#   2K1N 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.279 
PDB   2K1N         
RCSB  RCSB100562   
WWPDB D_1000100562 
_pdbx_database_related.db_id          1Z0R 
_pdbx_database_related.db_name        PDB 
_pdbx_database_related.details        'Structure of the N-terminal domain of AbrB' 
_pdbx_database_related.content_type   unspecified 
_pdbx_database_status.deposit_site                    BMRB 
_pdbx_database_status.entry_id                        2K1N 
_pdbx_database_status.process_site                    RCSB 
_pdbx_database_status.recvd_initial_deposition_date   2008-03-10 
_pdbx_database_status.SG_entry                        ? 
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.status_code_mr                  REL 
_pdbx_database_status.status_code_sf                  ? 
_pdbx_database_status.pdb_format_compatible           Y 
_pdbx_database_status.status_code_cs                  ? 
_pdbx_database_status.methods_development_category    ? 
'Cavanagh, J.'   1 
'Bobay, B.G.'    2 
'Sullivan, D.M.' 3 
'Thompson, R.J.' 4 
#                        primary 
_citation.title                     'Insights into the Nature of DNA Binding of AbrB-like Transcription Factors' 
_citation.journal_abbrev            Structure 
_citation.journal_volume            16 
_citation.page_first                1702 
_citation.page_last                 1713 
_citation.year                      2008 
_citation.journal_id_ASTM           STRUE6                   UK 
_citation.journal_id_ISSN           0969-2126 
_citation.journal_id_CSD            2005 
_citation.book_publisher            ? 
_citation.pdbx_database_id_PubMed   19000822 
_citation.pdbx_database_id_DOI      10.1016/j.str.2008.08.014 
primary 'Sullivan, D.M.' 1 
primary 'Bobay, B.G.'    2 
primary 'Kojetin, D.J.'  3 
primary 'Thompson, R.J.' 4 
primary 'Rance, M.'      5 
primary 'Strauch, M.A.'  6 
primary 'Cavanagh, J.'   7 
1 polymer syn 'DNA (25-MER)'                             7696.008 1 ? A10G ?                                 ? 
2 polymer syn 'DNA (25-MER)'                             7655.984 1 ? A10G ?                                 ? 
3 polymer man 'Transition state regulatory protein abrB' 6342.559 4 ? ?    'sequence database residues 3-57' ? 
1 polydeoxyribonucleotide no no 
ATGATTGACAATTATTGGAAACCTT                               E       ? 
2 polydeoxyribonucleotide no no 
AAGGTTTCCAATAATTGTCAATCAT                               F       ? 
1 1  DA  n 
1 2  DT  n 
1 3  DG  n 
1 4  DA  n 
1 5  DT  n 
1 6  DT  n 
1 7  DG  n 
1 8  DA  n 
1 9  DC  n 
1 10 DA  n 
1 11 DA  n 
1 12 DT  n 
1 13 DT  n 
1 14 DA  n 
1 15 DT  n 
1 16 DT  n 
1 17 DG  n 
1 18 DG  n 
1 19 DA  n 
1 20 DA  n 
1 21 DA  n 
1 22 DC  n 
1 23 DC  n 
1 24 DT  n 
1 25 DT  n 
2 1  DA  n 
2 2  DA  n 
2 3  DG  n 
2 4  DG  n 
2 5  DT  n 
2 6  DT  n 
2 7  DT  n 
2 8  DC  n 
2 9  DC  n 
2 10 DA  n 
2 11 DA  n 
2 12 DT  n 
2 13 DA  n 
2 14 DA  n 
2 15 DT  n 
2 16 DT  n 
2 17 DG  n 
2 18 DT  n 
2 19 DC  n 
2 20 DA  n 
2 21 DA  n 
2 22 DT  n 
2 23 DC  n 
2 24 DA  n 
2 25 DT  n 
3 1  MET n 
3 2  LYS n 
3 3  SER n 
3 4  THR n 
3 5  GLY n 
3 6  ILE n 
3 7  VAL n 
3 8  ARG n 
3 9  LYS n 
3 10 VAL n 
3 11 ASP n 
3 12 GLU n 
3 13 LEU n 
3 14 GLY n 
3 15 ARG n 
3 16 VAL n 
3 17 VAL n 
3 18 ILE n 
3 19 PRO n 
3 20 ILE n 
3 21 GLU n 
3 22 LEU n 
3 23 ARG n 
3 24 ARG n 
3 25 THR n 
3 26 LEU n 
3 27 GLY n 
3 28 ILE n 
3 29 ALA n 
3 30 GLU n 
3 31 LYS n 
3 32 ASP n 
3 33 ALA n 
3 34 LEU n 
3 35 GLU n 
3 36 ILE n 
3 37 TYR n 
3 38 VAL n 
3 39 ASP n 
3 40 ASP n 
3 41 GLU n 
3 42 LYS n 
3 43 ILE n 
3 44 ILE n 
3 45 LEU n 
3 46 LYS n 
3 47 LYS n 
3 48 TYR n 
3 49 LYS n 
3 50 PRO n 
3 51 ASN n 
3 52 MET n 
3 53 THR n 
3 54 CYS n 
3 55 GLN n 
_entity_src_gen.entity_id                          3 
_entity_src_gen.pdbx_src_id                        1 
_entity_src_gen.pdbx_alt_source_flag               sample 
_entity_src_gen.pdbx_seq_type                      ? 
_entity_src_gen.pdbx_beg_seq_num                   ? 
_entity_src_gen.pdbx_end_seq_num                   ? 
_entity_src_gen.gene_src_common_name               ? 
_entity_src_gen.gene_src_genus                     Bacillus 
_entity_src_gen.pdbx_gene_src_gene                 'abrB, cpsX' 
_entity_src_gen.gene_src_species                   subtilis 
_entity_src_gen.gene_src_strain                    ? 
_entity_src_gen.gene_src_tissue                    ? 
_entity_src_gen.gene_src_tissue_fraction           ? 
_entity_src_gen.gene_src_details                   ? 
_entity_src_gen.pdbx_gene_src_fragment             ? 
_entity_src_gen.pdbx_gene_src_scientific_name      'Bacillus subtilis' 
_entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id     1423 
_entity_src_gen.pdbx_gene_src_variant              ? 
_entity_src_gen.pdbx_gene_src_cell_line            ? 
_entity_src_gen.pdbx_gene_src_atcc                 ? 
_entity_src_gen.pdbx_gene_src_organ                ? 
_entity_src_gen.pdbx_gene_src_organelle            ? 
_entity_src_gen.pdbx_gene_src_cell                 ? 
_entity_src_gen.pdbx_gene_src_cellular_location    ? 
_entity_src_gen.host_org_common_name               ? 
_entity_src_gen.pdbx_host_org_scientific_name      'Escherichia coli' 
_entity_src_gen.pdbx_host_org_ncbi_taxonomy_id     562 
_entity_src_gen.host_org_genus                     ? 
_entity_src_gen.pdbx_host_org_gene                 ? 
_entity_src_gen.pdbx_host_org_organ                ? 
_entity_src_gen.host_org_species                   ? 
_entity_src_gen.pdbx_host_org_tissue               ? 
_entity_src_gen.pdbx_host_org_tissue_fraction      ? 
_entity_src_gen.pdbx_host_org_strain               BL21DE3 
_entity_src_gen.pdbx_host_org_variant              ? 
_entity_src_gen.pdbx_host_org_cell_line            ? 
_entity_src_gen.pdbx_host_org_atcc                 ? 
_entity_src_gen.pdbx_host_org_culture_collection   ? 
_entity_src_gen.pdbx_host_org_cell                 ? 
_entity_src_gen.pdbx_host_org_organelle            ? 
_entity_src_gen.pdbx_host_org_cellular_location    ? 
_entity_src_gen.pdbx_host_org_vector_type          vector 
_entity_src_gen.pdbx_host_org_vector               pET24b 
_entity_src_gen.host_org_details                   ? 
_entity_src_gen.expression_system_id               ? 
_entity_src_gen.plasmid_name                       ? 
_entity_src_gen.plasmid_details                    ? 
_entity_src_gen.pdbx_description                   ? 
#                         1 
_struct_ref.db_name                    UNP 
_struct_ref.db_code                    ABRB_BACSU 
_struct_ref.pdbx_db_accession          P08874 
_struct_ref.entity_id                  3 
_struct_ref.pdbx_align_begin           3 
_struct_ref.pdbx_db_isoform            ? 
1 1 2K1N A 1 ? 55 ? P08874 3 ? 57 ? 1 55 
2 1 2K1N B 1 ? 55 ? P08874 3 ? 57 ? 1 55 
3 1 2K1N C 1 ? 55 ? P08874 3 ? 57 ? 1 55 
4 1 2K1N D 1 ? 55 ? P08874 3 ? 57 ? 1 55 
ALA 'L-peptide linking' y ALANINE                              ? 'C3 H7 N O2'      89.093  
ARG 'L-peptide linking' y ARGININE                             ? 'C6 H15 N4 O2 1'  175.209 
ASN 'L-peptide linking' y ASPARAGINE                           ? 'C4 H8 N2 O3'     132.118 
ASP 'L-peptide linking' y 'ASPARTIC ACID'                      ? 'C4 H7 N O4'      133.103 
CYS 'L-peptide linking' y CYSTEINE                             ? 'C3 H7 N O2 S'    121.158 
DA  'DNA linking'       y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 
DC  'DNA linking'       y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE"  ? 'C9 H14 N3 O7 P'  307.197 
DG  'DNA linking'       y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 
DT  'DNA linking'       y "THYMIDINE-5'-MONOPHOSPHATE"         ? 'C10 H15 N2 O8 P' 322.208 
GLN 'L-peptide linking' y GLUTAMINE                            ? 'C5 H10 N2 O3'    146.144 
GLU 'L-peptide linking' y 'GLUTAMIC ACID'                      ? 'C5 H9 N O4'      147.129 
GLY 'peptide linking'   y GLYCINE                              ? 'C2 H5 N O2'      75.067  
ILE 'L-peptide linking' y ISOLEUCINE                           ? 'C6 H13 N O2'     131.173 
LEU 'L-peptide linking' y LEUCINE                              ? 'C6 H13 N O2'     131.173 
LYS 'L-peptide linking' y LYSINE                               ? 'C6 H15 N2 O2 1'  147.195 
MET 'L-peptide linking' y METHIONINE                           ? 'C5 H11 N O2 S'   149.211 
PRO 'L-peptide linking' y PROLINE                              ? 'C5 H9 N O2'      115.130 
SER 'L-peptide linking' y SERINE                               ? 'C3 H7 N O3'      105.093 
THR 'L-peptide linking' y THREONINE                            ? 'C4 H9 N O3'      119.119 
TYR 'L-peptide linking' y TYROSINE                             ? 'C9 H11 N O3'     181.189 
VAL 'L-peptide linking' y VALINE                               ? 'C5 H11 N O2'     117.146 
_pdbx_nmr_exptl.conditions_id   1 
_pdbx_nmr_exptl.experiment_id   1 
_pdbx_nmr_exptl.solution_id     1 
_pdbx_nmr_exptl.type            '2D 1H-15N HSQC' 
_pdbx_nmr_exptl_sample_conditions.conditions_id       1 
_pdbx_nmr_exptl_sample_conditions.ionic_strength      10 
_pdbx_nmr_exptl_sample_conditions.pH                  5.5 
_pdbx_nmr_exptl_sample_conditions.pressure            ambient 
_pdbx_nmr_exptl_sample_conditions.pressure_units      ? 
_pdbx_nmr_exptl_sample_conditions.temperature         305 
_pdbx_nmr_exptl_sample_conditions.temperature_units   K 
_pdbx_nmr_sample_details.contents         '0.5 mM [U-99% 15N] AbrBN55, 90% H2O/10% D2O' 
_pdbx_nmr_sample_details.solution_id      1 
_pdbx_nmr_sample_details.solvent_system   '90% H2O/10% D2O' 
_pdbx_nmr_spectrometer.field_strength    600 
_pdbx_nmr_spectrometer.manufacturer      Varian 
_pdbx_nmr_spectrometer.model             INOVA 
_pdbx_nmr_spectrometer.spectrometer_id   1 
_pdbx_nmr_spectrometer.type              'Varian INOVA' 
_pdbx_nmr_refine.entry_id           2K1N 
_pdbx_nmr_refine.method             'simulated annealing' 
_pdbx_nmr_refine.details            ? 
_pdbx_nmr_refine.software_ordinal   1 
_pdbx_nmr_ensemble.average_constraint_violations_per_residue     ? 
_pdbx_nmr_ensemble.average_constraints_per_residue               ? 
_pdbx_nmr_ensemble.average_distance_constraint_violation         ? 
_pdbx_nmr_ensemble.average_torsion_angle_constraint_violation    ? 
_pdbx_nmr_ensemble.conformer_selection_criteria                  'structures with the lowest energy' 
_pdbx_nmr_ensemble.conformers_calculated_total_number            200 
_pdbx_nmr_ensemble.conformers_submitted_total_number             10 
_pdbx_nmr_ensemble.distance_constraint_violation_method          ? 
_pdbx_nmr_ensemble.entry_id                                      2K1N 
_pdbx_nmr_ensemble.maximum_distance_constraint_violation         ? 
_pdbx_nmr_ensemble.maximum_lower_distance_constraint_violation   ? 
_pdbx_nmr_ensemble.maximum_torsion_angle_constraint_violation    ? 
_pdbx_nmr_ensemble.maximum_upper_distance_constraint_violation   ? 
_pdbx_nmr_ensemble.torsion_angle_constraint_violation_method     ? 
_pdbx_nmr_representative.conformer_id         1 
_pdbx_nmr_representative.entry_id             2K1N 
_pdbx_nmr_representative.selection_criteria   'lowest energy' 
'Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax'         processing      NMRPipe ?   1 
'Johnson, One Moon Scientific'                              'data analysis' NMRView ?   2 
'Cyril Dominguez, Rolf Boelens and Alexandre M.J.J. Bonvin' refinement      HADDOCK 1.3 3 
_exptl.absorpt_coefficient_mu     ? 
_exptl.absorpt_correction_T_max   ? 
_exptl.absorpt_correction_T_min   ? 
_exptl.absorpt_correction_type    ? 
_exptl.absorpt_process_details    ? 
_exptl.crystals_number            ? 
_exptl.details                    'N-terminal domain of the Transition State Regulator AbrB bound to a DNA target (abrB8)' 
_exptl.entry_id                   2K1N 
_exptl.method                     'SOLUTION NMR' 
_exptl.method_details             ? 
_struct.entry_id                  2K1N 
_struct.title                     'DNA bound structure of the N-terminal domain of AbrB' 
_struct.pdbx_descriptor           'Transition state regulatory protein abrB/DNA Complex' 
_struct.pdbx_model_details        'N-terminal domain of the Transition State Regulator AbrB bound to a DNA target (abrB8)' 
_struct.pdbx_CASP_flag            ? 
_struct.pdbx_model_type_details   ? 
_struct_keywords.entry_id        2K1N 
_struct_keywords.pdbx_keywords   TRANSCRIPTION/DNA 
;AbrB, abrB8, DNA bound, Transition State Regulator, DNA binding protein, Activator, DNA-binding, Repressor, Sporulation, Transcription, Transcription regulation, TRANSCRIPTION-DNA COMPLEX
A N N 1 ? 
B N N 2 ? 
C N N 3 ? 
D N N 3 ? 
E N N 3 ? 
F N N 3 ? 
#        1 
_struct_biol.details   ? 
HELX_P HELX_P1 1 PRO C 19 ? GLY C 27 ? PRO A 19 GLY A 27 1 ? 9 
HELX_P HELX_P2 2 LYS C 49 ? THR C 53 ? LYS A 49 THR A 53 5 ? 5 
HELX_P HELX_P3 3 PRO D 19 ? LEU D 26 ? PRO B 19 LEU B 26 1 ? 8 
HELX_P HELX_P4 4 PRO E 19 ? GLY E 27 ? PRO C 19 GLY C 27 1 ? 9 
HELX_P HELX_P5 5 PRO F 19 ? GLY F 27 ? PRO D 19 GLY D 27 1 ? 9 
#          HELX_P 
_struct_conf_type.criteria    ? 
_struct_conf_type.reference   ? 
disulf1  disulf ? ? C CYS 54 SG ? ? ? 1_555 E CYS 54 SG ? ? A CYS 54 C CYS 54 1_555 ? ? ? ? ? ? ?            2.032 ? 
disulf2  disulf ? ? D CYS 54 SG ? ? ? 1_555 F CYS 54 SG ? ? B CYS 54 D CYS 54 1_555 ? ? ? ? ? ? ?            2.033 ? 
hydrog1  hydrog ? ? A DA  1  N1 ? ? ? 1_555 B DT  25 N3 ? ? E DA  1  F DT  25 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog2  hydrog ? ? A DA  1  N6 ? ? ? 1_555 B DT  25 O4 ? ? E DA  1  F DT  25 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog3  hydrog ? ? A DT  2  N3 ? ? ? 1_555 B DA  24 N1 ? ? E DT  2  F DA  24 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog4  hydrog ? ? A DT  2  O4 ? ? ? 1_555 B DA  24 N6 ? ? E DT  2  F DA  24 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog5  hydrog ? ? A DG  3  N1 ? ? ? 1_555 B DC  23 N3 ? ? E DG  3  F DC  23 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog6  hydrog ? ? A DG  3  N2 ? ? ? 1_555 B DC  23 O2 ? ? E DG  3  F DC  23 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog7  hydrog ? ? A DG  3  O6 ? ? ? 1_555 B DC  23 N4 ? ? E DG  3  F DC  23 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog8  hydrog ? ? A DA  4  N1 ? ? ? 1_555 B DT  22 N3 ? ? E DA  4  F DT  22 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog9  hydrog ? ? A DA  4  N6 ? ? ? 1_555 B DT  22 O4 ? ? E DA  4  F DT  22 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog10 hydrog ? ? A DT  5  N3 ? ? ? 1_555 B DA  21 N1 ? ? E DT  5  F DA  21 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog11 hydrog ? ? A DT  5  O4 ? ? ? 1_555 B DA  21 N6 ? ? E DT  5  F DA  21 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog12 hydrog ? ? A DT  6  N3 ? ? ? 1_555 B DA  20 N1 ? ? E DT  6  F DA  20 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog13 hydrog ? ? A DT  6  O4 ? ? ? 1_555 B DA  20 N6 ? ? E DT  6  F DA  20 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog14 hydrog ? ? A DG  7  N1 ? ? ? 1_555 B DC  19 N3 ? ? E DG  7  F DC  19 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog15 hydrog ? ? A DG  7  N2 ? ? ? 1_555 B DC  19 O2 ? ? E DG  7  F DC  19 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog16 hydrog ? ? A DG  7  O6 ? ? ? 1_555 B DC  19 N4 ? ? E DG  7  F DC  19 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog17 hydrog ? ? A DA  8  N1 ? ? ? 1_555 B DT  18 N3 ? ? E DA  8  F DT  18 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog18 hydrog ? ? A DA  8  N6 ? ? ? 1_555 B DT  18 O4 ? ? E DA  8  F DT  18 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog19 hydrog ? ? A DC  9  N3 ? ? ? 1_555 B DG  17 N1 ? ? E DC  9  F DG  17 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog20 hydrog ? ? A DC  9  N4 ? ? ? 1_555 B DG  17 O6 ? ? E DC  9  F DG  17 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog21 hydrog ? ? A DC  9  O2 ? ? ? 1_555 B DG  17 N2 ? ? E DC  9  F DG  17 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog22 hydrog ? ? A DA  10 N1 ? ? ? 1_555 B DT  16 N3 ? ? E DA  10 F DT  16 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog23 hydrog ? ? A DA  10 N6 ? ? ? 1_555 B DT  16 O4 ? ? E DA  10 F DT  16 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog24 hydrog ? ? A DA  11 N1 ? ? ? 1_555 B DT  15 N3 ? ? E DA  11 F DT  15 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog25 hydrog ? ? A DA  11 N6 ? ? ? 1_555 B DT  15 O4 ? ? E DA  11 F DT  15 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog26 hydrog ? ? A DT  12 N3 ? ? ? 1_555 B DA  14 N1 ? ? E DT  12 F DA  14 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog27 hydrog ? ? A DT  12 O4 ? ? ? 1_555 B DA  14 N6 ? ? E DT  12 F DA  14 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog28 hydrog ? ? A DT  13 N3 ? ? ? 1_555 B DA  13 N1 ? ? E DT  13 F DA  13 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog29 hydrog ? ? A DT  13 O4 ? ? ? 1_555 B DA  13 N6 ? ? E DT  13 F DA  13 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog30 hydrog ? ? A DA  14 N1 ? ? ? 1_555 B DT  12 N3 ? ? E DA  14 F DT  12 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog31 hydrog ? ? A DA  14 N6 ? ? ? 1_555 B DT  12 O4 ? ? E DA  14 F DT  12 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog32 hydrog ? ? A DT  15 N3 ? ? ? 1_555 B DA  11 N1 ? ? E DT  15 F DA  11 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog33 hydrog ? ? A DT  15 O4 ? ? ? 1_555 B DA  11 N6 ? ? E DT  15 F DA  11 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog34 hydrog ? ? A DT  16 N3 ? ? ? 1_555 B DA  10 N1 ? ? E DT  16 F DA  10 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog35 hydrog ? ? A DT  16 O4 ? ? ? 1_555 B DA  10 N6 ? ? E DT  16 F DA  10 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog36 hydrog ? ? A DG  17 N1 ? ? ? 1_555 B DC  9  N3 ? ? E DG  17 F DC  9  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog37 hydrog ? ? A DG  17 N2 ? ? ? 1_555 B DC  9  O2 ? ? E DG  17 F DC  9  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog38 hydrog ? ? A DG  17 O6 ? ? ? 1_555 B DC  9  N4 ? ? E DG  17 F DC  9  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog39 hydrog ? ? A DG  18 N1 ? ? ? 1_555 B DC  8  N3 ? ? E DG  18 F DC  8  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog40 hydrog ? ? A DG  18 N2 ? ? ? 1_555 B DC  8  O2 ? ? E DG  18 F DC  8  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog41 hydrog ? ? A DG  18 O6 ? ? ? 1_555 B DC  8  N4 ? ? E DG  18 F DC  8  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog42 hydrog ? ? A DA  19 N1 ? ? ? 1_555 B DT  7  N3 ? ? E DA  19 F DT  7  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog43 hydrog ? ? A DA  19 N6 ? ? ? 1_555 B DT  7  O4 ? ? E DA  19 F DT  7  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog44 hydrog ? ? A DA  20 N1 ? ? ? 1_555 B DT  6  N3 ? ? E DA  20 F DT  6  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog45 hydrog ? ? A DA  20 N6 ? ? ? 1_555 B DT  6  O4 ? ? E DA  20 F DT  6  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog46 hydrog ? ? A DA  21 N1 ? ? ? 1_555 B DT  5  N3 ? ? E DA  21 F DT  5  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog47 hydrog ? ? A DA  21 N6 ? ? ? 1_555 B DT  5  O4 ? ? E DA  21 F DT  5  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog48 hydrog ? ? A DC  22 N3 ? ? ? 1_555 B DG  4  N1 ? ? E DC  22 F DG  4  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog49 hydrog ? ? A DC  22 N4 ? ? ? 1_555 B DG  4  O6 ? ? E DC  22 F DG  4  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog50 hydrog ? ? A DC  22 O2 ? ? ? 1_555 B DG  4  N2 ? ? E DC  22 F DG  4  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog51 hydrog ? ? A DC  23 N3 ? ? ? 1_555 B DG  3  N1 ? ? E DC  23 F DG  3  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog52 hydrog ? ? A DC  23 N4 ? ? ? 1_555 B DG  3  O6 ? ? E DC  23 F DG  3  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog53 hydrog ? ? A DC  23 O2 ? ? ? 1_555 B DG  3  N2 ? ? E DC  23 F DG  3  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog54 hydrog ? ? A DT  24 N3 ? ? ? 1_555 B DA  2  N1 ? ? E DT  24 F DA  2  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog55 hydrog ? ? A DT  24 O4 ? ? ? 1_555 B DA  2  N6 ? ? E DT  24 F DA  2  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog56 hydrog ? ? A DT  25 N3 ? ? ? 1_555 B DA  1  N1 ? ? E DT  25 F DA  1  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog57 hydrog ? ? A DT  25 O4 ? ? ? 1_555 B DA  1  N6 ? ? E DT  25 F DA  1  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
disulf ? ? 
hydrog ? ? 
A ? 6 ? 
B ? 6 ? 
