#   2A07 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.281 
PDB   2A07         
NDB   PD0689       
RCSB  RCSB033328   
WWPDB D_1000033328 
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.entry_id                        2A07 
_pdbx_database_status.recvd_initial_deposition_date   2005-06-16 
_pdbx_database_status.deposit_site                    RCSB 
_pdbx_database_status.process_site                    RCSB 
_pdbx_database_status.status_code_sf                  REL 
_pdbx_database_status.status_code_mr                  ? 
_pdbx_database_status.SG_entry                        ? 
_pdbx_database_status.pdb_format_compatible           Y 
_pdbx_database_status.status_code_cs                  ? 
'Stroud, J.C.' 1 
'Wu, Y.'       2 
'Bates, D.L.'  3 
'Han, A.'      4 
'Nowick, K.'   5 
'Paabo, S.'    6 
'Tong, H.'     7 
'Chen, L.'     8 
#                        primary 
_citation.title                     'Structure of the Forkhead Domain of FOXP2 Bound to DNA.' 
_citation.journal_abbrev            Structure 
_citation.journal_volume            14 
_citation.page_first                159 
_citation.page_last                 166 
_citation.year                      2006 
_citation.journal_id_ASTM           STRUE6                   UK 
_citation.journal_id_ISSN           0969-2126 
_citation.journal_id_CSD            2005 
_citation.book_publisher            ? 
_citation.pdbx_database_id_PubMed   16407075 
_citation.pdbx_database_id_DOI      10.1016/j.str.2005.10.005 
primary 'Stroud, J.C.' 1 
primary 'Wu, Y.'       2 
primary 'Bates, D.L.'  3 
primary 'Han, A.'      4 
primary 'Nowick, K.'   5 
primary 'Paabo, S.'    6 
primary 'Tong, H.'     7 
primary 'Chen, L.'     8 
_cell.entry_id           2A07 
_cell.length_a           67.542 
_cell.length_b           124.210 
_cell.length_c           67.666 
_cell.angle_alpha        90.00 
_cell.angle_beta         110.81 
_cell.angle_gamma        90.00 
_cell.Z_PDB              12 
_cell.pdbx_unique_axis   ? 
_symmetry.entry_id                         2A07 
_symmetry.space_group_name_H-M             'P 1 21 1' 
_symmetry.pdbx_full_space_group_name_H-M   ? 
_symmetry.cell_setting                     ? 
_symmetry.Int_Tables_number                4 
_symmetry.space_group_name_Hall            ? 
1 polymer     syn "5'-D(*AP*AP*CP*TP*AP*TP*GP*AP*AP*AP*CP*AP*AP*AP*TP*TP*TP*TP*CP*CP*T)-3'" 6389.186  2   ? ?     ? 
'Promoter Element of a Foxp regulated gene, plus strand'  
2 polymer     syn "5'-D(*TP*TP*AP*GP*GP*AP*AP*AP*AP*TP*TP*TP*GP*TP*TP*TP*CP*AP*TP*AP*G)-3'" 6491.230  2   ? ?     ? 
'Promoter Element of a Foxp regulated gene, minus strand' 
3 polymer     man 'Forkhead box protein P2'                                                 11025.630 6   ? D502I 
'Foxp2 Forkhead Domain' ?                                                         
4 non-polymer syn 'MAGNESIUM ION'                                                           24.305    6   ? ?     ? ? 
5 water       nat water                                                                     18.015    581 ? ?     ? ? 
_entity_name_com.entity_id   3        'CAG repeat protein 44, Trinucleotide repeat-containing gene 10 protein' 
1 polydeoxyribonucleotide no no 
AACTATGAAACAAATTTTCCT                                                                            A,C         ? 
2 polydeoxyribonucleotide no no 
TTAGGAAAATTTGTTTCATAG                                                                            B,D         ? 
3 'polypeptide(L)'        no no 
F,G,H,I,J,K ? 
1 1  DA  n 
1 2  DA  n 
1 3  DC  n 
1 4  DT  n 
1 5  DA  n 
1 6  DT  n 
1 7  DG  n 
1 8  DA  n 
1 9  DA  n 
1 10 DA  n 
1 11 DC  n 
1 12 DA  n 
1 13 DA  n 
1 14 DA  n 
1 15 DT  n 
1 16 DT  n 
1 17 DT  n 
1 18 DT  n 
1 19 DC  n 
1 20 DC  n 
1 21 DT  n 
2 1  DT  n 
2 2  DT  n 
2 3  DA  n 
2 4  DG  n 
2 5  DG  n 
2 6  DA  n 
2 7  DA  n 
2 8  DA  n 
2 9  DA  n 
2 10 DT  n 
2 11 DT  n 
2 12 DT  n 
2 13 DG  n 
2 14 DT  n 
2 15 DT  n 
2 16 DT  n 
2 17 DC  n 
2 18 DA  n 
2 19 DT  n 
2 20 DA  n 
2 21 DG  n 
3 1  ILE n 
3 2  VAL n 
3 3  ARG n 
3 4  PRO n 
3 5  PRO n 
3 6  PHE n 
3 7  THR n 
3 8  TYR n 
3 9  ALA n 
3 10 THR n 
3 11 LEU n 
3 12 ILE n 
3 13 ARG n 
3 14 GLN n 
3 15 ALA n 
3 16 ILE n 
3 17 MET n 
3 18 GLU n 
3 19 SER n 
3 20 SER n 
3 21 ASP n 
3 22 ARG n 
3 23 GLN n 
3 24 LEU n 
3 25 THR n 
3 26 LEU n 
3 27 ASN n 
3 28 GLU n 
3 29 ILE n 
3 30 TYR n 
3 31 SER n 
3 32 TRP n 
3 33 PHE n 
3 34 THR n 
3 35 ARG n 
3 36 THR n 
3 37 PHE n 
3 38 ALA n 
3 39 TYR n 
3 40 PHE n 
3 41 ARG n 
3 42 ARG n 
3 43 ASN n 
3 44 ALA n 
3 45 ALA n 
3 46 THR n 
3 47 TRP n 
3 48 LYS n 
3 49 ASN n 
3 50 ALA n 
3 51 VAL n 
3 52 ARG n 
3 53 HIS n 
3 54 ASN n 
3 55 LEU n 
3 56 SER n 
3 57 LEU n 
3 58 HIS n 
3 59 LYS n 
3 60 CYS n 
3 61 PHE n 
3 62 VAL n 
3 63 ARG n 
3 64 VAL n 
3 65 GLU n 
3 66 ASN n 
3 67 VAL n 
3 68 LYS n 
3 69 GLY n 
3 70 ALA n 
3 71 VAL n 
3 72 TRP n 
3 73 THR n 
3 74 VAL n 
3 75 ASP n 
3 76 GLU n 
3 77 VAL n 
3 78 GLU n 
3 79 TYR n 
3 80 GLN n 
3 81 LYS n 
3 82 ARG n 
3 83 ARG n 
3 84 SER n 
3 85 GLN n 
3 86 LYS n 
3 87 ILE n 
3 88 THR n 
3 89 GLY n 
3 90 SER n 
3 91 PRO n 
3 92 THR n 
3 93 LEU n 
_entity_src_gen.entity_id                          3 
_entity_src_gen.pdbx_src_id                        1 
_entity_src_gen.pdbx_alt_source_flag               sample 
_entity_src_gen.pdbx_seq_type                      ? 
_entity_src_gen.pdbx_beg_seq_num                   ? 
_entity_src_gen.pdbx_end_seq_num                   ? 
_entity_src_gen.gene_src_common_name               human 
_entity_src_gen.gene_src_genus                     Homo 
_entity_src_gen.pdbx_gene_src_gene                 'FOXP2, CAGH44, TNRC10' 
_entity_src_gen.gene_src_species                   ? 
_entity_src_gen.gene_src_strain                    ? 
_entity_src_gen.gene_src_tissue                    ? 
_entity_src_gen.gene_src_tissue_fraction           ? 
_entity_src_gen.gene_src_details                   ? 
_entity_src_gen.pdbx_gene_src_fragment             ? 
_entity_src_gen.pdbx_gene_src_scientific_name      'Homo sapiens' 
_entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id     9606 
_entity_src_gen.pdbx_gene_src_variant              ? 
_entity_src_gen.pdbx_gene_src_cell_line            ? 
_entity_src_gen.pdbx_gene_src_atcc                 ? 
_entity_src_gen.pdbx_gene_src_organ                ? 
_entity_src_gen.pdbx_gene_src_organelle            ? 
_entity_src_gen.pdbx_gene_src_cell                 ? 
_entity_src_gen.pdbx_gene_src_cellular_location    ? 
_entity_src_gen.host_org_common_name               ? 
_entity_src_gen.pdbx_host_org_scientific_name      'Escherichia coli' 
_entity_src_gen.pdbx_host_org_ncbi_taxonomy_id     562 
_entity_src_gen.host_org_genus                     Escherichia 
_entity_src_gen.pdbx_host_org_gene                 ? 
_entity_src_gen.pdbx_host_org_organ                ? 
_entity_src_gen.host_org_species                   ? 
_entity_src_gen.pdbx_host_org_tissue               ? 
_entity_src_gen.pdbx_host_org_tissue_fraction      ? 
_entity_src_gen.pdbx_host_org_strain               ? 
_entity_src_gen.pdbx_host_org_variant              ? 
_entity_src_gen.pdbx_host_org_cell_line            ? 
_entity_src_gen.pdbx_host_org_atcc                 ? 
_entity_src_gen.pdbx_host_org_culture_collection   ? 
_entity_src_gen.pdbx_host_org_cell                 ? 
_entity_src_gen.pdbx_host_org_organelle            ? 
_entity_src_gen.pdbx_host_org_cellular_location    ? 
_entity_src_gen.pdbx_host_org_vector_type          ? 
_entity_src_gen.pdbx_host_org_vector               ? 
_entity_src_gen.host_org_details                   ? 
_entity_src_gen.expression_system_id               ? 
_entity_src_gen.plasmid_name                       ? 
_entity_src_gen.plasmid_details                    ? 
_entity_src_gen.pdbx_description                   ? 
1 1 sample ? ? ? ? ? 'DNA is Synthesized by Solid Phase Method' 
2 1 sample ? ? ? ? ? 'DNA is Synthesized by Solid Phase Method' 
1 UNP FOXP2_HUMAN O15409 3 
502 ? 
2 PDB 2A07        2A07   1 ?                                                                                                ?   ? 
3 PDB 2A07        2A07   2 ?                                                                                                ?   ? 
1  1 2A07 F 1 ? 93 ? O15409 502 ? 594 ? 502 594 
2  1 2A07 G 1 ? 93 ? O15409 502 ? 594 ? 502 594 
3  1 2A07 H 1 ? 93 ? O15409 502 ? 594 ? 502 594 
4  1 2A07 I 1 ? 93 ? O15409 502 ? 594 ? 502 594 
5  1 2A07 J 1 ? 93 ? O15409 502 ? 594 ? 502 594 
6  1 2A07 K 1 ? 93 ? O15409 502 ? 594 ? 502 594 
7  2 2A07 A 1 ? 21 ? 2A07   1   ? 21  ? 1   21  
8  3 2A07 B 1 ? 21 ? 2A07   1   ? 21  ? 1   21  
9  2 2A07 C 1 ? 21 ? 2A07   1   ? 21  ? 1   21  
10 3 2A07 D 1 ? 21 ? 2A07   1   ? 21  ? 1   21  
1 2A07 ILE F 1 ? UNP O15409 ASP 502 ENGINEERED 502 1 
2 2A07 ILE G 1 ? UNP O15409 ASP 502 ENGINEERED 502 2 
3 2A07 ILE H 1 ? UNP O15409 ASP 502 ENGINEERED 502 3 
4 2A07 ILE I 1 ? UNP O15409 ASP 502 ENGINEERED 502 4 
5 2A07 ILE J 1 ? UNP O15409 ASP 502 ENGINEERED 502 5 
6 2A07 ILE K 1 ? UNP O15409 ASP 502 ENGINEERED 502 6 
ALA 'L-peptide linking' y ALANINE                              ? 'C3 H7 N O2'      89.093  
ARG 'L-peptide linking' y ARGININE                             ? 'C6 H15 N4 O2 1'  175.209 
ASN 'L-peptide linking' y ASPARAGINE                           ? 'C4 H8 N2 O3'     132.118 
ASP 'L-peptide linking' y 'ASPARTIC ACID'                      ? 'C4 H7 N O4'      133.103 
CYS 'L-peptide linking' y CYSTEINE                             ? 'C3 H7 N O2 S'    121.158 
DA  'DNA linking'       y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 
DC  'DNA linking'       y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE"  ? 'C9 H14 N3 O7 P'  307.197 
DG  'DNA linking'       y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 
DT  'DNA linking'       y "THYMIDINE-5'-MONOPHOSPHATE"         ? 'C10 H15 N2 O8 P' 322.208 
GLN 'L-peptide linking' y GLUTAMINE                            ? 'C5 H10 N2 O3'    146.144 
GLU 'L-peptide linking' y 'GLUTAMIC ACID'                      ? 'C5 H9 N O4'      147.129 
GLY 'peptide linking'   y GLYCINE                              ? 'C2 H5 N O2'      75.067  
HIS 'L-peptide linking' y HISTIDINE                            ? 'C6 H10 N3 O2 1'  156.162 
HOH non-polymer         . WATER                                ? 'H2 O'            18.015  
ILE 'L-peptide linking' y ISOLEUCINE                           ? 'C6 H13 N O2'     131.173 
LEU 'L-peptide linking' y LEUCINE                              ? 'C6 H13 N O2'     131.173 
LYS 'L-peptide linking' y LYSINE                               ? 'C6 H15 N2 O2 1'  147.195 
MET 'L-peptide linking' y METHIONINE                           ? 'C5 H11 N O2 S'   149.211 
MG  non-polymer         . 'MAGNESIUM ION'                      ? 'Mg 2'            24.305  
PHE 'L-peptide linking' y PHENYLALANINE                        ? 'C9 H11 N O2'     165.189 
PRO 'L-peptide linking' y PROLINE                              ? 'C5 H9 N O2'      115.130 
SER 'L-peptide linking' y SERINE                               ? 'C3 H7 N O3'      105.093 
THR 'L-peptide linking' y THREONINE                            ? 'C4 H9 N O3'      119.119 
TRP 'L-peptide linking' y TRYPTOPHAN                           ? 'C11 H12 N2 O2'   204.225 
TYR 'L-peptide linking' y TYROSINE                             ? 'C9 H11 N O3'     181.189 
VAL 'L-peptide linking' y VALINE                               ? 'C5 H11 N O2'     117.146 
_exptl.entry_id          2A07 
_exptl.method            'X-RAY DIFFRACTION' 
_exptl.crystals_number   1 
#                    1 
_exptl_crystal.density_meas          ? 
_exptl_crystal.density_Matthews      2.99 
_exptl_crystal.density_percent_sol   62.24 
_exptl_crystal.description           ? 
_exptl_crystal.F_000                 ? 
_exptl_crystal.preparation           ? 
_exptl_crystal_grow.crystal_id      1 
_exptl_crystal_grow.method          'VAPOR DIFFUSION, HANGING DROP' 
_exptl_crystal_grow.temp            291 
_exptl_crystal_grow.temp_details    ? 
_exptl_crystal_grow.pH              6.68 
'BTP, Sodium Chloride, PEG 3k, Magnesium Chloride, Sodium Azide, pH 6.68, VAPOR DIFFUSION, HANGING DROP, temperature 291K' 
_exptl_crystal_grow.pdbx_pH_range   . 
1 1  1 BTP                  ? ? ? 
1 2  1 'Sodium Chloride'    ? ? ? 
1 3  1 'PEG 3k'             ? ? ? 
1 4  1 'Magnesium Chloride' ? ? ? 
1 5  1 'Sodium Azide'       ? ? ? 
1 6  1 H2O                  ? ? ? 
1 7  2 'Sodium Chloride'    ? ? ? 
1 8  2 'PEG 3k'             ? ? ? 
1 9  2 'Magnesium Chloride' ? ? ? 
1 10 2 H2O                  ? ? ? 
#                     1 
_diffrn.ambient_temp           298 
_diffrn.ambient_temp_details   ? 
_diffrn.crystal_id             1 
_diffrn_detector.diffrn_id              1 
_diffrn_detector.detector               CCD 
_diffrn_detector.type                   'ADSC QUANTUM 210' 
_diffrn_detector.pdbx_collection_date   2004-06-04 
_diffrn_detector.details                ? 
_diffrn_radiation.diffrn_id                        1 
_diffrn_radiation.wavelength_id                    1 
_diffrn_radiation.pdbx_monochromatic_or_laue_m_l   M 
_diffrn_radiation.monochromator                    ? 
_diffrn_radiation.pdbx_diffrn_protocol             'SINGLE WAVELENGTH' 
_diffrn_radiation.pdbx_scattering_type             x-ray 
#           1 
_diffrn_radiation_wavelength.wavelength   1.07810 
_diffrn_radiation_wavelength.wt           1.0 
_diffrn_source.diffrn_id                   1 
_diffrn_source.source                      SYNCHROTRON 
_diffrn_source.type                        'ALS BEAMLINE 8.2.1' 
_diffrn_source.pdbx_synchrotron_site       ALS 
_diffrn_source.pdbx_synchrotron_beamline   8.2.1 
_diffrn_source.pdbx_wavelength             ? 
_diffrn_source.pdbx_wavelength_list        1.07810 
_reflns.entry_id                     2A07 
_reflns.observed_criterion_sigma_F   2.0 
_reflns.observed_criterion_sigma_I   0.0 
_reflns.d_resolution_high            1.9 
_reflns.d_resolution_low             40 
_reflns.number_all                   81978 
_reflns.number_obs                   79203 
_reflns.percent_possible_obs         96.4 
_reflns.pdbx_Rmerge_I_obs            0.055 
_reflns.pdbx_Rsym_value              ? 
_reflns.pdbx_netI_over_sigmaI        28.46 
_reflns.B_iso_Wilson_estimate        ? 
_reflns.pdbx_redundancy              4 
_reflns.R_free_details               ? 
_reflns.pdbx_chi_squared             ? 
_reflns.pdbx_scaling_rejects         ? 
_reflns.pdbx_diffrn_id               1 
_reflns.pdbx_ordinal                 1 
_reflns_shell.d_res_high             1.90 
_reflns_shell.d_res_low              1.97 
_reflns_shell.percent_possible_all   8.4 
_reflns_shell.Rmerge_I_obs           ? 
_reflns_shell.pdbx_Rsym_value        ? 
_reflns_shell.meanI_over_sigI_obs    ? 
_reflns_shell.pdbx_redundancy        ? 
_reflns_shell.percent_possible_obs   ? 
_reflns_shell.number_unique_all      ? 
_reflns_shell.number_measured_all    ? 
_reflns_shell.number_measured_obs    ? 
_reflns_shell.number_unique_obs      ? 
_reflns_shell.pdbx_chi_squared       ? 
_reflns_shell.pdbx_diffrn_id         ? 
_reflns_shell.pdbx_ordinal           1 
_refine.entry_id                                 2A07 
_refine.ls_d_res_high                            1.9 
_refine.ls_d_res_low                             40 
_refine.pdbx_ls_sigma_F                          2 
_refine.pdbx_ls_sigma_I                          ? 
_refine.ls_number_reflns_all                     81978 
_refine.ls_number_reflns_obs                     73908 
_refine.ls_number_reflns_R_free                  7443 
_refine.ls_percent_reflns_obs                    ? 
_refine.ls_R_factor_all                          0.2311 
_refine.ls_R_factor_obs                          0.2224 
_refine.ls_R_factor_R_work                       0.2224 
_refine.ls_R_factor_R_free                       0.2436 
_refine.ls_redundancy_reflns_obs                 ? 
_refine.pdbx_data_cutoff_high_absF               ? 
_refine.pdbx_data_cutoff_low_absF                ? 
_refine.ls_number_parameters                     ? 
_refine.ls_number_restraints                     ? 
_refine.ls_percent_reflns_R_free                 ? 
_refine.ls_R_factor_R_free_error                 ? 
_refine.ls_R_factor_R_free_error_details         ? 
_refine.pdbx_method_to_determine_struct          'MOLECULAR REPLACEMENT' 
_refine.pdbx_starting_model                      ? 
_refine.pdbx_ls_cross_valid_method               ? 
_refine.pdbx_R_Free_selection_details            Random 
_refine.pdbx_stereochem_target_val_spec_case     ? 
_refine.pdbx_stereochemistry_target_values       'Engh & Huber' 
_refine.solvent_model_details                    ? 
_refine.solvent_model_param_bsol                 ? 
_refine.solvent_model_param_ksol                 ? 
_refine.occupancy_max                            ? 
_refine.occupancy_min                            ? 
_refine.pdbx_isotropic_thermal_model             ? 
_refine.B_iso_mean                               ? 
_refine.aniso_B[1][1]                            ? 
_refine.aniso_B[1][2]                            ? 
_refine.aniso_B[1][3]                            ? 
_refine.aniso_B[2][2]                            ? 
_refine.aniso_B[2][3]                            ? 
_refine.aniso_B[3][3]                            ? 
_refine.details                                  ? 
_refine.correlation_coeff_Fo_to_Fc               ? 
_refine.correlation_coeff_Fo_to_Fc_free          ? 
_refine.pdbx_solvent_vdw_probe_radii             ? 
_refine.pdbx_solvent_ion_probe_radii             ? 
_refine.pdbx_solvent_shrinkage_radii             ? 
_refine.overall_SU_R_Cruickshank_DPI             ? 
_refine.overall_SU_R_free                        ? 
_refine.overall_SU_ML                            ? 
_refine.overall_SU_B                             ? 
_refine.pdbx_overall_ESU_R_Free                  ? 
_refine.pdbx_data_cutoff_high_rms_absF           ? 
_refine.pdbx_overall_ESU_R                       ? 
_refine.ls_wR_factor_R_free                      ? 
_refine.ls_wR_factor_R_work                      ? 
_refine.overall_FOM_free_R_set                   ? 
_refine.overall_FOM_work_R_set                   ? 
_refine.pdbx_refine_id                           'X-RAY DIFFRACTION' 
_refine.pdbx_diffrn_id                           1 
_refine.pdbx_TLS_residual_ADP_flag               ? 
_refine.pdbx_overall_phase_error                 ? 
_refine.pdbx_overall_SU_R_free_Cruickshank_DPI   ? 
_refine.pdbx_overall_SU_R_Blow_DPI               ? 
_refine.pdbx_overall_SU_R_free_Blow_DPI          ? 
_refine_hist.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_refine_hist.cycle_id                         LAST 
_refine_hist.pdbx_number_atoms_protein        4149 
_refine_hist.pdbx_number_atoms_nucleic_acid   1710 
_refine_hist.pdbx_number_atoms_ligand         6 
_refine_hist.number_atoms_solvent             581 
_refine_hist.number_atoms_total               6446 
_refine_hist.d_res_high                       1.9 
_refine_hist.d_res_low                        40 
c_bond_d           0.005852 ? ? ? 'X-RAY DIFFRACTION' ? 
c_angle_deg        1.06712  ? ? ? 'X-RAY DIFFRACTION' ? 
c_dihedral_angle_d 18.99112 ? ? ? 'X-RAY DIFFRACTION' ? 
c_improper_angle_d 0.95273  ? ? ? 'X-RAY DIFFRACTION' ? 
_struct.entry_id                  2A07 
_struct.title                     'Crystal Structure of Foxp2 bound Specifically to DNA.' 
_struct.pdbx_descriptor           'Forkhead box protein P2/DNA Complex' 
_struct.pdbx_model_details        ? 
_struct.pdbx_CASP_flag            ? 
_struct.pdbx_model_type_details   ? 
_struct_keywords.entry_id        2A07 
_struct_keywords.pdbx_keywords   Transcription/DNA 
'Forkhead, Double-Helix, Swapping, Homodimer, Monomer, Winged-Helix, Magnesium, Transcription-DNA COMPLEX' 
A N N 1 ? 
B N N 2 ? 
C N N 1 ? 
D N N 2 ? 
E N N 3 ? 
F N N 3 ? 
G N N 3 ? 
H N N 3 ? 
I N N 3 ? 
J N N 3 ? 
K N N 4 ? 
L N N 4 ? 
M N N 4 ? 
N N N 4 ? 
O N N 4 ? 
P N N 4 ? 
Q N N 5 ? 
R N N 5 ? 
S N N 5 ? 
T N N 5 ? 
U N N 5 ? 
V N N 5 ? 
W N N 5 ? 
X N N 5 ? 
Y N N 5 ? 
Z N N 5 ? 
#                    1 
_struct_biol.pdbx_parent_biol_id   ? 
_struct_biol.details               ? 
HELX_P HELX_P1  1  THR E 7  ? SER E 19 ? THR F 508 SER F 520 1 ? 13 
HELX_P HELX_P2  2  THR E 25 ? ARG E 41 ? THR F 526 ARG F 542 1 ? 17 
HELX_P HELX_P3  3  ASN E 43 ? HIS E 58 ? ASN F 544 HIS F 559 1 ? 16 
HELX_P HELX_P4  4  ASP E 75 ? ARG E 83 ? ASP F 576 ARG F 584 1 ? 9  
HELX_P HELX_P5  5  THR F 7  ? SER F 19 ? THR G 508 SER G 520 1 ? 13 
HELX_P HELX_P6  6  SER F 20 ? GLN F 23 ? SER G 521 GLN G 524 5 ? 4  
HELX_P HELX_P7  7  THR F 25 ? ASN F 43 ? THR G 526 ASN G 544 1 ? 19 
HELX_P HELX_P8  8  THR F 46 ? HIS F 58 ? THR G 547 HIS G 559 1 ? 13 
HELX_P HELX_P9  9  ASP F 75 ? ARG F 83 ? ASP G 576 ARG G 584 1 ? 9  
HELX_P HELX_P10 10 THR G 7  ? GLU G 18 ? THR H 508 GLU H 519 1 ? 12 
HELX_P HELX_P11 11 THR G 25 ? ASN G 43 ? THR H 526 ASN H 544 1 ? 19 
HELX_P HELX_P12 12 THR G 46 ? HIS G 58 ? THR H 547 HIS H 559 1 ? 13 
HELX_P HELX_P13 13 ASP G 75 ? GLN G 80 ? ASP H 576 GLN H 581 1 ? 6  
HELX_P HELX_P14 14 THR H 7  ? GLU H 18 ? THR I 508 GLU I 519 1 ? 12 
HELX_P HELX_P15 15 THR H 25 ? ARG H 41 ? THR I 526 ARG I 542 1 ? 17 
HELX_P HELX_P16 16 ASN H 43 ? HIS H 58 ? ASN I 544 HIS I 559 1 ? 16 
HELX_P HELX_P17 17 ASP H 75 ? LYS H 81 ? ASP I 576 LYS I 582 1 ? 7  
HELX_P HELX_P18 18 THR I 7  ? SER I 19 ? THR J 508 SER J 520 1 ? 13 
HELX_P HELX_P19 19 THR I 25 ? PHE I 37 ? THR J 526 PHE J 538 1 ? 13 
HELX_P HELX_P20 20 ALA I 38 ? ARG I 42 ? ALA J 539 ARG J 543 5 ? 5  
HELX_P HELX_P21 21 ASN I 43 ? HIS I 58 ? ASN J 544 HIS J 559 1 ? 16 
HELX_P HELX_P22 22 ASP I 75 ? LYS I 81 ? ASP J 576 LYS J 582 1 ? 7  
HELX_P HELX_P23 23 THR J 7  ? SER J 19 ? THR K 508 SER K 520 1 ? 13 
HELX_P HELX_P24 24 THR J 25 ? PHE J 37 ? THR K 526 PHE K 538 1 ? 13 
HELX_P HELX_P25 25 ALA J 38 ? ARG J 42 ? ALA K 539 ARG K 543 5 ? 5  
HELX_P HELX_P26 26 ASN J 43 ? HIS J 58 ? ASN K 544 HIS K 559 1 ? 16 
HELX_P HELX_P27 27 ASP J 75 ? LYS J 81 ? ASP K 576 LYS K 582 1 ? 7  
#          HELX_P 
_struct_conf_type.criteria    ? 
_struct_conf_type.reference   ? 
metalc1  metalc ? ? K MG .  MG ? ? ? 1_555 E SER 56 O  ? ? F MG 601 F SER 557 1_555 ? ? ? ? ? ? ?            2.582 ? 
metalc2  metalc ? ? K MG .  MG ? ? ? 1_555 E LEU 57 O  ? ? F MG 601 F LEU 558 1_555 ? ? ? ? ? ? ?            3.012 ? 
metalc3  metalc ? ? K MG .  MG ? ? ? 1_555 U HOH .  O  ? ? F MG 601 F HOH 613 1_555 ? ? ? ? ? ? ?            2.800 ? 
metalc4  metalc ? ? L MG .  MG ? ? ? 1_555 F PHE 61 O  ? ? G MG 604 G PHE 562 1_555 ? ? ? ? ? ? ?            2.439 ? 
metalc5  metalc ? ? L MG .  MG ? ? ? 1_555 F LEU 55 O  ? ? G MG 604 G LEU 556 1_555 ? ? ? ? ? ? ?            2.425 ? 
metalc6  metalc ? ? L MG .  MG ? ? ? 1_555 F HIS 58 O  ? ? G MG 604 G HIS 559 1_555 ? ? ? ? ? ? ?            2.446 ? 
metalc7  metalc ? ? M MG .  MG ? ? ? 1_555 W HOH .  O  ? ? H MG 602 H HOH 397 1_555 ? ? ? ? ? ? ?            2.662 ? 
metalc8  metalc ? ? M MG .  MG ? ? ? 1_555 G LEU 55 O  ? ? H MG 602 H LEU 556 1_555 ? ? ? ? ? ? ?            2.560 ? 
metalc9  metalc ? ? M MG .  MG ? ? ? 1_555 G HIS 58 O  ? ? H MG 602 H HIS 559 1_555 ? ? ? ? ? ? ?            2.482 ? 
metalc10 metalc ? ? M MG .  MG ? ? ? 1_555 G PHE 61 O  ? ? H MG 602 H PHE 562 1_555 ? ? ? ? ? ? ?            2.552 ? 
metalc11 metalc ? ? N MG .  MG ? ? ? 1_555 H HIS 58 O  ? ? I MG 603 I HIS 559 1_555 ? ? ? ? ? ? ?            3.145 ? 
metalc12 metalc ? ? N MG .  MG ? ? ? 1_555 H SER 56 O  ? ? I MG 603 I SER 557 1_555 ? ? ? ? ? ? ?            3.128 ? 
metalc13 metalc ? ? O MG .  MG ? ? ? 1_555 I PHE 61 O  ? ? J MG 605 J PHE 562 1_555 ? ? ? ? ? ? ?            2.405 ? 
metalc14 metalc ? ? O MG .  MG ? ? ? 1_555 Y HOH .  O  ? ? J MG 605 J HOH 673 1_555 ? ? ? ? ? ? ?            2.588 ? 
metalc15 metalc ? ? O MG .  MG ? ? ? 1_555 I HIS 58 O  ? ? J MG 605 J HIS 559 1_555 ? ? ? ? ? ? ?            2.439 ? 
metalc16 metalc ? ? O MG .  MG ? ? ? 1_555 I LEU 55 O  ? ? J MG 605 J LEU 556 1_555 ? ? ? ? ? ? ?            2.264 ? 
metalc17 metalc ? ? P MG .  MG ? ? ? 1_555 J SER 56 O  ? ? K MG 606 K SER 557 1_555 ? ? ? ? ? ? ?            3.050 ? 
metalc18 metalc ? ? P MG .  MG ? ? ? 1_555 J HIS 58 O  ? ? K MG 606 K HIS 559 1_555 ? ? ? ? ? ? ?            2.454 ? 
metalc19 metalc ? ? P MG .  MG ? ? ? 1_555 J PHE 61 O  ? ? K MG 606 K PHE 562 1_555 ? ? ? ? ? ? ?            2.448 ? 
metalc20 metalc ? ? P MG .  MG ? ? ? 1_555 T HOH .  O  ? ? K MG 606 D HOH 24  1_555 ? ? ? ? ? ? ?            2.741 ? 
metalc21 metalc ? ? P MG .  MG ? ? ? 1_555 Z HOH .  O  ? ? K MG 606 K HOH 645 1_555 ? ? ? ? ? ? ?            2.582 ? 
metalc22 metalc ? ? P MG .  MG ? ? ? 1_555 J LEU 55 O  ? ? K MG 606 K LEU 556 1_555 ? ? ? ? ? ? ?            2.286 ? 
hydrog1  hydrog ? ? A DC 3  N3 ? ? ? 1_555 B DG  21 N1 ? ? A DC 3   B DG  21  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog2  hydrog ? ? A DC 3  N4 ? ? ? 1_555 B DG  21 O6 ? ? A DC 3   B DG  21  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog3  hydrog ? ? A DC 3  O2 ? ? ? 1_555 B DG  21 N2 ? ? A DC 3   B DG  21  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog4  hydrog ? ? A DT 4  N3 ? ? ? 1_555 B DA  20 N1 ? ? A DT 4   B DA  20  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog5  hydrog ? ? A DT 4  O4 ? ? ? 1_555 B DA  20 N6 ? ? A DT 4   B DA  20  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog6  hydrog ? ? A DA 5  N1 ? ? ? 1_555 B DT  19 N3 ? ? A DA 5   B DT  19  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog7  hydrog ? ? A DA 5  N6 ? ? ? 1_555 B DT  19 O4 ? ? A DA 5   B DT  19  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog8  hydrog ? ? A DT 6  N3 ? ? ? 1_555 B DA  18 N1 ? ? A DT 6   B DA  18  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog9  hydrog ? ? A DT 6  O4 ? ? ? 1_555 B DA  18 N6 ? ? A DT 6   B DA  18  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog10 hydrog ? ? A DG 7  N1 ? ? ? 1_555 B DC  17 N3 ? ? A DG 7   B DC  17  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog11 hydrog ? ? A DG 7  N2 ? ? ? 1_555 B DC  17 O2 ? ? A DG 7   B DC  17  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog12 hydrog ? ? A DG 7  O6 ? ? ? 1_555 B DC  17 N4 ? ? A DG 7   B DC  17  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog13 hydrog ? ? A DA 8  N1 ? ? ? 1_555 B DT  16 N3 ? ? A DA 8   B DT  16  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog14 hydrog ? ? A DA 8  N6 ? ? ? 1_555 B DT  16 O4 ? ? A DA 8   B DT  16  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog15 hydrog ? ? A DA 9  N1 ? ? ? 1_555 B DT  15 N3 ? ? A DA 9   B DT  15  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog16 hydrog ? ? A DA 9  N6 ? ? ? 1_555 B DT  15 O4 ? ? A DA 9   B DT  15  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog17 hydrog ? ? A DA 10 N1 ? ? ? 1_555 B DT  14 N3 ? ? A DA 10  B DT  14  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog18 hydrog ? ? A DA 10 N6 ? ? ? 1_555 B DT  14 O4 ? ? A DA 10  B DT  14  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog19 hydrog ? ? A DC 11 N3 ? ? ? 1_555 B DG  13 N1 ? ? A DC 11  B DG  13  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog20 hydrog ? ? A DC 11 N4 ? ? ? 1_555 B DG  13 O6 ? ? A DC 11  B DG  13  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog21 hydrog ? ? A DC 11 O2 ? ? ? 1_555 B DG  13 N2 ? ? A DC 11  B DG  13  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog22 hydrog ? ? A DA 12 N1 ? ? ? 1_555 B DT  12 N3 ? ? A DA 12  B DT  12  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog23 hydrog ? ? A DA 12 N6 ? ? ? 1_555 B DT  12 O4 ? ? A DA 12  B DT  12  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog24 hydrog ? ? A DA 13 N1 ? ? ? 1_555 B DT  11 N3 ? ? A DA 13  B DT  11  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog25 hydrog ? ? A DA 13 N6 ? ? ? 1_555 B DT  11 O4 ? ? A DA 13  B DT  11  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog26 hydrog ? ? A DA 14 N1 ? ? ? 1_555 B DT  10 N3 ? ? A DA 14  B DT  10  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog27 hydrog ? ? A DA 14 N6 ? ? ? 1_555 B DT  10 O4 ? ? A DA 14  B DT  10  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog28 hydrog ? ? A DT 15 N3 ? ? ? 1_555 B DA  9  N1 ? ? A DT 15  B DA  9   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog29 hydrog ? ? A DT 15 O4 ? ? ? 1_555 B DA  9  N6 ? ? A DT 15  B DA  9   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog30 hydrog ? ? A DT 16 N3 ? ? ? 1_555 B DA  8  N1 ? ? A DT 16  B DA  8   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog31 hydrog ? ? A DT 16 O4 ? ? ? 1_555 B DA  8  N6 ? ? A DT 16  B DA  8   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog32 hydrog ? ? A DT 17 N3 ? ? ? 1_555 B DA  7  N1 ? ? A DT 17  B DA  7   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog33 hydrog ? ? A DT 17 O4 ? ? ? 1_555 B DA  7  N6 ? ? A DT 17  B DA  7   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog34 hydrog ? ? A DT 18 N3 ? ? ? 1_555 B DA  6  N1 ? ? A DT 18  B DA  6   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog35 hydrog ? ? A DT 18 O4 ? ? ? 1_555 B DA  6  N6 ? ? A DT 18  B DA  6   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog36 hydrog ? ? A DC 19 N3 ? ? ? 1_555 B DG  5  N1 ? ? A DC 19  B DG  5   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog37 hydrog ? ? A DC 19 N4 ? ? ? 1_555 B DG  5  O6 ? ? A DC 19  B DG  5   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog38 hydrog ? ? A DC 19 O2 ? ? ? 1_555 B DG  5  N2 ? ? A DC 19  B DG  5   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog39 hydrog ? ? A DC 20 N3 ? ? ? 1_555 B DG  4  N1 ? ? A DC 20  B DG  4   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog40 hydrog ? ? A DC 20 N4 ? ? ? 1_555 B DG  4  O6 ? ? A DC 20  B DG  4   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog41 hydrog ? ? A DC 20 O2 ? ? ? 1_555 B DG  4  N2 ? ? A DC 20  B DG  4   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog42 hydrog ? ? A DT 21 N3 ? ? ? 1_555 B DA  3  N1 ? ? A DT 21  B DA  3   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog43 hydrog ? ? A DT 21 O4 ? ? ? 1_555 B DA  3  N6 ? ? A DT 21  B DA  3   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog44 hydrog ? ? C DC 3  N3 ? ? ? 1_555 D DG  21 N1 ? ? C DC 3   D DG  21  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog45 hydrog ? ? C DC 3  N4 ? ? ? 1_555 D DG  21 O6 ? ? C DC 3   D DG  21  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog46 hydrog ? ? C DC 3  O2 ? ? ? 1_555 D DG  21 N2 ? ? C DC 3   D DG  21  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog47 hydrog ? ? C DT 4  N3 ? ? ? 1_555 D DA  20 N1 ? ? C DT 4   D DA  20  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog48 hydrog ? ? C DT 4  O4 ? ? ? 1_555 D DA  20 N6 ? ? C DT 4   D DA  20  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog49 hydrog ? ? C DA 5  N1 ? ? ? 1_555 D DT  19 N3 ? ? C DA 5   D DT  19  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog50 hydrog ? ? C DA 5  N6 ? ? ? 1_555 D DT  19 O4 ? ? C DA 5   D DT  19  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog51 hydrog ? ? C DT 6  N3 ? ? ? 1_555 D DA  18 N1 ? ? C DT 6   D DA  18  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog52 hydrog ? ? C DT 6  O4 ? ? ? 1_555 D DA  18 N6 ? ? C DT 6   D DA  18  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog53 hydrog ? ? C DG 7  N1 ? ? ? 1_555 D DC  17 N3 ? ? C DG 7   D DC  17  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog54 hydrog ? ? C DG 7  N2 ? ? ? 1_555 D DC  17 O2 ? ? C DG 7   D DC  17  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog55 hydrog ? ? C DG 7  O6 ? ? ? 1_555 D DC  17 N4 ? ? C DG 7   D DC  17  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog56 hydrog ? ? C DA 8  N1 ? ? ? 1_555 D DT  16 N3 ? ? C DA 8   D DT  16  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog57 hydrog ? ? C DA 8  N6 ? ? ? 1_555 D DT  16 O4 ? ? C DA 8   D DT  16  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog58 hydrog ? ? C DA 9  N1 ? ? ? 1_555 D DT  15 N3 ? ? C DA 9   D DT  15  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog59 hydrog ? ? C DA 9  N6 ? ? ? 1_555 D DT  15 O4 ? ? C DA 9   D DT  15  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog60 hydrog ? ? C DA 10 N1 ? ? ? 1_555 D DT  14 N3 ? ? C DA 10  D DT  14  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog61 hydrog ? ? C DA 10 N6 ? ? ? 1_555 D DT  14 O4 ? ? C DA 10  D DT  14  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog62 hydrog ? ? C DC 11 N3 ? ? ? 1_555 D DG  13 N1 ? ? C DC 11  D DG  13  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog63 hydrog ? ? C DC 11 N4 ? ? ? 1_555 D DG  13 O6 ? ? C DC 11  D DG  13  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog64 hydrog ? ? C DC 11 O2 ? ? ? 1_555 D DG  13 N2 ? ? C DC 11  D DG  13  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog65 hydrog ? ? C DA 12 N1 ? ? ? 1_555 D DT  12 N3 ? ? C DA 12  D DT  12  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog66 hydrog ? ? C DA 12 N6 ? ? ? 1_555 D DT  12 O4 ? ? C DA 12  D DT  12  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog67 hydrog ? ? C DA 13 N1 ? ? ? 1_555 D DT  11 N3 ? ? C DA 13  D DT  11  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog68 hydrog ? ? C DA 13 N6 ? ? ? 1_555 D DT  11 O4 ? ? C DA 13  D DT  11  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog69 hydrog ? ? C DA 14 N1 ? ? ? 1_555 D DT  10 N3 ? ? C DA 14  D DT  10  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog70 hydrog ? ? C DA 14 N6 ? ? ? 1_555 D DT  10 O4 ? ? C DA 14  D DT  10  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog71 hydrog ? ? C DT 15 N3 ? ? ? 1_555 D DA  9  N1 ? ? C DT 15  D DA  9   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog72 hydrog ? ? C DT 15 O4 ? ? ? 1_555 D DA  9  N6 ? ? C DT 15  D DA  9   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog73 hydrog ? ? C DT 16 N3 ? ? ? 1_555 D DA  8  N1 ? ? C DT 16  D DA  8   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog74 hydrog ? ? C DT 16 O4 ? ? ? 1_555 D DA  8  N6 ? ? C DT 16  D DA  8   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog75 hydrog ? ? C DT 17 N3 ? ? ? 1_555 D DA  7  N1 ? ? C DT 17  D DA  7   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog76 hydrog ? ? C DT 17 O4 ? ? ? 1_555 D DA  7  N6 ? ? C DT 17  D DA  7   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog77 hydrog ? ? C DT 18 N3 ? ? ? 1_555 D DA  6  N1 ? ? C DT 18  D DA  6   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog78 hydrog ? ? C DT 18 O4 ? ? ? 1_555 D DA  6  N6 ? ? C DT 18  D DA  6   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog79 hydrog ? ? C DC 19 N3 ? ? ? 1_555 D DG  5  N1 ? ? C DC 19  D DG  5   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog80 hydrog ? ? C DC 19 N4 ? ? ? 1_555 D DG  5  O6 ? ? C DC 19  D DG  5   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog81 hydrog ? ? C DC 19 O2 ? ? ? 1_555 D DG  5  N2 ? ? C DC 19  D DG  5   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog82 hydrog ? ? C DC 20 N3 ? ? ? 1_555 D DG  4  N1 ? ? C DC 20  D DG  4   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog83 hydrog ? ? C DC 20 N4 ? ? ? 1_555 D DG  4  O6 ? ? C DC 20  D DG  4   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog84 hydrog ? ? C DC 20 O2 ? ? ? 1_555 D DG  4  N2 ? ? C DC 20  D DG  4   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog85 hydrog ? ? C DT 21 N3 ? ? ? 1_555 D DA  3  N1 ? ? C DT 21  D DA  3   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog86 hydrog ? ? C DT 21 O4 ? ? ? 1_555 D DA  3  N6 ? ? C DT 21  D DA  3   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
metalc ? ? 
hydrog ? ? 
A ? 2 ? 
B ? 2 ? 
C ? 2 ? 
D ? 2 ? 
E ? 2 ? 
F ? 2 ? 
A 1 2 ? anti-parallel 
B 1 2 ? anti-parallel 
C 1 2 ? anti-parallel 
D 1 2 ? anti-parallel 
E 1 2 ? anti-parallel 
F 1 2 ? anti-parallel 
A 1 VAL E 64 ? GLU E 65 ? VAL F 565 GLU F 566 
A 2 ALA E 70 ? VAL E 71 ? ALA F 571 VAL F 572 
B 1 PHE F 61 ? GLU F 65 ? PHE G 562 GLU G 566 
B 2 ALA F 70 ? VAL F 74 ? ALA G 571 VAL G 575 
C 1 PHE G 61 ? GLU G 65 ? PHE H 562 GLU H 566 
C 2 ALA G 70 ? VAL G 74 ? ALA H 571 VAL H 575 
D 1 PHE H 61 ? VAL H 64 ? PHE I 562 VAL I 565 
D 2 VAL H 71 ? VAL H 74 ? VAL I 572 VAL I 575 
E 1 PHE I 61 ? ASN I 66 ? PHE J 562 ASN J 567 
E 2 GLY I 69 ? VAL I 74 ? GLY J 570 VAL J 575 
F 1 PHE J 61 ? ASN J 66 ? PHE K 562 ASN K 567 
F 2 GLY J 69 ? VAL J 74 ? GLY K 570 VAL K 575 
A 1 2 N VAL E 64 ? N VAL F 565 O VAL E 71 ? O VAL F 572 
B 1 2 N VAL F 64 ? N VAL G 565 O VAL F 71 ? O VAL G 572 
C 1 2 N VAL G 64 ? N VAL H 565 O VAL G 71 ? O VAL H 572 
D 1 2 N VAL H 64 ? N VAL I 565 O VAL H 71 ? O VAL I 572 
E 1 2 N VAL I 64 ? N VAL J 565 O VAL I 71 ? O VAL J 572 
F 1 2 N VAL J 64 ? N VAL K 565 O VAL J 71 ? O VAL K 572 
AC1 Software ? ? ? ? 4 'BINDING SITE FOR RESIDUE MG F 601' 
AC2 Software ? ? ? ? 4 'BINDING SITE FOR RESIDUE MG H 602' 
AC3 Software ? ? ? ? 3 'BINDING SITE FOR RESIDUE MG I 603' 
AC4 Software ? ? ? ? 3 'BINDING SITE FOR RESIDUE MG G 604' 
AC5 Software ? ? ? ? 5 'BINDING SITE FOR RESIDUE MG J 605' 
AC6 Software ? ? ? ? 6 'BINDING SITE FOR RESIDUE MG K 606' 
1  AC1 4 SER E 56 ? SER F 557 . ? 1_555 ? 
2  AC1 4 LEU E 57 ? LEU F 558 . ? 1_555 ? 
3  AC1 4 HIS E 58 ? HIS F 559 . ? 1_555 ? 
4  AC1 4 HOH U .  ? HOH F 613 . ? 1_555 ? 
5  AC2 4 HOH W .  ? HOH H 397 . ? 1_555 ? 
6  AC2 4 LEU G 55 ? LEU H 556 . ? 1_555 ? 
7  AC2 4 HIS G 58 ? HIS H 559 . ? 1_555 ? 
8  AC2 4 PHE G 61 ? PHE H 562 . ? 1_555 ? 
9  AC3 3 SER H 56 ? SER I 557 . ? 1_555 ? 
10 AC3 3 LEU H 57 ? LEU I 558 . ? 1_555 ? 
11 AC3 3 HIS H 58 ? HIS I 559 . ? 1_555 ? 
12 AC4 3 LEU F 55 ? LEU G 556 . ? 1_555 ? 
13 AC4 3 HIS F 58 ? HIS G 559 . ? 1_555 ? 
14 AC4 3 PHE F 61 ? PHE G 562 . ? 1_555 ? 
15 AC5 5 LEU I 55 ? LEU J 556 . ? 1_555 ? 
16 AC5 5 SER I 56 ? SER J 557 . ? 1_555 ? 
17 AC5 5 HIS I 58 ? HIS J 559 . ? 1_555 ? 
18 AC5 5 PHE I 61 ? PHE J 562 . ? 1_555 ? 
19 AC5 5 HOH Y .  ? HOH J 673 . ? 1_555 ? 
20 AC6 6 HOH T .  ? HOH D 24  . ? 1_555 ? 
21 AC6 6 LEU J 55 ? LEU K 556 . ? 1_555 ? 
22 AC6 6 SER J 56 ? SER K 557 . ? 1_555 ? 
23 AC6 6 HIS J 58 ? HIS K 559 . ? 1_555 ? 
24 AC6 6 PHE J 61 ? PHE K 562 . ? 1_555 ? 
25 AC6 6 HOH Z .  ? HOH K 645 . ? 1_555 ? 
_database_PDB_matrix.entry_id          2A07 
_database_PDB_matrix.origx[1][1]       1.000000 
_database_PDB_matrix.origx[1][2]       0.000000 
_database_PDB_matrix.origx[1][3]       0.000000 
_database_PDB_matrix.origx[2][1]       0.000000 
_database_PDB_matrix.origx[2][2]       1.000000 
_database_PDB_matrix.origx[2][3]       0.000000 
_database_PDB_matrix.origx[3][1]       0.000000 
_database_PDB_matrix.origx[3][2]       0.000000 
_database_PDB_matrix.origx[3][3]       1.000000 
_database_PDB_matrix.origx_vector[1]   0.00000 
_database_PDB_matrix.origx_vector[2]   0.00000 
_database_PDB_matrix.origx_vector[3]   0.00000 
_atom_sites.entry_id                    2A07 
_atom_sites.fract_transf_matrix[1][1]   0.014806 
_atom_sites.fract_transf_matrix[1][2]   0.000000 
_atom_sites.fract_transf_matrix[1][3]   0.005627 
_atom_sites.fract_transf_matrix[2][1]   0.000000 
_atom_sites.fract_transf_matrix[2][2]   0.008051 
_atom_sites.fract_transf_matrix[2][3]   0.000000 
_atom_sites.fract_transf_matrix[3][1]   0.000000 
_atom_sites.fract_transf_matrix[3][2]   0.000000 
_atom_sites.fract_transf_matrix[3][3]   0.015810 
_atom_sites.fract_transf_vector[1]      0.00000 
_atom_sites.fract_transf_vector[2]      0.00000 
_atom_sites.fract_transf_vector[3]      0.00000 
ATOM   1    O  "O5'" . DA  A 1 1  ? 66.987 94.180  40.686 1.00 65.80  ? 1   DA  A "O5'" 1 
ATOM   2    C  "C5'" . DA  A 1 1  ? 67.940 93.489  41.500 1.00 68.70  ? 1   DA  A "C5'" 1 
ATOM   3    C  "C4'" . DA  A 1 1  ? 68.708 94.431  42.398 1.00 69.34  ? 1   DA  A "C4'" 1 
ATOM   4    O  "O4'" . DA  A 1 1  ? 69.386 95.413  41.575 1.00 67.35  ? 1   DA  A "O4'" 1 
ATOM   5    C  "C3'" . DA  A 1 1  ? 67.830 95.224  43.367 1.00 70.52  ? 1   DA  A "C3'" 1 
ATOM   6    O  "O3'" . DA  A 1 1  ? 68.474 95.389  44.636 1.00 73.46  ? 1   DA  A "O3'" 1 
ATOM   7    C  "C2'" . DA  A 1 1  ? 67.658 96.562  42.673 1.00 68.73  ? 1   DA  A "C2'" 1 
ATOM   8    C  "C1'" . DA  A 1 1  ? 68.972 96.723  41.929 1.00 65.00  ? 1   DA  A "C1'" 1 
ATOM   9    N  N9    . DA  A 1 1  ? 68.848 97.506  40.700 1.00 59.36  ? 1   DA  A N9    1 
ATOM   10   C  C8    . DA  A 1 1  ? 68.664 97.072  39.407 1.00 56.29  ? 1   DA  A C8    1 
ATOM   11   N  N7    . DA  A 1 1  ? 68.580 98.045  38.531 1.00 53.82  ? 1   DA  A N7    1 
ATOM   12   C  C5    . DA  A 1 1  ? 68.719 99.193  39.299 1.00 54.12  ? 1   DA  A C5    1 
ATOM   13   C  C6    . DA  A 1 1  ? 68.711 100.552 38.970 1.00 53.51  ? 1   DA  A C6    1 
ATOM   14   N  N6    . DA  A 1 1  ? 68.556 101.009 37.724 1.00 54.01  ? 1   DA  A N6    1 
ATOM   15   N  N1    . DA  A 1 1  ? 68.869 101.443 39.974 1.00 53.44  ? 1   DA  A N1    1 
ATOM   16   C  C2    . DA  A 1 1  ? 69.024 100.986 41.221 1.00 53.24  ? 1   DA  A C2    1 
ATOM   17   N  N3    . DA  A 1 1  ? 69.049 99.732  41.657 1.00 54.22  ? 1   DA  A N3    1 
ATOM   18   C  C4    . DA  A 1 1  ? 68.888 98.875  40.634 1.00 55.36  ? 1   DA  A C4    1 
ATOM   19   P  P     . DA  A 1 2  ? 67.580 95.685  45.938 1.00 76.39  ? 2   DA  A P     1 
ATOM   20   O  OP1   . DA  A 1 2  ? 68.440 96.304  46.979 1.00 76.77  ? 2   DA  A OP1   1 
ATOM   21   O  OP2   . DA  A 1 2  ? 66.804 94.461  46.260 1.00 76.72  ? 2   DA  A OP2   1 
ATOM   22   O  "O5'" . DA  A 1 2  ? 66.569 96.802  45.429 1.00 75.09  ? 2   DA  A "O5'" 1 
ATOM   23   C  "C5'" . DA  A 1 2  ? 65.566 97.332  46.287 1.00 74.11  ? 2   DA  A "C5'" 1 
ATOM   24   C  "C4'" . DA  A 1 2  ? 65.940 98.733  46.707 1.00 70.89  ? 2   DA  A "C4'" 1 
ATOM   25   O  "O4'" . DA  A 1 2  ? 66.491 99.442  45.575 1.00 68.47  ? 2   DA  A "O4'" 1 
ATOM   26   C  "C3'" . DA  A 1 2  ? 64.763 99.568  47.194 1.00 70.13  ? 2   DA  A "C3'" 1 
ATOM   27   O  "O3'" . DA  A 1 2  ? 65.194 100.462 48.223 1.00 71.83  ? 2   DA  A "O3'" 1 
ATOM   28   C  "C2'" . DA  A 1 2  ? 64.329 100.309 45.940 1.00 67.09  ? 2   DA  A "C2'" 1 
ATOM   29   C  "C1'" . DA  A 1 2  ? 65.636 100.506 45.183 1.00 64.22  ? 2   DA  A "C1'" 1 
ATOM   30   N  N9    . DA  A 1 2  ? 65.514 100.442 43.726 1.00 58.72  ? 2   DA  A N9    1 
ATOM   31   C  C8    . DA  A 1 2  ? 65.240 99.329  42.966 1.00 55.65  ? 2   DA  A C8    1 
ATOM   32   N  N7    . DA  A 1 2  ? 65.231 99.557  41.675 1.00 54.25  ? 2   DA  A N7    1 
ATOM   33   C  C5    . DA  A 1 2  ? 65.510 100.914 41.576 1.00 55.55  ? 2   DA  A C5    1 
ATOM   34   C  C6    . DA  A 1 2  ? 65.642 101.770 40.471 1.00 55.60  ? 2   DA  A C6    1 
ATOM   35   N  N6    . DA  A 1 2  ? 65.514 101.366 39.204 1.00 56.56  ? 2   DA  A N6    1 
ATOM   36   N  N1    . DA  A 1 2  ? 65.917 103.070 40.713 1.00 56.36  ? 2   DA  A N1    1 
ATOM   37   C  C2    . DA  A 1 2  ? 66.050 103.471 41.985 1.00 56.96  ? 2   DA  A C2    1 
ATOM   38   N  N3    . DA  A 1 2  ? 65.950 102.761 43.108 1.00 56.58  ? 2   DA  A N3    1 
ATOM   39   C  C4    . DA  A 1 2  ? 65.676 101.474 42.831 1.00 56.41  ? 2   DA  A C4    1 
ATOM   40   P  P     . DC  A 1 3  ? 64.111 101.133 49.199 1.00 73.39  ? 3   DC  A P     1 
ATOM   41   O  OP1   . DC  A 1 3  ? 64.532 100.891 50.601 1.00 73.94  ? 3   DC  A OP1   1 
ATOM   42   O  OP2   . DC  A 1 3  ? 62.766 100.693 48.748 1.00 74.30  ? 3   DC  A OP2   1 
ATOM   43   O  "O5'" . DC  A 1 3  ? 64.256 102.685 48.886 1.00 72.73  ? 3   DC  A "O5'" 1 
ATOM   44   C  "C5'" . DC  A 1 3  ? 64.403 103.125 47.543 1.00 72.37  ? 3   DC  A "C5'" 1 
ATOM   45   C  "C4'" . DC  A 1 3  ? 63.676 104.430 47.337 1.00 69.21  ? 3   DC  A "C4'" 1 
ATOM   46   O  "O4'" . DC  A 1 3  ? 63.708 104.722 45.921 1.00 67.91  ? 3   DC  A "O4'" 1 
ATOM   47   C  "C3'" . DC  A 1 3  ? 62.200 104.389 47.728 1.00 67.76  ? 3   DC  A "C3'" 1 
ATOM   48   O  "O3'" . DC  A 1 3  ? 61.812 105.641 48.305 1.00 67.85  ? 3   DC  A "O3'" 1 
ATOM   49   C  "C2'" . DC  A 1 3  ? 61.488 104.090 46.423 1.00 65.90  ? 3   DC  A "C2'" 1 
ATOM   50   C  "C1'" . DC  A 1 3  ? 62.406 104.669 45.357 1.00 64.17  ? 3   DC  A "C1'" 1 
ATOM   51   N  N1    . DC  A 1 3  ? 62.475 103.840 44.140 1.00 60.40  ? 3   DC  A N1    1 
ATOM   52   C  C2    . DC  A 1 3  ? 62.693 104.461 42.907 1.00 58.09  ? 3   DC  A C2    1 
ATOM   53   O  O2    . DC  A 1 3  ? 62.867 105.686 42.877 1.00 57.38  ? 3   DC  A O2    1 
ATOM   54   N  N3    . DC  A 1 3  ? 62.711 103.710 41.781 1.00 57.51  ? 3   DC  A N3    1 
ATOM   55   C  C4    . DC  A 1 3  ? 62.535 102.389 41.857 1.00 57.22  ? 3   DC  A C4    1 
ATOM   56   N  N4    . DC  A 1 3  ? 62.547 101.689 40.721 1.00 59.22  ? 3   DC  A N4    1 
ATOM   57   C  C5    . DC  A 1 3  ? 62.335 101.727 43.101 1.00 57.75  ? 3   DC  A C5    1 
ATOM   58   C  C6    . DC  A 1 3  ? 62.316 102.482 44.208 1.00 58.32  ? 3   DC  A C6    1 
ATOM   59   P  P     . DT  A 1 4  ? 60.271 106.096 48.283 1.00 68.86  ? 4   DT  A P     1 
ATOM   60   O  OP1   . DT  A 1 4  ? 60.059 107.004 49.437 1.00 69.65  ? 4   DT  A OP1   1 
ATOM   61   O  OP2   . DT  A 1 4  ? 59.383 104.918 48.106 1.00 68.91  ? 4   DT  A OP2   1 
ATOM   62   O  "O5'" . DT  A 1 4  ? 60.192 106.990 46.973 1.00 67.46  ? 4   DT  A "O5'" 1 
ATOM   63   C  "C5'" . DT  A 1 4  ? 61.139 108.030 46.764 1.00 65.25  ? 4   DT  A "C5'" 1 
ATOM   64   C  "C4'" . DT  A 1 4  ? 60.616 109.005 45.741 1.00 61.80  ? 4   DT  A "C4'" 1 
ATOM   65   O  "O4'" . DT  A 1 4  ? 60.651 108.399 44.429 1.00 59.63  ? 4   DT  A "O4'" 1 
ATOM   66   C  "C3'" . DT  A 1 4  ? 59.170 109.431 45.977 1.00 61.07  ? 4   DT  A "C3'" 1 
ATOM   67   O  "O3'" . DT  A 1 4  ? 59.037 110.819 45.670 1.00 61.20  ? 4   DT  A "O3'" 1 
ATOM   68   C  "C2'" . DT  A 1 4  ? 58.378 108.542 45.032 1.00 58.20  ? 4   DT  A "C2'" 1 
ATOM   69   C  "C1'" . DT  A 1 4  ? 59.344 108.307 43.880 1.00 55.28  ? 4   DT  A "C1'" 1 
ATOM   70   N  N1    . DT  A 1 4  ? 59.234 106.983 43.233 1.00 49.86  ? 4   DT  A N1    1 
ATOM   71   C  C2    . DT  A 1 4  ? 59.259 106.929 41.857 1.00 46.12  ? 4   DT  A C2    1 
ATOM   72   O  O2    . DT  A 1 4  ? 59.322 107.921 41.152 1.00 44.47  ? 4   DT  A O2    1 
ATOM   73   N  N3    . DT  A 1 4  ? 59.207 105.664 41.334 1.00 43.13  ? 4   DT  A N3    1 
ATOM   74   C  C4    . DT  A 1 4  ? 59.127 104.474 42.028 1.00 43.79  ? 4   DT  A C4    1 
ATOM   75   O  O4    . DT  A 1 4  ? 59.119 103.407 41.415 1.00 43.07  ? 4   DT  A O4    1 
ATOM   76   C  C5    . DT  A 1 4  ? 59.070 104.601 43.465 1.00 44.38  ? 4   DT  A C5    1 
ATOM   77   C  C7    . DT  A 1 4  ? 58.946 103.361 44.295 1.00 43.63  ? 4   DT  A C7    1 
ATOM   78   C  C6    . DT  A 1 4  ? 59.127 105.831 43.990 1.00 46.90  ? 4   DT  A C6    1 
ATOM   79   P  P     . DA  A 1 5  ? 57.584 111.494 45.629 1.00 63.08  ? 5   DA  A P     1 
ATOM   80   O  OP1   . DA  A 1 5  ? 57.775 112.932 45.936 1.00 63.31  ? 5   DA  A OP1   1 
ATOM   81   O  OP2   . DA  A 1 5  ? 56.624 110.693 46.433 1.00 62.86  ? 5   DA  A OP2   1 
ATOM   82   O  "O5'" . DA  A 1 5  ? 57.199 111.388 44.091 1.00 60.75  ? 5   DA  A "O5'" 1 
ATOM   83   C  "C5'" . DA  A 1 5  ? 58.055 111.954 43.104 1.00 58.02  ? 5   DA  A "C5'" 1 
ATOM   84   C  "C4'" . DA  A 1 5  ? 57.362 111.964 41.764 1.00 54.53  ? 5   DA  A "C4'" 1 
ATOM   85   O  "O4'" . DA  A 1 5  ? 57.313 110.622 41.232 1.00 53.00  ? 5   DA  A "O4'" 1 
ATOM   86   C  "C3'" . DA  A 1 5  ? 55.919 112.448 41.832 1.00 53.10  ? 5   DA  A "C3'" 1 
ATOM   87   O  "O3'" . DA  A 1 5  ? 55.621 113.229 40.679 1.00 52.53  ? 5   DA  A "O3'" 1 
ATOM   88   C  "C2'" . DA  A 1 5  ? 55.114 111.161 41.869 1.00 50.95  ? 5   DA  A "C2'" 1 
ATOM   89   C  "C1'" . DA  A 1 5  ? 55.972 110.194 41.067 1.00 49.10  ? 5   DA  A "C1'" 1 
ATOM   90   N  N9    . DA  A 1 5  ? 55.902 108.809 41.530 1.00 44.82  ? 5   DA  A N9    1 
ATOM   91   C  C8    . DA  A 1 5  ? 55.787 108.363 42.824 1.00 42.00  ? 5   DA  A C8    1 
ATOM   92   N  N7    . DA  A 1 5  ? 55.777 107.056 42.933 1.00 41.14  ? 5   DA  A N7    1 
ATOM   93   C  C5    . DA  A 1 5  ? 55.884 106.612 41.622 1.00 41.70  ? 5   DA  A C5    1 
ATOM   94   C  C6    . DA  A 1 5  ? 55.932 105.324 41.062 1.00 41.49  ? 5   DA  A C6    1 
ATOM   95   N  N6    . DA  A 1 5  ? 55.886 104.200 41.782 1.00 42.19  ? 5   DA  A N6    1 
ATOM   96   N  N1    . DA  A 1 5  ? 56.036 105.229 39.719 1.00 41.58  ? 5   DA  A N1    1 
ATOM   97   C  C2    . DA  A 1 5  ? 56.093 106.357 39.000 1.00 41.54  ? 5   DA  A C2    1 
ATOM   98   N  N3    . DA  A 1 5  ? 56.065 107.620 39.410 1.00 41.37  ? 5   DA  A N3    1 
ATOM   99   C  C4    . DA  A 1 5  ? 55.958 107.680 40.747 1.00 41.68  ? 5   DA  A C4    1 
ATOM   100  P  P     . DT  A 1 6  ? 54.136 113.786 40.464 1.00 52.76  ? 6   DT  A P     1 
ATOM   101  O  OP1   . DT  A 1 6  ? 54.243 115.058 39.706 1.00 53.98  ? 6   DT  A OP1   1 
ATOM   102  O  OP2   . DT  A 1 6  ? 53.407 113.757 41.755 1.00 53.57  ? 6   DT  A OP2   1 
ATOM   103  O  "O5'" . DT  A 1 6  ? 53.488 112.701 39.503 1.00 51.62  ? 6   DT  A "O5'" 1 
ATOM   104  C  "C5'" . DT  A 1 6  ? 54.071 112.430 38.235 1.00 49.21  ? 6   DT  A "C5'" 1 
ATOM   105  C  "C4'" . DT  A 1 6  ? 53.187 111.489 37.456 1.00 46.72  ? 6   DT  A "C4'" 1 
ATOM   106  O  "O4'" . DT  A 1 6  ? 53.370 110.123 37.901 1.00 45.65  ? 6   DT  A "O4'" 1 
ATOM   107  C  "C3'" . DT  A 1 6  ? 51.699 111.793 37.613 1.00 45.41  ? 6   DT  A "C3'" 1 
ATOM   108  O  "O3'" . DT  A 1 6  ? 51.049 111.616 36.364 1.00 44.84  ? 6   DT  A "O3'" 1 
ATOM   109  C  "C2'" . DT  A 1 6  ? 51.225 110.726 38.582 1.00 45.25  ? 6   DT  A "C2'" 1 
ATOM   110  C  "C1'" . DT  A 1 6  ? 52.103 109.556 38.181 1.00 43.85  ? 6   DT  A "C1'" 1 
ATOM   111  N  N1    . DT  A 1 6  ? 52.279 108.514 39.211 1.00 40.16  ? 6   DT  A N1    1 
ATOM   112  C  C2    . DT  A 1 6  ? 52.559 107.235 38.787 1.00 38.22  ? 6   DT  A C2    1 
ATOM   113  O  O2    . DT  A 1 6  ? 52.694 106.938 37.611 1.00 37.27  ? 6   DT  A O2    1 
ATOM   114  N  N3    . DT  A 1 6  ? 52.684 106.313 39.795 1.00 36.88  ? 6   DT  A N3    1 
ATOM   115  C  C4    . DT  A 1 6  ? 52.571 106.541 41.152 1.00 37.44  ? 6   DT  A C4    1 
ATOM   116  O  O4    . DT  A 1 6  ? 52.717 105.614 41.940 1.00 38.72  ? 6   DT  A O4    1 
ATOM   117  C  C5    . DT  A 1 6  ? 52.284 107.910 41.526 1.00 38.65  ? 6   DT  A C5    1 
ATOM   118  C  C7    . DT  A 1 6  ? 52.142 108.255 42.975 1.00 38.74  ? 6   DT  A C7    1 
ATOM   119  C  C6    . DT  A 1 6  ? 52.157 108.813 40.550 1.00 38.53  ? 6   DT  A C6    1 
ATOM   120  P  P     . DG  A 1 7  ? 49.770 112.510 36.001 1.00 44.20  ? 7   DG  A P     1 
ATOM   121  O  OP1   . DG  A 1 7  ? 50.271 113.783 35.439 1.00 44.30  ? 7   DG  A OP1   1 
ATOM   122  O  OP2   . DG  A 1 7  ? 48.840 112.531 37.159 1.00 42.64  ? 7   DG  A OP2   1 
ATOM   123  O  "O5'" . DG  A 1 7  ? 49.126 111.702 34.796 1.00 41.95  ? 7   DG  A "O5'" 1 
ATOM   124  C  "C5'" . DG  A 1 7  ? 49.934 111.341 33.683 1.00 39.68  ? 7   DG  A "C5'" 1 
ATOM   125  C  "C4'" . DG  A 1 7  ? 49.511 109.997 33.145 1.00 38.50  ? 7   DG  A "C4'" 1 
ATOM   126  O  "O4'" . DG  A 1 7  ? 49.784 108.956 34.111 1.00 35.86  ? 7   DG  A "O4'" 1 
ATOM   127  C  "C3'" . DG  A 1 7  ? 48.026 109.884 32.822 1.00 38.27  ? 7   DG  A "C3'" 1 
ATOM   128  O  "O3'" . DG  A 1 7  ? 47.911 109.032 31.689 1.00 40.09  ? 7   DG  A "O3'" 1 
ATOM   129  C  "C2'" . DG  A 1 7  ? 47.452 109.225 34.064 1.00 35.57  ? 7   DG  A "C2'" 1 
ATOM   130  C  "C1'" . DG  A 1 7  ? 48.583 108.303 34.488 1.00 32.07  ? 7   DG  A "C1'" 1 
ATOM   131  N  N9    . DG  A 1 7  ? 48.672 108.028 35.918 1.00 29.39  ? 7   DG  A N9    1 
ATOM   132  C  C8    . DG  A 1 7  ? 48.505 108.913 36.958 1.00 26.76  ? 7   DG  A C8    1 
ATOM   133  N  N7    . DG  A 1 7  ? 48.711 108.373 38.130 1.00 26.22  ? 7   DG  A N7    1 
ATOM   134  C  C5    . DG  A 1 7  ? 49.019 107.050 37.846 1.00 25.91  ? 7   DG  A C5    1 
ATOM   135  C  C6    . DG  A 1 7  ? 49.347 105.974 38.716 1.00 23.24  ? 7   DG  A C6    1 
ATOM   136  O  O6    . DG  A 1 7  ? 49.444 105.980 39.946 1.00 23.08  ? 7   DG  A O6    1 
ATOM   137  N  N1    . DG  A 1 7  ? 49.578 104.800 38.008 1.00 22.30  ? 7   DG  A N1    1 
ATOM   138  C  C2    . DG  A 1 7  ? 49.508 104.671 36.644 1.00 22.89  ? 7   DG  A C2    1 
ATOM   139  N  N2    . DG  A 1 7  ? 49.754 103.447 36.153 1.00 19.84  ? 7   DG  A N2    1 
ATOM   140  N  N3    . DG  A 1 7  ? 49.214 105.665 35.822 1.00 24.03  ? 7   DG  A N3    1 
ATOM   141  C  C4    . DG  A 1 7  ? 48.983 106.816 36.489 1.00 25.92  ? 7   DG  A C4    1 
ATOM   142  P  P     . DA  A 1 8  ? 46.508 108.874 30.946 1.00 40.30  ? 8   DA  A P     1 
ATOM   143  O  OP1   . DA  A 1 8  ? 46.778 109.154 29.510 1.00 41.96  ? 8   DA  A OP1   1 
ATOM   144  O  OP2   . DA  A 1 8  ? 45.460 109.636 31.664 1.00 39.46  ? 8   DA  A OP2   1 
ATOM   145  O  "O5'" . DA  A 1 8  ? 46.202 107.314 31.063 1.00 36.69  ? 8   DA  A "O5'" 1 
ATOM   146  C  "C5'" . DA  A 1 8  ? 47.124 106.370 30.528 1.00 32.83  ? 8   DA  A "C5'" 1 
ATOM   147  C  "C4'" . DA  A 1 8  ? 46.812 104.974 31.014 1.00 30.70  ? 8   DA  A "C4'" 1 
ATOM   148  O  "O4'" . DA  A 1 8  ? 47.008 104.880 32.446 1.00 29.65  ? 8   DA  A "O4'" 1 
ATOM   149  C  "C3'" . DA  A 1 8  ? 45.405 104.454 30.736 1.00 29.24  ? 8   DA  A "C3'" 1 
ATOM   150  O  "O3'" . DA  A 1 8  ? 45.523 103.081 30.337 1.00 30.03  ? 8   DA  A "O3'" 1 
ATOM   151  C  "C2'" . DA  A 1 8  ? 44.704 104.618 32.078 1.00 28.59  ? 8   DA  A "C2'" 1 
ATOM   152  C  "C1'" . DA  A 1 8  ? 45.833 104.392 33.075 1.00 27.41  ? 8   DA  A "C1'" 1 
ATOM   153  N  N9    . DA  A 1 8  ? 45.709 105.093 34.356 1.00 23.65  ? 8   DA  A N9    1 
ATOM   154  C  C8    . DA  A 1 8  ? 45.395 106.412 34.572 1.00 24.17  ? 8   DA  A C8    1 
ATOM   155  N  N7    . DA  A 1 8  ? 45.426 106.765 35.838 1.00 23.13  ? 8   DA  A N7    1 
ATOM   156  C  C5    . DA  A 1 8  ? 45.768 105.595 36.500 1.00 20.34  ? 8   DA  A C5    1 
ATOM   157  C  C6    . DA  A 1 8  ? 45.976 105.304 37.864 1.00 19.23  ? 8   DA  A C6    1 
ATOM   158  N  N6    . DA  A 1 8  ? 45.870 106.211 38.838 1.00 14.74  ? 8   DA  A N6    1 
ATOM   159  N  N1    . DA  A 1 8  ? 46.307 104.031 38.192 1.00 16.71  ? 8   DA  A N1    1 
ATOM   160  C  C2    . DA  A 1 8  ? 46.430 103.127 37.207 1.00 14.97  ? 8   DA  A C2    1 
ATOM   161  N  N3    . DA  A 1 8  ? 46.270 103.283 35.891 1.00 17.78  ? 8   DA  A N3    1 
ATOM   162  C  C4    . DA  A 1 8  ? 45.933 104.553 35.600 1.00 21.05  ? 8   DA  A C4    1 
ATOM   163  P  P     . DA  A 1 9  ? 44.267 102.307 29.695 1.00 30.25  ? 9   DA  A P     1 
ATOM   164  O  OP1   . DA  A 1 9  ? 44.745 101.478 28.559 1.00 31.13  ? 9   DA  A OP1   1 
ATOM   165  O  OP2   . DA  A 1 9  ? 43.101 103.210 29.526 1.00 28.75  ? 9   DA  A OP2   1 
ATOM   166  O  "O5'" . DA  A 1 9  ? 43.879 101.277 30.831 1.00 28.39  ? 9   DA  A "O5'" 1 
ATOM   167  C  "C5'" . DA  A 1 9  ? 44.219 101.561 32.155 1.00 27.30  ? 9   DA  A "C5'" 1 
ATOM   168  C  "C4'" . DA  A 1 9  ? 44.134 100.322 33.003 1.00 21.08  ? 9   DA  A "C4'" 1 
ATOM   169  O  "O4'" . DA  A 1 9  ? 44.285 100.845 34.334 1.00 17.05  ? 9   DA  A "O4'" 1 
ATOM   170  C  "C3'" . DA  A 1 9  ? 42.780 99.608  32.980 1.00 18.37  ? 9   DA  A "C3'" 1 
ATOM   171  O  "O3'" . DA  A 1 9  ? 42.979 98.200  33.219 1.00 15.53  ? 9   DA  A "O3'" 1 
ATOM   172  C  "C2'" . DA  A 1 9  ? 41.985 100.322 34.062 1.00 16.22  ? 9   DA  A "C2'" 1 
ATOM   173  C  "C1'" . DA  A 1 9  ? 43.054 100.830 35.030 1.00 16.30  ? 9   DA  A "C1'" 1 
ATOM   174  N  N9    . DA  A 1 9  ? 42.853 102.179 35.565 1.00 15.22  ? 9   DA  A N9    1 
ATOM   175  C  C8    . DA  A 1 9  ? 42.508 103.342 34.911 1.00 16.42  ? 9   DA  A C8    1 
ATOM   176  N  N7    . DA  A 1 9  ? 42.425 104.389 35.703 1.00 15.77  ? 9   DA  A N7    1 
ATOM   177  C  C5    . DA  A 1 9  ? 42.733 103.880 36.957 1.00 15.04  ? 9   DA  A C5    1 
ATOM   178  C  C6    . DA  A 1 9  ? 42.822 104.475 38.226 1.00 17.04  ? 9   DA  A C6    1 
ATOM   179  N  N6    . DA  A 1 9  ? 42.603 105.774 38.455 1.00 14.41  ? 9   DA  A N6    1 
ATOM   180  N  N1    . DA  A 1 9  ? 43.155 103.678 39.270 1.00 14.97  ? 9   DA  A N1    1 
ATOM   181  C  C2    . DA  A 1 9  ? 43.391 102.379 39.038 1.00 14.67  ? 9   DA  A C2    1 
ATOM   182  N  N3    . DA  A 1 9  ? 43.343 101.707 37.894 1.00 12.52  ? 9   DA  A N3    1 
ATOM   183  C  C4    . DA  A 1 9  ? 43.003 102.522 36.882 1.00 15.33  ? 9   DA  A C4    1 
ATOM   184  P  P     . DA  A 1 10 ? 41.719 97.233  33.490 1.00 16.09  ? 10  DA  A P     1 
ATOM   185  O  OP1   . DA  A 1 10 ? 42.172 95.828  33.341 1.00 13.27  ? 10  DA  A OP1   1 
ATOM   186  O  OP2   . DA  A 1 10 ? 40.527 97.701  32.745 1.00 14.66  ? 10  DA  A OP2   1 
ATOM   187  O  "O5'" . DA  A 1 10 ? 41.440 97.446  35.033 1.00 15.60  ? 10  DA  A "O5'" 1 
ATOM   188  C  "C5'" . DA  A 1 10 ? 42.488 97.205  35.959 1.00 14.77  ? 10  DA  A "C5'" 1 
ATOM   189  C  "C4'" . DA  A 1 10 ? 41.997 97.396  37.370 1.00 13.11  ? 10  DA  A "C4'" 1 
ATOM   190  O  "O4'" . DA  A 1 10 ? 41.818 98.806  37.644 1.00 12.43  ? 10  DA  A "O4'" 1 
ATOM   191  C  "C3'" . DA  A 1 10 ? 40.669 96.713  37.715 1.00 13.70  ? 10  DA  A "C3'" 1 
ATOM   192  O  "O3'" . DA  A 1 10 ? 40.838 96.033  38.960 1.00 15.41  ? 10  DA  A "O3'" 1 
ATOM   193  C  "C2'" . DA  A 1 10 ? 39.696 97.873  37.873 1.00 12.16  ? 10  DA  A "C2'" 1 
ATOM   194  C  "C1'" . DA  A 1 10 ? 40.607 98.998  38.345 1.00 10.27  ? 10  DA  A "C1'" 1 
ATOM   195  N  N9    . DA  A 1 10 ? 40.163 100.360 38.061 1.00 12.78  ? 10  DA  A N9    1 
ATOM   196  C  C8    . DA  A 1 10 ? 39.742 100.877 36.852 1.00 13.12  ? 10  DA  A C8    1 
ATOM   197  N  N7    . DA  A 1 10 ? 39.478 102.163 36.892 1.00 11.59  ? 10  DA  A N7    1 
ATOM   198  C  C5    . DA  A 1 10 ? 39.725 102.514 38.214 1.00 13.73  ? 10  DA  A C5    1 
ATOM   199  C  C6    . DA  A 1 10 ? 39.639 103.743 38.897 1.00 12.75  ? 10  DA  A C6    1 
ATOM   200  N  N6    . DA  A 1 10 ? 39.295 104.903 38.311 1.00 13.28  ? 10  DA  A N6    1 
ATOM   201  N  N1    . DA  A 1 10 ? 39.930 103.748 40.218 1.00 14.49  ? 10  DA  A N1    1 
ATOM   202  C  C2    . DA  A 1 10 ? 40.308 102.602 40.801 1.00 13.76  ? 10  DA  A C2    1 
ATOM   203  N  N3    . DA  A 1 10 ? 40.451 101.385 40.261 1.00 13.45  ? 10  DA  A N3    1 
ATOM   204  C  C4    . DA  A 1 10 ? 40.132 101.410 38.950 1.00 12.26  ? 10  DA  A C4    1 
ATOM   205  P  P     . DC  A 1 11 ? 39.749 94.976  39.453 1.00 19.24  ? 11  DC  A P     1 
ATOM   206  O  OP1   . DC  A 1 11 ? 40.488 93.898  40.180 1.00 18.41  ? 11  DC  A OP1   1 
ATOM   207  O  OP2   . DC  A 1 11 ? 38.816 94.643  38.351 1.00 21.22  ? 11  DC  A OP2   1 
ATOM   208  O  "O5'" . DC  A 1 11 ? 38.926 95.773  40.535 1.00 18.06  ? 11  DC  A "O5'" 1 
ATOM   209  C  "C5'" . DC  A 1 11 ? 39.170 97.132  40.706 1.00 27.24  ? 11  DC  A "C5'" 1 
ATOM   210  C  "C4'" . DC  A 1 11 ? 38.794 97.563  42.094 1.00 21.76  ? 11  DC  A "C4'" 1 
ATOM   211  O  "O4'" . DC  A 1 11 ? 38.722 98.989  41.930 1.00 21.58  ? 11  DC  A "O4'" 1 
ATOM   212  C  "C3'" . DC  A 1 11 ? 37.408 97.100  42.543 1.00 20.95  ? 11  DC  A "C3'" 1 
ATOM   213  O  "O3'" . DC  A 1 11 ? 37.427 96.744  43.926 1.00 24.08  ? 11  DC  A "O3'" 1 
ATOM   214  C  "C2'" . DC  A 1 11 ? 36.492 98.275  42.245 1.00 19.36  ? 11  DC  A "C2'" 1 
ATOM   215  C  "C1'" . DC  A 1 11 ? 37.417 99.481  42.155 1.00 18.24  ? 11  DC  A "C1'" 1 
ATOM   216  N  N1    . DC  A 1 11 ? 37.112 100.406 41.049 1.00 15.57  ? 11  DC  A N1    1 
ATOM   217  C  C2    . DC  A 1 11 ? 36.950 101.759 41.343 1.00 15.74  ? 11  DC  A C2    1 
ATOM   218  O  O2    . DC  A 1 11 ? 37.098 102.128 42.517 1.00 13.86  ? 11  DC  A O2    1 
ATOM   219  N  N3    . DC  A 1 11 ? 36.643 102.627 40.347 1.00 13.37  ? 11  DC  A N3    1 
ATOM   220  C  C4    . DC  A 1 11 ? 36.530 102.189 39.088 1.00 12.14  ? 11  DC  A C4    1 
ATOM   221  N  N4    . DC  A 1 11 ? 36.254 103.097 38.136 1.00 13.62  ? 11  DC  A N4    1 
ATOM   222  C  C5    . DC  A 1 11 ? 36.701 100.808 38.751 1.00 14.10  ? 11  DC  A C5    1 
ATOM   223  C  C6    . DC  A 1 11 ? 36.987 99.958  39.757 1.00 13.63  ? 11  DC  A C6    1 
ATOM   224  P  P     . DA  A 1 12 ? 36.114 96.119  44.606 1.00 27.56  ? 12  DA  A P     1 
ATOM   225  O  OP1   . DA  A 1 12 ? 36.521 95.304  45.771 1.00 31.01  ? 12  DA  A OP1   1 
ATOM   226  O  OP2   . DA  A 1 12 ? 35.269 95.514  43.551 1.00 26.44  ? 12  DA  A OP2   1 
ATOM   227  O  "O5'" . DA  A 1 12 ? 35.354 97.399  45.160 1.00 23.82  ? 12  DA  A "O5'" 1 
ATOM   228  C  "C5'" . DA  A 1 12 ? 36.017 98.310  46.029 1.00 23.83  ? 12  DA  A "C5'" 1 
ATOM   229  C  "C4'" . DA  A 1 12 ? 35.106 99.465  46.356 1.00 24.62  ? 12  DA  A "C4'" 1 
ATOM   230  O  "O4'" . DA  A 1 12 ? 35.001 100.355 45.215 1.00 22.52  ? 12  DA  A "O4'" 1 
ATOM   231  C  "C3'" . DA  A 1 12 ? 33.680 99.040  46.704 1.00 26.38  ? 12  DA  A "C3'" 1 
ATOM   232  O  "O3'" . DA  A 1 12 ? 33.243 99.759  47.862 1.00 31.89  ? 12  DA  A "O3'" 1 
ATOM   233  C  "C2'" . DA  A 1 12 ? 32.882 99.410  45.458 1.00 24.61  ? 12  DA  A "C2'" 1 
ATOM   234  C  "C1'" . DA  A 1 12 ? 33.639 100.624 44.938 1.00 22.62  ? 12  DA  A "C1'" 1 
ATOM   235  N  N9    . DA  A 1 12 ? 33.527 100.897 43.503 1.00 19.24  ? 12  DA  A N9    1 
ATOM   236  C  C8    . DA  A 1 12 ? 33.578 100.002 42.459 1.00 17.97  ? 12  DA  A C8    1 
ATOM   237  N  N7    . DA  A 1 12 ? 33.488 100.564 41.275 1.00 14.12  ? 12  DA  A N7    1 
ATOM   238  C  C5    . DA  A 1 12 ? 33.358 101.918 41.557 1.00 15.47  ? 12  DA  A C5    1 
ATOM   239  C  C6    . DA  A 1 12 ? 33.208 103.051 40.730 1.00 15.42  ? 12  DA  A C6    1 
ATOM   240  N  N6    . DA  A 1 12 ? 33.163 103.003 39.389 1.00 12.99  ? 12  DA  A N6    1 
ATOM   241  N  N1    . DA  A 1 12 ? 33.099 104.256 41.333 1.00 15.82  ? 12  DA  A N1    1 
ATOM   242  C  C2    . DA  A 1 12 ? 33.137 104.310 42.672 1.00 16.05  ? 12  DA  A C2    1 
ATOM   243  N  N3    . DA  A 1 12 ? 33.270 103.322 43.552 1.00 15.80  ? 12  DA  A N3    1 
ATOM   244  C  C4    . DA  A 1 12 ? 33.374 102.136 42.924 1.00 17.45  ? 12  DA  A C4    1 
ATOM   245  P  P     . DA  A 1 13 ? 31.947 99.261  48.665 1.00 34.36  ? 13  DA  A P     1 
ATOM   246  O  OP1   . DA  A 1 13 ? 32.165 99.451  50.113 1.00 35.16  ? 13  DA  A OP1   1 
ATOM   247  O  OP2   . DA  A 1 13 ? 31.550 97.939  48.147 1.00 33.97  ? 13  DA  A OP2   1 
ATOM   248  O  "O5'" . DA  A 1 13 ? 30.828 100.288 48.232 1.00 35.50  ? 13  DA  A "O5'" 1 
ATOM   249  C  "C5'" . DA  A 1 13 ? 30.924 100.932 46.993 1.00 36.01  ? 13  DA  A "C5'" 1 
ATOM   250  C  "C4'" . DA  A 1 13 ? 30.404 102.336 47.104 1.00 34.68  ? 13  DA  A "C4'" 1 
ATOM   251  O  "O4'" . DA  A 1 13 ? 30.656 102.956 45.831 1.00 31.50  ? 13  DA  A "O4'" 1 
ATOM   252  C  "C3'" . DA  A 1 13 ? 28.896 102.378 47.318 1.00 34.95  ? 13  DA  A "C3'" 1 
ATOM   253  O  "O3'" . DA  A 1 13 ? 28.555 103.517 48.105 1.00 39.54  ? 13  DA  A "O3'" 1 
ATOM   254  C  "C2'" . DA  A 1 13 ? 28.345 102.432 45.905 1.00 32.58  ? 13  DA  A "C2'" 1 
ATOM   255  C  "C1'" . DA  A 1 13 ? 29.457 103.094 45.096 1.00 29.73  ? 13  DA  A "C1'" 1 
ATOM   256  N  N9    . DA  A 1 13 ? 29.684 102.500 43.777 1.00 24.82  ? 13  DA  A N9    1 
ATOM   257  C  C8    . DA  A 1 13 ? 29.805 101.173 43.423 1.00 22.34  ? 13  DA  A C8    1 
ATOM   258  N  N7    . DA  A 1 13 ? 29.944 100.983 42.130 1.00 20.32  ? 13  DA  A N7    1 
ATOM   259  C  C5    . DA  A 1 13 ? 29.928 102.268 41.603 1.00 19.21  ? 13  DA  A C5    1 
ATOM   260  C  C6    . DA  A 1 13 ? 30.016 102.754 40.290 1.00 17.49  ? 13  DA  A C6    1 
ATOM   261  N  N6    . DA  A 1 13 ? 30.125 101.973 39.214 1.00 14.93  ? 13  DA  A N6    1 
ATOM   262  N  N1    . DA  A 1 13 ? 29.980 104.094 40.114 1.00 16.00  ? 13  DA  A N1    1 
ATOM   263  C  C2    . DA  A 1 13 ? 29.850 104.878 41.188 1.00 19.49  ? 13  DA  A C2    1 
ATOM   264  N  N3    . DA  A 1 13 ? 29.747 104.543 42.467 1.00 18.55  ? 13  DA  A N3    1 
ATOM   265  C  C4    . DA  A 1 13 ? 29.791 103.208 42.610 1.00 21.46  ? 13  DA  A C4    1 
ATOM   266  P  P     . DA  A 1 14 ? 27.080 103.650 48.728 1.00 39.80  ? 14  DA  A P     1 
ATOM   267  O  OP1   . DA  A 1 14 ? 27.231 104.039 50.148 1.00 42.56  ? 14  DA  A OP1   1 
ATOM   268  O  OP2   . DA  A 1 14 ? 26.283 102.447 48.383 1.00 38.88  ? 14  DA  A OP2   1 
ATOM   269  O  "O5'" . DA  A 1 14 ? 26.502 104.900 47.939 1.00 38.83  ? 14  DA  A "O5'" 1 
ATOM   270  C  "C5'" . DA  A 1 14 ? 27.275 106.089 47.839 1.00 38.23  ? 14  DA  A "C5'" 1 
ATOM   271  C  "C4'" . DA  A 1 14 ? 26.703 106.991 46.775 1.00 37.79  ? 14  DA  A "C4'" 1 
ATOM   272  O  "O4'" . DA  A 1 14 ? 27.012 106.478 45.454 1.00 36.42  ? 14  DA  A "O4'" 1 
ATOM   273  C  "C3'" . DA  A 1 14 ? 25.184 107.122 46.842 1.00 37.82  ? 14  DA  A "C3'" 1 
ATOM   274  O  "O3'" . DA  A 1 14 ? 24.826 108.482 46.596 1.00 40.19  ? 14  DA  A "O3'" 1 
ATOM   275  C  "C2'" . DA  A 1 14 ? 24.707 106.207 45.725 1.00 36.05  ? 14  DA  A "C2'" 1 
ATOM   276  C  "C1'" . DA  A 1 14 ? 25.819 106.348 44.697 1.00 32.81  ? 14  DA  A "C1'" 1 
ATOM   277  N  N9    . DA  A 1 14 ? 25.980 105.206 43.790 1.00 28.17  ? 14  DA  A N9    1 
ATOM   278  C  C8    . DA  A 1 14 ? 25.983 103.873 44.114 1.00 25.48  ? 14  DA  A C8    1 
ATOM   279  N  N7    . DA  A 1 14 ? 26.146 103.077 43.082 1.00 24.37  ? 14  DA  A N7    1 
ATOM   280  C  C5    . DA  A 1 14 ? 26.261 103.943 42.007 1.00 22.41  ? 14  DA  A C5    1 
ATOM   281  C  C6    . DA  A 1 14 ? 26.454 103.721 40.626 1.00 21.53  ? 14  DA  A C6    1 
ATOM   282  N  N6    . DA  A 1 14 ? 26.576 102.507 40.079 1.00 19.17  ? 14  DA  A N6    1 
ATOM   283  N  N1    . DA  A 1 14 ? 26.521 104.804 39.821 1.00 20.12  ? 14  DA  A N1    1 
ATOM   284  C  C2    . DA  A 1 14 ? 26.406 106.019 40.374 1.00 23.24  ? 14  DA  A C2    1 
ATOM   285  N  N3    . DA  A 1 14 ? 26.225 106.354 41.652 1.00 23.93  ? 14  DA  A N3    1 
ATOM   286  C  C4    . DA  A 1 14 ? 26.160 105.258 42.425 1.00 24.04  ? 14  DA  A C4    1 
ATOM   287  P  P     . DT  A 1 15 ? 23.353 109.007 46.970 1.00 41.09  ? 15  DT  A P     1 
ATOM   288  O  OP1   . DT  A 1 15 ? 23.517 110.316 47.634 1.00 40.69  ? 15  DT  A OP1   1 
ATOM   289  O  OP2   . DT  A 1 15 ? 22.576 107.923 47.626 1.00 38.87  ? 15  DT  A OP2   1 
ATOM   290  O  "O5'" . DT  A 1 15 ? 22.704 109.252 45.550 1.00 39.57  ? 15  DT  A "O5'" 1 
ATOM   291  C  "C5'" . DT  A 1 15 ? 23.011 108.366 44.508 1.00 38.39  ? 15  DT  A "C5'" 1 
ATOM   292  C  "C4'" . DT  A 1 15 ? 22.892 109.060 43.181 1.00 35.78  ? 15  DT  A "C4'" 1 
ATOM   293  O  "O4'" . DT  A 1 15 ? 23.439 108.148 42.209 1.00 33.71  ? 15  DT  A "O4'" 1 
ATOM   294  C  "C3'" . DT  A 1 15 ? 21.443 109.305 42.780 1.00 33.97  ? 15  DT  A "C3'" 1 
ATOM   295  O  "O3'" . DT  A 1 15 ? 21.356 110.505 42.006 1.00 34.96  ? 15  DT  A "O3'" 1 
ATOM   296  C  "C2'" . DT  A 1 15 ? 21.087 108.045 42.008 1.00 33.38  ? 15  DT  A "C2'" 1 
ATOM   297  C  "C1'" . DT  A 1 15 ? 22.416 107.616 41.391 1.00 31.84  ? 15  DT  A "C1'" 1 
ATOM   298  N  N1    . DT  A 1 15 ? 22.631 106.157 41.315 1.00 29.36  ? 15  DT  A N1    1 
ATOM   299  C  C2    . DT  A 1 15 ? 22.873 105.614 40.076 1.00 26.70  ? 15  DT  A C2    1 
ATOM   300  O  O2    . DT  A 1 15 ? 22.933 106.283 39.061 1.00 23.66  ? 15  DT  A O2    1 
ATOM   301  N  N3    . DT  A 1 15 ? 23.042 104.255 40.069 1.00 25.62  ? 15  DT  A N3    1 
ATOM   302  C  C4    . DT  A 1 15 ? 22.991 103.400 41.149 1.00 25.72  ? 15  DT  A C4    1 
ATOM   303  O  O4    . DT  A 1 15 ? 23.149 102.194 40.981 1.00 24.25  ? 15  DT  A O4    1 
ATOM   304  C  C5    . DT  A 1 15 ? 22.745 104.034 42.425 1.00 26.86  ? 15  DT  A C5    1 
ATOM   305  C  C7    . DT  A 1 15 ? 22.676 103.183 43.654 1.00 27.22  ? 15  DT  A C7    1 
ATOM   306  C  C6    . DT  A 1 15 ? 22.582 105.365 42.445 1.00 27.32  ? 15  DT  A C6    1 
ATOM   307  P  P     . DT  A 1 16 ? 19.915 111.117 41.627 1.00 35.33  ? 16  DT  A P     1 
ATOM   308  O  OP1   . DT  A 1 16 ? 20.019 112.595 41.727 1.00 35.78  ? 16  DT  A OP1   1 
ATOM   309  O  OP2   . DT  A 1 16 ? 18.864 110.397 42.379 1.00 31.21  ? 16  DT  A OP2   1 
ATOM   310  O  "O5'" . DT  A 1 16 ? 19.787 110.786 40.082 1.00 33.95  ? 16  DT  A "O5'" 1 
ATOM   311  C  "C5'" . DT  A 1 16 ? 20.491 109.693 39.542 1.00 33.82  ? 16  DT  A "C5'" 1 
ATOM   312  C  "C4'" . DT  A 1 16 ? 20.355 109.671 38.043 1.00 31.95  ? 16  DT  A "C4'" 1 
ATOM   313  O  "O4'" . DT  A 1 16 ? 20.722 108.334 37.649 1.00 29.97  ? 16  DT  A "O4'" 1 
ATOM   314  C  "C3'" . DT  A 1 16 ? 18.923 109.865 37.552 1.00 29.36  ? 16  DT  A "C3'" 1 
ATOM   315  O  "O3'" . DT  A 1 16 ? 18.948 110.459 36.254 1.00 30.41  ? 16  DT  A "O3'" 1 
ATOM   316  C  "C2'" . DT  A 1 16 ? 18.358 108.458 37.547 1.00 28.95  ? 16  DT  A "C2'" 1 
ATOM   317  C  "C1'" . DT  A 1 16 ? 19.577 107.586 37.273 1.00 28.90  ? 16  DT  A "C1'" 1 
ATOM   318  N  N1    . DT  A 1 16 ? 19.610 106.335 38.047 1.00 25.69  ? 16  DT  A N1    1 
ATOM   319  C  C2    . DT  A 1 16 ? 19.869 105.172 37.370 1.00 22.57  ? 16  DT  A C2    1 
ATOM   320  O  O2    . DT  A 1 16 ? 20.038 105.131 36.166 1.00 19.80  ? 16  DT  A O2    1 
ATOM   321  N  N3    . DT  A 1 16 ? 19.922 104.054 38.158 1.00 20.72  ? 16  DT  A N3    1 
ATOM   322  C  C4    . DT  A 1 16 ? 19.743 103.987 39.520 1.00 21.96  ? 16  DT  A C4    1 
ATOM   323  O  O4    . DT  A 1 16 ? 19.839 102.912 40.093 1.00 22.90  ? 16  DT  A O4    1 
ATOM   324  C  C5    . DT  A 1 16 ? 19.454 105.244 40.169 1.00 24.40  ? 16  DT  A C5    1 
ATOM   325  C  C7    . DT  A 1 16 ? 19.230 105.262 41.650 1.00 24.38  ? 16  DT  A C7    1 
ATOM   326  C  C6    . DT  A 1 16 ? 19.403 106.342 39.409 1.00 24.18  ? 16  DT  A C6    1 
ATOM   327  P  P     . DT  A 1 17 ? 17.574 110.742 35.471 1.00 30.40  ? 17  DT  A P     1 
ATOM   328  O  OP1   . DT  A 1 17 ? 17.862 111.818 34.490 1.00 29.09  ? 17  DT  A OP1   1 
ATOM   329  O  OP2   . DT  A 1 17 ? 16.459 110.893 36.434 1.00 28.25  ? 17  DT  A OP2   1 
ATOM   330  O  "O5'" . DT  A 1 17 ? 17.338 109.399 34.655 1.00 28.63  ? 17  DT  A "O5'" 1 
ATOM   331  C  "C5'" . DT  A 1 17 ? 18.287 108.981 33.684 1.00 28.07  ? 17  DT  A "C5'" 1 
ATOM   332  C  "C4'" . DT  A 1 17 ? 17.821 107.715 33.006 1.00 28.43  ? 17  DT  A "C4'" 1 
ATOM   333  O  "O4'" . DT  A 1 17 ? 17.978 106.581 33.898 1.00 28.23  ? 17  DT  A "O4'" 1 
ATOM   334  C  "C3'" . DT  A 1 17 ? 16.357 107.718 32.556 1.00 28.08  ? 17  DT  A "C3'" 1 
ATOM   335  O  "O3'" . DT  A 1 17 ? 16.282 107.237 31.209 1.00 29.40  ? 17  DT  A "O3'" 1 
ATOM   336  C  "C2'" . DT  A 1 17 ? 15.682 106.764 33.534 1.00 26.69  ? 17  DT  A "C2'" 1 
ATOM   337  C  "C1'" . DT  A 1 17 ? 16.800 105.789 33.871 1.00 26.77  ? 17  DT  A "C1'" 1 
ATOM   338  N  N1    . DT  A 1 17 ? 16.689 105.091 35.176 1.00 22.96  ? 17  DT  A N1    1 
ATOM   339  C  C2    . DT  A 1 17 ? 16.916 103.721 35.224 1.00 22.89  ? 17  DT  A C2    1 
ATOM   340  O  O2    . DT  A 1 17 ? 17.129 103.038 34.237 1.00 23.50  ? 17  DT  A O2    1 
ATOM   341  N  N3    . DT  A 1 17 ? 16.874 103.176 36.484 1.00 21.13  ? 17  DT  A N3    1 
ATOM   342  C  C4    . DT  A 1 17 ? 16.608 103.836 37.669 1.00 22.91  ? 17  DT  A C4    1 
ATOM   343  O  O4    . DT  A 1 17 ? 16.630 103.221 38.731 1.00 22.37  ? 17  DT  A O4    1 
ATOM   344  C  C5    . DT  A 1 17 ? 16.329 105.250 37.539 1.00 23.56  ? 17  DT  A C5    1 
ATOM   345  C  C7    . DT  A 1 17 ? 15.986 106.035 38.767 1.00 23.60  ? 17  DT  A C7    1 
ATOM   346  C  C6    . DT  A 1 17 ? 16.386 105.800 36.318 1.00 23.16  ? 17  DT  A C6    1 
ATOM   347  P  P     . DT  A 1 18 ? 14.994 107.561 30.304 1.00 31.83  ? 18  DT  A P     1 
ATOM   348  O  OP1   . DT  A 1 18 ? 15.485 108.018 28.987 1.00 30.27  ? 18  DT  A OP1   1 
ATOM   349  O  OP2   . DT  A 1 18 ? 14.031 108.392 31.064 1.00 31.50  ? 18  DT  A OP2   1 
ATOM   350  O  "O5'" . DT  A 1 18 ? 14.340 106.133 30.111 1.00 33.33  ? 18  DT  A "O5'" 1 
ATOM   351  C  "C5'" . DT  A 1 18 ? 14.518 105.165 31.119 1.00 39.20  ? 18  DT  A "C5'" 1 
ATOM   352  C  "C4'" . DT  A 1 18 ? 14.350 103.778 30.563 1.00 38.51  ? 18  DT  A "C4'" 1 
ATOM   353  O  "O4'" . DT  A 1 18 ? 14.663 102.885 31.647 1.00 37.68  ? 18  DT  A "O4'" 1 
ATOM   354  C  "C3'" . DT  A 1 18 ? 12.916 103.467 30.159 1.00 39.42  ? 18  DT  A "C3'" 1 
ATOM   355  O  "O3'" . DT  A 1 18 ? 12.904 102.539 29.077 1.00 41.97  ? 18  DT  A "O3'" 1 
ATOM   356  C  "C2'" . DT  A 1 18 ? 12.308 102.895 31.426 1.00 37.99  ? 18  DT  A "C2'" 1 
ATOM   357  C  "C1'" . DT  A 1 18 ? 13.495 102.271 32.153 1.00 36.40  ? 18  DT  A "C1'" 1 
ATOM   358  N  N1    . DT  A 1 18 ? 13.497 102.496 33.608 1.00 33.28  ? 18  DT  A N1    1 
ATOM   359  C  C2    . DT  A 1 18 ? 13.855 101.454 34.426 1.00 30.19  ? 18  DT  A C2    1 
ATOM   360  O  O2    . DT  A 1 18 ? 14.188 100.362 34.004 1.00 28.90  ? 18  DT  A O2    1 
ATOM   361  N  N3    . DT  A 1 18 ? 13.826 101.744 35.764 1.00 29.16  ? 18  DT  A N3    1 
ATOM   362  C  C4    . DT  A 1 18 ? 13.498 102.948 36.352 1.00 28.53  ? 18  DT  A C4    1 
ATOM   363  O  O4    . DT  A 1 18 ? 13.538 103.061 37.573 1.00 27.66  ? 18  DT  A O4    1 
ATOM   364  C  C5    . DT  A 1 18 ? 13.136 104.002 35.431 1.00 29.83  ? 18  DT  A C5    1 
ATOM   365  C  C7    . DT  A 1 18 ? 12.758 105.344 35.972 1.00 28.15  ? 18  DT  A C7    1 
ATOM   366  C  C6    . DT  A 1 18 ? 13.152 103.726 34.123 1.00 30.96  ? 18  DT  A C6    1 
ATOM   367  P  P     . DC  A 1 19 ? 11.515 102.162 28.377 1.00 45.69  ? 19  DC  A P     1 
ATOM   368  O  OP1   . DC  A 1 19 ? 11.840 101.851 26.964 1.00 44.16  ? 19  DC  A OP1   1 
ATOM   369  O  OP2   . DC  A 1 19 ? 10.515 103.210 28.686 1.00 43.41  ? 19  DC  A OP2   1 
ATOM   370  O  "O5'" . DC  A 1 19 ? 11.100 100.819 29.121 1.00 45.61  ? 19  DC  A "O5'" 1 
ATOM   371  C  "C5'" . DC  A 1 19 ? 11.988 99.706  29.128 1.00 48.11  ? 19  DC  A "C5'" 1 
ATOM   372  C  "C4'" . DC  A 1 19 ? 11.438 98.595  29.989 1.00 48.63  ? 19  DC  A "C4'" 1 
ATOM   373  O  "O4'" . DC  A 1 19 ? 11.622 98.895  31.394 1.00 48.22  ? 19  DC  A "O4'" 1 
ATOM   374  C  "C3'" . DC  A 1 19 ? 9.948  98.317  29.799 1.00 50.22  ? 19  DC  A "C3'" 1 
ATOM   375  O  "O3'" . DC  A 1 19 ? 9.735  96.905  29.773 1.00 54.07  ? 19  DC  A "O3'" 1 
ATOM   376  C  "C2'" . DC  A 1 19 ? 9.315  98.935  31.035 1.00 47.91  ? 19  DC  A "C2'" 1 
ATOM   377  C  "C1'" . DC  A 1 19 ? 10.394 98.722  32.082 1.00 45.97  ? 19  DC  A "C1'" 1 
ATOM   378  N  N1    . DC  A 1 19 ? 10.373 99.665  33.215 1.00 41.59  ? 19  DC  A N1    1 
ATOM   379  C  C2    . DC  A 1 19 ? 10.643 99.180  34.501 1.00 40.11  ? 19  DC  A C2    1 
ATOM   380  O  O2    . DC  A 1 19 ? 10.881 97.972  34.651 1.00 39.78  ? 19  DC  A O2    1 
ATOM   381  N  N3    . DC  A 1 19 ? 10.639 100.038 35.548 1.00 37.96  ? 19  DC  A N3    1 
ATOM   382  C  C4    . DC  A 1 19 ? 10.376 101.330 35.349 1.00 37.95  ? 19  DC  A C4    1 
ATOM   383  N  N4    . DC  A 1 19 ? 10.387 102.139 36.410 1.00 37.08  ? 19  DC  A N4    1 
ATOM   384  C  C5    . DC  A 1 19 ? 10.090 101.851 34.050 1.00 38.33  ? 19  DC  A C5    1 
ATOM   385  C  C6    . DC  A 1 19 ? 10.099 100.990 33.022 1.00 39.73  ? 19  DC  A C6    1 
ATOM   386  P  P     . DC  A 1 20 ? 8.316  96.320  29.303 1.00 57.95  ? 20  DC  A P     1 
ATOM   387  O  OP1   . DC  A 1 20 ? 8.574  95.334  28.223 1.00 57.83  ? 20  DC  A OP1   1 
ATOM   388  O  OP2   . DC  A 1 20 ? 7.386  97.451  29.065 1.00 56.35  ? 20  DC  A OP2   1 
ATOM   389  O  "O5'" . DC  A 1 20 ? 7.815  95.546  30.595 1.00 58.35  ? 20  DC  A "O5'" 1 
ATOM   390  C  "C5'" . DC  A 1 20 ? 8.088  96.079  31.880 1.00 62.03  ? 20  DC  A "C5'" 1 
ATOM   391  C  "C4'" . DC  A 1 20 ? 7.835  95.041  32.944 1.00 62.83  ? 20  DC  A "C4'" 1 
ATOM   392  O  "O4'" . DC  A 1 20 ? 8.233  95.616  34.206 1.00 61.78  ? 20  DC  A "O4'" 1 
ATOM   393  C  "C3'" . DC  A 1 20 ? 6.368  94.658  33.093 1.00 64.00  ? 20  DC  A "C3'" 1 
ATOM   394  O  "O3'" . DC  A 1 20 ? 6.245  93.281  33.454 1.00 67.77  ? 20  DC  A "O3'" 1 
ATOM   395  C  "C2'" . DC  A 1 20 ? 5.862  95.593  34.176 1.00 62.16  ? 20  DC  A "C2'" 1 
ATOM   396  C  "C1'" . DC  A 1 20 ? 7.101  95.933  34.999 1.00 59.54  ? 20  DC  A "C1'" 1 
ATOM   397  N  N1    . DC  A 1 20 ? 7.185  97.366  35.329 1.00 56.35  ? 20  DC  A N1    1 
ATOM   398  C  C2    . DC  A 1 20 ? 7.426  97.744  36.651 1.00 54.17  ? 20  DC  A C2    1 
ATOM   399  O  O2    . DC  A 1 20 ? 7.618  96.863  37.498 1.00 53.32  ? 20  DC  A O2    1 
ATOM   400  N  N3    . DC  A 1 20 ? 7.448  99.060  36.969 1.00 53.67  ? 20  DC  A N3    1 
ATOM   401  C  C4    . DC  A 1 20 ? 7.246  99.979  36.021 1.00 53.55  ? 20  DC  A C4    1 
ATOM   402  N  N4    . DC  A 1 20 ? 7.242  101.265 36.386 1.00 53.18  ? 20  DC  A N4    1 
ATOM   403  C  C5    . DC  A 1 20 ? 7.030  99.621  34.658 1.00 53.21  ? 20  DC  A C5    1 
ATOM   404  C  C6    . DC  A 1 20 ? 7.008  98.316  34.359 1.00 54.15  ? 20  DC  A C6    1 
ATOM   405  P  P     . DT  A 1 21 ? 4.817  92.696  33.893 1.00 70.47  ? 21  DT  A P     1 
ATOM   406  O  OP1   . DT  A 1 21 ? 4.816  91.243  33.587 1.00 70.92  ? 21  DT  A OP1   1 
ATOM   407  O  OP2   . DT  A 1 21 ? 3.752  93.567  33.330 1.00 70.38  ? 21  DT  A OP2   1 
ATOM   408  O  "O5'" . DT  A 1 21 ? 4.837  92.872  35.474 1.00 69.20  ? 21  DT  A "O5'" 1 
ATOM   409  C  "C5'" . DT  A 1 21 ? 3.709  92.546  36.272 1.00 68.55  ? 21  DT  A "C5'" 1 
ATOM   410  C  "C4'" . DT  A 1 21 ? 4.110  92.534  37.727 1.00 65.30  ? 21  DT  A "C4'" 1 
ATOM   411  O  "O4'" . DT  A 1 21 ? 4.829  93.757  38.008 1.00 65.07  ? 21  DT  A "O4'" 1 
ATOM   412  C  "C3'" . DT  A 1 21 ? 2.946  92.503  38.712 1.00 64.38  ? 21  DT  A "C3'" 1 
ATOM   413  O  "O3'" . DT  A 1 21 ? 3.401  91.985  39.963 1.00 61.51  ? 21  DT  A "O3'" 1 
ATOM   414  C  "C2'" . DT  A 1 21 ? 2.671  93.978  38.933 1.00 63.27  ? 21  DT  A "C2'" 1 
ATOM   415  C  "C1'" . DT  A 1 21 ? 4.070  94.578  38.884 1.00 64.24  ? 21  DT  A "C1'" 1 
ATOM   416  N  N1    . DT  A 1 21 ? 4.110  95.956  38.361 1.00 63.40  ? 21  DT  A N1    1 
ATOM   417  C  C2    . DT  A 1 21 ? 4.476  96.967  39.219 1.00 63.43  ? 21  DT  A C2    1 
ATOM   418  O  O2    . DT  A 1 21 ? 4.797  96.770  40.383 1.00 63.49  ? 21  DT  A O2    1 
ATOM   419  N  N3    . DT  A 1 21 ? 4.453  98.224  38.666 1.00 63.68  ? 21  DT  A N3    1 
ATOM   420  C  C4    . DT  A 1 21 ? 4.116  98.561  37.369 1.00 64.21  ? 21  DT  A C4    1 
ATOM   421  O  O4    . DT  A 1 21 ? 4.136  99.739  37.016 1.00 64.92  ? 21  DT  A O4    1 
ATOM   422  C  C5    . DT  A 1 21 ? 3.756  97.450  36.519 1.00 64.61  ? 21  DT  A C5    1 
ATOM   423  C  C7    . DT  A 1 21 ? 3.377  97.718  35.096 1.00 64.59  ? 21  DT  A C7    1 
ATOM   424  C  C6    . DT  A 1 21 ? 3.775  96.218  37.049 1.00 64.12  ? 21  DT  A C6    1 
ATOM   425  O  "O5'" . DT  B 2 1  ? -1.210 112.343 36.472 1.00 66.57  ? 1   DT  B "O5'" 1 
ATOM   426  C  "C5'" . DT  B 2 1  ? -1.765 111.134 36.992 1.00 68.68  ? 1   DT  B "C5'" 1 
ATOM   427  C  "C4'" . DT  B 2 1  ? -1.331 110.851 38.409 1.00 68.86  ? 1   DT  B "C4'" 1 
ATOM   428  O  "O4'" . DT  B 2 1  ? -1.876 109.567 38.805 1.00 66.95  ? 1   DT  B "O4'" 1 
ATOM   429  C  "C3'" . DT  B 2 1  ? 0.186  110.750 38.561 1.00 69.80  ? 1   DT  B "C3'" 1 
ATOM   430  O  "O3'" . DT  B 2 1  ? 0.653  111.442 39.723 1.00 74.00  ? 1   DT  B "O3'" 1 
ATOM   431  C  "C2'" . DT  B 2 1  ? 0.448  109.260 38.654 1.00 67.95  ? 1   DT  B "C2'" 1 
ATOM   432  C  "C1'" . DT  B 2 1  ? -0.843 108.696 39.227 1.00 64.62  ? 1   DT  B "C1'" 1 
ATOM   433  N  N1    . DT  B 2 1  ? -1.130 107.349 38.696 1.00 59.57  ? 1   DT  B N1    1 
ATOM   434  C  C2    . DT  B 2 1  ? -1.386 106.326 39.578 1.00 56.72  ? 1   DT  B C2    1 
ATOM   435  O  O2    . DT  B 2 1  ? -1.521 106.498 40.778 1.00 55.30  ? 1   DT  B O2    1 
ATOM   436  N  N3    . DT  B 2 1  ? -1.488 105.084 38.996 1.00 54.89  ? 1   DT  B N3    1 
ATOM   437  C  C4    . DT  B 2 1  ? -1.396 104.784 37.646 1.00 55.13  ? 1   DT  B C4    1 
ATOM   438  O  O4    . DT  B 2 1  ? -1.466 103.616 37.266 1.00 53.94  ? 1   DT  B O4    1 
ATOM   439  C  C5    . DT  B 2 1  ? -1.206 105.917 36.778 1.00 55.61  ? 1   DT  B C5    1 
ATOM   440  C  C7    . DT  B 2 1  ? -1.147 105.695 35.301 1.00 55.14  ? 1   DT  B C7    1 
ATOM   441  C  C6    . DT  B 2 1  ? -1.088 107.125 37.337 1.00 57.48  ? 1   DT  B C6    1 
ATOM   442  P  P     . DT  B 2 2  ? 2.121  112.104 39.712 1.00 77.18  ? 2   DT  B P     1 
ATOM   443  O  OP1   . DT  B 2 2  ? 2.041  113.503 40.211 1.00 77.28  ? 2   DT  B OP1   1 
ATOM   444  O  OP2   . DT  B 2 2  ? 2.696  111.832 38.368 1.00 76.82  ? 2   DT  B OP2   1 
ATOM   445  O  "O5'" . DT  B 2 2  ? 2.927  111.230 40.767 1.00 76.10  ? 2   DT  B "O5'" 1 
ATOM   446  C  "C5'" . DT  B 2 2  ? 2.785  109.820 40.760 1.00 76.74  ? 2   DT  B "C5'" 1 
ATOM   447  C  "C4'" . DT  B 2 2  ? 2.386  109.318 42.127 1.00 75.30  ? 2   DT  B "C4'" 1 
ATOM   448  O  "O4'" . DT  B 2 2  ? 1.537  108.166 41.939 1.00 74.43  ? 2   DT  B "O4'" 1 
ATOM   449  C  "C3'" . DT  B 2 2  ? 3.563  108.832 42.964 1.00 75.17  ? 2   DT  B "C3'" 1 
ATOM   450  O  "O3'" . DT  B 2 2  ? 3.272  108.949 44.369 1.00 76.49  ? 2   DT  B "O3'" 1 
ATOM   451  C  "C2'" . DT  B 2 2  ? 3.689  107.385 42.524 1.00 73.83  ? 2   DT  B "C2'" 1 
ATOM   452  C  "C1'" . DT  B 2 2  ? 2.249  106.974 42.234 1.00 71.95  ? 2   DT  B "C1'" 1 
ATOM   453  N  N1    . DT  B 2 2  ? 2.118  106.087 41.063 1.00 68.62  ? 2   DT  B N1    1 
ATOM   454  C  C2    . DT  B 2 2  ? 1.886  104.746 41.270 1.00 66.48  ? 2   DT  B C2    1 
ATOM   455  O  O2    . DT  B 2 2  ? 1.764  104.251 42.377 1.00 64.96  ? 2   DT  B O2    1 
ATOM   456  N  N3    . DT  B 2 2  ? 1.797  104.000 40.121 1.00 65.92  ? 2   DT  B N3    1 
ATOM   457  C  C4    . DT  B 2 2  ? 1.908  104.450 38.818 1.00 66.71  ? 2   DT  B C4    1 
ATOM   458  O  O4    . DT  B 2 2  ? 1.806  103.658 37.885 1.00 67.60  ? 2   DT  B O4    1 
ATOM   459  C  C5    . DT  B 2 2  ? 2.143  105.869 38.676 1.00 67.23  ? 2   DT  B C5    1 
ATOM   460  C  C7    . DT  B 2 2  ? 2.272  106.450 37.303 1.00 67.65  ? 2   DT  B C7    1 
ATOM   461  C  C6    . DT  B 2 2  ? 2.235  106.605 39.790 1.00 67.56  ? 2   DT  B C6    1 
ATOM   462  P  P     . DA  B 2 3  ? 4.477  109.114 45.431 1.00 78.09  ? 3   DA  B P     1 
ATOM   463  O  OP1   . DA  B 2 3  ? 4.012  109.944 46.572 1.00 78.88  ? 3   DA  B OP1   1 
ATOM   464  O  OP2   . DA  B 2 3  ? 5.686  109.521 44.672 1.00 78.97  ? 3   DA  B OP2   1 
ATOM   465  O  "O5'" . DA  B 2 3  ? 4.716  107.641 45.987 1.00 75.96  ? 3   DA  B "O5'" 1 
ATOM   466  C  "C5'" . DA  B 2 3  ? 4.377  106.511 45.199 1.00 74.09  ? 3   DA  B "C5'" 1 
ATOM   467  C  "C4'" . DA  B 2 3  ? 4.469  105.246 46.015 1.00 70.09  ? 3   DA  B "C4'" 1 
ATOM   468  O  "O4'" . DA  B 2 3  ? 4.030  104.153 45.180 1.00 67.39  ? 3   DA  B "O4'" 1 
ATOM   469  C  "C3'" . DA  B 2 3  ? 5.882  104.889 46.454 1.00 69.42  ? 3   DA  B "C3'" 1 
ATOM   470  O  "O3'" . DA  B 2 3  ? 5.832  104.200 47.707 1.00 71.08  ? 3   DA  B "O3'" 1 
ATOM   471  C  "C2'" . DA  B 2 3  ? 6.389  104.013 45.322 1.00 65.96  ? 3   DA  B "C2'" 1 
ATOM   472  C  "C1'" . DA  B 2 3  ? 5.129  103.346 44.782 1.00 62.24  ? 3   DA  B "C1'" 1 
ATOM   473  N  N9    . DA  B 2 3  ? 5.088  103.254 43.322 1.00 55.70  ? 3   DA  B N9    1 
ATOM   474  C  C8    . DA  B 2 3  ? 5.157  104.286 42.417 1.00 51.57  ? 3   DA  B C8    1 
ATOM   475  N  N7    . DA  B 2 3  ? 5.073  103.899 41.166 1.00 50.13  ? 3   DA  B N7    1 
ATOM   476  C  C5    . DA  B 2 3  ? 4.945  102.520 41.251 1.00 50.78  ? 3   DA  B C5    1 
ATOM   477  C  C6    . DA  B 2 3  ? 4.811  101.523 40.272 1.00 50.59  ? 3   DA  B C6    1 
ATOM   478  N  N6    . DA  B 2 3  ? 4.779  101.771 38.961 1.00 51.45  ? 3   DA  B N6    1 
ATOM   479  N  N1    . DA  B 2 3  ? 4.710  100.245 40.690 1.00 51.44  ? 3   DA  B N1    1 
ATOM   480  C  C2    . DA  B 2 3  ? 4.740  99.996  42.007 1.00 52.51  ? 3   DA  B C2    1 
ATOM   481  N  N3    . DA  B 2 3  ? 4.859  100.847 43.024 1.00 52.62  ? 3   DA  B N3    1 
ATOM   482  C  C4    . DA  B 2 3  ? 4.958  102.109 42.573 1.00 52.34  ? 3   DA  B C4    1 
ATOM   483  P  P     . DG  B 2 4  ? 7.185  103.642 48.367 1.00 73.26  ? 4   DG  B P     1 
ATOM   484  O  OP1   . DG  B 2 4  ? 6.884  103.181 49.743 1.00 73.67  ? 4   DG  B OP1   1 
ATOM   485  O  OP2   . DG  B 2 4  ? 8.266  104.637 48.147 1.00 73.45  ? 4   DG  B OP2   1 
ATOM   486  O  "O5'" . DG  B 2 4  ? 7.507  102.357 47.492 1.00 71.96  ? 4   DG  B "O5'" 1 
ATOM   487  C  "C5'" . DG  B 2 4  ? 8.809  101.801 47.470 1.00 70.98  ? 4   DG  B "C5'" 1 
ATOM   488  C  "C4'" . DG  B 2 4  ? 8.754  100.399 46.918 1.00 67.81  ? 4   DG  B "C4'" 1 
ATOM   489  O  "O4'" . DG  B 2 4  ? 8.064  100.412 45.645 1.00 65.66  ? 4   DG  B "O4'" 1 
ATOM   490  C  "C3'" . DG  B 2 4  ? 10.125 99.786  46.655 1.00 66.68  ? 4   DG  B "C3'" 1 
ATOM   491  O  "O3'" . DG  B 2 4  ? 10.100 98.398  46.976 1.00 67.01  ? 4   DG  B "O3'" 1 
ATOM   492  C  "C2'" . DG  B 2 4  ? 10.324 99.994  45.165 1.00 64.11  ? 4   DG  B "C2'" 1 
ATOM   493  C  "C1'" . DG  B 2 4  ? 8.906  99.898  44.624 1.00 60.93  ? 4   DG  B "C1'" 1 
ATOM   494  N  N9    . DG  B 2 4  ? 8.679  100.682 43.415 1.00 54.70  ? 4   DG  B N9    1 
ATOM   495  C  C8    . DG  B 2 4  ? 8.697  102.053 43.295 1.00 51.14  ? 4   DG  B C8    1 
ATOM   496  N  N7    . DG  B 2 4  ? 8.486  102.464 42.074 1.00 49.07  ? 4   DG  B N7    1 
ATOM   497  C  C5    . DG  B 2 4  ? 8.311  101.295 41.343 1.00 49.33  ? 4   DG  B C5    1 
ATOM   498  C  C6    . DG  B 2 4  ? 8.053  101.106 39.960 1.00 48.33  ? 4   DG  B C6    1 
ATOM   499  O  O6    . DG  B 2 4  ? 7.919  101.958 39.076 1.00 48.65  ? 4   DG  B O6    1 
ATOM   500  N  N1    . DG  B 2 4  ? 7.948  99.759  39.641 1.00 48.31  ? 4   DG  B N1    1 
ATOM   501  C  C2    . DG  B 2 4  ? 8.065  98.724  40.531 1.00 49.14  ? 4   DG  B C2    1 
ATOM   502  N  N2    . DG  B 2 4  ? 7.923  97.493  40.022 1.00 48.57  ? 4   DG  B N2    1 
ATOM   503  N  N3    . DG  B 2 4  ? 8.303  98.883  41.824 1.00 50.06  ? 4   DG  B N3    1 
ATOM   504  C  C4    . DG  B 2 4  ? 8.417  100.188 42.156 1.00 50.90  ? 4   DG  B C4    1 
ATOM   505  P  P     . DG  B 2 5  ? 11.475 97.623  47.252 1.00 67.78  ? 5   DG  B P     1 
ATOM   506  O  OP1   . DG  B 2 5  ? 11.502 97.249  48.687 1.00 68.61  ? 5   DG  B OP1   1 
ATOM   507  O  OP2   . DG  B 2 5  ? 12.583 98.429  46.679 1.00 67.75  ? 5   DG  B OP2   1 
ATOM   508  O  "O5'" . DG  B 2 5  ? 11.321 96.307  46.376 1.00 66.69  ? 5   DG  B "O5'" 1 
ATOM   509  C  "C5'" . DG  B 2 5  ? 10.801 96.404  45.061 1.00 65.21  ? 5   DG  B "C5'" 1 
ATOM   510  C  "C4'" . DG  B 2 5  ? 11.435 95.373  44.161 1.00 61.59  ? 5   DG  B "C4'" 1 
ATOM   511  O  "O4'" . DG  B 2 5  ? 11.151 95.789  42.808 1.00 59.38  ? 5   DG  B "O4'" 1 
ATOM   512  C  "C3'" . DG  B 2 5  ? 12.957 95.298  44.254 1.00 60.41  ? 5   DG  B "C3'" 1 
ATOM   513  O  "O3'" . DG  B 2 5  ? 13.388 93.974  43.933 1.00 60.11  ? 5   DG  B "O3'" 1 
