data_2F4T
# 
_entry.id   2F4T 
# 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.286 
_audit_conform.dict_location   http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic 
# 
loop_
_database_2.database_id 
_database_2.database_code 
PDB   2F4T         
NDB   DR0028       
RCSB  RCSB035453   
WWPDB D_1000035453 
# 
loop_
_pdbx_database_related.db_name 
_pdbx_database_related.db_id 
_pdbx_database_related.details 
_pdbx_database_related.content_type 
PDB 2F4S . unspecified 
PDB 2F4U . unspecified 
PDB 2F4V . unspecified 
# 
_pdbx_database_status.entry_id                        2F4T 
_pdbx_database_status.deposit_site                    RCSB 
_pdbx_database_status.process_site                    RCSB 
_pdbx_database_status.recvd_initial_deposition_date   2005-11-24 
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.status_code_sf                  ? 
_pdbx_database_status.status_code_mr                  ? 
_pdbx_database_status.SG_entry                        ? 
_pdbx_database_status.pdb_format_compatible           Y 
_pdbx_database_status.status_code_cs                  ? 
_pdbx_database_status.methods_development_category    ? 
# 
loop_
_audit_author.name 
_audit_author.pdbx_ordinal 
'Murray, J.B.'  1 
'Meroueh, S.O.' 2 
'Russell, R.J.' 3 
'Lentzen, G.'   4 
'Haddad, J.'    5 
'Mobashery, S.' 6 
# 
_citation.id                        primary 
_citation.title                     'Interactions of designer antibiotics and the bacterial ribosomal aminoacyl-tRNA site' 
_citation.journal_abbrev            Chem.Biol. 
_citation.journal_volume            13 
_citation.page_first                129 
_citation.page_last                 138 
_citation.year                      2006 
_citation.journal_id_ASTM           CBOLE2 
_citation.country                   UK 
_citation.journal_id_ISSN           1074-5521 
_citation.journal_id_CSD            2050 
_citation.book_publisher            ? 
_citation.pdbx_database_id_PubMed   16492561 
_citation.pdbx_database_id_DOI      10.1016/j.chembiol.2005.11.004 
# 
loop_
_citation_author.citation_id 
_citation_author.name 
_citation_author.ordinal 
primary 'Murray, J.B.'  1 
primary 'Meroueh, S.O.' 2 
primary 'Russell, R.J.' 3 
primary 'Lentzen, G.'   4 
primary 'Haddad, J.'    5 
primary 'Mobashery, S.' 6 
# 
_cell.length_a           45.976 
_cell.length_b           32.926 
_cell.length_c           46.414 
_cell.angle_alpha        90.00 
_cell.angle_beta         95.62 
_cell.angle_gamma        90.00 
_cell.entry_id           2F4T 
_cell.pdbx_unique_axis   ? 
_cell.Z_PDB              2 
_cell.length_a_esd       ? 
_cell.length_b_esd       ? 
_cell.length_c_esd       ? 
_cell.angle_alpha_esd    ? 
_cell.angle_beta_esd     ? 
_cell.angle_gamma_esd    ? 
# 
_symmetry.space_group_name_H-M             'P 1 21 1' 
_symmetry.entry_id                         2F4T 
_symmetry.pdbx_full_space_group_name_H-M   ? 
_symmetry.Int_Tables_number                4 
_symmetry.cell_setting                     ? 
_symmetry.space_group_name_Hall            ? 
# 
loop_
_entity.id 
_entity.type 
_entity.src_method 
_entity.pdbx_description 
_entity.formula_weight 
_entity.pdbx_number_of_molecules 
_entity.pdbx_ec 
_entity.pdbx_mutation 
_entity.pdbx_fragment 
_entity.details 
1 polymer     syn "5'-R(*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*GP*GP*UP*GP*AP*AP*GP*UP*CP*GP*C)-3'" 6743.077 1 ? ? ? 'A-site RNA' 
2 polymer     syn "5'-R(*UP*UP*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*GP*GP*UP*GP*AP*AP*GP*UP*CP*GP*C)-3'" 7355.409 1 ? ? ? 'A-site RNA' 
3 non-polymer syn 
;(2R)-4-AMINO-N-{(1R,2S,3R,4R,5S)-5-AMINO-2-{2-[(2-AMINOETHYL)AMINO]ETHOXY}-4-[(2,6-DIAMINO-2,6-DIDEOXY-ALPHA-D-GLUCOPYRANOSYL)OXY]-3-HYDROXYCYCLOHEXYL}-2-HYDROXYBUTANAMIDE
;
509.598  1 ? ? ? ?            
# 
loop_
_entity_poly.entity_id 
_entity_poly.type 
_entity_poly.nstd_linkage 
_entity_poly.nstd_monomer 
_entity_poly.pdbx_seq_one_letter_code 
_entity_poly.pdbx_seq_one_letter_code_can 
_entity_poly.pdbx_strand_id 
_entity_poly.pdbx_target_identifier 
1 polyribonucleotide no no GCGUCACACCGGUGAAGUCGC   GCGUCACACCGGUGAAGUCGC   A ? 
2 polyribonucleotide no no UUGCGUCACACCGGUGAAGUCGC UUGCGUCACACCGGUGAAGUCGC B ? 
# 
loop_
_entity_poly_seq.entity_id 
_entity_poly_seq.num 
_entity_poly_seq.mon_id 
_entity_poly_seq.hetero 
1 1  G n 
1 2  C n 
1 3  G n 
1 4  U n 
1 5  C n 
1 6  A n 
1 7  C n 
1 8  A n 
1 9  C n 
1 10 C n 
1 11 G n 
1 12 G n 
1 13 U n 
1 14 G n 
1 15 A n 
1 16 A n 
1 17 G n 
1 18 U n 
1 19 C n 
1 20 G n 
1 21 C n 
2 1  U n 
2 2  U n 
2 3  G n 
2 4  C n 
2 5  G n 
2 6  U n 
2 7  C n 
2 8  A n 
2 9  C n 
2 10 A n 
2 11 C n 
2 12 C n 
2 13 G n 
2 14 G n 
2 15 U n 
2 16 G n 
2 17 A n 
2 18 A n 
2 19 G n 
2 20 U n 
2 21 C n 
2 22 G n 
2 23 C n 
# 
loop_
_struct_ref.id 
_struct_ref.entity_id 
_struct_ref.db_name 
_struct_ref.db_code 
_struct_ref.pdbx_db_accession 
_struct_ref.pdbx_db_isoform 
_struct_ref.pdbx_seq_one_letter_code 
_struct_ref.pdbx_align_begin 
1 1 PDB 2F4T 2F4T ? ? ? 
2 2 PDB 2F4T 2F4T ? ? ? 
# 
loop_
_struct_ref_seq.align_id 
_struct_ref_seq.ref_id 
_struct_ref_seq.pdbx_PDB_id_code 
_struct_ref_seq.pdbx_strand_id 
_struct_ref_seq.seq_align_beg 
_struct_ref_seq.pdbx_seq_align_beg_ins_code 
_struct_ref_seq.seq_align_end 
_struct_ref_seq.pdbx_seq_align_end_ins_code 
_struct_ref_seq.pdbx_db_accession 
_struct_ref_seq.db_align_beg 
_struct_ref_seq.pdbx_db_align_beg_ins_code 
_struct_ref_seq.db_align_end 
_struct_ref_seq.pdbx_db_align_end_ins_code 
_struct_ref_seq.pdbx_auth_seq_align_beg 
_struct_ref_seq.pdbx_auth_seq_align_end 
1 1 2F4T A 1 ? 21 ? 2F4T 1403 ? 1498 ? 1403 1498 
2 2 2F4T B 1 ? 23 ? 2F4T 1401 ? 1498 ? 1401 1498 
# 
loop_
_chem_comp.id 
_chem_comp.type 
_chem_comp.mon_nstd_flag 
_chem_comp.name 
_chem_comp.pdbx_synonyms 
_chem_comp.formula 
_chem_comp.formula_weight 
A   'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 
AB9 non-polymer   . 
;(2R)-4-AMINO-N-{(1R,2S,3R,4R,5S)-5-AMINO-2-{2-[(2-AMINOETHYL)AMINO]ETHOXY}-4-[(2,6-DIAMINO-2,6-DIDEOXY-ALPHA-D-GLUCOPYRANOSYL)OXY]-3-HYDROXYCYCLOHEXYL}-2-HYDROXYBUTANAMIDE
;
? 'C20 H43 N7 O8'   509.598 
C   'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE" ? 'C9 H14 N3 O8 P'  323.197 
G   'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 
U   'RNA linking' y "URIDINE-5'-MONOPHOSPHATE" ? 'C9 H13 N2 O9 P'  324.181 
# 
_exptl.entry_id          2F4T 
_exptl.crystals_number   1 
_exptl.method            'X-RAY DIFFRACTION' 
# 
_exptl_crystal.id                    1 
_exptl_crystal.density_Matthews      2.48 
_exptl_crystal.density_meas          ? 
_exptl_crystal.density_percent_sol   50.40 
_exptl_crystal.description           ? 
_exptl_crystal.F_000                 ? 
_exptl_crystal.preparation           ? 
# 
_diffrn.id                     1 
_diffrn.ambient_temp           100 
_diffrn.ambient_temp_details   ? 
_diffrn.crystal_id             1 
# 
_diffrn_detector.diffrn_id              1 
_diffrn_detector.detector               ? 
_diffrn_detector.type                   ? 
_diffrn_detector.pdbx_collection_date   2002-06-01 
_diffrn_detector.details                ? 
# 
_diffrn_radiation.diffrn_id                        1 
_diffrn_radiation.wavelength_id                    1 
_diffrn_radiation.pdbx_diffrn_protocol             'SINGLE WAVELENGTH' 
_diffrn_radiation.monochromator                    ? 
_diffrn_radiation.pdbx_monochromatic_or_laue_m_l   M 
_diffrn_radiation.pdbx_scattering_type             x-ray 
# 
_diffrn_radiation_wavelength.id           1 
_diffrn_radiation_wavelength.wavelength   0.991 
_diffrn_radiation_wavelength.wt           1.0 
# 
_diffrn_source.diffrn_id                   1 
_diffrn_source.source                      SYNCHROTRON 
_diffrn_source.type                        'ESRF BEAMLINE ID29' 
_diffrn_source.pdbx_wavelength             ? 
_diffrn_source.pdbx_wavelength_list        0.991 
_diffrn_source.pdbx_synchrotron_site       ESRF 
_diffrn_source.pdbx_synchrotron_beamline   ID29 
# 
_reflns.entry_id                     2F4T 
_reflns.d_resolution_low             30.00 
_reflns.d_resolution_high            3.00 
_reflns.number_obs                   2746 
_reflns.percent_possible_obs         97.700 
_reflns.pdbx_Rmerge_I_obs            0.078 
_reflns.pdbx_chi_squared             1.016 
_reflns.pdbx_redundancy              ? 
_reflns.pdbx_scaling_rejects         ? 
_reflns.pdbx_netI_over_sigmaI        8.0 
_reflns.pdbx_Rsym_value              ? 
_reflns.observed_criterion_sigma_F   0 
_reflns.observed_criterion_sigma_I   0 
_reflns.number_all                   2746 
_reflns.B_iso_Wilson_estimate        ? 
_reflns.R_free_details               ? 
_reflns.pdbx_diffrn_id               1 
_reflns.pdbx_ordinal                 1 
# 
loop_
_reflns_shell.d_res_low 
_reflns_shell.d_res_high 
_reflns_shell.number_unique_all 
_reflns_shell.percent_possible_all 
_reflns_shell.Rmerge_I_obs 
_reflns_shell.pdbx_chi_squared 
_reflns_shell.pdbx_redundancy 
_reflns_shell.number_unique_obs 
_reflns_shell.meanI_over_sigI_obs 
_reflns_shell.pdbx_Rsym_value 
_reflns_shell.percent_possible_obs 
_reflns_shell.number_measured_all 
_reflns_shell.number_measured_obs 
_reflns_shell.pdbx_diffrn_id 
_reflns_shell.pdbx_ordinal 
3.11  3.00 272 100.000 0.206 1.503 ? ? 3.2 ? ? ? ? ? 1  
3.23  3.11 277 100.000 0.135 1.267 ? ? ?   ? ? ? ? ? 2  
3.38  3.23 272 100.000 0.133 1.294 ? ? ?   ? ? ? ? ? 3  
3.56  3.38 283 99.300  0.111 1.011 ? ? ?   ? ? ? ? ? 4  
3.78  3.56 282 100.000 0.102 0.766 ? ? ?   ? ? ? ? ? 5  
4.07  3.78 278 100.000 0.081 0.941 ? ? ?   ? ? ? ? ? 6  
4.48  4.07 276 100.000 0.075 0.895 ? ? ?   ? ? ? ? ? 7  
5.12  4.48 287 99.700  0.062 0.547 ? ? ?   ? ? ? ? ? 8  
6.44  5.12 277 99.600  0.053 0.952 ? ? ?   ? ? ? ? ? 9  
30.00 6.44 242 79.900  0.04  1.076 ? ? ?   ? ? ? ? ? 10 
# 
_refine.ls_d_res_high                            3.000 
_refine.ls_d_res_low                             15.000 
_refine.pdbx_ls_sigma_F                          0.00 
_refine.ls_percent_reflns_obs                    97.600 
_refine.ls_number_reflns_obs                     2735 
_refine.ls_R_factor_R_work                       0.211 
_refine.ls_R_factor_R_free                       0.267 
_refine.ls_percent_reflns_R_free                 9.800 
_refine.ls_number_reflns_R_free                  280 
_refine.B_iso_mean                               80.240 
_refine.solvent_model_param_bsol                 135.759 
_refine.aniso_B[1][1]                            1.140 
_refine.aniso_B[2][2]                            -5.315 
_refine.aniso_B[3][3]                            4.175 
_refine.aniso_B[1][2]                            0.000 
_refine.aniso_B[1][3]                            -0.612 
_refine.aniso_B[2][3]                            0.000 
_refine.entry_id                                 2F4T 
_refine.pdbx_ls_sigma_I                          ? 
_refine.ls_number_reflns_all                     2795 
_refine.ls_R_factor_all                          0.211 
_refine.ls_R_factor_obs                          0.267 
_refine.ls_redundancy_reflns_obs                 ? 
_refine.pdbx_data_cutoff_high_absF               ? 
_refine.pdbx_data_cutoff_low_absF                ? 
_refine.ls_number_parameters                     ? 
_refine.ls_number_restraints                     ? 
_refine.ls_R_factor_R_free_error                 ? 
_refine.ls_R_factor_R_free_error_details         ? 
_refine.pdbx_method_to_determine_struct          'MOLECULAR REPLACEMENT' 
_refine.pdbx_starting_model                      ? 
_refine.pdbx_ls_cross_valid_method               ? 
_refine.pdbx_R_Free_selection_details            Random 
_refine.pdbx_stereochem_target_val_spec_case     ? 
_refine.pdbx_stereochemistry_target_values       'Engh & Huber' 
_refine.solvent_model_details                    ? 
_refine.solvent_model_param_ksol                 ? 
_refine.occupancy_max                            ? 
_refine.occupancy_min                            ? 
_refine.pdbx_isotropic_thermal_model             ? 
_refine.details                                  ? 
_refine.correlation_coeff_Fo_to_Fc               ? 
_refine.correlation_coeff_Fo_to_Fc_free          ? 
_refine.pdbx_solvent_vdw_probe_radii             ? 
_refine.pdbx_solvent_ion_probe_radii             ? 
_refine.pdbx_solvent_shrinkage_radii             ? 
_refine.overall_SU_R_Cruickshank_DPI             ? 
_refine.overall_SU_R_free                        ? 
_refine.overall_SU_ML                            ? 
_refine.overall_SU_B                             ? 
_refine.pdbx_overall_ESU_R_Free                  ? 
_refine.pdbx_data_cutoff_high_rms_absF           ? 
_refine.pdbx_overall_ESU_R                       ? 
_refine.ls_wR_factor_R_free                      ? 
_refine.ls_wR_factor_R_work                      ? 
_refine.overall_FOM_free_R_set                   ? 
_refine.overall_FOM_work_R_set                   ? 
_refine.pdbx_refine_id                           'X-RAY DIFFRACTION' 
_refine.pdbx_diffrn_id                           1 
_refine.pdbx_TLS_residual_ADP_flag               ? 
_refine.pdbx_overall_phase_error                 ? 
_refine.pdbx_overall_SU_R_free_Cruickshank_DPI   ? 
_refine.pdbx_overall_SU_R_Blow_DPI               ? 
_refine.pdbx_overall_SU_R_free_Blow_DPI          ? 
# 
_refine_hist.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_refine_hist.cycle_id                         LAST 
_refine_hist.pdbx_number_atoms_protein        0 
_refine_hist.pdbx_number_atoms_nucleic_acid   932 
_refine_hist.pdbx_number_atoms_ligand         35 
_refine_hist.number_atoms_solvent             0 
_refine_hist.number_atoms_total               967 
_refine_hist.d_res_high                       3.000 
_refine_hist.d_res_low                        15.000 
# 
loop_
_pdbx_xplor_file.serial_no 
_pdbx_xplor_file.param_file 
_pdbx_xplor_file.topol_file 
_pdbx_xplor_file.pdbx_refine_id 
1 CNS_TOPPAR:protein_rep.param CNS_TOPPAR:protein.top 'X-RAY DIFFRACTION' 
2 dna-rna-multi-endo.param     CNS_TOPPAR:dna-rna.top 'X-RAY DIFFRACTION' 
3 CNS_TOPPAR:water_rep.param   CNS_TOPPAR:water.top   'X-RAY DIFFRACTION' 
4 CNS_TOPPAR:ion.param         CNS_TOPPAR:ion.top     'X-RAY DIFFRACTION' 
5 893.par                      893.top                'X-RAY DIFFRACTION' 
# 
_struct.entry_id                  2F4T 
_struct.title                     'Asite RNA + designer antibiotic' 
_struct.pdbx_descriptor           "5'-R(*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*GP*GP*UP*GP*AP*AP*GP*UP*CP*GP*C)-3'" 
_struct.pdbx_model_details        ? 
_struct.pdbx_CASP_flag            ? 
_struct.pdbx_model_type_details   ? 
# 
_struct_keywords.entry_id        2F4T 
_struct_keywords.pdbx_keywords   RNA 
_struct_keywords.text            'Asite RNA, designer antibiotic, RNA' 
# 
loop_
_struct_asym.id 
_struct_asym.pdbx_blank_PDB_chainid_flag 
_struct_asym.pdbx_modified 
_struct_asym.entity_id 
_struct_asym.details 
A N N 1 ? 
B N N 2 ? 
C N N 3 ? 
# 
loop_
_struct_conn.id 
_struct_conn.conn_type_id 
_struct_conn.pdbx_leaving_atom_flag 
_struct_conn.pdbx_PDB_id 
_struct_conn.ptnr1_label_asym_id 
_struct_conn.ptnr1_label_comp_id 
_struct_conn.ptnr1_label_seq_id 
_struct_conn.ptnr1_label_atom_id 
_struct_conn.pdbx_ptnr1_label_alt_id 
_struct_conn.pdbx_ptnr1_PDB_ins_code 
_struct_conn.pdbx_ptnr1_standard_comp_id 
_struct_conn.ptnr1_symmetry 
_struct_conn.ptnr2_label_asym_id 
_struct_conn.ptnr2_label_comp_id 
_struct_conn.ptnr2_label_seq_id 
_struct_conn.ptnr2_label_atom_id 
_struct_conn.pdbx_ptnr2_label_alt_id 
_struct_conn.pdbx_ptnr2_PDB_ins_code 
_struct_conn.ptnr1_auth_asym_id 
_struct_conn.ptnr1_auth_comp_id 
_struct_conn.ptnr1_auth_seq_id 
_struct_conn.ptnr2_auth_asym_id 
_struct_conn.ptnr2_auth_comp_id 
_struct_conn.ptnr2_auth_seq_id 
_struct_conn.ptnr2_symmetry 
_struct_conn.pdbx_ptnr3_label_atom_id 
_struct_conn.pdbx_ptnr3_label_seq_id 
_struct_conn.pdbx_ptnr3_label_comp_id 
_struct_conn.pdbx_ptnr3_label_asym_id 
_struct_conn.pdbx_ptnr3_label_alt_id 
_struct_conn.pdbx_ptnr3_PDB_ins_code 
_struct_conn.details 
_struct_conn.pdbx_dist_value 
_struct_conn.pdbx_value_order 
hydrog1  hydrog ? ? A G 1  N1 ? ? ? 1_555 B C 23 N3 ? ? A G 1403 B C 1498 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog2  hydrog ? ? A G 1  N2 ? ? ? 1_555 B C 23 O2 ? ? A G 1403 B C 1498 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog3  hydrog ? ? A G 1  O6 ? ? ? 1_555 B C 23 N4 ? ? A G 1403 B C 1498 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog4  hydrog ? ? A C 2  N3 ? ? ? 1_555 B G 22 N1 ? ? A C 1404 B G 1497 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog5  hydrog ? ? A C 2  N4 ? ? ? 1_555 B G 22 O6 ? ? A C 1404 B G 1497 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog6  hydrog ? ? A C 2  O2 ? ? ? 1_555 B G 22 N2 ? ? A C 1404 B G 1497 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog7  hydrog ? ? A G 3  N1 ? ? ? 1_555 B C 21 N3 ? ? A G 1405 B C 1496 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog8  hydrog ? ? A G 3  N2 ? ? ? 1_555 B C 21 O2 ? ? A G 1405 B C 1496 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog9  hydrog ? ? A G 3  O6 ? ? ? 1_555 B C 21 N4 ? ? A G 1405 B C 1496 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog10 hydrog ? ? A U 4  O4 ? ? ? 1_555 B U 20 N3 ? ? A U 1406 B U 1495 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? 
hydrog11 hydrog ? ? A C 5  N3 ? ? ? 1_555 B G 19 N1 ? ? A C 1407 B G 1494 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog12 hydrog ? ? A C 5  N4 ? ? ? 1_555 B G 19 O6 ? ? A C 1407 B G 1494 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog13 hydrog ? ? A C 5  O2 ? ? ? 1_555 B G 19 N2 ? ? A C 1407 B G 1494 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog14 hydrog ? ? A C 7  N3 ? ? ? 1_555 B G 16 N1 ? ? A C 1409 B G 1491 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog15 hydrog ? ? A C 7  N4 ? ? ? 1_555 B G 16 O6 ? ? A C 1409 B G 1491 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog16 hydrog ? ? A C 7  O2 ? ? ? 1_555 B G 16 N2 ? ? A C 1409 B G 1491 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog17 hydrog ? ? A A 8  N1 ? ? ? 1_555 B U 15 N3 ? ? A A 1410 B U 1490 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog18 hydrog ? ? A A 8  N6 ? ? ? 1_555 B U 15 O4 ? ? A A 1410 B U 1490 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog19 hydrog ? ? A C 9  N3 ? ? ? 1_555 B G 14 N1 ? ? A C 1411 B G 1489 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog20 hydrog ? ? A C 9  N4 ? ? ? 1_555 B G 14 O6 ? ? A C 1411 B G 1489 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog21 hydrog ? ? A C 9  O2 ? ? ? 1_555 B G 14 N2 ? ? A C 1411 B G 1489 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog22 hydrog ? ? A C 10 N3 ? ? ? 1_555 B G 13 N1 ? ? A C 1412 B G 1488 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog23 hydrog ? ? A C 10 N4 ? ? ? 1_555 B G 13 O6 ? ? A C 1412 B G 1488 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog24 hydrog ? ? A C 10 O2 ? ? ? 1_555 B G 13 N2 ? ? A C 1412 B G 1488 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog25 hydrog ? ? A G 11 N1 ? ? ? 1_555 B C 12 N3 ? ? A G 1488 B C 1412 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog26 hydrog ? ? A G 11 N2 ? ? ? 1_555 B C 12 O2 ? ? A G 1488 B C 1412 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog27 hydrog ? ? A G 11 O6 ? ? ? 1_555 B C 12 N4 ? ? A G 1488 B C 1412 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog28 hydrog ? ? A G 12 N1 ? ? ? 1_555 B C 11 N3 ? ? A G 1489 B C 1411 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog29 hydrog ? ? A G 12 N2 ? ? ? 1_555 B C 11 O2 ? ? A G 1489 B C 1411 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog30 hydrog ? ? A G 12 O6 ? ? ? 1_555 B C 11 N4 ? ? A G 1489 B C 1411 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog31 hydrog ? ? A U 13 N3 ? ? ? 1_555 B A 10 N1 ? ? A U 1490 B A 1410 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog32 hydrog ? ? A U 13 O4 ? ? ? 1_555 B A 10 N6 ? ? A U 1490 B A 1410 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog33 hydrog ? ? A G 14 N1 ? ? ? 1_555 B C 9  N3 ? ? A G 1491 B C 1409 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog34 hydrog ? ? A G 14 N2 ? ? ? 1_555 B C 9  O2 ? ? A G 1491 B C 1409 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog35 hydrog ? ? A G 14 O6 ? ? ? 1_555 B C 9  N4 ? ? A G 1491 B C 1409 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog36 hydrog ? ? A G 17 N1 ? ? ? 1_555 B C 7  N3 ? ? A G 1494 B C 1407 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog37 hydrog ? ? A G 17 N2 ? ? ? 1_555 B C 7  O2 ? ? A G 1494 B C 1407 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog38 hydrog ? ? A G 17 O6 ? ? ? 1_555 B C 7  N4 ? ? A G 1494 B C 1407 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog39 hydrog ? ? A U 18 O4 ? ? ? 1_555 B U 6  N3 ? ? A U 1495 B U 1406 1_555 ? ? ? ? ? ? 'U-U MISPAIR' ? ? 
hydrog40 hydrog ? ? A C 19 N3 ? ? ? 1_555 B G 5  N1 ? ? A C 1496 B G 1405 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog41 hydrog ? ? A C 19 N4 ? ? ? 1_555 B G 5  O6 ? ? A C 1496 B G 1405 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog42 hydrog ? ? A C 19 O2 ? ? ? 1_555 B G 5  N2 ? ? A C 1496 B G 1405 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog43 hydrog ? ? A G 20 N1 ? ? ? 1_555 B C 4  N3 ? ? A G 1497 B C 1404 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog44 hydrog ? ? A G 20 N2 ? ? ? 1_555 B C 4  O2 ? ? A G 1497 B C 1404 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog45 hydrog ? ? A G 20 O6 ? ? ? 1_555 B C 4  N4 ? ? A G 1497 B C 1404 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog46 hydrog ? ? A C 21 N3 ? ? ? 1_555 B G 3  N1 ? ? A C 1498 B G 1403 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog47 hydrog ? ? A C 21 N4 ? ? ? 1_555 B G 3  O6 ? ? A C 1498 B G 1403 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
hydrog48 hydrog ? ? A C 21 O2 ? ? ? 1_555 B G 3  N2 ? ? A C 1498 B G 1403 1_555 ? ? ? ? ? ? WATSON-CRICK  ? ? 