A 1 2 ? anti-parallel 
A 2 3 ? anti-parallel 
A 3 4 ? anti-parallel 
A 4 5 ? anti-parallel 
A 5 6 ? anti-parallel 
B 1 2 ? anti-parallel 
B 2 3 ? anti-parallel 
B 3 4 ? anti-parallel 
B 4 5 ? anti-parallel 
B 5 6 ? anti-parallel 
A 1 ILE C 6  ? LYS C 9  ? ILE A 6  LYS A 9  
A 2 ALA D 33 ? ASP D 39 ? ALA B 33 ASP B 39 
A 3 LYS D 42 ? LYS D 47 ? LYS B 42 LYS B 47 
A 4 LYS C 42 ? LYS C 46 ? LYS A 42 LYS A 46 
A 5 ALA C 33 ? ASP C 39 ? ALA A 33 ASP A 39 
A 6 ILE D 6  ? LYS D 9  ? ILE B 6  LYS B 9  
B 1 ILE E 6  ? LYS E 9  ? ILE C 6  LYS C 9  
B 2 ALA F 33 ? ASP F 39 ? ALA D 33 ASP D 39 
B 3 LYS F 42 ? LYS F 46 ? LYS D 42 LYS D 46 
B 4 LYS E 42 ? LYS E 46 ? LYS C 42 LYS C 46 
B 5 ALA E 33 ? ASP E 39 ? ALA C 33 ASP C 39 
B 6 THR F 4  ? LYS F 9  ? THR D 4  LYS D 9  
A 1 2 N ILE C 6  ? N ILE A 6  O ILE D 36 ? O ILE B 36 
A 2 3 N TYR D 37 ? N TYR B 37 O ILE D 44 ? O ILE B 44 
A 3 4 O LEU D 45 ? O LEU B 45 N ILE C 43 ? N ILE A 43 
A 4 5 O LYS C 42 ? O LYS A 42 N ASP C 39 ? N ASP A 39 
A 5 6 N LEU C 34 ? N LEU A 34 O ARG D 8  ? O ARG B 8  
B 1 2 N ILE E 6  ? N ILE C 6  O ILE F 36 ? O ILE D 36 
B 2 3 N TYR F 37 ? N TYR D 37 O ILE F 44 ? O ILE D 44 
B 3 4 O ILE F 43 ? O ILE D 43 N LEU E 45 ? N LEU C 45 
B 4 5 O ILE E 44 ? O ILE C 44 N TYR E 37 ? N TYR C 37 
B 5 6 N ILE E 36 ? N ILE C 36 O ILE F 6  ? O ILE D 6  
_atom_sites.entry_id                    2K1N 
_atom_sites.fract_transf_matrix[1][1]   1.000000 
_atom_sites.fract_transf_matrix[1][2]   0.000000 
_atom_sites.fract_transf_matrix[1][3]   0.000000 
_atom_sites.fract_transf_matrix[2][1]   0.000000 
_atom_sites.fract_transf_matrix[2][2]   1.000000 
_atom_sites.fract_transf_matrix[2][3]   0.000000 
_atom_sites.fract_transf_matrix[3][1]   0.000000 
_atom_sites.fract_transf_matrix[3][2]   0.000000 
_atom_sites.fract_transf_matrix[3][3]   1.000000 
_atom_sites.fract_transf_vector[1]      0.00000 
_atom_sites.fract_transf_vector[2]      0.00000 
_atom_sites.fract_transf_vector[3]      0.00000 
ATOM 1     O "O5'"  . DA  A 1 1  ? 40.301  20.816  1.132   1.00 4.09  ? 1  DA  E "O5'"  1  
ATOM 2     C "C5'"  . DA  A 1 1  ? 41.306  20.933  0.120   1.00 4.09  ? 1  DA  E "C5'"  1  
ATOM 3     C "C4'"  . DA  A 1 1  ? 40.936  20.120  -1.097  1.00 4.00  ? 1  DA  E "C4'"  1  
ATOM 4     O "O4'"  . DA  A 1 1  ? 41.042  18.717  -0.756  1.00 3.96  ? 1  DA  E "O4'"  1  
ATOM 5     C "C3'"  . DA  A 1 1  ? 39.493  20.305  -1.560  1.00 3.93  ? 1  DA  E "C3'"  1  
ATOM 6     O "O3'"  . DA  A 1 1  ? 39.358  19.964  -2.941  1.00 3.91  ? 1  DA  E "O3'"  1  
ATOM 7     C "C2'"  . DA  A 1 1  ? 38.744  19.293  -0.720  1.00 3.85  ? 1  DA  E "C2'"  1  
ATOM 8     C "C1'"  . DA  A 1 1  ? 39.746  18.148  -0.617  1.00 3.87  ? 1  DA  E "C1'"  1  
ATOM 9     N N9     . DA  A 1 1  ? 39.704  17.403  0.641   1.00 3.89  ? 1  DA  E N9     1  
ATOM 10    C C8     . DA  A 1 1  ? 39.444  17.877  1.905   1.00 3.95  ? 1  DA  E C8     1  
ATOM 11    N N7     . DA  A 1 1  ? 39.460  16.948  2.831   1.00 3.99  ? 1  DA  E N7     1  
ATOM 12    C C5     . DA  A 1 1  ? 39.756  15.785  2.132   1.00 3.95  ? 1  DA  E C5     1  
ATOM 13    C C6     . DA  A 1 1  ? 39.916  14.448  2.542   1.00 3.99  ? 1  DA  E C6     1  
ATOM 14    N N6     . DA  A 1 1  ? 39.791  14.041  3.807   1.00 4.09  ? 1  DA  E N6     1  
ATOM 15    N N1     . DA  A 1 1  ? 40.211  13.532  1.594   1.00 3.97  ? 1  DA  E N1     1  
ATOM 16    C C2     . DA  A 1 1  ? 40.333  13.940  0.325   1.00 3.91  ? 1  DA  E C2     1  
ATOM 17    N N3     . DA  A 1 1  ? 40.203  15.165  -0.183  1.00 3.87  ? 1  DA  E N3     1  
ATOM 18    C C4     . DA  A 1 1  ? 39.912  16.051  0.784   1.00 3.89  ? 1  DA  E C4     1  
ATOM 19    H "H5'"  . DA  A 1 1  ? 42.260  20.576  0.509   1.00 4.15  ? 1  DA  E "H5'"  1  
ATOM 20    H "H5''" . DA  A 1 1  ? 41.409  21.978  -0.171  1.00 4.15  ? 1  DA  E "H5''" 1  
ATOM 21    H "H4'"  . DA  A 1 1  ? 41.583  20.421  -1.922  1.00 4.05  ? 1  DA  E "H4'"  1  
ATOM 22    H "H3'"  . DA  A 1 1  ? 39.145  21.326  -1.396  1.00 3.97  ? 1  DA  E "H3'"  1  
ATOM 23    H "H2'"  . DA  A 1 1  ? 38.483  19.701  0.256   1.00 3.88  ? 1  DA  E "H2'"  1  
ATOM 24    H "H2''" . DA  A 1 1  ? 37.824  18.984  -1.206  1.00 3.78  ? 1  DA  E "H2''" 1  
ATOM 25    H "H1'"  . DA  A 1 1  ? 39.604  17.444  -1.439  1.00 3.83  ? 1  DA  E "H1'"  1  
ATOM 26    H H8     . DA  A 1 1  ? 39.245  18.917  2.117   1.00 3.99  ? 1  DA  E H8     1  
ATOM 27    H H61    . DA  A 1 1  ? 39.566  14.712  4.530   1.00 4.13  ? 1  DA  E H61    1  
ATOM 28    H H62    . DA  A 1 1  ? 39.927  13.068  4.043   1.00 4.14  ? 1  DA  E H62    1  
ATOM 29    H H2     . DA  A 1 1  ? 40.574  13.159  -0.394  1.00 3.93  ? 1  DA  E H2     1  
ATOM 30    H "HO5'" . DA  A 1 1  ? 40.651  21.229  1.926   1.00 4.25  ? 1  DA  E "HO5'" 1  
ATOM 31    P P      . DT  A 1 2  ? 38.191  20.638  -3.827  1.00 3.90  ? 2  DT  E P      1  
ATOM 32    O OP1    . DT  A 1 2  ? 38.753  21.771  -4.606  1.00 4.01  ? 2  DT  E OP1    1  
ATOM 33    O OP2    . DT  A 1 2  ? 37.016  20.865  -2.948  1.00 3.83  ? 2  DT  E OP2    1  
ATOM 34    O "O5'"  . DT  A 1 2  ? 37.827  19.472  -4.848  1.00 3.87  ? 2  DT  E "O5'"  1  
ATOM 35    C "C5'"  . DT  A 1 2  ? 38.616  18.283  -4.885  1.00 3.88  ? 2  DT  E "C5'"  1  
ATOM 36    C "C4'"  . DT  A 1 2  ? 37.777  17.089  -5.279  1.00 3.85  ? 2  DT  E "C4'"  1  
ATOM 37    O "O4'"  . DT  A 1 2  ? 37.544  16.270  -4.108  1.00 3.78  ? 2  DT  E "O4'"  1  
ATOM 38    C "C3'"  . DT  A 1 2  ? 36.380  17.436  -5.789  1.00 3.81  ? 2  DT  E "C3'"  1  
ATOM 39    O "O3'"  . DT  A 1 2  ? 35.908  16.354  -6.591  1.00 3.84  ? 2  DT  E "O3'"  1  
ATOM 40    C "C2'"  . DT  A 1 2  ? 35.559  17.513  -4.516  1.00 3.70  ? 2  DT  E "C2'"  1  
ATOM 41    C "C1'"  . DT  A 1 2  ? 36.193  16.410  -3.676  1.00 3.69  ? 2  DT  E "C1'"  1  
ATOM 42    N N1     . DT  A 1 2  ? 36.183  16.589  -2.207  1.00 3.65  ? 2  DT  E N1     1  
ATOM 43    C C2     . DT  A 1 2  ? 36.385  15.456  -1.450  1.00 3.65  ? 2  DT  E C2     1  
ATOM 44    O O2     . DT  A 1 2  ? 36.587  14.356  -1.940  1.00 3.68  ? 2  DT  E O2     1  
ATOM 45    N N3     . DT  A 1 2  ? 36.340  15.653  -0.097  1.00 3.66  ? 2  DT  E N3     1  
ATOM 46    C C4     . DT  A 1 2  ? 36.119  16.842  0.564   1.00 3.67  ? 2  DT  E C4     1  
ATOM 47    O O4     . DT  A 1 2  ? 36.093  16.861  1.792   1.00 3.71  ? 2  DT  E O4     1  
ATOM 48    C C5     . DT  A 1 2  ? 35.918  17.994  -0.288  1.00 3.67  ? 2  DT  E C5     1  
ATOM 49    C C7     . DT  A 1 2  ? 35.642  19.322  0.343   1.00 3.71  ? 2  DT  E C7     1  
ATOM 50    C C6     . DT  A 1 2  ? 35.963  17.818  -1.618  1.00 3.66  ? 2  DT  E C6     1  
ATOM 51    H "H5'"  . DT  A 1 2  ? 39.051  18.103  -3.901  1.00 3.86  ? 2  DT  E "H5'"  1  
ATOM 52    H "H5''" . DT  A 1 2  ? 39.421  18.406  -5.610  1.00 3.97  ? 2  DT  E "H5''" 1  
ATOM 53    H "H4'"  . DT  A 1 2  ? 38.293  16.562  -6.084  1.00 3.93  ? 2  DT  E "H4'"  1  
ATOM 54    H "H3'"  . DT  A 1 2  ? 36.368  18.361  -6.363  1.00 3.87  ? 2  DT  E "H3'"  1  
ATOM 55    H "H2'"  . DT  A 1 2  ? 35.648  18.493  -4.050  1.00 3.70  ? 2  DT  E "H2'"  1  
ATOM 56    H "H2''" . DT  A 1 2  ? 34.503  17.344  -4.717  1.00 3.66  ? 2  DT  E "H2''" 1  
ATOM 57    H "H1'"  . DT  A 1 2  ? 35.698  15.461  -3.891  1.00 3.68  ? 2  DT  E "H1'"  1  
ATOM 58    H H3     . DT  A 1 2  ? 36.473  14.832  0.477   1.00 3.69  ? 2  DT  E H3     1  
ATOM 59    H H71    . DT  A 1 2  ? 36.435  20.022  0.081   1.00 3.72  ? 2  DT  E H71    1  
ATOM 60    H H72    . DT  A 1 2  ? 35.599  19.209  1.427   1.00 3.79  ? 2  DT  E H72    1  
ATOM 61    H H73    . DT  A 1 2  ? 34.688  19.705  -0.019  1.00 3.98  ? 2  DT  E H73    1  
ATOM 62    H H6     . DT  A 1 2  ? 35.821  18.687  -2.260  1.00 3.69  ? 2  DT  E H6     1  
ATOM 63    P P      . DG  A 1 3  ? 34.797  16.600  -7.719  1.00 3.88  ? 3  DG  E P      1  
ATOM 64    O OP1    . DG  A 1 3  ? 35.462  16.964  -8.996  1.00 4.05  ? 3  DG  E OP1    1  
ATOM 65    O OP2    . DG  A 1 3  ? 33.748  17.491  -7.158  1.00 3.77  ? 3  DG  E OP2    1  
ATOM 66    O "O5'"  . DG  A 1 3  ? 34.182  15.140  -7.887  1.00 3.91  ? 3  DG  E "O5'"  1  
ATOM 67    C "C5'"  . DG  A 1 3  ? 35.054  14.024  -8.058  1.00 3.87  ? 3  DG  E "C5'"  1  
ATOM 68    C "C4'"  . DG  A 1 3  ? 34.483  12.773  -7.427  1.00 3.85  ? 3  DG  E "C4'"  1  
ATOM 69    O "O4'"  . DG  A 1 3  ? 34.517  12.906  -5.985  1.00 3.72  ? 3  DG  E "O4'"  1  
ATOM 70    C "C3'"  . DG  A 1 3  ? 33.011  12.536  -7.755  1.00 3.85  ? 3  DG  E "C3'"  1  
ATOM 71    O "O3'"  . DG  A 1 3  ? 32.730  11.147  -7.577  1.00 3.91  ? 3  DG  E "O3'"  1  
ATOM 72    C "C2'"  . DG  A 1 3  ? 32.283  13.329  -6.686  1.00 3.69  ? 3  DG  E "C2'"  1  
ATOM 73    C "C1'"  . DG  A 1 3  ? 33.198  13.116  -5.487  1.00 3.63  ? 3  DG  E "C1'"  1  
ATOM 74    N N9     . DG  A 1 3  ? 33.222  14.173  -4.482  1.00 3.54  ? 3  DG  E N9     1  
ATOM 75    C C8     . DG  A 1 3  ? 33.154  15.531  -4.669  1.00 3.53  ? 3  DG  E C8     1  
ATOM 76    N N7     . DG  A 1 3  ? 33.156  16.206  -3.550  1.00 3.49  ? 3  DG  E N7     1  
ATOM 77    C C5     . DG  A 1 3  ? 33.234  15.232  -2.561  1.00 3.46  ? 3  DG  E C5     1  
ATOM 78    C C6     . DG  A 1 3  ? 33.271  15.352  -1.139  1.00 3.46  ? 3  DG  E C6     1  
ATOM 79    O O6     . DG  A 1 3  ? 33.239  16.376  -0.444  1.00 3.47  ? 3  DG  E O6     1  
ATOM 80    N N1     . DG  A 1 3  ? 33.349  14.105  -0.524  1.00 3.48  ? 3  DG  E N1     1  
ATOM 81    C C2     . DG  A 1 3  ? 33.394  12.902  -1.183  1.00 3.51  ? 3  DG  E C2     1  
ATOM 82    N N2     . DG  A 1 3  ? 33.475  11.804  -0.415  1.00 3.58  ? 3  DG  E N2     1  
ATOM 83    N N3     . DG  A 1 3  ? 33.364  12.778  -2.500  1.00 3.53  ? 3  DG  E N3     1  
ATOM 84    C C4     . DG  A 1 3  ? 33.284  13.976  -3.121  1.00 3.50  ? 3  DG  E C4     1  
ATOM 85    H "H5'"  . DG  A 1 3  ? 36.017  14.245  -7.597  1.00 3.75  ? 3  DG  E "H5'"  1  
ATOM 86    H "H5''" . DG  A 1 3  ? 35.206  13.843  -9.121  1.00 4.01  ? 3  DG  E "H5''" 1  
ATOM 87    H "H4'"  . DG  A 1 3  ? 35.042  11.914  -7.805  1.00 3.94  ? 3  DG  E "H4'"  1  
ATOM 88    H "H3'"  . DG  A 1 3  ? 32.756  12.845  -8.768  1.00 3.94  ? 3  DG  E "H3'"  1  
ATOM 89    H "H2'"  . DG  A 1 3  ? 32.205  14.379  -6.963  1.00 3.68  ? 3  DG  E "H2'"  1  
ATOM 90    H "H2''" . DG  A 1 3  ? 31.272  12.958  -6.540  1.00 3.67  ? 3  DG  E "H2''" 1  
ATOM 91    H "H1'"  . DG  A 1 3  ? 32.913  12.192  -4.977  1.00 3.62  ? 3  DG  E "H1'"  1  
ATOM 92    H H8     . DG  A 1 3  ? 33.102  15.993  -5.642  1.00 3.59  ? 3  DG  E H8     1  
ATOM 93    H H1     . DG  A 1 3  ? 33.376  14.086  0.488   1.00 3.51  ? 3  DG  E H1     1  
ATOM 94    H H21    . DG  A 1 3  ? 33.511  10.895  -0.856  1.00 3.63  ? 3  DG  E H21    1  
ATOM 95    H H22    . DG  A 1 3  ? 33.490  11.877  0.594   1.00 3.60  ? 3  DG  E H22    1  
ATOM 96    P P      . DA  A 1 4  ? 31.500  10.458  -8.337  1.00 4.02  ? 4  DA  E P      1  
ATOM 97    O OP1    . DA  A 1 4  ? 31.986  9.799   -9.576  1.00 4.23  ? 4  DA  E OP1    1  
ATOM 98    O OP2    . DA  A 1 4  ? 30.389  11.441  -8.416  1.00 3.94  ? 4  DA  E OP2    1  
ATOM 99    O "O5'"  . DA  A 1 4  ? 31.086  9.316   -7.305  1.00 4.02  ? 4  DA  E "O5'"  1  
ATOM 100   C "C5'"  . DA  A 1 4  ? 32.067  8.796   -6.405  1.00 4.12  ? 4  DA  E "C5'"  1  
ATOM 101   C "C4'"  . DA  A 1 4  ? 31.429  8.182   -5.178  1.00 4.06  ? 4  DA  E "C4'"  1  
ATOM 102   O "O4'"  . DA  A 1 4  ? 31.380  9.176   -4.124  1.00 3.92  ? 4  DA  E "O4'"  1  
ATOM 103   C "C3'"  . DA  A 1 4  ? 29.977  7.740   -5.344  1.00 4.01  ? 4  DA  E "C3'"  1  
ATOM 104   O "O3'"  . DA  A 1 4  ? 29.685  6.756   -4.352  1.00 4.04  ? 4  DA  E "O3'"  1  
ATOM 105   C "C2'"  . DA  A 1 4  ? 29.195  9.001   -5.034  1.00 3.84  ? 4  DA  E "C2'"  1  
ATOM 106   C "C1'"  . DA  A 1 4  ? 30.043  9.632   -3.940  1.00 3.79  ? 4  DA  E "C1'"  1  
ATOM 107   N N9     . DA  A 1 4  ? 30.038  11.096  -3.891  1.00 3.68  ? 4  DA  E N9     1  
ATOM 108   C C8     . DA  A 1 4  ? 30.023  11.999  -4.922  1.00 3.67  ? 4  DA  E C8     1  
ATOM 109   N N7     . DA  A 1 4  ? 29.983  13.251  -4.529  1.00 3.58  ? 4  DA  E N7     1  
ATOM 110   C C5     . DA  A 1 4  ? 29.974  13.166  -3.143  1.00 3.52  ? 4  DA  E C5     1  
ATOM 111   C C6     . DA  A 1 4  ? 29.933  14.146  -2.128  1.00 3.46  ? 4  DA  E C6     1  
ATOM 112   N N6     . DA  A 1 4  ? 29.886  15.460  -2.362  1.00 3.44  ? 4  DA  E N6     1  
ATOM 113   N N1     . DA  A 1 4  ? 29.940  13.720  -0.846  1.00 3.47  ? 4  DA  E N1     1  
ATOM 114   C C2     . DA  A 1 4  ? 29.981  12.402  -0.607  1.00 3.54  ? 4  DA  E C2     1  
ATOM 115   N N3     . DA  A 1 4  ? 30.020  11.390  -1.472  1.00 3.60  ? 4  DA  E N3     1  
ATOM 116   C C4     . DA  A 1 4  ? 30.015  11.845  -2.737  1.00 3.58  ? 4  DA  E C4     1  
ATOM 117   H "H5'"  . DA  A 1 4  ? 32.730  9.602   -6.091  1.00 4.16  ? 4  DA  E "H5'"  1  
ATOM 118   H "H5''" . DA  A 1 4  ? 32.657  8.034   -6.913  1.00 4.28  ? 4  DA  E "H5''" 1  
ATOM 119   H "H4'"  . DA  A 1 4  ? 32.004  7.294   -4.909  1.00 4.16  ? 4  DA  E "H4'"  1  
ATOM 120   H "H3'"  . DA  A 1 4  ? 29.776  7.342   -6.337  1.00 4.10  ? 4  DA  E "H3'"  1  
ATOM 121   H "H2'"  . DA  A 1 4  ? 29.109  9.640   -5.913  1.00 3.84  ? 4  DA  E "H2'"  1  
ATOM 122   H "H2''" . DA  A 1 4  ? 28.186  8.766   -4.700  1.00 3.78  ? 4  DA  E "H2''" 1  
ATOM 123   H "H1'"  . DA  A 1 4  ? 29.716  9.267   -2.964  1.00 3.77  ? 4  DA  E "H1'"  1  
ATOM 124   H H8     . DA  A 1 4  ? 30.037  11.707  -5.962  1.00 3.76  ? 4  DA  E H8     1  
ATOM 125   H H61    . DA  A 1 4  ? 29.879  15.790  -3.317  1.00 3.46  ? 4  DA  E H61    1  
ATOM 126   H H62    . DA  A 1 4  ? 29.853  16.119  -1.599  1.00 3.42  ? 4  DA  E H62    1  
ATOM 127   H H2     . DA  A 1 4  ? 29.980  12.118  0.446   1.00 3.58  ? 4  DA  E H2     1  
ATOM 128   P P      . DT  A 1 5  ? 28.470  5.727   -4.554  1.00 4.10  ? 5  DT  E P      1  
ATOM 129   O OP1    . DT  A 1 5  ? 28.979  4.446   -5.105  1.00 4.31  ? 5  DT  E OP1    1  
ATOM 130   O OP2    . DT  A 1 5  ? 27.353  6.428   -5.237  1.00 4.01  ? 5  DT  E OP2    1  
ATOM 131   O "O5'"  . DT  A 1 5  ? 28.042  5.464   -3.042  1.00 4.05  ? 5  DT  E "O5'"  1  
ATOM 132   C "C5'"  . DT  A 1 5  ? 28.973  5.748   -1.997  1.00 4.03  ? 5  DT  E "C5'"  1  
ATOM 133   C "C4'"  . DT  A 1 5  ? 28.279  5.898   -0.663  1.00 3.97  ? 5  DT  E "C4'"  1  
ATOM 134   O "O4'"  . DT  A 1 5  ? 28.160  7.310   -0.354  1.00 3.80  ? 5  DT  E "O4'"  1  
ATOM 135   C "C3'"  . DT  A 1 5  ? 26.844  5.378   -0.637  1.00 3.95  ? 5  DT  E "C3'"  1  
ATOM 136   O "O3'"  . DT  A 1 5  ? 26.482  5.096   0.712   1.00 3.98  ? 5  DT  E "O3'"  1  
ATOM 137   C "C2'"  . DT  A 1 5  ? 26.037  6.566   -1.120  1.00 3.75  ? 5  DT  E "C2'"  1  
ATOM 138   C "C1'"  . DT  A 1 5  ? 26.807  7.729   -0.508  1.00 3.67  ? 5  DT  E "C1'"  1  
ATOM 139   N N1     . DT  A 1 5  ? 26.768  9.011   -1.251  1.00 3.55  ? 5  DT  E N1     1  
ATOM 140   C C2     . DT  A 1 5  ? 26.774  10.162  -0.490  1.00 3.45  ? 5  DT  E C2     1  
ATOM 141   O O2     . DT  A 1 5  ? 26.876  10.156  0.727   1.00 3.47  ? 5  DT  E O2     1  
ATOM 142   N N3     . DT  A 1 5  ? 26.655  11.323  -1.203  1.00 3.36  ? 5  DT  E N3     1  
ATOM 143   C C4     . DT  A 1 5  ? 26.545  11.456  -2.569  1.00 3.38  ? 5  DT  E C4     1  
ATOM 144   O O4     . DT  A 1 5  ? 26.402  12.574  -3.063  1.00 3.33  ? 5  DT  E O4     1  
ATOM 145   C C5     . DT  A 1 5  ? 26.571  10.213  -3.315  1.00 3.49  ? 5  DT  E C5     1  
ATOM 146   C C7     . DT  A 1 5  ? 26.375  10.262  -4.799  1.00 3.56  ? 5  DT  E C7     1  