ATOM   514  C  "C2'" . DG  B 2 5  ? 13.425 96.305  43.223 1.00 57.67  ? 5   DG  B "C2'" 1 
ATOM   515  C  "C1'" . DG  B 2 5  ? 12.318 96.300  42.179 1.00 54.77  ? 5   DG  B "C1'" 1 
ATOM   516  N  N9    . DG  B 2 5  ? 12.006 97.641  41.697 1.00 49.02  ? 5   DG  B N9    1 
ATOM   517  C  C8    . DG  B 2 5  ? 12.009 98.801  42.434 1.00 45.48  ? 5   DG  B C8    1 
ATOM   518  N  N7    . DG  B 2 5  ? 11.721 99.857  41.727 1.00 42.97  ? 5   DG  B N7    1 
ATOM   519  C  C5    . DG  B 2 5  ? 11.513 99.364  40.448 1.00 43.22  ? 5   DG  B C5    1 
ATOM   520  C  C6    . DG  B 2 5  ? 11.186 100.041 39.252 1.00 42.16  ? 5   DG  B C6    1 
ATOM   521  O  O6    . DG  B 2 5  ? 11.025 101.254 39.076 1.00 42.14  ? 5   DG  B O6    1 
ATOM   522  N  N1    . DG  B 2 5  ? 11.055 99.159  38.186 1.00 42.20  ? 5   DG  B N1    1 
ATOM   523  C  C2    . DG  B 2 5  ? 11.228 97.799  38.262 1.00 43.49  ? 5   DG  B C2    1 
ATOM   524  N  N2    . DG  B 2 5  ? 11.054 97.112  37.129 1.00 44.31  ? 5   DG  B N2    1 
ATOM   525  N  N3    . DG  B 2 5  ? 11.548 97.157  39.370 1.00 44.94  ? 5   DG  B N3    1 
ATOM   526  C  C4    . DG  B 2 5  ? 11.672 97.997  40.416 1.00 45.06  ? 5   DG  B C4    1 
ATOM   527  P  P     . DA  B 2 6  ? 14.956 93.631  43.874 1.00 60.62  ? 6   DA  B P     1 
ATOM   528  O  OP1   . DA  B 2 6  ? 15.126 92.309  44.527 1.00 60.43  ? 6   DA  B OP1   1 
ATOM   529  O  OP2   . DA  B 2 6  ? 15.757 94.792  44.348 1.00 59.83  ? 6   DA  B OP2   1 
ATOM   530  O  "O5'" . DA  B 2 6  ? 15.228 93.448  42.318 1.00 56.82  ? 6   DA  B "O5'" 1 
ATOM   531  C  "C5'" . DA  B 2 6  ? 14.396 92.601  41.532 1.00 52.61  ? 6   DA  B "C5'" 1 
ATOM   532  C  "C4'" . DA  B 2 6  ? 14.759 92.726  40.072 1.00 48.77  ? 6   DA  B "C4'" 1 
ATOM   533  O  "O4'" . DA  B 2 6  ? 14.368 94.030  39.578 1.00 46.55  ? 6   DA  B "O4'" 1 
ATOM   534  C  "C3'" . DA  B 2 6  ? 16.254 92.588  39.789 1.00 47.15  ? 6   DA  B "C3'" 1 
ATOM   535  O  "O3'" . DA  B 2 6  ? 16.452 91.799  38.610 1.00 45.80  ? 6   DA  B "O3'" 1 
ATOM   536  C  "C2'" . DA  B 2 6  ? 16.716 94.027  39.615 1.00 45.22  ? 6   DA  B "C2'" 1 
ATOM   537  C  "C1'" . DA  B 2 6  ? 15.487 94.719  39.041 1.00 43.42  ? 6   DA  B "C1'" 1 
ATOM   538  N  N9    . DA  B 2 6  ? 15.349 96.138  39.393 1.00 38.89  ? 6   DA  B N9    1 
ATOM   539  C  C8    . DA  B 2 6  ? 15.547 96.723  40.620 1.00 37.04  ? 6   DA  B C8    1 
ATOM   540  N  N7    . DA  B 2 6  ? 15.320 98.017  40.636 1.00 35.27  ? 6   DA  B N7    1 
ATOM   541  C  C5    . DA  B 2 6  ? 14.952 98.307  39.330 1.00 35.96  ? 6   DA  B C5    1 
ATOM   542  C  C6    . DA  B 2 6  ? 14.576 99.509  38.695 1.00 36.00  ? 6   DA  B C6    1 
ATOM   543  N  N6    . DA  B 2 6  ? 14.496 100.686 39.318 1.00 35.60  ? 6   DA  B N6    1 
ATOM   544  N  N1    . DA  B 2 6  ? 14.275 99.456  37.381 1.00 35.07  ? 6   DA  B N1    1 
ATOM   545  C  C2    . DA  B 2 6  ? 14.342 98.274  36.756 1.00 36.78  ? 6   DA  B C2    1 
ATOM   546  N  N3    . DA  B 2 6  ? 14.675 97.076  37.242 1.00 37.39  ? 6   DA  B N3    1 
ATOM   547  C  C4    . DA  B 2 6  ? 14.973 97.161  38.550 1.00 37.22  ? 6   DA  B C4    1 
ATOM   548  P  P     . DA  B 2 7  ? 17.887 91.128  38.322 1.00 44.73  ? 7   DA  B P     1 
ATOM   549  O  OP1   . DA  B 2 7  ? 17.703 89.680  38.026 1.00 45.61  ? 7   DA  B OP1   1 
ATOM   550  O  OP2   . DA  B 2 7  ? 18.846 91.555  39.377 1.00 42.85  ? 7   DA  B OP2   1 
ATOM   551  O  "O5'" . DA  B 2 7  ? 18.324 91.825  36.965 1.00 39.91  ? 7   DA  B "O5'" 1 
ATOM   552  C  "C5'" . DA  B 2 7  ? 17.941 93.158  36.733 1.00 36.49  ? 7   DA  B "C5'" 1 
ATOM   553  C  "C4'" . DA  B 2 7  ? 17.920 93.466  35.258 1.00 31.39  ? 7   DA  B "C4'" 1 
ATOM   554  O  "O4'" . DA  B 2 7  ? 17.422 94.812  35.174 1.00 29.28  ? 7   DA  B "O4'" 1 
ATOM   555  C  "C3'" . DA  B 2 7  ? 19.300 93.504  34.611 1.00 27.64  ? 7   DA  B "C3'" 1 
ATOM   556  O  "O3'" . DA  B 2 7  ? 19.176 93.288  33.203 1.00 23.80  ? 7   DA  B "O3'" 1 
ATOM   557  C  "C2'" . DA  B 2 7  ? 19.785 94.904  34.939 1.00 26.71  ? 7   DA  B "C2'" 1 
ATOM   558  C  "C1'" . DA  B 2 7  ? 18.498 95.724  35.028 1.00 27.68  ? 7   DA  B "C1'" 1 
ATOM   559  N  N9    . DA  B 2 7  ? 18.446 96.629  36.174 1.00 25.03  ? 7   DA  B N9    1 
ATOM   560  C  C8    . DA  B 2 7  ? 18.820 96.383  37.474 1.00 25.64  ? 7   DA  B C8    1 
ATOM   561  N  N7    . DA  B 2 7  ? 18.647 97.407  38.276 1.00 23.71  ? 7   DA  B N7    1 
ATOM   562  C  C5    . DA  B 2 7  ? 18.126 98.393  37.447 1.00 23.90  ? 7   DA  B C5    1 
ATOM   563  C  C6    . DA  B 2 7  ? 17.733 99.719  37.686 1.00 22.53  ? 7   DA  B C6    1 
ATOM   564  N  N6    . DA  B 2 7  ? 17.801 100.308 38.883 1.00 23.07  ? 7   DA  B N6    1 
ATOM   565  N  N1    . DA  B 2 7  ? 17.262 100.430 36.639 1.00 22.68  ? 7   DA  B N1    1 
ATOM   566  C  C2    . DA  B 2 7  ? 17.189 99.839  35.442 1.00 20.92  ? 7   DA  B C2    1 
ATOM   567  N  N3    . DA  B 2 7  ? 17.525 98.603  35.094 1.00 23.10  ? 7   DA  B N3    1 
ATOM   568  C  C4    . DA  B 2 7  ? 17.994 97.925  36.154 1.00 23.55  ? 7   DA  B C4    1 
ATOM   569  P  P     . DA  B 2 8  ? 20.475 93.363  32.260 1.00 21.39  ? 8   DA  B P     1 
ATOM   570  O  OP1   . DA  B 2 8  ? 20.136 92.686  30.984 1.00 21.87  ? 8   DA  B OP1   1 
ATOM   571  O  OP2   . DA  B 2 8  ? 21.669 92.924  33.037 1.00 22.73  ? 8   DA  B OP2   1 
ATOM   572  O  "O5'" . DA  B 2 8  ? 20.638 94.913  31.939 1.00 20.59  ? 8   DA  B "O5'" 1 
ATOM   573  C  "C5'" . DA  B 2 8  ? 19.591 95.622  31.285 1.00 21.04  ? 8   DA  B "C5'" 1 
ATOM   574  C  "C4'" . DA  B 2 8  ? 19.908 97.097  31.215 1.00 19.81  ? 8   DA  B "C4'" 1 
ATOM   575  O  "O4'" . DA  B 2 8  ? 19.802 97.711  32.524 1.00 20.13  ? 8   DA  B "O4'" 1 
ATOM   576  C  "C3'" . DA  B 2 8  ? 21.296 97.458  30.678 1.00 20.39  ? 8   DA  B "C3'" 1 
ATOM   577  O  "O3'" . DA  B 2 8  ? 21.132 98.498  29.706 1.00 19.28  ? 8   DA  B "O3'" 1 
ATOM   578  C  "C2'" . DA  B 2 8  ? 22.033 97.959  31.917 1.00 19.64  ? 8   DA  B "C2'" 1 
ATOM   579  C  "C1'" . DA  B 2 8  ? 20.899 98.591  32.709 1.00 20.50  ? 8   DA  B "C1'" 1 
ATOM   580  N  N9    . DA  B 2 8  ? 21.093 98.764  34.150 1.00 19.05  ? 8   DA  B N9    1 
ATOM   581  C  C8    . DA  B 2 8  ? 21.538 97.854  35.077 1.00 19.37  ? 8   DA  B C8    1 
ATOM   582  N  N7    . DA  B 2 8  ? 21.558 98.316  36.304 1.00 20.06  ? 8   DA  B N7    1 
ATOM   583  C  C5    . DA  B 2 8  ? 21.103 99.624  36.178 1.00 18.72  ? 8   DA  B C5    1 
ATOM   584  C  C6    . DA  B 2 8  ? 20.892 100.649 37.118 1.00 17.87  ? 8   DA  B C6    1 
ATOM   585  N  N6    . DA  B 2 8  ? 21.116 100.513 38.429 1.00 17.79  ? 8   DA  B N6    1 
ATOM   586  N  N1    . DA  B 2 8  ? 20.434 101.836 36.663 1.00 17.85  ? 8   DA  B N1    1 
ATOM   587  C  C2    . DA  B 2 8  ? 20.201 101.974 35.351 1.00 17.24  ? 8   DA  B C2    1 
ATOM   588  N  N3    . DA  B 2 8  ? 20.360 101.084 34.370 1.00 17.99  ? 8   DA  B N3    1 
ATOM   589  C  C4    . DA  B 2 8  ? 20.820 99.915  34.857 1.00 20.21  ? 8   DA  B C4    1 
ATOM   590  P  P     . DA  B 2 9  ? 22.283 98.793  28.629 1.00 21.34  ? 9   DA  B P     1 
ATOM   591  O  OP1   . DA  B 2 9  ? 21.660 99.050  27.320 1.00 20.10  ? 9   DA  B OP1   1 
ATOM   592  O  OP2   . DA  B 2 9  ? 23.412 97.835  28.749 1.00 22.68  ? 9   DA  B OP2   1 
ATOM   593  O  "O5'" . DA  B 2 9  ? 22.855 100.199 29.076 1.00 20.91  ? 9   DA  B "O5'" 1 
ATOM   594  C  "C5'" . DA  B 2 9  ? 22.768 100.578 30.412 1.00 25.84  ? 9   DA  B "C5'" 1 
ATOM   595  C  "C4'" . DA  B 2 9  ? 22.694 102.077 30.517 1.00 21.76  ? 9   DA  B "C4'" 1 
ATOM   596  O  "O4'" . DA  B 2 9  ? 22.445 102.291 31.914 1.00 20.86  ? 9   DA  B "O4'" 1 
ATOM   597  C  "C3'" . DA  B 2 9  ? 24.004 102.795 30.179 1.00 19.40  ? 9   DA  B "C3'" 1 
ATOM   598  O  "O3'" . DA  B 2 9  ? 23.756 104.038 29.493 1.00 16.57  ? 9   DA  B "O3'" 1 
ATOM   599  C  "C2'" . DA  B 2 9  ? 24.678 102.959 31.531 1.00 19.91  ? 9   DA  B "C2'" 1 
ATOM   600  C  "C1'" . DA  B 2 9  ? 23.526 102.952 32.530 1.00 18.88  ? 9   DA  B "C1'" 1 
ATOM   601  N  N9    . DA  B 2 9  ? 23.794 102.239 33.778 1.00 17.81  ? 9   DA  B N9    1 
ATOM   602  C  C8    . DA  B 2 9  ? 24.234 100.944 33.930 1.00 16.95  ? 9   DA  B C8    1 
ATOM   603  N  N7    . DA  B 2 9  ? 24.381 100.580 35.179 1.00 18.81  ? 9   DA  B N7    1 
ATOM   604  C  C5    . DA  B 2 9  ? 24.012 101.710 35.901 1.00 18.51  ? 9   DA  B C5    1 
ATOM   605  C  C6    . DA  B 2 9  ? 23.950 101.971 37.281 1.00 20.20  ? 9   DA  B C6    1 
ATOM   606  N  N6    . DA  B 2 9  ? 24.291 101.075 38.217 1.00 19.05  ? 9   DA  B N6    1 
ATOM   607  N  N1    . DA  B 2 9  ? 23.524 103.198 37.673 1.00 18.54  ? 9   DA  B N1    1 
ATOM   608  C  C2    . DA  B 2 9  ? 23.200 104.093 36.729 1.00 19.07  ? 9   DA  B C2    1 
ATOM   609  N  N3    . DA  B 2 9  ? 23.231 103.967 35.398 1.00 16.53  ? 9   DA  B N3    1 
ATOM   610  C  C4    . DA  B 2 9  ? 23.646 102.737 35.048 1.00 18.16  ? 9   DA  B C4    1 
ATOM   611  P  P     . DT  B 2 10 ? 24.983 104.995 29.078 1.00 19.24  ? 10  DT  B P     1 
ATOM   612  O  OP1   . DT  B 2 10 ? 24.513 105.902 27.998 1.00 17.86  ? 10  DT  B OP1   1 
ATOM   613  O  OP2   . DT  B 2 10 ? 26.245 104.229 28.882 1.00 17.15  ? 10  DT  B OP2   1 
ATOM   614  O  "O5'" . DT  B 2 10 ? 25.169 105.886 30.382 1.00 19.35  ? 10  DT  B "O5'" 1 
ATOM   615  C  "C5'" . DT  B 2 10 ? 24.035 106.526 30.956 1.00 20.75  ? 10  DT  B "C5'" 1 
ATOM   616  C  "C4'" . DT  B 2 10 ? 24.428 107.300 32.190 1.00 20.74  ? 10  DT  B "C4'" 1 
ATOM   617  O  "O4'" . DT  B 2 10 ? 24.598 106.411 33.320 1.00 18.82  ? 10  DT  B "O4'" 1 
ATOM   618  C  "C3'" . DT  B 2 10 ? 25.725 108.101 32.065 1.00 20.79  ? 10  DT  B "C3'" 1 
ATOM   619  O  "O3'" . DT  B 2 10 ? 25.489 109.450 32.498 1.00 23.52  ? 10  DT  B "O3'" 1 
ATOM   620  C  "C2'" . DT  B 2 10 ? 26.685 107.362 32.992 1.00 19.44  ? 10  DT  B "C2'" 1 
ATOM   621  C  "C1'" . DT  B 2 10 ? 25.740 106.816 34.042 1.00 18.85  ? 10  DT  B "C1'" 1 
ATOM   622  N  N1    . DT  B 2 10 ? 26.203 105.668 34.858 1.00 18.06  ? 10  DT  B N1    1 
ATOM   623  C  C2    . DT  B 2 10 ? 26.108 105.788 36.228 1.00 18.51  ? 10  DT  B C2    1 
ATOM   624  O  O2    . DT  B 2 10 ? 25.686 106.787 36.781 1.00 17.49  ? 10  DT  B O2    1 
ATOM   625  N  N3    . DT  B 2 10 ? 26.528 104.687 36.933 1.00 17.08  ? 10  DT  B N3    1 
ATOM   626  C  C4    . DT  B 2 10 ? 27.020 103.503 36.417 1.00 15.57  ? 10  DT  B C4    1 
ATOM   627  O  O4    . DT  B 2 10 ? 27.334 102.597 37.173 1.00 15.25  ? 10  DT  B O4    1 
ATOM   628  C  C5    . DT  B 2 10 ? 27.108 103.446 34.974 1.00 17.84  ? 10  DT  B C5    1 
ATOM   629  C  C7    . DT  B 2 10 ? 27.644 102.202 34.329 1.00 15.67  ? 10  DT  B C7    1 
ATOM   630  C  C6    . DT  B 2 10 ? 26.700 104.518 34.273 1.00 16.94  ? 10  DT  B C6    1 
ATOM   631  P  P     . DT  B 2 11 ? 26.579 110.596 32.188 1.00 24.86  ? 11  DT  B P     1 
ATOM   632  O  OP1   . DT  B 2 11 ? 25.852 111.827 31.839 1.00 27.33  ? 11  DT  B OP1   1 
ATOM   633  O  OP2   . DT  B 2 11 ? 27.651 110.092 31.292 1.00 22.27  ? 11  DT  B OP2   1 
ATOM   634  O  "O5'" . DT  B 2 11 ? 27.212 110.866 33.612 1.00 24.74  ? 11  DT  B "O5'" 1 
ATOM   635  C  "C5'" . DT  B 2 11 ? 27.265 109.829 34.546 1.00 28.54  ? 11  DT  B "C5'" 1 
ATOM   636  C  "C4'" . DT  B 2 11 ? 27.339 110.379 35.943 1.00 25.24  ? 11  DT  B "C4'" 1 
ATOM   637  O  "O4'" . DT  B 2 11 ? 27.440 109.200 36.761 1.00 23.44  ? 11  DT  B "O4'" 1 
ATOM   638  C  "C3'" . DT  B 2 11 ? 28.593 111.208 36.220 1.00 22.82  ? 11  DT  B "C3'" 1 
ATOM   639  O  "O3'" . DT  B 2 11 ? 28.305 112.237 37.184 1.00 26.23  ? 11  DT  B "O3'" 1 
ATOM   640  C  "C2'" . DT  B 2 11 ? 29.592 110.176 36.718 1.00 20.92  ? 11  DT  B "C2'" 1 
ATOM   641  C  "C1'" . DT  B 2 11 ? 28.724 109.088 37.339 1.00 22.12  ? 11  DT  B "C1'" 1 
ATOM   642  N  N1    . DT  B 2 11 ? 29.188 107.696 37.107 1.00 17.83  ? 11  DT  B N1    1 
ATOM   643  C  C2    . DT  B 2 11 ? 29.300 106.884 38.209 1.00 19.88  ? 11  DT  B C2    1 
ATOM   644  O  O2    . DT  B 2 11 ? 29.036 107.261 39.345 1.00 18.56  ? 11  DT  B O2    1 
ATOM   645  N  N3    . DT  B 2 11 ? 29.743 105.609 37.940 1.00 15.83  ? 11  DT  B N3    1 
ATOM   646  C  C4    . DT  B 2 11 ? 30.095 105.086 36.715 1.00 16.14  ? 11  DT  B C4    1 
ATOM   647  O  O4    . DT  B 2 11 ? 30.517 103.939 36.644 1.00 17.80  ? 11  DT  B O4    1 
ATOM   648  C  C5    . DT  B 2 11 ? 29.943 105.983 35.594 1.00 18.21  ? 11  DT  B C5    1 
ATOM   649  C  C7    . DT  B 2 11 ? 30.278 105.484 34.223 1.00 16.09  ? 11  DT  B C7    1 
ATOM   650  C  C6    . DT  B 2 11 ? 29.503 107.232 35.840 1.00 16.47  ? 11  DT  B C6    1 
ATOM   651  P  P     . DT  B 2 12 ? 29.287 113.512 37.326 1.00 26.08  ? 12  DT  B P     1 
ATOM   652  O  OP1   . DT  B 2 12 ? 28.454 114.699 37.656 1.00 27.06  ? 12  DT  B OP1   1 
ATOM   653  O  OP2   . DT  B 2 12 ? 30.255 113.575 36.213 1.00 24.25  ? 12  DT  B OP2   1 
ATOM   654  O  "O5'" . DT  B 2 12 ? 30.104 113.195 38.641 1.00 26.94  ? 12  DT  B "O5'" 1 
ATOM   655  C  "C5'" . DT  B 2 12 ? 30.181 111.882 39.110 1.00 30.11  ? 12  DT  B "C5'" 1 
ATOM   656  C  "C4'" . DT  B 2 12 ? 30.641 111.869 40.539 1.00 25.15  ? 12  DT  B "C4'" 1 
ATOM   657  O  "O4'" . DT  B 2 12 ? 30.802 110.470 40.826 1.00 23.47  ? 12  DT  B "O4'" 1 
ATOM   658  C  "C3'" . DT  B 2 12 ? 32.007 112.521 40.745 1.00 22.36  ? 12  DT  B "C3'" 1 
ATOM   659  O  "O3'" . DT  B 2 12 ? 32.058 113.171 42.021 1.00 21.25  ? 12  DT  B "O3'" 1 
ATOM   660  C  "C2'" . DT  B 2 12 ? 32.987 111.368 40.593 1.00 21.64  ? 12  DT  B "C2'" 1 
ATOM   661  C  "C1'" . DT  B 2 12 ? 32.168 110.123 40.936 1.00 21.88  ? 12  DT  B "C1'" 1 
ATOM   662  N  N1    . DT  B 2 12 ? 32.398 108.949 40.060 1.00 18.17  ? 12  DT  B N1    1 
ATOM   663  C  C2    . DT  B 2 12 ? 32.489 107.723 40.675 1.00 18.92  ? 12  DT  B C2    1 
ATOM   664  O  O2    . DT  B 2 12 ? 32.399 107.574 41.885 1.00 16.70  ? 12  DT  B O2    1 
ATOM   665  N  N3    . DT  B 2 12 ? 32.703 106.668 39.826 1.00 15.06  ? 12  DT  B N3    1 
ATOM   666  C  C4    . DT  B 2 12 ? 32.835 106.708 38.459 1.00 15.24  ? 12  DT  B C4    1 
ATOM   667  O  O4    . DT  B 2 12 ? 33.022 105.665 37.834 1.00 14.71  ? 12  DT  B O4    1 
ATOM   668  C  C5    . DT  B 2 12 ? 32.737 108.025 37.868 1.00 16.39  ? 12  DT  B C5    1 
ATOM   669  C  C7    . DT  B 2 12 ? 32.889 108.160 36.384 1.00 14.81  ? 12  DT  B C7    1 
ATOM   670  C  C6    . DT  B 2 12 ? 32.513 109.070 38.686 1.00 14.51  ? 12  DT  B C6    1 
ATOM   671  P  P     . DG  B 2 13 ? 33.324 114.095 42.410 1.00 18.78  ? 13  DG  B P     1 
ATOM   672  O  OP1   . DG  B 2 13 ? 32.832 115.098 43.383 1.00 20.48  ? 13  DG  B OP1   1 
ATOM   673  O  OP2   . DG  B 2 13 ? 34.067 114.539 41.220 1.00 18.22  ? 13  DG  B OP2   1 
ATOM   674  O  "O5'" . DG  B 2 13 ? 34.235 113.085 43.234 1.00 18.03  ? 13  DG  B "O5'" 1 
ATOM   675  C  "C5'" . DG  B 2 13 ? 33.689 112.438 44.373 1.00 19.88  ? 13  DG  B "C5'" 1 
ATOM   676  C  "C4'" . DG  B 2 13 ? 34.582 111.311 44.834 1.00 22.93  ? 13  DG  B "C4'" 1 
ATOM   677  O  "O4'" . DG  B 2 13 ? 34.572 110.212 43.889 1.00 21.15  ? 13  DG  B "O4'" 1 
ATOM   678  C  "C3'" . DG  B 2 13 ? 36.050 111.660 45.060 1.00 22.43  ? 13  DG  B "C3'" 1 
ATOM   679  O  "O3'" . DG  B 2 13 ? 36.443 111.039 46.283 1.00 25.33  ? 13  DG  B "O3'" 1 
ATOM   680  C  "C2'" . DG  B 2 13 ? 36.753 111.005 43.884 1.00 22.28  ? 13  DG  B "C2'" 1 
ATOM   681  C  "C1'" . DG  B 2 13 ? 35.898 109.768 43.697 1.00 20.05  ? 13  DG  B "C1'" 1 
ATOM   682  N  N9    . DG  B 2 13 ? 35.961 109.108 42.396 1.00 19.00  ? 13  DG  B N9    1 
ATOM   683  C  C8    . DG  B 2 13 ? 35.880 109.684 41.150 1.00 18.83  ? 13  DG  B C8    1 
ATOM   684  N  N7    . DG  B 2 13 ? 35.940 108.807 40.183 1.00 18.26  ? 13  DG  B N7    1 
ATOM   685  C  C5    . DG  B 2 13 ? 36.072 107.586 40.830 1.00 16.39  ? 13  DG  B C5    1 
ATOM   686  C  C6    . DG  B 2 13 ? 36.182 106.277 40.302 1.00 13.16  ? 13  DG  B C6    1 
ATOM   687  O  O6    . DG  B 2 13 ? 36.146 105.924 39.124 1.00 14.54  ? 13  DG  B O6    1 
ATOM   688  N  N1    . DG  B 2 13 ? 36.331 105.328 41.307 1.00 14.23  ? 13  DG  B N1    1 
ATOM   689  C  C2    . DG  B 2 13 ? 36.352 105.604 42.649 1.00 16.31  ? 13  DG  B C2    1 
ATOM   690  N  N2    . DG  B 2 13 ? 36.512 104.561 43.463 1.00 15.34  ? 13  DG  B N2    1 
ATOM   691  N  N3    . DG  B 2 13 ? 36.228 106.820 43.155 1.00 17.22  ? 13  DG  B N3    1 
ATOM   692  C  C4    . DG  B 2 13 ? 36.098 107.757 42.195 1.00 16.90  ? 13  DG  B C4    1 
ATOM   693  P  P     . DT  B 2 14 ? 37.935 111.211 46.830 1.00 29.60  ? 14  DT  B P     1 
ATOM   694  O  OP1   . DT  B 2 14 ? 37.785 111.676 48.231 1.00 29.68  ? 14  DT  B OP1   1 
ATOM   695  O  OP2   . DT  B 2 14 ? 38.763 111.980 45.875 1.00 28.83  ? 14  DT  B OP2   1 
ATOM   696  O  "O5'" . DT  B 2 14 ? 38.478 109.718 46.867 1.00 29.72  ? 14  DT  B "O5'" 1 
ATOM   697  C  "C5'" . DT  B 2 14 ? 37.693 108.696 47.468 1.00 28.11  ? 14  DT  B "C5'" 1 
ATOM   698  C  "C4'" . DT  B 2 14 ? 38.376 107.356 47.342 1.00 26.06  ? 14  DT  B "C4'" 1 
ATOM   699  O  "O4'" . DT  B 2 14 ? 38.321 106.863 45.981 1.00 25.80  ? 14  DT  B "O4'" 1 
ATOM   700  C  "C3'" . DT  B 2 14 ? 39.843 107.299 47.765 1.00 25.85  ? 14  DT  B "C3'" 1 
ATOM   701  O  "O3'" . DT  B 2 14 ? 40.000 106.112 48.545 1.00 27.78  ? 14  DT  B "O3'" 1 
ATOM   702  C  "C2'" . DT  B 2 14 ? 40.591 107.227 46.442 1.00 24.25  ? 14  DT  B "C2'" 1 
ATOM   703  C  "C1'" . DT  B 2 14 ? 39.617 106.467 45.556 1.00 22.91  ? 14  DT  B "C1'" 1 
ATOM   704  N  N1    . DT  B 2 14 ? 39.701 106.721 44.101 1.00 18.81  ? 14  DT  B N1    1 
ATOM   705  C  C2    . DT  B 2 14 ? 39.842 105.625 43.273 1.00 18.93  ? 14  DT  B C2    1 
ATOM   706  O  O2    . DT  B 2 14 ? 39.978 104.487 43.697 1.00 17.42  ? 14  DT  B O2    1 
ATOM   707  N  N3    . DT  B 2 14 ? 39.832 105.912 41.930 1.00 15.92  ? 14  DT  B N3    1 
ATOM   708  C  C4    . DT  B 2 14 ? 39.716 107.159 41.344 1.00 17.14  ? 14  DT  B C4    1 
ATOM   709  O  O4    . DT  B 2 14 ? 39.707 107.263 40.114 1.00 15.40  ? 14  DT  B O4    1 
ATOM   710  C  C5    . DT  B 2 14 ? 39.609 108.269 42.271 1.00 17.34  ? 14  DT  B C5    1 
ATOM   711  C  C7    . DT  B 2 14 ? 39.498 109.658 41.722 1.00 16.20  ? 14  DT  B C7    1 
ATOM   712  C  C6    . DT  B 2 14 ? 39.609 107.999 43.587 1.00 17.68  ? 14  DT  B C6    1 
ATOM   713  P  P     . DT  B 2 15 ? 41.426 105.738 49.185 1.00 29.39  ? 15  DT  B P     1 
ATOM   714  O  OP1   . DT  B 2 15 ? 41.119 105.181 50.518 1.00 27.55  ? 15  DT  B OP1   1 
ATOM   715  O  OP2   . DT  B 2 15 ? 42.399 106.838 49.043 1.00 26.35  ? 15  DT  B OP2   1 
ATOM   716  O  "O5'" . DT  B 2 15 ? 41.906 104.538 48.262 1.00 25.47  ? 15  DT  B "O5'" 1 
ATOM   717  C  "C5'" . DT  B 2 15 ? 41.065 103.415 48.085 1.00 22.78  ? 15  DT  B "C5'" 1 
ATOM   718  C  "C4'" . DT  B 2 15 ? 41.713 102.419 47.157 1.00 20.82  ? 15  DT  B "C4'" 1 
ATOM   719  O  "O4'" . DT  B 2 15 ? 41.693 102.912 45.794 1.00 17.28  ? 15  DT  B "O4'" 1 
ATOM   720  C  "C3'" . DT  B 2 15 ? 43.167 102.066 47.481 1.00 18.60  ? 15  DT  B "C3'" 1 
ATOM   721  O  "O3'" . DT  B 2 15 ? 43.264 100.640 47.487 1.00 21.74  ? 15  DT  B "O3'" 1 
ATOM   722  C  "C2'" . DT  B 2 15 ? 43.958 102.713 46.350 1.00 18.79  ? 15  DT  B "C2'" 1 
ATOM   723  C  "C1'" . DT  B 2 15 ? 42.962 102.723 45.193 1.00 18.28  ? 15  DT  B "C1'" 1 
ATOM   724  N  N1    . DT  B 2 15 ? 43.131 103.770 44.148 1.00 17.61  ? 15  DT  B N1    1 
ATOM   725  C  C2    . DT  B 2 15 ? 43.141 103.369 42.822 1.00 16.82  ? 15  DT  B C2    1 
ATOM   726  O  O2    . DT  B 2 15 ? 43.113 102.198 42.479 1.00 15.49  ? 15  DT  B O2    1 
ATOM   727  N  N3    . DT  B 2 15 ? 43.186 104.394 41.908 1.00 14.43  ? 15  DT  B N3    1 
ATOM   728  C  C4    . DT  B 2 15 ? 43.230 105.750 42.176 1.00 16.76  ? 15  DT  B C4    1 
ATOM   729  O  O4    . DT  B 2 15 ? 43.183 106.558 41.247 1.00 16.54  ? 15  DT  B O4    1 
ATOM   730  C  C5    . DT  B 2 15 ? 43.301 106.099 43.585 1.00 17.20  ? 15  DT  B C5    1 
ATOM   731  C  C7    . DT  B 2 15 ? 43.446 107.542 43.972 1.00 18.40  ? 15  DT  B C7    1 
ATOM   732  C  C6    . DT  B 2 15 ? 43.239 105.106 44.486 1.00 18.26  ? 15  DT  B C6    1 
ATOM   733  P  P     . DT  B 2 16 ? 44.677 99.914  47.726 1.00 21.97  ? 16  DT  B P     1 
ATOM   734  O  OP1   . DT  B 2 16 ? 44.346 98.648  48.432 1.00 21.81  ? 16  DT  B OP1   1 
ATOM   735  O  OP2   . DT  B 2 16 ? 45.679 100.848 48.307 1.00 22.15  ? 16  DT  B OP2   1 
ATOM   736  O  "O5'" . DT  B 2 16 ? 45.100 99.542  46.245 1.00 19.55  ? 16  DT  B "O5'" 1 
ATOM   737  C  "C5'" . DT  B 2 16 ? 44.176 98.848  45.418 1.00 18.54  ? 16  DT  B "C5'" 1 
ATOM   738  C  "C4'" . DT  B 2 16 ? 44.784 98.554  44.070 1.00 17.95  ? 16  DT  B "C4'" 1 
ATOM   739  O  "O4'" . DT  B 2 16 ? 44.799 99.732  43.232 1.00 16.34  ? 16  DT  B "O4'" 1 
ATOM   740  C  "C3'" . DT  B 2 16 ? 46.210 98.007  44.089 1.00 15.81  ? 16  DT  B "C3'" 1 
ATOM   741  O  "O3'" . DT  B 2 16 ? 46.222 96.834  43.283 1.00 17.09  ? 16  DT  B "O3'" 1 
ATOM   742  C  "C2'" . DT  B 2 16 ? 47.045 99.126  43.471 1.00 15.57  ? 16  DT  B "C2'" 1 
ATOM   743  C  "C1'" . DT  B 2 16 ? 46.047 99.841  42.567 1.00 15.63  ? 16  DT  B "C1'" 1 
ATOM   744  N  N1    . DT  B 2 16 ? 46.285 101.286 42.326 1.00 14.60  ? 16  DT  B N1    1 
ATOM   745  C  C2    . DT  B 2 16 ? 46.290 101.750 41.020 1.00 14.98  ? 16  DT  B C2    1 
ATOM   746  O  O2    . DT  B 2 16 ? 46.213 101.021 40.051 1.00 12.16  ? 16  DT  B O2    1 
ATOM   747  N  N3    . DT  B 2 16 ? 46.401 103.112 40.896 1.00 13.32  ? 16  DT  B N3    1 
ATOM   748  C  C4    . DT  B 2 16 ? 46.528 104.033 41.918 1.00 14.98  ? 16  DT  B C4    1 
ATOM   749  O  O4    . DT  B 2 16 ? 46.568 105.229 41.657 1.00 16.49  ? 16  DT  B O4    1 
ATOM   750  C  C5    . DT  B 2 16 ? 46.591 103.472 43.254 1.00 16.16  ? 16  DT  B C5    1 
ATOM   751  C  C7    . DT  B 2 16 ? 46.810 104.387 44.418 1.00 16.82  ? 16  DT  B C7    1 
ATOM   752  C  C6    . DT  B 2 16 ? 46.459 102.146 43.388 1.00 14.41  ? 16  DT  B C6    1 
ATOM   753  P  P     . DC  B 2 17 ? 47.575 95.999  43.097 1.00 17.92  ? 17  DC  B P     1 
ATOM   754  O  OP1   . DC  B 2 17 ? 47.139 94.590  42.965 1.00 17.22  ? 17  DC  B OP1   1 
ATOM   755  O  OP2   . DC  B 2 17 ? 48.578 96.378  44.120 1.00 16.15  ? 17  DC  B OP2   1 
ATOM   756  O  "O5'" . DC  B 2 17 ? 48.083 96.483  41.672 1.00 18.88  ? 17  DC  B "O5'" 1 
ATOM   757  C  "C5'" . DC  B 2 17 ? 47.199 96.399  40.565 1.00 19.12  ? 17  DC  B "C5'" 1 
ATOM   758  C  "C4'" . DC  B 2 17 ? 47.884 96.858  39.303 1.00 23.09  ? 17  DC  B "C4'" 1 
ATOM   759  O  "O4'" . DC  B 2 17 ? 47.952 98.302  39.278 1.00 22.82  ? 17  DC  B "O4'" 1 
ATOM   760  C  "C3'" . DC  B 2 17 ? 49.308 96.342  39.112 1.00 24.29  ? 17  DC  B "C3'" 1 
ATOM   761  O  "O3'" . DC  B 2 17 ? 49.419 95.814  37.795 1.00 29.33  ? 17  DC  B "O3'" 1 
ATOM   762  C  "C2'" . DC  B 2 17 ? 50.179 97.576  39.315 1.00 23.95  ? 17  DC  B "C2'" 1 
ATOM   763  C  "C1'" . DC  B 2 17 ? 49.261 98.727  38.927 1.00 22.38  ? 17  DC  B "C1'" 1 
ATOM   764  N  N1    . DC  B 2 17 ? 49.492 100.007 39.625 1.00 20.58  ? 17  DC  B N1    1 
ATOM   765  C  C2    . DC  B 2 17 ? 49.534 101.198 38.879 1.00 20.79  ? 17  DC  B C2    1 
ATOM   766  O  O2    . DC  B 2 17 ? 49.452 101.140 37.643 1.00 20.05  ? 17  DC  B O2    1 
ATOM   767  N  N3    . DC  B 2 17 ? 49.657 102.381 39.525 1.00 18.79  ? 17  DC  B N3    1 
ATOM   768  C  C4    . DC  B 2 17 ? 49.738 102.408 40.856 1.00 19.04  ? 17  DC  B C4    1 
ATOM   769  N  N4    . DC  B 2 17 ? 49.812 103.601 41.451 1.00 18.55  ? 17  DC  B N4    1 
ATOM   770  C  C5    . DC  B 2 17 ? 49.737 101.208 41.640 1.00 20.44  ? 17  DC  B C5    1 
ATOM   771  C  C6    . DC  B 2 17 ? 49.622 100.043 40.987 1.00 19.57  ? 17  DC  B C6    1 
ATOM   772  P  P     . DA  B 2 18 ? 50.742 95.021  37.356 1.00 34.15  ? 18  DA  B P     1 
ATOM   773  O  OP1   . DA  B 2 18 ? 50.278 93.928  36.473 1.00 33.86  ? 18  DA  B OP1   1 
ATOM   774  O  OP2   . DA  B 2 18 ? 51.576 94.709  38.534 1.00 34.29  ? 18  DA  B OP2   1 
ATOM   775  O  "O5'" . DA  B 2 18 ? 51.490 96.080  36.443 1.00 35.39  ? 18  DA  B "O5'" 1 
ATOM   776  C  "C5'" . DA  B 2 18 ? 50.793 96.680  35.358 1.00 37.61  ? 18  DA  B "C5'" 1 
ATOM   777  C  "C4'" . DA  B 2 18 ? 51.628 97.772  34.738 1.00 39.67  ? 18  DA  B "C4'" 1 
ATOM   778  O  "O4'" . DA  B 2 18 ? 51.660 98.932  35.603 1.00 38.87  ? 18  DA  B "O4'" 1 
ATOM   779  C  "C3'" . DA  B 2 18 ? 53.081 97.391  34.470 1.00 41.17  ? 18  DA  B "C3'" 1 
ATOM   780  O  "O3'" . DA  B 2 18 ? 53.446 97.920  33.195 1.00 44.33  ? 18  DA  B "O3'" 1 
ATOM   781  C  "C2'" . DA  B 2 18 ? 53.835 98.065  35.606 1.00 39.21  ? 18  DA  B "C2'" 1 
ATOM   782  C  "C1'" . DA  B 2 18 ? 53.001 99.314  35.851 1.00 36.46  ? 18  DA  B "C1'" 1 
ATOM   783  N  N9    . DA  B 2 18 ? 53.062 99.868  37.205 1.00 31.94  ? 18  DA  B N9    1 
ATOM   784  C  C8    . DA  B 2 18 ? 53.195 99.198  38.395 1.00 29.89  ? 18  DA  B C8    1 
ATOM   785  N  N7    . DA  B 2 18 ? 53.208 99.987  39.446 1.00 29.47  ? 18  DA  B N7    1 
ATOM   786  C  C5    . DA  B 2 18 ? 53.074 101.260 38.911 1.00 26.60  ? 18  DA  B C5    1 
ATOM   787  C  C6    . DA  B 2 18 ? 53.013 102.539 39.504 1.00 26.42  ? 18  DA  B C6    1 
ATOM   788  N  N6    . DA  B 2 18 ? 53.059 102.750 40.818 1.00 25.77  ? 18  DA  B N6    1 
ATOM   789  N  N1    . DA  B 2 18 ? 52.892 103.605 38.685 1.00 26.08  ? 18  DA  B N1    1 
ATOM   790  C  C2    . DA  B 2 18 ? 52.819 103.392 37.366 1.00 24.50  ? 18  DA  B C2    1 
ATOM   791  N  N3    . DA  B 2 18 ? 52.851 102.244 36.694 1.00 28.31  ? 18  DA  B N3    1 
ATOM   792  C  C4    . DA  B 2 18 ? 52.986 101.204 37.534 1.00 28.78  ? 18  DA  B C4    1 
ATOM   793  P  P     . DT  B 2 19 ? 54.875 97.572  32.556 1.00 45.72  ? 19  DT  B P     1 
ATOM   794  O  OP1   . DT  B 2 19 ? 54.618 97.060  31.187 1.00 47.51  ? 19  DT  B OP1   1 
ATOM   795  O  OP2   . DT  B 2 19 ? 55.688 96.771  33.506 1.00 44.66  ? 19  DT  B OP2   1 
ATOM   796  O  "O5'" . DT  B 2 19 ? 55.540 99.008  32.450 1.00 45.56  ? 19  DT  B "O5'" 1 
ATOM   797  C  "C5'" . DT  B 2 19 ? 55.339 99.934  33.499 1.00 45.25  ? 19  DT  B "C5'" 1 
ATOM   798  C  "C4'" . DT  B 2 19 ? 55.980 101.257 33.176 1.00 44.22  ? 19  DT  B "C4'" 1 
ATOM   799  O  "O4'" . DT  B 2 19 ? 55.789 102.086 34.340 1.00 42.99  ? 19  DT  B "O4'" 1 
ATOM   800  C  "C3'" . DT  B 2 19 ? 57.490 101.192 32.970 1.00 44.09  ? 19  DT  B "C3'" 1 
ATOM   801  O  "O3'" . DT  B 2 19 ? 57.880 102.343 32.220 1.00 45.92  ? 19  DT  B "O3'" 1 
ATOM   802  C  "C2'" . DT  B 2 19 ? 58.013 101.295 34.388 1.00 43.23  ? 19  DT  B "C2'" 1 
ATOM   803  C  "C1'" . DT  B 2 19 ? 57.018 102.259 35.022 1.00 42.17  ? 19  DT  B "C1'" 1 
ATOM   804  N  N1    . DT  B 2 19 ? 56.764 102.036 36.453 1.00 38.82  ? 19  DT  B N1    1 
ATOM   805  C  C2    . DT  B 2 19 ? 56.441 103.126 37.209 1.00 37.45  ? 19  DT  B C2    1 
ATOM   806  O  O2    . DT  B 2 19 ? 56.323 104.245 36.737 1.00 36.98  ? 19  DT  B O2    1 
ATOM   807  N  N3    . DT  B 2 19 ? 56.253 102.863 38.543 1.00 36.88  ? 19  DT  B N3    1 
ATOM   808  C  C4    . DT  B 2 19 ? 56.337 101.635 39.171 1.00 37.07  ? 19  DT  B C4    1 
ATOM   809  O  O4    . DT  B 2 19 ? 56.152 101.552 40.380 1.00 37.84  ? 19  DT  B O4    1 
ATOM   810  C  C5    . DT  B 2 19 ? 56.652 100.524 38.307 1.00 38.33  ? 19  DT  B C5    1 
ATOM   811  C  C7    . DT  B 2 19 ? 56.734 99.148  38.892 1.00 39.55  ? 19  DT  B C7    1 
ATOM   812  C  C6    . DT  B 2 19 ? 56.851 100.776 37.009 1.00 39.02  ? 19  DT  B C6    1 
ATOM   813  P  P     . DA  B 2 20 ? 59.071 102.250 31.148 1.00 47.21  ? 20  DA  B P     1 
ATOM   814  O  OP1   . DA  B 2 20 ? 58.511 101.634 29.922 1.00 45.85  ? 20  DA  B OP1   1 
ATOM   815  O  OP2   . DA  B 2 20 ? 60.286 101.669 31.781 1.00 46.72  ? 20  DA  B OP2   1 
ATOM   816  O  "O5'" . DA  B 2 20 ? 59.342 103.777 30.810 1.00 45.62  ? 20  DA  B "O5'" 1 
ATOM   817  C  "C5'" . DA  B 2 20 ? 58.261 104.621 30.438 1.00 45.94  ? 20  DA  B "C5'" 1 
ATOM   818  C  "C4'" . DA  B 2 20 ? 58.358 105.942 31.161 1.00 44.80  ? 20  DA  B "C4'" 1 
ATOM   819  O  "O4'" . DA  B 2 20 ? 58.182 105.750 32.586 1.00 44.34  ? 20  DA  B "O4'" 1 
ATOM   820  C  "C3'" . DA  B 2 20 ? 59.695 106.650 30.992 1.00 44.43  ? 20  DA  B "C3'" 1 
ATOM   821  O  "O3'" . DA  B 2 20 ? 59.452 108.045 30.820 1.00 45.60  ? 20  DA  B "O3'" 1 
ATOM   822  C  "C2'" . DA  B 2 20 ? 60.437 106.337 32.284 1.00 43.33  ? 20  DA  B "C2'" 1 
ATOM   823  C  "C1'" . DA  B 2 20 ? 59.317 106.216 33.306 1.00 41.90  ? 20  DA  B "C1'" 1 
ATOM   824  N  N9    . DA  B 2 20 ? 59.560 105.264 34.394 1.00 39.80  ? 20  DA  B N9    1 
ATOM   825  C  C8    . DA  B 2 20 ? 59.838 103.924 34.280 1.00 38.70  ? 20  DA  B C8    1 
ATOM   826  N  N7    . DA  B 2 20 ? 59.930 103.302 35.430 1.00 38.24  ? 20  DA  B N7    1 
ATOM   827  C  C5    . DA  B 2 20 ? 59.713 104.301 36.369 1.00 37.54  ? 20  DA  B C5    1 
ATOM   828  C  C6    . DA  B 2 20 ? 59.656 104.280 37.775 1.00 37.36  ? 20  DA  B C6    1 
ATOM   829  N  N6    . DA  B 2 20 ? 59.793 103.171 38.507 1.00 36.34  ? 20  DA  B N6    1 
ATOM   830  N  N1    . DA  B 2 20 ? 59.438 105.451 38.412 1.00 36.47  ? 20  DA  B N1    1 
ATOM   831  C  C2    . DA  B 2 20 ? 59.273 106.557 37.675 1.00 38.27  ? 20  DA  B C2    1 
ATOM   832  N  N3    . DA  B 2 20 ? 59.286 106.700 36.348 1.00 37.76  ? 20  DA  B N3    1 
ATOM   833  C  C4    . DA  B 2 20 ? 59.512 105.520 35.747 1.00 38.02  ? 20  DA  B C4    1 
ATOM   834  P  P     . DG  B 2 21 ? 60.686 109.052 30.673 1.00 46.15  ? 21  DG  B P     1 
ATOM   835  O  OP1   . DG  B 2 21 ? 60.172 110.317 30.094 1.00 46.11  ? 21  DG  B OP1   1 
ATOM   836  O  OP2   . DG  B 2 21 ? 61.793 108.334 30.003 1.00 43.90  ? 21  DG  B OP2   1 
ATOM   837  O  "O5'" . DG  B 2 21 ? 61.080 109.328 32.185 1.00 45.57  ? 21  DG  B "O5'" 1 
ATOM   838  C  "C5'" . DG  B 2 21 ? 62.360 109.807 32.530 1.00 47.11  ? 21  DG  B "C5'" 1 
ATOM   839  C  "C4'" . DG  B 2 21 ? 62.359 110.253 33.970 1.00 46.49  ? 21  DG  B "C4'" 1 
ATOM   840  O  "O4'" . DG  B 2 21 ? 61.935 109.148 34.811 1.00 46.47  ? 21  DG  B "O4'" 1 
ATOM   841  C  "C3'" . DG  B 2 21 ? 63.740 110.656 34.476 1.00 46.16  ? 21  DG  B "C3'" 1 
ATOM   842  O  "O3'" . DG  B 2 21 ? 63.538 111.610 35.516 1.00 48.74  ? 21  DG  B "O3'" 1 
ATOM   843  C  "C2'" . DG  B 2 21 ? 64.247 109.366 35.091 1.00 46.30  ? 21  DG  B "C2'" 1 
ATOM   844  C  "C1'" . DG  B 2 21 ? 62.977 108.832 35.723 1.00 44.25  ? 21  DG  B "C1'" 1 
ATOM   845  N  N9    . DG  B 2 21 ? 62.972 107.388 35.961 1.00 41.85  ? 21  DG  B N9    1 
ATOM   846  C  C8    . DG  B 2 21 ? 63.090 106.383 35.034 1.00 40.33  ? 21  DG  B C8    1 
ATOM   847  N  N7    . DG  B 2 21 ? 63.079 105.190 35.572 1.00 39.35  ? 21  DG  B N7    1 
ATOM   848  C  C5    . DG  B 2 21 ? 62.940 105.427 36.931 1.00 38.60  ? 21  DG  B C5    1 
ATOM   849  C  C6    . DG  B 2 21 ? 62.873 104.520 38.030 1.00 38.14  ? 21  DG  B C6    1 
ATOM   850  O  O6    . DG  B 2 21 ? 62.920 103.283 38.016 1.00 37.46  ? 21  DG  B O6    1 
ATOM   851  N  N1    . DG  B 2 21 ? 62.735 105.192 39.237 1.00 37.40  ? 21  DG  B N1    1 
ATOM   852  C  C2    . DG  B 2 21 ? 62.667 106.553 39.381 1.00 37.17  ? 21  DG  B C2    1 
ATOM   853  N  N2    . DG  B 2 21 ? 62.525 107.012 40.632 1.00 36.90  ? 21  DG  B N2    1 
ATOM   854  N  N3    . DG  B 2 21 ? 62.730 107.405 38.373 1.00 39.23  ? 21  DG  B N3    1 
ATOM   855  C  C4    . DG  B 2 21 ? 62.866 106.780 37.190 1.00 39.20  ? 21  DG  B C4    1 
ATOM   856  O  "O5'" . DA  C 1 1  ? 51.123 80.791  17.694 1.00 69.60  ? 1   DA  C "O5'" 1 
ATOM   857  C  "C5'" . DA  C 1 1  ? 50.684 81.501  16.533 1.00 71.01  ? 1   DA  C "C5'" 1 
ATOM   858  C  "C4'" . DA  C 1 1  ? 50.137 80.579  15.468 1.00 71.49  ? 1   DA  C "C4'" 1 
ATOM   859  O  "O4'" . DA  C 1 1  ? 51.152 79.609  15.113 1.00 69.82  ? 1   DA  C "O4'" 1 
ATOM   860  C  "C3'" . DA  C 1 1  ? 48.914 79.770  15.903 1.00 72.33  ? 1   DA  C "C3'" 1 
ATOM   861  O  "O3'" . DA  C 1 1  ? 47.993 79.611  14.818 1.00 74.85  ? 1   DA  C "O3'" 1 
ATOM   862  C  "C2'" . DA  C 1 1  ? 49.502 78.429  16.296 1.00 70.92  ? 1   DA  C "C2'" 1 
ATOM   863  C  "C1'" . DA  C 1 1  ? 50.675 78.291  15.342 1.00 67.85  ? 1   DA  C "C1'" 1 
ATOM   864  N  N9    . DA  C 1 1  ? 51.781 77.501  15.882 1.00 62.77  ? 1   DA  C N9    1 
ATOM   865  C  C8    . DA  C 1 1  ? 52.936 77.946  16.478 1.00 60.25  ? 1   DA  C C8    1 
ATOM   866  N  N7    . DA  C 1 1  ? 53.734 76.982  16.870 1.00 57.86  ? 1   DA  C N7    1 
ATOM   867  C  C5    . DA  C 1 1  ? 53.059 75.825  16.507 1.00 58.48  ? 1   DA  C C5    1 
ATOM   868  C  C6    . DA  C 1 1  ? 53.371 74.467  16.656 1.00 57.81  ? 1   DA  C C6    1 
ATOM   869  N  N6    . DA  C 1 1  ? 54.492 74.025  17.236 1.00 57.93  ? 1   DA  C N6    1 
ATOM   870  N  N1    . DA  C 1 1  ? 52.481 73.564  16.187 1.00 57.88  ? 1   DA  C N1    1 
ATOM   871  C  C2    . DA  C 1 1  ? 51.355 74.010  15.612 1.00 58.08  ? 1   DA  C C2    1 
ATOM   872  N  N3    . DA  C 1 1  ? 50.949 75.261  15.418 1.00 58.68  ? 1   DA  C N3    1 
ATOM   873  C  C4    . DA  C 1 1  ? 51.857 76.130  15.894 1.00 59.62  ? 1   DA  C C4    1 
ATOM   874  P  P     . DA  C 1 2  ? 46.449 79.294  15.131 1.00 76.91  ? 2   DA  C P     1 
ATOM   875  O  OP1   . DA  C 1 2  ? 45.891 78.535  13.983 1.00 77.34  ? 2   DA  C OP1   1 
ATOM   876  O  OP2   . DA  C 1 2  ? 45.787 80.549  15.573 1.00 77.77  ? 2   DA  C OP2   1 
ATOM   877  O  "O5'" . DA  C 1 2  ? 46.526 78.298  16.370 1.00 75.38  ? 2   DA  C "O5'" 1 
ATOM   878  C  "C5'" . DA  C 1 2  ? 45.346 77.795  16.986 1.00 72.87  ? 2   DA  C "C5'" 1 
ATOM   879  C  "C4'" . DA  C 1 2  ? 45.096 76.377  16.531 1.00 69.33  ? 2   DA  C "C4'" 1 
ATOM   880  O  "O4'" . DA  C 1 2  ? 46.356 75.677  16.429 1.00 66.64  ? 2   DA  C "O4'" 1 
ATOM   881  C  "C3'" . DA  C 1 2  ? 44.233 75.556  17.482 1.00 68.33  ? 2   DA  C "C3'" 1 
ATOM   882  O  "O3'" . DA  C 1 2  ? 43.431 74.636  16.736 1.00 69.20  ? 2   DA  C "O3'" 1 
ATOM   883  C  "C2'" . DA  C 1 2  ? 45.261 74.841  18.342 1.00 65.89  ? 2   DA  C "C2'" 1 
ATOM   884  C  "C1'" . DA  C 1 2  ? 46.423 74.627  17.382 1.00 63.02  ? 2   DA  C "C1'" 1 
ATOM   885  N  N9    . DA  C 1 2  ? 47.749 74.691  18.000 1.00 58.33  ? 2   DA  C N9    1 
ATOM   886  C  C8    . DA  C 1 2  ? 48.373 75.797  18.523 1.00 55.63  ? 2   DA  C C8    1 
ATOM   887  N  N7    . DA  C 1 2  ? 49.582 75.559  18.975 1.00 54.14  ? 2   DA  C N7    1 
ATOM   888  C  C5    . DA  C 1 2  ? 49.762 74.204  18.742 1.00 54.49  ? 2   DA  C C5    1 
ATOM   889  C  C6    . DA  C 1 2  ? 50.838 73.340  18.989 1.00 54.12  ? 2   DA  C C6    1 
ATOM   890  N  N6    . DA  C 1 2  ? 51.989 73.732  19.545 1.00 54.28  ? 2   DA  C N6    1 
ATOM   891  N  N1    . DA  C 1 2  ? 50.697 72.043  18.641 1.00 54.27  ? 2   DA  C N1    1 
ATOM   892  C  C2    . DA  C 1 2  ? 49.546 71.653  18.078 1.00 54.93  ? 2   DA  C C2    1 
ATOM   893  N  N3    . DA  C 1 2  ? 48.463 72.371  17.792 1.00 55.07  ? 2   DA  C N3    1 
ATOM   894  C  C4    . DA  C 1 2  ? 48.637 73.652  18.151 1.00 55.70  ? 2   DA  C C4    1 
ATOM   895  P  P     . DC  C 1 3  ? 42.159 73.944  17.430 1.00 70.40  ? 3   DC  C P     1 
ATOM   896  O  OP1   . DC  C 1 3  ? 40.978 74.165  16.556 1.00 70.87  ? 3   DC  C OP1   1 
ATOM   897  O  OP2   . DC  C 1 3  ? 42.115 74.377  18.851 1.00 70.84  ? 3   DC  C OP2   1 
ATOM   898  O  "O5'" . DC  C 1 3  ? 42.527 72.398  17.397 1.00 69.31  ? 3   DC  C "O5'" 1 
ATOM   899  C  "C5'" . DC  C 1 3  ? 43.838 71.971  17.742 1.00 67.69  ? 3   DC  C "C5'" 1 
ATOM   900  C  "C4'" . DC  C 1 3  ? 43.785 70.647  18.462 1.00 64.83  ? 3   DC  C "C4'" 1 
ATOM   901  O  "O4'" . DC  C 1 3  ? 45.124 70.352  18.923 1.00 63.42  ? 3   DC  C "O4'" 1 
ATOM   902  C  "C3'" . DC  C 1 3  ? 42.901 70.654  19.706 1.00 63.76  ? 3   DC  C "C3'" 1 
ATOM   903  O  "O3'" . DC  C 1 3  ? 42.237 69.393  19.848 1.00 63.77  ? 3   DC  C "O3'" 1 
ATOM   904  C  "C2'" . DC  C 1 3  ? 43.872 70.942  20.836 1.00 62.09  ? 3   DC  C "C2'" 1 
ATOM   905  C  "C1'" . DC  C 1 3  ? 45.193 70.375  20.341 1.00 60.26  ? 3   DC  C "C1'" 1 
ATOM   906  N  N1    . DC  C 1 3  ? 46.354 71.202  20.719 1.00 56.55  ? 3   DC  C N1    1 
ATOM   907  C  C2    . DC  C 1 3  ? 47.589 70.582  20.936 1.00 54.29  ? 3   DC  C C2    1 
ATOM   908  O  O2    . DC  C 1 3  ? 47.685 69.359  20.767 1.00 54.37  ? 3   DC  C O2    1 
ATOM   909  N  N3    . DC  C 1 3  ? 48.646 71.331  21.318 1.00 52.60  ? 3   DC  C N3    1 
ATOM   910  C  C4    . DC  C 1 3  ? 48.507 72.648  21.480 1.00 52.18  ? 3   DC  C C4    1 
ATOM   911  N  N4    . DC  C 1 3  ? 49.576 73.345  21.871 1.00 52.04  ? 3   DC  C N4    1 
ATOM   912  C  C5    . DC  C 1 3  ? 47.267 73.309  21.250 1.00 53.20  ? 3   DC  C C5    1 
ATOM   913  C  C6    . DC  C 1 3  ? 46.228 72.556  20.872 1.00 54.85  ? 3   DC  C C6    1 
ATOM   914  P  P     . DT  C 1 4  ? 41.740 68.902  21.296 1.00 64.82  ? 4   DT  C P     1 
ATOM   915  O  OP1   . DT  C 1 4  ? 40.616 67.956  21.087 1.00 64.92  ? 4   DT  C OP1   1 
ATOM   916  O  OP2   . DT  C 1 4  ? 41.556 70.072  22.193 1.00 64.03  ? 4   DT  C OP2   1 
ATOM   917  O  "O5'" . DT  C 1 4  ? 42.977 68.050  21.815 1.00 63.59  ? 4   DT  C "O5'" 1 
ATOM   918  C  "C5'" . DT  C 1 4  ? 43.514 67.008  21.006 1.00 61.52  ? 4   DT  C "C5'" 1 
ATOM   919  C  "C4'" . DT  C 1 4  ? 44.247 66.011  21.868 1.00 59.06  ? 4   DT  C "C4'" 1 
ATOM   920  O  "O4'" . DT  C 1 4  ? 45.488 66.589  22.330 1.00 57.09  ? 4   DT  C "O4'" 1 
ATOM   921  C  "C3'" . DT  C 1 4  ? 43.479 65.602  23.120 1.00 58.94  ? 4   DT  C "C3'" 1 
ATOM   922  O  "O3'" . DT  C 1 4  ? 43.710 64.219  23.389 1.00 60.19  ? 4   DT  C "O3'" 1 
ATOM   923  C  "C2'" . DT  C 1 4  ? 44.053 66.506  24.198 1.00 56.16  ? 4   DT  C "C2'" 1 
ATOM   924  C  "C1'" . DT  C 1 4  ? 45.489 66.722  23.744 1.00 53.47  ? 4   DT  C "C1'" 1 
ATOM   925  N  N1    . DT  C 1 4  ? 46.039 68.055  24.051 1.00 48.72  ? 4   DT  C N1    1 
ATOM   926  C  C2    . DT  C 1 4  ? 47.342 68.134  24.480 1.00 45.65  ? 4   DT  C C2    1 
ATOM   927  O  O2    . DT  C 1 4  ? 48.042 67.153  24.669 1.00 44.43  ? 4   DT  C O2    1 
ATOM   928  N  N3    . DT  C 1 4  ? 47.800 69.409  24.680 1.00 42.98  ? 4   DT  C N3    1 
ATOM   929  C  C4    . DT  C 1 4  ? 47.101 70.587  24.503 1.00 43.11  ? 4   DT  C C4    1 
ATOM   930  O  O4    . DT  C 1 4  ? 47.662 71.667  24.681 1.00 40.92  ? 4   DT  C O4    1 
ATOM   931  C  C5    . DT  C 1 4  ? 45.727 70.431  24.094 1.00 43.59  ? 4   DT  C C5    1 
ATOM   932  C  C7    . DT  C 1 4  ? 44.880 71.655  23.925 1.00 43.22  ? 4   DT  C C7    1 
ATOM   933  C  C6    . DT  C 1 4  ? 45.270 69.191  23.889 1.00 46.32  ? 4   DT  C C6    1 
ATOM   934  P  P     . DA  C 1 5  ? 43.209 63.578  24.771 1.00 62.18  ? 5   DA  C P     1 
ATOM   935  O  OP1   . DA  C 1 5  ? 42.914 62.148  24.507 1.00 62.37  ? 5   DA  C OP1   1 
ATOM   936  O  OP2   . DA  C 1 5  ? 42.160 64.447  25.367 1.00 61.53  ? 5   DA  C OP2   1 
ATOM   937  O  "O5'" . DA  C 1 5  ? 44.512 63.649  25.681 1.00 59.67  ? 5   DA  C "O5'" 1 
ATOM   938  C  "C5'" . DA  C 1 5  ? 45.737 63.084  25.224 1.00 56.45  ? 5   DA  C "C5'" 1 
ATOM   939  C  "C4'" . DA  C 1 5  ? 46.756 63.087  26.337 1.00 53.66  ? 5   DA  C "C4'" 1 
ATOM   940  O  "O4'" . DA  C 1 5  ? 47.226 64.435  26.567 1.00 51.88  ? 5   DA  C "O4'" 1 
ATOM   941  C  "C3'" . DA  C 1 5  ? 46.211 62.592  27.672 1.00 52.44  ? 5   DA  C "C3'" 1 
ATOM   942  O  "O3'" . DA  C 1 5  ? 47.206 61.815  28.339 1.00 52.87  ? 5   DA  C "O3'" 1 
ATOM   943  C  "C2'" . DA  C 1 5  ? 45.891 63.873  28.423 1.00 50.44  ? 5   DA  C "C2'" 1 
ATOM   944  C  "C1'" . DA  C 1 5  ? 46.921 64.856  27.889 1.00 48.34  ? 5   DA  C "C1'" 1 
ATOM   945  N  N9    . DA  C 1 5  ? 46.443 66.237  27.802 1.00 44.45  ? 5   DA  C N9    1 
ATOM   946  C  C8    . DA  C 1 5  ? 45.176 66.666  27.484 1.00 42.42  ? 5   DA  C C8    1 
ATOM   947  N  N7    . DA  C 1 5  ? 45.056 67.972  27.445 1.00 40.78  ? 5   DA  C N7    1 
ATOM   948  C  C5    . DA  C 1 5  ? 46.325 68.433  27.769 1.00 40.22  ? 5   DA  C C5    1 
ATOM   949  C  C6    . DA  C 1 5  ? 46.858 69.730  27.894 1.00 38.83  ? 5   DA  C C6    1 
ATOM   950  N  N6    . DA  C 1 5  ? 46.152 70.847  27.695 1.00 37.89  ? 5   DA  C N6    1 
ATOM   951  N  N1    . DA  C 1 5  ? 48.160 69.842  28.231 1.00 38.35  ? 5   DA  C N1    1 
ATOM   952  C  C2    . DA  C 1 5  ? 48.870 68.724  28.425 1.00 39.10  ? 5   DA  C C2    1 
ATOM   953  N  N3    . DA  C 1 5  ? 48.484 67.455  28.336 1.00 39.68  ? 5   DA  C N3    1 
ATOM   954  C  C4    . DA  C 1 5  ? 47.187 67.376  28.000 1.00 40.78  ? 5   DA  C C4    1 
ATOM   955  P  P     . DT  C 1 6  ? 46.903 61.212  29.792 1.00 52.58  ? 6   DT  C P     1 
ATOM   956  O  OP1   . DT  C 1 6  ? 47.695 59.963  29.924 1.00 53.77  ? 6   DT  C OP1   1 
ATOM   957  O  OP2   . DT  C 1 6  ? 45.436 61.182  30.018 1.00 52.81  ? 6   DT  C OP2   1 
ATOM   958  O  "O5'" . DT  C 1 6  ? 47.541 62.294  30.763 1.00 51.29  ? 6   DT  C "O5'" 1 
ATOM   959  C  "C5'" . DT  C 1 6  ? 48.927 62.598  30.680 1.00 48.67  ? 6   DT  C "C5'" 1 
ATOM   960  C  "C4'" . DT  C 1 6  ? 49.311 63.555  31.780 1.00 46.62  ? 6   DT  C "C4'" 1 
ATOM   961  O  "O4'" . DT  C 1 6  ? 48.945 64.913  31.435 1.00 45.28  ? 6   DT  C "O4'" 1 
ATOM   962  C  "C3'" . DT  C 1 6  ? 48.635 63.252  33.116 1.00 45.60  ? 6   DT  C "C3'" 1 
ATOM   963  O  "O3'" . DT  C 1 6  ? 49.580 63.407  34.169 1.00 45.85  ? 6   DT  C "O3'" 1 
ATOM   964  C  "C2'" . DT  C 1 6  ? 47.563 64.323  33.217 1.00 45.13  ? 6   DT  C "C2'" 1 
ATOM   965  C  "C1'" . DT  C 1 6  ? 48.236 65.489  32.517 1.00 43.48  ? 6   DT  C "C1'" 1 
ATOM   966  N  N1    . DT  C 1 6  ? 47.335 66.526  31.977 1.00 39.58  ? 6   DT  C N1    1 
ATOM   967  C  C2    . DT  C 1 6  ? 47.827 67.808  31.876 1.00 37.42  ? 6   DT  C C2    1 
ATOM   968  O  O2    . DT  C 1 6  ? 48.970 68.106  32.180 1.00 36.93  ? 6   DT  C O2    1 
ATOM   969  N  N3    . DT  C 1 6  ? 46.935 68.728  31.389 1.00 35.74  ? 6   DT  C N3    1 
ATOM   970  C  C4    . DT  C 1 6  ? 45.636 68.497  30.987 1.00 36.25  ? 6   DT  C C4    1 
ATOM   971  O  O4    . DT  C 1 6  ? 44.960 69.421  30.548 1.00 36.12  ? 6   DT  C O4    1 
ATOM   972  C  C5    . DT  C 1 6  ? 45.184 67.127  31.115 1.00 37.89  ? 6   DT  C C5    1 
ATOM   973  C  C7    . DT  C 1 6  ? 43.788 66.782  30.708 1.00 38.27  ? 6   DT  C C7    1 
ATOM   974  C  C6    . DT  C 1 6  ? 46.045 66.224  31.600 1.00 37.99  ? 6   DT  C C6    1 
ATOM   975  P  P     . DG  C 1 7  ? 49.459 62.500  35.487 1.00 45.31  ? 7   DG  C P     1 
ATOM   976  O  OP1   . DG  C 1 7  ? 50.097 61.192  35.209 1.00 45.86  ? 7   DG  C OP1   1 
ATOM   977  O  OP2   . DG  C 1 7  ? 48.050 62.548  35.960 1.00 44.82  ? 7   DG  C OP2   1 
ATOM   978  O  "O5'" . DG  C 1 7  ? 50.388 63.273  36.519 1.00 43.07  ? 7   DG  C "O5'" 1 
ATOM   979  C  "C5'" . DG  C 1 7  ? 51.704 63.669  36.140 1.00 39.07  ? 7   DG  C "C5'" 1 
ATOM   980  C  "C4'" . DG  C 1 7  ? 52.042 65.004  36.759 1.00 38.04  ? 7   DG  C "C4'" 1 
ATOM   981  O  "O4'" . DG  C 1 7  ? 51.247 66.054  36.151 1.00 34.45  ? 7   DG  C "O4'" 1 
ATOM   982  C  "C3'" . DG  C 1 7  ? 51.769 65.081  38.258 1.00 37.19  ? 7   DG  C "C3'" 1 
ATOM   983  O  "O3'" . DG  C 1 7  ? 52.806 65.850  38.869 1.00 39.76  ? 7   DG  C "O3'" 1 
ATOM   984  C  "C2'" . DG  C 1 7  ? 50.424 65.785  38.335 1.00 34.15  ? 7   DG  C "C2'" 1 
ATOM   985  C  "C1'" . DG  C 1 7  ? 50.462 66.713  37.132 1.00 31.40  ? 7   DG  C "C1'" 1 
ATOM   986  N  N9    . DG  C 1 7  ? 49.157 66.993  36.530 1.00 29.27  ? 7   DG  C N9    1 
ATOM   987  C  C8    . DG  C 1 7  ? 48.127 66.106  36.326 1.00 27.92  ? 7   DG  C C8    1 
ATOM   988  N  N7    . DG  C 1 7  ? 47.096 66.649  35.731 1.00 26.49  ? 7   DG  C N7    1 
ATOM   989  C  C5    . DG  C 1 7  ? 47.468 67.973  35.537 1.00 26.58  ? 7   DG  C C5    1 
ATOM   990  C  C6    . DG  C 1 7  ? 46.760 69.053  34.935 1.00 23.05  ? 7   DG  C C6    1 
ATOM   991  O  O6    . DG  C 1 7  ? 45.635 69.044  34.426 1.00 23.10  ? 7   DG  C O6    1 
ATOM   992  N  N1    . DG  C 1 7  ? 47.501 70.231  34.963 1.00 21.36  ? 7   DG  C N1    1 
ATOM   993  C  C2    . DG  C 1 7  ? 48.761 70.362  35.496 1.00 22.88  ? 7   DG  C C2    1 
ATOM   994  N  N2    . DG  C 1 7  ? 49.307 71.592  35.436 1.00 17.88  ? 7   DG  C N2    1 
ATOM   995  N  N3    . DG  C 1 7  ? 49.436 69.362  36.051 1.00 23.88  ? 7   DG  C N3    1 
ATOM   996  C  C4    . DG  C 1 7  ? 48.735 68.209  36.037 1.00 26.06  ? 7   DG  C C4    1 
ATOM   997  P  P     . DA  C 1 8  ? 52.776 66.126  40.446 1.00 40.91  ? 8   DA  C P     1 
ATOM   998  O  OP1   . DA  C 1 8  ? 54.148 65.838  40.934 1.00 43.79  ? 8   DA  C OP1   1 
ATOM   999  O  OP2   . DA  C 1 8  ? 51.614 65.441  41.059 1.00 41.27  ? 8   DA  C OP2   1 
ATOM   1000 O  "O5'" . DA  C 1 8  ? 52.556 67.701  40.551 1.00 38.67  ? 8   DA  C "O5'" 1 
ATOM   1001 C  "C5'" . DA  C 1 8  ? 53.473 68.591  39.927 1.00 34.01  ? 8   DA  C "C5'" 1 
ATOM   1002 C  "C4'" . DA  C 1 8  ? 52.989 70.020  40.024 1.00 31.10  ? 8   DA  C "C4'" 1 
ATOM   1003 O  "O4'" . DA  C 1 8  ? 51.737 70.160  39.310 1.00 29.16  ? 8   DA  C "O4'" 1 
ATOM   1004 C  "C3'" . DA  C 1 8  ? 52.751 70.574  41.429 1.00 30.65  ? 8   DA  C "C3'" 1 
ATOM   1005 O  "O3'" . DA  C 1 8  ? 53.215 71.938  41.451 1.00 31.03  ? 8   DA  C "O3'" 1 
ATOM   1006 C  "C2'" . DA  C 1 8  ? 51.242 70.452  41.590 1.00 28.06  ? 8   DA  C "C2'" 1 
ATOM   1007 C  "C1'" . DA  C 1 8  ? 50.730 70.673  40.170 1.00 27.08  ? 8   DA  C "C1'" 1 
ATOM   1008 N  N9    . DA  C 1 8  ? 49.486 69.979  39.836 1.00 22.59  ? 8   DA  C N9    1 
ATOM   1009 C  C8    . DA  C 1 8  ? 49.166 68.668  40.090 1.00 24.37  ? 8   DA  C C8    1 
ATOM   1010 N  N7    . DA  C 1 8  ? 47.997 68.305  39.615 1.00 22.36  ? 8   DA  C N7    1 
ATOM   1011 C  C5    . DA  C 1 8  ? 47.506 69.461  39.025 1.00 20.65  ? 8   DA  C C5    1 
ATOM   1012 C  C6    . DA  C 1 8  ? 46.311 69.731  38.335 1.00 19.47  ? 8   DA  C C6    1 
ATOM   1013 N  N6    . DA  C 1 8  ? 45.380 68.805  38.089 1.00 14.94  ? 8   DA  C N6    1 
ATOM   1014 N  N1    . DA  C 1 8  ? 46.113 70.993  37.888 1.00 18.70  ? 8   DA  C N1    1 
ATOM   1015 C  C2    . DA  C 1 8  ? 47.073 71.906  38.100 1.00 15.81  ? 8   DA  C C2    1 
ATOM   1016 N  N3    . DA  C 1 8  ? 48.252 71.766  38.714 1.00 19.45  ? 8   DA  C N3    1 
ATOM   1017 C  C4    . DA  C 1 8  ? 48.406 70.504  39.165 1.00 21.33  ? 8   DA  C C4    1 
ATOM   1018 P  P     . DA  C 1 9  ? 53.376 72.729  42.848 1.00 33.60  ? 9   DA  C P     1 
ATOM   1019 O  OP1   . DA  C 1 9  ? 54.652 73.489  42.815 1.00 34.48  ? 9   DA  C OP1   1 
ATOM   1020 O  OP2   . DA  C 1 9  ? 53.062 71.850  44.000 1.00 32.14  ? 9   DA  C OP2   1 
ATOM   1021 O  "O5'" . DA  C 1 9  ? 52.220 73.809  42.756 1.00 31.07  ? 9   DA  C "O5'" 1 
ATOM   1022 C  "C5'" . DA  C 1 9  ? 51.068 73.503  42.028 1.00 28.77  ? 9   DA  C "C5'" 1 
ATOM   1023 C  "C4'" . DA  C 1 9  ? 50.223 74.729  41.814 1.00 21.85  ? 9   DA  C "C4'" 1 
ATOM   1024 O  "O4'" . DA  C 1 9  ? 49.045 74.165  41.213 1.00 19.36  ? 9   DA  C "O4'" 1 
ATOM   1025 C  "C3'" . DA  C 1 9  ? 49.757 75.442  43.088 1.00 19.01  ? 9   DA  C "C3'" 1 
ATOM   1026 O  "O3'" . DA  C 1 9  ? 49.611 76.862  42.840 1.00 13.50  ? 9   DA  C "O3'" 1 
ATOM   1027 C  "C2'" . DA  C 1 9  ? 48.461 74.726  43.446 1.00 16.89  ? 9   DA  C "C2'" 1 
ATOM   1028 C  "C1'" . DA  C 1 9  ? 47.948 74.197  42.103 1.00 16.70  ? 9   DA  C "C1'" 1 
ATOM   1029 N  N9    . DA  C 1 9  ? 47.367 72.851  42.101 1.00 15.58  ? 9   DA  C N9    1 
ATOM   1030 C  C8    . DA  C 1 9  ? 47.849 71.681  42.658 1.00 15.82  ? 9   DA  C C8    1 
ATOM   1031 N  N7    . DA  C 1 9  ? 47.070 70.639  42.453 1.00 16.47  ? 9   DA  C N7    1 
ATOM   1032 C  C5    . DA  C 1 9  ? 46.013 71.155  41.714 1.00 14.86  ? 9   DA  C C5    1 
ATOM   1033 C  C6    . DA  C 1 9  ? 44.855 70.564  41.175 1.00 15.87  ? 9   DA  C C6    1 
ATOM   1034 N  N6    . DA  C 1 9  ? 44.557 69.264  41.293 1.00 14.12  ? 9   DA  C N6    1 
ATOM   1035 N  N1    . DA  C 1 9  ? 44.003 71.364  40.494 1.00 14.80  ? 9   DA  C N1    1 
ATOM   1036 C  C2    . DA  C 1 9  ? 44.310 72.663  40.354 1.00 15.50  ? 9   DA  C C2    1 
ATOM   1037 N  N3    . DA  C 1 9  ? 45.367 73.333  40.811 1.00 12.84  ? 9   DA  C N3    1 
ATOM   1038 C  C4    . DA  C 1 9  ? 46.186 72.514  41.491 1.00 15.12  ? 9   DA  C C4    1 
ATOM   1039 P  P     . DA  C 1 10 ? 48.887 77.806  43.927 1.00 19.82  ? 10  DA  C P     1 
ATOM   1040 O  OP1   . DA  C 1 10 ? 49.181 79.212  43.560 1.00 15.58  ? 10  DA  C OP1   1 
ATOM   1041 O  OP2   . DA  C 1 10 ? 49.167 77.334  45.306 1.00 12.56  ? 10  DA  C OP2   1 
ATOM   1042 O  "O5'" . DA  C 1 10 ? 47.350 77.576  43.624 1.00 15.89  ? 10  DA  C "O5'" 1 
ATOM   1043 C  "C5'" . DA  C 1 10 ? 46.858 77.832  42.312 1.00 15.09  ? 10  DA  C "C5'" 1 
ATOM   1044 C  "C4'" . DA  C 1 10 ? 45.367 77.625  42.260 1.00 15.34  ? 10  DA  C "C4'" 1 
ATOM   1045 O  "O4'" . DA  C 1 10 ? 45.048 76.214  42.326 1.00 13.40  ? 10  DA  C "O4'" 1 
ATOM   1046 C  "C3'" . DA  C 1 10 ? 44.575 78.306  43.378 1.00 15.04  ? 10  DA  C "C3'" 1 
ATOM   1047 O  "O3'" . DA  C 1 10 ? 43.462 78.977  42.778 1.00 16.26  ? 10  DA  C "O3'" 1 
ATOM   1048 C  "C2'" . DA  C 1 10 ? 44.113 77.145  44.249 1.00 14.27  ? 10  DA  C "C2'" 1 
ATOM   1049 C  "C1'" . DA  C 1 10 ? 43.980 76.020  43.233 1.00 11.06  ? 10  DA  C "C1'" 1 
ATOM   1050 N  N9    . DA  C 1 10 ? 44.082 74.652  43.738 1.00 13.73  ? 10  DA  C N9    1 
ATOM   1051 C  C8    . DA  C 1 10 ? 45.050 74.105  44.551 1.00 14.84  ? 10  DA  C C8    1 
ATOM   1052 N  N7    . DA  C 1 10 ? 44.893 72.818  44.770 1.00 12.32  ? 10  DA  C N7    1 
ATOM   1053 C  C5    . DA  C 1 10 ? 43.740 72.498  44.064 1.00 14.77  ? 10  DA  C C5    1 
ATOM   1054 C  C6    . DA  C 1 10 ? 43.041 71.283  43.885 1.00 13.31  ? 10  DA  C C6    1 
ATOM   1055 N  N6    . DA  C 1 10 ? 43.418 70.103  44.416 1.00 12.12  ? 10  DA  C N6    1 
ATOM   1056 N  N1    . DA  C 1 10 ? 41.925 71.313  43.129 1.00 14.18  ? 10  DA  C N1    1 
ATOM   1057 C  C2    . DA  C 1 10 ? 41.543 72.476  42.584 1.00 15.17  ? 10  DA  C C2    1 
ATOM   1058 N  N3    . DA  C 1 10 ? 42.115 73.679  42.671 1.00 14.85  ? 10  DA  C N3    1 
ATOM   1059 C  C4    . DA  C 1 10 ? 43.222 73.622  43.437 1.00 14.51  ? 10  DA  C C4    1 
ATOM   1060 P  P     . DC  C 1 11 ? 42.628 80.055  43.614 1.00 21.30  ? 11  DC  C P     1 
ATOM   1061 O  OP1   . DC  C 1 11 ? 42.191 81.107  42.650 1.00 17.64  ? 11  DC  C OP1   1 
ATOM   1062 O  OP2   . DC  C 1 11 ? 43.322 80.428  44.868 1.00 19.27  ? 11  DC  C OP2   1 
ATOM   1063 O  "O5'" . DC  C 1 11 ? 41.335 79.263  44.038 1.00 18.46  ? 11  DC  C "O5'" 1 
ATOM   1064 C  "C5'" . DC  C 1 11 ? 41.275 77.893  43.813 1.00 28.26  ? 11  DC  C "C5'" 1 
ATOM   1065 C  "C4'" . DC  C 1 11 ? 39.852 77.473  43.592 1.00 23.38  ? 11  DC  C "C4'" 1 
ATOM   1066 O  "O4'" . DC  C 1 11 ? 39.953 76.044  43.691 1.00 22.92  ? 11  DC  C "O4'" 1 
ATOM   1067 C  "C3'" . DC  C 1 11 ? 38.915 77.932  44.707 1.00 22.64  ? 11  DC  C "C3'" 1 
ATOM   1068 O  "O3'" . DC  C 1 11 ? 37.634 78.307  44.195 1.00 24.55  ? 11  DC  C "O3'" 1 
ATOM   1069 C  "C2'" . DC  C 1 11 ? 38.862 76.754  45.667 1.00 19.93  ? 11  DC  C "C2'" 1 
ATOM   1070 C  "C1'" . DC  C 1 11 ? 39.269 75.555  44.825 1.00 19.46  ? 11  DC  C "C1'" 1 
ATOM   1071 N  N1    . DC  C 1 11 ? 40.177 74.612  45.493 1.00 16.64  ? 11  DC  C N1    1 
ATOM   1072 C  C2    . DC  C 1 11 ? 39.823 73.271  45.516 1.00 16.76  ? 11  DC  C C2    1 
ATOM   1073 O  O2    . DC  C 1 11 ? 38.783 72.927  44.943 1.00 15.50  ? 11  DC  C O2    1 
ATOM   1074 N  N3    . DC  C 1 11 ? 40.619 72.382  46.149 1.00 14.43  ? 11  DC  C N3    1 
ATOM   1075 C  C4    . DC  C 1 11 ? 41.755 72.787  46.721 1.00 12.96  ? 11  DC  C C4    1 
ATOM   1076 N  N4    . DC  C 1 11 ? 42.515 71.853  47.308 1.00 12.19  ? 11  DC  C N4    1 
ATOM   1077 C  C5    . DC  C 1 11 ? 42.159 74.160  46.707 1.00 14.30  ? 11  DC  C C5    1 
ATOM   1078 C  C6    . DC  C 1 11 ? 41.341 75.033  46.085 1.00 13.55  ? 11  DC  C C6    1 
ATOM   1079 P  P     . DA  C 1 12 ? 36.539 78.955  45.181 1.00 28.00  ? 12  DA  C P     1 
ATOM   1080 O  OP1   . DA  C 1 12 ? 35.615 79.800  44.394 1.00 30.30  ? 12  DA  C OP1   1 
ATOM   1081 O  OP2   . DA  C 1 12 ? 37.232 79.527  46.359 1.00 27.28  ? 12  DA  C OP2   1 
ATOM   1082 O  "O5'" . DA  C 1 12 ? 35.729 77.689  45.695 1.00 25.04  ? 12  DA  C "O5'" 1 
ATOM   1083 C  "C5'" . DA  C 1 12 ? 35.162 76.771  44.770 1.00 23.55  ? 12  DA  C "C5'" 1 
ATOM   1084 C  "C4'" . DA  C 1 12 ? 34.559 75.605  45.512 1.00 24.75  ? 12  DA  C "C4'" 1 
ATOM   1085 O  "O4'" . DA  C 1 12 ? 35.612 74.742  46.015 1.00 22.65  ? 12  DA  C "O4'" 1 
ATOM   1086 C  "C3'" . DA  C 1 12 ? 33.722 76.017  46.725 1.00 26.86  ? 12  DA  C "C3'" 1 
ATOM   1087 O  "O3'" . DA  C 1 12 ? 32.487 75.294  46.712 1.00 32.93  ? 12  DA  C "O3'" 1 
ATOM   1088 C  "C2'" . DA  C 1 12 ? 34.601 75.640  47.914 1.00 24.80  ? 12  DA  C "C2'" 1 
ATOM   1089 C  "C1'" . DA  C 1 12 ? 35.371 74.442  47.379 1.00 22.18  ? 12  DA  C "C1'" 1 
ATOM   1090 N  N9    . DA  C 1 12 ? 36.665 74.154  48.008 1.00 18.96  ? 12  DA  C N9    1 
ATOM   1091 C  C8    . DA  C 1 12 ? 37.669 75.033  48.356 1.00 17.75  ? 12  DA  C C8    1 
ATOM   1092 N  N7    . DA  C 1 12 ? 38.732 74.449  48.862 1.00 15.38  ? 12  DA  C N7    1 
ATOM   1093 C  C5    . DA  C 1 12 ? 38.404 73.096  48.860 1.00 16.18  ? 12  DA  C C5    1 
ATOM   1094 C  C6    . DA  C 1 12 ? 39.107 71.942  49.277 1.00 16.36  ? 12  DA  C C6    1 
ATOM   1095 N  N6    . DA  C 1 12 ? 40.345 71.959  49.802 1.00 13.94  ? 12  DA  C N6    1 
ATOM   1096 N  N1    . DA  C 1 12 ? 38.488 70.747  49.138 1.00 16.45  ? 12  DA  C N1    1 
ATOM   1097 C  C2    . DA  C 1 12 ? 37.248 70.722  48.624 1.00 16.33  ? 12  DA  C C2    1 
ATOM   1098 N  N3    . DA  C 1 12 ? 36.488 71.732  48.205 1.00 15.89  ? 12  DA  C N3    1 
ATOM   1099 C  C4    . DA  C 1 12 ? 37.130 72.904  48.348 1.00 17.26  ? 12  DA  C C4    1 
ATOM   1100 P  P     . DA  C 1 13 ? 31.229 75.844  47.545 1.00 35.39  ? 13  DA  C P     1 
ATOM   1101 O  OP1   . DA  C 1 13 ? 29.991 75.600  46.765 1.00 38.61  ? 13  DA  C OP1   1 
ATOM   1102 O  OP2   . DA  C 1 13 ? 31.539 77.210  48.026 1.00 37.56  ? 13  DA  C OP2   1 
ATOM   1103 O  "O5'" . DA  C 1 13 ? 31.194 74.886  48.805 1.00 36.66  ? 13  DA  C "O5'" 1 
ATOM   1104 C  "C5'" . DA  C 1 13 ? 32.380 74.259  49.225 1.00 35.13  ? 13  DA  C "C5'" 1 
ATOM   1105 C  "C4'" . DA  C 1 13 ? 32.110 72.834  49.625 1.00 33.66  ? 13  DA  C "C4'" 1 
ATOM   1106 O  "O4'" . DA  C 1 13 ? 33.399 72.211  49.783 1.00 29.95  ? 13  DA  C "O4'" 1 
ATOM   1107 C  "C3'" . DA  C 1 13 ? 31.410 72.725  50.975 1.00 34.03  ? 13  DA  C "C3'" 1 
ATOM   1108 O  "O3'" . DA  C 1 13 ? 30.581 71.564  51.008 1.00 38.89  ? 13  DA  C "O3'" 1 
ATOM   1109 C  "C2'" . DA  C 1 13 ? 32.562 72.634  51.957 1.00 31.53  ? 13  DA  C "C2'" 1 
ATOM   1110 C  "C1'" . DA  C 1 13 ? 33.681 71.983  51.151 1.00 28.60  ? 13  DA  C "C1'" 1 
ATOM   1111 N  N9    . DA  C 1 13 ? 35.008 72.540  51.430 1.00 24.19  ? 13  DA  C N9    1 
ATOM   1112 C  C8    . DA  C 1 13 ? 35.403 73.861  51.442 1.00 21.79  ? 13  DA  C C8    1 
ATOM   1113 N  N7    . DA  C 1 13 ? 36.654 74.033  51.803 1.00 20.10  ? 13  DA  C N7    1 
ATOM   1114 C  C5    . DA  C 1 13 ? 37.117 72.740  52.022 1.00 19.13  ? 13  DA  C C5    1 
ATOM   1115 C  C6    . DA  C 1 13 ? 38.359 72.236  52.439 1.00 16.15  ? 13  DA  C C6    1 
ATOM   1116 N  N6    . DA  C 1 13 ? 39.407 73.006  52.746 1.00 16.05  ? 13  DA  C N6    1 
ATOM   1117 N  N1    . DA  C 1 13 ? 38.491 70.894  52.544 1.00 14.65  ? 13  DA  C N1    1 
ATOM   1118 C  C2    . DA  C 1 13 ? 37.433 70.122  52.267 1.00 17.90  ? 13  DA  C C2    1 
ATOM   1119 N  N3    . DA  C 1 13 ? 36.212 70.477  51.883 1.00 16.80  ? 13  DA  C N3    1 
ATOM   1120 C  C4    . DA  C 1 13 ? 36.119 71.813  51.776 1.00 20.26  ? 13  DA  C C4    1 
ATOM   1121 P  P     . DA  C 1 14 ? 29.457 71.413  52.148 1.00 39.18  ? 14  DA  C P     1 
ATOM   1122 O  OP1   . DA  C 1 14 ? 28.177 71.084  51.475 1.00 41.07  ? 14  DA  C OP1   1 
ATOM   1123 O  OP2   . DA  C 1 14 ? 29.524 72.580  53.059 1.00 37.63  ? 14  DA  C OP2   1 
ATOM   1124 O  "O5'" . DA  C 1 14 ? 29.948 70.131  52.950 1.00 38.71  ? 14  DA  C "O5'" 1 
ATOM   1125 C  "C5'" . DA  C 1 14 ? 30.344 68.953  52.253 1.00 38.88  ? 14  DA  C "C5'" 1 
ATOM   1126 C  "C4'" . DA  C 1 14 ? 31.122 68.041  53.172 1.00 39.05  ? 14  DA  C "C4'" 1 
ATOM   1127 O  "O4'" . DA  C 1 14 ? 32.464 68.552  53.377 1.00 37.85  ? 14  DA  C "O4'" 1 
ATOM   1128 C  "C3'" . DA  C 1 14 ? 30.503 67.885  54.560 1.00 39.23  ? 14  DA  C "C3'" 1 
ATOM   1129 O  "O3'" . DA  C 1 14 ? 30.586 66.512  54.966 1.00 42.37  ? 14  DA  C "O3'" 1 
ATOM   1130 C  "C2'" . DA  C 1 14 ? 31.363 68.794  55.427 1.00 37.45  ? 14  DA  C "C2'" 1 
ATOM   1131 C  "C1'" . DA  C 1 14 ? 32.730 68.672  54.768 1.00 34.75  ? 14  DA  C "C1'" 1 
ATOM   1132 N  N9    . DA  C 1 14 ? 33.629 69.815  54.958 1.00 30.30  ? 14  DA  C N9    1 
ATOM   1133 C  C8    . DA  C 1 14 ? 33.326 71.147  54.835 1.00 28.40  ? 14  DA  C C8    1 
ATOM   1134 N  N7    . DA  C 1 14 ? 34.349 71.945  55.039 1.00 26.76  ? 14  DA  C N7    1 
ATOM   1135 C  C5    . DA  C 1 14 ? 35.398 71.082  55.316 1.00 24.12  ? 14  DA  C C5    1 
ATOM   1136 C  C6    . DA  C 1 14 ? 36.757 71.308  55.611 1.00 23.46  ? 14  DA  C C6    1 
ATOM   1137 N  N6    . DA  C 1 14 ? 37.312 72.525  55.670 1.00 20.23  ? 14  DA  C N6    1 
ATOM   1138 N  N1    . DA  C 1 14 ? 37.536 70.231  55.843 1.00 19.88  ? 14  DA  C N1    1 
ATOM   1139 C  C2    . DA  C 1 14 ? 36.979 69.013  55.776 1.00 23.69  ? 14  DA  C C2    1 
ATOM   1140 N  N3    . DA  C 1 14 ? 35.718 68.675  55.506 1.00 24.43  ? 14  DA  C N3    1 
ATOM   1141 C  C4    . DA  C 1 14 ? 34.968 69.767  55.282 1.00 26.58  ? 14  DA  C C4    1 
ATOM   1142 P  P     . DT  C 1 15 ? 29.697 65.980  56.201 1.00 44.23  ? 15  DT  C P     1 
ATOM   1143 O  OP1   . DT  C 1 15 ? 29.148 64.653  55.830 1.00 44.54  ? 15  DT  C OP1   1 
ATOM   1144 O  OP2   . DT  C 1 15 ? 28.783 67.062  56.656 1.00 43.42  ? 15  DT  C OP2   1 
ATOM   1145 O  "O5'" . DT  C 1 15 ? 30.779 65.757  57.336 1.00 42.02  ? 15  DT  C "O5'" 1 
ATOM   1146 C  "C5'" . DT  C 1 15 ? 31.873 66.640  57.421 1.00 39.50  ? 15  DT  C "C5'" 1 
ATOM   1147 C  "C4'" . DT  C 1 15 ? 33.070 65.942  58.005 1.00 36.68  ? 15  DT  C "C4'" 1 
ATOM   1148 O  "O4'" . DT  C 1 15 ? 34.184 66.846  57.851 1.00 34.33  ? 15  DT  C "O4'" 1 
ATOM   1149 C  "C3'" . DT  C 1 15 ? 32.933 65.681  59.500 1.00 34.51  ? 15  DT  C "C3'" 1 
ATOM   1150 O  "O3'" . DT  C 1 15 ? 33.630 64.476  59.850 1.00 35.02  ? 15  DT  C "O3'" 1 
ATOM   1151 C  "C2'" . DT  C 1 15 ? 33.524 66.938  60.120 1.00 33.35  ? 15  DT  C "C2'" 1 
ATOM   1152 C  "C1'" . DT  C 1 15 ? 34.580 67.370  59.106 1.00 32.52  ? 15  DT  C "C1'" 1 
ATOM   1153 N  N1    . DT  C 1 15 ? 34.733 68.831  58.943 1.00 29.40  ? 15  DT  C N1    1 
ATOM   1154 C  C2    . DT  C 1 15 ? 35.983 69.371  59.137 1.00 26.50  ? 15  DT  C C2    1 
ATOM   1155 O  O2    . DT  C 1 15 ? 36.959 68.706  59.432 1.00 24.69  ? 15  DT  C O2    1 
ATOM   1156 N  N3    . DT  C 1 15 ? 36.050 70.728  58.974 1.00 26.25  ? 15  DT  C N3    1 
ATOM   1157 C  C4    . DT  C 1 15 ? 35.020 71.583  58.655 1.00 27.25  ? 15  DT  C C4    1 
ATOM   1158 O  O4    . DT  C 1 15 ? 35.238 72.789  58.554 1.00 27.28  ? 15  DT  C O4    1 
ATOM   1159 C  C5    . DT  C 1 15 ? 33.733 70.953  58.461 1.00 28.41  ? 15  DT  C C5    1 
ATOM   1160 C  C7    . DT  C 1 15 ? 32.557 71.806  58.107 1.00 29.63  ? 15  DT  C C7    1 
ATOM   1161 C  C6    . DT  C 1 15 ? 33.655 69.624  58.610 1.00 27.77  ? 15  DT  C C6    1 
ATOM   1162 P  P     . DT  C 1 16 ? 33.492 63.866  61.338 1.00 36.39  ? 16  DT  C P     1 
ATOM   1163 O  OP1   . DT  C 1 16 ? 33.370 62.392  61.230 1.00 37.70  ? 16  DT  C OP1   1 
ATOM   1164 O  OP2   . DT  C 1 16 ? 32.474 64.637  62.088 1.00 32.42  ? 16  DT  C OP2   1 
ATOM   1165 O  "O5'" . DT  C 1 16 ? 34.917 64.158  61.971 1.00 35.54  ? 16  DT  C "O5'" 1 
ATOM   1166 C  "C5'" . DT  C 1 16 ? 35.610 65.333  61.619 1.00 34.86  ? 16  DT  C "C5'" 1 
ATOM   1167 C  "C4'" . DT  C 1 16 ? 36.963 65.368  62.279 1.00 32.38  ? 16  DT  C "C4'" 1 
ATOM   1168 O  "O4'" . DT  C 1 16 ? 37.457 66.707  62.079 1.00 29.22  ? 16  DT  C "O4'" 1 
ATOM   1169 C  "C3'" . DT  C 1 16 ? 36.918 65.169  63.791 1.00 30.33  ? 16  DT  C "C3'" 1 
ATOM   1170 O  "O3'" . DT  C 1 16 ? 38.150 64.595  64.231 1.00 31.07  ? 16  DT  C "O3'" 1 
ATOM   1171 C  "C2'" . DT  C 1 16 ? 36.707 66.573  64.322 1.00 29.01  ? 16  DT  C "C2'" 1 
ATOM   1172 C  "C1'" . DT  C 1 16 ? 37.398 67.449  63.287 1.00 28.14  ? 16  DT  C "C1'" 1 
ATOM   1173 N  N1    . DT  C 1 16 ? 36.693 68.701  62.987 1.00 25.25  ? 16  DT  C N1    1 
ATOM   1174 C  C2    . DT  C 1 16 ? 37.430 69.855  62.983 1.00 23.94  ? 16  DT  C C2    1 
ATOM   1175 O  O2    . DT  C 1 16 ? 38.614 69.885  63.266 1.00 21.52  ? 16  DT  C O2    1 
ATOM   1176 N  N3    . DT  C 1 16 ? 36.729 70.978  62.635 1.00 20.47  ? 16  DT  C N3    1 
ATOM   1177 C  C4    . DT  C 1 16 ? 35.398 71.061  62.303 1.00 20.67  ? 16  DT  C C4    1 
ATOM   1178 O  O4    . DT  C 1 16 ? 34.917 72.139  61.971 1.00 20.52  ? 16  DT  C O4    1 
ATOM   1179 C  C5    . DT  C 1 16 ? 34.669 69.817  62.365 1.00 21.80  ? 16  DT  C C5    1 
ATOM   1180 C  C7    . DT  C 1 16 ? 33.205 69.823  62.053 1.00 22.10  ? 16  DT  C C7    1 
ATOM   1181 C  C6    . DT  C 1 16 ? 35.343 68.711  62.701 1.00 23.25  ? 16  DT  C C6    1 
ATOM   1182 P  P     . DT  C 1 17 ? 38.384 64.293  65.793 1.00 32.26  ? 17  DT  C P     1 
ATOM   1183 O  OP1   . DT  C 1 17 ? 39.400 63.217  65.870 1.00 30.29  ? 17  DT  C OP1   1 
ATOM   1184 O  OP2   . DT  C 1 17 ? 37.079 64.130  66.476 1.00 30.74  ? 17  DT  C OP2   1 
ATOM   1185 O  "O5'" . DT  C 1 17 ? 39.055 65.632  66.326 1.00 30.48  ? 17  DT  C "O5'" 1 
ATOM   1186 C  "C5'" . DT  C 1 17 ? 40.300 66.060  65.795 1.00 29.42  ? 17  DT  C "C5'" 1 
ATOM   1187 C  "C4'" . DT  C 1 17 ? 40.756 67.332  66.468 1.00 28.19  ? 17  DT  C "C4'" 1 
ATOM   1188 O  "O4'" . DT  C 1 17 ? 39.972 68.459  66.003 1.00 28.05  ? 17  DT  C "O4'" 1 
ATOM   1189 C  "C3'" . DT  C 1 17 ? 40.672 67.339  67.996 1.00 28.17  ? 17  DT  C "C3'" 1 
ATOM   1190 O  "O3'" . DT  C 1 17 ? 41.921 67.807  68.522 1.00 28.13  ? 17  DT  C "O3'" 1 
ATOM   1191 C  "C2'" . DT  C 1 17 ? 39.523 68.299  68.284 1.00 25.95  ? 17  DT  C "C2'" 1 
ATOM   1192 C  "C1'" . DT  C 1 17 ? 39.594 69.262  67.108 1.00 25.23  ? 17  DT  C "C1'" 1 
ATOM   1193 N  N1    . DT  C 1 17 ? 38.341 69.967  66.746 1.00 22.31  ? 17  DT  C N1    1 
ATOM   1194 C  C2    . DT  C 1 17 ? 38.390 71.332  66.496 1.00 22.42  ? 17  DT  C C2    1 
ATOM   1195 O  O2    . DT  C 1 17 ? 39.393 72.009  66.640 1.00 22.27  ? 17  DT  C O2    1 
ATOM   1196 N  N3    . DT  C 1 17 ? 37.204 71.881  66.076 1.00 20.29  ? 17  DT  C N3    1 
ATOM   1197 C  C4    . DT  C 1 17 ? 36.000 71.232  65.904 1.00 22.60  ? 17  DT  C C4    1 
ATOM   1198 O  O4    . DT  C 1 17 ? 35.024 71.850  65.483 1.00 23.17  ? 17  DT  C O4    1 
ATOM   1199 C  C5    . DT  C 1 17 ? 36.003 69.827  66.238 1.00 23.46  ? 17  DT  C C5    1 
ATOM   1200 C  C7    . DT  C 1 17 ? 34.722 69.061  66.138 1.00 23.02  ? 17  DT  C C7    1 
ATOM   1201 C  C6    . DT  C 1 17 ? 37.158 69.270  66.632 1.00 21.68  ? 17  DT  C C6    1 
ATOM   1202 P  P     . DT  C 1 18 ? 42.329 67.489  70.045 1.00 29.48  ? 18  DT  C P     1 
ATOM   1203 O  OP1   . DT  C 1 18 ? 43.750 67.064  70.055 1.00 27.01  ? 18  DT  C OP1   1 
ATOM   1204 O  OP2   . DT  C 1 18 ? 41.297 66.627  70.680 1.00 29.61  ? 18  DT  C OP2   1 
ATOM   1205 O  "O5'" . DT  C 1 18 ? 42.252 68.920  70.718 1.00 31.39  ? 18  DT  C "O5'" 1 
ATOM   1206 C  "C5'" . DT  C 1 18 ? 41.445 69.911  70.118 1.00 38.38  ? 18  DT  C "C5'" 1 
ATOM   1207 C  "C4'" . DT  C 1 18 ? 41.908 71.286  70.516 1.00 38.10  ? 18  DT  C "C4'" 1 
ATOM   1208 O  "O4'" . DT  C 1 18 ? 41.009 72.203  69.865 1.00 38.73  ? 18  DT  C "O4'" 1 
ATOM   1209 C  "C3'" . DT  C 1 18 ? 41.771 71.551  72.008 1.00 39.37  ? 18  DT  C "C3'" 1 
ATOM   1210 O  "O3'" . DT  C 1 18 ? 42.770 72.477  72.429 1.00 42.36  ? 18  DT  C "O3'" 1 
ATOM   1211 C  "C2'" . DT  C 1 18 ? 40.365 72.104  72.142 1.00 38.33  ? 18  DT  C "C2'" 1 
ATOM   1212 C  "C1'" . DT  C 1 18 ? 40.102 72.769  70.795 1.00 36.70  ? 18  DT  C "C1'" 1 
ATOM   1213 N  N1    . DT  C 1 18 ? 38.741 72.542  70.267 1.00 34.73  ? 18  DT  C N1    1 
ATOM   1214 C  C2    . DT  C 1 18 ? 38.109 73.592  69.649 1.00 32.11  ? 18  DT  C C2    1 
ATOM   1215 O  O2    . DT  C 1 18 ? 38.631 74.679  69.495 1.00 32.85  ? 18  DT  C O2    1 
ATOM   1216 N  N3    . DT  C 1 18 ? 36.842 73.317  69.207 1.00 31.74  ? 18  DT  C N3    1 
ATOM   1217 C  C4    . DT  C 1 18 ? 36.164 72.121  69.303 1.00 30.70  ? 18  DT  C C4    1 
ATOM   1218 O  O4    . DT  C 1 18 ? 35.028 72.028  68.852 1.00 30.57  ? 18  DT  C O4    1 
ATOM   1219 C  C5    . DT  C 1 18 ? 36.894 71.051  69.949 1.00 31.30  ? 18  DT  C C5    1 
ATOM   1220 C  C7    . DT  C 1 18 ? 36.247 69.711  70.092 1.00 28.52  ? 18  DT  C C7    1 
ATOM   1221 C  C6    . DT  C 1 18 ? 38.128 71.315  70.396 1.00 31.50  ? 18  DT  C C6    1 
ATOM   1222 P  P     . DC  C 1 19 ? 42.901 72.855  73.981 1.00 45.68  ? 19  DC  C P     1 
ATOM   1223 O  OP1   . DC  C 1 19 ? 44.332 73.185  74.205 1.00 45.64  ? 19  DC  C OP1   1 
ATOM   1224 O  OP2   . DC  C 1 19 ? 42.250 71.806  74.803 1.00 44.49  ? 19  DC  C OP2   1 
ATOM   1225 O  "O5'" . DC  C 1 19 ? 42.051 74.195  74.098 1.00 45.66  ? 19  DC  C "O5'" 1 
ATOM   1226 C  "C5'" . DC  C 1 19 ? 42.386 75.323  73.292 1.00 47.00  ? 19  DC  C "C5'" 1 
ATOM   1227 C  "C4'" . DC  C 1 19 ? 41.374 76.428  73.479 1.00 48.08  ? 19  DC  C "C4'" 1 
ATOM   1228 O  "O4'" . DC  C 1 19 ? 40.134 76.111  72.799 1.00 47.84  ? 19  DC  C "O4'" 1 
ATOM   1229 C  "C3'" . DC  C 1 19 ? 41.003 76.722  74.932 1.00 49.56  ? 19  DC  C "C3'" 1 
ATOM   1230 O  "O3'" . DC  C 1 19 ? 40.942 78.135  75.127 1.00 52.93  ? 19  DC  C "O3'" 1 
ATOM   1231 C  "C2'" . DC  C 1 19 ? 39.623 76.105  75.076 1.00 47.81  ? 19  DC  C "C2'" 1 
ATOM   1232 C  "C1'" . DC  C 1 19 ? 39.046 76.307  73.686 1.00 45.99  ? 19  DC  C "C1'" 1 
ATOM   1233 N  N1    . DC  C 1 19 ? 37.976 75.372  73.306 1.00 42.27  ? 19  DC  C N1    1 
ATOM   1234 C  C2    . DC  C 1 19 ? 36.880 75.864  72.587 1.00 40.83  ? 19  DC  C C2    1 
ATOM   1235 O  O2    . DC  C 1 19 ? 36.846 77.070  72.295 1.00 40.78  ? 19  DC  C O2    1 
ATOM   1236 N  N3    . DC  C 1 19 ? 35.889 75.016  72.227 1.00 38.70  ? 19  DC  C N3    1 
ATOM   1237 C  C4    . DC  C 1 19 ? 35.967 73.723  72.554 1.00 39.39  ? 19  DC  C C4    1 
ATOM   1238 N  N4    . DC  C 1 19 ? 34.968 72.921  72.173 1.00 37.24  ? 19  DC  C N4    1 
ATOM   1239 C  C5    . DC  C 1 19 ? 37.073 73.194  73.286 1.00 39.30  ? 19  DC  C C5    1 
ATOM   1240 C  C6    . DC  C 1 19 ? 38.045 74.047  73.640 1.00 40.49  ? 19  DC  C C6    1 
ATOM   1241 P  P     . DC  C 1 20 ? 40.886 78.732  76.615 1.00 56.33  ? 20  DC  C P     1 
ATOM   1242 O  OP1   . DC  C 1 20 ? 41.987 79.721  76.742 1.00 55.94  ? 20  DC  C OP1   1 
ATOM   1243 O  OP2   . DC  C 1 20 ? 40.792 77.604  77.575 1.00 54.85  ? 20  DC  C OP2   1 
ATOM   1244 O  "O5'" . DC  C 1 20 ? 39.500 79.506  76.630 1.00 56.55  ? 20  DC  C "O5'" 1 
ATOM   1245 C  "C5'" . DC  C 1 20 ? 38.386 78.968  75.935 1.00 58.66  ? 20  DC  C "C5'" 1 
ATOM   1246 C  "C4'" . DC  C 1 20 ? 37.301 80.007  75.794 1.00 59.61  ? 20  DC  C "C4'" 1 
ATOM   1247 O  "O4'" . DC  C 1 20 ? 36.256 79.434  74.981 1.00 58.49  ? 20  DC  C "O4'" 1 
ATOM   1248 C  "C3'" . DC  C 1 20 ? 36.644 80.398  77.113 1.00 60.70  ? 20  DC  C "C3'" 1 
ATOM   1249 O  "O3'" . DC  C 1 20 ? 36.254 81.772  77.087 1.00 64.34  ? 20  DC  C "O3'" 1 
ATOM   1250 C  "C2'" . DC  C 1 20 ? 35.454 79.463  77.211 1.00 58.89  ? 20  DC  C "C2'" 1 
ATOM   1251 C  "C1'" . DC  C 1 20 ? 35.116 79.120  75.763 1.00 56.72  ? 20  DC  C "C1'" 1 
ATOM   1252 N  N1    . DC  C 1 20 ? 34.845 77.686  75.580 1.00 54.65  ? 20  DC  C N1    1 
ATOM   1253 C  C2    . DC  C 1 20 ? 33.692 77.293  74.896 1.00 52.98  ? 20  DC  C C2    1 
ATOM   1254 O  O2    . DC  C 1 20 ? 32.943 78.164  74.429 1.00 52.76  ? 20  DC  C O2    1 
ATOM   1255 N  N3    . DC  C 1 20 ? 33.421 75.974  74.763 1.00 52.22  ? 20  DC  C N3    1 
ATOM   1256 C  C4    . DC  C 1 20 ? 34.256 75.065  75.277 1.00 51.93  ? 20  DC  C C4    1 
ATOM   1257 N  N4    . DC  C 1 20 ? 33.936 73.777  75.144 1.00 51.42  ? 20  DC  C N4    1 
ATOM   1258 C  C5    . DC  C 1 20 ? 35.452 75.439  75.957 1.00 51.92  ? 20  DC  C C5    1 
ATOM   1259 C  C6    . DC  C 1 20 ? 35.705 76.747  76.083 1.00 52.73  ? 20  DC  C C6    1 
ATOM   1260 P  P     . DT  C 1 21 ? 35.321 82.356  78.255 1.00 66.90  ? 21  DT  C P     1 
ATOM   1261 O  OP1   . DT  C 1 21 ? 35.608 83.811  78.353 1.00 66.97  ? 21  DT  C OP1   1 
ATOM   1262 O  OP2   . DT  C 1 21 ? 35.462 81.493  79.458 1.00 65.61  ? 21  DT  C OP2   1 
ATOM   1263 O  "O5'" . DT  C 1 21 ? 33.854 82.169  77.669 1.00 65.46  ? 21  DT  C "O5'" 1 
ATOM   1264 C  "C5'" . DT  C 1 21 ? 32.703 82.492  78.439 1.00 64.99  ? 21  DT  C "C5'" 1 
ATOM   1265 C  "C4'" . DT  C 1 21 ? 31.487 82.519  77.544 1.00 63.21  ? 21  DT  C "C4'" 1 
ATOM   1266 O  "O4'" . DT  C 1 21 ? 31.467 81.297  76.772 1.00 62.67  ? 21  DT  C "O4'" 1 
ATOM   1267 C  "C3'" . DT  C 1 21 ? 30.153 82.560  78.282 1.00 62.79  ? 21  DT  C "C3'" 1 
ATOM   1268 O  "O3'" . DT  C 1 21 ? 29.145 83.073  77.408 1.00 61.96  ? 21  DT  C "O3'" 1 
ATOM   1269 C  "C2'" . DT  C 1 21 ? 29.848 81.088  78.476 1.00 62.07  ? 21  DT  C "C2'" 1 
ATOM   1270 C  "C1'" . DT  C 1 21 ? 30.386 80.475  77.189 1.00 61.86  ? 21  DT  C "C1'" 1 
ATOM   1271 N  N1    . DT  C 1 21 ? 30.901 79.103  77.347 1.00 60.45  ? 21  DT  C N1    1 
ATOM   1272 C  C2    . DT  C 1 21 ? 30.239 78.084  76.705 1.00 60.30  ? 21  DT  C C2    1 
ATOM   1273 O  O2    . DT  C 1 21 ? 29.252 78.266  76.008 1.00 60.78  ? 21  DT  C O2    1 
ATOM   1274 N  N3    . DT  C 1 21 ? 30.772 76.834  76.914 1.00 59.86  ? 21  DT  C N3    1 
ATOM   1275 C  C4    . DT  C 1 21 ? 31.874 76.514  77.684 1.00 59.72  ? 21  DT  C C4    1 
ATOM   1276 O  O4    . DT  C 1 21 ? 32.233 75.343  77.786 1.00 60.14  ? 21  DT  C O4    1 
ATOM   1277 C  C5    . DT  C 1 21 ? 32.521 77.632  78.325 1.00 60.12  ? 21  DT  C C5    1 
ATOM   1278 C  C7    . DT  C 1 21 ? 33.720 77.379  79.183 1.00 59.83  ? 21  DT  C C7    1 
ATOM   1279 C  C6    . DT  C 1 21 ? 32.013 78.856  78.123 1.00 60.17  ? 21  DT  C C6    1 
ATOM   1280 O  "O5'" . DT  D 2 1  ? 30.524 65.298  83.656 1.00 69.04  ? 1   DT  D "O5'" 1 
ATOM   1281 C  "C5'" . DT  D 2 1  ? 29.452 64.358  83.571 1.00 70.07  ? 1   DT  D "C5'" 1 
ATOM   1282 C  "C4'" . DT  D 2 1  ? 28.528 64.763  82.448 1.00 70.00  ? 1   DT  D "C4'" 1 
ATOM   1283 O  "O4'" . DT  D 2 1  ? 28.123 66.134  82.683 1.00 69.43  ? 1   DT  D "O4'" 1 
ATOM   1284 C  "C3'" . DT  D 2 1  ? 29.196 64.747  81.072 1.00 70.26  ? 1   DT  D "C3'" 1 
ATOM   1285 O  "O3'" . DT  D 2 1  ? 28.260 64.385  80.053 1.00 71.80  ? 1   DT  D "O3'" 1 
ATOM   1286 C  "C2'" . DT  D 2 1  ? 29.620 66.186  80.883 1.00 70.12  ? 1   DT  D "C2'" 1 
ATOM   1287 C  "C1'" . DT  D 2 1  ? 28.513 66.944  81.591 1.00 68.53  ? 1   DT  D "C1'" 1 
ATOM   1288 N  N1    . DT  D 2 1  ? 28.958 68.247  82.112 1.00 65.86  ? 1   DT  D N1    1 
ATOM   1289 C  C2    . DT  D 2 1  ? 28.065 69.289  82.114 1.00 64.56  ? 1   DT  D C2    1 
ATOM   1290 O  O2    . DT  D 2 1  ? 26.890 69.160  81.811 1.00 63.73  ? 1   DT  D O2    1 
ATOM   1291 N  N3    . DT  D 2 1  ? 28.599 70.494  82.497 1.00 63.97  ? 1   DT  D N3    1 
ATOM   1292 C  C4    . DT  D 2 1  ? 29.901 70.743  82.894 1.00 63.96  ? 1   DT  D C4    1 
ATOM   1293 O  O4    . DT  D 2 1  ? 30.251 71.884  83.178 1.00 64.13  ? 1   DT  D O4    1 
ATOM   1294 C  C5    . DT  D 2 1  ? 30.761 69.590  82.931 1.00 64.09  ? 1   DT  D C5    1 
ATOM   1295 C  C7    . DT  D 2 1  ? 32.173 69.754  83.395 1.00 64.41  ? 1   DT  D C7    1 
ATOM   1296 C  C6    . DT  D 2 1  ? 30.254 68.415  82.545 1.00 64.73  ? 1   DT  D C6    1 
ATOM   1297 P  P     . DT  D 2 2  ? 28.751 64.249  78.525 1.00 72.84  ? 2   DT  D P     1 
ATOM   1298 O  OP1   . DT  D 2 2  ? 28.883 62.805  78.200 1.00 73.48  ? 2   DT  D OP1   1 
ATOM   1299 O  OP2   . DT  D 2 2  ? 29.906 65.157  78.307 1.00 72.84  ? 2   DT  D OP2   1 
ATOM   1300 O  "O5'" . DT  D 2 2  ? 27.520 64.828  77.702 1.00 71.79  ? 2   DT  D "O5'" 1 
ATOM   1301 C  "C5'" . DT  D 2 2  ? 26.191 64.651  78.180 1.00 70.58  ? 2   DT  D "C5'" 1 
ATOM   1302 C  "C4'" . DT  D 2 2  ? 25.337 65.836  77.799 1.00 68.70  ? 2   DT  D "C4'" 1 
ATOM   1303 O  "O4'" . DT  D 2 2  ? 25.800 67.018  78.498 1.00 67.04  ? 2   DT  D "O4'" 1 
ATOM   1304 C  "C3'" . DT  D 2 2  ? 25.368 66.181  76.310 1.00 68.48  ? 2   DT  D "C3'" 1 
ATOM   1305 O  "O3'" . DT  D 2 2  ? 24.055 66.541  75.872 1.00 70.11  ? 2   DT  D "O3'" 1 
ATOM   1306 C  "C2'" . DT  D 2 2  ? 26.305 67.374  76.243 1.00 66.79  ? 2   DT  D "C2'" 1 
ATOM   1307 C  "C1'" . DT  D 2 2  ? 26.043 68.063  77.570 1.00 64.81  ? 2   DT  D "C1'" 1 
ATOM   1308 N  N1    . DT  D 2 2  ? 27.167 68.879  78.078 1.00 61.04  ? 2   DT  D N1    1 
ATOM   1309 C  C2    . DT  D 2 2  ? 26.946 70.223  78.292 1.00 59.43  ? 2   DT  D C2    1 
ATOM   1310 O  O2    . DT  D 2 2  ? 25.874 70.767  78.085 1.00 58.95  ? 2   DT  D O2    1 
ATOM   1311 N  N3    . DT  D 2 2  ? 28.033 70.915  78.760 1.00 58.07  ? 2   DT  D N3    1 
ATOM   1312 C  C4    . DT  D 2 2  ? 29.290 70.412  79.031 1.00 58.43  ? 2   DT  D C4    1 
ATOM   1313 O  O4    . DT  D 2 2  ? 30.166 71.156  79.464 1.00 58.14  ? 2   DT  D O4    1 
ATOM   1314 C  C5    . DT  D 2 2  ? 29.458 69.001  78.776 1.00 58.97  ? 2   DT  D C5    1 
ATOM   1315 C  C7    . DT  D 2 2  ? 30.797 68.379  79.015 1.00 59.00  ? 2   DT  D C7    1 
ATOM   1316 C  C6    . DT  D 2 2  ? 28.400 68.311  78.325 1.00 59.86  ? 2   DT  D C6    1 
ATOM   1317 P  P     . DA  D 2 3  ? 23.743 66.661  74.301 1.00 71.54  ? 3   DA  D P     1 
ATOM   1318 O  OP1   . DA  D 2 3  ? 22.622 65.738  73.985 1.00 71.18  ? 3   DA  D OP1   1 
ATOM   1319 O  OP2   . DA  D 2 3  ? 25.027 66.537  73.567 1.00 71.16  ? 3   DA  D OP2   1 
ATOM   1320 O  "O5'" . DA  D 2 3  ? 23.224 68.158  74.155 1.00 69.46  ? 3   DA  D "O5'" 1 
ATOM   1321 C  "C5'" . DA  D 2 3  ? 23.861 69.204  74.879 1.00 68.16  ? 3   DA  D "C5'" 1 
ATOM   1322 C  "C4'" . DA  D 2 3  ? 23.481 70.548  74.308 1.00 66.03  ? 3   DA  D "C4'" 1 
ATOM   1323 O  "O4'" . DA  D 2 3  ? 24.323 71.538  74.942 1.00 63.44  ? 3   DA  D "O4'" 1 
ATOM   1324 C  "C3'" . DA  D 2 3  ? 23.756 70.670  72.813 1.00 65.68  ? 3   DA  D "C3'" 1 
ATOM   1325 O  "O3'" . DA  D 2 3  ? 22.825 71.567  72.204 1.00 67.62  ? 3   DA  D "O3'" 1 
ATOM   1326 C  "C2'" . DA  D 2 3  ? 25.165 71.221  72.761 1.00 62.99  ? 3   DA  D "C2'" 1 
ATOM   1327 C  "C1'" . DA  D 2 3  ? 25.253 72.075  74.013 1.00 59.75  ? 3   DA  D "C1'" 1 
ATOM   1328 N  N9    . DA  D 2 3  ? 26.575 72.020  74.632 1.00 54.58  ? 3   DA  D N9    1 
ATOM   1329 C  C8    . DA  D 2 3  ? 27.352 70.908  74.855 1.00 51.61  ? 3   DA  D C8    1 
ATOM   1330 N  N7    . DA  D 2 3  ? 28.510 71.175  75.409 1.00 49.97  ? 3   DA  D N7    1 
ATOM   1331 C  C5    . DA  D 2 3  ? 28.492 72.553  75.567 1.00 49.62  ? 3   DA  D C5    1 
ATOM   1332 C  C6    . DA  D 2 3  ? 29.429 73.452  76.089 1.00 48.62  ? 3   DA  D C6    1 
ATOM   1333 N  N6    . DA  D 2 3  ? 30.617 73.084  76.572 1.00 48.14  ? 3   DA  D N6    1 
ATOM   1334 N  N1    . DA  D 2 3  ? 29.106 74.762  76.099 1.00 49.47  ? 3   DA  D N1    1 
ATOM   1335 C  C2    . DA  D 2 3  ? 27.911 75.132  75.616 1.00 50.48  ? 3   DA  D C2    1 
ATOM   1336 N  N3    . DA  D 2 3  ? 26.942 74.380  75.101 1.00 51.43  ? 3   DA  D N3    1 
ATOM   1337 C  C4    . DA  D 2 3  ? 27.302 73.085  75.101 1.00 51.44  ? 3   DA  D C4    1 
ATOM   1338 P  P     . DG  D 2 4  ? 22.788 71.704  70.604 1.00 70.39  ? 4   DG  D P     1 
ATOM   1339 O  OP1   . DG  D 2 4  ? 21.957 72.892  70.278 1.00 70.47  ? 4   DG  D OP1   1 
ATOM   1340 O  OP2   . DG  D 2 4  ? 22.445 70.382  70.018 1.00 70.50  ? 4   DG  D OP2   1 
ATOM   1341 O  "O5'" . DG  D 2 4  ? 24.297 72.036  70.227 1.00 68.82  ? 4   DG  D "O5'" 1 
ATOM   1342 C  "C5'" . DG  D 2 4  ? 24.609 72.887  69.133 1.00 67.77  ? 4   DG  D "C5'" 1 
ATOM   1343 C  "C4'" . DG  D 2 4  ? 24.770 74.308  69.617 1.00 65.41  ? 4   DG  D "C4'" 1 
ATOM   1344 O  "O4'" . DG  D 2 4  ? 25.561 74.323  70.828 1.00 63.88  ? 4   DG  D "O4'" 1 
ATOM   1345 C  "C3'" . DG  D 2 4  ? 25.491 75.218  68.628 1.00 64.71  ? 4   DG  D "C3'" 1 
ATOM   1346 O  "O3'" . DG  D 2 4  ? 24.941 76.535  68.668 1.00 64.74  ? 4   DG  D "O3'" 1 
ATOM   1347 C  "C2'" . DG  D 2 4  ? 26.924 75.207  69.125 1.00 62.84  ? 4   DG  D "C2'" 1 
ATOM   1348 C  "C1'" . DG  D 2 4  ? 26.767 75.046  70.630 1.00 60.02  ? 4   DG  D "C1'" 1 
ATOM   1349 N  N9    . DG  D 2 4  ? 27.843 74.281  71.249 1.00 55.15  ? 4   DG  D N9    1 
ATOM   1350 C  C8    . DG  D 2 4  ? 28.000 72.914  71.226 1.00 52.91  ? 4   DG  D C8    1 
ATOM   1351 N  N7    . DG  D 2 4  ? 29.066 72.508  71.857 1.00 51.27  ? 4   DG  D N7    1 
ATOM   1352 C  C5    . DG  D 2 4  ? 29.652 73.676  72.330 1.00 50.21  ? 4   DG  D C5    1 
ATOM   1353 C  C6    . DG  D 2 4  ? 30.834 73.866  73.086 1.00 48.58  ? 4   DG  D C6    1 
ATOM   1354 O  O6    . DG  D 2 4  ? 31.622 73.014  73.515 1.00 47.53  ? 4   DG  D O6    1 
ATOM   1355 N  N1    . DG  D 2 4  ? 31.064 75.211  73.344 1.00 47.77  ? 4   DG  D N1    1 
ATOM   1356 C  C2    . DG  D 2 4  ? 30.256 76.242  72.937 1.00 48.86  ? 4   DG  D C2    1 
ATOM   1357 N  N2    . DG  D 2 4  ? 30.650 77.474  73.291 1.00 48.39  ? 4   DG  D N2    1 
ATOM   1358 N  N3    . DG  D 2 4  ? 29.145 76.080  72.235 1.00 50.13  ? 4   DG  D N3    1 
ATOM   1359 C  C4    . DG  D 2 4  ? 28.908 74.777  71.967 1.00 51.67  ? 4   DG  D C4    1 
ATOM   1360 P  P     . DG  D 2 5  ? 25.119 77.505  67.401 1.00 65.45  ? 5   DG  D P     1 
ATOM   1361 O  OP1   . DG  D 2 5  ? 23.768 77.955  66.980 1.00 66.25  ? 5   DG  D OP1   1 
ATOM   1362 O  OP2   . DG  D 2 5  ? 26.005 76.820  66.426 1.00 64.98  ? 5   DG  D OP2   1 
ATOM   1363 O  "O5'" . DG  D 2 5  ? 25.907 78.751  67.995 1.00 63.61  ? 5   DG  D "O5'" 1 
ATOM   1364 C  "C5'" . DG  D 2 5  ? 27.032 78.544  68.839 1.00 61.01  ? 5   DG  D "C5'" 1 
ATOM   1365 C  "C4'" . DG  D 2 5  ? 28.060 79.627  68.623 1.00 57.63  ? 5   DG  D "C4'" 1 
ATOM   1366 O  "O4'" . DG  D 2 5  ? 29.247 79.235  69.346 1.00 56.15  ? 5   DG  D "O4'" 1 
ATOM   1367 C  "C3'" . DG  D 2 5  ? 28.500 79.789  67.171 1.00 56.32  ? 5   DG  D "C3'" 1 
ATOM   1368 O  "O3'" . DG  D 2 5  ? 28.881 81.143  66.919 1.00 55.66  ? 5   DG  D "O3'" 1 
ATOM   1369 C  "C2'" . DG  D 2 5  ? 29.680 78.846  67.049 1.00 54.40  ? 5   DG  D "C2'" 1 
ATOM   1370 C  "C1'" . DG  D 2 5  ? 30.264 78.802  68.454 1.00 52.44  ? 5   DG  D "C1'" 1 
ATOM   1371 N  N9    . DG  D 2 5  ? 30.636 77.446  68.850 1.00 48.51  ? 5   DG  D N9    1 
ATOM   1372 C  C8    . DG  D 2 5  ? 29.952 76.295  68.554 1.00 46.38  ? 5   DG  D C8    1 
ATOM   1373 N  N7    . DG  D 2 5  ? 30.526 75.223  69.027 1.00 44.28  ? 5   DG  D N7    1 
ATOM   1374 C  C5    . DG  D 2 5  ? 31.655 75.698  69.675 1.00 44.11  ? 5   DG  D C5    1 
ATOM   1375 C  C6    . DG  D 2 5  ? 32.664 75.003  70.372 1.00 42.67  ? 5   DG  D C6    1 
ATOM   1376 O  O6    . DG  D 2 5  ? 32.769 73.786  70.556 1.00 42.66  ? 5   DG  D O6    1 
ATOM   1377 N  N1    . DG  D 2 5  ? 33.624 75.870  70.882 1.00 42.88  ? 5   DG  D N1    1 
ATOM   1378 C  C2    . DG  D 2 5  ? 33.610 77.236  70.735 1.00 43.88  ? 5   DG  D C2    1 
ATOM   1379 N  N2    . DG  D 2 5  ? 34.621 77.904  71.307 1.00 44.34  ? 5   DG  D N2    1 
ATOM   1380 N  N3    . DG  D 2 5  ? 32.674 77.896  70.079 1.00 45.19  ? 5   DG  D N3    1 
ATOM   1381 C  C4    . DG  D 2 5  ? 31.735 77.073  69.580 1.00 45.58  ? 5   DG  D C4    1 
ATOM   1382 P  P     . DA  D 2 6  ? 29.473 81.550  65.483 1.00 55.54  ? 6   DA  D P     1 
ATOM   1383 O  OP1   . DA  D 2 6  ? 29.060 82.952  65.224 1.00 55.27  ? 6   DA  D OP1   1 
ATOM   1384 O  OP2   . DA  D 2 6  ? 29.140 80.487  64.497 1.00 54.89  ? 6   DA  D OP2   1 
ATOM   1385 O  "O5'" . DA  D 2 6  ? 31.047 81.541  65.716 1.00 52.35  ? 6   DA  D "O5'" 1 
ATOM   1386 C  "C5'" . DA  D 2 6  ? 31.627 82.342  66.739 1.00 47.62  ? 6   DA  D "C5'" 1 
ATOM   1387 C  "C4'" . DA  D 2 6  ? 33.123 82.147  66.768 1.00 44.62  ? 6   DA  D "C4'" 1 
ATOM   1388 O  "O4'" . DA  D 2 6  ? 33.445 80.830  67.279 1.00 41.25  ? 6   DA  D "O4'" 1 
ATOM   1389 C  "C3'" . DA  D 2 6  ? 33.793 82.254  65.399 1.00 43.27  ? 6   DA  D "C3'" 1 
ATOM   1390 O  "O3'" . DA  D 2 6  ? 34.998 83.008  65.516 1.00 43.10  ? 6   DA  D "O3'" 1 
ATOM   1391 C  "C2'" . DA  D 2 6  ? 34.074 80.808  65.021 1.00 41.80  ? 6   DA  D "C2'" 1 
ATOM   1392 C  "C1'" . DA  D 2 6  ? 34.285 80.138  66.370 1.00 39.41  ? 6   DA  D "C1'" 1 
ATOM   1393 N  N9    . DA  D 2 6  ? 33.916 78.722  66.415 1.00 35.05  ? 6   DA  D N9    1 
ATOM   1394 C  C8    . DA  D 2 6  ? 32.848 78.107  65.806 1.00 34.68  ? 6   DA  D C8    1 
ATOM   1395 N  N7    . DA  D 2 6  ? 32.768 76.820  66.046 1.00 31.98  ? 6   DA  D N7    1 
ATOM   1396 C  C5    . DA  D 2 6  ? 33.860 76.566  66.865 1.00 31.61  ? 6   DA  D C5    1 
ATOM   1397 C  C6    . DA  D 2 6  ? 34.333 75.387  67.474 1.00 29.49  ? 6   DA  D C6    1 
ATOM   1398 N  N6    . DA  D 2 6  ? 33.740 74.198  67.352 1.00 27.00  ? 6   DA  D N6    1 
ATOM   1399 N  N1    . DA  D 2 6  ? 35.448 75.476  68.228 1.00 28.11  ? 6   DA  D N1    1 
ATOM   1400 C  C2    . DA  D 2 6  ? 36.038 76.667  68.361 1.00 29.76  ? 6   DA  D C2    1 
ATOM   1401 N  N3    . DA  D 2 6  ? 35.689 77.847  67.843 1.00 32.18  ? 6   DA  D N3    1 
ATOM   1402 C  C4    . DA  D 2 6  ? 34.578 77.726  67.096 1.00 33.27  ? 6   DA  D C4    1 
ATOM   1403 P  P     . DA  D 2 7  ? 35.808 83.428  64.196 1.00 42.93  ? 7   DA  D P     1 
ATOM   1404 O  OP1   . DA  D 2 7  ? 36.023 84.897  64.244 1.00 42.35  ? 7   DA  D OP1   1 
ATOM   1405 O  OP2   . DA  D 2 7  ? 35.160 82.814  63.009 1.00 42.75  ? 7   DA  D OP2   1 
ATOM   1406 O  "O5'" . DA  D 2 7  ? 37.216 82.728  64.419 1.00 37.90  ? 7   DA  D "O5'" 1 
ATOM   1407 C  "C5'" . DA  D 2 7  ? 37.860 82.833  65.678 1.00 31.85  ? 7   DA  D "C5'" 1 
ATOM   1408 C  "C4'" . DA  D 2 7  ? 38.944 81.791  65.806 1.00 27.17  ? 7   DA  D "C4'" 1 
ATOM   1409 O  "O4'" . DA  D 2 7  ? 38.376 80.469  65.972 1.00 25.30  ? 7   DA  D "O4'" 1 
ATOM   1410 C  "C3'" . DA  D 2 7  ? 39.911 81.705  64.629 1.00 24.46  ? 7   DA  D "C3'" 1 
ATOM   1411 O  "O3'" . DA  D 2 7  ? 41.220 81.620  65.173 1.00 22.14  ? 7   DA  D "O3'" 1 
ATOM   1412 C  "C2'" . DA  D 2 7  ? 39.511 80.415  63.926 1.00 24.60  ? 7   DA  D "C2'" 1 
ATOM   1413 C  "C1'" . DA  D 2 7  ? 38.980 79.560  65.067 1.00 25.19  ? 7   DA  D "C1'" 1 
ATOM   1414 N  N9    . DA  D 2 7  ? 37.965 78.570  64.693 1.00 24.04  ? 7   DA  D N9    1 
ATOM   1415 C  C8    . DA  D 2 7  ? 36.871 78.745  63.881 1.00 24.06  ? 7   DA  D C8    1 
ATOM   1416 N  N7    . DA  D 2 7  ? 36.124 77.670  63.760 1.00 22.61  ? 7   DA  D N7    1 
ATOM   1417 C  C5    . DA  D 2 7  ? 36.772 76.722  64.540 1.00 23.69  ? 7   DA  D C5    1 
ATOM   1418 C  C6    . DA  D 2 7  ? 36.484 75.371  64.832 1.00 23.73  ? 7   DA  D C6    1 
ATOM   1419 N  N6    . DA  D 2 7  ? 35.419 74.716  64.361 1.00 23.24  ? 7   DA  D N6    1 
ATOM   1420 N  N1    . DA  D 2 7  ? 37.339 74.708  65.638 1.00 22.25  ? 7   DA  D N1    1 
ATOM   1421 C  C2    . DA  D 2 7  ? 38.403 75.364  66.122 1.00 23.67  ? 7   DA  D C2    1 
ATOM   1422 N  N3    . DA  D 2 7  ? 38.778 76.628  65.925 1.00 23.01  ? 7   DA  D N3    1 
ATOM   1423 C  C4    . DA  D 2 7  ? 37.913 77.259  65.115 1.00 23.78  ? 7   DA  D C4    1 
ATOM   1424 P  P     . DA  D 2 8  ? 42.495 81.655  64.217 1.00 21.98  ? 8   DA  D P     1 
ATOM   1425 O  OP1   . DA  D 2 8  ? 43.557 82.371  64.960 1.00 21.13  ? 8   DA  D OP1   1 
ATOM   1426 O  OP2   . DA  D 2 8  ? 42.114 82.107  62.850 1.00 21.71  ? 8   DA  D OP2   1 
ATOM   1427 O  "O5'" . DA  D 2 8  ? 42.920 80.125  64.167 1.00 20.41  ? 8   DA  D "O5'" 1 
ATOM   1428 C  "C5'" . DA  D 2 8  ? 43.072 79.400  65.382 1.00 20.99  ? 8   DA  D "C5'" 1 
ATOM   1429 C  "C4'" . DA  D 2 8  ? 43.245 77.925  65.107 1.00 20.11  ? 8   DA  D "C4'" 1 
ATOM   1430 O  "O4'" . DA  D 2 8  ? 41.985 77.313  64.744 1.00 20.33  ? 8   DA  D "O4'" 1 
ATOM   1431 C  "C3'" . DA  D 2 8  ? 44.241 77.564  64.002 1.00 20.01  ? 8   DA  D "C3'" 1 
ATOM   1432 O  "O3'" . DA  D 2 8  ? 45.077 76.504  64.484 1.00 18.76  ? 8   DA  D "O3'" 1 
ATOM   1433 C  "C2'" . DA  D 2 8  ? 43.341 77.087  62.868 1.00 19.48  ? 8   DA  D "C2'" 1 
ATOM   1434 C  "C1'" . DA  D 2 8  ? 42.204 76.443  63.645 1.00 20.65  ? 8   DA  D "C1'" 1 
ATOM   1435 N  N9    . DA  D 2 8  ? 40.927 76.267  62.947 1.00 19.59  ? 8   DA  D N9    1 
ATOM   1436 C  C8    . DA  D 2 8  ? 40.229 77.180  62.201 1.00 20.13  ? 8   DA  D C8    1 
ATOM   1437 N  N7    . DA  D 2 8  ? 39.086 76.727  61.743 1.00 21.36  ? 8   DA  D N7    1 
ATOM   1438 C  C5    . DA  D 2 8  ? 39.033 75.420  62.210 1.00 19.48  ? 8   DA  D C5    1 
ATOM   1439 C  C6    . DA  D 2 8  ? 38.071 74.402  62.073 1.00 19.42  ? 8   DA  D C6    1 
ATOM   1440 N  N6    . DA  D 2 8  ? 36.933 74.550  61.395 1.00 19.23  ? 8   DA  D N6    1 
ATOM   1441 N  N1    . DA  D 2 8  ? 38.321 73.211  62.668 1.00 18.83  ? 8   DA  D N1    1 
ATOM   1442 C  C2    . DA  D 2 8  ? 39.465 73.066  63.350 1.00 19.84  ? 8   DA  D C2    1 
ATOM   1443 N  N3    . DA  D 2 8  ? 40.446 73.948  63.546 1.00 18.51  ? 8   DA  D N3    1 
ATOM   1444 C  C4    . DA  D 2 8  ? 40.163 75.118  62.947 1.00 21.02  ? 8   DA  D C4    1 
ATOM   1445 P  P     . DA  D 2 9  ? 46.506 76.224  63.809 1.00 20.52  ? 9   DA  D P     1 
ATOM   1446 O  OP1   . DA  D 2 9  ? 47.481 75.934  64.876 1.00 20.60  ? 9   DA  D OP1   1 
ATOM   1447 O  OP2   . DA  D 2 9  ? 46.807 77.231  62.762 1.00 22.55  ? 9   DA  D OP2   1 
ATOM   1448 O  "O5'" . DA  D 2 9  ? 46.300 74.841  63.073 1.00 22.05  ? 9   DA  D "O5'" 1 
ATOM   1449 C  "C5'" . DA  D 2 9  ? 45.018 74.452  62.689 1.00 26.33  ? 9   DA  D "C5'" 1 
ATOM   1450 C  "C4'" . DA  D 2 9  ? 44.897 72.955  62.757 1.00 21.35  ? 9   DA  D "C4'" 1 
ATOM   1451 O  "O4'" . DA  D 2 9  ? 43.502 72.722  62.507 1.00 20.99  ? 9   DA  D "O4'" 1 
ATOM   1452 C  "C3'" . DA  D 2 9  ? 45.675 72.229  61.658 1.00 19.23  ? 9   DA  D "C3'" 1 
ATOM   1453 O  "O3'" . DA  D 2 9  ? 46.211 70.981  62.140 1.00 16.91  ? 9   DA  D "O3'" 1 
ATOM   1454 C  "C2'" . DA  D 2 9  ? 44.652 72.074  60.545 1.00 19.51  ? 9   DA  D "C2'" 1 
ATOM   1455 C  "C1'" . DA  D 2 9  ? 43.313 72.071  61.267 1.00 19.38  ? 9   DA  D "C1'" 1 
ATOM   1456 N  N9    . DA  D 2 9  ? 42.246 72.787  60.571 1.00 18.29  ? 9   DA  D N9    1 
ATOM   1457 C  C8    . DA  D 2 9  ? 42.254 74.079  60.099 1.00 16.54  ? 9   DA  D C8    1 
ATOM   1458 N  N7    . DA  D 2 9  ? 41.134 74.433  59.517 1.00 18.61  ? 9   DA  D N7    1 
ATOM   1459 C  C5    . DA  D 2 9  ? 40.338 73.297  59.607 1.00 18.19  ? 9   DA  D C5    1 
ATOM   1460 C  C6    . DA  D 2 9  ? 39.032 73.024  59.171 1.00 20.02  ? 9   DA  D C6    1 
