#   1QP9 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.351 
PDB   1QP9         pdb_00001qp9 10.2210/pdb1qp9/pdb 
NDB   PD0148       ?            ?                   
RCSB  RCSB009138   ?            ?                   
WWPDB D_1000009138 ?            ?                   
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.entry_id                        1QP9 
_pdbx_database_status.recvd_initial_deposition_date   1999-06-01 
_pdbx_database_status.deposit_site                    NDB 
_pdbx_database_status.process_site                    NDB 
_pdbx_database_status.SG_entry                        . 
_pdbx_database_status.pdb_format_compatible           Y 
_pdbx_database_status.status_code_mr                  ? 
_pdbx_database_status.status_code_sf                  ? 
_pdbx_database_status.status_code_cs                  ? 
_pdbx_database_status.status_code_nmr_data            ? 
_pdbx_database_status.methods_development_category    ? 
'Lukens, A.'      1 
'King, D.'        2 
'Marmorstein, R.' 3 
;Structure of HAP1-PC7 bound to DNA: implications for DNA recognition and allosteric effects of DNA-binding on transcriptional activation.
'Nucleic Acids Res.' 28 3853 3863 2000 NARHAD UK 0305-1048 0389 ? 11024163 10.1093/nar/28.20.3853 
1       'Structure of a HAP1-DNA complex reveals dramatically asymmetric DNA binding by a homodimeric protein' Nat.Struct.Biol. 6  
64   71   1999 NSBIEW US 1072-8368 2024 ? ?        10.1038/4940           
2       'Structure of HAP-18-DNA implicates direct allosteric effect of protein-DNA interactions on transcriptional activation' 
Nat.Struct.Biol.     6  22   27   1999 NSBIEW US 1072-8368 2024 ? ?        10.1038/4893           
3       'Asymmetric binding and transactivation properties of the HAP1 DNA binding domain' Thesis               ?  ?    ?    1999 
?      ?  ?         ?    ? ?        ?                      
primary 'Lukens, A.K.'    1  ? 
primary 'King, D.A.'      2  ? 
primary 'Marmorstein, R.' 3  ? 
1       'King, D.'        4  ? 
1       'Zhang, L.'       5  ? 
1       'Guarente, L.'    6  ? 
1       'Marmorstein, R.' 7  ? 
2       'King, D.'        8  ? 
2       'Zhang, L.'       9  ? 
2       'Guarente, L.'    10 ? 
2       'Marmorstein, R.' 11 ? 
3       'King, D.'        12 ? 
_cell.entry_id           1QP9 
_cell.length_a           85.900 
_cell.length_b           90.900 
_cell.length_c           96.500 
_cell.angle_alpha        90.00 
_cell.angle_beta         90.00 
_cell.angle_gamma        90.00 
_cell.Z_PDB              16 
_cell.pdbx_unique_axis   ? 
_symmetry.entry_id                         1QP9 
_symmetry.space_group_name_H-M             'P 21 21 21' 
_symmetry.pdbx_full_space_group_name_H-M   ? 
_symmetry.cell_setting                     orthorhombic 
_symmetry.Int_Tables_number                19 
1 polymer     syn 
6098.964 2  ? ?    ?                                              ? 
2 polymer     syn 
6166.030 2  ? ?    ?                                              ? 
3 polymer     man 'CYP1(HAP1-PC7) ACTIVATORY PROTEIN'                                          9087.827 4  ? S63G 
4 non-polymer syn 'ZINC ION'                                                                   65.409   9  ? ?    ? ? 
5 water       nat water                                                                        18.015   96 ? ?    ? ? 
1 polydeoxyribonucleotide no no '(DA)(DC)(DG)(DC)(DT)(DA)(DT)(DT)(DA)(DT)(DC)(DG)(DC)(DT)(DA)(DT)(DT)(DA)(DG)(DT)' 
ACGCTATTATCGCTATTAGT                                                         E,G     ? 
2 polydeoxyribonucleotide no no '(DA)(DC)(DT)(DA)(DA)(DT)(DA)(DG)(DC)(DG)(DA)(DT)(DA)(DA)(DT)(DA)(DG)(DC)(DG)(DT)' 
ACTAATAGCGATAATAGCGT                                                         F,H     ? 
1 1  DA  n 
1 2  DC  n 
1 3  DG  n 
1 4  DC  n 
1 5  DT  n 
1 6  DA  n 
1 7  DT  n 
1 8  DT  n 
1 9  DA  n 
1 10 DT  n 
1 11 DC  n 
1 12 DG  n 
1 13 DC  n 
1 14 DT  n 
1 15 DA  n 
1 16 DT  n 
1 17 DT  n 
1 18 DA  n 
1 19 DG  n 
1 20 DT  n 
2 1  DA  n 
2 2  DC  n 
2 3  DT  n 
2 4  DA  n 
2 5  DA  n 
2 6  DT  n 
2 7  DA  n 
2 8  DG  n 
2 9  DC  n 
2 10 DG  n 
2 11 DA  n 
2 12 DT  n 
2 13 DA  n 
2 14 DA  n 
2 15 DT  n 
2 16 DA  n 
2 17 DG  n 
2 18 DC  n 
2 19 DG  n 
2 20 DT  n 
3 1  ARG n 
3 2  LYS n 
3 3  ARG n 
3 4  ASN n 
3 5  ARG n 
3 6  ILE n 
3 7  PRO n 
3 8  LEU n 
3 9  GLY n 
3 10 CYS n 
3 11 THR n 
3 12 ILE n 
3 13 CYS n 
3 14 ARG n 
3 15 LYS n 
3 16 ARG n 
3 17 LYS n 
3 18 VAL n 
3 19 LYS n 
3 20 CYS n 
3 21 ASP n 
3 22 LYS n 
3 23 LEU n 
3 24 ARG n 
3 25 PRO n 
3 26 HIS n 
3 27 CYS n 
3 28 GLN n 
3 29 GLN n 
3 30 CYS n 
3 31 THR n 
3 32 LYS n 
3 33 THR n 
3 34 GLY n 
3 35 VAL n 
3 36 ALA n 
3 37 HIS n 
3 38 LEU n 
3 39 CYS n 
3 40 HIS n 
3 41 TYR n 
3 42 MET n 
3 43 GLU n 
3 44 GLN n 
3 45 THR n 
3 46 TRP n 
3 47 ALA n 
3 48 GLU n 
3 49 GLU n 
3 50 ALA n 
3 51 GLU n 
3 52 LYS n 
3 53 GLU n 
3 54 LEU n 
3 55 LEU n 
3 56 LYS n 
3 57 ASP n 
3 58 ASN n 
3 59 GLU n 
3 60 LEU n 
3 61 LYS n 
3 62 LYS n 
3 63 LEU n 
3 64 ARG n 
3 65 GLU n 
3 66 ARG n 
3 67 VAL n 
3 68 LYS n 
3 69 SER n 
3 70 LEU n 
3 71 GLU n 
3 72 LYS n 
3 73 THR n 
3 74 LEU n 
3 75 SER n 
3 76 LYS n 
_entity_src_gen.entity_id                          3 
_entity_src_gen.pdbx_src_id                        1 
_entity_src_gen.pdbx_alt_source_flag               sample 
_entity_src_gen.pdbx_seq_type                      ? 
_entity_src_gen.pdbx_beg_seq_num                   ? 
_entity_src_gen.pdbx_end_seq_num                   ? 
;baker's yeast
_entity_src_gen.gene_src_genus                     Saccharomyces 
_entity_src_gen.pdbx_gene_src_gene                 ? 
_entity_src_gen.gene_src_species                   ? 
_entity_src_gen.gene_src_strain                    ? 
_entity_src_gen.gene_src_tissue                    ? 
_entity_src_gen.gene_src_tissue_fraction           ? 
_entity_src_gen.gene_src_details                   ? 
_entity_src_gen.pdbx_gene_src_fragment             ? 
_entity_src_gen.pdbx_gene_src_scientific_name      'Saccharomyces cerevisiae' 
_entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id     4932 
_entity_src_gen.pdbx_gene_src_variant              ? 
_entity_src_gen.pdbx_gene_src_cell_line            ? 
_entity_src_gen.pdbx_gene_src_atcc                 ? 
_entity_src_gen.pdbx_gene_src_organ                ? 
_entity_src_gen.pdbx_gene_src_organelle            ? 
_entity_src_gen.pdbx_gene_src_cell                 ? 
_entity_src_gen.pdbx_gene_src_cellular_location    ? 
_entity_src_gen.host_org_common_name               ? 
_entity_src_gen.pdbx_host_org_scientific_name      'Escherichia coli' 
_entity_src_gen.pdbx_host_org_ncbi_taxonomy_id     562 
_entity_src_gen.host_org_genus                     Escherichia 
_entity_src_gen.pdbx_host_org_gene                 ? 
_entity_src_gen.pdbx_host_org_organ                ? 
_entity_src_gen.host_org_species                   ? 
_entity_src_gen.pdbx_host_org_tissue               ? 
_entity_src_gen.pdbx_host_org_tissue_fraction      ? 
_entity_src_gen.pdbx_host_org_strain               ? 
_entity_src_gen.pdbx_host_org_variant              ? 
_entity_src_gen.pdbx_host_org_cell_line            ? 
_entity_src_gen.pdbx_host_org_atcc                 ? 
_entity_src_gen.pdbx_host_org_culture_collection   ? 
_entity_src_gen.pdbx_host_org_cell                 ? 
_entity_src_gen.pdbx_host_org_organelle            ? 
_entity_src_gen.pdbx_host_org_cellular_location    ? 
_entity_src_gen.pdbx_host_org_vector_type          PLASMID 
_entity_src_gen.pdbx_host_org_vector               ? 
_entity_src_gen.host_org_details                   ? 
_entity_src_gen.expression_system_id               ? 
_entity_src_gen.plasmid_name                       PRSET-A 
_entity_src_gen.plasmid_details                    ? 
_entity_src_gen.pdbx_description                   ? 
1 UNP CYP1_YEAST P12351 3 55 ? ? 
2 PDB 1QP9       1QP9   1 ?  ? ? 
3 PDB 1QP9       1QP9   2 ?  ? ? 
1 1 1QP9 A 1 ? 76 ? P12351 55 ? 130 ? 55 130 
2 1 1QP9 B 1 ? 76 ? P12351 55 ? 130 ? 55 130 
3 1 1QP9 C 1 ? 76 ? P12351 55 ? 130 ? 55 130 
4 1 1QP9 D 1 ? 76 ? P12351 55 ? 130 ? 55 130 
5 2 1QP9 E 1 ? 20 ? 1QP9   1  ? 20  ? 1  20  
6 3 1QP9 F 1 ? 20 ? 1QP9   1  ? 20  ? 1  20  
7 2 1QP9 G 1 ? 20 ? 1QP9   1  ? 20  ? 1  20  
8 3 1QP9 H 1 ? 20 ? 1QP9   1  ? 20  ? 1  20  
1 1qp9 GLY A 9 ? UNP P12351 SER 63 'engineered mutation' 63 1 
2 1qp9 GLY B 9 ? UNP P12351 SER 63 'engineered mutation' 63 2 
3 1qp9 GLY C 9 ? UNP P12351 SER 63 'engineered mutation' 63 3 
4 1qp9 GLY D 9 ? UNP P12351 SER 63 'engineered mutation' 63 4 
ALA 'L-peptide linking' y ALANINE                              ? 'C3 H7 N O2'      89.093  
ARG 'L-peptide linking' y ARGININE                             ? 'C6 H15 N4 O2 1'  175.209 
ASN 'L-peptide linking' y ASPARAGINE                           ? 'C4 H8 N2 O3'     132.118 
ASP 'L-peptide linking' y 'ASPARTIC ACID'                      ? 'C4 H7 N O4'      133.103 
CYS 'L-peptide linking' y CYSTEINE                             ? 'C3 H7 N O2 S'    121.158 
DA  'DNA linking'       y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 
DC  'DNA linking'       y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE"  ? 'C9 H14 N3 O7 P'  307.197 
DG  'DNA linking'       y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 
DT  'DNA linking'       y "THYMIDINE-5'-MONOPHOSPHATE"         ? 'C10 H15 N2 O8 P' 322.208 
GLN 'L-peptide linking' y GLUTAMINE                            ? 'C5 H10 N2 O3'    146.144 
GLU 'L-peptide linking' y 'GLUTAMIC ACID'                      ? 'C5 H9 N O4'      147.129 
GLY 'peptide linking'   y GLYCINE                              ? 'C2 H5 N O2'      75.067  
HIS 'L-peptide linking' y HISTIDINE                            ? 'C6 H10 N3 O2 1'  156.162 
HOH non-polymer         . WATER                                ? 'H2 O'            18.015  
ILE 'L-peptide linking' y ISOLEUCINE                           ? 'C6 H13 N O2'     131.173 
LEU 'L-peptide linking' y LEUCINE                              ? 'C6 H13 N O2'     131.173 
LYS 'L-peptide linking' y LYSINE                               ? 'C6 H15 N2 O2 1'  147.195 
MET 'L-peptide linking' y METHIONINE                           ? 'C5 H11 N O2 S'   149.211 
PRO 'L-peptide linking' y PROLINE                              ? 'C5 H9 N O2'      115.130 
SER 'L-peptide linking' y SERINE                               ? 'C3 H7 N O3'      105.093 
THR 'L-peptide linking' y THREONINE                            ? 'C4 H9 N O3'      119.119 
TRP 'L-peptide linking' y TRYPTOPHAN                           ? 'C11 H12 N2 O2'   204.225 
TYR 'L-peptide linking' y TYROSINE                             ? 'C9 H11 N O3'     181.189 
VAL 'L-peptide linking' y VALINE                               ? 'C5 H11 N O2'     117.146 
ZN  non-polymer         . 'ZINC ION'                           ? 'Zn 2'            65.409  
_exptl.entry_id          1QP9 
_exptl.method            'X-RAY DIFFRACTION' 
_exptl.crystals_number   1 
#                    1 
_exptl_crystal.density_meas          ? 
_exptl_crystal.density_Matthews      3.05 
_exptl_crystal.density_percent_sol   59.68 
_exptl_crystal.description           ? 
_exptl_crystal_grow.crystal_id      1 
_exptl_crystal_grow.method          'VAPOR DIFFUSION, HANGING DROP' 
_exptl_crystal_grow.temp            293 
_exptl_crystal_grow.temp_details    ? 
_exptl_crystal_grow.pH              5.6 
_exptl_crystal_grow.pdbx_details    '11% PEG 400, 10 MM MGSO4, 200 MM KCL, pH 5.6, VAPOR DIFFUSION, HANGING DROP, temperature 293K' 
_exptl_crystal_grow.pdbx_pH_range   ? 
1 1 1 'PEG 400' ? ? ? 
1 2 1 MGSO4     ? ? ? 
1 3 1 KCL       ? ? ? 
1 4 2 'PEG 400' ? ? ? 
1 5 2 MGSO4     ? ? ? 
1 6 2 KCL       ? ? ? 
#                     1 
_diffrn.ambient_temp           100 
_diffrn.ambient_temp_details   ? 
_diffrn.crystal_id             1 
_diffrn_detector.diffrn_id              1 
_diffrn_detector.detector               CCD 
_diffrn_detector.type                   CUSTOM-MADE 
_diffrn_detector.pdbx_collection_date   1998-09-11 
_diffrn_detector.details                ? 
_diffrn_radiation.diffrn_id                        1 
_diffrn_radiation.wavelength_id                    1 
_diffrn_radiation.pdbx_monochromatic_or_laue_m_l   M 
_diffrn_radiation.monochromator                    ? 
_diffrn_radiation.pdbx_diffrn_protocol             'SINGLE WAVELENGTH' 
_diffrn_radiation.pdbx_scattering_type             x-ray 
#           1 
_diffrn_radiation_wavelength.wavelength   0.917 
_diffrn_radiation_wavelength.wt           1.0 
_diffrn_source.diffrn_id                   1 
_diffrn_source.source                      SYNCHROTRON 
_diffrn_source.type                        'CHESS BEAMLINE A1' 
_diffrn_source.pdbx_synchrotron_site       CHESS 
_diffrn_source.pdbx_synchrotron_beamline   A1 
_diffrn_source.pdbx_wavelength             0.917 
_diffrn_source.pdbx_wavelength_list        ? 
_reflns.entry_id                     1QP9 
_reflns.observed_criterion_sigma_I   0 
_reflns.observed_criterion_sigma_F   ? 
_reflns.d_resolution_low             30.0 
_reflns.d_resolution_high            2.8 
_reflns.number_obs                   27006 
_reflns.number_all                   27006 
_reflns.percent_possible_obs         99.6 
_reflns.pdbx_Rmerge_I_obs            0.0690000 
_reflns.pdbx_Rsym_value              ? 
_reflns.pdbx_netI_over_sigmaI        28.8 
_reflns.B_iso_Wilson_estimate        60.054 
_reflns.pdbx_redundancy              14.77 
_reflns.R_free_details               ? 
_reflns.limit_k_min                  ? 
_reflns.observed_criterion_F_min     ? 
_reflns.pdbx_diffrn_id               1 
_reflns.pdbx_ordinal                 1 
_reflns_shell.d_res_high             2.75 
_reflns_shell.d_res_low              2.86 
_reflns_shell.percent_possible_all   100 
_reflns_shell.Rmerge_I_obs           0.1670000 
_reflns_shell.pdbx_Rsym_value        ? 
_reflns_shell.meanI_over_sigI_obs    ? 
_reflns_shell.pdbx_redundancy        6.5 
_reflns_shell.percent_possible_obs   ? 
_reflns_shell.number_unique_all      ? 
_reflns_shell.pdbx_diffrn_id         ? 
_reflns_shell.pdbx_ordinal           1 
_refine.entry_id                                 1QP9 
_refine.ls_number_reflns_obs                     18115 
_refine.ls_number_reflns_all                     27006 
_refine.pdbx_ls_sigma_I                          ? 
_refine.pdbx_ls_sigma_F                          2.0 
_refine.pdbx_data_cutoff_high_absF               ? 
_refine.pdbx_data_cutoff_low_absF                ? 
_refine.pdbx_data_cutoff_high_rms_absF           ? 
_refine.ls_d_res_low                             8.0 
_refine.ls_d_res_high                            2.8 
_refine.ls_percent_reflns_obs                    99.6 
_refine.ls_R_factor_obs                          0.2550000 
_refine.ls_R_factor_all                          ? 
_refine.ls_R_factor_R_work                       0.2550000 
_refine.ls_R_factor_R_free                       0.2940000 
_refine.ls_R_factor_R_free_error                 ? 
_refine.ls_R_factor_R_free_error_details         ? 
_refine.ls_percent_reflns_R_free                 ? 
_refine.ls_number_reflns_R_free                  1812 
_refine.ls_number_parameters                     ? 
_refine.ls_number_restraints                     ? 
_refine.occupancy_min                            ? 
_refine.occupancy_max                            ? 
_refine.B_iso_mean                               ? 
_refine.aniso_B[1][1]                            ? 
_refine.aniso_B[2][2]                            ? 
_refine.aniso_B[3][3]                            ? 
_refine.aniso_B[1][2]                            ? 
_refine.aniso_B[1][3]                            ? 
_refine.aniso_B[2][3]                            ? 
_refine.solvent_model_details                    ? 
_refine.solvent_model_param_ksol                 ? 
_refine.solvent_model_param_bsol                 ? 
_refine.pdbx_ls_cross_valid_method               THROUGHOUT 
_refine.details                                  ? 
_refine.pdbx_starting_model                      ? 
_refine.pdbx_method_to_determine_struct          ? 
_refine.pdbx_isotropic_thermal_model             ? 
_refine.pdbx_stereochemistry_target_values       'ENGH & HUBER' 
_refine.pdbx_stereochem_target_val_spec_case     ? 
_refine.pdbx_R_Free_selection_details            ? 
_refine.pdbx_overall_ESU_R                       ? 
_refine.pdbx_overall_ESU_R_Free                  ? 
_refine.overall_SU_ML                            ? 
_refine.overall_SU_B                             ? 
_refine.ls_redundancy_reflns_obs                 ? 
_refine.pdbx_refine_id                           'X-RAY DIFFRACTION' 
_refine.pdbx_diffrn_id                           1 
_refine.pdbx_TLS_residual_ADP_flag               ? 
_refine.correlation_coeff_Fo_to_Fc               ? 
_refine.correlation_coeff_Fo_to_Fc_free          ? 
_refine.pdbx_solvent_vdw_probe_radii             ? 
_refine.pdbx_solvent_ion_probe_radii             ? 
_refine.pdbx_solvent_shrinkage_radii             ? 
_refine.pdbx_overall_phase_error                 ? 
_refine.overall_SU_R_Cruickshank_DPI             ? 
_refine.pdbx_overall_SU_R_free_Cruickshank_DPI   ? 
_refine.pdbx_overall_SU_R_Blow_DPI               ? 
_refine.pdbx_overall_SU_R_free_Blow_DPI          ? 
_refine_hist.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_refine_hist.cycle_id                         LAST 
_refine_hist.pdbx_number_atoms_protein        2440 
_refine_hist.pdbx_number_atoms_nucleic_acid   1571 
_refine_hist.pdbx_number_atoms_ligand         9 
_refine_hist.number_atoms_solvent             96 
_refine_hist.number_atoms_total               4116 
_refine_hist.d_res_high                       2.8 
_refine_hist.d_res_low                        8.0 
c_bond_d                0.009 ? ? ? 'X-RAY DIFFRACTION' ? 
c_bond_d_na             ?     ? ? ? 'X-RAY DIFFRACTION' ? 
c_bond_d_prot           ?     ? ? ? 'X-RAY DIFFRACTION' ? 
c_angle_d               ?     ? ? ? 'X-RAY DIFFRACTION' ? 
c_angle_d_na            ?     ? ? ? 'X-RAY DIFFRACTION' ? 
c_angle_d_prot          ?     ? ? ? 'X-RAY DIFFRACTION' ? 
c_angle_deg             1.529 ? ? ? 'X-RAY DIFFRACTION' ? 
c_angle_deg_na          ?     ? ? ? 'X-RAY DIFFRACTION' ? 
c_angle_deg_prot        ?     ? ? ? 'X-RAY DIFFRACTION' ? 
c_dihedral_angle_d      ?     ? ? ? 'X-RAY DIFFRACTION' ? 
c_dihedral_angle_d_na   ?     ? ? ? 'X-RAY DIFFRACTION' ? 
c_dihedral_angle_d_prot ?     ? ? ? 'X-RAY DIFFRACTION' ? 
c_improper_angle_d      ?     ? ? ? 'X-RAY DIFFRACTION' ? 
c_improper_angle_d_na   ?     ? ? ? 'X-RAY DIFFRACTION' ? 
c_improper_angle_d_prot ?     ? ? ? 'X-RAY DIFFRACTION' ? 
c_mcbond_it             ?     ? ? ? 'X-RAY DIFFRACTION' ? 
c_mcangle_it            ?     ? ? ? 'X-RAY DIFFRACTION' ? 
c_scbond_it             ?     ? ? ? 'X-RAY DIFFRACTION' ? 
c_scangle_it            ?     ? ? ? 'X-RAY DIFFRACTION' ? 
_struct.entry_id                  1QP9 
_struct.title                     'STRUCTURE OF HAP1-PC7 COMPLEXED TO THE UAS OF CYC7' 
_struct.pdbx_model_details        ? 
_struct.pdbx_CASP_flag            ? 
_struct.pdbx_model_type_details   ? 
_struct_keywords.entry_id        1QP9 
_struct_keywords.pdbx_keywords   TRANSCRIPTION/DNA 
A N N 1 ? 
B N N 2 ? 
C N N 1 ? 
D N N 2 ? 
E N N 3 ? 
F N N 3 ? 
G N N 3 ? 
H N N 3 ? 
I N N 4 ? 
J N N 4 ? 
K N N 4 ? 
L N N 4 ? 
M N N 4 ? 
N N N 4 ? 
O N N 4 ? 
P N N 4 ? 
Q N N 4 ? 
R N N 5 ? 
S N N 5 ? 
T N N 5 ? 
U N N 5 ? 
V N N 5 ? 
W N N 5 ? 
X N N 5 ? 
Y N N 5 ? 
HELX_P HELX_P1  1  CYS E 10 ? LYS E 17 ? CYS A 64  LYS A 71  1 ? 8  
HELX_P HELX_P2  2  CYS E 27 ? THR E 33 ? CYS A 81  THR A 87  1 ? 7  
HELX_P HELX_P3  3  VAL E 35 ? CYS E 39 ? VAL A 89  CYS A 93  5 ? 5  
HELX_P HELX_P4  4  THR E 45 ? LEU E 74 ? THR A 99  LEU A 128 1 ? 30 
HELX_P HELX_P5  5  CYS F 10 ? LYS F 17 ? CYS B 64  LYS B 71  1 ? 8  
HELX_P HELX_P6  6  GLN F 28 ? THR F 33 ? GLN B 82  THR B 87  1 ? 6  
HELX_P HELX_P7  7  VAL F 35 ? CYS F 39 ? VAL B 89  CYS B 93  5 ? 5  
HELX_P HELX_P8  8  GLN F 44 ? TRP F 46 ? GLN B 98  TRP B 100 5 ? 3  
HELX_P HELX_P9  9  ALA F 47 ? THR F 73 ? ALA B 101 THR B 127 1 ? 27 
HELX_P HELX_P10 10 CYS G 10 ? ARG G 16 ? CYS C 64  ARG C 70  1 ? 7  
HELX_P HELX_P11 11 CYS G 27 ? THR G 33 ? CYS C 81  THR C 87  1 ? 7  
HELX_P HELX_P12 12 GLY G 34 ? CYS G 39 ? GLY C 88  CYS C 93  5 ? 6  
HELX_P HELX_P13 13 THR G 45 ? LEU G 74 ? THR C 99  LEU C 128 1 ? 30 
HELX_P HELX_P14 14 CYS H 10 ? ARG H 16 ? CYS D 64  ARG D 70  1 ? 7  
HELX_P HELX_P15 15 CYS H 27 ? THR H 33 ? CYS D 81  THR D 87  1 ? 7  
HELX_P HELX_P16 16 VAL H 35 ? CYS H 39 ? VAL D 89  CYS D 93  5 ? 5  
HELX_P HELX_P17 17 GLN H 44 ? TRP H 46 ? GLN D 98  TRP D 100 5 ? 3  
HELX_P HELX_P18 18 ALA H 47 ? LEU H 74 ? ALA D 101 LEU D 128 1 ? 28 
#          HELX_P 
_struct_conf_type.criteria    ? 
_struct_conf_type.reference   ? 
metalc1  metalc ? ? E CYS 10 SG  ? ? ? 1_555 I ZN  .  ZN  ? ? A CYS 64  A ZN  131 1_555 ? ? ? ? ? ? ?               2.344 ? ? 
metalc2  metalc ? ? E CYS 10 SG  ? ? ? 1_555 J ZN  .  ZN  ? ? A CYS 64  A ZN  132 1_555 ? ? ? ? ? ? ?               2.266 ? ? 
metalc3  metalc ? ? E CYS 13 SG  ? ? ? 1_555 I ZN  .  ZN  ? ? A CYS 67  A ZN  131 1_555 ? ? ? ? ? ? ?               2.296 ? ? 
metalc4  metalc ? ? E CYS 20 SG  ? ? ? 1_555 I ZN  .  ZN  ? ? A CYS 74  A ZN  131 1_555 ? ? ? ? ? ? ?               2.319 ? ? 
metalc5  metalc ? ? E CYS 27 SG  ? ? ? 1_555 I ZN  .  ZN  ? ? A CYS 81  A ZN  131 1_555 ? ? ? ? ? ? ?               2.321 ? ? 
metalc6  metalc ? ? E CYS 27 SG  ? ? ? 1_555 J ZN  .  ZN  ? ? A CYS 81  A ZN  132 1_555 ? ? ? ? ? ? ?               2.348 ? ? 
metalc7  metalc ? ? E CYS 30 SG  ? ? ? 1_555 J ZN  .  ZN  ? ? A CYS 84  A ZN  132 1_555 ? ? ? ? ? ? ?               2.368 ? ? 
metalc8  metalc ? ? E CYS 39 SG  ? ? ? 1_555 J ZN  .  ZN  ? ? A CYS 93  A ZN  132 1_555 ? ? ? ? ? ? ?               2.296 ? ? 
metalc9  metalc ? ? F CYS 10 SG  ? ? ? 1_555 K ZN  .  ZN  ? ? B CYS 64  B ZN  131 1_555 ? ? ? ? ? ? ?               2.356 ? ? 
metalc10 metalc ? ? F CYS 10 SG  ? ? ? 1_555 L ZN  .  ZN  ? ? B CYS 64  B ZN  132 1_555 ? ? ? ? ? ? ?               2.348 ? ? 
metalc11 metalc ? ? F CYS 13 SG  ? ? ? 1_555 K ZN  .  ZN  ? ? B CYS 67  B ZN  131 1_555 ? ? ? ? ? ? ?               2.428 ? ? 
metalc12 metalc ? ? F CYS 20 SG  ? ? ? 1_555 K ZN  .  ZN  ? ? B CYS 74  B ZN  131 1_555 ? ? ? ? ? ? ?               2.314 ? ? 
metalc13 metalc ? ? F HIS 26 NE2 ? ? ? 1_555 M ZN  .  ZN  ? ? B HIS 80  B ZN  133 1_555 ? ? ? ? ? ? ?               2.125 ? ? 
metalc14 metalc ? ? F CYS 27 SG  ? ? ? 1_555 K ZN  .  ZN  ? ? B CYS 81  B ZN  131 1_555 ? ? ? ? ? ? ?               2.334 ? ? 
metalc15 metalc ? ? F CYS 27 SG  ? ? ? 1_555 L ZN  .  ZN  ? ? B CYS 81  B ZN  132 1_555 ? ? ? ? ? ? ?               2.337 ? ? 
metalc16 metalc ? ? F CYS 30 SG  ? ? ? 1_555 L ZN  .  ZN  ? ? B CYS 84  B ZN  132 1_555 ? ? ? ? ? ? ?               2.295 ? ? 
metalc17 metalc ? ? F HIS 37 ND1 ? ? ? 1_555 M ZN  .  ZN  ? ? B HIS 91  B ZN  133 1_555 ? ? ? ? ? ? ?               1.892 ? ? 
metalc18 metalc ? ? F CYS 39 SG  ? ? ? 1_555 L ZN  .  ZN  ? ? B CYS 93  B ZN  132 1_555 ? ? ? ? ? ? ?               2.338 ? ? 
metalc19 metalc ? ? M ZN  .  ZN  ? ? ? 1_555 H HIS 26 NE2 ? ? B ZN  133 D HIS 80  1_555 ? ? ? ? ? ? ?               1.917 ? ? 
metalc20 metalc ? ? M ZN  .  ZN  ? ? ? 1_555 H HIS 37 ND1 ? ? B ZN  133 D HIS 91  1_555 ? ? ? ? ? ? ?               2.224 ? ? 
metalc21 metalc ? ? G CYS 10 SG  ? ? ? 1_555 N ZN  .  ZN  ? ? C CYS 64  C ZN  131 1_555 ? ? ? ? ? ? ?               2.356 ? ? 
metalc22 metalc ? ? G CYS 10 SG  ? ? ? 1_555 O ZN  .  ZN  ? ? C CYS 64  C ZN  132 1_555 ? ? ? ? ? ? ?               2.333 ? ? 
metalc23 metalc ? ? G CYS 13 SG  ? ? ? 1_555 N ZN  .  ZN  ? ? C CYS 67  C ZN  131 1_555 ? ? ? ? ? ? ?               2.278 ? ? 
metalc24 metalc ? ? G CYS 20 SG  ? ? ? 1_555 N ZN  .  ZN  ? ? C CYS 74  C ZN  131 1_555 ? ? ? ? ? ? ?               2.323 ? ? 
metalc25 metalc ? ? G CYS 27 SG  ? ? ? 1_555 N ZN  .  ZN  ? ? C CYS 81  C ZN  131 1_555 ? ? ? ? ? ? ?               2.321 ? ? 
metalc26 metalc ? ? G CYS 27 SG  ? ? ? 1_555 O ZN  .  ZN  ? ? C CYS 81  C ZN  132 1_555 ? ? ? ? ? ? ?               2.335 ? ? 
metalc27 metalc ? ? G CYS 30 SG  ? ? ? 1_555 O ZN  .  ZN  ? ? C CYS 84  C ZN  132 1_555 ? ? ? ? ? ? ?               2.312 ? ? 
metalc28 metalc ? ? G CYS 39 SG  ? ? ? 1_555 O ZN  .  ZN  ? ? C CYS 93  C ZN  132 1_555 ? ? ? ? ? ? ?               2.248 ? ? 
metalc29 metalc ? ? H CYS 10 SG  ? ? ? 1_555 P ZN  .  ZN  ? ? D CYS 64  D ZN  131 1_555 ? ? ? ? ? ? ?               2.300 ? ? 
metalc30 metalc ? ? H CYS 10 SG  ? ? ? 1_555 Q ZN  .  ZN  ? ? D CYS 64  D ZN  132 1_555 ? ? ? ? ? ? ?               2.336 ? ? 
metalc31 metalc ? ? H CYS 13 SG  ? ? ? 1_555 P ZN  .  ZN  ? ? D CYS 67  D ZN  131 1_555 ? ? ? ? ? ? ?               2.335 ? ? 
metalc32 metalc ? ? H CYS 20 SG  ? ? ? 1_555 P ZN  .  ZN  ? ? D CYS 74  D ZN  131 1_555 ? ? ? ? ? ? ?               2.302 ? ? 
metalc33 metalc ? ? H CYS 27 SG  ? ? ? 1_555 P ZN  .  ZN  ? ? D CYS 81  D ZN  131 1_555 ? ? ? ? ? ? ?               2.356 ? ? 
metalc34 metalc ? ? H CYS 27 SG  ? ? ? 1_555 Q ZN  .  ZN  ? ? D CYS 81  D ZN  132 1_555 ? ? ? ? ? ? ?               2.334 ? ? 
metalc35 metalc ? ? H CYS 30 SG  ? ? ? 1_555 Q ZN  .  ZN  ? ? D CYS 84  D ZN  132 1_555 ? ? ? ? ? ? ?               2.327 ? ? 
metalc36 metalc ? ? H CYS 39 SG  ? ? ? 1_555 Q ZN  .  ZN  ? ? D CYS 93  D ZN  132 1_555 ? ? ? ? ? ? ?               2.324 ? ? 
hydrog1  hydrog ? ? A DA  1  N1  ? ? ? 1_555 B DT  20 N3  ? ? E DA  1   F DT  20  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog2  hydrog ? ? A DA  1  N6  ? ? ? 1_555 B DT  20 O4  ? ? E DA  1   F DT  20  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog3  hydrog ? ? A DC  2  N3  ? ? ? 1_555 B DC  18 N4  ? ? E DC  2   F DC  18  1_555 ? ? ? ? ? ? 'DC-DC MISPAIR' ?     ? ? 
hydrog4  hydrog ? ? A DC  2  N3  ? ? ? 1_555 B DG  19 N1  ? ? E DC  2   F DG  19  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog5  hydrog ? ? A DC  2  N4  ? ? ? 1_555 B DG  19 O6  ? ? E DC  2   F DG  19  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog6  hydrog ? ? A DC  2  O2  ? ? ? 1_555 B DG  19 N2  ? ? E DC  2   F DG  19  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog7  hydrog ? ? A DG  3  N1  ? ? ? 1_555 B DC  18 N3  ? ? E DG  3   F DC  18  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog8  hydrog ? ? A DG  3  N2  ? ? ? 1_555 B DC  18 O2  ? ? E DG  3   F DC  18  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog9  hydrog ? ? A DG  3  O6  ? ? ? 1_555 B DC  18 N4  ? ? E DG  3   F DC  18  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog10 hydrog ? ? A DC  4  N3  ? ? ? 1_555 B DG  17 N1  ? ? E DC  4   F DG  17  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog11 hydrog ? ? A DC  4  N4  ? ? ? 1_555 B DG  17 O6  ? ? E DC  4   F DG  17  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog12 hydrog ? ? A DC  4  O2  ? ? ? 1_555 B DG  17 N2  ? ? E DC  4   F DG  17  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog13 hydrog ? ? A DT  5  N3  ? ? ? 1_555 B DA  16 N1  ? ? E DT  5   F DA  16  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog14 hydrog ? ? A DT  5  O4  ? ? ? 1_555 B DA  16 N6  ? ? E DT  5   F DA  16  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog15 hydrog ? ? A DA  6  N1  ? ? ? 1_555 B DT  15 N3  ? ? E DA  6   F DT  15  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog16 hydrog ? ? A DA  6  N6  ? ? ? 1_555 B DT  15 O4  ? ? E DA  6   F DT  15  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog17 hydrog ? ? A DT  7  N3  ? ? ? 1_555 B DA  14 N1  ? ? E DT  7   F DA  14  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog18 hydrog ? ? A DT  7  O4  ? ? ? 1_555 B DA  14 N6  ? ? E DT  7   F DA  14  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog19 hydrog ? ? A DT  8  N3  ? ? ? 1_555 B DA  13 N1  ? ? E DT  8   F DA  13  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog20 hydrog ? ? A DT  8  O4  ? ? ? 1_555 B DA  13 N6  ? ? E DT  8   F DA  13  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog21 hydrog ? ? A DA  9  N1  ? ? ? 1_555 B DT  12 N3  ? ? E DA  9   F DT  12  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog22 hydrog ? ? A DA  9  N6  ? ? ? 1_555 B DT  12 O4  ? ? E DA  9   F DT  12  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog23 hydrog ? ? A DT  10 N3  ? ? ? 1_555 B DA  11 N1  ? ? E DT  10  F DA  11  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog24 hydrog ? ? A DT  10 O4  ? ? ? 1_555 B DA  11 N6  ? ? E DT  10  F DA  11  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog25 hydrog ? ? A DC  11 N3  ? ? ? 1_555 B DG  10 N1  ? ? E DC  11  F DG  10  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog26 hydrog ? ? A DC  11 N4  ? ? ? 1_555 B DG  10 O6  ? ? E DC  11  F DG  10  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog27 hydrog ? ? A DC  11 O2  ? ? ? 1_555 B DG  10 N2  ? ? E DC  11  F DG  10  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog28 hydrog ? ? A DG  12 N1  ? ? ? 1_555 B DC  9  N3  ? ? E DG  12  F DC  9   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog29 hydrog ? ? A DG  12 N2  ? ? ? 1_555 B DC  9  O2  ? ? E DG  12  F DC  9   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog30 hydrog ? ? A DG  12 O6  ? ? ? 1_555 B DC  9  N4  ? ? E DG  12  F DC  9   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog31 hydrog ? ? A DC  13 N3  ? ? ? 1_555 B DG  8  N1  ? ? E DC  13  F DG  8   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog32 hydrog ? ? A DC  13 N4  ? ? ? 1_555 B DG  8  O6  ? ? E DC  13  F DG  8   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog33 hydrog ? ? A DC  13 O2  ? ? ? 1_555 B DG  8  N2  ? ? E DC  13  F DG  8   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog34 hydrog ? ? A DT  14 N3  ? ? ? 1_555 B DA  7  N1  ? ? E DT  14  F DA  7   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog35 hydrog ? ? A DT  14 O4  ? ? ? 1_555 B DA  7  N6  ? ? E DT  14  F DA  7   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog36 hydrog ? ? A DA  15 N1  ? ? ? 1_555 B DT  6  N3  ? ? E DA  15  F DT  6   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog37 hydrog ? ? A DA  15 N6  ? ? ? 1_555 B DT  6  O4  ? ? E DA  15  F DT  6   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog38 hydrog ? ? A DT  16 N3  ? ? ? 1_555 B DA  5  N1  ? ? E DT  16  F DA  5   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog39 hydrog ? ? A DT  16 O4  ? ? ? 1_555 B DA  5  N6  ? ? E DT  16  F DA  5   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog40 hydrog ? ? A DT  17 N3  ? ? ? 1_555 B DA  4  N1  ? ? E DT  17  F DA  4   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog41 hydrog ? ? A DT  17 O4  ? ? ? 1_555 B DA  4  N6  ? ? E DT  17  F DA  4   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog42 hydrog ? ? A DA  18 N1  ? ? ? 1_555 B DT  3  N3  ? ? E DA  18  F DT  3   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog43 hydrog ? ? A DA  18 N6  ? ? ? 1_555 B DT  3  O4  ? ? E DA  18  F DT  3   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog44 hydrog ? ? A DG  19 N1  ? ? ? 1_555 B DC  2  N3  ? ? E DG  19  F DC  2   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog45 hydrog ? ? A DG  19 N2  ? ? ? 1_555 B DC  2  O2  ? ? E DG  19  F DC  2   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog46 hydrog ? ? A DG  19 O6  ? ? ? 1_555 B DC  2  N4  ? ? E DG  19  F DC  2   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog47 hydrog ? ? A DT  20 N3  ? ? ? 1_555 B DA  1  N1  ? ? E DT  20  F DA  1   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog48 hydrog ? ? A DT  20 O4  ? ? ? 1_555 B DA  1  N6  ? ? E DT  20  F DA  1   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog49 hydrog ? ? C DC  2  N3  ? ? ? 1_555 D DC  18 N4  ? ? G DC  2   H DC  18  1_555 ? ? ? ? ? ? 'DC-DC MISPAIR' ?     ? ? 
hydrog50 hydrog ? ? C DC  2  N3  ? ? ? 1_555 D DG  19 N1  ? ? G DC  2   H DG  19  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog51 hydrog ? ? C DC  2  N4  ? ? ? 1_555 D DG  19 O6  ? ? G DC  2   H DG  19  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog52 hydrog ? ? C DC  2  O2  ? ? ? 1_555 D DG  19 N2  ? ? G DC  2   H DG  19  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog53 hydrog ? ? C DG  3  N1  ? ? ? 1_555 D DC  18 N3  ? ? G DG  3   H DC  18  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog54 hydrog ? ? C DG  3  N2  ? ? ? 1_555 D DC  18 O2  ? ? G DG  3   H DC  18  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog55 hydrog ? ? C DG  3  O6  ? ? ? 1_555 D DC  18 N4  ? ? G DG  3   H DC  18  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog56 hydrog ? ? C DC  4  N3  ? ? ? 1_555 D DG  17 N1  ? ? G DC  4   H DG  17  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog57 hydrog ? ? C DC  4  N4  ? ? ? 1_555 D DG  17 O6  ? ? G DC  4   H DG  17  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog58 hydrog ? ? C DC  4  O2  ? ? ? 1_555 D DG  17 N2  ? ? G DC  4   H DG  17  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog59 hydrog ? ? C DT  5  N3  ? ? ? 1_555 D DA  16 N1  ? ? G DT  5   H DA  16  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog60 hydrog ? ? C DT  5  O4  ? ? ? 1_555 D DA  16 N6  ? ? G DT  5   H DA  16  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog61 hydrog ? ? C DA  6  N1  ? ? ? 1_555 D DT  15 N3  ? ? G DA  6   H DT  15  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog62 hydrog ? ? C DA  6  N6  ? ? ? 1_555 D DT  15 O4  ? ? G DA  6   H DT  15  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog63 hydrog ? ? C DT  7  N3  ? ? ? 1_555 D DA  14 N1  ? ? G DT  7   H DA  14  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog64 hydrog ? ? C DT  7  O4  ? ? ? 1_555 D DA  14 N6  ? ? G DT  7   H DA  14  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog65 hydrog ? ? C DT  8  N3  ? ? ? 1_555 D DA  13 N1  ? ? G DT  8   H DA  13  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog66 hydrog ? ? C DT  8  O4  ? ? ? 1_555 D DA  13 N6  ? ? G DT  8   H DA  13  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog67 hydrog ? ? C DA  9  N1  ? ? ? 1_555 D DT  12 N3  ? ? G DA  9   H DT  12  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog68 hydrog ? ? C DA  9  N6  ? ? ? 1_555 D DT  12 O4  ? ? G DA  9   H DT  12  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog69 hydrog ? ? C DT  10 N3  ? ? ? 1_555 D DA  11 N1  ? ? G DT  10  H DA  11  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog70 hydrog ? ? C DT  10 O4  ? ? ? 1_555 D DA  11 N6  ? ? G DT  10  H DA  11  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog71 hydrog ? ? C DC  11 N3  ? ? ? 1_555 D DG  10 N1  ? ? G DC  11  H DG  10  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog72 hydrog ? ? C DC  11 N4  ? ? ? 1_555 D DG  10 O6  ? ? G DC  11  H DG  10  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog73 hydrog ? ? C DC  11 O2  ? ? ? 1_555 D DG  10 N2  ? ? G DC  11  H DG  10  1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog74 hydrog ? ? C DG  12 N1  ? ? ? 1_555 D DC  9  N3  ? ? G DG  12  H DC  9   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog75 hydrog ? ? C DG  12 N2  ? ? ? 1_555 D DC  9  O2  ? ? G DG  12  H DC  9   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog76 hydrog ? ? C DG  12 O6  ? ? ? 1_555 D DC  9  N4  ? ? G DG  12  H DC  9   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog77 hydrog ? ? C DC  13 N3  ? ? ? 1_555 D DG  8  N1  ? ? G DC  13  H DG  8   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog78 hydrog ? ? C DC  13 N4  ? ? ? 1_555 D DG  8  O6  ? ? G DC  13  H DG  8   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog79 hydrog ? ? C DC  13 O2  ? ? ? 1_555 D DG  8  N2  ? ? G DC  13  H DG  8   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog80 hydrog ? ? C DT  14 N3  ? ? ? 1_555 D DA  7  N1  ? ? G DT  14  H DA  7   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog81 hydrog ? ? C DT  14 O4  ? ? ? 1_555 D DA  7  N6  ? ? G DT  14  H DA  7   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog82 hydrog ? ? C DA  15 N1  ? ? ? 1_555 D DT  6  N3  ? ? G DA  15  H DT  6   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog83 hydrog ? ? C DA  15 N6  ? ? ? 1_555 D DT  6  O4  ? ? G DA  15  H DT  6   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog84 hydrog ? ? C DT  16 N3  ? ? ? 1_555 D DA  5  N1  ? ? G DT  16  H DA  5   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog85 hydrog ? ? C DT  16 O4  ? ? ? 1_555 D DA  5  N6  ? ? G DT  16  H DA  5   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog86 hydrog ? ? C DT  17 N3  ? ? ? 1_555 D DA  4  N1  ? ? G DT  17  H DA  4   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog87 hydrog ? ? C DT  17 O4  ? ? ? 1_555 D DA  4  N6  ? ? G DT  17  H DA  4   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog88 hydrog ? ? C DA  18 N1  ? ? ? 1_555 D DT  3  N3  ? ? G DA  18  H DT  3   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
hydrog89 hydrog ? ? C DA  18 N6  ? ? ? 1_555 D DT  3  O4  ? ? G DA  18  H DT  3   1_555 ? ? ? ? ? ? WATSON-CRICK    ?     ? ? 
metalc ? ? 
hydrog ? ? 
1 ARG 24 E . ? ARG 78 A PRO 25 E ? PRO 79 A 1 1.33  
2 ARG 24 F . ? ARG 78 B PRO 25 F ? PRO 79 B 1 0.43  
3 ARG 24 G . ? ARG 78 C PRO 25 G ? PRO 79 C 1 -1.33 
4 ARG 24 H . ? ARG 78 D PRO 25 H ? PRO 79 D 1 -0.73 
AC1 Software A ZN 131 ? 5 'BINDING SITE FOR RESIDUE ZN A 131' 
AC2 Software A ZN 132 ? 5 'BINDING SITE FOR RESIDUE ZN A 132' 
AC3 Software B ZN 131 ? 5 'BINDING SITE FOR RESIDUE ZN B 131' 
AC4 Software B ZN 132 ? 5 'BINDING SITE FOR RESIDUE ZN B 132' 
AC5 Software C ZN 131 ? 5 'BINDING SITE FOR RESIDUE ZN C 131' 
AC6 Software C ZN 132 ? 5 'BINDING SITE FOR RESIDUE ZN C 132' 
AC7 Software D ZN 131 ? 5 'BINDING SITE FOR RESIDUE ZN D 131' 
AC8 Software D ZN 132 ? 5 'BINDING SITE FOR RESIDUE ZN D 132' 
AC9 Software B ZN 133 ? 4 'BINDING SITE FOR RESIDUE ZN B 133' 
1  AC1 5 CYS E 10 ? CYS A 64  . ? 1_555 ? 
2  AC1 5 CYS E 13 ? CYS A 67  . ? 1_555 ? 
3  AC1 5 CYS E 20 ? CYS A 74  . ? 1_555 ? 
4  AC1 5 CYS E 27 ? CYS A 81  . ? 1_555 ? 
5  AC1 5 ZN  J .  ? ZN  A 132 . ? 1_555 ? 
6  AC2 5 CYS E 10 ? CYS A 64  . ? 1_555 ? 
7  AC2 5 CYS E 27 ? CYS A 81  . ? 1_555 ? 
8  AC2 5 CYS E 30 ? CYS A 84  . ? 1_555 ? 
9  AC2 5 CYS E 39 ? CYS A 93  . ? 1_555 ? 
10 AC2 5 ZN  I .  ? ZN  A 131 . ? 1_555 ? 
11 AC3 5 CYS F 10 ? CYS B 64  . ? 1_555 ? 
12 AC3 5 CYS F 13 ? CYS B 67  . ? 1_555 ? 
13 AC3 5 CYS F 20 ? CYS B 74  . ? 1_555 ? 
14 AC3 5 CYS F 27 ? CYS B 81  . ? 1_555 ? 
15 AC3 5 ZN  L .  ? ZN  B 132 . ? 1_555 ? 
16 AC4 5 CYS F 10 ? CYS B 64  . ? 1_555 ? 
17 AC4 5 CYS F 27 ? CYS B 81  . ? 1_555 ? 
18 AC4 5 CYS F 30 ? CYS B 84  . ? 1_555 ? 
19 AC4 5 CYS F 39 ? CYS B 93  . ? 1_555 ? 
20 AC4 5 ZN  K .  ? ZN  B 131 . ? 1_555 ? 
21 AC5 5 CYS G 10 ? CYS C 64  . ? 1_555 ? 
22 AC5 5 CYS G 13 ? CYS C 67  . ? 1_555 ? 
23 AC5 5 CYS G 20 ? CYS C 74  . ? 1_555 ? 
24 AC5 5 CYS G 27 ? CYS C 81  . ? 1_555 ? 
25 AC5 5 ZN  O .  ? ZN  C 132 . ? 1_555 ? 
26 AC6 5 CYS G 10 ? CYS C 64  . ? 1_555 ? 
27 AC6 5 CYS G 27 ? CYS C 81  . ? 1_555 ? 
28 AC6 5 CYS G 30 ? CYS C 84  . ? 1_555 ? 
29 AC6 5 CYS G 39 ? CYS C 93  . ? 1_555 ? 
30 AC6 5 ZN  N .  ? ZN  C 131 . ? 1_555 ? 
31 AC7 5 CYS H 10 ? CYS D 64  . ? 1_555 ? 
32 AC7 5 CYS H 13 ? CYS D 67  . ? 1_555 ? 
33 AC7 5 CYS H 20 ? CYS D 74  . ? 1_555 ? 
34 AC7 5 CYS H 27 ? CYS D 81  . ? 1_555 ? 
35 AC7 5 ZN  Q .  ? ZN  D 132 . ? 1_555 ? 
36 AC8 5 CYS H 10 ? CYS D 64  . ? 1_555 ? 
37 AC8 5 CYS H 27 ? CYS D 81  . ? 1_555 ? 
38 AC8 5 CYS H 30 ? CYS D 84  . ? 1_555 ? 
39 AC8 5 CYS H 39 ? CYS D 93  . ? 1_555 ? 
40 AC8 5 ZN  P .  ? ZN  D 131 . ? 1_555 ? 
41 AC9 4 HIS F 26 ? HIS B 80  . ? 1_555 ? 
42 AC9 4 HIS F 37 ? HIS B 91  . ? 1_555 ? 
43 AC9 4 HIS H 26 ? HIS D 80  . ? 1_555 ? 
44 AC9 4 HIS H 37 ? HIS D 91  . ? 1_555 ? 
_database_PDB_matrix.entry_id          1QP9 
_database_PDB_matrix.origx[1][1]       1.000000 
_database_PDB_matrix.origx[1][2]       0.000000 
_database_PDB_matrix.origx[1][3]       0.000000 
_database_PDB_matrix.origx[2][1]       0.000000 
_database_PDB_matrix.origx[2][2]       1.000000 
_database_PDB_matrix.origx[2][3]       0.000000 
_database_PDB_matrix.origx[3][1]       0.000000 
_database_PDB_matrix.origx[3][2]       0.000000 
_database_PDB_matrix.origx[3][3]       1.000000 
_database_PDB_matrix.origx_vector[1]   0.00000 
_database_PDB_matrix.origx_vector[2]   0.00000 
_database_PDB_matrix.origx_vector[3]   0.00000 
_atom_sites.entry_id                    1QP9 
_atom_sites.fract_transf_matrix[1][1]   0.011641 
_atom_sites.fract_transf_matrix[1][2]   0.000000 
_atom_sites.fract_transf_matrix[1][3]   0.000000 
_atom_sites.fract_transf_matrix[2][1]   0.000000 
_atom_sites.fract_transf_matrix[2][2]   0.011001 
_atom_sites.fract_transf_matrix[2][3]   0.000000 
_atom_sites.fract_transf_matrix[3][1]   0.000000 
_atom_sites.fract_transf_matrix[3][2]   0.000000 
_atom_sites.fract_transf_matrix[3][3]   0.010363 
_atom_sites.fract_transf_vector[1]      0.00000 
_atom_sites.fract_transf_vector[2]      0.00000 
_atom_sites.fract_transf_vector[3]      0.00000 
ATOM   1    O  "O5'" . DA  A 1 1  ? 0.491   57.694 10.768  1.00 64.30 ? 1   DA  E "O5'" 1 
ATOM   2    C  "C5'" . DA  A 1 1  ? 1.316   58.866 10.624  1.00 62.90 ? 1   DA  E "C5'" 1 
ATOM   3    C  "C4'" . DA  A 1 1  ? 0.626   60.145 11.049  1.00 62.53 ? 1   DA  E "C4'" 1 
ATOM   4    O  "O4'" . DA  A 1 1  ? -0.780  60.076 10.689  1.00 63.94 ? 1   DA  E "O4'" 1 
ATOM   5    C  "C3'" . DA  A 1 1  ? 0.631   60.365 12.558  1.00 60.64 ? 1   DA  E "C3'" 1 
ATOM   6    O  "O3'" . DA  A 1 1  ? 0.590   61.788 12.809  1.00 59.31 ? 1   DA  E "O3'" 1 
ATOM   7    C  "C2'" . DA  A 1 1  ? -0.632  59.635 13.001  1.00 61.58 ? 1   DA  E "C2'" 1 
ATOM   8    C  "C1'" . DA  A 1 1  ? -1.592  59.912 11.859  1.00 62.54 ? 1   DA  E "C1'" 1 
ATOM   9    N  N9    . DA  A 1 1  ? -2.625  58.897 11.574  1.00 62.87 ? 1   DA  E N9    1 
ATOM   10   C  C8    . DA  A 1 1  ? -2.468  57.583 11.165  1.00 62.46 ? 1   DA  E C8    1 
ATOM   11   N  N7    . DA  A 1 1  ? -3.605  56.963 10.906  1.00 61.01 ? 1   DA  E N7    1 
ATOM   12   C  C5    . DA  A 1 1  ? -4.578  57.919 11.182  1.00 61.27 ? 1   DA  E C5    1 
ATOM   13   C  C6    . DA  A 1 1  ? -5.990  57.890 11.099  1.00 61.54 ? 1   DA  E C6    1 
ATOM   14   N  N6    . DA  A 1 1  ? -6.686  56.831 10.716  1.00 60.47 ? 1   DA  E N6    1 
ATOM   15   N  N1    . DA  A 1 1  ? -6.667  59.013 11.434  1.00 62.99 ? 1   DA  E N1    1 
ATOM   16   C  C2    . DA  A 1 1  ? -5.961  60.094 11.840  1.00 63.11 ? 1   DA  E C2    1 
ATOM   17   N  N3    . DA  A 1 1  ? -4.633  60.243 11.966  1.00 62.79 ? 1   DA  E N3    1 
ATOM   18   C  C4    . DA  A 1 1  ? -3.992  59.109 11.614  1.00 62.43 ? 1   DA  E C4    1 
ATOM   19   P  P     . DC  A 1 2  ? 1.166   62.396 14.198  1.00 58.75 ? 2   DC  E P     1 
ATOM   20   O  OP1   . DC  A 1 2  ? 1.818   63.711 13.946  1.00 57.91 ? 2   DC  E OP1   1 
ATOM   21   O  OP2   . DC  A 1 2  ? 1.927   61.319 14.908  1.00 58.78 ? 2   DC  E OP2   1 
ATOM   22   O  "O5'" . DC  A 1 2  ? -0.168  62.669 15.011  1.00 57.17 ? 2   DC  E "O5'" 1 
ATOM   23   C  "C5'" . DC  A 1 2  ? -1.332  61.949 14.661  1.00 55.01 ? 2   DC  E "C5'" 1 
ATOM   24   C  "C4'" . DC  A 1 2  ? -2.550  62.563 15.294  1.00 53.99 ? 2   DC  E "C4'" 1 
ATOM   25   O  "O4'" . DC  A 1 2  ? -3.679  61.752 14.923  1.00 54.60 ? 2   DC  E "O4'" 1 
ATOM   26   C  "C3'" . DC  A 1 2  ? -2.517  62.545 16.811  1.00 53.46 ? 2   DC  E "C3'" 1 
ATOM   27   O  "O3'" . DC  A 1 2  ? -3.376  63.587 17.263  1.00 53.30 ? 2   DC  E "O3'" 1 
ATOM   28   C  "C2'" . DC  A 1 2  ? -3.089  61.178 17.131  1.00 53.61 ? 2   DC  E "C2'" 1 
ATOM   29   C  "C1'" . DC  A 1 2  ? -4.119  60.982 16.024  1.00 53.20 ? 2   DC  E "C1'" 1 
ATOM   30   N  N1    . DC  A 1 2  ? -4.266  59.608 15.545  1.00 53.23 ? 2   DC  E N1    1 
ATOM   31   C  C2    . DC  A 1 2  ? -5.536  59.061 15.496  1.00 54.04 ? 2   DC  E C2    1 
ATOM   32   O  O2    . DC  A 1 2  ? -6.491  59.742 15.929  1.00 55.72 ? 2   DC  E O2    1 
ATOM   33   N  N3    . DC  A 1 2  ? -5.708  57.815 14.993  1.00 53.05 ? 2   DC  E N3    1 
ATOM   34   C  C4    . DC  A 1 2  ? -4.655  57.121 14.567  1.00 51.89 ? 2   DC  E C4    1 
ATOM   35   N  N4    . DC  A 1 2  ? -4.876  55.901 14.065  1.00 52.11 ? 2   DC  E N4    1 
ATOM   36   C  C5    . DC  A 1 2  ? -3.332  57.641 14.633  1.00 51.53 ? 2   DC  E C5    1 
ATOM   37   C  C6    . DC  A 1 2  ? -3.186  58.879 15.124  1.00 53.01 ? 2   DC  E C6    1 
ATOM   38   P  P     . DG  A 1 3  ? -3.081  64.324 18.662  1.00 55.75 ? 3   DG  E P     1 
ATOM   39   O  OP1   . DG  A 1 3  ? -2.077  65.413 18.422  1.00 55.08 ? 3   DG  E OP1   1 
ATOM   40   O  OP2   . DG  A 1 3  ? -2.779  63.250 19.667  1.00 55.15 ? 3   DG  E OP2   1 
ATOM   41   O  "O5'" . DG  A 1 3  ? -4.492  64.992 18.984  1.00 53.47 ? 3   DG  E "O5'" 1 
ATOM   42   C  "C5'" . DG  A 1 3  ? -5.187  65.679 17.954  1.00 53.93 ? 3   DG  E "C5'" 1 
ATOM   43   C  "C4'" . DG  A 1 3  ? -6.683  65.530 18.109  1.00 53.52 ? 3   DG  E "C4'" 1 
ATOM   44   O  "O4'" . DG  A 1 3  ? -7.072  64.163 17.845  1.00 52.09 ? 3   DG  E "O4'" 1 
ATOM   45   C  "C3'" . DG  A 1 3  ? -7.165  65.813 19.526  1.00 54.14 ? 3   DG  E "C3'" 1 
ATOM   46   O  "O3'" . DG  A 1 3  ? -8.499  66.321 19.475  1.00 57.65 ? 3   DG  E "O3'" 1 
ATOM   47   C  "C2'" . DG  A 1 3  ? -7.102  64.453 20.195  1.00 53.23 ? 3   DG  E "C2'" 1 
ATOM   48   C  "C1'" . DG  A 1 3  ? -7.498  63.526 19.054  1.00 52.21 ? 3   DG  E "C1'" 1 
ATOM   49   N  N9    . DG  A 1 3  ? -6.924  62.180 19.084  1.00 49.94 ? 3   DG  E N9    1 
ATOM   50   C  C8    . DG  A 1 3  ? -5.628  61.834 19.384  1.00 49.42 ? 3   DG  E C8    1 
ATOM   51   N  N7    . DG  A 1 3  ? -5.394  60.554 19.257  1.00 48.73 ? 3   DG  E N7    1 
ATOM   52   C  C5    . DG  A 1 3  ? -6.614  60.019 18.865  1.00 47.76 ? 3   DG  E C5    1 
ATOM   53   C  C6    . DG  A 1 3  ? -6.973  58.679 18.573  1.00 47.52 ? 3   DG  E C6    1 
ATOM   54   O  O6    . DG  A 1 3  ? -6.258  57.671 18.582  1.00 46.41 ? 3   DG  E O6    1 
ATOM   55   N  N1    . DG  A 1 3  ? -8.315  58.574 18.229  1.00 46.92 ? 3   DG  E N1    1 
ATOM   56   C  C2    . DG  A 1 3  ? -9.198  59.618 18.167  1.00 46.66 ? 3   DG  E C2    1 
ATOM   57   N  N2    . DG  A 1 3  ? -10.455 59.304 17.818  1.00 45.46 ? 3   DG  E N2    1 
ATOM   58   N  N3    . DG  A 1 3  ? -8.874  60.876 18.425  1.00 47.34 ? 3   DG  E N3    1 
ATOM   59   C  C4    . DG  A 1 3  ? -7.574  61.001 18.769  1.00 48.00 ? 3   DG  E C4    1 
ATOM   60   P  P     . DC  A 1 4  ? -9.337  66.506 20.841  1.00 62.00 ? 4   DC  E P     1 
ATOM   61   O  OP1   . DC  A 1 4  ? -10.488 67.440 20.582  1.00 60.31 ? 4   DC  E OP1   1 
ATOM   62   O  OP2   . DC  A 1 4  ? -8.351  66.827 21.949  1.00 60.14 ? 4   DC  E OP2   1 
ATOM   63   O  "O5'" . DC  A 1 4  ? -9.949  65.047 21.071  1.00 60.88 ? 4   DC  E "O5'" 1 
ATOM   64   C  "C5'" . DC  A 1 4  ? -10.780 64.454 20.080  1.00 57.21 ? 4   DC  E "C5'" 1 
ATOM   65   C  "C4'" . DC  A 1 4  ? -11.727 63.455 20.708  1.00 55.34 ? 4   DC  E "C4'" 1 
ATOM   66   O  "O4'" . DC  A 1 4  ? -11.090 62.153 20.791  1.00 55.98 ? 4   DC  E "O4'" 1 
ATOM   67   C  "C3'" . DC  A 1 4  ? -12.101 63.820 22.143  1.00 52.92 ? 4   DC  E "C3'" 1 
ATOM   68   O  "O3'" . DC  A 1 4  ? -13.394 63.317 22.434  1.00 49.74 ? 4   DC  E "O3'" 1 
ATOM   69   C  "C2'" . DC  A 1 4  ? -11.040 63.106 22.965  1.00 54.94 ? 4   DC  E "C2'" 1 
ATOM   70   C  "C1'" . DC  A 1 4  ? -10.825 61.822 22.156  1.00 55.69 ? 4   DC  E "C1'" 1 
ATOM   71   N  N1    . DC  A 1 4  ? -9.488  61.197 22.246  1.00 54.52 ? 4   DC  E N1    1 
ATOM   72   C  C2    . DC  A 1 4  ? -9.237  59.991 21.551  1.00 53.84 ? 4   DC  E C2    1 
ATOM   73   O  O2    . DC  A 1 4  ? -10.144 59.478 20.886  1.00 50.80 ? 4   DC  E O2    1 
ATOM   74   N  N3    . DC  A 1 4  ? -8.013  59.423 21.628  1.00 54.84 ? 4   DC  E N3    1 
ATOM   75   C  C4    . DC  A 1 4  ? -7.054  60.000 22.366  1.00 55.59 ? 4   DC  E C4    1 
ATOM   76   N  N4    . DC  A 1 4  ? -5.856  59.403 22.424  1.00 55.61 ? 4   DC  E N4    1 
ATOM   77   C  C5    . DC  A 1 4  ? -7.277  61.215 23.083  1.00 55.52 ? 4   DC  E C5    1 
ATOM   78   C  C6    . DC  A 1 4  ? -8.494  61.771 22.997  1.00 55.09 ? 4   DC  E C6    1 
ATOM   79   P  P     . DT  A 1 5  ? -14.179 63.827 23.740  1.00 49.83 ? 5   DT  E P     1 
ATOM   80   O  OP1   . DT  A 1 5  ? -15.191 64.811 23.276  1.00 50.44 ? 5   DT  E OP1   1 
ATOM   81   O  OP2   . DT  A 1 5  ? -13.198 64.214 24.796  1.00 48.97 ? 5   DT  E OP2   1 
ATOM   82   O  "O5'" . DT  A 1 5  ? -14.955 62.520 24.233  1.00 47.90 ? 5   DT  E "O5'" 1 
ATOM   83   C  "C5'" . DT  A 1 5  ? -15.652 61.701 23.293  1.00 43.67 ? 5   DT  E "C5'" 1 
ATOM   84   C  "C4'" . DT  A 1 5  ? -15.687 60.251 23.732  1.00 43.64 ? 5   DT  E "C4'" 1 
ATOM   85   O  "O4'" . DT  A 1 5  ? -14.352 59.689 23.763  1.00 44.44 ? 5   DT  E "O4'" 1 
ATOM   86   C  "C3'" . DT  A 1 5  ? -16.208 60.090 25.161  1.00 42.75 ? 5   DT  E "C3'" 1 
ATOM   87   O  "O3'" . DT  A 1 5  ? -16.704 58.764 25.291  1.00 41.80 ? 5   DT  E "O3'" 1 
ATOM   88   C  "C2'" . DT  A 1 5  ? -14.947 60.176 25.999  1.00 40.73 ? 5   DT  E "C2'" 1 
ATOM   89   C  "C1'" . DT  A 1 5  ? -14.006 59.391 25.112  1.00 41.53 ? 5   DT  E "C1'" 1 
ATOM   90   N  N1    . DT  A 1 5  ? -12.554 59.529 25.289  1.00 40.45 ? 5   DT  E N1    1 
ATOM   91   C  C2    . DT  A 1 5  ? -11.788 58.447 24.911  1.00 38.45 ? 5   DT  E C2    1 
ATOM   92   O  O2    . DT  A 1 5  ? -12.269 57.420 24.460  1.00 36.26 ? 5   DT  E O2    1 
ATOM   93   N  N3    . DT  A 1 5  ? -10.442 58.615 25.083  1.00 38.06 ? 5   DT  E N3    1 
ATOM   94   C  C4    . DT  A 1 5  ? -9.796  59.738 25.580  1.00 40.54 ? 5   DT  E C4    1 
ATOM   95   O  O4    . DT  A 1 5  ? -8.566  59.750 25.673  1.00 42.09 ? 5   DT  E O4    1 
ATOM   96   C  C5    . DT  A 1 5  ? -10.662 60.833 25.962  1.00 40.91 ? 5   DT  E C5    1 
ATOM   97   C  C7    . DT  A 1 5  ? -10.061 62.084 26.516  1.00 40.37 ? 5   DT  E C7    1 
ATOM   98   C  C6    . DT  A 1 5  ? -11.980 60.677 25.799  1.00 42.11 ? 5   DT  E C6    1 
ATOM   99   P  P     . DA  A 1 6  ? -18.274 58.484 25.191  1.00 43.32 ? 6   DA  E P     1 
ATOM   100  O  OP1   . DA  A 1 6  ? -18.777 59.133 23.956  1.00 44.16 ? 6   DA  E OP1   1 
ATOM   101  O  OP2   . DA  A 1 6  ? -18.863 58.848 26.511  1.00 41.81 ? 6   DA  E OP2   1 
ATOM   102  O  "O5'" . DA  A 1 6  ? -18.345 56.903 24.975  1.00 42.24 ? 6   DA  E "O5'" 1 
ATOM   103  C  "C5'" . DA  A 1 6  ? -18.254 56.346 23.661  1.00 39.17 ? 6   DA  E "C5'" 1 
ATOM   104  C  "C4'" . DA  A 1 6  ? -17.580 54.984 23.676  1.00 39.00 ? 6   DA  E "C4'" 1 
ATOM   105  O  "O4'" . DA  A 1 6  ? -16.206 55.093 24.133  1.00 38.87 ? 6   DA  E "O4'" 1 
ATOM   106  C  "C3'" . DA  A 1 6  ? -18.218 53.969 24.620  1.00 39.20 ? 6   DA  E "C3'" 1 
ATOM   107  O  "O3'" . DA  A 1 6  ? -18.024 52.669 24.068  1.00 39.98 ? 6   DA  E "O3'" 1 
ATOM   108  C  "C2'" . DA  A 1 6  ? -17.455 54.184 25.918  1.00 36.22 ? 6   DA  E "C2'" 1 
ATOM   109  C  "C1'" . DA  A 1 6  ? -16.053 54.479 25.410  1.00 34.55 ? 6   DA  E "C1'" 1 
ATOM   110  N  N9    . DA  A 1 6  ? -15.193 55.334 26.242  1.00 31.78 ? 6   DA  E N9    1 
ATOM   111  C  C8    . DA  A 1 6  ? -15.545 56.411 27.010  1.00 28.88 ? 6   DA  E C8    1 
ATOM   112  N  N7    . DA  A 1 6  ? -14.531 56.971 27.629  1.00 27.89 ? 6   DA  E N7    1 
ATOM   113  C  C5    . DA  A 1 6  ? -13.437 56.210 27.242  1.00 26.59 ? 6   DA  E C5    1 
ATOM   114  C  C6    . DA  A 1 6  ? -12.055 56.293 27.547  1.00 26.19 ? 6   DA  E C6    1 
ATOM   115  N  N6    . DA  A 1 6  ? -11.513 57.219 28.334  1.00 24.07 ? 6   DA  E N6    1 
ATOM   116  N  N1    . DA  A 1 6  ? -11.238 55.371 27.001  1.00 25.94 ? 6   DA  E N1    1 
ATOM   117  C  C2    . DA  A 1 6  ? -11.776 54.435 26.201  1.00 26.92 ? 6   DA  E C2    1 
ATOM   118  N  N3    . DA  A 1 6  ? -13.046 54.258 25.836  1.00 27.81 ? 6   DA  E N3    1 
ATOM   119  C  C4    . DA  A 1 6  ? -13.833 55.190 26.395  1.00 28.69 ? 6   DA  E C4    1 
ATOM   120  P  P     . DT  A 1 7  ? -18.371 51.370 24.932  1.00 42.50 ? 7   DT  E P     1 
ATOM   121  O  OP1   . DT  A 1 7  ? -19.037 50.420 24.018  1.00 43.20 ? 7   DT  E OP1   1 
ATOM   122  O  OP2   . DT  A 1 7  ? -19.054 51.790 26.184  1.00 41.55 ? 7   DT  E OP2   1 
ATOM   123  O  "O5'" . DT  A 1 7  ? -16.933 50.773 25.263  1.00 41.13 ? 7   DT  E "O5'" 1 
ATOM   124  C  "C5'" . DT  A 1 7  ? -15.969 50.694 24.226  1.00 38.59 ? 7   DT  E "C5'" 1 
ATOM   125  C  "C4'" . DT  A 1 7  ? -14.667 50.099 24.711  1.00 36.46 ? 7   DT  E "C4'" 1 
ATOM   126  O  "O4'" . DT  A 1 7  ? -13.973 51.032 25.584  1.00 35.16 ? 7   DT  E "O4'" 1 
ATOM   127  C  "C3'" . DT  A 1 7  ? -14.842 48.837 25.548  1.00 35.08 ? 7   DT  E "C3'" 1 
ATOM   128  O  "O3'" . DT  A 1 7  ? -13.735 47.974 25.291  1.00 35.71 ? 7   DT  E "O3'" 1 
ATOM   129  C  "C2'" . DT  A 1 7  ? -14.913 49.367 26.975  1.00 33.84 ? 7   DT  E "C2'" 1 
ATOM   130  C  "C1'" . DT  A 1 7  ? -13.933 50.532 26.916  1.00 32.05 ? 7   DT  E "C1'" 1 
ATOM   131  N  N1    . DT  A 1 7  ? -14.105 51.669 27.865  1.00 30.80 ? 7   DT  E N1    1 
ATOM   132  C  C2    . DT  A 1 7  ? -12.973 52.161 28.491  1.00 30.78 ? 7   DT  E C2    1 
ATOM   133  O  O2    . DT  A 1 7  ? -11.859 51.706 28.308  1.00 32.66 ? 7   DT  E O2    1 
ATOM   134  N  N3    . DT  A 1 7  ? -13.200 53.212 29.348  1.00 29.08 ? 7   DT  E N3    1 
ATOM   135  C  C4    . DT  A 1 7  ? -14.414 53.802 29.639  1.00 29.74 ? 7   DT  E C4    1 
ATOM   136  O  O4    . DT  A 1 7  ? -14.473 54.727 30.436  1.00 30.08 ? 7   DT  E O4    1 
ATOM   137  C  C5    . DT  A 1 7  ? -15.547 53.245 28.958  1.00 28.86 ? 7   DT  E C5    1 
ATOM   138  C  C7    . DT  A 1 7  ? -16.895 53.828 29.222  1.00 27.91 ? 7   DT  E C7    1 
ATOM   139  C  C6    . DT  A 1 7  ? -15.343 52.224 28.112  1.00 30.98 ? 7   DT  E C6    1 
ATOM   140  P  P     . DT  A 1 8  ? -13.641 46.548 26.014  1.00 37.02 ? 8   DT  E P     1 
ATOM   141  O  OP1   . DT  A 1 8  ? -13.008 45.593 25.059  1.00 34.09 ? 8   DT  E OP1   1 
ATOM   142  O  OP2   . DT  A 1 8  ? -14.975 46.233 26.584  1.00 35.79 ? 8   DT  E OP2   1 
ATOM   143  O  "O5'" . DT  A 1 8  ? -12.623 46.847 27.207  1.00 37.54 ? 8   DT  E "O5'" 1 
ATOM   144  C  "C5'" . DT  A 1 8  ? -11.469 47.651 26.962  1.00 35.74 ? 8   DT  E "C5'" 1 
ATOM   145  C  "C4'" . DT  A 1 8  ? -10.530 47.641 28.145  1.00 34.90 ? 8   DT  E "C4'" 1 
ATOM   146  O  "O4'" . DT  A 1 8  ? -10.793 48.753 29.036  1.00 33.54 ? 8   DT  E "O4'" 1 
ATOM   147  C  "C3'" . DT  A 1 8  ? -10.707 46.401 29.014  1.00 34.36 ? 8   DT  E "C3'" 1 
ATOM   148  O  "O3'" . DT  A 1 8  ? -9.474  46.231 29.714  1.00 37.05 ? 8   DT  E "O3'" 1 
ATOM   149  C  "C2'" . DT  A 1 8  ? -11.775 46.846 30.001  1.00 32.54 ? 8   DT  E "C2'" 1 
ATOM   150  C  "C1'" . DT  A 1 8  ? -11.298 48.256 30.255  1.00 30.87 ? 8   DT  E "C1'" 1 
ATOM   151  N  N1    . DT  A 1 8  ? -12.174 49.263 30.867  1.00 30.46 ? 8   DT  E N1    1 
ATOM   152  C  C2    . DT  A 1 8  ? -11.541 50.184 31.668  1.00 31.33 ? 8   DT  E C2    1 
ATOM   153  O  O2    . DT  A 1 8  ? -10.335 50.174 31.843  1.00 32.11 ? 8   DT  E O2    1 
ATOM   154  N  N3    . DT  A 1 8  ? -12.366 51.113 32.256  1.00 32.41 ? 8   DT  E N3    1 
ATOM   155  C  C4    . DT  A 1 8  ? -13.738 51.203 32.111  1.00 35.31 ? 8   DT  E C4    1 
ATOM   156  O  O4    . DT  A 1 8  ? -14.357 52.090 32.697  1.00 38.98 ? 8   DT  E O4    1 
ATOM   157  C  C5    . DT  A 1 8  ? -14.338 50.201 31.248  1.00 32.65 ? 8   DT  E C5    1 
ATOM   158  C  C7    . DT  A 1 8  ? -15.817 50.227 31.039  1.00 33.45 ? 8   DT  E C7    1 
ATOM   159  C  C6    . DT  A 1 8  ? -13.534 49.295 30.674  1.00 31.95 ? 8   DT  E C6    1 
ATOM   160  P  P     . DA  A 1 9  ? -9.046  44.788 30.263  1.00 36.63 ? 9   DA  E P     1 
ATOM   161  O  OP1   . DA  A 1 9  ? -8.345  44.088 29.151  1.00 32.36 ? 9   DA  E OP1   1 
ATOM   162  O  OP2   . DA  A 1 9  ? -10.217 44.145 30.934  1.00 35.73 ? 9   DA  E OP2   1 
ATOM   163  O  "O5'" . DA  A 1 9  ? -7.997  45.162 31.401  1.00 32.28 ? 9   DA  E "O5'" 1 
ATOM   164  C  "C5'" . DA  A 1 9  ? -6.887  45.991 31.109  1.00 27.77 ? 9   DA  E "C5'" 1 
ATOM   165  C  "C4'" . DA  A 1 9  ? -6.388  46.664 32.365  1.00 27.19 ? 9   DA  E "C4'" 1 
ATOM   166  O  "O4'" . DA  A 1 9  ? -7.420  47.527 32.886  1.00 27.82 ? 9   DA  E "O4'" 1 
ATOM   167  C  "C3'" . DA  A 1 9  ? -6.073  45.711 33.510  1.00 27.21 ? 9   DA  E "C3'" 1 
ATOM   168  O  "O3'" . DA  A 1 9  ? -5.091  46.326 34.333  1.00 28.87 ? 9   DA  E "O3'" 1 
ATOM   169  C  "C2'" . DA  A 1 9  ? -7.405  45.599 34.230  1.00 27.82 ? 9   DA  E "C2'" 1 
ATOM   170  C  "C1'" . DA  A 1 9  ? -7.962  47.001 34.091  1.00 27.22 ? 9   DA  E "C1'" 1 
ATOM   171  N  N9    . DA  A 1 9  ? -9.418  47.144 34.033  1.00 25.11 ? 9   DA  E N9    1 
ATOM   172  C  C8    . DA  A 1 9  ? -10.321 46.439 33.277  1.00 24.18 ? 9   DA  E C8    1 
ATOM   173  N  N7    . DA  A 1 9  ? -11.554 46.872 33.383  1.00 22.78 ? 9   DA  E N7    1 
ATOM   174  C  C5    . DA  A 1 9  ? -11.461 47.918 34.286  1.00 23.70 ? 9   DA  E C5    1 
ATOM   175  C  C6    . DA  A 1 9  ? -12.420 48.805 34.808  1.00 26.44 ? 9   DA  E C6    1 
ATOM   176  N  N6    . DA  A 1 9  ? -13.715 48.781 34.487  1.00 29.44 ? 9   DA  E N6    1 