ATOM 147   C C6     . DT  A 1 5  ? 26.692  9.062   -2.630  1.00 3.57  ? 5  DT  E C6     1  
ATOM 148   H "H5'"  . DT  A 1 5  ? 29.503  6.673   -2.227  1.00 3.95  ? 5  DT  E "H5'"  1  
ATOM 149   H "H5''" . DT  A 1 5  ? 29.697  4.936   -1.925  1.00 4.18  ? 5  DT  E "H5''" 1  
ATOM 150   H "H4'"  . DT  A 1 5  ? 28.843  5.333   0.081   1.00 4.08  ? 5  DT  E "H4'"  1  
ATOM 151   H "H3'"  . DT  A 1 5  ? 26.714  4.490   -1.253  1.00 4.05  ? 5  DT  E "H3'"  1  
ATOM 152   H "H2'"  . DT  A 1 5  ? 26.013  6.612   -2.207  1.00 3.76  ? 5  DT  E "H2'"  1  
ATOM 153   H "H2''" . DT  A 1 5  ? 25.007  6.507   -0.772  1.00 3.70  ? 5  DT  E "H2''" 1  
ATOM 154   H "H1'"  . DT  A 1 5  ? 26.426  7.926   0.498   1.00 3.65  ? 5  DT  E "H1'"  1  
ATOM 155   H H3     . DT  A 1 5  ? 26.623  12.177  -0.663  1.00 3.31  ? 5  DT  E H3     1  
ATOM 156   H H71    . DT  A 1 5  ? 27.230  10.753  -5.264  1.00 3.50  ? 5  DT  E H71    1  
ATOM 157   H H72    . DT  A 1 5  ? 26.283  9.248   -5.190  1.00 3.89  ? 5  DT  E H72    1  
ATOM 158   H H73    . DT  A 1 5  ? 25.468  10.821  -5.028  1.00 3.66  ? 5  DT  E H73    1  
ATOM 159   H H6     . DT  A 1 5  ? 26.739  8.127   -3.188  1.00 3.68  ? 5  DT  E H6     1  
ATOM 160   P P      . DT  A 1 6  ? 25.278  4.086   1.043   1.00 4.05  ? 6  DT  E P      1  
ATOM 161   O OP1    . DT  A 1 6  ? 25.832  2.741   1.333   1.00 4.28  ? 6  DT  E OP1    1  
ATOM 162   O OP2    . DT  A 1 6  ? 24.229  4.243   0.001   1.00 3.94  ? 6  DT  E OP2    1  
ATOM 163   O "O5'"  . DT  A 1 6  ? 24.739  4.722   2.398   1.00 3.99  ? 6  DT  E "O5'"  1  
ATOM 164   C "C5'"  . DT  A 1 6  ? 25.531  5.713   3.056   1.00 3.96  ? 6  DT  E "C5'"  1  
ATOM 165   C "C4'"  . DT  A 1 6  ? 24.694  6.566   3.981   1.00 3.86  ? 6  DT  E "C4'"  1  
ATOM 166   O "O4'"  . DT  A 1 6  ? 24.530  7.876   3.387   1.00 3.65  ? 6  DT  E "O4'"  1  
ATOM 167   C "C3'"  . DT  A 1 6  ? 23.272  6.064   4.208   1.00 3.87  ? 6  DT  E "C3'"  1  
ATOM 168   O "O3'"  . DT  A 1 6  ? 22.806  6.606   5.444   1.00 3.87  ? 6  DT  E "O3'"  1  
ATOM 169   C "C2'"  . DT  A 1 6  ? 22.508  6.677   3.049   1.00 3.69  ? 6  DT  E "C2'"  1  
ATOM 170   C "C1'"  . DT  A 1 6  ? 23.203  8.029   2.901   1.00 3.54  ? 6  DT  E "C1'"  1  
ATOM 171   N N1     . DT  A 1 6  ? 23.257  8.613   1.540   1.00 3.42  ? 6  DT  E N1     1  
ATOM 172   C C2     . DT  A 1 6  ? 23.230  9.991   1.461   1.00 3.29  ? 6  DT  E C2     1  
ATOM 173   O O2     . DT  A 1 6  ? 23.199  10.713  2.443   1.00 3.27  ? 6  DT  E O2     1  
ATOM 174   N N3     . DT  A 1 6  ? 23.238  10.496  0.190   1.00 3.22  ? 6  DT  E N3     1  
ATOM 175   C C4     . DT  A 1 6  ? 23.275  9.784   -0.988  1.00 3.28  ? 6  DT  E C4     1  
ATOM 176   O O4     . DT  A 1 6  ? 23.260  10.381  -2.062  1.00 3.25  ? 6  DT  E O4     1  
ATOM 177   C C5     . DT  A 1 6  ? 23.316  8.345   -0.840  1.00 3.42  ? 6  DT  E C5     1  
ATOM 178   C C7     . DT  A 1 6  ? 23.306  7.494   -2.072  1.00 3.54  ? 6  DT  E C7     1  
ATOM 179   C C6     . DT  A 1 6  ? 23.312  7.830   0.403   1.00 3.48  ? 6  DT  E C6     1  
ATOM 180   H "H5'"  . DT  A 1 6  ? 25.998  6.355   2.309   1.00 3.89  ? 6  DT  E "H5'"  1  
ATOM 181   H "H5''" . DT  A 1 6  ? 26.312  5.226   3.635   1.00 4.12  ? 6  DT  E "H5''" 1  
ATOM 182   H "H4'"  . DT  A 1 6  ? 25.186  6.590   4.954   1.00 3.94  ? 6  DT  E "H4'"  1  
ATOM 183   H "H3'"  . DT  A 1 6  ? 23.216  4.977   4.231   1.00 4.03  ? 6  DT  E "H3'"  1  
ATOM 184   H "H2'"  . DT  A 1 6  ? 22.603  6.064   2.152   1.00 3.74  ? 6  DT  E "H2'"  1  
ATOM 185   H "H2''" . DT  A 1 6  ? 21.448  6.757   3.274   1.00 3.64  ? 6  DT  E "H2''" 1  
ATOM 186   H "H1'"  . DT  A 1 6  ? 22.717  8.762   3.551   1.00 3.47  ? 6  DT  E "H1'"  1  
ATOM 187   H H3     . DT  A 1 6  ? 23.201  11.504  0.115   1.00 3.14  ? 6  DT  E H3     1  
ATOM 188   H H71    . DT  A 1 6  ? 22.486  7.801   -2.720  1.00 3.87  ? 6  DT  E H71    1  
ATOM 189   H H72    . DT  A 1 6  ? 24.250  7.613   -2.605  1.00 3.48  ? 6  DT  E H72    1  
ATOM 190   H H73    . DT  A 1 6  ? 23.178  6.448   -1.792  1.00 3.74  ? 6  DT  E H73    1  
ATOM 191   H H6     . DT  A 1 6  ? 23.360  6.748   0.518   1.00 3.61  ? 6  DT  E H6     1  
ATOM 192   P P      . DG  A 1 7  ? 21.640  5.875   6.273   1.00 4.01  ? 7  DG  E P      1  
ATOM 193   O OP1    . DG  A 1 7  ? 22.228  4.886   7.213   1.00 4.24  ? 7  DG  E OP1    1  
ATOM 194   O OP2    . DG  A 1 7  ? 20.589  5.445   5.322   1.00 3.96  ? 7  DG  E OP2    1  
ATOM 195   O "O5'"  . DG  A 1 7  ? 21.053  7.087   7.121   1.00 3.93  ? 7  DG  E "O5'"  1  
ATOM 196   C "C5'"  . DG  A 1 7  ? 21.902  8.188   7.442   1.00 3.84  ? 7  DG  E "C5'"  1  
ATOM 197   C "C4'"  . DG  A 1 7  ? 21.127  9.484   7.517   1.00 3.74  ? 7  DG  E "C4'"  1  
ATOM 198   O "O4'"  . DG  A 1 7  ? 21.084  10.090  6.201   1.00 3.56  ? 7  DG  E "O4'"  1  
ATOM 199   C "C3'"  . DG  A 1 7  ? 19.660  9.309   7.905   1.00 3.71  ? 7  DG  E "C3'"  1  
ATOM 200   O "O3'"  . DG  A 1 7  ? 19.196  10.545  8.447   1.00 3.70  ? 7  DG  E "O3'"  1  
ATOM 201   C "C2'"  . DG  A 1 7  ? 18.976  9.054   6.574   1.00 3.53  ? 7  DG  E "C2'"  1  
ATOM 202   C "C1'"  . DG  A 1 7  ? 19.779  9.961   5.650   1.00 3.43  ? 7  DG  E "C1'"  1  
ATOM 203   N N9     . DG  A 1 7  ? 19.876  9.560   4.248   1.00 3.33  ? 7  DG  E N9     1  
ATOM 204   C C8     . DG  A 1 7  ? 19.899  8.291   3.725   1.00 3.39  ? 7  DG  E C8     1  
ATOM 205   N N7     . DG  A 1 7  ? 19.922  8.272   2.418   1.00 3.31  ? 7  DG  E N7     1  
ATOM 206   C C5     . DG  A 1 7  ? 19.926  9.614   2.054   1.00 3.19  ? 7  DG  E C5     1  
ATOM 207   C C6     . DG  A 1 7  ? 19.942  10.229  0.766   1.00 3.10  ? 7  DG  E C6     1  
ATOM 208   O O6     . DG  A 1 7  ? 19.954  9.692   -0.351  1.00 3.12  ? 7  DG  E O6     1  
ATOM 209   N N1     . DG  A 1 7  ? 19.939  11.616  0.861   1.00 3.02  ? 7  DG  E N1     1  
ATOM 210   C C2     . DG  A 1 7  ? 19.929  12.327  2.036   1.00 3.05  ? 7  DG  E C2     1  
ATOM 211   N N2     . DG  A 1 7  ? 19.940  13.664  1.916   1.00 3.02  ? 7  DG  E N2     1  
ATOM 212   N N3     . DG  A 1 7  ? 19.912  11.771  3.237   1.00 3.14  ? 7  DG  E N3     1  
ATOM 213   C C4     . DG  A 1 7  ? 19.911  10.421  3.172   1.00 3.20  ? 7  DG  E C4     1  
ATOM 214   H "H5'"  . DG  A 1 7  ? 22.674  8.283   6.678   1.00 3.75  ? 7  DG  E "H5'"  1  
ATOM 215   H "H5''" . DG  A 1 7  ? 22.380  8.007   8.404   1.00 3.99  ? 7  DG  E "H5''" 1  
ATOM 216   H "H4'"  . DG  A 1 7  ? 21.591  10.115  8.276   1.00 3.83  ? 7  DG  E "H4'"  1  
ATOM 217   H "H3'"  . DG  A 1 7  ? 19.514  8.504   8.623   1.00 3.84  ? 7  DG  E "H3'"  1  
ATOM 218   H "H2'"  . DG  A 1 7  ? 19.050  8.004   6.288   1.00 3.57  ? 7  DG  E "H2'"  1  
ATOM 219   H "H2''" . DG  A 1 7  ? 17.919  9.302   6.619   1.00 3.47  ? 7  DG  E "H2''" 1  
ATOM 220   H "H1'"  . DG  A 1 7  ? 19.341  10.963  5.668   1.00 3.36  ? 7  DG  E "H1'"  1  
ATOM 221   H H8     . DG  A 1 7  ? 19.895  7.399   4.332   1.00 3.51  ? 7  DG  E H8     1  
ATOM 222   H H1     . DG  A 1 7  ? 19.943  12.139  -0.005  1.00 2.98  ? 7  DG  E H1     1  
ATOM 223   H H21    . DG  A 1 7  ? 19.937  14.241  2.744   1.00 3.07  ? 7  DG  E H21    1  
ATOM 224   H H22    . DG  A 1 7  ? 19.952  14.105  1.005   1.00 2.97  ? 7  DG  E H22    1  
ATOM 225   P P      . DA  A 1 8  ? 17.945  10.585  9.450   1.00 3.78  ? 8  DA  E P      1  
ATOM 226   O OP1    . DA  A 1 8  ? 18.422  10.394  10.842  1.00 4.00  ? 8  DA  E OP1    1  
ATOM 227   O OP2    . DA  A 1 8  ? 16.876  9.705   8.911   1.00 3.71  ? 8  DA  E OP2    1  
ATOM 228   O "O5'"  . DA  A 1 8  ? 17.472  12.097  9.285   1.00 3.67  ? 8  DA  E "O5'"  1  
ATOM 229   C "C5'"  . DA  A 1 8  ? 18.378  13.057  8.736   1.00 3.62  ? 8  DA  E "C5'"  1  
ATOM 230   C "C4'"  . DA  A 1 8  ? 17.639  14.219  8.111   1.00 3.48  ? 8  DA  E "C4'"  1  
ATOM 231   O "O4'"  . DA  A 1 8  ? 17.717  14.111  6.669   1.00 3.28  ? 8  DA  E "O4'"  1  
ATOM 232   C "C3'"  . DA  A 1 8  ? 16.142  14.272  8.404   1.00 3.49  ? 8  DA  E "C3'"  1  
ATOM 233   O "O3'"  . DA  A 1 8  ? 15.694  15.607  8.194   1.00 3.45  ? 8  DA  E "O3'"  1  
ATOM 234   C "C2'"  . DA  A 1 8  ? 15.544  13.398  7.320   1.00 3.33  ? 8  DA  E "C2'"  1  
ATOM 235   C "C1'"  . DA  A 1 8  ? 16.455  13.713  6.141   1.00 3.19  ? 8  DA  E "C1'"  1  
ATOM 236   N N9     . DA  A 1 8  ? 16.658  12.622  5.191   1.00 3.12  ? 8  DA  E N9     1  
ATOM 237   C C8     . DA  A 1 8  ? 16.962  11.310  5.433   1.00 3.21  ? 8  DA  E C8     1  
ATOM 238   N N7     . DA  A 1 8  ? 17.046  10.578  4.347   1.00 3.15  ? 8  DA  E N7     1  
ATOM 239   C C5     . DA  A 1 8  ? 16.781  11.473  3.320   1.00 3.01  ? 8  DA  E C5     1  
ATOM 240   C C6     . DA  A 1 8  ? 16.711  11.322  1.923   1.00 2.94  ? 8  DA  E C6     1  
ATOM 241   N N6     . DA  A 1 8  ? 16.909  10.162  1.292   1.00 3.00  ? 8  DA  E N6     1  
ATOM 242   N N1     . DA  A 1 8  ? 16.424  12.418  1.187   1.00 2.86  ? 8  DA  E N1     1  
ATOM 243   C C2     . DA  A 1 8  ? 16.221  13.582  1.821   1.00 2.85  ? 8  DA  E C2     1  
ATOM 244   N N3     . DA  A 1 8  ? 16.256  13.845  3.125   1.00 2.91  ? 8  DA  E N3     1  
ATOM 245   C C4     . DA  A 1 8  ? 16.546  12.737  3.827   1.00 2.99  ? 8  DA  E C4     1  
ATOM 246   H "H5'"  . DA  A 1 8  ? 18.994  12.579  7.972   1.00 3.56  ? 8  DA  E "H5'"  1  
ATOM 247   H "H5''" . DA  A 1 8  ? 19.027  13.433  9.524   1.00 3.77  ? 8  DA  E "H5''" 1  
ATOM 248   H "H4'"  . DA  A 1 8  ? 18.074  15.141  8.500   1.00 3.54  ? 8  DA  E "H4'"  1  
ATOM 249   H "H3'"  . DA  A 1 8  ? 15.898  13.942  9.413   1.00 3.65  ? 8  DA  E "H3'"  1  
ATOM 250   H "H2'"  . DA  A 1 8  ? 15.578  12.344  7.599   1.00 3.41  ? 8  DA  E "H2'"  1  
ATOM 251   H "H2''" . DA  A 1 8  ? 14.501  13.652  7.140   1.00 3.28  ? 8  DA  E "H2''" 1  
ATOM 252   H "H1'"  . DA  A 1 8  ? 16.060  14.567  5.586   1.00 3.11  ? 8  DA  E "H1'"  1  
ATOM 253   H H8     . DA  A 1 8  ? 17.111  10.916  6.426   1.00 3.35  ? 8  DA  E H8     1  
ATOM 254   H H61    . DA  A 1 8  ? 17.123  9.322   1.814   1.00 3.09  ? 8  DA  E H61    1  
ATOM 255   H H62    . DA  A 1 8  ? 16.835  10.119  0.284   1.00 2.98  ? 8  DA  E H62    1  
ATOM 256   H H2     . DA  A 1 8  ? 15.998  14.434  1.179   1.00 2.82  ? 8  DA  E H2     1  
ATOM 257   P P      . DC  A 1 9  ? 14.343  16.136  8.870   1.00 3.55  ? 9  DC  E P      1  
ATOM 258   O OP1    . DC  A 1 9  ? 14.678  16.906  10.096  1.00 3.78  ? 9  DC  E OP1    1  
ATOM 259   O OP2    . DC  A 1 9  ? 13.374  15.015  8.945   1.00 3.53  ? 9  DC  E OP2    1  
ATOM 260   O "O5'"  . DC  A 1 9  ? 13.851  17.162  7.755   1.00 3.41  ? 9  DC  E "O5'"  1  
ATOM 261   C "C5'"  . DC  A 1 9  ? 14.752  17.516  6.702   1.00 3.31  ? 9  DC  E "C5'"  1  
ATOM 262   C "C4'"  . DC  A 1 9  ? 14.017  18.032  5.486   1.00 3.19  ? 9  DC  E "C4'"  1  
ATOM 263   O "O4'"  . DC  A 1 9  ? 14.044  17.017  4.450   1.00 3.02  ? 9  DC  E "O4'"  1  
ATOM 264   C "C3'"  . DC  A 1 9  ? 12.533  18.317  5.697   1.00 3.21  ? 9  DC  E "C3'"  1  
ATOM 265   O "O3'"  . DC  A 1 9  ? 12.131  19.245  4.692   1.00 3.17  ? 9  DC  E "O3'"  1  
ATOM 266   C "C2'"  . DC  A 1 9  ? 11.881  16.972  5.436   1.00 3.09  ? 9  DC  E "C2'"  1  
ATOM 267   C "C1'"  . DC  A 1 9  ? 12.758  16.422  4.316   1.00 2.96  ? 9  DC  E "C1'"  1  
ATOM 268   N N1     . DC  A 1 9  ? 12.903  14.955  4.246   1.00 2.92  ? 9  DC  E N1     1  
ATOM 269   C C2     . DC  A 1 9  ? 12.917  14.354  2.981   1.00 2.80  ? 9  DC  E C2     1  
ATOM 270   O O2     . DC  A 1 9  ? 12.862  15.074  1.973   1.00 2.74  ? 9  DC  E O2     1  
ATOM 271   N N3     . DC  A 1 9  ? 12.986  13.010  2.883   1.00 2.81  ? 9  DC  E N3     1  
ATOM 272   C C4     . DC  A 1 9  ? 13.047  12.265  3.987   1.00 2.93  ? 9  DC  E C4     1  
ATOM 273   N N4     . DC  A 1 9  ? 13.087  10.937  3.835   1.00 2.98  ? 9  DC  E N4     1  
ATOM 274   C C5     . DC  A 1 9  ? 13.063  12.848  5.292   1.00 3.04  ? 9  DC  E C5     1  
ATOM 275   C C6     . DC  A 1 9  ? 12.994  14.188  5.372   1.00 3.03  ? 9  DC  E C6     1  
ATOM 276   H "H5'"  . DC  A 1 9  ? 15.335  16.640  6.418   1.00 3.24  ? 9  DC  E "H5'"  1  
ATOM 277   H "H5''" . DC  A 1 9  ? 15.432  18.291  7.055   1.00 3.41  ? 9  DC  E "H5''" 1  
ATOM 278   H "H4'"  . DC  A 1 9  ? 14.483  18.971  5.184   1.00 3.23  ? 9  DC  E "H4'"  1  
ATOM 279   H "H3'"  . DC  A 1 9  ? 12.320  18.716  6.687   1.00 3.36  ? 9  DC  E "H3'"  1  
ATOM 280   H "H2'"  . DC  A 1 9  ? 11.907  16.344  6.326   1.00 3.17  ? 9  DC  E "H2'"  1  
ATOM 281   H "H2''" . DC  A 1 9  ? 10.838  17.087  5.151   1.00 3.06  ? 9  DC  E "H2''" 1  
ATOM 282   H "H1'"  . DC  A 1 9  ? 12.363  16.755  3.353   1.00 2.89  ? 9  DC  E "H1'"  1  
ATOM 283   H H41    . DC  A 1 9  ? 13.130  10.342  4.649   1.00 3.10  ? 9  DC  E H41    1  
ATOM 284   H H42    . DC  A 1 9  ? 13.054  10.533  2.910   1.00 2.94  ? 9  DC  E H42    1  
ATOM 285   H H5     . DC  A 1 9  ? 13.130  12.230  6.187   1.00 3.17  ? 9  DC  E H5     1  
ATOM 286   H H6     . DC  A 1 9  ? 13.007  14.664  6.351   1.00 3.15  ? 9  DC  E H6     1  
ATOM 287   P P      . DA  A 1 10 ? 10.830  20.160  4.889   1.00 3.27  ? 10 DA  E P      1  
ATOM 288   O OP1    . DA  A 1 10 ? 11.227  21.488  5.417   1.00 3.48  ? 10 DA  E OP1    1  
ATOM 289   O OP2    . DA  A 1 10 ? 9.787   19.367  5.591   1.00 3.27  ? 10 DA  E OP2    1  
ATOM 290   O "O5'"  . DA  A 1 10 ? 10.379  20.341  3.373   1.00 3.16  ? 10 DA  E "O5'"  1  
ATOM 291   C "C5'"  . DA  A 1 10 ? 11.305  20.017  2.332   1.00 3.07  ? 10 DA  E "C5'"  1  
ATOM 292   C "C4'"  . DA  A 1 10 ? 10.593  19.703  1.037   1.00 2.98  ? 10 DA  E "C4'"  1  
ATOM 293   O "O4'"  . DA  A 1 10 ? 10.618  18.271  0.823   1.00 2.83  ? 10 DA  E "O4'"  1  
ATOM 294   C "C3'"  . DA  A 1 10 ? 9.113   20.069  1.009   1.00 3.01  ? 10 DA  E "C3'"  1  
ATOM 295   O "O3'"  . DA  A 1 10 ? 8.726   20.213  -0.356  1.00 3.00  ? 10 DA  E "O3'"  1  
ATOM 296   C "C2'"  . DA  A 1 10 ? 8.445   18.842  1.600   1.00 2.90  ? 10 DA  E "C2'"  1  
ATOM 297   C "C1'"  . DA  A 1 10 ? 9.325   17.722  1.054   1.00 2.79  ? 10 DA  E "C1'"  1  
ATOM 298   N N9     . DA  A 1 10 ? 9.457   16.535  1.900   1.00 2.75  ? 10 DA  E N9     1  
ATOM 299   C C8     . DA  A 1 10 ? 9.534   16.445  3.266   1.00 2.84  ? 10 DA  E C8     1  
ATOM 300   N N7     . DA  A 1 10 ? 9.619   15.212  3.712   1.00 2.83  ? 10 DA  E N7     1  
ATOM 301   C C5     . DA  A 1 10 ? 9.595   14.438  2.559   1.00 2.73  ? 10 DA  E C5     1  
ATOM 302   C C6     . DA  A 1 10 ? 9.644   13.043  2.345   1.00 2.72  ? 10 DA  E C6     1  
ATOM 303   N N6     . DA  A 1 10 ? 9.726   12.140  3.325   1.00 2.82  ? 10 DA  E N6     1  
ATOM 304   N N1     . DA  A 1 10 ? 9.600   12.603  1.069   1.00 2.66  ? 10 DA  E N1     1  
ATOM 305   C C2     . DA  A 1 10 ? 9.509   13.503  0.082   1.00 2.62  ? 10 DA  E C2     1  
ATOM 306   N N3     . DA  A 1 10 ? 9.453   14.832  0.156   1.00 2.63  ? 10 DA  E N3     1  
ATOM 307   C C4     . DA  A 1 10 ? 9.501   15.240  1.436   1.00 2.68  ? 10 DA  E C4     1  
ATOM 308   H "H5'"  . DA  A 1 10 ? 11.892  19.148  2.629   1.00 3.04  ? 10 DA  E "H5'"  1  
ATOM 309   H "H5''" . DA  A 1 10 ? 11.978  20.858  2.171   1.00 3.16  ? 10 DA  E "H5''" 1  
ATOM 310   H "H4'"  . DA  A 1 10 ? 11.078  20.267  0.241   1.00 3.02  ? 10 DA  E "H4'"  1  
ATOM 311   H "H3'"  . DA  A 1 10 ? 8.899   20.983  1.560   1.00 3.14  ? 10 DA  E "H3'"  1  
ATOM 312   H "H2'"  . DA  A 1 10 ? 8.454   18.878  2.690   1.00 2.97  ? 10 DA  E "H2'"  1  
ATOM 313   H "H2''" . DA  A 1 10 ? 7.407   18.773  1.290   1.00 2.88  ? 10 DA  E "H2''" 1  
ATOM 314   H "H1'"  . DA  A 1 10 ? 8.943   17.395  0.084   1.00 2.74  ? 10 DA  E "H1'"  1  