# 
_struct_conn_type.id          hydrog 
_struct_conn_type.criteria    ? 
_struct_conn_type.reference   ? 
# 
loop_
_struct_site.id 
_struct_site.pdbx_evidence_code 
_struct_site.pdbx_auth_asym_id 
_struct_site.pdbx_auth_comp_id 
_struct_site.pdbx_auth_seq_id 
_struct_site.pdbx_auth_ins_code 
_struct_site.pdbx_num_residues 
_struct_site.details 
AC1 Software ? ? ? ? 10 'BINDING SITE FOR RESIDUE AB9 B 1' 
1   ?        ? ? ? ? ?  ?                                  
# 
loop_
_struct_site_gen.id 
_struct_site_gen.site_id 
_struct_site_gen.pdbx_num_res 
_struct_site_gen.label_comp_id 
_struct_site_gen.label_asym_id 
_struct_site_gen.label_seq_id 
_struct_site_gen.pdbx_auth_ins_code 
_struct_site_gen.auth_comp_id 
_struct_site_gen.auth_asym_id 
_struct_site_gen.auth_seq_id 
_struct_site_gen.label_atom_id 
_struct_site_gen.label_alt_id 
_struct_site_gen.symmetry 
_struct_site_gen.details 
1  AC1 10 C A 2  ? C A 1404 . ? 1_555 ? 
2  AC1 10 G A 3  ? G A 1405 . ? 1_555 ? 
3  AC1 10 A A 6  ? A A 1408 . ? 1_555 ? 
4  AC1 10 G B 16 ? G B 1491 . ? 1_555 ? 
5  AC1 10 A B 17 ? A B 1492 . ? 1_555 ? 
6  AC1 10 A B 18 ? A B 1493 . ? 1_555 ? 
7  AC1 10 G B 19 ? G B 1494 . ? 1_555 ? 
8  AC1 10 U B 20 ? U B 1495 . ? 1_555 ? 
9  AC1 10 C B 21 ? C B 1496 . ? 1_555 ? 
10 AC1 10 G B 22 ? G B 1497 . ? 1_555 ? 
# 
_atom_sites.entry_id                    2F4T 
_atom_sites.fract_transf_matrix[1][1]   0.021750 
_atom_sites.fract_transf_matrix[1][2]   0.000000 
_atom_sites.fract_transf_matrix[1][3]   0.002140 
_atom_sites.fract_transf_matrix[2][1]   0.000000 
_atom_sites.fract_transf_matrix[2][2]   0.030371 
_atom_sites.fract_transf_matrix[2][3]   0.000000 
_atom_sites.fract_transf_matrix[3][1]   0.000000 
_atom_sites.fract_transf_matrix[3][2]   0.000000 
_atom_sites.fract_transf_matrix[3][3]   0.021649 
_atom_sites.fract_transf_vector[1]      0.00000 
_atom_sites.fract_transf_vector[2]      0.00000 
_atom_sites.fract_transf_vector[3]      0.00000 
# 
loop_
_atom_type.symbol 
C 
N 
O 
P 
# 
loop_
_atom_site.group_PDB 
_atom_site.id 
_atom_site.type_symbol 
_atom_site.label_atom_id 
_atom_site.label_alt_id 
_atom_site.label_comp_id 
_atom_site.label_asym_id 
_atom_site.label_entity_id 
_atom_site.label_seq_id 
_atom_site.pdbx_PDB_ins_code 
_atom_site.Cartn_x 
_atom_site.Cartn_y 
_atom_site.Cartn_z 
_atom_site.occupancy 
_atom_site.B_iso_or_equiv 
_atom_site.pdbx_formal_charge 
_atom_site.auth_seq_id 
_atom_site.auth_comp_id 
_atom_site.auth_asym_id 
_atom_site.auth_atom_id 
_atom_site.pdbx_PDB_model_num 
ATOM   1   O "O5'" . G   A 1 1  ? 2.005   -7.480  38.468  1.00 115.39 ? 1403 G   A "O5'" 1 
ATOM   2   C "C5'" . G   A 1 1  ? 2.479   -6.471  39.379  1.00 115.63 ? 1403 G   A "C5'" 1 
ATOM   3   C "C4'" . G   A 1 1  ? 3.813   -6.720  40.071  1.00 109.08 ? 1403 G   A "C4'" 1 
ATOM   4   O "O4'" . G   A 1 1  ? 3.870   -8.086  40.570  1.00 107.10 ? 1403 G   A "O4'" 1 
ATOM   5   C "C3'" . G   A 1 1  ? 5.074   -6.591  39.227  1.00 107.78 ? 1403 G   A "C3'" 1 
ATOM   6   O "O3'" . G   A 1 1  ? 5.490   -5.234  39.055  1.00 102.89 ? 1403 G   A "O3'" 1 
ATOM   7   C "C2'" . G   A 1 1  ? 6.086   -7.397  40.038  1.00 108.33 ? 1403 G   A "C2'" 1 
ATOM   8   O "O2'" . G   A 1 1  ? 6.612   -6.688  41.143  1.00 100.30 ? 1403 G   A "O2'" 1 
ATOM   9   C "C1'" . G   A 1 1  ? 5.217   -8.549  40.552  1.00 103.14 ? 1403 G   A "C1'" 1 
ATOM   10  N N9    . G   A 1 1  ? 5.296   -9.765  39.738  1.00 99.32  ? 1403 G   A N9    1 
ATOM   11  C C8    . G   A 1 1  ? 4.263   -10.391 39.081  1.00 102.40 ? 1403 G   A C8    1 
ATOM   12  N N7    . G   A 1 1  ? 4.637   -11.467 38.439  1.00 101.06 ? 1403 G   A N7    1 
ATOM   13  C C5    . G   A 1 1  ? 6.000   -11.561 38.684  1.00 92.36  ? 1403 G   A C5    1 
ATOM   14  C C6    . G   A 1 1  ? 6.948   -12.524 38.246  1.00 86.86  ? 1403 G   A C6    1 
ATOM   15  O O6    . G   A 1 1  ? 6.766   -13.517 37.533  1.00 78.76  ? 1403 G   A O6    1 
ATOM   16  N N1    . G   A 1 1  ? 8.219   -12.241 38.723  1.00 79.46  ? 1403 G   A N1    1 
ATOM   17  C C2    . G   A 1 1  ? 8.544   -11.176 39.518  1.00 83.20  ? 1403 G   A C2    1 
ATOM   18  N N2    . G   A 1 1  ? 9.830   -11.086 39.879  1.00 91.27  ? 1403 G   A N2    1 
ATOM   19  N N3    . G   A 1 1  ? 7.675   -10.267 39.931  1.00 91.74  ? 1403 G   A N3    1 
ATOM   20  C C4    . G   A 1 1  ? 6.428   -10.520 39.481  1.00 95.18  ? 1403 G   A C4    1 
ATOM   21  P P     . C   A 1 2  ? 6.390   -4.826  37.779  1.00 105.02 ? 1404 C   A P     1 
ATOM   22  O OP1   . C   A 1 2  ? 6.835   -3.421  37.976  1.00 112.17 ? 1404 C   A OP1   1 
ATOM   23  O OP2   . C   A 1 2  ? 5.664   -5.194  36.536  1.00 106.47 ? 1404 C   A OP2   1 
ATOM   24  O "O5'" . C   A 1 2  ? 7.678   -5.752  37.890  1.00 90.12  ? 1404 C   A "O5'" 1 
ATOM   25  C "C5'" . C   A 1 2  ? 8.723   -5.443  38.823  1.00 84.03  ? 1404 C   A "C5'" 1 
ATOM   26  C "C4'" . C   A 1 2  ? 9.959   -6.241  38.502  1.00 84.84  ? 1404 C   A "C4'" 1 
ATOM   27  O "O4'" . C   A 1 2  ? 9.687   -7.660  38.655  1.00 75.11  ? 1404 C   A "O4'" 1 
ATOM   28  C "C3'" . C   A 1 2  ? 10.434  -6.116  37.069  1.00 91.12  ? 1404 C   A "C3'" 1 
ATOM   29  O "O3'" . C   A 1 2  ? 11.170  -4.916  36.861  1.00 91.10  ? 1404 C   A "O3'" 1 
ATOM   30  C "C2'" . C   A 1 2  ? 11.250  -7.389  36.883  1.00 81.17  ? 1404 C   A "C2'" 1 
ATOM   31  O "O2'" . C   A 1 2  ? 12.547  -7.298  37.435  1.00 88.63  ? 1404 C   A "O2'" 1 
ATOM   32  C "C1'" . C   A 1 2  ? 10.414  -8.393  37.681  1.00 72.76  ? 1404 C   A "C1'" 1 
ATOM   33  N N1    . C   A 1 2  ? 9.451   -9.139  36.854  1.00 71.24  ? 1404 C   A N1    1 
ATOM   34  C C2    . C   A 1 2  ? 9.852   -10.349 36.262  1.00 70.77  ? 1404 C   A C2    1 
ATOM   35  O O2    . C   A 1 2  ? 10.997  -10.766 36.460  1.00 83.29  ? 1404 C   A O2    1 
ATOM   36  N N3    . C   A 1 2  ? 8.980   -11.029 35.490  1.00 57.94  ? 1404 C   A N3    1 
ATOM   37  C C4    . C   A 1 2  ? 7.750   -10.550 35.296  1.00 76.94  ? 1404 C   A C4    1 
ATOM   38  N N4    . C   A 1 2  ? 6.921   -11.247 34.515  1.00 81.56  ? 1404 C   A N4    1 
ATOM   39  C C5    . C   A 1 2  ? 7.311   -9.331  35.892  1.00 85.87  ? 1404 C   A C5    1 
ATOM   40  C C6    . C   A 1 2  ? 8.185   -8.665  36.658  1.00 76.68  ? 1404 C   A C6    1 
ATOM   41  P P     . G   A 1 3  ? 11.416  -4.393  35.365  1.00 82.52  ? 1405 G   A P     1 
ATOM   42  O OP1   . G   A 1 3  ? 12.231  -3.152  35.465  1.00 77.69  ? 1405 G   A OP1   1 
ATOM   43  O OP2   . G   A 1 3  ? 10.108  -4.352  34.653  1.00 81.81  ? 1405 G   A OP2   1 
ATOM   44  O "O5'" . G   A 1 3  ? 12.308  -5.555  34.730  1.00 78.51  ? 1405 G   A "O5'" 1 
ATOM   45  C "C5'" . G   A 1 3  ? 13.690  -5.718  35.120  1.00 83.22  ? 1405 G   A "C5'" 1 
ATOM   46  C "C4'" . G   A 1 3  ? 14.384  -6.742  34.243  1.00 88.67  ? 1405 G   A "C4'" 1 
ATOM   47  O "O4'" . G   A 1 3  ? 13.872  -8.067  34.536  1.00 84.89  ? 1405 G   A "O4'" 1 
ATOM   48  C "C3'" . G   A 1 3  ? 14.222  -6.594  32.736  1.00 91.85  ? 1405 G   A "C3'" 1 
ATOM   49  O "O3'" . G   A 1 3  ? 15.119  -5.638  32.174  1.00 99.45  ? 1405 G   A "O3'" 1 
ATOM   50  C "C2'" . G   A 1 3  ? 14.511  -8.008  32.251  1.00 91.80  ? 1405 G   A "C2'" 1 
ATOM   51  O "O2'" . G   A 1 3  ? 15.898  -8.288  32.214  1.00 92.65  ? 1405 G   A "O2'" 1 
ATOM   52  C "C1'" . G   A 1 3  ? 13.842  -8.840  33.348  1.00 80.83  ? 1405 G   A "C1'" 1 
ATOM   53  N N9    . G   A 1 3  ? 12.445  -9.134  33.051  1.00 71.29  ? 1405 G   A N9    1 
ATOM   54  C C8    . G   A 1 3  ? 11.350  -8.390  33.426  1.00 74.02  ? 1405 G   A C8    1 
ATOM   55  N N7    . G   A 1 3  ? 10.221  -8.903  33.024  1.00 76.66  ? 1405 G   A N7    1 
ATOM   56  C C5    . G   A 1 3  ? 10.592  -10.052 32.339  1.00 71.94  ? 1405 G   A C5    1 
ATOM   57  C C6    . G   A 1 3  ? 9.799   -11.014 31.672  1.00 67.11  ? 1405 G   A C6    1 
ATOM   58  O O6    . G   A 1 3  ? 8.573   -11.034 31.528  1.00 65.86  ? 1405 G   A O6    1 
ATOM   59  N N1    . G   A 1 3  ? 10.577  -12.026 31.123  1.00 59.80  ? 1405 G   A N1    1 
ATOM   60  C C2    . G   A 1 3  ? 11.941  -12.096 31.189  1.00 60.51  ? 1405 G   A C2    1 
ATOM   61  N N2    . G   A 1 3  ? 12.499  -13.166 30.603  1.00 57.36  ? 1405 G   A N2    1 
ATOM   62  N N3    . G   A 1 3  ? 12.698  -11.192 31.790  1.00 59.23  ? 1405 G   A N3    1 
ATOM   63  C C4    . G   A 1 3  ? 11.961  -10.208 32.345  1.00 65.93  ? 1405 G   A C4    1 
ATOM   64  P P     . U   A 1 4  ? 14.884  -5.108  30.671  1.00 112.77 ? 1406 U   A P     1 
ATOM   65  O OP1   . U   A 1 4  ? 15.922  -4.081  30.393  1.00 123.49 ? 1406 U   A OP1   1 
ATOM   66  O OP2   . U   A 1 4  ? 13.452  -4.746  30.533  1.00 118.23 ? 1406 U   A OP2   1 
ATOM   67  O "O5'" . U   A 1 4  ? 15.192  -6.382  29.757  1.00 107.10 ? 1406 U   A "O5'" 1 
ATOM   68  C "C5'" . U   A 1 4  ? 14.704  -6.459  28.401  1.00 104.46 ? 1406 U   A "C5'" 1 
ATOM   69  C "C4'" . U   A 1 4  ? 15.265  -7.678  27.695  1.00 109.42 ? 1406 U   A "C4'" 1 
ATOM   70  O "O4'" . U   A 1 4  ? 14.960  -8.884  28.456  1.00 113.34 ? 1406 U   A "O4'" 1 
ATOM   71  C "C3'" . U   A 1 4  ? 14.624  -7.948  26.344  1.00 110.50 ? 1406 U   A "C3'" 1 
ATOM   72  O "O3'" . U   A 1 4  ? 15.119  -7.153  25.289  1.00 106.96 ? 1406 U   A "O3'" 1 
ATOM   73  C "C2'" . U   A 1 4  ? 14.855  -9.436  26.151  1.00 107.84 ? 1406 U   A "C2'" 1 
ATOM   74  O "O2'" . U   A 1 4  ? 16.167  -9.751  25.725  1.00 107.88 ? 1406 U   A "O2'" 1 
ATOM   75  C "C1'" . U   A 1 4  ? 14.585  -9.942  27.569  1.00 108.40 ? 1406 U   A "C1'" 1 
ATOM   76  N N1    . U   A 1 4  ? 13.145  -10.210 27.750  1.00 99.89  ? 1406 U   A N1    1 
ATOM   77  C C2    . U   A 1 4  ? 12.595  -11.339 27.146  1.00 95.94  ? 1406 U   A C2    1 
ATOM   78  O O2    . U   A 1 4  ? 13.258  -12.177 26.552  1.00 96.00  ? 1406 U   A O2    1 
ATOM   79  N N3    . U   A 1 4  ? 11.234  -11.453 27.275  1.00 94.23  ? 1406 U   A N3    1 
ATOM   80  C C4    . U   A 1 4  ? 10.387  -10.595 27.947  1.00 90.12  ? 1406 U   A C4    1 
ATOM   81  O O4    . U   A 1 4  ? 9.177   -10.777 27.889  1.00 88.74  ? 1406 U   A O4    1 
ATOM   82  C C5    . U   A 1 4  ? 11.030  -9.496  28.585  1.00 96.39  ? 1406 U   A C5    1 
ATOM   83  C C6    . U   A 1 4  ? 12.351  -9.344  28.471  1.00 100.68 ? 1406 U   A C6    1 
ATOM   84  P P     . C   A 1 5  ? 14.082  -6.571  24.214  1.00 110.15 ? 1407 C   A P     1 
ATOM   85  O OP1   . C   A 1 5  ? 14.845  -5.862  23.147  1.00 113.25 ? 1407 C   A OP1   1 
ATOM   86  O OP2   . C   A 1 5  ? 13.024  -5.855  24.968  1.00 105.25 ? 1407 C   A OP2   1 
ATOM   87  O "O5'" . C   A 1 5  ? 13.421  -7.875  23.585  1.00 94.16  ? 1407 C   A "O5'" 1 
ATOM   88  C "C5'" . C   A 1 5  ? 14.228  -8.833  22.906  1.00 77.59  ? 1407 C   A "C5'" 1 
ATOM   89  C "C4'" . C   A 1 5  ? 13.378  -9.927  22.333  1.00 58.52  ? 1407 C   A "C4'" 1 
ATOM   90  O "O4'" . C   A 1 5  ? 12.678  -10.596 23.407  1.00 60.92  ? 1407 C   A "O4'" 1 
ATOM   91  C "C3'" . C   A 1 5  ? 12.263  -9.513  21.394  1.00 65.41  ? 1407 C   A "C3'" 1 
ATOM   92  O "O3'" . C   A 1 5  ? 12.735  -9.217  20.086  1.00 76.71  ? 1407 C   A "O3'" 1 
ATOM   93  C "C2'" . C   A 1 5  ? 11.361  -10.743 21.441  1.00 63.13  ? 1407 C   A "C2'" 1 
ATOM   94  O "O2'" . C   A 1 5  ? 11.820  -11.843 20.677  1.00 74.57  ? 1407 C   A "O2'" 1 
ATOM   95  C "C1'" . C   A 1 5  ? 11.441  -11.105 22.924  1.00 56.15  ? 1407 C   A "C1'" 1 
ATOM   96  N N1    . C   A 1 5  ? 10.351  -10.460 23.661  1.00 48.36  ? 1407 C   A N1    1 
ATOM   97  C C2    . C   A 1 5  ? 9.042   -10.928 23.484  1.00 56.88  ? 1407 C   A C2    1 
ATOM   98  O O2    . C   A 1 5  ? 8.855   -11.959 22.814  1.00 47.40  ? 1407 C   A O2    1 
ATOM   99  N N3    . C   A 1 5  ? 8.023   -10.253 24.061  1.00 48.61  ? 1407 C   A N3    1 
ATOM   100 C C4    . C   A 1 5  ? 8.281   -9.184  24.822  1.00 42.39  ? 1407 C   A C4    1 
ATOM   101 N N4    . C   A 1 5  ? 7.255   -8.524  25.355  1.00 48.10  ? 1407 C   A N4    1 
ATOM   102 C C5    . C   A 1 5  ? 9.603   -8.738  25.069  1.00 33.81  ? 1407 C   A C5    1 
ATOM   103 C C6    . C   A 1 5  ? 10.596  -9.395  24.477  1.00 40.72  ? 1407 C   A C6    1 
ATOM   104 P P     . A   A 1 6  ? 11.851  -8.287  19.110  1.00 94.45  ? 1408 A   A P     1 
ATOM   105 O OP1   . A   A 1 6  ? 12.573  -8.168  17.816  1.00 104.85 ? 1408 A   A OP1   1 
ATOM   106 O OP2   . A   A 1 6  ? 11.463  -7.061  19.852  1.00 88.32  ? 1408 A   A OP2   1 
ATOM   107 O "O5'" . A   A 1 6  ? 10.537  -9.137  18.824  1.00 73.18  ? 1408 A   A "O5'" 1 
ATOM   108 C "C5'" . A   A 1 6  ? 10.619  -10.425 18.210  1.00 55.64  ? 1408 A   A "C5'" 1 
ATOM   109 C "C4'" . A   A 1 6  ? 9.280   -11.102 18.273  1.00 57.07  ? 1408 A   A "C4'" 1 
ATOM   110 O "O4'" . A   A 1 6  ? 8.841   -11.114 19.652  1.00 53.65  ? 1408 A   A "O4'" 1 
ATOM   111 C "C3'" . A   A 1 6  ? 8.171   -10.361 17.558  1.00 64.55  ? 1408 A   A "C3'" 1 
ATOM   112 O "O3'" . A   A 1 6  ? 8.179   -10.646 16.171  1.00 76.89  ? 1408 A   A "O3'" 1 
ATOM   113 C "C2'" . A   A 1 6  ? 6.921   -10.860 18.273  1.00 59.01  ? 1408 A   A "C2'" 1 
ATOM   114 O "O2'" . A   A 1 6  ? 6.468   -12.118 17.816  1.00 54.11  ? 1408 A   A "O2'" 1 
ATOM   115 C "C1'" . A   A 1 6  ? 7.433   -10.971 19.710  1.00 46.40  ? 1408 A   A "C1'" 1 
ATOM   116 N N9    . A   A 1 6  ? 7.123   -9.810  20.543  1.00 47.51  ? 1408 A   A N9    1 
ATOM   117 C C8    . A   A 1 6  ? 7.967   -8.835  21.027  1.00 53.65  ? 1408 A   A C8    1 
ATOM   118 N N7    . A   A 1 6  ? 7.361   -7.927  21.755  1.00 45.78  ? 1408 A   A N7    1 
ATOM   119 C C5    . A   A 1 6  ? 6.033   -8.334  21.752  1.00 36.04  ? 1408 A   A C5    1 
ATOM   120 C C6    . A   A 1 6  ? 4.886   -7.811  22.358  1.00 46.26  ? 1408 A   A C6    1 
ATOM   121 N N6    . A   A 1 6  ? 4.883   -6.719  23.132  1.00 56.16  ? 1408 A   A N6    1 
ATOM   122 N N1    . A   A 1 6  ? 3.720   -8.457  22.152  1.00 42.81  ? 1408 A   A N1    1 
ATOM   123 C C2    . A   A 1 6  ? 3.720   -9.557  21.398  1.00 41.45  ? 1408 A   A C2    1 
ATOM   124 N N3    . A   A 1 6  ? 4.732   -10.153 20.783  1.00 47.17  ? 1408 A   A N3    1 
ATOM   125 C C4    . A   A 1 6  ? 5.874   -9.485  21.005  1.00 43.26  ? 1408 A   A C4    1 
ATOM   126 P P     . C   A 1 7  ? 7.827   -9.485  15.125  1.00 79.61  ? 1409 C   A P     1 
ATOM   127 O OP1   . C   A 1 7  ? 7.900   -10.107 13.773  1.00 81.23  ? 1409 C   A OP1   1 
ATOM   128 O OP2   . C   A 1 7  ? 8.670   -8.297  15.436  1.00 74.34  ? 1409 C   A OP2   1 
ATOM   129 O "O5'" . C   A 1 7  ? 6.304   -9.149  15.451  1.00 66.22  ? 1409 C   A "O5'" 1 
ATOM   130 C "C5'" . C   A 1 7  ? 5.255   -10.024 15.005  1.00 63.56  ? 1409 C   A "C5'" 1 
ATOM   131 C "C4'" . C   A 1 7  ? 3.912   -9.450  15.363  1.00 70.21  ? 1409 C   A "C4'" 1 
ATOM   132 O "O4'" . C   A 1 7  ? 3.766   -9.465  16.804  1.00 73.02  ? 1409 C   A "O4'" 1 
ATOM   133 C "C3'" . C   A 1 7  ? 3.683   -7.990  15.008  1.00 74.81  ? 1409 C   A "C3'" 1 
ATOM   134 O "O3'" . C   A 1 7  ? 3.357   -7.768  13.644  1.00 75.24  ? 1409 C   A "O3'" 1 
ATOM   135 C "C2'" . C   A 1 7  ? 2.563   -7.612  15.962  1.00 71.84  ? 1409 C   A "C2'" 1 
ATOM   136 O "O2'" . C   A 1 7  ? 1.298   -8.133  15.606  1.00 76.06  ? 1409 C   A "O2'" 1 
ATOM   137 C "C1'" . C   A 1 7  ? 3.028   -8.325  17.222  1.00 58.90  ? 1409 C   A "C1'" 1 
ATOM   138 N N1    . C   A 1 7  ? 3.924   -7.473  18.016  1.00 51.51  ? 1409 C   A N1    1 
ATOM   139 C C2    . C   A 1 7  ? 3.366   -6.563  18.929  1.00 49.98  ? 1409 C   A C2    1 
ATOM   140 O O2    . C   A 1 7  ? 2.133   -6.477  19.021  1.00 55.44  ? 1409 C   A O2    1 
ATOM   141 N N3    . C   A 1 7  ? 4.181   -5.808  19.688  1.00 46.51  ? 1409 C   A N3    1 
ATOM   142 C C4    . C   A 1 7  ? 5.501   -5.939  19.579  1.00 47.75  ? 1409 C   A C4    1 