ATOM   177  N  N1    . DA  A 1 9  ? -11.999 49.739 35.689  1.00 25.46 ? 9   DA  E N1    1 
ATOM   178  C  C2    . DA  A 1 9  ? -10.699 49.772 36.011  1.00 25.34 ? 9   DA  E C2    1 
ATOM   179  N  N3    . DA  A 1 9  ? -9.704  48.997 35.583  1.00 23.84 ? 9   DA  E N3    1 
ATOM   180  C  C4    . DA  A 1 9  ? -10.158 48.082 34.713  1.00 22.78 ? 9   DA  E C4    1 
ATOM   181  P  P     . DT  A 1 10 ? -4.449  45.519 35.548  1.00 28.28 ? 10  DT  E P     1 
ATOM   182  O  OP1   . DT  A 1 10 ? -3.063  45.194 35.211  1.00 27.77 ? 10  DT  E OP1   1 
ATOM   183  O  OP2   . DT  A 1 10 ? -5.380  44.436 35.915  1.00 31.16 ? 10  DT  E OP2   1 
ATOM   184  O  "O5'" . DT  A 1 10 ? -4.445  46.610 36.704  1.00 27.51 ? 10  DT  E "O5'" 1 
ATOM   185  C  "C5'" . DT  A 1 10 ? -4.022  47.935 36.427  1.00 27.82 ? 10  DT  E "C5'" 1 
ATOM   186  C  "C4'" . DT  A 1 10 ? -4.201  48.832 37.629  1.00 29.92 ? 10  DT  E "C4'" 1 
ATOM   187  O  "O4'" . DT  A 1 10 ? -5.610  49.053 37.868  1.00 31.25 ? 10  DT  E "O4'" 1 
ATOM   188  C  "C3'" . DT  A 1 10 ? -3.671  48.251 38.934  1.00 29.27 ? 10  DT  E "C3'" 1 
ATOM   189  O  "O3'" . DT  A 1 10 ? -3.259  49.334 39.771  1.00 31.86 ? 10  DT  E "O3'" 1 
ATOM   190  C  "C2'" . DT  A 1 10 ? -4.875  47.496 39.479  1.00 31.38 ? 10  DT  E "C2'" 1 
ATOM   191  C  "C1'" . DT  A 1 10 ? -6.021  48.407 39.066  1.00 30.73 ? 10  DT  E "C1'" 1 
ATOM   192  N  N1    . DT  A 1 10 ? -7.364  47.830 38.833  1.00 28.93 ? 10  DT  E N1    1 
ATOM   193  C  C2    . DT  A 1 10 ? -8.451  48.591 39.200  1.00 29.13 ? 10  DT  E C2    1 
ATOM   194  O  O2    . DT  A 1 10 ? -8.353  49.657 39.782  1.00 31.28 ? 10  DT  E O2    1 
ATOM   195  N  N3    . DT  A 1 10 ? -9.666  48.057 38.858  1.00 29.16 ? 10  DT  E N3    1 
ATOM   196  C  C4    . DT  A 1 10 ? -9.900  46.864 38.214  1.00 30.55 ? 10  DT  E C4    1 
ATOM   197  O  O4    . DT  A 1 10 ? -11.049 46.535 37.948  1.00 30.99 ? 10  DT  E O4    1 
ATOM   198  C  C5    . DT  A 1 10 ? -8.720  46.096 37.899  1.00 30.14 ? 10  DT  E C5    1 
ATOM   199  C  C7    . DT  A 1 10 ? -8.872  44.775 37.217  1.00 30.34 ? 10  DT  E C7    1 
ATOM   200  C  C6    . DT  A 1 10 ? -7.527  46.607 38.228  1.00 30.61 ? 10  DT  E C6    1 
ATOM   201  P  P     . DC  A 1 11 ? -2.253  49.065 40.994  1.00 37.84 ? 11  DC  E P     1 
ATOM   202  O  OP1   . DC  A 1 11 ? -1.359  50.246 41.138  1.00 37.89 ? 11  DC  E OP1   1 
ATOM   203  O  OP2   . DC  A 1 11 ? -1.652  47.725 40.830  1.00 38.77 ? 11  DC  E OP2   1 
ATOM   204  O  "O5'" . DC  A 1 11 ? -3.228  49.013 42.252  1.00 38.78 ? 11  DC  E "O5'" 1 
ATOM   205  C  "C5'" . DC  A 1 11 ? -4.026  50.143 42.586  1.00 36.46 ? 11  DC  E "C5'" 1 
ATOM   206  C  "C4'" . DC  A 1 11 ? -4.863  49.873 43.815  1.00 36.90 ? 11  DC  E "C4'" 1 
ATOM   207  O  "O4'" . DC  A 1 11 ? -6.005  49.046 43.488  1.00 37.22 ? 11  DC  E "O4'" 1 
ATOM   208  C  "C3'" . DC  A 1 11 ? -4.094  49.077 44.867  1.00 37.98 ? 11  DC  E "C3'" 1 
ATOM   209  O  "O3'" . DC  A 1 11 ? -4.663  49.363 46.135  1.00 42.01 ? 11  DC  E "O3'" 1 
ATOM   210  C  "C2'" . DC  A 1 11 ? -4.411  47.639 44.497  1.00 37.21 ? 11  DC  E "C2'" 1 
ATOM   211  C  "C1'" . DC  A 1 11 ? -5.867  47.769 44.096  1.00 33.81 ? 11  DC  E "C1'" 1 
ATOM   212  N  N1    . DC  A 1 11 ? -6.469  46.758 43.212  1.00 32.21 ? 11  DC  E N1    1 
ATOM   213  C  C2    . DC  A 1 11 ? -7.812  46.897 42.898  1.00 30.67 ? 11  DC  E C2    1 
ATOM   214  O  O2    . DC  A 1 11 ? -8.428  47.842 43.384  1.00 29.64 ? 11  DC  E O2    1 
ATOM   215  N  N3    . DC  A 1 11 ? -8.409  46.000 42.081  1.00 31.53 ? 11  DC  E N3    1 
ATOM   216  C  C4    . DC  A 1 11 ? -7.709  44.977 41.582  1.00 30.22 ? 11  DC  E C4    1 
ATOM   217  N  N4    . DC  A 1 11 ? -8.341  44.114 40.777  1.00 25.28 ? 11  DC  E N4    1 
ATOM   218  C  C5    . DC  A 1 11 ? -6.329  44.800 41.894  1.00 28.96 ? 11  DC  E C5    1 
ATOM   219  C  C6    . DC  A 1 11 ? -5.751  45.706 42.703  1.00 31.57 ? 11  DC  E C6    1 
ATOM   220  P  P     . DG  A 1 12 ? -3.836  50.210 47.218  1.00 47.38 ? 12  DG  E P     1 
ATOM   221  O  OP1   . DG  A 1 12 ? -3.126  51.338 46.560  1.00 46.41 ? 12  DG  E OP1   1 
ATOM   222  O  OP2   . DG  A 1 12 ? -3.064  49.254 48.064  1.00 46.53 ? 12  DG  E OP2   1 
ATOM   223  O  "O5'" . DG  A 1 12 ? -5.022  50.828 48.078  1.00 47.58 ? 12  DG  E "O5'" 1 
ATOM   224  C  "C5'" . DG  A 1 12 ? -5.772  51.908 47.555  1.00 49.07 ? 12  DG  E "C5'" 1 
ATOM   225  C  "C4'" . DG  A 1 12 ? -7.209  51.856 48.024  1.00 50.65 ? 12  DG  E "C4'" 1 
ATOM   226  O  "O4'" . DG  A 1 12 ? -7.924  50.767 47.396  1.00 49.94 ? 12  DG  E "O4'" 1 
ATOM   227  C  "C3'" . DG  A 1 12 ? -7.386  51.617 49.519  1.00 51.24 ? 12  DG  E "C3'" 1 
ATOM   228  O  "O3'" . DG  A 1 12 ? -8.628  52.248 49.874  1.00 53.15 ? 12  DG  E "O3'" 1 
ATOM   229  C  "C2'" . DG  A 1 12 ? -7.453  50.097 49.607  1.00 49.43 ? 12  DG  E "C2'" 1 
ATOM   230  C  "C1'" . DG  A 1 12 ? -8.240  49.758 48.347  1.00 48.04 ? 12  DG  E "C1'" 1 
ATOM   231  N  N9    . DG  A 1 12 ? -8.022  48.464 47.704  1.00 46.50 ? 12  DG  E N9    1 
ATOM   232  C  C8    . DG  A 1 12 ? -6.832  47.799 47.548  1.00 46.03 ? 12  DG  E C8    1 
ATOM   233  N  N7    . DG  A 1 12 ? -6.948  46.707 46.840  1.00 44.55 ? 12  DG  E N7    1 
ATOM   234  C  C5    . DG  A 1 12 ? -8.296  46.643 46.523  1.00 42.61 ? 12  DG  E C5    1 
ATOM   235  C  C6    . DG  A 1 12 ? -9.015  45.689 45.754  1.00 43.53 ? 12  DG  E C6    1 
ATOM   236  O  O6    . DG  A 1 12 ? -8.589  44.678 45.176  1.00 44.39 ? 12  DG  E O6    1 
ATOM   237  N  N1    . DG  A 1 12 ? -10.367 46.004 45.684  1.00 41.79 ? 12  DG  E N1    1 
ATOM   238  C  C2    . DG  A 1 12 ? -10.952 47.082 46.286  1.00 41.22 ? 12  DG  E C2    1 
ATOM   239  N  N2    . DG  A 1 12 ? -12.276 47.187 46.120  1.00 40.40 ? 12  DG  E N2    1 
ATOM   240  N  N3    . DG  A 1 12 ? -10.292 47.983 47.000  1.00 41.08 ? 12  DG  E N3    1 
ATOM   241  C  C4    . DG  A 1 12 ? -8.977  47.703 47.072  1.00 42.63 ? 12  DG  E C4    1 
ATOM   242  P  P     . DC  A 1 13 ? -9.208  52.140 51.373  1.00 55.91 ? 13  DC  E P     1 
ATOM   243  O  OP1   . DC  A 1 13 ? -9.958  53.421 51.564  1.00 53.96 ? 13  DC  E OP1   1 
ATOM   244  O  OP2   . DC  A 1 13 ? -8.098  51.774 52.322  1.00 52.32 ? 13  DC  E OP2   1 
ATOM   245  O  "O5'" . DC  A 1 13 ? -10.251 50.933 51.282  1.00 53.54 ? 13  DC  E "O5'" 1 
ATOM   246  C  "C5'" . DC  A 1 13 ? -11.217 50.912 50.228  1.00 54.94 ? 13  DC  E "C5'" 1 
ATOM   247  C  "C4'" . DC  A 1 13 ? -12.287 49.877 50.492  1.00 55.80 ? 13  DC  E "C4'" 1 
ATOM   248  O  "O4'" . DC  A 1 13 ? -11.964 48.634 49.805  1.00 55.56 ? 13  DC  E "O4'" 1 
ATOM   249  C  "C3'" . DC  A 1 13 ? -12.368 49.513 51.973  1.00 55.84 ? 13  DC  E "C3'" 1 
ATOM   250  O  "O3'" . DC  A 1 13 ? -13.713 49.128 52.279  1.00 57.38 ? 13  DC  E "O3'" 1 
ATOM   251  C  "C2'" . DC  A 1 13 ? -11.401 48.346 52.082  1.00 55.73 ? 13  DC  E "C2'" 1 
ATOM   252  C  "C1'" . DC  A 1 13 ? -11.629 47.627 50.754  1.00 53.61 ? 13  DC  E "C1'" 1 
ATOM   253  N  N1    . DC  A 1 13 ? -10.503 46.825 50.235  1.00 51.48 ? 13  DC  E N1    1 
ATOM   254  C  C2    . DC  A 1 13 ? -10.777 45.691 49.427  1.00 49.20 ? 13  DC  E C2    1 
ATOM   255  O  O2    . DC  A 1 13 ? -11.947 45.439 49.118  1.00 46.14 ? 13  DC  E O2    1 
ATOM   256  N  N3    . DC  A 1 13 ? -9.759  44.903 49.010  1.00 49.02 ? 13  DC  E N3    1 
ATOM   257  C  C4    . DC  A 1 13 ? -8.502  45.204 49.353  1.00 51.58 ? 13  DC  E C4    1 
ATOM   258  N  N4    . DC  A 1 13 ? -7.522  44.382 48.923  1.00 50.68 ? 13  DC  E N4    1 
ATOM   259  C  C5    . DC  A 1 13 ? -8.186  46.362 50.151  1.00 51.88 ? 13  DC  E C5    1 
ATOM   260  C  C6    . DC  A 1 13 ? -9.209  47.139 50.555  1.00 52.11 ? 13  DC  E C6    1 
ATOM   261  P  P     . DT  A 1 14 ? -14.093 48.555 53.746  1.00 59.39 ? 14  DT  E P     1 
ATOM   262  O  OP1   . DT  A 1 14 ? -14.841 49.647 54.450  1.00 57.51 ? 14  DT  E OP1   1 
ATOM   263  O  OP2   . DT  A 1 14 ? -12.878 47.954 54.391  1.00 57.54 ? 14  DT  E OP2   1 
ATOM   264  O  "O5'" . DT  A 1 14 ? -15.108 47.381 53.374  1.00 57.29 ? 14  DT  E "O5'" 1 
ATOM   265  C  "C5'" . DT  A 1 14 ? -15.938 47.533 52.229  1.00 58.99 ? 14  DT  E "C5'" 1 
ATOM   266  C  "C4'" . DT  A 1 14 ? -16.604 46.231 51.851  1.00 60.79 ? 14  DT  E "C4'" 1 
ATOM   267  O  "O4'" . DT  A 1 14 ? -15.645 45.320 51.247  1.00 60.80 ? 14  DT  E "O4'" 1 
ATOM   268  C  "C3'" . DT  A 1 14 ? -17.129 45.501 53.087  1.00 61.29 ? 14  DT  E "C3'" 1 
ATOM   269  O  "O3'" . DT  A 1 14 ? -18.292 44.738 52.732  1.00 61.79 ? 14  DT  E "O3'" 1 
ATOM   270  C  "C2'" . DT  A 1 14 ? -15.953 44.624 53.492  1.00 60.29 ? 14  DT  E "C2'" 1 
ATOM   271  C  "C1'" . DT  A 1 14 ? -15.415 44.214 52.124  1.00 59.39 ? 14  DT  E "C1'" 1 
ATOM   272  N  N1    . DT  A 1 14 ? -13.994 43.784 52.023  1.00 56.23 ? 14  DT  E N1    1 
ATOM   273  C  C2    . DT  A 1 14 ? -13.723 42.620 51.331  1.00 55.21 ? 14  DT  E C2    1 
ATOM   274  O  O2    . DT  A 1 14 ? -14.590 41.960 50.768  1.00 55.15 ? 14  DT  E O2    1 
ATOM   275  N  N3    . DT  A 1 14 ? -12.392 42.253 51.320  1.00 52.28 ? 14  DT  E N3    1 
ATOM   276  C  C4    . DT  A 1 14 ? -11.337 42.920 51.917  1.00 52.70 ? 14  DT  E C4    1 
ATOM   277  O  O4    . DT  A 1 14 ? -10.194 42.467 51.840  1.00 49.57 ? 14  DT  E O4    1 
ATOM   278  C  C5    . DT  A 1 14 ? -11.695 44.141 52.607  1.00 53.95 ? 14  DT  E C5    1 
ATOM   279  C  C7    . DT  A 1 14 ? -10.619 44.937 53.275  1.00 54.14 ? 14  DT  E C7    1 
ATOM   280  C  C6    . DT  A 1 14 ? -12.987 44.506 52.620  1.00 55.33 ? 14  DT  E C6    1 
ATOM   281  P  P     . DA  A 1 15 ? -19.248 44.143 53.889  1.00 62.29 ? 15  DA  E P     1 
ATOM   282  O  OP1   . DA  A 1 15 ? -20.659 44.523 53.575  1.00 61.49 ? 15  DA  E OP1   1 
ATOM   283  O  OP2   . DA  A 1 15 ? -18.660 44.519 55.217  1.00 60.19 ? 15  DA  E OP2   1 
ATOM   284  O  "O5'" . DA  A 1 15 ? -19.111 42.566 53.701  1.00 60.12 ? 15  DA  E "O5'" 1 
ATOM   285  C  "C5'" . DA  A 1 15 ? -17.901 42.013 53.213  1.00 57.00 ? 15  DA  E "C5'" 1 
ATOM   286  C  "C4'" . DA  A 1 15 ? -18.132 40.604 52.716  1.00 54.76 ? 15  DA  E "C4'" 1 
ATOM   287  O  "O4'" . DA  A 1 15 ? -16.859 40.110 52.247  1.00 53.94 ? 15  DA  E "O4'" 1 
ATOM   288  C  "C3'" . DA  A 1 15 ? -18.575 39.622 53.792  1.00 52.70 ? 15  DA  E "C3'" 1 
ATOM   289  O  "O3'" . DA  A 1 15 ? -19.360 38.567 53.219  1.00 51.62 ? 15  DA  E "O3'" 1 
ATOM   290  C  "C2'" . DA  A 1 15 ? -17.260 39.127 54.365  1.00 52.06 ? 15  DA  E "C2'" 1 
ATOM   291  C  "C1'" . DA  A 1 15 ? -16.310 39.166 53.165  1.00 49.85 ? 15  DA  E "C1'" 1 
ATOM   292  N  N9    . DA  A 1 15 ? -14.959 39.632 53.491  1.00 44.74 ? 15  DA  E N9    1 
ATOM   293  C  C8    . DA  A 1 15 ? -14.624 40.680 54.311  1.00 43.11 ? 15  DA  E C8    1 
ATOM   294  N  N7    . DA  A 1 15 ? -13.331 40.874 54.421  1.00 41.37 ? 15  DA  E N7    1 
ATOM   295  C  C5    . DA  A 1 15 ? -12.777 39.893 53.619  1.00 40.36 ? 15  DA  E C5    1 
ATOM   296  C  C6    . DA  A 1 15 ? -11.450 39.565 53.320  1.00 39.82 ? 15  DA  E C6    1 
ATOM   297  N  N6    . DA  A 1 15 ? -10.395 40.216 53.818  1.00 39.23 ? 15  DA  E N6    1 
ATOM   298  N  N1    . DA  A 1 15 ? -11.234 38.530 52.487  1.00 39.29 ? 15  DA  E N1    1 
ATOM   299  C  C2    . DA  A 1 15 ? -12.297 37.873 51.991  1.00 39.51 ? 15  DA  E C2    1 
ATOM   300  N  N3    . DA  A 1 15 ? -13.593 38.086 52.198  1.00 39.40 ? 15  DA  E N3    1 
ATOM   301  C  C4    . DA  A 1 15 ? -13.769 39.121 53.034  1.00 41.36 ? 15  DA  E C4    1 
ATOM   302  P  P     . DT  A 1 16 ? -19.717 37.252 54.097  1.00 55.08 ? 16  DT  E P     1 
ATOM   303  O  OP1   . DT  A 1 16 ? -20.749 36.437 53.359  1.00 51.68 ? 16  DT  E OP1   1 
ATOM   304  O  OP2   . DT  A 1 16 ? -19.990 37.663 55.524  1.00 51.83 ? 16  DT  E OP2   1 
ATOM   305  O  "O5'" . DT  A 1 16 ? -18.347 36.432 54.037  1.00 51.16 ? 16  DT  E "O5'" 1 
ATOM   306  C  "C5'" . DT  A 1 16 ? -17.718 36.219 52.777  1.00 47.43 ? 16  DT  E "C5'" 1 
ATOM   307  C  "C4'" . DT  A 1 16 ? -16.856 34.982 52.809  1.00 43.96 ? 16  DT  E "C4'" 1 
ATOM   308  O  "O4'" . DT  A 1 16 ? -15.488 35.354 53.092  1.00 42.25 ? 16  DT  E "O4'" 1 
ATOM   309  C  "C3'" . DT  A 1 16 ? -17.242 34.012 53.924  1.00 43.48 ? 16  DT  E "C3'" 1 
ATOM   310  O  "O3'" . DT  A 1 16 ? -16.935 32.686 53.496  1.00 42.88 ? 16  DT  E "O3'" 1 
ATOM   311  C  "C2'" . DT  A 1 16 ? -16.384 34.477 55.089  1.00 41.16 ? 16  DT  E "C2'" 1 
ATOM   312  C  "C1'" . DT  A 1 16 ? -15.109 34.908 54.385  1.00 38.99 ? 16  DT  E "C1'" 1 
ATOM   313  N  N1    . DT  A 1 16 ? -14.288 35.964 55.019  1.00 35.59 ? 16  DT  E N1    1 
ATOM   314  C  C2    . DT  A 1 16 ? -12.914 35.836 54.922  1.00 33.88 ? 16  DT  E C2    1 
ATOM   315  O  O2    . DT  A 1 16 ? -12.369 34.913 54.341  1.00 35.60 ? 16  DT  E O2    1 
ATOM   316  N  N3    . DT  A 1 16 ? -12.197 36.832 55.530  1.00 32.31 ? 16  DT  E N3    1 
ATOM   317  C  C4    . DT  A 1 16 ? -12.695 37.925 56.206  1.00 32.06 ? 16  DT  E C4    1 
ATOM   318  O  O4    . DT  A 1 16 ? -11.918 38.742 56.693  1.00 31.24 ? 16  DT  E O4    1 
ATOM   319  C  C5    . DT  A 1 16 ? -14.143 38.001 56.276  1.00 33.28 ? 16  DT  E C5    1 
ATOM   320  C  C7    . DT  A 1 16 ? -14.772 39.141 57.011  1.00 30.83 ? 16  DT  E C7    1 
ATOM   321  C  C6    . DT  A 1 16 ? -14.858 37.030 55.678  1.00 34.17 ? 16  DT  E C6    1 
ATOM   322  P  P     . DT  A 1 17 ? -17.027 31.455 54.520  1.00 44.92 ? 17  DT  E P     1 
ATOM   323  O  OP1   . DT  A 1 17 ? -17.850 30.419 53.845  1.00 45.95 ? 17  DT  E OP1   1 
ATOM   324  O  OP2   . DT  A 1 17 ? -17.427 31.940 55.870  1.00 44.27 ? 17  DT  E OP2   1 
ATOM   325  O  "O5'" . DT  A 1 17 ? -15.521 30.923 54.549  1.00 42.33 ? 17  DT  E "O5'" 1 
ATOM   326  C  "C5'" . DT  A 1 17 ? -14.791 30.805 53.330  1.00 36.63 ? 17  DT  E "C5'" 1 
ATOM   327  C  "C4'" . DT  A 1 17 ? -13.408 30.239 53.556  1.00 34.66 ? 17  DT  E "C4'" 1 
ATOM   328  O  "O4'" . DT  A 1 17 ? -12.553 31.189 54.244  1.00 35.58 ? 17  DT  E "O4'" 1 
ATOM   329  C  "C3'" . DT  A 1 17 ? -13.384 28.994 54.439  1.00 31.76 ? 17  DT  E "C3'" 1 
ATOM   330  O  "O3'" . DT  A 1 17 ? -12.277 28.197 54.032  1.00 25.42 ? 17  DT  E "O3'" 1 
ATOM   331  C  "C2'" . DT  A 1 17 ? -13.209 29.569 55.837  1.00 33.92 ? 17  DT  E "C2'" 1 
ATOM   332  C  "C1'" . DT  A 1 17 ? -12.254 30.717 55.552  1.00 35.51 ? 17  DT  E "C1'" 1 
ATOM   333  N  N1    . DT  A 1 17 ? -12.194 31.877 56.471  1.00 35.52 ? 17  DT  E N1    1 
ATOM   334  C  C2    . DT  A 1 17 ? -10.947 32.398 56.720  1.00 35.49 ? 17  DT  E C2    1 
ATOM   335  O  O2    . DT  A 1 17 ? -9.927  31.912 56.279  1.00 37.48 ? 17  DT  E O2    1 
ATOM   336  N  N3    . DT  A 1 17 ? -10.933 33.509 57.510  1.00 35.58 ? 17  DT  E N3    1 
ATOM   337  C  C4    . DT  A 1 17 ? -12.009 34.135 58.085  1.00 35.91 ? 17  DT  E C4    1 
ATOM   338  O  O4    . DT  A 1 17 ? -11.833 35.143 58.763  1.00 35.72 ? 17  DT  E O4    1 
ATOM   339  C  C5    . DT  A 1 17 ? -13.293 33.524 57.819  1.00 37.22 ? 17  DT  E C5    1 
ATOM   340  C  C7    . DT  A 1 17 ? -14.522 34.133 58.420  1.00 35.42 ? 17  DT  E C7    1 
ATOM   341  C  C6    . DT  A 1 17 ? -13.322 32.430 57.035  1.00 36.82 ? 17  DT  E C6    1 
ATOM   342  P  P     . DA  A 1 18 ? -11.958 26.844 54.795  1.00 28.24 ? 18  DA  E P     1 
ATOM   343  O  OP1   . DA  A 1 18 ? -11.374 25.887 53.846  1.00 26.80 ? 18  DA  E OP1   1 
ATOM   344  O  OP2   . DA  A 1 18 ? -13.183 26.488 55.519  1.00 28.27 ? 18  DA  E OP2   1 
ATOM   345  O  "O5'" . DA  A 1 18 ? -10.818 27.275 55.824  1.00 27.13 ? 18  DA  E "O5'" 1 
ATOM   346  C  "C5'" . DA  A 1 18 ? -9.554  27.706 55.339  1.00 20.94 ? 18  DA  E "C5'" 1 
ATOM   347  C  "C4'" . DA  A 1 18 ? -8.576  27.967 56.464  1.00 21.42 ? 18  DA  E "C4'" 1 
ATOM   348  O  "O4'" . DA  A 1 18 ? -8.964  29.132 57.234  1.00 22.66 ? 18  DA  E "O4'" 1 
ATOM   349  C  "C3'" . DA  A 1 18 ? -8.491  26.838 57.493  1.00 19.36 ? 18  DA  E "C3'" 1 
ATOM   350  O  "O3'" . DA  A 1 18 ? -7.213  26.921 58.118  1.00 17.52 ? 18  DA  E "O3'" 1 
ATOM   351  C  "C2'" . DA  A 1 18 ? -9.552  27.227 58.505  1.00 22.52 ? 18  DA  E "C2'" 1 
ATOM   352  C  "C1'" . DA  A 1 18 ? -9.320  28.722 58.545  1.00 23.95 ? 18  DA  E "C1'" 1 
ATOM   353  N  N9    . DA  A 1 18 ? -10.335 29.620 59.093  1.00 26.43 ? 18  DA  E N9    1 
ATOM   354  C  C8    . DA  A 1 18 ? -11.697 29.491 59.135  1.00 27.07 ? 18  DA  E C8    1 
ATOM   355  N  N7    . DA  A 1 18 ? -12.300 30.488 59.743  1.00 25.43 ? 18  DA  E N7    1 
ATOM   356  C  C5    . DA  A 1 18 ? -11.262 31.330 60.115  1.00 25.46 ? 18  DA  E C5    1 
ATOM   357  C  C6    . DA  A 1 18 ? -11.232 32.561 60.794  1.00 23.83 ? 18  DA  E C6    1 
ATOM   358  N  N6    . DA  A 1 18 ? -12.306 33.198 61.237  1.00 24.55 ? 18  DA  E N6    1 
ATOM   359  N  N1    . DA  A 1 18 ? -10.029 33.131 61.005  1.00 23.90 ? 18  DA  E N1    1 
ATOM   360  C  C2    . DA  A 1 18 ? -8.938  32.505 60.560  1.00 23.03 ? 18  DA  E C2    1 
ATOM   361  N  N3    . DA  A 1 18 ? -8.837  31.353 59.913  1.00 24.94 ? 18  DA  E N3    1 
ATOM   362  C  C4    . DA  A 1 18 ? -10.048 30.807 59.718  1.00 26.69 ? 18  DA  E C4    1 
ATOM   363  P  P     . DG  A 1 19 ? -6.382  25.595 58.436  1.00 20.89 ? 19  DG  E P     1 
ATOM   364  O  OP1   . DG  A 1 19 ? -5.879  25.024 57.182  1.00 19.58 ? 19  DG  E OP1   1 
ATOM   365  O  OP2   . DG  A 1 19 ? -7.148  24.736 59.363  1.00 19.62 ? 19  DG  E OP2   1 
ATOM   366  O  "O5'" . DG  A 1 19 ? -5.117  26.162 59.217  1.00 22.86 ? 19  DG  E "O5'" 1 
ATOM   367  C  "C5'" . DG  A 1 19 ? -4.156  26.967 58.545  1.00 25.24 ? 19  DG  E "C5'" 1 
ATOM   368  C  "C4'" . DG  A 1 19 ? -3.344  27.777 59.531  1.00 26.05 ? 19  DG  E "C4'" 1 
ATOM   369  O  "O4'" . DG  A 1 19 ? -4.190  28.750 60.184  1.00 25.50 ? 19  DG  E "O4'" 1 
ATOM   370  C  "C3'" . DG  A 1 19 ? -2.750  26.951 60.663  1.00 26.54 ? 19  DG  E "C3'" 1 
ATOM   371  O  "O3'" . DG  A 1 19 ? -1.559  27.601 61.111  1.00 28.79 ? 19  DG  E "O3'" 1 
ATOM   372  C  "C2'" . DG  A 1 19 ? -3.853  26.984 61.706  1.00 24.82 ? 19  DG  E "C2'" 1 
ATOM   373  C  "C1'" . DG  A 1 19 ? -4.397  28.391 61.542  1.00 24.39 ? 19  DG  E "C1'" 1 
ATOM   374  N  N9    . DG  A 1 19 ? -5.801  28.632 61.847  1.00 22.81 ? 19  DG  E N9    1 
ATOM   375  C  C8    . DG  A 1 19 ? -6.878  27.948 61.355  1.00 23.50 ? 19  DG  E C8    1 
ATOM   376  N  N7    . DG  A 1 19 ? -8.021  28.454 61.731  1.00 23.41 ? 19  DG  E N7    1 
ATOM   377  C  C5    . DG  A 1 19 ? -7.670  29.528 62.543  1.00 22.80 ? 19  DG  E C5    1 
ATOM   378  C  C6    . DG  A 1 19 ? -8.481  30.473 63.233  1.00 20.38 ? 19  DG  E C6    1 
ATOM   379  O  O6    . DG  A 1 19 ? -9.707  30.565 63.265  1.00 20.50 ? 19  DG  E O6    1 
ATOM   380  N  N1    . DG  A 1 19 ? -7.714  31.390 63.931  1.00 19.27 ? 19  DG  E N1    1 
ATOM   381  C  C2    . DG  A 1 19 ? -6.352  31.407 63.971  1.00 23.35 ? 19  DG  E C2    1 
ATOM   382  N  N2    . DG  A 1 19 ? -5.797  32.364 64.713  1.00 22.44 ? 19  DG  E N2    1 
ATOM   383  N  N3    . DG  A 1 19 ? -5.583  30.544 63.326  1.00 24.18 ? 19  DG  E N3    1 
ATOM   384  C  C4    . DG  A 1 19 ? -6.305  29.637 62.640  1.00 22.06 ? 19  DG  E C4    1 
ATOM   385  P  P     . DT  A 1 20 ? -0.537  26.825 62.060  1.00 33.43 ? 20  DT  E P     1 
ATOM   386  O  OP1   . DT  A 1 20 ? 0.803   26.921 61.467  1.00 34.07 ? 20  DT  E OP1   1 
ATOM   387  O  OP2   . DT  A 1 20 ? -1.089  25.504 62.382  1.00 32.21 ? 20  DT  E OP2   1 
ATOM   388  O  "O5'" . DT  A 1 20 ? -0.518  27.697 63.391  1.00 34.21 ? 20  DT  E "O5'" 1 
ATOM   389  C  "C5'" . DT  A 1 20 ? -1.726  28.243 63.923  1.00 34.10 ? 20  DT  E "C5'" 1 
ATOM   390  C  "C4'" . DT  A 1 20 ? -1.528  28.701 65.348  1.00 34.59 ? 20  DT  E "C4'" 1 
ATOM   391  O  "O4'" . DT  A 1 20 ? -2.775  29.276 65.804  1.00 34.42 ? 20  DT  E "O4'" 1 
ATOM   392  C  "C3'" . DT  A 1 20 ? -1.218  27.583 66.340  1.00 35.58 ? 20  DT  E "C3'" 1 
ATOM   393  O  "O3'" . DT  A 1 20 ? -0.683  28.198 67.515  1.00 37.95 ? 20  DT  E "O3'" 1 
ATOM   394  C  "C2'" . DT  A 1 20 ? -2.603  27.104 66.731  1.00 34.83 ? 20  DT  E "C2'" 1 
ATOM   395  C  "C1'" . DT  A 1 20 ? -3.415  28.396 66.722  1.00 32.85 ? 20  DT  E "C1'" 1 
ATOM   396  N  N1    . DT  A 1 20 ? -4.823  28.256 66.298  1.00 29.98 ? 20  DT  E N1    1 
ATOM   397  C  C2    . DT  A 1 20 ? -5.660  29.300 66.574  1.00 29.54 ? 20  DT  E C2    1 
ATOM   398  O  O2    . DT  A 1 20 ? -5.286  30.320 67.122  1.00 30.45 ? 20  DT  E O2    1 
ATOM   399  N  N3    . DT  A 1 20 ? -6.959  29.112 66.183  1.00 29.81 ? 20  DT  E N3    1 
ATOM   400  C  C4    . DT  A 1 20 ? -7.490  28.013 65.550  1.00 29.13 ? 20  DT  E C4    1 
ATOM   401  O  O4    . DT  A 1 20 ? -8.675  27.991 65.271  1.00 27.51 ? 20  DT  E O4    1 
ATOM   402  C  C5    . DT  A 1 20 ? -6.553  26.951 65.274  1.00 30.50 ? 20  DT  E C5    1 
ATOM   403  C  C7    . DT  A 1 20 ? -7.038  25.715 64.580  1.00 29.64 ? 20  DT  E C7    1 
ATOM   404  C  C6    . DT  A 1 20 ? -5.280  27.125 65.654  1.00 29.13 ? 20  DT  E C6    1 
ATOM   405  O  "O5'" . DA  B 2 1  ? -15.384 35.686 70.638  1.00 49.25 ? 1   DA  F "O5'" 1 
ATOM   406  C  "C5'" . DA  B 2 1  ? -14.460 34.649 70.964  1.00 45.78 ? 1   DA  F "C5'" 1 
ATOM   407  C  "C4'" . DA  B 2 1  ? -13.089 35.218 71.247  1.00 47.06 ? 1   DA  F "C4'" 1 
ATOM   408  O  "O4'" . DA  B 2 1  ? -12.084 34.261 70.843  1.00 47.70 ? 1   DA  F "O4'" 1 
ATOM   409  C  "C3'" . DA  B 2 1  ? -12.750 36.491 70.477  1.00 46.88 ? 1   DA  F "C3'" 1 
ATOM   410  O  "O3'" . DA  B 2 1  ? -11.812 37.270 71.244  1.00 47.62 ? 1   DA  F "O3'" 1 
ATOM   411  C  "C2'" . DA  B 2 1  ? -12.158 35.949 69.186  1.00 45.91 ? 1   DA  F "C2'" 1 
ATOM   412  C  "C1'" . DA  B 2 1  ? -11.434 34.690 69.647  1.00 45.45 ? 1   DA  F "C1'" 1 
ATOM   413  N  N9    . DA  B 2 1  ? -11.516 33.584 68.696  1.00 43.40 ? 1   DA  F N9    1 
ATOM   414  C  C8    . DA  B 2 1  ? -12.631 33.142 68.022  1.00 43.19 ? 1   DA  F C8    1 
ATOM   415  N  N7    . DA  B 2 1  ? -12.405 32.102 67.256  1.00 42.03 ? 1   DA  F N7    1 
ATOM   416  C  C5    . DA  B 2 1  ? -11.050 31.853 67.432  1.00 41.81 ? 1   DA  F C5    1 
ATOM   417  C  C6    . DA  B 2 1  ? -10.199 30.881 66.903  1.00 40.51 ? 1   DA  F C6    1 
ATOM   418  N  N6    . DA  B 2 1  ? -10.596 29.932 66.059  1.00 39.93 ? 1   DA  F N6    1 
ATOM   419  N  N1    . DA  B 2 1  ? -8.905  30.910 67.281  1.00 41.32 ? 1   DA  F N1    1 
ATOM   420  C  C2    . DA  B 2 1  ? -8.510  31.845 68.138  1.00 40.73 ? 1   DA  F C2    1 
ATOM   421  N  N3    . DA  B 2 1  ? -9.216  32.808 68.712  1.00 42.08 ? 1   DA  F N3    1 
ATOM   422  C  C4    . DA  B 2 1  ? -10.494 32.760 68.312  1.00 41.92 ? 1   DA  F C4    1 
ATOM   423  P  P     . DC  B 2 2  ? -11.268 38.677 70.673  1.00 49.97 ? 2   DC  F P     1 
ATOM   424  O  OP1   . DC  B 2 2  ? -10.681 39.412 71.830  1.00 49.67 ? 2   DC  F OP1   1 
ATOM   425  O  OP2   . DC  B 2 2  ? -12.338 39.323 69.846  1.00 46.30 ? 2   DC  F OP2   1 
ATOM   426  O  "O5'" . DC  B 2 2  ? -10.059 38.251 69.731  1.00 48.78 ? 2   DC  F "O5'" 1 
ATOM   427  C  "C5'" . DC  B 2 2  ? -8.962  37.542 70.284  1.00 48.60 ? 2   DC  F "C5'" 1 
ATOM   428  C  "C4'" . DC  B 2 2  ? -7.793  37.539 69.331  1.00 47.03 ? 2   DC  F "C4'" 1 
ATOM   429  O  "O4'" . DC  B 2 2  ? -7.898  36.384 68.458  1.00 47.15 ? 2   DC  F "O4'" 1 
ATOM   430  C  "C3'" . DC  B 2 2  ? -7.824  38.760 68.405  1.00 45.93 ? 2   DC  F "C3'" 1 
ATOM   431  O  "O3'" . DC  B 2 2  ? -6.486  39.130 68.029  1.00 45.92 ? 2   DC  F "O3'" 1 
ATOM   432  C  "C2'" . DC  B 2 2  ? -8.638  38.260 67.226  1.00 45.82 ? 2   DC  F "C2'" 1 
ATOM   433  C  "C1'" . DC  B 2 2  ? -8.153  36.820 67.134  1.00 45.83 ? 2   DC  F "C1'" 1 
ATOM   434  N  N1    . DC  B 2 2  ? -8.983  35.827 66.419  1.00 44.30 ? 2   DC  F N1    1 
ATOM   435  C  C2    . DC  B 2 2  ? -8.362  34.675 65.900  1.00 41.28 ? 2   DC  F C2    1 
ATOM   436  O  O2    . DC  B 2 2  ? -7.169  34.473 66.152  1.00 39.74 ? 2   DC  F O2    1 
ATOM   437  N  N3    . DC  B 2 2  ? -9.076  33.822 65.138  1.00 39.03 ? 2   DC  F N3    1 
ATOM   438  C  C4    . DC  B 2 2  ? -10.364 34.066 64.892  1.00 39.62 ? 2   DC  F C4    1 
ATOM   439  N  N4    . DC  B 2 2  ? -11.014 33.229 64.092  1.00 38.08 ? 2   DC  F N4    1 
ATOM   440  C  C5    . DC  B 2 2  ? -11.040 35.191 65.449  1.00 41.96 ? 2   DC  F C5    1 
ATOM   441  C  C6    . DC  B 2 2  ? -10.321 36.034 66.204  1.00 43.99 ? 2   DC  F C6    1 
ATOM   442  P  P     . DT  B 2 3  ? -6.236  40.383 67.045  1.00 45.95 ? 3   DT  F P     1 
ATOM   443  O  OP1   . DT  B 2 3  ? -4.993  41.063 67.500  1.00 45.24 ? 3   DT  F OP1   1 
ATOM   444  O  OP2   . DT  B 2 3  ? -7.503  41.145 66.926  1.00 43.63 ? 3   DT  F OP2   1 
ATOM   445  O  "O5'" . DT  B 2 3  ? -5.930  39.718 65.632  1.00 46.59 ? 3   DT  F "O5'" 1 
ATOM   446  C  "C5'" . DT  B 2 3  ? -4.939  38.701 65.533  1.00 49.49 ? 3   DT  F "C5'" 1 
ATOM   447  C  "C4'" . DT  B 2 3  ? -4.837  38.178 64.115  1.00 50.58 ? 3   DT  F "C4'" 1 
ATOM   448  O  "O4'" . DT  B 2 3  ? -5.941  37.273 63.818  1.00 49.97 ? 3   DT  F "O4'" 1 
ATOM   449  C  "C3'" . DT  B 2 3  ? -4.982  39.344 63.129  1.00 49.28 ? 3   DT  F "C3'" 1 
ATOM   450  O  "O3'" . DT  B 2 3  ? -4.346  39.024 61.895  1.00 47.77 ? 3   DT  F "O3'" 1 
ATOM   451  C  "C2'" . DT  B 2 3  ? -6.477  39.380 62.881  1.00 50.26 ? 3   DT  F "C2'" 1 
ATOM   452  C  "C1'" . DT  B 2 3  ? -6.744  37.889 62.829  1.00 50.48 ? 3   DT  F "C1'" 1 
ATOM   453  N  N1    . DT  B 2 3  ? -8.120  37.364 62.864  1.00 51.13 ? 3   DT  F N1    1 
ATOM   454  C  C2    . DT  B 2 3  ? -8.306  36.091 62.357  1.00 51.26 ? 3   DT  F C2    1 
ATOM   455  O  O2    . DT  B 2 3  ? -7.383  35.375 61.990  1.00 49.79 ? 3   DT  F O2    1 
ATOM   456  N  N3    . DT  B 2 3  ? -9.616  35.689 62.286  1.00 51.44 ? 3   DT  F N3    1 
ATOM   457  C  C4    . DT  B 2 3  ? -10.735 36.415 62.655  1.00 52.67 ? 3   DT  F C4    1 
ATOM   458  O  O4    . DT  B 2 3  ? -11.865 35.937 62.482  1.00 52.58 ? 3   DT  F O4    1 
ATOM   459  C  C5    . DT  B 2 3  ? -10.460 37.724 63.218  1.00 51.73 ? 3   DT  F C5    1 
ATOM   460  C  C7    . DT  B 2 3  ? -11.606 38.575 63.662  1.00 52.21 ? 3   DT  F C7    1 
ATOM   461  C  C6    . DT  B 2 3  ? -9.183  38.120 63.308  1.00 51.60 ? 3   DT  F C6    1 
ATOM   462  P  P     . DA  B 2 4  ? -2.936  39.690 61.524  1.00 47.92 ? 4   DA  F P     1 
ATOM   463  O  OP1   . DA  B 2 4  ? -2.148  39.884 62.781  1.00 46.87 ? 4   DA  F OP1   1 
ATOM   464  O  OP2   . DA  B 2 4  ? -3.182  40.836 60.606  1.00 48.30 ? 4   DA  F OP2   1 
ATOM   465  O  "O5'" . DA  B 2 4  ? -2.218  38.541 60.698  1.00 46.92 ? 4   DA  F "O5'" 1 
ATOM   466  C  "C5'" . DA  B 2 4  ? -1.675  37.428 61.388  1.00 45.89 ? 4   DA  F "C5'" 1 
ATOM   467  C  "C4'" . DA  B 2 4  ? -1.669  36.198 60.513  1.00 43.87 ? 4   DA  F "C4'" 1 
ATOM   468  O  "O4'" . DA  B 2 4  ? -3.015  35.733 60.247  1.00 43.92 ? 4   DA  F "O4'" 1 
ATOM   469  C  "C3'" . DA  B 2 4  ? -1.070  36.437 59.142  1.00 42.83 ? 4   DA  F "C3'" 1 
ATOM   470  O  "O3'" . DA  B 2 4  ? -0.465  35.214 58.760  1.00 41.74 ? 4   DA  F "O3'" 1 
ATOM   471  C  "C2'" . DA  B 2 4  ? -2.275  36.835 58.299  1.00 42.37 ? 4   DA  F "C2'" 1 
ATOM   472  C  "C1'" . DA  B 2 4  ? -3.370  35.960 58.886  1.00 43.34 ? 4   DA  F "C1'" 1 
ATOM   473  N  N9    . DA  B 2 4  ? -4.745  36.469 58.864  1.00 44.31 ? 4   DA  F N9    1 
ATOM   474  C  C8    . DA  B 2 4  ? -5.188  37.733 59.135  1.00 45.85 ? 4   DA  F C8    1 
ATOM   475  N  N7    . DA  B 2 4  ? -6.497  37.850 59.118  1.00 45.46 ? 4   DA  F N7    1 
ATOM   476  C  C5    . DA  B 2 4  ? -6.942  36.579 58.801  1.00 42.45 ? 4   DA  F C5    1 
ATOM   477  C  C6    . DA  B 2 4  ? -8.227  36.043 58.640  1.00 42.97 ? 4   DA  F C6    1 
ATOM   478  N  N6    . DA  B 2 4  ? -9.350  36.751 58.805  1.00 41.25 ? 4   DA  F N6    1 
ATOM   479  N  N1    . DA  B 2 4  ? -8.328  34.739 58.299  1.00 43.43 ? 4   DA  F N1    1 
ATOM   480  C  C2    . DA  B 2 4  ? -7.209  34.037 58.141  1.00 43.07 ? 4   DA  F C2    1 
ATOM   481  N  N3    . DA  B 2 4  ? -5.945  34.426 58.275  1.00 44.51 ? 4   DA  F N3    1 
ATOM   482  C  C4    . DA  B 2 4  ? -5.878  35.723 58.614  1.00 43.95 ? 4   DA  F C4    1 
ATOM   483  P  P     . DA  B 2 5  ? 0.040   35.015 57.266  1.00 41.61 ? 5   DA  F P     1 
ATOM   484  O  OP1   . DA  B 2 5  ? 1.219   34.114 57.310  1.00 40.98 ? 5   DA  F OP1   1 
ATOM   485  O  OP2   . DA  B 2 5  ? 0.137   36.352 56.614  1.00 42.60 ? 5   DA  F OP2   1 
ATOM   486  O  "O5'" . DA  B 2 5  ? -1.163  34.247 56.577  1.00 41.93 ? 5   DA  F "O5'" 1 
ATOM   487  C  "C5'" . DA  B 2 5  ? -1.478  34.491 55.216  1.00 39.52 ? 5   DA  F "C5'" 1 
ATOM   488  C  "C4'" . DA  B 2 5  ? -2.487  33.485 54.734  1.00 37.32 ? 5   DA  F "C4'" 1 
ATOM   489  O  "O4'" . DA  B 2 5  ? -3.785  33.829 55.273  1.00 37.83 ? 5   DA  F "O4'" 1 
ATOM   490  C  "C3'" . DA  B 2 5  ? -2.655  33.567 53.228  1.00 36.90 ? 5   DA  F "C3'" 1 
ATOM   491  O  "O3'" . DA  B 2 5  ? -2.982  32.271 52.750  1.00 38.71 ? 5   DA  F "O3'" 1 
ATOM   492  C  "C2'" . DA  B 2 5  ? -3.744  34.611 53.056  1.00 36.30 ? 5   DA  F "C2'" 1 
ATOM   493  C  "C1'" . DA  B 2 5  ? -4.637  34.330 54.251  1.00 37.79 ? 5   DA  F "C1'" 1 
ATOM   494  N  N9    . DA  B 2 5  ? -5.396  35.462 54.804  1.00 36.76 ? 5   DA  F N9    1 
ATOM   495  C  C8    . DA  B 2 5  ? -4.892  36.601 55.372  1.00 37.35 ? 5   DA  F C8    1 
ATOM   496  N  N7    . DA  B 2 5  ? -5.813  37.430 55.805  1.00 38.11 ? 5   DA  F N7    1 
ATOM   497  C  C5    . DA  B 2 5  ? -7.006  36.797 55.500  1.00 36.47 ? 5   DA  F C5    1 
ATOM   498  C  C6    . DA  B 2 5  ? -8.354  37.165 55.708  1.00 37.46 ? 5   DA  F C6    1 
ATOM   499  N  N6    . DA  B 2 5  ? -8.746  38.297 56.297  1.00 37.77 ? 5   DA  F N6    1 
ATOM   500  N  N1    . DA  B 2 5  ? -9.303  36.314 55.285  1.00 38.13 ? 5   DA  F N1    1 
ATOM   501  C  C2    . DA  B 2 5  ? -8.917  35.170 54.693  1.00 39.04 ? 5   DA  F C2    1 
ATOM   502  N  N3    . DA  B 2 5  ? -7.689  34.715 54.442  1.00 37.61 ? 5   DA  F N3    1 
ATOM   503  C  C4    . DA  B 2 5  ? -6.765  35.584 54.876  1.00 35.95 ? 5   DA  F C4    1 
ATOM   504  P  P     . DT  B 2 6  ? -2.735  31.917 51.210  1.00 43.13 ? 6   DT  F P     1 
ATOM   505  O  OP1   . DT  B 2 6  ? -2.196  30.538 51.074  1.00 39.29 ? 6   DT  F OP1   1 
ATOM   506  O  OP2   . DT  B 2 6  ? -1.981  33.070 50.655  1.00 42.11 ? 6   DT  F OP2   1 
ATOM   507  O  "O5'" . DT  B 2 6  ? -4.204  31.957 50.618  1.00 39.22 ? 6   DT  F "O5'" 1 
ATOM   508  C  "C5'" . DT  B 2 6  ? -5.176  32.727 51.287  1.00 36.53 ? 6   DT  F "C5'" 1 
ATOM   509  C  "C4'" . DT  B 2 6  ? -6.542  32.431 50.744  1.00 33.98 ? 6   DT  F "C4'" 1 
ATOM   510  O  "O4'" . DT  B 2 6  ? -7.442  33.368 51.378  1.00 34.56 ? 6   DT  F "O4'" 1 
ATOM   511  C  "C3'" . DT  B 2 6  ? -6.644  32.717 49.254  1.00 32.08 ? 6   DT  F "C3'" 1 
ATOM   512  O  "O3'" . DT  B 2 6  ? -7.627  31.861 48.687  1.00 28.28 ? 6   DT  F "O3'" 1 
ATOM   513  C  "C2'" . DT  B 2 6  ? -7.008  34.193 49.215  1.00 31.60 ? 6   DT  F "C2'" 1 
ATOM   514  C  "C1'" . DT  B 2 6  ? -7.866  34.358 50.454  1.00 31.33 ? 6   DT  F "C1'" 1 
ATOM   515  N  N1    . DT  B 2 6  ? -7.771  35.651 51.137  1.00 30.29 ? 6   DT  F N1    1 
ATOM   516  C  C2    . DT  B 2 6  ? -8.947  36.250 51.499  1.00 30.52 ? 6   DT  F C2    1 
ATOM   517  O  O2    . DT  B 2 6  ? -10.036 35.767 51.246  1.00 32.24 ? 6   DT  F O2    1 
ATOM   518  N  N3    . DT  B 2 6  ? -8.804  37.434 52.168  1.00 30.06 ? 6   DT  F N3    1 
ATOM   519  C  C4    . DT  B 2 6  ? -7.625  38.066 52.502  1.00 31.79 ? 6   DT  F C4    1 
ATOM   520  O  O4    . DT  B 2 6  ? -7.652  39.129 53.126  1.00 33.07 ? 6   DT  F O4    1 
ATOM   521  C  C5    . DT  B 2 6  ? -6.428  37.389 52.079  1.00 31.10 ? 6   DT  F C5    1 
ATOM   522  C  C7    . DT  B 2 6  ? -5.103  38.003 52.389  1.00 29.18 ? 6   DT  F C7    1 
ATOM   523  C  C6    . DT  B 2 6  ? -6.558  36.228 51.422  1.00 30.64 ? 6   DT  F C6    1 
ATOM   524  P  P     . DA  B 2 7  ? -7.903  31.909 47.118  1.00 28.91 ? 7   DA  F P     1 
ATOM   525  O  OP1   . DA  B 2 7  ? -8.349  30.555 46.721  1.00 33.02 ? 7   DA  F OP1   1 
ATOM   526  O  OP2   . DA  B 2 7  ? -6.717  32.504 46.471  1.00 28.38 ? 7   DA  F OP2   1 
ATOM   527  O  "O5'" . DA  B 2 7  ? -9.157  32.879 47.020  1.00 27.44 ? 7   DA  F "O5'" 1 
ATOM   528  C  "C5'" . DA  B 2 7  ? -10.364 32.522 47.674  1.00 28.14 ? 7   DA  F "C5'" 1 
ATOM   529  C  "C4'" . DA  B 2 7  ? -11.528 33.345 47.178  1.00 29.22 ? 7   DA  F "C4'" 1 
ATOM   530  O  "O4'" . DA  B 2 7  ? -11.573 34.621 47.857  1.00 30.78 ? 7   DA  F "O4'" 1 
ATOM   531  C  "C3'" . DA  B 2 7  ? -11.456 33.705 45.696  1.00 29.05 ? 7   DA  F "C3'" 1 
ATOM   532  O  "O3'" . DA  B 2 7  ? -12.792 33.847 45.218  1.00 30.70 ? 7   DA  F "O3'" 1 
ATOM   533  C  "C2'" . DA  B 2 7  ? -10.712 35.033 45.696  1.00 26.86 ? 7   DA  F "C2'" 1 
ATOM   534  C  "C1'" . DA  B 2 7  ? -11.289 35.678 46.940  1.00 27.15 ? 7   DA  F "C1'" 1 
ATOM   535  N  N9    . DA  B 2 7  ? -10.530 36.706 47.651  1.00 23.26 ? 7   DA  F N9    1 
ATOM   536  C  C8    . DA  B 2 7  ? -9.189  36.790 47.880  1.00 22.81 ? 7   DA  F C8    1 
ATOM   537  N  N7    . DA  B 2 7  ? -8.845  37.819 48.621  1.00 22.33 ? 7   DA  F N7    1 
ATOM   538  C  C5    . DA  B 2 7  ? -10.044 38.457 48.881  1.00 20.09 ? 7   DA  F C5    1 
ATOM   539  C  C6    . DA  B 2 7  ? -10.360 39.605 49.618  1.00 22.54 ? 7   DA  F C6    1 
ATOM   540  N  N6    . DA  B 2 7  ? -9.455  40.342 50.264  1.00 24.58 ? 7   DA  F N6    1 
ATOM   541  N  N1    . DA  B 2 7  ? -11.653 39.977 49.676  1.00 22.10 ? 7   DA  F N1    1 
ATOM   542  C  C2    . DA  B 2 7  ? -12.555 39.234 49.037  1.00 23.06 ? 7   DA  F C2    1 
ATOM   543  N  N3    . DA  B 2 7  ? -12.381 38.134 48.319  1.00 21.08 ? 7   DA  F N3    1 
ATOM   544  C  C4    . DA  B 2 7  ? -11.087 37.794 48.279  1.00 20.76 ? 7   DA  F C4    1 
ATOM   545  P  P     . DG  B 2 8  ? -13.058 34.012 43.653  1.00 34.03 ? 8   DG  F P     1 
ATOM   546  O  OP1   . DG  B 2 8  ? -13.939 32.908 43.189  1.00 29.51 ? 8   DG  F OP1   1 
ATOM   547  O  OP2   . DG  B 2 8  ? -11.735 34.212 43.019  1.00 32.85 ? 8   DG  F OP2   1 
ATOM   548  O  "O5'" . DG  B 2 8  ? -13.837 35.401 43.595  1.00 35.45 ? 8   DG  F "O5'" 1 
ATOM   549  C  "C5'" . DG  B 2 8  ? -13.585 36.379 44.597  1.00 31.94 ? 8   DG  F "C5'" 1 
ATOM   550  C  "C4'" . DG  B 2 8  ? -13.965 37.759 44.120  1.00 31.66 ? 8   DG  F "C4'" 1 
ATOM   551  O  "O4'" . DG  B 2 8  ? -13.196 38.697 44.909  1.00 31.48 ? 8   DG  F "O4'" 1 
ATOM   552  C  "C3'" . DG  B 2 8  ? -13.559 38.017 42.669  1.00 32.44 ? 8   DG  F "C3'" 1 
ATOM   553  O  "O3'" . DG  B 2 8  ? -14.246 39.192 42.201  1.00 36.39 ? 8   DG  F "O3'" 1 
ATOM   554  C  "C2'" . DG  B 2 8  ? -12.116 38.452 42.827  1.00 30.05 ? 8   DG  F "C2'" 1 
ATOM   555  C  "C1'" . DG  B 2 8  ? -12.223 39.284 44.085  1.00 27.39 ? 8   DG  F "C1'" 1 
ATOM   556  N  N9    . DG  B 2 8  ? -11.025 39.568 44.860  1.00 24.10 ? 8   DG  F N9    1 
ATOM   557  C  C8    . DG  B 2 8  ? -9.773  39.033 44.710  1.00 22.10 ? 8   DG  F C8    1 
ATOM   558  N  N7    . DG  B 2 8  ? -8.876  39.634 45.443  1.00 22.32 ? 8   DG  F N7    1 
ATOM   559  C  C5    . DG  B 2 8  ? -9.597  40.592 46.145  1.00 20.27 ? 8   DG  F C5    1 
ATOM   560  C  C6    . DG  B 2 8  ? -9.179  41.561 47.082  1.00 21.11 ? 8   DG  F C6    1 
ATOM   561  O  O6    . DG  B 2 8  ? -8.044  41.796 47.505  1.00 25.02 ? 8   DG  F O6    1 
ATOM   562  N  N1    . DG  B 2 8  ? -10.244 42.318 47.540  1.00 21.59 ? 8   DG  F N1    1 
ATOM   563  C  C2    . DG  B 2 8  ? -11.547 42.162 47.152  1.00 21.67 ? 8   DG  F C2    1 
ATOM   564  N  N2    . DG  B 2 8  ? -12.443 42.981 47.709  1.00 21.86 ? 8   DG  F N2    1 
ATOM   565  N  N3    . DG  B 2 8  ? -11.946 41.272 46.278  1.00 21.20 ? 8   DG  F N3    1 
ATOM   566  C  C4    . DG  B 2 8  ? -10.929 40.528 45.818  1.00 21.13 ? 8   DG  F C4    1 
ATOM   567  P  P     . DC  B 2 9  ? -15.736 39.106 41.605  1.00 39.32 ? 9   DC  F P     1 
ATOM   568  O  OP1   . DC  B 2 9  ? -16.414 37.907 42.116  1.00 41.95 ? 9   DC  F OP1   1 
ATOM   569  O  OP2   . DC  B 2 9  ? -15.635 39.311 40.137  1.00 39.09 ? 9   DC  F OP2   1 
ATOM   570  O  "O5'" . DC  B 2 9  ? -16.432 40.383 42.261  1.00 37.27 ? 9   DC  F "O5'" 1 
ATOM   571  C  "C5'" . DC  B 2 9  ? -16.984 40.313 43.565  1.00 36.51 ? 9   DC  F "C5'" 1 
ATOM   572  C  "C4'" . DC  B 2 9  ? -17.410 41.683 44.053  1.00 38.52 ? 9   DC  F "C4'" 1 
ATOM   573  O  "O4'" . DC  B 2 9  ? -16.283 42.408 44.610  1.00 38.87 ? 9   DC  F "O4'" 1 
ATOM   574  C  "C3'" . DC  B 2 9  ? -17.981 42.598 42.980  1.00 38.59 ? 9   DC  F "C3'" 1 
ATOM   575  O  "O3'" . DC  B 2 9  ? -18.930 43.494 43.576  1.00 40.86 ? 9   DC  F "O3'" 1 
ATOM   576  C  "C2'" . DC  B 2 9  ? -16.741 43.324 42.481  1.00 40.25 ? 9   DC  F "C2'" 1 
ATOM   577  C  "C1'" . DC  B 2 9  ? -15.907 43.488 43.752  1.00 38.66 ? 9   DC  F "C1'" 1 
ATOM   578  N  N1    . DC  B 2 9  ? -14.438 43.427 43.566  1.00 38.10 ? 9   DC  F N1    1 
ATOM   579  C  C2    . DC  B 2 9  ? -13.624 44.362 44.227  1.00 36.89 ? 9   DC  F C2    1 
ATOM   580  O  O2    . DC  B 2 9  ? -14.147 45.263 44.891  1.00 39.10 ? 9   DC  F O2    1 
ATOM   581  N  N3    . DC  B 2 9  ? -12.282 44.258 44.119  1.00 35.00 ? 9   DC  F N3    1 
ATOM   582  C  C4    . DC  B 2 9  ? -11.744 43.279 43.389  1.00 33.58 ? 9   DC  F C4    1 
ATOM   583  N  N4    . DC  B 2 9  ? -10.420 43.204 43.334  1.00 32.35 ? 9   DC  F N4    1 
ATOM   584  C  C5    . DC  B 2 9  ? -12.543 42.336 42.684  1.00 33.95 ? 9   DC  F C5    1 
ATOM   585  C  C6    . DC  B 2 9  ? -13.873 42.448 42.795  1.00 36.76 ? 9   DC  F C6    1 
ATOM   586  P  P     . DG  B 2 10 ? -19.783 44.499 42.652  1.00 43.74 ? 10  DG  F P     1 
ATOM   587  O  OP1   . DG  B 2 10 ? -20.928 44.959 43.468  1.00 39.82 ? 10  DG  F OP1   1 
ATOM   588  O  OP2   . DG  B 2 10 ? -20.054 43.820 41.354  1.00 42.07 ? 10  DG  F OP2   1 
ATOM   589  O  "O5'" . DG  B 2 10 ? -18.778 45.727 42.454  1.00 41.28 ? 10  DG  F "O5'" 1 
ATOM   590  C  "C5'" . DG  B 2 10 ? -18.411 46.533 43.580  1.00 42.19 ? 10  DG  F "C5'" 1 
ATOM   591  C  "C4'" . DG  B 2 10 ? -17.784 47.840 43.150  1.00 42.83 ? 10  DG  F "C4'" 1 
ATOM   592  O  "O4'" . DG  B 2 10 ? -16.379 47.670 42.844  1.00 41.56 ? 10  DG  F "O4'" 1 
ATOM   593  C  "C3'" . DG  B 2 10 ? -18.401 48.416 41.878  1.00 44.75 ? 10  DG  F "C3'" 1 
ATOM   594  O  "O3'" . DG  B 2 10 ? -18.141 49.820 41.867  1.00 48.68 ? 10  DG  F "O3'" 1 
ATOM   595  C  "C2'" . DG  B 2 10 ? -17.555 47.772 40.796  1.00 42.08 ? 10  DG  F "C2'" 1 
ATOM   596  C  "C1'" . DG  B 2 10 ? -16.178 47.827 41.447  1.00 39.71 ? 10  DG  F "C1'" 1 
ATOM   597  N  N9    . DG  B 2 10 ? -15.170 46.868 40.996  1.00 37.08 ? 10  DG  F N9    1 
ATOM   598  C  C8    . DG  B 2 10 ? -15.361 45.791 40.166  1.00 32.70 ? 10  DG  F C8    1 
ATOM   599  N  N7    . DG  B 2 10 ? -14.258 45.139 39.912  1.00 30.83 ? 10  DG  F N7    1 
ATOM   600  C  C5    . DG  B 2 10 ? -13.282 45.822 40.617  1.00 30.15 ? 10  DG  F C5    1 
ATOM   601  C  C6    . DG  B 2 10 ? -11.897 45.584 40.718  1.00 29.38 ? 10  DG  F C6    1 
ATOM   602  O  O6    . DG  B 2 10 ? -11.230 44.696 40.195  1.00 31.39 ? 10  DG  F O6    1 
ATOM   603  N  N1    . DG  B 2 10 ? -11.277 46.519 41.529  1.00 28.99 ? 10  DG  F N1    1 
ATOM   604  C  C2    . DG  B 2 10 ? -11.907 47.551 42.166  1.00 31.07 ? 10  DG  F C2    1 
ATOM   605  N  N2    . DG  B 2 10 ? -11.126 48.349 42.904  1.00 30.23 ? 10  DG  F N2    1 
ATOM   606  N  N3    . DG  B 2 10 ? -13.202 47.785 42.086  1.00 30.66 ? 10  DG  F N3    1 
ATOM   607  C  C4    . DG  B 2 10 ? -13.825 46.888 41.298  1.00 33.36 ? 10  DG  F C4    1 
ATOM   608  P  P     . DA  B 2 11 ? -19.343 50.869 41.693  1.00 50.46 ? 11  DA  F P     1 
ATOM   609  O  OP1   . DA  B 2 11 ? -20.322 50.635 42.795  1.00 48.93 ? 11  DA  F OP1   1 
ATOM   610  O  OP2   . DA  B 2 11 ? -19.804 50.807 40.279  1.00 50.11 ? 11  DA  F OP2   1 
ATOM   611  O  "O5'" . DA  B 2 11 ? -18.586 52.254 41.939  1.00 49.56 ? 11  DA  F "O5'" 1 
ATOM   612  C  "C5'" . DA  B 2 11 ? -18.106 52.583 43.249  1.00 48.22 ? 11  DA  F "C5'" 1 
ATOM   613  C  "C4'" . DA  B 2 11 ? -16.831 53.398 43.187  1.00 47.25 ? 11  DA  F "C4'" 1 
ATOM   614  O  "O4'" . DA  B 2 11 ? -15.771 52.594 42.624  1.00 46.74 ? 11  DA  F "O4'" 1 
ATOM   615  C  "C3'" . DA  B 2 11 ? -16.909 54.625 42.284  1.00 47.75 ? 11  DA  F "C3'" 1 
ATOM   616  O  "O3'" . DA  B 2 11 ? -16.012 55.637 42.777  1.00 48.92 ? 11  DA  F "O3'" 1 
ATOM   617  C  "C2'" . DA  B 2 11 ? -16.486 54.079 40.929  1.00 46.96 ? 11  DA  F "C2'" 1 
ATOM   618  C  "C1'" . DA  B 2 11 ? -15.430 53.054 41.315  1.00 45.61 ? 11  DA  F "C1'" 1 
ATOM   619  N  N9    . DA  B 2 11 ? -15.276 51.882 40.445  1.00 42.83 ? 11  DA  F N9    1 
ATOM   620  C  C8    . DA  B 2 11 ? -16.238 51.169 39.776  1.00 41.06 ? 11  DA  F C8    1 
ATOM   621  N  N7    . DA  B 2 11 ? -15.767 50.136 39.116  1.00 39.76 ? 11  DA  F N7    1 
ATOM   622  C  C5    . DA  B 2 11 ? -14.401 50.174 39.365  1.00 39.47 ? 11  DA  F C5    1 
ATOM   623  C  C6    . DA  B 2 11 ? -13.335 49.345 38.961  1.00 40.00 ? 11  DA  F C6    1 
ATOM   624  N  N6    . DA  B 2 11 ? -13.477 48.259 38.195  1.00 37.28 ? 11  DA  F N6    1 
ATOM   625  N  N1    . DA  B 2 11 ? -12.090 49.678 39.379  1.00 41.22 ? 11  DA  F N1    1 
ATOM   626  C  C2    . DA  B 2 11 ? -11.939 50.757 40.144  1.00 40.28 ? 11  DA  F C2    1 
ATOM   627  N  N3    . DA  B 2 11 ? -12.855 51.605 40.590  1.00 40.88 ? 11  DA  F N3    1 
ATOM   628  C  C4    . DA  B 2 11 ? -14.084 51.254 40.164  1.00 41.00 ? 11  DA  F C4    1 
ATOM   629  P  P     . DT  B 2 12 ? -15.708 56.949 41.889  1.00 50.33 ? 12  DT  F P     1 
ATOM   630  O  OP1   . DT  B 2 12 ? -15.093 57.962 42.803  1.00 47.69 ? 12  DT  F OP1   1 
ATOM   631  O  OP2   . DT  B 2 12 ? -16.949 57.285 41.125  1.00 49.34 ? 12  DT  F OP2   1 
ATOM   632  O  "O5'" . DT  B 2 12 ? -14.598 56.468 40.848  1.00 48.20 ? 12  DT  F "O5'" 1 
ATOM   633  C  "C5'" . DT  B 2 12 ? -13.355 55.974 41.331  1.00 49.05 ? 12  DT  F "C5'" 1 
ATOM   634  C  "C4'" . DT  B 2 12 ? -12.304 55.962 40.247  1.00 49.10 ? 12  DT  F "C4'" 1 
ATOM   635  O  "O4'" . DT  B 2 12 ? -12.407 54.760 39.437  1.00 48.13 ? 12  DT  F "O4'" 1 
ATOM   636  C  "C3'" . DT  B 2 12 ? -12.474 57.126 39.264  1.00 48.37 ? 12  DT  F "C3'" 1 
ATOM   637  O  "O3'" . DT  B 2 12 ? -11.203 57.406 38.685  1.00 50.08 ? 12  DT  F "O3'" 1 
ATOM   638  C  "C2'" . DT  B 2 12 ? -13.383 56.534 38.197  1.00 47.14 ? 12  DT  F "C2'" 1 
ATOM   639  C  "C1'" . DT  B 2 12 ? -12.817 55.119 38.123  1.00 46.89 ? 12  DT  F "C1'" 1 
ATOM   640  N  N1    . DT  B 2 12 ? -13.598 54.013 37.529  1.00 44.42 ? 12  DT  F N1    1 
ATOM   641  C  C2    . DT  B 2 12 ? -12.888 52.893 37.196  1.00 42.82 ? 12  DT  F C2    1 
ATOM   642  O  O2    . DT  B 2 12 ? -11.694 52.786 37.401  1.00 42.38 ? 12  DT  F O2    1 
ATOM   643  N  N3    . DT  B 2 12 ? -13.622 51.903 36.611  1.00 41.85 ? 12  DT  F N3    1 
ATOM   644  C  C4    . DT  B 2 12 ? -14.970 51.916 36.328  1.00 41.92 ? 12  DT  F C4    1 
ATOM   645  O  O4    . DT  B 2 12 ? -15.487 50.946 35.780  1.00 41.69 ? 12  DT  F O4    1 
ATOM   646  C  C5    . DT  B 2 12 ? -15.663 53.117 36.715  1.00 41.86 ? 12  DT  F C5    1 
ATOM   647  C  C7    . DT  B 2 12 ? -17.131 53.221 36.454  1.00 42.18 ? 12  DT  F C7    1 
ATOM   648  C  C6    . DT  B 2 12 ? -14.953 54.094 37.297  1.00 43.24 ? 12  DT  F C6    1 
ATOM   649  P  P     . DA  B 2 13 ? -10.497 58.828 38.927  1.00 52.45 ? 13  DA  F P     1 
ATOM   650  O  OP1   . DA  B 2 13 ? -10.560 59.216 40.366  1.00 50.13 ? 13  DA  F OP1   1 
ATOM   651  O  OP2   . DA  B 2 13 ? -11.053 59.734 37.885  1.00 53.57 ? 13  DA  F OP2   1 
ATOM   652  O  "O5'" . DA  B 2 13 ? -8.969  58.534 38.586  1.00 52.08 ? 13  DA  F "O5'" 1 
ATOM   653  C  "C5'" . DA  B 2 13 ? -8.153  57.805 39.502  1.00 49.01 ? 13  DA  F "C5'" 1 
ATOM   654  C  "C4'" . DA  B 2 13 ? -7.247  56.840 38.770  1.00 46.15 ? 13  DA  F "C4'" 1 
ATOM   655  O  "O4'" . DA  B 2 13 ? -8.047  55.918 37.992  1.00 46.15 ? 13  DA  F "O4'" 1 
ATOM   656  C  "C3'" . DA  B 2 13 ? -6.331  57.505 37.745  1.00 45.26 ? 13  DA  F "C3'" 1 
ATOM   657  O  "O3'" . DA  B 2 13 ? -5.136  56.734 37.615  1.00 44.10 ? 13  DA  F "O3'" 1 
ATOM   658  C  "C2'" . DA  B 2 13 ? -7.164  57.488 36.472  1.00 45.38 ? 13  DA  F "C2'" 1 
ATOM   659  C  "C1'" . DA  B 2 13 ? -7.888  56.159 36.594  1.00 45.20 ? 13  DA  F "C1'" 1 
ATOM   660  N  N9    . DA  B 2 13 ? -9.209  56.032 35.979  1.00 43.71 ? 13  DA  F N9    1 
ATOM   661  C  C8    . DA  B 2 13 ? -10.304 56.832 36.167  1.00 43.97 ? 13  DA  F C8    1 
ATOM   662  N  N7    . DA  B 2 13 ? -11.394 56.377 35.594  1.00 45.38 ? 13  DA  F N7    1 
ATOM   663  C  C5    . DA  B 2 13 ? -10.976 55.215 34.955  1.00 43.46 ? 13  DA  F C5    1 
ATOM   664  C  C6    . DA  B 2 13 ? -11.663 54.255 34.194  1.00 42.21 ? 13  DA  F C6    1 
ATOM   665  N  N6    . DA  B 2 13 ? -12.965 54.319 33.939  1.00 43.68 ? 13  DA  F N6    1 
ATOM   666  N  N1    . DA  B 2 13 ? -10.959 53.211 33.706  1.00 40.67 ? 13  DA  F N1    1 
ATOM   667  C  C2    . DA  B 2 13 ? -9.652  53.148 33.973  1.00 40.88 ? 13  DA  F C2    1 
ATOM   668  N  N3    . DA  B 2 13 ? -8.893  53.987 34.680  1.00 42.01 ? 13  DA  F N3    1 
ATOM   669  C  C4    . DA  B 2 13 ? -9.625  55.010 35.155  1.00 43.15 ? 13  DA  F C4    1 
ATOM   670  P  P     . DA  B 2 14 ? -3.877  57.352 36.836  1.00 45.17 ? 14  DA  F P     1 
ATOM   671  O  OP1   . DA  B 2 14 ? -2.644  57.135 37.627  1.00 41.36 ? 14  DA  F OP1   1 
ATOM   672  O  OP2   . DA  B 2 14 ? -4.270  58.736 36.451  1.00 46.93 ? 14  DA  F OP2   1 
ATOM   673  O  "O5'" . DA  B 2 14 ? -3.789  56.481 35.514  1.00 42.47 ? 14  DA  F "O5'" 1 
ATOM   674  C  "C5'" . DA  B 2 14 ? -4.972  55.948 34.953  1.00 43.88 ? 14  DA  F "C5'" 1 
ATOM   675  C  "C4'" . DA  B 2 14 ? -4.646  55.093 33.754  1.00 44.78 ? 14  DA  F "C4'" 1 
ATOM   676  O  "O4'" . DA  B 2 14 ? -5.897  54.651 33.174  1.00 45.52 ? 14  DA  F "O4'" 1 
ATOM   677  C  "C3'" . DA  B 2 14 ? -3.942  55.866 32.650  1.00 45.03 ? 14  DA  F "C3'" 1 
ATOM   678  O  "O3'" . DA  B 2 14 ? -3.156  54.945 31.883  1.00 43.98 ? 14  DA  F "O3'" 1 
ATOM   679  C  "C2'" . DA  B 2 14 ? -5.108  56.437 31.862  1.00 45.01 ? 14  DA  F "C2'" 1 
ATOM   680  C  "C1'" . DA  B 2 14 ? -6.156  55.338 31.959  1.00 43.51 ? 14  DA  F "C1'" 1 
ATOM   681  N  N9    . DA  B 2 14 ? -7.542  55.801 32.008  1.00 42.50 ? 14  DA  F N9    1 
ATOM   682  C  C8    . DA  B 2 14 ? -8.050  56.923 32.607  1.00 42.72 ? 14  DA  F C8    1 
ATOM   683  N  N7    . DA  B 2 14 ? -9.352  57.042 32.491  1.00 42.26 ? 14  DA  F N7    1 
ATOM   684  C  C5    . DA  B 2 14 ? -9.724  55.926 31.761  1.00 40.42 ? 14  DA  F C5    1 
ATOM   685  C  C6    . DA  B 2 14 ? -10.966 55.472 31.302  1.00 40.10 ? 14  DA  F C6    1 
ATOM   686  N  N6    . DA  B 2 14 ? -12.119 56.113 31.520  1.00 40.31 ? 14  DA  F N6    1 
ATOM   687  N  N1    . DA  B 2 14 ? -10.991 54.320 30.598  1.00 39.62 ? 14  DA  F N1    1 
ATOM   688  C  C2    . DA  B 2 14 ? -9.838  53.683 30.377  1.00 41.42 ? 14  DA  F C2    1 
ATOM   689  N  N3    . DA  B 2 14 ? -8.604  54.013 30.756  1.00 40.88 ? 14  DA  F N3    1 
ATOM   690  C  C4    . DA  B 2 14 ? -8.619  55.157 31.453  1.00 41.56 ? 14  DA  F C4    1 
ATOM   691  P  P     . DT  B 2 15 ? -2.306  55.460 30.617  1.00 45.64 ? 15  DT  F P     1 
ATOM   692  O  OP1   . DT  B 2 15 ? -0.877  55.479 31.024  1.00 42.36 ? 15  DT  F OP1   1 
ATOM   693  O  OP2   . DT  B 2 15 ? -2.928  56.689 30.035  1.00 43.81 ? 15  DT  F OP2   1 
ATOM   694  O  "O5'" . DT  B 2 15 ? -2.524  54.278 29.577  1.00 43.55 ? 15  DT  F "O5'" 1 
ATOM   695  C  "C5'" . DT  B 2 15 ? -2.403  52.948 30.027  1.00 41.88 ? 15  DT  F "C5'" 1 
ATOM   696  C  "C4'" . DT  B 2 15 ? -3.451  52.051 29.411  1.00 42.45 ? 15  DT  F "C4'" 1 
ATOM   697  O  "O4'" . DT  B 2 15 ? -4.771  52.665 29.490  1.00 43.64 ? 15  DT  F "O4'" 1 
ATOM   698  C  "C3'" . DT  B 2 15 ? -3.207  51.831 27.917  1.00 40.60 ? 15  DT  F "C3'" 1 
ATOM   699  O  "O3'" . DT  B 2 15 ? -3.657  50.517 27.582  1.00 37.94 ? 15  DT  F "O3'" 1 
ATOM   700  C  "C2'" . DT  B 2 15 ? -4.023  52.934 27.263  1.00 42.11 ? 15  DT  F "C2'" 1 
ATOM   701  C  "C1'" . DT  B 2 15 ? -5.239  52.971 28.177  1.00 43.29 ? 15  DT  F "C1'" 1 
ATOM   702  N  N1    . DT  B 2 15 ? -6.079  54.196 28.222  1.00 43.81 ? 15  DT  F N1    1 
ATOM   703  C  C2    . DT  B 2 15 ? -7.410  54.072 27.834  1.00 44.22 ? 15  DT  F C2    1 
ATOM   704  O  O2    . DT  B 2 15 ? -7.898  53.025 27.459  1.00 45.38 ? 15  DT  F O2    1 
ATOM   705  N  N3    . DT  B 2 15 ? -8.151  55.227 27.904  1.00 44.47 ? 15  DT  F N3    1 
ATOM   706  C  C4    . DT  B 2 15 ? -7.709  56.469 28.302  1.00 43.77 ? 15  DT  F C4    1 
ATOM   707  O  O4    . DT  B 2 15 ? -8.493  57.410 28.314  1.00 43.83 ? 15  DT  F O4    1 
ATOM   708  C  C5    . DT  B 2 15 ? -6.304  56.537 28.684  1.00 44.11 ? 15  DT  F C5    1 
ATOM   709  C  C7    . DT  B 2 15 ? -5.739  57.852 29.116  1.00 44.18 ? 15  DT  F C7    1 
ATOM   710  C  C6    . DT  B 2 15 ? -5.569  55.409 28.628  1.00 43.90 ? 15  DT  F C6    1 
ATOM   711  P  P     . DA  B 2 16 ? -3.604  50.015 26.068  1.00 37.38 ? 16  DA  F P     1 
ATOM   712  O  OP1   . DA  B 2 16 ? -3.384  48.556 26.026  1.00 37.74 ? 16  DA  F OP1   1 
ATOM   713  O  OP2   . DA  B 2 16 ? -2.667  50.914 25.371  1.00 40.48 ? 16  DA  F OP2   1 
ATOM   714  O  "O5'" . DA  B 2 16 ? -5.075  50.280 25.548  1.00 36.48 ? 16  DA  F "O5'" 1 
ATOM   715  C  "C5'" . DA  B 2 16 ? -6.168  49.647 26.181  1.00 36.53 ? 16  DA  F "C5'" 1 
ATOM   716  C  "C4'" . DA  B 2 16 ? -7.357  49.607 25.259  1.00 36.57 ? 16  DA  F "C4'" 1 
ATOM   717  O  "O4'" . DA  B 2 16 ? -7.862  50.953 25.114  1.00 38.63 ? 16  DA  F "O4'" 1 
ATOM   718  C  "C3'" . DA  B 2 16 ? -7.014  49.150 23.845  1.00 35.60 ? 16  DA  F "C3'" 1 
ATOM   719  O  "O3'" . DA  B 2 16 ? -8.123  48.463 23.271  1.00 35.74 ? 16  DA  F "O3'" 1 
ATOM   720  C  "C2'" . DA  B 2 16 ? -6.666  50.449 23.137  1.00 38.16 ? 16  DA  F "C2'" 1 
ATOM   721  C  "C1'" . DA  B 2 16 ? -7.605  51.449 23.806  1.00 40.65 ? 16  DA  F "C1'" 1 
ATOM   722  N  N9    . DA  B 2 16 ? -7.117  52.824 23.945  1.00 42.95 ? 16  DA  F N9    1 
ATOM   723  C  C8    . DA  B 2 16 ? -5.825  53.278 24.025  1.00 43.19 ? 16  DA  F C8    1 
ATOM   724  N  N7    . DA  B 2 16 ? -5.725  54.581 24.155  1.00 44.26 ? 16  DA  F N7    1 
ATOM   725  C  C5    . DA  B 2 16 ? -7.044  55.017 24.157  1.00 45.97 ? 16  DA  F C5    1 
ATOM   726  C  C6    . DA  B 2 16 ? -7.628  56.306 24.263  1.00 46.93 ? 16  DA  F C6    1 
ATOM   727  N  N6    . DA  B 2 16 ? -6.924  57.437 24.385  1.00 47.60 ? 16  DA  F N6    1 
ATOM   728  N  N1    . DA  B 2 16 ? -8.976  56.390 24.238  1.00 48.05 ? 16  DA  F N1    1 
ATOM   729  C  C2    . DA  B 2 16 ? -9.684  55.263 24.112  1.00 47.70 ? 16  DA  F C2    1 
ATOM   730  N  N3    . DA  B 2 16 ? -9.258  54.002 24.001  1.00 47.51 ? 16  DA  F N3    1 
ATOM   731  C  C4    . DA  B 2 16 ? -7.913  53.947 24.030  1.00 45.61 ? 16  DA  F C4    1 
ATOM   732  P  P     . DG  B 2 17 ? -7.995  47.843 21.804  1.00 40.43 ? 17  DG  F P     1 
ATOM   733  O  OP1   . DG  B 2 17 ? -9.003  46.764 21.629  1.00 39.59 ? 17  DG  F OP1   1 
ATOM   734  O  OP2   . DG  B 2 17 ? -6.560  47.544 21.595  1.00 38.84 ? 17  DG  F OP2   1 
ATOM   735  O  "O5'" . DG  B 2 17 ? -8.380  49.066 20.850  1.00 43.55 ? 17  DG  F "O5'" 1 
ATOM   736  C  "C5'" . DG  B 2 17 ? -9.744  49.462 20.683  1.00 43.44 ? 17  DG  F "C5'" 1 
ATOM   737  C  "C4'" . DG  B 2 17 ? -9.914  50.337 19.459  1.00 44.34 ? 17  DG  F "C4'" 1 
ATOM   738  O  "O4'" . DG  B 2 17 ? -9.418  51.675 19.711  1.00 43.40 ? 17  DG  F "O4'" 1 
ATOM   739  C  "C3'" . DG  B 2 17 ? -9.108  49.847 18.255  1.00 44.98 ? 17  DG  F "C3'" 1 
ATOM   740  O  "O3'" . DG  B 2 17 ? -9.714  50.345 17.054  1.00 48.30 ? 17  DG  F "O3'" 1 
ATOM   741  C  "C2'" . DG  B 2 17 ? -7.778  50.558 18.443  1.00 43.86 ? 17  DG  F "C2'" 1 
ATOM   742  C  "C1'" . DG  B 2 17 ? -8.257  51.910 18.936  1.00 40.83 ? 17  DG  F "C1'" 1 
ATOM   743  N  N9    . DG  B 2 17 ? -7.356  52.786 19.678  1.00 39.31 ? 17  DG  F N9    1 
ATOM   744  C  C8    . DG  B 2 17 ? -6.065  52.545 20.071  1.00 38.94 ? 17  DG  F C8    1 
ATOM   745  N  N7    . DG  B 2 17 ? -5.523  53.559 20.695  1.00 37.54 ? 17  DG  F N7    1 
ATOM   746  C  C5    . DG  B 2 17 ? -6.522  54.521 20.720  1.00 36.51 ? 17  DG  F C5    1 
ATOM   747  C  C6    . DG  B 2 17 ? -6.528  55.845 21.253  1.00 36.04 ? 17  DG  F C6    1 
ATOM   748  O  O6    . DG  B 2 17 ? -5.625  56.452 21.836  1.00 36.23 ? 17  DG  F O6    1 
ATOM   749  N  N1    . DG  B 2 17 ? -7.748  56.470 21.051  1.00 37.54 ? 17  DG  F N1    1 
ATOM   750  C  C2    . DG  B 2 17 ? -8.821  55.909 20.412  1.00 39.03 ? 17  DG  F C2    1 
ATOM   751  N  N2    . DG  B 2 17 ? -9.910  56.670 20.314  1.00 40.46 ? 17  DG  F N2    1 
ATOM   752  N  N3    . DG  B 2 17 ? -8.830  54.693 19.906  1.00 38.44 ? 17  DG  F N3    1 
ATOM   753  C  C4    . DG  B 2 17 ? -7.657  54.059 20.097  1.00 38.20 ? 17  DG  F C4    1 
ATOM   754  P  P     . DC  B 2 18 ? -10.892 49.513 16.335  1.00 52.50 ? 18  DC  F P     1 
ATOM   755  O  OP1   . DC  B 2 18 ? -11.364 48.451 17.290  1.00 53.52 ? 18  DC  F OP1   1 
ATOM   756  O  OP2   . DC  B 2 18 ? -10.428 49.129 14.972  1.00 52.50 ? 18  DC  F OP2   1 
ATOM   757  O  "O5'" . DC  B 2 18 ? -12.056 50.588 16.188  1.00 50.33 ? 18  DC  F "O5'" 1 
ATOM   758  C  "C5'" . DC  B 2 18 ? -12.698 51.110 17.350  1.00 50.78 ? 18  DC  F "C5'" 1 
ATOM   759  C  "C4'" . DC  B 2 18 ? -13.445 52.377 17.017  1.00 51.47 ? 18  DC  F "C4'" 1 
ATOM   760  O  "O4'" . DC  B 2 18 ? -12.632 53.542 17.315  1.00 47.73 ? 18  DC  F "O4'" 1 
ATOM   761  C  "C3'" . DC  B 2 18 ? -13.768 52.491 15.531  1.00 52.00 ? 18  DC  F "C3'" 1 
ATOM   762  O  "O3'" . DC  B 2 18 ? -14.988 53.213 15.363  1.00 56.29 ? 18  DC  F "O3'" 1 
ATOM   763  C  "C2'" . DC  B 2 18 ? -12.558 53.223 14.971  1.00 47.24 ? 18  DC  F "C2'" 1 
ATOM   764  C  "C1'" . DC  B 2 18 ? -12.208 54.176 16.110  1.00 44.42 ? 18  DC  F "C1'" 1 
ATOM   765  N  N1    . DC  B 2 18 ? -10.785 54.542 16.256  1.00 40.34 ? 18  DC  F N1    1 
ATOM   766  C  C2    . DC  B 2 18 ? -10.455 55.798 16.817  1.00 39.40 ? 18  DC  F C2    1 
ATOM   767  O  O2    . DC  B 2 18 ? -11.369 56.581 17.148  1.00 37.84 ? 18  DC  F O2    1 
ATOM   768  N  N3    . DC  B 2 18 ? -9.154  56.125 16.977  1.00 36.38 ? 18  DC  F N3    1 
ATOM   769  C  C4    . DC  B 2 18 ? -8.205  55.274 16.604  1.00 35.00 ? 18  DC  F C4    1 
ATOM   770  N  N4    . DC  B 2 18 ? -6.940  55.643 16.791  1.00 33.13 ? 18  DC  F N4    1 
ATOM   771  C  C5    . DC  B 2 18 ? -8.505  54.007 16.022  1.00 34.25 ? 18  DC  F C5    1 
ATOM   772  C  C6    . DC  B 2 18 ? -9.796  53.684 15.869  1.00 36.19 ? 18  DC  F C6    1 
ATOM   773  P  P     . DG  B 2 19 ? -15.696 53.256 13.917  1.00 59.48 ? 19  DG  F P     1 
ATOM   774  O  OP1   . DG  B 2 19 ? -17.097 52.759 14.104  1.00 60.03 ? 19  DG  F OP1   1 
ATOM   775  O  OP2   . DG  B 2 19 ? -14.799 52.595 12.903  1.00 57.50 ? 19  DG  F OP2   1 
ATOM   776  O  "O5'" . DG  B 2 19 ? -15.716 54.813 13.602  1.00 59.68 ? 19  DG  F "O5'" 1 
ATOM   777  C  "C5'" . DG  B 2 19 ? -15.872 55.744 14.651  1.00 63.07 ? 19  DG  F "C5'" 1 
ATOM   778  C  "C4'" . DG  B 2 19 ? -15.306 57.084 14.242  1.00 66.42 ? 19  DG  F "C4'" 1 
ATOM   779  O  "O4'" . DG  B 2 19 ? -13.855 57.047 14.288  1.00 65.82 ? 19  DG  F "O4'" 1 
ATOM   780  C  "C3'" . DG  B 2 19 ? -15.653 57.392 12.780  1.00 69.09 ? 19  DG  F "C3'" 1 
ATOM   781  O  "O3'" . DG  B 2 19 ? -15.715 58.820 12.611  1.00 73.18 ? 19  DG  F "O3'" 1 
ATOM   782  C  "C2'" . DG  B 2 19 ? -14.484 56.789 12.016  1.00 67.53 ? 19  DG  F "C2'" 1 
ATOM   783  C  "C1'" . DG  B 2 19 ? -13.345 57.141 12.957  1.00 65.61 ? 19  DG  F "C1'" 1 
ATOM   784  N  N9    . DG  B 2 19 ? -12.083 56.410 12.858  1.00 63.55 ? 19  DG  F N9    1 
ATOM   785  C  C8    . DG  B 2 19 ? -11.840 55.202 12.253  1.00 62.12 ? 19  DG  F C8    1 
ATOM   786  N  N7    . DG  B 2 19 ? -10.580 54.848 12.310  1.00 60.71 ? 19  DG  F N7    1 
ATOM   787  C  C5    . DG  B 2 19 ? -9.962  55.884 13.004  1.00 60.06 ? 19  DG  F C5    1 
ATOM   788  C  C6    . DG  B 2 19 ? -8.588  56.069 13.377  1.00 59.48 ? 19  DG  F C6    1 
ATOM   789  O  O6    . DG  B 2 19 ? -7.615  55.336 13.162  1.00 58.84 ? 19  DG  F O6    1 
ATOM   790  N  N1    . DG  B 2 19 ? -8.407  57.258 14.076  1.00 59.32 ? 19  DG  F N1    1 
ATOM   791  C  C2    . DG  B 2 19 ? -9.398  58.157 14.372  1.00 60.23 ? 19  DG  F C2    1 
ATOM   792  N  N2    . DG  B 2 19 ? -9.019  59.260 15.054  1.00 59.16 ? 19  DG  F N2    1 
ATOM   793  N  N3    . DG  B 2 19 ? -10.671 57.995 14.032  1.00 60.62 ? 19  DG  F N3    1 
ATOM   794  C  C4    . DG  B 2 19 ? -10.874 56.847 13.353  1.00 61.31 ? 19  DG  F C4    1 
ATOM   795  P  P     . DT  B 2 20 ? -16.093 59.457 11.177  1.00 74.82 ? 20  DT  F P     1 
ATOM   796  O  OP1   . DT  B 2 20 ? -17.531 59.852 11.272  1.00 74.80 ? 20  DT  F OP1   1 
ATOM   797  O  OP2   . DT  B 2 20 ? -15.622 58.563 10.060  1.00 74.03 ? 20  DT  F OP2   1 
ATOM   798  O  "O5'" . DT  B 2 20 ? -15.199 60.777 11.137  1.00 76.52 ? 20  DT  F "O5'" 1 
ATOM   799  C  "C5'" . DT  B 2 20 ? -15.135 61.650 12.267  1.00 78.00 ? 20  DT  F "C5'" 1 
ATOM   800  C  "C4'" . DT  B 2 20 ? -14.080 62.713 12.051  1.00 79.33 ? 20  DT  F "C4'" 1 
ATOM   801  O  "O4'" . DT  B 2 20 ? -12.763 62.111 12.161  1.00 79.61 ? 20  DT  F "O4'" 1 
ATOM   802  C  "C3'" . DT  B 2 20 ? -14.136 63.319 10.646  1.00 80.10 ? 20  DT  F "C3'" 1 
ATOM   803  O  "O3'" . DT  B 2 20 ? -13.555 64.633 10.626  1.00 80.00 ? 20  DT  F "O3'" 1 
