#   1YSA 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.279 
PDB   1YSA         
RCSB  PDT002       
WWPDB D_1000177428 
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.entry_id                        1YSA 
_pdbx_database_status.recvd_initial_deposition_date   1993-08-09 
_pdbx_database_status.deposit_site                    BNL 
_pdbx_database_status.process_site                    BNL 
_pdbx_database_status.SG_entry                        . 
_pdbx_database_status.pdb_format_compatible           Y 
_pdbx_database_status.status_code_mr                  ? 
_pdbx_database_status.status_code_sf                  ? 
_pdbx_database_status.status_code_cs                  ? 
'Ellenberger, T.E.' 1 
'Brandl, C.J.'      2 
'Struhl, K.'        3 
'Harrison, S.C.'    4 
;The GCN4 basic region leucine zipper binds DNA as a dimer of uninterrupted alpha helices: crystal structure of the protein-DNA complex.
'Cell(Cambridge,Mass.)' 71  1223 1237 1992 CELLB5 US 0092-8674 0998 ? 1473154 '10.1016/S0092-8674(05)80070-4' 
1       'X-Ray Structure of the GCN4 Leucine Zipper, a Two-Stranded, Parallel Coiled Coil' Science                 254 539  ?    
1991 SCIEAS US 0036-8075 0038 ? ?       ?                               
primary 'Ellenberger, T.E.' 1 
primary 'Brandl, C.J.'      2 
primary 'Struhl, K.'        3 
primary 'Harrison, S.C.'    4 
;O'Shea, E.K.
1       'Klemm, J.D.'       6 
1       'Kim, P.S.'         7 
1       'Alber, T.'         8 
_cell.entry_id           1YSA 
_cell.length_a           49.130 
_cell.length_b           88.540 
_cell.length_c           59.240 
_cell.angle_alpha        90.00 
_cell.angle_beta         90.00 
_cell.angle_gamma        90.00 
_cell.Z_PDB              8 
_cell.pdbx_unique_axis   ? 
_symmetry.entry_id                         1YSA 
_symmetry.space_group_name_H-M             'P 21 21 21' 
_symmetry.pdbx_full_space_group_name_H-M   ? 
_symmetry.cell_setting                     ? 
_symmetry.Int_Tables_number                19 
1 polymer syn 
6034.915 1  ? ? ? ? 
2 polymer syn 
6231.067 1  ? ? ? ? 
3 polymer nat 'PROTEIN (GCN4)'                                                              6892.072 2  ? ? ? ? 
4 water   nat water                                                                         18.015   17 ? ? ? ? 
1 polydeoxyribonucleotide no no '(DT)(DT)(DC)(DC)(DT)(DA)(DT)(DG)(DA)(DC)(DT)(DC)(DA)(DT)(DC)(DC)(DA)(DG)(DT)(DT)' 
TTCCTATGACTCATCCAGTT                                       A   ? 
2 polydeoxyribonucleotide no no '(DA)(DA)(DA)(DC)(DT)(DG)(DG)(DA)(DT)(DG)(DA)(DG)(DT)(DC)(DA)(DT)(DA)(DG)(DG)(DA)' 
AAACTGGATGAGTCATAGGA                                       B   ? 
1 1  DT  n 
1 2  DT  n 
1 3  DC  n 
1 4  DC  n 
1 5  DT  n 
1 6  DA  n 
1 7  DT  n 
1 8  DG  n 
1 9  DA  n 
1 10 DC  n 
1 11 DT  n 
1 12 DC  n 
1 13 DA  n 
1 14 DT  n 
1 15 DC  n 
1 16 DC  n 
1 17 DA  n 
1 18 DG  n 
1 19 DT  n 
1 20 DT  n 
2 1  DA  n 
2 2  DA  n 
2 3  DA  n 
2 4  DC  n 
2 5  DT  n 
2 6  DG  n 
2 7  DG  n 
2 8  DA  n 
2 9  DT  n 
2 10 DG  n 
2 11 DA  n 
2 12 DG  n 
2 13 DT  n 
2 14 DC  n 
2 15 DA  n 
2 16 DT  n 
2 17 DA  n 
2 18 DG  n 
2 19 DG  n 
2 20 DA  n 
3 1  MET n 
3 2  LYS n 
3 3  ASP n 
3 4  PRO n 
3 5  ALA n 
3 6  ALA n 
3 7  LEU n 
3 8  LYS n 
3 9  ARG n 
3 10 ALA n 
3 11 ARG n 
3 12 ASN n 
3 13 THR n 
3 14 GLU n 
3 15 ALA n 
3 16 ALA n 
3 17 ARG n 
3 18 ARG n 
3 19 SER n 
3 20 ARG n 
3 21 ALA n 
3 22 ARG n 
3 23 LYS n 
3 24 LEU n 
3 25 GLN n 
3 26 ARG n 
3 27 MET n 
3 28 LYS n 
3 29 GLN n 
3 30 LEU n 
3 31 GLU n 
3 32 ASP n 
3 33 LYS n 
3 34 VAL n 
3 35 GLU n 
3 36 GLU n 
3 37 LEU n 
3 38 LEU n 
3 39 SER n 
3 40 LYS n 
3 41 ASN n 
3 42 TYR n 
3 43 HIS n 
3 44 LEU n 
3 45 GLU n 
3 46 ASN n 
3 47 GLU n 
3 48 VAL n 
3 49 ALA n 
3 50 ARG n 
3 51 LEU n 
3 52 LYS n 
3 53 LYS n 
3 54 LEU n 
3 55 VAL n 
3 56 GLY n 
3 57 GLU n 
3 58 ARG n 
_entity_src_nat.entity_id                  3 
_entity_src_nat.pdbx_src_id                1 
_entity_src_nat.pdbx_alt_source_flag       sample 
_entity_src_nat.pdbx_beg_seq_num           ? 
_entity_src_nat.pdbx_end_seq_num           ? 
;baker's yeast
_entity_src_nat.pdbx_organism_scientific   'Saccharomyces cerevisiae' 
_entity_src_nat.pdbx_ncbi_taxonomy_id      4932 
_entity_src_nat.genus                      Saccharomyces 
_entity_src_nat.species                    ? 
_entity_src_nat.strain                     ? 
_entity_src_nat.tissue                     ? 
_entity_src_nat.tissue_fraction            ? 
_entity_src_nat.pdbx_secretion             ? 
_entity_src_nat.pdbx_fragment              ? 
_entity_src_nat.pdbx_variant               ? 
_entity_src_nat.pdbx_cell_line             ? 
_entity_src_nat.pdbx_atcc                  ? 
_entity_src_nat.pdbx_cellular_location     ? 
_entity_src_nat.pdbx_organ                 ? 
_entity_src_nat.pdbx_organelle             ? 
_entity_src_nat.pdbx_cell                  ? 
_entity_src_nat.pdbx_plasmid_name          ? 
_entity_src_nat.pdbx_plasmid_details       ? 
_entity_src_nat.details                    ? 
1 UNP GCN4_YEAST 3 P03069 ? 226 ? 
2 PDB 1YSA       1 1YSA   ? ?   ? 
3 PDB 1YSA       2 1YSA   ? ?   ? 
1 1 1YSA C 3 ? 58 ? P03069 226 ? 281 ? 226 281 
2 1 1YSA D 3 ? 58 ? P03069 226 ? 281 ? 226 281 
3 2 1YSA A 1 ? 20 ? 1YSA   1   ? 20  ? 1   20  
4 3 1YSA B 1 ? 20 ? 1YSA   21  ? 40  ? 21  40  
ALA 'L-peptide linking' y ALANINE                              ? 'C3 H7 N O2'      89.093  
ARG 'L-peptide linking' y ARGININE                             ? 'C6 H15 N4 O2 1'  175.209 
ASN 'L-peptide linking' y ASPARAGINE                           ? 'C4 H8 N2 O3'     132.118 
ASP 'L-peptide linking' y 'ASPARTIC ACID'                      ? 'C4 H7 N O4'      133.103 
DA  'DNA linking'       y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 
DC  'DNA linking'       y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE"  ? 'C9 H14 N3 O7 P'  307.197 
DG  'DNA linking'       y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 
DT  'DNA linking'       y "THYMIDINE-5'-MONOPHOSPHATE"         ? 'C10 H15 N2 O8 P' 322.208 
GLN 'L-peptide linking' y GLUTAMINE                            ? 'C5 H10 N2 O3'    146.144 
GLU 'L-peptide linking' y 'GLUTAMIC ACID'                      ? 'C5 H9 N O4'      147.129 
GLY 'peptide linking'   y GLYCINE                              ? 'C2 H5 N O2'      75.067  
HIS 'L-peptide linking' y HISTIDINE                            ? 'C6 H10 N3 O2 1'  156.162 
HOH non-polymer         . WATER                                ? 'H2 O'            18.015  
LEU 'L-peptide linking' y LEUCINE                              ? 'C6 H13 N O2'     131.173 
LYS 'L-peptide linking' y LYSINE                               ? 'C6 H15 N2 O2 1'  147.195 
MET 'L-peptide linking' y METHIONINE                           ? 'C5 H11 N O2 S'   149.211 
PRO 'L-peptide linking' y PROLINE                              ? 'C5 H9 N O2'      115.130 
SER 'L-peptide linking' y SERINE                               ? 'C3 H7 N O3'      105.093 
THR 'L-peptide linking' y THREONINE                            ? 'C4 H9 N O3'      119.119 
TYR 'L-peptide linking' y TYROSINE                             ? 'C9 H11 N O3'     181.189 
VAL 'L-peptide linking' y VALINE                               ? 'C5 H11 N O2'     117.146 
_exptl.entry_id          1YSA 
_exptl.method            'X-RAY DIFFRACTION' 
_exptl.crystals_number   ? 
#                    1 
_exptl_crystal.density_meas          ? 
_exptl_crystal.density_Matthews      2.43 
_exptl_crystal.density_percent_sol   49.40 
_exptl_crystal.description           ? 
_exptl_crystal_grow.crystal_id      1 
_exptl_crystal_grow.method          'VAPOR DIFFUSION, HANGING DROP' 
_exptl_crystal_grow.temp            295.00 
_exptl_crystal_grow.temp_details    ? 
_exptl_crystal_grow.pH              5.75 
;pH 5.75, VAPOR DIFFUSION, HANGING DROP, temperature 295.00K

_exptl_crystal_grow.pdbx_pH_range   ? 
1 1  1 WATER        ? ? ? 
1 2  1 'PEG 400'    ? ? ? 
1 3  1 NACL         ? ? ? 
1 4  1 MGCL2        ? ? ? 
1 5  1 MES          ? ? ? 
1 6  1 SPERMINE_HCL ? ? ? 
1 7  2 WATER        ? ? ? 
1 8  2 'PEG 400'    ? ? ? 
1 9  3 WATER        ? ? ? 
1 10 3 'PEG 400'    ? ? ? 
#                     1 
_diffrn.ambient_temp           118.00 
_diffrn.ambient_temp_details   ? 
_diffrn.crystal_id             1 
_diffrn_detector.diffrn_id              1 
_diffrn_detector.detector               'AREA DETECTOR' 
_diffrn_detector.type                   SIEMENS-NICOLET 
_diffrn_detector.pdbx_collection_date   ? 
_diffrn_detector.details                ? 
_diffrn_radiation.diffrn_id                        1 
_diffrn_radiation.wavelength_id                    1 
_diffrn_radiation.pdbx_monochromatic_or_laue_m_l   M 
_diffrn_radiation.monochromator                    ? 
_diffrn_radiation.pdbx_diffrn_protocol             'SINGLE WAVELENGTH' 
_diffrn_radiation.pdbx_scattering_type             x-ray 
#           1 
_diffrn_radiation_wavelength.wavelength   . 
_diffrn_radiation_wavelength.wt           1.0 
_diffrn_source.diffrn_id                   1 
_diffrn_source.source                      'ROTATING ANODE' 
_diffrn_source.type                        'ELLIOTT GX-13' 
_diffrn_source.pdbx_synchrotron_site       ? 
_diffrn_source.pdbx_synchrotron_beamline   ? 
_diffrn_source.pdbx_wavelength             ? 
_diffrn_source.pdbx_wavelength_list        ? 
_reflns.entry_id                     1YSA 
_reflns.observed_criterion_sigma_I   ? 
_reflns.observed_criterion_sigma_F   1.500 
_reflns.d_resolution_low             8.000 
_reflns.d_resolution_high            2.900 
_reflns.number_obs                   5289 
_reflns.number_all                   ? 
_reflns.percent_possible_obs         96 
_reflns.pdbx_Rmerge_I_obs            0.099 
_reflns.pdbx_Rsym_value              ? 
_reflns.pdbx_netI_over_sigmaI        ? 
_reflns.B_iso_Wilson_estimate        ? 
_reflns.pdbx_redundancy              ? 
_reflns.R_free_details               ? 
_reflns.pdbx_diffrn_id               1 
_reflns.pdbx_ordinal                 1 
_refine.entry_id                                 1YSA 
_refine.ls_number_reflns_obs                     5289 
_refine.ls_number_reflns_all                     ? 
_refine.pdbx_ls_sigma_I                          ? 
_refine.pdbx_ls_sigma_F                          1.500 
_refine.pdbx_data_cutoff_high_absF               ? 
_refine.pdbx_data_cutoff_low_absF                ? 
_refine.pdbx_data_cutoff_high_rms_absF           ? 
_refine.ls_d_res_low                             8.000 
_refine.ls_d_res_high                            2.900 
_refine.ls_percent_reflns_obs                    ? 
_refine.ls_R_factor_obs                          0.23 
_refine.ls_R_factor_all                          ? 
_refine.ls_R_factor_R_work                       ? 
_refine.ls_R_factor_R_free                       ? 
_refine.ls_R_factor_R_free_error                 ? 
_refine.ls_R_factor_R_free_error_details         ? 
_refine.ls_percent_reflns_R_free                 ? 
_refine.ls_number_reflns_R_free                  ? 
_refine.ls_number_parameters                     ? 
_refine.ls_number_restraints                     ? 
_refine.occupancy_min                            ? 
_refine.occupancy_max                            ? 
_refine.B_iso_mean                               ? 
_refine.aniso_B[1][1]                            ? 
_refine.aniso_B[2][2]                            ? 
_refine.aniso_B[3][3]                            ? 
_refine.aniso_B[1][2]                            ? 
_refine.aniso_B[1][3]                            ? 
_refine.aniso_B[2][3]                            ? 
_refine.solvent_model_details                    ? 
_refine.solvent_model_param_ksol                 ? 
_refine.solvent_model_param_bsol                 ? 
_refine.pdbx_ls_cross_valid_method               ? 
_refine.details                                  ? 
_refine.pdbx_starting_model                      ? 
_refine.pdbx_method_to_determine_struct          ? 
_refine.pdbx_isotropic_thermal_model             ? 
_refine.pdbx_stereochemistry_target_values       ? 
_refine.pdbx_stereochem_target_val_spec_case     ? 
_refine.pdbx_R_Free_selection_details            ? 
_refine.pdbx_overall_ESU_R                       ? 
_refine.pdbx_overall_ESU_R_Free                  ? 
_refine.overall_SU_ML                            ? 
_refine.overall_SU_B                             ? 
_refine.ls_redundancy_reflns_obs                 ? 
_refine.pdbx_refine_id                           'X-RAY DIFFRACTION' 
_refine.pdbx_diffrn_id                           1 
_refine.pdbx_TLS_residual_ADP_flag               ? 
_refine.correlation_coeff_Fo_to_Fc               ? 
_refine.correlation_coeff_Fo_to_Fc_free          ? 
_refine.pdbx_solvent_vdw_probe_radii             ? 
_refine.pdbx_solvent_ion_probe_radii             ? 
_refine.pdbx_solvent_shrinkage_radii             ? 
_refine.pdbx_overall_phase_error                 ? 
_refine.overall_SU_R_Cruickshank_DPI             ? 
_refine.pdbx_overall_SU_R_free_Cruickshank_DPI   ? 
_refine.pdbx_overall_SU_R_Blow_DPI               ? 
_refine.pdbx_overall_SU_R_free_Blow_DPI          ? 
_refine_hist.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_refine_hist.cycle_id                         LAST 
_refine_hist.pdbx_number_atoms_protein        941 
_refine_hist.pdbx_number_atoms_nucleic_acid   814 
_refine_hist.pdbx_number_atoms_ligand         0 
_refine_hist.number_atoms_solvent             17 
_refine_hist.number_atoms_total               1772 
_refine_hist.d_res_high                       2.900 
_refine_hist.d_res_low                        8.000 
t_bond_d           0.023 ? ? ? 'X-RAY DIFFRACTION' ? 
t_angle_deg        3.300 ? ? ? 'X-RAY DIFFRACTION' ? 
t_dihedral_angle_d ?     ? ? ? 'X-RAY DIFFRACTION' ? 
t_incorr_chiral_ct ?     ? ? ? 'X-RAY DIFFRACTION' ? 
t_pseud_angle      ?     ? ? ? 'X-RAY DIFFRACTION' ? 
t_trig_c_planes    ?     ? ? ? 'X-RAY DIFFRACTION' ? 
t_gen_planes       ?     ? ? ? 'X-RAY DIFFRACTION' ? 
t_it               ?     ? ? ? 'X-RAY DIFFRACTION' ? 
t_nbd              ?     ? ? ? 'X-RAY DIFFRACTION' ? 
_struct.entry_id                  1YSA 
_struct.pdbx_descriptor           'GCN4/DNA COMPLEX' 
_struct.pdbx_model_details        ? 
_struct.pdbx_CASP_flag            ? 
_struct.pdbx_model_type_details   ? 
_struct_keywords.entry_id        1YSA 
_struct_keywords.pdbx_keywords   TRANSCRIPTION/DNA 
A N N 1 ? 
B N N 2 ? 
C N N 3 ? 
D N N 3 ? 
E N N 4 ? 
F N N 4 ? 
G N N 4 ? 
H N N 4 ? 
#   1 
HELX_P HELX_P1 C1 ALA C 5 ? GLY C 56 ? ALA C 228 GLY C 279 1 ? 52 
HELX_P HELX_P2 D1 ALA D 5 ? GLY D 56 ? ALA D 228 GLY D 279 1 ? 52 
#          HELX_P 
_struct_conf_type.criteria    ? 
_struct_conf_type.reference   ? 
hydrog1  hydrog ? ? A DT 2  N3 ? ? ? 1_555 B DA 20 N1 ? ? A DT 2  B DA 40 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog2  hydrog ? ? A DT 2  O4 ? ? ? 1_555 B DA 20 N6 ? ? A DT 2  B DA 40 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog3  hydrog ? ? A DC 3  N3 ? ? ? 1_555 B DG 19 N1 ? ? A DC 3  B DG 39 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog4  hydrog ? ? A DC 3  N4 ? ? ? 1_555 B DG 19 O6 ? ? A DC 3  B DG 39 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog5  hydrog ? ? A DC 3  O2 ? ? ? 1_555 B DG 19 N2 ? ? A DC 3  B DG 39 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog6  hydrog ? ? A DC 4  N3 ? ? ? 1_555 B DG 18 N1 ? ? A DC 4  B DG 38 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog7  hydrog ? ? A DC 4  N4 ? ? ? 1_555 B DG 18 O6 ? ? A DC 4  B DG 38 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog8  hydrog ? ? A DC 4  O2 ? ? ? 1_555 B DG 18 N2 ? ? A DC 4  B DG 38 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog9  hydrog ? ? A DT 5  N3 ? ? ? 1_555 B DA 17 N1 ? ? A DT 5  B DA 37 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog10 hydrog ? ? A DT 5  O4 ? ? ? 1_555 B DA 17 N6 ? ? A DT 5  B DA 37 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog11 hydrog ? ? A DA 6  N1 ? ? ? 1_555 B DT 16 N3 ? ? A DA 6  B DT 36 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog12 hydrog ? ? A DA 6  N6 ? ? ? 1_555 B DT 16 O4 ? ? A DA 6  B DT 36 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog13 hydrog ? ? A DT 7  N3 ? ? ? 1_555 B DA 15 N1 ? ? A DT 7  B DA 35 1_555 ? ? ? ? ? ? 'DT-DA PAIR'            ? ? 
hydrog14 hydrog ? ? A DG 8  N1 ? ? ? 1_555 B DC 14 N3 ? ? A DG 8  B DC 34 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog15 hydrog ? ? A DG 8  N2 ? ? ? 1_555 B DC 14 O2 ? ? A DG 8  B DC 34 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog16 hydrog ? ? A DG 8  O6 ? ? ? 1_555 B DC 14 N4 ? ? A DG 8  B DC 34 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog17 hydrog ? ? A DA 9  N1 ? ? ? 1_555 B DT 13 N3 ? ? A DA 9  B DT 33 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog18 hydrog ? ? A DA 9  N6 ? ? ? 1_555 B DT 13 O4 ? ? A DA 9  B DT 33 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog19 hydrog ? ? A DC 10 N3 ? ? ? 1_555 B DG 12 N1 ? ? A DC 10 B DG 32 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog20 hydrog ? ? A DC 10 N4 ? ? ? 1_555 B DG 12 O6 ? ? A DC 10 B DG 32 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog21 hydrog ? ? A DC 10 O2 ? ? ? 1_555 B DG 12 N2 ? ? A DC 10 B DG 32 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog22 hydrog ? ? A DT 11 N3 ? ? ? 1_555 B DA 11 N1 ? ? A DT 11 B DA 31 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog23 hydrog ? ? A DT 11 O4 ? ? ? 1_555 B DA 11 N6 ? ? A DT 11 B DA 31 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog24 hydrog ? ? A DC 12 N3 ? ? ? 1_555 B DG 10 N1 ? ? A DC 12 B DG 30 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog25 hydrog ? ? A DC 12 N4 ? ? ? 1_555 B DG 10 O6 ? ? A DC 12 B DG 30 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog26 hydrog ? ? A DC 12 O2 ? ? ? 1_555 B DG 10 N2 ? ? A DC 12 B DG 30 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog27 hydrog ? ? A DA 13 N1 ? ? ? 1_555 B DT 9  N3 ? ? A DA 13 B DT 29 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog28 hydrog ? ? A DA 13 N6 ? ? ? 1_555 B DT 9  O4 ? ? A DA 13 B DT 29 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog29 hydrog ? ? A DT 14 N3 ? ? ? 1_555 B DA 8  N1 ? ? A DT 14 B DA 28 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog30 hydrog ? ? A DT 14 O4 ? ? ? 1_555 B DA 8  N6 ? ? A DT 14 B DA 28 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog31 hydrog ? ? A DC 15 N3 ? ? ? 1_555 B DG 7  N1 ? ? A DC 15 B DG 27 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog32 hydrog ? ? A DC 15 N4 ? ? ? 1_555 B DG 7  O6 ? ? A DC 15 B DG 27 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog33 hydrog ? ? A DC 15 O2 ? ? ? 1_555 B DG 7  N2 ? ? A DC 15 B DG 27 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog34 hydrog ? ? A DC 16 N3 ? ? ? 1_555 B DG 6  N1 ? ? A DC 16 B DG 26 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog35 hydrog ? ? A DC 16 N4 ? ? ? 1_555 B DG 6  O6 ? ? A DC 16 B DG 26 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog36 hydrog ? ? A DC 16 O2 ? ? ? 1_555 B DG 6  N2 ? ? A DC 16 B DG 26 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog37 hydrog ? ? A DA 17 N1 ? ? ? 1_555 B DT 5  N3 ? ? A DA 17 B DT 25 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog38 hydrog ? ? A DA 17 N6 ? ? ? 1_555 B DT 5  O4 ? ? A DA 17 B DT 25 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog39 hydrog ? ? A DG 18 N1 ? ? ? 1_555 B DC 4  N3 ? ? A DG 18 B DC 24 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog40 hydrog ? ? A DG 18 N2 ? ? ? 1_555 B DC 4  O2 ? ? A DG 18 B DC 24 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog41 hydrog ? ? A DG 18 O6 ? ? ? 1_555 B DC 4  N4 ? ? A DG 18 B DC 24 1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog42 hydrog ? ? A DT 19 N3 ? ? ? 1_555 B DA 1  N1 ? ? A DT 19 B DA 21 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? 
hydrog43 hydrog ? ? A DT 19 O2 ? ? ? 1_555 B DA 1  N6 ? ? A DT 19 B DA 21 1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? 
#          hydrog 
_struct_conn_type.criteria    ? 
_struct_conn_type.reference   ? 
_database_PDB_matrix.entry_id          1YSA 
_database_PDB_matrix.origx[1][1]       1.000000 
_database_PDB_matrix.origx[1][2]       0.000000 
_database_PDB_matrix.origx[1][3]       0.000000 
_database_PDB_matrix.origx[2][1]       0.000000 
_database_PDB_matrix.origx[2][2]       1.000000 
_database_PDB_matrix.origx[2][3]       0.000000 
_database_PDB_matrix.origx[3][1]       0.000000 
_database_PDB_matrix.origx[3][2]       0.000000 
_database_PDB_matrix.origx[3][3]       1.000000 
_database_PDB_matrix.origx_vector[1]   0.00000 
_database_PDB_matrix.origx_vector[2]   0.00000 
_database_PDB_matrix.origx_vector[3]   0.00000 
_atom_sites.entry_id                    1YSA 
_atom_sites.fract_transf_matrix[1][1]   0.020354 
_atom_sites.fract_transf_matrix[1][2]   0.000000 
_atom_sites.fract_transf_matrix[1][3]   0.000000 
_atom_sites.fract_transf_matrix[2][1]   0.000000 
_atom_sites.fract_transf_matrix[2][2]   0.011294 
_atom_sites.fract_transf_matrix[2][3]   0.000000 
_atom_sites.fract_transf_matrix[3][1]   0.000000 
_atom_sites.fract_transf_matrix[3][2]   0.000000 
_atom_sites.fract_transf_matrix[3][3]   0.016880 
_atom_sites.fract_transf_vector[1]      0.00000 
_atom_sites.fract_transf_vector[2]      0.00000 
_atom_sites.fract_transf_vector[3]      0.00000 
#     1 
ATOM   1    O "O5'" . DT  A 1 1  ? 34.365  25.932  46.896  1.00 28.97 ? 1   DT  A "O5'" 1 
ATOM   2    C "C5'" . DT  A 1 1  ? 34.791  26.378  48.253  1.00 30.72 ? 1   DT  A "C5'" 1 
ATOM   3    C "C4'" . DT  A 1 1  ? 35.107  25.292  49.337  1.00 26.46 ? 1   DT  A "C4'" 1 
ATOM   4    O "O4'" . DT  A 1 1  ? 33.949  24.683  49.916  1.00 26.96 ? 1   DT  A "O4'" 1 
ATOM   5    C "C3'" . DT  A 1 1  ? 35.759  24.147  48.613  1.00 26.44 ? 1   DT  A "C3'" 1 
ATOM   6    O "O3'" . DT  A 1 1  ? 36.611  23.332  49.361  1.00 27.26 ? 1   DT  A "O3'" 1 
ATOM   7    C "C2'" . DT  A 1 1  ? 34.635  23.222  48.353  1.00 26.17 ? 1   DT  A "C2'" 1 
ATOM   8    C "C1'" . DT  A 1 1  ? 33.950  23.272  49.642  1.00 25.32 ? 1   DT  A "C1'" 1 
ATOM   9    N N1    . DT  A 1 1  ? 32.608  22.719  49.460  1.00 28.60 ? 1   DT  A N1    1 
ATOM   10   C C2    . DT  A 1 1  ? 32.410  21.317  49.664  1.00 30.86 ? 1   DT  A C2    1 
ATOM   11   O O2    . DT  A 1 1  ? 33.265  20.468  49.930  1.00 36.50 ? 1   DT  A O2    1 
ATOM   12   N N3    . DT  A 1 1  ? 31.137  20.857  49.517  1.00 27.30 ? 1   DT  A N3    1 
ATOM   13   C C4    . DT  A 1 1  ? 30.059  21.632  49.182  1.00 30.92 ? 1   DT  A C4    1 
ATOM   14   O O4    . DT  A 1 1  ? 28.975  21.071  49.079  1.00 37.98 ? 1   DT  A O4    1 
ATOM   15   C C5    . DT  A 1 1  ? 30.327  23.072  48.974  1.00 29.46 ? 1   DT  A C5    1 
ATOM   16   C C7    . DT  A 1 1  ? 29.202  24.049  48.543  1.00 23.87 ? 1   DT  A C7    1 
ATOM   17   C C6    . DT  A 1 1  ? 31.581  23.556  49.122  1.00 26.21 ? 1   DT  A C6    1 
ATOM   18   P P     . DT  A 1 2  ? 37.710  22.655  48.351  1.00 29.66 ? 2   DT  A P     1 
ATOM   19   O OP1   . DT  A 1 2  ? 38.843  22.139  49.186  1.00 25.36 ? 2   DT  A OP1   1 
ATOM   20   O OP2   . DT  A 1 2  ? 37.950  23.620  47.241  1.00 27.61 ? 2   DT  A OP2   1 
ATOM   21   O "O5'" . DT  A 1 2  ? 36.913  21.458  47.673  1.00 22.77 ? 2   DT  A "O5'" 1 
ATOM   22   C "C5'" . DT  A 1 2  ? 36.552  20.407  48.522  1.00 21.23 ? 2   DT  A "C5'" 1 
ATOM   23   C "C4'" . DT  A 1 2  ? 36.147  19.167  47.843  1.00 22.61 ? 2   DT  A "C4'" 1 
ATOM   24   O "O4'" . DT  A 1 2  ? 34.757  19.343  47.650  1.00 20.75 ? 2   DT  A "O4'" 1 
ATOM   25   C "C3'" . DT  A 1 2  ? 36.754  18.952  46.464  1.00 23.62 ? 2   DT  A "C3'" 1 
ATOM   26   O "O3'" . DT  A 1 2  ? 37.387  17.657  46.429  1.00 27.48 ? 2   DT  A "O3'" 1 
ATOM   27   C "C2'" . DT  A 1 2  ? 35.472  18.980  45.634  1.00 21.84 ? 2   DT  A "C2'" 1 
ATOM   28   C "C1'" . DT  A 1 2  ? 34.400  18.509  46.564  1.00 22.59 ? 2   DT  A "C1'" 1 
ATOM   29   N N1    . DT  A 1 2  ? 33.019  18.961  46.413  1.00 26.84 ? 2   DT  A N1    1 
ATOM   30   C C2    . DT  A 1 2  ? 31.956  18.055  46.504  1.00 26.55 ? 2   DT  A C2    1 
ATOM   31   O O2    . DT  A 1 2  ? 32.102  16.855  46.616  1.00 25.33 ? 2   DT  A O2    1 
ATOM   32   N N3    . DT  A 1 2  ? 30.680  18.554  46.449  1.00 23.45 ? 2   DT  A N3    1 
ATOM   33   C C4    . DT  A 1 2  ? 30.355  19.863  46.301  1.00 25.45 ? 2   DT  A C4    1 
ATOM   34   O O4    . DT  A 1 2  ? 29.194  20.234  46.280  1.00 25.30 ? 2   DT  A O4    1 
ATOM   35   C C5    . DT  A 1 2  ? 31.503  20.740  46.199  1.00 29.48 ? 2   DT  A C5    1 
ATOM   36   C C7    . DT  A 1 2  ? 31.300  22.229  45.957  1.00 30.97 ? 2   DT  A C7    1 
ATOM   37   C C6    . DT  A 1 2  ? 32.767  20.287  46.260  1.00 27.01 ? 2   DT  A C6    1 
ATOM   38   P P     . DC  A 1 3  ? 38.289  17.067  45.159  1.00 32.03 ? 3   DC  A P     1 
ATOM   39   O OP1   . DC  A 1 3  ? 39.412  16.191  45.632  1.00 29.47 ? 3   DC  A OP1   1 
ATOM   40   O OP2   . DC  A 1 3  ? 38.553  18.206  44.229  1.00 31.13 ? 3   DC  A OP2   1 
ATOM   41   O "O5'" . DC  A 1 3  ? 37.195  16.056  44.502  1.00 35.13 ? 3   DC  A "O5'" 1 
ATOM   42   C "C5'" . DC  A 1 3  ? 36.580  15.183  45.477  1.00 37.39 ? 3   DC  A "C5'" 1 
ATOM   43   C "C4'" . DC  A 1 3  ? 35.268  14.447  45.174  1.00 32.67 ? 3   DC  A "C4'" 1 
ATOM   44   O "O4'" . DC  A 1 3  ? 34.123  15.346  45.165  1.00 30.98 ? 3   DC  A "O4'" 1 
ATOM   45   C "C3'" . DC  A 1 3  ? 35.385  13.823  43.790  1.00 30.85 ? 3   DC  A "C3'" 1 
ATOM   46   O "O3'" . DC  A 1 3  ? 34.853  12.497  43.937  1.00 29.35 ? 3   DC  A "O3'" 1 
ATOM   47   C "C2'" . DC  A 1 3  ? 34.476  14.748  42.978  1.00 25.31 ? 3   DC  A "C2'" 1 
ATOM   48   C "C1'" . DC  A 1 3  ? 33.388  14.966  43.999  1.00 29.25 ? 3   DC  A "C1'" 1 
ATOM   49   N N1    . DC  A 1 3  ? 32.429  16.068  43.726  1.00 30.76 ? 3   DC  A N1    1 
ATOM   50   C C2    . DC  A 1 3  ? 31.066  15.808  44.006  1.00 30.78 ? 3   DC  A C2    1 
ATOM   51   O O2    . DC  A 1 3  ? 30.687  14.705  44.400  1.00 25.70 ? 3   DC  A O2    1 
ATOM   52   N N3    . DC  A 1 3  ? 30.135  16.810  43.818  1.00 32.63 ? 3   DC  A N3    1 
ATOM   53   C C4    . DC  A 1 3  ? 30.538  18.014  43.384  1.00 30.04 ? 3   DC  A C4    1 
ATOM   54   N N4    . DC  A 1 3  ? 29.614  18.948  43.241  1.00 27.67 ? 3   DC  A N4    1 
ATOM   55   C C5    . DC  A 1 3  ? 31.923  18.294  43.088  1.00 28.16 ? 3   DC  A C5    1 
ATOM   56   C C6    . DC  A 1 3  ? 32.829  17.301  43.276  1.00 29.36 ? 3   DC  A C6    1 
ATOM   57   P P     . DC  A 1 4  ? 35.299  11.349  42.903  1.00 29.85 ? 4   DC  A P     1 
ATOM   58   O OP1   . DC  A 1 4  ? 35.266  10.097  43.718  1.00 25.68 ? 4   DC  A OP1   1 
ATOM   59   O OP2   . DC  A 1 4  ? 36.519  11.748  42.123  1.00 30.81 ? 4   DC  A OP2   1 
ATOM   60   O "O5'" . DC  A 1 4  ? 34.087  11.465  41.843  1.00 23.54 ? 4   DC  A "O5'" 1 
ATOM   61   C "C5'" . DC  A 1 4  ? 32.868  11.159  42.429  1.00 23.19 ? 4   DC  A "C5'" 1 
ATOM   62   C "C4'" . DC  A 1 4  ? 31.768  10.826  41.500  1.00 23.92 ? 4   DC  A "C4'" 1 
ATOM   63   O "O4'" . DC  A 1 4  ? 30.800  11.912  41.638  1.00 21.59 ? 4   DC  A "O4'" 1 
ATOM   64   C "C3'" . DC  A 1 4  ? 32.262  10.595  40.080  1.00 22.10 ? 4   DC  A "C3'" 1 
ATOM   65   O "O3'" . DC  A 1 4  ? 31.428  9.571   39.518  1.00 24.40 ? 4   DC  A "O3'" 1 