ATOM   143 N N4    . C   A 1 7  ? 6.265   -5.205  20.386  1.00 49.80  ? 1409 C   A N4    1 
ATOM   144 C C5    . C   A 1 7  ? 6.096   -6.836  18.645  1.00 55.21  ? 1409 C   A C5    1 
ATOM   145 C C6    . C   A 1 7  ? 5.277   -7.572  17.884  1.00 31.67  ? 1409 C   A C6    1 
ATOM   146 P P     . A   A 1 8  ? 3.842   -6.411  12.935  1.00 72.79  ? 1410 A   A P     1 
ATOM   147 O OP1   . A   A 1 8  ? 3.523   -6.578  11.502  1.00 78.52  ? 1410 A   A OP1   1 
ATOM   148 O OP2   . A   A 1 8  ? 5.243   -6.122  13.335  1.00 50.20  ? 1410 A   A OP2   1 
ATOM   149 O "O5'" . A   A 1 8  ? 2.894   -5.290  13.573  1.00 65.13  ? 1410 A   A "O5'" 1 
ATOM   150 C "C5'" . A   A 1 8  ? 1.448   -5.387  13.471  1.00 59.42  ? 1410 A   A "C5'" 1 
ATOM   151 C "C4'" . A   A 1 8  ? 0.769   -4.256  14.229  1.00 58.97  ? 1410 A   A "C4'" 1 
ATOM   152 O "O4'" . A   A 1 8  ? 0.939   -4.428  15.664  1.00 66.58  ? 1410 A   A "O4'" 1 
ATOM   153 C "C3'" . A   A 1 8  ? 1.283   -2.851  13.976  1.00 65.72  ? 1410 A   A "C3'" 1 
ATOM   154 O "O3'" . A   A 1 8  ? 0.787   -2.295  12.767  1.00 71.37  ? 1410 A   A "O3'" 1 
ATOM   155 C "C2'" . A   A 1 8  ? 0.790   -2.108  15.211  1.00 60.63  ? 1410 A   A "C2'" 1 
ATOM   156 O "O2'" . A   A 1 8  ? -0.589  -1.817  15.154  1.00 72.55  ? 1410 A   A "O2'" 1 
ATOM   157 C "C1'" . A   A 1 8  ? 1.020   -3.157  16.298  1.00 52.45  ? 1410 A   A "C1'" 1 
ATOM   158 N N9    . A   A 1 8  ? 2.341   -3.032  16.917  1.00 42.86  ? 1410 A   A N9    1 
ATOM   159 C C8    . A   A 1 8  ? 3.485   -3.721  16.591  1.00 53.70  ? 1410 A   A C8    1 
ATOM   160 N N7    . A   A 1 8  ? 4.533   -3.385  17.308  1.00 49.42  ? 1410 A   A N7    1 
ATOM   161 C C5    . A   A 1 8  ? 4.046   -2.415  18.170  1.00 51.22  ? 1410 A   A C5    1 
ATOM   162 C C6    . A   A 1 8  ? 4.659   -1.670  19.190  1.00 41.06  ? 1410 A   A C6    1 
ATOM   163 N N6    . A   A 1 8  ? 5.934   -1.797  19.534  1.00 52.20  ? 1410 A   A N6    1 
ATOM   164 N N1    . A   A 1 8  ? 3.904   -0.784  19.856  1.00 38.56  ? 1410 A   A N1    1 
ATOM   165 C C2    . A   A 1 8  ? 2.609   -0.669  19.524  1.00 55.30  ? 1410 A   A C2    1 
ATOM   166 N N3    . A   A 1 8  ? 1.911   -1.320  18.594  1.00 44.85  ? 1410 A   A N3    1 
ATOM   167 C C4    . A   A 1 8  ? 2.696   -2.188  17.941  1.00 47.32  ? 1410 A   A C4    1 
ATOM   168 P P     . C   A 1 9  ? 1.771   -1.430  11.828  1.00 80.05  ? 1411 C   A P     1 
ATOM   169 O OP1   . C   A 1 9  ? 1.030   -1.195  10.571  1.00 86.30  ? 1411 C   A OP1   1 
ATOM   170 O OP2   . C   A 1 9  ? 3.113   -2.063  11.780  1.00 82.59  ? 1411 C   A OP2   1 
ATOM   171 O "O5'" . C   A 1 9  ? 1.949   -0.045  12.594  1.00 75.95  ? 1411 C   A "O5'" 1 
ATOM   172 C "C5'" . C   A 1 9  ? 0.810   0.731   12.953  1.00 56.81  ? 1411 C   A "C5'" 1 
ATOM   173 C "C4'" . C   A 1 9  ? 1.096   1.571   14.178  1.00 56.08  ? 1411 C   A "C4'" 1 
ATOM   174 O "O4'" . C   A 1 9  ? 1.711   0.755   15.204  1.00 42.61  ? 1411 C   A "O4'" 1 
ATOM   175 C "C3'" . C   A 1 9  ? 2.114   2.701   14.107  1.00 46.00  ? 1411 C   A "C3'" 1 
ATOM   176 O "O3'" . C   A 1 9  ? 1.636   3.855   13.424  1.00 43.98  ? 1411 C   A "O3'" 1 
ATOM   177 C "C2'" . C   A 1 9  ? 2.250   3.022   15.592  1.00 42.87  ? 1411 C   A "C2'" 1 
ATOM   178 O "O2'" . C   A 1 9  ? 1.119   3.702   16.104  1.00 50.30  ? 1411 C   A "O2'" 1 
ATOM   179 C "C1'" . C   A 1 9  ? 2.236   1.621   16.200  1.00 41.97  ? 1411 C   A "C1'" 1 
ATOM   180 N N1    . C   A 1 9  ? 3.586   1.191   16.597  1.00 31.82  ? 1411 C   A N1    1 
ATOM   181 C C2    . C   A 1 9  ? 4.187   1.835   17.679  1.00 42.61  ? 1411 C   A C2    1 
ATOM   182 O O2    . C   A 1 9  ? 3.563   2.716   18.272  1.00 54.39  ? 1411 C   A O2    1 
ATOM   183 N N3    . C   A 1 9  ? 5.432   1.490   18.050  1.00 56.15  ? 1411 C   A N3    1 
ATOM   184 C C4    . C   A 1 9  ? 6.084   0.542   17.386  1.00 57.45  ? 1411 C   A C4    1 
ATOM   185 N N4    . C   A 1 9  ? 7.318   0.246   17.786  1.00 62.32  ? 1411 C   A N4    1 
ATOM   186 C C5    . C   A 1 9  ? 5.498   -0.144  16.284  1.00 51.63  ? 1411 C   A C5    1 
ATOM   187 C C6    . C   A 1 9  ? 4.254   0.206   15.929  1.00 48.57  ? 1411 C   A C6    1 
ATOM   188 P P     . C   A 1 10 ? 2.682   4.930   12.843  1.00 51.60  ? 1412 C   A P     1 
ATOM   189 O OP1   . C   A 1 10 ? 1.922   5.793   11.920  1.00 67.72  ? 1412 C   A OP1   1 
ATOM   190 O OP2   . C   A 1 10 ? 3.910   4.247   12.368  1.00 58.69  ? 1412 C   A OP2   1 
ATOM   191 O "O5'" . C   A 1 10 ? 3.085   5.827   14.083  1.00 27.01  ? 1412 C   A "O5'" 1 
ATOM   192 C "C5'" . C   A 1 10 ? 2.112   6.633   14.727  1.00 50.02  ? 1412 C   A "C5'" 1 
ATOM   193 C "C4'" . C   A 1 10 ? 2.754   7.397   15.840  1.00 45.49  ? 1412 C   A "C4'" 1 
ATOM   194 O "O4'" . C   A 1 10 ? 3.267   6.455   16.816  1.00 49.00  ? 1412 C   A "O4'" 1 
ATOM   195 C "C3'" . C   A 1 10 ? 3.989   8.158   15.419  1.00 56.70  ? 1412 C   A "C3'" 1 
ATOM   196 O "O3'" . C   A 1 10 ? 3.689   9.382   14.784  1.00 60.00  ? 1412 C   A "O3'" 1 
ATOM   197 C "C2'" . C   A 1 10 ? 4.708   8.336   16.741  1.00 61.08  ? 1412 C   A "C2'" 1 
ATOM   198 O "O2'" . C   A 1 10 ? 4.101   9.355   17.510  1.00 52.18  ? 1412 C   A "O2'" 1 
ATOM   199 C "C1'" . C   A 1 10 ? 4.463   6.967   17.383  1.00 58.03  ? 1412 C   A "C1'" 1 
ATOM   200 N N1    . C   A 1 10 ? 5.553   5.974   17.192  1.00 55.90  ? 1412 C   A N1    1 
ATOM   201 C C2    . C   A 1 10 ? 6.759   6.127   17.925  1.00 56.75  ? 1412 C   A C2    1 
ATOM   202 O O2    . C   A 1 10 ? 6.901   7.115   18.661  1.00 65.09  ? 1412 C   A O2    1 
ATOM   203 N N3    . C   A 1 10 ? 7.731   5.196   17.804  1.00 43.84  ? 1412 C   A N3    1 
ATOM   204 C C4    . C   A 1 10 ? 7.558   4.156   16.990  1.00 50.53  ? 1412 C   A C4    1 
ATOM   205 N N4    . C   A 1 10 ? 8.536   3.254   16.924  1.00 54.98  ? 1412 C   A N4    1 
ATOM   206 C C5    . C   A 1 10 ? 6.369   3.989   16.213  1.00 49.77  ? 1412 C   A C5    1 
ATOM   207 C C6    . C   A 1 10 ? 5.401   4.912   16.344  1.00 43.54  ? 1412 C   A C6    1 
ATOM   208 P P     . G   A 1 11 ? 4.768   10.032  13.792  1.00 60.76  ? 1488 G   A P     1 
ATOM   209 O OP1   . G   A 1 11 ? 4.170   11.297  13.308  1.00 63.92  ? 1488 G   A OP1   1 
ATOM   210 O OP2   . G   A 1 11 ? 5.219   9.002   12.814  1.00 51.71  ? 1488 G   A OP2   1 
ATOM   211 O "O5'" . G   A 1 11 ? 5.980   10.403  14.752  1.00 44.30  ? 1488 G   A "O5'" 1 
ATOM   212 C "C5'" . G   A 1 11 ? 5.857   11.509  15.643  1.00 54.99  ? 1488 G   A "C5'" 1 
ATOM   213 C "C4'" . G   A 1 11 ? 7.127   11.697  16.425  1.00 58.22  ? 1488 G   A "C4'" 1 
ATOM   214 O "O4'" . G   A 1 11 ? 7.383   10.515  17.222  1.00 60.61  ? 1488 G   A "O4'" 1 
ATOM   215 C "C3'" . G   A 1 11 ? 8.390   11.864  15.611  1.00 55.35  ? 1488 G   A "C3'" 1 
ATOM   216 O "O3'" . G   A 1 11 ? 8.518   13.189  15.135  1.00 70.06  ? 1488 G   A "O3'" 1 
ATOM   217 C "C2'" . G   A 1 11 ? 9.455   11.493  16.627  1.00 58.43  ? 1488 G   A "C2'" 1 
ATOM   218 O "O2'" . G   A 1 11 ? 9.681   12.514  17.575  1.00 54.30  ? 1488 G   A "O2'" 1 
ATOM   219 C "C1'" . G   A 1 11 ? 8.781   10.313  17.330  1.00 60.69  ? 1488 G   A "C1'" 1 
ATOM   220 N N9    . G   A 1 11 ? 9.097   9.032   16.705  1.00 61.93  ? 1488 G   A N9    1 
ATOM   221 C C8    . G   A 1 11 ? 8.341   8.349   15.778  1.00 57.37  ? 1488 G   A C8    1 
ATOM   222 N N7    . G   A 1 11 ? 8.881   7.220   15.414  1.00 55.25  ? 1488 G   A N7    1 
ATOM   223 C C5    . G   A 1 11 ? 10.064  7.156   16.139  1.00 46.91  ? 1488 G   A C5    1 
ATOM   224 C C6    . G   A 1 11 ? 11.067  6.165   16.160  1.00 54.36  ? 1488 G   A C6    1 
ATOM   225 O O6    . G   A 1 11 ? 11.106  5.094   15.533  1.00 60.53  ? 1488 G   A O6    1 
ATOM   226 N N1    . G   A 1 11 ? 12.107  6.512   17.015  1.00 52.30  ? 1488 G   A N1    1 
ATOM   227 C C2    . G   A 1 11 ? 12.167  7.667   17.755  1.00 61.44  ? 1488 G   A C2    1 
ATOM   228 N N2    . G   A 1 11 ? 13.273  7.846   18.493  1.00 74.74  ? 1488 G   A N2    1 
ATOM   229 N N3    . G   A 1 11 ? 11.221  8.585   17.763  1.00 44.99  ? 1488 G   A N3    1 
ATOM   230 C C4    . G   A 1 11 ? 10.212  8.270   16.935  1.00 41.29  ? 1488 G   A C4    1 
ATOM   231 P P     . G   A 1 12 ? 9.411   13.480  13.835  1.00 70.20  ? 1489 G   A P     1 
ATOM   232 O OP1   . G   A 1 12 ? 9.312   14.937  13.590  1.00 66.82  ? 1489 G   A OP1   1 
ATOM   233 O OP2   . G   A 1 12 ? 9.005   12.530  12.776  1.00 49.83  ? 1489 G   A OP2   1 
ATOM   234 O "O5'" . G   A 1 12 ? 10.890  13.149  14.331  1.00 68.55  ? 1489 G   A "O5'" 1 
ATOM   235 C "C5'" . G   A 1 12 ? 11.462  13.913  15.411  1.00 75.85  ? 1489 G   A "C5'" 1 
ATOM   236 C "C4'" . G   A 1 12 ? 12.798  13.345  15.862  1.00 81.74  ? 1489 G   A "C4'" 1 
ATOM   237 O "O4'" . G   A 1 12 ? 12.635  12.028  16.442  1.00 75.88  ? 1489 G   A "O4'" 1 
ATOM   238 C "C3'" . G   A 1 12 ? 13.910  13.152  14.845  1.00 73.71  ? 1489 G   A "C3'" 1 
ATOM   239 O "O3'" . G   A 1 12 ? 14.555  14.382  14.520  1.00 77.62  ? 1489 G   A "O3'" 1 
ATOM   240 C "C2'" . G   A 1 12 ? 14.848  12.219  15.601  1.00 69.75  ? 1489 G   A "C2'" 1 
ATOM   241 O "O2'" . G   A 1 12 ? 15.621  12.892  16.580  1.00 72.34  ? 1489 G   A "O2'" 1 
ATOM   242 C "C1'" . G   A 1 12 ? 13.847  11.306  16.309  1.00 69.31  ? 1489 G   A "C1'" 1 
ATOM   243 N N9    . G   A 1 12 ? 13.577  10.076  15.571  1.00 76.32  ? 1489 G   A N9    1 
ATOM   244 C C8    . G   A 1 12 ? 12.430  9.746   14.885  1.00 71.35  ? 1489 G   A C8    1 
ATOM   245 N N7    . G   A 1 12 ? 12.484  8.563   14.340  1.00 69.12  ? 1489 G   A N7    1 
ATOM   246 C C5    . G   A 1 12 ? 13.743  8.082   14.683  1.00 71.97  ? 1489 G   A C5    1 
ATOM   247 C C6    . G   A 1 12 ? 14.369  6.845   14.382  1.00 72.49  ? 1489 G   A C6    1 
ATOM   248 O O6    . G   A 1 12 ? 13.912  5.886   13.744  1.00 69.22  ? 1489 G   A O6    1 
ATOM   249 N N1    . G   A 1 12 ? 15.655  6.777   14.915  1.00 72.67  ? 1489 G   A N1    1 
ATOM   250 C C2    . G   A 1 12 ? 16.257  7.763   15.653  1.00 82.61  ? 1489 G   A C2    1 
ATOM   251 N N2    . G   A 1 12 ? 17.503  7.506   16.083  1.00 87.18  ? 1489 G   A N2    1 
ATOM   252 N N3    . G   A 1 12 ? 15.680  8.918   15.951  1.00 85.53  ? 1489 G   A N3    1 
ATOM   253 C C4    . G   A 1 12 ? 14.432  9.008   15.436  1.00 78.55  ? 1489 G   A C4    1 
ATOM   254 P P     . U   A 1 13 ? 15.130  14.614  13.036  1.00 82.57  ? 1490 U   A P     1 
ATOM   255 O OP1   . U   A 1 13 ? 15.751  15.961  13.081  1.00 85.37  ? 1490 U   A OP1   1 
ATOM   256 O OP2   . U   A 1 13 ? 14.069  14.326  12.035  1.00 74.38  ? 1490 U   A OP2   1 
ATOM   257 O "O5'" . U   A 1 13 ? 16.250  13.489  12.859  1.00 79.62  ? 1490 U   A "O5'" 1 
ATOM   258 C "C5'" . U   A 1 13 ? 17.381  13.411  13.756  1.00 83.74  ? 1490 U   A "C5'" 1 
ATOM   259 C "C4'" . U   A 1 13 ? 18.196  12.166  13.482  1.00 85.73  ? 1490 U   A "C4'" 1 
ATOM   260 O "O4'" . U   A 1 13 ? 17.478  10.984  13.925  1.00 83.68  ? 1490 U   A "O4'" 1 
ATOM   261 C "C3'" . U   A 1 13 ? 18.509  11.866  12.025  1.00 99.58  ? 1490 U   A "C3'" 1 
ATOM   262 O "O3'" . U   A 1 13 ? 19.581  12.646  11.508  1.00 114.97 ? 1490 U   A "O3'" 1 
ATOM   263 C "C2'" . U   A 1 13 ? 18.843  10.382  12.068  1.00 92.81  ? 1490 U   A "C2'" 1 
ATOM   264 O "O2'" . U   A 1 13 ? 20.151  10.112  12.523  1.00 102.82 ? 1490 U   A "O2'" 1 
ATOM   265 C "C1'" . U   A 1 13 ? 17.826  9.881   13.094  1.00 90.30  ? 1490 U   A "C1'" 1 
ATOM   266 N N1    . U   A 1 13 ? 16.614  9.368   12.441  1.00 94.16  ? 1490 U   A N1    1 
ATOM   267 C C2    . U   A 1 13 ? 16.641  8.067   11.972  1.00 98.34  ? 1490 U   A C2    1 
ATOM   268 O O2    . U   A 1 13 ? 17.612  7.341   12.095  1.00 101.97 ? 1490 U   A O2    1 
ATOM   269 N N3    . U   A 1 13 ? 15.488  7.648   11.351  1.00 105.65 ? 1490 U   A N3    1 
ATOM   270 C C4    . U   A 1 13 ? 14.328  8.383   11.159  1.00 107.13 ? 1490 U   A C4    1 
ATOM   271 O O4    . U   A 1 13 ? 13.369  7.876   10.560  1.00 104.20 ? 1490 U   A O4    1 
ATOM   272 C C5    . U   A 1 13 ? 14.381  9.712   11.682  1.00 104.68 ? 1490 U   A C5    1 
ATOM   273 C C6    . U   A 1 13 ? 15.492  10.148  12.288  1.00 99.75  ? 1490 U   A C6    1 
ATOM   274 P P     . G   A 1 14 ? 19.666  12.931  9.924   1.00 129.38 ? 1491 G   A P     1 
ATOM   275 O OP1   . G   A 1 14 ? 20.843  13.820  9.739   1.00 135.22 ? 1491 G   A OP1   1 
ATOM   276 O OP2   . G   A 1 14 ? 18.334  13.370  9.419   1.00 126.11 ? 1491 G   A OP2   1 
ATOM   277 O "O5'" . G   A 1 14 ? 19.993  11.504  9.279   1.00 127.73 ? 1491 G   A "O5'" 1 
ATOM   278 C "C5'" . G   A 1 14 ? 21.316  10.936  9.381   1.00 119.89 ? 1491 G   A "C5'" 1 
ATOM   279 C "C4'" . G   A 1 14 ? 21.378  9.570   8.726   1.00 115.34 ? 1491 G   A "C4'" 1 
ATOM   280 O "O4'" . G   A 1 14 ? 20.438  8.675   9.373   1.00 106.75 ? 1491 G   A "O4'" 1 
ATOM   281 C "C3'" . G   A 1 14 ? 21.030  9.441   7.248   1.00 116.43 ? 1491 G   A "C3'" 1 
ATOM   282 O "O3'" . G   A 1 14 ? 22.111  9.855   6.397   1.00 124.60 ? 1491 G   A "O3'" 1 
ATOM   283 C "C2'" . G   A 1 14 ? 20.748  7.944   7.126   1.00 113.37 ? 1491 G   A "C2'" 1 
ATOM   284 O "O2'" . G   A 1 14 ? 21.923  7.157   7.026   1.00 120.68 ? 1491 G   A "O2'" 1 
ATOM   285 C "C1'" . G   A 1 14 ? 20.059  7.655   8.463   1.00 102.08 ? 1491 G   A "C1'" 1 
ATOM   286 N N9    . G   A 1 14 ? 18.605  7.634   8.363   1.00 82.59  ? 1491 G   A N9    1 
ATOM   287 C C8    . G   A 1 14 ? 17.747  8.681   8.570   1.00 82.40  ? 1491 G   A C8    1 
ATOM   288 N N7    . G   A 1 14 ? 16.497  8.360   8.392   1.00 82.52  ? 1491 G   A N7    1 
ATOM   289 C C5    . G   A 1 14 ? 16.531  7.018   8.051   1.00 77.86  ? 1491 G   A C5    1 
ATOM   290 C C6    . G   A 1 14 ? 15.479  6.126   7.752   1.00 84.19  ? 1491 G   A C6    1 
ATOM   291 O O6    . G   A 1 14 ? 14.268  6.352   7.716   1.00 97.23  ? 1491 G   A O6    1 
ATOM   292 N N1    . G   A 1 14 ? 15.951  4.852   7.476   1.00 78.66  ? 1491 G   A N1    1 
ATOM   293 C C2    . G   A 1 14 ? 17.267  4.481   7.481   1.00 75.16  ? 1491 G   A C2    1 
ATOM   294 N N2    . G   A 1 14 ? 17.514  3.201   7.186   1.00 48.36  ? 1491 G   A N2    1 
ATOM   295 N N3    . G   A 1 14 ? 18.266  5.307   7.754   1.00 79.80  ? 1491 G   A N3    1 
ATOM   296 C C4    . G   A 1 14 ? 17.824  6.552   8.031   1.00 78.28  ? 1491 G   A C4    1 
ATOM   297 P P     . A   A 1 15 ? 22.026  9.606   4.804   1.00 116.50 ? 1492 A   A P     1 
ATOM   298 O OP1   . A   A 1 15 ? 20.595  9.561   4.419   1.00 119.53 ? 1492 A   A OP1   1 
ATOM   299 O OP2   . A   A 1 15 ? 22.916  8.464   4.463   1.00 121.89 ? 1492 A   A OP2   1 
ATOM   300 O "O5'" . A   A 1 15 ? 22.652  10.920  4.164   1.00 117.29 ? 1492 A   A "O5'" 1 
ATOM   301 C "C5'" . A   A 1 15 ? 24.029  11.264  4.369   1.00 123.45 ? 1492 A   A "C5'" 1 
ATOM   302 C "C4'" . A   A 1 15 ? 24.684  11.571  3.044   1.00 131.81 ? 1492 A   A "C4'" 1 
ATOM   303 O "O4'" . A   A 1 15 ? 25.853  12.390  3.276   1.00 131.97 ? 1492 A   A "O4'" 1 
ATOM   304 C "C3'" . A   A 1 15 ? 25.200  10.387  2.233   1.00 133.12 ? 1492 A   A "C3'" 1 
ATOM   305 O "O3'" . A   A 1 15 ? 24.185  9.735   1.462   1.00 135.25 ? 1492 A   A "O3'" 1 
ATOM   306 C "C2'" . A   A 1 15 ? 26.258  11.044  1.358   1.00 131.78 ? 1492 A   A "C2'" 1 
ATOM   307 O "O2'" . A   A 1 15 ? 25.710  11.734  0.254   1.00 131.68 ? 1492 A   A "O2'" 1 
ATOM   308 C "C1'" . A   A 1 15 ? 26.854  12.061  2.330   1.00 136.14 ? 1492 A   A "C1'" 1 
ATOM   309 N N9    . A   A 1 15 ? 28.009  11.542  3.058   1.00 143.32 ? 1492 A   A N9    1 
ATOM   310 C C8    . A   A 1 15 ? 28.031  10.632  4.087   1.00 143.59 ? 1492 A   A C8    1 
ATOM   311 N N7    . A   A 1 15 ? 29.235  10.367  4.528   1.00 149.50 ? 1492 A   A N7    1 
ATOM   312 C C5    . A   A 1 15 ? 30.062  11.155  3.737   1.00 149.88 ? 1492 A   A C5    1 