ATOM 315   H H8     . DA  A 1 10 ? 9.517   17.308  3.914   1.00 2.94  ? 10 DA  E H8     1  
ATOM 316   H H61    . DA  A 1 10 ? 9.756   12.444  4.288   1.00 2.90  ? 10 DA  E H61    1  
ATOM 317   H H62    . DA  A 1 10 ? 9.748   11.153  3.105   1.00 2.85  ? 10 DA  E H62    1  
ATOM 318   H H2     . DA  A 1 10 ? 9.478   13.089  -0.925  1.00 2.61  ? 10 DA  E H2     1  
ATOM 319   P P      . DA  A 1 11 ? 7.447   21.091  -0.758  1.00 3.11  ? 11 DA  E P      1  
ATOM 320   O OP1    . DA  A 1 11 ? 7.871   22.475  -1.081  1.00 3.30  ? 11 DA  E OP1    1  
ATOM 321   O OP2    . DA  A 1 11 ? 6.379   20.865  0.249   1.00 3.11  ? 11 DA  E OP2    1  
ATOM 322   O "O5'"  . DA  A 1 11 ? 7.005   20.374  -2.110  1.00 3.03  ? 11 DA  E "O5'"  1  
ATOM 323   C "C5'"  . DA  A 1 11 ? 7.986   19.676  -2.881  1.00 2.98  ? 11 DA  E "C5'"  1  
ATOM 324   C "C4'"  . DA  A 1 11 ? 7.357   18.605  -3.744  1.00 2.92  ? 11 DA  E "C4'"  1  
ATOM 325   O "O4'"  . DA  A 1 11 ? 7.433   17.332  -3.052  1.00 2.76  ? 11 DA  E "O4'"  1  
ATOM 326   C "C3'"  . DA  A 1 11 ? 5.867   18.796  -4.016  1.00 2.96  ? 11 DA  E "C3'"  1  
ATOM 327   O "O3'"  . DA  A 1 11 ? 5.526   18.062  -5.185  1.00 2.99  ? 11 DA  E "O3'"  1  
ATOM 328   C "C2'"  . DA  A 1 11 ? 5.205   18.129  -2.828  1.00 2.84  ? 11 DA  E "C2'"  1  
ATOM 329   C "C1'"  . DA  A 1 11 ? 6.142   16.957  -2.575  1.00 2.71  ? 11 DA  E "C1'"  1  
ATOM 330   N N9     . DA  A 1 11 ? 6.240   16.509  -1.186  1.00 2.64  ? 11 DA  E N9     1  
ATOM 331   C C8     . DA  A 1 11 ? 6.301   17.252  -0.038  1.00 2.69  ? 11 DA  E C8     1  
ATOM 332   N N7     . DA  A 1 11 ? 6.331   16.531  1.060   1.00 2.67  ? 11 DA  E N7     1  
ATOM 333   C C5     . DA  A 1 11 ? 6.289   15.221  0.600   1.00 2.60  ? 11 DA  E C5     1  
ATOM 334   C C6     . DA  A 1 11 ? 6.281   13.976  1.266   1.00 2.60  ? 11 DA  E C6     1  
ATOM 335   N N6     . DA  A 1 11 ? 6.306   13.839  2.595   1.00 2.67  ? 11 DA  E N6     1  
ATOM 336   N N1     . DA  A 1 11 ? 6.241   12.858  0.506   1.00 2.59  ? 11 DA  E N1     1  
ATOM 337   C C2     . DA  A 1 11 ? 6.204   12.991  -0.827  1.00 2.58  ? 11 DA  E C2     1  
ATOM 338   N N3     . DA  A 1 11 ? 6.200   14.101  -1.565  1.00 2.58  ? 11 DA  E N3     1  
ATOM 339   C C4     . DA  A 1 11 ? 6.245   15.193  -0.782  1.00 2.59  ? 11 DA  E C4     1  
ATOM 340   H "H5'"  . DA  A 1 11 ? 8.709   19.210  -2.211  1.00 2.95  ? 11 DA  E "H5'"  1  
ATOM 341   H "H5''" . DA  A 1 11 ? 8.509   20.382  -3.526  1.00 3.06  ? 11 DA  E "H5''" 1  
ATOM 342   H "H4'"  . DA  A 1 11 ? 7.864   18.606  -4.709  1.00 2.98  ? 11 DA  E "H4'"  1  
ATOM 343   H "H3'"  . DA  A 1 11 ? 5.592   19.843  -4.134  1.00 3.09  ? 11 DA  E "H3'"  1  
ATOM 344   H "H2'"  . DA  A 1 11 ? 5.148   18.806  -1.975  1.00 2.88  ? 11 DA  E "H2'"  1  
ATOM 345   H "H2''" . DA  A 1 11 ? 4.192   17.815  -3.065  1.00 2.83  ? 11 DA  E "H2''" 1  
ATOM 346   H "H1'"  . DA  A 1 11 ? 5.825   16.101  -3.175  1.00 2.69  ? 11 DA  E "H1'"  1  
ATOM 347   H H8     . DA  A 1 11 ? 6.315   18.331  -0.038  1.00 2.77  ? 11 DA  E H8     1  
ATOM 348   H H61    . DA  A 1 11 ? 6.329   14.659  3.185   1.00 2.73  ? 11 DA  E H61    1  
ATOM 349   H H62    . DA  A 1 11 ? 6.287   12.921  3.016   1.00 2.71  ? 11 DA  E H62    1  
ATOM 350   H H2     . DA  A 1 11 ? 6.172   12.057  -1.389  1.00 2.61  ? 11 DA  E H2     1  
ATOM 351   P P      . DT  A 1 12 ? 4.202   18.410  -6.014  1.00 3.13  ? 12 DT  E P      1  
ATOM 352   O OP1    . DT  A 1 12 ? 4.545   19.247  -7.190  1.00 3.34  ? 12 DT  E OP1    1  
ATOM 353   O OP2    . DT  A 1 12 ? 3.147   18.860  -5.070  1.00 3.10  ? 12 DT  E OP2    1  
ATOM 354   O "O5'"  . DT  A 1 12 ? 3.820   16.959  -6.540  1.00 3.07  ? 12 DT  E "O5'"  1  
ATOM 355   C "C5'"  . DT  A 1 12 ? 4.797   15.919  -6.455  1.00 2.99  ? 12 DT  E "C5'"  1  
ATOM 356   C "C4'"  . DT  A 1 12 ? 4.164   14.552  -6.566  1.00 2.96  ? 12 DT  E "C4'"  1  
ATOM 357   O "O4'"  . DT  A 1 12 ? 4.185   13.912  -5.264  1.00 2.81  ? 12 DT  E "O4'"  1  
ATOM 358   C "C3'"  . DT  A 1 12 ? 2.688   14.577  -6.953  1.00 3.02  ? 12 DT  E "C3'"  1  
ATOM 359   O "O3'"  . DT  A 1 12 ? 2.362   13.313  -7.515  1.00 3.08  ? 12 DT  E "O3'"  1  
ATOM 360   C "C2'"  . DT  A 1 12 ? 1.979   14.722  -5.620  1.00 2.88  ? 12 DT  E "C2'"  1  
ATOM 361   C "C1'"  . DT  A 1 12 ? 2.872   13.888  -4.711  1.00 2.76  ? 12 DT  E "C1'"  1  
ATOM 362   N N1     . DT  A 1 12 ? 2.929   14.274  -3.282  1.00 2.66  ? 12 DT  E N1     1  
ATOM 363   C C2     . DT  A 1 12 ? 2.961   13.237  -2.371  1.00 2.61  ? 12 DT  E C2     1  
ATOM 364   O O2     . DT  A 1 12 ? 2.997   12.063  -2.701  1.00 2.63  ? 12 DT  E O2     1  
ATOM 365   N N3     . DT  A 1 12 ? 2.946   13.621  -1.058  1.00 2.58  ? 12 DT  E N3     1  
ATOM 366   C C4     . DT  A 1 12 ? 2.910   14.907  -0.569  1.00 2.61  ? 12 DT  E C4     1  
ATOM 367   O O4     . DT  A 1 12 ? 2.870   15.094  0.646   1.00 2.64  ? 12 DT  E O4     1  
ATOM 368   C C5     . DT  A 1 12 ? 2.898   15.951  -1.575  1.00 2.67  ? 12 DT  E C5     1  
ATOM 369   C C7     . DT  A 1 12 ? 2.790   17.375  -1.132  1.00 2.76  ? 12 DT  E C7     1  
ATOM 370   C C6     . DT  A 1 12 ? 2.917   15.591  -2.870  1.00 2.69  ? 12 DT  E C6     1  
ATOM 371   H "H5'"  . DT  A 1 12 ? 5.318   15.989  -5.500  1.00 2.89  ? 12 DT  E "H5'"  1  
ATOM 372   H "H5''" . DT  A 1 12 ? 5.523   16.036  -7.259  1.00 3.09  ? 12 DT  E "H5''" 1  
ATOM 373   H "H4'"  . DT  A 1 12 ? 4.694   13.992  -7.338  1.00 3.04  ? 12 DT  E "H4'"  1  
ATOM 374   H "H3'"  . DT  A 1 12 ? 2.456   15.374  -7.655  1.00 3.14  ? 12 DT  E "H3'"  1  
ATOM 375   H "H2'"  . DT  A 1 12 ? 1.930   15.766  -5.308  1.00 2.90  ? 12 DT  E "H2'"  1  
ATOM 376   H "H2''" . DT  A 1 12 ? 0.959   14.350  -5.675  1.00 2.89  ? 12 DT  E "H2''" 1  
ATOM 377   H "H1'"  . DT  A 1 12 ? 2.544   12.845  -4.749  1.00 2.77  ? 12 DT  E "H1'"  1  
ATOM 378   H H3     . DT  A 1 12 ? 2.946   12.878  -0.370  1.00 2.58  ? 12 DT  E H3     1  
ATOM 379   H H71    . DT  A 1 12 ? 2.488   17.996  -1.974  1.00 2.87  ? 12 DT  E H71    1  
ATOM 380   H H72    . DT  A 1 12 ? 2.048   17.454  -0.340  1.00 3.10  ? 12 DT  E H72    1  
ATOM 381   H H73    . DT  A 1 12 ? 3.756   17.713  -0.759  1.00 2.88  ? 12 DT  E H73    1  
ATOM 382   H H6     . DT  A 1 12 ? 2.926   16.374  -3.628  1.00 2.78  ? 12 DT  E H6     1  
ATOM 383   P P      . DT  A 1 13 ? 1.084   13.140  -8.456  1.00 3.22  ? 13 DT  E P      1  
ATOM 384   O OP1    . DT  A 1 13 ? 1.494   13.187  -9.881  1.00 3.44  ? 13 DT  E OP1    1  
ATOM 385   O OP2    . DT  A 1 13 ? 0.005   14.040  -7.971  1.00 3.18  ? 13 DT  E OP2    1  
ATOM 386   O "O5'"  . DT  A 1 13 ? 0.694   11.640  -8.099  1.00 3.19  ? 13 DT  E "O5'"  1  
ATOM 387   C "C5'"  . DT  A 1 13 ? 1.622   10.856  -7.344  1.00 3.11  ? 13 DT  E "C5'"  1  
ATOM 388   C "C4'"  . DT  A 1 13 ? 0.924   9.761   -6.572  1.00 3.08  ? 13 DT  E "C4'"  1  
ATOM 389   O "O4'"  . DT  A 1 13 ? 0.831   10.151  -5.179  1.00 2.92  ? 13 DT  E "O4'"  1  
ATOM 390   C "C3'"  . DT  A 1 13 ? -0.521  9.518   -7.000  1.00 3.14  ? 13 DT  E "C3'"  1  
ATOM 391   O "O3'"  . DT  A 1 13 ? -0.861  8.185   -6.619  1.00 3.18  ? 13 DT  E "O3'"  1  
ATOM 392   C "C2'"  . DT  A 1 13 ? -1.301  10.517  -6.165  1.00 3.02  ? 13 DT  E "C2'"  1  
ATOM 393   C "C1'"  . DT  A 1 13 ? -0.511  10.501  -4.861  1.00 2.89  ? 13 DT  E "C1'"  1  
ATOM 394   N N1     . DT  A 1 13 ? -0.517  11.739  -4.048  1.00 2.79  ? 13 DT  E N1     1  
ATOM 395   C C2     . DT  A 1 13 ? -0.401  11.568  -2.685  1.00 2.73  ? 13 DT  E C2     1  
ATOM 396   O O2     . DT  A 1 13 ? -0.230  10.478  -2.164  1.00 2.75  ? 13 DT  E O2     1  
ATOM 397   N N3     . DT  A 1 13 ? -0.489  12.717  -1.949  1.00 2.69  ? 13 DT  E N3     1  
ATOM 398   C C4     . DT  A 1 13 ? -0.666  13.997  -2.423  1.00 2.72  ? 13 DT  E C4     1  
ATOM 399   O O4     . DT  A 1 13 ? -0.776  14.932  -1.627  1.00 2.73  ? 13 DT  E O4     1  
ATOM 400   C C5     . DT  A 1 13 ? -0.750  14.114  -3.867  1.00 2.79  ? 13 DT  E C5     1  
ATOM 401   C C7     . DT  A 1 13 ? -0.954  15.465  -4.476  1.00 2.87  ? 13 DT  E C7     1  
ATOM 402   C C6     . DT  A 1 13 ? -0.666  12.993  -4.604  1.00 2.82  ? 13 DT  E C6     1  
ATOM 403   H "H5'"  . DT  A 1 13 ? 2.154   11.500  -6.643  1.00 3.03  ? 13 DT  E "H5'"  1  
ATOM 404   H "H5''" . DT  A 1 13 ? 2.344   10.402  -8.021  1.00 3.20  ? 13 DT  E "H5''" 1  
ATOM 405   H "H4'"  . DT  A 1 13 ? 1.470   8.831   -6.730  1.00 3.15  ? 13 DT  E "H4'"  1  
ATOM 406   H "H3'"  . DT  A 1 13 ? -0.663  9.652   -8.070  1.00 3.26  ? 13 DT  E "H3'"  1  
ATOM 407   H "H2'"  . DT  A 1 13 ? -1.308  11.503  -6.633  1.00 3.04  ? 13 DT  E "H2'"  1  
ATOM 408   H "H2''" . DT  A 1 13 ? -2.338  10.210  -6.047  1.00 3.03  ? 13 DT  E "H2''" 1  
ATOM 409   H "H1'"  . DT  A 1 13 ? -0.892  9.698   -4.224  1.00 2.88  ? 13 DT  E "H1'"  1  
ATOM 410   H H3     . DT  A 1 13 ? -0.437  12.610  -0.946  1.00 2.67  ? 13 DT  E H3     1  
ATOM 411   H H71    . DT  A 1 13 ? -1.931  15.851  -4.189  1.00 3.45  ? 13 DT  E H71    1  
ATOM 412   H H72    . DT  A 1 13 ? -0.178  16.144  -4.124  1.00 2.94  ? 13 DT  E H72    1  
ATOM 413   H H73    . DT  A 1 13 ? -0.902  15.387  -5.560  1.00 2.79  ? 13 DT  E H73    1  
ATOM 414   H H6     . DT  A 1 13 ? -0.714  13.081  -5.688  1.00 2.91  ? 13 DT  E H6     1  
ATOM 415   P P      . DA  A 1 14 ? -2.019  7.386   -7.381  1.00 3.32  ? 14 DA  E P      1  
ATOM 416   O OP1    . DA  A 1 14 ? -1.445  6.641   -8.533  1.00 3.54  ? 14 DA  E OP1    1  
ATOM 417   O OP2    . DA  A 1 14 ? -3.159  8.311   -7.599  1.00 3.28  ? 14 DA  E OP2    1  
ATOM 418   O "O5'"  . DA  A 1 14 ? -2.439  6.330   -6.267  1.00 3.29  ? 14 DA  E "O5'"  1  
ATOM 419   C "C5'"  . DA  A 1 14 ? -1.480  5.938   -5.285  1.00 3.23  ? 14 DA  E "C5'"  1  
ATOM 420   C "C4'"  . DA  A 1 14 ? -2.151  5.458   -4.017  1.00 3.17  ? 14 DA  E "C4'"  1  
ATOM 421   O "O4'"  . DA  A 1 14 ? -2.155  6.533   -3.044  1.00 2.99  ? 14 DA  E "O4'"  1  
ATOM 422   C "C3'"  . DA  A 1 14 ? -3.624  5.091   -4.175  1.00 3.24  ? 14 DA  E "C3'"  1  
ATOM 423   O "O3'"  . DA  A 1 14 ? -3.985  4.227   -3.105  1.00 3.27  ? 14 DA  E "O3'"  1  
ATOM 424   C "C2'"  . DA  A 1 14 ? -4.341  6.410   -3.971  1.00 3.08  ? 14 DA  E "C2'"  1  
ATOM 425   C "C1'"  . DA  A 1 14 ? -3.471  7.062   -2.907  1.00 2.94  ? 14 DA  E "C1'"  1  
ATOM 426   N N9     . DA  A 1 14 ? -3.423  8.524   -2.937  1.00 2.83  ? 14 DA  E N9     1  
ATOM 427   C C8     . DA  A 1 14 ? -3.307  9.371   -4.006  1.00 2.86  ? 14 DA  E C8     1  
ATOM 428   N N7     . DA  A 1 14 ? -3.354  10.642  -3.681  1.00 2.79  ? 14 DA  E N7     1  
ATOM 429   C C5     . DA  A 1 14 ? -3.507  10.630  -2.301  1.00 2.69  ? 14 DA  E C5     1  
ATOM 430   C C6     . DA  A 1 14 ? -3.630  11.659  -1.343  1.00 2.63  ? 14 DA  E C6     1  
ATOM 431   N N6     . DA  A 1 14 ? -3.633  12.961  -1.645  1.00 2.65  ? 14 DA  E N6     1  
ATOM 432   N N1     . DA  A 1 14 ? -3.759  11.299  -0.047  1.00 2.61  ? 14 DA  E N1     1  
ATOM 433   C C2     . DA  A 1 14 ? -3.771  9.995   0.257   1.00 2.64  ? 14 DA  E C2     1  
ATOM 434   N N3     . DA  A 1 14 ? -3.670  8.941   -0.548  1.00 2.70  ? 14 DA  E N3     1  
ATOM 435   C C4     . DA  A 1 14 ? -3.537  9.331   -1.828  1.00 2.72  ? 14 DA  E C4     1  
ATOM 436   H "H5'"  . DA  A 1 14 ? -0.837  6.787   -5.047  1.00 3.10  ? 14 DA  E "H5'"  1  
ATOM 437   H "H5''" . DA  A 1 14 ? -0.864  5.131   -5.683  1.00 3.37  ? 14 DA  E "H5''" 1  
ATOM 438   H "H4'"  . DA  A 1 14 ? -1.631  4.562   -3.675  1.00 3.26  ? 14 DA  E "H4'"  1  
ATOM 439   H "H3'"  . DA  A 1 14 ? -3.840  4.622   -5.132  1.00 3.37  ? 14 DA  E "H3'"  1  
ATOM 440   H "H2'"  . DA  A 1 14 ? -4.371  6.990   -4.894  1.00 3.11  ? 14 DA  E "H2'"  1  
ATOM 441   H "H2''" . DA  A 1 14 ? -5.369  6.254   -3.648  1.00 3.09  ? 14 DA  E "H2''" 1  
ATOM 442   H "H1'"  . DA  A 1 14 ? -3.826  6.767   -1.916  1.00 2.93  ? 14 DA  E "H1'"  1  
ATOM 443   H H8     . DA  A 1 14 ? -3.199  9.022   -5.021  1.00 2.98  ? 14 DA  E H8     1  
ATOM 444   H H61    . DA  A 1 14 ? -3.544  13.253  -2.610  1.00 2.71  ? 14 DA  E H61    1  
ATOM 445   H H62    . DA  A 1 14 ? -3.736  13.652  -0.917  1.00 2.65  ? 14 DA  E H62    1  
ATOM 446   H H2     . DA  A 1 14 ? -3.881  9.764   1.317   1.00 2.67  ? 14 DA  E H2     1  
ATOM 447   P P      . DT  A 1 15 ? -5.273  3.288   -3.208  1.00 3.41  ? 15 DT  E P      1  
ATOM 448   O OP1    . DT  A 1 15 ? -4.862  1.908   -3.575  1.00 3.62  ? 15 DT  E OP1    1  
ATOM 449   O OP2    . DT  A 1 15 ? -6.317  3.982   -4.006  1.00 3.38  ? 15 DT  E OP2    1  
ATOM 450   O "O5'"  . DT  A 1 15 ? -5.724  3.293   -1.682  1.00 3.36  ? 15 DT  E "O5'"  1  
ATOM 451   C "C5'"  . DT  A 1 15 ? -4.834  3.848   -0.709  1.00 3.28  ? 15 DT  E "C5'"  1  
ATOM 452   C "C4'"  . DT  A 1 15 ? -5.551  4.165   0.583   1.00 3.23  ? 15 DT  E "C4'"  1  
ATOM 453   O "O4'"  . DT  A 1 15 ? -5.647  5.604   0.728   1.00 3.05  ? 15 DT  E "O4'"  1  
ATOM 454   C "C3'"  . DT  A 1 15 ? -6.995  3.677   0.640   1.00 3.30  ? 15 DT  E "C3'"  1  
ATOM 455   O "O3'"  . DT  A 1 15 ? -7.367  3.553   2.008   1.00 3.35  ? 15 DT  E "O3'"  1  
ATOM 456   C "C2'"  . DT  A 1 15 ? -7.768  4.817   0.006   1.00 3.15  ? 15 DT  E "C2'"  1  
ATOM 457   C "C1'"  . DT  A 1 15 ? -6.985  6.028   0.499   1.00 3.01  ? 15 DT  E "C1'"  1  
ATOM 458   N N1     . DT  A 1 15 ? -6.975  7.223   -0.376  1.00 2.88  ? 15 DT  E N1     1  
ATOM 459   C C2     . DT  A 1 15 ? -7.042  8.445   0.258   1.00 2.79  ? 15 DT  E C2     1  
ATOM 460   O O2     . DT  A 1 15 ? -7.065  8.564   1.473   1.00 2.81  ? 15 DT  E O2     1  
ATOM 461   N N3     . DT  A 1 15 ? -7.085  9.526   -0.576  1.00 2.73  ? 15 DT  E N3     1  
ATOM 462   C C4     . DT  A 1 15 ? -7.065  9.518   -1.951  1.00 2.76  ? 15 DT  E C4     1  
ATOM 463   O O4     . DT  A 1 15 ? -7.152  10.582  -2.565  1.00 2.75  ? 15 DT  E O4     1  
ATOM 464   C C5     . DT  A 1 15 ? -6.977  8.205   -2.561  1.00 2.86  ? 15 DT  E C5     1  
ATOM 465   C C7     . DT  A 1 15 ? -6.993  8.100   -4.055  1.00 2.97  ? 15 DT  E C7     1  
ATOM 466   C C6     . DT  A 1 15 ? -6.930  7.130   -1.753  1.00 2.92  ? 15 DT  E C6     1  
ATOM 467   H "H5'"  . DT  A 1 15 ? -4.395  4.765   -1.105  1.00 3.17  ? 15 DT  E "H5'"  1  
ATOM 468   H "H5''" . DT  A 1 15 ? -4.036  3.139   -0.503  1.00 3.38  ? 15 DT  E "H5''" 1  
ATOM 469   H "H4'"  . DT  A 1 15 ? -5.015  3.681   1.400   1.00 3.32  ? 15 DT  E "H4'"  1  
ATOM 470   H "H3'"  . DT  A 1 15 ? -7.130  2.728   0.125   1.00 3.42  ? 15 DT  E "H3'"  1  
ATOM 471   H "H2'"  . DT  A 1 15 ? -7.766  4.738   -1.080  1.00 3.16  ? 15 DT  E "H2'"  1  
ATOM 472   H "H2''" . DT  A 1 15 ? -8.804  4.818   0.333   1.00 3.15  ? 15 DT  E "H2''" 1  
ATOM 473   H "H1'"  . DT  A 1 15 ? -7.377  6.341   1.471   1.00 3.00  ? 15 DT  E "H1'"  1  
ATOM 474   H H3     . DT  A 1 15 ? -7.148  10.428  -0.128  1.00 2.69  ? 15 DT  E H3     1  
ATOM 475   H H71    . DT  A 1 15 ? -7.806  8.707   -4.452  1.00 3.26  ? 15 DT  E H71    1  
ATOM 476   H H72    . DT  A 1 15 ? -7.140  7.059   -4.347  1.00 3.18  ? 15 DT  E H72    1  
ATOM 477   H H73    . DT  A 1 15 ? -6.045  8.457   -4.456  1.00 2.91  ? 15 DT  E H73    1  
ATOM 478   H H6     . DT  A 1 15 ? -6.850  6.143   -2.205  1.00 3.03  ? 15 DT  E H6     1  
ATOM 479   P P      . DT  A 1 16 ? -8.586  2.613   2.441   1.00 3.49  ? 16 DT  E P      1  
ATOM 480   O OP1    . DT  A 1 16 ? -8.068  1.288   2.867   1.00 3.70  ? 16 DT  E OP1    1  
ATOM 481   O OP2    . DT  A 1 16 ? -9.652  2.693   1.408   1.00 3.45  ? 16 DT  E OP2    1  