ATOM   66   C "C2'" . DC  A 1 4  ? 31.860  11.986  39.664  1.00 24.96 ? 4   DC  A "C2'" 1 
ATOM   67   C "C1'" . DC  A 1 4  ? 30.564  12.434  40.396  1.00 20.42 ? 4   DC  A "C1'" 1 
ATOM   68   N N1    . DC  A 1 4  ? 30.458  13.924  40.383  1.00 14.68 ? 4   DC  A N1    1 
ATOM   69   C C2    . DC  A 1 4  ? 29.201  14.477  40.343  1.00 17.02 ? 4   DC  A C2    1 
ATOM   70   O O2    . DC  A 1 4  ? 28.183  13.821  40.499  1.00 18.80 ? 4   DC  A O2    1 
ATOM   71   N N3    . DC  A 1 4  ? 29.074  15.806  40.181  1.00 20.94 ? 4   DC  A N3    1 
ATOM   72   C C4    . DC  A 1 4  ? 30.168  16.576  40.075  1.00 24.03 ? 4   DC  A C4    1 
ATOM   73   N N4    . DC  A 1 4  ? 29.995  17.884  39.889  1.00 29.78 ? 4   DC  A N4    1 
ATOM   74   C C5    . DC  A 1 4  ? 31.490  16.040  40.136  1.00 15.40 ? 4   DC  A C5    1 
ATOM   75   C C6    . DC  A 1 4  ? 31.555  14.710  40.294  1.00 15.01 ? 4   DC  A C6    1 
ATOM   76   P P     . DT  A 1 5  ? 31.286  8.917   38.043  1.00 27.83 ? 5   DT  A P     1 
ATOM   77   O OP1   . DT  A 1 5  ? 31.425  7.450   38.257  1.00 30.64 ? 5   DT  A OP1   1 
ATOM   78   O OP2   . DT  A 1 5  ? 32.162  9.624   37.074  1.00 26.47 ? 5   DT  A OP2   1 
ATOM   79   O "O5'" . DT  A 1 5  ? 29.770  9.119   37.613  1.00 22.97 ? 5   DT  A "O5'" 1 
ATOM   80   C "C5'" . DT  A 1 5  ? 28.803  8.596   38.486  1.00 14.70 ? 5   DT  A "C5'" 1 
ATOM   81   C "C4'" . DT  A 1 5  ? 27.457  9.073   38.025  1.00 18.92 ? 5   DT  A "C4'" 1 
ATOM   82   O "O4'" . DT  A 1 5  ? 27.546  10.488  38.206  1.00 23.42 ? 5   DT  A "O4'" 1 
ATOM   83   C "C3'" . DT  A 1 5  ? 27.090  8.879   36.518  1.00 18.47 ? 5   DT  A "C3'" 1 
ATOM   84   O "O3'" . DT  A 1 5  ? 25.707  8.536   36.437  1.00 15.24 ? 5   DT  A "O3'" 1 
ATOM   85   C "C2'" . DT  A 1 5  ? 27.301  10.293  35.972  1.00 20.28 ? 5   DT  A "C2'" 1 
ATOM   86   C "C1'" . DT  A 1 5  ? 26.903  11.183  37.113  1.00 19.14 ? 5   DT  A "C1'" 1 
ATOM   87   N N1    . DT  A 1 5  ? 27.462  12.603  37.099  1.00 15.48 ? 5   DT  A N1    1 
ATOM   88   C C2    . DT  A 1 5  ? 26.528  13.582  37.243  1.00 16.89 ? 5   DT  A C2    1 
ATOM   89   O O2    . DT  A 1 5  ? 25.321  13.364  37.356  1.00 24.43 ? 5   DT  A O2    1 
ATOM   90   N N3    . DT  A 1 5  ? 26.985  14.864  37.257  1.00 15.82 ? 5   DT  A N3    1 
ATOM   91   C C4    . DT  A 1 5  ? 28.288  15.282  37.139  1.00 14.94 ? 5   DT  A C4    1 
ATOM   92   O O4    . DT  A 1 5  ? 28.615  16.467  37.190  1.00 11.98 ? 5   DT  A O4    1 
ATOM   93   C C5    . DT  A 1 5  ? 29.192  14.212  36.979  1.00 11.85 ? 5   DT  A C5    1 
ATOM   94   C C7    . DT  A 1 5  ? 30.623  14.645  36.745  1.00 12.83 ? 5   DT  A C7    1 
ATOM   95   C C6    . DT  A 1 5  ? 28.771  12.931  36.972  1.00 10.00 ? 5   DT  A C6    1 
ATOM   96   P P     . DA  A 1 6  ? 24.856  8.029   35.155  1.00 20.78 ? 6   DA  A P     1 
ATOM   97   O OP1   . DA  A 1 6  ? 23.888  6.967   35.505  1.00 16.97 ? 6   DA  A OP1   1 
ATOM   98   O OP2   . DA  A 1 6  ? 25.838  7.760   34.072  1.00 20.52 ? 6   DA  A OP2   1 
ATOM   99   O "O5'" . DA  A 1 6  ? 24.101  9.433   34.918  1.00 17.41 ? 6   DA  A "O5'" 1 
ATOM   100  C "C5'" . DA  A 1 6  ? 22.999  9.836   35.707  1.00 19.82 ? 6   DA  A "C5'" 1 
ATOM   101  C "C4'" . DA  A 1 6  ? 22.089  10.890  35.009  1.00 18.06 ? 6   DA  A "C4'" 1 
ATOM   102  O "O4'" . DA  A 1 6  ? 22.784  12.142  34.891  1.00 18.08 ? 6   DA  A "O4'" 1 
ATOM   103  C "C3'" . DA  A 1 6  ? 21.684  10.425  33.648  1.00 19.80 ? 6   DA  A "C3'" 1 
ATOM   104  O "O3'" . DA  A 1 6  ? 20.423  10.996  33.175  1.00 19.88 ? 6   DA  A "O3'" 1 
ATOM   105  C "C2'" . DA  A 1 6  ? 22.792  11.077  32.903  1.00 20.14 ? 6   DA  A "C2'" 1 
ATOM   106  C "C1'" . DA  A 1 6  ? 23.109  12.346  33.563  1.00 17.78 ? 6   DA  A "C1'" 1 
ATOM   107  N N9    . DA  A 1 6  ? 24.513  12.631  33.471  1.00 17.80 ? 6   DA  A N9    1 
ATOM   108  C C8    . DA  A 1 6  ? 25.577  11.811  33.419  1.00 22.61 ? 6   DA  A C8    1 
ATOM   109  N N7    . DA  A 1 6  ? 26.749  12.409  33.369  1.00 23.33 ? 6   DA  A N7    1 
ATOM   110  C C5    . DA  A 1 6  ? 26.385  13.726  33.394  1.00 19.76 ? 6   DA  A C5    1 
ATOM   111  C C6    . DA  A 1 6  ? 27.139  14.873  33.365  1.00 21.58 ? 6   DA  A C6    1 
ATOM   112  N N6    . DA  A 1 6  ? 28.466  14.869  33.320  1.00 25.90 ? 6   DA  A N6    1 
ATOM   113  N N1    . DA  A 1 6  ? 26.482  16.028  33.396  1.00 21.87 ? 6   DA  A N1    1 
ATOM   114  C C2    . DA  A 1 6  ? 25.145  16.001  33.455  1.00 22.49 ? 6   DA  A C2    1 
ATOM   115  N N3    . DA  A 1 6  ? 24.317  14.986  33.489  1.00 18.91 ? 6   DA  A N3    1 
ATOM   116  C C4    . DA  A 1 6  ? 25.033  13.859  33.454  1.00 19.43 ? 6   DA  A C4    1 
ATOM   117  P P     . DT  A 1 7  ? 19.843  10.651  31.642  1.00 22.88 ? 7   DT  A P     1 
ATOM   118  O OP1   . DT  A 1 7  ? 18.328  10.513  31.593  1.00 23.55 ? 7   DT  A OP1   1 
ATOM   119  O OP2   . DT  A 1 7  ? 20.774  9.651   31.041  1.00 21.28 ? 7   DT  A OP2   1 
ATOM   120  O "O5'" . DT  A 1 7  ? 20.159  12.153  31.050  1.00 19.46 ? 7   DT  A "O5'" 1 
ATOM   121  C "C5'" . DT  A 1 7  ? 19.630  13.223  31.731  1.00 14.98 ? 7   DT  A "C5'" 1 
ATOM   122  C "C4'" . DT  A 1 7  ? 19.865  14.563  31.026  1.00 17.48 ? 7   DT  A "C4'" 1 
ATOM   123  O "O4'" . DT  A 1 7  ? 21.240  14.977  31.217  1.00 16.33 ? 7   DT  A "O4'" 1 
ATOM   124  C "C3'" . DT  A 1 7  ? 19.537  14.464  29.529  1.00 14.69 ? 7   DT  A "C3'" 1 
ATOM   125  O "O3'" . DT  A 1 7  ? 18.768  15.635  29.233  1.00 19.50 ? 7   DT  A "O3'" 1 
ATOM   126  C "C2'" . DT  A 1 7  ? 20.955  14.507  28.951  1.00 13.75 ? 7   DT  A "C2'" 1 
ATOM   127  C "C1'" . DT  A 1 7  ? 21.743  15.387  29.926  1.00 15.25 ? 7   DT  A "C1'" 1 
ATOM   128  N N1    . DT  A 1 7  ? 23.190  15.123  29.935  1.00 15.47 ? 7   DT  A N1    1 
ATOM   129  C C2    . DT  A 1 7  ? 23.991  16.146  30.147  1.00 15.76 ? 7   DT  A C2    1 
ATOM   130  O O2    . DT  A 1 7  ? 23.582  17.277  30.238  1.00 23.37 ? 7   DT  A O2    1 
ATOM   131  N N3    . DT  A 1 7  ? 25.307  15.884  30.237  1.00 15.42 ? 7   DT  A N3    1 
ATOM   132  C C4    . DT  A 1 7  ? 25.903  14.667  30.124  1.00 18.37 ? 7   DT  A C4    1 
ATOM   133  O O4    . DT  A 1 7  ? 27.111  14.519  30.241  1.00 26.20 ? 7   DT  A O4    1 
ATOM   134  C C5    . DT  A 1 7  ? 25.006  13.611  29.890  1.00 19.92 ? 7   DT  A C5    1 
ATOM   135  C C7    . DT  A 1 7  ? 25.537  12.175  29.789  1.00 20.05 ? 7   DT  A C7    1 
ATOM   136  C C6    . DT  A 1 7  ? 23.693  13.872  29.802  1.00 21.53 ? 7   DT  A C6    1 
ATOM   137  P P     . DG  A 1 8  ? 18.389  16.125  27.795  1.00 25.07 ? 8   DG  A P     1 
ATOM   138  O OP1   . DG  A 1 8  ? 17.059  16.690  27.886  1.00 24.12 ? 8   DG  A OP1   1 
ATOM   139  O OP2   . DG  A 1 8  ? 18.565  15.010  26.810  1.00 21.43 ? 8   DG  A OP2   1 
ATOM   140  O "O5'" . DG  A 1 8  ? 19.295  17.413  27.521  1.00 19.26 ? 8   DG  A "O5'" 1 
ATOM   141  C "C5'" . DG  A 1 8  ? 18.860  18.747  27.854  1.00 12.21 ? 8   DG  A "C5'" 1 
ATOM   142  C "C4'" . DG  A 1 8  ? 19.748  20.000  27.586  1.00 10.57 ? 8   DG  A "C4'" 1 
ATOM   143  O "O4'" . DG  A 1 8  ? 21.102  19.767  28.091  1.00 13.17 ? 8   DG  A "O4'" 1 
ATOM   144  C "C3'" . DG  A 1 8  ? 19.967  20.256  26.134  1.00 12.21 ? 8   DG  A "C3'" 1 
ATOM   145  O "O3'" . DG  A 1 8  ? 20.135  21.663  25.950  1.00 12.88 ? 8   DG  A "O3'" 1 
ATOM   146  C "C2'" . DG  A 1 8  ? 21.227  19.510  25.842  1.00 13.33 ? 8   DG  A "C2'" 1 
ATOM   147  C "C1'" . DG  A 1 8  ? 22.077  19.683  27.053  1.00 12.76 ? 8   DG  A "C1'" 1 
ATOM   148  N N9    . DG  A 1 8  ? 22.941  18.506  27.035  1.00 11.69 ? 8   DG  A N9    1 
ATOM   149  C C8    . DG  A 1 8  ? 22.592  17.228  26.974  1.00 11.95 ? 8   DG  A C8    1 
ATOM   150  N N7    . DG  A 1 8  ? 23.594  16.395  26.922  1.00 15.93 ? 8   DG  A N7    1 
ATOM   151  C C5    . DG  A 1 8  ? 24.723  17.196  26.955  1.00 16.95 ? 8   DG  A C5    1 
ATOM   152  C C6    . DG  A 1 8  ? 26.158  16.868  26.963  1.00 22.16 ? 8   DG  A C6    1 
ATOM   153  O O6    . DG  A 1 8  ? 26.765  15.766  26.843  1.00 17.44 ? 8   DG  A O6    1 
ATOM   154  N N1    . DG  A 1 8  ? 26.900  18.043  27.060  1.00 19.46 ? 8   DG  A N1    1 
ATOM   155  C C2    . DG  A 1 8  ? 26.369  19.297  27.125  1.00 21.28 ? 8   DG  A C2    1 
ATOM   156  N N2    . DG  A 1 8  ? 27.194  20.322  27.223  1.00 19.89 ? 8   DG  A N2    1 
ATOM   157  N N3    . DG  A 1 8  ? 25.081  19.562  27.106  1.00 20.24 ? 8   DG  A N3    1 
ATOM   158  C C4    . DG  A 1 8  ? 24.307  18.489  27.027  1.00 14.63 ? 8   DG  A C4    1 
ATOM   159  P P     . DA  A 1 9  ? 19.929  22.431  24.586  1.00 18.41 ? 9   DA  A P     1 
ATOM   160  O OP1   . DA  A 1 9  ? 19.502  23.811  24.781  1.00 18.97 ? 9   DA  A OP1   1 
ATOM   161  O OP2   . DA  A 1 9  ? 19.325  21.579  23.570  1.00 21.42 ? 9   DA  A OP2   1 
ATOM   162  O "O5'" . DA  A 1 9  ? 21.445  22.500  24.233  1.00 19.99 ? 9   DA  A "O5'" 1 
ATOM   163  C "C5'" . DA  A 1 9  ? 22.158  23.479  24.983  1.00 23.35 ? 9   DA  A "C5'" 1 
ATOM   164  C "C4'" . DA  A 1 9  ? 23.627  23.603  24.653  1.00 24.56 ? 9   DA  A "C4'" 1 
ATOM   165  O "O4'" . DA  A 1 9  ? 24.353  22.359  24.981  1.00 28.12 ? 9   DA  A "O4'" 1 
ATOM   166  C "C3'" . DA  A 1 9  ? 23.792  23.761  23.164  1.00 22.54 ? 9   DA  A "C3'" 1 
ATOM   167  O "O3'" . DA  A 1 9  ? 24.864  24.501  22.798  1.00 20.67 ? 9   DA  A "O3'" 1 
ATOM   168  C "C2'" . DA  A 1 9  ? 24.238  22.357  22.712  1.00 20.68 ? 9   DA  A "C2'" 1 
ATOM   169  C "C1'" . DA  A 1 9  ? 25.040  21.808  23.836  1.00 25.48 ? 9   DA  A "C1'" 1 
ATOM   170  N N9    . DA  A 1 9  ? 24.979  20.328  23.758  1.00 21.59 ? 9   DA  A N9    1 
ATOM   171  C C8    . DA  A 1 9  ? 23.943  19.491  23.562  1.00 21.24 ? 9   DA  A C8    1 
ATOM   172  N N7    . DA  A 1 9  ? 24.268  18.217  23.502  1.00 21.44 ? 9   DA  A N7    1 
ATOM   173  C C5    . DA  A 1 9  ? 25.633  18.229  23.677  1.00 20.51 ? 9   DA  A C5    1 
ATOM   174  C C6    . DA  A 1 9  ? 26.620  17.213  23.720  1.00 22.43 ? 9   DA  A C6    1 
ATOM   175  N N6    . DA  A 1 9  ? 26.468  15.899  23.610  1.00 16.43 ? 9   DA  A N6    1 
ATOM   176  N N1    . DA  A 1 9  ? 27.864  17.633  23.907  1.00 23.83 ? 9   DA  A N1    1 
ATOM   177  C C2    . DA  A 1 9  ? 28.109  18.943  24.043  1.00 24.44 ? 9   DA  A C2    1 
ATOM   178  N N3    . DA  A 1 9  ? 27.296  19.968  24.025  1.00 23.03 ? 9   DA  A N3    1 
ATOM   179  C C4    . DA  A 1 9  ? 26.053  19.522  23.833  1.00 20.82 ? 9   DA  A C4    1 
ATOM   180  P P     . DC  A 1 10 ? 24.947  25.592  21.703  1.00 23.90 ? 10  DC  A P     1 
ATOM   181  O OP1   . DC  A 1 10 ? 25.397  26.932  22.156  1.00 20.50 ? 10  DC  A OP1   1 
ATOM   182  O OP2   . DC  A 1 10 ? 23.861  25.392  20.712  1.00 23.61 ? 10  DC  A OP2   1 
ATOM   183  O "O5'" . DC  A 1 10 ? 26.261  24.739  21.299  1.00 17.97 ? 10  DC  A "O5'" 1 
ATOM   184  C "C5'" . DC  A 1 10 ? 27.512  25.025  21.921  1.00 17.71 ? 10  DC  A "C5'" 1 
ATOM   185  C "C4'" . DC  A 1 10 ? 28.669  24.220  21.395  1.00 20.08 ? 10  DC  A "C4'" 1 
ATOM   186  O "O4'" . DC  A 1 10 ? 28.295  22.826  21.577  1.00 22.59 ? 10  DC  A "O4'" 1 
ATOM   187  C "C3'" . DC  A 1 10 ? 28.923  24.412  19.874  1.00 20.45 ? 10  DC  A "C3'" 1 
ATOM   188  O "O3'" . DC  A 1 10 ? 30.291  24.720  19.794  1.00 22.95 ? 10  DC  A "O3'" 1 
ATOM   189  C "C2'" . DC  A 1 10 ? 28.596  23.041  19.289  1.00 15.97 ? 10  DC  A "C2'" 1 
ATOM   190  C "C1'" . DC  A 1 10 ? 28.942  22.164  20.496  1.00 21.39 ? 10  DC  A "C1'" 1 
ATOM   191  N N1    . DC  A 1 10 ? 28.387  20.799  20.517  1.00 19.30 ? 10  DC  A N1    1 
ATOM   192  C C2    . DC  A 1 10 ? 29.210  19.684  20.780  1.00 23.80 ? 10  DC  A C2    1 
ATOM   193  O O2    . DC  A 1 10 ? 30.425  19.732  21.012  1.00 28.01 ? 10  DC  A O2    1 
ATOM   194  N N3    . DC  A 1 10 ? 28.664  18.448  20.796  1.00 23.36 ? 10  DC  A N3    1 
ATOM   195  C C4    . DC  A 1 10 ? 27.398  18.302  20.574  1.00 20.57 ? 10  DC  A C4    1 
ATOM   196  N N4    . DC  A 1 10 ? 26.911  17.082  20.612  1.00 19.19 ? 10  DC  A N4    1 
ATOM   197  C C5    . DC  A 1 10 ? 26.567  19.412  20.312  1.00 23.26 ? 10  DC  A C5    1 
ATOM   198  C C6    . DC  A 1 10 ? 27.113  20.638  20.294  1.00 18.31 ? 10  DC  A C6    1 
ATOM   199  P P     . DT  A 1 11 ? 31.173  25.147  18.489  1.00 31.39 ? 11  DT  A P     1 
ATOM   200  O OP1   . DT  A 1 11 ? 32.178  26.113  19.021  1.00 26.58 ? 11  DT  A OP1   1 
ATOM   201  O OP2   . DT  A 1 11 ? 30.358  25.503  17.263  1.00 26.74 ? 11  DT  A OP2   1 
ATOM   202  O "O5'" . DT  A 1 11 ? 31.871  23.704  18.195  1.00 25.52 ? 11  DT  A "O5'" 1 
ATOM   203  C "C5'" . DT  A 1 11 ? 33.006  23.220  18.933  1.00 24.03 ? 11  DT  A "C5'" 1 
ATOM   204  C "C4'" . DT  A 1 11 ? 33.714  21.940  18.363  1.00 26.15 ? 11  DT  A "C4'" 1 
ATOM   205  O "O4'" . DT  A 1 11 ? 32.730  20.881  18.403  1.00 29.28 ? 11  DT  A "O4'" 1 
ATOM   206  C "C3'" . DT  A 1 11 ? 34.079  21.975  16.904  1.00 25.62 ? 11  DT  A "C3'" 1 
ATOM   207  O "O3'" . DT  A 1 11 ? 35.350  21.358  16.772  1.00 25.61 ? 11  DT  A "O3'" 1 
ATOM   208  C "C2'" . DT  A 1 11 ? 32.961  21.109  16.257  1.00 26.37 ? 11  DT  A "C2'" 1 
ATOM   209  C "C1'" . DT  A 1 11 ? 32.670  20.044  17.271  1.00 25.14 ? 11  DT  A "C1'" 1 
ATOM   210  N N1    . DT  A 1 11 ? 31.283  19.423  17.305  1.00 23.30 ? 11  DT  A N1    1 
ATOM   211  C C2    . DT  A 1 11 ? 31.203  18.046  17.543  1.00 24.47 ? 11  DT  A C2    1 
ATOM   212  O O2    . DT  A 1 11 ? 32.145  17.280  17.750  1.00 27.46 ? 11  DT  A O2    1 
ATOM   213  N N3    . DT  A 1 11 ? 29.968  17.497  17.547  1.00 22.68 ? 11  DT  A N3    1 
ATOM   214  C C4    . DT  A 1 11 ? 28.805  18.143  17.344  1.00 23.35 ? 11  DT  A C4    1 
ATOM   215  O O4    . DT  A 1 11 ? 27.791  17.458  17.358  1.00 24.88 ? 11  DT  A O4    1 
ATOM   216  C C5    . DT  A 1 11 ? 28.948  19.560  17.110  1.00 22.36 ? 11  DT  A C5    1 
ATOM   217  C C7    . DT  A 1 11 ? 27.731  20.417  16.859  1.00 20.70 ? 11  DT  A C7    1 
ATOM   218  C C6    . DT  A 1 11 ? 30.153  20.140  17.099  1.00 21.15 ? 11  DT  A C6    1 
ATOM   219  P P     . DC  A 1 12 ? 35.983  21.267  15.303  1.00 28.01 ? 12  DC  A P     1 
ATOM   220  O OP1   . DC  A 1 12 ? 37.437  21.366  15.455  1.00 25.06 ? 12  DC  A OP1   1 
ATOM   221  O OP2   . DC  A 1 12 ? 35.255  22.159  14.361  1.00 28.67 ? 12  DC  A OP2   1 
ATOM   222  O "O5'" . DC  A 1 12 ? 35.603  19.769  14.922  1.00 27.19 ? 12  DC  A "O5'" 1 
ATOM   223  C "C5'" . DC  A 1 12 ? 36.204  18.840  15.818  1.00 28.49 ? 12  DC  A "C5'" 1 
ATOM   224  C "C4'" . DC  A 1 12 ? 36.210  17.424  15.322  1.00 31.73 ? 12  DC  A "C4'" 1 
ATOM   225  O "O4'" . DC  A 1 12 ? 34.932  16.738  15.510  1.00 33.02 ? 12  DC  A "O4'" 1 
ATOM   226  C "C3'" . DC  A 1 12 ? 36.547  17.530  13.806  1.00 35.57 ? 12  DC  A "C3'" 1 
ATOM   227  O "O3'" . DC  A 1 12 ? 37.285  16.333  13.308  1.00 40.01 ? 12  DC  A "O3'" 1 
ATOM   228  C "C2'" . DC  A 1 12 ? 35.122  17.529  13.271  1.00 34.14 ? 12  DC  A "C2'" 1 
ATOM   229  C "C1'" . DC  A 1 12 ? 34.369  16.563  14.194  1.00 32.15 ? 12  DC  A "C1'" 1 
ATOM   230  N N1    . DC  A 1 12 ? 32.939  16.904  14.186  1.00 29.44 ? 12  DC  A N1    1 
ATOM   231  C C2    . DC  A 1 12 ? 32.035  15.842  14.173  1.00 28.06 ? 12  DC  A C2    1 
ATOM   232  O O2    . DC  A 1 12 ? 32.415  14.660  14.167  1.00 23.75 ? 12  DC  A O2    1 
ATOM   233  N N3    . DC  A 1 12 ? 30.697  16.173  14.163  1.00 27.03 ? 12  DC  A N3    1 
ATOM   234  C C4    . DC  A 1 12 ? 30.290  17.481  14.176  1.00 26.25 ? 12  DC  A C4    1 
ATOM   235  N N4    . DC  A 1 12 ? 28.976  17.776  14.185  1.00 23.38 ? 12  DC  A N4    1 
ATOM   236  C C5    . DC  A 1 12 ? 31.234  18.553  14.191  1.00 22.40 ? 12  DC  A C5    1 
ATOM   237  C C6    . DC  A 1 12 ? 32.536  18.214  14.196  1.00 23.95 ? 12  DC  A C6    1 
ATOM   238  P P     . DA  A 1 13 ? 38.284  16.185  11.976  1.00 37.13 ? 13  DA  A P     1 
ATOM   239  O OP1   . DA  A 1 13 ? 39.648  15.712  12.373  1.00 38.31 ? 13  DA  A OP1   1 
ATOM   240  O OP2   . DA  A 1 13 ? 38.179  17.377  11.110  1.00 36.65 ? 13  DA  A OP2   1 
ATOM   241  O "O5'" . DA  A 1 13 ? 37.369  14.999  11.367  1.00 31.55 ? 13  DA  A "O5'" 1 
ATOM   242  C "C5'" . DA  A 1 13 ? 37.314  13.762  12.078  1.00 33.07 ? 13  DA  A "C5'" 1 
ATOM   243  C "C4'" . DA  A 1 13 ? 36.310  12.808  11.488  1.00 34.72 ? 13  DA  A "C4'" 1 
ATOM   244  O "O4'" . DA  A 1 13 ? 34.961  13.259  11.699  1.00 33.60 ? 13  DA  A "O4'" 1 
ATOM   245  C "C3'" . DA  A 1 13 ? 36.532  12.766  9.981   1.00 34.40 ? 13  DA  A "C3'" 1 
ATOM   246  O "O3'" . DA  A 1 13 ? 36.095  11.492  9.484   1.00 36.22 ? 13  DA  A "O3'" 1 
ATOM   247  C "C2'" . DA  A 1 13 ? 35.547  13.825  9.583   1.00 32.35 ? 13  DA  A "C2'" 1 
ATOM   248  C "C1'" . DA  A 1 13 ? 34.389  13.539  10.451  1.00 29.29 ? 13  DA  A "C1'" 1 
ATOM   249  N N9    . DA  A 1 13 ? 33.543  14.694  10.546  1.00 31.99 ? 13  DA  A N9    1 
ATOM   250  C C8    . DA  A 1 13 ? 33.838  16.039  10.666  1.00 31.93 ? 13  DA  A C8    1 
ATOM   251  N N7    . DA  A 1 13 ? 32.761  16.792  10.732  1.00 31.58 ? 13  DA  A N7    1 
ATOM   252  C C5    . DA  A 1 13 ? 31.707  15.867  10.642  1.00 30.64 ? 13  DA  A C5    1 
ATOM   253  C C6    . DA  A 1 13 ? 30.308  15.983  10.630  1.00 28.33 ? 13  DA  A C6    1 
ATOM   254  N N6    . DA  A 1 13 ? 29.680  17.150  10.752  1.00 28.72 ? 13  DA  A N6    1 
ATOM   255  N N1    . DA  A 1 13 ? 29.566  14.854  10.508  1.00 29.13 ? 13  DA  A N1    1 
ATOM   256  C C2    . DA  A 1 13 ? 30.166  13.667  10.403  1.00 29.70 ? 13  DA  A C2    1 
ATOM   257  N N3    . DA  A 1 13 ? 31.472  13.428  10.405  1.00 29.83 ? 13  DA  A N3    1 
ATOM   258  C C4    . DA  A 1 13 ? 32.184  14.588  10.530  1.00 31.29 ? 13  DA  A C4    1 
ATOM   259  P P     . DT  A 1 14 ? 36.612  10.769  8.133   1.00 34.29 ? 14  DT  A P     1 
ATOM   260  O OP1   . DT  A 1 14 ? 36.664  9.335   8.494   1.00 34.35 ? 14  DT  A OP1   1 
ATOM   261  O OP2   . DT  A 1 14 ? 37.835  11.484  7.706   1.00 32.71 ? 14  DT  A OP2   1 
ATOM   262  O "O5'" . DT  A 1 14 ? 35.475  10.973  6.976   1.00 32.12 ? 14  DT  A "O5'" 1 
ATOM   263  C "C5'" . DT  A 1 14 ? 34.237  11.591  7.310   1.00 33.89 ? 14  DT  A "C5'" 1 
ATOM   264  C "C4'" . DT  A 1 14 ? 33.112  10.646  7.643   1.00 35.57 ? 14  DT  A "C4'" 1 
ATOM   265  O "O4'" . DT  A 1 14 ? 31.992  11.363  8.237   1.00 37.75 ? 14  DT  A "O4'" 1 
ATOM   266  C "C3'" . DT  A 1 14 ? 32.633  10.008  6.376   1.00 35.23 ? 14  DT  A "C3'" 1 
ATOM   267  O "O3'" . DT  A 1 14 ? 32.052  8.704   6.619   1.00 37.52 ? 14  DT  A "O3'" 1 
ATOM   268  C "C2'" . DT  A 1 14 ? 31.556  11.034  6.020   1.00 36.01 ? 14  DT  A "C2'" 1 
ATOM   269  C "C1'" . DT  A 1 14 ? 30.943  11.669  7.298   1.00 35.10 ? 14  DT  A "C1'" 1 
ATOM   270  N N1    . DT  A 1 14 ? 30.798  13.197  7.263   1.00 34.49 ? 14  DT  A N1    1 
ATOM   271  C C2    . DT  A 1 14 ? 29.543  13.800  7.374   1.00 30.95 ? 14  DT  A C2    1 
ATOM   272  O O2    . DT  A 1 14 ? 28.489  13.178  7.425   1.00 26.35 ? 14  DT  A O2    1 
ATOM   273  N N3    . DT  A 1 14 ? 29.525  15.183  7.399   1.00 26.28 ? 14  DT  A N3    1 
ATOM   274  C C4    . DT  A 1 14 ? 30.627  16.002  7.318   1.00 27.69 ? 14  DT  A C4    1 
ATOM   275  O O4    . DT  A 1 14 ? 30.562  17.219  7.374   1.00 32.09 ? 14  DT  A O4    1 
ATOM   276  C C5    . DT  A 1 14 ? 31.868  15.336  7.194   1.00 27.64 ? 14  DT  A C5    1 
ATOM   277  C C7    . DT  A 1 14 ? 33.137  16.193  7.073   1.00 27.25 ? 14  DT  A C7    1 
ATOM   278  C C6    . DT  A 1 14 ? 31.923  13.998  7.171   1.00 31.09 ? 14  DT  A C6    1 
ATOM   279  P P     . DC  A 1 15 ? 31.715  7.674   5.361   1.00 42.70 ? 15  DC  A P     1 
ATOM   280  O OP1   . DC  A 1 15 ? 31.551  6.314   5.953   1.00 41.60 ? 15  DC  A OP1   1 
ATOM   281  O OP2   . DC  A 1 15 ? 32.676  7.851   4.236   1.00 41.83 ? 15  DC  A OP2   1 
ATOM   282  O "O5'" . DC  A 1 15 ? 30.324  8.227   4.803   1.00 36.26 ? 15  DC  A "O5'" 1 
ATOM   283  C "C5'" . DC  A 1 15 ? 29.296  8.327   5.739   1.00 34.43 ? 15  DC  A "C5'" 1 
ATOM   284  C "C4'" . DC  A 1 15 ? 28.187  9.164   5.228   1.00 35.37 ? 15  DC  A "C4'" 1 
ATOM   285  O "O4'" . DC  A 1 15 ? 28.534  10.580  5.341   1.00 35.66 ? 15  DC  A "O4'" 1 
ATOM   286  C "C3'" . DC  A 1 15 ? 27.990  8.927   3.742   1.00 36.47 ? 15  DC  A "C3'" 1 
ATOM   287  O "O3'" . DC  A 1 15 ? 26.644  8.522   3.741   1.00 39.35 ? 15  DC  A "O3'" 1 
ATOM   288  C "C2'" . DC  A 1 15 ? 28.278  10.361  3.196   1.00 34.77 ? 15  DC  A "C2'" 1 
ATOM   289  C "C1'" . DC  A 1 15 ? 27.822  11.275  4.333   1.00 33.40 ? 15  DC  A "C1'" 1 
ATOM   290  N N1    . DC  A 1 15 ? 28.321  12.690  4.296   1.00 31.69 ? 15  DC  A N1    1 
ATOM   291  C C2    . DC  A 1 15 ? 27.447  13.717  4.576   1.00 32.60 ? 15  DC  A C2    1 
ATOM   292  O O2    . DC  A 1 15 ? 26.277  13.544  4.871   1.00 39.40 ? 15  DC  A O2    1 
ATOM   293  N N3    . DC  A 1 15 ? 27.856  14.987  4.532   1.00 28.95 ? 15  DC  A N3    1 
ATOM   294  C C4    . DC  A 1 15 ? 29.091  15.263  4.222   1.00 28.28 ? 15  DC  A C4    1 
ATOM   295  N N4    . DC  A 1 15 ? 29.419  16.537  4.159   1.00 29.98 ? 15  DC  A N4    1 
ATOM   296  C C5    . DC  A 1 15 ? 30.033  14.241  3.932   1.00 30.60 ? 15  DC  A C5    1 
ATOM   297  C C6    . DC  A 1 15 ? 29.591  12.972  3.984   1.00 32.40 ? 15  DC  A C6    1 
ATOM   298  P P     . DC  A 1 16 ? 25.734  7.911   2.575   1.00 44.25 ? 16  DC  A P     1 
ATOM   299  O OP1   . DC  A 1 16 ? 24.942  6.824   3.207   1.00 44.44 ? 16  DC  A OP1   1 
ATOM   300  O OP2   . DC  A 1 16 ? 26.514  7.699   1.311   1.00 41.43 ? 16  DC  A OP2   1 
ATOM   301  O "O5'" . DC  A 1 16 ? 24.807  9.250   2.361   1.00 44.73 ? 16  DC  A "O5'" 1 
ATOM   302  C "C5'" . DC  A 1 16 ? 23.799  9.749   3.292   1.00 43.48 ? 16  DC  A "C5'" 1 
ATOM   303  C "C4'" . DC  A 1 16 ? 22.861  10.813  2.688   1.00 38.08 ? 16  DC  A "C4'" 1 
ATOM   304  O "O4'" . DC  A 1 16 ? 23.463  12.132  2.741   1.00 34.03 ? 16  DC  A "O4'" 1 
ATOM   305  C "C3'" . DC  A 1 16 ? 22.638  10.475  1.201   1.00 36.63 ? 16  DC  A "C3'" 1 
ATOM   306  O "O3'" . DC  A 1 16 ? 21.299  10.797  0.800   1.00 39.02 ? 16  DC  A "O3'" 1 
ATOM   307  C "C2'" . DC  A 1 16 ? 23.608  11.456  0.551   1.00 36.12 ? 16  DC  A "C2'" 1 
ATOM   308  C "C1'" . DC  A 1 16 ? 23.605  12.684  1.428   1.00 30.07 ? 16  DC  A "C1'" 1 
ATOM   309  N N1    . DC  A 1 16 ? 24.895  13.412  1.296   1.00 26.24 ? 16  DC  A N1    1 
ATOM   310  C C2    . DC  A 1 16 ? 24.867  14.805  1.135   1.00 27.42 ? 16  DC  A C2    1 
ATOM   311  O O2    . DC  A 1 16 ? 23.828  15.484  1.066   1.00 27.40 ? 16  DC  A O2    1 
ATOM   312  N N3    . DC  A 1 16 ? 26.076  15.428  1.048   1.00 23.84 ? 16  DC  A N3    1 
ATOM   313  C C4    . DC  A 1 16 ? 27.242  14.766  1.112   1.00 23.77 ? 16  DC  A C4    1 
ATOM   314  N N4    . DC  A 1 16 ? 28.375  15.486  1.041   1.00 22.20 ? 16  DC  A N4    1 
ATOM   315  C C5    . DC  A 1 16 ? 27.286  13.346  1.269   1.00 23.61 ? 16  DC  A C5    1 
ATOM   316  C C6    . DC  A 1 16 ? 26.089  12.728  1.354   1.00 25.83 ? 16  DC  A C6    1 
ATOM   317  P P     . DA  A 1 17 ? 20.723  11.269  -0.661  1.00 39.54 ? 17  DA  A P     1 
ATOM   318  O OP1   . DA  A 1 17 ? 19.234  11.067  -0.624  1.00 36.56 ? 17  DA  A OP1   1 
ATOM   319  O OP2   . DA  A 1 17 ? 21.552  10.745  -1.793  1.00 34.37 ? 17  DA  A OP2   1 
ATOM   320  O "O5'" . DA  A 1 17 ? 21.074  12.823  -0.333  1.00 35.50 ? 17  DA  A "O5'" 1 
ATOM   321  C "C5'" . DA  A 1 17 ? 20.266  13.439  0.673   1.00 35.59 ? 17  DA  A "C5'" 1 
ATOM   322  C "C4'" . DA  A 1 17 ? 19.502  14.631  0.160   1.00 37.68 ? 17  DA  A "C4'" 1 
ATOM   323  O "O4'" . DA  A 1 17 ? 20.498  15.635  -0.073  1.00 38.62 ? 17  DA  A "O4'" 1 
ATOM   324  C "C3'" . DA  A 1 17 ? 18.731  14.363  -1.145  1.00 39.64 ? 17  DA  A "C3'" 1 
ATOM   325  O "O3'" . DA  A 1 17 ? 17.568  15.230  -1.307  1.00 40.34 ? 17  DA  A "O3'" 1 
ATOM   326  C "C2'" . DA  A 1 17 ? 19.813  14.765  -2.149  1.00 39.95 ? 17  DA  A "C2'" 1 
ATOM   327  C "C1'" . DA  A 1 17 ? 20.687  15.821  -1.474  1.00 37.29 ? 17  DA  A "C1'" 1 
ATOM   328  N N9    . DA  A 1 17 ? 22.134  15.644  -1.749  1.00 33.78 ? 17  DA  A N9    1 
ATOM   329  C C8    . DA  A 1 17 ? 22.874  14.531  -1.993  1.00 32.25 ? 17  DA  A C8    1 
ATOM   330  N N7    . DA  A 1 17 ? 24.146  14.764  -2.190  1.00 31.52 ? 17  DA  A N7    1 
ATOM   331  C C5    . DA  A 1 17 ? 24.245  16.134  -2.066  1.00 33.83 ? 17  DA  A C5    1 
ATOM   332  C C6    . DA  A 1 17 ? 25.341  17.030  -2.159  1.00 37.13 ? 17  DA  A C6    1 
ATOM   333  N N6    . DA  A 1 17 ? 26.629  16.683  -2.422  1.00 32.92 ? 17  DA  A N6    1 
ATOM   334  N N1    . DA  A 1 17 ? 25.042  18.330  -1.964  1.00 37.22 ? 17  DA  A N1    1 
ATOM   335  C C2    . DA  A 1 17 ? 23.771  18.691  -1.706  1.00 34.83 ? 17  DA  A C2    1 
ATOM   336  N N3    . DA  A 1 17 ? 22.680  17.959  -1.599  1.00 32.43 ? 17  DA  A N3    1 
ATOM   337  C C4    . DA  A 1 17 ? 23.012  16.668  -1.796  1.00 33.15 ? 17  DA  A C4    1 
ATOM   338  P P     . DG  A 1 18 ? 16.570  15.173  -2.636  1.00 40.27 ? 18  DG  A P     1 
ATOM   339  O OP1   . DG  A 1 18 ? 15.148  15.297  -2.224  1.00 39.89 ? 18  DG  A OP1   1 
ATOM   340  O OP2   . DG  A 1 18 ? 16.985  14.025  -3.484  1.00 35.51 ? 18  DG  A OP2   1 
ATOM   341  O "O5'" . DG  A 1 18 ? 17.002  16.569  -3.357  1.00 39.83 ? 18  DG  A "O5'" 1 
ATOM   342  C "C5'" . DG  A 1 18 ? 16.996  17.737  -2.512  1.00 37.12 ? 18  DG  A "C5'" 1 
ATOM   343  C "C4'" . DG  A 1 18 ? 17.657  19.082  -2.983  1.00 36.86 ? 18  DG  A "C4'" 1 
ATOM   344  O "O4'" . DG  A 1 18 ? 19.103  18.929  -3.117  1.00 36.96 ? 18  DG  A "O4'" 1 
ATOM   345  C "C3'" . DG  A 1 18 ? 17.104  19.535  -4.345  1.00 33.32 ? 18  DG  A "C3'" 1 
ATOM   346  O "O3'" . DG  A 1 18 ? 16.929  20.951  -4.307  1.00 29.99 ? 18  DG  A "O3'" 1 
ATOM   347  C "C2'" . DG  A 1 18 ? 18.316  19.191  -5.237  1.00 36.21 ? 18  DG  A "C2'" 1 
ATOM   348  C "C1'" . DG  A 1 18 ? 19.555  19.458  -4.394  1.00 32.87 ? 18  DG  A "C1'" 1 
ATOM   349  N N9    . DG  A 1 18 ? 20.735  18.638  -4.711  1.00 31.19 ? 18  DG  A N9    1 
ATOM   350  C C8    . DG  A 1 18 ? 20.771  17.267  -4.681  1.00 29.50 ? 18  DG  A C8    1 
ATOM   351  N N7    . DG  A 1 18 ? 21.952  16.768  -4.909  1.00 29.65 ? 18  DG  A N7    1 
ATOM   352  C C5    . DG  A 1 18 ? 22.768  17.880  -5.110  1.00 28.25 ? 18  DG  A C5    1 
ATOM   353  C C6    . DG  A 1 18 ? 24.170  17.936  -5.365  1.00 28.74 ? 18  DG  A C6    1 
ATOM   354  O O6    . DG  A 1 18 ? 24.987  17.016  -5.485  1.00 23.31 ? 18  DG  A O6    1 
ATOM   355  N N1    . DG  A 1 18 ? 24.605  19.243  -5.459  1.00 26.62 ? 18  DG  A N1    1 
ATOM   356  C C2    . DG  A 1 18 ? 23.813  20.334  -5.328  1.00 25.91 ? 18  DG  A C2    1 
ATOM   357  N N2    . DG  A 1 18 ? 24.467  21.476  -5.412  1.00 25.87 ? 18  DG  A N2    1 
ATOM   358  N N3    . DG  A 1 18 ? 22.500  20.295  -5.099  1.00 25.08 ? 18  DG  A N3    1 
ATOM   359  C C4    . DG  A 1 18 ? 22.039  19.038  -4.996  1.00 27.40 ? 18  DG  A C4    1 
ATOM   360  P P     . DT  A 1 19 ? 16.294  21.826  -5.485  1.00 29.09 ? 19  DT  A P     1 
ATOM   361  O OP1   . DT  A 1 19 ? 15.886  23.141  -4.940  1.00 28.95 ? 19  DT  A OP1   1 
ATOM   362  O OP2   . DT  A 1 19 ? 15.351  20.944  -6.236  1.00 27.61 ? 19  DT  A OP2   1 
ATOM   363  O "O5'" . DT  A 1 19 ? 17.529  22.174  -6.436  1.00 25.70 ? 19  DT  A "O5'" 1 
ATOM   364  C "C5'" . DT  A 1 19 ? 18.580  23.032  -6.003  1.00 27.68 ? 19  DT  A "C5'" 1 
