT  D N3    1 
ATOM   236  C C4    . DT  A 1 12 ? 2.240   29.472 13.023  1.00 28.17  ? 12  DT  D C4    1 
ATOM   237  O O4    . DT  A 1 12 ? 2.504   29.175 11.876  1.00 30.54  ? 12  DT  D O4    1 
ATOM   238  C C5    . DT  A 1 12 ? 1.082   30.228 13.433  1.00 28.26  ? 12  DT  D C5    1 
ATOM   239  C C7    . DT  A 1 12 ? 0.157   30.766 12.382  1.00 29.09  ? 12  DT  D C7    1 
ATOM   240  C C6    . DT  A 1 12 ? 0.889   30.424 14.744  1.00 26.23  ? 12  DT  D C6    1 
ATOM   241  P P     . DA  A 1 13 ? 1.666   32.009 20.923  1.00 33.60  ? 13  DA  D P     1 
ATOM   242  O OP1   . DA  A 1 13 ? 1.860   31.343 22.267  1.00 32.79  ? 13  DA  D OP1   1 
ATOM   243  O OP2   . DA  A 1 13 ? 1.049   33.336 20.843  1.00 33.07  ? 13  DA  D OP2   1 
ATOM   244  O "O5'" . DA  A 1 13 ? 3.139   32.169 20.311  1.00 34.60  ? 13  DA  D "O5'" 1 
ATOM   245  C "C5'" . DA  A 1 13 ? 4.048   31.075 20.340  1.00 34.00  ? 13  DA  D "C5'" 1 
ATOM   246  C "C4'" . DA  A 1 13 ? 5.341   31.440 19.643  1.00 32.83  ? 13  DA  D "C4'" 1 
ATOM   247  O "O4'" . DA  A 1 13 ? 5.218   31.219 18.220  1.00 31.62  ? 13  DA  D "O4'" 1 
ATOM   248  C "C3'" . DA  A 1 13 ? 5.816   32.885 19.827  1.00 31.48  ? 13  DA  D "C3'" 1 
ATOM   249  O "O3'" . DA  A 1 13 ? 7.134   32.846 20.348  1.00 33.08  ? 13  DA  D "O3'" 1 
ATOM   250  C "C2'" . DA  A 1 13 ? 5.789   33.463 18.415  1.00 30.57  ? 13  DA  D "C2'" 1 
ATOM   251  C "C1'" . DA  A 1 13 ? 5.937   32.234 17.534  1.00 30.82  ? 13  DA  D "C1'" 1 
ATOM   252  N N9    . DA  A 1 13 ? 5.360   32.338 16.190  1.00 29.14  ? 13  DA  D N9    1 
ATOM   253  C C8    . DA  A 1 13 ? 4.207   32.963 15.788  1.00 28.39  ? 13  DA  D C8    1 
ATOM   254  N N7    . DA  A 1 13 ? 3.948   32.822 14.493  1.00 26.99  ? 13  DA  D N7    1 
ATOM   255  C C5    . DA  A 1 13 ? 5.013   32.072 14.022  1.00 26.37  ? 13  DA  D C5    1 
ATOM   256  C C6    . DA  A 1 13 ? 5.349   31.605 12.746  1.00 24.98  ? 13  DA  D C6    1 
ATOM   257  N N6    . DA  A 1 13 ? 4.605   31.839 11.643  1.00 25.79  ? 13  DA  D N6    1 
ATOM   258  N N1    . DA  A 1 13 ? 6.484   30.877 12.624  1.00 25.82  ? 13  DA  D N1    1 
ATOM   259  C C2    . DA  A 1 13 ? 7.237   30.655 13.720  1.00 26.45  ? 13  DA  D C2    1 
ATOM   260  N N3    . DA  A 1 13 ? 7.035   31.059 14.962  1.00 25.10  ? 13  DA  D N3    1 
ATOM   261  C C4    . DA  A 1 13 ? 5.895   31.767 15.054  1.00 25.64  ? 13  DA  D C4    1 
ATOM   262  P P     . DC  A 1 14 ? 7.845   34.174 20.898  1.00 34.89  ? 14  DC  D P     1 
ATOM   263  O OP1   . DC  A 1 14 ? 8.690   33.625 22.007  1.00 35.51  ? 14  DC  D OP1   1 
ATOM   264  O OP2   . DC  A 1 14 ? 7.022   35.359 21.105  1.00 37.25  ? 14  DC  D OP2   1 
ATOM   265  O "O5'" . DC  A 1 14 ? 8.896   34.566 19.784  1.00 40.35  ? 14  DC  D "O5'" 1 
ATOM   266  C "C5'" . DC  A 1 14 ? 8.732   34.066 18.510  1.00 45.38  ? 14  DC  D "C5'" 1 
ATOM   267  C "C4'" . DC  A 1 14 ? 9.997   33.404 18.054  1.00 44.47  ? 14  DC  D "C4'" 1 
ATOM   268  O "O4'" . DC  A 1 14 ? 9.567   32.883 16.790  1.00 41.21  ? 14  DC  D "O4'" 1 
ATOM   269  C "C3'" . DC  A 1 14 ? 11.092  34.430 17.768  1.00 44.80  ? 14  DC  D "C3'" 1 
ATOM   270  O "O3'" . DC  A 1 14 ? 12.412  33.903 17.931  1.00 49.46  ? 14  DC  D "O3'" 1 
ATOM   271  C "C2'" . DC  A 1 14 ? 10.798  34.862 16.349  1.00 40.79  ? 14  DC  D "C2'" 1 
ATOM   272  C "C1'" . DC  A 1 14 ? 10.096  33.660 15.749  1.00 39.45  ? 14  DC  D "C1'" 1 
ATOM   273  N N1    . DC  A 1 14 ? 8.998   33.989 14.847  1.00 31.58  ? 14  DC  D N1    1 
ATOM   274  C C2    . DC  A 1 14 ? 9.059   33.438 13.611  1.00 29.77  ? 14  DC  D C2    1 
ATOM   275  O O2    . DC  A 1 14 ? 9.967   32.631 13.405  1.00 29.75  ? 14  DC  D O2    1 
ATOM   276  N N3    . DC  A 1 14 ? 8.133   33.773 12.674  1.00 26.59  ? 14  DC  D N3    1 
ATOM   277  C C4    . DC  A 1 14 ? 7.162   34.602 12.980  1.00 23.07  ? 14  DC  D C4    1 
ATOM   278  N N4    . DC  A 1 14 ? 6.277   34.905 12.023  1.00 23.58  ? 14  DC  D N4    1 
ATOM   279  C C5    . DC  A 1 14 ? 7.038   35.165 14.287  1.00 27.12  ? 14  DC  D C5    1 
ATOM   280  C C6    . DC  A 1 14 ? 7.975   34.828 15.187  1.00 30.03  ? 14  DC  D C6    1 
ATOM   281  P P     . DG  A 1 15 ? 13.689  34.913 17.934  1.00 50.88  ? 15  DG  D P     1 
ATOM   282  O OP1   . DG  A 1 15 ? 14.567  34.453 19.030  1.00 50.94  ? 15  DG  D OP1   1 
ATOM   283  O OP2   . DG  A 1 15 ? 13.275  36.348 17.878  1.00 49.01  ? 15  DG  D OP2   1 
ATOM   284  O "O5'" . DG  A 1 15 ? 14.402  34.621 16.534  1.00 46.01  ? 15  DG  D "O5'" 1 
ATOM   285  C "C5'" . DG  A 1 15 ? 14.911  33.338 16.215  1.00 40.83  ? 15  DG  D "C5'" 1 
ATOM   286  C "C4'" . DG  A 1 15 ? 15.515  33.372 14.829  1.00 39.82  ? 15  DG  D "C4'" 1 
ATOM   287  O "O4'" . DG  A 1 15 ? 14.443  33.541 13.871  1.00 35.11  ? 15  DG  D "O4'" 1 
ATOM   288  C "C3'" . DG  A 1 15 ? 16.502  34.518 14.564  1.00 39.33  ? 15  DG  D "C3'" 1 
ATOM   289  O "O3'" . DG  A 1 15 ? 17.535  34.025 13.695  1.00 41.93  ? 15  DG  D "O3'" 1 
ATOM   290  C "C2'" . DG  A 1 15 ? 15.643  35.571 13.882  1.00 37.93  ? 15  DG  D "C2'" 1 
ATOM   291  C "C1'" . DG  A 1 15 ? 14.632  34.717 13.110  1.00 34.72  ? 15  DG  D "C1'" 1 
ATOM   292  N N9    . DG  A 1 15 ? 13.318  35.315 12.892  1.00 32.31  ? 15  DG  D N9    1 
ATOM   293  C C8    . DG  A 1 15 ? 12.557  36.022 13.800  1.00 31.16  ? 15  DG  D C8    1 
ATOM   294  N N7    . DG  A 1 15 ? 11.393  36.381 13.323  1.00 28.57  ? 15  DG  D N7    1 
ATOM   295  C C5    . DG  A 1 15 ? 11.389  35.889 12.025  1.00 30.85  ? 15  DG  D C5    1 
ATOM   296  C C6    . DG  A 1 15 ? 10.389  35.964 11.034  1.00 28.93  ? 15  DG  D C6    1 
ATOM   297  O O6    . DG  A 1 15 ? 9.290   36.503 11.111  1.00 29.32  ? 15  DG  D O6    1 
ATOM   298  N N1    . DG  A 1 15 ? 10.789  35.341 9.854   1.00 30.02  ? 15  DG  D N1    1 
ATOM   299  C C2    . DG  A 1 15 ? 12.004  34.739 9.651   1.00 29.81  ? 15  DG  D C2    1 
ATOM   300  N N2    . DG  A 1 15 ? 12.205  34.202 8.435   1.00 29.68  ? 15  DG  D N2    1 
ATOM   301  N N3    . DG  A 1 15 ? 12.958  34.663 10.580  1.00 30.35  ? 15  DG  D N3    1 
ATOM   302  C C4    . DG  A 1 15 ? 12.576  35.252 11.734  1.00 30.45  ? 15  DG  D C4    1 
ATOM   303  P P     . DA  A 1 16 ? 18.791  34.960 13.300  1.00 43.62  ? 16  DA  D P     1 
ATOM   304  O OP1   . DA  A 1 16 ? 19.879  33.964 13.196  1.00 43.07  ? 16  DA  D OP1   1 
ATOM   305  O OP2   . DA  A 1 16 ? 18.940  36.138 14.181  1.00 43.76  ? 16  DA  D OP2   1 
ATOM   306  O "O5'" . DA  A 1 16 ? 18.389  35.482 11.849  1.00 40.78  ? 16  DA  D "O5'" 1 
ATOM   307  C "C5'" . DA  A 1 16 ? 18.174  34.550 10.793  1.00 39.24  ? 16  DA  D "C5'" 1 
ATOM   308  C "C4'" . DA  A 1 16 ? 17.832  35.284 9.518   1.00 39.22  ? 16  DA  D "C4'" 1 
ATOM   309  O "O4'" . DA  A 1 16 ? 16.444  35.699 9.532   1.00 36.23  ? 16  DA  D "O4'" 1 
ATOM   310  C "C3'" . DA  A 1 16 ? 18.660  36.552 9.291   1.00 38.75  ? 16  DA  D "C3'" 1 
ATOM   311  O "O3'" . DA  A 1 16 ? 18.948  36.673 7.906   1.00 43.62  ? 16  DA  D "O3'" 1 
ATOM   312  C "C2'" . DA  A 1 16 ? 17.707  37.663 9.697   1.00 38.69  ? 16  DA  D "C2'" 1 
ATOM   313  C "C1'" . DA  A 1 16 ? 16.363  37.083 9.270   1.00 35.99  ? 16  DA  D "C1'" 1 
ATOM   314  N N9    . DA  A 1 16 ? 15.190  37.622 9.962   1.00 34.86  ? 16  DA  D N9    1 
ATOM   315  C C8    . DA  A 1 16 ? 15.076  38.042 11.270  1.00 34.79  ? 16  DA  D C8    1 
ATOM   316  N N7    . DA  A 1 16 ? 13.892  38.529 11.565  1.00 33.76  ? 16  DA  D N7    1 
ATOM   317  C C5    . DA  A 1 16 ? 13.174  38.402 10.384  1.00 33.14  ? 16  DA  D C5    1 
ATOM   318  C C6    . DA  A 1 16 ? 11.856  38.745 10.040  1.00 32.64  ? 16  DA  D C6    1 
ATOM   319  N N6    . DA  A 1 16 ? 10.997  39.345 10.881  1.00 31.35  ? 16  DA  D N6    1 
ATOM   320  N N1    . DA  A 1 16 ? 11.443  38.472 8.785   1.00 32.03  ? 16  DA  D N1    1 
ATOM   321  C C2    . DA  A 1 16 ? 12.312  37.902 7.928   1.00 31.66  ? 16  DA  D C2    1 
ATOM   322  N N3    . DA  A 1 16 ? 13.584  37.550 8.132   1.00 30.95  ? 16  DA  D N3    1 
ATOM   323  C C4    . DA  A 1 16 ? 13.957  37.837 9.392   1.00 34.08  ? 16  DA  D C4    1 
ATOM   324  P P     . DC  A 1 17 ? 20.225  37.515 7.414   1.00 44.16  ? 17  DC  D P     1 
ATOM   325  O OP1   . DC  A 1 17 ? 20.931  36.539 6.563   1.00 45.82  ? 17  DC  D OP1   1 
ATOM   326  O OP2   . DC  A 1 17 ? 20.928  38.154 8.549   1.00 43.40  ? 17  DC  D OP2   1 
ATOM   327  O "O5'" . DC  A 1 17 ? 19.569  38.681 6.554   1.00 43.82  ? 17  DC  D "O5'" 1 
ATOM   328  C "C5'" . DC  A 1 17 ? 18.762  38.351 5.450   1.00 44.94  ? 17  DC  D "C5'" 1 
ATOM   329  C "C4'" . DC  A 1 17 ? 17.646  39.353 5.264   1.00 43.38  ? 17  DC  D "C4'" 1 
ATOM   330  O "O4'" . DC  A 1 17 ? 16.582  39.196 6.250   1.00 41.12  ? 17  DC  D "O4'" 1 
ATOM   331  C "C3'" . DC  A 1 17 ? 18.017  40.844 5.247   1.00 43.94  ? 17  DC  D "C3'" 1 
ATOM   332  O "O3'" . DC  A 1 17 ? 17.783  41.437 3.974   1.00 40.15  ? 17  DC  D "O3'" 1 
ATOM   333  C "C2'" . DC  A 1 17 ? 16.993  41.468 6.163   1.00 42.51  ? 17  DC  D "C2'" 1 
ATOM   334  C "C1'" . DC  A 1 17 ? 15.877  40.421 6.223   1.00 42.03  ? 17  DC  D "C1'" 1 
ATOM   335  N N1    . DC  A 1 17 ? 15.160  40.627 7.492   1.00 38.18  ? 17  DC  D N1    1 
ATOM   336  C C2    . DC  A 1 17 ? 13.759  40.852 7.486   1.00 36.47  ? 17  DC  D C2    1 
ATOM   337  O O2    . DC  A 1 17 ? 13.086  40.601 6.459   1.00 37.69  ? 17  DC  D O2    1 
ATOM   338  N N3    . DC  A 1 17 ? 13.174  41.318 8.609   1.00 34.80  ? 17  DC  D N3    1 
ATOM   339  C C4    . DC  A 1 17 ? 13.900  41.493 9.717   1.00 35.06  ? 17  DC  D C4    1 
ATOM   340  N N4    . DC  A 1 17 ? 13.280  41.978 10.793  1.00 32.45  ? 17  DC  D N4    1 
ATOM   341  C C5    . DC  A 1 17 ? 15.294  41.170 9.774   1.00 32.80  ? 17  DC  D C5    1 
ATOM   342  C C6    . DC  A 1 17 ? 15.869  40.727 8.657   1.00 36.25  ? 17  DC  D C6    1 
ATOM   343  P P     . DG  A 1 18 ? 18.103  42.998 3.728   1.00 42.44  ? 18  DG  D P     1 
ATOM   344  O OP1   . DG  A 1 18 ? 18.865  42.988 2.436   1.00 43.68  ? 18  DG  D OP1   1 
ATOM   345  O OP2   . DG  A 1 18 ? 18.661  43.755 4.898   1.00 39.63  ? 18  DG  D OP2   1 
ATOM   346  O "O5'" . DG  A 1 18 ? 16.666  43.579 3.444   1.00 41.58  ? 18  DG  D "O5'" 1 
ATOM   347  C "C5'" . DG  A 1 18 ? 15.845  42.966 2.465   1.00 44.72  ? 18  DG  D "C5'" 1 
ATOM   348  C "C4'" . DG  A 1 18 ? 14.607  43.794 2.260   1.00 44.18  ? 18  DG  D "C4'" 1 
ATOM   349  O "O4'" . DG  A 1 18 ? 13.709  43.516 3.366   1.00 44.27  ? 18  DG  D "O4'" 1 
ATOM   350  C "C3'" . DG  A 1 18 ? 14.956  45.278 2.329   1.00 45.79  ? 18  DG  D "C3'" 1 
ATOM   351  O "O3'" . DG  A 1 18 ? 14.613  46.046 1.189   1.00 47.41  ? 18  DG  D "O3'" 1 
ATOM   352  C "C2'" . DG  A 1 18 ? 14.192  45.820 3.516   1.00 45.17  ? 18  DG  D "C2'" 1 
ATOM   353  C "C1'" . DG  A 1 18 ? 13.218  44.730 3.931   1.00 43.58  ? 18  DG  D "C1'" 1 
ATOM   354  N N9    . DG  A 1 18 ? 13.362  44.653 5.376   1.00 41.68  ? 18  DG  D N9    1 
ATOM   355  C C8    . DG  A 1 18 ? 14.447  44.167 6.055   1.00 41.21  ? 18  DG  D C8    1 
ATOM   356  N N7    . DG  A 1 18 ? 14.373  44.361 7.342   1.00 40.56  ? 18  DG  D N7    1 
ATOM   357  C C5    . DG  A 1 18 ? 13.142  44.982 7.530   1.00 39.17  ? 18  DG  D C5    1 
ATOM   358  C C6    . DG  A 1 18 ? 12.512  45.424 8.721   1.00 37.65  ? 18  DG  D C6    1 
ATOM   359  O O6    . DG  A 1 18 ? 12.941  45.375 9.882   1.00 37.59  ? 18  DG  D O6    1 
ATOM   360  N N1    . DG  A 1 18 ? 11.270  45.976 8.465   1.00 34.59  ? 18  DG  D N1    1 
ATOM   361  C C2    . DG  A 1 18 ? 10.710  46.098 7.223   1.00 37.96  ? 18  DG  D C2    1 
ATOM   362  N N2    . DG  A 1 18 ? 9.508   46.673 7.174   1.00 39.69  ? 18  DG  D N2    1 
ATOM   363  N N3    . DG  A 1 18 ? 11.289  45.687 6.101   1.00 38.04  ? 18  DG  D N3    1 
ATOM   364  C C4    . DG  A 1 18 ? 12.493  45.146 6.331   1.00 39.95  ? 18  DG  D C4    1 
ATOM   365  P P     . DC  A 1 19 ? 15.228  47.523 1.060   1.00 50.97  ? 19  DC  D P     1 
ATOM   366  O OP1   . DC  A 1 19 ? 15.281  47.817 -0.406  1.00 51.20  ? 19  DC  D OP1   1 
ATOM   367  O OP2   . DC  A 1 19 ? 16.453  47.597 1.871   1.00 48.57  ? 19  DC  D OP2   1 
ATOM   368  O "O5'" . DC  A 1 19 ? 14.126  48.440 1.763   1.00 48.30  ? 19  DC  D "O5'" 1 
ATOM   369  C "C5'" . DC  A 1 19 ? 12.742  48.261 1.477   1.00 51.07  ? 19  DC  D "C5'" 1 
ATOM   370  C "C4'" . DC  A 1 19 ? 11.915  49.181 2.342   1.00 52.18  ? 19  DC  D "C4'" 1 
ATOM   371  O "O4'" . DC  A 1 19 ? 11.853  48.661 3.696   1.00 48.65  ? 19  DC  D "O4'" 1 
ATOM   372  C "C3'" . DC  A 1 19 ? 12.532  50.578 2.439   1.00 53.54  ? 19  DC  D "C3'" 1 
ATOM   373  O "O3'" . DC  A 1 19 ? 11.597  51.626 2.234   1.00 59.57  ? 19  DC  D "O3'" 1 
ATOM   374  C "C2'" . DC  A 1 19 ? 13.051  50.666 3.857   1.00 51.84  ? 19  DC  D "C2'" 1 
ATOM   375  C "C1'" . DC  A 1 19 ? 12.152  49.703 4.614   1.00 48.66  ? 19  DC  D "C1'" 1 
ATOM   376  N N1    . DC  A 1 19 ? 12.870  49.135 5.761   1.00 44.11  ? 19  DC  D N1    1 
ATOM   377  C C2    . DC  A 1 19 ? 12.340  49.303 7.036   1.00 41.83  ? 19  DC  D C2    1 
ATOM   378  O O2    . DC  A 1 19 ? 11.222  49.811 7.153   1.00 42.34  ? 19  DC  D O2    1 
ATOM   379  N N3    . DC  A 1 19 ? 13.052  48.908 8.106   1.00 39.63  ? 19  DC  D N3    1 
ATOM   380  C C4    . DC  A 1 19 ? 14.237  48.333 7.937   1.00 39.65  ? 19  DC  D C4    1 
ATOM   381  N N4    . DC  A 1 19 ? 14.926  47.991 9.017   1.00 39.57  ? 19  DC  D N4    1 
ATOM   382  C C5    . DC  A 1 19 ? 14.781  48.089 6.637   1.00 42.38  ? 19  DC  D C5    1 
ATOM   383  C C6    . DC  A 1 19 ? 14.065  48.500 5.588   1.00 42.30  ? 19  DC  D C6    1 
ATOM   384  P P     . DT  A 1 20 ? 12.145  53.131 2.103   1.00 63.16  ? 20  DT  D P     1 
ATOM   385  O OP1   . DT  A 1 20 ? 11.711  53.631 0.766   1.00 63.09  ? 20  DT  D OP1   1 
ATOM   386  O OP2   . DT  A 1 20 ? 13.590  53.115 2.452   1.00 61.72  ? 20  DT  D OP2   1 
ATOM   387  O "O5'" . DT  A 1 20 ? 11.396  53.923 3.266   1.00 63.73  ? 20  DT  D "O5'" 1 
ATOM   388  C "C5'" . DT  A 1 20 ? 10.022  53.697 3.551   1.00 65.29  ? 20  DT  D "C5'" 1 
ATOM   389  C "C4'" . DT  A 1 20 ? 9.693   54.203 4.937   1.00 66.33  ? 20  DT  D "C4'" 1 
ATOM   390  O "O4'" . DT  A 1 20 ? 10.362  53.384 5.931   1.00 66.12  ? 20  DT  D "O4'" 1 
ATOM   391  C "C3'" . DT  A 1 20 ? 10.146  55.641 5.214   1.00 66.63  ? 20  DT  D "C3'" 1 
ATOM   392  O "O3'" . DT  A 1 20 ? 9.256   56.242 6.169   1.00 68.32  ? 20  DT  D "O3'" 1 
ATOM   393  C "C2'" . DT  A 1 20 ? 11.466  55.446 5.937   1.00 65.91  ? 20  DT  D "C2'" 1 
ATOM   394  C "C1'" . DT  A 1 20 ? 11.163  54.208 6.766   1.00 65.26  ? 20  DT  D "C1'" 1 
ATOM   395  N N1    . DT  A 1 20 ? 12.338  53.424 7.220   1.00 63.89  ? 20  DT  D N1    1 
ATOM   396  C C2    . DT  A 1 20 ? 12.423  53.116 8.566   1.00 63.80  ? 20  DT  D C2    1 
ATOM   397  O O2    . DT  A 1 20 ? 11.578  53.442 9.380   1.00 63.54  ? 20  DT  D O2    1 
ATOM   398  N N3    . DT  A 1 20 ? 13.539  52.402 8.923   1.00 62.93  ? 20  DT  D N3    1 
ATOM   399  C C4    . DT  A 1 20 ? 14.545  51.963 8.094   1.00 62.58  ? 20  DT  D C4    1 
ATOM   400  O O4    . DT  A 1 20 ? 15.483  51.332 8.563   1.00 63.74  ? 20  DT  D O4    1 
ATOM   401  C C5    . DT  A 1 20 ? 14.391  52.307 6.696   1.00 62.78  ? 20  DT  D C5    1 
ATOM   402  C C7    . DT  A 1 20 ? 15.433  51.861 5.724   1.00 62.71  ? 20  DT  D C7    1 
ATOM   403  C C6    . DT  A 1 20 ? 13.311  53.015 6.334   1.00 63.47  ? 20  DT  D C6    1 
ATOM   404  O "O5'" . DT  B 2 1  ? 20.378  51.057 16.759  1.00 85.13  ? 21  DT  E "O5'" 1 
ATOM   405  C "C5'" . DT  B 2 1  ? 20.547  51.640 18.062  1.00 84.18  ? 21  DT  E "C5'" 1 
ATOM   406  C "C4'" . DT  B 2 1  ? 19.259  52.270 18.538  1.00 83.14  ? 21  DT  E "C4'" 1 
ATOM   407  O "O4'" . DT  B 2 1  ? 18.796  53.171 17.509  1.00 82.27  ? 21  DT  E "O4'" 1 
ATOM   408  C "C3'" . DT  B 2 1  ? 18.124  51.270 18.751  1.00 82.86  ? 21  DT  E "C3'" 1 
ATOM   409  O "O3'" . DT  B 2 1  ? 17.250  51.722 19.792  1.00 83.05  ? 21  DT  E "O3'" 1 
ATOM   410  C "C2'" . DT  B 2 1  ? 17.417  51.265 17.411  1.00 82.06  ? 21  DT  E "C2'" 1 
ATOM   411  C "C1'" . DT  B 2 1  ? 17.588  52.696 16.937  1.00 80.66  ? 21  DT  E "C1'" 1 
ATOM   412  N N1    . DT  B 2 1  ? 17.708  52.829 15.478  1.00 78.52  ? 21  DT  E N1    1 
ATOM   413  C C2    . DT  B 2 1  ? 16.788  53.611 14.838  1.00 77.40  ? 21  DT  E C2    1 
ATOM   414  O O2    . DT  B 2 1  ? 15.876  54.174 15.422  1.00 77.73  ? 21  DT  E O2    1 
ATOM   415  N N3    . DT  B 2 1  ? 16.964  53.709 13.485  1.00 76.20  ? 21  DT  E N3    1 
ATOM   416  C C4    . DT  B 2 1  ? 17.938  53.105 12.722  1.00 75.96  ? 21  DT  E C4    1 
ATOM   417  O O4    . DT  B 2 1  ? 17.960  53.285 11.509  1.00 75.02  ? 21  DT  E O4    1 
ATOM   418  C C5    . DT  B 2 1  ? 18.869  52.284 13.456  1.00 76.84  ? 21  DT  E C5    1 
ATOM   419  C C7    . DT  B 2 1  ? 19.955  51.575 12.711  1.00 76.95  ? 21  DT  E C7    1 
ATOM   420  C C6    . DT  B 2 1  ? 18.712  52.190 14.784  1.00 77.51  ? 21  DT  E C6    1 
ATOM   421  P P     . DA  B 2 2  ? 16.100  50.742 20.353  1.00 83.92  ? 22  DA  E P     1 
ATOM   422  O OP1   . DA  B 2 2  ? 15.918  51.024 21.802  1.00 83.87  ? 22  DA  E OP1   1 
ATOM   423  O OP2   . DA  B 2 2  ? 16.381  49.349 19.902  1.00 83.61  ? 22  DA  E OP2   1 
ATOM   424  O "O5'" . DA  B 2 2  ? 14.787  51.254 19.617  1.00 80.54  ? 22  DA  E "O5'" 1 
ATOM   425  C "C5'" . DA  B 2 2  ? 14.280  52.557 19.867  1.00 75.51  ? 22  DA  E "C5'" 1 
ATOM   426  C "C4'" . DA  B 2 2  ? 12.938  52.717 19.198  1.00 72.31  ? 22  DA  E "C4'" 1 
ATOM   427  O "O4'" . DA  B 2 2  ? 13.096  52.812 17.763  1.00 69.88  ? 22  DA  E "O4'" 1 
ATOM   428  C "C3'" . DA  B 2 2  ? 12.015  51.528 19.436  1.00 70.92  ? 22  DA  E "C3'" 1 
ATOM   429  O "O3'" . DA  B 2 2  ? 10.677  51.992 19.580  1.00 69.18  ? 22  DA  E "O3'" 1 
ATOM   430  C "C2'" . DA  B 2 2  ? 12.199  50.680 18.188  1.00 68.80  ? 22  DA  E "C2'" 1 
ATOM   431  C "C1'" . DA  B 2 2  ? 12.442  51.726 17.113  1.00 67.25  ? 22  DA  E "C1'" 1 
ATOM   432  N N9    . DA  B 2 2  ? 13.309  51.305 16.011  1.00 63.67  ? 22  DA  E N9    1 
ATOM   433  C C8    . DA  B 2 2  ? 14.482  50.596 16.083  1.00 62.37  ? 22  DA  E C8    1 
ATOM   434  N N7    . DA  B 2 2  ? 15.084  50.448 14.925  1.00 60.37  ? 22  DA  E N7    1 
ATOM   435  C C5    . DA  B 2 2  ? 14.243  51.086 14.026  1.00 59.17  ? 22  DA  E C5    1 
ATOM   436  C C6    . DA  B 2 2  ? 14.320  51.291 12.634  1.00 57.35  ? 22  DA  E C6    1 
ATOM   437  N N6    . DA  B 2 2  ? 15.333  50.871 11.876  1.00 56.02  ? 22  DA  E N6    1 
ATOM   438  N N1    . DA  B 2 2  ? 13.308  51.957 12.041  1.00 56.27  ? 22  DA  E N1    1 
ATOM   439  C C2    . DA  B 2 2  ? 12.294  52.387 12.798  1.00 58.29  ? 22  DA  E C2    1 
ATOM   440  N N3    . DA  B 2 2  ? 12.109  52.263 14.116  1.00 59.64  ? 22  DA  E N3    1 
ATOM   441  C C4    . DA  B 2 2  ? 13.132  51.597 14.677  1.00 60.86  ? 22  DA  E C4    1 
ATOM   442  P P     . DG  B 2 3  ? 9.502   50.930 19.764  1.00 70.42  ? 23  DG  E P     1 
ATOM   443  O OP1   . DG  B 2 3  ? 8.326   51.621 20.381  1.00 70.68  ? 23  DG  E OP1   1 
ATOM   444  O OP2   . DG  B 2 3  ? 10.083  49.722 20.408  1.00 69.67  ? 23  DG  E OP2   1 
ATOM   445  O "O5'" . DG  B 2 3  ? 9.144   50.568 18.266  1.00 67.30  ? 23  DG  E "O5'" 1 
ATOM   446  C "C5'" . DG  B 2 3  ? 8.571   51.543 17.419  1.00 63.29  ? 23  DG  E "C5'" 1 
ATOM   447  C "C4'" . DG  B 2 3  ? 8.082   50.869 16.167  1.00 59.93  ? 23  DG  E "C4'" 1 
ATOM   448  O "O4'" . DG  B 2 3  ? 9.189   50.649 15.262  1.00 57.19  ? 23  DG  E "O4'" 1 
ATOM   449  C "C3'" . DG  B 2 3  ? 7.510   49.486 16.477  1.00 58.62  ? 23  DG  E "C3'" 1 
ATOM   450  O "O3'" . DG  B 2 3  ? 6.383   49.269 15.651  1.00 59.60  ? 23  DG  E "O3'" 1 
ATOM   451  C "C2'" . DG  B 2 3  ? 8.629   48.543 16.065  1.00 57.51  ? 23  DG  E "C2'" 1 
ATOM   452  C "C1'" . DG  B 2 3  ? 9.159   49.296 14.863  1.00 53.13  ? 23  DG  E "C1'" 1 
ATOM   453  N N9    . DG  B 2 3  ? 10.476  48.927 14.362  1.00 48.17  ? 23  DG  E N9    1 
ATOM   454  C C8    . DG  B 2 3  ? 11.518  48.340 15.039  1.00 44.59  ? 23  DG  E C8    1 
ATOM   455  N N7    . DG  B 2 3  ? 12.541  48.083 14.271  1.00 44.33  ? 23  DG  E N7    1 
ATOM   456  C C5    . DG  B 2 3  ? 12.151  48.544 13.014  1.00 44.90  ? 23  DG  E C5    1 
ATOM   457  C C6    . DG  B 2 3  ? 12.832  48.523 11.760  1.00 41.89  ? 23  DG  E C6    1 
ATOM   458  O O6    . DG  B 2 3  ? 13.931  48.079 11.502  1.00 42.50  ? 23  DG  E O6    1 
ATOM   459  N N1    . DG  B 2 3  ? 12.072  49.094 10.750  1.00 42.80  ? 23  DG  E N1    1 
ATOM   460  C C2    . DG  B 2 3  ? 10.823  49.618 10.906  1.00 44.10  ? 23  DG  E C2    1 
ATOM   461  N N2    . DG  B 2 3  ? 10.263  50.137 9.800   1.00 43.65  ? 23  DG  E N2    1 
ATOM   462  N N3    . DG  B 2 3  ? 10.169  49.637 12.060  1.00 44.06  ? 23  DG  E N3    1 
ATOM   463  C C4    . DG  B 2 3  ? 10.891  49.083 13.062  1.00 44.36  ? 23  DG  E C4    1 
ATOM   464  P P     . DC  B 2 4  ? 5.147   48.419 16.205  1.00 61.29  ? 24  DC  E P     1 
ATOM   465  O OP1   . DC  B 2 4  ? 4.230   49.393 16.861  1.00 61.19  ? 24  DC  E OP1   1 
ATOM   466  O OP2   . DC  B 2 4  ? 5.648   47.232 16.969  1.00 59.19  ? 24  DC  E OP2   1 
ATOM   467  O "O5'" . DC  B 2 4  ? 4.475   47.928 14.853  1.00 58.09  ? 24  DC  E "O5'" 1 
ATOM   468  C "C5'" . DC  B 2 4  ? 4.098   48.884 13.882  1.00 54.09  ? 24  DC  E "C5'" 1 
ATOM   469  C "C4'" . DC  B 2 4  ? 4.428   48.382 12.500  1.00 48.56  ? 24  DC  E "C4'" 1 
ATOM   470  O "O4'" . DC  B 2 4  ? 5.862   48.407 12.279  1.00 47.80  ? 24  DC  E "O4'" 1 
ATOM   471  C "C3'" . DC  B 2 4  ? 3.964   46.946 12.233  1.00 46.16  ? 24  DC  E "C3'" 1 
ATOM   472  O "O3'" . DC  B 2 4  ? 3.198   46.903 11.036  1.00 42.53  ? 24  DC  E "O3'" 1 
ATOM   473  C "C2'" . DC  B 2 4  ? 5.256   46.172 12.066  1.00 44.65  ? 24  DC  E "C2'" 1 
ATOM   474  C "C1'" . DC  B 2 4  ? 6.204   47.242 11.547  1.00 44.71  ? 24  DC  E "C1'" 1 
ATOM   475  N N1    . DC  B 2 4  ? 7.618   46.905 11.786  1.00 41.77  ? 24  DC  E N1    1 
ATOM   476  C C2    . DC  B 2 4  ? 8.536   46.971 10.698  1.00 39.97  ? 24  DC  E C2    1 
ATOM   477  O O2    . DC  B 2 4  ? 8.175   47.505 9.630   1.00 36.35  ? 24  DC  E O2    1 
ATOM   478  N N3    . DC  B 2 4  ? 9.776   46.464 10.859  1.00 34.72  ? 24  DC  E N3    1 
ATOM   479  C C4    . DC  B 2 4  ? 10.140  45.951 12.033  1.00 37.62  ? 24  DC  E C4    1 
ATOM   480  N N4    . DC  B 2 4  ? 11.363  45.420 12.139  1.00 34.46  ? 24  DC  E N4    1 
ATOM   481  C C5    . DC  B 2 4  ? 9.262   45.957 13.168  1.00 38.35  ? 24  DC  E C5    1 
ATOM   482  C C6    . DC  B 2 4  ? 8.031   46.455 13.003  1.00 38.48  ? 24  DC  E C6    1 
ATOM   483  P P     . DG  B 2 5  ? 2.477   45.544 10.602  1.00 38.58  ? 25  DG  E P     1 
ATOM   484  O OP1   . DG  B 2 5  ? 1.105   45.870 10.175  1.00 37.03  ? 25  DG  E OP1   1 
ATOM   485  O OP2   . DG  B 2 5  ? 2.717   44.461 11.575  1.00 39.84  ? 25  DG  E OP2   1 
ATOM   486  O "O5'" . DG  B 2 5  ? 3.255   45.161 9.263   1.00 38.48  ? 25  DG  E "O5'" 1 
ATOM   487  C "C5'" . DG  B 2 5  ? 3.114   46.009 8.143   1.00 34.94  ? 25  DG  E "C5'" 1 
ATOM   488  C "C4'" . DG  B 2 5  ? 4.024   45.573 7.024   1.00 34.16  ? 25  DG  E "C4'" 1 
ATOM   489  O "O4'" . DG  B 2 5  ? 5.400   45.856 7.406   1.00 33.48  ? 25  DG  E "O4'" 1 
ATOM   490  C "C3'" . DG  B 2 5  ? 3.952   44.072 6.783   1.00 32.86  ? 25  DG  E "C3'" 1 
ATOM   491  O "O3'" . DG  B 2 5  ? 3.112   43.678 5.711   1.00 34.31  ? 25  DG  E "O3'" 1 
ATOM   492  C "C2'" . DG  B 2 5  ? 5.386   43.647 6.532   1.00 33.90  ? 25  DG  E "C2'" 1 
ATOM   493  C "C1'" . DG  B 2 5  ? 6.251   44.804 6.969   1.00 33.36  ? 25  DG  E "C1'" 1 
ATOM   494  N N9    . DG  B 2 5  ? 7.009   44.334 8.111   1.00 33.14  ? 25  DG  E N9    1 
ATOM   495  C C8    . DG  B 2 5  ? 6.688   44.448 9.450   1.00 32.42  ? 25  DG  E C8    1 
ATOM   496  N N7    . DG  B 2 5  ? 7.579   43.904 10.224  1.00 31.51  ? 25  DG  E N7    1 
ATOM   497  C C5    . DG  B 2 5  ? 8.534   43.400 9.348   1.00 31.96  ? 25  DG  E C5    1 
ATOM   498  C C6    . DG  B 2 5  ? 9.750   42.714 9.598   1.00 32.22  ? 25  DG  E C6    1 
ATOM   499  O O6    . DG  B 2 5  ? 10.245  42.393 10.674  1.00 32.13  ? 25  DG  E O6    1 
ATOM   500  N N1    . DG  B 2 5  ? 10.414  42.395 8.410   1.00 32.20  ? 25  DG  E N1    1 
ATOM   501  C C2    . DG  B 2 5  ? 9.954   42.683 7.146   1.00 33.19  ? 25  DG  E C2    1 
ATOM   502  N N2    . DG  B 2 5  ? 10.693  42.239 6.100   1.00 29.53  ? 25  DG  E N2    1 
ATOM   503  N N3    . DG  B 2 5  ? 8.840   43.334 6.910   1.00 33.58  ? 25  DG  E N3    1 
ATOM   504  C C4    . DG  B 2 5  ? 8.185   43.659 8.047   1.00 32.87  ? 25  DG  E C4    1 
ATOM   505  P P     . DT  B 2 6  ? 2.691   42.137 5.602   1.00 34.91  ? 26  DT  E P     1 
ATOM   506  O OP1   . DT  B 2 6  ? 1.491   42.042 4.775   1.00 32.66  ? 26  DT  E OP1   1 
ATOM   507  O OP2   . DT  B 2 6  ? 2.675   41.557 6.982   1.00 35.73  ? 26  DT  E OP2   1 
ATOM   508  O "O5'" . DT  B 2 6  ? 3.936   41.448 4.897   1.00 31.67  ? 26  DT  E "O5'" 1 
ATOM   509  C "C5'" . DT  B 2 6  ? 4.404   41.955 3.647   1.00 32.93  ? 26  DT  E "C5'" 1 
ATOM   510  C "C4'" . DT  B 2 6  ? 5.603   41.166 3.181   1.00 32.30  ? 26  DT  E "C4'" 1 
ATOM   511  O "O4'" . DT  B 2 6  ? 6.643   41.175 4.198   1.00 29.94  ? 26  DT  E "O4'" 1 
ATOM   512  C "C3'" . DT  B 2 6  ? 5.319   39.701 2.878   1.00 33.01  ? 26  DT  E "C3'" 1 
ATOM   513  O "O3'" . DT  B 2 6  ? 6.052   39.344 1.707   1.00 34.04  ? 26  DT  E "O3'" 1 
ATOM   514  C "C2'" . DT  B 2 6  ? 5.893   38.978 4.080   1.00 28.84  ? 26  DT  E "C2'" 1 
ATOM   515  C "C1'" . DT  B 2 6  ? 7.058   39.857 4.469   1.00 29.59  ? 26  DT  E "C1'" 1 
ATOM   516  N N1    . DT  B 2 6  ? 7.394   39.799 5.906   1.00 28.40  ? 26  DT  E N1    1 
ATOM   517  C C2    . DT  B 2 6  ? 8.634   39.344 6.297   1.00 29.05  ? 26  DT  E C2    1 
ATOM   518  O O2    . DT  B 2 6  ? 9.487   38.911 5.521   1.00 30.86  ? 26  DT  E O2    1 
ATOM   519  N N3    . DT  B 2 6  ? 8.849   39.401 7.655   1.00 28.83  ? 26  DT  E N3    1 
ATOM   520  C C4    . DT  B 2 6  ? 7.962   39.849 8.629   1.00 26.98  ? 26  DT  E C4    1 
ATOM   521  O O4    . DT  B 2 6  ? 8.318   39.883 9.808   1.00 28.78  ? 26  DT  E O4    1 
ATOM   522  C C5    . DT  B 2 6  ? 6.668   40.257 8.153   1.00 29.05  ? 26  DT  E C5    1 
ATOM   523  C C7    . DT  B 2 6  ? 5.626   40.690 9.146   1.00 27.23  ? 26  DT  E C7    1 
ATOM   524  C C6    . DT  B 2 6  ? 6.447   40.220 6.829   1.00 27.84  ? 26  DT  E C6    1 
ATOM   525  P P     . DC  B 2 7  ? 5.727   37.978 0.950   1.00 37.49  ? 27  DC  E P     1 
ATOM   526  O OP1   . DC  B 2 7  ? 6.090   38.294 -0.479  1.00 38.36  ? 27  DC  E OP1   1 
ATOM   527  O OP2   . DC  B 2 7  ? 4.373   37.470 1.264   1.00 38.66  ? 27  DC  E OP2   1 
ATOM   528  O "O5'" . DC  B 2 7  ? 6.811   36.988 1.568   1.00 36.43  ? 27  DC  E "O5'" 1 
ATOM   529  C "C5'" . DC  B 2 7  ? 8.190   37.230 1.343   1.00 38.34  ? 27  DC  E "C5'" 1 
ATOM   530  C "C4'" . DC  B 2 7  ? 9.032   36.121 1.921   1.00 38.79  ? 27  DC  E "C4'" 1 
ATOM   531  O "O4'" . DC  B 2 7  ? 9.221   36.281 3.348   1.00 37.00  ? 27  DC  E "O4'" 1 
ATOM   532  C "C3'" . DC  B 2 7  ? 8.502   34.708 1.705   1.00 38.82  ? 27  DC  E "C3'" 1 
ATOM   533  O "O3'" . DC  B 2 7  ? 9.552   33.928 1.159   1.00 38.67  ? 27  DC  E "O3'" 1 
ATOM   534  C "C2'" . DC  B 2 7  ? 8.116   34.238 3.106   1.00 35.74  ? 27  DC  E "C2'" 1 
ATOM   535  C "C1'" . DC  B 2 7  ? 9.039   35.055 4.020   1.00 33.37  ? 27  DC  E "C1'" 1 
ATOM   536  N N1    . DC  B 2 7  ? 8.544   35.391 5.384   1.00 31.91  ? 27  DC  E N1    1 
ATOM   537  C C2    . DC  B 2 7  ? 9.396   35.225 6.483   1.00 30.52  ? 27  DC  E C2    1 
ATOM   538  O O2    . DC  B 2 7  ? 10.528  34.750 6.317   1.00 31.63  ? 27  DC  E O2    1 
ATOM   539  N N3    . DC  B 2 7  ? 8.967   35.589 7.719   1.00 29.38  ? 27  DC  E N3    1 
ATOM   540  C C4    . DC  B 2 7  ? 7.754   36.121 7.880   1.00 29.02  ? 27  DC  E C4    1 
ATOM   541  N N4    . DC  B 2 7  ? 7.404   36.525 9.127   1.00 24.76  ? 27  DC  E N4    1 
ATOM   542  C C5    . DC  B 2 7  ? 6.853   36.279 6.787   1.00 30.02  ? 27  DC  E C5    1 
ATOM   543  C C6    . DC  B 2 7  ? 7.281   35.898 5.568   1.00 30.45  ? 27  DC  E C6    1 
ATOM   544  P P     . DG  B 2 8  ? 9.244   32.445 0.645   1.00 41.45  ? 28  DG  E P     1 
ATOM   545  O OP1   . DG  B 2 8  ? 10.183  32.218 -0.496  1.00 43.24  ? 28  DG  E OP1   1 