ATOM   1461 N  N6    . DA  D 2 9  ? 38.274 73.910  58.514 1.00 19.09  ? 9   DA  D N6    1 
ATOM   1462 N  N1    . DA  D 2 9  ? 38.523 71.793  59.433 1.00 18.50  ? 9   DA  D N1    1 
ATOM   1463 C  C2    . DA  D 2 9  ? 39.293 70.909  60.082 1.00 17.89  ? 9   DA  D C2    1 
ATOM   1464 N  N3    . DA  D 2 9  ? 40.543 71.049  60.533 1.00 16.52  ? 9   DA  D N3    1 
ATOM   1465 C  C4    . DA  D 2 9  ? 41.009 72.279  60.260 1.00 18.55  ? 9   DA  D C4    1 
ATOM   1466 P  P     . DT  D 2 10 ? 47.055 70.027  61.156 1.00 19.92  ? 10  DT  D P     1 
ATOM   1467 O  OP1   . DT  D 2 10 ? 47.891 69.134  62.003 1.00 18.44  ? 10  DT  D OP1   1 
ATOM   1468 O  OP2   . DT  D 2 10 ? 47.700 70.806  60.074 1.00 17.65  ? 10  DT  D OP2   1 
ATOM   1469 O  "O5'" . DT  D 2 10 ? 45.918 69.131  60.499 1.00 19.21  ? 10  DT  D "O5'" 1 
ATOM   1470 C  "C5'" . DT  D 2 10 ? 44.964 68.489  61.336 1.00 20.36  ? 10  DT  D "C5'" 1 
ATOM   1471 C  "C4'" . DT  D 2 10 ? 43.960 67.721  60.512 1.00 20.93  ? 10  DT  D "C4'" 1 
ATOM   1472 O  "O4'" . DT  D 2 10 ? 42.974 68.621  59.950 1.00 18.39  ? 10  DT  D "O4'" 1 
ATOM   1473 C  "C3'" . DT  D 2 10 ? 44.528 66.910  59.345 1.00 20.08  ? 10  DT  D "C3'" 1 
ATOM   1474 O  "O3'" . DT  D 2 10 ? 44.024 65.571  59.432 1.00 23.96  ? 10  DT  D "O3'" 1 
ATOM   1475 C  "C2'" . DT  D 2 10 ? 43.993 67.641  58.116 1.00 19.83  ? 10  DT  D "C2'" 1 
ATOM   1476 C  "C1'" . DT  D 2 10 ? 42.683 68.203  58.635 1.00 18.77  ? 10  DT  D "C1'" 1 
ATOM   1477 N  N1    . DT  D 2 10 ? 42.082 69.354  57.917 1.00 18.83  ? 10  DT  D N1    1 
ATOM   1478 C  C2    . DT  D 2 10 ? 40.760 69.250  57.543 1.00 18.50  ? 10  DT  D C2    1 
ATOM   1479 O  O2    . DT  D 2 10 ? 40.080 68.262  57.764 1.00 17.91  ? 10  DT  D O2    1 
ATOM   1480 N  N3    . DT  D 2 10 ? 40.255 70.350  56.902 1.00 16.22  ? 10  DT  D N3    1 
ATOM   1481 C  C4    . DT  D 2 10 ? 40.920 71.524  56.610 1.00 16.07  ? 10  DT  D C4    1 
ATOM   1482 O  O4    . DT  D 2 10 ? 40.324 72.430  56.045 1.00 13.89  ? 10  DT  D O4    1 
ATOM   1483 C  C5    . DT  D 2 10 ? 42.309 71.570  57.028 1.00 17.49  ? 10  DT  D C5    1 
ATOM   1484 C  C7    . DT  D 2 10 ? 43.110 72.809  56.763 1.00 16.87  ? 10  DT  D C7    1 
ATOM   1485 C  C6    . DT  D 2 10 ? 42.816 70.493  57.646 1.00 17.37  ? 10  DT  D C6    1 
ATOM   1486 P  P     . DT  D 2 11 ? 44.688 64.396  58.552 1.00 25.22  ? 11  DT  D P     1 
ATOM   1487 O  OP1   . DT  D 2 11 ? 44.753 63.187  59.400 1.00 26.61  ? 11  DT  D OP1   1 
ATOM   1488 O  OP2   . DT  D 2 11 ? 45.901 64.877  57.847 1.00 23.42  ? 11  DT  D OP2   1 
ATOM   1489 O  "O5'" . DT  D 2 11 ? 43.576 64.128  57.462 1.00 25.01  ? 11  DT  D "O5'" 1 
ATOM   1490 C  "C5'" . DT  D 2 11 ? 42.717 65.169  57.104 1.00 28.39  ? 11  DT  D "C5'" 1 
ATOM   1491 C  "C4'" . DT  D 2 11 ? 41.449 64.628  56.511 1.00 24.46  ? 11  DT  D "C4'" 1 
ATOM   1492 O  "O4'" . DT  D 2 11 ? 40.746 65.817  56.108 1.00 23.67  ? 11  DT  D "O4'" 1 
ATOM   1493 C  "C3'" . DT  D 2 11 ? 41.669 63.799  55.245 1.00 23.42  ? 11  DT  D "C3'" 1 
ATOM   1494 O  "O3'" . DT  D 2 11 ? 40.682 62.753  55.155 1.00 26.04  ? 11  DT  D "O3'" 1 
ATOM   1495 C  "C2'" . DT  D 2 11 ? 41.583 64.831  54.132 1.00 21.02  ? 11  DT  D "C2'" 1 
ATOM   1496 C  "C1'" . DT  D 2 11 ? 40.685 65.925  54.702 1.00 21.82  ? 11  DT  D "C1'" 1 
ATOM   1497 N  N1    . DT  D 2 11 ? 41.068 67.318  54.354 1.00 17.38  ? 11  DT  D N1    1 
ATOM   1498 C  C2    . DT  D 2 11 ? 40.077 68.138  53.878 1.00 18.09  ? 11  DT  D C2    1 
ATOM   1499 O  O2    . DT  D 2 11 ? 38.922 67.762  53.725 1.00 17.50  ? 11  DT  D O2    1 
ATOM   1500 N  N3    . DT  D 2 11 ? 40.485 69.416  53.568 1.00 15.14  ? 11  DT  D N3    1 
ATOM   1501 C  C4    . DT  D 2 11 ? 41.765 69.927  53.654 1.00 14.96  ? 11  DT  D C4    1 
ATOM   1502 O  O4    . DT  D 2 11 ? 41.988 71.075  53.287 1.00 16.62  ? 11  DT  D O4    1 
ATOM   1503 C  C5    . DT  D 2 11 ? 42.762 69.017  54.167 1.00 16.92  ? 11  DT  D C5    1 
ATOM   1504 C  C7    . DT  D 2 11 ? 44.174 69.494  54.299 1.00 14.52  ? 11  DT  D C7    1 
ATOM   1505 C  C6    . DT  D 2 11 ? 42.369 67.771  54.497 1.00 13.75  ? 11  DT  D C6    1 
ATOM   1506 P  P     . DT  D 2 12 ? 40.924 61.484  54.182 1.00 25.06  ? 12  DT  D P     1 
ATOM   1507 O  OP1   . DT  D 2 12 ? 40.382 60.274  54.863 1.00 29.14  ? 12  DT  D OP1   1 
ATOM   1508 O  OP2   . DT  D 2 12 ? 42.294 61.465  53.630 1.00 23.22  ? 12  DT  D OP2   1 
ATOM   1509 O  "O5'" . DT  D 2 12 ? 39.953 61.779  52.972 1.00 27.35  ? 12  DT  D "O5'" 1 
ATOM   1510 C  "C5'" . DT  D 2 12 ? 39.573 63.097  52.704 1.00 29.90  ? 12  DT  D "C5'" 1 
ATOM   1511 C  "C4'" . DT  D 2 12 ? 38.410 63.117  51.757 1.00 25.57  ? 12  DT  D "C4'" 1 
ATOM   1512 O  "O4'" . DT  D 2 12 ? 38.194 64.515  51.509 1.00 23.52  ? 12  DT  D "O4'" 1 
ATOM   1513 C  "C3'" . DT  D 2 12 ? 38.719 62.474  50.407 1.00 23.37  ? 12  DT  D "C3'" 1 
ATOM   1514 O  "O3'" . DT  D 2 12 ? 37.546 61.848  49.885 1.00 21.59  ? 12  DT  D "O3'" 1 
ATOM   1515 C  "C2'" . DT  D 2 12 ? 39.218 63.633  49.561 1.00 21.33  ? 12  DT  D "C2'" 1 
ATOM   1516 C  "C1'" . DT  D 2 12 ? 38.559 64.860  50.187 1.00 21.98  ? 12  DT  D "C1'" 1 
ATOM   1517 N  N1    . DT  D 2 12 ? 39.432 66.048  50.280 1.00 18.25  ? 12  DT  D N1    1 
ATOM   1518 C  C2    . DT  D 2 12 ? 38.882 67.266  49.959 1.00 18.21  ? 12  DT  D C2    1 
ATOM   1519 O  O2    . DT  D 2 12 ? 37.721 67.405  49.605 1.00 15.97  ? 12  DT  D O2    1 
ATOM   1520 N  N3    . DT  D 2 12 ? 39.744 68.325  50.060 1.00 13.72  ? 12  DT  D N3    1 
ATOM   1521 C  C4    . DT  D 2 12 ? 41.066 68.294  50.437 1.00 14.89  ? 12  DT  D C4    1 
ATOM   1522 O  O4    . DT  D 2 12 ? 41.707 69.340  50.481 1.00 15.63  ? 12  DT  D O4    1 
ATOM   1523 C  C5    . DT  D 2 12 ? 41.590 66.983  50.759 1.00 14.65  ? 12  DT  D C5    1 
ATOM   1524 C  C7    . DT  D 2 12 ? 43.028 66.855  51.162 1.00 14.60  ? 12  DT  D C7    1 
ATOM   1525 C  C6    . DT  D 2 12 ? 40.754 65.936  50.674 1.00 14.83  ? 12  DT  D C6    1 
ATOM   1526 P  P     . DG  D 2 13 ? 37.641 60.944  48.555 1.00 18.46  ? 13  DG  D P     1 
ATOM   1527 O  OP1   . DG  D 2 13 ? 36.580 59.918  48.690 1.00 19.89  ? 13  DG  D OP1   1 
ATOM   1528 O  OP2   . DG  D 2 13 ? 39.021 60.525  48.254 1.00 17.36  ? 13  DG  D OP2   1 
ATOM   1529 O  "O5'" . DG  D 2 13 ? 37.175 61.958  47.423 1.00 16.92  ? 13  DG  D "O5'" 1 
ATOM   1530 C  "C5'" . DG  D 2 13 ? 35.909 62.585  47.545 1.00 19.85  ? 13  DG  D "C5'" 1 
ATOM   1531 C  "C4'" . DG  D 2 13 ? 35.779 63.721  46.561 1.00 23.41  ? 13  DG  D "C4'" 1 
ATOM   1532 O  "O4'" . DG  D 2 13 ? 36.648 64.824  46.914 1.00 21.38  ? 13  DG  D "O4'" 1 
ATOM   1533 C  "C3'" . DG  D 2 13 ? 36.097 63.378  45.107 1.00 23.03  ? 13  DG  D "C3'" 1 
ATOM   1534 O  "O3'" . DG  D 2 13 ? 35.092 63.994  44.308 1.00 26.28  ? 13  DG  D "O3'" 1 
ATOM   1535 C  "C2'" . DG  D 2 13 ? 37.442 64.045  44.877 1.00 22.15  ? 13  DG  D "C2'" 1 
ATOM   1536 C  "C1'" . DG  D 2 13 ? 37.292 65.280  45.740 1.00 19.97  ? 13  DG  D "C1'" 1 
ATOM   1537 N  N9    . DG  D 2 13 ? 38.528 65.949  46.136 1.00 18.57  ? 13  DG  D N9    1 
ATOM   1538 C  C8    . DG  D 2 13 ? 39.661 65.380  46.668 1.00 18.81  ? 13  DG  D C8    1 
ATOM   1539 N  N7    . DG  D 2 13 ? 40.589 66.260  46.944 1.00 17.11  ? 13  DG  D N7    1 
ATOM   1540 C  C5    . DG  D 2 13 ? 40.031 67.476  46.572 1.00 16.37  ? 13  DG  D C5    1 
ATOM   1541 C  C6    . DG  D 2 13 ? 40.557 68.788  46.653 1.00 14.38  ? 13  DG  D C6    1 
ATOM   1542 O  O6    . DG  D 2 13 ? 41.630 69.144  47.132 1.00 15.29  ? 13  DG  D O6    1 
ATOM   1543 N  N1    . DG  D 2 13 ? 39.681 69.731  46.127 1.00 14.86  ? 13  DG  D N1    1 
ATOM   1544 C  C2    . DG  D 2 13 ? 38.439 69.453  45.617 1.00 16.58  ? 13  DG  D C2    1 
ATOM   1545 N  N2    . DG  D 2 13 ? 37.743 70.503  45.146 1.00 15.77  ? 13  DG  D N2    1 
ATOM   1546 N  N3    . DG  D 2 13 ? 37.918 68.236  45.569 1.00 16.58  ? 13  DG  D N3    1 
ATOM   1547 C  C4    . DG  D 2 13 ? 38.767 67.303  46.055 1.00 16.75  ? 13  DG  D C4    1 
ATOM   1548 P  P     . DT  D 2 14 ? 35.120 63.837  42.719 1.00 29.23  ? 14  DT  D P     1 
ATOM   1549 O  OP1   . DT  D 2 14 ? 33.759 63.370  42.353 1.00 30.62  ? 14  DT  D OP1   1 
ATOM   1550 O  OP2   . DT  D 2 14 ? 36.311 63.073  42.276 1.00 29.39  ? 14  DT  D OP2   1 
ATOM   1551 O  "O5'" . DT  D 2 14 ? 35.282 65.339  42.219 1.00 29.93  ? 14  DT  D "O5'" 1 
ATOM   1552 C  "C5'" . DT  D 2 14 ? 34.404 66.346  42.710 1.00 27.55  ? 14  DT  D "C5'" 1 
ATOM   1553 C  "C4'" . DT  D 2 14 ? 34.734 67.684  42.096 1.00 25.79  ? 14  DT  D "C4'" 1 
ATOM   1554 O  "O4'" . DT  D 2 14 ? 35.986 68.181  42.625 1.00 24.67  ? 14  DT  D "O4'" 1 
ATOM   1555 C  "C3'" . DT  D 2 14 ? 34.869 67.705  40.573 1.00 25.92  ? 14  DT  D "C3'" 1 
ATOM   1556 O  "O3'" . DT  D 2 14 ? 34.195 68.870  40.084 1.00 28.45  ? 14  DT  D "O3'" 1 
ATOM   1557 C  "C2'" . DT  D 2 14 ? 36.371 67.783  40.348 1.00 24.37  ? 14  DT  D "C2'" 1 
ATOM   1558 C  "C1'" . DT  D 2 14 ? 36.845 68.567  41.564 1.00 22.65  ? 14  DT  D "C1'" 1 
ATOM   1559 N  N1    . DT  D 2 14 ? 38.236 68.313  42.013 1.00 18.83  ? 14  DT  D N1    1 
ATOM   1560 C  C2    . DT  D 2 14 ? 39.062 69.400  42.178 1.00 18.30  ? 14  DT  D C2    1 
ATOM   1561 O  O2    . DT  D 2 14 ? 38.720 70.540  41.905 1.00 16.92  ? 14  DT  D O2    1 
ATOM   1562 N  N3    . DT  D 2 14 ? 40.312 69.106  42.668 1.00 15.00  ? 14  DT  D N3    1 
ATOM   1563 C  C4    . DT  D 2 14 ? 40.813 67.852  42.979 1.00 16.17  ? 14  DT  D C4    1 
ATOM   1564 O  O4    . DT  D 2 14 ? 41.955 67.741  43.422 1.00 15.20  ? 14  DT  D O4    1 
ATOM   1565 C  C5    . DT  D 2 14 ? 39.901 66.749  42.746 1.00 17.72  ? 14  DT  D C5    1 
ATOM   1566 C  C7    . DT  D 2 14 ? 40.360 65.353  43.036 1.00 16.51  ? 14  DT  D C7    1 
ATOM   1567 C  C6    . DT  D 2 14 ? 38.675 67.032  42.278 1.00 17.20  ? 14  DT  D C6    1 
ATOM   1568 P  P     . DT  D 2 15 ? 34.173 69.191  38.510 1.00 30.69  ? 15  DT  D P     1 
ATOM   1569 O  OP1   . DT  D 2 15 ? 32.812 69.705  38.227 1.00 30.27  ? 15  DT  D OP1   1 
ATOM   1570 O  OP2   . DT  D 2 15 ? 34.714 68.060  37.730 1.00 28.67  ? 15  DT  D OP2   1 
ATOM   1571 O  "O5'" . DT  D 2 15 ? 35.181 70.417  38.388 1.00 26.68  ? 15  DT  D "O5'" 1 
ATOM   1572 C  "C5'" . DT  D 2 15 ? 35.010 71.548  39.228 1.00 23.24  ? 15  DT  D "C5'" 1 
ATOM   1573 C  "C4'" . DT  D 2 15 ? 36.098 72.565  38.983 1.00 20.58  ? 15  DT  D "C4'" 1 
ATOM   1574 O  "O4'" . DT  D 2 15 ? 37.362 72.095  39.515 1.00 15.70  ? 15  DT  D "O4'" 1 
ATOM   1575 C  "C3'" . DT  D 2 15 ? 36.342 72.943  37.519 1.00 18.31  ? 15  DT  D "C3'" 1 
ATOM   1576 O  "O3'" . DT  D 2 15 ? 36.355 74.369  37.444 1.00 20.70  ? 15  DT  D "O3'" 1 
ATOM   1577 C  "C2'" . DT  D 2 15 ? 37.700 72.329  37.207 1.00 18.22  ? 15  DT  D "C2'" 1 
ATOM   1578 C  "C1'" . DT  D 2 15 ? 38.390 72.311  38.567 1.00 17.93  ? 15  DT  D "C1'" 1 
ATOM   1579 N  N1    . DT  D 2 15 ? 39.422 71.269  38.781 1.00 17.65  ? 15  DT  D N1    1 
ATOM   1580 C  C2    . DT  D 2 15 ? 40.658 71.671  39.239 1.00 17.65  ? 15  DT  D C2    1 
ATOM   1581 O  O2    . DT  D 2 15 ? 40.966 72.843  39.398 1.00 16.77  ? 15  DT  D O2    1 
ATOM   1582 N  N3    . DT  D 2 15 ? 41.528 70.646  39.511 1.00 14.27  ? 15  DT  D N3    1 
ATOM   1583 C  C4    . DT  D 2 15 ? 41.298 69.291  39.360 1.00 16.49  ? 15  DT  D C4    1 
ATOM   1584 O  O4    . DT  D 2 15 ? 42.162 68.485  39.703 1.00 16.89  ? 15  DT  D O4    1 
ATOM   1585 C  C5    . DT  D 2 15 ? 40.006 68.941  38.811 1.00 17.48  ? 15  DT  D C5    1 
ATOM   1586 C  C7    . DT  D 2 15 ? 39.695 67.497  38.543 1.00 17.88  ? 15  DT  D C7    1 
ATOM   1587 C  C6    . DT  D 2 15 ? 39.141 69.934  38.556 1.00 17.77  ? 15  DT  D C6    1 
ATOM   1588 P  P     . DT  D 2 16 ? 36.638 75.116  36.049 1.00 23.04  ? 16  DT  D P     1 
ATOM   1589 O  OP1   . DT  D 2 16 ? 35.861 76.375  36.119 1.00 21.79  ? 16  DT  D OP1   1 
ATOM   1590 O  OP2   . DT  D 2 16 ? 36.461 74.202  34.889 1.00 19.95  ? 16  DT  D OP2   1 
ATOM   1591 O  "O5'" . DT  D 2 16 ? 38.171 75.487  36.180 1.00 19.60  ? 16  DT  D "O5'" 1 
ATOM   1592 C  "C5'" . DT  D 2 16 ? 38.611 76.194  37.329 1.00 18.88  ? 16  DT  D "C5'" 1 
ATOM   1593 C  "C4'" . DT  D 2 16 ? 40.091 76.471  37.246 1.00 18.07  ? 16  DT  D "C4'" 1 
ATOM   1594 O  "O4'" . DT  D 2 16 ? 40.860 75.277  37.519 1.00 17.13  ? 16  DT  D "O4'" 1 
ATOM   1595 C  "C3'" . DT  D 2 16 ? 40.587 77.017  35.910 1.00 16.58  ? 16  DT  D "C3'" 1 
ATOM   1596 O  "O3'" . DT  D 2 16 ? 41.354 78.181  36.198 1.00 16.65  ? 16  DT  D "O3'" 1 
ATOM   1597 C  "C2'" . DT  D 2 16 ? 41.444 75.886  35.346 1.00 15.58  ? 16  DT  D "C2'" 1 
ATOM   1598 C  "C1'" . DT  D 2 16 ? 41.930 75.171  36.602 1.00 15.48  ? 16  DT  D "C1'" 1 
ATOM   1599 N  N1    . DT  D 2 16 ? 42.247 73.724  36.473 1.00 14.92  ? 16  DT  D N1    1 
ATOM   1600 C  C2    . DT  D 2 16 ? 43.474 73.278  36.928 1.00 14.66  ? 16  DT  D C2    1 
ATOM   1601 O  O2    . DT  D 2 16 ? 44.342 74.022  37.350 1.00 13.05  ? 16  DT  D O2    1 
ATOM   1602 N  N3    . DT  D 2 16 ? 43.649 71.918  36.869 1.00 13.19  ? 16  DT  D N3    1 
ATOM   1603 C  C4    . DT  D 2 16 ? 42.746 70.982  36.398 1.00 15.44  ? 16  DT  D C4    1 
ATOM   1604 O  O4    . DT  D 2 16 ? 43.015 69.789  36.458 1.00 16.89  ? 16  DT  D O4    1 
ATOM   1605 C  C5    . DT  D 2 16 ? 41.509 71.521  35.878 1.00 16.21  ? 16  DT  D C5    1 
ATOM   1606 C  C7    . DT  D 2 16 ? 40.503 70.582  35.289 1.00 18.32  ? 16  DT  D C7    1 
ATOM   1607 C  C6    . DT  D 2 16 ? 41.321 72.849  35.942 1.00 14.77  ? 16  DT  D C6    1 
ATOM   1608 P  P     . DC  D 2 17 ? 41.997 79.040  35.009 1.00 17.16  ? 17  DC  D P     1 
ATOM   1609 O  OP1   . DC  D 2 17 ? 41.977 80.443  35.477 1.00 15.83  ? 17  DC  D OP1   1 
ATOM   1610 O  OP2   . DC  D 2 17 ? 41.404 78.674  33.694 1.00 15.49  ? 17  DC  D OP2   1 
ATOM   1611 O  "O5'" . DC  D 2 17 ? 43.511 78.562  35.027 1.00 17.44  ? 17  DC  D "O5'" 1 
ATOM   1612 C  "C5'" . DC  D 2 17 ? 44.248 78.656  36.238 1.00 19.88  ? 17  DC  D "C5'" 1 
ATOM   1613 C  "C4'" . DC  D 2 17 ? 45.669 78.191  36.035 1.00 23.23  ? 17  DC  D "C4'" 1 
ATOM   1614 O  "O4'" . DC  D 2 17 ? 45.710 76.747  35.982 1.00 22.75  ? 17  DC  D "O4'" 1 
ATOM   1615 C  "C3'" . DC  D 2 17 ? 46.356 78.703  34.770 1.00 24.24  ? 17  DC  D "C3'" 1 
ATOM   1616 O  "O3'" . DC  D 2 17 ? 47.639 79.213  35.124 1.00 29.99  ? 17  DC  D "O3'" 1 
ATOM   1617 C  "C2'" . DC  D 2 17 ? 46.457 77.470  33.880 1.00 23.25  ? 17  DC  D "C2'" 1 
ATOM   1618 C  "C1'" . DC  D 2 17 ? 46.487 76.317  34.875 1.00 22.55  ? 17  DC  D "C1'" 1 
ATOM   1619 N  N1    . DC  D 2 17 ? 45.909 75.038  34.415 1.00 21.70  ? 17  DC  D N1    1 
ATOM   1620 C  C2    . DC  D 2 17 ? 46.632 73.849  34.628 1.00 21.82  ? 17  DC  D C2    1 
ATOM   1621 O  O2    . DC  D 2 17 ? 47.767 73.914  35.116 1.00 21.10  ? 17  DC  D O2    1 
ATOM   1622 N  N3    . DC  D 2 17 ? 46.072 72.662  34.296 1.00 20.54  ? 17  DC  D N3    1 
ATOM   1623 C  C4    . DC  D 2 17 ? 44.848 72.629  33.765 1.00 20.21  ? 17  DC  D C4    1 
ATOM   1624 N  N4    . DC  D 2 17 ? 44.318 71.432  33.497 1.00 20.00  ? 17  DC  D N4    1 
ATOM   1625 C  C5    . DC  D 2 17 ? 44.106 73.825  33.494 1.00 21.61  ? 17  DC  D C5    1 
ATOM   1626 C  C6    . DC  D 2 17 ? 44.673 74.996  33.827 1.00 21.43  ? 17  DC  D C6    1 
ATOM   1627 P  P     . DA  D 2 18 ? 48.507 80.019  34.041 1.00 34.91  ? 18  DA  D P     1 
ATOM   1628 O  OP1   . DA  D 2 18 ? 49.161 81.136  34.765 1.00 35.15  ? 18  DA  D OP1   1 
ATOM   1629 O  OP2   . DA  D 2 18 ? 47.681 80.302  32.843 1.00 33.54  ? 18  DA  D OP2   1 
ATOM   1630 O  "O5'" . DA  D 2 18 ? 49.638 78.972  33.660 1.00 34.68  ? 18  DA  D "O5'" 1 
ATOM   1631 C  "C5'" . DA  D 2 18 ? 50.387 78.340  34.689 1.00 36.78  ? 18  DA  D "C5'" 1 
ATOM   1632 C  "C4'" . DA  D 2 18 ? 51.257 77.255  34.106 1.00 38.67  ? 18  DA  D "C4'" 1 
ATOM   1633 O  "O4'" . DA  D 2 18 ? 50.464 76.084  33.797 1.00 38.26  ? 18  DA  D "O4'" 1 
ATOM   1634 C  "C3'" . DA  D 2 18 ? 51.959 77.657  32.810 1.00 39.71  ? 18  DA  D "C3'" 1 
ATOM   1635 O  "O3'" . DA  D 2 18 ? 53.307 77.192  32.842 1.00 43.08  ? 18  DA  D "O3'" 1 
ATOM   1636 C  "C2'" . DA  D 2 18 ? 51.149 76.956  31.733 1.00 38.05  ? 18  DA  D "C2'" 1 
ATOM   1637 C  "C1'" . DA  D 2 18 ? 50.670 75.701  32.447 1.00 35.80  ? 18  DA  D "C1'" 1 
ATOM   1638 N  N9    . DA  D 2 18 ? 49.414 75.144  31.942 1.00 32.67  ? 18  DA  D N9    1 
ATOM   1639 C  C8    . DA  D 2 18 ? 48.337 75.818  31.424 1.00 31.01  ? 18  DA  D C8    1 
ATOM   1640 N  N7    . DA  D 2 18 ? 47.350 75.035  31.057 1.00 30.65  ? 18  DA  D N7    1 
ATOM   1641 C  C5    . DA  D 2 18 ? 47.810 73.758  31.354 1.00 28.90  ? 18  DA  D C5    1 
ATOM   1642 C  C6    . DA  D 2 18 ? 47.231 72.483  31.206 1.00 28.78  ? 18  DA  D C6    1 
ATOM   1643 N  N6    . DA  D 2 18 ? 46.012 72.274  30.706 1.00 28.78  ? 18  DA  D N6    1 
ATOM   1644 N  N1    . DA  D 2 18 ? 47.958 71.414  31.597 1.00 29.11  ? 18  DA  D N1    1 
ATOM   1645 C  C2    . DA  D 2 18 ? 49.177 71.622  32.105 1.00 27.28  ? 18  DA  D C2    1 
ATOM   1646 N  N3    . DA  D 2 18 ? 49.826 72.767  32.300 1.00 30.21  ? 18  DA  D N3    1 
ATOM   1647 C  C4    . DA  D 2 18 ? 49.079 73.810  31.897 1.00 30.32  ? 18  DA  D C4    1 
ATOM   1648 P  P     . DT  D 2 19 ? 54.258 77.413  31.571 1.00 44.71  ? 19  DT  D P     1 
ATOM   1649 O  OP1   . DT  D 2 19 ? 55.613 77.680  32.107 1.00 45.19  ? 19  DT  D OP1   1 
ATOM   1650 O  OP2   . DT  D 2 19 ? 53.638 78.373  30.621 1.00 43.75  ? 19  DT  D OP2   1 
ATOM   1651 O  "O5'" . DT  D 2 19 ? 54.261 75.978  30.888 1.00 43.65  ? 19  DT  D "O5'" 1 
ATOM   1652 C  "C5'" . DT  D 2 19 ? 54.616 74.827  31.643 1.00 42.97  ? 19  DT  D "C5'" 1 
ATOM   1653 C  "C4'" . DT  D 2 19 ? 54.542 73.596  30.774 1.00 42.91  ? 19  DT  D "C4'" 1 
ATOM   1654 O  "O4'" . DT  D 2 19 ? 53.165 73.208  30.553 1.00 41.35  ? 19  DT  D "O4'" 1 
ATOM   1655 C  "C3'" . DT  D 2 19 ? 55.163 73.766  29.387 1.00 42.47  ? 19  DT  D "C3'" 1 
ATOM   1656 O  "O3'" . DT  D 2 19 ? 55.813 72.551  29.028 1.00 45.07  ? 19  DT  D "O3'" 1 
ATOM   1657 C  "C2'" . DT  D 2 19 ? 53.953 73.952  28.492 1.00 41.68  ? 19  DT  D "C2'" 1 
ATOM   1658 C  "C1'" . DT  D 2 19 ? 52.970 73.016  29.166 1.00 40.58  ? 19  DT  D "C1'" 1 
ATOM   1659 N  N1    . DT  D 2 19 ? 51.546 73.230  28.863 1.00 38.20  ? 19  DT  D N1    1 
ATOM   1660 C  C2    . DT  D 2 19 ? 50.746 72.118  28.852 1.00 37.42  ? 19  DT  D C2    1 
ATOM   1661 O  O2    . DT  D 2 19 ? 51.165 71.002  29.118 1.00 37.18  ? 19  DT  D O2    1 
ATOM   1662 N  N3    . DT  D 2 19 ? 49.434 72.356  28.524 1.00 37.18  ? 19  DT  D N3    1 
ATOM   1663 C  C4    . DT  D 2 19 ? 48.857 73.577  28.231 1.00 37.60  ? 19  DT  D C4    1 
ATOM   1664 O  O4    . DT  D 2 19 ? 47.663 73.637  27.945 1.00 38.73  ? 19  DT  D O4    1 
ATOM   1665 C  C5    . DT  D 2 19 ? 49.754 74.711  28.289 1.00 38.48  ? 19  DT  D C5    1 
ATOM   1666 C  C7    . DT  D 2 19 ? 49.215 76.079  28.010 1.00 39.47  ? 19  DT  D C7    1 
ATOM   1667 C  C6    . DT  D 2 19 ? 51.037 74.482  28.595 1.00 38.75  ? 19  DT  D C6    1 
ATOM   1668 P  P     . DA  D 2 20 ? 57.331 72.576  28.516 1.00 44.52  ? 20  DA  D P     1 
ATOM   1669 O  OP1   . DA  D 2 20 ? 58.161 73.138  29.613 1.00 43.39  ? 20  DA  D OP1   1 
ATOM   1670 O  OP2   . DA  D 2 20 ? 57.369 73.197  27.166 1.00 44.05  ? 20  DA  D OP2   1 
ATOM   1671 O  "O5'" . DA  D 2 20 ? 57.674 71.033  28.384 1.00 44.06  ? 20  DA  D "O5'" 1 
ATOM   1672 C  "C5'" . DA  D 2 20 ? 57.497 70.160  29.494 1.00 42.38  ? 20  DA  D "C5'" 1 
ATOM   1673 C  "C4'" . DA  D 2 20 ? 56.833 68.881  29.045 1.00 41.49  ? 20  DA  D "C4'" 1 
ATOM   1674 O  "O4'" . DA  D 2 20 ? 55.452 69.132  28.691 1.00 40.62  ? 20  DA  D "O4'" 1 
ATOM   1675 C  "C3'" . DA  D 2 20 ? 57.471 68.246  27.813 1.00 40.58  ? 20  DA  D "C3'" 1 
ATOM   1676 O  "O3'" . DA  D 2 20 ? 57.430 66.828  27.951 1.00 42.03  ? 20  DA  D "O3'" 1 
ATOM   1677 C  "C2'" . DA  D 2 20 ? 56.576 68.707  26.675 1.00 40.34  ? 20  DA  D "C2'" 1 
ATOM   1678 C  "C1'" . DA  D 2 20 ? 55.209 68.772  27.338 1.00 38.86  ? 20  DA  D "C1'" 1 
ATOM   1679 N  N9    . DA  D 2 20 ? 54.293 69.768  26.782 1.00 37.36  ? 20  DA  D N9    1 
ATOM   1680 C  C8    . DA  D 2 20 ? 54.512 71.116  26.627 1.00 36.86  ? 20  DA  D C8    1 
ATOM   1681 N  N7    . DA  D 2 20 ? 53.475 71.770  26.162 1.00 36.39  ? 20  DA  D N7    1 
ATOM   1682 C  C5    . DA  D 2 20 ? 52.512 70.786  25.987 1.00 35.37  ? 20  DA  D C5    1 
ATOM   1683 C  C6    . DA  D 2 20 ? 51.178 70.837  25.542 1.00 34.35  ? 20  DA  D C6    1 
ATOM   1684 N  N6    . DA  D 2 20 ? 50.557 71.968  25.188 1.00 32.71  ? 20  DA  D N6    1 
ATOM   1685 N  N1    . DA  D 2 20 ? 50.491 69.677  25.479 1.00 33.78  ? 20  DA  D N1    1 
ATOM   1686 C  C2    . DA  D 2 20 ? 51.110 68.547  25.849 1.00 35.07  ? 20  DA  D C2    1 
ATOM   1687 N  N3    . DA  D 2 20 ? 52.354 68.372  26.296 1.00 35.24  ? 20  DA  D N3    1 
ATOM   1688 C  C4    . DA  D 2 20 ? 53.009 69.546  26.344 1.00 35.79  ? 20  DA  D C4    1 
ATOM   1689 P  P     . DG  D 2 21 ? 58.228 65.907  26.911 1.00 42.48  ? 21  DG  D P     1 
ATOM   1690 O  OP1   . DG  D 2 21 ? 58.459 64.607  27.585 1.00 41.68  ? 21  DG  D OP1   1 
ATOM   1691 O  OP2   . DG  D 2 21 ? 59.382 66.686  26.397 1.00 39.93  ? 21  DG  D OP2   1 
ATOM   1692 O  "O5'" . DG  D 2 21 ? 57.175 65.672  25.741 1.00 41.45  ? 21  DG  D "O5'" 1 
ATOM   1693 C  "C5'" . DG  D 2 21 ? 56.042 64.833  25.950 1.00 41.18  ? 21  DG  D "C5'" 1 
ATOM   1694 C  "C4'" . DG  D 2 21 ? 55.215 64.737  24.690 1.00 40.90  ? 21  DG  D "C4'" 1 
ATOM   1695 O  "O4'" . DG  D 2 21 ? 54.405 65.927  24.507 1.00 41.23  ? 21  DG  D "O4'" 1 
ATOM   1696 C  "C3'" . DG  D 2 21 ? 56.026 64.570  23.403 1.00 40.66  ? 21  DG  D "C3'" 1 
ATOM   1697 O  "O3'" . DG  D 2 21 ? 55.332 63.701  22.514 1.00 42.74  ? 21  DG  D "O3'" 1 
ATOM   1698 C  "C2'" . DG  D 2 21 ? 55.955 65.951  22.775 1.00 40.71  ? 21  DG  D "C2'" 1 
ATOM   1699 C  "C1'" . DG  D 2 21 ? 54.549 66.359  23.166 1.00 40.18  ? 21  DG  D "C1'" 1 
ATOM   1700 N  N9    . DG  D 2 21 ? 54.244 67.790  23.093 1.00 38.64  ? 21  DG  D N9    1 
ATOM   1701 C  C8    . DG  D 2 21 ? 55.102 68.840  23.299 1.00 38.45  ? 21  DG  D C8    1 
ATOM   1702 N  N7    . DG  D 2 21 ? 54.534 70.005  23.118 1.00 38.45  ? 21  DG  D N7    1 
ATOM   1703 C  C5    . DG  D 2 21 ? 53.224 69.702  22.779 1.00 36.67  ? 21  DG  D C5    1 
ATOM   1704 C  C6    . DG  D 2 21 ? 52.131 70.554  22.455 1.00 36.77  ? 21  DG  D C6    1 
ATOM   1705 O  O6    . DG  D 2 21 ? 52.107 71.791  22.397 1.00 36.22  ? 21  DG  D O6    1 
ATOM   1706 N  N1    . DG  D 2 21 ? 50.980 69.825  22.178 1.00 35.57  ? 21  DG  D N1    1 
ATOM   1707 C  C2    . DG  D 2 21 ? 50.886 68.455  22.208 1.00 35.31  ? 21  DG  D C2    1 
ATOM   1708 N  N2    . DG  D 2 21 ? 49.684 67.936  21.922 1.00 35.10  ? 21  DG  D N2    1 
ATOM   1709 N  N3    . DG  D 2 21 ? 51.895 67.653  22.499 1.00 36.28  ? 21  DG  D N3    1 
ATOM   1710 C  C4    . DG  D 2 21 ? 53.024 68.336  22.771 1.00 37.39  ? 21  DG  D C4    1 
ATOM   1711 N  N     . VAL E 3 2  ? 41.103 140.060 44.044 1.00 57.42  ? 503 VAL F N     1 
ATOM   1712 C  CA    . VAL E 3 2  ? 41.037 138.637 44.485 1.00 56.98  ? 503 VAL F CA    1 
ATOM   1713 C  C     . VAL E 3 2  ? 39.772 138.354 45.297 1.00 55.80  ? 503 VAL F C     1 
ATOM   1714 O  O     . VAL E 3 2  ? 39.843 138.081 46.498 1.00 55.67  ? 503 VAL F O     1 
ATOM   1715 C  CB    . VAL E 3 2  ? 42.282 138.254 45.341 1.00 58.29  ? 503 VAL F CB    1 
ATOM   1716 C  CG1   . VAL E 3 2  ? 42.190 136.808 45.792 1.00 58.92  ? 503 VAL F CG1   1 
ATOM   1717 C  CG2   . VAL E 3 2  ? 43.550 138.479 44.542 1.00 58.61  ? 503 VAL F CG2   1 
ATOM   1718 N  N     . ARG E 3 3  ? 38.609 138.421 44.647 1.00 54.02  ? 504 ARG F N     1 
ATOM   1719 C  CA    . ARG E 3 3  ? 37.337 138.145 45.337 1.00 52.36  ? 504 ARG F CA    1 
ATOM   1720 C  C     . ARG E 3 3  ? 37.341 136.659 45.717 1.00 49.09  ? 504 ARG F C     1 
ATOM   1721 O  O     . ARG E 3 3  ? 37.759 135.813 44.929 1.00 48.47  ? 504 ARG F O     1 
ATOM   1722 C  CB    . ARG E 3 3  ? 36.154 138.454 44.432 1.00 56.42  ? 504 ARG F CB    1 
ATOM   1723 C  CG    . ARG E 3 3  ? 35.989 139.943 44.085 1.00 62.39  ? 504 ARG F CG    1 
ATOM   1724 C  CD    . ARG E 3 3  ? 35.831 140.811 45.333 1.00 66.48  ? 504 ARG F CD    1 
ATOM   1725 N  NE    . ARG E 3 3  ? 35.786 142.236 45.007 1.00 71.06  ? 504 ARG F NE    1 
ATOM   1726 C  CZ    . ARG E 3 3  ? 35.634 143.210 45.902 1.00 73.46  ? 504 ARG F CZ    1 
ATOM   1727 N  NH1   . ARG E 3 3  ? 35.511 142.919 47.190 1.00 74.87  ? 504 ARG F NH1   1 
ATOM   1728 N  NH2   . ARG E 3 3  ? 35.608 144.481 45.513 1.00 75.14  ? 504 ARG F NH2   1 
ATOM   1729 N  N     . PRO E 3 4  ? 36.873 136.320 46.934 1.00 43.96  ? 505 PRO F N     1 
ATOM   1730 C  CA    . PRO E 3 4  ? 36.846 134.925 47.408 1.00 40.70  ? 505 PRO F CA    1 
ATOM   1731 C  C     . PRO E 3 4  ? 36.072 133.982 46.480 1.00 37.56  ? 505 PRO F C     1 
ATOM   1732 O  O     . PRO E 3 4  ? 35.075 134.381 45.872 1.00 36.18  ? 505 PRO F O     1 
ATOM   1733 C  CB    . PRO E 3 4  ? 36.163 135.036 48.777 1.00 41.25  ? 505 PRO F CB    1 
ATOM   1734 C  CG    . PRO E 3 4  ? 36.476 136.447 49.209 1.00 43.53  ? 505 PRO F CG    1 
ATOM   1735 C  CD    . PRO E 3 4  ? 36.280 137.223 47.939 1.00 44.33  ? 505 PRO F CD    1 
ATOM   1736 N  N     . PRO E 3 5  ? 36.512 132.716 46.361 1.00 34.57  ? 506 PRO F N     1 
ATOM   1737 C  CA    . PRO E 3 5  ? 35.788 131.791 45.489 1.00 32.45  ? 506 PRO F CA    1 
ATOM   1738 C  C     . PRO E 3 5  ? 34.368 131.622 46.000 1.00 29.82  ? 506 PRO F C     1 
ATOM   1739 O  O     . PRO E 3 5  ? 33.423 131.495 45.225 1.00 29.86  ? 506 PRO F O     1 
ATOM   1740 C  CB    . PRO E 3 5  ? 36.618 130.506 45.610 1.00 33.82  ? 506 PRO F CB    1 
ATOM   1741 C  CG    . PRO E 3 5  ? 38.003 131.041 45.792 1.00 36.14  ? 506 PRO F CG    1 
ATOM   1742 C  CD    . PRO E 3 5  ? 37.724 132.056 46.871 1.00 35.66  ? 506 PRO F CD    1 
ATOM   1743 N  N     . PHE E 3 6  ? 34.234 131.641 47.323 1.00 26.08  ? 507 PHE F N     1 
ATOM   1744 C  CA    . PHE E 3 6  ? 32.940 131.487 47.978 1.00 23.83  ? 507 PHE F CA    1 
ATOM   1745 C  C     . PHE E 3 6  ? 32.812 132.421 49.178 1.00 22.43  ? 507 PHE F C     1 
ATOM   1746 O  O     . PHE E 3 6  ? 33.810 132.797 49.794 1.00 21.64  ? 507 PHE F O     1 
ATOM   1747 C  CB    . PHE E 3 6  ? 32.771 130.047 48.484 1.00 24.25  ? 507 PHE F CB    1 
ATOM   1748 C  CG    . PHE E 3 6  ? 32.825 129.010 47.394 1.00 23.85  ? 507 PHE F CG    1 
ATOM   1749 C  CD1   . PHE E 3 6  ? 34.035 128.441 47.005 1.00 24.38  ? 507 PHE F CD1   1 
ATOM   1750 C  CD2   . PHE E 3 6  ? 31.661 128.628 46.734 1.00 24.31  ? 507 PHE F CD2   1 
ATOM   1751 C  CE1   . PHE E 3 6  ? 34.084 127.504 45.971 1.00 24.07  ? 507 PHE F CE1   1 
ATOM   1752 C  CE2   . PHE E 3 6  ? 31.699 127.691 45.700 1.00 24.66  ? 507 PHE F CE2   1 
ATOM   1753 C  CZ    . PHE E 3 6  ? 32.916 127.129 45.319 1.00 24.03  ? 507 PHE F CZ    1 
ATOM   1754 N  N     . THR E 3 7  ? 31.573 132.780 49.498 1.00 20.00  ? 508 THR F N     1 
ATOM   1755 C  CA    . THR E 3 7  ? 31.251 133.605 50.665 1.00 19.60  ? 508 THR F CA    1 
ATOM   1756 C  C     . THR E 3 7  ? 29.948 133.001 51.153 1.00 19.70  ? 508 THR F C     1 
ATOM   1757 O  O     . THR E 3 7  ? 29.291 132.269 50.404 1.00 20.35  ? 508 THR F O     1 
ATOM   1758 C  CB    . THR E 3 7  ? 30.986 135.085 50.304 1.00 19.32  ? 508 THR F CB    1 
ATOM   1759 O  OG1   . THR E 3 7  ? 29.772 135.178 49.555 1.00 20.12  ? 508 THR F OG1   1 
ATOM   1760 C  CG2   . THR E 3 7  ? 32.137 135.653 49.493 1.00 20.56  ? 508 THR F CG2   1 
ATOM   1761 N  N     . TYR E 3 8  ? 29.556 133.286 52.389 1.00 18.92  ? 509 TYR F N     1 
ATOM   1762 C  CA    . TYR E 3 8  ? 28.308 132.726 52.884 1.00 18.37  ? 509 TYR F CA    1 
ATOM   1763 C  C     . TYR E 3 8  ? 27.171 133.158 51.980 1.00 19.93  ? 509 TYR F C     1 
ATOM   1764 O  O     . TYR E 3 8  ? 26.227 132.395 51.750 1.00 17.85  ? 509 TYR F O     1 
ATOM   1765 C  CB    . TYR E 3 8  ? 28.024 133.183 54.314 1.00 18.58  ? 509 TYR F CB    1 
ATOM   1766 C  CG    . TYR E 3 8  ? 29.021 132.627 55.306 1.00 17.78  ? 509 TYR F CG    1 
ATOM   1767 C  CD1   . TYR E 3 8  ? 30.022 133.432 55.843 1.00 16.36  ? 509 TYR F CD1   1 
ATOM   1768 C  CD2   . TYR E 3 8  ? 28.987 131.279 55.669 1.00 18.44  ? 509 TYR F CD2   1 
ATOM   1769 C  CE1   . TYR E 3 8  ? 30.968 132.911 56.715 1.00 18.25  ? 509 TYR F CE1   1 
ATOM   1770 C  CE2   . TYR E 3 8  ? 29.925 130.743 56.542 1.00 18.64  ? 509 TYR F CE2   1 
ATOM   1771 C  CZ    . TYR E 3 8  ? 30.914 131.567 57.063 1.00 19.40  ? 509 TYR F CZ    1 
ATOM   1772 O  OH    . TYR E 3 8  ? 31.841 131.055 57.944 1.00 17.56  ? 509 TYR F OH    1 
ATOM   1773 N  N     . ALA E 3 9  ? 27.269 134.382 51.469 1.00 18.13  ? 510 ALA F N     1 
ATOM   1774 C  CA    . ALA E 3 9  ? 26.238 134.912 50.589 1.00 20.50  ? 510 ALA F CA    1 
ATOM   1775 C  C     . ALA E 3 9  ? 26.075 134.099 49.300 1.00 19.71  ? 510 ALA F C     1 
ATOM   1776 O  O     . ALA E 3 9  ? 24.955 133.713 48.946 1.00 21.68  ? 510 ALA F O     1 
ATOM   1777 C  CB    . ALA E 3 9  ? 26.533 136.373 50.255 1.00 21.21  ? 510 ALA F CB    1 
ATOM   1778 N  N     . THR E 3 10 ? 27.170 133.829 48.598 1.00 19.25  ? 511 THR F N     1 
ATOM   1779 C  CA    . THR E 3 10 ? 27.045 133.076 47.350 1.00 20.61  ? 511 THR F CA    1 
ATOM   1780 C  C     . THR E 3 10 ? 26.566 131.654 47.611 1.00 20.48  ? 511 THR F C     1 
ATOM   1781 O  O     . THR E 3 10 ? 25.818 131.097 46.815 1.00 19.64  ? 511 THR F O     1 
ATOM   1782 C  CB    . THR E 3 10 ? 28.369 133.032 46.547 1.00 21.50  ? 511 THR F CB    1 
ATOM   1783 O  OG1   . THR E 3 10 ? 29.338 132.233 47.232 1.00 21.53  ? 511 THR F OG1   1 
ATOM   1784 C  CG2   . THR E 3 10 ? 28.922 134.431 46.363 1.00 22.62  ? 511 THR F CG2   1 
ATOM   1785 N  N     . LEU E 3 11 ? 26.980 131.078 48.737 1.00 20.73  ? 512 LEU F N     1 
ATOM   1786 C  CA    . LEU E 3 11 ? 26.583 129.715 49.088 1.00 19.80  ? 512 LEU F CA    1 
ATOM   1787 C  C     . LEU E 3 11 ? 25.103 129.627 49.444 1.00 20.25  ? 512 LEU F C     1 
ATOM   1788 O  O     . LEU E 3 11 ? 24.418 128.684 49.048 1.00 18.64  ? 512 LEU F O     1 
ATOM   1789 C  CB    . LEU E 3 11 ? 27.432 129.194 50.252 1.00 19.68  ? 512 LEU F CB    1 
ATOM   1790 C  CG    . LEU E 3 11 ? 28.891 128.891 49.906 1.00 21.49  ? 512 LEU F CG    1 
ATOM   1791 C  CD1   . LEU E 3 11 ? 29.668 128.656 51.183 1.00 22.09  ? 512 LEU F CD1   1 
ATOM   1792 C  CD2   . LEU E 3 11 ? 28.971 127.665 48.997 1.00 21.16  ? 512 LEU F CD2   1 
ATOM   1793 N  N     . ILE E 3 12 ? 24.611 130.600 50.203 1.00 18.42  ? 513 ILE F N     1 
ATOM   1794 C  CA    . ILE E 3 12 ? 23.204 130.608 50.569 1.00 20.06  ? 513 ILE F CA    1 
ATOM   1795 C  C     . ILE E 3 12 ? 22.369 130.752 49.291 1.00 21.17  ? 513 ILE F C     1 
ATOM   1796 O  O     . ILE E 3 12 ? 21.353 130.075 49.125 1.00 21.87  ? 513 ILE F O     1 
ATOM   1797 C  CB    . ILE E 3 12 ? 22.875 131.775 51.537 1.00 19.99  ? 513 ILE F CB    1 
ATOM   1798 C  CG1   . ILE E 3 12 ? 23.517 131.513 52.907 1.00 22.86  ? 513 ILE F CG1   1 
ATOM   1799 C  CG2   . ILE E 3 12 ? 21.354 131.922 51.681 1.00 19.91  ? 513 ILE F CG2   1 
ATOM   1800 C  CD1   . ILE E 3 12 ? 23.480 132.719 53.851 1.00 22.00  ? 513 ILE F CD1   1 
ATOM   1801 N  N     . ARG E 3 13 ? 22.802 131.630 48.395 1.00 21.91  ? 514 ARG F N     1 
ATOM   1802 C  CA    . ARG E 3 13 ? 22.081 131.832 47.143 1.00 23.18  ? 514 ARG F CA    1 
ATOM   1803 C  C     . ARG E 3 13 ? 22.098 130.552 46.305 1.00 23.96  ? 514 ARG F C     1 
ATOM   1804 O  O     . ARG E 3 13 ? 21.102 130.205 45.680 1.00 23.53  ? 514 ARG F O     1 
ATOM   1805 C  CB    . ARG E 3 13 ? 22.699 132.976 46.339 1.00 23.95  ? 514 ARG F CB    1 
ATOM   1806 C  CG    . ARG E 3 13 ? 22.208 133.037 44.893 1.00 27.22  ? 514 ARG F CG    1 
ATOM   1807 C  CD    . ARG E 3 13 ? 22.586 134.347 44.238 1.00 30.61  ? 514 ARG F CD    1 
ATOM   1808 N  NE    . ARG E 3 13 ? 22.271 134.380 42.807 1.00 34.01  ? 514 ARG F NE    1 
ATOM   1809 C  CZ    . ARG E 3 13 ? 22.979 133.760 41.866 1.00 36.05  ? 514 ARG F CZ    1 
ATOM   1810 N  NH1   . ARG E 3 13 ? 24.053 133.051 42.194 1.00 35.36  ? 514 ARG F NH1   1 
ATOM   1811 N  NH2   . ARG E 3 13 ? 22.616 133.856 40.591 1.00 35.80  ? 514 ARG F NH2   1 
ATOM   1812 N  N     . GLN E 3 14 ? 23.229 129.855 46.294 1.00 24.62  ? 515 GLN F N     1 
ATOM   1813 C  CA    . GLN E 3 14 ? 23.326 128.616 45.533 1.00 26.20  ? 515 GLN F CA    1 
ATOM   1814 C  C     . GLN E 3 14 ? 22.330 127.577 46.055 1.00 27.44  ? 515 GLN F C     1 
ATOM   1815 O  O     . GLN E 3 14 ? 21.625 126.930 45.278 1.00 28.44  ? 515 GLN F O     1 
ATOM   1816 C  CB    . GLN E 3 14 ? 24.743 128.040 45.606 1.00 26.14  ? 515 GLN F CB    1 
ATOM   1817 C  CG    . GLN E 3 14 ? 24.991 126.933 44.581 1.00 28.05  ? 515 GLN F CG    1 
ATOM   1818 C  CD    . GLN E 3 14 ? 26.362 126.298 44.707 1.00 30.23  ? 515 GLN F CD    1 
ATOM   1819 O  OE1   . GLN E 3 14 ? 27.339 126.962 45.054 1.00 29.81  ? 515 GLN F OE1   1 
ATOM   1820 N  NE2   . GLN E 3 14 ? 26.446 125.004 44.405 1.00 30.99  ? 515 GLN F NE2   1 
ATOM   1821 N  N     . ALA E 3 15 ? 22.273 127.421 47.373 1.00 27.07  ? 516 ALA F N     1 
ATOM   1822 C  CA    . ALA E 3 15 ? 21.374 126.452 47.990 1.00 28.54  ? 516 ALA F CA    1 
ATOM   1823 C  C     . ALA E 3 15 ? 19.912 126.742 47.641 1.00 30.51  ? 516 ALA F C     1 
ATOM   1824 O  O     . ALA E 3 15 ? 19.139 125.837 47.304 1.00 29.10  ? 516 ALA F O     1 
ATOM   1825 C  CB    . ALA E 3 15 ? 21.566 126.467 49.504 1.00 28.61  ? 516 ALA F CB    1 
ATOM   1826 N  N     . ILE E 3 16 ? 19.539 128.014 47.713 1.00 31.28  ? 517 ILE F N     1 
ATOM   1827 C  CA    . ILE E 3 16 ? 18.178 128.417 47.413 1.00 33.66  ? 517 ILE F CA    1 
ATOM   1828 C  C     . ILE E 3 16 ? 17.861 128.288 45.928 1.00 35.20  ? 517 ILE F C     1 
ATOM   1829 O  O     . ILE E 3 16 ? 16.792 127.814 45.567 1.00 35.98  ? 517 ILE F O     1 
ATOM   1830 C  CB    . ILE E 3 16 ? 17.918 129.867 47.871 1.00 33.31  ? 517 ILE F CB    1 
ATOM   1831 C  CG1   . ILE E 3 16 ? 18.057 129.950 49.397 1.00 33.43  ? 517 ILE F CG1   1 
ATOM   1832 C  CG2   . ILE E 3 16 ? 16.532 130.319 47.408 1.00 32.77  ? 517 ILE F CG2   1 
ATOM   1833 C  CD1   . ILE E 3 16 ? 17.702 131.297 50.001 1.00 32.08  ? 517 ILE F CD1   1 
ATOM   1834 N  N     . MET E 3 17 ? 18.791 128.693 45.073 1.00 37.67  ? 518 MET F N     1 
ATOM   1835 C  CA    . MET E 3 17 ? 18.574 128.619 43.634 1.00 42.02  ? 518 MET F CA    1 
ATOM   1836 C  C     . MET E 3 17 ? 18.493 127.195 43.096 1.00 44.17  ? 518 MET F C     1 
ATOM   1837 O  O     . MET E 3 17 ? 17.723 126.916 42.173 1.00 44.67  ? 518 MET F O     1 
ATOM   1838 C  CB    . MET E 3 17 ? 19.673 129.379 42.893 1.00 44.71  ? 518 MET F CB    1 
ATOM   1839 C  CG    . MET E 3 17 ? 19.582 130.883 43.042 1.00 48.88  ? 518 MET F CG    1 
ATOM   1840 S  SD    . MET E 3 17 ? 20.813 131.733 42.048 1.00 54.84  ? 518 MET F SD    1 
ATOM   1841 C  CE    . MET E 3 17 ? 19.967 131.833 40.482 1.00 50.40  ? 518 MET F CE    1 
ATOM   1842 N  N     . GLU E 3 18 ? 19.275 126.290 43.672 1.00 44.73  ? 519 GLU F N     1 
ATOM   1843 C  CA    . GLU E 3 18 ? 19.268 124.909 43.214 1.00 45.94  ? 519 GLU F CA    1 
ATOM   1844 C  C     . GLU E 3 18 ? 18.072 124.133 43.758 1.00 46.34  ? 519 GLU F C     1 
ATOM   1845 O  O     . GLU E 3 18 ? 17.806 123.015 43.322 1.00 47.05  ? 519 GLU F O     1 
ATOM   1846 C  CB    . GLU E 3 18 ? 20.577 124.216 43.615 1.00 46.51  ? 519 GLU F CB    1 
ATOM   1847 C  CG    . GLU E 3 18 ? 21.813 124.790 42.926 1.00 48.73  ? 519 GLU F CG    1 
ATOM   1848 C  CD    . GLU E 3 18 ? 23.103 124.083 43.321 1.00 49.43  ? 519 GLU F CD    1 
ATOM   1849 O  OE1   . GLU E 3 18 ? 23.046 123.121 44.118 1.00 50.23  ? 519 GLU F OE1   1 
ATOM   1850 O  OE2   . GLU E 3 18 ? 24.179 124.491 42.831 1.00 49.46  ? 519 GLU F OE2   1 
ATOM   1851 N  N     . SER E 3 19 ? 17.341 124.731 44.695 1.00 47.09  ? 520 SER F N     1 
ATOM   1852 C  CA    . SER E 3 19 ? 16.187 124.066 45.297 1.00 47.76  ? 520 SER F CA    1 
ATOM   1853 C  C     . SER E 3 19 ? 14.977 123.996 44.367 1.00 48.85  ? 520 SER F C     1 
ATOM   1854 O  O     . SER E 3 19 ? 14.857 124.774 43.415 1.00 48.31  ? 520 SER F O     1 
ATOM   1855 C  CB    . SER E 3 19 ? 15.786 124.766 46.595 1.00 46.99  ? 520 SER F CB    1 
ATOM   1856 O  OG    . SER E 3 19 ? 15.224 126.039 46.337 1.00 47.56  ? 520 SER F OG    1 
ATOM   1857 N  N     . SER E 3 20 ? 14.078 123.061 44.669 1.00 49.81  ? 521 SER F N     1 
ATOM   1858 C  CA    . SER E 3 20 ? 12.870 122.840 43.879 1.00 50.84  ? 521 SER F CA    1 
ATOM   1859 C  C     . SER E 3 20 ? 12.036 124.093 43.635 1.00 51.25  ? 521 SER F C     1 
ATOM   1860 O  O     . SER E 3 20 ? 11.789 124.463 42.486 1.00 51.28  ? 521 SER F O     1 
ATOM   1861 C  CB    . SER E 3 20 ? 11.990 121.780 44.549 1.00 51.44  ? 521 SER F CB    1 
ATOM   1862 O  OG    . SER E 3 20 ? 12.655 120.533 44.629 1.00 52.99  ? 521 SER F OG    1 
ATOM   1863 N  N     . ASP E 3 21 ? 11.600 124.738 44.715 1.00 51.21  ? 522 ASP F N     1 
ATOM   1864 C  CA    . ASP E 3 21 ? 10.773 125.939 44.616 1.00 50.84  ? 522 ASP F CA    1 
ATOM   1865 C  C     . ASP E 3 21 ? 11.522 127.243 44.899 1.00 50.95  ? 522 ASP F C     1 
ATOM   1866 O  O     . ASP E 3 21 ? 10.911 128.249 45.270 1.00 50.05  ? 522 ASP F O     1 
ATOM   1867 C  CB    . ASP E 3 21 ? 9.581  125.825 45.567 1.00 52.58  ? 522 ASP F CB    1 
ATOM   1868 C  CG    . ASP E 3 21 ? 8.697  124.636 45.251 1.00 53.99  ? 522 ASP F CG    1 
ATOM   1869 O  OD1   . ASP E 3 21 ? 7.725  124.411 46.003 1.00 55.30  ? 522 ASP F OD1   1 
ATOM   1870 O  OD2   . ASP E 3 21 ? 8.971  123.928 44.257 1.00 54.77  ? 522 ASP F OD2   1 
ATOM   1871 N  N     . ARG E 3 22 ? 12.839 127.227 44.720 1.00 50.02  ? 523 ARG F N     1 
ATOM   1872 C  CA    . ARG E 3 22 ? 13.654 128.416 44.949 1.00 49.36  ? 523 ARG F CA    1 
ATOM   1873 C  C     . ARG E 3 22 ? 13.370 129.062 46.304 1.00 47.20  ? 523 ARG F C     1 
ATOM   1874 O  O     . ARG E 3 22 ? 13.200 130.278 46.405 1.00 45.40  ? 523 ARG F O     1 
ATOM   1875 C  CB    . ARG E 3 22 ? 13.415 129.433 43.830 1.00 52.37  ? 523 ARG F CB    1 
ATOM   1876 C  CG    . ARG E 3 22 ? 13.807 128.932 42.450 1.00 56.06  ? 523 ARG F CG    1 
ATOM   1877 C  CD    . ARG E 3 22 ? 15.027 129.668 41.923 1.00 59.90  ? 523 ARG F CD    1 
ATOM   1878 N  NE    . ARG E 3 22 ? 15.424 129.188 40.602 1.00 63.15  ? 523 ARG F NE    1 
ATOM   1879 C  CZ    . ARG E 3 22 ? 16.376 129.744 39.858 1.00 64.53  ? 523 ARG F CZ    1 
ATOM   1880 N  NH1   . ARG E 3 22 ? 17.035 130.806 40.302 1.00 65.36  ? 523 ARG F NH1   1 
ATOM   1881 N  NH2   . ARG E 3 22 ? 16.672 129.234 38.670 1.00 65.86  ? 523 ARG F NH2   1 
ATOM   1882 N  N     . GLN E 3 23 ? 13.316 128.233 47.342 1.00 44.86  ? 524 GLN F N     1 
ATOM   1883 C  CA    . GLN E 3 23 ? 13.069 128.700 48.700 1.00 43.39  ? 524 GLN F CA    1 
ATOM   1884 C  C     . GLN E 3 23 ? 13.332 127.570 49.683 1.00 42.29  ? 524 GLN F C     1 
ATOM   1885 O  O     . GLN E 3 23 ? 12.945 126.428 49.442 1.00 41.57  ? 524 GLN F O     1 
ATOM   1886 C  CB    . GLN E 3 23 ? 11.630 129.192 48.849 1.00 44.38  ? 524 GLN F CB    1 
ATOM   1887 C  CG    . GLN E 3 23 ? 10.581 128.188 48.416 1.00 46.10  ? 524 GLN F CG    1 
ATOM   1888 C  CD    . GLN E 3 23 ? 9.172  128.673 48.691 1.00 46.77  ? 524 GLN F CD    1 
ATOM   1889 O  OE1   . GLN E 3 23 ? 8.795  129.775 48.293 1.00 46.78  ? 524 GLN F OE1   1 
ATOM   1890 N  NE2   . GLN E 3 23 ? 8.383  127.849 49.370 1.00 46.65  ? 524 GLN F NE2   1 
ATOM   1891 N  N     . LEU E 3 24 ? 13.987 127.895 50.793 1.00 39.67  ? 525 LEU F N     1 
ATOM   1892 C  CA    . LEU E 3 24 ? 14.314 126.894 51.800 1.00 36.74  ? 525 LEU F CA    1 
ATOM   1893 C  C     . LEU E 3 24 ? 14.084 127.393 53.214 1.00 35.35  ? 525 LEU F C     1 
ATOM   1894 O  O     . LEU E 3 24 ? 14.172 128.588 53.485 1.00 33.52  ? 525 LEU F O     1 
ATOM   1895 C  CB    . LEU E 3 24 ? 15.781 126.481 51.674 1.00 35.91  ? 525 LEU F CB    1 
ATOM   1896 C  CG    . LEU E 3 24 ? 16.291 125.904 50.354 1.00 35.98  ? 525 LEU F CG    1 
ATOM   1897 C  CD1   . LEU E 3 24 ? 17.789 125.646 50.462 1.00 33.38  ? 525 LEU F CD1   1 
ATOM   1898 C  CD2   . LEU E 3 24 ? 15.536 124.616 50.033 1.00 35.51  ? 525 LEU F CD2   1 
ATOM   1899 N  N     . THR E 3 25 ? 13.786 126.463 54.114 1.00 34.72  ? 526 THR F N     1 
ATOM   1900 C  CA    . THR E 3 25 ? 13.595 126.807 55.514 1.00 34.77  ? 526 THR F CA    1 
ATOM   1901 C  C     . THR E 3 25 ? 15.020 126.930 56.048 1.00 33.67  ? 526 THR F C     1 
ATOM   1902 O  O     . THR E 3 25 ? 15.968 126.548 55.363 1.00 32.89  ? 526 THR F O     1 
ATOM   1903 C  CB    . THR E 3 25 ? 12.867 125.687 56.277 1.00 35.16  ? 526 THR F CB    1 
ATOM   1904 O  OG1   . THR E 3 25 ? 13.618 124.471 56.172 1.00 34.42  ? 526 THR F OG1   1 
ATOM   1905 C  CG2   . THR E 3 25 ? 11.476 125.465 55.698 1.00 36.23  ? 526 THR F CG2   1 
ATOM   1906 N  N     . LEU E 3 26 ? 15.176 127.468 57.250 1.00 33.97  ? 527 LEU F N     1 
ATOM   1907 C  CA    . LEU E 3 26 ? 16.507 127.612 57.821 1.00 33.92  ? 527 LEU F CA    1 
ATOM   1908 C  C     . LEU E 3 26 ? 17.140 126.228 57.952 1.00 33.84  ? 527 LEU F C     1 
ATOM   1909 O  O     . LEU E 3 26 ? 18.285 126.014 57.547 1.00 32.95  ? 527 LEU F O     1 
ATOM   1910 C  CB    . LEU E 3 26 ? 16.426 128.287 59.189 1.00 34.13  ? 527 LEU F CB    1 
ATOM   1911 C  CG    . LEU E 3 26 ? 17.762 128.543 59.886 1.00 34.12  ? 527 LEU F CG    1 
ATOM   1912 C  CD1   . LEU E 3 26 ? 18.619 129.484 59.045 1.00 35.74  ? 527 LEU F CD1   1 
ATOM   1913 C  CD2   . LEU E 3 26 ? 17.503 129.139 61.260 1.00 35.74  ? 527 LEU F CD2   1 
ATOM   1914 N  N     . ASN E 3 27 ? 16.382 125.287 58.504 1.00 33.12  ? 528 ASN F N     1 
ATOM   1915 C  CA    . ASN E 3 27 ? 16.873 123.925 58.674 1.00 33.64  ? 528 ASN F CA    1 
ATOM   1916 C  C     . ASN E 3 27 ? 17.311 123.296 57.357 1.00 32.21  ? 528 ASN F C     1 
ATOM   1917 O  O     . ASN E 3 27 ? 18.286 122.543 57.320 1.00 32.16  ? 528 ASN F O     1 
ATOM   1918 C  CB    . ASN E 3 27 ? 15.808 123.059 59.346 1.00 36.76  ? 528 ASN F CB    1 
ATOM   1919 C  CG    . ASN E 3 27 ? 15.842 123.172 60.856 1.00 40.13  ? 528 ASN F CG    1 
ATOM   1920 O  OD1   . ASN E 3 27 ? 15.851 124.274 61.408 1.00 43.44  ? 528 ASN F OD1   1 
ATOM   1921 N  ND2   . ASN E 3 27 ? 15.861 122.030 61.535 1.00 43.30  ? 528 ASN F ND2   1 
ATOM   1922 N  N     . GLU E 3 28 ? 16.602 123.600 56.273 1.00 30.62  ? 529 GLU F N     1 
ATOM   1923 C  CA    . GLU E 3 28 ? 16.981 123.046 54.978 1.00 29.55  ? 529 GLU F CA    1 
ATOM   1924 C  C     . GLU E 3 28 ? 18.292 123.660 54.518 1.00 28.53  ? 529 GLU F C     1 
ATOM   1925 O  O     . GLU E 3 28 ? 19.116 122.984 53.906 1.00 26.11  ? 529 GLU F O     1 
ATOM   1926 C  CB    . GLU E 3 28 ? 15.885 123.279 53.934 1.00 32.84  ? 529 GLU F CB    1 
ATOM   1927 C  CG    . GLU E 3 28 ? 14.921 122.106 53.821 1.00 34.90  ? 529 GLU F CG    1 
ATOM   1928 C  CD    . GLU E 3 28 ? 13.738 122.397 52.920 1.00 37.09  ? 529 GLU F CD    1 
ATOM   1929 O  OE1   . GLU E 3 28 ? 13.365 123.582 52.796 1.00 36.44  ? 529 GLU F OE1   1 
ATOM   1930 O  OE2   . GLU E 3 28 ? 13.167 121.441 52.350 1.00 39.56  ? 529 GLU F OE2   1 
ATOM   1931 N  N     . ILE E 3 29 ? 18.483 124.947 54.807 1.00 26.51  ? 530 ILE F N     1 
ATOM   1932 C  CA    . ILE E 3 29 ? 19.721 125.616 54.440 1.00 23.72  ? 530 ILE F CA    1 
ATOM   1933 C  C     . ILE E 3 29 ? 20.856 124.978 55.236 1.00 23.74  ? 530 ILE F C     1 
ATOM   1934 O  O     . ILE E 3 29 ? 21.950 124.765 54.713 1.00 21.24  ? 530 ILE F O     1 
ATOM   1935 C  CB    . ILE E 3 29 ? 19.646 127.133 54.739 1.00 23.94  ? 530 ILE F CB    1 
ATOM   1936 C  CG1   . ILE E 3 29 ? 18.653 127.788 53.769 1.00 22.30  ? 530 ILE F CG1   1 
ATOM   1937 C  CG2   . ILE E 3 29 ? 21.029 127.770 54.579 1.00 22.10  ? 530 ILE F CG2   1 
ATOM   1938 C  CD1   . ILE E 3 29 ? 18.412 129.269 54.004 1.00 26.07  ? 530 ILE F CD1   1 
ATOM   1939 N  N     . TYR E 3 30 ? 20.586 124.660 56.501 1.00 25.39  ? 531 TYR F N     1 
ATOM   1940 C  CA    . TYR E 3 30 ? 21.588 124.027 57.361 1.00 27.19  ? 531 TYR F CA    1 
ATOM   1941 C  C     . TYR E 3 30 ? 21.984 122.658 56.803 1.00 26.94  ? 531 TYR F C     1 
ATOM   1942 O  O     . TYR E 3 30 ? 23.164 122.296 56.782 1.00 26.96  ? 531 TYR F O     1 
ATOM   1943 C  CB    . TYR E 3 30 ? 21.042 123.841 58.776 1.00 28.27  ? 531 TYR F CB    1 
ATOM   1944 C  CG    . TYR E 3 30 ? 20.998 125.091 59.632 1.00 30.25  ? 531 TYR F CG    1 
ATOM   1945 C  CD1   . TYR E 3 30 ? 20.358 125.073 60.867 1.00 31.39  ? 531 TYR F CD1   1 
ATOM   1946 C  CD2   . TYR E 3 30 ? 21.605 126.281 59.222 1.00 31.31  ? 531 TYR F CD2   1 
ATOM   1947 C  CE1   . TYR E 3 30 ? 20.316 126.196 61.678 1.00 34.31  ? 531 TYR F CE1   1 
ATOM   1948 C  CE2   . TYR E 3 30 ? 21.572 127.420 60.032 1.00 32.58  ? 531 TYR F CE2   1 
ATOM   1949 C  CZ    . TYR E 3 30 ? 20.923 127.364 61.260 1.00 33.36  ? 531 TYR F CZ    1 
ATOM   1950 O  OH    . TYR E 3 30 ? 20.878 128.463 62.083 1.00 36.27  ? 531 TYR F OH    1 
ATOM   1951 N  N     . SER E 3 31 ? 20.987 121.897 56.362 1.00 26.86  ? 532 SER F N     1 
ATOM   1952 C  CA    . SER E 3 31 ? 21.238 120.572 55.805 1.00 27.21  ? 532 SER F CA    1 
ATOM   1953 C  C     . SER E 3 31 ? 22.133 120.686 54.593 1.00 24.81  ? 532 SER F C     1 
ATOM   1954 O  O     . SER E 3 31 ? 23.041 119.882 54.404 1.00 24.03  ? 532 SER F O     1 
ATOM   1955 C  CB    . SER E 3 31 ? 19.922 119.908 55.410 1.00 30.20  ? 532 SER F CB    1 
ATOM   1956 O  OG    . SER E 3 31 ? 19.069 119.806 56.532 1.00 35.87  ? 532 SER F OG    1 
ATOM   1957 N  N     . TRP E 3 32 ? 21.868 121.694 53.767 1.00 22.16  ? 533 TRP F N     1 
ATOM   1958 C  CA    . TRP E 3 32 ? 22.661 121.911 52.571 1.00 20.88  ? 533 TRP F CA    1 
ATOM   1959 C  C     . TRP E 3 32 ? 24.099 122.245 52.967 1.00 19.31  ? 533 TRP F C     1 
ATOM   1960 O  O     . TRP E 3 32 ? 25.045 121.704 52.398 1.00 17.71  ? 533 TRP F O     1 
ATOM   1961 C  CB    . TRP E 3 32 ? 22.065 123.055 51.744 1.00 20.49  ? 533 TRP F CB    1 
ATOM   1962 C  CG    . TRP E 3 32 ? 22.694 123.208 50.389 1.00 21.54  ? 533 TRP F CG    1 
ATOM   1963 C  CD1   . TRP E 3 32 ? 22.305 122.596 49.229 1.00 22.53  ? 533 TRP F CD1   1 
ATOM   1964 C  CD2   . TRP E 3 32 ? 23.821 124.024 50.054 1.00 20.84  ? 533 TRP F CD2   1 
ATOM   1965 N  NE1   . TRP E 3 32 ? 23.121 122.982 48.193 1.00 23.26  ? 533 TRP F NE1   1 
ATOM   1966 C  CE2   . TRP E 3 32 ? 24.063 123.855 48.671 1.00 21.51  ? 533 TRP F CE2   1 
ATOM   1967 C  CE3   . TRP E 3 32 ? 24.658 124.874 50.790 1.00 22.23  ? 533 TRP F CE3   1 
ATOM   1968 C  CZ2   . TRP E 3 32 ? 25.100 124.514 48.006 1.00 21.76  ? 533 TRP F CZ2   1 
ATOM   1969 C  CZ3   . TRP E 3 32 ? 25.695 125.531 50.126 1.00 19.88  ? 533 TRP F CZ3   1 
ATOM   1970 C  CH2   . TRP E 3 32 ? 25.907 125.344 48.748 1.00 23.75  ? 533 TRP F CH2   1 
ATOM   1971 N  N     . PHE E 3 33 ? 24.266 123.140 53.940 1.00 18.34  ? 534 PHE F N     1 
ATOM   1972 C  CA    . PHE E 3 33 ? 25.607 123.521 54.387 1.00 19.25  ? 534 PHE F CA    1 
ATOM   1973 C  C     . PHE E 3 33 ? 26.342 122.332 55.004 1.00 18.71  ? 534 PHE F C     1 
ATOM   1974 O  O     . PHE E 3 33 ? 27.537 122.144 54.790 1.00 20.16  ? 534 PHE F O     1 
ATOM   1975 C  CB    . PHE E 3 33 ? 25.521 124.680 55.397 1.00 19.04  ? 534 PHE F CB    1 
ATOM   1976 C  CG    . PHE E 3 33 ? 25.637 126.047 54.763 1.00 18.37  ? 534 PHE F CG    1 
ATOM   1977 C  CD1   . PHE E 3 33 ? 26.823 126.775 54.858 1.00 18.53  ? 534 PHE F CD1   1 
ATOM   1978 C  CD2   . PHE E 3 33 ? 24.583 126.582 54.034 1.00 17.51  ? 534 PHE F CD2   1 
ATOM   1979 C  CE1   . PHE E 3 33 ? 26.961 128.022 54.230 1.00 21.18  ? 534 PHE F CE1   1 
ATOM   1980 C  CE2   . PHE E 3 33 ? 24.708 127.826 53.402 1.00 18.75  ? 534 PHE F CE2   1 
ATOM   1981 C  CZ    . PHE E 3 33 ? 25.900 128.547 53.500 1.00 19.59  ? 534 PHE F CZ    1 
ATOM   1982 N  N     . THR E 3 34 ? 25.625 121.522 55.770 1.00 20.83  ? 535 THR F N     1 
ATOM   1983 C  CA    . THR E 3 34 ? 26.252 120.369 56.387 1.00 22.49  ? 535 THR F CA    1 
ATOM   1984 C  C     . THR E 3 34 ? 26.870 119.500 55.298 1.00 23.03  ? 535 THR F C     1 
ATOM   1985 O  O     . THR E 3 34 ? 28.053 119.159 55.360 1.00 23.13  ? 535 THR F O     1 
ATOM   1986 C  CB    . THR E 3 34 ? 25.228 119.557 57.206 1.00 25.03  ? 535 THR F CB    1 
ATOM   1987 O  OG1   . THR E 3 34 ? 24.748 120.363 58.293 1.00 23.62  ? 535 THR F OG1   1 
ATOM   1988 C  CG2   . THR E 3 34 ? 25.866 118.284 57.757 1.00 26.48  ? 535 THR F CG2   1 
ATOM   1989 N  N     . ARG E 3 35 ? 26.074 119.173 54.285 1.00 23.07  ? 536 ARG F N     1 
ATOM   1990 C  CA    . ARG E 3 35 ? 26.549 118.341 53.189 1.00 24.77  ? 536 ARG F CA    1 
ATOM   1991 C  C     . ARG E 3 35 ? 27.710 119.005 52.468 1.00 24.05  ? 536 ARG F C     1 
ATOM   1992 O  O     . ARG E 3 35 ? 28.697 118.357 52.121 1.00 23.70  ? 536 ARG F O     1 
ATOM   1993 C  CB    . ARG E 3 35 ? 25.413 118.065 52.198 1.00 28.06  ? 536 ARG F CB    1 
ATOM   1994 C  CG    . ARG E 3 35 ? 24.257 117.259 52.776 1.00 33.01  ? 536 ARG F CG    1 
ATOM   1995 C  CD    . ARG E 3 35 ? 23.276 116.840 51.685 1.00 37.35  ? 536 ARG F CD    1 
ATOM   1996 N  NE    . ARG E 3 35 ? 22.527 117.966 51.125 1.00 39.65  ? 536 ARG F NE    1 
ATOM   1997 C  CZ    . ARG E 3 35 ? 21.324 118.353 51.542 1.00 40.97  ? 536 ARG F CZ    1 
ATOM   1998 N  NH1   . ARG E 3 35 ? 20.716 117.704 52.528 1.00 40.57  ? 536 ARG F NH1   1 
ATOM   1999 N  NH2   . ARG E 3 35 ? 20.727 119.395 50.974 1.00 40.04  ? 536 ARG F NH2   1 
ATOM   2000 N  N     . THR E 3 36 ? 27.591 120.308 52.238 1.00 21.93  ? 537 THR F N     1 
ATOM   2001 C  CA    . THR E 3 36 ? 28.644 121.035 51.552 1.00 19.99  ? 537 THR F CA    1 
ATOM   2002 C  C     . THR E 3 36 ? 29.950 121.035 52.342 1.00 19.31  ? 537 THR F C     1 
ATOM   2003 O  O     . THR E 3 36 ? 31.009 120.707 51.803 1.00 18.69  ? 537 THR F O     1 
ATOM   2004 C  CB    . THR E 3 36 ? 28.197 122.487 51.254 1.00 18.70  ? 537 THR F CB    1 
ATOM   2005 O  OG1   . THR E 3 36 ? 27.100 122.459 50.328 1.00 20.92  ? 537 THR F OG1   1 
ATOM   2006 C  CG2   . THR E 3 36 ? 29.337 123.292 50.647 1.00 18.98  ? 537 THR F CG2   1 
ATOM   2007 N  N     . PHE E 3 37 ? 29.898 121.386 53.622 1.00 18.57  ? 538 PHE F N     1 
ATOM   2008 C  CA    . PHE E 3 37 ? 31.143 121.394 54.374 1.00 18.76  ? 538 PHE F CA    1 
ATOM   2009 C  C     . PHE E 3 37 ? 31.748 119.995 54.457 1.00 18.76  ? 538 PHE F C     1 
ATOM   2010 O  O     . PHE E 3 37 ? 32.958 119.850 54.398 1.00 19.44  ? 538 PHE F O     1 
ATOM   2011 C  CB    . PHE E 3 37 ? 30.950 122.020 55.761 1.00 17.43  ? 538 PHE F CB    1 
ATOM   2012 C  CG    . PHE E 3 37 ? 31.109 123.529 55.758 1.00 19.24  ? 538 PHE F CG    1 
ATOM   2013 C  CD1   . PHE E 3 37 ? 30.106 124.351 55.248 1.00 18.51  ? 538 PHE F CD1   1 
ATOM   2014 C  CD2   . PHE E 3 37 ? 32.302 124.116 56.184 1.00 17.68  ? 538 PHE F CD2   1 
ATOM   2015 C  CE1   . PHE E 3 37 ? 30.294 125.741 55.153 1.00 18.57  ? 538 PHE F CE1   1 
ATOM   2016 C  CE2   . PHE E 3 37 ? 32.503 125.502 56.094 1.00 19.82  ? 538 PHE F CE2   1 
ATOM   2017 C  CZ    . PHE E 3 37 ? 31.499 126.314 55.577 1.00 18.78  ? 538 PHE F CZ    1 
ATOM   2018 N  N     . ALA E 3 38 ? 30.913 118.967 54.556 1.00 21.29  ? 539 ALA F N     1 
ATOM   2019 C  CA    . ALA E 3 38 ? 31.430 117.601 54.617 1.00 22.53  ? 539 ALA F CA    1 
ATOM   2020 C  C     . ALA E 3 38 ? 32.191 117.260 53.323 1.00 23.07  ? 539 ALA F C     1 
ATOM   2021 O  O     . ALA E 3 38 ? 33.225 116.585 53.349 1.00 23.70  ? 539 ALA F O     1 
ATOM   2022 C  CB    . ALA E 3 38 ? 30.271 116.607 54.847 1.00 22.71  ? 539 ALA F CB    1 
ATOM   2023 N  N     . TYR E 3 39 ? 31.690 117.744 52.189 1.00 22.48  ? 540 TYR F N     1 
ATOM   2024 C  CA    . TYR E 3 39 ? 32.330 117.467 50.908 1.00 23.07  ? 540 TYR F CA    1 
ATOM   2025 C  C     . TYR E 3 39 ? 33.751 118.027 50.863 1.00 24.03  ? 540 TYR F C     1 
ATOM   2026 O  O     . TYR E 3 39 ? 34.670 117.369 50.370 1.00 23.16  ? 540 TYR F O     1 
ATOM   2027 C  CB    . TYR E 3 39 ? 31.510 118.068 49.753 1.00 20.87  ? 540 TYR F CB    1 
ATOM   2028 C  CG    . TYR E 3 39 ? 32.113 117.850 48.377 1.00 21.50  ? 540 TYR F CG    1 
ATOM   2029 C  CD1   . TYR E 3 39 ? 31.844 116.686 47.639 1.00 24.12  ? 540 TYR F CD1   1 
ATOM   2030 C  CD2   . TYR E 3 39 ? 32.970 118.794 47.817 1.00 21.01  ? 540 TYR F CD2   1 
ATOM   2031 C  CE1   . TYR E 3 39 ? 32.427 116.483 46.366 1.00 21.42  ? 540 TYR F CE1   1 
ATOM   2032 C  CE2   . TYR E 3 39 ? 33.556 118.600 46.559 1.00 21.29  ? 540 TYR F CE2   1 
ATOM   2033 C  CZ    . TYR E 3 39 ? 33.277 117.440 45.840 1.00 21.78  ? 540 TYR F CZ    1 
ATOM   2034 O  OH    . TYR E 3 39 ? 33.856 117.272 44.602 1.00 20.09  ? 540 TYR F OH    1 
ATOM   2035 N  N     . PHE E 3 40 ? 33.932 119.240 51.380 1.00 23.62  ? 541 PHE F N     1 
ATOM   2036 C  CA    . PHE E 3 40 ? 35.245 119.877 51.356 1.00 26.57  ? 541 PHE F CA    1 
ATOM   2037 C  C     . PHE E 3 40 ? 36.225 119.437 52.430 1.00 29.96  ? 541 PHE F C     1 
ATOM   2038 O  O     . PHE E 3 40 ? 37.378 119.868 52.430 1.00 30.66  ? 541 PHE F O     1 
ATOM   2039 C  CB    . PHE E 3 40 ? 35.092 121.402 51.383 1.00 24.36  ? 541 PHE F CB    1 
ATOM   2040 C  CG    . PHE E 3 40 ? 34.564 121.966 50.095 1.00 22.96  ? 541 PHE F CG    1 
ATOM   2041 C  CD1   . PHE E 3 40 ? 33.211 122.232 49.938 1.00 21.90  ? 541 PHE F CD1   1 
ATOM   2042 C  CD2   . PHE E 3 40 ? 35.420 122.185 49.017 1.00 22.55  ? 541 PHE F CD2   1 
ATOM   2043 C  CE1   . PHE E 3 40 ? 32.715 122.711 48.727 1.00 22.04  ? 541 PHE F CE1   1 
ATOM   2044 C  CE2   . PHE E 3 40 ? 34.933 122.663 47.801 1.00 21.34  ? 541 PHE F CE2   1 
ATOM   2045 C  CZ    . PHE E 3 40 ? 33.579 122.925 47.658 1.00 20.30  ? 541 PHE F CZ    1 
ATOM   2046 N  N     . ARG E 3 41 ? 35.782 118.581 53.341 1.00 34.34  ? 542 ARG F N     1 
ATOM   2047 C  CA    . ARG E 3 41 ? 36.673 118.106 54.390 1.00 40.41  ? 542 ARG F CA    1 
ATOM   2048 C  C     . ARG E 3 41 ? 37.592 117.019 53.812 1.00 42.01  ? 542 ARG F C     1 
ATOM   2049 O  O     . ARG E 3 41 ? 37.470 115.836 54.141 1.00 42.18  ? 542 ARG F O     1 
ATOM   2050 C  CB    . ARG E 3 41 ? 35.859 117.559 55.564 1.00 43.76  ? 542 ARG F CB    1 
ATOM   2051 C  CG    . ARG E 3 41 ? 36.685 117.252 56.795 1.00 50.26  ? 542 ARG F CG    1 
ATOM   2052 C  CD    . ARG E 3 41 ? 35.821 116.911 57.987 1.00 54.97  ? 542 ARG F CD    1 
ATOM   2053 N  NE    . ARG E 3 41 ? 36.629 116.726 59.190 1.00 60.28  ? 542 ARG F NE    1 
ATOM   2054 C  CZ    . ARG E 3 41 ? 36.140 116.398 60.383 1.00 63.09  ? 542 ARG F CZ    1 
ATOM   2055 N  NH1   . ARG E 3 41 ? 34.834 116.217 60.544 1.00 64.87  ? 542 ARG F NH1   1 
ATOM   2056 N  NH2   . ARG E 3 41 ? 36.961 116.253 61.418 1.00 65.18  ? 542 ARG F NH2   1 
ATOM   2057 N  N     . ARG E 3 42 ? 38.499 117.445 52.933 1.00 44.53  ? 543 ARG F N     1 
ATOM   2058 C  CA    . ARG E 3 42 ? 39.459 116.563 52.262 1.00 46.24  ? 543 ARG F CA    1 
ATOM   2059 C  C     . ARG E 3 42 ? 40.855 117.204 52.304 1.00 47.09  ? 543 ARG F C     1 
ATOM   2060 O  O     . ARG E 3 42 ? 40.978 118.425 52.405 1.00 47.32  ? 543 ARG F O     1 
ATOM   2061 C  CB    . ARG E 3 42 ? 39.050 116.360 50.798 1.00 48.10  ? 543 ARG F CB    1 
ATOM   2062 C  CG    . ARG E 3 42 ? 37.704 115.664 50.557 1.00 51.59  ? 543 ARG F CG    1 
ATOM   2063 C  CD    . ARG E 3 42 ? 37.172 116.047 49.173 1.00 55.21  ? 543 ARG F CD    1 
ATOM   2064 N  NE    . ARG E 3 42 ? 36.725 114.920 48.356 1.00 57.21  ? 543 ARG F NE    1 
ATOM   2065 C  CZ    . ARG E 3 42 ? 35.513 114.376 48.406 1.00 58.62  ? 543 ARG F CZ    1 
ATOM   2066 N  NH1   . ARG E 3 42 ? 34.604 114.849 49.242 1.00 59.76  ? 543 ARG F NH1   1 
ATOM   2067 N  NH2   . ARG E 3 42 ? 35.206 113.363 47.606 1.00 59.70  ? 543 ARG F NH2   1 
ATOM   2068 N  N     . ASN E 3 43 ? 41.906 116.389 52.211 1.00 47.39  ? 544 ASN F N     1 
ATOM   2069 C  CA    . ASN E 3 43 ? 43.268 116.921 52.253 1.00 48.36  ? 544 ASN F CA    1 
ATOM   2070 C  C     . ASN E 3 43 ? 43.822 117.244 50.871 1.00 48.34  ? 544 ASN F C     1 
ATOM   2071 O  O     . ASN E 3 43 ? 43.254 116.846 49.854 1.00 49.06  ? 544 ASN F O     1 
ATOM   2072 C  CB    . ASN E 3 43 ? 44.217 115.946 52.968 1.00 49.53  ? 544 ASN F CB    1 
ATOM   2073 C  CG    . ASN E 3 43 ? 44.468 114.672 52.180 1.00 49.80  ? 544 ASN F CG    1 
ATOM   2074 O  OD1   . ASN E 3 43 ? 44.804 114.708 50.994 1.00 50.08  ? 544 ASN F OD1   1 
ATOM   2075 N  ND2   . ASN E 3 43 ? 44.328 113.531 52.852 1.00 51.32  ? 544 ASN F ND2   1 
ATOM   2076 N  N     . ALA E 3 44 ? 44.940 117.965 50.846 1.00 48.10  ? 545 ALA F N     1 
ATOM   2077 C  CA    . ALA E 3 44 ? 45.585 118.358 49.597 1.00 47.03  ? 545 ALA F CA    1 
ATOM   2078 C  C     . ALA E 3 44 ? 45.993 117.156 48.757 1.00 46.10  ? 545 ALA F C     1 
ATOM   2079 O  O     . ALA E 3 44 ? 45.924 117.201 47.532 1.00 44.73  ? 545 ALA F O     1 
ATOM   2080 C  CB    . ALA E 3 44 ? 46.805 119.225 49.894 1.00 47.98  ? 545 ALA F CB    1 
ATOM   2081 N  N     . ALA E 3 45 ? 46.421 116.084 49.416 1.00 44.89  ? 546 ALA F N     1 
ATOM   2082 C  CA    . ALA E 3 45 ? 46.829 114.881 48.697 1.00 44.19  ? 546 ALA F CA    1 
ATOM   2083 C  C     . ALA E 3 45 ? 45.636 114.303 47.941 1.00 43.06  ? 546 ALA F C     1 
ATOM   2084 O  O     . ALA E 3 45 ? 45.781 113.771 46.835 1.00 43.08  ? 546 ALA F O     1 
ATOM   2085 C  CB    . ALA E 3 45 ? 47.377 113.838 49.667 1.00 44.55  ? 546 ALA F CB    1 
ATOM   2086 N  N     . THR E 3 46 ? 44.460 114.423 48.549 1.00 40.59  ? 547 THR F N     1 
ATOM   2087 C  CA    . THR E 3 46 ? 43.225 113.909 47.978 1.00 39.15  ? 547 THR F CA    1 
ATOM   2088 C  C     . THR E 3 46 ? 42.747 114.745 46.795 1.00 37.20  ? 547 THR F C     1 
ATOM   2089 O  O     . THR E 3 46 ? 42.647 114.239 45.677 1.00 36.10  ? 547 THR F O     1 
ATOM   2090 C  CB    . THR E 3 46 ? 42.122 113.864 49.032 1.00 38.93  ? 547 THR F CB    1 
ATOM   2091 O  OG1   . THR E 3 46 ? 42.558 113.055 50.128 1.00 41.46  ? 547 THR F OG1   1 
ATOM   2092 C  CG2   . THR E 3 46 ? 40.858 113.246 48.452 1.00 38.91  ? 547 THR F CG2   1 
ATOM   2093 N  N     . TRP E 3 47 ? 42.444 116.022 47.026 1.00 34.49  ? 548 TRP F N     1 
ATOM   2094 C  CA    . TRP E 3 47 ? 41.974 116.858 45.923 1.00 32.36  ? 548 TRP F CA    1 
ATOM   2095 C  C     . TRP E 3 47 ? 42.984 117.071 44.806 1.00 30.94  ? 548 TRP F C     1 
ATOM   2096 O  O     . TRP E 3 47 ? 42.601 117.194 43.637 1.00 29.59  ? 548 TRP F O     1 
ATOM   2097 C  CB    . TRP E 3 47 ? 41.422 118.208 46.426 1.00 32.14  ? 548 TRP F CB    1 
ATOM   2098 C  CG    . TRP E 3 47 ? 42.379 119.165 47.102 1.00 30.99  ? 548 TRP F CG    1 
ATOM   2099 C  CD1   . TRP E 3 47 ? 42.444 119.450 48.443 1.00 31.16  ? 548 TRP F CD1   1 
ATOM   2100 C  CD2   . TRP E 3 47 ? 43.348 120.016 46.466 1.00 31.43  ? 548 TRP F CD2   1 
ATOM   2101 N  NE1   . TRP E 3 47 ? 43.386 120.428 48.676 1.00 30.57  ? 548 TRP F NE1   1 
ATOM   2102 C  CE2   . TRP E 3 47 ? 43.955 120.795 47.483 1.00 31.59  ? 548 TRP F CE2   1 
ATOM   2103 C  CE3   . TRP E 3 47 ? 43.759 120.202 45.135 1.00 30.20  ? 548 TRP F CE3   1 
ATOM   2104 C  CZ2   . TRP E 3 47 ? 44.954 121.743 47.211 1.00 31.47  ? 548 TRP F CZ2   1 
ATOM   2105 C  CZ3   . TRP E 3 47 ? 44.755 121.147 44.864 1.00 31.29  ? 548 TRP F CZ3   1 
ATOM   2106 C  CH2   . TRP E 3 47 ? 45.338 121.905 45.900 1.00 30.53  ? 548 TRP F CH2   1 
ATOM   2107 N  N     . LYS E 3 48 ? 44.270 117.088 45.145 1.00 31.23  ? 549 LYS F N     1 
ATOM   2108 C  CA    . LYS E 3 48 ? 45.287 117.257 44.115 1.00 31.67  ? 549 LYS F CA    1 
ATOM   2109 C  C     . LYS E 3 48 ? 45.213 116.067 43.162 1.00 31.91  ? 549 LYS F C     1 
ATOM   2110 O  O     . LYS E 3 48 ? 45.202 116.223 41.941 1.00 31.60  ? 549 LYS F O     1 
ATOM   2111 C  CB    . LYS E 3 48 ? 46.685 117.336 44.732 1.00 35.06  ? 549 LYS F CB    1 
ATOM   2112 C  CG    . LYS E 3 48 ? 47.214 118.748 44.897 1.00 37.53  ? 549 LYS F CG    1 
ATOM   2113 C  CD    . LYS E 3 48 ? 48.660 118.737 45.346 1.00 40.40  ? 549 LYS F CD    1 
ATOM   2114 C  CE    . LYS E 3 48 ? 49.283 120.120 45.322 1.00 41.48  ? 549 LYS F CE    1 
ATOM   2115 N  NZ    . LYS E 3 48 ? 48.588 121.061 46.242 1.00 43.30  ? 549 LYS F NZ    1 
ATOM   2116 N  N     . ASN E 3 49 ? 45.177 114.866 43.727 1.00 31.04  ? 550 ASN F N     1 
ATOM   2117 C  CA    . ASN E 3 49 ? 45.074 113.663 42.907 1.00 30.63  ? 550 ASN F CA    1 
ATOM   2118 C  C     . ASN E 3 49 ? 43.814 113.761 42.051 1.00 29.75  ? 550 ASN F C     1 
ATOM   2119 O  O     . ASN E 3 49 ? 43.867 113.603 40.836 1.00 29.59  ? 550 ASN F O     1 
ATOM   2120 C  CB    . ASN E 3 49 ? 44.982 112.423 43.795 1.00 32.71  ? 550 ASN F CB    1 
ATOM   2121 C  CG    . ASN E 3 49 ? 44.439 111.215 43.057 1.00 34.09  ? 550 ASN F CG    1 
ATOM   2122 O  OD1   . ASN E 3 49 ? 43.273 110.850 43.212 1.00 34.42  ? 550 ASN F OD1   1 
ATOM   2123 N  ND2   . ASN E 3 49 ? 45.280 110.594 42.238 1.00 36.12  ? 550 ASN F ND2   1 
ATOM   2124 N  N     . ALA E 3 50 ? 42.686 114.042 42.703 1.00 29.00  ? 551 ALA F N     1 
ATOM   2125 C  CA    . ALA E 3 50 ? 41.391 114.140 42.026 1.00 28.22  ? 551 ALA F CA    1 
ATOM   2126 C  C     . ALA E 3 50 ? 41.391 115.138 40.871 1.00 28.24  ? 551 ALA F C     1 
ATOM   2127 O  O     . ALA E 3 50 ? 40.826 114.868 39.810 1.00 26.54  ? 551 ALA F O     1 
ATOM   2128 C  CB    . ALA E 3 50 ? 40.302 114.499 43.038 1.00 29.05  ? 551 ALA F CB    1 
ATOM   2129 N  N     . VAL E 3 51 ? 42.041 116.283 41.064 1.00 27.40  ? 552 VAL F N     1 
ATOM   2130 C  CA    . VAL E 3 51 ? 42.099 117.321 40.027 1.00 27.13  ? 552 VAL F CA    1 
ATOM   2131 C  C     . VAL E 3 51 ? 42.816 116.863 38.778 1.00 27.73  ? 552 VAL F C     1 
ATOM   2132 O  O     . VAL E 3 51 ? 42.343 117.090 37.666 1.00 28.57  ? 552 VAL F O     1 
ATOM   2133 C  CB    . VAL E 3 51 ? 42.792 118.610 40.533 1.00 27.53  ? 552 VAL F CB    1 
ATOM   2134 C  CG1   . VAL E 3 51 ? 43.102 119.519 39.362 1.00 25.94  ? 552 VAL F CG1   1 
ATOM   2135 C  CG2   . VAL E 3 51 ? 41.882 119.323 41.530 1.00 24.76  ? 552 VAL F CG2   1 
ATOM   2136 N  N     . ARG E 3 52 ? 43.963 116.223 38.958 1.00 28.19  ? 553 ARG F N     1 
ATOM   2137 C  CA    . ARG E 3 52 ? 44.712 115.720 37.817 1.00 29.51  ? 553 ARG F CA    1 
ATOM   2138 C  C     . ARG E 3 52 ? 43.852 114.661 37.119 1.00 27.99  ? 553 ARG F C     1 
ATOM   2139 O  O     . ARG E 3 52 ? 43.742 114.641 35.899 1.00 26.58  ? 553 ARG F O     1 
ATOM   2140 C  CB    . ARG E 3 52 ? 46.041 115.107 38.277 1.00 31.94  ? 553 ARG F CB    1 
ATOM   2141 C  CG    . ARG E 3 52 ? 46.976 116.083 38.993 1.00 36.93  ? 553 ARG F CG    1 
ATOM   2142 C  CD    . ARG E 3 52 ? 48.424 115.589 38.965 1.00 39.61  ? 553 ARG F CD    1 
ATOM   2143 N  NE    . ARG E 3 52 ? 48.587 114.273 39.582 1.00 43.05  ? 553 ARG F NE    1 
ATOM   2144 C  CZ    . ARG E 3 52 ? 48.510 114.040 40.889 1.00 43.26  ? 553 ARG F CZ    1 
ATOM   2145 N  NH1   . ARG E 3 52 ? 48.274 115.037 41.731 1.00 44.08  ? 553 ARG F NH1   1 
ATOM   2146 N  NH2   . ARG E 3 52 ? 48.668 112.808 41.356 1.00 43.00  ? 553 ARG F NH2   1 
ATOM   2147 N  N     . HIS E 3 53 ? 43.232 113.797 37.912 1.00 29.25  ? 554 HIS F N     1 
ATOM   2148 C  CA    . HIS E 3 53 ? 42.366 112.735 37.390 1.00 29.75  ? 554 HIS F CA    1 
ATOM   2149 C  C     . HIS E 3 53 ? 41.268 113.297 36.484 1.00 29.71  ? 554 HIS F C     1 
ATOM   2150 O  O     . HIS E 3 53 ? 41.071 112.828 35.357 1.00 29.31  ? 554 HIS F O     1 
ATOM   2151 C  CB    . HIS E 3 53 ? 41.759 111.966 38.571 1.00 31.41  ? 554 HIS F CB    1 
ATOM   2152 C  CG    . HIS E 3 53 ? 40.763 110.916 38.179 1.00 32.85  ? 554 HIS F CG    1 
ATOM   2153 N  ND1   . HIS E 3 53 ? 39.451 111.206 37.886 1.00 33.85  ? 554 HIS F ND1   1 
ATOM   2154 C  CD2   . HIS E 3 53 ? 40.889 109.571 38.061 1.00 33.13  ? 554 HIS F CD2   1 
ATOM   2155 C  CE1   . HIS E 3 53 ? 38.805 110.085 37.605 1.00 33.42  ? 554 HIS F CE1   1 
ATOM   2156 N  NE2   . HIS E 3 53 ? 39.656 109.082 37.705 1.00 33.49  ? 554 HIS F NE2   1 
ATOM   2157 N  N     . ASN E 3 54 ? 40.563 114.311 36.981 1.00 29.22  ? 555 ASN F N     1 
ATOM   2158 C  CA    . ASN E 3 54 ? 39.482 114.946 36.233 1.00 29.75  ? 555 ASN F CA    1 
ATOM   2159 C  C     . ASN E 3 54 ? 39.921 115.691 34.981 1.00 30.82  ? 555 ASN F C     1 
ATOM   2160 O  O     . ASN E 3 54 ? 39.175 115.740 34.003 1.00 31.64  ? 555 ASN F O     1 
ATOM   2161 C  CB    . ASN E 3 54 ? 38.709 115.903 37.141 1.00 27.11  ? 555 ASN F CB    1 
ATOM   2162 C  CG    . ASN E 3 54 ? 37.618 115.206 37.924 1.00 25.44  ? 555 ASN F CG    1 
ATOM   2163 O  OD1   . ASN E 3 54 ? 36.461 115.191 37.510 1.00 25.79  ? 555 ASN F OD1   1 
ATOM   2164 N  ND2   . ASN E 3 54 ? 37.981 114.613 39.055 1.00 24.43  ? 555 ASN F ND2   1 
ATOM   2165 N  N     . LEU E 3 55 ? 41.114 116.280 35.010 1.00 32.05  ? 556 LEU F N     1 
ATOM   2166 C  CA    . LEU E 3 55 ? 41.617 117.022 33.855 1.00 34.24  ? 556 LEU F CA    1 
ATOM   2167 C  C     . LEU E 3 55 ? 41.946 116.090 32.688 1.00 36.11  ? 556 LEU F C     1 
ATOM   2168 O  O     . LEU E 3 55 ? 41.776 116.455 31.525 1.00 36.44  ? 556 LEU F O     1 
ATOM   2169 C  CB    . LEU E 3 55 ? 42.872 117.825 34.229 1.00 33.59  ? 556 LEU F CB    1 
ATOM   2170 C  CG    . LEU E 3 55 ? 42.661 119.104 35.044 1.00 31.58  ? 556 LEU F CG    1 
ATOM   2171 C  CD1   . LEU E 3 55 ? 44.008 119.751 35.364 1.00 30.48  ? 556 LEU F CD1   1 
ATOM   2172 C  CD2   . LEU E 3 55 ? 41.795 120.062 34.254 1.00 29.73  ? 556 LEU F CD2   1 
ATOM   2173 N  N     . SER E 3 56 ? 42.413 114.888 33.006 1.00 38.00  ? 557 SER F N     1 
ATOM   2174 C  CA    . SER E 3 56 ? 42.775 113.922 31.977 1.00 41.04  ? 557 SER F CA    1 
ATOM   2175 C  C     . SER E 3 56 ? 41.659 112.939 31.635 1.00 41.95  ? 557 SER F C     1 
ATOM   2176 O  O     . SER E 3 56 ? 41.820 112.114 30.738 1.00 42.30  ? 557 SER F O     1 
ATOM   2177 C  CB    . SER E 3 56 ? 44.019 113.139 32.404 1.00 40.98  ? 557 SER F CB    1 
ATOM   2178 O  OG    . SER E 3 56 ? 43.764 112.365 33.562 1.00 43.54  ? 557 SER F OG    1 
ATOM   2179 N  N     . LEU E 3 57 ? 40.534 113.019 32.340 1.00 43.38  ? 558 LEU F N     1 
ATOM   2180 C  CA    . LEU E 3 57 ? 39.416 112.116 32.073 1.00 43.77  ? 558 LEU F CA    1 
ATOM   2181 C  C     . LEU E 3 57 ? 38.310 112.791 31.270 1.00 44.15  ? 558 LEU F C     1 
ATOM   2182 O  O     . LEU E 3 57 ? 37.807 112.227 30.301 1.00 44.14  ? 558 LEU F O     1 
ATOM   2183 C  CB    . LEU E 3 57 ? 38.825 111.583 33.382 1.00 43.26  ? 558 LEU F CB    1 
ATOM   2184 C  CG    . LEU E 3 57 ? 37.685 110.560 33.240 1.00 44.32  ? 558 LEU F CG    1 
ATOM   2185 C  CD1   . LEU E 3 57 ? 38.228 109.286 32.609 1.00 43.31  ? 558 LEU F CD1   1 
ATOM   2186 C  CD2   . LEU E 3 57 ? 37.064 110.259 34.603 1.00 42.22  ? 558 LEU F CD2   1 
ATOM   2187 N  N     . HIS E 3 58 ? 37.939 114.001 31.674 1.00 44.90  ? 559 HIS F N     1 
ATOM   2188 C  CA    . HIS E 3 58 ? 36.875 114.738 31.007 1.00 46.70  ? 559 HIS F CA    1 
ATOM   2189 C  C     . HIS E 3 58 ? 37.354 115.557 29.816 1.00 47.82  ? 559 HIS F C     1 
ATOM   2190 O  O     . HIS E 3 58 ? 38.285 116.357 29.926 1.00 47.91  ? 559 HIS F O     1 
ATOM   2191 C  CB    . HIS E 3 58 ? 36.166 115.645 32.015 1.00 47.44  ? 559 HIS F CB    1 
ATOM   2192 C  CG    . HIS E 3 58 ? 35.596 114.906 33.186 1.00 48.97  ? 559 HIS F CG    1 
ATOM   2193 N  ND1   . HIS E 3 58 ? 34.624 113.937 33.053 1.00 49.49  ? 559 HIS F ND1   1 
ATOM   2194 C  CD2   . HIS E 3 58 ? 35.880 114.974 34.508 1.00 48.42  ? 559 HIS F CD2   1 
ATOM   2195 C  CE1   . HIS E 3 58 ? 34.335 113.440 34.242 1.00 49.80  ? 559 HIS F CE1   1 
ATOM   2196 N  NE2   . HIS E 3 58 ? 35.083 114.051 35.143 1.00 49.51  ? 559 HIS F NE2   1 
ATOM   2197 N  N     . LYS E 3 59 ? 36.697 115.347 28.678 1.00 48.37  ? 560 LYS F N     1 
ATOM   2198 C  CA    . LYS E 3 59 ? 37.027 116.037 27.436 1.00 49.04  ? 560 LYS F CA    1 
ATOM   2199 C  C     . LYS E 3 59 ? 36.704 117.528 27.476 1.00 48.29  ? 560 LYS F C     1 
ATOM   2200 O  O     . LYS E 3 59 ? 37.266 118.301 26.705 1.00 48.37  ? 560 LYS F O     1 
ATOM   2201 C  CB    . LYS E 3 59 ? 36.284 115.386 26.265 1.00 51.15  ? 560 LYS F CB    1 
ATOM   2202 C  CG    . LYS E 3 59 ? 36.565 113.898 26.101 1.00 54.56  ? 560 LYS F CG    1 
ATOM   2203 C  CD    . LYS E 3 59 ? 35.697 113.269 25.016 1.00 56.55  ? 560 LYS F CD    1 
ATOM   2204 C  CE    . LYS E 3 59 ? 35.988 113.858 23.643 1.00 57.35  ? 560 LYS F CE    1 
ATOM   2205 N  NZ    . LYS E 3 59 ? 37.405 113.641 23.230 1.00 57.47  ? 560 LYS F NZ    1 
ATOM   2206 N  N     . CYS E 3 60 ? 35.800 117.936 28.362 1.00 48.37  ? 561 CYS F N     1 
ATOM   2207 C  CA    . CYS E 3 60 ? 35.447 119.351 28.458 1.00 48.10  ? 561 CYS F CA    1 
ATOM   2208 C  C     . CYS E 3 60 ? 36.638 120.197 28.918 1.00 47.13  ? 561 CYS F C     1 
ATOM   2209 O  O     . CYS E 3 60 ? 36.637 121.417 28.768 1.00 46.49  ? 561 CYS F O     1 
ATOM   2210 C  CB    . CYS E 3 60 ? 34.248 119.551 29.396 1.00 49.46  ? 561 CYS F CB    1 
ATOM   2211 S  SG    . CYS E 3 60 ? 34.447 118.912 31.072 1.00 51.60  ? 561 CYS F SG    1 
ATOM   2212 N  N     . PHE E 3 61 ? 37.655 119.543 29.472 1.00 46.42  ? 562 PHE F N     1 
ATOM   2213 C  CA    . PHE E 3 61 ? 38.859 120.241 29.920 1.00 47.31  ? 562 PHE F CA    1 
ATOM   2214 C  C     . PHE E 3 61 ? 39.945 119.986 28.878 1.00 49.05  ? 562 PHE F C     1 
ATOM   2215 O  O     . PHE E 3 61 ? 40.446 118.868 28.746 1.00 48.29  ? 562 PHE F O     1 
ATOM   2216 C  CB    . PHE E 3 61 ? 39.309 119.723 31.295 1.00 44.39  ? 562 PHE F CB    1 
ATOM   2217 C  CG    . PHE E 3 61 ? 38.302 119.956 32.388 1.00 41.28  ? 562 PHE F CG    1 
ATOM   2218 C  CD1   . PHE E 3 61 ? 37.919 118.917 33.232 1.00 40.65  ? 562 PHE F CD1   1 
ATOM   2219 C  CD2   . PHE E 3 61 ? 37.716 121.208 32.555 1.00 39.88  ? 562 PHE F CD2   1 
ATOM   2220 C  CE1   . PHE E 3 61 ? 36.955 119.118 34.227 1.00 39.66  ? 562 PHE F CE1   1 
ATOM   2221 C  CE2   . PHE E 3 61 ? 36.755 121.422 33.543 1.00 39.65  ? 562 PHE F CE2   1 
ATOM   2222 C  CZ    . PHE E 3 61 ? 36.374 120.373 34.381 1.00 39.04  ? 562 PHE F CZ    1 
ATOM   2223 N  N     . VAL E 3 62 ? 40.292 121.027 28.130 1.00 51.70  ? 563 VAL F N     1 
ATOM   2224 C  CA    . VAL E 3 62 ? 41.298 120.913 27.085 1.00 54.50  ? 563 VAL F CA    1 
ATOM   2225 C  C     . VAL E 3 62 ? 42.548 121.721 27.404 1.00 56.74  ? 563 VAL F C     1 
ATOM   2226 O  O     . VAL E 3 62 ? 42.468 122.901 27.746 1.00 56.42  ? 563 VAL F O     1 
ATOM   2227 C  CB    . VAL E 3 62 ? 40.745 121.394 25.731 1.00 54.95  ? 563 VAL F CB    1 
ATOM   2228 C  CG1   . VAL E 3 62 ? 41.763 121.131 24.633 1.00 55.13  ? 563 VAL F CG1   1 
ATOM   2229 C  CG2   . VAL E 3 62 ? 39.436 120.688 25.427 1.00 55.50  ? 563 VAL F CG2   1 
ATOM   2230 N  N     . ARG E 3 63 ? 43.703 121.076 27.282 1.00 59.73  ? 564 ARG F N     1 
ATOM   2231 C  CA    . ARG E 3 63 ? 44.971 121.735 27.553 1.00 64.05  ? 564 ARG F CA    1 
ATOM   2232 C  C     . ARG E 3 63 ? 45.464 122.482 26.315 1.00 65.23  ? 564 ARG F C     1 
ATOM   2233 O  O     . ARG E 3 63 ? 45.960 121.877 25.365 1.00 65.23  ? 564 ARG F O     1 
ATOM   2234 C  CB    . ARG E 3 63 ? 46.023 120.707 28.004 1.00 66.62  ? 564 ARG F CB    1 
ATOM   2235 C  CG    . ARG E 3 63 ? 46.571 119.791 26.908 1.00 71.81  ? 564 ARG F CG    1 
ATOM   2236 C  CD    . ARG E 3 63 ? 45.477 118.998 26.198 1.00 75.88  ? 564 ARG F CD    1 
ATOM   2237 N  NE    . ARG E 3 63 ? 46.002 118.252 25.056 1.00 79.21  ? 564 ARG F NE    1 
ATOM   2238 C  CZ    . ARG E 3 63 ? 45.258 117.530 24.222 1.00 80.53  ? 564 ARG F CZ    1 
ATOM   2239 N  NH1   . ARG E 3 63 ? 43.945 117.450 24.398 1.00 81.40  ? 564 ARG F NH1   1 
ATOM   2240 N  NH2   . ARG E 3 63 ? 45.827 116.891 23.208 1.00 81.48  ? 564 ARG F NH2   1 
ATOM   2241 N  N     . VAL E 3 64 ? 45.313 123.801 26.317 1.00 66.80  ? 565 VAL F N     1 
ATOM   2242 C  CA    . VAL E 3 64 ? 45.769 124.593 25.184 1.00 69.28  ? 565 VAL F CA    1 
ATOM   2243 C  C     . VAL E 3 64 ? 47.208 125.044 25.412 1.00 70.39  ? 565 VAL F C     1 
ATOM   2244 O  O     . VAL E 3 64 ? 47.473 125.973 26.178 1.00 71.10  ? 565 VAL F O     1 
ATOM   2245 C  CB    . VAL E 3 64 ? 44.867 125.822 24.948 1.00 69.17  ? 565 VAL F CB    1 
ATOM   2246 C  CG1   . VAL E 3 64 ? 44.777 126.660 26.204 1.00 69.32  ? 565 VAL F CG1   1 
ATOM   2247 C  CG2   . VAL E 3 64 ? 45.408 126.647 23.798 1.00 69.20  ? 565 VAL F CG2   1 
ATOM   2248 N  N     . GLU E 3 65 ? 48.133 124.363 24.742 1.00 71.72  ? 566 GLU F N     1 
ATOM   2249 C  CA    . GLU E 3 65 ? 49.556 124.660 24.856 1.00 72.52  ? 566 GLU F CA    1 
ATOM   2250 C  C     . GLU E 3 65 ? 49.933 125.867 24.011 1.00 72.63  ? 566 GLU F C     1 
ATOM   2251 O  O     . GLU E 3 65 ? 49.873 125.827 22.784 1.00 72.55  ? 566 GLU F O     1 
ATOM   2252 C  CB    . GLU E 3 65 ? 50.377 123.444 24.424 1.00 73.16  ? 566 GLU F CB    1 
ATOM   2253 C  CG    . GLU E 3 65 ? 50.103 122.199 25.254 1.00 74.30  ? 566 GLU F CG    1 
ATOM   2254 C  CD    . GLU E 3 65 ? 50.870 120.985 24.760 1.00 74.91  ? 566 GLU F CD    1 
ATOM   2255 O  OE1   . GLU E 3 65 ? 50.679 120.594 23.588 1.00 74.86  ? 566 GLU F OE1   1 
ATOM   2256 O  OE2   . GLU E 3 65 ? 51.660 120.419 25.547 1.00 74.94  ? 566 GLU F OE2   1 
ATOM   2257 N  N     . ASN E 3 66 ? 50.325 126.942 24.685 1.00 72.92  ? 567 ASN F N     1 
ATOM   2258 C  CA    . ASN E 3 66 ? 50.706 128.175 24.013 1.00 73.28  ? 567 ASN F CA    1 
ATOM   2259 C  C     . ASN E 3 66 ? 52.196 128.446 24.145 1.00 73.85  ? 567 ASN F C     1 
ATOM   2260 O  O     . ASN E 3 66 ? 53.009 127.527 24.252 1.00 73.81  ? 567 ASN F O     1 
ATOM   2261 C  CB    . ASN E 3 66 ? 49.936 129.352 24.612 1.00 73.42  ? 567 ASN F CB    1 
ATOM   2262 C  CG    . ASN E 3 66 ? 50.223 129.541 26.098 1.00 74.09  ? 567 ASN F CG    1 
ATOM   2263 O  OD1   . ASN E 3 66 ? 49.732 130.484 26.721 1.00 74.65  ? 567 ASN F OD1   1 
ATOM   2264 N  ND2   . ASN E 3 66 ? 51.019 128.641 26.672 1.00 74.01  ? 567 ASN F ND2   1 
ATOM   2265 N  N     . VAL E 3 67 ? 52.527 129.733 24.138 1.00 74.33  ? 568 VAL F N     1 
ATOM   2266 C  CA    . VAL E 3 67 ? 53.890 130.231 24.266 1.00 74.69  ? 568 VAL F CA    1 
ATOM   2267 C  C     . VAL E 3 67 ? 54.708 129.420 25.294 1.00 74.22  ? 568 VAL F C     1 
ATOM   2268 O  O     . VAL E 3 67 ? 55.225 128.351 24.957 1.00 74.49  ? 568 VAL F O     1 
ATOM   2269 C  CB    . VAL E 3 67 ? 53.829 131.727 24.647 1.00 74.57  ? 568 VAL F CB    1 
ATOM   2270 C  CG1   . VAL E 3 67 ? 53.003 131.911 25.898 1.00 74.74  ? 568 VAL F CG1   1 
ATOM   2271 C  CG2   . VAL E 3 67 ? 55.210 132.283 24.840 1.00 74.04  ? 568 VAL F CG2   1 
ATOM   2272 N  N     . LYS E 3 68 ? 54.840 129.909 26.528 1.00 73.62  ? 569 LYS F N     1 
ATOM   2273 C  CA    . LYS E 3 68 ? 55.575 129.161 27.553 1.00 72.59  ? 569 LYS F CA    1 
ATOM   2274 C  C     . LYS E 3 68 ? 54.584 128.419 28.449 1.00 72.04  ? 569 LYS F C     1 
ATOM   2275 O  O     . LYS E 3 68 ? 53.531 128.954 28.800 1.00 71.91  ? 569 LYS F O     1 
ATOM   2276 C  CB    . LYS E 3 68 ? 56.449 130.088 28.409 1.00 72.06  ? 569 LYS F CB    1 
ATOM   2277 C  CG    . LYS E 3 68 ? 57.827 130.386 27.829 1.00 71.71  ? 569 LYS F CG    1 
ATOM   2278 C  CD    . LYS E 3 68 ? 58.749 131.003 28.877 1.00 71.37  ? 569 LYS F CD    1 
ATOM   2279 C  CE    . LYS E 3 68 ? 58.246 132.364 29.326 1.00 71.42  ? 569 LYS F CE    1 
ATOM   2280 N  NZ    . LYS E 3 68 ? 59.100 132.945 30.399 1.00 72.63  ? 569 LYS F NZ    1 
ATOM   2281 N  N     . GLY E 3 69 ? 54.920 127.187 28.818 1.00 71.53  ? 570 GLY F N     1 
ATOM   2282 C  CA    . GLY E 3 69 ? 54.026 126.407 29.655 1.00 70.73  ? 570 GLY F CA    1 
ATOM   2283 C  C     . GLY E 3 69 ? 52.749 126.027 28.922 1.00 70.14  ? 570 GLY F C     1 
ATOM   2284 O  O     . GLY E 3 69 ? 52.553 126.414 27.769 1.00 70.38  ? 570 GLY F O     1 
ATOM   2285 N  N     . ALA E 3 70 ? 51.889 125.263 29.593 1.00 68.91  ? 571 ALA F N     1 
ATOM   2286 C  CA    . ALA E 3 70 ? 50.617 124.811 29.031 1.00 67.49  ? 571 ALA F CA    1 
ATOM   2287 C  C     . ALA E 3 70 ? 49.460 125.229 29.941 1.00 66.23  ? 571 ALA F C     1 
ATOM   2288 O  O     . ALA E 3 70 ? 49.446 124.897 31.127 1.00 66.62  ? 571 ALA F O     1 
ATOM   2289 C  CB    . ALA E 3 70 ? 50.631 123.287 28.869 1.00 66.68  ? 571 ALA F CB    1 
ATOM   2290 N  N     . VAL E 3 71 ? 48.491 125.953 29.386 1.00 64.74  ? 572 VAL F N     1 
ATOM   2291 C  CA    . VAL E 3 71 ? 47.330 126.401 30.158 1.00 63.22  ? 572 VAL F CA    1 
ATOM   2292 C  C     . VAL E 3 71 ? 46.090 125.597 29.761 1.00 61.55  ? 572 VAL F C     1 
ATOM   2293 O  O     . VAL E 3 71 ? 45.973 125.166 28.617 1.00 61.43  ? 572 VAL F O     1 
ATOM   2294 C  CB    . VAL E 3 71 ? 47.061 127.915 29.930 1.00 62.99  ? 572 VAL F CB    1 
ATOM   2295 C  CG1   . VAL E 3 71 ? 48.327 128.707 30.216 1.00 63.33  ? 572 VAL F CG1   1 
ATOM   2296 C  CG2   . VAL E 3 71 ? 46.609 128.170 28.498 1.00 63.11  ? 572 VAL F CG2   1 
ATOM   2297 N  N     . TRP E 3 72 ? 45.178 125.365 30.702 1.00 58.69  ? 573 TRP F N     1 
ATOM   2298 C  CA    . TRP E 3 72 ? 43.973 124.620 30.358 1.00 56.27  ? 573 TRP F CA    1 
ATOM   2299 C  C     . TRP E 3 72 ? 42.912 125.605 29.908 1.00 55.94  ? 573 TRP F C     1 
ATOM   2300 O  O     . TRP E 3 72 ? 43.222 126.738 29.506 1.00 57.26  ? 573 TRP F O     1 
ATOM   2301 C  CB    . TRP E 3 72 ? 43.441 123.779 31.539 1.00 53.50  ? 573 TRP F CB    1 
ATOM   2302 C  CG    . TRP E 3 72 ? 44.354 122.635 31.901 1.00 50.56  ? 573 TRP F CG    1 
ATOM   2303 C  CD1   . TRP E 3 72 ? 45.500 122.720 32.624 1.00 49.45  ? 573 TRP F CD1   1 
ATOM   2304 C  CD2   . TRP E 3 72 ? 44.272 121.274 31.443 1.00 49.46  ? 573 TRP F CD2   1 
ATOM   2305 N  NE1   . TRP E 3 72 ? 46.144 121.507 32.648 1.00 48.42  ? 573 TRP F NE1   1 
ATOM   2306 C  CE2   . TRP E 3 72 ? 45.402 120.589 31.933 1.00 49.16  ? 573 TRP F CE2   1 
ATOM   2307 C  CE3   . TRP E 3 72 ? 43.339 120.549 30.677 1.00 49.20  ? 573 TRP F CE3   1 
ATOM   2308 C  CZ2   . TRP E 3 72 ? 45.660 119.245 31.673 1.00 48.81  ? 573 TRP F CZ2   1 
ATOM   2309 C  CZ3   . TRP E 3 72 ? 43.589 119.192 30.413 1.00 49.21  ? 573 TRP F CZ3   1 
ATOM   2310 C  CH2   . TRP E 3 72 ? 44.739 118.557 30.923 1.00 49.56  ? 573 TRP F CH2   1 
ATOM   2311 N  N     . THR E 3 73 ? 41.661 125.164 29.984 1.00 54.41  ? 574 THR F N     1 
ATOM   2312 C  CA    . THR E 3 73 ? 40.522 125.979 29.599 1.00 52.64  ? 574 THR F CA    1 
ATOM   2313 C  C     . THR E 3 73 ? 39.273 125.109 29.571 1.00 51.85  ? 574 THR F C     1 
ATOM   2314 O  O     . THR E 3 73 ? 39.359 123.881 29.611 1.00 50.32  ? 574 THR F O     1 
ATOM   2315 C  CB    . THR E 3 73 ? 40.728 126.599 28.211 1.00 52.94  ? 574 THR F CB    1 
ATOM   2316 O  OG1   . THR E 3 73 ? 39.847 127.721 28.069 1.00 51.71  ? 574 THR F OG1   1 
ATOM   2317 C  CG2   . THR E 3 73 ? 40.429 125.565 27.114 1.00 51.87  ? 574 THR F CG2   1 
ATOM   2318 N  N     . VAL E 3 74 ? 38.114 125.743 29.473 1.00 52.30  ? 575 VAL F N     1 
ATOM   2319 C  CA    . VAL E 3 74 ? 36.878 124.989 29.456 1.00 53.72  ? 575 VAL F CA    1 
ATOM   2320 C  C     . VAL E 3 74 ? 36.141 125.021 28.124 1.00 55.05  ? 575 VAL F C     1 
ATOM   2321 O  O     . VAL E 3 74 ? 35.962 126.077 27.508 1.00 54.20  ? 575 VAL F O     1 
ATOM   2322 C  CB    . VAL E 3 74 ? 35.929 125.468 30.569 1.00 53.82  ? 575 VAL F CB    1 
ATOM   2323 C  CG1   . VAL E 3 74 ? 34.610 124.700 30.507 1.00 53.91  ? 575 VAL F CG1   1 
ATOM   2324 C  CG2   . VAL E 3 74 ? 36.590 125.261 31.923 1.00 53.76  ? 575 VAL F CG2   1 
ATOM   2325 N  N     . ASP E 3 75 ? 35.742 123.833 27.680 1.00 56.87  ? 576 ASP F N     1 
ATOM   2326 C  CA    . ASP E 3 75 ? 34.994 123.668 26.443 1.00 58.54  ? 576 ASP F CA    1 
ATOM   2327 C  C     . ASP E 3 75 ? 33.537 123.739 26.873 1.00 59.50  ? 576 ASP F C     1 
ATOM   2328 O  O     . ASP E 3 75 ? 32.901 122.714 27.117 1.00 60.45  ? 576 ASP F O     1 
ATOM   2329 C  CB    . ASP E 3 75 ? 35.282 122.301 25.822 1.00 58.70  ? 576 ASP F CB    1 
ATOM   2330 C  CG    . ASP E 3 75 ? 34.599 122.114 24.480 1.00 59.29  ? 576 ASP F CG    1 
ATOM   2331 O  OD1   . ASP E 3 75 ? 33.414 122.488 24.353 1.00 59.73  ? 576 ASP F OD1   1 
ATOM   2332 O  OD2   . ASP E 3 75 ? 35.243 121.581 23.552 1.00 58.67  ? 576 ASP F OD2   1 
ATOM   2333 N  N     . GLU E 3 76 ? 33.026 124.959 26.982 1.00 61.08  ? 577 GLU F N     1 
ATOM   2334 C  CA    . GLU E 3 76 ? 31.652 125.196 27.404 1.00 63.04  ? 577 GLU F CA    1 
ATOM   2335 C  C     . GLU E 3 76 ? 30.660 124.262 26.715 1.00 63.94  ? 577 GLU F C     1 
ATOM   2336 O  O     . GLU E 3 76 ? 29.693 123.808 27.330 1.00 64.01  ? 577 GLU F O     1 
ATOM   2337 C  CB    . GLU E 3 76 ? 31.278 126.653 27.127 1.00 63.79  ? 577 GLU F CB    1 
ATOM   2338 C  CG    . GLU E 3 76 ? 30.017 127.122 27.829 1.00 65.23  ? 577 GLU F CG    1 
ATOM   2339 C  CD    . GLU E 3 76 ? 30.101 126.980 29.338 1.00 66.15  ? 577 GLU F CD    1 
ATOM   2340 O  OE1   . GLU E 3 76 ? 31.214 126.749 29.859 1.00 66.74  ? 577 GLU F OE1   1 
ATOM   2341 O  OE2   . GLU E 3 76 ? 29.054 127.109 30.008 1.00 66.03  ? 577 GLU F OE2   1 
ATOM   2342 N  N     . VAL E 3 77 ? 30.904 123.975 25.441 1.00 64.65  ? 578 VAL F N     1 
ATOM   2343 C  CA    . VAL E 3 77 ? 30.026 123.092 24.685 1.00 65.93  ? 578 VAL F CA    1 
ATOM   2344 C  C     . VAL E 3 77 ? 30.121 121.662 25.194 1.00 66.40  ? 578 VAL F C     1 
ATOM   2345 O  O     . VAL E 3 77 ? 29.106 121.003 25.411 1.00 66.80  ? 578 VAL F O     1 
ATOM   2346 C  CB    . VAL E 3 77 ? 30.377 123.103 23.184 1.00 66.44  ? 578 VAL F CB    1 
ATOM   2347 C  CG1   . VAL E 3 77 ? 29.498 122.107 22.438 1.00 66.82  ? 578 VAL F CG1   1 
ATOM   2348 C  CG2   . VAL E 3 77 ? 30.193 124.504 22.621 1.00 66.38  ? 578 VAL F CG2   1 
ATOM   2349 N  N     . GLU E 3 78 ? 31.344 121.180 25.377 1.00 67.01  ? 579 GLU F N     1 
ATOM   2350 C  CA    . GLU E 3 78 ? 31.545 119.825 25.864 1.00 67.83  ? 579 GLU F CA    1 
ATOM   2351 C  C     . GLU E 3 78 ? 30.941 119.698 27.259 1.00 68.56  ? 579 GLU F C     1 
ATOM   2352 O  O     . GLU E 3 78 ? 30.439 118.638 27.637 1.00 68.05  ? 579 GLU F O     1 
ATOM   2353 C  CB    . GLU E 3 78 ? 33.037 119.494 25.914 1.00 68.13  ? 579 GLU F CB    1 
ATOM   2354 C  CG    . GLU E 3 78 ? 33.325 118.029 26.186 1.00 68.05  ? 579 GLU F CG    1 
ATOM   2355 C  CD    . GLU E 3 78 ? 32.970 117.140 25.010 1.00 67.78  ? 579 GLU F CD    1 
ATOM   2356 O  OE1   . GLU E 3 78 ? 32.277 117.618 24.088 1.00 67.15  ? 579 GLU F OE1   1 
ATOM   2357 O  OE2   . GLU E 3 78 ? 33.381 115.961 25.012 1.00 67.86  ? 579 GLU F OE2   1 
ATOM   2358 N  N     . TYR E 3 79 ? 30.989 120.792 28.014 1.00 69.27  ? 580 TYR F N     1 
ATOM   2359 C  CA    . TYR E 3 79 ? 30.455 120.819 29.370 1.00 70.18  ? 580 TYR F CA    1 
ATOM   2360 C  C     . TYR E 3 79 ? 28.927 120.814 29.320 1.00 71.64  ? 580 TYR F C     1 
ATOM   2361 O  O     . TYR E 3 79 ? 28.261 120.515 30.312 1.00 71.91  ? 580 TYR F O     1 
ATOM   2362 C  CB    . TYR E 3 79 ? 30.941 122.074 30.102 1.00 69.15  ? 580 TYR F CB    1 
ATOM   2363 C  CG    . TYR E 3 79 ? 30.993 121.930 31.606 1.00 67.77  ? 580 TYR F CG    1 
ATOM   2364 C  CD1   . TYR E 3 79 ? 32.116 121.396 32.236 1.00 66.89  ? 580 TYR F CD1   1 
ATOM   2365 C  CD2   . TYR E 3 79 ? 29.912 122.312 32.400 1.00 67.56  ? 580 TYR F CD2   1 
ATOM   2366 C  CE1   . TYR E 3 79 ? 32.161 121.246 33.620 1.00 66.73  ? 580 TYR F CE1   1 
ATOM   2367 C  CE2   . TYR E 3 79 ? 29.945 122.164 33.784 1.00 66.67  ? 580 TYR F CE2   1 
ATOM   2368 C  CZ    . TYR E 3 79 ? 31.070 121.632 34.387 1.00 66.78  ? 580 TYR F CZ    1 
ATOM   2369 O  OH    . TYR E 3 79 ? 31.094 121.486 35.755 1.00 66.99  ? 580 TYR F OH    1 
ATOM   2370 N  N     . GLN E 3 80 ? 28.385 121.142 28.151 1.00 73.44  ? 581 GLN F N     1 
ATOM   2371 C  CA    . GLN E 3 80 ? 26.941 121.186 27.940 1.00 75.21  ? 581 GLN F CA    1 
ATOM   2372 C  C     . GLN E 3 80 ? 26.268 119.830 28.153 1.00 76.47  ? 581 GLN F C     1 
ATOM   2373 O  O     . GLN E 3 80 ? 25.145 119.760 28.657 1.00 76.64  ? 581 GLN F O     1 
ATOM   2374 C  CB    . GLN E 3 80 ? 26.651 121.705 26.531 1.00 75.81  ? 581 GLN F CB    1 
ATOM   2375 C  CG    . GLN E 3 80 ? 25.192 121.697 26.126 1.00 75.80  ? 581 GLN F CG    1 
ATOM   2376 C  CD    . GLN E 3 80 ? 24.969 122.399 24.801 1.00 75.99  ? 581 GLN F CD    1 
ATOM   2377 O  OE1   . GLN E 3 80 ? 25.623 122.090 23.803 1.00 75.83  ? 581 GLN F OE1   1 
ATOM   2378 N  NE2   . GLN E 3 80 ? 24.042 123.350 24.784 1.00 75.67  ? 581 GLN F NE2   1 
ATOM   2379 N  N     . LYS E 3 81 ? 26.951 118.760 27.758 1.00 77.84  ? 582 LYS F N     1 
ATOM   2380 C  CA    . LYS E 3 81 ? 26.433 117.403 27.926 1.00 79.24  ? 582 LYS F CA    1 
ATOM   2381 C  C     . LYS E 3 81 ? 26.048 117.176 29.386 1.00 80.49  ? 582 LYS F C     1 
ATOM   2382 O  O     . LYS E 3 81 ? 24.947 116.711 29.685 1.00 80.73  ? 582 LYS F O     1 
ATOM   2383 C  CB    . LYS E 3 81 ? 27.504 116.386 27.509 1.00 78.88  ? 582 LYS F CB    1 
ATOM   2384 C  CG    . LYS E 3 81 ? 27.355 114.985 28.113 1.00 78.22  ? 582 LYS F CG    1 
ATOM   2385 C  CD    . LYS E 3 81 ? 26.320 114.126 27.396 1.00 77.45  ? 582 LYS F CD    1 
ATOM   2386 C  CE    . LYS E 3 81 ? 26.306 112.713 27.973 1.00 76.56  ? 582 LYS F CE    1 
ATOM   2387 N  NZ    . LYS E 3 81 ? 25.438 111.782 27.201 1.00 76.21  ? 582 LYS F NZ    1 
ATOM   2388 N  N     . ARG E 3 82 ? 26.965 117.514 30.288 1.00 81.83  ? 583 ARG F N     1 
ATOM   2389 C  CA    . ARG E 3 82 ? 26.748 117.347 31.720 1.00 83.17  ? 583 ARG F CA    1 
ATOM   2390 C  C     . ARG E 3 82 ? 25.576 118.179 32.236 1.00 83.93  ? 583 ARG F C     1 
ATOM   2391 O  O     . ARG E 3 82 ? 24.934 117.812 33.222 1.00 84.13  ? 583 ARG F O     1 
ATOM   2392 C  CB    . ARG E 3 82 ? 28.021 117.718 32.485 1.00 83.68  ? 583 ARG F CB    1 
ATOM   2393 C  CG    . ARG E 3 82 ? 29.226 116.844 32.154 1.00 84.97  ? 583 ARG F CG    1 
ATOM   2394 C  CD    . ARG E 3 82 ? 29.023 115.410 32.630 1.00 85.41  ? 583 ARG F CD    1 
ATOM   2395 N  NE    . ARG E 3 82 ? 29.107 114.445 31.536 1.00 85.95  ? 583 ARG F NE    1 
ATOM   2396 C  CZ    . ARG E 3 82 ? 30.011 113.471 31.464 1.00 85.99  ? 583 ARG F CZ    1 
ATOM   2397 N  NH1   . ARG E 3 82 ? 30.915 113.330 32.425 1.00 85.78  ? 583 ARG F NH1   1 
ATOM   2398 N  NH2   . ARG E 3 82 ? 30.008 112.635 30.434 1.00 85.67  ? 583 ARG F NH2   1 
ATOM   2399 N  N     . ARG E 3 83 ? 25.303 119.296 31.569 1.00 84.86  ? 584 ARG F N     1 
ATOM   2400 C  CA    . ARG E 3 83 ? 24.210 120.182 31.960 1.00 86.24  ? 584 ARG F CA    1 
ATOM   2401 C  C     . ARG E 3 83 ? 22.884 119.437 32.082 1.00 86.60  ? 584 ARG F C     1 
ATOM   2402 O  O     . ARG E 3 83 ? 22.074 119.521 31.132 1.00 87.02  ? 584 ARG F O     1 
ATOM   2403 C  CB    . ARG E 3 83 ? 24.063 121.321 30.949 1.00 87.51  ? 584 ARG F CB    1 
ATOM   2404 C  CG    . ARG E 3 83 ? 25.301 122.185 30.795 1.00 88.93  ? 584 ARG F CG    1 
ATOM   2405 C  CD    . ARG E 3 83 ? 25.049 123.313 29.813 1.00 90.41  ? 584 ARG F CD    1 
ATOM   2406 N  NE    . ARG E 3 83 ? 26.250 124.100 29.552 1.00 91.30  ? 584 ARG F NE    1 
ATOM   2407 C  CZ    . ARG E 3 83 ? 26.286 125.151 28.740 1.00 91.82  ? 584 ARG F CZ    1 