ATOM   365  C "C4'" . DT  A 1 19 ? 19.739  23.132  -6.984  1.00 31.89 ? 19  DT  A "C4'" 1 
ATOM   366  O "O4'" . DT  A 1 19 ? 20.591  21.950  -6.969  1.00 31.12 ? 19  DT  A "O4'" 1 
ATOM   367  C "C3'" . DT  A 1 19 ? 19.155  23.147  -8.367  1.00 35.47 ? 19  DT  A "C3'" 1 
ATOM   368  O "O3'" . DT  A 1 19 ? 19.709  24.144  -9.208  1.00 41.69 ? 19  DT  A "O3'" 1 
ATOM   369  C "C2'" . DT  A 1 19 ? 19.682  21.833  -8.912  1.00 33.41 ? 19  DT  A "C2'" 1 
ATOM   370  C "C1'" . DT  A 1 19 ? 21.033  21.618  -8.270  1.00 27.09 ? 19  DT  A "C1'" 1 
ATOM   371  N N1    . DT  A 1 19 ? 21.465  20.189  -8.306  1.00 27.41 ? 19  DT  A N1    1 
ATOM   372  C C2    . DT  A 1 19 ? 22.796  19.920  -8.536  1.00 27.00 ? 19  DT  A C2    1 
ATOM   373  O O2    . DT  A 1 19 ? 23.669  20.780  -8.658  1.00 26.43 ? 19  DT  A O2    1 
ATOM   374  N N3    . DT  A 1 19 ? 23.149  18.586  -8.604  1.00 24.86 ? 19  DT  A N3    1 
ATOM   375  C C4    . DT  A 1 19 ? 22.320  17.502  -8.462  1.00 26.17 ? 19  DT  A C4    1 
ATOM   376  O O4    . DT  A 1 19 ? 22.793  16.369  -8.577  1.00 24.76 ? 19  DT  A O4    1 
ATOM   377  C C5    . DT  A 1 19 ? 20.938  17.875  -8.208  1.00 25.75 ? 19  DT  A C5    1 
ATOM   378  C C7    . DT  A 1 19 ? 19.863  16.813  -7.954  1.00 27.37 ? 19  DT  A C7    1 
ATOM   379  C C6    . DT  A 1 19 ? 20.565  19.162  -8.143  1.00 25.27 ? 19  DT  A C6    1 
ATOM   380  P P     . DT  A 1 20 ? 18.727  24.689  -10.393 1.00 44.02 ? 20  DT  A P     1 
ATOM   381  O OP1   . DT  A 1 20 ? 18.274  26.045  -10.022 1.00 43.39 ? 20  DT  A OP1   1 
ATOM   382  O OP2   . DT  A 1 20 ? 17.712  23.644  -10.744 1.00 42.45 ? 20  DT  A OP2   1 
ATOM   383  O "O5'" . DT  A 1 20 ? 19.995  24.737  -11.459 1.00 42.55 ? 20  DT  A "O5'" 1 
ATOM   384  C "C5'" . DT  A 1 20 ? 21.246  25.357  -11.087 1.00 40.65 ? 20  DT  A "C5'" 1 
ATOM   385  C "C4'" . DT  A 1 20 ? 22.481  25.122  -12.017 1.00 41.42 ? 20  DT  A "C4'" 1 
ATOM   386  O "O4'" . DT  A 1 20 ? 23.115  23.833  -11.719 1.00 42.66 ? 20  DT  A "O4'" 1 
ATOM   387  C "C3'" . DT  A 1 20 ? 22.040  25.157  -13.521 1.00 40.91 ? 20  DT  A "C3'" 1 
ATOM   388  O "O3'" . DT  A 1 20 ? 23.064  25.672  -14.419 1.00 39.33 ? 20  DT  A "O3'" 1 
ATOM   389  C "C2'" . DT  A 1 20 ? 21.957  23.666  -13.770 1.00 41.04 ? 20  DT  A "C2'" 1 
ATOM   390  C "C1'" . DT  A 1 20 ? 23.075  23.022  -12.885 1.00 41.99 ? 20  DT  A "C1'" 1 
ATOM   391  N N1    . DT  A 1 20 ? 22.717  21.589  -12.567 1.00 38.60 ? 20  DT  A N1    1 
ATOM   392  C C2    . DT  A 1 20 ? 23.744  20.718  -12.577 1.00 38.24 ? 20  DT  A C2    1 
ATOM   393  O O2    . DT  A 1 20 ? 24.890  21.116  -12.777 1.00 37.73 ? 20  DT  A O2    1 
ATOM   394  N N3    . DT  A 1 20 ? 23.406  19.374  -12.370 1.00 39.15 ? 20  DT  A N3    1 
ATOM   395  C C4    . DT  A 1 20 ? 22.108  18.832  -12.150 1.00 43.07 ? 20  DT  A C4    1 
ATOM   396  O O4    . DT  A 1 20 ? 21.843  17.634  -11.989 1.00 43.23 ? 20  DT  A O4    1 
ATOM   397  C C5    . DT  A 1 20 ? 21.103  19.834  -12.151 1.00 41.17 ? 20  DT  A C5    1 
ATOM   398  C C7    . DT  A 1 20 ? 19.661  19.362  -11.973 1.00 39.77 ? 20  DT  A C7    1 
ATOM   399  C C6    . DT  A 1 20 ? 21.427  21.136  -12.348 1.00 41.73 ? 20  DT  A C6    1 
ATOM   400  O "O5'" . DA  B 2 1  ? 33.136  13.545  -11.786 1.00 46.15 ? 21  DA  B "O5'" 1 
ATOM   401  C "C5'" . DA  B 2 1  ? 32.871  14.457  -10.676 1.00 39.51 ? 21  DA  B "C5'" 1 
ATOM   402  C "C4'" . DA  B 2 1  ? 32.092  13.765  -9.539  1.00 36.60 ? 21  DA  B "C4'" 1 
ATOM   403  O "O4'" . DA  B 2 1  ? 31.546  14.751  -8.677  1.00 32.46 ? 21  DA  B "O4'" 1 
ATOM   404  C "C3'" . DA  B 2 1  ? 30.929  12.923  -10.091 1.00 37.76 ? 21  DA  B "C3'" 1 
ATOM   405  O "O3'" . DA  B 2 1  ? 30.682  11.758  -9.215  1.00 37.23 ? 21  DA  B "O3'" 1 
ATOM   406  C "C2'" . DA  B 2 1  ? 29.833  13.970  -9.999  1.00 33.99 ? 21  DA  B "C2'" 1 
ATOM   407  C "C1'" . DA  B 2 1  ? 30.133  14.743  -8.748  1.00 32.85 ? 21  DA  B "C1'" 1 
ATOM   408  N N9    . DA  B 2 1  ? 29.635  16.139  -8.804  1.00 31.85 ? 21  DA  B N9    1 
ATOM   409  C C8    . DA  B 2 1  ? 30.396  17.283  -8.880  1.00 29.27 ? 21  DA  B C8    1 
ATOM   410  N N7    . DA  B 2 1  ? 29.674  18.385  -8.902  1.00 33.49 ? 21  DA  B N7    1 
ATOM   411  C C5    . DA  B 2 1  ? 28.330  17.948  -8.842  1.00 29.84 ? 21  DA  B C5    1 
ATOM   412  C C6    . DA  B 2 1  ? 27.075  18.631  -8.849  1.00 30.26 ? 21  DA  B C6    1 
ATOM   413  N N6    . DA  B 2 1  ? 26.930  19.963  -8.910  1.00 29.08 ? 21  DA  B N6    1 
ATOM   414  N N1    . DA  B 2 1  ? 25.955  17.884  -8.782  1.00 30.47 ? 21  DA  B N1    1 
ATOM   415  C C2    . DA  B 2 1  ? 26.072  16.563  -8.720  1.00 30.25 ? 21  DA  B C2    1 
ATOM   416  N N3    . DA  B 2 1  ? 27.173  15.808  -8.710  1.00 31.89 ? 21  DA  B N3    1 
ATOM   417  C C4    . DA  B 2 1  ? 28.296  16.575  -8.779  1.00 30.53 ? 21  DA  B C4    1 
ATOM   418  P P     . DA  B 2 2  ? 29.428  11.304  -8.255  1.00 38.08 ? 22  DA  B P     1 
ATOM   419  O OP1   . DA  B 2 2  ? 28.569  10.384  -9.068  1.00 32.82 ? 22  DA  B OP1   1 
ATOM   420  O OP2   . DA  B 2 2  ? 28.765  12.429  -7.497  1.00 38.07 ? 22  DA  B OP2   1 
ATOM   421  O "O5'" . DA  B 2 2  ? 30.491  10.534  -7.275  1.00 33.75 ? 22  DA  B "O5'" 1 
ATOM   422  C "C5'" . DA  B 2 2  ? 30.754  11.369  -6.158  1.00 34.97 ? 22  DA  B "C5'" 1 
ATOM   423  C "C4'" . DA  B 2 2  ? 32.168  11.502  -5.733  1.00 38.73 ? 22  DA  B "C4'" 1 
ATOM   424  O "O4'" . DA  B 2 2  ? 32.423  10.454  -4.795  1.00 40.76 ? 22  DA  B "O4'" 1 
ATOM   425  C "C3'" . DA  B 2 2  ? 33.106  11.339  -6.885  1.00 42.64 ? 22  DA  B "C3'" 1 
ATOM   426  O "O3'" . DA  B 2 2  ? 34.113  12.428  -6.804  1.00 41.27 ? 22  DA  B "O3'" 1 
ATOM   427  C "C2'" . DA  B 2 2  ? 33.628  9.909   -6.604  1.00 41.44 ? 22  DA  B "C2'" 1 
ATOM   428  C "C1'" . DA  B 2 2  ? 33.627  9.784   -5.105  1.00 42.96 ? 22  DA  B "C1'" 1 
ATOM   429  N N9    . DA  B 2 2  ? 33.492  8.399   -4.568  1.00 43.94 ? 22  DA  B N9    1 
ATOM   430  C C8    . DA  B 2 2  ? 32.931  7.283   -5.159  1.00 43.46 ? 22  DA  B C8    1 
ATOM   431  N N7    . DA  B 2 2  ? 32.992  6.191   -4.418  1.00 44.33 ? 22  DA  B N7    1 
ATOM   432  C C5    . DA  B 2 2  ? 33.647  6.620   -3.247  1.00 42.34 ? 22  DA  B C5    1 
ATOM   433  C C6    . DA  B 2 2  ? 34.045  5.962   -2.067  1.00 40.91 ? 22  DA  B C6    1 
ATOM   434  N N6    . DA  B 2 2  ? 33.857  4.672   -1.876  1.00 39.14 ? 22  DA  B N6    1 
ATOM   435  N N1    . DA  B 2 2  ? 34.680  6.649   -1.100  1.00 39.44 ? 22  DA  B N1    1 
ATOM   436  C C2    . DA  B 2 2  ? 34.917  7.936   -1.290  1.00 38.82 ? 22  DA  B C2    1 
ATOM   437  N N3    . DA  B 2 2  ? 34.605  8.674   -2.351  1.00 41.31 ? 22  DA  B N3    1 
ATOM   438  C C4    . DA  B 2 2  ? 33.957  7.952   -3.319  1.00 41.96 ? 22  DA  B C4    1 
ATOM   439  P P     . DA  B 2 3  ? 35.455  12.783  -5.979  1.00 46.00 ? 23  DA  B P     1 
ATOM   440  O OP1   . DA  B 2 3  ? 36.550  11.965  -6.570  1.00 49.83 ? 23  DA  B OP1   1 
ATOM   441  O OP2   . DA  B 2 3  ? 35.129  12.684  -4.535  1.00 49.09 ? 23  DA  B OP2   1 
ATOM   442  O "O5'" . DA  B 2 3  ? 35.908  14.271  -6.306  1.00 47.23 ? 23  DA  B "O5'" 1 
ATOM   443  C "C5'" . DA  B 2 3  ? 35.597  14.965  -7.521  1.00 46.18 ? 23  DA  B "C5'" 1 
ATOM   444  C "C4'" . DA  B 2 3  ? 34.570  16.002  -7.118  1.00 42.58 ? 23  DA  B "C4'" 1 
ATOM   445  O "O4'" . DA  B 2 3  ? 33.533  15.142  -6.500  1.00 43.10 ? 23  DA  B "O4'" 1 
ATOM   446  C "C3'" . DA  B 2 3  ? 34.991  17.035  -5.957  1.00 43.01 ? 23  DA  B "C3'" 1 
ATOM   447  O "O3'" . DA  B 2 3  ? 34.385  18.394  -6.110  1.00 40.27 ? 23  DA  B "O3'" 1 
ATOM   448  C "C2'" . DA  B 2 3  ? 34.250  16.347  -4.755  1.00 41.24 ? 23  DA  B "C2'" 1 
ATOM   449  C "C1'" . DA  B 2 3  ? 33.032  16.029  -5.554  1.00 43.41 ? 23  DA  B "C1'" 1 
ATOM   450  N N9    . DA  B 2 3  ? 31.900  15.402  -4.848  1.00 45.60 ? 23  DA  B N9    1 
ATOM   451  C C8    . DA  B 2 3  ? 30.565  15.666  -5.120  1.00 45.00 ? 23  DA  B C8    1 
ATOM   452  N N7    . DA  B 2 3  ? 29.687  15.079  -4.363  1.00 46.36 ? 23  DA  B N7    1 
ATOM   453  C C5    . DA  B 2 3  ? 30.539  14.341  -3.502  1.00 49.36 ? 23  DA  B C5    1 
ATOM   454  C C6    . DA  B 2 3  ? 30.270  13.439  -2.447  1.00 51.10 ? 23  DA  B C6    1 
ATOM   455  N N6    . DA  B 2 3  ? 29.024  13.145  -2.016  1.00 49.25 ? 23  DA  B N6    1 
ATOM   456  N N1    . DA  B 2 3  ? 31.346  12.866  -1.850  1.00 49.00 ? 23  DA  B N1    1 
ATOM   457  C C2    . DA  B 2 3  ? 32.585  13.167  -2.265  1.00 47.29 ? 23  DA  B C2    1 
ATOM   458  N N3    . DA  B 2 3  ? 32.976  13.985  -3.233  1.00 45.36 ? 23  DA  B N3    1 
ATOM   459  C C4    . DA  B 2 3  ? 31.884  14.538  -3.807  1.00 46.46 ? 23  DA  B C4    1 
ATOM   460  P P     . DC  B 2 4  ? 34.590  19.581  -4.951  1.00 40.01 ? 24  DC  B P     1 
ATOM   461  O OP1   . DC  B 2 4  ? 35.869  20.268  -5.246  1.00 37.93 ? 24  DC  B OP1   1 
ATOM   462  O OP2   . DC  B 2 4  ? 34.409  19.016  -3.583  1.00 39.53 ? 24  DC  B OP2   1 
ATOM   463  O "O5'" . DC  B 2 4  ? 33.388  20.656  -5.099  1.00 36.51 ? 24  DC  B "O5'" 1 
ATOM   464  C "C5'" . DC  B 2 4  ? 33.616  21.750  -5.956  1.00 32.76 ? 24  DC  B "C5'" 1 
ATOM   465  C "C4'" . DC  B 2 4  ? 32.470  22.641  -6.260  1.00 32.48 ? 24  DC  B "C4'" 1 
ATOM   466  O "O4'" . DC  B 2 4  ? 31.451  21.766  -6.837  1.00 33.93 ? 24  DC  B "O4'" 1 
ATOM   467  C "C3'" . DC  B 2 4  ? 31.977  23.363  -5.030  1.00 34.26 ? 24  DC  B "C3'" 1 
ATOM   468  O "O3'" . DC  B 2 4  ? 31.575  24.784  -5.139  1.00 35.16 ? 24  DC  B "O3'" 1 
ATOM   469  C "C2'" . DC  B 2 4  ? 30.685  22.586  -4.875  1.00 35.82 ? 24  DC  B "C2'" 1 
ATOM   470  C "C1'" . DC  B 2 4  ? 30.191  22.026  -6.206  1.00 34.41 ? 24  DC  B "C1'" 1 
ATOM   471  N N1    . DC  B 2 4  ? 29.451  20.759  -5.982  1.00 30.39 ? 24  DC  B N1    1 
ATOM   472  C C2    . DC  B 2 4  ? 28.054  20.718  -5.954  1.00 31.02 ? 24  DC  B C2    1 
ATOM   473  O O2    . DC  B 2 4  ? 27.373  21.737  -6.137  1.00 32.65 ? 24  DC  B O2    1 
ATOM   474  N N3    . DC  B 2 4  ? 27.444  19.516  -5.721  1.00 22.51 ? 24  DC  B N3    1 
ATOM   475  C C4    . DC  B 2 4  ? 28.174  18.441  -5.531  1.00 22.69 ? 24  DC  B C4    1 
ATOM   476  N N4    . DC  B 2 4  ? 27.603  17.276  -5.338  1.00 27.25 ? 24  DC  B N4    1 
ATOM   477  C C5    . DC  B 2 4  ? 29.569  18.478  -5.555  1.00 21.81 ? 24  DC  B C5    1 
ATOM   478  C C6    . DC  B 2 4  ? 30.163  19.648  -5.784  1.00 26.35 ? 24  DC  B C6    1 
ATOM   479  P P     . DT  B 2 5  ? 31.477  25.584  -3.630  1.00 38.71 ? 25  DT  B P     1 
ATOM   480  O OP1   . DT  B 2 5  ? 31.746  27.050  -3.612  1.00 36.84 ? 25  DT  B OP1   1 
ATOM   481  O OP2   . DT  B 2 5  ? 32.077  24.755  -2.561  1.00 40.60 ? 25  DT  B OP2   1 
ATOM   482  O "O5'" . DT  B 2 5  ? 29.935  25.384  -3.451  1.00 39.10 ? 25  DT  B "O5'" 1 
ATOM   483  C "C5'" . DT  B 2 5  ? 28.851  25.935  -4.200  1.00 37.95 ? 25  DT  B "C5'" 1 
ATOM   484  C "C4'" . DT  B 2 5  ? 27.520  25.700  -3.413  1.00 39.65 ? 25  DT  B "C4'" 1 
ATOM   485  O "O4'" . DT  B 2 5  ? 27.091  24.280  -3.326  1.00 39.53 ? 25  DT  B "O4'" 1 
ATOM   486  C "C3'" . DT  B 2 5  ? 27.792  26.202  -1.998  1.00 38.64 ? 25  DT  B "C3'" 1 
ATOM   487  O "O3'" . DT  B 2 5  ? 26.511  26.791  -1.591  1.00 41.98 ? 25  DT  B "O3'" 1 
ATOM   488  C "C2'" . DT  B 2 5  ? 28.195  24.842  -1.336  1.00 37.41 ? 25  DT  B "C2'" 1 
ATOM   489  C "C1'" . DT  B 2 5  ? 27.324  23.794  -2.020  1.00 35.49 ? 25  DT  B "C1'" 1 
ATOM   490  N N1    . DT  B 2 5  ? 27.939  22.384  -2.103  1.00 29.60 ? 25  DT  B N1    1 
ATOM   491  C C2    . DT  B 2 5  ? 26.960  21.402  -2.150  1.00 28.75 ? 25  DT  B C2    1 
ATOM   492  O O2    . DT  B 2 5  ? 25.762  21.665  -2.202  1.00 32.66 ? 25  DT  B O2    1 
ATOM   493  N N3    . DT  B 2 5  ? 27.307  20.063  -2.154  1.00 26.32 ? 25  DT  B N3    1 
ATOM   494  C C4    . DT  B 2 5  ? 28.564  19.569  -2.124  1.00 25.17 ? 25  DT  B C4    1 
ATOM   495  O O4    . DT  B 2 5  ? 28.728  18.352  -2.159  1.00 22.35 ? 25  DT  B O4    1 
ATOM   496  C C5    . DT  B 2 5  ? 29.563  20.624  -2.072  1.00 24.39 ? 25  DT  B C5    1 
ATOM   497  C C7    . DT  B 2 5  ? 30.972  20.122  -1.981  1.00 24.36 ? 25  DT  B C7    1 
ATOM   498  C C6    . DT  B 2 5  ? 29.253  21.978  -2.068  1.00 25.40 ? 25  DT  B C6    1 
ATOM   499  P P     . DG  B 2 6  ? 26.218  27.935  -0.382  1.00 40.57 ? 26  DG  B P     1 
ATOM   500  O OP1   . DG  B 2 6  ? 25.024  28.775  -0.718  1.00 35.28 ? 26  DG  B OP1   1 
ATOM   501  O OP2   . DG  B 2 6  ? 27.553  28.522  -0.033  1.00 39.55 ? 26  DG  B OP2   1 
ATOM   502  O "O5'" . DG  B 2 6  ? 25.833  27.066  0.871   1.00 40.69 ? 26  DG  B "O5'" 1 
ATOM   503  C "C5'" . DG  B 2 6  ? 25.528  25.727  0.619   1.00 39.54 ? 26  DG  B "C5'" 1 
ATOM   504  C "C4'" . DG  B 2 6  ? 24.658  25.211  1.608   1.00 34.82 ? 26  DG  B "C4'" 1 
ATOM   505  O "O4'" . DG  B 2 6  ? 24.747  23.790  1.485   1.00 36.23 ? 26  DG  B "O4'" 1 
ATOM   506  C "C3'" . DG  B 2 6  ? 25.000  25.754  2.952   1.00 32.38 ? 26  DG  B "C3'" 1 
ATOM   507  O "O3'" . DG  B 2 6  ? 23.701  25.810  3.594   1.00 28.32 ? 26  DG  B "O3'" 1 
ATOM   508  C "C2'" . DG  B 2 6  ? 25.967  24.627  3.303   1.00 32.09 ? 26  DG  B "C2'" 1 
ATOM   509  C "C1'" . DG  B 2 6  ? 25.486  23.357  2.598   1.00 31.97 ? 26  DG  B "C1'" 1 
ATOM   510  N N9    . DG  B 2 6  ? 26.588  22.520  2.100   1.00 28.77 ? 26  DG  B N9    1 
ATOM   511  C C8    . DG  B 2 6  ? 27.940  22.789  1.890   1.00 30.14 ? 26  DG  B C8    1 
ATOM   512  N N7    . DG  B 2 6  ? 28.630  21.746  1.503   1.00 26.32 ? 26  DG  B N7    1 
ATOM   513  C C5    . DG  B 2 6  ? 27.640  20.743  1.463   1.00 21.20 ? 26  DG  B C5    1 
ATOM   514  C C6    . DG  B 2 6  ? 27.771  19.384  1.164   1.00 19.40 ? 26  DG  B C6    1 
ATOM   515  O O6    . DG  B 2 6  ? 28.794  18.760  0.848   1.00 25.29 ? 26  DG  B O6    1 
ATOM   516  N N1    . DG  B 2 6  ? 26.566  18.741  1.302   1.00 17.49 ? 26  DG  B N1    1 
ATOM   517  C C2    . DG  B 2 6  ? 25.384  19.323  1.673   1.00 21.31 ? 26  DG  B C2    1 
ATOM   518  N N2    . DG  B 2 6  ? 24.336  18.485  1.792   1.00 26.90 ? 26  DG  B N2    1 
ATOM   519  N N3    . DG  B 2 6  ? 25.254  20.615  1.953   1.00 16.42 ? 26  DG  B N3    1 
ATOM   520  C C4    . DG  B 2 6  ? 26.418  21.230  1.822   1.00 20.23 ? 26  DG  B C4    1 
ATOM   521  P P     . DG  B 2 7  ? 23.481  25.820  5.160   1.00 29.33 ? 27  DG  B P     1 
ATOM   522  O OP1   . DG  B 2 7  ? 22.626  26.978  5.511   1.00 26.31 ? 27  DG  B OP1   1 
ATOM   523  O OP2   . DG  B 2 7  ? 24.764  25.722  5.863   1.00 28.84 ? 27  DG  B OP2   1 
ATOM   524  O "O5'" . DG  B 2 7  ? 22.736  24.345  5.307   1.00 25.72 ? 27  DG  B "O5'" 1 
ATOM   525  C "C5'" . DG  B 2 7  ? 21.514  23.977  4.610   1.00 23.02 ? 27  DG  B "C5'" 1 
ATOM   526  C "C4'" . DG  B 2 7  ? 20.911  22.542  4.750   1.00 24.50 ? 27  DG  B "C4'" 1 
ATOM   527  O "O4'" . DG  B 2 7  ? 21.893  21.611  4.271   1.00 29.63 ? 27  DG  B "O4'" 1 
ATOM   528  C "C3'" . DG  B 2 7  ? 20.660  22.079  6.168   1.00 25.11 ? 27  DG  B "C3'" 1 
ATOM   529  O "O3'" . DG  B 2 7  ? 19.643  21.061  6.247   1.00 24.77 ? 27  DG  B "O3'" 1 
ATOM   530  C "C2'" . DG  B 2 7  ? 21.977  21.379  6.479   1.00 27.92 ? 27  DG  B "C2'" 1 
ATOM   531  C "C1'" . DG  B 2 7  ? 22.299  20.604  5.240   1.00 24.22 ? 27  DG  B "C1'" 1 
ATOM   532  N N9    . DG  B 2 7  ? 23.769  20.296  5.172   1.00 19.52 ? 27  DG  B N9    1 
ATOM   533  C C8    . DG  B 2 7  ? 24.797  21.186  5.181   1.00 21.99 ? 27  DG  B C8    1 
ATOM   534  N N7    . DG  B 2 7  ? 25.980  20.658  5.089   1.00 21.98 ? 27  DG  B N7    1 
ATOM   535  C C5    . DG  B 2 7  ? 25.688  19.317  5.014   1.00 19.62 ? 27  DG  B C5    1 
ATOM   536  C C6    . DG  B 2 7  ? 26.566  18.267  4.918   1.00 23.30 ? 27  DG  B C6    1 
ATOM   537  O O6    . DG  B 2 7  ? 27.789  18.359  4.861   1.00 26.46 ? 27  DG  B O6    1 
ATOM   538  N N1    . DG  B 2 7  ? 25.928  17.050  4.883   1.00 20.23 ? 27  DG  B N1    1 
ATOM   539  C C2    . DG  B 2 7  ? 24.597  16.867  4.935   1.00 21.94 ? 27  DG  B C2    1 
ATOM   540  N N2    . DG  B 2 7  ? 24.145  15.603  4.920   1.00 18.38 ? 27  DG  B N2    1 
ATOM   541  N N3    . DG  B 2 7  ? 23.764  17.883  5.023   1.00 25.53 ? 27  DG  B N3    1 
ATOM   542  C C4    . DG  B 2 7  ? 24.370  19.076  5.062   1.00 18.96 ? 27  DG  B C4    1 
ATOM   543  P P     . DA  B 2 8  ? 19.338  20.403  7.681   1.00 24.61 ? 28  DA  B P     1 
ATOM   544  O OP1   . DA  B 2 8  ? 17.916  20.075  7.886   1.00 27.49 ? 28  DA  B OP1   1 
ATOM   545  O OP2   . DA  B 2 8  ? 20.043  21.253  8.681   1.00 21.27 ? 28  DA  B OP2   1 
ATOM   546  O "O5'" . DA  B 2 8  ? 20.017  19.035  7.504   1.00 18.50 ? 28  DA  B "O5'" 1 
ATOM   547  C "C5'" . DA  B 2 8  ? 19.334  17.994  6.909   1.00 17.25 ? 28  DA  B "C5'" 1 
ATOM   548  C "C4'" . DA  B 2 8  ? 20.081  16.779  7.284   1.00 23.18 ? 28  DA  B "C4'" 1 
ATOM   549  O "O4'" . DA  B 2 8  ? 21.495  17.047  7.078   1.00 24.88 ? 28  DA  B "O4'" 1 
ATOM   550  C "C3'" . DA  B 2 8  ? 19.865  16.439  8.767   1.00 23.78 ? 28  DA  B "C3'" 1 
ATOM   551  O "O3'" . DA  B 2 8  ? 19.894  15.003  8.987   1.00 25.41 ? 28  DA  B "O3'" 1 
ATOM   552  C "C2'" . DA  B 2 8  ? 21.147  17.026  9.316   1.00 25.84 ? 28  DA  B "C2'" 1 
ATOM   553  C "C1'" . DA  B 2 8  ? 22.151  16.671  8.269   1.00 23.83 ? 28  DA  B "C1'" 1 
ATOM   554  N N9    . DA  B 2 8  ? 23.387  17.417  8.355   1.00 20.73 ? 28  DA  B N9    1 
ATOM   555  C C8    . DA  B 2 8  ? 23.597  18.753  8.460   1.00 23.74 ? 28  DA  B C8    1 
ATOM   556  N N7    . DA  B 2 8  ? 24.873  19.095  8.449   1.00 26.07 ? 28  DA  B N7    1 
ATOM   557  C C5    . DA  B 2 8  ? 25.544  17.874  8.324   1.00 23.54 ? 28  DA  B C5    1 
ATOM   558  C C6    . DA  B 2 8  ? 26.909  17.507  8.232   1.00 19.94 ? 28  DA  B C6    1 
ATOM   559  N N6    . DA  B 2 8  ? 27.892  18.339  8.274   1.00 20.46 ? 28  DA  B N6    1 
ATOM   560  N N1    . DA  B 2 8  ? 27.262  16.249  8.101   1.00 15.19 ? 28  DA  B N1    1 
ATOM   561  C C2    . DA  B 2 8  ? 26.254  15.378  8.073   1.00 22.86 ? 28  DA  B C2    1 
ATOM   562  N N3    . DA  B 2 8  ? 24.928  15.561  8.150   1.00 24.59 ? 28  DA  B N3    1 
ATOM   563  C C4    . DA  B 2 8  ? 24.634  16.862  8.275   1.00 23.40 ? 28  DA  B C4    1 
ATOM   564  P P     . DT  B 2 9  ? 18.899  14.250  10.032  1.00 32.42 ? 29  DT  B P     1 
ATOM   565  O OP1   . DT  B 2 9  ? 17.952  13.354  9.293   1.00 28.92 ? 29  DT  B OP1   1 
ATOM   566  O OP2   . DT  B 2 9  ? 18.365  15.346  10.887  1.00 34.32 ? 29  DT  B OP2   1 
ATOM   567  O "O5'" . DT  B 2 9  ? 19.834  13.313  10.973  1.00 28.66 ? 29  DT  B "O5'" 1 
ATOM   568  C "C5'" . DT  B 2 9  ? 20.425  12.411  10.081  1.00 28.03 ? 29  DT  B "C5'" 1 
ATOM   569  C "C4'" . DT  B 2 9  ? 21.615  11.593  10.474  1.00 29.05 ? 29  DT  B "C4'" 1 
ATOM   570  O "O4'" . DT  B 2 9  ? 22.796  12.356  10.206  1.00 29.26 ? 29  DT  B "O4'" 1 
ATOM   571  C "C3'" . DT  B 2 9  ? 21.579  11.211  11.897  1.00 28.83 ? 29  DT  B "C3'" 1 
ATOM   572  O "O3'" . DT  B 2 9  ? 22.016  9.914   11.877  1.00 31.82 ? 29  DT  B "O3'" 1 
ATOM   573  C "C2'" . DT  B 2 9  ? 22.617  12.146  12.434  1.00 28.49 ? 29  DT  B "C2'" 1 
ATOM   574  C "C1'" . DT  B 2 9  ? 23.677  12.274  11.315  1.00 27.52 ? 29  DT  B "C1'" 1 
ATOM   575  N N1    . DT  B 2 9  ? 24.452  13.545  11.342  1.00 27.25 ? 29  DT  B N1    1 
ATOM   576  C C2    . DT  B 2 9  ? 25.825  13.545  11.163  1.00 27.20 ? 29  DT  B C2    1 
ATOM   577  O O2    . DT  B 2 9  ? 26.543  12.594  10.902  1.00 30.12 ? 29  DT  B O2    1 
ATOM   578  N N3    . DT  B 2 9  ? 26.419  14.739  11.274  1.00 28.22 ? 29  DT  B N3    1 
ATOM   579  C C4    . DT  B 2 9  ? 25.800  15.944  11.535  1.00 29.52 ? 29  DT  B C4    1 
ATOM   580  O O4    . DT  B 2 9  ? 26.485  16.980  11.629  1.00 32.17 ? 29  DT  B O4    1 
ATOM   581  C C5    . DT  B 2 9  ? 24.372  15.841  11.687  1.00 23.30 ? 29  DT  B C5    1 
ATOM   582  C C7    . DT  B 2 9  ? 23.518  17.019  11.937  1.00 24.45 ? 29  DT  B C7    1 
ATOM   583  C C6    . DT  B 2 9  ? 23.770  14.693  11.593  1.00 23.84 ? 29  DT  B C6    1 
ATOM   584  P P     . DG  B 2 10 ? 21.849  9.081   13.162  1.00 35.33 ? 30  DG  B P     1 
ATOM   585  O OP1   . DG  B 2 10 ? 21.391  7.723   12.743  1.00 33.69 ? 30  DG  B OP1   1 
ATOM   586  O OP2   . DG  B 2 10 ? 21.154  9.865   14.204  1.00 32.01 ? 30  DG  B OP2   1 
ATOM   587  O "O5'" . DG  B 2 10 ? 23.298  8.994   13.747  1.00 37.08 ? 30  DG  B "O5'" 1 
ATOM   588  C "C5'" . DG  B 2 10 ? 24.208  8.163   13.067  1.00 36.67 ? 30  DG  B "C5'" 1 
ATOM   589  C "C4'" . DG  B 2 10 ? 25.534  7.981   13.812  1.00 36.20 ? 30  DG  B "C4'" 1 
ATOM   590  O "O4'" . DG  B 2 10 ? 26.385  9.195   13.866  1.00 31.30 ? 30  DG  B "O4'" 1 
ATOM   591  C "C3'" . DG  B 2 10 ? 25.162  7.546   15.222  1.00 30.09 ? 30  DG  B "C3'" 1 
ATOM   592  O "O3'" . DG  B 2 10 ? 26.184  6.632   15.395  1.00 27.79 ? 30  DG  B "O3'" 1 
ATOM   593  C "C2'" . DG  B 2 10 ? 25.330  8.917   15.893  1.00 29.86 ? 30  DG  B "C2'" 1 
ATOM   594  C "C1'" . DG  B 2 10 ? 26.515  9.673   15.217  1.00 29.29 ? 30  DG  B "C1'" 1 
ATOM   595  N N9    . DG  B 2 10 ? 26.341  11.146  15.149  1.00 26.89 ? 30  DG  B N9    1 
ATOM   596  C C8    . DG  B 2 10 ? 25.194  11.870  15.286  1.00 29.20 ? 30  DG  B C8    1 
ATOM   597  N N7    . DG  B 2 10 ? 25.316  13.144  15.064  1.00 31.21 ? 30  DG  B N7    1 
ATOM   598  C C5    . DG  B 2 10 ? 26.665  13.278  14.757  1.00 28.20 ? 30  DG  B C5    1 
ATOM   599  C C6    . DG  B 2 10 ? 27.409  14.458  14.443  1.00 28.67 ? 30  DG  B C6    1 
ATOM   600  O O6    . DG  B 2 10 ? 27.045  15.630  14.345  1.00 26.12 ? 30  DG  B O6    1 
ATOM   601  N N1    . DG  B 2 10 ? 28.734  14.171  14.250  1.00 28.79 ? 30  DG  B N1    1 
ATOM   602  C C2    . DG  B 2 10 ? 29.287  12.916  14.345  1.00 32.11 ? 30  DG  B C2    1 
ATOM   603  N N2    . DG  B 2 10 ? 30.610  12.902  14.137  1.00 28.37 ? 30  DG  B N2    1 
ATOM   604  N N3    . DG  B 2 10 ? 28.595  11.783  14.632  1.00 28.50 ? 30  DG  B N3    1 
ATOM   605  C C4    . DG  B 2 10 ? 27.295  12.057  14.823  1.00 27.39 ? 30  DG  B C4    1 
ATOM   606  P P     . DA  B 2 11 ? 26.695  5.896   16.638  1.00 25.04 ? 31  DA  B P     1 
ATOM   607  O OP1   . DA  B 2 11 ? 27.516  4.826   16.028  1.00 21.56 ? 31  DA  B OP1   1 
ATOM   608  O OP2   . DA  B 2 11 ? 25.521  5.622   17.476  1.00 16.45 ? 31  DA  B OP2   1 
ATOM   609  O "O5'" . DA  B 2 11 ? 27.692  6.866   17.468  1.00 21.49 ? 31  DA  B "O5'" 1 
ATOM   610  C "C5'" . DA  B 2 11 ? 28.953  7.010   16.872  1.00 14.46 ? 31  DA  B "C5'" 1 
ATOM   611  C "C4'" . DA  B 2 11 ? 30.005  7.734   17.627  1.00 14.31 ? 31  DA  B "C4'" 1 
ATOM   612  O "O4'" . DA  B 2 11 ? 29.786  9.123   17.371  1.00 18.12 ? 31  DA  B "O4'" 1 
ATOM   613  C "C3'" . DA  B 2 11 ? 29.967  7.484   19.107  1.00 11.64 ? 31  DA  B "C3'" 1 
ATOM   614  O "O3'" . DA  B 2 11 ? 31.310  7.554   19.569  1.00 15.76 ? 31  DA  B "O3'" 1 
ATOM   615  C "C2'" . DA  B 2 11 ? 29.199  8.690   19.486  1.00 15.31 ? 31  DA  B "C2'" 1 
ATOM   616  C "C1'" . DA  B 2 11 ? 29.681  9.808   18.612  1.00 17.55 ? 31  DA  B "C1'" 1 
ATOM   617  N N9    . DA  B 2 11 ? 28.679  10.895  18.499  1.00 18.12 ? 31  DA  B N9    1 
ATOM   618  C C8    . DA  B 2 11 ? 27.342  10.799  18.555  1.00 17.61 ? 31  DA  B C8    1 
ATOM   619  N N7    . DA  B 2 11 ? 26.714  11.929  18.426  1.00 19.10 ? 31  DA  B N7    1 
ATOM   620  C C5    . DA  B 2 11 ? 27.701  12.827  18.271  1.00 12.02 ? 31  DA  B C5    1 
ATOM   621  C C6    . DA  B 2 11 ? 27.685  14.168  18.132  1.00 11.92 ? 31  DA  B C6    1 
ATOM   622  N N6    . DA  B 2 11 ? 26.596  14.816  18.046  1.00 13.90 ? 31  DA  B N6    1 
ATOM   623  N N1    . DA  B 2 11 ? 28.783  14.859  18.031  1.00 16.86 ? 31  DA  B N1    1 
ATOM   624  C C2    . DA  B 2 11 ? 29.874  14.143  18.080  1.00 18.03 ? 31  DA  B C2    1 
ATOM   625  N N3    . DA  B 2 11 ? 30.044  12.830  18.212  1.00 16.81 ? 31  DA  B N3    1 
ATOM   626  C C4    . DA  B 2 11 ? 28.887  12.222  18.309  1.00 14.51 ? 31  DA  B C4    1 
ATOM   627  P P     . DG  B 2 12 ? 32.000  7.235   21.002  1.00 22.84 ? 32  DG  B P     1 
ATOM   628  O OP1   . DG  B 2 12 ? 33.026  6.221   20.736  1.00 27.32 ? 32  DG  B OP1   1 
ATOM   629  O OP2   . DG  B 2 12 ? 30.956  6.915   21.985  1.00 29.19 ? 32  DG  B OP2   1 
ATOM   630  O "O5'" . DG  B 2 12 ? 32.729  8.545   21.507  1.00 16.20 ? 32  DG  B "O5'" 1 
ATOM   631  C "C5'" . DG  B 2 12 ? 33.907  8.831   20.819  1.00 14.50 ? 32  DG  B "C5'" 1 
ATOM   632  C "C4'" . DG  B 2 12 ? 34.505  10.166  21.052  1.00 15.91 ? 32  DG  B "C4'" 1 
ATOM   633  O "O4'" . DG  B 2 12 ? 33.540  11.109  20.594  1.00 17.48 ? 32  DG  B "O4'" 1 
ATOM   634  C "C3'" . DG  B 2 12 ? 34.754  10.509  22.505  1.00 17.56 ? 32  DG  B "C3'" 1 
ATOM   635  O "O3'" . DG  B 2 12 ? 35.993  11.172  22.477  1.00 19.43 ? 32  DG  B "O3'" 1 
ATOM   636  C "C2'" . DG  B 2 12 ? 33.593  11.427  22.836  1.00 17.69 ? 32  DG  B "C2'" 1 
ATOM   637  C "C1'" . DG  B 2 12 ? 33.248  12.150  21.522  1.00 15.37 ? 32  DG  B "C1'" 1 
ATOM   638  N N9    . DG  B 2 12 ? 31.806  12.447  21.431  1.00 17.24 ? 32  DG  B N9    1 
ATOM   639  C C8    . DG  B 2 12 ? 30.809  11.515  21.584  1.00 22.36 ? 32  DG  B C8    1 
ATOM   640  N N7    . DG  B 2 12 ? 29.604  12.021  21.522  1.00 27.46 ? 32  DG  B N7    1 
ATOM   641  C C5    . DG  B 2 12 ? 29.805  13.390  21.309  1.00 23.20 ? 32  DG  B C5    1 
ATOM   642  C C6    . DG  B 2 12 ? 28.851  14.458  21.154  1.00 22.88 ? 32  DG  B C6    1 
ATOM   643  O O6    . DG  B 2 12 ? 27.629  14.464  21.241  1.00 21.55 ? 32  DG  B O6    1 
ATOM   644  N N1    . DG  B 2 12 ? 29.472  15.648  20.948  1.00 22.07 ? 32  DG  B N1    1 
ATOM   645  C C2    . DG  B 2 12 ? 30.825  15.826  20.904  1.00 24.76 ? 32  DG  B C2    1 
ATOM   646  N N2    . DG  B 2 12 ? 31.237  17.085  20.684  1.00 25.63 ? 32  DG  B N2    1 
ATOM   647  N N3    . DG  B 2 12 ? 31.712  14.827  21.056  1.00 20.42 ? 32  DG  B N3    1 
ATOM   648  C C4    . DG  B 2 12 ? 31.145  13.647  21.252  1.00 18.19 ? 32  DG  B C4    1 
ATOM   649  P P     . DT  B 2 13 ? 36.742  11.462  23.756  1.00 17.55 ? 33  DT  B P     1 
ATOM   650  O OP1   . DT  B 2 13 ? 38.129  11.880  23.538  1.00 16.81 ? 33  DT  B OP1   1 
ATOM   651  O OP2   . DT  B 2 13 ? 36.399  10.351  24.664  1.00 13.54 ? 33  DT  B OP2   1 
ATOM   652  O "O5'" . DT  B 2 13 ? 35.927  12.806  23.878  1.00 14.55 ? 33  DT  B "O5'" 1 
ATOM   653  C "C5'" . DT  B 2 13 ? 36.433  13.871  23.091  1.00 11.54 ? 33  DT  B "C5'" 1 
ATOM   654  C "C4'" . DT  B 2 13 ? 35.960  15.270  23.430  1.00 14.20 ? 33  DT  B "C4'" 1 
ATOM   655  O "O4'" . DT  B 2 13 ? 34.550  15.346  23.160  1.00 17.57 ? 33  DT  B "O4'" 1 
ATOM   656  C "C3'" . DT  B 2 13 ? 36.139  15.629  24.892  1.00 15.95 ? 33  DT  B "C3'" 1 
ATOM   657  O "O3'" . DT  B 2 13 ? 36.499  16.983  24.869  1.00 22.21 ? 33  DT  B "O3'" 1 
ATOM   658  C "C2'" . DT  B 2 13 ? 34.770  15.425  25.433  1.00 14.20 ? 33  DT  B "C2'" 1 
ATOM   659  C "C1'" . DT  B 2 13 ? 33.902  15.981  24.291  1.00 18.29 ? 33  DT  B "C1'" 1 
ATOM   660  N N1    . DT  B 2 13 ? 32.430  15.571  24.408  1.00 14.71 ? 33  DT  B N1    1 
ATOM   661  C C2    . DT  B 2 13 ? 31.440  16.495  24.195  1.00 15.91 ? 33  DT  B C2    1 
ATOM   662  O O2    . DT  B 2 13 ? 31.582  17.663  23.893  1.00 20.09 ? 33  DT  B O2    1 
ATOM   663  N N3    . DT  B 2 13 ? 30.172  16.105  24.328  1.00 18.37 ? 33  DT  B N3    1 