ATOM   546  O OP2   . DG  B 2 8  ? 7.790   32.215 0.465   1.00 41.11  ? 28  DG  E OP2   1 
ATOM   547  O "O5'" . DG  B 2 8  ? 9.739   31.564 1.862   1.00 37.94  ? 28  DG  E "O5'" 1 
ATOM   548  C "C5'" . DG  B 2 8  ? 11.060  31.701 2.354   1.00 36.82  ? 28  DG  E "C5'" 1 
ATOM   549  C "C4'" . DG  B 2 8  ? 11.221  30.926 3.641   1.00 34.08  ? 28  DG  E "C4'" 1 
ATOM   550  O "O4'" . DG  B 2 8  ? 10.593  31.643 4.738   1.00 32.12  ? 28  DG  E "O4'" 1 
ATOM   551  C "C3'" . DG  B 2 8  ? 10.633  29.507 3.648   1.00 33.04  ? 28  DG  E "C3'" 1 
ATOM   552  O "O3'" . DG  B 2 8  ? 11.654  28.607 4.022   1.00 34.79  ? 28  DG  E "O3'" 1 
ATOM   553  C "C2'" . DG  B 2 8  ? 9.562   29.564 4.733   1.00 33.78  ? 28  DG  E "C2'" 1 
ATOM   554  C "C1'" . DG  B 2 8  ? 10.033  30.697 5.630   1.00 31.50  ? 28  DG  E "C1'" 1 
ATOM   555  N N9    . DG  B 2 8  ? 8.969   31.375 6.365   1.00 28.91  ? 28  DG  E N9    1 
ATOM   556  C C8    . DG  B 2 8  ? 7.757   31.800 5.878   1.00 25.38  ? 28  DG  E C8    1 
ATOM   557  N N7    . DG  B 2 8  ? 7.027   32.410 6.790   1.00 26.95  ? 28  DG  E N7    1 
ATOM   558  C C5    . DG  B 2 8  ? 7.815   32.370 7.931   1.00 24.83  ? 28  DG  E C5    1 
ATOM   559  C C6    . DG  B 2 8  ? 7.559   32.866 9.228   1.00 25.17  ? 28  DG  E C6    1 
ATOM   560  O O6    . DG  B 2 8  ? 6.550   33.453 9.632   1.00 28.43  ? 28  DG  E O6    1 
ATOM   561  N N1    . DG  B 2 8  ? 8.619   32.633 10.085  1.00 25.12  ? 28  DG  E N1    1 
ATOM   562  C C2    . DG  B 2 8  ? 9.778   31.991 9.747   1.00 25.84  ? 28  DG  E C2    1 
ATOM   563  N N2    . DG  B 2 8  ? 10.689  31.870 10.751  1.00 24.82  ? 28  DG  E N2    1 
ATOM   564  N N3    . DG  B 2 8  ? 10.033  31.509 8.528   1.00 24.11  ? 28  DG  E N3    1 
ATOM   565  C C4    . DG  B 2 8  ? 9.012   31.733 7.684   1.00 25.15  ? 28  DG  E C4    1 
ATOM   566  P P     . DT  B 2 9  ? 11.446  27.025 3.890   1.00 36.41  ? 29  DT  E P     1 
ATOM   567  O OP1   . DT  B 2 9  ? 12.746  26.581 3.331   1.00 39.82  ? 29  DT  E OP1   1 
ATOM   568  O OP2   . DT  B 2 9  ? 10.167  26.553 3.249   1.00 35.24  ? 29  DT  E OP2   1 
ATOM   569  O "O5'" . DT  B 2 9  ? 11.380  26.551 5.399   1.00 36.43  ? 29  DT  E "O5'" 1 
ATOM   570  C "C5'" . DT  B 2 9  ? 12.350  27.015 6.299   1.00 37.48  ? 29  DT  E "C5'" 1 
ATOM   571  C "C4'" . DT  B 2 9  ? 11.818  27.032 7.710   1.00 35.00  ? 29  DT  E "C4'" 1 
ATOM   572  O "O4'" . DT  B 2 9  ? 10.759  28.021 7.868   1.00 32.59  ? 29  DT  E "O4'" 1 
ATOM   573  C "C3'" . DT  B 2 9  ? 11.271  25.722 8.264   1.00 33.94  ? 29  DT  E "C3'" 1 
ATOM   574  O "O3'" . DT  B 2 9  ? 12.243  25.143 9.152   1.00 32.19  ? 29  DT  E "O3'" 1 
ATOM   575  C "C2'" . DT  B 2 9  ? 10.003  26.144 8.997   1.00 34.13  ? 29  DT  E "C2'" 1 
ATOM   576  C "C1'" . DT  B 2 9  ? 10.051  27.663 9.033   1.00 32.86  ? 29  DT  E "C1'" 1 
ATOM   577  N N1    . DT  B 2 9  ? 8.724   28.331 9.012   1.00 29.02  ? 29  DT  E N1    1 
ATOM   578  C C2    . DT  B 2 9  ? 8.354   28.940 10.185  1.00 30.06  ? 29  DT  E C2    1 
ATOM   579  O O2    . DT  B 2 9  ? 9.056   28.925 11.191  1.00 30.10  ? 29  DT  E O2    1 
ATOM   580  N N3    . DT  B 2 9  ? 7.132   29.561 10.150  1.00 26.25  ? 29  DT  E N3    1 
ATOM   581  C C4    . DT  B 2 9  ? 6.250   29.623 9.079   1.00 26.71  ? 29  DT  E C4    1 
ATOM   582  O O4    . DT  B 2 9  ? 5.210   30.253 9.184   1.00 29.12  ? 29  DT  E O4    1 
ATOM   583  C C5    . DT  B 2 9  ? 6.680   28.938 7.881   1.00 27.46  ? 29  DT  E C5    1 
ATOM   584  C C7    . DT  B 2 9  ? 5.761   28.928 6.700   1.00 27.93  ? 29  DT  E C7    1 
ATOM   585  C C6    . DT  B 2 9  ? 7.884   28.346 7.896   1.00 28.38  ? 29  DT  E C6    1 
ATOM   586  P P     . DA  B 2 10 ? 11.953  23.755 9.889   1.00 33.52  ? 30  DA  E P     1 
ATOM   587  O OP1   . DA  B 2 10 ? 13.270  23.056 10.000  1.00 33.37  ? 30  DA  E OP1   1 
ATOM   588  O OP2   . DA  B 2 10 ? 10.787  23.009 9.331   1.00 33.82  ? 30  DA  E OP2   1 
ATOM   589  O "O5'" . DA  B 2 10 ? 11.559  24.227 11.364  1.00 33.44  ? 30  DA  E "O5'" 1 
ATOM   590  C "C5'" . DA  B 2 10 ? 12.467  25.032 12.119  1.00 32.11  ? 30  DA  E "C5'" 1 
ATOM   591  C "C4'" . DA  B 2 10 ? 12.004  25.110 13.554  1.00 32.51  ? 30  DA  E "C4'" 1 
ATOM   592  O "O4'" . DA  B 2 10 ? 10.745  25.810 13.597  1.00 30.53  ? 30  DA  E "O4'" 1 
ATOM   593  C "C3'" . DA  B 2 10 ? 11.749  23.747 14.176  1.00 34.70  ? 30  DA  E "C3'" 1 
ATOM   594  O "O3'" . DA  B 2 10 ? 12.152  23.810 15.548  1.00 35.23  ? 30  DA  E "O3'" 1 
ATOM   595  C "C2'" . DA  B 2 10 ? 10.254  23.528 13.944  1.00 31.92  ? 30  DA  E "C2'" 1 
ATOM   596  C "C1'" . DA  B 2 10 ? 9.693   24.947 13.982  1.00 31.87  ? 30  DA  E "C1'" 1 
ATOM   597  N N9    . DA  B 2 10 ? 8.555   25.255 13.108  1.00 30.81  ? 30  DA  E N9    1 
ATOM   598  C C8    . DA  B 2 10 ? 8.283   24.798 11.827  1.00 29.89  ? 30  DA  E C8    1 
ATOM   599  N N7    . DA  B 2 10 ? 7.219   25.355 11.288  1.00 29.51  ? 30  DA  E N7    1 
ATOM   600  C C5    . DA  B 2 10 ? 6.757   26.212 12.288  1.00 29.36  ? 30  DA  E C5    1 
ATOM   601  C C6    . DA  B 2 10 ? 5.666   27.104 12.340  1.00 27.94  ? 30  DA  E C6    1 
ATOM   602  N N6    . DA  B 2 10 ? 4.844   27.322 11.308  1.00 26.76  ? 30  DA  E N6    1 
ATOM   603  N N1    . DA  B 2 10 ? 5.461   27.779 13.486  1.00 28.98  ? 30  DA  E N1    1 
ATOM   604  C C2    . DA  B 2 10 ? 6.299   27.597 14.501  1.00 24.68  ? 30  DA  E C2    1 
ATOM   605  N N3    . DA  B 2 10 ? 7.380   26.815 14.573  1.00 31.74  ? 30  DA  E N3    1 
ATOM   606  C C4    . DA  B 2 10 ? 7.553   26.138 13.413  1.00 29.45  ? 30  DA  E C4    1 
ATOM   607  P P     . DA  B 2 11 ? 12.292  22.470 16.401  1.00 39.66  ? 31  DA  E P     1 
ATOM   608  O OP1   . DA  B 2 11 ? 13.172  22.832 17.563  1.00 41.06  ? 31  DA  E OP1   1 
ATOM   609  O OP2   . DA  B 2 11 ? 12.626  21.307 15.555  1.00 39.85  ? 31  DA  E OP2   1 
ATOM   610  O "O5'" . DA  B 2 11 ? 10.840  22.307 17.001  1.00 40.16  ? 31  DA  E "O5'" 1 
ATOM   611  C "C5'" . DA  B 2 11 ? 10.341  23.334 17.840  1.00 40.18  ? 31  DA  E "C5'" 1 
ATOM   612  C "C4'" . DA  B 2 11 ? 8.867   23.154 18.091  1.00 40.50  ? 31  DA  E "C4'" 1 
ATOM   613  O "O4'" . DA  B 2 11 ? 8.108   23.555 16.925  1.00 40.68  ? 31  DA  E "O4'" 1 
ATOM   614  C "C3'" . DA  B 2 11 ? 8.411   21.747 18.455  1.00 40.13  ? 31  DA  E "C3'" 1 
ATOM   615  O "O3'" . DA  B 2 11 ? 7.848   21.832 19.755  1.00 43.50  ? 31  DA  E "O3'" 1 
ATOM   616  C "C2'" . DA  B 2 11 ? 7.382   21.400 17.380  1.00 41.46  ? 31  DA  E "C2'" 1 
ATOM   617  C "C1'" . DA  B 2 11 ? 6.954   22.762 16.849  1.00 39.49  ? 31  DA  E "C1'" 1 
ATOM   618  N N9    . DA  B 2 11 ? 6.476   22.808 15.462  1.00 37.87  ? 31  DA  E N9    1 
ATOM   619  C C8    . DA  B 2 11 ? 6.900   22.097 14.366  1.00 36.71  ? 31  DA  E C8    1 
ATOM   620  N N7    . DA  B 2 11 ? 6.240   22.381 13.268  1.00 35.14  ? 31  DA  E N7    1 
ATOM   621  C C5    . DA  B 2 11 ? 5.328   23.348 13.670  1.00 34.25  ? 31  DA  E C5    1 
ATOM   622  C C6    . DA  B 2 11 ? 4.337   24.068 12.978  1.00 31.34  ? 31  DA  E C6    1 
ATOM   623  N N6    . DA  B 2 11 ? 4.080   23.917 11.677  1.00 30.76  ? 31  DA  E N6    1 
ATOM   624  N N1    . DA  B 2 11 ? 3.603   24.958 13.682  1.00 31.82  ? 31  DA  E N1    1 
ATOM   625  C C2    . DA  B 2 11 ? 3.852   25.102 14.985  1.00 31.87  ? 31  DA  E C2    1 
ATOM   626  N N3    . DA  B 2 11 ? 4.740   24.494 15.734  1.00 31.73  ? 31  DA  E N3    1 
ATOM   627  C C4    . DA  B 2 11 ? 5.461   23.618 15.014  1.00 33.58  ? 31  DA  E C4    1 
ATOM   628  P P     . DA  B 2 12 ? 7.159   20.550 20.428  1.00 44.56  ? 32  DA  E P     1 
ATOM   629  O OP1   . DA  B 2 12 ? 7.637   20.574 21.839  1.00 46.90  ? 32  DA  E OP1   1 
ATOM   630  O OP2   . DA  B 2 12 ? 7.335   19.322 19.624  1.00 45.71  ? 32  DA  E OP2   1 
ATOM   631  O "O5'" . DA  B 2 12 ? 5.631   20.981 20.383  1.00 45.25  ? 32  DA  E "O5'" 1 
ATOM   632  C "C5'" . DA  B 2 12 ? 5.247   22.279 20.824  1.00 43.13  ? 32  DA  E "C5'" 1 
ATOM   633  C "C4'" . DA  B 2 12 ? 3.793   22.529 20.510  1.00 41.20  ? 32  DA  E "C4'" 1 
ATOM   634  O "O4'" . DA  B 2 12 ? 3.625   22.673 19.074  1.00 39.78  ? 32  DA  E "O4'" 1 
ATOM   635  C "C3'" . DA  B 2 12 ? 2.834   21.411 20.952  1.00 40.77  ? 32  DA  E "C3'" 1 
ATOM   636  O "O3'" . DA  B 2 12 ? 1.694   22.012 21.556  1.00 42.69  ? 32  DA  E "O3'" 1 
ATOM   637  C "C2'" . DA  B 2 12 ? 2.466   20.708 19.651  1.00 40.17  ? 32  DA  E "C2'" 1 
ATOM   638  C "C1'" . DA  B 2 12 ? 2.574   21.841 18.626  1.00 37.55  ? 32  DA  E "C1'" 1 
ATOM   639  N N9    . DA  B 2 12 ? 2.874   21.441 17.249  1.00 36.83  ? 32  DA  E N9    1 
ATOM   640  C C8    . DA  B 2 12 ? 3.796   20.529 16.786  1.00 33.74  ? 32  DA  E C8    1 
ATOM   641  N N7    . DA  B 2 12 ? 3.801   20.400 15.482  1.00 36.18  ? 32  DA  E N7    1 
ATOM   642  C C5    . DA  B 2 12 ? 2.816   21.285 15.055  1.00 35.44  ? 32  DA  E C5    1 
ATOM   643  C C6    . DA  B 2 12 ? 2.300   21.600 13.778  1.00 34.14  ? 32  DA  E C6    1 
ATOM   644  N N6    . DA  B 2 12 ? 2.742   21.058 12.643  1.00 33.42  ? 32  DA  E N6    1 
ATOM   645  N N1    . DA  B 2 12 ? 1.296   22.511 13.710  1.00 33.13  ? 32  DA  E N1    1 
ATOM   646  C C2    . DA  B 2 12 ? 0.878   23.082 14.848  1.00 34.97  ? 32  DA  E C2    1 
ATOM   647  N N3    . DA  B 2 12 ? 1.279   22.871 16.098  1.00 35.32  ? 32  DA  E N3    1 
ATOM   648  C C4    . DA  B 2 12 ? 2.247   21.940 16.135  1.00 35.12  ? 32  DA  E C4    1 
ATOM   649  P P     . DT  B 2 13 ? 0.516   21.089 22.160  1.00 42.17  ? 33  DT  E P     1 
ATOM   650  O OP1   . DT  B 2 13 ? 0.007   21.855 23.327  1.00 42.56  ? 33  DT  E OP1   1 
ATOM   651  O OP2   . DT  B 2 13 ? 1.001   19.697 22.314  1.00 41.74  ? 33  DT  E OP2   1 
ATOM   652  O "O5'" . DT  B 2 13 ? -0.574  21.101 21.009  1.00 41.35  ? 33  DT  E "O5'" 1 
ATOM   653  C "C5'" . DT  B 2 13 ? -1.101  22.336 20.561  1.00 37.84  ? 33  DT  E "C5'" 1 
ATOM   654  C "C4'" . DT  B 2 13 ? -2.032  22.108 19.401  1.00 40.46  ? 33  DT  E "C4'" 1 
ATOM   655  O "O4'" . DT  B 2 13 ? -1.272  21.731 18.222  1.00 36.61  ? 33  DT  E "O4'" 1 
ATOM   656  C "C3'" . DT  B 2 13 ? -3.058  20.990 19.643  1.00 39.19  ? 33  DT  E "C3'" 1 
ATOM   657  O "O3'" . DT  B 2 13 ? -4.353  21.579 19.614  1.00 43.66  ? 33  DT  E "O3'" 1 
ATOM   658  C "C2'" . DT  B 2 13 ? -2.801  19.992 18.519  1.00 38.86  ? 33  DT  E "C2'" 1 
ATOM   659  C "C1'" . DT  B 2 13 ? -2.043  20.832 17.467  1.00 39.73  ? 33  DT  E "C1'" 1 
ATOM   660  N N1    . DT  B 2 13 ? -1.119  20.085 16.585  1.00 39.11  ? 33  DT  E N1    1 
ATOM   661  C C2    . DT  B 2 13 ? -1.220  20.266 15.228  1.00 39.31  ? 33  DT  E C2    1 
ATOM   662  O O2    . DT  B 2 13 ? -2.024  21.022 14.717  1.00 40.03  ? 33  DT  E O2    1 
ATOM   663  N N3    . DT  B 2 13 ? -0.345  19.528 14.480  1.00 39.84  ? 33  DT  E N3    1 
ATOM   664  C C4    . DT  B 2 13 ? 0.603   18.649 14.943  1.00 41.67  ? 33  DT  E C4    1 
ATOM   665  O O4    . DT  B 2 13 ? 1.317   18.053 14.144  1.00 41.91  ? 33  DT  E O4    1 
ATOM   666  C C5    . DT  B 2 13 ? 0.662   18.513 16.398  1.00 41.15  ? 33  DT  E C5    1 
ATOM   667  C C7    . DT  B 2 13 ? 1.663   17.588 17.012  1.00 41.38  ? 33  DT  E C7    1 
ATOM   668  C C6    . DT  B 2 13 ? -0.190  19.230 17.125  1.00 41.08  ? 33  DT  E C6    1 
ATOM   669  P P     . DC  B 2 14 ? -5.664  20.657 19.630  1.00 43.74  ? 34  DC  E P     1 
ATOM   670  O OP1   . DC  B 2 14 ? -6.654  21.492 20.292  1.00 43.96  ? 34  DC  E OP1   1 
ATOM   671  O OP2   . DC  B 2 14 ? -5.365  19.286 20.123  1.00 42.91  ? 34  DC  E OP2   1 
ATOM   672  O "O5'" . DC  B 2 14 ? -6.050  20.581 18.091  1.00 40.97  ? 34  DC  E "O5'" 1 
ATOM   673  C "C5'" . DC  B 2 14 ? -6.142  21.775 17.346  1.00 38.17  ? 34  DC  E "C5'" 1 
ATOM   674  C "C4'" . DC  B 2 14 ? -6.488  21.465 15.911  1.00 40.18  ? 34  DC  E "C4'" 1 
ATOM   675  O "O4'" . DC  B 2 14 ? -5.380  20.823 15.256  1.00 36.70  ? 34  DC  E "O4'" 1 
ATOM   676  C "C3'" . DC  B 2 14 ? -7.677  20.523 15.758  1.00 39.38  ? 34  DC  E "C3'" 1 
ATOM   677  O "O3'" . DC  B 2 14 ? -8.619  21.097 14.891  1.00 44.64  ? 34  DC  E "O3'" 1 
ATOM   678  C "C2'" . DC  B 2 14 ? -7.101  19.254 15.156  1.00 39.79  ? 34  DC  E "C2'" 1 
ATOM   679  C "C1'" . DC  B 2 14 ? -5.837  19.748 14.452  1.00 37.51  ? 34  DC  E "C1'" 1 
ATOM   680  N N1    . DC  B 2 14 ? -4.755  18.760 14.430  1.00 37.29  ? 34  DC  E N1    1 
ATOM   681  C C2    . DC  B 2 14 ? -4.224  18.341 13.209  1.00 34.93  ? 34  DC  E C2    1 
ATOM   682  O O2    . DC  B 2 14 ? -4.736  18.751 12.160  1.00 39.45  ? 34  DC  E O2    1 
ATOM   683  N N3    . DC  B 2 14 ? -3.175  17.495 13.206  1.00 36.44  ? 34  DC  E N3    1 
ATOM   684  C C4    . DC  B 2 14 ? -2.667  17.062 14.352  1.00 36.84  ? 34  DC  E C4    1 
ATOM   685  N N4    . DC  B 2 14 ? -1.620  16.267 14.305  1.00 34.31  ? 34  DC  E N4    1 
ATOM   686  C C5    . DC  B 2 14 ? -3.221  17.437 15.613  1.00 36.27  ? 34  DC  E C5    1 
ATOM   687  C C6    . DC  B 2 14 ? -4.248  18.277 15.604  1.00 35.04  ? 34  DC  E C6    1 
ATOM   688  P P     . DA  B 2 15 ? -10.084 20.459 14.807  1.00 50.68  ? 35  DA  E P     1 
ATOM   689  O OP1   . DA  B 2 15 ? -10.972 21.592 14.493  1.00 48.92  ? 35  DA  E OP1   1 
ATOM   690  O OP2   . DA  B 2 15 ? -10.334 19.623 16.018  1.00 46.82  ? 35  DA  E OP2   1 
ATOM   691  O "O5'" . DA  B 2 15 ? -9.950  19.511 13.543  1.00 47.94  ? 35  DA  E "O5'" 1 
ATOM   692  C "C5'" . DA  B 2 15 ? -9.523  20.061 12.305  1.00 49.72  ? 35  DA  E "C5'" 1 
ATOM   693  C "C4'" . DA  B 2 15 ? -9.578  19.011 11.226  1.00 48.68  ? 35  DA  E "C4'" 1 
ATOM   694  O "O4'" . DA  B 2 15 ? -8.415  18.168 11.333  1.00 47.28  ? 35  DA  E "O4'" 1 
ATOM   695  C "C3'" . DA  B 2 15 ? -10.796 18.089 11.299  1.00 49.32  ? 35  DA  E "C3'" 1 
ATOM   696  O "O3'" . DA  B 2 15 ? -11.285 17.873 9.978   1.00 50.23  ? 35  DA  E "O3'" 1 
ATOM   697  C "C2'" . DA  B 2 15 ? -10.245 16.808 11.903  1.00 47.02  ? 35  DA  E "C2'" 1 
ATOM   698  C "C1'" . DA  B 2 15 ? -8.790  16.808 11.438  1.00 45.61  ? 35  DA  E "C1'" 1 
ATOM   699  N N9    . DA  B 2 15 ? -7.836  16.185 12.352  1.00 41.75  ? 35  DA  E N9    1 
ATOM   700  C C8    . DA  B 2 15 ? -7.822  16.266 13.727  1.00 41.63  ? 35  DA  E C8    1 
ATOM   701  N N7    . DA  B 2 15 ? -6.782  15.689 14.278  1.00 38.41  ? 35  DA  E N7    1 
ATOM   702  C C5    . DA  B 2 15 ? -6.082  15.166 13.201  1.00 38.01  ? 35  DA  E C5    1 
ATOM   703  C C6    . DA  B 2 15 ? -4.891  14.465 13.120  1.00 36.95  ? 35  DA  E C6    1 
ATOM   704  N N6    . DA  B 2 15 ? -4.175  14.117 14.187  1.00 35.40  ? 35  DA  E N6    1 
ATOM   705  N N1    . DA  B 2 15 ? -4.439  14.120 11.885  1.00 38.78  ? 35  DA  E N1    1 
ATOM   706  C C2    . DA  B 2 15 ? -5.178  14.449 10.821  1.00 37.47  ? 35  DA  E C2    1 
ATOM   707  N N3    . DA  B 2 15 ? -6.329  15.102 10.772  1.00 38.67  ? 35  DA  E N3    1 
ATOM   708  C C4    . DA  B 2 15 ? -6.731  15.446 12.009  1.00 40.38  ? 35  DA  E C4    1 
ATOM   709  P P     . DT  B 2 16 ? -12.702 17.159 9.745   1.00 52.16  ? 36  DT  E P     1 
ATOM   710  O OP1   . DT  B 2 16 ? -13.345 17.907 8.616   1.00 53.76  ? 36  DT  E OP1   1 
ATOM   711  O OP2   . DT  B 2 16 ? -13.456 16.958 11.011  1.00 50.74  ? 36  DT  E OP2   1 
ATOM   712  O "O5'" . DT  B 2 16 ? -12.248 15.740 9.204   1.00 49.16  ? 36  DT  E "O5'" 1 
ATOM   713  C "C5'" . DT  B 2 16 ? -11.234 15.666 8.214   1.00 47.48  ? 36  DT  E "C5'" 1 
ATOM   714  C "C4'" . DT  B 2 16 ? -10.715 14.256 8.109   1.00 46.97  ? 36  DT  E "C4'" 1 
ATOM   715  O "O4'" . DT  B 2 16 ? -9.718  13.976 9.119   1.00 45.41  ? 36  DT  E "O4'" 1 
ATOM   716  C "C3'" . DT  B 2 16 ? -11.795 13.177 8.253   1.00 45.68  ? 36  DT  E "C3'" 1 
ATOM   717  O "O3'" . DT  B 2 16 ? -11.528 12.137 7.313   1.00 45.45  ? 36  DT  E "O3'" 1 
ATOM   718  C "C2'" . DT  B 2 16 ? -11.541 12.634 9.652   1.00 45.40  ? 36  DT  E "C2'" 1 
ATOM   719  C "C1'" . DT  B 2 16 ? -10.026 12.704 9.672   1.00 45.71  ? 36  DT  E "C1'" 1 
ATOM   720  N N1    . DT  B 2 16 ? -9.349  12.577 10.974  1.00 43.81  ? 36  DT  E N1    1 
ATOM   721  C C2    . DT  B 2 16 ? -8.063  12.074 10.968  1.00 43.19  ? 36  DT  E C2    1 
ATOM   722  O O2    . DT  B 2 16 ? -7.483  11.751 9.948   1.00 42.85  ? 36  DT  E O2    1 
ATOM   723  N N3    . DT  B 2 16 ? -7.484  11.966 12.202  1.00 41.79  ? 36  DT  E N3    1 
ATOM   724  C C4    . DT  B 2 16 ? -8.051  12.309 13.417  1.00 44.19  ? 36  DT  E C4    1 
ATOM   725  O O4    . DT  B 2 16 ? -7.411  12.170 14.450  1.00 43.47  ? 36  DT  E O4    1 
ATOM   726  C C5    . DT  B 2 16 ? -9.393  12.827 13.351  1.00 43.18  ? 36  DT  E C5    1 
ATOM   727  C C7    . DT  B 2 16 ? -10.079 13.222 14.621  1.00 45.74  ? 36  DT  E C7    1 
ATOM   728  C C6    . DT  B 2 16 ? -9.973  12.934 12.148  1.00 43.78  ? 36  DT  E C6    1 
ATOM   729  P P     . DA  B 2 17 ? -12.011 12.293 5.792   1.00 45.03  ? 37  DA  E P     1 
ATOM   730  O OP1   . DA  B 2 17 ? -12.443 13.685 5.517   1.00 45.71  ? 37  DA  E OP1   1 
ATOM   731  O OP2   . DA  B 2 17 ? -12.912 11.154 5.452   1.00 48.46  ? 37  DA  E OP2   1 
ATOM   732  O "O5'" . DA  B 2 17 ? -10.649 12.185 5.004   1.00 48.22  ? 37  DA  E "O5'" 1 
ATOM   733  C "C5'" . DA  B 2 17 ? -10.266 10.997 4.462   1.00 47.13  ? 37  DA  E "C5'" 1 
ATOM   734  C "C4'" . DA  B 2 17 ? -8.779  10.819 4.604   1.00 46.67  ? 37  DA  E "C4'" 1 
ATOM   735  O "O4'" . DA  B 2 17 ? -8.391  10.672 6.007   1.00 45.57  ? 37  DA  E "O4'" 1 
ATOM   736  C "C3'" . DA  B 2 17 ? -8.592  9.457  4.001   1.00 46.21  ? 37  DA  E "C3'" 1 
ATOM   737  O "O3'" . DA  B 2 17 ? -7.319  9.315  3.395   1.00 45.24  ? 37  DA  E "O3'" 1 
ATOM   738  C "C2'" . DA  B 2 17 ? -8.894  8.539  5.169   1.00 46.44  ? 37  DA  E "C2'" 1 
ATOM   739  C "C1'" . DA  B 2 17 ? -8.262  9.283  6.325   1.00 47.16  ? 37  DA  E "C1'" 1 
ATOM   740  N N9    . DA  B 2 17 ? -8.897  9.074  7.628   1.00 46.78  ? 37  DA  E N9    1 
ATOM   741  C C8    . DA  B 2 17 ? -10.195 9.347  7.973   1.00 47.00  ? 37  DA  E C8    1 
ATOM   742  N N7    . DA  B 2 17 ? -10.425 9.263  9.263   1.00 46.64  ? 37  DA  E N7    1 
ATOM   743  C C5    . DA  B 2 17 ? -9.210  8.865  9.794   1.00 45.36  ? 37  DA  E C5    1 
ATOM   744  C C6    . DA  B 2 17 ? -8.786  8.650  11.109  1.00 44.66  ? 37  DA  E C6    1 
ATOM   745  N N6    . DA  B 2 17 ? -9.553  8.868  12.178  1.00 46.57  ? 37  DA  E N6    1 
ATOM   746  N N1    . DA  B 2 17 ? -7.524  8.224  11.298  1.00 44.94  ? 37  DA  E N1    1 
ATOM   747  C C2    . DA  B 2 17 ? -6.736  8.061  10.227  1.00 45.13  ? 37  DA  E C2    1 
ATOM   748  N N3    . DA  B 2 17 ? -7.007  8.270  8.943   1.00 44.32  ? 37  DA  E N3    1 
ATOM   749  C C4    . DA  B 2 17 ? -8.276  8.681  8.792   1.00 45.45  ? 37  DA  E C4    1 
ATOM   750  P P     . DG  B 2 18 ? -7.160  8.278  2.201   1.00 45.46  ? 38  DG  E P     1 
ATOM   751  O OP1   . DG  B 2 18 ? -5.950  8.512  1.366   1.00 41.60  ? 38  DG  E OP1   1 
ATOM   752  O OP2   . DG  B 2 18 ? -8.521  8.250  1.571   1.00 44.67  ? 38  DG  E OP2   1 
ATOM   753  O "O5'" . DG  B 2 18 ? -6.955  6.883  2.914   1.00 48.20  ? 38  DG  E "O5'" 1 
ATOM   754  C "C5'" . DG  B 2 18 ? -7.307  6.728  4.259   1.00 52.74  ? 38  DG  E "C5'" 1 
ATOM   755  C "C4'" . DG  B 2 18 ? -6.482  5.656  4.913   1.00 53.43  ? 38  DG  E "C4'" 1 
ATOM   756  O "O4'" . DG  B 2 18 ? -6.794  5.715  6.315   1.00 51.76  ? 38  DG  E "O4'" 1 
ATOM   757  C "C3'" . DG  B 2 18 ? -6.841  4.245  4.462   1.00 55.33  ? 38  DG  E "C3'" 1 
ATOM   758  O "O3'" . DG  B 2 18 ? -5.691  3.441  4.676   1.00 60.18  ? 38  DG  E "O3'" 1 
ATOM   759  C "C2'" . DG  B 2 18 ? -7.969  3.877  5.405   1.00 53.48  ? 38  DG  E "C2'" 1 
ATOM   760  C "C1'" . DG  B 2 18 ? -7.569  4.593  6.689   1.00 51.20  ? 38  DG  E "C1'" 1 
ATOM   761  N N9    . DG  B 2 18 ? -8.679  5.087  7.485   1.00 46.67  ? 38  DG  E N9    1 
ATOM   762  C C8    . DG  B 2 18 ? -9.875  5.584  7.051   1.00 46.91  ? 38  DG  E C8    1 
ATOM   763  N N7    . DG  B 2 18 ? -10.672 5.916  8.031   1.00 47.07  ? 38  DG  E N7    1 
ATOM   764  C C5    . DG  B 2 18 ? -9.945  5.625  9.173   1.00 46.16  ? 38  DG  E C5    1 
ATOM   765  C C6    . DG  B 2 18 ? -10.281 5.765  10.541  1.00 47.14  ? 38  DG  E C6    1 
ATOM   766  O O6    . DG  B 2 18 ? -11.325 6.193  11.039  1.00 48.14  ? 38  DG  E O6    1 
ATOM   767  N N1    . DG  B 2 18 ? -9.243  5.343  11.367  1.00 48.10  ? 38  DG  E N1    1 
ATOM   768  C C2    . DG  B 2 18 ? -8.043  4.852  10.930  1.00 47.93  ? 38  DG  E C2    1 
ATOM   769  N N2    . DG  B 2 18 ? -7.171  4.484  11.868  1.00 49.90  ? 38  DG  E N2    1 
ATOM   770  N N3    . DG  B 2 18 ? -7.719  4.725  9.656   1.00 48.24  ? 38  DG  E N3    1 
ATOM   771  C C4    . DG  B 2 18 ? -8.711  5.124  8.845   1.00 47.22  ? 38  DG  E C4    1 
ATOM   772  P P     . DA  B 2 19 ? -5.606  1.967  4.066   1.00 63.48  ? 39  DA  E P     1 
ATOM   773  O OP1   . DA  B 2 19 ? -4.557  2.007  3.024   1.00 64.44  ? 39  DA  E OP1   1 
ATOM   774  O OP2   . DA  B 2 19 ? -6.974  1.489  3.724   1.00 64.66  ? 39  DA  E OP2   1 
ATOM   775  O "O5'" . DA  B 2 19 ? -5.035  1.138  5.298   1.00 64.26  ? 39  DA  E "O5'" 1 
ATOM   776  C "C5'" . DA  B 2 19 ? -3.955  1.661  6.072   1.00 66.60  ? 39  DA  E "C5'" 1 
ATOM   777  C "C4'" . DA  B 2 19 ? -3.981  1.100  7.474   1.00 67.92  ? 39  DA  E "C4'" 1 
ATOM   778  O "O4'" . DA  B 2 19 ? -5.070  1.680  8.238   1.00 65.68  ? 39  DA  E "O4'" 1 
ATOM   779  C "C3'" . DA  B 2 19 ? -4.175  -0.415 7.523   1.00 69.95  ? 39  DA  E "C3'" 1 
ATOM   780  O "O3'" . DA  B 2 19 ? -3.310  -1.015 8.492   1.00 74.30  ? 39  DA  E "O3'" 1 
ATOM   781  C "C2'" . DA  B 2 19 ? -5.631  -0.575 7.920   1.00 67.58  ? 39  DA  E "C2'" 1 
ATOM   782  C "C1'" . DA  B 2 19 ? -5.871  0.647  8.792   1.00 65.21  ? 39  DA  E "C1'" 1 
ATOM   783  N N9    . DA  B 2 19 ? -7.260  1.098  8.777   1.00 61.79  ? 39  DA  E N9    1 
ATOM   784  C C8    . DA  B 2 19 ? -8.045  1.352  7.683   1.00 60.72  ? 39  DA  E C8    1 
ATOM   785  N N7    . DA  B 2 19 ? -9.257  1.739  7.982   1.00 60.20  ? 39  DA  E N7    1 
ATOM   786  C C5    . DA  B 2 19 ? -9.271  1.746  9.369   1.00 59.59  ? 39  DA  E C5    1 
ATOM   787  C C6    . DA  B 2 19 ? -10.264 2.073  10.300  1.00 59.23  ? 39  DA  E C6    1 
ATOM   788  N N6    . DA  B 2 19 ? -11.489 2.496  9.961   1.00 57.94  ? 39  DA  E N6    1 
ATOM   789  N N1    . DA  B 2 19 ? -9.955  1.959  11.611  1.00 58.80  ? 39  DA  E N1    1 
ATOM   790  C C2    . DA  B 2 19 ? -8.727  1.553  11.948  1.00 58.46  ? 39  DA  E C2    1 
ATOM   791  N N3    . DA  B 2 19 ? -7.708  1.228  11.165  1.00 58.98  ? 39  DA  E N3    1 
ATOM   792  C C4    . DA  B 2 19 ? -8.049  1.347  9.871   1.00 60.49  ? 39  DA  E C4    1 
ATOM   793  P P     . DG  B 2 20 ? -3.050  -2.603 8.437   1.00 77.65  ? 40  DG  E P     1 
ATOM   794  O OP1   . DG  B 2 20 ? -2.324  -2.967 9.682   1.00 77.83  ? 40  DG  E OP1   1 
ATOM   795  O OP2   . DG  B 2 20 ? -2.465  -2.960 7.108   1.00 77.70  ? 40  DG  E OP2   1 
ATOM   796  O "O5'" . DG  B 2 20 ? -4.520  -3.214 8.512   1.00 77.46  ? 40  DG  E "O5'" 1 
ATOM   797  C "C5'" . DG  B 2 20 ? -4.811  -4.326 9.354   1.00 77.41  ? 40  DG  E "C5'" 1 
ATOM   798  C "C4'" . DG  B 2 20 ? -4.901  -3.875 10.793  1.00 76.84  ? 40  DG  E "C4'" 1 
ATOM   799  O "O4'" . DG  B 2 20 ? -5.758  -2.714 10.885  1.00 75.78  ? 40  DG  E "O4'" 1 
ATOM   800  C "C3'" . DG  B 2 20 ? -5.527  -4.912 11.717  1.00 76.84  ? 40  DG  E "C3'" 1 
ATOM   801  O "O3'" . DG  B 2 20 ? -5.168  -4.573 13.057  1.00 77.97  ? 40  DG  E "O3'" 1 
ATOM   802  C "C2'" . DG  B 2 20 ? -7.004  -4.592 11.587  1.00 75.91  ? 40  DG  E "C2'" 1 
ATOM   803  C "C1'" . DG  B 2 20 ? -6.986  -3.071 11.510  1.00 74.20  ? 40  DG  E "C1'" 1 
ATOM   804  N N9    . DG  B 2 20 ? -8.066  -2.517 10.707  1.00 71.47  ? 40  DG  E N9    1 
ATOM   805  C C8    . DG  B 2 20 ? -8.117  -2.420 9.339   1.00 70.70  ? 40  DG  E C8    1 
ATOM   806  N N7    . DG  B 2 20 ? -9.215  -1.867 8.907   1.00 70.07  ? 40  DG  E N7    1 
ATOM   807  C C5    . DG  B 2 20 ? -9.930  -1.585 10.062  1.00 69.01  ? 40  DG  E C5    1 
ATOM   808  C C6    . DG  B 2 20 ? -11.192 -0.974 10.229  1.00 68.28  ? 40  DG  E C6    1 
ATOM   809  O O6    . DG  B 2 20 ? -11.955 -0.530 9.360   1.00 67.34  ? 40  DG  E O6    1 
ATOM   810  N N1    . DG  B 2 20 ? -11.543 -0.889 11.574  1.00 67.91  ? 40  DG  E N1    1 
ATOM   811  C C2    . DG  B 2 20 ? -10.769 -1.331 12.621  1.00 68.03  ? 40  DG  E C2    1 
ATOM   812  N N2    . DG  B 2 20 ? -11.271 -1.158 13.847  1.00 68.24  ? 40  DG  E N2    1 
ATOM   813  N N3    . DG  B 2 20 ? -9.587  -1.896 12.474  1.00 68.51  ? 40  DG  E N3    1 
ATOM   814  C C4    . DG  B 2 20 ? -9.233  -1.988 11.179  1.00 69.65  ? 40  DG  E C4    1 
ATOM   815  N N     . ASN C 3 1  ? 25.806  10.469 15.538  1.00 87.46  ? 193 ASN A N     1 
ATOM   816  C CA    . ASN C 3 1  ? 26.003  11.184 14.244  1.00 86.99  ? 193 ASN A CA    1 
ATOM   817  C C     . ASN C 3 1  ? 25.340  12.564 14.262  1.00 86.09  ? 193 ASN A C     1 
ATOM   818  O O     . ASN C 3 1  ? 25.943  13.558 13.851  1.00 86.39  ? 193 ASN A O     1 
ATOM   819  C CB    . ASN C 3 1  ? 25.434  10.345 13.101  1.00 88.36  ? 193 ASN A CB    1 
ATOM   820  C CG    . ASN C 3 1  ? 25.566  11.031 11.764  1.00 89.40  ? 193 ASN A CG    1 
ATOM   821  O OD1   . ASN C 3 1  ? 26.663  11.425 11.359  1.00 90.36  ? 193 ASN A OD1   1 
ATOM   822  N ND2   . ASN C 3 1  ? 24.445  11.184 11.066  1.00 90.17  ? 193 ASN A ND2   1 
ATOM   823  N N     . ASN C 3 2  ? 24.093  12.612 14.727  1.00 84.29  ? 194 ASN A N     1 
ATOM   824  C CA    . ASN C 3 2  ? 23.344  13.863 14.829  1.00 82.02  ? 194 ASN A CA    1 
ATOM   825  C C     . ASN C 3 2  ? 23.245  14.585 13.476  1.00 79.71  ? 194 ASN A C     1 
ATOM   826  O O     . ASN C 3 2  ? 23.767  15.684 13.308  1.00 79.44  ? 194 ASN A O     1 
ATOM   827  C CB    . ASN C 3 2  ? 24.021  14.754 15.883  1.00 82.64  ? 194 ASN A CB    1 
ATOM   828  C CG    . ASN C 3 2  ? 23.132  15.884 16.358  1.00 83.26  ? 194 ASN A CG    1 
ATOM   829  O OD1   . ASN C 3 2  ? 21.958  15.680 16.658  1.00 84.03  ? 194 ASN A OD1   1 
ATOM   830  N ND2   . ASN C 3 2  ? 23.695  17.082 16.445  1.00 83.64  ? 194 ASN A ND2   1 
ATOM   831  N N     . PRO C 3 3  ? 22.551  13.976 12.498  1.00 77.56  ? 195 PRO A N     1 
ATOM   832  C CA    . PRO C 3 3  ? 22.395  14.568 11.165  1.00 75.46  ? 195 PRO A CA    1 
ATOM   833  C C     . PRO C 3 3  ? 21.499  15.804 11.138  1.00 73.23  ? 195 PRO A C     1 
ATOM   834  O O     . PRO C 3 3  ? 21.525  16.568 10.174  1.00 73.70  ? 195 PRO A O     1 
ATOM   835  C CB    . PRO C 3 3  ? 21.831  13.414 10.345  1.00 75.74  ? 195 PRO A CB    1 
ATOM   836  C CG    . PRO C 3 3  ? 20.940  12.747 11.327  1.00 77.23  ? 195 PRO A CG    1 
ATOM   837  C CD    . PRO C 3 3  ? 21.775  12.726 12.602  1.00 77.67  ? 195 PRO A CD    1 
ATOM   838  N N     . ALA C 3 4  ? 20.715  16.000 12.197  1.00 70.03  ? 196 ALA A N     1 
ATOM   839  C CA    . ALA C 3 4  ? 19.826  17.158 12.301  1.00 66.75  ? 196 ALA A CA    1 
ATOM   840  C C     . ALA C 3 4  ? 20.575  18.384 12.839  1.00 64.56  ? 196 ALA A C     1 
ATOM   841  O O     . ALA C 3 4  ? 20.005  19.474 12.944  1.00 63.61  ? 196 ALA A O     1 
ATOM   842  C CB    . ALA C 3 4  ? 18.644  16.831 13.217  1.00 66.40  ? 196 ALA A CB    1 
ATOM   843  N N     . ALA C 3 5  ? 21.856  18.199 13.153  1.00 61.02  ? 197 ALA A N     1 
ATOM   844  C CA    . ALA C 3 5  ? 22.706  19.252 13.705  1.00 58.76  ? 197 ALA A CA    1 
ATOM   845  C C     . ALA C 3 5  ? 22.660  20.611 13.015  1.00 57.38  ? 197 ALA A C     1 
ATOM   846  O O     . ALA C 3 5  ? 22.496  21.641 13.674  1.00 56.37  ? 197 ALA A O     1 
ATOM   847  C CB    . ALA C 3 5  ? 24.151  18.759 13.761  1.00 59.16  ? 197 ALA A CB    1 
ATOM   848  N N     . ASN C 3 6  ? 22.817  20.626 11.695  1.00 54.95  ? 198 ASN A N     1 
ATOM   849  C CA    . ASN C 3 6  ? 22.802  21.883 10.958  1.00 54.63  ? 198 ASN A CA    1 
ATOM   850  C C     . ASN C 3 6  ? 21.423  22.388 10.531  1.00 52.04  ? 198 ASN A C     1 
ATOM   851  O O     . ASN C 3 6  ? 21.328  23.394 9.825   1.00 51.47  ? 198 ASN A O     1 
ATOM   852  C CB    . ASN C 3 6  ? 23.674  21.776 9.705   1.00 57.25  ? 198 ASN A CB    1 
ATOM   853  C CG    . ASN C 3 6  ? 25.123  21.491 10.025  1.00 60.21  ? 198 ASN A CG    1 
ATOM   854  O OD1   . ASN C 3 6  ? 25.949  21.323 9.119   1.00 61.83  ? 198 ASN A OD1   1 
ATOM   855  N ND2   . ASN C 3 6  ? 25.445  21.431 11.311  1.00 61.16  ? 198 ASN A ND2   1 
ATOM   856  N N     . TRP C 3 7  ? 20.363  21.697 10.935  1.00 49.66  ? 199 TRP A N     1 