ATOM   2408 N  NH1   . ARG E 3 83 ? 25.188 125.545 28.110 1.00 91.80  ? 584 ARG F NH1   1 
ATOM   2409 N  NH2   . ARG E 3 83 ? 27.421 125.806 28.554 1.00 91.95  ? 584 ARG F NH2   1 
ATOM   2410 N  N     . PRO F 3 5  ? 25.668 119.655 42.800 1.00 37.60  ? 506 PRO G N     1 
ATOM   2411 C  CA    . PRO F 3 5  ? 26.110 120.834 43.582 1.00 35.61  ? 506 PRO G CA    1 
ATOM   2412 C  C     . PRO F 3 5  ? 27.591 121.054 43.322 1.00 34.48  ? 506 PRO G C     1 
ATOM   2413 O  O     . PRO F 3 5  ? 27.976 122.006 42.641 1.00 35.97  ? 506 PRO G O     1 
ATOM   2414 C  CB    . PRO F 3 5  ? 25.850 120.518 45.046 1.00 35.85  ? 506 PRO G CB    1 
ATOM   2415 C  CG    . PRO F 3 5  ? 25.950 119.000 45.042 1.00 36.87  ? 506 PRO G CG    1 
ATOM   2416 C  CD    . PRO F 3 5  ? 25.318 118.552 43.711 1.00 37.27  ? 506 PRO G CD    1 
ATOM   2417 N  N     . PHE F 3 6  ? 28.423 120.175 43.869 1.00 30.24  ? 507 PHE G N     1 
ATOM   2418 C  CA    . PHE F 3 6  ? 29.852 120.284 43.646 1.00 26.26  ? 507 PHE G CA    1 
ATOM   2419 C  C     . PHE F 3 6  ? 30.475 118.952 43.259 1.00 24.63  ? 507 PHE G C     1 
ATOM   2420 O  O     . PHE F 3 6  ? 30.190 117.927 43.873 1.00 22.57  ? 507 PHE G O     1 
ATOM   2421 C  CB    . PHE F 3 6  ? 30.571 120.785 44.900 1.00 28.36  ? 507 PHE G CB    1 
ATOM   2422 C  CG    . PHE F 3 6  ? 30.119 122.134 45.368 1.00 27.48  ? 507 PHE G CG    1 
ATOM   2423 C  CD1   . PHE F 3 6  ? 29.280 122.255 46.468 1.00 28.35  ? 507 PHE G CD1   1 
ATOM   2424 C  CD2   . PHE F 3 6  ? 30.552 123.285 44.720 1.00 28.70  ? 507 PHE G CD2   1 
ATOM   2425 C  CE1   . PHE F 3 6  ? 28.876 123.514 46.923 1.00 28.07  ? 507 PHE G CE1   1 
ATOM   2426 C  CE2   . PHE F 3 6  ? 30.154 124.548 45.165 1.00 28.75  ? 507 PHE G CE2   1 
ATOM   2427 C  CZ    . PHE F 3 6  ? 29.316 124.661 46.268 1.00 28.04  ? 507 PHE G CZ    1 
ATOM   2428 N  N     . THR F 3 7  ? 31.320 118.987 42.236 1.00 22.02  ? 508 THR G N     1 
ATOM   2429 C  CA    . THR F 3 7  ? 32.079 117.822 41.791 1.00 20.82  ? 508 THR G CA    1 
ATOM   2430 C  C     . THR F 3 7  ? 33.392 118.469 41.424 1.00 21.13  ? 508 THR G C     1 
ATOM   2431 O  O     . THR F 3 7  ? 33.462 119.694 41.300 1.00 20.83  ? 508 THR G O     1 
ATOM   2432 C  CB    . THR F 3 7  ? 31.515 117.144 40.509 1.00 19.77  ? 508 THR G CB    1 
ATOM   2433 O  OG1   . THR F 3 7  ? 31.692 118.020 39.389 1.00 20.52  ? 508 THR G OG1   1 
ATOM   2434 C  CG2   . THR F 3 7  ? 30.044 116.799 40.679 1.00 19.44  ? 508 THR G CG2   1 
ATOM   2435 N  N     . TYR F 3 8  ? 34.440 117.676 41.254 1.00 20.37  ? 509 TYR G N     1 
ATOM   2436 C  CA    . TYR F 3 8  ? 35.705 118.268 40.887 1.00 20.74  ? 509 TYR G CA    1 
ATOM   2437 C  C     . TYR F 3 8  ? 35.596 118.987 39.552 1.00 19.97  ? 509 TYR G C     1 
ATOM   2438 O  O     . TYR F 3 8  ? 36.286 119.973 39.323 1.00 18.66  ? 509 TYR G O     1 
ATOM   2439 C  CB    . TYR F 3 8  ? 36.807 117.211 40.843 1.00 23.45  ? 509 TYR G CB    1 
ATOM   2440 C  CG    . TYR F 3 8  ? 37.347 116.926 42.215 1.00 25.67  ? 509 TYR G CG    1 
ATOM   2441 C  CD1   . TYR F 3 8  ? 36.795 115.927 43.015 1.00 28.24  ? 509 TYR G CD1   1 
ATOM   2442 C  CD2   . TYR F 3 8  ? 38.361 117.718 42.753 1.00 28.11  ? 509 TYR G CD2   1 
ATOM   2443 C  CE1   . TYR F 3 8  ? 37.242 115.727 44.322 1.00 30.52  ? 509 TYR G CE1   1 
ATOM   2444 C  CE2   . TYR F 3 8  ? 38.810 117.530 44.051 1.00 29.57  ? 509 TYR G CE2   1 
ATOM   2445 C  CZ    . TYR F 3 8  ? 38.250 116.536 44.830 1.00 31.16  ? 509 TYR G CZ    1 
ATOM   2446 O  OH    . TYR F 3 8  ? 38.706 116.351 46.115 1.00 35.67  ? 509 TYR G OH    1 
ATOM   2447 N  N     . ALA F 3 9  ? 34.733 118.493 38.671 1.00 19.94  ? 510 ALA G N     1 
ATOM   2448 C  CA    . ALA F 3 9  ? 34.567 119.125 37.367 1.00 20.61  ? 510 ALA G CA    1 
ATOM   2449 C  C     . ALA F 3 9  ? 33.919 120.505 37.476 1.00 19.82  ? 510 ALA G C     1 
ATOM   2450 O  O     . ALA F 3 9  ? 34.379 121.449 36.830 1.00 20.30  ? 510 ALA G O     1 
ATOM   2451 C  CB    . ALA F 3 9  ? 33.741 118.226 36.425 1.00 20.57  ? 510 ALA G CB    1 
ATOM   2452 N  N     . THR F 3 10 ? 32.865 120.632 38.279 1.00 21.28  ? 511 THR G N     1 
ATOM   2453 C  CA    . THR F 3 10 ? 32.206 121.933 38.416 1.00 22.13  ? 511 THR G CA    1 
ATOM   2454 C  C     . THR F 3 10 ? 33.158 122.926 39.078 1.00 22.46  ? 511 THR G C     1 
ATOM   2455 O  O     . THR F 3 10 ? 33.145 124.118 38.767 1.00 21.29  ? 511 THR G O     1 
ATOM   2456 C  CB    . THR F 3 10 ? 30.896 121.861 39.261 1.00 22.28  ? 511 THR G CB    1 
ATOM   2457 O  OG1   . THR F 3 10 ? 31.215 121.630 40.643 1.00 22.53  ? 511 THR G OG1   1 
ATOM   2458 C  CG2   . THR F 3 10 ? 29.969 120.748 38.739 1.00 21.40  ? 511 THR G CG2   1 
ATOM   2459 N  N     . LEU F 3 11 ? 33.995 122.427 39.982 1.00 21.69  ? 512 LEU G N     1 
ATOM   2460 C  CA    . LEU F 3 11 ? 34.952 123.286 40.672 1.00 20.93  ? 512 LEU G CA    1 
ATOM   2461 C  C     . LEU F 3 11 ? 36.064 123.765 39.746 1.00 21.61  ? 512 LEU G C     1 
ATOM   2462 O  O     . LEU F 3 11 ? 36.421 124.948 39.754 1.00 20.81  ? 512 LEU G O     1 
ATOM   2463 C  CB    . LEU F 3 11 ? 35.550 122.541 41.865 1.00 19.78  ? 512 LEU G CB    1 
ATOM   2464 C  CG    . LEU F 3 11 ? 34.568 122.345 43.021 1.00 20.20  ? 512 LEU G CG    1 
ATOM   2465 C  CD1   . LEU F 3 11 ? 35.179 121.404 44.053 1.00 19.38  ? 512 LEU G CD1   1 
ATOM   2466 C  CD2   . LEU F 3 11 ? 34.242 123.710 43.648 1.00 21.10  ? 512 LEU G CD2   1 
ATOM   2467 N  N     . ILE F 3 12 ? 36.622 122.848 38.962 1.00 21.33  ? 513 ILE G N     1 
ATOM   2468 C  CA    . ILE F 3 12 ? 37.683 123.204 38.030 1.00 23.41  ? 513 ILE G CA    1 
ATOM   2469 C  C     . ILE F 3 12 ? 37.111 124.204 37.029 1.00 25.17  ? 513 ILE G C     1 
ATOM   2470 O  O     . ILE F 3 12 ? 37.771 125.174 36.658 1.00 25.80  ? 513 ILE G O     1 
ATOM   2471 C  CB    . ILE F 3 12 ? 38.214 121.964 37.271 1.00 23.94  ? 513 ILE G CB    1 
ATOM   2472 C  CG1   . ILE F 3 12 ? 38.831 120.973 38.264 1.00 24.62  ? 513 ILE G CG1   1 
ATOM   2473 C  CG2   . ILE F 3 12 ? 39.262 122.386 36.233 1.00 24.35  ? 513 ILE G CG2   1 
ATOM   2474 C  CD1   . ILE F 3 12 ? 39.259 119.650 37.638 1.00 23.69  ? 513 ILE G CD1   1 
ATOM   2475 N  N     . ARG F 3 13 ? 35.875 123.970 36.605 1.00 27.99  ? 514 ARG G N     1 
ATOM   2476 C  CA    . ARG F 3 13 ? 35.226 124.861 35.653 1.00 29.59  ? 514 ARG G CA    1 
ATOM   2477 C  C     . ARG F 3 13 ? 34.981 126.226 36.299 1.00 30.75  ? 514 ARG G C     1 
ATOM   2478 O  O     . ARG F 3 13 ? 35.168 127.270 35.662 1.00 31.39  ? 514 ARG G O     1 
ATOM   2479 C  CB    . ARG F 3 13 ? 33.911 124.238 35.174 1.00 33.12  ? 514 ARG G CB    1 
ATOM   2480 C  CG    . ARG F 3 13 ? 33.116 125.093 34.205 1.00 37.43  ? 514 ARG G CG    1 
ATOM   2481 C  CD    . ARG F 3 13 ? 31.966 125.785 34.912 1.00 43.80  ? 514 ARG G CD    1 
ATOM   2482 N  NE    . ARG F 3 13 ? 31.156 126.594 34.005 1.00 48.55  ? 514 ARG G NE    1 
ATOM   2483 C  CZ    . ARG F 3 13 ? 30.030 127.205 34.360 1.00 49.93  ? 514 ARG G CZ    1 
ATOM   2484 N  NH1   . ARG F 3 13 ? 29.581 127.097 35.602 1.00 50.90  ? 514 ARG G NH1   1 
ATOM   2485 N  NH2   . ARG F 3 13 ? 29.355 127.926 33.477 1.00 51.68  ? 514 ARG G NH2   1 
ATOM   2486 N  N     . GLN F 3 14 ? 34.578 126.220 37.567 1.00 30.10  ? 515 GLN G N     1 
ATOM   2487 C  CA    . GLN F 3 14 ? 34.333 127.470 38.277 1.00 30.53  ? 515 GLN G CA    1 
ATOM   2488 C  C     . GLN F 3 14 ? 35.625 128.281 38.343 1.00 31.16  ? 515 GLN G C     1 
ATOM   2489 O  O     . GLN F 3 14 ? 35.635 129.481 38.051 1.00 31.44  ? 515 GLN G O     1 
ATOM   2490 C  CB    . GLN F 3 14 ? 33.830 127.198 39.698 1.00 30.46  ? 515 GLN G CB    1 
ATOM   2491 C  CG    . GLN F 3 14 ? 33.331 128.443 40.416 1.00 31.17  ? 515 GLN G CG    1 
ATOM   2492 C  CD    . GLN F 3 14 ? 32.932 128.180 41.861 1.00 33.13  ? 515 GLN G CD    1 
ATOM   2493 O  OE1   . GLN F 3 14 ? 32.425 127.110 42.191 1.00 33.54  ? 515 GLN G OE1   1 
ATOM   2494 N  NE2   . GLN F 3 14 ? 33.138 129.172 42.725 1.00 33.16  ? 515 GLN G NE2   1 
ATOM   2495 N  N     . ALA F 3 15 ? 36.714 127.621 38.728 1.00 31.97  ? 516 ALA G N     1 
ATOM   2496 C  CA    . ALA F 3 15 ? 38.009 128.279 38.833 1.00 34.60  ? 516 ALA G CA    1 
ATOM   2497 C  C     . ALA F 3 15 ? 38.398 128.947 37.518 1.00 37.46  ? 516 ALA G C     1 
ATOM   2498 O  O     . ALA F 3 15 ? 38.645 130.153 37.470 1.00 37.59  ? 516 ALA G O     1 
ATOM   2499 C  CB    . ALA F 3 15 ? 39.075 127.272 39.237 1.00 34.00  ? 516 ALA G CB    1 
ATOM   2500 N  N     . ILE F 3 16 ? 38.448 128.154 36.454 1.00 38.54  ? 517 ILE G N     1 
ATOM   2501 C  CA    . ILE F 3 16 ? 38.809 128.653 35.135 1.00 40.42  ? 517 ILE G CA    1 
ATOM   2502 C  C     . ILE F 3 16 ? 37.889 129.778 34.657 1.00 42.38  ? 517 ILE G C     1 
ATOM   2503 O  O     . ILE F 3 16 ? 38.353 130.769 34.094 1.00 43.48  ? 517 ILE G O     1 
ATOM   2504 C  CB    . ILE F 3 16 ? 38.790 127.502 34.105 1.00 39.17  ? 517 ILE G CB    1 
ATOM   2505 C  CG1   . ILE F 3 16 ? 39.856 126.466 34.482 1.00 39.48  ? 517 ILE G CG1   1 
ATOM   2506 C  CG2   . ILE F 3 16 ? 39.027 128.044 32.697 1.00 38.83  ? 517 ILE G CG2   1 
ATOM   2507 C  CD1   . ILE F 3 16 ? 39.845 125.220 33.624 1.00 39.91  ? 517 ILE G CD1   1 
ATOM   2508 N  N     . MET F 3 17 ? 36.590 129.625 34.895 1.00 44.88  ? 518 MET G N     1 
ATOM   2509 C  CA    . MET F 3 17 ? 35.603 130.614 34.477 1.00 48.27  ? 518 MET G CA    1 
ATOM   2510 C  C     . MET F 3 17 ? 35.700 131.946 35.210 1.00 50.35  ? 518 MET G C     1 
ATOM   2511 O  O     . MET F 3 17 ? 35.301 132.984 34.674 1.00 50.54  ? 518 MET G O     1 
ATOM   2512 C  CB    . MET F 3 17 ? 34.191 130.050 34.651 1.00 49.32  ? 518 MET G CB    1 
ATOM   2513 C  CG    . MET F 3 17 ? 33.767 129.087 33.562 1.00 51.91  ? 518 MET G CG    1 
ATOM   2514 S  SD    . MET F 3 17 ? 33.563 129.911 31.969 1.00 55.98  ? 518 MET G SD    1 
ATOM   2515 C  CE    . MET F 3 17 ? 35.225 129.789 31.299 1.00 53.87  ? 518 MET G CE    1 
ATOM   2516 N  N     . GLU F 3 18 ? 36.218 131.920 36.433 1.00 52.43  ? 519 GLU G N     1 
ATOM   2517 C  CA    . GLU F 3 18 ? 36.342 133.141 37.217 1.00 54.83  ? 519 GLU G CA    1 
ATOM   2518 C  C     . GLU F 3 18 ? 37.674 133.841 36.976 1.00 56.00  ? 519 GLU G C     1 
ATOM   2519 O  O     . GLU F 3 18 ? 37.889 134.960 37.437 1.00 57.47  ? 519 GLU G O     1 
ATOM   2520 C  CB    . GLU F 3 18 ? 36.158 132.830 38.708 1.00 54.87  ? 519 GLU G CB    1 
ATOM   2521 C  CG    . GLU F 3 18 ? 34.760 132.341 39.044 1.00 55.28  ? 519 GLU G CG    1 
ATOM   2522 C  CD    . GLU F 3 18 ? 34.554 132.091 40.526 1.00 55.79  ? 519 GLU G CD    1 
ATOM   2523 O  OE1   . GLU F 3 18 ? 35.509 132.267 41.313 1.00 55.96  ? 519 GLU G OE1   1 
ATOM   2524 O  OE2   . GLU F 3 18 ? 33.428 131.715 40.910 1.00 55.56  ? 519 GLU G OE2   1 
ATOM   2525 N  N     . SER F 3 19 ? 38.557 133.188 36.230 1.00 57.43  ? 520 SER G N     1 
ATOM   2526 C  CA    . SER F 3 19 ? 39.869 133.752 35.934 1.00 59.18  ? 520 SER G CA    1 
ATOM   2527 C  C     . SER F 3 19 ? 39.845 134.587 34.661 1.00 60.51  ? 520 SER G C     1 
ATOM   2528 O  O     . SER F 3 19 ? 38.986 134.402 33.797 1.00 60.42  ? 520 SER G O     1 
ATOM   2529 C  CB    . SER F 3 19 ? 40.896 132.638 35.758 1.00 59.10  ? 520 SER G CB    1 
ATOM   2530 O  OG    . SER F 3 19 ? 40.695 131.974 34.522 1.00 59.65  ? 520 SER G OG    1 
ATOM   2531 N  N     . SER F 3 20 ? 40.797 135.506 34.550 1.00 61.87  ? 521 SER G N     1 
ATOM   2532 C  CA    . SER F 3 20 ? 40.904 136.347 33.368 1.00 63.42  ? 521 SER G CA    1 
ATOM   2533 C  C     . SER F 3 20 ? 41.485 135.480 32.254 1.00 64.05  ? 521 SER G C     1 
ATOM   2534 O  O     . SER F 3 20 ? 42.270 134.566 32.517 1.00 65.03  ? 521 SER G O     1 
ATOM   2535 C  CB    . SER F 3 20 ? 41.827 137.536 33.642 1.00 63.60  ? 521 SER G CB    1 
ATOM   2536 O  OG    . SER F 3 20 ? 41.964 138.345 32.487 1.00 65.10  ? 521 SER G OG    1 
ATOM   2537 N  N     . ASP F 3 21 ? 41.096 135.762 31.015 1.00 63.90  ? 522 ASP G N     1 
ATOM   2538 C  CA    . ASP F 3 21 ? 41.573 134.996 29.866 1.00 63.22  ? 522 ASP G CA    1 
ATOM   2539 C  C     . ASP F 3 21 ? 40.991 133.585 29.885 1.00 62.18  ? 522 ASP G C     1 
ATOM   2540 O  O     . ASP F 3 21 ? 41.331 132.754 29.043 1.00 62.09  ? 522 ASP G O     1 
ATOM   2541 C  CB    . ASP F 3 21 ? 43.104 134.919 29.869 1.00 64.64  ? 522 ASP G CB    1 
ATOM   2542 C  CG    . ASP F 3 21 ? 43.760 136.288 29.838 1.00 65.45  ? 522 ASP G CG    1 
ATOM   2543 O  OD1   . ASP F 3 21 ? 45.008 136.351 29.858 1.00 66.26  ? 522 ASP G OD1   1 
ATOM   2544 O  OD2   . ASP F 3 21 ? 43.029 137.302 29.794 1.00 66.03  ? 522 ASP G OD2   1 
ATOM   2545 N  N     . ARG F 3 22 ? 40.115 133.326 30.853 1.00 60.95  ? 523 ARG G N     1 
ATOM   2546 C  CA    . ARG F 3 22 ? 39.470 132.023 30.999 1.00 59.06  ? 523 ARG G CA    1 
ATOM   2547 C  C     . ARG F 3 22 ? 40.435 130.862 30.809 1.00 56.39  ? 523 ARG G C     1 
ATOM   2548 O  O     . ARG F 3 22 ? 40.120 129.886 30.129 1.00 56.02  ? 523 ARG G O     1 
ATOM   2549 C  CB    . ARG F 3 22 ? 38.316 131.892 30.006 1.00 61.78  ? 523 ARG G CB    1 
ATOM   2550 C  CG    . ARG F 3 22 ? 37.214 132.908 30.206 1.00 65.15  ? 523 ARG G CG    1 
ATOM   2551 C  CD    . ARG F 3 22 ? 36.022 132.590 29.326 1.00 68.22  ? 523 ARG G CD    1 
ATOM   2552 N  NE    . ARG F 3 22 ? 34.926 133.528 29.537 1.00 70.10  ? 523 ARG G NE    1 
ATOM   2553 C  CZ    . ARG F 3 22 ? 33.740 133.432 28.949 1.00 70.93  ? 523 ARG G CZ    1 
ATOM   2554 N  NH1   . ARG F 3 22 ? 33.494 132.435 28.109 1.00 71.33  ? 523 ARG G NH1   1 
ATOM   2555 N  NH2   . ARG F 3 22 ? 32.799 134.333 29.199 1.00 71.59  ? 523 ARG G NH2   1 
ATOM   2556 N  N     . GLN F 3 23 ? 41.614 130.981 31.407 1.00 53.71  ? 524 GLN G N     1 
ATOM   2557 C  CA    . GLN F 3 23 ? 42.637 129.945 31.329 1.00 50.98  ? 524 GLN G CA    1 
ATOM   2558 C  C     . GLN F 3 23 ? 43.358 129.883 32.666 1.00 48.72  ? 524 GLN G C     1 
ATOM   2559 O  O     . GLN F 3 23 ? 43.374 130.863 33.411 1.00 47.89  ? 524 GLN G O     1 
ATOM   2560 C  CB    . GLN F 3 23 ? 43.666 130.266 30.244 1.00 51.76  ? 524 GLN G CB    1 
ATOM   2561 C  CG    . GLN F 3 23 ? 43.120 130.405 28.843 1.00 52.53  ? 524 GLN G CG    1 
ATOM   2562 C  CD    . GLN F 3 23 ? 44.229 130.602 27.830 1.00 52.40  ? 524 GLN G CD    1 
ATOM   2563 O  OE1   . GLN F 3 23 ? 45.078 131.479 27.990 1.00 51.95  ? 524 GLN G OE1   1 
ATOM   2564 N  NE2   . GLN F 3 23 ? 44.229 129.786 26.781 1.00 52.08  ? 524 GLN G NE2   1 
ATOM   2565 N  N     . LEU F 3 24 ? 43.958 128.732 32.960 1.00 45.67  ? 525 LEU G N     1 
ATOM   2566 C  CA    . LEU F 3 24 ? 44.700 128.543 34.201 1.00 42.07  ? 525 LEU G CA    1 
ATOM   2567 C  C     . LEU F 3 24 ? 45.667 127.380 34.052 1.00 40.29  ? 525 LEU G C     1 
ATOM   2568 O  O     . LEU F 3 24 ? 45.320 126.345 33.483 1.00 39.66  ? 525 LEU G O     1 
ATOM   2569 C  CB    . LEU F 3 24 ? 43.747 128.239 35.367 1.00 41.59  ? 525 LEU G CB    1 
ATOM   2570 C  CG    . LEU F 3 24 ? 42.727 129.275 35.849 1.00 40.23  ? 525 LEU G CG    1 
ATOM   2571 C  CD1   . LEU F 3 24 ? 41.912 128.695 36.997 1.00 38.10  ? 525 LEU G CD1   1 
ATOM   2572 C  CD2   . LEU F 3 24 ? 43.447 130.537 36.303 1.00 40.93  ? 525 LEU G CD2   1 
ATOM   2573 N  N     . THR F 3 25 ? 46.887 127.552 34.546 1.00 37.24  ? 526 THR G N     1 
ATOM   2574 C  CA    . THR F 3 25 ? 47.859 126.471 34.491 1.00 35.75  ? 526 THR G CA    1 
ATOM   2575 C  C     . THR F 3 25 ? 47.482 125.537 35.631 1.00 34.67  ? 526 THR G C     1 
ATOM   2576 O  O     . THR F 3 25 ? 46.668 125.894 36.485 1.00 34.18  ? 526 THR G O     1 
ATOM   2577 C  CB    . THR F 3 25 ? 49.289 126.965 34.748 1.00 36.95  ? 526 THR G CB    1 
ATOM   2578 O  OG1   . THR F 3 25 ? 49.340 127.625 36.020 1.00 36.64  ? 526 THR G OG1   1 
ATOM   2579 C  CG2   . THR F 3 25 ? 49.735 127.916 33.648 1.00 36.26  ? 526 THR G CG2   1 
ATOM   2580 N  N     . LEU F 3 26 ? 48.075 124.351 35.649 1.00 32.91  ? 527 LEU G N     1 
ATOM   2581 C  CA    . LEU F 3 26 ? 47.791 123.389 36.700 1.00 32.76  ? 527 LEU G CA    1 
ATOM   2582 C  C     . LEU F 3 26 ? 48.130 123.973 38.073 1.00 31.42  ? 527 LEU G C     1 
ATOM   2583 O  O     . LEU F 3 26 ? 47.439 123.714 39.052 1.00 30.53  ? 527 LEU G O     1 
ATOM   2584 C  CB    . LEU F 3 26 ? 48.592 122.104 36.481 1.00 33.99  ? 527 LEU G CB    1 
ATOM   2585 C  CG    . LEU F 3 26 ? 48.356 121.032 37.551 1.00 36.93  ? 527 LEU G CG    1 
ATOM   2586 C  CD1   . LEU F 3 26 ? 46.890 120.603 37.534 1.00 36.62  ? 527 LEU G CD1   1 
ATOM   2587 C  CD2   . LEU F 3 26 ? 49.270 119.840 37.303 1.00 37.88  ? 527 LEU G CD2   1 
ATOM   2588 N  N     . ASN F 3 27 ? 49.192 124.765 38.153 1.00 30.40  ? 528 ASN G N     1 
ATOM   2589 C  CA    . ASN F 3 27 ? 49.562 125.335 39.440 1.00 28.70  ? 528 ASN G CA    1 
ATOM   2590 C  C     . ASN F 3 27 ? 48.543 126.370 39.895 1.00 27.21  ? 528 ASN G C     1 
ATOM   2591 O  O     . ASN F 3 27 ? 48.266 126.491 41.090 1.00 26.97  ? 528 ASN G O     1 
ATOM   2592 C  CB    . ASN F 3 27 ? 50.952 125.974 39.381 1.00 31.96  ? 528 ASN G CB    1 
ATOM   2593 C  CG    . ASN F 3 27 ? 51.504 126.283 40.765 1.00 33.50  ? 528 ASN G CG    1 
ATOM   2594 O  OD1   . ASN F 3 27 ? 51.751 125.378 41.563 1.00 36.34  ? 528 ASN G OD1   1 
ATOM   2595 N  ND2   . ASN F 3 27 ? 51.691 127.564 41.058 1.00 35.04  ? 528 ASN G ND2   1 
ATOM   2596 N  N     . GLU F 3 28 ? 47.984 127.110 38.941 1.00 25.83  ? 529 GLU G N     1 
ATOM   2597 C  CA    . GLU F 3 28 ? 46.991 128.133 39.249 1.00 26.62  ? 529 GLU G CA    1 
ATOM   2598 C  C     . GLU F 3 28 ? 45.680 127.500 39.701 1.00 26.10  ? 529 GLU G C     1 
ATOM   2599 O  O     . GLU F 3 28 ? 44.964 128.055 40.533 1.00 23.11  ? 529 GLU G O     1 
ATOM   2600 C  CB    . GLU F 3 28 ? 46.758 129.017 38.028 1.00 30.55  ? 529 GLU G CB    1 
ATOM   2601 C  CG    . GLU F 3 28 ? 48.011 129.735 37.576 1.00 36.80  ? 529 GLU G CG    1 
ATOM   2602 C  CD    . GLU F 3 28 ? 47.822 130.465 36.263 1.00 40.21  ? 529 GLU G CD    1 
ATOM   2603 O  OE1   . GLU F 3 28 ? 47.050 131.448 36.226 1.00 42.30  ? 529 GLU G OE1   1 
ATOM   2604 O  OE2   . GLU F 3 28 ? 48.447 130.047 35.266 1.00 41.31  ? 529 GLU G OE2   1 
ATOM   2605 N  N     . ILE F 3 29 ? 45.357 126.341 39.136 1.00 23.52  ? 530 ILE G N     1 
ATOM   2606 C  CA    . ILE F 3 29 ? 44.154 125.634 39.543 1.00 21.67  ? 530 ILE G CA    1 
ATOM   2607 C  C     . ILE F 3 29 ? 44.423 125.145 40.968 1.00 20.69  ? 530 ILE G C     1 
ATOM   2608 O  O     . ILE F 3 29 ? 43.557 125.235 41.834 1.00 19.75  ? 530 ILE G O     1 
ATOM   2609 C  CB    . ILE F 3 29 ? 43.859 124.450 38.595 1.00 22.32  ? 530 ILE G CB    1 
ATOM   2610 C  CG1   . ILE F 3 29 ? 43.478 125.001 37.213 1.00 24.11  ? 530 ILE G CG1   1 
ATOM   2611 C  CG2   . ILE F 3 29 ? 42.739 123.581 39.161 1.00 20.36  ? 530 ILE G CG2   1 
ATOM   2612 C  CD1   . ILE F 3 29 ? 43.262 123.941 36.143 1.00 27.47  ? 530 ILE G CD1   1 
ATOM   2613 N  N     . TYR F 3 30 ? 45.634 124.645 41.208 1.00 21.18  ? 531 TYR G N     1 
ATOM   2614 C  CA    . TYR F 3 30 ? 46.022 124.176 42.543 1.00 23.45  ? 531 TYR G CA    1 
ATOM   2615 C  C     . TYR F 3 30 ? 45.869 125.304 43.576 1.00 23.60  ? 531 TYR G C     1 
ATOM   2616 O  O     . TYR F 3 30 ? 45.409 125.081 44.702 1.00 20.57  ? 531 TYR G O     1 
ATOM   2617 C  CB    . TYR F 3 30 ? 47.481 123.707 42.541 1.00 25.97  ? 531 TYR G CB    1 
ATOM   2618 C  CG    . TYR F 3 30 ? 47.710 122.291 42.047 1.00 30.66  ? 531 TYR G CG    1 
ATOM   2619 C  CD1   . TYR F 3 30 ? 49.000 121.764 41.982 1.00 32.96  ? 531 TYR G CD1   1 
ATOM   2620 C  CD2   . TYR F 3 30 ? 46.644 121.470 41.670 1.00 31.48  ? 531 TYR G CD2   1 
ATOM   2621 C  CE1   . TYR F 3 30 ? 49.228 120.453 41.556 1.00 35.52  ? 531 TYR G CE1   1 
ATOM   2622 C  CE2   . TYR F 3 30 ? 46.859 120.159 41.243 1.00 33.96  ? 531 TYR G CE2   1 
ATOM   2623 C  CZ    . TYR F 3 30 ? 48.152 119.656 41.189 1.00 36.06  ? 531 TYR G CZ    1 
ATOM   2624 O  OH    . TYR F 3 30 ? 48.373 118.359 40.773 1.00 35.49  ? 531 TYR G OH    1 
ATOM   2625 N  N     . SER F 3 31 ? 46.285 126.508 43.201 1.00 24.01  ? 532 SER G N     1 
ATOM   2626 C  CA    . SER F 3 31 ? 46.177 127.654 44.104 1.00 25.39  ? 532 SER G CA    1 
ATOM   2627 C  C     . SER F 3 31 ? 44.718 127.934 44.440 1.00 24.39  ? 532 SER G C     1 
ATOM   2628 O  O     . SER F 3 31 ? 44.379 128.210 45.592 1.00 24.78  ? 532 SER G O     1 
ATOM   2629 C  CB    . SER F 3 31 ? 46.789 128.902 43.465 1.00 27.10  ? 532 SER G CB    1 
ATOM   2630 O  OG    . SER F 3 31 ? 48.164 128.709 43.208 1.00 32.87  ? 532 SER G OG    1 
ATOM   2631 N  N     . TRP F 3 32 ? 43.861 127.864 43.425 1.00 23.00  ? 533 TRP G N     1 
ATOM   2632 C  CA    . TRP F 3 32 ? 42.434 128.110 43.608 1.00 21.64  ? 533 TRP G CA    1 
ATOM   2633 C  C     . TRP F 3 32 ? 41.813 127.081 44.554 1.00 20.76  ? 533 TRP G C     1 
ATOM   2634 O  O     . TRP F 3 32 ? 41.029 127.435 45.441 1.00 20.87  ? 533 TRP G O     1 
ATOM   2635 C  CB    . TRP F 3 32 ? 41.716 128.083 42.254 1.00 22.91  ? 533 TRP G CB    1 
ATOM   2636 C  CG    . TRP F 3 32 ? 40.309 128.566 42.325 1.00 22.02  ? 533 TRP G CG    1 
ATOM   2637 C  CD1   . TRP F 3 32 ? 39.870 129.849 42.176 1.00 22.83  ? 533 TRP G CD1   1 
ATOM   2638 C  CD2   . TRP F 3 32 ? 39.154 127.774 42.600 1.00 21.14  ? 533 TRP G CD2   1 
ATOM   2639 N  NE1   . TRP F 3 32 ? 38.505 129.905 42.339 1.00 22.12  ? 533 TRP G NE1   1 
ATOM   2640 C  CE2   . TRP F 3 32 ? 38.041 128.641 42.597 1.00 21.49  ? 533 TRP G CE2   1 
ATOM   2641 C  CE3   . TRP F 3 32 ? 38.949 126.410 42.843 1.00 21.02  ? 533 TRP G CE3   1 
ATOM   2642 C  CZ2   . TRP F 3 32 ? 36.740 128.189 42.832 1.00 21.72  ? 533 TRP G CZ2   1 
ATOM   2643 C  CZ3   . TRP F 3 32 ? 37.654 125.958 43.078 1.00 19.64  ? 533 TRP G CZ3   1 
ATOM   2644 C  CH2   . TRP F 3 32 ? 36.566 126.847 43.066 1.00 21.85  ? 533 TRP G CH2   1 
ATOM   2645 N  N     . PHE F 3 33 ? 42.155 125.806 44.371 1.00 20.08  ? 534 PHE G N     1 
ATOM   2646 C  CA    . PHE F 3 33 ? 41.633 124.760 45.249 1.00 18.77  ? 534 PHE G CA    1 
ATOM   2647 C  C     . PHE F 3 33 ? 42.167 124.922 46.667 1.00 18.36  ? 534 PHE G C     1 
ATOM   2648 O  O     . PHE F 3 33 ? 41.446 124.688 47.633 1.00 18.75  ? 534 PHE G O     1 
ATOM   2649 C  CB    . PHE F 3 33 ? 42.008 123.372 44.720 1.00 17.80  ? 534 PHE G CB    1 
ATOM   2650 C  CG    . PHE F 3 33 ? 41.016 122.813 43.747 1.00 18.99  ? 534 PHE G CG    1 
ATOM   2651 C  CD1   . PHE F 3 33 ? 40.136 121.803 44.132 1.00 20.22  ? 534 PHE G CD1   1 
ATOM   2652 C  CD2   . PHE F 3 33 ? 40.944 123.304 42.446 1.00 18.31  ? 534 PHE G CD2   1 
ATOM   2653 C  CE1   . PHE F 3 33 ? 39.201 121.288 43.237 1.00 20.79  ? 534 PHE G CE1   1 
ATOM   2654 C  CE2   . PHE F 3 33 ? 40.006 122.793 41.542 1.00 19.98  ? 534 PHE G CE2   1 
ATOM   2655 C  CZ    . PHE F 3 33 ? 39.137 121.784 41.940 1.00 20.04  ? 534 PHE G CZ    1 
ATOM   2656 N  N     . THR F 3 34 ? 43.435 125.309 46.793 1.00 20.61  ? 535 THR G N     1 
ATOM   2657 C  CA    . THR F 3 34 ? 44.028 125.511 48.112 1.00 21.11  ? 535 THR G CA    1 
ATOM   2658 C  C     . THR F 3 34 ? 43.221 126.569 48.855 1.00 21.06  ? 535 THR G C     1 
ATOM   2659 O  O     . THR F 3 34 ? 42.848 126.377 50.009 1.00 22.70  ? 535 THR G O     1 
ATOM   2660 C  CB    . THR F 3 34 ? 45.502 125.972 48.011 1.00 21.76  ? 535 THR G CB    1 
ATOM   2661 O  OG1   . THR F 3 34 ? 46.292 124.917 47.456 1.00 22.81  ? 535 THR G OG1   1 
ATOM   2662 C  CG2   . THR F 3 34 ? 46.058 126.331 49.393 1.00 23.71  ? 535 THR G CG2   1 
ATOM   2663 N  N     . ARG F 3 35 ? 42.943 127.683 48.186 1.00 22.66  ? 536 ARG G N     1 
ATOM   2664 C  CA    . ARG F 3 35 ? 42.170 128.755 48.804 1.00 22.96  ? 536 ARG G CA    1 
ATOM   2665 C  C     . ARG F 3 35 ? 40.759 128.284 49.121 1.00 22.43  ? 536 ARG G C     1 
ATOM   2666 O  O     . ARG F 3 35 ? 40.209 128.595 50.174 1.00 20.60  ? 536 ARG G O     1 
ATOM   2667 C  CB    . ARG F 3 35 ? 42.099 129.984 47.885 1.00 26.98  ? 536 ARG G CB    1 
ATOM   2668 C  CG    . ARG F 3 35 ? 43.401 130.758 47.755 1.00 32.62  ? 536 ARG G CG    1 
ATOM   2669 C  CD    . ARG F 3 35 ? 43.168 132.133 47.136 1.00 37.38  ? 536 ARG G CD    1 
ATOM   2670 N  NE    . ARG F 3 35 ? 42.719 132.067 45.746 1.00 42.59  ? 536 ARG G NE    1 
ATOM   2671 C  CZ    . ARG F 3 35 ? 43.492 131.732 44.714 1.00 44.44  ? 536 ARG G CZ    1 
ATOM   2672 N  NH1   . ARG F 3 35 ? 44.770 131.428 44.900 1.00 45.37  ? 536 ARG G NH1   1 
ATOM   2673 N  NH2   . ARG F 3 35 ? 42.986 131.707 43.488 1.00 44.07  ? 536 ARG G NH2   1 
ATOM   2674 N  N     . THR F 3 36 ? 40.170 127.522 48.207 1.00 19.84  ? 537 THR G N     1 
ATOM   2675 C  CA    . THR F 3 36 ? 38.816 127.029 48.414 1.00 18.15  ? 537 THR G CA    1 
ATOM   2676 C  C     . THR F 3 36 ? 38.722 126.055 49.588 1.00 17.70  ? 537 THR G C     1 
ATOM   2677 O  O     . THR F 3 36 ? 37.873 126.206 50.465 1.00 16.76  ? 537 THR G O     1 
ATOM   2678 C  CB    . THR F 3 36 ? 38.291 126.363 47.120 1.00 18.83  ? 537 THR G CB    1 
ATOM   2679 O  OG1   . THR F 3 36 ? 38.232 127.350 46.084 1.00 18.97  ? 537 THR G OG1   1 
ATOM   2680 C  CG2   . THR F 3 36 ? 36.903 125.782 47.322 1.00 16.98  ? 537 THR G CG2   1 
ATOM   2681 N  N     . PHE F 3 37 ? 39.588 125.049 49.626 1.00 17.86  ? 538 PHE G N     1 
ATOM   2682 C  CA    . PHE F 3 37 ? 39.514 124.106 50.729 1.00 18.33  ? 538 PHE G CA    1 
ATOM   2683 C  C     . PHE F 3 37 ? 39.855 124.779 52.056 1.00 18.36  ? 538 PHE G C     1 
ATOM   2684 O  O     . PHE F 3 37 ? 39.288 124.434 53.089 1.00 17.20  ? 538 PHE G O     1 
ATOM   2685 C  CB    . PHE F 3 37 ? 40.405 122.894 50.460 1.00 19.77  ? 538 PHE G CB    1 
ATOM   2686 C  CG    . PHE F 3 37 ? 39.766 121.891 49.537 1.00 23.58  ? 538 PHE G CG    1 
ATOM   2687 C  CD1   . PHE F 3 37 ? 39.530 122.212 48.200 1.00 23.90  ? 538 PHE G CD1   1 
ATOM   2688 C  CD2   . PHE F 3 37 ? 39.351 120.648 50.014 1.00 25.96  ? 538 PHE G CD2   1 
ATOM   2689 C  CE1   . PHE F 3 37 ? 38.888 121.314 47.346 1.00 26.36  ? 538 PHE G CE1   1 
ATOM   2690 C  CE2   . PHE F 3 37 ? 38.706 119.736 49.168 1.00 25.22  ? 538 PHE G CE2   1 
ATOM   2691 C  CZ    . PHE F 3 37 ? 38.474 120.069 47.834 1.00 25.69  ? 538 PHE G CZ    1 
ATOM   2692 N  N     . ALA F 3 38 ? 40.751 125.757 52.016 1.00 18.12  ? 539 ALA G N     1 
ATOM   2693 C  CA    . ALA F 3 38 ? 41.126 126.481 53.231 1.00 19.22  ? 539 ALA G CA    1 
ATOM   2694 C  C     . ALA F 3 38 ? 39.901 127.189 53.795 1.00 19.14  ? 539 ALA G C     1 
ATOM   2695 O  O     . ALA F 3 38 ? 39.686 127.199 55.009 1.00 18.57  ? 539 ALA G O     1 
ATOM   2696 C  CB    . ALA F 3 38 ? 42.235 127.502 52.928 1.00 20.44  ? 539 ALA G CB    1 
ATOM   2697 N  N     . TYR F 3 39 ? 39.100 127.788 52.915 1.00 17.92  ? 540 TYR G N     1 
ATOM   2698 C  CA    . TYR F 3 39 ? 37.893 128.485 53.345 1.00 16.41  ? 540 TYR G CA    1 
ATOM   2699 C  C     . TYR F 3 39 ? 36.976 127.580 54.166 1.00 17.09  ? 540 TYR G C     1 
ATOM   2700 O  O     . TYR F 3 39 ? 36.539 127.950 55.259 1.00 16.20  ? 540 TYR G O     1 
ATOM   2701 C  CB    . TYR F 3 39 ? 37.121 129.018 52.125 1.00 16.41  ? 540 TYR G CB    1 
ATOM   2702 C  CG    . TYR F 3 39 ? 35.799 129.683 52.465 1.00 16.36  ? 540 TYR G CG    1 
ATOM   2703 C  CD1   . TYR F 3 39 ? 35.752 131.018 52.875 1.00 17.05  ? 540 TYR G CD1   1 
ATOM   2704 C  CD2   . TYR F 3 39 ? 34.601 128.970 52.405 1.00 17.35  ? 540 TYR G CD2   1 
ATOM   2705 C  CE1   . TYR F 3 39 ? 34.539 131.627 53.215 1.00 16.61  ? 540 TYR G CE1   1 
ATOM   2706 C  CE2   . TYR F 3 39 ? 33.383 129.567 52.746 1.00 14.63  ? 540 TYR G CE2   1 
ATOM   2707 C  CZ    . TYR F 3 39 ? 33.365 130.896 53.151 1.00 17.33  ? 540 TYR G CZ    1 
ATOM   2708 O  OH    . TYR F 3 39 ? 32.172 131.472 53.505 1.00 15.92  ? 540 TYR G OH    1 
ATOM   2709 N  N     . PHE F 3 40 ? 36.672 126.392 53.649 1.00 16.77  ? 541 PHE G N     1 
ATOM   2710 C  CA    . PHE F 3 40 ? 35.781 125.498 54.373 1.00 18.10  ? 541 PHE G CA    1 
ATOM   2711 C  C     . PHE F 3 40 ? 36.376 124.937 55.663 1.00 19.89  ? 541 PHE G C     1 
ATOM   2712 O  O     . PHE F 3 40 ? 35.637 124.664 56.611 1.00 20.80  ? 541 PHE G O     1 
ATOM   2713 C  CB    . PHE F 3 40 ? 35.289 124.370 53.452 1.00 19.03  ? 541 PHE G CB    1 
ATOM   2714 C  CG    . PHE F 3 40 ? 34.403 124.862 52.345 1.00 17.69  ? 541 PHE G CG    1 
ATOM   2715 C  CD1   . PHE F 3 40 ? 34.929 125.151 51.091 1.00 18.77  ? 541 PHE G CD1   1 
ATOM   2716 C  CD2   . PHE F 3 40 ? 33.057 125.133 52.587 1.00 16.46  ? 541 PHE G CD2   1 
ATOM   2717 C  CE1   . PHE F 3 40 ? 34.126 125.712 50.096 1.00 19.08  ? 541 PHE G CE1   1 
ATOM   2718 C  CE2   . PHE F 3 40 ? 32.249 125.696 51.595 1.00 17.15  ? 541 PHE G CE2   1 
ATOM   2719 C  CZ    . PHE F 3 40 ? 32.786 125.986 50.352 1.00 17.16  ? 541 PHE G CZ    1 
ATOM   2720 N  N     . ARG F 3 41 ? 37.701 124.800 55.717 1.00 21.24  ? 542 ARG G N     1 
ATOM   2721 C  CA    . ARG F 3 41 ? 38.367 124.279 56.917 1.00 23.43  ? 542 ARG G CA    1 
ATOM   2722 C  C     . ARG F 3 41 ? 38.312 125.356 58.017 1.00 23.21  ? 542 ARG G C     1 
ATOM   2723 O  O     . ARG F 3 41 ? 37.988 125.076 59.182 1.00 21.56  ? 542 ARG G O     1 
ATOM   2724 C  CB    . ARG F 3 41 ? 39.829 123.951 56.609 1.00 27.48  ? 542 ARG G CB    1 
ATOM   2725 C  CG    . ARG F 3 41 ? 40.574 123.318 57.767 1.00 35.58  ? 542 ARG G CG    1 
ATOM   2726 C  CD    . ARG F 3 41 ? 42.040 123.073 57.428 1.00 42.71  ? 542 ARG G CD    1 
ATOM   2727 N  NE    . ARG F 3 41 ? 42.752 122.435 58.533 1.00 50.72  ? 542 ARG G NE    1 
ATOM   2728 C  CZ    . ARG F 3 41 ? 44.054 122.155 58.535 1.00 53.93  ? 542 ARG G CZ    1 
ATOM   2729 N  NH1   . ARG F 3 41 ? 44.813 122.452 57.484 1.00 55.94  ? 542 ARG G NH1   1 
ATOM   2730 N  NH2   . ARG F 3 41 ? 44.601 121.579 59.599 1.00 55.73  ? 542 ARG G NH2   1 
ATOM   2731 N  N     . ARG F 3 42 ? 38.653 126.584 57.628 1.00 22.87  ? 543 ARG G N     1 
ATOM   2732 C  CA    . ARG F 3 42 ? 38.652 127.740 58.532 1.00 23.12  ? 543 ARG G CA    1 
ATOM   2733 C  C     . ARG F 3 42 ? 37.300 127.980 59.181 1.00 23.47  ? 543 ARG G C     1 
ATOM   2734 O  O     . ARG F 3 42 ? 37.211 128.351 60.355 1.00 24.56  ? 543 ARG G O     1 
ATOM   2735 C  CB    . ARG F 3 42 ? 38.980 129.027 57.768 1.00 23.74  ? 543 ARG G CB    1 
ATOM   2736 C  CG    . ARG F 3 42 ? 40.430 129.411 57.660 1.00 28.14  ? 543 ARG G CG    1 
ATOM   2737 C  CD    . ARG F 3 42 ? 40.534 130.940 57.473 1.00 26.61  ? 543 ARG G CD    1 
ATOM   2738 N  NE    . ARG F 3 42 ? 39.822 131.402 56.280 1.00 26.91  ? 543 ARG G NE    1 
ATOM   2739 C  CZ    . ARG F 3 42 ? 40.228 131.175 55.035 1.00 24.92  ? 543 ARG G CZ    1 
ATOM   2740 N  NH1   . ARG F 3 42 ? 41.340 130.491 54.813 1.00 24.97  ? 543 ARG G NH1   1 
ATOM   2741 N  NH2   . ARG F 3 42 ? 39.535 131.647 54.012 1.00 25.41  ? 543 ARG G NH2   1 
ATOM   2742 N  N     . ASN F 3 43 ? 36.244 127.785 58.399 1.00 21.26  ? 544 ASN G N     1 
ATOM   2743 C  CA    . ASN F 3 43 ? 34.899 128.073 58.878 1.00 21.54  ? 544 ASN G CA    1 
ATOM   2744 C  C     . ASN F 3 43 ? 33.990 126.895 59.197 1.00 21.28  ? 544 ASN G C     1 
ATOM   2745 O  O     . ASN F 3 43 ? 32.778 127.062 59.306 1.00 19.50  ? 544 ASN G O     1 
ATOM   2746 C  CB    . ASN F 3 43 ? 34.238 129.006 57.863 1.00 20.86  ? 544 ASN G CB    1 
ATOM   2747 C  CG    . ASN F 3 43 ? 35.102 130.214 57.568 1.00 22.78  ? 544 ASN G CG    1 
ATOM   2748 O  OD1   . ASN F 3 43 ? 35.541 130.433 56.429 1.00 22.57  ? 544 ASN G OD1   1 
ATOM   2749 N  ND2   . ASN F 3 43 ? 35.376 131.000 58.604 1.00 19.21  ? 544 ASN G ND2   1 
ATOM   2750 N  N     . ALA F 3 44 ? 34.575 125.715 59.372 1.00 21.25  ? 545 ALA G N     1 
ATOM   2751 C  CA    . ALA F 3 44 ? 33.796 124.519 59.665 1.00 23.69  ? 545 ALA G CA    1 
ATOM   2752 C  C     . ALA F 3 44 ? 32.942 124.603 60.934 1.00 24.31  ? 545 ALA G C     1 
ATOM   2753 O  O     . ALA F 3 44 ? 31.918 123.924 61.042 1.00 23.33  ? 545 ALA G O     1 
ATOM   2754 C  CB    . ALA F 3 44 ? 34.726 123.313 59.745 1.00 24.65  ? 545 ALA G CB    1 
ATOM   2755 N  N     . ALA F 3 45 ? 33.355 125.420 61.900 1.00 24.74  ? 546 ALA G N     1 
ATOM   2756 C  CA    . ALA F 3 45 ? 32.599 125.530 63.147 1.00 25.35  ? 546 ALA G CA    1 
ATOM   2757 C  C     . ALA F 3 45 ? 31.808 126.823 63.281 1.00 25.62  ? 546 ALA G C     1 
ATOM   2758 O  O     . ALA F 3 45 ? 31.080 127.008 64.250 1.00 29.18  ? 546 ALA G O     1 
ATOM   2759 C  CB    . ALA F 3 45 ? 33.547 125.395 64.338 1.00 25.85  ? 546 ALA G CB    1 
ATOM   2760 N  N     . THR F 3 46 ? 31.925 127.710 62.305 1.00 23.78  ? 547 THR G N     1 
ATOM   2761 C  CA    . THR F 3 46 ? 31.246 128.996 62.393 1.00 23.46  ? 547 THR G CA    1 
ATOM   2762 C  C     . THR F 3 46 ? 30.093 129.226 61.418 1.00 22.65  ? 547 THR G C     1 
ATOM   2763 O  O     . THR F 3 46 ? 29.305 130.157 61.602 1.00 21.84  ? 547 THR G O     1 
ATOM   2764 C  CB    . THR F 3 46 ? 32.253 130.145 62.168 1.00 24.10  ? 547 THR G CB    1 
ATOM   2765 O  OG1   . THR F 3 46 ? 32.949 129.917 60.935 1.00 24.14  ? 547 THR G OG1   1 
ATOM   2766 C  CG2   . THR F 3 46 ? 33.264 130.225 63.301 1.00 24.62  ? 547 THR G CG2   1 
ATOM   2767 N  N     . TRP F 3 47 ? 29.974 128.386 60.395 1.00 22.69  ? 548 TRP G N     1 
ATOM   2768 C  CA    . TRP F 3 47 ? 28.940 128.622 59.401 1.00 21.49  ? 548 TRP G CA    1 
ATOM   2769 C  C     . TRP F 3 47 ? 27.497 128.742 59.875 1.00 21.08  ? 548 TRP G C     1 
ATOM   2770 O  O     . TRP F 3 47 ? 26.725 129.477 59.267 1.00 21.25  ? 548 TRP G O     1 
ATOM   2771 C  CB    . TRP F 3 47 ? 29.040 127.613 58.245 1.00 20.39  ? 548 TRP G CB    1 
ATOM   2772 C  CG    . TRP F 3 47 ? 28.778 126.179 58.572 1.00 20.21  ? 548 TRP G CG    1 
ATOM   2773 C  CD1   . TRP F 3 47 ? 29.710 125.191 58.714 1.00 20.69  ? 548 TRP G CD1   1 
ATOM   2774 C  CD2   . TRP F 3 47 ? 27.500 125.546 58.689 1.00 21.41  ? 548 TRP G CD2   1 
ATOM   2775 N  NE1   . TRP F 3 47 ? 29.093 123.977 58.902 1.00 21.44  ? 548 TRP G NE1   1 
ATOM   2776 C  CE2   . TRP F 3 47 ? 27.734 124.164 58.891 1.00 22.23  ? 548 TRP G CE2   1 
ATOM   2777 C  CE3   . TRP F 3 47 ? 26.179 126.008 58.639 1.00 23.22  ? 548 TRP G CE3   1 
ATOM   2778 C  CZ2   . TRP F 3 47 ? 26.694 123.241 59.042 1.00 22.03  ? 548 TRP G CZ2   1 
ATOM   2779 C  CZ3   . TRP F 3 47 ? 25.139 125.086 58.790 1.00 23.04  ? 548 TRP G CZ3   1 
ATOM   2780 C  CH2   . TRP F 3 47 ? 25.408 123.717 58.988 1.00 21.95  ? 548 TRP G CH2   1 
ATOM   2781 N  N     . LYS F 3 48 ? 27.124 128.052 60.951 1.00 21.93  ? 549 LYS G N     1 
ATOM   2782 C  CA    . LYS F 3 48 ? 25.749 128.146 61.432 1.00 24.07  ? 549 LYS G CA    1 
ATOM   2783 C  C     . LYS F 3 48 ? 25.405 129.576 61.831 1.00 24.60  ? 549 LYS G C     1 
ATOM   2784 O  O     . LYS F 3 48 ? 24.411 130.145 61.370 1.00 22.85  ? 549 LYS G O     1 
ATOM   2785 C  CB    . LYS F 3 48 ? 25.510 127.201 62.613 1.00 28.22  ? 549 LYS G CB    1 
ATOM   2786 C  CG    . LYS F 3 48 ? 24.760 125.940 62.220 1.00 34.07  ? 549 LYS G CG    1 
ATOM   2787 C  CD    . LYS F 3 48 ? 24.355 125.122 63.428 1.00 36.68  ? 549 LYS G CD    1 
ATOM   2788 C  CE    . LYS F 3 48 ? 23.509 123.940 63.011 1.00 38.82  ? 549 LYS G CE    1 
ATOM   2789 N  NZ    . LYS F 3 48 ? 24.232 123.070 62.044 1.00 39.55  ? 549 LYS G NZ    1 
ATOM   2790 N  N     . ASN F 3 49 ? 26.234 130.159 62.689 1.00 21.88  ? 550 ASN G N     1 
ATOM   2791 C  CA    . ASN F 3 49 ? 26.011 131.530 63.123 1.00 22.19  ? 550 ASN G CA    1 
ATOM   2792 C  C     . ASN F 3 49 ? 26.225 132.509 61.965 1.00 20.90  ? 550 ASN G C     1 
ATOM   2793 O  O     . ASN F 3 49 ? 25.525 133.520 61.856 1.00 19.64  ? 550 ASN G O     1 
ATOM   2794 C  CB    . ASN F 3 49 ? 26.958 131.870 64.278 1.00 24.82  ? 550 ASN G CB    1 
ATOM   2795 C  CG    . ASN F 3 49 ? 26.460 131.351 65.614 1.00 29.00  ? 550 ASN G CG    1 
ATOM   2796 O  OD1   . ASN F 3 49 ? 25.449 131.818 66.130 1.00 35.65  ? 550 ASN G OD1   1 
ATOM   2797 N  ND2   . ASN F 3 49 ? 27.168 130.385 66.179 1.00 31.95  ? 550 ASN G ND2   1 
ATOM   2798 N  N     . ALA F 3 50 ? 27.187 132.202 61.099 1.00 19.04  ? 551 ALA G N     1 
ATOM   2799 C  CA    . ALA F 3 50 ? 27.490 133.068 59.965 1.00 18.58  ? 551 ALA G CA    1 
ATOM   2800 C  C     . ALA F 3 50 ? 26.315 133.140 59.000 1.00 20.21  ? 551 ALA G C     1 
ATOM   2801 O  O     . ALA F 3 50 ? 26.028 134.200 58.437 1.00 16.94  ? 551 ALA G O     1 
ATOM   2802 C  CB    . ALA F 3 50 ? 28.733 132.581 59.246 1.00 18.39  ? 551 ALA G CB    1 
ATOM   2803 N  N     . VAL F 3 51 ? 25.644 132.006 58.806 1.00 20.35  ? 552 VAL G N     1 
ATOM   2804 C  CA    . VAL F 3 51 ? 24.478 131.947 57.929 1.00 21.02  ? 552 VAL G CA    1 
ATOM   2805 C  C     . VAL F 3 51 ? 23.335 132.767 58.528 1.00 22.20  ? 552 VAL G C     1 
ATOM   2806 O  O     . VAL F 3 51 ? 22.693 133.561 57.832 1.00 22.95  ? 552 VAL G O     1 
ATOM   2807 C  CB    . VAL F 3 51 ? 24.025 130.478 57.720 1.00 21.29  ? 552 VAL G CB    1 
ATOM   2808 C  CG1   . VAL F 3 51 ? 22.638 130.428 57.117 1.00 21.54  ? 552 VAL G CG1   1 
ATOM   2809 C  CG2   . VAL F 3 51 ? 25.004 129.782 56.799 1.00 19.98  ? 552 VAL G CG2   1 
ATOM   2810 N  N     . ARG F 3 52 ? 23.082 132.589 59.819 1.00 23.46  ? 553 ARG G N     1 
ATOM   2811 C  CA    . ARG F 3 52 ? 22.018 133.343 60.475 1.00 24.95  ? 553 ARG G CA    1 
ATOM   2812 C  C     . ARG F 3 52 ? 22.284 134.845 60.382 1.00 24.58  ? 553 ARG G C     1 
ATOM   2813 O  O     . ARG F 3 52 ? 21.361 135.639 60.177 1.00 24.87  ? 553 ARG G O     1 
ATOM   2814 C  CB    . ARG F 3 52 ? 21.891 132.928 61.943 1.00 27.41  ? 553 ARG G CB    1 
ATOM   2815 C  CG    . ARG F 3 52 ? 21.359 131.520 62.138 1.00 34.18  ? 553 ARG G CG    1 
ATOM   2816 C  CD    . ARG F 3 52 ? 20.763 131.329 63.528 1.00 38.25  ? 553 ARG G CD    1 
ATOM   2817 N  NE    . ARG F 3 52 ? 21.768 131.296 64.587 1.00 43.13  ? 553 ARG G NE    1 
ATOM   2818 C  CZ    . ARG F 3 52 ? 22.645 130.309 64.763 1.00 44.98  ? 553 ARG G CZ    1 
ATOM   2819 N  NH1   . ARG F 3 52 ? 22.653 129.261 63.949 1.00 46.39  ? 553 ARG G NH1   1 
ATOM   2820 N  NH2   . ARG F 3 52 ? 23.510 130.364 65.766 1.00 46.13  ? 553 ARG G NH2   1 
ATOM   2821 N  N     . HIS F 3 53 ? 23.548 135.227 60.533 1.00 23.31  ? 554 HIS G N     1 
ATOM   2822 C  CA    . HIS F 3 53 ? 23.936 136.630 60.468 1.00 22.83  ? 554 HIS G CA    1 
ATOM   2823 C  C     . HIS F 3 53 ? 23.690 137.189 59.064 1.00 23.38  ? 554 HIS G C     1 
ATOM   2824 O  O     . HIS F 3 53 ? 23.065 138.242 58.907 1.00 24.34  ? 554 HIS G O     1 
ATOM   2825 C  CB    . HIS F 3 53 ? 25.415 136.775 60.833 1.00 21.66  ? 554 HIS G CB    1 
ATOM   2826 C  CG    . HIS F 3 53 ? 25.895 138.191 60.846 1.00 21.88  ? 554 HIS G CG    1 
ATOM   2827 N  ND1   . HIS F 3 53 ? 25.452 139.115 61.765 1.00 22.12  ? 554 HIS G ND1   1 
ATOM   2828 C  CD2   . HIS F 3 53 ? 26.777 138.842 60.051 1.00 19.11  ? 554 HIS G CD2   1 
ATOM   2829 C  CE1   . HIS F 3 53 ? 26.039 140.277 61.536 1.00 22.21  ? 554 HIS G CE1   1 
ATOM   2830 N  NE2   . HIS F 3 53 ? 26.848 140.135 60.501 1.00 21.78  ? 554 HIS G NE2   1 
ATOM   2831 N  N     . ASN F 3 54 ? 24.185 136.481 58.050 1.00 21.98  ? 555 ASN G N     1 
ATOM   2832 C  CA    . ASN F 3 54 ? 24.028 136.905 56.658 1.00 22.95  ? 555 ASN G CA    1 
ATOM   2833 C  C     . ASN F 3 54 ? 22.565 137.036 56.256 1.00 23.50  ? 555 ASN G C     1 
ATOM   2834 O  O     . ASN F 3 54 ? 22.194 137.986 55.570 1.00 24.74  ? 555 ASN G O     1 
ATOM   2835 C  CB    . ASN F 3 54 ? 24.715 135.917 55.712 1.00 21.45  ? 555 ASN G CB    1 
ATOM   2836 C  CG    . ASN F 3 54 ? 26.163 136.266 55.455 1.00 20.74  ? 555 ASN G CG    1 
ATOM   2837 O  OD1   . ASN F 3 54 ? 26.498 136.849 54.422 1.00 20.47  ? 555 ASN G OD1   1 
ATOM   2838 N  ND2   . ASN F 3 54 ? 27.038 135.923 56.409 1.00 18.66  ? 555 ASN G ND2   1 
ATOM   2839 N  N     . LEU F 3 55 ? 21.742 136.080 56.678 1.00 24.60  ? 556 LEU G N     1 
ATOM   2840 C  CA    . LEU F 3 55 ? 20.324 136.108 56.341 1.00 25.68  ? 556 LEU G CA    1 
ATOM   2841 C  C     . LEU F 3 55 ? 19.643 137.379 56.850 1.00 27.69  ? 556 LEU G C     1 
ATOM   2842 O  O     . LEU F 3 55 ? 18.843 137.986 56.140 1.00 28.07  ? 556 LEU G O     1 
ATOM   2843 C  CB    . LEU F 3 55 ? 19.614 134.874 56.905 1.00 25.05  ? 556 LEU G CB    1 
ATOM   2844 C  CG    . LEU F 3 55 ? 19.948 133.524 56.256 1.00 24.07  ? 556 LEU G CG    1 
ATOM   2845 C  CD1   . LEU F 3 55 ? 19.205 132.428 57.007 1.00 23.59  ? 556 LEU G CD1   1 
ATOM   2846 C  CD2   . LEU F 3 55 ? 19.557 133.520 54.784 1.00 24.60  ? 556 LEU G CD2   1 
ATOM   2847 N  N     . SER F 3 56 ? 19.956 137.791 58.075 1.00 27.89  ? 557 SER G N     1 
ATOM   2848 C  CA    . SER F 3 56 ? 19.340 138.998 58.613 1.00 29.25  ? 557 SER G CA    1 
ATOM   2849 C  C     . SER F 3 56 ? 20.066 140.277 58.197 1.00 28.90  ? 557 SER G C     1 
ATOM   2850 O  O     . SER F 3 56 ? 19.469 141.352 58.195 1.00 30.40  ? 557 SER G O     1 
ATOM   2851 C  CB    . SER F 3 56 ? 19.238 138.920 60.143 1.00 31.66  ? 557 SER G CB    1 
ATOM   2852 O  OG    . SER F 3 56 ? 20.497 138.681 60.737 1.00 37.64  ? 557 SER G OG    1 
ATOM   2853 N  N     . LEU F 3 57 ? 21.341 140.169 57.828 1.00 26.51  ? 558 LEU G N     1 
ATOM   2854 C  CA    . LEU F 3 57 ? 22.107 141.347 57.422 1.00 27.23  ? 558 LEU G CA    1 
ATOM   2855 C  C     . LEU F 3 57 ? 21.828 141.799 55.986 1.00 27.91  ? 558 LEU G C     1 
ATOM   2856 O  O     . LEU F 3 57 ? 21.590 142.977 55.742 1.00 27.93  ? 558 LEU G O     1 
ATOM   2857 C  CB    . LEU F 3 57 ? 23.616 141.098 57.562 1.00 27.68  ? 558 LEU G CB    1 
ATOM   2858 C  CG    . LEU F 3 57 ? 24.531 142.235 57.069 1.00 28.57  ? 558 LEU G CG    1 
ATOM   2859 C  CD1   . LEU F 3 57 ? 24.391 143.434 57.991 1.00 30.13  ? 558 LEU G CD1   1 
ATOM   2860 C  CD2   . LEU F 3 57 ? 25.984 141.779 57.021 1.00 29.53  ? 558 LEU G CD2   1 
ATOM   2861 N  N     . HIS F 3 58 ? 21.859 140.864 55.041 1.00 27.11  ? 559 HIS G N     1 
ATOM   2862 C  CA    . HIS F 3 58 ? 21.657 141.201 53.636 1.00 29.00  ? 559 HIS G CA    1 
ATOM   2863 C  C     . HIS F 3 58 ? 20.200 141.216 53.198 1.00 30.07  ? 559 HIS G C     1 
ATOM   2864 O  O     . HIS F 3 58 ? 19.464 140.242 53.378 1.00 27.67  ? 559 HIS G O     1 
ATOM   2865 C  CB    . HIS F 3 58 ? 22.444 140.237 52.748 1.00 29.88  ? 559 HIS G CB    1 
ATOM   2866 C  CG    . HIS F 3 58 ? 23.908 140.193 53.057 1.00 31.15  ? 559 HIS G CG    1 
ATOM   2867 N  ND1   . HIS F 3 58 ? 24.751 141.258 52.819 1.00 32.58  ? 559 HIS G ND1   1 
ATOM   2868 C  CD2   . HIS F 3 58 ? 24.677 139.216 53.594 1.00 31.22  ? 559 HIS G CD2   1 
ATOM   2869 C  CE1   . HIS F 3 58 ? 25.977 140.937 53.197 1.00 33.45  ? 559 HIS G CE1   1 
ATOM   2870 N  NE2   . HIS F 3 58 ? 25.959 139.704 53.671 1.00 31.45  ? 559 HIS G NE2   1 
ATOM   2871 N  N     . LYS F 3 59 ? 19.800 142.336 52.606 1.00 31.27  ? 560 LYS G N     1 
ATOM   2872 C  CA    . LYS F 3 59 ? 18.433 142.513 52.136 1.00 33.17  ? 560 LYS G CA    1 
ATOM   2873 C  C     . LYS F 3 59 ? 18.072 141.547 51.003 1.00 31.98  ? 560 LYS G C     1 
ATOM   2874 O  O     . LYS F 3 59 ? 16.900 141.226 50.813 1.00 33.39  ? 560 LYS G O     1 
ATOM   2875 C  CB    . LYS F 3 59 ? 18.234 143.960 51.674 1.00 35.53  ? 560 LYS G CB    1 
ATOM   2876 C  CG    . LYS F 3 59 ? 18.596 144.986 52.742 1.00 40.73  ? 560 LYS G CG    1 
ATOM   2877 C  CD    . LYS F 3 59 ? 18.429 146.415 52.250 1.00 43.67  ? 560 LYS G CD    1 
ATOM   2878 C  CE    . LYS F 3 59 ? 16.975 146.728 51.941 1.00 45.89  ? 560 LYS G CE    1 
ATOM   2879 N  NZ    . LYS F 3 59 ? 16.098 146.588 53.137 1.00 48.15  ? 560 LYS G NZ    1 
ATOM   2880 N  N     . CYS F 3 60 ? 19.073 141.079 50.262 1.00 30.94  ? 561 CYS G N     1 
ATOM   2881 C  CA    . CYS F 3 60 ? 18.826 140.159 49.153 1.00 31.46  ? 561 CYS G CA    1 
ATOM   2882 C  C     . CYS F 3 60 ? 18.214 138.837 49.607 1.00 31.94  ? 561 CYS G C     1 
ATOM   2883 O  O     . CYS F 3 60 ? 17.654 138.096 48.795 1.00 32.33  ? 561 CYS G O     1 
ATOM   2884 C  CB    . CYS F 3 60 ? 20.116 139.889 48.377 1.00 32.82  ? 561 CYS G CB    1 
ATOM   2885 S  SG    . CYS F 3 60 ? 21.419 139.075 49.330 1.00 31.83  ? 561 CYS G SG    1 
ATOM   2886 N  N     . PHE F 3 61 ? 18.334 138.535 50.897 1.00 28.88  ? 562 PHE G N     1 
ATOM   2887 C  CA    . PHE F 3 61 ? 17.756 137.313 51.448 1.00 30.03  ? 562 PHE G CA    1 
ATOM   2888 C  C     . PHE F 3 61 ? 16.483 137.718 52.181 1.00 32.02  ? 562 PHE G C     1 
ATOM   2889 O  O     . PHE F 3 61 ? 16.534 138.391 53.216 1.00 30.43  ? 562 PHE G O     1 
ATOM   2890 C  CB    . PHE F 3 61 ? 18.743 136.639 52.409 1.00 27.29  ? 562 PHE G CB    1 
ATOM   2891 C  CG    . PHE F 3 61 ? 20.016 136.187 51.745 1.00 25.40  ? 562 PHE G CG    1 
ATOM   2892 C  CD1   . PHE F 3 61 ? 21.260 136.516 52.285 1.00 24.28  ? 562 PHE G CD1   1 
ATOM   2893 C  CD2   . PHE F 3 61 ? 19.972 135.432 50.576 1.00 23.85  ? 562 PHE G CD2   1 
ATOM   2894 C  CE1   . PHE F 3 61 ? 22.440 136.099 51.669 1.00 23.83  ? 562 PHE G CE1   1 
ATOM   2895 C  CE2   . PHE F 3 61 ? 21.145 135.008 49.953 1.00 23.75  ? 562 PHE G CE2   1 
ATOM   2896 C  CZ    . PHE F 3 61 ? 22.382 135.342 50.499 1.00 23.58  ? 562 PHE G CZ    1 
ATOM   2897 N  N     . VAL F 3 62 ? 15.339 137.305 51.645 1.00 33.49  ? 563 VAL G N     1 
ATOM   2898 C  CA    . VAL F 3 62 ? 14.055 137.663 52.230 1.00 35.56  ? 563 VAL G CA    1 
ATOM   2899 C  C     . VAL F 3 62 ? 13.319 136.484 52.843 1.00 37.50  ? 563 VAL G C     1 
ATOM   2900 O  O     . VAL F 3 62 ? 13.162 135.446 52.210 1.00 36.62  ? 563 VAL G O     1 
ATOM   2901 C  CB    . VAL F 3 62 ? 13.151 138.310 51.164 1.00 36.84  ? 563 VAL G CB    1 
ATOM   2902 C  CG1   . VAL F 3 62 ? 11.820 138.704 51.775 1.00 37.07  ? 563 VAL G CG1   1 
ATOM   2903 C  CG2   . VAL F 3 62 ? 13.858 139.517 50.558 1.00 37.18  ? 563 VAL G CG2   1 
ATOM   2904 N  N     . ARG F 3 63 ? 12.850 136.652 54.074 1.00 41.07  ? 564 ARG G N     1 
ATOM   2905 C  CA    . ARG F 3 63 ? 12.128 135.576 54.738 1.00 46.45  ? 564 ARG G CA    1 
ATOM   2906 C  C     . ARG F 3 63 ? 10.636 135.641 54.416 1.00 49.04  ? 564 ARG G C     1 
ATOM   2907 O  O     . ARG F 3 63 ? 9.954  136.602 54.779 1.00 48.30  ? 564 ARG G O     1 
ATOM   2908 C  CB    . ARG F 3 63 ? 12.329 135.649 56.251 1.00 48.68  ? 564 ARG G CB    1 
ATOM   2909 C  CG    . ARG F 3 63 ? 11.682 134.497 56.991 1.00 53.20  ? 564 ARG G CG    1 
ATOM   2910 C  CD    . ARG F 3 63 ? 11.864 134.617 58.490 1.00 56.91  ? 564 ARG G CD    1 
ATOM   2911 N  NE    . ARG F 3 63 ? 11.206 133.520 59.191 1.00 60.60  ? 564 ARG G NE    1 
ATOM   2912 C  CZ    . ARG F 3 63 ? 11.203 133.371 60.510 1.00 62.18  ? 564 ARG G CZ    1 
ATOM   2913 N  NH1   . ARG F 3 63 ? 11.827 134.254 61.278 1.00 63.27  ? 564 ARG G NH1   1 
ATOM   2914 N  NH2   . ARG F 3 63 ? 10.572 132.344 61.063 1.00 63.39  ? 564 ARG G NH2   1 
ATOM   2915 N  N     . VAL F 3 64 ? 10.139 134.616 53.729 1.00 52.37  ? 565 VAL G N     1 
ATOM   2916 C  CA    . VAL F 3 64 ? 8.731  134.555 53.352 1.00 56.33  ? 565 VAL G CA    1 
ATOM   2917 C  C     . VAL F 3 64 ? 8.000  133.555 54.232 1.00 58.78  ? 565 VAL G C     1 
ATOM   2918 O  O     . VAL F 3 64 ? 8.281  132.356 54.196 1.00 59.68  ? 565 VAL G O     1 
ATOM   2919 C  CB    . VAL F 3 64 ? 8.562  134.134 51.880 1.00 55.91  ? 565 VAL G CB    1 
ATOM   2920 C  CG1   . VAL F 3 64 ? 7.097  134.191 51.488 1.00 56.49  ? 565 VAL G CG1   1 
ATOM   2921 C  CG2   . VAL F 3 64 ? 9.389  135.036 50.989 1.00 55.94  ? 565 VAL G CG2   1 
ATOM   2922 N  N     . GLU F 3 65 ? 7.056  134.055 55.019 1.00 62.56  ? 566 GLU G N     1 
ATOM   2923 C  CA    . GLU F 3 65 ? 6.287  133.211 55.923 1.00 66.01  ? 566 GLU G CA    1 
ATOM   2924 C  C     . GLU F 3 65 ? 4.996  132.732 55.276 1.00 67.28  ? 566 GLU G C     1 
ATOM   2925 O  O     . GLU F 3 65 ? 4.087  133.523 55.025 1.00 67.92  ? 566 GLU G O     1 
ATOM   2926 C  CB    . GLU F 3 65 ? 5.974  133.984 57.203 1.00 66.85  ? 566 GLU G CB    1 
ATOM   2927 C  CG    . GLU F 3 65 ? 7.214  134.537 57.890 1.00 69.63  ? 566 GLU G CG    1 
ATOM   2928 C  CD    . GLU F 3 65 ? 6.885  135.391 59.096 1.00 70.94  ? 566 GLU G CD    1 
ATOM   2929 O  OE1   . GLU F 3 65 ? 6.165  136.399 58.933 1.00 71.74  ? 566 GLU G OE1   1 
ATOM   2930 O  OE2   . GLU F 3 65 ? 7.350  135.057 60.206 1.00 72.05  ? 566 GLU G OE2   1 
ATOM   2931 N  N     . ASN F 3 66 ? 4.921  131.433 55.004 1.00 69.50  ? 567 ASN G N     1 
ATOM   2932 C  CA    . ASN F 3 66 ? 3.735  130.849 54.388 1.00 71.56  ? 567 ASN G CA    1 
ATOM   2933 C  C     . ASN F 3 66 ? 2.909  130.090 55.421 1.00 72.60  ? 567 ASN G C     1 
ATOM   2934 O  O     . ASN F 3 66 ? 2.980  130.378 56.619 1.00 72.86  ? 567 ASN G O     1 
ATOM   2935 C  CB    . ASN F 3 66 ? 4.133  129.909 53.242 1.00 72.15  ? 567 ASN G CB    1 
ATOM   2936 C  CG    . ASN F 3 66 ? 5.037  128.775 53.695 1.00 72.94  ? 567 ASN G CG    1 
ATOM   2937 O  OD1   . ASN F 3 66 ? 5.439  127.930 52.893 1.00 73.56  ? 567 ASN G OD1   1 
ATOM   2938 N  ND2   . ASN F 3 66 ? 5.363  128.751 54.983 1.00 73.57  ? 567 ASN G ND2   1 
ATOM   2939 N  N     . VAL F 3 67 ? 2.126  129.123 54.949 1.00 73.80  ? 568 VAL G N     1 
ATOM   2940 C  CA    . VAL F 3 67 ? 1.271  128.313 55.814 1.00 74.41  ? 568 VAL G CA    1 
ATOM   2941 C  C     . VAL F 3 67 ? 1.972  127.874 57.101 1.00 73.74  ? 568 VAL G C     1 
ATOM   2942 O  O     . VAL F 3 67 ? 1.863  128.537 58.134 1.00 74.27  ? 568 VAL G O     1 
ATOM   2943 C  CB    . VAL F 3 67 ? 0.756  127.064 55.056 1.00 75.03  ? 568 VAL G CB    1 
ATOM   2944 C  CG1   . VAL F 3 67 ? -0.290 127.479 54.028 1.00 75.62  ? 568 VAL G CG1   1 
ATOM   2945 C  CG2   . VAL F 3 67 ? 1.917  126.358 54.355 1.00 75.70  ? 568 VAL G CG2   1 
ATOM   2946 N  N     . LYS F 3 68 ? 2.683  126.753 57.038 1.00 72.95  ? 569 LYS G N     1 
ATOM   2947 C  CA    . LYS F 3 68 ? 3.402  126.241 58.196 1.00 71.55  ? 569 LYS G CA    1 
ATOM   2948 C  C     . LYS F 3 68 ? 4.890  126.538 58.066 1.00 69.88  ? 569 LYS G C     1 
ATOM   2949 O  O     . LYS F 3 68 ? 5.529  126.155 57.085 1.00 69.28  ? 569 LYS G O     1 
ATOM   2950 C  CB    . LYS F 3 68 ? 3.181  124.732 58.337 1.00 72.68  ? 569 LYS G CB    1 
ATOM   2951 C  CG    . LYS F 3 68 ? 1.768  124.351 58.760 1.00 74.19  ? 569 LYS G CG    1 
ATOM   2952 C  CD    . LYS F 3 68 ? 1.594  122.841 58.855 1.00 75.67  ? 569 LYS G CD    1 
ATOM   2953 C  CE    . LYS F 3 68 ? 1.749  122.173 57.494 1.00 76.52  ? 569 LYS G CE    1 
ATOM   2954 N  NZ    . LYS F 3 68 ? 1.532  120.700 57.565 1.00 77.74  ? 569 LYS G NZ    1 
ATOM   2955 N  N     . GLY F 3 69 ? 5.431  127.232 59.063 1.00 68.01  ? 570 GLY G N     1 
ATOM   2956 C  CA    . GLY F 3 69 ? 6.840  127.573 59.050 1.00 65.66  ? 570 GLY G CA    1 
ATOM   2957 C  C     . GLY F 3 69 ? 7.155  128.705 58.093 1.00 63.55  ? 570 GLY G C     1 
ATOM   2958 O  O     . GLY F 3 69 ? 6.277  129.193 57.380 1.00 64.32  ? 570 GLY G O     1 
ATOM   2959 N  N     . ALA F 3 70 ? 8.414  129.126 58.083 1.00 60.54  ? 571 ALA G N     1 
ATOM   2960 C  CA    . ALA F 3 70 ? 8.857  130.203 57.209 1.00 57.12  ? 571 ALA G CA    1 
ATOM   2961 C  C     . ALA F 3 70 ? 9.996  129.717 56.322 1.00 55.01  ? 571 ALA G C     1 
ATOM   2962 O  O     . ALA F 3 70 ? 10.742 128.808 56.689 1.00 55.55  ? 571 ALA G O     1 
ATOM   2963 C  CB    . ALA F 3 70 ? 9.312  131.396 58.040 1.00 55.08  ? 571 ALA G CB    1 
ATOM   2964 N  N     . VAL F 3 71 ? 10.124 130.327 55.151 1.00 51.70  ? 572 VAL G N     1 
ATOM   2965 C  CA    . VAL F 3 71 ? 11.172 129.953 54.216 1.00 48.54  ? 572 VAL G CA    1 
ATOM   2966 C  C     . VAL F 3 71 ? 11.963 131.183 53.794 1.00 45.70  ? 572 VAL G C     1 
ATOM   2967 O  O     . VAL F 3 71 ? 11.496 132.315 53.937 1.00 45.60  ? 572 VAL G O     1 
ATOM   2968 C  CB    . VAL F 3 71 ? 10.578 129.282 52.960 1.00 48.99  ? 572 VAL G CB    1 
ATOM   2969 C  CG1   . VAL F 3 71 ? 9.806  128.039 53.358 1.00 48.64  ? 572 VAL G CG1   1 
ATOM   2970 C  CG2   . VAL F 3 71 ? 9.669  130.258 52.225 1.00 49.30  ? 572 VAL G CG2   1 
ATOM   2971 N  N     . TRP F 3 72 ? 13.170 130.960 53.288 1.00 41.29  ? 573 TRP G N     1 
ATOM   2972 C  CA    . TRP F 3 72 ? 14.009 132.058 52.837 1.00 36.83  ? 573 TRP G CA    1 
ATOM   2973 C  C     . TRP F 3 72 ? 14.122 132.043 51.331 1.00 34.51  ? 573 TRP G C     1 
ATOM   2974 O  O     . TRP F 3 72 ? 14.191 130.987 50.705 1.00 33.40  ? 573 TRP G O     1 
ATOM   2975 C  CB    . TRP F 3 72 ? 15.409 131.978 53.452 1.00 36.22  ? 573 TRP G CB    1 
ATOM   2976 C  CG    . TRP F 3 72 ? 15.419 132.240 54.918 1.00 34.22  ? 573 TRP G CG    1 
ATOM   2977 C  CD1   . TRP F 3 72 ? 15.191 131.338 55.911 1.00 34.69  ? 573 TRP G CD1   1 
ATOM   2978 C  CD2   . TRP F 3 72 ? 15.631 133.505 55.560 1.00 34.13  ? 573 TRP G CD2   1 
ATOM   2979 N  NE1   . TRP F 3 72 ? 15.248 131.959 57.139 1.00 35.01  ? 573 TRP G NE1   1 
ATOM   2980 C  CE2   . TRP F 3 72 ? 15.517 133.289 56.951 1.00 33.85  ? 573 TRP G CE2   1 
ATOM   2981 C  CE3   . TRP F 3 72 ? 15.907 134.797 55.093 1.00 33.17  ? 573 TRP G CE3   1 
ATOM   2982 C  CZ2   . TRP F 3 72 ? 15.671 134.320 57.884 1.00 33.55  ? 573 TRP G CZ2   1 
ATOM   2983 C  CZ3   . TRP F 3 72 ? 16.060 135.822 56.020 1.00 34.00  ? 573 TRP G CZ3   1 
ATOM   2984 C  CH2   . TRP F 3 72 ? 15.941 135.574 57.402 1.00 33.38  ? 573 TRP G CH2   1 
ATOM   2985 N  N     . THR F 3 73 ? 14.147 133.234 50.756 1.00 31.44  ? 574 THR G N     1 
ATOM   2986 C  CA    . THR F 3 73 ? 14.241 133.379 49.321 1.00 31.20  ? 574 THR G CA    1 
ATOM   2987 C  C     . THR F 3 73 ? 15.325 134.377 48.987 1.00 30.60  ? 574 THR G C     1 
ATOM   2988 O  O     . THR F 3 73 ? 15.850 135.062 49.870 1.00 29.31  ? 574 THR G O     1 
ATOM   2989 C  CB    . THR F 3 73 ? 12.911 133.885 48.730 1.00 32.09  ? 574 THR G CB    1 
ATOM   2990 O  OG1   . THR F 3 73 ? 12.560 135.131 49.338 1.00 31.72  ? 574 THR G OG1   1 
ATOM   2991 C  CG2   . THR F 3 73 ? 11.805 132.892 48.997 1.00 32.99  ? 574 THR G CG2   1 
ATOM   2992 N  N     . VAL F 3 74 ? 15.661 134.452 47.707 1.00 28.26  ? 575 VAL G N     1 
ATOM   2993 C  CA    . VAL F 3 74 ? 16.667 135.381 47.247 1.00 28.60  ? 575 VAL G CA    1 
ATOM   2994 C  C     . VAL F 3 74 ? 16.023 136.425 46.346 1.00 29.82  ? 575 VAL G C     1 
ATOM   2995 O  O     . VAL F 3 74 ? 15.266 136.086 45.435 1.00 28.96  ? 575 VAL G O     1 
ATOM   2996 C  CB    . VAL F 3 74 ? 17.774 134.665 46.449 1.00 28.47  ? 575 VAL G CB    1 
ATOM   2997 C  CG1   . VAL F 3 74 ? 18.774 135.684 45.928 1.00 30.37  ? 575 VAL G CG1   1 
ATOM   2998 C  CG2   . VAL F 3 74 ? 18.481 133.635 47.335 1.00 29.10  ? 575 VAL G CG2   1 
ATOM   2999 N  N     . ASP F 3 75 ? 16.294 137.696 46.626 1.00 28.87  ? 576 ASP G N     1 
ATOM   3000 C  CA    . ASP F 3 75 ? 15.783 138.786 45.800 1.00 29.66  ? 576 ASP G CA    1 
ATOM   3001 C  C     . ASP F 3 75 ? 16.913 138.943 44.799 1.00 29.41  ? 576 ASP G C     1 
ATOM   3002 O  O     . ASP F 3 75 ? 17.905 139.620 45.079 1.00 29.75  ? 576 ASP G O     1 
ATOM   3003 C  CB    . ASP F 3 75 ? 15.638 140.065 46.627 1.00 31.79  ? 576 ASP G CB    1 
ATOM   3004 C  CG    . ASP F 3 75 ? 15.193 141.251 45.792 1.00 33.15  ? 576 ASP G CG    1 
ATOM   3005 O  OD1   . ASP F 3 75 ? 15.743 141.438 44.683 1.00 33.13  ? 576 ASP G OD1   1 
ATOM   3006 O  OD2   . ASP F 3 75 ? 14.301 141.999 46.252 1.00 35.62  ? 576 ASP G OD2   1 
ATOM   3007 N  N     . GLU F 3 76 ? 16.781 138.298 43.643 1.00 29.94  ? 577 GLU G N     1 
ATOM   3008 C  CA    . GLU F 3 76 ? 17.834 138.333 42.633 1.00 30.91  ? 577 GLU G CA    1 
ATOM   3009 C  C     . GLU F 3 76 ? 18.263 139.726 42.207 1.00 31.54  ? 577 GLU G C     1 
ATOM   3010 O  O     . GLU F 3 76 ? 19.440 139.953 41.926 1.00 31.29  ? 577 GLU G O     1 
ATOM   3011 C  CB    . GLU F 3 76 ? 17.417 137.527 41.403 1.00 33.05  ? 577 GLU G CB    1 
ATOM   3012 C  CG    . GLU F 3 76 ? 18.511 137.371 40.348 1.00 35.69  ? 577 GLU G CG    1 
ATOM   3013 C  CD    . GLU F 3 76 ? 19.787 136.746 40.894 1.00 38.28  ? 577 GLU G CD    1 
ATOM   3014 O  OE1   . GLU F 3 76 ? 19.699 135.905 41.815 1.00 38.49  ? 577 GLU G OE1   1 
ATOM   3015 O  OE2   . GLU F 3 76 ? 20.883 137.081 40.391 1.00 37.17  ? 577 GLU G OE2   1 
ATOM   3016 N  N     . VAL F 3 77 ? 17.323 140.661 42.143 1.00 32.28  ? 578 VAL G N     1 
ATOM   3017 C  CA    . VAL F 3 77 ? 17.683 142.019 41.748 1.00 33.35  ? 578 VAL G CA    1 
ATOM   3018 C  C     . VAL F 3 77 ? 18.636 142.629 42.774 1.00 32.92  ? 578 VAL G C     1 
ATOM   3019 O  O     . VAL F 3 77 ? 19.690 143.151 42.420 1.00 31.48  ? 578 VAL G O     1 
ATOM   3020 C  CB    . VAL F 3 77 ? 16.441 142.931 41.619 1.00 34.70  ? 578 VAL G CB    1 
ATOM   3021 C  CG1   . VAL F 3 77 ? 16.882 144.369 41.376 1.00 36.51  ? 578 VAL G CG1   1 
ATOM   3022 C  CG2   . VAL F 3 77 ? 15.561 142.452 40.471 1.00 36.51  ? 578 VAL G CG2   1 
ATOM   3023 N  N     . GLU F 3 78 ? 18.263 142.553 44.047 1.00 34.57  ? 579 GLU G N     1 
ATOM   3024 C  CA    . GLU F 3 78 ? 19.096 143.107 45.110 1.00 36.96  ? 579 GLU G CA    1 
ATOM   3025 C  C     . GLU F 3 78 ? 20.463 142.431 45.152 1.00 37.68  ? 579 GLU G C     1 
ATOM   3026 O  O     . GLU F 3 78 ? 21.494 143.096 45.270 1.00 37.40  ? 579 GLU G O     1 
ATOM   3027 C  CB    . GLU F 3 78 ? 18.405 142.943 46.464 1.00 38.94  ? 579 GLU G CB    1 
ATOM   3028 C  CG    . GLU F 3 78 ? 18.859 143.951 47.498 1.00 42.58  ? 579 GLU G CG    1 
ATOM   3029 C  CD    . GLU F 3 78 ? 18.407 145.358 47.161 1.00 44.16  ? 579 GLU G CD    1 
ATOM   3030 O  OE1   . GLU F 3 78 ? 18.664 145.817 46.029 1.00 47.23  ? 579 GLU G OE1   1 
ATOM   3031 O  OE2   . GLU F 3 78 ? 17.789 146.008 48.029 1.00 46.25  ? 579 GLU G OE2   1 
ATOM   3032 N  N     . TYR F 3 79 ? 20.472 141.106 45.048 1.00 38.92  ? 580 TYR G N     1 
ATOM   3033 C  CA    . TYR F 3 79 ? 21.723 140.358 45.082 1.00 40.75  ? 580 TYR G CA    1 
ATOM   3034 C  C     . TYR F 3 79 ? 22.719 140.871 44.050 1.00 43.06  ? 580 TYR G C     1 
ATOM   3035 O  O     . TYR F 3 79 ? 23.904 141.024 44.343 1.00 42.38  ? 580 TYR G O     1 
ATOM   3036 C  CB    . TYR F 3 79 ? 21.466 138.870 44.825 1.00 39.74  ? 580 TYR G CB    1 
ATOM   3037 C  CG    . TYR F 3 79 ? 22.717 138.021 44.903 1.00 39.19  ? 580 TYR G CG    1 
ATOM   3038 C  CD1   . TYR F 3 79 ? 23.267 137.667 46.136 1.00 39.18  ? 580 TYR G CD1   1 
ATOM   3039 C  CD2   . TYR F 3 79 ? 23.364 137.591 43.745 1.00 39.29  ? 580 TYR G CD2   1 
ATOM   3040 C  CE1   . TYR F 3 79 ? 24.430 136.904 46.214 1.00 37.48  ? 580 TYR G CE1   1 
ATOM   3041 C  CE2   . TYR F 3 79 ? 24.531 136.829 43.810 1.00 38.77  ? 580 TYR G CE2   1 
ATOM   3042 C  CZ    . TYR F 3 79 ? 25.055 136.489 45.050 1.00 38.54  ? 580 TYR G CZ    1 
ATOM   3043 O  OH    . TYR F 3 79 ? 26.195 135.722 45.123 1.00 38.59  ? 580 TYR G OH    1 
ATOM   3044 N  N     . GLN F 3 80 ? 22.234 141.144 42.843 1.00 46.32  ? 581 GLN G N     1 
ATOM   3045 C  CA    . GLN F 3 80 ? 23.096 141.609 41.764 1.00 50.67  ? 581 GLN G CA    1 
ATOM   3046 C  C     . GLN F 3 80 ? 23.736 142.988 41.928 1.00 53.13  ? 581 GLN G C     1 
ATOM   3047 O  O     . GLN F 3 80 ? 24.816 143.227 41.393 1.00 53.26  ? 581 GLN G O     1 
ATOM   3048 C  CB    . GLN F 3 80 ? 22.339 141.541 40.437 1.00 51.46  ? 581 GLN G CB    1 
ATOM   3049 C  CG    . GLN F 3 80 ? 22.075 140.118 39.973 1.00 53.28  ? 581 GLN G CG    1 
ATOM   3050 C  CD    . GLN F 3 80 ? 23.343 139.393 39.550 1.00 54.72  ? 581 GLN G CD    1 
ATOM   3051 O  OE1   . GLN F 3 80 ? 24.363 139.440 40.237 1.00 54.90  ? 581 GLN G OE1   1 
ATOM   3052 N  NE2   . GLN F 3 80 ? 23.279 138.709 38.414 1.00 55.83  ? 581 GLN G NE2   1 
ATOM   3053 N  N     . LYS F 3 81 ? 23.091 143.895 42.652 1.00 56.64  ? 582 LYS G N     1 
ATOM   3054 C  CA    . LYS F 3 81 ? 23.671 145.221 42.841 1.00 60.95  ? 582 LYS G CA    1 
ATOM   3055 C  C     . LYS F 3 81 ? 25.087 145.148 43.406 1.00 63.87  ? 582 LYS G C     1 
ATOM   3056 O  O     . LYS F 3 81 ? 26.039 145.650 42.806 1.00 64.60  ? 582 LYS G O     1 
ATOM   3057 C  CB    . LYS F 3 81 ? 22.814 146.065 43.785 1.00 60.88  ? 582 LYS G CB    1 
ATOM   3058 C  CG    . LYS F 3 81 ? 21.624 146.745 43.142 1.00 62.42  ? 582 LYS G CG    1 
ATOM   3059 C  CD    . LYS F 3 81 ? 21.009 147.741 44.116 1.00 63.32  ? 582 LYS G CD    1 
ATOM   3060 C  CE    . LYS F 3 81 ? 19.869 148.526 43.487 1.00 63.47  ? 582 LYS G CE    1 
ATOM   3061 N  NZ    . LYS F 3 81 ? 19.324 149.539 44.439 1.00 63.72  ? 582 LYS G NZ    1 
ATOM   3062 N  N     . ARG F 3 82 ? 25.216 144.509 44.564 1.00 67.16  ? 583 ARG G N     1 
ATOM   3063 C  CA    . ARG F 3 82 ? 26.498 144.390 45.246 1.00 70.28  ? 583 ARG G CA    1 
ATOM   3064 C  C     . ARG F 3 82 ? 27.620 143.759 44.422 1.00 72.51  ? 583 ARG G C     1 
ATOM   3065 O  O     . ARG F 3 82 ? 28.793 144.082 44.621 1.00 73.31  ? 583 ARG G O     1 
ATOM   3066 C  CB    . ARG F 3 82 ? 26.310 143.618 46.553 1.00 70.99  ? 583 ARG G CB    1 
ATOM   3067 C  CG    . ARG F 3 82 ? 24.991 143.929 47.248 1.00 71.79  ? 583 ARG G CG    1 
ATOM   3068 C  CD    . ARG F 3 82 ? 25.036 143.620 48.735 1.00 72.56  ? 583 ARG G CD    1 
ATOM   3069 N  NE    . ARG F 3 82 ? 25.308 144.818 49.529 1.00 73.01  ? 583 ARG G NE    1 
ATOM   3070 C  CZ    . ARG F 3 82 ? 25.314 144.853 50.859 1.00 73.19  ? 583 ARG G CZ    1 
ATOM   3071 N  NH1   . ARG F 3 82 ? 25.065 143.752 51.558 1.00 72.95  ? 583 ARG G NH1   1 
ATOM   3072 N  NH2   . ARG F 3 82 ? 25.556 145.993 51.492 1.00 72.87  ? 583 ARG G NH2   1 
ATOM   3073 N  N     . ARG F 3 83 ? 27.274 142.864 43.502 1.00 74.70  ? 584 ARG G N     1 
ATOM   3074 C  CA    . ARG F 3 83 ? 28.291 142.225 42.673 1.00 77.30  ? 584 ARG G CA    1 
ATOM   3075 C  C     . ARG F 3 83 ? 28.937 143.242 41.739 1.00 77.90  ? 584 ARG G C     1 
ATOM   3076 O  O     . ARG F 3 83 ? 28.422 144.380 41.665 1.00 78.73  ? 584 ARG G O     1 
ATOM   3077 C  CB    . ARG F 3 83 ? 27.676 141.091 41.849 1.00 79.41  ? 584 ARG G CB    1 
ATOM   3078 C  CG    . ARG F 3 83 ? 27.166 139.936 42.687 1.00 81.96  ? 584 ARG G CG    1 
ATOM   3079 C  CD    . ARG F 3 83 ? 28.295 139.306 43.484 1.00 84.82  ? 584 ARG G CD    1 
ATOM   3080 N  NE    . ARG F 3 83 ? 27.791 138.499 44.589 1.00 86.79  ? 584 ARG G NE    1 
ATOM   3081 C  CZ    . ARG F 3 83 ? 28.561 137.901 45.491 1.00 87.91  ? 584 ARG G CZ    1 
ATOM   3082 N  NH1   . ARG F 3 83 ? 29.882 138.013 45.422 1.00 88.47  ? 584 ARG G NH1   1 
ATOM   3083 N  NH2   . ARG F 3 83 ? 28.008 137.204 46.472 1.00 88.56  ? 584 ARG G NH2   1 
ATOM   3084 N  N     . PRO G 3 5  ? 33.624 55.842  55.320 1.00 35.16  ? 506 PRO H N     1 
ATOM   3085 C  CA    . PRO G 3 5  ? 33.290 54.540  54.696 1.00 33.34  ? 506 PRO H CA    1 
ATOM   3086 C  C     . PRO G 3 5  ? 34.299 54.200  53.602 1.00 32.40  ? 506 PRO H C     1 
ATOM   3087 O  O     . PRO G 3 5  ? 35.087 53.264  53.741 1.00 33.92  ? 506 PRO H O     1 
ATOM   3088 C  CB    . PRO G 3 5  ? 31.884 54.670  54.127 1.00 35.08  ? 506 PRO H CB    1 
ATOM   3089 C  CG    . PRO G 3 5  ? 31.798 56.178  53.884 1.00 35.61  ? 506 PRO H CG    1 
ATOM   3090 C  CD    . PRO G 3 5  ? 32.537 56.807  55.077 1.00 35.50  ? 506 PRO H CD    1 
ATOM   3091 N  N     . PHE G 3 6  ? 34.266 54.957  52.509 1.00 28.49  ? 507 PHE H N     1 
ATOM   3092 C  CA    . PHE G 3 6  ? 35.196 54.744  51.409 1.00 25.44  ? 507 PHE H CA    1 
ATOM   3093 C  C     . PHE G 3 6  ? 35.768 56.070  50.927 1.00 24.19  ? 507 PHE H C     1 
ATOM   3094 O  O     . PHE G 3 6  ? 35.067 57.083  50.918 1.00 22.61  ? 507 PHE H O     1 
ATOM   3095 C  CB    . PHE G 3 6  ? 34.506 54.100  50.204 1.00 27.82  ? 507 PHE H CB    1 
ATOM   3096 C  CG    . PHE G 3 6  ? 33.772 52.839  50.516 1.00 27.73  ? 507 PHE H CG    1 
ATOM   3097 C  CD1   . PHE G 3 6  ? 32.446 52.874  50.929 1.00 28.07  ? 507 PHE H CD1   1 
ATOM   3098 C  CD2   . PHE G 3 6  ? 34.406 51.610  50.382 1.00 29.48  ? 507 PHE H CD2   1 
ATOM   3099 C  CE1   . PHE G 3 6  ? 31.753 51.690  51.205 1.00 28.74  ? 507 PHE H CE1   1 
ATOM   3100 C  CE2   . PHE G 3 6  ? 33.726 50.421  50.656 1.00 30.16  ? 507 PHE H CE2   1 
ATOM   3101 C  CZ    . PHE G 3 6  ? 32.399 50.462  51.067 1.00 29.01  ? 507 PHE H CZ    1 
ATOM   3102 N  N     . THR G 3 7  ? 37.033 56.043  50.523 1.00 22.49  ? 508 THR H N     1 
ATOM   3103 C  CA    . THR G 3 7  ? 37.710 57.203  49.952 1.00 21.86  ? 508 THR H CA    1 
ATOM   3104 C  C     . THR G 3 7  ? 38.522 56.564  48.848 1.00 21.43  ? 508 THR H C     1 
ATOM   3105 O  O     . THR G 3 7  ? 38.652 55.337  48.814 1.00 22.12  ? 508 THR H O     1 
ATOM   3106 C  CB    . THR G 3 7  ? 38.692 57.909  50.935 1.00 20.52  ? 508 THR H CB    1 
ATOM   3107 O  OG1   . THR G 3 7  ? 39.829 57.067  51.172 1.00 20.68  ? 508 THR H OG1   1 
ATOM   3108 C  CG2   . THR G 3 7  ? 37.992 58.235  52.253 1.00 19.47  ? 508 THR H CG2   1 
ATOM   3109 N  N     . TYR G 3 8  ? 39.068 57.359  47.938 1.00 20.93  ? 509 TYR H N     1 
ATOM   3110 C  CA    . TYR G 3 8  ? 39.848 56.759  46.877 1.00 20.81  ? 509 TYR H CA    1 
ATOM   3111 C  C     . TYR G 3 8  ? 41.052 56.036  47.452 1.00 20.35  ? 509 TYR H C     1 
ATOM   3112 O  O     . TYR G 3 8  ? 41.488 55.017  46.916 1.00 17.62  ? 509 TYR H O     1 
ATOM   3113 C  CB    . TYR G 3 8  ? 40.280 57.811  45.853 1.00 23.00  ? 509 TYR H CB    1 
ATOM   3114 C  CG    . TYR G 3 8  ? 39.170 58.110  44.882 1.00 25.39  ? 509 TYR H CG    1 
ATOM   3115 C  CD1   . TYR G 3 8  ? 38.280 59.158  45.105 1.00 27.32  ? 509 TYR H CD1   1 
ATOM   3116 C  CD2   . TYR G 3 8  ? 38.949 57.277  43.783 1.00 26.90  ? 509 TYR H CD2   1 
ATOM   3117 C  CE1   . TYR G 3 8  ? 37.192 59.367  44.258 1.00 31.08  ? 509 TYR H CE1   1 
ATOM   3118 C  CE2   . TYR G 3 8  ? 37.869 57.475  42.936 1.00 29.83  ? 509 TYR H CE2   1 
ATOM   3119 C  CZ    . TYR G 3 8  ? 36.996 58.516  43.177 1.00 31.87  ? 509 TYR H CZ    1 
ATOM   3120 O  OH    . TYR G 3 8  ? 35.923 58.694  42.337 1.00 37.09  ? 509 TYR H OH    1 
ATOM   3121 N  N     . ALA G 3 9  ? 41.573 56.557  48.557 1.00 19.94  ? 510 ALA H N     1 
ATOM   3122 C  CA    . ALA G 3 9  ? 42.729 55.947  49.200 1.00 20.86  ? 510 ALA H CA    1 
ATOM   3123 C  C     . ALA G 3 9  ? 42.395 54.567  49.760 1.00 20.48  ? 510 ALA H C     1 
ATOM   3124 O  O     . ALA G 3 9  ? 43.158 53.624  49.555 1.00 21.58  ? 510 ALA H O     1 
ATOM   3125 C  CB    . ALA G 3 9  ? 43.265 56.857  50.320 1.00 20.32  ? 510 ALA H CB    1 
ATOM   3126 N  N     . THR G 3 10 ? 41.269 54.439  50.458 1.00 21.35  ? 511 THR H N     1 
ATOM   3127 C  CA    . THR G 3 10 ? 40.898 53.135  51.026 1.00 22.90  ? 511 THR H CA    1 
ATOM   3128 C  C     . THR G 3 10 ? 40.635 52.138  49.898 1.00 23.19  ? 511 THR H C     1 
ATOM   3129 O  O     . THR G 3 10 ? 41.002 50.957  49.985 1.00 22.21  ? 511 THR H O     1 
ATOM   3130 C  CB    . THR G 3 10 ? 39.633 53.213  51.938 1.00 22.46  ? 511 THR H CB    1 
ATOM   3131 O  OG1   . THR G 3 10 ? 38.456 53.439  51.145 1.00 23.34  ? 511 THR H OG1   1 
ATOM   3132 C  CG2   . THR G 3 10 ? 39.780 54.335  52.961 1.00 21.80  ? 511 THR H CG2   1 
ATOM   3133 N  N     . LEU G 3 11 ? 40.016 52.623  48.827 1.00 22.06  ? 512 LEU H N     1 
ATOM   3134 C  CA    . LEU G 3 11 ? 39.710 51.770  47.689 1.00 21.98  ? 512 LEU H CA    1 
ATOM   3135 C  C     . LEU G 3 11 ? 40.970 51.316  46.968 1.00 22.95  ? 512 LEU H C     1 
ATOM   3136 O  O     . LEU G 3 11 ? 41.101 50.144  46.606 1.00 21.62  ? 512 LEU H O     1 
ATOM   3137 C  CB    . LEU G 3 11 ? 38.779 52.502  46.722 1.00 20.20  ? 512 LEU H CB    1 
ATOM   3138 C  CG    . LEU G 3 11 ? 37.337 52.636  47.221 1.00 20.48  ? 512 LEU H CG    1 
ATOM   3139 C  CD1   . LEU G 3 11 ? 36.542 53.526  46.277 1.00 19.68  ? 512 LEU H CD1   1 
ATOM   3140 C  CD2   . LEU G 3 11 ? 36.707 51.249  47.309 1.00 19.19  ? 512 LEU H CD2   1 
ATOM   3141 N  N     . ILE G 3 12 ? 41.895 52.245  46.742 1.00 22.17  ? 513 ILE H N     1 
ATOM   3142 C  CA    . ILE G 3 12 ? 43.143 51.906  46.077 1.00 24.34  ? 513 ILE H CA    1 
ATOM   3143 C  C     . ILE G 3 12 ? 43.886 50.884  46.931 1.00 26.22  ? 513 ILE H C     1 
ATOM   3144 O  O     . ILE G 3 12 ? 44.508 49.964  46.399 1.00 25.82  ? 513 ILE H O     1 
ATOM   3145 C  CB    . ILE G 3 12 ? 44.051 53.139  45.888 1.00 24.43  ? 513 ILE H CB    1 
ATOM   3146 C  CG1   . ILE G 3 12 ? 43.409 54.111  44.892 1.00 24.64  ? 513 ILE H CG1   1 
ATOM   3147 C  CG2   . ILE G 3 12 ? 45.433 52.702  45.386 1.00 24.42  ? 513 ILE H CG2   1 
ATOM   3148 C  CD1   . ILE G 3 12 ? 44.152 55.431  44.745 1.00 23.09  ? 513 ILE H CD1   1 
ATOM   3149 N  N     . ARG G 3 13 ? 43.824 51.048  48.251 1.00 28.45  ? 514 ARG H N     1 
ATOM   3150 C  CA    . ARG G 3 13 ? 44.502 50.114  49.145 1.00 30.87  ? 514 ARG H CA    1 
ATOM   3151 C  C     . ARG G 3 13 ? 43.828 48.752  49.088 1.00 31.60  ? 514 ARG H C     1 
ATOM   3152 O  O     . ARG G 3 13 ? 44.500 47.718  49.040 1.00 32.05  ? 514 ARG H O     1 
ATOM   3153 C  CB    . ARG G 3 13 ? 44.497 50.610  50.591 1.00 33.02  ? 514 ARG H CB    1 
ATOM   3154 C  CG    . ARG G 3 13 ? 45.014 49.555  51.564 1.00 37.67  ? 514 ARG H CG    1 
ATOM   3155 C  CD    . ARG G 3 13 ? 45.037 50.048  52.994 1.00 42.51  ? 514 ARG H CD    1 
ATOM   3156 N  NE    . ARG G 3 13 ? 45.378 48.991  53.944 1.00 46.74  ? 514 ARG H NE    1 
ATOM   3157 C  CZ    . ARG G 3 13 ? 44.575 47.978  54.257 1.00 49.10  ? 514 ARG H CZ    1 
ATOM   3158 N  NH1   . ARG G 3 13 ? 43.376 47.878  53.700 1.00 49.46  ? 514 ARG H NH1   1 
ATOM   3159 N  NH2   . ARG G 3 13 ? 44.969 47.063  55.133 1.00 50.99  ? 514 ARG H NH2   1 
ATOM   3160 N  N     . GLN G 3 14 ? 42.500 48.750  49.105 1.00 30.18  ? 515 GLN H N     1 
ATOM   3161 C  CA    . GLN G 3 14 ? 41.754 47.499  49.044 1.00 30.70  ? 515 GLN H CA    1 
ATOM   3162 C  C     . GLN G 3 14 ? 42.163 46.699  47.812 1.00 31.57  ? 515 GLN H C     1 
ATOM   3163 O  O     . GLN G 3 14 ? 42.411 45.489  47.898 1.00 31.44  ? 515 GLN H O     1 
ATOM   3164 C  CB    . GLN G 3 14 ? 40.248 47.771  48.999 1.00 31.56  ? 515 GLN H CB    1 
ATOM   3165 C  CG    . GLN G 3 14 ? 39.400 46.536  49.294 1.00 32.80  ? 515 GLN H CG    1 
ATOM   3166 C  CD    . GLN G 3 14 ? 37.906 46.776  49.128 1.00 35.03  ? 515 GLN H CD    1 
ATOM   3167 O  OE1   . GLN G 3 14 ? 37.399 47.859  49.431 1.00 34.79  ? 515 GLN H OE1   1 
ATOM   3168 N  NE2   . GLN G 3 14 ? 37.189 45.751  48.661 1.00 34.13  ? 515 GLN H NE2   1 
ATOM   3169 N  N     . ALA G 3 15 ? 42.228 47.374  46.668 1.00 33.65  ? 516 ALA H N     1 
ATOM   3170 C  CA    . ALA G 3 15 ? 42.608 46.731  45.415 1.00 36.64  ? 516 ALA H CA    1 
ATOM   3171 C  C     . ALA G 3 15 ? 43.988 46.090  45.532 1.00 39.85  ? 516 ALA H C     1 
ATOM   3172 O  O     . ALA G 3 15 ? 44.143 44.878  45.365 1.00 39.13  ? 516 ALA H O     1 
ATOM   3173 C  CB    . ALA G 3 15 ? 42.603 47.749  44.287 1.00 37.13  ? 516 ALA H CB    1 
ATOM   3174 N  N     . ILE G 3 16 ? 44.991 46.914  45.815 1.00 41.87  ? 517 ILE H N     1 
ATOM   3175 C  CA    . ILE G 3 16 ? 46.355 46.431  45.956 1.00 45.38  ? 517 ILE H CA    1 
ATOM   3176 C  C     . ILE G 3 16 ? 46.443 45.338  47.023 1.00 48.83  ? 517 ILE H C     1 
ATOM   3177 O  O     . ILE G 3 16 ? 47.036 44.286  46.794 1.00 48.63  ? 517 ILE H O     1 
ATOM   3178 C  CB    . ILE G 3 16 ? 47.308 47.588  46.329 1.00 43.89  ? 517 ILE H CB    1 
ATOM   3179 C  CG1   . ILE G 3 16 ? 47.360 48.603  45.182 1.00 43.44  ? 517 ILE H CG1   1 
ATOM   3180 C  CG2   . ILE G 3 16 ? 48.696 47.043  46.646 1.00 43.80  ? 517 ILE H CG2   1 
ATOM   3181 C  CD1   . ILE G 3 16 ? 48.173 49.839  45.490 1.00 43.04  ? 517 ILE H CD1   1 
ATOM   3182 N  N     . MET G 3 17 ? 45.835 45.590  48.177 1.00 53.83  ? 518 MET H N     1 
ATOM   3183 C  CA    . MET G 3 17 ? 45.855 44.643  49.286 1.00 59.69  ? 518 MET H CA    1 
ATOM   3184 C  C     . MET G 3 17 ? 45.217 43.301  48.941 1.00 63.27  ? 518 MET H C     1 
ATOM   3185 O  O     . MET G 3 17 ? 45.588 42.268  49.503 1.00 63.44  ? 518 MET H O     1 
ATOM   3186 C  CB    . MET G 3 17 ? 45.145 45.242  50.503 1.00 61.00  ? 518 MET H CB    1 
ATOM   3187 C  CG    . MET G 3 17 ? 45.477 44.545  51.805 1.00 63.97  ? 518 MET H CG    1 
ATOM   3188 S  SD    . MET G 3 17 ? 47.270 44.496  52.066 1.00 67.04  ? 518 MET H SD    1 
ATOM   3189 C  CE    . MET G 3 17 ? 47.528 45.999  52.967 1.00 64.98  ? 518 MET H CE    1 
ATOM   3190 N  N     . GLU G 3 18 ? 44.252 43.316  48.027 1.00 67.44  ? 519 GLU H N     1 
ATOM   3191 C  CA    . GLU G 3 18 ? 43.575 42.092  47.627 1.00 71.46  ? 519 GLU H CA    1 
ATOM   3192 C  C     . GLU G 3 18 ? 44.021 41.717  46.224 1.00 73.84  ? 519 GLU H C     1 
ATOM   3193 O  O     . GLU G 3 18 ? 43.275 41.815  45.244 1.00 75.09  ? 519 GLU H O     1 
ATOM   3194 C  CB    . GLU G 3 18 ? 42.058 42.274  47.700 1.00 71.54  ? 519 GLU H CB    1 
ATOM   3195 C  CG    . GLU G 3 18 ? 41.587 42.671  49.097 1.00 72.59  ? 519 GLU H CG    1 
ATOM   3196 C  CD    . GLU G 3 18 ? 40.075 42.812  49.200 1.00 73.02  ? 519 GLU H CD    1 
ATOM   3197 O  OE1   . GLU G 3 18 ? 39.421 42.963  48.147 1.00 72.76  ? 519 GLU H OE1   1 
ATOM   3198 O  OE2   . GLU G 3 18 ? 39.548 42.784  50.334 1.00 72.94  ? 519 GLU H OE2   1 
ATOM   3199 N  N     . SER G 3 19 ? 45.274 41.287  46.166 1.00 76.65  ? 520 SER H N     1 
ATOM   3200 C  CA    . SER G 3 19 ? 45.936 40.864  44.946 1.00 79.43  ? 520 SER H CA    1 
ATOM   3201 C  C     . SER G 3 19 ? 47.233 40.221  45.426 1.00 81.23  ? 520 SER H C     1 
ATOM   3202 O  O     . SER G 3 19 ? 47.861 40.721  46.366 1.00 81.36  ? 520 SER H O     1 
ATOM   3203 C  CB    . SER G 3 19 ? 46.262 42.074  44.074 1.00 79.53  ? 520 SER H CB    1 
ATOM   3204 O  OG    . SER G 3 19 ? 47.282 42.862  44.672 1.00 80.07  ? 520 SER H OG    1 
ATOM   3205 N  N     . SER G 3 20 ? 47.607 39.103  44.803 1.00 83.14  ? 521 SER H N     1 
ATOM   3206 C  CA    . SER G 3 20 ? 48.835 38.385  45.140 1.00 85.07  ? 521 SER H CA    1 
ATOM   3207 C  C     . SER G 3 20 ? 50.041 39.163  44.639 1.00 85.98  ? 521 SER H C     1 
ATOM   3208 O  O     . SER G 3 20 ? 50.099 39.566  43.481 1.00 86.60  ? 521 SER H O     1 
ATOM   3209 C  CB    . SER G 3 20 ? 48.837 36.981  44.526 1.00 85.60  ? 521 SER H CB    1 
ATOM   3210 O  OG    . SER G 3 20 ? 49.976 36.243  44.936 1.00 86.80  ? 521 SER H OG    1 
ATOM   3211 N  N     . ASP G 3 21 ? 50.993 39.345  45.549 1.00 86.39  ? 522 ASP H N     1 
ATOM   3212 C  CA    . ASP G 3 21 ? 52.239 40.087  45.352 1.00 86.23  ? 522 ASP H CA    1 
ATOM   3213 C  C     . ASP G 3 21 ? 52.022 41.500  45.857 1.00 85.00  ? 522 ASP H C     1 
ATOM   3214 O  O     . ASP G 3 21 ? 52.916 42.336  45.777 1.00 85.43  ? 522 ASP H O     1 
ATOM   3215 C  CB    . ASP G 3 21 ? 52.658 40.148  43.880 1.00 87.86  ? 522 ASP H CB    1 
ATOM   3216 C  CG    . ASP G 3 21 ? 52.984 38.787  43.305 1.00 89.14  ? 522 ASP H CG    1 
ATOM   3217 O  OD1   . ASP G 3 21 ? 53.405 38.742  42.132 1.00 90.09  ? 522 ASP H OD1   1 
ATOM   3218 O  OD2   . ASP G 3 21 ? 52.823 37.775  44.020 1.00 89.78  ? 522 ASP H OD2   1 
ATOM   3219 N  N     . ARG G 3 22 ? 50.814 41.758  46.350 1.00 83.04  ? 523 ARG H N     1 
ATOM   3220 C  CA    . ARG G 3 22 ? 50.436 43.070  46.869 1.00 80.26  ? 523 ARG H CA    1 
ATOM   3221 C  C     . ARG G 3 22 ? 50.941 44.228  46.015 1.00 76.31  ? 523 ARG H C     1 
ATOM   3222 O  O     . ARG G 3 22 ? 51.397 45.250  46.530 1.00 75.80  ? 523 ARG H O     1 
ATOM   3223 C  CB    . ARG G 3 22 ? 50.926 43.231  48.308 1.00 83.78  ? 523 ARG H CB    1 
ATOM   3224 C  CG    . ARG G 3 22 ? 50.320 42.214  49.263 1.00 87.96  ? 523 ARG H CG    1 
ATOM   3225 C  CD    . ARG G 3 22 ? 50.699 42.522  50.697 1.00 91.77  ? 523 ARG H CD    1 
ATOM   3226 N  NE    . ARG G 3 22 ? 50.136 41.562  51.640 1.00 94.54  ? 523 ARG H NE    1 
ATOM   3227 C  CZ    . ARG G 3 22 ? 50.292 41.640  52.957 1.00 95.93  ? 523 ARG H CZ    1 
ATOM   3228 N  NH1   . ARG G 3 22 ? 50.994 42.635  53.482 1.00 96.68  ? 523 ARG H NH1   1 
ATOM   3229 N  NH2   . ARG G 3 22 ? 49.750 40.725  53.750 1.00 96.85  ? 523 ARG H NH2   1 
ATOM   3230 N  N     . GLN G 3 23 ? 50.856 44.054  44.701 1.00 71.44  ? 524 GLN H N     1 
ATOM   3231 C  CA    . GLN G 3 23 ? 51.283 45.073  43.752 1.00 66.63  ? 524 GLN H CA    1 
ATOM   3232 C  C     . GLN G 3 23 ? 50.286 45.130  42.606 1.00 62.36  ? 524 GLN H C     1 
ATOM   3233 O  O     . GLN G 3 23 ? 49.599 44.151  42.324 1.00 61.63  ? 524 GLN H O     1 
ATOM   3234 C  CB    . GLN G 3 23 ? 52.662 44.748  43.178 1.00 67.70  ? 524 GLN H CB    1 
ATOM   3235 C  CG    . GLN G 3 23 ? 53.769 44.626  44.196 1.00 68.33  ? 524 GLN H CG    1 
ATOM   3236 C  CD    . GLN G 3 23 ? 55.108 44.359  43.542 1.00 68.51  ? 524 GLN H CD    1 
ATOM   3237 O  OE1   . GLN G 3 23 ? 55.236 43.454  42.718 1.00 67.95  ? 524 GLN H OE1   1 
ATOM   3238 N  NE2   . GLN G 3 23 ? 56.115 45.146  43.907 1.00 68.60  ? 524 GLN H NE2   1 
ATOM   3239 N  N     . LEU G 3 24 ? 50.216 46.283  41.952 1.00 56.67  ? 525 LEU H N     1 
ATOM   3240 C  CA    . LEU G 3 24 ? 49.317 46.475  40.824 1.00 50.77  ? 525 LEU H CA    1 
ATOM   3241 C  C     . LEU G 3 24 ? 49.807 47.627  39.967 1.00 47.35  ? 525 LEU H C     1 
ATOM   3242 O  O     . LEU G 3 24 ? 50.239 48.657  40.482 1.00 46.59  ? 525 LEU H O     1 
ATOM   3243 C  CB    . LEU G 3 24 ? 47.892 46.785  41.300 1.00 50.25  ? 525 LEU H CB    1 
ATOM   3244 C  CG    . LEU G 3 24 ? 47.083 45.709  42.029 1.00 49.18  ? 525 LEU H CG    1 
ATOM   3245 C  CD1   . LEU G 3 24 ? 45.714 46.265  42.393 1.00 47.87  ? 525 LEU H CD1   1 
ATOM   3246 C  CD2   . LEU G 3 24 ? 46.934 44.483  41.142 1.00 49.88  ? 525 LEU H CD2   1 
ATOM   3247 N  N     . THR G 3 25 ? 49.753 47.446  38.655 1.00 42.87  ? 526 THR H N     1 
ATOM   3248 C  CA    . THR G 3 25 ? 50.158 48.496  37.733 1.00 39.66  ? 526 THR H CA    1 
ATOM   3249 C  C     . THR G 3 25 ? 48.981 49.465  37.692 1.00 37.94  ? 526 THR H C     1 
ATOM   3250 O  O     . THR G 3 25 ? 47.885 49.121  38.144 1.00 36.36  ? 526 THR H O     1 
ATOM   3251 C  CB    . THR G 3 25 ? 50.374 47.936  36.321 1.00 40.99  ? 526 THR H CB    1 
ATOM   3252 O  OG1   . THR G 3 25 ? 49.133 47.427  35.819 1.00 39.98  ? 526 THR H OG1   1 
ATOM   3253 C  CG2   . THR G 3 25 ? 51.397 46.815  36.346 1.00 39.60  ? 526 THR H CG2   1 
ATOM   3254 N  N     . LEU G 3 26 ? 49.193 50.657  37.149 1.00 36.57  ? 527 LEU H N     1 
ATOM   3255 C  CA    . LEU G 3 26 ? 48.113 51.629  37.067 1.00 36.32  ? 527 LEU H CA    1 
ATOM   3256 C  C     . LEU G 3 26 ? 46.947 51.055  36.265 1.00 35.71  ? 527 LEU H C     1 
ATOM   3257 O  O     . LEU G 3 26 ? 45.786 51.318  36.570 1.00 34.91  ? 527 LEU H O     1 
ATOM   3258 C  CB    . LEU G 3 26 ? 48.590 52.928  36.412 1.00 36.72  ? 527 LEU H CB    1 
ATOM   3259 C  CG    . LEU G 3 26 ? 47.483 53.979  36.235 1.00 38.73  ? 527 LEU H CG    1 
ATOM   3260 C  CD1   . LEU G 3 26 ? 46.904 54.355  37.598 1.00 38.99  ? 527 LEU H CD1   1 
ATOM   3261 C  CD2   . LEU G 3 26 ? 48.035 55.210  35.531 1.00 39.53  ? 527 LEU H CD2   1 
ATOM   3262 N  N     . ASN G 3 27 ? 47.250 50.267  35.240 1.00 34.74  ? 528 ASN H N     1 
ATOM   3263 C  CA    . ASN G 3 27 ? 46.183 49.693  34.432 1.00 33.20  ? 528 ASN H CA    1 
ATOM   3264 C  C     . ASN G 3 27 ? 45.380 48.664  35.215 1.00 31.80  ? 528 ASN H C     1 
ATOM   3265 O  O     . ASN G 3 27 ? 44.163 48.559  35.044 1.00 30.58  ? 528 ASN H O     1 
ATOM   3266 C  CB    . ASN G 3 27 ? 46.736 49.042  33.166 1.00 35.95  ? 528 ASN H CB    1 
ATOM   3267 C  CG    . ASN G 3 27 ? 45.634 48.619  32.213 1.00 37.01  ? 528 ASN H CG    1 
ATOM   3268 O  OD1   . ASN G 3 27 ? 44.885 49.454  31.705 1.00 37.69  ? 528 ASN H OD1   1 
ATOM   3269 N  ND2   . ASN G 3 27 ? 45.519 47.318  31.977 1.00 38.22  ? 528 ASN H ND2   1 
ATOM   3270 N  N     . GLU G 3 28 ? 46.065 47.906  36.065 1.00 29.29  ? 529 GLU H N     1 
ATOM   3271 C  CA    . GLU G 3 28 ? 45.420 46.886  36.886 1.00 30.11  ? 529 GLU H CA    1 
ATOM   3272 C  C     . GLU G 3 28 ? 44.515 47.531  37.935 1.00 28.49  ? 529 GLU H C     1 
ATOM   3273 O  O     . GLU G 3 28 ? 43.458 46.992  38.285 1.00 26.62  ? 529 GLU H O     1 
ATOM   3274 C  CB    . GLU G 3 28 ? 46.482 46.020  37.563 1.00 33.91  ? 529 GLU H CB    1 
ATOM   3275 C  CG    . GLU G 3 28 ? 47.207 45.091  36.604 1.00 40.52  ? 529 GLU H CG    1 
ATOM   3276 C  CD    . GLU G 3 28 ? 48.401 44.410  37.243 1.00 44.11  ? 529 GLU H CD    1 
ATOM   3277 O  OE1   . GLU G 3 28 ? 48.439 44.315  38.488 1.00 45.25  ? 529 GLU H OE1   1 
ATOM   3278 O  OE2   . GLU G 3 28 ? 49.295 43.959  36.496 1.00 47.71  ? 529 GLU H OE2   1 
ATOM   3279 N  N     . ILE G 3 29 ? 44.938 48.682  38.448 1.00 25.84  ? 530 ILE H N     1 
ATOM   3280 C  CA    . ILE G 3 29 ? 44.131 49.401  39.420 1.00 23.57  ? 530 ILE H CA    1 
ATOM   3281 C  C     . ILE G 3 29 ? 42.895 49.890  38.676 1.00 22.24  ? 530 ILE H C     1 
ATOM   3282 O  O     . ILE G 3 29 ? 41.783 49.792  39.189 1.00 21.14  ? 530 ILE H O     1 
ATOM   3283 C  CB    . ILE G 3 29 ? 44.907 50.595  40.029 1.00 23.98  ? 530 ILE H CB    1 
ATOM   3284 C  CG1   . ILE G 3 29 ? 46.006 50.061  40.953 1.00 24.60  ? 530 ILE H CG1   1 
ATOM   3285 C  CG2   . ILE G 3 29 ? 43.947 51.514  40.784 1.00 22.40  ? 530 ILE H CG2   1 
ATOM   3286 C  CD1   . ILE G 3 29 ? 46.955 51.125  41.478 1.00 27.94  ? 530 ILE H CD1   1 
ATOM   3287 N  N     . TYR G 3 30 ? 43.092 50.409  37.466 1.00 21.44  ? 531 TYR H N     1 
ATOM   3288 C  CA    . TYR G 3 30 ? 41.974 50.872  36.648 1.00 23.98  ? 531 TYR H CA    1 
ATOM   3289 C  C     . TYR G 3 30 ? 40.959 49.737  36.441 1.00 23.62  ? 531 TYR H C     1 
ATOM   3290 O  O     . TYR G 3 30 ? 39.745 49.941  36.529 1.00 20.23  ? 531 TYR H O     1 
ATOM   3291 C  CB    . TYR G 3 30 ? 42.469 51.344  35.279 1.00 25.83  ? 531 TYR H CB    1 
ATOM   3292 C  CG    . TYR G 3 30 ? 43.029 52.751  35.234 1.00 30.05  ? 531 TYR H CG    1 
ATOM   3293 C  CD1   . TYR G 3 30 ? 43.506 53.284  34.037 1.00 32.38  ? 531 TYR H CD1   1 
ATOM   3294 C  CD2   . TYR G 3 30 ? 43.066 53.558  36.375 1.00 30.43  ? 531 TYR H CD2   1 
ATOM   3295 C  CE1   . TYR G 3 30 ? 44.005 54.584  33.968 1.00 35.40  ? 531 TYR H CE1   1 
ATOM   3296 C  CE2   . TYR G 3 30 ? 43.561 54.861  36.318 1.00 33.72  ? 531 TYR H CE2   1 
ATOM   3297 C  CZ    . TYR G 3 30 ? 44.029 55.368  35.110 1.00 35.95  ? 531 TYR H CZ    1 
ATOM   3298 O  OH    . TYR G 3 30 ? 44.522 56.655  35.036 1.00 36.67  ? 531 TYR H OH    1 
ATOM   3299 N  N     . SER G 3 31 ? 41.461 48.543  36.141 1.00 23.83  ? 532 SER H N     1 
ATOM   3300 C  CA    . SER G 3 31 ? 40.584 47.393  35.931 1.00 24.54  ? 532 SER H CA    1 
ATOM   3301 C  C     . SER G 3 31 ? 39.761 47.101  37.177 1.00 23.81  ? 532 SER H C     1 
ATOM   3302 O  O     . SER G 3 31 ? 38.558 46.836  37.085 1.00 23.81  ? 532 SER H O     1 
ATOM   3303 C  CB    . SER G 3 31 ? 41.397 46.148  35.569 1.00 25.74  ? 532 SER H CB    1 
ATOM   3304 O  OG    . SER G 3 31 ? 42.055 46.324  34.334 1.00 30.45  ? 532 SER H OG    1 
ATOM   3305 N  N     . TRP G 3 32 ? 40.412 47.142  38.338 1.00 22.87  ? 533 TRP H N     1 
ATOM   3306 C  CA    . TRP G 3 32 ? 39.728 46.882  39.600 1.00 21.80  ? 533 TRP H CA    1 
ATOM   3307 C  C     . TRP G 3 32 ? 38.638 47.932  39.834 1.00 21.28  ? 533 TRP H C     1 
ATOM   3308 O  O     . TRP G 3 32 ? 37.518 47.598  40.228 1.00 21.71  ? 533 TRP H O     1 
ATOM   3309 C  CB    . TRP G 3 32 ? 40.731 46.885  40.762 1.00 22.31  ? 533 TRP H CB    1 
ATOM   3310 C  CG    . TRP G 3 32 ? 40.152 46.425  42.067 1.00 22.23  ? 533 TRP H CG    1 
ATOM   3311 C  CD1   . TRP G 3 32 ? 40.150 45.151  42.565 1.00 24.27  ? 533 TRP H CD1   1 
ATOM   3312 C  CD2   . TRP G 3 32 ? 39.491 47.237  43.041 1.00 21.20  ? 533 TRP H CD2   1 
ATOM   3313 N  NE1   . TRP G 3 32 ? 39.532 45.122  43.794 1.00 23.63  ? 533 TRP H NE1   1 
ATOM   3314 C  CE2   . TRP G 3 32 ? 39.117 46.391  44.108 1.00 22.68  ? 533 TRP H CE2   1 
ATOM   3315 C  CE3   . TRP G 3 32 ? 39.177 48.599  43.114 1.00 20.63  ? 533 TRP H CE3   1 
ATOM   3316 C  CZ2   . TRP G 3 32 ? 38.445 46.866  45.243 1.00 22.22  ? 533 TRP H CZ2   1 
ATOM   3317 C  CZ3   . TRP G 3 32 ? 38.507 49.073  44.244 1.00 19.74  ? 533 TRP H CZ3   1 
ATOM   3318 C  CH2   . TRP G 3 32 ? 38.150 48.205  45.293 1.00 21.97  ? 533 TRP H CH2   1 
ATOM   3319 N  N     . PHE G 3 33 ? 38.952 49.204  39.602 1.00 20.27  ? 534 PHE H N     1 
ATOM   3320 C  CA    . PHE G 3 33 ? 37.935 50.239  39.777 1.00 20.05  ? 534 PHE H CA    1 
ATOM   3321 C  C     . PHE G 3 33 ? 36.789 50.065  38.779 1.00 19.80  ? 534 PHE H C     1 
ATOM   3322 O  O     . PHE G 3 33 ? 35.628 50.274  39.124 1.00 20.21  ? 534 PHE H O     1 
ATOM   3323 C  CB    . PHE G 3 33 ? 38.543 51.637  39.621 1.00 18.83  ? 534 PHE H CB    1 
ATOM   3324 C  CG    . PHE G 3 33 ? 39.080 52.207  40.905 1.00 20.03  ? 534 PHE H CG    1 
ATOM   3325 C  CD1   . PHE G 3 33 ? 38.401 53.228  41.561 1.00 21.30  ? 534 PHE H CD1   1 
ATOM   3326 C  CD2   . PHE G 3 33 ? 40.256 51.713  41.464 1.00 19.11  ? 534 PHE H CD2   1 
ATOM   3327 C  CE1   . PHE G 3 33 ? 38.884 53.755  42.759 1.00 22.53  ? 534 PHE H CE1   1 
ATOM   3328 C  CE2   . PHE G 3 33 ? 40.750 52.231  42.665 1.00 20.75  ? 534 PHE H CE2   1 
ATOM   3329 C  CZ    . PHE G 3 33 ? 40.060 53.256  43.312 1.00 21.03  ? 534 PHE H CZ    1 
ATOM   3330 N  N     . THR G 3 34 ? 37.110 49.700  37.539 1.00 21.83  ? 535 THR H N     1 
ATOM   3331 C  CA    . THR G 3 34 ? 36.069 49.499  36.529 1.00 22.53  ? 535 THR H CA    1 
ATOM   3332 C  C     . THR G 3 34 ? 35.087 48.436  37.035 1.00 22.33  ? 535 THR H C     1 
ATOM   3333 O  O     . THR G 3 34 ? 33.872 48.634  37.007 1.00 22.18  ? 535 THR H O     1 
ATOM   3334 C  CB    . THR G 3 34 ? 36.667 49.037  35.178 1.00 22.82  ? 535 THR H CB    1 
ATOM   3335 O  OG1   . THR G 3 34 ? 37.522 50.060  34.654 1.00 24.10  ? 535 THR H OG1   1 
ATOM   3336 C  CG2   . THR G 3 34 ? 35.553 48.762  34.166 1.00 24.49  ? 535 THR H CG2   1 
ATOM   3337 N  N     . ARG G 3 35 ? 35.620 47.314  37.505 1.00 23.98  ? 536 ARG H N     1 
ATOM   3338 C  CA    . ARG G 3 35 ? 34.778 46.240  38.039 1.00 25.67  ? 536 ARG H CA    1 
ATOM   3339 C  C     . ARG G 3 35 ? 33.952 46.749  39.212 1.00 23.96  ? 536 ARG H C     1 
ATOM   3340 O  O     . ARG G 3 35 ? 32.759 46.481  39.319 1.00 22.77  ? 536 ARG H O     1 
ATOM   3341 C  CB    . ARG G 3 35 ? 35.630 45.074  38.550 1.00 32.36  ? 536 ARG H CB    1 
ATOM   3342 C  CG    . ARG G 3 35 ? 36.043 44.037  37.527 1.00 41.89  ? 536 ARG H CG    1 
ATOM   3343 C  CD    . ARG G 3 35 ? 36.614 42.829  38.255 1.00 50.20  ? 536 ARG H CD    1 
ATOM   3344 N  NE    . ARG G 3 35 ? 36.936 41.716  37.367 1.00 59.45  ? 536 ARG H NE    1 
ATOM   3345 C  CZ    . ARG G 3 35 ? 37.311 40.514  37.795 1.00 63.93  ? 536 ARG H CZ    1 
ATOM   3346 N  NH1   . ARG G 3 35 ? 37.407 40.277  39.097 1.00 65.86  ? 536 ARG H NH1   1 
ATOM   3347 N  NH2   . ARG G 3 35 ? 37.590 39.548  36.926 1.00 65.65  ? 536 ARG H NH2   1 
ATOM   3348 N  N     . THR G 3 36 ? 34.600 47.484  40.105 1.00 21.33  ? 537 THR H N     1 
ATOM   3349 C  CA    . THR G 3 36 ? 33.920 47.997  41.285 1.00 18.38  ? 537 THR H CA    1 
ATOM   3350 C  C     . THR G 3 36 ? 32.790 48.969  40.975 1.00 18.39  ? 537 THR H C     1 
ATOM   3351 O  O     . THR G 3 36 ? 31.673 48.812  41.472 1.00 16.91  ? 537 THR H O     1 
ATOM   3352 C  CB    . THR G 3 36 ? 34.943 48.647  42.243 1.00 17.86  ? 537 THR H CB    1 
ATOM   3353 O  OG1   . THR G 3 36 ? 35.871 47.646  42.672 1.00 18.15  ? 537 THR H OG1   1 
ATOM   3354 C  CG2   . THR G 3 36 ? 34.267 49.234  43.458 1.00 16.96  ? 537 THR H CG2   1 