ATOM   313 C C6    . A   A 1 15 ? 31.457  11.327  3.700   1.00 151.78 ? 1492 A   A C6    1 
ATOM   314 N N6    . A   A 1 15 ? 32.305  10.681  4.499   1.00 153.10 ? 1492 A   A N6    1 
ATOM   315 N N1    . A   A 1 15 ? 31.960  12.195  2.795   1.00 155.31 ? 1492 A   A N1    1 
ATOM   316 C C2    . A   A 1 15 ? 31.113  12.834  1.982   1.00 156.92 ? 1492 A   A C2    1 
ATOM   317 N N3    . A   A 1 15 ? 29.787  12.751  1.915   1.00 154.82 ? 1492 A   A N3    1 
ATOM   318 C C4    . A   A 1 15 ? 29.318  11.885  2.830   1.00 149.33 ? 1492 A   A C4    1 
ATOM   319 P P     . A   A 1 16 ? 24.490  8.307   0.770   1.00 131.21 ? 1493 A   A P     1 
ATOM   320 O OP1   . A   A 1 16 ? 23.195  7.767   0.285   1.00 129.28 ? 1493 A   A OP1   1 
ATOM   321 O OP2   . A   A 1 16 ? 25.325  7.492   1.692   1.00 130.22 ? 1493 A   A OP2   1 
ATOM   322 O "O5'" . A   A 1 16 ? 25.373  8.673   -0.505  1.00 125.05 ? 1493 A   A "O5'" 1 
ATOM   323 C "C5'" . A   A 1 16 ? 25.957  7.647   -1.338  0.01 120.94 ? 1493 A   A "C5'" 1 
ATOM   324 C "C4'" . A   A 1 16 ? 25.350  7.705   -2.718  0.01 117.31 ? 1493 A   A "C4'" 1 
ATOM   325 O "O4'" . A   A 1 16 ? 26.143  6.956   -3.672  0.01 115.51 ? 1493 A   A "O4'" 1 
ATOM   326 C "C3'" . A   A 1 16 ? 23.962  7.108   -2.857  0.01 116.49 ? 1493 A   A "C3'" 1 
ATOM   327 O "O3'" . A   A 1 16 ? 22.987  8.007   -2.340  1.00 115.34 ? 1493 A   A "O3'" 1 
ATOM   328 C "C2'" . A   A 1 16 ? 23.861  6.898   -4.365  0.01 114.75 ? 1493 A   A "C2'" 1 
ATOM   329 O "O2'" . A   A 1 16 ? 23.544  8.084   -5.068  0.01 114.60 ? 1493 A   A "O2'" 1 
ATOM   330 C "C1'" . A   A 1 16 ? 25.298  6.489   -4.713  0.01 113.70 ? 1493 A   A "C1'" 1 
ATOM   331 N N9    . A   A 1 16 ? 25.504  5.049   -4.879  0.01 111.42 ? 1493 A   A N9    1 
ATOM   332 C C8    . A   A 1 16 ? 25.431  4.060   -3.928  0.01 110.54 ? 1493 A   A C8    1 
ATOM   333 N N7    . A   A 1 16 ? 25.672  2.859   -4.397  0.01 109.73 ? 1493 A   A N7    1 
ATOM   334 C C5    . A   A 1 16 ? 25.919  3.071   -5.747  0.01 109.42 ? 1493 A   A C5    1 
ATOM   335 C C6    . A   A 1 16 ? 26.238  2.194   -6.800  0.01 108.84 ? 1493 A   A C6    1 
ATOM   336 N N6    . A   A 1 16 ? 26.369  0.874   -6.652  0.01 108.27 ? 1493 A   A N6    1 
ATOM   337 N N1    . A   A 1 16 ? 26.421  2.728   -8.027  0.01 108.65 ? 1493 A   A N1    1 
ATOM   338 C C2    . A   A 1 16 ? 26.290  4.052   -8.176  0.01 108.84 ? 1493 A   A C2    1 
ATOM   339 N N3    . A   A 1 16 ? 25.994  4.977   -7.266  0.01 109.34 ? 1493 A   A N3    1 
ATOM   340 C C4    . A   A 1 16 ? 25.818  4.415   -6.057  0.01 110.03 ? 1493 A   A C4    1 
ATOM   341 P P     . G   A 1 17 ? 21.453  7.541   -2.176  1.00 122.21 ? 1494 G   A P     1 
ATOM   342 O OP1   . G   A 1 17 ? 20.894  7.326   -3.541  1.00 128.48 ? 1494 G   A OP1   1 
ATOM   343 O OP2   . G   A 1 17 ? 20.804  8.517   -1.260  1.00 112.89 ? 1494 G   A OP2   1 
ATOM   344 O "O5'" . G   A 1 17 ? 21.500  6.135   -1.426  1.00 113.92 ? 1494 G   A "O5'" 1 
ATOM   345 C "C5'" . G   A 1 17 ? 21.734  4.904   -2.145  1.00 112.77 ? 1494 G   A "C5'" 1 
ATOM   346 C "C4'" . G   A 1 17 ? 20.497  4.028   -2.121  1.00 107.29 ? 1494 G   A "C4'" 1 
ATOM   347 O "O4'" . G   A 1 17 ? 19.981  3.963   -0.762  1.00 101.14 ? 1494 G   A "O4'" 1 
ATOM   348 C "C3'" . G   A 1 17 ? 19.298  4.518   -2.920  1.00 110.03 ? 1494 G   A "C3'" 1 
ATOM   349 O "O3'" . G   A 1 17 ? 19.367  4.205   -4.303  1.00 113.26 ? 1494 G   A "O3'" 1 
ATOM   350 C "C2'" . G   A 1 17 ? 18.145  3.777   -2.259  1.00 103.03 ? 1494 G   A "C2'" 1 
ATOM   351 O "O2'" . G   A 1 17 ? 18.058  2.427   -2.664  1.00 100.12 ? 1494 G   A "O2'" 1 
ATOM   352 C "C1'" . G   A 1 17 ? 18.558  3.849   -0.792  1.00 99.49  ? 1494 G   A "C1'" 1 
ATOM   353 N N9    . G   A 1 17 ? 17.968  5.008   -0.121  1.00 89.07  ? 1494 G   A N9    1 
ATOM   354 C C8    . G   A 1 17 ? 18.615  6.160   0.267   1.00 86.06  ? 1494 G   A C8    1 
ATOM   355 N N7    . G   A 1 17 ? 17.832  7.012   0.869   1.00 84.66  ? 1494 G   A N7    1 
ATOM   356 C C5    . G   A 1 17 ? 16.587  6.393   0.874   1.00 86.86  ? 1494 G   A C5    1 
ATOM   357 C C6    . G   A 1 17 ? 15.342  6.840   1.400   1.00 84.84  ? 1494 G   A C6    1 
ATOM   358 O O6    . G   A 1 17 ? 15.093  7.903   1.989   1.00 82.34  ? 1494 G   A O6    1 
ATOM   359 N N1    . G   A 1 17 ? 14.330  5.904   1.187   1.00 77.78  ? 1494 G   A N1    1 
ATOM   360 C C2    . G   A 1 17 ? 14.494  4.690   0.555   1.00 74.44  ? 1494 G   A C2    1 
ATOM   361 N N2    . G   A 1 17 ? 13.395  3.922   0.456   1.00 52.85  ? 1494 G   A N2    1 
ATOM   362 N N3    . G   A 1 17 ? 15.652  4.262   0.061   1.00 70.61  ? 1494 G   A N3    1 
ATOM   363 C C4    . G   A 1 17 ? 16.649  5.158   0.258   1.00 81.03  ? 1494 G   A C4    1 
ATOM   364 P P     . U   A 1 18 ? 18.312  4.875   -5.312  1.00 118.91 ? 1495 U   A P     1 
ATOM   365 O OP1   . U   A 1 18 ? 18.551  4.290   -6.657  1.00 116.58 ? 1495 U   A OP1   1 
ATOM   366 O OP2   . U   A 1 18 ? 18.382  6.352   -5.119  1.00 112.74 ? 1495 U   A OP2   1 
ATOM   367 O "O5'" . U   A 1 18 ? 16.887  4.378   -4.795  1.00 108.79 ? 1495 U   A "O5'" 1 
ATOM   368 C "C5'" . U   A 1 18 ? 16.454  3.016   -5.000  1.00 114.19 ? 1495 U   A "C5'" 1 
ATOM   369 C "C4'" . U   A 1 18 ? 14.944  2.921   -4.927  1.00 112.93 ? 1495 U   A "C4'" 1 
ATOM   370 O "O4'" . U   A 1 18 ? 14.476  3.173   -3.576  1.00 112.51 ? 1495 U   A "O4'" 1 
ATOM   371 C "C3'" . U   A 1 18 ? 14.192  3.921   -5.783  1.00 114.08 ? 1495 U   A "C3'" 1 
ATOM   372 O "O3'" . U   A 1 18 ? 14.133  3.455   -7.126  1.00 114.15 ? 1495 U   A "O3'" 1 
ATOM   373 C "C2'" . U   A 1 18 ? 12.831  4.002   -5.093  1.00 110.78 ? 1495 U   A "C2'" 1 
ATOM   374 O "O2'" . U   A 1 18 ? 11.943  2.961   -5.450  1.00 117.34 ? 1495 U   A "O2'" 1 
ATOM   375 C "C1'" . U   A 1 18 ? 13.224  3.848   -3.620  1.00 104.56 ? 1495 U   A "C1'" 1 
ATOM   376 N N1    . U   A 1 18 ? 13.350  5.114   -2.877  1.00 97.61  ? 1495 U   A N1    1 
ATOM   377 C C2    . U   A 1 18 ? 12.206  5.650   -2.285  1.00 94.46  ? 1495 U   A C2    1 
ATOM   378 O O2    . U   A 1 18 ? 11.095  5.132   -2.371  1.00 86.92  ? 1495 U   A O2    1 
ATOM   379 N N3    . U   A 1 18 ? 12.413  6.821   -1.590  1.00 92.35  ? 1495 U   A N3    1 
ATOM   380 C C4    . U   A 1 18 ? 13.612  7.501   -1.438  1.00 88.60  ? 1495 U   A C4    1 
ATOM   381 O O4    . U   A 1 18 ? 13.635  8.563   -0.813  1.00 74.11  ? 1495 U   A O4    1 
ATOM   382 C C5    . U   A 1 18 ? 14.732  6.889   -2.083  1.00 86.42  ? 1495 U   A C5    1 
ATOM   383 C C6    . U   A 1 18 ? 14.570  5.752   -2.762  1.00 92.03  ? 1495 U   A C6    1 
ATOM   384 P P     . C   A 1 19 ? 13.597  4.420   -8.289  1.00 118.91 ? 1496 C   A P     1 
ATOM   385 O OP1   . C   A 1 19 ? 14.009  3.777   -9.565  1.00 124.19 ? 1496 C   A OP1   1 
ATOM   386 O OP2   . C   A 1 19 ? 14.010  5.825   -8.007  1.00 110.68 ? 1496 C   A OP2   1 
ATOM   387 O "O5'" . C   A 1 19 ? 12.010  4.317   -8.164  1.00 115.55 ? 1496 C   A "O5'" 1 
ATOM   388 C "C5'" . C   A 1 19 ? 11.168  5.331   -8.734  1.00 108.79 ? 1496 C   A "C5'" 1 
ATOM   389 C "C4'" . C   A 1 19 ? 9.828   5.368   -8.040  1.00 98.19  ? 1496 C   A "C4'" 1 
ATOM   390 O "O4'" . C   A 1 19 ? 10.005  5.285   -6.604  1.00 83.59  ? 1496 C   A "O4'" 1 
ATOM   391 C "C3'" . C   A 1 19 ? 9.103   6.683   -8.254  1.00 102.02 ? 1496 C   A "C3'" 1 
ATOM   392 O "O3'" . C   A 1 19 ? 8.382   6.724   -9.468  1.00 115.62 ? 1496 C   A "O3'" 1 
ATOM   393 C "C2'" . C   A 1 19 ? 8.207   6.779   -7.035  1.00 100.77 ? 1496 C   A "C2'" 1 
ATOM   394 O "O2'" . C   A 1 19 ? 7.024   6.015   -7.162  1.00 114.68 ? 1496 C   A "O2'" 1 
ATOM   395 C "C1'" . C   A 1 19 ? 9.125   6.198   -5.957  1.00 93.34  ? 1496 C   A "C1'" 1 
ATOM   396 N N1    . C   A 1 19 ? 9.940   7.233   -5.282  1.00 90.25  ? 1496 C   A N1    1 
ATOM   397 C C2    . C   A 1 19 ? 9.297   8.232   -4.507  1.00 89.94  ? 1496 C   A C2    1 
ATOM   398 O O2    . C   A 1 19 ? 8.054   8.234   -4.417  1.00 88.77  ? 1496 C   A O2    1 
ATOM   399 N N3    . C   A 1 19 ? 10.052  9.167   -3.886  1.00 82.33  ? 1496 C   A N3    1 
ATOM   400 C C4    . C   A 1 19 ? 11.382  9.145   -4.017  1.00 85.07  ? 1496 C   A C4    1 
ATOM   401 N N4    . C   A 1 19 ? 12.084  10.083  -3.394  1.00 86.04  ? 1496 C   A N4    1 
ATOM   402 C C5    . C   A 1 19 ? 12.053  8.156   -4.797  1.00 75.07  ? 1496 C   A C5    1 
ATOM   403 C C6    . C   A 1 19 ? 11.304  7.231   -5.402  1.00 82.75  ? 1496 C   A C6    1 
ATOM   404 P P     . G   A 1 20 ? 8.238   8.118   -10.245 1.00 122.56 ? 1497 G   A P     1 
ATOM   405 O OP1   . G   A 1 20 ? 7.492   7.851   -11.498 1.00 129.70 ? 1497 G   A OP1   1 
ATOM   406 O OP2   . G   A 1 20 ? 9.586   8.743   -10.307 1.00 116.49 ? 1497 G   A OP2   1 
ATOM   407 O "O5'" . G   A 1 20 ? 7.314   9.006   -9.297  1.00 119.70 ? 1497 G   A "O5'" 1 
ATOM   408 C "C5'" . G   A 1 20 ? 7.237   10.423  -9.492  1.00 111.47 ? 1497 G   A "C5'" 1 
ATOM   409 C "C4'" . G   A 1 20 ? 6.467   11.073  -8.374  1.00 110.64 ? 1497 G   A "C4'" 1 
ATOM   410 O "O4'" . G   A 1 20 ? 7.061   10.740  -7.091  1.00 106.59 ? 1497 G   A "O4'" 1 
ATOM   411 C "C3'" . G   A 1 20 ? 6.527   12.585  -8.422  1.00 114.25 ? 1497 G   A "C3'" 1 
ATOM   412 O "O3'" . G   A 1 20 ? 5.591   13.110  -9.350  1.00 116.70 ? 1497 G   A "O3'" 1 
ATOM   413 C "C2'" . G   A 1 20 ? 6.252   12.975  -6.977  1.00 113.72 ? 1497 G   A "C2'" 1 
ATOM   414 O "O2'" . G   A 1 20 ? 4.875   12.926  -6.651  1.00 116.57 ? 1497 G   A "O2'" 1 
ATOM   415 C "C1'" . G   A 1 20 ? 7.013   11.874  -6.228  1.00 110.33 ? 1497 G   A "C1'" 1 
ATOM   416 N N9    . G   A 1 20 ? 8.388   12.226  -5.855  1.00 104.39 ? 1497 G   A N9    1 
ATOM   417 C C8    . G   A 1 20 ? 9.530   11.561  -6.237  1.00 104.81 ? 1497 G   A C8    1 
ATOM   418 N N7    . G   A 1 20 ? 10.623  12.094  -5.760  1.00 98.72  ? 1497 G   A N7    1 
ATOM   419 C C5    . G   A 1 20 ? 10.185  13.179  -5.016  1.00 91.36  ? 1497 G   A C5    1 
ATOM   420 C C6    . G   A 1 20 ? 10.925  14.131  -4.273  1.00 83.92  ? 1497 G   A C6    1 
ATOM   421 O O6    . G   A 1 20 ? 12.150  14.210  -4.136  1.00 72.52  ? 1497 G   A O6    1 
ATOM   422 N N1    . G   A 1 20 ? 10.094  15.058  -3.655  1.00 79.94  ? 1497 G   A N1    1 
ATOM   423 C C2    . G   A 1 20 ? 8.723   15.071  -3.746  1.00 92.60  ? 1497 G   A C2    1 
ATOM   424 N N2    . G   A 1 20 ? 8.097   16.044  -3.064  1.00 99.07  ? 1497 G   A N2    1 
ATOM   425 N N3    . G   A 1 20 ? 8.016   14.193  -4.450  1.00 96.10  ? 1497 G   A N3    1 
ATOM   426 C C4    . G   A 1 20 ? 8.807   13.279  -5.055  1.00 97.73  ? 1497 G   A C4    1 
ATOM   427 P P     . C   A 1 21 ? 6.092   14.136  -10.477 1.00 114.26 ? 1498 C   A P     1 
ATOM   428 O OP1   . C   A 1 21 ? 4.930   14.409  -11.365 1.00 117.73 ? 1498 C   A OP1   1 
ATOM   429 O OP2   . C   A 1 21 ? 7.345   13.580  -11.056 1.00 99.96  ? 1498 C   A OP2   1 
ATOM   430 O "O5'" . C   A 1 21 ? 6.429   15.465  -9.659  1.00 102.17 ? 1498 C   A "O5'" 1 
ATOM   431 C "C5'" . C   A 1 21 ? 5.486   15.997  -8.703  1.00 92.16  ? 1498 C   A "C5'" 1 
ATOM   432 C "C4'" . C   A 1 21 ? 6.189   16.874  -7.693  1.00 88.70  ? 1498 C   A "C4'" 1 
ATOM   433 O "O4'" . C   A 1 21 ? 7.319   16.156  -7.151  1.00 84.56  ? 1498 C   A "O4'" 1 
ATOM   434 C "C3'" . C   A 1 21 ? 6.869   18.123  -8.223  1.00 88.12  ? 1498 C   A "C3'" 1 
ATOM   435 O "O3'" . C   A 1 21 ? 5.892   19.148  -8.479  1.00 99.53  ? 1498 C   A "O3'" 1 
ATOM   436 C "C2'" . C   A 1 21 ? 7.831   18.473  -7.085  1.00 76.33  ? 1498 C   A "C2'" 1 
ATOM   437 O "O2'" . C   A 1 21 ? 7.212   19.188  -6.040  1.00 77.90  ? 1498 C   A "O2'" 1 
ATOM   438 C "C1'" . C   A 1 21 ? 8.200   17.087  -6.546  1.00 72.17  ? 1498 C   A "C1'" 1 
ATOM   439 N N1    . C   A 1 21 ? 9.599   16.637  -6.722  1.00 60.19  ? 1498 C   A N1    1 
ATOM   440 C C2    . C   A 1 21 ? 10.639  17.340  -6.073  1.00 57.54  ? 1498 C   A C2    1 
ATOM   441 O O2    . C   A 1 21 ? 10.363  18.347  -5.386  1.00 54.31  ? 1498 C   A O2    1 
ATOM   442 N N3    . C   A 1 21 ? 11.912  16.900  -6.212  1.00 48.54  ? 1498 C   A N3    1 
ATOM   443 C C4    . C   A 1 21 ? 12.171  15.818  -6.957  1.00 58.23  ? 1498 C   A C4    1 
ATOM   444 N N4    . C   A 1 21 ? 13.443  15.412  -7.069  1.00 56.13  ? 1498 C   A N4    1 
ATOM   445 C C5    . C   A 1 21 ? 11.140  15.100  -7.625  1.00 46.93  ? 1498 C   A C5    1 
ATOM   446 C C6    . C   A 1 21 ? 9.887   15.541  -7.487  1.00 49.98  ? 1498 C   A C6    1 
ATOM   447 O "O5'" . U   B 2 1  ? 24.894  20.207  -6.857  1.00 121.73 ? 1401 U   B "O5'" 1 
ATOM   448 C "C5'" . U   B 2 1  ? 24.834  18.788  -7.019  1.00 136.32 ? 1401 U   B "C5'" 1 
ATOM   449 C "C4'" . U   B 2 1  ? 23.421  18.249  -6.955  1.00 149.17 ? 1401 U   B "C4'" 1 
ATOM   450 O "O4'" . U   B 2 1  ? 22.598  18.950  -7.929  1.00 158.25 ? 1401 U   B "O4'" 1 
ATOM   451 C "C3'" . U   B 2 1  ? 23.277  16.762  -7.268  1.00 154.55 ? 1401 U   B "C3'" 1 
ATOM   452 O "O3'" . U   B 2 1  ? 22.204  16.192  -6.520  1.00 147.76 ? 1401 U   B "O3'" 1 
ATOM   453 C "C2'" . U   B 2 1  ? 22.969  16.769  -8.764  1.00 160.74 ? 1401 U   B "C2'" 1 
ATOM   454 O "O2'" . U   B 2 1  ? 22.276  15.617  -9.209  1.00 160.35 ? 1401 U   B "O2'" 1 
ATOM   455 C "C1'" . U   B 2 1  ? 22.125  18.038  -8.907  1.00 162.65 ? 1401 U   B "C1'" 1 
ATOM   456 N N1    . U   B 2 1  ? 22.266  18.678  -10.227 1.00 170.83 ? 1401 U   B N1    1 
ATOM   457 C C2    . U   B 2 1  ? 21.154  18.724  -11.059 1.00 171.94 ? 1401 U   B C2    1 
ATOM   458 O O2    . U   B 2 1  ? 20.063  18.280  -10.744 1.00 168.65 ? 1401 U   B O2    1 
ATOM   459 N N3    . U   B 2 1  ? 21.370  19.316  -12.280 1.00 175.95 ? 1401 U   B N3    1 
ATOM   460 C C4    . U   B 2 1  ? 22.552  19.860  -12.747 1.00 175.99 ? 1401 U   B C4    1 
ATOM   461 O O4    . U   B 2 1  ? 22.591  20.337  -13.883 1.00 177.91 ? 1401 U   B O4    1 
ATOM   462 C C5    . U   B 2 1  ? 23.649  19.788  -11.831 1.00 172.95 ? 1401 U   B C5    1 
ATOM   463 C C6    . U   B 2 1  ? 23.476  19.216  -10.635 1.00 172.60 ? 1401 U   B C6    1 
ATOM   464 P P     . U   B 2 2  ? 22.527  15.305  -5.221  0.00 139.29 ? 1402 U   B P     1 
ATOM   465 O OP1   . U   B 2 2  ? 23.519  14.271  -5.614  0.00 139.40 ? 1402 U   B OP1   1 
ATOM   466 O OP2   . U   B 2 2  ? 21.238  14.890  -4.609  0.00 139.40 ? 1402 U   B OP2   1 
ATOM   467 O "O5'" . U   B 2 2  ? 23.242  16.333  -4.237  1.00 134.13 ? 1402 U   B "O5'" 1 
ATOM   468 C "C5'" . U   B 2 2  ? 22.613  17.588  -3.896  1.00 120.45 ? 1402 U   B "C5'" 1 
ATOM   469 C "C4'" . U   B 2 2  ? 23.147  18.102  -2.580  1.00 118.13 ? 1402 U   B "C4'" 1 
ATOM   470 O "O4'" . U   B 2 2  ? 24.567  18.400  -2.725  1.00 108.94 ? 1402 U   B "O4'" 1 
ATOM   471 C "C3'" . U   B 2 2  ? 22.494  19.382  -2.052  1.00 119.64 ? 1402 U   B "C3'" 1 
ATOM   472 O "O3'" . U   B 2 2  ? 22.428  19.359  -0.620  1.00 129.98 ? 1402 U   B "O3'" 1 
ATOM   473 C "C2'" . U   B 2 2  ? 23.488  20.457  -2.485  1.00 107.83 ? 1402 U   B "C2'" 1 
ATOM   474 O "O2'" . U   B 2 2  ? 23.452  21.631  -1.697  1.00 100.79 ? 1402 U   B "O2'" 1 
ATOM   475 C "C1'" . U   B 2 2  ? 24.815  19.725  -2.295  1.00 101.35 ? 1402 U   B "C1'" 1 
ATOM   476 N N1    . U   B 2 2  ? 25.966  20.278  -3.035  1.00 98.95  ? 1402 U   B N1    1 
ATOM   477 C C2    . U   B 2 2  ? 27.091  19.476  -3.205  1.00 92.09  ? 1402 U   B C2    1 
ATOM   478 O O2    . U   B 2 2  ? 27.148  18.314  -2.825  1.00 94.40  ? 1402 U   B O2    1 
ATOM   479 N N3    . U   B 2 2  ? 28.143  20.085  -3.843  1.00 81.42  ? 1402 U   B N3    1 
ATOM   480 C C4    . U   B 2 2  ? 28.191  21.375  -4.330  1.00 82.99  ? 1402 U   B C4    1 
ATOM   481 O O4    . U   B 2 2  ? 29.238  21.799  -4.816  1.00 89.09  ? 1402 U   B O4    1 
ATOM   482 C C5    . U   B 2 2  ? 26.991  22.127  -4.153  1.00 83.00  ? 1402 U   B C5    1 