ATOM   857  C CA    . TRP C 3 7  ? 19.006  22.108 10.563  1.00 46.60  ? 199 TRP A CA    1 
ATOM   858  C C     . TRP C 3 7  ? 18.551  23.305 11.397  1.00 47.00  ? 199 TRP A C     1 
ATOM   859  O O     . TRP C 3 7  ? 19.186  23.661 12.389  1.00 44.32  ? 199 TRP A O     1 
ATOM   860  C CB    . TRP C 3 7  ? 18.017  20.973 10.792  1.00 44.79  ? 199 TRP A CB    1 
ATOM   861  C CG    . TRP C 3 7  ? 18.229  19.767 9.970   1.00 44.25  ? 199 TRP A CG    1 
ATOM   862  C CD1   . TRP C 3 7  ? 19.310  19.477 9.180   1.00 43.29  ? 199 TRP A CD1   1 
ATOM   863  C CD2   . TRP C 3 7  ? 17.381  18.617 9.936   1.00 44.85  ? 199 TRP A CD2   1 
ATOM   864  N NE1   . TRP C 3 7  ? 19.187  18.209 8.665   1.00 43.70  ? 199 TRP A NE1   1 
ATOM   865  C CE2   . TRP C 3 7  ? 18.012  17.658 9.110   1.00 44.27  ? 199 TRP A CE2   1 
ATOM   866  C CE3   . TRP C 3 7  ? 16.145  18.303 10.525  1.00 43.47  ? 199 TRP A CE3   1 
ATOM   867  C CZ2   . TRP C 3 7  ? 17.452  16.406 8.860   1.00 45.07  ? 199 TRP A CZ2   1 
ATOM   868  C CZ3   . TRP C 3 7  ? 15.588  17.071 10.281  1.00 44.08  ? 199 TRP A CZ3   1 
ATOM   869  C CH2   . TRP C 3 7  ? 16.240  16.128 9.452   1.00 46.48  ? 199 TRP A CH2   1 
ATOM   870  N N     . LEU C 3 8  ? 17.443  23.928 11.004  1.00 46.18  ? 200 LEU A N     1 
ATOM   871  C CA    . LEU C 3 8  ? 16.948  25.064 11.770  1.00 47.38  ? 200 LEU A CA    1 
ATOM   872  C C     . LEU C 3 8  ? 16.360  24.535 13.060  1.00 47.71  ? 200 LEU A C     1 
ATOM   873  O O     . LEU C 3 8  ? 15.608  23.571 13.046  1.00 46.42  ? 200 LEU A O     1 
ATOM   874  C CB    . LEU C 3 8  ? 15.875  25.812 10.990  1.00 47.42  ? 200 LEU A CB    1 
ATOM   875  C CG    . LEU C 3 8  ? 16.381  26.675 9.852   1.00 49.37  ? 200 LEU A CG    1 
ATOM   876  C CD1   . LEU C 3 8  ? 17.255  27.799 10.406  1.00 48.87  ? 200 LEU A CD1   1 
ATOM   877  C CD2   . LEU C 3 8  ? 17.166  25.813 8.906   1.00 50.79  ? 200 LEU A CD2   1 
ATOM   878  N N     . HIS C 3 9  ? 16.722  25.143 14.180  1.00 50.15  ? 201 HIS A N     1 
ATOM   879  C CA    . HIS C 3 9  ? 16.187  24.709 15.460  1.00 54.00  ? 201 HIS A CA    1 
ATOM   880  C C     . HIS C 3 9  ? 15.533  25.872 16.171  1.00 55.65  ? 201 HIS A C     1 
ATOM   881  O O     . HIS C 3 9  ? 15.942  27.028 16.014  1.00 54.74  ? 201 HIS A O     1 
ATOM   882  C CB    . HIS C 3 9  ? 17.295  24.135 16.339  1.00 55.25  ? 201 HIS A CB    1 
ATOM   883  C CG    . HIS C 3 9  ? 17.900  22.886 15.785  1.00 57.75  ? 201 HIS A CG    1 
ATOM   884  N ND1   . HIS C 3 9  ? 17.220  21.687 15.745  1.00 58.55  ? 201 HIS A ND1   1 
ATOM   885  C CD2   . HIS C 3 9  ? 19.104  22.658 15.208  1.00 58.92  ? 201 HIS A CD2   1 
ATOM   886  C CE1   . HIS C 3 9  ? 17.980  20.772 15.168  1.00 59.78  ? 201 HIS A CE1   1 
ATOM   887  N NE2   . HIS C 3 9  ? 19.128  21.335 14.833  1.00 59.68  ? 201 HIS A NE2   1 
ATOM   888  N N     . ALA C 3 10 ? 14.500  25.559 16.937  1.00 57.21  ? 202 ALA A N     1 
ATOM   889  C CA    . ALA C 3 10 ? 13.808  26.577 17.695  1.00 60.67  ? 202 ALA A CA    1 
ATOM   890  C C     . ALA C 3 10 ? 14.730  26.959 18.844  1.00 62.48  ? 202 ALA A C     1 
ATOM   891  O O     . ALA C 3 10 ? 15.362  26.096 19.462  1.00 62.59  ? 202 ALA A O     1 
ATOM   892  C CB    . ALA C 3 10 ? 12.493  26.023 18.230  1.00 61.32  ? 202 ALA A CB    1 
ATOM   893  N N     . ARG C 3 11 ? 14.832  28.253 19.111  1.00 65.54  ? 203 ARG A N     1 
ATOM   894  C CA    . ARG C 3 11 ? 15.669  28.719 20.199  1.00 68.64  ? 203 ARG A CA    1 
ATOM   895  C C     . ARG C 3 11 ? 15.033  28.197 21.486  1.00 69.10  ? 203 ARG A C     1 
ATOM   896  O O     . ARG C 3 11 ? 13.837  28.376 21.717  1.00 68.96  ? 203 ARG A O     1 
ATOM   897  C CB    . ARG C 3 11 ? 15.722  30.248 20.190  1.00 71.21  ? 203 ARG A CB    1 
ATOM   898  C CG    . ARG C 3 11 ? 16.856  30.841 20.989  1.00 73.99  ? 203 ARG A CG    1 
ATOM   899  C CD    . ARG C 3 11 ? 17.132  32.270 20.552  1.00 76.00  ? 203 ARG A CD    1 
ATOM   900  N NE    . ARG C 3 11 ? 17.721  32.332 19.215  1.00 77.94  ? 203 ARG A NE    1 
ATOM   901  C CZ    . ARG C 3 11 ? 18.141  33.453 18.634  1.00 78.68  ? 203 ARG A CZ    1 
ATOM   902  N NH1   . ARG C 3 11 ? 18.666  33.416 17.417  1.00 79.04  ? 203 ARG A NH1   1 
ATOM   903  N NH2   . ARG C 3 11 ? 18.037  34.616 19.268  1.00 79.16  ? 203 ARG A NH2   1 
ATOM   904  N N     . SER C 3 12 ? 15.837  27.530 22.304  1.00 70.34  ? 204 SER A N     1 
ATOM   905  C CA    . SER C 3 12 ? 15.379  26.956 23.564  1.00 71.19  ? 204 SER A CA    1 
ATOM   906  C C     . SER C 3 12 ? 14.647  27.948 24.482  1.00 70.66  ? 204 SER A C     1 
ATOM   907  O O     . SER C 3 12 ? 14.167  27.579 25.555  1.00 70.29  ? 204 SER A O     1 
ATOM   908  C CB    . SER C 3 12 ? 16.573  26.359 24.305  1.00 72.72  ? 204 SER A CB    1 
ATOM   909  O OG    . SER C 3 12 ? 16.166  25.718 25.502  1.00 75.13  ? 204 SER A OG    1 
ATOM   910  N N     . THR C 3 13 ? 14.555  29.202 24.057  1.00 69.72  ? 205 THR A N     1 
ATOM   911  C CA    . THR C 3 13 ? 13.896  30.222 24.855  1.00 68.99  ? 205 THR A CA    1 
ATOM   912  C C     . THR C 3 13 ? 12.646  30.776 24.188  1.00 67.97  ? 205 THR A C     1 
ATOM   913  O O     . THR C 3 13 ? 12.199  31.880 24.516  1.00 68.59  ? 205 THR A O     1 
ATOM   914  C CB    . THR C 3 13 ? 14.852  31.384 25.137  1.00 69.34  ? 205 THR A CB    1 
ATOM   915  O OG1   . THR C 3 13 ? 15.383  31.872 23.897  1.00 69.33  ? 205 THR A OG1   1 
ATOM   916  C CG2   . THR C 3 13 ? 15.997  30.917 26.047  1.00 69.10  ? 205 THR A CG2   1 
ATOM   917  N N     . ARG C 3 14 ? 12.086  30.012 23.255  1.00 65.69  ? 206 ARG A N     1 
ATOM   918  C CA    . ARG C 3 14 ? 10.885  30.426 22.532  1.00 63.42  ? 206 ARG A CA    1 
ATOM   919  C C     . ARG C 3 14 ? 9.640   30.117 23.369  1.00 60.78  ? 206 ARG A C     1 
ATOM   920  O O     . ARG C 3 14 ? 9.569   29.066 24.009  1.00 60.63  ? 206 ARG A O     1 
ATOM   921  C CB    . ARG C 3 14 ? 10.825  29.690 21.184  1.00 64.27  ? 206 ARG A CB    1 
ATOM   922  C CG    . ARG C 3 14 ? 9.666   30.092 20.291  1.00 65.28  ? 206 ARG A CG    1 
ATOM   923  C CD    . ARG C 3 14 ? 9.673   29.341 18.955  1.00 65.06  ? 206 ARG A CD    1 
ATOM   924  N NE    . ARG C 3 14 ? 10.828  29.705 18.139  1.00 65.73  ? 206 ARG A NE    1 
ATOM   925  C CZ    . ARG C 3 14 ? 10.884  29.568 16.818  1.00 65.95  ? 206 ARG A CZ    1 
ATOM   926  N NH1   . ARG C 3 14 ? 11.983  29.924 16.160  1.00 65.87  ? 206 ARG A NH1   1 
ATOM   927  N NH2   . ARG C 3 14 ? 9.835   29.092 16.155  1.00 64.96  ? 206 ARG A NH2   1 
ATOM   928  N N     . LYS C 3 15 ? 8.667   31.028 23.386  1.00 57.73  ? 207 LYS A N     1 
ATOM   929  C CA    . LYS C 3 15 ? 7.454   30.789 24.155  1.00 55.09  ? 207 LYS A CA    1 
ATOM   930  C C     . LYS C 3 15 ? 6.801   29.533 23.596  1.00 53.87  ? 207 LYS A C     1 
ATOM   931  O O     . LYS C 3 15 ? 6.776   29.341 22.387  1.00 53.91  ? 207 LYS A O     1 
ATOM   932  C CB    . LYS C 3 15 ? 6.487   31.965 24.039  1.00 53.90  ? 207 LYS A CB    1 
ATOM   933  C CG    . LYS C 3 15 ? 5.164   31.758 24.782  1.00 51.89  ? 207 LYS A CG    1 
ATOM   934  C CD    . LYS C 3 15 ? 4.156   32.840 24.424  1.00 51.11  ? 207 LYS A CD    1 
ATOM   935  C CE    . LYS C 3 15 ? 2.834   32.685 25.168  1.00 49.98  ? 207 LYS A CE    1 
ATOM   936  N NZ    . LYS C 3 15 ? 2.161   31.387 24.878  1.00 48.50  ? 207 LYS A NZ    1 
ATOM   937  N N     . LYS C 3 16 ? 6.308   28.659 24.470  1.00 52.44  ? 208 LYS A N     1 
ATOM   938  C CA    . LYS C 3 16 ? 5.651   27.447 23.994  1.00 49.53  ? 208 LYS A CA    1 
ATOM   939  C C     . LYS C 3 16 ? 4.262   27.819 23.449  1.00 46.16  ? 208 LYS A C     1 
ATOM   940  O O     . LYS C 3 16 ? 3.530   28.610 24.048  1.00 44.13  ? 208 LYS A O     1 
ATOM   941  C CB    . LYS C 3 16 ? 5.519   26.426 25.113  1.00 50.03  ? 208 LYS A CB    1 
ATOM   942  C CG    . LYS C 3 16 ? 4.781   25.186 24.665  1.00 53.26  ? 208 LYS A CG    1 
ATOM   943  C CD    . LYS C 3 16 ? 4.257   24.403 25.845  1.00 54.76  ? 208 LYS A CD    1 
ATOM   944  C CE    . LYS C 3 16 ? 3.213   23.389 25.394  1.00 57.98  ? 208 LYS A CE    1 
ATOM   945  N NZ    . LYS C 3 16 ? 2.064   24.070 24.683  1.00 58.66  ? 208 LYS A NZ    1 
ATOM   946  N N     . ARG C 3 17 ? 3.938   27.246 22.303  1.00 42.47  ? 209 ARG A N     1 
ATOM   947  C CA    . ARG C 3 17 ? 2.690   27.476 21.581  1.00 41.04  ? 209 ARG A CA    1 
ATOM   948  C C     . ARG C 3 17 ? 1.430   27.339 22.426  1.00 39.67  ? 209 ARG A C     1 
ATOM   949  O O     . ARG C 3 17 ? 1.247   26.338 23.098  1.00 38.87  ? 209 ARG A O     1 
ATOM   950  C CB    . ARG C 3 17 ? 2.590   26.466 20.439  1.00 39.56  ? 209 ARG A CB    1 
ATOM   951  C CG    . ARG C 3 17 ? 2.309   27.083 19.130  1.00 39.26  ? 209 ARG A CG    1 
ATOM   952  C CD    . ARG C 3 17 ? 1.738   26.095 18.147  1.00 33.96  ? 209 ARG A CD    1 
ATOM   953  N NE    . ARG C 3 17 ? 0.465   26.636 17.742  1.00 33.70  ? 209 ARG A NE    1 
ATOM   954  C CZ    . ARG C 3 17 ? -0.618  25.929 17.465  1.00 31.20  ? 209 ARG A CZ    1 
ATOM   955  N NH1   . ARG C 3 17 ? -0.614  24.598 17.526  1.00 33.19  ? 209 ARG A NH1   1 
ATOM   956  N NH2   . ARG C 3 17 ? -1.734  26.590 17.200  1.00 31.99  ? 209 ARG A NH2   1 
ATOM   957  N N     . CYS C 3 18 ? 0.563   28.338 22.354  1.00 38.33  ? 210 CYS A N     1 
ATOM   958  C CA    . CYS C 3 18 ? -0.717  28.336 23.070  1.00 40.34  ? 210 CYS A CA    1 
ATOM   959  C C     . CYS C 3 18 ? -1.868  28.556 22.095  1.00 38.08  ? 210 CYS A C     1 
ATOM   960  O O     . CYS C 3 18 ? -2.061  29.678 21.657  1.00 38.65  ? 210 CYS A O     1 
ATOM   961  C CB    . CYS C 3 18 ? -0.758  29.493 24.064  1.00 41.72  ? 210 CYS A CB    1 
ATOM   962  S SG    . CYS C 3 18 ? 0.264   29.239 25.487  1.00 50.01  ? 210 CYS A SG    1 
ATOM   963  N N     . PRO C 3 19 ? -2.615  27.511 21.723  1.00 37.03  ? 211 PRO A N     1 
ATOM   964  C CA    . PRO C 3 19 ? -3.739  27.713 20.794  1.00 37.51  ? 211 PRO A CA    1 
ATOM   965  C C     . PRO C 3 19 ? -4.693  28.734 21.390  1.00 38.97  ? 211 PRO A C     1 
ATOM   966  O O     . PRO C 3 19 ? -4.913  28.732 22.609  1.00 37.36  ? 211 PRO A O     1 
ATOM   967  C CB    . PRO C 3 19 ? -4.387  26.343 20.727  1.00 37.57  ? 211 PRO A CB    1 
ATOM   968  C CG    . PRO C 3 19 ? -3.248  25.432 20.932  1.00 38.47  ? 211 PRO A CG    1 
ATOM   969  C CD    . PRO C 3 19 ? -2.437  26.082 22.020  1.00 36.93  ? 211 PRO A CD    1 
ATOM   970  N N     . TYR C 3 20 ? -5.259  29.608 20.567  1.00 38.27  ? 212 TYR A N     1 
ATOM   971  C CA    . TYR C 3 20 ? -6.177  30.584 21.120  1.00 41.27  ? 212 TYR A CA    1 
ATOM   972  C C     . TYR C 3 20 ? -7.568  29.942 21.105  1.00 42.49  ? 212 TYR A C     1 
ATOM   973  O O     . TYR C 3 20 ? -7.807  28.952 20.411  1.00 44.17  ? 212 TYR A O     1 
ATOM   974  C CB    . TYR C 3 20 ? -6.174  31.902 20.314  1.00 37.53  ? 212 TYR A CB    1 
ATOM   975  C CG    . TYR C 3 20 ? -4.816  32.579 20.193  1.00 35.53  ? 212 TYR A CG    1 
ATOM   976  C CD1   . TYR C 3 20 ? -3.733  32.199 21.004  1.00 34.81  ? 212 TYR A CD1   1 
ATOM   977  C CD2   . TYR C 3 20 ? -4.612  33.603 19.286  1.00 34.51  ? 212 TYR A CD2   1 
ATOM   978  C CE1   . TYR C 3 20 ? -2.468  32.831 20.899  1.00 33.20  ? 212 TYR A CE1   1 
ATOM   979  C CE2   . TYR C 3 20 ? -3.361  34.246 19.188  1.00 32.51  ? 212 TYR A CE2   1 
ATOM   980  C CZ    . TYR C 3 20 ? -2.300  33.848 19.998  1.00 30.48  ? 212 TYR A CZ    1 
ATOM   981  O OH    . TYR C 3 20 ? -1.103  34.522 19.920  1.00 30.08  ? 212 TYR A OH    1 
ATOM   982  N N     . THR C 3 21 ? -8.480  30.523 21.865  1.00 45.61  ? 213 THR A N     1 
ATOM   983  C CA    . THR C 3 21 ? -9.840  30.002 21.952  1.00 46.66  ? 213 THR A CA    1 
ATOM   984  C C     . THR C 3 21 ? -10.710 30.430 20.787  1.00 47.88  ? 213 THR A C     1 
ATOM   985  O O     . THR C 3 21 ? -10.384 31.374 20.075  1.00 46.44  ? 213 THR A O     1 
ATOM   986  C CB    . THR C 3 21 ? -10.512 30.477 23.234  1.00 47.07  ? 213 THR A CB    1 
ATOM   987  O OG1   . THR C 3 21 ? -10.453 31.901 23.301  1.00 48.12  ? 213 THR A OG1   1 
ATOM   988  C CG2   . THR C 3 21 ? -9.786  29.902 24.457  1.00 46.99  ? 213 THR A CG2   1 
ATOM   989  N N     . LYS C 3 22 ? -11.826 29.727 20.606  1.00 48.05  ? 214 LYS A N     1 
ATOM   990  C CA    . LYS C 3 22 ? -12.753 30.046 19.546  1.00 49.08  ? 214 LYS A CA    1 
ATOM   991  C C     . LYS C 3 22 ? -13.069 31.523 19.671  1.00 47.10  ? 214 LYS A C     1 
ATOM   992  O O     . LYS C 3 22 ? -13.112 32.238 18.676  1.00 48.77  ? 214 LYS A O     1 
ATOM   993  C CB    . LYS C 3 22 ? -14.039 29.246 19.701  1.00 52.02  ? 214 LYS A CB    1 
ATOM   994  C CG    . LYS C 3 22 ? -14.693 28.875 18.383  1.00 58.06  ? 214 LYS A CG    1 
ATOM   995  C CD    . LYS C 3 22 ? -14.250 27.472 17.930  1.00 60.86  ? 214 LYS A CD    1 
ATOM   996  C CE    . LYS C 3 22 ? -14.835 26.389 18.848  1.00 62.69  ? 214 LYS A CE    1 
ATOM   997  N NZ    . LYS C 3 22 ? -14.449 25.002 18.451  1.00 64.10  ? 214 LYS A NZ    1 
ATOM   998  N N     . HIS C 3 23 ? -13.269 31.988 20.898  1.00 44.15  ? 215 HIS A N     1 
ATOM   999  C CA    . HIS C 3 23 ? -13.602 33.394 21.132  1.00 42.90  ? 215 HIS A CA    1 
ATOM   1000 C C     . HIS C 3 23 ? -12.497 34.371 20.736  1.00 41.26  ? 215 HIS A C     1 
ATOM   1001 O O     . HIS C 3 23 ? -12.758 35.409 20.125  1.00 38.61  ? 215 HIS A O     1 
ATOM   1002 C CB    . HIS C 3 23 ? -13.952 33.634 22.608  1.00 43.44  ? 215 HIS A CB    1 
ATOM   1003 C CG    . HIS C 3 23 ? -14.163 35.081 22.957  1.00 43.77  ? 215 HIS A CG    1 
ATOM   1004 N ND1   . HIS C 3 23 ? -15.250 35.807 22.515  1.00 46.07  ? 215 HIS A ND1   1 
ATOM   1005 C CD2   . HIS C 3 23 ? -13.420 35.937 23.702  1.00 43.77  ? 215 HIS A CD2   1 
ATOM   1006 C CE1   . HIS C 3 23 ? -15.166 37.047 22.971  1.00 44.94  ? 215 HIS A CE1   1 
ATOM   1007 N NE2   . HIS C 3 23 ? -14.062 37.152 23.690  1.00 46.46  ? 215 HIS A NE2   1 
ATOM   1008 N N     . GLN C 3 24 ? -11.263 34.068 21.122  1.00 38.49  ? 216 GLN A N     1 
ATOM   1009 C CA    . GLN C 3 24 ? -10.188 34.973 20.770  1.00 36.48  ? 216 GLN A CA    1 
ATOM   1010 C C     . GLN C 3 24 ? -10.095 34.983 19.242  1.00 32.13  ? 216 GLN A C     1 
ATOM   1011 O O     . GLN C 3 24 ? -10.040 36.040 18.662  1.00 31.29  ? 216 GLN A O     1 
ATOM   1012 C CB    . GLN C 3 24 ? -8.872  34.499 21.372  1.00 37.24  ? 216 GLN A CB    1 
ATOM   1013 C CG    . GLN C 3 24 ? -8.815  34.599 22.851  1.00 39.70  ? 216 GLN A CG    1 
ATOM   1014 C CD    . GLN C 3 24 ? -7.670  33.803 23.387  1.00 36.06  ? 216 GLN A CD    1 
ATOM   1015 O OE1   . GLN C 3 24 ? -7.564  32.585 23.149  1.00 40.27  ? 216 GLN A OE1   1 
ATOM   1016 N NE2   . GLN C 3 24 ? -6.810  34.465 24.100  1.00 37.36  ? 216 GLN A NE2   1 
ATOM   1017 N N     . THR C 3 25 ? -10.130 33.813 18.627  1.00 34.47  ? 217 THR A N     1 
ATOM   1018 C CA    . THR C 3 25 ? -10.043 33.705 17.151  1.00 36.85  ? 217 THR A CA    1 
ATOM   1019 C C     . THR C 3 25 ? -11.156 34.492 16.446  1.00 38.42  ? 217 THR A C     1 
ATOM   1020 O O     . THR C 3 25 ? -10.886 35.287 15.559  1.00 38.19  ? 217 THR A O     1 
ATOM   1021 C CB    . THR C 3 25 ? -10.084 32.235 16.703  1.00 36.95  ? 217 THR A CB    1 
ATOM   1022 O OG1   . THR C 3 25 ? -8.861  31.599 17.086  1.00 38.72  ? 217 THR A OG1   1 
ATOM   1023 C CG2   . THR C 3 25 ? -10.245 32.111 15.207  1.00 38.30  ? 217 THR A CG2   1 
ATOM   1024 N N     . LEU C 3 26 ? -12.405 34.313 16.880  1.00 40.28  ? 218 LEU A N     1 
ATOM   1025 C CA    . LEU C 3 26 ? -13.514 35.014 16.253  1.00 39.71  ? 218 LEU A CA    1 
ATOM   1026 C C     . LEU C 3 26 ? -13.410 36.524 16.400  1.00 39.27  ? 218 LEU A C     1 
ATOM   1027 O O     . LEU C 3 26 ? -13.700 37.276 15.463  1.00 38.89  ? 218 LEU A O     1 
ATOM   1028 C CB    . LEU C 3 26 ? -14.838 34.484 16.820  1.00 44.40  ? 218 LEU A CB    1 
ATOM   1029 C CG    . LEU C 3 26 ? -15.316 33.175 16.173  1.00 48.60  ? 218 LEU A CG    1 
ATOM   1030 C CD1   . LEU C 3 26 ? -15.736 33.469 14.739  1.00 52.02  ? 218 LEU A CD1   1 
ATOM   1031 C CD2   . LEU C 3 26 ? -14.220 32.104 16.179  1.00 53.30  ? 218 LEU A CD2   1 
ATOM   1032 N N     . GLU C 3 27 ? -12.962 36.988 17.559  1.00 37.14  ? 219 GLU A N     1 
ATOM   1033 C CA    . GLU C 3 27 ? -12.800 38.410 17.778  1.00 36.71  ? 219 GLU A CA    1 
ATOM   1034 C C     . GLU C 3 27 ? -11.633 38.988 16.944  1.00 36.00  ? 219 GLU A C     1 
ATOM   1035 O O     . GLU C 3 27 ? -11.680 40.124 16.451  1.00 34.14  ? 219 GLU A O     1 
ATOM   1036 C CB    . GLU C 3 27 ? -12.549 38.681 19.260  1.00 40.64  ? 219 GLU A CB    1 
ATOM   1037 C CG    . GLU C 3 27 ? -13.825 38.691 20.096  1.00 44.33  ? 219 GLU A CG    1 
ATOM   1038 C CD    . GLU C 3 27 ? -14.786 39.772 19.644  1.00 47.01  ? 219 GLU A CD    1 
ATOM   1039 O OE1   . GLU C 3 27 ? -14.423 40.971 19.728  1.00 48.50  ? 219 GLU A OE1   1 
ATOM   1040 O OE2   . GLU C 3 27 ? -15.904 39.421 19.194  1.00 50.42  ? 219 GLU A OE2   1 
ATOM   1041 N N     . LEU C 3 28 ? -10.553 38.226 16.834  1.00 34.12  ? 220 LEU A N     1 
ATOM   1042 C CA    . LEU C 3 28 ? -9.442  38.699 16.041  1.00 32.46  ? 220 LEU A CA    1 
ATOM   1043 C C     . LEU C 3 28 ? -9.891  38.729 14.560  1.00 33.58  ? 220 LEU A C     1 
ATOM   1044 O O     . LEU C 3 28 ? -9.587  39.662 13.831  1.00 36.47  ? 220 LEU A O     1 
ATOM   1045 C CB    . LEU C 3 28 ? -8.263  37.764 16.225  1.00 31.19  ? 220 LEU A CB    1 
ATOM   1046 C CG    . LEU C 3 28 ? -7.470  38.026 17.520  1.00 27.74  ? 220 LEU A CG    1 
ATOM   1047 C CD1   . LEU C 3 28 ? -6.644  36.810 17.802  1.00 29.49  ? 220 LEU A CD1   1 
ATOM   1048 C CD2   . LEU C 3 28 ? -6.626  39.277 17.410  1.00 27.52  ? 220 LEU A CD2   1 
ATOM   1049 N N     . GLU C 3 29 ? -10.581 37.706 14.123  1.00 34.49  ? 221 GLU A N     1 
ATOM   1050 C CA    . GLU C 3 29 ? -11.048 37.735 12.745  1.00 40.66  ? 221 GLU A CA    1 
ATOM   1051 C C     . GLU C 3 29 ? -11.901 38.997 12.475  1.00 42.12  ? 221 GLU A C     1 
ATOM   1052 O O     . GLU C 3 29 ? -11.727 39.666 11.452  1.00 41.99  ? 221 GLU A O     1 
ATOM   1053 C CB    . GLU C 3 29 ? -11.827 36.475 12.440  1.00 40.04  ? 221 GLU A CB    1 
ATOM   1054 C CG    . GLU C 3 29 ? -12.238 36.385 10.986  1.00 46.21  ? 221 GLU A CG    1 
ATOM   1055 C CD    . GLU C 3 29 ? -11.036 36.489 10.054  1.00 48.98  ? 221 GLU A CD    1 
ATOM   1056 O OE1   . GLU C 3 29 ? -9.891  36.235 10.520  1.00 47.47  ? 221 GLU A OE1   1 
ATOM   1057 O OE2   . GLU C 3 29 ? -11.236 36.807 8.860   1.00 47.52  ? 221 GLU A OE2   1 
ATOM   1058 N N     . LYS C 3 30 ? -12.803 39.363 13.390  1.00 43.32  ? 222 LYS A N     1 
ATOM   1059 C CA    . LYS C 3 30 ? -13.602 40.567 13.183  1.00 42.83  ? 222 LYS A CA    1 
ATOM   1060 C C     . LYS C 3 30 ? -12.760 41.843 13.184  1.00 43.24  ? 222 LYS A C     1 
ATOM   1061 O O     . LYS C 3 30 ? -13.113 42.821 12.529  1.00 41.17  ? 222 LYS A O     1 
ATOM   1062 C CB    . LYS C 3 30 ? -14.713 40.690 14.255  1.00 47.48  ? 222 LYS A CB    1 
ATOM   1063 C CG    . LYS C 3 30 ? -15.744 39.564 14.181  1.00 52.19  ? 222 LYS A CG    1 
ATOM   1064 C CD    . LYS C 3 30 ? -17.116 39.911 14.810  1.00 56.25  ? 222 LYS A CD    1 
ATOM   1065 C CE    . LYS C 3 30 ? -17.005 40.316 16.277  1.00 56.78  ? 222 LYS A CE    1 
ATOM   1066 N NZ    . LYS C 3 30 ? -18.357 40.518 16.905  1.00 60.47  ? 222 LYS A NZ    1 
ATOM   1067 N N     . GLU C 3 31 ? -11.650 41.865 13.921  1.00 40.73  ? 223 GLU A N     1 
ATOM   1068 C CA    . GLU C 3 31 ? -10.833 43.065 13.929  1.00 42.10  ? 223 GLU A CA    1 
ATOM   1069 C C     . GLU C 3 31 ? -10.087 43.145 12.596  1.00 42.85  ? 223 GLU A C     1 
ATOM   1070 O O     . GLU C 3 31 ? -9.813  44.247 12.092  1.00 42.37  ? 223 GLU A O     1 
ATOM   1071 C CB    . GLU C 3 31 ? -9.829  43.026 15.080  1.00 42.67  ? 223 GLU A CB    1 
ATOM   1072 C CG    . GLU C 3 31 ? -8.958  44.252 15.170  1.00 46.59  ? 223 GLU A CG    1 
ATOM   1073 C CD    . GLU C 3 31 ? -9.767  45.514 15.389  1.00 49.42  ? 223 GLU A CD    1 
ATOM   1074 O OE1   . GLU C 3 31 ? -10.703 45.470 16.218  1.00 50.89  ? 223 GLU A OE1   1 
ATOM   1075 O OE2   . GLU C 3 31 ? -9.463  46.535 14.735  1.00 51.28  ? 223 GLU A OE2   1 
ATOM   1076 N N     . PHE C 3 32 ? -9.790  41.971 12.043  1.00 42.76  ? 224 PHE A N     1 
ATOM   1077 C CA    . PHE C 3 32 ? -9.067  41.839 10.789  1.00 45.21  ? 224 PHE A CA    1 
ATOM   1078 C C     . PHE C 3 32 ? -9.879  42.479 9.670   1.00 47.37  ? 224 PHE A C     1 
ATOM   1079 O O     . PHE C 3 32 ? -9.349  43.329 8.943   1.00 47.53  ? 224 PHE A O     1 
ATOM   1080 C CB    . PHE C 3 32 ? -8.807  40.363 10.473  1.00 43.64  ? 224 PHE A CB    1 
ATOM   1081 C CG    . PHE C 3 32 ? -7.892  40.149 9.285   1.00 43.18  ? 224 PHE A CG    1 
ATOM   1082 C CD1   . PHE C 3 32 ? -6.625  40.727 9.255   1.00 41.34  ? 224 PHE A CD1   1 
ATOM   1083 C CD2   . PHE C 3 32 ? -8.302  39.378 8.207   1.00 42.47  ? 224 PHE A CD2   1 
ATOM   1084 C CE1   . PHE C 3 32 ? -5.756  40.536 8.140   1.00 44.05  ? 224 PHE A CE1   1 
ATOM   1085 C CE2   . PHE C 3 32 ? -7.446  39.176 7.080   1.00 43.15  ? 224 PHE A CE2   1 
ATOM   1086 C CZ    . PHE C 3 32 ? -6.182  39.756 7.055   1.00 40.52  ? 224 PHE A CZ    1 
ATOM   1087 N N     . LEU C 3 33 ? -11.150 42.085 9.554   1.00 48.74  ? 225 LEU A N     1 
ATOM   1088 C CA    . LEU C 3 33 ? -12.059 42.631 8.521   1.00 50.25  ? 225 LEU A CA    1 
ATOM   1089 C C     . LEU C 3 33 ? -12.352 44.128 8.664   1.00 51.09  ? 225 LEU A C     1 
ATOM   1090 O O     . LEU C 3 33 ? -12.675 44.814 7.681   1.00 50.86  ? 225 LEU A O     1 
ATOM   1091 C CB    . LEU C 3 33 ? -13.359 41.855 8.519   1.00 49.27  ? 225 LEU A CB    1 
ATOM   1092 C CG    . LEU C 3 33 ? -13.136 40.369 8.292   1.00 48.59  ? 225 LEU A CG    1 
ATOM   1093 C CD1   . LEU C 3 33 ? -14.488 39.719 8.118   1.00 47.60  ? 225 LEU A CD1   1 
ATOM   1094 C CD2   . LEU C 3 33 ? -12.260 40.139 7.056   1.00 49.66  ? 225 LEU A CD2   1 
ATOM   1095 N N     . PHE C 3 34 ? -12.254 44.643 9.883   1.00 50.13  ? 226 PHE A N     1 
ATOM   1096 C CA    . PHE C 3 34 ? -12.454 46.060 10.069  1.00 50.93  ? 226 PHE A CA    1 
ATOM   1097 C C     . PHE C 3 34 ? -11.268 46.824 9.466   1.00 50.47  ? 226 PHE A C     1 
ATOM   1098 O O     . PHE C 3 34 ? -11.459 47.854 8.830   1.00 49.84  ? 226 PHE A O     1 
ATOM   1099 C CB    . PHE C 3 34 ? -12.577 46.432 11.541  1.00 52.39  ? 226 PHE A CB    1 
ATOM   1100 C CG    . PHE C 3 34 ? -12.640 47.908 11.758  1.00 55.88  ? 226 PHE A CG    1 
ATOM   1101 C CD1   . PHE C 3 34 ? -13.704 48.651 11.236  1.00 57.45  ? 226 PHE A CD1   1 
ATOM   1102 C CD2   . PHE C 3 34 ? -11.594 48.581 12.393  1.00 57.97  ? 226 PHE A CD2   1 
ATOM   1103 C CE1   . PHE C 3 34 ? -13.726 50.051 11.332  1.00 58.61  ? 226 PHE A CE1   1 
ATOM   1104 C CE2   . PHE C 3 34 ? -11.597 49.984 12.502  1.00 59.00  ? 226 PHE A CE2   1 
ATOM   1105 C CZ    . PHE C 3 34 ? -12.668 50.723 11.967  1.00 59.74  ? 226 PHE A CZ    1 
ATOM   1106 N N     . ASN C 3 35 ? -10.043 46.340 9.685   1.00 49.06  ? 227 ASN A N     1 
ATOM   1107 C CA    . ASN C 3 35 ? -8.831  46.983 9.136   1.00 48.83  ? 227 ASN A CA    1 
ATOM   1108 C C     . ASN C 3 35 ? -7.723  45.932 9.128   1.00 48.48  ? 227 ASN A C     1 
ATOM   1109 O O     . ASN C 3 35 ? -7.242  45.543 10.195  1.00 47.80  ? 227 ASN A O     1 
ATOM   1110 C CB    . ASN C 3 35 ? -8.421  48.207 10.004  1.00 50.17  ? 227 ASN A CB    1 
ATOM   1111 N N     . MET C 3 36 ? -7.313  45.471 7.940   1.00 46.59  ? 228 MET A N     1 
ATOM   1112 C CA    . MET C 3 36 ? -6.307  44.410 7.845   1.00 44.61  ? 228 MET A CA    1 
ATOM   1113 C C     . MET C 3 36 ? -4.940  44.716 8.390   1.00 42.60  ? 228 MET A C     1 
ATOM   1114 O O     . MET C 3 36 ? -4.104  43.816 8.509   1.00 41.72  ? 228 MET A O     1 
ATOM   1115 C CB    . MET C 3 36 ? -6.201  43.896 6.422   1.00 46.12  ? 228 MET A CB    1 
ATOM   1116 C CG    . MET C 3 36 ? -7.455  43.186 5.985   1.00 46.69  ? 228 MET A CG    1 
ATOM   1117 S SD    . MET C 3 36 ? -7.407  42.737 4.221   1.00 49.07  ? 228 MET A SD    1 
ATOM   1118 C CE    . MET C 3 36 ? -7.581  41.021 4.273   1.00 42.65  ? 228 MET A CE    1 
ATOM   1119 N N     . TYR C 3 37 ? -4.726  45.984 8.718   1.00 41.77  ? 229 TYR A N     1 
ATOM   1120 C CA    . TYR C 3 37 ? -3.493  46.457 9.313   1.00 44.27  ? 229 TYR A CA    1 
ATOM   1121 C C     . TYR C 3 37 ? -3.866  47.216 10.586  1.00 45.87  ? 229 TYR A C     1 
ATOM   1122 O O     . TYR C 3 37 ? -4.705  48.123 10.565  1.00 44.80  ? 229 TYR A O     1 
ATOM   1123 C CB    . TYR C 3 37 ? -2.736  47.377 8.361   1.00 44.86  ? 229 TYR A CB    1 
ATOM   1124 C CG    . TYR C 3 37 ? -2.217  46.637 7.156   1.00 46.55  ? 229 TYR A CG    1 
ATOM   1125 C CD1   . TYR C 3 37 ? -3.026  46.423 6.039   1.00 47.31  ? 229 TYR A CD1   1 
ATOM   1126 C CD2   . TYR C 3 37 ? -0.937  46.100 7.160   1.00 46.13  ? 229 TYR A CD2   1 
ATOM   1127 C CE1   . TYR C 3 37 ? -2.556  45.690 4.956   1.00 48.03  ? 229 TYR A CE1   1 
ATOM   1128 C CE2   . TYR C 3 37 ? -0.468  45.363 6.091   1.00 47.13  ? 229 TYR A CE2   1 
ATOM   1129 C CZ    . TYR C 3 37 ? -1.280  45.166 5.002   1.00 46.85  ? 229 TYR A CZ    1 
ATOM   1130 O OH    . TYR C 3 37 ? -0.812  44.411 3.966   1.00 50.70  ? 229 TYR A OH    1 
ATOM   1131 N N     . LEU C 3 38 ? -3.238  46.825 11.689  1.00 47.05  ? 230 LEU A N     1 
ATOM   1132 C CA    . LEU C 3 38 ? -3.491  47.427 13.000  1.00 48.97  ? 230 LEU A CA    1 
ATOM   1133 C C     . LEU C 3 38 ? -2.804  48.762 13.208  1.00 50.13  ? 230 LEU A C     1 
ATOM   1134 O O     . LEU C 3 38 ? -1.739  49.031 12.643  1.00 51.37  ? 230 LEU A O     1 
ATOM   1135 C CB    . LEU C 3 38 ? -2.991  46.495 14.104  1.00 47.94  ? 230 LEU A CB    1 
ATOM   1136 C CG    . LEU C 3 38 ? -3.556  45.081 14.172  1.00 49.34  ? 230 LEU A CG    1 
ATOM   1137 C CD1   . LEU C 3 38 ? -2.606  44.201 14.965  1.00 50.18  ? 230 LEU A CD1   1 
ATOM   1138 C CD2   . LEU C 3 38 ? -4.949  45.107 14.793  1.00 48.26  ? 230 LEU A CD2   1 
ATOM   1139 N N     . THR C 3 39 ? -3.426  49.595 14.032  1.00 51.66  ? 231 THR A N     1 
ATOM   1140 C CA    . THR C 3 39 ? -2.869  50.876 14.418  1.00 53.22  ? 231 THR A CA    1 
ATOM   1141 C C     . THR C 3 39 ? -2.375  50.539 15.821  1.00 54.41  ? 231 THR A C     1 
ATOM   1142 O O     . THR C 3 39 ? -2.845  49.569 16.413  1.00 52.68  ? 231 THR A O     1 
ATOM   1143 C CB    . THR C 3 39 ? -3.947  51.945 14.546  1.00 53.71  ? 231 THR A CB    1 
ATOM   1144 O OG1   . THR C 3 39 ? -4.835  51.589 15.618  1.00 52.94  ? 231 THR A OG1   1 
ATOM   1145 C CG2   . THR C 3 39 ? -4.742  52.054 13.246  1.00 53.34  ? 231 THR A CG2   1 
ATOM   1146 N N     . ARG C 3 40 ? -1.453  51.329 16.354  1.00 57.23  ? 232 ARG A N     1 
ATOM   1147 C CA    . ARG C 3 40 ? -0.912  51.071 17.685  1.00 60.72  ? 232 ARG A CA    1 
ATOM   1148 C C     . ARG C 3 40 ? -2.031  50.980 18.735  1.00 61.13  ? 232 ARG A C     1 
ATOM   1149 O O     . ARG C 3 40 ? -1.986  50.140 19.639  1.00 61.60  ? 232 ARG A O     1 
ATOM   1150 C CB    . ARG C 3 40 ? 0.093   52.170 18.050  1.00 63.05  ? 232 ARG A CB    1 
ATOM   1151 C CG    . ARG C 3 40 ? 0.984   51.866 19.254  1.00 67.88  ? 232 ARG A CG    1 
ATOM   1152 C CD    . ARG C 3 40 ? 2.306   52.616 19.126  1.00 71.35  ? 232 ARG A CD    1 
ATOM   1153 N NE    . ARG C 3 40 ? 2.953   52.262 17.864  1.00 74.06  ? 232 ARG A NE    1 
ATOM   1154 C CZ    . ARG C 3 40 ? 4.097   52.775 17.420  1.00 75.71  ? 232 ARG A CZ    1 
ATOM   1155 N NH1   . ARG C 3 40 ? 4.587   52.369 16.251  1.00 76.60  ? 232 ARG A NH1   1 
ATOM   1156 N NH2   . ARG C 3 40 ? 4.749   53.689 18.134  1.00 76.01  ? 232 ARG A NH2   1 
ATOM   1157 N N     . ASP C 3 41 ? -3.053  51.815 18.583  1.00 61.80  ? 233 ASP A N     1 
ATOM   1158 C CA    . ASP C 3 41 ? -4.168  51.851 19.528  1.00 62.00  ? 233 ASP A CA    1 
ATOM   1159 C C     . ASP C 3 41 ? -5.172  50.707 19.406  1.00 60.23  ? 233 ASP A C     1 
ATOM   1160 O O     . ASP C 3 41 ? -5.607  50.149 20.422  1.00 59.48  ? 233 ASP A O     1 
ATOM   1161 C CB    . ASP C 3 41 ? -4.895  53.200 19.419  1.00 64.82  ? 233 ASP A CB    1 
ATOM   1162 C CG    . ASP C 3 41 ? -3.960  54.388 19.670  1.00 67.68  ? 233 ASP A CG    1 
ATOM   1163 O OD1   . ASP C 3 41 ? -3.279  54.406 20.721  1.00 68.74  ? 233 ASP A OD1   1 
ATOM   1164 O OD2   . ASP C 3 41 ? -3.904  55.301 18.816  1.00 69.51  ? 233 ASP A OD2   1 
ATOM   1165 N N     . ARG C 3 42 ? -5.545  50.367 18.175  1.00 57.44  ? 234 ARG A N     1 
ATOM   1166 C CA    . ARG C 3 42 ? -6.493  49.283 17.942  1.00 56.65  ? 234 ARG A CA    1 