ATOM   3355 N  N     . PHE G 3 37 ? 33.055 49.976  40.156 1.00 19.16  ? 538 PHE H N     1 
ATOM   3356 C  CA    . PHE G 3 37 ? 31.998 50.920  39.842 1.00 19.83  ? 538 PHE H CA    1 
ATOM   3357 C  C     . PHE G 3 37 ? 30.894 50.259  39.039 1.00 20.17  ? 538 PHE H C     1 
ATOM   3358 O  O     . PHE G 3 37 ? 29.733 50.641  39.157 1.00 18.92  ? 538 PHE H O     1 
ATOM   3359 C  CB    . PHE G 3 37 ? 32.552 52.142  39.108 1.00 21.35  ? 538 PHE H CB    1 
ATOM   3360 C  CG    . PHE G 3 37 ? 33.163 53.158  40.034 1.00 24.73  ? 538 PHE H CG    1 
ATOM   3361 C  CD1   . PHE G 3 37 ? 34.337 52.864  40.724 1.00 24.37  ? 538 PHE H CD1   1 
ATOM   3362 C  CD2   . PHE G 3 37 ? 32.534 54.384  40.267 1.00 26.03  ? 538 PHE H CD2   1 
ATOM   3363 C  CE1   . PHE G 3 37 ? 34.883 53.774  41.639 1.00 28.13  ? 538 PHE H CE1   1 
ATOM   3364 C  CE2   . PHE G 3 37 ? 33.071 55.305  41.180 1.00 26.31  ? 538 PHE H CE2   1 
ATOM   3365 C  CZ    . PHE G 3 37 ? 34.247 54.997  41.867 1.00 26.49  ? 538 PHE H CZ    1 
ATOM   3366 N  N     . ALA G 3 38 ? 31.256 49.258  38.241 1.00 20.00  ? 539 ALA H N     1 
ATOM   3367 C  CA    . ALA G 3 38 ? 30.268 48.539  37.440 1.00 19.97  ? 539 ALA H CA    1 
ATOM   3368 C  C     . ALA G 3 38 ? 29.293 47.845  38.383 1.00 20.24  ? 539 ALA H C     1 
ATOM   3369 O  O     . ALA G 3 38 ? 28.087 47.880  38.165 1.00 19.68  ? 539 ALA H O     1 
ATOM   3370 C  CB    . ALA G 3 38 ? 30.951 47.509  36.545 1.00 22.07  ? 539 ALA H CB    1 
ATOM   3371 N  N     . TYR G 3 39 ? 29.823 47.207  39.430 1.00 17.72  ? 540 TYR H N     1 
ATOM   3372 C  CA    . TYR G 3 39 ? 28.987 46.520  40.410 1.00 18.11  ? 540 TYR H CA    1 
ATOM   3373 C  C     . TYR G 3 39 ? 27.894 47.427  40.973 1.00 18.42  ? 540 TYR H C     1 
ATOM   3374 O  O     . TYR G 3 39 ? 26.715 47.055  41.001 1.00 17.38  ? 540 TYR H O     1 
ATOM   3375 C  CB    . TYR G 3 39 ? 29.846 45.994  41.571 1.00 17.21  ? 540 TYR H CB    1 
ATOM   3376 C  CG    . TYR G 3 39 ? 29.055 45.342  42.691 1.00 16.56  ? 540 TYR H CG    1 
ATOM   3377 C  CD1   . TYR G 3 39 ? 28.660 44.005  42.609 1.00 16.32  ? 540 TYR H CD1   1 
ATOM   3378 C  CD2   . TYR G 3 39 ? 28.685 46.070  43.825 1.00 17.02  ? 540 TYR H CD2   1 
ATOM   3379 C  CE1   . TYR G 3 39 ? 27.920 43.407  43.629 1.00 15.35  ? 540 TYR H CE1   1 
ATOM   3380 C  CE2   . TYR G 3 39 ? 27.943 45.485  44.846 1.00 15.03  ? 540 TYR H CE2   1 
ATOM   3381 C  CZ    . TYR G 3 39 ? 27.565 44.151  44.737 1.00 17.11  ? 540 TYR H CZ    1 
ATOM   3382 O  OH    . TYR G 3 39 ? 26.839 43.582  45.745 1.00 16.11  ? 540 TYR H OH    1 
ATOM   3383 N  N     . PHE G 3 40 ? 28.273 48.616  41.435 1.00 17.67  ? 541 PHE H N     1 
ATOM   3384 C  CA    . PHE G 3 40 ? 27.287 49.516  42.009 1.00 19.38  ? 541 PHE H CA    1 
ATOM   3385 C  C     . PHE G 3 40 ? 26.297 50.068  40.986 1.00 21.37  ? 541 PHE H C     1 
ATOM   3386 O  O     . PHE G 3 40 ? 25.141 50.324  41.318 1.00 21.75  ? 541 PHE H O     1 
ATOM   3387 C  CB    . PHE G 3 40 ? 27.990 50.643  42.783 1.00 19.13  ? 541 PHE H CB    1 
ATOM   3388 C  CG    . PHE G 3 40 ? 28.680 50.159  44.026 1.00 17.27  ? 541 PHE H CG    1 
ATOM   3389 C  CD1   . PHE G 3 40 ? 30.037 49.842  44.010 1.00 17.93  ? 541 PHE H CD1   1 
ATOM   3390 C  CD2   . PHE G 3 40 ? 27.948 49.917  45.184 1.00 17.23  ? 541 PHE H CD2   1 
ATOM   3391 C  CE1   . PHE G 3 40 ? 30.646 49.280  45.132 1.00 18.77  ? 541 PHE H CE1   1 
ATOM   3392 C  CE2   . PHE G 3 40 ? 28.553 49.350  46.317 1.00 17.16  ? 541 PHE H CE2   1 
ATOM   3393 C  CZ    . PHE G 3 40 ? 29.905 49.031  46.283 1.00 17.32  ? 541 PHE H CZ    1 
ATOM   3394 N  N     . ARG G 3 41 ? 26.734 50.208  39.737 1.00 21.38  ? 542 ARG H N     1 
ATOM   3395 C  CA    . ARG G 3 41 ? 25.855 50.719  38.686 1.00 24.25  ? 542 ARG H CA    1 
ATOM   3396 C  C     . ARG G 3 41 ? 24.791 49.652  38.381 1.00 23.13  ? 542 ARG H C     1 
ATOM   3397 O  O     . ARG G 3 41 ? 23.586 49.934  38.320 1.00 22.16  ? 542 ARG H O     1 
ATOM   3398 C  CB    . ARG G 3 41 ? 26.662 51.002  37.420 1.00 28.05  ? 542 ARG H CB    1 
ATOM   3399 C  CG    . ARG G 3 41 ? 25.844 51.559  36.267 1.00 34.67  ? 542 ARG H CG    1 
ATOM   3400 C  CD    . ARG G 3 41 ? 26.692 51.695  35.010 1.00 39.94  ? 542 ARG H CD    1 
ATOM   3401 N  NE    . ARG G 3 41 ? 25.901 52.118  33.858 1.00 46.80  ? 542 ARG H NE    1 
ATOM   3402 C  CZ    . ARG G 3 41 ? 26.374 52.231  32.618 1.00 49.92  ? 542 ARG H CZ    1 
ATOM   3403 N  NH1   . ARG G 3 41 ? 27.647 51.953  32.354 1.00 50.76  ? 542 ARG H NH1   1 
ATOM   3404 N  NH2   . ARG G 3 41 ? 25.571 52.620  31.636 1.00 51.68  ? 542 ARG H NH2   1 
ATOM   3405 N  N     . ARG G 3 42 ? 25.260 48.421  38.195 1.00 22.83  ? 543 ARG H N     1 
ATOM   3406 C  CA    . ARG G 3 42 ? 24.400 47.273  37.893 1.00 23.60  ? 543 ARG H CA    1 
ATOM   3407 C  C     . ARG G 3 42 ? 23.308 47.049  38.918 1.00 23.64  ? 543 ARG H C     1 
ATOM   3408 O  O     . ARG G 3 42 ? 22.176 46.733  38.576 1.00 24.73  ? 543 ARG H O     1 
ATOM   3409 C  CB    . ARG G 3 42 ? 25.219 45.981  37.852 1.00 24.20  ? 543 ARG H CB    1 
ATOM   3410 C  CG    . ARG G 3 42 ? 25.885 45.651  36.542 1.00 27.65  ? 543 ARG H CG    1 
ATOM   3411 C  CD    . ARG G 3 42 ? 26.094 44.123  36.432 1.00 26.02  ? 543 ARG H CD    1 
ATOM   3412 N  NE    . ARG G 3 42 ? 26.930 43.598  37.512 1.00 25.85  ? 543 ARG H NE    1 
ATOM   3413 C  CZ    . ARG G 3 42 ? 28.238 43.814  37.615 1.00 24.03  ? 543 ARG H CZ    1 
ATOM   3414 N  NH1   . ARG G 3 42 ? 28.862 44.547  36.705 1.00 23.01  ? 543 ARG H NH1   1 
ATOM   3415 N  NH2   . ARG G 3 42 ? 28.928 43.279  38.611 1.00 23.60  ? 543 ARG H NH2   1 
ATOM   3416 N  N     . ASN G 3 43 ? 23.666 47.211  40.185 1.00 22.63  ? 544 ASN H N     1 
ATOM   3417 C  CA    . ASN G 3 43 ? 22.743 46.945  41.278 1.00 22.73  ? 544 ASN H CA    1 
ATOM   3418 C  C     . ASN G 3 43 ? 22.143 48.156  41.989 1.00 22.22  ? 544 ASN H C     1 
ATOM   3419 O  O     . ASN G 3 43 ? 21.610 48.032  43.088 1.00 20.14  ? 544 ASN H O     1 
ATOM   3420 C  CB    . ASN G 3 43 ? 23.470 46.027  42.258 1.00 21.49  ? 544 ASN H CB    1 
ATOM   3421 C  CG    . ASN G 3 43 ? 24.092 44.841  41.552 1.00 23.84  ? 544 ASN H CG    1 
ATOM   3422 O  OD1   . ASN G 3 43 ? 25.319 44.648  41.555 1.00 23.52  ? 544 ASN H OD1   1 
ATOM   3423 N  ND2   . ASN G 3 43 ? 23.240 44.044  40.905 1.00 19.40  ? 544 ASN H ND2   1 
ATOM   3424 N  N     . ALA G 3 44 ? 22.210 49.323  41.356 1.00 22.59  ? 545 ALA H N     1 
ATOM   3425 C  CA    . ALA G 3 44 ? 21.683 50.544  41.959 1.00 23.71  ? 545 ALA H CA    1 
ATOM   3426 C  C     . ALA G 3 44 ? 20.192 50.466  42.303 1.00 24.93  ? 545 ALA H C     1 
ATOM   3427 O  O     . ALA G 3 44 ? 19.726 51.167  43.195 1.00 24.36  ? 545 ALA H O     1 
ATOM   3428 C  CB    . ALA G 3 44 ? 21.942 51.724  41.030 1.00 23.74  ? 545 ALA H CB    1 
ATOM   3429 N  N     . ALA G 3 45 ? 19.437 49.617  41.613 1.00 25.46  ? 546 ALA H N     1 
ATOM   3430 C  CA    . ALA G 3 45 ? 18.006 49.537  41.893 1.00 25.27  ? 546 ALA H CA    1 
ATOM   3431 C  C     . ALA G 3 45 ? 17.569 48.242  42.560 1.00 25.49  ? 546 ALA H C     1 
ATOM   3432 O  O     . ALA G 3 45 ? 16.393 48.066  42.858 1.00 27.97  ? 546 ALA H O     1 
ATOM   3433 C  CB    . ALA G 3 45 ? 17.217 49.742  40.602 1.00 26.06  ? 546 ALA H CB    1 
ATOM   3434 N  N     . THR G 3 46 ? 18.508 47.342  42.817 1.00 24.06  ? 547 THR H N     1 
ATOM   3435 C  CA    . THR G 3 46 ? 18.156 46.064  43.412 1.00 23.46  ? 547 THR H CA    1 
ATOM   3436 C  C     . THR G 3 46 ? 18.672 45.827  44.827 1.00 23.09  ? 547 THR H C     1 
ATOM   3437 O  O     . THR G 3 46 ? 18.218 44.900  45.499 1.00 21.93  ? 547 THR H O     1 
ATOM   3438 C  CB    . THR G 3 46 ? 18.691 44.902  42.553 1.00 25.30  ? 547 THR H CB    1 
ATOM   3439 O  OG1   . THR G 3 46 ? 20.106 45.067  42.371 1.00 26.68  ? 547 THR H OG1   1 
ATOM   3440 C  CG2   . THR G 3 46 ? 18.014 44.867  41.193 1.00 26.09  ? 547 THR H CG2   1 
ATOM   3441 N  N     . TRP G 3 47 ? 19.602 46.659  45.288 1.00 22.25  ? 548 TRP H N     1 
ATOM   3442 C  CA    . TRP G 3 47 ? 20.194 46.430  46.595 1.00 21.64  ? 548 TRP H CA    1 
ATOM   3443 C  C     . TRP G 3 47 ? 19.254 46.306  47.791 1.00 20.85  ? 548 TRP H C     1 
ATOM   3444 O  O     . TRP G 3 47 ? 19.556 45.561  48.718 1.00 21.30  ? 548 TRP H O     1 
ATOM   3445 C  CB    . TRP G 3 47 ? 21.299 47.463  46.888 1.00 20.28  ? 548 TRP H CB    1 
ATOM   3446 C  CG    . TRP G 3 47 ? 20.874 48.890  47.024 1.00 20.99  ? 548 TRP H CG    1 
ATOM   3447 C  CD1   . TRP G 3 47 ? 21.017 49.882  46.095 1.00 21.22  ? 548 TRP H CD1   1 
ATOM   3448 C  CD2   . TRP G 3 47 ? 20.323 49.507  48.190 1.00 22.85  ? 548 TRP H CD2   1 
ATOM   3449 N  NE1   . TRP G 3 47 ? 20.598 51.086  46.616 1.00 23.64  ? 548 TRP H NE1   1 
ATOM   3450 C  CE2   . TRP G 3 47 ? 20.166 50.886  47.901 1.00 22.89  ? 548 TRP H CE2   1 
ATOM   3451 C  CE3   . TRP G 3 47 ? 19.950 49.032  49.454 1.00 23.72  ? 548 TRP H CE3   1 
ATOM   3452 C  CZ2   . TRP G 3 47 ? 19.653 51.793  48.830 1.00 23.10  ? 548 TRP H CZ2   1 
ATOM   3453 C  CZ3   . TRP G 3 47 ? 19.433 49.939  50.385 1.00 24.70  ? 548 TRP H CZ3   1 
ATOM   3454 C  CH2   . TRP G 3 47 ? 19.292 51.306  50.063 1.00 24.74  ? 548 TRP H CH2   1 
ATOM   3455 N  N     . LYS G 3 48 ? 18.111 46.994  47.783 1.00 21.25  ? 549 LYS H N     1 
ATOM   3456 C  CA    . LYS G 3 48 ? 17.188 46.906  48.922 1.00 22.84  ? 549 LYS H CA    1 
ATOM   3457 C  C     . LYS G 3 48 ? 16.677 45.472  49.081 1.00 22.81  ? 549 LYS H C     1 
ATOM   3458 O  O     . LYS G 3 48 ? 16.715 44.904  50.171 1.00 21.34  ? 549 LYS H O     1 
ATOM   3459 C  CB    . LYS G 3 48 ? 15.992 47.846  48.745 1.00 27.16  ? 549 LYS H CB    1 
ATOM   3460 C  CG    . LYS G 3 48 ? 16.081 49.115  49.584 1.00 33.31  ? 549 LYS H CG    1 
ATOM   3461 C  CD    . LYS G 3 48 ? 14.791 49.921  49.513 1.00 36.69  ? 549 LYS H CD    1 
ATOM   3462 C  CE    . LYS G 3 48 ? 14.827 51.138  50.416 1.00 38.63  ? 549 LYS H CE    1 
ATOM   3463 N  NZ    . LYS G 3 48 ? 15.953 52.060  50.082 1.00 40.30  ? 549 LYS H NZ    1 
ATOM   3464 N  N     . ASN G 3 49 ? 16.177 44.893  47.996 1.00 20.39  ? 550 ASN H N     1 
ATOM   3465 C  CA    . ASN G 3 49 ? 15.681 43.528  48.058 1.00 21.20  ? 550 ASN H CA    1 
ATOM   3466 C  C     . ASN G 3 49 ? 16.838 42.540  48.239 1.00 20.33  ? 550 ASN H C     1 
ATOM   3467 O  O     . ASN G 3 49 ? 16.688 41.526  48.924 1.00 19.96  ? 550 ASN H O     1 
ATOM   3468 C  CB    . ASN G 3 49 ? 14.878 43.202  46.793 1.00 24.68  ? 550 ASN H CB    1 
ATOM   3469 C  CG    . ASN G 3 49 ? 13.443 43.703  46.860 1.00 28.93  ? 550 ASN H CG    1 
ATOM   3470 O  OD1   . ASN G 3 49 ? 12.731 43.398  47.808 1.00 35.51  ? 550 ASN H OD1   1 
ATOM   3471 N  ND2   . ASN G 3 49 ? 13.008 44.455  45.838 1.00 31.73  ? 550 ASN H ND2   1 
ATOM   3472 N  N     . ALA G 3 50 ? 17.990 42.854  47.652 1.00 18.85  ? 551 ALA H N     1 
ATOM   3473 C  CA    . ALA G 3 50 ? 19.150 41.978  47.763 1.00 19.06  ? 551 ALA H CA    1 
ATOM   3474 C  C     . ALA G 3 50 ? 19.607 41.893  49.217 1.00 20.92  ? 551 ALA H C     1 
ATOM   3475 O  O     . ALA G 3 50 ? 19.999 40.828  49.700 1.00 18.41  ? 551 ALA H O     1 
ATOM   3476 C  CB    . ALA G 3 50 ? 20.280 42.484  46.885 1.00 18.26  ? 551 ALA H CB    1 
ATOM   3477 N  N     . VAL G 3 51 ? 19.565 43.027  49.908 1.00 20.07  ? 552 VAL H N     1 
ATOM   3478 C  CA    . VAL G 3 51 ? 19.950 43.093  51.313 1.00 20.75  ? 552 VAL H CA    1 
ATOM   3479 C  C     . VAL G 3 51 ? 18.999 42.275  52.178 1.00 22.45  ? 552 VAL H C     1 
ATOM   3480 O  O     . VAL G 3 51 ? 19.432 41.499  53.032 1.00 21.92  ? 552 VAL H O     1 
ATOM   3481 C  CB    . VAL G 3 51 ? 19.958 44.561  51.794 1.00 21.69  ? 552 VAL H CB    1 
ATOM   3482 C  CG1   . VAL G 3 51 ? 20.008 44.627  53.305 1.00 22.38  ? 552 VAL H CG1   1 
ATOM   3483 C  CG2   . VAL G 3 51 ? 21.164 45.263  51.203 1.00 22.41  ? 552 VAL H CG2   1 
ATOM   3484 N  N     . ARG G 3 52 ? 17.699 42.436  51.951 1.00 22.89  ? 553 ARG H N     1 
ATOM   3485 C  CA    . ARG G 3 52 ? 16.718 41.683  52.724 1.00 25.61  ? 553 ARG H CA    1 
ATOM   3486 C  C     . ARG G 3 52 ? 16.919 40.188  52.515 1.00 24.55  ? 553 ARG H C     1 
ATOM   3487 O  O     . ARG G 3 52 ? 16.839 39.404  53.462 1.00 24.92  ? 553 ARG H O     1 
ATOM   3488 C  CB    . ARG G 3 52 ? 15.296 42.076  52.325 1.00 29.59  ? 553 ARG H CB    1 
ATOM   3489 C  CG    . ARG G 3 52 ? 14.924 43.487  52.730 1.00 37.95  ? 553 ARG H CG    1 
ATOM   3490 C  CD    . ARG G 3 52 ? 13.421 43.635  52.890 1.00 45.07  ? 553 ARG H CD    1 
ATOM   3491 N  NE    . ARG G 3 52 ? 12.705 43.421  51.639 1.00 51.16  ? 553 ARG H NE    1 
ATOM   3492 C  CZ    . ARG G 3 52 ? 11.383 43.313  51.549 1.00 54.89  ? 553 ARG H CZ    1 
ATOM   3493 N  NH1   . ARG G 3 52 ? 10.634 43.397  52.642 1.00 56.39  ? 553 ARG H NH1   1 
ATOM   3494 N  NH2   . ARG G 3 52 ? 10.809 43.122  50.367 1.00 56.52  ? 553 ARG H NH2   1 
ATOM   3495 N  N     . HIS G 3 53 ? 17.183 39.805  51.268 1.00 22.51  ? 554 HIS H N     1 
ATOM   3496 C  CA    . HIS G 3 53 ? 17.398 38.409  50.917 1.00 22.32  ? 554 HIS H CA    1 
ATOM   3497 C  C     . HIS G 3 53 ? 18.628 37.852  51.635 1.00 22.70  ? 554 HIS H C     1 
ATOM   3498 O  O     . HIS G 3 53 ? 18.562 36.781  52.260 1.00 23.81  ? 554 HIS H O     1 
ATOM   3499 C  CB    . HIS G 3 53 ? 17.572 38.281  49.398 1.00 21.14  ? 554 HIS H CB    1 
ATOM   3500 C  CG    . HIS G 3 53 ? 17.750 36.871  48.928 1.00 21.86  ? 554 HIS H CG    1 
ATOM   3501 N  ND1   . HIS G 3 53 ? 16.761 35.917  49.041 1.00 22.84  ? 554 HIS H ND1   1 
ATOM   3502 C  CD2   . HIS G 3 53 ? 18.808 36.249  48.356 1.00 20.96  ? 554 HIS H CD2   1 
ATOM   3503 C  CE1   . HIS G 3 53 ? 17.202 34.768  48.560 1.00 22.15  ? 554 HIS H CE1   1 
ATOM   3504 N  NE2   . HIS G 3 53 ? 18.442 34.942  48.138 1.00 23.02  ? 554 HIS H NE2   1 
ATOM   3505 N  N     . ASN G 3 54 ? 19.742 38.579  51.557 1.00 20.98  ? 555 ASN H N     1 
ATOM   3506 C  CA    . ASN G 3 54 ? 20.984 38.141  52.192 1.00 21.44  ? 555 ASN H CA    1 
ATOM   3507 C  C     . ASN G 3 54 ? 20.846 38.021  53.699 1.00 22.08  ? 555 ASN H C     1 
ATOM   3508 O  O     . ASN G 3 54 ? 21.383 37.091  54.300 1.00 22.79  ? 555 ASN H O     1 
ATOM   3509 C  CB    . ASN G 3 54 ? 22.139 39.103  51.866 1.00 21.07  ? 555 ASN H CB    1 
ATOM   3510 C  CG    . ASN G 3 54 ? 22.893 38.707  50.608 1.00 21.03  ? 555 ASN H CG    1 
ATOM   3511 O  OD1   . ASN G 3 54 ? 23.962 38.096  50.672 1.00 21.28  ? 555 ASN H OD1   1 
ATOM   3512 N  ND2   . ASN G 3 54 ? 22.325 39.040  49.446 1.00 19.52  ? 555 ASN H ND2   1 
ATOM   3513 N  N     . LEU G 3 55 ? 20.132 38.964  54.307 1.00 22.44  ? 556 LEU H N     1 
ATOM   3514 C  CA    . LEU G 3 55 ? 19.953 38.946  55.751 1.00 24.54  ? 556 LEU H CA    1 
ATOM   3515 C  C     . LEU G 3 55 ? 19.254 37.666  56.201 1.00 26.67  ? 556 LEU H C     1 
ATOM   3516 O  O     . LEU G 3 55 ? 19.676 37.037  57.169 1.00 25.98  ? 556 LEU H O     1 
ATOM   3517 C  CB    . LEU G 3 55 ? 19.158 40.172  56.211 1.00 24.26  ? 556 LEU H CB    1 
ATOM   3518 C  CG    . LEU G 3 55 ? 19.872 41.526  56.111 1.00 23.60  ? 556 LEU H CG    1 
ATOM   3519 C  CD1   . LEU G 3 55 ? 18.912 42.630  56.523 1.00 24.50  ? 556 LEU H CD1   1 
ATOM   3520 C  CD2   . LEU G 3 55 ? 21.109 41.540  57.004 1.00 24.89  ? 556 LEU H CD2   1 
ATOM   3521 N  N     . SER G 3 56 ? 18.195 37.272  55.500 1.00 26.48  ? 557 SER H N     1 
ATOM   3522 C  CA    . SER G 3 56 ? 17.478 36.058  55.879 1.00 29.46  ? 557 SER H CA    1 
ATOM   3523 C  C     . SER G 3 56 ? 18.112 34.774  55.345 1.00 28.87  ? 557 SER H C     1 
ATOM   3524 O  O     . SER G 3 56 ? 17.866 33.695  55.881 1.00 30.17  ? 557 SER H O     1 
ATOM   3525 C  CB    . SER G 3 56 ? 16.011 36.140  55.438 1.00 32.17  ? 557 SER H CB    1 
ATOM   3526 O  OG    . SER G 3 56 ? 15.900 36.369  54.049 1.00 38.65  ? 557 SER H OG    1 
ATOM   3527 N  N     . LEU G 3 57 ? 18.943 34.879  54.311 1.00 27.16  ? 558 LEU H N     1 
ATOM   3528 C  CA    . LEU G 3 57 ? 19.578 33.688  53.751 1.00 27.65  ? 558 LEU H CA    1 
ATOM   3529 C  C     . LEU G 3 57 ? 20.825 33.232  54.517 1.00 28.79  ? 558 LEU H C     1 
ATOM   3530 O  O     . LEU G 3 57 ? 20.970 32.053  54.831 1.00 27.58  ? 558 LEU H O     1 
ATOM   3531 C  CB    . LEU G 3 57 ? 19.968 33.916  52.287 1.00 28.52  ? 558 LEU H CB    1 
ATOM   3532 C  CG    . LEU G 3 57 ? 20.750 32.763  51.638 1.00 29.05  ? 558 LEU H CG    1 
ATOM   3533 C  CD1   . LEU G 3 57 ? 19.833 31.564  51.455 1.00 29.86  ? 558 LEU H CD1   1 
ATOM   3534 C  CD2   . LEU G 3 57 ? 21.326 33.197  50.300 1.00 29.67  ? 558 LEU H CD2   1 
ATOM   3535 N  N     . HIS G 3 58 ? 21.724 34.167  54.815 1.00 28.06  ? 559 HIS H N     1 
ATOM   3536 C  CA    . HIS G 3 58 ? 22.971 33.837  55.497 1.00 29.63  ? 559 HIS H CA    1 
ATOM   3537 C  C     . HIS G 3 58 ? 22.874 33.825  57.021 1.00 31.14  ? 559 HIS H C     1 
ATOM   3538 O  O     . HIS G 3 58 ? 22.490 34.813  57.653 1.00 27.86  ? 559 HIS H O     1 
ATOM   3539 C  CB    . HIS G 3 58 ? 24.067 34.806  55.056 1.00 30.37  ? 559 HIS H CB    1 
ATOM   3540 C  CG    . HIS G 3 58 ? 24.301 34.815  53.576 1.00 32.51  ? 559 HIS H CG    1 
ATOM   3541 N  ND1   . HIS G 3 58 ? 24.802 33.725  52.895 1.00 33.36  ? 559 HIS H ND1   1 
ATOM   3542 C  CD2   . HIS G 3 58 ? 24.088 35.775  52.646 1.00 32.34  ? 559 HIS H CD2   1 
ATOM   3543 C  CE1   . HIS G 3 58 ? 24.887 34.015  51.608 1.00 34.12  ? 559 HIS H CE1   1 
ATOM   3544 N  NE2   . HIS G 3 58 ? 24.460 35.253  51.429 1.00 32.14  ? 559 HIS H NE2   1 
ATOM   3545 N  N     . LYS G 3 59 ? 23.243 32.691  57.603 1.00 32.65  ? 560 LYS H N     1 
ATOM   3546 C  CA    . LYS G 3 59 ? 23.201 32.517  59.049 1.00 35.88  ? 560 LYS H CA    1 
ATOM   3547 C  C     . LYS G 3 59 ? 24.151 33.462  59.792 1.00 34.91  ? 560 LYS H C     1 
ATOM   3548 O  O     . LYS G 3 59 ? 23.958 33.737  60.974 1.00 36.56  ? 560 LYS H O     1 
ATOM   3549 C  CB    . LYS G 3 59 ? 23.536 31.064  59.395 1.00 38.51  ? 560 LYS H CB    1 
ATOM   3550 C  CG    . LYS G 3 59 ? 22.647 30.053  58.684 1.00 43.79  ? 560 LYS H CG    1 
ATOM   3551 C  CD    . LYS G 3 59 ? 23.038 28.619  59.011 1.00 47.13  ? 560 LYS H CD    1 
ATOM   3552 C  CE    . LYS G 3 59 ? 22.866 28.321  60.493 1.00 49.50  ? 560 LYS H CE    1 
ATOM   3553 N  NZ    . LYS G 3 59 ? 21.457 28.500  60.943 1.00 51.24  ? 560 LYS H NZ    1 
ATOM   3554 N  N     . CYS G 3 60 ? 25.169 33.963  59.098 1.00 34.36  ? 561 CYS H N     1 
ATOM   3555 C  CA    . CYS G 3 60 ? 26.136 34.869  59.714 1.00 34.90  ? 561 CYS H CA    1 
ATOM   3556 C  C     . CYS G 3 60 ? 25.514 36.202  60.125 1.00 35.32  ? 561 CYS H C     1 
ATOM   3557 O  O     . CYS G 3 60 ? 26.115 36.963  60.887 1.00 35.03  ? 561 CYS H O     1 
ATOM   3558 C  CB    . CYS G 3 60 ? 27.306 35.128  58.766 1.00 35.37  ? 561 CYS H CB    1 
ATOM   3559 S  SG    . CYS G 3 60 ? 26.842 36.007  57.260 1.00 34.86  ? 561 CYS H SG    1 
ATOM   3560 N  N     . PHE G 3 61 ? 24.323 36.487  59.605 1.00 32.56  ? 562 PHE H N     1 
ATOM   3561 C  CA    . PHE G 3 61 ? 23.609 37.715  59.944 1.00 33.69  ? 562 PHE H CA    1 
ATOM   3562 C  C     . PHE G 3 61 ? 22.473 37.328  60.881 1.00 36.85  ? 562 PHE H C     1 
ATOM   3563 O  O     . PHE G 3 61 ? 21.493 36.698  60.472 1.00 34.57  ? 562 PHE H O     1 
ATOM   3564 C  CB    . PHE G 3 61 ? 23.068 38.386  58.675 1.00 30.96  ? 562 PHE H CB    1 
ATOM   3565 C  CG    . PHE G 3 61 ? 24.148 38.808  57.710 1.00 28.30  ? 562 PHE H CG    1 
ATOM   3566 C  CD1   . PHE G 3 61 ? 24.082 38.457  56.363 1.00 27.55  ? 562 PHE H CD1   1 
ATOM   3567 C  CD2   . PHE G 3 61 ? 25.236 39.560  58.151 1.00 27.41  ? 562 PHE H CD2   1 
ATOM   3568 C  CE1   . PHE G 3 61 ? 25.083 38.847  55.471 1.00 26.16  ? 562 PHE H CE1   1 
ATOM   3569 C  CE2   . PHE G 3 61 ? 26.240 39.955  57.266 1.00 26.47  ? 562 PHE H CE2   1 
ATOM   3570 C  CZ    . PHE G 3 61 ? 26.163 39.598  55.923 1.00 25.29  ? 562 PHE H CZ    1 
ATOM   3571 N  N     . VAL G 3 62 ? 22.604 37.698  62.151 1.00 39.80  ? 563 VAL H N     1 
ATOM   3572 C  CA    . VAL G 3 62 ? 21.597 37.348  63.143 1.00 44.58  ? 563 VAL H CA    1 
ATOM   3573 C  C     . VAL G 3 62 ? 20.768 38.531  63.611 1.00 48.92  ? 563 VAL H C     1 
ATOM   3574 O  O     . VAL G 3 62 ? 21.307 39.571  63.977 1.00 47.03  ? 563 VAL H O     1 
ATOM   3575 C  CB    . VAL G 3 62 ? 22.256 36.686  64.369 1.00 45.44  ? 563 VAL H CB    1 
ATOM   3576 C  CG1   . VAL G 3 62 ? 21.196 36.299  65.384 1.00 45.74  ? 563 VAL H CG1   1 
ATOM   3577 C  CG2   . VAL G 3 62 ? 23.049 35.461  63.928 1.00 45.00  ? 563 VAL H CG2   1 
ATOM   3578 N  N     . ARG G 3 63 ? 19.452 38.353  63.612 1.00 55.58  ? 564 ARG H N     1 
ATOM   3579 C  CA    . ARG G 3 63 ? 18.538 39.400  64.037 1.00 64.51  ? 564 ARG H CA    1 
ATOM   3580 C  C     . ARG G 3 63 ? 18.323 39.345  65.549 1.00 68.89  ? 564 ARG H C     1 
ATOM   3581 O  O     . ARG G 3 63 ? 17.776 38.375  66.071 1.00 69.18  ? 564 ARG H O     1 
ATOM   3582 C  CB    . ARG G 3 63 ? 17.198 39.246  63.319 1.00 66.57  ? 564 ARG H CB    1 
ATOM   3583 C  CG    . ARG G 3 63 ? 16.208 40.366  63.579 1.00 71.59  ? 564 ARG H CG    1 
ATOM   3584 C  CD    . ARG G 3 63 ? 14.897 40.096  62.868 1.00 75.49  ? 564 ARG H CD    1 
ATOM   3585 N  NE    . ARG G 3 63 ? 13.926 41.168  63.064 1.00 79.50  ? 564 ARG H NE    1 
ATOM   3586 C  CZ    . ARG G 3 63 ? 12.673 41.121  62.626 1.00 81.57  ? 564 ARG H CZ    1 
ATOM   3587 N  NH1   . ARG G 3 63 ? 12.244 40.053  61.967 1.00 82.97  ? 564 ARG H NH1   1 
ATOM   3588 N  NH2   . ARG G 3 63 ? 11.851 42.138  62.843 1.00 82.72  ? 564 ARG H NH2   1 
ATOM   3589 N  N     . VAL G 3 64 ? 18.765 40.387  66.246 1.00 74.71  ? 565 VAL H N     1 
ATOM   3590 C  CA    . VAL G 3 64 ? 18.622 40.467  67.697 1.00 80.33  ? 565 VAL H CA    1 
ATOM   3591 C  C     . VAL G 3 64 ? 17.531 41.468  68.052 1.00 84.59  ? 565 VAL H C     1 
ATOM   3592 O  O     . VAL G 3 64 ? 17.671 42.666  67.816 1.00 85.27  ? 565 VAL H O     1 
ATOM   3593 C  CB    . VAL G 3 64 ? 19.941 40.910  68.369 1.00 79.61  ? 565 VAL H CB    1 
ATOM   3594 C  CG1   . VAL G 3 64 ? 19.796 40.854  69.883 1.00 79.63  ? 565 VAL H CG1   1 
ATOM   3595 C  CG2   . VAL G 3 64 ? 21.079 40.023  67.908 1.00 79.45  ? 565 VAL H CG2   1 
ATOM   3596 N  N     . GLU G 3 65 ? 16.444 40.966  68.626 1.00 90.30  ? 566 GLU H N     1 
ATOM   3597 C  CA    . GLU G 3 65 ? 15.322 41.810  69.011 1.00 95.87  ? 566 GLU H CA    1 
ATOM   3598 C  C     . GLU G 3 65 ? 15.467 42.286  70.453 1.00 98.63  ? 566 GLU H C     1 
ATOM   3599 O  O     . GLU G 3 65 ? 15.384 41.492  71.390 1.00 98.99  ? 566 GLU H O     1 
ATOM   3600 C  CB    . GLU G 3 65 ? 14.015 41.035  68.837 1.00 97.34  ? 566 GLU H CB    1 
ATOM   3601 C  CG    . GLU G 3 65 ? 13.828 40.482  67.429 1.00 100.41 ? 566 GLU H CG    1 
ATOM   3602 C  CD    . GLU G 3 65 ? 12.608 39.591  67.299 1.00 101.87 ? 566 GLU H CD    1 
ATOM   3603 O  OE1   . GLU G 3 65 ? 12.547 38.558  67.999 1.00 102.90 ? 566 GLU H OE1   1 
ATOM   3604 O  OE2   . GLU G 3 65 ? 11.712 39.921  66.495 1.00 102.75 ? 566 GLU H OE2   1 
ATOM   3605 N  N     . ASN G 3 66 ? 15.692 43.585  70.624 1.00 102.26 ? 567 ASN H N     1 
ATOM   3606 C  CA    . ASN G 3 66 ? 15.854 44.171  71.950 1.00 105.75 ? 567 ASN H CA    1 
ATOM   3607 C  C     . ASN G 3 66 ? 14.609 44.942  72.382 1.00 107.16 ? 567 ASN H C     1 
ATOM   3608 O  O     . ASN G 3 66 ? 13.503 44.653  71.924 1.00 107.62 ? 567 ASN H O     1 
ATOM   3609 C  CB    . ASN G 3 66 ? 17.075 45.099  71.972 1.00 107.11 ? 567 ASN H CB    1 
ATOM   3610 C  CG    . ASN G 3 66 ? 16.988 46.212  70.941 1.00 108.52 ? 567 ASN H CG    1 
ATOM   3611 O  OD1   . ASN G 3 66 ? 17.895 47.035  70.824 1.00 109.20 ? 567 ASN H OD1   1 
ATOM   3612 N  ND2   . ASN G 3 66 ? 15.894 46.241  70.188 1.00 109.25 ? 567 ASN H ND2   1 
ATOM   3613 N  N     . VAL G 3 67 ? 14.799 45.919  73.265 1.00 108.49 ? 568 VAL H N     1 
ATOM   3614 C  CA    . VAL G 3 67 ? 13.699 46.738  73.770 1.00 109.30 ? 568 VAL H CA    1 
ATOM   3615 C  C     . VAL G 3 67 ? 12.738 47.177  72.664 1.00 108.65 ? 568 VAL H C     1 
ATOM   3616 O  O     . VAL G 3 67 ? 11.732 46.514  72.410 1.00 109.18 ? 568 VAL H O     1 
ATOM   3617 C  CB    . VAL G 3 67 ? 14.235 47.990  74.513 1.00 110.09 ? 568 VAL H CB    1 
ATOM   3618 C  CG1   . VAL G 3 67 ? 14.809 47.583  75.861 1.00 110.70 ? 568 VAL H CG1   1 
ATOM   3619 C  CG2   . VAL G 3 67 ? 15.311 48.677  73.680 1.00 110.69 ? 568 VAL H CG2   1 
ATOM   3620 N  N     . LYS G 3 68 ? 13.046 48.293  72.012 1.00 107.47 ? 569 LYS H N     1 
ATOM   3621 C  CA    . LYS G 3 68 ? 12.208 48.801  70.935 1.00 105.62 ? 569 LYS H CA    1 
ATOM   3622 C  C     . LYS G 3 68 ? 12.842 48.510  69.582 1.00 102.67 ? 569 LYS H C     1 
ATOM   3623 O  O     . LYS G 3 68 ? 13.974 48.915  69.315 1.00 102.83 ? 569 LYS H O     1 
ATOM   3624 C  CB    . LYS G 3 68 ? 11.990 50.308  71.092 1.00 107.91 ? 569 LYS H CB    1 
ATOM   3625 C  CG    . LYS G 3 68 ? 11.111 50.690  72.274 1.00 110.33 ? 569 LYS H CG    1 
ATOM   3626 C  CD    . LYS G 3 68 ? 10.947 52.199  72.388 1.00 112.17 ? 569 LYS H CD    1 
ATOM   3627 C  CE    . LYS G 3 68 ? 12.276 52.883  72.678 1.00 113.28 ? 569 LYS H CE    1 
ATOM   3628 N  NZ    . LYS G 3 68 ? 12.129 54.359  72.801 1.00 114.24 ? 569 LYS H NZ    1 
ATOM   3629 N  N     . GLY G 3 69 ? 12.105 47.803  68.732 1.00 98.70  ? 570 GLY H N     1 
ATOM   3630 C  CA    . GLY G 3 69 ? 12.611 47.467  67.415 1.00 93.02  ? 570 GLY H CA    1 
ATOM   3631 C  C     . GLY G 3 69 ? 13.596 46.316  67.455 1.00 88.56  ? 570 GLY H C     1 
ATOM   3632 O  O     . GLY G 3 69 ? 13.937 45.814  68.525 1.00 88.78  ? 570 GLY H O     1 
ATOM   3633 N  N     . ALA G 3 70 ? 14.050 45.896  66.280 1.00 83.27  ? 571 ALA H N     1 
ATOM   3634 C  CA    . ALA G 3 70 ? 15.003 44.800  66.174 1.00 77.12  ? 571 ALA H CA    1 
ATOM   3635 C  C     . ALA G 3 70 ? 16.248 45.268  65.432 1.00 72.57  ? 571 ALA H C     1 
ATOM   3636 O  O     . ALA G 3 70 ? 16.178 46.153  64.579 1.00 72.43  ? 571 ALA H O     1 
ATOM   3637 C  CB    . ALA G 3 70 ? 14.367 43.625  65.442 1.00 77.19  ? 571 ALA H CB    1 
ATOM   3638 N  N     . VAL G 3 71 ? 17.388 44.675  65.762 1.00 66.12  ? 572 VAL H N     1 
ATOM   3639 C  CA    . VAL G 3 71 ? 18.639 45.041  65.115 1.00 59.53  ? 572 VAL H CA    1 
ATOM   3640 C  C     . VAL G 3 71 ? 19.309 43.819  64.500 1.00 54.50  ? 572 VAL H C     1 
ATOM   3641 O  O     . VAL G 3 71 ? 18.989 42.682  64.845 1.00 53.91  ? 572 VAL H O     1 
ATOM   3642 C  CB    . VAL G 3 71 ? 19.615 45.695  66.116 1.00 60.23  ? 572 VAL H CB    1 
ATOM   3643 C  CG1   . VAL G 3 71 ? 18.984 46.942  66.711 1.00 59.75  ? 572 VAL H CG1   1 
ATOM   3644 C  CG2   . VAL G 3 71 ? 19.979 44.709  67.211 1.00 60.39  ? 572 VAL H CG2   1 
ATOM   3645 N  N     . TRP G 3 72 ? 20.231 44.061  63.577 1.00 47.66  ? 573 TRP H N     1 
ATOM   3646 C  CA    . TRP G 3 72 ? 20.949 42.979  62.928 1.00 41.12  ? 573 TRP H CA    1 
ATOM   3647 C  C     . TRP G 3 72 ? 22.402 43.001  63.342 1.00 38.29  ? 573 TRP H C     1 
ATOM   3648 O  O     . TRP G 3 72 ? 23.019 44.060  63.454 1.00 37.06  ? 573 TRP H O     1 
ATOM   3649 C  CB    . TRP G 3 72 ? 20.847 43.084  61.402 1.00 39.72  ? 573 TRP H CB    1 
ATOM   3650 C  CG    . TRP G 3 72 ? 19.484 42.783  60.875 1.00 37.98  ? 573 TRP H CG    1 
ATOM   3651 C  CD1   . TRP G 3 72 ? 18.446 43.658  60.729 1.00 37.74  ? 573 TRP H CD1   1 
ATOM   3652 C  CD2   . TRP G 3 72 ? 18.991 41.502  60.463 1.00 37.59  ? 573 TRP H CD2   1 
ATOM   3653 N  NE1   . TRP G 3 72 ? 17.336 43.002  60.249 1.00 37.65  ? 573 TRP H NE1   1 
ATOM   3654 C  CE2   . TRP G 3 72 ? 17.644 41.679  60.073 1.00 37.39  ? 573 TRP H CE2   1 
ATOM   3655 C  CE3   . TRP G 3 72 ? 19.559 40.224  60.378 1.00 37.24  ? 573 TRP H CE3   1 
ATOM   3656 C  CZ2   . TRP G 3 72 ? 16.852 40.620  59.612 1.00 36.56  ? 573 TRP H CZ2   1 
ATOM   3657 C  CZ3   . TRP G 3 72 ? 18.771 39.171  59.919 1.00 37.36  ? 573 TRP H CZ3   1 
ATOM   3658 C  CH2   . TRP G 3 72 ? 17.433 39.379  59.540 1.00 36.65  ? 573 TRP H CH2   1 
ATOM   3659 N  N     . THR G 3 73 ? 22.947 41.815  63.560 1.00 34.42  ? 574 THR H N     1 
ATOM   3660 C  CA    . THR G 3 73 ? 24.328 41.675  63.976 1.00 33.06  ? 574 THR H CA    1 
ATOM   3661 C  C     . THR G 3 73 ? 25.036 40.664  63.099 1.00 31.92  ? 574 THR H C     1 
ATOM   3662 O  O     . THR G 3 73 ? 24.402 39.925  62.342 1.00 30.89  ? 574 THR H O     1 
ATOM   3663 C  CB    . THR G 3 73 ? 24.412 41.173  65.426 1.00 33.88  ? 574 THR H CB    1 
ATOM   3664 O  OG1   . THR G 3 73 ? 23.801 39.881  65.510 1.00 32.14  ? 574 THR H OG1   1 
ATOM   3665 C  CG2   . THR G 3 73 ? 23.683 42.120  66.360 1.00 33.88  ? 574 THR H CG2   1 
ATOM   3666 N  N     . VAL G 3 74 ? 26.356 40.630  63.209 1.00 29.80  ? 575 VAL H N     1 
ATOM   3667 C  CA    . VAL G 3 74 ? 27.143 39.688  62.442 1.00 29.89  ? 575 VAL H CA    1 
ATOM   3668 C  C     . VAL G 3 74 ? 27.744 38.634  63.368 1.00 31.29  ? 575 VAL H C     1 
ATOM   3669 O  O     . VAL G 3 74 ? 28.267 38.958  64.438 1.00 29.56  ? 575 VAL H O     1 
ATOM   3670 C  CB    . VAL G 3 74 ? 28.300 40.386  61.701 1.00 29.29  ? 575 VAL H CB    1 
ATOM   3671 C  CG1   . VAL G 3 74 ? 29.149 39.354  60.974 1.00 31.01  ? 575 VAL H CG1   1 
ATOM   3672 C  CG2   . VAL G 3 74 ? 27.752 41.410  60.722 1.00 30.09  ? 575 VAL H CG2   1 
ATOM   3673 N  N     . ASP G 3 75 ? 27.636 37.372  62.972 1.00 30.37  ? 576 ASP H N     1 
ATOM   3674 C  CA    . ASP G 3 75 ? 28.231 36.276  63.733 1.00 30.55  ? 576 ASP H CA    1 
ATOM   3675 C  C     . ASP G 3 75 ? 29.556 36.093  63.007 1.00 30.33  ? 576 ASP H C     1 
ATOM   3676 O  O     . ASP G 3 75 ? 29.624 35.399  61.988 1.00 30.59  ? 576 ASP H O     1 
ATOM   3677 C  CB    . ASP G 3 75 ? 27.387 35.010  63.605 1.00 32.20  ? 576 ASP H CB    1 
ATOM   3678 C  CG    . ASP G 3 75 ? 28.012 33.823  64.311 1.00 32.56  ? 576 ASP H CG    1 
ATOM   3679 O  OD1   . ASP G 3 75 ? 29.252 33.667  64.236 1.00 32.17  ? 576 ASP H OD1   1 
ATOM   3680 O  OD2   . ASP G 3 75 ? 27.260 33.042  64.930 1.00 34.59  ? 576 ASP H OD2   1 
ATOM   3681 N  N     . GLU G 3 76 ? 30.607 36.729  63.519 1.00 31.30  ? 577 GLU H N     1 
ATOM   3682 C  CA    . GLU G 3 76 ? 31.915 36.684  62.873 1.00 31.98  ? 577 GLU H CA    1 
ATOM   3683 C  C     . GLU G 3 76 ? 32.481 35.297  62.656 1.00 33.31  ? 577 GLU H C     1 
ATOM   3684 O  O     . GLU G 3 76 ? 33.156 35.060  61.656 1.00 33.54  ? 577 GLU H O     1 
ATOM   3685 C  CB    . GLU G 3 76 ? 32.924 37.530  63.653 1.00 33.56  ? 577 GLU H CB    1 
ATOM   3686 C  CG    . GLU G 3 76 ? 34.281 37.711  62.964 1.00 35.28  ? 577 GLU H CG    1 
ATOM   3687 C  CD    . GLU G 3 76 ? 34.185 38.416  61.616 1.00 37.98  ? 577 GLU H CD    1 
ATOM   3688 O  OE1   . GLU G 3 76 ? 33.278 39.260  61.446 1.00 38.64  ? 577 GLU H OE1   1 
ATOM   3689 O  OE2   . GLU G 3 76 ? 35.027 38.139  60.731 1.00 36.56  ? 577 GLU H OE2   1 
ATOM   3690 N  N     . VAL G 3 77 ? 32.232 34.381  63.586 1.00 33.98  ? 578 VAL H N     1 
ATOM   3691 C  CA    . VAL G 3 77 ? 32.743 33.021  63.422 1.00 35.92  ? 578 VAL H CA    1 
ATOM   3692 C  C     . VAL G 3 77 ? 32.066 32.392  62.209 1.00 36.04  ? 578 VAL H C     1 
ATOM   3693 O  O     . VAL G 3 77 ? 32.726 31.836  61.333 1.00 34.34  ? 578 VAL H O     1 
ATOM   3694 C  CB    . VAL G 3 77 ? 32.460 32.141  64.662 1.00 37.13  ? 578 VAL H CB    1 
ATOM   3695 C  CG1   . VAL G 3 77 ? 32.860 30.701  64.373 1.00 38.83  ? 578 VAL H CG1   1 
ATOM   3696 C  CG2   . VAL G 3 77 ? 33.235 32.668  65.861 1.00 38.85  ? 578 VAL H CG2   1 
ATOM   3697 N  N     . GLU G 3 78 ? 30.742 32.484  62.169 1.00 38.62  ? 579 GLU H N     1 
ATOM   3698 C  CA    . GLU G 3 78 ? 29.969 31.938  61.059 1.00 42.03  ? 579 GLU H CA    1 
ATOM   3699 C  C     . GLU G 3 78 ? 30.409 32.591  59.749 1.00 43.39  ? 579 GLU H C     1 
ATOM   3700 O  O     . GLU G 3 78 ? 30.657 31.912  58.753 1.00 42.88  ? 579 GLU H O     1 
ATOM   3701 C  CB    . GLU G 3 78 ? 28.479 32.204  61.277 1.00 44.34  ? 579 GLU H CB    1 
ATOM   3702 C  CG    . GLU G 3 78 ? 27.588 31.608  60.204 1.00 47.04  ? 579 GLU H CG    1 
ATOM   3703 C  CD    . GLU G 3 78 ? 27.288 30.145  60.444 1.00 49.57  ? 579 GLU H CD    1 
ATOM   3704 O  OE1   . GLU G 3 78 ? 28.123 29.455  61.065 1.00 48.87  ? 579 GLU H OE1   1 
ATOM   3705 O  OE2   . GLU G 3 78 ? 26.219 29.679  60.001 1.00 51.74  ? 579 GLU H OE2   1 
ATOM   3706 N  N     . TYR G 3 79 ? 30.505 33.916  59.758 1.00 45.75  ? 580 TYR H N     1 
ATOM   3707 C  CA    . TYR G 3 79 ? 30.905 34.655  58.566 1.00 48.30  ? 580 TYR H CA    1 
ATOM   3708 C  C     . TYR G 3 79 ? 32.235 34.185  57.985 1.00 51.81  ? 580 TYR H C     1 
ATOM   3709 O  O     . TYR G 3 79 ? 32.332 33.913  56.787 1.00 51.00  ? 580 TYR H O     1 
ATOM   3710 C  CB    . TYR G 3 79 ? 30.998 36.151  58.870 1.00 46.21  ? 580 TYR H CB    1 
ATOM   3711 C  CG    . TYR G 3 79 ? 31.373 36.981  57.663 1.00 44.25  ? 580 TYR H CG    1 
ATOM   3712 C  CD1   . TYR G 3 79 ? 30.399 37.430  56.772 1.00 43.39  ? 580 TYR H CD1   1 
ATOM   3713 C  CD2   . TYR G 3 79 ? 32.706 37.299  57.401 1.00 43.54  ? 580 TYR H CD2   1 
ATOM   3714 C  CE1   . TYR G 3 79 ? 30.740 38.181  55.653 1.00 41.60  ? 580 TYR H CE1   1 
ATOM   3715 C  CE2   . TYR G 3 79 ? 33.061 38.045  56.281 1.00 42.38  ? 580 TYR H CE2   1 
ATOM   3716 C  CZ    . TYR G 3 79 ? 32.070 38.486  55.413 1.00 42.19  ? 580 TYR H CZ    1 
ATOM   3717 O  OH    . TYR G 3 79 ? 32.412 39.249  54.321 1.00 42.03  ? 580 TYR H OH    1 
ATOM   3718 N  N     . GLN G 3 80 ? 33.256 34.090  58.831 1.00 56.65  ? 581 GLN H N     1 
ATOM   3719 C  CA    . GLN G 3 80 ? 34.573 33.669  58.373 1.00 62.48  ? 581 GLN H CA    1 
ATOM   3720 C  C     . GLN G 3 80 ? 34.610 32.229  57.860 1.00 66.94  ? 581 GLN H C     1 
ATOM   3721 O  O     . GLN G 3 80 ? 35.631 31.774  57.349 1.00 66.87  ? 581 GLN H O     1 
ATOM   3722 C  CB    . GLN G 3 80 ? 35.602 33.845  59.489 1.00 61.78  ? 581 GLN H CB    1 
ATOM   3723 C  CG    . GLN G 3 80 ? 35.990 35.277  59.786 1.00 61.95  ? 581 GLN H CG    1 
ATOM   3724 C  CD    . GLN G 3 80 ? 36.599 35.987  58.571 1.00 61.45  ? 581 GLN H CD    1 
ATOM   3725 O  OE1   . GLN G 3 80 ? 37.046 35.350  57.631 1.00 61.20  ? 581 GLN H OE1   1 
ATOM   3726 N  NE2   . GLN G 3 80 ? 36.625 37.304  58.604 1.00 61.48  ? 581 GLN H NE2   1 
ATOM   3727 N  N     . LYS G 3 81 ? 33.498 31.512  57.963 1.00 73.00  ? 582 LYS H N     1 
ATOM   3728 C  CA    . LYS G 3 81 ? 33.470 30.129  57.490 1.00 79.79  ? 582 LYS H CA    1 
ATOM   3729 C  C     . LYS G 3 81 ? 33.170 30.029  55.991 1.00 84.45  ? 582 LYS H C     1 
ATOM   3730 O  O     . LYS G 3 81 ? 33.554 29.054  55.346 1.00 85.04  ? 582 LYS H O     1 
ATOM   3731 C  CB    . LYS G 3 81 ? 32.435 29.324  58.270 1.00 79.76  ? 582 LYS H CB    1 
ATOM   3732 C  CG    . LYS G 3 81 ? 32.338 27.869  57.853 1.00 81.06  ? 582 LYS H CG    1 
ATOM   3733 C  CD    . LYS G 3 81 ? 31.351 27.093  58.716 1.00 81.71  ? 582 LYS H CD    1 
ATOM   3734 C  CE    . LYS G 3 81 ? 29.953 27.689  58.635 1.00 81.96  ? 582 LYS H CE    1 
ATOM   3735 N  NZ    . LYS G 3 81 ? 28.956 26.920  59.432 1.00 82.22  ? 582 LYS H NZ    1 
ATOM   3736 N  N     . ARG G 3 82 ? 32.508 31.045  55.442 1.00 90.25  ? 583 ARG H N     1 
ATOM   3737 C  CA    . ARG G 3 82 ? 32.154 31.057  54.033 1.00 96.04  ? 583 ARG H CA    1 
ATOM   3738 C  C     . ARG G 3 82 ? 33.347 31.017  53.095 1.00 99.02  ? 583 ARG H C     1 
ATOM   3739 O  O     . ARG G 3 82 ? 33.373 30.237  52.139 1.00 99.91  ? 583 ARG H O     1 
ATOM   3740 C  CB    . ARG G 3 82 ? 31.288 32.286  53.728 1.00 97.67  ? 583 ARG H CB    1 
ATOM   3741 C  CG    . ARG G 3 82 ? 32.039 33.619  53.716 1.00 100.00 ? 583 ARG H CG    1 
ATOM   3742 C  CD    . ARG G 3 82 ? 31.068 34.786  53.860 1.00 101.51 ? 583 ARG H CD    1 
ATOM   3743 N  NE    . ARG G 3 82 ? 29.879 34.615  53.030 1.00 103.21 ? 583 ARG H NE    1 
ATOM   3744 C  CZ    . ARG G 3 82 ? 28.668 35.038  53.375 1.00 103.99 ? 583 ARG H CZ    1 
ATOM   3745 N  NH1   . ARG G 3 82 ? 28.485 35.655  54.535 1.00 104.62 ? 583 ARG H NH1   1 
ATOM   3746 N  NH2   . ARG G 3 82 ? 27.637 34.837  52.569 1.00 104.63 ? 583 ARG H NH2   1 
ATOM   3747 N  N     . ARG G 3 83 ? 34.339 31.857  53.363 1.00 102.34 ? 584 ARG H N     1 
ATOM   3748 C  CA    . ARG G 3 83 ? 35.535 31.923  52.515 1.00 105.45 ? 584 ARG H CA    1 
ATOM   3749 C  C     . ARG G 3 83 ? 36.304 30.607  52.407 1.00 106.13 ? 584 ARG H C     1 
ATOM   3750 O  O     . ARG G 3 83 ? 36.055 29.694  53.206 1.00 106.62 ? 584 ARG H O     1 
ATOM   3751 C  CB    . ARG G 3 83 ? 36.493 32.995  53.035 1.00 107.69 ? 584 ARG H CB    1 
ATOM   3752 C  CG    . ARG G 3 83 ? 36.115 34.447  52.777 1.00 110.70 ? 584 ARG H CG    1 
ATOM   3753 C  CD    . ARG G 3 83 ? 37.284 35.349  53.178 1.00 113.33 ? 584 ARG H CD    1 
ATOM   3754 N  NE    . ARG G 3 83 ? 37.055 36.762  52.899 1.00 115.58 ? 584 ARG H NE    1 
ATOM   3755 C  CZ    . ARG G 3 83 ? 38.004 37.693  52.963 1.00 116.69 ? 584 ARG H CZ    1 
ATOM   3756 N  NH1   . ARG G 3 83 ? 39.250 37.368  53.296 1.00 117.24 ? 584 ARG H NH1   1 
ATOM   3757 N  NH2   . ARG G 3 83 ? 37.709 38.954  52.689 1.00 117.39 ? 584 ARG H NH2   1 
ATOM   3758 N  N     . VAL H 3 2  ? 37.909 35.451  39.572 1.00 72.35  ? 503 VAL I N     1 
ATOM   3759 C  CA    . VAL H 3 2  ? 38.432 36.178  40.764 1.00 72.10  ? 503 VAL I CA    1 
ATOM   3760 C  C     . VAL H 3 2  ? 37.293 36.671  41.651 1.00 70.24  ? 503 VAL I C     1 
ATOM   3761 O  O     . VAL H 3 2  ? 36.262 37.127  41.159 1.00 70.04  ? 503 VAL I O     1 
ATOM   3762 C  CB    . VAL H 3 2  ? 39.294 37.393  40.342 1.00 73.76  ? 503 VAL I CB    1 
ATOM   3763 C  CG1   . VAL H 3 2  ? 39.796 38.132  41.576 1.00 74.85  ? 503 VAL I CG1   1 
ATOM   3764 C  CG2   . VAL H 3 2  ? 40.465 36.928  39.491 1.00 75.15  ? 503 VAL I CG2   1 
ATOM   3765 N  N     . ARG H 3 3  ? 37.493 36.565  42.961 1.00 67.79  ? 504 ARG I N     1 
ATOM   3766 C  CA    . ARG H 3 3  ? 36.509 36.997  43.950 1.00 64.97  ? 504 ARG I CA    1 
ATOM   3767 C  C     . ARG H 3 3  ? 36.066 38.432  43.662 1.00 59.90  ? 504 ARG I C     1 
ATOM   3768 O  O     . ARG H 3 3  ? 36.891 39.293  43.357 1.00 59.95  ? 504 ARG I O     1 
ATOM   3769 C  CB    . ARG H 3 3  ? 37.128 36.923  45.349 1.00 69.47  ? 504 ARG I CB    1 
ATOM   3770 C  CG    . ARG H 3 3  ? 36.205 37.313  46.496 1.00 75.58  ? 504 ARG I CG    1 
ATOM   3771 C  CD    . ARG H 3 3  ? 35.344 36.146  46.960 1.00 80.53  ? 504 ARG I CD    1 
ATOM   3772 N  NE    . ARG H 3 3  ? 34.559 36.492  48.143 1.00 84.94  ? 504 ARG I NE    1 
ATOM   3773 C  CZ    . ARG H 3 3  ? 33.838 35.624  48.845 1.00 86.91  ? 504 ARG I CZ    1 
ATOM   3774 N  NH1   . ARG H 3 3  ? 33.798 34.347  48.489 1.00 88.27  ? 504 ARG I NH1   1 
ATOM   3775 N  NH2   . ARG H 3 3  ? 33.155 36.033  49.906 1.00 88.33  ? 504 ARG I NH2   1 
ATOM   3776 N  N     . PRO H 3 4  ? 34.754 38.707  43.745 1.00 53.53  ? 505 PRO I N     1 
ATOM   3777 C  CA    . PRO H 3 4  ? 34.260 40.063  43.486 1.00 48.80  ? 505 PRO I CA    1 
ATOM   3778 C  C     . PRO H 3 4  ? 34.773 41.045  44.545 1.00 43.68  ? 505 PRO I C     1 
ATOM   3779 O  O     . PRO H 3 4  ? 34.946 40.680  45.706 1.00 41.79  ? 505 PRO I O     1 
ATOM   3780 C  CB    . PRO H 3 4  ? 32.742 39.897  43.551 1.00 49.71  ? 505 PRO I CB    1 
ATOM   3781 C  CG    . PRO H 3 4  ? 32.533 38.462  43.159 1.00 51.95  ? 505 PRO I CG    1 
ATOM   3782 C  CD    . PRO H 3 4  ? 33.632 37.768  43.913 1.00 53.51  ? 505 PRO I CD    1 
ATOM   3783 N  N     . PRO H 3 5  ? 35.033 42.300  44.153 1.00 38.27  ? 506 PRO I N     1 
ATOM   3784 C  CA    . PRO H 3 5  ? 35.523 43.301  45.111 1.00 35.13  ? 506 PRO I CA    1 
ATOM   3785 C  C     . PRO H 3 5  ? 34.560 43.456  46.291 1.00 31.34  ? 506 PRO I C     1 
ATOM   3786 O  O     . PRO H 3 5  ? 34.985 43.614  47.437 1.00 30.38  ? 506 PRO I O     1 
ATOM   3787 C  CB    . PRO H 3 5  ? 35.604 44.570  44.269 1.00 36.09  ? 506 PRO I CB    1 
ATOM   3788 C  CG    . PRO H 3 5  ? 35.924 44.044  42.907 1.00 39.02  ? 506 PRO I CG    1 
ATOM   3789 C  CD    . PRO H 3 5  ? 34.998 42.854  42.789 1.00 39.00  ? 506 PRO I CD    1 
ATOM   3790 N  N     . PHE H 3 6  ? 33.261 43.403  45.999 1.00 26.56  ? 507 PHE I N     1 
ATOM   3791 C  CA    . PHE H 3 6  ? 32.226 43.525  47.020 1.00 23.90  ? 507 PHE I CA    1 
ATOM   3792 C  C     . PHE H 3 6  ? 31.052 42.595  46.722 1.00 22.26  ? 507 PHE I C     1 
ATOM   3793 O  O     . PHE H 3 6  ? 30.823 42.216  45.574 1.00 21.68  ? 507 PHE I O     1 
ATOM   3794 C  CB    . PHE H 3 6  ? 31.677 44.963  47.083 1.00 25.25  ? 507 PHE I CB    1 
ATOM   3795 C  CG    . PHE H 3 6  ? 32.723 46.009  47.375 1.00 24.80  ? 507 PHE I CG    1 
ATOM   3796 C  CD1   . PHE H 3 6  ? 33.492 46.544  46.349 1.00 25.70  ? 507 PHE I CD1   1 
ATOM   3797 C  CD2   . PHE H 3 6  ? 32.948 46.441  48.678 1.00 25.47  ? 507 PHE I CD2   1 
ATOM   3798 C  CE1   . PHE H 3 6  ? 34.473 47.500  46.610 1.00 26.39  ? 507 PHE I CE1   1 
ATOM   3799 C  CE2   . PHE H 3 6  ? 33.931 47.402  48.952 1.00 25.62  ? 507 PHE I CE2   1 
ATOM   3800 C  CZ    . PHE H 3 6  ? 34.693 47.929  47.912 1.00 24.89  ? 507 PHE I CZ    1 
ATOM   3801 N  N     . THR H 3 7  ? 30.318 42.240  47.770 1.00 20.79  ? 508 THR I N     1 
ATOM   3802 C  CA    . THR H 3 7  ? 29.120 41.417  47.647 1.00 19.68  ? 508 THR I CA    1 
ATOM   3803 C  C     . THR H 3 7  ? 28.179 42.024  48.671 1.00 19.29  ? 508 THR I C     1 
ATOM   3804 O  O     . THR H 3 7  ? 28.621 42.798  49.527 1.00 19.67  ? 508 THR I O     1 
ATOM   3805 C  CB    . THR H 3 7  ? 29.383 39.939  48.017 1.00 20.33  ? 508 THR I CB    1 
ATOM   3806 O  OG1   . THR H 3 7  ? 29.654 39.836  49.418 1.00 19.83  ? 508 THR I OG1   1 
ATOM   3807 C  CG2   . THR H 3 7  ? 30.571 39.414  47.250 1.00 20.67  ? 508 THR I CG2   1 
ATOM   3808 N  N     . TYR H 3 8  ? 26.894 41.700  48.605 1.00 17.89  ? 509 TYR I N     1 
ATOM   3809 C  CA    . TYR H 3 8  ? 25.979 42.265  49.579 1.00 18.00  ? 509 TYR I CA    1 
ATOM   3810 C  C     . TYR H 3 8  ? 26.420 41.835  50.967 1.00 19.84  ? 509 TYR I C     1 
ATOM   3811 O  O     . TYR H 3 8  ? 26.331 42.609  51.925 1.00 16.98  ? 509 TYR I O     1 
ATOM   3812 C  CB    . TYR H 3 8  ? 24.540 41.817  49.310 1.00 18.53  ? 509 TYR I CB    1 
ATOM   3813 C  CG    . TYR H 3 8  ? 23.997 42.402  48.024 1.00 17.20  ? 509 TYR I CG    1 
ATOM   3814 C  CD1   . TYR H 3 8  ? 23.877 41.619  46.871 1.00 15.69  ? 509 TYR I CD1   1 
ATOM   3815 C  CD2   . TYR H 3 8  ? 23.646 43.754  47.946 1.00 17.67  ? 509 TYR I CD2   1 
ATOM   3816 C  CE1   . TYR H 3 8  ? 23.423 42.165  45.671 1.00 16.91  ? 509 TYR I CE1   1 
ATOM   3817 C  CE2   . TYR H 3 8  ? 23.184 44.317  46.738 1.00 17.97  ? 509 TYR I CE2   1 
ATOM   3818 C  CZ    . TYR H 3 8  ? 23.075 43.513  45.613 1.00 18.63  ? 509 TYR I CZ    1 
ATOM   3819 O  OH    . TYR H 3 8  ? 22.592 44.024  44.422 1.00 19.58  ? 509 TYR I OH    1 
ATOM   3820 N  N     . ALA H 3 9  ? 26.924 40.611  51.066 1.00 18.59  ? 510 ALA I N     1 
ATOM   3821 C  CA    . ALA H 3 9  ? 27.380 40.099  52.353 1.00 20.77  ? 510 ALA I CA    1 
ATOM   3822 C  C     . ALA H 3 9  ? 28.553 40.916  52.924 1.00 19.71  ? 510 ALA I C     1 
ATOM   3823 O  O     . ALA H 3 9  ? 28.526 41.313  54.095 1.00 21.23  ? 510 ALA I O     1 
ATOM   3824 C  CB    . ALA H 3 9  ? 27.783 38.633  52.215 1.00 21.46  ? 510 ALA I CB    1 
ATOM   3825 N  N     . THR H 3 10 ? 29.583 41.173  52.125 1.00 18.69  ? 511 THR I N     1 
ATOM   3826 C  CA    . THR H 3 10 ? 30.711 41.930  52.669 1.00 20.64  ? 511 THR I CA    1 
ATOM   3827 C  C     . THR H 3 10 ? 30.303 43.358  53.027 1.00 20.83  ? 511 THR I C     1 
ATOM   3828 O  O     . THR H 3 10 ? 30.794 43.917  54.003 1.00 19.27  ? 511 THR I O     1 
ATOM   3829 C  CB    . THR H 3 10 ? 31.941 41.962  51.715 1.00 21.44  ? 511 THR I CB    1 
ATOM   3830 O  OG1   . THR H 3 10 ? 31.630 42.688  50.525 1.00 22.18  ? 511 THR I OG1   1 
ATOM   3831 C  CG2   . THR H 3 10 ? 32.358 40.550  51.327 1.00 22.37  ? 511 THR I CG2   1 
ATOM   3832 N  N     . LEU H 3 11 ? 29.384 43.936  52.255 1.00 19.56  ? 512 LEU I N     1 
ATOM   3833 C  CA    . LEU H 3 11 ? 28.918 45.297  52.510 1.00 20.44  ? 512 LEU I CA    1 
ATOM   3834 C  C     . LEU H 3 11 ? 28.050 45.376  53.762 1.00 20.85  ? 512 LEU I C     1 
ATOM   3835 O  O     . LEU H 3 11 ? 28.164 46.318  54.543 1.00 20.40  ? 512 LEU I O     1 
ATOM   3836 C  CB    . LEU H 3 11 ? 28.142 45.829  51.301 1.00 19.96  ? 512 LEU I CB    1 
ATOM   3837 C  CG    . LEU H 3 11 ? 28.998 46.134  50.071 1.00 22.31  ? 512 LEU I CG    1 
ATOM   3838 C  CD1   . LEU H 3 11 ? 28.098 46.351  48.867 1.00 20.17  ? 512 LEU I CD1   1 
ATOM   3839 C  CD2   . LEU H 3 11 ? 29.860 47.367  50.339 1.00 21.06  ? 512 LEU I CD2   1 
ATOM   3840 N  N     . ILE H 3 12 ? 27.175 44.395  53.958 1.00 20.57  ? 513 ILE I N     1 
ATOM   3841 C  CA    . ILE H 3 12 ? 26.332 44.398  55.148 1.00 21.43  ? 513 ILE I CA    1 
ATOM   3842 C  C     . ILE H 3 12 ? 27.243 44.258  56.373 1.00 22.14  ? 513 ILE I C     1 
ATOM   3843 O  O     . ILE H 3 12 ? 27.073 44.963  57.364 1.00 21.01  ? 513 ILE I O     1 
ATOM   3844 C  CB    . ILE H 3 12 ? 25.305 43.236  55.120 1.00 21.82  ? 513 ILE I CB    1 
ATOM   3845 C  CG1   . ILE H 3 12 ? 24.273 43.486  54.008 1.00 23.73  ? 513 ILE I CG1   1 
ATOM   3846 C  CG2   . ILE H 3 12 ? 24.597 43.131  56.478 1.00 21.04  ? 513 ILE I CG2   1 
ATOM   3847 C  CD1   . ILE H 3 12 ? 23.419 42.268  53.662 1.00 21.38  ? 513 ILE I CD1   1 
ATOM   3848 N  N     . ARG H 3 13 ? 28.222 43.364  56.284 1.00 22.63  ? 514 ARG I N     1 
ATOM   3849 C  CA    . ARG H 3 13 ? 29.155 43.152  57.389 1.00 24.19  ? 514 ARG I CA    1 
ATOM   3850 C  C     . ARG H 3 13 ? 29.929 44.438  57.698 1.00 25.30  ? 514 ARG I C     1 
ATOM   3851 O  O     . ARG H 3 13 ? 30.128 44.787  58.860 1.00 23.41  ? 514 ARG I O     1 
ATOM   3852 C  CB    . ARG H 3 13 ? 30.146 42.037  57.052 1.00 25.76  ? 514 ARG I CB    1 
ATOM   3853 C  CG    . ARG H 3 13 ? 31.270 41.889  58.078 1.00 30.13  ? 514 ARG I CG    1 
ATOM   3854 C  CD    . ARG H 3 13 ? 32.149 40.702  57.753 1.00 33.94  ? 514 ARG I CD    1 
ATOM   3855 N  NE    . ARG H 3 13 ? 33.250 40.523  58.699 1.00 36.72  ? 514 ARG I NE    1 
ATOM   3856 C  CZ    . ARG H 3 13 ? 34.388 41.212  58.672 1.00 37.95  ? 514 ARG I CZ    1 
ATOM   3857 N  NH1   . ARG H 3 13 ? 34.586 42.136  57.743 1.00 37.96  ? 514 ARG I NH1   1 
ATOM   3858 N  NH2   . ARG H 3 13 ? 35.333 40.969  59.572 1.00 38.34  ? 514 ARG I NH2   1 
ATOM   3859 N  N     . GLN H 3 14 ? 30.369 45.139  56.660 1.00 24.34  ? 515 GLN I N     1 
ATOM   3860 C  CA    . GLN H 3 14 ? 31.102 46.384  56.869 1.00 27.22  ? 515 GLN I CA    1 
ATOM   3861 C  C     . GLN H 3 14 ? 30.230 47.400  57.611 1.00 28.33  ? 515 GLN I C     1 
ATOM   3862 O  O     . GLN H 3 14 ? 30.652 47.985  58.611 1.00 29.20  ? 515 GLN I O     1 
ATOM   3863 C  CB    . GLN H 3 14 ? 31.545 46.979  55.529 1.00 27.19  ? 515 GLN I CB    1 
ATOM   3864 C  CG    . GLN H 3 14 ? 32.620 48.061  55.659 1.00 29.48  ? 515 GLN I CG    1 
ATOM   3865 C  CD    . GLN H 3 14 ? 32.950 48.719  54.331 1.00 31.70  ? 515 GLN I CD    1 
ATOM   3866 O  OE1   . GLN H 3 14 ? 32.993 48.058  53.292 1.00 31.39  ? 515 GLN I OE1   1 
ATOM   3867 N  NE2   . GLN H 3 14 ? 33.198 50.026  54.360 1.00 32.30  ? 515 GLN I NE2   1 
ATOM   3868 N  N     . ALA H 3 15 ? 29.010 47.603  57.124 1.00 27.64  ? 516 ALA I N     1 
ATOM   3869 C  CA    . ALA H 3 15 ? 28.094 48.559  57.741 1.00 29.43  ? 516 ALA I CA    1 
ATOM   3870 C  C     . ALA H 3 15 ? 27.936 48.282  59.237 1.00 31.65  ? 516 ALA I C     1 
ATOM   3871 O  O     . ALA H 3 15 ? 28.034 49.186  60.074 1.00 30.69  ? 516 ALA I O     1 
ATOM   3872 C  CB    . ALA H 3 15 ? 26.744 48.492  57.055 1.00 28.55  ? 516 ALA I CB    1 
ATOM   3873 N  N     . ILE H 3 16 ? 27.705 47.018  59.567 1.00 32.75  ? 517 ILE I N     1 
ATOM   3874 C  CA    . ILE H 3 16 ? 27.519 46.621  60.949 1.00 35.11  ? 517 ILE I CA    1 
ATOM   3875 C  C     . ILE H 3 16 ? 28.794 46.756  61.778 1.00 37.28  ? 517 ILE I C     1 
ATOM   3876 O  O     . ILE H 3 16 ? 28.762 47.297  62.878 1.00 37.16  ? 517 ILE I O     1 
ATOM   3877 C  CB    . ILE H 3 16 ? 26.988 45.174  61.030 1.00 33.42  ? 517 ILE I CB    1 
ATOM   3878 C  CG1   . ILE H 3 16 ? 25.632 45.097  60.313 1.00 31.95  ? 517 ILE I CG1   1 
ATOM   3879 C  CG2   . ILE H 3 16 ? 26.880 44.736  62.494 1.00 32.58  ? 517 ILE I CG2   1 
ATOM   3880 C  CD1   . ILE H 3 16 ? 24.896 43.782  60.467 1.00 28.10  ? 517 ILE I CD1   1 
ATOM   3881 N  N     . MET H 3 17 ? 29.915 46.291  61.243 1.00 40.93  ? 518 MET I N     1 
ATOM   3882 C  CA    . MET H 3 17 ? 31.181 46.357  61.963 1.00 46.24  ? 518 MET I CA    1 
ATOM   3883 C  C     . MET H 3 17 ? 31.679 47.779  62.222 1.00 48.48  ? 518 MET I C     1 
ATOM   3884 O  O     . MET H 3 17 ? 32.272 48.051  63.266 1.00 48.25  ? 518 MET I O     1 
ATOM   3885 C  CB    . MET H 3 17 ? 32.250 45.559  61.211 1.00 48.55  ? 518 MET I CB    1 
ATOM   3886 C  CG    . MET H 3 17 ? 31.934 44.072  61.088 1.00 51.97  ? 518 MET I CG    1 
ATOM   3887 S  SD    . MET H 3 17 ? 31.862 43.201  62.678 1.00 58.36  ? 518 MET I SD    1 
ATOM   3888 C  CE    . MET H 3 17 ? 30.161 43.497  63.179 1.00 54.40  ? 518 MET I CE    1 
ATOM   3889 N  N     . GLU H 3 18 ? 31.435 48.687  61.283 1.00 50.66  ? 519 GLU I N     1 
ATOM   3890 C  CA    . GLU H 3 18 ? 31.885 50.063  61.448 1.00 52.92  ? 519 GLU I CA    1 
ATOM   3891 C  C     . GLU H 3 18 ? 30.948 50.867  62.342 1.00 54.47  ? 519 GLU I C     1 
ATOM   3892 O  O     . GLU H 3 18 ? 31.250 52.005  62.696 1.00 54.96  ? 519 GLU I O     1 
ATOM   3893 C  CB    . GLU H 3 18 ? 32.004 50.760  60.088 1.00 53.06  ? 519 GLU I CB    1 
ATOM   3894 C  CG    . GLU H 3 18 ? 32.855 50.021  59.069 1.00 53.55  ? 519 GLU I CG    1 
ATOM   3895 C  CD    . GLU H 3 18 ? 33.134 50.851  57.828 1.00 53.62  ? 519 GLU I CD    1 
ATOM   3896 O  OE1   . GLU H 3 18 ? 32.208 51.538  57.347 1.00 53.04  ? 519 GLU I OE1   1 
ATOM   3897 O  OE2   . GLU H 3 18 ? 34.278 50.807  57.328 1.00 53.58  ? 519 GLU I OE2   1 
ATOM   3898 N  N     . SER H 3 19 ? 29.817 50.275  62.712 1.00 56.83  ? 520 SER I N     1 
ATOM   3899 C  CA    . SER H 3 19 ? 28.841 50.963  63.554 1.00 58.87  ? 520 SER I CA    1 
ATOM   3900 C  C     . SER H 3 19 ? 29.248 51.003  65.025 1.00 60.93  ? 520 SER I C     1 
ATOM   3901 O  O     . SER H 3 19 ? 30.118 50.251  65.466 1.00 59.95  ? 520 SER I O     1 
ATOM   3902 C  CB    . SER H 3 19 ? 27.469 50.301  63.429 1.00 58.21  ? 520 SER I CB    1 
ATOM   3903 O  OG    . SER H 3 19 ? 27.447 49.046  64.082 1.00 58.25  ? 520 SER I OG    1 
ATOM   3904 N  N     . SER H 3 20 ? 28.591 51.881  65.777 1.00 63.59  ? 521 SER I N     1 
ATOM   3905 C  CA    . SER H 3 20 ? 28.864 52.066  67.199 1.00 66.38  ? 521 SER I CA    1 
ATOM   3906 C  C     . SER H 3 20 ? 28.701 50.809  68.051 1.00 68.00  ? 521 SER I C     1 
ATOM   3907 O  O     . SER H 3 20 ? 29.673 50.307  68.617 1.00 68.52  ? 521 SER I O     1 
ATOM   3908 C  CB    . SER H 3 20 ? 27.965 53.173  67.757 1.00 66.40  ? 521 SER I CB    1 
ATOM   3909 O  OG    . SER H 3 20 ? 28.212 54.407  67.108 1.00 66.65  ? 521 SER I OG    1 
ATOM   3910 N  N     . ASP H 3 21 ? 27.474 50.308  68.145 1.00 69.47  ? 522 ASP I N     1 
ATOM   3911 C  CA    . ASP H 3 21 ? 27.192 49.123  68.949 1.00 70.51  ? 522 ASP I CA    1 
ATOM   3912 C  C     . ASP H 3 21 ? 27.353 47.812  68.185 1.00 70.40  ? 522 ASP I C     1 
ATOM   3913 O  O     . ASP H 3 21 ? 26.914 46.761  68.654 1.00 70.02  ? 522 ASP I O     1 
ATOM   3914 C  CB    . ASP H 3 21 ? 25.770 49.200  69.517 1.00 72.95  ? 522 ASP I CB    1 
ATOM   3915 C  CG    . ASP H 3 21 ? 25.496 50.506  70.235 1.00 74.39  ? 522 ASP I CG    1 
ATOM   3916 O  OD1   . ASP H 3 21 ? 26.313 50.895  71.097 1.00 75.11  ? 522 ASP I OD1   1 
ATOM   3917 O  OD2   . ASP H 3 21 ? 24.460 51.140  69.942 1.00 75.61  ? 522 ASP I OD2   1 
ATOM   3918 N  N     . ARG H 3 22 ? 27.984 47.868  67.015 1.00 69.77  ? 523 ARG I N     1 
ATOM   3919 C  CA    . ARG H 3 22 ? 28.180 46.668  66.209 1.00 68.76  ? 523 ARG I CA    1 
ATOM   3920 C  C     . ARG H 3 22 ? 26.825 46.055  65.873 1.00 65.39  ? 523 ARG I C     1 
ATOM   3921 O  O     . ARG H 3 22 ? 26.702 44.839  65.725 1.00 64.09  ? 523 ARG I O     1 
ATOM   3922 C  CB    . ARG H 3 22 ? 29.021 45.646  66.975 1.00 72.85  ? 523 ARG I CB    1 
ATOM   3923 C  CG    . ARG H 3 22 ? 30.465 46.051  67.214 1.00 78.04  ? 523 ARG I CG    1 
ATOM   3924 C  CD    . ARG H 3 22 ? 31.346 45.714  66.021 1.00 82.23  ? 523 ARG I CD    1 
ATOM   3925 N  NE    . ARG H 3 22 ? 32.762 45.773  66.376 1.00 85.89  ? 523 ARG I NE    1 
ATOM   3926 C  CZ    . ARG H 3 22 ? 33.751 45.349  65.596 1.00 87.48  ? 523 ARG I CZ    1 
ATOM   3927 N  NH1   . ARG H 3 22 ? 33.487 44.832  64.405 1.00 88.41  ? 523 ARG I NH1   1 
ATOM   3928 N  NH2   . ARG H 3 22 ? 35.007 45.436  66.010 1.00 88.66  ? 523 ARG I NH2   1 
ATOM   3929 N  N     . GLN H 3 23 ? 25.809 46.907  65.770 1.00 61.16  ? 524 GLN I N     1 
ATOM   3930 C  CA    . GLN H 3 23 ? 24.453 46.470  65.453 1.00 57.33  ? 524 GLN I CA    1 
ATOM   3931 C  C     . GLN H 3 23 ? 23.767 47.571  64.659 1.00 53.58  ? 524 GLN I C     1 
ATOM   3932 O  O     . GLN H 3 23 ? 24.097 48.745  64.813 1.00 52.99  ? 524 GLN I O     1 
ATOM   3933 C  CB    . GLN H 3 23 ? 23.647 46.229  66.731 1.00 59.12  ? 524 GLN I CB    1 
ATOM   3934 C  CG    . GLN H 3 23 ? 24.383 45.500  67.835 1.00 61.53  ? 524 GLN I CG    1 
ATOM   3935 C  CD    . GLN H 3 23 ? 23.544 45.365  69.089 1.00 62.02  ? 524 GLN I CD    1 
ATOM   3936 O  OE1   . GLN H 3 23 ? 22.961 46.340  69.565 1.00 61.98  ? 524 GLN I OE1   1 
ATOM   3937 N  NE2   . GLN H 3 23 ? 23.482 44.156  69.636 1.00 62.59  ? 524 GLN I NE2   1 
ATOM   3938 N  N     . LEU H 3 24 ? 22.811 47.191  63.819 1.00 48.15  ? 525 LEU I N     1 
ATOM   3939 C  CA    . LEU H 3 24 ? 22.073 48.159  63.019 1.00 42.92  ? 525 LEU I CA    1 
ATOM   3940 C  C     . LEU H 3 24 ? 20.667 47.665  62.721 1.00 40.15  ? 525 LEU I C     1 
ATOM   3941 O  O     . LEU H 3 24 ? 20.443 46.468  62.546 1.00 37.48  ? 525 LEU I O     1 
ATOM   3942 C  CB    . LEU H 3 24 ? 22.783 48.430  61.688 1.00 41.28  ? 525 LEU I CB    1 
ATOM   3943 C  CG    . LEU H 3 24 ? 24.151 49.115  61.648 1.00 39.78  ? 525 LEU I CG    1 
ATOM   3944 C  CD1   . LEU H 3 24 ? 24.548 49.340  60.192 1.00 37.21  ? 525 LEU I CD1   1 
ATOM   3945 C  CD2   . LEU H 3 24 ? 24.097 50.444  62.395 1.00 38.99  ? 525 LEU I CD2   1 
ATOM   3946 N  N     . THR H 3 25 ? 19.718 48.592  62.676 1.00 37.98  ? 526 THR I N     1 
ATOM   3947 C  CA    . THR H 3 25 ? 18.345 48.240  62.355 1.00 37.40  ? 526 THR I CA    1 
ATOM   3948 C  C     . THR H 3 25 ? 18.339 48.143  60.835 1.00 36.18  ? 526 THR I C     1 
ATOM   3949 O  O     . THR H 3 25 ? 19.281 48.593  60.187 1.00 35.14  ? 526 THR I O     1 
ATOM   3950 C  CB    . THR H 3 25 ? 17.363 49.341  62.787 1.00 37.58  ? 526 THR I CB    1 
ATOM   3951 O  OG1   . THR H 3 25 ? 17.633 50.536  62.048 1.00 36.41  ? 526 THR I OG1   1 
ATOM   3952 C  CG2   . THR H 3 25 ? 17.509 49.631  64.271 1.00 38.42  ? 526 THR I CG2   1 
ATOM   3953 N  N     . LEU H 3 26 ? 17.296 47.557  60.263 1.00 35.84  ? 527 LEU I N     1 
ATOM   3954 C  CA    . LEU H 3 26 ? 17.229 47.443  58.813 1.00 35.34  ? 527 LEU I CA    1 
ATOM   3955 C  C     . LEU H 3 26 ? 17.311 48.847  58.204 1.00 35.66  ? 527 LEU I C     1 
ATOM   3956 O  O     . LEU H 3 26 ? 18.084 49.089  57.277 1.00 34.66  ? 527 LEU I O     1 
ATOM   3957 C  CB    . LEU H 3 26 ? 15.925 46.763  58.391 1.00 36.45  ? 527 LEU I CB    1 
ATOM   3958 C  CG    . LEU H 3 26 ? 15.772 46.487  56.894 1.00 36.13  ? 527 LEU I CG    1 
ATOM   3959 C  CD1   . LEU H 3 26 ? 16.872 45.538  56.427 1.00 37.24  ? 527 LEU I CD1   1 
ATOM   3960 C  CD2   . LEU H 3 26 ? 14.406 45.886  56.626 1.00 38.01  ? 527 LEU I CD2   1 
ATOM   3961 N  N     . ASN H 3 27 ? 16.524 49.775  58.739 1.00 34.62  ? 528 ASN I N     1 
ATOM   3962 C  CA    . ASN H 3 27 ? 16.530 51.141  58.228 1.00 35.05  ? 528 ASN I CA    1 
ATOM   3963 C  C     . ASN H 3 27 ? 17.920 51.770  58.266 1.00 33.83  ? 528 ASN I C     1 
ATOM   3964 O  O     . ASN H 3 27 ? 18.270 52.561  57.392 1.00 33.50  ? 528 ASN I O     1 
ATOM   3965 C  CB    . ASN H 3 27 ? 15.550 52.017  59.012 1.00 38.26  ? 528 ASN I CB    1 
ATOM   3966 C  CG    . ASN H 3 27 ? 14.112 51.575  58.841 1.00 41.05  ? 528 ASN I CG    1 
ATOM   3967 O  OD1   . ASN H 3 27 ? 13.644 51.365  57.722 1.00 43.70  ? 528 ASN I OD1   1 
ATOM   3968 N  ND2   . ASN H 3 27 ? 13.398 51.439  59.952 1.00 44.27  ? 528 ASN I ND2   1 
ATOM   3969 N  N     . GLU H 3 28 ? 18.709 51.424  59.277 1.00 32.49  ? 529 GLU I N     1 
ATOM   3970 C  CA    . GLU H 3 28 ? 20.058 51.972  59.386 1.00 31.22  ? 529 GLU I CA    1 
ATOM   3971 C  C     . GLU H 3 28 ? 20.945 51.347  58.322 1.00 29.39  ? 529 GLU I C     1 
ATOM   3972 O  O     . GLU H 3 28 ? 21.824 52.008  57.772 1.00 26.83  ? 529 GLU I O     1 
ATOM   3973 C  CB    . GLU H 3 28 ? 20.647 51.701  60.768 1.00 34.13  ? 529 GLU I CB    1 
ATOM   3974 C  CG    . GLU H 3 28 ? 19.894 52.367  61.896 1.00 37.95  ? 529 GLU I CG    1 
ATOM   3975 C  CD    . GLU H 3 28 ? 20.539 52.118  63.239 1.00 39.85  ? 529 GLU I CD    1 
ATOM   3976 O  OE1   . GLU H 3 28 ? 21.612 52.698  63.500 1.00 41.74  ? 529 GLU I OE1   1 
ATOM   3977 O  OE2   . GLU H 3 28 ? 19.980 51.333  64.030 1.00 41.99  ? 529 GLU I OE2   1 
ATOM   3978 N  N     . ILE H 3 29 ? 20.723 50.066  58.040 1.00 27.21  ? 530 ILE I N     1 
ATOM   3979 C  CA    . ILE H 3 29 ? 21.506 49.395  57.019 1.00 25.29  ? 530 ILE I CA    1 
ATOM   3980 C  C     . ILE H 3 29 ? 21.155 50.026  55.678 1.00 25.60  ? 530 ILE I C     1 
ATOM   3981 O  O     . ILE H 3 29 ? 22.028 50.220  54.832 1.00 24.45  ? 530 ILE I O     1 
ATOM   3982 C  CB    . ILE H 3 29 ? 21.212 47.879  56.984 1.00 25.68  ? 530 ILE I CB    1 
ATOM   3983 C  CG1   . ILE H 3 29 ? 21.713 47.231  58.285 1.00 25.17  ? 530 ILE I CG1   1 
ATOM   3984 C  CG2   . ILE H 3 29 ? 21.895 47.246  55.769 1.00 23.79  ? 530 ILE I CG2   1 
ATOM   3985 C  CD1   . ILE H 3 29 ? 21.387 45.749  58.431 1.00 27.72  ? 530 ILE I CD1   1 
ATOM   3986 N  N     . TYR H 3 30 ? 19.878 50.357  55.492 1.00 26.02  ? 531 TYR I N     1 
ATOM   3987 C  CA    . TYR H 3 30 ? 19.424 50.985  54.247 1.00 27.19  ? 531 TYR I CA    1 
ATOM   3988 C  C     . TYR H 3 30 ? 20.078 52.354  54.077 1.00 26.57  ? 531 TYR I C     1 
ATOM   3989 O  O     . TYR H 3 30 ? 20.494 52.723  52.979 1.00 26.72  ? 531 TYR I O     1 
ATOM   3990 C  CB    . TYR H 3 30 ? 17.906 51.175  54.248 1.00 28.96  ? 531 TYR I CB    1 
ATOM   3991 C  CG    . TYR H 3 30 ? 17.079 49.936  53.969 1.00 31.67  ? 531 TYR I CG    1 
ATOM   3992 C  CD1   . TYR H 3 30 ? 15.693 49.979  54.076 1.00 33.27  ? 531 TYR I CD1   1 
ATOM   3993 C  CD2   . TYR H 3 30 ? 17.673 48.727  53.598 1.00 32.86  ? 531 TYR I CD2   1 
ATOM   3994 C  CE1   . TYR H 3 30 ? 14.910 48.860  53.826 1.00 35.93  ? 531 TYR I CE1   1 
ATOM   3995 C  CE2   . TYR H 3 30 ? 16.894 47.591  53.341 1.00 34.04  ? 531 TYR I CE2   1 
ATOM   3996 C  CZ    . TYR H 3 30 ? 15.510 47.671  53.459 1.00 35.14  ? 531 TYR I CZ    1 
ATOM   3997 O  OH    . TYR H 3 30 ? 14.715 46.578  53.204 1.00 36.53  ? 531 TYR I OH    1 
ATOM   3998 N  N     . SER H 3 31 ? 20.146 53.114  55.165 1.00 26.48  ? 532 SER I N     1 
ATOM   3999 C  CA    . SER H 3 31 ? 20.756 54.438  55.118 1.00 25.97  ? 532 SER I CA    1 
ATOM   4000 C  C     . SER H 3 31 ? 22.208 54.320  54.699 1.00 24.12  ? 532 SER I C     1 
ATOM   4001 O  O     . SER H 3 31 ? 22.690 55.108  53.895 1.00 24.51  ? 532 SER I O     1 
ATOM   4002 C  CB    . SER H 3 31 ? 20.671 55.113  56.485 1.00 29.39  ? 532 SER I CB    1 
ATOM   4003 O  OG    . SER H 3 31 ? 19.323 55.238  56.889 1.00 36.11  ? 532 SER I OG    1 
ATOM   4004 N  N     . TRP H 3 32 ? 22.904 53.329  55.251 1.00 21.75  ? 533 TRP I N     1 
ATOM   4005 C  CA    . TRP H 3 32 ? 24.305 53.104  54.921 1.00 20.84  ? 533 TRP I CA    1 
ATOM   4006 C  C     . TRP H 3 32 ? 24.434 52.760  53.434 1.00 20.13  ? 533 TRP I C     1 
ATOM   4007 O  O     . TRP H 3 32 ? 25.296 53.295  52.741 1.00 18.67  ? 533 TRP I O     1 
ATOM   4008 C  CB    . TRP H 3 32 ? 24.869 51.962  55.776 1.00 21.49  ? 533 TRP I CB    1 
ATOM   4009 C  CG    . TRP H 3 32 ? 26.360 51.777  55.660 1.00 21.45  ? 533 TRP I CG    1 
ATOM   4010 C  CD1   . TRP H 3 32 ? 27.323 52.349  56.449 1.00 22.18  ? 533 TRP I CD1   1 
ATOM   4011 C  CD2   . TRP H 3 32 ? 27.057 50.969  54.701 1.00 21.18  ? 533 TRP I CD2   1 
ATOM   4012 N  NE1   . TRP H 3 32 ? 28.569 51.948  56.040 1.00 22.58  ? 533 TRP I NE1   1 
ATOM   4013 C  CE2   . TRP H 3 32 ? 28.438 51.105  54.967 1.00 20.39  ? 533 TRP I CE2   1 
ATOM   4014 C  CE3   . TRP H 3 32 ? 26.650 50.154  53.635 1.00 20.53  ? 533 TRP I CE3   1 
ATOM   4015 C  CZ2   . TRP H 3 32 ? 29.416 50.447  54.214 1.00 20.40  ? 533 TRP I CZ2   1 
ATOM   4016 C  CZ3   . TRP H 3 32 ? 27.626 49.500  52.882 1.00 19.51  ? 533 TRP I CZ3   1 
ATOM   4017 C  CH2   . TRP H 3 32 ? 28.991 49.654  53.174 1.00 21.65  ? 533 TRP I CH2   1 
ATOM   4018 N  N     . PHE H 3 33 ? 23.581 51.862  52.941 1.00 18.29  ? 534 PHE I N     1 
ATOM   4019 C  CA    . PHE H 3 33 ? 23.631 51.480  51.526 1.00 19.92  ? 534 PHE I CA    1 
ATOM   4020 C  C     . PHE H 3 33 ? 23.278 52.667  50.631 1.00 19.87  ? 534 PHE I C     1 
ATOM   4021 O  O     . PHE H 3 33 ? 23.841 52.837  49.549 1.00 20.47  ? 534 PHE I O     1 
ATOM   4022 C  CB    . PHE H 3 33 ? 22.665 50.316  51.250 1.00 19.99  ? 534 PHE I CB    1 
ATOM   4023 C  CG    . PHE H 3 33 ? 23.310 48.953  51.361 1.00 18.63  ? 534 PHE I CG    1 
ATOM   4024 C  CD1   . PHE H 3 33 ? 23.638 48.230  50.215 1.00 19.89  ? 534 PHE I CD1   1 
ATOM   4025 C  CD2   . PHE H 3 33 ? 23.624 48.414  52.604 1.00 18.35  ? 534 PHE I CD2   1 
ATOM   4026 C  CE1   . PHE H 3 33 ? 24.276 46.985  50.302 1.00 19.99  ? 534 PHE I CE1   1 
ATOM   4027 C  CE2   . PHE H 3 33 ? 24.262 47.173  52.709 1.00 17.78  ? 534 PHE I CE2   1 
ATOM   4028 C  CZ    . PHE H 3 33 ? 24.589 46.456  51.551 1.00 18.41  ? 534 PHE I CZ    1 
ATOM   4029 N  N     . THR H 3 34 ? 22.342 53.494  51.079 1.00 21.16  ? 535 THR I N     1 
ATOM   4030 C  CA    . THR H 3 34 ? 21.958 54.639  50.274 1.00 22.79  ? 535 THR I CA    1 
ATOM   4031 C  C     . THR H 3 34 ? 23.184 55.522  50.067 1.00 22.68  ? 535 THR I C     1 
ATOM   4032 O  O     . THR H 3 34 ? 23.503 55.902  48.937 1.00 22.50  ? 535 THR I O     1 
ATOM   4033 C  CB    . THR H 3 34 ? 20.823 55.434  50.955 1.00 24.49  ? 535 THR I CB    1 
ATOM   4034 O  OG1   . THR H 3 34 ? 19.652 54.606  51.041 1.00 23.26  ? 535 THR I OG1   1 
ATOM   4035 C  CG2   . THR H 3 34 ? 20.503 56.698  50.168 1.00 26.18  ? 535 THR I CG2   1 
ATOM   4036 N  N     . ARG H 3 35 ? 23.888 55.814  51.158 1.00 22.18  ? 536 ARG I N     1 
ATOM   4037 C  CA    . ARG H 3 35 ? 25.074 56.658  51.100 1.00 23.94  ? 536 ARG I CA    1 
ATOM   4038 C  C     . ARG H 3 35 ? 26.176 56.015  50.272 1.00 22.98  ? 536 ARG I C     1 
ATOM   4039 O  O     . ARG H 3 35 ? 26.849 56.685  49.495 1.00 22.17  ? 536 ARG I O     1 
ATOM   4040 C  CB    . ARG H 3 35 ? 25.600 56.951  52.514 1.00 26.30  ? 536 ARG I CB    1 
ATOM   4041 C  CG    . ARG H 3 35 ? 24.665 57.792  53.378 1.00 31.06  ? 536 ARG I CG    1 
ATOM   4042 C  CD    . ARG H 3 35 ? 25.341 58.218  54.679 1.00 35.11  ? 536 ARG I CD    1 
ATOM   4043 N  NE    . ARG H 3 35 ? 25.491 57.121  55.635 1.00 38.69  ? 536 ARG I NE    1 
ATOM   4044 C  CZ    . ARG H 3 35 ? 24.542 56.727  56.482 1.00 40.66  ? 536 ARG I CZ    1 
ATOM   4045 N  NH1   . ARG H 3 35 ? 23.366 57.342  56.502 1.00 41.11  ? 536 ARG I NH1   1 
ATOM   4046 N  NH2   . ARG H 3 35 ? 24.771 55.717  57.313 1.00 40.68  ? 536 ARG I NH2   1 
ATOM   4047 N  N     . THR H 3 36 ? 26.357 54.710  50.441 1.00 21.57  ? 537 THR I N     1 
ATOM   4048 C  CA    . THR H 3 36 ? 27.383 53.991  49.705 1.00 19.31  ? 537 THR I CA    1 
ATOM   4049 C  C     . THR H 3 36 ? 27.126 53.972  48.193 1.00 18.94  ? 537 THR I C     1 
ATOM   4050 O  O     . THR H 3 36 ? 28.016 54.290  47.406 1.00 17.96  ? 537 THR I O     1 
ATOM   4051 C  CB    . THR H 3 36 ? 27.523 52.550  50.247 1.00 18.74  ? 537 THR I CB    1 
ATOM   4052 O  OG1   . THR H 3 36 ? 28.004 52.608  51.601 1.00 21.05  ? 537 THR I OG1   1 
ATOM   4053 C  CG2   . THR H 3 36 ? 28.504 51.739  49.392 1.00 18.75  ? 537 THR I CG2   1 
ATOM   4054 N  N     . PHE H 3 37 ? 25.920 53.610  47.771 1.00 18.00  ? 538 PHE I N     1 
ATOM   4055 C  CA    . PHE H 3 37 ? 25.660 53.600  46.335 1.00 17.94  ? 538 PHE I CA    1 
ATOM   4056 C  C     . PHE H 3 37 ? 25.780 55.012  45.745 1.00 18.76  ? 538 PHE I C     1 
ATOM   4057 O  O     . PHE H 3 37 ? 26.228 55.180  44.610 1.00 18.41  ? 538 PHE I O     1 
ATOM   4058 C  CB    . PHE H 3 37 ? 24.292 52.971  46.032 1.00 17.22  ? 538 PHE I CB    1 
ATOM   4059 C  CG    . PHE H 3 37 ? 24.347 51.462  45.877 1.00 17.58  ? 538 PHE I CG    1 
ATOM   4060 C  CD1   . PHE H 3 37 ? 24.463 50.633  46.993 1.00 18.08  ? 538 PHE I CD1   1 
ATOM   4061 C  CD2   . PHE H 3 37 ? 24.355 50.881  44.610 1.00 17.21  ? 538 PHE I CD2   1 
ATOM   4062 C  CE1   . PHE H 3 37 ? 24.590 49.245  46.846 1.00 19.04  ? 538 PHE I CE1   1 
ATOM   4063 C  CE2   . PHE H 3 37 ? 24.482 49.489  44.450 1.00 19.01  ? 538 PHE I CE2   1 
ATOM   4064 C  CZ    . PHE H 3 37 ? 24.602 48.674  45.569 1.00 17.86  ? 538 PHE I CZ    1 
ATOM   4065 N  N     . ALA H 3 38 ? 25.413 56.026  46.518 1.00 20.69  ? 539 ALA I N     1 
ATOM   4066 C  CA    . ALA H 3 38 ? 25.523 57.403  46.037 1.00 22.48  ? 539 ALA I CA    1 
ATOM   4067 C  C     . ALA H 3 38 ? 26.997 57.740  45.769 1.00 22.58  ? 539 ALA I C     1 
ATOM   4068 O  O     . ALA H 3 38 ? 27.327 58.378  44.770 1.00 21.78  ? 539 ALA I O     1 
ATOM   4069 C  CB    . ALA H 3 38 ? 24.937 58.369  47.070 1.00 22.99  ? 539 ALA I CB    1 
ATOM   4070 N  N     . TYR H 3 39 ? 27.885 57.299  46.657 1.00 21.27  ? 540 TYR I N     1 
ATOM   4071 C  CA    . TYR H 3 39 ? 29.312 57.568  46.497 1.00 22.99  ? 540 TYR I CA    1 
ATOM   4072 C  C     . TYR H 3 39 ? 29.839 57.000  45.183 1.00 24.91  ? 540 TYR I C     1 
ATOM   4073 O  O     . TYR H 3 39 ? 30.615 57.648  44.480 1.00 23.38  ? 540 TYR I O     1 
ATOM   4074 C  CB    . TYR H 3 39 ? 30.111 56.963  47.660 1.00 20.49  ? 540 TYR I CB    1 
ATOM   4075 C  CG    . TYR H 3 39 ? 31.606 57.174  47.559 1.00 20.45  ? 540 TYR I CG    1 
ATOM   4076 C  CD1   . TYR H 3 39 ? 32.204 58.358  48.012 1.00 22.85  ? 540 TYR I CD1   1 
ATOM   4077 C  CD2   . TYR H 3 39 ? 32.428 56.198  47.002 1.00 19.01  ? 540 TYR I CD2   1 
ATOM   4078 C  CE1   . TYR H 3 39 ? 33.590 58.551  47.908 1.00 19.68  ? 540 TYR I CE1   1 
ATOM   4079 C  CE2   . TYR H 3 39 ? 33.807 56.382  46.892 1.00 19.65  ? 540 TYR I CE2   1 
ATOM   4080 C  CZ    . TYR H 3 39 ? 34.379 57.567  47.351 1.00 19.52  ? 540 TYR I CZ    1 
ATOM   4081 O  OH    . TYR H 3 39 ? 35.737 57.732  47.245 1.00 19.04  ? 540 TYR I OH    1 
ATOM   4082 N  N     . PHE H 3 40 ? 29.413 55.786  44.846 1.00 24.64  ? 541 PHE I N     1 
ATOM   4083 C  CA    . PHE H 3 40 ? 29.885 55.141  43.622 1.00 30.18  ? 541 PHE I CA    1 
ATOM   4084 C  C     . PHE H 3 40 ? 29.240 55.595  42.321 1.00 35.26  ? 541 PHE I C     1 
ATOM   4085 O  O     . PHE H 3 40 ? 29.662 55.178  41.241 1.00 35.08  ? 541 PHE I O     1 
ATOM   4086 C  CB    . PHE H 3 40 ? 29.774 53.620  43.766 1.00 26.63  ? 541 PHE I CB    1 
ATOM   4087 C  CG    . PHE H 3 40 ? 30.777 53.047  44.720 1.00 24.03  ? 541 PHE I CG    1 
ATOM   4088 C  CD1   . PHE H 3 40 ? 30.424 52.732  46.026 1.00 24.48  ? 541 PHE I CD1   1 
ATOM   4089 C  CD2   . PHE H 3 40 ? 32.102 52.880  44.326 1.00 24.58  ? 541 PHE I CD2   1 
ATOM   4090 C  CE1   . PHE H 3 40 ? 31.379 52.256  46.926 1.00 23.85  ? 541 PHE I CE1   1 
ATOM   4091 C  CE2   . PHE H 3 40 ? 33.060 52.406  45.216 1.00 23.86  ? 541 PHE I CE2   1 
ATOM   4092 C  CZ    . PHE H 3 40 ? 32.697 52.094  46.519 1.00 22.39  ? 541 PHE I CZ    1 
ATOM   4093 N  N     . ARG H 3 41 ? 28.230 56.451  42.413 1.00 42.26  ? 542 ARG I N     1 
ATOM   4094 C  CA    . ARG H 3 41 ? 27.573 56.936  41.208 1.00 50.88  ? 542 ARG I CA    1 
ATOM   4095 C  C     . ARG H 3 41 ? 28.438 58.020  40.552 1.00 54.15  ? 542 ARG I C     1 
ATOM   4096 O  O     . ARG H 3 41 ? 28.074 59.200  40.524 1.00 54.16  ? 542 ARG I O     1 
ATOM   4097 C  CB    . ARG H 3 41 ? 26.186 57.481  41.549 1.00 54.36  ? 542 ARG I CB    1 
ATOM   4098 C  CG    . ARG H 3 41 ? 25.337 57.791  40.335 1.00 61.07  ? 542 ARG I CG    1 
ATOM   4099 C  CD    . ARG H 3 41 ? 23.908 58.106  40.711 1.00 66.07  ? 542 ARG I CD    1 
ATOM   4100 N  NE    . ARG H 3 41 ? 23.070 58.268  39.525 1.00 71.18  ? 542 ARG I NE    1 
ATOM   4101 C  CZ    . ARG H 3 41 ? 21.781 58.592  39.555 1.00 73.92  ? 542 ARG I CZ    1 
ATOM   4102 N  NH1   . ARG H 3 41 ? 21.168 58.791  40.716 1.00 75.59  ? 542 ARG I NH1   1 
ATOM   4103 N  NH2   . ARG H 3 41 ? 21.103 58.715  38.420 1.00 75.64  ? 542 ARG I NH2   1 
ATOM   4104 N  N     . ARG H 3 42 ? 29.593 57.596  40.040 1.00 58.47  ? 543 ARG I N     1 
ATOM   4105 C  CA    . ARG H 3 42 ? 30.559 58.475  39.378 1.00 62.53  ? 543 ARG I CA    1 
ATOM   4106 C  C     . ARG H 3 42 ? 30.978 57.835  38.046 1.00 64.11  ? 543 ARG I C     1 
ATOM   4107 O  O     . ARG H 3 42 ? 30.825 56.629  37.862 1.00 64.55  ? 543 ARG I O     1 
ATOM   4108 C  CB    . ARG H 3 42 ? 31.802 58.649  40.259 1.00 64.35  ? 543 ARG I CB    1 
ATOM   4109 C  CG    . ARG H 3 42 ? 31.582 59.351  41.604 1.00 67.73  ? 543 ARG I CG    1 
ATOM   4110 C  CD    . ARG H 3 42 ? 32.696 58.964  42.577 1.00 70.43  ? 543 ARG I CD    1 
ATOM   4111 N  NE    . ARG H 3 42 ? 33.288 60.091  43.295 1.00 72.39  ? 543 ARG I NE    1 
ATOM   4112 C  CZ    . ARG H 3 42 ? 32.789 60.643  44.397 1.00 73.71  ? 543 ARG I CZ    1 
ATOM   4113 N  NH1   . ARG H 3 42 ? 31.671 60.178  44.932 1.00 74.52  ? 543 ARG I NH1   1 
ATOM   4114 N  NH2   . ARG H 3 42 ? 33.418 61.661  44.970 1.00 74.63  ? 543 ARG I NH2   1 
ATOM   4115 N  N     . ASN H 3 43 ? 31.516 58.632  37.126 1.00 65.46  ? 544 ASN I N     1 
ATOM   4116 C  CA    . ASN H 3 43 ? 31.940 58.098  35.832 1.00 66.93  ? 544 ASN I CA    1 
ATOM   4117 C  C     . ASN H 3 43 ? 33.424 57.750  35.816 1.00 67.17  ? 544 ASN I C     1 
ATOM   4118 O  O     . ASN H 3 43 ? 34.165 58.101  36.735 1.00 68.06  ? 544 ASN I O     1 
ATOM   4119 C  CB    . ASN H 3 43 ? 31.629 59.089  34.698 1.00 67.98  ? 544 ASN I CB    1 
ATOM   4120 C  CG    . ASN H 3 43 ? 32.458 60.361  34.773 1.00 68.23  ? 544 ASN I CG    1 
ATOM   4121 O  OD1   . ASN H 3 43 ? 33.678 60.318  34.926 1.00 67.65  ? 544 ASN I OD1   1 
ATOM   4122 N  ND2   . ASN H 3 43 ? 31.793 61.505  34.636 1.00 69.16  ? 544 ASN I ND2   1 
ATOM   4123 N  N     . ALA H 3 44 ? 33.849 57.052  34.766 1.00 66.90  ? 545 ALA I N     1 
ATOM   4124 C  CA    . ALA H 3 44 ? 35.243 56.645  34.613 1.00 65.80  ? 545 ALA I CA    1 
ATOM   4125 C  C     . ALA H 3 44 ? 36.170 57.848  34.539 1.00 64.19  ? 545 ALA I C     1 
ATOM   4126 O  O     . ALA H 3 44 ? 37.289 57.808  35.043 1.00 63.86  ? 545 ALA I O     1 
ATOM   4127 C  CB    . ALA H 3 44 ? 35.399 55.794  33.361 1.00 67.48  ? 545 ALA I CB    1 
ATOM   4128 N  N     . ALA H 3 45 ? 35.698 58.917  33.907 1.00 61.70  ? 546 ALA I N     1 
ATOM   4129 C  CA    . ALA H 3 45 ? 36.493 60.132  33.773 1.00 59.07  ? 546 ALA I CA    1 
ATOM   4130 C  C     . ALA H 3 45 ? 36.760 60.751  35.144 1.00 56.50  ? 546 ALA I C     1 
ATOM   4131 O  O     . ALA H 3 45 ? 37.804 61.367  35.371 1.00 56.18  ? 546 ALA I O     1 
ATOM   4132 C  CB    . ALA H 3 45 ? 35.768 61.135  32.888 1.00 59.58  ? 546 ALA I CB    1 
ATOM   4133 N  N     . THR H 3 46 ? 35.808 60.575  36.054 1.00 52.72  ? 547 THR I N     1 
ATOM   4134 C  CA    . THR H 3 46 ? 35.908 61.120  37.399 1.00 49.78  ? 547 THR I CA    1 
ATOM   4135 C  C     . THR H 3 46 ? 36.846 60.290  38.270 1.00 46.94  ? 547 THR I C     1 
ATOM   4136 O  O     . THR H 3 46 ? 37.829 60.807  38.800 1.00 46.60  ? 547 THR I O     1 
ATOM   4137 C  CB    . THR H 3 46 ? 34.532 61.174  38.067 1.00 49.37  ? 547 THR I CB    1 
ATOM   4138 O  OG1   . THR H 3 46 ? 33.657 61.981  37.275 1.00 50.86  ? 547 THR I OG1   1 
ATOM   4139 C  CG2   . THR H 3 46 ? 34.640 61.800  39.451 1.00 48.67  ? 547 THR I CG2   1 
ATOM   4140 N  N     . TRP H 3 47 ? 36.551 59.001  38.424 1.00 43.27  ? 548 TRP I N     1 
ATOM   4141 C  CA    . TRP H 3 47 ? 37.404 58.156  39.254 1.00 39.65  ? 548 TRP I CA    1 
ATOM   4142 C  C     . TRP H 3 47 ? 38.800 57.938  38.704 1.00 38.24  ? 548 TRP I C     1 
ATOM   4143 O  O     . TRP H 3 47 ? 39.756 57.803  39.473 1.00 37.56  ? 548 TRP I O     1 
ATOM   4144 C  CB    . TRP H 3 47 ? 36.726 56.811  39.579 1.00 37.82  ? 548 TRP I CB    1 
ATOM   4145 C  CG    . TRP H 3 47 ? 36.428 55.861  38.445 1.00 34.93  ? 548 TRP I CG    1 
ATOM   4146 C  CD1   . TRP H 3 47 ? 35.191 55.566  37.926 1.00 34.99  ? 548 TRP I CD1   1 
ATOM   4147 C  CD2   . TRP H 3 47 ? 37.360 55.006  37.761 1.00 33.49  ? 548 TRP I CD2   1 
ATOM   4148 N  NE1   . TRP H 3 47 ? 35.298 54.579  36.973 1.00 33.40  ? 548 TRP I NE1   1 
ATOM   4149 C  CE2   . TRP H 3 47 ? 36.616 54.215  36.852 1.00 33.56  ? 548 TRP I CE2   1 
ATOM   4150 C  CE3   . TRP H 3 47 ? 38.751 54.825  37.833 1.00 32.83  ? 548 TRP I CE3   1 
ATOM   4151 C  CZ2   . TRP H 3 47 ? 37.217 53.261  36.017 1.00 32.50  ? 548 TRP I CZ2   1 
ATOM   4152 C  CZ3   . TRP H 3 47 ? 39.349 53.876  37.002 1.00 32.67  ? 548 TRP I CZ3   1 
ATOM   4153 C  CH2   . TRP H 3 47 ? 38.581 53.105  36.109 1.00 32.65  ? 548 TRP I CH2   1 
ATOM   4154 N  N     . LYS H 3 48 ? 38.936 57.927  37.382 1.00 36.78  ? 549 LYS I N     1 
ATOM   4155 C  CA    . LYS H 3 48 ? 40.258 57.753  36.793 1.00 36.10  ? 549 LYS I CA    1 
ATOM   4156 C  C     . LYS H 3 48 ? 41.141 58.935  37.197 1.00 35.58  ? 549 LYS I C     1 
ATOM   4157 O  O     . LYS H 3 48 ? 42.304 58.767  37.575 1.00 34.58  ? 549 LYS I O     1 
ATOM   4158 C  CB    . LYS H 3 48 ? 40.175 57.678  35.269 1.00 38.49  ? 549 LYS I CB    1 
ATOM   4159 C  CG    . LYS H 3 48 ? 40.216 56.270  34.712 1.00 40.29  ? 549 LYS I CG    1 
ATOM   4160 C  CD    . LYS H 3 48 ? 40.280 56.295  33.200 1.00 42.50  ? 549 LYS I CD    1 
ATOM   4161 C  CE    . LYS H 3 48 ? 40.499 54.913  32.620 1.00 42.92  ? 549 LYS I CE    1 
ATOM   4162 N  NZ    . LYS H 3 48 ? 39.387 53.984  32.955 1.00 43.11  ? 549 LYS I NZ    1 
ATOM   4163 N  N     . ASN H 3 49 ? 40.588 60.138  37.097 1.00 33.53  ? 550 ASN I N     1 
ATOM   4164 C  CA    . ASN H 3 49 ? 41.333 61.333  37.473 1.00 32.83  ? 550 ASN I CA    1 
ATOM   4165 C  C     . ASN H 3 49 ? 41.663 61.276  38.964 1.00 31.61  ? 550 ASN I C     1 
ATOM   4166 O  O     . ASN H 3 49 ? 42.802 61.504  39.366 1.00 31.41  ? 550 ASN I O     1 
ATOM   4167 C  CB    . ASN H 3 49 ? 40.513 62.589  37.160 1.00 33.89  ? 550 ASN I CB    1 
ATOM   4168 C  CG    . ASN H 3 49 ? 40.960 63.793  37.965 1.00 35.42  ? 550 ASN I CG    1 
ATOM   4169 O  OD1   . ASN H 3 49 ? 40.370 64.115  38.996 1.00 36.45  ? 550 ASN I OD1   1 
ATOM   4170 N  ND2   . ASN H 3 49 ? 42.014 64.457  37.505 1.00 37.40  ? 550 ASN I ND2   1 
ATOM   4171 N  N     . ALA H 3 50 ? 40.658 60.951  39.774 1.00 30.16  ? 551 ALA I N     1 
ATOM   4172 C  CA    . ALA H 3 50 ? 40.821 60.862  41.222 1.00 28.99  ? 551 ALA I CA    1 
ATOM   4173 C  C     . ALA H 3 50 ? 41.884 59.841  41.644 1.00 28.81  ? 551 ALA I C     1 
ATOM   4174 O  O     . ALA H 3 50 ? 42.618 60.062  42.618 1.00 26.46  ? 551 ALA I O     1 
ATOM   4175 C  CB    . ALA H 3 50 ? 39.484 60.520  41.865 1.00 30.29  ? 551 ALA I CB    1 
ATOM   4176 N  N     . VAL H 3 51 ? 41.971 58.724  40.924 1.00 26.56  ? 552 VAL I N     1 
ATOM   4177 C  CA    . VAL H 3 51 ? 42.958 57.690  41.249 1.00 26.29  ? 552 VAL I CA    1 
ATOM   4178 C  C     . VAL H 3 51 ? 44.386 58.154  41.007 1.00 26.79  ? 552 VAL I C     1 
ATOM   4179 O  O     . VAL H 3 51 ? 45.273 57.912  41.829 1.00 27.24  ? 552 VAL I O     1 
ATOM   4180 C  CB    . VAL H 3 51 ? 42.719 56.398  40.439 1.00 25.66  ? 552 VAL I CB    1 
ATOM   4181 C  CG1   . VAL H 3 51 ? 43.911 55.470  40.588 1.00 24.43  ? 552 VAL I CG1   1 
ATOM   4182 C  CG2   . VAL H 3 51 ? 41.459 55.709  40.940 1.00 23.19  ? 552 VAL I CG2   1 
ATOM   4183 N  N     . ARG H 3 52 ? 44.620 58.799  39.871 1.00 27.32  ? 553 ARG I N     1 
ATOM   4184 C  CA    . ARG H 3 52 ? 45.954 59.301  39.581 1.00 29.86  ? 553 ARG I CA    1 
ATOM   4185 C  C     . ARG H 3 52 ? 46.305 60.369  40.628 1.00 28.77  ? 553 ARG I C     1 
ATOM   4186 O  O     . ARG H 3 52 ? 47.413 60.400  41.156 1.00 28.02  ? 553 ARG I O     1 
ATOM   4187 C  CB    . ARG H 3 52 ? 46.007 59.891  38.167 1.00 31.82  ? 553 ARG I CB    1 
ATOM   4188 C  CG    . ARG H 3 52 ? 45.742 58.872  37.059 1.00 36.10  ? 553 ARG I CG    1 
ATOM   4189 C  CD    . ARG H 3 52 ? 46.281 59.352  35.716 1.00 38.65  ? 553 ARG I CD    1 
ATOM   4190 N  NE    . ARG H 3 52 ? 45.742 60.655  35.338 1.00 41.90  ? 553 ARG I NE    1 
ATOM   4191 C  CZ    . ARG H 3 52 ? 44.482 60.872  34.976 1.00 42.61  ? 553 ARG I CZ    1 
ATOM   4192 N  NH1   . ARG H 3 52 ? 43.618 59.867  34.935 1.00 43.34  ? 553 ARG I NH1   1 
ATOM   4193 N  NH2   . ARG H 3 52 ? 44.084 62.097  34.656 1.00 42.45  ? 553 ARG I NH2   1 
ATOM   4194 N  N     . HIS H 3 53 ? 45.338 61.222  40.932 1.00 29.61  ? 554 HIS I N     1 
ATOM   4195 C  CA    . HIS H 3 53 ? 45.506 62.288  41.919 1.00 30.36  ? 554 HIS I CA    1 
ATOM   4196 C  C     . HIS H 3 53 ? 45.949 61.736  43.278 1.00 30.44  ? 554 HIS I C     1 
ATOM   4197 O  O     . HIS H 3 53 ? 46.906 62.233  43.882 1.00 30.10  ? 554 HIS I O     1 
ATOM   4198 C  CB    . HIS H 3 53 ? 44.181 63.048  42.051 1.00 31.33  ? 554 HIS I CB    1 
ATOM   4199 C  CG    . HIS H 3 53 ? 44.182 64.107  43.109 1.00 33.47  ? 554 HIS I CG    1 
ATOM   4200 N  ND1   . HIS H 3 53 ? 43.991 63.826  44.443 1.00 34.80  ? 554 HIS I ND1   1 
ATOM   4201 C  CD2   . HIS H 3 53 ? 44.336 65.451  43.023 1.00 33.10  ? 554 HIS I CD2   1 
ATOM   4202 C  CE1   . HIS H 3 53 ? 44.024 64.953  45.137 1.00 34.63  ? 554 HIS I CE1   1 
ATOM   4203 N  NE2   . HIS H 3 53 ? 44.232 65.950  44.299 1.00 34.96  ? 554 HIS I NE2   1 
ATOM   4204 N  N     . ASN H 3 54 ? 45.255 60.703  43.752 1.00 30.21  ? 555 ASN I N     1 
ATOM   4205 C  CA    . ASN H 3 54 ? 45.574 60.078  45.037 1.00 30.85  ? 555 ASN I CA    1 
ATOM   4206 C  C     . ASN H 3 54 ? 46.904 59.337  45.080 1.00 32.37  ? 555 ASN I C     1 
ATOM   4207 O  O     . ASN H 3 54 ? 47.557 59.300  46.124 1.00 31.88  ? 555 ASN I O     1 
ATOM   4208 C  CB    . ASN H 3 54 ? 44.459 59.117  45.448 1.00 28.63  ? 555 ASN I CB    1 
ATOM   4209 C  CG    . ASN H 3 54 ? 43.350 59.808  46.192 1.00 26.34  ? 555 ASN I CG    1 
ATOM   4210 O  OD1   . ASN H 3 54 ? 43.319 59.808  47.426 1.00 26.74  ? 555 ASN I OD1   1 
ATOM   4211 N  ND2   . ASN H 3 54 ? 42.433 60.420  45.451 1.00 25.36  ? 555 ASN I ND2   1 
ATOM   4212 N  N     . LEU H 3 55 ? 47.298 58.731  43.964 1.00 34.19  ? 556 LEU I N     1 
ATOM   4213 C  CA    . LEU H 3 55 ? 48.561 57.997  43.914 1.00 37.43  ? 556 LEU I CA    1 
ATOM   4214 C  C     . LEU H 3 55 ? 49.765 58.939  43.996 1.00 40.29  ? 556 LEU I C     1 
ATOM   4215 O  O     . LEU H 3 55 ? 50.809 58.580  44.544 1.00 40.71  ? 556 LEU I O     1 
ATOM   4216 C  CB    . LEU H 3 55 ? 48.651 57.162  42.628 1.00 36.32  ? 556 LEU I CB    1 
ATOM   4217 C  CG    . LEU H 3 55 ? 47.789 55.898  42.564 1.00 34.30  ? 556 LEU I CG    1 
ATOM   4218 C  CD1   . LEU H 3 55 ? 47.924 55.248  41.195 1.00 34.37  ? 556 LEU I CD1   1 
ATOM   4219 C  CD2   . LEU H 3 55 ? 48.218 54.930  43.655 1.00 32.67  ? 556 LEU I CD2   1 
ATOM   4220 N  N     . SER H 3 56 ? 49.612 60.146  43.459 1.00 43.16  ? 557 SER I N     1 
ATOM   4221 C  CA    . SER H 3 56 ? 50.699 61.120  43.472 1.00 47.06  ? 557 SER I CA    1 
ATOM   4222 C  C     . SER H 3 56 ? 50.613 62.133  44.609 1.00 49.22  ? 557 SER I C     1 
ATOM   4223 O  O     . SER H 3 56 ? 51.478 62.999  44.734 1.00 49.85  ? 557 SER I O     1 
ATOM   4224 C  CB    . SER H 3 56 ? 50.753 61.869  42.138 1.00 46.58  ? 557 SER I CB    1 
ATOM   4225 O  OG    . SER H 3 56 ? 49.587 62.649  41.942 1.00 46.72  ? 557 SER I OG    1 
ATOM   4226 N  N     . LEU H 3 57 ? 49.576 62.031  45.435 1.00 51.93  ? 558 LEU I N     1 
ATOM   4227 C  CA    . LEU H 3 57 ? 49.410 62.957  46.551 1.00 54.10  ? 558 LEU I CA    1 
ATOM   4228 C  C     . LEU H 3 57 ? 49.742 62.295  47.882 1.00 55.19  ? 558 LEU I C     1 
ATOM   4229 O  O     . LEU H 3 57 ? 50.429 62.876  48.720 1.00 54.91  ? 558 LEU I O     1 
ATOM   4230 C  CB    . LEU H 3 57 ? 47.971 63.484  46.600 1.00 55.30  ? 558 LEU I CB    1 
ATOM   4231 C  CG    . LEU H 3 57 ? 47.655 64.492  47.715 1.00 56.54  ? 558 LEU I CG    1 
ATOM   4232 C  CD1   . LEU H 3 57 ? 48.429 65.776  47.467 1.00 56.86  ? 558 LEU I CD1   1 
ATOM   4233 C  CD2   . LEU H 3 57 ? 46.161 64.779  47.763 1.00 55.79  ? 558 LEU I CD2   1 
ATOM   4234 N  N     . HIS H 3 58 ? 49.246 61.077  48.067 1.00 56.31  ? 559 HIS I N     1 
ATOM   4235 C  CA    . HIS H 3 58 ? 49.465 60.337  49.304 1.00 58.22  ? 559 HIS I CA    1 
ATOM   4236 C  C     . HIS H 3 58 ? 50.747 59.514  49.279 1.00 59.06  ? 559 HIS I C     1 
ATOM   4237 O  O     . HIS H 3 58 ? 50.979 58.723  48.365 1.00 58.91  ? 559 HIS I O     1 
ATOM   4238 C  CB    . HIS H 3 58 ? 48.257 59.440  49.585 1.00 58.48  ? 559 HIS I CB    1 
ATOM   4239 C  CG    . HIS H 3 58 ? 46.962 60.191  49.677 1.00 59.21  ? 559 HIS I CG    1 
ATOM   4240 N  ND1   . HIS H 3 58 ? 46.746 61.189  50.605 1.00 59.27  ? 559 HIS I ND1   1 
ATOM   4241 C  CD2   . HIS H 3 58 ? 45.829 60.106  48.945 1.00 58.73  ? 559 HIS I CD2   1 
ATOM   4242 C  CE1   . HIS H 3 58 ? 45.533 61.685  50.437 1.00 59.41  ? 559 HIS I CE1   1 
ATOM   4243 N  NE2   . HIS H 3 58 ? 44.954 61.048  49.439 1.00 58.68  ? 559 HIS I NE2   1 
ATOM   4244 N  N     . LYS H 3 59 ? 51.572 59.710  50.304 1.00 59.79  ? 560 LYS I N     1 
ATOM   4245 C  CA    . LYS H 3 59 ? 52.853 59.023  50.434 1.00 59.94  ? 560 LYS I CA    1 
ATOM   4246 C  C     . LYS H 3 59 ? 52.722 57.525  50.683 1.00 58.74  ? 560 LYS I C     1 
ATOM   4247 O  O     . LYS H 3 59 ? 53.634 56.762  50.370 1.00 58.76  ? 560 LYS I O     1 
ATOM   4248 C  CB    . LYS H 3 59 ? 53.667 59.658  51.567 1.00 62.60  ? 560 LYS I CB    1 
ATOM   4249 C  CG    . LYS H 3 59 ? 53.926 61.148  51.390 1.00 66.07  ? 560 LYS I CG    1 
ATOM   4250 C  CD    . LYS H 3 59 ? 54.617 61.751  52.608 1.00 68.39  ? 560 LYS I CD    1 
ATOM   4251 C  CE    . LYS H 3 59 ? 56.007 61.164  52.816 1.00 69.24  ? 560 LYS I CE    1 
ATOM   4252 N  NZ    . LYS H 3 59 ? 56.899 61.431  51.651 1.00 70.16  ? 560 LYS I NZ    1 
ATOM   4253 N  N     . CYS H 3 60 ? 51.598 57.100  51.248 1.00 57.23  ? 561 CYS I N     1 
ATOM   4254 C  CA    . CYS H 3 60 ? 51.393 55.680  51.520 1.00 56.36  ? 561 CYS I CA    1 
ATOM   4255 C  C     . CYS H 3 60 ? 51.391 54.848  50.232 1.00 55.50  ? 561 CYS I C     1 
ATOM   4256 O  O     . CYS H 3 60 ? 51.523 53.628  50.272 1.00 54.35  ? 561 CYS I O     1 
ATOM   4257 C  CB    . CYS H 3 60 ? 50.083 55.467  52.290 1.00 56.94  ? 561 CYS I CB    1 
ATOM   4258 S  SG    . CYS H 3 60 ? 48.600 56.095  51.476 1.00 57.68  ? 561 CYS I SG    1 
ATOM   4259 N  N     . PHE H 3 61 ? 51.245 55.518  49.093 1.00 55.11  ? 562 PHE I N     1 
ATOM   4260 C  CA    . PHE H 3 61 ? 51.238 54.840  47.799 1.00 56.33  ? 562 PHE I CA    1 
ATOM   4261 C  C     . PHE H 3 61 ? 52.583 55.069  47.116 1.00 59.78  ? 562 PHE I C     1 
ATOM   4262 O  O     . PHE H 3 61 ? 52.881 56.178  46.669 1.00 59.42  ? 562 PHE I O     1 
ATOM   4263 C  CB    . PHE H 3 61 ? 50.102 55.376  46.919 1.00 51.43  ? 562 PHE I CB    1 
ATOM   4264 C  CG    . PHE H 3 61 ? 48.725 55.127  47.483 1.00 46.28  ? 562 PHE I CG    1 
ATOM   4265 C  CD1   . PHE H 3 61 ? 47.774 56.146  47.512 1.00 44.45  ? 562 PHE I CD1   1 
ATOM   4266 C  CD2   . PHE H 3 61 ? 48.382 53.878  47.991 1.00 43.77  ? 562 PHE I CD2   1 
ATOM   4267 C  CE1   . PHE H 3 61 ? 46.502 55.923  48.046 1.00 43.16  ? 562 PHE I CE1   1 
ATOM   4268 C  CE2   . PHE H 3 61 ? 47.116 53.643  48.524 1.00 42.47  ? 562 PHE I CE2   1 
ATOM   4269 C  CZ    . PHE H 3 61 ? 46.175 54.667  48.554 1.00 41.79  ? 562 PHE I CZ    1 
ATOM   4270 N  N     . VAL H 3 62 ? 53.394 54.016  47.042 1.00 64.31  ? 563 VAL I N     1 
ATOM   4271 C  CA    . VAL H 3 62 ? 54.720 54.104  46.430 1.00 69.52  ? 563 VAL I CA    1 
ATOM   4272 C  C     . VAL H 3 62 ? 54.808 53.248  45.169 1.00 74.06  ? 563 VAL I C     1 
ATOM   4273 O  O     . VAL H 3 62 ? 54.447 52.073  45.179 1.00 73.78  ? 563 VAL I O     1 
ATOM   4274 C  CB    . VAL H 3 62 ? 55.819 53.630  47.403 1.00 68.97  ? 563 VAL I CB    1 
ATOM   4275 C  CG1   . VAL H 3 62 ? 57.190 53.906  46.805 1.00 69.07  ? 563 VAL I CG1   1 
ATOM   4276 C  CG2   . VAL H 3 62 ? 55.663 54.333  48.738 1.00 68.89  ? 563 VAL I CG2   1 
ATOM   4277 N  N     . ARG H 3 63 ? 55.307 53.838  44.089 1.00 80.02  ? 564 ARG I N     1 
ATOM   4278 C  CA    . ARG H 3 63 ? 55.447 53.121  42.831 1.00 86.80  ? 564 ARG I CA    1 
ATOM   4279 C  C     . ARG H 3 63 ? 56.801 52.415  42.732 1.00 89.93  ? 564 ARG I C     1 
ATOM   4280 O  O     . ARG H 3 63 ? 57.853 53.054  42.659 1.00 90.29  ? 564 ARG I O     1 
ATOM   4281 C  CB    . ARG H 3 63 ? 55.255 54.076  41.644 1.00 89.12  ? 564 ARG I CB    1 
ATOM   4282 C  CG    . ARG H 3 63 ? 56.179 55.287  41.610 1.00 93.42  ? 564 ARG I CG    1 
ATOM   4283 C  CD    . ARG H 3 63 ? 55.708 56.270  40.542 1.00 96.56  ? 564 ARG I CD    1 
ATOM   4284 N  NE    . ARG H 3 63 ? 56.521 57.481  40.459 1.00 99.49  ? 564 ARG I NE    1 
ATOM   4285 C  CZ    . ARG H 3 63 ? 56.220 58.515  39.677 1.00 101.05 ? 564 ARG I CZ    1 
ATOM   4286 N  NH1   . ARG H 3 63 ? 55.129 58.480  38.918 1.00 101.87 ? 564 ARG I NH1   1 
ATOM   4287 N  NH2   . ARG H 3 63 ? 57.006 59.583  39.643 1.00 102.09 ? 564 ARG I NH2   1 
ATOM   4288 N  N     . VAL H 3 64 ? 56.762 51.085  42.750 1.00 93.91  ? 565 VAL I N     1 
ATOM   4289 C  CA    . VAL H 3 64 ? 57.967 50.259  42.663 1.00 98.08  ? 565 VAL I CA    1 
ATOM   4290 C  C     . VAL H 3 64 ? 58.168 49.757  41.237 1.00 100.81 ? 565 VAL I C     1 
ATOM   4291 O  O     . VAL H 3 64 ? 57.383 48.956  40.733 1.00 101.33 ? 565 VAL I O     1 
ATOM   4292 C  CB    . VAL H 3 64 ? 57.883 49.033  43.622 1.00 97.93  ? 565 VAL I CB    1 
ATOM   4293 C  CG1   . VAL H 3 64 ? 59.130 48.201  43.515 1.00 98.22  ? 565 VAL I CG1   1 
ATOM   4294 C  CG2   . VAL H 3 64 ? 57.657 49.503  45.040 1.00 98.31  ? 565 VAL I CG2   1 
ATOM   4295 N  N     . GLU H 3 65 ? 59.239 50.222  40.603 1.00 104.10 ? 566 GLU I N     1 
ATOM   4296 C  CA    . GLU H 3 65 ? 59.551 49.830  39.238 1.00 107.11 ? 566 GLU I CA    1 
ATOM   4297 C  C     . GLU H 3 65 ? 60.356 48.534  39.202 1.00 108.23 ? 566 GLU I C     1 
ATOM   4298 O  O     . GLU H 3 65 ? 61.529 48.506  39.579 1.00 108.50 ? 566 GLU I O     1 
ATOM   4299 C  CB    . GLU H 3 65 ? 60.322 50.952  38.539 1.00 108.53 ? 566 GLU I CB    1 
ATOM   4300 C  CG    . GLU H 3 65 ? 59.539 52.259  38.424 1.00 110.65 ? 566 GLU I CG    1 
ATOM   4301 C  CD    . GLU H 3 65 ? 60.336 53.359  37.752 1.00 111.73 ? 566 GLU I CD    1 