ATOM 482   O "O5'"  . DT  A 1 16 ? -9.089  3.382   3.738   1.00 3.44  ? 16 DT  E "O5'"  1  
ATOM 483   C "C5'"  . DT  A 1 16 ? -8.200  4.289   4.387   1.00 3.36  ? 16 DT  E "C5'"  1  
ATOM 484   C "C4'"  . DT  A 1 16 ? -8.956  5.325   5.186   1.00 3.31  ? 16 DT  E "C4'"  1  
ATOM 485   O "O4'"  . DT  A 1 16 ? -9.022  6.557   4.424   1.00 3.14  ? 16 DT  E "O4'"  1  
ATOM 486   C "C3'"  . DT  A 1 16 ? -10.415 4.955   5.439   1.00 3.39  ? 16 DT  E "C3'"  1  
ATOM 487   O "O3'"  . DT  A 1 16 ? -10.859 5.700   6.565   1.00 3.44  ? 16 DT  E "O3'"  1  
ATOM 488   C "C2'"  . DT  A 1 16 ? -11.130 5.473   4.208   1.00 3.26  ? 16 DT  E "C2'"  1  
ATOM 489   C "C1'"  . DT  A 1 16 ? -10.343 6.748   3.931   1.00 3.11  ? 16 DT  E "C1'"  1  
ATOM 490   N N1     . DT  A 1 16 ? -10.296 7.204   2.524   1.00 3.01  ? 16 DT  E N1     1  
ATOM 491   C C2     . DT  A 1 16 ? -10.275 8.569   2.327   1.00 2.92  ? 16 DT  E C2     1  
ATOM 492   O O2     . DT  A 1 16 ? -10.210 9.374   3.243   1.00 2.93  ? 16 DT  E O2     1  
ATOM 493   N N3     . DT  A 1 16 ? -10.336 8.962   1.019   1.00 2.87  ? 16 DT  E N3     1  
ATOM 494   C C4     . DT  A 1 16 ? -10.399 8.153   -0.092  1.00 2.90  ? 16 DT  E C4     1  
ATOM 495   O O4     . DT  A 1 16 ? -10.515 8.657   -1.208  1.00 2.90  ? 16 DT  E O4     1  
ATOM 496   C C5     . DT  A 1 16 ? -10.382 6.729   0.182   1.00 2.99  ? 16 DT  E C5     1  
ATOM 497   C C7     . DT  A 1 16 ? -10.514 5.775   -0.962  1.00 3.08  ? 16 DT  E C7     1  
ATOM 498   C C6     . DT  A 1 16 ? -10.321 6.326   1.462   1.00 3.04  ? 16 DT  E C6     1  
ATOM 499   H "H5'"  . DT  A 1 16 ? -7.590  4.796   3.637   1.00 3.25  ? 16 DT  E "H5'"  1  
ATOM 500   H "H5''" . DT  A 1 16 ? -7.545  3.736   5.059   1.00 3.46  ? 16 DT  E "H5''" 1  
ATOM 501   H "H4'"  . DT  A 1 16 ? -8.472  5.431   6.158   1.00 3.38  ? 16 DT  E "H4'"  1  
ATOM 502   H "H3'"  . DT  A 1 16 ? -10.557 3.890   5.610   1.00 3.52  ? 16 DT  E "H3'"  1  
ATOM 503   H "H2'"  . DT  A 1 16 ? -11.058 4.759   3.389   1.00 3.28  ? 16 DT  E "H2'"  1  
ATOM 504   H "H2''" . DT  A 1 16 ? -12.188 5.630   4.405   1.00 3.27  ? 16 DT  E "H2''" 1  
ATOM 505   H "H1'"  . DT  A 1 16 ? -10.768 7.566   4.519   1.00 3.10  ? 16 DT  E "H1'"  1  
ATOM 506   H H3     . DT  A 1 16 ? -10.363 9.960   0.859   1.00 2.84  ? 16 DT  E H3     1  
ATOM 507   H H71    . DT  A 1 16 ? -9.618  5.826   -1.582  1.00 3.29  ? 16 DT  E H71    1  
ATOM 508   H H72    . DT  A 1 16 ? -10.635 4.762   -0.580  1.00 3.10  ? 16 DT  E H72    1  
ATOM 509   H H73    . DT  A 1 16 ? -11.385 6.042   -1.559  1.00 3.40  ? 16 DT  E H73    1  
ATOM 510   H H6     . DT  A 1 16 ? -10.287 5.257   1.668   1.00 3.13  ? 16 DT  E H6     1  
ATOM 511   P P      . DG  A 1 17 ? -12.156 5.255   7.385   1.00 3.61  ? 17 DG  E P      1  
ATOM 512   O OP1    . DG  A 1 17 ? -11.756 4.463   8.576   1.00 3.84  ? 17 DG  E OP1    1  
ATOM 513   O OP2    . DG  A 1 17 ? -13.155 4.702   6.436   1.00 3.56  ? 17 DG  E OP2    1  
ATOM 514   O "O5'"  . DG  A 1 17 ? -12.666 6.679   7.882   1.00 3.57  ? 17 DG  E "O5'"  1  
ATOM 515   C "C5'"  . DG  A 1 17 ? -11.757 7.785   7.851   1.00 3.50  ? 17 DG  E "C5'"  1  
ATOM 516   C "C4'"  . DG  A 1 17 ? -12.485 9.109   7.880   1.00 3.48  ? 17 DG  E "C4'"  1  
ATOM 517   O "O4'"  . DG  A 1 17 ? -12.416 9.719   6.566   1.00 3.30  ? 17 DG  E "O4'"  1  
ATOM 518   C "C3'"  . DG  A 1 17 ? -13.980 9.003   8.169   1.00 3.57  ? 17 DG  E "C3'"  1  
ATOM 519   O "O3'"  . DG  A 1 17 ? -14.422 10.261  8.670   1.00 3.64  ? 17 DG  E "O3'"  1  
ATOM 520   C "C2'"  . DG  A 1 17 ? -14.586 8.776   6.798   1.00 3.42  ? 17 DG  E "C2'"  1  
ATOM 521   C "C1'"  . DG  A 1 17 ? -13.684 9.639   5.924   1.00 3.27  ? 17 DG  E "C1'"  1  
ATOM 522   N N9     . DG  A 1 17 ? -13.507 9.193   4.544   1.00 3.14  ? 17 DG  E N9     1  
ATOM 523   C C8     . DG  A 1 17 ? -13.256 7.925   4.088   1.00 3.13  ? 17 DG  E C8     1  
ATOM 524   N N7     . DG  A 1 17 ? -13.217 7.846   2.782   1.00 3.04  ? 17 DG  E N7     1  
ATOM 525   C C5     . DG  A 1 17 ? -13.443 9.147   2.353   1.00 2.98  ? 17 DG  E C5     1  
ATOM 526   C C6     . DG  A 1 17 ? -13.524 9.693   1.037   1.00 2.92  ? 17 DG  E C6     1  
ATOM 527   O O6     . DG  A 1 17 ? -13.421 9.108   -0.055  1.00 2.91  ? 17 DG  E O6     1  
ATOM 528   N N1     . DG  A 1 17 ? -13.757 11.066  1.065   1.00 2.93  ? 17 DG  E N1     1  
ATOM 529   C C2     . DG  A 1 17 ? -13.902 11.817  2.206   1.00 2.99  ? 17 DG  E C2     1  
ATOM 530   N N2     . DG  A 1 17 ? -14.113 13.128  2.033   1.00 3.04  ? 17 DG  E N2     1  
ATOM 531   N N3     . DG  A 1 17 ? -13.841 11.322  3.431   1.00 3.05  ? 17 DG  E N3     1  
ATOM 532   C C4     . DG  A 1 17 ? -13.610 9.993   3.430   1.00 3.04  ? 17 DG  E C4     1  
ATOM 533   H "H5'"  . DG  A 1 17 ? -11.155 7.732   6.943   1.00 3.39  ? 17 DG  E "H5'"  1  
ATOM 534   H "H5''" . DG  A 1 17 ? -11.095 7.731   8.714   1.00 3.59  ? 17 DG  E "H5''" 1  
ATOM 535   H "H4'"  . DG  A 1 17 ? -12.046 9.723   8.669   1.00 3.57  ? 17 DG  E "H4'"  1  
ATOM 536   H "H3'"  . DG  A 1 17 ? -14.211 8.212   8.879   1.00 3.69  ? 17 DG  E "H3'"  1  
ATOM 537   H "H2'"  . DG  A 1 17 ? -14.543 7.723   6.520   1.00 3.41  ? 17 DG  E "H2'"  1  
ATOM 538   H "H2''" . DG  A 1 17 ? -15.631 9.074   6.775   1.00 3.44  ? 17 DG  E "H2''" 1  
ATOM 539   H "H1'"  . DG  A 1 17 ? -14.080 10.657  5.890   1.00 3.28  ? 17 DG  E "H1'"  1  
ATOM 540   H H8     . DG  A 1 17 ? -13.112 7.081   4.739   1.00 3.22  ? 17 DG  E H8     1  
ATOM 541   H H1     . DG  A 1 17 ? -13.827 11.546  0.176   1.00 2.92  ? 17 DG  E H1     1  
ATOM 542   H H21    . DG  A 1 17 ? -14.224 13.730  2.838   1.00 3.12  ? 17 DG  E H21    1  
ATOM 543   H H22    . DG  A 1 17 ? -14.161 13.533  1.107   1.00 3.03  ? 17 DG  E H22    1  
ATOM 544   P P      . DG  A 1 18 ? -15.770 10.373  9.526   1.00 3.81  ? 18 DG  E P      1  
ATOM 545   O OP1    . DG  A 1 18 ? -15.448 10.380  10.976  1.00 4.03  ? 18 DG  E OP1    1  
ATOM 546   O OP2    . DG  A 1 18 ? -16.755 9.396   8.997   1.00 3.77  ? 18 DG  E OP2    1  
ATOM 547   O "O5'"  . DG  A 1 18 ? -16.243 11.834  9.112   1.00 3.80  ? 18 DG  E "O5'"  1  
ATOM 548   C "C5'"  . DG  A 1 18 ? -15.358 12.652  8.342   1.00 3.73  ? 18 DG  E "C5'"  1  
ATOM 549   C "C4'"  . DG  A 1 18 ? -16.117 13.690  7.550   1.00 3.69  ? 18 DG  E "C4'"  1  
ATOM 550   O "O4'"  . DG  A 1 18 ? -16.126 13.308  6.152   1.00 3.50  ? 18 DG  E "O4'"  1  
ATOM 551   C "C3'"  . DG  A 1 18 ? -17.593 13.799  7.925   1.00 3.79  ? 18 DG  E "C3'"  1  
ATOM 552   O "O3'"  . DG  A 1 18 ? -18.040 15.089  7.521   1.00 3.83  ? 18 DG  E "O3'"  1  
ATOM 553   C "C2'"  . DG  A 1 18 ? -18.252 12.744  7.057   1.00 3.66  ? 18 DG  E "C2'"  1  
ATOM 554   C "C1'"  . DG  A 1 18 ? -17.420 12.849  5.786   1.00 3.49  ? 18 DG  E "C1'"  1  
ATOM 555   N N9     . DG  A 1 18 ? -17.299 11.640  4.973   1.00 3.37  ? 18 DG  E N9     1  
ATOM 556   C C8     . DG  A 1 18 ? -17.189 10.336  5.385   1.00 3.38  ? 18 DG  E C8     1  
ATOM 557   N N7     . DG  A 1 18 ? -17.163 9.484   4.391   1.00 3.30  ? 18 DG  E N7     1  
ATOM 558   C C5     . DG  A 1 18 ? -17.254 10.281  3.256   1.00 3.23  ? 18 DG  E C5     1  
ATOM 559   C C6     . DG  A 1 18 ? -17.285 9.931   1.868   1.00 3.17  ? 18 DG  E C6     1  
ATOM 560   O O6     . DG  A 1 18 ? -17.244 8.805   1.349   1.00 3.16  ? 18 DG  E O6     1  
ATOM 561   N N1     . DG  A 1 18 ? -17.380 11.061  1.059   1.00 3.15  ? 18 DG  E N1     1  
ATOM 562   C C2     . DG  A 1 18 ? -17.440 12.356  1.517   1.00 3.20  ? 18 DG  E C2     1  
ATOM 563   N N2     . DG  A 1 18 ? -17.520 13.317  0.589   1.00 3.22  ? 18 DG  E N2     1  
ATOM 564   N N3     . DG  A 1 18 ? -17.418 12.690  2.793   1.00 3.26  ? 18 DG  E N3     1  
ATOM 565   C C4     . DG  A 1 18 ? -17.325 11.613  3.600   1.00 3.27  ? 18 DG  E C4     1  
ATOM 566   H "H5'"  . DG  A 1 18 ? -14.794 12.025  7.651   1.00 3.60  ? 18 DG  E "H5'"  1  
ATOM 567   H "H5''" . DG  A 1 18 ? -14.659 13.157  9.007   1.00 3.84  ? 18 DG  E "H5''" 1  
ATOM 568   H "H4'"  . DG  A 1 18 ? -15.663 14.664  7.737   1.00 3.75  ? 18 DG  E "H4'"  1  
ATOM 569   H "H3'"  . DG  A 1 18 ? -17.767 13.654  8.990   1.00 3.93  ? 18 DG  E "H3'"  1  
ATOM 570   H "H2'"  . DG  A 1 18 ? -18.179 11.757  7.515   1.00 3.67  ? 18 DG  E "H2'"  1  
ATOM 571   H "H2''" . DG  A 1 18 ? -19.307 12.954  6.913   1.00 3.69  ? 18 DG  E "H2''" 1  
ATOM 572   H "H1'"  . DG  A 1 18 ? -17.846 13.625  5.144   1.00 3.48  ? 18 DG  E "H1'"  1  
ATOM 573   H H8     . DG  A 1 18 ? -17.141 10.041  6.422   1.00 3.48  ? 18 DG  E H8     1  
ATOM 574   H H1     . DG  A 1 18 ? -17.406 10.918  0.059   1.00 3.14  ? 18 DG  E H1     1  
ATOM 575   H H21    . DG  A 1 18 ? -17.564 14.284  0.876   1.00 3.27  ? 18 DG  E H21    1  
ATOM 576   H H22    . DG  A 1 18 ? -17.547 13.090  -0.396  1.00 3.20  ? 18 DG  E H22    1  
ATOM 577   P P      . DA  A 1 19 ? -19.325 15.760  8.194   1.00 4.01  ? 19 DA  E P      1  
ATOM 578   O OP1    . DA  A 1 19 ? -18.892 16.630  9.317   1.00 4.19  ? 19 DA  E OP1    1  
ATOM 579   O OP2    . DA  A 1 19 ? -20.352 14.712  8.430   1.00 4.02  ? 19 DA  E OP2    1  
ATOM 580   O "O5'"  . DA  A 1 19 ? -19.833 16.696  7.010   1.00 3.96  ? 19 DA  E "O5'"  1  
ATOM 581   C "C5'"  . DA  A 1 19 ? -18.902 17.138  6.018   1.00 3.84  ? 19 DA  E "C5'"  1  
ATOM 582   C "C4'"  . DA  A 1 19 ? -19.598 17.491  4.723   1.00 3.81  ? 19 DA  E "C4'"  1  
ATOM 583   O "O4'"  . DA  A 1 19 ? -19.524 16.360  3.820   1.00 3.64  ? 19 DA  E "O4'"  1  
ATOM 584   C "C3'"  . DA  A 1 19 ? -21.092 17.766  4.862   1.00 3.92  ? 19 DA  E "C3'"  1  
ATOM 585   O "O3'"  . DA  A 1 19 ? -21.501 18.549  3.743   1.00 3.96  ? 19 DA  E "O3'"  1  
ATOM 586   C "C2'"  . DA  A 1 19 ? -21.714 16.389  4.743   1.00 3.82  ? 19 DA  E "C2'"  1  
ATOM 587   C "C1'"  . DA  A 1 19 ? -20.800 15.736  3.717   1.00 3.66  ? 19 DA  E "C1'"  1  
ATOM 588   N N9     . DA  A 1 19 ? -20.644 14.288  3.829   1.00 3.56  ? 19 DA  E N9     1  
ATOM 589   C C8     . DA  A 1 19 ? -20.485 13.508  4.943   1.00 3.59  ? 19 DA  E C8     1  
ATOM 590   N N7     . DA  A 1 19 ? -20.412 12.223  4.685   1.00 3.52  ? 19 DA  E N7     1  
ATOM 591   C C5     . DA  A 1 19 ? -20.529 12.154  3.304   1.00 3.43  ? 19 DA  E C5     1  
ATOM 592   C C6     . DA  A 1 19 ? -20.534 11.072  2.400   1.00 3.36  ? 19 DA  E C6     1  
ATOM 593   N N6     . DA  A 1 19 ? -20.419 9.795   2.770   1.00 3.36  ? 19 DA  E N6     1  
ATOM 594   N N1     . DA  A 1 19 ? -20.668 11.352  1.086   1.00 3.33  ? 19 DA  E N1     1  
ATOM 595   C C2     . DA  A 1 19 ? -20.791 12.633  0.713   1.00 3.36  ? 19 DA  E C2     1  
ATOM 596   N N3     . DA  A 1 19 ? -20.803 13.732  1.463   1.00 3.43  ? 19 DA  E N3     1  
ATOM 597   C C4     . DA  A 1 19 ? -20.665 13.419  2.763   1.00 3.45  ? 19 DA  E C4     1  
ATOM 598   H "H5'"  . DA  A 1 19 ? -18.177 16.348  5.824   1.00 3.73  ? 19 DA  E "H5'"  1  
ATOM 599   H "H5''" . DA  A 1 19 ? -18.373 18.018  6.383   1.00 3.92  ? 19 DA  E "H5''" 1  
ATOM 600   H "H4'"  . DA  A 1 19 ? -19.138 18.398  4.326   1.00 3.85  ? 19 DA  E "H4'"  1  
ATOM 601   H "H3'"  . DA  A 1 19 ? -21.341 18.275  5.790   1.00 4.06  ? 19 DA  E "H3'"  1  
ATOM 602   H "H2'"  . DA  A 1 19 ? -21.698 15.867  5.699   1.00 3.86  ? 19 DA  E "H2'"  1  
ATOM 603   H "H2''" . DA  A 1 19 ? -22.752 16.452  4.428   1.00 3.86  ? 19 DA  E "H2''" 1  
ATOM 604   H "H1'"  . DA  A 1 19 ? -21.170 15.949  2.710   1.00 3.64  ? 19 DA  E "H1'"  1  
ATOM 605   H H8     . DA  A 1 19 ? -20.433 13.914  5.941   1.00 3.70  ? 19 DA  E H8     1  
ATOM 606   H H61    . DA  A 1 19 ? -20.320 9.568   3.749   1.00 3.42  ? 19 DA  E H61    1  
ATOM 607   H H62    . DA  A 1 19 ? -20.429 9.062   2.076   1.00 3.35  ? 19 DA  E H62    1  
ATOM 608   H H2     . DA  A 1 19 ? -20.901 12.799  -0.360  1.00 3.37  ? 19 DA  E H2     1  
ATOM 609   P P      . DA  A 1 20 ? -22.834 19.427  3.803   1.00 4.14  ? 20 DA  E P      1  
ATOM 610   O OP1    . DA  A 1 20 ? -22.489 20.828  4.148   1.00 4.31  ? 20 DA  E OP1    1  
ATOM 611   O OP2    . DA  A 1 20 ? -23.848 18.700  4.608   1.00 4.16  ? 20 DA  E OP2    1  
ATOM 612   O "O5'"  . DA  A 1 20 ? -23.278 19.385  2.274   1.00 4.09  ? 20 DA  E "O5'"  1  
ATOM 613   C "C5'"  . DA  A 1 20 ? -22.336 18.945  1.292   1.00 3.97  ? 20 DA  E "C5'"  1  
ATOM 614   C "C4'"  . DA  A 1 20 ? -23.024 18.452  0.039   1.00 3.94  ? 20 DA  E "C4'"  1  
ATOM 615   O "O4'"  . DA  A 1 20 ? -22.956 17.006  0.001   1.00 3.79  ? 20 DA  E "O4'"  1  
ATOM 616   C "C3'"  . DA  A 1 20 ? -24.517 18.763  -0.041  1.00 4.07  ? 20 DA  E "C3'"  1  
ATOM 617   O "O3'"  . DA  A 1 20 ? -24.895 18.722  -1.415  1.00 4.11  ? 20 DA  E "O3'"  1  
ATOM 618   C "C2'"  . DA  A 1 20 ? -25.153 17.597  0.689   1.00 3.98  ? 20 DA  E "C2'"  1  
ATOM 619   C "C1'"  . DA  A 1 20 ? -24.236 16.450  0.284   1.00 3.81  ? 20 DA  E "C1'"  1  
ATOM 620   N N9     . DA  A 1 20 ? -24.094 15.366  1.258   1.00 3.72  ? 20 DA  E N9     1  
ATOM 621   C C8     . DA  A 1 20 ? -23.990 15.413  2.623   1.00 3.76  ? 20 DA  E C8     1  
ATOM 622   N N7     . DA  A 1 20 ? -23.912 14.229  3.189   1.00 3.69  ? 20 DA  E N7     1  
ATOM 623   C C5     . DA  A 1 20 ? -23.971 13.344  2.120   1.00 3.58  ? 20 DA  E C5     1  
ATOM 624   C C6     . DA  A 1 20 ? -23.946 11.933  2.040   1.00 3.50  ? 20 DA  E C6     1  
ATOM 625   N N6     . DA  A 1 20 ? -23.858 11.121  3.100   1.00 3.51  ? 20 DA  E N6     1  
ATOM 626   N N1     . DA  A 1 20 ? -24.020 11.374  0.812   1.00 3.45  ? 20 DA  E N1     1  
ATOM 627   C C2     . DA  A 1 20 ? -24.117 12.178  -0.255  1.00 3.48  ? 20 DA  E C2     1  
ATOM 628   N N3     . DA  A 1 20 ? -24.151 13.505  -0.308  1.00 3.55  ? 20 DA  E N3     1  
ATOM 629   C C4     . DA  A 1 20 ? -24.074 14.033  0.925   1.00 3.60  ? 20 DA  E C4     1  
ATOM 630   H "H5'"  . DA  A 1 20 ? -21.735 18.135  1.706   1.00 3.87  ? 20 DA  E "H5'"  1  
ATOM 631   H "H5''" . DA  A 1 20 ? -21.678 19.772  1.029   1.00 4.02  ? 20 DA  E "H5''" 1  
ATOM 632   H "H4'"  . DA  A 1 20 ? -22.551 18.931  -0.818  1.00 3.98  ? 20 DA  E "H4'"  1  
ATOM 633   H "H3'"  . DA  A 1 20 ? -24.767 19.729  0.390   1.00 4.20  ? 20 DA  E "H3'"  1  
ATOM 634   H "H2'"  . DA  A 1 20 ? -25.154 17.763  1.766   1.00 4.01  ? 20 DA  E "H2'"  1  
ATOM 635   H "H2''" . DA  A 1 20 ? -26.186 17.458  0.384   1.00 4.03  ? 20 DA  E "H2''" 1  
ATOM 636   H "H1'"  . DA  A 1 20 ? -24.596 16.007  -0.648  1.00 3.80  ? 20 DA  E "H1'"  1  
ATOM 637   H H8     . DA  A 1 20 ? -23.991 16.338  3.181   1.00 3.88  ? 20 DA  E H8     1  
ATOM 638   H H61    . DA  A 1 20 ? -23.804 11.510  4.031   1.00 3.58  ? 20 DA  E H61    1  
ATOM 639   H H62    . DA  A 1 20 ? -23.856 10.118  2.980   1.00 3.48  ? 20 DA  E H62    1  
ATOM 640   H H2     . DA  A 1 20 ? -24.178 11.672  -1.217  1.00 3.46  ? 20 DA  E H2     1  
ATOM 641   P P      . DA  A 1 21 ? -26.205 19.488  -1.931  1.00 4.29  ? 21 DA  E P      1  
ATOM 642   O OP1    . DA  A 1 21 ? -25.828 20.811  -2.489  1.00 4.45  ? 21 DA  E OP1    1  
ATOM 643   O OP2    . DA  A 1 21 ? -27.259 19.402  -0.889  1.00 4.32  ? 21 DA  E OP2    1  
ATOM 644   O "O5'"  . DA  A 1 21 ? -26.628 18.548  -3.144  1.00 4.25  ? 21 DA  E "O5'"  1  
ATOM 645   C "C5'"  . DA  A 1 21 ? -25.661 17.652  -3.691  1.00 4.13  ? 21 DA  E "C5'"  1  
ATOM 646   C "C4'"  . DA  A 1 21 ? -26.318 16.508  -4.428  1.00 4.09  ? 21 DA  E "C4'"  1  
ATOM 647   O "O4'"  . DA  A 1 21 ? -26.259 15.317  -3.604  1.00 3.92  ? 21 DA  E "O4'"  1  
ATOM 648   C "C3'"  . DA  A 1 21 ? -27.806 16.697  -4.711  1.00 4.23  ? 21 DA  E "C3'"  1  