ATOM   1167 C C     . ARG C 3 42 ? -5.906  47.975 18.464  1.00 54.15  ? 234 ARG A C     1 
ATOM   1168 O O     . ARG C 3 42 ? -6.615  47.145 19.022  1.00 52.30  ? 234 ARG A O     1 
ATOM   1169 C CB    . ARG C 3 42 ? -6.790  49.141 16.450  1.00 59.41  ? 234 ARG A CB    1 
ATOM   1170 C CG    . ARG C 3 42 ? -8.174  49.601 16.023  1.00 63.75  ? 234 ARG A CG    1 
ATOM   1171 C CD    . ARG C 3 42 ? -9.256  48.823 16.756  1.00 66.68  ? 234 ARG A CD    1 
ATOM   1172 N NE    . ARG C 3 42 ? -10.570 48.991 16.135  1.00 70.54  ? 234 ARG A NE    1 
ATOM   1173 C CZ    . ARG C 3 42 ? -11.688 48.410 16.569  1.00 71.41  ? 234 ARG A CZ    1 
ATOM   1174 N NH1   . ARG C 3 42 ? -11.656 47.618 17.635  1.00 71.93  ? 234 ARG A NH1   1 
ATOM   1175 N NH2   . ARG C 3 42 ? -12.840 48.617 15.934  1.00 72.89  ? 234 ARG A NH2   1 
ATOM   1176 N N     . ARG C 3 43 ? -4.602  47.806 18.253  1.00 51.08  ? 235 ARG A N     1 
ATOM   1177 C CA    . ARG C 3 43 ? -3.878  46.623 18.695  1.00 49.74  ? 235 ARG A CA    1 
ATOM   1178 C C     . ARG C 3 43 ? -3.905  46.556 20.216  1.00 47.75  ? 235 ARG A C     1 
ATOM   1179 O O     . ARG C 3 43 ? -4.086  45.499 20.801  1.00 46.09  ? 235 ARG A O     1 
ATOM   1180 C CB    . ARG C 3 43 ? -2.420  46.684 18.233  1.00 48.53  ? 235 ARG A CB    1 
ATOM   1181 C CG    . ARG C 3 43 ? -1.595  45.490 18.691  1.00 49.25  ? 235 ARG A CG    1 
ATOM   1182 C CD    . ARG C 3 43 ? -0.186  45.556 18.139  1.00 51.26  ? 235 ARG A CD    1 
ATOM   1183 N NE    . ARG C 3 43 ? 0.584   46.595 18.788  1.00 52.35  ? 235 ARG A NE    1 
ATOM   1184 C CZ    . ARG C 3 43 ? 1.596   47.232 18.211  1.00 54.61  ? 235 ARG A CZ    1 
ATOM   1185 N NH1   . ARG C 3 43 ? 1.955   46.926 16.967  1.00 53.43  ? 235 ARG A NH1   1 
ATOM   1186 N NH2   . ARG C 3 43 ? 2.236   48.191 18.870  1.00 55.09  ? 235 ARG A NH2   1 
ATOM   1187 N N     . TYR C 3 44 ? -3.680  47.709 20.824  1.00 48.01  ? 236 TYR A N     1 
ATOM   1188 C CA    . TYR C 3 44 ? -3.676  47.865 22.266  1.00 48.06  ? 236 TYR A CA    1 
ATOM   1189 C C     . TYR C 3 44 ? -5.023  47.476 22.860  1.00 47.78  ? 236 TYR A C     1 
ATOM   1190 O O     . TYR C 3 44 ? -5.068  46.755 23.853  1.00 48.76  ? 236 TYR A O     1 
ATOM   1191 C CB    . TYR C 3 44 ? -3.349  49.297 22.606  1.00 48.08  ? 236 TYR A CB    1 
ATOM   1192 N N     . GLU C 3 45 ? -6.116  47.917 22.237  1.00 47.72  ? 237 GLU A N     1 
ATOM   1193 C CA    . GLU C 3 45 ? -7.464  47.616 22.733  1.00 46.03  ? 237 GLU A CA    1 
ATOM   1194 C C     . GLU C 3 45 ? -7.878  46.161 22.555  1.00 46.46  ? 237 GLU A C     1 
ATOM   1195 O O     . GLU C 3 45 ? -8.496  45.549 23.448  1.00 45.18  ? 237 GLU A O     1 
ATOM   1196 C CB    . GLU C 3 45 ? -8.476  48.533 22.072  1.00 45.37  ? 237 GLU A CB    1 
ATOM   1197 N N     . VAL C 3 46 ? -7.536  45.594 21.399  1.00 44.86  ? 238 VAL A N     1 
ATOM   1198 C CA    . VAL C 3 46 ? -7.850  44.208 21.114  1.00 43.75  ? 238 VAL A CA    1 
ATOM   1199 C C     . VAL C 3 46 ? -7.051  43.320 22.065  1.00 43.86  ? 238 VAL A C     1 
ATOM   1200 O O     . VAL C 3 46 ? -7.560  42.321 22.581  1.00 43.80  ? 238 VAL A O     1 
ATOM   1201 C CB    . VAL C 3 46 ? -7.466  43.842 19.656  1.00 44.53  ? 238 VAL A CB    1 
ATOM   1202 C CG1   . VAL C 3 46 ? -7.592  42.356 19.438  1.00 45.30  ? 238 VAL A CG1   1 
ATOM   1203 C CG2   . VAL C 3 46 ? -8.378  44.585 18.682  1.00 48.13  ? 238 VAL A CG2   1 
ATOM   1204 N N     . ALA C 3 47 ? -5.788  43.674 22.278  1.00 43.21  ? 239 ALA A N     1 
ATOM   1205 C CA    . ALA C 3 47 ? -4.934  42.910 23.176  1.00 44.75  ? 239 ALA A CA    1 
ATOM   1206 C C     . ALA C 3 47 ? -5.566  42.820 24.594  1.00 45.48  ? 239 ALA A C     1 
ATOM   1207 O O     . ALA C 3 47 ? -5.728  41.730 25.142  1.00 46.80  ? 239 ALA A O     1 
ATOM   1208 C CB    . ALA C 3 47 ? -3.555  43.567 23.250  1.00 43.54  ? 239 ALA A CB    1 
ATOM   1209 N N     . ARG C 3 48 ? -5.908  43.973 25.159  1.00 46.46  ? 240 ARG A N     1 
ATOM   1210 C CA    . ARG C 3 48 ? -6.523  44.080 26.499  1.00 47.37  ? 240 ARG A CA    1 
ATOM   1211 C C     . ARG C 3 48 ? -7.817  43.271 26.584  1.00 48.43  ? 240 ARG A C     1 
ATOM   1212 O O     . ARG C 3 48 ? -8.007  42.417 27.463  1.00 48.83  ? 240 ARG A O     1 
ATOM   1213 C CB    . ARG C 3 48 ? -6.810  45.540 26.802  1.00 46.48  ? 240 ARG A CB    1 
ATOM   1214 N N     . LEU C 3 49 ? -8.703  43.546 25.643  1.00 49.13  ? 241 LEU A N     1 
ATOM   1215 C CA    . LEU C 3 49 ? -9.984  42.884 25.542  1.00 50.11  ? 241 LEU A CA    1 
ATOM   1216 C C     . LEU C 3 49 ? -9.893  41.352 25.538  1.00 49.48  ? 241 LEU A C     1 
ATOM   1217 O O     . LEU C 3 49 ? -10.745 40.672 26.126  1.00 49.11  ? 241 LEU A O     1 
ATOM   1218 C CB    . LEU C 3 49 ? -10.667 43.392 24.268  1.00 53.20  ? 241 LEU A CB    1 
ATOM   1219 C CG    . LEU C 3 49 ? -12.147 43.179 23.985  1.00 56.53  ? 241 LEU A CG    1 
ATOM   1220 C CD1   . LEU C 3 49 ? -12.584 44.222 22.953  1.00 58.33  ? 241 LEU A CD1   1 
ATOM   1221 C CD2   . LEU C 3 49 ? -12.410 41.769 23.480  1.00 57.35  ? 241 LEU A CD2   1 
ATOM   1222 N N     . LEU C 3 50 ? -8.858  40.802 24.895  1.00 46.23  ? 242 LEU A N     1 
ATOM   1223 C CA    . LEU C 3 50 ? -8.695  39.356 24.807  1.00 43.22  ? 242 LEU A CA    1 
ATOM   1224 C C     . LEU C 3 50 ? -7.627  38.762 25.733  1.00 41.75  ? 242 LEU A C     1 
ATOM   1225 O O     . LEU C 3 50 ? -7.420  37.556 25.739  1.00 40.95  ? 242 LEU A O     1 
ATOM   1226 C CB    . LEU C 3 50 ? -8.375  38.960 23.357  1.00 44.95  ? 242 LEU A CB    1 
ATOM   1227 C CG    . LEU C 3 50 ? -9.405  39.371 22.296  1.00 46.65  ? 242 LEU A CG    1 
ATOM   1228 C CD1   . LEU C 3 50 ? -8.871  39.017 20.901  1.00 46.25  ? 242 LEU A CD1   1 
ATOM   1229 C CD2   . LEU C 3 50 ? -10.732 38.661 22.555  1.00 45.66  ? 242 LEU A CD2   1 
ATOM   1230 N N     . ASN C 3 51 ? -6.933  39.595 26.493  1.00 42.71  ? 243 ASN A N     1 
ATOM   1231 C CA    . ASN C 3 51 ? -5.896  39.085 27.405  1.00 44.13  ? 243 ASN A CA    1 
ATOM   1232 C C     . ASN C 3 51 ? -4.774  38.387 26.613  1.00 42.91  ? 243 ASN A C     1 
ATOM   1233 O O     . ASN C 3 51 ? -4.353  37.262 26.918  1.00 43.67  ? 243 ASN A O     1 
ATOM   1234 C CB    . ASN C 3 51 ? -6.515  38.114 28.442  1.00 45.78  ? 243 ASN A CB    1 
ATOM   1235 C CG    . ASN C 3 51 ? -5.574  37.818 29.610  1.00 48.08  ? 243 ASN A CG    1 
ATOM   1236 O OD1   . ASN C 3 51 ? -5.746  36.838 30.334  1.00 52.29  ? 243 ASN A OD1   1 
ATOM   1237 N ND2   . ASN C 3 51 ? -4.581  38.672 29.796  1.00 49.64  ? 243 ASN A ND2   1 
ATOM   1238 N N     . LEU C 3 52 ? -4.329  39.063 25.558  1.00 43.45  ? 244 LEU A N     1 
ATOM   1239 C CA    . LEU C 3 52 ? -3.233  38.581 24.719  1.00 40.26  ? 244 LEU A CA    1 
ATOM   1240 C C     . LEU C 3 52 ? -2.309  39.760 24.749  1.00 39.79  ? 244 LEU A C     1 
ATOM   1241 O O     . LEU C 3 52 ? -2.752  40.873 25.000  1.00 39.27  ? 244 LEU A O     1 
ATOM   1242 C CB    . LEU C 3 52 ? -3.691  38.350 23.271  1.00 39.53  ? 244 LEU A CB    1 
ATOM   1243 C CG    . LEU C 3 52 ? -4.651  37.197 23.063  1.00 38.12  ? 244 LEU A CG    1 
ATOM   1244 C CD1   . LEU C 3 52 ? -5.182  37.220 21.620  1.00 36.88  ? 244 LEU A CD1   1 
ATOM   1245 C CD2   . LEU C 3 52 ? -3.951  35.891 23.372  1.00 37.62  ? 244 LEU A CD2   1 
ATOM   1246 N N     . THR C 3 53 ? -1.026  39.523 24.513  1.00 39.30  ? 245 THR A N     1 
ATOM   1247 C CA    . THR C 3 53 ? -0.082  40.612 24.497  1.00 38.85  ? 245 THR A CA    1 
ATOM   1248 C C     . THR C 3 53 ? -0.226  41.344 23.163  1.00 41.35  ? 245 THR A C     1 
ATOM   1249 O O     . THR C 3 53 ? -0.768  40.783 22.194  1.00 38.15  ? 245 THR A O     1 
ATOM   1250 C CB    . THR C 3 53 ? 1.378   40.101 24.624  1.00 40.45  ? 245 THR A CB    1 
ATOM   1251 O OG1   . THR C 3 53 ? 1.759   39.353 23.446  1.00 35.21  ? 245 THR A OG1   1 
ATOM   1252 C CG2   . THR C 3 53 ? 1.516   39.189 25.855  1.00 39.43  ? 245 THR A CG2   1 
ATOM   1253 N N     . GLU C 3 54 ? 0.244   42.586 23.127  1.00 39.02  ? 246 GLU A N     1 
ATOM   1254 C CA    . GLU C 3 54 ? 0.224   43.355 21.899  1.00 40.78  ? 246 GLU A CA    1 
ATOM   1255 C C     . GLU C 3 54 ? 1.106   42.620 20.858  1.00 39.05  ? 246 GLU A C     1 
ATOM   1256 O O     . GLU C 3 54 ? 0.810   42.650 19.669  1.00 37.98  ? 246 GLU A O     1 
ATOM   1257 C CB    . GLU C 3 54 ? 0.786   44.764 22.117  1.00 43.33  ? 246 GLU A CB    1 
ATOM   1258 C CG    . GLU C 3 54 ? -0.012  45.658 23.093  1.00 50.59  ? 246 GLU A CG    1 
ATOM   1259 C CD    . GLU C 3 54 ? 0.577   47.078 23.214  1.00 52.80  ? 246 GLU A CD    1 
ATOM   1260 O OE1   . GLU C 3 54 ? 1.817   47.193 23.413  1.00 56.62  ? 246 GLU A OE1   1 
ATOM   1261 O OE2   . GLU C 3 54 ? -0.182  48.076 23.114  1.00 55.28  ? 246 GLU A OE2   1 
ATOM   1262 N N     A ARG C 3 55 ? 2.173   41.973 21.319  0.50 38.34  ? 247 ARG A N     1 
ATOM   1263 N N     B ARG C 3 55 ? 2.179   41.977 21.315  0.50 38.05  ? 247 ARG A N     1 
ATOM   1264 C CA    A ARG C 3 55 ? 3.054   41.247 20.411  0.50 37.02  ? 247 ARG A CA    1 
ATOM   1265 C CA    B ARG C 3 55 ? 3.067   41.252 20.406  0.50 36.51  ? 247 ARG A CA    1 
ATOM   1266 C C     A ARG C 3 55 ? 2.263   40.125 19.752  0.50 35.57  ? 247 ARG A C     1 
ATOM   1267 C C     B ARG C 3 55 ? 2.312   40.086 19.762  0.50 35.30  ? 247 ARG A C     1 
ATOM   1268 O O     A ARG C 3 55 ? 2.289   39.977 18.522  0.50 33.01  ? 247 ARG A O     1 
ATOM   1269 O O     B ARG C 3 55 ? 2.424   39.858 18.549  0.50 33.07  ? 247 ARG A O     1 
ATOM   1270 C CB    A ARG C 3 55 ? 4.259   40.672 21.158  0.50 37.41  ? 247 ARG A CB    1 
ATOM   1271 C CB    B ARG C 3 55 ? 4.316   40.764 21.147  0.50 36.00  ? 247 ARG A CB    1 
ATOM   1272 C CG    A ARG C 3 55 ? 5.271   39.972 20.264  0.50 39.06  ? 247 ARG A CG    1 
ATOM   1273 C CG    B ARG C 3 55 ? 4.574   39.282 21.046  0.50 36.86  ? 247 ARG A CG    1 
ATOM   1274 C CD    A ARG C 3 55 ? 6.624   39.795 20.965  0.50 41.57  ? 247 ARG A CD    1 
ATOM   1275 C CD    B ARG C 3 55 ? 5.953   38.949 20.498  0.50 36.17  ? 247 ARG A CD    1 
ATOM   1276 N NE    A ARG C 3 55 ? 7.646   39.253 20.063  0.50 43.89  ? 247 ARG A NE    1 
ATOM   1277 N NE    B ARG C 3 55 ? 6.991   38.954 21.525  0.50 37.55  ? 247 ARG A NE    1 
ATOM   1278 C CZ    A ARG C 3 55 ? 7.619   38.023 19.565  0.50 44.36  ? 247 ARG A CZ    1 
ATOM   1279 C CZ    B ARG C 3 55 ? 7.559   40.050 22.017  0.50 36.17  ? 247 ARG A CZ    1 
ATOM   1280 N NH1   A ARG C 3 55 ? 8.573   37.606 18.750  0.50 43.92  ? 247 ARG A NH1   1 
ATOM   1281 N NH1   B ARG C 3 55 ? 8.491   39.944 22.950  0.50 35.15  ? 247 ARG A NH1   1 
ATOM   1282 N NH2   A ARG C 3 55 ? 6.630   37.207 19.887  0.50 45.29  ? 247 ARG A NH2   1 
ATOM   1283 N NH2   B ARG C 3 55 ? 7.209   41.249 21.560  0.50 37.36  ? 247 ARG A NH2   1 
ATOM   1284 N N     . GLN C 3 56 ? 1.539   39.355 20.563  1.00 32.19  ? 248 GLN A N     1 
ATOM   1285 C CA    . GLN C 3 56 ? 0.750   38.248 20.034  1.00 31.21  ? 248 GLN A CA    1 
ATOM   1286 C C     . GLN C 3 56 ? -0.281  38.764 19.034  1.00 29.31  ? 248 GLN A C     1 
ATOM   1287 O O     . GLN C 3 56 ? -0.554  38.088 18.050  1.00 29.52  ? 248 GLN A O     1 
ATOM   1288 C CB    . GLN C 3 56 ? 0.006   37.487 21.156  1.00 29.75  ? 248 GLN A CB    1 
ATOM   1289 C CG    . GLN C 3 56 ? 0.878   36.566 22.019  1.00 31.23  ? 248 GLN A CG    1 
ATOM   1290 C CD    . GLN C 3 56 ? 0.058   35.966 23.177  1.00 31.70  ? 248 GLN A CD    1 
ATOM   1291 O OE1   . GLN C 3 56 ? -0.510  36.708 23.955  1.00 29.81  ? 248 GLN A OE1   1 
ATOM   1292 N NE2   . GLN C 3 56 ? -0.026  34.644 23.252  1.00 30.48  ? 248 GLN A NE2   1 
ATOM   1293 N N     . VAL C 3 57 ? -0.859  39.932 19.290  1.00 28.59  ? 249 VAL A N     1 
ATOM   1294 C CA    . VAL C 3 57 ? -1.877  40.464 18.382  1.00 29.20  ? 249 VAL A CA    1 
ATOM   1295 C C     . VAL C 3 57 ? -1.220  40.906 17.066  1.00 28.71  ? 249 VAL A C     1 
ATOM   1296 O O     . VAL C 3 57 ? -1.743  40.607 16.014  1.00 27.81  ? 249 VAL A O     1 
ATOM   1297 C CB    . VAL C 3 57 ? -2.645  41.656 19.000  1.00 29.78  ? 249 VAL A CB    1 
ATOM   1298 C CG1   . VAL C 3 57 ? -3.549  42.267 17.990  1.00 31.27  ? 249 VAL A CG1   1 
ATOM   1299 C CG2   . VAL C 3 57 ? -3.532  41.150 20.188  1.00 31.05  ? 249 VAL A CG2   1 
ATOM   1300 N N     . LYS C 3 58 ? -0.082  41.589 17.157  1.00 27.90  ? 250 LYS A N     1 
ATOM   1301 C CA    . LYS C 3 58 ? 0.677   42.048 15.958  1.00 28.82  ? 250 LYS A CA    1 
ATOM   1302 C C     . LYS C 3 58 ? 1.030   40.849 15.079  1.00 26.69  ? 250 LYS A C     1 
ATOM   1303 O O     . LYS C 3 58 ? 0.874   40.882 13.839  1.00 28.40  ? 250 LYS A O     1 
ATOM   1304 C CB    . LYS C 3 58 ? 1.975   42.751 16.406  1.00 30.09  ? 250 LYS A CB    1 
ATOM   1305 C CG    . LYS C 3 58 ? 2.937   43.124 15.237  1.00 33.29  ? 250 LYS A CG    1 
ATOM   1306 C CD    . LYS C 3 58 ? 4.232   43.786 15.762  1.00 35.64  ? 250 LYS A CD    1 
ATOM   1307 C CE    . LYS C 3 58 ? 4.965   42.797 16.643  1.00 39.61  ? 250 LYS A CE    1 
ATOM   1308 N NZ    . LYS C 3 58 ? 6.335   43.247 17.040  1.00 44.13  ? 250 LYS A NZ    1 
ATOM   1309 N N     A ILE C 3 59 ? 1.511   39.790 15.714  0.50 25.82  ? 251 ILE A N     1 
ATOM   1310 N N     B ILE C 3 59 ? 1.515   39.791 15.715  0.50 26.55  ? 251 ILE A N     1 
ATOM   1311 C CA    A ILE C 3 59 ? 1.902   38.569 15.022  0.50 26.13  ? 251 ILE A CA    1 
ATOM   1312 C CA    B ILE C 3 59 ? 1.905   38.565 15.029  0.50 27.38  ? 251 ILE A CA    1 
ATOM   1313 C C     A ILE C 3 59 ? 0.711   37.793 14.453  0.50 26.52  ? 251 ILE A C     1 
ATOM   1314 C C     B ILE C 3 59 ? 0.712   37.797 14.453  0.50 27.27  ? 251 ILE A C     1 
ATOM   1315 O O     A ILE C 3 59 ? 0.793   37.199 13.358  0.50 25.23  ? 251 ILE A O     1 
ATOM   1316 O O     B ILE C 3 59 ? 0.793   37.212 13.355  0.50 25.93  ? 251 ILE A O     1 
ATOM   1317 C CB    A ILE C 3 59 ? 2.726   37.683 15.961  0.50 25.25  ? 251 ILE A CB    1 
ATOM   1318 C CB    B ILE C 3 59 ? 2.709   37.660 15.978  0.50 28.06  ? 251 ILE A CB    1 
ATOM   1319 C CG1   A ILE C 3 59 ? 4.059   38.371 16.255  0.50 26.28  ? 251 ILE A CG1   1 
ATOM   1320 C CG1   B ILE C 3 59 ? 4.079   38.286 16.253  0.50 30.20  ? 251 ILE A CG1   1 
ATOM   1321 C CG2   A ILE C 3 59 ? 2.895   36.309 15.370  0.50 27.40  ? 251 ILE A CG2   1 
ATOM   1322 C CG2   B ILE C 3 59 ? 2.814   36.268 15.407  0.50 29.64  ? 251 ILE A CG2   1 
ATOM   1323 C CD1   A ILE C 3 59 ? 4.963   37.587 17.172  0.50 22.33  ? 251 ILE A CD1   1 
ATOM   1324 C CD1   B ILE C 3 59 ? 4.989   38.375 15.032  0.50 31.37  ? 251 ILE A CD1   1 
ATOM   1325 N N     . TRP C 3 60 ? -0.404  37.792 15.176  1.00 24.85  ? 252 TRP A N     1 
ATOM   1326 C CA    . TRP C 3 60 ? -1.572  37.098 14.679  1.00 26.80  ? 252 TRP A CA    1 
ATOM   1327 C C     . TRP C 3 60 ? -1.987  37.773 13.359  1.00 25.44  ? 252 TRP A C     1 
ATOM   1328 O O     . TRP C 3 60 ? -2.302  37.095 12.382  1.00 26.36  ? 252 TRP A O     1 
ATOM   1329 C CB    . TRP C 3 60 ? -2.747  37.172 15.669  1.00 25.89  ? 252 TRP A CB    1 
ATOM   1330 C CG    . TRP C 3 60 ? -3.880  36.314 15.244  1.00 28.34  ? 252 TRP A CG    1 
ATOM   1331 C CD1   . TRP C 3 60 ? -4.138  35.039 15.631  1.00 29.44  ? 252 TRP A CD1   1 
ATOM   1332 C CD2   . TRP C 3 60 ? -4.942  36.687 14.357  1.00 26.77  ? 252 TRP A CD2   1 
ATOM   1333 N NE1   . TRP C 3 60 ? -5.294  34.597 15.049  1.00 27.63  ? 252 TRP A NE1   1 
ATOM   1334 C CE2   . TRP C 3 60 ? -5.809  35.593 14.267  1.00 28.58  ? 252 TRP A CE2   1 
ATOM   1335 C CE3   . TRP C 3 60 ? -5.244  37.856 13.647  1.00 27.55  ? 252 TRP A CE3   1 
ATOM   1336 C CZ2   . TRP C 3 60 ? -6.978  35.616 13.477  1.00 28.94  ? 252 TRP A CZ2   1 
ATOM   1337 C CZ3   . TRP C 3 60 ? -6.412  37.889 12.864  1.00 26.57  ? 252 TRP A CZ3   1 
ATOM   1338 C CH2   . TRP C 3 60 ? -7.255  36.777 12.794  1.00 25.21  ? 252 TRP A CH2   1 
ATOM   1339 N N     . PHE C 3 61 ? -1.980  39.096 13.346  1.00 24.80  ? 253 PHE A N     1 
ATOM   1340 C CA    . PHE C 3 61 ? -2.386  39.813 12.140  1.00 26.61  ? 253 PHE A CA    1 
ATOM   1341 C C     . PHE C 3 61 ? -1.408  39.528 10.997  1.00 25.75  ? 253 PHE A C     1 
ATOM   1342 O O     . PHE C 3 61 ? -1.825  39.359 9.858   1.00 26.21  ? 253 PHE A O     1 
ATOM   1343 C CB    . PHE C 3 61 ? -2.458  41.317 12.376  1.00 25.16  ? 253 PHE A CB    1 
ATOM   1344 C CG    . PHE C 3 61 ? -3.819  41.779 12.701  1.00 33.70  ? 253 PHE A CG    1 
ATOM   1345 C CD1   . PHE C 3 61 ? -4.403  41.434 13.915  1.00 29.92  ? 253 PHE A CD1   1 
ATOM   1346 C CD2   . PHE C 3 61 ? -4.572  42.472 11.757  1.00 36.74  ? 253 PHE A CD2   1 
ATOM   1347 C CE1   . PHE C 3 61 ? -5.709  41.761 14.181  1.00 34.80  ? 253 PHE A CE1   1 
ATOM   1348 C CE2   . PHE C 3 61 ? -5.885  42.804 12.015  1.00 38.84  ? 253 PHE A CE2   1 
ATOM   1349 C CZ    . PHE C 3 61 ? -6.462  42.451 13.224  1.00 37.10  ? 253 PHE A CZ    1 
ATOM   1350 N N     . GLN C 3 62 ? -0.135  39.464 11.323  1.00 26.85  ? 254 GLN A N     1 
ATOM   1351 C CA    . GLN C 3 62 ? 0.905   39.156 10.297  1.00 25.34  ? 254 GLN A CA    1 
ATOM   1352 C C     . GLN C 3 62 ? 0.694   37.751 9.740   1.00 26.38  ? 254 GLN A C     1 
ATOM   1353 O O     . GLN C 3 62 ? 0.744   37.532 8.510   1.00 26.21  ? 254 GLN A O     1 
ATOM   1354 C CB    . GLN C 3 62 ? 2.306   39.305 10.942  1.00 24.16  ? 254 GLN A CB    1 
ATOM   1355 C CG    . GLN C 3 62 ? 2.595   40.776 11.248  1.00 23.98  ? 254 GLN A CG    1 
ATOM   1356 C CD    . GLN C 3 62 ? 3.874   40.978 12.031  1.00 25.30  ? 254 GLN A CD    1 
ATOM   1357 O OE1   . GLN C 3 62 ? 4.501   40.025 12.473  1.00 28.73  ? 254 GLN A OE1   1 
ATOM   1358 N NE2   . GLN C 3 62 ? 4.269   42.238 12.190  1.00 31.00  ? 254 GLN A NE2   1 
ATOM   1359 N N     . ASN C 3 63 ? 0.440   36.786 10.622  1.00 22.35  ? 255 ASN A N     1 
ATOM   1360 C CA    . ASN C 3 63 ? 0.177   35.415 10.185  1.00 24.87  ? 255 ASN A CA    1 
ATOM   1361 C C     . ASN C 3 63 ? -1.143  35.350 9.370   1.00 25.71  ? 255 ASN A C     1 
ATOM   1362 O O     . ASN C 3 63 ? -1.233  34.617 8.373   1.00 24.93  ? 255 ASN A O     1 
ATOM   1363 C CB    . ASN C 3 63 ? 0.094   34.424 11.379  1.00 24.70  ? 255 ASN A CB    1 
ATOM   1364 C CG    . ASN C 3 63 ? 1.481   34.071 11.967  1.00 28.87  ? 255 ASN A CG    1 
ATOM   1365 O OD1   . ASN C 3 63 ? 2.451   33.950 11.240  1.00 29.17  ? 255 ASN A OD1   1 
ATOM   1366 N ND2   . ASN C 3 63 ? 1.547   33.871 13.294  1.00 24.84  ? 255 ASN A ND2   1 
ATOM   1367 N N     . ARG C 3 64 ? -2.141  36.129 9.778   1.00 27.76  ? 256 ARG A N     1 
ATOM   1368 C CA    . ARG C 3 64 ? -3.438  36.129 9.083   1.00 29.65  ? 256 ARG A CA    1 
ATOM   1369 C C     . ARG C 3 64 ? -3.296  36.638 7.638   1.00 30.10  ? 256 ARG A C     1 
ATOM   1370 O O     . ARG C 3 64 ? -3.978  36.172 6.712   1.00 29.31  ? 256 ARG A O     1 
ATOM   1371 C CB    . ARG C 3 64 ? -4.454  36.993 9.829   1.00 30.79  ? 256 ARG A CB    1 
ATOM   1372 C CG    . ARG C 3 64 ? -5.837  36.996 9.162   1.00 30.72  ? 256 ARG A CG    1 
ATOM   1373 C CD    . ARG C 3 64 ? -6.495  35.628 9.222   1.00 33.48  ? 256 ARG A CD    1 
ATOM   1374 N NE    . ARG C 3 64 ? -7.820  35.642 8.587   1.00 40.03  ? 256 ARG A NE    1 
ATOM   1375 C CZ    . ARG C 3 64 ? -8.009  35.605 7.265   1.00 43.24  ? 256 ARG A CZ    1 
ATOM   1376 N NH1   . ARG C 3 64 ? -6.958  35.547 6.447   1.00 40.30  ? 256 ARG A NH1   1 
ATOM   1377 N NH2   . ARG C 3 64 ? -9.238  35.642 6.750   1.00 42.86  ? 256 ARG A NH2   1 
ATOM   1378 N N     . ARG C 3 65 ? -2.412  37.597 7.444   1.00 31.98  ? 257 ARG A N     1 
ATOM   1379 C CA    . ARG C 3 65 ? -2.185  38.086 6.091   1.00 31.17  ? 257 ARG A CA    1 
ATOM   1380 C C     . ARG C 3 65 ? -1.431  37.039 5.261   1.00 32.26  ? 257 ARG A C     1 
ATOM   1381 O O     . ARG C 3 65 ? -1.617  36.968 4.042   1.00 31.91  ? 257 ARG A O     1 
ATOM   1382 C CB    . ARG C 3 65 ? -1.455  39.417 6.129   1.00 30.23  ? 257 ARG A CB    1 
ATOM   1383 C CG    . ARG C 3 65 ? -2.335  40.582 6.574   1.00 29.30  ? 257 ARG A CG    1 
ATOM   1384 C CD    . ARG C 3 65 ? -1.686  41.944 6.303   1.00 28.80  ? 257 ARG A CD    1 
ATOM   1385 N NE    . ARG C 3 65 ? -0.419  42.128 7.008   1.00 29.84  ? 257 ARG A NE    1 
ATOM   1386 C CZ    . ARG C 3 65 ? -0.315  42.594 8.256   1.00 31.96  ? 257 ARG A CZ    1 
ATOM   1387 N NH1   . ARG C 3 65 ? -1.402  42.932 8.934   1.00 30.43  ? 257 ARG A NH1   1 
ATOM   1388 N NH2   . ARG C 3 65 ? 0.872   42.684 8.830   1.00 30.25  ? 257 ARG A NH2   1 
ATOM   1389 N N     . MET C 3 66 ? -0.591  36.222 5.892   1.00 31.12  ? 258 MET A N     1 
ATOM   1390 C CA    . MET C 3 66 ? 0.121   35.165 5.166   1.00 30.54  ? 258 MET A CA    1 
ATOM   1391 C C     . MET C 3 66 ? -0.864  34.032 4.807   1.00 31.87  ? 258 MET A C     1 
ATOM   1392 O O     . MET C 3 66 ? -0.742  33.378 3.755   1.00 31.35  ? 258 MET A O     1 
ATOM   1393 C CB    . MET C 3 66 ? 1.289   34.639 6.006   1.00 30.78  ? 258 MET A CB    1 
ATOM   1394 C CG    . MET C 3 66 ? 2.397   35.682 6.182   1.00 32.65  ? 258 MET A CG    1 
ATOM   1395 S SD    . MET C 3 66 ? 3.195   36.175 4.545   1.00 30.80  ? 258 MET A SD    1 
ATOM   1396 C CE    . MET C 3 66 ? 2.323   37.652 4.154   1.00 29.15  ? 258 MET A CE    1 
ATOM   1397 N N     . LYS C 3 67 ? -1.874  33.814 5.653   1.00 28.36  ? 259 LYS A N     1 
ATOM   1398 C CA    . LYS C 3 67 ? -2.880  32.782 5.376   1.00 28.12  ? 259 LYS A CA    1 
ATOM   1399 C C     . LYS C 3 67 ? -3.707  33.252 4.173   1.00 30.60  ? 259 LYS A C     1 
ATOM   1400 O O     . LYS C 3 67 ? -4.054  32.450 3.310   1.00 33.89  ? 259 LYS A O     1 
ATOM   1401 C CB    . LYS C 3 67 ? -3.827  32.591 6.578   1.00 29.47  ? 259 LYS A CB    1 
ATOM   1402 C CG    . LYS C 3 67 ? -4.904  31.521 6.370   1.00 33.27  ? 259 LYS A CG    1 
ATOM   1403 C CD    . LYS C 3 67 ? -5.830  31.421 7.578   1.00 35.38  ? 259 LYS A CD    1 
ATOM   1404 C CE    . LYS C 3 67 ? -6.954  30.424 7.353   1.00 37.29  ? 259 LYS A CE    1 
ATOM   1405 N NZ    . LYS C 3 67 ? -7.918  30.471 8.531   1.00 40.73  ? 259 LYS A NZ    1 
ATOM   1406 N N     . MET C 3 68 ? -4.042  34.533 4.131   1.00 31.72  ? 260 MET A N     1 
ATOM   1407 C CA    . MET C 3 68 ? -4.817  35.079 3.022   1.00 34.88  ? 260 MET A CA    1 
ATOM   1408 C C     . MET C 3 68 ? -4.012  34.856 1.710   1.00 36.16  ? 260 MET A C     1 
ATOM   1409 O O     . MET C 3 68 ? -4.579  34.484 0.664   1.00 36.10  ? 260 MET A O     1 
ATOM   1410 C CB    . MET C 3 68 ? -5.071  36.555 3.249   1.00 35.66  ? 260 MET A CB    1 
ATOM   1411 C CG    . MET C 3 68 ? -5.896  37.209 2.157   1.00 39.03  ? 260 MET A CG    1 
ATOM   1412 S SD    . MET C 3 68 ? -6.364  38.881 2.527   1.00 43.24  ? 260 MET A SD    1 
ATOM   1413 C CE    . MET C 3 68 ? -4.811  39.761 2.358   1.00 45.05  ? 260 MET A CE    1 
ATOM   1414 N N     . LYS C 3 69 ? -2.707  35.086 1.775   1.00 34.34  ? 261 LYS A N     1 
ATOM   1415 C CA    . LYS C 3 69 ? -1.825  34.859 0.610   1.00 36.95  ? 261 LYS A CA    1 
ATOM   1416 C C     . LYS C 3 69 ? -1.871  33.376 0.257   1.00 36.96  ? 261 LYS A C     1 
ATOM   1417 O O     . LYS C 3 69 ? -2.035  33.001 -0.915  1.00 36.60  ? 261 LYS A O     1 
ATOM   1418 C CB    . LYS C 3 69 ? -0.379  35.259 0.937   1.00 37.61  ? 261 LYS A CB    1 
ATOM   1419 C CG    . LYS C 3 69 ? 0.637   34.962 -0.204  1.00 37.15  ? 261 LYS A CG    1 
ATOM   1420 C CD    . LYS C 3 69 ? 2.077   35.391 0.143   1.00 38.77  ? 261 LYS A CD    1 
ATOM   1421 C CE    . LYS C 3 69 ? 2.665   34.552 1.292   1.00 38.10  ? 261 LYS A CE    1 
ATOM   1422 N NZ    . LYS C 3 69 ? 4.141   34.722 1.473   1.00 37.96  ? 261 LYS A NZ    1 
ATOM   1423 N N     . LYS C 3 70 ? -1.757  32.510 1.262   1.00 37.16  ? 262 LYS A N     1 
ATOM   1424 C CA    . LYS C 3 70 ? -1.792  31.083 0.991   1.00 39.31  ? 262 LYS A CA    1 
ATOM   1425 C C     . LYS C 3 70 ? -3.083  30.631 0.280   1.00 41.08  ? 262 LYS A C     1 
ATOM   1426 O O     . LYS C 3 70 ? -3.039  29.830 -0.654  1.00 40.88  ? 262 LYS A O     1 
ATOM   1427 C CB    . LYS C 3 70 ? -1.638  30.288 2.278   1.00 39.98  ? 262 LYS A CB    1 
ATOM   1428 C CG    . LYS C 3 70 ? -1.443  28.815 2.057   1.00 44.21  ? 262 LYS A CG    1 
ATOM   1429 C CD    . LYS C 3 70 ? -1.537  28.057 3.356   1.00 47.04  ? 262 LYS A CD    1 
ATOM   1430 C CE    . LYS C 3 70 ? -0.669  26.831 3.263   1.00 51.73  ? 262 LYS A CE    1 
ATOM   1431 N NZ    . LYS C 3 70 ? 0.720   27.255 2.887   1.00 52.78  ? 262 LYS A NZ    1 
ATOM   1432 N N     . ILE C 3 71 ? -4.222  31.138 0.743   1.00 42.23  ? 263 ILE A N     1 
ATOM   1433 C CA    . ILE C 3 71 ? -5.517  30.802 0.174   1.00 43.43  ? 263 ILE A CA    1 
ATOM   1434 C C     . ILE C 3 71 ? -5.641  31.334 -1.256  1.00 44.57  ? 263 ILE A C     1 
ATOM   1435 O O     . ILE C 3 71 ? -6.113  30.616 -2.138  1.00 44.83  ? 263 ILE A O     1 
ATOM   1436 C CB    . ILE C 3 71 ? -6.654  31.356 1.060   1.00 43.30  ? 263 ILE A CB    1 
ATOM   1437 C CG1   . ILE C 3 71 ? -6.771  30.491 2.323   1.00 45.92  ? 263 ILE A CG1   1 
ATOM   1438 C CG2   . ILE C 3 71 ? -7.983  31.371 0.295   1.00 44.66  ? 263 ILE A CG2   1 
ATOM   1439 C CD1   . ILE C 3 71 ? -7.801  30.980 3.317   1.00 46.82  ? 263 ILE A CD1   1 
ATOM   1440 N N     . ASN C 3 72 ? -5.221  32.574 -1.496  1.00 44.86  ? 264 ASN A N     1 
ATOM   1441 C CA    . ASN C 3 72 ? -5.312  33.143 -2.833  1.00 47.32  ? 264 ASN A CA    1 
ATOM   1442 C C     . ASN C 3 72 ? -4.382  32.455 -3.872  1.00 49.01  ? 264 ASN A C     1 
ATOM   1443 O O     . ASN C 3 72 ? -4.679  32.422 -5.074  1.00 48.42  ? 264 ASN A O     1 
ATOM   1444 C CB    . ASN C 3 72 ? -5.069  34.654 -2.758  1.00 48.90  ? 264 ASN A CB    1 
ATOM   1445 C CG    . ASN C 3 72 ? -6.317  35.426 -2.290  1.00 49.44  ? 264 ASN A CG    1 
ATOM   1446 O OD1   . ASN C 3 72 ? -6.242  36.595 -1.915  1.00 47.21  ? 264 ASN A OD1   1 
ATOM   1447 N ND2   . ASN C 3 72 ? -7.474  34.766 -2.342  1.00 51.86  ? 264 ASN A ND2   1 
ATOM   1448 N N     . LYS C 3 73 ? -3.274  31.889 -3.408  1.00 49.64  ? 265 LYS A N     1 
ATOM   1449 C CA    . LYS C 3 73 ? -2.363  31.188 -4.305  1.00 51.39  ? 265 LYS A CA    1 
ATOM   1450 C C     . LYS C 3 73 ? -3.015  29.848 -4.621  1.00 52.48  ? 265 LYS A C     1 
ATOM   1451 O O     . LYS C 3 73 ? -2.852  29.304 -5.704  1.00 50.75  ? 265 LYS A O     1 
ATOM   1452 C CB    . LYS C 3 73 ? -1.002  30.961 -3.623  1.00 51.43  ? 265 LYS A CB    1 
ATOM   1453 N N     . ASP C 3 74 ? -3.758  29.319 -3.658  1.00 54.00  ? 266 ASP A N     1 
ATOM   1454 C CA    . ASP C 3 74 ? -4.419  28.038 -3.830  1.00 57.03  ? 266 ASP A CA    1 
ATOM   1455 C C     . ASP C 3 74 ? -5.554  28.132 -4.844  1.00 59.96  ? 266 ASP A C     1 
ATOM   1456 O O     . ASP C 3 74 ? -5.978  27.115 -5.413  1.00 59.55  ? 266 ASP A O     1 
ATOM   1457 C CB    . ASP C 3 74 ? -4.959  27.548 -2.492  1.00 56.60  ? 266 ASP A CB    1 
ATOM   1458 N N     . ARG C 3 75 ? -6.028  29.352 -5.079  1.00 62.04  ? 267 ARG A N     1 
ATOM   1459 C CA    . ARG C 3 75 ? -7.145  29.573 -5.992  1.00 66.02  ? 267 ARG A CA    1 
ATOM   1460 C C     . ARG C 3 75 ? -6.759  29.984 -7.410  1.00 68.17  ? 267 ARG A C     1 
ATOM   1461 O O     . ARG C 3 75 ? -7.287  29.440 -8.379  1.00 68.74  ? 267 ARG A O     1 
ATOM   1462 C CB    . ARG C 3 75 ? -8.105  30.627 -5.403  1.00 65.27  ? 267 ARG A CB    1 
ATOM   1463 C CG    . ARG C 3 75 ? -8.785  30.233 -4.078  1.00 66.63  ? 267 ARG A CG    1 
ATOM   1464 C CD    . ARG C 3 75 ? -9.790  31.296 -3.564  1.00 66.37  ? 267 ARG A CD    1 
ATOM   1465 N NE    . ARG C 3 75 ? -11.165 31.107 -4.049  1.00 66.87  ? 267 ARG A NE    1 
ATOM   1466 C CZ    . ARG C 3 75 ? -11.528 31.182 -5.324  1.00 66.15  ? 267 ARG A CZ    1 
ATOM   1467 N NH1   . ARG C 3 75 ? -10.621 31.448 -6.248  1.00 66.82  ? 267 ARG A NH1   1 
ATOM   1468 N NH2   . ARG C 3 75 ? -12.787 30.976 -5.679  1.00 64.43  ? 267 ARG A NH2   1 
ATOM   1469 N N     . ALA C 3 76 ? -5.836  30.933 -7.531  1.00 71.04  ? 268 ALA A N     1 
ATOM   1470 C CA    . ALA C 3 76 ? -5.429  31.434 -8.837  1.00 73.46  ? 268 ALA A CA    1 
ATOM   1471 C C     . ALA C 3 76 ? -4.423  30.538 -9.536  1.00 74.98  ? 268 ALA A C     1 
ATOM   1472 O O     . ALA C 3 76 ? -3.304  30.965 -9.808  1.00 75.87  ? 268 ALA A O     1 
ATOM   1473 C CB    . ALA C 3 76 ? -4.861  32.836 -8.693  1.00 73.59  ? 268 ALA A CB    1 
ATOM   1474 N N     . LYS C 3 77 ? -4.820  29.307 -9.844  1.00 76.39  ? 269 LYS A N     1 
ATOM   1475 C CA    . LYS C 3 77 ? -3.920  28.363 -10.513 1.00 78.27  ? 269 LYS A CA    1 
ATOM   1476 C C     . LYS C 3 77 ? -3.432  28.886 -11.875 1.00 78.81  ? 269 LYS A C     1 
ATOM   1477 O O     . LYS C 3 77 ? -2.195  28.912 -12.086 1.00 79.21  ? 269 LYS A O     1 