ATOM   4302 O  OE1   . GLU H 3 65 ? 61.420 53.704  38.270 1.00 112.30 ? 566 GLU I OE1   1 
ATOM   4303 O  OE2   . GLU H 3 65 ? 59.880 53.876  36.708 1.00 112.15 ? 566 GLU I OE2   1 
ATOM   4304 N  N     . ASN H 3 66 ? 59.710 47.462  38.747 1.00 109.52 ? 567 ASN I N     1 
ATOM   4305 C  CA    . ASN H 3 66 ? 60.351 46.155  38.660 1.00 110.48 ? 567 ASN I CA    1 
ATOM   4306 C  C     . ASN H 3 66 ? 60.598 45.758  37.210 1.00 110.83 ? 567 ASN I C     1 
ATOM   4307 O  O     . ASN H 3 66 ? 60.488 46.582  36.302 1.00 110.82 ? 567 ASN I O     1 
ATOM   4308 C  CB    . ASN H 3 66 ? 59.479 45.092  39.335 1.00 111.37 ? 567 ASN I CB    1 
ATOM   4309 C  CG    . ASN H 3 66 ? 58.119 44.935  38.667 1.00 112.23 ? 567 ASN I CG    1 
ATOM   4310 O  OD1   . ASN H 3 66 ? 57.346 44.042  39.013 1.00 112.81 ? 567 ASN I OD1   1 
ATOM   4311 N  ND2   . ASN H 3 66 ? 57.821 45.808  37.709 1.00 112.50 ? 567 ASN I ND2   1 
ATOM   4312 N  N     . VAL H 3 67 ? 60.927 44.486  37.005 1.00 111.11 ? 568 VAL I N     1 
ATOM   4313 C  CA    . VAL H 3 67 ? 61.191 43.950  35.674 1.00 111.34 ? 568 VAL I CA    1 
ATOM   4314 C  C     . VAL H 3 67 ? 59.878 43.709  34.926 1.00 110.69 ? 568 VAL I C     1 
ATOM   4315 O  O     . VAL H 3 67 ? 59.589 42.596  34.484 1.00 111.08 ? 568 VAL I O     1 
ATOM   4316 C  CB    . VAL H 3 67 ? 61.999 42.625  35.770 1.00 111.56 ? 568 VAL I CB    1 
ATOM   4317 C  CG1   . VAL H 3 67 ? 62.161 41.993  34.400 1.00 111.88 ? 568 VAL I CG1   1 
ATOM   4318 C  CG2   . VAL H 3 67 ? 63.366 42.902  36.372 1.00 111.54 ? 568 VAL I CG2   1 
ATOM   4319 N  N     . LYS H 3 68 ? 59.081 44.766  34.798 1.00 109.62 ? 569 LYS I N     1 
ATOM   4320 C  CA    . LYS H 3 68 ? 57.797 44.690  34.106 1.00 107.88 ? 569 LYS I CA    1 
ATOM   4321 C  C     . LYS H 3 68 ? 57.377 46.061  33.583 1.00 105.88 ? 569 LYS I C     1 
ATOM   4322 O  O     . LYS H 3 68 ? 56.744 46.167  32.532 1.00 106.12 ? 569 LYS I O     1 
ATOM   4323 C  CB    . LYS H 3 68 ? 56.716 44.143  35.045 1.00 108.56 ? 569 LYS I CB    1 
ATOM   4324 C  CG    . LYS H 3 68 ? 56.913 42.683  35.431 1.00 109.39 ? 569 LYS I CG    1 
ATOM   4325 C  CD    . LYS H 3 68 ? 55.822 42.185  36.364 1.00 110.32 ? 569 LYS I CD    1 
ATOM   4326 C  CE    . LYS H 3 68 ? 56.041 40.723  36.726 1.00 110.87 ? 569 LYS I CE    1 
ATOM   4327 N  NZ    . LYS H 3 68 ? 54.980 40.201  37.632 1.00 111.49 ? 569 LYS I NZ    1 
ATOM   4328 N  N     . GLY H 3 69 ? 57.737 47.106  34.322 1.00 103.33 ? 570 GLY I N     1 
ATOM   4329 C  CA    . GLY H 3 69 ? 57.389 48.454  33.913 1.00 99.79  ? 570 GLY I CA    1 
ATOM   4330 C  C     . GLY H 3 69 ? 57.167 49.377  35.096 1.00 97.12  ? 570 GLY I C     1 
ATOM   4331 O  O     . GLY H 3 69 ? 57.971 50.274  35.351 1.00 97.08  ? 570 GLY I O     1 
ATOM   4332 N  N     . ALA H 3 70 ? 56.074 49.158  35.820 1.00 93.72  ? 571 ALA I N     1 
ATOM   4333 C  CA    . ALA H 3 70 ? 55.751 49.978  36.981 1.00 89.45  ? 571 ALA I CA    1 
ATOM   4334 C  C     . ALA H 3 70 ? 54.574 49.404  37.758 1.00 86.03  ? 571 ALA I C     1 
ATOM   4335 O  O     . ALA H 3 70 ? 53.521 49.118  37.189 1.00 86.49  ? 571 ALA I O     1 
ATOM   4336 C  CB    . ALA H 3 70 ? 55.436 51.402  36.541 1.00 89.78  ? 571 ALA I CB    1 
ATOM   4337 N  N     . VAL H 3 71 ? 54.758 49.235  39.061 1.00 81.16  ? 572 VAL I N     1 
ATOM   4338 C  CA    . VAL H 3 71 ? 53.703 48.707  39.913 1.00 76.20  ? 572 VAL I CA    1 
ATOM   4339 C  C     . VAL H 3 71 ? 53.586 49.565  41.164 1.00 72.23  ? 572 VAL I C     1 
ATOM   4340 O  O     . VAL H 3 71 ? 54.589 50.019  41.712 1.00 70.83  ? 572 VAL I O     1 
ATOM   4341 C  CB    . VAL H 3 71 ? 53.989 47.249  40.337 1.00 76.45  ? 572 VAL I CB    1 
ATOM   4342 C  CG1   . VAL H 3 71 ? 54.230 46.392  39.108 1.00 76.78  ? 572 VAL I CG1   1 
ATOM   4343 C  CG2   . VAL H 3 71 ? 55.184 47.195  41.272 1.00 76.68  ? 572 VAL I CG2   1 
ATOM   4344 N  N     . TRP H 3 72 ? 52.358 49.795  41.609 1.00 67.14  ? 573 TRP I N     1 
ATOM   4345 C  CA    . TRP H 3 72 ? 52.141 50.590  42.804 1.00 62.61  ? 573 TRP I CA    1 
ATOM   4346 C  C     . TRP H 3 72 ? 51.926 49.678  43.992 1.00 62.17  ? 573 TRP I C     1 
ATOM   4347 O  O     . TRP H 3 72 ? 51.273 48.642  43.881 1.00 62.33  ? 573 TRP I O     1 
ATOM   4348 C  CB    . TRP H 3 72 ? 50.931 51.502  42.635 1.00 57.71  ? 573 TRP I CB    1 
ATOM   4349 C  CG    . TRP H 3 72 ? 51.141 52.553  41.611 1.00 52.26  ? 573 TRP I CG    1 
ATOM   4350 C  CD1   . TRP H 3 72 ? 50.957 52.437  40.263 1.00 50.07  ? 573 TRP I CD1   1 
ATOM   4351 C  CD2   . TRP H 3 72 ? 51.596 53.886  41.844 1.00 49.69  ? 573 TRP I CD2   1 
ATOM   4352 N  NE1   . TRP H 3 72 ? 51.269 53.621  39.641 1.00 48.45  ? 573 TRP I NE1   1 
ATOM   4353 C  CE2   . TRP H 3 72 ? 51.668 54.528  40.589 1.00 48.99  ? 573 TRP I CE2   1 
ATOM   4354 C  CE3   . TRP H 3 72 ? 51.959 54.600  42.994 1.00 48.84  ? 573 TRP I CE3   1 
ATOM   4355 C  CZ2   . TRP H 3 72 ? 52.076 55.856  40.450 1.00 48.32  ? 573 TRP I CZ2   1 
ATOM   4356 C  CZ3   . TRP H 3 72 ? 52.365 55.920  42.857 1.00 48.30  ? 573 TRP I CZ3   1 
ATOM   4357 C  CH2   . TRP H 3 72 ? 52.424 56.533  41.592 1.00 48.58  ? 573 TRP I CH2   1 
ATOM   4358 N  N     . THR H 3 73 ? 52.484 50.066  45.130 1.00 61.52  ? 574 THR I N     1 
ATOM   4359 C  CA    . THR H 3 73 ? 52.354 49.280  46.344 1.00 60.99  ? 574 THR I CA    1 
ATOM   4360 C  C     . THR H 3 73 ? 51.851 50.172  47.472 1.00 61.40  ? 574 THR I C     1 
ATOM   4361 O  O     . THR H 3 73 ? 51.711 51.383  47.299 1.00 59.49  ? 574 THR I O     1 
ATOM   4362 C  CB    . THR H 3 73 ? 53.704 48.660  46.742 1.00 60.96  ? 574 THR I CB    1 
ATOM   4363 O  OG1   . THR H 3 73 ? 53.522 47.805  47.876 1.00 60.88  ? 574 THR I OG1   1 
ATOM   4364 C  CG2   . THR H 3 73 ? 54.712 49.751  47.081 1.00 59.88  ? 574 THR I CG2   1 
ATOM   4365 N  N     . VAL H 3 74 ? 51.585 49.572  48.626 1.00 62.84  ? 575 VAL I N     1 
ATOM   4366 C  CA    . VAL H 3 74 ? 51.089 50.322  49.776 1.00 65.94  ? 575 VAL I CA    1 
ATOM   4367 C  C     . VAL H 3 74 ? 52.017 50.223  50.985 1.00 68.55  ? 575 VAL I C     1 
ATOM   4368 O  O     . VAL H 3 74 ? 52.400 49.130  51.399 1.00 68.16  ? 575 VAL I O     1 
ATOM   4369 C  CB    . VAL H 3 74 ? 49.689 49.827  50.198 1.00 65.66  ? 575 VAL I CB    1 
ATOM   4370 C  CG1   . VAL H 3 74 ? 49.244 50.539  51.465 1.00 65.97  ? 575 VAL I CG1   1 
ATOM   4371 C  CG2   . VAL H 3 74 ? 48.699 50.075  49.077 1.00 65.62  ? 575 VAL I CG2   1 
ATOM   4372 N  N     . ASP H 3 75 ? 52.372 51.375  51.544 1.00 71.83  ? 576 ASP I N     1 
ATOM   4373 C  CA    . ASP H 3 75 ? 53.232 51.433  52.718 1.00 75.32  ? 576 ASP I CA    1 
ATOM   4374 C  C     . ASP H 3 75 ? 52.279 51.445  53.913 1.00 77.81  ? 576 ASP I C     1 
ATOM   4375 O  O     . ASP H 3 75 ? 51.835 52.503  54.362 1.00 78.40  ? 576 ASP I O     1 
ATOM   4376 C  CB    . ASP H 3 75 ? 54.079 52.710  52.685 1.00 75.26  ? 576 ASP I CB    1 
ATOM   4377 C  CG    . ASP H 3 75 ? 55.066 52.791  53.841 1.00 75.11  ? 576 ASP I CG    1 
ATOM   4378 O  OD1   . ASP H 3 75 ? 54.659 52.517  54.990 1.00 75.13  ? 576 ASP I OD1   1 
ATOM   4379 O  OD2   . ASP H 3 75 ? 56.240 53.147  53.606 1.00 75.07  ? 576 ASP I OD2   1 
ATOM   4380 N  N     . GLU H 3 76 ? 51.955 50.257  54.412 1.00 81.03  ? 577 GLU I N     1 
ATOM   4381 C  CA    . GLU H 3 76 ? 51.029 50.108  55.528 1.00 84.35  ? 577 GLU I CA    1 
ATOM   4382 C  C     . GLU H 3 76 ? 51.398 50.984  56.730 1.00 86.01  ? 577 GLU I C     1 
ATOM   4383 O  O     . GLU H 3 76 ? 50.525 51.558  57.373 1.00 86.34  ? 577 GLU I O     1 
ATOM   4384 C  CB    . GLU H 3 76 ? 50.966 48.635  55.945 1.00 85.20  ? 577 GLU I CB    1 
ATOM   4385 C  CG    . GLU H 3 76 ? 49.735 48.258  56.755 1.00 86.67  ? 577 GLU I CG    1 
ATOM   4386 C  CD    . GLU H 3 76 ? 48.454 48.255  55.937 1.00 87.47  ? 577 GLU I CD    1 
ATOM   4387 O  OE1   . GLU H 3 76 ? 48.526 48.406  54.698 1.00 87.73  ? 577 GLU I OE1   1 
ATOM   4388 O  OE2   . GLU H 3 76 ? 47.369 48.088  56.537 1.00 87.55  ? 577 GLU I OE2   1 
ATOM   4389 N  N     . VAL H 3 77 ? 52.692 51.087  57.024 1.00 87.71  ? 578 VAL I N     1 
ATOM   4390 C  CA    . VAL H 3 77 ? 53.165 51.889  58.152 1.00 89.63  ? 578 VAL I CA    1 
ATOM   4391 C  C     . VAL H 3 77 ? 52.861 53.373  57.974 1.00 90.50  ? 578 VAL I C     1 
ATOM   4392 O  O     . VAL H 3 77 ? 52.585 54.079  58.946 1.00 90.88  ? 578 VAL I O     1 
ATOM   4393 C  CB    . VAL H 3 77 ? 54.689 51.738  58.360 1.00 89.92  ? 578 VAL I CB    1 
ATOM   4394 C  CG1   . VAL H 3 77 ? 55.118 52.489  59.617 1.00 90.42  ? 578 VAL I CG1   1 
ATOM   4395 C  CG2   . VAL H 3 77 ? 55.059 50.267  58.464 1.00 90.37  ? 578 VAL I CG2   1 
ATOM   4396 N  N     . GLU H 3 78 ? 52.923 53.848  56.734 1.00 91.50  ? 579 GLU I N     1 
ATOM   4397 C  CA    . GLU H 3 78 ? 52.648 55.252  56.441 1.00 92.63  ? 579 GLU I CA    1 
ATOM   4398 C  C     . GLU H 3 78 ? 51.152 55.422  56.208 1.00 93.31  ? 579 GLU I C     1 
ATOM   4399 O  O     . GLU H 3 78 ? 50.643 56.541  56.134 1.00 93.29  ? 579 GLU I O     1 
ATOM   4400 C  CB    . GLU H 3 78 ? 53.413 55.693  55.190 1.00 92.80  ? 579 GLU I CB    1 
ATOM   4401 C  CG    . GLU H 3 78 ? 53.335 57.183  54.910 1.00 93.13  ? 579 GLU I CG    1 
ATOM   4402 C  CD    . GLU H 3 78 ? 54.129 58.001  55.905 1.00 93.40  ? 579 GLU I CD    1 
ATOM   4403 O  OE1   . GLU H 3 78 ? 53.931 57.816  57.124 1.00 93.47  ? 579 GLU I OE1   1 
ATOM   4404 O  OE2   . GLU H 3 78 ? 54.952 58.831  55.467 1.00 93.92  ? 579 GLU I OE2   1 
ATOM   4405 N  N     . TYR H 3 79 ? 50.455 54.297  56.096 1.00 93.92  ? 580 TYR I N     1 
ATOM   4406 C  CA    . TYR H 3 79 ? 49.020 54.309  55.857 1.00 94.63  ? 580 TYR I CA    1 
ATOM   4407 C  C     . TYR H 3 79 ? 48.233 54.387  57.161 1.00 96.03  ? 580 TYR I C     1 
ATOM   4408 O  O     . TYR H 3 79 ? 47.153 54.977  57.210 1.00 95.95  ? 580 TYR I O     1 
ATOM   4409 C  CB    . TYR H 3 79 ? 48.607 53.049  55.090 1.00 92.91  ? 580 TYR I CB    1 
ATOM   4410 C  CG    . TYR H 3 79 ? 47.223 53.129  54.487 1.00 91.03  ? 580 TYR I CG    1 
ATOM   4411 C  CD1   . TYR H 3 79 ? 47.013 53.758  53.261 1.00 90.07  ? 580 TYR I CD1   1 
ATOM   4412 C  CD2   . TYR H 3 79 ? 46.120 52.599  55.154 1.00 90.25  ? 580 TYR I CD2   1 
ATOM   4413 C  CE1   . TYR H 3 79 ? 45.738 53.857  52.712 1.00 89.46  ? 580 TYR I CE1   1 
ATOM   4414 C  CE2   . TYR H 3 79 ? 44.838 52.697  54.616 1.00 89.53  ? 580 TYR I CE2   1 
ATOM   4415 C  CZ    . TYR H 3 79 ? 44.655 53.325  53.395 1.00 89.42  ? 580 TYR I CZ    1 
ATOM   4416 O  OH    . TYR H 3 79 ? 43.392 53.415  52.858 1.00 89.75  ? 580 TYR I OH    1 
ATOM   4417 N  N     . GLN H 3 80 ? 48.782 53.797  58.217 1.00 97.87  ? 581 GLN I N     1 
ATOM   4418 C  CA    . GLN H 3 80 ? 48.118 53.782  59.515 1.00 99.95  ? 581 GLN I CA    1 
ATOM   4419 C  C     . GLN H 3 80 ? 48.080 55.144  60.205 1.00 101.09 ? 581 GLN I C     1 
ATOM   4420 O  O     . GLN H 3 80 ? 47.043 55.545  60.736 1.00 101.28 ? 581 GLN I O     1 
ATOM   4421 C  CB    . GLN H 3 80 ? 48.795 52.756  60.429 1.00 100.28 ? 581 GLN I CB    1 
ATOM   4422 C  CG    . GLN H 3 80 ? 48.918 51.372  59.801 1.00 100.56 ? 581 GLN I CG    1 
ATOM   4423 C  CD    . GLN H 3 80 ? 47.574 50.727  59.520 1.00 100.68 ? 581 GLN I CD    1 
ATOM   4424 O  OE1   . GLN H 3 80 ? 46.566 51.411  59.344 1.00 100.76 ? 581 GLN I OE1   1 
ATOM   4425 N  NE2   . GLN H 3 80 ? 47.558 49.401  59.460 1.00 100.85 ? 581 GLN I NE2   1 
ATOM   4426 N  N     . LYS H 3 81 ? 49.207 55.847  60.194 1.00 102.44 ? 582 LYS I N     1 
ATOM   4427 C  CA    . LYS H 3 81 ? 49.306 57.160  60.827 1.00 103.88 ? 582 LYS I CA    1 
ATOM   4428 C  C     . LYS H 3 81 ? 48.056 58.010  60.615 1.00 104.87 ? 582 LYS I C     1 
ATOM   4429 O  O     . LYS H 3 81 ? 47.469 58.514  61.573 1.00 105.16 ? 582 LYS I O     1 
ATOM   4430 C  CB    . LYS H 3 81 ? 50.528 57.908  60.291 1.00 103.89 ? 582 LYS I CB    1 
ATOM   4431 C  CG    . LYS H 3 81 ? 51.821 57.124  60.411 1.00 104.10 ? 582 LYS I CG    1 
ATOM   4432 C  CD    . LYS H 3 81 ? 53.028 57.974  60.061 1.00 104.24 ? 582 LYS I CD    1 
ATOM   4433 C  CE    . LYS H 3 81 ? 54.315 57.194  60.267 1.00 104.32 ? 582 LYS I CE    1 
ATOM   4434 N  NZ    . LYS H 3 81 ? 55.517 58.020  59.980 1.00 104.57 ? 582 LYS I NZ    1 
ATOM   4435 N  N     . ARG H 3 82 ? 47.658 58.162  59.356 1.00 105.92 ? 583 ARG I N     1 
ATOM   4436 C  CA    . ARG H 3 82 ? 46.482 58.951  59.000 1.00 106.83 ? 583 ARG I CA    1 
ATOM   4437 C  C     . ARG H 3 82 ? 45.233 58.455  59.726 1.00 106.96 ? 583 ARG I C     1 
ATOM   4438 O  O     . ARG H 3 82 ? 44.431 57.738  59.090 1.00 107.01 ? 583 ARG I O     1 
ATOM   4439 C  CB    . ARG H 3 82 ? 46.252 58.895  57.487 1.00 107.42 ? 583 ARG I CB    1 
ATOM   4440 C  CG    . ARG H 3 82 ? 47.508 59.103  56.652 1.00 108.16 ? 583 ARG I CG    1 
ATOM   4441 C  CD    . ARG H 3 82 ? 48.160 60.452  56.912 1.00 108.89 ? 583 ARG I CD    1 
ATOM   4442 N  NE    . ARG H 3 82 ? 49.383 60.609  56.128 1.00 109.68 ? 583 ARG I NE    1 
ATOM   4443 C  CZ    . ARG H 3 82 ? 50.181 61.670  56.181 1.00 109.95 ? 583 ARG I CZ    1 
ATOM   4444 N  NH1   . ARG H 3 82 ? 49.891 62.683  56.985 1.00 110.16 ? 583 ARG I NH1   1 
ATOM   4445 N  NH2   . ARG H 3 82 ? 51.272 61.717  55.428 1.00 110.05 ? 583 ARG I NH2   1 
ATOM   4446 N  N     . ILE I 3 1  ? 43.110 80.049  39.958 1.00 16.57  ? 502 ILE J N     1 
ATOM   4447 C  CA    . ILE I 3 1  ? 42.430 80.806  38.857 1.00 18.03  ? 502 ILE J CA    1 
ATOM   4448 C  C     . ILE I 3 1  ? 43.207 82.099  38.586 1.00 19.31  ? 502 ILE J C     1 
ATOM   4449 O  O     . ILE I 3 1  ? 43.609 82.797  39.516 1.00 18.85  ? 502 ILE J O     1 
ATOM   4450 C  CB    . ILE I 3 1  ? 40.961 81.112  39.242 1.00 17.79  ? 502 ILE J CB    1 
ATOM   4451 C  CG1   . ILE I 3 1  ? 40.182 79.795  39.319 1.00 19.28  ? 502 ILE J CG1   1 
ATOM   4452 C  CG2   . ILE I 3 1  ? 40.309 82.048  38.213 1.00 20.28  ? 502 ILE J CG2   1 
ATOM   4453 C  CD1   . ILE I 3 1  ? 38.748 79.934  39.784 1.00 20.24  ? 502 ILE J CD1   1 
ATOM   4454 N  N     . VAL I 3 2  ? 43.427 82.395  37.306 1.00 19.57  ? 503 VAL J N     1 
ATOM   4455 C  CA    . VAL I 3 2  ? 44.183 83.575  36.888 1.00 21.87  ? 503 VAL J CA    1 
ATOM   4456 C  C     . VAL I 3 2  ? 43.295 84.486  36.040 1.00 20.57  ? 503 VAL J C     1 
ATOM   4457 O  O     . VAL I 3 2  ? 42.571 84.005  35.173 1.00 18.80  ? 503 VAL J O     1 
ATOM   4458 C  CB    . VAL I 3 2  ? 45.409 83.165  36.031 1.00 23.87  ? 503 VAL J CB    1 
ATOM   4459 C  CG1   . VAL I 3 2  ? 46.135 84.403  35.524 1.00 28.86  ? 503 VAL J CG1   1 
ATOM   4460 C  CG2   . VAL I 3 2  ? 46.352 82.298  36.849 1.00 28.48  ? 503 VAL J CG2   1 
ATOM   4461 N  N     . ARG I 3 3  ? 43.327 85.789  36.287 1.00 20.15  ? 504 ARG J N     1 
ATOM   4462 C  CA    . ARG I 3 3  ? 42.506 86.667  35.459 1.00 21.12  ? 504 ARG J CA    1 
ATOM   4463 C  C     . ARG I 3 3  ? 43.242 86.862  34.141 1.00 19.58  ? 504 ARG J C     1 
ATOM   4464 O  O     . ARG I 3 3  ? 44.470 86.874  34.098 1.00 18.54  ? 504 ARG J O     1 
ATOM   4465 C  CB    . ARG I 3 3  ? 42.265 88.023  36.133 1.00 22.69  ? 504 ARG J CB    1 
ATOM   4466 C  CG    . ARG I 3 3  ? 43.399 89.021  36.011 1.00 24.08  ? 504 ARG J CG    1 
ATOM   4467 C  CD    . ARG I 3 3  ? 43.079 90.260  36.828 1.00 23.04  ? 504 ARG J CD    1 
ATOM   4468 N  NE    . ARG I 3 3  ? 41.882 90.950  36.356 1.00 23.79  ? 504 ARG J NE    1 
ATOM   4469 C  CZ    . ARG I 3 3  ? 41.200 91.835  37.077 1.00 24.28  ? 504 ARG J CZ    1 
ATOM   4470 N  NH1   . ARG I 3 3  ? 41.599 92.128  38.311 1.00 23.28  ? 504 ARG J NH1   1 
ATOM   4471 N  NH2   . ARG I 3 3  ? 40.134 92.443  36.563 1.00 24.95  ? 504 ARG J NH2   1 
ATOM   4472 N  N     . PRO I 3 4  ? 42.499 87.017  33.044 1.00 20.34  ? 505 PRO J N     1 
ATOM   4473 C  CA    . PRO I 3 4  ? 43.148 87.206  31.743 1.00 19.76  ? 505 PRO J CA    1 
ATOM   4474 C  C     . PRO I 3 4  ? 44.008 88.463  31.758 1.00 19.08  ? 505 PRO J C     1 
ATOM   4475 O  O     . PRO I 3 4  ? 43.613 89.483  32.323 1.00 17.69  ? 505 PRO J O     1 
ATOM   4476 C  CB    . PRO I 3 4  ? 41.966 87.345  30.778 1.00 21.10  ? 505 PRO J CB    1 
ATOM   4477 C  CG    . PRO I 3 4  ? 40.802 86.737  31.530 1.00 22.87  ? 505 PRO J CG    1 
ATOM   4478 C  CD    . PRO I 3 4  ? 41.038 87.161  32.934 1.00 21.40  ? 505 PRO J CD    1 
ATOM   4479 N  N     . PRO I 3 5  ? 45.188 88.412  31.123 1.00 19.64  ? 506 PRO J N     1 
ATOM   4480 C  CA    . PRO I 3 5  ? 46.113 89.543  31.057 1.00 20.03  ? 506 PRO J CA    1 
ATOM   4481 C  C     . PRO I 3 5  ? 45.720 90.574  30.000 1.00 21.08  ? 506 PRO J C     1 
ATOM   4482 O  O     . PRO I 3 5  ? 46.496 90.859  29.089 1.00 21.16  ? 506 PRO J O     1 
ATOM   4483 C  CB    . PRO I 3 5  ? 47.440 88.872  30.726 1.00 21.17  ? 506 PRO J CB    1 
ATOM   4484 C  CG    . PRO I 3 5  ? 47.027 87.795  29.804 1.00 19.64  ? 506 PRO J CG    1 
ATOM   4485 C  CD    . PRO I 3 5  ? 45.771 87.228  30.459 1.00 21.30  ? 506 PRO J CD    1 
ATOM   4486 N  N     . PHE I 3 6  ? 44.514 91.121  30.120 1.00 17.27  ? 507 PHE J N     1 
ATOM   4487 C  CA    . PHE I 3 6  ? 44.028 92.132  29.180 1.00 17.99  ? 507 PHE J CA    1 
ATOM   4488 C  C     . PHE I 3 6  ? 43.114 93.066  29.957 1.00 16.81  ? 507 PHE J C     1 
ATOM   4489 O  O     . PHE I 3 6  ? 42.566 92.675  30.985 1.00 15.87  ? 507 PHE J O     1 
ATOM   4490 C  CB    . PHE I 3 6  ? 43.222 91.493  28.041 1.00 17.71  ? 507 PHE J CB    1 
ATOM   4491 C  CG    . PHE I 3 6  ? 43.979 90.461  27.263 1.00 21.37  ? 507 PHE J CG    1 
ATOM   4492 C  CD1   . PHE I 3 6  ? 43.774 89.107  27.501 1.00 22.14  ? 507 PHE J CD1   1 
ATOM   4493 C  CD2   . PHE I 3 6  ? 44.915 90.842  26.308 1.00 23.09  ? 507 PHE J CD2   1 
ATOM   4494 C  CE1   . PHE I 3 6  ? 44.494 88.138  26.797 1.00 25.89  ? 507 PHE J CE1   1 
ATOM   4495 C  CE2   . PHE I 3 6  ? 45.643 89.887  25.596 1.00 24.81  ? 507 PHE J CE2   1 
ATOM   4496 C  CZ    . PHE I 3 6  ? 45.430 88.529  25.843 1.00 27.20  ? 507 PHE J CZ    1 
ATOM   4497 N  N     . THR I 3 7  ? 42.948 94.292  29.471 1.00 15.54  ? 508 THR J N     1 
ATOM   4498 C  CA    . THR I 3 7  ? 42.072 95.249  30.152 1.00 15.27  ? 508 THR J CA    1 
ATOM   4499 C  C     . THR I 3 7  ? 40.611 94.901  29.901 1.00 13.95  ? 508 THR J C     1 
ATOM   4500 O  O     . THR I 3 7  ? 40.284 94.125  28.999 1.00 13.42  ? 508 THR J O     1 
ATOM   4501 C  CB    . THR I 3 7  ? 42.260 96.688  29.630 1.00 15.47  ? 508 THR J CB    1 
ATOM   4502 O  OG1   . THR I 3 7  ? 41.964 96.706  28.229 1.00 14.19  ? 508 THR J OG1   1 
ATOM   4503 C  CG2   . THR I 3 7  ? 43.690 97.186  29.878 1.00 14.78  ? 508 THR J CG2   1 
ATOM   4504 N  N     . TYR I 3 8  ? 39.723 95.494  30.692 1.00 11.85  ? 509 TYR J N     1 
ATOM   4505 C  CA    . TYR I 3 8  ? 38.300 95.237  30.501 1.00 12.97  ? 509 TYR J CA    1 
ATOM   4506 C  C     . TYR I 3 8  ? 37.896 95.704  29.113 1.00 12.13  ? 509 TYR J C     1 
ATOM   4507 O  O     . TYR I 3 8  ? 37.119 95.042  28.427 1.00 13.11  ? 509 TYR J O     1 
ATOM   4508 C  CB    . TYR I 3 8  ? 37.474 95.957  31.572 1.00 10.74  ? 509 TYR J CB    1 
ATOM   4509 C  CG    . TYR I 3 8  ? 37.194 95.064  32.759 1.00 12.46  ? 509 TYR J CG    1 
ATOM   4510 C  CD1   . TYR I 3 8  ? 37.882 95.211  33.964 1.00 14.06  ? 509 TYR J CD1   1 
ATOM   4511 C  CD2   . TYR I 3 8  ? 36.272 94.022  32.652 1.00 11.62  ? 509 TYR J CD2   1 
ATOM   4512 C  CE1   . TYR I 3 8  ? 37.658 94.329  35.034 1.00 14.50  ? 509 TYR J CE1   1 
ATOM   4513 C  CE2   . TYR I 3 8  ? 36.047 93.149  33.704 1.00 14.72  ? 509 TYR J CE2   1 
ATOM   4514 C  CZ    . TYR I 3 8  ? 36.742 93.300  34.887 1.00 16.01  ? 509 TYR J CZ    1 
ATOM   4515 O  OH    . TYR I 3 8  ? 36.537 92.373  35.893 1.00 15.54  ? 509 TYR J OH    1 
ATOM   4516 N  N     . ALA I 3 9  ? 38.441 96.845  28.704 1.00 12.76  ? 510 ALA J N     1 
ATOM   4517 C  CA    . ALA I 3 9  ? 38.137 97.400  27.389 1.00 13.94  ? 510 ALA J CA    1 
ATOM   4518 C  C     . ALA I 3 9  ? 38.522 96.405  26.297 1.00 14.98  ? 510 ALA J C     1 
ATOM   4519 O  O     . ALA I 3 9  ? 37.742 96.133  25.388 1.00 14.51  ? 510 ALA J O     1 
ATOM   4520 C  CB    . ALA I 3 9  ? 38.888 98.731  27.193 1.00 15.43  ? 510 ALA J CB    1 
ATOM   4521 N  N     . THR I 3 10 ? 39.720 95.847  26.394 1.00 13.48  ? 511 THR J N     1 
ATOM   4522 C  CA    . THR I 3 10 ? 40.170 94.895  25.389 1.00 16.38  ? 511 THR J CA    1 
ATOM   4523 C  C     . THR I 3 10 ? 39.274 93.651  25.334 1.00 15.15  ? 511 THR J C     1 
ATOM   4524 O  O     . THR I 3 10 ? 38.922 93.174  24.250 1.00 16.79  ? 511 THR J O     1 
ATOM   4525 C  CB    . THR I 3 10 ? 41.647 94.510  25.648 1.00 16.09  ? 511 THR J CB    1 
ATOM   4526 O  OG1   . THR I 3 10 ? 42.470 95.663  25.427 1.00 16.90  ? 511 THR J OG1   1 
ATOM   4527 C  CG2   . THR I 3 10 ? 42.100 93.393  24.710 1.00 16.51  ? 511 THR J CG2   1 
ATOM   4528 N  N     . LEU I 3 11 ? 38.902 93.142  26.505 1.00 13.93  ? 512 LEU J N     1 
ATOM   4529 C  CA    . LEU I 3 11 ? 38.034 91.965  26.627 1.00 15.71  ? 512 LEU J CA    1 
ATOM   4530 C  C     . LEU I 3 11 ? 36.637 92.214  26.061 1.00 15.73  ? 512 LEU J C     1 
ATOM   4531 O  O     . LEU I 3 11 ? 36.070 91.364  25.358 1.00 14.69  ? 512 LEU J O     1 
ATOM   4532 C  CB    . LEU I 3 11 ? 37.909 91.571  28.101 1.00 17.12  ? 512 LEU J CB    1 
ATOM   4533 C  CG    . LEU I 3 11 ? 38.711 90.398  28.668 1.00 24.14  ? 512 LEU J CG    1 
ATOM   4534 C  CD1   . LEU I 3 11 ? 40.033 90.232  27.964 1.00 25.28  ? 512 LEU J CD1   1 
ATOM   4535 C  CD2   . LEU I 3 11 ? 38.904 90.621  30.163 1.00 23.23  ? 512 LEU J CD2   1 
ATOM   4536 N  N     . ILE I 3 12 ? 36.066 93.369  26.389 1.00 15.32  ? 513 ILE J N     1 
ATOM   4537 C  CA    . ILE I 3 12 ? 34.740 93.717  25.896 1.00 15.64  ? 513 ILE J CA    1 
ATOM   4538 C  C     . ILE I 3 12 ? 34.779 93.820  24.365 1.00 16.83  ? 513 ILE J C     1 
ATOM   4539 O  O     . ILE I 3 12 ? 33.895 93.306  23.664 1.00 15.13  ? 513 ILE J O     1 
ATOM   4540 C  CB    . ILE I 3 12 ? 34.264 95.061  26.501 1.00 16.15  ? 513 ILE J CB    1 
ATOM   4541 C  CG1   . ILE I 3 12 ? 34.096 94.916  28.018 1.00 14.89  ? 513 ILE J CG1   1 
ATOM   4542 C  CG2   . ILE I 3 12 ? 32.956 95.493  25.861 1.00 15.92  ? 513 ILE J CG2   1 
ATOM   4543 C  CD1   . ILE I 3 12 ? 33.860 96.241  28.743 1.00 16.51  ? 513 ILE J CD1   1 
ATOM   4544 N  N     . ARG I 3 13 ? 35.805 94.479  23.846 1.00 17.96  ? 514 ARG J N     1 
ATOM   4545 C  CA    . ARG I 3 13 ? 35.939 94.631  22.397 1.00 20.06  ? 514 ARG J CA    1 
ATOM   4546 C  C     . ARG I 3 13 ? 36.037 93.253  21.752 1.00 21.26  ? 514 ARG J C     1 
ATOM   4547 O  O     . ARG I 3 13 ? 35.451 93.002  20.689 1.00 18.89  ? 514 ARG J O     1 
ATOM   4548 C  CB    . ARG I 3 13 ? 37.193 95.437  22.058 1.00 22.52  ? 514 ARG J CB    1 
ATOM   4549 C  CG    . ARG I 3 13 ? 37.623 95.332  20.604 1.00 24.37  ? 514 ARG J CG    1 
ATOM   4550 C  CD    . ARG I 3 13 ? 38.702 96.359  20.303 1.00 30.91  ? 514 ARG J CD    1 
ATOM   4551 N  NE    . ARG I 3 13 ? 39.191 96.305  18.928 1.00 32.45  ? 514 ARG J NE    1 
ATOM   4552 C  CZ    . ARG I 3 13 ? 40.067 95.415  18.474 1.00 35.12  ? 514 ARG J CZ    1 
ATOM   4553 N  NH1   . ARG I 3 13 ? 40.561 94.487  19.286 1.00 34.73  ? 514 ARG J NH1   1 
ATOM   4554 N  NH2   . ARG I 3 13 ? 40.458 95.460  17.204 1.00 35.55  ? 514 ARG J NH2   1 
ATOM   4555 N  N     . GLN I 3 14 ? 36.783 92.363  22.401 1.00 19.99  ? 515 GLN J N     1 
ATOM   4556 C  CA    . GLN I 3 14 ? 36.958 91.010  21.882 1.00 20.53  ? 515 GLN J CA    1 
ATOM   4557 C  C     . GLN I 3 14 ? 35.607 90.321  21.760 1.00 20.25  ? 515 GLN J C     1 
ATOM   4558 O  O     . GLN I 3 14 ? 35.290 89.736  20.712 1.00 19.79  ? 515 GLN J O     1 
ATOM   4559 C  CB    . GLN I 3 14 ? 37.871 90.193  22.801 1.00 20.99  ? 515 GLN J CB    1 
ATOM   4560 C  CG    . GLN I 3 14 ? 38.263 88.835  22.251 1.00 25.60  ? 515 GLN J CG    1 
ATOM   4561 C  CD    . GLN I 3 14 ? 39.043 88.945  20.931 1.00 29.50  ? 515 GLN J CD    1 
ATOM   4562 O  OE1   . GLN I 3 14 ? 39.863 89.834  20.756 1.00 29.45  ? 515 GLN J OE1   1 
ATOM   4563 N  NE2   . GLN I 3 14 ? 38.789 88.029  20.013 1.00 30.90  ? 515 GLN J NE2   1 
ATOM   4564 N  N     . ALA I 3 15 ? 34.817 90.387  22.830 1.00 17.69  ? 516 ALA J N     1 
ATOM   4565 C  CA    . ALA I 3 15 ? 33.489 89.781  22.848 1.00 18.69  ? 516 ALA J CA    1 
ATOM   4566 C  C     . ALA I 3 15 ? 32.649 90.268  21.673 1.00 20.12  ? 516 ALA J C     1 
ATOM   4567 O  O     . ALA I 3 15 ? 32.063 89.469  20.942 1.00 20.24  ? 516 ALA J O     1 
ATOM   4568 C  CB    . ALA I 3 15 ? 32.769 90.113  24.161 1.00 16.17  ? 516 ALA J CB    1 
ATOM   4569 N  N     . ILE I 3 16 ? 32.572 91.582  21.510 1.00 18.87  ? 517 ILE J N     1 
ATOM   4570 C  CA    . ILE I 3 16 ? 31.786 92.163  20.432 1.00 20.17  ? 517 ILE J CA    1 
ATOM   4571 C  C     . ILE I 3 16 ? 32.328 91.813  19.041 1.00 22.20  ? 517 ILE J C     1 
ATOM   4572 O  O     . ILE I 3 16 ? 31.560 91.484  18.132 1.00 23.09  ? 517 ILE J O     1 
ATOM   4573 C  CB    . ILE I 3 16 ? 31.729 93.694  20.582 1.00 19.93  ? 517 ILE J CB    1 
ATOM   4574 C  CG1   . ILE I 3 16 ? 31.027 94.051  21.894 1.00 19.69  ? 517 ILE J CG1   1 
ATOM   4575 C  CG2   . ILE I 3 16 ? 31.015 94.319  19.385 1.00 20.88  ? 517 ILE J CG2   1 
ATOM   4576 C  CD1   . ILE I 3 16 ? 31.081 95.531  22.229 1.00 21.32  ? 517 ILE J CD1   1 
ATOM   4577 N  N     . MET I 3 17 ? 33.643 91.889  18.873 1.00 23.25  ? 518 MET J N     1 
ATOM   4578 C  CA    . MET I 3 17 ? 34.246 91.587  17.586 1.00 27.01  ? 518 MET J CA    1 
ATOM   4579 C  C     . MET I 3 17 ? 33.999 90.144  17.165 1.00 27.68  ? 518 MET J C     1 
ATOM   4580 O  O     . MET I 3 17 ? 33.920 89.851  15.973 1.00 28.09  ? 518 MET J O     1 
ATOM   4581 C  CB    . MET I 3 17 ? 35.752 91.866  17.617 1.00 29.48  ? 518 MET J CB    1 
ATOM   4582 C  CG    . MET I 3 17 ? 36.110 93.340  17.732 1.00 34.44  ? 518 MET J CG    1 
ATOM   4583 S  SD    . MET I 3 17 ? 35.511 94.318  16.330 1.00 45.14  ? 518 MET J SD    1 
ATOM   4584 C  CE    . MET I 3 17 ? 37.005 94.443  15.344 1.00 39.89  ? 518 MET J CE    1 
ATOM   4585 N  N     . GLU I 3 18 ? 33.866 89.246  18.138 1.00 26.34  ? 519 GLU J N     1 
ATOM   4586 C  CA    . GLU I 3 18 ? 33.640 87.834  17.837 1.00 25.95  ? 519 GLU J CA    1 
ATOM   4587 C  C     . GLU I 3 18 ? 32.192 87.504  17.507 1.00 26.64  ? 519 GLU J C     1 
ATOM   4588 O  O     . GLU I 3 18 ? 31.897 86.415  17.010 1.00 26.45  ? 519 GLU J O     1 
ATOM   4589 C  CB    . GLU I 3 18 ? 34.098 86.957  19.011 1.00 24.86  ? 519 GLU J CB    1 
ATOM   4590 C  CG    . GLU I 3 18 ? 35.594 86.966  19.226 1.00 24.58  ? 519 GLU J CG    1 
ATOM   4591 C  CD    . GLU I 3 18 ? 36.045 86.006  20.314 1.00 23.94  ? 519 GLU J CD    1 
ATOM   4592 O  OE1   . GLU I 3 18 ? 37.264 85.935  20.549 1.00 24.88  ? 519 GLU J OE1   1 
ATOM   4593 O  OE2   . GLU I 3 18 ? 35.193 85.331  20.929 1.00 26.36  ? 519 GLU J OE2   1 
ATOM   4594 N  N     . SER I 3 19 ? 31.282 88.431  17.784 1.00 23.97  ? 520 SER J N     1 
ATOM   4595 C  CA    . SER I 3 19 ? 29.872 88.177  17.511 1.00 25.03  ? 520 SER J CA    1 
ATOM   4596 C  C     . SER I 3 19 ? 29.616 88.293  16.007 1.00 24.85  ? 520 SER J C     1 
ATOM   4597 O  O     . SER I 3 19 ? 30.268 89.077  15.318 1.00 24.39  ? 520 SER J O     1 
ATOM   4598 C  CB    . SER I 3 19 ? 28.991 89.165  18.282 1.00 24.32  ? 520 SER J CB    1 
ATOM   4599 O  OG    . SER I 3 19 ? 29.299 90.496  17.920 1.00 25.15  ? 520 SER J OG    1 
ATOM   4600 N  N     . SER I 3 20 ? 28.662 87.517  15.510 1.00 26.88  ? 521 SER J N     1 
ATOM   4601 C  CA    . SER I 3 20 ? 28.340 87.508  14.082 1.00 29.72  ? 521 SER J CA    1 
ATOM   4602 C  C     . SER I 3 20 ? 27.952 88.862  13.466 1.00 29.53  ? 521 SER J C     1 
ATOM   4603 O  O     . SER I 3 20 ? 28.260 89.128  12.304 1.00 30.56  ? 521 SER J O     1 
ATOM   4604 C  CB    . SER I 3 20 ? 27.230 86.485  13.820 1.00 31.18  ? 521 SER J CB    1 
ATOM   4605 O  OG    . SER I 3 20 ? 26.072 86.771  14.583 1.00 35.06  ? 521 SER J OG    1 
ATOM   4606 N  N     . ASP I 3 21 ? 27.286 89.711  14.244 1.00 28.30  ? 522 ASP J N     1 
ATOM   4607 C  CA    . ASP I 3 21 ? 26.839 91.021  13.764 1.00 27.41  ? 522 ASP J CA    1 
ATOM   4608 C  C     . ASP I 3 21 ? 27.583 92.169  14.445 1.00 27.07  ? 522 ASP J C     1 
ATOM   4609 O  O     . ASP I 3 21 ? 27.145 93.317  14.394 1.00 25.99  ? 522 ASP J O     1 
ATOM   4610 C  CB    . ASP I 3 21 ? 25.341 91.176  14.027 1.00 29.17  ? 522 ASP J CB    1 
ATOM   4611 C  CG    . ASP I 3 21 ? 24.514 90.127  13.314 1.00 31.42  ? 522 ASP J CG    1 
ATOM   4612 O  OD1   . ASP I 3 21 ? 23.495 89.679  13.887 1.00 32.93  ? 522 ASP J OD1   1 
ATOM   4613 O  OD2   . ASP I 3 21 ? 24.879 89.763  12.175 1.00 31.58  ? 522 ASP J OD2   1 
ATOM   4614 N  N     . ARG I 3 22 ? 28.707 91.854  15.077 1.00 25.75  ? 523 ARG J N     1 
ATOM   4615 C  CA    . ARG I 3 22 ? 29.502 92.861  15.781 1.00 25.85  ? 523 ARG J CA    1 
ATOM   4616 C  C     . ARG I 3 22 ? 28.645 93.711  16.718 1.00 23.56  ? 523 ARG J C     1 
ATOM   4617 O  O     . ARG I 3 22 ? 28.729 94.939  16.716 1.00 22.03  ? 523 ARG J O     1 
ATOM   4618 C  CB    . ARG I 3 22 ? 30.235 93.768  14.788 1.00 30.85  ? 523 ARG J CB    1 
ATOM   4619 C  CG    . ARG I 3 22 ? 31.513 93.176  14.218 1.00 37.82  ? 523 ARG J CG    1 
ATOM   4620 C  CD    . ARG I 3 22 ? 32.296 94.235  13.460 1.00 45.30  ? 523 ARG J CD    1 
ATOM   4621 N  NE    . ARG I 3 22 ? 32.505 95.431  14.275 1.00 50.65  ? 523 ARG J NE    1 
ATOM   4622 C  CZ    . ARG I 3 22 ? 33.137 96.526  13.859 1.00 54.09  ? 523 ARG J CZ    1 
ATOM   4623 N  NH1   . ARG I 3 22 ? 33.631 96.585  12.628 1.00 54.94  ? 523 ARG J NH1   1 
ATOM   4624 N  NH2   . ARG I 3 22 ? 33.268 97.568  14.672 1.00 54.29  ? 523 ARG J NH2   1 
ATOM   4625 N  N     . GLN I 3 23 ? 27.831 93.037  17.522 1.00 21.97  ? 524 GLN J N     1 
ATOM   4626 C  CA    . GLN I 3 23 ? 26.964 93.689  18.491 1.00 21.04  ? 524 GLN J CA    1 
ATOM   4627 C  C     . GLN I 3 23 ? 26.498 92.664  19.506 1.00 21.20  ? 524 GLN J C     1 
ATOM   4628 O  O     . GLN I 3 23 ? 26.236 91.505  19.159 1.00 21.13  ? 524 GLN J O     1 
ATOM   4629 C  CB    . GLN I 3 23 ? 25.738 94.307  17.809 1.00 22.38  ? 524 GLN J CB    1 
ATOM   4630 C  CG    . GLN I 3 23 ? 24.925 93.316  16.987 1.00 22.21  ? 524 GLN J CG    1 
ATOM   4631 C  CD    . GLN I 3 23 ? 23.603 93.902  16.507 1.00 25.75  ? 524 GLN J CD    1 
ATOM   4632 O  OE1   . GLN I 3 23 ? 23.500 95.101  16.234 1.00 22.77  ? 524 GLN J OE1   1 
ATOM   4633 N  NE2   . GLN I 3 23 ? 22.588 93.050  16.393 1.00 24.61  ? 524 GLN J NE2   1 
ATOM   4634 N  N     . LEU I 3 24 ? 26.389 93.092  20.757 1.00 18.36  ? 525 LEU J N     1 
ATOM   4635 C  CA    . LEU I 3 24 ? 25.943 92.217  21.838 1.00 18.01  ? 525 LEU J CA    1 
ATOM   4636 C  C     . LEU I 3 24 ? 25.192 93.008  22.894 1.00 17.36  ? 525 LEU J C     1 
ATOM   4637 O  O     . LEU I 3 24 ? 25.537 94.154  23.183 1.00 16.72  ? 525 LEU J O     1 
ATOM   4638 C  CB    . LEU I 3 24 ? 27.136 91.543  22.528 1.00 14.31  ? 525 LEU J CB    1 
ATOM   4639 C  CG    . LEU I 3 24 ? 27.964 90.448  21.854 1.00 18.24  ? 525 LEU J CG    1 
ATOM   4640 C  CD1   . LEU I 3 24 ? 29.090 90.050  22.835 1.00 17.95  ? 525 LEU J CD1   1 
ATOM   4641 C  CD2   . LEU I 3 24 ? 27.096 89.219  21.529 1.00 15.88  ? 525 LEU J CD2   1 
ATOM   4642 N  N     . THR I 3 25 ? 24.160 92.403  23.467 1.00 16.37  ? 526 THR J N     1 
ATOM   4643 C  CA    . THR I 3 25 ? 23.424 93.054  24.541 1.00 16.59  ? 526 THR J CA    1 
ATOM   4644 C  C     . THR I 3 25 ? 24.334 92.929  25.765 1.00 17.49  ? 526 THR J C     1 
ATOM   4645 O  O     . THR I 3 25 ? 25.301 92.151  25.756 1.00 13.51  ? 526 THR J O     1 
ATOM   4646 C  CB    . THR I 3 25 ? 22.116 92.327  24.878 1.00 18.67  ? 526 THR J CB    1 
ATOM   4647 O  OG1   . THR I 3 25 ? 22.415 91.009  25.355 1.00 17.35  ? 526 THR J OG1   1 
ATOM   4648 C  CG2   . THR I 3 25 ? 21.219 92.231  23.652 1.00 19.31  ? 526 THR J CG2   1 
ATOM   4649 N  N     . LEU I 3 26 ? 24.024 93.671  26.822 1.00 16.01  ? 527 LEU J N     1 
ATOM   4650 C  CA    . LEU I 3 26 ? 24.838 93.592  28.039 1.00 16.52  ? 527 LEU J CA    1 
ATOM   4651 C  C     . LEU I 3 26 ? 24.888 92.155  28.581 1.00 16.83  ? 527 LEU J C     1 
ATOM   4652 O  O     . LEU I 3 26 ? 25.957 91.646  28.916 1.00 14.08  ? 527 LEU J O     1 
ATOM   4653 C  CB    . LEU I 3 26 ? 24.272 94.524  29.119 1.00 14.72  ? 527 LEU J CB    1 
ATOM   4654 C  CG    . LEU I 3 26 ? 24.953 94.454  30.492 1.00 13.48  ? 527 LEU J CG    1 
ATOM   4655 C  CD1   . LEU I 3 26 ? 26.404 94.893  30.374 1.00 12.38  ? 527 LEU J CD1   1 
ATOM   4656 C  CD2   . LEU I 3 26 ? 24.208 95.350  31.481 1.00 16.11  ? 527 LEU J CD2   1 
ATOM   4657 N  N     . ASN I 3 27 ? 23.737 91.491  28.647 1.00 17.22  ? 528 ASN J N     1 
ATOM   4658 C  CA    . ASN I 3 27 ? 23.712 90.129  29.170 1.00 18.34  ? 528 ASN J CA    1 
ATOM   4659 C  C     . ASN I 3 27 ? 24.525 89.153  28.326 1.00 18.69  ? 528 ASN J C     1 
ATOM   4660 O  O     . ASN I 3 27 ? 25.096 88.197  28.855 1.00 17.73  ? 528 ASN J O     1 
ATOM   4661 C  CB    . ASN I 3 27 ? 22.278 89.620  29.311 1.00 21.59  ? 528 ASN J CB    1 
ATOM   4662 C  CG    . ASN I 3 27 ? 22.194 88.393  30.195 1.00 24.59  ? 528 ASN J CG    1 
ATOM   4663 O  OD1   . ASN I 3 27 ? 21.736 87.328  29.767 1.00 26.03  ? 528 ASN J OD1   1 
ATOM   4664 N  ND2   . ASN I 3 27 ? 22.645 88.533  31.438 1.00 21.03  ? 528 ASN J ND2   1 
ATOM   4665 N  N     . GLU I 3 28 ? 24.567 89.384  27.017 1.00 17.79  ? 529 GLU J N     1 
ATOM   4666 C  CA    . GLU I 3 28 ? 25.339 88.537  26.109 1.00 18.55  ? 529 GLU J CA    1 
ATOM   4667 C  C     . GLU I 3 28 ? 26.825 88.755  26.382 1.00 18.11  ? 529 GLU J C     1 
ATOM   4668 O  O     . GLU I 3 28 ? 27.637 87.827  26.277 1.00 14.87  ? 529 GLU J O     1 
ATOM   4669 C  CB    . GLU I 3 28 ? 25.004 88.874  24.649 1.00 20.03  ? 529 GLU J CB    1 
ATOM   4670 C  CG    . GLU I 3 28 ? 23.674 88.280  24.179 1.00 20.80  ? 529 GLU J CG    1 
ATOM   4671 C  CD    . GLU I 3 28 ? 23.266 88.735  22.782 1.00 25.93  ? 529 GLU J CD    1 
ATOM   4672 O  OE1   . GLU I 3 28 ? 22.470 88.006  22.145 1.00 28.53  ? 529 GLU J OE1   1 
ATOM   4673 O  OE2   . GLU I 3 28 ? 23.718 89.812  22.318 1.00 23.22  ? 529 GLU J OE2   1 
ATOM   4674 N  N     . ILE I 3 29 ? 27.185 89.988  26.742 1.00 15.24  ? 530 ILE J N     1 
ATOM   4675 C  CA    . ILE I 3 29 ? 28.580 90.270  27.059 1.00 14.28  ? 530 ILE J CA    1 
ATOM   4676 C  C     . ILE I 3 29 ? 28.951 89.556  28.367 1.00 13.63  ? 530 ILE J C     1 
ATOM   4677 O  O     . ILE I 3 29 ? 30.037 88.976  28.466 1.00 14.65  ? 530 ILE J O     1 
ATOM   4678 C  CB    . ILE I 3 29 ? 28.838 91.791  27.172 1.00 15.65  ? 530 ILE J CB    1 
ATOM   4679 C  CG1   . ILE I 3 29 ? 28.755 92.410  25.772 1.00 14.63  ? 530 ILE J CG1   1 
ATOM   4680 C  CG2   . ILE I 3 29 ? 30.218 92.058  27.774 1.00 12.52  ? 530 ILE J CG2   1 
ATOM   4681 C  CD1   . ILE I 3 29 ? 28.698 93.941  25.766 1.00 20.26  ? 530 ILE J CD1   1 
ATOM   4682 N  N     . TYR I 3 30 ? 28.067 89.600  29.361 1.00 12.05  ? 531 TYR J N     1 
ATOM   4683 C  CA    . TYR I 3 30 ? 28.316 88.892  30.625 1.00 14.34  ? 531 TYR J CA    1 
ATOM   4684 C  C     . TYR I 3 30 ? 28.541 87.404  30.301 1.00 15.18  ? 531 TYR J C     1 
ATOM   4685 O  O     . TYR I 3 30 ? 29.496 86.774  30.772 1.00 13.20  ? 531 TYR J O     1 
ATOM   4686 C  CB    . TYR I 3 30 ? 27.098 88.970  31.552 1.00 13.23  ? 531 TYR J CB    1 
ATOM   4687 C  CG    . TYR I 3 30 ? 26.770 90.309  32.192 1.00 13.33  ? 531 TYR J CG    1 
ATOM   4688 C  CD1   . TYR I 3 30 ? 25.494 90.542  32.715 1.00 12.73  ? 531 TYR J CD1   1 
ATOM   4689 C  CD2   . TYR I 3 30 ? 27.724 91.318  32.318 1.00 13.77  ? 531 TYR J CD2   1 
ATOM   4690 C  CE1   . TYR I 3 30 ? 25.172 91.750  33.351 1.00 14.82  ? 531 TYR J CE1   1 
ATOM   4691 C  CE2   . TYR I 3 30 ? 27.411 92.540  32.963 1.00 14.79  ? 531 TYR J CE2   1 
ATOM   4692 C  CZ    . TYR I 3 30 ? 26.135 92.740  33.473 1.00 14.27  ? 531 TYR J CZ    1 
ATOM   4693 O  OH    . TYR I 3 30 ? 25.814 93.918  34.122 1.00 14.41  ? 531 TYR J OH    1 
ATOM   4694 N  N     . SER I 3 31 ? 27.650 86.842  29.487 1.00 15.54  ? 532 SER J N     1 
ATOM   4695 C  CA    . SER I 3 31 ? 27.763 85.423  29.128 1.00 16.79  ? 532 SER J CA    1 
ATOM   4696 C  C     . SER I 3 31 ? 29.098 85.062  28.492 1.00 17.48  ? 532 SER J C     1 
ATOM   4697 O  O     . SER I 3 31 ? 29.633 83.986  28.768 1.00 19.01  ? 532 SER J O     1 
ATOM   4698 C  CB    . SER I 3 31 ? 26.625 85.012  28.193 1.00 16.71  ? 532 SER J CB    1 
ATOM   4699 O  OG    . SER I 3 31 ? 25.384 85.159  28.854 1.00 19.25  ? 532 SER J OG    1 
ATOM   4700 N  N     . TRP I 3 32 ? 29.629 85.946  27.642 1.00 15.97  ? 533 TRP J N     1 
ATOM   4701 C  CA    . TRP I 3 32 ? 30.913 85.708  26.983 1.00 15.28  ? 533 TRP J CA    1 
ATOM   4702 C  C     . TRP I 3 32 ? 32.024 85.646  28.035 1.00 16.93  ? 533 TRP J C     1 
ATOM   4703 O  O     . TRP I 3 32 ? 32.914 84.800  27.966 1.00 16.24  ? 533 TRP J O     1 
ATOM   4704 C  CB    . TRP I 3 32 ? 31.230 86.828  25.988 1.00 16.11  ? 533 TRP J CB    1 
ATOM   4705 C  CG    . TRP I 3 32 ? 32.514 86.623  25.226 1.00 17.31  ? 533 TRP J CG    1 
ATOM   4706 C  CD1   . TRP I 3 32 ? 32.669 85.958  24.038 1.00 18.64  ? 533 TRP J CD1   1 
ATOM   4707 C  CD2   . TRP I 3 32 ? 33.818 87.105  25.585 1.00 17.24  ? 533 TRP J CD2   1 
ATOM   4708 N  NE1   . TRP I 3 32 ? 33.980 86.006  23.639 1.00 18.72  ? 533 TRP J NE1   1 
ATOM   4709 C  CE2   . TRP I 3 32 ? 34.706 86.701  24.570 1.00 18.40  ? 533 TRP J CE2   1 
ATOM   4710 C  CE3   . TRP I 3 32 ? 34.320 87.844  26.668 1.00 16.26  ? 533 TRP J CE3   1 
ATOM   4711 C  CZ2   . TRP I 3 32 ? 36.073 87.009  24.604 1.00 19.38  ? 533 TRP J CZ2   1 
ATOM   4712 C  CZ3   . TRP I 3 32 ? 35.677 88.152  26.698 1.00 15.90  ? 533 TRP J CZ3   1 
ATOM   4713 C  CH2   . TRP I 3 32 ? 36.536 87.736  25.679 1.00 16.82  ? 533 TRP J CH2   1 
ATOM   4714 N  N     . PHE I 3 33 ? 31.981 86.570  28.993 1.00 16.55  ? 534 PHE J N     1 
ATOM   4715 C  CA    . PHE I 3 33 ? 32.975 86.594  30.066 1.00 16.31  ? 534 PHE J CA    1 
ATOM   4716 C  C     . PHE I 3 33 ? 32.963 85.295  30.880 1.00 16.17  ? 534 PHE J C     1 
ATOM   4717 O  O     . PHE I 3 33 ? 34.007 84.676  31.082 1.00 17.13  ? 534 PHE J O     1 
ATOM   4718 C  CB    . PHE I 3 33 ? 32.712 87.781  31.004 1.00 14.53  ? 534 PHE J CB    1 
ATOM   4719 C  CG    . PHE I 3 33 ? 33.389 89.059  30.573 1.00 15.16  ? 534 PHE J CG    1 
ATOM   4720 C  CD1   . PHE I 3 33 ? 34.509 89.530  31.257 1.00 17.03  ? 534 PHE J CD1   1 
ATOM   4721 C  CD2   . PHE I 3 33 ? 32.922 89.782  29.476 1.00 14.26  ? 534 PHE J CD2   1 
ATOM   4722 C  CE1   . PHE I 3 33 ? 35.165 90.712  30.856 1.00 15.21  ? 534 PHE J CE1   1 
ATOM   4723 C  CE2   . PHE I 3 33 ? 33.563 90.960  29.067 1.00 13.32  ? 534 PHE J CE2   1 
ATOM   4724 C  CZ    . PHE I 3 33 ? 34.683 91.427  29.752 1.00 14.97  ? 534 PHE J CZ    1 
ATOM   4725 N  N     . THR I 3 34 ? 31.789 84.871  31.335 1.00 16.61  ? 535 THR J N     1 
ATOM   4726 C  CA    . THR I 3 34 ? 31.715 83.662  32.157 1.00 19.12  ? 535 THR J CA    1 
ATOM   4727 C  C     . THR I 3 34 ? 32.048 82.385  31.394 1.00 19.72  ? 535 THR J C     1 
ATOM   4728 O  O     . THR I 3 34 ? 32.660 81.458  31.944 1.00 18.94  ? 535 THR J O     1 
ATOM   4729 C  CB    . THR I 3 34 ? 30.326 83.504  32.812 1.00 21.14  ? 535 THR J CB    1 
ATOM   4730 O  OG1   . THR I 3 34 ? 29.357 83.188  31.810 1.00 23.69  ? 535 THR J OG1   1 
ATOM   4731 C  CG2   . THR I 3 34 ? 29.913 84.786  33.509 1.00 18.95  ? 535 THR J CG2   1 
ATOM   4732 N  N     . ARG I 3 35 ? 31.651 82.328  30.130 1.00 20.39  ? 536 ARG J N     1 
ATOM   4733 C  CA    . ARG I 3 35 ? 31.914 81.156  29.297 1.00 21.31  ? 536 ARG J CA    1 
ATOM   4734 C  C     . ARG I 3 35 ? 33.393 81.021  28.947 1.00 21.02  ? 536 ARG J C     1 
ATOM   4735 O  O     . ARG I 3 35 ? 33.938 79.913  28.867 1.00 21.28  ? 536 ARG J O     1 
ATOM   4736 C  CB    . ARG I 3 35 ? 31.100 81.274  28.003 1.00 24.01  ? 536 ARG J CB    1 
ATOM   4737 C  CG    . ARG I 3 35 ? 31.531 80.368  26.868 1.00 29.92  ? 536 ARG J CG    1 
ATOM   4738 C  CD    . ARG I 3 35 ? 31.102 80.970  25.523 1.00 31.04  ? 536 ARG J CD    1 
ATOM   4739 N  NE    . ARG I 3 35 ? 29.818 81.647  25.654 1.00 31.40  ? 536 ARG J NE    1 
ATOM   4740 C  CZ    . ARG I 3 35 ? 29.427 82.681  24.915 1.00 29.56  ? 536 ARG J CZ    1 
ATOM   4741 N  NH1   . ARG I 3 35 ? 30.213 83.174  23.968 1.00 30.58  ? 536 ARG J NH1   1 
ATOM   4742 N  NH2   . ARG I 3 35 ? 28.252 83.233  25.143 1.00 27.44  ? 536 ARG J NH2   1 
ATOM   4743 N  N     . THR I 3 36 ? 34.048 82.158  28.779 1.00 17.01  ? 537 THR J N     1 
ATOM   4744 C  CA    . THR I 3 36 ? 35.433 82.180  28.355 1.00 17.11  ? 537 THR J CA    1 
ATOM   4745 C  C     . THR I 3 36 ? 36.505 82.018  29.415 1.00 19.03  ? 537 THR J C     1 
ATOM   4746 O  O     . THR I 3 36 ? 37.521 81.376  29.158 1.00 18.84  ? 537 THR J O     1 
ATOM   4747 C  CB    . THR I 3 36 ? 35.688 83.465  27.566 1.00 17.05  ? 537 THR J CB    1 
ATOM   4748 O  OG1   . THR I 3 36 ? 34.695 83.561  26.539 1.00 17.38  ? 537 THR J OG1   1 
ATOM   4749 C  CG2   . THR I 3 36 ? 37.075 83.454  26.919 1.00 17.81  ? 537 THR J CG2   1 
ATOM   4750 N  N     . PHE I 3 37 ? 36.300 82.593  30.597 1.00 16.10  ? 538 PHE J N     1 
ATOM   4751 C  CA    . PHE I 3 37 ? 37.320 82.483  31.642 1.00 17.17  ? 538 PHE J CA    1 
ATOM   4752 C  C     . PHE I 3 37 ? 36.778 82.112  33.007 1.00 15.82  ? 538 PHE J C     1 
ATOM   4753 O  O     . PHE I 3 37 ? 35.766 82.652  33.453 1.00 15.45  ? 538 PHE J O     1 
ATOM   4754 C  CB    . PHE I 3 37 ? 38.089 83.796  31.808 1.00 16.97  ? 538 PHE J CB    1 
ATOM   4755 C  CG    . PHE I 3 37 ? 38.520 84.424  30.522 1.00 17.71  ? 538 PHE J CG    1 
ATOM   4756 C  CD1   . PHE I 3 37 ? 37.716 85.370  29.891 1.00 16.93  ? 538 PHE J CD1   1 
ATOM   4757 C  CD2   . PHE I 3 37 ? 39.744 84.092  29.947 1.00 18.77  ? 538 PHE J CD2   1 
ATOM   4758 C  CE1   . PHE I 3 37 ? 38.129 85.979  28.704 1.00 15.21  ? 538 PHE J CE1   1 
ATOM   4759 C  CE2   . PHE I 3 37 ? 40.164 84.694  28.760 1.00 17.83  ? 538 PHE J CE2   1 
ATOM   4760 C  CZ    . PHE I 3 37 ? 39.353 85.641  28.139 1.00 19.28  ? 538 PHE J CZ    1 
ATOM   4761 N  N     . ALA I 3 38 ? 37.492 81.217  33.687 1.00 13.80  ? 539 ALA J N     1 
ATOM   4762 C  CA    . ALA I 3 38 ? 37.103 80.771  35.023 1.00 13.67  ? 539 ALA J CA    1 
ATOM   4763 C  C     . ALA I 3 38 ? 37.024 81.952  35.984 1.00 11.18  ? 539 ALA J C     1 
ATOM   4764 O  O     . ALA I 3 38 ? 36.179 81.979  36.873 1.00 13.27  ? 539 ALA J O     1 
ATOM   4765 C  CB    . ALA I 3 38 ? 38.135 79.736  35.553 1.00 12.85  ? 539 ALA J CB    1 
ATOM   4766 N  N     . TYR I 3 39 ? 37.917 82.916  35.807 1.00 13.21  ? 540 TYR J N     1 
ATOM   4767 C  CA    . TYR I 3 39 ? 37.961 84.100  36.671 1.00 14.05  ? 540 TYR J CA    1 
ATOM   4768 C  C     . TYR I 3 39 ? 36.604 84.776  36.800 1.00 13.05  ? 540 TYR J C     1 
ATOM   4769 O  O     . TYR I 3 39 ? 36.249 85.270  37.878 1.00 12.15  ? 540 TYR J O     1 
ATOM   4770 C  CB    . TYR I 3 39 ? 38.983 85.111  36.129 1.00 13.45  ? 540 TYR J CB    1 
ATOM   4771 C  CG    . TYR I 3 39 ? 39.117 86.380  36.958 1.00 16.42  ? 540 TYR J CG    1 
ATOM   4772 C  CD1   . TYR I 3 39 ? 39.829 86.380  38.160 1.00 17.85  ? 540 TYR J CD1   1 
ATOM   4773 C  CD2   . TYR I 3 39 ? 38.539 87.584  36.535 1.00 16.04  ? 540 TYR J CD2   1 
ATOM   4774 C  CE1   . TYR I 3 39 ? 39.969 87.544  38.923 1.00 19.48  ? 540 TYR J CE1   1 
ATOM   4775 C  CE2   . TYR I 3 39 ? 38.677 88.765  37.297 1.00 18.07  ? 540 TYR J CE2   1 
ATOM   4776 C  CZ    . TYR I 3 39 ? 39.393 88.734  38.483 1.00 19.93  ? 540 TYR J CZ    1 
ATOM   4777 O  OH    . TYR I 3 39 ? 39.578 89.883  39.231 1.00 20.88  ? 540 TYR J OH    1 
ATOM   4778 N  N     . PHE I 3 40 ? 35.834 84.797  35.714 1.00 12.31  ? 541 PHE J N     1 
ATOM   4779 C  CA    . PHE I 3 40 ? 34.536 85.458  35.758 1.00 13.34  ? 541 PHE J CA    1 
ATOM   4780 C  C     . PHE I 3 40 ? 33.368 84.588  36.209 1.00 16.44  ? 541 PHE J C     1 
ATOM   4781 O  O     . PHE I 3 40 ? 32.202 84.962  36.049 1.00 17.51  ? 541 PHE J O     1 
ATOM   4782 C  CB    . PHE I 3 40 ? 34.245 86.124  34.400 1.00 11.64  ? 541 PHE J CB    1 
ATOM   4783 C  CG    . PHE I 3 40 ? 35.273 87.155  34.017 1.00 11.96  ? 541 PHE J CG    1 
ATOM   4784 C  CD1   . PHE I 3 40 ? 36.166 86.912  32.989 1.00 12.41  ? 541 PHE J CD1   1 
ATOM   4785 C  CD2   . PHE I 3 40 ? 35.396 88.337  34.749 1.00 12.64  ? 541 PHE J CD2   1 
ATOM   4786 C  CE1   . PHE I 3 40 ? 37.172 87.813  32.689 1.00 14.19  ? 541 PHE J CE1   1 
ATOM   4787 C  CE2   . PHE I 3 40 ? 36.410 89.261  34.458 1.00 11.20  ? 541 PHE J CE2   1 
ATOM   4788 C  CZ    . PHE I 3 40 ? 37.296 89.000  33.431 1.00 12.73  ? 541 PHE J CZ    1 
ATOM   4789 N  N     . ARG I 3 41 ? 33.671 83.430  36.784 1.00 17.62  ? 542 ARG J N     1 
ATOM   4790 C  CA    . ARG I 3 41 ? 32.617 82.569  37.291 1.00 18.98  ? 542 ARG J CA    1 
ATOM   4791 C  C     . ARG I 3 41 ? 32.438 82.752  38.797 1.00 19.64  ? 542 ARG J C     1 
ATOM   4792 O  O     . ARG I 3 41 ? 31.952 81.862  39.485 1.00 20.46  ? 542 ARG J O     1 
ATOM   4793 C  CB    . ARG I 3 41 ? 32.903 81.101  36.955 1.00 20.51  ? 542 ARG J CB    1 
ATOM   4794 C  CG    . ARG I 3 41 ? 32.660 80.788  35.492 1.00 21.11  ? 542 ARG J CG    1 
ATOM   4795 C  CD    . ARG I 3 41 ? 33.222 79.425  35.075 1.00 25.44  ? 542 ARG J CD    1 
ATOM   4796 N  NE    . ARG I 3 41 ? 33.610 79.519  33.676 1.00 26.70  ? 542 ARG J NE    1 
ATOM   4797 C  CZ    . ARG I 3 41 ? 34.602 78.853  33.114 1.00 25.02  ? 542 ARG J CZ    1 
ATOM   4798 N  NH1   . ARG I 3 41 ? 35.335 77.998  33.823 1.00 21.78  ? 542 ARG J NH1   1 
ATOM   4799 N  NH2   . ARG I 3 41 ? 34.893 79.092  31.843 1.00 27.26  ? 542 ARG J NH2   1 
ATOM   4800 N  N     . ARG I 3 42 ? 32.860 83.909  39.303 1.00 17.73  ? 543 ARG J N     1 
ATOM   4801 C  CA    . ARG I 3 42 ? 32.701 84.238  40.713 1.00 18.03  ? 543 ARG J CA    1 
ATOM   4802 C  C     . ARG I 3 42 ? 32.777 85.749  40.876 1.00 18.38  ? 543 ARG J C     1 
ATOM   4803 O  O     . ARG I 3 42 ? 33.238 86.450  39.973 1.00 18.00  ? 543 ARG J O     1 
ATOM   4804 C  CB    . ARG I 3 42 ? 33.792 83.577  41.567 1.00 21.45  ? 543 ARG J CB    1 
ATOM   4805 C  CG    . ARG I 3 42 ? 35.215 83.961  41.192 1.00 23.34  ? 543 ARG J CG    1 
ATOM   4806 C  CD    . ARG I 3 42 ? 35.857 82.855  40.375 1.00 28.20  ? 543 ARG J CD    1 
ATOM   4807 N  NE    . ARG I 3 42 ? 35.964 81.629  41.159 1.00 28.76  ? 543 ARG J NE    1 
ATOM   4808 C  CZ    . ARG I 3 42 ? 35.791 80.404  40.672 1.00 30.27  ? 543 ARG J CZ    1 
ATOM   4809 N  NH1   . ARG I 3 42 ? 35.497 80.229  39.393 1.00 27.92  ? 543 ARG J NH1   1 
ATOM   4810 N  NH2   . ARG I 3 42 ? 35.913 79.349  41.472 1.00 30.90  ? 543 ARG J NH2   1 
ATOM   4811 N  N     . ASN I 3 43 ? 32.328 86.236  42.028 1.00 18.96  ? 544 ASN J N     1 
ATOM   4812 C  CA    . ASN I 3 43 ? 32.347 87.662  42.337 1.00 20.19  ? 544 ASN J CA    1 
ATOM   4813 C  C     . ASN I 3 43 ? 31.702 88.503  41.229 1.00 19.41  ? 544 ASN J C     1 
ATOM   4814 O  O     . ASN I 3 43 ? 32.221 89.543  40.833 1.00 18.12  ? 544 ASN J O     1 
ATOM   4815 C  CB    . ASN I 3 43 ? 33.791 88.094  42.582 1.00 22.74  ? 544 ASN J CB    1 
ATOM   4816 C  CG    . ASN I 3 43 ? 34.447 87.284  43.688 1.00 25.37  ? 544 ASN J CG    1 
ATOM   4817 O  OD1   . ASN I 3 43 ? 35.567 86.799  43.541 1.00 26.87  ? 544 ASN J OD1   1 
ATOM   4818 N  ND2   . ASN I 3 43 ? 33.739 87.128  44.804 1.00 28.04  ? 544 ASN J ND2   1 
ATOM   4819 N  N     . ALA I 3 44 ? 30.546 88.055  40.754 1.00 18.59  ? 545 ALA J N     1 
ATOM   4820 C  CA    . ALA I 3 44 ? 29.850 88.764  39.690 1.00 20.49  ? 545 ALA J CA    1 
ATOM   4821 C  C     . ALA I 3 44 ? 29.590 90.226  40.035 1.00 21.21  ? 545 ALA J C     1 
ATOM   4822 O  O     . ALA I 3 44 ? 29.722 91.099  39.180 1.00 19.78  ? 545 ALA J O     1 
ATOM   4823 C  CB    . ALA I 3 44 ? 28.534 88.060  39.376 1.00 20.96  ? 545 ALA J CB    1 
ATOM   4824 N  N     . ALA I 3 45 ? 29.228 90.499  41.286 1.00 22.91  ? 546 ALA J N     1 
ATOM   4825 C  CA    . ALA I 3 45 ? 28.942 91.872  41.687 1.00 23.83  ? 546 ALA J CA    1 
ATOM   4826 C  C     . ALA I 3 45 ? 30.101 92.793  41.322 1.00 24.61  ? 546 ALA J C     1 
ATOM   4827 O  O     . ALA I 3 45 ? 29.889 93.936  40.919 1.00 24.16  ? 546 ALA J O     1 
ATOM   4828 C  CB    . ALA I 3 45 ? 28.656 91.941  43.181 1.00 25.76  ? 546 ALA J CB    1 
ATOM   4829 N  N     . THR I 3 46 ? 31.324 92.291  41.446 1.00 20.89  ? 547 THR J N     1 
ATOM   4830 C  CA    . THR I 3 46 ? 32.497 93.085  41.114 1.00 20.32  ? 547 THR J CA    1 
ATOM   4831 C  C     . THR I 3 46 ? 32.767 93.233  39.616 1.00 17.75  ? 547 THR J C     1 
ATOM   4832 O  O     . THR I 3 46 ? 32.856 94.346  39.111 1.00 14.53  ? 547 THR J O     1 
ATOM   4833 C  CB    . THR I 3 46 ? 33.782 92.506  41.752 1.00 23.93  ? 547 THR J CB    1 
ATOM   4834 O  OG1   . THR I 3 46 ? 33.680 92.571  43.178 1.00 29.53  ? 547 THR J OG1   1 
ATOM   4835 C  CG2   . THR I 3 46 ? 35.004 93.299  41.302 1.00 24.65  ? 547 THR J CG2   1 
ATOM   4836 N  N     . TRP I 3 47 ? 32.924 92.118  38.900 1.00 14.31  ? 548 TRP J N     1 
ATOM   4837 C  CA    . TRP I 3 47 ? 33.241 92.250  37.487 1.00 13.46  ? 548 TRP J CA    1 
ATOM   4838 C  C     . TRP I 3 47 ? 32.114 92.746  36.573 1.00 12.42  ? 548 TRP J C     1 
ATOM   4839 O  O     . TRP I 3 47 ? 32.393 93.362  35.546 1.00 12.48  ? 548 TRP J O     1 
ATOM   4840 C  CB    . TRP I 3 47 ? 33.852 90.947  36.940 1.00 12.45  ? 548 TRP J CB    1 
ATOM   4841 C  CG    . TRP I 3 47 ? 32.931 89.788  36.833 1.00 12.36  ? 548 TRP J CG    1 
ATOM   4842 C  CD1   . TRP I 3 47 ? 32.770 88.765  37.729 1.00 11.19  ? 548 TRP J CD1   1 
ATOM   4843 C  CD2   . TRP I 3 47 ? 32.077 89.499  35.730 1.00 12.40  ? 548 TRP J CD2   1 
ATOM   4844 N  NE1   . TRP I 3 47 ? 31.868 87.845  37.237 1.00 12.36  ? 548 TRP J NE1   1 
ATOM   4845 C  CE2   . TRP I 3 47 ? 31.430 88.273  36.008 1.00 13.81  ? 548 TRP J CE2   1 
ATOM   4846 C  CE3   . TRP I 3 47 ? 31.809 90.152  34.518 1.00 13.50  ? 548 TRP J CE3   1 
ATOM   4847 C  CZ2   . TRP I 3 47 ? 30.512 87.692  35.122 1.00 14.40  ? 548 TRP J CZ2   1 
ATOM   4848 C  CZ3   . TRP I 3 47 ? 30.896 89.572  33.635 1.00 14.28  ? 548 TRP J CZ3   1 
ATOM   4849 C  CH2   . TRP I 3 47 ? 30.264 88.350  33.945 1.00 14.68  ? 548 TRP J CH2   1 
ATOM   4850 N  N     . LYS I 3 48 ? 30.857 92.486  36.920 1.00 12.41  ? 549 LYS J N     1 
ATOM   4851 C  CA    . LYS I 3 48 ? 29.761 92.978  36.076 1.00 12.35  ? 549 LYS J CA    1 
ATOM   4852 C  C     . LYS I 3 48 ? 29.692 94.504  36.192 1.00 13.46  ? 549 LYS J C     1 
ATOM   4853 O  O     . LYS I 3 48 ? 29.365 95.208  35.226 1.00 13.34  ? 549 LYS J O     1 
ATOM   4854 C  CB    . LYS I 3 48 ? 28.439 92.349  36.488 1.00 12.21  ? 549 LYS J CB    1 
ATOM   4855 C  CG    . LYS I 3 48 ? 28.341 90.879  36.081 1.00 13.41  ? 549 LYS J CG    1 
ATOM   4856 C  CD    . LYS I 3 48 ? 26.970 90.292  36.420 1.00 16.02  ? 549 LYS J CD    1 
ATOM   4857 C  CE    . LYS I 3 48 ? 26.840 88.884  35.879 1.00 16.23  ? 549 LYS J CE    1 
ATOM   4858 N  NZ    . LYS I 3 48 ? 25.464 88.347  36.150 1.00 19.63  ? 549 LYS J NZ    1 
ATOM   4859 N  N     . ASN I 3 49 ? 30.024 94.998  37.380 1.00 11.84  ? 550 ASN J N     1 
ATOM   4860 C  CA    . ASN I 3 49 ? 30.058 96.429  37.647 1.00 14.67  ? 550 ASN J CA    1 
ATOM   4861 C  C     . ASN I 3 49 ? 31.192 97.001  36.789 1.00 13.86  ? 550 ASN J C     1 
ATOM   4862 O  O     . ASN I 3 49 ? 31.043 98.042  36.142 1.00 14.40  ? 550 ASN J O     1 
ATOM   4863 C  CB    . ASN I 3 49 ? 30.293 96.644  39.152 1.00 15.55  ? 550 ASN J CB    1 
ATOM   4864 C  CG    . ASN I 3 49 ? 30.310 98.110  39.554 1.00 19.92  ? 550 ASN J CG    1 
ATOM   4865 O  OD1   . ASN I 3 49 ? 29.888 98.987  38.805 1.00 19.03  ? 550 ASN J OD1   1 
ATOM   4866 N  ND2   . ASN I 3 49 ? 30.789 98.376  40.774 1.00 23.82  ? 550 ASN J ND2   1 
ATOM   4867 N  N     . ALA I 3 50 ? 32.324 96.300  36.748 1.00 14.06  ? 551 ALA J N     1 
ATOM   4868 C  CA    . ALA I 3 50 ? 33.450 96.752  35.934 1.00 14.06  ? 551 ALA J CA    1 
ATOM   4869 C  C     . ALA I 3 50 ? 33.052 96.825  34.469 1.00 13.77  ? 551 ALA J C     1 
ATOM   4870 O  O     . ALA I 3 50 ? 33.399 97.772  33.768 1.00 13.81  ? 551 ALA J O     1 
ATOM   4871 C  CB    . ALA I 3 50 ? 34.651 95.797  36.097 1.00 13.15  ? 551 ALA J CB    1 
ATOM   4872 N  N     . VAL I 3 51 ? 32.343 95.805  33.995 1.00 11.90  ? 552 VAL J N     1 
ATOM   4873 C  CA    . VAL I 3 51 ? 31.921 95.795  32.597 1.00 11.57  ? 552 VAL J CA    1 
ATOM   4874 C  C     . VAL I 3 51 ? 30.992 96.973  32.276 1.00 10.99  ? 552 VAL J C     1 
ATOM   4875 O  O     . VAL I 3 51 ? 31.195 97.676  31.277 1.00 12.19  ? 552 VAL J O     1 
ATOM   4876 C  CB    . VAL I 3 51 ? 31.201 94.470  32.251 1.00 11.97  ? 552 VAL J CB    1 
ATOM   4877 C  CG1   . VAL I 3 51 ? 30.514 94.582  30.898 1.00 13.04  ? 552 VAL J CG1   1 
ATOM   4878 C  CG2   . VAL I 3 51 ? 32.218 93.318  32.248 1.00 12.37  ? 552 VAL J CG2   1 
ATOM   4879 N  N     . ARG I 3 52 ? 29.971 97.184  33.097 1.00 11.01  ? 553 ARG J N     1 
ATOM   4880 C  CA    . ARG I 3 52 ? 29.041 98.293  32.845 1.00 13.24  ? 553 ARG J CA    1 
ATOM   4881 C  C     . ARG I 3 52 ? 29.781 99.636  32.897 1.00 12.26  ? 553 ARG J C     1 
ATOM   4882 O  O     . ARG I 3 52 ? 29.548 100.524 32.076 1.00 10.35  ? 553 ARG J O     1 
ATOM   4883 C  CB    . ARG I 3 52 ? 27.908 98.305  33.876 1.00 13.81  ? 553 ARG J CB    1 
ATOM   4884 C  CG    . ARG I 3 52 ? 26.973 97.102  33.804 1.00 14.66  ? 553 ARG J CG    1 
ATOM   4885 C  CD    . ARG I 3 52 ? 25.779 97.301  34.732 1.00 14.36  ? 553 ARG J CD    1 
ATOM   4886 N  NE    . ARG I 3 52 ? 26.159 97.522  36.129 1.00 17.06  ? 553 ARG J NE    1 
ATOM   4887 C  CZ    . ARG I 3 52 ? 26.361 96.558  37.027 1.00 18.04  ? 553 ARG J CZ    1 
ATOM   4888 N  NH1   . ARG I 3 52 ? 26.229 95.283  36.682 1.00 15.67  ? 553 ARG J NH1   1 
ATOM   4889 N  NH2   . ARG I 3 52 ? 26.652 96.869  38.290 1.00 16.65  ? 553 ARG J NH2   1 
ATOM   4890 N  N     . HIS I 3 53 ? 30.656 99.778  33.888 1.00 11.94  ? 554 HIS J N     1 
ATOM   4891 C  CA    . HIS I 3 53 ? 31.444 100.998 34.039 1.00 13.80  ? 554 HIS J CA    1 
ATOM   4892 C  C     . HIS I 3 53 ? 32.271 101.260 32.780 1.00 12.78  ? 554 HIS J C     1 
ATOM   4893 O  O     . HIS I 3 53 ? 32.295 102.377 32.259 1.00 12.09  ? 554 HIS J O     1 
ATOM   4894 C  CB    . HIS I 3 53 ? 32.362 100.872 35.263 1.00 13.16  ? 554 HIS J CB    1 
ATOM   4895 C  CG    . HIS I 3 53 ? 33.432 101.916 35.333 1.00 13.75  ? 554 HIS J CG    1 
ATOM   4896 N  ND1   . HIS I 3 53 ? 33.192 103.214 35.735 1.00 13.43  ? 554 HIS J ND1   1 
ATOM   4897 C  CD2   . HIS I 3 53 ? 34.755 101.854 35.032 1.00 13.75  ? 554 HIS J CD2   1 
ATOM   4898 C  CE1   . HIS I 3 53 ? 34.317 103.907 35.678 1.00 16.02  ? 554 HIS J CE1   1 
ATOM   4899 N  NE2   . HIS I 3 53 ? 35.279 103.103 35.253 1.00 14.45  ? 554 HIS J NE2   1 
ATOM   4900 N  N     . ASN I 3 54 ? 32.951 100.227 32.287 1.00 12.05  ? 555 ASN J N     1 
ATOM   4901 C  CA    . ASN I 3 54 ? 33.758 100.384 31.087 1.00 11.35  ? 555 ASN J CA    1 
ATOM   4902 C  C     . ASN I 3 54 ? 32.919 100.721 29.844 1.00 12.30  ? 555 ASN J C     1 
ATOM   4903 O  O     . ASN I 3 54 ? 33.299 101.578 29.032 1.00 11.28  ? 555 ASN J O     1 
ATOM   4904 C  CB    . ASN I 3 54 ? 34.591 99.122  30.841 1.00 12.59  ? 555 ASN J CB    1 
ATOM   4905 C  CG    . ASN I 3 54 ? 35.913 99.153  31.575 1.00 10.51  ? 555 ASN J CG    1 
ATOM   4906 O  OD1   . ASN I 3 54 ? 36.002 98.827  32.779 1.00 13.73  ? 555 ASN J OD1   1 
ATOM   4907 N  ND2   . ASN I 3 54 ? 36.948 99.554  30.867 1.00 9.41   ? 555 ASN J ND2   1 
ATOM   4908 N  N     . LEU I 3 55 ? 31.774 100.065 29.702 1.00 12.08  ? 556 LEU J N     1 
ATOM   4909 C  CA    . LEU I 3 55 ? 30.910 100.338 28.561 1.00 13.53  ? 556 LEU J CA    1 
ATOM   4910 C  C     . LEU I 3 55 ? 30.485 101.811 28.536 1.00 14.99  ? 556 LEU J C     1 
ATOM   4911 O  O     . LEU I 3 55 ? 30.517 102.441 27.479 1.00 13.87  ? 556 LEU J O     1 
ATOM   4912 C  CB    . LEU I 3 55 ? 29.676 99.432  28.600 1.00 13.34  ? 556 LEU J CB    1 
ATOM   4913 C  CG    . LEU I 3 55 ? 29.984 97.970  28.256 1.00 12.29  ? 556 LEU J CG    1 
ATOM   4914 C  CD1   . LEU I 3 55 ? 28.772 97.109  28.592 1.00 14.81  ? 556 LEU J CD1   1 
ATOM   4915 C  CD2   . LEU I 3 55 ? 30.362 97.840  26.762 1.00 13.31  ? 556 LEU J CD2   1 
ATOM   4916 N  N     . SER I 3 56 ? 30.103 102.365 29.686 1.00 15.75  ? 557 SER J N     1 
ATOM   4917 C  CA    . SER I 3 56 ? 29.672 103.769 29.738 1.00 18.59  ? 557 SER J CA    1 
ATOM   4918 C  C     . SER I 3 56 ? 30.827 104.750 29.660 1.00 17.84  ? 557 SER J C     1 
ATOM   4919 O  O     . SER I 3 56 ? 30.783 105.712 28.900 1.00 18.00  ? 557 SER J O     1 
ATOM   4920 C  CB    . SER I 3 56 ? 28.901 104.071 31.029 1.00 19.27  ? 557 SER J CB    1 
ATOM   4921 O  OG    . SER I 3 56 ? 27.612 103.501 31.024 1.00 23.25  ? 557 SER J OG    1 
ATOM   4922 N  N     . LEU I 3 57 ? 31.865 104.500 30.448 1.00 16.96  ? 558 LEU J N     1 
ATOM   4923 C  CA    . LEU I 3 57 ? 33.013 105.410 30.503 1.00 16.39  ? 558 LEU J CA    1 
ATOM   4924 C  C     . LEU I 3 57 ? 33.742 105.648 29.188 1.00 17.04  ? 558 LEU J C     1 
ATOM   4925 O  O     . LEU I 3 57 ? 34.007 106.789 28.808 1.00 16.98  ? 558 LEU J O     1 
ATOM   4926 C  CB    . LEU I 3 57 ? 34.036 104.925 31.537 1.00 17.92  ? 558 LEU J CB    1 
ATOM   4927 C  CG    . LEU I 3 57 ? 35.146 105.948 31.831 1.00 19.84  ? 558 LEU J CG    1 
ATOM   4928 C  CD1   . LEU I 3 57 ? 34.519 107.153 32.535 1.00 21.84  ? 558 LEU J CD1   1 
ATOM   4929 C  CD2   . LEU I 3 57 ? 36.246 105.331 32.702 1.00 19.21  ? 558 LEU J CD2   1 
ATOM   4930 N  N     . HIS I 3 58 ? 34.070 104.568 28.496 1.00 16.75  ? 559 HIS J N     1 
ATOM   4931 C  CA    . HIS I 3 58 ? 34.816 104.662 27.264 1.00 17.68  ? 559 HIS J CA    1 
ATOM   4932 C  C     . HIS I 3 58 ? 33.963 104.926 26.035 1.00 18.90  ? 559 HIS J C     1 
ATOM   4933 O  O     . HIS I 3 58 ? 33.013 104.190 25.751 1.00 16.96  ? 559 HIS J O     1 
ATOM   4934 C  CB    . HIS I 3 58 ? 35.647 103.395 27.098 1.00 18.74  ? 559 HIS J CB    1 
ATOM   4935 C  CG    . HIS I 3 58 ? 36.544 103.126 28.264 1.00 21.16  ? 559 HIS J CG    1 
ATOM   4936 N  ND1   . HIS I 3 58 ? 37.480 104.039 28.704 1.00 22.55  ? 559 HIS J ND1   1 
ATOM   4937 C  CD2   . HIS I 3 58 ? 36.624 102.068 29.106 1.00 20.17  ? 559 HIS J CD2   1 
ATOM   4938 C  CE1   . HIS I 3 58 ? 38.098 103.555 29.769 1.00 22.83  ? 559 HIS J CE1   1 
ATOM   4939 N  NE2   . HIS I 3 58 ? 37.596 102.361 30.033 1.00 20.84  ? 559 HIS J NE2   1 
ATOM   4940 N  N     . LYS I 3 59 ? 34.325 105.986 25.320 1.00 18.87  ? 560 LYS J N     1 
ATOM   4941 C  CA    . LYS I 3 59 ? 33.623 106.407 24.111 1.00 23.48  ? 560 LYS J CA    1 
ATOM   4942 C  C     . LYS I 3 59 ? 33.700 105.363 23.002 1.00 23.53  ? 560 LYS J C     1 
ATOM   4943 O  O     . LYS I 3 59 ? 32.864 105.357 22.097 1.00 24.02  ? 560 LYS J O     1 
ATOM   4944 C  CB    . LYS I 3 59 ? 34.209 107.723 23.591 1.00 26.53  ? 560 LYS J CB    1 
ATOM   4945 C  CG    . LYS I 3 59 ? 34.202 108.865 24.590 1.00 31.82  ? 560 LYS J CG    1 
ATOM   4946 C  CD    . LYS I 3 59 ? 32.795 109.328 24.925 1.00 34.19  ? 560 LYS J CD    1 
ATOM   4947 C  CE    . LYS I 3 59 ? 32.838 110.530 25.856 1.00 36.39  ? 560 LYS J CE    1 
ATOM   4948 N  NZ    . LYS I 3 59 ? 31.482 110.968 26.298 1.00 37.19  ? 560 LYS J NZ    1 
ATOM   4949 N  N     . CYS I 3 60 ? 34.700 104.489 23.051 1.00 23.13  ? 561 CYS J N     1 
ATOM   4950 C  CA    . CYS I 3 60 ? 34.809 103.465 22.016 1.00 23.18  ? 561 CYS J CA    1 
ATOM   4951 C  C     . CYS I 3 60 ? 33.637 102.480 22.060 1.00 22.01  ? 561 CYS J C     1 
ATOM   4952 O  O     . CYS I 3 60 ? 33.380 101.775 21.082 1.00 24.02  ? 561 CYS J O     1 
ATOM   4953 C  CB    . CYS I 3 60 ? 36.138 102.716 22.130 1.00 24.57  ? 561 CYS J CB    1 
ATOM   4954 S  SG    . CYS I 3 60 ? 36.366 101.820 23.668 1.00 27.66  ? 561 CYS J SG    1 
ATOM   4955 N  N     . PHE I 3 61 ? 32.923 102.429 23.182 1.00 18.17  ? 562 PHE J N     1 
ATOM   4956 C  CA    . PHE I 3 61 ? 31.774 101.527 23.283 1.00 18.44  ? 562 PHE J CA    1 
ATOM   4957 C  C     . PHE I 3 61 ? 30.504 102.345 23.126 1.00 18.98  ? 562 PHE J C     1 
ATOM   4958 O  O     . PHE I 3 61 ? 30.175 103.200 23.955 1.00 17.00  ? 562 PHE J O     1 
ATOM   4959 C  CB    . PHE I 3 61 ? 31.785 100.772 24.618 1.00 16.31  ? 562 PHE J CB    1 
ATOM   4960 C  CG    . PHE I 3 61 ? 33.015 99.942  24.810 1.00 15.47  ? 562 PHE J CG    1 
ATOM   4961 C  CD1   . PHE I 3 61 ? 33.865 100.179 25.887 1.00 14.88  ? 562 PHE J CD1   1 
ATOM   4962 C  CD2   . PHE I 3 61 ? 33.369 98.968  23.872 1.00 14.33  ? 562 PHE J CD2   1 
ATOM   4963 C  CE1   . PHE I 3 61 ? 35.057 99.477  26.030 1.00 13.86  ? 562 PHE J CE1   1 
ATOM   4964 C  CE2   . PHE I 3 61 ? 34.563 98.253  24.004 1.00 15.48  ? 562 PHE J CE2   1 
ATOM   4965 C  CZ    . PHE I 3 61 ? 35.410 98.513  25.092 1.00 14.96  ? 562 PHE J CZ    1 
ATOM   4966 N  N     . VAL I 3 62 ? 29.783 102.077 22.049 1.00 18.15  ? 563 VAL J N     1 
ATOM   4967 C  CA    . VAL I 3 62 ? 28.573 102.836 21.759 1.00 19.68  ? 563 VAL J CA    1 
ATOM   4968 C  C     . VAL I 3 62 ? 27.320 101.996 21.855 1.00 17.57  ? 563 VAL J C     1 
ATOM   4969 O  O     . VAL I 3 62 ? 27.218 100.951 21.219 1.00 17.24  ? 563 VAL J O     1 
ATOM   4970 C  CB    . VAL I 3 62 ? 28.652 103.439 20.346 1.00 22.04  ? 563 VAL J CB    1 
ATOM   4971 C  CG1   . VAL I 3 62 ? 27.422 104.302 20.063 1.00 22.43  ? 563 VAL J CG1   1 
ATOM   4972 C  CG2   . VAL I 3 62 ? 29.930 104.254 20.216 1.00 24.45  ? 563 VAL J CG2   1 
ATOM   4973 N  N     . ARG I 3 63 ? 26.381 102.463 22.667 1.00 16.10  ? 564 ARG J N     1 
ATOM   4974 C  CA    . ARG I 3 63 ? 25.104 101.800 22.862 1.00 17.40  ? 564 ARG J CA    1 
ATOM   4975 C  C     . ARG I 3 63 ? 24.210 102.131 21.666 1.00 18.38  ? 564 ARG J C     1 
ATOM   4976 O  O     . ARG I 3 63 ? 24.013 103.308 21.334 1.00 16.06  ? 564 ARG J O     1 
ATOM   4977 C  CB    . ARG I 3 63 ? 24.461 102.301 24.154 1.00 18.51  ? 564 ARG J CB    1 
ATOM   4978 C  CG    . ARG I 3 63 ? 23.080 101.753 24.433 1.00 19.80  ? 564 ARG J CG    1 
ATOM   4979 C  CD    . ARG I 3 63 ? 22.638 102.106 25.849 1.00 22.71  ? 564 ARG J CD    1 
ATOM   4980 N  NE    . ARG I 3 63 ? 21.289 101.628 26.131 1.00 24.03  ? 564 ARG J NE    1 
ATOM   4981 C  CZ    . ARG I 3 63 ? 20.181 102.214 25.686 1.00 26.02  ? 564 ARG J CZ    1 
ATOM   4982 N  NH1   . ARG I 3 63 ? 20.258 103.310 24.941 1.00 25.82  ? 564 ARG J NH1   1 
ATOM   4983 N  NH2   . ARG I 3 63 ? 18.996 101.696 25.979 1.00 25.98  ? 564 ARG J NH2   1 
ATOM   4984 N  N     . VAL I 3 64 ? 23.680 101.094 21.025 1.00 16.65  ? 565 VAL J N     1 
ATOM   4985 C  CA    . VAL I 3 64 ? 22.810 101.267 19.861 1.00 16.30  ? 565 VAL J CA    1 
ATOM   4986 C  C     . VAL I 3 64 ? 21.452 100.697 20.206 1.00 17.04  ? 565 VAL J C     1 
ATOM   4987 O  O     . VAL I 3 64 ? 21.267 99.484  20.316 1.00 17.26  ? 565 VAL J O     1 
ATOM   4988 C  CB    . VAL I 3 64 ? 23.379 100.536 18.618 1.00 16.73  ? 565 VAL J CB    1 
ATOM   4989 C  CG1   . VAL I 3 64 ? 22.419 100.660 17.440 1.00 16.52  ? 565 VAL J CG1   1 
ATOM   4990 C  CG2   . VAL I 3 64 ? 24.732 101.126 18.251 1.00 16.95  ? 565 VAL J CG2   1 
ATOM   4991 N  N     . GLU I 3 65 ? 20.499 101.589 20.402 1.00 15.72  ? 566 GLU J N     1 
ATOM   4992 C  CA    . GLU I 3 65 ? 19.159 101.187 20.753 1.00 17.73  ? 566 GLU J CA    1 
ATOM   4993 C  C     . GLU I 3 65 ? 18.490 100.559 19.535 1.00 18.29  ? 566 GLU J C     1 
ATOM   4994 O  O     . GLU I 3 65 ? 18.740 100.980 18.404 1.00 16.63  ? 566 GLU J O     1 
ATOM   4995 C  CB    . GLU I 3 65 ? 18.383 102.422 21.218 1.00 21.20  ? 566 GLU J CB    1 
ATOM   4996 C  CG    . GLU I 3 65 ? 17.306 102.135 22.216 1.00 25.53  ? 566 GLU J CG    1 
ATOM   4997 C  CD    . GLU I 3 65 ? 16.795 103.390 22.904 1.00 27.45  ? 566 GLU J CD    1 
ATOM   4998 O  OE1   . GLU I 3 65 ? 17.612 104.146 23.478 1.00 26.80  ? 566 GLU J OE1   1 
ATOM   4999 O  OE2   . GLU I 3 65 ? 15.570 103.606 22.881 1.00 29.60  ? 566 GLU J OE2   1 
ATOM   5000 N  N     . ASN I 3 66 ? 17.674 99.534  19.768 1.00 19.76  ? 567 ASN J N     1 
ATOM   5001 C  CA    . ASN I 3 66 ? 16.951 98.882  18.682 1.00 23.31  ? 567 ASN J CA    1 
ATOM   5002 C  C     . ASN I 3 66 ? 15.554 98.483  19.146 1.00 24.61  ? 567 ASN J C     1 
ATOM   5003 O  O     . ASN I 3 66 ? 15.175 98.751  20.288 1.00 23.15  ? 567 ASN J O     1 
ATOM   5004 C  CB    . ASN I 3 66 ? 17.719 97.662  18.128 1.00 24.06  ? 567 ASN J CB    1 
ATOM   5005 C  CG    . ASN I 3 66 ? 18.089 96.644  19.197 1.00 25.16  ? 567 ASN J CG    1 
ATOM   5006 O  OD1   . ASN I 3 66 ? 17.316 96.366  20.108 1.00 26.05  ? 567 ASN J OD1   1 
ATOM   5007 N  ND2   . ASN I 3 66 ? 19.275 96.062  19.064 1.00 25.22  ? 567 ASN J ND2   1 
ATOM   5008 N  N     . VAL I 3 67 ? 14.781 97.847  18.270 1.00 28.40  ? 568 VAL J N     1 
ATOM   5009 C  CA    . VAL I 3 67 ? 13.419 97.459  18.632 1.00 32.16  ? 568 VAL J CA    1 
ATOM   5010 C  C     . VAL I 3 67 ? 13.305 96.630  19.909 1.00 33.34  ? 568 VAL J C     1 
ATOM   5011 O  O     . VAL I 3 67 ? 12.409 96.865  20.716 1.00 35.58  ? 568 VAL J O     1 
ATOM   5012 C  CB    . VAL I 3 67 ? 12.717 96.692  17.484 1.00 33.10  ? 568 VAL J CB    1 
ATOM   5013 C  CG1   . VAL I 3 67 ? 12.533 97.606  16.291 1.00 33.02  ? 568 VAL J CG1   1 
ATOM   5014 C  CG2   . VAL I 3 67 ? 13.535 95.475  17.086 1.00 34.04  ? 568 VAL J CG2   1 
ATOM   5015 N  N     . LYS I 3 68 ? 14.214 95.680  20.108 1.00 35.71  ? 569 LYS J N     1 
ATOM   5016 C  CA    . LYS I 3 68 ? 14.159 94.827  21.294 1.00 36.73  ? 569 LYS J CA    1 
ATOM   5017 C  C     . LYS I 3 68 ? 15.015 95.246  22.483 1.00 35.86  ? 569 LYS J C     1 
ATOM   5018 O  O     . LYS I 3 68 ? 15.275 94.442  23.381 1.00 37.45  ? 569 LYS J O     1 
ATOM   5019 C  CB    . LYS I 3 68 ? 14.494 93.383  20.910 1.00 40.35  ? 569 LYS J CB    1 
ATOM   5020 C  CG    . LYS I 3 68 ? 13.352 92.671  20.206 1.00 45.40  ? 569 LYS J CG    1 
ATOM   5021 C  CD    . LYS I 3 68 ? 12.106 92.679  21.086 1.00 49.24  ? 569 LYS J CD    1 
ATOM   5022 C  CE    . LYS I 3 68 ? 10.922 92.020  20.404 1.00 50.63  ? 569 LYS J CE    1 
ATOM   5023 N  NZ    . LYS I 3 68 ? 9.715  92.083  21.273 1.00 51.85  ? 569 LYS J NZ    1 
ATOM   5024 N  N     . GLY I 3 69 ? 15.446 96.501  22.505 1.00 32.72  ? 570 GLY J N     1 
ATOM   5025 C  CA    . GLY I 3 69 ? 16.260 96.969  23.613 1.00 27.86  ? 570 GLY J CA    1 
ATOM   5026 C  C     . GLY I 3 69 ? 17.470 97.745  23.139 1.00 26.63  ? 570 GLY J C     1 
ATOM   5027 O  O     . GLY I 3 69 ? 17.329 98.806  22.534 1.00 26.84  ? 570 GLY J O     1 
ATOM   5028 N  N     . ALA I 3 70 ? 18.662 97.224  23.414 1.00 21.39  ? 571 ALA J N     1 
ATOM   5029 C  CA    . ALA I 3 70 ? 19.886 97.893  22.997 1.00 20.51  ? 571 ALA J CA    1 
ATOM   5030 C  C     . ALA I 3 70 ? 21.060 96.941  22.955 1.00 20.20  ? 571 ALA J C     1 
ATOM   5031 O  O     . ALA I 3 70 ? 21.130 95.990  23.731 1.00 22.17  ? 571 ALA J O     1 
ATOM   5032 C  CB    . ALA I 3 70 ? 20.201 99.043  23.937 1.00 18.37  ? 571 ALA J CB    1 
ATOM   5033 N  N     . VAL I 3 71 ? 21.984 97.203  22.043 1.00 19.05  ? 572 VAL J N     1 
ATOM   5034 C  CA    . VAL I 3 71 ? 23.169 96.377  21.907 1.00 18.76  ? 572 VAL J CA    1 
ATOM   5035 C  C     . VAL I 3 71 ? 24.353 97.303  22.031 1.00 18.73  ? 572 VAL J C     1 
ATOM   5036 O  O     . VAL I 3 71 ? 24.239 98.511  21.791 1.00 18.42  ? 572 VAL J O     1 
ATOM   5037 C  CB    . VAL I 3 71 ? 23.256 95.696  20.518 1.00 19.47  ? 572 VAL J CB    1 
ATOM   5038 C  CG1   . VAL I 3 71 ? 22.124 94.677  20.355 1.00 19.94  ? 572 VAL J CG1   1 
ATOM   5039 C  CG2   . VAL I 3 71 ? 23.202 96.754  19.407 1.00 19.71  ? 572 VAL J CG2   1 
ATOM   5040 N  N     . TRP I 3 72 ? 25.485 96.733  22.410 1.00 16.92  ? 573 TRP J N     1 
ATOM   5041 C  CA    . TRP I 3 72 ? 26.711 97.489  22.524 1.00 16.90  ? 573 TRP J CA    1 
ATOM   5042 C  C     . TRP I 3 72 ? 27.545 97.175  21.290 1.00 17.40  ? 573 TRP J C     1 
ATOM   5043 O  O     . TRP I 3 72 ? 27.576 96.027  20.830 1.00 18.35  ? 573 TRP J O     1 
ATOM   5044 C  CB    . TRP I 3 72 ? 27.459 97.106  23.818 1.00 15.87  ? 573 TRP J CB    1 
ATOM   5045 C  CG    . TRP I 3 72 ? 26.785 97.677  25.041 1.00 15.31  ? 573 TRP J CG    1 
ATOM   5046 C  CD1   . TRP I 3 72 ? 25.857 97.067  25.830 1.00 14.90  ? 573 TRP J CD1   1 
ATOM   5047 C  CD2   . TRP I 3 72 ? 26.939 99.007  25.557 1.00 16.55  ? 573 TRP J CD2   1 
ATOM   5048 N  NE1   . TRP I 3 72 ? 25.417 97.936  26.804 1.00 16.46  ? 573 TRP J NE1   1 
ATOM   5049 C  CE2   . TRP I 3 72 ? 26.064 99.133  26.655 1.00 15.62  ? 573 TRP J CE2   1 
ATOM   5050 C  CE3   . TRP I 3 72 ? 27.724 100.107 25.186 1.00 15.33  ? 573 TRP J CE3   1 
ATOM   5051 C  CZ2   . TRP I 3 72 ? 25.962 100.316 27.405 1.00 16.25  ? 573 TRP J CZ2   1 
ATOM   5052 C  CZ3   . TRP I 3 72 ? 27.620 101.286 25.934 1.00 14.90  ? 573 TRP J CZ3   1 
ATOM   5053 C  CH2   . TRP I 3 72 ? 26.743 101.377 27.024 1.00 13.50  ? 573 TRP J CH2   1 
ATOM   5054 N  N     . THR I 3 73 ? 28.203 98.200  20.753 1.00 15.25  ? 574 THR J N     1 
ATOM   5055 C  CA    . THR I 3 73 ? 29.045 98.072  19.573 1.00 17.41  ? 574 THR J CA    1 
ATOM   5056 C  C     . THR I 3 73 ? 30.370 98.749  19.857 1.00 17.72  ? 574 THR J C     1 
ATOM   5057 O  O     . THR I 3 73 ? 30.495 99.476  20.850 1.00 17.78  ? 574 THR J O     1 
ATOM   5058 C  CB    . THR I 3 73 ? 28.420 98.790  18.363 1.00 18.47  ? 574 THR J CB    1 
ATOM   5059 O  OG1   . THR I 3 73 ? 28.334 100.195 18.647 1.00 17.13  ? 574 THR J OG1   1 
ATOM   5060 C  CG2   . THR I 3 73 ? 27.022 98.253  18.099 1.00 18.82  ? 574 THR J CG2   1 
ATOM   5061 N  N     . VAL I 3 74 ? 31.345 98.545  18.978 1.00 18.59  ? 575 VAL J N     1 
ATOM   5062 C  CA    . VAL I 3 74 ? 32.665 99.140  19.154 1.00 22.39  ? 575 VAL J CA    1 
ATOM   5063 C  C     . VAL I 3 74 ? 33.073 100.140 18.073 1.00 25.85  ? 575 VAL J C     1 
ATOM   5064 O  O     . VAL I 3 74 ? 33.043 99.830  16.879 1.00 26.52  ? 575 VAL J O     1 
ATOM   5065 C  CB    . VAL I 3 74 ? 33.769 98.058  19.196 1.00 23.89  ? 575 VAL J CB    1 
ATOM   5066 C  CG1   . VAL I 3 74 ? 35.135 98.718  19.333 1.00 24.40  ? 575 VAL J CG1   1 
ATOM   5067 C  CG2   . VAL I 3 74 ? 33.527 97.103  20.348 1.00 23.68  ? 575 VAL J CG2   1 
ATOM   5068 N  N     . ASP I 3 75 ? 33.451 101.345 18.492 1.00 26.38  ? 576 ASP J N     1 
ATOM   5069 C  CA    . ASP I 3 75 ? 33.916 102.351 17.543 1.00 28.59  ? 576 ASP J CA    1 
ATOM   5070 C  C     . ASP I 3 75 ? 35.416 102.092 17.478 1.00 30.21  ? 576 ASP J C     1 
ATOM   5071 O  O     . ASP I 3 75 ? 36.185 102.621 18.284 1.00 29.97  ? 576 ASP J O     1 
ATOM   5072 C  CB    . ASP I 3 75 ? 33.631 103.765 18.057 1.00 29.49  ? 576 ASP J CB    1 
ATOM   5073 C  CG    . ASP I 3 75 ? 34.085 104.846 17.085 1.00 31.71  ? 576 ASP J CG    1 
ATOM   5074 O  OD1   . ASP I 3 75 ? 33.658 106.009 17.247 1.00 31.12  ? 576 ASP J OD1   1 
ATOM   5075 O  OD2   . ASP I 3 75 ? 34.873 104.538 16.166 1.00 32.47  ? 576 ASP J OD2   1 
ATOM   5076 N  N     . GLU I 3 76 ? 35.816 101.252 16.525 1.00 32.90  ? 577 GLU J N     1 
ATOM   5077 C  CA    . GLU I 3 76 ? 37.212 100.864 16.351 1.00 36.20  ? 577 GLU J CA    1 
ATOM   5078 C  C     . GLU I 3 76 ? 38.186 102.036 16.258 1.00 38.25  ? 577 GLU J C     1 
ATOM   5079 O  O     . GLU I 3 76 ? 39.255 102.004 16.870 1.00 39.46  ? 577 GLU J O     1 
ATOM   5080 C  CB    . GLU I 3 76 ? 37.348 99.971  15.115 1.00 36.86  ? 577 GLU J CB    1 
ATOM   5081 C  CG    . GLU I 3 76 ? 38.732 99.361  14.905 1.00 38.46  ? 577 GLU J CG    1 
ATOM   5082 C  CD    . GLU I 3 76 ? 39.160 98.418  16.022 1.00 40.16  ? 577 GLU J CD    1 
ATOM   5083 O  OE1   . GLU I 3 76 ? 38.296 97.975  16.812 1.00 38.39  ? 577 GLU J OE1   1 
ATOM   5084 O  OE2   . GLU I 3 76 ? 40.372 98.107  16.099 1.00 39.86  ? 577 GLU J OE2   1 
ATOM   5085 N  N     . VAL I 3 77 ? 37.827 103.064 15.493 1.00 39.57  ? 578 VAL J N     1 
ATOM   5086 C  CA    . VAL I 3 77 ? 38.696 104.228 15.357 1.00 41.53  ? 578 VAL J CA    1 
ATOM   5087 C  C     . VAL I 3 77 ? 38.956 104.814 16.734 1.00 41.86  ? 578 VAL J C     1 
ATOM   5088 O  O     . VAL I 3 77 ? 40.081 105.189 17.066 1.00 42.36  ? 578 VAL J O     1 
ATOM   5089 C  CB    . VAL I 3 77 ? 38.056 105.324 14.483 1.00 41.58  ? 578 VAL J CB    1 
ATOM   5090 C  CG1   . VAL I 3 77 ? 38.979 106.540 14.420 1.00 42.78  ? 578 VAL J CG1   1 
ATOM   5091 C  CG2   . VAL I 3 77 ? 37.790 104.785 13.089 1.00 42.17  ? 578 VAL J CG2   1 
ATOM   5092 N  N     . GLU I 3 78 ? 37.898 104.888 17.532 1.00 42.28  ? 579 GLU J N     1 
ATOM   5093 C  CA    . GLU I 3 78 ? 37.995 105.427 18.877 1.00 42.30  ? 579 GLU J CA    1 
ATOM   5094 C  C     . GLU I 3 78 ? 38.846 104.488 19.731 1.00 42.64  ? 579 GLU J C     1 
ATOM   5095 O  O     . GLU I 3 78 ? 39.750 104.929 20.437 1.00 42.13  ? 579 GLU J O     1 
ATOM   5096 C  CB    . GLU I 3 78 ? 36.594 105.569 19.471 1.00 43.08  ? 579 GLU J CB    1 
ATOM   5097 C  CG    . GLU I 3 78 ? 36.465 106.643 20.533 1.00 45.76  ? 579 GLU J CG    1 
ATOM   5098 C  CD    . GLU I 3 78 ? 36.923 108.013 20.047 1.00 47.98  ? 579 GLU J CD    1 
ATOM   5099 O  OE1   . GLU I 3 78 ? 36.624 108.375 18.887 1.00 49.15  ? 579 GLU J OE1   1 
ATOM   5100 O  OE2   . GLU I 3 78 ? 37.574 108.734 20.832 1.00 47.97  ? 579 GLU J OE2   1 
ATOM   5101 N  N     . TYR I 3 79 ? 38.566 103.190 19.655 1.00 43.31  ? 580 TYR J N     1 
ATOM   5102 C  CA    . TYR I 3 79 ? 39.321 102.212 20.431 1.00 45.06  ? 580 TYR J CA    1 
ATOM   5103 C  C     . TYR I 3 79 ? 40.819 102.363 20.165 1.00 47.68  ? 580 TYR J C     1 
ATOM   5104 O  O     . TYR I 3 79 ? 41.633 102.275 21.082 1.00 46.61  ? 580 TYR J O     1 
ATOM   5105 C  CB    . TYR I 3 79 ? 38.889 100.784 20.076 1.00 42.50  ? 580 TYR J CB    1 
ATOM   5106 C  CG    . TYR I 3 79 ? 39.682 99.714  20.806 1.00 41.18  ? 580 TYR J CG    1 
ATOM   5107 C  CD1   . TYR I 3 79 ? 39.395 99.382  22.134 1.00 40.25  ? 580 TYR J CD1   1 
ATOM   5108 C  CD2   . TYR I 3 79 ? 40.745 99.061  20.181 1.00 39.68  ? 580 TYR J CD2   1 
ATOM   5109 C  CE1   . TYR I 3 79 ? 40.152 98.423  22.821 1.00 38.12  ? 580 TYR J CE1   1 
ATOM   5110 C  CE2   . TYR I 3 79 ? 41.508 98.107  20.855 1.00 39.27  ? 580 TYR J CE2   1 
ATOM   5111 C  CZ    . TYR I 3 79 ? 41.207 97.792  22.176 1.00 40.25  ? 580 TYR J CZ    1 
ATOM   5112 O  OH    . TYR I 3 79 ? 41.968 96.855  22.841 1.00 37.52  ? 580 TYR J OH    1 
ATOM   5113 N  N     . GLN I 3 80 ? 41.174 102.601 18.907 1.00 51.41  ? 581 GLN J N     1 
ATOM   5114 C  CA    . GLN I 3 80 ? 42.574 102.750 18.525 1.00 55.66  ? 581 GLN J CA    1 
ATOM   5115 C  C     . GLN I 3 80 ? 43.265 103.969 19.124 1.00 57.96  ? 581 GLN J C     1 
ATOM   5116 O  O     . GLN I 3 80 ? 44.485 103.971 19.284 1.00 58.50  ? 581 GLN J O     1 
ATOM   5117 C  CB    . GLN I 3 80 ? 42.702 102.777 17.003 1.00 55.45  ? 581 GLN J CB    1 
ATOM   5118 C  CG    . GLN I 3 80 ? 42.386 101.447 16.342 1.00 55.86  ? 581 GLN J CG    1 
ATOM   5119 C  CD    . GLN I 3 80 ? 43.108 100.287 17.006 1.00 55.77  ? 581 GLN J CD    1 
ATOM   5120 O  OE1   . GLN I 3 80 ? 44.255 100.418 17.431 1.00 56.73  ? 581 GLN J OE1   1 
ATOM   5121 N  NE2   . GLN I 3 80 ? 42.442 99.143  17.088 1.00 55.10  ? 581 GLN J NE2   1 
ATOM   5122 N  N     . LYS I 3 81 ? 42.497 105.004 19.447 1.00 61.69  ? 582 LYS J N     1 
ATOM   5123 C  CA    . LYS I 3 81 ? 43.072 106.204 20.045 1.00 65.19  ? 582 LYS J CA    1 
ATOM   5124 C  C     . LYS I 3 81 ? 43.442 105.902 21.494 1.00 67.90  ? 582 LYS J C     1 
ATOM   5125 O  O     . LYS I 3 81 ? 42.703 105.212 22.201 1.00 67.82  ? 582 LYS J O     1 
ATOM   5126 C  CB    . LYS I 3 81 ? 42.080 107.367 19.981 1.00 65.80  ? 582 LYS J CB    1 
ATOM   5127 C  CG    . LYS I 3 81 ? 41.811 107.867 18.572 1.00 66.43  ? 582 LYS J CG    1 
ATOM   5128 C  CD    . LYS I 3 81 ? 40.928 109.102 18.589 1.00 67.97  ? 582 LYS J CD    1 
ATOM   5129 C  CE    . LYS I 3 81 ? 40.675 109.622 17.184 1.00 68.97  ? 582 LYS J CE    1 
ATOM   5130 N  NZ    . LYS I 3 81 ? 39.818 110.843 17.194 1.00 69.45  ? 582 LYS J NZ    1 
ATOM   5131 N  N     . ARG I 3 82 ? 44.587 106.427 21.925 1.00 71.24  ? 583 ARG J N     1 
ATOM   5132 C  CA    . ARG I 3 82 ? 45.102 106.204 23.273 1.00 75.02  ? 583 ARG J CA    1 
ATOM   5133 C  C     . ARG I 3 82 ? 45.807 104.854 23.329 1.00 76.35  ? 583 ARG J C     1 
ATOM   5134 O  O     . ARG I 3 82 ? 46.508 104.544 24.292 1.00 77.41  ? 583 ARG J O     1 
ATOM   5135 C  CB    . ARG I 3 82 ? 43.982 106.264 24.319 1.00 76.84  ? 583 ARG J CB    1 
ATOM   5136 C  CG    . ARG I 3 82 ? 43.660 107.675 24.787 1.00 80.21  ? 583 ARG J CG    1 
ATOM   5137 C  CD    . ARG I 3 82 ? 44.887 108.305 25.430 1.00 82.41  ? 583 ARG J CD    1 
ATOM   5138 N  NE    . ARG I 3 82 ? 44.659 109.683 25.851 1.00 84.32  ? 583 ARG J NE    1 
ATOM   5139 C  CZ    . ARG I 3 82 ? 45.601 110.468 26.363 1.00 85.02  ? 583 ARG J CZ    1 
ATOM   5140 N  NH1   . ARG I 3 82 ? 46.838 110.012 26.517 1.00 85.27  ? 583 ARG J NH1   1 
ATOM   5141 N  NH2   . ARG I 3 82 ? 45.308 111.711 26.720 1.00 86.14  ? 583 ARG J NH2   1 
ATOM   5142 N  N     . ARG I 3 83 ? 45.612 104.056 22.284 1.00 77.64  ? 584 ARG J N     1 
ATOM   5143 C  CA    . ARG I 3 83 ? 46.247 102.749 22.176 1.00 78.53  ? 584 ARG J CA    1 
ATOM   5144 C  C     . ARG I 3 83 ? 47.183 102.759 20.970 1.00 78.91  ? 584 ARG J C     1 
ATOM   5145 O  O     . ARG I 3 83 ? 46.943 101.975 20.026 1.00 79.32  ? 584 ARG J O     1 
ATOM   5146 C  CB    . ARG I 3 83 ? 45.201 101.636 22.007 1.00 78.80  ? 584 ARG J CB    1 
ATOM   5147 C  CG    . ARG I 3 83 ? 44.476 101.224 23.287 1.00 79.05  ? 584 ARG J CG    1 
ATOM   5148 C  CD    . ARG I 3 83 ? 43.145 101.942 23.456 1.00 79.30  ? 584 ARG J CD    1 
ATOM   5149 N  NE    . ARG I 3 83 ? 42.400 101.453 24.616 1.00 79.42  ? 584 ARG J NE    1 
ATOM   5150 C  CZ    . ARG I 3 83 ? 41.144 101.790 24.900 1.00 78.96  ? 584 ARG J CZ    1 
ATOM   5151 N  NH1   . ARG I 3 83 ? 40.478 102.618 24.108 1.00 78.47  ? 584 ARG J NH1   1 
ATOM   5152 N  NH2   . ARG I 3 83 ? 40.553 101.301 25.983 1.00 78.48  ? 584 ARG J NH2   1 
ATOM   5153 N  N     . ILE J 3 1  ? 43.426 94.989  40.250 1.00 18.01  ? 502 ILE K N     1 
ATOM   5154 C  CA    . ILE J 3 1  ? 44.172 94.243  41.316 1.00 18.99  ? 502 ILE K CA    1 
ATOM   5155 C  C     . ILE J 3 1  ? 44.670 92.935  40.710 1.00 20.61  ? 502 ILE K C     1 
ATOM   5156 O  O     . ILE J 3 1  ? 43.920 92.236  40.029 1.00 20.63  ? 502 ILE K O     1 
ATOM   5157 C  CB    . ILE J 3 1  ? 43.254 93.960  42.528 1.00 18.31  ? 502 ILE K CB    1 
ATOM   5158 C  CG1   . ILE J 3 1  ? 42.916 95.286  43.214 1.00 19.65  ? 502 ILE K CG1   1 
ATOM   5159 C  CG2   . ILE J 3 1  ? 43.938 92.997  43.524 1.00 20.31  ? 502 ILE K CG2   1 
ATOM   5160 C  CD1   . ILE J 3 1  ? 41.903 95.178  44.310 1.00 21.77  ? 502 ILE K CD1   1 
ATOM   5161 N  N     . VAL J 3 2  ? 45.941 92.624  40.955 1.00 20.23  ? 503 VAL K N     1 
ATOM   5162 C  CA    . VAL J 3 2  ? 46.572 91.419  40.422 1.00 23.51  ? 503 VAL K CA    1 
ATOM   5163 C  C     . VAL J 3 2  ? 47.056 90.526  41.566 1.00 21.58  ? 503 VAL K C     1 
ATOM   5164 O  O     . VAL J 3 2  ? 47.566 91.027  42.563 1.00 20.50  ? 503 VAL K O     1 
ATOM   5165 C  CB    . VAL J 3 2  ? 47.795 91.795  39.547 1.00 25.58  ? 503 VAL K CB    1 
ATOM   5166 C  CG1   . VAL J 3 2  ? 48.452 90.545  38.991 1.00 29.10  ? 503 VAL K CG1   1 
ATOM   5167 C  CG2   . VAL J 3 2  ? 47.361 92.714  38.414 1.00 29.12  ? 503 VAL K CG2   1 
ATOM   5168 N  N     . ARG J 3 3  ? 46.891 89.215  41.440 1.00 21.92  ? 504 ARG K N     1 
ATOM   5169 C  CA    . ARG J 3 3  ? 47.377 88.337  42.497 1.00 22.33  ? 504 ARG K CA    1 
ATOM   5170 C  C     . ARG J 3 3  ? 48.872 88.154  42.263 1.00 19.70  ? 504 ARG K C     1 
ATOM   5171 O  O     . ARG J 3 3  ? 49.332 88.151  41.126 1.00 18.41  ? 504 ARG K O     1 
ATOM   5172 C  CB    . ARG J 3 3  ? 46.668 86.977  42.474 1.00 23.23  ? 504 ARG K CB    1 
ATOM   5173 C  CG    . ARG J 3 3  ? 47.118 86.026  41.385 1.00 24.41  ? 504 ARG K CG    1 
ATOM   5174 C  CD    . ARG J 3 3  ? 46.251 84.774  41.413 1.00 25.26  ? 504 ARG K CD    1 
ATOM   5175 N  NE    . ARG J 3 3  ? 46.311 84.089  42.703 1.00 25.78  ? 504 ARG K NE    1 
ATOM   5176 C  CZ    . ARG J 3 3  ? 45.418 83.194  43.116 1.00 27.57  ? 504 ARG K CZ    1 
ATOM   5177 N  NH1   . ARG J 3 3  ? 44.383 82.874  42.340 1.00 26.59  ? 504 ARG K NH1   1 
ATOM   5178 N  NH2   . ARG J 3 3  ? 45.561 82.608  44.300 1.00 27.48  ? 504 ARG K NH2   1 
ATOM   5179 N  N     . PRO J 3 4  ? 49.652 88.009  43.341 1.00 19.86  ? 505 PRO K N     1 
ATOM   5180 C  CA    . PRO J 3 4  ? 51.099 87.830  43.187 1.00 18.67  ? 505 PRO K CA    1 
ATOM   5181 C  C     . PRO J 3 4  ? 51.374 86.584  42.358 1.00 19.16  ? 505 PRO K C     1 
ATOM   5182 O  O     . PRO J 3 4  ? 50.680 85.578  42.506 1.00 18.27  ? 505 PRO K O     1 
ATOM   5183 C  CB    . PRO J 3 4  ? 51.588 87.654  44.625 1.00 19.90  ? 505 PRO K CB    1 
ATOM   5184 C  CG    . PRO J 3 4  ? 50.513 88.285  45.453 1.00 22.60  ? 505 PRO K CG    1 
ATOM   5185 C  CD    . PRO J 3 4  ? 49.253 87.928  44.756 1.00 19.25  ? 505 PRO K CD    1 
ATOM   5186 N  N     . PRO J 3 5  ? 52.392 86.626  41.486 1.00 19.65  ? 506 PRO K N     1 
ATOM   5187 C  CA    . PRO J 3 5  ? 52.711 85.460  40.661 1.00 19.82  ? 506 PRO K CA    1 
ATOM   5188 C  C     . PRO J 3 5  ? 53.550 84.434  41.419 1.00 20.65  ? 506 PRO K C     1 
ATOM   5189 O  O     . PRO J 3 5  ? 54.666 84.119  41.007 1.00 20.02  ? 506 PRO K O     1 
ATOM   5190 C  CB    . PRO J 3 5  ? 53.484 86.069  39.500 1.00 20.03  ? 506 PRO K CB    1 
ATOM   5191 C  CG    . PRO J 3 5  ? 54.260 87.136  40.164 1.00 19.10  ? 506 PRO K CG    1 
ATOM   5192 C  CD    . PRO J 3 5  ? 53.237 87.775  41.107 1.00 20.74  ? 506 PRO K CD    1 
ATOM   5193 N  N     . PHE J 3 6  ? 53.020 83.937  42.531 1.00 17.97  ? 507 PHE K N     1 
ATOM   5194 C  CA    . PHE J 3 6  ? 53.720 82.931  43.331 1.00 18.31  ? 507 PHE K CA    1 
ATOM   5195 C  C     . PHE J 3 6  ? 52.674 81.981  43.891 1.00 17.29  ? 507 PHE K C     1 
ATOM   5196 O  O     . PHE J 3 6  ? 51.513 82.360  44.044 1.00 17.00  ? 507 PHE K O     1 
ATOM   5197 C  CB    . PHE J 3 6  ? 54.479 83.581  44.491 1.00 19.25  ? 507 PHE K CB    1 
ATOM   5198 C  CG    . PHE J 3 6  ? 55.479 84.605  44.056 1.00 22.50  ? 507 PHE K CG    1 
ATOM   5199 C  CD1   . PHE J 3 6  ? 55.182 85.959  44.138 1.00 23.34  ? 507 PHE K CD1   1 
ATOM   5200 C  CD2   . PHE J 3 6  ? 56.706 84.216  43.530 1.00 24.25  ? 507 PHE K CD2   1 
ATOM   5201 C  CE1   . PHE J 3 6  ? 56.097 86.920  43.697 1.00 25.47  ? 507 PHE K CE1   1 
ATOM   5202 C  CE2   . PHE J 3 6  ? 57.630 85.164  43.087 1.00 25.91  ? 507 PHE K CE2   1 
ATOM   5203 C  CZ    . PHE J 3 6  ? 57.321 86.520  43.171 1.00 26.36  ? 507 PHE K CZ    1 
ATOM   5204 N  N     . THR J 3 7  ? 53.074 80.752  44.190 1.00 14.99  ? 508 THR K N     1 
ATOM   5205 C  CA    . THR J 3 7  ? 52.122 79.788  44.740 1.00 15.89  ? 508 THR K CA    1 
ATOM   5206 C  C     . THR J 3 7  ? 51.850 80.117  46.200 1.00 14.21  ? 508 THR K C     1 
ATOM   5207 O  O     . THR J 3 7  ? 52.591 80.868  46.826 1.00 12.04  ? 508 THR K O     1 
ATOM   5208 C  CB    . THR J 3 7  ? 52.670 78.349  44.718 1.00 16.57  ? 508 THR K CB    1 
ATOM   5209 O  OG1   . THR J 3 7  ? 53.839 78.294  45.542 1.00 15.67  ? 508 THR K OG1   1 
ATOM   5210 C  CG2   . THR J 3 7  ? 53.012 77.906  43.291 1.00 18.37  ? 508 THR K CG2   1 
ATOM   5211 N  N     . TYR J 3 8  ? 50.781 79.551  46.744 1.00 11.88  ? 509 TYR K N     1 
ATOM   5212 C  CA    . TYR J 3 8  ? 50.466 79.782  48.145 1.00 14.08  ? 509 TYR K CA    1 
ATOM   5213 C  C     . TYR J 3 8  ? 51.604 79.308  49.037 1.00 13.47  ? 509 TYR K C     1 
ATOM   5214 O  O     . TYR J 3 8  ? 51.950 79.963  50.020 1.00 13.83  ? 509 TYR K O     1 
ATOM   5215 C  CB    . TYR J 3 8  ? 49.164 79.069  48.521 1.00 11.82  ? 509 TYR K CB    1 
ATOM   5216 C  CG    . TYR J 3 8  ? 47.959 79.982  48.361 1.00 12.84  ? 509 TYR K CG    1 
ATOM   5217 C  CD1   . TYR J 3 8  ? 47.065 79.831  47.300 1.00 14.33  ? 509 TYR K CD1   1 
ATOM   5218 C  CD2   . TYR J 3 8  ? 47.745 81.031  49.258 1.00 12.57  ? 509 TYR K CD2   1 
ATOM   5219 C  CE1   . TYR J 3 8  ? 45.987 80.713  47.134 1.00 14.17  ? 509 TYR K CE1   1 
ATOM   5220 C  CE2   . TYR J 3 8  ? 46.675 81.908  49.099 1.00 14.68  ? 509 TYR K CE2   1 
ATOM   5221 C  CZ    . TYR J 3 8  ? 45.804 81.749  48.035 1.00 16.18  ? 509 TYR K CZ    1 
ATOM   5222 O  OH    . TYR J 3 8  ? 44.777 82.658  47.868 1.00 16.35  ? 509 TYR K OH    1 
ATOM   5223 N  N     . ALA J 3 9  ? 52.184 78.166  48.691 1.00 13.75  ? 510 ALA K N     1 
ATOM   5224 C  CA    . ALA J 3 9  ? 53.283 77.618  49.474 1.00 14.56  ? 510 ALA K CA    1 
ATOM   5225 C  C     . ALA J 3 9  ? 54.445 78.608  49.466 1.00 15.87  ? 510 ALA K C     1 
ATOM   5226 O  O     . ALA J 3 9  ? 55.035 78.894  50.503 1.00 15.47  ? 510 ALA K O     1 
ATOM   5227 C  CB    . ALA J 3 9  ? 53.716 76.272  48.892 1.00 16.91  ? 510 ALA K CB    1 
ATOM   5228 N  N     . THR J 3 10 ? 54.757 79.160  48.298 1.00 13.08  ? 511 THR K N     1 
ATOM   5229 C  CA    . THR J 3 10 ? 55.857 80.103  48.217 1.00 15.74  ? 511 THR K CA    1 
ATOM   5230 C  C     . THR J 3 10 ? 55.620 81.363  49.068 1.00 15.65  ? 511 THR K C     1 
ATOM   5231 O  O     . THR J 3 10 ? 56.534 81.833  49.752 1.00 16.78  ? 511 THR K O     1 
ATOM   5232 C  CB    . THR J 3 10 ? 56.146 80.478  46.738 1.00 16.42  ? 511 THR K CB    1 
ATOM   5233 O  OG1   . THR J 3 10 ? 56.634 79.318  46.046 1.00 15.74  ? 511 THR K OG1   1 
ATOM   5234 C  CG2   . THR J 3 10 ? 57.200 81.587  46.648 1.00 17.17  ? 511 THR K CG2   1 
ATOM   5235 N  N     . LEU J 3 11 ? 54.398 81.895  49.040 1.00 14.62  ? 512 LEU K N     1 
ATOM   5236 C  CA    . LEU J 3 11 ? 54.046 83.091  49.821 1.00 15.73  ? 512 LEU K CA    1 
ATOM   5237 C  C     . LEU J 3 11 ? 54.033 82.829  51.324 1.00 15.63  ? 512 LEU K C     1 
ATOM   5238 O  O     . LEU J 3 11 ? 54.433 83.678  52.126 1.00 14.77  ? 512 LEU K O     1 
ATOM   5239 C  CB    . LEU J 3 11 ? 52.668 83.608  49.408 1.00 15.86  ? 512 LEU K CB    1 
ATOM   5240 C  CG    . LEU J 3 11 ? 52.570 84.116  47.973 1.00 17.90  ? 512 LEU K CG    1 
ATOM   5241 C  CD1   . LEU J 3 11 ? 51.116 84.425  47.645 1.00 20.54  ? 512 LEU K CD1   1 
ATOM   5242 C  CD2   . LEU J 3 11 ? 53.448 85.354  47.803 1.00 19.34  ? 512 LEU K CD2   1 
ATOM   5243 N  N     . ILE J 3 12 ? 53.546 81.658  51.709 1.00 15.03  ? 513 ILE K N     1 
ATOM   5244 C  CA    . ILE J 3 12 ? 53.500 81.311  53.118 1.00 15.46  ? 513 ILE K CA    1 
ATOM   5245 C  C     . ILE J 3 12 ? 54.935 81.190  53.634 1.00 16.17  ? 513 ILE K C     1 
ATOM   5246 O  O     . ILE J 3 12 ? 55.268 81.711  54.704 1.00 15.13  ? 513 ILE K O     1 
ATOM   5247 C  CB    . ILE J 3 12 ? 52.722 79.993  53.332 1.00 14.83  ? 513 ILE K CB    1 
ATOM   5248 C  CG1   . ILE J 3 12 ? 51.243 80.227  53.007 1.00 13.64  ? 513 ILE K CG1   1 