ATOM   483 C C6    . U   B 2 2  ? 25.948  21.573  -3.530  1.00 97.01  ? 1402 U   B C6    1 
ATOM   484 P P     . G   B 2 3  ? 21.228  18.579  0.127   1.00 129.88 ? 1403 G   B P     1 
ATOM   485 O OP1   . G   B 2 3  ? 21.505  18.663  1.587   1.00 132.27 ? 1403 G   B OP1   1 
ATOM   486 O OP2   . G   B 2 3  ? 21.119  17.243  -0.523  1.00 120.06 ? 1403 G   B OP2   1 
ATOM   487 O "O5'" . G   B 2 3  ? 19.894  19.410  -0.191  1.00 130.26 ? 1403 G   B "O5'" 1 
ATOM   488 C "C5'" . G   B 2 3  ? 19.597  20.658  0.495   1.00 124.41 ? 1403 G   B "C5'" 1 
ATOM   489 C "C4'" . G   B 2 3  ? 18.118  21.027  0.377   1.00 118.50 ? 1403 G   B "C4'" 1 
ATOM   490 O "O4'" . G   B 2 3  ? 17.736  21.197  -1.017  1.00 112.81 ? 1403 G   B "O4'" 1 
ATOM   491 C "C3'" . G   B 2 3  ? 17.088  20.048  0.919   1.00 114.84 ? 1403 G   B "C3'" 1 
ATOM   492 O "O3'" . G   B 2 3  ? 16.941  20.160  2.330   1.00 120.76 ? 1403 G   B "O3'" 1 
ATOM   493 C "C2'" . G   B 2 3  ? 15.817  20.470  0.187   1.00 106.61 ? 1403 G   B "C2'" 1 
ATOM   494 O "O2'" . G   B 2 3  ? 15.179  21.601  0.745   1.00 91.84  ? 1403 G   B "O2'" 1 
ATOM   495 C "C1'" . G   B 2 3  ? 16.371  20.837  -1.189  1.00 99.74  ? 1403 G   B "C1'" 1 
ATOM   496 N N9    . G   B 2 3  ? 16.294  19.737  -2.149  1.00 95.42  ? 1403 G   B N9    1 
ATOM   497 C C8    . G   B 2 3  ? 17.271  18.809  -2.430  1.00 97.71  ? 1403 G   B C8    1 
ATOM   498 N N7    . G   B 2 3  ? 16.916  17.951  -3.348  1.00 96.97  ? 1403 G   B N7    1 
ATOM   499 C C5    . G   B 2 3  ? 15.626  18.330  -3.692  1.00 90.28  ? 1403 G   B C5    1 
ATOM   500 C C6    . G   B 2 3  ? 14.731  17.770  -4.631  1.00 90.28  ? 1403 G   B C6    1 
ATOM   501 O O6    . G   B 2 3  ? 14.912  16.809  -5.385  1.00 96.85  ? 1403 G   B O6    1 
ATOM   502 N N1    . G   B 2 3  ? 13.516  18.448  -4.648  1.00 82.55  ? 1403 G   B N1    1 
ATOM   503 C C2    . G   B 2 3  ? 13.207  19.531  -3.871  1.00 83.77  ? 1403 G   B C2    1 
ATOM   504 N N2    . G   B 2 3  ? 11.980  20.035  -4.029  1.00 85.93  ? 1403 G   B N2    1 
ATOM   505 N N3    . G   B 2 3  ? 14.039  20.078  -3.000  1.00 89.24  ? 1403 G   B N3    1 
ATOM   506 C C4    . G   B 2 3  ? 15.223  19.427  -2.959  1.00 90.97  ? 1403 G   B C4    1 
ATOM   507 P P     . C   B 2 4  ? 16.116  19.040  3.135   1.00 129.12 ? 1404 C   B P     1 
ATOM   508 O OP1   . C   B 2 4  ? 16.130  19.446  4.563   1.00 127.36 ? 1404 C   B OP1   1 
ATOM   509 O OP2   . C   B 2 4  ? 16.647  17.708  2.744   1.00 131.40 ? 1404 C   B OP2   1 
ATOM   510 O "O5'" . C   B 2 4  ? 14.622  19.168  2.588   1.00 113.12 ? 1404 C   B "O5'" 1 
ATOM   511 C "C5'" . C   B 2 4  ? 13.777  20.263  2.992   1.00 109.37 ? 1404 C   B "C5'" 1 
ATOM   512 C "C4'" . C   B 2 4  ? 12.410  20.136  2.360   1.00 111.36 ? 1404 C   B "C4'" 1 
ATOM   513 O "O4'" . C   B 2 4  ? 12.546  20.166  0.914   1.00 107.54 ? 1404 C   B "O4'" 1 
ATOM   514 C "C3'" . C   B 2 4  ? 11.663  18.836  2.625   1.00 113.60 ? 1404 C   B "C3'" 1 
ATOM   515 O "O3'" . C   B 2 4  ? 11.011  18.823  3.894   1.00 118.16 ? 1404 C   B "O3'" 1 
ATOM   516 C "C2'" . C   B 2 4  ? 10.690  18.771  1.450   1.00 105.88 ? 1404 C   B "C2'" 1 
ATOM   517 O "O2'" . C   B 2 4  ? 9.521   19.553  1.596   1.00 102.19 ? 1404 C   B "O2'" 1 
ATOM   518 C "C1'" . C   B 2 4  ? 11.552  19.339  0.323   1.00 100.54 ? 1404 C   B "C1'" 1 
ATOM   519 N N1    . C   B 2 4  ? 12.216  18.277  -0.450  1.00 95.00  ? 1404 C   B N1    1 
ATOM   520 C C2    . C   B 2 4  ? 11.495  17.637  -1.469  1.00 93.60  ? 1404 C   B C2    1 
ATOM   521 O O2    . C   B 2 4  ? 10.317  17.980  -1.683  1.00 92.54  ? 1404 C   B O2    1 
ATOM   522 N N3    . C   B 2 4  ? 12.096  16.662  -2.186  1.00 92.08  ? 1404 C   B N3    1 
ATOM   523 C C4    . C   B 2 4  ? 13.358  16.315  -1.917  1.00 97.34  ? 1404 C   B C4    1 
ATOM   524 N N4    . C   B 2 4  ? 13.915  15.353  -2.656  1.00 104.33 ? 1404 C   B N4    1 
ATOM   525 C C5    . C   B 2 4  ? 14.110  16.943  -0.880  1.00 96.48  ? 1404 C   B C5    1 
ATOM   526 C C6    . C   B 2 4  ? 13.508  17.910  -0.181  1.00 95.61  ? 1404 C   B C6    1 
ATOM   527 P P     . G   B 2 5  ? 10.663  17.416  4.597   1.00 118.23 ? 1405 G   B P     1 
ATOM   528 O OP1   . G   B 2 5  ? 9.945   17.719  5.864   1.00 114.67 ? 1405 G   B OP1   1 
ATOM   529 O OP2   . G   B 2 5  ? 11.898  16.591  4.635   1.00 111.69 ? 1405 G   B OP2   1 
ATOM   530 O "O5'" . G   B 2 5  ? 9.633   16.733  3.590   1.00 111.11 ? 1405 G   B "O5'" 1 
ATOM   531 C "C5'" . G   B 2 5  ? 8.380   17.367  3.292   1.00 102.11 ? 1405 G   B "C5'" 1 
ATOM   532 C "C4'" . G   B 2 5  ? 7.526   16.475  2.429   1.00 95.21  ? 1405 G   B "C4'" 1 
ATOM   533 O "O4'" . G   B 2 5  ? 8.008   16.454  1.058   1.00 90.18  ? 1405 G   B "O4'" 1 
ATOM   534 C "C3'" . G   B 2 5  ? 7.490   15.013  2.822   1.00 90.01  ? 1405 G   B "C3'" 1 
ATOM   535 O "O3'" . G   B 2 5  ? 6.634   14.778  3.930   1.00 92.56  ? 1405 G   B "O3'" 1 
ATOM   536 C "C2'" . G   B 2 5  ? 6.990   14.361  1.539   1.00 86.89  ? 1405 G   B "C2'" 1 
ATOM   537 O "O2'" . G   B 2 5  ? 5.599   14.503  1.356   1.00 94.24  ? 1405 G   B "O2'" 1 
ATOM   538 C "C1'" . G   B 2 5  ? 7.726   15.183  0.481   1.00 82.00  ? 1405 G   B "C1'" 1 
ATOM   539 N N9    . G   B 2 5  ? 8.989   14.549  0.128   1.00 74.83  ? 1405 G   B N9    1 
ATOM   540 C C8    . G   B 2 5  ? 10.238  14.914  0.564   1.00 69.32  ? 1405 G   B C8    1 
ATOM   541 N N7    . G   B 2 5  ? 11.186  14.154  0.095   1.00 60.72  ? 1405 G   B N7    1 
ATOM   542 C C5    . G   B 2 5  ? 10.527  13.233  -0.701  1.00 60.49  ? 1405 G   B C5    1 
ATOM   543 C C6    . G   B 2 5  ? 11.040  12.164  -1.453  1.00 61.23  ? 1405 G   B C6    1 
ATOM   544 O O6    . G   B 2 5  ? 12.216  11.812  -1.572  1.00 64.76  ? 1405 G   B O6    1 
ATOM   545 N N1    . G   B 2 5  ? 10.029  11.463  -2.107  1.00 57.02  ? 1405 G   B N1    1 
ATOM   546 C C2    . G   B 2 5  ? 8.692   11.756  -2.032  1.00 59.19  ? 1405 G   B C2    1 
ATOM   547 N N2    . G   B 2 5  ? 7.883   10.942  -2.710  1.00 59.99  ? 1405 G   B N2    1 
ATOM   548 N N3    . G   B 2 5  ? 8.194   12.769  -1.333  1.00 63.70  ? 1405 G   B N3    1 
ATOM   549 C C4    . G   B 2 5  ? 9.168   13.461  -0.694  1.00 68.88  ? 1405 G   B C4    1 
ATOM   550 P P     . U   B 2 6  ? 6.573   13.312  4.584   1.00 97.01  ? 1406 U   B P     1 
ATOM   551 O OP1   . U   B 2 6  ? 5.458   13.296  5.572   1.00 86.29  ? 1406 U   B OP1   1 
ATOM   552 O OP2   . U   B 2 6  ? 7.949   12.961  5.026   1.00 94.56  ? 1406 U   B OP2   1 
ATOM   553 O "O5'" . U   B 2 6  ? 6.173   12.373  3.355   1.00 80.48  ? 1406 U   B "O5'" 1 
ATOM   554 C "C5'" . U   B 2 6  ? 6.475   10.975  3.377   1.00 74.68  ? 1406 U   B "C5'" 1 
ATOM   555 C "C4'" . U   B 2 6  ? 6.003   10.297  2.111   1.00 81.83  ? 1406 U   B "C4'" 1 
ATOM   556 O "O4'" . U   B 2 6  ? 6.701   10.800  0.940   1.00 76.05  ? 1406 U   B "O4'" 1 
ATOM   557 C "C3'" . U   B 2 6  ? 6.279   8.804   2.146   1.00 93.86  ? 1406 U   B "C3'" 1 
ATOM   558 O "O3'" . U   B 2 6  ? 5.188   8.120   2.751   1.00 105.60 ? 1406 U   B "O3'" 1 
ATOM   559 C "C2'" . U   B 2 6  ? 6.573   8.449   0.691   1.00 85.46  ? 1406 U   B "C2'" 1 
ATOM   560 O "O2'" . U   B 2 6  ? 5.442   8.207   -0.119  1.00 74.93  ? 1406 U   B "O2'" 1 
ATOM   561 C "C1'" . U   B 2 6  ? 7.295   9.718   0.235   1.00 83.26  ? 1406 U   B "C1'" 1 
ATOM   562 N N1    . U   B 2 6  ? 8.737   9.722   0.534   1.00 84.04  ? 1406 U   B N1    1 
ATOM   563 C C2    . U   B 2 6  ? 9.533   8.733   -0.027  1.00 82.79  ? 1406 U   B C2    1 
ATOM   564 O O2    . U   B 2 6  ? 9.085   7.819   -0.702  1.00 85.76  ? 1406 U   B O2    1 
ATOM   565 N N3    . U   B 2 6  ? 10.875  8.853   0.242   1.00 80.76  ? 1406 U   B N3    1 
ATOM   566 C C4    . U   B 2 6  ? 11.486  9.830   1.009   1.00 91.96  ? 1406 U   B C4    1 
ATOM   567 O O4    . U   B 2 6  ? 12.717  9.867   1.081   1.00 106.22 ? 1406 U   B O4    1 
ATOM   568 C C5    . U   B 2 6  ? 10.591  10.784  1.584   1.00 86.78  ? 1406 U   B C5    1 
ATOM   569 C C6    . U   B 2 6  ? 9.286   10.701  1.335   1.00 82.68  ? 1406 U   B C6    1 
ATOM   570 P P     . C   B 2 7  ? 5.384   7.397   4.178   1.00 104.14 ? 1407 C   B P     1 
ATOM   571 O OP1   . C   B 2 7  ? 4.081   7.500   4.886   1.00 109.42 ? 1407 C   B OP1   1 
ATOM   572 O OP2   . C   B 2 7  ? 6.623   7.904   4.839   1.00 91.27  ? 1407 C   B OP2   1 
ATOM   573 O "O5'" . C   B 2 7  ? 5.607   5.873   3.779   1.00 103.54 ? 1407 C   B "O5'" 1 
ATOM   574 C "C5'" . C   B 2 7  ? 4.793   5.259   2.757   1.00 100.31 ? 1407 C   B "C5'" 1 
ATOM   575 C "C4'" . C   B 2 7  ? 5.625   4.317   1.920   1.00 92.65  ? 1407 C   B "C4'" 1 
ATOM   576 O "O4'" . C   B 2 7  ? 6.563   5.054   1.089   1.00 92.99  ? 1407 C   B "O4'" 1 
ATOM   577 C "C3'" . C   B 2 7  ? 6.510   3.387   2.720   1.00 88.06  ? 1407 C   B "C3'" 1 
ATOM   578 O "O3'" . C   B 2 7  ? 5.776   2.303   3.266   1.00 97.85  ? 1407 C   B "O3'" 1 
ATOM   579 C "C2'" . C   B 2 7  ? 7.563   2.985   1.696   1.00 86.58  ? 1407 C   B "C2'" 1 
ATOM   580 O "O2'" . C   B 2 7  ? 7.131   2.007   0.770   1.00 81.76  ? 1407 C   B "O2'" 1 
ATOM   581 C "C1'" . C   B 2 7  ? 7.770   4.308   0.959   1.00 83.22  ? 1407 C   B "C1'" 1 
ATOM   582 N N1    . C   B 2 7  ? 8.887   5.099   1.514   1.00 71.63  ? 1407 C   B N1    1 
ATOM   583 C C2    . C   B 2 7  ? 10.210  4.717   1.210   1.00 66.95  ? 1407 C   B C2    1 
ATOM   584 O O2    . C   B 2 7  ? 10.404  3.726   0.477   1.00 65.60  ? 1407 C   B O2    1 
ATOM   585 N N3    . C   B 2 7  ? 11.237  5.437   1.721   1.00 63.07  ? 1407 C   B N3    1 
ATOM   586 C C4    . C   B 2 7  ? 10.986  6.499   2.499   1.00 74.11  ? 1407 C   B C4    1 
ATOM   587 N N4    . C   B 2 7  ? 12.026  7.186   2.981   1.00 64.29  ? 1407 C   B N4    1 
ATOM   588 C C5    . C   B 2 7  ? 9.656   6.906   2.817   1.00 69.37  ? 1407 C   B C5    1 
ATOM   589 C C6    . C   B 2 7  ? 8.650   6.186   2.311   1.00 67.87  ? 1407 C   B C6    1 
ATOM   590 P P     . A   B 2 8  ? 6.279   1.624   4.630   1.00 106.26 ? 1408 A   B P     1 
ATOM   591 O OP1   . A   B 2 8  ? 5.277   0.598   5.034   1.00 106.44 ? 1408 A   B OP1   1 
ATOM   592 O OP2   . A   B 2 8  ? 6.636   2.720   5.572   1.00 99.36  ? 1408 A   B OP2   1 
ATOM   593 O "O5'" . A   B 2 8  ? 7.615   0.873   4.188   1.00 109.24 ? 1408 A   B "O5'" 1 
ATOM   594 C "C5'" . A   B 2 8  ? 7.596   -0.093  3.111   1.00 98.31  ? 1408 A   B "C5'" 1 
ATOM   595 C "C4'" . A   B 2 8  ? 9.000   -0.521  2.753   1.00 92.45  ? 1408 A   B "C4'" 1 
ATOM   596 O "O4'" . A   B 2 8  ? 9.726   0.569   2.129   1.00 90.01  ? 1408 A   B "O4'" 1 
ATOM   597 C "C3'" . A   B 2 8  ? 9.886   -0.907  3.920   1.00 95.79  ? 1408 A   B "C3'" 1 
ATOM   598 O "O3'" . A   B 2 8  ? 9.590   -2.207  4.399   1.00 104.73 ? 1408 A   B "O3'" 1 
ATOM   599 C "C2'" . A   B 2 8  ? 11.281  -0.779  3.321   1.00 90.63  ? 1408 A   B "C2'" 1 
ATOM   600 O "O2'" . A   B 2 8  ? 11.638  -1.863  2.487   1.00 90.01  ? 1408 A   B "O2'" 1 
ATOM   601 C "C1'" . A   B 2 8  ? 11.108  0.463   2.449   1.00 83.51  ? 1408 A   B "C1'" 1 
ATOM   602 N N9    . A   B 2 8  ? 11.534  1.699   3.105   1.00 80.02  ? 1408 A   B N9    1 
ATOM   603 C C8    . A   B 2 8  ? 10.756  2.673   3.680   1.00 77.10  ? 1408 A   B C8    1 
ATOM   604 N N7    . A   B 2 8  ? 11.439  3.695   4.134   1.00 79.84  ? 1408 A   B N7    1 
ATOM   605 C C5    . A   B 2 8  ? 12.758  3.366   3.852   1.00 74.53  ? 1408 A   B C5    1 
ATOM   606 C C6    . A   B 2 8  ? 13.968  4.042   4.072   1.00 70.95  ? 1408 A   B C6    1 
ATOM   607 N N6    . A   B 2 8  ? 14.051  5.248   4.640   1.00 65.74  ? 1408 A   B N6    1 
ATOM   608 N N1    . A   B 2 8  ? 15.107  3.432   3.679   1.00 63.44  ? 1408 A   B N1    1 
ATOM   609 C C2    . A   B 2 8  ? 15.026  2.234   3.105   1.00 58.13  ? 1408 A   B C2    1 
ATOM   610 N N3    . A   B 2 8  ? 13.950  1.501   2.840   1.00 80.63  ? 1408 A   B N3    1 
ATOM   611 C C4    . A   B 2 8  ? 12.833  2.132   3.239   1.00 79.32  ? 1408 A   B C4    1 
ATOM   612 P P     . C   B 2 9  ? 9.668   -2.503  5.976   1.00 107.31 ? 1409 C   B P     1 
ATOM   613 O OP1   . C   B 2 9  ? 9.174   -3.894  6.169   1.00 110.20 ? 1409 C   B OP1   1 
ATOM   614 O OP2   . C   B 2 9  ? 9.014   -1.382  6.705   1.00 110.19 ? 1409 C   B OP2   1 
ATOM   615 O "O5'" . C   B 2 9  ? 11.231  -2.455  6.290   1.00 99.26  ? 1409 C   B "O5'" 1 
ATOM   616 C "C5'" . C   B 2 9  ? 12.140  -3.354  5.624   1.00 83.92  ? 1409 C   B "C5'" 1 
ATOM   617 C "C4'" . C   B 2 9  ? 13.563  -2.864  5.751   1.00 74.07  ? 1409 C   B "C4'" 1 
ATOM   618 O "O4'" . C   B 2 9  ? 13.694  -1.567  5.117   1.00 69.03  ? 1409 C   B "O4'" 1 
ATOM   619 C "C3'" . C   B 2 9  ? 14.076  -2.628  7.162   1.00 72.90  ? 1409 C   B "C3'" 1 
ATOM   620 O "O3'" . C   B 2 9  ? 14.497  -3.843  7.768   1.00 76.55  ? 1409 C   B "O3'" 1 
ATOM   621 C "C2'" . C   B 2 9  ? 15.247  -1.682  6.925   1.00 71.05  ? 1409 C   B "C2'" 1 
ATOM   622 O "O2'" . C   B 2 9  ? 16.441  -2.337  6.549   1.00 78.01  ? 1409 C   B "O2'" 1 
ATOM   623 C "C1'" . C   B 2 9  ? 14.726  -0.834  5.759   1.00 63.71  ? 1409 C   B "C1'" 1 
ATOM   624 N N1    . C   B 2 9  ? 14.192  0.463   6.197   1.00 57.91  ? 1409 C   B N1    1 
ATOM   625 C C2    . C   B 2 9  ? 15.085  1.425   6.674   1.00 59.42  ? 1409 C   B C2    1 
ATOM   626 O O2    . C   B 2 9  ? 16.299  1.167   6.685   1.00 60.82  ? 1409 C   B O2    1 
ATOM   627 N N3    . C   B 2 9  ? 14.609  2.605   7.109   1.00 56.04  ? 1409 C   B N3    1 
ATOM   628 C C4    . C   B 2 9  ? 13.302  2.848   7.074   1.00 54.60  ? 1409 C   B C4    1 
ATOM   629 N N4    . C   B 2 9  ? 12.877  4.029   7.514   1.00 55.91  ? 1409 C   B N4    1 
ATOM   630 C C5    . C   B 2 9  ? 12.371  1.892   6.583   1.00 58.20  ? 1409 C   B C5    1 
ATOM   631 C C6    . C   B 2 9  ? 12.854  0.726   6.156   1.00 54.63  ? 1409 C   B C6    1 
ATOM   632 P P     . A   B 2 10 ? 14.483  -3.985  9.366   1.00 82.01  ? 1410 A   B P     1 
ATOM   633 O OP1   . A   B 2 10 ? 14.824  -5.399  9.658   1.00 80.74  ? 1410 A   B OP1   1 
ATOM   634 O OP2   . A   B 2 10 ? 13.210  -3.423  9.872   1.00 87.46  ? 1410 A   B OP2   1 
ATOM   635 O "O5'" . A   B 2 10 ? 15.686  -3.054  9.848   1.00 85.41  ? 1410 A   B "O5'" 1 
ATOM   636 C "C5'" . A   B 2 10 ? 17.045  -3.383  9.498   1.00 86.62  ? 1410 A   B "C5'" 1 
ATOM   637 C "C4'" . A   B 2 10 ? 17.998  -2.281  9.914   1.00 86.53  ? 1410 A   B "C4'" 1 
ATOM   638 O "O4'" . A   B 2 10 ? 17.707  -1.064  9.185   1.00 84.30  ? 1410 A   B "O4'" 1 
ATOM   639 C "C3'" . A   B 2 10 ? 17.977  -1.845  11.370  1.00 82.41  ? 1410 A   B "C3'" 1 
ATOM   640 O "O3'" . A   B 2 10 ? 18.733  -2.733  12.188  1.00 84.86  ? 1410 A   B "O3'" 1 
ATOM   641 C "C2'" . A   B 2 10 ? 18.628  -0.465  11.306  1.00 77.47  ? 1410 A   B "C2'" 1 
ATOM   642 O "O2'" . A   B 2 10 ? 20.035  -0.503  11.294  1.00 68.23  ? 1410 A   B "O2'" 1 
ATOM   643 C "C1'" . A   B 2 10 ? 18.129  0.050   9.954   1.00 81.10  ? 1410 A   B "C1'" 1 
ATOM   644 N N9    . A   B 2 10 ? 17.023  0.998   10.061  1.00 90.34  ? 1410 A   B N9    1 
ATOM   645 C C8    . A   B 2 10 ? 15.674  0.805   9.849   1.00 91.08  ? 1410 A   B C8    1 
ATOM   646 N N7    . A   B 2 10 ? 14.955  1.890   10.013  1.00 90.39  ? 1410 A   B N7    1 
ATOM   647 C C5    . A   B 2 10 ? 15.890  2.859   10.358  1.00 86.44  ? 1410 A   B C5    1 
ATOM   648 C C6    . A   B 2 10 ? 15.771  4.224   10.652  1.00 79.55  ? 1410 A   B C6    1 
ATOM   649 N N6    . A   B 2 10 ? 14.619  4.887   10.623  1.00 81.13  ? 1410 A   B N6    1 
ATOM   650 N N1    . A   B 2 10 ? 16.895  4.897   10.973  1.00 77.31  ? 1410 A   B N1    1 
ATOM   651 C C2    . A   B 2 10 ? 18.062  4.235   10.982  1.00 80.09  ? 1410 A   B C2    1 
ATOM   652 N N3    . A   B 2 10 ? 18.306  2.958   10.710  1.00 75.43  ? 1410 A   B N3    1 