ATOM   664  C C4    . DT  B 2 13 ? 29.736  14.872  24.658  1.00 24.12 ? 33  DT  B C4    1 
ATOM   665  O O4    . DT  B 2 13 ? 28.526  14.655  24.781  1.00 30.40 ? 33  DT  B O4    1 
ATOM   666  C C5    . DT  B 2 13 ? 30.809  13.958  24.859  1.00 17.89 ? 33  DT  B C5    1 
ATOM   667  C C7    . DT  B 2 13 ? 30.495  12.556  25.196  1.00 16.21 ? 33  DT  B C7    1 
ATOM   668  C C6    . DT  B 2 13 ? 32.081  14.317  24.735  1.00 14.73 ? 33  DT  B C6    1 
ATOM   669  P P     . DC  B 2 14 ? 36.849  17.908  26.119  1.00 26.35 ? 34  DC  B P     1 
ATOM   670  O OP1   . DC  B 2 14 ? 38.058  18.718  25.800  1.00 20.50 ? 34  DC  B OP1   1 
ATOM   671  O OP2   . DC  B 2 14 ? 36.844  17.009  27.325  1.00 27.11 ? 34  DC  B OP2   1 
ATOM   672  O "O5'" . DC  B 2 14 ? 35.504  18.838  26.158  1.00 22.70 ? 34  DC  B "O5'" 1 
ATOM   673  C "C5'" . DC  B 2 14 ? 35.639  20.095  25.508  1.00 22.27 ? 34  DC  B "C5'" 1 
ATOM   674  C "C4'" . DC  B 2 14 ? 34.653  21.119  25.987  1.00 23.36 ? 34  DC  B "C4'" 1 
ATOM   675  O "O4'" . DC  B 2 14 ? 33.307  20.639  25.710  1.00 27.86 ? 34  DC  B "O4'" 1 
ATOM   676  C "C3'" . DC  B 2 14 ? 34.813  21.313  27.461  1.00 24.98 ? 34  DC  B "C3'" 1 
ATOM   677  O "O3'" . DC  B 2 14 ? 34.714  22.561  28.149  1.00 26.38 ? 34  DC  B "O3'" 1 
ATOM   678  C "C2'" . DC  B 2 14 ? 33.557  20.724  27.975  1.00 29.45 ? 34  DC  B "C2'" 1 
ATOM   679  C "C1'" . DC  B 2 14 ? 32.472  20.658  26.890  1.00 28.75 ? 34  DC  B "C1'" 1 
ATOM   680  N N1    . DC  B 2 14 ? 31.696  19.366  27.137  1.00 29.67 ? 34  DC  B N1    1 
ATOM   681  C C2    . DC  B 2 14 ? 30.348  19.401  27.322  1.00 30.49 ? 34  DC  B C2    1 
ATOM   682  O O2    . DC  B 2 14 ? 29.755  20.454  27.249  1.00 31.40 ? 34  DC  B O2    1 
ATOM   683  N N3    . DC  B 2 14 ? 29.676  18.255  27.589  1.00 32.59 ? 34  DC  B N3    1 
ATOM   684  C C4    . DC  B 2 14 ? 30.305  17.089  27.672  1.00 29.10 ? 34  DC  B C4    1 
ATOM   685  N N4    . DC  B 2 14 ? 29.602  16.000  27.931  1.00 26.02 ? 34  DC  B N4    1 
ATOM   686  C C5    . DC  B 2 14 ? 31.700  17.010  27.482  1.00 27.77 ? 34  DC  B C5    1 
ATOM   687  C C6    . DC  B 2 14 ? 32.347  18.163  27.219  1.00 28.57 ? 34  DC  B C6    1 
ATOM   688  P P     . DA  B 2 15 ? 34.355  24.049  27.915  1.00 26.48 ? 35  DA  B P     1 
ATOM   689  O OP1   . DA  B 2 15 ? 34.317  24.398  26.495  1.00 26.08 ? 35  DA  B OP1   1 
ATOM   690  O OP2   . DA  B 2 15 ? 35.291  24.817  28.769  1.00 26.73 ? 35  DA  B OP2   1 
ATOM   691  O "O5'" . DA  B 2 15 ? 32.849  23.945  28.553  1.00 29.54 ? 35  DA  B "O5'" 1 
ATOM   692  C "C5'" . DA  B 2 15 ? 31.648  24.436  27.874  1.00 30.61 ? 35  DA  B "C5'" 1 
ATOM   693  C "C4'" . DA  B 2 15 ? 30.273  24.660  28.677  1.00 29.59 ? 35  DA  B "C4'" 1 
ATOM   694  O "O4'" . DA  B 2 15 ? 29.617  23.374  28.820  1.00 28.32 ? 35  DA  B "O4'" 1 
ATOM   695  C "C3'" . DA  B 2 15 ? 30.483  25.280  30.090  1.00 29.20 ? 35  DA  B "C3'" 1 
ATOM   696  O "O3'" . DA  B 2 15 ? 29.391  26.134  30.606  1.00 30.05 ? 35  DA  B "O3'" 1 
ATOM   697  C "C2'" . DA  B 2 15 ? 30.411  23.962  30.851  1.00 28.80 ? 35  DA  B "C2'" 1 
ATOM   698  C "C1'" . DA  B 2 15 ? 29.431  23.025  30.166  1.00 24.87 ? 35  DA  B "C1'" 1 
ATOM   699  N N9    . DA  B 2 15 ? 29.792  21.614  30.332  1.00 25.17 ? 35  DA  B N9    1 
ATOM   700  C C8    . DA  B 2 15 ? 31.012  21.049  30.471  1.00 22.59 ? 35  DA  B C8    1 
ATOM   701  N N7    . DA  B 2 15 ? 30.994  19.758  30.608  1.00 21.80 ? 35  DA  B N7    1 
ATOM   702  C C5    . DA  B 2 15 ? 29.650  19.451  30.551  1.00 21.72 ? 35  DA  B C5    1 
ATOM   703  C C6    . DA  B 2 15 ? 28.936  18.233  30.646  1.00 23.19 ? 35  DA  B C6    1 
ATOM   704  N N6    . DA  B 2 15 ? 29.521  17.038  30.740  1.00 22.78 ? 35  DA  B N6    1 
ATOM   705  N N1    . DA  B 2 15 ? 27.591  18.279  30.575  1.00 20.53 ? 35  DA  B N1    1 
ATOM   706  C C2    . DA  B 2 15 ? 27.014  19.463  30.406  1.00 22.17 ? 35  DA  B C2    1 
ATOM   707  N N3    . DA  B 2 15 ? 27.574  20.666  30.295  1.00 23.65 ? 35  DA  B N3    1 
ATOM   708  C C4    . DA  B 2 15 ? 28.915  20.581  30.382  1.00 23.76 ? 35  DA  B C4    1 
ATOM   709  P P     . DT  B 2 16 ? 29.175  26.456  32.246  1.00 33.97 ? 36  DT  B P     1 
ATOM   710  O OP1   . DT  B 2 16 ? 28.473  27.752  32.319  1.00 33.79 ? 36  DT  B OP1   1 
ATOM   711  O OP2   . DT  B 2 16 ? 30.422  26.216  33.024  1.00 29.87 ? 36  DT  B OP2   1 
ATOM   712  O "O5'" . DT  B 2 16 ? 28.132  25.318  32.597  1.00 29.62 ? 36  DT  B "O5'" 1 
ATOM   713  C "C5'" . DT  B 2 16 ? 26.947  25.327  31.819  1.00 32.67 ? 36  DT  B "C5'" 1 
ATOM   714  C "C4'" . DT  B 2 16 ? 25.750  24.498  32.309  1.00 33.14 ? 36  DT  B "C4'" 1 
ATOM   715  O "O4'" . DT  B 2 16 ? 26.023  23.069  32.282  1.00 33.33 ? 36  DT  B "O4'" 1 
ATOM   716  C "C3'" . DT  B 2 16 ? 25.490  24.830  33.714  1.00 31.25 ? 36  DT  B "C3'" 1 
ATOM   717  O "O3'" . DT  B 2 16 ? 24.120  24.810  33.881  1.00 27.09 ? 36  DT  B "O3'" 1 
ATOM   718  C "C2'" . DT  B 2 16 ? 26.137  23.680  34.447  1.00 30.03 ? 36  DT  B "C2'" 1 
ATOM   719  C "C1'" . DT  B 2 16 ? 25.908  22.512  33.577  1.00 29.50 ? 36  DT  B "C1'" 1 
ATOM   720  N N1    . DT  B 2 16 ? 26.936  21.451  33.696  1.00 28.25 ? 36  DT  B N1    1 
ATOM   721  C C2    . DT  B 2 16 ? 26.468  20.172  33.503  1.00 31.97 ? 36  DT  B C2    1 
ATOM   722  O O2    . DT  B 2 16 ? 25.301  19.926  33.238  1.00 37.45 ? 36  DT  B O2    1 
ATOM   723  N N3    . DT  B 2 16 ? 27.340  19.126  33.606  1.00 31.25 ? 36  DT  B N3    1 
ATOM   724  C C4    . DT  B 2 16 ? 28.647  19.233  33.887  1.00 31.00 ? 36  DT  B C4    1 
ATOM   725  O O4    . DT  B 2 16 ? 29.303  18.206  33.933  1.00 31.48 ? 36  DT  B O4    1 
ATOM   726  C C5    . DT  B 2 16 ? 29.079  20.593  34.082  1.00 29.77 ? 36  DT  B C5    1 
ATOM   727  C C7    . DT  B 2 16 ? 30.491  20.847  34.424  1.00 27.41 ? 36  DT  B C7    1 
ATOM   728  C C6    . DT  B 2 16 ? 28.243  21.645  33.984  1.00 28.92 ? 36  DT  B C6    1 
ATOM   729  P P     . DA  B 2 17 ? 23.439  25.421  35.223  1.00 28.70 ? 37  DA  B P     1 
ATOM   730  O OP1   . DA  B 2 17 ? 22.412  26.316  34.628  1.00 28.58 ? 37  DA  B OP1   1 
ATOM   731  O OP2   . DA  B 2 17 ? 24.406  25.931  36.228  1.00 28.08 ? 37  DA  B OP2   1 
ATOM   732  O "O5'" . DA  B 2 17 ? 22.903  24.055  35.933  1.00 27.10 ? 37  DA  B "O5'" 1 
ATOM   733  C "C5'" . DA  B 2 17 ? 22.370  23.119  34.993  1.00 28.73 ? 37  DA  B "C5'" 1 
ATOM   734  C "C4'" . DA  B 2 17 ? 21.356  22.115  35.474  1.00 25.40 ? 37  DA  B "C4'" 1 
ATOM   735  O "O4'" . DA  B 2 17 ? 21.986  20.861  35.677  1.00 28.48 ? 37  DA  B "O4'" 1 
ATOM   736  C "C3'" . DA  B 2 17 ? 20.773  22.496  36.779  1.00 22.99 ? 37  DA  B "C3'" 1 
ATOM   737  O "O3'" . DA  B 2 17 ? 19.572  21.791  36.804  1.00 25.23 ? 37  DA  B "O3'" 1 
ATOM   738  C "C2'" . DA  B 2 17 ? 21.805  21.989  37.730  1.00 23.10 ? 37  DA  B "C2'" 1 
ATOM   739  C "C1'" . DA  B 2 17 ? 22.313  20.758  37.050  1.00 24.86 ? 37  DA  B "C1'" 1 
ATOM   740  N N9    . DA  B 2 17 ? 23.744  20.633  37.097  1.00 20.58 ? 37  DA  B N9    1 
ATOM   741  C C8    . DA  B 2 17 ? 24.730  21.560  37.235  1.00 21.68 ? 37  DA  B C8    1 
ATOM   742  N N7    . DA  B 2 17 ? 25.950  21.052  37.284  1.00 23.13 ? 37  DA  B N7    1 
ATOM   743  C C5    . DA  B 2 17 ? 25.701  19.704  37.163  1.00 22.93 ? 37  DA  B C5    1 
ATOM   744  C C6    . DA  B 2 17 ? 26.564  18.623  37.152  1.00 24.99 ? 37  DA  B C6    1 
ATOM   745  N N6    . DA  B 2 17 ? 27.852  18.791  37.295  1.00 23.46 ? 37  DA  B N6    1 
ATOM   746  N N1    . DA  B 2 17 ? 26.016  17.396  37.018  1.00 22.77 ? 37  DA  B N1    1 
ATOM   747  C C2    . DA  B 2 17 ? 24.656  17.307  36.908  1.00 24.95 ? 37  DA  B C2    1 
ATOM   748  N N3    . DA  B 2 17 ? 23.713  18.265  36.909  1.00 22.75 ? 37  DA  B N3    1 
ATOM   749  C C4    . DA  B 2 17 ? 24.351  19.454  37.044  1.00 22.19 ? 37  DA  B C4    1 
ATOM   750  P P     . DG  B 2 18 ? 18.648  21.807  38.077  1.00 29.42 ? 38  DG  B P     1 
ATOM   751  O OP1   . DG  B 2 18 ? 17.268  21.635  37.524  1.00 21.69 ? 38  DG  B OP1   1 
ATOM   752  O OP2   . DG  B 2 18 ? 18.979  22.967  38.928  1.00 30.20 ? 38  DG  B OP2   1 
ATOM   753  O "O5'" . DG  B 2 18 ? 19.218  20.577  38.972  1.00 24.96 ? 38  DG  B "O5'" 1 
ATOM   754  C "C5'" . DG  B 2 18 ? 18.848  19.327  38.469  1.00 22.06 ? 38  DG  B "C5'" 1 
ATOM   755  C "C4'" . DG  B 2 18 ? 19.305  18.227  39.302  1.00 25.67 ? 38  DG  B "C4'" 1 
ATOM   756  O "O4'" . DG  B 2 18 ? 20.744  18.261  39.189  1.00 26.80 ? 38  DG  B "O4'" 1 
ATOM   757  C "C3'" . DG  B 2 18 ? 18.998  18.374  40.794  1.00 29.32 ? 38  DG  B "C3'" 1 
ATOM   758  O "O3'" . DG  B 2 18 ? 18.479  17.093  41.135  1.00 35.13 ? 38  DG  B "O3'" 1 
ATOM   759  C "C2'" . DG  B 2 18 ? 20.403  18.616  41.321  1.00 27.51 ? 38  DG  B "C2'" 1 
ATOM   760  C "C1'" . DG  B 2 18 ? 21.310  17.766  40.391  1.00 24.24 ? 38  DG  B "C1'" 1 
ATOM   761  N N9    . DG  B 2 18 ? 22.744  18.146  40.355  1.00 24.04 ? 38  DG  B N9    1 
ATOM   762  C C8    . DG  B 2 18 ? 23.265  19.426  40.264  1.00 24.90 ? 38  DG  B C8    1 
ATOM   763  N N7    . DG  B 2 18 ? 24.568  19.497  40.260  1.00 24.11 ? 38  DG  B N7    1 
ATOM   764  C C5    . DG  B 2 18 ? 24.956  18.151  40.352  1.00 24.69 ? 38  DG  B C5    1 
ATOM   765  C C6    . DG  B 2 18 ? 26.294  17.574  40.404  1.00 27.36 ? 38  DG  B C6    1 
ATOM   766  O O6    . DG  B 2 18 ? 27.413  18.112  40.341  1.00 26.06 ? 38  DG  B O6    1 
ATOM   767  N N1    . DG  B 2 18 ? 26.199  16.197  40.525  1.00 23.53 ? 38  DG  B N1    1 
ATOM   768  C C2    . DG  B 2 18 ? 25.009  15.516  40.571  1.00 24.63 ? 38  DG  B C2    1 
ATOM   769  N N2    . DG  B 2 18 ? 25.120  14.233  40.711  1.00 30.51 ? 38  DG  B N2    1 
ATOM   770  N N3    . DG  B 2 18 ? 23.789  16.025  40.509  1.00 21.67 ? 38  DG  B N3    1 
ATOM   771  C C4    . DG  B 2 18 ? 23.836  17.340  40.406  1.00 21.30 ? 38  DG  B C4    1 
ATOM   772  P P     . DG  B 2 19 ? 18.084  16.420  42.561  1.00 38.33 ? 39  DG  B P     1 
ATOM   773  O OP1   . DG  B 2 19 ? 16.904  15.551  42.274  1.00 36.38 ? 39  DG  B OP1   1 
ATOM   774  O OP2   . DG  B 2 19 ? 17.928  17.528  43.540  1.00 35.48 ? 39  DG  B OP2   1 
ATOM   775  O "O5'" . DG  B 2 19 ? 19.501  15.513  42.887  1.00 36.99 ? 39  DG  B "O5'" 1 
ATOM   776  C "C5'" . DG  B 2 19 ? 20.216  14.534  41.994  1.00 36.55 ? 39  DG  B "C5'" 1 
ATOM   777  C "C4'" . DG  B 2 19 ? 21.356  13.525  42.581  1.00 37.03 ? 39  DG  B "C4'" 1 
ATOM   778  O "O4'" . DG  B 2 19 ? 22.797  13.931  42.720  1.00 34.63 ? 39  DG  B "O4'" 1 
ATOM   779  C "C3'" . DG  B 2 19 ? 20.913  13.397  44.037  1.00 37.28 ? 39  DG  B "C3'" 1 
ATOM   780  O "O3'" . DG  B 2 19 ? 21.489  12.179  44.509  1.00 39.79 ? 39  DG  B "O3'" 1 
ATOM   781  C "C2'" . DG  B 2 19 ? 21.551  14.627  44.654  1.00 32.84 ? 39  DG  B "C2'" 1 
ATOM   782  C "C1'" . DG  B 2 19 ? 22.884  14.533  44.032  1.00 26.61 ? 39  DG  B "C1'" 1 
ATOM   783  N N9    . DG  B 2 19 ? 23.520  15.844  43.953  1.00 20.58 ? 39  DG  B N9    1 
ATOM   784  C C8    . DG  B 2 19 ? 22.974  17.096  43.984  1.00 20.70 ? 39  DG  B C8    1 
ATOM   785  N N7    . DG  B 2 19 ? 23.838  18.072  43.853  1.00 16.66 ? 39  DG  B N7    1 
ATOM   786  C C5    . DG  B 2 19 ? 25.041  17.389  43.727  1.00 21.83 ? 39  DG  B C5    1 
ATOM   787  C C6    . DG  B 2 19 ? 26.398  17.895  43.609  1.00 26.82 ? 39  DG  B C6    1 
ATOM   788  O O6    . DG  B 2 19 ? 26.779  19.073  43.584  1.00 29.06 ? 39  DG  B O6    1 
ATOM   789  N N1    . DG  B 2 19 ? 27.354  16.844  43.563  1.00 24.64 ? 39  DG  B N1    1 
ATOM   790  C C2    . DG  B 2 19 ? 27.018  15.508  43.628  1.00 23.72 ? 39  DG  B C2    1 
ATOM   791  N N2    . DG  B 2 19 ? 28.022  14.666  43.595  1.00 14.97 ? 39  DG  B N2    1 
ATOM   792  N N3    . DG  B 2 19 ? 25.759  15.043  43.734  1.00 23.90 ? 39  DG  B N3    1 
ATOM   793  C C4    . DG  B 2 19 ? 24.835  16.032  43.780  1.00 21.61 ? 39  DG  B C4    1 
ATOM   794  P P     . DA  B 2 20 ? 20.773  11.181  45.589  1.00 45.01 ? 40  DA  B P     1 
ATOM   795  O OP1   . DA  B 2 20 ? 20.884  9.800   45.026  1.00 44.64 ? 40  DA  B OP1   1 
ATOM   796  O OP2   . DA  B 2 20 ? 19.415  11.652  46.004  1.00 45.32 ? 40  DA  B OP2   1 
ATOM   797  O "O5'" . DA  B 2 20 ? 21.829  11.474  46.814  1.00 42.64 ? 40  DA  B "O5'" 1 
ATOM   798  C "C5'" . DA  B 2 20 ? 23.118  10.941  46.539  1.00 41.31 ? 40  DA  B "C5'" 1 
ATOM   799  C "C4'" . DA  B 2 20 ? 24.248  11.408  47.373  1.00 38.44 ? 40  DA  B "C4'" 1 
ATOM   800  O "O4'" . DA  B 2 20 ? 24.562  12.713  46.815  1.00 36.09 ? 40  DA  B "O4'" 1 
ATOM   801  C "C3'" . DA  B 2 20 ? 23.917  11.556  48.857  1.00 36.84 ? 40  DA  B "C3'" 1 
ATOM   802  O "O3'" . DA  B 2 20 ? 24.930  10.998  49.700  1.00 36.74 ? 40  DA  B "O3'" 1 
ATOM   803  C "C2'" . DA  B 2 20 ? 24.115  13.083  48.896  1.00 37.35 ? 40  DA  B "C2'" 1 
ATOM   804  C "C1'" . DA  B 2 20 ? 25.185  13.390  47.838  1.00 31.22 ? 40  DA  B "C1'" 1 
ATOM   805  N N9    . DA  B 2 20 ? 25.336  14.862  47.570  1.00 25.65 ? 40  DA  B N9    1 
ATOM   806  C C8    . DA  B 2 20 ? 24.420  15.880  47.719  1.00 25.73 ? 40  DA  B C8    1 
ATOM   807  N N7    . DA  B 2 20 ? 24.936  17.093  47.593  1.00 21.91 ? 40  DA  B N7    1 
ATOM   808  C C5    . DA  B 2 20 ? 26.286  16.851  47.329  1.00 19.03 ? 40  DA  B C5    1 
ATOM   809  C C6    . DA  B 2 20 ? 27.364  17.702  47.107  1.00 19.51 ? 40  DA  B C6    1 
ATOM   810  N N6    . DA  B 2 20 ? 27.262  19.017  47.164  1.00 22.03 ? 40  DA  B N6    1 
ATOM   811  N N1    . DA  B 2 20 ? 28.547  17.167  46.873  1.00 14.27 ? 40  DA  B N1    1 
ATOM   812  C C2    . DA  B 2 20 ? 28.628  15.868  46.873  1.00 14.82 ? 40  DA  B C2    1 
ATOM   813  N N3    . DA  B 2 20 ? 27.712  14.951  47.072  1.00 16.71 ? 40  DA  B N3    1 
ATOM   814  C C4    . DA  B 2 20 ? 26.536  15.513  47.301  1.00 18.38 ? 40  DA  B C4    1 
ATOM   815  N N     . LYS C 3 2  ? 35.801  35.304  10.307  1.00 42.23 ? 225 LYS C N     1 
ATOM   816  C CA    . LYS C 3 2  ? 35.321  33.990  9.875   1.00 42.36 ? 225 LYS C CA    1 
ATOM   817  C C     . LYS C 3 2  ? 36.036  33.088  8.810   1.00 40.71 ? 225 LYS C C     1 
ATOM   818  O O     . LYS C 3 2  ? 35.856  33.182  7.601   1.00 39.52 ? 225 LYS C O     1 
ATOM   819  C CB    . LYS C 3 2  ? 33.855  34.216  9.453   1.00 46.78 ? 225 LYS C CB    1 
ATOM   820  C CG    . LYS C 3 2  ? 33.821  35.233  8.312   1.00 48.36 ? 225 LYS C CG    1 
ATOM   821  C CD    . LYS C 3 2  ? 32.523  35.422  7.577   1.00 45.84 ? 225 LYS C CD    1 
ATOM   822  C CE    . LYS C 3 2  ? 32.872  36.524  6.599   1.00 46.41 ? 225 LYS C CE    1 
ATOM   823  N NZ    . LYS C 3 2  ? 31.774  37.466  6.489   1.00 43.17 ? 225 LYS C NZ    1 
ATOM   824  N N     . ASP C 3 3  ? 36.918  32.154  9.172   1.00 41.20 ? 226 ASP C N     1 
ATOM   825  C CA    . ASP C 3 3  ? 37.407  31.179  8.181   1.00 40.26 ? 226 ASP C CA    1 
ATOM   826  C C     . ASP C 3 3  ? 36.162  30.466  7.561   1.00 39.22 ? 226 ASP C C     1 
ATOM   827  O O     . ASP C 3 3  ? 35.145  30.417  8.282   1.00 37.12 ? 226 ASP C O     1 
ATOM   828  C CB    . ASP C 3 3  ? 38.339  30.180  8.941   1.00 42.34 ? 226 ASP C CB    1 
ATOM   829  C CG    . ASP C 3 3  ? 39.514  29.534  8.164   1.00 45.78 ? 226 ASP C CG    1 
ATOM   830  O OD1   . ASP C 3 3  ? 39.482  29.391  6.930   1.00 45.44 ? 226 ASP C OD1   1 
ATOM   831  O OD2   . ASP C 3 3  ? 40.494  29.154  8.818   1.00 44.91 ? 226 ASP C OD2   1 
ATOM   832  N N     . PRO C 3 4  ? 36.076  29.880  6.354   1.00 39.18 ? 227 PRO C N     1 
ATOM   833  C CA    . PRO C 3 4  ? 35.059  28.847  6.035   1.00 38.06 ? 227 PRO C CA    1 
ATOM   834  C C     . PRO C 3 4  ? 34.871  27.708  7.112   1.00 36.21 ? 227 PRO C C     1 
ATOM   835  O O     . PRO C 3 4  ? 33.768  27.208  7.306   1.00 36.15 ? 227 PRO C O     1 
ATOM   836  C CB    . PRO C 3 4  ? 35.505  28.355  4.643   1.00 38.86 ? 227 PRO C CB    1 
ATOM   837  C CG    . PRO C 3 4  ? 36.089  29.597  4.011   1.00 40.16 ? 227 PRO C CG    1 
ATOM   838  C CD    . PRO C 3 4  ? 36.888  30.191  5.185   1.00 40.95 ? 227 PRO C CD    1 
ATOM   839  N N     . ALA C 3 5  ? 35.879  27.223  7.859   1.00 32.59 ? 228 ALA C N     1 
ATOM   840  C CA    . ALA C 3 5  ? 35.682  26.420  9.095   1.00 30.65 ? 228 ALA C CA    1 
ATOM   841  C C     . ALA C 3 5  ? 34.910  27.112  10.250  1.00 28.50 ? 228 ALA C C     1 
ATOM   842  O O     . ALA C 3 5  ? 34.162  26.536  11.041  1.00 26.36 ? 228 ALA C O     1 
ATOM   843  C CB    . ALA C 3 5  ? 36.985  26.018  9.738   1.00 31.99 ? 228 ALA C CB    1 
ATOM   844  N N     . ALA C 3 6  ? 35.125  28.414  10.380  1.00 25.00 ? 229 ALA C N     1 
ATOM   845  C CA    . ALA C 3 6  ? 34.447  29.131  11.430  1.00 25.77 ? 229 ALA C CA    1 
ATOM   846  C C     . ALA C 3 6  ? 33.004  29.243  11.002  1.00 27.42 ? 229 ALA C C     1 
ATOM   847  O O     . ALA C 3 6  ? 32.142  28.775  11.712  1.00 31.84 ? 229 ALA C O     1 
ATOM   848  C CB    . ALA C 3 6  ? 35.085  30.498  11.585  1.00 31.07 ? 229 ALA C CB    1 
ATOM   849  N N     . LEU C 3 7  ? 32.751  29.774  9.817   1.00 26.98 ? 230 LEU C N     1 
ATOM   850  C CA    . LEU C 3 7  ? 31.433  29.886  9.199   1.00 25.81 ? 230 LEU C CA    1 
ATOM   851  C C     . LEU C 3 7  ? 30.757  28.549  9.362   1.00 24.21 ? 230 LEU C C     1 
ATOM   852  O O     . LEU C 3 7  ? 29.736  28.392  10.021  1.00 26.08 ? 230 LEU C O     1 
ATOM   853  C CB    . LEU C 3 7  ? 31.585  30.154  7.740   1.00 28.93 ? 230 LEU C CB    1 
ATOM   854  C CG    . LEU C 3 7  ? 30.639  30.863  6.861   1.00 29.43 ? 230 LEU C CG    1 
ATOM   855  C CD1   . LEU C 3 7  ? 30.860  32.357  6.991   1.00 29.66 ? 230 LEU C CD1   1 
ATOM   856  C CD2   . LEU C 3 7  ? 30.888  30.395  5.423   1.00 30.34 ? 230 LEU C CD2   1 
ATOM   857  N N     . LYS C 3 8  ? 31.427  27.537  8.825   1.00 24.38 ? 231 LYS C N     1 
ATOM   858  C CA    . LYS C 3 8  ? 30.886  26.196  8.853   1.00 26.93 ? 231 LYS C CA    1 
ATOM   859  C C     . LYS C 3 8  ? 30.495  25.757  10.247  1.00 28.08 ? 231 LYS C C     1 
ATOM   860  O O     . LYS C 3 8  ? 29.368  25.282  10.422  1.00 26.46 ? 231 LYS C O     1 
ATOM   861  C CB    . LYS C 3 8  ? 31.901  25.202  8.284   1.00 26.67 ? 231 LYS C CB    1 
ATOM   862  C CG    . LYS C 3 8  ? 31.470  24.298  7.127   1.00 32.27 ? 231 LYS C CG    1 
ATOM   863  C CD    . LYS C 3 8  ? 30.592  23.079  7.530   1.00 39.67 ? 231 LYS C CD    1 
ATOM   864  C CE    . LYS C 3 8  ? 29.070  23.343  7.771   1.00 42.95 ? 231 LYS C CE    1 
ATOM   865  N NZ    . LYS C 3 8  ? 28.343  22.244  8.417   1.00 40.74 ? 231 LYS C NZ    1 
ATOM   866  N N     . ARG C 3 9  ? 31.351  25.963  11.256  1.00 30.34 ? 232 ARG C N     1 
ATOM   867  C CA    . ARG C 3 9  ? 31.029  25.442  12.587  1.00 34.19 ? 232 ARG C CA    1 
ATOM   868  C C     . ARG C 3 9  ? 29.775  26.077  13.211  1.00 32.32 ? 232 ARG C C     1 
ATOM   869  O O     . ARG C 3 9  ? 28.818  25.369  13.552  1.00 31.49 ? 232 ARG C O     1 
ATOM   870  C CB    . ARG C 3 9  ? 32.299  25.628  13.505  1.00 37.62 ? 232 ARG C CB    1 
ATOM   871  C CG    . ARG C 3 9  ? 33.474  24.596  13.228  1.00 42.48 ? 232 ARG C CG    1 
ATOM   872  C CD    . ARG C 3 9  ? 34.923  24.964  13.590  1.00 43.22 ? 232 ARG C CD    1 
ATOM   873  N NE    . ARG C 3 9  ? 35.007  26.284  14.182  1.00 50.25 ? 232 ARG C NE    1 
ATOM   874  C CZ    . ARG C 3 9  ? 35.508  26.521  15.415  1.00 52.22 ? 232 ARG C CZ    1 
ATOM   875  N NH1   . ARG C 3 9  ? 36.012  25.540  16.170  1.00 53.89 ? 232 ARG C NH1   1 
ATOM   876  N NH2   . ARG C 3 9  ? 35.525  27.765  15.917  1.00 50.53 ? 232 ARG C NH2   1 
ATOM   877  N N     . ALA C 3 10 ? 29.670  27.393  13.317  1.00 29.41 ? 233 ALA C N     1 
ATOM   878  C CA    . ALA C 3 10 ? 28.455  27.994  13.842  1.00 28.06 ? 233 ALA C CA    1 
ATOM   879  C C     . ALA C 3 10 ? 27.313  27.647  12.944  1.00 28.02 ? 233 ALA C C     1 
ATOM   880  O O     . ALA C 3 10 ? 26.171  27.738  13.372  1.00 31.44 ? 233 ALA C O     1 
ATOM   881  C CB    . ALA C 3 10 ? 28.411  29.499  13.869  1.00 34.65 ? 233 ALA C CB    1 
ATOM   882  N N     . ARG C 3 11 ? 27.501  27.300  11.701  1.00 28.17 ? 234 ARG C N     1 
ATOM   883  C CA    . ARG C 3 11 ? 26.338  26.756  11.021  1.00 32.67 ? 234 ARG C CA    1 
ATOM   884  C C     . ARG C 3 11 ? 25.935  25.279  11.224  1.00 31.26 ? 234 ARG C C     1 
ATOM   885  O O     . ARG C 3 11 ? 24.754  24.936  11.285  1.00 31.05 ? 234 ARG C O     1 
ATOM   886  C CB    . ARG C 3 11 ? 26.519  27.037  9.567   1.00 38.46 ? 234 ARG C CB    1 
ATOM   887  C CG    . ARG C 3 11 ? 26.263  28.505  9.205   1.00 38.84 ? 234 ARG C CG    1 
ATOM   888  C CD    . ARG C 3 11 ? 25.643  28.508  7.810   1.00 40.71 ? 234 ARG C CD    1 
ATOM   889  N NE    . ARG C 3 11 ? 26.186  27.493  6.904   1.00 41.47 ? 234 ARG C NE    1 
ATOM   890  C CZ    . ARG C 3 11 ? 27.412  27.515  6.358   1.00 44.36 ? 234 ARG C CZ    1 
ATOM   891  N NH1   . ARG C 3 11 ? 28.271  28.511  6.607   1.00 43.74 ? 234 ARG C NH1   1 
ATOM   892  N NH2   . ARG C 3 11 ? 27.783  26.507  5.551   1.00 42.15 ? 234 ARG C NH2   1 
ATOM   893  N N     . ASN C 3 12 ? 26.888  24.334  11.299  1.00 31.98 ? 235 ASN C N     1 
ATOM   894  C CA    . ASN C 3 12 ? 26.652  22.917  11.657  1.00 28.87 ? 235 ASN C CA    1 
ATOM   895  C C     . ASN C 3 12 ? 25.971  22.846  13.025  1.00 30.03 ? 235 ASN C C     1 
ATOM   896  O O     . ASN C 3 12 ? 24.941  22.195  13.213  1.00 28.31 ? 235 ASN C O     1 
ATOM   897  C CB    . ASN C 3 12 ? 27.981  22.176  11.712  1.00 25.98 ? 235 ASN C CB    1 
ATOM   898  C CG    . ASN C 3 12 ? 28.000  20.817  12.400  1.00 28.27 ? 235 ASN C CG    1 
ATOM   899  O OD1   . ASN C 3 12 ? 28.471  20.674  13.533  1.00 32.69 ? 235 ASN C OD1   1 
ATOM   900  N ND2   . ASN C 3 12 ? 27.531  19.721  11.834  1.00 28.76 ? 235 ASN C ND2   1 
ATOM   901  N N     . THR C 3 13 ? 26.567  23.566  13.986  1.00 30.75 ? 236 THR C N     1 
ATOM   902  C CA    . THR C 3 13 ? 26.049  23.723  15.337  1.00 30.35 ? 236 THR C CA    1 
ATOM   903  C C     . THR C 3 13 ? 24.552  24.009  15.314  1.00 30.10 ? 236 THR C C     1 
ATOM   904  O O     . THR C 3 13 ? 23.805  23.342  16.042  1.00 33.10 ? 236 THR C O     1 
ATOM   905  C CB    . THR C 3 13 ? 26.883  24.849  15.998  1.00 31.79 ? 236 THR C CB    1 
ATOM   906  O OG1   . THR C 3 13 ? 28.127  24.244  16.391  1.00 33.92 ? 236 THR C OG1   1 
ATOM   907  C CG2   . THR C 3 13 ? 26.173  25.524  17.158  1.00 38.64 ? 236 THR C CG2   1 
ATOM   908  N N     . GLU C 3 14 ? 24.056  24.931  14.476  1.00 27.61 ? 237 GLU C N     1 
ATOM   909  C CA    . GLU C 3 14 ? 22.603  25.061  14.298  1.00 26.89 ? 237 GLU C CA    1 
ATOM   910  C C     . GLU C 3 14 ? 21.987  23.840  13.669  1.00 24.66 ? 237 GLU C C     1 
ATOM   911  O O     . GLU C 3 14 ? 20.923  23.476  14.120  1.00 26.28 ? 237 GLU C O     1 
ATOM   912  C CB    . GLU C 3 14 ? 22.145  26.151  13.381  1.00 27.08 ? 237 GLU C CB    1 
ATOM   913  C CG    . GLU C 3 14 ? 22.566  27.466  13.989  1.00 33.18 ? 237 GLU C CG    1 
ATOM   914  C CD    . GLU C 3 14 ? 21.517  28.559  13.949  1.00 34.59 ? 237 GLU C CD    1 
ATOM   915  O OE1   . GLU C 3 14 ? 20.610  28.497  13.125  1.00 38.53 ? 237 GLU C OE1   1 
ATOM   916  O OE2   . GLU C 3 14 ? 21.605  29.476  14.757  1.00 38.52 ? 237 GLU C OE2   1 
ATOM   917  N N     . ALA C 3 15 ? 22.497  23.147  12.663  1.00 24.52 ? 238 ALA C N     1 
ATOM   918  C CA    . ALA C 3 15 ? 21.833  21.930  12.157  1.00 24.70 ? 238 ALA C CA    1 
ATOM   919  C C     . ALA C 3 15 ? 21.841  20.760  13.118  1.00 24.96 ? 238 ALA C C     1 
ATOM   920  O O     . ALA C 3 15 ? 21.023  19.837  12.984  1.00 26.96 ? 238 ALA C O     1 
ATOM   921  C CB    . ALA C 3 15 ? 22.442  21.350  10.886  1.00 25.83 ? 238 ALA C CB    1 
ATOM   922  N N     . ALA C 3 16 ? 22.789  20.755  14.066  1.00 23.92 ? 239 ALA C N     1 
ATOM   923  C CA    . ALA C 3 16 ? 22.741  19.805  15.161  1.00 22.58 ? 239 ALA C CA    1 
ATOM   924  C C     . ALA C 3 16 ? 21.625  20.214  16.091  1.00 22.92 ? 239 ALA C C     1 
ATOM   925  O O     . ALA C 3 16 ? 20.949  19.350  16.615  1.00 24.90 ? 239 ALA C O     1 
ATOM   926  C CB    . ALA C 3 16 ? 23.999  19.829  15.896  1.00 23.40 ? 239 ALA C CB    1 
ATOM   927  N N     . ARG C 3 17 ? 21.400  21.515  16.322  1.00 25.21 ? 240 ARG C N     1 
ATOM   928  C CA    . ARG C 3 17 ? 20.241  22.075  17.052  1.00 22.65 ? 240 ARG C CA    1 
ATOM   929  C C     . ARG C 3 17 ? 18.864  21.776  16.480  1.00 21.91 ? 240 ARG C C     1 
ATOM   930  O O     . ARG C 3 17 ? 18.117  21.072  17.147  1.00 27.44 ? 240 ARG C O     1 
ATOM   931  C CB    . ARG C 3 17 ? 20.240  23.591  17.148  1.00 23.59 ? 240 ARG C CB    1 
ATOM   932  C CG    . ARG C 3 17 ? 18.928  24.340  17.507  1.00 27.32 ? 240 ARG C CG    1 
ATOM   933  C CD    . ARG C 3 17 ? 19.234  25.741  17.035  1.00 31.03 ? 240 ARG C CD    1 
ATOM   934  N NE    . ARG C 3 17 ? 18.090  26.633  16.960  1.00 35.74 ? 240 ARG C NE    1 
ATOM   935  C CZ    . ARG C 3 17 ? 17.978  27.550  15.989  1.00 36.49 ? 240 ARG C CZ    1 
ATOM   936  N NH1   . ARG C 3 17 ? 18.917  27.639  15.056  1.00 35.75 ? 240 ARG C NH1   1 
ATOM   937  N NH2   . ARG C 3 17 ? 16.909  28.366  15.961  1.00 40.02 ? 240 ARG C NH2   1 
ATOM   938  N N     . ARG C 3 18 ? 18.441  22.239  15.286  1.00 19.35 ? 241 ARG C N     1 
ATOM   939  C CA    . ARG C 3 18 ? 17.108  21.982  14.710  1.00 16.08 ? 241 ARG C CA    1 
ATOM   940  C C     . ARG C 3 18 ? 16.871  20.520  14.822  1.00 14.88 ? 241 ARG C C     1 
ATOM   941  O O     . ARG C 3 18 ? 15.795  20.195  15.272  1.00 18.91 ? 241 ARG C O     1 
ATOM   942  C CB    . ARG C 3 18 ? 17.071  22.395  13.277  1.00 15.95 ? 241 ARG C CB    1 
ATOM   943  C CG    . ARG C 3 18 ? 17.055  23.937  13.252  1.00 19.24 ? 241 ARG C CG    1 
ATOM   944  C CD    . ARG C 3 18 ? 17.820  24.566  12.095  1.00 17.59 ? 241 ARG C CD    1 
ATOM   945  N NE    . ARG C 3 18 ? 17.413  23.838  10.935  1.00 18.91 ? 241 ARG C NE    1 
ATOM   946  C CZ    . ARG C 3 18 ? 18.258  23.302  10.069  1.00 23.50 ? 241 ARG C CZ    1 
ATOM   947  N NH1   . ARG C 3 18 ? 19.592  23.505  10.163  1.00 21.68 ? 241 ARG C NH1   1 
ATOM   948  N NH2   . ARG C 3 18 ? 17.680  22.568  9.086   1.00 22.58 ? 241 ARG C NH2   1 
ATOM   949  N N     . SER C 3 19 ? 17.864  19.652  14.580  1.00 13.79 ? 242 SER C N     1 
ATOM   950  C CA    . SER C 3 19 ? 17.656  18.238  14.910  1.00 15.20 ? 242 SER C CA    1 
ATOM   951  C C     . SER C 3 19 ? 17.446  17.848  16.354  1.00 11.57 ? 242 SER C C     1 
ATOM   952  O O     . SER C 3 19 ? 16.671  16.925  16.539  1.00 13.42 ? 242 SER C O     1 
ATOM   953  C CB    . SER C 3 19 ? 18.764  17.289  14.556  1.00 19.53 ? 242 SER C CB    1 
ATOM   954  O OG    . SER C 3 19 ? 18.118  16.016  14.446  1.00 28.88 ? 242 SER C OG    1 
ATOM   955  N N     . ARG C 3 20 ? 18.007  18.392  17.432  1.00 11.99 ? 243 ARG C N     1 
ATOM   956  C CA    . ARG C 3 20 ? 17.640  17.914  18.783  1.00 17.47 ? 243 ARG C CA    1 
ATOM   957  C C     . ARG C 3 20 ? 16.208  18.306  18.934  1.00 19.02 ? 243 ARG C C     1 
ATOM   958  O O     . ARG C 3 20 ? 15.400  17.471  19.258  1.00 22.70 ? 243 ARG C O     1 
ATOM   959  C CB    . ARG C 3 20 ? 18.359  18.597  19.964  1.00 21.56 ? 243 ARG C CB    1 
ATOM   960  C CG    . ARG C 3 20 ? 19.895  18.619  19.746  1.00 26.51 ? 243 ARG C CG    1 
ATOM   961  C CD    . ARG C 3 20 ? 20.777  19.323  20.801  1.00 27.47 ? 243 ARG C CD    1 
ATOM   962  N NE    . ARG C 3 20 ? 21.836  20.103  20.160  1.00 26.91 ? 243 ARG C NE    1 