ATOM   1478 C CB    . LYS C 3 77 ? -4.610  26.994 -10.679 1.00 78.24  ? 269 LYS A CB    1 
ATOM   1479 N N     . ALA D 4 1  ? -18.538 18.823 -4.305  1.00 37.79  ? 233 ALA B N     1 
ATOM   1480 C CA    . ALA D 4 1  ? -18.251 18.372 -2.915  1.00 38.59  ? 233 ALA B CA    1 
ATOM   1481 C C     . ALA D 4 1  ? -16.843 18.846 -2.493  1.00 38.26  ? 233 ALA B C     1 
ATOM   1482 O O     . ALA D 4 1  ? -15.965 19.031 -3.326  1.00 37.55  ? 233 ALA B O     1 
ATOM   1483 C CB    . ALA D 4 1  ? -18.366 16.838 -2.833  1.00 36.24  ? 233 ALA B CB    1 
ATOM   1484 N N     . ARG D 4 2  ? -16.637 19.052 -1.199  1.00 40.17  ? 234 ARG B N     1 
ATOM   1485 C CA    . ARG D 4 2  ? -15.336 19.520 -0.720  1.00 43.45  ? 234 ARG B CA    1 
ATOM   1486 C C     . ARG D 4 2  ? -14.222 18.475 -0.964  1.00 43.07  ? 234 ARG B C     1 
ATOM   1487 O O     . ARG D 4 2  ? -14.462 17.277 -0.840  1.00 43.53  ? 234 ARG B O     1 
ATOM   1488 C CB    . ARG D 4 2  ? -15.452 19.852 0.772   1.00 46.53  ? 234 ARG B CB    1 
ATOM   1489 C CG    . ARG D 4 2  ? -14.319 20.696 1.336   1.00 51.93  ? 234 ARG B CG    1 
ATOM   1490 C CD    . ARG D 4 2  ? -14.799 21.526 2.524   1.00 56.36  ? 234 ARG B CD    1 
ATOM   1491 N NE    . ARG D 4 2  ? -15.222 20.707 3.660   1.00 61.06  ? 234 ARG B NE    1 
ATOM   1492 C CZ    . ARG D 4 2  ? -14.416 20.330 4.657   1.00 63.14  ? 234 ARG B CZ    1 
ATOM   1493 N NH1   . ARG D 4 2  ? -13.138 20.700 4.661   1.00 63.31  ? 234 ARG B NH1   1 
ATOM   1494 N NH2   . ARG D 4 2  ? -14.889 19.584 5.656   1.00 63.67  ? 234 ARG B NH2   1 
ATOM   1495 N N     . ARG D 4 3  ? -13.016 18.919 -1.325  1.00 43.10  ? 235 ARG B N     1 
ATOM   1496 C CA    . ARG D 4 3  ? -11.904 17.976 -1.525  1.00 44.50  ? 235 ARG B CA    1 
ATOM   1497 C C     . ARG D 4 3  ? -11.478 17.409 -0.170  1.00 43.35  ? 235 ARG B C     1 
ATOM   1498 O O     . ARG D 4 3  ? -11.380 18.145 0.806   1.00 43.17  ? 235 ARG B O     1 
ATOM   1499 C CB    . ARG D 4 3  ? -10.690 18.655 -2.170  1.00 47.16  ? 235 ARG B CB    1 
ATOM   1500 C CG    . ARG D 4 3  ? -9.436  17.797 -2.102  1.00 51.27  ? 235 ARG B CG    1 
ATOM   1501 C CD    . ARG D 4 3  ? -8.279  18.365 -2.909  1.00 56.61  ? 235 ARG B CD    1 
ATOM   1502 N NE    . ARG D 4 3  ? -8.323  17.908 -4.294  1.00 61.12  ? 235 ARG B NE    1 
ATOM   1503 C CZ    . ARG D 4 3  ? -7.317  18.019 -5.159  1.00 63.38  ? 235 ARG B CZ    1 
ATOM   1504 N NH1   . ARG D 4 3  ? -6.165  18.574 -4.790  1.00 64.73  ? 235 ARG B NH1   1 
ATOM   1505 N NH2   . ARG D 4 3  ? -7.468  17.577 -6.402  1.00 64.67  ? 235 ARG B NH2   1 
ATOM   1506 N N     . LYS D 4 4  ? -11.236 16.107 -0.121  1.00 42.01  ? 236 LYS B N     1 
ATOM   1507 C CA    . LYS D 4 4  ? -10.816 15.436 1.108   1.00 42.25  ? 236 LYS B CA    1 
ATOM   1508 C C     . LYS D 4 4  ? -9.302  15.275 1.182   1.00 41.35  ? 236 LYS B C     1 
ATOM   1509 O O     . LYS D 4 4  ? -8.615  15.113 0.165   1.00 39.65  ? 236 LYS B O     1 
ATOM   1510 C CB    . LYS D 4 4  ? -11.433 14.042 1.189   1.00 42.87  ? 236 LYS B CB    1 
ATOM   1511 C CG    . LYS D 4 4  ? -12.906 14.004 1.549   1.00 45.40  ? 236 LYS B CG    1 
ATOM   1512 C CD    . LYS D 4 4  ? -13.424 12.587 1.376   1.00 46.84  ? 236 LYS B CD    1 
ATOM   1513 C CE    . LYS D 4 4  ? -14.642 12.281 2.244   1.00 49.15  ? 236 LYS B CE    1 
ATOM   1514 N NZ    . LYS D 4 4  ? -15.838 13.044 1.865   1.00 50.63  ? 236 LYS B NZ    1 
ATOM   1515 N N     . ARG D 4 5  ? -8.769  15.317 2.396   1.00 39.43  ? 237 ARG B N     1 
ATOM   1516 C CA    . ARG D 4 5  ? -7.337  15.109 2.553   1.00 37.37  ? 237 ARG B CA    1 
ATOM   1517 C C     . ARG D 4 5  ? -7.084  13.652 2.191   1.00 37.74  ? 237 ARG B C     1 
ATOM   1518 O O     . ARG D 4 5  ? -7.962  12.807 2.380   1.00 37.80  ? 237 ARG B O     1 
ATOM   1519 C CB    . ARG D 4 5  ? -6.923  15.308 4.006   1.00 37.02  ? 237 ARG B CB    1 
ATOM   1520 C CG    . ARG D 4 5  ? -5.457  14.965 4.243   1.00 37.04  ? 237 ARG B CG    1 
ATOM   1521 C CD    . ARG D 4 5  ? -5.100  15.131 5.710   1.00 40.58  ? 237 ARG B CD    1 
ATOM   1522 N NE    . ARG D 4 5  ? -5.604  14.034 6.519   1.00 41.56  ? 237 ARG B NE    1 
ATOM   1523 C CZ    . ARG D 4 5  ? -5.143  12.794 6.489   1.00 43.02  ? 237 ARG B CZ    1 
ATOM   1524 N NH1   . ARG D 4 5  ? -4.146  12.441 5.684   1.00 42.45  ? 237 ARG B NH1   1 
ATOM   1525 N NH2   . ARG D 4 5  ? -5.674  11.898 7.308   1.00 46.89  ? 237 ARG B NH2   1 
ATOM   1526 N N     . ARG D 4 6  ? -5.908  13.340 1.659   1.00 38.19  ? 238 ARG B N     1 
ATOM   1527 C CA    . ARG D 4 6  ? -5.588  11.953 1.356   1.00 39.19  ? 238 ARG B CA    1 
ATOM   1528 C C     . ARG D 4 6  ? -4.109  11.717 1.563   1.00 38.84  ? 238 ARG B C     1 
ATOM   1529 O O     . ARG D 4 6  ? -3.305  12.648 1.428   1.00 38.31  ? 238 ARG B O     1 
ATOM   1530 C CB    . ARG D 4 6  ? -6.000  11.567 -0.077  1.00 43.17  ? 238 ARG B CB    1 
ATOM   1531 C CG    . ARG D 4 6  ? -7.523  11.487 -0.205  1.00 45.98  ? 238 ARG B CG    1 
ATOM   1532 C CD    . ARG D 4 6  ? -8.024  10.926 -1.496  1.00 49.32  ? 238 ARG B CD    1 
ATOM   1533 N NE    . ARG D 4 6  ? -9.418  11.313 -1.690  1.00 48.94  ? 238 ARG B NE    1 
ATOM   1534 C CZ    . ARG D 4 6  ? -10.450 10.867 -0.979  1.00 50.61  ? 238 ARG B CZ    1 
ATOM   1535 N NH1   . ARG D 4 6  ? -10.281 9.985  0.008   1.00 49.44  ? 238 ARG B NH1   1 
ATOM   1536 N NH2   . ARG D 4 6  ? -11.668 11.318 -1.256  1.00 48.97  ? 238 ARG B NH2   1 
ATOM   1537 N N     . ASN D 4 7  ? -3.766  10.487 1.942   1.00 36.44  ? 239 ASN B N     1 
ATOM   1538 C CA    . ASN D 4 7  ? -2.383  10.097 2.136   1.00 37.96  ? 239 ASN B CA    1 
ATOM   1539 C C     . ASN D 4 7  ? -1.797  10.049 0.733   1.00 39.12  ? 239 ASN B C     1 
ATOM   1540 O O     . ASN D 4 7  ? -2.470  9.615  -0.189  1.00 39.90  ? 239 ASN B O     1 
ATOM   1541 C CB    . ASN D 4 7  ? -2.276  8.687  2.734   1.00 37.32  ? 239 ASN B CB    1 
ATOM   1542 C CG    . ASN D 4 7  ? -2.671  8.626  4.201   1.00 38.18  ? 239 ASN B CG    1 
ATOM   1543 O OD1   . ASN D 4 7  ? -3.001  9.633  4.814   1.00 38.08  ? 239 ASN B OD1   1 
ATOM   1544 N ND2   . ASN D 4 7  ? -2.646  7.417  4.764   1.00 38.28  ? 239 ASN B ND2   1 
ATOM   1545 N N     . PHE D 4 8  ? -0.558  10.472 0.558   1.00 40.16  ? 240 PHE B N     1 
ATOM   1546 C CA    . PHE D 4 8  ? 0.035   10.427 -0.779  1.00 42.59  ? 240 PHE B CA    1 
ATOM   1547 C C     . PHE D 4 8  ? 0.327   8.972  -1.222  1.00 44.42  ? 240 PHE B C     1 
ATOM   1548 O O     . PHE D 4 8  ? 0.666   8.115  -0.409  1.00 42.59  ? 240 PHE B O     1 
ATOM   1549 C CB    . PHE D 4 8  ? 1.330   11.257 -0.831  1.00 40.83  ? 240 PHE B CB    1 
ATOM   1550 C CG    . PHE D 4 8  ? 1.143   12.733 -0.510  1.00 41.67  ? 240 PHE B CG    1 
ATOM   1551 C CD1   . PHE D 4 8  ? 0.025   13.429 -0.957  1.00 41.74  ? 240 PHE B CD1   1 
ATOM   1552 C CD2   . PHE D 4 8  ? 2.112   13.433 0.216   1.00 42.43  ? 240 PHE B CD2   1 
ATOM   1553 C CE1   . PHE D 4 8  ? -0.134  14.789 -0.695  1.00 40.78  ? 240 PHE B CE1   1 
ATOM   1554 C CE2   . PHE D 4 8  ? 1.957   14.808 0.485   1.00 40.91  ? 240 PHE B CE2   1 
ATOM   1555 C CZ    . PHE D 4 8  ? 0.829   15.479 0.025   1.00 41.39  ? 240 PHE B CZ    1 
ATOM   1556 N N     A ASN D 4 9  ? 0.176   8.703  -2.516  0.50 45.46  ? 241 ASN B N     1 
ATOM   1557 N N     B ASN D 4 9  ? 0.200   8.713  -2.520  0.50 45.77  ? 241 ASN B N     1 
ATOM   1558 C CA    A ASN D 4 9  ? 0.433   7.367  -3.046  0.50 47.16  ? 241 ASN B CA    1 
ATOM   1559 C CA    B ASN D 4 9  ? 0.457   7.384  -3.072  0.50 47.68  ? 241 ASN B CA    1 
ATOM   1560 C C     A ASN D 4 9  ? 1.904   7.004  -2.838  0.50 48.04  ? 241 ASN B C     1 
ATOM   1561 C C     B ASN D 4 9  ? 1.911   7.002  -2.807  0.50 48.39  ? 241 ASN B C     1 
ATOM   1562 O O     A ASN D 4 9  ? 2.742   7.876  -2.578  0.50 47.04  ? 241 ASN B O     1 
ATOM   1563 O O     B ASN D 4 9  ? 2.746   7.857  -2.488  0.50 47.42  ? 241 ASN B O     1 
ATOM   1564 C CB    A ASN D 4 9  ? 0.075   7.303  -4.540  0.50 47.71  ? 241 ASN B CB    1 
ATOM   1565 C CB    B ASN D 4 9  ? 0.239   7.380  -4.590  0.50 48.84  ? 241 ASN B CB    1 
ATOM   1566 C CG    A ASN D 4 9  ? 0.939   8.219  -5.392  0.50 47.68  ? 241 ASN B CG    1 
ATOM   1567 C CG    B ASN D 4 9  ? -0.919  8.252  -5.020  0.50 49.34  ? 241 ASN B CG    1 
ATOM   1568 O OD1   A ASN D 4 9  ? 2.150   8.059  -5.456  0.50 48.21  ? 241 ASN B OD1   1 
ATOM   1569 O OD1   B ASN D 4 9  ? -0.987  8.680  -6.170  0.50 50.20  ? 241 ASN B OD1   1 
ATOM   1570 N ND2   A ASN D 4 9  ? 0.314   9.182  -6.049  0.50 48.87  ? 241 ASN B ND2   1 
ATOM   1571 N ND2   B ASN D 4 9  ? -1.843  8.513  -4.103  0.50 50.73  ? 241 ASN B ND2   1 
ATOM   1572 N N     . LYS D 4 10 ? 2.204   5.712  -2.957  1.00 48.53  ? 242 LYS B N     1 
ATOM   1573 C CA    . LYS D 4 10 ? 3.554   5.186  -2.775  1.00 50.12  ? 242 LYS B CA    1 
ATOM   1574 C C     . LYS D 4 10 ? 4.575   5.874  -3.701  1.00 50.22  ? 242 LYS B C     1 
ATOM   1575 O O     . LYS D 4 10 ? 5.735   6.063  -3.337  1.00 49.16  ? 242 LYS B O     1 
ATOM   1576 C CB    . LYS D 4 10 ? 3.546   3.675  -3.052  1.00 51.85  ? 242 LYS B CB    1 
ATOM   1577 C CG    . LYS D 4 10 ? 4.894   2.977  -2.905  1.00 55.30  ? 242 LYS B CG    1 
ATOM   1578 C CD    . LYS D 4 10 ? 5.184   2.630  -1.444  1.00 57.01  ? 242 LYS B CD    1 
ATOM   1579 C CE    . LYS D 4 10 ? 6.403   1.717  -1.300  1.00 58.64  ? 242 LYS B CE    1 
ATOM   1580 N NZ    . LYS D 4 10 ? 7.635   2.310  -1.915  1.00 57.50  ? 242 LYS B NZ    1 
ATOM   1581 N N     . GLN D 4 11 ? 4.136   6.253  -4.893  1.00 51.05  ? 243 GLN B N     1 
ATOM   1582 C CA    . GLN D 4 11 ? 5.028   6.895  -5.848  1.00 52.75  ? 243 GLN B CA    1 
ATOM   1583 C C     . GLN D 4 11 ? 5.537   8.240  -5.337  1.00 51.39  ? 243 GLN B C     1 
ATOM   1584 O O     . GLN D 4 11 ? 6.743   8.494  -5.312  1.00 50.61  ? 243 GLN B O     1 
ATOM   1585 C CB    . GLN D 4 11 ? 4.314   7.098  -7.191  1.00 55.52  ? 243 GLN B CB    1 
ATOM   1586 C CG    . GLN D 4 11 ? 4.080   5.804  -7.988  1.00 60.92  ? 243 GLN B CG    1 
ATOM   1587 C CD    . GLN D 4 11 ? 2.926   4.958  -7.465  1.00 63.17  ? 243 GLN B CD    1 
ATOM   1588 O OE1   . GLN D 4 11 ? 2.777   3.795  -7.854  1.00 65.29  ? 243 GLN B OE1   1 
ATOM   1589 N NE2   . GLN D 4 11 ? 2.098   5.538  -6.596  1.00 64.68  ? 243 GLN B NE2   1 
ATOM   1590 N N     . ALA D 4 12 ? 4.604   9.095  -4.934  1.00 50.16  ? 244 ALA B N     1 
ATOM   1591 C CA    . ALA D 4 12 ? 4.946   10.423 -4.447  1.00 47.93  ? 244 ALA B CA    1 
ATOM   1592 C C     . ALA D 4 12 ? 5.834   10.354 -3.218  1.00 46.98  ? 244 ALA B C     1 
ATOM   1593 O O     . ALA D 4 12 ? 6.821   11.082 -3.111  1.00 47.58  ? 244 ALA B O     1 
ATOM   1594 C CB    . ALA D 4 12 ? 3.681   11.196 -4.141  1.00 47.96  ? 244 ALA B CB    1 
ATOM   1595 N N     . THR D 4 13 ? 5.479   9.475  -2.289  1.00 45.74  ? 245 THR B N     1 
ATOM   1596 C CA    . THR D 4 13 ? 6.239   9.315  -1.067  1.00 44.19  ? 245 THR B CA    1 
ATOM   1597 C C     . THR D 4 13 ? 7.659   8.860  -1.340  1.00 45.25  ? 245 THR B C     1 
ATOM   1598 O O     . THR D 4 13 ? 8.591   9.298  -0.667  1.00 44.13  ? 245 THR B O     1 
ATOM   1599 C CB    . THR D 4 13 ? 5.539   8.326  -0.124  1.00 43.11  ? 245 THR B CB    1 
ATOM   1600 O OG1   . THR D 4 13 ? 4.287   8.889  0.282   1.00 44.43  ? 245 THR B OG1   1 
ATOM   1601 C CG2   . THR D 4 13 ? 6.382   8.056  1.102   1.00 41.00  ? 245 THR B CG2   1 
ATOM   1602 N N     . GLU D 4 14 ? 7.839   7.980  -2.327  1.00 45.86  ? 246 GLU B N     1 
ATOM   1603 C CA    . GLU D 4 14 ? 9.182   7.504  -2.665  1.00 45.52  ? 246 GLU B CA    1 
ATOM   1604 C C     . GLU D 4 14 ? 10.039  8.663  -3.199  1.00 44.95  ? 246 GLU B C     1 
ATOM   1605 O O     . GLU D 4 14 ? 11.208  8.779  -2.857  1.00 45.01  ? 246 GLU B O     1 
ATOM   1606 C CB    . GLU D 4 14 ? 9.105   6.368  -3.726  1.00 45.63  ? 246 GLU B CB    1 
ATOM   1607 N N     . ILE D 4 15 ? 9.453   9.497  -4.053  1.00 45.23  ? 247 ILE B N     1 
ATOM   1608 C CA    . ILE D 4 15 ? 10.160  10.643 -4.626  1.00 45.76  ? 247 ILE B CA    1 
ATOM   1609 C C     . ILE D 4 15 ? 10.575  11.618 -3.504  1.00 45.50  ? 247 ILE B C     1 
ATOM   1610 O O     . ILE D 4 15 ? 11.717  12.067 -3.445  1.00 44.27  ? 247 ILE B O     1 
ATOM   1611 C CB    . ILE D 4 15 ? 9.264   11.411 -5.616  1.00 47.21  ? 247 ILE B CB    1 
ATOM   1612 C CG1   . ILE D 4 15 ? 8.915   10.527 -6.819  1.00 48.29  ? 247 ILE B CG1   1 
ATOM   1613 C CG2   . ILE D 4 15 ? 9.968   12.674 -6.081  1.00 47.71  ? 247 ILE B CG2   1 
ATOM   1614 C CD1   . ILE D 4 15 ? 10.113  10.182 -7.671  1.00 52.30  ? 247 ILE B CD1   1 
ATOM   1615 N N     . LEU D 4 16 ? 9.634   11.924 -2.613  1.00 43.77  ? 248 LEU B N     1 
ATOM   1616 C CA    . LEU D 4 16 ? 9.904   12.853 -1.523  1.00 42.72  ? 248 LEU B CA    1 
ATOM   1617 C C     . LEU D 4 16 ? 10.953  12.299 -0.574  1.00 42.37  ? 248 LEU B C     1 
ATOM   1618 O O     . LEU D 4 16 ? 11.881  13.012 -0.188  1.00 41.78  ? 248 LEU B O     1 
ATOM   1619 C CB    . LEU D 4 16 ? 8.614   13.167 -0.771  1.00 41.79  ? 248 LEU B CB    1 
ATOM   1620 C CG    . LEU D 4 16 ? 7.538   13.858 -1.604  1.00 42.31  ? 248 LEU B CG    1 
ATOM   1621 C CD1   . LEU D 4 16 ? 6.177   13.732 -0.907  1.00 43.12  ? 248 LEU B CD1   1 
ATOM   1622 C CD2   . LEU D 4 16 ? 7.898   15.317 -1.807  1.00 43.48  ? 248 LEU B CD2   1 
ATOM   1623 N N     . ASN D 4 17 ? 10.817  11.028 -0.198  1.00 42.10  ? 249 ASN B N     1 
ATOM   1624 C CA    . ASN D 4 17 ? 11.795  10.414 0.692   1.00 42.42  ? 249 ASN B CA    1 
ATOM   1625 C C     . ASN D 4 17 ? 13.171  10.371 0.002   1.00 43.05  ? 249 ASN B C     1 
ATOM   1626 O O     . ASN D 4 17 ? 14.186  10.589 0.644   1.00 41.98  ? 249 ASN B O     1 
ATOM   1627 C CB    . ASN D 4 17 ? 11.359  8.999  1.090   1.00 43.56  ? 249 ASN B CB    1 
ATOM   1628 C CG    . ASN D 4 17 ? 10.344  8.983  2.251   1.00 45.44  ? 249 ASN B CG    1 
ATOM   1629 O OD1   . ASN D 4 17 ? 9.533   8.058  2.369   1.00 46.46  ? 249 ASN B OD1   1 
ATOM   1630 N ND2   . ASN D 4 17 ? 10.413  9.975  3.117   1.00 43.75  ? 249 ASN B ND2   1 
ATOM   1631 N N     . GLU D 4 18 ? 13.196  10.088 -1.300  1.00 42.32  ? 250 GLU B N     1 
ATOM   1632 C CA    . GLU D 4 18 ? 14.465  10.036 -2.031  1.00 44.27  ? 250 GLU B CA    1 
ATOM   1633 C C     . GLU D 4 18 ? 15.206  11.358 -1.876  1.00 43.14  ? 250 GLU B C     1 
ATOM   1634 O O     . GLU D 4 18 ? 16.373  11.380 -1.483  1.00 44.60  ? 250 GLU B O     1 
ATOM   1635 C CB    . GLU D 4 18 ? 14.217  9.732  -3.520  1.00 43.89  ? 250 GLU B CB    1 
ATOM   1636 N N     . TYR D 4 19 ? 14.515  12.459 -2.153  1.00 42.83  ? 251 TYR B N     1 
ATOM   1637 C CA    . TYR D 4 19 ? 15.101  13.795 -2.051  1.00 41.56  ? 251 TYR B CA    1 
ATOM   1638 C C     . TYR D 4 19 ? 15.509  14.080 -0.612  1.00 41.77  ? 251 TYR B C     1 
ATOM   1639 O O     . TYR D 4 19 ? 16.642  14.461 -0.342  1.00 41.07  ? 251 TYR B O     1 
ATOM   1640 C CB    . TYR D 4 19 ? 14.098  14.855 -2.537  1.00 40.79  ? 251 TYR B CB    1 
ATOM   1641 C CG    . TYR D 4 19 ? 14.669  16.261 -2.582  1.00 42.10  ? 251 TYR B CG    1 
ATOM   1642 C CD1   . TYR D 4 19 ? 14.926  16.979 -1.404  1.00 40.48  ? 251 TYR B CD1   1 
ATOM   1643 C CD2   . TYR D 4 19 ? 14.998  16.856 -3.804  1.00 41.13  ? 251 TYR B CD2   1 
ATOM   1644 C CE1   . TYR D 4 19 ? 15.502  18.260 -1.444  1.00 40.59  ? 251 TYR B CE1   1 
ATOM   1645 C CE2   . TYR D 4 19 ? 15.575  18.131 -3.864  1.00 41.15  ? 251 TYR B CE2   1 
ATOM   1646 C CZ    . TYR D 4 19 ? 15.827  18.828 -2.685  1.00 41.03  ? 251 TYR B CZ    1 
ATOM   1647 O OH    . TYR D 4 19 ? 16.402  20.074 -2.767  1.00 35.92  ? 251 TYR B OH    1 
ATOM   1648 N N     . PHE D 4 20 ? 14.583  13.872 0.314   1.00 40.44  ? 252 PHE B N     1 
ATOM   1649 C CA    . PHE D 4 20 ? 14.855  14.120 1.715   1.00 40.93  ? 252 PHE B CA    1 
ATOM   1650 C C     . PHE D 4 20 ? 16.147  13.443 2.157   1.00 40.93  ? 252 PHE B C     1 
ATOM   1651 O O     . PHE D 4 20 ? 17.078  14.099 2.635   1.00 40.76  ? 252 PHE B O     1 
ATOM   1652 C CB    . PHE D 4 20 ? 13.687  13.603 2.561   1.00 41.58  ? 252 PHE B CB    1 
ATOM   1653 C CG    . PHE D 4 20 ? 13.838  13.862 4.017   1.00 43.30  ? 252 PHE B CG    1 
ATOM   1654 C CD1   . PHE D 4 20 ? 13.580  15.122 4.543   1.00 43.12  ? 252 PHE B CD1   1 
ATOM   1655 C CD2   . PHE D 4 20 ? 14.237  12.846 4.880   1.00 44.21  ? 252 PHE B CD2   1 
ATOM   1656 C CE1   . PHE D 4 20 ? 13.721  15.359 5.913   1.00 42.48  ? 252 PHE B CE1   1 
ATOM   1657 C CE2   . PHE D 4 20 ? 14.375  13.081 6.243   1.00 44.08  ? 252 PHE B CE2   1 
ATOM   1658 C CZ    . PHE D 4 20 ? 14.117  14.341 6.759   1.00 40.81  ? 252 PHE B CZ    1 
ATOM   1659 N N     . TYR D 4 21 ? 16.222  12.132 1.990   1.00 41.75  ? 253 TYR B N     1 
ATOM   1660 C CA    . TYR D 4 21 ? 17.420  11.422 2.415   1.00 44.15  ? 253 TYR B CA    1 
ATOM   1661 C C     . TYR D 4 21 ? 18.703  11.763 1.655   1.00 44.45  ? 253 TYR B C     1 
ATOM   1662 O O     . TYR D 4 21 ? 19.780  11.740 2.247   1.00 44.95  ? 253 TYR B O     1 
ATOM   1663 C CB    . TYR D 4 21 ? 17.149  9.923  2.411   1.00 45.00  ? 253 TYR B CB    1 
ATOM   1664 C CG    . TYR D 4 21 ? 16.233  9.567  3.554   1.00 46.83  ? 253 TYR B CG    1 
ATOM   1665 C CD1   . TYR D 4 21 ? 16.672  9.658  4.873   1.00 46.62  ? 253 TYR B CD1   1 
ATOM   1666 C CD2   . TYR D 4 21 ? 14.913  9.208  3.322   1.00 47.33  ? 253 TYR B CD2   1 
ATOM   1667 C CE1   . TYR D 4 21 ? 15.808  9.397  5.938   1.00 47.89  ? 253 TYR B CE1   1 
ATOM   1668 C CE2   . TYR D 4 21 ? 14.038  8.948  4.384   1.00 48.19  ? 253 TYR B CE2   1 
ATOM   1669 C CZ    . TYR D 4 21 ? 14.495  9.046  5.683   1.00 48.24  ? 253 TYR B CZ    1 
ATOM   1670 O OH    . TYR D 4 21 ? 13.626  8.783  6.723   1.00 49.89  ? 253 TYR B OH    1 
ATOM   1671 N N     . SER D 4 22 ? 18.603  12.112 0.372   1.00 45.14  ? 254 SER B N     1 
ATOM   1672 C CA    . SER D 4 22 ? 19.816  12.473 -0.365  1.00 46.22  ? 254 SER B CA    1 
ATOM   1673 C C     . SER D 4 22 ? 20.310  13.863 0.064   1.00 46.76  ? 254 SER B C     1 
ATOM   1674 O O     . SER D 4 22 ? 21.443  14.240 -0.219  1.00 45.84  ? 254 SER B O     1 
ATOM   1675 C CB    . SER D 4 22 ? 19.589  12.442 -1.876  1.00 45.68  ? 254 SER B CB    1 
ATOM   1676 O OG    . SER D 4 22 ? 18.532  13.293 -2.262  1.00 47.58  ? 254 SER B OG    1 
ATOM   1677 N N     . HIS D 4 23 ? 19.463  14.626 0.749   1.00 46.64  ? 255 HIS B N     1 
ATOM   1678 C CA    . HIS D 4 23 ? 19.868  15.948 1.234   1.00 46.88  ? 255 HIS B CA    1 
ATOM   1679 C C     . HIS D 4 23 ? 19.748  15.976 2.761   1.00 46.24  ? 255 HIS B C     1 
ATOM   1680 O O     . HIS D 4 23 ? 19.510  17.030 3.360   1.00 44.64  ? 255 HIS B O     1 
ATOM   1681 C CB    . HIS D 4 23 ? 18.961  17.028 0.647   1.00 46.36  ? 255 HIS B CB    1 
ATOM   1682 C CG    . HIS D 4 23 ? 19.052  17.159 -0.838  1.00 47.03  ? 255 HIS B CG    1 
ATOM   1683 N ND1   . HIS D 4 23 ? 18.438  16.279 -1.704  1.00 47.81  ? 255 HIS B ND1   1 
ATOM   1684 C CD2   . HIS D 4 23 ? 19.687  18.069 -1.613  1.00 48.62  ? 255 HIS B CD2   1 
ATOM   1685 C CE1   . HIS D 4 23 ? 18.693  16.643 -2.949  1.00 48.48  ? 255 HIS B CE1   1 
ATOM   1686 N NE2   . HIS D 4 23 ? 19.448  17.728 -2.923  1.00 46.93  ? 255 HIS B NE2   1 
ATOM   1687 N N     . LEU D 4 24 ? 19.941  14.829 3.399   1.00 46.95  ? 256 LEU B N     1 
ATOM   1688 C CA    . LEU D 4 24 ? 19.748  14.770 4.844   1.00 48.50  ? 256 LEU B CA    1 
ATOM   1689 C C     . LEU D 4 24 ? 20.515  15.758 5.702   1.00 49.76  ? 256 LEU B C     1 
ATOM   1690 O O     . LEU D 4 24 ? 20.037  16.118 6.771   1.00 49.82  ? 256 LEU B O     1 
ATOM   1691 C CB    . LEU D 4 24 ? 19.983  13.357 5.370   1.00 48.95  ? 256 LEU B CB    1 
ATOM   1692 C CG    . LEU D 4 24 ? 19.540  13.127 6.823   1.00 50.09  ? 256 LEU B CG    1 
ATOM   1693 C CD1   . LEU D 4 24 ? 18.017  13.189 6.912   1.00 49.41  ? 256 LEU B CD1   1 
ATOM   1694 C CD2   . LEU D 4 24 ? 20.014  11.769 7.290   1.00 51.14  ? 256 LEU B CD2   1 
ATOM   1695 N N     . SER D 4 25 ? 21.690  16.213 5.278   1.00 49.89  ? 257 SER B N     1 
ATOM   1696 C CA    . SER D 4 25 ? 22.413  17.166 6.121   1.00 49.90  ? 257 SER B CA    1 
ATOM   1697 C C     . SER D 4 25 ? 21.786  18.577 6.068   1.00 48.85  ? 257 SER B C     1 
ATOM   1698 O O     . SER D 4 25 ? 22.160  19.462 6.844   1.00 48.37  ? 257 SER B O     1 
ATOM   1699 C CB    . SER D 4 25 ? 23.894  17.225 5.726   1.00 51.05  ? 257 SER B CB    1 
ATOM   1700 O OG    . SER D 4 25 ? 24.057  17.875 4.480   1.00 51.27  ? 257 SER B OG    1 
ATOM   1701 N N     . ASN D 4 26 ? 20.823  18.774 5.165   1.00 47.64  ? 258 ASN B N     1 
ATOM   1702 C CA    . ASN D 4 26 ? 20.137  20.070 5.009   1.00 45.20  ? 258 ASN B CA    1 
ATOM   1703 C C     . ASN D 4 26 ? 18.974  19.882 4.030   1.00 42.87  ? 258 ASN B C     1 
ATOM   1704 O O     . ASN D 4 26 ? 19.020  20.329 2.866   1.00 39.35  ? 258 ASN B O     1 
ATOM   1705 C CB    . ASN D 4 26 ? 21.128  21.102 4.476   1.00 48.67  ? 258 ASN B CB    1 
ATOM   1706 C CG    . ASN D 4 26 ? 20.772  22.512 4.884   1.00 52.22  ? 258 ASN B CG    1 
ATOM   1707 O OD1   . ASN D 4 26 ? 20.387  23.328 4.045   1.00 52.95  ? 258 ASN B OD1   1 
ATOM   1708 N ND2   . ASN D 4 26 ? 20.900  22.812 6.188   1.00 54.46  ? 258 ASN B ND2   1 
ATOM   1709 N N     . PRO D 4 27 ? 17.905  19.217 4.486   1.00 40.12  ? 259 PRO B N     1 
ATOM   1710 C CA    . PRO D 4 27 ? 16.767  18.987 3.600   1.00 37.36  ? 259 PRO B CA    1 
ATOM   1711 C C     . PRO D 4 27 ? 15.811  20.178 3.451   1.00 35.36  ? 259 PRO B C     1 
ATOM   1712 O O     . PRO D 4 27 ? 14.662  20.147 3.904   1.00 34.60  ? 259 PRO B O     1 
ATOM   1713 C CB    . PRO D 4 27 ? 16.126  17.754 4.210   1.00 38.73  ? 259 PRO B CB    1 
ATOM   1714 C CG    . PRO D 4 27 ? 16.338  17.993 5.711   1.00 41.03  ? 259 PRO B CG    1 
ATOM   1715 C CD    . PRO D 4 27 ? 17.746  18.519 5.779   1.00 40.97  ? 259 PRO B CD    1 
ATOM   1716 N N     . TYR D 4 28 ? 16.298  21.214 2.780   1.00 33.37  ? 260 TYR B N     1 
ATOM   1717 C CA    . TYR D 4 28 ? 15.548  22.432 2.537   1.00 32.27  ? 260 TYR B CA    1 
ATOM   1718 C C     . TYR D 4 28 ? 15.449  22.799 1.058   1.00 34.13  ? 260 TYR B C     1 
ATOM   1719 O O     . TYR D 4 28 ? 16.112  23.725 0.577   1.00 31.13  ? 260 TYR B O     1 
ATOM   1720 C CB    . TYR D 4 28 ? 16.174  23.590 3.306   1.00 34.01  ? 260 TYR B CB    1 
ATOM   1721 C CG    . TYR D 4 28 ? 16.042  23.408 4.815   1.00 33.93  ? 260 TYR B CG    1 
ATOM   1722 C CD1   . TYR D 4 28 ? 17.036  22.785 5.549   1.00 34.56  ? 260 TYR B CD1   1 
ATOM   1723 C CD2   . TYR D 4 28 ? 14.890  23.825 5.482   1.00 33.92  ? 260 TYR B CD2   1 
ATOM   1724 C CE1   . TYR D 4 28 ? 16.896  22.579 6.944   1.00 36.06  ? 260 TYR B CE1   1 
ATOM   1725 C CE2   . TYR D 4 28 ? 14.725  23.631 6.856   1.00 34.29  ? 260 TYR B CE2   1 
ATOM   1726 C CZ    . TYR D 4 28 ? 15.726  23.013 7.585   1.00 34.80  ? 260 TYR B CZ    1 
ATOM   1727 O OH    . TYR D 4 28 ? 15.577  22.826 8.948   1.00 34.52  ? 260 TYR B OH    1 
ATOM   1728 N N     . PRO D 4 29 ? 14.584  22.096 0.319   1.00 35.20  ? 261 PRO B N     1 
ATOM   1729 C CA    . PRO D 4 29 ? 14.465  22.427 -1.108  1.00 34.26  ? 261 PRO B CA    1 
ATOM   1730 C C     . PRO D 4 29 ? 14.132  23.892 -1.375  1.00 35.31  ? 261 PRO B C     1 
ATOM   1731 O O     . PRO D 4 29 ? 13.321  24.513 -0.670  1.00 32.85  ? 261 PRO B O     1 
ATOM   1732 C CB    . PRO D 4 29 ? 13.358  21.500 -1.597  1.00 36.13  ? 261 PRO B CB    1 
ATOM   1733 C CG    . PRO D 4 29 ? 12.510  21.247 -0.327  1.00 35.47  ? 261 PRO B CG    1 
ATOM   1734 C CD    . PRO D 4 29 ? 13.584  21.101 0.746   1.00 34.63  ? 261 PRO B CD    1 
ATOM   1735 N N     . SER D 4 30 ? 14.761  24.451 -2.405  1.00 34.15  ? 262 SER B N     1 
ATOM   1736 C CA    . SER D 4 30 ? 14.517  25.830 -2.804  1.00 35.62  ? 262 SER B CA    1 
ATOM   1737 C C     . SER D 4 30 ? 13.132  25.856 -3.435  1.00 36.57  ? 262 SER B C     1 
ATOM   1738 O O     . SER D 4 30 ? 12.572  24.806 -3.729  1.00 37.18  ? 262 SER B O     1 
ATOM   1739 C CB    . SER D 4 30 ? 15.522  26.251 -3.872  1.00 37.09  ? 262 SER B CB    1 
ATOM   1740 O OG    . SER D 4 30 ? 15.334  25.390 -4.987  1.00 38.05  ? 262 SER B OG    1 
ATOM   1741 N N     . GLU D 4 31 ? 12.591  27.043 -3.669  1.00 36.71  ? 263 GLU B N     1 
ATOM   1742 C CA    . GLU D 4 31 ? 11.272  27.130 -4.260  1.00 38.46  ? 263 GLU B CA    1 
ATOM   1743 C C     . GLU D 4 31 ? 11.250  26.399 -5.606  1.00 40.82  ? 263 GLU B C     1 
ATOM   1744 O O     . GLU D 4 31 ? 10.328  25.635 -5.877  1.00 40.33  ? 263 GLU B O     1 
ATOM   1745 C CB    . GLU D 4 31 ? 10.870  28.582 -4.415  1.00 39.32  ? 263 GLU B CB    1 
ATOM   1746 N N     . GLU D 4 32 ? 12.281  26.597 -6.430  1.00 40.96  ? 264 GLU B N     1 
ATOM   1747 C CA    . GLU D 4 32 ? 12.337  25.940 -7.732  1.00 42.63  ? 264 GLU B CA    1 
ATOM   1748 C C     . GLU D 4 32 ? 12.369  24.426 -7.574  1.00 40.29  ? 264 GLU B C     1 
ATOM   1749 O O     . GLU D 4 32 ? 11.736  23.705 -8.345  1.00 40.00  ? 264 GLU B O     1 
ATOM   1750 C CB    . GLU D 4 32 ? 13.552  26.428 -8.527  1.00 46.19  ? 264 GLU B CB    1 
ATOM   1751 C CG    . GLU D 4 32 ? 13.765  27.924 -8.416  1.00 52.73  ? 264 GLU B CG    1 
ATOM   1752 C CD    . GLU D 4 32 ? 14.480  28.317 -7.119  1.00 56.43  ? 264 GLU B CD    1 
ATOM   1753 O OE1   . GLU D 4 32 ? 15.686  27.992 -6.974  1.00 59.22  ? 264 GLU B OE1   1 
ATOM   1754 O OE2   . GLU D 4 32 ? 13.844  28.944 -6.245  1.00 57.74  ? 264 GLU B OE2   1 
ATOM   1755 N N     . ALA D 4 33 ? 13.086  23.939 -6.565  1.00 36.87  ? 265 ALA B N     1 
ATOM   1756 C CA    . ALA D 4 33 ? 13.159  22.508 -6.290  1.00 34.67  ? 265 ALA B CA    1 
ATOM   1757 C C     . ALA D 4 33 ? 11.801  21.982 -5.762  1.00 34.48  ? 265 ALA B C     1 
ATOM   1758 O O     . ALA D 4 33 ? 11.444  20.830 -5.992  1.00 33.72  ? 265 ALA B O     1 
ATOM   1759 C CB    . ALA D 4 33 ? 14.264  22.224 -5.252  1.00 35.12  ? 265 ALA B CB    1 
ATOM   1760 N N     . LYS D 4 34 ? 11.044  22.819 -5.063  1.00 34.30  ? 266 LYS B N     1 
ATOM   1761 C CA    . LYS D 4 34 ? 9.747   22.369 -4.563  1.00 35.53  ? 266 LYS B CA    1 
ATOM   1762 C C     . LYS D 4 34 ? 8.781   22.275 -5.760  1.00 37.26  ? 266 LYS B C     1 
ATOM   1763 O O     . LYS D 4 34 ? 7.965   21.366 -5.832  1.00 35.41  ? 266 LYS B O     1 
ATOM   1764 C CB    . LYS D 4 34 ? 9.196   23.335 -3.528  1.00 32.72  ? 266 LYS B CB    1 
ATOM   1765 C CG    . LYS D 4 34 ? 9.973   23.350 -2.197  1.00 32.75  ? 266 LYS B CG    1 
ATOM   1766 C CD    . LYS D 4 34 ? 9.295   24.331 -1.259  1.00 31.03  ? 266 LYS B CD    1 
ATOM   1767 C CE    . LYS D 4 34 ? 9.940   24.410 0.118   1.00 34.37  ? 266 LYS B CE    1 
ATOM   1768 N NZ    . LYS D 4 34 ? 9.190   25.432 0.875   1.00 31.86  ? 266 LYS B NZ    1 
ATOM   1769 N N     . GLU D 4 35 ? 8.909   23.180 -6.720  1.00 39.81  ? 267 GLU B N     1 
ATOM   1770 C CA    . GLU D 4 35 ? 8.018   23.120 -7.883  1.00 43.93  ? 267 GLU B CA    1 
ATOM   1771 C C     . GLU D 4 35 ? 8.212   21.834 -8.693  1.00 44.88  ? 267 GLU B C     1 
ATOM   1772 O O     . GLU D 4 35 ? 7.232   21.216 -9.146  1.00 44.14  ? 267 GLU B O     1 
ATOM   1773 C CB    . GLU D 4 35 ? 8.226   24.345 -8.766  1.00 46.28  ? 267 GLU B CB    1 
ATOM   1774 C CG    . GLU D 4 35 ? 7.507   25.567 -8.246  1.00 53.77  ? 267 GLU B CG    1 
ATOM   1775 C CD    . GLU D 4 35 ? 8.072   26.865 -8.813  1.00 58.66  ? 267 GLU B CD    1 
ATOM   1776 O OE1   . GLU D 4 35 ? 9.104   26.805 -9.528  1.00 59.57  ? 267 GLU B OE1   1 
ATOM   1777 O OE2   . GLU D 4 35 ? 7.491   27.947 -8.534  1.00 60.91  ? 267 GLU B OE2   1 
ATOM   1778 N N     . GLU D 4 36 ? 9.467   21.426 -8.876  1.00 45.39  ? 268 GLU B N     1 
ATOM   1779 C CA    . GLU D 4 36 ? 9.772   20.208 -9.634  1.00 46.33  ? 268 GLU B CA    1 
ATOM   1780 C C     . GLU D 4 36 ? 9.316   18.949 -8.890  1.00 45.99  ? 268 GLU B C     1 
ATOM   1781 O O     . GLU D 4 36 ? 8.837   17.992 -9.505  1.00 44.12  ? 268 GLU B O     1 
ATOM   1782 C CB    . GLU D 4 36 ? 11.270  20.116 -9.932  1.00 47.96  ? 268 GLU B CB    1 
ATOM   1783 C CG    . GLU D 4 36 ? 11.669  18.817 -10.642 1.00 53.25  ? 268 GLU B CG    1 
ATOM   1784 C CD    . GLU D 4 36 ? 10.975  18.640 -11.997 1.00 55.91  ? 268 GLU B CD    1 
ATOM   1785 O OE1   . GLU D 4 36 ? 10.945  17.496 -12.511 1.00 58.34  ? 268 GLU B OE1   1 
ATOM   1786 O OE2   . GLU D 4 36 ? 10.467  19.648 -12.554 1.00 58.58  ? 268 GLU B OE2   1 
ATOM   1787 N N     . LEU D 4 37 ? 9.478   18.931 -7.571  1.00 43.76  ? 269 LEU B N     1 