ATOM   653 C C4    . A   B 2 10 ? 17.164  2.319   10.402  1.00 85.96  ? 1410 A   B C4    1 
ATOM   654 P P     . C   B 2 11 ? 18.446  -2.803  13.765  1.00 89.81  ? 1411 C   B P     1 
ATOM   655 O OP1   . C   B 2 11 ? 19.266  -3.918  14.297  1.00 98.19  ? 1411 C   B OP1   1 
ATOM   656 O OP2   . C   B 2 11 ? 16.972  -2.838  13.933  1.00 90.07  ? 1411 C   B OP2   1 
ATOM   657 O "O5'" . C   B 2 11 ? 19.000  -1.417  14.343  1.00 75.24  ? 1411 C   B "O5'" 1 
ATOM   658 C "C5'" . C   B 2 11 ? 20.408  -1.217  14.587  1.00 71.19  ? 1411 C   B "C5'" 1 
ATOM   659 C "C4'" . C   B 2 11 ? 20.667  0.167   15.156  1.00 82.45  ? 1411 C   B "C4'" 1 
ATOM   660 O "O4'" . C   B 2 11 ? 20.254  1.185   14.201  1.00 83.62  ? 1411 C   B "O4'" 1 
ATOM   661 C "C3'" . C   B 2 11 ? 19.925  0.538   16.433  1.00 86.56  ? 1411 C   B "C3'" 1 
ATOM   662 O "O3'" . C   B 2 11 ? 20.547  0.030   17.611  1.00 97.34  ? 1411 C   B "O3'" 1 
ATOM   663 C "C2'" . C   B 2 11 ? 19.955  2.063   16.398  1.00 87.31  ? 1411 C   B "C2'" 1 
ATOM   664 O "O2'" . C   B 2 11 ? 21.163  2.628   16.878  1.00 63.06  ? 1411 C   B "O2'" 1 
ATOM   665 C "C1'" . C   B 2 11 ? 19.778  2.334   14.901  1.00 87.03  ? 1411 C   B "C1'" 1 
ATOM   666 N N1    . C   B 2 11 ? 18.363  2.567   14.532  1.00 87.09  ? 1411 C   B N1    1 
ATOM   667 C C2    . C   B 2 11 ? 17.813  3.866   14.658  1.00 80.03  ? 1411 C   B C2    1 
ATOM   668 O O2    . C   B 2 11 ? 18.517  4.789   15.097  1.00 73.43  ? 1411 C   B O2    1 
ATOM   669 N N3    . C   B 2 11 ? 16.523  4.070   14.301  1.00 85.14  ? 1411 C   B N3    1 
ATOM   670 C C4    . C   B 2 11 ? 15.784  3.050   13.846  1.00 92.00  ? 1411 C   B C4    1 
ATOM   671 N N4    . C   B 2 11 ? 14.514  3.293   13.495  1.00 85.50  ? 1411 C   B N4    1 
ATOM   672 C C5    . C   B 2 11 ? 16.310  1.732   13.724  1.00 94.16  ? 1411 C   B C5    1 
ATOM   673 C C6    . C   B 2 11 ? 17.589  1.537   14.072  1.00 89.25  ? 1411 C   B C6    1 
ATOM   674 P P     . C   B 2 12 ? 19.746  0.047   19.010  1.00 100.96 ? 1412 C   B P     1 
ATOM   675 O OP1   . C   B 2 12 ? 20.659  -0.448  20.068  1.00 104.50 ? 1412 C   B OP1   1 
ATOM   676 O OP2   . C   B 2 12 ? 18.440  -0.627  18.802  1.00 102.08 ? 1412 C   B OP2   1 
ATOM   677 O "O5'" . C   B 2 12 ? 19.474  1.594   19.298  1.00 100.51 ? 1412 C   B "O5'" 1 
ATOM   678 C "C5'" . C   B 2 12 ? 20.454  2.415   19.967  1.00 86.05  ? 1412 C   B "C5'" 1 
ATOM   679 C "C4'" . C   B 2 12 ? 19.849  3.746   20.368  1.00 89.81  ? 1412 C   B "C4'" 1 
ATOM   680 O "O4'" . C   B 2 12 ? 19.376  4.442   19.177  1.00 98.12  ? 1412 C   B "O4'" 1 
ATOM   681 C "C3'" . C   B 2 12 ? 18.614  3.711   21.258  1.00 87.86  ? 1412 C   B "C3'" 1 
ATOM   682 O "O3'" . C   B 2 12 ? 18.886  3.467   22.637  1.00 85.00  ? 1412 C   B "O3'" 1 
ATOM   683 C "C2'" . C   B 2 12 ? 18.008  5.090   21.005  1.00 88.12  ? 1412 C   B "C2'" 1 
ATOM   684 O "O2'" . C   B 2 12 ? 18.668  6.149   21.673  1.00 74.76  ? 1412 C   B "O2'" 1 
ATOM   685 C "C1'" . C   B 2 12 ? 18.231  5.236   19.499  1.00 85.45  ? 1412 C   B "C1'" 1 
ATOM   686 N N1    . C   B 2 12 ? 17.066  4.753   18.717  1.00 67.51  ? 1412 C   B N1    1 
ATOM   687 C C2    . C   B 2 12 ? 15.983  5.626   18.483  1.00 62.01  ? 1412 C   B C2    1 
ATOM   688 O O2    . C   B 2 12 ? 16.046  6.799   18.895  1.00 62.68  ? 1412 C   B O2    1 
ATOM   689 N N3    . C   B 2 12 ? 14.899  5.164   17.811  1.00 57.36  ? 1412 C   B N3    1 
ATOM   690 C C4    . C   B 2 12 ? 14.876  3.900   17.368  1.00 62.57  ? 1412 C   B C4    1 
ATOM   691 N N4    . C   B 2 12 ? 13.787  3.470   16.719  1.00 51.11  ? 1412 C   B N4    1 
ATOM   692 C C5    . C   B 2 12 ? 15.968  3.010   17.572  1.00 63.29  ? 1412 C   B C5    1 
ATOM   693 C C6    . C   B 2 12 ? 17.028  3.472   18.243  1.00 59.84  ? 1412 C   B C6    1 
ATOM   694 P P     . G   B 2 13 ? 17.786  2.705   23.535  1.00 91.44  ? 1488 G   B P     1 
ATOM   695 O OP1   . G   B 2 13 ? 18.340  2.561   24.904  1.00 99.89  ? 1488 G   B OP1   1 
ATOM   696 O OP2   . G   B 2 13 ? 17.351  1.492   22.795  1.00 87.92  ? 1488 G   B OP2   1 
ATOM   697 O "O5'" . G   B 2 13 ? 16.554  3.724   23.612  1.00 96.62  ? 1488 G   B "O5'" 1 
ATOM   698 C "C5'" . G   B 2 13 ? 16.657  4.956   24.370  1.00 88.86  ? 1488 G   B "C5'" 1 
ATOM   699 C "C4'" . G   B 2 13 ? 15.397  5.802   24.244  1.00 83.79  ? 1488 G   B "C4'" 1 
ATOM   700 O "O4'" . G   B 2 13 ? 15.160  6.170   22.858  1.00 84.83  ? 1488 G   B "O4'" 1 
ATOM   701 C "C3'" . G   B 2 13 ? 14.063  5.205   24.664  1.00 87.16  ? 1488 G   B "C3'" 1 
ATOM   702 O "O3'" . G   B 2 13 ? 13.876  5.175   26.075  1.00 94.90  ? 1488 G   B "O3'" 1 
ATOM   703 C "C2'" . G   B 2 13 ? 13.084  6.170   24.005  1.00 79.15  ? 1488 G   B "C2'" 1 
ATOM   704 O "O2'" . G   B 2 13 ? 12.968  7.394   24.704  1.00 83.97  ? 1488 G   B "O2'" 1 
ATOM   705 C "C1'" . G   B 2 13 ? 13.771  6.421   22.663  1.00 75.95  ? 1488 G   B "C1'" 1 
ATOM   706 N N9    . G   B 2 13 ? 13.250  5.518   21.638  1.00 68.70  ? 1488 G   B N9    1 
ATOM   707 C C8    . G   B 2 13 ? 13.800  4.339   21.197  1.00 63.49  ? 1488 G   B C8    1 
ATOM   708 N N7    . G   B 2 13 ? 13.058  3.728   20.312  1.00 62.30  ? 1488 G   B N7    1 
ATOM   709 C C5    . G   B 2 13 ? 11.958  4.558   20.152  1.00 59.04  ? 1488 G   B C5    1 
ATOM   710 C C6    . G   B 2 13 ? 10.801  4.412   19.336  1.00 65.53  ? 1488 G   B C6    1 
ATOM   711 O O6    . G   B 2 13 ? 10.500  3.481   18.578  1.00 56.75  ? 1488 G   B O6    1 
ATOM   712 N N1    . G   B 2 13 ? 9.943   5.494   19.473  1.00 64.67  ? 1488 G   B N1    1 
ATOM   713 C C2    . G   B 2 13 ? 10.163  6.573   20.287  1.00 65.41  ? 1488 G   B C2    1 
ATOM   714 N N2    . G   B 2 13 ? 9.234   7.531   20.255  1.00 84.72  ? 1488 G   B N2    1 
ATOM   715 N N3    . G   B 2 13 ? 11.219  6.710   21.067  1.00 60.93  ? 1488 G   B N3    1 
ATOM   716 C C4    . G   B 2 13 ? 12.071  5.675   20.949  1.00 60.92  ? 1488 G   B C4    1 
ATOM   717 P P     . G   B 2 14 ? 12.776  4.181   26.710  1.00 98.24  ? 1489 G   B P     1 
ATOM   718 O OP1   . G   B 2 14 ? 12.732  4.460   28.166  1.00 103.74 ? 1489 G   B OP1   1 
ATOM   719 O OP2   . G   B 2 14 ? 13.042  2.795   26.234  1.00 98.24  ? 1489 G   B OP2   1 
ATOM   720 O "O5'" . G   B 2 14 ? 11.394  4.663   26.077  1.00 82.33  ? 1489 G   B "O5'" 1 
ATOM   721 C "C5'" . G   B 2 14 ? 10.881  5.970   26.358  1.00 67.51  ? 1489 G   B "C5'" 1 
ATOM   722 C "C4'" . G   B 2 14 ? 9.616   6.222   25.576  1.00 63.74  ? 1489 G   B "C4'" 1 
ATOM   723 O "O4'" . G   B 2 14 ? 9.875   6.181   24.149  1.00 64.10  ? 1489 G   B "O4'" 1 
ATOM   724 C "C3'" . G   B 2 14 ? 8.517   5.199   25.746  1.00 61.17  ? 1489 G   B "C3'" 1 
ATOM   725 O "O3'" . G   B 2 14 ? 7.813   5.393   26.950  1.00 64.50  ? 1489 G   B "O3'" 1 
ATOM   726 C "C2'" . G   B 2 14 ? 7.650   5.485   24.535  1.00 57.32  ? 1489 G   B "C2'" 1 
ATOM   727 O "O2'" . G   B 2 14 ? 6.905   6.667   24.703  1.00 69.88  ? 1489 G   B "O2'" 1 
ATOM   728 C "C1'" . G   B 2 14 ? 8.715   5.723   23.469  1.00 56.32  ? 1489 G   B "C1'" 1 
ATOM   729 N N9    . G   B 2 14 ? 9.033   4.477   22.773  1.00 60.98  ? 1489 G   B N9    1 
ATOM   730 C C8    . G   B 2 14 ? 10.134  3.671   22.949  1.00 54.30  ? 1489 G   B C8    1 
ATOM   731 N N7    . G   B 2 14 ? 10.112  2.602   22.198  1.00 47.26  ? 1489 G   B N7    1 
ATOM   732 C C5    . G   B 2 14 ? 8.933   2.713   21.475  1.00 45.22  ? 1489 G   B C5    1 
ATOM   733 C C6    . G   B 2 14 ? 8.374   1.857   20.498  1.00 45.15  ? 1489 G   B C6    1 
ATOM   734 O O6    . G   B 2 14 ? 8.836   0.813   20.036  1.00 46.61  ? 1489 G   B O6    1 
ATOM   735 N N1    . G   B 2 14 ? 7.156   2.331   20.040  1.00 44.51  ? 1489 G   B N1    1 
ATOM   736 C C2    . G   B 2 14 ? 6.560   3.494   20.448  1.00 55.80  ? 1489 G   B C2    1 
ATOM   737 N N2    . G   B 2 14 ? 5.386   3.778   19.882  1.00 53.73  ? 1489 G   B N2    1 
ATOM   738 N N3    . G   B 2 14 ? 7.076   4.316   21.344  1.00 50.58  ? 1489 G   B N3    1 
ATOM   739 C C4    . G   B 2 14 ? 8.256   3.864   21.815  1.00 55.62  ? 1489 G   B C4    1 
ATOM   740 P P     . U   B 2 15 ? 6.750   4.294   27.419  1.00 66.45  ? 1490 U   B P     1 
ATOM   741 O OP1   . U   B 2 15 ? 6.182   4.748   28.724  1.00 50.99  ? 1490 U   B OP1   1 
ATOM   742 O OP2   . U   B 2 15 ? 7.385   2.949   27.315  1.00 47.71  ? 1490 U   B OP2   1 
ATOM   743 O "O5'" . U   B 2 15 ? 5.604   4.418   26.324  1.00 50.91  ? 1490 U   B "O5'" 1 
ATOM   744 C "C5'" . U   B 2 15 ? 4.668   5.497   26.387  1.00 48.79  ? 1490 U   B "C5'" 1 
ATOM   745 C "C4'" . U   B 2 15 ? 3.467   5.191   25.541  1.00 47.03  ? 1490 U   B "C4'" 1 
ATOM   746 O "O4'" . U   B 2 15 ? 3.901   5.006   24.174  1.00 43.04  ? 1490 U   B "O4'" 1 
ATOM   747 C "C3'" . U   B 2 15 ? 2.733   3.901   25.849  1.00 44.58  ? 1490 U   B "C3'" 1 
ATOM   748 O "O3'" . U   B 2 15 ? 1.846   4.021   26.942  1.00 52.73  ? 1490 U   B "O3'" 1 
ATOM   749 C "C2'" . U   B 2 15 ? 2.000   3.657   24.542  1.00 49.26  ? 1490 U   B "C2'" 1 
ATOM   750 O "O2'" . U   B 2 15 ? 0.887   4.520   24.357  1.00 52.65  ? 1490 U   B "O2'" 1 
ATOM   751 C "C1'" . U   B 2 15 ? 3.088   4.032   23.543  1.00 42.67  ? 1490 U   B "C1'" 1 
ATOM   752 N N1    . U   B 2 15 ? 3.941   2.895   23.152  1.00 36.07  ? 1490 U   B N1    1 
ATOM   753 C C2    . U   B 2 15 ? 3.471   2.034   22.164  1.00 52.54  ? 1490 U   B C2    1 
ATOM   754 O O2    . U   B 2 15 ? 2.371   2.168   21.620  1.00 49.35  ? 1490 U   B O2    1 
ATOM   755 N N3    . U   B 2 15 ? 4.328   1.008   21.832  1.00 51.87  ? 1490 U   B N3    1 
ATOM   756 C C4    . U   B 2 15 ? 5.565   0.749   22.370  1.00 47.58  ? 1490 U   B C4    1 
ATOM   757 O O4    . U   B 2 15 ? 6.177   -0.266  22.025  1.00 53.15  ? 1490 U   B O4    1 
ATOM   758 C C5    . U   B 2 15 ? 5.973   1.673   23.376  1.00 52.19  ? 1490 U   B C5    1 
ATOM   759 C C6    . U   B 2 15 ? 5.167   2.687   23.726  1.00 38.23  ? 1490 U   B C6    1 
ATOM   760 P P     . G   B 2 16 ? 1.365   2.700   27.708  1.00 58.75  ? 1491 G   B P     1 
ATOM   761 O OP1   . G   B 2 16 ? 0.382   3.110   28.737  1.00 64.17  ? 1491 G   B OP1   1 
ATOM   762 O OP2   . G   B 2 16 ? 2.559   1.909   28.090  1.00 54.41  ? 1491 G   B OP2   1 
ATOM   763 O "O5'" . G   B 2 16 ? 0.596   1.876   26.597  1.00 40.20  ? 1491 G   B "O5'" 1 
ATOM   764 C "C5'" . G   B 2 16 ? -0.604  2.376   26.021  1.00 33.23  ? 1491 G   B "C5'" 1 
ATOM   765 C "C4'" . G   B 2 16 ? -1.114  1.397   25.002  1.00 41.20  ? 1491 G   B "C4'" 1 
ATOM   766 O "O4'" . G   B 2 16 ? -0.086  1.185   24.005  1.00 33.07  ? 1491 G   B "O4'" 1 
ATOM   767 C "C3'" . G   B 2 16 ? -1.354  -0.014  25.504  1.00 49.76  ? 1491 G   B "C3'" 1 
ATOM   768 O "O3'" . G   B 2 16 ? -2.565  -0.128  26.250  1.00 54.28  ? 1491 G   B "O3'" 1 
ATOM   769 C "C2'" . G   B 2 16 ? -1.362  -0.792  24.196  1.00 41.80  ? 1491 G   B "C2'" 1 
ATOM   770 O "O2'" . G   B 2 16 ? -2.548  -0.545  23.447  1.00 41.34  ? 1491 G   B "O2'" 1 
ATOM   771 C "C1'" . G   B 2 16 ? -0.207  -0.118  23.462  1.00 38.81  ? 1491 G   B "C1'" 1 
ATOM   772 N N9    . G   B 2 16 ? 1.091   -0.792  23.547  1.00 39.90  ? 1491 G   B N9    1 
ATOM   773 C C8    . G   B 2 16 ? 2.102   -0.527  24.428  1.00 42.66  ? 1491 G   B C8    1 
ATOM   774 N N7    . G   B 2 16 ? 3.165   -1.261  24.224  1.00 46.14  ? 1491 G   B N7    1 
ATOM   775 C C5    . G   B 2 16 ? 2.834   -2.064  23.145  1.00 32.75  ? 1491 G   B C5    1 
ATOM   776 C C6    . G   B 2 16 ? 3.602   -3.041  22.450  1.00 43.93  ? 1491 G   B C6    1 
ATOM   777 O O6    . G   B 2 16 ? 4.785   -3.382  22.628  1.00 44.14  ? 1491 G   B O6    1 
ATOM   778 N N1    . G   B 2 16 ? 2.871   -3.629  21.436  1.00 39.65  ? 1491 G   B N1    1 
ATOM   779 C C2    . G   B 2 16 ? 1.589   -3.316  21.110  1.00 37.84  ? 1491 G   B C2    1 
ATOM   780 N N2    . G   B 2 16 ? 1.057   -4.016  20.102  1.00 50.51  ? 1491 G   B N2    1 
ATOM   781 N N3    . G   B 2 16 ? 0.874   -2.391  21.721  1.00 54.23  ? 1491 G   B N3    1 
ATOM   782 C C4    . G   B 2 16 ? 1.554   -1.808  22.726  1.00 40.69  ? 1491 G   B C4    1 
ATOM   783 P P     . A   B 2 17 ? -2.650  -1.177  27.470  1.00 50.26  ? 1492 A   B P     1 
ATOM   784 O OP1   . A   B 2 17 ? -3.771  -0.741  28.339  1.00 73.10  ? 1492 A   B OP1   1 
ATOM   785 O OP2   . A   B 2 17 ? -1.317  -1.414  28.067  1.00 55.77  ? 1492 A   B OP2   1 
ATOM   786 O "O5'" . A   B 2 17 ? -3.077  -2.527  26.763  1.00 57.31  ? 1492 A   B "O5'" 1 
ATOM   787 C "C5'" . A   B 2 17 ? -4.421  -2.710  26.332  1.00 65.33  ? 1492 A   B "C5'" 1 
ATOM   788 C "C4'" . A   B 2 17 ? -5.041  -3.852  27.087  1.00 67.88  ? 1492 A   B "C4'" 1 
ATOM   789 O "O4'" . A   B 2 17 ? -6.476  -3.772  26.997  1.00 72.27  ? 1492 A   B "O4'" 1 
ATOM   790 C "C3'" . A   B 2 17 ? -4.665  -5.233  26.596  1.00 63.18  ? 1492 A   B "C3'" 1 
ATOM   791 O "O3'" . A   B 2 17 ? -3.461  -5.641  27.236  1.00 57.32  ? 1492 A   B "O3'" 1 
ATOM   792 C "C2'" . A   B 2 17 ? -5.872  -6.055  27.017  1.00 59.74  ? 1492 A   B "C2'" 1 
ATOM   793 O "O2'" . A   B 2 17 ? -5.835  -6.331  28.401  1.00 77.34  ? 1492 A   B "O2'" 1 
ATOM   794 C "C1'" . A   B 2 17 ? -7.008  -5.055  26.804  1.00 52.78  ? 1492 A   B "C1'" 1 
ATOM   795 N N9    . A   B 2 17 ? -7.662  -5.044  25.501  1.00 48.58  ? 1492 A   B N9    1 
ATOM   796 C C8    . A   B 2 17 ? -7.186  -4.557  24.308  1.00 49.62  ? 1492 A   B C8    1 
ATOM   797 N N7    . A   B 2 17 ? -8.045  -4.651  23.321  1.00 48.10  ? 1492 A   B N7    1 
ATOM   798 C C5    . A   B 2 17 ? -9.156  -5.249  23.905  1.00 46.71  ? 1492 A   B C5    1 
ATOM   799 C C6    . A   B 2 17 ? -10.408 -5.625  23.392  1.00 47.92  ? 1492 A   B C6    1 
ATOM   800 N N6    . A   B 2 17 ? -10.779 -5.439  22.120  1.00 70.12  ? 1492 A   B N6    1 
ATOM   801 N N1    . A   B 2 17 ? -11.283 -6.203  24.239  1.00 52.23  ? 1492 A   B N1    1 
ATOM   802 C C2    . A   B 2 17 ? -10.922 -6.378  25.516  1.00 58.55  ? 1492 A   B C2    1 
ATOM   803 N N3    . A   B 2 17 ? -9.781  -6.062  26.117  1.00 52.19  ? 1492 A   B N3    1 
ATOM   804 C C4    . A   B 2 17 ? -8.930  -5.498  25.244  1.00 46.38  ? 1492 A   B C4    1 
ATOM   805 P P     . A   B 2 18 ? -2.543  -6.763  26.564  1.00 67.85  ? 1493 A   B P     1 
ATOM   806 O OP1   . A   B 2 18 ? -1.305  -6.845  27.371  1.00 58.92  ? 1493 A   B OP1   1 
ATOM   807 O OP2   . A   B 2 18 ? -2.456  -6.538  25.098  1.00 63.22  ? 1493 A   B OP2   1 
ATOM   808 O "O5'" . A   B 2 18 ? -3.383  -8.095  26.778  1.00 56.37  ? 1493 A   B "O5'" 1 
ATOM   809 C "C5'" . A   B 2 18 ? -3.383  -8.773  28.044  1.00 67.50  ? 1493 A   B "C5'" 1 
ATOM   810 C "C4'" . A   B 2 18 ? -4.242  -10.003 27.954  1.00 60.01  ? 1493 A   B "C4'" 1 
ATOM   811 O "O4'" . A   B 2 18 ? -5.559  -9.576  27.553  1.00 57.02  ? 1493 A   B "O4'" 1 
ATOM   812 C "C3'" . A   B 2 18 ? -3.794  -10.987 26.890  1.00 61.78  ? 1493 A   B "C3'" 1 
ATOM   813 O "O3'" . A   B 2 18 ? -2.943  -11.948 27.502  1.00 80.57  ? 1493 A   B "O3'" 1 
ATOM   814 C "C2'" . A   B 2 18 ? -5.100  -11.625 26.450  1.00 59.45  ? 1493 A   B "C2'" 1 
ATOM   815 O "O2'" . A   B 2 18 ? -5.505  -12.618 27.364  1.00 68.68  ? 1493 A   B "O2'" 1 
ATOM   816 C "C1'" . A   B 2 18 ? -6.074  -10.453 26.583  1.00 53.28  ? 1493 A   B "C1'" 1 
ATOM   817 N N9    . A   B 2 18 ? -6.358  -9.662  25.388  1.00 44.87  ? 1493 A   B N9    1 
ATOM   818 C C8    . A   B 2 18 ? -5.510  -8.883  24.657  1.00 40.20  ? 1493 A   B C8    1 
ATOM   819 N N7    . A   B 2 18 ? -6.088  -8.273  23.652  1.00 42.17  ? 1493 A   B N7    1 
ATOM   820 C C5    . A   B 2 18 ? -7.405  -8.685  23.726  1.00 36.54  ? 1493 A   B C5    1 
ATOM   821 C C6    . A   B 2 18 ? -8.531  -8.388  22.948  1.00 48.39  ? 1493 A   B C6    1 
ATOM   822 N N6    . A   B 2 18 ? -8.503  -7.595  21.877  1.00 62.68  ? 1493 A   B N6    1 