ATOM   804  C  "C2'" . DT  B 2 20 ? -13.235 62.393 9.844   1.00 80.27 ? 20  DT  F "C2'" 1 
ATOM   805  C  "C1'" . DT  B 2 20 ? -12.148 62.045 10.868  1.00 80.83 ? 20  DT  F "C1'" 1 
ATOM   806  N  N1    . DT  B 2 20 ? -11.509 60.713 10.717  1.00 81.21 ? 20  DT  F N1    1 
ATOM   807  C  C2    . DT  B 2 20 ? -10.170 60.585 11.074  1.00 81.57 ? 20  DT  F C2    1 
ATOM   808  O  O2    . DT  B 2 20 ? -9.513  61.503 11.531  1.00 81.70 ? 20  DT  F O2    1 
ATOM   809  N  N3    . DT  B 2 20 ? -9.634  59.333 10.886  1.00 81.45 ? 20  DT  F N3    1 
ATOM   810  C  C4    . DT  B 2 20 ? -10.289 58.215 10.404  1.00 82.01 ? 20  DT  F C4    1 
ATOM   811  O  O4    . DT  B 2 20 ? -9.680  57.142 10.301  1.00 81.38 ? 20  DT  F O4    1 
ATOM   812  C  C5    . DT  B 2 20 ? -11.691 58.418 10.055  1.00 82.25 ? 20  DT  F C5    1 
ATOM   813  C  C7    . DT  B 2 20 ? -12.475 57.263 9.516   1.00 82.66 ? 20  DT  F C7    1 
ATOM   814  C  C6    . DT  B 2 20 ? -12.222 59.641 10.228  1.00 81.39 ? 20  DT  F C6    1 
ATOM   815  O  "O5'" . DA  C 1 1  ? 19.433  33.730 37.463  1.00 86.25 ? 1   DA  G "O5'" 1 
ATOM   816  C  "C5'" . DA  C 1 1  ? 19.076  33.009 38.651  1.00 87.15 ? 1   DA  G "C5'" 1 
ATOM   817  C  "C4'" . DA  C 1 1  ? 19.814  33.482 39.883  1.00 87.38 ? 1   DA  G "C4'" 1 
ATOM   818  O  "O4'" . DA  C 1 1  ? 21.223  33.213 39.722  1.00 88.22 ? 1   DA  G "O4'" 1 
ATOM   819  C  "C3'" . DA  C 1 1  ? 19.732  34.991 40.087  1.00 87.20 ? 1   DA  G "C3'" 1 
ATOM   820  O  "O3'" . DA  C 1 1  ? 19.843  35.281 41.486  1.00 85.49 ? 1   DA  G "O3'" 1 
ATOM   821  C  "C2'" . DA  C 1 1  ? 20.915  35.523 39.293  1.00 87.75 ? 1   DA  G "C2'" 1 
ATOM   822  C  "C1'" . DA  C 1 1  ? 21.950  34.430 39.518  1.00 88.92 ? 1   DA  G "C1'" 1 
ATOM   823  N  N9    . DA  C 1 1  ? 22.910  34.193 38.437  1.00 90.60 ? 1   DA  G N9    1 
ATOM   824  C  C8    . DA  C 1 1  ? 22.671  33.979 37.095  1.00 90.82 ? 1   DA  G C8    1 
ATOM   825  N  N7    . DA  C 1 1  ? 23.753  33.716 36.395  1.00 90.70 ? 1   DA  G N7    1 
ATOM   826  C  C5    . DA  C 1 1  ? 24.776  33.777 37.330  1.00 91.36 ? 1   DA  G C5    1 
ATOM   827  C  C6    . DA  C 1 1  ? 26.167  33.590 37.222  1.00 92.07 ? 1   DA  G C6    1 
ATOM   828  N  N6    . DA  C 1 1  ? 26.774  33.284 36.073  1.00 92.47 ? 1   DA  G N6    1 
ATOM   829  N  N1    . DA  C 1 1  ? 26.918  33.728 38.345  1.00 93.13 ? 1   DA  G N1    1 
ATOM   830  C  C2    . DA  C 1 1  ? 26.294  34.036 39.502  1.00 93.54 ? 1   DA  G C2    1 
ATOM   831  N  N3    . DA  C 1 1  ? 24.986  34.238 39.729  1.00 93.04 ? 1   DA  G N3    1 
ATOM   832  C  C4    . DA  C 1 1  ? 24.278  34.089 38.588  1.00 91.62 ? 1   DA  G C4    1 
ATOM   833  P  P     . DC  C 1 2  ? 19.184  36.629 42.086  1.00 85.33 ? 2   DC  G P     1 
ATOM   834  O  OP1   . DC  C 1 2  ? 18.363  36.275 43.296  1.00 85.66 ? 2   DC  G OP1   1 
ATOM   835  O  OP2   . DC  C 1 2  ? 18.540  37.384 40.954  1.00 85.40 ? 2   DC  G OP2   1 
ATOM   836  O  "O5'" . DC  C 1 2  ? 20.462  37.448 42.571  1.00 84.68 ? 2   DC  G "O5'" 1 
ATOM   837  C  "C5'" . DC  C 1 2  ? 21.710  37.254 41.926  1.00 84.53 ? 2   DC  G "C5'" 1 
ATOM   838  C  "C4'" . DC  C 1 2  ? 22.781  38.085 42.590  1.00 84.34 ? 2   DC  G "C4'" 1 
ATOM   839  O  "O4'" . DC  C 1 2  ? 24.012  37.859 41.872  1.00 83.69 ? 2   DC  G "O4'" 1 
ATOM   840  C  "C3'" . DC  C 1 2  ? 22.538  39.591 42.523  1.00 83.97 ? 2   DC  G "C3'" 1 
ATOM   841  O  "O3'" . DC  C 1 2  ? 23.227  40.208 43.614  1.00 85.42 ? 2   DC  G "O3'" 1 
ATOM   842  C  "C2'" . DC  C 1 2  ? 23.160  39.975 41.195  1.00 83.66 ? 2   DC  G "C2'" 1 
ATOM   843  C  "C1'" . DC  C 1 2  ? 24.347  39.018 41.106  1.00 83.34 ? 2   DC  G "C1'" 1 
ATOM   844  N  N1    . DC  C 1 2  ? 24.704  38.568 39.755  1.00 83.01 ? 2   DC  G N1    1 
ATOM   845  C  C2    . DC  C 1 2  ? 26.068  38.519 39.416  1.00 83.30 ? 2   DC  G C2    1 
ATOM   846  O  O2    . DC  C 1 2  ? 26.911  38.892 40.272  1.00 82.84 ? 2   DC  G O2    1 
ATOM   847  N  N3    . DC  C 1 2  ? 26.430  38.067 38.188  1.00 83.04 ? 2   DC  G N3    1 
ATOM   848  C  C4    . DC  C 1 2  ? 25.492  37.682 37.315  1.00 82.95 ? 2   DC  G C4    1 
ATOM   849  N  N4    . DC  C 1 2  ? 25.916  37.220 36.113  1.00 83.08 ? 2   DC  G N4    1 
ATOM   850  C  C5    . DC  C 1 2  ? 24.087  37.741 37.629  1.00 82.39 ? 2   DC  G C5    1 
ATOM   851  C  C6    . DC  C 1 2  ? 23.745  38.191 38.850  1.00 82.57 ? 2   DC  G C6    1 
ATOM   852  P  P     . DG  C 1 3  ? 22.685  41.601 44.229  1.00 87.20 ? 3   DG  G P     1 
ATOM   853  O  OP1   . DG  C 1 3  ? 21.609  41.295 45.235  1.00 87.09 ? 3   DG  G OP1   1 
ATOM   854  O  OP2   . DG  C 1 3  ? 22.387  42.529 43.067  1.00 88.30 ? 3   DG  G OP2   1 
ATOM   855  O  "O5'" . DG  C 1 3  ? 23.952  42.168 45.020  1.00 88.52 ? 3   DG  G "O5'" 1 
ATOM   856  C  "C5'" . DG  C 1 3  ? 24.723  41.318 45.863  1.00 90.26 ? 3   DG  G "C5'" 1 
ATOM   857  C  "C4'" . DG  C 1 3  ? 26.145  41.830 45.981  1.00 91.74 ? 3   DG  G "C4'" 1 
ATOM   858  O  "O4'" . DG  C 1 3  ? 26.860  41.608 44.738  1.00 91.80 ? 3   DG  G "O4'" 1 
ATOM   859  C  "C3'" . DG  C 1 3  ? 26.219  43.332 46.224  1.00 92.02 ? 3   DG  G "C3'" 1 
ATOM   860  O  "O3'" . DG  C 1 3  ? 27.390  43.662 46.982  1.00 92.94 ? 3   DG  G "O3'" 1 
ATOM   861  C  "C2'" . DG  C 1 3  ? 26.262  43.906 44.817  1.00 92.56 ? 3   DG  G "C2'" 1 
ATOM   862  C  "C1'" . DG  C 1 3  ? 27.069  42.854 44.051  1.00 92.34 ? 3   DG  G "C1'" 1 
ATOM   863  N  N9    . DG  C 1 3  ? 26.639  42.685 42.660  1.00 92.55 ? 3   DG  G N9    1 
ATOM   864  C  C8    . DG  C 1 3  ? 25.435  43.069 42.104  1.00 91.84 ? 3   DG  G C8    1 
ATOM   865  N  N7    . DG  C 1 3  ? 25.337  42.767 40.836  1.00 91.96 ? 3   DG  G N7    1 
ATOM   866  C  C5    . DG  C 1 3  ? 26.543  42.151 40.529  1.00 92.66 ? 3   DG  G C5    1 
ATOM   867  C  C6    . DG  C 1 3  ? 27.017  41.592 39.286  1.00 93.04 ? 3   DG  G C6    1 
ATOM   868  O  O6    . DG  C 1 3  ? 26.436  41.535 38.196  1.00 93.42 ? 3   DG  G O6    1 
ATOM   869  N  N1    . DG  C 1 3  ? 28.296  41.066 39.412  1.00 92.82 ? 3   DG  G N1    1 
ATOM   870  C  C2    . DG  C 1 3  ? 29.031  41.060 40.569  1.00 93.20 ? 3   DG  G C2    1 
ATOM   871  N  N2    . DG  C 1 3  ? 30.268  40.494 40.467  1.00 93.30 ? 3   DG  G N2    1 
ATOM   872  N  N3    . DG  C 1 3  ? 28.605  41.568 41.736  1.00 92.75 ? 3   DG  G N3    1 
ATOM   873  C  C4    . DG  C 1 3  ? 27.363  42.092 41.635  1.00 92.49 ? 3   DG  G C4    1 
ATOM   874  P  P     . DC  C 1 4  ? 27.816  45.218 47.167  1.00 94.42 ? 4   DC  G P     1 
ATOM   875  O  OP1   . DC  C 1 4  ? 28.607  45.369 48.448  1.00 93.95 ? 4   DC  G OP1   1 
ATOM   876  O  OP2   . DC  C 1 4  ? 26.558  46.043 46.967  1.00 93.80 ? 4   DC  G OP2   1 
ATOM   877  O  "O5'" . DC  C 1 4  ? 28.810  45.478 45.937  1.00 93.90 ? 4   DC  G "O5'" 1 
ATOM   878  C  "C5'" . DC  C 1 4  ? 29.826  44.522 45.633  1.00 93.85 ? 4   DC  G "C5'" 1 
ATOM   879  C  "C4'" . DC  C 1 4  ? 30.713  44.999 44.501  1.00 94.19 ? 4   DC  G "C4'" 1 
ATOM   880  O  "O4'" . DC  C 1 4  ? 30.032  44.888 43.221  1.00 94.75 ? 4   DC  G "O4'" 1 
ATOM   881  C  "C3'" . DC  C 1 4  ? 31.050  46.483 44.650  1.00 93.75 ? 4   DC  G "C3'" 1 
ATOM   882  O  "O3'" . DC  C 1 4  ? 32.299  46.731 43.995  1.00 92.15 ? 4   DC  G "O3'" 1 
ATOM   883  C  "C2'" . DC  C 1 4  ? 29.927  47.165 43.884  1.00 94.02 ? 4   DC  G "C2'" 1 
ATOM   884  C  "C1'" . DC  C 1 4  ? 29.764  46.198 42.710  1.00 94.24 ? 4   DC  G "C1'" 1 
ATOM   885  N  N1    . DC  C 1 4  ? 28.484  46.188 41.974  1.00 93.70 ? 4   DC  G N1    1 
ATOM   886  C  C2    . DC  C 1 4  ? 28.321  45.275 40.897  1.00 93.44 ? 4   DC  G C2    1 
ATOM   887  O  O2    . DC  C 1 4  ? 29.252  44.484 40.628  1.00 93.05 ? 4   DC  G O2    1 
ATOM   888  N  N3    . DC  C 1 4  ? 27.168  45.291 40.179  1.00 93.15 ? 4   DC  G N3    1 
ATOM   889  C  C4    . DC  C 1 4  ? 26.198  46.157 40.499  1.00 93.40 ? 4   DC  G C4    1 
ATOM   890  N  N4    . DC  C 1 4  ? 25.075  46.141 39.752  1.00 93.27 ? 4   DC  G N4    1 
ATOM   891  C  C5    . DC  C 1 4  ? 26.329  47.084 41.593  1.00 93.33 ? 4   DC  G C5    1 
ATOM   892  C  C6    . DC  C 1 4  ? 27.473  47.054 42.301  1.00 93.61 ? 4   DC  G C6    1 
ATOM   893  P  P     . DT  C 1 5  ? 33.303  47.863 44.564  1.00 91.21 ? 5   DT  G P     1 
ATOM   894  O  OP1   . DT  C 1 5  ? 34.002  47.273 45.776  1.00 90.57 ? 5   DT  G OP1   1 
ATOM   895  O  OP2   . DT  C 1 5  ? 32.546  49.173 44.694  1.00 90.62 ? 5   DT  G OP2   1 
ATOM   896  O  "O5'" . DT  C 1 5  ? 34.370  47.983 43.383  1.00 89.00 ? 5   DT  G "O5'" 1 
ATOM   897  C  "C5'" . DT  C 1 5  ? 35.092  46.831 42.986  1.00 85.46 ? 5   DT  G "C5'" 1 
ATOM   898  C  "C4'" . DT  C 1 5  ? 35.365  46.843 41.499  1.00 83.39 ? 5   DT  G "C4'" 1 
ATOM   899  O  "O4'" . DT  C 1 5  ? 34.130  46.855 40.725  1.00 82.24 ? 5   DT  G "O4'" 1 
ATOM   900  C  "C3'" . DT  C 1 5  ? 36.116  48.096 41.047  1.00 81.39 ? 5   DT  G "C3'" 1 
ATOM   901  O  "O3'" . DT  C 1 5  ? 36.839  47.737 39.865  1.00 79.91 ? 5   DT  G "O3'" 1 
ATOM   902  C  "C2'" . DT  C 1 5  ? 35.001  49.070 40.694  1.00 80.74 ? 5   DT  G "C2'" 1 
ATOM   903  C  "C1'" . DT  C 1 5  ? 33.998  48.114 40.051  1.00 80.51 ? 5   DT  G "C1'" 1 
ATOM   904  N  N1    . DT  C 1 5  ? 32.565  48.494 39.991  1.00 78.36 ? 5   DT  G N1    1 
ATOM   905  C  C2    . DT  C 1 5  ? 31.804  47.868 39.028  1.00 77.03 ? 5   DT  G C2    1 
ATOM   906  O  O2    . DT  C 1 5  ? 32.262  47.049 38.239  1.00 76.05 ? 5   DT  G O2    1 
ATOM   907  N  N3    . DT  C 1 5  ? 30.481  48.236 39.014  1.00 76.43 ? 5   DT  G N3    1 
ATOM   908  C  C4    . DT  C 1 5  ? 29.853  49.157 39.833  1.00 76.65 ? 5   DT  G C4    1 
ATOM   909  O  O4    . DT  C 1 5  ? 28.640  49.386 39.685  1.00 76.09 ? 5   DT  G O4    1 
ATOM   910  C  C5    . DT  C 1 5  ? 30.716  49.788 40.817  1.00 77.27 ? 5   DT  G C5    1 
ATOM   911  C  C7    . DT  C 1 5  ? 30.130  50.807 41.746  1.00 76.37 ? 5   DT  G C7    1 
ATOM   912  C  C6    . DT  C 1 5  ? 32.012  49.428 40.846  1.00 77.86 ? 5   DT  G C6    1 
ATOM   913  P  P     . DA  C 1 6  ? 38.076  48.637 39.366  1.00 78.19 ? 6   DA  G P     1 
ATOM   914  O  OP1   . DA  C 1 6  ? 39.338  48.042 39.919  1.00 78.80 ? 6   DA  G OP1   1 
ATOM   915  O  OP2   . DA  C 1 6  ? 37.725  50.073 39.675  1.00 78.44 ? 6   DA  G OP2   1 
ATOM   916  O  "O5'" . DA  C 1 6  ? 38.090  48.373 37.791  1.00 75.74 ? 6   DA  G "O5'" 1 
ATOM   917  C  "C5'" . DA  C 1 6  ? 38.030  47.039 37.308  1.00 71.86 ? 6   DA  G "C5'" 1 
ATOM   918  C  "C4'" . DA  C 1 6  ? 37.456  47.003 35.909  1.00 68.62 ? 6   DA  G "C4'" 1 
ATOM   919  O  "O4'" . DA  C 1 6  ? 36.096  47.511 35.910  1.00 67.88 ? 6   DA  G "O4'" 1 
ATOM   920  C  "C3'" . DA  C 1 6  ? 38.212  47.910 34.944  1.00 66.45 ? 6   DA  G "C3'" 1 
ATOM   921  O  "O3'" . DA  C 1 6  ? 38.111  47.328 33.643  1.00 64.17 ? 6   DA  G "O3'" 1 
ATOM   922  C  "C2'" . DA  C 1 6  ? 37.482  49.242 35.064  1.00 65.45 ? 6   DA  G "C2'" 1 
ATOM   923  C  "C1'" . DA  C 1 6  ? 36.045  48.771 35.235  1.00 66.02 ? 6   DA  G "C1'" 1 
ATOM   924  N  N9    . DA  C 1 6  ? 35.110  49.652 35.945  1.00 64.69 ? 6   DA  G N9    1 
ATOM   925  C  C8    . DA  C 1 6  ? 35.344  50.578 36.937  1.00 63.41 ? 6   DA  G C8    1 
ATOM   926  N  N7    . DA  C 1 6  ? 34.261  51.222 37.324  1.00 62.99 ? 6   DA  G N7    1 
ATOM   927  C  C5    . DA  C 1 6  ? 33.244  50.671 36.547  1.00 62.57 ? 6   DA  G C5    1 
ATOM   928  C  C6    . DA  C 1 6  ? 31.844  50.918 36.470  1.00 61.43 ? 6   DA  G C6    1 
ATOM   929  N  N6    . DA  C 1 6  ? 31.203  51.819 37.217  1.00 58.92 ? 6   DA  G N6    1 
ATOM   930  N  N1    . DA  C 1 6  ? 31.125  50.193 35.574  1.00 61.93 ? 6   DA  G N1    1 
ATOM   931  C  C2    . DA  C 1 6  ? 31.771  49.291 34.802  1.00 62.21 ? 6   DA  G C2    1 
ATOM   932  N  N3    . DA  C 1 6  ? 33.068  48.970 34.785  1.00 63.60 ? 6   DA  G N3    1 
ATOM   933  C  C4    . DA  C 1 6  ? 33.755  49.703 35.690  1.00 64.04 ? 6   DA  G C4    1 
ATOM   934  P  P     . DT  C 1 7  ? 38.690  48.109 32.360  1.00 62.69 ? 7   DT  G P     1 
ATOM   935  O  OP1   . DT  C 1 7  ? 39.622  47.196 31.623  1.00 62.57 ? 7   DT  G OP1   1 
ATOM   936  O  OP2   . DT  C 1 7  ? 39.163  49.481 32.792  1.00 61.92 ? 7   DT  G OP2   1 
ATOM   937  O  "O5'" . DT  C 1 7  ? 37.377  48.327 31.489  1.00 61.75 ? 7   DT  G "O5'" 1 
ATOM   938  C  "C5'" . DT  C 1 7  ? 36.247  48.961 32.082  1.00 59.56 ? 7   DT  G "C5'" 1 
ATOM   939  C  "C4'" . DT  C 1 7  ? 35.041  48.865 31.180  1.00 57.27 ? 7   DT  G "C4'" 1 
ATOM   940  O  "O4'" . DT  C 1 7  ? 33.917  49.425 31.902  1.00 56.67 ? 7   DT  G "O4'" 1 
ATOM   941  C  "C3'" . DT  C 1 7  ? 35.158  49.692 29.904  1.00 55.61 ? 7   DT  G "C3'" 1 
ATOM   942  O  "O3'" . DT  C 1 7  ? 34.380  49.082 28.862  1.00 55.19 ? 7   DT  G "O3'" 1 
ATOM   943  C  "C2'" . DT  C 1 7  ? 34.629  51.045 30.347  1.00 54.44 ? 7   DT  G "C2'" 1 
ATOM   944  C  "C1'" . DT  C 1 7  ? 33.556  50.692 31.382  1.00 52.58 ? 7   DT  G "C1'" 1 
ATOM   945  N  N1    . DT  C 1 7  ? 33.481  51.626 32.531  1.00 49.39 ? 7   DT  G N1    1 
ATOM   946  C  C2    . DT  C 1 7  ? 32.253  52.167 32.854  1.00 48.90 ? 7   DT  G C2    1 
ATOM   947  O  O2    . DT  C 1 7  ? 31.227  51.893 32.250  1.00 50.00 ? 7   DT  G O2    1 
ATOM   948  N  N3    . DT  C 1 7  ? 32.268  53.045 33.917  1.00 46.70 ? 7   DT  G N3    1 
ATOM   949  C  C4    . DT  C 1 7  ? 33.367  53.429 34.671  1.00 46.37 ? 7   DT  G C4    1 
ATOM   950  O  O4    . DT  C 1 7  ? 33.233  54.244 35.599  1.00 43.19 ? 7   DT  G O4    1 
ATOM   951  C  C5    . DT  C 1 7  ? 34.624  52.812 34.279  1.00 47.11 ? 7   DT  G C5    1 
ATOM   952  C  C7    . DT  C 1 7  ? 35.868  53.168 35.032  1.00 45.94 ? 7   DT  G C7    1 
ATOM   953  C  C6    . DT  C 1 7  ? 34.616  51.950 33.247  1.00 47.69 ? 7   DT  G C6    1 
ATOM   954  P  P     . DT  C 1 8  ? 34.475  49.628 27.342  1.00 55.87 ? 8   DT  G P     1 
ATOM   955  O  OP1   . DT  C 1 8  ? 34.538  48.453 26.405  1.00 52.63 ? 8   DT  G OP1   1 
ATOM   956  O  OP2   . DT  C 1 8  ? 35.535  50.682 27.289  1.00 54.12 ? 8   DT  G OP2   1 
ATOM   957  O  "O5'" . DT  C 1 8  ? 33.086  50.384 27.149  1.00 53.18 ? 8   DT  G "O5'" 1 
ATOM   958  C  "C5'" . DT  C 1 8  ? 32.661  51.307 28.136  1.00 50.52 ? 8   DT  G "C5'" 1 
ATOM   959  C  "C4'" . DT  C 1 8  ? 31.191  51.614 27.995  1.00 48.44 ? 8   DT  G "C4'" 1 
ATOM   960  O  "O4'" . DT  C 1 8  ? 30.783  52.304 29.197  1.00 48.48 ? 8   DT  G "O4'" 1 
ATOM   961  C  "C3'" . DT  C 1 8  ? 30.870  52.565 26.851  1.00 46.51 ? 8   DT  G "C3'" 1 
ATOM   962  O  "O3'" . DT  C 1 8  ? 29.515  52.353 26.417  1.00 44.55 ? 8   DT  G "O3'" 1 
ATOM   963  C  "C2'" . DT  C 1 8  ? 31.049  53.920 27.511  1.00 45.08 ? 8   DT  G "C2'" 1 
ATOM   964  C  "C1'" . DT  C 1 8  ? 30.567  53.678 28.933  1.00 43.34 ? 8   DT  G "C1'" 1 
ATOM   965  N  N1    . DT  C 1 8  ? 31.266  54.433 29.985  1.00 39.40 ? 8   DT  G N1    1 
ATOM   966  C  C2    . DT  C 1 8  ? 30.515  55.256 30.788  1.00 39.72 ? 8   DT  G C2    1 
ATOM   967  O  O2    . DT  C 1 8  ? 29.303  55.391 30.648  1.00 39.78 ? 8   DT  G O2    1 
ATOM   968  N  N3    . DT  C 1 8  ? 31.233  55.912 31.767  1.00 37.78 ? 8   DT  G N3    1 
ATOM   969  C  C4    . DT  C 1 8  ? 32.591  55.815 32.009  1.00 36.53 ? 8   DT  G C4    1 
ATOM   970  O  O4    . DT  C 1 8  ? 33.098  56.449 32.921  1.00 35.87 ? 8   DT  G O4    1 
ATOM   971  C  C5    . DT  C 1 8  ? 33.309  54.940 31.125  1.00 35.29 ? 8   DT  G C5    1 
ATOM   972  C  C7    . DT  C 1 8  ? 34.780  54.774 31.317  1.00 32.42 ? 8   DT  G C7    1 
ATOM   973  C  C6    . DT  C 1 8  ? 32.623  54.304 30.166  1.00 36.50 ? 8   DT  G C6    1 
ATOM   974  P  P     . DA  C 1 9  ? 29.002  52.975 25.023  1.00 42.61 ? 9   DA  G P     1 
ATOM   975  O  OP1   . DA  C 1 9  ? 28.034  52.010 24.443  1.00 40.78 ? 9   DA  G OP1   1 
ATOM   976  O  OP2   . DA  C 1 9  ? 30.169  53.424 24.212  1.00 40.78 ? 9   DA  G OP2   1 
ATOM   977  O  "O5'" . DA  C 1 9  ? 28.160  54.232 25.502  1.00 38.38 ? 9   DA  G "O5'" 1 
ATOM   978  C  "C5'" . DA  C 1 9  ? 26.859  54.036 26.017  1.00 40.24 ? 9   DA  G "C5'" 1 
ATOM   979  C  "C4'" . DA  C 1 9  ? 26.287  55.333 26.531  1.00 42.44 ? 9   DA  G "C4'" 1 
ATOM   980  O  "O4'" . DA  C 1 9  ? 27.225  55.938 27.455  1.00 44.32 ? 9   DA  G "O4'" 1 
ATOM   981  C  "C3'" . DA  C 1 9  ? 26.088  56.380 25.436  1.00 43.72 ? 9   DA  G "C3'" 1 
ATOM   982  O  "O3'" . DA  C 1 9  ? 25.075  57.277 25.891  1.00 44.14 ? 9   DA  G "O3'" 1 
ATOM   983  C  "C2'" . DA  C 1 9  ? 27.424  57.097 25.405  1.00 45.36 ? 9   DA  G "C2'" 1 
ATOM   984  C  "C1'" . DA  C 1 9  ? 27.771  57.126 26.889  1.00 46.05 ? 9   DA  G "C1'" 1 
ATOM   985  N  N9    . DA  C 1 9  ? 29.182  57.215 27.271  1.00 45.80 ? 9   DA  G N9    1 
ATOM   986  C  C8    . DA  C 1 9  ? 30.273  56.655 26.659  1.00 45.60 ? 9   DA  G C8    1 
ATOM   987  N  N7    . DA  C 1 9  ? 31.403  56.877 27.286  1.00 45.81 ? 9   DA  G N7    1 
ATOM   988  C  C5    . DA  C 1 9  ? 31.036  57.651 28.380  1.00 44.67 ? 9   DA  G C5    1 
ATOM   989  C  C6    . DA  C 1 9  ? 31.778  58.221 29.436  1.00 43.22 ? 9   DA  G C6    1 
ATOM   990  N  N6    . DA  C 1 9  ? 33.098  58.071 29.586  1.00 43.65 ? 9   DA  G N6    1 
ATOM   991  N  N1    . DA  C 1 9  ? 31.105  58.957 30.352  1.00 43.72 ? 9   DA  G N1    1 
ATOM   992  C  C2    . DA  C 1 9  ? 29.774  59.094 30.215  1.00 44.45 ? 9   DA  G C2    1 
ATOM   993  N  N3    . DA  C 1 9  ? 28.966  58.598 29.272  1.00 45.59 ? 9   DA  G N3    1 
ATOM   994  C  C4    . DA  C 1 9  ? 29.671  57.879 28.373  1.00 45.60 ? 9   DA  G C4    1 
ATOM   995  P  P     . DT  C 1 10 ? 24.316  58.232 24.857  1.00 43.18 ? 10  DT  G P     1 
ATOM   996  O  OP1   . DT  C 1 10 ? 23.055  57.559 24.464  1.00 42.14 ? 10  DT  G OP1   1 
ATOM   997  O  OP2   . DT  C 1 10 ? 25.282  58.659 23.815  1.00 44.64 ? 10  DT  G OP2   1 
ATOM   998  O  "O5'" . DT  C 1 10 ? 23.950  59.493 25.751  1.00 41.56 ? 10  DT  G "O5'" 1 
ATOM   999  C  "C5'" . DT  C 1 10 ? 23.236  59.309 26.960  1.00 41.45 ? 10  DT  G "C5'" 1 
ATOM   1000 C  "C4'" . DT  C 1 10 ? 23.362  60.521 27.850  1.00 42.44 ? 10  DT  G "C4'" 1 
ATOM   1001 O  "O4'" . DT  C 1 10 ? 24.746  60.710 28.239  1.00 42.76 ? 10  DT  G "O4'" 1 
ATOM   1002 C  "C3'" . DT  C 1 10 ? 22.969  61.821 27.156  1.00 42.12 ? 10  DT  G "C3'" 1 
ATOM   1003 O  "O3'" . DT  C 1 10 ? 22.521  62.720 28.163  1.00 45.63 ? 10  DT  G "O3'" 1 
ATOM   1004 C  "C2'" . DT  C 1 10 ? 24.280  62.297 26.555  1.00 42.22 ? 10  DT  G "C2'" 1 
ATOM   1005 C  "C1'" . DT  C 1 10 ? 25.267  61.884 27.636  1.00 41.44 ? 10  DT  G "C1'" 1 
ATOM   1006 N  N1    . DT  C 1 10 ? 26.689  61.646 27.292  1.00 40.90 ? 10  DT  G N1    1 
ATOM   1007 C  C2    . DT  C 1 10 ? 27.629  62.141 28.173  1.00 42.53 ? 10  DT  G C2    1 
ATOM   1008 O  O2    . DT  C 1 10 ? 27.335  62.778 29.170  1.00 45.76 ? 10  DT  G O2    1 
ATOM   1009 N  N3    . DT  C 1 10 ? 28.933  61.868 27.845  1.00 40.79 ? 10  DT  G N3    1 
ATOM   1010 C  C4    . DT  C 1 10 ? 29.383  61.164 26.748  1.00 40.37 ? 10  DT  G C4    1 
ATOM   1011 O  O4    . DT  C 1 10 ? 30.587  60.979 26.595  1.00 41.19 ? 10  DT  G O4    1 
ATOM   1012 C  C5    . DT  C 1 10 ? 28.348  60.690 25.850  1.00 41.57 ? 10  DT  G C5    1 
ATOM   1013 C  C7    . DT  C 1 10 ? 28.749  59.934 24.620  1.00 40.98 ? 10  DT  G C7    1 
ATOM   1014 C  C6    . DT  C 1 10 ? 27.067  60.951 26.165  1.00 41.09 ? 10  DT  G C6    1 
ATOM   1015 P  P     . DC  C 1 11 ? 21.225  63.635 27.914  1.00 49.34 ? 11  DC  G P     1 
ATOM   1016 O  OP1   . DC  C 1 11 ? 20.356  63.534 29.130  1.00 45.24 ? 11  DC  G OP1   1 
ATOM   1017 O  OP2   . DC  C 1 11 ? 20.654  63.336 26.570  1.00 49.68 ? 11  DC  G OP2   1 
ATOM   1018 O  "O5'" . DC  C 1 11 ? 21.856  65.097 27.899  1.00 50.80 ? 11  DC  G "O5'" 1 
ATOM   1019 C  "C5'" . DC  C 1 11 ? 22.438  65.606 29.094  1.00 51.82 ? 11  DC  G "C5'" 1 
ATOM   1020 C  "C4'" . DC  C 1 11 ? 23.202  66.888 28.842  1.00 51.71 ? 11  DC  G "C4'" 1 
ATOM   1021 O  "O4'" . DC  C 1 11 ? 24.494  66.608 28.253  1.00 50.54 ? 11  DC  G "O4'" 1 
ATOM   1022 C  "C3'" . DC  C 1 11 ? 22.505  67.806 27.850  1.00 52.30 ? 11  DC  G "C3'" 1 
ATOM   1023 O  "O3'" . DC  C 1 11 ? 22.928  69.124 28.155  1.00 55.83 ? 11  DC  G "O3'" 1 
ATOM   1024 C  "C2'" . DC  C 1 11 ? 23.096  67.363 26.520  1.00 51.38 ? 11  DC  G "C2'" 1 
ATOM   1025 C  "C1'" . DC  C 1 11 ? 24.537  67.078 26.916  1.00 48.18 ? 11  DC  G "C1'" 1 
ATOM   1026 N  N1    . DC  C 1 11 ? 25.355  66.146 26.112  1.00 45.17 ? 11  DC  G N1    1 
ATOM   1027 C  C2    . DC  C 1 11 ? 26.722  66.057 26.397  1.00 42.73 ? 11  DC  G C2    1 
ATOM   1028 O  O2    . DC  C 1 11 ? 27.183  66.746 27.306  1.00 40.06 ? 11  DC  G O2    1 
ATOM   1029 N  N3    . DC  C 1 11 ? 27.503  65.234 25.671  1.00 41.83 ? 11  DC  G N3    1 
ATOM   1030 C  C4    . DC  C 1 11 ? 26.973  64.514 24.680  1.00 43.13 ? 11  DC  G C4    1 
ATOM   1031 N  N4    . DC  C 1 11 ? 27.795  63.721 23.967  1.00 41.64 ? 11  DC  G N4    1 
ATOM   1032 C  C5    . DC  C 1 11 ? 25.579  64.575 24.368  1.00 42.82 ? 11  DC  G C5    1 
ATOM   1033 C  C6    . DC  C 1 11 ? 24.814  65.393 25.106  1.00 44.39 ? 11  DC  G C6    1 
ATOM   1034 P  P     . DG  C 1 12 ? 21.875  70.344 28.157  1.00 58.97 ? 12  DG  G P     1 
ATOM   1035 O  OP1   . DG  C 1 12 ? 20.589  69.904 28.781  1.00 55.83 ? 12  DG  G OP1   1 
ATOM   1036 O  OP2   . DG  C 1 12 ? 21.851  70.949 26.781  1.00 58.83 ? 12  DG  G OP2   1 
ATOM   1037 O  "O5'" . DG  C 1 12 ? 22.627  71.365 29.125  1.00 60.40 ? 12  DG  G "O5'" 1 
ATOM   1038 C  "C5'" . DG  C 1 12 ? 23.131  70.912 30.377  1.00 64.28 ? 12  DG  G "C5'" 1 
ATOM   1039 C  "C4'" . DG  C 1 12 ? 24.570  71.335 30.580  1.00 66.62 ? 12  DG  G "C4'" 1 
ATOM   1040 O  "O4'" . DG  C 1 12 ? 25.459  70.547 29.749  1.00 67.09 ? 12  DG  G "O4'" 1 
ATOM   1041 C  "C3'" . DG  C 1 12 ? 24.819  72.784 30.162  1.00 68.44 ? 12  DG  G "C3'" 1 
ATOM   1042 O  "O3'" . DG  C 1 12 ? 25.897  73.343 30.938  1.00 71.94 ? 12  DG  G "O3'" 1 
ATOM   1043 C  "C2'" . DG  C 1 12 ? 25.206  72.653 28.699  1.00 67.40 ? 12  DG  G "C2'" 1 
ATOM   1044 C  "C1'" . DG  C 1 12 ? 26.031  71.370 28.733  1.00 66.75 ? 12  DG  G "C1'" 1 
ATOM   1045 N  N9    . DG  C 1 12 ? 26.104  70.609 27.484  1.00 66.02 ? 12  DG  G N9    1 
ATOM   1046 C  C8    . DG  C 1 12 ? 25.063  70.305 26.638  1.00 65.78 ? 12  DG  G C8    1 
ATOM   1047 N  N7    . DG  C 1 12 ? 25.441  69.638 25.580  1.00 64.89 ? 12  DG  G N7    1 
ATOM   1048 C  C5    . DG  C 1 12 ? 26.812  69.485 25.736  1.00 63.39 ? 12  DG  G C5    1 
ATOM   1049 C  C6    . DG  C 1 12 ? 27.766  68.840 24.899  1.00 62.30 ? 12  DG  G C6    1 
ATOM   1050 O  O6    . DG  C 1 12 ? 27.582  68.256 23.821  1.00 61.40 ? 12  DG  G O6    1 
ATOM   1051 N  N1    . DG  C 1 12 ? 29.046  68.914 25.434  1.00 61.56 ? 12  DG  G N1    1 
ATOM   1052 C  C2    . DG  C 1 12 ? 29.371  69.519 26.616  1.00 61.49 ? 12  DG  G C2    1 
ATOM   1053 N  N2    . DG  C 1 12 ? 30.677  69.456 26.955  1.00 59.56 ? 12  DG  G N2    1 
ATOM   1054 N  N3    . DG  C 1 12 ? 28.491  70.129 27.407  1.00 62.60 ? 12  DG  G N3    1 
ATOM   1055 C  C4    . DG  C 1 12 ? 27.238  70.073 26.907  1.00 64.05 ? 12  DG  G C4    1 
ATOM   1056 P  P     . DC  C 1 13 ? 26.049  74.956 31.069  1.00 74.52 ? 13  DC  G P     1 
ATOM   1057 O  OP1   . DC  C 1 13 ? 26.349  75.293 32.512  1.00 73.10 ? 13  DC  G OP1   1 
ATOM   1058 O  OP2   . DC  C 1 13 ? 24.867  75.613 30.360  1.00 72.83 ? 13  DC  G OP2   1 
ATOM   1059 O  "O5'" . DC  C 1 13 ? 27.351  75.272 30.205  1.00 73.89 ? 13  DC  G "O5'" 1 
ATOM   1060 C  "C5'" . DC  C 1 13 ? 27.687  74.434 29.117  1.00 73.95 ? 13  DC  G "C5'" 1 
ATOM   1061 C  "C4'" . DC  C 1 13 ? 29.145  74.596 28.773  1.00 73.01 ? 13  DC  G "C4'" 1 
ATOM   1062 O  "O4'" . DC  C 1 13 ? 29.465  73.646 27.735  1.00 72.64 ? 13  DC  G "O4'" 1 
ATOM   1063 C  "C3'" . DC  C 1 13 ? 29.482  75.960 28.194  1.00 72.92 ? 13  DC  G "C3'" 1 
ATOM   1064 O  "O3'" . DC  C 1 13 ? 30.839  76.287 28.514  1.00 73.71 ? 13  DC  G "O3'" 1 
ATOM   1065 C  "C2'" . DC  C 1 13 ? 29.235  75.771 26.708  1.00 72.27 ? 13  DC  G "C2'" 1 
ATOM   1066 C  "C1'" . DC  C 1 13 ? 29.615  74.307 26.478  1.00 71.63 ? 13  DC  G "C1'" 1 
ATOM   1067 N  N1    . DC  C 1 13 ? 28.737  73.613 25.511  1.00 70.41 ? 13  DC  G N1    1 
ATOM   1068 C  C2    . DC  C 1 13 ? 29.229  72.468 24.836  1.00 69.04 ? 13  DC  G C2    1 
ATOM   1069 O  O2    . DC  C 1 13 ? 30.378  72.062 25.060  1.00 68.01 ? 13  DC  G O2    1 
ATOM   1070 N  N3    . DC  C 1 13 ? 28.429  71.837 23.956  1.00 68.59 ? 13  DC  G N3    1 
ATOM   1071 C  C4    . DC  C 1 13 ? 27.190  72.284 23.732  1.00 69.01 ? 13  DC  G C4    1 
ATOM   1072 N  N4    . DC  C 1 13 ? 26.443  71.617 22.847  1.00 69.53 ? 13  DC  G N4    1 
ATOM   1073 C  C5    . DC  C 1 13 ? 26.662  73.434 24.401  1.00 68.67 ? 13  DC  G C5    1 
ATOM   1074 C  C6    . DC  C 1 13 ? 27.463  74.063 25.273  1.00 69.63 ? 13  DC  G C6    1 
ATOM   1075 P  P     . DT  C 1 14 ? 31.563  77.521 27.775  1.00 74.18 ? 14  DT  G P     1 
ATOM   1076 O  OP1   . DT  C 1 14 ? 32.355  78.253 28.816  1.00 74.19 ? 14  DT  G OP1   1 
ATOM   1077 O  OP2   . DT  C 1 14 ? 30.514  78.248 26.968  1.00 73.43 ? 14  DT  G OP2   1 
ATOM   1078 O  "O5'" . DT  C 1 14 ? 32.595  76.806 26.794  1.00 72.82 ? 14  DT  G "O5'" 1 
ATOM   1079 C  "C5'" . DT  C 1 14 ? 33.331  75.688 27.269  1.00 71.23 ? 14  DT  G "C5'" 1 
ATOM   1080 C  "C4'" . DT  C 1 14 ? 34.317  75.216 26.230  1.00 69.84 ? 14  DT  G "C4'" 1 
ATOM   1081 O  "O4'" . DT  C 1 14 ? 33.605  74.514 25.177  1.00 70.23 ? 14  DT  G "O4'" 1 
ATOM   1082 C  "C3'" . DT  C 1 14 ? 34.993  76.392 25.539  1.00 69.01 ? 14  DT  G "C3'" 1 
ATOM   1083 O  "O3'" . DT  C 1 14 ? 36.299  75.990 25.150  1.00 69.93 ? 14  DT  G "O3'" 1 
ATOM   1084 C  "C2'" . DT  C 1 14 ? 34.085  76.675 24.350  1.00 68.05 ? 14  DT  G "C2'" 1 
ATOM   1085 C  "C1'" . DT  C 1 14 ? 33.633  75.268 23.963  1.00 66.65 ? 14  DT  G "C1'" 1 
ATOM   1086 N  N1    . DT  C 1 14 ? 32.325  75.105 23.267  1.00 62.18 ? 14  DT  G N1    1 
ATOM   1087 C  C2    . DT  C 1 14 ? 32.273  74.183 22.225  1.00 60.11 ? 14  DT  G C2    1 
ATOM   1088 O  O2    . DT  C 1 14 ? 33.239  73.515 21.866  1.00 58.20 ? 14  DT  G O2    1 
ATOM   1089 N  N3    . DT  C 1 14 ? 31.040  74.070 21.614  1.00 58.65 ? 14  DT  G N3    1 
ATOM   1090 C  C4    . DT  C 1 14 ? 29.885  74.770 21.926  1.00 57.27 ? 14  DT  G C4    1 
ATOM   1091 O  O4    . DT  C 1 14 ? 28.846  74.560 21.285  1.00 53.06 ? 14  DT  G O4    1 
ATOM   1092 C  C5    . DT  C 1 14 ? 30.015  75.719 23.023  1.00 57.40 ? 14  DT  G C5    1 
ATOM   1093 C  C7    . DT  C 1 14 ? 28.819  76.518 23.422  1.00 55.95 ? 14  DT  G C7    1 
ATOM   1094 C  C6    . DT  C 1 14 ? 31.210  75.836 23.633  1.00 59.38 ? 14  DT  G C6    1 
ATOM   1095 P  P     . DA  C 1 15 ? 37.090  76.815 24.015  1.00 72.63 ? 15  DA  G P     1 
ATOM   1096 O  OP1   . DA  C 1 15 ? 38.555  76.856 24.387  1.00 71.91 ? 15  DA  G OP1   1 
ATOM   1097 O  OP2   . DA  C 1 15 ? 36.358  78.113 23.750  1.00 72.13 ? 15  DA  G OP2   1 
ATOM   1098 O  "O5'" . DA  C 1 15 ? 36.924  75.868 22.738  1.00 70.03 ? 15  DA  G "O5'" 1 
ATOM   1099 C  "C5'" . DA  C 1 15 ? 37.330  74.501 22.801  1.00 67.14 ? 15  DA  G "C5'" 1 
ATOM   1100 C  "C4'" . DA  C 1 15 ? 37.513  73.940 21.407  1.00 64.48 ? 15  DA  G "C4'" 1 
ATOM   1101 O  "O4'" . DA  C 1 15 ? 36.237  73.908 20.716  1.00 61.71 ? 15  DA  G "O4'" 1 
ATOM   1102 C  "C3'" . DA  C 1 15 ? 38.425  74.803 20.541  1.00 62.84 ? 15  DA  G "C3'" 1 
ATOM   1103 O  "O3'" . DA  C 1 15 ? 39.059  73.962 19.561  1.00 64.02 ? 15  DA  G "O3'" 1 
ATOM   1104 C  "C2'" . DA  C 1 15 ? 37.450  75.782 19.912  1.00 61.55 ? 15  DA  G "C2'" 1 
ATOM   1105 C  "C1'" . DA  C 1 15 ? 36.211  74.907 19.701  1.00 59.66 ? 15  DA  G "C1'" 1 
ATOM   1106 N  N9    . DA  C 1 15 ? 34.917  75.592 19.772  1.00 58.07 ? 15  DA  G N9    1 
ATOM   1107 C  C8    . DA  C 1 15 ? 34.519  76.632 20.587  1.00 56.95 ? 15  DA  G C8    1 
ATOM   1108 N  N7    . DA  C 1 15 ? 33.268  76.999 20.404  1.00 55.02 ? 15  DA  G N7    1 
ATOM   1109 C  C5    . DA  C 1 15 ? 32.814  76.149 19.405  1.00 53.73 ? 15  DA  G C5    1 
ATOM   1110 C  C6    . DA  C 1 15 ? 31.570  76.024 18.756  1.00 52.89 ? 15  DA  G C6    1 
ATOM   1111 N  N6    . DA  C 1 15 ? 30.502  76.789 19.037  1.00 51.95 ? 15  DA  G N6    1 
ATOM   1112 N  N1    . DA  C 1 15 ? 31.455  75.076 17.797  1.00 52.01 ? 15  DA  G N1    1 
ATOM   1113 C  C2    . DA  C 1 15 ? 32.511  74.321 17.510  1.00 52.48 ? 15  DA  G C2    1 
ATOM   1114 N  N3    . DA  C 1 15 ? 33.728  74.340 18.043  1.00 55.19 ? 15  DA  G N3    1 
ATOM   1115 C  C4    . DA  C 1 15 ? 33.815  75.284 18.998  1.00 56.30 ? 15  DA  G C4    1 
ATOM   1116 P  P     . DT  C 1 16 ? 40.147  74.580 18.535  1.00 65.12 ? 16  DT  G P     1 
ATOM   1117 O  OP1   . DT  C 1 16 ? 41.343  73.670 18.538  1.00 64.85 ? 16  DT  G OP1   1 
ATOM   1118 O  OP2   . DT  C 1 16 ? 40.309  76.047 18.841  1.00 64.33 ? 16  DT  G OP2   1 
ATOM   1119 O  "O5'" . DT  C 1 16 ? 39.438  74.466 17.112  1.00 63.08 ? 16  DT  G "O5'" 1 
ATOM   1120 C  "C5'" . DT  C 1 16 ? 38.032  74.636 17.008  1.00 61.49 ? 16  DT  G "C5'" 1 
ATOM   1121 C  "C4'" . DT  C 1 16 ? 37.482  73.813 15.869  1.00 59.12 ? 16  DT  G "C4'" 1 
ATOM   1122 O  "O4'" . DT  C 1 16 ? 36.044  73.981 15.847  1.00 57.86 ? 16  DT  G "O4'" 1 
ATOM   1123 C  "C3'" . DT  C 1 16 ? 37.966  74.296 14.509  1.00 58.24 ? 16  DT  G "C3'" 1 
ATOM   1124 O  "O3'" . DT  C 1 16 ? 38.031  73.211 13.577  1.00 57.72 ? 16  DT  G "O3'" 1 
ATOM   1125 C  "C2'" . DT  C 1 16 ? 36.938  75.351 14.138  1.00 56.63 ? 16  DT  G "C2'" 1 
ATOM   1126 C  "C1'" . DT  C 1 16 ? 35.651  74.804 14.752  1.00 54.49 ? 16  DT  G "C1'" 1 
ATOM   1127 N  N1    . DT  C 1 16 ? 34.773  75.849 15.291  1.00 50.47 ? 16  DT  G N1    1 
ATOM   1128 C  C2    . DT  C 1 16 ? 33.472  75.910 14.852  1.00 49.20 ? 16  DT  G C2    1 
ATOM   1129 O  O2    . DT  C 1 16 ? 33.000  75.129 14.048  1.00 46.92 ? 16  DT  G O2    1 
ATOM   1130 N  N3    . DT  C 1 16 ? 32.735  76.923 15.406  1.00 48.27 ? 16  DT  G N3    1 
ATOM   1131 C  C4    . DT  C 1 16 ? 33.161  77.860 16.332  1.00 47.35 ? 16  DT  G C4    1 
ATOM   1132 O  O4    . DT  C 1 16 ? 32.385  78.714 16.745  1.00 47.28 ? 16  DT  G O4    1 
ATOM   1133 C  C5    . DT  C 1 16 ? 34.532  77.737 16.745  1.00 48.61 ? 16  DT  G C5    1 
ATOM   1134 C  C7    . DT  C 1 16 ? 35.078  78.720 17.731  1.00 46.81 ? 16  DT  G C7    1 
ATOM   1135 C  C6    . DT  C 1 16 ? 35.262  76.748 16.215  1.00 48.94 ? 16  DT  G C6    1 
ATOM   1136 P  P     . DT  C 1 17 ? 38.353  73.509 12.030  1.00 58.63 ? 17  DT  G P     1 
ATOM   1137 O  OP1   . DT  C 1 17 ? 38.814  72.227 11.397  1.00 55.23 ? 17  DT  G OP1   1 
ATOM   1138 O  OP2   . DT  C 1 17 ? 39.226  74.733 11.979  1.00 56.89 ? 17  DT  G OP2   1 
ATOM   1139 O  "O5'" . DT  C 1 17 ? 36.935  73.937 11.431  1.00 59.22 ? 17  DT  G "O5'" 1 
ATOM   1140 C  "C5'" . DT  C 1 17 ? 35.790  73.122 11.635  1.00 59.35 ? 17  DT  G "C5'" 1 
ATOM   1141 C  "C4'" . DT  C 1 17 ? 34.660  73.545 10.720  1.00 60.97 ? 17  DT  G "C4'" 1 
ATOM   1142 O  "O4'" . DT  C 1 17 ? 33.906  74.642 11.288  1.00 62.07 ? 17  DT  G "O4'" 1 
ATOM   1143 C  "C3'" . DT  C 1 17 ? 35.163  74.074 9.380   1.00 62.02 ? 17  DT  G "C3'" 1 
ATOM   1144 O  "O3'" . DT  C 1 17 ? 34.127  73.863 8.417   1.00 62.60 ? 17  DT  G "O3'" 1 
ATOM   1145 C  "C2'" . DT  C 1 17 ? 35.336  75.561 9.649   1.00 61.51 ? 17  DT  G "C2'" 1 
ATOM   1146 C  "C1'" . DT  C 1 17 ? 34.119  75.824 10.528  1.00 61.38 ? 17  DT  G "C1'" 1 
ATOM   1147 N  N1    . DT  C 1 17 ? 34.123  76.980 11.443  1.00 61.00 ? 17  DT  G N1    1 
ATOM   1148 C  C2    . DT  C 1 17 ? 32.932  77.638 11.591  1.00 60.66 ? 17  DT  G C2    1 
ATOM   1149 O  O2    . DT  C 1 17 ? 31.926  77.311 10.998  1.00 62.07 ? 17  DT  G O2    1 
ATOM   1150 N  N3    . DT  C 1 17 ? 32.956  78.689 12.454  1.00 60.31 ? 17  DT  G N3    1 
ATOM   1151 C  C4    . DT  C 1 17 ? 34.034  79.154 13.172  1.00 61.37 ? 17  DT  G C4    1 
ATOM   1152 O  O4    . DT  C 1 17 ? 33.889  80.126 13.936  1.00 62.62 ? 17  DT  G O4    1 
ATOM   1153 C  C5    . DT  C 1 17 ? 35.274  78.424 12.959  1.00 61.11 ? 17  DT  G C5    1 
ATOM   1154 C  C7    . DT  C 1 17 ? 36.512  78.861 13.678  1.00 59.48 ? 17  DT  G C7    1 
ATOM   1155 C  C6    . DT  C 1 17 ? 35.252  77.384 12.115  1.00 61.30 ? 17  DT  G C6    1 
ATOM   1156 P  P     . DA  C 1 18 ? 34.488  73.814 6.854   1.00 62.69 ? 18  DA  G P     1 
ATOM   1157 O  OP1   . DA  C 1 18 ? 34.671  72.376 6.507   1.00 62.04 ? 18  DA  G OP1   1 
ATOM   1158 O  OP2   . DA  C 1 18 ? 35.584  74.799 6.570   1.00 60.47 ? 18  DA  G OP2   1 
ATOM   1159 O  "O5'" . DA  C 1 18 ? 33.143  74.324 6.160   1.00 63.78 ? 18  DA  G "O5'" 1 
ATOM   1160 C  "C5'" . DA  C 1 18 ? 32.932  75.711 5.876   1.00 62.82 ? 18  DA  G "C5'" 1 
ATOM   1161 C  "C4'" . DA  C 1 18 ? 31.534  76.125 6.284   1.00 62.33 ? 18  DA  G "C4'" 1 
ATOM   1162 O  "O4'" . DA  C 1 18 ? 31.607  76.799 7.564   1.00 60.08 ? 18  DA  G "O4'" 1 
ATOM   1163 C  "C3'" . DA  C 1 18 ? 30.966  77.168 5.325   1.00 63.63 ? 18  DA  G "C3'" 1 
ATOM   1164 O  "O3'" . DA  C 1 18 ? 29.542  77.117 5.319   1.00 68.33 ? 18  DA  G "O3'" 1 
ATOM   1165 C  "C2'" . DA  C 1 18 ? 31.435  78.485 5.910   1.00 61.15 ? 18  DA  G "C2'" 1 
ATOM   1166 C  "C1'" . DA  C 1 18 ? 31.356  78.200 7.398   1.00 57.21 ? 18  DA  G "C1'" 1 
ATOM   1167 N  N9    . DA  C 1 18 ? 32.286  78.941 8.250   1.00 52.46 ? 18  DA  G N9    1 
ATOM   1168 C  C8    . DA  C 1 18 ? 33.625  78.717 8.456   1.00 50.68 ? 18  DA  G C8    1 
ATOM   1169 N  N7    . DA  C 1 18 ? 34.158  79.501 9.361   1.00 49.13 ? 18  DA  G N7    1 
ATOM   1170 C  C5    . DA  C 1 18 ? 33.104  80.315 9.759   1.00 48.55 ? 18  DA  G C5    1 
ATOM   1171 C  C6    . DA  C 1 18 ? 33.008  81.347 10.708  1.00 48.08 ? 18  DA  G C6    1 
ATOM   1172 N  N6    . DA  C 1 18 ? 34.028  81.755 11.465  1.00 48.80 ? 18  DA  G N6    1 
ATOM   1173 N  N1    . DA  C 1 18 ? 31.807  81.954 10.860  1.00 47.07 ? 18  DA  G N1    1 
ATOM   1174 C  C2    . DA  C 1 18 ? 30.781  81.541 10.110  1.00 45.20 ? 18  DA  G C2    1 
ATOM   1175 N  N3    . DA  C 1 18 ? 30.744  80.575 9.196   1.00 46.93 ? 18  DA  G N3    1 
ATOM   1176 C  C4    . DA  C 1 18 ? 31.953  79.996 9.067   1.00 49.60 ? 18  DA  G C4    1 
ATOM   1177 P  P     . DG  C 1 19 ? 28.728  77.924 4.182   1.00 73.77 ? 19  DG  G P     1 
ATOM   1178 O  OP1   . DG  C 1 19 ? 27.662  76.985 3.672   1.00 74.25 ? 19  DG  G OP1   1 
ATOM   1179 O  OP2   . DG  C 1 19 ? 29.729  78.502 3.224   1.00 73.86 ? 19  DG  G OP2   1 
ATOM   1180 O  "O5'" . DG  C 1 19 ? 28.032  79.151 4.944   1.00 75.52 ? 19  DG  G "O5'" 1 
ATOM   1181 C  "C5'" . DG  C 1 19 ? 26.837  78.937 5.720   1.00 80.04 ? 19  DG  G "C5'" 1 
ATOM   1182 C  "C4'" . DG  C 1 19 ? 26.146  80.250 6.038   1.00 81.14 ? 19  DG  G "C4'" 1 
ATOM   1183 O  "O4'" . DG  C 1 19 ? 27.037  81.072 6.821   1.00 80.72 ? 19  DG  G "O4'" 1 
ATOM   1184 C  "C3'" . DG  C 1 19 ? 25.824  81.079 4.799   1.00 83.03 ? 19  DG  G "C3'" 1 
ATOM   1185 O  "O3'" . DG  C 1 19 ? 24.734  81.962 5.113   1.00 86.63 ? 19  DG  G "O3'" 1 
ATOM   1186 C  "C2'" . DG  C 1 19 ? 27.100  81.881 4.596   1.00 81.58 ? 19  DG  G "C2'" 1 
ATOM   1187 C  "C1'" . DG  C 1 19 ? 27.527  82.157 6.035   1.00 79.26 ? 19  DG  G "C1'" 1 
ATOM   1188 N  N9    . DG  C 1 19 ? 28.968  82.248 6.265   1.00 77.85 ? 19  DG  G N9    1 
ATOM   1189 C  C8    . DG  C 1 19 ? 29.958  81.407 5.803   1.00 77.38 ? 19  DG  G C8    1 
ATOM   1190 N  N7    . DG  C 1 19 ? 31.150  81.748 6.218   1.00 76.65 ? 19  DG  G N7    1 
ATOM   1191 C  C5    . DG  C 1 19 ? 30.935  82.875 6.997   1.00 75.63 ? 19  DG  G C5    1 
ATOM   1192 C  C6    . DG  C 1 19 ? 31.849  83.685 7.730   1.00 74.93 ? 19  DG  G C6    1 
ATOM   1193 O  O6    . DG  C 1 19 ? 33.085  83.549 7.852   1.00 74.39 ? 19  DG  G O6    1 
ATOM   1194 N  N1    . DG  C 1 19 ? 31.197  84.736 8.367   1.00 73.61 ? 19  DG  G N1    1 
ATOM   1195 C  C2    . DG  C 1 19 ? 29.839  84.975 8.309   1.00 74.71 ? 19  DG  G C2    1 
ATOM   1196 N  N2    . DG  C 1 19 ? 29.371  86.048 8.984   1.00 75.12 ? 19  DG  G N2    1 
ATOM   1197 N  N3    . DG  C 1 19 ? 28.986  84.220 7.643   1.00 75.43 ? 19  DG  G N3    1 
ATOM   1198 C  C4    . DG  C 1 19 ? 29.593  83.201 7.018   1.00 76.05 ? 19  DG  G C4    1 
ATOM   1199 P  P     . DT  C 1 20 ? 23.365  81.907 4.252   1.00 89.02 ? 20  DT  G P     1 
ATOM   1200 O  OP1   . DT  C 1 20 ? 22.461  80.860 4.853   1.00 89.00 ? 20  DT  G OP1   1 
ATOM   1201 O  OP2   . DT  C 1 20 ? 23.748  81.831 2.798   1.00 89.61 ? 20  DT  G OP2   1 
ATOM   1202 O  "O5'" . DT  C 1 20 ? 22.684  83.324 4.524   1.00 89.44 ? 20  DT  G "O5'" 1 
ATOM   1203 C  "C5'" . DT  C 1 20 ? 21.986  83.575 5.742   1.00 89.91 ? 20  DT  G "C5'" 1 
ATOM   1204 C  "C4'" . DT  C 1 20 ? 21.961  85.057 6.035   1.00 90.70 ? 20  DT  G "C4'" 1 
ATOM   1205 O  "O4'" . DT  C 1 20 ? 23.305  85.507 6.339   1.00 91.03 ? 20  DT  G "O4'" 1 
ATOM   1206 C  "C3'" . DT  C 1 20 ? 21.538  85.872 4.811   1.00 91.08 ? 20  DT  G "C3'" 1 
ATOM   1207 O  "O3'" . DT  C 1 20 ? 21.056  87.153 5.298   1.00 91.77 ? 20  DT  G "O3'" 1 
ATOM   1208 C  "C2'" . DT  C 1 20 ? 22.858  86.113 4.095   1.00 90.84 ? 20  DT  G "C2'" 1 
ATOM   1209 C  "C1'" . DT  C 1 20 ? 23.788  86.329 5.279   1.00 91.29 ? 20  DT  G "C1'" 1 
ATOM   1210 N  N1    . DT  C 1 20 ? 25.235  86.061 5.082   1.00 91.91 ? 20  DT  G N1    1 
ATOM   1211 C  C2    . DT  C 1 20 ? 26.099  86.535 6.056   1.00 91.71 ? 20  DT  G C2    1 
ATOM   1212 O  O2    . DT  C 1 20 ? 25.707  87.109 7.078   1.00 91.61 ? 20  DT  G O2    1 
ATOM   1213 N  N3    . DT  C 1 20 ? 27.440  86.302 5.798   1.00 90.51 ? 20  DT  G N3    1 
ATOM   1214 C  C4    . DT  C 1 20 ? 27.981  85.646 4.705   1.00 89.61 ? 20  DT  G C4    1 
ATOM   1215 O  O4    . DT  C 1 20 ? 29.201  85.508 4.618   1.00 87.72 ? 20  DT  G O4    1 
ATOM   1216 C  C5    . DT  C 1 20 ? 27.015  85.161 3.735   1.00 90.16 ? 20  DT  G C5    1 
ATOM   1217 C  C7    . DT  C 1 20 ? 27.507  84.434 2.526   1.00 89.80 ? 20  DT  G C7    1 
ATOM   1218 C  C6    . DT  C 1 20 ? 25.709  85.389 3.968   1.00 91.44 ? 20  DT  G C6    1 
ATOM   1219 P  P     . DT  D 2 3  ? 28.985  90.133 15.730  1.00 82.05 ? 3   DT  H P     1 
ATOM   1220 O  OP1   . DT  D 2 3  ? 29.421  89.474 17.022  1.00 81.60 ? 3   DT  H OP1   1 
ATOM   1221 O  OP2   . DT  D 2 3  ? 28.141  91.386 15.766  1.00 82.14 ? 3   DT  H OP2   1 
ATOM   1222 O  "O5'" . DT  D 2 3  ? 28.199  89.040 14.871  1.00 81.94 ? 3   DT  H "O5'" 1 
ATOM   1223 C  "C5'" . DT  D 2 3  ? 27.353  88.081 15.516  1.00 82.49 ? 3   DT  H "C5'" 1 
ATOM   1224 C  "C4'" . DT  D 2 3  ? 26.804  87.099 14.508  1.00 82.05 ? 3   DT  H "C4'" 1 
ATOM   1225 O  "O4'" . DT  D 2 3  ? 27.900  86.573 13.716  1.00 81.36 ? 3   DT  H "O4'" 1 
ATOM   1226 C  "C3'" . DT  D 2 3  ? 26.163  85.891 15.200  1.00 82.02 ? 3   DT  H "C3'" 1 
ATOM   1227 O  "O3'" . DT  D 2 3  ? 25.250  85.219 14.299  1.00 84.25 ? 3   DT  H "O3'" 1 
ATOM   1228 C  "C2'" . DT  D 2 3  ? 27.360  84.969 15.379  1.00 81.68 ? 3   DT  H "C2'" 1 
ATOM   1229 C  "C1'" . DT  D 2 3  ? 28.100  85.212 14.058  1.00 80.50 ? 3   DT  H "C1'" 1 
ATOM   1230 N  N1    . DT  D 2 3  ? 29.545  84.898 13.969  1.00 78.63 ? 3   DT  H N1    1 
ATOM   1231 C  C2    . DT  D 2 3  ? 29.975  84.349 12.779  1.00 78.02 ? 3   DT  H C2    1 
ATOM   1232 O  O2    . DT  D 2 3  ? 29.223  84.142 11.832  1.00 78.02 ? 3   DT  H O2    1 
ATOM   1233 N  N3    . DT  D 2 3  ? 31.316  84.044 12.735  1.00 77.26 ? 3   DT  H N3    1 
ATOM   1234 C  C4    . DT  D 2 3  ? 32.250  84.228 13.740  1.00 77.29 ? 3   DT  H C4    1 
ATOM   1235 O  O4    . DT  D 2 3  ? 33.426  83.895 13.554  1.00 76.32 ? 3   DT  H O4    1 
ATOM   1236 C  C5    . DT  D 2 3  ? 31.730  84.816 14.962  1.00 77.30 ? 3   DT  H C5    1 
ATOM   1237 C  C7    . DT  D 2 3  ? 32.668  85.047 16.102  1.00 77.11 ? 3   DT  H C7    1 
ATOM   1238 C  C6    . DT  D 2 3  ? 30.420  85.123 15.011  1.00 78.12 ? 3   DT  H C6    1 
ATOM   1239 P  P     . DA  D 2 4  ? 24.086  86.044 13.511  1.00 85.34 ? 4   DA  H P     1 
ATOM   1240 O  OP1   . DA  D 2 4  ? 24.627  87.373 13.026  1.00 84.99 ? 4   DA  H OP1   1 
ATOM   1241 O  OP2   . DA  D 2 4  ? 22.840  86.003 14.366  1.00 84.78 ? 4   DA  H OP2   1 
ATOM   1242 O  "O5'" . DA  D 2 4  ? 23.838  85.159 12.201  1.00 83.60 ? 4   DA  H "O5'" 1 
ATOM   1243 C  "C5'" . DA  D 2 4  ? 24.941  84.496 11.590  1.00 80.85 ? 4   DA  H "C5'" 1 
ATOM   1244 C  "C4'" . DA  D 2 4  ? 24.549  83.117 11.123  1.00 78.58 ? 4   DA  H "C4'" 1 
ATOM   1245 O  "O4'" . DA  D 2 4  ? 25.741  82.293 11.225  1.00 77.97 ? 4   DA  H "O4'" 1 
ATOM   1246 C  "C3'" . DA  D 2 4  ? 23.514  82.430 12.027  1.00 77.03 ? 4   DA  H "C3'" 1 
ATOM   1247 O  "O3'" . DA  D 2 4  ? 22.750  81.463 11.277  1.00 73.88 ? 4   DA  H "O3'" 1 
ATOM   1248 C  "C2'" . DA  D 2 4  ? 24.361  81.760 13.091  1.00 76.53 ? 4   DA  H "C2'" 1 
ATOM   1249 C  "C1'" . DA  D 2 4  ? 25.607  81.354 12.306  1.00 76.40 ? 4   DA  H "C1'" 1 
ATOM   1250 N  N9    . DA  D 2 4  ? 26.826  81.387 13.125  1.00 73.95 ? 4   DA  H N9    1 
ATOM   1251 C  C8    . DA  D 2 4  ? 27.000  82.042 14.325  1.00 73.18 ? 4   DA  H C8    1 
ATOM   1252 N  N7    . DA  D 2 4  ? 28.172  81.831 14.878  1.00 72.08 ? 4   DA  H N7    1 
ATOM   1253 C  C5    . DA  D 2 4  ? 28.820  80.997 13.976  1.00 70.37 ? 4   DA  H C5    1 
ATOM   1254 C  C6    . DA  D 2 4  ? 30.093  80.402 13.988  1.00 69.37 ? 4   DA  H C6    1 
ATOM   1255 N  N6    . DA  D 2 4  ? 30.977  80.579 14.983  1.00 68.18 ? 4   DA  H N6    1 
ATOM   1256 N  N1    . DA  D 2 4  ? 30.428  79.612 12.939  1.00 68.92 ? 4   DA  H N1    1 
ATOM   1257 C  C2    . DA  D 2 4  ? 29.540  79.443 11.954  1.00 69.07 ? 4   DA  H C2    1 
ATOM   1258 N  N3    . DA  D 2 4  ? 28.314  79.954 11.827  1.00 69.75 ? 4   DA  H N3    1 
ATOM   1259 C  C4    . DA  D 2 4  ? 28.010  80.726 12.884  1.00 71.37 ? 4   DA  H C4    1 
ATOM   1260 P  P     . DA  D 2 5  ? 22.125  80.159 12.025  1.00 73.63 ? 5   DA  H P     1 
ATOM   1261 O  OP1   . DA  D 2 5  ? 20.801  79.801 11.372  1.00 71.92 ? 5   DA  H OP1   1 
ATOM   1262 O  OP2   . DA  D 2 5  ? 22.184  80.403 13.517  1.00 71.51 ? 5   DA  H OP2   1 
ATOM   1263 O  "O5'" . DA  D 2 5  ? 23.159  78.988 11.672  1.00 70.87 ? 5   DA  H "O5'" 1 
ATOM   1264 C  "C5'" . DA  D 2 5  ? 23.575  78.780 10.319  1.00 65.55 ? 5   DA  H "C5'" 1 
ATOM   1265 C  "C4'" . DA  D 2 5  ? 24.346  77.487 10.164  1.00 61.63 ? 5   DA  H "C4'" 1 
ATOM   1266 O  "O4'" . DA  D 2 5  ? 25.614  77.574 10.866  1.00 60.60 ? 5   DA  H "O4'" 1 
ATOM   1267 C  "C3'" . DA  D 2 5  ? 23.636  76.279 10.773  1.00 59.54 ? 5   DA  H "C3'" 1 
ATOM   1268 O  "O3'" . DA  D 2 5  ? 24.025  75.110 10.049  1.00 57.82 ? 5   DA  H "O3'" 1 
ATOM   1269 C  "C2'" . DA  D 2 5  ? 24.156  76.260 12.203  1.00 58.49 ? 5   DA  H "C2'" 1 
ATOM   1270 C  "C1'" . DA  D 2 5  ? 25.602  76.706 12.000  1.00 57.82 ? 5   DA  H "C1'" 1 
ATOM   1271 N  N9    . DA  D 2 5  ? 26.279  77.381 13.117  1.00 54.46 ? 5   DA  H N9    1 
ATOM   1272 C  C8    . DA  D 2 5  ? 25.826  78.397 13.928  1.00 53.42 ? 5   DA  H C8    1 
ATOM   1273 N  N7    . DA  D 2 5  ? 26.705  78.783 14.828  1.00 51.31 ? 5   DA  H N7    1 
ATOM   1274 C  C5    . DA  D 2 5  ? 27.807  77.965 14.594  1.00 50.12 ? 5   DA  H C5    1 
ATOM   1275 C  C6    . DA  D 2 5  ? 29.078  77.879 15.204  1.00 48.77 ? 5   DA  H C6    1 
ATOM   1276 N  N6    . DA  D 2 5  ? 29.468  78.650 16.221  1.00 46.25 ? 5   DA  H N6    1 
ATOM   1277 N  N1    . DA  D 2 5  ? 29.948  76.958 14.725  1.00 48.01 ? 5   DA  H N1    1 
ATOM   1278 C  C2    . DA  D 2 5  ? 29.558  76.175 13.709  1.00 49.65 ? 5   DA  H C2    1 
ATOM   1279 N  N3    . DA  D 2 5  ? 28.394  76.158 13.057  1.00 51.01 ? 5   DA  H N3    1 
ATOM   1280 C  C4    . DA  D 2 5  ? 27.555  77.092 13.549  1.00 51.85 ? 5   DA  H C4    1 
ATOM   1281 P  P     . DT  D 2 6  ? 23.529  73.663 10.541  1.00 57.16 ? 6   DT  H P     1 
ATOM   1282 O  OP1   . DT  D 2 6  ? 22.781  72.984 9.435   1.00 54.70 ? 6   DT  H OP1   1 
ATOM   1283 O  OP2   . DT  D 2 6  ? 22.887  73.870 11.873  1.00 54.05 ? 6   DT  H OP2   1 
ATOM   1284 O  "O5'" . DT  D 2 6  ? 24.889  72.876 10.781  1.00 54.84 ? 6   DT  H "O5'" 1 
ATOM   1285 C  "C5'" . DT  D 2 6  ? 25.904  73.432 11.611  1.00 50.28 ? 6   DT  H "C5'" 1 
ATOM   1286 C  "C4'" . DT  D 2 6  ? 27.190  72.656 11.445  1.00 48.28 ? 6   DT  H "C4'" 1 
ATOM   1287 O  "O4'" . DT  D 2 6  ? 28.188  73.253 12.295  1.00 47.96 ? 6   DT  H "O4'" 1 
ATOM   1288 C  "C3'" . DT  D 2 6  ? 27.095  71.210 11.905  1.00 47.45 ? 6   DT  H "C3'" 1 
ATOM   1289 O  "O3'" . DT  D 2 6  ? 28.038  70.422 11.181  1.00 47.35 ? 6   DT  H "O3'" 1 
ATOM   1290 C  "C2'" . DT  D 2 6  ? 27.429  71.304 13.379  1.00 46.82 ? 6   DT  H "C2'" 1 
ATOM   1291 C  "C1'" . DT  D 2 6  ? 28.442  72.436 13.428  1.00 46.71 ? 6   DT  H "C1'" 1 
ATOM   1292 N  N1    . DT  D 2 6  ? 28.313  73.301 14.621  1.00 45.28 ? 6   DT  H N1    1 
ATOM   1293 C  C2    . DT  D 2 6  ? 29.423  73.494 15.410  1.00 44.48 ? 6   DT  H C2    1 
ATOM   1294 O  O2    . DT  D 2 6  ? 30.496  72.971 15.171  1.00 45.56 ? 6   DT  H O2    1 
ATOM   1295 N  N3    . DT  D 2 6  ? 29.230  74.327 16.488  1.00 42.99 ? 6   DT  H N3    1 
ATOM   1296 C  C4    . DT  D 2 6  ? 28.060  74.983 16.837  1.00 44.61 ? 6   DT  H C4    1 
ATOM   1297 O  O4    . DT  D 2 6  ? 28.039  75.722 17.822  1.00 44.38 ? 6   DT  H O4    1 
ATOM   1298 C  C5    . DT  D 2 6  ? 26.924  74.727 15.965  1.00 44.84 ? 6   DT  H C5    1 
ATOM   1299 C  C7    . DT  D 2 6  ? 25.609  75.381 16.261  1.00 43.48 ? 6   DT  H C7    1 
ATOM   1300 C  C6    . DT  D 2 6  ? 27.109  73.909 14.917  1.00 44.95 ? 6   DT  H C6    1 
ATOM   1301 P  P     . DA  D 2 7  ? 28.251  68.868 11.552  1.00 48.98 ? 7   DA  H P     1 
ATOM   1302 O  OP1   . DA  D 2 7  ? 28.587  68.164 10.268  1.00 47.13 ? 7   DA  H OP1   1 
ATOM   1303 O  OP2   . DA  D 2 7  ? 27.084  68.423 12.367  1.00 47.96 ? 7   DA  H OP2   1 
ATOM   1304 O  "O5'" . DA  D 2 7  ? 29.558  68.870 12.471  1.00 46.33 ? 7   DA  H "O5'" 1 
ATOM   1305 C  "C5'" . DA  D 2 7  ? 30.733  69.540 12.011  1.00 43.67 ? 7   DA  H "C5'" 1 
ATOM   1306 C  "C4'" . DA  D 2 7  ? 31.928  69.214 12.875  1.00 40.22 ? 7   DA  H "C4'" 1 
ATOM   1307 O  "O4'" . DA  D 2 7  ? 31.870  69.916 14.138  1.00 39.15 ? 7   DA  H "O4'" 1 
ATOM   1308 C  "C3'" . DA  D 2 7  ? 32.045  67.750 13.254  1.00 38.38 ? 7   DA  H "C3'" 1 
ATOM   1309 O  "O3'" . DA  D 2 7  ? 33.437  67.496 13.433  1.00 38.32 ? 7   DA  H "O3'" 1 
ATOM   1310 C  "C2'" . DA  D 2 7  ? 31.238  67.683 14.546  1.00 36.19 ? 7   DA  H "C2'" 1 
ATOM   1311 C  "C1'" . DA  D 2 7  ? 31.572  69.015 15.199  1.00 33.91 ? 7   DA  H "C1'" 1 
ATOM   1312 N  N9    . DA  D 2 7  ? 30.563  69.665 16.035  1.00 30.31 ? 7   DA  H N9    1 
ATOM   1313 C  C8    . DA  D 2 7  ? 29.215  69.734 15.846  1.00 28.99 ? 7   DA  H C8    1 
ATOM   1314 N  N7    . DA  D 2 7  ? 28.604  70.520 16.705  1.00 28.07 ? 7   DA  H N7    1 
ATOM   1315 C  C5    . DA  D 2 7  ? 29.624  70.974 17.531  1.00 26.91 ? 7   DA  H C5    1 
ATOM   1316 C  C6    . DA  D 2 7  ? 29.644  71.861 18.633  1.00 26.07 ? 7   DA  H C6    1 
ATOM   1317 N  N6    . DA  D 2 7  ? 28.576  72.501 19.104  1.00 25.53 ? 7   DA  H N6    1 
ATOM   1318 N  N1    . DA  D 2 7  ? 30.823  72.084 19.238  1.00 26.85 ? 7   DA  H N1    1 
ATOM   1319 C  C2    . DA  D 2 7  ? 31.901  71.471 18.761  1.00 28.58 ? 7   DA  H C2    1 
ATOM   1320 N  N3    . DA  D 2 7  ? 32.015  70.638 17.731  1.00 27.53 ? 7   DA  H N3    1 
ATOM   1321 C  C4    . DA  D 2 7  ? 30.828  70.428 17.151  1.00 28.08 ? 7   DA  H C4    1 
ATOM   1322 P  P     . DG  D 2 8  ? 33.953  66.006 13.707  1.00 43.38 ? 8   DG  H P     1 
ATOM   1323 O  OP1   . DG  D 2 8  ? 35.185  65.763 12.911  1.00 44.21 ? 8   DG  H OP1   1 
ATOM   1324 O  OP2   . DG  D 2 8  ? 32.774  65.095 13.536  1.00 43.33 ? 8   DG  H OP2   1 
ATOM   1325 O  "O5'" . DG  D 2 8  ? 34.372  66.068 15.244  1.00 41.47 ? 8   DG  H "O5'" 1 
ATOM   1326 C  "C5'" . DG  D 2 8  ? 33.546  66.776 16.157  1.00 40.56 ? 8   DG  H "C5'" 1 
ATOM   1327 C  "C4'" . DG  D 2 8  ? 34.203  66.901 17.508  1.00 39.44 ? 8   DG  H "C4'" 1 
ATOM   1328 O  "O4'" . DG  D 2 8  ? 33.407  67.824 18.288  1.00 37.54 ? 8   DG  H "O4'" 1 
ATOM   1329 C  "C3'" . DG  D 2 8  ? 34.216  65.594 18.301  1.00 40.46 ? 8   DG  H "C3'" 1 
ATOM   1330 O  "O3'" . DG  D 2 8  ? 35.326  65.646 19.216  1.00 44.17 ? 8   DG  H "O3'" 1 
ATOM   1331 C  "C2'" . DG  D 2 8  ? 32.874  65.637 19.009  1.00 37.52 ? 8   DG  H "C2'" 1 
ATOM   1332 C  "C1'" . DG  D 2 8  ? 32.722  67.122 19.310  1.00 33.53 ? 8   DG  H "C1'" 1 
ATOM   1333 N  N9    . DG  D 2 8  ? 31.365  67.649 19.402  1.00 28.80 ? 8   DG  H N9    1 
ATOM   1334 C  C8    . DG  D 2 8  ? 30.282  67.364 18.606  1.00 25.18 ? 8   DG  H C8    1 
ATOM   1335 N  N7    . DG  D 2 8  ? 29.202  68.004 18.968  1.00 22.58 ? 8   DG  H N7    1 
ATOM   1336 C  C5    . DG  D 2 8  ? 29.600  68.754 20.068  1.00 26.62 ? 8   DG  H C5    1 
ATOM   1337 C  C6    . DG  D 2 8  ? 28.876  69.655 20.899  1.00 27.22 ? 8   DG  H C6    1 
ATOM   1338 O  O6    . DG  D 2 8  ? 27.685  69.982 20.836  1.00 27.45 ? 8   DG  H O6    1 
ATOM   1339 N  N1    . DG  D 2 8  ? 29.681  70.198 21.893  1.00 25.19 ? 8   DG  H N1    1 
ATOM   1340 C  C2    . DG  D 2 8  ? 31.008  69.911 22.079  1.00 28.85 ? 8   DG  H C2    1 
ATOM   1341 N  N2    . DG  D 2 8  ? 31.621  70.519 23.101  1.00 30.67 ? 8   DG  H N2    1 
ATOM   1342 N  N3    . DG  D 2 8  ? 31.693  69.080 21.318  1.00 29.70 ? 8   DG  H N3    1 
ATOM   1343 C  C4    . DG  D 2 8  ? 30.935  68.541 20.341  1.00 28.29 ? 8   DG  H C4    1 
ATOM   1344 P  P     . DC  D 2 9  ? 35.527  64.510 20.345  1.00 47.85 ? 9   DC  H P     1 
ATOM   1345 O  OP1   . DC  D 2 9  ? 36.554  63.556 19.855  1.00 44.36 ? 9   DC  H OP1   1 
ATOM   1346 O  OP2   . DC  D 2 9  ? 34.209  63.996 20.786  1.00 45.63 ? 9   DC  H OP2   1 
ATOM   1347 O  "O5'" . DC  D 2 9  ? 36.139  65.361 21.546  1.00 46.89 ? 9   DC  H "O5'" 1 
ATOM   1348 C  "C5'" . DC  D 2 9  ? 36.809  66.585 21.257  1.00 48.27 ? 9   DC  H "C5'" 1 
ATOM   1349 C  "C4'" . DC  D 2 9  ? 36.789  67.519 22.443  1.00 49.56 ? 9   DC  H "C4'" 1 
ATOM   1350 O  "O4'" . DC  D 2 9  ? 35.448  68.023 22.693  1.00 49.21 ? 9   DC  H "O4'" 1 
ATOM   1351 C  "C3'" . DC  D 2 9  ? 37.199  66.825 23.736  1.00 50.42 ? 9   DC  H "C3'" 1 
ATOM   1352 O  "O3'" . DC  D 2 9  ? 37.834  67.777 24.599  1.00 53.36 ? 9   DC  H "O3'" 1 
ATOM   1353 C  "C2'" . DC  D 2 9  ? 35.872  66.324 24.283  1.00 48.16 ? 9   DC  H "C2'" 1 
ATOM   1354 C  "C1'" . DC  D 2 9  ? 34.924  67.456 23.896  1.00 46.21 ? 9   DC  H "C1'" 1 
ATOM   1355 N  N1    . DC  D 2 9  ? 33.519  67.067 23.651  1.00 43.29 ? 9   DC  H N1    1 
ATOM   1356 C  C2    . DC  D 2 9  ? 32.496  67.733 24.354  1.00 41.08 ? 9   DC  H C2    1 
ATOM   1357 O  O2    . DC  D 2 9  ? 32.794  68.597 25.178  1.00 40.75 ? 9   DC  H O2    1 
ATOM   1358 N  N3    . DC  D 2 9  ? 31.209  67.413 24.109  1.00 39.63 ? 9   DC  H N3    1 
ATOM   1359 C  C4    . DC  D 2 9  ? 30.913  66.477 23.206  1.00 38.79 ? 9   DC  H C4    1 
ATOM   1360 N  N4    . DC  D 2 9  ? 29.632  66.222 22.985  1.00 39.67 ? 9   DC  H N4    1 
ATOM   1361 C  C5    . DC  D 2 9  ? 31.923  65.771 22.492  1.00 38.96 ? 9   DC  H C5    1 
ATOM   1362 C  C6    . DC  D 2 9  ? 33.204  66.092 22.746  1.00 41.29 ? 9   DC  H C6    1 
ATOM   1363 P  P     . DG  D 2 10 ? 38.782  67.271 25.796  1.00 55.60 ? 10  DG  H P     1 
ATOM   1364 O  OP1   . DG  D 2 10 ? 39.560  68.463 26.251  1.00 56.21 ? 10  DG  H OP1   1 
ATOM   1365 O  OP2   . DG  D 2 10 ? 39.494  66.025 25.366  1.00 52.76 ? 10  DG  H OP2   1 
ATOM   1366 O  "O5'" . DG  D 2 10 ? 37.755  66.892 26.956  1.00 56.34 ? 10  DG  H "O5'" 1 
ATOM   1367 C  "C5'" . DG  D 2 10 ? 36.894  67.890 27.504  1.00 56.63 ? 10  DG  H "C5'" 1 
ATOM   1368 C  "C4'" . DG  D 2 10 ? 36.150  67.355 28.708  1.00 57.43 ? 10  DG  H "C4'" 1 
ATOM   1369 O  "O4'" . DG  D 2 10 ? 34.887  66.769 28.305  1.00 55.32 ? 10  DG  H "O4'" 1 
ATOM   1370 C  "C3'" . DG  D 2 10 ? 36.909  66.220 29.402  1.00 58.34 ? 10  DG  H "C3'" 1 
ATOM   1371 O  "O3'" . DG  D 2 10 ? 36.513  66.182 30.775  1.00 62.90 ? 10  DG  H "O3'" 1 
ATOM   1372 C  "C2'" . DG  D 2 10 ? 36.386  64.980 28.697  1.00 54.89 ? 10  DG  H "C2'" 1 
ATOM   1373 C  "C1'" . DG  D 2 10 ? 34.924  65.360 28.505  1.00 51.44 ? 10  DG  H "C1'" 1 
ATOM   1374 N  N9    . DG  D 2 10 ? 34.157  64.714 27.442  1.00 46.72 ? 10  DG  H N9    1 
ATOM   1375 C  C8    . DG  D 2 10 ? 34.589  63.802 26.506  1.00 45.28 ? 10  DG  H C8    1 
ATOM   1376 N  N7    . DG  D 2 10 ? 33.632  63.391 25.715  1.00 43.32 ? 10  DG  H N7    1 
ATOM   1377 C  C5    . DG  D 2 10 ? 32.508  64.084 26.143  1.00 41.25 ? 10  DG  H C5    1 
ATOM   1378 C  C6    . DG  D 2 10 ? 31.170  64.070 25.662  1.00 40.24 ? 10  DG  H C6    1 
ATOM   1379 O  O6    . DG  D 2 10 ? 30.691  63.417 24.728  1.00 38.74 ? 10  DG  H O6    1 
ATOM   1380 N  N1    . DG  D 2 10 ? 30.358  64.928 26.389  1.00 40.25 ? 10  DG  H N1    1 
ATOM   1381 C  C2    . DG  D 2 10 ? 30.771  65.698 27.446  1.00 42.05 ? 10  DG  H C2    1 
ATOM   1382 N  N2    . DG  D 2 10 ? 29.839  66.476 28.025  1.00 42.98 ? 10  DG  H N2    1 
ATOM   1383 N  N3    . DG  D 2 10 ? 32.005  65.719 27.902  1.00 42.44 ? 10  DG  H N3    1 
ATOM   1384 C  C4    . DG  D 2 10 ? 32.816  64.899 27.209  1.00 43.15 ? 10  DG  H C4    1 
ATOM   1385 P  P     . DA  D 2 11 ? 37.576  65.785 31.918  1.00 65.41 ? 11  DA  H P     1 
ATOM   1386 O  OP1   . DA  D 2 11 ? 38.785  66.660 31.748  1.00 65.32 ? 11  DA  H OP1   1 
ATOM   1387 O  OP2   . DA  D 2 11 ? 37.732  64.295 31.909  1.00 64.90 ? 11  DA  H OP2   1 
ATOM   1388 O  "O5'" . DA  D 2 11 ? 36.799  66.228 33.236  1.00 65.58 ? 11  DA  H "O5'" 1 
ATOM   1389 C  "C5'" . DA  D 2 11 ? 36.130  67.484 33.271  1.00 67.48 ? 11  DA  H "C5'" 1 
ATOM   1390 C  "C4'" . DA  D 2 11 ? 34.772  67.335 33.912  1.00 69.50 ? 11  DA  H "C4'" 1 
ATOM   1391 O  "O4'" . DA  D 2 11 ? 33.883  66.630 33.010  1.00 70.75 ? 11  DA  H "O4'" 1 
ATOM   1392 C  "C3'" . DA  D 2 11 ? 34.839  66.457 35.157  1.00 71.50 ? 11  DA  H "C3'" 1 
ATOM   1393 O  "O3'" . DA  D 2 11 ? 33.813  66.823 36.063  1.00 72.98 ? 11  DA  H "O3'" 1 
ATOM   1394 C  "C2'" . DA  D 2 11 ? 34.611  65.051 34.629  1.00 71.10 ? 11  DA  H "C2'" 1 
ATOM   1395 C  "C1'" . DA  D 2 11 ? 33.603  65.310 33.511  1.00 70.39 ? 11  DA  H "C1'" 1 
ATOM   1396 N  N9    . DA  D 2 11 ? 33.658  64.362 32.388  1.00 68.45 ? 11  DA  H N9    1 
ATOM   1397 C  C8    . DA  D 2 11 ? 34.768  63.742 31.860  1.00 67.48 ? 11  DA  H C8    1 
ATOM   1398 N  N7    . DA  D 2 11 ? 34.504  62.957 30.839  1.00 67.12 ? 11  DA  H N7    1 
ATOM   1399 C  C5    . DA  D 2 11 ? 33.126  63.063 30.685  1.00 66.41 ? 11  DA  H C5    1 
ATOM   1400 C  C6    . DA  D 2 11 ? 32.223  62.466 29.769  1.00 65.08 ? 11  DA  H C6    1 
ATOM   1401 N  N6    . DA  D 2 11 ? 32.597  61.616 28.810  1.00 62.89 ? 11  DA  H N6    1 
ATOM   1402 N  N1    . DA  D 2 11 ? 30.914  62.780 29.884  1.00 65.21 ? 11  DA  H N1    1 
ATOM   1403 C  C2    . DA  D 2 11 ? 30.543  63.633 30.866  1.00 65.95 ? 11  DA  H C2    1 
ATOM   1404 N  N3    . DA  D 2 11 ? 31.297  64.252 31.787  1.00 65.45 ? 11  DA  H N3    1 
ATOM   1405 C  C4    . DA  D 2 11 ? 32.589  63.922 31.638  1.00 66.67 ? 11  DA  H C4    1 
ATOM   1406 P  P     . DT  D 2 12 ? 33.522  65.881 37.333  1.00 75.95 ? 12  DT  H P     1 
ATOM   1407 O  OP1   . DT  D 2 12 ? 32.844  66.748 38.381  1.00 74.95 ? 12  DT  H OP1   1 
ATOM   1408 O  OP2   . DT  D 2 12 ? 34.818  65.152 37.651  1.00 74.18 ? 12  DT  H OP2   1 
ATOM   1409 O  "O5'" . DT  D 2 12 ? 32.471  64.807 36.775  1.00 74.27 ? 12  DT  H "O5'" 1 
ATOM   1410 C  "C5'" . DT  D 2 12 ? 31.200  65.239 36.290  1.00 71.94 ? 12  DT  H "C5'" 1 
ATOM   1411 C  "C4'" . DT  D 2 12 ? 30.219  64.092 36.207  1.00 70.58 ? 12  DT  H "C4'" 1 
ATOM   1412 O  "O4'" . DT  D 2 12 ? 30.519  63.248 35.067  1.00 69.17 ? 12  DT  H "O4'" 1 
ATOM   1413 C  "C3'" . DT  D 2 12 ? 30.318  63.169 37.419  1.00 70.59 ? 12  DT  H "C3'" 1 
ATOM   1414 O  "O3'" . DT  D 2 12 ? 29.066  62.521 37.591  1.00 73.28 ? 12  DT  H "O3'" 1 
ATOM   1415 C  "C2'" . DT  D 2 12 ? 31.355  62.145 36.987  1.00 69.00 ? 12  DT  H "C2'" 1 
ATOM   1416 C  "C1'" . DT  D 2 12 ? 30.974  61.980 35.526  1.00 67.80 ? 12  DT  H "C1'" 1 
ATOM   1417 N  N1    . DT  D 2 12 ? 31.945  61.410 34.555  1.00 65.97 ? 12  DT  H N1    1 
ATOM   1418 C  C2    . DT  D 2 12 ? 31.451  61.099 33.299  1.00 65.20 ? 12  DT  H C2    1 
ATOM   1419 O  O2    . DT  D 2 12 ? 30.294  61.304 32.961  1.00 65.14 ? 12  DT  H O2    1 
ATOM   1420 N  N3    . DT  D 2 12 ? 32.358  60.529 32.450  1.00 64.07 ? 12  DT  H N3    1 
ATOM   1421 C  C4    . DT  D 2 12 ? 33.680  60.244 32.717  1.00 63.64 ? 12  DT  H C4    1 
ATOM   1422 O  O4    . DT  D 2 12 ? 34.374  59.709 31.852  1.00 63.45 ? 12  DT  H O4    1 
ATOM   1423 C  C5    . DT  D 2 12 ? 34.140  60.608 34.042  1.00 62.75 ? 12  DT  H C5    1 
ATOM   1424 C  C7    . DT  D 2 12 ? 35.561  60.335 34.408  1.00 62.95 ? 12  DT  H C7    1 
ATOM   1425 C  C6    . DT  D 2 12 ? 33.266  61.174 34.883  1.00 63.65 ? 12  DT  H C6    1 
ATOM   1426 P  P     . DA  D 2 13 ? 28.064  63.015 38.750  1.00 75.94 ? 13  DA  H P     1 
ATOM   1427 O  OP1   . DA  D 2 13 ? 28.126  64.516 38.841  1.00 76.32 ? 13  DA  H OP1   1 
ATOM   1428 O  OP2   . DA  D 2 13 ? 28.308  62.166 39.979  1.00 76.34 ? 13  DA  H OP2   1 
ATOM   1429 O  "O5'" . DA  D 2 13 ? 26.624  62.654 38.168  1.00 76.08 ? 13  DA  H "O5'" 1 