ATOM   963  C CZ    . ARG C 3 20 ? 22.037  21.385  20.493  1.00 23.81 ? 243 ARG C CZ    1 
ATOM   964  N NH1   . ARG C 3 20 ? 21.349  21.905  21.506  1.00 20.33 ? 243 ARG C NH1   1 
ATOM   965  N NH2   . ARG C 3 20 ? 22.936  22.155  19.840  1.00 23.25 ? 243 ARG C NH2   1 
ATOM   966  N N     . ALA C 3 21 ? 15.809  19.515  18.611  1.00 20.88 ? 244 ALA C N     1 
ATOM   967  C CA    . ALA C 3 21 ? 14.392  19.924  18.631  1.00 22.22 ? 244 ALA C CA    1 
ATOM   968  C C     . ALA C 3 21 ? 13.262  19.064  17.952  1.00 25.29 ? 244 ALA C C     1 
ATOM   969  O O     . ALA C 3 21 ? 12.111  18.832  18.431  1.00 21.72 ? 244 ALA C O     1 
ATOM   970  C CB    . ALA C 3 21 ? 14.363  21.323  18.063  1.00 21.29 ? 244 ALA C CB    1 
ATOM   971  N N     . ARG C 3 22 ? 13.704  18.593  16.763  1.00 29.42 ? 245 ARG C N     1 
ATOM   972  C CA    . ARG C 3 22 ? 13.003  17.680  15.851  1.00 29.75 ? 245 ARG C CA    1 
ATOM   973  C C     . ARG C 3 22 ? 13.034  16.280  16.443  1.00 29.55 ? 245 ARG C C     1 
ATOM   974  O O     . ARG C 3 22 ? 12.014  15.605  16.440  1.00 33.37 ? 245 ARG C O     1 
ATOM   975  C CB    . ARG C 3 22 ? 13.698  17.749  14.484  1.00 27.48 ? 245 ARG C CB    1 
ATOM   976  C CG    . ARG C 3 22 ? 13.370  16.628  13.537  1.00 30.89 ? 245 ARG C CG    1 
ATOM   977  C CD    . ARG C 3 22 ? 14.034  16.776  12.186  1.00 29.97 ? 245 ARG C CD    1 
ATOM   978  N NE    . ARG C 3 22 ? 15.496  16.758  12.187  1.00 29.69 ? 245 ARG C NE    1 
ATOM   979  C CZ    . ARG C 3 22 ? 16.184  17.793  11.652  1.00 32.37 ? 245 ARG C CZ    1 
ATOM   980  N NH1   . ARG C 3 22 ? 15.531  18.846  11.136  1.00 34.18 ? 245 ARG C NH1   1 
ATOM   981  N NH2   . ARG C 3 22 ? 17.538  17.819  11.610  1.00 33.75 ? 245 ARG C NH2   1 
ATOM   982  N N     . LYS C 3 23 ? 14.136  15.792  16.993  1.00 32.29 ? 246 LYS C N     1 
ATOM   983  C CA    . LYS C 3 23 ? 14.148  14.506  17.708  1.00 35.12 ? 246 LYS C CA    1 
ATOM   984  C C     . LYS C 3 23 ? 13.310  14.467  18.997  1.00 31.77 ? 246 LYS C C     1 
ATOM   985  O O     . LYS C 3 23 ? 12.735  13.448  19.375  1.00 33.18 ? 246 LYS C O     1 
ATOM   986  C CB    . LYS C 3 23 ? 15.579  14.138  18.046  1.00 38.11 ? 246 LYS C CB    1 
ATOM   987  C CG    . LYS C 3 23 ? 16.107  13.632  16.691  1.00 47.16 ? 246 LYS C CG    1 
ATOM   988  C CD    . LYS C 3 23 ? 17.525  13.067  16.741  1.00 49.85 ? 246 LYS C CD    1 
ATOM   989  C CE    . LYS C 3 23 ? 17.986  12.213  17.968  1.00 55.38 ? 246 LYS C CE    1 
ATOM   990  N NZ    . LYS C 3 23 ? 19.258  11.547  17.620  1.00 55.22 ? 246 LYS C NZ    1 
ATOM   991  N N     . LEU C 3 24 ? 13.217  15.583  19.716  1.00 28.10 ? 247 LEU C N     1 
ATOM   992  C CA    . LEU C 3 24 ? 12.271  15.772  20.822  1.00 26.61 ? 247 LEU C CA    1 
ATOM   993  C C     . LEU C 3 24 ? 10.848  15.533  20.360  1.00 28.23 ? 247 LEU C C     1 
ATOM   994  O O     . LEU C 3 24 ? 10.152  14.707  20.962  1.00 29.19 ? 247 LEU C O     1 
ATOM   995  C CB    . LEU C 3 24 ? 12.165  17.161  21.371  1.00 26.74 ? 247 LEU C CB    1 
ATOM   996  C CG    . LEU C 3 24 ? 12.742  17.600  22.675  1.00 27.23 ? 247 LEU C CG    1 
ATOM   997  C CD1   . LEU C 3 24 ? 12.107  18.948  23.029  1.00 28.07 ? 247 LEU C CD1   1 
ATOM   998  C CD2   . LEU C 3 24 ? 12.439  16.602  23.760  1.00 31.71 ? 247 LEU C CD2   1 
ATOM   999  N N     . GLN C 3 25 ? 10.400  16.253  19.293  1.00 27.86 ? 248 GLN C N     1 
ATOM   1000 C CA    . GLN C 3 25 ? 9.052   16.046  18.772  1.00 26.81 ? 248 GLN C CA    1 
ATOM   1001 C C     . GLN C 3 25 ? 8.715   14.650  18.305  1.00 29.15 ? 248 GLN C C     1 
ATOM   1002 O O     . GLN C 3 25 ? 7.710   14.124  18.801  1.00 29.24 ? 248 GLN C O     1 
ATOM   1003 C CB    . GLN C 3 25 ? 8.760   16.934  17.631  1.00 23.58 ? 248 GLN C CB    1 
ATOM   1004 C CG    . GLN C 3 25 ? 7.362   17.456  17.952  1.00 27.05 ? 248 GLN C CG    1 
ATOM   1005 C CD    . GLN C 3 25 ? 7.192   18.285  19.259  1.00 29.70 ? 248 GLN C CD    1 
ATOM   1006 O OE1   . GLN C 3 25 ? 6.079   18.623  19.634  1.00 29.61 ? 248 GLN C OE1   1 
ATOM   1007 N NE2   . GLN C 3 25 ? 8.134   18.723  20.081  1.00 27.20 ? 248 GLN C NE2   1 
ATOM   1008 N N     . ARG C 3 26 ? 9.517   14.020  17.435  1.00 32.51 ? 249 ARG C N     1 
ATOM   1009 C CA    . ARG C 3 26 ? 9.380   12.579  17.137  1.00 35.91 ? 249 ARG C CA    1 
ATOM   1010 C C     . ARG C 3 26 ? 9.111   11.691  18.351  1.00 37.12 ? 249 ARG C C     1 
ATOM   1011 O O     . ARG C 3 26 ? 8.342   10.742  18.216  1.00 41.92 ? 249 ARG C O     1 
ATOM   1012 C CB    . ARG C 3 26 ? 10.607  11.929  16.532  1.00 37.01 ? 249 ARG C CB    1 
ATOM   1013 C CG    . ARG C 3 26 ? 11.181  12.546  15.254  1.00 44.56 ? 249 ARG C CG    1 
ATOM   1014 C CD    . ARG C 3 26 ? 12.420  11.755  14.815  1.00 46.34 ? 249 ARG C CD    1 
ATOM   1015 N NE    . ARG C 3 26 ? 13.320  12.517  13.962  1.00 45.39 ? 249 ARG C NE    1 
ATOM   1016 C CZ    . ARG C 3 26 ? 13.148  12.669  12.642  1.00 45.39 ? 249 ARG C CZ    1 
ATOM   1017 N NH1   . ARG C 3 26 ? 12.131  12.117  11.950  1.00 42.89 ? 249 ARG C NH1   1 
ATOM   1018 N NH2   . ARG C 3 26 ? 14.060  13.408  12.010  1.00 44.37 ? 249 ARG C NH2   1 
ATOM   1019 N N     . MET C 3 27 ? 9.682   11.849  19.552  1.00 36.99 ? 250 MET C N     1 
ATOM   1020 C CA    . MET C 3 27 ? 9.172   11.014  20.651  1.00 36.46 ? 250 MET C CA    1 
ATOM   1021 C C     . MET C 3 27 ? 7.911   11.522  21.370  1.00 35.80 ? 250 MET C C     1 
ATOM   1022 O O     . MET C 3 27 ? 7.099   10.746  21.893  1.00 32.69 ? 250 MET C O     1 
ATOM   1023 C CB    . MET C 3 27 ? 10.165  10.806  21.736  1.00 40.91 ? 250 MET C CB    1 
ATOM   1024 C CG    . MET C 3 27 ? 9.625   9.634   22.547  1.00 44.26 ? 250 MET C CG    1 
ATOM   1025 S SD    . MET C 3 27 ? 10.737  9.679   23.936  1.00 44.96 ? 250 MET C SD    1 
ATOM   1026 C CE    . MET C 3 27 ? 9.884   9.678   25.504  1.00 43.63 ? 250 MET C CE    1 
ATOM   1027 N N     . LYS C 3 28 ? 7.702   12.837  21.495  1.00 35.73 ? 251 LYS C N     1 
ATOM   1028 C CA    . LYS C 3 28 ? 6.497   13.309  22.147  1.00 35.41 ? 251 LYS C CA    1 
ATOM   1029 C C     . LYS C 3 28 ? 5.299   12.866  21.396  1.00 35.17 ? 251 LYS C C     1 
ATOM   1030 O O     . LYS C 3 28 ? 4.262   12.583  21.967  1.00 40.71 ? 251 LYS C O     1 
ATOM   1031 C CB    . LYS C 3 28 ? 6.472   14.777  22.220  1.00 37.14 ? 251 LYS C CB    1 
ATOM   1032 C CG    . LYS C 3 28 ? 6.791   15.142  23.678  1.00 46.83 ? 251 LYS C CG    1 
ATOM   1033 C CD    . LYS C 3 28 ? 8.006   14.481  24.437  1.00 46.00 ? 251 LYS C CD    1 
ATOM   1034 C CE    . LYS C 3 28 ? 9.437   14.933  24.062  1.00 48.00 ? 251 LYS C CE    1 
ATOM   1035 N NZ    . LYS C 3 28 ? 10.480  14.094  24.662  1.00 47.00 ? 251 LYS C NZ    1 
ATOM   1036 N N     . GLN C 3 29 ? 5.413   12.763  20.089  1.00 32.36 ? 252 GLN C N     1 
ATOM   1037 C CA    . GLN C 3 29 ? 4.338   12.155  19.344  1.00 28.27 ? 252 GLN C CA    1 
ATOM   1038 C C     . GLN C 3 29 ? 4.214   10.647  19.562  1.00 27.45 ? 252 GLN C C     1 
ATOM   1039 O O     . GLN C 3 29 ? 3.136   10.120  19.850  1.00 30.03 ? 252 GLN C O     1 
ATOM   1040 C CB    . GLN C 3 29 ? 4.562   12.432  17.926  1.00 27.64 ? 252 GLN C CB    1 
ATOM   1041 C CG    . GLN C 3 29 ? 4.278   13.893  17.717  1.00 31.55 ? 252 GLN C CG    1 
ATOM   1042 C CD    . GLN C 3 29 ? 4.038   14.166  16.248  1.00 35.41 ? 252 GLN C CD    1 
ATOM   1043 O OE1   . GLN C 3 29 ? 4.840   13.898  15.370  1.00 39.01 ? 252 GLN C OE1   1 
ATOM   1044 N NE2   . GLN C 3 29 ? 2.921   14.712  15.830  1.00 40.02 ? 252 GLN C NE2   1 
ATOM   1045 N N     . LEU C 3 30 ? 5.277   9.860   19.471  1.00 26.44 ? 253 LEU C N     1 
ATOM   1046 C CA    . LEU C 3 30 ? 5.211   8.423   19.730  1.00 23.16 ? 253 LEU C CA    1 
ATOM   1047 C C     . LEU C 3 30 ? 4.689   8.147   21.140  1.00 25.00 ? 253 LEU C C     1 
ATOM   1048 O O     . LEU C 3 30 ? 4.137   7.092   21.419  1.00 24.71 ? 253 LEU C O     1 
ATOM   1049 C CB    . LEU C 3 30 ? 6.582   7.928   19.516  1.00 22.43 ? 253 LEU C CB    1 
ATOM   1050 C CG    . LEU C 3 30 ? 6.876   6.561   19.048  1.00 25.16 ? 253 LEU C CG    1 
ATOM   1051 C CD1   . LEU C 3 30 ? 6.876   5.674   20.184  1.00 28.47 ? 253 LEU C CD1   1 
ATOM   1052 C CD2   . LEU C 3 30 ? 5.843   6.073   18.118  1.00 29.37 ? 253 LEU C CD2   1 
ATOM   1053 N N     . GLU C 3 31 ? 4.820   9.064   22.098  1.00 26.84 ? 254 GLU C N     1 
ATOM   1054 C CA    . GLU C 3 31 ? 4.089   8.924   23.367  1.00 31.75 ? 254 GLU C CA    1 
ATOM   1055 C C     . GLU C 3 31 ? 2.557   9.023   23.185  1.00 32.48 ? 254 GLU C C     1 
ATOM   1056 O O     . GLU C 3 31 ? 1.793   8.214   23.729  1.00 34.33 ? 254 GLU C O     1 
ATOM   1057 C CB    . GLU C 3 31 ? 4.535   10.001  24.354  1.00 34.02 ? 254 GLU C CB    1 
ATOM   1058 C CG    . GLU C 3 31 ? 5.677   9.478   25.219  1.00 40.52 ? 254 GLU C CG    1 
ATOM   1059 C CD    . GLU C 3 31 ? 6.480   10.549  25.945  1.00 46.25 ? 254 GLU C CD    1 
ATOM   1060 O OE1   . GLU C 3 31 ? 7.064   11.375  25.238  1.00 49.18 ? 254 GLU C OE1   1 
ATOM   1061 O OE2   . GLU C 3 31 ? 6.534   10.559  27.189  1.00 48.39 ? 254 GLU C OE2   1 
ATOM   1062 N N     . ASP C 3 32 ? 2.084   10.002  22.382  1.00 30.92 ? 255 ASP C N     1 
ATOM   1063 C CA    . ASP C 3 32 ? 0.665   10.240  22.082  1.00 29.21 ? 255 ASP C CA    1 
ATOM   1064 C C     . ASP C 3 32 ? 0.030   9.097   21.304  1.00 27.16 ? 255 ASP C C     1 
ATOM   1065 O O     . ASP C 3 32 ? -0.918  8.533   21.839  1.00 24.04 ? 255 ASP C O     1 
ATOM   1066 C CB    . ASP C 3 32 ? 0.564   11.557  21.306  1.00 31.50 ? 255 ASP C CB    1 
ATOM   1067 C CG    . ASP C 3 32 ? 1.204   12.737  22.068  1.00 35.63 ? 255 ASP C CG    1 
ATOM   1068 O OD1   . ASP C 3 32 ? 1.687   12.559  23.195  1.00 31.56 ? 255 ASP C OD1   1 
ATOM   1069 O OD2   . ASP C 3 32 ? 1.229   13.849  21.531  1.00 39.68 ? 255 ASP C OD2   1 
ATOM   1070 N N     . LYS C 3 33 ? 0.495   8.669   20.103  1.00 25.49 ? 256 LYS C N     1 
ATOM   1071 C CA    . LYS C 3 33 ? 0.013   7.445   19.428  1.00 25.07 ? 256 LYS C CA    1 
ATOM   1072 C C     . LYS C 3 33 ? -0.044  6.338   20.481  1.00 28.32 ? 256 LYS C C     1 
ATOM   1073 O O     . LYS C 3 33 ? -1.062  5.666   20.466  1.00 29.88 ? 256 LYS C O     1 
ATOM   1074 C CB    . LYS C 3 33 ? 0.945   6.919   18.339  1.00 23.31 ? 256 LYS C CB    1 
ATOM   1075 C CG    . LYS C 3 33 ? 0.829   7.469   16.886  1.00 30.09 ? 256 LYS C CG    1 
ATOM   1076 C CD    . LYS C 3 33 ? 1.970   7.085   15.842  1.00 26.42 ? 256 LYS C CD    1 
ATOM   1077 C CE    . LYS C 3 33 ? 3.268   7.914   16.059  1.00 27.87 ? 256 LYS C CE    1 
ATOM   1078 N NZ    . LYS C 3 33 ? 4.526   7.351   15.578  1.00 24.27 ? 256 LYS C NZ    1 
ATOM   1079 N N     . VAL C 3 34 ? 0.908   6.097   21.432  1.00 27.63 ? 257 VAL C N     1 
ATOM   1080 C CA    . VAL C 3 34 ? 0.728   5.111   22.517  1.00 26.06 ? 257 VAL C CA    1 
ATOM   1081 C C     . VAL C 3 34 ? -0.367  5.414   23.547  1.00 27.45 ? 257 VAL C C     1 
ATOM   1082 O O     . VAL C 3 34 ? -1.001  4.503   24.076  1.00 28.79 ? 257 VAL C O     1 
ATOM   1083 C CB    . VAL C 3 34 ? 1.983   4.910   23.276  1.00 24.74 ? 257 VAL C CB    1 
ATOM   1084 C CG1   . VAL C 3 34 ? 1.819   3.875   24.376  1.00 21.76 ? 257 VAL C CG1   1 
ATOM   1085 C CG2   . VAL C 3 34 ? 3.005   4.392   22.331  1.00 23.11 ? 257 VAL C CG2   1 
ATOM   1086 N N     . GLU C 3 35 ? -0.616  6.677   23.883  1.00 28.66 ? 258 GLU C N     1 
ATOM   1087 C CA    . GLU C 3 35 ? -1.749  7.112   24.720  1.00 29.35 ? 258 GLU C CA    1 
ATOM   1088 C C     . GLU C 3 35 ? -3.114  6.729   24.105  1.00 28.94 ? 258 GLU C C     1 
ATOM   1089 O O     . GLU C 3 35 ? -3.885  5.885   24.575  1.00 27.61 ? 258 GLU C O     1 
ATOM   1090 C CB    . GLU C 3 35 ? -1.705  8.599   24.861  1.00 29.47 ? 258 GLU C CB    1 
ATOM   1091 C CG    . GLU C 3 35 ? -2.614  9.193   25.878  1.00 36.57 ? 258 GLU C CG    1 
ATOM   1092 C CD    . GLU C 3 35 ? -1.868  9.567   27.146  1.00 41.82 ? 258 GLU C CD    1 
ATOM   1093 O OE1   . GLU C 3 35 ? -0.746  9.063   27.353  1.00 41.95 ? 258 GLU C OE1   1 
ATOM   1094 O OE2   . GLU C 3 35 ? -2.436  10.365  27.914  1.00 38.72 ? 258 GLU C OE2   1 
ATOM   1095 N N     . GLU C 3 36 ? -3.433  7.350   22.956  1.00 31.24 ? 259 GLU C N     1 
ATOM   1096 C CA    . GLU C 3 36 ? -4.750  7.224   22.295  1.00 31.46 ? 259 GLU C CA    1 
ATOM   1097 C C     . GLU C 3 36 ? -5.120  5.801   21.994  1.00 24.99 ? 259 GLU C C     1 
ATOM   1098 O O     . GLU C 3 36 ? -6.288  5.450   22.079  1.00 25.57 ? 259 GLU C O     1 
ATOM   1099 C CB    . GLU C 3 36 ? -4.852  7.939   20.940  1.00 39.71 ? 259 GLU C CB    1 
ATOM   1100 C CG    . GLU C 3 36 ? -4.713  9.473   20.929  1.00 55.83 ? 259 GLU C CG    1 
ATOM   1101 C CD    . GLU C 3 36 ? -3.279  10.072  20.949  1.00 65.94 ? 259 GLU C CD    1 
ATOM   1102 O OE1   . GLU C 3 36 ? -2.637  10.187  19.877  1.00 69.01 ? 259 GLU C OE1   1 
ATOM   1103 O OE2   . GLU C 3 36 ? -2.809  10.435  22.051  1.00 69.33 ? 259 GLU C OE2   1 
ATOM   1104 N N     . LEU C 3 37 ? -4.115  4.991   21.674  1.00 19.47 ? 260 LEU C N     1 
ATOM   1105 C CA    . LEU C 3 37 ? -4.352  3.594   21.419  1.00 15.16 ? 260 LEU C CA    1 
ATOM   1106 C C     . LEU C 3 37 ? -4.797  2.937   22.701  1.00 13.75 ? 260 LEU C C     1 
ATOM   1107 O O     . LEU C 3 37 ? -5.706  2.130   22.673  1.00 15.24 ? 260 LEU C O     1 
ATOM   1108 C CB    . LEU C 3 37 ? -3.073  2.971   20.877  1.00 18.13 ? 260 LEU C CB    1 
ATOM   1109 C CG    . LEU C 3 37 ? -2.507  3.486   19.543  1.00 17.60 ? 260 LEU C CG    1 
ATOM   1110 C CD1   . LEU C 3 37 ? -1.625  2.390   18.955  1.00 17.12 ? 260 LEU C CD1   1 
ATOM   1111 C CD2   . LEU C 3 37 ? -3.627  3.917   18.613  1.00 11.78 ? 260 LEU C CD2   1 
ATOM   1112 N N     . LEU C 3 38 ? -4.249  3.246   23.860  1.00 15.13 ? 261 LEU C N     1 
ATOM   1113 C CA    . LEU C 3 38 ? -4.855  2.724   25.075  1.00 18.81 ? 261 LEU C CA    1 
ATOM   1114 C C     . LEU C 3 38 ? -6.223  3.329   25.418  1.00 21.56 ? 261 LEU C C     1 
ATOM   1115 O O     . LEU C 3 38 ? -7.108  2.606   25.864  1.00 25.17 ? 261 LEU C O     1 
ATOM   1116 C CB    . LEU C 3 38 ? -3.921  2.939   26.207  1.00 21.33 ? 261 LEU C CB    1 
ATOM   1117 C CG    . LEU C 3 38 ? -2.785  1.935   26.108  1.00 25.49 ? 261 LEU C CG    1 
ATOM   1118 C CD1   . LEU C 3 38 ? -1.491  2.688   26.196  1.00 24.79 ? 261 LEU C CD1   1 
ATOM   1119 C CD2   . LEU C 3 38 ? -2.947  0.833   27.179  1.00 23.91 ? 261 LEU C CD2   1 
ATOM   1120 N N     . SER C 3 39 ? -6.542  4.610   25.240  1.00 22.03 ? 262 SER C N     1 
ATOM   1121 C CA    . SER C 3 39 ? -7.944  5.055   25.379  1.00 21.15 ? 262 SER C CA    1 
ATOM   1122 C C     . SER C 3 39 ? -8.895  4.338   24.408  1.00 24.64 ? 262 SER C C     1 
ATOM   1123 O O     . SER C 3 39 ? -10.036 3.988   24.757  1.00 28.97 ? 262 SER C O     1 
ATOM   1124 C CB    . SER C 3 39 ? -8.188  6.511   25.065  1.00 18.38 ? 262 SER C CB    1 
ATOM   1125 O OG    . SER C 3 39 ? -7.521  7.426   25.930  1.00 27.98 ? 262 SER C OG    1 
ATOM   1126 N N     . LYS C 3 40 ? -8.488  4.104   23.145  1.00 26.69 ? 263 LYS C N     1 
ATOM   1127 C CA    . LYS C 3 40 ? -9.278  3.363   22.178  1.00 20.27 ? 263 LYS C CA    1 
ATOM   1128 C C     . LYS C 3 40 ? -9.318  1.955   22.789  1.00 21.69 ? 263 LYS C C     1 
ATOM   1129 O O     . LYS C 3 40 ? -10.461 1.644   23.155  1.00 23.37 ? 263 LYS C O     1 
ATOM   1130 C CB    . LYS C 3 40 ? -8.587  3.404   20.830  1.00 19.96 ? 263 LYS C CB    1 
ATOM   1131 C CG    . LYS C 3 40 ? -9.597  2.974   19.736  1.00 31.34 ? 263 LYS C CG    1 
ATOM   1132 C CD    . LYS C 3 40 ? -9.198  3.017   18.192  1.00 35.03 ? 263 LYS C CD    1 
ATOM   1133 C CE    . LYS C 3 40 ? -8.513  1.840   17.422  1.00 30.33 ? 263 LYS C CE    1 
ATOM   1134 N NZ    . LYS C 3 40 ? -7.182  1.492   17.912  1.00 27.33 ? 263 LYS C NZ    1 
ATOM   1135 N N     . ASN C 3 41 ? -8.315  1.061   23.034  1.00 21.01 ? 264 ASN C N     1 
ATOM   1136 C CA    . ASN C 3 41 ? -8.602  -0.219  23.718  1.00 22.60 ? 264 ASN C CA    1 
ATOM   1137 C C     . ASN C 3 41 ? -9.468  -0.156  25.018  1.00 25.05 ? 264 ASN C C     1 
ATOM   1138 O O     . ASN C 3 41 ? -10.225 -1.100  25.321  1.00 27.15 ? 264 ASN C O     1 
ATOM   1139 C CB    . ASN C 3 41 ? -7.321  -0.907  24.055  1.00 24.69 ? 264 ASN C CB    1 
ATOM   1140 C CG    . ASN C 3 41 ? -7.413  -2.445  24.108  1.00 30.25 ? 264 ASN C CG    1 
ATOM   1141 O OD1   . ASN C 3 41 ? -6.782  -3.194  23.368  1.00 26.34 ? 264 ASN C OD1   1 
ATOM   1142 N ND2   . ASN C 3 41 ? -8.152  -3.144  24.941  1.00 34.72 ? 264 ASN C ND2   1 
ATOM   1143 N N     . TYR C 3 42 ? -9.451  0.912   25.830  1.00 22.45 ? 265 TYR C N     1 
ATOM   1144 C CA    . TYR C 3 42 ? -10.365 1.024   26.964  1.00 20.95 ? 265 TYR C CA    1 
ATOM   1145 C C     . TYR C 3 42 ? -11.793 1.027   26.463  1.00 23.12 ? 265 TYR C C     1 
ATOM   1146 O O     . TYR C 3 42 ? -12.563 0.129   26.776  1.00 26.62 ? 265 TYR C O     1 
ATOM   1147 C CB    . TYR C 3 42 ? -10.141 2.289   27.694  1.00 20.80 ? 265 TYR C CB    1 
ATOM   1148 C CG    . TYR C 3 42 ? -11.071 2.549   28.851  1.00 21.16 ? 265 TYR C CG    1 
ATOM   1149 C CD1   . TYR C 3 42 ? -10.827 2.022   30.085  1.00 25.98 ? 265 TYR C CD1   1 
ATOM   1150 C CD2   . TYR C 3 42 ? -12.177 3.296   28.670  1.00 22.93 ? 265 TYR C CD2   1 
ATOM   1151 C CE1   . TYR C 3 42 ? -11.673 2.231   31.146  1.00 24.80 ? 265 TYR C CE1   1 
ATOM   1152 C CE2   . TYR C 3 42 ? -13.033 3.503   29.728  1.00 29.41 ? 265 TYR C CE2   1 
ATOM   1153 C CZ    . TYR C 3 42 ? -12.787 2.965   30.957  1.00 23.03 ? 265 TYR C CZ    1 
ATOM   1154 O OH    . TYR C 3 42 ? -13.693 3.112   31.976  1.00 23.49 ? 265 TYR C OH    1 
ATOM   1155 N N     . HIS C 3 43 ? -12.173 2.009   25.621  1.00 26.66 ? 266 HIS C N     1 
ATOM   1156 C CA    . HIS C 3 43 ? -13.577 2.156   25.146  1.00 26.29 ? 266 HIS C CA    1 
ATOM   1157 C C     . HIS C 3 43 ? -14.058 0.995   24.272  1.00 24.92 ? 266 HIS C C     1 
ATOM   1158 O O     . HIS C 3 43 ? -15.190 0.509   24.385  1.00 21.81 ? 266 HIS C O     1 
ATOM   1159 C CB    . HIS C 3 43 ? -13.742 3.469   24.358  1.00 25.70 ? 266 HIS C CB    1 
ATOM   1160 C CG    . HIS C 3 43 ? -13.501 4.631   25.297  1.00 25.62 ? 266 HIS C CG    1 
ATOM   1161 N ND1   . HIS C 3 43 ? -13.818 4.750   26.575  1.00 27.14 ? 266 HIS C ND1   1 
ATOM   1162 C CD2   . HIS C 3 43 ? -12.858 5.781   24.964  1.00 27.55 ? 266 HIS C CD2   1 
ATOM   1163 C CE1   . HIS C 3 43 ? -13.397 5.893   27.035  1.00 27.61 ? 266 HIS C CE1   1 
ATOM   1164 N NE2   . HIS C 3 43 ? -12.823 6.512   26.061  1.00 30.14 ? 266 HIS C NE2   1 
ATOM   1165 N N     . LEU C 3 44 ? -13.165 0.512   23.428  1.00 23.67 ? 267 LEU C N     1 
ATOM   1166 C CA    . LEU C 3 44 ? -13.490 -0.676  22.703  1.00 24.59 ? 267 LEU C CA    1 
ATOM   1167 C C     . LEU C 3 44 ? -13.709 -1.916  23.576  1.00 25.12 ? 267 LEU C C     1 
ATOM   1168 O O     . LEU C 3 44 ? -14.785 -2.472  23.413  1.00 24.27 ? 267 LEU C O     1 
ATOM   1169 C CB    . LEU C 3 44 ? -12.400 -0.892  21.722  1.00 24.58 ? 267 LEU C CB    1 
ATOM   1170 C CG    . LEU C 3 44 ? -12.892 -0.626  20.344  1.00 23.23 ? 267 LEU C CG    1 
ATOM   1171 C CD1   . LEU C 3 44 ? -13.266 0.808   20.146  1.00 30.80 ? 267 LEU C CD1   1 
ATOM   1172 C CD2   . LEU C 3 44 ? -11.791 -1.009  19.423  1.00 30.37 ? 267 LEU C CD2   1 
ATOM   1173 N N     . GLU C 3 45 ? -12.887 -2.428  24.514  1.00 23.91 ? 268 GLU C N     1 
ATOM   1174 C CA    . GLU C 3 45 ? -13.301 -3.617  25.256  1.00 26.07 ? 268 GLU C CA    1 
ATOM   1175 C C     . GLU C 3 45 ? -14.532 -3.415  26.190  1.00 28.12 ? 268 GLU C C     1 
ATOM   1176 O O     . GLU C 3 45 ? -15.303 -4.338  26.520  1.00 28.59 ? 268 GLU C O     1 
ATOM   1177 C CB    . GLU C 3 45 ? -12.134 -4.091  26.056  1.00 31.56 ? 268 GLU C CB    1 
ATOM   1178 C CG    . GLU C 3 45 ? -12.462 -5.421  26.750  1.00 40.10 ? 268 GLU C CG    1 
ATOM   1179 C CD    . GLU C 3 45 ? -12.702 -6.671  25.889  1.00 46.43 ? 268 GLU C CD    1 
ATOM   1180 O OE1   . GLU C 3 45 ? -12.126 -6.786  24.796  1.00 51.22 ? 268 GLU C OE1   1 
ATOM   1181 O OE2   . GLU C 3 45 ? -13.469 -7.537  26.329  1.00 41.09 ? 268 GLU C OE2   1 
ATOM   1182 N N     . ASN C 3 46 ? -14.806 -2.194  26.669  1.00 27.83 ? 269 ASN C N     1 
ATOM   1183 C CA    . ASN C 3 46 ? -16.090 -1.904  27.336  1.00 24.81 ? 269 ASN C CA    1 
ATOM   1184 C C     . ASN C 3 46 ? -17.205 -2.092  26.320  1.00 21.73 ? 269 ASN C C     1 
ATOM   1185 O O     . ASN C 3 46 ? -18.073 -2.914  26.536  1.00 22.42 ? 269 ASN C O     1 
ATOM   1186 C CB    . ASN C 3 46 ? -16.186 -0.451  27.839  1.00 27.60 ? 269 ASN C CB    1 
ATOM   1187 C CG    . ASN C 3 46 ? -15.469 -0.146  29.146  1.00 28.12 ? 269 ASN C CG    1 
ATOM   1188 O OD1   . ASN C 3 46 ? -14.472 -0.692  29.580  1.00 30.65 ? 269 ASN C OD1   1 
ATOM   1189 N ND2   . ASN C 3 46 ? -15.955 0.789   29.889  1.00 31.18 ? 269 ASN C ND2   1 
ATOM   1190 N N     . GLU C 3 47 ? -17.194 -1.418  25.176  1.00 20.00 ? 270 GLU C N     1 
ATOM   1191 C CA    . GLU C 3 47 ? -18.214 -1.578  24.158  1.00 18.92 ? 270 GLU C CA    1 
ATOM   1192 C C     . GLU C 3 47 ? -18.521 -3.017  23.870  1.00 18.52 ? 270 GLU C C     1 
ATOM   1193 O O     . GLU C 3 47 ? -19.694 -3.347  23.757  1.00 23.19 ? 270 GLU C O     1 
ATOM   1194 C CB    . GLU C 3 47 ? -17.809 -0.983  22.849  1.00 21.83 ? 270 GLU C CB    1 
ATOM   1195 C CG    . GLU C 3 47 ? -18.703 -1.297  21.659  1.00 16.31 ? 270 GLU C CG    1 
ATOM   1196 C CD    . GLU C 3 47 ? -19.846 -0.313  21.580  1.00 23.55 ? 270 GLU C CD    1 
ATOM   1197 O OE1   . GLU C 3 47 ? -20.353 0.109   22.624  1.00 21.91 ? 270 GLU C OE1   1 
ATOM   1198 O OE2   . GLU C 3 47 ? -20.229 0.034   20.459  1.00 24.94 ? 270 GLU C OE2   1 
ATOM   1199 N N     . VAL C 3 48 ? -17.496 -3.865  23.751  1.00 17.91 ? 271 VAL C N     1 
ATOM   1200 C CA    . VAL C 3 48 ? -17.680 -5.289  23.511  1.00 13.53 ? 271 VAL C CA    1 
ATOM   1201 C C     . VAL C 3 48 ? -18.339 -5.709  24.762  1.00 14.32 ? 271 VAL C C     1 
ATOM   1202 O O     . VAL C 3 48 ? -19.473 -6.111  24.589  1.00 21.70 ? 271 VAL C O     1 
ATOM   1203 C CB    . VAL C 3 48 ? -16.379 -6.073  23.361  1.00 15.43 ? 271 VAL C CB    1 
ATOM   1204 C CG1   . VAL C 3 48 ? -16.564 -7.551  23.152  1.00 15.46 ? 271 VAL C CG1   1 
ATOM   1205 C CG2   . VAL C 3 48 ? -15.740 -5.572  22.081  1.00 16.71 ? 271 VAL C CG2   1 
ATOM   1206 N N     . ALA C 3 49 ? -17.878 -5.588  26.003  1.00 17.31 ? 272 ALA C N     1 
ATOM   1207 C CA    . ALA C 3 49 ? -18.624 -6.156  27.153  1.00 18.04 ? 272 ALA C CA    1 
ATOM   1208 C C     . ALA C 3 49 ? -20.115 -5.774  27.270  1.00 23.45 ? 272 ALA C C     1 
ATOM   1209 O O     . ALA C 3 49 ? -20.923 -6.615  27.667  1.00 26.51 ? 272 ALA C O     1 
ATOM   1210 C CB    . ALA C 3 49 ? -17.917 -5.744  28.393  1.00 16.35 ? 272 ALA C CB    1 
ATOM   1211 N N     . ARG C 3 50 ? -20.515 -4.538  26.867  1.00 24.64 ? 273 ARG C N     1 
ATOM   1212 C CA    . ARG C 3 50 ? -21.908 -4.069  26.763  1.00 24.03 ? 273 ARG C CA    1 
ATOM   1213 C C     . ARG C 3 50 ? -22.618 -4.866  25.697  1.00 26.72 ? 273 ARG C C     1 
ATOM   1214 O O     . ARG C 3 50 ? -23.567 -5.542  26.084  1.00 31.33 ? 273 ARG C O     1 
ATOM   1215 C CB    . ARG C 3 50 ? -22.071 -2.580  26.327  1.00 27.04 ? 273 ARG C CB    1 
ATOM   1216 C CG    . ARG C 3 50 ? -23.422 -2.138  25.704  1.00 34.53 ? 273 ARG C CG    1 
ATOM   1217 C CD    . ARG C 3 50 ? -23.416 -1.004  24.684  1.00 38.70 ? 273 ARG C CD    1 
ATOM   1218 N NE    . ARG C 3 50 ? -24.534 -1.122  23.725  1.00 44.71 ? 273 ARG C NE    1 
ATOM   1219 C CZ    . ARG C 3 50 ? -25.087 -0.045  23.071  1.00 46.18 ? 273 ARG C CZ    1 
ATOM   1220 N NH1   . ARG C 3 50 ? -24.648 1.208   23.370  1.00 46.74 ? 273 ARG C NH1   1 
ATOM   1221 N NH2   . ARG C 3 50 ? -26.085 -0.170  22.134  1.00 38.27 ? 273 ARG C NH2   1 
ATOM   1222 N N     . LEU C 3 51 ? -22.286 -4.875  24.390  1.00 24.78 ? 274 LEU C N     1 
ATOM   1223 C CA    . LEU C 3 51 ? -23.098 -5.664  23.434  1.00 21.25 ? 274 LEU C CA    1 
ATOM   1224 C C     . LEU C 3 51 ? -23.002 -7.180  23.687  1.00 19.29 ? 274 LEU C C     1 
ATOM   1225 O O     . LEU C 3 51 ? -23.916 -7.960  23.479  1.00 15.95 ? 274 LEU C O     1 
ATOM   1226 C CB    . LEU C 3 51 ? -22.645 -5.313  22.030  1.00 19.42 ? 274 LEU C CB    1 
ATOM   1227 C CG    . LEU C 3 51 ? -22.865 -3.854  21.593  1.00 18.37 ? 274 LEU C CG    1 
ATOM   1228 C CD1   . LEU C 3 51 ? -21.707 -3.590  20.729  1.00 20.19 ? 274 LEU C CD1   1 
ATOM   1229 C CD2   . LEU C 3 51 ? -24.020 -3.543  20.672  1.00 15.89 ? 274 LEU C CD2   1 
ATOM   1230 N N     . LYS C 3 52 ? -21.903 -7.617  24.260  1.00 20.49 ? 275 LYS C N     1 
ATOM   1231 C CA    . LYS C 3 52 ? -21.698 -8.980  24.746  1.00 24.45 ? 275 LYS C CA    1 
ATOM   1232 C C     . LYS C 3 52 ? -22.826 -9.372  25.694  1.00 25.21 ? 275 LYS C C     1 
ATOM   1233 O O     . LYS C 3 52 ? -23.518 -10.382 25.542  1.00 27.53 ? 275 LYS C O     1 
ATOM   1234 C CB    . LYS C 3 52 ? -20.349 -9.059  25.498  1.00 28.56 ? 275 LYS C CB    1 
ATOM   1235 C CG    . LYS C 3 52 ? -19.801 -10.386 25.957  1.00 31.41 ? 275 LYS C CG    1 
ATOM   1236 C CD    . LYS C 3 52 ? -19.563 -11.305 24.772  1.00 32.17 ? 275 LYS C CD    1 
ATOM   1237 C CE    . LYS C 3 52 ? -18.353 -12.189 25.126  1.00 30.30 ? 275 LYS C CE    1 
ATOM   1238 N NZ    . LYS C 3 52 ? -17.120 -11.409 25.218  1.00 27.85 ? 275 LYS C NZ    1 
ATOM   1239 N N     . LYS C 3 53 ? -23.034 -8.533  26.701  1.00 28.70 ? 276 LYS C N     1 
ATOM   1240 C CA    . LYS C 3 53 ? -24.091 -8.809  27.678  1.00 34.50 ? 276 LYS C CA    1 
ATOM   1241 C C     . LYS C 3 53 ? -25.466 -9.081  27.011  1.00 32.07 ? 276 LYS C C     1 
ATOM   1242 O O     . LYS C 3 53 ? -26.049 -10.149 27.258  1.00 35.66 ? 276 LYS C O     1 
ATOM   1243 C CB    . LYS C 3 53 ? -24.208 -7.606  28.674  1.00 36.20 ? 276 LYS C CB    1 
ATOM   1244 C CG    . LYS C 3 53 ? -24.190 -8.060  30.131  1.00 41.31 ? 276 LYS C CG    1 
ATOM   1245 C CD    . LYS C 3 53 ? -25.510 -8.719  30.533  1.00 44.16 ? 276 LYS C CD    1 
ATOM   1246 C CE    . LYS C 3 53 ? -25.396 -9.753  31.660  1.00 47.90 ? 276 LYS C CE    1 
ATOM   1247 N NZ    . LYS C 3 53 ? -25.067 -9.181  32.964  1.00 50.19 ? 276 LYS C NZ    1 
ATOM   1248 N N     . LEU C 3 54 ? -26.025 -8.234  26.137  1.00 28.82 ? 277 LEU C N     1 
ATOM   1249 C CA    . LEU C 3 54 ? -27.347 -8.524  25.552  1.00 29.77 ? 277 LEU C CA    1 
ATOM   1250 C C     . LEU C 3 54 ? -27.386 -9.553  24.406  1.00 30.99 ? 277 LEU C C     1 
ATOM   1251 O O     . LEU C 3 54 ? -27.895 -9.275  23.314  1.00 31.25 ? 277 LEU C O     1 
ATOM   1252 C CB    . LEU C 3 54 ? -27.973 -7.214  25.070  1.00 29.34 ? 277 LEU C CB    1 
ATOM   1253 C CG    . LEU C 3 54 ? -27.150 -6.411  24.104  1.00 31.25 ? 277 LEU C CG    1 
ATOM   1254 C CD1   . LEU C 3 54 ? -28.037 -5.836  23.046  1.00 31.62 ? 277 LEU C CD1   1 
ATOM   1255 C CD2   . LEU C 3 54 ? -26.408 -5.344  24.863  1.00 34.34 ? 277 LEU C CD2   1 
ATOM   1256 N N     . VAL C 3 55 ? -26.817 -10.757 24.668  1.00 33.63 ? 278 VAL C N     1 
ATOM   1257 C CA    . VAL C 3 55 ? -26.644 -11.967 23.788  1.00 37.79 ? 278 VAL C CA    1 
ATOM   1258 C C     . VAL C 3 55 ? -25.852 -13.168 24.508  1.00 37.50 ? 278 VAL C C     1 
ATOM   1259 O O     . VAL C 3 55 ? -26.545 -13.956 25.191  1.00 35.71 ? 278 VAL C O     1 
ATOM   1260 C CB    . VAL C 3 55 ? -25.942 -11.404 22.382  1.00 39.91 ? 278 VAL C CB    1 
ATOM   1261 C CG1   . VAL C 3 55 ? -24.438 -11.580 22.348  1.00 37.42 ? 278 VAL C CG1   1 