ATOM 649   O "O3'"  . DA  A 1 21 ? -28.151 15.842  -5.798  1.00 4.26  ? 21 DA  E "O3'"  1  
ATOM 650   C "C2'"  . DA  A 1 21 ? -28.470 16.177  -3.451  1.00 4.14  ? 21 DA  E "C2'"  1  
ATOM 651   C "C1'"  . DA  A 1 21 ? -27.550 15.021  -3.080  1.00 3.95  ? 21 DA  E "C1'"  1  
ATOM 652   N N9     . DA  A 1 21 ? -27.442 14.721  -1.651  1.00 3.85  ? 21 DA  E N9     1  
ATOM 653   C C8     . DA  A 1 21 ? -27.357 15.575  -0.583  1.00 3.90  ? 21 DA  E C8     1  
ATOM 654   N N7     . DA  A 1 21 ? -27.329 14.965  0.581   1.00 3.84  ? 21 DA  E N7     1  
ATOM 655   C C5     . DA  A 1 21 ? -27.394 13.617  0.254   1.00 3.74  ? 21 DA  E C5     1  
ATOM 656   C C6     . DA  A 1 21 ? -27.410 12.444  1.038   1.00 3.68  ? 21 DA  E C6     1  
ATOM 657   N N6     . DA  A 1 21 ? -27.378 12.438  2.374   1.00 3.71  ? 21 DA  E N6     1  
ATOM 658   N N1     . DA  A 1 21 ? -27.471 11.258  0.393   1.00 3.62  ? 21 DA  E N1     1  
ATOM 659   C C2     . DA  A 1 21 ? -27.523 11.259  -0.946  1.00 3.64  ? 21 DA  E C2     1  
ATOM 660   N N3     . DA  A 1 21 ? -27.519 12.290  -1.789  1.00 3.71  ? 21 DA  E N3     1  
ATOM 661   C C4     . DA  A 1 21 ? -27.451 13.453  -1.118  1.00 3.75  ? 21 DA  E C4     1  
ATOM 662   H "H5'"  . DA  A 1 21 ? -25.049 17.246  -2.885  1.00 4.01  ? 21 DA  E "H5'"  1  
ATOM 663   H "H5''" . DA  A 1 21 ? -25.017 18.193  -4.382  1.00 4.19  ? 21 DA  E "H5''" 1  
ATOM 664   H "H4'"  . DA  A 1 21 ? -25.818 16.397  -5.391  1.00 4.12  ? 21 DA  E "H4'"  1  
ATOM 665   H "H3'"  . DA  A 1 21 ? -28.062 17.728  -4.944  1.00 4.38  ? 21 DA  E "H3'"  1  
ATOM 666   H "H2'"  . DA  A 1 21 ? -28.501 16.944  -2.677  1.00 4.19  ? 21 DA  E "H2'"  1  
ATOM 667   H "H2''" . DA  A 1 21 ? -29.496 15.873  -3.646  1.00 4.20  ? 21 DA  E "H2''" 1  
ATOM 668   H "H1'"  . DA  A 1 21 ? -27.889 14.111  -3.581  1.00 3.92  ? 21 DA  E "H1'"  1  
ATOM 669   H H8     . DA  A 1 21 ? -27.328 16.647  -0.689  1.00 4.01  ? 21 DA  E H8     1  
ATOM 670   H H61    . DA  A 1 21 ? -27.339 13.319  2.871   1.00 3.78  ? 21 DA  E H61    1  
ATOM 671   H H62    . DA  A 1 21 ? -27.410 11.571  2.890   1.00 3.69  ? 21 DA  E H62    1  
ATOM 672   H H2     . DA  A 1 21 ? -27.576 10.275  -1.412  1.00 3.63  ? 21 DA  E H2     1  
ATOM 673   P P      . DC  A 1 22 ? -29.460 16.115  -6.675  1.00 4.46  ? 22 DC  E P      1  
ATOM 674   O OP1    . DC  A 1 22 ? -29.086 16.848  -7.911  1.00 4.62  ? 22 DC  E OP1    1  
ATOM 675   O OP2    . DC  A 1 22 ? -30.526 16.653  -5.791  1.00 4.50  ? 22 DC  E OP2    1  
ATOM 676   O "O5'"  . DC  A 1 22 ? -29.838 14.620  -7.072  1.00 4.40  ? 22 DC  E "O5'"  1  
ATOM 677   C "C5'"  . DC  A 1 22 ? -28.855 13.597  -6.901  1.00 4.27  ? 22 DC  E "C5'"  1  
ATOM 678   C "C4'"  . DC  A 1 22 ? -29.484 12.225  -6.817  1.00 4.24  ? 22 DC  E "C4'"  1  
ATOM 679   O "O4'"  . DC  A 1 22 ? -29.432 11.763  -5.444  1.00 4.10  ? 22 DC  E "O4'"  1  
ATOM 680   C "C3'"  . DC  A 1 22 ? -30.967 12.184  -7.172  1.00 4.36  ? 22 DC  E "C3'"  1  
ATOM 681   O "O3'"  . DC  A 1 22 ? -31.289 10.844  -7.533  1.00 4.37  ? 22 DC  E "O3'"  1  
ATOM 682   C "C2'"  . DC  A 1 22 ? -31.652 12.506  -5.858  1.00 4.29  ? 22 DC  E "C2'"  1  
ATOM 683   C "C1'"  . DC  A 1 22 ? -30.732 11.810  -4.865  1.00 4.13  ? 22 DC  E "C1'"  1  
ATOM 684   N N1     . DC  A 1 22 ? -30.654 12.397  -3.515  1.00 4.06  ? 22 DC  E N1     1  
ATOM 685   C C2     . DC  A 1 22 ? -30.663 11.524  -2.419  1.00 3.97  ? 22 DC  E C2     1  
ATOM 686   O O2     . DC  A 1 22 ? -30.653 10.301  -2.627  1.00 3.95  ? 22 DC  E O2     1  
ATOM 687   N N3     . DC  A 1 22 ? -30.683 12.028  -1.167  1.00 3.95  ? 22 DC  E N3     1  
ATOM 688   C C4     . DC  A 1 22 ? -30.685 13.348  -0.980  1.00 4.01  ? 22 DC  E C4     1  
ATOM 689   N N4     . DC  A 1 22 ? -30.749 13.797  0.276   1.00 4.02  ? 22 DC  E N4     1  
ATOM 690   C C5     . DC  A 1 22 ? -30.633 14.265  -2.074  1.00 4.09  ? 22 DC  E C5     1  
ATOM 691   C C6     . DC  A 1 22 ? -30.615 13.748  -3.315  1.00 4.12  ? 22 DC  E C6     1  
ATOM 692   H "H5'"  . DC  A 1 22 ? -28.292 13.785  -5.986  1.00 4.16  ? 22 DC  E "H5'"  1  
ATOM 693   H "H5''" . DC  A 1 22 ? -28.165 13.615  -7.745  1.00 4.31  ? 22 DC  E "H5''" 1  
ATOM 694   H "H4'"  . DC  A 1 22 ? -28.965 11.570  -7.517  1.00 4.25  ? 22 DC  E "H4'"  1  
ATOM 695   H "H3'"  . DC  A 1 22 ? -31.227 12.868  -7.978  1.00 4.48  ? 22 DC  E "H3'"  1  
ATOM 696   H "H2'"  . DC  A 1 22 ? -31.701 13.583  -5.693  1.00 4.34  ? 22 DC  E "H2'"  1  
ATOM 697   H "H2''" . DC  A 1 22 ? -32.673 12.128  -5.841  1.00 4.34  ? 22 DC  E "H2''" 1  
ATOM 698   H "H1'"  . DC  A 1 22 ? -31.052 10.772  -4.747  1.00 4.11  ? 22 DC  E "H1'"  1  
ATOM 699   H H41    . DC  A 1 22 ? -30.760 14.791  0.454   1.00 4.08  ? 22 DC  E H41    1  
ATOM 700   H H42    . DC  A 1 22 ? -30.799 13.150  1.050   1.00 3.98  ? 22 DC  E H42    1  
ATOM 701   H H5     . DC  A 1 22 ? -30.610 15.342  -1.909  1.00 4.16  ? 22 DC  E H5     1  
ATOM 702   H H6     . DC  A 1 22 ? -30.569 14.418  -4.173  1.00 4.21  ? 22 DC  E H6     1  
ATOM 703   P P      . DC  A 1 23 ? -32.579 10.517  -8.419  1.00 4.53  ? 23 DC  E P      1  
ATOM 704   O OP1    . DC  A 1 23 ? -32.181 10.343  -9.839  1.00 4.67  ? 23 DC  E OP1    1  
ATOM 705   O OP2    . DC  A 1 23 ? -33.659 11.471  -8.067  1.00 4.58  ? 23 DC  E OP2    1  
ATOM 706   O "O5'"  . DC  A 1 23 ? -32.960 9.087   -7.828  1.00 4.47  ? 23 DC  E "O5'"  1  
ATOM 707   C "C5'"  . DC  A 1 23 ? -31.985 8.378   -7.055  1.00 4.34  ? 23 DC  E "C5'"  1  
ATOM 708   C "C4'"  . DC  A 1 23 ? -32.614 7.277   -6.230  1.00 4.30  ? 23 DC  E "C4'"  1  
ATOM 709   O "O4'"  . DC  A 1 23 ? -32.581 7.654   -4.829  1.00 4.18  ? 23 DC  E "O4'"  1  
ATOM 710   C "C3'"  . DC  A 1 23 ? -34.093 7.031   -6.521  1.00 4.42  ? 23 DC  E "C3'"  1  
ATOM 711   O "O3'"  . DC  A 1 23 ? -34.419 5.705   -6.109  1.00 4.42  ? 23 DC  E "O3'"  1  
ATOM 712   C "C2'"  . DC  A 1 23 ? -34.795 8.021   -5.611  1.00 4.38  ? 23 DC  E "C2'"  1  
ATOM 713   C "C1'"  . DC  A 1 23 ? -33.888 8.004   -4.387  1.00 4.23  ? 23 DC  E "C1'"  1  
ATOM 714   N N1     . DC  A 1 23 ? -33.823 9.245   -3.590  1.00 4.19  ? 23 DC  E N1     1  
ATOM 715   C C2     . DC  A 1 23 ? -33.922 9.138   -2.192  1.00 4.13  ? 23 DC  E C2     1  
ATOM 716   O O2     . DC  A 1 23 ? -34.006 8.011   -1.679  1.00 4.11  ? 23 DC  E O2     1  
ATOM 717   N N3     . DC  A 1 23 ? -33.925 10.259  -1.437  1.00 4.13  ? 23 DC  E N3     1  
ATOM 718   C C4     . DC  A 1 23 ? -33.831 11.453  -2.019  1.00 4.19  ? 23 DC  E C4     1  
ATOM 719   N N4     . DC  A 1 23 ? -33.865 12.530  -1.229  1.00 4.22  ? 23 DC  E N4     1  
ATOM 720   C C5     . DC  A 1 23 ? -33.704 11.598  -3.438  1.00 4.24  ? 23 DC  E C5     1  
ATOM 721   C C6     . DC  A 1 23 ? -33.700 10.474  -4.177  1.00 4.24  ? 23 DC  E C6     1  
ATOM 722   H "H5'"  . DC  A 1 23 ? -31.480 9.075   -6.386  1.00 4.25  ? 23 DC  E "H5'"  1  
ATOM 723   H "H5''" . DC  A 1 23 ? -31.246 7.936   -7.723  1.00 4.37  ? 23 DC  E "H5''" 1  
ATOM 724   H "H4'"  . DC  A 1 23 ? -32.084 6.348   -6.444  1.00 4.30  ? 23 DC  E "H4'"  1  
ATOM 725   H "H3'"  . DC  A 1 23 ? -34.335 7.169   -7.572  1.00 4.53  ? 23 DC  E "H3'"  1  
ATOM 726   H "H2'"  . DC  A 1 23 ? -34.856 9.009   -6.068  1.00 4.43  ? 23 DC  E "H2'"  1  
ATOM 727   H "H2''" . DC  A 1 23 ? -35.810 7.699   -5.387  1.00 4.42  ? 23 DC  E "H2''" 1  
ATOM 728   H "H1'"  . DC  A 1 23 ? -34.209 7.205   -3.714  1.00 4.21  ? 23 DC  E "H1'"  1  
ATOM 729   H H41    . DC  A 1 23 ? -33.800 13.450  -1.641  1.00 4.28  ? 23 DC  E H41    1  
ATOM 730   H H42    . DC  A 1 23 ? -33.971 12.434  -0.229  1.00 4.21  ? 23 DC  E H42    1  
ATOM 731   H H5     . DC  A 1 23 ? -33.617 12.581  -3.901  1.00 4.31  ? 23 DC  E H5     1  
ATOM 732   H H6     . DC  A 1 23 ? -33.593 10.545  -5.260  1.00 4.31  ? 23 DC  E H6     1  
ATOM 733   P P      . DT  A 1 24 ? -35.692 4.949   -6.722  1.00 4.57  ? 24 DT  E P      1  
ATOM 734   O OP1    . DT  A 1 24 ? -35.263 4.074   -7.842  1.00 4.69  ? 24 DT  E OP1    1  
ATOM 735   O OP2    . DT  A 1 24 ? -36.776 5.942   -6.938  1.00 4.65  ? 24 DT  E OP2    1  
ATOM 736   O "O5'"  . DT  A 1 24 ? -36.111 4.029   -5.491  1.00 4.52  ? 24 DT  E "O5'"  1  
ATOM 737   C "C5'"  . DT  A 1 24 ? -35.280 3.996   -4.327  1.00 4.39  ? 24 DT  E "C5'"  1  
ATOM 738   C "C4'"  . DT  A 1 24 ? -36.068 3.583   -3.105  1.00 4.38  ? 24 DT  E "C4'"  1  
ATOM 739   O "O4'"  . DT  A 1 24 ? -36.279 4.747   -2.270  1.00 4.31  ? 24 DT  E "O4'"  1  
ATOM 740   C "C3'"  . DT  A 1 24 ? -37.469 3.055   -3.393  1.00 4.51  ? 24 DT  E "C3'"  1  
ATOM 741   O "O3'"  . DT  A 1 24 ? -37.893 2.234   -2.306  1.00 4.53  ? 24 DT  E "O3'"  1  
ATOM 742   C "C2'"  . DT  A 1 24 ? -38.307 4.320   -3.427  1.00 4.50  ? 24 DT  E "C2'"  1  
ATOM 743   C "C1'"  . DT  A 1 24 ? -37.636 5.171   -2.354  1.00 4.38  ? 24 DT  E "C1'"  1  
ATOM 744   N N1     . DT  A 1 24 ? -37.659 6.637   -2.556  1.00 4.37  ? 24 DT  E N1     1  
ATOM 745   C C2     . DT  A 1 24 ? -37.655 7.411   -1.417  1.00 4.32  ? 24 DT  E C2     1  
ATOM 746   O O2     . DT  A 1 24 ? -37.635 6.936   -0.294  1.00 4.29  ? 24 DT  E O2     1  
ATOM 747   N N3     . DT  A 1 24 ? -37.680 8.762   -1.639  1.00 4.34  ? 24 DT  E N3     1  
ATOM 748   C C4     . DT  A 1 24 ? -37.715 9.406   -2.856  1.00 4.40  ? 24 DT  E C4     1  
ATOM 749   O O4     . DT  A 1 24 ? -37.729 10.636  -2.896  1.00 4.44  ? 24 DT  E O4     1  
ATOM 750   C C5     . DT  A 1 24 ? -37.722 8.536   -4.014  1.00 4.45  ? 24 DT  E C5     1  
ATOM 751   C C7     . DT  A 1 24 ? -37.781 9.148   -5.378  1.00 4.57  ? 24 DT  E C7     1  
ATOM 752   C C6     . DT  A 1 24 ? -37.691 7.208   -3.814  1.00 4.43  ? 24 DT  E C6     1  
ATOM 753   H "H5'"  . DT  A 1 24 ? -34.854 4.985   -4.156  1.00 4.31  ? 24 DT  E "H5'"  1  
ATOM 754   H "H5''" . DT  A 1 24 ? -34.469 3.285   -4.480  1.00 4.40  ? 24 DT  E "H5''" 1  
ATOM 755   H "H4'"  . DT  A 1 24 ? -35.520 2.784   -2.604  1.00 4.37  ? 24 DT  E "H4'"  1  
ATOM 756   H "H3'"  . DT  A 1 24 ? -37.512 2.493   -4.324  1.00 4.59  ? 24 DT  E "H3'"  1  
ATOM 757   H "H2'"  . DT  A 1 24 ? -38.279 4.791   -4.407  1.00 4.54  ? 24 DT  E "H2'"  1  
ATOM 758   H "H2''" . DT  A 1 24 ? -39.349 4.110   -3.191  1.00 4.56  ? 24 DT  E "H2''" 1  
ATOM 759   H "H1'"  . DT  A 1 24 ? -38.092 4.964   -1.382  1.00 4.39  ? 24 DT  E "H1'"  1  
ATOM 760   H H3     . DT  A 1 24 ? -37.663 9.355   -0.821  1.00 4.33  ? 24 DT  E H3     1  
ATOM 761   H H71    . DT  A 1 24 ? -37.861 8.362   -6.127  1.00 4.76  ? 24 DT  E H71    1  
ATOM 762   H H72    . DT  A 1 24 ? -36.876 9.729   -5.556  1.00 4.52  ? 24 DT  E H72    1  
ATOM 763   H H73    . DT  A 1 24 ? -38.650 9.802   -5.446  1.00 4.85  ? 24 DT  E H73    1  
ATOM 764   H H6     . DT  A 1 24 ? -37.690 6.553   -4.684  1.00 4.49  ? 24 DT  E H6     1  
ATOM 765   P P      . DT  A 1 25 ? -38.944 1.051   -2.551  1.00 4.67  ? 25 DT  E P      1  
ATOM 766   O OP1    . DT  A 1 25 ? -38.211 -0.230  -2.705  1.00 4.74  ? 25 DT  E OP1    1  
ATOM 767   O OP2    . DT  A 1 25 ? -39.898 1.481   -3.606  1.00 4.74  ? 25 DT  E OP2    1  
ATOM 768   O "O5'"  . DT  A 1 25 ? -39.733 0.991   -1.168  1.00 4.68  ? 25 DT  E "O5'"  1  
ATOM 769   C "C5'"  . DT  A 1 25 ? -39.132 1.487   0.029   1.00 4.59  ? 25 DT  E "C5'"  1  
ATOM 770   C "C4'"  . DT  A 1 25 ? -40.167 1.654   1.118   1.00 4.64  ? 25 DT  E "C4'"  1  
ATOM 771   O "O4'"  . DT  A 1 25 ? -40.409 3.070   1.307   1.00 4.57  ? 25 DT  E "O4'"  1  
ATOM 772   C "C3'"  . DT  A 1 25 ? -41.536 1.058   0.807   1.00 4.76  ? 25 DT  E "C3'"  1  
ATOM 773   O "O3'"  . DT  A 1 25 ? -42.240 0.732   2.010   1.00 4.84  ? 25 DT  E "O3'"  1  
ATOM 774   C "C2'"  . DT  A 1 25 ? -42.225 2.188   0.063   1.00 4.73  ? 25 DT  E "C2'"  1  
ATOM 775   C "C1'"  . DT  A 1 25 ? -41.676 3.430   0.767   1.00 4.62  ? 25 DT  E "C1'"  1  
ATOM 776   N N1     . DT  A 1 25 ? -41.496 4.639   -0.080  1.00 4.56  ? 25 DT  E N1     1  
ATOM 777   C C2     . DT  A 1 25 ? -41.449 5.864   0.561   1.00 4.53  ? 25 DT  E C2     1  
ATOM 778   O O2     . DT  A 1 25 ? -41.522 5.990   1.775   1.00 4.54  ? 25 DT  E O2     1  
ATOM 779   N N3     . DT  A 1 25 ? -41.313 6.943   -0.273  1.00 4.51  ? 25 DT  E N3     1  
ATOM 780   C C4     . DT  A 1 25 ? -41.218 6.928   -1.648  1.00 4.53  ? 25 DT  E C4     1  
ATOM 781   O O4     . DT  A 1 25 ? -41.094 7.985   -2.265  1.00 4.55  ? 25 DT  E O4     1  
ATOM 782   C C5     . DT  A 1 25 ? -41.267 5.618   -2.256  1.00 4.57  ? 25 DT  E C5     1  
ATOM 783   C C7     . DT  A 1 25 ? -41.222 5.512   -3.746  1.00 4.64  ? 25 DT  E C7     1  
ATOM 784   C C6     . DT  A 1 25 ? -41.394 4.548   -1.456  1.00 4.58  ? 25 DT  E C6     1  
ATOM 785   H "H5'"  . DT  A 1 25 ? -38.666 2.452   -0.171  1.00 4.50  ? 25 DT  E "H5'"  1  
ATOM 786   H "H5''" . DT  A 1 25 ? -38.368 0.787   0.370   1.00 4.60  ? 25 DT  E "H5''" 1  
ATOM 787   H "H4'"  . DT  A 1 25 ? -39.795 1.156   2.014   1.00 4.66  ? 25 DT  E "H4'"  1  
ATOM 788   H "H3'"  . DT  A 1 25 ? -41.443 0.163   0.191   1.00 4.83  ? 25 DT  E "H3'"  1  
ATOM 789   H "HO3'" . DT  A 1 25 ? -41.616 0.289   2.594   1.00 4.80  ? 25 DT  E "HO3'" 1  
ATOM 790   H "H2'"  . DT  A 1 25 ? -41.978 2.168   -0.996  1.00 4.73  ? 25 DT  E "H2'"  1  
ATOM 791   H "H2''" . DT  A 1 25 ? -43.309 2.115   0.147   1.00 4.80  ? 25 DT  E "H2''" 1  
ATOM 792   H "H1'"  . DT  A 1 25 ? -42.320 3.701   1.607   1.00 4.65  ? 25 DT  E "H1'"  1  
ATOM 793   H H3     . DT  A 1 25 ? -41.294 7.847   0.177   1.00 4.51  ? 25 DT  E H3     1  
ATOM 794   H H71    . DT  A 1 25 ? -42.104 5.994   -4.171  1.00 4.78  ? 25 DT  E H71    1  
ATOM 795   H H72    . DT  A 1 25 ? -40.325 6.002   -4.121  1.00 4.58  ? 25 DT  E H72    1  
ATOM 796   H H73    . DT  A 1 25 ? -41.210 4.461   -4.035  1.00 4.72  ? 25 DT  E H73    1  
ATOM 797   H H6     . DT  A 1 25 ? -41.414 3.561   -1.916  1.00 4.63  ? 25 DT  E H6     1  
ATOM 798   O "O5'"  . DA  B 2 1  ? -40.881 17.005  2.190   1.00 5.07  ? 1  DA  F "O5'"  1  
ATOM 799   C "C5'"  . DA  B 2 1  ? -42.078 17.209  2.944   1.00 5.14  ? 1  DA  F "C5'"  1  
ATOM 800   C "C4'"  . DA  B 2 1  ? -42.117 16.293  4.144   1.00 5.09  ? 1  DA  F "C4'"  1  
ATOM 801   O "O4'"  . DA  B 2 1  ? -42.560 14.986  3.704   1.00 4.99  ? 1  DA  F "O4'"  1  
ATOM 802   C "C3'"  . DA  B 2 1  ? -40.771 16.047  4.819   1.00 5.01  ? 1  DA  F "C3'"  1  
ATOM 803   O "O3'"  . DA  B 2 1  ? -40.929 15.687  6.192   1.00 5.06  ? 1  DA  F "O3'"  1  
ATOM 804   C "C2'"  . DA  B 2 1  ? -40.217 14.883  4.025   1.00 4.84  ? 1  DA  F "C2'"  1  
ATOM 805   C "C1'"  . DA  B 2 1  ? -41.461 14.074  3.691   1.00 4.85  ? 1  DA  F "C1'"  1  
ATOM 806   N N9     . DA  B 2 1  ? -41.406 13.445  2.371   1.00 4.77  ? 1  DA  F N9     1  
ATOM 807   C C8     . DA  B 2 1  ? -41.345 14.081  1.155   1.00 4.80  ? 1  DA  F C8     1  
ATOM 808   N N7     . DA  B 2 1  ? -41.293 13.263  0.133   1.00 4.74  ? 1  DA  F N7     1  
ATOM 809   C C5     . DA  B 2 1  ? -41.320 12.002  0.711   1.00 4.66  ? 1  DA  F C5     1  
ATOM 810   C C6     . DA  B 2 1  ? -41.291 10.710  0.157   1.00 4.60  ? 1  DA  F C6     1  
ATOM 811   N N6     . DA  B 2 1  ? -41.217 10.468  -1.153  1.00 4.61  ? 1  DA  F N6     1  
ATOM 812   N N1     . DA  B 2 1  ? -41.340 9.661   1.007   1.00 4.56  ? 1  DA  F N1     1  
ATOM 813   C C2     . DA  B 2 1  ? -41.410 9.904   2.322   1.00 4.58  ? 1  DA  F C2     1  
ATOM 814   N N3     . DA  B 2 1  ? -41.440 11.075  2.964   1.00 4.64  ? 1  DA  F N3     1  
ATOM 815   C C4     . DA  B 2 1  ? -41.394 12.098  2.089   1.00 4.67  ? 1  DA  F C4     1  
ATOM 816   H "H5'"  . DA  B 2 1  ? -42.944 17.007  2.313   1.00 5.11  ? 1  DA  F "H5'"  1  