ATOM   823 N N1    . A   B 2 18 ? -9.707  -8.945  23.307  1.00 57.30  ? 1493 A   B N1    1 
ATOM   824 C C2    . A   B 2 18 ? -9.736  -9.751  24.371  1.00 52.52  ? 1493 A   B C2    1 
ATOM   825 N N3    . A   B 2 18 ? -8.744  -10.111 25.176  1.00 57.93  ? 1493 A   B N3    1 
ATOM   826 C C4    . A   B 2 18 ? -7.588  -9.537  24.792  1.00 50.36  ? 1493 A   B C4    1 
ATOM   827 P P     . G   B 2 19 ? -1.433  -12.123 26.996  1.00 99.12  ? 1494 G   B P     1 
ATOM   828 O OP1   . G   B 2 19 ? -0.877  -13.301 27.710  1.00 91.26  ? 1494 G   B OP1   1 
ATOM   829 O OP2   . G   B 2 19 ? -0.740  -10.816 27.095  1.00 99.18  ? 1494 G   B OP2   1 
ATOM   830 O "O5'" . G   B 2 19 ? -1.588  -12.476 25.453  1.00 80.11  ? 1494 G   B "O5'" 1 
ATOM   831 C "C5'" . G   B 2 19 ? -1.896  -13.810 25.020  1.00 70.42  ? 1494 G   B "C5'" 1 
ATOM   832 C "C4'" . G   B 2 19 ? -0.794  -14.322 24.128  1.00 62.59  ? 1494 G   B "C4'" 1 
ATOM   833 O "O4'" . G   B 2 19 ? -0.284  -13.191 23.377  1.00 62.55  ? 1494 G   B "O4'" 1 
ATOM   834 C "C3'" . G   B 2 19 ? 0.440   -14.853 24.829  1.00 54.10  ? 1494 G   B "C3'" 1 
ATOM   835 O "O3'" . G   B 2 19 ? 0.298   -16.219 25.162  1.00 48.64  ? 1494 G   B "O3'" 1 
ATOM   836 C "C2'" . G   B 2 19 ? 1.519   -14.672 23.775  1.00 58.04  ? 1494 G   B "C2'" 1 
ATOM   837 O "O2'" . G   B 2 19 ? 1.508   -15.673 22.783  1.00 72.77  ? 1494 G   B "O2'" 1 
ATOM   838 C "C1'" . G   B 2 19 ? 1.105   -13.341 23.158  1.00 47.09  ? 1494 G   B "C1'" 1 
ATOM   839 N N9    . G   B 2 19 ? 1.792   -12.213 23.772  1.00 39.91  ? 1494 G   B N9    1 
ATOM   840 C C8    . G   B 2 19 ? 1.236   -11.184 24.495  1.00 52.10  ? 1494 G   B C8    1 
ATOM   841 N N7    . G   B 2 19 ? 2.122   -10.330 24.931  1.00 48.11  ? 1494 G   B N7    1 
ATOM   842 C C5    . G   B 2 19 ? 3.332   -10.827 24.465  1.00 31.62  ? 1494 G   B C5    1 
ATOM   843 C C6    . G   B 2 19 ? 4.638   -10.342 24.646  1.00 43.88  ? 1494 G   B C6    1 
ATOM   844 O O6    . G   B 2 19 ? 5.001   -9.342  25.269  1.00 52.27  ? 1494 G   B O6    1 
ATOM   845 N N1    . G   B 2 19 ? 5.577   -11.156 24.023  1.00 51.96  ? 1494 G   B N1    1 
ATOM   846 C C2    . G   B 2 19 ? 5.289   -12.304 23.325  1.00 57.92  ? 1494 G   B C2    1 
ATOM   847 N N2    . G   B 2 19 ? 6.334   -12.960 22.806  1.00 50.12  ? 1494 G   B N2    1 
ATOM   848 N N3    . G   B 2 19 ? 4.064   -12.772 23.154  1.00 37.81  ? 1494 G   B N3    1 
ATOM   849 C C4    . G   B 2 19 ? 3.143   -11.985 23.747  1.00 29.14  ? 1494 G   B C4    1 
ATOM   850 P P     . U   B 2 20 ? 1.265   -16.867 26.263  1.00 58.97  ? 1495 U   B P     1 
ATOM   851 O OP1   . U   B 2 20 ? 0.847   -18.284 26.397  1.00 53.44  ? 1495 U   B OP1   1 
ATOM   852 O OP2   . U   B 2 20 ? 1.323   -16.003 27.458  1.00 61.76  ? 1495 U   B OP2   1 
ATOM   853 O "O5'" . U   B 2 20 ? 2.710   -16.792 25.609  1.00 49.10  ? 1495 U   B "O5'" 1 
ATOM   854 C "C5'" . U   B 2 20 ? 3.048   -17.619 24.496  1.00 55.44  ? 1495 U   B "C5'" 1 
ATOM   855 C "C4'" . U   B 2 20 ? 4.531   -17.593 24.276  1.00 48.95  ? 1495 U   B "C4'" 1 
ATOM   856 O "O4'" . U   B 2 20 ? 4.926   -16.254 23.898  1.00 51.76  ? 1495 U   B "O4'" 1 
ATOM   857 C "C3'" . U   B 2 20 ? 5.372   -17.885 25.505  1.00 56.76  ? 1495 U   B "C3'" 1 
ATOM   858 O "O3'" . U   B 2 20 ? 5.501   -19.285 25.738  1.00 62.24  ? 1495 U   B "O3'" 1 
ATOM   859 C "C2'" . U   B 2 20 ? 6.694   -17.231 25.137  1.00 47.58  ? 1495 U   B "C2'" 1 
ATOM   860 O "O2'" . U   B 2 20 ? 7.410   -17.996 24.190  1.00 57.20  ? 1495 U   B "O2'" 1 
ATOM   861 C "C1'" . U   B 2 20 ? 6.205   -15.963 24.445  1.00 41.64  ? 1495 U   B "C1'" 1 
ATOM   862 N N1    . U   B 2 20 ? 6.085   -14.807 25.347  1.00 38.01  ? 1495 U   B N1    1 
ATOM   863 C C2    . U   B 2 20 ? 7.245   -14.152 25.714  1.00 48.08  ? 1495 U   B C2    1 
ATOM   864 O O2    . U   B 2 20 ? 8.351   -14.487 25.323  1.00 50.42  ? 1495 U   B O2    1 
ATOM   865 N N3    . U   B 2 20 ? 7.063   -13.084 26.558  1.00 48.38  ? 1495 U   B N3    1 
ATOM   866 C C4    . U   B 2 20 ? 5.866   -12.611 27.060  1.00 51.50  ? 1495 U   B C4    1 
ATOM   867 O O4    . U   B 2 20 ? 5.870   -11.660 27.849  1.00 55.32  ? 1495 U   B O4    1 
ATOM   868 C C5    . U   B 2 20 ? 4.713   -13.334 26.626  1.00 45.32  ? 1495 U   B C5    1 
ATOM   869 C C6    . U   B 2 20 ? 4.859   -14.383 25.810  1.00 47.82  ? 1495 U   B C6    1 
ATOM   870 P P     . C   B 2 21 ? 5.906   -19.816 27.200  1.00 63.54  ? 1496 C   B P     1 
ATOM   871 O OP1   . C   B 2 21 ? 5.876   -21.295 27.103  1.00 62.73  ? 1496 C   B OP1   1 
ATOM   872 O OP2   . C   B 2 21 ? 5.068   -19.128 28.214  1.00 61.07  ? 1496 C   B OP2   1 
ATOM   873 O "O5'" . C   B 2 21 ? 7.414   -19.332 27.400  1.00 54.58  ? 1496 C   B "O5'" 1 
ATOM   874 C "C5'" . C   B 2 21 ? 8.472   -19.910 26.619  1.00 64.51  ? 1496 C   B "C5'" 1 
ATOM   875 C "C4'" . C   B 2 21 ? 9.807   -19.274 26.955  1.00 67.86  ? 1496 C   B "C4'" 1 
ATOM   876 O "O4'" . C   B 2 21 ? 9.790   -17.870 26.603  1.00 64.82  ? 1496 C   B "O4'" 1 
ATOM   877 C "C3'" . C   B 2 21 ? 10.245  -19.273 28.410  1.00 77.11  ? 1496 C   B "C3'" 1 
ATOM   878 O "O3'" . C   B 2 21 ? 10.778  -20.525 28.823  1.00 81.84  ? 1496 C   B "O3'" 1 
ATOM   879 C "C2'" . C   B 2 21 ? 11.291  -18.165 28.414  1.00 73.58  ? 1496 C   B "C2'" 1 
ATOM   880 O "O2'" . C   B 2 21 ? 12.527  -18.548 27.842  1.00 79.77  ? 1496 C   B "O2'" 1 
ATOM   881 C "C1'" . C   B 2 21 ? 10.631  -17.145 27.491  1.00 67.96  ? 1496 C   B "C1'" 1 
ATOM   882 N N1    . C   B 2 21 ? 9.794   -16.188 28.232  1.00 56.81  ? 1496 C   B N1    1 
ATOM   883 C C2    . C   B 2 21 ? 10.389  -15.045 28.796  1.00 60.20  ? 1496 C   B C2    1 
ATOM   884 O O2    . C   B 2 21 ? 11.624  -14.867 28.667  1.00 64.76  ? 1496 C   B O2    1 
ATOM   885 N N3    . C   B 2 21 ? 9.604   -14.163 29.461  1.00 53.48  ? 1496 C   B N3    1 
ATOM   886 C C4    . C   B 2 21 ? 8.284   -14.383 29.563  1.00 59.15  ? 1496 C   B C4    1 
ATOM   887 N N4    . C   B 2 21 ? 7.527   -13.474 30.210  1.00 53.32  ? 1496 C   B N4    1 
ATOM   888 C C5    . C   B 2 21 ? 7.670   -15.537 29.007  1.00 60.80  ? 1496 C   B C5    1 
ATOM   889 C C6    . C   B 2 21 ? 8.453   -16.404 28.362  1.00 49.32  ? 1496 C   B C6    1 
ATOM   890 P P     . G   B 2 22 ? 10.763  -20.918 30.379  1.00 84.97  ? 1497 G   B P     1 
ATOM   891 O OP1   . G   B 2 22 ? 11.435  -22.231 30.488  1.00 94.76  ? 1497 G   B OP1   1 
ATOM   892 O OP2   . G   B 2 22 ? 9.387   -20.757 30.914  1.00 83.67  ? 1497 G   B OP2   1 
ATOM   893 O "O5'" . G   B 2 22 ? 11.699  -19.819 31.048  1.00 75.11  ? 1497 G   B "O5'" 1 
ATOM   894 C "C5'" . G   B 2 22 ? 13.066  -19.709 30.664  1.00 65.71  ? 1497 G   B "C5'" 1 
ATOM   895 C "C4'" . G   B 2 22 ? 13.709  -18.553 31.369  1.00 71.93  ? 1497 G   B "C4'" 1 
ATOM   896 O "O4'" . G   B 2 22 ? 13.104  -17.311 30.935  1.00 84.50  ? 1497 G   B "O4'" 1 
ATOM   897 C "C3'" . G   B 2 22 ? 13.504  -18.491 32.864  1.00 78.52  ? 1497 G   B "C3'" 1 
ATOM   898 O "O3'" . G   B 2 22 ? 14.296  -19.432 33.563  1.00 91.54  ? 1497 G   B "O3'" 1 
ATOM   899 C "C2'" . G   B 2 22 ? 13.880  -17.046 33.152  1.00 82.27  ? 1497 G   B "C2'" 1 
ATOM   900 O "O2'" . G   B 2 22 ? 15.271  -16.790 33.079  1.00 86.81  ? 1497 G   B "O2'" 1 
ATOM   901 C "C1'" . G   B 2 22 ? 13.202  -16.348 31.979  1.00 77.38  ? 1497 G   B "C1'" 1 
ATOM   902 N N9    . G   B 2 22 ? 11.862  -15.911 32.354  1.00 64.11  ? 1497 G   B N9    1 
ATOM   903 C C8    . G   B 2 22 ? 10.669  -16.540 32.101  1.00 65.40  ? 1497 G   B C8    1 
ATOM   904 N N7    . G   B 2 22 ? 9.640   -15.901 32.590  1.00 53.44  ? 1497 G   B N7    1 
ATOM   905 C C5    . G   B 2 22 ? 10.191  -14.787 33.203  1.00 48.32  ? 1497 G   B C5    1 
ATOM   906 C C6    . G   B 2 22 ? 9.573   -13.737 33.908  1.00 49.91  ? 1497 G   B C6    1 
ATOM   907 O O6    . G   B 2 22 ? 8.375   -13.580 34.149  1.00 54.13  ? 1497 G   B O6    1 
ATOM   908 N N1    . G   B 2 22 ? 10.500  -12.805 34.357  1.00 51.15  ? 1497 G   B N1    1 
ATOM   909 C C2    . G   B 2 22 ? 11.851  -12.882 34.156  1.00 67.89  ? 1497 G   B C2    1 
ATOM   910 N N2    . G   B 2 22 ? 12.591  -11.883 34.659  1.00 76.22  ? 1497 G   B N2    1 
ATOM   911 N N3    . G   B 2 22 ? 12.442  -13.865 33.504  1.00 74.09  ? 1497 G   B N3    1 
ATOM   912 C C4    . G   B 2 22 ? 11.557  -14.775 33.058  1.00 58.71  ? 1497 G   B C4    1 
ATOM   913 P P     . C   B 2 23 ? 13.679  -20.171 34.849  1.00 90.84  ? 1498 C   B P     1 
ATOM   914 O OP1   . C   B 2 23 ? 14.633  -21.245 35.214  1.00 95.22  ? 1498 C   B OP1   1 
ATOM   915 O OP2   . C   B 2 23 ? 12.254  -20.516 34.564  1.00 96.03  ? 1498 C   B OP2   1 
ATOM   916 O "O5'" . C   B 2 23 ? 13.724  -19.054 35.987  1.00 75.39  ? 1498 C   B "O5'" 1 
ATOM   917 C "C5'" . C   B 2 23 ? 14.977  -18.475 36.375  1.00 75.14  ? 1498 C   B "C5'" 1 
ATOM   918 C "C4'" . C   B 2 23 ? 14.759  -17.275 37.258  1.00 82.04  ? 1498 C   B "C4'" 1 
ATOM   919 O "O4'" . C   B 2 23 ? 13.960  -16.295 36.553  1.00 84.19  ? 1498 C   B "O4'" 1 
ATOM   920 C "C3'" . C   B 2 23 ? 13.985  -17.497 38.544  1.00 91.38  ? 1498 C   B "C3'" 1 
ATOM   921 O "O3'" . C   B 2 23 ? 14.730  -18.160 39.583  1.00 100.99 ? 1498 C   B "O3'" 1 
ATOM   922 C "C2'" . C   B 2 23 ? 13.549  -16.076 38.887  1.00 93.67  ? 1498 C   B "C2'" 1 
ATOM   923 O "O2'" . C   B 2 23 ? 14.576  -15.326 39.511  1.00 96.40  ? 1498 C   B "O2'" 1 
ATOM   924 C "C1'" . C   B 2 23 ? 13.245  -15.506 37.493  1.00 83.23  ? 1498 C   B "C1'" 1 
ATOM   925 N N1    . C   B 2 23 ? 11.812  -15.533 37.137  1.00 71.97  ? 1498 C   B N1    1 
ATOM   926 C C2    . C   B 2 23 ? 10.982  -14.470 37.545  1.00 70.28  ? 1498 C   B C2    1 
ATOM   927 O O2    . C   B 2 23 ? 11.472  -13.521 38.175  1.00 52.40  ? 1498 C   B O2    1 
ATOM   928 N N3    . C   B 2 23 ? 9.663   -14.512 37.243  1.00 71.27  ? 1498 C   B N3    1 
ATOM   929 C C4    . C   B 2 23 ? 9.166   -15.548 36.566  1.00 66.60  ? 1498 C   B C4    1 
ATOM   930 N N4    . C   B 2 23 ? 7.865   -15.550 36.300  1.00 64.50  ? 1498 C   B N4    1 
ATOM   931 C C5    . C   B 2 23 ? 9.983   -16.630 36.132  1.00 71.64  ? 1498 C   B C5    1 
ATOM   932 C C6    . C   B 2 23 ? 11.288  -16.581 36.431  1.00 74.86  ? 1498 C   B C6    1 
HETATM 933 C C11   . AB9 C 3 .  ? 2.824   -5.788  25.852  1.00 41.87  ? 1    AB9 B C11   1 
HETATM 934 C C12   . AB9 C 3 .  ? 3.686   -9.574  29.743  1.00 42.52  ? 1    AB9 B C12   1 
HETATM 935 C C21   . AB9 C 3 .  ? 2.350   -4.311  26.005  1.00 28.40  ? 1    AB9 B C21   1 
HETATM 936 C C22   . AB9 C 3 .  ? 2.578   -9.878  28.669  1.00 46.15  ? 1    AB9 B C22   1 
HETATM 937 C C23   . AB9 C 3 .  ? 3.295   -11.464 31.558  1.00 46.79  ? 1    AB9 B C23   1 
HETATM 938 C C24   . AB9 C 3 .  ? 4.268   -12.622 31.581  1.00 62.41  ? 1    AB9 B C24   1 
HETATM 939 C C25   . AB9 C 3 .  ? 3.839   -13.563 32.709  1.00 65.75  ? 1    AB9 B C25   1 
HETATM 940 C C26   . AB9 C 3 .  ? 4.942   -13.951 33.708  1.00 82.01  ? 1    AB9 B C26   1 
HETATM 941 C C29   . AB9 C 3 .  ? 7.088   -8.171  30.540  1.00 63.24  ? 1    AB9 B C29   1 
HETATM 942 C C30   . AB9 C 3 .  ? 6.973   -7.683  31.976  1.00 78.98  ? 1    AB9 B C30   1 
HETATM 943 C C31   . AB9 C 3 .  ? 0.788   -4.236  25.922  1.00 35.58  ? 1    AB9 B C31   1 
HETATM 944 C C32   . AB9 C 3 .  ? 1.942   -8.592  28.123  1.00 29.30  ? 1    AB9 B C32   1 
HETATM 945 C C33   . AB9 C 3 .  ? 7.147   -4.036  33.329  1.00 110.02 ? 1    AB9 B C33   1 
HETATM 946 C C35   . AB9 C 3 .  ? 6.969   -5.578  33.455  1.00 102.38 ? 1    AB9 B C35   1 
HETATM 947 O O11   . AB9 C 3 .  ? 2.329   -6.492  27.038  1.00 28.54  ? 1    AB9 B O11   1 
HETATM 948 N N21   . AB9 C 3 .  ? 2.821   -3.751  27.250  1.00 52.68  ? 1    AB9 B N21   1 
HETATM 949 O O31   . AB9 C 3 .  ? 0.337   -2.902  26.054  1.00 52.63  ? 1    AB9 B O31   1 
HETATM 950 C C41   . AB9 C 3 .  ? 0.355   -4.824  24.575  1.00 43.89  ? 1    AB9 B C41   1 
HETATM 951 O O41   . AB9 C 3 .  ? -1.055  -4.775  24.429  1.00 44.70  ? 1    AB9 B O41   1 
HETATM 952 C C51   . AB9 C 3 .  ? 0.861   -6.290  24.449  1.00 40.73  ? 1    AB9 B C51   1 
HETATM 953 O O51   . AB9 C 3 .  ? 2.295   -6.359  24.592  1.00 33.93  ? 1    AB9 B O51   1 
HETATM 954 C C61   . AB9 C 3 .  ? 0.491   -6.894  23.147  1.00 34.78  ? 1    AB9 B C61   1 
HETATM 955 N N61   . AB9 C 3 .  ? 0.957   -8.161  23.090  1.00 43.44  ? 1    AB9 B N61   1 
HETATM 956 N N12   . AB9 C 3 .  ? 4.262   -10.841 30.218  1.00 48.78  ? 1    AB9 B N12   1 
HETATM 957 N N32   . AB9 C 3 .  ? 0.947   -8.898  27.100  1.00 33.95  ? 1    AB9 B N32   1 
HETATM 958 C C42   . AB9 C 3 .  ? 2.998   -7.693  27.530  1.00 26.61  ? 1    AB9 B C42   1 
HETATM 959 C C52   . AB9 C 3 .  ? 4.105   -7.356  28.619  1.00 44.03  ? 1    AB9 B C52   1 
HETATM 960 O O52   . AB9 C 3 .  ? 5.104   -6.482  28.013  1.00 80.72  ? 1    AB9 B O52   1 
HETATM 961 C C62   . AB9 C 3 .  ? 4.768   -8.694  29.098  1.00 47.03  ? 1    AB9 B C62   1 
HETATM 962 O O62   . AB9 C 3 .  ? 5.764   -8.430  30.034  1.00 52.74  ? 1    AB9 B O62   1 
HETATM 963 N N31   . AB9 C 3 .  ? 7.057   -6.212  32.109  1.00 96.37  ? 1    AB9 B N31   1 
HETATM 964 N N34   . AB9 C 3 .  ? 7.070   -3.281  34.695  1.00 115.14 ? 1    AB9 B N34   1 
HETATM 965 O O36   . AB9 C 3 .  ? 2.424   -11.126 32.074  1.00 53.38  ? 1    AB9 B O36   1 
HETATM 966 N N27   . AB9 C 3 .  ? 4.361   -14.844 34.715  1.00 94.06  ? 1    AB9 B N27   1 
HETATM 967 O O28   . AB9 C 3 .  ? 4.181   -13.374 30.399  1.00 70.31  ? 1    AB9 B O28   1 
# 
loop_
_pdbx_poly_seq_scheme.asym_id 
_pdbx_poly_seq_scheme.entity_id 
_pdbx_poly_seq_scheme.seq_id 
_pdbx_poly_seq_scheme.mon_id 
_pdbx_poly_seq_scheme.ndb_seq_num 
_pdbx_poly_seq_scheme.pdb_seq_num 
_pdbx_poly_seq_scheme.auth_seq_num 
_pdbx_poly_seq_scheme.pdb_mon_id 
_pdbx_poly_seq_scheme.auth_mon_id 
_pdbx_poly_seq_scheme.pdb_strand_id 
_pdbx_poly_seq_scheme.pdb_ins_code 
_pdbx_poly_seq_scheme.hetero 
A 1 1  G 1  1403 1403 G G A . n 
A 1 2  C 2  1404 1404 C C A . n 
A 1 3  G 3  1405 1405 G G A . n 
A 1 4  U 4  1406 1406 U U A . n 
A 1 5  C 5  1407 1407 C C A . n 
A 1 6  A 6  1408 1408 A A A . n 
A 1 7  C 7  1409 1409 C C A . n 
A 1 8  A 8  1410 1410 A A A . n 
A 1 9  C 9  1411 1411 C C A . n 
A 1 10 C 10 1412 1412 C C A . n 
A 1 11 G 11 1488 1488 G G A . n 
A 1 12 G 12 1489 1489 G G A . n 
A 1 13 U 13 1490 1490 U U A . n 
A 1 14 G 14 1491 1491 G G A . n 
A 1 15 A 15 1492 1492 A A A . n 
A 1 16 A 16 1493 1493 A A A . n 
A 1 17 G 17 1494 1494 G G A . n 
A 1 18 U 18 1495 1495 U U A . n 
A 1 19 C 19 1496 1496 C C A . n 
A 1 20 G 20 1497 1497 G G A . n 
A 1 21 C 21 1498 1498 C C A . n 
B 2 1  U 1  1401 1401 U U B . n 
B 2 2  U 2  1402 1402 U U B . n 
B 2 3  G 3  1403 1403 G G B . n 
B 2 4  C 4  1404 1404 C C B . n 
B 2 5  G 5  1405 1405 G G B . n 
B 2 6  U 6  1406 1406 U U B . n 
B 2 7  C 7  1407 1407 C C B . n 
B 2 8  A 8  1408 1408 A A B . n 
B 2 9  C 9  1409 1409 C C B . n 
B 2 10 A 10 1410 1410 A A B . n 
B 2 11 C 11 1411 1411 C C B . n 
B 2 12 C 12 1412 1412 C C B . n 
B 2 13 G 13 1488 1488 G G B . n 
B 2 14 G 14 1489 1489 G G B . n 
B 2 15 U 15 1490 1490 U U B . n 
B 2 16 G 16 1491 1491 G G B . n 
B 2 17 A 17 1492 1492 A A B . n 
B 2 18 A 18 1493 1493 A A B . n 
B 2 19 G 19 1494 1494 G G B . n 
B 2 20 U 20 1495 1495 U U B . n 
B 2 21 C 21 1496 1496 C C B . n 
B 2 22 G 22 1497 1497 G G B . n 
B 2 23 C 23 1498 1498 C C B . n 
# 
_pdbx_nonpoly_scheme.asym_id         C 
_pdbx_nonpoly_scheme.entity_id       3 
_pdbx_nonpoly_scheme.mon_id          AB9 
_pdbx_nonpoly_scheme.ndb_seq_num     1 
_pdbx_nonpoly_scheme.pdb_seq_num     1 
_pdbx_nonpoly_scheme.auth_seq_num    1 
_pdbx_nonpoly_scheme.pdb_mon_id      AB9 
_pdbx_nonpoly_scheme.auth_mon_id     AB9 
_pdbx_nonpoly_scheme.pdb_strand_id   B 
_pdbx_nonpoly_scheme.pdb_ins_code    . 