ATOM   1788 C CA    . LEU D 4 37 ? 9.024   17.774 -6.817  1.00 45.07  ? 269 LEU B CA    1 
ATOM   1789 C C     . LEU D 4 37 ? 7.505   17.766 -6.909  1.00 45.53  ? 269 LEU B C     1 
ATOM   1790 O O     . LEU D 4 37 ? 6.893   16.721 -7.131  1.00 46.27  ? 269 LEU B O     1 
ATOM   1791 C CB    . LEU D 4 37 ? 9.481   17.841 -5.348  1.00 43.92  ? 269 LEU B CB    1 
ATOM   1792 C CG    . LEU D 4 37 ? 10.973  17.568 -5.103  1.00 46.61  ? 269 LEU B CG    1 
ATOM   1793 C CD1   . LEU D 4 37 ? 11.415  18.081 -3.732  1.00 46.89  ? 269 LEU B CD1   1 
ATOM   1794 C CD2   . LEU D 4 37 ? 11.246  16.083 -5.231  1.00 47.12  ? 269 LEU B CD2   1 
ATOM   1795 N N     . ALA D 4 38 ? 6.895   18.935 -6.766  1.00 45.24  ? 270 ALA B N     1 
ATOM   1796 C CA    . ALA D 4 38 ? 5.450   19.027 -6.833  1.00 47.66  ? 270 ALA B CA    1 
ATOM   1797 C C     . ALA D 4 38 ? 4.983   18.444 -8.161  1.00 49.47  ? 270 ALA B C     1 
ATOM   1798 O O     . ALA D 4 38 ? 3.962   17.768 -8.226  1.00 49.01  ? 270 ALA B O     1 
ATOM   1799 C CB    . ALA D 4 38 ? 5.008   20.478 -6.711  1.00 47.98  ? 270 ALA B CB    1 
ATOM   1800 N N     . LYS D 4 39 ? 5.746   18.696 -9.218  1.00 50.80  ? 271 LYS B N     1 
ATOM   1801 C CA    . LYS D 4 39 ? 5.380   18.180 -10.529 1.00 52.31  ? 271 LYS B CA    1 
ATOM   1802 C C     . LYS D 4 39 ? 5.503   16.670 -10.607 1.00 51.61  ? 271 LYS B C     1 
ATOM   1803 O O     . LYS D 4 39 ? 4.572   15.993 -11.040 1.00 52.71  ? 271 LYS B O     1 
ATOM   1804 C CB    . LYS D 4 39 ? 6.241   18.815 -11.616 1.00 54.62  ? 271 LYS B CB    1 
ATOM   1805 C CG    . LYS D 4 39 ? 5.655   20.077 -12.225 1.00 57.02  ? 271 LYS B CG    1 
ATOM   1806 C CD    . LYS D 4 39 ? 6.129   20.195 -13.669 1.00 59.01  ? 271 LYS B CD    1 
ATOM   1807 C CE    . LYS D 4 39 ? 5.716   18.954 -14.461 1.00 59.76  ? 271 LYS B CE    1 
ATOM   1808 N NZ    . LYS D 4 39 ? 6.434   18.791 -15.770 1.00 59.39  ? 271 LYS B NZ    1 
ATOM   1809 N N     . LYS D 4 40 ? 6.642   16.134 -10.197 1.00 50.49  ? 272 LYS B N     1 
ATOM   1810 C CA    . LYS D 4 40 ? 6.832   14.696 -10.239 1.00 50.12  ? 272 LYS B CA    1 
ATOM   1811 C C     . LYS D 4 40 ? 5.825   13.951 -9.376  1.00 49.92  ? 272 LYS B C     1 
ATOM   1812 O O     . LYS D 4 40 ? 5.437   12.839 -9.698  1.00 50.12  ? 272 LYS B O     1 
ATOM   1813 C CB    . LYS D 4 40 ? 8.248   14.319 -9.794  1.00 51.24  ? 272 LYS B CB    1 
ATOM   1814 C CG    . LYS D 4 40 ? 9.333   14.757 -10.770 1.00 52.48  ? 272 LYS B CG    1 
ATOM   1815 C CD    . LYS D 4 40 ? 10.618  13.951 -10.588 1.00 53.76  ? 272 LYS B CD    1 
ATOM   1816 C CE    . LYS D 4 40 ? 11.364  14.343 -9.314  1.00 54.49  ? 272 LYS B CE    1 
ATOM   1817 N NZ    . LYS D 4 40 ? 12.562  13.477 -9.070  1.00 54.38  ? 272 LYS B NZ    1 
ATOM   1818 N N     . CYS D 4 41 ? 5.388   14.568 -8.286  1.00 48.08  ? 273 CYS B N     1 
ATOM   1819 C CA    . CYS D 4 41 ? 4.458   13.905 -7.378  1.00 48.16  ? 273 CYS B CA    1 
ATOM   1820 C C     . CYS D 4 41 ? 3.000   14.091 -7.662  1.00 47.82  ? 273 CYS B C     1 
ATOM   1821 O O     . CYS D 4 41 ? 2.178   13.344 -7.138  1.00 49.54  ? 273 CYS B O     1 
ATOM   1822 C CB    . CYS D 4 41 ? 4.710   14.364 -5.944  1.00 46.09  ? 273 CYS B CB    1 
ATOM   1823 S SG    . CYS D 4 41 ? 6.311   13.916 -5.376  1.00 46.38  ? 273 CYS B SG    1 
ATOM   1824 N N     . GLY D 4 42 ? 2.676   15.100 -8.461  1.00 48.26  ? 274 GLY B N     1 
ATOM   1825 C CA    . GLY D 4 42 ? 1.285   15.391 -8.761  1.00 48.16  ? 274 GLY B CA    1 
ATOM   1826 C C     . GLY D 4 42 ? 0.597   16.125 -7.614  1.00 46.98  ? 274 GLY B C     1 
ATOM   1827 O O     . GLY D 4 42 ? -0.623  16.047 -7.473  1.00 47.14  ? 274 GLY B O     1 
ATOM   1828 N N     . ILE D 4 43 ? 1.371   16.832 -6.791  1.00 44.88  ? 275 ILE B N     1 
ATOM   1829 C CA    . ILE D 4 43 ? 0.802   17.571 -5.662  1.00 43.45  ? 275 ILE B CA    1 
ATOM   1830 C C     . ILE D 4 43 ? 1.158   19.032 -5.786  1.00 42.31  ? 275 ILE B C     1 
ATOM   1831 O O     . ILE D 4 43 ? 1.797   19.415 -6.758  1.00 43.24  ? 275 ILE B O     1 
ATOM   1832 C CB    . ILE D 4 43 ? 1.317   17.021 -4.317  1.00 43.47  ? 275 ILE B CB    1 
ATOM   1833 C CG1   . ILE D 4 43 ? 2.837   17.160 -4.213  1.00 43.51  ? 275 ILE B CG1   1 
ATOM   1834 C CG2   . ILE D 4 43 ? 0.922   15.563 -4.189  1.00 44.31  ? 275 ILE B CG2   1 
ATOM   1835 C CD1   . ILE D 4 43 ? 3.436   16.508 -2.933  1.00 43.30  ? 275 ILE B CD1   1 
ATOM   1836 N N     . THR D 4 44 ? 0.767   19.858 -4.821  1.00 40.34  ? 276 THR B N     1 
ATOM   1837 C CA    . THR D 4 44 ? 1.079   21.278 -4.918  1.00 39.06  ? 276 THR B CA    1 
ATOM   1838 C C     . THR D 4 44 ? 2.357   21.657 -4.162  1.00 37.35  ? 276 THR B C     1 
ATOM   1839 O O     . THR D 4 44 ? 2.867   20.872 -3.392  1.00 37.52  ? 276 THR B O     1 
ATOM   1840 C CB    . THR D 4 44 ? -0.064  22.160 -4.380  1.00 39.06  ? 276 THR B CB    1 
ATOM   1841 O OG1   . THR D 4 44 ? -0.162  22.000 -2.958  1.00 39.28  ? 276 THR B OG1   1 
ATOM   1842 C CG2   . THR D 4 44 ? -1.376  21.794 -5.037  1.00 39.14  ? 276 THR B CG2   1 
ATOM   1843 N N     . VAL D 4 45 ? 2.878   22.853 -4.406  1.00 38.26  ? 277 VAL B N     1 
ATOM   1844 C CA    . VAL D 4 45 ? 4.091   23.284 -3.714  1.00 37.87  ? 277 VAL B CA    1 
ATOM   1845 C C     . VAL D 4 45 ? 3.790   23.449 -2.210  1.00 36.58  ? 277 VAL B C     1 
ATOM   1846 O O     . VAL D 4 45 ? 4.621   23.139 -1.377  1.00 35.69  ? 277 VAL B O     1 
ATOM   1847 C CB    . VAL D 4 45 ? 4.637   24.585 -4.345  1.00 40.03  ? 277 VAL B CB    1 
ATOM   1848 C CG1   . VAL D 4 45 ? 5.695   25.235 -3.437  1.00 37.86  ? 277 VAL B CG1   1 
ATOM   1849 C CG2   . VAL D 4 45 ? 5.249   24.246 -5.707  1.00 40.38  ? 277 VAL B CG2   1 
ATOM   1850 N N     . SER D 4 46 ? 2.597   23.912 -1.860  1.00 36.55  ? 278 SER B N     1 
ATOM   1851 C CA    . SER D 4 46 ? 2.254   24.017 -0.426  1.00 36.23  ? 278 SER B CA    1 
ATOM   1852 C C     . SER D 4 46 ? 2.332   22.628 0.197   1.00 35.07  ? 278 SER B C     1 
ATOM   1853 O O     . SER D 4 46 ? 2.785   22.452 1.342   1.00 34.89  ? 278 SER B O     1 
ATOM   1854 C CB    . SER D 4 46 ? 0.841   24.546 -0.228  1.00 36.52  ? 278 SER B CB    1 
ATOM   1855 O OG    . SER D 4 46 ? 0.807   25.922 -0.477  1.00 44.06  ? 278 SER B OG    1 
ATOM   1856 N N     . GLN D 4 47 ? 1.878   21.628 -0.552  1.00 33.87  ? 279 GLN B N     1 
ATOM   1857 C CA    . GLN D 4 47 ? 1.923   20.271 -0.044  1.00 33.64  ? 279 GLN B CA    1 
ATOM   1858 C C     . GLN D 4 47 ? 3.356   19.754 0.093   1.00 33.12  ? 279 GLN B C     1 
ATOM   1859 O O     . GLN D 4 47 ? 3.678   18.961 0.999   1.00 32.12  ? 279 GLN B O     1 
ATOM   1860 C CB    . GLN D 4 47 ? 1.070   19.345 -0.925  1.00 36.13  ? 279 GLN B CB    1 
ATOM   1861 C CG    . GLN D 4 47 ? -0.423  19.543 -0.655  1.00 37.93  ? 279 GLN B CG    1 
ATOM   1862 C CD    . GLN D 4 47 ? -1.302  18.666 -1.516  1.00 40.68  ? 279 GLN B CD    1 
ATOM   1863 O OE1   . GLN D 4 47 ? -2.290  18.104 -1.033  1.00 42.53  ? 279 GLN B OE1   1 
ATOM   1864 N NE2   . GLN D 4 47 ? -0.958  18.553 -2.801  1.00 37.00  ? 279 GLN B NE2   1 
ATOM   1865 N N     . VAL D 4 48 ? 4.231   20.160 -0.817  1.00 32.39  ? 280 VAL B N     1 
ATOM   1866 C CA    . VAL D 4 48 ? 5.615   19.751 -0.664  1.00 31.96  ? 280 VAL B CA    1 
ATOM   1867 C C     . VAL D 4 48 ? 6.179   20.460 0.594   1.00 29.66  ? 280 VAL B C     1 
ATOM   1868 O O     . VAL D 4 48 ? 6.896   19.851 1.374   1.00 30.06  ? 280 VAL B O     1 
ATOM   1869 C CB    . VAL D 4 48 ? 6.475   20.151 -1.889  1.00 33.58  ? 280 VAL B CB    1 
ATOM   1870 C CG1   . VAL D 4 48 ? 7.915   19.855 -1.610  1.00 33.05  ? 280 VAL B CG1   1 
ATOM   1871 C CG2   . VAL D 4 48 ? 5.988   19.377 -3.148  1.00 35.51  ? 280 VAL B CG2   1 
ATOM   1872 N N     . SER D 4 49 ? 5.837   21.728 0.793   1.00 29.89  ? 281 SER B N     1 
ATOM   1873 C CA    . SER D 4 49 ? 6.360   22.458 1.956   1.00 32.36  ? 281 SER B CA    1 
ATOM   1874 C C     . SER D 4 49 ? 5.873   21.801 3.254   1.00 30.85  ? 281 SER B C     1 
ATOM   1875 O O     . SER D 4 49 ? 6.655   21.637 4.209   1.00 28.00  ? 281 SER B O     1 
ATOM   1876 C CB    . SER D 4 49 ? 5.944   23.927 1.897   1.00 34.08  ? 281 SER B CB    1 
ATOM   1877 O OG    . SER D 4 49 ? 6.502   24.538 0.744   1.00 36.53  ? 281 SER B OG    1 
ATOM   1878 N N     . ASN D 4 50 ? 4.602   21.397 3.264   1.00 31.96  ? 282 ASN B N     1 
ATOM   1879 C CA    . ASN D 4 50 ? 4.017   20.727 4.446   1.00 32.50  ? 282 ASN B CA    1 
ATOM   1880 C C     . ASN D 4 50 ? 4.711   19.386 4.677   1.00 31.29  ? 282 ASN B C     1 
ATOM   1881 O O     . ASN D 4 50 ? 5.032   19.037 5.808   1.00 33.06  ? 282 ASN B O     1 
ATOM   1882 C CB    . ASN D 4 50 ? 2.507   20.441 4.279   1.00 31.37  ? 282 ASN B CB    1 
ATOM   1883 C CG    . ASN D 4 50 ? 1.667   21.684 4.173   1.00 33.83  ? 282 ASN B CG    1 
ATOM   1884 O OD1   . ASN D 4 50 ? 2.070   22.783 4.563   1.00 33.83  ? 282 ASN B OD1   1 
ATOM   1885 N ND2   . ASN D 4 50 ? 0.454   21.514 3.649   1.00 36.02  ? 282 ASN B ND2   1 
ATOM   1886 N N     . TRP D 4 51 ? 4.933   18.614 3.612   1.00 32.18  ? 283 TRP B N     1 
ATOM   1887 C CA    . TRP D 4 51 ? 5.595   17.320 3.754   1.00 30.59  ? 283 TRP B CA    1 
ATOM   1888 C C     . TRP D 4 51 ? 7.001   17.448 4.355   1.00 30.67  ? 283 TRP B C     1 
ATOM   1889 O O     . TRP D 4 51 ? 7.359   16.682 5.247   1.00 29.27  ? 283 TRP B O     1 
ATOM   1890 C CB    . TRP D 4 51 ? 5.694   16.600 2.400   1.00 32.15  ? 283 TRP B CB    1 
ATOM   1891 C CG    . TRP D 4 51 ? 6.151   15.170 2.509   1.00 33.83  ? 283 TRP B CG    1 
ATOM   1892 C CD1   . TRP D 4 51 ? 5.356   14.076 2.618   1.00 35.90  ? 283 TRP B CD1   1 
ATOM   1893 C CD2   . TRP D 4 51 ? 7.505   14.690 2.522   1.00 34.73  ? 283 TRP B CD2   1 
ATOM   1894 N NE1   . TRP D 4 51 ? 6.124   12.940 2.695   1.00 37.53  ? 283 TRP B NE1   1 
ATOM   1895 C CE2   . TRP D 4 51 ? 7.449   13.289 2.635   1.00 35.41  ? 283 TRP B CE2   1 
ATOM   1896 C CE3   . TRP D 4 51 ? 8.764   15.313 2.448   1.00 33.89  ? 283 TRP B CE3   1 
ATOM   1897 C CZ2   . TRP D 4 51 ? 8.603   12.488 2.678   1.00 35.52  ? 283 TRP B CZ2   1 
ATOM   1898 C CZ3   . TRP D 4 51 ? 9.914   14.514 2.496   1.00 35.67  ? 283 TRP B CZ3   1 
ATOM   1899 C CH2   . TRP D 4 51 ? 9.823   13.118 2.610   1.00 36.28  ? 283 TRP B CH2   1 
ATOM   1900 N N     . PHE D 4 52 ? 7.802   18.401 3.867   1.00 29.44  ? 284 PHE B N     1 
ATOM   1901 C CA    . PHE D 4 52 ? 9.135   18.588 4.419   1.00 29.84  ? 284 PHE B CA    1 
ATOM   1902 C C     . PHE D 4 52 ? 9.124   19.093 5.883   1.00 28.67  ? 284 PHE B C     1 
ATOM   1903 O O     . PHE D 4 52 ? 9.947   18.658 6.694   1.00 28.91  ? 284 PHE B O     1 
ATOM   1904 C CB    . PHE D 4 52 ? 9.954   19.519 3.516   1.00 29.93  ? 284 PHE B CB    1 
ATOM   1905 C CG    . PHE D 4 52 ? 10.597  18.793 2.352   1.00 31.16  ? 284 PHE B CG    1 
ATOM   1906 C CD1   . PHE D 4 52 ? 9.864   18.526 1.184   1.00 31.65  ? 284 PHE B CD1   1 
ATOM   1907 C CD2   . PHE D 4 52 ? 11.890  18.258 2.477   1.00 31.07  ? 284 PHE B CD2   1 
ATOM   1908 C CE1   . PHE D 4 52 ? 10.409  17.734 0.161   1.00 30.11  ? 284 PHE B CE1   1 
ATOM   1909 C CE2   . PHE D 4 52 ? 12.446  17.455 1.457   1.00 33.01  ? 284 PHE B CE2   1 
ATOM   1910 C CZ    . PHE D 4 52 ? 11.694  17.195 0.296   1.00 30.64  ? 284 PHE B CZ    1 
ATOM   1911 N N     . GLY D 4 53 ? 8.219   20.007 6.195   1.00 29.26  ? 285 GLY B N     1 
ATOM   1912 C CA    . GLY D 4 53 ? 8.096   20.497 7.566   1.00 30.66  ? 285 GLY B CA    1 
ATOM   1913 C C     . GLY D 4 53 ? 7.786   19.277 8.427   1.00 32.02  ? 285 GLY B C     1 
ATOM   1914 O O     . GLY D 4 53 ? 8.514   18.986 9.379   1.00 32.25  ? 285 GLY B O     1 
ATOM   1915 N N     . ASN D 4 54 ? 6.726   18.541 8.064   1.00 32.37  ? 286 ASN B N     1 
ATOM   1916 C CA    . ASN D 4 54 ? 6.325   17.350 8.815   1.00 34.22  ? 286 ASN B CA    1 
ATOM   1917 C C     . ASN D 4 54 ? 7.431   16.316 8.914   1.00 34.39  ? 286 ASN B C     1 
ATOM   1918 O O     . ASN D 4 54 ? 7.669   15.754 9.987   1.00 33.42  ? 286 ASN B O     1 
ATOM   1919 C CB    . ASN D 4 54 ? 5.056   16.695 8.207   1.00 33.69  ? 286 ASN B CB    1 
ATOM   1920 C CG    . ASN D 4 54 ? 3.792   17.537 8.432   1.00 34.66  ? 286 ASN B CG    1 
ATOM   1921 O OD1   . ASN D 4 54 ? 3.642   18.180 9.471   1.00 36.36  ? 286 ASN B OD1   1 
ATOM   1922 N ND2   . ASN D 4 54 ? 2.883   17.528 7.459   1.00 34.55  ? 286 ASN B ND2   1 
ATOM   1923 N N     . LYS D 4 55 ? 8.123   16.063 7.799   1.00 33.75  ? 287 LYS B N     1 
ATOM   1924 C CA    . LYS D 4 55 ? 9.192   15.082 7.816   1.00 33.53  ? 287 LYS B CA    1 
ATOM   1925 C C     . LYS D 4 55 ? 10.365  15.479 8.725   1.00 32.77  ? 287 LYS B C     1 
ATOM   1926 O O     . LYS D 4 55 ? 10.829  14.666 9.519   1.00 33.59  ? 287 LYS B O     1 
ATOM   1927 C CB    . LYS D 4 55 ? 9.728   14.828 6.401   1.00 35.68  ? 287 LYS B CB    1 
ATOM   1928 C CG    . LYS D 4 55 ? 10.644  13.596 6.324   1.00 37.25  ? 287 LYS B CG    1 
ATOM   1929 C CD    . LYS D 4 55 ? 9.862   12.320 6.016   1.00 40.62  ? 287 LYS B CD    1 
ATOM   1930 C CE    . LYS D 4 55 ? 10.765  11.096 6.140   1.00 42.71  ? 287 LYS B CE    1 
ATOM   1931 N NZ    . LYS D 4 55 ? 10.011  9.838  5.840   1.00 42.84  ? 287 LYS B NZ    1 
ATOM   1932 N N     . ARG D 4 56 ? 10.867  16.709 8.609   1.00 33.65  ? 288 ARG B N     1 
ATOM   1933 C CA    . ARG D 4 56 ? 11.999  17.101 9.453   1.00 31.85  ? 288 ARG B CA    1 
ATOM   1934 C C     . ARG D 4 56 ? 11.718  16.966 10.958  1.00 34.09  ? 288 ARG B C     1 
ATOM   1935 O O     . ARG D 4 56 ? 12.542  16.419 11.700  1.00 33.18  ? 288 ARG B O     1 
ATOM   1936 C CB    . ARG D 4 56 ? 12.413  18.539 9.172   1.00 32.07  ? 288 ARG B CB    1 
ATOM   1937 C CG    . ARG D 4 56 ? 13.105  18.806 7.801   1.00 29.66  ? 288 ARG B CG    1 
ATOM   1938 C CD    . ARG D 4 56 ? 13.576  20.271 7.682   1.00 27.08  ? 288 ARG B CD    1 
ATOM   1939 N NE    . ARG D 4 56 ? 12.487  21.229 7.607   1.00 27.90  ? 288 ARG B NE    1 
ATOM   1940 C CZ    . ARG D 4 56 ? 11.923  21.685 6.488   1.00 29.57  ? 288 ARG B CZ    1 
ATOM   1941 N NH1   . ARG D 4 56 ? 12.350  21.280 5.282   1.00 30.39  ? 288 ARG B NH1   1 
ATOM   1942 N NH2   . ARG D 4 56 ? 10.931  22.561 6.576   1.00 28.73  ? 288 ARG B NH2   1 
ATOM   1943 N N     . ILE D 4 57 ? 10.581  17.479 11.422  1.00 34.73  ? 289 ILE B N     1 
ATOM   1944 C CA    . ILE D 4 57 ? 10.285  17.421 12.861  1.00 37.19  ? 289 ILE B CA    1 
ATOM   1945 C C     . ILE D 4 57 ? 10.049  15.994 13.332  1.00 38.67  ? 289 ILE B C     1 
ATOM   1946 O O     . ILE D 4 57 ? 10.584  15.589 14.356  1.00 39.44  ? 289 ILE B O     1 
ATOM   1947 C CB    . ILE D 4 57 ? 9.090   18.339 13.229  1.00 39.62  ? 289 ILE B CB    1 
ATOM   1948 C CG1   . ILE D 4 57 ? 8.866   18.357 14.754  1.00 41.14  ? 289 ILE B CG1   1 
ATOM   1949 C CG2   . ILE D 4 57 ? 7.828   17.857 12.552  1.00 37.35  ? 289 ILE B CG2   1 
ATOM   1950 C CD1   . ILE D 4 57 ? 9.979   18.959 15.514  1.00 44.08  ? 289 ILE B CD1   1 
ATOM   1951 N N     . ARG D 4 58 ? 9.278   15.209 12.586  1.00 39.47  ? 290 ARG B N     1 
ATOM   1952 C CA    . ARG D 4 58 ? 9.036   13.833 13.007  1.00 38.96  ? 290 ARG B CA    1 
ATOM   1953 C C     . ARG D 4 58 ? 10.307  12.993 12.960  1.00 41.05  ? 290 ARG B C     1 
ATOM   1954 O O     . ARG D 4 58 ? 10.544  12.146 13.841  1.00 38.75  ? 290 ARG B O     1 
ATOM   1955 C CB    . ARG D 4 58 ? 7.902   13.232 12.170  1.00 37.60  ? 290 ARG B CB    1 
ATOM   1956 C CG    . ARG D 4 58 ? 6.570   13.846 12.584  1.00 36.28  ? 290 ARG B CG    1 
ATOM   1957 C CD    . ARG D 4 58 ? 5.432   13.656 11.600  1.00 36.87  ? 290 ARG B CD    1 
ATOM   1958 N NE    . ARG D 4 58 ? 4.250   14.312 12.148  1.00 36.89  ? 290 ARG B NE    1 
ATOM   1959 C CZ    . ARG D 4 58 ? 3.148   14.612 11.470  1.00 36.92  ? 290 ARG B CZ    1 
ATOM   1960 N NH1   . ARG D 4 58 ? 3.023   14.312 10.168  1.00 35.49  ? 290 ARG B NH1   1 
ATOM   1961 N NH2   . ARG D 4 58 ? 2.184   15.270 12.090  1.00 36.87  ? 290 ARG B NH2   1 
ATOM   1962 N N     . TYR D 4 59 ? 11.150  13.242 11.963  1.00 40.78  ? 291 TYR B N     1 
ATOM   1963 C CA    . TYR D 4 59 ? 12.406  12.506 11.874  1.00 44.26  ? 291 TYR B CA    1 
ATOM   1964 C C     . TYR D 4 59 ? 13.316  12.946 13.025  1.00 45.63  ? 291 TYR B C     1 
ATOM   1965 O O     . TYR D 4 59 ? 13.947  12.125 13.692  1.00 46.71  ? 291 TYR B O     1 
ATOM   1966 C CB    . TYR D 4 59 ? 13.108  12.788 10.538  1.00 44.69  ? 291 TYR B CB    1 
ATOM   1967 C CG    . TYR D 4 59 ? 14.477  12.163 10.433  1.00 48.25  ? 291 TYR B CG    1 
ATOM   1968 C CD1   . TYR D 4 59 ? 14.641  10.858 9.959   1.00 49.70  ? 291 TYR B CD1   1 
ATOM   1969 C CD2   . TYR D 4 59 ? 15.608  12.851 10.871  1.00 50.32  ? 291 TYR B CD2   1 
ATOM   1970 C CE1   . TYR D 4 59 ? 15.892  10.259 9.936   1.00 51.59  ? 291 TYR B CE1   1 
ATOM   1971 C CE2   . TYR D 4 59 ? 16.868  12.262 10.850  1.00 51.33  ? 291 TYR B CE2   1 
ATOM   1972 C CZ    . TYR D 4 59 ? 16.999  10.970 10.387  1.00 52.27  ? 291 TYR B CZ    1 
ATOM   1973 O OH    . TYR D 4 59 ? 18.244  10.385 10.397  1.00 54.55  ? 291 TYR B OH    1 
ATOM   1974 N N     . LYS D 4 60 ? 13.395  14.249 13.245  1.00 47.90  ? 292 LYS B N     1 
ATOM   1975 C CA    . LYS D 4 60 ? 14.232  14.799 14.299  1.00 51.06  ? 292 LYS B CA    1 
ATOM   1976 C C     . LYS D 4 60 ? 13.769  14.277 15.658  1.00 53.01  ? 292 LYS B C     1 
ATOM   1977 O O     . LYS D 4 60 ? 14.584  14.002 16.540  1.00 52.89  ? 292 LYS B O     1 
ATOM   1978 C CB    . LYS D 4 60 ? 14.137  16.324 14.271  1.00 52.32  ? 292 LYS B CB    1 
ATOM   1979 C CG    . LYS D 4 60 ? 14.990  17.032 15.282  1.00 54.91  ? 292 LYS B CG    1 
ATOM   1980 C CD    . LYS D 4 60 ? 14.633  18.517 15.371  1.00 55.82  ? 292 LYS B CD    1 
ATOM   1981 C CE    . LYS D 4 60 ? 14.881  19.231 14.070  1.00 55.54  ? 292 LYS B CE    1 
ATOM   1982 N NZ    . LYS D 4 60 ? 14.781  20.703 14.259  1.00 55.41  ? 292 LYS B NZ    1 
ATOM   1983 N N     . LYS D 4 61 ? 12.459  14.133 15.817  1.00 54.78  ? 293 LYS B N     1 
ATOM   1984 C CA    . LYS D 4 61 ? 11.885  13.654 17.066  1.00 58.61  ? 293 LYS B CA    1 
ATOM   1985 C C     . LYS D 4 61 ? 12.082  12.161 17.296  1.00 60.64  ? 293 LYS B C     1 
ATOM   1986 O O     . LYS D 4 61 ? 12.030  11.704 18.433  1.00 60.98  ? 293 LYS B O     1 
ATOM   1987 C CB    . LYS D 4 61 ? 10.389  13.963 17.122  1.00 59.34  ? 293 LYS B CB    1 
ATOM   1988 C CG    . LYS D 4 61 ? 10.042  15.350 17.616  1.00 61.29  ? 293 LYS B CG    1 
ATOM   1989 C CD    . LYS D 4 61 ? 8.524   15.506 17.703  1.00 63.55  ? 293 LYS B CD    1 
ATOM   1990 C CE    . LYS D 4 61 ? 8.153   16.792 18.401  1.00 64.85  ? 293 LYS B CE    1 
ATOM   1991 N NZ    . LYS D 4 61 ? 8.714   16.833 19.789  1.00 64.43  ? 293 LYS B NZ    1 
ATOM   1992 N N     . ASN D 4 62 ? 12.319  11.399 16.233  1.00 62.69  ? 294 ASN B N     1 
ATOM   1993 C CA    . ASN D 4 62 ? 12.489  9.960  16.395  1.00 64.47  ? 294 ASN B CA    1 
ATOM   1994 C C     . ASN D 4 62 ? 13.449  9.335  15.384  1.00 64.93  ? 294 ASN B C     1 
ATOM   1995 O O     . ASN D 4 62 ? 13.025  8.555  14.531  1.00 64.20  ? 294 ASN B O     1 
ATOM   1996 C CB    . ASN D 4 62 ? 11.130  9.284  16.279  1.00 65.99  ? 294 ASN B CB    1 
ATOM   1997 C CG    . ASN D 4 62 ? 11.050  8.007  17.082  1.00 68.81  ? 294 ASN B CG    1 
ATOM   1998 O OD1   . ASN D 4 62 ? 11.962  7.171  17.042  1.00 69.42  ? 294 ASN B OD1   1 
ATOM   1999 N ND2   . ASN D 4 62 ? 9.951   7.840  17.819  1.00 69.89  ? 294 ASN B ND2   1 
ATOM   2000 N N     . ILE D 4 63 ? 14.736  9.659  15.496  1.00 66.37  ? 295 ILE B N     1 
ATOM   2001 C CA    . ILE D 4 63 ? 15.759  9.143  14.580  1.00 68.51  ? 295 ILE B CA    1 
ATOM   2002 C C     . ILE D 4 63 ? 15.700  7.624  14.428  1.00 69.71  ? 295 ILE B C     1 
ATOM   2003 O O     . ILE D 4 63 ? 15.764  7.093  13.314  1.00 70.46  ? 295 ILE B O     1 
ATOM   2004 C CB    . ILE D 4 63 ? 17.184  9.506  15.046  1.00 68.63  ? 295 ILE B CB    1 
ATOM   2005 C CG1   . ILE D 4 63 ? 17.267  10.986 15.401  1.00 69.26  ? 295 ILE B CG1   1 
ATOM   2006 C CG2   . ILE D 4 63 ? 18.180  9.194  13.938  1.00 68.90  ? 295 ILE B CG2   1 
ATOM   2007 C CD1   . ILE D 4 63 ? 16.911  11.898 14.268  1.00 69.42  ? 295 ILE B CD1   1 
ATOM   2008 N N     . GLY D 4 64 ? 15.582  6.930  15.555  1.00 70.40  ? 296 GLY B N     1 
ATOM   2009 C CA    . GLY D 4 64 ? 15.511  5.481  15.535  1.00 71.41  ? 296 GLY B CA    1 
ATOM   2010 C C     . GLY D 4 64 ? 14.369  4.933  14.696  1.00 72.43  ? 296 GLY B C     1 
ATOM   2011 O O     . GLY D 4 64 ? 14.582  4.044  13.871  1.00 72.71  ? 296 GLY B O     1 
ATOM   2012 N N     . LYS D 4 65 ? 13.159  5.450  14.898  1.00 72.83  ? 297 LYS B N     1 
ATOM   2013 C CA    . LYS D 4 65 ? 12.001  4.986  14.139  1.00 73.57  ? 297 LYS B CA    1 
ATOM   2014 C C     . LYS D 4 65 ? 12.194  5.094  12.623  1.00 74.57  ? 297 LYS B C     1 
ATOM   2015 O O     . LYS D 4 65 ? 11.690  4.264  11.874  1.00 74.26  ? 297 LYS B O     1 
ATOM   2016 C CB    . LYS D 4 65 ? 10.756  5.756  14.558  1.00 73.39  ? 297 LYS B CB    1 
ATOM   2017 N N     . PHE D 4 66 ? 12.927  6.107  12.169  1.00 75.64  ? 298 PHE B N     1 
ATOM   2018 C CA    . PHE D 4 66 ? 13.144  6.292  10.736  1.00 76.88  ? 298 PHE B CA    1 
ATOM   2019 C C     . PHE D 4 66 ? 14.423  5.672  10.196  1.00 78.16  ? 298 PHE B C     1 
ATOM   2020 O O     . PHE D 4 66 ? 14.817  5.926  9.052   1.00 78.25  ? 298 PHE B O     1 
ATOM   2021 C CB    . PHE D 4 66 ? 13.114  7.777  10.384  1.00 76.05  ? 298 PHE B CB    1 
ATOM   2022 C CG    . PHE D 4 66 ? 11.773  8.396  10.546  1.00 75.51  ? 298 PHE B CG    1 
ATOM   2023 C CD1   . PHE D 4 66 ? 11.344  8.835  11.792  1.00 76.14  ? 298 PHE B CD1   1 
ATOM   2024 C CD2   . PHE D 4 66 ? 10.914  8.502  9.462   1.00 75.51  ? 298 PHE B CD2   1 
ATOM   2025 C CE1   . PHE D 4 66 ? 10.076  9.367  11.963  1.00 75.93  ? 298 PHE B CE1   1 
ATOM   2026 C CE2   . PHE D 4 66 ? 9.641   9.032  9.618   1.00 75.89  ? 298 PHE B CE2   1 
ATOM   2027 C CZ    . PHE D 4 66 ? 9.219   9.467  10.874  1.00 76.10  ? 298 PHE B CZ    1 
ATOM   2028 N N     . GLN D 4 67 ? 15.085  4.870  11.020  1.00 79.65  ? 299 GLN B N     1 
ATOM   2029 C CA    . GLN D 4 67 ? 16.297  4.213  10.575  1.00 80.81  ? 299 GLN B CA    1 
ATOM   2030 C C     . GLN D 4 67 ? 15.840  3.038  9.729   1.00 81.09  ? 299 GLN B C     1 
ATOM   2031 O O     . GLN D 4 67 ? 14.687  2.622  9.814   1.00 81.38  ? 299 GLN B O     1 
ATOM   2032 C CB    . GLN D 4 67 ? 17.121  3.725  11.763  1.00 81.47  ? 299 GLN B CB    1 
ATOM   2033 C CG    . GLN D 4 67 ? 18.496  3.255  11.361  1.00 82.52  ? 299 GLN B CG    1 
ATOM   2034 C CD    . GLN D 4 67 ? 19.147  4.195  10.360  1.00 83.23  ? 299 GLN B CD    1 
ATOM   2035 O OE1   . GLN D 4 67 ? 18.705  4.301  9.213   1.00 83.56  ? 299 GLN B OE1   1 
ATOM   2036 N NE2   . GLN D 4 67 ? 20.196  4.889  10.791  1.00 83.26  ? 299 GLN B NE2   1 
ATOM   2037 N N     . GLU D 4 68 ? 16.727  2.500  8.909   1.00 81.32  ? 300 GLU B N     1 
ATOM   2038 C CA    . GLU D 4 68 ? 16.313  1.393  8.073   1.00 82.17  ? 300 GLU B CA    1 
ATOM   2039 C C     . GLU D 4 68 ? 15.683  1.997  6.839   1.00 82.42  ? 300 GLU B C     1 
ATOM   2040 O O     . GLU D 4 68 ? 15.951  1.552  5.720   1.00 82.74  ? 300 GLU B O     1 
ATOM   2041 N N     . GLU D 4 69 ? 14.837  3.010  7.048   1.00 82.10  ? 301 GLU B N     1 
ATOM   2042 C CA    . GLU D 4 69 ? 14.199  3.720  5.944   1.00 81.63  ? 301 GLU B CA    1 
ATOM   2043 C C     . GLU D 4 69 ? 15.284  4.640  5.399   1.00 81.44  ? 301 GLU B C     1 
ATOM   2044 O O     . GLU D 4 69 ? 15.312  4.972  4.213   1.00 81.14  ? 301 GLU B O     1 
ATOM   2045 C CB    . GLU D 4 69 ? 13.019  4.563  6.429   1.00 81.41  ? 301 GLU B CB    1 
ATOM   2046 C CG    . GLU D 4 69 ? 12.227  5.208  5.289   1.00 81.00  ? 301 GLU B CG    1 
ATOM   2047 C CD    . GLU D 4 69 ? 11.133  6.151  5.770   1.00 80.85  ? 301 GLU B CD    1 
ATOM   2048 O OE1   . GLU D 4 69 ? 11.460  7.250  6.268   1.00 80.38  ? 301 GLU B OE1   1 
ATOM   2049 O OE2   . GLU D 4 69 ? 9.944   5.793  5.650   1.00 80.66  ? 301 GLU B OE2   1 
ATOM   2050 N N     . ALA D 4 70 ? 16.179  5.044  6.291   1.00 81.03  ? 302 ALA B N     1 
ATOM   2051 C CA    . ALA D 4 70 ? 17.287  5.902  5.924   1.00 81.23  ? 302 ALA B CA    1 
ATOM   2052 C C     . ALA D 4 70 ? 18.256  5.093  5.070   1.00 81.19  ? 302 ALA B C     1 
ATOM   2053 O O     . ALA D 4 70 ? 18.908  5.623  4.176   1.00 81.05  ? 302 ALA B O     1 
ATOM   2054 C CB    . ALA D 4 70 ? 17.986  6.411  7.174   1.00 80.94  ? 302 ALA B CB    1 
ATOM   2055 N N     . ASN D 4 71 ? 18.338  3.797  5.346   1.00 81.40  ? 303 ASN B N     1 
ATOM   2056 C CA    . ASN D 4 71 ? 19.240  2.939  4.600   1.00 81.22  ? 303 ASN B CA    1 
ATOM   2057 C C     . ASN D 4 71 ? 18.718  2.519  3.234   1.00 80.63  ? 303 ASN B C     1 
ATOM   2058 O O     . ASN D 4 71 ? 19.422  2.665  2.237   1.00 79.97  ? 303 ASN B O     1 
ATOM   2059 C CB    . ASN D 4 71 ? 19.588  1.713  5.428   1.00 82.24  ? 303 ASN B CB    1 
ATOM   2060 C CG    . ASN D 4 71 ? 20.316  2.074  6.693   1.00 83.11  ? 303 ASN B CG    1 
ATOM   2061 O OD1   . ASN D 4 71 ? 21.331  2.768  6.659   1.00 83.95  ? 303 ASN B OD1   1 
ATOM   2062 N ND2   . ASN D 4 71 ? 19.802  1.612  7.822   1.00 83.93  ? 303 ASN B ND2   1 
ATOM   2063 N N     . ILE D 4 72 ? 17.494  2.001  3.170   1.00 80.51  ? 304 ILE B N     1 
ATOM   2064 C CA    . ILE D 4 72 ? 16.953  1.587  1.877   1.00 80.44  ? 304 ILE B CA    1 
ATOM   2065 C C     . ILE D 4 72 ? 17.019  2.768  0.902   1.00 80.15  ? 304 ILE B C     1 
ATOM   2066 O O     . ILE D 4 72 ? 17.103  2.581  -0.316  1.00 79.86  ? 304 ILE B O     1 
ATOM   2067 C CB    . ILE D 4 72 ? 15.494  1.072  1.990   1.00 80.53  ? 304 ILE B CB    1 
ATOM   2068 C CG1   . ILE D 4 72 ? 14.541  2.220  2.319   1.00 80.94  ? 304 ILE B CG1   1 
ATOM   2069 C CG2   . ILE D 4 72 ? 15.416  0.000  3.061   1.00 80.70  ? 304 ILE B CG2   1 
ATOM   2070 C CD1   . ILE D 4 72 ? 13.083  1.822  2.310   1.00 81.08  ? 304 ILE B CD1   1 
ATOM   2071 N N     . TYR D 4 73 ? 16.999  3.983  1.452   1.00 79.61  ? 305 TYR B N     1 
ATOM   2072 C CA    . TYR D 4 73 ? 17.089  5.193  0.643   1.00 79.21  ? 305 TYR B CA    1 
ATOM   2073 C C     . TYR D 4 73 ? 18.531  5.716  0.633   1.00 79.77  ? 305 TYR B C     1 
ATOM   2074 O O     . TYR D 4 73 ? 19.368  5.202  1.411   1.00 79.75  ? 305 TYR B O     1 
ATOM   2075 C CB    . TYR D 4 73 ? 16.142  6.283  1.180   1.00 77.40  ? 305 TYR B CB    1 
ATOM   2076 C CG    . TYR D 4 73 ? 14.700  6.128  0.748   1.00 75.71  ? 305 TYR B CG    1 
ATOM   2077 C CD1   . TYR D 4 73 ? 13.756  5.537  1.582   1.00 74.99  ? 305 TYR B CD1   1 
ATOM   2078 C CD2   . TYR D 4 73 ? 14.293  6.539  -0.515  1.00 75.53  ? 305 TYR B CD2   1 
ATOM   2079 C CE1   . TYR D 4 73 ? 12.437  5.356  1.163   1.00 75.41  ? 305 TYR B CE1   1 
ATOM   2080 C CE2   . TYR D 4 73 ? 12.984  6.364  -0.946  1.00 75.86  ? 305 TYR B CE2   1 
ATOM   2081 C CZ    . TYR D 4 73 ? 12.058  5.768  -0.107  1.00 76.13  ? 305 TYR B CZ    1 
ATOM   2082 O OH    . TYR D 4 73 ? 10.770  5.564  -0.565  1.00 76.68  ? 305 TYR B OH    1 
HETATM 2083 O O     . HOH E 5 .  ? 2.548   34.822 18.876  1.00 28.62  ? 21  HOH D O     1 
HETATM 2084 O O     . HOH E 5 .  ? -1.608  23.534 2.938   1.00 36.55  ? 22  HOH D O     1 
HETATM 2085 O O     . HOH E 5 .  ? -1.963  25.657 6.134   1.00 31.87  ? 23  HOH D O     1 
HETATM 2086 O O     . HOH E 5 .  ? 7.920   38.136 12.694  1.00 32.58  ? 24  HOH D O     1 
HETATM 2087 O O     . HOH E 5 .  ? 21.433  43.413 2.134   1.00 41.44  ? 25  HOH D O     1 
HETATM 2088 O O     . HOH E 5 .  ? -3.207  28.426 6.873   1.00 35.73  ? 26  HOH D O     1 
HETATM 2089 O O     . HOH E 5 .  ? 9.638   37.672 14.678  1.00 46.85  ? 27  HOH D O     1 
HETATM 2090 O O     . HOH E 5 .  ? 11.064  40.358 14.011  1.00 62.67  ? 28  HOH D O     1 
HETATM 2091 O O     . HOH E 5 .  ? -2.341  32.250 14.582  1.00 36.41  ? 29  HOH D O     1 
HETATM 2092 O O     . HOH E 5 .  ? 14.686  35.822 6.135   1.00 35.73  ? 30  HOH D O     1 
HETATM 2093 O O     . HOH E 5 .  ? 2.521   29.906 9.311   1.00 41.63  ? 31  HOH D O     1 
HETATM 2094 O O     . HOH E 5 .  ? 13.271  39.581 14.047  1.00 47.02  ? 32  HOH D O     1 
HETATM 2095 O O     . HOH E 5 .  ? 15.189  45.024 11.006  1.00 45.48  ? 33  HOH D O     1 
HETATM 2096 O O     . HOH E 5 .  ? -3.091  21.447 0.887   1.00 41.29  ? 34  HOH D O     1 
HETATM 2097 O O     . HOH E 5 .  ? 3.103   26.101 8.023   1.00 42.85  ? 35  HOH D O     1 