ATOM 817   H "H5''" . DA  B 2 1  ? -42.120 18.242  3.285   1.00 5.29  ? 1  DA  F "H5''" 1  
ATOM 818   H "H4'"  . DA  B 2 1  ? -42.772 16.743  4.892   1.00 5.20  ? 1  DA  F "H4'"  1  
ATOM 819   H "H3'"  . DA  B 2 1  ? -40.131 16.928  4.748   1.00 5.05  ? 1  DA  F "H3'"  1  
ATOM 820   H "H2'"  . DA  B 2 1  ? -39.688 15.219  3.135   1.00 4.80  ? 1  DA  F "H2'"  1  
ATOM 821   H "H2''" . DA  B 2 1  ? -39.522 14.295  4.623   1.00 4.77  ? 1  DA  F "H2''" 1  
ATOM 822   H "H1'"  . DA  B 2 1  ? -41.647 13.303  4.440   1.00 4.84  ? 1  DA  F "H1'"  1  
ATOM 823   H H8     . DA  B 2 1  ? -41.337 15.156  1.052   1.00 4.89  ? 1  DA  F H8     1  
ATOM 824   H H61    . DA  B 2 1  ? -41.176 11.241  -1.804  1.00 4.67  ? 1  DA  F H61    1  
ATOM 825   H H62    . DA  B 2 1  ? -41.212 9.518   -1.499  1.00 4.59  ? 1  DA  F H62    1  
ATOM 826   H H2     . DA  B 2 1  ? -41.452 9.018   2.959   1.00 4.56  ? 1  DA  F H2     1  
ATOM 827   H "HO5'" . DA  B 2 1  ? -40.154 16.990  2.821   1.00 4.98  ? 1  DA  F "HO5'" 1  
ATOM 828   P P      . DA  B 2 2  ? -39.733 15.981  7.240   1.00 5.09  ? 2  DA  F P      1  
ATOM 829   O OP1    . DA  B 2 2  ? -40.307 16.518  8.501   1.00 5.28  ? 2  DA  F OP1    1  
ATOM 830   O OP2    . DA  B 2 2  ? -38.661 16.738  6.544   1.00 5.05  ? 2  DA  F OP2    1  
ATOM 831   O "O5'"  . DA  B 2 2  ? -39.179 14.520  7.542   1.00 4.95  ? 2  DA  F "O5'"  1  
ATOM 832   C "C5'"  . DA  B 2 2  ? -39.983 13.373  7.262   1.00 4.89  ? 2  DA  F "C5'"  1  
ATOM 833   C "C4'"  . DA  B 2 2  ? -39.150 12.113  7.290   1.00 4.77  ? 2  DA  F "C4'"  1  
ATOM 834   O "O4'"  . DA  B 2 2  ? -38.972 11.635  5.935   1.00 4.64  ? 2  DA  F "O4'"  1  
ATOM 835   C "C3'"  . DA  B 2 2  ? -37.733 12.321  7.817   1.00 4.73  ? 2  DA  F "C3'"  1  
ATOM 836   O "O3'"  . DA  B 2 2  ? -37.243 11.071  8.300   1.00 4.68  ? 2  DA  F "O3'"  1  
ATOM 837   C "C2'"  . DA  B 2 2  ? -36.962 12.731  6.576   1.00 4.61  ? 2  DA  F "C2'"  1  
ATOM 838   C "C1'"  . DA  B 2 2  ? -37.636 11.880  5.507   1.00 4.54  ? 2  DA  F "C1'"  1  
ATOM 839   N N9     . DA  B 2 2  ? -37.665 12.426  4.148   1.00 4.50  ? 2  DA  F N9     1  
ATOM 840   C C8     . DA  B 2 2  ? -37.623 13.726  3.710   1.00 4.56  ? 2  DA  F C8     1  
ATOM 841   N N7     . DA  B 2 2  ? -37.637 13.844  2.402   1.00 4.53  ? 2  DA  F N7     1  
ATOM 842   C C5     . DA  B 2 2  ? -37.693 12.532  1.950   1.00 4.44  ? 2  DA  F C5     1  
ATOM 843   C C6     . DA  B 2 2  ? -37.725 11.970  0.658   1.00 4.40  ? 2  DA  F C6     1  
ATOM 844   N N6     . DA  B 2 2  ? -37.702 12.686  -0.469  1.00 4.45  ? 2  DA  F N6     1  
ATOM 845   N N1     . DA  B 2 2  ? -37.778 10.622  0.563   1.00 4.34  ? 2  DA  F N1     1  
ATOM 846   C C2     . DA  B 2 2  ? -37.794 9.900   1.691   1.00 4.33  ? 2  DA  F C2     1  
ATOM 847   N N3     . DA  B 2 2  ? -37.766 10.312  2.953   1.00 4.36  ? 2  DA  F N3     1  
ATOM 848   C C4     . DA  B 2 2  ? -37.716 11.652  3.015   1.00 4.42  ? 2  DA  F C4     1  
ATOM 849   H "H5'"  . DA  B 2 2  ? -40.437 13.478  6.277   1.00 4.86  ? 2  DA  F "H5'"  1  
ATOM 850   H "H5''" . DA  B 2 2  ? -40.771 13.291  8.009   1.00 5.00  ? 2  DA  F "H5''" 1  
ATOM 851   H "H4'"  . DA  B 2 2  ? -39.641 11.394  7.949   1.00 4.82  ? 2  DA  F "H4'"  1  
ATOM 852   H "H3'"  . DA  B 2 2  ? -37.694 13.068  8.608   1.00 4.84  ? 2  DA  F "H3'"  1  
ATOM 853   H "H2'"  . DA  B 2 2  ? -37.074 13.799  6.382   1.00 4.68  ? 2  DA  F "H2'"  1  
ATOM 854   H "H2''" . DA  B 2 2  ? -35.899 12.536  6.691   1.00 4.54  ? 2  DA  F "H2''" 1  
ATOM 855   H "H1'"  . DA  B 2 2  ? -37.144 10.906  5.455   1.00 4.45  ? 2  DA  F "H1'"  1  
ATOM 856   H H8     . DA  B 2 2  ? -37.583 14.573  4.378   1.00 4.65  ? 2  DA  F H8     1  
ATOM 857   H H61    . DA  B 2 2  ? -37.659 13.695  -0.425  1.00 4.51  ? 2  DA  F H61    1  
ATOM 858   H H62    . DA  B 2 2  ? -37.716 12.224  -1.368  1.00 4.45  ? 2  DA  F H62    1  
ATOM 859   H H2     . DA  B 2 2  ? -37.832 8.820   1.555   1.00 4.30  ? 2  DA  F H2     1  
ATOM 860   P P      . DG  B 2 3  ? -36.098 11.022  9.424   1.00 4.72  ? 3  DG  F P      1  
ATOM 861   O OP1    . DG  B 2 3  ? -36.727 11.000  10.768  1.00 4.90  ? 3  DG  F OP1    1  
ATOM 862   O OP2    . DG  B 2 3  ? -35.077 12.053  9.108   1.00 4.67  ? 3  DG  F OP2    1  
ATOM 863   O "O5'"  . DG  B 2 3  ? -35.461 9.586   9.161   1.00 4.59  ? 3  DG  F "O5'"  1  
ATOM 864   C "C5'"  . DG  B 2 3  ? -36.322 8.457   9.056   1.00 4.62  ? 3  DG  F "C5'"  1  
ATOM 865   C "C4'"  . DG  B 2 3  ? -35.728 7.383   8.170   1.00 4.50  ? 3  DG  F "C4'"  1  
ATOM 866   O "O4'"  . DG  B 2 3  ? -35.844 7.788   6.779   1.00 4.40  ? 3  DG  F "O4'"  1  
ATOM 867   C "C3'"  . DG  B 2 3  ? -34.227 7.190   8.380   1.00 4.44  ? 3  DG  F "C3'"  1  
ATOM 868   O "O3'"  . DG  B 2 3  ? -33.880 5.879   7.946   1.00 4.40  ? 3  DG  F "O3'"  1  
ATOM 869   C "C2'"  . DG  B 2 3  ? -33.599 8.206   7.447   1.00 4.33  ? 3  DG  F "C2'"  1  
ATOM 870   C "C1'"  . DG  B 2 3  ? -34.564 8.156   6.275   1.00 4.29  ? 3  DG  F "C1'"  1  
ATOM 871   N N9     . DG  B 2 3  ? -34.663 9.365   5.461   1.00 4.26  ? 3  DG  F N9     1  
ATOM 872   C C8     . DG  B 2 3  ? -34.771 10.670  5.874   1.00 4.34  ? 3  DG  F C8     1  
ATOM 873   N N7     . DG  B 2 3  ? -34.743 11.526  4.884   1.00 4.31  ? 3  DG  F N7     1  
ATOM 874   C C5     . DG  B 2 3  ? -34.626 10.734  3.748   1.00 4.22  ? 3  DG  F C5     1  
ATOM 875   C C6     . DG  B 2 3  ? -34.538 11.091  2.364   1.00 4.18  ? 3  DG  F C6     1  
ATOM 876   O O6     . DG  B 2 3  ? -34.537 12.218  1.847   1.00 4.23  ? 3  DG  F O6     1  
ATOM 877   N N1     . DG  B 2 3  ? -34.436 9.966   1.552   1.00 4.12  ? 3  DG  F N1     1  
ATOM 878   C C2     . DG  B 2 3  ? -34.415 8.668   2.000   1.00 4.10  ? 3  DG  F C2     1  
ATOM 879   N N2     . DG  B 2 3  ? -34.305 7.717   1.060   1.00 4.07  ? 3  DG  F N2     1  
ATOM 880   N N3     . DG  B 2 3  ? -34.496 8.324   3.274   1.00 4.13  ? 3  DG  F N3     1  
ATOM 881   C C4     . DG  B 2 3  ? -34.596 9.399   4.086   1.00 4.19  ? 3  DG  F C4     1  
ATOM 882   H "H5'"  . DG  B 2 3  ? -37.279 8.769   8.639   1.00 4.68  ? 3  DG  F "H5'"  1  
ATOM 883   H "H5''" . DG  B 2 3  ? -36.490 8.039   10.047  1.00 4.70  ? 3  DG  F "H5''" 1  
ATOM 884   H "H4'"  . DG  B 2 3  ? -36.218 6.435   8.400   1.00 4.55  ? 3  DG  F "H4'"  1  
ATOM 885   H "H3'"  . DG  B 2 3  ? -33.934 7.327   9.419   1.00 4.53  ? 3  DG  F "H3'"  1  
ATOM 886   H "H2'"  . DG  B 2 3  ? -33.560 9.194   7.906   1.00 4.38  ? 3  DG  F "H2'"  1  
ATOM 887   H "H2''" . DG  B 2 3  ? -32.581 7.927   7.185   1.00 4.25  ? 3  DG  F "H2''" 1  
ATOM 888   H "H1'"  . DG  B 2 3  ? -34.260 7.346   5.604   1.00 4.23  ? 3  DG  F "H1'"  1  
ATOM 889   H H8     . DG  B 2 3  ? -34.866 10.959  6.908   1.00 4.43  ? 3  DG  F H8     1  
ATOM 890   H H1     . DG  B 2 3  ? -34.369 10.124  0.556   1.00 4.12  ? 3  DG  F H1     1  
ATOM 891   H H21    . DG  B 2 3  ? -34.283 6.743   1.327   1.00 4.08  ? 3  DG  F H21    1  
ATOM 892   H H22    . DG  B 2 3  ? -34.227 7.960   0.081   1.00 4.08  ? 3  DG  F H22    1  
ATOM 893   P P      . DG  B 2 4  ? -32.497 5.209   8.398   1.00 4.39  ? 4  DG  F P      1  
ATOM 894   O OP1    . DG  B 2 4  ? -32.756 4.096   9.345   1.00 4.55  ? 4  DG  F OP1    1  
ATOM 895   O OP2    . DG  B 2 4  ? -31.538 6.282   8.769   1.00 4.36  ? 4  DG  F OP2    1  
ATOM 896   O "O5'"  . DG  B 2 4  ? -32.022 4.585   7.014   1.00 4.26  ? 4  DG  F "O5'"  1  
ATOM 897   C "C5'"  . DG  B 2 4  ? -32.998 4.336   5.999   1.00 4.23  ? 4  DG  F "C5'"  1  
ATOM 898   C "C4'"  . DG  B 2 4  ? -32.357 3.878   4.710   1.00 4.14  ? 4  DG  F "C4'"  1  
ATOM 899   O "O4'"  . DG  B 2 4  ? -32.476 4.936   3.723   1.00 4.05  ? 4  DG  F "O4'"  1  
ATOM 900   C "C3'"  . DG  B 2 4  ? -30.857 3.614   4.803   1.00 4.09  ? 4  DG  F "C3'"  1  
ATOM 901   O "O3'"  . DG  B 2 4  ? -30.483 2.705   3.770   1.00 4.08  ? 4  DG  F "O3'"  1  
ATOM 902   C "C2'"  . DG  B 2 4  ? -30.248 4.977   4.540   1.00 3.98  ? 4  DG  F "C2'"  1  
ATOM 903   C "C1'"  . DG  B 2 4  ? -31.209 5.554   3.513   1.00 3.95  ? 4  DG  F "C1'"  1  
ATOM 904   N N9     . DG  B 2 4  ? -31.360 7.007   3.535   1.00 3.92  ? 4  DG  F N9     1  
ATOM 905   C C8     . DG  B 2 4  ? -31.561 7.823   4.621   1.00 3.97  ? 4  DG  F C8     1  
ATOM 906   N N7     . DG  B 2 4  ? -31.585 9.092   4.313   1.00 3.96  ? 4  DG  F N7     1  
ATOM 907   C C5     . DG  B 2 4  ? -31.403 9.115   2.936   1.00 3.89  ? 4  DG  F C5     1  
ATOM 908   C C6     . DG  B 2 4  ? -31.331 10.213  2.027   1.00 3.88  ? 4  DG  F C6     1  
ATOM 909   O O6     . DG  B 2 4  ? -31.411 11.428  2.267   1.00 3.93  ? 4  DG  F O6     1  
ATOM 910   N N1     . DG  B 2 4  ? -31.143 9.781   0.718   1.00 3.85  ? 4  DG  F N1     1  
ATOM 911   C C2     . DG  B 2 4  ? -31.040 8.469   0.327   1.00 3.83  ? 4  DG  F C2     1  
ATOM 912   N N2     . DG  B 2 4  ? -30.880 8.251   -0.986  1.00 3.85  ? 4  DG  F N2     1  
ATOM 913   N N3     . DG  B 2 4  ? -31.094 7.442   1.160   1.00 3.84  ? 4  DG  F N3     1  
ATOM 914   C C4     . DG  B 2 4  ? -31.277 7.836   2.439   1.00 3.87  ? 4  DG  F C4     1  
ATOM 915   H "H5'"  . DG  B 2 4  ? -33.560 5.248   5.808   1.00 4.20  ? 4  DG  F "H5'"  1  
ATOM 916   H "H5''" . DG  B 2 4  ? -33.685 3.564   6.342   1.00 4.32  ? 4  DG  F "H5''" 1  
ATOM 917   H "H4'"  . DG  B 2 4  ? -32.834 2.944   4.407   1.00 4.20  ? 4  DG  F "H4'"  1  
ATOM 918   H "H3'"  . DG  B 2 4  ? -30.578 3.209   5.772   1.00 4.17  ? 4  DG  F "H3'"  1  
ATOM 919   H "H2'"  . DG  B 2 4  ? -30.207 5.576   5.450   1.00 4.01  ? 4  DG  F "H2'"  1  
ATOM 920   H "H2''" . DG  B 2 4  ? -29.232 4.886   4.163   1.00 3.92  ? 4  DG  F "H2''" 1  
ATOM 921   H "H1'"  . DG  B 2 4  ? -30.883 5.272   2.508   1.00 3.91  ? 4  DG  F "H1'"  1  
ATOM 922   H H8     . DG  B 2 4  ? -31.680 7.453   5.627   1.00 4.05  ? 4  DG  F H8     1  
ATOM 923   H H1     . DG  B 2 4  ? -31.074 10.494  0.004   1.00 3.86  ? 4  DG  F H1     1  
ATOM 924   H H21    . DG  B 2 4  ? -30.805 7.303   -1.327  1.00 3.86  ? 4  DG  F H21    1  
ATOM 925   H H22    . DG  B 2 4  ? -30.839 9.022   -1.641  1.00 3.86  ? 4  DG  F H22    1  
ATOM 926   P P      . DT  B 2 5  ? -29.073 1.939   3.832   1.00 4.08  ? 5  DT  F P      1  
ATOM 927   O OP1    . DT  B 2 5  ? -29.302 0.481   3.988   1.00 4.21  ? 5  DT  F OP1    1  
ATOM 928   O OP2    . DT  B 2 5  ? -28.172 2.649   4.774   1.00 4.04  ? 5  DT  F OP2    1  
ATOM 929   O "O5'"  . DT  B 2 5  ? -28.557 2.203   2.350   1.00 4.00  ? 5  DT  F "O5'"  1  
ATOM 930   C "C5'"  . DT  B 2 5  ? -29.504 2.628   1.369   1.00 3.98  ? 5  DT  F "C5'"  1  
ATOM 931   C "C4'"  . DT  B 2 5  ? -28.832 3.025   0.076   1.00 3.90  ? 5  DT  F "C4'"  1  
ATOM 932   O "O4'"  . DT  B 2 5  ? -28.888 4.468   -0.061  1.00 3.81  ? 5  DT  F "O4'"  1  
ATOM 933   C "C3'"  . DT  B 2 5  ? -27.345 2.698   -0.024  1.00 3.86  ? 5  DT  F "C3'"  1  
ATOM 934   O "O3'"  . DT  B 2 5  ? -27.016 2.630   -1.407  1.00 3.86  ? 5  DT  F "O3'"  1  
ATOM 935   C "C2'"  . DT  B 2 5  ? -26.679 3.905   0.607   1.00 3.74  ? 5  DT  F "C2'"  1  
ATOM 936   C "C1'"  . DT  B 2 5  ? -27.598 5.033   0.164   1.00 3.72  ? 5  DT  F "C1'"  1  
ATOM 937   N N1     . DT  B 2 5  ? -27.715 6.179   1.091   1.00 3.68  ? 5  DT  F N1     1  
ATOM 938   C C2     . DT  B 2 5  ? -27.738 7.431   0.514   1.00 3.63  ? 5  DT  F C2     1  
ATOM 939   O O2     . DT  B 2 5  ? -27.718 7.608   -0.693  1.00 3.63  ? 5  DT  F O2     1  
ATOM 940   N N3     . DT  B 2 5  ? -27.783 8.473   1.402   1.00 3.63  ? 5  DT  F N3     1  
ATOM 941   C C4     . DT  B 2 5  ? -27.813 8.397   2.775   1.00 3.68  ? 5  DT  F C4     1  
ATOM 942   O O4     . DT  B 2 5  ? -27.812 9.432   3.442   1.00 3.71  ? 5  DT  F O4     1  
ATOM 943   C C5     . DT  B 2 5  ? -27.808 7.054   3.317   1.00 3.73  ? 5  DT  F C5     1  
ATOM 944   C C7     . DT  B 2 5  ? -27.802 6.878   4.802   1.00 3.82  ? 5  DT  F C7     1  
ATOM 945   C C6     . DT  B 2 5  ? -27.766 6.019   2.461   1.00 3.72  ? 5  DT  F C6     1  
ATOM 946   H "H5'"  . DT  B 2 5  ? -30.063 3.482   1.752   1.00 3.95  ? 5  DT  F "H5'"  1  
ATOM 947   H "H5''" . DT  B 2 5  ? -30.201 1.816   1.166   1.00 4.08  ? 5  DT  F "H5''" 1  
ATOM 948   H "H4'"  . DT  B 2 5  ? -29.330 2.496   -0.738  1.00 3.97  ? 5  DT  F "H4'"  1  
ATOM 949   H "H3'"  . DT  B 2 5  ? -27.092 1.760   0.468   1.00 3.93  ? 5  DT  F "H3'"  1  
ATOM 950   H "H2'"  . DT  B 2 5  ? -26.629 3.811   1.693   1.00 3.76  ? 5  DT  F "H2'"  1  
ATOM 951   H "H2''" . DT  B 2 5  ? -25.663 4.033   0.240   1.00 3.68  ? 5  DT  F "H2''" 1  
ATOM 952   H "H1'"  . DT  B 2 5  ? -27.258 5.424   -0.798  1.00 3.68  ? 5  DT  F "H1'"  1  
ATOM 953   H H3     . DT  B 2 5  ? -27.781 9.403   1.009   1.00 3.62  ? 5  DT  F H3     1  
ATOM 954   H H71    . DT  B 2 5  ? -27.626 5.831   5.044   1.00 4.07  ? 5  DT  F H71    1  
ATOM 955   H H72    . DT  B 2 5  ? -27.011 7.488   5.238   1.00 4.12  ? 5  DT  F H72    1  
ATOM 956   H H73    . DT  B 2 5  ? -28.764 7.187   5.208   1.00 3.63  ? 5  DT  F H73    1  
ATOM 957   H H6     . DT  B 2 5  ? -27.774 5.006   2.867   1.00 3.79  ? 5  DT  F H6     1  
ATOM 958   P P      . DT  B 2 6  ? -25.668 1.925   -1.895  1.00 3.87  ? 6  DT  F P      1  
ATOM 959   O OP1    . DT  B 2 6  ? -25.990 0.685   -2.644  1.00 4.03  ? 6  DT  F OP1    1  
ATOM 960   O OP2    . DT  B 2 6  ? -24.692 1.881   -0.775  1.00 3.82  ? 6  DT  F OP2    1  
ATOM 961   O "O5'"  . DT  B 2 6  ? -25.172 3.013   -2.945  1.00 3.79  ? 6  DT  F "O5'"  1  
ATOM 962   C "C5'"  . DT  B 2 6  ? -26.120 3.966   -3.428  1.00 3.79  ? 6  DT  F "C5'"  1  
ATOM 963   C "C4'"  . DT  B 2 6  ? -25.460 5.068   -4.225  1.00 3.74  ? 6  DT  F "C4'"  1  
ATOM 964   O "O4'"  . DT  B 2 6  ? -25.461 6.284   -3.436  1.00 3.64  ? 6  DT  F "O4'"  1  
ATOM 965   C "C3'"  . DT  B 2 6  ? -23.991 4.845   -4.567  1.00 3.71  ? 6  DT  F "C3'"  1  
ATOM 966   O "O3'"  . DT  B 2 6  ? -23.683 5.648   -5.702  1.00 3.75  ? 6  DT  F "O3'"  1  
ATOM 967   C "C2'"  . DT  B 2 6  ? -23.264 5.387   -3.353  1.00 3.57  ? 6  DT  F "C2'"  1  
ATOM 968   C "C1'"  . DT  B 2 6  ? -24.146 6.565   -2.965  1.00 3.54  ? 6  DT  F "C1'"  1  
ATOM 969   N N1     . DT  B 2 6  ? -24.198 6.892   -1.523  1.00 3.48  ? 6  DT  F N1     1  
ATOM 970   C C2     . DT  B 2 6  ? -24.243 8.230   -1.201  1.00 3.43  ? 6  DT  F C2     1  
ATOM 971   O O2     . DT  B 2 6  ? -24.292 9.112   -2.041  1.00 3.44  ? 6  DT  F O2     1  
ATOM 972   N N3     . DT  B 2 6  ? -24.225 8.500   0.141   1.00 3.41  ? 6  DT  F N3     1  
ATOM 973   C C4     . DT  B 2 6  ? -24.169 7.592   1.171   1.00 3.44  ? 6  DT  F C4     1  
ATOM 974   O O4     . DT  B 2 6  ? -24.092 7.994   2.332   1.00 3.46  ? 6  DT  F O4     1  
ATOM 975   C C5     . DT  B 2 6  ? -24.147 6.201   0.767   1.00 3.49  ? 6  DT  F C5     1  
ATOM 976   C C7     . DT  B 2 6  ? -24.056 5.145   1.822   1.00 3.57  ? 6  DT  F C7     1  
ATOM 977   C C6     . DT  B 2 6  ? -24.170 5.918   -0.547  1.00 3.51  ? 6  DT  F C6     1  
ATOM 978   H "H5'"  . DT  B 2 6  ? -26.647 4.411   -2.583  1.00 3.75  ? 6  DT  F "H5'"  1  
ATOM 979   H "H5''" . DT  B 2 6  ? -26.846 3.462   -4.064  1.00 3.89  ? 6  DT  F "H5''" 1  
ATOM 980   H "H4'"  . DT  B 2 6  ? -25.998 5.166   -5.168  1.00 3.83  ? 6  DT  F "H4'"  1  
ATOM 981   H "H3'"  . DT  B 2 6  ? -23.764 3.801   -4.774  1.00 3.79  ? 6  DT  F "H3'"  1  
ATOM 982   H "H2'"  . DT  B 2 6  ? -23.198 4.641   -2.563  1.00 3.57  ? 6  DT  F "H2'"  1  
ATOM 983   H "H2''" . DT  B 2 6  ? -22.250 5.692   -3.603  1.00 3.53  ? 6  DT  F "H2''" 1  