ATOM   1262 C CG2   . VAL C 3 55 ? -26.605 -12.119 21.198  1.00 42.59 ? 278 VAL C CG2   1 
ATOM   1263 N N     . GLY C 3 56 ? -24.536 -13.528 24.544  1.00 34.64 ? 279 GLY C N     1 
ATOM   1264 C CA    . GLY C 3 56 ? -24.119 -14.716 25.332  1.00 36.36 ? 279 GLY C CA    1 
ATOM   1265 C C     . GLY C 3 56 ? -22.785 -14.542 26.060  1.00 36.11 ? 279 GLY C C     1 
ATOM   1266 O O     . GLY C 3 56 ? -22.302 -13.413 26.122  1.00 37.90 ? 279 GLY C O     1 
ATOM   1267 N N     . GLU C 3 57 ? -22.157 -15.528 26.712  1.00 36.88 ? 280 GLU C N     1 
ATOM   1268 C CA    . GLU C 3 57 ? -20.731 -15.347 26.990  1.00 38.05 ? 280 GLU C CA    1 
ATOM   1269 C C     . GLU C 3 57 ? -20.111 -16.435 26.113  1.00 39.24 ? 280 GLU C C     1 
ATOM   1270 O O     . GLU C 3 57 ? -20.654 -17.536 25.962  1.00 38.12 ? 280 GLU C O     1 
ATOM   1271 C CB    . GLU C 3 57 ? -20.263 -15.617 28.475  1.00 39.37 ? 280 GLU C CB    1 
ATOM   1272 C CG    . GLU C 3 57 ? -20.023 -17.014 29.066  1.00 37.79 ? 280 GLU C CG    1 
ATOM   1273 C CD    . GLU C 3 57 ? -21.282 -17.904 29.130  1.00 44.48 ? 280 GLU C CD    1 
ATOM   1274 O OE1   . GLU C 3 57 ? -22.004 -17.947 28.145  1.00 45.44 ? 280 GLU C OE1   1 
ATOM   1275 O OE2   . GLU C 3 57 ? -21.555 -18.562 30.141  1.00 46.86 ? 280 GLU C OE2   1 
ATOM   1276 N N     . ARG C 3 58 ? -19.024 -16.012 25.497  1.00 40.58 ? 281 ARG C N     1 
ATOM   1277 C CA    . ARG C 3 58 ? -18.054 -16.791 24.705  1.00 42.70 ? 281 ARG C CA    1 
ATOM   1278 C C     . ARG C 3 58 ? -16.847 -15.840 24.935  1.00 43.63 ? 281 ARG C C     1 
ATOM   1279 O O     . ARG C 3 58 ? -16.305 -15.248 23.958  1.00 42.62 ? 281 ARG C O     1 
ATOM   1280 C CB    . ARG C 3 58 ? -18.302 -16.873 23.122  1.00 43.98 ? 281 ARG C CB    1 
ATOM   1281 C CG    . ARG C 3 58 ? -19.699 -17.217 22.655  1.00 43.79 ? 281 ARG C CG    1 
ATOM   1282 C CD    . ARG C 3 58 ? -19.611 -17.717 21.223  1.00 44.81 ? 281 ARG C CD    1 
ATOM   1283 N NE    . ARG C 3 58 ? -20.794 -17.485 20.348  1.00 48.83 ? 281 ARG C NE    1 
ATOM   1284 C CZ    . ARG C 3 58 ? -22.059 -17.970 20.504  1.00 52.97 ? 281 ARG C CZ    1 
ATOM   1285 N NH1   . ARG C 3 58 ? -22.435 -18.743 21.544  1.00 51.93 ? 281 ARG C NH1   1 
ATOM   1286 N NH2   . ARG C 3 58 ? -22.970 -17.653 19.562  1.00 52.07 ? 281 ARG C NH2   1 
ATOM   1287 N N     . MET D 3 1  ? 52.433  16.501  30.138  1.00 56.26 ? 224 MET D N     1 
ATOM   1288 C CA    . MET D 3 1  ? 52.617  15.124  29.642  1.00 57.47 ? 224 MET D CA    1 
ATOM   1289 C C     . MET D 3 1  ? 51.489  14.033  29.674  1.00 57.74 ? 224 MET D C     1 
ATOM   1290 O O     . MET D 3 1  ? 51.522  13.161  28.805  1.00 57.88 ? 224 MET D O     1 
ATOM   1291 C CB    . MET D 3 1  ? 53.868  14.585  30.364  1.00 52.77 ? 224 MET D CB    1 
ATOM   1292 C CG    . MET D 3 1  ? 54.742  13.706  29.472  1.00 46.60 ? 224 MET D CG    1 
ATOM   1293 S SD    . MET D 3 1  ? 56.367  13.395  30.204  1.00 42.69 ? 224 MET D SD    1 
ATOM   1294 C CE    . MET D 3 1  ? 56.025  11.884  31.059  1.00 38.81 ? 224 MET D CE    1 
ATOM   1295 N N     . LYS D 3 2  ? 50.459  14.073  30.561  1.00 56.23 ? 225 LYS D N     1 
ATOM   1296 C CA    . LYS D 3 2  ? 49.509  12.957  30.733  1.00 52.20 ? 225 LYS D CA    1 
ATOM   1297 C C     . LYS D 3 2  ? 47.949  13.038  30.949  1.00 47.01 ? 225 LYS D C     1 
ATOM   1298 O O     . LYS D 3 2  ? 47.187  13.953  30.627  1.00 42.10 ? 225 LYS D O     1 
ATOM   1299 C CB    . LYS D 3 2  ? 50.171  12.102  31.874  1.00 56.87 ? 225 LYS D CB    1 
ATOM   1300 C CG    . LYS D 3 2  ? 50.634  10.688  31.435  1.00 64.66 ? 225 LYS D CG    1 
ATOM   1301 C CD    . LYS D 3 2  ? 52.136  10.628  31.060  1.00 69.74 ? 225 LYS D CD    1 
ATOM   1302 C CE    . LYS D 3 2  ? 52.490  9.999   29.692  1.00 78.13 ? 225 LYS D CE    1 
ATOM   1303 N NZ    . LYS D 3 2  ? 51.966  8.655   29.532  1.00 80.04 ? 225 LYS D NZ    1 
ATOM   1304 N N     . ASP D 3 3  ? 47.424  11.998  31.576  1.00 43.60 ? 226 ASP D N     1 
ATOM   1305 C CA    . ASP D 3 3  ? 46.026  11.777  31.859  1.00 40.60 ? 226 ASP D CA    1 
ATOM   1306 C C     . ASP D 3 3  ? 45.379  12.233  33.188  1.00 39.61 ? 226 ASP D C     1 
ATOM   1307 O O     . ASP D 3 3  ? 44.731  11.376  33.792  1.00 39.24 ? 226 ASP D O     1 
ATOM   1308 C CB    . ASP D 3 3  ? 45.899  10.282  31.627  1.00 43.47 ? 226 ASP D CB    1 
ATOM   1309 C CG    . ASP D 3 3  ? 46.612  9.385   32.652  1.00 46.35 ? 226 ASP D CG    1 
ATOM   1310 O OD1   . ASP D 3 3  ? 47.534  9.832   33.369  1.00 44.90 ? 226 ASP D OD1   1 
ATOM   1311 O OD2   . ASP D 3 3  ? 46.218  8.214   32.720  1.00 47.76 ? 226 ASP D OD2   1 
ATOM   1312 N N     . PRO D 3 4  ? 45.423  13.451  33.797  1.00 39.60 ? 227 PRO D N     1 
ATOM   1313 C CA    . PRO D 3 4  ? 44.509  13.799  34.918  1.00 35.71 ? 227 PRO D CA    1 
ATOM   1314 C C     . PRO D 3 4  ? 43.085  13.657  34.327  1.00 34.00 ? 227 PRO D C     1 
ATOM   1315 O O     . PRO D 3 4  ? 42.234  12.779  34.521  1.00 34.09 ? 227 PRO D O     1 
ATOM   1316 C CB    . PRO D 3 4  ? 44.920  15.230  35.297  1.00 36.09 ? 227 PRO D CB    1 
ATOM   1317 C CG    . PRO D 3 4  ? 46.251  15.559  34.618  1.00 37.16 ? 227 PRO D CG    1 
ATOM   1318 C CD    . PRO D 3 4  ? 46.286  14.604  33.425  1.00 39.60 ? 227 PRO D CD    1 
ATOM   1319 N N     . ALA D 3 5  ? 42.941  14.568  33.383  1.00 31.72 ? 228 ALA D N     1 
ATOM   1320 C CA    . ALA D 3 5  ? 41.765  14.656  32.588  1.00 28.26 ? 228 ALA D CA    1 
ATOM   1321 C C     . ALA D 3 5  ? 41.556  13.439  31.733  1.00 25.18 ? 228 ALA D C     1 
ATOM   1322 O O     . ALA D 3 5  ? 40.369  13.192  31.575  1.00 28.26 ? 228 ALA D O     1 
ATOM   1323 C CB    . ALA D 3 5  ? 41.851  15.883  31.722  1.00 34.08 ? 228 ALA D CB    1 
ATOM   1324 N N     . ALA D 3 6  ? 42.476  12.658  31.135  1.00 21.78 ? 229 ALA D N     1 
ATOM   1325 C CA    . ALA D 3 6  ? 41.972  11.434  30.458  1.00 22.34 ? 229 ALA D CA    1 
ATOM   1326 C C     . ALA D 3 6  ? 41.126  10.444  31.287  1.00 22.78 ? 229 ALA D C     1 
ATOM   1327 O O     . ALA D 3 6  ? 40.512  9.536   30.753  1.00 27.40 ? 229 ALA D O     1 
ATOM   1328 C CB    . ALA D 3 6  ? 43.040  10.551  29.900  1.00 23.10 ? 229 ALA D CB    1 
ATOM   1329 N N     . LEU D 3 7  ? 41.078  10.504  32.615  1.00 23.60 ? 230 LEU D N     1 
ATOM   1330 C CA    . LEU D 3 7  ? 40.088  9.734   33.340  1.00 24.30 ? 230 LEU D CA    1 
ATOM   1331 C C     . LEU D 3 7  ? 38.725  10.441  33.292  1.00 24.15 ? 230 LEU D C     1 
ATOM   1332 O O     . LEU D 3 7  ? 37.718  9.794   33.035  1.00 25.57 ? 230 LEU D O     1 
ATOM   1333 C CB    . LEU D 3 7  ? 40.577  9.552   34.786  1.00 27.23 ? 230 LEU D CB    1 
ATOM   1334 C CG    . LEU D 3 7  ? 39.957  8.364   35.562  1.00 27.46 ? 230 LEU D CG    1 
ATOM   1335 C CD1   . LEU D 3 7  ? 39.981  7.068   34.723  1.00 29.57 ? 230 LEU D CD1   1 
ATOM   1336 C CD2   . LEU D 3 7  ? 40.730  8.207   36.860  1.00 26.44 ? 230 LEU D CD2   1 
ATOM   1337 N N     . LYS D 3 8  ? 38.600  11.757  33.483  1.00 24.18 ? 231 LYS D N     1 
ATOM   1338 C CA    . LYS D 3 8  ? 37.290  12.438  33.420  1.00 25.19 ? 231 LYS D CA    1 
ATOM   1339 C C     . LYS D 3 8  ? 36.605  12.238  32.079  1.00 26.26 ? 231 LYS D C     1 
ATOM   1340 O O     . LYS D 3 8  ? 35.413  11.923  32.092  1.00 25.69 ? 231 LYS D O     1 
ATOM   1341 C CB    . LYS D 3 8  ? 37.312  13.967  33.558  1.00 26.08 ? 231 LYS D CB    1 
ATOM   1342 C CG    . LYS D 3 8  ? 35.963  14.363  34.125  1.00 26.31 ? 231 LYS D CG    1 
ATOM   1343 C CD    . LYS D 3 8  ? 35.673  15.859  34.101  1.00 31.49 ? 231 LYS D CD    1 
ATOM   1344 C CE    . LYS D 3 8  ? 34.409  16.251  34.928  1.00 28.82 ? 231 LYS D CE    1 
ATOM   1345 N NZ    . LYS D 3 8  ? 34.657  16.489  36.355  1.00 23.87 ? 231 LYS D NZ    1 
ATOM   1346 N N     . ARG D 3 9  ? 37.273  12.388  30.909  1.00 29.38 ? 232 ARG D N     1 
ATOM   1347 C CA    . ARG D 3 9  ? 36.612  12.031  29.616  1.00 30.05 ? 232 ARG D CA    1 
ATOM   1348 C C     . ARG D 3 9  ? 36.316  10.499  29.489  1.00 26.33 ? 232 ARG D C     1 
ATOM   1349 O O     . ARG D 3 9  ? 35.147  10.151  29.350  1.00 23.77 ? 232 ARG D O     1 
ATOM   1350 C CB    . ARG D 3 9  ? 37.468  12.407  28.362  1.00 30.54 ? 232 ARG D CB    1 
ATOM   1351 C CG    . ARG D 3 9  ? 38.027  13.831  28.258  1.00 35.06 ? 232 ARG D CG    1 
ATOM   1352 C CD    . ARG D 3 9  ? 38.943  14.091  27.026  1.00 35.82 ? 232 ARG D CD    1 
ATOM   1353 N NE    . ARG D 3 9  ? 40.147  13.272  27.038  1.00 37.93 ? 232 ARG D NE    1 
ATOM   1354 C CZ    . ARG D 3 9  ? 40.743  12.769  25.952  1.00 37.86 ? 232 ARG D CZ    1 
ATOM   1355 N NH1   . ARG D 3 9  ? 40.400  13.083  24.705  1.00 40.85 ? 232 ARG D NH1   1 
ATOM   1356 N NH2   . ARG D 3 9  ? 41.748  11.929  26.122  1.00 36.37 ? 232 ARG D NH2   1 
ATOM   1357 N N     . ALA D 3 10 ? 37.211  9.488   29.570  1.00 23.01 ? 233 ALA D N     1 
ATOM   1358 C CA    . ALA D 3 10 ? 36.860  8.091   29.344  1.00 21.71 ? 233 ALA D CA    1 
ATOM   1359 C C     . ALA D 3 10 ? 35.710  7.570   30.200  1.00 24.15 ? 233 ALA D C     1 
ATOM   1360 O O     . ALA D 3 10 ? 35.097  6.536   29.882  1.00 24.85 ? 233 ALA D O     1 
ATOM   1361 C CB    . ALA D 3 10 ? 38.008  7.184   29.602  1.00 16.81 ? 233 ALA D CB    1 
ATOM   1362 N N     . ARG D 3 11 ? 35.432  8.294   31.297  1.00 22.17 ? 234 ARG D N     1 
ATOM   1363 C CA    . ARG D 3 11 ? 34.205  8.053   32.076  1.00 19.65 ? 234 ARG D CA    1 
ATOM   1364 C C     . ARG D 3 11 ? 32.992  8.873   31.577  1.00 19.40 ? 234 ARG D C     1 
ATOM   1365 O O     . ARG D 3 11 ? 31.903  8.332   31.385  1.00 21.10 ? 234 ARG D O     1 
ATOM   1366 C CB    . ARG D 3 11 ? 34.424  8.391   33.575  1.00 18.60 ? 234 ARG D CB    1 
ATOM   1367 C CG    . ARG D 3 11 ? 35.560  7.701   34.317  1.00 17.46 ? 234 ARG D CG    1 
ATOM   1368 C CD    . ARG D 3 11 ? 35.538  8.313   35.679  1.00 22.81 ? 234 ARG D CD    1 
ATOM   1369 N NE    . ARG D 3 11 ? 35.976  7.365   36.686  1.00 26.53 ? 234 ARG D NE    1 
ATOM   1370 C CZ    . ARG D 3 11 ? 36.521  7.772   37.837  1.00 26.09 ? 234 ARG D CZ    1 
ATOM   1371 N NH1   . ARG D 3 11 ? 36.775  9.084   38.132  1.00 23.89 ? 234 ARG D NH1   1 
ATOM   1372 N NH2   . ARG D 3 11 ? 36.828  6.789   38.683  1.00 25.13 ? 234 ARG D NH2   1 
ATOM   1373 N N     . ASN D 3 12 ? 33.063  10.164  31.303  1.00 18.28 ? 235 ASN D N     1 
ATOM   1374 C CA    . ASN D 3 12 ? 31.929  10.927  30.763  1.00 18.57 ? 235 ASN D CA    1 
ATOM   1375 C C     . ASN D 3 12 ? 31.391  10.278  29.508  1.00 20.37 ? 235 ASN D C     1 
ATOM   1376 O O     . ASN D 3 12 ? 30.203  10.073  29.345  1.00 19.35 ? 235 ASN D O     1 
ATOM   1377 C CB    . ASN D 3 12 ? 32.325  12.362  30.394  1.00 20.06 ? 235 ASN D CB    1 
ATOM   1378 C CG    . ASN D 3 12 ? 31.132  13.107  29.898  1.00 19.18 ? 235 ASN D CG    1 
ATOM   1379 O OD1   . ASN D 3 12 ? 31.088  13.556  28.789  1.00 25.20 ? 235 ASN D OD1   1 
ATOM   1380 N ND2   . ASN D 3 12 ? 30.014  13.269  30.499  1.00 25.05 ? 235 ASN D ND2   1 
ATOM   1381 N N     . THR D 3 13 ? 32.324  9.988   28.592  1.00 23.69 ? 236 THR D N     1 
ATOM   1382 C CA    . THR D 3 13 ? 32.121  9.188   27.371  1.00 21.83 ? 236 THR D CA    1 
ATOM   1383 C C     . THR D 3 13 ? 31.478  7.844   27.618  1.00 22.37 ? 236 THR D C     1 
ATOM   1384 O O     . THR D 3 13 ? 30.737  7.443   26.732  1.00 25.43 ? 236 THR D O     1 
ATOM   1385 C CB    . THR D 3 13 ? 33.432  8.942   26.683  1.00 21.74 ? 236 THR D CB    1 
ATOM   1386 O OG1   . THR D 3 13 ? 33.830  10.253  26.221  1.00 24.62 ? 236 THR D OG1   1 
ATOM   1387 C CG2   . THR D 3 13 ? 33.350  7.849   25.631  1.00 19.64 ? 236 THR D CG2   1 
ATOM   1388 N N     . GLU D 3 14 ? 31.731  7.079   28.709  1.00 21.01 ? 237 GLU D N     1 
ATOM   1389 C CA    . GLU D 3 14 ? 30.853  5.946   28.988  1.00 17.55 ? 237 GLU D CA    1 
ATOM   1390 C C     . GLU D 3 14 ? 29.440  6.452   29.296  1.00 18.37 ? 237 GLU D C     1 
ATOM   1391 O O     . GLU D 3 14 ? 28.455  6.036   28.670  1.00 19.03 ? 237 GLU D O     1 
ATOM   1392 C CB    . GLU D 3 14 ? 31.338  5.142   30.186  1.00 16.55 ? 237 GLU D CB    1 
ATOM   1393 C CG    . GLU D 3 14 ? 32.487  4.284   29.766  1.00 17.43 ? 237 GLU D CG    1 
ATOM   1394 C CD    . GLU D 3 14 ? 32.125  3.473   28.552  1.00 15.63 ? 237 GLU D CD    1 
ATOM   1395 O OE1   . GLU D 3 14 ? 31.166  2.760   28.630  1.00 19.51 ? 237 GLU D OE1   1 
ATOM   1396 O OE2   . GLU D 3 14 ? 32.767  3.533   27.521  1.00 20.17 ? 237 GLU D OE2   1 
ATOM   1397 N N     . ALA D 3 15 ? 29.347  7.421   30.208  1.00 18.20 ? 238 ALA D N     1 
ATOM   1398 C CA    . ALA D 3 15 ? 28.040  7.955   30.569  1.00 20.59 ? 238 ALA D CA    1 
ATOM   1399 C C     . ALA D 3 15 ? 27.344  8.362   29.291  1.00 21.06 ? 238 ALA D C     1 
ATOM   1400 O O     . ALA D 3 15 ? 26.333  7.711   29.106  1.00 25.45 ? 238 ALA D O     1 
ATOM   1401 C CB    . ALA D 3 15 ? 28.115  9.201   31.449  1.00 19.85 ? 238 ALA D CB    1 
ATOM   1402 N N     . ALA D 3 16 ? 27.777  9.233   28.352  1.00 19.94 ? 239 ALA D N     1 
ATOM   1403 C CA    . ALA D 3 16 ? 27.015  9.466   27.119  1.00 16.94 ? 239 ALA D CA    1 
ATOM   1404 C C     . ALA D 3 16 ? 26.748  8.151   26.417  1.00 15.74 ? 239 ALA D C     1 
ATOM   1405 O O     . ALA D 3 16 ? 25.609  8.081   25.978  1.00 14.98 ? 239 ALA D O     1 
ATOM   1406 C CB    . ALA D 3 16 ? 27.714  10.330  26.097  1.00 12.33 ? 239 ALA D CB    1 
ATOM   1407 N N     . ARG D 3 17 ? 27.562  7.085   26.298  1.00 14.73 ? 240 ARG D N     1 
ATOM   1408 C CA    . ARG D 3 17 ? 27.086  5.839   25.684  1.00 17.94 ? 240 ARG D CA    1 
ATOM   1409 C C     . ARG D 3 17 ? 25.804  5.211   26.255  1.00 20.24 ? 240 ARG D C     1 
ATOM   1410 O O     . ARG D 3 17 ? 24.864  4.715   25.582  1.00 19.36 ? 240 ARG D O     1 
ATOM   1411 C CB    . ARG D 3 17 ? 28.097  4.785   25.771  1.00 21.68 ? 240 ARG D CB    1 
ATOM   1412 C CG    . ARG D 3 17 ? 29.091  4.894   24.635  1.00 28.37 ? 240 ARG D CG    1 
ATOM   1413 C CD    . ARG D 3 17 ? 30.070  3.720   24.742  1.00 28.25 ? 240 ARG D CD    1 
ATOM   1414 N NE    . ARG D 3 17 ? 31.335  4.035   24.101  1.00 25.53 ? 240 ARG D NE    1 
ATOM   1415 C CZ    . ARG D 3 17 ? 31.503  4.143   22.775  1.00 28.97 ? 240 ARG D CZ    1 
ATOM   1416 N NH1   . ARG D 3 17 ? 30.504  4.075   21.899  1.00 29.02 ? 240 ARG D NH1   1 
ATOM   1417 N NH2   . ARG D 3 17 ? 32.719  4.341   22.301  1.00 29.44 ? 240 ARG D NH2   1 
ATOM   1418 N N     . ARG D 3 18 ? 25.853  5.339   27.592  1.00 20.14 ? 241 ARG D N     1 
ATOM   1419 C CA    . ARG D 3 18 ? 24.800  4.872   28.488  1.00 19.31 ? 241 ARG D CA    1 
ATOM   1420 C C     . ARG D 3 18 ? 23.542  5.680   28.376  1.00 18.26 ? 241 ARG D C     1 
ATOM   1421 O O     . ARG D 3 18 ? 22.499  5.061   28.270  1.00 23.14 ? 241 ARG D O     1 
ATOM   1422 C CB    . ARG D 3 18 ? 25.196  4.926   29.977  1.00 14.44 ? 241 ARG D CB    1 
ATOM   1423 C CG    . ARG D 3 18 ? 25.999  3.721   30.475  1.00 17.77 ? 241 ARG D CG    1 
ATOM   1424 C CD    . ARG D 3 18 ? 26.072  3.449   31.992  1.00 17.78 ? 241 ARG D CD    1 
ATOM   1425 N NE    . ARG D 3 18 ? 26.642  4.491   32.843  1.00 20.99 ? 241 ARG D NE    1 
ATOM   1426 C CZ    . ARG D 3 18 ? 27.906  4.879   32.736  1.00 27.33 ? 241 ARG D CZ    1 
ATOM   1427 N NH1   . ARG D 3 18 ? 28.742  4.289   31.854  1.00 31.52 ? 241 ARG D NH1   1 
ATOM   1428 N NH2   . ARG D 3 18 ? 28.357  5.877   33.511  1.00 27.75 ? 241 ARG D NH2   1 
ATOM   1429 N N     . SER D 3 19 ? 23.579  7.016   28.389  1.00 16.33 ? 242 SER D N     1 
ATOM   1430 C CA    . SER D 3 19 ? 22.408  7.876   28.401  1.00 11.43 ? 242 SER D CA    1 
ATOM   1431 C C     . SER D 3 19 ? 21.703  7.702   27.102  1.00 14.99 ? 242 SER D C     1 
ATOM   1432 O O     . SER D 3 19 ? 20.465  7.591   27.063  1.00 17.08 ? 242 SER D O     1 
ATOM   1433 C CB    . SER D 3 19 ? 22.807  9.312   28.576  1.00 10.00 ? 242 SER D CB    1 
ATOM   1434 O OG    . SER D 3 19 ? 22.172  10.281  27.740  1.00 13.61 ? 242 SER D OG    1 
ATOM   1435 N N     . ARG D 3 20 ? 22.521  7.674   26.017  1.00 17.34 ? 243 ARG D N     1 
ATOM   1436 C CA    . ARG D 3 20 ? 22.026  7.316   24.652  1.00 15.67 ? 243 ARG D CA    1 
ATOM   1437 C C     . ARG D 3 20 ? 21.546  5.837   24.520  1.00 14.69 ? 243 ARG D C     1 
ATOM   1438 O O     . ARG D 3 20 ? 20.586  5.627   23.794  1.00 17.34 ? 243 ARG D O     1 
ATOM   1439 C CB    . ARG D 3 20 ? 23.138  7.620   23.607  1.00 10.00 ? 243 ARG D CB    1 
ATOM   1440 C CG    . ARG D 3 20 ? 23.109  9.176   23.563  1.00 15.77 ? 243 ARG D CG    1 
ATOM   1441 C CD    . ARG D 3 20 ? 23.926  10.130  22.627  1.00 17.64 ? 243 ARG D CD    1 
ATOM   1442 N NE    . ARG D 3 20 ? 25.345  10.271  22.937  1.00 24.87 ? 243 ARG D NE    1 
ATOM   1443 C CZ    . ARG D 3 20 ? 26.151  11.306  22.567  1.00 25.09 ? 243 ARG D CZ    1 
ATOM   1444 N NH1   . ARG D 3 20 ? 25.734  12.426  21.989  1.00 22.16 ? 243 ARG D NH1   1 
ATOM   1445 N NH2   . ARG D 3 20 ? 27.462  11.241  22.812  1.00 22.17 ? 243 ARG D NH2   1 
ATOM   1446 N N     . ALA D 3 21 ? 22.018  4.722   25.096  1.00 14.21 ? 244 ALA D N     1 
ATOM   1447 C CA    . ALA D 3 21 ? 21.267  3.472   25.049  1.00 14.98 ? 244 ALA D CA    1 
ATOM   1448 C C     . ALA D 3 21 ? 19.882  3.712   25.661  1.00 18.37 ? 244 ALA D C     1 
ATOM   1449 O O     . ALA D 3 21 ? 18.869  3.399   25.045  1.00 22.99 ? 244 ALA D O     1 
ATOM   1450 C CB    . ALA D 3 21 ? 21.877  2.368   25.880  1.00 21.08 ? 244 ALA D CB    1 
ATOM   1451 N N     . ARG D 3 22 ? 19.662  4.288   26.831  1.00 20.31 ? 245 ARG D N     1 
ATOM   1452 C CA    . ARG D 3 22 ? 18.298  4.534   27.337  1.00 20.68 ? 245 ARG D CA    1 
ATOM   1453 C C     . ARG D 3 22 ? 17.294  5.140   26.370  1.00 18.23 ? 245 ARG D C     1 
ATOM   1454 O O     . ARG D 3 22 ? 16.249  4.610   26.083  1.00 14.70 ? 245 ARG D O     1 
ATOM   1455 C CB    . ARG D 3 22 ? 18.328  5.449   28.568  1.00 25.76 ? 245 ARG D CB    1 
ATOM   1456 C CG    . ARG D 3 22 ? 18.532  4.605   29.835  1.00 28.39 ? 245 ARG D CG    1 
ATOM   1457 C CD    . ARG D 3 22 ? 18.436  5.410   31.138  1.00 30.35 ? 245 ARG D CD    1 
ATOM   1458 N NE    . ARG D 3 22 ? 19.511  6.371   31.366  1.00 34.15 ? 245 ARG D NE    1 
ATOM   1459 C CZ    . ARG D 3 22 ? 20.758  6.019   31.708  1.00 31.44 ? 245 ARG D CZ    1 
ATOM   1460 N NH1   . ARG D 3 22 ? 21.195  4.761   31.796  1.00 30.80 ? 245 ARG D NH1   1 
ATOM   1461 N NH2   . ARG D 3 22 ? 21.615  6.997   31.933  1.00 32.82 ? 245 ARG D NH2   1 
ATOM   1462 N N     . LYS D 3 23 ? 17.606  6.254   25.802  1.00 20.28 ? 246 LYS D N     1 
ATOM   1463 C CA    . LYS D 3 23 ? 16.709  6.845   24.862  1.00 26.91 ? 246 LYS D CA    1 
ATOM   1464 C C     . LYS D 3 23 ? 16.422  5.838   23.720  1.00 27.06 ? 246 LYS D C     1 
ATOM   1465 O O     . LYS D 3 23 ? 15.278  5.639   23.312  1.00 29.71 ? 246 LYS D O     1 
ATOM   1466 C CB    . LYS D 3 23 ? 17.435  8.160   24.453  1.00 33.46 ? 246 LYS D CB    1 
ATOM   1467 C CG    . LYS D 3 23 ? 16.690  8.842   23.328  1.00 41.21 ? 246 LYS D CG    1 
ATOM   1468 C CD    . LYS D 3 23 ? 17.386  9.797   22.325  1.00 48.20 ? 246 LYS D CD    1 
ATOM   1469 C CE    . LYS D 3 23 ? 18.286  9.120   21.283  1.00 48.59 ? 246 LYS D CE    1 
ATOM   1470 N NZ    . LYS D 3 23 ? 17.630  8.009   20.651  1.00 48.67 ? 246 LYS D NZ    1 
ATOM   1471 N N     . LEU D 3 24 ? 17.407  5.080   23.263  1.00 26.52 ? 247 LEU D N     1 
ATOM   1472 C CA    . LEU D 3 24 ? 17.240  4.072   22.213  1.00 25.31 ? 247 LEU D CA    1 
ATOM   1473 C C     . LEU D 3 24 ? 16.267  3.047   22.630  1.00 23.57 ? 247 LEU D C     1 
ATOM   1474 O O     . LEU D 3 24 ? 15.369  2.759   21.882  1.00 26.45 ? 247 LEU D O     1 
ATOM   1475 C CB    . LEU D 3 24 ? 18.530  3.344   21.907  1.00 29.22 ? 247 LEU D CB    1 
ATOM   1476 C CG    . LEU D 3 24 ? 18.734  2.323   20.816  1.00 30.73 ? 247 LEU D CG    1 
ATOM   1477 C CD1   . LEU D 3 24 ? 18.501  0.896   21.386  1.00 34.08 ? 247 LEU D CD1   1 
ATOM   1478 C CD2   . LEU D 3 24 ? 17.926  2.812   19.621  1.00 28.04 ? 247 LEU D CD2   1 
ATOM   1479 N N     . GLN D 3 25 ? 16.404  2.481   23.799  1.00 24.23 ? 248 GLN D N     1 
ATOM   1480 C CA    . GLN D 3 25 ? 15.415  1.528   24.268  1.00 26.58 ? 248 GLN D CA    1 
ATOM   1481 C C     . GLN D 3 25 ? 14.043  2.108   24.698  1.00 28.12 ? 248 GLN D C     1 
ATOM   1482 O O     . GLN D 3 25 ? 13.021  1.415   24.577  1.00 30.52 ? 248 GLN D O     1 
ATOM   1483 C CB    . GLN D 3 25 ? 15.991  0.774   25.414  1.00 26.58 ? 248 GLN D CB    1 
ATOM   1484 C CG    . GLN D 3 25 ? 15.579  -0.677  25.381  1.00 30.98 ? 248 GLN D CG    1 
ATOM   1485 C CD    . GLN D 3 25 ? 14.972  -1.067  26.716  1.00 37.30 ? 248 GLN D CD    1 
ATOM   1486 O OE1   . GLN D 3 25 ? 13.950  -1.730  26.855  1.00 41.92 ? 248 GLN D OE1   1 
ATOM   1487 N NE2   . GLN D 3 25 ? 15.548  -0.664  27.831  1.00 41.54 ? 248 GLN D NE2   1 
ATOM   1488 N N     . ARG D 3 26 ? 13.828  3.330   25.225  1.00 28.42 ? 249 ARG D N     1 
ATOM   1489 C CA    . ARG D 3 26 ? 12.444  3.788   25.474  1.00 28.17 ? 249 ARG D CA    1 
ATOM   1490 C C     . ARG D 3 26 ? 11.844  3.882   24.083  1.00 27.57 ? 249 ARG D C     1 
ATOM   1491 O O     . ARG D 3 26 ? 10.754  3.364   23.901  1.00 31.65 ? 249 ARG D O     1 
ATOM   1492 C CB    . ARG D 3 26 ? 12.266  5.193   26.062  1.00 29.16 ? 249 ARG D CB    1 
ATOM   1493 C CG    . ARG D 3 26 ? 13.292  5.683   27.042  1.00 32.90 ? 249 ARG D CG    1 
ATOM   1494 C CD    . ARG D 3 26 ? 13.251  5.286   28.512  1.00 40.09 ? 249 ARG D CD    1 
ATOM   1495 N NE    . ARG D 3 26 ? 14.348  5.821   29.344  1.00 44.11 ? 249 ARG D NE    1 
ATOM   1496 C CZ    . ARG D 3 26 ? 15.137  6.934   29.150  1.00 46.36 ? 249 ARG D CZ    1 
ATOM   1497 N NH1   . ARG D 3 26 ? 15.085  7.794   28.119  1.00 41.53 ? 249 ARG D NH1   1 
ATOM   1498 N NH2   . ARG D 3 26 ? 16.078  7.218   30.074  1.00 45.79 ? 249 ARG D NH2   1 
ATOM   1499 N N     . MET D 3 27 ? 12.522  4.451   23.071  1.00 28.92 ? 250 MET D N     1 
ATOM   1500 C CA    . MET D 3 27 ? 11.991  4.531   21.714  1.00 25.88 ? 250 MET D CA    1 
ATOM   1501 C C     . MET D 3 27 ? 11.631  3.179   21.159  1.00 23.00 ? 250 MET D C     1 
ATOM   1502 O O     . MET D 3 27 ? 10.461  3.013   20.824  1.00 22.48 ? 250 MET D O     1 
ATOM   1503 C CB    . MET D 3 27 ? 12.966  5.133   20.713  1.00 27.71 ? 250 MET D CB    1 
ATOM   1504 C CG    . MET D 3 27 ? 12.131  5.497   19.481  1.00 30.11 ? 250 MET D CG    1 
ATOM   1505 S SD    . MET D 3 27 ? 13.009  6.417   18.189  1.00 31.94 ? 250 MET D SD    1 
ATOM   1506 C CE    . MET D 3 27 ? 14.301  5.268   17.759  1.00 18.72 ? 250 MET D CE    1 
ATOM   1507 N N     . LYS D 3 28 ? 12.487  2.176   21.059  1.00 23.17 ? 251 LYS D N     1 
ATOM   1508 C CA    . LYS D 3 28 ? 11.988  0.917   20.508  1.00 27.36 ? 251 LYS D CA    1 
ATOM   1509 C C     . LYS D 3 28 ? 10.910  0.377   21.430  1.00 28.08 ? 251 LYS D C     1 
ATOM   1510 O O     . LYS D 3 28 ? 9.891   -0.079  20.942  1.00 30.12 ? 251 LYS D O     1 
ATOM   1511 C CB    . LYS D 3 28 ? 13.108  -0.094  20.365  1.00 29.22 ? 251 LYS D CB    1 
ATOM   1512 C CG    . LYS D 3 28 ? 14.062  0.318   19.225  1.00 36.80 ? 251 LYS D CG    1 
ATOM   1513 C CD    . LYS D 3 28 ? 15.313  -0.594  19.219  1.00 40.64 ? 251 LYS D CD    1 
ATOM   1514 C CE    . LYS D 3 28 ? 16.296  -0.316  18.054  1.00 45.02 ? 251 LYS D CE    1 
ATOM   1515 N NZ    . LYS D 3 28 ? 17.429  -1.244  18.021  1.00 43.49 ? 251 LYS D NZ    1 
ATOM   1516 N N     . GLN D 3 29 ? 10.993  0.501   22.743  1.00 30.25 ? 252 GLN D N     1 
ATOM   1517 C CA    . GLN D 3 29 ? 9.920   -0.008  23.607  1.00 32.45 ? 252 GLN D CA    1 
ATOM   1518 C C     . GLN D 3 29 ? 8.502   0.489   23.287  1.00 28.00 ? 252 GLN D C     1 
ATOM   1519 O O     . GLN D 3 29 ? 7.556   -0.296  23.188  1.00 28.39 ? 252 GLN D O     1 
ATOM   1520 C CB    . GLN D 3 29 ? 10.261  0.342   25.056  1.00 36.09 ? 252 GLN D CB    1 
ATOM   1521 C CG    . GLN D 3 29 ? 9.244   -0.098  26.116  1.00 41.10 ? 252 GLN D CG    1 
ATOM   1522 C CD    . GLN D 3 29 ? 9.234   0.803   27.359  1.00 45.80 ? 252 GLN D CD    1 
ATOM   1523 O OE1   . GLN D 3 29 ? 8.548   0.560   28.358  1.00 47.83 ? 252 GLN D OE1   1 
ATOM   1524 N NE2   . GLN D 3 29 ? 9.966   1.910   27.419  1.00 45.13 ? 252 GLN D NE2   1 
ATOM   1525 N N     . LEU D 3 30 ? 8.326   1.789   23.069  1.00 25.55 ? 253 LEU D N     1 
ATOM   1526 C CA    . LEU D 3 30 ? 7.013   2.338   22.716  1.00 22.44 ? 253 LEU D CA    1 
ATOM   1527 C C     . LEU D 3 30 ? 6.501   1.932   21.361  1.00 22.00 ? 253 LEU D C     1 
ATOM   1528 O O     . LEU D 3 30 ? 5.372   1.493   21.237  1.00 20.90 ? 253 LEU D O     1 
ATOM   1529 C CB    . LEU D 3 30 ? 7.011   3.797   22.695  1.00 17.75 ? 253 LEU D CB    1 
ATOM   1530 C CG    . LEU D 3 30 ? 7.216   4.511   23.930  1.00 13.85 ? 253 LEU D CG    1 
ATOM   1531 C CD1   . LEU D 3 30 ? 6.802   5.901   23.691  1.00 15.72 ? 253 LEU D CD1   1 
ATOM   1532 C CD2   . LEU D 3 30 ? 6.349   3.961   25.022  1.00 16.75 ? 253 LEU D CD2   1 
ATOM   1533 N N     . GLU D 3 31 ? 7.328   2.064   20.329  1.00 22.72 ? 254 GLU D N     1 
ATOM   1534 C CA    . GLU D 3 31 ? 7.000   1.546   18.991  1.00 25.16 ? 254 GLU D CA    1 
ATOM   1535 C C     . GLU D 3 31 ? 6.502   0.072   18.903  1.00 25.24 ? 254 GLU D C     1 
ATOM   1536 O O     . GLU D 3 31 ? 5.705   -0.323  18.045  1.00 24.03 ? 254 GLU D O     1 
ATOM   1537 C CB    . GLU D 3 31 ? 8.228   1.677   18.064  1.00 26.35 ? 254 GLU D CB    1 
ATOM   1538 C CG    . GLU D 3 31 ? 8.814   3.097   17.915  1.00 30.62 ? 254 GLU D CG    1 
ATOM   1539 C CD    . GLU D 3 31 ? 9.799   3.346   16.748  1.00 32.25 ? 254 GLU D CD    1 
ATOM   1540 O OE1   . GLU D 3 31 ? 10.860  2.688   16.653  1.00 34.05 ? 254 GLU D OE1   1 
ATOM   1541 O OE2   . GLU D 3 31 ? 9.483   4.239   15.942  1.00 31.79 ? 254 GLU D OE2   1 
ATOM   1542 N N     . ASP D 3 32 ? 6.953   -0.812  19.787  1.00 24.80 ? 255 ASP D N     1 
ATOM   1543 C CA    . ASP D 3 32 ? 6.467   -2.172  19.755  1.00 26.17 ? 255 ASP D CA    1 
ATOM   1544 C C     . ASP D 3 32 ? 5.069   -1.980  20.276  1.00 27.93 ? 255 ASP D C     1 
ATOM   1545 O O     . ASP D 3 32 ? 4.134   -2.349  19.563  1.00 30.37 ? 255 ASP D O     1 
ATOM   1546 C CB    . ASP D 3 32 ? 7.214   -3.123  20.721  1.00 29.51 ? 255 ASP D CB    1 
ATOM   1547 C CG    . ASP D 3 32 ? 8.684   -3.520  20.381  1.00 33.33 ? 255 ASP D CG    1 
ATOM   1548 O OD1   . ASP D 3 32 ? 8.964   -3.906  19.222  1.00 28.68 ? 255 ASP D OD1   1 
ATOM   1549 O OD2   . ASP D 3 32 ? 9.531   -3.453  21.312  1.00 31.19 ? 255 ASP D OD2   1 
ATOM   1550 N N     . LYS D 3 33 ? 4.852   -1.342  21.436  1.00 28.07 ? 256 LYS D N     1 
ATOM   1551 C CA    . LYS D 3 33 ? 3.494   -1.116  21.947  1.00 26.72 ? 256 LYS D CA    1 
ATOM   1552 C C     . LYS D 3 33 ? 2.577   -0.412  20.902  1.00 26.46 ? 256 LYS D C     1 
ATOM   1553 O O     . LYS D 3 33 ? 1.400   -0.776  20.775  1.00 28.36 ? 256 LYS D O     1 
ATOM   1554 C CB    . LYS D 3 33 ? 3.610   -0.286  23.230  1.00 26.41 ? 256 LYS D CB    1 
ATOM   1555 C CG    . LYS D 3 33 ? 2.570   -0.622  24.316  1.00 28.66 ? 256 LYS D CG    1 
ATOM   1556 C CD    . LYS D 3 33 ? 3.171   -1.044  25.673  1.00 30.98 ? 256 LYS D CD    1 
ATOM   1557 C CE    . LYS D 3 33 ? 2.106   -1.284  26.756  1.00 31.12 ? 256 LYS D CE    1 
ATOM   1558 N NZ    . LYS D 3 33 ? 1.602   -0.042  27.341  1.00 28.49 ? 256 LYS D NZ    1 
ATOM   1559 N N     . VAL D 3 34 ? 2.977   0.580   20.082  1.00 24.83 ? 257 VAL D N     1 
ATOM   1560 C CA    . VAL D 3 34 ? 2.125   1.063   18.995  1.00 22.38 ? 257 VAL D CA    1 