ATOM   1430 C  "C5'" . DA  D 2 13 ? 26.060  63.416 37.107  1.00 74.30 ? 13  DA  H "C5'" 1 
ATOM   1431 C  "C4'" . DA  D 2 13 ? 25.368  62.512 36.109  1.00 72.30 ? 13  DA  H "C4'" 1 
ATOM   1432 O  "O4'" . DA  D 2 13 ? 26.346  61.685 35.436  1.00 71.49 ? 13  DA  H "O4'" 1 
ATOM   1433 C  "C3'" . DA  D 2 13 ? 24.425  61.532 36.802  1.00 70.88 ? 13  DA  H "C3'" 1 
ATOM   1434 O  "O3'" . DA  D 2 13 ? 23.361  61.175 35.912  1.00 70.12 ? 13  DA  H "O3'" 1 
ATOM   1435 C  "C2'" . DA  D 2 13 ? 25.325  60.345 37.081  1.00 71.15 ? 13  DA  H "C2'" 1 
ATOM   1436 C  "C1'" . DA  D 2 13 ? 26.183  60.336 35.830  1.00 71.38 ? 13  DA  H "C1'" 1 
ATOM   1437 N  N9    . DA  D 2 13 ? 27.505  59.722 35.942  1.00 72.06 ? 13  DA  H N9    1 
ATOM   1438 C  C8    . DA  D 2 13 ? 28.409  59.821 36.972  1.00 73.51 ? 13  DA  H C8    1 
ATOM   1439 N  N7    . DA  D 2 13 ? 29.506  59.115 36.788  1.00 74.17 ? 13  DA  H N7    1 
ATOM   1440 C  C5    . DA  D 2 13 ? 29.315  58.517 35.546  1.00 73.70 ? 13  DA  H C5    1 
ATOM   1441 C  C6    . DA  D 2 13 ? 30.117  57.641 34.780  1.00 73.45 ? 13  DA  H C6    1 
ATOM   1442 N  N6    . DA  D 2 13 ? 31.313  57.213 35.181  1.00 73.89 ? 13  DA  H N6    1 
ATOM   1443 N  N1    . DA  D 2 13 ? 29.634  57.222 33.581  1.00 72.81 ? 13  DA  H N1    1 
ATOM   1444 C  C2    . DA  D 2 13 ? 28.422  57.663 33.190  1.00 72.57 ? 13  DA  H C2    1 
ATOM   1445 N  N3    . DA  D 2 13 ? 27.574  58.492 33.825  1.00 73.00 ? 13  DA  H N3    1 
ATOM   1446 C  C4    . DA  D 2 13 ? 28.087  58.888 35.008  1.00 73.26 ? 13  DA  H C4    1 
ATOM   1447 P  P     . DA  D 2 14 ? 22.086  60.365 36.475  1.00 68.75 ? 14  DA  H P     1 
ATOM   1448 O  OP1   . DA  D 2 14 ? 20.834  60.924 35.868  1.00 68.14 ? 14  DA  H OP1   1 
ATOM   1449 O  OP2   . DA  D 2 14 ? 22.231  60.329 37.968  1.00 71.42 ? 14  DA  H OP2   1 
ATOM   1450 O  "O5'" . DA  D 2 14 ? 22.288  58.881 35.934  1.00 65.41 ? 14  DA  H "O5'" 1 
ATOM   1451 C  "C5'" . DA  D 2 14 ? 23.576  58.370 35.651  1.00 63.22 ? 14  DA  H "C5'" 1 
ATOM   1452 C  "C4'" . DA  D 2 14 ? 23.438  57.218 34.695  1.00 63.94 ? 14  DA  H "C4'" 1 
ATOM   1453 O  "O4'" . DA  D 2 14 ? 24.748  56.632 34.494  1.00 64.78 ? 14  DA  H "O4'" 1 
ATOM   1454 C  "C3'" . DA  D 2 14 ? 22.590  56.122 35.330  1.00 63.98 ? 14  DA  H "C3'" 1 
ATOM   1455 O  "O3'" . DA  D 2 14 ? 21.823  55.426 34.349  1.00 63.60 ? 14  DA  H "O3'" 1 
ATOM   1456 C  "C2'" . DA  D 2 14 ? 23.612  55.259 36.042  1.00 65.59 ? 14  DA  H "C2'" 1 
ATOM   1457 C  "C1'" . DA  D 2 14 ? 24.818  55.355 35.117  1.00 66.23 ? 14  DA  H "C1'" 1 
ATOM   1458 N  N9    . DA  D 2 14 ? 26.112  55.247 35.796  1.00 68.16 ? 14  DA  H N9    1 
ATOM   1459 C  C8    . DA  D 2 14 ? 26.383  55.497 37.116  1.00 69.14 ? 14  DA  H C8    1 
ATOM   1460 N  N7    . DA  D 2 14 ? 27.633  55.283 37.451  1.00 69.97 ? 14  DA  H N7    1 
ATOM   1461 C  C5    . DA  D 2 14 ? 28.232  54.872 36.268  1.00 69.72 ? 14  DA  H C5    1 
ATOM   1462 C  C6    . DA  D 2 14 ? 29.555  54.481 35.957  1.00 70.14 ? 14  DA  H C6    1 
ATOM   1463 N  N6    . DA  D 2 14 ? 30.549  54.432 36.860  1.00 69.94 ? 14  DA  H N6    1 
ATOM   1464 N  N1    . DA  D 2 14 ? 29.821  54.125 34.678  1.00 70.17 ? 14  DA  H N1    1 
ATOM   1465 C  C2    . DA  D 2 14 ? 28.820  54.152 33.788  1.00 70.60 ? 14  DA  H C2    1 
ATOM   1466 N  N3    . DA  D 2 14 ? 27.538  54.491 33.962  1.00 70.34 ? 14  DA  H N3    1 
ATOM   1467 C  C4    . DA  D 2 14 ? 27.308  54.849 35.238  1.00 69.38 ? 14  DA  H C4    1 
ATOM   1468 P  P     . DT  D 2 15 ? 21.327  53.927 34.649  1.00 62.09 ? 15  DT  H P     1 
ATOM   1469 O  OP1   . DT  D 2 15 ? 20.154  53.628 33.777  1.00 62.00 ? 15  DT  H OP1   1 
ATOM   1470 O  OP2   . DT  D 2 15 ? 21.193  53.775 36.129  1.00 61.08 ? 15  DT  H OP2   1 
ATOM   1471 O  "O5'" . DT  D 2 15 ? 22.569  53.066 34.148  1.00 60.76 ? 15  DT  H "O5'" 1 
ATOM   1472 C  "C5'" . DT  D 2 15 ? 22.372  51.853 33.451  1.00 59.51 ? 15  DT  H "C5'" 1 
ATOM   1473 C  "C4'" . DT  D 2 15 ? 23.308  51.780 32.276  1.00 58.84 ? 15  DT  H "C4'" 1 
ATOM   1474 O  "O4'" . DT  D 2 15 ? 24.629  52.172 32.725  1.00 61.54 ? 15  DT  H "O4'" 1 
ATOM   1475 C  "C3'" . DT  D 2 15 ? 23.459  50.341 31.798  1.00 57.43 ? 15  DT  H "C3'" 1 
ATOM   1476 O  "O3'" . DT  D 2 15 ? 23.791  50.272 30.424  1.00 52.82 ? 15  DT  H "O3'" 1 
ATOM   1477 C  "C2'" . DT  D 2 15 ? 24.596  49.805 32.638  1.00 60.08 ? 15  DT  H "C2'" 1 
ATOM   1478 C  "C1'" . DT  D 2 15 ? 25.493  51.026 32.767  1.00 63.57 ? 15  DT  H "C1'" 1 
ATOM   1479 N  N1    . DT  D 2 15 ? 26.263  51.055 34.032  1.00 65.67 ? 15  DT  H N1    1 
ATOM   1480 C  C2    . DT  D 2 15 ? 27.526  50.461 34.051  1.00 66.60 ? 15  DT  H C2    1 
ATOM   1481 O  O2    . DT  D 2 15 ? 28.033  49.919 33.064  1.00 64.07 ? 15  DT  H O2    1 
ATOM   1482 N  N3    . DT  D 2 15 ? 28.172  50.521 35.274  1.00 68.07 ? 15  DT  H N3    1 
ATOM   1483 C  C4    . DT  D 2 15 ? 27.687  51.086 36.443  1.00 68.93 ? 15  DT  H C4    1 
ATOM   1484 O  O4    . DT  D 2 15 ? 28.366  51.034 37.466  1.00 70.37 ? 15  DT  H O4    1 
ATOM   1485 C  C5    . DT  D 2 15 ? 26.351  51.699 36.344  1.00 68.46 ? 15  DT  H C5    1 
ATOM   1486 C  C7    . DT  D 2 15 ? 25.744  52.342 37.553  1.00 67.53 ? 15  DT  H C7    1 
ATOM   1487 C  C6    . DT  D 2 15 ? 25.724  51.651 35.159  1.00 66.98 ? 15  DT  H C6    1 
ATOM   1488 P  P     . DA  D 2 16 ? 24.000  48.834 29.757  1.00 51.96 ? 16  DA  H P     1 
ATOM   1489 O  OP1   . DA  D 2 16 ? 24.036  48.982 28.279  1.00 53.70 ? 16  DA  H OP1   1 
ATOM   1490 O  OP2   . DA  D 2 16 ? 22.970  47.950 30.388  1.00 52.60 ? 16  DA  H OP2   1 
ATOM   1491 O  "O5'" . DA  D 2 16 ? 25.450  48.378 30.254  1.00 51.85 ? 16  DA  H "O5'" 1 
ATOM   1492 C  "C5'" . DA  D 2 16 ? 26.620  48.970 29.711  1.00 49.70 ? 16  DA  H "C5'" 1 
ATOM   1493 C  "C4'" . DA  D 2 16 ? 27.789  48.012 29.741  1.00 50.50 ? 16  DA  H "C4'" 1 
ATOM   1494 O  "O4'" . DA  D 2 16 ? 28.291  47.888 31.085  1.00 52.88 ? 16  DA  H "O4'" 1 
ATOM   1495 C  "C3'" . DA  D 2 16 ? 27.514  46.582 29.302  1.00 50.55 ? 16  DA  H "C3'" 1 
ATOM   1496 O  "O3'" . DA  D 2 16 ? 28.722  46.060 28.750  1.00 51.27 ? 16  DA  H "O3'" 1 
ATOM   1497 C  "C2'" . DA  D 2 16 ? 27.109  45.900 30.602  1.00 52.03 ? 16  DA  H "C2'" 1 
ATOM   1498 C  "C1'" . DA  D 2 16 ? 27.993  46.599 31.625  1.00 54.57 ? 16  DA  H "C1'" 1 
ATOM   1499 N  N9    . DA  D 2 16 ? 27.430  46.830 32.954  1.00 56.78 ? 16  DA  H N9    1 
ATOM   1500 C  C8    . DA  D 2 16 ? 26.125  47.055 33.304  1.00 58.44 ? 16  DA  H C8    1 
ATOM   1501 N  N7    . DA  D 2 16 ? 25.965  47.423 34.555  1.00 59.90 ? 16  DA  H N7    1 
ATOM   1502 C  C5    . DA  D 2 16 ? 27.249  47.395 35.081  1.00 59.22 ? 16  DA  H C5    1 
ATOM   1503 C  C6    . DA  D 2 16 ? 27.763  47.703 36.372  1.00 59.68 ? 16  DA  H C6    1 
ATOM   1504 N  N6    . DA  D 2 16 ? 27.007  48.124 37.402  1.00 59.62 ? 16  DA  H N6    1 
ATOM   1505 N  N1    . DA  D 2 16 ? 29.094  47.565 36.563  1.00 59.70 ? 16  DA  H N1    1 
ATOM   1506 C  C2    . DA  D 2 16 ? 29.848  47.140 35.529  1.00 60.11 ? 16  DA  H C2    1 
ATOM   1507 N  N3    . DA  D 2 16 ? 29.484  46.830 34.275  1.00 59.34 ? 16  DA  H N3    1 
ATOM   1508 C  C4    . DA  D 2 16 ? 28.158  46.987 34.117  1.00 58.40 ? 16  DA  H C4    1 
ATOM   1509 P  P     . DG  D 2 17 ? 28.779  44.529 28.258  1.00 57.13 ? 17  DG  H P     1 
ATOM   1510 O  OP1   . DG  D 2 17 ? 29.955  44.362 27.333  1.00 53.35 ? 17  DG  H OP1   1 
ATOM   1511 O  OP2   . DG  D 2 17 ? 27.401  44.135 27.796  1.00 56.61 ? 17  DG  H OP2   1 
ATOM   1512 O  "O5'" . DG  D 2 17 ? 29.077  43.724 29.609  1.00 58.91 ? 17  DG  H "O5'" 1 
ATOM   1513 C  "C5'" . DG  D 2 17 ? 30.224  44.033 30.414  1.00 59.93 ? 17  DG  H "C5'" 1 
ATOM   1514 C  "C4'" . DG  D 2 17 ? 30.469  42.962 31.451  1.00 60.89 ? 17  DG  H "C4'" 1 
ATOM   1515 O  "O4'" . DG  D 2 17 ? 29.797  43.295 32.693  1.00 60.48 ? 17  DG  H "O4'" 1 
ATOM   1516 C  "C3'" . DG  D 2 17 ? 29.867  41.617 31.023  1.00 62.46 ? 17  DG  H "C3'" 1 
ATOM   1517 O  "O3'" . DG  D 2 17 ? 30.577  40.548 31.664  1.00 65.40 ? 17  DG  H "O3'" 1 
ATOM   1518 C  "C2'" . DG  D 2 17 ? 28.460  41.685 31.600  1.00 60.59 ? 17  DG  H "C2'" 1 
ATOM   1519 C  "C1'" . DG  D 2 17 ? 28.752  42.362 32.927  1.00 58.40 ? 17  DG  H "C1'" 1 
ATOM   1520 N  N9    . DG  D 2 17 ? 27.666  43.016 33.653  1.00 56.30 ? 17  DG  H N9    1 
ATOM   1521 C  C8    . DG  D 2 17 ? 26.356  43.170 33.263  1.00 55.97 ? 17  DG  H C8    1 
ATOM   1522 N  N7    . DG  D 2 17 ? 25.618  43.760 34.167  1.00 54.83 ? 17  DG  H N7    1 
ATOM   1523 C  C5    . DG  D 2 17 ? 26.496  44.029 35.208  1.00 54.73 ? 17  DG  H C5    1 
ATOM   1524 C  C6    . DG  D 2 17 ? 26.272  44.661 36.466  1.00 54.90 ? 17  DG  H C6    1 
ATOM   1525 O  O6    . DG  D 2 17 ? 25.226  45.122 36.921  1.00 56.11 ? 17  DG  H O6    1 
ATOM   1526 N  N1    . DG  D 2 17 ? 27.430  44.722 37.224  1.00 55.04 ? 17  DG  H N1    1 
ATOM   1527 C  C2    . DG  D 2 17 ? 28.653  44.238 36.836  1.00 56.29 ? 17  DG  H C2    1 
ATOM   1528 N  N2    . DG  D 2 17 ? 29.662  44.409 37.726  1.00 56.85 ? 17  DG  H N2    1 
ATOM   1529 N  N3    . DG  D 2 17 ? 28.878  43.635 35.670  1.00 56.23 ? 17  DG  H N3    1 
ATOM   1530 C  C4    . DG  D 2 17 ? 27.762  43.575 34.910  1.00 55.55 ? 17  DG  H C4    1 
ATOM   1531 P  P     . DC  D 2 18 ? 31.821  39.834 30.922  1.00 67.57 ? 18  DC  H P     1 
ATOM   1532 O  OP1   . DC  D 2 18 ? 32.262  40.751 29.819  1.00 68.24 ? 18  DC  H OP1   1 
ATOM   1533 O  OP2   . DC  D 2 18 ? 31.475  38.416 30.585  1.00 66.69 ? 18  DC  H OP2   1 
ATOM   1534 O  "O5'" . DC  D 2 18 ? 32.928  39.855 32.078  1.00 68.91 ? 18  DC  H "O5'" 1 
ATOM   1535 C  "C5'" . DC  D 2 18 ? 33.635  41.064 32.365  1.00 70.86 ? 18  DC  H "C5'" 1 
ATOM   1536 C  "C4'" . DC  D 2 18 ? 34.332  40.988 33.702  1.00 71.66 ? 18  DC  H "C4'" 1 
ATOM   1537 O  "O4'" . DC  D 2 18 ? 33.393  41.229 34.782  1.00 71.40 ? 18  DC  H "O4'" 1 
ATOM   1538 C  "C3'" . DC  D 2 18 ? 34.936  39.613 33.984  1.00 72.18 ? 18  DC  H "C3'" 1 
ATOM   1539 O  "O3'" . DC  D 2 18 ? 36.104  39.754 34.799  1.00 72.83 ? 18  DC  H "O3'" 1 
ATOM   1540 C  "C2'" . DC  D 2 18 ? 33.804  38.880 34.686  1.00 71.62 ? 18  DC  H "C2'" 1 
ATOM   1541 C  "C1'" . DC  D 2 18 ? 33.142  40.009 35.497  1.00 71.40 ? 18  DC  H "C1'" 1 
ATOM   1542 N  N1    . DC  D 2 18 ? 31.680  39.874 35.687  1.00 70.98 ? 18  DC  H N1    1 
ATOM   1543 C  C2    . DC  D 2 18 ? 31.095  40.367 36.878  1.00 70.98 ? 18  DC  H C2    1 
ATOM   1544 O  O2    . DC  D 2 18 ? 31.819  40.897 37.747  1.00 70.68 ? 18  DC  H O2    1 
ATOM   1545 N  N3    . DC  D 2 18 ? 29.758  40.251 37.046  1.00 71.20 ? 18  DC  H N3    1 
ATOM   1546 C  C4    . DC  D 2 18 ? 29.010  39.673 36.098  1.00 70.80 ? 18  DC  H C4    1 
ATOM   1547 N  N4    . DC  D 2 18 ? 27.690  39.576 36.329  1.00 71.02 ? 18  DC  H N4    1 
ATOM   1548 C  C5    . DC  D 2 18 ? 29.575  39.165 34.882  1.00 69.58 ? 18  DC  H C5    1 
ATOM   1549 C  C6    . DC  D 2 18 ? 30.900  39.283 34.724  1.00 70.27 ? 18  DC  H C6    1 
ATOM   1550 P  P     . DG  D 2 19 ? 36.902  38.445 35.289  1.00 72.08 ? 19  DG  H P     1 
ATOM   1551 O  OP1   . DG  D 2 19 ? 38.281  38.887 35.655  1.00 72.27 ? 19  DG  H OP1   1 
ATOM   1552 O  OP2   . DG  D 2 19 ? 36.723  37.338 34.279  1.00 71.12 ? 19  DG  H OP2   1 
ATOM   1553 O  "O5'" . DG  D 2 19 ? 36.117  38.022 36.614  1.00 72.94 ? 19  DG  H "O5'" 1 
ATOM   1554 C  "C5'" . DG  D 2 19 ? 36.167  38.825 37.795  1.00 71.80 ? 19  DG  H "C5'" 1 
ATOM   1555 C  "C4'" . DG  D 2 19 ? 35.760  37.996 39.000  1.00 71.80 ? 19  DG  H "C4'" 1 
ATOM   1556 O  "O4'" . DG  D 2 19 ? 34.342  37.706 38.943  1.00 72.04 ? 19  DG  H "O4'" 1 
ATOM   1557 C  "C3'" . DG  D 2 19 ? 36.441  36.631 39.007  1.00 71.37 ? 19  DG  H "C3'" 1 
ATOM   1558 O  "O3'" . DG  D 2 19 ? 36.594  36.172 40.368  1.00 69.30 ? 19  DG  H "O3'" 1 
ATOM   1559 C  "C2'" . DG  D 2 19 ? 35.478  35.771 38.201  1.00 71.48 ? 19  DG  H "C2'" 1 
ATOM   1560 C  "C1'" . DG  D 2 19 ? 34.136  36.324 38.643  1.00 72.42 ? 19  DG  H "C1'" 1 
ATOM   1561 N  N9    . DG  D 2 19 ? 33.020  36.209 37.702  1.00 73.01 ? 19  DG  H N9    1 
ATOM   1562 C  C8    . DG  D 2 19 ? 33.004  35.623 36.449  1.00 73.30 ? 19  DG  H C8    1 
ATOM   1563 N  N7    . DG  D 2 19 ? 31.827  35.669 35.877  1.00 72.80 ? 19  DG  H N7    1 
ATOM   1564 C  C5    . DG  D 2 19 ? 31.022  36.329 36.801  1.00 72.73 ? 19  DG  H C5    1 
ATOM   1565 C  C6    . DG  D 2 19 ? 29.641  36.688 36.743  1.00 72.67 ? 19  DG  H C6    1 
ATOM   1566 O  O6    . DG  D 2 19 ? 28.823  36.491 35.827  1.00 72.98 ? 19  DG  H O6    1 
ATOM   1567 N  N1    . DG  D 2 19 ? 29.236  37.347 37.907  1.00 72.88 ? 19  DG  H N1    1 
ATOM   1568 C  C2    . DG  D 2 19 ? 30.047  37.633 38.984  1.00 73.41 ? 19  DG  H C2    1 
ATOM   1569 N  N2    . DG  D 2 19 ? 29.478  38.264 40.010  1.00 72.74 ? 19  DG  H N2    1 
ATOM   1570 N  N3    . DG  D 2 19 ? 31.327  37.312 39.048  1.00 73.94 ? 19  DG  H N3    1 
ATOM   1571 C  C4    . DG  D 2 19 ? 31.745  36.668 37.930  1.00 73.23 ? 19  DG  H C4    1 
ATOM   1572 N  N     . ARG E 3 1  ? 1.548   31.695 59.967  1.00 34.56 ? 55  ARG A N     1 
ATOM   1573 C  CA    . ARG E 3 1  ? 0.473   30.667 59.786  1.00 34.34 ? 55  ARG A CA    1 
ATOM   1574 C  C     . ARG E 3 1  ? 0.678   29.771 58.561  1.00 32.87 ? 55  ARG A C     1 
ATOM   1575 O  O     . ARG E 3 1  ? 1.044   30.244 57.489  1.00 33.81 ? 55  ARG A O     1 
ATOM   1576 C  CB    . ARG E 3 1  ? -0.895  31.349 59.699  1.00 34.07 ? 55  ARG A CB    1 
ATOM   1577 C  CG    . ARG E 3 1  ? -1.347  32.000 60.976  1.00 32.27 ? 55  ARG A CG    1 
ATOM   1578 C  CD    . ARG E 3 1  ? -2.726  32.593 60.811  1.00 32.83 ? 55  ARG A CD    1 
ATOM   1579 N  NE    . ARG E 3 1  ? -3.205  33.186 62.048  1.00 32.98 ? 55  ARG A NE    1 
ATOM   1580 C  CZ    . ARG E 3 1  ? -4.348  33.853 62.161  1.00 33.93 ? 55  ARG A CZ    1 
ATOM   1581 N  NH1   . ARG E 3 1  ? -5.134  34.003 61.103  1.00 34.18 ? 55  ARG A NH1   1 
ATOM   1582 N  NH2   . ARG E 3 1  ? -4.693  34.394 63.322  1.00 34.98 ? 55  ARG A NH2   1 
ATOM   1583 N  N     . LYS E 3 2  ? 0.425   28.478 58.738  1.00 31.41 ? 56  LYS A N     1 
ATOM   1584 C  CA    . LYS E 3 2  ? 0.588   27.491 57.680  1.00 29.70 ? 56  LYS A CA    1 
ATOM   1585 C  C     . LYS E 3 2  ? -0.459  27.662 56.592  1.00 30.26 ? 56  LYS A C     1 
ATOM   1586 O  O     . LYS E 3 2  ? -1.589  28.083 56.862  1.00 31.06 ? 56  LYS A O     1 
ATOM   1587 C  CB    . LYS E 3 2  ? 0.493   26.088 58.275  1.00 30.00 ? 56  LYS A CB    1 
ATOM   1588 C  CG    . LYS E 3 2  ? 0.926   24.947 57.350  1.00 31.83 ? 56  LYS A CG    1 
ATOM   1589 C  CD    . LYS E 3 2  ? 0.824   23.612 58.089  1.00 32.54 ? 56  LYS A CD    1 
ATOM   1590 C  CE    . LYS E 3 2  ? 1.372   22.435 57.292  1.00 31.57 ? 56  LYS A CE    1 
ATOM   1591 N  NZ    . LYS E 3 2  ? 1.101   21.145 57.994  1.00 27.75 ? 56  LYS A NZ    1 
ATOM   1592 N  N     . ARG E 3 3  ? -0.075  27.329 55.365  1.00 29.27 ? 57  ARG A N     1 
ATOM   1593 C  CA    . ARG E 3 3  ? -0.961  27.447 54.223  1.00 27.77 ? 57  ARG A CA    1 
ATOM   1594 C  C     . ARG E 3 3  ? -1.213  26.067 53.653  1.00 27.64 ? 57  ARG A C     1 
ATOM   1595 O  O     . ARG E 3 3  ? -0.422  25.563 52.861  1.00 28.24 ? 57  ARG A O     1 
ATOM   1596 C  CB    . ARG E 3 3  ? -0.310  28.330 53.167  1.00 28.60 ? 57  ARG A CB    1 
ATOM   1597 C  CG    . ARG E 3 3  ? 0.361   29.550 53.747  1.00 32.18 ? 57  ARG A CG    1 
ATOM   1598 C  CD    . ARG E 3 3  ? -0.361  30.826 53.358  1.00 35.76 ? 57  ARG A CD    1 
ATOM   1599 N  NE    . ARG E 3 3  ? 0.027   31.307 52.034  1.00 36.97 ? 57  ARG A NE    1 
ATOM   1600 C  CZ    . ARG E 3 3  ? 1.235   31.770 51.727  1.00 38.80 ? 57  ARG A CZ    1 
ATOM   1601 N  NH1   . ARG E 3 3  ? 2.185   31.812 52.656  1.00 38.14 ? 57  ARG A NH1   1 
ATOM   1602 N  NH2   . ARG E 3 3  ? 1.488   32.211 50.497  1.00 39.13 ? 57  ARG A NH2   1 
ATOM   1603 N  N     . ASN E 3 4  ? -2.322  25.454 54.046  1.00 25.57 ? 58  ASN A N     1 
ATOM   1604 C  CA    . ASN E 3 4  ? -2.642  24.118 53.562  1.00 23.36 ? 58  ASN A CA    1 
ATOM   1605 C  C     . ASN E 3 4  ? -3.445  24.139 52.282  1.00 22.03 ? 58  ASN A C     1 
ATOM   1606 O  O     . ASN E 3 4  ? -3.429  23.184 51.526  1.00 24.42 ? 58  ASN A O     1 
ATOM   1607 C  CB    . ASN E 3 4  ? -3.418  23.354 54.631  1.00 21.04 ? 58  ASN A CB    1 
ATOM   1608 C  CG    . ASN E 3 4  ? -2.667  23.265 55.920  1.00 21.95 ? 58  ASN A CG    1 
ATOM   1609 O  OD1   . ASN E 3 4  ? -1.632  22.615 55.998  1.00 19.64 ? 58  ASN A OD1   1 
ATOM   1610 N  ND2   . ASN E 3 4  ? -3.177  23.928 56.945  1.00 19.13 ? 58  ASN A ND2   1 
ATOM   1611 N  N     . ARG E 3 5  ? -4.143  25.237 52.047  1.00 21.71 ? 59  ARG A N     1 
ATOM   1612 C  CA    . ARG E 3 5  ? -4.978  25.388 50.871  1.00 21.02 ? 59  ARG A CA    1 
ATOM   1613 C  C     . ARG E 3 5  ? -4.238  25.492 49.545  1.00 20.43 ? 59  ARG A C     1 
ATOM   1614 O  O     . ARG E 3 5  ? -3.162  26.056 49.457  1.00 20.71 ? 59  ARG A O     1 
ATOM   1615 C  CB    . ARG E 3 5  ? -5.874  26.610 51.039  1.00 21.66 ? 59  ARG A CB    1 
ATOM   1616 C  CG    . ARG E 3 5  ? -6.883  26.752 49.929  1.00 27.72 ? 59  ARG A CG    1 
ATOM   1617 C  CD    . ARG E 3 5  ? -7.777  27.965 50.077  1.00 29.86 ? 59  ARG A CD    1 
ATOM   1618 N  NE    . ARG E 3 5  ? -8.786  27.980 49.016  1.00 29.72 ? 59  ARG A NE    1 
ATOM   1619 C  CZ    . ARG E 3 5  ? -9.753  27.074 48.890  1.00 28.55 ? 59  ARG A CZ    1 
ATOM   1620 N  NH1   . ARG E 3 5  ? -9.855  26.076 49.762  1.00 29.56 ? 59  ARG A NH1   1 
ATOM   1621 N  NH2   . ARG E 3 5  ? -10.619 27.160 47.888  1.00 27.81 ? 59  ARG A NH2   1 
ATOM   1622 N  N     . ILE E 3 6  ? -4.822  24.920 48.508  1.00 19.39 ? 60  ILE A N     1 
ATOM   1623 C  CA    . ILE E 3 6  ? -4.227  24.997 47.197  1.00 18.87 ? 60  ILE A CA    1 
ATOM   1624 C  C     . ILE E 3 6  ? -5.214  25.779 46.352  1.00 22.50 ? 60  ILE A C     1 
ATOM   1625 O  O     . ILE E 3 6  ? -6.251  25.260 45.973  1.00 23.52 ? 60  ILE A O     1 
ATOM   1626 C  CB    . ILE E 3 6  ? -4.014  23.609 46.614  1.00 15.78 ? 60  ILE A CB    1 
ATOM   1627 C  CG1   . ILE E 3 6  ? -2.996  22.866 47.464  1.00 12.71 ? 60  ILE A CG1   1 
ATOM   1628 C  CG2   . ILE E 3 6  ? -3.563  23.706 45.185  1.00 13.11 ? 60  ILE A CG2   1 
ATOM   1629 C  CD1   . ILE E 3 6  ? -2.849  21.407 47.099  1.00 11.69 ? 60  ILE A CD1   1 
ATOM   1630 N  N     . PRO E 3 7  ? -4.913  27.065 46.088  1.00 24.41 ? 61  PRO A N     1 
ATOM   1631 C  CA    . PRO E 3 7  ? -5.733  27.983 45.294  1.00 23.00 ? 61  PRO A CA    1 
ATOM   1632 C  C     . PRO E 3 7  ? -6.275  27.350 44.020  1.00 22.12 ? 61  PRO A C     1 
ATOM   1633 O  O     . PRO E 3 7  ? -5.567  26.621 43.334  1.00 21.01 ? 61  PRO A O     1 
ATOM   1634 C  CB    . PRO E 3 7  ? -4.770  29.127 45.012  1.00 24.42 ? 61  PRO A CB    1 
ATOM   1635 C  CG    . PRO E 3 7  ? -4.010  29.213 46.288  1.00 26.12 ? 61  PRO A CG    1 
ATOM   1636 C  CD    . PRO E 3 7  ? -3.712  27.762 46.593  1.00 26.04 ? 61  PRO A CD    1 
ATOM   1637 N  N     . LEU E 3 8  ? -7.535  27.642 43.714  1.00 20.28 ? 62  LEU A N     1 
ATOM   1638 C  CA    . LEU E 3 8  ? -8.190  27.101 42.529  1.00 20.06 ? 62  LEU A CA    1 
ATOM   1639 C  C     . LEU E 3 8  ? -8.061  27.990 41.313  1.00 20.05 ? 62  LEU A C     1 
ATOM   1640 O  O     . LEU E 3 8  ? -8.167  27.521 40.194  1.00 19.53 ? 62  LEU A O     1 
ATOM   1641 C  CB    . LEU E 3 8  ? -9.663  26.833 42.822  1.00 19.80 ? 62  LEU A CB    1 
ATOM   1642 C  CG    . LEU E 3 8  ? -9.893  25.700 43.821  1.00 18.97 ? 62  LEU A CG    1 
ATOM   1643 C  CD1   . LEU E 3 8  ? -11.317 25.711 44.307  1.00 18.76 ? 62  LEU A CD1   1 
ATOM   1644 C  CD2   . LEU E 3 8  ? -9.540  24.383 43.177  1.00 17.91 ? 62  LEU A CD2   1 
ATOM   1645 N  N     . GLY E 3 9  ? -7.836  29.274 41.544  1.00 19.64 ? 63  GLY A N     1 
ATOM   1646 C  CA    . GLY E 3 9  ? -7.659  30.204 40.447  1.00 19.92 ? 63  GLY A CA    1 
ATOM   1647 C  C     . GLY E 3 9  ? -6.218  30.129 39.992  1.00 19.81 ? 63  GLY A C     1 
ATOM   1648 O  O     . GLY E 3 9  ? -5.396  29.556 40.687  1.00 19.55 ? 63  GLY A O     1 
ATOM   1649 N  N     . CYS E 3 10 ? -5.909  30.691 38.828  1.00 18.88 ? 64  CYS A N     1 
ATOM   1650 C  CA    . CYS E 3 10 ? -4.544  30.650 38.308  1.00 18.05 ? 64  CYS A CA    1 
ATOM   1651 C  C     . CYS E 3 10 ? -3.666  31.674 39.020  1.00 17.01 ? 64  CYS A C     1 
ATOM   1652 O  O     . CYS E 3 10 ? -4.169  32.615 39.612  1.00 14.09 ? 64  CYS A O     1 
ATOM   1653 C  CB    . CYS E 3 10 ? -4.547  30.874 36.782  1.00 20.48 ? 64  CYS A CB    1 
ATOM   1654 S  SG    . CYS E 3 10 ? -4.858  32.569 36.187  1.00 22.61 ? 64  CYS A SG    1 
ATOM   1655 N  N     . THR E 3 11 ? -2.354  31.483 38.985  1.00 15.98 ? 65  THR A N     1 
ATOM   1656 C  CA    . THR E 3 11 ? -1.471  32.410 39.676  1.00 18.14 ? 65  THR A CA    1 
ATOM   1657 C  C     . THR E 3 11 ? -1.676  33.872 39.300  1.00 19.26 ? 65  THR A C     1 
ATOM   1658 O  O     . THR E 3 11 ? -1.781  34.718 40.177  1.00 21.36 ? 65  THR A O     1 
ATOM   1659 C  CB    . THR E 3 11 ? 0.005   32.063 39.473  1.00 17.37 ? 65  THR A CB    1 
ATOM   1660 O  OG1   . THR E 3 11 ? 0.329   32.132 38.082  1.00 25.13 ? 65  THR A OG1   1 
ATOM   1661 C  CG2   . THR E 3 11 ? 0.293   30.701 39.996  1.00 15.30 ? 65  THR A CG2   1 
ATOM   1662 N  N     . ILE E 3 12 ? -1.735  34.176 38.010  1.00 19.13 ? 66  ILE A N     1 
ATOM   1663 C  CA    . ILE E 3 12 ? -1.916  35.555 37.587  1.00 19.46 ? 66  ILE A CA    1 
ATOM   1664 C  C     . ILE E 3 12 ? -3.216  36.186 38.075  1.00 18.71 ? 66  ILE A C     1 
ATOM   1665 O  O     . ILE E 3 12 ? -3.194  37.269 38.645  1.00 19.39 ? 66  ILE A O     1 
ATOM   1666 C  CB    . ILE E 3 12 ? -1.783  35.690 36.057  1.00 20.51 ? 66  ILE A CB    1 
ATOM   1667 C  CG1   . ILE E 3 12 ? -0.325  35.432 35.661  1.00 20.96 ? 66  ILE A CG1   1 
ATOM   1668 C  CG2   . ILE E 3 12 ? -2.202  37.076 35.627  1.00 18.87 ? 66  ILE A CG2   1 
ATOM   1669 C  CD1   . ILE E 3 12 ? -0.014  35.580 34.209  1.00 23.66 ? 66  ILE A CD1   1 
ATOM   1670 N  N     . CYS E 3 13 ? -4.344  35.516 37.871  1.00 18.94 ? 67  CYS A N     1 
ATOM   1671 C  CA    . CYS E 3 13 ? -5.613  36.053 38.353  1.00 20.18 ? 67  CYS A CA    1 
ATOM   1672 C  C     . CYS E 3 13 ? -5.533  36.382 39.838  1.00 22.72 ? 67  CYS A C     1 
ATOM   1673 O  O     . CYS E 3 13 ? -6.166  37.317 40.309  1.00 22.96 ? 67  CYS A O     1 
ATOM   1674 C  CB    . CYS E 3 13 ? -6.748  35.053 38.131  1.00 19.93 ? 67  CYS A CB    1 
ATOM   1675 S  SG    . CYS E 3 13 ? -7.506  35.138 36.492  1.00 23.72 ? 67  CYS A SG    1 
ATOM   1676 N  N     . ARG E 3 14 ? -4.759  35.584 40.566  1.00 24.34 ? 68  ARG A N     1 
ATOM   1677 C  CA    . ARG E 3 14 ? -4.579  35.779 41.991  1.00 26.30 ? 68  ARG A CA    1 
ATOM   1678 C  C     . ARG E 3 14 ? -3.859  37.105 42.199  1.00 26.36 ? 68  ARG A C     1 
ATOM   1679 O  O     . ARG E 3 14 ? -4.298  37.961 42.972  1.00 26.18 ? 68  ARG A O     1 
ATOM   1680 C  CB    . ARG E 3 14 ? -3.745  34.637 42.584  1.00 28.51 ? 68  ARG A CB    1 
ATOM   1681 C  CG    . ARG E 3 14 ? -4.499  33.763 43.586  1.00 32.01 ? 68  ARG A CG    1 
ATOM   1682 C  CD    . ARG E 3 14 ? -3.583  32.771 44.311  1.00 35.84 ? 68  ARG A CD    1 
ATOM   1683 N  NE    . ARG E 3 14 ? -2.982  31.798 43.400  1.00 39.35 ? 68  ARG A NE    1 
ATOM   1684 C  CZ    . ARG E 3 14 ? -1.960  31.004 43.719  1.00 40.83 ? 68  ARG A CZ    1 
ATOM   1685 N  NH1   . ARG E 3 14 ? -1.407  31.051 44.932  1.00 39.42 ? 68  ARG A NH1   1 
ATOM   1686 N  NH2   . ARG E 3 14 ? -1.479  30.164 42.817  1.00 42.35 ? 68  ARG A NH2   1 
ATOM   1687 N  N     . LYS E 3 15 ? -2.750  37.275 41.488  1.00 26.64 ? 69  LYS A N     1 
ATOM   1688 C  CA    . LYS E 3 15 ? -1.965  38.493 41.595  1.00 26.24 ? 69  LYS A CA    1 
ATOM   1689 C  C     . LYS E 3 15 ? -2.735  39.723 41.122  1.00 27.50 ? 69  LYS A C     1 
ATOM   1690 O  O     . LYS E 3 15 ? -2.644  40.792 41.720  1.00 27.97 ? 69  LYS A O     1 
ATOM   1691 C  CB    . LYS E 3 15 ? -0.662  38.338 40.810  1.00 24.79 ? 69  LYS A CB    1 
ATOM   1692 C  CG    . LYS E 3 15 ? 0.359   37.470 41.516  1.00 22.76 ? 69  LYS A CG    1 
ATOM   1693 C  CD    . LYS E 3 15 ? 1.673   37.417 40.761  1.00 24.73 ? 69  LYS A CD    1 
ATOM   1694 C  CE    . LYS E 3 15 ? 2.661   36.466 41.402  1.00 24.88 ? 69  LYS A CE    1 
ATOM   1695 N  NZ    . LYS E 3 15 ? 3.143   36.960 42.710  1.00 27.99 ? 69  LYS A NZ    1 
ATOM   1696 N  N     . ARG E 3 16 ? -3.510  39.569 40.058  1.00 27.51 ? 70  ARG A N     1 
ATOM   1697 C  CA    . ARG E 3 16 ? -4.280  40.687 39.531  1.00 28.83 ? 70  ARG A CA    1 
ATOM   1698 C  C     . ARG E 3 16 ? -5.523  40.979 40.362  1.00 29.08 ? 70  ARG A C     1 
ATOM   1699 O  O     . ARG E 3 16 ? -6.213  41.988 40.138  1.00 27.27 ? 70  ARG A O     1 
ATOM   1700 C  CB    . ARG E 3 16 ? -4.697  40.406 38.084  1.00 28.55 ? 70  ARG A CB    1 
ATOM   1701 C  CG    . ARG E 3 16 ? -3.583  40.500 37.076  1.00 28.85 ? 70  ARG A CG    1 
ATOM   1702 C  CD    . ARG E 3 16 ? -4.162  40.326 35.705  1.00 28.94 ? 70  ARG A CD    1 
ATOM   1703 N  NE    . ARG E 3 16 ? -5.259  41.263 35.512  1.00 27.04 ? 70  ARG A NE    1 
ATOM   1704 C  CZ    . ARG E 3 16 ? -6.227  41.097 34.623  1.00 27.50 ? 70  ARG A CZ    1 
ATOM   1705 N  NH1   . ARG E 3 16 ? -6.247  40.028 33.834  1.00 30.79 ? 70  ARG A NH1   1 
ATOM   1706 N  NH2   . ARG E 3 16 ? -7.187  42.000 34.533  1.00 31.98 ? 70  ARG A NH2   1 
ATOM   1707 N  N     . LYS E 3 17 ? -5.810  40.070 41.295  1.00 28.69 ? 71  LYS A N     1 
ATOM   1708 C  CA    . LYS E 3 17 ? -6.965  40.167 42.185  1.00 26.84 ? 71  LYS A CA    1 
ATOM   1709 C  C     . LYS E 3 17 ? -8.310  40.249 41.451  1.00 26.14 ? 71  LYS A C     1 
ATOM   1710 O  O     . LYS E 3 17 ? -9.126  41.104 41.746  1.00 27.54 ? 71  LYS A O     1 
ATOM   1711 C  CB    . LYS E 3 17 ? -6.793  41.376 43.106  1.00 27.02 ? 71  LYS A CB    1 
ATOM   1712 C  CG    . LYS E 3 17 ? -5.467  41.377 43.848  1.00 30.17 ? 71  LYS A CG    1 
ATOM   1713 C  CD    . LYS E 3 17 ? -5.178  42.682 44.539  1.00 31.43 ? 71  LYS A CD    1 
ATOM   1714 C  CE    . LYS E 3 17 ? -6.193  42.987 45.608  1.00 31.55 ? 71  LYS A CE    1 
ATOM   1715 N  NZ    . LYS E 3 17 ? -5.802  44.171 46.415  1.00 34.44 ? 71  LYS A NZ    1 
ATOM   1716 N  N     . VAL E 3 18 ? -8.531  39.355 40.491  1.00 25.83 ? 72  VAL A N     1 
ATOM   1717 C  CA    . VAL E 3 18 ? -9.779  39.323 39.729  1.00 26.13 ? 72  VAL A CA    1 
ATOM   1718 C  C     . VAL E 3 18 ? -10.291 37.893 39.632  1.00 26.45 ? 72  VAL A C     1 
ATOM   1719 O  O     . VAL E 3 18 ? -9.533  36.950 39.795  1.00 28.07 ? 72  VAL A O     1 
ATOM   1720 C  CB    . VAL E 3 18 ? -9.601  39.887 38.290  1.00 25.69 ? 72  VAL A CB    1 
ATOM   1721 C  CG1   . VAL E 3 18 ? -9.059  41.302 38.361  1.00 23.41 ? 72  VAL A CG1   1 
ATOM   1722 C  CG2   . VAL E 3 18 ? -8.694  38.995 37.469  1.00 22.02 ? 72  VAL A CG2   1 
ATOM   1723 N  N     . LYS E 3 19 ? -11.581 37.737 39.376  1.00 27.59 ? 73  LYS A N     1 
ATOM   1724 C  CA    . LYS E 3 19 ? -12.184 36.415 39.276  1.00 29.35 ? 73  LYS A CA    1 
ATOM   1725 C  C     . LYS E 3 19 ? -11.573 35.584 38.149  1.00 29.61 ? 73  LYS A C     1 
ATOM   1726 O  O     . LYS E 3 19 ? -11.432 36.049 37.021  1.00 30.65 ? 73  LYS A O     1 
ATOM   1727 C  CB    . LYS E 3 19 ? -13.705 36.548 39.069  1.00 31.50 ? 73  LYS A CB    1 
ATOM   1728 C  CG    . LYS E 3 19 ? -14.419 35.277 38.620  1.00 34.22 ? 73  LYS A CG    1 
ATOM   1729 C  CD    . LYS E 3 19 ? -14.603 34.273 39.758  1.00 38.18 ? 73  LYS A CD    1 
ATOM   1730 C  CE    . LYS E 3 19 ? -15.894 34.533 40.529  1.00 40.21 ? 73  LYS A CE    1 
ATOM   1731 N  NZ    . LYS E 3 19 ? -17.082 34.395 39.633  1.00 41.75 ? 73  LYS A NZ    1 
ATOM   1732 N  N     . CYS E 3 20 ? -11.218 34.345 38.462  1.00 27.95 ? 74  CYS A N     1 
ATOM   1733 C  CA    . CYS E 3 20 ? -10.638 33.440 37.476  1.00 27.54 ? 74  CYS A CA    1 
ATOM   1734 C  C     . CYS E 3 20 ? -11.679 32.432 37.004  1.00 28.30 ? 74  CYS A C     1 
ATOM   1735 O  O     . CYS E 3 20 ? -12.231 31.690 37.797  1.00 30.23 ? 74  CYS A O     1 
ATOM   1736 C  CB    . CYS E 3 20 ? -9.454  32.704 38.093  1.00 27.58 ? 74  CYS A CB    1 
ATOM   1737 S  SG    . CYS E 3 20 ? -8.541  31.640 36.955  1.00 24.75 ? 74  CYS A SG    1 
ATOM   1738 N  N     . ASP E 3 21 ? -11.977 32.421 35.712  1.00 28.49 ? 75  ASP A N     1 
ATOM   1739 C  CA    . ASP E 3 21 ? -12.958 31.470 35.196  1.00 29.08 ? 75  ASP A CA    1 
ATOM   1740 C  C     . ASP E 3 21 ? -12.403 30.059 35.315  1.00 28.04 ? 75  ASP A C     1 
ATOM   1741 O  O     . ASP E 3 21 ? -13.104 29.087 35.109  1.00 27.05 ? 75  ASP A O     1 
ATOM   1742 C  CB    . ASP E 3 21 ? -13.294 31.755 33.728  1.00 29.82 ? 75  ASP A CB    1 
ATOM   1743 C  CG    . ASP E 3 21 ? -12.083 31.772 32.851  1.00 29.55 ? 75  ASP A CG    1 
ATOM   1744 O  OD1   . ASP E 3 21 ? -11.283 32.711 32.978  1.00 30.78 ? 75  ASP A OD1   1 
ATOM   1745 O  OD2   . ASP E 3 21 ? -11.927 30.847 32.043  1.00 29.18 ? 75  ASP A OD2   1 
ATOM   1746 N  N     . LYS E 3 22 ? -11.123 29.977 35.639  1.00 28.93 ? 76  LYS A N     1 
ATOM   1747 C  CA    . LYS E 3 22 ? -10.418 28.722 35.820  1.00 29.53 ? 76  LYS A CA    1 
ATOM   1748 C  C     . LYS E 3 22 ? -10.568 27.640 34.767  1.00 30.76 ? 76  LYS A C     1 
ATOM   1749 O  O     . LYS E 3 22 ? -10.598 26.465 35.089  1.00 30.08 ? 76  LYS A O     1 
ATOM   1750 C  CB    . LYS E 3 22 ? -10.731 28.159 37.211  1.00 29.36 ? 76  LYS A CB    1 
ATOM   1751 C  CG    . LYS E 3 22 ? -12.162 28.305 37.673  1.00 26.38 ? 76  LYS A CG    1 
ATOM   1752 C  CD    . LYS E 3 22 ? -12.231 28.093 39.159  1.00 26.78 ? 76  LYS A CD    1 
ATOM   1753 C  CE    . LYS E 3 22 ? -11.606 29.247 39.911  1.00 23.98 ? 76  LYS A CE    1 
ATOM   1754 N  NZ    . LYS E 3 22 ? -12.559 30.358 40.058  1.00 23.15 ? 76  LYS A NZ    1 
ATOM   1755 N  N     . LEU E 3 23 ? -10.646 28.039 33.505  1.00 33.36 ? 77  LEU A N     1 
ATOM   1756 C  CA    . LEU E 3 23 ? -10.732 27.086 32.405  1.00 34.85 ? 77  LEU A CA    1 
ATOM   1757 C  C     . LEU E 3 23 ? -9.317  26.560 32.170  1.00 35.42 ? 77  LEU A C     1 
ATOM   1758 O  O     . LEU E 3 23 ? -8.349  27.250 32.448  1.00 34.70 ? 77  LEU A O     1 
ATOM   1759 C  CB    . LEU E 3 23 ? -11.258 27.776 31.149  1.00 36.35 ? 77  LEU A CB    1 
ATOM   1760 C  CG    . LEU E 3 23 ? -12.777 27.932 30.999  1.00 41.12 ? 77  LEU A CG    1 
ATOM   1761 C  CD1   . LEU E 3 23 ? -13.419 28.290 32.321  1.00 42.35 ? 77  LEU A CD1   1 
ATOM   1762 C  CD2   . LEU E 3 23 ? -13.072 29.000 29.947  1.00 42.72 ? 77  LEU A CD2   1 
ATOM   1763 N  N     . ARG E 3 24 ? -9.190  25.337 31.677  1.00 36.64 ? 78  ARG A N     1 
ATOM   1764 C  CA    . ARG E 3 24 ? -7.869  24.766 31.440  1.00 37.98 ? 78  ARG A CA    1 
ATOM   1765 C  C     . ARG E 3 24 ? -7.736  24.351 29.984  1.00 38.27 ? 78  ARG A C     1 
ATOM   1766 O  O     . ARG E 3 24 ? -8.728  23.969 29.357  1.00 39.28 ? 78  ARG A O     1 
ATOM   1767 C  CB    . ARG E 3 24 ? -7.656  23.552 32.347  1.00 38.06 ? 78  ARG A CB    1 
ATOM   1768 C  CG    . ARG E 3 24 ? -7.879  23.840 33.809  1.00 38.06 ? 78  ARG A CG    1 
ATOM   1769 C  CD    . ARG E 3 24 ? -6.700  23.399 34.646  1.00 37.83 ? 78  ARG A CD    1 
ATOM   1770 N  NE    . ARG E 3 24 ? -6.997  23.540 36.068  1.00 37.08 ? 78  ARG A NE    1 
ATOM   1771 C  CZ    . ARG E 3 24 ? -6.145  23.245 37.042  1.00 36.49 ? 78  ARG A CZ    1 
ATOM   1772 N  NH1   . ARG E 3 24 ? -4.926  22.794 36.751  1.00 34.19 ? 78  ARG A NH1   1 
ATOM   1773 N  NH2   . ARG E 3 24 ? -6.525  23.396 38.307  1.00 37.38 ? 78  ARG A NH2   1 
ATOM   1774 N  N     . PRO E 3 25 ? -6.504  24.362 29.436  1.00 37.52 ? 79  PRO A N     1 
ATOM   1775 C  CA    . PRO E 3 25 ? -5.194  24.693 30.016  1.00 36.23 ? 79  PRO A CA    1 
ATOM   1776 C  C     . PRO E 3 25 ? -5.034  26.068 30.647  1.00 35.07 ? 79  PRO A C     1 
ATOM   1777 O  O     . PRO E 3 25 ? -4.463  26.204 31.721  1.00 35.95 ? 79  PRO A O     1 
ATOM   1778 C  CB    . PRO E 3 25 ? -4.236  24.519 28.833  1.00 35.72 ? 79  PRO A CB    1 
ATOM   1779 C  CG    . PRO E 3 25 ? -4.936  23.546 27.954  1.00 35.73 ? 79  PRO A CG    1 
ATOM   1780 C  CD    . PRO E 3 25 ? -6.349  24.043 28.008  1.00 35.58 ? 79  PRO A CD    1 
ATOM   1781 N  N     . HIS E 3 26 ? -5.509  27.093 29.964  1.00 33.08 ? 80  HIS A N     1 
ATOM   1782 C  CA    . HIS E 3 26 ? -5.374  28.440 30.475  1.00 31.01 ? 80  HIS A CA    1 
ATOM   1783 C  C     . HIS E 3 26 ? -6.744  29.022 30.600  1.00 29.99 ? 80  HIS A C     1 
ATOM   1784 O  O     . HIS E 3 26 ? -7.639  28.647 29.860  1.00 29.78 ? 80  HIS A O     1 
ATOM   1785 C  CB    . HIS E 3 26 ? -4.550  29.281 29.511  1.00 32.11 ? 80  HIS A CB    1 
ATOM   1786 C  CG    . HIS E 3 26 ? -3.368  28.561 28.951  1.00 34.55 ? 80  HIS A CG    1 
ATOM   1787 N  ND1   . HIS E 3 26 ? -2.357  28.059 29.744  1.00 37.02 ? 80  HIS A ND1   1 
ATOM   1788 C  CD2   . HIS E 3 26 ? -3.043  28.243 27.678  1.00 34.19 ? 80  HIS A CD2   1 
ATOM   1789 C  CE1   . HIS E 3 26 ? -1.458  27.462 28.981  1.00 36.76 ? 80  HIS A CE1   1 
ATOM   1790 N  NE2   . HIS E 3 26 ? -1.850  27.559 27.722  1.00 36.97 ? 80  HIS A NE2   1 
ATOM   1791 N  N     . CYS E 3 27 ? -6.904  29.952 31.531  1.00 28.84 ? 81  CYS A N     1 
ATOM   1792 C  CA    . CYS E 3 27 ? -8.189  30.578 31.747  1.00 28.85 ? 81  CYS A CA    1 
ATOM   1793 C  C     . CYS E 3 27 ? -8.469  31.651 30.693  1.00 30.48 ? 81  CYS A C     1 
ATOM   1794 O  O     . CYS E 3 27 ? -7.555  32.169 30.070  1.00 30.24 ? 81  CYS A O     1 
ATOM   1795 C  CB    . CYS E 3 27 ? -8.233  31.169 33.156  1.00 27.74 ? 81  CYS A CB    1 
ATOM   1796 S  SG    . CYS E 3 27 ? -7.164  32.607 33.450  1.00 22.66 ? 81  CYS A SG    1 
ATOM   1797 N  N     . GLN E 3 28 ? -9.740  31.954 30.467  1.00 33.18 ? 82  GLN A N     1 
ATOM   1798 C  CA    . GLN E 3 28 ? -10.097 32.977 29.502  1.00 35.92 ? 82  GLN A CA    1 
ATOM   1799 C  C     . GLN E 3 28 ? -9.521  34.317 29.936  1.00 35.98 ? 82  GLN A C     1 
ATOM   1800 O  O     . GLN E 3 28 ? -9.138  35.140 29.104  1.00 36.45 ? 82  GLN A O     1 
ATOM   1801 C  CB    . GLN E 3 28 ? -11.613 33.089 29.380  1.00 38.55 ? 82  GLN A CB    1 
ATOM   1802 C  CG    . GLN E 3 28 ? -12.268 31.987 28.555  1.00 43.79 ? 82  GLN A CG    1 
ATOM   1803 C  CD    . GLN E 3 28 ? -11.769 31.960 27.113  1.00 46.88 ? 82  GLN A CD    1 
ATOM   1804 O  OE1   . GLN E 3 28 ? -11.641 33.013 26.450  1.00 47.09 ? 82  GLN A OE1   1 
ATOM   1805 N  NE2   . GLN E 3 28 ? -11.492 30.750 26.611  1.00 48.17 ? 82  GLN A NE2   1 
ATOM   1806 N  N     . GLN E 3 29 ? -9.451  34.526 31.244  1.00 35.87 ? 83  GLN A N     1 
ATOM   1807 C  CA    . GLN E 3 29 ? -8.917  35.762 31.782  1.00 37.47 ? 83  GLN A CA    1 
ATOM   1808 C  C     . GLN E 3 29 ? -7.558  36.081 31.190  1.00 37.64 ? 83  GLN A C     1 
ATOM   1809 O  O     . GLN E 3 29 ? -7.320  37.203 30.736  1.00 38.21 ? 83  GLN A O     1 
ATOM   1810 C  CB    . GLN E 3 29 ? -8.772  35.664 33.293  1.00 41.02 ? 83  GLN A CB    1 
ATOM   1811 C  CG    . GLN E 3 29 ? -9.380  36.815 34.027  1.00 45.98 ? 83  GLN A CG    1 
ATOM   1812 C  CD    . GLN E 3 29 ? -10.865 36.871 33.811  1.00 49.02 ? 83  GLN A CD    1 
ATOM   1813 O  OE1   . GLN E 3 29 ? -11.584 35.895 34.097  1.00 52.90 ? 83  GLN A OE1   1 
ATOM   1814 N  NE2   . GLN E 3 29 ? -11.350 38.008 33.305  1.00 49.98 ? 83  GLN A NE2   1 
ATOM   1815 N  N     . CYS E 3 30 ? -6.660  35.098 31.210  1.00 36.28 ? 84  CYS A N     1 
ATOM   1816 C  CA    . CYS E 3 30 ? -5.319  35.307 30.687  1.00 35.37 ? 84  CYS A CA    1 
ATOM   1817 C  C     . CYS E 3 30 ? -5.312  35.328 29.170  1.00 37.60 ? 84  CYS A C     1 
ATOM   1818 O  O     . CYS E 3 30 ? -4.608  36.126 28.561  1.00 38.77 ? 84  CYS A O     1 
ATOM   1819 C  CB    . CYS E 3 30 ? -4.360  34.231 31.208  1.00 30.95 ? 84  CYS A CB    1 
ATOM   1820 S  SG    . CYS E 3 30 ? -3.978  34.365 32.983  1.00 25.83 ? 84  CYS A SG    1 
ATOM   1821 N  N     . THR E 3 31 ? -6.104  34.458 28.558  1.00 38.39 ? 85  THR A N     1 
ATOM   1822 C  CA    . THR E 3 31 ? -6.167  34.414 27.105  1.00 40.07 ? 85  THR A CA    1 
ATOM   1823 C  C     . THR E 3 31 ? -6.631  35.776 26.594  1.00 40.77 ? 85  THR A C     1 
ATOM   1824 O  O     . THR E 3 31 ? -6.102  36.290 25.611  1.00 41.03 ? 85  THR A O     1 
ATOM   1825 C  CB    . THR E 3 31 ? -7.130  33.308 26.610  1.00 39.78 ? 85  THR A CB    1 
ATOM   1826 O  OG1   . THR E 3 31 ? -6.607  32.026 26.985  1.00 40.22 ? 85  THR A OG1   1 
ATOM   1827 C  CG2   . THR E 3 31 ? -7.262  33.354 25.084  1.00 36.68 ? 85  THR A CG2   1 
ATOM   1828 N  N     . LYS E 3 32 ? -7.608  36.360 27.280  1.00 40.55 ? 86  LYS A N     1 
ATOM   1829 C  CA    . LYS E 3 32 ? -8.134  37.667 26.912  1.00 39.53 ? 86  LYS A CA    1 
ATOM   1830 C  C     . LYS E 3 32 ? -7.058  38.737 26.960  1.00 37.35 ? 86  LYS A C     1 
ATOM   1831 O  O     . LYS E 3 32 ? -6.887  39.477 25.994  1.00 38.71 ? 86  LYS A O     1 
ATOM   1832 C  CB    . LYS E 3 32 ? -9.278  38.085 27.845  1.00 42.20 ? 86  LYS A CB    1 
ATOM   1833 C  CG    . LYS E 3 32 ? -9.849  39.472 27.541  1.00 44.78 ? 86  LYS A CG    1 
ATOM   1834 C  CD    . LYS E 3 32 ? -10.618 40.061 28.729  1.00 48.39 ? 86  LYS A CD    1 
ATOM   1835 C  CE    . LYS E 3 32 ? -11.912 39.274 29.067  1.00 49.74 ? 86  LYS A CE    1 
ATOM   1836 N  NZ    . LYS E 3 32 ? -12.964 39.389 28.015  1.00 47.25 ? 86  LYS A NZ    1 
ATOM   1837 N  N     . THR E 3 33 ? -6.347  38.833 28.081  1.00 34.26 ? 87  THR A N     1 
ATOM   1838 C  CA    . THR E 3 33 ? -5.312  39.845 28.212  1.00 33.69 ? 87  THR A CA    1 
ATOM   1839 C  C     . THR E 3 33 ? -4.002  39.495 27.531  1.00 32.90 ? 87  THR A C     1 
ATOM   1840 O  O     . THR E 3 33 ? -3.010  40.203 27.698  1.00 34.12 ? 87  THR A O     1 
ATOM   1841 C  CB    . THR E 3 33 ? -5.028  40.203 29.696  1.00 33.94 ? 87  THR A CB    1 
ATOM   1842 O  OG1   . THR E 3 33 ? -4.814  39.011 30.470  1.00 37.01 ? 87  THR A OG1   1 
ATOM   1843 C  CG2   . THR E 3 33 ? -6.197  40.989 30.279  1.00 30.77 ? 87  THR A CG2   1 
ATOM   1844 N  N     . GLY E 3 34 ? -4.003  38.398 26.778  1.00 32.06 ? 88  GLY A N     1 
ATOM   1845 C  CA    . GLY E 3 34 ? -2.817  37.983 26.044  1.00 30.57 ? 88  GLY A CA    1 
ATOM   1846 C  C     . GLY E 3 34 ? -1.678  37.278 26.760  1.00 29.45 ? 88  GLY A C     1 
ATOM   1847 O  O     . GLY E 3 34 ? -0.603  37.098 26.201  1.00 28.97 ? 88  GLY A O     1 
ATOM   1848 N  N     . VAL E 3 35 ? -1.897  36.856 27.992  1.00 29.59 ? 89  VAL A N     1 
ATOM   1849 C  CA    . VAL E 3 35 ? -0.841  36.180 28.731  1.00 27.55 ? 89  VAL A CA    1 
ATOM   1850 C  C     . VAL E 3 35 ? -1.100  34.687 28.976  1.00 26.19 ? 89  VAL A C     1 
ATOM   1851 O  O     . VAL E 3 35 ? -0.629  34.128 29.951  1.00 26.52 ? 89  VAL A O     1 
ATOM   1852 C  CB    . VAL E 3 35 ? -0.588  36.918 30.069  1.00 27.25 ? 89  VAL A CB    1 
ATOM   1853 C  CG1   . VAL E 3 35 ? -0.007  38.303 29.778  1.00 23.06 ? 89  VAL A CG1   1 
ATOM   1854 C  CG2   . VAL E 3 35 ? -1.884  37.046 30.851  1.00 26.63 ? 89  VAL A CG2   1 
ATOM   1855 N  N     . ALA E 3 36 ? -1.830  34.043 28.075  1.00 24.83 ? 90  ALA A N     1 
ATOM   1856 C  CA    . ALA E 3 36 ? -2.136  32.631 28.226  1.00 24.86 ? 90  ALA A CA    1 
ATOM   1857 C  C     . ALA E 3 36 ? -0.881  31.783 28.424  1.00 26.63 ? 90  ALA A C     1 
ATOM   1858 O  O     . ALA E 3 36 ? -0.906  30.766 29.116  1.00 28.67 ? 90  ALA A O     1 
ATOM   1859 C  CB    . ALA E 3 36 ? -2.908  32.140 27.023  1.00 23.92 ? 90  ALA A CB    1 
ATOM   1860 N  N     . HIS E 3 37 ? 0.223   32.200 27.816  1.00 26.63 ? 91  HIS A N     1 
ATOM   1861 C  CA    . HIS E 3 37 ? 1.461   31.446 27.946  1.00 25.27 ? 91  HIS A CA    1 
ATOM   1862 C  C     . HIS E 3 37 ? 2.074   31.575 29.343  1.00 24.23 ? 91  HIS A C     1 
ATOM   1863 O  O     . HIS E 3 37 ? 3.093   30.959 29.632  1.00 23.08 ? 91  HIS A O     1 
ATOM   1864 C  CB    . HIS E 3 37 ? 2.469   31.904 26.896  1.00 24.66 ? 91  HIS A CB    1 
ATOM   1865 C  CG    . HIS E 3 37 ? 3.078   33.229 27.204  1.00 26.44 ? 91  HIS A CG    1 
ATOM   1866 N  ND1   . HIS E 3 37 ? 2.357   34.398 27.188  1.00 28.57 ? 91  HIS A ND1   1 
ATOM   1867 C  CD2   . HIS E 3 37 ? 4.331   33.561 27.604  1.00 27.27 ? 91  HIS A CD2   1 
ATOM   1868 C  CE1   . HIS E 3 37 ? 3.129   35.398 27.568  1.00 28.66 ? 91  HIS A CE1   1 
ATOM   1869 N  NE2   . HIS E 3 37 ? 4.334   34.915 27.830  1.00 29.70 ? 91  HIS A NE2   1 
ATOM   1870 N  N     . LEU E 3 38 ? 1.454   32.378 30.203  1.00 22.79 ? 92  LEU A N     1 
ATOM   1871 C  CA    . LEU E 3 38 ? 1.938   32.561 31.565  1.00 24.32 ? 92  LEU A CA    1 
ATOM   1872 C  C     . LEU E 3 38 ? 0.937   32.019 32.571  1.00 24.29 ? 92  LEU A C     1 
ATOM   1873 O  O     . LEU E 3 38 ? 1.185   32.037 33.765  1.00 25.25 ? 92  LEU A O     1 
ATOM   1874 C  CB    . LEU E 3 38 ? 2.172   34.038 31.867  1.00 23.88 ? 92  LEU A CB    1 
ATOM   1875 C  CG    . LEU E 3 38 ? 3.151   34.790 30.980  1.00 25.54 ? 92  LEU A CG    1 
ATOM   1876 C  CD1   . LEU E 3 38 ? 3.215   36.219 31.421  1.00 24.73 ? 92  LEU A CD1   1 
ATOM   1877 C  CD2   . LEU E 3 38 ? 4.523   34.132 31.044  1.00 25.36 ? 92  LEU A CD2   1 
ATOM   1878 N  N     . CYS E 3 39 ? -0.188  31.534 32.067  1.00 24.85 ? 93  CYS A N     1 
ATOM   1879 C  CA    . CYS E 3 39 ? -1.254  31.000 32.895  1.00 26.52 ? 93  CYS A CA    1 
ATOM   1880 C  C     . CYS E 3 39 ? -1.036  29.575 33.396  1.00 26.92 ? 93  CYS A C     1 
ATOM   1881 O  O     . CYS E 3 39 ? -0.844  28.659 32.606  1.00 28.62 ? 93  CYS A O     1 
ATOM   1882 C  CB    . CYS E 3 39 ? -2.554  31.053 32.105  1.00 27.07 ? 93  CYS A CB    1 
ATOM   1883 S  SG    . CYS E 3 39 ? -4.011  30.470 33.009  1.00 26.49 ? 93  CYS A SG    1 
ATOM   1884 N  N     . HIS E 3 40 ? -1.086  29.389 34.710  1.00 27.18 ? 94  HIS A N     1 
ATOM   1885 C  CA    . HIS E 3 40 ? -0.904  28.062 35.291  1.00 26.12 ? 94  HIS A CA    1 
ATOM   1886 C  C     . HIS E 3 40 ? -1.489  27.976 36.690  1.00 22.36 ? 94  HIS A C     1 
ATOM   1887 O  O     . HIS E 3 40 ? -1.547  28.966 37.408  1.00 19.48 ? 94  HIS A O     1 
ATOM   1888 C  CB    . HIS E 3 40 ? 0.581   27.703 35.350  1.00 30.51 ? 94  HIS A CB    1 
ATOM   1889 C  CG    . HIS E 3 40 ? 1.339   28.480 36.372  1.00 35.79 ? 94  HIS A CG    1 
ATOM   1890 N  ND1   . HIS E 3 40 ? 1.794   29.761 36.146  1.00 38.90 ? 94  HIS A ND1   1 
ATOM   1891 C  CD2   . HIS E 3 40 ? 1.651   28.192 37.663  1.00 38.24 ? 94  HIS A CD2   1 
ATOM   1892 C  CE1   . HIS E 3 40 ? 2.349   30.232 37.246  1.00 40.32 ? 94  HIS A CE1   1 
ATOM   1893 N  NE2   . HIS E 3 40 ? 2.274   29.300 38.183  1.00 40.36 ? 94  HIS A NE2   1 
ATOM   1894 N  N     . TYR E 3 41 ? -1.900  26.770 37.068  1.00 18.95 ? 95  TYR A N     1 
ATOM   1895 C  CA    . TYR E 3 41 ? -2.497  26.532 38.371  1.00 16.87 ? 95  TYR A CA    1 
ATOM   1896 C  C     . TYR E 3 41 ? -1.554  25.827 39.337  1.00 17.47 ? 95  TYR A C     1 
ATOM   1897 O  O     . TYR E 3 41 ? -0.712  25.051 38.913  1.00 18.98 ? 95  TYR A O     1 
ATOM   1898 C  CB    . TYR E 3 41 ? -3.758  25.692 38.209  1.00 14.77 ? 95  TYR A CB    1 
ATOM   1899 C  CG    . TYR E 3 41 ? -4.786  26.302 37.301  1.00 12.92 ? 95  TYR A CG    1 
ATOM   1900 C  CD1   . TYR E 3 41 ? -4.719  26.125 35.925  1.00 13.76 ? 95  TYR A CD1   1 
ATOM   1901 C  CD2   . TYR E 3 41 ? -5.813  27.075 37.819  1.00 12.52 ? 95  TYR A CD2   1 
ATOM   1902 C  CE1   . TYR E 3 41 ? -5.652  26.699 35.086  1.00 13.58 ? 95  TYR A CE1   1 
ATOM   1903 C  CE2   . TYR E 3 41 ? -6.749  27.659 36.995  1.00 15.89 ? 95  TYR A CE2   1 
ATOM   1904 C  CZ    . TYR E 3 41 ? -6.666  27.472 35.622  1.00 16.76 ? 95  TYR A CZ    1 
ATOM   1905 O  OH    . TYR E 3 41 ? -7.584  28.079 34.791  1.00 18.37 ? 95  TYR A OH    1 
ATOM   1906 N  N     . MET E 3 42 ? -1.687  26.104 40.630  1.00 18.31 ? 96  MET A N     1 
ATOM   1907 C  CA    . MET E 3 42 ? -0.846  25.445 41.628  1.00 19.84 ? 96  MET A CA    1 
ATOM   1908 C  C     . MET E 3 42 ? -1.331  24.015 41.818  1.00 19.53 ? 96  MET A C     1 
ATOM   1909 O  O     . MET E 3 42 ? -2.529  23.741 41.699  1.00 17.56 ? 96  MET A O     1 
ATOM   1910 C  CB    . MET E 3 42 ? -0.896  26.185 42.962  1.00 21.80 ? 96  MET A CB    1 
ATOM   1911 C  CG    . MET E 3 42 ? 0.137   27.296 43.106  1.00 27.18 ? 96  MET A CG    1 
ATOM   1912 S  SD    . MET E 3 42 ? -0.029  28.204 44.647  1.00 34.92 ? 96  MET A SD    1 
ATOM   1913 C  CE    . MET E 3 42 ? 0.362   26.941 45.870  1.00 29.67 ? 96  MET A CE    1 
ATOM   1914 N  N     . GLU E 3 43 ? -0.393  23.113 42.091  1.00 20.21 ? 97  GLU A N     1 
ATOM   1915 C  CA    . GLU E 3 43 ? -0.706  21.707 42.286  1.00 22.00 ? 97  GLU A CA    1 
ATOM   1916 C  C     . GLU E 3 43 ? -0.306  21.259 43.690  1.00 21.75 ? 97  GLU A C     1 
ATOM   1917 O  O     . GLU E 3 43 ? -0.834  20.288 44.220  1.00 22.59 ? 97  GLU A O     1 
ATOM   1918 C  CB    . GLU E 3 43 ? 0.027   20.865 41.241  1.00 25.09 ? 97  GLU A CB    1 
ATOM   1919 C  CG    . GLU E 3 43 ? -0.856  19.914 40.476  1.00 31.59 ? 97  GLU A CG    1 
ATOM   1920 C  CD    . GLU E 3 43 ? -0.074  18.975 39.554  1.00 39.07 ? 97  GLU A CD    1 
ATOM   1921 O  OE1   . GLU E 3 43 ? 0.776   19.502 38.770  1.00 37.27 ? 97  GLU A OE1   1 
ATOM   1922 O  OE2   . GLU E 3 43 ? -0.327  17.724 39.616  1.00 38.84 ? 97  GLU A OE2   1 
ATOM   1923 N  N     . GLN E 3 44 ? 0.640   21.971 44.282  1.00 21.61 ? 98  GLN A N     1 
ATOM   1924 C  CA    . GLN E 3 44 ? 1.104   21.662 45.626  1.00 21.43 ? 98  GLN A CA    1 
ATOM   1925 C  C     . GLN E 3 44 ? 0.866   22.856 46.519  1.00 19.01 ? 98  GLN A C     1 
ATOM   1926 O  O     . GLN E 3 44 ? 0.329   23.860 46.082  1.00 20.70 ? 98  GLN A O     1 
ATOM   1927 C  CB    . GLN E 3 44 ? 2.589   21.335 45.616  1.00 24.95 ? 98  GLN A CB    1 
ATOM   1928 C  CG    . GLN E 3 44 ? 2.963   20.220 44.696  1.00 28.70 ? 98  GLN A CG    1 
ATOM   1929 C  CD    . GLN E 3 44 ? 4.458   20.139 44.512  1.00 33.27 ? 98  GLN A CD    1 
ATOM   1930 O  OE1   . GLN E 3 44 ? 5.087   21.083 44.037  1.00 36.67 ? 98  GLN A OE1   1 
ATOM   1931 N  NE2   . GLN E 3 44 ? 5.038   19.015 44.888  1.00 35.98 ? 98  GLN A NE2   1 
ATOM   1932 N  N     . THR E 3 45 ? 1.285   22.753 47.769  1.00 19.01 ? 99  THR A N     1 
ATOM   1933 C  CA    . THR E 3 45 ? 1.097   23.834 48.734  1.00 17.91 ? 99  THR A CA    1 
ATOM   1934 C  C     . THR E 3 45 ? 2.208   24.857 48.648  1.00 19.79 ? 99  THR A C     1 
ATOM   1935 O  O     . THR E 3 45 ? 3.246   24.575 48.098  1.00 21.74 ? 99  THR A O     1 
ATOM   1936 C  CB    . THR E 3 45 ? 1.071   23.289 50.148  1.00 15.93 ? 99  THR A CB    1 
ATOM   1937 O  OG1   . THR E 3 45 ? 2.221   22.471 50.345  1.00 16.31 ? 99  THR A OG1   1 
ATOM   1938 C  CG2   . THR E 3 45 ? -0.160  22.466 50.383  1.00 12.67 ? 99  THR A CG2   1 
ATOM   1939 N  N     . TRP E 3 46 ? 1.985   26.048 49.190  1.00 21.70 ? 100 TRP A N     1 
ATOM   1940 C  CA    . TRP E 3 46 ? 3.000   27.101 49.184  1.00 21.22 ? 100 TRP A CA    1 
ATOM   1941 C  C     . TRP E 3 46 ? 4.379   26.547 49.524  1.00 19.09 ? 100 TRP A C     1 
ATOM   1942 O  O     . TRP E 3 46 ? 5.328   26.772 48.803  1.00 18.36 ? 100 TRP A O     1 
ATOM   1943 C  CB    . TRP E 3 46 ? 2.632   28.197 50.193  1.00 27.45 ? 100 TRP A CB    1 
ATOM   1944 C  CG    . TRP E 3 46 ? 3.765   29.156 50.484  1.00 34.53 ? 100 TRP A CG    1 
ATOM   1945 C  CD1   . TRP E 3 46 ? 4.123   30.249 49.745  1.00 37.48 ? 100 TRP A CD1   1 
ATOM   1946 C  CD2   . TRP E 3 46 ? 4.772   29.019 51.507  1.00 36.80 ? 100 TRP A CD2   1 
ATOM   1947 N  NE1   . TRP E 3 46 ? 5.297   30.793 50.236  1.00 38.30 ? 100 TRP A NE1   1 
ATOM   1948 C  CE2   . TRP E 3 46 ? 5.713   30.056 51.316  1.00 37.75 ? 100 TRP A CE2   1 
ATOM   1949 C  CE3   . TRP E 3 46 ? 4.970   28.117 52.569  1.00 38.42 ? 100 TRP A CE3   1 
ATOM   1950 C  CZ2   . TRP E 3 46 ? 6.843   30.210 52.133  1.00 39.92 ? 100 TRP A CZ2   1 
ATOM   1951 C  CZ3   . TRP E 3 46 ? 6.095   28.269 53.382  1.00 39.16 ? 100 TRP A CZ3   1 
ATOM   1952 C  CH2   . TRP E 3 46 ? 7.013   29.309 53.158  1.00 39.93 ? 100 TRP A CH2   1 
ATOM   1953 N  N     . ALA E 3 47 ? 4.470   25.803 50.622  1.00 18.07 ? 101 ALA A N     1 
ATOM   1954 C  CA    . ALA E 3 47 ? 5.731   25.223 51.088  1.00 16.76 ? 101 ALA A CA    1 
ATOM   1955 C  C     . ALA E 3 47 ? 6.391   24.186 50.185  1.00 16.98 ? 101 ALA A C     1 
ATOM   1956 O  O     . ALA E 3 47 ? 7.603   24.187 50.029  1.00 15.19 ? 101 ALA A O     1 
ATOM   1957 C  CB    . ALA E 3 47 ? 5.542   24.641 52.486  1.00 14.60 ? 101 ALA A CB    1 
ATOM   1958 N  N     . GLU E 3 48 ? 5.602   23.286 49.613  1.00 16.62 ? 102 GLU A N     1 
ATOM   1959 C  CA    . GLU E 3 48 ? 6.150   22.272 48.722  1.00 19.16 ? 102 GLU A CA    1 
ATOM   1960 C  C     . GLU E 3 48 ? 6.628   22.977 47.467  1.00 20.48 ? 102 GLU A C     1 
ATOM   1961 O  O     . GLU E 3 48 ? 7.654   22.643 46.901  1.00 23.12 ? 102 GLU A O     1 
ATOM   1962 C  CB    . GLU E 3 48 ? 5.079   21.236 48.385  1.00 19.98 ? 102 GLU A CB    1 
ATOM   1963 C  CG    . GLU E 3 48 ? 4.421   20.693 49.618  1.00 19.89 ? 102 GLU A CG    1 
ATOM   1964 C  CD    . GLU E 3 48 ? 3.291   19.755 49.337  1.00 20.40 ? 102 GLU A CD    1 
ATOM   1965 O  OE1   . GLU E 3 48 ? 2.397   20.097 48.549  1.00 15.14 ? 102 GLU A OE1   1 
ATOM   1966 O  OE2   . GLU E 3 48 ? 3.292   18.671 49.938  1.00 24.44 ? 102 GLU A OE2   1 
ATOM   1967 N  N     . GLU E 3 49 ? 5.871   23.980 47.059  1.00 21.45 ? 103 GLU A N     1 
ATOM   1968 C  CA    . GLU E 3 49 ? 6.194   24.787 45.905  1.00 22.73 ? 103 GLU A CA    1 
ATOM   1969 C  C     . GLU E 3 49 ? 7.480   25.581 46.124  1.00 22.43 ? 103 GLU A C     1 
ATOM   1970 O  O     . GLU E 3 49 ? 8.286   25.727 45.226  1.00 22.76 ? 103 GLU A O     1 
ATOM   1971 C  CB    . GLU E 3 49 ? 5.055   25.751 45.635  1.00 27.24 ? 103 GLU A CB    1 
ATOM   1972 C  CG    . GLU E 3 49 ? 5.139   26.410 44.288  1.00 35.41 ? 103 GLU A CG    1 
ATOM   1973 C  CD    . GLU E 3 49 ? 4.589   25.512 43.202  1.00 40.52 ? 103 GLU A CD    1 
ATOM   1974 O  OE1   . GLU E 3 49 ? 4.937   24.296 43.194  1.00 41.23 ? 103 GLU A OE1   1 
ATOM   1975 O  OE2   . GLU E 3 49 ? 3.808   26.033 42.364  1.00 44.87 ? 103 GLU A OE2   1 
ATOM   1976 N  N     . ALA E 3 50 ? 7.665   26.111 47.324  1.00 20.66 ? 104 ALA A N     1 
ATOM   1977 C  CA    . ALA E 3 50 ? 8.869   26.870 47.622  1.00 21.09 ? 104 ALA A CA    1 
ATOM   1978 C  C     . ALA E 3 50 ? 10.095  25.979 47.512  1.00 22.38 ? 104 ALA A C     1 
ATOM   1979 O  O     . ALA E 3 50 ? 11.077  26.342 46.881  1.00 25.39 ? 104 ALA A O     1 
ATOM   1980 C  CB    . ALA E 3 50 ? 8.782   27.457 49.008  1.00 21.89 ? 104 ALA A CB    1 
ATOM   1981 N  N     . GLU E 3 51 ? 10.029  24.817 48.140  1.00 19.94 ? 105 GLU A N     1 
ATOM   1982 C  CA    . GLU E 3 51 ? 11.113  23.859 48.105  1.00 19.43 ? 105 GLU A CA    1 
ATOM   1983 C  C     . GLU E 3 51 ? 11.473  23.558 46.663  1.00 20.40 ? 105 GLU A C     1 
ATOM   1984 O  O     . GLU E 3 51 ? 12.616  23.679 46.252  1.00 22.37 ? 105 GLU A O     1 
ATOM   1985 C  CB    . GLU E 3 51 ? 10.675  22.584 48.825  1.00 16.42 ? 105 GLU A CB    1 
ATOM   1986 C  CG    . GLU E 3 51 ? 11.770  21.542 49.028  1.00 13.13 ? 105 GLU A CG    1 
ATOM   1987 C  CD    . GLU E 3 51 ? 13.009  22.107 49.659  1.00 17.23 ? 105 GLU A CD    1 
ATOM   1988 O  OE1   . GLU E 3 51 ? 12.900  23.045 50.461  1.00 16.83 ? 105 GLU A OE1   1 
ATOM   1989 O  OE2   . GLU E 3 51 ? 14.100  21.603 49.359  1.00 15.02 ? 105 GLU A OE2   1 
ATOM   1990 N  N     . LYS E 3 52 ? 10.474  23.177 45.890  1.00 20.63 ? 106 LYS A N     1 
ATOM   1991 C  CA    . LYS E 3 52 ? 10.659  22.848 44.492  1.00 21.63 ? 106 LYS A CA    1 
ATOM   1992 C  C     . LYS E 3 52 ? 11.461  23.910 43.764  1.00 22.62 ? 106 LYS A C     1 
ATOM   1993 O  O     . LYS E 3 52 ? 12.388  23.583 43.048  1.00 21.91 ? 106 LYS A O     1 
ATOM   1994 C  CB    . LYS E 3 52 ? 9.295   22.665 43.833  1.00 23.33 ? 106 LYS A CB    1 
ATOM   1995 C  CG    . LYS E 3 52 ? 9.304   21.849 42.560  1.00 25.96 ? 106 LYS A CG    1 
ATOM   1996 C  CD    . LYS E 3 52 ? 7.944   21.879 41.879  1.00 28.17 ? 106 LYS A CD    1 
ATOM   1997 C  CE    . LYS E 3 52 ? 7.958   21.076 40.592  1.00 28.75 ? 106 LYS A CE    1 
ATOM   1998 N  NZ    . LYS E 3 52 ? 9.032   21.540 39.660  1.00 33.25 ? 106 LYS A NZ    1 
ATOM   1999 N  N     . GLU E 3 53 ? 11.108  25.178 43.951  1.00 24.27 ? 107 GLU A N     1 
ATOM   2000 C  CA    . GLU E 3 53 ? 11.825  26.268 43.295  1.00 26.30 ? 107 GLU A CA    1 
ATOM   2001 C  C     . GLU E 3 53 ? 13.287  26.367 43.724  1.00 27.50 ? 107 GLU A C     1 
ATOM   2002 O  O     . GLU E 3 53 ? 14.166  26.645 42.910  1.00 29.74 ? 107 GLU A O     1 
ATOM   2003 C  CB    . GLU E 3 53 ? 11.111  27.600 43.536  1.00 25.67 ? 107 GLU A CB    1 
ATOM   2004 C  CG    . GLU E 3 53 ? 9.953   27.861 42.580  1.00 29.81 ? 107 GLU A CG    1 
ATOM   2005 C  CD    . GLU E 3 53 ? 10.391  27.914 41.114  1.00 33.92 ? 107 GLU A CD    1 
ATOM   2006 O  OE1   . GLU E 3 53 ? 11.288  28.724 40.796  1.00 37.69 ? 107 GLU A OE1   1 
ATOM   2007 O  OE2   . GLU E 3 53 ? 9.844   27.161 40.276  1.00 27.74 ? 107 GLU A OE2   1 
ATOM   2008 N  N     . LEU E 3 54 ? 13.540  26.124 45.004  1.00 25.56 ? 108 LEU A N     1 
ATOM   2009 C  CA    . LEU E 3 54 ? 14.885  26.160 45.543  1.00 22.19 ? 108 LEU A CA    1 
ATOM   2010 C  C     . LEU E 3 54 ? 15.722  25.073 44.881  1.00 20.74 ? 108 LEU A C     1 
ATOM   2011 O  O     . LEU E 3 54 ? 16.874  25.292 44.550  1.00 20.01 ? 108 LEU A O     1 
ATOM   2012 C  CB    . LEU E 3 54 ? 14.832  25.949 47.060  1.00 23.84 ? 108 LEU A CB    1 
ATOM   2013 C  CG    . LEU E 3 54 ? 15.196  27.116 47.989  1.00 23.91 ? 108 LEU A CG    1 
ATOM   2014 C  CD1   . LEU E 3 54 ? 14.734  28.439 47.414  1.00 23.51 ? 108 LEU A CD1   1 
ATOM   2015 C  CD2   . LEU E 3 54 ? 14.570  26.871 49.340  1.00 20.74 ? 108 LEU A CD2   1 
ATOM   2016 N  N     . LEU E 3 55 ? 15.129  23.904 44.678  1.00 17.04 ? 109 LEU A N     1 
ATOM   2017 C  CA    . LEU E 3 55 ? 15.835  22.796 44.062  1.00 14.21 ? 109 LEU A CA    1 
ATOM   2018 C  C     . LEU E 3 55 ? 16.161  23.100 42.615  1.00 15.58 ? 109 LEU A C     1 
ATOM   2019 O  O     . LEU E 3 55 ? 17.265  22.869 42.159  1.00 14.64 ? 109 LEU A O     1 
ATOM   2020 C  CB    . LEU E 3 55 ? 14.996  21.517 44.181  1.00 10.99 ? 109 LEU A CB    1 
ATOM   2021 C  CG    . LEU E 3 55 ? 15.354  20.542 45.305  1.00 10.04 ? 109 LEU A CG    1 
ATOM   2022 C  CD1   . LEU E 3 55 ? 15.719  21.288 46.525  1.00 12.06 ? 109 LEU A CD1   1 
ATOM   2023 C  CD2   . LEU E 3 55 ? 14.205  19.613 45.585  1.00 2.12  ? 109 LEU A CD2   1 
ATOM   2024 N  N     . LYS E 3 56 ? 15.184  23.644 41.906  1.00 19.77 ? 110 LYS A N     1 
ATOM   2025 C  CA    . LYS E 3 56 ? 15.318  23.995 40.497  1.00 20.50 ? 110 LYS A CA    1 
ATOM   2026 C  C     . LYS E 3 56 ? 16.325  25.109 40.265  1.00 19.81 ? 110 LYS A C     1 
ATOM   2027 O  O     . LYS E 3 56 ? 16.992  25.142 39.243  1.00 19.42 ? 110 LYS A O     1 
ATOM   2028 C  CB    . LYS E 3 56 ? 13.961  24.415 39.949  1.00 25.01 ? 110 LYS A CB    1 
ATOM   2029 C  CG    . LYS E 3 56 ? 13.964  24.771 38.478  1.00 29.64 ? 110 LYS A CG    1 
ATOM   2030 C  CD    . LYS E 3 56 ? 12.982  25.900 38.219  1.00 36.97 ? 110 LYS A CD    1 
ATOM   2031 C  CE    . LYS E 3 56 ? 13.136  26.449 36.824  1.00 41.38 ? 110 LYS A CE    1 
ATOM   2032 N  NZ    . LYS E 3 56 ? 14.539  26.860 36.563  1.00 43.94 ? 110 LYS A NZ    1 
ATOM   2033 N  N     . ASP E 3 57 ? 16.421  26.028 41.215  1.00 19.12 ? 111 ASP A N     1 
ATOM   2034 C  CA    . ASP E 3 57 ? 17.363  27.126 41.114  1.00 18.22 ? 111 ASP A CA    1 
ATOM   2035 C  C     . ASP E 3 57 ? 18.773  26.598 41.264  1.00 17.27 ? 111 ASP A C     1 
ATOM   2036 O  O     . ASP E 3 57 ? 19.663  26.979 40.521  1.00 20.26 ? 111 ASP A O     1 
ATOM   2037 C  CB    . ASP E 3 57 ? 17.106  28.158 42.210  1.00 20.49 ? 111 ASP A CB    1 
ATOM   2038 C  CG    . ASP E 3 57 ? 15.959  29.083 41.887  1.00 24.67 ? 111 ASP A CG    1 
ATOM   2039 O  OD1   . ASP E 3 57 ? 15.415  28.994 40.768  1.00 26.74 ? 111 ASP A OD1   1 
ATOM   2040 O  OD2   . ASP E 3 57 ? 15.605  29.914 42.749  1.00 26.59 ? 111 ASP A OD2   1 
ATOM   2041 N  N     . ASN E 3 58 ? 18.964  25.723 42.237  1.00 16.36 ? 112 ASN A N     1 
ATOM   2042 C  CA    . ASN E 3 58 ? 20.264  25.141 42.517  1.00 16.28 ? 112 ASN A CA    1 
ATOM   2043 C  C     . ASN E 3 58 ? 20.706  24.279 41.356  1.00 18.95 ? 112 ASN A C     1 
ATOM   2044 O  O     . ASN E 3 58 ? 21.857  24.304 40.950  1.00 19.44 ? 112 ASN A O     1 
ATOM   2045 C  CB    . ASN E 3 58 ? 20.185  24.326 43.803  1.00 13.23 ? 112 ASN A CB    1 
ATOM   2046 C  CG    . ASN E 3 58 ? 21.524  23.939 44.319  1.00 11.13 ? 112 ASN A CG    1 
ATOM   2047 O  OD1   . ASN E 3 58 ? 22.469  24.692 44.235  1.00 16.51 ? 112 ASN A OD1   1 
ATOM   2048 N  ND2   . ASN E 3 58 ? 21.613  22.761 44.882  1.00 15.54 ? 112 ASN A ND2   1 
ATOM   2049 N  N     . GLU E 3 59 ? 19.773  23.509 40.822  1.00 20.85 ? 113 GLU A N     1 
ATOM   2050 C  CA    . GLU E 3 59 ? 20.066  22.673 39.686  1.00 22.07 ? 113 GLU A CA    1 
ATOM   2051 C  C     . GLU E 3 59 ? 20.468  23.610 38.559  1.00 22.34 ? 113 GLU A C     1 
ATOM   2052 O  O     . GLU E 3 59 ? 21.521  23.460 37.960  1.00 24.41 ? 113 GLU A O     1 
ATOM   2053 C  CB    . GLU E 3 59 ? 18.826  21.871 39.295  1.00 25.17 ? 113 GLU A CB    1 
ATOM   2054 C  CG    . GLU E 3 59 ? 18.977  21.097 38.004  1.00 30.41 ? 113 GLU A CG    1 
ATOM   2055 C  CD    . GLU E 3 59 ? 17.691  20.421 37.561  1.00 35.57 ? 113 GLU A CD    1 