ATOM   5249 C  CG2   . ILE J 3 12 ? 52.879 79.505  54.772 1.00 14.35  ? 513 ILE K CG2   1 
ATOM   5250 C  CD1   . ILE J 3 12 ? 50.390 78.965  53.030 1.00 16.91  ? 513 ILE K CD1   1 
ATOM   5251 N  N     . ARG J 3 13 ? 55.781 80.514  52.869 1.00 16.68  ? 514 ARG K N     1 
ATOM   5252 C  CA    . ARG J 3 13 ? 57.177 80.366  53.264 1.00 19.76  ? 514 ARG K CA    1 
ATOM   5253 C  C     . ARG J 3 13 ? 57.797 81.751  53.426 1.00 20.20  ? 514 ARG K C     1 
ATOM   5254 O  O     . ARG J 3 13 ? 58.545 82.010  54.373 1.00 19.27  ? 514 ARG K O     1 
ATOM   5255 C  CB    . ARG J 3 13 ? 57.967 79.606  52.202 1.00 22.13  ? 514 ARG K CB    1 
ATOM   5256 C  CG    . ARG J 3 13 ? 59.460 79.604  52.500 1.00 23.59  ? 514 ARG K CG    1 
ATOM   5257 C  CD    . ARG J 3 13 ? 60.292 79.151  51.321 1.00 29.65  ? 514 ARG K CD    1 
ATOM   5258 N  NE    . ARG J 3 13 ? 61.715 79.295  51.615 1.00 35.64  ? 514 ARG K NE    1 
ATOM   5259 C  CZ    . ARG J 3 13 ? 62.684 79.225  50.710 1.00 38.55  ? 514 ARG K CZ    1 
ATOM   5260 N  NH1   . ARG J 3 13 ? 62.392 79.010  49.437 1.00 42.83  ? 514 ARG K NH1   1 
ATOM   5261 N  NH2   . ARG J 3 13 ? 63.949 79.383  51.078 1.00 40.19  ? 514 ARG K NH2   1 
ATOM   5262 N  N     . GLN J 3 14 ? 57.473 82.642  52.496 1.00 19.04  ? 515 GLN K N     1 
ATOM   5263 C  CA    . GLN J 3 14 ? 57.998 84.001  52.527 1.00 20.13  ? 515 GLN K CA    1 
ATOM   5264 C  C     . GLN J 3 14 ? 57.611 84.721  53.809 1.00 19.61  ? 515 GLN K C     1 
ATOM   5265 O  O     . GLN J 3 14 ? 58.459 85.358  54.448 1.00 18.97  ? 515 GLN K O     1 
ATOM   5266 C  CB    . GLN J 3 14 ? 57.491 84.789  51.315 1.00 21.58  ? 515 GLN K CB    1 
ATOM   5267 C  CG    . GLN J 3 14 ? 58.156 86.143  51.108 1.00 25.96  ? 515 GLN K CG    1 
ATOM   5268 C  CD    . GLN J 3 14 ? 59.648 86.031  50.855 1.00 29.47  ? 515 GLN K CD    1 
ATOM   5269 O  OE1   . GLN J 3 14 ? 60.104 85.119  50.163 1.00 30.88  ? 515 GLN K OE1   1 
ATOM   5270 N  NE2   . GLN J 3 14 ? 60.417 86.971  51.403 1.00 30.51  ? 515 GLN K NE2   1 
ATOM   5271 N  N     . ALA J 3 15 ? 56.334 84.627  54.184 1.00 17.96  ? 516 ALA K N     1 
ATOM   5272 C  CA    . ALA J 3 15 ? 55.839 85.270  55.400 1.00 18.81  ? 516 ALA K CA    1 
ATOM   5273 C  C     . ALA J 3 15 ? 56.648 84.785  56.599 1.00 21.03  ? 516 ALA K C     1 
ATOM   5274 O  O     . ALA J 3 15 ? 57.157 85.582  57.391 1.00 21.49  ? 516 ALA K O     1 
ATOM   5275 C  CB    . ALA J 3 15 ? 54.344 84.945  55.613 1.00 14.68  ? 516 ALA K CB    1 
ATOM   5276 N  N     . ILE J 3 16 ? 56.756 83.469  56.732 1.00 19.93  ? 517 ILE K N     1 
ATOM   5277 C  CA    . ILE J 3 16 ? 57.497 82.882  57.840 1.00 20.51  ? 517 ILE K CA    1 
ATOM   5278 C  C     . ILE J 3 16 ? 58.991 83.236  57.816 1.00 22.19  ? 517 ILE K C     1 
ATOM   5279 O  O     . ILE J 3 16 ? 59.562 83.602  58.842 1.00 23.11  ? 517 ILE K O     1 
ATOM   5280 C  CB    . ILE J 3 16 ? 57.318 81.353  57.835 1.00 19.16  ? 517 ILE K CB    1 
ATOM   5281 C  CG1   . ILE J 3 16 ? 55.831 81.023  58.035 1.00 17.48  ? 517 ILE K CG1   1 
ATOM   5282 C  CG2   . ILE J 3 16 ? 58.178 80.710  58.920 1.00 20.59  ? 517 ILE K CG2   1 
ATOM   5283 C  CD1   . ILE J 3 16 ? 55.513 79.540  57.928 1.00 19.55  ? 517 ILE K CD1   1 
ATOM   5284 N  N     . MET J 3 17 ? 59.623 83.131  56.652 1.00 22.70  ? 518 MET K N     1 
ATOM   5285 C  CA    . MET J 3 17 ? 61.043 83.436  56.538 1.00 25.75  ? 518 MET K CA    1 
ATOM   5286 C  C     . MET J 3 17 ? 61.372 84.891  56.884 1.00 26.25  ? 518 MET K C     1 
ATOM   5287 O  O     . MET J 3 17 ? 62.500 85.196  57.281 1.00 26.97  ? 518 MET K O     1 
ATOM   5288 C  CB    . MET J 3 17 ? 61.543 83.119  55.127 1.00 29.17  ? 518 MET K CB    1 
ATOM   5289 C  CG    . MET J 3 17 ? 61.518 81.639  54.768 1.00 33.47  ? 518 MET K CG    1 
ATOM   5290 S  SD    . MET J 3 17 ? 62.584 80.636  55.832 1.00 43.46  ? 518 MET K SD    1 
ATOM   5291 C  CE    . MET J 3 17 ? 64.115 80.645  54.888 1.00 40.80  ? 518 MET K CE    1 
ATOM   5292 N  N     . GLU J 3 18 ? 60.396 85.784  56.745 1.00 24.90  ? 519 GLU K N     1 
ATOM   5293 C  CA    . GLU J 3 18 ? 60.615 87.200  57.044 1.00 25.41  ? 519 GLU K CA    1 
ATOM   5294 C  C     . GLU J 3 18 ? 60.418 87.517  58.520 1.00 25.92  ? 519 GLU K C     1 
ATOM   5295 O  O     . GLU J 3 18 ? 60.845 88.569  58.992 1.00 25.45  ? 519 GLU K O     1 
ATOM   5296 C  CB    . GLU J 3 18 ? 59.673 88.085  56.213 1.00 24.14  ? 519 GLU K CB    1 
ATOM   5297 C  CG    . GLU J 3 18 ? 59.929 88.021  54.724 1.00 23.07  ? 519 GLU K CG    1 
ATOM   5298 C  CD    . GLU J 3 18 ? 59.082 89.003  53.927 1.00 24.32  ? 519 GLU K CD    1 
ATOM   5299 O  OE1   . GLU J 3 18 ? 59.290 89.084  52.703 1.00 24.41  ? 519 GLU K OE1   1 
ATOM   5300 O  OE2   . GLU J 3 18 ? 58.215 89.691  54.511 1.00 24.96  ? 519 GLU K OE2   1 
ATOM   5301 N  N     . SER J 3 19 ? 59.767 86.617  59.250 1.00 24.19  ? 520 SER K N     1 
ATOM   5302 C  CA    . SER J 3 19 ? 59.524 86.842  60.669 1.00 25.01  ? 520 SER K CA    1 
ATOM   5303 C  C     . SER J 3 19 ? 60.845 86.764  61.436 1.00 24.83  ? 520 SER K C     1 
ATOM   5304 O  O     . SER J 3 19 ? 61.771 86.065  61.025 1.00 23.56  ? 520 SER K O     1 
ATOM   5305 C  CB    . SER J 3 19 ? 58.533 85.807  61.207 1.00 24.94  ? 520 SER K CB    1 
ATOM   5306 O  OG    . SER J 3 19 ? 59.051 84.498  61.064 1.00 25.45  ? 520 SER K OG    1 
ATOM   5307 N  N     . SER J 3 20 ? 60.926 87.479  62.551 1.00 26.43  ? 521 SER K N     1 
ATOM   5308 C  CA    . SER J 3 20 ? 62.152 87.506  63.349 1.00 29.58  ? 521 SER K CA    1 
ATOM   5309 C  C     . SER J 3 20 ? 62.608 86.153  63.915 1.00 29.08  ? 521 SER K C     1 
ATOM   5310 O  O     . SER J 3 20 ? 63.806 85.898  64.027 1.00 30.26  ? 521 SER K O     1 
ATOM   5311 C  CB    . SER J 3 20 ? 62.000 88.524  64.486 1.00 31.20  ? 521 SER K CB    1 
ATOM   5312 O  OG    . SER J 3 20 ? 60.884 88.227  65.303 1.00 36.50  ? 521 SER K OG    1 
ATOM   5313 N  N     . ASP J 3 21 ? 61.660 85.286  64.259 1.00 27.83  ? 522 ASP K N     1 
ATOM   5314 C  CA    . ASP J 3 21 ? 61.991 83.977  64.828 1.00 26.88  ? 522 ASP K CA    1 
ATOM   5315 C  C     . ASP J 3 21 ? 61.621 82.826  63.892 1.00 26.13  ? 522 ASP K C     1 
ATOM   5316 O  O     . ASP J 3 21 ? 61.545 81.674  64.318 1.00 25.41  ? 522 ASP K O     1 
ATOM   5317 C  CB    . ASP J 3 21 ? 61.259 83.796  66.157 1.00 27.83  ? 522 ASP K CB    1 
ATOM   5318 C  CG    . ASP J 3 21 ? 61.692 84.804  67.198 1.00 30.35  ? 522 ASP K CG    1 
ATOM   5319 O  OD1   . ASP J 3 21 ? 60.814 85.323  67.921 1.00 33.42  ? 522 ASP K OD1   1 
ATOM   5320 O  OD2   . ASP J 3 21 ? 62.909 85.070  67.297 1.00 30.02  ? 522 ASP K OD2   1 
ATOM   5321 N  N     . ARG J 3 22 ? 61.396 83.144  62.623 1.00 24.83  ? 523 ARG K N     1 
ATOM   5322 C  CA    . ARG J 3 22 ? 61.022 82.137  61.634 1.00 24.22  ? 523 ARG K CA    1 
ATOM   5323 C  C     . ARG J 3 22 ? 59.852 81.287  62.113 1.00 21.90  ? 523 ARG K C     1 
ATOM   5324 O  O     . ARG J 3 22 ? 59.889 80.059  62.036 1.00 21.81  ? 523 ARG K O     1 
ATOM   5325 C  CB    . ARG J 3 22 ? 62.207 81.227  61.309 1.00 28.65  ? 523 ARG K CB    1 
ATOM   5326 C  CG    . ARG J 3 22 ? 63.199 81.818  60.328 1.00 36.06  ? 523 ARG K CG    1 
ATOM   5327 C  CD    . ARG J 3 22 ? 64.183 80.754  59.866 1.00 43.66  ? 523 ARG K CD    1 
ATOM   5328 N  NE    . ARG J 3 22 ? 63.493 79.576  59.343 1.00 49.12  ? 523 ARG K NE    1 
ATOM   5329 C  CZ    . ARG J 3 22 ? 64.107 78.490  58.882 1.00 52.51  ? 523 ARG K CZ    1 
ATOM   5330 N  NH1   . ARG J 3 22 ? 65.433 78.425  58.875 1.00 53.44  ? 523 ARG K NH1   1 
ATOM   5331 N  NH2   . ARG J 3 22 ? 63.394 77.464  58.433 1.00 52.35  ? 523 ARG K NH2   1 
ATOM   5332 N  N     . GLN J 3 23 ? 58.812 81.956  62.592 1.00 20.09  ? 524 GLN K N     1 
ATOM   5333 C  CA    . GLN J 3 23 ? 57.614 81.292  63.080 1.00 19.74  ? 524 GLN K CA    1 
ATOM   5334 C  C     . GLN J 3 23 ? 56.494 82.327  63.123 1.00 19.81  ? 524 GLN K C     1 
ATOM   5335 O  O     . GLN J 3 23 ? 56.725 83.498  63.450 1.00 20.31  ? 524 GLN K O     1 
ATOM   5336 C  CB    . GLN J 3 23 ? 57.844 80.732  64.492 1.00 20.20  ? 524 GLN K CB    1 
ATOM   5337 C  CG    . GLN J 3 23 ? 58.102 81.812  65.528 1.00 21.07  ? 524 GLN K CG    1 
ATOM   5338 C  CD    . GLN J 3 23 ? 58.266 81.273  66.944 1.00 24.97  ? 524 GLN K CD    1 
ATOM   5339 O  OE1   . GLN J 3 23 ? 58.161 82.026  67.914 1.00 24.63  ? 524 GLN K OE1   1 
ATOM   5340 N  NE2   . GLN J 3 23 ? 58.531 79.977  67.069 1.00 21.01  ? 524 GLN K NE2   1 
ATOM   5341 N  N     . LEU J 3 24 ? 55.285 81.896  62.796 1.00 17.36  ? 525 LEU K N     1 
ATOM   5342 C  CA    . LEU J 3 24 ? 54.126 82.782  62.817 1.00 16.91  ? 525 LEU K CA    1 
ATOM   5343 C  C     . LEU J 3 24 ? 52.879 81.987  63.134 1.00 16.73  ? 525 LEU K C     1 
ATOM   5344 O  O     . LEU J 3 24 ? 52.744 80.836  62.716 1.00 16.57  ? 525 LEU K O     1 
ATOM   5345 C  CB    . LEU J 3 24 ? 53.913 83.463  61.456 1.00 14.34  ? 525 LEU K CB    1 
ATOM   5346 C  CG    . LEU J 3 24 ? 54.867 84.540  60.935 1.00 18.47  ? 525 LEU K CG    1 
ATOM   5347 C  CD1   . LEU J 3 24 ? 54.398 84.969  59.525 1.00 17.42  ? 525 LEU K CD1   1 
ATOM   5348 C  CD2   . LEU J 3 24 ? 54.872 85.745  61.890 1.00 15.94  ? 525 LEU K CD2   1 
ATOM   5349 N  N     . THR J 3 25 ? 51.967 82.599  63.879 1.00 15.39  ? 526 THR K N     1 
ATOM   5350 C  CA    . THR J 3 25 ? 50.705 81.956  64.187 1.00 16.43  ? 526 THR K CA    1 
ATOM   5351 C  C     . THR J 3 25 ? 49.889 82.076  62.905 1.00 17.07  ? 526 THR K C     1 
ATOM   5352 O  O     . THR J 3 25 ? 50.253 82.843  61.996 1.00 12.71  ? 526 THR K O     1 
ATOM   5353 C  CB    . THR J 3 25 ? 49.939 82.695  65.290 1.00 17.73  ? 526 THR K CB    1 
ATOM   5354 O  OG1   . THR J 3 25 ? 49.616 84.021  64.844 1.00 16.27  ? 526 THR K OG1   1 
ATOM   5355 C  CG2   . THR J 3 25 ? 50.774 82.777  66.549 1.00 19.50  ? 526 THR K CG2   1 
ATOM   5356 N  N     . LEU J 3 26 ? 48.780 81.349  62.829 1.00 15.93  ? 527 LEU K N     1 
ATOM   5357 C  CA    . LEU J 3 26 ? 47.926 81.428  61.637 1.00 16.76  ? 527 LEU K CA    1 
ATOM   5358 C  C     . LEU J 3 26 ? 47.425 82.860  61.409 1.00 16.46  ? 527 LEU K C     1 
ATOM   5359 O  O     . LEU J 3 26 ? 47.446 83.356  60.286 1.00 13.29  ? 527 LEU K O     1 
ATOM   5360 C  CB    . LEU J 3 26 ? 46.712 80.509  61.777 1.00 14.55  ? 527 LEU K CB    1 
ATOM   5361 C  CG    . LEU J 3 26 ? 45.726 80.555  60.601 1.00 14.31  ? 527 LEU K CG    1 
ATOM   5362 C  CD1   . LEU J 3 26 ? 46.399 80.025  59.354 1.00 11.55  ? 527 LEU K CD1   1 
ATOM   5363 C  CD2   . LEU J 3 26 ? 44.486 79.730  60.929 1.00 14.18  ? 527 LEU K CD2   1 
ATOM   5364 N  N     . ASN J 3 27 ? 46.974 83.529  62.467 1.00 16.16  ? 528 ASN K N     1 
ATOM   5365 C  CA    . ASN J 3 27 ? 46.468 84.892  62.309 1.00 16.89  ? 528 ASN K CA    1 
ATOM   5366 C  C     . ASN J 3 27 ? 47.542 85.860  61.832 1.00 17.39  ? 528 ASN K C     1 
ATOM   5367 O  O     . ASN J 3 27 ? 47.252 86.796  61.082 1.00 16.10  ? 528 ASN K O     1 
ATOM   5368 C  CB    . ASN J 3 27 ? 45.853 85.406  63.608 1.00 20.34  ? 528 ASN K CB    1 
ATOM   5369 C  CG    . ASN J 3 27 ? 44.978 86.617  63.381 1.00 23.91  ? 528 ASN K CG    1 
ATOM   5370 O  OD1   . ASN J 3 27 ? 45.195 87.683  63.967 1.00 25.59  ? 528 ASN K OD1   1 
ATOM   5371 N  ND2   . ASN J 3 27 ? 43.980 86.463  62.515 1.00 21.03  ? 528 ASN K ND2   1 
ATOM   5372 N  N     . GLU J 3 28 ? 48.778 85.639  62.269 1.00 17.70  ? 529 GLU K N     1 
ATOM   5373 C  CA    . GLU J 3 28 ? 49.901 86.474  61.859 1.00 17.51  ? 529 GLU K CA    1 
ATOM   5374 C  C     . GLU J 3 28 ? 50.191 86.251  60.374 1.00 17.87  ? 529 GLU K C     1 
ATOM   5375 O  O     . GLU J 3 28 ? 50.602 87.174  59.661 1.00 14.81  ? 529 GLU K O     1 
ATOM   5376 C  CB    . GLU J 3 28 ? 51.140 86.151  62.705 1.00 20.19  ? 529 GLU K CB    1 
ATOM   5377 C  CG    . GLU J 3 28 ? 51.096 86.788  64.102 1.00 20.63  ? 529 GLU K CG    1 
ATOM   5378 C  CD    . GLU J 3 28 ? 52.216 86.312  65.021 1.00 25.00  ? 529 GLU K CD    1 
ATOM   5379 O  OE1   . GLU J 3 28 ? 52.549 87.062  65.966 1.00 27.21  ? 529 GLU K OE1   1 
ATOM   5380 O  OE2   . GLU J 3 28 ? 52.760 85.199  64.814 1.00 21.19  ? 529 GLU K OE2   1 
ATOM   5381 N  N     . ILE J 3 29 ? 49.984 85.024  59.901 1.00 14.02  ? 530 ILE K N     1 
ATOM   5382 C  CA    . ILE J 3 29 ? 50.192 84.761  58.483 1.00 12.87  ? 530 ILE K CA    1 
ATOM   5383 C  C     . ILE J 3 29 ? 49.102 85.481  57.671 1.00 12.30  ? 530 ILE K C     1 
ATOM   5384 O  O     . ILE J 3 29 ? 49.400 86.065  56.628 1.00 13.59  ? 530 ILE K O     1 
ATOM   5385 C  CB    . ILE J 3 29 ? 50.182 83.249  58.179 1.00 14.32  ? 530 ILE K CB    1 
ATOM   5386 C  CG1   . ILE J 3 29 ? 51.449 82.616  58.768 1.00 14.33  ? 530 ILE K CG1   1 
ATOM   5387 C  CG2   . ILE J 3 29 ? 50.143 83.009  56.665 1.00 12.30  ? 530 ILE K CG2   1 
ATOM   5388 C  CD1   . ILE J 3 29 ? 51.484 81.098  58.655 1.00 19.56  ? 530 ILE K CD1   1 
ATOM   5389 N  N     . TYR J 3 30 ? 47.852 85.427  58.130 1.00 12.04  ? 531 TYR K N     1 
ATOM   5390 C  CA    . TYR J 3 30 ? 46.767 86.142  57.440 1.00 13.37  ? 531 TYR K CA    1 
ATOM   5391 C  C     . TYR J 3 30 ? 47.148 87.634  57.365 1.00 14.88  ? 531 TYR K C     1 
ATOM   5392 O  O     . TYR J 3 30 ? 47.028 88.280  56.321 1.00 12.87  ? 531 TYR K O     1 
ATOM   5393 C  CB    . TYR J 3 30 ? 45.449 86.056  58.223 1.00 12.88  ? 531 TYR K CB    1 
ATOM   5394 C  CG    . TYR J 3 30 ? 44.742 84.710  58.313 1.00 13.25  ? 531 TYR K CG    1 
ATOM   5395 C  CD1   . TYR J 3 30 ? 43.795 84.481  59.318 1.00 11.51  ? 531 TYR K CD1   1 
ATOM   5396 C  CD2   . TYR J 3 30 ? 44.974 83.692  57.385 1.00 14.67  ? 531 TYR K CD2   1 
ATOM   5397 C  CE1   . TYR J 3 30 ? 43.098 83.275  59.398 1.00 15.33  ? 531 TYR K CE1   1 
ATOM   5398 C  CE2   . TYR J 3 30 ? 44.269 82.473  57.455 1.00 14.39  ? 531 TYR K CE2   1 
ATOM   5399 C  CZ    . TYR J 3 30 ? 43.338 82.280  58.462 1.00 14.31  ? 531 TYR K CZ    1 
ATOM   5400 O  OH    . TYR J 3 30 ? 42.623 81.101  58.534 1.00 14.09  ? 531 TYR K OH    1 
ATOM   5401 N  N     . SER J 3 31 ? 47.607 88.188  58.485 1.00 15.07  ? 532 SER K N     1 
ATOM   5402 C  CA    . SER J 3 31 ? 47.968 89.606  58.506 1.00 16.82  ? 532 SER K CA    1 
ATOM   5403 C  C     . SER J 3 31 ? 49.059 89.947  57.501 1.00 16.53  ? 532 SER K C     1 
ATOM   5404 O  O     . SER J 3 31 ? 49.020 91.019  56.898 1.00 18.87  ? 532 SER K O     1 
ATOM   5405 C  CB    . SER J 3 31 ? 48.385 90.038  59.919 1.00 14.88  ? 532 SER K CB    1 
ATOM   5406 O  OG    . SER J 3 31 ? 47.300 89.832  60.804 1.00 18.70  ? 532 SER K OG    1 
ATOM   5407 N  N     . TRP J 3 32 ? 50.027 89.049  57.314 1.00 15.83  ? 533 TRP K N     1 
ATOM   5408 C  CA    . TRP J 3 32 ? 51.103 89.287  56.349 1.00 14.82  ? 533 TRP K CA    1 
ATOM   5409 C  C     . TRP J 3 32 ? 50.528 89.352  54.931 1.00 16.73  ? 533 TRP K C     1 
ATOM   5410 O  O     . TRP J 3 32 ? 50.945 90.183  54.121 1.00 15.69  ? 533 TRP K O     1 
ATOM   5411 C  CB    . TRP J 3 32 ? 52.152 88.172  56.402 1.00 16.55  ? 533 TRP K CB    1 
ATOM   5412 C  CG    . TRP J 3 32 ? 53.325 88.388  55.464 1.00 17.16  ? 533 TRP K CG    1 
ATOM   5413 C  CD1   . TRP J 3 32 ? 54.493 89.049  55.745 1.00 18.60  ? 533 TRP K CD1   1 
ATOM   5414 C  CD2   . TRP J 3 32 ? 53.448 87.925  54.108 1.00 17.51  ? 533 TRP K CD2   1 
ATOM   5415 N  NE1   . TRP J 3 32 ? 55.328 89.020  54.654 1.00 17.78  ? 533 TRP K NE1   1 
ATOM   5416 C  CE2   . TRP J 3 32 ? 54.713 88.336  53.638 1.00 17.88  ? 533 TRP K CE2   1 
ATOM   5417 C  CE3   . TRP J 3 32 ? 52.611 87.198  53.246 1.00 16.21  ? 533 TRP K CE3   1 
ATOM   5418 C  CZ2   . TRP J 3 32 ? 55.167 88.047  52.344 1.00 18.90  ? 533 TRP K CZ2   1 
ATOM   5419 C  CZ3   . TRP J 3 32 ? 53.061 86.909  51.960 1.00 15.82  ? 533 TRP K CZ3   1 
ATOM   5420 C  CH2   . TRP J 3 32 ? 54.326 87.333  51.521 1.00 17.09  ? 533 TRP K CH2   1 
ATOM   5421 N  N     . PHE J 3 33 ? 49.590 88.458  54.630 1.00 15.94  ? 534 PHE K N     1 
ATOM   5422 C  CA    . PHE J 3 33 ? 48.953 88.428  53.308 1.00 15.16  ? 534 PHE K CA    1 
ATOM   5423 C  C     . PHE J 3 33 ? 48.182 89.728  53.025 1.00 16.44  ? 534 PHE K C     1 
ATOM   5424 O  O     . PHE J 3 33 ? 48.338 90.330  51.959 1.00 16.50  ? 534 PHE K O     1 
ATOM   5425 C  CB    . PHE J 3 33 ? 47.985 87.241  53.216 1.00 12.93  ? 534 PHE K CB    1 
ATOM   5426 C  CG    . PHE J 3 33 ? 48.623 85.964  52.736 1.00 14.42  ? 534 PHE K CG    1 
ATOM   5427 C  CD1   . PHE J 3 33 ? 48.420 85.521  51.431 1.00 16.49  ? 534 PHE K CD1   1 
ATOM   5428 C  CD2   . PHE J 3 33 ? 49.430 85.210  53.578 1.00 14.04  ? 534 PHE K CD2   1 
ATOM   5429 C  CE1   . PHE J 3 33 ? 49.017 84.330  50.962 1.00 15.21  ? 534 PHE K CE1   1 
ATOM   5430 C  CE2   . PHE J 3 33 ? 50.036 84.016  53.121 1.00 13.69  ? 534 PHE K CE2   1 
ATOM   5431 C  CZ    . PHE J 3 33 ? 49.826 83.581  51.812 1.00 14.92  ? 534 PHE K CZ    1 
ATOM   5432 N  N     . THR J 3 34 ? 47.373 90.173  53.979 1.00 16.42  ? 535 THR K N     1 
ATOM   5433 C  CA    . THR J 3 34 ? 46.568 91.381  53.760 1.00 18.79  ? 535 THR K CA    1 
ATOM   5434 C  C     . THR J 3 34 ? 47.399 92.660  53.707 1.00 19.81  ? 535 THR K C     1 
ATOM   5435 O  O     . THR J 3 34 ? 47.115 93.572  52.913 1.00 18.60  ? 535 THR K O     1 
ATOM   5436 C  CB    . THR J 3 34 ? 45.444 91.536  54.828 1.00 20.91  ? 535 THR K CB    1 
ATOM   5437 O  OG1   . THR J 3 34 ? 46.017 91.811  56.112 1.00 22.53  ? 535 THR K OG1   1 
ATOM   5438 C  CG2   . THR J 3 34 ? 44.628 90.257  54.933 1.00 19.28  ? 535 THR K CG2   1 
ATOM   5439 N  N     . ARG J 3 35 ? 48.431 92.727  54.537 1.00 20.38  ? 536 ARG K N     1 
ATOM   5440 C  CA    . ARG J 3 35 ? 49.302 93.899  54.583 1.00 21.22  ? 536 ARG K CA    1 
ATOM   5441 C  C     . ARG J 3 35 ? 50.136 94.015  53.313 1.00 20.93  ? 536 ARG K C     1 
ATOM   5442 O  O     . ARG J 3 35 ? 50.388 95.111  52.803 1.00 19.84  ? 536 ARG K O     1 
ATOM   5443 C  CB    . ARG J 3 35 ? 50.239 93.782  55.798 1.00 24.18  ? 536 ARG K CB    1 
ATOM   5444 C  CG    . ARG J 3 35 ? 51.447 94.706  55.793 1.00 30.63  ? 536 ARG K CG    1 
ATOM   5445 C  CD    . ARG J 3 35 ? 52.576 94.105  56.648 1.00 31.90  ? 536 ARG K CD    1 
ATOM   5446 N  NE    . ARG J 3 35 ? 52.030 93.385  57.789 1.00 31.84  ? 536 ARG K NE    1 
ATOM   5447 C  CZ    . ARG J 3 35 ? 52.612 92.349  58.386 1.00 30.19  ? 536 ARG K CZ    1 
ATOM   5448 N  NH1   . ARG J 3 35 ? 53.782 91.889  57.968 1.00 30.46  ? 536 ARG K NH1   1 
ATOM   5449 N  NH2   . ARG J 3 35 ? 51.998 91.752  59.390 1.00 29.25  ? 536 ARG K NH2   1 
ATOM   5450 N  N     . THR J 3 36 ? 50.535 92.868  52.781 1.00 18.08  ? 537 THR K N     1 
ATOM   5451 C  CA    . THR J 3 36 ? 51.414 92.838  51.629 1.00 17.41  ? 537 THR K CA    1 
ATOM   5452 C  C     . THR J 3 36 ? 50.808 92.994  50.246 1.00 18.92  ? 537 THR K C     1 
ATOM   5453 O  O     . THR J 3 36 ? 51.423 93.619  49.387 1.00 17.91  ? 537 THR K O     1 
ATOM   5454 C  CB    . THR J 3 36 ? 52.250 91.560  51.670 1.00 17.69  ? 537 THR K CB    1 
ATOM   5455 O  OG1   . THR J 3 36 ? 52.822 91.442  52.978 1.00 17.73  ? 537 THR K OG1   1 
ATOM   5456 C  CG2   . THR J 3 36 ? 53.377 91.604  50.632 1.00 18.53  ? 537 THR K CG2   1 
ATOM   5457 N  N     . PHE J 3 37 ? 49.623 92.436  50.013 1.00 16.80  ? 538 PHE K N     1 
ATOM   5458 C  CA    . PHE J 3 37 ? 49.013 92.546  48.683 1.00 17.06  ? 538 PHE K CA    1 
ATOM   5459 C  C     . PHE J 3 37 ? 47.542 92.921  48.689 1.00 14.53  ? 538 PHE K C     1 
ATOM   5460 O  O     . PHE J 3 37 ? 46.754 92.378  49.463 1.00 15.60  ? 538 PHE K O     1 
ATOM   5461 C  CB    . PHE J 3 37 ? 49.137 91.229  47.913 1.00 16.22  ? 538 PHE K CB    1 
ATOM   5462 C  CG    . PHE J 3 37 ? 50.497 90.619  47.956 1.00 18.22  ? 538 PHE K CG    1 
ATOM   5463 C  CD1   . PHE J 3 37 ? 50.807 89.646  48.906 1.00 16.14  ? 538 PHE K CD1   1 
ATOM   5464 C  CD2   . PHE J 3 37 ? 51.465 90.989  47.030 1.00 17.55  ? 538 PHE K CD2   1 
ATOM   5465 C  CE1   . PHE J 3 37 ? 52.058 89.050  48.923 1.00 14.79  ? 538 PHE K CE1   1 
ATOM   5466 C  CE2   . PHE J 3 37 ? 52.727 90.396  47.041 1.00 18.03  ? 538 PHE K CE2   1 
ATOM   5467 C  CZ    . PHE J 3 37 ? 53.020 89.421  47.995 1.00 17.93  ? 538 PHE K CZ    1 
ATOM   5468 N  N     . ALA J 3 38 ? 47.168 93.827  47.788 1.00 13.76  ? 539 ALA K N     1 
ATOM   5469 C  CA    . ALA J 3 38 ? 45.781 94.270  47.668 1.00 13.14  ? 539 ALA K CA    1 
ATOM   5470 C  C     . ALA J 3 38 ? 44.869 93.076  47.393 1.00 11.31  ? 539 ALA K C     1 
ATOM   5471 O  O     . ALA J 3 38 ? 43.731 93.040  47.850 1.00 12.52  ? 539 ALA K O     1 
ATOM   5472 C  CB    . ALA J 3 38 ? 45.658 95.291  46.514 1.00 12.96  ? 539 ALA K CB    1 
ATOM   5473 N  N     . TYR J 3 39 ? 45.374 92.113  46.631 1.00 13.11  ? 540 TYR K N     1 
ATOM   5474 C  CA    . TYR J 3 39 ? 44.599 90.921  46.282 1.00 14.29  ? 540 TYR K CA    1 
ATOM   5475 C  C     . TYR J 3 39 ? 43.992 90.255  47.507 1.00 13.41  ? 540 TYR K C     1 
ATOM   5476 O  O     . TYR J 3 39 ? 42.850 89.771  47.463 1.00 12.47  ? 540 TYR K O     1 
ATOM   5477 C  CB    . TYR J 3 39 ? 45.486 89.909  45.537 1.00 13.59  ? 540 TYR K CB    1 
ATOM   5478 C  CG    . TYR J 3 39 ? 44.761 88.651  45.089 1.00 17.12  ? 540 TYR K CG    1 
ATOM   5479 C  CD1   . TYR J 3 39 ? 43.964 88.653  43.943 1.00 18.26  ? 540 TYR K CD1   1 
ATOM   5480 C  CD2   . TYR J 3 39 ? 44.873 87.460  45.815 1.00 17.27  ? 540 TYR K CD2   1 
ATOM   5481 C  CE1   . TYR J 3 39 ? 43.293 87.499  43.522 1.00 19.89  ? 540 TYR K CE1   1 
ATOM   5482 C  CE2   . TYR J 3 39 ? 44.203 86.292  45.400 1.00 18.98  ? 540 TYR K CE2   1 
ATOM   5483 C  CZ    . TYR J 3 39 ? 43.419 86.320  44.256 1.00 18.75  ? 540 TYR K CZ    1 
ATOM   5484 O  OH    . TYR J 3 39 ? 42.772 85.177  43.826 1.00 21.13  ? 540 TYR K OH    1 
ATOM   5485 N  N     . PHE J 3 40 ? 44.736 90.231  48.612 1.00 14.04  ? 541 PHE K N     1 
ATOM   5486 C  CA    . PHE J 3 40 ? 44.224 89.584  49.817 1.00 14.61  ? 541 PHE K CA    1 
ATOM   5487 C  C     . PHE J 3 40 ? 43.379 90.449  50.747 1.00 17.82  ? 541 PHE K C     1 
ATOM   5488 O  O     . PHE J 3 40 ? 43.102 90.069  51.891 1.00 17.99  ? 541 PHE K O     1 
ATOM   5489 C  CB    . PHE J 3 40 ? 45.385 88.923  50.576 1.00 12.93  ? 541 PHE K CB    1 
ATOM   5490 C  CG    . PHE J 3 40 ? 46.098 87.878  49.765 1.00 12.91  ? 541 PHE K CG    1 
ATOM   5491 C  CD1   . PHE J 3 40 ? 47.376 88.110  49.285 1.00 12.96  ? 541 PHE K CD1   1 
ATOM   5492 C  CD2   . PHE J 3 40 ? 45.446 86.698  49.403 1.00 13.65  ? 541 PHE K CD2   1 
ATOM   5493 C  CE1   . PHE J 3 40 ? 48.005 87.192  48.458 1.00 14.22  ? 541 PHE K CE1   1 
ATOM   5494 C  CE2   . PHE J 3 40 ? 46.066 85.762  48.569 1.00 13.17  ? 541 PHE K CE2   1 
ATOM   5495 C  CZ    . PHE J 3 40 ? 47.347 86.009  48.094 1.00 13.39  ? 541 PHE K CZ    1 
ATOM   5496 N  N     . ARG J 3 41 ? 42.951 91.608  50.263 1.00 18.59  ? 542 ARG K N     1 
ATOM   5497 C  CA    . ARG J 3 41 ? 42.097 92.456  51.074 1.00 19.27  ? 542 ARG K CA    1 
ATOM   5498 C  C     . ARG J 3 41 ? 40.626 92.267  50.707 1.00 20.37  ? 542 ARG K C     1 
ATOM   5499 O  O     . ARG J 3 41 ? 39.804 93.138  50.952 1.00 19.96  ? 542 ARG K O     1 
ATOM   5500 C  CB    . ARG J 3 41 ? 42.505 93.926  50.940 1.00 20.92  ? 542 ARG K CB    1 
ATOM   5501 C  CG    . ARG J 3 41 ? 43.834 94.201  51.604 1.00 22.16  ? 542 ARG K CG    1 
ATOM   5502 C  CD    . ARG J 3 41 ? 44.416 95.568  51.252 1.00 25.53  ? 542 ARG K CD    1 
ATOM   5503 N  NE    . ARG J 3 41 ? 45.859 95.479  51.408 1.00 26.52  ? 542 ARG K NE    1 
ATOM   5504 C  CZ    . ARG J 3 41 ? 46.740 96.195  50.736 1.00 25.00  ? 542 ARG K CZ    1 
ATOM   5505 N  NH1   . ARG J 3 41 ? 46.341 97.095  49.843 1.00 22.08  ? 542 ARG K NH1   1 
ATOM   5506 N  NH2   . ARG J 3 41 ? 48.029 95.968  50.930 1.00 26.14  ? 542 ARG K NH2   1 
ATOM   5507 N  N     . ARG J 3 42 ? 40.305 91.125  50.104 1.00 18.28  ? 543 ARG K N     1 
ATOM   5508 C  CA    . ARG J 3 42 ? 38.923 90.805  49.754 1.00 17.60  ? 543 ARG K CA    1 
ATOM   5509 C  C     . ARG J 3 42 ? 38.781 89.299  49.599 1.00 18.19  ? 543 ARG K C     1 
ATOM   5510 O  O     . ARG J 3 42 ? 39.782 88.595  49.436 1.00 18.66  ? 543 ARG K O     1 
ATOM   5511 C  CB    . ARG J 3 42 ? 38.502 91.491  48.449 1.00 19.38  ? 543 ARG K CB    1 
ATOM   5512 C  CG    . ARG J 3 42 ? 39.315 91.077  47.236 1.00 21.16  ? 543 ARG K CG    1 
ATOM   5513 C  CD    . ARG J 3 42 ? 40.336 92.157  46.902 1.00 25.55  ? 543 ARG K CD    1 
ATOM   5514 N  NE    . ARG J 3 42 ? 39.669 93.393  46.510 1.00 24.04  ? 543 ARG K NE    1 
ATOM   5515 C  CZ    . ARG J 3 42 ? 40.082 94.610  46.850 1.00 26.11  ? 543 ARG K CZ    1 
ATOM   5516 N  NH1   . ARG J 3 42 ? 41.167 94.767  47.592 1.00 22.29  ? 543 ARG K NH1   1 
ATOM   5517 N  NH2   . ARG J 3 42 ? 39.394 95.675  46.456 1.00 26.26  ? 543 ARG K NH2   1 
ATOM   5518 N  N     . ASN J 3 43 ? 37.542 88.817  49.647 1.00 18.56  ? 544 ASN K N     1 
ATOM   5519 C  CA    . ASN J 3 43 ? 37.250 87.395  49.510 1.00 19.14  ? 544 ASN K CA    1 
ATOM   5520 C  C     . ASN J 3 43 ? 38.056 86.548  50.506 1.00 19.64  ? 544 ASN K C     1 
ATOM   5521 O  O     . ASN J 3 43 ? 38.615 85.513  50.158 1.00 18.81  ? 544 ASN K O     1 
ATOM   5522 C  CB    . ASN J 3 43 ? 37.532 86.966  48.073 1.00 22.81  ? 544 ASN K CB    1 
ATOM   5523 C  CG    . ASN J 3 43 ? 36.752 87.799  47.066 1.00 23.99  ? 544 ASN K CG    1 
ATOM   5524 O  OD1   . ASN J 3 43 ? 37.286 88.218  46.039 1.00 26.84  ? 544 ASN K OD1   1 
ATOM   5525 N  ND2   . ASN J 3 43 ? 35.477 88.050  47.367 1.00 25.89  ? 544 ASN K ND2   1 
ATOM   5526 N  N     . ALA J 3 44 ? 38.090 86.992  51.757 1.00 18.21  ? 545 ALA K N     1 
ATOM   5527 C  CA    . ALA J 3 44 ? 38.836 86.276  52.789 1.00 20.26  ? 545 ALA K CA    1 
ATOM   5528 C  C     . ALA J 3 44 ? 38.424 84.809  52.907 1.00 21.20  ? 545 ALA K C     1 
ATOM   5529 O  O     . ALA J 3 44 ? 39.265 83.944  53.131 1.00 19.81  ? 545 ALA K O     1 
ATOM   5530 C  CB    . ALA J 3 44 ? 38.660 86.975  54.128 1.00 21.02  ? 545 ALA K CB    1 
ATOM   5531 N  N     . ALA J 3 45 ? 37.134 84.526  52.754 1.00 23.44  ? 546 ALA K N     1 
ATOM   5532 C  CA    . ALA J 3 45 ? 36.652 83.153  52.866 1.00 24.24  ? 546 ALA K CA    1 
ATOM   5533 C  C     . ALA J 3 45 ? 37.438 82.216  51.950 1.00 24.92  ? 546 ALA K C     1 
ATOM   5534 O  O     . ALA J 3 45 ? 37.754 81.082  52.320 1.00 23.96  ? 546 ALA K O     1 
ATOM   5535 C  CB    . ALA J 3 45 ? 35.168 83.085  52.535 1.00 26.31  ? 546 ALA K CB    1 
ATOM   5536 N  N     . THR J 3 46 ? 37.753 82.696  50.753 1.00 21.29  ? 547 THR K N     1 
ATOM   5537 C  CA    . THR J 3 46 ? 38.503 81.907  49.793 1.00 20.82  ? 547 THR K CA    1 
ATOM   5538 C  C     . THR J 3 46 ? 39.994 81.776  50.086 1.00 18.17  ? 547 THR K C     1 
ATOM   5539 O  O     . THR J 3 46 ? 40.502 80.667  50.210 1.00 14.72  ? 547 THR K O     1 
ATOM   5540 C  CB    . THR J 3 46 ? 38.375 82.475  48.363 1.00 22.86  ? 547 THR K CB    1 
ATOM   5541 O  OG1   . THR J 3 46 ? 37.010 82.395  47.938 1.00 28.24  ? 547 THR K OG1   1 
ATOM   5542 C  CG2   . THR J 3 46 ? 39.245 81.677  47.397 1.00 24.15  ? 547 THR K CG2   1 
ATOM   5543 N  N     . TRP J 3 47 ? 40.710 82.895  50.189 1.00 15.16  ? 548 TRP K N     1 
ATOM   5544 C  CA    . TRP J 3 47 ? 42.138 82.764  50.398 1.00 14.02  ? 548 TRP K CA    1 
ATOM   5545 C  C     . TRP J 3 47 ? 42.582 82.269  51.781 1.00 12.65  ? 548 TRP K C     1 
ATOM   5546 O  O     . TRP J 3 47 ? 43.633 81.637  51.889 1.00 13.72  ? 548 TRP K O     1 
ATOM   5547 C  CB    . TRP J 3 47 ? 42.865 84.065  50.013 1.00 12.17  ? 548 TRP K CB    1 
ATOM   5548 C  CG    . TRP J 3 47 ? 42.618 85.236  50.901 1.00 12.96  ? 548 TRP K CG    1 
ATOM   5549 C  CD1   . TRP J 3 47 ? 41.720 86.255  50.713 1.00 11.62  ? 548 TRP K CD1   1 
ATOM   5550 C  CD2   . TRP J 3 47 ? 43.330 85.539  52.100 1.00 13.56  ? 548 TRP K CD2   1 
ATOM   5551 N  NE1   . TRP J 3 47 ? 41.840 87.185  51.733 1.00 12.87  ? 548 TRP K NE1   1 
ATOM   5552 C  CE2   . TRP J 3 47 ? 42.821 86.764  52.597 1.00 14.05  ? 548 TRP K CE2   1 
ATOM   5553 C  CE3   . TRP J 3 47 ? 44.356 84.895  52.802 1.00 15.36  ? 548 TRP K CE3   1 
ATOM   5554 C  CZ2   . TRP J 3 47 ? 43.303 87.357  53.770 1.00 15.60  ? 548 TRP K CZ2   1 
ATOM   5555 C  CZ3   . TRP J 3 47 ? 44.839 85.488  53.973 1.00 14.47  ? 548 TRP K CZ3   1 
ATOM   5556 C  CH2   . TRP J 3 47 ? 44.306 86.710  54.441 1.00 15.22  ? 548 TRP K CH2   1 
ATOM   5557 N  N     . LYS J 3 48 ? 41.810 82.549  52.830 1.00 12.92  ? 549 LYS K N     1 
ATOM   5558 C  CA    . LYS J 3 48 ? 42.193 82.055  54.160 1.00 12.83  ? 549 LYS K CA    1 
ATOM   5559 C  C     . LYS J 3 48 ? 42.045 80.544  54.186 1.00 14.64  ? 549 LYS K C     1 
ATOM   5560 O  O     . LYS J 3 48 ? 42.823 79.844  54.839 1.00 13.56  ? 549 LYS K O     1 
ATOM   5561 C  CB    . LYS J 3 48 ? 41.345 82.687  55.249 1.00 11.87  ? 549 LYS K CB    1 
ATOM   5562 C  CG    . LYS J 3 48 ? 41.724 84.153  55.508 1.00 12.64  ? 549 LYS K CG    1 
ATOM   5563 C  CD    . LYS J 3 48 ? 40.893 84.745  56.635 1.00 15.79  ? 549 LYS K CD    1 
ATOM   5564 C  CE    . LYS J 3 48 ? 41.346 86.165  56.950 1.00 18.00  ? 549 LYS K CE    1 
ATOM   5565 N  NZ    . LYS J 3 48 ? 40.614 86.713  58.130 1.00 20.32  ? 549 LYS K NZ    1 
ATOM   5566 N  N     . ASN J 3 49 ? 41.047 80.051  53.461 1.00 12.92  ? 550 ASN K N     1 
ATOM   5567 C  CA    . ASN J 3 49 ? 40.815 78.615  53.349 1.00 14.64  ? 550 ASN K CA    1 
ATOM   5568 C  C     . ASN J 3 49 ? 42.031 78.038  52.611 1.00 14.02  ? 550 ASN K C     1 
ATOM   5569 O  O     . ASN J 3 49 ? 42.575 76.992  52.992 1.00 14.98  ? 550 ASN K O     1 
ATOM   5570 C  CB    . ASN J 3 49 ? 39.499 78.387  52.583 1.00 15.49  ? 550 ASN K CB    1 
ATOM   5571 C  CG    . ASN J 3 49 ? 39.152 76.913  52.397 1.00 19.02  ? 550 ASN K CG    1 
ATOM   5572 O  OD1   . ASN J 3 49 ? 39.648 76.036  53.100 1.00 16.67  ? 550 ASN K OD1   1 
ATOM   5573 N  ND2   . ASN J 3 49 ? 38.263 76.645  51.447 1.00 24.68  ? 550 ASN K ND2   1 
ATOM   5574 N  N     . ALA J 3 50 ? 42.481 78.737  51.568 1.00 14.33  ? 551 ALA K N     1 
ATOM   5575 C  CA    . ALA J 3 50 ? 43.645 78.297  50.800 1.00 13.56  ? 551 ALA K CA    1 
ATOM   5576 C  C     . ALA J 3 50 ? 44.879 78.205  51.682 1.00 14.36  ? 551 ALA K C     1 
ATOM   5577 O  O     . ALA J 3 50 ? 45.654 77.257  51.585 1.00 13.32  ? 551 ALA K O     1 
ATOM   5578 C  CB    . ALA J 3 50 ? 43.921 79.270  49.639 1.00 14.43  ? 551 ALA K CB    1 
ATOM   5579 N  N     . VAL J 3 51 ? 45.084 79.216  52.517 1.00 11.33  ? 552 VAL K N     1 
ATOM   5580 C  CA    . VAL J 3 51 ? 46.243 79.228  53.398 1.00 12.20  ? 552 VAL K CA    1 
ATOM   5581 C  C     . VAL J 3 51 ? 46.185 78.065  54.383 1.00 11.30  ? 552 VAL K C     1 
ATOM   5582 O  O     . VAL J 3 51 ? 47.171 77.347  54.555 1.00 12.58  ? 552 VAL K O     1 
ATOM   5583 C  CB    . VAL J 3 51 ? 46.329 80.569  54.170 1.00 12.51  ? 552 VAL K CB    1 
ATOM   5584 C  CG1   . VAL J 3 51 ? 47.382 80.486  55.281 1.00 14.03  ? 552 VAL K CG1   1 
ATOM   5585 C  CG2   . VAL J 3 51 ? 46.675 81.690  53.189 1.00 11.78  ? 552 VAL K CG2   1 
ATOM   5586 N  N     . ARG J 3 52 ? 45.039 77.864  55.023 1.00 11.12  ? 553 ARG K N     1 
ATOM   5587 C  CA    . ARG J 3 52 ? 44.931 76.761  55.986 1.00 11.67  ? 553 ARG K CA    1 
ATOM   5588 C  C     . ARG J 3 52 ? 45.150 75.421  55.288 1.00 11.62  ? 553 ARG K C     1 
ATOM   5589 O  O     . ARG J 3 52 ? 45.818 74.531  55.817 1.00 11.00  ? 553 ARG K O     1 
ATOM   5590 C  CB    . ARG J 3 52 ? 43.563 76.755  56.666 1.00 13.14  ? 553 ARG K CB    1 
ATOM   5591 C  CG    . ARG J 3 52 ? 43.317 77.942  57.617 1.00 13.69  ? 553 ARG K CG    1 
ATOM   5592 C  CD    . ARG J 3 52 ? 42.011 77.746  58.373 1.00 16.56  ? 553 ARG K CD    1 
ATOM   5593 N  NE    . ARG J 3 52 ? 40.855 77.510  57.501 1.00 16.24  ? 553 ARG K NE    1 
ATOM   5594 C  CZ    . ARG J 3 52 ? 40.074 78.472  57.009 1.00 19.12  ? 553 ARG K CZ    1 
ATOM   5595 N  NH1   . ARG J 3 52 ? 40.321 79.747  57.294 1.00 15.93  ? 553 ARG K NH1   1 
ATOM   5596 N  NH2   . ARG J 3 52 ? 39.027 78.161  56.254 1.00 18.74  ? 553 ARG K NH2   1 
ATOM   5597 N  N     . HIS J 3 53 ? 44.561 75.284  54.107 1.00 10.84  ? 554 HIS K N     1 
ATOM   5598 C  CA    . HIS J 3 53 ? 44.695 74.062  53.323 1.00 12.58  ? 554 HIS K CA    1 
ATOM   5599 C  C     . HIS J 3 53 ? 46.160 73.798  52.998 1.00 12.02  ? 554 HIS K C     1 
ATOM   5600 O  O     . HIS J 3 53 ? 46.656 72.680  53.163 1.00 10.43  ? 554 HIS K O     1 
ATOM   5601 C  CB    . HIS J 3 53 ? 43.883 74.189  52.029 1.00 13.13  ? 554 HIS K CB    1 
ATOM   5602 C  CG    . HIS J 3 53 ? 44.175 73.126  51.016 1.00 13.46  ? 554 HIS K CG    1 
ATOM   5603 N  ND1   . HIS J 3 53 ? 43.717 71.829  51.133 1.00 13.13  ? 554 HIS K ND1   1 
ATOM   5604 C  CD2   . HIS J 3 53 ? 44.880 73.174  49.859 1.00 15.01  ? 554 HIS K CD2   1 
ATOM   5605 C  CE1   . HIS J 3 53 ? 44.124 71.125  50.092 1.00 15.15  ? 554 HIS K CE1   1 
ATOM   5606 N  NE2   . HIS J 3 53 ? 44.832 71.917  49.305 1.00 16.42  ? 554 HIS K NE2   1 
ATOM   5607 N  N     . ASN J 3 54 ? 46.863 74.828  52.533 1.00 9.71   ? 555 ASN K N     1 
ATOM   5608 C  CA    . ASN J 3 54 ? 48.267 74.651  52.197 1.00 11.14  ? 555 ASN K CA    1 
ATOM   5609 C  C     . ASN J 3 54 ? 49.129 74.302  53.420 1.00 11.62  ? 555 ASN K C     1 
ATOM   5610 O  O     . ASN J 3 54 ? 50.024 73.442  53.354 1.00 11.14  ? 555 ASN K O     1 
ATOM   5611 C  CB    . ASN J 3 54 ? 48.806 75.912  51.513 1.00 11.52  ? 555 ASN K CB    1 
ATOM   5612 C  CG    . ASN J 3 54 ? 48.584 75.899  50.016 1.00 11.40  ? 555 ASN K CG    1 
ATOM   5613 O  OD1   . ASN J 3 54 ? 47.492 76.232  49.513 1.00 13.96  ? 555 ASN K OD1   1 
ATOM   5614 N  ND2   . ASN J 3 54 ? 49.615 75.500  49.288 1.00 9.40   ? 555 ASN K ND2   1 
ATOM   5615 N  N     . LEU J 3 55 ? 48.858 74.967  54.538 1.00 13.03  ? 556 LEU K N     1 
ATOM   5616 C  CA    . LEU J 3 55 ? 49.618 74.690  55.753 1.00 13.12  ? 556 LEU K CA    1 
ATOM   5617 C  C     . LEU J 3 55 ? 49.495 73.216  56.151 1.00 15.10  ? 556 LEU K C     1 
ATOM   5618 O  O     . LEU J 3 55 ? 50.498 72.586  56.459 1.00 12.87  ? 556 LEU K O     1 
ATOM   5619 C  CB    . LEU J 3 55 ? 49.141 75.583  56.900 1.00 13.14  ? 556 LEU K CB    1 
ATOM   5620 C  CG    . LEU J 3 55 ? 49.570 77.048  56.783 1.00 12.49  ? 556 LEU K CG    1 
ATOM   5621 C  CD1   . LEU J 3 55 ? 48.888 77.858  57.876 1.00 13.22  ? 556 LEU K CD1   1 
ATOM   5622 C  CD2   . LEU J 3 55 ? 51.106 77.155  56.885 1.00 12.42  ? 556 LEU K CD2   1 
ATOM   5623 N  N     . SER J 3 56 ? 48.285 72.660  56.137 1.00 15.89  ? 557 SER K N     1 
ATOM   5624 C  CA    . SER J 3 56 ? 48.121 71.250  56.512 1.00 18.56  ? 557 SER K CA    1 
ATOM   5625 C  C     . SER J 3 56 ? 48.618 70.269  55.458 1.00 17.78  ? 557 SER K C     1 
ATOM   5626 O  O     . SER J 3 56 ? 49.361 69.344  55.770 1.00 19.32  ? 557 SER K O     1 
ATOM   5627 C  CB    . SER J 3 56 ? 46.655 70.912  56.803 1.00 18.87  ? 557 SER K CB    1 
ATOM   5628 O  OG    . SER J 3 56 ? 46.209 71.498  58.001 1.00 24.96  ? 557 SER K OG    1 
ATOM   5629 N  N     . LEU J 3 57 ? 48.213 70.480  54.207 1.00 16.39  ? 558 LEU K N     1 
ATOM   5630 C  CA    . LEU J 3 57 ? 48.578 69.566  53.117 1.00 15.23  ? 558 LEU K CA    1 
ATOM   5631 C  C     . LEU J 3 57 ? 50.065 69.333  52.896 1.00 15.98  ? 558 LEU K C     1 
ATOM   5632 O  O     . LEU J 3 57 ? 50.522 68.192  52.801 1.00 15.52  ? 558 LEU K O     1 
ATOM   5633 C  CB    . LEU J 3 57 ? 47.958 70.038  51.788 1.00 16.94  ? 558 LEU K CB    1 
ATOM   5634 C  CG    . LEU J 3 57 ? 48.037 68.991  50.658 1.00 20.04  ? 558 LEU K CG    1 
ATOM   5635 C  CD1   . LEU J 3 57 ? 47.153 67.796  51.029 1.00 21.86  ? 558 LEU K CD1   1 
ATOM   5636 C  CD2   . LEU J 3 57 ? 47.572 69.600  49.325 1.00 20.05  ? 558 LEU K CD2   1 
ATOM   5637 N  N     . HIS J 3 58 ? 50.819 70.416  52.799 1.00 15.66  ? 559 HIS K N     1 
ATOM   5638 C  CA    . HIS J 3 58 ? 52.237 70.333  52.544 1.00 17.66  ? 559 HIS K CA    1 
ATOM   5639 C  C     . HIS J 3 58 ? 53.063 70.077  53.793 1.00 19.24  ? 559 HIS K C     1 
ATOM   5640 O  O     . HIS J 3 58 ? 52.986 70.823  54.766 1.00 17.44  ? 559 HIS K O     1 
ATOM   5641 C  CB    . HIS J 3 58 ? 52.675 71.607  51.837 1.00 19.01  ? 559 HIS K CB    1 
ATOM   5642 C  CG    . HIS J 3 58 ? 51.891 71.880  50.589 1.00 20.67  ? 559 HIS K CG    1 
ATOM   5643 N  ND1   . HIS J 3 58 ? 51.818 70.974  49.549 1.00 21.78  ? 559 HIS K ND1   1 
ATOM   5644 C  CD2   . HIS J 3 58 ? 51.121 72.931  50.231 1.00 19.17  ? 559 HIS K CD2   1 
ATOM   5645 C  CE1   . HIS J 3 58 ? 51.033 71.461  48.602 1.00 22.41  ? 559 HIS K CE1   1 
ATOM   5646 N  NE2   . HIS J 3 58 ? 50.597 72.646  48.989 1.00 19.25  ? 559 HIS K NE2   1 
ATOM   5647 N  N     . LYS J 3 59 ? 53.859 69.013  53.736 1.00 19.91  ? 560 LYS K N     1 
ATOM   5648 C  CA    . LYS J 3 59 ? 54.714 68.604  54.849 1.00 24.24  ? 560 LYS K CA    1 
ATOM   5649 C  C     . LYS J 3 59 ? 55.782 69.649  55.178 1.00 23.53  ? 560 LYS K C     1 
ATOM   5650 O  O     . LYS J 3 59 ? 56.303 69.674  56.292 1.00 24.64  ? 560 LYS K O     1 
ATOM   5651 C  CB    . LYS J 3 59 ? 55.387 67.266  54.518 1.00 28.15  ? 560 LYS K CB    1 
ATOM   5652 C  CG    . LYS J 3 59 ? 54.422 66.193  54.020 1.00 33.91  ? 560 LYS K CG    1 
ATOM   5653 C  CD    . LYS J 3 59 ? 53.731 65.451  55.153 1.00 37.31  ? 560 LYS K CD    1 
ATOM   5654 C  CE    . LYS J 3 59 ? 54.629 64.354  55.708 1.00 40.48  ? 560 LYS K CE    1 
ATOM   5655 N  NZ    . LYS J 3 59 ? 53.958 63.562  56.778 1.00 41.45  ? 560 LYS K NZ    1 
ATOM   5656 N  N     . CYS J 3 60 ? 56.111 70.512  54.221 1.00 23.44  ? 561 CYS K N     1 
ATOM   5657 C  CA    . CYS J 3 60 ? 57.110 71.541  54.483 1.00 22.69  ? 561 CYS K CA    1 
ATOM   5658 C  C     . CYS J 3 60 ? 56.655 72.549  55.544 1.00 21.25  ? 561 CYS K C     1 
ATOM   5659 O  O     . CYS J 3 60 ? 57.477 73.293  56.082 1.00 22.73  ? 561 CYS K O     1 
ATOM   5660 C  CB    . CYS J 3 60 ? 57.492 72.269  53.192 1.00 24.35  ? 561 CYS K CB    1 
ATOM   5661 S  SG    . CYS J 3 60 ? 56.153 73.137  52.390 1.00 28.10  ? 561 CYS K SG    1 
ATOM   5662 N  N     . PHE J 3 61 ? 55.356 72.589  55.838 1.00 18.95  ? 562 PHE K N     1 
ATOM   5663 C  CA    . PHE J 3 61 ? 54.855 73.502  56.870 1.00 18.82  ? 562 PHE K CA    1 
ATOM   5664 C  C     . PHE J 3 61 ? 54.545 72.681  58.105 1.00 19.31  ? 562 PHE K C     1 
ATOM   5665 O  O     . PHE J 3 61 ? 53.659 71.821  58.116 1.00 16.40  ? 562 PHE K O     1 
ATOM   5666 C  CB    . PHE J 3 61 ? 53.616 74.266  56.387 1.00 16.74  ? 562 PHE K CB    1 
ATOM   5667 C  CG    . PHE J 3 61 ? 53.881 75.101  55.173 1.00 16.48  ? 562 PHE K CG    1 
ATOM   5668 C  CD1   . PHE J 3 61 ? 53.188 74.866  53.990 1.00 15.19  ? 562 PHE K CD1   1 
ATOM   5669 C  CD2   . PHE J 3 61 ? 54.884 76.073  55.186 1.00 15.48  ? 562 PHE K CD2   1 
ATOM   5670 C  CE1   . PHE J 3 61 ? 53.490 75.579  52.829 1.00 13.28  ? 562 PHE K CE1   1 
ATOM   5671 C  CE2   . PHE J 3 61 ? 55.193 76.797  54.029 1.00 15.84  ? 562 PHE K CE2   1 
ATOM   5672 C  CZ    . PHE J 3 61 ? 54.490 76.542  52.844 1.00 14.16  ? 562 PHE K CZ    1 
ATOM   5673 N  N     . VAL J 3 62 ? 55.283 72.965  59.163 1.00 17.80  ? 563 VAL K N     1 
ATOM   5674 C  CA    . VAL J 3 62 ? 55.144 72.203  60.396 1.00 19.44  ? 563 VAL K CA    1 
ATOM   5675 C  C     . VAL J 3 62 ? 54.609 73.034  61.536 1.00 17.53  ? 563 VAL K C     1 
ATOM   5676 O  O     . VAL J 3 62 ? 55.178 74.069  61.877 1.00 18.01  ? 563 VAL K O     1 
ATOM   5677 C  CB    . VAL J 3 62 ? 56.513 71.625  60.793 1.00 21.08  ? 563 VAL K CB    1 
ATOM   5678 C  CG1   . VAL J 3 62 ? 56.401 70.784  62.067 1.00 24.15  ? 563 VAL K CG1   1 
ATOM   5679 C  CG2   . VAL J 3 62 ? 57.059 70.802  59.633 1.00 23.53  ? 563 VAL K CG2   1 
ATOM   5680 N  N     . ARG J 3 63 ? 53.496 72.582  62.101 1.00 16.27  ? 564 ARG K N     1 
ATOM   5681 C  CA    . ARG J 3 63 ? 52.867 73.251  63.229 1.00 17.76  ? 564 ARG K CA    1 
ATOM   5682 C  C     . ARG J 3 63 ? 53.682 72.909  64.468 1.00 17.97  ? 564 ARG K C     1 
ATOM   5683 O  O     . ARG J 3 63 ? 53.948 71.732  64.729 1.00 17.72  ? 564 ARG K O     1 
ATOM   5684 C  CB    . ARG J 3 63 ? 51.434 72.742  63.392 1.00 17.01  ? 564 ARG K CB    1 
ATOM   5685 C  CG    . ARG J 3 63 ? 50.672 73.310  64.573 1.00 19.52  ? 564 ARG K CG    1 
ATOM   5686 C  CD    . ARG J 3 63 ? 49.203 72.893  64.511 1.00 21.61  ? 564 ARG K CD    1 
ATOM   5687 N  NE    . ARG J 3 63 ? 48.439 73.404  65.643 1.00 24.24  ? 564 ARG K NE    1 
ATOM   5688 C  CZ    . ARG J 3 63 ? 48.450 72.865  66.860 1.00 25.51  ? 564 ARG K CZ    1 
ATOM   5689 N  NH1   . ARG J 3 63 ? 49.186 71.784  67.107 1.00 25.45  ? 564 ARG K NH1   1 
ATOM   5690 N  NH2   . ARG J 3 63 ? 47.735 73.413  67.833 1.00 25.29  ? 564 ARG K NH2   1 
ATOM   5691 N  N     . VAL J 3 64 ? 54.090 73.931  65.215 1.00 17.63  ? 565 VAL K N     1 
ATOM   5692 C  CA    . VAL J 3 64 ? 54.870 73.733  66.438 1.00 16.63  ? 565 VAL K CA    1 
ATOM   5693 C  C     . VAL J 3 64 ? 54.053 74.298  67.576 1.00 17.63  ? 565 VAL K C     1 
ATOM   5694 O  O     . VAL J 3 64 ? 53.855 75.513  67.693 1.00 16.70  ? 565 VAL K O     1 
ATOM   5695 C  CB    . VAL J 3 64 ? 56.233 74.459  66.369 1.00 16.69  ? 565 VAL K CB    1 
ATOM   5696 C  CG1   . VAL J 3 64 ? 57.002 74.272  67.681 1.00 17.40  ? 565 VAL K CG1   1 
ATOM   5697 C  CG2   . VAL J 3 64 ? 57.043 73.913  65.208 1.00 17.38  ? 565 VAL K CG2   1 
ATOM   5698 N  N     . GLU J 3 65 ? 53.555 73.405  68.413 1.00 16.56  ? 566 GLU K N     1 
ATOM   5699 C  CA    . GLU J 3 65 ? 52.730 73.812  69.519 1.00 18.48  ? 566 GLU K CA    1 
ATOM   5700 C  C     . GLU J 3 65 ? 53.628 74.454  70.559 1.00 18.78  ? 566 GLU K C     1 
ATOM   5701 O  O     . GLU J 3 65 ? 54.784 74.065  70.704 1.00 16.93  ? 566 GLU K O     1 
ATOM   5702 C  CB    . GLU J 3 65 ? 52.015 72.585  70.093 1.00 21.13  ? 566 GLU K CB    1 
ATOM   5703 C  CG    . GLU J 3 65 ? 50.681 72.876  70.708 1.00 26.67  ? 566 GLU K CG    1 
ATOM   5704 C  CD    . GLU J 3 65 ? 49.850 71.617  70.913 1.00 28.23  ? 566 GLU K CD    1 
ATOM   5705 O  OE1   . GLU J 3 65 ? 49.563 70.914  69.918 1.00 27.10  ? 566 GLU K OE1   1 
ATOM   5706 O  OE2   . GLU J 3 65 ? 49.475 71.347  72.072 1.00 30.63  ? 566 GLU K OE2   1 
ATOM   5707 N  N     . ASN J 3 66 ? 53.108 75.459  71.253 1.00 20.15  ? 567 ASN K N     1 
ATOM   5708 C  CA    . ASN J 3 66 ? 53.879 76.112  72.303 1.00 23.98  ? 567 ASN K CA    1 
ATOM   5709 C  C     . ASN J 3 66 ? 52.952 76.537  73.429 1.00 25.08  ? 567 ASN K C     1 
ATOM   5710 O  O     . ASN J 3 66 ? 51.743 76.325  73.361 1.00 24.78  ? 567 ASN K O     1 
ATOM   5711 C  CB    . ASN J 3 66 ? 54.683 77.315  71.766 1.00 24.51  ? 567 ASN K CB    1 
ATOM   5712 C  CG    . ASN J 3 66 ? 53.817 78.372  71.086 1.00 25.24  ? 567 ASN K CG    1 
ATOM   5713 O  OD1   . ASN J 3 66 ? 52.699 78.663  71.514 1.00 25.52  ? 567 ASN K OD1   1 
ATOM   5714 N  ND2   . ASN J 3 66 ? 54.356 78.977  70.038 1.00 24.55  ? 567 ASN K ND2   1 
ATOM   5715 N  N     . VAL J 3 67 ? 53.511 77.132  74.472 1.00 29.15  ? 568 VAL K N     1 
ATOM   5716 C  CA    . VAL J 3 67 ? 52.698 77.546  75.610 1.00 32.70  ? 568 VAL K CA    1 
ATOM   5717 C  C     . VAL J 3 67 ? 51.490 78.421  75.259 1.00 33.98  ? 568 VAL K C     1 
ATOM   5718 O  O     . VAL J 3 67 ? 50.404 78.216  75.793 1.00 36.16  ? 568 VAL K O     1 
ATOM   5719 C  CB    . VAL J 3 67 ? 53.554 78.285  76.662 1.00 34.19  ? 568 VAL K CB    1 
ATOM   5720 C  CG1   . VAL J 3 67 ? 52.683 78.724  77.818 1.00 35.74  ? 568 VAL K CG1   1 
ATOM   5721 C  CG2   . VAL J 3 67 ? 54.652 77.372  77.167 1.00 34.01  ? 568 VAL K CG2   1 
ATOM   5722 N  N     . LYS J 3 68 ? 51.667 79.377  74.353 1.00 36.44  ? 569 LYS K N     1 
ATOM   5723 C  CA    . LYS J 3 68 ? 50.577 80.282  73.989 1.00 38.00  ? 569 LYS K CA    1 
ATOM   5724 C  C     . LYS J 3 68 ? 49.625 79.784  72.905 1.00 37.16  ? 569 LYS K C     1 
ATOM   5725 O  O     . LYS J 3 68 ? 48.633 80.445  72.595 1.00 37.98  ? 569 LYS K O     1 
ATOM   5726 C  CB    . LYS J 3 68 ? 51.154 81.640  73.578 1.00 42.96  ? 569 LYS K CB    1 
ATOM   5727 C  CG    . LYS J 3 68 ? 51.935 82.330  74.687 1.00 48.50  ? 569 LYS K CG    1 
ATOM   5728 C  CD    . LYS J 3 68 ? 52.526 83.654  74.227 1.00 52.70  ? 569 LYS K CD    1 
ATOM   5729 C  CE    . LYS J 3 68 ? 53.301 84.321  75.355 1.00 54.93  ? 569 LYS K CE    1 
ATOM   5730 N  NZ    . LYS J 3 68 ? 53.919 85.611  74.940 1.00 56.17  ? 569 LYS K NZ    1 
ATOM   5731 N  N     . GLY J 3 69 ? 49.918 78.622  72.333 1.00 33.79  ? 570 GLY K N     1 
ATOM   5732 C  CA    . GLY J 3 69 ? 49.068 78.083  71.285 1.00 29.89  ? 570 GLY K CA    1 
ATOM   5733 C  C     . GLY J 3 69 ? 49.907 77.292  70.304 1.00 27.55  ? 570 GLY K C     1 
ATOM   5734 O  O     . GLY J 3 69 ? 50.371 76.202  70.629 1.00 27.34  ? 570 GLY K O     1 
ATOM   5735 N  N     . ALA J 3 70 ? 50.106 77.831  69.106 1.00 23.59  ? 571 ALA K N     1 
ATOM   5736 C  CA    . ALA J 3 70 ? 50.916 77.150  68.101 1.00 21.82  ? 571 ALA K CA    1 
ATOM   5737 C  C     . ALA J 3 70 ? 51.357 78.096  66.999 1.00 20.37  ? 571 ALA K C     1 
ATOM   5738 O  O     . ALA J 3 70 ? 50.642 79.028  66.636 1.00 21.78  ? 571 ALA K O     1 
ATOM   5739 C  CB    . ALA J 3 70 ? 50.151 75.986  67.503 1.00 19.41  ? 571 ALA K CB    1 
ATOM   5740 N  N     . VAL J 3 71 ? 52.549 77.853  66.479 1.00 18.57  ? 572 VAL K N     1 
ATOM   5741 C  CA    . VAL J 3 71 ? 53.099 78.669  65.411 1.00 18.29  ? 572 VAL K CA    1 
ATOM   5742 C  C     . VAL J 3 71 ? 53.363 77.735  64.254 1.00 18.43  ? 572 VAL K C     1 
ATOM   5743 O  O     . VAL J 3 71 ? 53.475 76.516  64.436 1.00 18.39  ? 572 VAL K O     1 
ATOM   5744 C  CB    . VAL J 3 71 ? 54.451 79.306  65.805 1.00 18.51  ? 572 VAL K CB    1 
ATOM   5745 C  CG1   . VAL J 3 71 ? 54.246 80.375  66.893 1.00 18.16  ? 572 VAL K CG1   1 
ATOM   5746 C  CG2   . VAL J 3 71 ? 55.401 78.215  66.308 1.00 19.10  ? 572 VAL K CG2   1 
ATOM   5747 N  N     . TRP J 3 72 ? 53.451 78.309  63.062 1.00 16.52  ? 573 TRP K N     1 
ATOM   5748 C  CA    . TRP J 3 72 ? 53.756 77.541  61.883 1.00 15.42  ? 573 TRP K CA    1 
ATOM   5749 C  C     . TRP J 3 72 ? 55.206 77.833  61.540 1.00 15.96  ? 573 TRP K C     1 
ATOM   5750 O  O     . TRP J 3 72 ? 55.677 78.972  61.687 1.00 18.42  ? 573 TRP K O     1 
ATOM   5751 C  CB    . TRP J 3 72 ? 52.824 77.934  60.716 1.00 14.73  ? 573 TRP K CB    1 
ATOM   5752 C  CG    . TRP J 3 72 ? 51.443 77.371  60.891 1.00 13.48  ? 573 TRP K CG    1 
ATOM   5753 C  CD1   . TRP J 3 72 ? 50.368 77.987  61.457 1.00 12.50  ? 573 TRP K CD1   1 
ATOM   5754 C  CD2   . TRP J 3 72 ? 51.021 76.036  60.576 1.00 13.75  ? 573 TRP K CD2   1 
ATOM   5755 N  NE1   . TRP J 3 72 ? 49.303 77.110  61.528 1.00 13.25  ? 573 TRP K NE1   1 
ATOM   5756 C  CE2   . TRP J 3 72 ? 49.684 75.906  61.003 1.00 14.17  ? 573 TRP K CE2   1 
ATOM   5757 C  CE3   . TRP J 3 72 ? 51.657 74.929  60.001 1.00 14.05  ? 573 TRP K CE3   1 
ATOM   5758 C  CZ2   . TRP J 3 72 ? 48.955 74.722  60.843 1.00 14.21  ? 573 TRP K CZ2   1 
ATOM   5759 C  CZ3   . TRP J 3 72 ? 50.933 73.745  59.843 1.00 14.54  ? 573 TRP K CZ3   1 
ATOM   5760 C  CH2   . TRP J 3 72 ? 49.601 73.652  60.274 1.00 13.25  ? 573 TRP K CH2   1 
ATOM   5761 N  N     . THR J 3 73 ? 55.915 76.802  61.098 1.00 15.08  ? 574 THR K N     1 
ATOM   5762 C  CA    . THR J 3 73 ? 57.315 76.922  60.726 1.00 17.17  ? 574 THR K CA    1 
ATOM   5763 C  C     . THR J 3 73 ? 57.510 76.248  59.383 1.00 17.87  ? 574 THR K C     1 
ATOM   5764 O  O     . THR J 3 73 ? 56.612 75.550  58.897 1.00 18.54  ? 574 THR K O     1 
ATOM   5765 C  CB    . THR J 3 73 ? 58.225 76.205  61.740 1.00 18.13  ? 574 THR K CB    1 
ATOM   5766 O  OG1   . THR J 3 73 ? 57.921 74.803  61.731 1.00 16.95  ? 574 THR K OG1   1 
ATOM   5767 C  CG2   . THR J 3 73 ? 57.997 76.757  63.133 1.00 18.93  ? 574 THR K CG2   1 
ATOM   5768 N  N     . VAL J 3 74 ? 58.689 76.426  58.801 1.00 18.61  ? 575 VAL K N     1 
ATOM   5769 C  CA    . VAL J 3 74 ? 58.992 75.837  57.505 1.00 23.03  ? 575 VAL K CA    1 
ATOM   5770 C  C     . VAL J 3 74 ? 60.165 74.865  57.535 1.00 26.35  ? 575 VAL K C     1 
ATOM   5771 O  O     . VAL J 3 74 ? 61.246 75.193  58.028 1.00 25.91  ? 575 VAL K O     1 
ATOM   5772 C  CB    . VAL J 3 74 ? 59.346 76.918  56.458 1.00 24.51  ? 575 VAL K CB    1 
ATOM   5773 C  CG1   . VAL J 3 74 ? 59.712 76.255  55.134 1.00 26.34  ? 575 VAL K CG1   1 
ATOM   5774 C  CG2   . VAL J 3 74 ? 58.189 77.866  56.264 1.00 24.05  ? 575 VAL K CG2   1 
ATOM   5775 N  N     . ASP J 3 75 ? 59.948 73.667  57.005 1.00 26.88  ? 576 ASP K N     1 
ATOM   5776 C  CA    . ASP J 3 75 ? 61.019 72.678  56.911 1.00 29.85  ? 576 ASP K CA    1 
ATOM   5777 C  C     . ASP J 3 75 ? 61.613 72.932  55.526 1.00 31.06  ? 576 ASP K C     1 
ATOM   5778 O  O     . ASP J 3 75 ? 61.125 72.409  54.524 1.00 30.18  ? 576 ASP K O     1 
ATOM   5779 C  CB    . ASP J 3 75 ? 60.451 71.260  57.009 1.00 30.97  ? 576 ASP K CB    1 
ATOM   5780 C  CG    . ASP J 3 75 ? 61.516 70.189  56.839 1.00 33.33  ? 576 ASP K CG    1 
ATOM   5781 O  OD1   . ASP J 3 75 ? 61.233 69.018  57.164 1.00 33.30  ? 576 ASP K OD1   1 
ATOM   5782 O  OD2   . ASP J 3 75 ? 62.628 70.512  56.373 1.00 34.17  ? 576 ASP K OD2   1 
ATOM   5783 N  N     . GLU J 3 76 ? 62.656 73.760  55.485 1.00 34.22  ? 577 GLU K N     1 
ATOM   5784 C  CA    . GLU J 3 76 ? 63.317 74.144  54.240 1.00 37.59  ? 577 GLU K CA    1 
ATOM   5785 C  C     . GLU J 3 76 ? 63.747 72.967  53.368 1.00 40.24  ? 577 GLU K C     1 
ATOM   5786 O  O     . GLU J 3 76 ? 63.555 72.990  52.150 1.00 40.36  ? 577 GLU K O     1 
ATOM   5787 C  CB    . GLU J 3 76 ? 64.523 75.030  54.551 1.00 38.18  ? 577 GLU K CB    1 
ATOM   5788 C  CG    . GLU J 3 76 ? 65.209 75.624  53.326 1.00 39.35  ? 577 GLU K CG    1 
ATOM   5789 C  CD    . GLU J 3 76 ? 64.312 76.560  52.527 1.00 40.58  ? 577 GLU K CD    1 
ATOM   5790 O  OE1   . GLU J 3 76 ? 63.229 76.941  53.028 1.00 38.53  ? 577 GLU K OE1   1 
ATOM   5791 O  OE2   . GLU J 3 76 ? 64.700 76.926  51.394 1.00 39.53  ? 577 GLU K OE2   1 
ATOM   5792 N  N     . VAL J 3 77 ? 64.336 71.946  53.983 1.00 43.27  ? 578 VAL K N     1 
ATOM   5793 C  CA    . VAL J 3 77 ? 64.768 70.770  53.236 1.00 46.57  ? 578 VAL K CA    1 
ATOM   5794 C  C     . VAL J 3 77 ? 63.577 70.207  52.473 1.00 48.71  ? 578 VAL K C     1 
ATOM   5795 O  O     . VAL J 3 77 ? 63.678 69.868  51.294 1.00 49.17  ? 578 VAL K O     1 
ATOM   5796 C  CB    . VAL J 3 77 ? 65.307 69.673  54.173 1.00 46.70  ? 578 VAL K CB    1 
ATOM   5797 C  CG1   . VAL J 3 77 ? 65.685 68.440  53.366 1.00 47.52  ? 578 VAL K CG1   1 
ATOM   5798 C  CG2   . VAL J 3 77 ? 66.509 70.193  54.941 1.00 47.48  ? 578 VAL K CG2   1 
ATOM   5799 N  N     . GLU J 3 78 ? 62.445 70.120  53.162 1.00 51.46  ? 579 GLU K N     1 
ATOM   5800 C  CA    . GLU J 3 78 ? 61.221 69.599  52.575 1.00 53.47  ? 579 GLU K CA    1 
ATOM   5801 C  C     . GLU J 3 78 ? 60.715 70.524  51.470 1.00 54.46  ? 579 GLU K C     1 
ATOM   5802 O  O     . GLU J 3 78 ? 60.377 70.069  50.378 1.00 54.57  ? 579 GLU K O     1 
ATOM   5803 C  CB    . GLU J 3 78 ? 60.158 69.445  53.663 1.00 54.91  ? 579 GLU K CB    1 
ATOM   5804 C  CG    . GLU J 3 78 ? 59.119 68.374  53.384 1.00 57.82  ? 579 GLU K CG    1 
ATOM   5805 C  CD    . GLU J 3 78 ? 59.743 67.012  53.131 1.00 59.85  ? 579 GLU K CD    1 
ATOM   5806 O  OE1   . GLU J 3 78 ? 60.742 66.676  53.803 1.00 61.26  ? 579 GLU K OE1   1 
ATOM   5807 O  OE2   . GLU J 3 78 ? 59.227 66.271  52.268 1.00 59.90  ? 579 GLU K OE2   1 
ATOM   5808 N  N     . TYR J 3 79 ? 60.669 71.823  51.750 1.00 55.72  ? 580 TYR K N     1 
ATOM   5809 C  CA    . TYR J 3 79 ? 60.202 72.793  50.763 1.00 58.29  ? 580 TYR K CA    1 
ATOM   5810 C  C     . TYR J 3 79 ? 60.990 72.651  49.462 1.00 62.02  ? 580 TYR K C     1 
ATOM   5811 O  O     . TYR J 3 79 ? 60.433 72.775  48.373 1.00 61.39  ? 580 TYR K O     1 
ATOM   5812 C  CB    . TYR J 3 79 ? 60.353 74.226  51.295 1.00 54.28  ? 580 TYR K CB    1 
ATOM   5813 C  CG    . TYR J 3 79 ? 59.959 75.304  50.296 1.00 50.88  ? 580 TYR K CG    1 
ATOM   5814 C  CD1   . TYR J 3 79 ? 58.621 75.666  50.109 1.00 48.94  ? 580 TYR K CD1   1 
ATOM   5815 C  CD2   . TYR J 3 79 ? 60.925 75.940  49.518 1.00 48.63  ? 580 TYR K CD2   1 
ATOM   5816 C  CE1   . TYR J 3 79 ? 58.259 76.639  49.168 1.00 45.84  ? 580 TYR K CE1   1 
ATOM   5817 C  CE2   . TYR J 3 79 ? 60.577 76.906  48.578 1.00 47.21  ? 580 TYR K CE2   1 
ATOM   5818 C  CZ    . TYR J 3 79 ? 59.245 77.252  48.405 1.00 47.24  ? 580 TYR K CZ    1 
ATOM   5819 O  OH    . TYR J 3 79 ? 58.918 78.203  47.461 1.00 43.95  ? 580 TYR K OH    1 
ATOM   5820 N  N     . GLN J 3 80 ? 62.287 72.382  49.585 1.00 67.00  ? 581 GLN K N     1 
ATOM   5821 C  CA    . GLN J 3 80 ? 63.151 72.235  48.419 1.00 72.64  ? 581 GLN K CA    1 
ATOM   5822 C  C     . GLN J 3 80 ? 62.841 71.016  47.558 1.00 76.37  ? 581 GLN K C     1 
ATOM   5823 O  O     . GLN J 3 80 ? 63.121 71.015  46.360 1.00 76.91  ? 581 GLN K O     1 
ATOM   5824 C  CB    . GLN J 3 80 ? 64.619 72.200  48.847 1.00 72.41  ? 581 GLN K CB    1 
ATOM   5825 C  CG    . GLN J 3 80 ? 65.140 73.525  49.374 1.00 72.29  ? 581 GLN K CG    1 
ATOM   5826 C  CD    . GLN J 3 80 ? 64.762 74.693  48.481 1.00 72.12  ? 581 GLN K CD    1 
ATOM   5827 O  OE1   . GLN J 3 80 ? 64.715 74.566  47.258 1.00 72.13  ? 581 GLN K OE1   1 
ATOM   5828 N  NE2   . GLN J 3 80 ? 64.502 75.843  49.089 1.00 71.59  ? 581 GLN K NE2   1 
ATOM   5829 N  N     . LYS J 3 81 ? 62.275 69.976  48.160 1.00 81.33  ? 582 LYS K N     1 
ATOM   5830 C  CA    . LYS J 3 81 ? 61.927 68.782  47.401 1.00 86.39  ? 582 LYS K CA    1 
ATOM   5831 C  C     . LYS J 3 81 ? 60.697 69.095  46.557 1.00 89.71  ? 582 LYS K C     1 
ATOM   5832 O  O     . LYS J 3 81 ? 59.793 69.801  47.008 1.00 89.91  ? 582 LYS K O     1 
ATOM   5833 C  CB    . LYS J 3 81 ? 61.644 67.612  48.342 1.00 87.26  ? 582 LYS K CB    1 
ATOM   5834 C  CG    . LYS J 3 81 ? 62.866 67.152  49.114 1.00 88.96  ? 582 LYS K CG    1 
ATOM   5835 C  CD    . LYS J 3 81 ? 62.569 65.912  49.934 1.00 90.94  ? 582 LYS K CD    1 
ATOM   5836 C  CE    . LYS J 3 81 ? 63.811 65.433  50.668 1.00 92.13  ? 582 LYS K CE    1 
ATOM   5837 N  NZ    . LYS J 3 81 ? 63.544 64.194  51.448 1.00 93.02  ? 582 LYS K NZ    1 
ATOM   5838 N  N     . ARG J 3 82 ? 60.671 68.570  45.335 1.00 93.67  ? 583 ARG K N     1 
ATOM   5839 C  CA    . ARG J 3 82 ? 59.574 68.808  44.400 1.00 97.88  ? 583 ARG K CA    1 
ATOM   5840 C  C     . ARG J 3 82 ? 59.711 70.192  43.778 1.00 99.05  ? 583 ARG K C     1 
ATOM   5841 O  O     . ARG J 3 82 ? 58.904 70.591  42.938 1.00 99.94  ? 583 ARG K O     1 
ATOM   5842 C  CB    . ARG J 3 82 ? 58.215 68.683  45.098 1.00 100.15 ? 583 ARG K CB    1 
ATOM   5843 C  CG    . ARG J 3 82 ? 57.710 67.256  45.216 1.00 103.79 ? 583 ARG K CG    1 
ATOM   5844 C  CD    . ARG J 3 82 ? 57.532 66.649  43.834 1.00 106.63 ? 583 ARG K CD    1 
ATOM   5845 N  NE    . ARG J 3 82 ? 57.060 65.270  43.886 1.00 109.30 ? 583 ARG K NE    1 
ATOM   5846 C  CZ    . ARG J 3 82 ? 56.927 64.491  42.817 1.00 110.57 ? 583 ARG K CZ    1 
ATOM   5847 N  NH1   . ARG J 3 82 ? 57.232 64.958  41.614 1.00 111.11 ? 583 ARG K NH1   1 
ATOM   5848 N  NH2   . ARG J 3 82 ? 56.491 63.246  42.951 1.00 111.73 ? 583 ARG K NH2   1 
ATOM   5849 N  N     . ARG J 3 83 ? 60.743 70.919  44.197 1.00 100.20 ? 584 ARG K N     1 
ATOM   5850 C  CA    . ARG J 3 83 ? 61.008 72.257  43.683 1.00 100.79 ? 584 ARG K CA    1 
ATOM   5851 C  C     . ARG J 3 83 ? 62.467 72.370  43.253 1.00 101.15 ? 584 ARG K C     1 
ATOM   5852 O  O     . ARG J 3 83 ? 63.195 71.362  43.381 1.00 101.39 ? 584 ARG K O     1 
ATOM   5853 C  CB    . ARG J 3 83 ? 60.701 73.312  44.752 1.00 100.61 ? 584 ARG K CB    1 
ATOM   5854 C  CG    . ARG J 3 83 ? 59.244 73.347  45.192 1.00 100.37 ? 584 ARG K CG    1 
ATOM   5855 C  CD    . ARG J 3 83 ? 58.992 74.441  46.219 1.00 99.92  ? 584 ARG K CD    1 
ATOM   5856 N  NE    . ARG J 3 83 ? 57.596 74.480  46.652 1.00 99.67  ? 584 ARG K NE    1 
ATOM   5857 C  CZ    . ARG J 3 83 ? 56.994 73.514  47.342 1.00 99.53  ? 584 ARG K CZ    1 
ATOM   5858 N  NH1   . ARG J 3 83 ? 57.663 72.423  47.686 1.00 99.48  ? 584 ARG K NH1   1 
ATOM   5859 N  NH2   . ARG J 3 83 ? 55.719 73.637  47.686 1.00 99.22  ? 584 ARG K NH2   1 
HETATM 5860 MG MG    . MG  K 4 .  ? 40.292 113.549 29.230 1.00 69.31  ? 601 MG  F MG    1 
HETATM 5861 MG MG    . MG  L 4 .  ? 17.650 139.717 54.932 1.00 34.78  ? 604 MG  G MG    1 
HETATM 5862 MG MG    . MG  M 4 .  ? 20.318 35.170  58.799 1.00 38.69  ? 602 MG  H MG    1 
HETATM 5863 MG MG    . MG  N 4 .  ? 52.541 61.049  46.937 1.00 82.79  ? 603 MG  I MG    1 
HETATM 5864 MG MG    . MG  O 4 .  ? 30.598 104.226 26.089 1.00 18.86  ? 605 MG  J MG    1 
HETATM 5865 MG MG    . MG  P 4 .  ? 51.804 70.766  56.916 1.00 21.89  ? 606 MG  K MG    1 
HETATM 5866 O  O     . HOH Q 5 .  ? 38.583 99.300  33.909 1.00 14.66  ? 22  HOH A O     1 
HETATM 5867 O  O     . HOH Q 5 .  ? 38.668 105.874 35.567 1.00 14.75  ? 23  HOH A O     1 
HETATM 5868 O  O     . HOH Q 5 .  ? 44.775 95.253  33.294 1.00 25.12  ? 24  HOH A O     1 
HETATM 5869 O  O     . HOH Q 5 .  ? 21.591 105.924 34.050 1.00 20.95  ? 25  HOH A O     1 
HETATM 5870 O  O     . HOH Q 5 .  ? 33.442 104.456 46.072 1.00 26.74  ? 26  HOH A O     1 
HETATM 5871 O  O     . HOH Q 5 .  ? 41.109 103.158 31.751 1.00 23.71  ? 27  HOH A O     1 
HETATM 5872 O  O     . HOH Q 5 .  ? 36.600 96.811  38.479 1.00 25.65  ? 28  HOH A O     1 
HETATM 5873 O  O     . HOH Q 5 .  ? 41.284 106.995 35.116 1.00 27.11  ? 29  HOH A O     1 
HETATM 5874 O  O     . HOH Q 5 .  ? 39.499 92.379  42.222 1.00 26.10  ? 30  HOH A O     1 
HETATM 5875 O  O     . HOH Q 5 .  ? 33.273 99.822  38.601 1.00 26.16  ? 31  HOH A O     1 
HETATM 5876 O  O     . HOH Q 5 .  ? 23.531 108.349 37.425 1.00 25.23  ? 32  HOH A O     1 
HETATM 5877 O  O     . HOH Q 5 .  ? 33.336 96.855  42.502 1.00 24.63  ? 33  HOH A O     1 
HETATM 5878 O  O     . HOH Q 5 .  ? 29.924 106.490 44.418 1.00 28.44  ? 34  HOH A O     1 
HETATM 5879 O  O     . HOH Q 5 .  ? 37.644 93.056  44.378 1.00 26.49  ? 35  HOH A O     1 
HETATM 5880 O  O     . HOH Q 5 .  ? 44.533 109.354 36.602 1.00 32.88  ? 36  HOH A O     1 
HETATM 5881 O  O     . HOH Q 5 .  ? 12.072 104.609 39.630 1.00 59.97  ? 37  HOH A O     1 
HETATM 5882 O  O     . HOH Q 5 .  ? 41.543 93.288  33.641 1.00 31.81  ? 38  HOH A O     1 
HETATM 5883 O  O     . HOH Q 5 .  ? 22.493 100.087 42.182 1.00 43.59  ? 39  HOH A O     1 
HETATM 5884 O  O     . HOH Q 5 .  ? 11.329 108.877 30.120 1.00 52.84  ? 40  HOH A O     1 
HETATM 5885 O  O     . HOH Q 5 .  ? 9.310  104.806 36.218 1.00 53.39  ? 41  HOH A O     1 
HETATM 5886 O  O     . HOH Q 5 .  ? 17.322 108.620 41.165 1.00 33.13  ? 42  HOH A O     1 
HETATM 5887 O  O     . HOH Q 5 .  ? 26.708 99.630  40.879 1.00 50.77  ? 43  HOH A O     1 
HETATM 5888 O  O     . HOH Q 5 .  ? 47.331 100.663 35.110 1.00 34.25  ? 44  HOH A O     1 
HETATM 5889 O  O     . HOH Q 5 .  ? 15.530 103.311 41.296 1.00 40.53  ? 45  HOH A O     1 
HETATM 5890 O  O     . HOH Q 5 .  ? 26.154 100.263 43.369 1.00 58.94  ? 46  HOH A O     1 
HETATM 5891 O  O     . HOH Q 5 .  ? 14.830 108.832 36.752 1.00 28.54  ? 47  HOH A O     1 
HETATM 5892 O  O     . HOH Q 5 .  ? 18.912 101.494 42.335 1.00 52.78  ? 48  HOH A O     1 
HETATM 5893 O  O     . HOH Q 5 .  ? 59.554 110.517 40.181 1.00 65.04  ? 49  HOH A O     1 
HETATM 5894 O  O     . HOH Q 5 .  ? 12.313 95.749  33.566 1.00 62.38  ? 50  HOH A O     1 
HETATM 5895 O  O     . HOH Q 5 .  ? 58.836 100.568 42.082 1.00 52.03  ? 51  HOH A O     1 
HETATM 5896 O  O     . HOH Q 5 .  ? 47.660 109.653 40.268 1.00 63.32  ? 52  HOH A O     1 
HETATM 5897 O  O     . HOH Q 5 .  ? 11.004 105.894 27.913 1.00 66.67  ? 53  HOH A O     1 
HETATM 5898 O  O     . HOH Q 5 .  ? 15.732 110.606 28.315 1.00 57.79  ? 54  HOH A O     1 
HETATM 5899 O  O     . HOH Q 5 .  ? 12.256 107.248 32.789 1.00 52.24  ? 55  HOH A O     1 
HETATM 5900 O  O     . HOH Q 5 .  ? 69.618 98.745  44.080 1.00 66.88  ? 56  HOH A O     1 
HETATM 5901 O  O     . HOH Q 5 .  ? 14.005 97.745  32.387 1.00 68.54  ? 57  HOH A O     1 
HETATM 5902 O  O     . HOH Q 5 .  ? 49.337 101.816 32.124 1.00 66.04  ? 58  HOH A O     1 
HETATM 5903 O  O     . HOH Q 5 .  ? 27.729 109.144 42.498 1.00 60.53  ? 59  HOH A O     1 
HETATM 5904 O  O     . HOH Q 5 .  ? 31.658 94.833  45.907 1.00 61.51  ? 60  HOH A O     1 
HETATM 5905 O  O     . HOH Q 5 .  ? 40.787 99.741  44.526 1.00 19.69  ? 61  HOH A O     1 
HETATM 5906 O  O     . HOH Q 5 .  ? 22.411 108.617 34.945 1.00 50.23  ? 62  HOH A O     1 
HETATM 5907 O  O     . HOH Q 5 .  ? 11.158 111.531 30.423 1.00 52.13  ? 63  HOH A O     1 
HETATM 5908 O  O     . HOH Q 5 .  ? 8.891  107.202 29.711 1.00 68.23  ? 64  HOH A O     1 
HETATM 5909 O  O     . HOH Q 5 .  ? 10.384 99.289  25.520 1.00 71.18  ? 65  HOH A O     1 
HETATM 5910 O  O     . HOH Q 5 .  ? 40.719 90.332  43.138 1.00 45.19  ? 66  HOH A O     1 
HETATM 5911 O  O     . HOH Q 5 .  ? 27.545 96.282  48.060 1.00 66.20  ? 67  HOH A O     1 
HETATM 5912 O  O     . HOH Q 5 .  ? 36.529 98.790  36.256 1.00 24.95  ? 68  HOH A O     1 
HETATM 5913 O  O     . HOH Q 5 .  ? 40.850 105.842 31.750 1.00 60.66  ? 69  HOH A O     1 
HETATM 5914 O  O     . HOH Q 5 .  ? 17.212 113.873 39.547 1.00 71.35  ? 70  HOH A O     1 
HETATM 5915 O  O     . HOH Q 5 .  ? 15.400 100.844 42.988 1.00 74.16  ? 71  HOH A O     1 
HETATM 5916 O  O     . HOH Q 5 .  ? 18.856 103.009 44.827 1.00 62.33  ? 72  HOH A O     1 
HETATM 5917 O  O     . HOH Q 5 .  ? 22.236 103.903 47.919 1.00 65.44  ? 73  HOH A O     1 
HETATM 5918 O  O     . HOH R 5 .  ? 44.672 99.253  38.552 1.00 14.78  ? 22  HOH B O     1 
HETATM 5919 O  O     . HOH R 5 .  ? 42.071 99.706  41.951 1.00 17.23  ? 23  HOH B O     1 
HETATM 5920 O  O     . HOH R 5 .  ? 19.183 102.152 32.133 1.00 26.51  ? 24  HOH B O     1 
HETATM 5921 O  O     . HOH R 5 .  ? 21.916 90.326  33.344 1.00 23.91  ? 25  HOH B O     1 
HETATM 5922 O  O     . HOH R 5 .  ? 36.096 109.476 37.484 1.00 17.89  ? 26  HOH B O     1 
HETATM 5923 O  O     . HOH R 5 .  ? -2.150 107.274 43.350 1.00 62.63  ? 27  HOH B O     1 
HETATM 5924 O  O     . HOH R 5 .  ? 39.088 102.092 44.576 1.00 16.27  ? 28  HOH B O     1 
HETATM 5925 O  O     . HOH R 5 .  ? 35.961 112.896 40.041 1.00 24.74  ? 29  HOH B O     1 
HETATM 5926 O  O     . HOH R 5 .  ? 42.219 97.102  48.482 1.00 36.21  ? 30  HOH B O     1 
HETATM 5927 O  O     . HOH R 5 .  ? 30.347 115.146 44.067 1.00 27.30  ? 31  HOH B O     1 
HETATM 5928 O  O     . HOH R 5 .  ? 21.088 92.469  28.470 1.00 22.29  ? 32  HOH B O     1 
HETATM 5929 O  O     . HOH R 5 .  ? 24.819 106.075 25.313 1.00 25.30  ? 33  HOH B O     1 
HETATM 5930 O  O     . HOH R 5 .  ? 49.131 95.325  46.416 1.00 23.70  ? 34  HOH B O     1 
HETATM 5931 O  O     . HOH R 5 .  ? 47.225 107.616 42.869 1.00 43.53  ? 35  HOH B O     1 
HETATM 5932 O  O     . HOH R 5 .  ? 16.679 98.042  32.519 1.00 37.98  ? 36  HOH B O     1 
HETATM 5933 O  O     . HOH R 5 .  ? 50.331 103.571 44.229 1.00 31.08  ? 37  HOH B O     1 
HETATM 5934 O  O     . HOH R 5 .  ? 18.940 99.370  27.569 1.00 46.30  ? 38  HOH B O     1 
HETATM 5935 O  O     . HOH R 5 .  ? 21.896 106.116 27.393 1.00 30.45  ? 39  HOH B O     1 
HETATM 5936 O  O     . HOH R 5 .  ? 32.232 111.924 36.305 1.00 30.12  ? 40  HOH B O     1 
HETATM 5937 O  O     . HOH R 5 .  ? 61.337 112.523 29.411 1.00 39.52  ? 41  HOH B O     1 
HETATM 5938 O  O     . HOH R 5 .  ? 32.345 108.201 44.350 1.00 28.15  ? 42  HOH B O     1 
HETATM 5939 O  O     . HOH R 5 .  ? 34.570 106.998 45.597 1.00 26.18  ? 43  HOH B O     1 
HETATM 5940 O  O     . HOH R 5 .  ? 50.332 98.298  43.849 1.00 35.63  ? 44  HOH B O     1 
HETATM 5941 O  O     . HOH R 5 .  ? 19.358 98.422  40.891 1.00 54.25  ? 45  HOH B O     1 
HETATM 5942 O  O     . HOH R 5 .  ? 27.602 109.512 28.846 1.00 51.22  ? 46  HOH B O     1 
HETATM 5943 O  O     . HOH R 5 .  ? 24.923 108.613 27.997 1.00 37.97  ? 47  HOH B O     1 
HETATM 5944 O  O     . HOH R 5 .  ? 12.123 102.486 42.047 1.00 57.22  ? 48  HOH B O     1 
HETATM 5945 O  O     . HOH R 5 .  ? 48.131 94.277  35.178 1.00 58.09  ? 49  HOH B O     1 
HETATM 5946 O  O     . HOH R 5 .  ? 31.971 115.481 36.626 1.00 40.98  ? 50  HOH B O     1 
HETATM 5947 O  O     . HOH R 5 .  ? 47.750 101.616 46.784 1.00 37.71  ? 51  HOH B O     1 
HETATM 5948 O  O     . HOH R 5 .  ? 35.422 110.922 49.272 1.00 64.51  ? 52  HOH B O     1 
HETATM 5949 O  O     . HOH R 5 .  ? 44.877 106.044 47.348 1.00 49.87  ? 53  HOH B O     1 
HETATM 5950 O  O     . HOH R 5 .  ? 20.649 93.823  39.237 1.00 64.16  ? 54  HOH B O     1 
HETATM 5951 O  O     . HOH R 5 .  ? 58.499 109.242 35.975 1.00 55.59  ? 55  HOH B O     1 
HETATM 5952 O  O     . HOH R 5 .  ? 14.153 94.604  35.607 1.00 55.96  ? 56  HOH B O     1 
HETATM 5953 O  O     . HOH R 5 .  ? 26.773 115.287 39.987 1.00 66.95  ? 57  HOH B O     1 
HETATM 5954 O  O     . HOH R 5 .  ? 38.631 114.049 46.997 1.00 52.28  ? 58  HOH B O     1 
HETATM 5955 O  O     . HOH R 5 .  ? 25.327 98.887  31.094 1.00 19.36  ? 59  HOH B O     1 
HETATM 5956 O  O     . HOH R 5 .  ? 30.126 109.292 33.235 1.00 37.98  ? 60  HOH B O     1 
HETATM 5957 O  O     . HOH R 5 .  ? 18.544 89.882  31.479 1.00 54.42  ? 61  HOH B O     1 
HETATM 5958 O  O     . HOH R 5 .  ? 18.028 100.275 30.519 1.00 49.58  ? 62  HOH B O     1 
HETATM 5959 O  O     . HOH R 5 .  ? 25.694 108.656 25.257 1.00 27.72  ? 63  HOH B O     1 
HETATM 5960 O  O     . HOH R 5 .  ? 46.122 95.778  35.662 1.00 37.34  ? 64  HOH B O     1 
HETATM 5961 O  O     . HOH R 5 .  ? 46.011 98.393  36.305 1.00 30.65  ? 65  HOH B O     1 
HETATM 5962 O  O     . HOH R 5 .  ? 37.586 102.223 46.879 1.00 31.75  ? 66  HOH B O     1 
HETATM 5963 O  O     . HOH R 5 .  ? 59.158 113.792 27.682 1.00 61.75  ? 67  HOH B O     1 
HETATM 5964 O  O     . HOH R 5 .  ? 17.844 103.373 28.929 1.00 50.05  ? 68  HOH B O     1 
HETATM 5965 O  O     . HOH R 5 .  ? 19.819 105.337 29.120 1.00 34.47  ? 69  HOH B O     1 
HETATM 5966 O  O     . HOH R 5 .  ? 20.224 104.915 31.782 1.00 43.28  ? 70  HOH B O     1 
HETATM 5967 O  O     . HOH R 5 .  ? 22.319 98.165  40.391 1.00 63.21  ? 71  HOH B O     1 
HETATM 5968 O  O     . HOH R 5 .  ? 15.543 95.265  32.542 1.00 58.56  ? 72  HOH B O     1 
HETATM 5969 O  O     . HOH R 5 .  ? 15.097 90.944  29.240 1.00 74.40  ? 73  HOH B O     1 
HETATM 5970 O  O     . HOH R 5 .  ? -0.652 105.209 46.572 1.00 66.36  ? 74  HOH B O     1 
HETATM 5971 O  O     . HOH R 5 .  ? 61.309 110.211 38.278 1.00 64.69  ? 75  HOH B O     1 
HETATM 5972 O  O     . HOH R 5 .  ? 28.536 113.513 42.957 1.00 51.63  ? 76  HOH B O     1 
HETATM 5973 O  O     . HOH S 5 .  ? 50.776 76.097  46.926 1.00 14.22  ? 22  HOH C O     1 
HETATM 5974 O  O     . HOH S 5 .  ? 50.121 79.723  41.063 1.00 25.86  ? 23  HOH C O     1 
HETATM 5975 O  O     . HOH S 5 .  ? 41.070 69.196  62.559 1.00 24.35  ? 24  HOH C O     1 
HETATM 5976 O  O     . HOH S 5 .  ? 37.598 72.995  42.465 1.00 16.38  ? 25  HOH C O     1 
HETATM 5977 O  O     . HOH S 5 .  ? 50.344 71.904  45.004 1.00 22.43  ? 26  HOH C O     1 
HETATM 5978 O  O     . HOH S 5 .  ? 34.158 70.583  47.102 1.00 26.24  ? 27  HOH C O     1 
HETATM 5979 O  O     . HOH S 5 .  ? 42.401 78.212  46.901 1.00 25.35  ? 28  HOH C O     1 
HETATM 5980 O  O     . HOH S 5 .  ? 39.764 82.632  42.904 1.00 26.14  ? 29  HOH C O     1 
HETATM 5981 O  O     . HOH S 5 .  ? 47.199 68.046  43.710 1.00 26.15  ? 30  HOH C O     1 
HETATM 5982 O  O     . HOH S 5 .  ? 41.167 75.244  49.954 1.00 25.58  ? 31  HOH C O     1 
HETATM 5983 O  O     . HOH S 5 .  ? 37.440 78.157  48.656 1.00 23.04  ? 32  HOH C O     1 
HETATM 5984 O  O     . HOH S 5 .  ? 37.247 81.919  43.816 1.00 26.51  ? 33  HOH C O     1 
HETATM 5985 O  O     . HOH S 5 .  ? 38.642 66.645  59.452 1.00 25.04  ? 34  HOH C O     1 
HETATM 5986 O  O     . HOH S 5 .  ? 34.451 68.533  51.021 1.00 26.82  ? 35  HOH C O     1 
HETATM 5987 O  O     . HOH S 5 .  ? 48.702 81.800  44.127 1.00 29.52  ? 36  HOH C O     1 
HETATM 5988 O  O     . HOH S 5 .  ? 47.310 74.463  24.957 1.00 55.29  ? 37  HOH C O     1 
HETATM 5989 O  O     . HOH S 5 .  ? 33.051 66.297  64.116 1.00 32.45  ? 38  HOH C O     1 
HETATM 5990 O  O     . HOH S 5 .  ? 41.309 66.219  73.418 1.00 50.24  ? 39  HOH C O     1 
HETATM 5991 O  O     . HOH S 5 .  ? 35.603 66.008  53.871 1.00 64.53  ? 40  HOH C O     1 
HETATM 5992 O  O     . HOH S 5 .  ? 46.953 65.754  40.148 1.00 40.81  ? 41  HOH C O     1 
HETATM 5993 O  O     . HOH S 5 .  ? 49.403 74.304  38.068 1.00 32.18  ? 42  HOH C O     1 
HETATM 5994 O  O     . HOH S 5 .  ? 34.582 70.140  73.378 1.00 45.95  ? 43  HOH C O     1 
HETATM 5995 O  O     . HOH S 5 .  ? 34.103 74.834  54.872 1.00 60.88  ? 44  HOH C O     1 
HETATM 5996 O  O     . HOH S 5 .  ? 36.335 66.355  68.058 1.00 32.99  ? 45  HOH C O     1 
HETATM 5997 O  O     . HOH S 5 .  ? 32.514 73.585  62.184 1.00 49.13  ? 46  HOH C O     1 
HETATM 5998 O  O     . HOH S 5 .  ? 32.233 71.603  65.517 1.00 55.01  ? 47  HOH C O     1 
HETATM 5999 O  O     . HOH S 5 .  ? 30.419 73.134  55.589 1.00 64.77  ? 48  HOH C O     1 
HETATM 6000 O  O     . HOH S 5 .  ? 43.291 69.066  74.467 1.00 61.32  ? 49  HOH C O     1 
HETATM 6001 O  O     . HOH S 5 .  ? 44.402 64.439  69.966 1.00 51.33  ? 50  HOH C O     1 
HETATM 6002 O  O     . HOH S 5 .  ? 44.383 65.661  36.008 1.00 66.36  ? 51  HOH C O     1 
HETATM 6003 O  O     . HOH S 5 .  ? 52.657 74.312  46.277 1.00 25.59  ? 52  HOH C O     1 
HETATM 6004 O  O     . HOH S 5 .  ? 40.909 63.535  73.692 1.00 62.30  ? 53  HOH C O     1 
HETATM 6005 O  O     . HOH S 5 .  ? 52.662 73.065  37.247 1.00 64.92  ? 54  HOH C O     1 
HETATM 6006 O  O     . HOH S 5 .  ? 46.491 73.267  71.347 1.00 54.41  ? 55  HOH C O     1 
HETATM 6007 O  O     . HOH S 5 .  ? 50.438 57.091  32.339 1.00 64.73  ? 56  HOH C O     1 
HETATM 6008 O  O     . HOH S 5 .  ? 50.269 69.196  45.628 1.00 59.28  ? 57  HOH C O     1 
HETATM 6009 O  O     . HOH S 5 .  ? 38.208 75.238  40.957 1.00 17.99  ? 58  HOH C O     1 
HETATM 6010 O  O     . HOH S 5 .  ? 33.785 80.027  49.046 1.00 65.62  ? 59  HOH C O     1 
HETATM 6011 O  O     . HOH S 5 .  ? 40.626 66.421  61.357 1.00 39.54  ? 60  HOH C O     1 
HETATM 6012 O  O     . HOH S 5 .  ? 32.264 70.337  69.273 1.00 69.68  ? 61  HOH C O     1 
HETATM 6013 O  O     . HOH S 5 .  ? 31.210 68.682  65.271 1.00 56.08  ? 62  HOH C O     1 
HETATM 6014 O  O     . HOH S 5 .  ? 30.277 71.921  61.346 1.00 55.77  ? 63  HOH C O     1 
HETATM 6015 O  O     . HOH S 5 .  ? 30.862 73.842  65.108 1.00 71.37  ? 64  HOH C O     1 
HETATM 6016 O  O     . HOH S 5 .  ? 30.415 60.460  57.503 1.00 64.11  ? 65  HOH C O     1 
HETATM 6017 O  O     . HOH T 5 .  ? 41.111 75.252  40.629 1.00 16.47  ? 22  HOH D O     1 
HETATM 6018 O  O     . HOH T 5 .  ? 45.212 75.792  39.305 1.00 15.33  ? 23  HOH D O     1 
HETATM 6019 O  O     . HOH T 5 .  ? 50.313 70.017  59.090 1.00 17.09  ? 24  HOH D O     1 
HETATM 6020 O  O     . HOH T 5 .  ? 42.106 72.855  65.426 1.00 26.23  ? 25  HOH D O     1 
HETATM 6021 O  O     . HOH T 5 .  ? 43.098 65.588  47.718 1.00 22.61  ? 26  HOH D O     1 
HETATM 6022 O  O     . HOH T 5 .  ? 44.007 68.092  47.975 1.00 17.82  ? 27  HOH D O     1 
HETATM 6023 O  O     . HOH T 5 .  ? 46.172 82.566  65.050 1.00 20.76  ? 28  HOH D O     1 
HETATM 6024 O  O     . HOH T 5 .  ? 41.891 84.724  62.493 1.00 23.01  ? 29  HOH D O     1 
HETATM 6025 O  O     . HOH T 5 .  ? 34.974 59.904  50.734 1.00 27.84  ? 30  HOH D O     1 
HETATM 6026 O  O     . HOH T 5 .  ? 50.400 68.867  62.668 1.00 24.70  ? 31  HOH D O     1 
HETATM 6027 O  O     . HOH T 5 .  ? 59.569 62.447  26.955 1.00 41.39  ? 32  HOH D O     1 
HETATM 6028 O  O     . HOH T 5 .  ? 42.043 71.392  31.948 1.00 33.55  ? 33  HOH D O     1 
HETATM 6029 O  O     . HOH T 5 .  ? 47.558 68.889  64.586 1.00 26.89  ? 34  HOH D O     1 
HETATM 6030 O  O     . HOH T 5 .  ? 41.995 67.447  35.515 1.00 41.18  ? 35  HOH D O     1 
HETATM 6031 O  O     . HOH T 5 .  ? 42.905 63.145  51.713 1.00 31.54  ? 36  HOH D O     1 
HETATM 6032 O  O     . HOH T 5 .  ? 40.894 77.214  67.581 1.00 32.50  ? 37  HOH D O     1 
HETATM 6033 O  O     . HOH T 5 .  ? 42.502 76.703  32.163 1.00 35.93  ? 38  HOH D O     1 
HETATM 6034 O  O     . HOH T 5 .  ? 33.838 76.446  62.298 1.00 48.06  ? 39  HOH D O     1 
HETATM 6035 O  O     . HOH T 5 .  ? 48.127 65.599  58.879 1.00 45.48  ? 40  HOH D O     1 
HETATM 6036 O  O     . HOH T 5 .  ? 44.972 65.782  55.028 1.00 36.29  ? 41  HOH D O     1 
HETATM 6037 O  O     . HOH T 5 .  ? 48.071 66.367  61.423 1.00 31.24  ? 42  HOH D O     1 
HETATM 6038 O  O     . HOH T 5 .  ? 35.035 68.071  46.246 1.00 25.20  ? 43  HOH D O     1 
HETATM 6039 O  O     . HOH T 5 .  ? 42.465 59.500  51.800 1.00 41.63  ? 44  HOH D O     1 
HETATM 6040 O  O     . HOH T 5 .  ? 44.680 61.080  54.914 1.00 65.38  ? 45  HOH D O     1 
HETATM 6041 O  O     . HOH T 5 .  ? 42.550 65.974  39.864 1.00 33.28  ? 46  HOH D O     1 
HETATM 6042 O  O     . HOH T 5 .  ? 37.761 63.859  40.054 1.00 57.19  ? 47  HOH D O     1 
HETATM 6043 O  O     . HOH T 5 .  ? 35.181 76.476  59.503 1.00 61.89  ? 48  HOH D O     1 
HETATM 6044 O  O     . HOH T 5 .  ? 30.053 72.696  68.445 1.00 66.21  ? 49  HOH D O     1 
HETATM 6045 O  O     . HOH T 5 .  ? 34.878 70.466  43.859 1.00 56.63  ? 50  HOH D O     1 
HETATM 6046 O  O     . HOH T 5 .  ? 49.555 80.843  37.258 1.00 54.75  ? 51  HOH D O     1 
HETATM 6047 O  O     . HOH T 5 .  ? 38.448 73.319  33.684 1.00 49.89  ? 52  HOH D O     1 
HETATM 6048 O  O     . HOH T 5 .  ? 37.311 80.057  68.806 1.00 48.88  ? 53  HOH D O     1 
HETATM 6049 O  O     . HOH T 5 .  ? 22.042 72.095  67.308 1.00 69.91  ? 54  HOH D O     1 
HETATM 6050 O  O     . HOH T 5 .  ? 52.561 65.825  27.538 1.00 62.63  ? 55  HOH D O     1 
HETATM 6051 O  O     . HOH T 5 .  ? 31.357 70.711  40.447 1.00 64.57  ? 56  HOH D O     1 
HETATM 6052 O  O     . HOH T 5 .  ? 37.394 77.838  59.443 1.00 54.91  ? 57  HOH D O     1 
HETATM 6053 O  O     . HOH T 5 .  ? 48.586 65.213  21.409 1.00 61.75  ? 58  HOH D O     1 
HETATM 6054 O  O     . HOH T 5 .  ? 51.701 74.779  24.911 1.00 65.75  ? 59  HOH D O     1 
HETATM 6055 O  O     . HOH T 5 .  ? 55.648 72.298  23.100 1.00 66.27  ? 60  HOH D O     1 
HETATM 6056 O  O     . HOH T 5 .  ? 42.224 85.254  66.486 1.00 61.20  ? 61  HOH D O     1 
HETATM 6057 O  O     . HOH T 5 .  ? 45.602 58.019  53.553 1.00 61.06  ? 62  HOH D O     1 
HETATM 6058 O  O     . HOH T 5 .  ? 45.028 69.626  65.950 1.00 43.44  ? 63  HOH D O     1 
HETATM 6059 O  O     . HOH T 5 .  ? 42.741 70.191  64.626 1.00 30.55  ? 64  HOH D O     1 
HETATM 6060 O  O     . HOH T 5 .  ? 50.879 66.422  61.737 1.00 28.03  ? 65  HOH D O     1 
HETATM 6061 O  O     . HOH T 5 .  ? 35.336 61.414  52.925 1.00 54.32  ? 66  HOH D O     1 
HETATM 6062 O  O     . HOH T 5 .  ? 37.061 59.638  55.461 1.00 62.48  ? 67  HOH D O     1 
HETATM 6063 O  O     . HOH T 5 .  ? 45.156 64.047  53.038 1.00 41.04  ? 68  HOH D O     1 
HETATM 6064 O  O     . HOH T 5 .  ? 48.471 64.386  53.086 1.00 63.68  ? 69  HOH D O     1 
HETATM 6065 O  O     . HOH T 5 .  ? 36.602 65.164  37.897 1.00 60.98  ? 70  HOH D O     1 
HETATM 6066 O  O     . HOH T 5 .  ? 34.936 72.941  42.861 1.00 28.42  ? 71  HOH D O     1 
HETATM 6067 O  O     . HOH T 5 .  ? 47.733 76.735  38.928 1.00 37.47  ? 72  HOH D O     1 
HETATM 6068 O  O     . HOH T 5 .  ? 48.459 79.340  38.967 1.00 33.39  ? 73  HOH D O     1 
HETATM 6069 O  O     . HOH T 5 .  ? 33.806 75.076  41.519 1.00 48.53  ? 74  HOH D O     1 
HETATM 6070 O  O     . HOH T 5 .  ? 40.428 74.457  32.317 1.00 51.95  ? 75  HOH D O     1 
HETATM 6071 O  O     . HOH T 5 .  ? 32.220 74.603  39.006 1.00 57.06  ? 76  HOH D O     1 
HETATM 6072 O  O     . HOH T 5 .  ? 32.214 77.314  37.971 1.00 63.95  ? 77  HOH D O     1 
HETATM 6073 O  O     . HOH T 5 .  ? 43.842 80.150  31.906 1.00 60.54  ? 78  HOH D O     1 
HETATM 6074 O  O     . HOH T 5 .  ? 45.203 76.187  60.149 1.00 23.64  ? 79  HOH D O     1 
HETATM 6075 O  O     . HOH T 5 .  ? 40.183 79.875  68.715 1.00 60.70  ? 80  HOH D O     1 
HETATM 6076 O  O     . HOH U 5 .  ? 34.251 134.737 51.871 1.00 27.95  ? 602 HOH F O     1 
HETATM 6077 O  O     . HOH U 5 .  ? 34.161 115.445 38.615 1.00 19.55  ? 603 HOH F O     1 
HETATM 6078 O  O     . HOH U 5 .  ? 29.422 118.695 57.696 1.00 25.82  ? 604 HOH F O     1 
HETATM 6079 O  O     . HOH U 5 .  ? 28.903 115.762 51.240 1.00 26.76  ? 605 HOH F O     1 
HETATM 6080 O  O     . HOH U 5 .  ? 36.162 131.410 49.343 1.00 35.71  ? 606 HOH F O     1 
HETATM 6081 O  O     . HOH U 5 .  ? 34.880 112.136 37.462 1.00 26.93  ? 607 HOH F O     1 
HETATM 6082 O  O     . HOH U 5 .  ? 25.504 131.781 44.146 1.00 26.98  ? 608 HOH F O     1 
HETATM 6083 O  O     . HOH U 5 .  ? 44.281 121.684 51.030 1.00 44.55  ? 609 HOH F O     1 
HETATM 6084 O  O     . HOH U 5 .  ? 30.661 131.379 44.968 1.00 52.26  ? 610 HOH F O     1 
HETATM 6085 O  O     . HOH U 5 .  ? 34.571 113.333 28.452 1.00 62.98  ? 611 HOH F O     1 
HETATM 6086 O  O     . HOH U 5 .  ? 32.922 135.611 45.497 1.00 58.38  ? 612 HOH F O     1 
HETATM 6087 O  O     . HOH U 5 .  ? 41.013 116.253 29.142 1.00 54.86  ? 613 HOH F O     1 
HETATM 6088 O  O     . HOH U 5 .  ? 19.220 123.224 47.036 1.00 52.18  ? 614 HOH F O     1 
HETATM 6089 O  O     . HOH U 5 .  ? 14.382 132.705 45.814 1.00 37.23  ? 615 HOH F O     1 
HETATM 6090 O  O     . HOH U 5 .  ? 13.473 125.688 59.710 1.00 47.96  ? 616 HOH F O     1 
HETATM 6091 O  O     . HOH U 5 .  ? 34.735 121.366 55.908 1.00 24.27  ? 617 HOH F O     1 
HETATM 6092 O  O     . HOH U 5 .  ? 35.846 119.623 59.992 1.00 53.32  ? 618 HOH F O     1 
HETATM 6093 O  O     . HOH U 5 .  ? 41.564 121.273 54.036 1.00 54.13  ? 619 HOH F O     1 
HETATM 6094 O  O     . HOH U 5 .  ? 45.260 111.138 39.072 1.00 60.84  ? 620 HOH F O     1 
HETATM 6095 O  O     . HOH U 5 .  ? 31.869 111.156 33.711 1.00 36.50  ? 621 HOH F O     1 
HETATM 6096 O  O     . HOH U 5 .  ? 50.622 123.547 33.681 1.00 66.58  ? 622 HOH F O     1 
HETATM 6097 O  O     . HOH U 5 .  ? 21.647 122.101 45.986 1.00 56.94  ? 623 HOH F O     1 
HETATM 6098 O  O     . HOH U 5 .  ? 41.264 113.602 52.603 1.00 55.28  ? 624 HOH F O     1 
HETATM 6099 O  O     . HOH U 5 .  ? 31.161 114.173 51.558 1.00 43.56  ? 625 HOH F O     1 
HETATM 6100 O  O     . HOH U 5 .  ? 33.519 120.243 58.398 1.00 25.79  ? 626 HOH F O     1 
HETATM 6101 O  O     . HOH U 5 .  ? 32.002 117.937 57.911 1.00 43.43  ? 627 HOH F O     1 
HETATM 6102 O  O     . HOH U 5 .  ? 27.894 116.149 48.283 1.00 45.99  ? 628 HOH F O     1 
HETATM 6103 O  O     . HOH U 5 .  ? 28.368 115.817 58.240 1.00 52.11  ? 629 HOH F O     1 
HETATM 6104 O  O     . HOH U 5 .  ? 37.384 121.057 56.177 1.00 30.44  ? 630 HOH F O     1 
HETATM 6105 O  O     . HOH U 5 .  ? 38.476 120.303 58.488 1.00 64.45  ? 631 HOH F O     1 
HETATM 6106 O  O     . HOH U 5 .  ? 42.742 123.566 54.352 1.00 50.17  ? 632 HOH F O     1 
HETATM 6107 O  O     . HOH U 5 .  ? 45.621 120.104 53.471 1.00 67.17  ? 633 HOH F O     1 
HETATM 6108 O  O     . HOH U 5 .  ? 51.678 120.373 34.369 1.00 62.69  ? 634 HOH F O     1 
HETATM 6109 O  O     . HOH U 5 .  ? 42.824 109.975 46.887 1.00 59.19  ? 635 HOH F O     1 
HETATM 6110 O  O     . HOH U 5 .  ? 33.461 116.068 29.451 1.00 63.57  ? 636 HOH F O     1 
HETATM 6111 O  O     . HOH U 5 .  ? 31.928 116.681 33.306 1.00 64.11  ? 637 HOH F O     1 
HETATM 6112 O  O     . HOH U 5 .  ? 32.620 110.509 30.609 1.00 59.89  ? 638 HOH F O     1 
HETATM 6113 O  O     . HOH U 5 .  ? 23.750 117.595 36.790 1.00 64.71  ? 639 HOH F O     1 
HETATM 6114 O  O     . HOH U 5 .  ? 33.551 112.883 52.203 1.00 67.32  ? 640 HOH F O     1 
HETATM 6115 O  O     . HOH V 5 .  ? 29.384 137.857 48.625 1.00 24.29  ? 605 HOH G O     1 
HETATM 6116 O  O     . HOH V 5 .  ? 33.558 132.882 59.112 1.00 17.50  ? 606 HOH G O     1 
HETATM 6117 O  O     . HOH V 5 .  ? 28.679 136.545 52.812 1.00 17.36  ? 607 HOH G O     1 
HETATM 6118 O  O     . HOH V 5 .  ? 32.342 134.214 53.612 1.00 17.87  ? 608 HOH G O     1 
HETATM 6119 O  O     . HOH V 5 .  ? 36.791 131.559 61.141 1.00 26.75  ? 609 HOH G O     1 
HETATM 6120 O  O     . HOH V 5 .  ? 31.140 121.785 59.543 1.00 27.87  ? 610 HOH G O     1 
HETATM 6121 O  O     . HOH V 5 .  ? 43.902 124.302 51.803 1.00 26.28  ? 611 HOH G O     1 
HETATM 6122 O  O     . HOH V 5 .  ? 35.793 127.142 62.204 1.00 30.18  ? 612 HOH G O     1 
HETATM 6123 O  O     . HOH V 5 .  ? 41.092 130.733 51.614 1.00 37.42  ? 613 HOH G O     1 
HETATM 6124 O  O     . HOH V 5 .  ? 38.206 122.584 60.536 1.00 44.15  ? 614 HOH G O     1 
HETATM 6125 O  O     . HOH V 5 .  ? 28.558 139.498 54.767 1.00 27.61  ? 615 HOH G O     1 
HETATM 6126 O  O     . HOH V 5 .  ? 30.979 125.232 37.759 1.00 32.86  ? 616 HOH G O     1 
HETATM 6127 O  O     . HOH V 5 .  ? 28.081 128.543 64.388 1.00 26.09  ? 617 HOH G O     1 
HETATM 6128 O  O     . HOH V 5 .  ? 18.724 135.442 60.498 1.00 53.59  ? 618 HOH G O     1 
HETATM 6129 O  O     . HOH V 5 .  ? 21.677 144.718 52.664 1.00 30.92  ? 619 HOH G O     1 
HETATM 6130 O  O     . HOH V 5 .  ? 23.889 127.780 66.098 1.00 52.38  ? 620 HOH G O     1 
HETATM 6131 O  O     . HOH V 5 .  ? 28.460 125.979 62.696 1.00 33.05  ? 621 HOH G O     1 
HETATM 6132 O  O     . HOH V 5 .  ? 47.120 132.638 46.176 1.00 76.97  ? 622 HOH G O     1 
HETATM 6133 O  O     . HOH V 5 .  ? 13.127 139.223 55.242 1.00 51.99  ? 623 HOH G O     1 
HETATM 6134 O  O     . HOH V 5 .  ? 15.113 142.754 49.088 1.00 46.53  ? 624 HOH G O     1 
HETATM 6135 O  O     . HOH V 5 .  ? 13.016 128.997 58.001 1.00 64.17  ? 625 HOH G O     1 
HETATM 6136 O  O     . HOH V 5 .  ? 38.863 121.807 53.720 1.00 24.28  ? 626 HOH G O     1 
HETATM 6137 O  O     . HOH V 5 .  ? 29.987 117.322 37.293 1.00 45.16  ? 627 HOH G O     1 
HETATM 6138 O  O     . HOH V 5 .  ? 31.131 124.512 41.457 1.00 49.01  ? 628 HOH G O     1 
HETATM 6139 O  O     . HOH V 5 .  ? 38.135 132.645 41.888 1.00 62.24  ? 629 HOH G O     1 
HETATM 6140 O  O     . HOH V 5 .  ? 44.513 130.705 41.083 1.00 45.68  ? 630 HOH G O     1 
HETATM 6141 O  O     . HOH V 5 .  ? 22.061 140.211 62.691 1.00 62.98  ? 631 HOH G O     1 
HETATM 6142 O  O     . HOH V 5 .  ? 24.817 138.646 64.547 1.00 51.14  ? 632 HOH G O     1 
HETATM 6143 O  O     . HOH V 5 .  ? 20.780 144.988 57.400 1.00 61.37  ? 633 HOH G O     1 
HETATM 6144 O  O     . HOH V 5 .  ? 14.262 137.609 42.632 1.00 41.88  ? 634 HOH G O     1 
HETATM 6145 O  O     . HOH V 5 .  ? 47.007 131.971 41.088 1.00 60.63  ? 635 HOH G O     1 
HETATM 6146 O  O     . HOH V 5 .  ? 30.008 138.693 51.418 1.00 42.17  ? 636 HOH G O     1 
HETATM 6147 O  O     . HOH V 5 .  ? 28.113 123.548 63.413 1.00 55.21  ? 637 HOH G O     1 
HETATM 6148 O  O     . HOH V 5 .  ? 28.854 120.572 59.894 1.00 54.34  ? 638 HOH G O     1 
HETATM 6149 O  O     . HOH V 5 .  ? 39.922 127.989 62.067 1.00 59.36  ? 639 HOH G O     1 
HETATM 6150 O  O     . HOH V 5 .  ? 17.294 133.565 61.658 1.00 65.61  ? 640 HOH G O     1 
HETATM 6151 O  O     . HOH V 5 .  ? 24.858 136.055 65.373 1.00 67.70  ? 641 HOH G O     1 
HETATM 6152 O  O     . HOH V 5 .  ? 25.435 140.079 48.905 1.00 64.38  ? 642 HOH G O     1 
HETATM 6153 O  O     . HOH V 5 .  ? 30.052 140.977 52.741 1.00 49.40  ? 643 HOH G O     1 
HETATM 6154 O  O     . HOH W 5 .  ? 21.401 43.411  38.779 1.00 25.83  ? 68  HOH H O     1 
HETATM 6155 O  O     . HOH W 5 .  ? 26.245 38.512  49.224 1.00 19.34  ? 75  HOH H O     1 
HETATM 6156 O  O     . HOH W 5 .  ? 20.828 53.163  44.480 1.00 30.85  ? 97  HOH H O     1 
HETATM 6157 O  O     . HOH W 5 .  ? 26.744 40.780  45.536 1.00 21.70  ? 98  HOH H O     1 
HETATM 6158 O  O     . HOH W 5 .  ? 32.616 50.649  35.337 1.00 26.59  ? 110 HOH H O     1 
HETATM 6159 O  O     . HOH W 5 .  ? 19.986 47.909  39.231 1.00 27.26  ? 129 HOH H O     1 
HETATM 6160 O  O     . HOH W 5 .  ? 22.655 52.322  37.467 1.00 37.14  ? 133 HOH H O     1 
HETATM 6161 O  O     . HOH W 5 .  ? 31.793 44.246  38.073 1.00 48.99  ? 169 HOH H O     1 
HETATM 6162 O  O     . HOH W 5 .  ? 41.180 49.919  52.405 1.00 36.21  ? 183 HOH H O     1 
HETATM 6163 O  O     . HOH W 5 .  ? 16.924 49.007  45.941 1.00 42.59  ? 187 HOH H O     1 
HETATM 6164 O  O     . HOH W 5 .  ? 24.350 35.544  48.613 1.00 29.59  ? 201 HOH H O     1 
HETATM 6165 O  O     . HOH W 5 .  ? 15.217 46.561  45.585 1.00 27.35  ? 205 HOH H O     1 
HETATM 6166 O  O     . HOH W 5 .  ? 15.492 39.465  55.817 1.00 52.36  ? 208 HOH H O     1 
HETATM 6167 O  O     . HOH W 5 .  ? 37.798 45.536  34.699 1.00 47.01  ? 220 HOH H O     1 
HETATM 6168 O  O     . HOH W 5 .  ? 47.002 45.356  32.315 1.00 52.02  ? 267 HOH H O     1 
HETATM 6169 O  O     . HOH W 5 .  ? 19.193 30.022  54.838 1.00 69.68  ? 271 HOH H O     1 
HETATM 6170 O  O     . HOH W 5 .  ? 13.741 36.424  48.679 1.00 49.39  ? 274 HOH H O     1 
HETATM 6171 O  O     . HOH W 5 .  ? 41.012 57.671  53.609 1.00 52.80  ? 312 HOH H O     1 
HETATM 6172 O  O     . HOH W 5 .  ? 40.691 47.016  52.568 1.00 60.94  ? 313 HOH H O     1 
HETATM 6173 O  O     . HOH W 5 .  ? 39.673 42.563  45.134 1.00 39.70  ? 314 HOH H O     1 
HETATM 6174 O  O     . HOH W 5 .  ? 42.762 44.365  38.908 1.00 49.35  ? 315 HOH H O     1 
HETATM 6175 O  O     . HOH W 5 .  ? 39.684 50.183  32.769 1.00 58.16  ? 318 HOH H O     1 
HETATM 6176 O  O     . HOH W 5 .  ? 29.004 53.219  39.399 1.00 22.07  ? 319 HOH H O     1 
HETATM 6177 O  O     . HOH W 5 .  ? 14.329 43.854  60.551 1.00 56.06  ? 327 HOH H O     1 
HETATM 6178 O  O     . HOH W 5 .  ? 24.587 32.201  63.253 1.00 42.68  ? 328 HOH H O     1 
HETATM 6179 O  O     . HOH W 5 .  ? 18.211 35.823  63.036 1.00 62.30  ? 329 HOH H O     1 
HETATM 6180 O  O     . HOH W 5 .  ? 28.213 30.110  65.245 1.00 60.88  ? 330 HOH H O     1 
HETATM 6181 O  O     . HOH W 5 .  ? 30.703 37.305  66.399 1.00 45.60  ? 332 HOH H O     1 
HETATM 6182 O  O     . HOH W 5 .  ? 29.624 25.600  62.273 1.00 51.92  ? 333 HOH H O     1 
HETATM 6183 O  O     . HOH W 5 .  ? 21.841 32.124  62.424 1.00 72.28  ? 334 HOH H O     1 
HETATM 6184 O  O     . HOH W 5 .  ? 15.718 46.006  61.982 1.00 58.58  ? 336 HOH H O     1 
HETATM 6185 O  O     . HOH W 5 .  ? 38.708 40.766  54.288 1.00 72.63  ? 339 HOH H O     1 
HETATM 6186 O  O     . HOH W 5 .  ? 35.189 60.962  42.101 1.00 63.51  ? 374 HOH H O     1 
HETATM 6187 O  O     . HOH W 5 .  ? 12.179 46.997  48.787 1.00 58.68  ? 390 HOH H O     1 
HETATM 6188 O  O     . HOH W 5 .  ? 23.835 30.137  55.832 1.00 32.22  ? 394 HOH H O     1 
HETATM 6189 O  O     . HOH W 5 .  ? 18.016 35.231  60.134 1.00 60.37  ? 397 HOH H O     1 
HETATM 6190 O  O     . HOH W 5 .  ? 37.091 49.473  52.618 1.00 62.59  ? 449 HOH H O     1 
HETATM 6191 O  O     . HOH W 5 .  ? 40.791 50.880  54.912 1.00 52.19  ? 451 HOH H O     1 
HETATM 6192 O  O     . HOH W 5 .  ? 39.969 56.504  55.950 1.00 65.24  ? 452 HOH H O     1 
HETATM 6193 O  O     . HOH W 5 .  ? 39.953 43.633  38.401 1.00 56.87  ? 455 HOH H O     1 
HETATM 6194 O  O     . HOH W 5 .  ? 38.479 47.271  32.105 1.00 64.01  ? 458 HOH H O     1 
HETATM 6195 O  O     . HOH W 5 .  ? 43.720 43.210  35.651 1.00 62.95  ? 459 HOH H O     1 