ATOM   1561 C C     . VAL D 3 34 ? 1.738   -0.080  18.077  1.00 25.35 ? 257 VAL D C     1 
ATOM   1562 O O     . VAL D 3 34 ? 0.533   -0.246  17.899  1.00 27.72 ? 257 VAL D O     1 
ATOM   1563 C CB    . VAL D 3 34 ? 2.837   2.087   18.189  1.00 20.54 ? 257 VAL D CB    1 
ATOM   1564 C CG1   . VAL D 3 34 ? 2.008   2.549   17.015  1.00 18.22 ? 257 VAL D CG1   1 
ATOM   1565 C CG2   . VAL D 3 34 ? 3.092   3.258   19.115  1.00 20.69 ? 257 VAL D CG2   1 
ATOM   1566 N N     . GLU D 3 35 ? 2.624   -0.915  17.508  1.00 29.28 ? 258 GLU D N     1 
ATOM   1567 C CA    . GLU D 3 35 ? 2.188   -2.148  16.795  1.00 29.76 ? 258 GLU D CA    1 
ATOM   1568 C C     . GLU D 3 35 ? 1.260   -3.042  17.639  1.00 27.81 ? 258 GLU D C     1 
ATOM   1569 O O     . GLU D 3 35 ? 0.123   -3.255  17.216  1.00 29.16 ? 258 GLU D O     1 
ATOM   1570 C CB    . GLU D 3 35 ? 3.346   -3.081  16.401  1.00 33.23 ? 258 GLU D CB    1 
ATOM   1571 C CG    . GLU D 3 35 ? 3.758   -3.326  14.943  1.00 35.35 ? 258 GLU D CG    1 
ATOM   1572 C CD    . GLU D 3 35 ? 4.678   -2.296  14.284  1.00 39.69 ? 258 GLU D CD    1 
ATOM   1573 O OE1   . GLU D 3 35 ? 5.887   -2.258  14.583  1.00 39.95 ? 258 GLU D OE1   1 
ATOM   1574 O OE2   . GLU D 3 35 ? 4.160   -1.544  13.453  1.00 38.68 ? 258 GLU D OE2   1 
ATOM   1575 N N     . GLU D 3 36 ? 1.642   -3.535  18.826  1.00 26.78 ? 259 GLU D N     1 
ATOM   1576 C CA    . GLU D 3 36 ? 0.769   -4.379  19.683  1.00 31.44 ? 259 GLU D CA    1 
ATOM   1577 C C     . GLU D 3 36 ? -0.673  -3.877  19.861  1.00 32.75 ? 259 GLU D C     1 
ATOM   1578 O O     . GLU D 3 36 ? -1.658  -4.539  19.483  1.00 37.39 ? 259 GLU D O     1 
ATOM   1579 C CB    . GLU D 3 36 ? 1.328   -4.548  21.137  1.00 33.28 ? 259 GLU D CB    1 
ATOM   1580 C CG    . GLU D 3 36 ? 0.320   -5.039  22.229  1.00 38.48 ? 259 GLU D CG    1 
ATOM   1581 C CD    . GLU D 3 36 ? 0.655   -4.734  23.707  1.00 42.92 ? 259 GLU D CD    1 
ATOM   1582 O OE1   . GLU D 3 36 ? 1.679   -5.224  24.192  1.00 45.88 ? 259 GLU D OE1   1 
ATOM   1583 O OE2   . GLU D 3 36 ? -0.095  -4.019  24.386  1.00 40.97 ? 259 GLU D OE2   1 
ATOM   1584 N N     . LEU D 3 37 ? -0.798  -2.658  20.401  1.00 29.92 ? 260 LEU D N     1 
ATOM   1585 C CA    . LEU D 3 37 ? -2.075  -2.038  20.683  1.00 24.22 ? 260 LEU D CA    1 
ATOM   1586 C C     . LEU D 3 37 ? -2.920  -1.963  19.432  1.00 22.72 ? 260 LEU D C     1 
ATOM   1587 O O     . LEU D 3 37 ? -4.093  -2.305  19.391  1.00 22.35 ? 260 LEU D O     1 
ATOM   1588 C CB    . LEU D 3 37 ? -1.797  -0.687  21.223  1.00 25.53 ? 260 LEU D CB    1 
ATOM   1589 C CG    . LEU D 3 37 ? -2.636  -0.239  22.365  1.00 27.55 ? 260 LEU D CG    1 
ATOM   1590 C CD1   . LEU D 3 37 ? -2.977  -1.323  23.315  1.00 29.11 ? 260 LEU D CD1   1 
ATOM   1591 C CD2   . LEU D 3 37 ? -1.795  0.694   23.152  1.00 29.25 ? 260 LEU D CD2   1 
ATOM   1592 N N     . LEU D 3 38 ? -2.305  -1.618  18.318  1.00 27.24 ? 261 LEU D N     1 
ATOM   1593 C CA    . LEU D 3 38 ? -3.014  -1.509  17.050  1.00 27.06 ? 261 LEU D CA    1 
ATOM   1594 C C     . LEU D 3 38 ? -3.736  -2.766  16.676  1.00 28.26 ? 261 LEU D C     1 
ATOM   1595 O O     . LEU D 3 38 ? -4.893  -2.780  16.211  1.00 29.06 ? 261 LEU D O     1 
ATOM   1596 C CB    . LEU D 3 38 ? -2.069  -1.203  15.946  1.00 25.83 ? 261 LEU D CB    1 
ATOM   1597 C CG    . LEU D 3 38 ? -1.624  0.183   15.878  1.00 23.67 ? 261 LEU D CG    1 
ATOM   1598 C CD1   . LEU D 3 38 ? -0.708  0.308   14.690  1.00 28.35 ? 261 LEU D CD1   1 
ATOM   1599 C CD2   . LEU D 3 38 ? -2.809  1.094   15.786  1.00 25.52 ? 261 LEU D CD2   1 
ATOM   1600 N N     . SER D 3 39 ? -2.947  -3.803  16.992  1.00 26.22 ? 262 SER D N     1 
ATOM   1601 C CA    . SER D 3 39 ? -3.416  -5.119  16.697  1.00 29.36 ? 262 SER D CA    1 
ATOM   1602 C C     . SER D 3 39 ? -4.507  -5.651  17.530  1.00 27.54 ? 262 SER D C     1 
ATOM   1603 O O     . SER D 3 39 ? -5.444  -6.257  17.007  1.00 30.28 ? 262 SER D O     1 
ATOM   1604 C CB    . SER D 3 39 ? -2.363  -6.104  16.789  1.00 31.04 ? 262 SER D CB    1 
ATOM   1605 O OG    . SER D 3 39 ? -2.591  -6.496  15.445  1.00 39.58 ? 262 SER D OG    1 
ATOM   1606 N N     . LYS D 3 40 ? -4.431  -5.384  18.822  1.00 25.66 ? 263 LYS D N     1 
ATOM   1607 C CA    . LYS D 3 40 ? -5.545  -5.762  19.695  1.00 24.35 ? 263 LYS D CA    1 
ATOM   1608 C C     . LYS D 3 40 ? -6.698  -4.993  19.113  1.00 23.58 ? 263 LYS D C     1 
ATOM   1609 O O     . LYS D 3 40 ? -7.629  -5.654  18.653  1.00 30.31 ? 263 LYS D O     1 
ATOM   1610 C CB    . LYS D 3 40 ? -5.545  -5.273  21.161  1.00 25.80 ? 263 LYS D CB    1 
ATOM   1611 C CG    . LYS D 3 40 ? -4.261  -5.371  21.965  1.00 23.79 ? 263 LYS D CG    1 
ATOM   1612 C CD    . LYS D 3 40 ? -4.601  -6.274  23.097  1.00 23.85 ? 263 LYS D CD    1 
ATOM   1613 C CE    . LYS D 3 40 ? -3.396  -6.348  23.981  1.00 25.95 ? 263 LYS D CE    1 
ATOM   1614 N NZ    . LYS D 3 40 ? -3.099  -5.019  24.519  1.00 33.55 ? 263 LYS D NZ    1 
ATOM   1615 N N     . ASN D 3 41 ? -6.659  -3.654  19.003  1.00 19.41 ? 264 ASN D N     1 
ATOM   1616 C CA    . ASN D 3 41 ? -7.894  -2.971  18.684  1.00 21.94 ? 264 ASN D CA    1 
ATOM   1617 C C     . ASN D 3 41 ? -8.496  -3.346  17.339  1.00 22.83 ? 264 ASN D C     1 
ATOM   1618 O O     . ASN D 3 41 ? -9.723  -3.361  17.304  1.00 23.00 ? 264 ASN D O     1 
ATOM   1619 C CB    . ASN D 3 41 ? -7.628  -1.472  18.806  1.00 26.50 ? 264 ASN D CB    1 
ATOM   1620 C CG    . ASN D 3 41 ? -7.231  -1.050  20.236  1.00 30.14 ? 264 ASN D CG    1 
ATOM   1621 O OD1   . ASN D 3 41 ? -7.202  0.113   20.636  1.00 30.94 ? 264 ASN D OD1   1 
ATOM   1622 N ND2   . ASN D 3 41 ? -6.888  -1.912  21.157  1.00 24.44 ? 264 ASN D ND2   1 
ATOM   1623 N N     . TYR D 3 42 ? -7.849  -3.730  16.225  1.00 27.93 ? 265 TYR D N     1 
ATOM   1624 C CA    . TYR D 3 42 ? -8.674  -4.225  15.094  1.00 32.52 ? 265 TYR D CA    1 
ATOM   1625 C C     . TYR D 3 42 ? -9.491  -5.437  15.509  1.00 31.05 ? 265 TYR D C     1 
ATOM   1626 O O     . TYR D 3 42 ? -10.656 -5.565  15.158  1.00 30.49 ? 265 TYR D O     1 
ATOM   1627 C CB    . TYR D 3 42 ? -7.951  -4.773  13.854  1.00 38.02 ? 265 TYR D CB    1 
ATOM   1628 C CG    . TYR D 3 42 ? -7.633  -3.839  12.675  1.00 52.94 ? 265 TYR D CG    1 
ATOM   1629 C CD1   . TYR D 3 42 ? -7.027  -2.594  12.924  1.00 58.56 ? 265 TYR D CD1   1 
ATOM   1630 C CD2   . TYR D 3 42 ? -7.856  -4.238  11.343  1.00 56.57 ? 265 TYR D CD2   1 
ATOM   1631 C CE1   . TYR D 3 42 ? -6.634  -1.762  11.875  1.00 60.97 ? 265 TYR D CE1   1 
ATOM   1632 C CE2   . TYR D 3 42 ? -7.457  -3.395  10.289  1.00 60.95 ? 265 TYR D CE2   1 
ATOM   1633 C CZ    . TYR D 3 42 ? -6.838  -2.156  10.553  1.00 61.13 ? 265 TYR D CZ    1 
ATOM   1634 O OH    . TYR D 3 42 ? -6.377  -1.303  9.543   1.00 57.19 ? 265 TYR D OH    1 
ATOM   1635 N N     . HIS D 3 43 ? -8.965  -6.352  16.313  1.00 32.08 ? 266 HIS D N     1 
ATOM   1636 C CA    . HIS D 3 43 ? -9.719  -7.571  16.612  1.00 35.38 ? 266 HIS D CA    1 
ATOM   1637 C C     . HIS D 3 43 ? -11.039 -7.297  17.328  1.00 35.02 ? 266 HIS D C     1 
ATOM   1638 O O     . HIS D 3 43 ? -12.058 -7.996  17.138  1.00 38.03 ? 266 HIS D O     1 
ATOM   1639 C CB    . HIS D 3 43 ? -8.853  -8.529  17.473  1.00 38.24 ? 266 HIS D CB    1 
ATOM   1640 C CG    . HIS D 3 43 ? -9.676  -9.617  18.151  1.00 44.96 ? 266 HIS D CG    1 
ATOM   1641 N ND1   . HIS D 3 43 ? -10.148 -10.742 17.644  1.00 49.62 ? 266 HIS D ND1   1 
ATOM   1642 C CD2   . HIS D 3 43 ? -10.095 -9.554  19.472  1.00 49.12 ? 266 HIS D CD2   1 
ATOM   1643 C CE1   . HIS D 3 43 ? -10.840 -11.341 18.586  1.00 52.40 ? 266 HIS D CE1   1 
ATOM   1644 N NE2   . HIS D 3 43 ? -10.797 -10.627 19.680  1.00 50.76 ? 266 HIS D NE2   1 
ATOM   1645 N N     . LEU D 3 44 ? -10.911 -6.269  18.180  1.00 31.80 ? 267 LEU D N     1 
ATOM   1646 C CA    . LEU D 3 44 ? -11.997 -5.791  19.004  1.00 27.97 ? 267 LEU D CA    1 
ATOM   1647 C C     . LEU D 3 44 ? -12.933 -5.030  18.085  1.00 27.24 ? 267 LEU D C     1 
ATOM   1648 O O     . LEU D 3 44 ? -14.111 -5.406  18.070  1.00 27.90 ? 267 LEU D O     1 
ATOM   1649 C CB    . LEU D 3 44 ? -11.392 -4.929  20.096  1.00 26.90 ? 267 LEU D CB    1 
ATOM   1650 C CG    . LEU D 3 44 ? -11.507 -5.451  21.520  1.00 28.02 ? 267 LEU D CG    1 
ATOM   1651 C CD1   . LEU D 3 44 ? -10.847 -6.767  21.817  1.00 24.36 ? 267 LEU D CD1   1 
ATOM   1652 C CD2   . LEU D 3 44 ? -10.824 -4.407  22.308  1.00 26.95 ? 267 LEU D CD2   1 
ATOM   1653 N N     . GLU D 3 45 ? -12.502 -4.057  17.270  1.00 26.87 ? 268 GLU D N     1 
ATOM   1654 C CA    . GLU D 3 45 ? -13.434 -3.496  16.274  1.00 28.36 ? 268 GLU D CA    1 
ATOM   1655 C C     . GLU D 3 45 ? -14.211 -4.607  15.492  1.00 27.15 ? 268 GLU D C     1 
ATOM   1656 O O     . GLU D 3 45 ? -15.444 -4.600  15.468  1.00 29.61 ? 268 GLU D O     1 
ATOM   1657 C CB    . GLU D 3 45 ? -12.684 -2.659  15.284  1.00 27.58 ? 268 GLU D CB    1 
ATOM   1658 C CG    . GLU D 3 45 ? -11.850 -1.504  15.746  1.00 27.48 ? 268 GLU D CG    1 
ATOM   1659 C CD    . GLU D 3 45 ? -11.163 -1.011  14.485  1.00 35.51 ? 268 GLU D CD    1 
ATOM   1660 O OE1   . GLU D 3 45 ? -10.093 -1.502  14.115  1.00 32.81 ? 268 GLU D OE1   1 
ATOM   1661 O OE2   . GLU D 3 45 ? -11.718 -0.140  13.816  1.00 37.43 ? 268 GLU D OE2   1 
ATOM   1662 N N     . ASN D 3 46 ? -13.596 -5.644  14.909  1.00 26.86 ? 269 ASN D N     1 
ATOM   1663 C CA    . ASN D 3 46 ? -14.309 -6.789  14.296  1.00 28.43 ? 269 ASN D CA    1 
ATOM   1664 C C     . ASN D 3 46 ? -15.339 -7.468  15.196  1.00 28.93 ? 269 ASN D C     1 
ATOM   1665 O O     . ASN D 3 46 ? -16.476 -7.692  14.767  1.00 29.16 ? 269 ASN D O     1 
ATOM   1666 C CB    . ASN D 3 46 ? -13.368 -7.892  13.880  1.00 33.70 ? 269 ASN D CB    1 
ATOM   1667 C CG    . ASN D 3 46 ? -12.350 -7.534  12.802  1.00 35.97 ? 269 ASN D CG    1 
ATOM   1668 O OD1   . ASN D 3 46 ? -12.583 -6.848  11.802  1.00 39.10 ? 269 ASN D OD1   1 
ATOM   1669 N ND2   . ASN D 3 46 ? -11.135 -8.018  12.949  1.00 32.30 ? 269 ASN D ND2   1 
ATOM   1670 N N     . GLU D 3 47 ? -14.971 -7.788  16.473  1.00 29.90 ? 270 GLU D N     1 
ATOM   1671 C CA    . GLU D 3 47 ? -15.895 -8.397  17.450  1.00 28.04 ? 270 GLU D CA    1 
ATOM   1672 C C     . GLU D 3 47 ? -17.061 -7.454  17.723  1.00 26.54 ? 270 GLU D C     1 
ATOM   1673 O O     . GLU D 3 47 ? -18.211 -7.875  17.929  1.00 26.92 ? 270 GLU D O     1 
ATOM   1674 C CB    . GLU D 3 47 ? -15.263 -8.663  18.811  1.00 31.07 ? 270 GLU D CB    1 
ATOM   1675 C CG    . GLU D 3 47 ? -14.956 -10.139 19.210  1.00 39.12 ? 270 GLU D CG    1 
ATOM   1676 C CD    . GLU D 3 47 ? -15.427 -10.659 20.597  1.00 41.49 ? 270 GLU D CD    1 
ATOM   1677 O OE1   . GLU D 3 47 ? -16.641 -10.637 20.846  1.00 41.16 ? 270 GLU D OE1   1 
ATOM   1678 O OE2   . GLU D 3 47 ? -14.598 -11.099 21.419  1.00 41.67 ? 270 GLU D OE2   1 
ATOM   1679 N N     . VAL D 3 48 ? -16.801 -6.146  17.705  1.00 26.04 ? 271 VAL D N     1 
ATOM   1680 C CA    . VAL D 3 48 ? -17.903 -5.240  17.875  1.00 24.80 ? 271 VAL D CA    1 
ATOM   1681 C C     . VAL D 3 48 ? -18.756 -5.252  16.622  1.00 24.15 ? 271 VAL D C     1 
ATOM   1682 O O     . VAL D 3 48 ? -19.973 -5.140  16.732  1.00 24.17 ? 271 VAL D O     1 
ATOM   1683 C CB    . VAL D 3 48 ? -17.361 -3.876  18.162  1.00 24.61 ? 271 VAL D CB    1 
ATOM   1684 C CG1   . VAL D 3 48 ? -18.378 -2.785  17.945  1.00 29.02 ? 271 VAL D CG1   1 
ATOM   1685 C CG2   . VAL D 3 48 ? -17.092 -3.815  19.631  1.00 27.81 ? 271 VAL D CG2   1 
ATOM   1686 N N     . ALA D 3 49 ? -18.240 -5.405  15.405  1.00 25.66 ? 272 ALA D N     1 
ATOM   1687 C CA    . ALA D 3 49 ? -19.149 -5.452  14.230  1.00 26.76 ? 272 ALA D CA    1 
ATOM   1688 C C     . ALA D 3 49 ? -20.074 -6.671  14.212  1.00 26.59 ? 272 ALA D C     1 
ATOM   1689 O O     . ALA D 3 49 ? -21.288 -6.663  13.950  1.00 25.60 ? 272 ALA D O     1 
ATOM   1690 C CB    . ALA D 3 49 ? -18.386 -5.497  12.934  1.00 27.91 ? 272 ALA D CB    1 
ATOM   1691 N N     . ARG D 3 50 ? -19.405 -7.754  14.615  1.00 27.56 ? 273 ARG D N     1 
ATOM   1692 C CA    . ARG D 3 50 ? -20.086 -9.012  14.759  1.00 27.18 ? 273 ARG D CA    1 
ATOM   1693 C C     . ARG D 3 50 ? -21.153 -8.917  15.827  1.00 26.26 ? 273 ARG D C     1 
ATOM   1694 O O     . ARG D 3 50 ? -22.301 -9.053  15.426  1.00 26.66 ? 273 ARG D O     1 
ATOM   1695 C CB    . ARG D 3 50 ? -19.124 -10.084 15.144  1.00 29.11 ? 273 ARG D CB    1 
ATOM   1696 C CG    . ARG D 3 50 ? -19.875 -11.401 15.017  1.00 34.63 ? 273 ARG D CG    1 
ATOM   1697 C CD    . ARG D 3 50 ? -20.010 -11.990 16.373  1.00 34.69 ? 273 ARG D CD    1 
ATOM   1698 N NE    . ARG D 3 50 ? -18.678 -12.093 16.914  1.00 40.25 ? 273 ARG D NE    1 
ATOM   1699 C CZ    . ARG D 3 50 ? -18.492 -12.191 18.217  1.00 45.59 ? 273 ARG D CZ    1 
ATOM   1700 N NH1   . ARG D 3 50 ? -19.518 -12.268 19.087  1.00 49.35 ? 273 ARG D NH1   1 
ATOM   1701 N NH2   . ARG D 3 50 ? -17.231 -12.235 18.627  1.00 46.73 ? 273 ARG D NH2   1 
ATOM   1702 N N     . LEU D 3 51 ? -20.888 -8.673  17.122  1.00 22.62 ? 274 LEU D N     1 
ATOM   1703 C CA    . LEU D 3 51 ? -21.972 -8.564  18.084  1.00 21.26 ? 274 LEU D CA    1 
ATOM   1704 C C     . LEU D 3 51 ? -23.013 -7.530  17.678  1.00 22.04 ? 274 LEU D C     1 
ATOM   1705 O O     . LEU D 3 51 ? -24.173 -7.827  17.911  1.00 23.59 ? 274 LEU D O     1 
ATOM   1706 C CB    . LEU D 3 51 ? -21.403 -8.213  19.412  1.00 21.10 ? 274 LEU D CB    1 
ATOM   1707 C CG    . LEU D 3 51 ? -20.539 -9.306  20.081  1.00 25.45 ? 274 LEU D CG    1 
ATOM   1708 C CD1   . LEU D 3 51 ? -19.687 -8.643  21.141  1.00 24.91 ? 274 LEU D CD1   1 
ATOM   1709 C CD2   . LEU D 3 51 ? -21.387 -10.386 20.736  1.00 21.12 ? 274 LEU D CD2   1 
ATOM   1710 N N     . LYS D 3 52 ? -22.748 -6.375  17.048  1.00 22.65 ? 275 LYS D N     1 
ATOM   1711 C CA    . LYS D 3 52 ? -23.809 -5.502  16.543  1.00 26.60 ? 275 LYS D CA    1 
ATOM   1712 C C     . LYS D 3 52 ? -24.578 -6.015  15.295  1.00 29.92 ? 275 LYS D C     1 
ATOM   1713 O O     . LYS D 3 52 ? -25.549 -5.391  14.838  1.00 28.45 ? 275 LYS D O     1 
ATOM   1714 C CB    . LYS D 3 52 ? -23.250 -4.128  16.193  1.00 29.83 ? 275 LYS D CB    1 
ATOM   1715 C CG    . LYS D 3 52 ? -22.545 -3.342  17.304  1.00 32.39 ? 275 LYS D CG    1 
ATOM   1716 C CD    . LYS D 3 52 ? -22.113 -1.929  16.882  1.00 32.24 ? 275 LYS D CD    1 
ATOM   1717 C CE    . LYS D 3 52 ? -22.979 -0.829  17.521  1.00 33.85 ? 275 LYS D CE    1 
ATOM   1718 N NZ    . LYS D 3 52 ? -22.873 -0.719  18.975  1.00 32.22 ? 275 LYS D NZ    1 
ATOM   1719 N N     . LYS D 3 53 ? -24.123 -7.140  14.690  1.00 33.06 ? 276 LYS D N     1 
ATOM   1720 C CA    . LYS D 3 53 ? -24.850 -7.931  13.651  1.00 33.59 ? 276 LYS D CA    1 
ATOM   1721 C C     . LYS D 3 53 ? -25.626 -9.143  14.217  1.00 29.79 ? 276 LYS D C     1 
ATOM   1722 O O     . LYS D 3 53 ? -26.684 -9.562  13.731  1.00 29.00 ? 276 LYS D O     1 
ATOM   1723 C CB    . LYS D 3 53 ? -23.885 -8.489  12.562  1.00 39.68 ? 276 LYS D CB    1 
ATOM   1724 C CG    . LYS D 3 53 ? -23.281 -9.950  12.609  1.00 43.84 ? 276 LYS D CG    1 
ATOM   1725 C CD    . LYS D 3 53 ? -23.827 -10.911 11.534  1.00 43.25 ? 276 LYS D CD    1 
ATOM   1726 C CE    . LYS D 3 53 ? -23.543 -10.328 10.148  1.00 43.63 ? 276 LYS D CE    1 
ATOM   1727 N NZ    . LYS D 3 53 ? -24.457 -10.857 9.144   1.00 44.80 ? 276 LYS D NZ    1 
ATOM   1728 N N     . LEU D 3 54 ? -25.069 -9.768  15.250  1.00 27.16 ? 277 LEU D N     1 
ATOM   1729 C CA    . LEU D 3 54 ? -25.823 -10.761 15.969  1.00 29.14 ? 277 LEU D CA    1 
ATOM   1730 C C     . LEU D 3 54 ? -27.136 -10.134 16.462  1.00 33.02 ? 277 LEU D C     1 
ATOM   1731 O O     . LEU D 3 54 ? -28.224 -10.622 16.150  1.00 33.78 ? 277 LEU D O     1 
ATOM   1732 C CB    . LEU D 3 54 ? -25.015 -11.275 17.158  1.00 24.52 ? 277 LEU D CB    1 
ATOM   1733 C CG    . LEU D 3 54 ? -24.024 -12.341 16.721  1.00 24.89 ? 277 LEU D CG    1 
ATOM   1734 C CD1   . LEU D 3 54 ? -23.145 -12.814 17.859  1.00 26.52 ? 277 LEU D CD1   1 
ATOM   1735 C CD2   . LEU D 3 54 ? -24.811 -13.534 16.276  1.00 23.80 ? 277 LEU D CD2   1 
ATOM   1736 N N     . VAL D 3 55 ? -26.974 -9.004  17.176  1.00 37.22 ? 278 VAL D N     1 
ATOM   1737 C CA    . VAL D 3 55 ? -28.053 -8.212  17.763  1.00 40.17 ? 278 VAL D CA    1 
ATOM   1738 C C     . VAL D 3 55 ? -28.374 -6.932  16.959  1.00 43.80 ? 278 VAL D C     1 
ATOM   1739 O O     . VAL D 3 55 ? -29.277 -6.924  16.120  1.00 42.87 ? 278 VAL D O     1 
ATOM   1740 C CB    . VAL D 3 55 ? -27.679 -7.788  19.222  1.00 41.51 ? 278 VAL D CB    1 
ATOM   1741 C CG1   . VAL D 3 55 ? -28.993 -7.370  19.836  1.00 43.54 ? 278 VAL D CG1   1 
ATOM   1742 C CG2   . VAL D 3 55 ? -26.971 -8.864  20.044  1.00 43.29 ? 278 VAL D CG2   1 
ATOM   1743 N N     . GLY D 3 56 ? -27.615 -5.824  17.238  1.00 48.36 ? 279 GLY D N     1 
ATOM   1744 C CA    . GLY D 3 56 ? -27.779 -4.457  16.663  1.00 48.72 ? 279 GLY D CA    1 
ATOM   1745 C C     . GLY D 3 56 ? -27.260 -3.171  17.420  1.00 48.71 ? 279 GLY D C     1 
ATOM   1746 O O     . GLY D 3 56 ? -27.112 -3.074  18.661  1.00 46.47 ? 279 GLY D O     1 
ATOM   1747 N N     . GLU D 3 57 ? -27.098 -2.227  16.465  1.00 48.07 ? 280 GLU D N     1 
ATOM   1748 C CA    . GLU D 3 57 ? -26.530 -0.858  16.516  1.00 50.00 ? 280 GLU D CA    1 
ATOM   1749 C C     . GLU D 3 57 ? -26.850 0.305   17.485  1.00 49.55 ? 280 GLU D C     1 
ATOM   1750 O O     . GLU D 3 57 ? -28.030 0.613   17.707  1.00 50.46 ? 280 GLU D O     1 
ATOM   1751 C CB    . GLU D 3 57 ? -26.687 -0.307  15.070  1.00 53.93 ? 280 GLU D CB    1 
ATOM   1752 C CG    . GLU D 3 57 ? -25.786 0.863   14.612  1.00 55.28 ? 280 GLU D CG    1 
ATOM   1753 C CD    . GLU D 3 57 ? -24.333 0.501   14.300  1.00 57.31 ? 280 GLU D CD    1 
ATOM   1754 O OE1   . GLU D 3 57 ? -24.078 -0.625  13.837  1.00 59.06 ? 280 GLU D OE1   1 
ATOM   1755 O OE2   . GLU D 3 57 ? -23.462 1.360   14.515  1.00 58.69 ? 280 GLU D OE2   1 
HETATM 1756 O O     . HOH E 4 .  ? 36.135  26.901  20.126  1.00 44.47 ? 401 HOH A O     1 
HETATM 1757 O O     . HOH E 4 .  ? 29.220  23.392  24.809  1.00 26.28 ? 407 HOH A O     1 
HETATM 1758 O O     . HOH E 4 .  ? 30.714  28.204  21.276  1.00 24.38 ? 409 HOH A O     1 
HETATM 1759 O O     . HOH E 4 .  ? 29.617  12.054  33.665  1.00 24.68 ? 415 HOH A O     1 
HETATM 1760 O O     . HOH F 4 .  ? 27.035  6.577   21.741  1.00 10.00 ? 403 HOH B O     1 
HETATM 1761 O O     . HOH F 4 .  ? 32.405  12.641  2.132   1.00 14.35 ? 412 HOH B O     1 
HETATM 1762 O O     . HOH G 4 .  ? -11.458 7.788   22.054  1.00 33.26 ? 402 HOH C O     1 
HETATM 1763 O O     . HOH G 4 .  ? 22.586  17.508  18.955  1.00 10.02 ? 405 HOH C O     1 
HETATM 1764 O O     . HOH G 4 .  ? -13.651 -7.058  30.476  1.00 29.70 ? 408 HOH C O     1 
HETATM 1765 O O     . HOH G 4 .  ? 22.541  10.377  19.555  1.00 15.39 ? 416 HOH C O     1 
HETATM 1766 O O     . HOH H 4 .  ? 22.335  13.882  19.982  1.00 21.79 ? 400 HOH D O     1 
HETATM 1767 O O     . HOH H 4 .  ? 22.733  12.048  25.973  1.00 10.00 ? 404 HOH D O     1 
HETATM 1768 O O     . HOH H 4 .  ? -4.491  -3.267  7.754   1.00 23.37 ? 406 HOH D O     1 
HETATM 1769 O O     . HOH H 4 .  ? 41.896  15.525  37.930  1.00 21.67 ? 410 HOH D O     1 
HETATM 1770 O O     . HOH H 4 .  ? 13.101  -0.206  31.749  1.00 15.68 ? 411 HOH D O     1 
HETATM 1771 O O     . HOH H 4 .  ? 18.646  7.310   34.920  1.00 17.08 ? 413 HOH D O     1 
HETATM 1772 O O     . HOH H 4 .  ? 41.308  5.396   39.498  1.00 32.14 ? 414 HOH D O     1 
A 1 1  DT  1  1   1   DT  T   A . n 
A 1 2  DT  2  2   2   DT  T   A . n 
A 1 3  DC  3  3   3   DC  C   A . n 
A 1 4  DC  4  4   4   DC  C   A . n 
A 1 5  DT  5  5   5   DT  T   A . n 
A 1 6  DA  6  6   6   DA  A   A . n 
A 1 7  DT  7  7   7   DT  T   A . n 
A 1 8  DG  8  8   8   DG  G   A . n 
A 1 9  DA  9  9   9   DA  A   A . n 
A 1 10 DC  10 10  10  DC  C   A . n 
A 1 11 DT  11 11  11  DT  T   A . n 
A 1 12 DC  12 12  12  DC  C   A . n 
A 1 13 DA  13 13  13  DA  A   A . n 
A 1 14 DT  14 14  14  DT  T   A . n 
A 1 15 DC  15 15  15  DC  C   A . n 
A 1 16 DC  16 16  16  DC  C   A . n 
A 1 17 DA  17 17  17  DA  A   A . n 
A 1 18 DG  18 18  18  DG  G   A . n 
A 1 19 DT  19 19  19  DT  T   A . n 
A 1 20 DT  20 20  20  DT  T   A . n 
B 2 1  DA  1  21  21  DA  A   B . n 
B 2 2  DA  2  22  22  DA  A   B . n 
B 2 3  DA  3  23  23  DA  A   B . n 
B 2 4  DC  4  24  24  DC  C   B . n 
B 2 5  DT  5  25  25  DT  T   B . n 
B 2 6  DG  6  26  26  DG  G   B . n 
B 2 7  DG  7  27  27  DG  G   B . n 
B 2 8  DA  8  28  28  DA  A   B . n 
B 2 9  DT  9  29  29  DT  T   B . n 
B 2 10 DG  10 30  30  DG  G   B . n 
B 2 11 DA  11 31  31  DA  A   B . n 
B 2 12 DG  12 32  32  DG  G   B . n 
B 2 13 DT  13 33  33  DT  T   B . n 
B 2 14 DC  14 34  34  DC  C   B . n 
B 2 15 DA  15 35  35  DA  A   B . n 
B 2 16 DT  16 36  36  DT  T   B . n 
B 2 17 DA  17 37  37  DA  A   B . n 
B 2 18 DG  18 38  38  DG  G   B . n 
B 2 19 DG  19 39  39  DG  G   B . n 
B 2 20 DA  20 40  40  DA  A   B . n 
C 3 1  MET 1  224 ?   ?   ?   C . n 
C 3 2  LYS 2  225 225 LYS LYS C . n 
C 3 3  ASP 3  226 226 ASP ASP C . n 
C 3 4  PRO 4  227 227 PRO PRO C . n 
C 3 5  ALA 5  228 228 ALA ALA C . n 
C 3 6  ALA 6  229 229 ALA ALA C . n 
C 3 7  LEU 7  230 230 LEU LEU C . n 
C 3 8  LYS 8  231 231 LYS LYS C . n 
C 3 9  ARG 9  232 232 ARG ARG C . n 
C 3 10 ALA 10 233 233 ALA ALA C . n 
C 3 11 ARG 11 234 234 ARG ARG C . n 
C 3 12 ASN 12 235 235 ASN ASN C . n 
C 3 13 THR 13 236 236 THR THR C . n 
C 3 14 GLU 14 237 237 GLU GLU C . n 
C 3 15 ALA 15 238 238 ALA ALA C . n 
C 3 16 ALA 16 239 239 ALA ALA C . n 
C 3 17 ARG 17 240 240 ARG ARG C . n 
C 3 18 ARG 18 241 241 ARG ARG C . n 
C 3 19 SER 19 242 242 SER SER C . n 
C 3 20 ARG 20 243 243 ARG ARG C . n 
C 3 21 ALA 21 244 244 ALA ALA C . n 
C 3 22 ARG 22 245 245 ARG ARG C . n 
C 3 23 LYS 23 246 246 LYS LYS C . n 
C 3 24 LEU 24 247 247 LEU LEU C . n 
C 3 25 GLN 25 248 248 GLN GLN C . n 
C 3 26 ARG 26 249 249 ARG ARG C . n 
C 3 27 MET 27 250 250 MET MET C . n 
C 3 28 LYS 28 251 251 LYS LYS C . n 
C 3 29 GLN 29 252 252 GLN GLN C . n 
C 3 30 LEU 30 253 253 LEU LEU C . n 
C 3 31 GLU 31 254 254 GLU GLU C . n 
C 3 32 ASP 32 255 255 ASP ASP C . n 
C 3 33 LYS 33 256 256 LYS LYS C . n 
C 3 34 VAL 34 257 257 VAL VAL C . n 
C 3 35 GLU 35 258 258 GLU GLU C . n 
C 3 36 GLU 36 259 259 GLU GLU C . n 
C 3 37 LEU 37 260 260 LEU LEU C . n 
C 3 38 LEU 38 261 261 LEU LEU C . n 
C 3 39 SER 39 262 262 SER SER C . n 
C 3 40 LYS 40 263 263 LYS LYS C . n 
C 3 41 ASN 41 264 264 ASN ASN C . n 
C 3 42 TYR 42 265 265 TYR TYR C . n 
C 3 43 HIS 43 266 266 HIS HIS C . n 
C 3 44 LEU 44 267 267 LEU LEU C . n 
C 3 45 GLU 45 268 268 GLU GLU C . n 
C 3 46 ASN 46 269 269 ASN ASN C . n 
C 3 47 GLU 47 270 270 GLU GLU C . n 
C 3 48 VAL 48 271 271 VAL VAL C . n 
C 3 49 ALA 49 272 272 ALA ALA C . n 
C 3 50 ARG 50 273 273 ARG ARG C . n 
C 3 51 LEU 51 274 274 LEU LEU C . n 
C 3 52 LYS 52 275 275 LYS LYS C . n 
C 3 53 LYS 53 276 276 LYS LYS C . n 
C 3 54 LEU 54 277 277 LEU LEU C . n 
C 3 55 VAL 55 278 278 VAL VAL C . n 
C 3 56 GLY 56 279 279 GLY GLY C . n 
C 3 57 GLU 57 280 280 GLU GLU C . n 
C 3 58 ARG 58 281 281 ARG ARG C . n 
D 3 1  MET 1  224 224 MET MET D . n 
D 3 2  LYS 2  225 225 LYS LYS D . n 
D 3 3  ASP 3  226 226 ASP ASP D . n 
D 3 4  PRO 4  227 227 PRO PRO D . n 
D 3 5  ALA 5  228 228 ALA ALA D . n 
D 3 6  ALA 6  229 229 ALA ALA D . n 
D 3 7  LEU 7  230 230 LEU LEU D . n 
D 3 8  LYS 8  231 231 LYS LYS D . n 
D 3 9  ARG 9  232 232 ARG ARG D . n 
D 3 10 ALA 10 233 233 ALA ALA D . n 
D 3 11 ARG 11 234 234 ARG ARG D . n 
D 3 12 ASN 12 235 235 ASN ASN D . n 
D 3 13 THR 13 236 236 THR THR D . n 
D 3 14 GLU 14 237 237 GLU GLU D . n 
D 3 15 ALA 15 238 238 ALA ALA D . n 
D 3 16 ALA 16 239 239 ALA ALA D . n 
D 3 17 ARG 17 240 240 ARG ARG D . n 
D 3 18 ARG 18 241 241 ARG ARG D . n 
D 3 19 SER 19 242 242 SER SER D . n 
D 3 20 ARG 20 243 243 ARG ARG D . n 
D 3 21 ALA 21 244 244 ALA ALA D . n 
D 3 22 ARG 22 245 245 ARG ARG D . n 
D 3 23 LYS 23 246 246 LYS LYS D . n 
D 3 24 LEU 24 247 247 LEU LEU D . n 
D 3 25 GLN 25 248 248 GLN GLN D . n 
D 3 26 ARG 26 249 249 ARG ARG D . n 
D 3 27 MET 27 250 250 MET MET D . n 
D 3 28 LYS 28 251 251 LYS LYS D . n 
D 3 29 GLN 29 252 252 GLN GLN D . n 
D 3 30 LEU 30 253 253 LEU LEU D . n 
D 3 31 GLU 31 254 254 GLU GLU D . n 
D 3 32 ASP 32 255 255 ASP ASP D . n 
D 3 33 LYS 33 256 256 LYS LYS D . n 
D 3 34 VAL 34 257 257 VAL VAL D . n 
D 3 35 GLU 35 258 258 GLU GLU D . n 
D 3 36 GLU 36 259 259 GLU GLU D . n 
D 3 37 LEU 37 260 260 LEU LEU D . n 
D 3 38 LEU 38 261 261 LEU LEU D . n 
D 3 39 SER 39 262 262 SER SER D . n 
D 3 40 LYS 40 263 263 LYS LYS D . n 
D 3 41 ASN 41 264 264 ASN ASN D . n 
D 3 42 TYR 42 265 265 TYR TYR D . n 
D 3 43 HIS 43 266 266 HIS HIS D . n 
D 3 44 LEU 44 267 267 LEU LEU D . n 
D 3 45 GLU 45 268 268 GLU GLU D . n 
D 3 46 ASN 46 269 269 ASN ASN D . n 
D 3 47 GLU 47 270 270 GLU GLU D . n 
D 3 48 VAL 48 271 271 VAL VAL D . n 
D 3 49 ALA 49 272 272 ALA ALA D . n 
D 3 50 ARG 50 273 273 ARG ARG D . n 
D 3 51 LEU 51 274 274 LEU LEU D . n 
D 3 52 LYS 52 275 275 LYS LYS D . n 
D 3 53 LYS 53 276 276 LYS LYS D . n 
D 3 54 LEU 54 277 277 LEU LEU D . n 
D 3 55 VAL 55 278 278 VAL VAL D . n 
D 3 56 GLY 56 279 279 GLY GLY D . n 
D 3 57 GLU 57 280 280 GLU GLU D . n 
D 3 58 ARG 58 281 ?   ?   ?   D . n 
E 4 HOH 1 401 401 HOH HOH A . 
E 4 HOH 2 407 407 HOH HOH A . 
E 4 HOH 3 409 409 HOH HOH A . 
E 4 HOH 4 415 415 HOH HOH A . 
F 4 HOH 1 403 403 HOH HOH B . 
F 4 HOH 2 412 412 HOH HOH B . 
G 4 HOH 1 402 402 HOH HOH C . 
G 4 HOH 2 405 405 HOH HOH C . 
G 4 HOH 3 408 408 HOH HOH C . 
G 4 HOH 4 416 416 HOH HOH C . 
H 4 HOH 1 400 400 HOH HOH D . 
H 4 HOH 2 404 404 HOH HOH D . 
H 4 HOH 3 406 406 HOH HOH D . 
H 4 HOH 4 410 410 HOH HOH D . 
H 4 HOH 5 411 411 HOH HOH D . 
H 4 HOH 6 413 413 HOH HOH D . 
H 4 HOH 7 414 414 HOH HOH D . 
#                   1 
_pdbx_struct_assembly.details              author_defined_assembly 
_pdbx_struct_assembly.method_details       ? 
_pdbx_struct_assembly.oligomeric_details   tetrameric 
_pdbx_struct_assembly.oligomeric_count     4 
_pdbx_struct_assembly_gen.assembly_id       1 
_pdbx_struct_assembly_gen.oper_expression   1 
_pdbx_struct_assembly_gen.asym_id_list      A,B,C,D,E,F,G,H 
#                   1 
_pdbx_struct_oper_list.type                 'identity operation'                 1_555 
_pdbx_struct_oper_list.symmetry_operation   x,y,z 
_pdbx_struct_oper_list.matrix[1][1]         1.0000000000 
_pdbx_struct_oper_list.matrix[1][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[1][3]         0.0000000000 
_pdbx_struct_oper_list.vector[1]            0.0000000000 
_pdbx_struct_oper_list.matrix[2][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[2][2]         1.0000000000 
_pdbx_struct_oper_list.matrix[2][3]         0.0000000000 
_pdbx_struct_oper_list.vector[2]            0.0000000000 
_pdbx_struct_oper_list.matrix[3][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][3]         1.0000000000 
_pdbx_struct_oper_list.vector[3]            0.0000000000 
1 'Structure model' 1 0 1993-10-31 
2 'Structure model' 1 1 2008-05-22 
3 'Structure model' 1 2 2011-07-13 
_pdbx_audit_revision_details.ordinal             1 
_pdbx_audit_revision_details.revision_ordinal    1 
_pdbx_audit_revision_details.data_content_type   'Structure model' 
_pdbx_audit_revision_details.provider            repository 
_pdbx_audit_revision_details.type                'Initial release' 
_pdbx_audit_revision_details.description         ? 