ATOM   2056 O  OE1   . GLU E 3 59 ? 16.591  20.986 37.792  1.00 36.37 ? 113 GLU A OE1   1 
ATOM   2057 O  OE2   . GLU E 3 59 ? 17.785  19.327 36.956  1.00 40.03 ? 113 GLU A OE2   1 
ATOM   2058 N  N     . LEU E 3 60 ? 19.635  24.600 38.286  1.00 22.28 ? 114 LEU A N     1 
ATOM   2059 C  CA    . LEU E 3 60 ? 19.926  25.543 37.224  1.00 22.24 ? 114 LEU A CA    1 
ATOM   2060 C  C     . LEU E 3 60 ? 21.294  26.196 37.379  1.00 21.83 ? 114 LEU A C     1 
ATOM   2061 O  O     . LEU E 3 60 ? 22.062  26.291 36.417  1.00 22.24 ? 114 LEU A O     1 
ATOM   2062 C  CB    . LEU E 3 60 ? 18.828  26.600 37.170  1.00 22.00 ? 114 LEU A CB    1 
ATOM   2063 C  CG    . LEU E 3 60 ? 18.756  27.477 35.923  1.00 21.90 ? 114 LEU A CG    1 
ATOM   2064 C  CD1   . LEU E 3 60 ? 17.360  28.029 35.784  1.00 22.58 ? 114 LEU A CD1   1 
ATOM   2065 C  CD2   . LEU E 3 60 ? 19.772  28.585 36.010  1.00 22.75 ? 114 LEU A CD2   1 
ATOM   2066 N  N     . LYS E 3 61 ? 21.597  26.639 38.591  1.00 21.00 ? 115 LYS A N     1 
ATOM   2067 C  CA    . LYS E 3 61 ? 22.869  27.280 38.879  1.00 21.91 ? 115 LYS A CA    1 
ATOM   2068 C  C     . LYS E 3 61 ? 24.078  26.380 38.627  1.00 21.01 ? 115 LYS A C     1 
ATOM   2069 O  O     . LYS E 3 61 ? 25.070  26.831 38.062  1.00 19.04 ? 115 LYS A O     1 
ATOM   2070 C  CB    . LYS E 3 61 ? 22.861  27.766 40.328  1.00 23.73 ? 115 LYS A CB    1 
ATOM   2071 C  CG    . LYS E 3 61 ? 24.163  28.364 40.844  1.00 28.52 ? 115 LYS A CG    1 
ATOM   2072 C  CD    . LYS E 3 61 ? 25.119  27.304 41.371  1.00 32.05 ? 115 LYS A CD    1 
ATOM   2073 C  CE    . LYS E 3 61 ? 25.847  27.780 42.597  1.00 34.36 ? 115 LYS A CE    1 
ATOM   2074 N  NZ    . LYS E 3 61 ? 24.881  27.971 43.745  1.00 37.33 ? 115 LYS A NZ    1 
ATOM   2075 N  N     . LYS E 3 62 ? 23.991  25.118 39.047  1.00 21.31 ? 116 LYS A N     1 
ATOM   2076 C  CA    . LYS E 3 62 ? 25.082  24.170 38.873  1.00 22.57 ? 116 LYS A CA    1 
ATOM   2077 C  C     . LYS E 3 62 ? 25.302  23.789 37.422  1.00 22.23 ? 116 LYS A C     1 
ATOM   2078 O  O     . LYS E 3 62 ? 26.421  23.545 37.004  1.00 23.12 ? 116 LYS A O     1 
ATOM   2079 C  CB    . LYS E 3 62 ? 24.833  22.925 39.726  1.00 23.81 ? 116 LYS A CB    1 
ATOM   2080 C  CG    . LYS E 3 62 ? 24.756  23.252 41.207  1.00 28.23 ? 116 LYS A CG    1 
ATOM   2081 C  CD    . LYS E 3 62 ? 24.825  22.037 42.119  1.00 28.25 ? 116 LYS A CD    1 
ATOM   2082 C  CE    . LYS E 3 62 ? 23.624  21.155 42.003  1.00 28.20 ? 116 LYS A CE    1 
ATOM   2083 N  NZ    . LYS E 3 62 ? 23.648  20.130 43.075  1.00 30.67 ? 116 LYS A NZ    1 
ATOM   2084 N  N     . LEU E 3 63 ? 24.232  23.757 36.651  1.00 20.61 ? 117 LEU A N     1 
ATOM   2085 C  CA    . LEU E 3 63 ? 24.328  23.424 35.246  1.00 22.46 ? 117 LEU A CA    1 
ATOM   2086 C  C     . LEU E 3 63 ? 25.083  24.531 34.492  1.00 23.59 ? 117 LEU A C     1 
ATOM   2087 O  O     . LEU E 3 63 ? 25.864  24.253 33.589  1.00 24.54 ? 117 LEU A O     1 
ATOM   2088 C  CB    . LEU E 3 63 ? 22.920  23.238 34.685  1.00 22.89 ? 117 LEU A CB    1 
ATOM   2089 C  CG    . LEU E 3 63 ? 22.766  22.369 33.451  1.00 21.95 ? 117 LEU A CG    1 
ATOM   2090 C  CD1   . LEU E 3 63 ? 23.627  21.136 33.580  1.00 21.73 ? 117 LEU A CD1   1 
ATOM   2091 C  CD2   . LEU E 3 63 ? 21.313  22.003 33.289  1.00 24.32 ? 117 LEU A CD2   1 
ATOM   2092 N  N     . ARG E 3 64 ? 24.848  25.783 34.860  1.00 22.75 ? 118 ARG A N     1 
ATOM   2093 C  CA    . ARG E 3 64 ? 25.539  26.882 34.219  1.00 21.92 ? 118 ARG A CA    1 
ATOM   2094 C  C     . ARG E 3 64 ? 27.021  26.783 34.492  1.00 21.13 ? 118 ARG A C     1 
ATOM   2095 O  O     . ARG E 3 64 ? 27.827  27.077 33.631  1.00 22.11 ? 118 ARG A O     1 
ATOM   2096 C  CB    . ARG E 3 64 ? 25.033  28.225 34.742  1.00 23.84 ? 118 ARG A CB    1 
ATOM   2097 C  CG    . ARG E 3 64 ? 23.733  28.702 34.143  1.00 24.35 ? 118 ARG A CG    1 
ATOM   2098 C  CD    . ARG E 3 64 ? 23.583  30.199 34.329  1.00 23.78 ? 118 ARG A CD    1 
ATOM   2099 N  NE    . ARG E 3 64 ? 23.084  30.558 35.645  1.00 24.45 ? 118 ARG A NE    1 
ATOM   2100 C  CZ    . ARG E 3 64 ? 21.829  30.912 35.876  1.00 25.36 ? 118 ARG A CZ    1 
ATOM   2101 N  NH1   . ARG E 3 64 ? 20.964  30.951 34.882  1.00 22.80 ? 118 ARG A NH1   1 
ATOM   2102 N  NH2   . ARG E 3 64 ? 21.438  31.226 37.097  1.00 29.13 ? 118 ARG A NH2   1 
ATOM   2103 N  N     . GLU E 3 65 ? 27.368  26.382 35.706  1.00 21.72 ? 119 GLU A N     1 
ATOM   2104 C  CA    . GLU E 3 65 ? 28.760  26.235 36.114  1.00 22.42 ? 119 GLU A CA    1 
ATOM   2105 C  C     . GLU E 3 65 ? 29.399  25.150 35.256  1.00 19.57 ? 119 GLU A C     1 
ATOM   2106 O  O     . GLU E 3 65 ? 30.453  25.347 34.673  1.00 17.42 ? 119 GLU A O     1 
ATOM   2107 C  CB    . GLU E 3 65 ? 28.832  25.891 37.623  1.00 25.77 ? 119 GLU A CB    1 
ATOM   2108 C  CG    . GLU E 3 65 ? 29.466  24.519 37.981  1.00 35.41 ? 119 GLU A CG    1 
ATOM   2109 C  CD    . GLU E 3 65 ? 28.815  23.830 39.199  1.00 40.90 ? 119 GLU A CD    1 
ATOM   2110 O  OE1   . GLU E 3 65 ? 28.934  24.365 40.341  1.00 41.63 ? 119 GLU A OE1   1 
ATOM   2111 O  OE2   . GLU E 3 65 ? 28.181  22.750 39.001  1.00 38.47 ? 119 GLU A OE2   1 
ATOM   2112 N  N     . ARG E 3 66 ? 28.734  24.006 35.178  1.00 18.21 ? 120 ARG A N     1 
ATOM   2113 C  CA    . ARG E 3 66 ? 29.218  22.884 34.393  1.00 17.28 ? 120 ARG A CA    1 
ATOM   2114 C  C     . ARG E 3 66 ? 29.468  23.263 32.937  1.00 17.43 ? 120 ARG A C     1 
ATOM   2115 O  O     . ARG E 3 66 ? 30.556  23.066 32.424  1.00 15.56 ? 120 ARG A O     1 
ATOM   2116 C  CB    . ARG E 3 66 ? 28.220  21.735 34.490  1.00 16.07 ? 120 ARG A CB    1 
ATOM   2117 C  CG    . ARG E 3 66 ? 28.623  20.475 33.768  1.00 19.24 ? 120 ARG A CG    1 
ATOM   2118 C  CD    . ARG E 3 66 ? 29.982  19.955 34.177  1.00 17.49 ? 120 ARG A CD    1 
ATOM   2119 N  NE    . ARG E 3 66 ? 30.132  18.544 33.825  1.00 21.08 ? 120 ARG A NE    1 
ATOM   2120 C  CZ    . ARG E 3 66 ? 31.248  17.839 33.977  1.00 23.13 ? 120 ARG A CZ    1 
ATOM   2121 N  NH1   . ARG E 3 66 ? 32.338  18.402 34.466  1.00 24.77 ? 120 ARG A NH1   1 
ATOM   2122 N  NH2   . ARG E 3 66 ? 31.259  16.556 33.669  1.00 23.67 ? 120 ARG A NH2   1 
ATOM   2123 N  N     . VAL E 3 67 ? 28.463  23.819 32.278  1.00 16.46 ? 121 VAL A N     1 
ATOM   2124 C  CA    . VAL E 3 67 ? 28.596  24.235 30.884  1.00 17.23 ? 121 VAL A CA    1 
ATOM   2125 C  C     . VAL E 3 67 ? 29.787  25.157 30.643  1.00 18.03 ? 121 VAL A C     1 
ATOM   2126 O  O     . VAL E 3 67 ? 30.546  24.955 29.712  1.00 18.07 ? 121 VAL A O     1 
ATOM   2127 C  CB    . VAL E 3 67 ? 27.303  24.908 30.390  1.00 16.52 ? 121 VAL A CB    1 
ATOM   2128 C  CG1   . VAL E 3 67 ? 27.550  25.606 29.067  1.00 16.41 ? 121 VAL A CG1   1 
ATOM   2129 C  CG2   . VAL E 3 67 ? 26.218  23.855 30.216  1.00 16.64 ? 121 VAL A CG2   1 
ATOM   2130 N  N     . LYS E 3 68 ? 29.933  26.173 31.481  1.00 19.87 ? 122 LYS A N     1 
ATOM   2131 C  CA    . LYS E 3 68 ? 31.059  27.098 31.403  1.00 20.56 ? 122 LYS A CA    1 
ATOM   2132 C  C     . LYS E 3 68 ? 32.343  26.285 31.409  1.00 21.57 ? 122 LYS A C     1 
ATOM   2133 O  O     . LYS E 3 68 ? 33.250  26.531 30.628  1.00 22.61 ? 122 LYS A O     1 
ATOM   2134 C  CB    . LYS E 3 68 ? 31.081  28.026 32.628  1.00 23.68 ? 122 LYS A CB    1 
ATOM   2135 C  CG    . LYS E 3 68 ? 30.648  29.467 32.391  1.00 28.14 ? 122 LYS A CG    1 
ATOM   2136 C  CD    . LYS E 3 68 ? 29.182  29.556 31.980  1.00 33.38 ? 122 LYS A CD    1 
ATOM   2137 C  CE    . LYS E 3 68 ? 28.768  30.989 31.715  1.00 36.07 ? 122 LYS A CE    1 
ATOM   2138 N  NZ    . LYS E 3 68 ? 28.793  31.831 32.953  1.00 38.47 ? 122 LYS A NZ    1 
ATOM   2139 N  N     . SER E 3 69 ? 32.405  25.318 32.318  1.00 22.91 ? 123 SER A N     1 
ATOM   2140 C  CA    . SER E 3 69 ? 33.561  24.444 32.467  1.00 21.65 ? 123 SER A CA    1 
ATOM   2141 C  C     . SER E 3 69 ? 33.856  23.707 31.175  1.00 23.52 ? 123 SER A C     1 
ATOM   2142 O  O     . SER E 3 69 ? 34.994  23.663 30.734  1.00 25.18 ? 123 SER A O     1 
ATOM   2143 C  CB    . SER E 3 69 ? 33.311  23.436 33.589  1.00 21.31 ? 123 SER A CB    1 
ATOM   2144 O  OG    . SER E 3 69 ? 34.441  22.627 33.853  1.00 20.38 ? 123 SER A OG    1 
ATOM   2145 N  N     . LEU E 3 70 ? 32.832  23.125 30.571  1.00 24.09 ? 124 LEU A N     1 
ATOM   2146 C  CA    . LEU E 3 70 ? 33.017  22.400 29.330  1.00 25.51 ? 124 LEU A CA    1 
ATOM   2147 C  C     . LEU E 3 70 ? 33.427  23.327 28.197  1.00 27.96 ? 124 LEU A C     1 
ATOM   2148 O  O     . LEU E 3 70 ? 34.355  23.036 27.461  1.00 28.02 ? 124 LEU A O     1 
ATOM   2149 C  CB    . LEU E 3 70 ? 31.742  21.633 28.964  1.00 23.47 ? 124 LEU A CB    1 
ATOM   2150 C  CG    . LEU E 3 70 ? 31.400  20.491 29.923  1.00 22.19 ? 124 LEU A CG    1 
ATOM   2151 C  CD1   . LEU E 3 70 ? 30.138  19.785 29.482  1.00 22.15 ? 124 LEU A CD1   1 
ATOM   2152 C  CD2   . LEU E 3 70 ? 32.551  19.524 29.969  1.00 19.85 ? 124 LEU A CD2   1 
ATOM   2153 N  N     . GLU E 3 71 ? 32.738  24.448 28.058  1.00 31.45 ? 125 GLU A N     1 
ATOM   2154 C  CA    . GLU E 3 71 ? 33.060  25.392 27.008  1.00 35.07 ? 125 GLU A CA    1 
ATOM   2155 C  C     . GLU E 3 71 ? 34.506  25.847 27.138  1.00 37.82 ? 125 GLU A C     1 
ATOM   2156 O  O     . GLU E 3 71 ? 35.226  25.953 26.133  1.00 39.23 ? 125 GLU A O     1 
ATOM   2157 C  CB    . GLU E 3 71 ? 32.113  26.588 27.073  1.00 37.38 ? 125 GLU A CB    1 
ATOM   2158 C  CG    . GLU E 3 71 ? 30.760  26.311 26.425  1.00 41.85 ? 125 GLU A CG    1 
ATOM   2159 C  CD    . GLU E 3 71 ? 29.692  27.348 26.783  1.00 45.59 ? 125 GLU A CD    1 
ATOM   2160 O  OE1   . GLU E 3 71 ? 28.580  27.273 26.195  1.00 48.55 ? 125 GLU A OE1   1 
ATOM   2161 O  OE2   . GLU E 3 71 ? 29.956  28.223 27.652  1.00 46.07 ? 125 GLU A OE2   1 
ATOM   2162 N  N     . LYS E 3 72 ? 34.933  26.100 28.374  1.00 39.22 ? 126 LYS A N     1 
ATOM   2163 C  CA    . LYS E 3 72 ? 36.299  26.543 28.637  1.00 41.39 ? 126 LYS A CA    1 
ATOM   2164 C  C     . LYS E 3 72 ? 37.309  25.455 28.248  1.00 41.94 ? 126 LYS A C     1 
ATOM   2165 O  O     . LYS E 3 72 ? 38.443  25.735 27.884  1.00 42.29 ? 126 LYS A O     1 
ATOM   2166 C  CB    . LYS E 3 72 ? 36.447  26.910 30.119  1.00 41.96 ? 126 LYS A CB    1 
ATOM   2167 C  CG    . LYS E 3 72 ? 37.579  27.877 30.433  1.00 43.97 ? 126 LYS A CG    1 
ATOM   2168 C  CD    . LYS E 3 72 ? 38.915  27.166 30.599  1.00 47.36 ? 126 LYS A CD    1 
ATOM   2169 C  CE    . LYS E 3 72 ? 38.909  26.253 31.812  1.00 47.64 ? 126 LYS A CE    1 
ATOM   2170 N  NZ    . LYS E 3 72 ? 40.231  25.597 32.036  1.00 47.64 ? 126 LYS A NZ    1 
ATOM   2171 N  N     . THR E 3 73 ? 36.888  24.202 28.320  1.00 44.11 ? 127 THR A N     1 
ATOM   2172 C  CA    . THR E 3 73 ? 37.762  23.088 27.966  1.00 45.63 ? 127 THR A CA    1 
ATOM   2173 C  C     . THR E 3 73 ? 37.813  22.923 26.450  1.00 46.59 ? 127 THR A C     1 
ATOM   2174 O  O     . THR E 3 73 ? 38.815  22.483 25.905  1.00 46.47 ? 127 THR A O     1 
ATOM   2175 C  CB    . THR E 3 73 ? 37.272  21.777 28.613  1.00 45.79 ? 127 THR A CB    1 
ATOM   2176 O  OG1   . THR E 3 73 ? 37.285  21.918 30.040  1.00 43.48 ? 127 THR A OG1   1 
ATOM   2177 C  CG2   . THR E 3 73 ? 38.165  20.613 28.211  1.00 45.24 ? 127 THR A CG2   1 
ATOM   2178 N  N     . LEU E 3 74 ? 36.726  23.284 25.772  1.00 49.26 ? 128 LEU A N     1 
ATOM   2179 C  CA    . LEU E 3 74 ? 36.661  23.213 24.307  1.00 50.84 ? 128 LEU A CA    1 
ATOM   2180 C  C     . LEU E 3 74 ? 37.276  24.466 23.696  1.00 51.63 ? 128 LEU A C     1 
ATOM   2181 O  O     . LEU E 3 74 ? 36.613  25.155 22.928  1.00 52.32 ? 128 LEU A O     1 
ATOM   2182 C  CB    . LEU E 3 74 ? 35.212  23.119 23.801  1.00 51.12 ? 128 LEU A CB    1 
ATOM   2183 C  CG    . LEU E 3 74 ? 34.458  21.788 23.748  1.00 52.47 ? 128 LEU A CG    1 
ATOM   2184 C  CD1   . LEU E 3 74 ? 35.210  20.774 22.862  1.00 52.45 ? 128 LEU A CD1   1 
ATOM   2185 C  CD2   . LEU E 3 74 ? 34.306  21.256 25.153  1.00 54.23 ? 128 LEU A CD2   1 
ATOM   2186 N  N     . SER E 3 75 ? 38.524  24.759 24.048  1.00 52.95 ? 129 SER A N     1 
ATOM   2187 C  CA    . SER E 3 75 ? 39.251  25.914 23.529  1.00 55.14 ? 129 SER A CA    1 
ATOM   2188 C  C     . SER E 3 75 ? 40.242  26.416 24.566  1.00 57.50 ? 129 SER A C     1 
ATOM   2189 O  O     . SER E 3 75 ? 40.465  27.625 24.666  1.00 58.00 ? 129 SER A O     1 
ATOM   2190 C  CB    . SER E 3 75 ? 38.310  27.072 23.187  1.00 54.97 ? 129 SER A CB    1 
ATOM   2191 O  OG    . SER E 3 75 ? 37.785  27.661 24.373  1.00 54.58 ? 129 SER A OG    1 
ATOM   2192 N  N     . LYS E 3 76 ? 40.838  25.510 25.335  1.00 59.89 ? 130 LYS A N     1 
ATOM   2193 C  CA    . LYS E 3 76 ? 41.792  25.931 26.355  1.00 62.75 ? 130 LYS A CA    1 
ATOM   2194 C  C     . LYS E 3 76 ? 43.207  26.028 25.787  1.00 64.67 ? 130 LYS A C     1 
ATOM   2195 O  O     . LYS E 3 76 ? 43.426  25.460 24.678  1.00 66.16 ? 130 LYS A O     1 
ATOM   2196 C  CB    . LYS E 3 76 ? 41.772  24.950 27.520  1.00 62.78 ? 130 LYS A CB    1 
ATOM   2197 C  CG    . LYS E 3 76 ? 42.576  25.390 28.738  1.00 62.67 ? 130 LYS A CG    1 
ATOM   2198 C  CD    . LYS E 3 76 ? 42.150  24.585 29.969  1.00 63.25 ? 130 LYS A CD    1 
ATOM   2199 C  CE    . LYS E 3 76 ? 43.115  24.794 31.127  1.00 64.61 ? 130 LYS A CE    1 
ATOM   2200 N  NZ    . LYS E 3 76 ? 44.441  24.100 30.874  1.00 64.66 ? 130 LYS A NZ    1 
ATOM   2201 O  OXT   . LYS E 3 76 ? 44.073  26.656 26.465  1.00 65.78 ? 130 LYS A OXT   1 
ATOM   2202 N  N     . LYS F 3 2  ? -4.191  57.332 42.018  1.00 50.95 ? 56  LYS B N     1 
ATOM   2203 C  CA    . LYS F 3 2  ? -3.204  57.075 40.931  1.00 53.41 ? 56  LYS B CA    1 
ATOM   2204 C  C     . LYS F 3 2  ? -2.746  55.594 40.892  1.00 53.32 ? 56  LYS B C     1 
ATOM   2205 O  O     . LYS F 3 2  ? -2.044  55.100 41.799  1.00 53.00 ? 56  LYS B O     1 
ATOM   2206 C  CB    . LYS F 3 2  ? -1.991  58.005 41.102  1.00 54.70 ? 56  LYS B CB    1 
ATOM   2207 C  CG    . LYS F 3 2  ? -0.879  57.789 40.065  1.00 57.89 ? 56  LYS B CG    1 
ATOM   2208 C  CD    . LYS F 3 2  ? 0.073   59.003 39.967  1.00 60.66 ? 56  LYS B CD    1 
ATOM   2209 C  CE    . LYS F 3 2  ? 0.868   59.248 41.270  1.00 62.31 ? 56  LYS B CE    1 
ATOM   2210 N  NZ    . LYS F 3 2  ? 1.760   60.458 41.179  1.00 62.36 ? 56  LYS B NZ    1 
ATOM   2211 N  N     . ARG F 3 3  ? -3.143  54.894 39.828  1.00 51.28 ? 57  ARG B N     1 
ATOM   2212 C  CA    . ARG F 3 3  ? -2.802  53.483 39.642  1.00 49.59 ? 57  ARG B CA    1 
ATOM   2213 C  C     . ARG F 3 3  ? -1.586  53.297 38.727  1.00 48.61 ? 57  ARG B C     1 
ATOM   2214 O  O     . ARG F 3 3  ? -1.102  54.246 38.123  1.00 49.64 ? 57  ARG B O     1 
ATOM   2215 C  CB    . ARG F 3 3  ? -3.999  52.753 39.040  1.00 48.29 ? 57  ARG B CB    1 
ATOM   2216 C  CG    . ARG F 3 3  ? -5.286  53.055 39.770  1.00 46.31 ? 57  ARG B CG    1 
ATOM   2217 C  CD    . ARG F 3 3  ? -6.496  52.729 38.928  1.00 43.16 ? 57  ARG B CD    1 
ATOM   2218 N  NE    . ARG F 3 3  ? -7.715  53.198 39.573  1.00 39.50 ? 57  ARG B NE    1 
ATOM   2219 C  CZ    . ARG F 3 3  ? -8.918  53.143 39.016  1.00 38.15 ? 57  ARG B CZ    1 
ATOM   2220 N  NH1   . ARG F 3 3  ? -9.074  52.638 37.798  1.00 35.92 ? 57  ARG B NH1   1 
ATOM   2221 N  NH2   . ARG F 3 3  ? -9.968  53.608 39.672  1.00 39.13 ? 57  ARG B NH2   1 
ATOM   2222 N  N     . ASN F 3 4  ? -1.097  52.067 38.626  1.00 47.29 ? 58  ASN B N     1 
ATOM   2223 C  CA    . ASN F 3 4  ? 0.049   51.767 37.773  1.00 45.27 ? 58  ASN B CA    1 
ATOM   2224 C  C     . ASN F 3 4  ? -0.371  50.870 36.609  1.00 43.31 ? 58  ASN B C     1 
ATOM   2225 O  O     . ASN F 3 4  ? 0.131   49.767 36.459  1.00 43.46 ? 58  ASN B O     1 
ATOM   2226 C  CB    . ASN F 3 4  ? 1.127   51.065 38.592  1.00 46.72 ? 58  ASN B CB    1 
ATOM   2227 C  CG    . ASN F 3 4  ? 2.324   50.658 37.750  1.00 47.53 ? 58  ASN B CG    1 
ATOM   2228 O  OD1   . ASN F 3 4  ? 3.052   49.711 38.090  1.00 47.26 ? 58  ASN B OD1   1 
ATOM   2229 N  ND2   . ASN F 3 4  ? 2.541   51.379 36.649  1.00 47.13 ? 58  ASN B ND2   1 
ATOM   2230 N  N     . ARG F 3 5  ? -1.288  51.349 35.780  1.00 41.39 ? 59  ARG B N     1 
ATOM   2231 C  CA    . ARG F 3 5  ? -1.781  50.582 34.640  1.00 39.28 ? 59  ARG B CA    1 
ATOM   2232 C  C     . ARG F 3 5  ? -0.748  50.494 33.512  1.00 38.27 ? 59  ARG B C     1 
ATOM   2233 O  O     . ARG F 3 5  ? -0.392  51.510 32.916  1.00 40.38 ? 59  ARG B O     1 
ATOM   2234 C  CB    . ARG F 3 5  ? -3.064  51.231 34.123  1.00 38.04 ? 59  ARG B CB    1 
ATOM   2235 C  CG    . ARG F 3 5  ? -4.069  50.275 33.487  1.00 38.53 ? 59  ARG B CG    1 
ATOM   2236 C  CD    . ARG F 3 5  ? -3.911  50.230 31.971  1.00 38.20 ? 59  ARG B CD    1 
ATOM   2237 N  NE    . ARG F 3 5  ? -5.095  49.710 31.278  1.00 33.61 ? 59  ARG B NE    1 
ATOM   2238 C  CZ    . ARG F 3 5  ? -6.322  50.197 31.423  1.00 32.02 ? 59  ARG B CZ    1 
ATOM   2239 N  NH1   . ARG F 3 5  ? -6.553  51.212 32.239  1.00 31.50 ? 59  ARG B NH1   1 
ATOM   2240 N  NH2   . ARG F 3 5  ? -7.322  49.685 30.732  1.00 32.00 ? 59  ARG B NH2   1 
ATOM   2241 N  N     . ILE F 3 6  ? -0.260  49.289 33.234  1.00 35.83 ? 60  ILE B N     1 
ATOM   2242 C  CA    . ILE F 3 6  ? 0.714   49.091 32.173  1.00 32.63 ? 60  ILE B CA    1 
ATOM   2243 C  C     . ILE F 3 6  ? 0.022   48.583 30.912  1.00 32.19 ? 60  ILE B C     1 
ATOM   2244 O  O     . ILE F 3 6  ? -0.761  47.648 30.965  1.00 31.96 ? 60  ILE B O     1 
ATOM   2245 C  CB    . ILE F 3 6  ? 1.765   48.063 32.578  1.00 31.77 ? 60  ILE B CB    1 
ATOM   2246 C  CG1   . ILE F 3 6  ? 2.422   48.488 33.892  1.00 31.40 ? 60  ILE B CG1   1 
ATOM   2247 C  CG2   . ILE F 3 6  ? 2.770   47.888 31.459  1.00 31.04 ? 60  ILE B CG2   1 
ATOM   2248 C  CD1   . ILE F 3 6  ? 3.349   49.653 33.785  1.00 32.59 ? 60  ILE B CD1   1 
ATOM   2249 N  N     . PRO F 3 7  ? 0.302   49.202 29.759  1.00 30.17 ? 61  PRO B N     1 
ATOM   2250 C  CA    . PRO F 3 7  ? -0.295  48.811 28.483  1.00 28.73 ? 61  PRO B CA    1 
ATOM   2251 C  C     . PRO F 3 7  ? -0.081  47.331 28.176  1.00 27.30 ? 61  PRO B C     1 
ATOM   2252 O  O     . PRO F 3 7  ? 0.972   46.793 28.458  1.00 28.12 ? 61  PRO B O     1 
ATOM   2253 C  CB    . PRO F 3 7  ? 0.418   49.723 27.491  1.00 29.85 ? 61  PRO B CB    1 
ATOM   2254 C  CG    . PRO F 3 7  ? 0.644   50.943 28.291  1.00 29.44 ? 61  PRO B CG    1 
ATOM   2255 C  CD    . PRO F 3 7  ? 1.146   50.393 29.590  1.00 28.83 ? 61  PRO B CD    1 
ATOM   2256 N  N     . LEU F 3 8  ? -1.082  46.687 27.585  1.00 26.82 ? 62  LEU B N     1 
ATOM   2257 C  CA    . LEU F 3 8  ? -1.020  45.269 27.245  1.00 27.24 ? 62  LEU B CA    1 
ATOM   2258 C  C     . LEU F 3 8  ? -0.590  44.907 25.835  1.00 27.36 ? 62  LEU B C     1 
ATOM   2259 O  O     . LEU F 3 8  ? -0.032  43.833 25.629  1.00 30.15 ? 62  LEU B O     1 
ATOM   2260 C  CB    . LEU F 3 8  ? -2.367  44.599 27.513  1.00 27.74 ? 62  LEU B CB    1 
ATOM   2261 C  CG    . LEU F 3 8  ? -2.657  44.183 28.954  1.00 31.01 ? 62  LEU B CG    1 
ATOM   2262 C  CD1   . LEU F 3 8  ? -3.992  43.455 28.989  1.00 30.97 ? 62  LEU B CD1   1 
ATOM   2263 C  CD2   . LEU F 3 8  ? -1.536  43.286 29.480  1.00 31.46 ? 62  LEU B CD2   1 
ATOM   2264 N  N     . GLY F 3 9  ? -0.854  45.774 24.865  1.00 25.96 ? 63  GLY B N     1 
ATOM   2265 C  CA    . GLY F 3 9  ? -0.473  45.467 23.499  1.00 24.99 ? 63  GLY B CA    1 
ATOM   2266 C  C     . GLY F 3 9  ? 0.993   45.720 23.273  1.00 26.14 ? 63  GLY B C     1 
ATOM   2267 O  O     . GLY F 3 9  ? 1.674   46.178 24.177  1.00 25.72 ? 63  GLY B O     1 
ATOM   2268 N  N     . CYS F 3 10 ? 1.484   45.435 22.073  1.00 26.57 ? 64  CYS B N     1 
ATOM   2269 C  CA    . CYS F 3 10 ? 2.889   45.666 21.771  1.00 28.38 ? 64  CYS B CA    1 
ATOM   2270 C  C     . CYS F 3 10 ? 3.184   47.160 21.596  1.00 29.22 ? 64  CYS B C     1 
ATOM   2271 O  O     . CYS F 3 10 ? 2.302   47.942 21.260  1.00 29.90 ? 64  CYS B O     1 
ATOM   2272 C  CB    . CYS F 3 10 ? 3.305   44.891 20.511  1.00 29.23 ? 64  CYS B CB    1 
ATOM   2273 S  SG    . CYS F 3 10 ? 2.670   45.522 18.928  1.00 29.57 ? 64  CYS B SG    1 
ATOM   2274 N  N     . THR F 3 11 ? 4.433   47.539 21.855  1.00 29.14 ? 65  THR B N     1 
ATOM   2275 C  CA    . THR F 3 11 ? 4.905   48.910 21.733  1.00 28.65 ? 65  THR B CA    1 
ATOM   2276 C  C     . THR F 3 11 ? 4.480   49.635 20.455  1.00 30.27 ? 65  THR B C     1 
ATOM   2277 O  O     . THR F 3 11 ? 4.008   50.772 20.509  1.00 31.42 ? 65  THR B O     1 
ATOM   2278 C  CB    . THR F 3 11 ? 6.422   48.961 21.785  1.00 28.03 ? 65  THR B CB    1 
ATOM   2279 O  OG1   . THR F 3 11 ? 6.959   47.884 20.998  1.00 29.31 ? 65  THR B OG1   1 
ATOM   2280 C  CG2   . THR F 3 11 ? 6.902   48.876 23.204  1.00 26.79 ? 65  THR B CG2   1 
ATOM   2281 N  N     . ILE F 3 12 ? 4.668   48.991 19.313  1.00 29.61 ? 66  ILE B N     1 
ATOM   2282 C  CA    . ILE F 3 12 ? 4.303   49.604 18.057  1.00 29.93 ? 66  ILE B CA    1 
ATOM   2283 C  C     . ILE F 3 12 ? 2.793   49.878 17.969  1.00 31.84 ? 66  ILE B C     1 
ATOM   2284 O  O     . ILE F 3 12 ? 2.385   51.034 17.888  1.00 33.81 ? 66  ILE B O     1 
ATOM   2285 C  CB    . ILE F 3 12 ? 4.759   48.737 16.874  1.00 26.03 ? 66  ILE B CB    1 
ATOM   2286 C  CG1   . ILE F 3 12 ? 6.282   48.632 16.871  1.00 22.37 ? 66  ILE B CG1   1 
ATOM   2287 C  CG2   . ILE F 3 12 ? 4.286   49.351 15.579  1.00 26.99 ? 66  ILE B CG2   1 
ATOM   2288 C  CD1   . ILE F 3 12 ? 6.847   47.855 15.710  1.00 22.92 ? 66  ILE B CD1   1 
ATOM   2289 N  N     . CYS F 3 13 ? 1.961   48.841 17.987  1.00 31.84 ? 67  CYS B N     1 
ATOM   2290 C  CA    . CYS F 3 13 ? 0.527   49.065 17.895  1.00 32.29 ? 67  CYS B CA    1 
ATOM   2291 C  C     . CYS F 3 13 ? 0.090   50.265 18.735  1.00 33.03 ? 67  CYS B C     1 
ATOM   2292 O  O     . CYS F 3 13 ? -0.778  51.037 18.324  1.00 33.54 ? 67  CYS B O     1 
ATOM   2293 C  CB    . CYS F 3 13 ? -0.248  47.818 18.327  1.00 32.20 ? 67  CYS B CB    1 
ATOM   2294 S  SG    . CYS F 3 13 ? -0.354  46.488 17.079  1.00 32.24 ? 67  CYS B SG    1 
ATOM   2295 N  N     . ARG F 3 14 ? 0.700   50.436 19.906  1.00 33.99 ? 68  ARG B N     1 
ATOM   2296 C  CA    . ARG F 3 14 ? 0.351   51.553 20.783  1.00 34.87 ? 68  ARG B CA    1 
ATOM   2297 C  C     . ARG F 3 14 ? 0.702   52.801 20.010  1.00 34.57 ? 68  ARG B C     1 
ATOM   2298 O  O     . ARG F 3 14 ? -0.147  53.620 19.696  1.00 35.35 ? 68  ARG B O     1 
ATOM   2299 C  CB    . ARG F 3 14 ? 1.170   51.490 22.077  1.00 35.35 ? 68  ARG B CB    1 
ATOM   2300 C  CG    . ARG F 3 14 ? 0.888   52.609 23.087  1.00 38.22 ? 68  ARG B CG    1 
ATOM   2301 C  CD    . ARG F 3 14 ? -0.237  52.240 24.045  1.00 41.87 ? 68  ARG B CD    1 
ATOM   2302 N  NE    . ARG F 3 14 ? -0.676  53.363 24.885  1.00 44.79 ? 68  ARG B NE    1 
ATOM   2303 C  CZ    . ARG F 3 14 ? 0.115   54.024 25.736  1.00 45.77 ? 68  ARG B CZ    1 
ATOM   2304 N  NH1   . ARG F 3 14 ? 1.401   53.685 25.870  1.00 45.82 ? 68  ARG B NH1   1 
ATOM   2305 N  NH2   . ARG F 3 14 ? -0.379  55.022 26.465  1.00 44.36 ? 68  ARG B NH2   1 
ATOM   2306 N  N     . LYS F 3 15 ? 1.986   52.909 19.706  1.00 34.97 ? 69  LYS B N     1 
ATOM   2307 C  CA    . LYS F 3 15 ? 2.567   54.001 18.938  1.00 34.62 ? 69  LYS B CA    1 
ATOM   2308 C  C     . LYS F 3 15 ? 1.653   54.375 17.753  1.00 34.44 ? 69  LYS B C     1 
ATOM   2309 O  O     . LYS F 3 15 ? 1.458   55.558 17.453  1.00 35.44 ? 69  LYS B O     1 
ATOM   2310 C  CB    . LYS F 3 15 ? 3.931   53.532 18.416  1.00 36.19 ? 69  LYS B CB    1 
ATOM   2311 C  CG    . LYS F 3 15 ? 4.913   54.596 18.043  1.00 37.21 ? 69  LYS B CG    1 
ATOM   2312 C  CD    . LYS F 3 15 ? 5.483   55.272 19.252  1.00 38.00 ? 69  LYS B CD    1 
ATOM   2313 C  CE    . LYS F 3 15 ? 6.637   56.150 18.825  1.00 43.28 ? 69  LYS B CE    1 
ATOM   2314 N  NZ    . LYS F 3 15 ? 6.320   56.897 17.555  1.00 43.46 ? 69  LYS B NZ    1 
ATOM   2315 N  N     . ARG F 3 16 ? 1.093   53.359 17.102  1.00 30.83 ? 70  ARG B N     1 
ATOM   2316 C  CA    . ARG F 3 16 ? 0.222   53.549 15.952  1.00 30.41 ? 70  ARG B CA    1 
ATOM   2317 C  C     . ARG F 3 16 ? -1.238  53.743 16.331  1.00 33.06 ? 70  ARG B C     1 
ATOM   2318 O  O     . ARG F 3 16 ? -2.040  54.235 15.548  1.00 34.01 ? 70  ARG B O     1 
ATOM   2319 C  CB    . ARG F 3 16 ? 0.335   52.341 15.022  1.00 28.40 ? 70  ARG B CB    1 
ATOM   2320 C  CG    . ARG F 3 16 ? 1.730   52.062 14.551  1.00 24.30 ? 70  ARG B CG    1 
ATOM   2321 C  CD    . ARG F 3 16 ? 1.792   50.868 13.649  1.00 21.76 ? 70  ARG B CD    1 
ATOM   2322 N  NE    . ARG F 3 16 ? 3.101   50.793 13.006  1.00 27.48 ? 70  ARG B NE    1 
ATOM   2323 C  CZ    . ARG F 3 16 ? 3.454   49.876 12.111  1.00 29.73 ? 70  ARG B CZ    1 
ATOM   2324 N  NH1   . ARG F 3 16 ? 2.600   48.934 11.743  1.00 29.49 ? 70  ARG B NH1   1 
ATOM   2325 N  NH2   . ARG F 3 16 ? 4.663   49.917 11.573  1.00 28.55 ? 70  ARG B NH2   1 
ATOM   2326 N  N     . LYS F 3 17 ? -1.585  53.314 17.534  1.00 35.33 ? 71  LYS B N     1 
ATOM   2327 C  CA    . LYS F 3 17 ? -2.947  53.437 18.028  1.00 36.10 ? 71  LYS B CA    1 
ATOM   2328 C  C     . LYS F 3 17 ? -3.938  52.498 17.341  1.00 37.38 ? 71  LYS B C     1 
ATOM   2329 O  O     . LYS F 3 17 ? -5.096  52.863 17.135  1.00 38.31 ? 71  LYS B O     1 
ATOM   2330 C  CB    . LYS F 3 17 ? -3.429  54.880 17.880  1.00 35.79 ? 71  LYS B CB    1 
ATOM   2331 C  CG    . LYS F 3 17 ? -2.596  55.907 18.619  1.00 35.12 ? 71  LYS B CG    1 
ATOM   2332 C  CD    . LYS F 3 17 ? -3.248  57.261 18.535  1.00 34.45 ? 71  LYS B CD    1 
ATOM   2333 C  CE    . LYS F 3 17 ? -2.537  58.276 19.406  1.00 34.92 ? 71  LYS B CE    1 
ATOM   2334 N  NZ    . LYS F 3 17 ? -2.744  58.004 20.851  1.00 38.82 ? 71  LYS B NZ    1 
ATOM   2335 N  N     . VAL F 3 18 ? -3.490  51.300 16.972  1.00 37.72 ? 72  VAL B N     1 
ATOM   2336 C  CA    . VAL F 3 18 ? -4.388  50.330 16.341  1.00 38.63 ? 72  VAL B CA    1 
ATOM   2337 C  C     . VAL F 3 18 ? -4.635  49.180 17.321  1.00 39.61 ? 72  VAL B C     1 
ATOM   2338 O  O     . VAL F 3 18 ? -4.014  49.112 18.375  1.00 40.26 ? 72  VAL B O     1 
ATOM   2339 C  CB    . VAL F 3 18 ? -3.797  49.756 15.042  1.00 37.84 ? 72  VAL B CB    1 
ATOM   2340 C  CG1   . VAL F 3 18 ? -3.482  50.880 14.078  1.00 38.74 ? 72  VAL B CG1   1 
ATOM   2341 C  CG2   . VAL F 3 18 ? -2.569  48.937 15.354  1.00 36.97 ? 72  VAL B CG2   1 
ATOM   2342 N  N     . LYS F 3 19 ? -5.544  48.276 16.980  1.00 40.02 ? 73  LYS B N     1 
ATOM   2343 C  CA    . LYS F 3 19 ? -5.840  47.155 17.860  1.00 40.01 ? 73  LYS B CA    1 
ATOM   2344 C  C     . LYS F 3 19 ? -4.789  46.070 17.704  1.00 38.72 ? 73  LYS B C     1 
ATOM   2345 O  O     . LYS F 3 19 ? -4.481  45.651 16.597  1.00 40.65 ? 73  LYS B O     1 
ATOM   2346 C  CB    . LYS F 3 19 ? -7.211  46.570 17.535  1.00 42.91 ? 73  LYS B CB    1 
ATOM   2347 C  CG    . LYS F 3 19 ? -7.731  45.582 18.574  1.00 45.21 ? 73  LYS B CG    1 
ATOM   2348 C  CD    . LYS F 3 19 ? -9.032  44.920 18.113  1.00 47.80 ? 73  LYS B CD    1 
ATOM   2349 C  CE    . LYS F 3 19 ? -9.563  43.941 19.174  1.00 47.82 ? 73  LYS B CE    1 
ATOM   2350 N  NZ    . LYS F 3 19 ? -10.639 43.034 18.643  1.00 48.82 ? 73  LYS B NZ    1 
ATOM   2351 N  N     . CYS F 3 20 ? -4.253  45.606 18.827  1.00 36.25 ? 74  CYS B N     1 
ATOM   2352 C  CA    . CYS F 3 20 ? -3.224  44.572 18.820  1.00 35.75 ? 74  CYS B CA    1 
ATOM   2353 C  C     . CYS F 3 20 ? -3.816  43.177 19.036  1.00 35.62 ? 74  CYS B C     1 
ATOM   2354 O  O     . CYS F 3 20 ? -4.430  42.920 20.073  1.00 34.99 ? 74  CYS B O     1 
ATOM   2355 C  CB    . CYS F 3 20 ? -2.203  44.851 19.923  1.00 34.56 ? 74  CYS B CB    1 
ATOM   2356 S  SG    . CYS F 3 20 ? -0.755  43.746 19.853  1.00 34.08 ? 74  CYS B SG    1 
ATOM   2357 N  N     . ASP F 3 21 ? -3.624  42.278 18.072  1.00 34.67 ? 75  ASP B N     1 
ATOM   2358 C  CA    . ASP F 3 21 ? -4.158  40.926 18.195  1.00 34.78 ? 75  ASP B CA    1 
ATOM   2359 C  C     . ASP F 3 21 ? -3.502  40.203 19.375  1.00 35.31 ? 75  ASP B C     1 
ATOM   2360 O  O     . ASP F 3 21 ? -3.913  39.110 19.775  1.00 35.26 ? 75  ASP B O     1 
ATOM   2361 C  CB    . ASP F 3 21 ? -3.980  40.161 16.877  1.00 34.33 ? 75  ASP B CB    1 
ATOM   2362 C  CG    . ASP F 3 21 ? -2.538  39.987 16.481  1.00 35.82 ? 75  ASP B CG    1 
ATOM   2363 O  OD1   . ASP F 3 21 ? -1.911  39.010 16.937  1.00 36.48 ? 75  ASP B OD1   1 
ATOM   2364 O  OD2   . ASP F 3 21 ? -2.031  40.821 15.701  1.00 36.08 ? 75  ASP B OD2   1 
ATOM   2365 N  N     . LYS F 3 22 ? -2.482  40.848 19.929  1.00 35.21 ? 76  LYS B N     1 
ATOM   2366 C  CA    . LYS F 3 22 ? -1.750  40.362 21.091  1.00 33.86 ? 76  LYS B CA    1 
ATOM   2367 C  C     . LYS F 3 22 ? -1.001  39.036 20.972  1.00 32.72 ? 76  LYS B C     1 
ATOM   2368 O  O     . LYS F 3 22 ? -0.366  38.590 21.930  1.00 33.66 ? 76  LYS B O     1 
ATOM   2369 C  CB    . LYS F 3 22 ? -2.696  40.304 22.284  1.00 33.04 ? 76  LYS B CB    1 
ATOM   2370 C  CG    . LYS F 3 22 ? -3.182  41.663 22.751  1.00 31.86 ? 76  LYS B CG    1 
ATOM   2371 C  CD    . LYS F 3 22 ? -3.981  41.532 24.031  1.00 32.68 ? 76  LYS B CD    1 
ATOM   2372 C  CE    . LYS F 3 22 ? -4.487  42.868 24.555  1.00 34.38 ? 76  LYS B CE    1 
ATOM   2373 N  NZ    . LYS F 3 22 ? -5.499  42.681 25.639  1.00 36.61 ? 76  LYS B NZ    1 
ATOM   2374 N  N     . LEU F 3 23 ? -1.048  38.410 19.807  1.00 31.55 ? 77  LEU B N     1 
ATOM   2375 C  CA    . LEU F 3 23 ? -0.359  37.146 19.623  1.00 31.16 ? 77  LEU B CA    1 
ATOM   2376 C  C     . LEU F 3 23 ? 1.075   37.264 20.124  1.00 31.43 ? 77  LEU B C     1 
ATOM   2377 O  O     . LEU F 3 23 ? 1.647   38.342 20.125  1.00 31.75 ? 77  LEU B O     1 
ATOM   2378 C  CB    . LEU F 3 23 ? -0.377  36.749 18.143  1.00 33.31 ? 77  LEU B CB    1 
ATOM   2379 C  CG    . LEU F 3 23 ? -0.273  35.254 17.803  1.00 34.67 ? 77  LEU B CG    1 
ATOM   2380 C  CD1   . LEU F 3 23 ? -0.605  35.061 16.336  1.00 35.84 ? 77  LEU B CD1   1 
ATOM   2381 C  CD2   . LEU F 3 23 ? 1.106   34.715 18.108  1.00 34.52 ? 77  LEU B CD2   1 
ATOM   2382 N  N     . ARG F 3 24 ? 1.642   36.145 20.558  1.00 32.16 ? 78  ARG B N     1 
ATOM   2383 C  CA    . ARG F 3 24 ? 3.011   36.101 21.051  1.00 30.67 ? 78  ARG B CA    1 
ATOM   2384 C  C     . ARG F 3 24 ? 3.774   35.074 20.238  1.00 31.47 ? 78  ARG B C     1 
ATOM   2385 O  O     . ARG F 3 24 ? 3.201   34.088 19.773  1.00 31.99 ? 78  ARG B O     1 
ATOM   2386 C  CB    . ARG F 3 24 ? 3.022   35.683 22.511  1.00 30.10 ? 78  ARG B CB    1 
ATOM   2387 C  CG    . ARG F 3 24 ? 2.143   36.527 23.397  1.00 29.17 ? 78  ARG B CG    1 
ATOM   2388 C  CD    . ARG F 3 24 ? 2.912   37.666 24.023  1.00 27.13 ? 78  ARG B CD    1 
ATOM   2389 N  NE    . ARG F 3 24 ? 2.036   38.517 24.819  1.00 24.58 ? 78  ARG B NE    1 
ATOM   2390 C  CZ    . ARG F 3 24 ? 2.445   39.278 25.824  1.00 22.48 ? 78  ARG B CZ    1 
ATOM   2391 N  NH1   . ARG F 3 24 ? 3.717   39.291 26.160  1.00 23.10 ? 78  ARG B NH1   1 
ATOM   2392 N  NH2   . ARG F 3 24 ? 1.584   40.030 26.484  1.00 21.22 ? 78  ARG B NH2   1 
ATOM   2393 N  N     . PRO F 3 25 ? 5.082   35.278 20.056  1.00 31.97 ? 79  PRO B N     1 
ATOM   2394 C  CA    . PRO F 3 25 ? 5.911   36.380 20.551  1.00 33.81 ? 79  PRO B CA    1 
ATOM   2395 C  C     . PRO F 3 25 ? 5.759   37.694 19.793  1.00 35.38 ? 79  PRO B C     1 
ATOM   2396 O  O     . PRO F 3 25 ? 6.200   38.730 20.274  1.00 38.07 ? 79  PRO B O     1 
ATOM   2397 C  CB    . PRO F 3 25 ? 7.315   35.826 20.412  1.00 32.94 ? 79  PRO B CB    1 
ATOM   2398 C  CG    . PRO F 3 25 ? 7.203   35.069 19.114  1.00 32.98 ? 79  PRO B CG    1 
ATOM   2399 C  CD    . PRO F 3 25 ? 5.894   34.316 19.290  1.00 30.31 ? 79  PRO B CD    1 
ATOM   2400 N  N     . HIS F 3 26 ? 5.149   37.652 18.612  1.00 35.18 ? 80  HIS B N     1 
ATOM   2401 C  CA    . HIS F 3 26 ? 4.979   38.854 17.800  1.00 33.65 ? 80  HIS B CA    1 
ATOM   2402 C  C     . HIS F 3 26 ? 3.602   38.872 17.159  1.00 34.68 ? 80  HIS B C     1 
ATOM   2403 O  O     . HIS F 3 26 ? 3.209   37.909 16.511  1.00 35.06 ? 80  HIS B O     1 
ATOM   2404 C  CB    . HIS F 3 26 ? 6.045   38.891 16.712  1.00 31.92 ? 80  HIS B CB    1 
ATOM   2405 C  CG    . HIS F 3 26 ? 7.451   38.862 17.235  1.00 29.62 ? 80  HIS B CG    1 
ATOM   2406 N  ND1   . HIS F 3 26 ? 7.930   39.703 18.215  1.00 27.03 ? 80  HIS B ND1   1 
ATOM   2407 C  CD2   . HIS F 3 26 ? 8.514   38.125 16.833  1.00 26.83 ? 80  HIS B CD2   1 
ATOM   2408 C  CE1   . HIS F 3 26 ? 9.234   39.454 18.356  1.00 28.47 ? 80  HIS B CE1   1 
ATOM   2409 N  NE2   . HIS F 3 26 ? 9.630   38.501 17.535  1.00 27.36 ? 80  HIS B NE2   1 
ATOM   2410 N  N     . CYS F 3 27 ? 2.878   39.975 17.336  1.00 36.44 ? 81  CYS B N     1 
ATOM   2411 C  CA    . CYS F 3 27 ? 1.512   40.118 16.813  1.00 37.01 ? 81  CYS B CA    1 
ATOM   2412 C  C     . CYS F 3 27 ? 1.405   40.168 15.291  1.00 38.88 ? 81  CYS B C     1 
ATOM   2413 O  O     . CYS F 3 27 ? 2.342   40.579 14.608  1.00 39.76 ? 81  CYS B O     1 
ATOM   2414 C  CB    . CYS F 3 27 ? 0.845   41.363 17.410  1.00 35.55 ? 81  CYS B CB    1 
ATOM   2415 S  SG    . CYS F 3 27 ? 1.315   42.952 16.669  1.00 30.19 ? 81  CYS B SG    1 
ATOM   2416 N  N     . GLN F 3 28 ? 0.254   39.747 14.765  1.00 39.93 ? 82  GLN B N     1 
ATOM   2417 C  CA    . GLN F 3 28 ? 0.040   39.739 13.321  1.00 40.70 ? 82  GLN B CA    1 
ATOM   2418 C  C     . GLN F 3 28 ? -0.063  41.162 12.789  1.00 40.51 ? 82  GLN B C     1 
ATOM   2419 O  O     . GLN F 3 28 ? 0.270   41.427 11.637  1.00 39.34 ? 82  GLN B O     1 
ATOM   2420 C  CB    . GLN F 3 28 ? -1.233  38.959 12.966  1.00 41.49 ? 82  GLN B CB    1 
ATOM   2421 C  CG    . GLN F 3 28 ? -0.987  37.559 12.352  1.00 46.04 ? 82  GLN B CG    1 
ATOM   2422 C  CD    . GLN F 3 28 ? -0.138  37.588 11.061  1.00 48.36 ? 82  GLN B CD    1 
ATOM   2423 O  OE1   . GLN F 3 28 ? -0.344  38.425 10.166  1.00 49.57 ? 82  GLN B OE1   1 
ATOM   2424 N  NE2   . GLN F 3 28 ? 0.811   36.657 10.962  1.00 48.78 ? 82  GLN B NE2   1 
ATOM   2425 N  N     . GLN F 3 29 ? -0.532  42.064 13.643  1.00 40.59 ? 83  GLN B N     1 
ATOM   2426 C  CA    . GLN F 3 29 ? -0.695  43.466 13.296  1.00 39.30 ? 83  GLN B CA    1 
ATOM   2427 C  C     . GLN F 3 29 ? 0.612   44.004 12.730  1.00 39.84 ? 83  GLN B C     1 
ATOM   2428 O  O     . GLN F 3 29 ? 0.642   44.597 11.649  1.00 41.05 ? 83  GLN B O     1 
ATOM   2429 C  CB    . GLN F 3 29 ? -1.089  44.266 14.536  1.00 39.05 ? 83  GLN B CB    1 
ATOM   2430 C  CG    . GLN F 3 29 ? -1.598  45.660 14.249  1.00 40.08 ? 83  GLN B CG    1 
ATOM   2431 C  CD    . GLN F 3 29 ? -2.850  45.670 13.395  1.00 41.44 ? 83  GLN B CD    1 
ATOM   2432 O  OE1   . GLN F 3 29 ? -2.828  45.279 12.221  1.00 43.37 ? 83  GLN B OE1   1 
ATOM   2433 N  NE2   . GLN F 3 29 ? -3.954  46.121 13.978  1.00 40.18 ? 83  GLN B NE2   1 
ATOM   2434 N  N     . CYS F 3 30 ? 1.712   43.805 13.444  1.00 39.41 ? 84  CYS B N     1 
ATOM   2435 C  CA    . CYS F 3 30 ? 2.947   44.323 12.906  1.00 39.89 ? 84  CYS B CA    1 
ATOM   2436 C  C     . CYS F 3 30 ? 3.843   43.279 12.235  1.00 40.81 ? 84  CYS B C     1 
ATOM   2437 O  O     . CYS F 3 30 ? 5.054   43.422 12.136  1.00 41.81 ? 84  CYS B O     1 
ATOM   2438 C  CB    . CYS F 3 30 ? 3.679   45.204 13.952  1.00 38.99 ? 84  CYS B CB    1 
ATOM   2439 S  SG    . CYS F 3 30 ? 4.461   44.469 15.409  1.00 33.51 ? 84  CYS B SG    1 
ATOM   2440 N  N     . THR F 3 31 ? 3.199   42.225 11.749  1.00 41.22 ? 85  THR B N     1 
ATOM   2441 C  CA    . THR F 3 31 ? 3.864   41.173 10.987  1.00 40.09 ? 85  THR B CA    1 
ATOM   2442 C  C     . THR F 3 31 ? 3.390   41.495 9.567   1.00 40.43 ? 85  THR B C     1 
ATOM   2443 O  O     . THR F 3 31 ? 4.099   41.279 8.590   1.00 40.37 ? 85  THR B O     1 
ATOM   2444 C  CB    . THR F 3 31 ? 3.369   39.750 11.381  1.00 40.52 ? 85  THR B CB    1 
ATOM   2445 O  OG1   . THR F 3 31 ? 3.976   39.353 12.616  1.00 40.34 ? 85  THR B OG1   1 
ATOM   2446 C  CG2   . THR F 3 31 ? 3.732   38.730 10.300  1.00 37.52 ? 85  THR B CG2   1 
ATOM   2447 N  N     . LYS F 3 32 ? 2.171   42.022 9.479   1.00 40.06 ? 86  LYS B N     1 
ATOM   2448 C  CA    . LYS F 3 32 ? 1.570   42.416 8.210   1.00 41.42 ? 86  LYS B CA    1 
ATOM   2449 C  C     . LYS F 3 32 ? 2.270   43.664 7.670   1.00 41.45 ? 86  LYS B C     1 
ATOM   2450 O  O     . LYS F 3 32 ? 2.380   43.857 6.449   1.00 41.47 ? 86  LYS B O     1 
ATOM   2451 C  CB    . LYS F 3 32 ? 0.080   42.736 8.384   1.00 42.30 ? 86  LYS B CB    1 
ATOM   2452 C  CG    . LYS F 3 32 ? -0.794  41.546 8.763   1.00 45.56 ? 86  LYS B CG    1 
ATOM   2453 C  CD    . LYS F 3 32 ? -2.288  41.845 8.582   1.00 46.81 ? 86  LYS B CD    1 
ATOM   2454 C  CE    . LYS F 3 32 ? -2.874  42.756 9.683   1.00 48.59 ? 86  LYS B CE    1 
ATOM   2455 N  NZ    . LYS F 3 32 ? -2.327  44.148 9.726   1.00 46.26 ? 86  LYS B NZ    1 
ATOM   2456 N  N     . THR F 3 33 ? 2.745   44.502 8.585   1.00 39.68 ? 87  THR B N     1 
ATOM   2457 C  CA    . THR F 3 33 ? 3.410   45.734 8.210   1.00 38.33 ? 87  THR B CA    1 
ATOM   2458 C  C     . THR F 3 33 ? 4.935   45.627 8.108   1.00 37.65 ? 87  THR B C     1 
ATOM   2459 O  O     . THR F 3 33 ? 5.629   46.644 8.024   1.00 37.71 ? 87  THR B O     1 
ATOM   2460 C  CB    . THR F 3 33 ? 3.011   46.855 9.180   1.00 38.63 ? 87  THR B CB    1 
ATOM   2461 O  OG1   . THR F 3 33 ? 3.098   46.368 10.522  1.00 40.40 ? 87  THR B OG1   1 
ATOM   2462 C  CG2   . THR F 3 33 ? 1.571   47.286 8.917   1.00 38.16 ? 87  THR B CG2   1 
ATOM   2463 N  N     . GLY F 3 34 ? 5.438   44.393 8.125   1.00 36.23 ? 88  GLY B N     1 
ATOM   2464 C  CA    . GLY F 3 34 ? 6.864   44.142 7.982   1.00 32.39 ? 88  GLY B CA    1 
ATOM   2465 C  C     . GLY F 3 34 ? 7.817   44.413 9.122   1.00 32.46 ? 88  GLY B C     1 
ATOM   2466 O  O     . GLY F 3 34 ? 8.990   44.636 8.882   1.00 32.62 ? 88  GLY B O     1 
ATOM   2467 N  N     . VAL F 3 35 ? 7.345   44.372 10.361  1.00 32.55 ? 89  VAL B N     1 
ATOM   2468 C  CA    . VAL F 3 35 ? 8.217   44.646 11.505  1.00 31.86 ? 89  VAL B CA    1 
ATOM   2469 C  C     . VAL F 3 35 ? 8.132   43.626 12.645  1.00 30.95 ? 89  VAL B C     1 
ATOM   2470 O  O     . VAL F 3 35 ? 8.565   43.901 13.766  1.00 31.24 ? 89  VAL B O     1 
ATOM   2471 C  CB    . VAL F 3 35 ? 7.918   46.054 12.079  1.00 33.08 ? 89  VAL B CB    1 
ATOM   2472 C  CG1   . VAL F 3 35 ? 8.378   47.125 11.091  1.00 34.04 ? 89  VAL B CG1   1 
ATOM   2473 C  CG2   . VAL F 3 35 ? 6.426   46.200 12.355  1.00 30.13 ? 89  VAL B CG2   1 
ATOM   2474 N  N     . ALA F 3 36 ? 7.585   42.453 12.335  1.00 30.15 ? 90  ALA B N     1 
ATOM   2475 C  CA    . ALA F 3 36 ? 7.401   41.348 13.288  1.00 29.75 ? 90  ALA B CA    1 
ATOM   2476 C  C     . ALA F 3 36 ? 8.396   41.220 14.439  1.00 28.60 ? 90  ALA B C     1 
ATOM   2477 O  O     . ALA F 3 36 ? 8.008   41.272 15.595  1.00 27.00 ? 90  ALA B O     1 
ATOM   2478 C  CB    . ALA F 3 36 ? 7.340   40.026 12.534  1.00 30.30 ? 90  ALA B CB    1 
ATOM   2479 N  N     . HIS F 3 37 ? 9.671   41.054 14.129  1.00 27.17 ? 91  HIS B N     1 
ATOM   2480 C  CA    . HIS F 3 37 ? 10.649  40.906 15.183  1.00 27.60 ? 91  HIS B CA    1 
ATOM   2481 C  C     . HIS F 3 37 ? 11.029  42.179 15.948  1.00 28.32 ? 91  HIS B C     1 
ATOM   2482 O  O     . HIS F 3 37 ? 12.022  42.194 16.681  1.00 29.24 ? 91  HIS B O     1 
ATOM   2483 C  CB    . HIS F 3 37 ? 11.872  40.184 14.622  1.00 25.95 ? 91  HIS B CB    1 
ATOM   2484 C  CG    . HIS F 3 37 ? 11.547  38.824 14.091  1.00 30.34 ? 91  HIS B CG    1 
ATOM   2485 N  ND1   . HIS F 3 37 ? 11.052  37.832 14.899  1.00 31.12 ? 91  HIS B ND1   1 
ATOM   2486 C  CD2   . HIS F 3 37 ? 11.578  38.380 12.809  1.00 31.01 ? 91  HIS B CD2   1 
ATOM   2487 C  CE1   . HIS F 3 37 ? 10.784  36.822 14.102  1.00 31.95 ? 91  HIS B CE1   1 
ATOM   2488 N  NE2   . HIS F 3 37 ? 11.084  37.107 12.827  1.00 32.68 ? 91  HIS B NE2   1 
ATOM   2489 N  N     . LEU F 3 38 ? 10.233  43.229 15.789  1.00 27.63 ? 92  LEU B N     1 
ATOM   2490 C  CA    . LEU F 3 38 ? 10.454  44.470 16.512  1.00 28.62 ? 92  LEU B CA    1 
ATOM   2491 C  C     . LEU F 3 38 ? 9.293   44.612 17.486  1.00 27.91 ? 92  LEU B C     1 
ATOM   2492 O  O     . LEU F 3 38 ? 9.212   45.559 18.261  1.00 28.42 ? 92  LEU B O     1 
ATOM   2493 C  CB    . LEU F 3 38 ? 10.471  45.655 15.558  1.00 31.23 ? 92  LEU B CB    1 
ATOM   2494 C  CG    . LEU F 3 38 ? 11.668  45.842 14.630  1.00 32.59 ? 92  LEU B CG    1 
ATOM   2495 C  CD1   . LEU F 3 38 ? 11.471  47.125 13.830  1.00 29.45 ? 92  LEU B CD1   1 
ATOM   2496 C  CD2   . LEU F 3 38 ? 12.951  45.917 15.453  1.00 31.65 ? 92  LEU B CD2   1 
ATOM   2497 N  N     . CYS F 3 39 ? 8.398   43.640 17.429  1.00 27.56 ? 93  CYS B N     1 
ATOM   2498 C  CA    . CYS F 3 39 ? 7.215   43.585 18.272  1.00 27.49 ? 93  CYS B CA    1 
ATOM   2499 C  C     . CYS F 3 39 ? 7.452   42.904 19.628  1.00 27.18 ? 93  CYS B C     1 
ATOM   2500 O  O     . CYS F 3 39 ? 7.763   41.713 19.688  1.00 25.28 ? 93  CYS B O     1 
ATOM   2501 C  CB    . CYS F 3 39 ? 6.127   42.840 17.523  1.00 27.98 ? 93  CYS B CB    1 
ATOM   2502 S  SG    . CYS F 3 39 ? 4.667   42.417 18.509  1.00 32.33 ? 93  CYS B SG    1 
ATOM   2503 N  N     . HIS F 3 40 ? 7.282   43.668 20.702  1.00 25.66 ? 94  HIS B N     1 
ATOM   2504 C  CA    . HIS F 3 40 ? 7.468   43.177 22.057  1.00 25.72 ? 94  HIS B CA    1 
ATOM   2505 C  C     . HIS F 3 40 ? 6.467   43.839 22.984  1.00 26.14 ? 94  HIS B C     1 
ATOM   2506 O  O     . HIS F 3 40 ? 5.971   44.920 22.693  1.00 27.82 ? 94  HIS B O     1 
ATOM   2507 C  CB    . HIS F 3 40 ? 8.870   43.499 22.554  1.00 27.77 ? 94  HIS B CB    1 
ATOM   2508 C  CG    . HIS F 3 40 ? 9.142   44.962 22.675  1.00 31.08 ? 94  HIS B CG    1 
ATOM   2509 N  ND1   . HIS F 3 40 ? 9.751   45.689 21.675  1.00 32.28 ? 94  HIS B ND1   1 
ATOM   2510 C  CD2   . HIS F 3 40 ? 8.859   45.843 23.665  1.00 34.14 ? 94  HIS B CD2   1 
ATOM   2511 C  CE1   . HIS F 3 40 ? 9.833   46.957 22.043  1.00 34.25 ? 94  HIS B CE1   1 
ATOM   2512 N  NE2   . HIS F 3 40 ? 9.298   47.077 23.248  1.00 34.30 ? 94  HIS B NE2   1 
ATOM   2513 N  N     . TYR F 3 41 ? 6.177   43.207 24.117  1.00 25.64 ? 95  TYR B N     1 
ATOM   2514 C  CA    . TYR F 3 41 ? 5.214   43.778 25.052  1.00 23.19 ? 95  TYR B CA    1 
ATOM   2515 C  C     . TYR F 3 41 ? 5.876   44.297 26.303  1.00 23.64 ? 95  TYR B C     1 
ATOM   2516 O  O     . TYR F 3 41 ? 6.980   43.898 26.625  1.00 24.53 ? 95  TYR B O     1 
ATOM   2517 C  CB    . TYR F 3 41 ? 4.174   42.736 25.421  1.00 20.54 ? 95  TYR B CB    1 
ATOM   2518 C  CG    . TYR F 3 41 ? 3.490   42.145 24.231  1.00 15.15 ? 95  TYR B CG    1 
ATOM   2519 C  CD1   . TYR F 3 41 ? 4.193   41.379 23.314  1.00 13.90 ? 95  TYR B CD1   1 
ATOM   2520 C  CD2   . TYR F 3 41 ? 2.139   42.357 24.017  1.00 17.10 ? 95  TYR B CD2   1 
ATOM   2521 C  CE1   . TYR F 3 41 ? 3.568   40.840 22.211  1.00 13.99 ? 95  TYR B CE1   1 
ATOM   2522 C  CE2   . TYR F 3 41 ? 1.498   41.827 22.912  1.00 19.66 ? 95  TYR B CE2   1 
ATOM   2523 C  CZ    . TYR F 3 41 ? 2.224   41.069 22.011  1.00 18.13 ? 95  TYR B CZ    1 
ATOM   2524 O  OH    . TYR F 3 41 ? 1.619   40.568 20.885  1.00 22.62 ? 95  TYR B OH    1 
ATOM   2525 N  N     . MET F 3 42 ? 5.199   45.194 27.007  1.00 26.21 ? 96  MET B N     1 
ATOM   2526 C  CA    . MET F 3 42 ? 5.747   45.758 28.233  1.00 29.36 ? 96  MET B CA    1 
ATOM   2527 C  C     . MET F 3 42 ? 5.557   44.803 29.408  1.00 29.16 ? 96  MET B C     1 
ATOM   2528 O  O     . MET F 3 42 ? 4.565   44.090 29.460  1.00 30.87 ? 96  MET B O     1 
ATOM   2529 C  CB    . MET F 3 42 ? 5.095   47.119 28.523  1.00 32.54 ? 96  MET B CB    1 
ATOM   2530 C  CG    . MET F 3 42 ? 5.497   48.220 27.542  1.00 34.99 ? 96  MET B CG    1 
ATOM   2531 S  SD    . MET F 3 42 ? 5.282   49.890 28.212  1.00 41.33 ? 96  MET B SD    1 
ATOM   2532 C  CE    . MET F 3 42 ? 3.805   50.458 27.326  1.00 39.00 ? 96  MET B CE    1 
ATOM   2533 N  N     . GLU F 3 43 ? 6.500   44.787 30.348  1.00 27.31 ? 97  GLU B N     1 
ATOM   2534 C  CA    . GLU F 3 43 ? 6.395   43.881 31.484  1.00 27.25 ? 97  GLU B CA    1 
ATOM   2535 C  C     . GLU F 3 43 ? 5.436   44.287 32.578  1.00 25.96 ? 97  GLU B C     1 
ATOM   2536 O  O     . GLU F 3 43 ? 5.618   45.298 33.237  1.00 27.44 ? 97  GLU B O     1 
ATOM   2537 C  CB    . GLU F 3 43 ? 7.777   43.612 32.098  1.00 29.87 ? 97  GLU B CB    1 
ATOM   2538 C  CG    . GLU F 3 43 ? 8.399   42.304 31.585  1.00 37.88 ? 97  GLU B CG    1 
ATOM   2539 C  CD    . GLU F 3 43 ? 9.659   41.867 32.340  1.00 42.09 ? 97  GLU B CD    1 
ATOM   2540 O  OE1   . GLU F 3 43 ? 10.189  40.769 32.026  1.00 42.24 ? 97  GLU B OE1   1 
ATOM   2541 O  OE2   . GLU F 3 43 ? 10.119  42.612 33.241  1.00 45.28 ? 97  GLU B OE2   1 
ATOM   2542 N  N     . GLN F 3 44 ? 4.405   43.473 32.767  1.00 25.13 ? 98  GLN B N     1 
ATOM   2543 C  CA    . GLN F 3 44 ? 3.418   43.716 33.808  1.00 24.78 ? 98  GLN B CA    1 
ATOM   2544 C  C     . GLN F 3 44 ? 3.998   43.246 35.153  1.00 24.26 ? 98  GLN B C     1 
ATOM   2545 O  O     . GLN F 3 44 ? 4.635   42.207 35.216  1.00 23.28 ? 98  GLN B O     1 
ATOM   2546 C  CB    . GLN F 3 44 ? 2.157   42.920 33.505  1.00 24.85 ? 98  GLN B CB    1 
ATOM   2547 C  CG    . GLN F 3 44 ? 1.552   43.169 32.155  1.00 26.73 ? 98  GLN B CG    1 
ATOM   2548 C  CD    . GLN F 3 44 ? 0.991   44.558 32.016  1.00 29.12 ? 98  GLN B CD    1 
ATOM   2549 O  OE1   . GLN F 3 44 ? 0.515   45.144 32.986  1.00 30.65 ? 98  GLN B OE1   1 
ATOM   2550 N  NE2   . GLN F 3 44 ? 1.023   45.093 30.801  1.00 30.29 ? 98  GLN B NE2   1 
ATOM   2551 N  N     . THR F 3 45 ? 3.790   44.005 36.224  1.00 25.04 ? 99  THR B N     1 
ATOM   2552 C  CA    . THR F 3 45 ? 4.315   43.611 37.533  1.00 25.19 ? 99  THR B CA    1 
ATOM   2553 C  C     . THR F 3 45 ? 3.715   42.277 37.974  1.00 24.97 ? 99  THR B C     1 
ATOM   2554 O  O     . THR F 3 45 ? 4.405   41.428 38.520  1.00 24.09 ? 99  THR B O     1 
ATOM   2555 C  CB    . THR F 3 45 ? 4.008   44.659 38.597  1.00 26.10 ? 99  THR B CB    1 
ATOM   2556 O  OG1   . THR F 3 45 ? 2.591   44.818 38.705  1.00 28.35 ? 99  THR B OG1   1 
ATOM   2557 C  CG2   . THR F 3 45 ? 4.631   45.988 38.216  1.00 25.71 ? 99  THR B CG2   1 
ATOM   2558 N  N     . TRP F 3 46 ? 2.426   42.085 37.720  1.00 25.23 ? 100 TRP B N     1 
ATOM   2559 C  CA    . TRP F 3 46 ? 1.767   40.833 38.089  1.00 24.99 ? 100 TRP B CA    1 
ATOM   2560 C  C     . TRP F 3 46 ? 2.171   39.687 37.174  1.00 26.11 ? 100 TRP B C     1 
ATOM   2561 O  O     . TRP F 3 46 ? 1.526   38.656 37.147  1.00 27.08 ? 100 TRP B O     1 
ATOM   2562 C  CB    . TRP F 3 46 ? 0.235   40.988 38.081  1.00 22.21 ? 100 TRP B CB    1 
ATOM   2563 C  CG    . TRP F 3 46 ? -0.347  41.642 36.848  1.00 21.29 ? 100 TRP B CG    1 
ATOM   2564 C  CD1   . TRP F 3 46 ? -0.909  42.873 36.775  1.00 20.34 ? 100 TRP B CD1   1 
ATOM   2565 C  CD2   . TRP F 3 46 ? -0.470  41.065 35.539  1.00 19.75 ? 100 TRP B CD2   1 
ATOM   2566 N  NE1   . TRP F 3 46 ? -1.378  43.106 35.511  1.00 20.72 ? 100 TRP B NE1   1 
ATOM   2567 C  CE2   . TRP F 3 46 ? -1.113  42.018 34.730  1.00 19.63 ? 100 TRP B CE2   1 
ATOM   2568 C  CE3   . TRP F 3 46 ? -0.080  39.852 34.975  1.00 17.98 ? 100 TRP B CE3   1 
ATOM   2569 C  CZ2   . TRP F 3 46 ? -1.398  41.780 33.392  1.00 18.89 ? 100 TRP B CZ2   1 
ATOM   2570 C  CZ3   . TRP F 3 46 ? -0.360  39.618 33.647  1.00 19.25 ? 100 TRP B CZ3   1 
ATOM   2571 C  CH2   . TRP F 3 46 ? -1.004  40.580 32.866  1.00 20.69 ? 100 TRP B CH2   1 
ATOM   2572 N  N     . ALA F 3 47 ? 3.243   39.872 36.419  1.00 26.80 ? 101 ALA B N     1 
ATOM   2573 C  CA    . ALA F 3 47 ? 3.713   38.835 35.509  1.00 28.11 ? 101 ALA B CA    1 
ATOM   2574 C  C     . ALA F 3 47 ? 5.211   38.588 35.666  1.00 29.99 ? 101 ALA B C     1 
ATOM   2575 O  O     . ALA F 3 47 ? 5.762   37.700 35.019  1.00 28.01 ? 101 ALA B O     1 
ATOM   2576 C  CB    . ALA F 3 47 ? 3.387   39.211 34.050  1.00 25.43 ? 101 ALA B CB    1 
ATOM   2577 N  N     . GLU F 3 48 ? 5.861   39.372 36.521  1.00 32.82 ? 102 GLU B N     1 
ATOM   2578 C  CA    . GLU F 3 48 ? 7.293   39.221 36.755  1.00 37.22 ? 102 GLU B CA    1 
ATOM   2579 C  C     . GLU F 3 48 ? 7.659   37.777 37.098  1.00 36.74 ? 102 GLU B C     1 
ATOM   2580 O  O     . GLU F 3 48 ? 8.449   37.140 36.392  1.00 36.12 ? 102 GLU B O     1 
ATOM   2581 C  CB    . GLU F 3 48 ? 7.747   40.134 37.899  1.00 41.63 ? 102 GLU B CB    1 
ATOM   2582 C  CG    . GLU F 3 48 ? 7.634   41.630 37.607  1.00 49.01 ? 102 GLU B CG    1 
ATOM   2583 C  CD    . GLU F 3 48 ? 8.071   42.496 38.793  1.00 53.33 ? 102 GLU B CD    1 
ATOM   2584 O  OE1   . GLU F 3 48 ? 9.254   42.368 39.206  1.00 56.50 ? 102 GLU B OE1   1 
ATOM   2585 O  OE2   . GLU F 3 48 ? 7.241   43.296 39.308  1.00 54.50 ? 102 GLU B OE2   1 
ATOM   2586 N  N     . GLU F 3 49 ? 7.076   37.273 38.182  1.00 37.09 ? 103 GLU B N     1 
ATOM   2587 C  CA    . GLU F 3 49 ? 7.332   35.922 38.646  1.00 37.22 ? 103 GLU B CA    1 
ATOM   2588 C  C     . GLU F 3 49 ? 7.063   34.852 37.592  1.00 36.52 ? 103 GLU B C     1 
ATOM   2589 O  O     . GLU F 3 49 ? 7.926   34.030 37.307  1.00 37.65 ? 103 GLU B O     1 
ATOM   2590 C  CB    . GLU F 3 49 ? 6.513   35.665 39.901  1.00 40.56 ? 103 GLU B CB    1 
ATOM   2591 C  CG    . GLU F 3 49 ? 6.732   34.309 40.520  1.00 48.13 ? 103 GLU B CG    1 
ATOM   2592 C  CD    . GLU F 3 49 ? 6.303   34.272 41.984  1.00 52.75 ? 103 GLU B CD    1 
ATOM   2593 O  OE1   . GLU F 3 49 ? 5.146   34.679 42.288  1.00 53.38 ? 103 GLU B OE1   1 
ATOM   2594 O  OE2   . GLU F 3 49 ? 7.131   33.838 42.831  1.00 55.22 ? 103 GLU B OE2   1 
ATOM   2595 N  N     . ALA F 3 50 ? 5.876   34.849 37.007  1.00 34.26 ? 104 ALA B N     1 
ATOM   2596 C  CA    . ALA F 3 50 ? 5.585   33.860 35.988  1.00 33.29 ? 104 ALA B CA    1 
ATOM   2597 C  C     . ALA F 3 50 ? 6.624   33.980 34.878  1.00 33.94 ? 104 ALA B C     1 
ATOM   2598 O  O     . ALA F 3 50 ? 7.069   32.986 34.309  1.00 34.33 ? 104 ALA B O     1 
ATOM   2599 C  CB    . ALA F 3 50 ? 4.196   34.087 35.430  1.00 33.86 ? 104 ALA B CB    1 
ATOM   2600 N  N     . GLU F 3 51 ? 7.017   35.214 34.593  1.00 33.94 ? 105 GLU B N     1 
ATOM   2601 C  CA    . GLU F 3 51 ? 7.978   35.514 33.550  1.00 33.05 ? 105 GLU B CA    1 
ATOM   2602 C  C     . GLU F 3 51 ? 9.340   34.951 33.891  1.00 33.52 ? 105 GLU B C     1 
ATOM   2603 O  O     . GLU F 3 51 ? 9.980   34.295 33.063  1.00 32.27 ? 105 GLU B O     1 
ATOM   2604 C  CB    . GLU F 3 51 ? 8.078   37.027 33.378  1.00 34.23 ? 105 GLU B CB    1 
ATOM   2605 C  CG    . GLU F 3 51 ? 8.636   37.461 32.052  1.00 36.28 ? 105 GLU B CG    1 
ATOM   2606 C  CD    . GLU F 3 51 ? 7.749   37.033 30.913  1.00 38.53 ? 105 GLU B CD    1 
ATOM   2607 O  OE1   . GLU F 3 51 ? 6.616   37.547 30.838  1.00 39.33 ? 105 GLU B OE1   1 
ATOM   2608 O  OE2   . GLU F 3 51 ? 8.171   36.180 30.101  1.00 40.97 ? 105 GLU B OE2   1 
ATOM   2609 N  N     . LYS F 3 52 ? 9.779   35.238 35.113  1.00 33.61 ? 106 LYS B N     1 
ATOM   2610 C  CA    . LYS F 3 52 ? 11.066  34.786 35.611  1.00 33.63 ? 106 LYS B CA    1 
ATOM   2611 C  C     . LYS F 3 52 ? 11.091  33.257 35.547  1.00 34.69 ? 106 LYS B C     1 
ATOM   2612 O  O     . LYS F 3 52 ? 12.076  32.646 35.147  1.00 35.24 ? 106 LYS B O     1 
ATOM   2613 C  CB    . LYS F 3 52 ? 11.248  35.271 37.051  1.00 33.63 ? 106 LYS B CB    1 
ATOM   2614 C  CG    . LYS F 3 52 ? 12.695  35.345 37.536  1.00 34.94 ? 106 LYS B CG    1 
ATOM   2615 C  CD    . LYS F 3 52 ? 12.771  35.743 39.021  1.00 37.08 ? 106 LYS B CD    1 
ATOM   2616 C  CE    . LYS F 3 52 ? 12.103  37.095 39.312  1.00 36.31 ? 106 LYS B CE    1 
ATOM   2617 N  NZ    . LYS F 3 52 ? 12.839  38.248 38.709  1.00 35.00 ? 106 LYS B NZ    1 
ATOM   2618 N  N     . GLU F 3 53 ? 9.981   32.642 35.925  1.00 34.60 ? 107 GLU B N     1 
ATOM   2619 C  CA    . GLU F 3 53 ? 9.882   31.198 35.907  1.00 35.83 ? 107 GLU B CA    1 
ATOM   2620 C  C     . GLU F 3 53 ? 9.934   30.657 34.482  1.00 35.81 ? 107 GLU B C     1 
ATOM   2621 O  O     . GLU F 3 53 ? 10.385  29.538 34.251  1.00 37.38 ? 107 GLU B O     1 
ATOM   2622 C  CB    . GLU F 3 53 ? 8.582   30.753 36.577  1.00 38.55 ? 107 GLU B CB    1 
ATOM   2623 C  CG    . GLU F 3 53 ? 8.629   29.324 37.100  1.00 41.30 ? 107 GLU B CG    1 
ATOM   2624 C  CD    . GLU F 3 53 ? 9.828   29.090 38.015  1.00 42.93 ? 107 GLU B CD    1 
ATOM   2625 O  OE1   . GLU F 3 53 ? 10.165  29.985 38.821  1.00 39.36 ? 107 GLU B OE1   1 
ATOM   2626 O  OE2   . GLU F 3 53 ? 10.430  28.002 37.933  1.00 46.23 ? 107 GLU B OE2   1 
ATOM   2627 N  N     . LEU F 3 54 ? 9.462   31.441 33.518  1.00 35.76 ? 108 LEU B N     1 
ATOM   2628 C  CA    . LEU F 3 54 ? 9.482   30.989 32.133  1.00 33.86 ? 108 LEU B CA    1 
ATOM   2629 C  C     . LEU F 3 54 ? 10.884  31.057 31.536  1.00 33.27 ? 108 LEU B C     1 
ATOM   2630 O  O     . LEU F 3 54 ? 11.188  30.311 30.613  1.00 33.04 ? 108 LEU B O     1 
ATOM   2631 C  CB    . LEU F 3 54 ? 8.538   31.818 31.276  1.00 36.50 ? 108 LEU B CB    1 
ATOM   2632 C  CG    . LEU F 3 54 ? 8.319   31.211 29.894  1.00 38.61 ? 108 LEU B CG    1 
ATOM   2633 C  CD1   . LEU F 3 54 ? 7.328   30.054 30.034  1.00 41.23 ? 108 LEU B CD1   1 
ATOM   2634 C  CD2   . LEU F 3 54 ? 7.772   32.253 28.929  1.00 39.69 ? 108 LEU B CD2   1 
ATOM   2635 N  N     . LEU F 3 55 ? 11.731  31.955 32.039  1.00 32.13 ? 109 LEU B N     1 
ATOM   2636 C  CA    . LEU F 3 55 ? 13.099  32.053 31.537  1.00 30.56 ? 109 LEU B CA    1 
ATOM   2637 C  C     . LEU F 3 55 ? 13.884  30.893 32.111  1.00 29.58 ? 109 LEU B C     1 
ATOM   2638 O  O     . LEU F 3 55 ? 14.619  30.217 31.395  1.00 28.56 ? 109 LEU B O     1 
ATOM   2639 C  CB    . LEU F 3 55 ? 13.763  33.365 31.961  1.00 32.79 ? 109 LEU B CB    1 
ATOM   2640 C  CG    . LEU F 3 55 ? 13.357  34.694 31.310  1.00 34.71 ? 109 LEU B CG    1 
ATOM   2641 C  CD1   . LEU F 3 55 ? 14.186  35.805 31.942  1.00 33.93 ? 109 LEU B CD1   1 
ATOM   2642 C  CD2   . LEU F 3 55 ? 13.581  34.660 29.802  1.00 35.62 ? 109 LEU B CD2   1 
ATOM   2643 N  N     . LYS F 3 56 ? 13.714  30.669 33.412  1.00 28.60 ? 110 LYS B N     1 
ATOM   2644 C  CA    . LYS F 3 56 ? 14.396  29.581 34.111  1.00 27.37 ? 110 LYS B CA    1 
ATOM   2645 C  C     . LYS F 3 56 ? 14.160  28.242 33.419  1.00 26.93 ? 110 LYS B C     1 
ATOM   2646 O  O     . LYS F 3 56 ? 15.086  27.484 33.152  1.00 25.12 ? 110 LYS B O     1 
ATOM   2647 C  CB    . LYS F 3 56 ? 13.915  29.494 35.565  1.00 26.59 ? 110 LYS B CB    1 
ATOM   2648 C  CG    . LYS F 3 56 ? 14.481  30.545 36.480  1.00 30.88 ? 110 LYS B CG    1 
ATOM   2649 C  CD    . LYS F 3 56 ? 14.020  30.335 37.922  1.00 35.59 ? 110 LYS B CD    1 
ATOM   2650 C  CE    . LYS F 3 56 ? 14.734  31.282 38.897  1.00 36.89 ? 110 LYS B CE    1 
ATOM   2651 N  NZ    . LYS F 3 56 ? 14.384  32.721 38.662  1.00 41.12 ? 110 LYS B NZ    1 
ATOM   2652 N  N     . ASP F 3 57 ? 12.907  27.955 33.123  1.00 27.02 ? 111 ASP B N     1 
ATOM   2653 C  CA    . ASP F 3 57 ? 12.591  26.705 32.475  1.00 28.69 ? 111 ASP B CA    1 
ATOM   2654 C  C     . ASP F 3 57 ? 13.229  26.614 31.104  1.00 27.34 ? 111 ASP B C     1 
ATOM   2655 O  O     . ASP F 3 57 ? 13.892  25.643 30.790  1.00 26.47 ? 111 ASP B O     1 
ATOM   2656 C  CB    . ASP F 3 57 ? 11.076  26.536 32.404  1.00 30.18 ? 111 ASP B CB    1 
ATOM   2657 C  CG    . ASP F 3 57 ? 10.480  26.164 33.747  1.00 33.66 ? 111 ASP B CG    1 
ATOM   2658 O  OD1   . ASP F 3 57 ? 9.241   26.178 33.874  1.00 37.64 ? 111 ASP B OD1   1 
ATOM   2659 O  OD2   . ASP F 3 57 ? 11.250  25.851 34.682  1.00 34.19 ? 111 ASP B OD2   1 
ATOM   2660 N  N     . ASN F 3 58 ? 13.040  27.636 30.287  1.00 27.61 ? 112 ASN B N     1 
ATOM   2661 C  CA    . ASN F 3 58 ? 13.638  27.635 28.960  1.00 27.41 ? 112 ASN B CA    1 
ATOM   2662 C  C     . ASN F 3 58 ? 15.145  27.490 29.037  1.00 25.19 ? 112 ASN B C     1 
ATOM   2663 O  O     . ASN F 3 58 ? 15.715  26.747 28.255  1.00 24.80 ? 112 ASN B O     1 
ATOM   2664 C  CB    . ASN F 3 58 ? 13.268  28.907 28.203  1.00 29.21 ? 112 ASN B CB    1 
ATOM   2665 C  CG    . ASN F 3 58 ? 11.947  28.778 27.476  1.00 30.45 ? 112 ASN B CG    1 
ATOM   2666 O  OD1   . ASN F 3 58 ? 11.849  28.041 26.496  1.00 32.28 ? 112 ASN B OD1   1 
ATOM   2667 N  ND2   . ASN F 3 58 ? 10.918  29.476 27.961  1.00 31.01 ? 112 ASN B ND2   1 
ATOM   2668 N  N     . GLU F 3 59 ? 15.781  28.186 29.976  1.00 22.31 ? 113 GLU B N     1 
ATOM   2669 C  CA    . GLU F 3 59 ? 17.227  28.084 30.144  1.00 21.61 ? 113 GLU B CA    1 
ATOM   2670 C  C     . GLU F 3 59 ? 17.696  26.714 30.663  1.00 22.60 ? 113 GLU B C     1 
ATOM   2671 O  O     . GLU F 3 59 ? 18.704  26.193 30.189  1.00 20.05 ? 113 GLU B O     1 
ATOM   2672 C  CB    . GLU F 3 59 ? 17.741  29.196 31.067  1.00 18.24 ? 113 GLU B CB    1 
ATOM   2673 C  CG    . GLU F 3 59 ? 19.225  29.092 31.336  1.00 19.73 ? 113 GLU B CG    1 
ATOM   2674 C  CD    . GLU F 3 59 ? 19.782  30.226 32.149  1.00 24.29 ? 113 GLU B CD    1 
ATOM   2675 O  OE1   . GLU F 3 59 ? 19.053  30.803 32.977  1.00 22.90 ? 113 GLU B OE1   1 
ATOM   2676 O  OE2   . GLU F 3 59 ? 20.973  30.529 31.969  1.00 25.31 ? 113 GLU B OE2   1 
ATOM   2677 N  N     . LEU F 3 60 ? 16.986  26.127 31.635  1.00 24.30 ? 114 LEU B N     1 
ATOM   2678 C  CA    . LEU F 3 60 ? 17.389  24.813 32.148  1.00 26.65 ? 114 LEU B CA    1 
ATOM   2679 C  C     . LEU F 3 60 ? 17.276  23.845 30.992  1.00 27.66 ? 114 LEU B C     1 
ATOM   2680 O  O     . LEU F 3 60 ? 18.076  22.926 30.863  1.00 30.25 ? 114 LEU B O     1 
ATOM   2681 C  CB    . LEU F 3 60 ? 16.499  24.291 33.326  1.00 28.49 ? 114 LEU B CB    1 