# 
_struct_site_keywords.site_id   1 
_struct_site_keywords.text      intercalation 
# 
_pdbx_struct_assembly.id                   1 
_pdbx_struct_assembly.details              author_defined_assembly 
_pdbx_struct_assembly.method_details       ? 
_pdbx_struct_assembly.oligomeric_details   dimeric 
_pdbx_struct_assembly.oligomeric_count     2 
# 
_pdbx_struct_assembly_gen.assembly_id       1 
_pdbx_struct_assembly_gen.oper_expression   1 
_pdbx_struct_assembly_gen.asym_id_list      A,B,C 
# 
_pdbx_struct_oper_list.id                   1 
_pdbx_struct_oper_list.type                 'identity operation' 
_pdbx_struct_oper_list.name                 1_555 
_pdbx_struct_oper_list.symmetry_operation   x,y,z 
_pdbx_struct_oper_list.matrix[1][1]         1.0000000000 
_pdbx_struct_oper_list.matrix[1][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[1][3]         0.0000000000 
_pdbx_struct_oper_list.vector[1]            0.0000000000 
_pdbx_struct_oper_list.matrix[2][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[2][2]         1.0000000000 
_pdbx_struct_oper_list.matrix[2][3]         0.0000000000 
_pdbx_struct_oper_list.vector[2]            0.0000000000 
_pdbx_struct_oper_list.matrix[3][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][3]         1.0000000000 
_pdbx_struct_oper_list.vector[3]            0.0000000000 
# 
loop_
_pdbx_audit_revision_history.ordinal 
_pdbx_audit_revision_history.data_content_type 
_pdbx_audit_revision_history.major_revision 
_pdbx_audit_revision_history.minor_revision 
_pdbx_audit_revision_history.revision_date 
1 'Structure model' 1 0 2006-05-02 
2 'Structure model' 1 1 2008-05-01 
3 'Structure model' 1 2 2011-07-13 
4 'Structure model' 1 3 2017-10-18 
# 
_pdbx_audit_revision_details.ordinal             1 
_pdbx_audit_revision_details.revision_ordinal    1 
_pdbx_audit_revision_details.data_content_type   'Structure model' 
_pdbx_audit_revision_details.provider            repository 
_pdbx_audit_revision_details.type                'Initial release' 
_pdbx_audit_revision_details.description         ? 
# 
loop_
_pdbx_audit_revision_group.ordinal 
_pdbx_audit_revision_group.revision_ordinal 
_pdbx_audit_revision_group.data_content_type 
_pdbx_audit_revision_group.group 
1 2 'Structure model' 'Version format compliance' 
2 3 'Structure model' 'Version format compliance' 
3 4 'Structure model' Advisory                    
4 4 'Structure model' 'Refinement description'    
# 
loop_
_pdbx_audit_revision_category.ordinal 
_pdbx_audit_revision_category.revision_ordinal 
_pdbx_audit_revision_category.data_content_type 
_pdbx_audit_revision_category.category 
1 4 'Structure model' pdbx_unobs_or_zero_occ_atoms 
2 4 'Structure model' software                     
# 
loop_
_pdbx_audit_revision_item.ordinal 
_pdbx_audit_revision_item.revision_ordinal 
_pdbx_audit_revision_item.data_content_type 
_pdbx_audit_revision_item.item 
1 4 'Structure model' '_software.classification'       
2 4 'Structure model' '_software.contact_author'       
3 4 'Structure model' '_software.contact_author_email' 
4 4 'Structure model' '_software.date'                 
5 4 'Structure model' '_software.language'             
6 4 'Structure model' '_software.location'             
7 4 'Structure model' '_software.name'                 
8 4 'Structure model' '_software.type'                 
9 4 'Structure model' '_software.version'              
# 
loop_
_software.name 
_software.version 
_software.date 
_software.type 
_software.contact_author 
_software.contact_author_email 
_software.classification 
_software.location 
_software.language 
_software.citation_id 
_software.pdbx_ordinal 
DENZO       .     ?               package 'Zbyszek Otwinowski' zbyszek@mix.swmed.edu    'data reduction'  
http://www.lnls.br/infra/linhasluz/denzo-hkl.htm ?          ? 1 
SCALEPACK   .     ?               package 'Zbyszek Otwinowski' zbyszek@mix.swmed.edu    'data scaling'    
http://www.lnls.br/infra/linhasluz/denzo-hkl.htm ?          ? 2 
CNS         .     ?               package 'Axel T. Brunger'    axel.brunger@yale.edu    refinement        
http://cns.csb.yale.edu/v1.1/                    Fortran_77 ? 3 
PDB_EXTRACT 1.701 'OCT. 28, 2005' package PDB                  sw-help@rcsb.rutgers.edu 'data extraction' 
http://pdb.rutgers.edu/software/                 C++        ? 4 
# 
loop_
_ndb_struct_conf_na.entry_id 
_ndb_struct_conf_na.feature 
2F4T 'double helix'         
2F4T 'a-form double helix'  
2F4T 'mismatched base pair' 
2F4T 'internal loop'        
# 
loop_
_ndb_struct_na_base_pair.model_number 
_ndb_struct_na_base_pair.i_label_asym_id 
_ndb_struct_na_base_pair.i_label_comp_id 
_ndb_struct_na_base_pair.i_label_seq_id 
_ndb_struct_na_base_pair.i_symmetry 
_ndb_struct_na_base_pair.j_label_asym_id 
_ndb_struct_na_base_pair.j_label_comp_id 
_ndb_struct_na_base_pair.j_label_seq_id 
_ndb_struct_na_base_pair.j_symmetry 
_ndb_struct_na_base_pair.shear 
_ndb_struct_na_base_pair.stretch 
_ndb_struct_na_base_pair.stagger 
_ndb_struct_na_base_pair.buckle 
_ndb_struct_na_base_pair.propeller 
_ndb_struct_na_base_pair.opening 
_ndb_struct_na_base_pair.pair_number 
_ndb_struct_na_base_pair.pair_name 
_ndb_struct_na_base_pair.i_auth_asym_id 
_ndb_struct_na_base_pair.i_auth_seq_id 
_ndb_struct_na_base_pair.i_PDB_ins_code 
_ndb_struct_na_base_pair.j_auth_asym_id 
_ndb_struct_na_base_pair.j_auth_seq_id 
_ndb_struct_na_base_pair.j_PDB_ins_code 
_ndb_struct_na_base_pair.hbond_type_28 
_ndb_struct_na_base_pair.hbond_type_12 
1 A G 1  1_555 B C 23 1_555 -0.733 -0.277 -0.350 -2.953  -3.791  -11.731 1  A_G1403:C1498_B A 1403 ? B 1498 ? 19 1 
1 A C 2  1_555 B G 22 1_555 0.816  -0.620 -0.026 3.369   -23.796 1.848   2  A_C1404:G1497_B A 1404 ? B 1497 ? 19 1 
1 A G 3  1_555 B C 21 1_555 0.212  -0.109 -0.330 -5.403  -11.673 2.385   3  A_G1405:C1496_B A 1405 ? B 1496 ? 19 1 
1 A U 4  1_555 B U 20 1_555 -2.042 -0.777 -0.108 5.078   -1.040  -18.633 4  A_U1406:U1495_B A 1406 ? B 1495 ? ?  ? 
1 A C 5  1_555 B G 19 1_555 -0.040 -0.478 0.265  -1.829  4.140   -6.040  5  A_C1407:G1494_B A 1407 ? B 1494 ? 19 1 
1 A C 7  1_555 B G 16 1_555 0.204  0.105  -0.011 4.353   -19.813 4.100   6  A_C1409:G1491_B A 1409 ? B 1491 ? 19 1 
1 A A 8  1_555 B U 15 1_555 0.536  -0.219 0.233  3.792   -12.856 2.288   7  A_A1410:U1490_B A 1410 ? B 1490 ? 20 1 
1 A C 9  1_555 B G 14 1_555 -0.650 -0.256 0.138  5.089   -12.573 -0.547  8  A_C1411:G1489_B A 1411 ? B 1489 ? 19 1 
1 A C 10 1_555 B G 13 1_555 0.233  -0.310 0.196  -4.089  -2.975  -5.185  9  A_C1412:G1488_B A 1412 ? B 1488 ? 19 1 
1 A G 11 1_555 B C 12 1_555 0.659  0.216  0.027  -1.051  -12.131 2.917   10 A_G1488:C1412_B A 1488 ? B 1412 ? 19 1 
1 A G 12 1_555 B C 11 1_555 -0.528 -0.281 -0.017 -6.655  -11.728 -7.080  11 A_G1489:C1411_B A 1489 ? B 1411 ? 19 1 
1 A U 13 1_555 B A 10 1_555 1.423  -0.371 0.320  -8.508  -12.144 0.631   12 A_U1490:A1410_B A 1490 ? B 1410 ? 20 1 
1 A G 14 1_555 B C 9  1_555 0.429  -0.383 0.610  7.574   -3.228  0.904   13 A_G1491:C1409_B A 1491 ? B 1409 ? 19 1 
1 A G 17 1_555 B C 7  1_555 1.106  0.091  0.593  9.106   -12.344 0.471   14 A_G1494:C1407_B A 1494 ? B 1407 ? 19 1 
1 A U 18 1_555 B U 6  1_555 -0.836 -1.793 0.374  10.402  -14.657 -6.107  15 A_U1495:U1406_B A 1495 ? B 1406 ? ?  ? 
1 A C 19 1_555 B G 5  1_555 -1.118 -0.251 0.107  0.764   -9.503  -12.524 16 A_C1496:G1405_B A 1496 ? B 1405 ? 19 1 
1 A G 20 1_555 B C 4  1_555 -0.613 -0.295 -0.476 -14.824 -10.875 -10.240 17 A_G1497:C1404_B A 1497 ? B 1404 ? 19 1 
1 A C 21 1_555 B G 3  1_555 0.570  -0.433 0.129  -14.598 -4.340  -2.911  18 A_C1498:G1403_B A 1498 ? B 1403 ? 19 1 
# 
loop_
_ndb_struct_na_base_pair_step.model_number 
_ndb_struct_na_base_pair_step.i_label_asym_id_1 
_ndb_struct_na_base_pair_step.i_label_comp_id_1 
_ndb_struct_na_base_pair_step.i_label_seq_id_1 
_ndb_struct_na_base_pair_step.i_symmetry_1 
_ndb_struct_na_base_pair_step.j_label_asym_id_1 
_ndb_struct_na_base_pair_step.j_label_comp_id_1 
_ndb_struct_na_base_pair_step.j_label_seq_id_1 
_ndb_struct_na_base_pair_step.j_symmetry_1 
_ndb_struct_na_base_pair_step.i_label_asym_id_2 
_ndb_struct_na_base_pair_step.i_label_comp_id_2 
_ndb_struct_na_base_pair_step.i_label_seq_id_2 
_ndb_struct_na_base_pair_step.i_symmetry_2 
_ndb_struct_na_base_pair_step.j_label_asym_id_2 
_ndb_struct_na_base_pair_step.j_label_comp_id_2 
_ndb_struct_na_base_pair_step.j_label_seq_id_2 
_ndb_struct_na_base_pair_step.j_symmetry_2 
_ndb_struct_na_base_pair_step.shift 
_ndb_struct_na_base_pair_step.slide 
_ndb_struct_na_base_pair_step.rise 
_ndb_struct_na_base_pair_step.tilt 
_ndb_struct_na_base_pair_step.roll 
_ndb_struct_na_base_pair_step.twist 
_ndb_struct_na_base_pair_step.x_displacement 
_ndb_struct_na_base_pair_step.y_displacement 
_ndb_struct_na_base_pair_step.helical_rise 
_ndb_struct_na_base_pair_step.inclination 
_ndb_struct_na_base_pair_step.tip 
_ndb_struct_na_base_pair_step.helical_twist 
_ndb_struct_na_base_pair_step.step_number 
_ndb_struct_na_base_pair_step.step_name 
_ndb_struct_na_base_pair_step.i_auth_asym_id_1 
_ndb_struct_na_base_pair_step.i_auth_seq_id_1 
_ndb_struct_na_base_pair_step.i_PDB_ins_code_1 
_ndb_struct_na_base_pair_step.j_auth_asym_id_1 
_ndb_struct_na_base_pair_step.j_auth_seq_id_1 
_ndb_struct_na_base_pair_step.j_PDB_ins_code_1 
_ndb_struct_na_base_pair_step.i_auth_asym_id_2 
_ndb_struct_na_base_pair_step.i_auth_seq_id_2 
_ndb_struct_na_base_pair_step.i_PDB_ins_code_2 
_ndb_struct_na_base_pair_step.j_auth_asym_id_2 
_ndb_struct_na_base_pair_step.j_auth_seq_id_2 
_ndb_struct_na_base_pair_step.j_PDB_ins_code_2 
1 A G 1  1_555 B C 23 1_555 A C 2  1_555 B G 22 1_555 0.102  -1.707 3.290 -1.952 3.463  40.030 -2.869 -0.366 3.129 5.044  2.843  
40.218 1  AA_G1403C1404:G1497C1498_BB A 1403 ? B 1498 ? A 1404 ? B 1497 ? 
1 A C 2  1_555 B G 22 1_555 A G 3  1_555 B C 21 1_555 -0.448 -1.451 3.465 1.092  9.106  29.375 -4.509 1.057  2.878 17.430 -2.089 
30.743 2  AA_C1404G1405:C1496G1497_BB A 1404 ? B 1497 ? A 1405 ? B 1496 ? 
1 A G 3  1_555 B C 21 1_555 A U 4  1_555 B U 20 1_555 -0.790 -2.083 3.107 -1.824 5.367  21.679 -7.123 1.436  2.579 13.964 4.747  
22.400 3  AA_G1405U1406:U1495C1496_BB A 1405 ? B 1496 ? A 1406 ? B 1495 ? 
1 A U 4  1_555 B U 20 1_555 A C 5  1_555 B G 19 1_555 1.480  -2.602 3.616 -1.106 -1.204 40.161 -3.634 -2.294 3.649 -1.752 1.610  
40.193 4  AA_U1406C1407:G1494U1495_BB A 1406 ? B 1495 ? A 1407 ? B 1494 ? 
1 A C 5  1_555 B G 19 1_555 A C 7  1_555 B G 16 1_555 1.240  -3.561 6.209 -6.439 17.806 81.917 -3.437 -1.207 5.398 13.422 4.854  
83.700 5  AA_C1407C1409:G1491G1494_BB A 1407 ? B 1494 ? A 1409 ? B 1491 ? 
1 A C 7  1_555 B G 16 1_555 A A 8  1_555 B U 15 1_555 -0.247 -1.608 3.262 -3.501 9.185  31.439 -4.306 -0.122 2.709 16.454 6.272  
32.903 6  AA_C1409A1410:U1490G1491_BB A 1409 ? B 1491 ? A 1410 ? B 1490 ? 
1 A A 8  1_555 B U 15 1_555 A C 9  1_555 B G 14 1_555 0.898  -2.105 3.059 1.236  6.317  23.001 -6.857 -1.824 2.445 15.457 -3.025 
23.873 7  AA_A1410C1411:G1489U1490_BB A 1410 ? B 1490 ? A 1411 ? B 1489 ? 
1 A C 9  1_555 B G 14 1_555 A C 10 1_555 B G 13 1_555 -0.966 -2.026 3.413 -3.036 5.969  36.563 -3.981 1.109  3.123 9.416  4.790  
37.151 8  AA_C1411C1412:G1488G1489_BB A 1411 ? B 1489 ? A 1412 ? B 1488 ? 
1 A C 10 1_555 B G 13 1_555 A G 11 1_555 B C 12 1_555 -0.057 -1.692 3.180 1.013  7.609  31.339 -4.283 0.267  2.702 13.828 -1.841 
32.242 9  AA_C1412G1488:C1412G1488_BB A 1412 ? B 1488 ? A 1488 ? B 1412 ? 
1 A G 11 1_555 B C 12 1_555 A G 12 1_555 B C 11 1_555 -0.256 -1.775 3.237 -1.702 9.019  27.370 -5.390 0.170  2.546 18.416 3.475  
28.840 10 AA_G1488G1489:C1411C1412_BB A 1488 ? B 1412 ? A 1489 ? B 1411 ? 
1 A G 12 1_555 B C 11 1_555 A U 13 1_555 B A 10 1_555 1.028  -1.291 3.323 0.536  5.808  43.310 -2.287 -1.331 3.145 7.826  -0.722 
43.682 11 AA_G1489U1490:A1410C1411_BB A 1489 ? B 1411 ? A 1490 ? B 1410 ? 
1 A U 13 1_555 B A 10 1_555 A G 14 1_555 B C 9  1_555 0.160  -1.876 2.509 1.890  9.107  26.469 -5.328 -0.030 1.783 19.152 -3.974 
28.028 12 AA_U1490G1491:C1409A1410_BB A 1490 ? B 1410 ? A 1491 ? B 1409 ? 
1 A G 14 1_555 B C 9  1_555 A G 17 1_555 B C 7  1_555 -0.676 -1.845 6.086 5.601  16.308 69.080 -2.608 0.932  5.528 14.160 -4.863 
70.939 13 AA_G1491G1494:C1407C1409_BB A 1491 ? B 1409 ? A 1494 ? B 1407 ? 
1 A G 17 1_555 B C 7  1_555 A U 18 1_555 B U 6  1_555 -0.427 -1.753 2.869 -2.560 4.525  31.561 -3.874 0.383  2.625 8.249  4.667  
31.975 14 AA_G1494U1495:U1406C1407_BB A 1494 ? B 1407 ? A 1495 ? B 1406 ? 
1 A U 18 1_555 B U 6  1_555 A C 19 1_555 B G 5  1_555 -0.607 -1.994 3.500 1.056  3.959  32.818 -4.194 1.251  3.223 6.974  -1.859 
33.066 15 AA_U1495C1496:G1405U1406_BB A 1495 ? B 1406 ? A 1496 ? B 1405 ? 
1 A C 19 1_555 B G 5  1_555 A G 20 1_555 B C 4  1_555 0.409  -2.604 3.732 4.954  10.359 34.837 -5.623 0.058  2.896 16.748 -8.011 
36.625 16 AA_C1496G1497:C1404G1405_BB A 1496 ? B 1405 ? A 1497 ? B 1404 ? 
1 A G 20 1_555 B C 4  1_555 A C 21 1_555 B G 3  1_555 0.932  -1.730 3.294 -0.589 3.507  34.626 -3.415 -1.646 3.094 5.872  0.986  
34.803 17 AA_G1497C1498:G1403C1404_BB A 1497 ? B 1404 ? A 1498 ? B 1403 ? 
# 
_pdbx_entity_nonpoly.entity_id   3 
_pdbx_entity_nonpoly.name        
;(2R)-4-AMINO-N-{(1R,2S,3R,4R,5S)-5-AMINO-2-{2-[(2-AMINOETHYL)AMINO]ETHOXY}-4-[(2,6-DIAMINO-2,6-DIDEOXY-ALPHA-D-GLUCOPYRANOSYL)OXY]-3-HYDROXYCYCLOHEXYL}-2-HYDROXYBUTANAMIDE
;
_pdbx_entity_nonpoly.comp_id     AB9 
#