1 2 'Structure model' 'Version format compliance' 
2 3 'Structure model' 'Version format compliance' 
#             TNT 
_software.classification   refinement 
_software.version          . 
_software.citation_id      ? 
_software.pdbx_ordinal     1 
1  1 "C5'" A DT  1   ? ? "C4'" A DT  1   ? ? 1.567 1.512 0.055  0.007 N 
2  1 N1    A DT  1   ? ? C2    A DT  1   ? ? 1.431 1.376 0.055  0.008 N 
3  1 C5    A DT  1   ? ? C7    A DT  1   ? ? 1.551 1.496 0.055  0.006 N 
4  1 "C5'" A DA  6   ? ? "C4'" A DA  6   ? ? 1.558 1.512 0.046  0.007 N 
5  1 N9    A DA  6   ? ? C4    A DA  6   ? ? 1.334 1.374 -0.040 0.006 N 
6  1 N1    A DT  7   ? ? C2    A DT  7   ? ? 1.316 1.376 -0.060 0.008 N 
7  1 C5    A DT  7   ? ? C7    A DT  7   ? ? 1.534 1.496 0.038  0.006 N 
8  1 "C5'" A DG  8   ? ? "C4'" A DG  8   ? ? 1.559 1.512 0.047  0.007 N 
9  1 C8    A DG  8   ? ? N9    A DG  8   ? ? 1.326 1.374 -0.048 0.007 N 
10 1 "O3'" A DA  9   ? ? "C3'" A DA  9   ? ? 1.353 1.419 -0.066 0.006 N 
11 1 N1    A DC  10  ? ? C6    A DC  10  ? ? 1.303 1.367 -0.064 0.006 N 
12 1 "C5'" A DT  11  ? ? "C4'" A DT  11  ? ? 1.570 1.512 0.058  0.007 N 
13 1 C5    A DT  14  ? ? C7    A DT  14  ? ? 1.536 1.496 0.040  0.006 N 
14 1 "C5'" A DG  18  ? ? "C4'" A DG  18  ? ? 1.571 1.512 0.059  0.007 N 
15 1 C5    A DT  19  ? ? C7    A DT  19  ? ? 1.532 1.496 0.036  0.006 N 
16 1 P     A DT  20  ? ? "O5'" A DT  20  ? ? 1.657 1.593 0.064  0.010 N 
17 1 "C5'" A DT  20  ? ? "C4'" A DT  20  ? ? 1.564 1.512 0.052  0.007 N 
18 1 "C4'" B DA  23  ? ? "C3'" B DA  23  ? ? 1.610 1.529 0.081  0.010 N 
19 1 "O3'" B DC  24  ? ? P     B DT  25  ? ? 1.711 1.607 0.104  0.012 Y 
20 1 "C5'" B DT  25  ? ? "C4'" B DT  25  ? ? 1.564 1.512 0.052  0.007 N 
21 1 C5    B DT  25  ? ? C6    B DT  25  ? ? 1.389 1.339 0.050  0.007 N 
22 1 "O3'" B DT  25  ? ? P     B DG  26  ? ? 1.690 1.607 0.083  0.012 Y 
23 1 "C5'" B DG  26  ? ? "C4'" B DG  26  ? ? 1.415 1.509 -0.094 0.011 N 
24 1 P     B DG  27  ? ? "O5'" B DG  27  ? ? 1.659 1.593 0.066  0.010 N 
25 1 "C5'" B DG  27  ? ? "C4'" B DG  27  ? ? 1.563 1.512 0.051  0.007 N 
26 1 "O3'" B DT  29  ? ? "C3'" B DT  29  ? ? 1.369 1.419 -0.050 0.006 N 
27 1 "O3'" B DG  30  ? ? "C3'" B DG  30  ? ? 1.382 1.419 -0.037 0.006 N 
28 1 "O3'" B DG  30  ? ? P     B DA  31  ? ? 1.532 1.607 -0.075 0.012 Y 
29 1 C4    B DA  31  ? ? C5    B DA  31  ? ? 1.332 1.383 -0.051 0.007 N 
30 1 C5    B DA  31  ? ? C6    B DA  31  ? ? 1.348 1.406 -0.058 0.009 N 
31 1 C6    B DA  31  ? ? N1    B DA  31  ? ? 1.301 1.351 -0.050 0.007 N 
32 1 C5    B DA  31  ? ? N7    B DA  31  ? ? 1.343 1.388 -0.045 0.006 N 
33 1 C6    B DA  31  ? ? N6    B DA  31  ? ? 1.270 1.335 -0.065 0.008 N 
34 1 "O3'" B DG  32  ? ? P     B DT  33  ? ? 1.510 1.607 -0.097 0.012 Y 
35 1 "C5'" B DA  35  ? ? "C4'" B DA  35  ? ? 1.608 1.512 0.096  0.007 N 
36 1 "O3'" B DA  35  ? ? P     B DT  36  ? ? 1.685 1.607 0.078  0.012 Y 
37 1 "O3'" B DT  36  ? ? "C3'" B DT  36  ? ? 1.380 1.419 -0.039 0.006 N 
38 1 N9    B DA  37  ? ? C4    B DA  37  ? ? 1.327 1.374 -0.047 0.006 N 
39 1 P     B DG  39  ? ? "O5'" B DG  39  ? ? 1.714 1.593 0.121  0.010 N 
40 1 "C5'" B DG  39  ? ? "C4'" B DG  39  ? ? 1.632 1.512 0.120  0.007 N 
41 1 "O4'" B DG  39  ? ? "C4'" B DG  39  ? ? 1.504 1.449 0.055  0.009 N 
42 1 CA    C VAL 278 ? ? CB    C VAL 278 ? ? 1.669 1.543 0.126  0.021 N 
43 1 NE2   D HIS 266 ? ? CD2   D HIS 266 ? ? 1.299 1.373 -0.074 0.011 N 
1   1 "O4'" A DT  1   ? ? "C1'" A DT  1   ? ? N1    A DT  1   ? ? 113.21 108.30 4.91   0.30 N 
2   1 N3    A DT  1   ? ? C2    A DT  1   ? ? O2    A DT  1   ? ? 116.02 122.30 -6.28  0.60 N 
3   1 C6    A DT  1   ? ? C5    A DT  1   ? ? C7    A DT  1   ? ? 118.53 122.90 -4.37  0.60 N 
4   1 "C3'" A DT  1   ? ? "O3'" A DT  1   ? ? P     A DT  2   ? ? 108.67 119.70 -11.03 1.20 Y 
5   1 "O4'" A DT  2   ? ? "C1'" A DT  2   ? ? "C2'" A DT  2   ? ? 96.36  105.90 -9.54  0.80 N 
6   1 "O4'" A DT  2   ? ? "C1'" A DT  2   ? ? N1    A DT  2   ? ? 97.79  108.00 -10.21 0.70 N 
7   1 C4    A DT  2   ? ? C5    A DT  2   ? ? C6    A DT  2   ? ? 122.56 118.00 4.56   0.60 N 
8   1 N3    A DT  2   ? ? C2    A DT  2   ? ? O2    A DT  2   ? ? 118.38 122.30 -3.92  0.60 N 
9   1 C6    A DT  2   ? ? C5    A DT  2   ? ? C7    A DT  2   ? ? 117.54 122.90 -5.36  0.60 N 
10  1 "O4'" A DC  4   ? ? "C4'" A DC  4   ? ? "C3'" A DC  4   ? ? 114.59 106.00 8.59   0.60 N 
11  1 "C4'" A DC  4   ? ? "C3'" A DC  4   ? ? "C2'" A DC  4   ? ? 91.77  102.20 -10.43 0.70 N 
12  1 "C3'" A DC  4   ? ? "C2'" A DC  4   ? ? "C1'" A DC  4   ? ? 111.01 102.50 8.51   1.20 N 
13  1 "O4'" A DC  4   ? ? "C1'" A DC  4   ? ? "C2'" A DC  4   ? ? 100.01 105.90 -5.89  0.80 N 
14  1 "O4'" A DC  4   ? ? "C1'" A DC  4   ? ? N1    A DC  4   ? ? 113.63 108.30 5.33   0.30 N 
15  1 N1    A DC  4   ? ? C2    A DC  4   ? ? O2    A DC  4   ? ? 122.88 118.90 3.98   0.60 N 
16  1 "C3'" A DC  4   ? ? "O3'" A DC  4   ? ? P     A DT  5   ? ? 134.07 119.70 14.37  1.20 Y 
17  1 "O4'" A DT  5   ? ? "C1'" A DT  5   ? ? "C2'" A DT  5   ? ? 99.89  105.90 -6.01  0.80 N 
18  1 C4    A DT  5   ? ? C5    A DT  5   ? ? C7    A DT  5   ? ? 114.00 119.00 -5.00  0.60 N 
19  1 "C3'" A DT  5   ? ? "O3'" A DT  5   ? ? P     A DA  6   ? ? 128.99 119.70 9.29   1.20 Y 
20  1 "C4'" A DA  6   ? ? "C3'" A DA  6   ? ? "C2'" A DA  6   ? ? 96.78  102.20 -5.42  0.70 N 
21  1 "O4'" A DT  7   ? ? "C4'" A DT  7   ? ? "C3'" A DT  7   ? ? 110.47 106.00 4.47   0.60 N 
22  1 "O4'" A DG  8   ? ? "C1'" A DG  8   ? ? N9    A DG  8   ? ? 117.44 108.30 9.14   0.30 N 
23  1 C4    A DG  8   ? ? C5    A DG  8   ? ? N7    A DG  8   ? ? 107.57 110.80 -3.23  0.40 N 
24  1 N9    A DG  8   ? ? C4    A DG  8   ? ? C5    A DG  8   ? ? 108.54 105.40 3.14   0.40 N 
25  1 "O4'" A DA  9   ? ? "C1'" A DA  9   ? ? N9    A DA  9   ? ? 113.75 108.30 5.45   0.30 N 
26  1 N9    A DA  9   ? ? C4    A DA  9   ? ? C5    A DA  9   ? ? 108.35 105.80 2.55   0.40 N 
27  1 C5    A DA  9   ? ? C6    A DA  9   ? ? N6    A DA  9   ? ? 128.86 123.70 5.16   0.80 N 
28  1 "C3'" A DA  9   ? ? "O3'" A DA  9   ? ? P     A DC  10  ? ? 128.26 119.70 8.56   1.20 Y 
29  1 "O3'" A DA  9   ? ? P     A DC  10  ? ? "O5'" A DC  10  ? ? 81.29  104.00 -22.71 1.90 Y 
30  1 "C1'" A DC  10  ? ? "O4'" A DC  10  ? ? "C4'" A DC  10  ? ? 103.52 110.10 -6.58  1.00 N 
31  1 N1    A DC  10  ? ? C2    A DC  10  ? ? O2    A DC  10  ? ? 125.24 118.90 6.34   0.60 N 
32  1 N3    A DC  10  ? ? C2    A DC  10  ? ? O2    A DC  10  ? ? 115.46 121.90 -6.44  0.70 N 
33  1 "C3'" A DC  10  ? ? "O3'" A DC  10  ? ? P     A DT  11  ? ? 129.00 119.70 9.30   1.20 Y 
34  1 "O4'" A DT  11  ? ? "C4'" A DT  11  ? ? "C3'" A DT  11  ? ? 102.06 104.50 -2.44  0.40 N 
35  1 "C1'" A DT  11  ? ? "O4'" A DT  11  ? ? "C4'" A DT  11  ? ? 116.21 110.30 5.91   0.70 N 
36  1 "O4'" A DT  11  ? ? "C1'" A DT  11  ? ? "C2'" A DT  11  ? ? 96.50  105.90 -9.40  0.80 N 
37  1 N3    A DT  11  ? ? C2    A DT  11  ? ? O2    A DT  11  ? ? 116.47 122.30 -5.83  0.60 N 
38  1 C5    A DT  11  ? ? C4    A DT  11  ? ? O4    A DT  11  ? ? 129.31 124.90 4.41   0.70 N 
39  1 C6    A DT  11  ? ? C5    A DT  11  ? ? C7    A DT  11  ? ? 118.61 122.90 -4.29  0.60 N 
40  1 P     A DC  12  ? ? "O5'" A DC  12  ? ? "C5'" A DC  12  ? ? 111.26 120.90 -9.64  1.60 N 
41  1 "O4'" A DC  12  ? ? "C4'" A DC  12  ? ? "C3'" A DC  12  ? ? 110.26 106.00 4.26   0.60 N 
42  1 "O4'" A DC  12  ? ? "C1'" A DC  12  ? ? N1    A DC  12  ? ? 110.89 108.30 2.59   0.30 N 
43  1 "C3'" A DC  12  ? ? "O3'" A DC  12  ? ? P     A DA  13  ? ? 129.25 119.70 9.55   1.20 Y 
44  1 "O3'" A DC  12  ? ? P     A DA  13  ? ? "O5'" A DA  13  ? ? 91.54  104.00 -12.46 1.90 Y 
45  1 "C4'" A DT  14  ? ? "C3'" A DT  14  ? ? "C2'" A DT  14  ? ? 97.84  102.20 -4.36  0.70 N 
46  1 "C3'" A DT  14  ? ? "C2'" A DT  14  ? ? "C1'" A DT  14  ? ? 111.14 102.50 8.64   1.20 N 
47  1 "O4'" A DT  14  ? ? "C1'" A DT  14  ? ? "C2'" A DT  14  ? ? 99.33  105.90 -6.57  0.80 N 
48  1 "O4'" A DC  15  ? ? "C1'" A DC  15  ? ? "C2'" A DC  15  ? ? 94.93  105.90 -10.97 0.80 N 
49  1 N1    A DC  15  ? ? C2    A DC  15  ? ? O2    A DC  15  ? ? 123.54 118.90 4.64   0.60 N 
50  1 N3    A DC  15  ? ? C2    A DC  15  ? ? O2    A DC  15  ? ? 115.92 121.90 -5.98  0.70 N 
51  1 "C3'" A DC  15  ? ? "O3'" A DC  15  ? ? P     A DC  16  ? ? 130.92 119.70 11.22  1.20 Y 
52  1 "O4'" A DC  16  ? ? "C1'" A DC  16  ? ? N1    A DC  16  ? ? 110.87 108.30 2.57   0.30 N 
53  1 N1    A DC  16  ? ? C2    A DC  16  ? ? O2    A DC  16  ? ? 124.44 118.90 5.54   0.60 N 
54  1 "C3'" A DC  16  ? ? "O3'" A DC  16  ? ? P     A DA  17  ? ? 129.91 119.70 10.21  1.20 Y 
55  1 "O3'" A DC  16  ? ? P     A DA  17  ? ? "O5'" A DA  17  ? ? 91.12  104.00 -12.88 1.90 Y 
56  1 "O4'" A DG  18  ? ? "C1'" A DG  18  ? ? "C2'" A DG  18  ? ? 99.76  105.90 -6.14  0.80 N 
57  1 "O4'" A DG  18  ? ? "C1'" A DG  18  ? ? N9    A DG  18  ? ? 103.63 108.00 -4.37  0.70 N 
58  1 "O4'" A DT  19  ? ? "C1'" A DT  19  ? ? "C2'" A DT  19  ? ? 94.48  105.90 -11.42 0.80 N 
59  1 C6    A DT  19  ? ? C5    A DT  19  ? ? C7    A DT  19  ? ? 117.50 122.90 -5.40  0.60 N 
60  1 "O3'" A DT  19  ? ? P     A DT  20  ? ? "O5'" A DT  20  ? ? 90.94  104.00 -13.06 1.90 Y 
61  1 "O4'" A DT  20  ? ? "C4'" A DT  20  ? ? "C3'" A DT  20  ? ? 109.64 106.00 3.64   0.60 N 
62  1 "O4'" A DT  20  ? ? "C1'" A DT  20  ? ? N1    A DT  20  ? ? 112.04 108.30 3.74   0.30 N 
63  1 N3    A DT  20  ? ? C4    A DT  20  ? ? O4    A DT  20  ? ? 125.72 119.90 5.82   0.60 N 
64  1 "C3'" B DA  21  ? ? "O3'" B DA  21  ? ? P     B DA  22  ? ? 133.74 119.70 14.04  1.20 Y 
65  1 "O3'" B DA  21  ? ? P     B DA  22  ? ? "O5'" B DA  22  ? ? 89.09  104.00 -14.91 1.90 Y 
66  1 P     B DA  22  ? ? "O5'" B DA  22  ? ? "C5'" B DA  22  ? ? 108.33 120.90 -12.57 1.60 N 
67  1 "O4'" B DA  22  ? ? "C1'" B DA  22  ? ? "C2'" B DA  22  ? ? 100.36 105.90 -5.54  0.80 N 
68  1 "C3'" B DA  22  ? ? "O3'" B DA  22  ? ? P     B DA  23  ? ? 138.80 119.70 19.10  1.20 Y 
69  1 "C1'" B DA  23  ? ? "O4'" B DA  23  ? ? "C4'" B DA  23  ? ? 99.54  110.10 -10.56 1.00 N 
70  1 "C3'" B DA  23  ? ? "C2'" B DA  23  ? ? "C1'" B DA  23  ? ? 93.94  102.40 -8.46  0.80 N 
71  1 C5    B DA  23  ? ? N7    B DA  23  ? ? C8    B DA  23  ? ? 100.53 103.90 -3.37  0.50 N 
72  1 "O4'" B DC  24  ? ? "C4'" B DC  24  ? ? "C3'" B DC  24  ? ? 112.36 106.00 6.36   0.60 N 
73  1 "C4'" B DC  24  ? ? "C3'" B DC  24  ? ? "C2'" B DC  24  ? ? 96.69  102.20 -5.51  0.70 N 
74  1 "C3'" B DC  24  ? ? "C2'" B DC  24  ? ? "C1'" B DC  24  ? ? 112.02 102.50 9.52   1.20 N 
75  1 "O4'" B DC  24  ? ? "C1'" B DC  24  ? ? "C2'" B DC  24  ? ? 99.56  105.90 -6.34  0.80 N 
76  1 "O4'" B DC  24  ? ? "C1'" B DC  24  ? ? N1    B DC  24  ? ? 110.48 108.30 2.18   0.30 N 
77  1 "O3'" B DC  24  ? ? P     B DT  25  ? ? OP1   B DT  25  ? ? 117.40 110.50 6.90   1.10 Y 
78  1 C6    B DT  25  ? ? N1    B DT  25  ? ? C2    B DT  25  ? ? 117.77 121.30 -3.53  0.50 N 
79  1 N1    B DT  25  ? ? C2    B DT  25  ? ? N3    B DT  25  ? ? 120.55 114.60 5.95   0.60 N 
80  1 C4    B DT  25  ? ? C5    B DT  25  ? ? C6    B DT  25  ? ? 123.65 118.00 5.65   0.60 N 
81  1 C5    B DT  25  ? ? C6    B DT  25  ? ? N1    B DT  25  ? ? 120.05 123.70 -3.65  0.60 N 
82  1 N3    B DT  25  ? ? C2    B DT  25  ? ? O2    B DT  25  ? ? 116.88 122.30 -5.42  0.60 N 
83  1 C4    B DT  25  ? ? C5    B DT  25  ? ? C7    B DT  25  ? ? 113.90 119.00 -5.10  0.60 N 
84  1 C6    B DT  25  ? ? N1    B DT  25  ? ? "C1'" B DT  25  ? ? 130.54 120.40 10.14  1.50 N 
85  1 "C3'" B DT  25  ? ? "O3'" B DT  25  ? ? P     B DG  26  ? ? 128.42 119.70 8.72   1.20 Y 
86  1 "O4'" B DG  26  ? ? "C4'" B DG  26  ? ? "C3'" B DG  26  ? ? 115.21 106.00 9.21   0.60 N 
87  1 "C4'" B DG  26  ? ? "C3'" B DG  26  ? ? "C2'" B DG  26  ? ? 94.81  102.20 -7.39  0.70 N 
88  1 "C1'" B DG  27  ? ? "O4'" B DG  27  ? ? "C4'" B DG  27  ? ? 114.67 110.30 4.37   0.70 N 
89  1 "O4'" B DG  27  ? ? "C1'" B DG  27  ? ? "C2'" B DG  27  ? ? 97.64  105.90 -8.26  0.80 N 
90  1 "O4'" B DG  27  ? ? "C1'" B DG  27  ? ? N9    B DG  27  ? ? 112.61 108.30 4.31   0.30 N 
91  1 C5    B DA  28  ? ? C6    B DA  28  ? ? N1    B DA  28  ? ? 120.91 117.70 3.21   0.50 N 
92  1 N1    B DA  28  ? ? C6    B DA  28  ? ? N6    B DA  28  ? ? 114.63 118.60 -3.97  0.60 N 
93  1 P     B DT  29  ? ? "O5'" B DT  29  ? ? "C5'" B DT  29  ? ? 104.22 120.90 -16.68 1.60 N 
94  1 "O4'" B DT  29  ? ? "C4'" B DT  29  ? ? "C3'" B DT  29  ? ? 109.82 106.00 3.82   0.60 N 
95  1 "O4'" B DT  29  ? ? "C1'" B DT  29  ? ? "C2'" B DT  29  ? ? 98.32  105.90 -7.58  0.80 N 
96  1 N3    B DT  29  ? ? C2    B DT  29  ? ? O2    B DT  29  ? ? 116.88 122.30 -5.42  0.60 N 
97  1 C6    B DT  29  ? ? C5    B DT  29  ? ? C7    B DT  29  ? ? 116.69 122.90 -6.21  0.60 N 
98  1 "O4'" B DG  30  ? ? "C4'" B DG  30  ? ? "C3'" B DG  30  ? ? 109.90 106.00 3.90   0.60 N 
99  1 "C4'" B DG  30  ? ? "C3'" B DG  30  ? ? "C2'" B DG  30  ? ? 97.06  102.20 -5.14  0.70 N 
100 1 "O4'" B DG  30  ? ? "C1'" B DG  30  ? ? "C2'" B DG  30  ? ? 100.21 105.90 -5.69  0.80 N 
101 1 "C3'" B DG  30  ? ? "O3'" B DG  30  ? ? P     B DA  31  ? ? 131.75 119.70 12.05  1.20 Y 
102 1 "C4'" B DA  31  ? ? "C3'" B DA  31  ? ? "C2'" B DA  31  ? ? 97.47  102.20 -4.73  0.70 N 
103 1 "O4'" B DA  31  ? ? "C1'" B DA  31  ? ? "C2'" B DA  31  ? ? 99.99  105.90 -5.91  0.80 N 
104 1 C6    B DA  31  ? ? N1    B DA  31  ? ? C2    B DA  31  ? ? 114.26 118.60 -4.34  0.60 N 
105 1 C5    B DA  31  ? ? C6    B DA  31  ? ? N1    B DA  31  ? ? 121.75 117.70 4.05   0.50 N 
106 1 C8    B DA  31  ? ? N9    B DA  31  ? ? C4    B DA  31  ? ? 103.22 105.80 -2.58  0.40 N 
107 1 "C3'" B DA  31  ? ? "O3'" B DA  31  ? ? P     B DG  32  ? ? 132.77 119.70 13.07  1.20 Y 
108 1 "O4'" B DG  32  ? ? "C1'" B DG  32  ? ? "C2'" B DG  32  ? ? 99.61  105.90 -6.29  0.80 N 
109 1 "O3'" B DG  32  ? ? P     B DT  33  ? ? "O5'" B DT  33  ? ? 88.44  104.00 -15.56 1.90 Y 
110 1 "O5'" B DT  33  ? ? P     B DT  33  ? ? OP2   B DT  33  ? ? 118.31 110.70 7.61   1.20 N 
111 1 "O4'" B DT  33  ? ? "C1'" B DT  33  ? ? "C2'" B DT  33  ? ? 99.71  105.90 -6.19  0.80 N 
112 1 "O4'" B DT  33  ? ? "C1'" B DT  33  ? ? N1    B DT  33  ? ? 111.82 108.30 3.52   0.30 N 
113 1 N1    B DT  33  ? ? C2    B DT  33  ? ? N3    B DT  33  ? ? 118.30 114.60 3.70   0.60 N 
114 1 C4    B DT  33  ? ? C5    B DT  33  ? ? C6    B DT  33  ? ? 122.37 118.00 4.37   0.60 N 
115 1 N3    B DT  33  ? ? C2    B DT  33  ? ? O2    B DT  33  ? ? 114.66 122.30 -7.64  0.60 N 
116 1 C6    B DT  33  ? ? C5    B DT  33  ? ? C7    B DT  33  ? ? 118.83 122.90 -4.07  0.60 N 
117 1 "C3'" B DT  33  ? ? "O3'" B DT  33  ? ? P     B DC  34  ? ? 127.18 119.70 7.48   1.20 Y 
118 1 "C4'" B DC  34  ? ? "C3'" B DC  34  ? ? "O3'" B DC  34  ? ? 125.50 112.30 13.20  2.00 N 
119 1 "C3'" B DC  34  ? ? "C2'" B DC  34  ? ? "C1'" B DC  34  ? ? 111.80 102.50 9.30   1.20 N 
120 1 "O4'" B DC  34  ? ? "C1'" B DC  34  ? ? "C2'" B DC  34  ? ? 99.74  105.90 -6.16  0.80 N 
121 1 "O4'" B DC  34  ? ? "C1'" B DC  34  ? ? N1    B DC  34  ? ? 114.48 108.30 6.18   0.30 N 
122 1 "C3'" B DC  34  ? ? "O3'" B DC  34  ? ? P     B DA  35  ? ? 141.52 119.70 21.82  1.20 Y 
123 1 "C4'" B DA  35  ? ? "C3'" B DA  35  ? ? "C2'" B DA  35  ? ? 95.88  102.20 -6.32  0.70 N 
124 1 "C3'" B DA  35  ? ? "C2'" B DA  35  ? ? "C1'" B DA  35  ? ? 109.81 102.50 7.31   1.20 N 
125 1 N1    B DT  36  ? ? C2    B DT  36  ? ? N3    B DT  36  ? ? 118.97 114.60 4.37   0.60 N 
126 1 C4    B DT  36  ? ? C5    B DT  36  ? ? C6    B DT  36  ? ? 122.78 118.00 4.78   0.60 N 
127 1 N3    B DT  36  ? ? C2    B DT  36  ? ? O2    B DT  36  ? ? 118.17 122.30 -4.13  0.60 N 
128 1 C6    B DT  36  ? ? C5    B DT  36  ? ? C7    B DT  36  ? ? 118.45 122.90 -4.45  0.60 N 
129 1 C2    B DA  37  ? ? N3    B DA  37  ? ? C4    B DA  37  ? ? 107.15 110.60 -3.45  0.50 N 
130 1 "O4'" B DG  38  ? ? "C1'" B DG  38  ? ? "C2'" B DG  38  ? ? 94.79  105.90 -11.11 0.80 N 
131 1 "C3'" B DG  38  ? ? "O3'" B DG  38  ? ? P     B DG  39  ? ? 132.16 119.70 12.46  1.20 Y 
132 1 "C5'" B DG  39  ? ? "C4'" B DG  39  ? ? "C3'" B DG  39  ? ? 101.08 114.10 -13.02 1.80 N 
133 1 "C5'" B DG  39  ? ? "C4'" B DG  39  ? ? "O4'" B DG  39  ? ? 122.40 109.80 12.60  1.10 N 
134 1 "O4'" B DG  39  ? ? "C1'" B DG  39  ? ? "C2'" B DG  39  ? ? 110.79 106.80 3.99   0.50 N 
135 1 "O4'" B DG  39  ? ? "C1'" B DG  39  ? ? N9    B DG  39  ? ? 110.55 108.30 2.25   0.30 N 
136 1 "C4'" B DA  40  ? ? "C3'" B DA  40  ? ? "C2'" B DA  40  ? ? 95.32  102.20 -6.88  0.70 N 
137 1 "O4'" B DA  40  ? ? "C1'" B DA  40  ? ? "C2'" B DA  40  ? ? 95.65  105.90 -10.25 0.80 N 
138 1 "O4'" B DA  40  ? ? "C1'" B DA  40  ? ? N9    B DA  40  ? ? 113.24 108.30 4.94   0.30 N 
139 1 NE    C ARG 241 ? ? CZ    C ARG 241 ? ? NH2   C ARG 241 ? ? 114.92 120.30 -5.38  0.50 N 
140 1 NE    C ARG 249 ? ? CZ    C ARG 249 ? ? NH1   C ARG 249 ? ? 123.78 120.30 3.48   0.50 N 
141 1 NE    C ARG 249 ? ? CZ    C ARG 249 ? ? NH2   C ARG 249 ? ? 116.24 120.30 -4.06  0.50 N 
142 1 CG    C MET 250 ? ? SD    C MET 250 ? ? CE    C MET 250 ? ? 112.77 100.20 12.57  1.60 N 
143 1 CA    C LYS 263 ? ? C     C LYS 263 ? ? N     C ASN 264 ? ? 130.73 117.20 13.53  2.20 Y 
144 1 CA    C VAL 278 ? ? C     C VAL 278 ? ? N     C GLY 279 ? ? 133.11 116.20 16.91  2.00 Y 
145 1 O     C VAL 278 ? ? C     C VAL 278 ? ? N     C GLY 279 ? ? 110.69 123.20 -12.51 1.70 Y 
146 1 NE    C ARG 281 ? ? CZ    C ARG 281 ? ? NH1   C ARG 281 ? ? 123.40 120.30 3.10   0.50 N 
147 1 N     D LYS 225 ? ? CA    D LYS 225 ? ? C     D LYS 225 ? ? 127.88 111.00 16.88  2.70 N 
148 1 NE    D ARG 232 ? ? CZ    D ARG 232 ? ? NH1   D ARG 232 ? ? 123.88 120.30 3.58   0.50 N 
149 1 NE    D ARG 234 ? ? CZ    D ARG 234 ? ? NH1   D ARG 234 ? ? 123.58 120.30 3.28   0.50 N 
150 1 NE    D ARG 234 ? ? CZ    D ARG 234 ? ? NH2   D ARG 234 ? ? 114.57 120.30 -5.73  0.50 N 
151 1 NE    D ARG 240 ? ? CZ    D ARG 240 ? ? NH1   D ARG 240 ? ? 123.57 120.30 3.27   0.50 N 
152 1 CB    D ARG 243 ? ? CG    D ARG 243 ? ? CD    D ARG 243 ? ? 128.01 111.60 16.41  2.60 N 
153 1 NE    D ARG 243 ? ? CZ    D ARG 243 ? ? NH1   D ARG 243 ? ? 124.97 120.30 4.67   0.50 N 
154 1 O     D ARG 243 ? ? C     D ARG 243 ? ? N     D ALA 244 ? ? 112.89 122.70 -9.81  1.60 Y 
155 1 NE    D ARG 245 ? ? CZ    D ARG 245 ? ? NH1   D ARG 245 ? ? 124.69 120.30 4.39   0.50 N 
156 1 NE    D ARG 245 ? ? CZ    D ARG 245 ? ? NH2   D ARG 245 ? ? 116.94 120.30 -3.36  0.50 N 
157 1 NE    D ARG 249 ? ? CZ    D ARG 249 ? ? NH1   D ARG 249 ? ? 127.07 120.30 6.77   0.50 N 
158 1 CA    D SER 262 ? ? CB    D SER 262 ? ? OG    D SER 262 ? ? 90.63  111.20 -20.57 2.70 N 
159 1 NE    D ARG 273 ? ? CZ    D ARG 273 ? ? NH2   D ARG 273 ? ? 116.20 120.30 -4.10  0.50 N 
160 1 N     D GLU 280 ? ? CA    D GLU 280 ? ? C     D GLU 280 ? ? 129.51 111.00 18.51  2.70 N 
1 1 VAL C 278 ? ? 177.79  -93.20  
2 1 LYS D 225 ? ? -139.91 -154.80 
3 1 ASP D 226 ? ? -92.16  50.73   
4 1 VAL D 278 ? ? -102.84 -85.44  
#              1 
_pdbx_validate_planes.PDB_model_num   1 
_pdbx_validate_planes.auth_comp_id    DA 
_pdbx_validate_planes.auth_asym_id    B 
_pdbx_validate_planes.auth_seq_id     40 
_pdbx_validate_planes.PDB_ins_code    ? 
_pdbx_validate_planes.label_alt_id    ? 
_pdbx_validate_planes.rmsd            0.058 
_pdbx_validate_planes.type            'SIDE CHAIN' 
1 1 Y 1 C MET 224 ? C MET 1  
2 1 Y 1 D ARG 281 ? D ARG 58 
1YSA 'double helix'        
1YSA 'b-form double helix' 
1 A DT 2  1_555 B DA 20 1_555 -0.418 -0.409 0.303  -7.193  -10.577 -8.166   1  A_DT2:DA40_B  A 2  ? B 40 ? 20 1 
1 A DC 3  1_555 B DG 19 1_555 -0.637 -0.188 -0.492 3.972   -15.752 2.361    2  A_DC3:DG39_B  A 3  ? B 39 ? 19 1 
1 A DC 4  1_555 B DG 18 1_555 0.971  -0.487 0.397  -0.783  -2.397  -6.879   3  A_DC4:DG38_B  A 4  ? B 38 ? 19 1 
1 A DT 5  1_555 B DA 17 1_555 -1.039 -0.402 -0.427 4.143   -9.732  -11.796  4  A_DT5:DA37_B  A 5  ? B 37 ? 20 1 
1 A DA 6  1_555 B DT 16 1_555 0.435  0.302  -0.001 -8.287  -12.372 5.104    5  A_DA6:DT36_B  A 6  ? B 36 ? 20 1 
1 A DT 7  1_555 B DA 15 1_555 -0.373 0.397  -0.001 11.712  -8.318  2.643    6  A_DT7:DA35_B  A 7  ? B 35 ? ?  ? 
1 A DG 8  1_555 B DC 14 1_555 0.277  -0.201 0.994  9.439   -11.012 4.170    7  A_DG8:DC34_B  A 8  ? B 34 ? 19 1 
1 A DA 9  1_555 B DT 13 1_555 0.563  -0.223 0.251  -4.182  -20.288 -4.463   8  A_DA9:DT33_B  A 9  ? B 33 ? 20 1 
1 A DC 10 1_555 B DG 12 1_555 -0.941 -0.151 -0.198 2.208   -11.569 -1.378   9  A_DC10:DG32_B A 10 ? B 32 ? 19 1 
1 A DT 11 1_555 B DA 11 1_555 -1.092 -0.121 0.127  2.110   -6.368  -1.679   10 A_DT11:DA31_B A 11 ? B 31 ? 20 1 
1 A DC 12 1_555 B DG 10 1_555 -0.030 -0.152 -0.020 -14.315 -0.513  2.284    11 A_DC12:DG30_B A 12 ? B 30 ? 19 1 
1 A DA 13 1_555 B DT 9  1_555 0.053  0.226  0.513  -7.243  -4.008  -0.088   12 A_DA13:DT29_B A 13 ? B 29 ? 20 1 
1 A DT 14 1_555 B DA 8  1_555 -0.127 -0.296 0.551  0.471   -4.829  6.077    13 A_DT14:DA28_B A 14 ? B 28 ? 20 1 
1 A DC 15 1_555 B DG 7  1_555 0.224  -0.347 -0.055 5.344   -10.599 -9.106   14 A_DC15:DG27_B A 15 ? B 27 ? 19 1 
1 A DC 16 1_555 B DG 6  1_555 -0.274 0.350  0.248  -16.724 13.360  0.080    15 A_DC16:DG26_B A 16 ? B 26 ? 19 1 
1 A DA 17 1_555 B DT 5  1_555 -0.201 -0.173 -0.097 -3.438  -12.304 -2.689   16 A_DA17:DT25_B A 17 ? B 25 ? 20 1 
1 A DG 18 1_555 B DC 4  1_555 0.034  -0.213 0.043  -7.501  -11.510 -8.342   17 A_DG18:DC24_B A 18 ? B 24 ? 19 1 
1 A DT 19 1_555 B DA 1  1_555 -0.010 -1.135 0.243  -0.150  8.933   -179.323 18 A_DT19:DA21_B A 19 ? B 21 ? 21 2 
1 A DT 2  1_555 B DA 20 1_555 A DC 3  1_555 B DG 19 1_555 0.111  -0.478 3.010 2.892  -5.101 25.448  0.244  0.493  3.040 -11.387 
-6.455  26.104  1  AA_DT2DC3:DG39DA40_BB   A 2  ? B 40 ? A 3  ? B 39 ? 
1 A DC 3  1_555 B DG 19 1_555 A DC 4  1_555 B DG 18 1_555 -0.115 -0.410 3.582 -5.424 5.538  40.830  -1.220 -0.467 3.487 7.852   
7.690   41.529  2  AA_DC3DC4:DG38DG39_BB   A 3  ? B 39 ? A 4  ? B 38 ? 
1 A DC 4  1_555 B DG 18 1_555 A DT 5  1_555 B DA 17 1_555 -0.472 -0.791 2.987 7.236  5.535  23.123  -3.285 2.988  2.475 13.171  
-17.219 24.831  3  AA_DC4DT5:DA37DG38_BB   A 4  ? B 38 ? A 5  ? B 37 ? 
1 A DT 5  1_555 B DA 17 1_555 A DA 6  1_555 B DT 16 1_555 0.638  0.792  3.913 -1.928 5.452  49.640  0.461  -0.924 3.948 6.468   
2.288   49.954  4  AA_DT5DA6:DT36DA37_BB   A 5  ? B 37 ? A 6  ? B 36 ? 
1 A DA 6  1_555 B DT 16 1_555 A DT 7  1_555 B DA 15 1_555 -0.312 -0.744 2.750 -1.354 0.526  24.812  -1.863 0.382  2.747 1.222   
3.149   24.854  5  AA_DA6DT7:DA35DT36_BB   A 6  ? B 36 ? A 7  ? B 35 ? 
1 A DT 7  1_555 B DA 15 1_555 A DG 8  1_555 B DC 14 1_555 -0.122 -0.040 3.137 -8.809 -0.497 42.982  -0.009 -0.643 3.102 -0.669  
11.873  43.836  6  AA_DT7DG8:DC34DA35_BB   A 7  ? B 35 ? A 8  ? B 34 ? 
1 A DG 8  1_555 B DC 14 1_555 A DA 9  1_555 B DT 13 1_555 0.025  -0.630 3.568 7.064  0.445  40.362  -0.954 0.807  3.516 0.639   
-10.143 40.953  7  AA_DG8DA9:DT33DC34_BB   A 8  ? B 34 ? A 9  ? B 33 ? 
1 A DA 9  1_555 B DT 13 1_555 A DC 10 1_555 B DG 12 1_555 -0.134 -1.024 3.064 3.095  -0.009 25.744  -2.280 1.099  3.028 -0.020  
-6.915  25.926  8  AA_DA9DC10:DG32DT33_BB  A 9  ? B 33 ? A 10 ? B 32 ? 
1 A DC 10 1_555 B DG 12 1_555 A DT 11 1_555 B DA 11 1_555 0.441  -0.214 3.165 0.469  3.779  37.606  -0.800 -0.622 3.134 5.844   
-0.725  37.792  9  AA_DC10DT11:DA31DG32_BB A 10 ? B 32 ? A 11 ? B 31 ? 
1 A DT 11 1_555 B DA 11 1_555 A DC 12 1_555 B DG 10 1_555 0.007  0.095  3.819 -0.627 7.720  38.564  -0.934 -0.098 3.768 11.547  
0.938   39.305  10 AA_DT11DC12:DG30DA31_BB A 11 ? B 31 ? A 12 ? B 30 ? 
1 A DC 12 1_555 B DG 10 1_555 A DA 13 1_555 B DT 9  1_555 0.099  0.490  3.290 -6.271 9.142  34.243  -0.543 -1.077 3.244 15.045  
10.321  35.941  11 AA_DC12DA13:DT29DG30_BB A 12 ? B 30 ? A 13 ? B 29 ? 
1 A DA 13 1_555 B DT 9  1_555 A DT 14 1_555 B DA 8  1_555 0.802  -1.029 3.121 -0.308 -4.092 35.460  -1.103 -1.351 3.209 -6.691  
0.503   35.689  12 AA_DA13DT14:DA28DT29_BB A 13 ? B 29 ? A 14 ? B 28 ? 
1 A DT 14 1_555 B DA 8  1_555 A DC 15 1_555 B DG 7  1_555 -0.355 -0.543 3.092 3.687  -3.307 31.550  -0.419 1.279  3.072 -6.035  
-6.729  31.927  13 AA_DT14DC15:DG27DA28_BB A 14 ? B 28 ? A 15 ? B 27 ? 
1 A DC 15 1_555 B DG 7  1_555 A DC 16 1_555 B DG 6  1_555 0.724  -0.591 3.954 -0.777 2.243  37.694  -1.260 -1.239 3.899 3.467   
1.201   37.766  14 AA_DC15DC16:DG26DG27_BB A 15 ? B 27 ? A 16 ? B 26 ? 
1 A DC 16 1_555 B DG 6  1_555 A DA 17 1_555 B DT 5  1_555 -0.779 0.119  3.160 1.534  1.812  31.766  -0.101 1.688  3.122 3.304   
-2.797  31.852  15 AA_DC16DA17:DT25DG26_BB A 16 ? B 26 ? A 17 ? B 25 ? 
1 A DA 17 1_555 B DT 5  1_555 A DG 18 1_555 B DC 4  1_555 -0.687 -0.050 3.439 -6.525 6.895  36.821  -1.018 0.166  3.442 10.700  
10.125  37.984  16 AA_DA17DG18:DC24DT25_BB A 17 ? B 25 ? A 18 ? B 24 ? 
1 A DG 18 1_555 B DC 4  1_555 A DT 19 1_555 B DA 1  1_555 -0.099 -0.666 3.315 -3.349 -3.129 120.709 -0.354 0.025  3.326 -1.800  
1.927   120.762 17 AA_DG18DT19:DA21DC24_BB A 18 ? B 24 ? A 19 ? B 21 ? 
_pdbx_entity_nonpoly.entity_id   4        water 
_pdbx_entity_nonpoly.comp_id     HOH 