ATOM   2682 C  CG    . LEU F 3 60 ? 16.727  22.823 33.530  1.00 27.06 ? 114 LEU B CG    1 
ATOM   2683 N  N     . LYS F 3 61 ? 16.295  24.079 30.131  1.00 27.97 ? 115 LYS B N     1 
ATOM   2684 C  CA    . LYS F 3 61 ? 16.078  23.236 28.964  1.00 27.94 ? 115 LYS B CA    1 
ATOM   2685 C  C     . LYS F 3 61 ? 17.251  23.298 27.985  1.00 26.57 ? 115 LYS B C     1 
ATOM   2686 O  O     . LYS F 3 61 ? 17.791  22.267 27.610  1.00 30.09 ? 115 LYS B O     1 
ATOM   2687 C  CB    . LYS F 3 61 ? 14.782  23.645 28.263  1.00 29.12 ? 115 LYS B CB    1 
ATOM   2688 C  CG    . LYS F 3 61 ? 14.464  22.859 27.010  1.00 32.12 ? 115 LYS B CG    1 
ATOM   2689 C  CD    . LYS F 3 61 ? 13.172  23.361 26.407  1.00 34.26 ? 115 LYS B CD    1 
ATOM   2690 C  CE    . LYS F 3 61 ? 12.957  22.829 25.014  1.00 35.72 ? 115 LYS B CE    1 
ATOM   2691 N  NZ    . LYS F 3 61 ? 11.614  23.255 24.522  1.00 37.89 ? 115 LYS B NZ    1 
ATOM   2692 N  N     . LYS F 3 62 ? 17.641  24.499 27.572  1.00 25.19 ? 116 LYS B N     1 
ATOM   2693 C  CA    . LYS F 3 62 ? 18.756  24.680 26.645  1.00 23.61 ? 116 LYS B CA    1 
ATOM   2694 C  C     . LYS F 3 62 ? 20.111  24.249 27.204  1.00 23.48 ? 116 LYS B C     1 
ATOM   2695 O  O     . LYS F 3 62 ? 20.967  23.785 26.464  1.00 25.61 ? 116 LYS B O     1 
ATOM   2696 C  CB    . LYS F 3 62 ? 18.849  26.143 26.216  1.00 25.01 ? 116 LYS B CB    1 
ATOM   2697 C  CG    . LYS F 3 62 ? 17.809  26.617 25.199  1.00 27.11 ? 116 LYS B CG    1 
ATOM   2698 C  CD    . LYS F 3 62 ? 18.236  26.333 23.769  1.00 28.69 ? 116 LYS B CD    1 
ATOM   2699 C  CE    . LYS F 3 62 ? 17.653  25.026 23.255  1.00 32.95 ? 116 LYS B CE    1 
ATOM   2700 N  NZ    . LYS F 3 62 ? 16.153  25.028 23.301  1.00 33.55 ? 116 LYS B NZ    1 
ATOM   2701 N  N     . LEU F 3 63 ? 20.314  24.409 28.504  1.00 22.10 ? 117 LEU B N     1 
ATOM   2702 C  CA    . LEU F 3 63 ? 21.577  24.019 29.113  1.00 21.74 ? 117 LEU B CA    1 
ATOM   2703 C  C     . LEU F 3 63 ? 21.771  22.517 29.077  1.00 23.66 ? 117 LEU B C     1 
ATOM   2704 O  O     . LEU F 3 63 ? 22.888  22.023 28.948  1.00 23.12 ? 117 LEU B O     1 
ATOM   2705 C  CB    . LEU F 3 63 ? 21.654  24.513 30.558  1.00 21.16 ? 117 LEU B CB    1 
ATOM   2706 C  CG    . LEU F 3 63 ? 21.924  26.005 30.684  1.00 21.44 ? 117 LEU B CG    1 
ATOM   2707 C  CD1   . LEU F 3 63 ? 22.046  26.387 32.128  1.00 18.65 ? 117 LEU B CD1   1 
ATOM   2708 C  CD2   . LEU F 3 63 ? 23.193  26.347 29.924  1.00 20.13 ? 117 LEU B CD2   1 
ATOM   2709 N  N     . ARG F 3 64 ? 20.677  21.784 29.192  1.00 24.79 ? 118 ARG B N     1 
ATOM   2710 C  CA    . ARG F 3 64 ? 20.753  20.339 29.167  1.00 26.51 ? 118 ARG B CA    1 
ATOM   2711 C  C     . ARG F 3 64 ? 21.072  19.857 27.772  1.00 28.72 ? 118 ARG B C     1 
ATOM   2712 O  O     . ARG F 3 64 ? 21.709  18.816 27.597  1.00 28.87 ? 118 ARG B O     1 
ATOM   2713 C  CB    . ARG F 3 64 ? 19.440  19.731 29.648  1.00 26.27 ? 118 ARG B CB    1 
ATOM   2714 C  CG    . ARG F 3 64 ? 19.237  19.819 31.144  1.00 27.57 ? 118 ARG B CG    1 
ATOM   2715 C  CD    . ARG F 3 64 ? 17.784  19.606 31.500  1.00 30.30 ? 118 ARG B CD    1 
ATOM   2716 N  NE    . ARG F 3 64 ? 17.593  19.520 32.943  1.00 36.12 ? 118 ARG B NE    1 
ATOM   2717 C  CZ    . ARG F 3 64 ? 16.454  19.817 33.562  1.00 36.65 ? 118 ARG B CZ    1 
ATOM   2718 N  NH1   . ARG F 3 64 ? 15.407  20.225 32.857  1.00 37.54 ? 118 ARG B NH1   1 
ATOM   2719 N  NH2   . ARG F 3 64 ? 16.362  19.715 34.882  1.00 36.85 ? 118 ARG B NH2   1 
ATOM   2720 N  N     . GLU F 3 65 ? 20.645  20.621 26.771  1.00 30.32 ? 119 GLU B N     1 
ATOM   2721 C  CA    . GLU F 3 65 ? 20.911  20.235 25.398  1.00 32.30 ? 119 GLU B CA    1 
ATOM   2722 C  C     . GLU F 3 65 ? 22.343  20.571 25.035  1.00 32.46 ? 119 GLU B C     1 
ATOM   2723 O  O     . GLU F 3 65 ? 22.964  19.882 24.223  1.00 33.19 ? 119 GLU B O     1 
ATOM   2724 C  CB    . GLU F 3 65 ? 19.966  20.944 24.436  1.00 35.78 ? 119 GLU B CB    1 
ATOM   2725 C  CG    . GLU F 3 65 ? 20.140  20.498 22.990  1.00 40.61 ? 119 GLU B CG    1 
ATOM   2726 C  CD    . GLU F 3 65 ? 19.375  21.370 22.010  1.00 45.43 ? 119 GLU B CD    1 
ATOM   2727 O  OE1   . GLU F 3 65 ? 19.432  21.048 20.791  1.00 46.04 ? 119 GLU B OE1   1 
ATOM   2728 O  OE2   . GLU F 3 65 ? 18.726  22.366 22.460  1.00 44.94 ? 119 GLU B OE2   1 
ATOM   2729 N  N     . ARG F 3 66 ? 22.870  21.633 25.635  1.00 33.41 ? 120 ARG B N     1 
ATOM   2730 C  CA    . ARG F 3 66 ? 24.235  22.036 25.341  1.00 33.11 ? 120 ARG B CA    1 
ATOM   2731 C  C     . ARG F 3 66 ? 25.233  21.150 26.078  1.00 33.16 ? 120 ARG B C     1 
ATOM   2732 O  O     . ARG F 3 66 ? 26.274  20.785 25.529  1.00 32.51 ? 120 ARG B O     1 
ATOM   2733 C  CB    . ARG F 3 66 ? 24.461  23.506 25.712  1.00 32.83 ? 120 ARG B CB    1 
ATOM   2734 C  CG    . ARG F 3 66 ? 25.629  24.161 24.953  1.00 35.24 ? 120 ARG B CG    1 
ATOM   2735 C  CD    . ARG F 3 66 ? 25.859  25.590 25.391  1.00 38.71 ? 120 ARG B CD    1 
ATOM   2736 N  NE    . ARG F 3 66 ? 24.620  26.371 25.390  1.00 41.33 ? 120 ARG B NE    1 
ATOM   2737 C  CZ    . ARG F 3 66 ? 24.466  27.546 25.997  1.00 42.83 ? 120 ARG B CZ    1 
ATOM   2738 N  NH1   . ARG F 3 66 ? 25.472  28.105 26.668  1.00 42.05 ? 120 ARG B NH1   1 
ATOM   2739 N  NH2   . ARG F 3 66 ? 23.291  28.161 25.942  1.00 43.60 ? 120 ARG B NH2   1 
ATOM   2740 N  N     . VAL F 3 67 ? 24.927  20.793 27.321  1.00 32.69 ? 121 VAL B N     1 
ATOM   2741 C  CA    . VAL F 3 67 ? 25.855  19.960 28.061  1.00 31.68 ? 121 VAL B CA    1 
ATOM   2742 C  C     . VAL F 3 67 ? 26.068  18.658 27.311  1.00 31.50 ? 121 VAL B C     1 
ATOM   2743 O  O     . VAL F 3 67 ? 27.185  18.166 27.251  1.00 32.24 ? 121 VAL B O     1 
ATOM   2744 C  CB    . VAL F 3 67 ? 25.375  19.700 29.522  1.00 31.33 ? 121 VAL B CB    1 
ATOM   2745 C  CG1   . VAL F 3 67 ? 24.103  18.884 29.544  1.00 34.55 ? 121 VAL B CG1   1 
ATOM   2746 C  CG2   . VAL F 3 67 ? 26.463  19.013 30.301  1.00 30.18 ? 121 VAL B CG2   1 
ATOM   2747 N  N     . LYS F 3 68 ? 25.006  18.108 26.726  1.00 32.68 ? 122 LYS B N     1 
ATOM   2748 C  CA    . LYS F 3 68 ? 25.114  16.861 25.954  1.00 34.47 ? 122 LYS B CA    1 
ATOM   2749 C  C     . LYS F 3 68 ? 25.893  17.127 24.667  1.00 34.55 ? 122 LYS B C     1 
ATOM   2750 O  O     . LYS F 3 68 ? 26.778  16.370 24.276  1.00 36.14 ? 122 LYS B O     1 
ATOM   2751 C  CB    . LYS F 3 68 ? 23.728  16.306 25.601  1.00 34.74 ? 122 LYS B CB    1 
ATOM   2752 C  CG    . LYS F 3 68 ? 22.999  15.678 26.792  1.00 38.37 ? 122 LYS B CG    1 
ATOM   2753 C  CD    . LYS F 3 68 ? 21.556  15.310 26.468  1.00 38.89 ? 122 LYS B CD    1 
ATOM   2754 C  CE    . LYS F 3 68 ? 21.471  14.462 25.201  1.00 40.68 ? 122 LYS B CE    1 
ATOM   2755 N  NZ    . LYS F 3 68 ? 22.256  13.206 25.305  1.00 41.97 ? 122 LYS B NZ    1 
ATOM   2756 N  N     . SER F 3 69 ? 25.558  18.233 24.024  1.00 34.29 ? 123 SER B N     1 
ATOM   2757 C  CA    . SER F 3 69 ? 26.207  18.634 22.798  1.00 34.69 ? 123 SER B CA    1 
ATOM   2758 C  C     . SER F 3 69 ? 27.706  18.848 22.990  1.00 35.37 ? 123 SER B C     1 
ATOM   2759 O  O     . SER F 3 69 ? 28.487  18.572 22.085  1.00 36.95 ? 123 SER B O     1 
ATOM   2760 C  CB    . SER F 3 69 ? 25.548  19.906 22.274  1.00 34.98 ? 123 SER B CB    1 
ATOM   2761 O  OG    . SER F 3 69 ? 26.148  20.321 21.064  1.00 37.13 ? 123 SER B OG    1 
ATOM   2762 N  N     . LEU F 3 70 ? 28.110  19.352 24.154  1.00 37.17 ? 124 LEU B N     1 
ATOM   2763 C  CA    . LEU F 3 70 ? 29.528  19.581 24.441  1.00 38.25 ? 124 LEU B CA    1 
ATOM   2764 C  C     . LEU F 3 70 ? 30.191  18.276 24.878  1.00 40.21 ? 124 LEU B C     1 
ATOM   2765 O  O     . LEU F 3 70 ? 31.327  17.985 24.501  1.00 39.61 ? 124 LEU B O     1 
ATOM   2766 C  CB    . LEU F 3 70 ? 29.691  20.632 25.543  1.00 36.58 ? 124 LEU B CB    1 
ATOM   2767 C  CG    . LEU F 3 70 ? 29.431  22.075 25.120  1.00 37.50 ? 124 LEU B CG    1 
ATOM   2768 C  CD1   . LEU F 3 70 ? 29.019  22.920 26.304  1.00 38.71 ? 124 LEU B CD1   1 
ATOM   2769 C  CD2   . LEU F 3 70 ? 30.673  22.628 24.469  1.00 37.35 ? 124 LEU B CD2   1 
ATOM   2770 N  N     . GLU F 3 71 ? 29.480  17.493 25.684  1.00 42.93 ? 125 GLU B N     1 
ATOM   2771 C  CA    . GLU F 3 71 ? 30.014  16.226 26.155  1.00 47.29 ? 125 GLU B CA    1 
ATOM   2772 C  C     . GLU F 3 71 ? 30.407  15.346 24.972  1.00 48.98 ? 125 GLU B C     1 
ATOM   2773 O  O     . GLU F 3 71 ? 31.348  14.565 25.067  1.00 49.84 ? 125 GLU B O     1 
ATOM   2774 C  CB    . GLU F 3 71 ? 28.994  15.512 27.042  1.00 48.67 ? 125 GLU B CB    1 
ATOM   2775 C  CG    . GLU F 3 71 ? 29.023  15.994 28.474  1.00 51.68 ? 125 GLU B CG    1 
ATOM   2776 C  CD    . GLU F 3 71 ? 27.947  15.371 29.337  1.00 54.13 ? 125 GLU B CD    1 
ATOM   2777 O  OE1   . GLU F 3 71 ? 28.083  15.438 30.581  1.00 56.07 ? 125 GLU B OE1   1 
ATOM   2778 O  OE2   . GLU F 3 71 ? 26.963  14.831 28.776  1.00 55.53 ? 125 GLU B OE2   1 
ATOM   2779 N  N     . LYS F 3 72 ? 29.693  15.480 23.855  1.00 51.16 ? 126 LYS B N     1 
ATOM   2780 C  CA    . LYS F 3 72 ? 30.002  14.702 22.659  1.00 52.18 ? 126 LYS B CA    1 
ATOM   2781 C  C     . LYS F 3 72 ? 31.171  15.354 21.923  1.00 52.86 ? 126 LYS B C     1 
ATOM   2782 O  O     . LYS F 3 72 ? 32.204  14.708 21.677  1.00 52.37 ? 126 LYS B O     1 
ATOM   2783 C  CB    . LYS F 3 72 ? 28.781  14.617 21.731  1.00 53.12 ? 126 LYS B CB    1 
ATOM   2784 C  CG    . LYS F 3 72 ? 27.683  13.679 22.231  1.00 55.14 ? 126 LYS B CG    1 
ATOM   2785 C  CD    . LYS F 3 72 ? 26.595  13.510 21.190  1.00 57.22 ? 126 LYS B CD    1 
ATOM   2786 C  CE    . LYS F 3 72 ? 25.615  12.378 21.560  1.00 59.05 ? 126 LYS B CE    1 
ATOM   2787 N  NZ    . LYS F 3 72 ? 24.829  12.629 22.830  1.00 59.20 ? 126 LYS B NZ    1 
ATOM   2788 N  N     . THR F 3 73 ? 31.015  16.637 21.594  1.00 52.94 ? 127 THR B N     1 
ATOM   2789 C  CA    . THR F 3 73 ? 32.048  17.369 20.873  1.00 54.49 ? 127 THR B CA    1 
ATOM   2790 C  C     . THR F 3 73 ? 33.364  17.321 21.623  1.00 55.29 ? 127 THR B C     1 
ATOM   2791 O  O     . THR F 3 73 ? 34.339  17.952 21.211  1.00 55.42 ? 127 THR B O     1 
ATOM   2792 C  CB    . THR F 3 73 ? 31.658  18.849 20.651  1.00 55.01 ? 127 THR B CB    1 
ATOM   2793 O  OG1   . THR F 3 73 ? 32.526  19.437 19.676  1.00 56.81 ? 127 THR B OG1   1 
ATOM   2794 C  CG2   . THR F 3 73 ? 31.801  19.646 21.944  1.00 57.98 ? 127 THR B CG2   1 
ATOM   2795 N  N     . LEU F 3 74 ? 33.380  16.587 22.733  1.00 56.99 ? 128 LEU B N     1 
ATOM   2796 C  CA    . LEU F 3 74 ? 34.584  16.436 23.549  1.00 58.25 ? 128 LEU B CA    1 
ATOM   2797 C  C     . LEU F 3 74 ? 35.098  15.013 23.427  1.00 59.49 ? 128 LEU B C     1 
ATOM   2798 O  O     . LEU F 3 74 ? 35.665  14.464 24.392  1.00 59.23 ? 128 LEU B O     1 
ATOM   2799 C  CB    . LEU F 3 74 ? 34.285  16.720 25.017  1.00 58.95 ? 128 LEU B CB    1 
ATOM   2800 C  CG    . LEU F 3 74 ? 34.513  18.149 25.481  1.00 57.81 ? 128 LEU B CG    1 
ATOM   2801 C  CD1   . LEU F 3 74 ? 34.079  18.280 26.929  1.00 57.99 ? 128 LEU B CD1   1 
ATOM   2802 C  CD2   . LEU F 3 74 ? 35.992  18.496 25.321  1.00 57.21 ? 128 LEU B CD2   1 
ATOM   2803 N  N     . SER F 3 75 ? 34.875  14.420 22.252  1.00 60.85 ? 129 SER B N     1 
ATOM   2804 C  CA    . SER F 3 75 ? 35.314  13.055 21.962  1.00 60.26 ? 129 SER B CA    1 
ATOM   2805 C  C     . SER F 3 75 ? 35.168  12.798 20.465  1.00 60.46 ? 129 SER B C     1 
ATOM   2806 O  O     . SER F 3 75 ? 34.339  11.932 20.094  1.00 61.22 ? 129 SER B O     1 
ATOM   2807 C  CB    . SER F 3 75 ? 34.474  12.048 22.756  1.00 59.09 ? 129 SER B CB    1 
ATOM   2808 O  OG    . SER F 3 75 ? 33.094  12.340 22.616  1.00 56.00 ? 129 SER B OG    1 
ATOM   2809 N  N     . ASN G 3 4  ? 22.812  74.113 2.615   1.00 39.11 ? 58  ASN C N     1 
ATOM   2810 C  CA    . ASN G 3 4  ? 23.305  73.897 1.223   1.00 39.13 ? 58  ASN C CA    1 
ATOM   2811 C  C     . ASN G 3 4  ? 24.353  72.768 1.202   1.00 37.76 ? 58  ASN C C     1 
ATOM   2812 O  O     . ASN G 3 4  ? 24.429  71.983 0.260   1.00 36.34 ? 58  ASN C O     1 
ATOM   2813 C  CB    . ASN G 3 4  ? 23.919  75.191 0.726   1.00 42.16 ? 58  ASN C CB    1 
ATOM   2814 C  CG    . ASN G 3 4  ? 23.210  76.429 1.296   1.00 45.94 ? 58  ASN C CG    1 
ATOM   2815 O  OD1   . ASN G 3 4  ? 22.032  76.694 1.003   1.00 47.84 ? 58  ASN C OD1   1 
ATOM   2816 N  ND2   . ASN G 3 4  ? 23.928  77.189 2.123   1.00 47.90 ? 58  ASN C ND2   1 
ATOM   2817 N  N     . ARG G 3 5  ? 25.159  72.691 2.255   1.00 34.36 ? 59  ARG C N     1 
ATOM   2818 C  CA    . ARG G 3 5  ? 26.172  71.661 2.335   1.00 31.58 ? 59  ARG C CA    1 
ATOM   2819 C  C     . ARG G 3 5  ? 25.541  70.394 2.876   1.00 29.15 ? 59  ARG C C     1 
ATOM   2820 O  O     . ARG G 3 5  ? 24.554  70.446 3.601   1.00 29.37 ? 59  ARG C O     1 
ATOM   2821 C  CB    . ARG G 3 5  ? 27.341  72.107 3.228   1.00 35.19 ? 59  ARG C CB    1 
ATOM   2822 C  CG    . ARG G 3 5  ? 27.188  71.885 4.738   1.00 40.85 ? 59  ARG C CG    1 
ATOM   2823 C  CD    . ARG G 3 5  ? 28.580  71.911 5.411   1.00 45.69 ? 59  ARG C CD    1 
ATOM   2824 N  NE    . ARG G 3 5  ? 29.487  70.897 4.836   1.00 48.75 ? 59  ARG C NE    1 
ATOM   2825 C  CZ    . ARG G 3 5  ? 30.810  70.852 5.032   1.00 48.97 ? 59  ARG C CZ    1 
ATOM   2826 N  NH1   . ARG G 3 5  ? 31.424  71.767 5.791   1.00 50.84 ? 59  ARG C NH1   1 
ATOM   2827 N  NH2   . ARG G 3 5  ? 31.527  69.878 4.485   1.00 46.97 ? 59  ARG C NH2   1 
ATOM   2828 N  N     . ILE G 3 6  ? 26.116  69.262 2.489   1.00 26.15 ? 60  ILE C N     1 
ATOM   2829 C  CA    . ILE G 3 6  ? 25.661  67.942 2.891   1.00 22.70 ? 60  ILE C CA    1 
ATOM   2830 C  C     . ILE G 3 6  ? 26.698  67.374 3.847   1.00 22.07 ? 60  ILE C C     1 
ATOM   2831 O  O     . ILE G 3 6  ? 27.823  67.115 3.453   1.00 21.58 ? 60  ILE C O     1 
ATOM   2832 C  CB    . ILE G 3 6  ? 25.535  67.038 1.649   1.00 23.09 ? 60  ILE C CB    1 
ATOM   2833 C  CG1   . ILE G 3 6  ? 24.559  67.669 0.665   1.00 21.61 ? 60  ILE C CG1   1 
ATOM   2834 C  CG2   . ILE G 3 6  ? 25.082  65.654 2.030   1.00 24.04 ? 60  ILE C CG2   1 
ATOM   2835 C  CD1   . ILE G 3 6  ? 24.352  66.860 -0.589  1.00 21.44 ? 60  ILE C CD1   1 
ATOM   2836 N  N     . PRO G 3 7  ? 26.336  67.195 5.124   1.00 21.18 ? 61  PRO C N     1 
ATOM   2837 C  CA    . PRO G 3 7  ? 27.266  66.661 6.120   1.00 20.63 ? 61  PRO C CA    1 
ATOM   2838 C  C     . PRO G 3 7  ? 27.902  65.346 5.701   1.00 21.06 ? 61  PRO C C     1 
ATOM   2839 O  O     . PRO G 3 7  ? 27.299  64.565 4.989   1.00 21.25 ? 61  PRO C O     1 
ATOM   2840 C  CB    . PRO G 3 7  ? 26.392  66.525 7.361   1.00 20.61 ? 61  PRO C CB    1 
ATOM   2841 C  CG    . PRO G 3 7  ? 25.434  67.638 7.199   1.00 22.11 ? 61  PRO C CG    1 
ATOM   2842 C  CD    . PRO G 3 7  ? 25.054  67.540 5.758   1.00 22.69 ? 61  PRO C CD    1 
ATOM   2843 N  N     . LEU G 3 8  ? 29.129  65.114 6.152   1.00 20.08 ? 62  LEU C N     1 
ATOM   2844 C  CA    . LEU G 3 8  ? 29.849  63.905 5.826   1.00 19.63 ? 62  LEU C CA    1 
ATOM   2845 C  C     . LEU G 3 8  ? 29.706  62.816 6.878   1.00 19.63 ? 62  LEU C C     1 
ATOM   2846 O  O     . LEU G 3 8  ? 29.966  61.663 6.601   1.00 21.84 ? 62  LEU C O     1 
ATOM   2847 C  CB    . LEU G 3 8  ? 31.322  64.225 5.591   1.00 19.82 ? 62  LEU C CB    1 
ATOM   2848 C  CG    . LEU G 3 8  ? 31.643  65.044 4.336   1.00 19.00 ? 62  LEU C CG    1 
ATOM   2849 C  CD1   . LEU G 3 8  ? 33.141  65.230 4.226   1.00 17.53 ? 62  LEU C CD1   1 
ATOM   2850 C  CD2   . LEU G 3 8  ? 31.103  64.341 3.103   1.00 15.31 ? 62  LEU C CD2   1 
ATOM   2851 N  N     . GLY G 3 9  ? 29.280  63.181 8.077   1.00 17.80 ? 63  GLY C N     1 
ATOM   2852 C  CA    . GLY G 3 9  ? 29.088  62.203 9.128   1.00 19.01 ? 63  GLY C CA    1 
ATOM   2853 C  C     . GLY G 3 9  ? 27.665  61.687 9.152   1.00 20.12 ? 63  GLY C C     1 
ATOM   2854 O  O     . GLY G 3 9  ? 26.745  62.360 8.702   1.00 20.56 ? 63  GLY C O     1 
ATOM   2855 N  N     . CYS G 3 10 ? 27.480  60.490 9.683   1.00 20.30 ? 64  CYS C N     1 
ATOM   2856 C  CA    . CYS G 3 10 ? 26.155  59.900 9.735   1.00 22.72 ? 64  CYS C CA    1 
ATOM   2857 C  C     . CYS G 3 10 ? 25.259  60.719 10.645  1.00 24.99 ? 64  CYS C C     1 
ATOM   2858 O  O     . CYS G 3 10 ? 25.750  61.476 11.483  1.00 27.02 ? 64  CYS C O     1 
ATOM   2859 C  CB    . CYS G 3 10 ? 26.222  58.465 10.232  1.00 25.37 ? 64  CYS C CB    1 
ATOM   2860 S  SG    . CYS G 3 10 ? 26.419  58.244 12.018  1.00 24.31 ? 64  CYS C SG    1 
ATOM   2861 N  N     . THR G 3 11 ? 23.948  60.565 10.489  1.00 25.05 ? 65  THR C N     1 
ATOM   2862 C  CA    . THR G 3 11 ? 22.990  61.329 11.286  1.00 26.26 ? 65  THR C CA    1 
ATOM   2863 C  C     . THR G 3 11 ? 22.944  61.017 12.780  1.00 26.45 ? 65  THR C C     1 
ATOM   2864 O  O     . THR G 3 11 ? 22.840  61.930 13.593  1.00 27.88 ? 65  THR C O     1 
ATOM   2865 C  CB    . THR G 3 11 ? 21.559  61.187 10.719  1.00 28.05 ? 65  THR C CB    1 
ATOM   2866 O  OG1   . THR G 3 11 ? 21.091  59.840 10.904  1.00 32.39 ? 65  THR C OG1   1 
ATOM   2867 C  CG2   . THR G 3 11 ? 21.543  61.542 9.228   1.00 25.38 ? 65  THR C CG2   1 
ATOM   2868 N  N     . ILE G 3 12 ? 23.009  59.739 13.149  1.00 25.48 ? 66  ILE C N     1 
ATOM   2869 C  CA    . ILE G 3 12 ? 22.960  59.371 14.563  1.00 24.88 ? 66  ILE C CA    1 
ATOM   2870 C  C     . ILE G 3 12 ? 24.084  60.040 15.330  1.00 25.35 ? 66  ILE C C     1 
ATOM   2871 O  O     . ILE G 3 12 ? 23.851  60.638 16.375  1.00 25.34 ? 66  ILE C O     1 
ATOM   2872 C  CB    . ILE G 3 12 ? 23.038  57.838 14.776  1.00 25.81 ? 66  ILE C CB    1 
ATOM   2873 C  CG1   . ILE G 3 12 ? 21.773  57.165 14.247  1.00 27.41 ? 66  ILE C CG1   1 
ATOM   2874 C  CG2   . ILE G 3 12 ? 23.162  57.519 16.251  1.00 26.29 ? 66  ILE C CG2   1 
ATOM   2875 C  CD1   . ILE G 3 12 ? 20.508  57.645 14.912  1.00 26.02 ? 66  ILE C CD1   1 
ATOM   2876 N  N     . CYS G 3 13 ? 25.302  59.953 14.810  1.00 25.61 ? 67  CYS C N     1 
ATOM   2877 C  CA    . CYS G 3 13 ? 26.439  60.580 15.457  1.00 25.97 ? 67  CYS C CA    1 
ATOM   2878 C  C     . CYS G 3 13 ? 26.175  62.044 15.728  1.00 28.62 ? 67  CYS C C     1 
ATOM   2879 O  O     . CYS G 3 13 ? 26.455  62.535 16.815  1.00 29.36 ? 67  CYS C O     1 
ATOM   2880 C  CB    . CYS G 3 13 ? 27.682  60.442 14.594  1.00 24.88 ? 67  CYS C CB    1 
ATOM   2881 S  SG    . CYS G 3 13 ? 28.608  58.918 14.908  1.00 26.33 ? 67  CYS C SG    1 
ATOM   2882 N  N     . ARG G 3 14 ? 25.643  62.745 14.732  1.00 30.28 ? 68  ARG C N     1 
ATOM   2883 C  CA    . ARG G 3 14 ? 25.357  64.155 14.895  1.00 31.61 ? 68  ARG C CA    1 
ATOM   2884 C  C     . ARG G 3 14 ? 24.372  64.322 16.039  1.00 31.07 ? 68  ARG C C     1 
ATOM   2885 O  O     . ARG G 3 14 ? 24.515  65.210 16.865  1.00 31.69 ? 68  ARG C O     1 
ATOM   2886 C  CB    . ARG G 3 14 ? 24.773  64.742 13.612  1.00 35.21 ? 68  ARG C CB    1 
ATOM   2887 C  CG    . ARG G 3 14 ? 25.697  64.692 12.407  1.00 39.55 ? 68  ARG C CG    1 
ATOM   2888 C  CD    . ARG G 3 14 ? 25.024  65.394 11.244  1.00 44.19 ? 68  ARG C CD    1 
ATOM   2889 N  NE    . ARG G 3 14 ? 24.796  66.800 11.566  1.00 48.77 ? 68  ARG C NE    1 
ATOM   2890 C  CZ    . ARG G 3 14 ? 23.904  67.584 10.968  1.00 52.36 ? 68  ARG C CZ    1 
ATOM   2891 N  NH1   . ARG G 3 14 ? 23.122  67.113 10.003  1.00 54.19 ? 68  ARG C NH1   1 
ATOM   2892 N  NH2   . ARG G 3 14 ? 23.801  68.853 11.331  1.00 54.96 ? 68  ARG C NH2   1 
ATOM   2893 N  N     . LYS G 3 15 ? 23.367  63.464 16.097  1.00 31.32 ? 69  LYS C N     1 
ATOM   2894 C  CA    . LYS G 3 15 ? 22.401  63.571 17.173  1.00 32.91 ? 69  LYS C CA    1 
ATOM   2895 C  C     . LYS G 3 15 ? 23.064  63.148 18.467  1.00 32.92 ? 69  LYS C C     1 
ATOM   2896 O  O     . LYS G 3 15 ? 22.878  63.767 19.500  1.00 34.39 ? 69  LYS C O     1 
ATOM   2897 C  CB    . LYS G 3 15 ? 21.179  62.694 16.891  1.00 33.87 ? 69  LYS C CB    1 
ATOM   2898 C  CG    . LYS G 3 15 ? 20.437  63.086 15.619  1.00 35.03 ? 69  LYS C CG    1 
ATOM   2899 C  CD    . LYS G 3 15 ? 19.059  62.484 15.552  1.00 33.74 ? 69  LYS C CD    1 
ATOM   2900 C  CE    . LYS G 3 15 ? 18.238  63.147 14.479  1.00 34.00 ? 69  LYS C CE    1 
ATOM   2901 N  NZ    . LYS G 3 15 ? 16.821  62.710 14.591  1.00 37.48 ? 69  LYS C NZ    1 
ATOM   2902 N  N     . ARG G 3 16 ? 23.853  62.089 18.401  1.00 31.99 ? 70  ARG C N     1 
ATOM   2903 C  CA    . ARG G 3 16 ? 24.541  61.580 19.576  1.00 31.11 ? 70  ARG C CA    1 
ATOM   2904 C  C     . ARG G 3 16 ? 25.677  62.513 19.934  1.00 31.47 ? 70  ARG C C     1 
ATOM   2905 O  O     . ARG G 3 16 ? 26.409  62.259 20.885  1.00 35.06 ? 70  ARG C O     1 
ATOM   2906 C  CB    . ARG G 3 16 ? 25.074  60.160 19.301  1.00 29.46 ? 70  ARG C CB    1 
ATOM   2907 C  CG    . ARG G 3 16 ? 24.308  59.076 20.013  1.00 27.49 ? 70  ARG C CG    1 
ATOM   2908 C  CD    . ARG G 3 16 ? 24.374  57.735 19.323  1.00 28.54 ? 70  ARG C CD    1 
ATOM   2909 N  NE    . ARG G 3 16 ? 25.705  57.136 19.178  1.00 29.57 ? 70  ARG C NE    1 
ATOM   2910 C  CZ    . ARG G 3 16 ? 26.587  56.949 20.157  1.00 25.81 ? 70  ARG C CZ    1 
ATOM   2911 N  NH1   . ARG G 3 16 ? 26.311  57.327 21.387  1.00 23.50 ? 70  ARG C NH1   1 
ATOM   2912 N  NH2   . ARG G 3 16 ? 27.742  56.347 19.902  1.00 23.49 ? 70  ARG C NH2   1 
ATOM   2913 N  N     . LYS G 3 17 ? 25.809  63.597 19.172  1.00 28.81 ? 71  LYS C N     1 
ATOM   2914 C  CA    . LYS G 3 17 ? 26.865  64.582 19.384  1.00 26.39 ? 71  LYS C CA    1 
ATOM   2915 C  C     . LYS G 3 17 ? 28.228  63.959 19.590  1.00 24.98 ? 71  LYS C C     1 
ATOM   2916 O  O     . LYS G 3 17 ? 29.019  64.465 20.369  1.00 22.82 ? 71  LYS C O     1 
ATOM   2917 C  CB    . LYS G 3 17 ? 26.572  65.467 20.590  1.00 26.92 ? 71  LYS C CB    1 
ATOM   2918 C  CG    . LYS G 3 17 ? 25.326  66.305 20.513  1.00 29.14 ? 71  LYS C CG    1 
ATOM   2919 C  CD    . LYS G 3 17 ? 25.336  67.277 21.675  1.00 32.46 ? 71  LYS C CD    1 
ATOM   2920 C  CE    . LYS G 3 17 ? 23.986  67.914 21.920  1.00 34.14 ? 71  LYS C CE    1 
ATOM   2921 N  NZ    . LYS G 3 17 ? 24.113  68.939 22.990  1.00 36.46 ? 71  LYS C NZ    1 
ATOM   2922 N  N     . VAL G 3 18 ? 28.500  62.855 18.909  1.00 25.99 ? 72  VAL C N     1 
ATOM   2923 C  CA    . VAL G 3 18 ? 29.795  62.217 19.035  1.00 28.59 ? 72  VAL C CA    1 
ATOM   2924 C  C     . VAL G 3 18 ? 30.590  62.471 17.780  1.00 29.82 ? 72  VAL C C     1 
ATOM   2925 O  O     . VAL G 3 18 ? 30.110  63.118 16.862  1.00 33.18 ? 72  VAL C O     1 
ATOM   2926 C  CB    . VAL G 3 18 ? 29.671  60.709 19.253  1.00 29.04 ? 72  VAL C CB    1 
ATOM   2927 C  CG1   . VAL G 3 18 ? 29.048  60.452 20.592  1.00 30.42 ? 72  VAL C CG1   1 
ATOM   2928 C  CG2   . VAL G 3 18 ? 28.854  60.089 18.154  1.00 30.13 ? 72  VAL C CG2   1 
ATOM   2929 N  N     . LYS G 3 19 ? 31.817  61.989 17.746  1.00 30.96 ? 73  LYS C N     1 
ATOM   2930 C  CA    . LYS G 3 19 ? 32.644  62.181 16.573  1.00 32.56 ? 73  LYS C CA    1 
ATOM   2931 C  C     . LYS G 3 19 ? 32.467  60.954 15.690  1.00 31.65 ? 73  LYS C C     1 
ATOM   2932 O  O     . LYS G 3 19 ? 32.807  59.843 16.082  1.00 32.36 ? 73  LYS C O     1 
ATOM   2933 C  CB    . LYS G 3 19 ? 34.105  62.342 16.994  1.00 35.29 ? 73  LYS C CB    1 
ATOM   2934 C  CG    . LYS G 3 19 ? 35.092  62.483 15.853  1.00 38.18 ? 73  LYS C CG    1 
ATOM   2935 C  CD    . LYS G 3 19 ? 36.524  62.630 16.394  1.00 41.00 ? 73  LYS C CD    1 
ATOM   2936 C  CE    . LYS G 3 19 ? 37.537  62.578 15.266  1.00 40.80 ? 73  LYS C CE    1 
ATOM   2937 N  NZ    . LYS G 3 19 ? 37.371  61.304 14.494  1.00 43.21 ? 73  LYS C NZ    1 
ATOM   2938 N  N     . CYS G 3 20 ? 31.918  61.165 14.505  1.00 29.91 ? 74  CYS C N     1 
ATOM   2939 C  CA    . CYS G 3 20 ? 31.697  60.075 13.578  1.00 29.62 ? 74  CYS C CA    1 
ATOM   2940 C  C     . CYS G 3 20 ? 32.979  59.594 12.910  1.00 29.59 ? 74  CYS C C     1 
ATOM   2941 O  O     . CYS G 3 20 ? 33.856  60.385 12.603  1.00 30.47 ? 74  CYS C O     1 
ATOM   2942 C  CB    . CYS G 3 20 ? 30.703  60.500 12.510  1.00 27.34 ? 74  CYS C CB    1 
ATOM   2943 S  SG    . CYS G 3 20 ? 30.160  59.094 11.515  1.00 27.18 ? 74  CYS C SG    1 
ATOM   2944 N  N     . ASP G 3 21 ? 33.087  58.294 12.674  1.00 29.04 ? 75  ASP C N     1 
ATOM   2945 C  CA    . ASP G 3 21 ? 34.281  57.755 12.028  1.00 29.10 ? 75  ASP C CA    1 
ATOM   2946 C  C     . ASP G 3 21 ? 34.087  57.659 10.523  1.00 27.91 ? 75  ASP C C     1 
ATOM   2947 O  O     . ASP G 3 21 ? 34.976  57.228 9.805   1.00 29.26 ? 75  ASP C O     1 
ATOM   2948 C  CB    . ASP G 3 21 ? 34.628  56.371 12.580  1.00 27.88 ? 75  ASP C CB    1 
ATOM   2949 C  CG    . ASP G 3 21 ? 33.538  55.368 12.345  1.00 27.71 ? 75  ASP C CG    1 
ATOM   2950 O  OD1   . ASP G 3 21 ? 32.526  55.416 13.061  1.00 28.19 ? 75  ASP C OD1   1 
ATOM   2951 O  OD2   . ASP G 3 21 ? 33.685  54.534 11.436  1.00 29.89 ? 75  ASP C OD2   1 
ATOM   2952 N  N     . LYS G 3 22 ? 32.914  58.049 10.057  1.00 27.22 ? 76  LYS C N     1 
ATOM   2953 C  CA    . LYS G 3 22 ? 32.595  58.034 8.634   1.00 29.20 ? 76  LYS C CA    1 
ATOM   2954 C  C     . LYS G 3 22 ? 32.812  56.734 7.859   1.00 30.67 ? 76  LYS C C     1 
ATOM   2955 O  O     . LYS G 3 22 ? 32.831  56.741 6.627   1.00 31.65 ? 76  LYS C O     1 
ATOM   2956 C  CB    . LYS G 3 22 ? 33.328  59.175 7.932   1.00 27.10 ? 76  LYS C CB    1 
ATOM   2957 C  CG    . LYS G 3 22 ? 33.029  60.518 8.548   1.00 27.19 ? 76  LYS C CG    1 
ATOM   2958 C  CD    . LYS G 3 22 ? 33.876  61.601 7.940   1.00 28.94 ? 76  LYS C CD    1 
ATOM   2959 C  CE    . LYS G 3 22 ? 33.664  62.923 8.664   1.00 31.26 ? 76  LYS C CE    1 
ATOM   2960 N  NZ    . LYS G 3 22 ? 34.613  63.971 8.173   1.00 33.22 ? 76  LYS C NZ    1 
ATOM   2961 N  N     . LEU G 3 23 ? 32.955  55.623 8.568   1.00 31.40 ? 77  LEU C N     1 
ATOM   2962 C  CA    . LEU G 3 23 ? 33.131  54.333 7.925   1.00 31.99 ? 77  LEU C CA    1 
ATOM   2963 C  C     . LEU G 3 23 ? 31.867  54.034 7.114   1.00 33.29 ? 77  LEU C C     1 
ATOM   2964 O  O     . LEU G 3 23 ? 30.814  54.611 7.364   1.00 33.62 ? 77  LEU C O     1 
ATOM   2965 C  CB    . LEU G 3 23 ? 33.332  53.262 8.986   1.00 33.45 ? 77  LEU C CB    1 
ATOM   2966 C  CG    . LEU G 3 23 ? 33.853  51.895 8.545   1.00 34.90 ? 77  LEU C CG    1 
ATOM   2967 C  CD1   . LEU G 3 23 ? 35.298  52.019 8.104   1.00 35.11 ? 77  LEU C CD1   1 
ATOM   2968 C  CD2   . LEU G 3 23 ? 33.739  50.916 9.716   1.00 36.49 ? 77  LEU C CD2   1 
ATOM   2969 N  N     . ARG G 3 24 ? 31.969  53.135 6.140   1.00 34.33 ? 78  ARG C N     1 
ATOM   2970 C  CA    . ARG G 3 24 ? 30.835  52.779 5.280   1.00 34.49 ? 78  ARG C CA    1 
ATOM   2971 C  C     . ARG G 3 24 ? 30.728  51.270 5.077   1.00 35.91 ? 78  ARG C C     1 
ATOM   2972 O  O     . ARG G 3 24 ? 31.732  50.566 5.048   1.00 35.93 ? 78  ARG C O     1 
ATOM   2973 C  CB    . ARG G 3 24 ? 30.972  53.462 3.923   1.00 34.87 ? 78  ARG C CB    1 
ATOM   2974 C  CG    . ARG G 3 24 ? 30.727  54.961 3.936   1.00 34.57 ? 78  ARG C CG    1 
ATOM   2975 C  CD    . ARG G 3 24 ? 29.476  55.279 3.130   1.00 36.61 ? 78  ARG C CD    1 
ATOM   2976 N  NE    . ARG G 3 24 ? 29.241  56.712 2.963   1.00 35.83 ? 78  ARG C NE    1 
ATOM   2977 C  CZ    . ARG G 3 24 ? 28.184  57.230 2.340   1.00 35.08 ? 78  ARG C CZ    1 
ATOM   2978 N  NH1   . ARG G 3 24 ? 27.255  56.442 1.814   1.00 32.08 ? 78  ARG C NH1   1 
ATOM   2979 N  NH2   . ARG G 3 24 ? 28.045  58.542 2.258   1.00 36.07 ? 78  ARG C NH2   1 
ATOM   2980 N  N     . PRO G 3 25 ? 29.508  50.756 4.863   1.00 37.24 ? 79  PRO C N     1 
ATOM   2981 C  CA    . PRO G 3 25 ? 28.196  51.416 4.812   1.00 37.45 ? 79  PRO C CA    1 
ATOM   2982 C  C     . PRO G 3 25 ? 27.628  51.928 6.133   1.00 37.66 ? 79  PRO C C     1 
ATOM   2983 O  O     . PRO G 3 25 ? 26.666  52.693 6.149   1.00 39.20 ? 79  PRO C O     1 
ATOM   2984 C  CB    . PRO G 3 25 ? 27.296  50.337 4.197   1.00 37.52 ? 79  PRO C CB    1 
ATOM   2985 C  CG    . PRO G 3 25 ? 28.255  49.471 3.432   1.00 37.82 ? 79  PRO C CG    1 
ATOM   2986 C  CD    . PRO G 3 25 ? 29.387  49.366 4.416   1.00 36.92 ? 79  PRO C CD    1 
ATOM   2987 N  N     . HIS G 3 26 ? 28.205  51.497 7.244   1.00 36.29 ? 80  HIS C N     1 
ATOM   2988 C  CA    . HIS G 3 26 ? 27.716  51.922 8.541   1.00 34.54 ? 80  HIS C CA    1 
ATOM   2989 C  C     . HIS G 3 26 ? 28.931  52.293 9.370   1.00 34.18 ? 80  HIS C C     1 
ATOM   2990 O  O     . HIS G 3 26 ? 29.895  51.542 9.430   1.00 33.98 ? 80  HIS C O     1 
ATOM   2991 C  CB    . HIS G 3 26 ? 26.920  50.783 9.191   1.00 35.57 ? 80  HIS C CB    1 
ATOM   2992 C  CG    . HIS G 3 26 ? 25.783  50.284 8.350   1.00 36.04 ? 80  HIS C CG    1 
ATOM   2993 N  ND1   . HIS G 3 26 ? 24.738  51.092 7.953   1.00 37.62 ? 80  HIS C ND1   1 
ATOM   2994 C  CD2   . HIS G 3 26 ? 25.546  49.070 7.798   1.00 36.81 ? 80  HIS C CD2   1 
ATOM   2995 C  CE1   . HIS G 3 26 ? 23.910  50.400 7.193   1.00 35.17 ? 80  HIS C CE1   1 
ATOM   2996 N  NE2   . HIS G 3 26 ? 24.376  49.172 7.081   1.00 36.49 ? 80  HIS C NE2   1 
ATOM   2997 N  N     . CYS G 3 27 ? 28.889  53.457 10.007  1.00 33.14 ? 81  CYS C N     1 
ATOM   2998 C  CA    . CYS G 3 27 ? 30.030  53.921 10.782  1.00 33.54 ? 81  CYS C CA    1 
ATOM   2999 C  C     . CYS G 3 27 ? 30.347  53.069 12.015  1.00 35.72 ? 81  CYS C C     1 
ATOM   3000 O  O     . CYS G 3 27 ? 29.469  52.421 12.588  1.00 36.60 ? 81  CYS C O     1 
ATOM   3001 C  CB    . CYS G 3 27 ? 29.831  55.387 11.178  1.00 30.72 ? 81  CYS C CB    1 
ATOM   3002 S  SG    . CYS G 3 27 ? 28.843  55.670 12.662  1.00 25.03 ? 81  CYS C SG    1 
ATOM   3003 N  N     . GLN G 3 28 ? 31.617  53.070 12.409  1.00 36.92 ? 82  GLN C N     1 
ATOM   3004 C  CA    . GLN G 3 28 ? 32.070  52.292 13.554  1.00 36.98 ? 82  GLN C CA    1 
ATOM   3005 C  C     . GLN G 3 28 ? 31.285  52.667 14.786  1.00 35.94 ? 82  GLN C C     1 
ATOM   3006 O  O     . GLN G 3 28 ? 30.669  51.825 15.422  1.00 36.77 ? 82  GLN C O     1 
ATOM   3007 C  CB    . GLN G 3 28 ? 33.552  52.541 13.823  1.00 39.80 ? 82  GLN C CB    1 
ATOM   3008 C  CG    . GLN G 3 28 ? 34.302  51.302 14.267  1.00 44.87 ? 82  GLN C CG    1 
ATOM   3009 C  CD    . GLN G 3 28 ? 34.532  50.325 13.126  1.00 47.75 ? 82  GLN C CD    1 
ATOM   3010 O  OE1   . GLN G 3 28 ? 35.388  50.545 12.265  1.00 48.89 ? 82  GLN C OE1   1 
ATOM   3011 N  NE2   . GLN G 3 28 ? 33.762  49.243 13.109  1.00 48.40 ? 82  GLN C NE2   1 
ATOM   3012 N  N     . GLN G 3 29 ? 31.321  53.945 15.120  1.00 36.02 ? 83  GLN C N     1 
ATOM   3013 C  CA    . GLN G 3 29 ? 30.618  54.456 16.287  1.00 36.91 ? 83  GLN C CA    1 
ATOM   3014 C  C     . GLN G 3 29 ? 29.223  53.818 16.407  1.00 36.72 ? 83  GLN C C     1 
ATOM   3015 O  O     . GLN G 3 29 ? 28.820  53.431 17.508  1.00 37.96 ? 83  GLN C O     1 
ATOM   3016 C  CB    . GLN G 3 29 ? 30.522  55.994 16.189  1.00 37.06 ? 83  GLN C CB    1 
ATOM   3017 C  CG    . GLN G 3 29 ? 30.381  56.737 17.508  1.00 38.78 ? 83  GLN C CG    1 
ATOM   3018 C  CD    . GLN G 3 29 ? 31.720  57.028 18.181  1.00 38.69 ? 83  GLN C CD    1 
ATOM   3019 O  OE1   . GLN G 3 29 ? 32.445  56.108 18.560  1.00 39.98 ? 83  GLN C OE1   1 
ATOM   3020 N  NE2   . GLN G 3 29 ? 32.044  58.315 18.340  1.00 36.16 ? 83  GLN C NE2   1 
ATOM   3021 N  N     . CYS G 3 30 ? 28.496  53.697 15.288  1.00 35.36 ? 84  CYS C N     1 
ATOM   3022 C  CA    . CYS G 3 30 ? 27.155  53.097 15.305  1.00 33.32 ? 84  CYS C CA    1 
ATOM   3023 C  C     . CYS G 3 30 ? 27.170  51.576 15.536  1.00 34.14 ? 84  CYS C C     1 
ATOM   3024 O  O     . CYS G 3 30 ? 26.247  51.016 16.140  1.00 34.46 ? 84  CYS C O     1 
ATOM   3025 C  CB    . CYS G 3 30 ? 26.399  53.387 13.999  1.00 29.95 ? 84  CYS C CB    1 
ATOM   3026 S  SG    . CYS G 3 30 ? 25.543  54.997 13.878  1.00 25.05 ? 84  CYS C SG    1 
ATOM   3027 N  N     . THR G 3 31 ? 28.209  50.908 15.059  1.00 34.00 ? 85  THR C N     1 
ATOM   3028 C  CA    . THR G 3 31 ? 28.302  49.471 15.237  1.00 36.29 ? 85  THR C CA    1 
ATOM   3029 C  C     . THR G 3 31 ? 28.600  49.165 16.705  1.00 36.31 ? 85  THR C C     1 
ATOM   3030 O  O     . THR G 3 31 ? 28.109  48.187 17.271  1.00 36.40 ? 85  THR C O     1 
ATOM   3031 C  CB    . THR G 3 31 ? 29.410  48.886 14.368  1.00 36.52 ? 85  THR C CB    1 
ATOM   3032 O  OG1   . THR G 3 31 ? 29.174  49.237 13.001  1.00 37.21 ? 85  THR C OG1   1 
ATOM   3033 C  CG2   . THR G 3 31 ? 29.428  47.363 14.489  1.00 36.57 ? 85  THR C CG2   1 
ATOM   3034 N  N     . LYS G 3 32 ? 29.409  50.024 17.311  1.00 36.92 ? 86  LYS C N     1 
ATOM   3035 C  CA    . LYS G 3 32 ? 29.792  49.889 18.703  1.00 36.50 ? 86  LYS C CA    1 
ATOM   3036 C  C     . LYS G 3 32 ? 28.549  49.873 19.584  1.00 35.92 ? 86  LYS C C     1 
ATOM   3037 O  O     . LYS G 3 32 ? 28.524  49.229 20.618  1.00 37.96 ? 86  LYS C O     1 
ATOM   3038 C  CB    . LYS G 3 32 ? 30.682  51.069 19.090  1.00 37.83 ? 86  LYS C CB    1 
ATOM   3039 C  CG    . LYS G 3 32 ? 31.479  50.889 20.359  1.00 40.02 ? 86  LYS C CG    1 
ATOM   3040 C  CD    . LYS G 3 32 ? 31.936  52.236 20.923  1.00 42.86 ? 86  LYS C CD    1 
ATOM   3041 C  CE    . LYS G 3 32 ? 32.950  52.960 20.030  1.00 43.71 ? 86  LYS C CE    1 
ATOM   3042 N  NZ    . LYS G 3 32 ? 33.354  54.292 20.624  1.00 44.86 ? 86  LYS C NZ    1 
ATOM   3043 N  N     . THR G 3 33 ? 27.509  50.578 19.161  1.00 34.05 ? 87  THR C N     1 
ATOM   3044 C  CA    . THR G 3 33 ? 26.274  50.660 19.936  1.00 33.06 ? 87  THR C CA    1 
ATOM   3045 C  C     . THR G 3 33 ? 25.141  49.809 19.391  1.00 32.43 ? 87  THR C C     1 
ATOM   3046 O  O     . THR G 3 33 ? 24.000  49.943 19.823  1.00 33.21 ? 87  THR C O     1 
ATOM   3047 C  CB    . THR G 3 33 ? 25.774  52.103 20.013  1.00 33.06 ? 87  THR C CB    1 
ATOM   3048 O  OG1   . THR G 3 33 ? 25.689  52.639 18.689  1.00 35.82 ? 87  THR C OG1   1 
ATOM   3049 C  CG2   . THR G 3 33 ? 26.716  52.949 20.830  1.00 31.35 ? 87  THR C CG2   1 
ATOM   3050 N  N     . GLY G 3 34 ? 25.445  48.947 18.433  1.00 31.66 ? 88  GLY C N     1 
ATOM   3051 C  CA    . GLY G 3 34 ? 24.422  48.078 17.877  1.00 29.43 ? 88  GLY C CA    1 
ATOM   3052 C  C     . GLY G 3 34 ? 23.369  48.721 16.996  1.00 29.00 ? 88  GLY C C     1 
ATOM   3053 O  O     . GLY G 3 34 ? 22.600  48.028 16.350  1.00 29.65 ? 88  GLY C O     1 
ATOM   3054 N  N     . VAL G 3 35 ? 23.345  50.048 16.932  1.00 28.80 ? 89  VAL C N     1 
ATOM   3055 C  CA    . VAL G 3 35 ? 22.350  50.749 16.117  1.00 26.52 ? 89  VAL C CA    1 
ATOM   3056 C  C     . VAL G 3 35 ? 22.689  50.841 14.639  1.00 26.63 ? 89  VAL C C     1 
ATOM   3057 O  O     . VAL G 3 35 ? 22.129  51.664 13.935  1.00 27.70 ? 89  VAL C O     1 
ATOM   3058 C  CB    . VAL G 3 35 ? 22.102  52.186 16.644  1.00 24.72 ? 89  VAL C CB    1 
ATOM   3059 C  CG1   . VAL G 3 35 ? 21.472  52.128 18.015  1.00 23.39 ? 89  VAL C CG1   1 
ATOM   3060 C  CG2   . VAL G 3 35 ? 23.405  52.958 16.686  1.00 22.82 ? 89  VAL C CG2   1 
ATOM   3061 N  N     . ALA G 3 36 ? 23.589  49.982 14.177  1.00 25.20 ? 90  ALA C N     1 
ATOM   3062 C  CA    . ALA G 3 36 ? 24.007  49.973 12.782  1.00 24.85 ? 90  ALA C CA    1 
ATOM   3063 C  C     . ALA G 3 36 ? 22.876  49.978 11.756  1.00 25.49 ? 90  ALA C C     1 
ATOM   3064 O  O     . ALA G 3 36 ? 22.945  50.678 10.746  1.00 28.75 ? 90  ALA C O     1 
ATOM   3065 C  CB    . ALA G 3 36 ? 24.920  48.798 12.530  1.00 24.13 ? 90  ALA C CB    1 
ATOM   3066 N  N     . HIS G 3 37 ? 21.824  49.211 11.981  1.00 24.98 ? 91  HIS C N     1 
ATOM   3067 C  CA    . HIS G 3 37 ? 20.750  49.217 11.001  1.00 25.41 ? 91  HIS C CA    1 
ATOM   3068 C  C     . HIS G 3 37 ? 20.183  50.620 10.859  1.00 26.57 ? 91  HIS C C     1 
ATOM   3069 O  O     . HIS G 3 37 ? 19.437  50.909 9.936   1.00 28.84 ? 91  HIS C O     1 
ATOM   3070 C  CB    . HIS G 3 37 ? 19.642  48.236 11.400  1.00 23.15 ? 91  HIS C CB    1 
ATOM   3071 C  CG    . HIS G 3 37 ? 19.012  48.539 12.723  1.00 20.87 ? 91  HIS C CG    1 
ATOM   3072 N  ND1   . HIS G 3 37 ? 19.745  48.735 13.870  1.00 22.59 ? 91  HIS C ND1   1 
ATOM   3073 C  CD2   . HIS G 3 37 ? 17.710  48.649 13.079  1.00 22.44 ? 91  HIS C CD2   1 
ATOM   3074 C  CE1   . HIS G 3 37 ? 18.923  48.956 14.881  1.00 23.88 ? 91  HIS C CE1   1 
ATOM   3075 N  NE2   . HIS G 3 37 ? 17.683  48.911 14.432  1.00 23.75 ? 91  HIS C NE2   1 
ATOM   3076 N  N     . LEU G 3 38 ? 20.553  51.498 11.780  1.00 25.40 ? 92  LEU C N     1 
ATOM   3077 C  CA    . LEU G 3 38 ? 20.056  52.866 11.765  1.00 24.82 ? 92  LEU C CA    1 
ATOM   3078 C  C     . LEU G 3 38 ? 21.033  53.919 11.233  1.00 23.11 ? 92  LEU C C     1 
ATOM   3079 O  O     . LEU G 3 38 ? 20.622  55.024 10.934  1.00 22.03 ? 92  LEU C O     1 
ATOM   3080 C  CB    . LEU G 3 38 ? 19.574  53.253 13.167  1.00 23.43 ? 92  LEU C CB    1 
ATOM   3081 C  CG    . LEU G 3 38 ? 18.419  52.400 13.695  1.00 21.86 ? 92  LEU C CG    1 
ATOM   3082 C  CD1   . LEU G 3 38 ? 18.079  52.839 15.097  1.00 21.53 ? 92  LEU C CD1   1 
ATOM   3083 C  CD2   . LEU G 3 38 ? 17.227  52.509 12.807  1.00 19.15 ? 92  LEU C CD2   1 
ATOM   3084 N  N     . CYS G 3 39 ? 22.312  53.570 11.112  1.00 22.12 ? 93  CYS C N     1 
ATOM   3085 C  CA    . CYS G 3 39 ? 23.331  54.484 10.598  1.00 22.94 ? 93  CYS C CA    1 
ATOM   3086 C  C     . CYS G 3 39 ? 23.004  54.916 9.177   1.00 24.03 ? 93  CYS C C     1 
ATOM   3087 O  O     . CYS G 3 39 ? 22.862  54.082 8.288   1.00 23.99 ? 93  CYS C O     1 
ATOM   3088 C  CB    . CYS G 3 39 ? 24.691  53.799 10.620  1.00 23.70 ? 93  CYS C CB    1 
ATOM   3089 S  SG    . CYS G 3 39 ? 26.085  54.841 10.140  1.00 20.52 ? 93  CYS C SG    1 
ATOM   3090 N  N     . HIS G 3 40 ? 22.915  56.226 8.966   1.00 23.98 ? 94  HIS C N     1 
ATOM   3091 C  CA    . HIS G 3 40 ? 22.566  56.775 7.654   1.00 25.00 ? 94  HIS C CA    1 
ATOM   3092 C  C     . HIS G 3 40 ? 23.323  58.040 7.255   1.00 23.65 ? 94  HIS C C     1 
ATOM   3093 O  O     . HIS G 3 40 ? 23.435  58.972 8.040   1.00 22.92 ? 94  HIS C O     1 
ATOM   3094 C  CB    . HIS G 3 40 ? 21.052  57.032 7.632   1.00 28.93 ? 94  HIS C CB    1 
ATOM   3095 C  CG    . HIS G 3 40 ? 20.591  57.939 6.537   1.00 31.02 ? 94  HIS C CG    1 
ATOM   3096 N  ND1   . HIS G 3 40 ? 20.493  57.533 5.222   1.00 33.34 ? 94  HIS C ND1   1 
ATOM   3097 C  CD2   . HIS G 3 40 ? 20.155  59.219 6.575   1.00 31.80 ? 94  HIS C CD2   1 
ATOM   3098 C  CE1   . HIS G 3 40 ? 20.013  58.529 4.498   1.00 33.37 ? 94  HIS C CE1   1 
ATOM   3099 N  NE2   . HIS G 3 40 ? 19.798  59.563 5.292   1.00 33.84 ? 94  HIS C NE2   1 
ATOM   3100 N  N     . TYR G 3 41 ? 23.849  58.041 6.032   1.00 22.67 ? 95  TYR C N     1 
ATOM   3101 C  CA    . TYR G 3 41 ? 24.565  59.192 5.470   1.00 20.89 ? 95  TYR C CA    1 
ATOM   3102 C  C     . TYR G 3 41 ? 23.667  59.951 4.489   1.00 20.53 ? 95  TYR C C     1 
ATOM   3103 O  O     . TYR G 3 41 ? 23.083  59.364 3.584   1.00 19.98 ? 95  TYR C O     1 
ATOM   3104 C  CB    . TYR G 3 41 ? 25.837  58.742 4.749   1.00 19.66 ? 95  TYR C CB    1 
ATOM   3105 C  CG    . TYR G 3 41 ? 26.923  58.226 5.664   1.00 23.62 ? 95  TYR C CG    1 
ATOM   3106 C  CD1   . TYR G 3 41 ? 27.194  56.866 5.762   1.00 24.81 ? 95  TYR C CD1   1 
ATOM   3107 C  CD2   . TYR G 3 41 ? 27.647  59.093 6.469   1.00 24.36 ? 95  TYR C CD2   1 
ATOM   3108 C  CE1   . TYR G 3 41 ? 28.160  56.386 6.644   1.00 23.90 ? 95  TYR C CE1   1 
ATOM   3109 C  CE2   . TYR G 3 41 ? 28.607  58.628 7.351   1.00 25.68 ? 95  TYR C CE2   1 
ATOM   3110 C  CZ    . TYR G 3 41 ? 28.860  57.273 7.443   1.00 26.36 ? 95  TYR C CZ    1 
ATOM   3111 O  OH    . TYR G 3 41 ? 29.781  56.810 8.365   1.00 26.18 ? 95  TYR C OH    1 
ATOM   3112 N  N     . MET G 3 42 ? 23.549  61.257 4.682   1.00 21.96 ? 96  MET C N     1 
ATOM   3113 C  CA    . MET G 3 42 ? 22.715  62.084 3.820   1.00 22.15 ? 96  MET C CA    1 
ATOM   3114 C  C     . MET G 3 42 ? 23.307  62.171 2.407   1.00 22.27 ? 96  MET C C     1 
ATOM   3115 O  O     . MET G 3 42 ? 24.524  62.088 2.223   1.00 22.15 ? 96  MET C O     1 
ATOM   3116 C  CB    . MET G 3 42 ? 22.578  63.490 4.418   1.00 21.78 ? 96  MET C CB    1 
ATOM   3117 C  CG    . MET G 3 42 ? 21.697  63.577 5.656   1.00 23.76 ? 96  MET C CG    1 
ATOM   3118 S  SD    . MET G 3 42 ? 22.076  65.012 6.723   1.00 32.37 ? 96  MET C SD    1 
ATOM   3119 C  CE    . MET G 3 42 ? 20.711  66.093 6.322   1.00 29.32 ? 96  MET C CE    1 
ATOM   3120 N  N     . GLU G 3 43 ? 22.434  62.318 1.413   1.00 22.63 ? 97  GLU C N     1 
ATOM   3121 C  CA    . GLU G 3 43 ? 22.848  62.436 0.023   1.00 23.85 ? 97  GLU C CA    1 
ATOM   3122 C  C     . GLU G 3 43 ? 22.307  63.767 -0.499  1.00 23.54 ? 97  GLU C C     1 
ATOM   3123 O  O     . GLU G 3 43 ? 22.642  64.214 -1.590  1.00 24.96 ? 97  GLU C O     1 
ATOM   3124 C  CB    . GLU G 3 43 ? 22.280  61.272 -0.789  1.00 27.16 ? 97  GLU C CB    1 
ATOM   3125 C  CG    . GLU G 3 43 ? 22.763  59.915 -0.336  1.00 32.89 ? 97  GLU C CG    1 
ATOM   3126 C  CD    . GLU G 3 43 ? 21.893  58.779 -0.829  1.00 36.35 ? 97  GLU C CD    1 
ATOM   3127 O  OE1   . GLU G 3 43 ? 20.664  58.817 -0.588  1.00 37.05 ? 97  GLU C OE1   1 
ATOM   3128 O  OE2   . GLU G 3 43 ? 22.439  57.840 -1.449  1.00 40.33 ? 97  GLU C OE2   1 
ATOM   3129 N  N     . GLN G 3 44 ? 21.458  64.384 0.308   1.00 21.23 ? 98  GLN C N     1 
ATOM   3130 C  CA    . GLN G 3 44 ? 20.854  65.662 -0.002  1.00 19.71 ? 98  GLN C CA    1 
ATOM   3131 C  C     . GLN G 3 44 ? 20.928  66.510 1.250   1.00 17.02 ? 98  GLN C C     1 
ATOM   3132 O  O     . GLN G 3 44 ? 21.485  66.100 2.250   1.00 15.66 ? 98  GLN C O     1 
ATOM   3133 C  CB    . GLN G 3 44 ? 19.387  65.479 -0.402  1.00 20.32 ? 98  GLN C CB    1 
ATOM   3134 C  CG    . GLN G 3 44 ? 19.185  64.840 -1.752  1.00 24.31 ? 98  GLN C CG    1 
ATOM   3135 C  CD    . GLN G 3 44 ? 17.756  64.919 -2.236  1.00 28.30 ? 98  GLN C CD    1 
ATOM   3136 O  OE1   . GLN G 3 44 ? 16.865  64.303 -1.665  1.00 30.70 ? 98  GLN C OE1   1 
ATOM   3137 N  NE2   . GLN G 3 44 ? 17.532  65.683 -3.295  1.00 26.48 ? 98  GLN C NE2   1 
ATOM   3138 N  N     . THR G 3 45 ? 20.362  67.703 1.174   1.00 14.92 ? 99  THR C N     1 
ATOM   3139 C  CA    . THR G 3 45 ? 20.321  68.621 2.305   1.00 12.90 ? 99  THR C CA    1 
ATOM   3140 C  C     . THR G 3 45 ? 19.214  68.185 3.255   1.00 14.42 ? 99  THR C C     1 
ATOM   3141 O  O     . THR G 3 45 ? 18.382  67.364 2.896   1.00 13.58 ? 99  THR C O     1 
ATOM   3142 C  CB    . THR G 3 45 ? 20.004  70.039 1.850   1.00 8.72  ? 99  THR C CB    1 
ATOM   3143 O  OG1   . THR G 3 45 ? 18.678  70.081 1.324   1.00 6.15  ? 99  THR C OG1   1 
ATOM   3144 C  CG2   . THR G 3 45 ? 20.973  70.491 0.794   1.00 9.06  ? 99  THR C CG2   1 
ATOM   3145 N  N     . TRP G 3 46 ? 19.207  68.732 4.465   1.00 15.79 ? 100 TRP C N     1 
ATOM   3146 C  CA    . TRP G 3 46 ? 18.178  68.390 5.438   1.00 16.02 ? 100 TRP C CA    1 
ATOM   3147 C  C     . TRP G 3 46 ? 16.785  68.623 4.866   1.00 16.84 ? 100 TRP C C     1 
ATOM   3148 O  O     . TRP G 3 46 ? 15.912  67.776 4.984   1.00 15.50 ? 100 TRP C O     1 
ATOM   3149 C  CB    . TRP G 3 46 ? 18.344  69.229 6.713   1.00 20.82 ? 100 TRP C CB    1 
ATOM   3150 C  CG    . TRP G 3 46 ? 17.279  68.972 7.753   1.00 25.88 ? 100 TRP C CG    1 
ATOM   3151 C  CD1   . TRP G 3 46 ? 17.305  68.023 8.723   1.00 28.04 ? 100 TRP C CD1   1 
ATOM   3152 C  CD2   . TRP G 3 46 ? 16.002  69.620 7.858   1.00 26.07 ? 100 TRP C CD2   1 
ATOM   3153 N  NE1   . TRP G 3 46 ? 16.121  68.025 9.423   1.00 29.91 ? 100 TRP C NE1   1 
ATOM   3154 C  CE2   . TRP G 3 46 ? 15.301  68.994 8.906   1.00 28.95 ? 100 TRP C CE2   1 
ATOM   3155 C  CE3   . TRP G 3 46 ? 15.375  70.651 7.153   1.00 26.38 ? 100 TRP C CE3   1 
ATOM   3156 C  CZ2   . TRP G 3 46 ? 14.007  69.377 9.279   1.00 31.04 ? 100 TRP C CZ2   1 
ATOM   3157 C  CZ3   . TRP G 3 46 ? 14.086  71.032 7.516   1.00 28.30 ? 100 TRP C CZ3   1 
ATOM   3158 C  CH2   . TRP G 3 46 ? 13.414  70.391 8.565   1.00 30.75 ? 100 TRP C CH2   1 
ATOM   3159 N  N     . ALA G 3 47 ? 16.591  69.786 4.245   1.00 17.36 ? 101 ALA C N     1 
ATOM   3160 C  CA    . ALA G 3 47 ? 15.304  70.167 3.677   1.00 17.09 ? 101 ALA C CA    1 
ATOM   3161 C  C     . ALA G 3 47 ? 14.816  69.297 2.546   1.00 17.81 ? 101 ALA C C     1 
ATOM   3162 O  O     . ALA G 3 47 ? 13.651  68.975 2.479   1.00 17.78 ? 101 ALA C O     1 
ATOM   3163 C  CB    . ALA G 3 47 ? 15.356  71.607 3.227   1.00 17.77 ? 101 ALA C CB    1 
ATOM   3164 N  N     . GLU G 3 48 ? 15.702  68.942 1.632   1.00 17.16 ? 102 GLU C N     1 
ATOM   3165 C  CA    . GLU G 3 48 ? 15.311  68.093 0.531   1.00 16.58 ? 102 GLU C CA    1 
ATOM   3166 C  C     . GLU G 3 48 ? 14.891  66.755 1.102   1.00 17.04 ? 102 GLU C C     1 
ATOM   3167 O  O     . GLU G 3 48 ? 13.854  66.223 0.745   1.00 16.16 ? 102 GLU C O     1 
ATOM   3168 C  CB    . GLU G 3 48 ? 16.473  67.954 -0.453  1.00 15.37 ? 102 GLU C CB    1 
ATOM   3169 C  CG    . GLU G 3 48 ? 16.934  69.287 -1.007  1.00 14.58 ? 102 GLU C CG    1 
ATOM   3170 C  CD    . GLU G 3 48 ? 18.173  69.211 -1.863  1.00 18.26 ? 102 GLU C CD    1 
ATOM   3171 O  OE1   . GLU G 3 48 ? 19.105  68.473 -1.509  1.00 13.35 ? 102 GLU C OE1   1 
ATOM   3172 O  OE2   . GLU G 3 48 ? 18.221  69.922 -2.883  1.00 17.24 ? 102 GLU C OE2   1 
ATOM   3173 N  N     . GLU G 3 49 ? 15.696  66.239 2.020   1.00 17.51 ? 103 GLU C N     1 
ATOM   3174 C  CA    . GLU G 3 49 ? 15.432  64.974 2.691   1.00 19.83 ? 103 GLU C CA    1 
ATOM   3175 C  C     . GLU G 3 49 ? 14.123  65.091 3.442   1.00 19.62 ? 103 GLU C C     1 
ATOM   3176 O  O     . GLU G 3 49 ? 13.300  64.191 3.425   1.00 19.55 ? 103 GLU C O     1 
ATOM   3177 C  CB    . GLU G 3 49 ? 16.575  64.675 3.659   1.00 23.66 ? 103 GLU C CB    1 
ATOM   3178 C  CG    . GLU G 3 49 ? 16.645  63.257 4.196   1.00 30.60 ? 103 GLU C CG    1 
ATOM   3179 C  CD    . GLU G 3 49 ? 18.059  62.885 4.629   1.00 38.01 ? 103 GLU C CD    1 
ATOM   3180 O  OE1   . GLU G 3 49 ? 18.576  63.491 5.609   1.00 40.33 ? 103 GLU C OE1   1 
ATOM   3181 O  OE2   . GLU G 3 49 ? 18.653  61.991 3.972   1.00 41.82 ? 103 GLU C OE2   1 
ATOM   3182 N  N     . ALA G 3 50 ? 13.945  66.225 4.099   1.00 17.74 ? 104 ALA C N     1 
ATOM   3183 C  CA    . ALA G 3 50 ? 12.737  66.489 4.846   1.00 17.44 ? 104 ALA C CA    1 
ATOM   3184 C  C     . ALA G 3 50 ? 11.494  66.456 3.973   1.00 18.94 ? 104 ALA C C     1 
ATOM   3185 O  O     . ALA G 3 50 ? 10.508  65.845 4.329   1.00 21.23 ? 104 ALA C O     1 
ATOM   3186 C  CB    . ALA G 3 50 ? 12.851  67.828 5.535   1.00 18.46 ? 104 ALA C CB    1 
ATOM   3187 N  N     . GLU G 3 51 ? 11.538  67.107 2.815   1.00 18.51 ? 105 GLU C N     1 
ATOM   3188 C  CA    . GLU G 3 51 ? 10.378  67.139 1.930   1.00 18.22 ? 105 GLU C CA    1 
ATOM   3189 C  C     . GLU G 3 51 ? 10.029  65.758 1.413   1.00 18.53 ? 105 GLU C C     1 
ATOM   3190 O  O     . GLU G 3 51 ? 8.863   65.424 1.264   1.00 17.23 ? 105 GLU C O     1 
ATOM   3191 C  CB    . GLU G 3 51 ? 10.622  68.096 0.756   1.00 18.41 ? 105 GLU C CB    1 
ATOM   3192 C  CG    . GLU G 3 51 ? 9.486   68.181 -0.262  1.00 17.63 ? 105 GLU C CG    1 
ATOM   3193 C  CD    . GLU G 3 51 ? 8.265   68.885 0.273   1.00 19.83 ? 105 GLU C CD    1 
ATOM   3194 O  OE1   . GLU G 3 51 ? 8.414   69.716 1.188   1.00 22.97 ? 105 GLU C OE1   1 
ATOM   3195 O  OE2   . GLU G 3 51 ? 7.158   68.623 -0.235  1.00 17.99 ? 105 GLU C OE2   1 
ATOM   3196 N  N     . LYS G 3 52 ? 11.043  64.954 1.127   1.00 20.55 ? 106 LYS C N     1 
ATOM   3197 C  CA    . LYS G 3 52 ? 10.802  63.606 0.647   1.00 21.57 ? 106 LYS C CA    1 
ATOM   3198 C  C     . LYS G 3 52 ? 10.070  62.790 1.686   1.00 22.87 ? 106 LYS C C     1 
ATOM   3199 O  O     . LYS G 3 52 ? 9.160   62.067 1.349   1.00 25.56 ? 106 LYS C O     1 
ATOM   3200 C  CB    . LYS G 3 52 ? 12.113  62.926 0.262   1.00 22.40 ? 106 LYS C CB    1 
ATOM   3201 C  CG    . LYS G 3 52 ? 12.520  63.200 -1.179  1.00 27.77 ? 106 LYS C CG    1 
ATOM   3202 C  CD    . LYS G 3 52 ? 13.935  62.737 -1.478  1.00 32.90 ? 106 LYS C CD    1 
ATOM   3203 C  CE    . LYS G 3 52 ? 14.299  62.934 -2.952  1.00 35.85 ? 106 LYS C CE    1 
ATOM   3204 N  NZ    . LYS G 3 52 ? 14.065  64.325 -3.414  1.00 38.56 ? 106 LYS C NZ    1 
ATOM   3205 N  N     . GLU G 3 53 ? 10.457  62.901 2.951   1.00 21.44 ? 107 GLU C N     1 
ATOM   3206 C  CA    . GLU G 3 53 ? 9.771   62.151 4.004   1.00 23.08 ? 107 GLU C CA    1 
ATOM   3207 C  C     . GLU G 3 53 ? 8.333   62.629 4.154   1.00 22.51 ? 107 GLU C C     1 
ATOM   3208 O  O     . GLU G 3 53 ? 7.444   61.864 4.483   1.00 24.23 ? 107 GLU C O     1 
ATOM   3209 C  CB    . GLU G 3 53 ? 10.498  62.277 5.347   1.00 24.11 ? 107 GLU C CB    1 
ATOM   3210 C  CG    . GLU G 3 53 ? 11.677  61.320 5.523   1.00 29.17 ? 107 GLU C CG    1 
ATOM   3211 C  CD    . GLU G 3 53 ? 11.279  59.844 5.385   1.00 34.75 ? 107 GLU C CD    1 
ATOM   3212 O  OE1   . GLU G 3 53 ? 10.175  59.480 5.846   1.00 38.42 ? 107 GLU C OE1   1 
ATOM   3213 O  OE2   . GLU G 3 53 ? 12.071  59.049 4.831   1.00 34.12 ? 107 GLU C OE2   1 
ATOM   3214 N  N     . LEU G 3 54 ? 8.111   63.903 3.891   1.00 20.91 ? 108 LEU C N     1 
ATOM   3215 C  CA    . LEU G 3 54 ? 6.792   64.483 3.982   1.00 18.92 ? 108 LEU C CA    1 
ATOM   3216 C  C     . LEU G 3 54 ? 5.902   63.907 2.894   1.00 17.39 ? 108 LEU C C     1 
ATOM   3217 O  O     . LEU G 3 54 ? 4.756   63.575 3.137   1.00 17.80 ? 108 LEU C O     1 
ATOM   3218 C  CB    . LEU G 3 54 ? 6.907   65.996 3.835   1.00 22.15 ? 108 LEU C CB    1 
ATOM   3219 C  CG    . LEU G 3 54 ? 6.055   66.847 4.761   1.00 22.86 ? 108 LEU C CG    1 
ATOM   3220 C  CD1   . LEU G 3 54 ? 6.252   66.408 6.202   1.00 20.77 ? 108 LEU C CD1   1 
ATOM   3221 C  CD2   . LEU G 3 54 ? 6.446   68.288 4.568   1.00 23.64 ? 108 LEU C CD2   1 
ATOM   3222 N  N     . LEU G 3 55 ? 6.433   63.802 1.686   1.00 15.30 ? 109 LEU C N     1 
ATOM   3223 C  CA    . LEU G 3 55 ? 5.670   63.240 0.593   1.00 12.47 ? 109 LEU C CA    1 
ATOM   3224 C  C     . LEU G 3 55 ? 5.407   61.776 0.866   1.00 13.21 ? 109 LEU C C     1 
ATOM   3225 O  O     . LEU G 3 55 ? 4.323   61.276 0.621   1.00 11.40 ? 109 LEU C O     1 
ATOM   3226 C  CB    . LEU G 3 55 ? 6.435   63.426 -0.718  1.00 9.07  ? 109 LEU C CB    1 
ATOM   3227 C  CG    . LEU G 3 55 ? 5.948   64.562 -1.615  1.00 3.80  ? 109 LEU C CG    1 
ATOM   3228 C  CD1   . LEU G 3 55 ? 5.139   65.540 -0.832  1.00 4.79  ? 109 LEU C CD1   1 
ATOM   3229 C  CD2   . LEU G 3 55 ? 7.117   65.239 -2.239  1.00 3.34  ? 109 LEU C CD2   1 
ATOM   3230 N  N     . LYS G 3 56 ? 6.423   61.108 1.401   1.00 14.95 ? 110 LYS C N     1 
ATOM   3231 C  CA    . LYS G 3 56 ? 6.355   59.702 1.739   1.00 15.18 ? 110 LYS C CA    1 
ATOM   3232 C  C     . LYS G 3 56 ? 5.211   59.463 2.713   1.00 16.11 ? 110 LYS C C     1 
ATOM   3233 O  O     . LYS G 3 56 ? 4.438   58.530 2.561   1.00 15.57 ? 110 LYS C O     1 
ATOM   3234 C  CB    . LYS G 3 56 ? 7.687   59.272 2.363   1.00 19.05 ? 110 LYS C CB    1 
ATOM   3235 C  CG    . LYS G 3 56 ? 8.217   57.939 1.858   1.00 21.55 ? 110 LYS C CG    1 
ATOM   3236 C  CD    . LYS G 3 56 ? 9.673   58.063 1.444   1.00 25.63 ? 110 LYS C CD    1 
ATOM   3237 C  CE    . LYS G 3 56 ? 10.631  57.784 2.583   1.00 25.41 ? 110 LYS C CE    1 
ATOM   3238 N  NZ    . LYS G 3 56 ? 11.000  56.346 2.620   1.00 24.74 ? 110 LYS C NZ    1 
ATOM   3239 N  N     . ASP G 3 57 ? 5.109   60.318 3.725   1.00 17.77 ? 111 ASP C N     1 
ATOM   3240 C  CA    . ASP G 3 57 ? 4.049   60.203 4.707   1.00 18.83 ? 111 ASP C CA    1 
ATOM   3241 C  C     . ASP G 3 57 ? 2.689   60.255 4.026   1.00 17.91 ? 111 ASP C C     1 
ATOM   3242 O  O     . ASP G 3 57 ? 1.772   59.530 4.366   1.00 17.00 ? 111 ASP C O     1 
ATOM   3243 C  CB    . ASP G 3 57 ? 4.124   61.353 5.724   1.00 22.59 ? 111 ASP C CB    1 
ATOM   3244 C  CG    . ASP G 3 57 ? 5.391   61.330 6.568   1.00 30.26 ? 111 ASP C CG    1 
ATOM   3245 O  OD1   . ASP G 3 57 ? 6.007   60.251 6.697   1.00 32.31 ? 111 ASP C OD1   1 
ATOM   3246 O  OD2   . ASP G 3 57 ? 5.753   62.397 7.128   1.00 34.21 ? 111 ASP C OD2   1 
ATOM   3247 N  N     . ASN G 3 58 ? 2.571   61.147 3.064   1.00 18.39 ? 112 ASN C N     1 
ATOM   3248 C  CA    . ASN G 3 58 ? 1.336   61.354 2.347   1.00 19.50 ? 112 ASN C CA    1 
ATOM   3249 C  C     . ASN G 3 58 ? 0.948   60.155 1.476   1.00 22.12 ? 112 ASN C C     1 
ATOM   3250 O  O     . ASN G 3 58 ? -0.231  59.874 1.283   1.00 22.93 ? 112 ASN C O     1 
ATOM   3251 C  CB    . ASN G 3 58 ? 1.480   62.636 1.526   1.00 18.30 ? 112 ASN C CB    1 
ATOM   3252 C  CG    . ASN G 3 58 ? 0.162   63.181 1.067   1.00 17.18 ? 112 ASN C CG    1 
ATOM   3253 O  OD1   . ASN G 3 58 ? -0.832  63.110 1.775   1.00 22.71 ? 112 ASN C OD1   1 
ATOM   3254 N  ND2   . ASN G 3 58 ? 0.143   63.745 -0.124  1.00 20.76 ? 112 ASN C ND2   1 
ATOM   3255 N  N     . GLU G 3 59 ? 1.941   59.452 0.953   1.00 22.45 ? 113 GLU C N     1 
ATOM   3256 C  CA    . GLU G 3 59 ? 1.690   58.285 0.130   1.00 24.62 ? 113 GLU C CA    1 
ATOM   3257 C  C     . GLU G 3 59 ? 1.220   57.178 1.059   1.00 24.62 ? 113 GLU C C     1 
ATOM   3258 O  O     . GLU G 3 59 ? 0.256   56.494 0.779   1.00 27.28 ? 113 GLU C O     1 
ATOM   3259 C  CB    . GLU G 3 59 ? 2.983   57.860 -0.572  1.00 28.40 ? 113 GLU C CB    1 
ATOM   3260 C  CG    . GLU G 3 59 ? 2.813   56.902 -1.759  1.00 32.15 ? 113 GLU C CG    1 
ATOM   3261 C  CD    . GLU G 3 59 ? 4.076   56.070 -2.002  1.00 36.23 ? 113 GLU C CD    1 
ATOM   3262 O  OE1   . GLU G 3 59 ? 5.171   56.541 -1.595  1.00 36.49 ? 113 GLU C OE1   1 
ATOM   3263 O  OE2   . GLU G 3 59 ? 3.982   54.957 -2.597  1.00 33.77 ? 113 GLU C OE2   1 
ATOM   3264 N  N     . LEU G 3 60 ? 1.909   57.027 2.181   1.00 22.85 ? 114 LEU C N     1 
ATOM   3265 C  CA    . LEU G 3 60 ? 1.602   56.013 3.175   1.00 23.13 ? 114 LEU C CA    1 
ATOM   3266 C  C     . LEU G 3 60 ? 0.147   56.125 3.589   1.00 23.82 ? 114 LEU C C     1 
ATOM   3267 O  O     . LEU G 3 60 ? -0.575  55.135 3.638   1.00 23.32 ? 114 LEU C O     1 
ATOM   3268 C  CB    . LEU G 3 60 ? 2.522   56.207 4.385   1.00 24.58 ? 114 LEU C CB    1 
ATOM   3269 C  CG    . LEU G 3 60 ? 2.813   55.059 5.347   1.00 25.09 ? 114 LEU C CG    1 
ATOM   3270 C  CD1   . LEU G 3 60 ? 3.752   55.536 6.411   1.00 23.64 ? 114 LEU C CD1   1 
ATOM   3271 C  CD2   . LEU G 3 60 ? 1.546   54.552 5.956   1.00 26.97 ? 114 LEU C CD2   1 
ATOM   3272 N  N     . LYS G 3 61 ? -0.272  57.347 3.880   1.00 24.86 ? 115 LYS C N     1 
ATOM   3273 C  CA    . LYS G 3 61 ? -1.635  57.630 4.286   1.00 26.71 ? 115 LYS C CA    1 
ATOM   3274 C  C     . LYS G 3 61 ? -2.643  57.198 3.222   1.00 27.50 ? 115 LYS C C     1 
ATOM   3275 O  O     . LYS G 3 61 ? -3.657  56.587 3.526   1.00 29.78 ? 115 LYS C O     1 
ATOM   3276 C  CB    . LYS G 3 61 ? -1.775  59.127 4.584   1.00 27.10 ? 115 LYS C CB    1 
ATOM   3277 C  CG    . LYS G 3 61 ? -3.161  59.585 4.978   1.00 28.85 ? 115 LYS C CG    1 
ATOM   3278 C  CD    . LYS G 3 61 ? -3.164  61.084 5.233   1.00 33.76 ? 115 LYS C CD    1 
ATOM   3279 C  CE    . LYS G 3 61 ? -4.488  61.567 5.812   1.00 36.29 ? 115 LYS C CE    1 
ATOM   3280 N  NZ    . LYS G 3 61 ? -4.419  63.013 6.188   1.00 36.25 ? 115 LYS C NZ    1 
ATOM   3281 N  N     . LYS G 3 62 ? -2.363  57.499 1.966   1.00 26.94 ? 116 LYS C N     1 
ATOM   3282 C  CA    . LYS G 3 62 ? -3.284  57.111 0.911   1.00 28.74 ? 116 LYS C CA    1 
ATOM   3283 C  C     . LYS G 3 62 ? -3.373  55.591 0.828   1.00 28.00 ? 116 LYS C C     1 
ATOM   3284 O  O     . LYS G 3 62 ? -4.456  55.022 0.701   1.00 28.10 ? 116 LYS C O     1 
ATOM   3285 C  CB    . LYS G 3 62 ? -2.835  57.708 -0.429  1.00 31.35 ? 116 LYS C CB    1 
ATOM   3286 C  CG    . LYS G 3 62 ? -3.070  59.202 -0.535  1.00 33.01 ? 116 LYS C CG    1 
ATOM   3287 C  CD    . LYS G 3 62 ? -2.595  59.761 -1.859  1.00 36.29 ? 116 LYS C CD    1 
ATOM   3288 C  CE    . LYS G 3 62 ? -2.962  61.208 -1.974  1.00 35.87 ? 116 LYS C CE    1 
ATOM   3289 N  NZ    . LYS G 3 62 ? -2.622  61.878 -0.697  1.00 38.12 ? 116 LYS C NZ    1 
ATOM   3290 N  N     . LEU G 3 63 ? -2.228  54.936 0.918   1.00 27.85 ? 117 LEU C N     1 
ATOM   3291 C  CA    . LEU G 3 63 ? -2.181  53.487 0.884   1.00 29.26 ? 117 LEU C CA    1 
ATOM   3292 C  C     . LEU G 3 63 ? -3.066  52.861 1.966   1.00 30.83 ? 117 LEU C C     1 
ATOM   3293 O  O     . LEU G 3 63 ? -3.946  52.055 1.666   1.00 30.50 ? 117 LEU C O     1 
ATOM   3294 C  CB    . LEU G 3 63 ? -0.743  53.023 1.067   1.00 28.60 ? 117 LEU C CB    1 
ATOM   3295 C  CG    . LEU G 3 63 ? 0.082   53.119 -0.206  1.00 30.03 ? 117 LEU C CG    1 
ATOM   3296 C  CD1   . LEU G 3 63 ? 1.540   52.828 0.099   1.00 32.81 ? 117 LEU C CD1   1 
ATOM   3297 C  CD2   . LEU G 3 63 ? -0.465  52.131 -1.217  1.00 28.30 ? 117 LEU C CD2   1 
ATOM   3298 N  N     . ARG G 3 64 ? -2.831  53.230 3.221   1.00 32.31 ? 118 ARG C N     1 
ATOM   3299 C  CA    . ARG G 3 64 ? -3.617  52.681 4.308   1.00 33.62 ? 118 ARG C CA    1 
ATOM   3300 C  C     . ARG G 3 64 ? -5.109  52.780 4.014   1.00 34.11 ? 118 ARG C C     1 
ATOM   3301 O  O     . ARG G 3 64 ? -5.823  51.782 4.117   1.00 33.73 ? 118 ARG C O     1 
ATOM   3302 C  CB    . ARG G 3 64 ? -3.265  53.379 5.627   1.00 32.43 ? 118 ARG C CB    1 
ATOM   3303 C  CG    . ARG G 3 64 ? -1.982  52.847 6.252   1.00 33.03 ? 118 ARG C CG    1 
ATOM   3304 C  CD    . ARG G 3 64 ? -1.801  53.293 7.702   1.00 33.21 ? 118 ARG C CD    1 
ATOM   3305 N  NE    . ARG G 3 64 ? -1.324  54.670 7.831   1.00 34.04 ? 118 ARG C NE    1 
ATOM   3306 C  CZ    . ARG G 3 64 ? -0.156  55.006 8.366   1.00 36.42 ? 118 ARG C CZ    1 
ATOM   3307 N  NH1   . ARG G 3 64 ? 0.662   54.070 8.821   1.00 38.26 ? 118 ARG C NH1   1 