HETATM 2098 O O     . HOH E 5 .  ? 3.473   21.235 8.035   1.00 42.37  ? 36  HOH D O     1 
HETATM 2099 O O     . HOH E 5 .  ? -1.180  29.913 6.587   1.00 36.62  ? 37  HOH D O     1 
HETATM 2100 O O     . HOH E 5 .  ? 8.003   46.977 4.311   1.00 62.13  ? 38  HOH D O     1 
HETATM 2101 O O     . HOH E 5 .  ? 9.681   45.347 3.699   1.00 48.74  ? 39  HOH D O     1 
HETATM 2102 O O     . HOH E 5 .  ? -6.603  31.923 15.626  1.00 34.36  ? 40  HOH D O     1 
HETATM 2103 O O     . HOH E 5 .  ? -3.935  26.336 2.642   1.00 44.07  ? 41  HOH D O     1 
HETATM 2104 O O     . HOH E 5 .  ? 18.111  33.789 5.603   1.00 51.85  ? 42  HOH D O     1 
HETATM 2105 O O     . HOH E 5 .  ? -2.708  30.359 10.213  1.00 46.16  ? 43  HOH D O     1 
HETATM 2106 O O     . HOH E 5 .  ? -5.104  28.047 5.075   1.00 45.43  ? 44  HOH D O     1 
HETATM 2107 O O     . HOH E 5 .  ? 14.329  42.745 13.014  1.00 51.06  ? 45  HOH D O     1 
HETATM 2108 O O     . HOH E 5 .  ? -6.782  31.289 13.108  1.00 48.25  ? 46  HOH D O     1 
HETATM 2109 O O     . HOH E 5 .  ? -3.676  11.230 17.408  1.00 50.96  ? 47  HOH D O     1 
HETATM 2110 O O     . HOH E 5 .  ? 20.456  42.928 6.692   1.00 57.77  ? 48  HOH D O     1 
HETATM 2111 O O     . HOH E 5 .  ? 1.197   8.680  2.422   1.00 44.17  ? 49  HOH D O     1 
HETATM 2112 O O     . HOH E 5 .  ? 14.780  38.539 15.954  1.00 63.20  ? 50  HOH D O     1 
HETATM 2113 O O     . HOH E 5 .  ? -21.989 6.267  17.795  1.00 66.49  ? 51  HOH D O     1 
HETATM 2114 O O     . HOH E 5 .  ? -1.273  10.553 16.083  1.00 76.90  ? 52  HOH D O     1 
HETATM 2115 O O     . HOH E 5 .  ? 5.439   6.998  10.621  1.00 58.12  ? 53  HOH D O     1 
HETATM 2116 O O     . HOH E 5 .  ? -0.177  13.347 15.517  1.00 54.55  ? 54  HOH D O     1 
HETATM 2117 O O     . HOH E 5 .  ? -7.821  2.876  22.725  1.00 66.22  ? 55  HOH D O     1 
HETATM 2118 O O     . HOH E 5 .  ? 7.874   35.257 23.952  1.00 49.23  ? 56  HOH D O     1 
HETATM 2119 O O     . HOH E 5 .  ? -9.084  26.052 10.503  1.00 56.98  ? 57  HOH D O     1 
HETATM 2120 O O     . HOH E 5 .  ? -7.112  26.769 5.615   1.00 52.12  ? 58  HOH D O     1 
HETATM 2121 O O     . HOH E 5 .  ? 16.666  44.528 8.758   1.00 55.13  ? 59  HOH D O     1 
HETATM 2122 O O     . HOH E 5 .  ? 14.915  32.349 10.230  1.00 49.54  ? 60  HOH D O     1 
HETATM 2123 O O     . HOH E 5 .  ? -5.021  17.376 0.943   1.00 52.83  ? 61  HOH D O     1 
HETATM 2124 O O     . HOH E 5 .  ? -7.511  18.647 5.063   1.00 58.04  ? 62  HOH D O     1 
HETATM 2125 O O     . HOH E 5 .  ? -6.999  19.877 2.636   1.00 62.75  ? 63  HOH D O     1 
HETATM 2126 O O     . HOH F 5 .  ? 4.314   37.184 9.200   1.00 26.98  ? 41  HOH E O     1 
HETATM 2127 O O     . HOH F 5 .  ? -0.979  44.870 11.180  1.00 34.85  ? 42  HOH E O     1 
HETATM 2128 O O     . HOH F 5 .  ? 13.021  24.469 1.904   1.00 28.32  ? 43  HOH E O     1 
HETATM 2129 O O     . HOH F 5 .  ? 4.367   33.000 6.475   1.00 32.57  ? 44  HOH E O     1 
HETATM 2130 O O     . HOH F 5 .  ? 4.066   34.359 8.843   1.00 34.47  ? 45  HOH E O     1 
HETATM 2131 O O     . HOH F 5 .  ? 6.877   21.075 11.039  1.00 40.90  ? 46  HOH E O     1 
HETATM 2132 O O     . HOH F 5 .  ? 11.828  20.380 12.575  1.00 37.46  ? 47  HOH E O     1 
HETATM 2133 O O     . HOH F 5 .  ? 9.556   21.105 11.079  1.00 36.48  ? 48  HOH E O     1 
HETATM 2134 O O     . HOH F 5 .  ? 3.000   38.933 7.471   1.00 28.59  ? 49  HOH E O     1 
HETATM 2135 O O     . HOH F 5 .  ? -3.487  23.243 14.366  1.00 33.91  ? 50  HOH E O     1 
HETATM 2136 O O     . HOH F 5 .  ? 5.493   25.237 8.458   1.00 44.45  ? 51  HOH E O     1 
HETATM 2137 O O     . HOH F 5 .  ? 9.037   41.837 13.324  1.00 63.77  ? 52  HOH E O     1 
HETATM 2138 O O     . HOH F 5 .  ? 7.098   45.528 15.812  1.00 65.75  ? 53  HOH E O     1 
HETATM 2139 O O     . HOH F 5 .  ? 0.495   43.504 12.691  1.00 40.10  ? 54  HOH E O     1 
HETATM 2140 O O     . HOH F 5 .  ? 10.790  28.880 13.240  1.00 38.61  ? 55  HOH E O     1 
HETATM 2141 O O     . HOH F 5 .  ? 4.383   18.016 13.791  1.00 46.20  ? 56  HOH E O     1 
HETATM 2142 O O     . HOH F 5 .  ? 6.360   31.198 2.900   1.00 43.66  ? 57  HOH E O     1 
HETATM 2143 O O     . HOH F 5 .  ? 12.384  36.084 4.653   1.00 38.81  ? 58  HOH E O     1 
HETATM 2144 O O     . HOH F 5 .  ? -5.194  20.866 10.772  1.00 35.84  ? 59  HOH E O     1 
HETATM 2145 O O     . HOH F 5 .  ? 5.288   18.296 18.565  1.00 53.76  ? 60  HOH E O     1 
HETATM 2146 O O     . HOH F 5 .  ? 5.430   22.276 9.366   1.00 48.30  ? 61  HOH E O     1 
HETATM 2147 O O     . HOH F 5 .  ? 5.948   16.761 16.208  1.00 47.08  ? 62  HOH E O     1 
HETATM 2148 O O     . HOH F 5 .  ? -5.721  23.281 12.834  1.00 37.93  ? 63  HOH E O     1 
HETATM 2149 O O     . HOH F 5 .  ? 7.817   26.484 4.621   1.00 44.02  ? 64  HOH E O     1 
HETATM 2150 O O     . HOH F 5 .  ? 0.779   40.633 2.839   1.00 36.82  ? 65  HOH E O     1 
HETATM 2151 O O     . HOH F 5 .  ? 8.253   26.888 17.116  1.00 39.47  ? 66  HOH E O     1 
HETATM 2152 O O     . HOH F 5 .  ? 12.811  35.182 2.175   1.00 48.45  ? 67  HOH E O     1 
HETATM 2153 O O     . HOH F 5 .  ? -4.531  17.062 18.897  1.00 53.14  ? 68  HOH E O     1 
HETATM 2154 O O     . HOH F 5 .  ? -15.054 12.136 9.770   1.00 73.15  ? 69  HOH E O     1 
HETATM 2155 O O     . HOH F 5 .  ? -7.047  20.087 8.807   1.00 50.57  ? 70  HOH E O     1 
HETATM 2156 O O     . HOH F 5 .  ? -1.572  14.968 17.050  1.00 51.34  ? 71  HOH E O     1 
HETATM 2157 O O     . HOH F 5 .  ? 13.167  28.737 12.087  1.00 55.24  ? 72  HOH E O     1 
HETATM 2158 O O     . HOH F 5 .  ? -11.560 1.846  7.064   1.00 68.69  ? 73  HOH E O     1 
HETATM 2159 O O     . HOH F 5 .  ? -0.203  17.656 20.006  1.00 66.81  ? 74  HOH E O     1 
HETATM 2160 O O     . HOH F 5 .  ? 12.067  34.341 -0.348  1.00 62.15  ? 75  HOH E O     1 
HETATM 2161 O O     . HOH F 5 .  ? 11.550  19.276 18.546  1.00 59.63  ? 76  HOH E O     1 
HETATM 2162 O O     . HOH F 5 .  ? 7.575   23.879 8.720   1.00 51.94  ? 77  HOH E O     1 
HETATM 2163 O O     . HOH F 5 .  ? -12.883 9.266  11.064  1.00 57.16  ? 78  HOH E O     1 
HETATM 2164 O O     . HOH F 5 .  ? -11.555 -1.458 3.915   1.00 67.14  ? 79  HOH E O     1 
HETATM 2165 O O     . HOH F 5 .  ? -14.502 15.075 4.767   1.00 66.46  ? 80  HOH E O     1 
HETATM 2166 O O     . HOH F 5 .  ? 8.992   36.540 -2.729  1.00 63.29  ? 81  HOH E O     1 
HETATM 2167 O O     . HOH F 5 .  ? 8.576   40.309 -0.352  1.00 57.93  ? 82  HOH E O     1 
HETATM 2168 O O     . HOH F 5 .  ? -8.723  -2.340 1.560   1.00 57.28  ? 83  HOH E O     1 
HETATM 2169 O O     . HOH F 5 .  ? -22.338 17.948 8.131   1.00 71.87  ? 84  HOH E O     1 
HETATM 2170 O O     . HOH F 5 .  ? -13.757 9.463  8.587   1.00 64.05  ? 85  HOH E O     1 
HETATM 2171 O O     . HOH F 5 .  ? 8.044   32.315 -2.291  1.00 74.87  ? 86  HOH E O     1 
HETATM 2172 O O     . HOH F 5 .  ? -16.284 8.089  5.276   1.00 65.18  ? 87  HOH E O     1 
HETATM 2173 O O     . HOH F 5 .  ? 9.002   40.557 -3.462  1.00 69.30  ? 88  HOH E O     1 
HETATM 2174 O O     . HOH F 5 .  ? 5.278   51.325 10.099  1.00 60.82  ? 89  HOH E O     1 
HETATM 2175 O O     . HOH F 5 .  ? 5.590   25.617 18.431  1.00 56.79  ? 90  HOH E O     1 
HETATM 2176 O O     . HOH F 5 .  ? -18.331 17.860 11.118  1.00 69.84  ? 91  HOH E O     1 
HETATM 2177 O O     . HOH F 5 .  ? -4.561  22.844 23.319  1.00 60.35  ? 92  HOH E O     1 
HETATM 2178 O O     . HOH F 5 .  ? 9.899   24.861 21.472  1.00 65.75  ? 93  HOH E O     1 
HETATM 2179 O O     . HOH F 5 .  ? 3.595   17.138 20.223  1.00 54.54  ? 94  HOH E O     1 
HETATM 2180 O O     . HOH F 5 .  ? 9.010   26.484 19.826  1.00 70.98  ? 95  HOH E O     1 
HETATM 2181 O O     . HOH F 5 .  ? 13.055  30.245 9.894   1.00 61.34  ? 96  HOH E O     1 
HETATM 2182 O O     . HOH F 5 .  ? 11.420  44.132 14.901  1.00 61.47  ? 97  HOH E O     1 
HETATM 2183 O O     . HOH F 5 .  ? -13.962 5.992  7.823   1.00 66.03  ? 98  HOH E O     1 
HETATM 2184 O O     . HOH F 5 .  ? 3.344   31.122 7.374   1.00 48.59  ? 99  HOH E O     1 
HETATM 2185 O O     . HOH F 5 .  ? 6.995   24.820 6.339   1.00 55.40  ? 100 HOH E O     1 
HETATM 2186 O O     . HOH G 5 .  ? -0.031  35.461 17.750  1.00 29.55  ? 270 HOH A O     1 
HETATM 2187 O O     . HOH G 5 .  ? -2.897  35.689 28.346  1.00 46.38  ? 271 HOH A O     1 
HETATM 2188 O O     . HOH G 5 .  ? -1.172  35.669 26.417  1.00 38.82  ? 272 HOH A O     1 
HETATM 2189 O O     . HOH G 5 .  ? 0.517   25.439 5.077   1.00 53.12  ? 273 HOH A O     1 
HETATM 2190 O O     . HOH G 5 .  ? -0.770  31.662 8.896   1.00 33.78  ? 274 HOH A O     1 
HETATM 2191 O O     . HOH G 5 .  ? -1.653  33.021 25.205  1.00 38.74  ? 275 HOH A O     1 
HETATM 2192 O O     . HOH G 5 .  ? 6.969   43.029 12.962  1.00 41.63  ? 276 HOH A O     1 
HETATM 2193 O O     . HOH G 5 .  ? -3.566  24.493 16.760  1.00 33.09  ? 277 HOH A O     1 
HETATM 2194 O O     . HOH G 5 .  ? -5.761  34.078 26.604  1.00 43.93  ? 278 HOH A O     1 
HETATM 2195 O O     . HOH G 5 .  ? -0.269  33.901 15.453  1.00 32.80  ? 279 HOH A O     1 
HETATM 2196 O O     . HOH G 5 .  ? 4.972   37.531 11.876  1.00 37.57  ? 280 HOH A O     1 
HETATM 2197 O O     . HOH G 5 .  ? 4.255   36.179 20.858  1.00 40.05  ? 281 HOH A O     1 
HETATM 2198 O O     . HOH G 5 .  ? 18.551  27.273 14.349  1.00 59.81  ? 282 HOH A O     1 
HETATM 2199 O O     . HOH G 5 .  ? -8.020  34.040 27.829  1.00 40.73  ? 283 HOH A O     1 
HETATM 2200 O O     . HOH G 5 .  ? -3.398  35.528 30.744  1.00 67.10  ? 284 HOH A O     1 
HETATM 2201 O O     . HOH G 5 .  ? -6.081  25.324 17.618  1.00 40.30  ? 285 HOH A O     1 
HETATM 2202 O O     . HOH G 5 .  ? 4.655   33.008 3.712   1.00 42.36  ? 286 HOH A O     1 
HETATM 2203 O O     . HOH G 5 .  ? -8.182  35.081 3.888   1.00 38.23  ? 287 HOH A O     1 
HETATM 2204 O O     . HOH G 5 .  ? -15.516 43.468 11.077  1.00 46.23  ? 288 HOH A O     1 
HETATM 2205 O O     . HOH G 5 .  ? 3.310   29.717 26.909  1.00 54.42  ? 289 HOH A O     1 
HETATM 2206 O O     . HOH G 5 .  ? 4.192   26.883 3.781   1.00 64.93  ? 290 HOH A O     1 
HETATM 2207 O O     . HOH G 5 .  ? 0.800   45.957 14.679  1.00 48.86  ? 291 HOH A O     1 
HETATM 2208 O O     . HOH G 5 .  ? 5.832   25.533 20.870  1.00 40.82  ? 292 HOH A O     1 
HETATM 2209 O O     . HOH G 5 .  ? -4.523  33.282 10.547  1.00 38.64  ? 293 HOH A O     1 
HETATM 2210 O O     . HOH G 5 .  ? -10.038 28.706 6.972   1.00 70.82  ? 294 HOH A O     1 
HETATM 2211 O O     . HOH G 5 .  ? 2.855   30.657 4.851   1.00 43.28  ? 295 HOH A O     1 
HETATM 2212 O O     . HOH G 5 .  ? -6.283  48.967 12.648  1.00 63.94  ? 296 HOH A O     1 
HETATM 2213 O O     . HOH G 5 .  ? 2.837   27.163 1.615   1.00 47.86  ? 297 HOH A O     1 
HETATM 2214 O O     . HOH G 5 .  ? -3.685  43.209 2.046   1.00 65.61  ? 298 HOH A O     1 
HETATM 2215 O O     . HOH G 5 .  ? 2.588   46.258 3.049   1.00 71.38  ? 299 HOH A O     1 
HETATM 2216 O O     . HOH G 5 .  ? -12.871 27.971 22.212  1.00 69.00  ? 300 HOH A O     1 
HETATM 2217 O O     . HOH G 5 .  ? -1.484  27.609 -1.191  1.00 43.84  ? 301 HOH A O     1 
HETATM 2218 O O     . HOH G 5 .  ? 22.944  21.819 16.585  1.00 69.67  ? 302 HOH A O     1 
HETATM 2219 O O     . HOH G 5 .  ? 3.541   42.909 23.826  1.00 60.09  ? 303 HOH A O     1 
HETATM 2220 O O     . HOH G 5 .  ? -3.219  34.201 12.617  1.00 43.05  ? 304 HOH A O     1 
HETATM 2221 O O     . HOH G 5 .  ? -15.277 38.177 11.297  1.00 45.97  ? 305 HOH A O     1 
HETATM 2222 O O     . HOH G 5 .  ? 5.486   33.859 -0.611  1.00 47.37  ? 306 HOH A O     1 
HETATM 2223 O O     . HOH G 5 .  ? -14.843 29.952 -4.786  1.00 46.60  ? 307 HOH A O     1 
HETATM 2224 O O     . HOH G 5 .  ? 1.444   29.589 6.381   1.00 44.96  ? 308 HOH A O     1 
HETATM 2225 O O     . HOH G 5 .  ? 1.587   31.910 3.100   1.00 40.19  ? 309 HOH A O     1 
HETATM 2226 O O     . HOH G 5 .  ? 3.543   52.155 13.998  1.00 69.29  ? 310 HOH A O     1 
HETATM 2227 O O     . HOH G 5 .  ? 7.782   44.410 22.509  1.00 71.30  ? 311 HOH A O     1 
HETATM 2228 O O     . HOH G 5 .  ? -10.723 24.467 18.079  1.00 64.97  ? 312 HOH A O     1 
HETATM 2229 O O     . HOH G 5 .  ? -15.613 36.516 9.250   1.00 43.10  ? 313 HOH A O     1 
HETATM 2230 O O     . HOH G 5 .  ? -15.972 34.491 10.981  1.00 62.12  ? 314 HOH A O     1 
HETATM 2231 O O     . HOH G 5 .  ? -15.568 37.077 13.758  1.00 43.48  ? 315 HOH A O     1 
HETATM 2232 O O     . HOH G 5 .  ? 22.771  18.627 9.604   1.00 44.36  ? 316 HOH A O     1 
HETATM 2233 O O     . HOH G 5 .  ? -0.102  26.246 25.976  1.00 73.91  ? 317 HOH A O     1 
HETATM 2234 O O     . HOH G 5 .  ? -13.156 44.119 29.313  1.00 68.67  ? 318 HOH A O     1 
HETATM 2235 O O     . HOH G 5 .  ? -11.477 32.625 11.859  1.00 54.07  ? 319 HOH A O     1 
HETATM 2236 O O     . HOH G 5 .  ? -9.757  34.105 11.000  1.00 49.68  ? 320 HOH A O     1 
HETATM 2237 O O     . HOH G 5 .  ? 18.370  28.054 17.582  1.00 72.23  ? 321 HOH A O     1 
HETATM 2238 O O     . HOH G 5 .  ? -6.493  30.899 -13.073 1.00 70.64  ? 322 HOH A O     1 
HETATM 2239 O O     . HOH G 5 .  ? -13.447 43.106 31.664  1.00 58.21  ? 323 HOH A O     1 
HETATM 2240 O O     . HOH G 5 .  ? -13.150 51.341 8.482   1.00 51.94  ? 324 HOH A O     1 
HETATM 2241 O O     . HOH G 5 .  ? 0.269   47.996 1.709   1.00 72.11  ? 325 HOH A O     1 
HETATM 2242 O O     . HOH G 5 .  ? -12.356 48.038 30.587  1.00 70.01  ? 326 HOH A O     1 
HETATM 2243 O O     . HOH G 5 .  ? -2.419  27.386 25.626  1.00 50.90  ? 327 HOH A O     1 
HETATM 2244 O O     . HOH G 5 .  ? -4.712  26.797 24.446  1.00 60.71  ? 328 HOH A O     1 
HETATM 2245 O O     . HOH G 5 .  ? 1.787   44.127 0.514   1.00 55.09  ? 329 HOH A O     1 
HETATM 2246 O O     . HOH G 5 .  ? -10.712 32.882 -8.065  1.00 55.87  ? 330 HOH A O     1 
HETATM 2247 O O     . HOH G 5 .  ? -14.042 34.983 27.749  1.00 86.33  ? 331 HOH A O     1 
HETATM 2248 O O     . HOH G 5 .  ? -2.930  48.978 25.154  1.00 62.39  ? 332 HOH A O     1 
HETATM 2249 O O     . HOH G 5 .  ? 15.270  37.263 26.715  1.00 65.68  ? 333 HOH A O     1 
HETATM 2250 O O     . HOH G 5 .  ? -3.922  49.831 27.209  1.00 61.86  ? 334 HOH A O     1 
HETATM 2251 O O     . HOH G 5 .  ? 4.457   45.040 -2.763  1.00 62.48  ? 335 HOH A O     1 
HETATM 2252 O O     . HOH G 5 .  ? 11.422  37.849 21.439  1.00 63.36  ? 336 HOH A O     1 
HETATM 2253 O O     . HOH G 5 .  ? -12.147 44.582 19.446  1.00 62.03  ? 337 HOH A O     1 
HETATM 2254 O O     . HOH G 5 .  ? -16.550 40.885 10.788  1.00 46.15  ? 338 HOH A O     1 
HETATM 2255 O O     . HOH G 5 .  ? -12.160 48.678 26.064  1.00 53.48  ? 339 HOH A O     1 
HETATM 2256 O O     . HOH G 5 .  ? -9.468  30.972 -10.312 1.00 73.12  ? 340 HOH A O     1 
HETATM 2257 O O     . HOH G 5 .  ? 2.031   27.144 5.831   1.00 62.19  ? 341 HOH A O     1 
HETATM 2258 O O     . HOH G 5 .  ? 1.328   44.053 3.328   1.00 48.35  ? 342 HOH A O     1 
HETATM 2259 O O     . HOH G 5 .  ? 1.850   48.545 5.426   1.00 78.31  ? 343 HOH A O     1 
HETATM 2260 O O     . HOH G 5 .  ? 13.544  31.015 18.127  1.00 45.47  ? 344 HOH A O     1 
HETATM 2261 O O     . HOH G 5 .  ? -3.655  31.825 12.167  1.00 55.71  ? 345 HOH A O     1 
HETATM 2262 O O     . HOH H 5 .  ? 8.916   23.308 4.388   1.00 36.70  ? 306 HOH B O     1 
HETATM 2263 O O     . HOH H 5 .  ? 2.135   17.360 2.630   1.00 34.05  ? 307 HOH B O     1 
HETATM 2264 O O     . HOH H 5 .  ? 4.801   26.681 -0.129  1.00 36.98  ? 308 HOH B O     1 
HETATM 2265 O O     . HOH H 5 .  ? 14.162  21.211 11.723  1.00 35.05  ? 309 HOH B O     1 
HETATM 2266 O O     . HOH H 5 .  ? -4.056  16.245 -2.793  1.00 60.00  ? 310 HOH B O     1 
HETATM 2267 O O     . HOH H 5 .  ? 1.154   25.654 -3.693  1.00 44.31  ? 311 HOH B O     1 
HETATM 2268 O O     . HOH H 5 .  ? -18.943 18.593 0.312   1.00 44.65  ? 312 HOH B O     1 
HETATM 2269 O O     . HOH H 5 .  ? -16.311 15.963 0.728   1.00 45.13  ? 313 HOH B O     1 
HETATM 2270 O O     . HOH H 5 .  ? 6.222   14.192 5.962   1.00 32.58  ? 314 HOH B O     1 
HETATM 2271 O O     . HOH H 5 .  ? 4.765   19.109 11.688  1.00 35.45  ? 315 HOH B O     1 
HETATM 2272 O O     . HOH H 5 .  ? -0.306  11.112 -3.923  1.00 52.69  ? 316 HOH B O     1 
HETATM 2273 O O     . HOH H 5 .  ? -10.610 15.662 4.513   1.00 35.30  ? 317 HOH B O     1 
HETATM 2274 O O     . HOH H 5 .  ? -12.376 21.721 -1.259  1.00 53.82  ? 318 HOH B O     1 
HETATM 2275 O O     . HOH H 5 .  ? 16.128  26.465 0.473   1.00 43.53  ? 319 HOH B O     1 
HETATM 2276 O O     . HOH H 5 .  ? 11.201  22.594 3.034   1.00 34.32  ? 320 HOH B O     1 
HETATM 2277 O O     . HOH H 5 .  ? 1.620   24.902 -6.587  1.00 46.78  ? 321 HOH B O     1 
HETATM 2278 O O     . HOH H 5 .  ? 17.210  23.557 -3.748  1.00 41.88  ? 322 HOH B O     1 
HETATM 2279 O O     . HOH H 5 .  ? 4.156   10.629 2.458   1.00 41.20  ? 323 HOH B O     1 
HETATM 2280 O O     . HOH H 5 .  ? 13.991  29.551 -3.115  1.00 46.33  ? 324 HOH B O     1 
HETATM 2281 O O     . HOH H 5 .  ? 1.032   28.518 -0.500  1.00 47.93  ? 325 HOH B O     1 
HETATM 2282 O O     . HOH H 5 .  ? 7.971   7.895  4.667   1.00 46.25  ? 326 HOH B O     1 
HETATM 2283 O O     . HOH H 5 .  ? 19.764  20.178 -4.591  1.00 47.13  ? 327 HOH B O     1 
HETATM 2284 O O     . HOH H 5 .  ? 6.356   28.250 2.824   1.00 46.17  ? 328 HOH B O     1 
HETATM 2285 O O     . HOH H 5 .  ? 7.077   27.922 0.436   1.00 48.59  ? 329 HOH B O     1 
HETATM 2286 O O     . HOH H 5 .  ? 17.452  21.199 -4.860  1.00 52.84  ? 330 HOH B O     1 
HETATM 2287 O O     . HOH H 5 .  ? 4.458   11.623 14.807  1.00 55.03  ? 331 HOH B O     1 
HETATM 2288 O O     . HOH H 5 .  ? 9.589   27.926 -1.212  1.00 58.99  ? 332 HOH B O     1 
HETATM 2289 O O     . HOH H 5 .  ? -2.792  17.777 -4.742  1.00 48.54  ? 333 HOH B O     1 
HETATM 2290 O O     . HOH H 5 .  ? 6.425   10.008 12.981  1.00 62.71  ? 334 HOH B O     1 
HETATM 2291 O O     . HOH H 5 .  ? -3.921  15.233 0.306   1.00 50.08  ? 335 HOH B O     1 
HETATM 2292 O O     . HOH H 5 .  ? -17.672 16.452 6.469   1.00 63.75  ? 336 HOH B O     1 
HETATM 2293 O O     . HOH H 5 .  ? 4.562   11.969 8.451   1.00 52.87  ? 337 HOH B O     1 
HETATM 2294 O O     . HOH H 5 .  ? 6.443   29.078 -13.896 1.00 78.81  ? 338 HOH B O     1 
HETATM 2295 O O     . HOH H 5 .  ? -3.088  15.181 -8.394  1.00 60.76  ? 339 HOH B O     1 
HETATM 2296 O O     . HOH H 5 .  ? 6.372   13.197 16.264  1.00 63.59  ? 340 HOH B O     1 
HETATM 2297 O O     . HOH H 5 .  ? -18.216 11.497 1.230   1.00 59.41  ? 341 HOH B O     1 
HETATM 2298 O O     . HOH H 5 .  ? 4.153   24.426 5.450   1.00 53.61  ? 342 HOH B O     1 
HETATM 2299 O O     . HOH H 5 .  ? 9.603   6.388  -6.796  1.00 74.76  ? 343 HOH B O     1 
HETATM 2300 O O     . HOH H 5 .  ? 4.081   25.645 -9.564  1.00 64.72  ? 344 HOH B O     1 
HETATM 2301 O O     . HOH H 5 .  ? -1.733  19.433 -8.263  1.00 75.05  ? 345 HOH B O     1 
HETATM 2302 O O     . HOH H 5 .  ? 18.669  24.394 -8.021  1.00 73.45  ? 346 HOH B O     1 
HETATM 2303 O O     . HOH H 5 .  ? 3.166   15.730 5.059   1.00 44.27  ? 347 HOH B O     1 
HETATM 2304 O O     . HOH H 5 .  ? 8.540   10.935 15.487  1.00 59.05  ? 348 HOH B O     1 
HETATM 2305 O O     . HOH H 5 .  ? -1.940  11.637 -7.728  1.00 56.37  ? 349 HOH B O     1 
HETATM 2306 O O     . HOH H 5 .  ? 5.181   31.983 -15.850 1.00 57.01  ? 350 HOH B O     1 
HETATM 2307 O O     . HOH H 5 .  ? 0.014   3.836  -3.348  1.00 52.51  ? 351 HOH B O     1 
HETATM 2308 O O     . HOH H 5 .  ? 23.552  2.500  10.517  1.00 73.18  ? 352 HOH B O     1 
HETATM 2309 O O     . HOH H 5 .  ? 22.145  8.481  7.134   1.00 69.60  ? 353 HOH B O     1 
HETATM 2310 O O     . HOH H 5 .  ? 17.817  31.764 -10.773 1.00 61.63  ? 354 HOH B O     1 
HETATM 2311 O O     . HOH H 5 .  ? -2.378  25.546 0.391   1.00 62.84  ? 355 HOH B O     1 
HETATM 2312 O O     . HOH H 5 .  ? -2.603  22.128 -1.921  1.00 48.36  ? 356 HOH B O     1 
HETATM 2313 O O     . HOH H 5 .  ? 23.560  -0.820 8.826   1.00 68.74  ? 357 HOH B O     1 
HETATM 2314 O O     . HOH H 5 .  ? 1.308   11.927 -11.382 1.00 73.52  ? 358 HOH B O     1 
HETATM 2315 O O     . HOH H 5 .  ? 0.461   9.302  -8.756  1.00 74.07  ? 359 HOH B O     1 
HETATM 2316 O O     . HOH H 5 .  ? -19.563 14.168 6.556   1.00 66.56  ? 360 HOH B O     1 
HETATM 2317 O O     . HOH H 5 .  ? 12.444  7.947  -6.008  1.00 59.20  ? 361 HOH B O     1 
HETATM 2318 O O     . HOH H 5 .  ? 6.745   4.989  -1.094  1.00 63.07  ? 362 HOH B O     1 
HETATM 2319 O O     . HOH H 5 .  ? 17.926  13.990 -5.112  1.00 59.89  ? 363 HOH B O     1 
HETATM 2320 O O     . HOH H 5 .  ? 6.472   31.300 -18.128 1.00 86.89  ? 364 HOH B O     1 
HETATM 2321 O O     . HOH H 5 .  ? 22.044  6.740  -5.882  1.00 73.65  ? 365 HOH B O     1 
HETATM 2322 O O     . HOH H 5 .  ? 14.429  14.363 -6.282  1.00 51.83  ? 366 HOH B O     1 
HETATM 2323 O O     . HOH H 5 .  ? -16.643 12.766 4.673   1.00 67.96  ? 367 HOH B O     1 
HETATM 2324 O O     . HOH H 5 .  ? 20.045  7.463  -3.910  1.00 63.92  ? 368 HOH B O     1 
HETATM 2325 O O     . HOH H 5 .  ? 0.856   2.526  -6.340  1.00 64.29  ? 369 HOH B O     1 
HETATM 2326 O O     . HOH H 5 .  ? 2.923   27.202 -2.120  1.00 41.40  ? 370 HOH B O     1 
HETATM 2327 O O     . HOH H 5 .  ? 17.498  26.212 -6.693  1.00 54.97  ? 371 HOH B O     1 
HETATM 2328 O O     . HOH H 5 .  ? 17.591  20.628 -0.088  1.00 49.99  ? 372 HOH B O     1 
HETATM 2329 O O     . HOH H 5 .  ? 20.577  25.085 -5.349  1.00 64.55  ? 373 HOH B O     1 
A 1 1  DA  1  1   1   DA  ADE D . n 
A 1 2  DC  2  2   2   DC  CYT D . n 
A 1 3  DT  3  3   3   DT  THY D . n 
A 1 4  DC  4  4   4   DC  CYT D . n 
A 1 5  DT  5  5   5   DT  THY D . n 
A 1 6  DA  6  6   6   DA  ADE D . n 
A 1 7  DT  7  7   7   DT  THY D . n 
A 1 8  DG  8  8   8   DG  GUA D . n 
A 1 9  DA  9  9   9   DA  ADE D . n 
A 1 10 DT  10 10  10  DT  THY D . n 
A 1 11 DT  11 11  11  DT  THY D . n 
A 1 12 DT  12 12  12  DT  THY D . n 
A 1 13 DA  13 13  13  DA  ADE D . n 
A 1 14 DC  14 14  14  DC  CYT D . n 
A 1 15 DG  15 15  15  DG  GUA D . n 
A 1 16 DA  16 16  16  DA  ADE D . n 
A 1 17 DC  17 17  17  DC  CYT D . n 
A 1 18 DG  18 18  18  DG  GUA D . n 
A 1 19 DC  19 19  19  DC  CYT D . n 
A 1 20 DT  20 20  20  DT  THY D . n 
B 2 1  DT  1  21  21  DT  THY E . n 
B 2 2  DA  2  22  22  DA  ADE E . n 
B 2 3  DG  3  23  23  DG  GUA E . n 
B 2 4  DC  4  24  24  DC  CYT E . n 
B 2 5  DG  5  25  25  DG  GUA E . n 
B 2 6  DT  6  26  26  DT  THY E . n 
B 2 7  DC  7  27  27  DC  CYT E . n 
B 2 8  DG  8  28  28  DG  GUA E . n 
B 2 9  DT  9  29  29  DT  THY E . n 
B 2 10 DA  10 30  30  DA  ADE E . n 
B 2 11 DA  11 31  31  DA  ADE E . n 
B 2 12 DA  12 32  32  DA  ADE E . n 
B 2 13 DT  13 33  33  DT  THY E . n 
B 2 14 DC  14 34  34  DC  CYT E . n 
B 2 15 DA  15 35  35  DA  ADE E . n 
B 2 16 DT  16 36  36  DT  THY E . n 
B 2 17 DA  17 37  37  DA  ADE E . n 
B 2 18 DG  18 38  38  DG  GUA E . n 
B 2 19 DA  19 39  39  DA  ADE E . n 
B 2 20 DG  20 40  40  DG  GUA E . n 
C 3 1  ASN 1  193 193 ASN ASN A . n 
C 3 2  ASN 2  194 194 ASN ASN A . n 
C 3 3  PRO 3  195 195 PRO PRO A . n 
C 3 4  ALA 4  196 196 ALA ALA A . n 
C 3 5  ALA 5  197 197 ALA ALA A . n 
C 3 6  ASN 6  198 198 ASN ASN A . n 
C 3 7  TRP 7  199 199 TRP TRP A . n 
C 3 8  LEU 8  200 200 LEU LEU A . n 
C 3 9  HIS 9  201 201 HIS HIS A . n 
C 3 10 ALA 10 202 202 ALA ALA A . n 
C 3 11 ARG 11 203 203 ARG ARG A . n 
C 3 12 SER 12 204 204 SER SER A . n 
C 3 13 THR 13 205 205 THR THR A . n 
C 3 14 ARG 14 206 206 ARG ARG A . n 
C 3 15 LYS 15 207 207 LYS LYS A . n 
C 3 16 LYS 16 208 208 LYS LYS A . n 
C 3 17 ARG 17 209 209 ARG ARG A . n 
C 3 18 CYS 18 210 210 CYS CYS A . n 
C 3 19 PRO 19 211 211 PRO PRO A . n 
C 3 20 TYR 20 212 212 TYR TYR A . n 
C 3 21 THR 21 213 213 THR THR A . n 
C 3 22 LYS 22 214 214 LYS LYS A . n 
C 3 23 HIS 23 215 215 HIS HIS A . n 
C 3 24 GLN 24 216 216 GLN GLN A . n 
C 3 25 THR 25 217 217 THR THR A . n 
C 3 26 LEU 26 218 218 LEU LEU A . n 
C 3 27 GLU 27 219 219 GLU GLU A . n 
C 3 28 LEU 28 220 220 LEU LEU A . n 
C 3 29 GLU 29 221 221 GLU GLU A . n 
C 3 30 LYS 30 222 222 LYS LYS A . n 
C 3 31 GLU 31 223 223 GLU GLU A . n 
C 3 32 PHE 32 224 224 PHE PHE A . n 
C 3 33 LEU 33 225 225 LEU LEU A . n 
C 3 34 PHE 34 226 226 PHE PHE A . n 
C 3 35 ASN 35 227 227 ASN ALA A . n 
C 3 36 MET 36 228 228 MET MET A . n 
C 3 37 TYR 37 229 229 TYR TYR A . n 
C 3 38 LEU 38 230 230 LEU LEU A . n 
C 3 39 THR 39 231 231 THR THR A . n 
C 3 40 ARG 40 232 232 ARG ARG A . n 
C 3 41 ASP 41 233 233 ASP ASP A . n 
C 3 42 ARG 42 234 234 ARG ARG A . n 
C 3 43 ARG 43 235 235 ARG ARG A . n 
C 3 44 TYR 44 236 236 TYR ALA A . n 
C 3 45 GLU 45 237 237 GLU ALA A . n 
C 3 46 VAL 46 238 238 VAL VAL A . n 
C 3 47 ALA 47 239 239 ALA ALA A . n 
C 3 48 ARG 48 240 240 ARG ALA A . n 
C 3 49 LEU 49 241 241 LEU LEU A . n 
C 3 50 LEU 50 242 242 LEU LEU A . n 
C 3 51 ASN 51 243 243 ASN ASN A . n 
C 3 52 LEU 52 244 244 LEU LEU A . n 
C 3 53 THR 53 245 245 THR THR A . n 
C 3 54 GLU 54 246 246 GLU GLU A . n 
C 3 55 ARG 55 247 247 ARG ARG A . n 
C 3 56 GLN 56 248 248 GLN GLN A . n 
C 3 57 VAL 57 249 249 VAL VAL A . n 
C 3 58 LYS 58 250 250 LYS LYS A . n 
C 3 59 ILE 59 251 251 ILE ILE A . n 
C 3 60 TRP 60 252 252 TRP TRP A . n 
C 3 61 PHE 61 253 253 PHE PHE A . n 
C 3 62 GLN 62 254 254 GLN GLN A . n 
C 3 63 ASN 63 255 255 ASN ASN A . n 
C 3 64 ARG 64 256 256 ARG ARG A . n 
C 3 65 ARG 65 257 257 ARG ARG A . n 
C 3 66 MET 66 258 258 MET MET A . n 
C 3 67 LYS 67 259 259 LYS LYS A . n 
C 3 68 MET 68 260 260 MET MET A . n 
C 3 69 LYS 69 261 261 LYS LYS A . n 
C 3 70 LYS 70 262 262 LYS LYS A . n 
C 3 71 ILE 71 263 263 ILE ILE A . n 
C 3 72 ASN 72 264 264 ASN ASN A . n 
C 3 73 LYS 73 265 265 LYS ALA A . n 
C 3 74 ASP 74 266 266 ASP ALA A . n 
C 3 75 ARG 75 267 267 ARG ARG A . n 
C 3 76 ALA 76 268 268 ALA ALA A . n 
C 3 77 LYS 77 269 269 LYS ALA A . n 
D 4 1  ALA 1  233 233 ALA ALA B . n 
D 4 2  ARG 2  234 234 ARG ARG B . n 
D 4 3  ARG 3  235 235 ARG ARG B . n 
D 4 4  LYS 4  236 236 LYS LYS B . n 
D 4 5  ARG 5  237 237 ARG ARG B . n 
D 4 6  ARG 6  238 238 ARG ARG B . n 
D 4 7  ASN 7  239 239 ASN ASN B . n 
D 4 8  PHE 8  240 240 PHE PHE B . n 
D 4 9  ASN 9  241 241 ASN ASN B . n 
D 4 10 LYS 10 242 242 LYS LYS B . n 
D 4 11 GLN 11 243 243 GLN GLN B . n 
D 4 12 ALA 12 244 244 ALA ALA B . n 
D 4 13 THR 13 245 245 THR THR B . n 
D 4 14 GLU 14 246 246 GLU ALA B . n 
D 4 15 ILE 15 247 247 ILE ILE B . n 
D 4 16 LEU 16 248 248 LEU LEU B . n 
D 4 17 ASN 17 249 249 ASN ASN B . n 
D 4 18 GLU 18 250 250 GLU ALA B . n 
D 4 19 TYR 19 251 251 TYR TYR B . n 
D 4 20 PHE 20 252 252 PHE PHE B . n 
D 4 21 TYR 21 253 253 TYR TYR B . n 
D 4 22 SER 22 254 254 SER SER B . n 
D 4 23 HIS 23 255 255 HIS HIS B . n 
D 4 24 LEU 24 256 256 LEU LEU B . n 
D 4 25 SER 25 257 257 SER SER B . n 
D 4 26 ASN 26 258 258 ASN ASN B . n 
D 4 27 PRO 27 259 259 PRO PRO B . n 
D 4 28 TYR 28 260 260 TYR TYR B . n 
D 4 29 PRO 29 261 261 PRO PRO B . n 
D 4 30 SER 30 262 262 SER SER B . n 
D 4 31 GLU 31 263 263 GLU ALA B . n 
D 4 32 GLU 32 264 264 GLU GLU B . n 
D 4 33 ALA 33 265 265 ALA ALA B . n 
D 4 34 LYS 34 266 266 LYS LYS B . n 
D 4 35 GLU 35 267 267 GLU GLU B . n 
D 4 36 GLU 36 268 268 GLU GLU B . n 
D 4 37 LEU 37 269 269 LEU LEU B . n 
D 4 38 ALA 38 270 270 ALA ALA B . n 
D 4 39 LYS 39 271 271 LYS LYS B . n 
D 4 40 LYS 40 272 272 LYS LYS B . n 
D 4 41 CYS 41 273 273 CYS CYS B . n 
D 4 42 GLY 42 274 274 GLY GLY B . n 
D 4 43 ILE 43 275 275 ILE ILE B . n 
D 4 44 THR 44 276 276 THR THR B . n 
D 4 45 VAL 45 277 277 VAL VAL B . n 
D 4 46 SER 46 278 278 SER SER B . n 
D 4 47 GLN 47 279 279 GLN GLN B . n 
D 4 48 VAL 48 280 280 VAL VAL B . n 
D 4 49 SER 49 281 281 SER SER B . n 
D 4 50 ASN 50 282 282 ASN ASN B . n 
D 4 51 TRP 51 283 283 TRP TRP B . n 
D 4 52 PHE 52 284 284 PHE PHE B . n 
D 4 53 GLY 53 285 285 GLY GLY B . n 
D 4 54 ASN 54 286 286 ASN ASN B . n 
D 4 55 LYS 55 287 287 LYS LYS B . n 
D 4 56 ARG 56 288 288 ARG ARG B . n 
D 4 57 ILE 57 289 289 ILE ILE B . n 
D 4 58 ARG 58 290 290 ARG ARG B . n 
D 4 59 TYR 59 291 291 TYR TYR B . n 
D 4 60 LYS 60 292 292 LYS LYS B . n 
D 4 61 LYS 61 293 293 LYS LYS B . n 
D 4 62 ASN 62 294 294 ASN ASN B . n 
D 4 63 ILE 63 295 295 ILE ILE B . n 
D 4 64 GLY 64 296 296 GLY GLY B . n 
D 4 65 LYS 65 297 297 LYS ALA B . n 
D 4 66 PHE 66 298 298 PHE PHE B . n 
D 4 67 GLN 67 299 299 GLN GLN B . n 
D 4 68 GLU 68 300 300 GLU GLY B . n 
D 4 69 GLU 69 301 301 GLU GLU B . n 
D 4 70 ALA 70 302 302 ALA ALA B . n 
D 4 71 ASN 71 303 303 ASN ASN B . n 
D 4 72 ILE 72 304 304 ILE ILE B . n 
D 4 73 TYR 73 305 305 TYR TYR B . n 
#                   1 
_pdbx_struct_assembly.details              author_defined_assembly 
_pdbx_struct_assembly.method_details       ? 