HETATM 6196 O  O     . HOH W 5 .  ? 19.956 54.463  46.506 1.00 39.20  ? 469 HOH H O     1 
HETATM 6197 O  O     . HOH W 5 .  ? 21.578 47.075  35.362 1.00 61.86  ? 473 HOH H O     1 
HETATM 6198 O  O     . HOH W 5 .  ? 18.067 53.513  41.320 1.00 58.74  ? 476 HOH H O     1 
HETATM 6199 O  O     . HOH W 5 .  ? 16.213 51.488  45.904 1.00 55.37  ? 477 HOH H O     1 
HETATM 6200 O  O     . HOH W 5 .  ? 17.692 54.982  47.664 1.00 58.78  ? 478 HOH H O     1 
HETATM 6201 O  O     . HOH W 5 .  ? 12.588 48.078  46.297 1.00 68.63  ? 479 HOH H O     1 
HETATM 6202 O  O     . HOH W 5 .  ? 28.038 36.309  48.398 1.00 35.77  ? 481 HOH H O     1 
HETATM 6203 O  O     . HOH W 5 .  ? 26.828 34.078  47.904 1.00 41.55  ? 482 HOH H O     1 
HETATM 6204 O  O     . HOH W 5 .  ? 14.025 41.445  56.715 1.00 71.29  ? 483 HOH H O     1 
HETATM 6205 O  O     . HOH W 5 .  ? 15.597 33.125  51.820 1.00 67.19  ? 485 HOH H O     1 
HETATM 6206 O  O     . HOH W 5 .  ? 31.441 27.192  63.488 1.00 47.36  ? 490 HOH H O     1 
HETATM 6207 O  O     . HOH W 5 .  ? 23.032 32.451  66.324 1.00 70.59  ? 492 HOH H O     1 
HETATM 6208 O  O     . HOH X 5 .  ? 30.281 37.211  50.116 1.00 25.31  ? 604 HOH I O     1 
HETATM 6209 O  O     . HOH X 5 .  ? 41.385 59.603  49.077 1.00 19.46  ? 605 HOH I O     1 
HETATM 6210 O  O     . HOH X 5 .  ? 29.102 40.284  44.291 1.00 25.50  ? 606 HOH I O     1 
HETATM 6211 O  O     . HOH X 5 .  ? 27.732 59.208  49.636 1.00 26.74  ? 607 HOH I O     1 
HETATM 6212 O  O     . HOH X 5 .  ? 21.903 56.336  46.790 1.00 26.75  ? 608 HOH I O     1 
HETATM 6213 O  O     . HOH X 5 .  ? 32.017 43.639  43.448 1.00 31.32  ? 609 HOH I O     1 
HETATM 6214 O  O     . HOH X 5 .  ? 42.732 62.942  48.860 1.00 24.98  ? 610 HOH I O     1 
HETATM 6215 O  O     . HOH X 5 .  ? 33.186 43.251  55.320 1.00 25.65  ? 611 HOH I O     1 
HETATM 6216 O  O     . HOH X 5 .  ? 34.425 43.649  50.032 1.00 55.79  ? 612 HOH I O     1 
HETATM 6217 O  O     . HOH X 5 .  ? 51.141 61.799  52.357 1.00 66.77  ? 613 HOH I O     1 
HETATM 6218 O  O     . HOH X 5 .  ? 33.335 53.277  35.193 1.00 50.19  ? 614 HOH I O     1 
HETATM 6219 O  O     . HOH X 5 .  ? 30.261 52.976  58.322 1.00 42.51  ? 615 HOH I O     1 
HETATM 6220 O  O     . HOH X 5 .  ? 34.400 39.430  47.881 1.00 60.99  ? 616 HOH I O     1 
HETATM 6221 O  O     . HOH X 5 .  ? 28.280 51.808  60.141 1.00 48.95  ? 617 HOH I O     1 
HETATM 6222 O  O     . HOH X 5 .  ? 54.098 48.074  33.585 1.00 65.24  ? 618 HOH I O     1 
HETATM 6223 O  O     . HOH X 5 .  ? 51.448 55.178  37.267 1.00 51.80  ? 619 HOH I O     1 
HETATM 6224 O  O     . HOH X 5 .  ? 25.443 53.676  42.382 1.00 28.78  ? 620 HOH I O     1 
HETATM 6225 O  O     . HOH X 5 .  ? 21.794 55.361  39.948 1.00 53.07  ? 621 HOH I O     1 
HETATM 6226 O  O     . HOH X 5 .  ? 27.815 42.380  65.107 1.00 29.45  ? 622 HOH I O     1 
HETATM 6227 O  O     . HOH X 5 .  ? 14.402 49.264  61.133 1.00 50.95  ? 623 HOH I O     1 
HETATM 6228 O  O     . HOH X 5 .  ? 21.364 50.534  66.107 1.00 63.66  ? 624 HOH I O     1 
HETATM 6229 O  O     . HOH X 5 .  ? 32.485 45.385  51.901 1.00 51.64  ? 625 HOH I O     1 
HETATM 6230 O  O     . HOH X 5 .  ? 32.379 49.253  66.329 1.00 75.07  ? 626 HOH I O     1 
HETATM 6231 O  O     . HOH X 5 .  ? 45.012 63.971  38.455 1.00 65.12  ? 627 HOH I O     1 
HETATM 6232 O  O     . HOH X 5 .  ? 49.489 58.484  53.123 1.00 63.94  ? 628 HOH I O     1 
HETATM 6233 O  O     . HOH X 5 .  ? 30.853 61.327  37.358 1.00 48.80  ? 629 HOH I O     1 
HETATM 6234 O  O     . HOH X 5 .  ? 31.795 61.871  47.730 1.00 55.43  ? 630 HOH I O     1 
HETATM 6235 O  O     . HOH X 5 .  ? 24.732 62.201  46.825 1.00 64.26  ? 631 HOH I O     1 
HETATM 6236 O  O     . HOH X 5 .  ? 31.667 42.266  40.803 1.00 42.05  ? 632 HOH I O     1 
HETATM 6237 O  O     . HOH X 5 .  ? 30.172 58.838  51.572 1.00 59.04  ? 633 HOH I O     1 
HETATM 6238 O  O     . HOH X 5 .  ? 35.238 45.352  52.136 1.00 69.90  ? 634 HOH I O     1 
HETATM 6239 O  O     . HOH X 5 .  ? 29.688 53.757  36.735 1.00 52.56  ? 635 HOH I O     1 
HETATM 6240 O  O     . HOH X 5 .  ? 29.821 51.443  35.540 1.00 52.10  ? 636 HOH I O     1 
HETATM 6241 O  O     . HOH X 5 .  ? 26.205 54.087  39.982 1.00 34.91  ? 637 HOH I O     1 
HETATM 6242 O  O     . HOH X 5 .  ? 22.785 54.802  42.689 1.00 26.82  ? 638 HOH I O     1 
HETATM 6243 O  O     . HOH X 5 .  ? 22.668 57.032  44.249 1.00 28.25  ? 639 HOH I O     1 
HETATM 6244 O  O     . HOH X 5 .  ? 24.450 54.701  38.002 1.00 66.30  ? 640 HOH I O     1 
HETATM 6245 O  O     . HOH X 5 .  ? 20.944 59.222  47.470 1.00 54.52  ? 641 HOH I O     1 
HETATM 6246 O  O     . HOH X 5 .  ? 22.890 59.775  50.539 1.00 64.14  ? 642 HOH I O     1 
HETATM 6247 O  O     . HOH X 5 .  ? 35.431 43.066  53.556 1.00 67.41  ? 643 HOH I O     1 
HETATM 6248 O  O     . HOH X 5 .  ? 38.339 41.765  58.992 1.00 71.70  ? 644 HOH I O     1 
HETATM 6249 O  O     . HOH X 5 .  ? 25.887 53.491  60.553 1.00 71.73  ? 645 HOH I O     1 
HETATM 6250 O  O     . HOH X 5 .  ? 28.386 61.008  47.411 1.00 52.94  ? 646 HOH I O     1 
HETATM 6251 O  O     . HOH X 5 .  ? 28.385 62.023  44.984 1.00 64.92  ? 647 HOH I O     1 
HETATM 6252 O  O     . HOH X 5 .  ? 17.354 54.648  53.770 1.00 60.23  ? 648 HOH I O     1 
HETATM 6253 O  O     . HOH Y 5 .  ? 44.705 94.743  26.974 1.00 16.42  ? 606 HOH J O     1 
HETATM 6254 O  O     . HOH Y 5 .  ? 39.530 98.928  30.547 1.00 12.46  ? 607 HOH J O     1 
HETATM 6255 O  O     . HOH Y 5 .  ? 27.462 99.761  37.272 1.00 18.36  ? 608 HOH J O     1 
HETATM 6256 O  O     . HOH Y 5 .  ? 23.245 94.378  34.680 1.00 16.42  ? 609 HOH J O     1 
HETATM 6257 O  O     . HOH Y 5 .  ? 21.511 104.280 20.802 1.00 16.78  ? 610 HOH J O     1 
HETATM 6258 O  O     . HOH Y 5 .  ? 38.775 101.656 32.722 1.00 15.74  ? 611 HOH J O     1 
HETATM 6259 O  O     . HOH Y 5 .  ? 22.346 95.952  26.324 1.00 24.91  ? 612 HOH J O     1 
HETATM 6260 O  O     . HOH Y 5 .  ? 23.199 89.862  35.824 1.00 25.09  ? 613 HOH J O     1 
HETATM 6261 O  O     . HOH Y 5 .  ? 19.147 100.185 15.953 1.00 19.84  ? 614 HOH J O     1 
HETATM 6262 O  O     . HOH Y 5 .  ? 26.975 104.841 24.161 1.00 20.88  ? 615 HOH J O     1 
HETATM 6263 O  O     . HOH Y 5 .  ? 26.053 89.649  16.952 1.00 26.19  ? 616 HOH J O     1 
HETATM 6264 O  O     . HOH Y 5 .  ? 40.489 82.538  34.359 1.00 19.84  ? 617 HOH J O     1 
HETATM 6265 O  O     . HOH Y 5 .  ? 20.950 96.118  16.499 1.00 25.34  ? 618 HOH J O     1 
HETATM 6266 O  O     . HOH Y 5 .  ? 27.511 85.732  24.572 1.00 19.16  ? 619 HOH J O     1 
HETATM 6267 O  O     . HOH Y 5 .  ? 40.115 92.914  21.690 1.00 26.28  ? 620 HOH J O     1 
HETATM 6268 O  O     . HOH Y 5 .  ? 35.964 76.834  40.463 1.00 27.88  ? 621 HOH J O     1 
HETATM 6269 O  O     . HOH Y 5 .  ? 36.066 87.739  39.361 1.00 25.62  ? 622 HOH J O     1 
HETATM 6270 O  O     . HOH Y 5 .  ? 34.004 96.769  39.665 1.00 19.88  ? 623 HOH J O     1 
HETATM 6271 O  O     . HOH Y 5 .  ? 23.083 90.117  16.815 1.00 47.58  ? 624 HOH J O     1 
HETATM 6272 O  O     . HOH Y 5 .  ? 35.091 77.928  38.154 1.00 35.44  ? 625 HOH J O     1 
HETATM 6273 O  O     . HOH Y 5 .  ? 30.756 86.991  20.928 1.00 25.01  ? 626 HOH J O     1 
HETATM 6274 O  O     . HOH Y 5 .  ? 42.669 99.177  27.219 1.00 27.03  ? 627 HOH J O     1 
HETATM 6275 O  O     . HOH Y 5 .  ? 28.971 88.773  43.647 1.00 32.04  ? 628 HOH J O     1 
HETATM 6276 O  O     . HOH Y 5 .  ? 19.659 93.385  15.641 1.00 32.44  ? 629 HOH J O     1 
HETATM 6277 O  O     . HOH Y 5 .  ? 37.519 104.935 24.412 1.00 33.48  ? 630 HOH J O     1 
HETATM 6278 O  O     . HOH Y 5 .  ? 25.219 87.815  38.808 1.00 26.24  ? 631 HOH J O     1 
HETATM 6279 O  O     . HOH Y 5 .  ? 30.752 96.959  16.753 1.00 26.10  ? 632 HOH J O     1 
HETATM 6280 O  O     . HOH Y 5 .  ? 31.283 84.745  44.053 1.00 27.29  ? 633 HOH J O     1 
HETATM 6281 O  O     . HOH Y 5 .  ? 34.805 82.405  24.037 1.00 24.89  ? 634 HOH J O     1 
HETATM 6282 O  O     . HOH Y 5 .  ? 28.042 81.763  29.773 1.00 24.35  ? 635 HOH J O     1 
HETATM 6283 O  O     . HOH Y 5 .  ? 46.961 87.492  34.680 1.00 46.72  ? 636 HOH J O     1 
HETATM 6284 O  O     . HOH Y 5 .  ? 33.169 106.909 19.788 1.00 44.22  ? 637 HOH J O     1 
HETATM 6285 O  O     . HOH Y 5 .  ? 14.665 99.985  22.751 1.00 32.71  ? 638 HOH J O     1 
HETATM 6286 O  O     . HOH Y 5 .  ? 13.890 102.535 21.526 1.00 31.70  ? 639 HOH J O     1 
HETATM 6287 O  O     . HOH Y 5 .  ? 37.648 92.094  38.408 1.00 36.57  ? 640 HOH J O     1 
HETATM 6288 O  O     . HOH Y 5 .  ? 39.313 92.156  33.843 1.00 47.78  ? 641 HOH J O     1 
HETATM 6289 O  O     . HOH Y 5 .  ? 18.822 94.419  21.809 1.00 27.29  ? 642 HOH J O     1 
HETATM 6290 O  O     . HOH Y 5 .  ? 20.996 87.001  26.973 1.00 26.48  ? 643 HOH J O     1 
HETATM 6291 O  O     . HOH Y 5 .  ? 31.892 90.521  44.541 1.00 55.29  ? 644 HOH J O     1 
HETATM 6292 O  O     . HOH Y 5 .  ? 23.554 85.600  26.986 1.00 33.10  ? 645 HOH J O     1 
HETATM 6293 O  O     . HOH Y 5 .  ? 41.197 90.216  33.490 1.00 33.64  ? 646 HOH J O     1 
HETATM 6294 O  O     . HOH Y 5 .  ? 48.548 90.256  27.519 1.00 44.80  ? 647 HOH J O     1 
HETATM 6295 O  O     . HOH Y 5 .  ? 37.091 87.784  41.720 1.00 59.21  ? 648 HOH J O     1 
HETATM 6296 O  O     . HOH Y 5 .  ? 21.979 84.781  30.770 1.00 54.94  ? 649 HOH J O     1 
HETATM 6297 O  O     . HOH Y 5 .  ? 40.047 80.439  29.919 1.00 47.74  ? 650 HOH J O     1 
HETATM 6298 O  O     . HOH Y 5 .  ? 46.031 80.292  39.815 1.00 26.00  ? 651 HOH J O     1 
HETATM 6299 O  O     . HOH Y 5 .  ? 42.897 77.366  39.740 1.00 14.72  ? 652 HOH J O     1 
HETATM 6300 O  O     . HOH Y 5 .  ? 29.976 85.100  37.786 1.00 25.22  ? 653 HOH J O     1 
HETATM 6301 O  O     . HOH Y 5 .  ? 40.860 100.726 29.002 1.00 26.30  ? 654 HOH J O     1 
HETATM 6302 O  O     . HOH Y 5 .  ? 31.999 108.459 28.230 1.00 65.10  ? 655 HOH J O     1 
HETATM 6303 O  O     . HOH Y 5 .  ? 27.093 81.398  27.159 1.00 38.87  ? 656 HOH J O     1 
HETATM 6304 O  O     . HOH Y 5 .  ? 20.485 85.901  23.224 1.00 61.02  ? 657 HOH J O     1 
HETATM 6305 O  O     . HOH Y 5 .  ? 29.704 101.687 16.248 1.00 61.80  ? 658 HOH J O     1 
HETATM 6306 O  O     . HOH Y 5 .  ? 18.471 94.624  24.823 1.00 30.64  ? 659 HOH J O     1 
HETATM 6307 O  O     . HOH Y 5 .  ? 42.706 85.341  40.492 1.00 25.29  ? 660 HOH J O     1 
HETATM 6308 O  O     . HOH Y 5 .  ? 36.475 78.071  30.010 1.00 51.56  ? 661 HOH J O     1 
HETATM 6309 O  O     . HOH Y 5 .  ? 32.692 77.615  29.246 1.00 51.18  ? 662 HOH J O     1 
HETATM 6310 O  O     . HOH Y 5 .  ? 38.019 79.692  27.122 1.00 49.82  ? 663 HOH J O     1 
HETATM 6311 O  O     . HOH Y 5 .  ? 35.677 90.713  44.748 1.00 45.39  ? 664 HOH J O     1 
HETATM 6312 O  O     . HOH Y 5 .  ? 32.252 84.524  20.718 1.00 42.45  ? 665 HOH J O     1 
HETATM 6313 O  O     . HOH Y 5 .  ? 32.323 82.208  22.695 1.00 49.22  ? 666 HOH J O     1 
HETATM 6314 O  O     . HOH Y 5 .  ? 32.561 89.426  13.185 1.00 70.57  ? 667 HOH J O     1 
HETATM 6315 O  O     . HOH Y 5 .  ? 24.227 85.500  22.580 1.00 64.71  ? 668 HOH J O     1 
HETATM 6316 O  O     . HOH Y 5 .  ? 38.038 106.871 28.176 1.00 67.49  ? 669 HOH J O     1 
HETATM 6317 O  O     . HOH Y 5 .  ? 34.619 107.876 15.689 1.00 64.45  ? 670 HOH J O     1 
HETATM 6318 O  O     . HOH Y 5 .  ? 46.248 86.197  37.897 1.00 38.85  ? 671 HOH J O     1 
HETATM 6319 O  O     . HOH Y 5 .  ? 22.042 90.870  19.680 1.00 51.70  ? 672 HOH J O     1 
HETATM 6320 O  O     . HOH Y 5 .  ? 30.374 106.767 25.651 1.00 29.75  ? 673 HOH J O     1 
HETATM 6321 O  O     . HOH Y 5 .  ? 25.543 93.104  39.071 1.00 25.14  ? 674 HOH J O     1 
HETATM 6322 O  O     . HOH Y 5 .  ? 27.254 85.176  36.754 1.00 27.52  ? 675 HOH J O     1 
HETATM 6323 O  O     . HOH Y 5 .  ? 26.110 85.288  39.761 1.00 63.35  ? 676 HOH J O     1 
HETATM 6324 O  O     . HOH Y 5 .  ? 29.966 107.769 31.135 1.00 52.67  ? 677 HOH J O     1 
HETATM 6325 O  O     . HOH Y 5 .  ? 28.320 107.256 27.581 1.00 57.65  ? 678 HOH J O     1 
HETATM 6326 O  O     . HOH Y 5 .  ? 28.916 82.853  18.180 1.00 62.92  ? 679 HOH J O     1 
HETATM 6327 O  O     . HOH Y 5 .  ? 28.735 85.831  22.109 1.00 26.27  ? 680 HOH J O     1 
HETATM 6328 O  O     . HOH Y 5 .  ? 15.055 101.037 25.412 1.00 57.17  ? 681 HOH J O     1 
HETATM 6329 O  O     . HOH Y 5 .  ? 28.869 107.002 23.027 1.00 59.32  ? 682 HOH J O     1 
HETATM 6330 O  O     . HOH Y 5 .  ? 33.976 101.316 13.488 1.00 52.22  ? 683 HOH J O     1 
HETATM 6331 O  O     . HOH Y 5 .  ? 20.362 90.929  11.891 1.00 72.26  ? 684 HOH J O     1 
HETATM 6332 O  O     . HOH Y 5 .  ? 44.056 83.856  31.040 1.00 39.73  ? 685 HOH J O     1 
HETATM 6333 O  O     . HOH Y 5 .  ? 36.159 90.484  39.878 1.00 26.45  ? 686 HOH J O     1 
HETATM 6334 O  O     . HOH Y 5 .  ? 37.130 90.474  42.466 1.00 26.29  ? 687 HOH J O     1 
HETATM 6335 O  O     . HOH Y 5 .  ? 38.737 84.600  44.996 1.00 26.01  ? 688 HOH J O     1 
HETATM 6336 O  O     . HOH Y 5 .  ? 38.123 77.369  32.084 1.00 59.18  ? 689 HOH J O     1 
HETATM 6337 O  O     . HOH Y 5 .  ? 44.180 84.458  28.262 1.00 50.50  ? 690 HOH J O     1 
HETATM 6338 O  O     . HOH Y 5 .  ? 33.933 82.838  45.332 1.00 62.84  ? 691 HOH J O     1 
HETATM 6339 O  O     . HOH Y 5 .  ? 36.088 84.440  45.626 1.00 50.56  ? 692 HOH J O     1 
HETATM 6340 O  O     . HOH Y 5 .  ? 34.860 91.883  47.175 1.00 60.19  ? 693 HOH J O     1 
HETATM 6341 O  O     . HOH Y 5 .  ? 28.750 81.875  35.877 1.00 59.92  ? 694 HOH J O     1 
HETATM 6342 O  O     . HOH Y 5 .  ? 41.802 81.811  31.283 1.00 54.29  ? 695 HOH J O     1 
HETATM 6343 O  O     . HOH Y 5 .  ? 42.402 89.716  23.218 1.00 69.94  ? 696 HOH J O     1 
HETATM 6344 O  O     . HOH Y 5 .  ? 47.521 85.525  26.319 1.00 64.16  ? 697 HOH J O     1 
HETATM 6345 O  O     . HOH Y 5 .  ? 45.266 93.124  22.548 1.00 66.75  ? 698 HOH J O     1 
HETATM 6346 O  O     . HOH Y 5 .  ? 31.782 83.248  18.361 1.00 66.32  ? 699 HOH J O     1 
HETATM 6347 O  O     . HOH Y 5 .  ? 26.172 85.862  33.684 1.00 56.29  ? 700 HOH J O     1 
HETATM 6348 O  O     . HOH Y 5 .  ? 20.153 95.066  27.140 1.00 26.31  ? 701 HOH J O     1 
HETATM 6349 O  O     . HOH Y 5 .  ? 19.496 90.498  26.827 1.00 43.07  ? 702 HOH J O     1 
HETATM 6350 O  O     . HOH Y 5 .  ? 25.084 84.546  24.943 1.00 47.93  ? 703 HOH J O     1 
HETATM 6351 O  O     . HOH Y 5 .  ? 17.659 96.106  27.858 1.00 46.99  ? 704 HOH J O     1 
HETATM 6352 O  O     . HOH Y 5 .  ? 35.256 79.557  24.802 1.00 63.68  ? 705 HOH J O     1 
HETATM 6353 O  O     . HOH Y 5 .  ? 26.568 85.729  20.310 1.00 48.66  ? 706 HOH J O     1 
HETATM 6354 O  O     . HOH Y 5 .  ? 16.320 94.303  17.570 1.00 42.61  ? 707 HOH J O     1 
HETATM 6355 O  O     . HOH Y 5 .  ? 22.446 85.967  34.662 1.00 67.35  ? 708 HOH J O     1 
HETATM 6356 O  O     . HOH Y 5 .  ? 25.448 90.636  40.203 1.00 58.00  ? 709 HOH J O     1 
HETATM 6357 O  O     . HOH Y 5 .  ? 22.928 93.126  37.164 1.00 59.64  ? 710 HOH J O     1 
HETATM 6358 O  O     . HOH Y 5 .  ? 41.280 87.157  24.591 1.00 50.14  ? 711 HOH J O     1 
HETATM 6359 O  O     . HOH Z 5 .  ? 46.274 71.600  46.969 1.00 13.07  ? 607 HOH K O     1 
HETATM 6360 O  O     . HOH Z 5 .  ? 41.141 80.687  60.759 1.00 21.68  ? 608 HOH K O     1 
HETATM 6361 O  O     . HOH Z 5 .  ? 47.657 92.527  44.759 1.00 16.90  ? 609 HOH K O     1 
HETATM 6362 O  O     . HOH Z 5 .  ? 52.344 70.102  61.064 1.00 16.91  ? 610 HOH K O     1 
HETATM 6363 O  O     . HOH Z 5 .  ? 57.274 74.776  71.232 1.00 18.19  ? 611 HOH K O     1 
HETATM 6364 O  O     . HOH Z 5 .  ? 48.698 79.045  64.537 1.00 25.11  ? 612 HOH K O     1 
HETATM 6365 O  O     . HOH Z 5 .  ? 40.170 85.235  60.362 1.00 26.39  ? 613 HOH K O     1 
HETATM 6366 O  O     . HOH Z 5 .  ? 46.299 74.310  58.485 1.00 16.31  ? 614 HOH K O     1 
HETATM 6367 O  O     . HOH Z 5 .  ? 58.724 85.404  64.386 1.00 26.38  ? 615 HOH K O     1 
HETATM 6368 O  O     . HOH Z 5 .  ? 59.394 82.058  49.481 1.00 25.35  ? 616 HOH K O     1 
HETATM 6369 O  O     . HOH Z 5 .  ? 41.399 87.295  47.121 1.00 25.34  ? 617 HOH K O     1 
HETATM 6370 O  O     . HOH Z 5 .  ? 40.365 78.199  48.826 1.00 20.30  ? 618 HOH K O     1 
HETATM 6371 O  O     . HOH Z 5 .  ? 52.080 89.320  60.425 1.00 23.78  ? 619 HOH K O     1 
HETATM 6372 O  O     . HOH Z 5 .  ? 58.020 84.988  67.263 1.00 35.81  ? 620 HOH K O     1 
HETATM 6373 O  O     . HOH Z 5 .  ? 57.853 81.663  70.898 1.00 26.76  ? 621 HOH K O     1 
HETATM 6374 O  O     . HOH Z 5 .  ? 56.620 88.108  58.573 1.00 26.52  ? 622 HOH K O     1 
HETATM 6375 O  O     . HOH Z 5 .  ? 34.805 86.206  52.091 1.00 26.54  ? 623 HOH K O     1 
HETATM 6376 O  O     . HOH Z 5 .  ? 57.308 78.820  69.397 1.00 27.29  ? 624 HOH K O     1 
HETATM 6377 O  O     . HOH Z 5 .  ? 38.012 81.905  57.048 1.00 27.34  ? 625 HOH K O     1 
HETATM 6378 O  O     . HOH Z 5 .  ? 40.219 98.231  46.759 1.00 27.49  ? 626 HOH K O     1 
HETATM 6379 O  O     . HOH Z 5 .  ? 37.262 80.141  55.171 1.00 29.18  ? 627 HOH K O     1 
HETATM 6380 O  O     . HOH Z 5 .  ? 60.606 78.091  60.156 1.00 27.55  ? 628 HOH K O     1 
HETATM 6381 O  O     . HOH Z 5 .  ? 55.144 75.857  45.248 1.00 27.72  ? 629 HOH K O     1 
HETATM 6382 O  O     . HOH Z 5 .  ? 49.614 87.507  38.503 1.00 40.60  ? 630 HOH K O     1 
HETATM 6383 O  O     . HOH Z 5 .  ? 55.790 70.078  51.128 1.00 29.67  ? 631 HOH K O     1 
HETATM 6384 O  O     . HOH Z 5 .  ? 47.493 93.212  58.190 1.00 25.06  ? 632 HOH K O     1 
HETATM 6385 O  O     . HOH Z 5 .  ? 35.281 90.478  49.871 1.00 27.36  ? 633 HOH K O     1 
HETATM 6386 O  O     . HOH Z 5 .  ? 46.489 75.721  67.371 1.00 40.69  ? 634 HOH K O     1 
HETATM 6387 O  O     . HOH Z 5 .  ? 55.202 92.662  53.767 1.00 27.15  ? 635 HOH K O     1 
HETATM 6388 O  O     . HOH Z 5 .  ? 50.128 72.574  74.102 1.00 25.58  ? 636 HOH K O     1 
HETATM 6389 O  O     . HOH Z 5 .  ? 58.352 68.200  57.149 1.00 49.11  ? 637 HOH K O     1 
HETATM 6390 O  O     . HOH Z 5 .  ? 54.626 84.180  67.010 1.00 50.49  ? 638 HOH K O     1 
HETATM 6391 O  O     . HOH Z 5 .  ? 49.242 75.101  73.008 1.00 29.04  ? 639 HOH K O     1 
HETATM 6392 O  O     . HOH Z 5 .  ? 38.065 87.246  57.390 1.00 31.39  ? 640 HOH K O     1 
HETATM 6393 O  O     . HOH Z 5 .  ? 42.799 83.109  45.815 1.00 38.02  ? 641 HOH K O     1 
HETATM 6394 O  O     . HOH Z 5 .  ? 48.496 89.487  63.229 1.00 29.47  ? 642 HOH K O     1 
HETATM 6395 O  O     . HOH Z 5 .  ? 49.557 97.392  53.867 1.00 40.50  ? 643 HOH K O     1 
HETATM 6396 O  O     . HOH Z 5 .  ? 47.585 88.048  65.618 1.00 29.28  ? 644 HOH K O     1 
HETATM 6397 O  O     . HOH Z 5 .  ? 52.045 68.205  57.141 1.00 40.22  ? 645 HOH K O     1 
HETATM 6398 O  O     . HOH Z 5 .  ? 48.711 84.761  44.437 1.00 25.97  ? 646 HOH K O     1 
HETATM 6399 O  O     . HOH Z 5 .  ? 51.585 80.544  69.358 1.00 25.74  ? 647 HOH K O     1 
HETATM 6400 O  O     . HOH Z 5 .  ? 35.073 84.541  49.218 1.00 45.21  ? 648 HOH K O     1 
HETATM 6401 O  O     . HOH Z 5 .  ? 56.942 84.721  39.622 1.00 58.79  ? 649 HOH K O     1 
HETATM 6402 O  O     . HOH Z 5 .  ? 39.593 87.273  45.414 1.00 59.43  ? 650 HOH K O     1 
HETATM 6403 O  O     . HOH Z 5 .  ? 48.717 80.407  68.652 1.00 25.80  ? 651 HOH K O     1 
HETATM 6404 O  O     . HOH Z 5 .  ? 57.506 90.505  57.338 1.00 48.50  ? 652 HOH K O     1 
HETATM 6405 O  O     . HOH Z 5 .  ? 43.495 97.648  40.592 1.00 14.21  ? 653 HOH K O     1 
HETATM 6406 O  O     . HOH Z 5 .  ? 44.537 94.687  37.659 1.00 26.99  ? 654 HOH K O     1 
HETATM 6407 O  O     . HOH Z 5 .  ? 49.506 93.618  59.923 1.00 43.86  ? 655 HOH K O     1 
HETATM 6408 O  O     . HOH Z 5 .  ? 56.801 70.775  41.409 1.00 62.35  ? 656 HOH K O     1 
HETATM 6409 O  O     . HOH Z 5 .  ? 42.726 89.705  40.561 1.00 26.66  ? 657 HOH K O     1 
HETATM 6410 O  O     . HOH Z 5 .  ? 50.179 97.089  50.067 1.00 56.02  ? 658 HOH K O     1 
HETATM 6411 O  O     . HOH Z 5 .  ? 51.693 94.591  46.563 1.00 42.53  ? 659 HOH K O     1 
HETATM 6412 O  O     . HOH Z 5 .  ? 47.651 84.869  66.969 1.00 48.06  ? 660 HOH K O     1 
HETATM 6413 O  O     . HOH Z 5 .  ? 40.544 89.934  53.242 1.00 27.36  ? 661 HOH K O     1 
HETATM 6414 O  O     . HOH Z 5 .  ? 50.393 66.460  54.979 1.00 73.52  ? 662 HOH K O     1 
HETATM 6415 O  O     . HOH Z 5 .  ? 49.773 67.553  58.387 1.00 61.46  ? 663 HOH K O     1 
HETATM 6416 O  O     . HOH Z 5 .  ? 52.380 68.015  49.225 1.00 68.02  ? 664 HOH K O     1 
HETATM 6417 O  O     . HOH Z 5 .  ? 46.277 88.725  38.142 1.00 36.26  ? 665 HOH K O     1 
HETATM 6418 O  O     . HOH Z 5 .  ? 37.699 89.974  52.772 1.00 37.95  ? 666 HOH K O     1 
HETATM 6419 O  O     . HOH Z 5 .  ? 52.103 91.089  42.525 1.00 36.51  ? 667 HOH K O     1 
HETATM 6420 O  O     . HOH Z 5 .  ? 54.615 90.539  43.532 1.00 48.74  ? 668 HOH K O     1 
HETATM 6421 O  O     . HOH Z 5 .  ? 38.464 99.997  48.252 1.00 43.23  ? 669 HOH K O     1 
HETATM 6422 O  O     . HOH Z 5 .  ? 48.658 70.696  75.782 1.00 43.73  ? 670 HOH K O     1 
HETATM 6423 O  O     . HOH Z 5 .  ? 54.041 67.911  59.594 1.00 57.01  ? 671 HOH K O     1 
HETATM 6424 O  O     . HOH Z 5 .  ? 44.767 71.682  68.074 1.00 45.42  ? 672 HOH K O     1 
HETATM 6425 O  O     . HOH Z 5 .  ? 54.892 82.449  71.215 1.00 50.56  ? 673 HOH K O     1 
HETATM 6426 O  O     . HOH Z 5 .  ? 54.857 89.104  60.106 1.00 26.42  ? 674 HOH K O     1 
HETATM 6427 O  O     . HOH Z 5 .  ? 51.000 90.448  62.557 1.00 45.67  ? 675 HOH K O     1 
HETATM 6428 O  O     . HOH Z 5 .  ? 59.423 92.000  58.559 1.00 67.78  ? 676 HOH K O     1 
HETATM 6429 O  O     . HOH Z 5 .  ? 61.158 92.160  55.741 1.00 71.47  ? 677 HOH K O     1 
HETATM 6430 O  O     . HOH Z 5 .  ? 43.939 87.556  39.604 1.00 26.82  ? 678 HOH K O     1 
HETATM 6431 O  O     . HOH Z 5 .  ? 48.930 97.705  47.845 1.00 50.29  ? 679 HOH K O     1 
HETATM 6432 O  O     . HOH Z 5 .  ? 40.869 84.545  46.859 1.00 26.69  ? 680 HOH K O     1 
HETATM 6433 O  O     . HOH Z 5 .  ? 51.076 93.403  44.316 1.00 57.79  ? 681 HOH K O     1 
HETATM 6434 O  O     . HOH Z 5 .  ? 59.143 85.385  46.844 1.00 75.93  ? 682 HOH K O     1 
HETATM 6435 O  O     . HOH Z 5 .  ? 58.995 81.157  42.897 1.00 60.76  ? 683 HOH K O     1 
HETATM 6436 O  O     . HOH Z 5 .  ? 52.429 81.298  40.435 1.00 50.86  ? 684 HOH K O     1 
HETATM 6437 O  O     . HOH Z 5 .  ? 44.531 76.260  47.752 1.00 25.24  ? 685 HOH K O     1 
HETATM 6438 O  O     . HOH Z 5 .  ? 43.350 89.280  58.431 1.00 50.25  ? 686 HOH K O     1 
HETATM 6439 O  O     . HOH Z 5 .  ? 47.109 79.908  66.386 1.00 27.11  ? 687 HOH K O     1 
HETATM 6440 O  O     . HOH Z 5 .  ? 41.796 93.159  54.956 1.00 58.97  ? 688 HOH K O     1 
HETATM 6441 O  O     . HOH Z 5 .  ? 45.492 78.947  68.325 1.00 46.21  ? 689 HOH K O     1 
HETATM 6442 O  O     . HOH Z 5 .  ? 38.601 81.512  60.346 1.00 57.57  ? 690 HOH K O     1 
HETATM 6443 O  O     . HOH Z 5 .  ? 36.771 84.437  56.597 1.00 53.99  ? 691 HOH K O     1 
HETATM 6444 O  O     . HOH Z 5 .  ? 37.448 85.793  60.716 1.00 63.89  ? 692 HOH K O     1 
HETATM 6445 O  O     . HOH Z 5 .  ? 54.512 80.729  73.367 1.00 41.92  ? 693 HOH K O     1 
HETATM 6446 O  O     . HOH Z 5 .  ? 56.971 87.709  47.470 1.00 49.60  ? 694 HOH K O     1 
A 1 1  DA  1  1   1   DA  ADE A . n 
A 1 2  DA  2  2   2   DA  ADE A . n 
A 1 3  DC  3  3   3   DC  CYT A . n 
A 1 4  DT  4  4   4   DT  THY A . n 
A 1 5  DA  5  5   5   DA  ADE A . n 
A 1 6  DT  6  6   6   DT  THY A . n 
A 1 7  DG  7  7   7   DG  GUA A . n 
A 1 8  DA  8  8   8   DA  ADE A . n 
A 1 9  DA  9  9   9   DA  ADE A . n 
A 1 10 DA  10 10  10  DA  ADE A . n 
A 1 11 DC  11 11  11  DC  CYT A . n 
A 1 12 DA  12 12  12  DA  ADE A . n 
A 1 13 DA  13 13  13  DA  ADE A . n 
A 1 14 DA  14 14  14  DA  ADE A . n 
A 1 15 DT  15 15  15  DT  THY A . n 
A 1 16 DT  16 16  16  DT  THY A . n 
A 1 17 DT  17 17  17  DT  THY A . n 
A 1 18 DT  18 18  18  DT  THY A . n 
A 1 19 DC  19 19  19  DC  CYT A . n 
A 1 20 DC  20 20  20  DC  CYT A . n 
A 1 21 DT  21 21  21  DT  THY A . n 
B 2 1  DT  1  1   1   DT  THY B . n 
B 2 2  DT  2  2   2   DT  THY B . n 
B 2 3  DA  3  3   3   DA  ADE B . n 
B 2 4  DG  4  4   4   DG  GUA B . n 
B 2 5  DG  5  5   5   DG  GUA B . n 
B 2 6  DA  6  6   6   DA  ADE B . n 
B 2 7  DA  7  7   7   DA  ADE B . n 
B 2 8  DA  8  8   8   DA  ADE B . n 
B 2 9  DA  9  9   9   DA  ADE B . n 
B 2 10 DT  10 10  10  DT  THY B . n 
B 2 11 DT  11 11  11  DT  THY B . n 
B 2 12 DT  12 12  12  DT  THY B . n 
B 2 13 DG  13 13  13  DG  GUA B . n 
B 2 14 DT  14 14  14  DT  THY B . n 
B 2 15 DT  15 15  15  DT  THY B . n 
B 2 16 DT  16 16  16  DT  THY B . n 
B 2 17 DC  17 17  17  DC  CYT B . n 
B 2 18 DA  18 18  18  DA  ADE B . n 
B 2 19 DT  19 19  19  DT  THY B . n 
B 2 20 DA  20 20  20  DA  ADE B . n 
B 2 21 DG  21 21  21  DG  GUA B . n 
C 1 1  DA  1  1   1   DA  ADE C . n 
C 1 2  DA  2  2   2   DA  ADE C . n 
C 1 3  DC  3  3   3   DC  CYT C . n 
C 1 4  DT  4  4   4   DT  THY C . n 
C 1 5  DA  5  5   5   DA  ADE C . n 
C 1 6  DT  6  6   6   DT  THY C . n 
C 1 7  DG  7  7   7   DG  GUA C . n 
C 1 8  DA  8  8   8   DA  ADE C . n 
C 1 9  DA  9  9   9   DA  ADE C . n 
C 1 10 DA  10 10  10  DA  ADE C . n 
C 1 11 DC  11 11  11  DC  CYT C . n 
C 1 12 DA  12 12  12  DA  ADE C . n 
C 1 13 DA  13 13  13  DA  ADE C . n 
C 1 14 DA  14 14  14  DA  ADE C . n 
C 1 15 DT  15 15  15  DT  THY C . n 
C 1 16 DT  16 16  16  DT  THY C . n 
C 1 17 DT  17 17  17  DT  THY C . n 
C 1 18 DT  18 18  18  DT  THY C . n 
C 1 19 DC  19 19  19  DC  CYT C . n 
C 1 20 DC  20 20  20  DC  CYT C . n 
C 1 21 DT  21 21  21  DT  THY C . n 
D 2 1  DT  1  1   1   DT  THY D . n 
D 2 2  DT  2  2   2   DT  THY D . n 
D 2 3  DA  3  3   3   DA  ADE D . n 
D 2 4  DG  4  4   4   DG  GUA D . n 
D 2 5  DG  5  5   5   DG  GUA D . n 
D 2 6  DA  6  6   6   DA  ADE D . n 
D 2 7  DA  7  7   7   DA  ADE D . n 
D 2 8  DA  8  8   8   DA  ADE D . n 
D 2 9  DA  9  9   9   DA  ADE D . n 
D 2 10 DT  10 10  10  DT  THY D . n 
D 2 11 DT  11 11  11  DT  THY D . n 
D 2 12 DT  12 12  12  DT  THY D . n 
D 2 13 DG  13 13  13  DG  GUA D . n 
D 2 14 DT  14 14  14  DT  THY D . n 
D 2 15 DT  15 15  15  DT  THY D . n 
D 2 16 DT  16 16  16  DT  THY D . n 
D 2 17 DC  17 17  17  DC  CYT D . n 
D 2 18 DA  18 18  18  DA  ADE D . n 
D 2 19 DT  19 19  19  DT  THY D . n 
D 2 20 DA  20 20  20  DA  ADE D . n 
D 2 21 DG  21 21  21  DG  GUA D . n 
E 3 1  ILE 1  502 ?   ?   ?   F . n 
E 3 2  VAL 2  503 503 VAL VAL F . n 
E 3 3  ARG 3  504 504 ARG ARG F . n 
E 3 4  PRO 4  505 505 PRO PRO F . n 
E 3 5  PRO 5  506 506 PRO PRO F . n 
E 3 6  PHE 6  507 507 PHE PHE F . n 
E 3 7  THR 7  508 508 THR THR F . n 
E 3 8  TYR 8  509 509 TYR TYR F . n 
E 3 9  ALA 9  510 510 ALA ALA F . n 
E 3 10 THR 10 511 511 THR THR F . n 
E 3 11 LEU 11 512 512 LEU LEU F . n 
E 3 12 ILE 12 513 513 ILE ILE F . n 
E 3 13 ARG 13 514 514 ARG ARG F . n 
E 3 14 GLN 14 515 515 GLN GLN F . n 
E 3 15 ALA 15 516 516 ALA ALA F . n 
E 3 16 ILE 16 517 517 ILE ILE F . n 
E 3 17 MET 17 518 518 MET MET F . n 
E 3 18 GLU 18 519 519 GLU GLU F . n 
E 3 19 SER 19 520 520 SER SER F . n 
E 3 20 SER 20 521 521 SER SER F . n 
E 3 21 ASP 21 522 522 ASP ASP F . n 
E 3 22 ARG 22 523 523 ARG ARG F . n 
E 3 23 GLN 23 524 524 GLN GLN F . n 
E 3 24 LEU 24 525 525 LEU LEU F . n 
E 3 25 THR 25 526 526 THR THR F . n 
E 3 26 LEU 26 527 527 LEU LEU F . n 
E 3 27 ASN 27 528 528 ASN ASN F . n 
E 3 28 GLU 28 529 529 GLU GLU F . n 
E 3 29 ILE 29 530 530 ILE ILE F . n 
E 3 30 TYR 30 531 531 TYR TYR F . n 
E 3 31 SER 31 532 532 SER SER F . n 
E 3 32 TRP 32 533 533 TRP TRP F . n 
E 3 33 PHE 33 534 534 PHE PHE F . n 
E 3 34 THR 34 535 535 THR THR F . n 
E 3 35 ARG 35 536 536 ARG ARG F . n 
E 3 36 THR 36 537 537 THR THR F . n 
E 3 37 PHE 37 538 538 PHE PHE F . n 
E 3 38 ALA 38 539 539 ALA ALA F . n 
E 3 39 TYR 39 540 540 TYR TYR F . n 
E 3 40 PHE 40 541 541 PHE PHE F . n 
E 3 41 ARG 41 542 542 ARG ARG F . n 
E 3 42 ARG 42 543 543 ARG ARG F . n 
E 3 43 ASN 43 544 544 ASN ASN F . n 
E 3 44 ALA 44 545 545 ALA ALA F . n 
E 3 45 ALA 45 546 546 ALA ALA F . n 
E 3 46 THR 46 547 547 THR THR F . n 
E 3 47 TRP 47 548 548 TRP TRP F . n 
E 3 48 LYS 48 549 549 LYS LYS F . n 
E 3 49 ASN 49 550 550 ASN ASN F . n 
E 3 50 ALA 50 551 551 ALA ALA F . n 
E 3 51 VAL 51 552 552 VAL VAL F . n 
E 3 52 ARG 52 553 553 ARG ARG F . n 
E 3 53 HIS 53 554 554 HIS HIS F . n 
E 3 54 ASN 54 555 555 ASN ASN F . n 
E 3 55 LEU 55 556 556 LEU LEU F . n 
E 3 56 SER 56 557 557 SER SER F . n 
E 3 57 LEU 57 558 558 LEU LEU F . n 
E 3 58 HIS 58 559 559 HIS HIS F . n 
E 3 59 LYS 59 560 560 LYS LYS F . n 
E 3 60 CYS 60 561 561 CYS CYS F . n 
E 3 61 PHE 61 562 562 PHE PHE F . n 
E 3 62 VAL 62 563 563 VAL VAL F . n 
E 3 63 ARG 63 564 564 ARG ARG F . n 
E 3 64 VAL 64 565 565 VAL VAL F . n 
E 3 65 GLU 65 566 566 GLU GLU F . n 
E 3 66 ASN 66 567 567 ASN ASN F . n 
E 3 67 VAL 67 568 568 VAL VAL F . n 
E 3 68 LYS 68 569 569 LYS LYS F . n 
E 3 69 GLY 69 570 570 GLY GLY F . n 
E 3 70 ALA 70 571 571 ALA ALA F . n 
E 3 71 VAL 71 572 572 VAL VAL F . n 
E 3 72 TRP 72 573 573 TRP TRP F . n 
E 3 73 THR 73 574 574 THR THR F . n 
E 3 74 VAL 74 575 575 VAL VAL F . n 
E 3 75 ASP 75 576 576 ASP ASP F . n 
E 3 76 GLU 76 577 577 GLU GLU F . n 
E 3 77 VAL 77 578 578 VAL VAL F . n 
E 3 78 GLU 78 579 579 GLU GLU F . n 
E 3 79 TYR 79 580 580 TYR TYR F . n 
E 3 80 GLN 80 581 581 GLN GLN F . n 
E 3 81 LYS 81 582 582 LYS LYS F . n 
E 3 82 ARG 82 583 583 ARG ARG F . n 
E 3 83 ARG 83 584 584 ARG ARG F . n 
E 3 84 SER 84 585 ?   ?   ?   F . n 
E 3 85 GLN 85 586 ?   ?   ?   F . n 
E 3 86 LYS 86 587 ?   ?   ?   F . n 
E 3 87 ILE 87 588 ?   ?   ?   F . n 
E 3 88 THR 88 589 ?   ?   ?   F . n 
E 3 89 GLY 89 590 ?   ?   ?   F . n 
E 3 90 SER 90 591 ?   ?   ?   F . n 
E 3 91 PRO 91 592 ?   ?   ?   F . n 
E 3 92 THR 92 593 ?   ?   ?   F . n 
E 3 93 LEU 93 594 ?   ?   ?   F . n 
F 3 1  ILE 1  502 ?   ?   ?   G . n 
F 3 2  VAL 2  503 ?   ?   ?   G . n 
F 3 3  ARG 3  504 ?   ?   ?   G . n 
F 3 4  PRO 4  505 ?   ?   ?   G . n 
F 3 5  PRO 5  506 506 PRO PRO G . n 
F 3 6  PHE 6  507 507 PHE PHE G . n 
F 3 7  THR 7  508 508 THR THR G . n 
F 3 8  TYR 8  509 509 TYR TYR G . n 
F 3 9  ALA 9  510 510 ALA ALA G . n 
F 3 10 THR 10 511 511 THR THR G . n 
F 3 11 LEU 11 512 512 LEU LEU G . n 
F 3 12 ILE 12 513 513 ILE ILE G . n 
F 3 13 ARG 13 514 514 ARG ARG G . n 
F 3 14 GLN 14 515 515 GLN GLN G . n 
F 3 15 ALA 15 516 516 ALA ALA G . n 
F 3 16 ILE 16 517 517 ILE ILE G . n 
F 3 17 MET 17 518 518 MET MET G . n 
F 3 18 GLU 18 519 519 GLU GLU G . n 
F 3 19 SER 19 520 520 SER SER G . n 
F 3 20 SER 20 521 521 SER SER G . n 
F 3 21 ASP 21 522 522 ASP ASP G . n 
F 3 22 ARG 22 523 523 ARG ARG G . n 
F 3 23 GLN 23 524 524 GLN GLN G . n 
F 3 24 LEU 24 525 525 LEU LEU G . n 
F 3 25 THR 25 526 526 THR THR G . n 
F 3 26 LEU 26 527 527 LEU LEU G . n 
F 3 27 ASN 27 528 528 ASN ASN G . n 
F 3 28 GLU 28 529 529 GLU GLU G . n 
F 3 29 ILE 29 530 530 ILE ILE G . n 
F 3 30 TYR 30 531 531 TYR TYR G . n 
F 3 31 SER 31 532 532 SER SER G . n 
F 3 32 TRP 32 533 533 TRP TRP G . n 
F 3 33 PHE 33 534 534 PHE PHE G . n 
F 3 34 THR 34 535 535 THR THR G . n 
F 3 35 ARG 35 536 536 ARG ARG G . n 
F 3 36 THR 36 537 537 THR THR G . n 
F 3 37 PHE 37 538 538 PHE PHE G . n 
F 3 38 ALA 38 539 539 ALA ALA G . n 
F 3 39 TYR 39 540 540 TYR TYR G . n 
F 3 40 PHE 40 541 541 PHE PHE G . n 
F 3 41 ARG 41 542 542 ARG ARG G . n 
F 3 42 ARG 42 543 543 ARG ARG G . n 
F 3 43 ASN 43 544 544 ASN ASN G . n 
F 3 44 ALA 44 545 545 ALA ALA G . n 
F 3 45 ALA 45 546 546 ALA ALA G . n 
F 3 46 THR 46 547 547 THR THR G . n 
F 3 47 TRP 47 548 548 TRP TRP G . n 
F 3 48 LYS 48 549 549 LYS LYS G . n 
F 3 49 ASN 49 550 550 ASN ASN G . n 
F 3 50 ALA 50 551 551 ALA ALA G . n 
F 3 51 VAL 51 552 552 VAL VAL G . n 
F 3 52 ARG 52 553 553 ARG ARG G . n 
F 3 53 HIS 53 554 554 HIS HIS G . n 
F 3 54 ASN 54 555 555 ASN ASN G . n 
F 3 55 LEU 55 556 556 LEU LEU G . n 
F 3 56 SER 56 557 557 SER SER G . n 
F 3 57 LEU 57 558 558 LEU LEU G . n 
F 3 58 HIS 58 559 559 HIS HIS G . n 
F 3 59 LYS 59 560 560 LYS LYS G . n 
F 3 60 CYS 60 561 561 CYS CYS G . n 
F 3 61 PHE 61 562 562 PHE PHE G . n 
F 3 62 VAL 62 563 563 VAL VAL G . n 
F 3 63 ARG 63 564 564 ARG ARG G . n 
F 3 64 VAL 64 565 565 VAL VAL G . n 
F 3 65 GLU 65 566 566 GLU GLU G . n 
F 3 66 ASN 66 567 567 ASN ASN G . n 
F 3 67 VAL 67 568 568 VAL VAL G . n 
F 3 68 LYS 68 569 569 LYS LYS G . n 
F 3 69 GLY 69 570 570 GLY GLY G . n 
F 3 70 ALA 70 571 571 ALA ALA G . n 
F 3 71 VAL 71 572 572 VAL VAL G . n 
F 3 72 TRP 72 573 573 TRP TRP G . n 
F 3 73 THR 73 574 574 THR THR G . n 
F 3 74 VAL 74 575 575 VAL VAL G . n 
F 3 75 ASP 75 576 576 ASP ASP G . n 
F 3 76 GLU 76 577 577 GLU GLU G . n 
F 3 77 VAL 77 578 578 VAL VAL G . n 
F 3 78 GLU 78 579 579 GLU GLU G . n 
F 3 79 TYR 79 580 580 TYR TYR G . n 
F 3 80 GLN 80 581 581 GLN GLN G . n 
F 3 81 LYS 81 582 582 LYS LYS G . n 
F 3 82 ARG 82 583 583 ARG ARG G . n 
F 3 83 ARG 83 584 584 ARG ARG G . n 
F 3 84 SER 84 585 ?   ?   ?   G . n 
F 3 85 GLN 85 586 ?   ?   ?   G . n 
F 3 86 LYS 86 587 ?   ?   ?   G . n 
F 3 87 ILE 87 588 ?   ?   ?   G . n 
F 3 88 THR 88 589 ?   ?   ?   G . n 
F 3 89 GLY 89 590 ?   ?   ?   G . n 
F 3 90 SER 90 591 ?   ?   ?   G . n 
F 3 91 PRO 91 592 ?   ?   ?   G . n 
F 3 92 THR 92 593 ?   ?   ?   G . n 
F 3 93 LEU 93 594 ?   ?   ?   G . n 
G 3 1  ILE 1  502 ?   ?   ?   H . n 
G 3 2  VAL 2  503 ?   ?   ?   H . n 
G 3 3  ARG 3  504 ?   ?   ?   H . n 
G 3 4  PRO 4  505 ?   ?   ?   H . n 
G 3 5  PRO 5  506 506 PRO PRO H . n 
G 3 6  PHE 6  507 507 PHE PHE H . n 
G 3 7  THR 7  508 508 THR THR H . n 
G 3 8  TYR 8  509 509 TYR TYR H . n 
G 3 9  ALA 9  510 510 ALA ALA H . n 
G 3 10 THR 10 511 511 THR THR H . n 
G 3 11 LEU 11 512 512 LEU LEU H . n 
G 3 12 ILE 12 513 513 ILE ILE H . n 
G 3 13 ARG 13 514 514 ARG ARG H . n 
G 3 14 GLN 14 515 515 GLN GLN H . n 
G 3 15 ALA 15 516 516 ALA ALA H . n 
G 3 16 ILE 16 517 517 ILE ILE H . n 
G 3 17 MET 17 518 518 MET MET H . n 
G 3 18 GLU 18 519 519 GLU GLU H . n 
G 3 19 SER 19 520 520 SER SER H . n 
G 3 20 SER 20 521 521 SER SER H . n 
G 3 21 ASP 21 522 522 ASP ASP H . n 
G 3 22 ARG 22 523 523 ARG ARG H . n 
G 3 23 GLN 23 524 524 GLN GLN H . n 
G 3 24 LEU 24 525 525 LEU LEU H . n 
G 3 25 THR 25 526 526 THR THR H . n 
G 3 26 LEU 26 527 527 LEU LEU H . n 
G 3 27 ASN 27 528 528 ASN ASN H . n 
G 3 28 GLU 28 529 529 GLU GLU H . n 
G 3 29 ILE 29 530 530 ILE ILE H . n 
G 3 30 TYR 30 531 531 TYR TYR H . n 
G 3 31 SER 31 532 532 SER SER H . n 
G 3 32 TRP 32 533 533 TRP TRP H . n 
G 3 33 PHE 33 534 534 PHE PHE H . n 
G 3 34 THR 34 535 535 THR THR H . n 
G 3 35 ARG 35 536 536 ARG ARG H . n 
G 3 36 THR 36 537 537 THR THR H . n 
G 3 37 PHE 37 538 538 PHE PHE H . n 
G 3 38 ALA 38 539 539 ALA ALA H . n 
G 3 39 TYR 39 540 540 TYR TYR H . n 
G 3 40 PHE 40 541 541 PHE PHE H . n 
G 3 41 ARG 41 542 542 ARG ARG H . n 
G 3 42 ARG 42 543 543 ARG ARG H . n 
G 3 43 ASN 43 544 544 ASN ASN H . n 
G 3 44 ALA 44 545 545 ALA ALA H . n 
G 3 45 ALA 45 546 546 ALA ALA H . n 
G 3 46 THR 46 547 547 THR THR H . n 
G 3 47 TRP 47 548 548 TRP TRP H . n 
G 3 48 LYS 48 549 549 LYS LYS H . n 
G 3 49 ASN 49 550 550 ASN ASN H . n 
G 3 50 ALA 50 551 551 ALA ALA H . n 
G 3 51 VAL 51 552 552 VAL VAL H . n 
G 3 52 ARG 52 553 553 ARG ARG H . n 
G 3 53 HIS 53 554 554 HIS HIS H . n 
G 3 54 ASN 54 555 555 ASN ASN H . n 
G 3 55 LEU 55 556 556 LEU LEU H . n 
G 3 56 SER 56 557 557 SER SER H . n 
G 3 57 LEU 57 558 558 LEU LEU H . n 
G 3 58 HIS 58 559 559 HIS HIS H . n 
G 3 59 LYS 59 560 560 LYS LYS H . n 
G 3 60 CYS 60 561 561 CYS CYS H . n 
G 3 61 PHE 61 562 562 PHE PHE H . n 
G 3 62 VAL 62 563 563 VAL VAL H . n 
G 3 63 ARG 63 564 564 ARG ARG H . n 
G 3 64 VAL 64 565 565 VAL VAL H . n 
G 3 65 GLU 65 566 566 GLU GLU H . n 
G 3 66 ASN 66 567 567 ASN ASN H . n 
G 3 67 VAL 67 568 568 VAL VAL H . n 
G 3 68 LYS 68 569 569 LYS LYS H . n 
G 3 69 GLY 69 570 570 GLY GLY H . n 
G 3 70 ALA 70 571 571 ALA ALA H . n 
G 3 71 VAL 71 572 572 VAL VAL H . n 
G 3 72 TRP 72 573 573 TRP TRP H . n 
G 3 73 THR 73 574 574 THR THR H . n 
G 3 74 VAL 74 575 575 VAL VAL H . n 
G 3 75 ASP 75 576 576 ASP ASP H . n 
G 3 76 GLU 76 577 577 GLU GLU H . n 
G 3 77 VAL 77 578 578 VAL VAL H . n 
G 3 78 GLU 78 579 579 GLU GLU H . n 
G 3 79 TYR 79 580 580 TYR TYR H . n 
G 3 80 GLN 80 581 581 GLN GLN H . n 
G 3 81 LYS 81 582 582 LYS LYS H . n 
G 3 82 ARG 82 583 583 ARG ARG H . n 
G 3 83 ARG 83 584 584 ARG ARG H . n 
G 3 84 SER 84 585 ?   ?   ?   H . n 
G 3 85 GLN 85 586 ?   ?   ?   H . n 
G 3 86 LYS 86 587 ?   ?   ?   H . n 
G 3 87 ILE 87 588 ?   ?   ?   H . n 
G 3 88 THR 88 589 ?   ?   ?   H . n 
G 3 89 GLY 89 590 ?   ?   ?   H . n 
G 3 90 SER 90 591 ?   ?   ?   H . n 
G 3 91 PRO 91 592 ?   ?   ?   H . n 
G 3 92 THR 92 593 ?   ?   ?   H . n 
G 3 93 LEU 93 594 ?   ?   ?   H . n 
H 3 1  ILE 1  502 ?   ?   ?   I . n 
H 3 2  VAL 2  503 503 VAL VAL I . n 
H 3 3  ARG 3  504 504 ARG ARG I . n 
H 3 4  PRO 4  505 505 PRO PRO I . n 
H 3 5  PRO 5  506 506 PRO PRO I . n 
H 3 6  PHE 6  507 507 PHE PHE I . n 
H 3 7  THR 7  508 508 THR THR I . n 
H 3 8  TYR 8  509 509 TYR TYR I . n 
H 3 9  ALA 9  510 510 ALA ALA I . n 
H 3 10 THR 10 511 511 THR THR I . n 
H 3 11 LEU 11 512 512 LEU LEU I . n 
H 3 12 ILE 12 513 513 ILE ILE I . n 
H 3 13 ARG 13 514 514 ARG ARG I . n 
H 3 14 GLN 14 515 515 GLN GLN I . n 
H 3 15 ALA 15 516 516 ALA ALA I . n 
H 3 16 ILE 16 517 517 ILE ILE I . n 
H 3 17 MET 17 518 518 MET MET I . n 
H 3 18 GLU 18 519 519 GLU GLU I . n 
H 3 19 SER 19 520 520 SER SER I . n 
H 3 20 SER 20 521 521 SER SER I . n 
H 3 21 ASP 21 522 522 ASP ASP I . n 
H 3 22 ARG 22 523 523 ARG ARG I . n 
H 3 23 GLN 23 524 524 GLN GLN I . n 
H 3 24 LEU 24 525 525 LEU LEU I . n 
H 3 25 THR 25 526 526 THR THR I . n 
H 3 26 LEU 26 527 527 LEU LEU I . n 
H 3 27 ASN 27 528 528 ASN ASN I . n 
H 3 28 GLU 28 529 529 GLU GLU I . n 
H 3 29 ILE 29 530 530 ILE ILE I . n 
H 3 30 TYR 30 531 531 TYR TYR I . n 
H 3 31 SER 31 532 532 SER SER I . n 
H 3 32 TRP 32 533 533 TRP TRP I . n 
H 3 33 PHE 33 534 534 PHE PHE I . n 
H 3 34 THR 34 535 535 THR THR I . n 
H 3 35 ARG 35 536 536 ARG ARG I . n 
H 3 36 THR 36 537 537 THR THR I . n 
H 3 37 PHE 37 538 538 PHE PHE I . n 
H 3 38 ALA 38 539 539 ALA ALA I . n 
H 3 39 TYR 39 540 540 TYR TYR I . n 
H 3 40 PHE 40 541 541 PHE PHE I . n 
H 3 41 ARG 41 542 542 ARG ARG I . n 
H 3 42 ARG 42 543 543 ARG ARG I . n 
H 3 43 ASN 43 544 544 ASN ASN I . n 
H 3 44 ALA 44 545 545 ALA ALA I . n 
H 3 45 ALA 45 546 546 ALA ALA I . n 
H 3 46 THR 46 547 547 THR THR I . n 
H 3 47 TRP 47 548 548 TRP TRP I . n 
H 3 48 LYS 48 549 549 LYS LYS I . n 
H 3 49 ASN 49 550 550 ASN ASN I . n 
H 3 50 ALA 50 551 551 ALA ALA I . n 
H 3 51 VAL 51 552 552 VAL VAL I . n 
H 3 52 ARG 52 553 553 ARG ARG I . n 
H 3 53 HIS 53 554 554 HIS HIS I . n 
H 3 54 ASN 54 555 555 ASN ASN I . n 
H 3 55 LEU 55 556 556 LEU LEU I . n 
H 3 56 SER 56 557 557 SER SER I . n 
H 3 57 LEU 57 558 558 LEU LEU I . n 
H 3 58 HIS 58 559 559 HIS HIS I . n 
H 3 59 LYS 59 560 560 LYS LYS I . n 
H 3 60 CYS 60 561 561 CYS CYS I . n 
H 3 61 PHE 61 562 562 PHE PHE I . n 
H 3 62 VAL 62 563 563 VAL VAL I . n 
H 3 63 ARG 63 564 564 ARG ARG I . n 
H 3 64 VAL 64 565 565 VAL VAL I . n 
H 3 65 GLU 65 566 566 GLU GLU I . n 
H 3 66 ASN 66 567 567 ASN ASN I . n 
H 3 67 VAL 67 568 568 VAL VAL I . n 
H 3 68 LYS 68 569 569 LYS LYS I . n 
H 3 69 GLY 69 570 570 GLY GLY I . n 
H 3 70 ALA 70 571 571 ALA ALA I . n 
H 3 71 VAL 71 572 572 VAL VAL I . n 
H 3 72 TRP 72 573 573 TRP TRP I . n 
H 3 73 THR 73 574 574 THR THR I . n 
H 3 74 VAL 74 575 575 VAL VAL I . n 
H 3 75 ASP 75 576 576 ASP ASP I . n 
H 3 76 GLU 76 577 577 GLU GLU I . n 
H 3 77 VAL 77 578 578 VAL VAL I . n 
H 3 78 GLU 78 579 579 GLU GLU I . n 
H 3 79 TYR 79 580 580 TYR TYR I . n 
H 3 80 GLN 80 581 581 GLN GLN I . n 
H 3 81 LYS 81 582 582 LYS LYS I . n 
H 3 82 ARG 82 583 583 ARG ARG I . n 
H 3 83 ARG 83 584 ?   ?   ?   I . n 
H 3 84 SER 84 585 ?   ?   ?   I . n 
H 3 85 GLN 85 586 ?   ?   ?   I . n 
H 3 86 LYS 86 587 ?   ?   ?   I . n 
H 3 87 ILE 87 588 ?   ?   ?   I . n 
H 3 88 THR 88 589 ?   ?   ?   I . n 
H 3 89 GLY 89 590 ?   ?   ?   I . n 
H 3 90 SER 90 591 ?   ?   ?   I . n 
H 3 91 PRO 91 592 ?   ?   ?   I . n 
H 3 92 THR 92 593 ?   ?   ?   I . n 
H 3 93 LEU 93 594 ?   ?   ?   I . n 
I 3 1  ILE 1  502 502 ILE ILE J . n 
I 3 2  VAL 2  503 503 VAL VAL J . n 
I 3 3  ARG 3  504 504 ARG ARG J . n 
I 3 4  PRO 4  505 505 PRO PRO J . n 
I 3 5  PRO 5  506 506 PRO PRO J . n 
I 3 6  PHE 6  507 507 PHE PHE J . n 
I 3 7  THR 7  508 508 THR THR J . n 
I 3 8  TYR 8  509 509 TYR TYR J . n 
I 3 9  ALA 9  510 510 ALA ALA J . n 
I 3 10 THR 10 511 511 THR THR J . n 
I 3 11 LEU 11 512 512 LEU LEU J . n 
I 3 12 ILE 12 513 513 ILE ILE J . n 
I 3 13 ARG 13 514 514 ARG ARG J . n 
I 3 14 GLN 14 515 515 GLN GLN J . n 
I 3 15 ALA 15 516 516 ALA ALA J . n 
I 3 16 ILE 16 517 517 ILE ILE J . n 
I 3 17 MET 17 518 518 MET MET J . n 
I 3 18 GLU 18 519 519 GLU GLU J . n 
I 3 19 SER 19 520 520 SER SER J . n 
I 3 20 SER 20 521 521 SER SER J . n 
I 3 21 ASP 21 522 522 ASP ASP J . n 
I 3 22 ARG 22 523 523 ARG ARG J . n 
I 3 23 GLN 23 524 524 GLN GLN J . n 
I 3 24 LEU 24 525 525 LEU LEU J . n 
I 3 25 THR 25 526 526 THR THR J . n 
I 3 26 LEU 26 527 527 LEU LEU J . n 
I 3 27 ASN 27 528 528 ASN ASN J . n 
I 3 28 GLU 28 529 529 GLU GLU J . n 
I 3 29 ILE 29 530 530 ILE ILE J . n 
I 3 30 TYR 30 531 531 TYR TYR J . n 
I 3 31 SER 31 532 532 SER SER J . n 
I 3 32 TRP 32 533 533 TRP TRP J . n 
I 3 33 PHE 33 534 534 PHE PHE J . n 
I 3 34 THR 34 535 535 THR THR J . n 
I 3 35 ARG 35 536 536 ARG ARG J . n 
I 3 36 THR 36 537 537 THR THR J . n 
I 3 37 PHE 37 538 538 PHE PHE J . n 
I 3 38 ALA 38 539 539 ALA ALA J . n 
I 3 39 TYR 39 540 540 TYR TYR J . n 
I 3 40 PHE 40 541 541 PHE PHE J . n 
I 3 41 ARG 41 542 542 ARG ARG J . n 
I 3 42 ARG 42 543 543 ARG ARG J . n 
I 3 43 ASN 43 544 544 ASN ASN J . n 
I 3 44 ALA 44 545 545 ALA ALA J . n 
I 3 45 ALA 45 546 546 ALA ALA J . n 
I 3 46 THR 46 547 547 THR THR J . n 
I 3 47 TRP 47 548 548 TRP TRP J . n 
I 3 48 LYS 48 549 549 LYS LYS J . n 
I 3 49 ASN 49 550 550 ASN ASN J . n 
I 3 50 ALA 50 551 551 ALA ALA J . n 
I 3 51 VAL 51 552 552 VAL VAL J . n 
I 3 52 ARG 52 553 553 ARG ARG J . n 
I 3 53 HIS 53 554 554 HIS HIS J . n 
I 3 54 ASN 54 555 555 ASN ASN J . n 
I 3 55 LEU 55 556 556 LEU LEU J . n 
I 3 56 SER 56 557 557 SER SER J . n 
I 3 57 LEU 57 558 558 LEU LEU J . n 
I 3 58 HIS 58 559 559 HIS HIS J . n 
I 3 59 LYS 59 560 560 LYS LYS J . n 
I 3 60 CYS 60 561 561 CYS CYS J . n 
I 3 61 PHE 61 562 562 PHE PHE J . n 
I 3 62 VAL 62 563 563 VAL VAL J . n 
I 3 63 ARG 63 564 564 ARG ARG J . n 
I 3 64 VAL 64 565 565 VAL VAL J . n 
I 3 65 GLU 65 566 566 GLU GLU J . n 
I 3 66 ASN 66 567 567 ASN ASN J . n 
I 3 67 VAL 67 568 568 VAL VAL J . n 
I 3 68 LYS 68 569 569 LYS LYS J . n 
I 3 69 GLY 69 570 570 GLY GLY J . n 
I 3 70 ALA 70 571 571 ALA ALA J . n 
I 3 71 VAL 71 572 572 VAL VAL J . n 
I 3 72 TRP 72 573 573 TRP TRP J . n 
I 3 73 THR 73 574 574 THR THR J . n 
I 3 74 VAL 74 575 575 VAL VAL J . n 
I 3 75 ASP 75 576 576 ASP ASP J . n 
I 3 76 GLU 76 577 577 GLU GLU J . n 
I 3 77 VAL 77 578 578 VAL VAL J . n 
I 3 78 GLU 78 579 579 GLU GLU J . n 
I 3 79 TYR 79 580 580 TYR TYR J . n 
I 3 80 GLN 80 581 581 GLN GLN J . n 
I 3 81 LYS 81 582 582 LYS LYS J . n 
I 3 82 ARG 82 583 583 ARG ARG J . n 
I 3 83 ARG 83 584 584 ARG ARG J . n 
I 3 84 SER 84 585 ?   ?   ?   J . n 
I 3 85 GLN 85 586 ?   ?   ?   J . n 
I 3 86 LYS 86 587 ?   ?   ?   J . n 
I 3 87 ILE 87 588 ?   ?   ?   J . n 
I 3 88 THR 88 589 ?   ?   ?   J . n 
I 3 89 GLY 89 590 ?   ?   ?   J . n 
I 3 90 SER 90 591 ?   ?   ?   J . n 
I 3 91 PRO 91 592 ?   ?   ?   J . n 
I 3 92 THR 92 593 ?   ?   ?   J . n 
I 3 93 LEU 93 594 ?   ?   ?   J . n 
J 3 1  ILE 1  502 502 ILE ILE K . n 
J 3 2  VAL 2  503 503 VAL VAL K . n 
J 3 3  ARG 3  504 504 ARG ARG K . n 
J 3 4  PRO 4  505 505 PRO PRO K . n 
J 3 5  PRO 5  506 506 PRO PRO K . n 
J 3 6  PHE 6  507 507 PHE PHE K . n 
J 3 7  THR 7  508 508 THR THR K . n 
J 3 8  TYR 8  509 509 TYR TYR K . n 
J 3 9  ALA 9  510 510 ALA ALA K . n 
J 3 10 THR 10 511 511 THR THR K . n 
J 3 11 LEU 11 512 512 LEU LEU K . n 
J 3 12 ILE 12 513 513 ILE ILE K . n 
J 3 13 ARG 13 514 514 ARG ARG K . n 
J 3 14 GLN 14 515 515 GLN GLN K . n 
J 3 15 ALA 15 516 516 ALA ALA K . n 
J 3 16 ILE 16 517 517 ILE ILE K . n 
J 3 17 MET 17 518 518 MET MET K . n 
J 3 18 GLU 18 519 519 GLU GLU K . n 
J 3 19 SER 19 520 520 SER SER K . n 
J 3 20 SER 20 521 521 SER SER K . n 
J 3 21 ASP 21 522 522 ASP ASP K . n 
J 3 22 ARG 22 523 523 ARG ARG K . n 
J 3 23 GLN 23 524 524 GLN GLN K . n 
J 3 24 LEU 24 525 525 LEU LEU K . n 
J 3 25 THR 25 526 526 THR THR K . n 
J 3 26 LEU 26 527 527 LEU LEU K . n 
J 3 27 ASN 27 528 528 ASN ASN K . n 
J 3 28 GLU 28 529 529 GLU GLU K . n 
J 3 29 ILE 29 530 530 ILE ILE K . n 
J 3 30 TYR 30 531 531 TYR TYR K . n 
J 3 31 SER 31 532 532 SER SER K . n 
J 3 32 TRP 32 533 533 TRP TRP K . n 
J 3 33 PHE 33 534 534 PHE PHE K . n 
J 3 34 THR 34 535 535 THR THR K . n 
J 3 35 ARG 35 536 536 ARG ARG K . n 
J 3 36 THR 36 537 537 THR THR K . n 
J 3 37 PHE 37 538 538 PHE PHE K . n 
J 3 38 ALA 38 539 539 ALA ALA K . n 
J 3 39 TYR 39 540 540 TYR TYR K . n 
J 3 40 PHE 40 541 541 PHE PHE K . n 
J 3 41 ARG 41 542 542 ARG ARG K . n 
J 3 42 ARG 42 543 543 ARG ARG K . n 
J 3 43 ASN 43 544 544 ASN ASN K . n 
J 3 44 ALA 44 545 545 ALA ALA K . n 
J 3 45 ALA 45 546 546 ALA ALA K . n 
J 3 46 THR 46 547 547 THR THR K . n 
J 3 47 TRP 47 548 548 TRP TRP K . n 
J 3 48 LYS 48 549 549 LYS LYS K . n 
J 3 49 ASN 49 550 550 ASN ASN K . n 
J 3 50 ALA 50 551 551 ALA ALA K . n 
J 3 51 VAL 51 552 552 VAL VAL K . n 
J 3 52 ARG 52 553 553 ARG ARG K . n 
J 3 53 HIS 53 554 554 HIS HIS K . n 
J 3 54 ASN 54 555 555 ASN ASN K . n 
J 3 55 LEU 55 556 556 LEU LEU K . n 
J 3 56 SER 56 557 557 SER SER K . n 
J 3 57 LEU 57 558 558 LEU LEU K . n 
J 3 58 HIS 58 559 559 HIS HIS K . n 
J 3 59 LYS 59 560 560 LYS LYS K . n 
J 3 60 CYS 60 561 561 CYS CYS K . n 
J 3 61 PHE 61 562 562 PHE PHE K . n 
J 3 62 VAL 62 563 563 VAL VAL K . n 
J 3 63 ARG 63 564 564 ARG ARG K . n 
J 3 64 VAL 64 565 565 VAL VAL K . n 
J 3 65 GLU 65 566 566 GLU GLU K . n 
J 3 66 ASN 66 567 567 ASN ASN K . n 
J 3 67 VAL 67 568 568 VAL VAL K . n 
J 3 68 LYS 68 569 569 LYS LYS K . n 
J 3 69 GLY 69 570 570 GLY GLY K . n 
J 3 70 ALA 70 571 571 ALA ALA K . n 
J 3 71 VAL 71 572 572 VAL VAL K . n 
J 3 72 TRP 72 573 573 TRP TRP K . n 
J 3 73 THR 73 574 574 THR THR K . n 
J 3 74 VAL 74 575 575 VAL VAL K . n 
J 3 75 ASP 75 576 576 ASP ASP K . n 
J 3 76 GLU 76 577 577 GLU GLU K . n 
J 3 77 VAL 77 578 578 VAL VAL K . n 
J 3 78 GLU 78 579 579 GLU GLU K . n 
J 3 79 TYR 79 580 580 TYR TYR K . n 
J 3 80 GLN 80 581 581 GLN GLN K . n 
J 3 81 LYS 81 582 582 LYS LYS K . n 
J 3 82 ARG 82 583 583 ARG ARG K . n 
J 3 83 ARG 83 584 584 ARG ARG K . n 
J 3 84 SER 84 585 ?   ?   ?   K . n 
J 3 85 GLN 85 586 ?   ?   ?   K . n 
J 3 86 LYS 86 587 ?   ?   ?   K . n 
J 3 87 ILE 87 588 ?   ?   ?   K . n 
J 3 88 THR 88 589 ?   ?   ?   K . n 
J 3 89 GLY 89 590 ?   ?   ?   K . n 
J 3 90 SER 90 591 ?   ?   ?   K . n 
J 3 91 PRO 91 592 ?   ?   ?   K . n 
J 3 92 THR 92 593 ?   ?   ?   K . n 
J 3 93 LEU 93 594 ?   ?   ?   K . n 
#                   1 
_pdbx_struct_assembly.details              author_defined_assembly 
_pdbx_struct_assembly.method_details       ? 
_pdbx_struct_assembly.oligomeric_details   decameric 
_pdbx_struct_assembly.oligomeric_count     10 
_pdbx_struct_assembly_gen.assembly_id       1 
_pdbx_struct_assembly_gen.oper_expression   1 
_pdbx_struct_assembly_gen.asym_id_list      A,B,C,D,E,F,G,H,I,J,K,L,M,N,O,P,Q,R,S,T,U,V,W,X,Y,Z 
#                   1 
_pdbx_struct_oper_list.type                 'identity operation'                 1_555 
_pdbx_struct_oper_list.symmetry_operation   x,y,z 
_pdbx_struct_oper_list.matrix[1][1]         1.0000000000 
_pdbx_struct_oper_list.matrix[1][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[1][3]         0.0000000000 
_pdbx_struct_oper_list.vector[1]            0.0000000000 
_pdbx_struct_oper_list.matrix[2][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[2][2]         1.0000000000 
_pdbx_struct_oper_list.matrix[2][3]         0.0000000000 
_pdbx_struct_oper_list.vector[2]            0.0000000000 
_pdbx_struct_oper_list.matrix[3][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][3]         1.0000000000 
_pdbx_struct_oper_list.vector[3]            0.0000000000 
1  O ? E SER 56 ? F SER 557 ? 1_555 MG ? K MG . ? F MG 601 ? 1_555 O ? E LEU 57 ? F LEU 558 ? 1_555 92.1  ? 
2  O ? E SER 56 ? F SER 557 ? 1_555 MG ? K MG . ? F MG 601 ? 1_555 O ? U HOH .  ? F HOH 613 ? 1_555 113.7 ? 
3  O ? E LEU 57 ? F LEU 558 ? 1_555 MG ? K MG . ? F MG 601 ? 1_555 O ? U HOH .  ? F HOH 613 ? 1_555 130.4 ? 
4  O ? F PHE 61 ? G PHE 562 ? 1_555 MG ? L MG . ? G MG 604 ? 1_555 O ? F LEU 55 ? G LEU 556 ? 1_555 100.8 ? 
5  O ? F PHE 61 ? G PHE 562 ? 1_555 MG ? L MG . ? G MG 604 ? 1_555 O ? F HIS 58 ? G HIS 559 ? 1_555 90.5  ? 
6  O ? F LEU 55 ? G LEU 556 ? 1_555 MG ? L MG . ? G MG 604 ? 1_555 O ? F HIS 58 ? G HIS 559 ? 1_555 96.0  ? 
7  O ? W HOH .  ? H HOH 397 ? 1_555 MG ? M MG . ? H MG 602 ? 1_555 O ? G LEU 55 ? H LEU 556 ? 1_555 94.9  ? 
8  O ? W HOH .  ? H HOH 397 ? 1_555 MG ? M MG . ? H MG 602 ? 1_555 O ? G HIS 58 ? H HIS 559 ? 1_555 172.7 ? 
9  O ? G LEU 55 ? H LEU 556 ? 1_555 MG ? M MG . ? H MG 602 ? 1_555 O ? G HIS 58 ? H HIS 559 ? 1_555 91.7  ? 
10 O ? W HOH .  ? H HOH 397 ? 1_555 MG ? M MG . ? H MG 602 ? 1_555 O ? G PHE 61 ? H PHE 562 ? 1_555 93.2  ? 
11 O ? G LEU 55 ? H LEU 556 ? 1_555 MG ? M MG . ? H MG 602 ? 1_555 O ? G PHE 61 ? H PHE 562 ? 1_555 95.5  ? 
12 O ? G HIS 58 ? H HIS 559 ? 1_555 MG ? M MG . ? H MG 602 ? 1_555 O ? G PHE 61 ? H PHE 562 ? 1_555 89.2  ? 
13 O ? H HIS 58 ? I HIS 559 ? 1_555 MG ? N MG . ? I MG 603 ? 1_555 O ? H SER 56 ? I SER 557 ? 1_555 127.7 ? 
14 O ? I PHE 61 ? J PHE 562 ? 1_555 MG ? O MG . ? J MG 605 ? 1_555 O ? Y HOH .  ? J HOH 673 ? 1_555 104.7 ? 
15 O ? I PHE 61 ? J PHE 562 ? 1_555 MG ? O MG . ? J MG 605 ? 1_555 O ? I HIS 58 ? J HIS 559 ? 1_555 92.6  ? 
16 O ? Y HOH .  ? J HOH 673 ? 1_555 MG ? O MG . ? J MG 605 ? 1_555 O ? I HIS 58 ? J HIS 559 ? 1_555 94.4  ? 
17 O ? I PHE 61 ? J PHE 562 ? 1_555 MG ? O MG . ? J MG 605 ? 1_555 O ? I LEU 55 ? J LEU 556 ? 1_555 101.7 ? 
18 O ? Y HOH .  ? J HOH 673 ? 1_555 MG ? O MG . ? J MG 605 ? 1_555 O ? I LEU 55 ? J LEU 556 ? 1_555 151.0 ? 
19 O ? I HIS 58 ? J HIS 559 ? 1_555 MG ? O MG . ? J MG 605 ? 1_555 O ? I LEU 55 ? J LEU 556 ? 1_555 96.3  ? 
20 O ? J SER 56 ? K SER 557 ? 1_555 MG ? P MG . ? K MG 606 ? 1_555 O ? J HIS 58 ? K HIS 559 ? 1_555 93.9  ? 
21 O ? J SER 56 ? K SER 557 ? 1_555 MG ? P MG . ? K MG 606 ? 1_555 O ? J PHE 61 ? K PHE 562 ? 1_555 172.7 ? 
22 O ? J HIS 58 ? K HIS 559 ? 1_555 MG ? P MG . ? K MG 606 ? 1_555 O ? J PHE 61 ? K PHE 562 ? 1_555 93.1  ? 
23 O ? J SER 56 ? K SER 557 ? 1_555 MG ? P MG . ? K MG 606 ? 1_555 O ? T HOH .  ? D HOH 24  ? 1_555 74.6  ? 
24 O ? J HIS 58 ? K HIS 559 ? 1_555 MG ? P MG . ? K MG 606 ? 1_555 O ? T HOH .  ? D HOH 24  ? 1_555 164.4 ? 
25 O ? J PHE 61 ? K PHE 562 ? 1_555 MG ? P MG . ? K MG 606 ? 1_555 O ? T HOH .  ? D HOH 24  ? 1_555 98.1  ? 
26 O ? J SER 56 ? K SER 557 ? 1_555 MG ? P MG . ? K MG 606 ? 1_555 O ? Z HOH .  ? K HOH 645 ? 1_555 69.2  ? 
27 O ? J HIS 58 ? K HIS 559 ? 1_555 MG ? P MG . ? K MG 606 ? 1_555 O ? Z HOH .  ? K HOH 645 ? 1_555 93.1  ? 
28 O ? J PHE 61 ? K PHE 562 ? 1_555 MG ? P MG . ? K MG 606 ? 1_555 O ? Z HOH .  ? K HOH 645 ? 1_555 108.3 ? 
29 O ? T HOH .  ? D HOH 24  ? 1_555 MG ? P MG . ? K MG 606 ? 1_555 O ? Z HOH .  ? K HOH 645 ? 1_555 73.2  ? 
30 O ? J SER 56 ? K SER 557 ? 1_555 MG ? P MG . ? K MG 606 ? 1_555 O ? J LEU 55 ? K LEU 556 ? 1_555 80.7  ? 
31 O ? J HIS 58 ? K HIS 559 ? 1_555 MG ? P MG . ? K MG 606 ? 1_555 O ? J LEU 55 ? K LEU 556 ? 1_555 94.7  ? 
32 O ? J PHE 61 ? K PHE 562 ? 1_555 MG ? P MG . ? K MG 606 ? 1_555 O ? J LEU 55 ? K LEU 556 ? 1_555 100.8 ? 
33 O ? T HOH .  ? D HOH 24  ? 1_555 MG ? P MG . ? K MG 606 ? 1_555 O ? J LEU 55 ? K LEU 556 ? 1_555 93.7  ? 
34 O ? Z HOH .  ? K HOH 645 ? 1_555 MG ? P MG . ? K MG 606 ? 1_555 O ? J LEU 55 ? K LEU 556 ? 1_555 149.3 ? 
1 'Structure model' 1 0 2006-01-31 
2 'Structure model' 1 1 2008-04-30 
3 'Structure model' 1 2 2011-07-13 
_pdbx_audit_revision_details.ordinal             1 
_pdbx_audit_revision_details.revision_ordinal    1 
_pdbx_audit_revision_details.data_content_type   'Structure model' 
_pdbx_audit_revision_details.provider            repository 
_pdbx_audit_revision_details.type                'Initial release' 
_pdbx_audit_revision_details.description         ? 
1 2 'Structure model' 'Version format compliance' 
2 3 'Structure model' 'Version format compliance' 
DENZO     'data reduction' . ? 1 
SCALEPACK 'data scaling'   . ? 2 
CNS       refinement       . ? 3 
CNS       phasing          . ? 4 
1  1 ASN F 567 ? ? -111.03 -150.41 
2  1 VAL F 568 ? ? -39.44  -98.53  
3  1 TRP F 573 ? ? -90.12  -158.70 
4  1 THR F 574 ? ? 170.11  168.30  
5  1 ASN G 567 ? ? -104.03 -155.38 
6  1 VAL G 568 ? ? -43.00  -86.69  
7  1 GLU H 519 ? ? -108.07 70.88   
8  1 ASP H 522 ? ? 95.48   0.16    
9  1 ASN H 567 ? ? -104.43 -154.25 
10 1 VAL H 568 ? ? -43.82  -86.79  
11 1 ASN I 567 ? ? -109.57 -167.02 
12 1 LYS I 569 ? ? -155.82 -33.38  
13 1 ALA I 571 ? ? -171.46 128.37  
14 1 ARG J 583 ? ? 81.31   -12.08  
15 1 ARG K 583 ? ? 77.66   -1.29   
#              1 
_pdbx_validate_planes.PDB_model_num   1 
_pdbx_validate_planes.auth_comp_id    DT 
_pdbx_validate_planes.auth_asym_id    B 
_pdbx_validate_planes.auth_seq_id     1 
_pdbx_validate_planes.PDB_ins_code    ? 
_pdbx_validate_planes.label_alt_id    ? 
_pdbx_validate_planes.rmsd            0.061 
_pdbx_validate_planes.type            'SIDE CHAIN' 
1  1 Y 1 F ILE 502 ? E ILE 1  
2  1 Y 1 F SER 585 ? E SER 84 
3  1 Y 1 F GLN 586 ? E GLN 85 
4  1 Y 1 F LYS 587 ? E LYS 86 
5  1 Y 1 F ILE 588 ? E ILE 87 
6  1 Y 1 F THR 589 ? E THR 88 
7  1 Y 1 F GLY 590 ? E GLY 89 
8  1 Y 1 F SER 591 ? E SER 90 
9  1 Y 1 F PRO 592 ? E PRO 91 
10 1 Y 1 F THR 593 ? E THR 92 
11 1 Y 1 F LEU 594 ? E LEU 93 
12 1 Y 1 G ILE 502 ? F ILE 1  
13 1 Y 1 G VAL 503 ? F VAL 2  
14 1 Y 1 G ARG 504 ? F ARG 3  
15 1 Y 1 G PRO 505 ? F PRO 4  
16 1 Y 1 G SER 585 ? F SER 84 
17 1 Y 1 G GLN 586 ? F GLN 85 
18 1 Y 1 G LYS 587 ? F LYS 86 
19 1 Y 1 G ILE 588 ? F ILE 87 
20 1 Y 1 G THR 589 ? F THR 88 
21 1 Y 1 G GLY 590 ? F GLY 89 
22 1 Y 1 G SER 591 ? F SER 90 
23 1 Y 1 G PRO 592 ? F PRO 91 
24 1 Y 1 G THR 593 ? F THR 92 
25 1 Y 1 G LEU 594 ? F LEU 93 
26 1 Y 1 H ILE 502 ? G ILE 1  
27 1 Y 1 H VAL 503 ? G VAL 2  
28 1 Y 1 H ARG 504 ? G ARG 3  
29 1 Y 1 H PRO 505 ? G PRO 4  
30 1 Y 1 H SER 585 ? G SER 84 
31 1 Y 1 H GLN 586 ? G GLN 85 
32 1 Y 1 H LYS 587 ? G LYS 86 
33 1 Y 1 H ILE 588 ? G ILE 87 
34 1 Y 1 H THR 589 ? G THR 88 
35 1 Y 1 H GLY 590 ? G GLY 89 
36 1 Y 1 H SER 591 ? G SER 90 
37 1 Y 1 H PRO 592 ? G PRO 91 
38 1 Y 1 H THR 593 ? G THR 92 
39 1 Y 1 H LEU 594 ? G LEU 93 
40 1 Y 1 I ILE 502 ? H ILE 1  
41 1 Y 1 I ARG 584 ? H ARG 83 
42 1 Y 1 I SER 585 ? H SER 84 
43 1 Y 1 I GLN 586 ? H GLN 85 
44 1 Y 1 I LYS 587 ? H LYS 86 
45 1 Y 1 I ILE 588 ? H ILE 87 
46 1 Y 1 I THR 589 ? H THR 88 
47 1 Y 1 I GLY 590 ? H GLY 89 
48 1 Y 1 I SER 591 ? H SER 90 
49 1 Y 1 I PRO 592 ? H PRO 91 
50 1 Y 1 I THR 593 ? H THR 92 
51 1 Y 1 I LEU 594 ? H LEU 93 
52 1 Y 1 J SER 585 ? I SER 84 
53 1 Y 1 J GLN 586 ? I GLN 85 
54 1 Y 1 J LYS 587 ? I LYS 86 
55 1 Y 1 J ILE 588 ? I ILE 87 
56 1 Y 1 J THR 589 ? I THR 88 
57 1 Y 1 J GLY 590 ? I GLY 89 
58 1 Y 1 J SER 591 ? I SER 90 
59 1 Y 1 J PRO 592 ? I PRO 91 
60 1 Y 1 J THR 593 ? I THR 92 
61 1 Y 1 J LEU 594 ? I LEU 93 
62 1 Y 1 K SER 585 ? J SER 84 
63 1 Y 1 K GLN 586 ? J GLN 85 
64 1 Y 1 K LYS 587 ? J LYS 86 
65 1 Y 1 K ILE 588 ? J ILE 87 
66 1 Y 1 K THR 589 ? J THR 88 
67 1 Y 1 K GLY 590 ? J GLY 89 
68 1 Y 1 K SER 591 ? J SER 90 
69 1 Y 1 K PRO 592 ? J PRO 91 
70 1 Y 1 K THR 593 ? J THR 92 
71 1 Y 1 K LEU 594 ? J LEU 93 
_ndb_struct_conf_na.entry_id   2A07 
_ndb_struct_conf_na.feature    'b-form double helix' 
1 A DC 3  1_555 B DG 21 1_555 0.190  -0.020 -0.259 3.751   -8.205  6.198  1  A_DC3:DG21_B  A 3  ? B 21 ? 19 1 
1 A DT 4  1_555 B DA 20 1_555 -0.081 -0.035 0.273  -2.142  -13.395 -2.002 2  A_DT4:DA20_B  A 4  ? B 20 ? 20 1 
1 A DA 5  1_555 B DT 19 1_555 -0.332 -0.281 -0.272 -10.317 -1.377  7.125  3  A_DA5:DT19_B  A 5  ? B 19 ? 20 1 
1 A DT 6  1_555 B DA 18 1_555 0.208  -0.027 -0.240 8.117   -5.137  2.254  4  A_DT6:DA18_B  A 6  ? B 18 ? 20 1 
1 A DG 7  1_555 B DC 17 1_555 -0.076 -0.139 0.057  15.450  -7.449  0.175  5  A_DG7:DC17_B  A 7  ? B 17 ? 19 1 
1 A DA 8  1_555 B DT 16 1_555 -0.024 -0.070 0.130  9.924   -16.296 2.427  6  A_DA8:DT16_B  A 8  ? B 16 ? 20 1 
1 A DA 9  1_555 B DT 15 1_555 0.125  -0.181 0.094  5.917   -16.249 3.215  7  A_DA9:DT15_B  A 9  ? B 15 ? 20 1 
1 A DA 10 1_555 B DT 14 1_555 0.124  -0.154 0.255  4.774   -14.842 2.597  8  A_DA10:DT14_B A 10 ? B 14 ? 20 1 
1 A DC 11 1_555 B DG 13 1_555 0.399  -0.149 0.053  -2.486  -7.088  2.923  9  A_DC11:DG13_B A 11 ? B 13 ? 19 1 
1 A DA 12 1_555 B DT 12 1_555 -0.192 -0.078 -0.128 -1.730  -7.399  4.156  10 A_DA12:DT12_B A 12 ? B 12 ? 20 1 
1 A DA 13 1_555 B DT 11 1_555 0.064  -0.162 0.076  7.909   -13.264 12.754 11 A_DA13:DT11_B A 13 ? B 11 ? 20 1 
1 A DA 14 1_555 B DT 10 1_555 0.172  -0.059 -0.002 6.151   -19.838 -0.083 12 A_DA14:DT10_B A 14 ? B 10 ? 20 1 
1 A DT 15 1_555 B DA 9  1_555 -0.104 -0.190 0.213  2.120   -14.558 9.149  13 A_DT15:DA9_B  A 15 ? B 9  ? 20 1 
1 A DT 16 1_555 B DA 8  1_555 0.105  -0.166 0.197  -2.016  -18.637 7.779  14 A_DT16:DA8_B  A 16 ? B 8  ? 20 1 
1 A DT 17 1_555 B DA 7  1_555 -0.122 -0.110 0.003  -9.740  -18.249 6.978  15 A_DT17:DA7_B  A 17 ? B 7  ? 20 1 
1 A DT 18 1_555 B DA 6  1_555 0.085  -0.097 -0.171 -2.266  -12.167 5.160  16 A_DT18:DA6_B  A 18 ? B 6  ? 20 1 
1 A DC 19 1_555 B DG 5  1_555 -0.071 -0.173 -0.103 -2.953  -4.322  1.882  17 A_DC19:DG5_B  A 19 ? B 5  ? 19 1 
1 A DC 20 1_555 B DG 4  1_555 0.117  -0.197 0.069  -1.720  -3.041  1.328  18 A_DC20:DG4_B  A 20 ? B 4  ? 19 1 
1 A DT 21 1_555 B DA 3  1_555 0.215  -0.145 -0.308 8.109   -10.988 -1.346 19 A_DT21:DA3_B  A 21 ? B 3  ? 20 1 
1 C DC 3  1_555 D DG 21 1_555 0.262  -0.108 -0.292 3.742   -9.058  3.419  20 C_DC3:DG21_D  C 3  ? D 21 ? 19 1 
1 C DT 4  1_555 D DA 20 1_555 -0.115 -0.126 0.159  -0.244  -10.975 0.538  21 C_DT4:DA20_D  C 4  ? D 20 ? 20 1 
1 C DA 5  1_555 D DT 19 1_555 -0.296 -0.092 -0.243 -6.838  -2.720  7.086  22 C_DA5:DT19_D  C 5  ? D 19 ? 20 1 
1 C DT 6  1_555 D DA 18 1_555 0.130  -0.071 -0.287 7.795   -2.869  2.226  23 C_DT6:DA18_D  C 6  ? D 18 ? 20 1 
1 C DG 7  1_555 D DC 17 1_555 -0.111 -0.093 0.112  15.436  -7.395  -0.101 24 C_DG7:DC17_D  C 7  ? D 17 ? 19 1 
1 C DA 8  1_555 D DT 16 1_555 0.034  -0.102 0.130  11.000  -17.294 2.207  25 C_DA8:DT16_D  C 8  ? D 16 ? 20 1 
1 C DA 9  1_555 D DT 15 1_555 0.123  -0.161 0.118  6.307   -16.778 2.963  26 C_DA9:DT15_D  C 9  ? D 15 ? 20 1 
1 C DA 10 1_555 D DT 14 1_555 0.030  -0.164 0.226  4.929   -14.747 1.616  27 C_DA10:DT14_D C 10 ? D 14 ? 20 1 
1 C DC 11 1_555 D DG 13 1_555 0.279  -0.222 0.038  -1.443  -6.835  1.282  28 C_DC11:DG13_D C 11 ? D 13 ? 19 1 
1 C DA 12 1_555 D DT 12 1_555 -0.178 -0.082 -0.119 -0.661  -7.261  2.634  29 C_DA12:DT12_D C 12 ? D 12 ? 20 1 
1 C DA 13 1_555 D DT 11 1_555 -0.016 -0.149 0.035  5.671   -13.947 12.075 30 C_DA13:DT11_D C 13 ? D 11 ? 20 1 
1 C DA 14 1_555 D DT 10 1_555 0.161  -0.032 -0.077 5.433   -19.554 0.593  31 C_DA14:DT10_D C 14 ? D 10 ? 20 1 
1 C DT 15 1_555 D DA 9  1_555 -0.061 -0.126 0.137  3.380   -15.231 8.834  32 C_DT15:DA9_D  C 15 ? D 9  ? 20 1 
1 C DT 16 1_555 D DA 8  1_555 0.075  -0.144 0.178  -1.291  -18.114 7.638  33 C_DT16:DA8_D  C 16 ? D 8  ? 20 1 
1 C DT 17 1_555 D DA 7  1_555 0.030  -0.065 0.027  -7.351  -18.822 3.644  34 C_DT17:DA7_D  C 17 ? D 7  ? 20 1 
1 C DT 18 1_555 D DA 6  1_555 -0.045 -0.195 -0.162 -3.865  -12.199 3.280  35 C_DT18:DA6_D  C 18 ? D 6  ? 20 1 
1 C DC 19 1_555 D DG 5  1_555 -0.098 -0.207 -0.030 -1.293  -6.363  2.179  36 C_DC19:DG5_D  C 19 ? D 5  ? 19 1 
1 C DC 20 1_555 D DG 4  1_555 0.100  -0.140 0.064  -3.599  -4.152  1.779  37 C_DC20:DG4_D  C 20 ? D 4  ? 19 1 
1 C DT 21 1_555 D DA 3  1_555 0.018  -0.155 -0.406 7.524   -9.725  4.675  38 C_DT21:DA3_D  C 21 ? D 3  ? 20 1 
1 A DC 3  1_555 B DG 21 1_555 A DT 4  1_555 B DA 20 1_555 -0.754 -0.303 3.496 -4.483 5.448  32.698 -1.497 0.512  3.472 9.539  
7.849  33.430 1  AA_DC3DT4:DA20DG21_BB   A 3  ? B 21 ? A 4  ? B 20 ? 
1 A DT 4  1_555 B DA 20 1_555 A DA 5  1_555 B DT 19 1_555 0.972  1.037  3.462 5.275  -2.109 40.324 1.740  -0.772 3.500 -3.041 
-7.607 40.706 2  AA_DT4DA5:DT19DA20_BB   A 4  ? B 20 ? A 5  ? B 19 ? 
1 A DA 5  1_555 B DT 19 1_555 A DT 6  1_555 B DA 18 1_555 -0.322 -0.311 2.879 -0.353 8.500  26.993 -2.348 0.587  2.663 17.662 
0.733  28.278 3  AA_DA5DT6:DA18DT19_BB   A 5  ? B 19 ? A 6  ? B 18 ? 
1 A DT 6  1_555 B DA 18 1_555 A DG 7  1_555 B DC 17 1_555 -0.657 1.070  3.191 -2.283 3.811  35.554 1.193  0.741  3.319 6.211  
3.721  35.822 4  AA_DT6DG7:DC17DA18_BB   A 6  ? B 18 ? A 7  ? B 17 ? 
1 A DG 7  1_555 B DC 17 1_555 A DA 8  1_555 B DT 16 1_555 -0.091 0.244  3.374 -0.496 0.920  39.726 0.248  0.075  3.380 1.353  
0.730  39.739 5  AA_DG7DA8:DT16DC17_BB   A 7  ? B 17 ? A 8  ? B 16 ? 
1 A DA 8  1_555 B DT 16 1_555 A DA 9  1_555 B DT 15 1_555 0.207  -0.364 3.274 0.484  -0.133 37.176 -0.554 -0.261 3.277 -0.209 
-0.760 37.179 6  AA_DA8DA9:DT15DT16_BB   A 8  ? B 16 ? A 9  ? B 15 ? 
1 A DA 9  1_555 B DT 15 1_555 A DA 10 1_555 B DT 14 1_555 0.332  -0.398 3.241 -1.120 -4.469 36.535 -0.024 -0.678 3.254 -7.094 
1.778  36.815 7  AA_DA9DA10:DT14DT15_BB  A 9  ? B 15 ? A 10 ? B 14 ? 
1 A DA 10 1_555 B DT 14 1_555 A DC 11 1_555 B DG 13 1_555 0.423  -0.779 3.487 0.725  1.192  36.800 -1.406 -0.565 3.469 1.887  
-1.147 36.826 8  AA_DA10DC11:DG13DT14_BB A 10 ? B 14 ? A 11 ? B 13 ? 
1 A DC 11 1_555 B DG 13 1_555 A DA 12 1_555 B DT 12 1_555 0.016  0.073  3.338 1.903  6.946  27.729 -1.462 0.408  3.253 14.192 
-3.887 28.631 9  AA_DC11DA12:DT12DG13_BB A 11 ? B 13 ? A 12 ? B 12 ? 
1 A DA 12 1_555 B DT 12 1_555 A DA 13 1_555 B DT 11 1_555 0.751  -0.362 3.016 -0.272 5.863  30.312 -1.718 -1.460 2.890 11.081 
0.513  30.862 10 AA_DA12DA13:DT11DT12_BB A 12 ? B 12 ? A 13 ? B 11 ? 
1 A DA 13 1_555 B DT 11 1_555 A DA 14 1_555 B DT 10 1_555 -1.140 -0.160 3.348 -2.052 1.122  35.789 -0.426 1.548  3.400 1.824  
3.334  35.863 11 AA_DA13DA14:DT10DT11_BB A 13 ? B 11 ? A 14 ? B 10 ? 
1 A DA 14 1_555 B DT 10 1_555 A DT 15 1_555 B DA 9  1_555 0.574  -0.904 3.329 -1.239 1.203  29.414 -2.036 -1.396 3.264 2.367  
2.438  29.463 12 AA_DA14DT15:DA9DT10_BB  A 14 ? B 10 ? A 15 ? B 9  ? 
1 A DT 15 1_555 B DA 9  1_555 A DT 16 1_555 B DA 8  1_555 -0.366 -0.617 3.296 -1.911 2.618  36.329 -1.350 0.320  3.260 4.189  
3.057  36.469 13 AA_DT15DT16:DA8DA9_BB   A 15 ? B 9  ? A 16 ? B 8  ? 
1 A DT 16 1_555 B DA 8  1_555 A DT 17 1_555 B DA 7  1_555 -0.328 -0.176 3.335 0.893  2.851  32.113 -0.831 0.752  3.298 5.140  
-1.611 32.248 14 AA_DT16DT17:DA7DA8_BB   A 16 ? B 8  ? A 17 ? B 7  ? 
1 A DT 17 1_555 B DA 7  1_555 A DT 18 1_555 B DA 6  1_555 0.135  0.048  3.047 1.100  5.586  35.560 -0.665 -0.073 3.023 9.075  
-1.787 35.999 15 AA_DT17DT18:DA6DA7_BB   A 17 ? B 7  ? A 18 ? B 6  ? 
1 A DT 18 1_555 B DA 6  1_555 A DC 19 1_555 B DG 5  1_555 0.091  0.411  3.328 -0.746 5.198  32.366 -0.190 -0.293 3.349 9.249  
1.328  32.778 16 AA_DT18DC19:DG5DA6_BB   A 18 ? B 6  ? A 19 ? B 5  ? 
1 A DC 19 1_555 B DG 5  1_555 A DC 20 1_555 B DG 4  1_555 0.507  -0.510 3.255 0.692  8.888  36.308 -1.945 -0.703 3.059 14.005 
-1.091 37.351 17 AA_DC19DC20:DG4DG5_BB   A 19 ? B 5  ? A 20 ? B 4  ? 
1 A DC 20 1_555 B DG 4  1_555 A DT 21 1_555 B DA 3  1_555 -0.383 -0.198 3.062 2.531  4.805  33.644 -1.047 1.027  2.970 8.234  
-4.337 34.067 18 AA_DC20DT21:DA3DG4_BB   A 20 ? B 4  ? A 21 ? B 3  ? 
1 C DC 3  1_555 D DG 21 1_555 C DT 4  1_555 D DA 20 1_555 -0.615 -0.181 3.432 -3.962 5.495  31.181 -1.385 0.357  3.402 10.075 
7.263  31.891 19 CC_DC3DT4:DA20DG21_DD   C 3  ? D 21 ? C 4  ? D 20 ? 
1 C DT 4  1_555 D DA 20 1_555 C DA 5  1_555 D DT 19 1_555 0.963  0.956  3.469 4.498  -1.392 41.182 1.510  -0.847 3.518 -1.971 
-6.370 41.438 20 CC_DT4DA5:DT19DA20_DD   C 4  ? D 20 ? C 5  ? D 19 ? 
1 C DA 5  1_555 D DT 19 1_555 C DT 6  1_555 D DA 18 1_555 -0.311 -0.206 2.952 0.071  8.485  26.172 -2.297 0.670  2.750 18.140 
-0.151 27.490 21 CC_DA5DT6:DA18DT19_DD   C 5  ? D 19 ? C 6  ? D 18 ? 
1 C DT 6  1_555 D DA 18 1_555 C DG 7  1_555 D DC 17 1_555 -0.657 1.057  3.188 -2.313 3.190  35.827 1.259  0.736  3.301 5.166  
3.746  36.036 22 CC_DT6DG7:DC17DA18_DD   C 6  ? D 18 ? C 7  ? D 17 ? 
1 C DG 7  1_555 D DC 17 1_555 C DA 8  1_555 D DT 16 1_555 -0.045 0.218  3.354 0.490  0.904  40.212 0.212  0.122  3.357 1.314  
-0.713 40.225 23 CC_DG7DA8:DT16DC17_DD   C 7  ? D 17 ? C 8  ? D 16 ? 
1 C DA 8  1_555 D DT 16 1_555 C DA 9  1_555 D DT 15 1_555 0.220  -0.380 3.291 0.399  0.583  36.319 -0.691 -0.296 3.287 0.935  
-0.640 36.326 24 CC_DA8DA9:DT15DT16_DD   C 8  ? D 16 ? C 9  ? D 15 ? 
1 C DA 9  1_555 D DT 15 1_555 C DA 10 1_555 D DT 14 1_555 0.328  -0.429 3.257 -0.989 -4.594 35.782 -0.040 -0.669 3.275 -7.438 
1.600  36.079 25 CC_DA9DA10:DT14DT15_DD  C 9  ? D 15 ? C 10 ? D 14 ? 
1 C DA 10 1_555 D DT 14 1_555 C DC 11 1_555 D DG 13 1_555 0.422  -0.783 3.457 0.622  0.640  37.122 -1.319 -0.576 3.450 1.005  
-0.976 37.132 26 CC_DA10DC11:DG13DT14_DD C 10 ? D 14 ? C 11 ? D 13 ? 
1 C DC 11 1_555 D DG 13 1_555 C DA 12 1_555 D DT 12 1_555 0.070  0.017  3.348 2.183  6.974  27.941 -1.559 0.359  3.253 14.138 
-4.426 28.863 27 CC_DC11DA12:DT12DG13_DD C 11 ? D 13 ? C 12 ? D 12 ? 
1 C DA 12 1_555 D DT 12 1_555 C DA 13 1_555 D DT 11 1_555 0.796  -0.382 3.107 -0.298 6.251  30.106 -1.869 -1.557 2.962 11.874 
0.566  30.735 28 CC_DA12DA13:DT11DT12_DD C 12 ? D 12 ? C 13 ? D 11 ? 
1 C DA 13 1_555 D DT 11 1_555 C DA 14 1_555 D DT 10 1_555 -1.131 -0.113 3.309 -1.492 1.717  36.333 -0.425 1.599  3.343 2.751  
2.390  36.402 29 CC_DA13DA14:DT10DT11_DD C 13 ? D 11 ? C 14 ? D 10 ? 
1 C DA 14 1_555 D DT 10 1_555 C DT 15 1_555 D DA 9  1_555 0.509  -0.856 3.269 -1.574 0.939  29.692 -1.863 -1.317 3.210 1.829  
3.068  29.748 30 CC_DA14DT15:DA9DT10_DD  C 14 ? D 10 ? C 15 ? D 9  ? 
1 C DT 15 1_555 D DA 9  1_555 C DT 16 1_555 D DA 8  1_555 -0.343 -0.630 3.343 -1.948 3.164  35.534 -1.492 0.272  3.290 5.167  
3.182  35.721 31 CC_DT15DT16:DA8DA9_DD   C 15 ? D 9  ? C 16 ? D 8  ? 
1 C DT 16 1_555 D DA 8  1_555 C DT 17 1_555 D DA 7  1_555 -0.398 -0.233 3.312 -0.076 3.059  33.922 -0.889 0.667  3.280 5.230  
0.129  34.056 32 CC_DT16DT17:DA7DA8_DD   C 16 ? D 8  ? C 17 ? D 7  ? 
1 C DT 17 1_555 D DA 7  1_555 C DT 18 1_555 D DA 6  1_555 0.189  0.127  3.135 1.615  4.910  34.678 -0.499 -0.081 3.129 8.181  
-2.691 35.050 33 CC_DT17DT18:DA6DA7_DD   C 17 ? D 7  ? C 18 ? D 6  ? 
1 C DT 18 1_555 D DA 6  1_555 C DC 19 1_555 D DG 5  1_555 0.059  0.346  3.244 -1.573 5.608  31.442 -0.389 -0.393 3.249 10.238 
2.871  31.963 34 CC_DT18DC19:DG5DA6_DD   C 18 ? D 6  ? C 19 ? D 5  ? 
1 C DC 19 1_555 D DG 5  1_555 C DC 20 1_555 D DG 4  1_555 0.511  -0.516 3.362 1.404  9.756  37.306 -2.005 -0.598 3.150 14.934 
-2.150 38.541 35 CC_DC19DC20:DG4DG5_DD   C 19 ? D 5  ? C 20 ? D 4  ? 
1 C DC 20 1_555 D DG 4  1_555 C DT 21 1_555 D DA 3  1_555 -0.353 -0.083 3.038 2.262  4.269  30.870 -0.902 1.051  2.967 7.958  
-4.218 31.237 36 CC_DC20DT21:DA3DG4_DD   C 20 ? D 4  ? C 21 ? D 3  ? 
5 water           HOH 
K 4 MG  1   601 1   MG  MG  F . 
L 4 MG  1   604 4   MG  MG  G . 
M 4 MG  1   602 2   MG  MG  H . 
N 4 MG  1   603 3   MG  MG  I . 
O 4 MG  1   605 5   MG  MG  J . 
P 4 MG  1   606 6   MG  MG  K . 
Q 5 HOH 1   22  2   HOH HOH A . 
Q 5 HOH 2   23  12  HOH HOH A . 
Q 5 HOH 3   24  15  HOH HOH A . 
Q 5 HOH 4   25  17  HOH HOH A . 
Q 5 HOH 5   26  28  HOH HOH A . 
Q 5 HOH 6   27  44  HOH HOH A . 
Q 5 HOH 7   28  56  HOH HOH A . 
Q 5 HOH 8   29  61  HOH HOH A . 
Q 5 HOH 9   30  62  HOH HOH A . 
Q 5 HOH 10  31  65  HOH HOH A . 
Q 5 HOH 11  32  94  HOH HOH A . 
Q 5 HOH 12  33  106 HOH HOH A . 
Q 5 HOH 13  34  111 HOH HOH A . 
Q 5 HOH 14  35  124 HOH HOH A . 
Q 5 HOH 15  36  153 HOH HOH A . 
Q 5 HOH 16  37  165 HOH HOH A . 
Q 5 HOH 17  38  177 HOH HOH A . 
Q 5 HOH 18  39  190 HOH HOH A . 
Q 5 HOH 19  40  211 HOH HOH A . 
Q 5 HOH 20  41  216 HOH HOH A . 
Q 5 HOH 21  42  217 HOH HOH A . 
Q 5 HOH 22  43  221 HOH HOH A . 
Q 5 HOH 23  44  225 HOH HOH A . 
Q 5 HOH 24  45  229 HOH HOH A . 
Q 5 HOH 25  46  233 HOH HOH A . 
Q 5 HOH 26  47  237 HOH HOH A . 
Q 5 HOH 27  48  238 HOH HOH A . 
Q 5 HOH 28  49  251 HOH HOH A . 
Q 5 HOH 29  50  252 HOH HOH A . 
Q 5 HOH 30  51  280 HOH HOH A . 
Q 5 HOH 31  52  291 HOH HOH A . 
Q 5 HOH 32  53  321 HOH HOH A . 
Q 5 HOH 33  54  323 HOH HOH A . 
Q 5 HOH 34  55  324 HOH HOH A . 
Q 5 HOH 35  56  366 HOH HOH A . 
Q 5 HOH 36  57  368 HOH HOH A . 
Q 5 HOH 37  58  388 HOH HOH A . 
Q 5 HOH 38  59  391 HOH HOH A . 
Q 5 HOH 39  60  400 HOH HOH A . 
Q 5 HOH 40  61  409 HOH HOH A . 
Q 5 HOH 41  62  432 HOH HOH A . 
Q 5 HOH 42  63  460 HOH HOH A . 
Q 5 HOH 43  64  466 HOH HOH A . 
Q 5 HOH 44  65  494 HOH HOH A . 
Q 5 HOH 45  66  504 HOH HOH A . 
Q 5 HOH 46  67  529 HOH HOH A . 
Q 5 HOH 47  68  531 HOH HOH A . 
Q 5 HOH 48  69  545 HOH HOH A . 
Q 5 HOH 49  70  565 HOH HOH A . 
Q 5 HOH 50  71  566 HOH HOH A . 
Q 5 HOH 51  72  567 HOH HOH A . 
Q 5 HOH 52  73  581 HOH HOH A . 
R 5 HOH 1   22  4   HOH HOH B . 
R 5 HOH 2   23  11  HOH HOH B . 
R 5 HOH 3   24  19  HOH HOH B . 
R 5 HOH 4   25  39  HOH HOH B . 
R 5 HOH 5   26  42  HOH HOH B . 
R 5 HOH 6   27  46  HOH HOH B . 
R 5 HOH 7   28  49  HOH HOH B . 
R 5 HOH 8   29  64  HOH HOH B . 
R 5 HOH 9   30  76  HOH HOH B . 
R 5 HOH 10  31  77  HOH HOH B . 
R 5 HOH 11  32  83  HOH HOH B . 
R 5 HOH 12  33  107 HOH HOH B . 
R 5 HOH 13  34  116 HOH HOH B . 
R 5 HOH 14  35  125 HOH HOH B . 
R 5 HOH 15  36  128 HOH HOH B . 
R 5 HOH 16  37  137 HOH HOH B . 
R 5 HOH 17  38  147 HOH HOH B . 
R 5 HOH 18  39  149 HOH HOH B . 
R 5 HOH 19  40  152 HOH HOH B . 
R 5 HOH 20  41  158 HOH HOH B . 
R 5 HOH 21  42  161 HOH HOH B . 
R 5 HOH 22  43  170 HOH HOH B . 
R 5 HOH 23  44  171 HOH HOH B . 
R 5 HOH 24  45  185 HOH HOH B . 
R 5 HOH 25  46  194 HOH HOH B . 
R 5 HOH 26  47  232 HOH HOH B . 
R 5 HOH 27  48  236 HOH HOH B . 
R 5 HOH 28  49  244 HOH HOH B . 
R 5 HOH 29  50  247 HOH HOH B . 
R 5 HOH 30  51  250 HOH HOH B . 
R 5 HOH 31  52  288 HOH HOH B . 
R 5 HOH 32  53  292 HOH HOH B . 
R 5 HOH 33  54  356 HOH HOH B . 
R 5 HOH 34  55  367 HOH HOH B . 
R 5 HOH 35  56  369 HOH HOH B . 
R 5 HOH 36  57  370 HOH HOH B . 
R 5 HOH 37  58  378 HOH HOH B . 
R 5 HOH 38  59  379 HOH HOH B . 
R 5 HOH 39  60  386 HOH HOH B . 
R 5 HOH 40  61  387 HOH HOH B . 
R 5 HOH 41  62  393 HOH HOH B . 
R 5 HOH 42  63  398 HOH HOH B . 
R 5 HOH 43  64  404 HOH HOH B . 
R 5 HOH 44  65  405 HOH HOH B . 
R 5 HOH 45  66  411 HOH HOH B . 
R 5 HOH 46  67  456 HOH HOH B . 
R 5 HOH 47  68  468 HOH HOH B . 
R 5 HOH 48  69  474 HOH HOH B . 
R 5 HOH 49  70  475 HOH HOH B . 
R 5 HOH 50  71  530 HOH HOH B . 
R 5 HOH 51  72  537 HOH HOH B . 
R 5 HOH 52  73  541 HOH HOH B . 
R 5 HOH 53  74  563 HOH HOH B . 
R 5 HOH 54  75  564 HOH HOH B . 
R 5 HOH 55  76  568 HOH HOH B . 
S 5 HOH 1   22  10  HOH HOH C . 
S 5 HOH 2   23  18  HOH HOH C . 
S 5 HOH 3   24  20  HOH HOH C . 
S 5 HOH 4   25  35  HOH HOH C . 
S 5 HOH 5   26  36  HOH HOH C . 
S 5 HOH 6   27  40  HOH HOH C . 
S 5 HOH 7   28  51  HOH HOH C . 
S 5 HOH 8   29  67  HOH HOH C . 
S 5 HOH 9   30  78  HOH HOH C . 
S 5 HOH 10  31  96  HOH HOH C . 
S 5 HOH 11  32  108 HOH HOH C . 
S 5 HOH 12  33  114 HOH HOH C . 
S 5 HOH 13  34  115 HOH HOH C . 
S 5 HOH 14  35  122 HOH HOH C . 
S 5 HOH 15  36  146 HOH HOH C . 
S 5 HOH 16  37  155 HOH HOH C . 
S 5 HOH 17  38  191 HOH HOH C . 
S 5 HOH 18  39  192 HOH HOH C . 
S 5 HOH 19  40  199 HOH HOH C . 
S 5 HOH 20  41  206 HOH HOH C . 
S 5 HOH 21  42  223 HOH HOH C . 
S 5 HOH 22  43  226 HOH HOH C . 
S 5 HOH 23  44  227 HOH HOH C . 
S 5 HOH 24  45  241 HOH HOH C . 
S 5 HOH 25  46  253 HOH HOH C . 
S 5 HOH 26  47  255 HOH HOH C . 
S 5 HOH 27  48  263 HOH HOH C . 
S 5 HOH 28  49  303 HOH HOH C . 
S 5 HOH 29  50  304 HOH HOH C . 
S 5 HOH 30  51  342 HOH HOH C . 
S 5 HOH 31  52  408 HOH HOH C . 
S 5 HOH 32  53  424 HOH HOH C . 
S 5 HOH 33  54  434 HOH HOH C . 
S 5 HOH 34  55  441 HOH HOH C . 
S 5 HOH 35  56  457 HOH HOH C . 
S 5 HOH 36  57  497 HOH HOH C . 
S 5 HOH 37  58  506 HOH HOH C . 
S 5 HOH 38  59  559 HOH HOH C . 
S 5 HOH 39  60  560 HOH HOH C . 
S 5 HOH 40  61  569 HOH HOH C . 
S 5 HOH 41  62  570 HOH HOH C . 
S 5 HOH 42  63  571 HOH HOH C . 
S 5 HOH 43  64  572 HOH HOH C . 
S 5 HOH 44  65  577 HOH HOH C . 
T 5 HOH 1   22  5   HOH HOH D . 
T 5 HOH 2   23  7   HOH HOH D . 
T 5 HOH 3   24  8   HOH HOH D . 
T 5 HOH 4   25  25  HOH HOH D . 
T 5 HOH 5   26  45  HOH HOH D . 
T 5 HOH 6   27  47  HOH HOH D . 
T 5 HOH 7   28  55  HOH HOH D . 
T 5 HOH 8   29  57  HOH HOH D . 
T 5 HOH 9   30  95  HOH HOH D . 
T 5 HOH 10  31  121 HOH HOH D . 
T 5 HOH 11  32  132 HOH HOH D . 
T 5 HOH 12  33  135 HOH HOH D . 
T 5 HOH 13  34  136 HOH HOH D . 
T 5 HOH 14  35  138 HOH HOH D . 
T 5 HOH 15  36  142 HOH HOH D . 
T 5 HOH 16  37  145 HOH HOH D . 
T 5 HOH 17  38  159 HOH HOH D . 
T 5 HOH 18  39  167 HOH HOH D . 
T 5 HOH 19  40  181 HOH HOH D . 
T 5 HOH 20  41  186 HOH HOH D . 
T 5 HOH 21  42  198 HOH HOH D . 
T 5 HOH 22  43  200 HOH HOH D . 
T 5 HOH 23  44  202 HOH HOH D . 
T 5 HOH 24  45  204 HOH HOH D . 
T 5 HOH 25  46  207 HOH HOH D . 
T 5 HOH 26  47  209 HOH HOH D . 
T 5 HOH 27  48  210 HOH HOH D . 
T 5 HOH 28  49  230 HOH HOH D . 
T 5 HOH 29  50  231 HOH HOH D . 
T 5 HOH 30  51  235 HOH HOH D . 
T 5 HOH 31  52  246 HOH HOH D . 
T 5 HOH 32  53  249 HOH HOH D . 
T 5 HOH 33  54  264 HOH HOH D . 
T 5 HOH 34  55  297 HOH HOH D . 
T 5 HOH 35  56  343 HOH HOH D . 
T 5 HOH 36  57  362 HOH HOH D . 
T 5 HOH 37  58  371 HOH HOH D . 
T 5 HOH 38  59  372 HOH HOH D . 
T 5 HOH 39  60  373 HOH HOH D . 
T 5 HOH 40  61  385 HOH HOH D . 
T 5 HOH 41  62  399 HOH HOH D . 
T 5 HOH 42  63  436 HOH HOH D . 
T 5 HOH 43  64  437 HOH HOH D . 
T 5 HOH 44  65  438 HOH HOH D . 
T 5 HOH 45  66  453 HOH HOH D . 
T 5 HOH 46  67  454 HOH HOH D . 
T 5 HOH 47  68  498 HOH HOH D . 
T 5 HOH 48  69  499 HOH HOH D . 
T 5 HOH 49  70  500 HOH HOH D . 
T 5 HOH 50  71  501 HOH HOH D . 
T 5 HOH 51  72  502 HOH HOH D . 
T 5 HOH 52  73  503 HOH HOH D . 
T 5 HOH 53  74  512 HOH HOH D . 
T 5 HOH 54  75  513 HOH HOH D . 
T 5 HOH 55  76  521 HOH HOH D . 
T 5 HOH 56  77  522 HOH HOH D . 
T 5 HOH 57  78  523 HOH HOH D . 
T 5 HOH 58  79  552 HOH HOH D . 
T 5 HOH 59  80  573 HOH HOH D . 
U 5 HOH 1   602 48  HOH HOH F . 
U 5 HOH 2   603 52  HOH HOH F . 
U 5 HOH 3   604 91  HOH HOH F . 
U 5 HOH 4   605 92  HOH HOH F . 
U 5 HOH 5   606 151 HOH HOH F . 
U 5 HOH 6   607 156 HOH HOH F . 
U 5 HOH 7   608 162 HOH HOH F . 
U 5 HOH 8   609 239 HOH HOH F . 
U 5 HOH 9   610 243 HOH HOH F . 
U 5 HOH 10  611 259 HOH HOH F . 
U 5 HOH 11  612 265 HOH HOH F . 
U 5 HOH 12  613 266 HOH HOH F . 
U 5 HOH 13  614 281 HOH HOH F . 
U 5 HOH 14  615 282 HOH HOH F . 
U 5 HOH 15  616 283 HOH HOH F . 
U 5 HOH 16  617 285 HOH HOH F . 
U 5 HOH 17  618 286 HOH HOH F . 
U 5 HOH 18  619 289 HOH HOH F . 
U 5 HOH 19  620 290 HOH HOH F . 
U 5 HOH 20  621 294 HOH HOH F . 
U 5 HOH 21  622 298 HOH HOH F . 
U 5 HOH 22  623 299 HOH HOH F . 
U 5 HOH 23  624 377 HOH HOH F . 
U 5 HOH 24  625 395 HOH HOH F . 
U 5 HOH 25  626 416 HOH HOH F . 
U 5 HOH 26  627 417 HOH HOH F . 
U 5 HOH 27  628 418 HOH HOH F . 
U 5 HOH 28  629 419 HOH HOH F . 
U 5 HOH 29  630 420 HOH HOH F . 
U 5 HOH 30  631 421 HOH HOH F . 
U 5 HOH 31  632 422 HOH HOH F . 
U 5 HOH 32  633 423 HOH HOH F . 
U 5 HOH 33  634 425 HOH HOH F . 
U 5 HOH 34  635 426 HOH HOH F . 
U 5 HOH 35  636 427 HOH HOH F . 
U 5 HOH 36  637 428 HOH HOH F . 
U 5 HOH 37  638 430 HOH HOH F . 
U 5 HOH 38  639 433 HOH HOH F . 
U 5 HOH 39  640 576 HOH HOH F . 
V 5 HOH 1   605 14  HOH HOH G . 
V 5 HOH 2   606 27  HOH HOH G . 
V 5 HOH 3   607 70  HOH HOH G . 
V 5 HOH 4   608 87  HOH HOH G . 
V 5 HOH 5   609 88  HOH HOH G . 
V 5 HOH 6   610 101 HOH HOH G . 
V 5 HOH 7   611 105 HOH HOH G . 
V 5 HOH 8   612 131 HOH HOH G . 
V 5 HOH 9   613 163 HOH HOH G . 
V 5 HOH 10  614 164 HOH HOH G . 
V 5 HOH 11  615 172 HOH HOH G . 
V 5 HOH 12  616 176 HOH HOH G . 
V 5 HOH 13  617 179 HOH HOH G . 
V 5 HOH 14  618 196 HOH HOH G . 
V 5 HOH 15  619 213 HOH HOH G . 
V 5 HOH 16  620 218 HOH HOH G . 
V 5 HOH 17  621 222 HOH HOH G . 
V 5 HOH 18  622 261 HOH HOH G . 
V 5 HOH 19  623 269 HOH HOH G . 
V 5 HOH 20  624 270 HOH HOH G . 
V 5 HOH 21  625 284 HOH HOH G . 
V 5 HOH 22  626 287 HOH HOH G . 
V 5 HOH 23  627 295 HOH HOH G . 
V 5 HOH 24  628 300 HOH HOH G . 
V 5 HOH 25  629 301 HOH HOH G . 
V 5 HOH 26  630 302 HOH HOH G . 
V 5 HOH 27  631 305 HOH HOH G . 
V 5 HOH 28  632 306 HOH HOH G . 
V 5 HOH 29  633 307 HOH HOH G . 
V 5 HOH 30  634 308 HOH HOH G . 
V 5 HOH 31  635 392 HOH HOH G . 
V 5 HOH 32  636 413 HOH HOH G . 
V 5 HOH 33  637 414 HOH HOH G . 
V 5 HOH 34  638 415 HOH HOH G . 
V 5 HOH 35  639 435 HOH HOH G . 
V 5 HOH 36  640 442 HOH HOH G . 
V 5 HOH 37  641 443 HOH HOH G . 
V 5 HOH 38  642 446 HOH HOH G . 
V 5 HOH 39  643 561 HOH HOH G . 
W 5 HOH 1   68  68  HOH HOH H . 
W 5 HOH 2   75  75  HOH HOH H . 
W 5 HOH 3   97  97  HOH HOH H . 
W 5 HOH 4   98  98  HOH HOH H . 
W 5 HOH 5   110 110 HOH HOH H . 
W 5 HOH 6   129 129 HOH HOH H . 
W 5 HOH 7   133 133 HOH HOH H . 
W 5 HOH 8   169 169 HOH HOH H . 
W 5 HOH 9   183 183 HOH HOH H . 
W 5 HOH 10  187 187 HOH HOH H . 
W 5 HOH 11  201 201 HOH HOH H . 
W 5 HOH 12  205 205 HOH HOH H . 
W 5 HOH 13  208 208 HOH HOH H . 
W 5 HOH 14  220 220 HOH HOH H . 
W 5 HOH 15  267 267 HOH HOH H . 
W 5 HOH 16  271 271 HOH HOH H . 
W 5 HOH 17  274 274 HOH HOH H . 
W 5 HOH 18  312 312 HOH HOH H . 
W 5 HOH 19  313 313 HOH HOH H . 
W 5 HOH 20  314 314 HOH HOH H . 
W 5 HOH 21  315 315 HOH HOH H . 
W 5 HOH 22  318 318 HOH HOH H . 
W 5 HOH 23  319 319 HOH HOH H . 
W 5 HOH 24  327 327 HOH HOH H . 
W 5 HOH 25  328 328 HOH HOH H . 
W 5 HOH 26  329 329 HOH HOH H . 
W 5 HOH 27  330 330 HOH HOH H . 
W 5 HOH 28  332 332 HOH HOH H . 
W 5 HOH 29  333 333 HOH HOH H . 
W 5 HOH 30  334 334 HOH HOH H . 
W 5 HOH 31  336 336 HOH HOH H . 
W 5 HOH 32  339 339 HOH HOH H . 
W 5 HOH 33  374 374 HOH HOH H . 
W 5 HOH 34  390 390 HOH HOH H . 
W 5 HOH 35  394 394 HOH HOH H . 
W 5 HOH 36  397 397 HOH HOH H . 
W 5 HOH 37  449 449 HOH HOH H . 
W 5 HOH 38  451 451 HOH HOH H . 
W 5 HOH 39  452 452 HOH HOH H . 
W 5 HOH 40  455 455 HOH HOH H . 
W 5 HOH 41  458 458 HOH HOH H . 
W 5 HOH 42  459 459 HOH HOH H . 
W 5 HOH 43  469 469 HOH HOH H . 
W 5 HOH 44  473 473 HOH HOH H . 
W 5 HOH 45  476 476 HOH HOH H . 
W 5 HOH 46  477 477 HOH HOH H . 
W 5 HOH 47  478 478 HOH HOH H . 
W 5 HOH 48  479 479 HOH HOH H . 
W 5 HOH 49  481 481 HOH HOH H . 
W 5 HOH 50  482 482 HOH HOH H . 
W 5 HOH 51  483 483 HOH HOH H . 
W 5 HOH 52  485 485 HOH HOH H . 
W 5 HOH 53  490 490 HOH HOH H . 
W 5 HOH 54  492 492 HOH HOH H . 
X 5 HOH 1   604 13  HOH HOH I . 
X 5 HOH 2   605 50  HOH HOH I . 
X 5 HOH 3   606 66  HOH HOH I . 
X 5 HOH 4   607 81  HOH HOH I . 
X 5 HOH 5   608 118 HOH HOH I . 
X 5 HOH 6   609 140 HOH HOH I . 
X 5 HOH 7   610 148 HOH HOH I . 
X 5 HOH 8   611 178 HOH HOH I . 
X 5 HOH 9   612 195 HOH HOH I . 
X 5 HOH 10  613 245 HOH HOH I . 
X 5 HOH 11  614 248 HOH HOH I . 
X 5 HOH 12  615 258 HOH HOH I . 
X 5 HOH 13  616 268 HOH HOH I . 
X 5 HOH 14  617 311 HOH HOH I . 
X 5 HOH 15  618 316 HOH HOH I . 
X 5 HOH 16  619 317 HOH HOH I . 
X 5 HOH 17  620 320 HOH HOH I . 
X 5 HOH 18  621 322 HOH HOH I . 
X 5 HOH 19  622 331 HOH HOH I . 
X 5 HOH 20  623 335 HOH HOH I . 
X 5 HOH 21  624 337 HOH HOH I . 
X 5 HOH 22  625 338 HOH HOH I . 
X 5 HOH 23  626 340 HOH HOH I . 
X 5 HOH 24  627 341 HOH HOH I . 
X 5 HOH 25  628 344 HOH HOH I . 
X 5 HOH 26  629 375 HOH HOH I . 
X 5 HOH 27  630 376 HOH HOH I . 
X 5 HOH 28  631 381 HOH HOH I . 
X 5 HOH 29  632 396 HOH HOH I . 
X 5 HOH 30  633 448 HOH HOH I . 
X 5 HOH 31  634 450 HOH HOH I . 
X 5 HOH 32  635 461 HOH HOH I . 
X 5 HOH 33  636 462 HOH HOH I . 
X 5 HOH 34  637 463 HOH HOH I . 
X 5 HOH 35  638 464 HOH HOH I . 
X 5 HOH 36  639 465 HOH HOH I . 
X 5 HOH 37  640 470 HOH HOH I . 
X 5 HOH 38  641 471 HOH HOH I . 
X 5 HOH 39  642 472 HOH HOH I . 
X 5 HOH 40  643 493 HOH HOH I . 
X 5 HOH 41  644 495 HOH HOH I . 
X 5 HOH 42  645 496 HOH HOH I . 
X 5 HOH 43  646 574 HOH HOH I . 
X 5 HOH 44  647 575 HOH HOH I . 
X 5 HOH 45  648 578 HOH HOH I . 
Y 5 HOH 1   606 3   HOH HOH J . 
Y 5 HOH 2   607 6   HOH HOH J . 
Y 5 HOH 3   608 9   HOH HOH J . 
Y 5 HOH 4   609 16  HOH HOH J . 
Y 5 HOH 5   610 22  HOH HOH J . 
Y 5 HOH 6   611 23  HOH HOH J . 
Y 5 HOH 7   612 24  HOH HOH J . 
Y 5 HOH 8   613 30  HOH HOH J . 
Y 5 HOH 9   614 33  HOH HOH J . 
Y 5 HOH 10  615 37  HOH HOH J . 
Y 5 HOH 11  616 43  HOH HOH J . 
Y 5 HOH 12  617 54  HOH HOH J . 
Y 5 HOH 13  618 58  HOH HOH J . 
Y 5 HOH 14  619 59  HOH HOH J . 
Y 5 HOH 15  620 63  HOH HOH J . 
Y 5 HOH 16  621 69  HOH HOH J . 
Y 5 HOH 17  622 73  HOH HOH J . 
Y 5 HOH 18  623 80  HOH HOH J . 
Y 5 HOH 19  624 82  HOH HOH J . 
Y 5 HOH 20  625 85  HOH HOH J . 
Y 5 HOH 21  626 86  HOH HOH J . 
Y 5 HOH 22  627 89  HOH HOH J . 
Y 5 HOH 23  628 90  HOH HOH J . 
Y 5 HOH 24  629 104 HOH HOH J . 
Y 5 HOH 25  630 112 HOH HOH J . 
Y 5 HOH 26  631 117 HOH HOH J . 
Y 5 HOH 27  632 120 HOH HOH J . 
Y 5 HOH 28  633 126 HOH HOH J . 
Y 5 HOH 29  634 130 HOH HOH J . 
Y 5 HOH 30  635 134 HOH HOH J . 
Y 5 HOH 31  636 143 HOH HOH J . 
Y 5 HOH 32  637 144 HOH HOH J . 
Y 5 HOH 33  638 160 HOH HOH J . 
Y 5 HOH 34  639 180 HOH HOH J . 
Y 5 HOH 35  640 184 HOH HOH J . 
Y 5 HOH 36  641 188 HOH HOH J . 
Y 5 HOH 37  642 197 HOH HOH J . 
Y 5 HOH 38  643 203 HOH HOH J . 
Y 5 HOH 39  644 212 HOH HOH J . 
Y 5 HOH 40  645 214 HOH HOH J . 
Y 5 HOH 41  646 234 HOH HOH J . 
Y 5 HOH 42  647 242 HOH HOH J . 
Y 5 HOH 43  648 256 HOH HOH J . 
Y 5 HOH 44  649 257 HOH HOH J . 
Y 5 HOH 45  650 262 HOH HOH J . 
Y 5 HOH 46  651 272 HOH HOH J . 
Y 5 HOH 47  652 273 HOH HOH J . 
Y 5 HOH 48  653 275 HOH HOH J . 
Y 5 HOH 49  654 279 HOH HOH J . 
Y 5 HOH 50  655 293 HOH HOH J . 
Y 5 HOH 51  656 309 HOH HOH J . 
Y 5 HOH 52  657 310 HOH HOH J . 
Y 5 HOH 53  658 325 HOH HOH J . 
Y 5 HOH 54  659 326 HOH HOH J . 
Y 5 HOH 55  660 346 HOH HOH J . 
Y 5 HOH 56  661 347 HOH HOH J . 
Y 5 HOH 57  662 348 HOH HOH J . 
Y 5 HOH 58  663 349 HOH HOH J . 
Y 5 HOH 59  664 350 HOH HOH J . 
Y 5 HOH 60  665 351 HOH HOH J . 
Y 5 HOH 61  666 352 HOH HOH J . 
Y 5 HOH 62  667 354 HOH HOH J . 
Y 5 HOH 63  668 355 HOH HOH J . 
Y 5 HOH 64  669 357 HOH HOH J . 
Y 5 HOH 65  670 358 HOH HOH J . 
Y 5 HOH 66  671 382 HOH HOH J . 
Y 5 HOH 67  672 383 HOH HOH J . 
Y 5 HOH 68  673 384 HOH HOH J . 
Y 5 HOH 69  674 401 HOH HOH J . 
Y 5 HOH 70  675 402 HOH HOH J . 
Y 5 HOH 71  676 403 HOH HOH J . 
Y 5 HOH 72  677 429 HOH HOH J . 
Y 5 HOH 73  678 431 HOH HOH J . 
Y 5 HOH 74  679 445 HOH HOH J . 
Y 5 HOH 75  680 447 HOH HOH J . 
Y 5 HOH 76  681 467 HOH HOH J . 
Y 5 HOH 77  682 480 HOH HOH J . 
Y 5 HOH 78  683 484 HOH HOH J . 
Y 5 HOH 79  684 486 HOH HOH J . 
Y 5 HOH 80  685 507 HOH HOH J . 
Y 5 HOH 81  686 508 HOH HOH J . 
Y 5 HOH 82  687 509 HOH HOH J . 
Y 5 HOH 83  688 510 HOH HOH J . 
Y 5 HOH 84  689 511 HOH HOH J . 
Y 5 HOH 85  690 514 HOH HOH J . 
Y 5 HOH 86  691 516 HOH HOH J . 
Y 5 HOH 87  692 517 HOH HOH J . 
Y 5 HOH 88  693 519 HOH HOH J . 
Y 5 HOH 89  694 520 HOH HOH J . 
Y 5 HOH 90  695 524 HOH HOH J . 
Y 5 HOH 91  696 525 HOH HOH J . 
Y 5 HOH 92  697 526 HOH HOH J . 
Y 5 HOH 93  698 527 HOH HOH J . 
Y 5 HOH 94  699 528 HOH HOH J . 
Y 5 HOH 95  700 532 HOH HOH J . 
Y 5 HOH 96  701 533 HOH HOH J . 
Y 5 HOH 97  702 534 HOH HOH J . 
Y 5 HOH 98  703 535 HOH HOH J . 
Y 5 HOH 99  704 536 HOH HOH J . 
Y 5 HOH 100 705 538 HOH HOH J . 
Y 5 HOH 101 706 539 HOH HOH J . 
Y 5 HOH 102 707 540 HOH HOH J . 
Y 5 HOH 103 708 542 HOH HOH J . 
Y 5 HOH 104 709 543 HOH HOH J . 
Y 5 HOH 105 710 544 HOH HOH J . 
Y 5 HOH 106 711 579 HOH HOH J . 
Z 5 HOH 1   607 1   HOH HOH K . 
Z 5 HOH 2   608 21  HOH HOH K . 
Z 5 HOH 3   609 26  HOH HOH K . 
Z 5 HOH 4   610 29  HOH HOH K . 
Z 5 HOH 5   611 31  HOH HOH K . 
Z 5 HOH 6   612 32  HOH HOH K . 
Z 5 HOH 7   613 34  HOH HOH K . 
Z 5 HOH 8   614 38  HOH HOH K . 
Z 5 HOH 9   615 41  HOH HOH K . 
Z 5 HOH 10  616 53  HOH HOH K . 
Z 5 HOH 11  617 60  HOH HOH K . 
Z 5 HOH 12  618 71  HOH HOH K . 
Z 5 HOH 13  619 72  HOH HOH K . 
Z 5 HOH 14  620 74  HOH HOH K . 
Z 5 HOH 15  621 79  HOH HOH K . 
Z 5 HOH 16  622 84  HOH HOH K . 
Z 5 HOH 17  623 93  HOH HOH K . 
Z 5 HOH 18  624 99  HOH HOH K . 
Z 5 HOH 19  625 100 HOH HOH K . 
Z 5 HOH 20  626 102 HOH HOH K . 
Z 5 HOH 21  627 103 HOH HOH K . 
Z 5 HOH 22  628 109 HOH HOH K . 
Z 5 HOH 23  629 113 HOH HOH K . 
Z 5 HOH 24  630 119 HOH HOH K . 
Z 5 HOH 25  631 123 HOH HOH K . 
Z 5 HOH 26  632 127 HOH HOH K . 
Z 5 HOH 27  633 139 HOH HOH K . 
Z 5 HOH 28  634 141 HOH HOH K . 
Z 5 HOH 29  635 150 HOH HOH K . 
Z 5 HOH 30  636 154 HOH HOH K . 
Z 5 HOH 31  637 157 HOH HOH K . 
Z 5 HOH 32  638 166 HOH HOH K . 
Z 5 HOH 33  639 168 HOH HOH K . 
Z 5 HOH 34  640 173 HOH HOH K . 
Z 5 HOH 35  641 174 HOH HOH K . 
Z 5 HOH 36  642 175 HOH HOH K . 
Z 5 HOH 37  643 182 HOH HOH K . 
Z 5 HOH 38  644 189 HOH HOH K . 
Z 5 HOH 39  645 193 HOH HOH K . 
Z 5 HOH 40  646 215 HOH HOH K . 
Z 5 HOH 41  647 219 HOH HOH K . 
Z 5 HOH 42  648 224 HOH HOH K . 
Z 5 HOH 43  649 228 HOH HOH K . 
Z 5 HOH 44  650 240 HOH HOH K . 
Z 5 HOH 45  651 254 HOH HOH K . 
Z 5 HOH 46  652 260 HOH HOH K . 
Z 5 HOH 47  653 276 HOH HOH K . 
Z 5 HOH 48  654 277 HOH HOH K . 
Z 5 HOH 49  655 278 HOH HOH K . 
Z 5 HOH 50  656 296 HOH HOH K . 
Z 5 HOH 51  657 345 HOH HOH K . 
Z 5 HOH 52  658 353 HOH HOH K . 
Z 5 HOH 53  659 359 HOH HOH K . 
Z 5 HOH 54  660 360 HOH HOH K . 
Z 5 HOH 55  661 361 HOH HOH K . 
Z 5 HOH 56  662 363 HOH HOH K . 
Z 5 HOH 57  663 364 HOH HOH K . 
Z 5 HOH 58  664 365 HOH HOH K . 
Z 5 HOH 59  665 380 HOH HOH K . 
Z 5 HOH 60  666 389 HOH HOH K . 
Z 5 HOH 61  667 406 HOH HOH K . 
Z 5 HOH 62  668 407 HOH HOH K . 
Z 5 HOH 63  669 410 HOH HOH K . 
Z 5 HOH 64  670 412 HOH HOH K . 
Z 5 HOH 65  671 439 HOH HOH K . 
Z 5 HOH 66  672 440 HOH HOH K . 
Z 5 HOH 67  673 444 HOH HOH K . 
Z 5 HOH 68  674 487 HOH HOH K . 
Z 5 HOH 69  675 488 HOH HOH K . 
Z 5 HOH 70  676 489 HOH HOH K . 
Z 5 HOH 71  677 491 HOH HOH K . 
Z 5 HOH 72  678 505 HOH HOH K . 
Z 5 HOH 73  679 515 HOH HOH K . 
Z 5 HOH 74  680 518 HOH HOH K . 
Z 5 HOH 75  681 546 HOH HOH K . 
Z 5 HOH 76  682 547 HOH HOH K . 
Z 5 HOH 77  683 548 HOH HOH K . 
Z 5 HOH 78  684 549 HOH HOH K . 
Z 5 HOH 79  685 550 HOH HOH K . 
Z 5 HOH 80  686 551 HOH HOH K . 
Z 5 HOH 81  687 553 HOH HOH K . 
Z 5 HOH 82  688 554 HOH HOH K . 
Z 5 HOH 83  689 555 HOH HOH K . 
Z 5 HOH 84  690 556 HOH HOH K . 
Z 5 HOH 85  691 557 HOH HOH K . 
Z 5 HOH 86  692 558 HOH HOH K . 
Z 5 HOH 87  693 562 HOH HOH K . 
Z 5 HOH 88  694 580 HOH HOH K . 