ATOM   3308 N  NH2   . ARG G 3 64 ? 0.196   56.275 8.467   1.00 38.98 ? 118 ARG C NH2   1 
ATOM   3309 N  N     . GLU G 3 65 ? -5.569  53.971 3.645   1.00 35.23 ? 119 GLU C N     1 
ATOM   3310 C  CA    . GLU G 3 65 ? -6.971  54.183 3.326   1.00 37.41 ? 119 GLU C CA    1 
ATOM   3311 C  C     . GLU G 3 65 ? -7.370  53.230 2.224   1.00 37.36 ? 119 GLU C C     1 
ATOM   3312 O  O     . GLU G 3 65 ? -8.302  52.443 2.367   1.00 37.82 ? 119 GLU C O     1 
ATOM   3313 C  CB    . GLU G 3 65 ? -7.201  55.616 2.846   1.00 39.85 ? 119 GLU C CB    1 
ATOM   3314 C  CG    . GLU G 3 65 ? -7.031  56.675 3.915   1.00 43.31 ? 119 GLU C CG    1 
ATOM   3315 C  CD    . GLU G 3 65 ? -7.140  58.097 3.352   1.00 47.75 ? 119 GLU C CD    1 
ATOM   3316 O  OE1   . GLU G 3 65 ? -7.037  59.061 4.156   1.00 50.68 ? 119 GLU C OE1   1 
ATOM   3317 O  OE2   . GLU G 3 65 ? -7.326  58.253 2.112   1.00 46.56 ? 119 GLU C OE2   1 
ATOM   3318 N  N     . ARG G 3 66 ? -6.656  53.323 1.112   1.00 37.80 ? 120 ARG C N     1 
ATOM   3319 C  CA    . ARG G 3 66 ? -6.902  52.487 -0.053  1.00 37.37 ? 120 ARG C CA    1 
ATOM   3320 C  C     . ARG G 3 66 ? -7.036  51.014 0.355   1.00 36.19 ? 120 ARG C C     1 
ATOM   3321 O  O     . ARG G 3 66 ? -7.918  50.312 -0.122  1.00 36.62 ? 120 ARG C O     1 
ATOM   3322 C  CB    . ARG G 3 66 ? -5.751  52.685 -1.036  1.00 39.10 ? 120 ARG C CB    1 
ATOM   3323 C  CG    . ARG G 3 66 ? -5.923  52.101 -2.434  1.00 43.74 ? 120 ARG C CG    1 
ATOM   3324 C  CD    . ARG G 3 66 ? -4.836  52.710 -3.354  1.00 45.93 ? 120 ARG C CD    1 
ATOM   3325 N  NE    . ARG G 3 66 ? -4.541  51.893 -4.527  1.00 48.91 ? 120 ARG C NE    1 
ATOM   3326 C  CZ    . ARG G 3 66 ? -3.364  51.884 -5.156  1.00 50.98 ? 120 ARG C CZ    1 
ATOM   3327 N  NH1   . ARG G 3 66 ? -2.367  52.650 -4.724  1.00 49.56 ? 120 ARG C NH1   1 
ATOM   3328 N  NH2   . ARG G 3 66 ? -3.169  51.099 -6.211  1.00 52.23 ? 120 ARG C NH2   1 
ATOM   3329 N  N     . VAL G 3 67 ? -6.180  50.550 1.257   1.00 35.42 ? 121 VAL C N     1 
ATOM   3330 C  CA    . VAL G 3 67 ? -6.234  49.154 1.683   1.00 35.55 ? 121 VAL C CA    1 
ATOM   3331 C  C     . VAL G 3 67 ? -7.430  48.812 2.575   1.00 36.25 ? 121 VAL C C     1 
ATOM   3332 O  O     . VAL G 3 67 ? -8.032  47.748 2.413   1.00 35.24 ? 121 VAL C O     1 
ATOM   3333 C  CB    . VAL G 3 67 ? -4.923  48.736 2.383   1.00 36.21 ? 121 VAL C CB    1 
ATOM   3334 C  CG1   . VAL G 3 67 ? -5.096  47.390 3.075   1.00 36.92 ? 121 VAL C CG1   1 
ATOM   3335 C  CG2   . VAL G 3 67 ? -3.810  48.629 1.358   1.00 35.52 ? 121 VAL C CG2   1 
ATOM   3336 N  N     . LYS G 3 68 ? -7.772  49.690 3.520   1.00 36.59 ? 122 LYS C N     1 
ATOM   3337 C  CA    . LYS G 3 68 ? -8.925  49.434 4.381   1.00 36.63 ? 122 LYS C CA    1 
ATOM   3338 C  C     . LYS G 3 68 ? -10.175 49.386 3.529   1.00 36.65 ? 122 LYS C C     1 
ATOM   3339 O  O     . LYS G 3 68 ? -11.071 48.581 3.767   1.00 37.02 ? 122 LYS C O     1 
ATOM   3340 C  CB    . LYS G 3 68 ? -9.080  50.512 5.458   1.00 36.29 ? 122 LYS C CB    1 
ATOM   3341 C  CG    . LYS G 3 68 ? -8.219  50.250 6.683   1.00 40.36 ? 122 LYS C CG    1 
ATOM   3342 C  CD    . LYS G 3 68 ? -8.689  50.986 7.935   1.00 41.37 ? 122 LYS C CD    1 
ATOM   3343 C  CE    . LYS G 3 68 ? -7.938  50.455 9.174   1.00 43.83 ? 122 LYS C CE    1 
ATOM   3344 N  NZ    . LYS G 3 68 ? -8.356  51.062 10.486  1.00 42.74 ? 122 LYS C NZ    1 
ATOM   3345 N  N     . SER G 3 69 ? -10.222 50.244 2.522   1.00 36.56 ? 123 SER C N     1 
ATOM   3346 C  CA    . SER G 3 69 ? -11.362 50.284 1.625   1.00 36.72 ? 123 SER C CA    1 
ATOM   3347 C  C     . SER G 3 69 ? -11.454 48.958 0.856   1.00 38.60 ? 123 SER C C     1 
ATOM   3348 O  O     . SER G 3 69 ? -12.506 48.325 0.825   1.00 40.22 ? 123 SER C O     1 
ATOM   3349 C  CB    . SER G 3 69 ? -11.212 51.448 0.658   1.00 35.14 ? 123 SER C CB    1 
ATOM   3350 O  OG    . SER G 3 69 ? -12.374 51.602 -0.121  1.00 34.81 ? 123 SER C OG    1 
ATOM   3351 N  N     . LEU G 3 70 ? -10.357 48.534 0.237   1.00 39.58 ? 124 LEU C N     1 
ATOM   3352 C  CA    . LEU G 3 70 ? -10.371 47.277 -0.486  1.00 40.61 ? 124 LEU C CA    1 
ATOM   3353 C  C     . LEU G 3 70 ? -10.659 46.179 0.520   1.00 43.88 ? 124 LEU C C     1 
ATOM   3354 O  O     . LEU G 3 70 ? -11.285 45.176 0.197   1.00 44.60 ? 124 LEU C O     1 
ATOM   3355 C  CB    . LEU G 3 70 ? -9.025  47.024 -1.175  1.00 37.47 ? 124 LEU C CB    1 
ATOM   3356 C  CG    . LEU G 3 70 ? -8.823  47.823 -2.459  1.00 35.69 ? 124 LEU C CG    1 
ATOM   3357 C  CD1   . LEU G 3 70 ? -7.467  47.545 -3.035  1.00 36.41 ? 124 LEU C CD1   1 
ATOM   3358 C  CD2   . LEU G 3 70 ? -9.896  47.467 -3.438  1.00 32.91 ? 124 LEU C CD2   1 
ATOM   3359 N  N     . GLU G 3 71 ? -10.197 46.386 1.747   1.00 47.03 ? 125 GLU C N     1 
ATOM   3360 C  CA    . GLU G 3 71 ? -10.399 45.424 2.815   1.00 48.93 ? 125 GLU C CA    1 
ATOM   3361 C  C     . GLU G 3 71 ? -11.886 45.137 2.922   1.00 50.26 ? 125 GLU C C     1 
ATOM   3362 O  O     . GLU G 3 71 ? -12.315 43.986 2.853   1.00 51.66 ? 125 GLU C O     1 
ATOM   3363 C  CB    . GLU G 3 71 ? -9.909  46.004 4.140   1.00 50.98 ? 125 GLU C CB    1 
ATOM   3364 C  CG    . GLU G 3 71 ? -9.121  45.031 5.007   1.00 51.67 ? 125 GLU C CG    1 
ATOM   3365 C  CD    . GLU G 3 71 ? -7.753  44.751 4.437   1.00 51.54 ? 125 GLU C CD    1 
ATOM   3366 O  OE1   . GLU G 3 71 ? -7.661  44.362 3.250   1.00 53.01 ? 125 GLU C OE1   1 
ATOM   3367 O  OE2   . GLU G 3 71 ? -6.769  44.926 5.177   1.00 53.09 ? 125 GLU C OE2   1 
ATOM   3368 N  N     . LYS G 3 72 ? -12.673 46.194 3.082   1.00 50.49 ? 126 LYS C N     1 
ATOM   3369 C  CA    . LYS G 3 72 ? -14.113 46.041 3.211   1.00 51.80 ? 126 LYS C CA    1 
ATOM   3370 C  C     . LYS G 3 72 ? -14.671 45.291 2.007   1.00 52.41 ? 126 LYS C C     1 
ATOM   3371 O  O     . LYS G 3 72 ? -15.220 44.189 2.134   1.00 51.79 ? 126 LYS C O     1 
ATOM   3372 C  CB    . LYS G 3 72 ? -14.801 47.408 3.321   1.00 51.71 ? 126 LYS C CB    1 
ATOM   3373 C  CG    . LYS G 3 72 ? -16.311 47.303 3.558   1.00 52.71 ? 126 LYS C CG    1 
ATOM   3374 C  CD    . LYS G 3 72 ? -17.023 48.619 3.334   1.00 54.09 ? 126 LYS C CD    1 
ATOM   3375 C  CE    . LYS G 3 72 ? -16.974 49.031 1.862   1.00 55.05 ? 126 LYS C CE    1 
ATOM   3376 N  NZ    . LYS G 3 72 ? -17.580 48.003 0.968   1.00 54.11 ? 126 LYS C NZ    1 
ATOM   3377 N  N     . THR G 3 73 ? -14.533 45.899 0.834   1.00 52.63 ? 127 THR C N     1 
ATOM   3378 C  CA    . THR G 3 73 ? -15.045 45.281 -0.377  1.00 52.86 ? 127 THR C CA    1 
ATOM   3379 C  C     . THR G 3 73 ? -14.829 43.776 -0.324  1.00 53.10 ? 127 THR C C     1 
ATOM   3380 O  O     . THR G 3 73 ? -15.730 43.015 -0.621  1.00 53.37 ? 127 THR C O     1 
ATOM   3381 C  CB    . THR G 3 73 ? -14.380 45.877 -1.640  1.00 51.77 ? 127 THR C CB    1 
ATOM   3382 O  OG1   . THR G 3 73 ? -14.899 47.190 -1.871  1.00 50.47 ? 127 THR C OG1   1 
ATOM   3383 C  CG2   . THR G 3 73 ? -14.671 45.033 -2.853  1.00 51.26 ? 127 THR C CG2   1 
ATOM   3384 N  N     . LEU G 3 74 ? -13.644 43.353 0.091   1.00 54.13 ? 128 LEU C N     1 
ATOM   3385 C  CA    . LEU G 3 74 ? -13.325 41.935 0.170   1.00 54.80 ? 128 LEU C CA    1 
ATOM   3386 C  C     . LEU G 3 74 ? -14.016 41.316 1.388   1.00 54.16 ? 128 LEU C C     1 
ATOM   3387 O  O     . LEU G 3 74 ? -13.373 40.533 2.128   1.00 54.49 ? 128 LEU C O     1 
ATOM   3388 C  CB    . LEU G 3 74 ? -11.803 41.747 0.273   1.00 55.90 ? 128 LEU C CB    1 
ATOM   3389 C  CG    . LEU G 3 74 ? -11.278 40.300 0.212   1.00 56.94 ? 128 LEU C CG    1 
ATOM   3390 C  CD1   . LEU G 3 74 ? -11.684 39.669 -1.111  1.00 56.89 ? 128 LEU C CD1   1 
ATOM   3391 C  CD2   . LEU G 3 74 ? -9.754  40.277 0.382   1.00 55.93 ? 128 LEU C CD2   1 
ATOM   3392 N  N     . ARG H 3 1  ? 23.158  68.231 36.565  1.00 69.63 ? 55  ARG D N     1 
ATOM   3393 C  CA    . ARG H 3 1  ? 23.304  66.832 37.064  1.00 68.88 ? 55  ARG D CA    1 
ATOM   3394 C  C     . ARG H 3 1  ? 22.142  65.958 36.582  1.00 67.58 ? 55  ARG D C     1 
ATOM   3395 O  O     . ARG H 3 1  ? 21.121  66.475 36.112  1.00 66.69 ? 55  ARG D O     1 
ATOM   3396 C  CB    . ARG H 3 1  ? 23.374  66.826 38.606  1.00 69.47 ? 55  ARG D CB    1 
ATOM   3397 C  CG    . ARG H 3 1  ? 23.815  65.484 39.194  1.00 71.21 ? 55  ARG D CG    1 
ATOM   3398 C  CD    . ARG H 3 1  ? 24.162  65.603 40.676  1.00 71.85 ? 55  ARG D CD    1 
ATOM   3399 N  NE    . ARG H 3 1  ? 24.793  64.382 41.193  1.00 71.91 ? 55  ARG D NE    1 
ATOM   3400 C  CZ    . ARG H 3 1  ? 24.168  63.218 41.369  1.00 71.86 ? 55  ARG D CZ    1 
ATOM   3401 N  NH1   . ARG H 3 1  ? 22.881  63.087 41.074  1.00 71.77 ? 55  ARG D NH1   1 
ATOM   3402 N  NH2   . ARG H 3 1  ? 24.834  62.178 41.838  1.00 71.94 ? 55  ARG D NH2   1 
ATOM   3403 N  N     . LYS H 3 2  ? 22.309  64.640 36.704  1.00 66.37 ? 56  LYS D N     1 
ATOM   3404 C  CA    . LYS H 3 2  ? 21.290  63.675 36.296  1.00 64.61 ? 56  LYS D CA    1 
ATOM   3405 C  C     . LYS H 3 2  ? 20.985  63.771 34.800  1.00 62.67 ? 56  LYS D C     1 
ATOM   3406 O  O     . LYS H 3 2  ? 20.378  64.736 34.323  1.00 63.15 ? 56  LYS D O     1 
ATOM   3407 C  CB    . LYS H 3 2  ? 19.995  63.885 37.089  1.00 65.35 ? 56  LYS D CB    1 
ATOM   3408 C  CG    . LYS H 3 2  ? 18.862  62.954 36.656  1.00 66.19 ? 56  LYS D CG    1 
ATOM   3409 C  CD    . LYS H 3 2  ? 17.565  63.199 37.437  1.00 66.37 ? 56  LYS D CD    1 
ATOM   3410 C  CE    . LYS H 3 2  ? 17.696  62.796 38.887  1.00 66.85 ? 56  LYS D CE    1 
ATOM   3411 N  NZ    . LYS H 3 2  ? 16.387  62.988 39.602  1.00 67.97 ? 56  LYS D NZ    1 
ATOM   3412 N  N     . ARG H 3 3  ? 21.408  62.754 34.061  1.00 60.78 ? 57  ARG D N     1 
ATOM   3413 C  CA    . ARG H 3 3  ? 21.188  62.707 32.621  1.00 59.16 ? 57  ARG D CA    1 
ATOM   3414 C  C     . ARG H 3 3  ? 19.963  61.868 32.260  1.00 58.82 ? 57  ARG D C     1 
ATOM   3415 O  O     . ARG H 3 3  ? 19.052  61.697 33.082  1.00 59.81 ? 57  ARG D O     1 
ATOM   3416 C  CB    . ARG H 3 3  ? 22.426  62.139 31.939  1.00 57.29 ? 57  ARG D CB    1 
ATOM   3417 C  CG    . ARG H 3 3  ? 23.696  62.879 32.328  1.00 54.03 ? 57  ARG D CG    1 
ATOM   3418 C  CD    . ARG H 3 3  ? 24.931  62.052 32.059  1.00 50.76 ? 57  ARG D CD    1 
ATOM   3419 N  NE    . ARG H 3 3  ? 26.068  62.619 32.762  1.00 49.27 ? 57  ARG D NE    1 
ATOM   3420 C  CZ    . ARG H 3 3  ? 27.295  62.114 32.733  1.00 49.65 ? 57  ARG D CZ    1 
ATOM   3421 N  NH1   . ARG H 3 3  ? 27.550  61.018 32.025  1.00 49.47 ? 57  ARG D NH1   1 
ATOM   3422 N  NH2   . ARG H 3 3  ? 28.267  62.709 33.417  1.00 48.40 ? 57  ARG D NH2   1 
ATOM   3423 N  N     . ASN H 3 4  ? 19.954  61.355 31.029  1.00 57.91 ? 58  ASN D N     1 
ATOM   3424 C  CA    . ASN H 3 4  ? 18.856  60.534 30.514  1.00 56.48 ? 58  ASN D CA    1 
ATOM   3425 C  C     . ASN H 3 4  ? 19.476  59.476 29.622  1.00 55.39 ? 58  ASN D C     1 
ATOM   3426 O  O     . ASN H 3 4  ? 19.447  59.592 28.396  1.00 56.87 ? 58  ASN D O     1 
ATOM   3427 C  CB    . ASN H 3 4  ? 17.901  61.393 29.686  1.00 56.75 ? 58  ASN D CB    1 
ATOM   3428 C  CG    . ASN H 3 4  ? 16.797  60.585 29.056  1.00 56.89 ? 58  ASN D CG    1 
ATOM   3429 O  OD1   . ASN H 3 4  ? 16.019  61.090 28.240  1.00 57.77 ? 58  ASN D OD1   1 
ATOM   3430 N  ND2   . ASN H 3 4  ? 16.714  59.318 29.440  1.00 58.22 ? 58  ASN D ND2   1 
ATOM   3431 N  N     . ARG H 3 5  ? 20.036  58.447 30.242  1.00 52.96 ? 59  ARG D N     1 
ATOM   3432 C  CA    . ARG H 3 5  ? 20.702  57.385 29.504  1.00 49.59 ? 59  ARG D CA    1 
ATOM   3433 C  C     . ARG H 3 5  ? 19.910  56.091 29.510  1.00 49.20 ? 59  ARG D C     1 
ATOM   3434 O  O     . ARG H 3 5  ? 19.514  55.593 30.571  1.00 49.89 ? 59  ARG D O     1 
ATOM   3435 C  CB    . ARG H 3 5  ? 22.079  57.128 30.106  1.00 47.07 ? 59  ARG D CB    1 
ATOM   3436 C  CG    . ARG H 3 5  ? 22.808  55.973 29.482  1.00 44.22 ? 59  ARG D CG    1 
ATOM   3437 C  CD    . ARG H 3 5  ? 24.207  55.877 30.045  1.00 41.99 ? 59  ARG D CD    1 
ATOM   3438 N  NE    . ARG H 3 5  ? 24.892  54.667 29.612  1.00 38.44 ? 59  ARG D NE    1 
ATOM   3439 C  CZ    . ARG H 3 5  ? 26.098  54.325 30.038  1.00 37.41 ? 59  ARG D CZ    1 
ATOM   3440 N  NH1   . ARG H 3 5  ? 26.732  55.105 30.902  1.00 33.67 ? 59  ARG D NH1   1 
ATOM   3441 N  NH2   . ARG H 3 5  ? 26.663  53.211 29.602  1.00 35.45 ? 59  ARG D NH2   1 
ATOM   3442 N  N     . ILE H 3 6  ? 19.696  55.542 28.318  1.00 47.80 ? 60  ILE D N     1 
ATOM   3443 C  CA    . ILE H 3 6  ? 18.952  54.304 28.157  1.00 44.97 ? 60  ILE D CA    1 
ATOM   3444 C  C     . ILE H 3 6  ? 19.898  53.207 27.678  1.00 44.81 ? 60  ILE D C     1 
ATOM   3445 O  O     . ILE H 3 6  ? 20.698  53.420 26.766  1.00 46.50 ? 60  ILE D O     1 
ATOM   3446 C  CB    . ILE H 3 6  ? 17.831  54.489 27.136  1.00 43.28 ? 60  ILE D CB    1 
ATOM   3447 C  CG1   . ILE H 3 6  ? 16.992  55.713 27.517  1.00 41.50 ? 60  ILE D CG1   1 
ATOM   3448 C  CG2   . ILE H 3 6  ? 16.961  53.239 27.095  1.00 44.23 ? 60  ILE D CG2   1 
ATOM   3449 C  CD1   . ILE H 3 6  ? 15.818  55.962 26.600  1.00 40.78 ? 60  ILE D CD1   1 
ATOM   3450 N  N     . PRO H 3 7  ? 19.829  52.018 28.295  1.00 44.06 ? 61  PRO D N     1 
ATOM   3451 C  CA    . PRO H 3 7  ? 20.703  50.901 27.905  1.00 42.88 ? 61  PRO D CA    1 
ATOM   3452 C  C     . PRO H 3 7  ? 20.542  50.373 26.473  1.00 40.77 ? 61  PRO D C     1 
ATOM   3453 O  O     . PRO H 3 7  ? 19.429  50.132 25.997  1.00 40.96 ? 61  PRO D O     1 
ATOM   3454 C  CB    . PRO H 3 7  ? 20.413  49.842 28.976  1.00 44.19 ? 61  PRO D CB    1 
ATOM   3455 C  CG    . PRO H 3 7  ? 19.030  50.182 29.436  1.00 44.69 ? 61  PRO D CG    1 
ATOM   3456 C  CD    . PRO H 3 7  ? 19.043  51.677 29.493  1.00 44.18 ? 61  PRO D CD    1 
ATOM   3457 N  N     . LEU H 3 8  ? 21.677  50.169 25.816  1.00 38.03 ? 62  LEU D N     1 
ATOM   3458 C  CA    . LEU H 3 8  ? 21.730  49.715 24.440  1.00 36.98 ? 62  LEU D CA    1 
ATOM   3459 C  C     . LEU H 3 8  ? 21.553  48.221 24.185  1.00 36.62 ? 62  LEU D C     1 
ATOM   3460 O  O     . LEU H 3 8  ? 21.359  47.807 23.042  1.00 35.65 ? 62  LEU D O     1 
ATOM   3461 C  CB    . LEU H 3 8  ? 23.045  50.175 23.819  1.00 38.84 ? 62  LEU D CB    1 
ATOM   3462 C  CG    . LEU H 3 8  ? 23.200  51.681 23.600  1.00 40.29 ? 62  LEU D CG    1 
ATOM   3463 C  CD1   . LEU H 3 8  ? 24.638  51.997 23.286  1.00 41.82 ? 62  LEU D CD1   1 
ATOM   3464 C  CD2   . LEU H 3 8  ? 22.287  52.136 22.466  1.00 41.77 ? 62  LEU D CD2   1 
ATOM   3465 N  N     . GLY H 3 9  ? 21.632  47.406 25.227  1.00 37.41 ? 63  GLY D N     1 
ATOM   3466 C  CA    . GLY H 3 9  ? 21.474  45.972 25.039  1.00 36.53 ? 63  GLY D CA    1 
ATOM   3467 C  C     . GLY H 3 9  ? 20.050  45.504 25.285  1.00 36.16 ? 63  GLY D C     1 
ATOM   3468 O  O     . GLY H 3 9  ? 19.238  46.243 25.845  1.00 37.55 ? 63  GLY D O     1 
ATOM   3469 N  N     . CYS H 3 10 ? 19.742  44.279 24.872  1.00 34.63 ? 64  CYS D N     1 
ATOM   3470 C  CA    . CYS H 3 10 ? 18.401  43.733 25.058  1.00 33.78 ? 64  CYS D CA    1 
ATOM   3471 C  C     . CYS H 3 10 ? 18.092  43.597 26.544  1.00 33.70 ? 64  CYS D C     1 
ATOM   3472 O  O     . CYS H 3 10 ? 18.979  43.337 27.359  1.00 32.88 ? 64  CYS D O     1 
ATOM   3473 C  CB    . CYS H 3 10 ? 18.271  42.363 24.387  1.00 34.92 ? 64  CYS D CB    1 
ATOM   3474 S  SG    . CYS H 3 10 ? 18.919  40.958 25.352  1.00 32.22 ? 64  CYS D SG    1 
ATOM   3475 N  N     . THR H 3 11 ? 16.817  43.769 26.870  1.00 33.19 ? 65  THR D N     1 
ATOM   3476 C  CA    . THR H 3 11 ? 16.308  43.716 28.238  1.00 33.15 ? 65  THR D CA    1 
ATOM   3477 C  C     . THR H 3 11 ? 16.714  42.510 29.100  1.00 34.94 ? 65  THR D C     1 
ATOM   3478 O  O     . THR H 3 11 ? 17.122  42.670 30.250  1.00 34.88 ? 65  THR D O     1 
ATOM   3479 C  CB    . THR H 3 11 ? 14.780  43.774 28.227  1.00 31.38 ? 65  THR D CB    1 
ATOM   3480 O  OG1   . THR H 3 11 ? 14.289  42.977 27.139  1.00 31.42 ? 65  THR D OG1   1 
ATOM   3481 C  CG2   . THR H 3 11 ? 14.299  45.183 28.102  1.00 26.22 ? 65  THR D CG2   1 
ATOM   3482 N  N     . ILE H 3 12 ? 16.571  41.313 28.547  1.00 34.51 ? 66  ILE D N     1 
ATOM   3483 C  CA    . ILE H 3 12 ? 16.886  40.098 29.266  1.00 34.59 ? 66  ILE D CA    1 
ATOM   3484 C  C     . ILE H 3 12 ? 18.328  40.066 29.755  1.00 36.69 ? 66  ILE D C     1 
ATOM   3485 O  O     . ILE H 3 12 ? 18.568  39.945 30.962  1.00 38.70 ? 66  ILE D O     1 
ATOM   3486 C  CB    . ILE H 3 12 ? 16.562  38.872 28.392  1.00 32.70 ? 66  ILE D CB    1 
ATOM   3487 C  CG1   . ILE H 3 12 ? 15.043  38.794 28.196  1.00 29.29 ? 66  ILE D CG1   1 
ATOM   3488 C  CG2   . ILE H 3 12 ? 17.084  37.601 29.055  1.00 32.23 ? 66  ILE D CG2   1 
ATOM   3489 C  CD1   . ILE H 3 12 ? 14.591  37.775 27.184  1.00 27.30 ? 66  ILE D CD1   1 
ATOM   3490 N  N     . CYS H 3 13 ? 19.284  40.186 28.832  1.00 37.21 ? 67  CYS D N     1 
ATOM   3491 C  CA    . CYS H 3 13 ? 20.703  40.177 29.184  1.00 36.42 ? 67  CYS D CA    1 
ATOM   3492 C  C     . CYS H 3 13 ? 20.971  41.117 30.362  1.00 37.38 ? 67  CYS D C     1 
ATOM   3493 O  O     . CYS H 3 13 ? 21.831  40.865 31.196  1.00 39.37 ? 67  CYS D O     1 
ATOM   3494 C  CB    . CYS H 3 13 ? 21.563  40.625 27.988  1.00 35.52 ? 67  CYS D CB    1 
ATOM   3495 S  SG    . CYS H 3 13 ? 21.905  39.424 26.646  1.00 36.10 ? 67  CYS D SG    1 
ATOM   3496 N  N     . ARG H 3 14 ? 20.226  42.208 30.429  1.00 37.17 ? 68  ARG D N     1 
ATOM   3497 C  CA    . ARG H 3 14 ? 20.430  43.169 31.499  1.00 37.93 ? 68  ARG D CA    1 
ATOM   3498 C  C     . ARG H 3 14 ? 19.941  42.622 32.841  1.00 38.85 ? 68  ARG D C     1 
ATOM   3499 O  O     . ARG H 3 14 ? 20.503  42.917 33.899  1.00 39.75 ? 68  ARG D O     1 
ATOM   3500 C  CB    . ARG H 3 14 ? 19.710  44.476 31.175  1.00 36.57 ? 68  ARG D CB    1 
ATOM   3501 C  CG    . ARG H 3 14 ? 20.166  45.642 32.021  1.00 37.66 ? 68  ARG D CG    1 
ATOM   3502 C  CD    . ARG H 3 14 ? 19.056  46.659 32.115  1.00 42.43 ? 68  ARG D CD    1 
ATOM   3503 N  NE    . ARG H 3 14 ? 19.431  47.840 32.886  1.00 46.20 ? 68  ARG D NE    1 
ATOM   3504 C  CZ    . ARG H 3 14 ? 18.588  48.829 33.179  1.00 49.17 ? 68  ARG D CZ    1 
ATOM   3505 N  NH1   . ARG H 3 14 ? 17.323  48.757 32.762  1.00 48.94 ? 68  ARG D NH1   1 
ATOM   3506 N  NH2   . ARG H 3 14 ? 19.004  49.891 33.873  1.00 50.69 ? 68  ARG D NH2   1 
ATOM   3507 N  N     . LYS H 3 15 ? 18.881  41.831 32.798  1.00 39.43 ? 69  LYS D N     1 
ATOM   3508 C  CA    . LYS H 3 15 ? 18.342  41.237 34.015  1.00 39.80 ? 69  LYS D CA    1 
ATOM   3509 C  C     . LYS H 3 15 ? 19.374  40.197 34.448  1.00 39.40 ? 69  LYS D C     1 
ATOM   3510 O  O     . LYS H 3 15 ? 19.799  40.148 35.608  1.00 39.00 ? 69  LYS D O     1 
ATOM   3511 C  CB    . LYS H 3 15 ? 17.001  40.559 33.709  1.00 41.21 ? 69  LYS D CB    1 
ATOM   3512 C  CG    . LYS H 3 15 ? 15.950  41.499 33.120  1.00 41.54 ? 69  LYS D CG    1 
ATOM   3513 C  CD    . LYS H 3 15 ? 15.114  40.810 32.049  1.00 40.19 ? 69  LYS D CD    1 
ATOM   3514 C  CE    . LYS H 3 15 ? 13.918  40.107 32.640  1.00 39.85 ? 69  LYS D CE    1 
ATOM   3515 N  NZ    . LYS H 3 15 ? 12.996  41.088 33.217  1.00 39.91 ? 69  LYS D NZ    1 
ATOM   3516 N  N     . ARG H 3 16 ? 19.776  39.385 33.477  1.00 38.36 ? 70  ARG D N     1 
ATOM   3517 C  CA    . ARG H 3 16 ? 20.758  38.333 33.658  1.00 37.45 ? 70  ARG D CA    1 
ATOM   3518 C  C     . ARG H 3 16 ? 22.144  38.937 33.830  1.00 39.12 ? 70  ARG D C     1 
ATOM   3519 O  O     . ARG H 3 16 ? 23.149  38.218 33.821  1.00 40.77 ? 70  ARG D O     1 
ATOM   3520 C  CB    . ARG H 3 16 ? 20.757  37.441 32.433  1.00 35.66 ? 70  ARG D CB    1 
ATOM   3521 C  CG    . ARG H 3 16 ? 19.390  36.962 32.053  1.00 35.10 ? 70  ARG D CG    1 
ATOM   3522 C  CD    . ARG H 3 16 ? 19.481  36.004 30.896  1.00 35.54 ? 70  ARG D CD    1 
ATOM   3523 N  NE    . ARG H 3 16 ? 18.357  35.085 30.922  1.00 39.01 ? 70  ARG D NE    1 
ATOM   3524 C  CZ    . ARG H 3 16 ? 18.129  34.160 30.003  1.00 40.57 ? 70  ARG D CZ    1 
ATOM   3525 N  NH1   . ARG H 3 16 ? 18.960  34.037 28.978  1.00 40.76 ? 70  ARG D NH1   1 
ATOM   3526 N  NH2   . ARG H 3 16 ? 17.067  33.364 30.117  1.00 41.31 ? 70  ARG D NH2   1 
ATOM   3527 N  N     . LYS H 3 17 ? 22.194  40.258 33.964  1.00 39.17 ? 71  LYS D N     1 
ATOM   3528 C  CA    . LYS H 3 17 ? 23.446  40.973 34.129  1.00 39.77 ? 71  LYS D CA    1 
ATOM   3529 C  C     . LYS H 3 17 ? 24.628  40.409 33.349  1.00 40.69 ? 71  LYS D C     1 
ATOM   3530 O  O     . LYS H 3 17 ? 25.751  40.481 33.827  1.00 41.97 ? 71  LYS D O     1 
ATOM   3531 C  CB    . LYS H 3 17 ? 23.818  41.036 35.603  1.00 39.28 ? 71  LYS D CB    1 
ATOM   3532 C  CG    . LYS H 3 17 ? 22.785  41.726 36.457  1.00 39.53 ? 71  LYS D CG    1 
ATOM   3533 C  CD    . LYS H 3 17 ? 23.440  42.439 37.632  1.00 39.44 ? 71  LYS D CD    1 
ATOM   3534 C  CE    . LYS H 3 17 ? 22.395  43.225 38.419  1.00 43.12 ? 71  LYS D CE    1 
ATOM   3535 N  NZ    . LYS H 3 17 ? 23.032  44.301 39.246  1.00 47.15 ? 71  LYS D NZ    1 
ATOM   3536 N  N     . VAL H 3 18 ? 24.393  39.849 32.164  1.00 40.40 ? 72  VAL D N     1 
ATOM   3537 C  CA    . VAL H 3 18 ? 25.495  39.313 31.366  1.00 42.73 ? 72  VAL D CA    1 
ATOM   3538 C  C     . VAL H 3 18 ? 25.913  40.313 30.289  1.00 44.99 ? 72  VAL D C     1 
ATOM   3539 O  O     . VAL H 3 18 ? 25.686  41.519 30.439  1.00 45.42 ? 72  VAL D O     1 
ATOM   3540 C  CB    . VAL H 3 18 ? 25.121  37.974 30.690  1.00 43.27 ? 72  VAL D CB    1 
ATOM   3541 C  CG1   . VAL H 3 18 ? 24.813  36.929 31.770  1.00 42.94 ? 72  VAL D CG1   1 
ATOM   3542 C  CG2   . VAL H 3 18 ? 23.930  38.162 29.742  1.00 42.25 ? 72  VAL D CG2   1 
ATOM   3543 N  N     . LYS H 3 19 ? 26.526  39.833 29.208  1.00 45.51 ? 73  LYS D N     1 
ATOM   3544 C  CA    . LYS H 3 19 ? 26.940  40.750 28.153  1.00 45.98 ? 73  LYS D CA    1 
ATOM   3545 C  C     . LYS H 3 19 ? 26.215  40.479 26.840  1.00 44.88 ? 73  LYS D C     1 
ATOM   3546 O  O     . LYS H 3 19 ? 26.376  39.415 26.223  1.00 43.26 ? 73  LYS D O     1 
ATOM   3547 C  CB    . LYS H 3 19 ? 28.452  40.683 27.926  1.00 48.53 ? 73  LYS D CB    1 
ATOM   3548 C  CG    . LYS H 3 19 ? 28.934  41.540 26.730  1.00 50.95 ? 73  LYS D CG    1 
ATOM   3549 C  CD    . LYS H 3 19 ? 30.396  41.249 26.376  1.00 51.47 ? 73  LYS D CD    1 
ATOM   3550 C  CE    . LYS H 3 19 ? 30.763  41.805 25.017  1.00 50.37 ? 73  LYS D CE    1 
ATOM   3551 N  NZ    . LYS H 3 19 ? 32.175  41.475 24.655  1.00 51.25 ? 73  LYS D NZ    1 
ATOM   3552 N  N     . CYS H 3 20 ? 25.435  41.472 26.414  1.00 43.74 ? 74  CYS D N     1 
ATOM   3553 C  CA    . CYS H 3 20 ? 24.653  41.380 25.190  1.00 41.65 ? 74  CYS D CA    1 
ATOM   3554 C  C     . CYS H 3 20 ? 25.495  41.611 23.940  1.00 40.94 ? 74  CYS D C     1 
ATOM   3555 O  O     . CYS H 3 20 ? 26.187  42.621 23.840  1.00 41.20 ? 74  CYS D O     1 
ATOM   3556 C  CB    . CYS H 3 20 ? 23.516  42.394 25.234  1.00 39.03 ? 74  CYS D CB    1 
ATOM   3557 S  SG    . CYS H 3 20 ? 22.283  42.091 23.935  1.00 37.58 ? 74  CYS D SG    1 
ATOM   3558 N  N     . ASP H 3 21 ? 25.435  40.675 22.992  1.00 39.62 ? 75  ASP D N     1 
ATOM   3559 C  CA    . ASP H 3 21 ? 26.194  40.800 21.749  1.00 39.79 ? 75  ASP D CA    1 
ATOM   3560 C  C     . ASP H 3 21 ? 25.561  41.858 20.815  1.00 38.68 ? 75  ASP D C     1 
ATOM   3561 O  O     . ASP H 3 21 ? 26.149  42.273 19.815  1.00 38.20 ? 75  ASP D O     1 
ATOM   3562 C  CB    . ASP H 3 21 ? 26.270  39.437 21.053  1.00 40.63 ? 75  ASP D CB    1 
ATOM   3563 C  CG    . ASP H 3 21 ? 24.899  38.890 20.697  1.00 44.93 ? 75  ASP D CG    1 
ATOM   3564 O  OD1   . ASP H 3 21 ? 24.281  39.391 19.735  1.00 46.64 ? 75  ASP D OD1   1 
ATOM   3565 O  OD2   . ASP H 3 21 ? 24.413  37.964 21.384  1.00 45.77 ? 75  ASP D OD2   1 
ATOM   3566 N  N     . LYS H 3 22 ? 24.358  42.291 21.165  1.00 36.73 ? 76  LYS D N     1 
ATOM   3567 C  CA    . LYS H 3 22 ? 23.632  43.305 20.416  1.00 34.50 ? 76  LYS D CA    1 
ATOM   3568 C  C     . LYS H 3 22 ? 23.221  42.967 18.981  1.00 33.01 ? 76  LYS D C     1 
ATOM   3569 O  O     . LYS H 3 22 ? 22.837  43.866 18.231  1.00 35.06 ? 76  LYS D O     1 
ATOM   3570 C  CB    . LYS H 3 22 ? 24.426  44.607 20.400  1.00 32.88 ? 76  LYS D CB    1 
ATOM   3571 C  CG    . LYS H 3 22 ? 24.684  45.216 21.746  1.00 32.60 ? 76  LYS D CG    1 
ATOM   3572 C  CD    . LYS H 3 22 ? 25.677  46.365 21.573  1.00 34.11 ? 76  LYS D CD    1 
ATOM   3573 C  CE    . LYS H 3 22 ? 26.094  46.975 22.887  1.00 35.00 ? 76  LYS D CE    1 
ATOM   3574 N  NZ    . LYS H 3 22 ? 24.920  47.553 23.576  1.00 37.35 ? 76  LYS D NZ    1 
ATOM   3575 N  N     . LEU H 3 23 ? 23.298  41.699 18.588  1.00 29.45 ? 77  LEU D N     1 
ATOM   3576 C  CA    . LEU H 3 23 ? 22.889  41.316 17.239  1.00 28.97 ? 77  LEU D CA    1 
ATOM   3577 C  C     . LEU H 3 23 ? 21.430  41.742 17.100  1.00 30.04 ? 77  LEU D C     1 
ATOM   3578 O  O     . LEU H 3 23 ? 20.753  41.964 18.090  1.00 30.02 ? 77  LEU D O     1 
ATOM   3579 C  CB    . LEU H 3 23 ? 22.994  39.799 17.052  1.00 30.61 ? 77  LEU D CB    1 
ATOM   3580 C  CG    . LEU H 3 23 ? 23.113  39.146 15.665  1.00 31.01 ? 77  LEU D CG    1 
ATOM   3581 C  CD1   . LEU H 3 23 ? 22.910  37.658 15.867  1.00 31.58 ? 77  LEU D CD1   1 
ATOM   3582 C  CD2   . LEU H 3 23 ? 22.090  39.655 14.672  1.00 30.40 ? 77  LEU D CD2   1 
ATOM   3583 N  N     . ARG H 3 24 ? 20.948  41.861 15.868  1.00 31.12 ? 78  ARG D N     1 
ATOM   3584 C  CA    . ARG H 3 24 ? 19.566  42.271 15.601  1.00 30.72 ? 78  ARG D CA    1 
ATOM   3585 C  C     . ARG H 3 24 ? 18.933  41.376 14.530  1.00 32.45 ? 78  ARG D C     1 
ATOM   3586 O  O     . ARG H 3 24 ? 19.614  40.893 13.619  1.00 33.53 ? 78  ARG D O     1 
ATOM   3587 C  CB    . ARG H 3 24 ? 19.535  43.731 15.154  1.00 27.25 ? 78  ARG D CB    1 
ATOM   3588 C  CG    . ARG H 3 24 ? 20.168  44.693 16.152  1.00 24.67 ? 78  ARG D CG    1 
ATOM   3589 C  CD    . ARG H 3 24 ? 19.152  45.315 17.054  1.00 24.28 ? 78  ARG D CD    1 
ATOM   3590 N  NE    . ARG H 3 24 ? 19.746  46.349 17.896  1.00 24.26 ? 78  ARG D NE    1 
ATOM   3591 C  CZ    . ARG H 3 24 ? 19.093  47.425 18.322  1.00 25.36 ? 78  ARG D CZ    1 
ATOM   3592 N  NH1   . ARG H 3 24 ? 17.826  47.607 17.980  1.00 24.42 ? 78  ARG D NH1   1 
ATOM   3593 N  NH2   . ARG H 3 24 ? 19.709  48.321 19.085  1.00 23.78 ? 78  ARG D NH2   1 
ATOM   3594 N  N     . PRO H 3 25 ? 17.609  41.157 14.608  1.00 31.93 ? 79  PRO D N     1 
ATOM   3595 C  CA    . PRO H 3 25 ? 16.657  41.653 15.606  1.00 32.29 ? 79  PRO D CA    1 
ATOM   3596 C  C     . PRO H 3 25 ? 16.743  41.019 16.997  1.00 33.05 ? 79  PRO D C     1 
ATOM   3597 O  O     . PRO H 3 25 ? 16.444  41.671 17.989  1.00 33.97 ? 79  PRO D O     1 
ATOM   3598 C  CB    . PRO H 3 25 ? 15.319  41.383 14.941  1.00 32.38 ? 79  PRO D CB    1 
ATOM   3599 C  CG    . PRO H 3 25 ? 15.580  40.051 14.282  1.00 31.04 ? 79  PRO D CG    1 
ATOM   3600 C  CD    . PRO H 3 25 ? 16.930  40.275 13.638  1.00 30.29 ? 79  PRO D CD    1 
ATOM   3601 N  N     . HIS H 3 26 ? 17.137  39.754 17.066  1.00 33.01 ? 80  HIS D N     1 
ATOM   3602 C  CA    . HIS H 3 26 ? 17.239  39.049 18.345  1.00 32.89 ? 80  HIS D CA    1 
ATOM   3603 C  C     . HIS H 3 26 ? 18.665  38.539 18.658  1.00 34.09 ? 80  HIS D C     1 
ATOM   3604 O  O     . HIS H 3 26 ? 19.179  37.632 17.994  1.00 30.77 ? 80  HIS D O     1 
ATOM   3605 C  CB    . HIS H 3 26 ? 16.248  37.879 18.364  1.00 30.95 ? 80  HIS D CB    1 
ATOM   3606 C  CG    . HIS H 3 26 ? 14.807  38.287 18.254  1.00 27.03 ? 80  HIS D CG    1 
ATOM   3607 N  ND1   . HIS H 3 26 ? 14.229  39.290 18.999  1.00 25.76 ? 80  HIS D ND1   1 
ATOM   3608 C  CD2   . HIS H 3 26 ? 13.810  37.762 17.502  1.00 24.23 ? 80  HIS D CD2   1 
ATOM   3609 C  CE1   . HIS H 3 26 ? 12.931  39.334 18.681  1.00 25.30 ? 80  HIS D CE1   1 
ATOM   3610 N  NE2   . HIS H 3 26 ? 12.633  38.424 17.776  1.00 22.43 ? 80  HIS D NE2   1 
ATOM   3611 N  N     . CYS H 3 27 ? 19.283  39.112 19.694  1.00 35.39 ? 81  CYS D N     1 
ATOM   3612 C  CA    . CYS H 3 27 ? 20.651  38.748 20.104  1.00 37.73 ? 81  CYS D CA    1 
ATOM   3613 C  C     . CYS H 3 27 ? 20.923  37.247 20.284  1.00 39.81 ? 81  CYS D C     1 
ATOM   3614 O  O     . CYS H 3 27 ? 20.003  36.424 20.247  1.00 40.24 ? 81  CYS D O     1 
ATOM   3615 C  CB    . CYS H 3 27 ? 21.042  39.490 21.400  1.00 36.72 ? 81  CYS D CB    1 
ATOM   3616 S  SG    . CYS H 3 27 ? 20.567  38.730 22.993  1.00 33.35 ? 81  CYS D SG    1 
ATOM   3617 N  N     . GLN H 3 28 ? 22.192  36.898 20.480  1.00 41.50 ? 82  GLN D N     1 
ATOM   3618 C  CA    . GLN H 3 28 ? 22.561  35.504 20.660  1.00 43.78 ? 82  GLN D CA    1 
ATOM   3619 C  C     . GLN H 3 28 ? 22.307  35.028 22.090  1.00 44.22 ? 82  GLN D C     1 
ATOM   3620 O  O     . GLN H 3 28 ? 21.784  33.926 22.311  1.00 44.64 ? 82  GLN D O     1 
ATOM   3621 C  CB    . GLN H 3 28 ? 24.029  35.292 20.298  1.00 44.96 ? 82  GLN D CB    1 
ATOM   3622 C  CG    . GLN H 3 28 ? 24.288  35.222 18.817  1.00 48.81 ? 82  GLN D CG    1 
ATOM   3623 C  CD    . GLN H 3 28 ? 23.574  34.041 18.143  1.00 50.36 ? 82  GLN D CD    1 
ATOM   3624 O  OE1   . GLN H 3 28 ? 23.627  33.882 16.910  1.00 51.16 ? 82  GLN D OE1   1 
ATOM   3625 N  NE2   . GLN H 3 28 ? 22.894  33.217 18.947  1.00 49.48 ? 82  GLN D NE2   1 
ATOM   3626 N  N     . GLN H 3 29 ? 22.682  35.860 23.056  1.00 43.86 ? 83  GLN D N     1 
ATOM   3627 C  CA    . GLN H 3 29 ? 22.496  35.528 24.454  1.00 43.43 ? 83  GLN D CA    1 
ATOM   3628 C  C     . GLN H 3 29 ? 21.098  34.953 24.707  1.00 43.98 ? 83  GLN D C     1 
ATOM   3629 O  O     . GLN H 3 29 ? 20.942  34.052 25.541  1.00 44.70 ? 83  GLN D O     1 
ATOM   3630 C  CB    . GLN H 3 29 ? 22.722  36.773 25.312  1.00 42.95 ? 83  GLN D CB    1 
ATOM   3631 C  CG    . GLN H 3 29 ? 23.429  36.522 26.647  1.00 45.30 ? 83  GLN D CG    1 
ATOM   3632 C  CD    . GLN H 3 29 ? 24.922  36.258 26.503  1.00 42.95 ? 83  GLN D CD    1 
ATOM   3633 O  OE1   . GLN H 3 29 ? 25.344  35.372 25.763  1.00 42.13 ? 83  GLN D OE1   1 
ATOM   3634 N  NE2   . GLN H 3 29 ? 25.722  37.025 27.221  1.00 42.44 ? 83  GLN D NE2   1 
ATOM   3635 N  N     . CYS H 3 30 ? 20.090  35.464 23.990  1.00 43.20 ? 84  CYS D N     1 
ATOM   3636 C  CA    . CYS H 3 30 ? 18.712  34.994 24.146  1.00 42.65 ? 84  CYS D CA    1 
ATOM   3637 C  C     . CYS H 3 30 ? 18.410  33.763 23.309  1.00 44.58 ? 84  CYS D C     1 
ATOM   3638 O  O     . CYS H 3 30 ? 17.550  32.950 23.672  1.00 44.79 ? 84  CYS D O     1 
ATOM   3639 C  CB    . CYS H 3 30 ? 17.718  36.085 23.774  1.00 40.32 ? 84  CYS D CB    1 
ATOM   3640 S  SG    . CYS H 3 30 ? 17.562  37.402 25.009  1.00 37.85 ? 84  CYS D SG    1 
ATOM   3641 N  N     . THR H 3 31 ? 19.111  33.630 22.184  1.00 45.29 ? 85  THR D N     1 
ATOM   3642 C  CA    . THR H 3 31 ? 18.922  32.485 21.299  1.00 47.11 ? 85  THR D CA    1 
ATOM   3643 C  C     . THR H 3 31 ? 19.485  31.249 21.997  1.00 47.86 ? 85  THR D C     1 
ATOM   3644 O  O     . THR H 3 31 ? 18.943  30.151 21.874  1.00 47.89 ? 85  THR D O     1 
ATOM   3645 C  CB    . THR H 3 31 ? 19.650  32.704 19.953  1.00 46.73 ? 85  THR D CB    1 
ATOM   3646 O  OG1   . THR H 3 31 ? 19.285  33.986 19.429  1.00 49.33 ? 85  THR D OG1   1 
ATOM   3647 C  CG2   . THR H 3 31 ? 19.247  31.638 18.934  1.00 46.12 ? 85  THR D CG2   1 
ATOM   3648 N  N     . LYS H 3 32 ? 20.572  31.437 22.744  1.00 48.01 ? 86  LYS D N     1 
ATOM   3649 C  CA    . LYS H 3 32 ? 21.183  30.335 23.478  1.00 48.99 ? 86  LYS D CA    1 
ATOM   3650 C  C     . LYS H 3 32 ? 20.265  29.838 24.589  1.00 48.60 ? 86  LYS D C     1 
ATOM   3651 O  O     . LYS H 3 32 ? 20.236  28.639 24.893  1.00 48.91 ? 86  LYS D O     1 
ATOM   3652 C  CB    . LYS H 3 32 ? 22.526  30.755 24.089  1.00 50.13 ? 86  LYS D CB    1 
ATOM   3653 C  CG    . LYS H 3 32 ? 23.686  30.727 23.098  1.00 51.06 ? 86  LYS D CG    1 
ATOM   3654 C  CD    . LYS H 3 32 ? 25.030  30.959 23.790  1.00 51.87 ? 86  LYS D CD    1 
ATOM   3655 C  CE    . LYS H 3 32 ? 25.103  32.352 24.434  1.00 51.73 ? 86  LYS D CE    1 
ATOM   3656 N  NZ    . LYS H 3 32 ? 26.487  32.661 24.885  1.00 51.01 ? 86  LYS D NZ    1 
ATOM   3657 N  N     . THR H 3 33 ? 19.508  30.761 25.179  1.00 47.16 ? 87  THR D N     1 
ATOM   3658 C  CA    . THR H 3 33 ? 18.592  30.428 26.266  1.00 44.74 ? 87  THR D CA    1 
ATOM   3659 C  C     . THR H 3 33 ? 17.209  30.047 25.748  1.00 44.34 ? 87  THR D C     1 
ATOM   3660 O  O     . THR H 3 33 ? 16.298  29.778 26.536  1.00 45.09 ? 87  THR D O     1 
ATOM   3661 C  CB    . THR H 3 33 ? 18.446  31.616 27.236  1.00 43.53 ? 87  THR D CB    1 
ATOM   3662 O  OG1   . THR H 3 33 ? 19.738  32.006 27.710  1.00 43.49 ? 87  THR D OG1   1 
ATOM   3663 C  CG2   . THR H 3 33 ? 17.581  31.248 28.412  1.00 42.78 ? 87  THR D CG2   1 
ATOM   3664 N  N     . GLY H 3 34 ? 17.047  30.033 24.428  1.00 43.87 ? 88  GLY D N     1 
ATOM   3665 C  CA    . GLY H 3 34 ? 15.759  29.676 23.850  1.00 43.61 ? 88  GLY D CA    1 
ATOM   3666 C  C     . GLY H 3 34 ? 14.655  30.717 23.988  1.00 42.93 ? 88  GLY D C     1 
ATOM   3667 O  O     . GLY H 3 34 ? 13.476  30.395 23.828  1.00 43.36 ? 88  GLY D O     1 
ATOM   3668 N  N     . VAL H 3 35 ? 15.027  31.959 24.276  1.00 40.65 ? 89  VAL D N     1 
ATOM   3669 C  CA    . VAL H 3 35 ? 14.043  33.025 24.427  1.00 38.56 ? 89  VAL D CA    1 
ATOM   3670 C  C     . VAL H 3 35 ? 14.245  34.151 23.408  1.00 37.44 ? 89  VAL D C     1 
ATOM   3671 O  O     . VAL H 3 35 ? 13.958  35.321 23.689  1.00 36.92 ? 89  VAL D O     1 
ATOM   3672 C  CB    . VAL H 3 35 ? 14.104  33.621 25.842  1.00 38.06 ? 89  VAL D CB    1 
ATOM   3673 C  CG1   . VAL H 3 35 ? 13.622  32.605 26.845  1.00 38.42 ? 89  VAL D CG1   1 
ATOM   3674 C  CG2   . VAL H 3 35 ? 15.522  34.048 26.162  1.00 35.82 ? 89  VAL D CG2   1 
ATOM   3675 N  N     . ALA H 3 36 ? 14.733  33.778 22.227  1.00 35.16 ? 90  ALA D N     1 
ATOM   3676 C  CA    . ALA H 3 36 ? 15.002  34.719 21.142  1.00 33.18 ? 90  ALA D CA    1 
ATOM   3677 C  C     . ALA H 3 36 ? 13.925  35.769 20.912  1.00 32.19 ? 90  ALA D C     1 
ATOM   3678 O  O     . ALA H 3 36 ? 14.130  36.964 21.138  1.00 31.25 ? 90  ALA D O     1 
ATOM   3679 C  CB    . ALA H 3 36 ? 15.237  33.954 19.854  1.00 33.17 ? 90  ALA D CB    1 
ATOM   3680 N  N     . HIS H 3 37 ? 12.771  35.313 20.457  1.00 30.95 ? 91  HIS D N     1 
ATOM   3681 C  CA    . HIS H 3 37 ? 11.679  36.212 20.167  1.00 31.41 ? 91  HIS D CA    1 
ATOM   3682 C  C     . HIS H 3 37 ? 11.093  36.950 21.357  1.00 30.86 ? 91  HIS D C     1 
ATOM   3683 O  O     . HIS H 3 37 ? 9.982   37.472 21.291  1.00 32.87 ? 91  HIS D O     1 
ATOM   3684 C  CB    . HIS H 3 37 ? 10.628  35.441 19.396  1.00 31.60 ? 91  HIS D CB    1 
ATOM   3685 C  CG    . HIS H 3 37 ? 11.193  34.730 18.209  1.00 35.11 ? 91  HIS D CG    1 
ATOM   3686 N  ND1   . HIS H 3 37 ? 11.905  35.402 17.244  1.00 37.14 ? 91  HIS D ND1   1 
ATOM   3687 C  CD2   . HIS H 3 37 ? 11.154  33.408 17.900  1.00 36.33 ? 91  HIS D CD2   1 
ATOM   3688 C  CE1   . HIS H 3 37 ? 12.282  34.488 16.374  1.00 38.58 ? 91  HIS D CE1   1 
ATOM   3689 N  NE2   . HIS H 3 37 ? 11.852  33.260 16.726  1.00 38.27 ? 91  HIS D NE2   1 
ATOM   3690 N  N     . LEU H 3 38 ? 11.870  37.005 22.433  1.00 30.21 ? 92  LEU D N     1 
ATOM   3691 C  CA    . LEU H 3 38 ? 11.505  37.708 23.664  1.00 29.36 ? 92  LEU D CA    1 
ATOM   3692 C  C     . LEU H 3 38 ? 12.556  38.788 23.875  1.00 28.86 ? 92  LEU D C     1 
ATOM   3693 O  O     . LEU H 3 38 ? 12.543  39.533 24.846  1.00 29.34 ? 92  LEU D O     1 
ATOM   3694 C  CB    . LEU H 3 38 ? 11.528  36.745 24.846  1.00 28.33 ? 92  LEU D CB    1 
ATOM   3695 C  CG    . LEU H 3 38 ? 10.212  36.051 25.149  1.00 27.17 ? 92  LEU D CG    1 
ATOM   3696 C  CD1   . LEU H 3 38 ? 10.442  34.970 26.174  1.00 26.59 ? 92  LEU D CD1   1 
ATOM   3697 C  CD2   . LEU H 3 38 ? 9.200   37.081 25.647  1.00 26.94 ? 92  LEU D CD2   1 
ATOM   3698 N  N     . CYS H 3 39 ? 13.469  38.850 22.920  1.00 29.00 ? 93  CYS D N     1 
ATOM   3699 C  CA    . CYS H 3 39 ? 14.577  39.782 22.922  1.00 30.01 ? 93  CYS D CA    1 
ATOM   3700 C  C     . CYS H 3 39 ? 14.257  41.133 22.263  1.00 29.25 ? 93  CYS D C     1 
ATOM   3701 O  O     . CYS H 3 39 ? 13.869  41.191 21.101  1.00 26.38 ? 93  CYS D O     1 
ATOM   3702 C  CB    . CYS H 3 39 ? 15.744  39.122 22.203  1.00 32.68 ? 93  CYS D CB    1 
ATOM   3703 S  SG    . CYS H 3 39 ? 17.231  40.155 22.124  1.00 38.70 ? 93  CYS D SG    1 
ATOM   3704 N  N     . HIS H 3 40 ? 14.426  42.214 23.018  1.00 28.49 ? 94  HIS D N     1 
ATOM   3705 C  CA    . HIS H 3 40 ? 14.170  43.560 22.516  1.00 28.68 ? 94  HIS D CA    1 
ATOM   3706 C  C     . HIS H 3 40 ? 14.980  44.653 23.187  1.00 28.48 ? 94  HIS D C     1 
ATOM   3707 O  O     . HIS H 3 40 ? 15.455  44.502 24.300  1.00 27.74 ? 94  HIS D O     1 
ATOM   3708 C  CB    . HIS H 3 40 ? 12.685  43.921 22.612  1.00 29.65 ? 94  HIS D CB    1 
ATOM   3709 C  CG    . HIS H 3 40 ? 12.155  43.956 24.008  1.00 31.54 ? 94  HIS D CG    1 
ATOM   3710 N  ND1   . HIS H 3 40 ? 11.371  42.948 24.532  1.00 31.70 ? 94  HIS D ND1   1 
ATOM   3711 C  CD2   . HIS H 3 40 ? 12.298  44.875 24.991  1.00 32.17 ? 94  HIS D CD2   1 
ATOM   3712 C  CE1   . HIS H 3 40 ? 11.057  43.246 25.780  1.00 32.07 ? 94  HIS D CE1   1 
ATOM   3713 N  NE2   . HIS H 3 40 ? 11.607  44.410 26.084  1.00 31.75 ? 94  HIS D NE2   1 
ATOM   3714 N  N     . TYR H 3 41 ? 15.127  45.766 22.479  1.00 29.36 ? 95  TYR D N     1 
ATOM   3715 C  CA    . TYR H 3 41 ? 15.874  46.908 22.984  1.00 27.43 ? 95  TYR D CA    1 
ATOM   3716 C  C     . TYR H 3 41 ? 14.968  48.098 23.238  1.00 26.87 ? 95  TYR D C     1 
ATOM   3717 O  O     . TYR H 3 41 ? 13.861  48.167 22.730  1.00 24.24 ? 95  TYR D O     1 
ATOM   3718 C  CB    . TYR H 3 41 ? 16.959  47.285 21.987  1.00 26.88 ? 95  TYR D CB    1 
ATOM   3719 C  CG    . TYR H 3 41 ? 17.784  46.106 21.527  1.00 24.12 ? 95  TYR D CG    1 
ATOM   3720 C  CD1   . TYR H 3 41 ? 17.235  45.119 20.711  1.00 22.62 ? 95  TYR D CD1   1 
ATOM   3721 C  CD2   . TYR H 3 41 ? 19.105  45.966 21.929  1.00 25.26 ? 95  TYR D CD2   1 
ATOM   3722 C  CE1   . TYR H 3 41 ? 17.990  44.022 20.304  1.00 24.43 ? 95  TYR D CE1   1 
ATOM   3723 C  CE2   . TYR H 3 41 ? 19.867  44.877 21.532  1.00 26.29 ? 95  TYR D CE2   1 
ATOM   3724 C  CZ    . TYR H 3 41 ? 19.304  43.911 20.723  1.00 26.93 ? 95  TYR D CZ    1 
ATOM   3725 O  OH    . TYR H 3 41 ? 20.068  42.836 20.342  1.00 30.21 ? 95  TYR D OH    1 
ATOM   3726 N  N     . MET H 3 42 ? 15.451  49.037 24.043  1.00 31.96 ? 96  MET D N     1 
ATOM   3727 C  CA    . MET H 3 42 ? 14.676  50.233 24.376  1.00 35.56 ? 96  MET D CA    1 
ATOM   3728 C  C     . MET H 3 42 ? 14.930  51.351 23.372  1.00 36.78 ? 96  MET D C     1 
ATOM   3729 O  O     . MET H 3 42 ? 16.064  51.580 22.971  1.00 38.79 ? 96  MET D O     1 
ATOM   3730 C  CB    . MET H 3 42 ? 15.045  50.717 25.780  1.00 37.73 ? 96  MET D CB    1 
ATOM   3731 C  CG    . MET H 3 42 ? 14.890  49.643 26.865  1.00 38.36 ? 96  MET D CG    1 
ATOM   3732 S  SD    . MET H 3 42 ? 14.400  50.384 28.438  1.00 43.21 ? 96  MET D SD    1 
ATOM   3733 C  CE    . MET H 3 42 ? 15.968  50.488 29.263  1.00 39.30 ? 96  MET D CE    1 
ATOM   3734 N  N     . GLU H 3 43 ? 13.880  52.047 22.953  1.00 37.73 ? 97  GLU D N     1 
ATOM   3735 C  CA    . GLU H 3 43 ? 14.072  53.129 22.000  1.00 37.90 ? 97  GLU D CA    1 
ATOM   3736 C  C     . GLU H 3 43 ? 15.019  54.161 22.567  1.00 36.74 ? 97  GLU D C     1 
ATOM   3737 O  O     . GLU H 3 43 ? 14.834  54.638 23.672  1.00 36.08 ? 97  GLU D O     1 
ATOM   3738 C  CB    . GLU H 3 43 ? 12.749  53.832 21.660  1.00 39.74 ? 97  GLU D CB    1 
ATOM   3739 C  CG    . GLU H 3 43 ? 11.752  53.035 20.790  1.00 44.55 ? 97  GLU D CG    1 
ATOM   3740 C  CD    . GLU H 3 43 ? 10.659  53.936 20.154  1.00 48.34 ? 97  GLU D CD    1 
ATOM   3741 O  OE1   . GLU H 3 43 ? 10.894  54.503 19.050  1.00 48.08 ? 97  GLU D OE1   1 
ATOM   3742 O  OE2   . GLU H 3 43 ? 9.570   54.087 20.774  1.00 48.98 ? 97  GLU D OE2   1 
ATOM   3743 N  N     . GLN H 3 44 ? 16.056  54.488 21.812  1.00 37.60 ? 98  GLN D N     1 
ATOM   3744 C  CA    . GLN H 3 44 ? 17.004  55.521 22.225  1.00 37.06 ? 98  GLN D CA    1 
ATOM   3745 C  C     . GLN H 3 44 ? 16.368  56.808 21.701  1.00 35.49 ? 98  GLN D C     1 
ATOM   3746 O  O     . GLN H 3 44 ? 15.713  56.783 20.658  1.00 33.50 ? 98  GLN D O     1 
ATOM   3747 C  CB    . GLN H 3 44 ? 18.356  55.304 21.546  1.00 38.79 ? 98  GLN D CB    1 
ATOM   3748 C  CG    . GLN H 3 44 ? 19.053  53.982 21.892  1.00 38.44 ? 98  GLN D CG    1 
ATOM   3749 C  CD    . GLN H 3 44 ? 19.480  53.918 23.341  1.00 38.74 ? 98  GLN D CD    1 
ATOM   3750 O  OE1   . GLN H 3 44 ? 19.648  54.944 23.996  1.00 40.78 ? 98  GLN D OE1   1 
ATOM   3751 N  NE2   . GLN H 3 44 ? 19.668  52.713 23.845  1.00 37.70 ? 98  GLN D NE2   1 
ATOM   3752 N  N     . THR H 3 45 ? 16.526  57.921 22.410  1.00 34.62 ? 99  THR D N     1 
ATOM   3753 C  CA    . THR H 3 45 ? 15.915  59.160 21.934  1.00 34.01 ? 99  THR D CA    1 
ATOM   3754 C  C     . THR H 3 45 ? 16.478  59.581 20.586  1.00 32.78 ? 99  THR D C     1 
ATOM   3755 O  O     . THR H 3 45 ? 15.729  59.880 19.664  1.00 32.59 ? 99  THR D O     1 
ATOM   3756 C  CB    . THR H 3 45 ? 16.107  60.322 22.923  1.00 33.53 ? 99  THR D CB    1 
ATOM   3757 O  OG1   . THR H 3 45 ? 15.307  60.091 24.085  1.00 35.67 ? 99  THR D OG1   1 
ATOM   3758 C  CG2   . THR H 3 45 ? 15.671  61.645 22.283  1.00 34.96 ? 99  THR D CG2   1 
ATOM   3759 N  N     . TRP H 3 46 ? 17.799  59.588 20.475  1.00 30.28 ? 100 TRP D N     1 
ATOM   3760 C  CA    . TRP H 3 46 ? 18.452  59.981 19.246  1.00 28.92 ? 100 TRP D CA    1 
ATOM   3761 C  C     . TRP H 3 46 ? 18.220  59.053 18.064  1.00 30.45 ? 100 TRP D C     1 
ATOM   3762 O  O     . TRP H 3 46 ? 18.962  59.094 17.092  1.00 30.30 ? 100 TRP D O     1 
ATOM   3763 C  CB    . TRP H 3 46 ? 19.951  60.121 19.487  1.00 27.58 ? 100 TRP D CB    1 
ATOM   3764 C  CG    . TRP H 3 46 ? 20.573  59.016 20.290  1.00 21.80 ? 100 TRP D CG    1 
ATOM   3765 C  CD1   . TRP H 3 46 ? 20.938  59.079 21.593  1.00 21.62 ? 100 TRP D CD1   1 
ATOM   3766 C  CD2   . TRP H 3 46 ? 20.942  57.708 19.833  1.00 20.83 ? 100 TRP D CD2   1 
ATOM   3767 N  NE1   . TRP H 3 46 ? 21.512  57.899 21.983  1.00 22.16 ? 100 TRP D NE1   1 
ATOM   3768 C  CE2   . TRP H 3 46 ? 21.520  57.037 20.917  1.00 21.96 ? 100 TRP D CE2   1 
ATOM   3769 C  CE3   . TRP H 3 46 ? 20.822  57.036 18.614  1.00 18.92 ? 100 TRP D CE3   1 
ATOM   3770 C  CZ2   . TRP H 3 46 ? 22.003  55.735 20.821  1.00 18.97 ? 100 TRP D CZ2   1 
ATOM   3771 C  CZ3   . TRP H 3 46 ? 21.303  55.734 18.523  1.00 19.49 ? 100 TRP D CZ3   1 
ATOM   3772 C  CH2   . TRP H 3 46 ? 21.878  55.101 19.618  1.00 19.22 ? 100 TRP D CH2   1 
ATOM   3773 N  N     . ALA H 3 47 ? 17.184  58.227 18.130  1.00 30.47 ? 101 ALA D N     1 
ATOM   3774 C  CA    . ALA H 3 47 ? 16.908  57.305 17.038  1.00 30.41 ? 101 ALA D CA    1 
ATOM   3775 C  C     . ALA H 3 47 ? 15.436  57.266 16.639  1.00 32.37 ? 101 ALA D C     1 
ATOM   3776 O  O     . ALA H 3 47 ? 15.084  56.631 15.647  1.00 32.34 ? 101 ALA D O     1 
ATOM   3777 C  CB    . ALA H 3 47 ? 17.387  55.913 17.408  1.00 29.55 ? 101 ALA D CB    1 
ATOM   3778 N  N     . GLU H 3 48 ? 14.574  57.950 17.392  1.00 34.56 ? 102 GLU D N     1 
ATOM   3779 C  CA    . GLU H 3 48 ? 13.142  57.954 17.069  1.00 36.76 ? 102 GLU D CA    1 
ATOM   3780 C  C     . GLU H 3 48 ? 12.981  58.196 15.569  1.00 36.27 ? 102 GLU D C     1 
ATOM   3781 O  O     . GLU H 3 48 ? 12.207  57.520 14.896  1.00 35.92 ? 102 GLU D O     1 
ATOM   3782 C  CB    . GLU H 3 48 ? 12.396  59.054 17.843  1.00 39.11 ? 102 GLU D CB    1 
ATOM   3783 C  CG    . GLU H 3 48 ? 12.559  59.000 19.354  1.00 46.51 ? 102 GLU D CG    1 
ATOM   3784 C  CD    . GLU H 3 48 ? 12.033  57.695 19.980  1.00 51.83 ? 102 GLU D CD    1 
ATOM   3785 O  OE1   . GLU H 3 48 ? 12.408  56.593 19.483  1.00 53.38 ? 102 GLU D OE1   1 
ATOM   3786 O  OE2   . GLU H 3 48 ? 11.257  57.775 20.976  1.00 51.94 ? 102 GLU D OE2   1 
ATOM   3787 N  N     . GLU H 3 49 ? 13.741  59.160 15.063  1.00 34.43 ? 103 GLU D N     1 
ATOM   3788 C  CA    . GLU H 3 49 ? 13.715  59.536 13.666  1.00 34.96 ? 103 GLU D CA    1 
ATOM   3789 C  C     . GLU H 3 49 ? 14.045  58.343 12.780  1.00 33.85 ? 103 GLU D C     1 
ATOM   3790 O  O     . GLU H 3 49 ? 13.222  57.899 11.983  1.00 33.95 ? 103 GLU D O     1 
ATOM   3791 C  CB    . GLU H 3 49 ? 14.729  60.663 13.432  1.00 39.01 ? 103 GLU D CB    1 
ATOM   3792 C  CG    . GLU H 3 49 ? 14.455  61.572 12.235  1.00 44.88 ? 103 GLU D CG    1 
ATOM   3793 C  CD    . GLU H 3 49 ? 15.543  62.651 12.069  1.00 50.08 ? 103 GLU D CD    1 
ATOM   3794 O  OE1   . GLU H 3 49 ? 16.726  62.289 11.848  1.00 51.64 ? 103 GLU D OE1   1 
ATOM   3795 O  OE2   . GLU H 3 49 ? 15.227  63.866 12.164  1.00 51.65 ? 103 GLU D OE2   1 
ATOM   3796 N  N     . ALA H 3 50 ? 15.259  57.830 12.919  1.00 31.25 ? 104 ALA D N     1 
ATOM   3797 C  CA    . ALA H 3 50 ? 15.704  56.695 12.127  1.00 28.10 ? 104 ALA D CA    1 
ATOM   3798 C  C     . ALA H 3 50 ? 14.741  55.546 12.282  1.00 27.94 ? 104 ALA D C     1 
ATOM   3799 O  O     . ALA H 3 50 ? 14.485  54.806 11.341  1.00 27.27 ? 104 ALA D O     1 
ATOM   3800 C  CB    . ALA H 3 50 ? 17.079  56.270 12.571  1.00 29.04 ? 104 ALA D CB    1 
ATOM   3801 N  N     . GLU H 3 51 ? 14.216  55.406 13.492  1.00 28.54 ? 105 GLU D N     1 
ATOM   3802 C  CA    . GLU H 3 51 ? 13.271  54.352 13.822  1.00 29.21 ? 105 GLU D CA    1 
ATOM   3803 C  C     . GLU H 3 51 ? 11.998  54.536 13.004  1.00 29.40 ? 105 GLU D C     1 
ATOM   3804 O  O     . GLU H 3 51 ? 11.561  53.633 12.293  1.00 28.74 ? 105 GLU D O     1 
ATOM   3805 C  CB    . GLU H 3 51 ? 12.949  54.411 15.316  1.00 31.27 ? 105 GLU D CB    1 
ATOM   3806 C  CG    . GLU H 3 51 ? 12.517  53.096 15.893  1.00 33.46 ? 105 GLU D CG    1 
ATOM   3807 C  CD    . GLU H 3 51 ? 13.574  52.042 15.699  1.00 36.35 ? 105 GLU D CD    1 
ATOM   3808 O  OE1   . GLU H 3 51 ? 14.627  52.106 16.366  1.00 35.36 ? 105 GLU D OE1   1 
ATOM   3809 O  OE2   . GLU H 3 51 ? 13.356  51.153 14.858  1.00 37.55 ? 105 GLU D OE2   1 
ATOM   3810 N  N     . LYS H 3 52 ? 11.419  55.721 13.123  1.00 30.03 ? 106 LYS D N     1 
ATOM   3811 C  CA    . LYS H 3 52 ? 10.210  56.087 12.416  1.00 30.34 ? 106 LYS D CA    1 
ATOM   3812 C  C     . LYS H 3 52 ? 10.363  55.826 10.918  1.00 30.64 ? 106 LYS D C     1 
ATOM   3813 O  O     . LYS H 3 52 ? 9.477   55.242 10.296  1.00 32.28 ? 106 LYS D O     1 
ATOM   3814 C  CB    . LYS H 3 52 ? 9.906   57.569 12.681  1.00 30.55 ? 106 LYS D CB    1 
ATOM   3815 C  CG    . LYS H 3 52 ? 8.557   58.054 12.161  1.00 34.43 ? 106 LYS D CG    1 
ATOM   3816 C  CD    . LYS H 3 52 ? 8.298   59.476 12.585  1.00 37.00 ? 106 LYS D CD    1 
ATOM   3817 C  CE    . LYS H 3 52 ? 7.029   60.017 11.944  1.00 38.85 ? 106 LYS D CE    1 
ATOM   3818 N  NZ    . LYS H 3 52 ? 7.082   60.002 10.444  1.00 40.89 ? 106 LYS D NZ    1 
ATOM   3819 N  N     . GLU H 3 53 ? 11.478  56.256 10.338  1.00 28.87 ? 107 GLU D N     1 
ATOM   3820 C  CA    . GLU H 3 53 ? 11.701  56.053 8.915   1.00 29.40 ? 107 GLU D CA    1 
ATOM   3821 C  C     . GLU H 3 53 ? 11.743  54.576 8.531   1.00 28.58 ? 107 GLU D C     1 
ATOM   3822 O  O     . GLU H 3 53 ? 11.323  54.202 7.432   1.00 26.52 ? 107 GLU D O     1 
ATOM   3823 C  CB    . GLU H 3 53 ? 12.984  56.751 8.466   1.00 32.58 ? 107 GLU D CB    1 
ATOM   3824 C  CG    . GLU H 3 53 ? 12.799  58.234 8.159   1.00 39.76 ? 107 GLU D CG    1 
ATOM   3825 C  CD    . GLU H 3 53 ? 14.062  58.881 7.560   1.00 46.33 ? 107 GLU D CD    1 
ATOM   3826 O  OE1   . GLU H 3 53 ? 14.622  58.314 6.576   1.00 48.92 ? 107 GLU D OE1   1 
ATOM   3827 O  OE2   . GLU H 3 53 ? 14.487  59.958 8.069   1.00 47.19 ? 107 GLU D OE2   1 
ATOM   3828 N  N     . LEU H 3 54 ? 12.240  53.735 9.440   1.00 28.60 ? 108 LEU D N     1 
ATOM   3829 C  CA    . LEU H 3 54 ? 12.313  52.293 9.189   1.00 27.11 ? 108 LEU D CA    1 
ATOM   3830 C  C     . LEU H 3 54 ? 10.917  51.669 9.165   1.00 25.24 ? 108 LEU D C     1 
ATOM   3831 O  O     . LEU H 3 54 ? 10.595  50.881 8.282   1.00 23.26 ? 108 LEU D O     1 
ATOM   3832 C  CB    . LEU H 3 54 ? 13.161  51.600 10.252  1.00 30.25 ? 108 LEU D CB    1 
ATOM   3833 C  CG    . LEU H 3 54 ? 13.262  50.089 10.030  1.00 33.88 ? 108 LEU D CG    1 
ATOM   3834 C  CD1   . LEU H 3 54 ? 14.165  49.829 8.851   1.00 35.29 ? 108 LEU D CD1   1 
ATOM   3835 C  CD2   . LEU H 3 54 ? 13.784  49.398 11.286  1.00 34.63 ? 108 LEU D CD2   1 
ATOM   3836 N  N     . LEU H 3 55 ? 10.098  52.016 10.151  1.00 25.09 ? 109 LEU D N     1 
ATOM   3837 C  CA    . LEU H 3 55 ? 8.736   51.517 10.206  1.00 26.76 ? 109 LEU D CA    1 
ATOM   3838 C  C     . LEU H 3 55 ? 8.054   51.928 8.913   1.00 27.85 ? 109 LEU D C     1 
ATOM   3839 O  O     . LEU H 3 55 ? 7.590   51.084 8.134   1.00 26.37 ? 109 LEU D O     1 
ATOM   3840 C  CB    . LEU H 3 55 ? 7.992   52.125 11.394  1.00 26.86 ? 109 LEU D CB    1 
ATOM   3841 C  CG    . LEU H 3 55 ? 8.199   51.454 12.750  1.00 29.24 ? 109 LEU D CG    1 
ATOM   3842 C  CD1   . LEU H 3 55 ? 7.432   52.201 13.811  1.00 29.08 ? 109 LEU D CD1   1 
ATOM   3843 C  CD2   . LEU H 3 55 ? 7.731   50.004 12.677  1.00 31.36 ? 109 LEU D CD2   1 
ATOM   3844 N  N     . LYS H 3 56 ? 8.015   53.241 8.703   1.00 29.83 ? 110 LYS D N     1 
ATOM   3845 C  CA    . LYS H 3 56 ? 7.422   53.845 7.519   1.00 30.69 ? 110 LYS D CA    1 
ATOM   3846 C  C     . LYS H 3 56 ? 7.877   53.101 6.245   1.00 31.19 ? 110 LYS D C     1 
ATOM   3847 O  O     . LYS H 3 56 ? 7.061   52.757 5.377   1.00 30.29 ? 110 LYS D O     1 
ATOM   3848 C  CB    . LYS H 3 56 ? 7.836   55.313 7.472   1.00 32.46 ? 110 LYS D CB    1 
ATOM   3849 C  CG    . LYS H 3 56 ? 7.102   56.167 6.449   1.00 36.49 ? 110 LYS D CG    1 
ATOM   3850 C  CD    . LYS H 3 56 ? 7.667   57.588 6.408   1.00 37.12 ? 110 LYS D CD    1 
ATOM   3851 C  CE    . LYS H 3 56 ? 7.613   58.235 7.787   1.00 38.00 ? 110 LYS D CE    1 
ATOM   3852 N  NZ    . LYS H 3 56 ? 8.215   59.603 7.747   1.00 40.77 ? 110 LYS D NZ    1 
ATOM   3853 N  N     . ASP H 3 57 ? 9.176   52.842 6.136   1.00 29.87 ? 111 ASP D N     1 
ATOM   3854 C  CA    . ASP H 3 57 ? 9.706   52.130 4.978   1.00 31.93 ? 111 ASP D CA    1 
ATOM   3855 C  C     . ASP H 3 57 ? 9.079   50.755 4.809   1.00 32.03 ? 111 ASP D C     1 
ATOM   3856 O  O     . ASP H 3 57 ? 8.705   50.360 3.713   1.00 30.65 ? 111 ASP D O     1 
ATOM   3857 C  CB    . ASP H 3 57 ? 11.208  51.938 5.120   1.00 35.13 ? 111 ASP D CB    1 
ATOM   3858 C  CG    . ASP H 3 57 ? 11.995  52.877 4.269   1.00 38.78 ? 111 ASP D CG    1 
ATOM   3859 O  OD1   . ASP H 3 57 ? 13.187  52.578 4.043   1.00 43.76 ? 111 ASP D OD1   1 
ATOM   3860 O  OD2   . ASP H 3 57 ? 11.439  53.908 3.834   1.00 38.56 ? 111 ASP D OD2   1 
ATOM   3861 N  N     . ASN H 3 58 ? 9.010   50.016 5.913   1.00 33.48 ? 112 ASN D N     1 
ATOM   3862 C  CA    . ASN H 3 58 ? 8.452   48.673 5.931   1.00 32.13 ? 112 ASN D CA    1 
ATOM   3863 C  C     . ASN H 3 58 ? 6.954   48.684 5.685   1.00 30.67 ? 112 ASN D C     1 
ATOM   3864 O  O     . ASN H 3 58 ? 6.435   47.855 4.948   1.00 29.94 ? 112 ASN D O     1 
ATOM   3865 C  CB    . ASN H 3 58 ? 8.768   47.993 7.267   1.00 33.49 ? 112 ASN D CB    1 
ATOM   3866 C  CG    . ASN H 3 58 ? 10.246  47.690 7.429   1.00 34.63 ? 112 ASN D CG    1 
ATOM   3867 O  OD1   . ASN H 3 58 ? 10.855  47.088 6.563   1.00 37.63 ? 112 ASN D OD1   1 
ATOM   3868 N  ND2   . ASN H 3 58 ? 10.820  48.093 8.547   1.00 36.67 ? 112 ASN D ND2   1 
ATOM   3869 N  N     . GLU H 3 59 ? 6.247   49.632 6.281   1.00 29.12 ? 113 GLU D N     1 
ATOM   3870 C  CA    . GLU H 3 59 ? 4.817   49.673 6.059   1.00 29.11 ? 113 GLU D CA    1 
ATOM   3871 C  C     . GLU H 3 59 ? 4.477   49.971 4.604   1.00 29.78 ? 113 GLU D C     1 
ATOM   3872 O  O     . GLU H 3 59 ? 3.576   49.355 4.049   1.00 27.25 ? 113 GLU D O     1 
ATOM   3873 C  CB    . GLU H 3 59 ? 4.130   50.699 6.963   1.00 28.05 ? 113 GLU D CB    1 
ATOM   3874 C  CG    . GLU H 3 59 ? 2.647   50.373 7.134   1.00 29.37 ? 113 GLU D CG    1 
ATOM   3875 C  CD    . GLU H 3 59 ? 1.884   51.376 7.964   1.00 30.85 ? 113 GLU D CD    1 
ATOM   3876 O  OE1   . GLU H 3 59 ? 2.460   51.929 8.918   1.00 33.27 ? 113 GLU D OE1   1 
ATOM   3877 O  OE2   . GLU H 3 59 ? 0.692   51.590 7.675   1.00 31.30 ? 113 GLU D OE2   1 
ATOM   3878 N  N     . LEU H 3 60 ? 5.197   50.913 3.987   1.00 30.86 ? 114 LEU D N     1 
ATOM   3879 C  CA    . LEU H 3 60 ? 4.922   51.269 2.595   1.00 32.37 ? 114 LEU D CA    1 
ATOM   3880 C  C     . LEU H 3 60 ? 5.207   50.101 1.663   1.00 32.01 ? 114 LEU D C     1 
ATOM   3881 O  O     . LEU H 3 60 ? 4.562   49.955 0.632   1.00 31.59 ? 114 LEU D O     1 
ATOM   3882 C  CB    . LEU H 3 60 ? 5.741   52.528 2.118   1.00 34.80 ? 114 LEU D CB    1 
ATOM   3883 C  CG    . LEU H 3 60 ? 5.382   52.870 0.673   1.00 34.60 ? 114 LEU D CG    1 
ATOM   3884 N  N     . LYS H 3 61 ? 6.158   49.255 2.033   1.00 33.44 ? 115 LYS D N     1 
ATOM   3885 C  CA    . LYS H 3 61 ? 6.483   48.111 1.198   1.00 34.47 ? 115 LYS D CA    1 
ATOM   3886 C  C     . LYS H 3 61 ? 5.376   47.063 1.252   1.00 36.19 ? 115 LYS D C     1 
ATOM   3887 O  O     . LYS H 3 61 ? 4.892   46.605 0.206   1.00 38.41 ? 115 LYS D O     1 
ATOM   3888 C  CB    . LYS H 3 61 ? 7.806   47.489 1.631   1.00 33.98 ? 115 LYS D CB    1 
ATOM   3889 C  CG    . LYS H 3 61 ? 8.292   46.383 0.710   1.00 35.21 ? 115 LYS D CG    1 
ATOM   3890 C  CD    . LYS H 3 61 ? 9.678   45.957 1.118   1.00 39.01 ? 115 LYS D CD    1 
ATOM   3891 C  CE    . LYS H 3 61 ? 10.246  44.898 0.191   1.00 40.95 ? 115 LYS D CE    1 
ATOM   3892 N  NZ    . LYS H 3 61 ? 11.713  44.686 0.458   1.00 42.55 ? 115 LYS D NZ    1 
ATOM   3893 N  N     . LYS H 3 62 ? 4.970   46.689 2.461   1.00 35.84 ? 116 LYS D N     1 
ATOM   3894 C  CA    . LYS H 3 62 ? 3.917   45.695 2.624   1.00 35.32 ? 116 LYS D CA    1 
ATOM   3895 C  C     . LYS H 3 62 ? 2.571   46.179 2.088   1.00 34.55 ? 116 LYS D C     1 
ATOM   3896 O  O     . LYS H 3 62 ? 1.782   45.397 1.558   1.00 35.08 ? 116 LYS D O     1 
ATOM   3897 C  CB    . LYS H 3 62 ? 3.776   45.323 4.104   1.00 37.64 ? 116 LYS D CB    1 
ATOM   3898 C  CG    . LYS H 3 62 ? 4.882   44.430 4.640   1.00 39.81 ? 116 LYS D CG    1 
ATOM   3899 C  CD    . LYS H 3 62 ? 4.757   43.026 4.085   1.00 42.04 ? 116 LYS D CD    1 
ATOM   3900 C  CE    . LYS H 3 62 ? 6.094   42.309 4.156   1.00 43.75 ? 116 LYS D CE    1 
ATOM   3901 N  NZ    . LYS H 3 62 ? 7.095   43.048 3.336   1.00 45.78 ? 116 LYS D NZ    1 
ATOM   3902 N  N     . LEU H 3 63 ? 2.303   47.469 2.231   1.00 34.91 ? 117 LEU D N     1 
ATOM   3903 C  CA    . LEU H 3 63 ? 1.036   48.011 1.780   1.00 34.95 ? 117 LEU D CA    1 
ATOM   3904 C  C     . LEU H 3 63 ? 0.935   48.049 0.277   1.00 37.05 ? 117 LEU D C     1 
ATOM   3905 O  O     . LEU H 3 63 ? -0.145  47.857 -0.279  1.00 37.91 ? 117 LEU D O     1 
ATOM   3906 C  CB    . LEU H 3 63 ? 0.816   49.408 2.359   1.00 33.58 ? 117 LEU D CB    1 
ATOM   3907 C  CG    . LEU H 3 63 ? 0.288   49.428 3.801   1.00 32.22 ? 117 LEU D CG    1 
ATOM   3908 C  CD1   . LEU H 3 63 ? 0.226   50.847 4.321   1.00 31.61 ? 117 LEU D CD1   1 
ATOM   3909 C  CD2   . LEU H 3 63 ? -1.099  48.798 3.840   1.00 30.78 ? 117 LEU D CD2   1 
ATOM   3910 N  N     . ARG H 3 64 ? 2.052   48.293 -0.397  1.00 38.52 ? 118 ARG D N     1 
ATOM   3911 C  CA    . ARG H 3 64 ? 2.018   48.327 -1.848  1.00 39.75 ? 118 ARG D CA    1 
ATOM   3912 C  C     . ARG H 3 64 ? 1.812   46.908 -2.346  1.00 40.68 ? 118 ARG D C     1 
ATOM   3913 O  O     . ARG H 3 64 ? 1.148   46.682 -3.358  1.00 41.17 ? 118 ARG D O     1 
ATOM   3914 C  CB    . ARG H 3 64 ? 3.319   48.897 -2.403  1.00 40.46 ? 118 ARG D CB    1 
ATOM   3915 C  CG    . ARG H 3 64 ? 3.450   50.383 -2.225  1.00 41.42 ? 118 ARG D CG    1 
ATOM   3916 C  CD    . ARG H 3 64 ? 4.800   50.872 -2.715  1.00 43.40 ? 118 ARG D CD    1 
ATOM   3917 N  NE    . ARG H 3 64 ? 5.067   52.228 -2.252  1.00 46.20 ? 118 ARG D NE    1 
ATOM   3918 C  CZ    . ARG H 3 64 ? 6.259   52.811 -2.299  1.00 47.88 ? 118 ARG D CZ    1 
ATOM   3919 N  NH1   . ARG H 3 64 ? 7.307   52.156 -2.791  1.00 47.38 ? 118 ARG D NH1   1 
ATOM   3920 N  NH2   . ARG H 3 64 ? 6.401   54.046 -1.844  1.00 48.88 ? 118 ARG D NH2   1 
ATOM   3921 N  N     . GLU H 3 65 ? 2.395   45.953 -1.627  1.00 41.57 ? 119 GLU D N     1 
ATOM   3922 C  CA    . GLU H 3 65 ? 2.272   44.544 -1.972  1.00 41.45 ? 119 GLU D CA    1 
ATOM   3923 C  C     . GLU H 3 65 ? 0.858   44.049 -1.720  1.00 41.15 ? 119 GLU D C     1 
ATOM   3924 O  O     . GLU H 3 65 ? 0.326   43.290 -2.528  1.00 42.27 ? 119 GLU D O     1 
ATOM   3925 C  CB    . GLU H 3 65 ? 3.248   43.695 -1.156  1.00 41.83 ? 119 GLU D CB    1 
ATOM   3926 C  CG    . GLU H 3 65 ? 4.617   43.523 -1.777  1.00 44.71 ? 119 GLU D CG    1 
ATOM   3927 C  CD    . GLU H 3 65 ? 5.636   42.998 -0.789  1.00 47.58 ? 119 GLU D CD    1 
ATOM   3928 O  OE1   . GLU H 3 65 ? 5.280   42.133 0.058   1.00 49.25 ? 119 GLU D OE1   1 
ATOM   3929 O  OE2   . GLU H 3 65 ? 6.800   43.446 -0.877  1.00 48.41 ? 119 GLU D OE2   1 
ATOM   3930 N  N     . ARG H 3 66 ? 0.238   44.473 -0.619  1.00 40.38 ? 120 ARG D N     1 
ATOM   3931 C  CA    . ARG H 3 66 ? -1.100  43.993 -0.335  1.00 40.46 ? 120 ARG D CA    1 
ATOM   3932 C  C     . ARG H 3 66 ? -2.184  44.693 -1.138  1.00 40.07 ? 120 ARG D C     1 
ATOM   3933 O  O     . ARG H 3 66 ? -3.272  44.149 -1.314  1.00 39.85 ? 120 ARG D O     1 