_pdbx_struct_assembly.oligomeric_details   tetrameric 
_pdbx_struct_assembly.oligomeric_count     4 
_pdbx_struct_assembly_gen.assembly_id       1 
_pdbx_struct_assembly_gen.oper_expression   1 
_pdbx_struct_assembly_gen.asym_id_list      A,B,C,D,E,F,G,H 
#                   1 
_pdbx_struct_oper_list.type                 'identity operation'                 1_555 
_pdbx_struct_oper_list.symmetry_operation   x,y,z 
_pdbx_struct_oper_list.matrix[1][1]         1.0000000000 
_pdbx_struct_oper_list.matrix[1][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[1][3]         0.0000000000 
_pdbx_struct_oper_list.vector[1]            0.0000000000 
_pdbx_struct_oper_list.matrix[2][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[2][2]         1.0000000000 
_pdbx_struct_oper_list.matrix[2][3]         0.0000000000 
_pdbx_struct_oper_list.vector[2]            0.0000000000 
_pdbx_struct_oper_list.matrix[3][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][3]         1.0000000000 
_pdbx_struct_oper_list.vector[3]            0.0000000000 
1 'Structure model' 1 0 2003-09-02 
2 'Structure model' 1 1 2008-04-29 
3 'Structure model' 1 2 2011-07-13 
_pdbx_audit_revision_details.ordinal             1 
_pdbx_audit_revision_details.revision_ordinal    1 
_pdbx_audit_revision_details.data_content_type   'Structure model' 
_pdbx_audit_revision_details.provider            repository 
_pdbx_audit_revision_details.type                'Initial release' 
_pdbx_audit_revision_details.description         ? 
1 2 'Structure model' 'Version format compliance' 
2 3 'Structure model' 'Version format compliance' 
DENZO     'data reduction' .   ? 1 
SCALEPACK 'data scaling'   .   ? 2 
AMoRE     phasing          .   ? 3 
CNS       refinement       1.0 ? 4 
#               1 
_pdbx_validate_close_contact.PDB_model_num    1 
_pdbx_validate_close_contact.auth_atom_id_1   OE1 
_pdbx_validate_close_contact.auth_asym_id_1   A 
_pdbx_validate_close_contact.auth_comp_id_1   GLU 
_pdbx_validate_close_contact.auth_seq_id_1    221 
_pdbx_validate_close_contact.PDB_ins_code_1   ? 
_pdbx_validate_close_contact.label_alt_id_1   ? 
_pdbx_validate_close_contact.auth_atom_id_2   O 
_pdbx_validate_close_contact.auth_asym_id_2   A 
_pdbx_validate_close_contact.auth_comp_id_2   HOH 
_pdbx_validate_close_contact.auth_seq_id_2    320 
_pdbx_validate_close_contact.PDB_ins_code_2   ? 
_pdbx_validate_close_contact.label_alt_id_2   ? 
_pdbx_validate_close_contact.dist             2.19 
#                1 
_pdbx_validate_symm_contact.PDB_model_num     1 
_pdbx_validate_symm_contact.auth_atom_id_1    O 
_pdbx_validate_symm_contact.auth_asym_id_1    A 
_pdbx_validate_symm_contact.auth_comp_id_1    HOH 
_pdbx_validate_symm_contact.auth_seq_id_1     317 
_pdbx_validate_symm_contact.PDB_ins_code_1    ? 
_pdbx_validate_symm_contact.label_alt_id_1    ? 
_pdbx_validate_symm_contact.site_symmetry_1   1_555 
_pdbx_validate_symm_contact.auth_atom_id_2    O 
_pdbx_validate_symm_contact.auth_asym_id_2    A 
_pdbx_validate_symm_contact.auth_comp_id_2    HOH 
_pdbx_validate_symm_contact.auth_seq_id_2     317 
_pdbx_validate_symm_contact.PDB_ins_code_2    ? 
_pdbx_validate_symm_contact.label_alt_id_2    ? 
_pdbx_validate_symm_contact.site_symmetry_2   3_555 
_pdbx_validate_symm_contact.dist              2.14 
1 1 "O3'" D DT 11 ? ? P     D DT 12 ? ? OP2   D DT 12 ? ? 119.11 110.50 8.61   1.10 Y 
2 1 "O3'" D DA 13 ? ? P     D DC 14 ? ? OP2   D DC 14 ? ? 118.14 110.50 7.64   1.10 Y 
3 1 "O4'" D DC 17 ? ? "C1'" D DC 17 ? ? N1    D DC 17 ? ? 110.35 108.30 2.05   0.30 N 
4 1 "C5'" E DA 37 ? ? "C4'" E DA 37 ? ? "C3'" E DA 37 ? ? 101.10 114.10 -13.00 1.80 N 
1 1 SER A 204 ? ? -52.48  -2.23  
2 1 ASN B 258 ? ? -172.29 73.44  
3 1 GLU B 300 ? ? 85.10   -44.50 
1 1 DT D 11 ? ? 0.076 'SIDE CHAIN' 
2 1 DC D 17 ? ? 0.103 'SIDE CHAIN' 
3 1 DC E 24 ? ? 0.083 'SIDE CHAIN' 
4 1 DA E 37 ? ? 0.093 'SIDE CHAIN' 
1  1 Y 1 A ASN 227 ? CG  ? C ASN 35 CG  
2  1 Y 1 A ASN 227 ? OD1 ? C ASN 35 OD1 
3  1 Y 1 A ASN 227 ? ND2 ? C ASN 35 ND2 
4  1 Y 1 A TYR 236 ? CG  ? C TYR 44 CG  
5  1 Y 1 A TYR 236 ? CD1 ? C TYR 44 CD1 
6  1 Y 1 A TYR 236 ? CD2 ? C TYR 44 CD2 
7  1 Y 1 A TYR 236 ? CE1 ? C TYR 44 CE1 
8  1 Y 1 A TYR 236 ? CE2 ? C TYR 44 CE2 
9  1 Y 1 A TYR 236 ? CZ  ? C TYR 44 CZ  
10 1 Y 1 A TYR 236 ? OH  ? C TYR 44 OH  
11 1 Y 1 A GLU 237 ? CG  ? C GLU 45 CG  
12 1 Y 1 A GLU 237 ? CD  ? C GLU 45 CD  
13 1 Y 1 A GLU 237 ? OE1 ? C GLU 45 OE1 
14 1 Y 1 A GLU 237 ? OE2 ? C GLU 45 OE2 
15 1 Y 1 A ARG 240 ? CG  ? C ARG 48 CG  
16 1 Y 1 A ARG 240 ? CD  ? C ARG 48 CD  
17 1 Y 1 A ARG 240 ? NE  ? C ARG 48 NE  
18 1 Y 1 A ARG 240 ? CZ  ? C ARG 48 CZ  
19 1 Y 1 A ARG 240 ? NH1 ? C ARG 48 NH1 
20 1 Y 1 A ARG 240 ? NH2 ? C ARG 48 NH2 
21 1 Y 1 A LYS 265 ? CG  ? C LYS 73 CG  
22 1 Y 1 A LYS 265 ? CD  ? C LYS 73 CD  
23 1 Y 1 A LYS 265 ? CE  ? C LYS 73 CE  
24 1 Y 1 A LYS 265 ? NZ  ? C LYS 73 NZ  
25 1 Y 1 A ASP 266 ? CG  ? C ASP 74 CG  
26 1 Y 1 A ASP 266 ? OD1 ? C ASP 74 OD1 
27 1 Y 1 A ASP 266 ? OD2 ? C ASP 74 OD2 
28 1 Y 1 A LYS 269 ? CG  ? C LYS 77 CG  
29 1 Y 1 A LYS 269 ? CD  ? C LYS 77 CD  
30 1 Y 1 A LYS 269 ? CE  ? C LYS 77 CE  
31 1 Y 1 A LYS 269 ? NZ  ? C LYS 77 NZ  
32 1 Y 1 B GLU 246 ? CG  ? D GLU 14 CG  
33 1 Y 1 B GLU 246 ? CD  ? D GLU 14 CD  
34 1 Y 1 B GLU 246 ? OE1 ? D GLU 14 OE1 
35 1 Y 1 B GLU 246 ? OE2 ? D GLU 14 OE2 
36 1 Y 1 B GLU 250 ? CG  ? D GLU 18 CG  
37 1 Y 1 B GLU 250 ? CD  ? D GLU 18 CD  
38 1 Y 1 B GLU 250 ? OE1 ? D GLU 18 OE1 
39 1 Y 1 B GLU 250 ? OE2 ? D GLU 18 OE2 
40 1 Y 1 B GLU 263 ? CG  ? D GLU 31 CG  
41 1 Y 1 B GLU 263 ? CD  ? D GLU 31 CD  
42 1 Y 1 B GLU 263 ? OE1 ? D GLU 31 OE1 
43 1 Y 1 B GLU 263 ? OE2 ? D GLU 31 OE2 
44 1 Y 1 B LYS 297 ? CG  ? D LYS 65 CG  
45 1 Y 1 B LYS 297 ? CD  ? D LYS 65 CD  
46 1 Y 1 B LYS 297 ? CE  ? D LYS 65 CE  
47 1 Y 1 B LYS 297 ? NZ  ? D LYS 65 NZ  
48 1 Y 1 B GLU 300 ? CB  ? D GLU 68 CB  
49 1 Y 1 B GLU 300 ? CG  ? D GLU 68 CG  
50 1 Y 1 B GLU 300 ? CD  ? D GLU 68 CD  
51 1 Y 1 B GLU 300 ? OE1 ? D GLU 68 OE1 
52 1 Y 1 B GLU 300 ? OE2 ? D GLU 68 OE2 
1PUF 'double helix'        
1PUF 'b-form double helix' 
1 A DC 2  1_555 B DG 20 1_555 -0.056 -0.472 0.160  4.192   -10.210 -4.204 1  D_DC2:DG40_E  D 2  ? E 40 ? 19 1 
1 A DT 3  1_555 B DA 19 1_555 -0.641 -0.364 0.204  5.641   -18.984 -8.823 2  D_DT3:DA39_E  D 3  ? E 39 ? 20 1 
1 A DC 4  1_555 B DG 18 1_555 -0.178 -0.126 0.145  0.635   -10.437 6.655  3  D_DC4:DG38_E  D 4  ? E 38 ? 19 1 
1 A DT 5  1_555 B DA 17 1_555 0.366  0.002  0.175  5.149   -20.058 4.325  4  D_DT5:DA37_E  D 5  ? E 37 ? 20 1 
1 A DA 6  1_555 B DT 16 1_555 0.030  0.039  -0.095 -8.973  -4.865  2.061  5  D_DA6:DT36_E  D 6  ? E 36 ? 20 1 
1 A DT 7  1_555 B DA 15 1_555 -0.171 -0.064 0.052  5.059   -6.542  3.652  6  D_DT7:DA35_E  D 7  ? E 35 ? 20 1 
1 A DG 8  1_555 B DC 14 1_555 -0.334 -0.125 -0.077 2.110   -11.498 2.324  7  D_DG8:DC34_E  D 8  ? E 34 ? 19 1 
1 A DA 9  1_555 B DT 13 1_555 0.116  -0.050 -0.053 -5.569  -12.176 6.732  8  D_DA9:DT33_E  D 9  ? E 33 ? 20 1 
1 A DT 10 1_555 B DA 12 1_555 0.006  -0.103 0.214  -9.162  -18.328 0.304  9  D_DT10:DA32_E D 10 ? E 32 ? 20 1 
1 A DT 11 1_555 B DA 11 1_555 -0.048 -0.056 0.266  -14.312 -21.587 2.277  10 D_DT11:DA31_E D 11 ? E 31 ? 20 1 
1 A DT 12 1_555 B DA 10 1_555 0.075  -0.167 -0.079 -11.304 -14.841 5.241  11 D_DT12:DA30_E D 12 ? E 30 ? 20 1 
1 A DA 13 1_555 B DT 9  1_555 -0.093 -0.105 0.190  -4.081  -7.698  0.109  12 D_DA13:DT29_E D 13 ? E 29 ? 20 1 
1 A DC 14 1_555 B DG 8  1_555 0.373  -0.234 0.040  3.252   -10.130 -1.677 13 D_DC14:DG28_E D 14 ? E 28 ? 19 1 
1 A DG 15 1_555 B DC 7  1_555 -0.158 -0.233 0.130  7.386   -6.979  -2.195 14 D_DG15:DC27_E D 15 ? E 27 ? 19 1 
1 A DA 16 1_555 B DT 6  1_555 0.224  0.005  -0.048 6.908   -9.471  -3.116 15 D_DA16:DT26_E D 16 ? E 26 ? 20 1 
1 A DC 17 1_555 B DG 5  1_555 0.182  -0.009 -0.073 15.514  -18.598 0.756  16 D_DC17:DG25_E D 17 ? E 25 ? 19 1 
1 A DG 18 1_555 B DC 4  1_555 -0.266 -0.165 -0.264 -19.457 -11.262 -3.375 17 D_DG18:DC24_E D 18 ? E 24 ? 19 1 
1 A DC 19 1_555 B DG 3  1_555 -0.068 -0.200 0.054  -10.331 0.849   -3.803 18 D_DC19:DG23_E D 19 ? E 23 ? 19 1 
1 A DT 20 1_555 B DA 2  1_555 0.483  0.147  0.002  0.938   0.814   3.109  19 D_DT20:DA22_E D 20 ? E 22 ? 20 1 
1 A DC 2  1_555 B DG 20 1_555 A DT 3  1_555 B DA 19 1_555 -0.349 0.014  3.192 -0.309 3.822  30.558 -0.702 0.598  3.173 7.215  
0.584  30.792 1  DD_DC2DT3:DA39DG40_EE   D 2  ? E 40 ? D 3  ? E 39 ? 
1 A DT 3  1_555 B DA 19 1_555 A DC 4  1_555 B DG 18 1_555 0.963  0.445  3.393 4.855  1.375  42.848 0.462  -0.806 3.489 1.874  
-6.618 43.131 2  DD_DT3DC4:DG38DA39_EE   D 3  ? E 39 ? D 4  ? E 38 ? 
1 A DC 4  1_555 B DG 18 1_555 A DT 5  1_555 B DA 17 1_555 -0.379 0.490  3.250 2.374  3.056  31.406 0.335  1.133  3.246 5.618  
-4.365 31.637 3  DD_DC4DT5:DA37DG38_EE   D 4  ? E 38 ? D 5  ? E 37 ? 
1 A DT 5  1_555 B DA 17 1_555 A DA 6  1_555 B DT 16 1_555 0.139  1.525  3.549 0.561  -5.529 49.349 2.248  -0.122 3.371 -6.598 
-0.670 49.641 4  DD_DT5DA6:DT36DA37_EE   D 5  ? E 37 ? D 6  ? E 36 ? 
1 A DA 6  1_555 B DT 16 1_555 A DT 7  1_555 B DA 15 1_555 -0.136 0.058  3.087 -1.124 0.686  24.547 -0.063 -0.007 3.090 1.611  
2.641  24.582 5  DD_DA6DT7:DA35DT36_EE   D 6  ? E 36 ? D 7  ? E 35 ? 
1 A DT 7  1_555 B DA 15 1_555 A DG 8  1_555 B DC 14 1_555 -0.321 0.554  3.332 -1.907 8.479  37.041 -0.273 0.240  3.385 13.126 
2.953  38.012 6  DD_DT7DG8:DC34DA35_EE   D 7  ? E 35 ? D 8  ? E 34 ? 
1 A DG 8  1_555 B DC 14 1_555 A DA 9  1_555 B DT 13 1_555 0.124  -0.587 3.450 0.603  1.870  39.665 -1.093 -0.109 3.422 2.754  
-0.888 39.712 7  DD_DG8DA9:DT33DC34_EE   D 8  ? E 34 ? D 9  ? E 33 ? 
1 A DA 9  1_555 B DT 13 1_555 A DT 10 1_555 B DA 12 1_555 -0.716 -0.701 3.349 -3.830 -0.793 33.521 -1.074 0.588  3.422 -1.370 
6.612  33.742 8  DD_DA9DT10:DA32DT33_EE  D 9  ? E 33 ? D 10 ? E 32 ? 
1 A DT 10 1_555 B DA 12 1_555 A DT 11 1_555 B DA 11 1_555 -0.129 -0.141 3.299 -0.785 0.269  36.664 -0.261 0.097  3.299 0.428  
1.248  36.673 9  DD_DT10DT11:DA31DA32_EE D 10 ? E 32 ? D 11 ? E 31 ? 
1 A DT 11 1_555 B DA 11 1_555 A DT 12 1_555 B DA 10 1_555 -0.463 0.350  3.143 1.586  8.213  33.968 -0.622 1.004  3.116 13.799 
-2.664 34.953 10 DD_DT11DT12:DA30DA31_EE D 11 ? E 31 ? D 12 ? E 30 ? 
1 A DT 12 1_555 B DA 10 1_555 A DA 13 1_555 B DT 9  1_555 0.548  0.135  3.265 -2.450 4.959  36.771 -0.446 -1.185 3.213 7.807  
3.856  37.171 11 DD_DT12DA13:DT29DA30_EE D 12 ? E 30 ? D 13 ? E 29 ? 
1 A DA 13 1_555 B DT 9  1_555 A DC 14 1_555 B DG 8  1_555 -0.175 -0.623 3.136 1.898  -0.551 28.200 -1.154 0.781  3.129 -1.129 
-3.890 28.268 12 DD_DA13DC14:DG28DT29_EE D 13 ? E 29 ? D 14 ? E 28 ? 
1 A DC 14 1_555 B DG 8  1_555 A DG 15 1_555 B DC 7  1_555 -0.692 0.205  3.223 -0.797 7.630  32.868 -0.881 1.064  3.204 13.260 
1.385  33.727 13 DD_DC14DG15:DC27DG28_EE D 14 ? E 28 ? D 15 ? E 27 ? 
1 A DG 15 1_555 B DC 7  1_555 A DA 16 1_555 B DT 6  1_555 0.197  -0.251 3.358 0.505  4.346  34.905 -1.078 -0.250 3.306 7.210  
-0.839 35.170 14 DD_DG15DA16:DT26DC27_EE D 15 ? E 27 ? D 16 ? E 26 ? 
1 A DA 16 1_555 B DT 6  1_555 A DC 17 1_555 B DG 5  1_555 0.766  -0.784 3.016 -2.339 4.005  30.728 -2.154 -1.834 2.829 7.503  
4.382  31.068 15 DD_DA16DC17:DG25DT26_EE D 16 ? E 26 ? D 17 ? E 25 ? 
1 A DC 17 1_555 B DG 5  1_555 A DG 18 1_555 B DC 4  1_555 -0.125 -1.103 4.016 3.425  11.101 39.939 -2.953 0.607  3.576 15.850 
-4.890 41.528 16 DD_DC17DG18:DC24DG25_EE D 17 ? E 25 ? D 18 ? E 24 ? 
1 A DG 18 1_555 B DC 4  1_555 A DC 19 1_555 B DG 3  1_555 0.360  -0.476 3.156 0.662  3.489  31.058 -1.517 -0.548 3.092 6.488  
-1.232 31.256 17 DD_DG18DC19:DG23DC24_EE D 18 ? E 24 ? D 19 ? E 23 ? 
1 A DC 19 1_555 B DG 3  1_555 A DT 20 1_555 B DA 2  1_555 -0.253 -0.434 3.110 1.543  4.576  28.359 -1.838 0.834  2.987 9.256  
-3.120 28.759 18 DD_DC19DT20:DA22DG23_EE D 19 ? E 23 ? D 20 ? E 22 ? 
_pdbx_entity_nonpoly.entity_id   5        water 
_pdbx_entity_nonpoly.comp_id     HOH 
E 5 HOH 1  21  11  HOH HOH D . 
E 5 HOH 2  22  12  HOH HOH D . 
E 5 HOH 3  23  15  HOH HOH D . 
E 5 HOH 4  24  18  HOH HOH D . 
E 5 HOH 5  25  21  HOH HOH D . 
E 5 HOH 6  26  24  HOH HOH D . 
E 5 HOH 7  27  26  HOH HOH D . 
E 5 HOH 8  28  28  HOH HOH D . 
E 5 HOH 9  29  34  HOH HOH D . 
E 5 HOH 10 30  37  HOH HOH D . 
E 5 HOH 11 31  46  HOH HOH D . 
E 5 HOH 12 32  47  HOH HOH D . 
E 5 HOH 13 33  53  HOH HOH D . 
E 5 HOH 14 34  58  HOH HOH D . 
E 5 HOH 15 35  59  HOH HOH D . 
E 5 HOH 16 36  60  HOH HOH D . 
E 5 HOH 17 37  65  HOH HOH D . 
E 5 HOH 18 38  69  HOH HOH D . 
E 5 HOH 19 39  70  HOH HOH D . 
E 5 HOH 20 40  75  HOH HOH D . 
E 5 HOH 21 41  76  HOH HOH D . 
E 5 HOH 22 42  99  HOH HOH D . 
E 5 HOH 23 43  105 HOH HOH D . 
E 5 HOH 24 44  112 HOH HOH D . 
E 5 HOH 25 45  116 HOH HOH D . 
E 5 HOH 26 46  120 HOH HOH D . 
E 5 HOH 27 47  121 HOH HOH D . 
E 5 HOH 28 48  126 HOH HOH D . 
E 5 HOH 29 49  137 HOH HOH D . 
E 5 HOH 30 50  143 HOH HOH D . 
E 5 HOH 31 51  182 HOH HOH D . 
E 5 HOH 32 52  188 HOH HOH D . 
E 5 HOH 33 53  189 HOH HOH D . 
E 5 HOH 34 54  205 HOH HOH D . 
E 5 HOH 35 55  219 HOH HOH D . 
E 5 HOH 36 56  221 HOH HOH D . 
E 5 HOH 37 57  227 HOH HOH D . 
E 5 HOH 38 58  229 HOH HOH D . 
E 5 HOH 39 59  230 HOH HOH D . 
E 5 HOH 40 60  233 HOH HOH D . 
E 5 HOH 41 61  241 HOH HOH D . 
E 5 HOH 42 62  242 HOH HOH D . 
E 5 HOH 43 63  243 HOH HOH D . 
F 5 HOH 1  41  2   HOH HOH E . 
F 5 HOH 2  42  3   HOH HOH E . 
F 5 HOH 3  43  5   HOH HOH E . 
F 5 HOH 4  44  6   HOH HOH E . 
F 5 HOH 5  45  7   HOH HOH E . 
F 5 HOH 6  46  8   HOH HOH E . 
F 5 HOH 7  47  13  HOH HOH E . 
F 5 HOH 8  48  16  HOH HOH E . 
F 5 HOH 9  49  20  HOH HOH E . 
F 5 HOH 10 50  22  HOH HOH E . 
F 5 HOH 11 51  23  HOH HOH E . 
F 5 HOH 12 52  29  HOH HOH E . 
F 5 HOH 13 53  30  HOH HOH E . 
F 5 HOH 14 54  33  HOH HOH E . 
F 5 HOH 15 55  35  HOH HOH E . 
F 5 HOH 16 56  36  HOH HOH E . 
F 5 HOH 17 57  38  HOH HOH E . 
F 5 HOH 18 58  39  HOH HOH E . 
F 5 HOH 19 59  40  HOH HOH E . 
F 5 HOH 20 60  50  HOH HOH E . 
F 5 HOH 21 61  56  HOH HOH E . 
F 5 HOH 22 62  66  HOH HOH E . 
F 5 HOH 23 63  67  HOH HOH E . 
F 5 HOH 24 64  77  HOH HOH E . 
F 5 HOH 25 65  80  HOH HOH E . 
F 5 HOH 26 66  89  HOH HOH E . 
F 5 HOH 27 67  95  HOH HOH E . 
F 5 HOH 28 68  100 HOH HOH E . 
F 5 HOH 29 69  102 HOH HOH E . 
F 5 HOH 30 70  104 HOH HOH E . 
F 5 HOH 31 71  107 HOH HOH E . 
F 5 HOH 32 72  113 HOH HOH E . 
F 5 HOH 33 73  115 HOH HOH E . 
F 5 HOH 34 74  118 HOH HOH E . 
F 5 HOH 35 75  122 HOH HOH E . 
F 5 HOH 36 76  125 HOH HOH E . 
F 5 HOH 37 77  136 HOH HOH E . 
F 5 HOH 38 78  141 HOH HOH E . 
F 5 HOH 39 79  148 HOH HOH E . 
F 5 HOH 40 80  150 HOH HOH E . 
F 5 HOH 41 81  155 HOH HOH E . 
F 5 HOH 42 82  161 HOH HOH E . 
F 5 HOH 43 83  163 HOH HOH E . 
F 5 HOH 44 84  168 HOH HOH E . 
F 5 HOH 45 85  174 HOH HOH E . 
F 5 HOH 46 86  177 HOH HOH E . 
F 5 HOH 47 87  178 HOH HOH E . 
F 5 HOH 48 88  180 HOH HOH E . 
F 5 HOH 49 89  185 HOH HOH E . 
F 5 HOH 50 90  191 HOH HOH E . 
F 5 HOH 51 91  193 HOH HOH E . 
F 5 HOH 52 92  196 HOH HOH E . 
F 5 HOH 53 93  200 HOH HOH E . 
F 5 HOH 54 94  208 HOH HOH E . 
F 5 HOH 55 95  213 HOH HOH E . 
F 5 HOH 56 96  218 HOH HOH E . 
F 5 HOH 57 97  224 HOH HOH E . 
F 5 HOH 58 98  225 HOH HOH E . 
F 5 HOH 59 99  245 HOH HOH E . 
F 5 HOH 60 100 247 HOH HOH E . 
G 5 HOH 1  270 1   HOH HOH A . 
G 5 HOH 2  271 9   HOH HOH A . 
G 5 HOH 3  272 10  HOH HOH A . 
G 5 HOH 4  273 14  HOH HOH A . 
G 5 HOH 5  274 19  HOH HOH A . 
G 5 HOH 6  275 25  HOH HOH A . 
G 5 HOH 7  276 31  HOH HOH A . 
G 5 HOH 8  277 42  HOH HOH A . 
G 5 HOH 9  278 43  HOH HOH A . 
G 5 HOH 10 279 44  HOH HOH A . 
G 5 HOH 11 280 61  HOH HOH A . 
G 5 HOH 12 281 63  HOH HOH A . 
G 5 HOH 13 282 64  HOH HOH A . 
G 5 HOH 14 283 71  HOH HOH A . 
G 5 HOH 15 284 72  HOH HOH A . 
G 5 HOH 16 285 73  HOH HOH A . 
G 5 HOH 17 286 74  HOH HOH A . 
G 5 HOH 18 287 79  HOH HOH A . 
G 5 HOH 19 288 86  HOH HOH A . 
G 5 HOH 20 289 87  HOH HOH A . 
G 5 HOH 21 290 90  HOH HOH A . 
G 5 HOH 22 291 93  HOH HOH A . 
G 5 HOH 23 292 94  HOH HOH A . 
G 5 HOH 24 293 98  HOH HOH A . 
G 5 HOH 25 294 101 HOH HOH A . 
G 5 HOH 26 295 108 HOH HOH A . 
G 5 HOH 27 296 109 HOH HOH A . 
G 5 HOH 28 297 110 HOH HOH A . 
G 5 HOH 29 298 123 HOH HOH A . 
G 5 HOH 30 299 124 HOH HOH A . 
G 5 HOH 31 300 127 HOH HOH A . 
G 5 HOH 32 301 130 HOH HOH A . 
G 5 HOH 33 302 131 HOH HOH A . 
G 5 HOH 34 303 132 HOH HOH A . 
G 5 HOH 35 304 135 HOH HOH A . 
G 5 HOH 36 305 138 HOH HOH A . 
G 5 HOH 37 306 139 HOH HOH A . 
G 5 HOH 38 307 140 HOH HOH A . 
G 5 HOH 39 308 142 HOH HOH A . 
G 5 HOH 40 309 145 HOH HOH A . 
G 5 HOH 41 310 151 HOH HOH A . 
G 5 HOH 42 311 154 HOH HOH A . 
G 5 HOH 43 312 156 HOH HOH A . 
G 5 HOH 44 313 157 HOH HOH A . 
G 5 HOH 45 314 158 HOH HOH A . 
G 5 HOH 46 315 159 HOH HOH A . 
G 5 HOH 47 316 162 HOH HOH A . 
G 5 HOH 48 317 169 HOH HOH A . 
G 5 HOH 49 318 170 HOH HOH A . 
G 5 HOH 50 319 172 HOH HOH A . 
G 5 HOH 51 320 173 HOH HOH A . 
G 5 HOH 52 321 179 HOH HOH A . 
G 5 HOH 53 322 181 HOH HOH A . 
G 5 HOH 54 323 183 HOH HOH A . 
G 5 HOH 55 324 184 HOH HOH A . 
G 5 HOH 56 325 186 HOH HOH A . 
G 5 HOH 57 326 187 HOH HOH A . 
G 5 HOH 58 327 190 HOH HOH A . 
G 5 HOH 59 328 195 HOH HOH A . 
G 5 HOH 60 329 202 HOH HOH A . 
G 5 HOH 61 330 204 HOH HOH A . 
G 5 HOH 62 331 207 HOH HOH A . 
G 5 HOH 63 332 209 HOH HOH A . 
G 5 HOH 64 333 214 HOH HOH A . 
G 5 HOH 65 334 215 HOH HOH A . 
G 5 HOH 66 335 217 HOH HOH A . 
G 5 HOH 67 336 222 HOH HOH A . 
G 5 HOH 68 337 223 HOH HOH A . 
G 5 HOH 69 338 231 HOH HOH A . 
G 5 HOH 70 339 235 HOH HOH A . 
G 5 HOH 71 340 236 HOH HOH A . 
G 5 HOH 72 341 237 HOH HOH A . 
G 5 HOH 73 342 239 HOH HOH A . 
G 5 HOH 74 343 240 HOH HOH A . 
G 5 HOH 75 344 244 HOH HOH A . 
G 5 HOH 76 345 246 HOH HOH A . 
H 5 HOH 1  306 4   HOH HOH B . 
H 5 HOH 2  307 17  HOH HOH B . 
H 5 HOH 3  308 27  HOH HOH B . 
H 5 HOH 4  309 32  HOH HOH B . 
H 5 HOH 5  310 41  HOH HOH B . 
H 5 HOH 6  311 45  HOH HOH B . 
H 5 HOH 7  312 48  HOH HOH B . 
H 5 HOH 8  313 49  HOH HOH B . 
H 5 HOH 9  314 51  HOH HOH B . 
H 5 HOH 10 315 52  HOH HOH B . 
H 5 HOH 11 316 54  HOH HOH B . 
H 5 HOH 12 317 55  HOH HOH B . 
H 5 HOH 13 318 57  HOH HOH B . 
H 5 HOH 14 319 62  HOH HOH B . 
H 5 HOH 15 320 68  HOH HOH B . 
H 5 HOH 16 321 78  HOH HOH B . 
H 5 HOH 17 322 81  HOH HOH B . 
H 5 HOH 18 323 82  HOH HOH B . 
H 5 HOH 19 324 83  HOH HOH B . 
H 5 HOH 20 325 84  HOH HOH B . 
H 5 HOH 21 326 85  HOH HOH B . 
H 5 HOH 22 327 88  HOH HOH B . 
H 5 HOH 23 328 91  HOH HOH B . 
H 5 HOH 24 329 92  HOH HOH B . 
H 5 HOH 25 330 96  HOH HOH B . 
H 5 HOH 26 331 97  HOH HOH B . 
H 5 HOH 27 332 103 HOH HOH B . 
H 5 HOH 28 333 106 HOH HOH B . 
H 5 HOH 29 334 111 HOH HOH B . 
H 5 HOH 30 335 114 HOH HOH B . 
H 5 HOH 31 336 117 HOH HOH B . 
H 5 HOH 32 337 119 HOH HOH B . 
H 5 HOH 33 338 128 HOH HOH B . 
H 5 HOH 34 339 129 HOH HOH B . 
H 5 HOH 35 340 133 HOH HOH B . 
H 5 HOH 36 341 134 HOH HOH B . 
H 5 HOH 37 342 144 HOH HOH B . 
H 5 HOH 38 343 146 HOH HOH B . 
H 5 HOH 39 344 147 HOH HOH B . 
H 5 HOH 40 345 149 HOH HOH B . 
H 5 HOH 41 346 152 HOH HOH B . 
H 5 HOH 42 347 153 HOH HOH B . 
H 5 HOH 43 348 160 HOH HOH B . 
H 5 HOH 44 349 164 HOH HOH B . 
H 5 HOH 45 350 165 HOH HOH B . 
H 5 HOH 46 351 166 HOH HOH B . 
H 5 HOH 47 352 167 HOH HOH B . 
H 5 HOH 48 353 171 HOH HOH B . 
H 5 HOH 49 354 175 HOH HOH B . 
H 5 HOH 50 355 176 HOH HOH B . 
H 5 HOH 51 356 192 HOH HOH B . 
H 5 HOH 52 357 194 HOH HOH B . 
H 5 HOH 53 358 197 HOH HOH B . 
H 5 HOH 54 359 198 HOH HOH B . 
H 5 HOH 55 360 199 HOH HOH B . 
H 5 HOH 56 361 201 HOH HOH B . 
H 5 HOH 57 362 203 HOH HOH B . 
H 5 HOH 58 363 206 HOH HOH B . 
H 5 HOH 59 364 210 HOH HOH B . 
H 5 HOH 60 365 211 HOH HOH B . 
H 5 HOH 61 366 212 HOH HOH B . 
H 5 HOH 62 367 216 HOH HOH B . 
H 5 HOH 63 368 220 HOH HOH B . 
H 5 HOH 64 369 226 HOH HOH B . 
H 5 HOH 65 370 228 HOH HOH B . 
H 5 HOH 66 371 232 HOH HOH B . 
H 5 HOH 67 372 234 HOH HOH B . 
H 5 HOH 68 373 238 HOH HOH B . 