ATOM   3934 C  CB    . ARG H 3 66 ? -1.429  44.085 1.157   1.00 41.53 ? 120 ARG D CB    1 
ATOM   3935 C  CG    . ARG H 3 66 ? -2.745  43.404 1.449   1.00 45.55 ? 120 ARG D CG    1 
ATOM   3936 C  CD    . ARG H 3 66 ? -3.217  43.481 2.878   1.00 48.77 ? 120 ARG D CD    1 
ATOM   3937 N  NE    . ARG H 3 66 ? -4.543  42.875 2.971   1.00 53.21 ? 120 ARG D NE    1 
ATOM   3938 C  CZ    . ARG H 3 66 ? -5.269  42.812 4.084   1.00 56.66 ? 120 ARG D CZ    1 
ATOM   3939 N  NH1   . ARG H 3 66 ? -4.800  43.323 5.221   1.00 58.13 ? 120 ARG D NH1   1 
ATOM   3940 N  NH2   . ARG H 3 66 ? -6.466  42.232 4.065   1.00 58.11 ? 120 ARG D NH2   1 
ATOM   3941 N  N     . VAL H 3 67 ? -1.904  45.897 -1.627  1.00 41.19 ? 121 VAL D N     1 
ATOM   3942 C  CA    . VAL H 3 67 ? -2.907  46.606 -2.414  1.00 40.93 ? 121 VAL D CA    1 
ATOM   3943 C  C     . VAL H 3 67 ? -3.028  45.871 -3.736  1.00 41.51 ? 121 VAL D C     1 
ATOM   3944 O  O     . VAL H 3 67 ? -4.045  45.965 -4.411  1.00 41.62 ? 121 VAL D O     1 
ATOM   3945 C  CB    . VAL H 3 67 ? -2.513  48.073 -2.674  1.00 40.20 ? 121 VAL D CB    1 
ATOM   3946 C  CG1   . VAL H 3 67 ? -1.251  48.127 -3.519  1.00 40.20 ? 121 VAL D CG1   1 
ATOM   3947 C  CG2   . VAL H 3 67 ? -3.652  48.808 -3.372  1.00 39.79 ? 121 VAL D CG2   1 
ATOM   3948 N  N     . LYS H 3 68 ? -1.983  45.135 -4.099  1.00 42.84 ? 122 LYS D N     1 
ATOM   3949 C  CA    . LYS H 3 68 ? -1.990  44.350 -5.330  1.00 45.01 ? 122 LYS D CA    1 
ATOM   3950 C  C     . LYS H 3 68 ? -2.593  42.979 -5.040  1.00 45.30 ? 122 LYS D C     1 
ATOM   3951 O  O     . LYS H 3 68 ? -3.379  42.442 -5.817  1.00 45.89 ? 122 LYS D O     1 
ATOM   3952 C  CB    . LYS H 3 68 ? -0.570  44.197 -5.871  1.00 45.76 ? 122 LYS D CB    1 
ATOM   3953 C  CG    . LYS H 3 68 ? -0.025  45.450 -6.565  1.00 48.37 ? 122 LYS D CG    1 
ATOM   3954 C  CD    . LYS H 3 68 ? 1.460   45.296 -6.893  1.00 51.48 ? 122 LYS D CD    1 
ATOM   3955 C  CE    . LYS H 3 68 ? 1.943   46.393 -7.856  1.00 51.99 ? 122 LYS D CE    1 
ATOM   3956 N  NZ    . LYS H 3 68 ? 1.403   46.244 -9.250  1.00 50.50 ? 122 LYS D NZ    1 
ATOM   3957 N  N     . SER H 3 69 ? -2.230  42.433 -3.890  1.00 45.66 ? 123 SER D N     1 
ATOM   3958 C  CA    . SER H 3 69 ? -2.731  41.138 -3.468  1.00 46.88 ? 123 SER D CA    1 
ATOM   3959 C  C     . SER H 3 69 ? -4.254  41.179 -3.383  1.00 47.16 ? 123 SER D C     1 
ATOM   3960 O  O     . SER H 3 69 ? -4.946  40.215 -3.728  1.00 47.16 ? 123 SER D O     1 
ATOM   3961 C  CB    . SER H 3 69 ? -2.139  40.781 -2.102  1.00 47.85 ? 123 SER D CB    1 
ATOM   3962 O  OG    . SER H 3 69 ? -2.437  39.440 -1.751  1.00 51.79 ? 123 SER D OG    1 
ATOM   3963 N  N     . LEU H 3 70 ? -4.772  42.310 -2.927  1.00 47.54 ? 124 LEU D N     1 
ATOM   3964 C  CA    . LEU H 3 70 ? -6.208  42.487 -2.796  1.00 47.83 ? 124 LEU D CA    1 
ATOM   3965 C  C     . LEU H 3 70 ? -6.850  42.735 -4.160  1.00 49.46 ? 124 LEU D C     1 
ATOM   3966 O  O     . LEU H 3 70 ? -7.799  42.049 -4.537  1.00 50.48 ? 124 LEU D O     1 
ATOM   3967 C  CB    . LEU H 3 70 ? -6.503  43.651 -1.845  1.00 46.15 ? 124 LEU D CB    1 
ATOM   3968 C  CG    . LEU H 3 70 ? -6.147  43.359 -0.390  1.00 44.19 ? 124 LEU D CG    1 
ATOM   3969 C  CD1   . LEU H 3 70 ? -5.906  44.627 0.389   1.00 42.70 ? 124 LEU D CD1   1 
ATOM   3970 C  CD2   . LEU H 3 70 ? -7.266  42.547 0.212   1.00 43.95 ? 124 LEU D CD2   1 
ATOM   3971 N  N     . GLU H 3 71 ? -6.339  43.709 -4.907  1.00 50.74 ? 125 GLU D N     1 
ATOM   3972 C  CA    . GLU H 3 71 ? -6.899  44.000 -6.223  1.00 52.69 ? 125 GLU D CA    1 
ATOM   3973 C  C     . GLU H 3 71 ? -7.080  42.719 -7.036  1.00 53.87 ? 125 GLU D C     1 
ATOM   3974 O  O     . GLU H 3 71 ? -8.162  42.472 -7.575  1.00 54.80 ? 125 GLU D O     1 
ATOM   3975 C  CB    . GLU H 3 71 ? -6.014  44.999 -6.979  1.00 51.89 ? 125 GLU D CB    1 
ATOM   3976 C  CG    . GLU H 3 71 ? -6.066  46.409 -6.377  1.00 51.58 ? 125 GLU D CG    1 
ATOM   3977 C  CD    . GLU H 3 71 ? -5.082  47.375 -7.009  1.00 50.44 ? 125 GLU D CD    1 
ATOM   3978 O  OE1   . GLU H 3 71 ? -4.805  48.425 -6.395  1.00 50.27 ? 125 GLU D OE1   1 
ATOM   3979 O  OE2   . GLU H 3 71 ? -4.592  47.096 -8.119  1.00 51.18 ? 125 GLU D OE2   1 
ATOM   3980 N  N     . LYS H 3 72 ? -6.035  41.902 -7.115  1.00 54.44 ? 126 LYS D N     1 
ATOM   3981 C  CA    . LYS H 3 72 ? -6.139  40.659 -7.859  1.00 55.54 ? 126 LYS D CA    1 
ATOM   3982 C  C     . LYS H 3 72 ? -7.220  39.789 -7.216  1.00 55.60 ? 126 LYS D C     1 
ATOM   3983 O  O     . LYS H 3 72 ? -8.140  39.317 -7.899  1.00 56.59 ? 126 LYS D O     1 
ATOM   3984 C  CB    . LYS H 3 72 ? -4.809  39.900 -7.856  1.00 56.53 ? 126 LYS D CB    1 
ATOM   3985 C  CG    . LYS H 3 72 ? -3.739  40.450 -8.794  1.00 57.70 ? 126 LYS D CG    1 
ATOM   3986 C  CD    . LYS H 3 72 ? -2.545  39.478 -8.859  1.00 59.27 ? 126 LYS D CD    1 
ATOM   3987 C  CE    . LYS H 3 72 ? -1.397  39.999 -9.740  1.00 59.54 ? 126 LYS D CE    1 
ATOM   3988 N  NZ    . LYS H 3 72 ? -1.750  40.096 -11.188 1.00 59.41 ? 126 LYS D NZ    1 
ATOM   3989 N  N     . THR H 3 73 ? -7.117  39.585 -5.904  1.00 55.03 ? 127 THR D N     1 
ATOM   3990 C  CA    . THR H 3 73 ? -8.091  38.751 -5.210  1.00 55.51 ? 127 THR D CA    1 
ATOM   3991 C  C     . THR H 3 73 ? -9.477  39.364 -5.278  1.00 55.78 ? 127 THR D C     1 
ATOM   3992 O  O     . THR H 3 73 ? -10.452 38.780 -4.813  1.00 55.97 ? 127 THR D O     1 
ATOM   3993 C  CB    . THR H 3 73 ? -7.709  38.542 -3.721  1.00 56.56 ? 127 THR D CB    1 
ATOM   3994 O  OG1   . THR H 3 73 ? -6.396  37.969 -3.632  1.00 58.40 ? 127 THR D OG1   1 
ATOM   3995 C  CG2   . THR H 3 73 ? -8.699  37.607 -3.041  1.00 55.54 ? 127 THR D CG2   1 
ATOM   3996 N  N     . LEU H 3 74 ? -9.568  40.555 -5.854  1.00 55.88 ? 128 LEU D N     1 
ATOM   3997 C  CA    . LEU H 3 74 ? -10.856 41.221 -5.961  1.00 55.33 ? 128 LEU D CA    1 
ATOM   3998 C  C     . LEU H 3 74 ? -11.385 41.013 -7.377  1.00 55.22 ? 128 LEU D C     1 
ATOM   3999 O  O     . LEU H 3 74 ? -12.464 41.502 -7.735  1.00 55.46 ? 128 LEU D O     1 
ATOM   4000 C  CB    . LEU H 3 74 ? -10.700 42.708 -5.634  1.00 54.88 ? 128 LEU D CB    1 
ATOM   4001 C  CG    . LEU H 3 74 ? -11.946 43.508 -5.213  1.00 54.18 ? 128 LEU D CG    1 
ATOM   4002 C  CD1   . LEU H 3 74 ? -12.697 43.983 -6.446  1.00 53.63 ? 128 LEU D CD1   1 
ATOM   4003 C  CD2   . LEU H 3 74 ? -12.837 42.670 -4.312  1.00 53.72 ? 128 LEU D CD2   1 
ATOM   4004 N  N     . SER H 3 75 ? -10.619 40.279 -8.178  1.00 55.50 ? 129 SER D N     1 
ATOM   4005 C  CA    . SER H 3 75 ? -11.016 39.969 -9.550  1.00 56.73 ? 129 SER D CA    1 
ATOM   4006 C  C     . SER H 3 75 ? -10.756 38.470 -9.843  1.00 56.60 ? 129 SER D C     1 
ATOM   4007 O  O     . SER H 3 75 ? -9.637  38.121 -10.307 1.00 55.40 ? 129 SER D O     1 
ATOM   4008 C  CB    . SER H 3 75 ? -10.254 40.859 -10.550 1.00 56.40 ? 129 SER D CB    1 
ATOM   4009 O  OG    . SER H 3 75 ? -8.864  40.563 -10.551 1.00 56.88 ? 129 SER D OG    1 
HETATM 4010 ZN ZN    . ZN  I 4 .  ? -7.117  33.005 35.736  1.00 24.30 ? 131 ZN  A ZN    1 
HETATM 4011 ZN ZN    . ZN  J 4 .  ? -4.876  32.388 33.928  1.00 24.28 ? 132 ZN  A ZN    1 
HETATM 4012 ZN ZN    . ZN  K 4 .  ? 0.638   44.577 18.202  1.00 32.26 ? 131 ZN  B ZN    1 
HETATM 4013 ZN ZN    . ZN  L 4 .  ? 3.330   43.932 17.332  1.00 30.96 ? 132 ZN  B ZN    1 
HETATM 4014 ZN ZN    . ZN  M 4 .  ? 11.320  37.488 16.740  1.00 36.68 ? 133 ZN  B ZN    1 
HETATM 4015 ZN ZN    . ZN  N 4 .  ? 28.612  57.973 12.835  1.00 28.01 ? 131 ZN  C ZN    1 
HETATM 4016 ZN ZN    . ZN  O 4 .  ? 26.605  55.919 12.043  1.00 26.41 ? 132 ZN  C ZN    1 
HETATM 4017 ZN ZN    . ZN  P 4 .  ? 21.021  40.314 24.677  1.00 33.28 ? 131 ZN  D ZN    1 
HETATM 4018 ZN ZN    . ZN  Q 4 .  ? 18.457  39.219 23.863  1.00 33.64 ? 132 ZN  D ZN    1 
HETATM 4019 O  O     . HOH R 5 .  ? -3.514  32.454 68.806  1.00 23.66 ? 21  HOH E O     1 
HETATM 4020 O  O     . HOH R 5 .  ? -12.587 26.366 58.600  1.00 21.62 ? 22  HOH E O     1 
HETATM 4021 O  O     . HOH R 5 .  ? 3.633   56.185 11.203  1.00 41.88 ? 23  HOH E O     1 
HETATM 4022 O  O     . HOH R 5 .  ? -5.209  44.203 38.457  1.00 29.10 ? 24  HOH E O     1 
HETATM 4023 O  O     . HOH R 5 .  ? -18.650 62.889 22.096  1.00 35.48 ? 25  HOH E O     1 
HETATM 4024 O  O     . HOH R 5 .  ? -7.565  50.265 36.548  1.00 23.16 ? 26  HOH E O     1 
HETATM 4025 O  O     . HOH R 5 .  ? -2.092  26.786 70.725  1.00 38.15 ? 27  HOH E O     1 
HETATM 4026 O  O     . HOH R 5 .  ? -16.720 43.580 56.431  1.00 47.34 ? 28  HOH E O     1 
HETATM 4027 O  O     . HOH R 5 .  ? -1.566  23.852 59.805  1.00 44.04 ? 29  HOH E O     1 
HETATM 4028 O  O     . HOH S 5 .  ? -4.071  32.032 57.354  1.00 18.56 ? 21  HOH F O     1 
HETATM 4029 O  O     . HOH S 5 .  ? -11.438 32.588 41.035  1.00 44.87 ? 22  HOH F O     1 
HETATM 4030 O  O     . HOH S 5 .  ? -14.517 41.825 46.369  1.00 29.71 ? 23  HOH F O     1 
HETATM 4031 O  O     . HOH S 5 .  ? -11.399 52.514 22.071  1.00 28.52 ? 24  HOH F O     1 
HETATM 4032 O  O     . HOH S 5 .  ? -7.141  40.812 72.426  1.00 28.37 ? 25  HOH F O     1 
HETATM 4033 O  O     . HOH S 5 .  ? -7.925  61.617 42.252  1.00 40.44 ? 26  HOH F O     1 
HETATM 4034 O  O     . HOH S 5 .  ? -20.553 54.513 44.572  1.00 48.68 ? 27  HOH F O     1 
HETATM 4035 O  O     . HOH T 5 .  ? 23.882  31.647 41.699  1.00 33.68 ? 21  HOH G O     1 
HETATM 4036 O  O     . HOH T 5 .  ? 21.613  43.695 45.114  1.00 47.18 ? 22  HOH G O     1 
HETATM 4037 O  O     . HOH U 5 .  ? 21.131  74.517 6.891   1.00 29.07 ? 21  HOH H O     1 
HETATM 4038 O  O     . HOH U 5 .  ? 34.288  70.875 16.519  1.00 54.16 ? 22  HOH H O     1 
HETATM 4039 O  O     . HOH U 5 .  ? 27.541  87.214 11.027  1.00 40.56 ? 23  HOH H O     1 
HETATM 4040 O  O     . HOH U 5 .  ? 37.507  64.286 26.416  1.00 40.57 ? 24  HOH H O     1 
HETATM 4041 O  O     . HOH U 5 .  ? 36.851  30.028 44.734  1.00 45.25 ? 25  HOH H O     1 
HETATM 4042 O  O     . HOH U 5 .  ? 32.600  62.261 23.403  1.00 34.86 ? 26  HOH H O     1 
HETATM 4043 O  O     . HOH V 5 .  ? 2.720   33.510 39.169  1.00 24.18 ? 133 HOH A O     1 
HETATM 4044 O  O     . HOH V 5 .  ? -0.927  26.272 50.105  1.00 16.51 ? 134 HOH A O     1 
HETATM 4045 O  O     . HOH V 5 .  ? 2.025   27.393 40.782  1.00 48.46 ? 135 HOH A O     1 
HETATM 4046 O  O     . HOH V 5 .  ? 4.478   32.082 58.133  1.00 28.80 ? 136 HOH A O     1 
HETATM 4047 O  O     . HOH V 5 .  ? -3.251  35.240 25.066  1.00 33.73 ? 137 HOH A O     1 
HETATM 4048 O  O     . HOH V 5 .  ? 17.990  27.684 45.385  1.00 28.25 ? 138 HOH A O     1 
HETATM 4049 O  O     . HOH V 5 .  ? 11.603  30.046 47.840  1.00 49.25 ? 139 HOH A O     1 
HETATM 4050 O  O     . HOH V 5 .  ? 36.901  23.642 33.033  1.00 38.43 ? 140 HOH A O     1 
HETATM 4051 O  O     . HOH V 5 .  ? 18.867  21.100 43.395  1.00 25.59 ? 141 HOH A O     1 
HETATM 4052 O  O     . HOH V 5 .  ? -4.553  26.615 54.682  1.00 28.51 ? 142 HOH A O     1 
HETATM 4053 O  O     . HOH V 5 .  ? -12.718 40.064 38.485  1.00 55.61 ? 143 HOH A O     1 
HETATM 4054 O  O     . HOH V 5 .  ? 3.081   28.326 33.903  1.00 50.27 ? 144 HOH A O     1 
HETATM 4055 O  O     . HOH V 5 .  ? -8.378  24.771 39.318  1.00 34.26 ? 145 HOH A O     1 
HETATM 4056 O  O     . HOH V 5 .  ? 0.014   34.170 25.724  1.00 50.32 ? 146 HOH A O     1 
HETATM 4057 O  O     . HOH V 5 .  ? 21.019  20.762 41.957  1.00 35.06 ? 147 HOH A O     1 
HETATM 4058 O  O     . HOH V 5 .  ? -3.043  28.059 41.278  1.00 31.52 ? 148 HOH A O     1 
HETATM 4059 O  O     . HOH V 5 .  ? -14.190 35.176 35.496  1.00 49.19 ? 149 HOH A O     1 
HETATM 4060 O  O     . HOH V 5 .  ? -2.826  18.845 43.240  1.00 31.08 ? 150 HOH A O     1 
HETATM 4061 O  O     . HOH W 5 .  ? 6.051   37.134 28.191  1.00 37.33 ? 134 HOH B O     1 
HETATM 4062 O  O     . HOH W 5 .  ? 10.510  25.063 37.374  1.00 32.11 ? 135 HOH B O     1 
HETATM 4063 O  O     . HOH W 5 .  ? 24.871  14.203 30.773  1.00 35.07 ? 136 HOH B O     1 
HETATM 4064 O  O     . HOH W 5 .  ? 3.627   40.370 29.522  1.00 37.56 ? 137 HOH B O     1 
HETATM 4065 O  O     . HOH W 5 .  ? 9.050   29.043 24.145  1.00 40.97 ? 138 HOH B O     1 
HETATM 4066 O  O     . HOH W 5 .  ? -8.975  54.617 42.062  1.00 54.07 ? 139 HOH B O     1 
HETATM 4067 O  O     . HOH W 5 .  ? 39.254  15.400 21.273  1.00 36.45 ? 140 HOH B O     1 
HETATM 4068 O  O     . HOH W 5 .  ? -5.318  40.670 13.307  1.00 30.94 ? 141 HOH B O     1 
HETATM 4069 O  O     . HOH W 5 .  ? -1.932  56.624 27.484  1.00 37.21 ? 142 HOH B O     1 
HETATM 4070 O  O     . HOH W 5 .  ? 2.599   45.558 26.966  1.00 42.94 ? 143 HOH B O     1 
HETATM 4071 O  O     . HOH W 5 .  ? -4.149  47.207 20.703  1.00 37.14 ? 144 HOH B O     1 
HETATM 4072 O  O     . HOH W 5 .  ? 8.870   58.807 17.730  1.00 42.98 ? 145 HOH B O     1 
HETATM 4073 O  O     . HOH W 5 .  ? 17.177  31.329 39.041  1.00 63.65 ? 146 HOH B O     1 
HETATM 4074 O  O     . HOH W 5 .  ? 4.740   55.287 14.699  1.00 41.30 ? 147 HOH B O     1 
HETATM 4075 O  O     . HOH W 5 .  ? 8.873   42.731 35.820  1.00 61.19 ? 148 HOH B O     1 
HETATM 4076 O  O     . HOH X 5 .  ? 23.116  70.593 -1.730  1.00 13.88 ? 133 HOH C O     1 
HETATM 4077 O  O     . HOH X 5 .  ? 15.044  72.632 0.125   1.00 24.60 ? 134 HOH C O     1 
HETATM 4078 O  O     . HOH X 5 .  ? 15.190  66.976 -4.510  1.00 23.73 ? 135 HOH C O     1 
HETATM 4079 O  O     . HOH X 5 .  ? 12.738  56.102 0.671   1.00 43.19 ? 136 HOH C O     1 
HETATM 4080 O  O     . HOH X 5 .  ? 22.022  69.519 8.134   1.00 24.43 ? 137 HOH C O     1 
HETATM 4081 O  O     . HOH X 5 .  ? 9.237   60.761 -1.249  1.00 33.31 ? 138 HOH C O     1 
HETATM 4082 O  O     . HOH X 5 .  ? 28.006  65.730 15.531  1.00 54.17 ? 139 HOH C O     1 
HETATM 4083 O  O     . HOH X 5 .  ? 30.840  57.701 4.589   1.00 41.40 ? 140 HOH C O     1 
HETATM 4084 O  O     . HOH X 5 .  ? 21.914  47.203 13.887  1.00 27.98 ? 141 HOH C O     1 
HETATM 4085 O  O     . HOH X 5 .  ? 34.665  54.272 17.895  1.00 45.34 ? 142 HOH C O     1 
HETATM 4086 O  O     . HOH X 5 .  ? 3.304   64.517 7.961   1.00 42.71 ? 143 HOH C O     1 
HETATM 4087 O  O     . HOH X 5 .  ? 27.029  62.682 3.506   1.00 28.26 ? 144 HOH C O     1 
HETATM 4088 O  O     . HOH X 5 .  ? 29.642  64.670 10.002  1.00 33.68 ? 145 HOH C O     1 
HETATM 4089 O  O     . HOH X 5 .  ? 18.678  71.640 4.471   1.00 37.06 ? 146 HOH C O     1 
HETATM 4090 O  O     . HOH X 5 .  ? 14.200  74.917 1.730   1.00 38.54 ? 147 HOH C O     1 
HETATM 4091 O  O     . HOH X 5 .  ? 12.740  71.064 0.273   1.00 39.46 ? 148 HOH C O     1 
HETATM 4092 O  O     . HOH X 5 .  ? 13.461  67.491 -1.541  1.00 31.66 ? 149 HOH C O     1 
HETATM 4093 O  O     . HOH X 5 .  ? 21.008  66.838 8.725   1.00 50.46 ? 150 HOH C O     1 
HETATM 4094 O  O     . HOH X 5 .  ? 20.419  71.236 -2.649  1.00 44.58 ? 151 HOH C O     1 
HETATM 4095 O  O     . HOH X 5 .  ? 13.129  53.810 -2.107  1.00 34.79 ? 152 HOH C O     1 
HETATM 4096 O  O     . HOH X 5 .  ? 24.725  47.360 15.250  1.00 43.23 ? 153 HOH C O     1 
HETATM 4097 O  O     . HOH X 5 .  ? -9.956  61.088 3.584   1.00 39.98 ? 154 HOH C O     1 
HETATM 4098 O  O     . HOH X 5 .  ? 10.046  66.974 -3.833  1.00 18.85 ? 155 HOH C O     1 
HETATM 4099 O  O     . HOH X 5 .  ? 2.968   62.051 -1.825  1.00 44.18 ? 156 HOH C O     1 
HETATM 4100 O  O     . HOH X 5 .  ? 2.316   53.463 -3.506  1.00 43.90 ? 157 HOH C O     1 
HETATM 4101 O  O     . HOH Y 5 .  ? -2.657  45.210 5.811   1.00 23.57 ? 133 HOH D O     1 
HETATM 4102 O  O     . HOH Y 5 .  ? 14.258  43.874 18.464  1.00 30.37 ? 134 HOH D O     1 
HETATM 4103 O  O     . HOH Y 5 .  ? 17.987  60.241 11.552  1.00 31.90 ? 135 HOH D O     1 
HETATM 4104 O  O     . HOH Y 5 .  ? -1.520  49.959 7.981   1.00 50.28 ? 136 HOH D O     1 
HETATM 4105 O  O     . HOH Y 5 .  ? 11.966  48.944 21.283  1.00 22.06 ? 137 HOH D O     1 
HETATM 4106 O  O     . HOH Y 5 .  ? 17.982  63.516 10.009  1.00 34.74 ? 138 HOH D O     1 
HETATM 4107 O  O     . HOH Y 5 .  ? 16.847  59.297 14.750  1.00 24.20 ? 139 HOH D O     1 
HETATM 4108 O  O     . HOH Y 5 .  ? 22.542  29.830 20.335  1.00 43.41 ? 140 HOH D O     1 
HETATM 4109 O  O     . HOH Y 5 .  ? 18.223  37.990 15.042  1.00 48.49 ? 141 HOH D O     1 
HETATM 4110 O  O     . HOH Y 5 .  ? 7.754   53.404 18.848  1.00 47.47 ? 142 HOH D O     1 
HETATM 4111 O  O     . HOH Y 5 .  ? 14.178  49.972 2.718   1.00 51.71 ? 143 HOH D O     1 
HETATM 4112 O  O     . HOH Y 5 .  ? 21.180  35.468 18.055  1.00 39.66 ? 144 HOH D O     1 
HETATM 4113 O  O     . HOH Y 5 .  ? 16.439  51.927 19.127  1.00 36.55 ? 145 HOH D O     1 
HETATM 4114 O  O     . HOH Y 5 .  ? 7.828   45.496 4.635   1.00 40.07 ? 146 HOH D O     1 
A 1 1  DA  1  1   1   DA  A   E . n 
A 1 2  DC  2  2   2   DC  C   E . n 
A 1 3  DG  3  3   3   DG  G   E . n 
A 1 4  DC  4  4   4   DC  C   E . n 
A 1 5  DT  5  5   5   DT  T   E . n 
A 1 6  DA  6  6   6   DA  A   E . n 
A 1 7  DT  7  7   7   DT  T   E . n 
A 1 8  DT  8  8   8   DT  T   E . n 
A 1 9  DA  9  9   9   DA  A   E . n 
A 1 10 DT  10 10  10  DT  T   E . n 
A 1 11 DC  11 11  11  DC  C   E . n 
A 1 12 DG  12 12  12  DG  G   E . n 
A 1 13 DC  13 13  13  DC  C   E . n 
A 1 14 DT  14 14  14  DT  T   E . n 
A 1 15 DA  15 15  15  DA  A   E . n 
A 1 16 DT  16 16  16  DT  T   E . n 
A 1 17 DT  17 17  17  DT  T   E . n 
A 1 18 DA  18 18  18  DA  A   E . n 
A 1 19 DG  19 19  19  DG  G   E . n 
A 1 20 DT  20 20  20  DT  T   E . n 
B 2 1  DA  1  1   1   DA  A   F . n 
B 2 2  DC  2  2   2   DC  C   F . n 
B 2 3  DT  3  3   3   DT  T   F . n 
B 2 4  DA  4  4   4   DA  A   F . n 
B 2 5  DA  5  5   5   DA  A   F . n 
B 2 6  DT  6  6   6   DT  T   F . n 
B 2 7  DA  7  7   7   DA  A   F . n 
B 2 8  DG  8  8   8   DG  G   F . n 
B 2 9  DC  9  9   9   DC  C   F . n 
B 2 10 DG  10 10  10  DG  G   F . n 
B 2 11 DA  11 11  11  DA  A   F . n 
B 2 12 DT  12 12  12  DT  T   F . n 
B 2 13 DA  13 13  13  DA  A   F . n 
B 2 14 DA  14 14  14  DA  A   F . n 
B 2 15 DT  15 15  15  DT  T   F . n 
B 2 16 DA  16 16  16  DA  A   F . n 
B 2 17 DG  17 17  17  DG  G   F . n 
B 2 18 DC  18 18  18  DC  C   F . n 
B 2 19 DG  19 19  19  DG  G   F . n 
B 2 20 DT  20 20  20  DT  T   F . n 
C 1 1  DA  1  1   1   DA  A   G . n 
C 1 2  DC  2  2   2   DC  C   G . n 
C 1 3  DG  3  3   3   DG  G   G . n 
C 1 4  DC  4  4   4   DC  C   G . n 
C 1 5  DT  5  5   5   DT  T   G . n 
C 1 6  DA  6  6   6   DA  A   G . n 
C 1 7  DT  7  7   7   DT  T   G . n 
C 1 8  DT  8  8   8   DT  T   G . n 
C 1 9  DA  9  9   9   DA  A   G . n 
C 1 10 DT  10 10  10  DT  T   G . n 
C 1 11 DC  11 11  11  DC  C   G . n 
C 1 12 DG  12 12  12  DG  G   G . n 
C 1 13 DC  13 13  13  DC  C   G . n 
C 1 14 DT  14 14  14  DT  T   G . n 
C 1 15 DA  15 15  15  DA  A   G . n 
C 1 16 DT  16 16  16  DT  T   G . n 
C 1 17 DT  17 17  17  DT  T   G . n 
C 1 18 DA  18 18  18  DA  A   G . n 
C 1 19 DG  19 19  19  DG  G   G . n 
C 1 20 DT  20 20  20  DT  T   G . n 
D 2 1  DA  1  1   ?   ?   ?   H . n 
D 2 2  DC  2  2   ?   ?   ?   H . n 
D 2 3  DT  3  3   3   DT  T   H . n 
D 2 4  DA  4  4   4   DA  A   H . n 
D 2 5  DA  5  5   5   DA  A   H . n 
D 2 6  DT  6  6   6   DT  T   H . n 
D 2 7  DA  7  7   7   DA  A   H . n 
D 2 8  DG  8  8   8   DG  G   H . n 
D 2 9  DC  9  9   9   DC  C   H . n 
D 2 10 DG  10 10  10  DG  G   H . n 
D 2 11 DA  11 11  11  DA  A   H . n 
D 2 12 DT  12 12  12  DT  T   H . n 
D 2 13 DA  13 13  13  DA  A   H . n 
D 2 14 DA  14 14  14  DA  A   H . n 
D 2 15 DT  15 15  15  DT  T   H . n 
D 2 16 DA  16 16  16  DA  A   H . n 
D 2 17 DG  17 17  17  DG  G   H . n 
D 2 18 DC  18 18  18  DC  C   H . n 
D 2 19 DG  19 19  19  DG  G   H . n 
D 2 20 DT  20 20  ?   ?   ?   H . n 
E 3 1  ARG 1  55  55  ARG ARG A . n 
E 3 2  LYS 2  56  56  LYS LYS A . n 
E 3 3  ARG 3  57  57  ARG ARG A . n 
E 3 4  ASN 4  58  58  ASN ASN A . n 
E 3 5  ARG 5  59  59  ARG ARG A . n 
E 3 6  ILE 6  60  60  ILE ILE A . n 
E 3 7  PRO 7  61  361 PRO PRO A . n 
E 3 8  LEU 8  62  62  LEU LEU A . n 
E 3 9  GLY 9  63  63  GLY GLY A . n 
E 3 10 CYS 10 64  64  CYS CYS A . n 
E 3 11 THR 11 65  65  THR THR A . n 
E 3 12 ILE 12 66  66  ILE ILE A . n 
E 3 13 CYS 13 67  67  CYS CYS A . n 
E 3 14 ARG 14 68  68  ARG ARG A . n 
E 3 15 LYS 15 69  69  LYS LYS A . n 
E 3 16 ARG 16 70  70  ARG ARG A . n 
E 3 17 LYS 17 71  71  LYS LYS A . n 
E 3 18 VAL 18 72  72  VAL VAL A . n 
E 3 19 LYS 19 73  73  LYS LYS A . n 
E 3 20 CYS 20 74  74  CYS CYS A . n 
E 3 21 ASP 21 75  75  ASP ASP A . n 
E 3 22 LYS 22 76  76  LYS LYS A . n 
E 3 23 LEU 23 77  77  LEU LEU A . n 
E 3 24 ARG 24 78  78  ARG ARG A . n 
E 3 25 PRO 25 79  79  PRO PRO A . n 
E 3 26 HIS 26 80  80  HIS HIS A . n 
E 3 27 CYS 27 81  81  CYS CYS A . n 
E 3 28 GLN 28 82  82  GLN GLN A . n 
E 3 29 GLN 29 83  83  GLN GLN A . n 
E 3 30 CYS 30 84  84  CYS CYS A . n 
E 3 31 THR 31 85  85  THR THR A . n 
E 3 32 LYS 32 86  86  LYS LYS A . n 
E 3 33 THR 33 87  87  THR THR A . n 
E 3 34 GLY 34 88  88  GLY GLY A . n 
E 3 35 VAL 35 89  89  VAL VAL A . n 
E 3 36 ALA 36 90  90  ALA ALA A . n 
E 3 37 HIS 37 91  91  HIS HIS A . n 
E 3 38 LEU 38 92  92  LEU LEU A . n 
E 3 39 CYS 39 93  93  CYS CYS A . n 
E 3 40 HIS 40 94  94  HIS HIS A . n 
E 3 41 TYR 41 95  95  TYR TYR A . n 
E 3 42 MET 42 96  96  MET MET A . n 
E 3 43 GLU 43 97  97  GLU GLU A . n 
E 3 44 GLN 44 98  98  GLN GLN A . n 
E 3 45 THR 45 99  99  THR THR A . n 
E 3 46 TRP 46 100 100 TRP TRP A . n 
E 3 47 ALA 47 101 101 ALA ALA A . n 
E 3 48 GLU 48 102 102 GLU GLU A . n 
E 3 49 GLU 49 103 103 GLU GLU A . n 
E 3 50 ALA 50 104 104 ALA ALA A . n 
E 3 51 GLU 51 105 105 GLU GLU A . n 
E 3 52 LYS 52 106 106 LYS LYS A . n 
E 3 53 GLU 53 107 107 GLU GLU A . n 
E 3 54 LEU 54 108 108 LEU LEU A . n 
E 3 55 LEU 55 109 109 LEU LEU A . n 
E 3 56 LYS 56 110 110 LYS LYS A . n 
E 3 57 ASP 57 111 111 ASP ASP A . n 
E 3 58 ASN 58 112 112 ASN ASN A . n 
E 3 59 GLU 59 113 113 GLU GLU A . n 
E 3 60 LEU 60 114 114 LEU LEU A . n 
E 3 61 LYS 61 115 115 LYS LYS A . n 
E 3 62 LYS 62 116 116 LYS LYS A . n 
E 3 63 LEU 63 117 117 LEU LEU A . n 
E 3 64 ARG 64 118 118 ARG ARG A . n 
E 3 65 GLU 65 119 119 GLU GLU A . n 
E 3 66 ARG 66 120 120 ARG ARG A . n 
E 3 67 VAL 67 121 121 VAL VAL A . n 
E 3 68 LYS 68 122 122 LYS LYS A . n 
E 3 69 SER 69 123 123 SER SER A . n 
E 3 70 LEU 70 124 124 LEU LEU A . n 
E 3 71 GLU 71 125 125 GLU GLU A . n 
E 3 72 LYS 72 126 126 LYS LYS A . n 
E 3 73 THR 73 127 127 THR THR A . n 
E 3 74 LEU 74 128 128 LEU LEU A . n 
E 3 75 SER 75 129 129 SER SER A . n 
E 3 76 LYS 76 130 130 LYS LYS A . n 
F 3 1  ARG 1  55  ?   ?   ?   B . n 
F 3 2  LYS 2  56  56  LYS LYS B . n 
F 3 3  ARG 3  57  57  ARG ARG B . n 
F 3 4  ASN 4  58  58  ASN ASN B . n 
F 3 5  ARG 5  59  59  ARG ARG B . n 
F 3 6  ILE 6  60  60  ILE ILE B . n 
F 3 7  PRO 7  61  61  PRO PRO B . n 
F 3 8  LEU 8  62  62  LEU LEU B . n 
F 3 9  GLY 9  63  63  GLY GLY B . n 
F 3 10 CYS 10 64  64  CYS CYS B . n 
F 3 11 THR 11 65  65  THR THR B . n 
F 3 12 ILE 12 66  66  ILE ILE B . n 
F 3 13 CYS 13 67  67  CYS CYS B . n 
F 3 14 ARG 14 68  68  ARG ARG B . n 
F 3 15 LYS 15 69  69  LYS LYS B . n 
F 3 16 ARG 16 70  70  ARG ARG B . n 
F 3 17 LYS 17 71  71  LYS LYS B . n 
F 3 18 VAL 18 72  72  VAL VAL B . n 
F 3 19 LYS 19 73  73  LYS LYS B . n 
F 3 20 CYS 20 74  74  CYS CYS B . n 
F 3 21 ASP 21 75  75  ASP ASP B . n 
F 3 22 LYS 22 76  76  LYS LYS B . n 
F 3 23 LEU 23 77  77  LEU LEU B . n 
F 3 24 ARG 24 78  78  ARG ARG B . n 
F 3 25 PRO 25 79  79  PRO PRO B . n 
F 3 26 HIS 26 80  80  HIS HIS B . n 
F 3 27 CYS 27 81  81  CYS CYS B . n 
F 3 28 GLN 28 82  82  GLN GLN B . n 
F 3 29 GLN 29 83  83  GLN GLN B . n 
F 3 30 CYS 30 84  84  CYS CYS B . n 
F 3 31 THR 31 85  85  THR THR B . n 
F 3 32 LYS 32 86  86  LYS LYS B . n 
F 3 33 THR 33 87  87  THR THR B . n 
F 3 34 GLY 34 88  88  GLY GLY B . n 
F 3 35 VAL 35 89  89  VAL VAL B . n 
F 3 36 ALA 36 90  90  ALA ALA B . n 
F 3 37 HIS 37 91  91  HIS HIS B . n 
F 3 38 LEU 38 92  92  LEU LEU B . n 
F 3 39 CYS 39 93  93  CYS CYS B . n 
F 3 40 HIS 40 94  94  HIS HIS B . n 
F 3 41 TYR 41 95  95  TYR TYR B . n 
F 3 42 MET 42 96  96  MET MET B . n 
F 3 43 GLU 43 97  97  GLU GLU B . n 
F 3 44 GLN 44 98  98  GLN GLN B . n 
F 3 45 THR 45 99  99  THR THR B . n 
F 3 46 TRP 46 100 100 TRP TRP B . n 
F 3 47 ALA 47 101 101 ALA ALA B . n 
F 3 48 GLU 48 102 102 GLU GLU B . n 
F 3 49 GLU 49 103 103 GLU GLU B . n 
F 3 50 ALA 50 104 104 ALA ALA B . n 
F 3 51 GLU 51 105 105 GLU GLU B . n 
F 3 52 LYS 52 106 106 LYS LYS B . n 
F 3 53 GLU 53 107 107 GLU GLU B . n 
F 3 54 LEU 54 108 108 LEU LEU B . n 
F 3 55 LEU 55 109 109 LEU LEU B . n 
F 3 56 LYS 56 110 110 LYS LYS B . n 
F 3 57 ASP 57 111 111 ASP ASP B . n 
F 3 58 ASN 58 112 112 ASN ASN B . n 
F 3 59 GLU 59 113 113 GLU GLU B . n 
F 3 60 LEU 60 114 114 LEU LEU B . n 
F 3 61 LYS 61 115 115 LYS LYS B . n 
F 3 62 LYS 62 116 116 LYS LYS B . n 
F 3 63 LEU 63 117 117 LEU LEU B . n 
F 3 64 ARG 64 118 118 ARG ARG B . n 
F 3 65 GLU 65 119 119 GLU GLU B . n 
F 3 66 ARG 66 120 120 ARG ARG B . n 
F 3 67 VAL 67 121 121 VAL VAL B . n 
F 3 68 LYS 68 122 122 LYS LYS B . n 
F 3 69 SER 69 123 123 SER SER B . n 
F 3 70 LEU 70 124 124 LEU LEU B . n 
F 3 71 GLU 71 125 125 GLU GLU B . n 
F 3 72 LYS 72 126 126 LYS LYS B . n 
F 3 73 THR 73 127 127 THR THR B . n 
F 3 74 LEU 74 128 128 LEU LEU B . n 
F 3 75 SER 75 129 129 SER SER B . n 
F 3 76 LYS 76 130 ?   ?   ?   B . n 
G 3 1  ARG 1  55  ?   ?   ?   C . n 
G 3 2  LYS 2  56  ?   ?   ?   C . n 
G 3 3  ARG 3  57  ?   ?   ?   C . n 
G 3 4  ASN 4  58  58  ASN ASN C . n 
G 3 5  ARG 5  59  59  ARG ARG C . n 
G 3 6  ILE 6  60  60  ILE ILE C . n 
G 3 7  PRO 7  61  61  PRO PRO C . n 
G 3 8  LEU 8  62  62  LEU LEU C . n 
G 3 9  GLY 9  63  63  GLY GLY C . n 
G 3 10 CYS 10 64  64  CYS CYS C . n 
G 3 11 THR 11 65  65  THR THR C . n 
G 3 12 ILE 12 66  66  ILE ILE C . n 
G 3 13 CYS 13 67  67  CYS CYS C . n 
G 3 14 ARG 14 68  68  ARG ARG C . n 
G 3 15 LYS 15 69  69  LYS LYS C . n 
G 3 16 ARG 16 70  70  ARG ARG C . n 
G 3 17 LYS 17 71  71  LYS LYS C . n 
G 3 18 VAL 18 72  72  VAL VAL C . n 
G 3 19 LYS 19 73  73  LYS LYS C . n 
G 3 20 CYS 20 74  74  CYS CYS C . n 
G 3 21 ASP 21 75  75  ASP ASP C . n 
G 3 22 LYS 22 76  76  LYS LYS C . n 
G 3 23 LEU 23 77  77  LEU LEU C . n 
G 3 24 ARG 24 78  78  ARG ARG C . n 
G 3 25 PRO 25 79  79  PRO PRO C . n 
G 3 26 HIS 26 80  80  HIS HIS C . n 
G 3 27 CYS 27 81  81  CYS CYS C . n 
G 3 28 GLN 28 82  82  GLN GLN C . n 
G 3 29 GLN 29 83  83  GLN GLN C . n 
G 3 30 CYS 30 84  84  CYS CYS C . n 
G 3 31 THR 31 85  85  THR THR C . n 
G 3 32 LYS 32 86  86  LYS LYS C . n 
G 3 33 THR 33 87  87  THR THR C . n 
G 3 34 GLY 34 88  88  GLY GLY C . n 
G 3 35 VAL 35 89  89  VAL VAL C . n 
G 3 36 ALA 36 90  90  ALA ALA C . n 
G 3 37 HIS 37 91  91  HIS HIS C . n 
G 3 38 LEU 38 92  92  LEU LEU C . n 
G 3 39 CYS 39 93  93  CYS CYS C . n 
G 3 40 HIS 40 94  94  HIS HIS C . n 
G 3 41 TYR 41 95  95  TYR TYR C . n 
G 3 42 MET 42 96  96  MET MET C . n 
G 3 43 GLU 43 97  97  GLU GLU C . n 
G 3 44 GLN 44 98  98  GLN GLN C . n 
G 3 45 THR 45 99  99  THR THR C . n 
G 3 46 TRP 46 100 100 TRP TRP C . n 
G 3 47 ALA 47 101 101 ALA ALA C . n 
G 3 48 GLU 48 102 102 GLU GLU C . n 
G 3 49 GLU 49 103 103 GLU GLU C . n 
G 3 50 ALA 50 104 104 ALA ALA C . n 
G 3 51 GLU 51 105 105 GLU GLU C . n 
G 3 52 LYS 52 106 106 LYS LYS C . n 
G 3 53 GLU 53 107 107 GLU GLU C . n 
G 3 54 LEU 54 108 108 LEU LEU C . n 
G 3 55 LEU 55 109 109 LEU LEU C . n 
G 3 56 LYS 56 110 110 LYS LYS C . n 
G 3 57 ASP 57 111 111 ASP ASP C . n 
G 3 58 ASN 58 112 112 ASN ASN C . n 
G 3 59 GLU 59 113 113 GLU GLU C . n 
G 3 60 LEU 60 114 114 LEU LEU C . n 
G 3 61 LYS 61 115 115 LYS LYS C . n 
G 3 62 LYS 62 116 116 LYS LYS C . n 
G 3 63 LEU 63 117 117 LEU LEU C . n 
G 3 64 ARG 64 118 118 ARG ARG C . n 
G 3 65 GLU 65 119 119 GLU GLU C . n 
G 3 66 ARG 66 120 120 ARG ARG C . n 
G 3 67 VAL 67 121 121 VAL VAL C . n 
G 3 68 LYS 68 122 122 LYS LYS C . n 
G 3 69 SER 69 123 123 SER SER C . n 
G 3 70 LEU 70 124 124 LEU LEU C . n 
G 3 71 GLU 71 125 125 GLU GLU C . n 
G 3 72 LYS 72 126 126 LYS LYS C . n 
G 3 73 THR 73 127 127 THR THR C . n 
G 3 74 LEU 74 128 128 LEU LEU C . n 
G 3 75 SER 75 129 ?   ?   ?   C . n 
G 3 76 LYS 76 130 ?   ?   ?   C . n 
H 3 1  ARG 1  55  55  ARG ARG D . n 
H 3 2  LYS 2  56  56  LYS LYS D . n 
H 3 3  ARG 3  57  57  ARG ARG D . n 
H 3 4  ASN 4  58  58  ASN ASN D . n 
H 3 5  ARG 5  59  59  ARG ARG D . n 
H 3 6  ILE 6  60  60  ILE ILE D . n 
H 3 7  PRO 7  61  61  PRO PRO D . n 
H 3 8  LEU 8  62  62  LEU LEU D . n 
H 3 9  GLY 9  63  63  GLY GLY D . n 
H 3 10 CYS 10 64  64  CYS CYS D . n 
H 3 11 THR 11 65  65  THR THR D . n 
H 3 12 ILE 12 66  66  ILE ILE D . n 
H 3 13 CYS 13 67  67  CYS CYS D . n 
H 3 14 ARG 14 68  68  ARG ARG D . n 
H 3 15 LYS 15 69  69  LYS LYS D . n 
H 3 16 ARG 16 70  70  ARG ARG D . n 
H 3 17 LYS 17 71  71  LYS LYS D . n 
H 3 18 VAL 18 72  72  VAL VAL D . n 
H 3 19 LYS 19 73  73  LYS LYS D . n 
H 3 20 CYS 20 74  74  CYS CYS D . n 
H 3 21 ASP 21 75  75  ASP ASP D . n 
H 3 22 LYS 22 76  76  LYS LYS D . n 
H 3 23 LEU 23 77  77  LEU LEU D . n 
H 3 24 ARG 24 78  78  ARG ARG D . n 
H 3 25 PRO 25 79  79  PRO PRO D . n 
H 3 26 HIS 26 80  80  HIS HIS D . n 
H 3 27 CYS 27 81  81  CYS CYS D . n 
H 3 28 GLN 28 82  82  GLN GLN D . n 
H 3 29 GLN 29 83  83  GLN GLN D . n 
H 3 30 CYS 30 84  84  CYS CYS D . n 
H 3 31 THR 31 85  85  THR THR D . n 
H 3 32 LYS 32 86  86  LYS LYS D . n 
H 3 33 THR 33 87  87  THR THR D . n 
H 3 34 GLY 34 88  88  GLY GLY D . n 
H 3 35 VAL 35 89  89  VAL VAL D . n 
H 3 36 ALA 36 90  90  ALA ALA D . n 
H 3 37 HIS 37 91  91  HIS HIS D . n 
H 3 38 LEU 38 92  92  LEU LEU D . n 
H 3 39 CYS 39 93  93  CYS CYS D . n 
H 3 40 HIS 40 94  94  HIS HIS D . n 
H 3 41 TYR 41 95  95  TYR TYR D . n 
H 3 42 MET 42 96  96  MET MET D . n 
H 3 43 GLU 43 97  97  GLU GLU D . n 
H 3 44 GLN 44 98  98  GLN GLN D . n 
H 3 45 THR 45 99  99  THR THR D . n 
H 3 46 TRP 46 100 100 TRP TRP D . n 
H 3 47 ALA 47 101 101 ALA ALA D . n 
H 3 48 GLU 48 102 102 GLU GLU D . n 
H 3 49 GLU 49 103 103 GLU GLU D . n 
H 3 50 ALA 50 104 104 ALA ALA D . n 
H 3 51 GLU 51 105 105 GLU GLU D . n 
H 3 52 LYS 52 106 106 LYS LYS D . n 
H 3 53 GLU 53 107 107 GLU GLU D . n 
H 3 54 LEU 54 108 108 LEU LEU D . n 
H 3 55 LEU 55 109 109 LEU LEU D . n 
H 3 56 LYS 56 110 110 LYS LYS D . n 
H 3 57 ASP 57 111 111 ASP ASP D . n 
H 3 58 ASN 58 112 112 ASN ASN D . n 
H 3 59 GLU 59 113 113 GLU GLU D . n 
H 3 60 LEU 60 114 114 LEU LEU D . n 
H 3 61 LYS 61 115 115 LYS LYS D . n 
H 3 62 LYS 62 116 116 LYS LYS D . n 
H 3 63 LEU 63 117 117 LEU LEU D . n 
H 3 64 ARG 64 118 118 ARG ARG D . n 
H 3 65 GLU 65 119 119 GLU GLU D . n 
H 3 66 ARG 66 120 120 ARG ARG D . n 
H 3 67 VAL 67 121 121 VAL VAL D . n 
H 3 68 LYS 68 122 122 LYS LYS D . n 
H 3 69 SER 69 123 123 SER SER D . n 
H 3 70 LEU 70 124 124 LEU LEU D . n 
H 3 71 GLU 71 125 125 GLU GLU D . n 
H 3 72 LYS 72 126 126 LYS LYS D . n 
H 3 73 THR 73 127 127 THR THR D . n 
H 3 74 LEU 74 128 128 LEU LEU D . n 
H 3 75 SER 75 129 129 SER SER D . n 
H 3 76 LYS 76 130 ?   ?   ?   D . n 
I 4 ZN  1  131 98  ZN  ZN  A . 
J 4 ZN  1  132 99  ZN  ZN  A . 
K 4 ZN  1  131 100 ZN  ZN  B . 
L 4 ZN  1  132 101 ZN  ZN  B . 
M 4 ZN  1  133 106 ZN  ZN  B . 
N 4 ZN  1  131 102 ZN  ZN  C . 
O 4 ZN  1  132 103 ZN  ZN  C . 
P 4 ZN  1  131 104 ZN  ZN  D . 
Q 4 ZN  1  132 105 ZN  ZN  D . 
R 5 HOH 1  21  14  HOH WAT E . 
R 5 HOH 2  22  31  HOH WAT E . 
R 5 HOH 3  23  39  HOH WAT E . 
R 5 HOH 4  24  40  HOH WAT E . 
R 5 HOH 5  25  48  HOH WAT E . 
R 5 HOH 6  26  51  HOH WAT E . 
R 5 HOH 7  27  65  HOH WAT E . 
R 5 HOH 8  28  79  HOH WAT E . 
R 5 HOH 9  29  92  HOH WAT E . 
S 5 HOH 1  21  3   HOH WAT F . 
S 5 HOH 2  22  7   HOH WAT F . 
S 5 HOH 3  23  11  HOH WAT F . 
S 5 HOH 4  24  36  HOH WAT F . 
S 5 HOH 5  25  43  HOH WAT F . 
S 5 HOH 6  26  50  HOH WAT F . 
S 5 HOH 7  27  71  HOH WAT F . 
T 5 HOH 1  21  5   HOH WAT G . 
T 5 HOH 2  22  86  HOH WAT G . 
U 5 HOH 1  21  9   HOH WAT H . 
U 5 HOH 2  22  25  HOH WAT H . 
U 5 HOH 3  23  26  HOH WAT H . 
U 5 HOH 4  24  28  HOH WAT H . 
U 5 HOH 5  25  75  HOH WAT H . 
U 5 HOH 6  26  85  HOH WAT H . 
V 5 HOH 1  133 2   HOH WAT A . 
V 5 HOH 2  134 18  HOH WAT A . 
V 5 HOH 3  135 20  HOH WAT A . 
V 5 HOH 4  136 21  HOH WAT A . 
V 5 HOH 5  137 24  HOH WAT A . 
V 5 HOH 6  138 30  HOH WAT A . 
V 5 HOH 7  139 37  HOH WAT A . 
V 5 HOH 8  140 41  HOH WAT A . 
V 5 HOH 9  141 42  HOH WAT A . 
V 5 HOH 10 142 47  HOH WAT A . 
V 5 HOH 11 143 53  HOH WAT A . 
V 5 HOH 12 144 56  HOH WAT A . 
V 5 HOH 13 145 62  HOH WAT A . 
V 5 HOH 14 146 64  HOH WAT A . 
V 5 HOH 15 147 68  HOH WAT A . 
V 5 HOH 16 148 87  HOH WAT A . 
V 5 HOH 17 149 91  HOH WAT A . 
V 5 HOH 18 150 93  HOH WAT A . 
W 5 HOH 1  134 10  HOH WAT B . 
W 5 HOH 2  135 12  HOH WAT B . 
W 5 HOH 3  136 13  HOH WAT B . 
W 5 HOH 4  137 16  HOH WAT B . 
W 5 HOH 5  138 33  HOH WAT B . 
W 5 HOH 6  139 54  HOH WAT B . 
W 5 HOH 7  140 58  HOH WAT B . 
W 5 HOH 8  141 59  HOH WAT B . 
W 5 HOH 9  142 63  HOH WAT B . 
W 5 HOH 10 143 77  HOH WAT B . 
W 5 HOH 11 144 78  HOH WAT B . 
W 5 HOH 12 145 80  HOH WAT B . 
W 5 HOH 13 146 90  HOH WAT B . 
W 5 HOH 14 147 94  HOH WAT B . 
W 5 HOH 15 148 95  HOH WAT B . 
X 5 HOH 1  133 4   HOH WAT C . 
X 5 HOH 2  134 6   HOH WAT C . 
X 5 HOH 3  135 15  HOH WAT C . 
X 5 HOH 4  136 22  HOH WAT C . 
X 5 HOH 5  137 27  HOH WAT C . 
X 5 HOH 6  138 29  HOH WAT C . 
X 5 HOH 7  139 32  HOH WAT C . 
X 5 HOH 8  140 38  HOH WAT C . 
X 5 HOH 9  141 52  HOH WAT C . 
X 5 HOH 10 142 57  HOH WAT C . 
X 5 HOH 11 143 60  HOH WAT C . 
X 5 HOH 12 144 61  HOH WAT C . 
X 5 HOH 13 145 66  HOH WAT C . 
X 5 HOH 14 146 67  HOH WAT C . 
X 5 HOH 15 147 69  HOH WAT C . 
X 5 HOH 16 148 70  HOH WAT C . 
X 5 HOH 17 149 72  HOH WAT C . 
X 5 HOH 18 150 73  HOH WAT C . 
X 5 HOH 19 151 74  HOH WAT C . 
X 5 HOH 20 152 76  HOH WAT C . 
X 5 HOH 21 153 81  HOH WAT C . 
X 5 HOH 22 154 82  HOH WAT C . 
X 5 HOH 23 155 84  HOH WAT C . 
X 5 HOH 24 156 88  HOH WAT C . 
X 5 HOH 25 157 96  HOH WAT C . 
Y 5 HOH 1  133 8   HOH WAT D . 
Y 5 HOH 2  134 17  HOH WAT D . 
Y 5 HOH 3  135 19  HOH WAT D . 
Y 5 HOH 4  136 23  HOH WAT D . 
Y 5 HOH 5  137 34  HOH WAT D . 
Y 5 HOH 6  138 35  HOH WAT D . 
Y 5 HOH 7  139 44  HOH WAT D . 
Y 5 HOH 8  140 45  HOH WAT D . 
Y 5 HOH 9  141 46  HOH WAT D . 
Y 5 HOH 10 142 49  HOH WAT D . 
Y 5 HOH 11 143 55  HOH WAT D . 
Y 5 HOH 12 144 83  HOH WAT D . 
Y 5 HOH 13 145 89  HOH WAT D . 
Y 5 HOH 14 146 97  HOH WAT D . 
1 author_defined_assembly ? tetrameric 4 
2 author_defined_assembly ? tetrameric 4 
1 1 A,B,E,F,I,J,K,L,M,R,S,V,W 
2 1 C,D,G,H,N,O,P,Q,T,U,X,Y   
#                   1 
_pdbx_struct_oper_list.type                 'identity operation'                 1_555 
_pdbx_struct_oper_list.symmetry_operation   x,y,z 
_pdbx_struct_oper_list.matrix[1][1]         1.0000000000 
_pdbx_struct_oper_list.matrix[1][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[1][3]         0.0000000000 
_pdbx_struct_oper_list.vector[1]            0.0000000000 
_pdbx_struct_oper_list.matrix[2][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[2][2]         1.0000000000 
_pdbx_struct_oper_list.matrix[2][3]         0.0000000000 
_pdbx_struct_oper_list.vector[2]            0.0000000000 
_pdbx_struct_oper_list.matrix[3][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][3]         1.0000000000 
_pdbx_struct_oper_list.vector[3]            0.0000000000 
1  SG  ? E CYS 10 ? A CYS 64 ? 1_555 ZN ? I ZN . ? A ZN 131 ? 1_555 SG  ? E CYS 13 ? A CYS 67 ? 1_555 105.8 ? 
2  SG  ? E CYS 10 ? A CYS 64 ? 1_555 ZN ? I ZN . ? A ZN 131 ? 1_555 SG  ? E CYS 20 ? A CYS 74 ? 1_555 112.4 ? 
3  SG  ? E CYS 13 ? A CYS 67 ? 1_555 ZN ? I ZN . ? A ZN 131 ? 1_555 SG  ? E CYS 20 ? A CYS 74 ? 1_555 105.6 ? 
4  SG  ? E CYS 10 ? A CYS 64 ? 1_555 ZN ? I ZN . ? A ZN 131 ? 1_555 SG  ? E CYS 27 ? A CYS 81 ? 1_555 100.2 ? 
5  SG  ? E CYS 13 ? A CYS 67 ? 1_555 ZN ? I ZN . ? A ZN 131 ? 1_555 SG  ? E CYS 27 ? A CYS 81 ? 1_555 118.7 ? 
6  SG  ? E CYS 20 ? A CYS 74 ? 1_555 ZN ? I ZN . ? A ZN 131 ? 1_555 SG  ? E CYS 27 ? A CYS 81 ? 1_555 113.9 ? 
7  SG  ? E CYS 10 ? A CYS 64 ? 1_555 ZN ? J ZN . ? A ZN 132 ? 1_555 SG  ? E CYS 27 ? A CYS 81 ? 1_555 101.7 ? 
8  SG  ? E CYS 10 ? A CYS 64 ? 1_555 ZN ? J ZN . ? A ZN 132 ? 1_555 SG  ? E CYS 30 ? A CYS 84 ? 1_555 109.2 ? 
9  SG  ? E CYS 27 ? A CYS 81 ? 1_555 ZN ? J ZN . ? A ZN 132 ? 1_555 SG  ? E CYS 30 ? A CYS 84 ? 1_555 102.1 ? 
10 SG  ? E CYS 10 ? A CYS 64 ? 1_555 ZN ? J ZN . ? A ZN 132 ? 1_555 SG  ? E CYS 39 ? A CYS 93 ? 1_555 117.6 ? 
11 SG  ? E CYS 27 ? A CYS 81 ? 1_555 ZN ? J ZN . ? A ZN 132 ? 1_555 SG  ? E CYS 39 ? A CYS 93 ? 1_555 111.3 ? 
12 SG  ? E CYS 30 ? A CYS 84 ? 1_555 ZN ? J ZN . ? A ZN 132 ? 1_555 SG  ? E CYS 39 ? A CYS 93 ? 1_555 113.3 ? 
13 SG  ? F CYS 10 ? B CYS 64 ? 1_555 ZN ? K ZN . ? B ZN 131 ? 1_555 SG  ? F CYS 13 ? B CYS 67 ? 1_555 100.3 ? 
14 SG  ? F CYS 10 ? B CYS 64 ? 1_555 ZN ? K ZN . ? B ZN 131 ? 1_555 SG  ? F CYS 20 ? B CYS 74 ? 1_555 116.3 ? 
15 SG  ? F CYS 13 ? B CYS 67 ? 1_555 ZN ? K ZN . ? B ZN 131 ? 1_555 SG  ? F CYS 20 ? B CYS 74 ? 1_555 111.5 ? 
16 SG  ? F CYS 10 ? B CYS 64 ? 1_555 ZN ? K ZN . ? B ZN 131 ? 1_555 SG  ? F CYS 27 ? B CYS 81 ? 1_555 103.4 ? 
17 SG  ? F CYS 13 ? B CYS 67 ? 1_555 ZN ? K ZN . ? B ZN 131 ? 1_555 SG  ? F CYS 27 ? B CYS 81 ? 1_555 111.3 ? 
18 SG  ? F CYS 20 ? B CYS 74 ? 1_555 ZN ? K ZN . ? B ZN 131 ? 1_555 SG  ? F CYS 27 ? B CYS 81 ? 1_555 113.1 ? 
19 SG  ? F CYS 10 ? B CYS 64 ? 1_555 ZN ? L ZN . ? B ZN 132 ? 1_555 SG  ? F CYS 27 ? B CYS 81 ? 1_555 103.6 ? 
20 SG  ? F CYS 10 ? B CYS 64 ? 1_555 ZN ? L ZN . ? B ZN 132 ? 1_555 SG  ? F CYS 30 ? B CYS 84 ? 1_555 123.4 ? 
21 SG  ? F CYS 27 ? B CYS 81 ? 1_555 ZN ? L ZN . ? B ZN 132 ? 1_555 SG  ? F CYS 30 ? B CYS 84 ? 1_555 106.6 ? 
22 SG  ? F CYS 10 ? B CYS 64 ? 1_555 ZN ? L ZN . ? B ZN 132 ? 1_555 SG  ? F CYS 39 ? B CYS 93 ? 1_555 104.9 ? 
23 SG  ? F CYS 27 ? B CYS 81 ? 1_555 ZN ? L ZN . ? B ZN 132 ? 1_555 SG  ? F CYS 39 ? B CYS 93 ? 1_555 111.4 ? 
24 SG  ? F CYS 30 ? B CYS 84 ? 1_555 ZN ? L ZN . ? B ZN 132 ? 1_555 SG  ? F CYS 39 ? B CYS 93 ? 1_555 107.0 ? 
25 NE2 ? F HIS 26 ? B HIS 80 ? 1_555 ZN ? M ZN . ? B ZN 133 ? 1_555 ND1 ? F HIS 37 ? B HIS 91 ? 1_555 99.5  ? 
26 NE2 ? F HIS 26 ? B HIS 80 ? 1_555 ZN ? M ZN . ? B ZN 133 ? 1_555 NE2 ? H HIS 26 ? D HIS 80 ? 1_555 96.3  ? 
27 ND1 ? F HIS 37 ? B HIS 91 ? 1_555 ZN ? M ZN . ? B ZN 133 ? 1_555 NE2 ? H HIS 26 ? D HIS 80 ? 1_555 122.3 ? 
28 NE2 ? F HIS 26 ? B HIS 80 ? 1_555 ZN ? M ZN . ? B ZN 133 ? 1_555 ND1 ? H HIS 37 ? D HIS 91 ? 1_555 124.9 ? 
29 ND1 ? F HIS 37 ? B HIS 91 ? 1_555 ZN ? M ZN . ? B ZN 133 ? 1_555 ND1 ? H HIS 37 ? D HIS 91 ? 1_555 115.4 ? 
30 NE2 ? H HIS 26 ? D HIS 80 ? 1_555 ZN ? M ZN . ? B ZN 133 ? 1_555 ND1 ? H HIS 37 ? D HIS 91 ? 1_555 98.9  ? 
31 SG  ? G CYS 10 ? C CYS 64 ? 1_555 ZN ? N ZN . ? C ZN 131 ? 1_555 SG  ? G CYS 13 ? C CYS 67 ? 1_555 105.4 ? 
32 SG  ? G CYS 10 ? C CYS 64 ? 1_555 ZN ? N ZN . ? C ZN 131 ? 1_555 SG  ? G CYS 20 ? C CYS 74 ? 1_555 111.6 ? 
33 SG  ? G CYS 13 ? C CYS 67 ? 1_555 ZN ? N ZN . ? C ZN 131 ? 1_555 SG  ? G CYS 20 ? C CYS 74 ? 1_555 108.5 ? 
34 SG  ? G CYS 10 ? C CYS 64 ? 1_555 ZN ? N ZN . ? C ZN 131 ? 1_555 SG  ? G CYS 27 ? C CYS 81 ? 1_555 100.4 ? 
35 SG  ? G CYS 13 ? C CYS 67 ? 1_555 ZN ? N ZN . ? C ZN 131 ? 1_555 SG  ? G CYS 27 ? C CYS 81 ? 1_555 118.7 ? 
36 SG  ? G CYS 20 ? C CYS 74 ? 1_555 ZN ? N ZN . ? C ZN 131 ? 1_555 SG  ? G CYS 27 ? C CYS 81 ? 1_555 111.7 ? 
37 SG  ? G CYS 10 ? C CYS 64 ? 1_555 ZN ? O ZN . ? C ZN 132 ? 1_555 SG  ? G CYS 27 ? C CYS 81 ? 1_555 100.7 ? 
38 SG  ? G CYS 10 ? C CYS 64 ? 1_555 ZN ? O ZN . ? C ZN 132 ? 1_555 SG  ? G CYS 30 ? C CYS 84 ? 1_555 111.7 ? 
39 SG  ? G CYS 27 ? C CYS 81 ? 1_555 ZN ? O ZN . ? C ZN 132 ? 1_555 SG  ? G CYS 30 ? C CYS 84 ? 1_555 100.8 ? 
40 SG  ? G CYS 10 ? C CYS 64 ? 1_555 ZN ? O ZN . ? C ZN 132 ? 1_555 SG  ? G CYS 39 ? C CYS 93 ? 1_555 116.8 ? 
41 SG  ? G CYS 27 ? C CYS 81 ? 1_555 ZN ? O ZN . ? C ZN 132 ? 1_555 SG  ? G CYS 39 ? C CYS 93 ? 1_555 113.3 ? 
42 SG  ? G CYS 30 ? C CYS 84 ? 1_555 ZN ? O ZN . ? C ZN 132 ? 1_555 SG  ? G CYS 39 ? C CYS 93 ? 1_555 112.0 ? 
43 SG  ? H CYS 10 ? D CYS 64 ? 1_555 ZN ? P ZN . ? D ZN 131 ? 1_555 SG  ? H CYS 13 ? D CYS 67 ? 1_555 101.8 ? 
44 SG  ? H CYS 10 ? D CYS 64 ? 1_555 ZN ? P ZN . ? D ZN 131 ? 1_555 SG  ? H CYS 20 ? D CYS 74 ? 1_555 112.3 ? 
45 SG  ? H CYS 13 ? D CYS 67 ? 1_555 ZN ? P ZN . ? D ZN 131 ? 1_555 SG  ? H CYS 20 ? D CYS 74 ? 1_555 111.0 ? 
46 SG  ? H CYS 10 ? D CYS 64 ? 1_555 ZN ? P ZN . ? D ZN 131 ? 1_555 SG  ? H CYS 27 ? D CYS 81 ? 1_555 102.8 ? 
47 SG  ? H CYS 13 ? D CYS 67 ? 1_555 ZN ? P ZN . ? D ZN 131 ? 1_555 SG  ? H CYS 27 ? D CYS 81 ? 1_555 114.8 ? 
48 SG  ? H CYS 20 ? D CYS 74 ? 1_555 ZN ? P ZN . ? D ZN 131 ? 1_555 SG  ? H CYS 27 ? D CYS 81 ? 1_555 113.2 ? 
49 SG  ? H CYS 10 ? D CYS 64 ? 1_555 ZN ? Q ZN . ? D ZN 132 ? 1_555 SG  ? H CYS 27 ? D CYS 81 ? 1_555 102.4 ? 
50 SG  ? H CYS 10 ? D CYS 64 ? 1_555 ZN ? Q ZN . ? D ZN 132 ? 1_555 SG  ? H CYS 30 ? D CYS 84 ? 1_555 110.1 ? 
51 SG  ? H CYS 27 ? D CYS 81 ? 1_555 ZN ? Q ZN . ? D ZN 132 ? 1_555 SG  ? H CYS 30 ? D CYS 84 ? 1_555 111.6 ? 
52 SG  ? H CYS 10 ? D CYS 64 ? 1_555 ZN ? Q ZN . ? D ZN 132 ? 1_555 SG  ? H CYS 39 ? D CYS 93 ? 1_555 106.3 ? 
53 SG  ? H CYS 27 ? D CYS 81 ? 1_555 ZN ? Q ZN . ? D ZN 132 ? 1_555 SG  ? H CYS 39 ? D CYS 93 ? 1_555 106.4 ? 
54 SG  ? H CYS 30 ? D CYS 84 ? 1_555 ZN ? Q ZN . ? D ZN 132 ? 1_555 SG  ? H CYS 39 ? D CYS 93 ? 1_555 118.7 ? 
1 'Structure model' 1 0 2000-10-09 
2 'Structure model' 1 1 2008-04-27 
3 'Structure model' 1 2 2011-07-13 
4 'Structure model' 1 3 2021-11-03 
_pdbx_audit_revision_details.ordinal             1 
_pdbx_audit_revision_details.revision_ordinal    1 
_pdbx_audit_revision_details.data_content_type   'Structure model' 
_pdbx_audit_revision_details.provider            repository 
_pdbx_audit_revision_details.type                'Initial release' 
_pdbx_audit_revision_details.description         ? 
_pdbx_audit_revision_details.details             ? 
1 2 'Structure model' 'Version format compliance' 
2 3 'Structure model' 'Version format compliance' 
3 4 'Structure model' 'Database references'       
4 4 'Structure model' 'Derived calculations'      
1 4 'Structure model' database_2             
2 4 'Structure model' pdbx_struct_conn_angle 
3 4 'Structure model' struct_conn            
4 4 'Structure model' struct_ref_seq_dif     
5 4 'Structure model' struct_site            
1  4 'Structure model' '_database_2.pdbx_DOI'                        
2  4 'Structure model' '_database_2.pdbx_database_accession'         
3  4 'Structure model' '_pdbx_struct_conn_angle.ptnr1_auth_asym_id'  
4  4 'Structure model' '_pdbx_struct_conn_angle.ptnr1_auth_seq_id'   
5  4 'Structure model' '_pdbx_struct_conn_angle.ptnr1_label_asym_id' 
6  4 'Structure model' '_pdbx_struct_conn_angle.ptnr1_label_atom_id' 
7  4 'Structure model' '_pdbx_struct_conn_angle.ptnr1_label_seq_id'  
8  4 'Structure model' '_pdbx_struct_conn_angle.ptnr3_auth_asym_id'  
9  4 'Structure model' '_pdbx_struct_conn_angle.ptnr3_auth_seq_id'   
10 4 'Structure model' '_pdbx_struct_conn_angle.ptnr3_label_asym_id' 
11 4 'Structure model' '_pdbx_struct_conn_angle.ptnr3_label_atom_id' 
12 4 'Structure model' '_pdbx_struct_conn_angle.ptnr3_label_seq_id'  
13 4 'Structure model' '_pdbx_struct_conn_angle.value'               
14 4 'Structure model' '_struct_conn.pdbx_dist_value'                
15 4 'Structure model' '_struct_conn.ptnr1_auth_comp_id'             
16 4 'Structure model' '_struct_conn.ptnr1_auth_seq_id'              
17 4 'Structure model' '_struct_conn.ptnr1_label_asym_id'            
18 4 'Structure model' '_struct_conn.ptnr1_label_atom_id'            
19 4 'Structure model' '_struct_conn.ptnr1_label_comp_id'            
20 4 'Structure model' '_struct_conn.ptnr1_label_seq_id'             
21 4 'Structure model' '_struct_conn.ptnr2_auth_asym_id'             
22 4 'Structure model' '_struct_conn.ptnr2_auth_comp_id'             
23 4 'Structure model' '_struct_conn.ptnr2_auth_seq_id'              
24 4 'Structure model' '_struct_conn.ptnr2_label_asym_id'            
25 4 'Structure model' '_struct_conn.ptnr2_label_atom_id'            
26 4 'Structure model' '_struct_conn.ptnr2_label_comp_id'            
27 4 'Structure model' '_struct_conn.ptnr2_label_seq_id'             
28 4 'Structure model' '_struct_ref_seq_dif.details'                 
29 4 'Structure model' '_struct_site.pdbx_auth_asym_id'              
30 4 'Structure model' '_struct_site.pdbx_auth_comp_id'              
31 4 'Structure model' '_struct_site.pdbx_auth_seq_id'               
AMoRE     phasing          . ? 1 
CNS       refinement       . ? 2 
DENZO     'data reduction' . ? 3 
SCALEPACK 'data scaling'   . ? 4 
1 1 "O4'" F DC  2  ? ? "C1'" F DC  2  ? ? N1 F DC  2  ? ? 110.25 108.30 1.95 0.30 N 
2 1 "O4'" F DT  3  ? ? "C1'" F DT  3  ? ? N1 F DT  3  ? ? 111.00 108.30 2.70 0.30 N 
3 1 CA    B CYS 84 ? ? CB    B CYS 84 ? ? SG B CYS 84 ? ? 121.08 114.20 6.88 1.10 N 
1  1 SER A 129 ? ? 149.57  35.26   
2  1 ASN B 58  ? ? -113.42 60.51   
3  1 LYS B 71  ? ? 71.13   34.45   
4  1 LEU B 77  ? ? -49.16  152.14  
5  1 ALA B 90  ? ? -29.68  -59.67  
6  1 THR B 127 ? ? -56.54  3.46    
7  1 LYS C 76  ? ? 52.71   16.32   
8  1 LYS D 56  ? ? 61.24   109.46  
9  1 ARG D 57  ? ? -97.34  -156.00 
10 1 LYS D 71  ? ? 35.89   33.44   
11 1 VAL D 72  ? ? -98.97  -156.14 
12 1 CYS D 81  ? ? -50.36  171.43  
13 1 HIS D 91  ? ? -65.02  19.21   
14 1 TRP D 100 ? ? -66.09  18.82   
1 1 DG F 8  ? ? 0.057 'SIDE CHAIN' 
2 1 DA F 13 ? ? 0.053 'SIDE CHAIN' 
3 1 DA H 7  ? ? 0.054 'SIDE CHAIN' 
4 1 DA H 16 ? ? 0.066 'SIDE CHAIN' 
1 1 Y 1 B LEU 114 ? CD1 ? F LEU 60 CD1 
2 1 Y 1 B LEU 114 ? CD2 ? F LEU 60 CD2 
3 1 Y 1 D LEU 114 ? CD1 ? H LEU 60 CD1 
4 1 Y 1 D LEU 114 ? CD2 ? H LEU 60 CD2 
1  1 Y 1 H DA  1   ? D DA  1  
2  1 Y 1 H DC  2   ? D DC  2  
3  1 Y 1 H DT  20  ? D DT  20 
4  1 Y 1 B ARG 55  ? F ARG 1  
5  1 Y 1 B LYS 130 ? F LYS 76 
6  1 Y 1 C ARG 55  ? G ARG 1  
7  1 Y 1 C LYS 56  ? G LYS 2  
8  1 Y 1 C ARG 57  ? G ARG 3  
9  1 Y 1 C SER 129 ? G SER 75 
10 1 Y 1 C LYS 130 ? G LYS 76 
11 1 Y 1 D LYS 130 ? H LYS 76 
1QP9 'double helix'         
1QP9 'b-form double helix'  
1QP9 'mismatched base pair' 
1 A DA 1  1_555 B DT 20 1_555 0.064  0.104  -0.078 -13.371 1.428   -2.055  1  E_DA1:DT20_F  E 1  ? F 20 ? 20 1 
1 A DC 2  1_555 B DG 19 1_555 0.234  -0.114 0.743  -17.554 2.318   1.904   2  E_DC2:DG19_F  E 2  ? F 19 ? 19 1 
1 A DG 3  1_555 B DC 18 1_555 0.058  -0.202 0.427  -8.668  -19.078 -6.585  3  E_DG3:DC18_F  E 3  ? F 18 ? 19 1 
1 A DC 4  1_555 B DG 17 1_555 0.006  -0.054 -0.890 10.555  -0.946  0.249   4  E_DC4:DG17_F  E 4  ? F 17 ? 19 1 
1 A DT 5  1_555 B DA 16 1_555 0.068  -0.124 0.291  11.343  -12.257 4.218   5  E_DT5:DA16_F  E 5  ? F 16 ? 20 1 
1 A DA 6  1_555 B DT 15 1_555 0.266  0.221  0.020  6.221   -23.990 -8.359  6  E_DA6:DT15_F  E 6  ? F 15 ? 20 1 
1 A DT 7  1_555 B DA 14 1_555 -0.156 -0.163 0.097  -6.483  -6.629  1.477   7  E_DT7:DA14_F  E 7  ? F 14 ? 20 1 
1 A DT 8  1_555 B DA 13 1_555 0.058  -0.092 0.362  -2.989  -6.145  -3.433  8  E_DT8:DA13_F  E 8  ? F 13 ? 20 1 
1 A DA 9  1_555 B DT 12 1_555 -0.049 -0.052 -0.226 -15.009 6.489   3.932   9  E_DA9:DT12_F  E 9  ? F 12 ? 20 1 
1 A DT 10 1_555 B DA 11 1_555 -0.167 -0.007 0.256  -0.189  -8.936  -1.731  10 E_DT10:DA11_F E 10 ? F 11 ? 20 1 
1 A DC 11 1_555 B DG 10 1_555 0.303  -0.081 0.099  4.738   -2.329  1.229   11 E_DC11:DG10_F E 11 ? F 10 ? 19 1 
1 A DG 12 1_555 B DC 9  1_555 0.108  0.011  0.317  4.263   -10.445 -2.038  12 E_DG12:DC9_F  E 12 ? F 9  ? 19 1 
1 A DC 13 1_555 B DG 8  1_555 -0.059 -0.010 -0.401 -8.442  3.416   0.293   13 E_DC13:DG8_F  E 13 ? F 8  ? 19 1 
1 A DT 14 1_555 B DA 7  1_555 -0.085 -0.120 0.283  -2.323  -0.126  -6.225  14 E_DT14:DA7_F  E 14 ? F 7  ? 20 1 
1 A DA 15 1_555 B DT 6  1_555 -0.231 -0.265 -0.254 5.208   -7.434  7.510   15 E_DA15:DT6_F  E 15 ? F 6  ? 20 1 
1 A DT 16 1_555 B DA 5  1_555 0.187  0.032  -0.028 0.086   -4.608  5.600   16 E_DT16:DA5_F  E 16 ? F 5  ? 20 1 
1 A DT 17 1_555 B DA 4  1_555 -0.189 -0.008 -0.024 -5.860  -22.113 -3.469  17 E_DT17:DA4_F  E 17 ? F 4  ? 20 1 
1 A DA 18 1_555 B DT 3  1_555 0.026  -0.040 -0.113 -5.278  -1.857  2.390   18 E_DA18:DT3_F  E 18 ? F 3  ? 20 1 
1 A DG 19 1_555 B DC 2  1_555 -0.077 0.028  0.225  -8.655  -11.055 -0.031  19 E_DG19:DC2_F  E 19 ? F 2  ? 19 1 
1 A DT 20 1_555 B DA 1  1_555 -0.076 -0.138 -0.462 8.728   -10.159 -1.799  20 E_DT20:DA1_F  E 20 ? F 1  ? 20 1 
1 C DC 2  1_555 D DG 19 1_555 0.200  -0.042 0.510  -17.107 1.375   3.625   21 G_DC2:DG19_H  G 2  ? H 19 ? 19 1 
1 C DG 3  1_555 D DC 18 1_555 0.178  -0.091 0.128  8.161   -31.448 -1.390  22 G_DG3:DC18_H  G 3  ? H 18 ? 19 1 
1 C DC 4  1_555 D DG 17 1_555 0.117  -0.141 -1.259 14.971  -13.068 3.915   23 G_DC4:DG17_H  G 4  ? H 17 ? 19 1 
1 C DT 5  1_555 D DA 16 1_555 0.073  0.005  -0.423 17.756  -19.248 3.537   24 G_DT5:DA16_H  G 5  ? H 16 ? 20 1 
1 C DA 6  1_555 D DT 15 1_555 0.554  -0.030 0.874  16.999  -25.932 -14.227 25 G_DA6:DT15_H  G 6  ? H 15 ? 20 1 
1 C DT 7  1_555 D DA 14 1_555 -0.114 -0.157 0.256  -10.857 -23.885 -0.850  26 G_DT7:DA14_H  G 7  ? H 14 ? 20 1 
1 C DT 8  1_555 D DA 13 1_555 -0.006 -0.256 0.597  -1.235  -18.585 -2.387  27 G_DT8:DA13_H  G 8  ? H 13 ? 20 1 
1 C DA 9  1_555 D DT 12 1_555 0.008  -0.076 -0.902 -14.504 -2.729  2.658   28 G_DA9:DT12_H  G 9  ? H 12 ? 20 1 
1 C DT 10 1_555 D DA 11 1_555 0.060  0.008  0.302  1.314   -8.876  -1.464  29 G_DT10:DA11_H G 10 ? H 11 ? 20 1 
1 C DC 11 1_555 D DG 10 1_555 0.061  -0.031 0.156  -2.147  0.608   1.941   30 G_DC11:DG10_H G 11 ? H 10 ? 19 1 
1 C DG 12 1_555 D DC 9  1_555 -0.040 -0.087 0.402  -0.476  -19.708 -2.079  31 G_DG12:DC9_H  G 12 ? H 9  ? 19 1 
1 C DC 13 1_555 D DG 8  1_555 0.028  -0.143 -0.833 13.384  -2.342  -0.216  32 G_DC13:DG8_H  G 13 ? H 8  ? 19 1 
1 C DT 14 1_555 D DA 7  1_555 -0.054 0.128  0.049  2.817   -6.575  -3.890  33 G_DT14:DA7_H  G 14 ? H 7  ? 20 1 
1 C DA 15 1_555 D DT 6  1_555 0.147  -0.245 0.497  4.618   -9.021  3.110   34 G_DA15:DT6_H  G 15 ? H 6  ? 20 1 
1 C DT 16 1_555 D DA 5  1_555 -0.078 -0.111 0.370  5.211   -6.070  -0.807  35 G_DT16:DA5_H  G 16 ? H 5  ? 20 1 
1 C DT 17 1_555 D DA 4  1_555 0.060  -0.241 0.639  -2.276  -20.749 2.797   36 G_DT17:DA4_H  G 17 ? H 4  ? 20 1 
1 C DA 18 1_555 D DT 3  1_555 -0.101 -0.059 -0.880 -24.537 -6.602  4.049   37 G_DA18:DT3_H  G 18 ? H 3  ? 20 1 
1 A DA 1  1_555 B DT 20 1_555 A DC 2  1_555 B DG 19 1_555 0.672  0.026  3.533 -5.675  9.980   37.040 -1.269 -1.758 3.296 15.266  
8.681   38.719 1  EE_DA1DC2:DG19DT20_FF   E 1  ? F 20 ? E 2  ? F 19 ? 
1 A DC 2  1_555 B DG 19 1_555 A DG 3  1_555 B DC 18 1_555 -1.826 1.634  3.015 -3.023  -10.346 37.088 3.598  2.435  2.619 -15.860 
4.633   38.569 2  EE_DC2DG3:DC18DG19_FF   E 2  ? F 19 ? E 3  ? F 18 ? 
1 A DG 3  1_555 B DC 18 1_555 A DC 4  1_555 B DG 17 1_555 1.491  0.823  2.822 12.044  -10.245 38.813 2.123  -0.950 2.848 -14.696 
-17.277 41.795 3  EE_DG3DC4:DG17DC18_FF   E 3  ? F 18 ? E 4  ? F 17 ? 
1 A DC 4  1_555 B DG 17 1_555 A DT 5  1_555 B DA 16 1_555 -0.399 1.339  3.412 -5.204  20.207  24.926 -1.903 -0.393 3.524 39.194  
10.094  32.401 4  EE_DC4DT5:DA16DG17_FF   E 4  ? F 17 ? E 5  ? F 16 ? 
1 A DT 5  1_555 B DA 16 1_555 A DA 6  1_555 B DT 15 1_555 -0.975 1.165  3.474 -3.072  -13.977 49.936 2.301  0.902  3.116 -16.176 
3.555   51.819 5  EE_DT5DA6:DT15DA16_FF   E 5  ? F 16 ? E 6  ? F 15 ? 
1 A DA 6  1_555 B DT 15 1_555 A DT 7  1_555 B DA 14 1_555 0.745  0.303  3.551 0.186   -11.498 38.240 1.873  -1.070 3.330 -17.085 
-0.277  39.870 6  EE_DA6DT7:DA14DT15_FF   E 6  ? F 15 ? E 7  ? F 14 ? 
1 A DT 7  1_555 B DA 14 1_555 A DT 8  1_555 B DA 13 1_555 -0.072 -0.632 3.215 -0.420  2.125   31.065 -1.573 0.055  3.167 3.961   
0.782   31.138 7  EE_DT7DT8:DA13DA14_FF   E 7  ? F 14 ? E 8  ? F 13 ? 
1 A DT 8  1_555 B DA 13 1_555 A DA 9  1_555 B DT 12 1_555 0.580  1.416  3.694 3.161   0.452   47.687 1.708  -0.431 3.735 0.558   
-3.904  47.787 8  EE_DT8DA9:DT12DA13_FF   E 8  ? F 13 ? E 9  ? F 12 ? 
1 A DA 9  1_555 B DT 12 1_555 A DT 10 1_555 B DA 11 1_555 -1.694 0.229  3.123 -3.056  -4.424  32.410 1.144  2.485  3.207 -7.858  
5.429   32.841 9  EE_DA9DT10:DA11DT12_FF  E 9  ? F 12 ? E 10 ? F 11 ? 
1 A DT 10 1_555 B DA 11 1_555 A DC 11 1_555 B DG 10 1_555 1.096  2.079  3.312 5.989   5.757   38.365 2.352  -0.858 3.697 8.638   
-8.985  39.221 10 EE_DT10DC11:DG10DA11_FF E 10 ? F 11 ? E 11 ? F 10 ? 
1 A DC 11 1_555 B DG 10 1_555 A DG 12 1_555 B DC 9  1_555 -1.289 1.432  3.375 -7.179  2.726   36.376 1.852  0.984  3.649 4.308   
11.345  37.150 11 EE_DC11DG12:DC9DG10_FF  E 11 ? F 10 ? E 12 ? F 9  ? 
1 A DG 12 1_555 B DC 9  1_555 A DC 13 1_555 B DG 8  1_555 1.241  0.166  3.645 3.931   -1.276  40.292 0.401  -1.296 3.738 -1.847  
-5.689  40.494 12 EE_DG12DC13:DG8DC9_FF   E 12 ? F 9  ? E 13 ? F 8  ? 
1 A DC 13 1_555 B DG 8  1_555 A DT 14 1_555 B DA 7  1_555 -1.446 -0.339 3.465 -4.957  0.336   26.226 -0.830 1.712  3.666 0.732   
10.800  26.684 13 EE_DC13DT14:DA7DG8_FF   E 13 ? F 8  ? E 14 ? F 7  ? 
1 A DT 14 1_555 B DA 7  1_555 A DA 15 1_555 B DT 6  1_555 0.845  -0.542 3.041 6.444   6.068   33.442 -1.794 -0.486 3.006 10.323  
-10.962 34.561 14 EE_DT14DA15:DT6DA7_FF   E 14 ? F 7  ? E 15 ? F 6  ? 
1 A DA 15 1_555 B DT 6  1_555 A DT 16 1_555 B DA 5  1_555 0.128  -0.627 3.338 -2.235  4.262   32.113 -1.875 -0.623 3.215 7.651   
4.011   32.462 15 EE_DA15DT16:DA5DT6_FF   E 15 ? F 6  ? E 16 ? F 5  ? 
1 A DT 16 1_555 B DA 5  1_555 A DT 17 1_555 B DA 4  1_555 -0.819 -0.401 3.332 2.624   3.823   36.077 -1.177 1.678  3.209 6.142   
-4.215  36.364 16 EE_DT16DT17:DA4DA5_FF   E 16 ? F 5  ? E 17 ? F 4  ? 
1 A DT 17 1_555 B DA 4  1_555 A DA 18 1_555 B DT 3  1_555 1.459  0.763  3.273 0.239   -2.382  41.899 1.312  -2.013 3.235 -3.327  
-0.334  41.964 17 EE_DT17DA18:DT3DA4_FF   E 17 ? F 4  ? E 18 ? F 3  ? 
1 A DA 18 1_555 B DT 3  1_555 A DG 19 1_555 B DC 2  1_555 -1.984 0.407  3.205 -8.169  11.638  34.413 -1.024 1.946  3.522 18.712  
13.135  37.152 18 EE_DA18DG19:DC2DT3_FF   E 18 ? F 3  ? E 19 ? F 2  ? 
1 A DG 19 1_555 B DC 2  1_555 A DT 20 1_555 B DA 1  1_555 -0.348 -0.115 2.843 5.536   2.594   28.659 -0.709 1.714  2.709 5.165   
-11.026 29.290 19 EE_DG19DT20:DA1DC2_FF   E 19 ? F 2  ? E 20 ? F 1  ? 
1 C DC 2  1_555 D DG 19 1_555 C DG 3  1_555 D DC 18 1_555 -1.636 2.058  2.523 0.304   -2.943  37.307 3.496  2.580  2.347 -4.591  
-0.474  37.420 20 GG_DC2DG3:DC18DG19_HH   G 2  ? H 19 ? G 3  ? H 18 ? 
1 C DG 3  1_555 D DC 18 1_555 C DC 4  1_555 D DG 17 1_555 2.061  1.691  3.143 14.064  -7.705  39.682 3.117  -1.386 3.291 -10.830 
-19.768 42.678 21 GG_DG3DC4:DG17DC18_HH   G 3  ? H 18 ? G 4  ? H 17 ? 
1 C DC 4  1_555 D DG 17 1_555 C DT 5  1_555 D DA 16 1_555 -0.913 1.497  3.356 -1.140  8.968   29.260 0.885  1.482  3.675 17.241  
2.192   30.595 22 GG_DC4DT5:DA16DG17_HH   G 4  ? H 17 ? G 5  ? H 16 ? 
1 C DT 5  1_555 D DA 16 1_555 C DA 6  1_555 D DT 15 1_555 -0.478 0.777  3.283 -4.981  -5.435  48.700 1.340  0.201  3.215 -6.547  
6.000   49.222 23 GG_DT5DA6:DT15DA16_HH   G 5  ? H 16 ? G 6  ? H 15 ? 
1 C DA 6  1_555 D DT 15 1_555 C DT 7  1_555 D DA 14 1_555 0.847  -1.153 3.835 6.611   3.050   35.196 -2.386 -0.258 3.816 4.978   
-10.790 35.917 24 GG_DA6DT7:DA14DT15_HH   G 6  ? H 15 ? G 7  ? H 14 ? 
1 C DT 7  1_555 D DA 14 1_555 C DT 8  1_555 D DA 13 1_555 -0.490 -0.833 3.175 -9.720  -1.177  31.132 -1.280 -0.817 3.207 -2.128  
17.573  32.599 25 GG_DT7DT8:DA13DA14_HH   G 7  ? H 14 ? G 8  ? H 13 ? 
1 C DT 8  1_555 D DA 13 1_555 C DA 9  1_555 D DT 12 1_555 0.510  1.587  3.808 7.889   -5.352  45.411 2.539  0.122  3.643 -6.843  
-10.088 46.349 26 GG_DT8DA9:DT12DA13_HH   G 8  ? H 13 ? G 9  ? H 12 ? 
1 C DA 9  1_555 D DT 12 1_555 C DT 10 1_555 D DA 11 1_555 -1.478 0.480  3.017 -10.302 -0.779  32.504 0.942  0.899  3.307 -1.349  
17.851  34.064 27 GG_DA9DT10:DA11DT12_HH  G 9  ? H 12 ? G 10 ? H 11 ? 
1 C DT 10 1_555 D DA 11 1_555 C DC 11 1_555 D DG 10 1_555 0.689  2.057  3.676 4.213   7.215   38.027 2.043  -0.424 4.036 10.913  
-6.372  38.901 28 GG_DT10DC11:DG10DA11_HH G 10 ? H 11 ? G 11 ? H 10 ? 
1 C DC 11 1_555 D DG 10 1_555 C DG 12 1_555 D DC 9  1_555 -1.218 1.501  3.323 -8.346  -0.224  35.157 2.455  0.717  3.503 -0.365  
13.582  36.105 29 GG_DC11DG12:DC9DG10_HH  G 11 ? H 10 ? G 12 ? H 9  ? 
1 C DG 12 1_555 D DC 9  1_555 C DC 13 1_555 D DG 8  1_555 1.100  0.148  2.997 13.734  -7.051  37.930 0.968  -0.105 3.123 -10.341 
-20.141 40.844 30 GG_DG12DC13:DG8DC9_HH   G 12 ? H 9  ? G 13 ? H 8  ? 
1 C DC 13 1_555 D DG 8  1_555 C DT 14 1_555 D DA 7  1_555 -0.672 -0.345 3.737 -5.029  5.040   28.314 -1.950 0.071  3.684 10.102  
10.080  29.178 31 GG_DC13DT14:DA7DG8_HH   G 13 ? H 8  ? G 14 ? H 7  ? 
1 C DT 14 1_555 D DA 7  1_555 C DA 15 1_555 D DT 6  1_555 0.509  0.123  3.141 -1.503  -3.978  41.178 0.581  -0.874 3.097 -5.637  
2.131   41.387 32 GG_DT14DA15:DT6DA7_HH   G 14 ? H 7  ? G 15 ? H 6  ? 
1 C DA 15 1_555 D DT 6  1_555 C DT 16 1_555 D DA 5  1_555 0.013  -1.463 3.261 -0.243  -6.700  32.907 -1.389 -0.065 3.483 -11.676 
0.424   33.565 33 GG_DA15DT16:DA5DT6_HH   G 15 ? H 6  ? G 16 ? H 5  ? 
1 C DT 16 1_555 D DA 5  1_555 C DT 17 1_555 D DA 4  1_555 0.275  -0.346 3.187 2.093   5.603   33.974 -1.426 -0.149 3.103 9.498   
-3.548  34.481 34 GG_DT16DT17:DA4DA5_HH   G 16 ? H 5  ? G 17 ? H 4  ? 
1 C DT 17 1_555 D DA 4  1_555 C DA 18 1_555 D DT 3  1_555 0.288  0.143  3.744 8.382   0.701   41.556 0.116  0.589  3.733 0.976   
-11.670 42.362 35 GG_DT17DA18:DT3DA4_HH   G 17 ? H 4  ? G 18 ? H 3  ? 
5 water      HOH 