ATOM 984   H "H1'"  . DT  B 2 6  ? -23.812 7.462   -3.492  1.00 3.53  ? 6  DT  F "H1'"  1  
ATOM 985   H H3     . DT  B 2 6  ? -24.252 9.474   0.411   1.00 3.40  ? 6  DT  F H3     1  
ATOM 986   H H71    . DT  B 2 6  ? -23.843 4.183   1.357   1.00 3.50  ? 6  DT  F H71    1  
ATOM 987   H H72    . DT  B 2 6  ? -25.002 5.088   2.360   1.00 3.83  ? 6  DT  F H72    1  
ATOM 988   H H73    . DT  B 2 6  ? -23.257 5.397   2.518   1.00 3.86  ? 6  DT  F H73    1  
ATOM 989   H H6     . DT  B 2 6  ? -24.169 4.871   -0.853  1.00 3.57  ? 6  DT  F H6     1  
ATOM 990   P P      . DT  B 2 7  ? -22.406 5.327   -6.613  1.00 3.81  ? 7  DT  F P      1  
ATOM 991   O OP1    . DT  B 2 7  ? -22.832 4.617   -7.847  1.00 4.01  ? 7  DT  F OP1    1  
ATOM 992   O OP2    . DT  B 2 7  ? -21.346 4.739   -5.753  1.00 3.72  ? 7  DT  F OP2    1  
ATOM 993   O "O5'"  . DT  B 2 7  ? -21.969 6.807   -7.006  1.00 3.78  ? 7  DT  F "O5'"  1  
ATOM 994   C "C5'"  . DT  B 2 7  ? -22.922 7.863   -6.862  1.00 3.78  ? 7  DT  F "C5'"  1  
ATOM 995   C "C4'"  . DT  B 2 7  ? -22.261 9.221   -6.865  1.00 3.73  ? 7  DT  F "C4'"  1  
ATOM 996   O "O4'"  . DT  B 2 7  ? -22.254 9.748   -5.514  1.00 3.60  ? 7  DT  F "O4'"  1  
ATOM 997   C "C3'"  . DT  B 2 7  ? -20.791 9.223   -7.275  1.00 3.71  ? 7  DT  F "C3'"  1  
ATOM 998   O "O3'"  . DT  B 2 7  ? -20.476 10.539  -7.722  1.00 3.75  ? 7  DT  F "O3'"  1  
ATOM 999   C "C2'"  . DT  B 2 7  ? -20.061 8.950   -5.975  1.00 3.56  ? 7  DT  F "C2'"  1  
ATOM 1000  C "C1'"  . DT  B 2 7  ? -20.934 9.698   -4.977  1.00 3.50  ? 7  DT  F "C1'"  1  
ATOM 1001  N N1     . DT  B 2 7  ? -20.977 9.156   -3.600  1.00 3.41  ? 7  DT  F N1     1  
ATOM 1002  C C2     . DT  B 2 7  ? -21.062 10.079  -2.580  1.00 3.37  ? 7  DT  F C2     1  
ATOM 1003  O O2     . DT  B 2 7  ? -21.159 11.279  -2.774  1.00 3.40  ? 7  DT  F O2     1  
ATOM 1004  N N3     . DT  B 2 7  ? -21.024 9.548   -1.320  1.00 3.33  ? 7  DT  F N3     1  
ATOM 1005  C C4     . DT  B 2 7  ? -20.921 8.219   -0.979  1.00 3.33  ? 7  DT  F C4     1  
ATOM 1006  O O4     . DT  B 2 7  ? -20.869 7.896   0.208   1.00 3.34  ? 7  DT  F O4     1  
ATOM 1007  C C5     . DT  B 2 7  ? -20.857 7.299   -2.097  1.00 3.38  ? 7  DT  F C5     1  
ATOM 1008  C C7     . DT  B 2 7  ? -20.677 5.839   -1.822  1.00 3.43  ? 7  DT  F C7     1  
ATOM 1009  C C6     . DT  B 2 7  ? -20.900 7.803   -3.341  1.00 3.42  ? 7  DT  F C6     1  
ATOM 1010  H "H5'"  . DT  B 2 7  ? -23.464 7.735   -5.924  1.00 3.72  ? 7  DT  F "H5'"  1  
ATOM 1011  H "H5''" . DT  B 2 7  ? -23.634 7.820   -7.685  1.00 3.90  ? 7  DT  F "H5''" 1  
ATOM 1012  H "H4'"  . DT  B 2 7  ? -22.794 9.854   -7.576  1.00 3.83  ? 7  DT  F "H4'"  1  
ATOM 1013  H "H3'"  . DT  B 2 7  ? -20.573 8.497   -8.055  1.00 3.80  ? 7  DT  F "H3'"  1  
ATOM 1014  H "H2'"  . DT  B 2 7  ? -20.018 7.881   -5.766  1.00 3.56  ? 7  DT  F "H2'"  1  
ATOM 1015  H "H2''" . DT  B 2 7  ? -19.037 9.313   -6.015  1.00 3.52  ? 7  DT  F "H2''" 1  
ATOM 1016  H "H1'"  . DT  B 2 7  ? -20.593 10.734  -4.906  1.00 3.49  ? 7  DT  F "H1'"  1  
ATOM 1017  H H3     . DT  B 2 7  ? -21.062 10.214  -0.561  1.00 3.32  ? 7  DT  F H3     1  
ATOM 1018  H H71    . DT  B 2 7  ? -19.823 5.697   -1.158  1.00 3.56  ? 7  DT  F H71    1  
ATOM 1019  H H72    . DT  B 2 7  ? -21.575 5.445   -1.349  1.00 3.67  ? 7  DT  F H72    1  
ATOM 1020  H H73    . DT  B 2 7  ? -20.497 5.310   -2.759  1.00 3.55  ? 7  DT  F H73    1  
ATOM 1021  H H6     . DT  B 2 7  ? -20.875 7.112   -4.182  1.00 3.50  ? 7  DT  F H6     1  
ATOM 1022  P P      . DC  B 2 8  ? -19.183 10.814  -8.622  1.00 3.80  ? 8  DC  F P      1  
ATOM 1023  O OP1    . DC  B 2 8  ? -19.585 10.990  -10.039 1.00 4.02  ? 8  DC  F OP1    1  
ATOM 1024  O OP2    . DC  B 2 8  ? -18.143 9.814   -8.273  1.00 3.71  ? 8  DC  F OP2    1  
ATOM 1025  O "O5'"  . DC  B 2 8  ? -18.737 12.226  -8.037  1.00 3.74  ? 8  DC  F "O5'"  1  
ATOM 1026  C "C5'"  . DC  B 2 8  ? -19.690 12.988  -7.293  1.00 3.71  ? 8  DC  F "C5'"  1  
ATOM 1027  C "C4'"  . DC  B 2 8  ? -19.028 14.068  -6.468  1.00 3.63  ? 8  DC  F "C4'"  1  
ATOM 1028  O "O4'"  . DC  B 2 8  ? -19.041 13.671  -5.075  1.00 3.50  ? 8  DC  F "O4'"  1  
ATOM 1029  C "C3'"  . DC  B 2 8  ? -17.554 14.321  -6.769  1.00 3.60  ? 8  DC  F "C3'"  1  
ATOM 1030  O "O3'"  . DC  B 2 8  ? -17.244 15.641  -6.327  1.00 3.60  ? 8  DC  F "O3'"  1  
ATOM 1031  C "C2'"  . DC  B 2 8  ? -16.839 13.311  -5.891  1.00 3.46  ? 8  DC  F "C2'"  1  
ATOM 1032  C "C1'"  . DC  B 2 8  ? -17.731 13.293  -4.659  1.00 3.40  ? 8  DC  F "C1'"  1  
ATOM 1033  N N1     . DC  B 2 8  ? -17.800 12.019  -3.921  1.00 3.33  ? 8  DC  F N1     1  
ATOM 1034  C C2     . DC  B 2 8  ? -17.788 12.070  -2.522  1.00 3.25  ? 8  DC  F C2     1  
ATOM 1035  O O2     . DC  B 2 8  ? -17.770 13.176  -1.965  1.00 3.24  ? 8  DC  F O2     1  
ATOM 1036  N N3     . DC  B 2 8  ? -17.795 10.918  -1.814  1.00 3.22  ? 8  DC  F N3     1  
ATOM 1037  C C4     . DC  B 2 8  ? -17.817 9.747   -2.450  1.00 3.27  ? 8  DC  F C4     1  
ATOM 1038  N N4     . DC  B 2 8  ? -17.800 8.636   -1.705  1.00 3.28  ? 8  DC  F N4     1  
ATOM 1039  C C5     . DC  B 2 8  ? -17.851 9.662   -3.875  1.00 3.36  ? 8  DC  F C5     1  
ATOM 1040  C C6     . DC  B 2 8  ? -17.845 10.815  -4.565  1.00 3.39  ? 8  DC  F C6     1  
ATOM 1041  H "H5'"  . DC  B 2 8  ? -20.242 12.323  -6.628  1.00 3.66  ? 8  DC  F "H5'"  1  
ATOM 1042  H "H5''" . DC  B 2 8  ? -20.393 13.456  -7.981  1.00 3.83  ? 8  DC  F "H5''" 1  
ATOM 1043  H "H4'"  . DC  B 2 8  ? -19.557 15.003  -6.653  1.00 3.71  ? 8  DC  F "H4'"  1  
ATOM 1044  H "H3'"  . DC  B 2 8  ? -17.320 14.214  -7.825  1.00 3.70  ? 8  DC  F "H3'"  1  
ATOM 1045  H "H2'"  . DC  B 2 8  ? -16.782 12.336  -6.375  1.00 3.49  ? 8  DC  F "H2'"  1  
ATOM 1046  H "H2''" . DC  B 2 8  ? -15.821 13.628  -5.674  1.00 3.41  ? 8  DC  F "H2''" 1  
ATOM 1047  H "H1'"  . DC  B 2 8  ? -17.393 14.060  -3.957  1.00 3.37  ? 8  DC  F "H1'"  1  
ATOM 1048  H H41    . DC  B 2 8  ? -17.810 7.729   -2.151  1.00 3.34  ? 8  DC  F H41    1  
ATOM 1049  H H42    . DC  B 2 8  ? -17.766 8.704   -0.697  1.00 3.24  ? 8  DC  F H42    1  
ATOM 1050  H H5     . DC  B 2 8  ? -17.877 8.698   -4.384  1.00 3.43  ? 8  DC  F H5     1  
ATOM 1051  H H6     . DC  B 2 8  ? -17.880 10.787  -5.653  1.00 3.49  ? 8  DC  F H6     1  
ATOM 1052  P P      . DC  B 2 9  ? -15.959 16.416  -6.887  1.00 3.64  ? 9  DC  F P      1  
ATOM 1053  O OP1    . DC  B 2 9  ? -16.374 17.424  -7.894  1.00 3.85  ? 9  DC  F OP1    1  
ATOM 1054  O OP2    . DC  B 2 9  ? -14.899 15.430  -7.225  1.00 3.57  ? 9  DC  F OP2    1  
ATOM 1055  O "O5'"  . DC  B 2 9  ? -15.511 17.196  -5.575  1.00 3.55  ? 9  DC  F "O5'"  1  
ATOM 1056  C "C5'"  . DC  B 2 9  ? -16.447 17.334  -4.504  1.00 3.52  ? 9  DC  F "C5'"  1  
ATOM 1057  C "C4'"  . DC  B 2 9  ? -15.757 17.686  -3.207  1.00 3.45  ? 9  DC  F "C4'"  1  
ATOM 1058  O "O4'"  . DC  B 2 9  ? -15.683 16.501  -2.376  1.00 3.30  ? 9  DC  F "O4'"  1  
ATOM 1059  C "C3'"  . DC  B 2 9  ? -14.306 18.133  -3.365  1.00 3.43  ? 9  DC  F "C3'"  1  
ATOM 1060  O "O3'"  . DC  B 2 9  ? -13.966 18.902  -2.214  1.00 3.46  ? 9  DC  F "O3'"  1  
ATOM 1061  C "C2'"  . DC  B 2 9  ? -13.536 16.827  -3.347  1.00 3.27  ? 9  DC  F "C2'"  1  
ATOM 1062  C "C1'"  . DC  B 2 9  ? -14.344 16.017  -2.341  1.00 3.20  ? 9  DC  F "C1'"  1  
ATOM 1063  N N1     . DC  B 2 9  ? -14.342 14.554  -2.524  1.00 3.10  ? 9  DC  F N1     1  
ATOM 1064  C C2     . DC  B 2 9  ? -14.295 13.746  -1.381  1.00 3.03  ? 9  DC  F C2     1  
ATOM 1065  O O2     . DC  B 2 9  ? -14.339 14.285  -0.266  1.00 3.05  ? 9  DC  F O2     1  
ATOM 1066  N N3     . DC  B 2 9  ? -14.205 12.407  -1.514  1.00 2.97  ? 9  DC  F N3     1  
ATOM 1067  C C4     . DC  B 2 9  ? -14.168 11.861  -2.729  1.00 2.99  ? 9  DC  F C4     1  
ATOM 1068  N N4     . DC  B 2 9  ? -14.031 10.536  -2.805  1.00 2.98  ? 9  DC  F N4     1  
ATOM 1069  C C5     . DC  B 2 9  ? -14.255 12.652  -3.916  1.00 3.08  ? 9  DC  F C5     1  
ATOM 1070  C C6     . DC  B 2 9  ? -14.345 13.984  -3.767  1.00 3.13  ? 9  DC  F C6     1  
ATOM 1071  H "H5'"  . DC  B 2 9  ? -16.989 16.398  -4.372  1.00 3.48  ? 9  DC  F "H5'"  1  
ATOM 1072  H "H5''" . DC  B 2 9  ? -17.159 18.122  -4.747  1.00 3.62  ? 9  DC  F "H5''" 1  
ATOM 1073  H "H4'"  . DC  B 2 9  ? -16.300 18.510  -2.745  1.00 3.55  ? 9  DC  F "H4'"  1  
ATOM 1074  H "H3'"  . DC  B 2 9  ? -14.146 18.716  -4.270  1.00 3.54  ? 9  DC  F "H3'"  1  
ATOM 1075  H "H2'"  . DC  B 2 9  ? -13.525 16.366  -4.335  1.00 3.29  ? 9  DC  F "H2'"  1  
ATOM 1076  H "H2''" . DC  B 2 9  ? -12.502 16.986  -3.056  1.00 3.22  ? 9  DC  F "H2''" 1  
ATOM 1077  H "H1'"  . DC  B 2 9  ? -13.970 16.218  -1.333  1.00 3.17  ? 9  DC  F "H1'"  1  
ATOM 1078  H H41    . DC  B 2 9  ? -13.990 10.090  -3.710  1.00 3.03  ? 9  DC  F H41    1  
ATOM 1079  H H42    . DC  B 2 9  ? -13.951 9.984   -1.963  1.00 2.95  ? 9  DC  F H42    1  
ATOM 1080  H H5     . DC  B 2 9  ? -14.248 12.193  -4.905  1.00 3.14  ? 9  DC  F H5     1  
ATOM 1081  H H6     . DC  B 2 9  ? -14.423 14.618  -4.650  1.00 3.23  ? 9  DC  F H6     1  
ATOM 1082  P P      . DA  B 2 10 ? -12.751 19.945  -2.250  1.00 3.53  ? 10 DA  F P      1  
ATOM 1083  O OP1    . DA  B 2 10 ? -13.266 21.303  -2.565  1.00 3.73  ? 10 DA  F OP1    1  
ATOM 1084  O OP2    . DA  B 2 10 ? -11.642 19.371  -3.054  1.00 3.44  ? 10 DA  F OP2    1  
ATOM 1085  O "O5'"  . DA  B 2 10 ? -12.305 19.923  -0.723  1.00 3.47  ? 10 DA  F "O5'"  1  
ATOM 1086  C "C5'"  . DA  B 2 10 ? -13.207 19.402  0.254   1.00 3.48  ? 10 DA  F "C5'"  1  
ATOM 1087  C "C4'"  . DA  B 2 10 ? -12.476 18.957  1.499   1.00 3.42  ? 10 DA  F "C4'"  1  
ATOM 1088  O "O4'"  . DA  B 2 10 ? -12.435 17.508  1.532   1.00 3.28  ? 10 DA  F "O4'"  1  
ATOM 1089  C "C3'"  . DA  B 2 10 ? -11.011 19.378  1.566   1.00 3.40  ? 10 DA  F "C3'"  1  
ATOM 1090  O "O3'"  . DA  B 2 10 ? -10.630 19.375  2.938   1.00 3.46  ? 10 DA  F "O3'"  1  
ATOM 1091  C "C2'"  . DA  B 2 10 ? -10.294 18.263  0.830   1.00 3.23  ? 10 DA  F "C2'"  1  
ATOM 1092  C "C1'"  . DA  B 2 10 ? -11.119 17.049  1.236   1.00 3.17  ? 10 DA  F "C1'"  1  
ATOM 1093  N N9     . DA  B 2 10 ? -11.192 15.967  0.253   1.00 3.06  ? 10 DA  F N9     1  
ATOM 1094  C C8     . DA  B 2 10 ? -11.353 16.040  -1.104  1.00 3.09  ? 10 DA  F C8     1  
ATOM 1095  N N7     . DA  B 2 10 ? -11.338 14.871  -1.704  1.00 3.02  ? 10 DA  F N7     1  
ATOM 1096  C C5     . DA  B 2 10 ? -11.155 13.967  -0.666  1.00 2.94  ? 10 DA  F C5     1  
ATOM 1097  C C6     . DA  B 2 10 ? -11.043 12.557  -0.634  1.00 2.89  ? 10 DA  F C6     1  
ATOM 1098  N N6     . DA  B 2 10 ? -11.091 11.776  -1.718  1.00 2.91  ? 10 DA  F N6     1  
ATOM 1099  N N1     . DA  B 2 10 ? -10.870 11.971  0.573   1.00 2.87  ? 10 DA  F N1     1  
ATOM 1100  C C2     . DA  B 2 10 ? -10.808 12.750  1.662   1.00 2.90  ? 10 DA  F C2     1  
ATOM 1101  N N3     . DA  B 2 10 ? -10.897 14.074  1.758   1.00 2.96  ? 10 DA  F N3     1  
ATOM 1102  C C4     . DA  B 2 10 ? -11.072 14.629  0.546   1.00 2.97  ? 10 DA  F C4     1  
ATOM 1103  H "H5'"  . DA  B 2 10 ? -13.744 18.550  -0.165  1.00 3.42  ? 10 DA  F "H5'"  1  
ATOM 1104  H "H5''" . DA  B 2 10 ? -13.928 20.172  0.526   1.00 3.61  ? 10 DA  F "H5''" 1  
ATOM 1105  H "H4'"  . DA  B 2 10 ? -12.979 19.398  2.363   1.00 3.54  ? 10 DA  F "H4'"  1  
ATOM 1106  H "H3'"  . DA  B 2 10 ? -10.840 20.360  1.129   1.00 3.50  ? 10 DA  F "H3'"  1  
ATOM 1107  H "H2'"  . DA  B 2 10 ? -10.312 18.432  -0.248  1.00 3.23  ? 10 DA  F "H2'"  1  
ATOM 1108  H "H2''" . DA  B 2 10 ? -9.251  18.203  1.127   1.00 3.19  ? 10 DA  F "H2''" 1  
ATOM 1109  H "H1'"  . DA  B 2 10 ? -10.719 16.626  2.162   1.00 3.16  ? 10 DA  F "H1'"  1  
ATOM 1110  H H8     . DA  B 2 10 ? -11.470 16.974  -1.632  1.00 3.19  ? 10 DA  F H8     1  
ATOM 1111  H H61    . DA  B 2 10 ? -11.213 12.184  -2.636  1.00 2.96  ? 10 DA  F H61    1  
ATOM 1112  H H62    . DA  B 2 10 ? -11.004 10.773  -1.629  1.00 2.90  ? 10 DA  F H62    1  
ATOM 1113  H H2     . DA  B 2 10 ? -10.662 12.221  2.604   1.00 2.92  ? 10 DA  F H2     1  
ATOM 1114  P P      . DA  B 2 11 ? -9.346  20.190  3.437   1.00 3.52  ? 11 DA  F P      1  
ATOM 1115  O OP1    . DA  B 2 11 ? -9.769  21.491  4.015   1.00 3.72  ? 11 DA  F OP1    1  
ATOM 1116  O OP2    . DA  B 2 11 ? -8.314  20.160  2.371   1.00 3.45  ? 11 DA  F OP2    1  
ATOM 1117  O "O5'"  . DA  B 2 11 ? -8.878  19.244  4.627   1.00 3.45  ? 11 DA  F "O5'"  1  
ATOM 1118  C "C5'"  . DA  B 2 11 ? -9.805  18.280  5.128   1.00 3.42  ? 11 DA  F "C5'"  1  
ATOM 1119  C "C4'"  . DA  B 2 11 ? -9.109  17.166  5.874   1.00 3.37  ? 11 DA  F "C4'"  1  
ATOM 1120  O "O4'"  . DA  B 2 11 ? -9.101  15.975  5.043   1.00 3.20  ? 11 DA  F "O4'"  1  
ATOM 1121  C "C3'"  . DA  B 2 11 ? -7.636  17.411  6.185   1.00 3.38  ? 11 DA  F "C3'"  1  
ATOM 1122  O "O3'"  . DA  B 2 11 ? -7.290  16.591  7.290   1.00 3.44  ? 11 DA  F "O3'"  1  
ATOM 1123  C "C2'"  . DA  B 2 11 ? -6.925  16.923  4.940   1.00 3.19  ? 11 DA  F "C2'"  1  
ATOM 1124  C "C1'"  . DA  B 2 11 ? -7.787  15.737  4.536   1.00 3.10  ? 11 DA  F "C1'"  1  
ATOM 1125  N N9     . DA  B 2 11 ? -7.854  15.474  3.098   1.00 2.97  ? 11 DA  F N9     1  
ATOM 1126  C C8     . DA  B 2 11 ? -7.998  16.362  2.066   1.00 2.99  ? 11 DA  F C8     1  
ATOM 1127  N N7     . DA  B 2 11 ? -7.971  15.804  0.877   1.00 2.90  ? 11 DA  F N7     1  
ATOM 1128  C C5     . DA  B 2 11 ? -7.799  14.453  1.148   1.00 2.81  ? 11 DA  F C5     1  
ATOM 1129  C C6     . DA  B 2 11 ? -7.682  13.319  0.314   1.00 2.74  ? 11 DA  F C6     1  
ATOM 1130  N N6     . DA  B 2 11 ? -7.713  13.368  -1.022  1.00 2.75  ? 11 DA  F N6     1  
ATOM 1131  N N1     . DA  B 2 11 ? -7.525  12.117  0.909   1.00 2.72  ? 11 DA  F N1     1  
ATOM 1132  C C2     . DA  B 2 11 ? -7.485  12.063  2.246   1.00 2.77  ? 11 DA  F C2     1  
ATOM 1133  N N3     . DA  B 2 11 ? -7.579  13.052  3.133   1.00 2.85  ? 11 DA  F N3     1  
ATOM 1134  C C4     . DA  B 2 11 ? -7.736  14.234  2.513   1.00 2.86  ? 11 DA  F C4     1  
ATOM 1135  H "H5'"  . DA  B 2 11 ? -10.365 17.851  4.296   1.00 3.33  ? 11 DA  F "H5'"  1  
ATOM 1136  H "H5''" . DA  B 2 11 ? -10.505 18.769  5.805   1.00 3.56  ? 11 DA  F "H5''" 1  
ATOM 1137  H "H4'"  . DA  B 2 11 ? -9.620  17.026  6.827   1.00 3.48  ? 11 DA  F "H4'"  1  
ATOM 1138  H "H3'"  . DA  B 2 11 ? -7.430  18.456  6.415   1.00 3.49  ? 11 DA  F "H3'"  1  
ATOM 1139  H "H2'"  . DA  B 2 11 ? -6.898  17.695  4.172   1.00 3.19  ? 11 DA  F "H2'"  1  
ATOM 1140  H "H2''" . DA  B 2 11 ? -5.896  16.641  5.158   1.00 3.17  ? 11 DA  F "H2''" 1  
ATOM 1141  H "H1'"  . DA  B 2 11 ? -7.420  14.829  5.023   1.00 3.08  ? 11 DA  F "H1'"  1  
ATOM 1142  H H8     . DA  B 2 11 ? -8.109  17.423  2.217   1.00 3.09  ? 11 DA  F H8     1  
ATOM 1143  H H61    . DA  B 2 11 ? -7.827  14.257  -1.488  1.00 2.80  ? 11 DA  F H61    1  
ATOM 1144  H H62    . DA  B 2 11 ? -7.615  12.523  -1.568  1.00 2.73  ? 11 DA  F H62    1  
ATOM 1145  H H2     . DA  B 2 11 ? -7.362  11.067  2.669   1.00 2.79  ? 11 DA  F H2     1  
ATOM 1146  P P      . DT  B 2 12 ? -5.977  16.885  8.144   1.00 3.55  ? 12 DT  F P      1  
ATOM 1147  O OP1    . DT  B 2 12 ? -6.358  17.377  9.492   1.00 3.80  ? 12 DT  F OP1    1  
ATOM 1148  O OP2    . DT  B 2 12 ? -5.014  17.658  7.321   1.00 3.48  ? 12 DT  F OP2    1  
ATOM 1149  O "O5'"  . DT  B 2 12 ? -5.431  15.399  8.291   1.00 3.46  ? 12 DT  F "O5'"  1  
ATOM 1150  C "C5'"  . DT  B 2 12 ? -6.333  14.317  8.052   1.00 3.38  ? 12 DT  F "C5'"  1  
ATOM 1151  C "C4'"  . DT  B 2 12 ? -5.612  12.992  8.022   1.00 3.31  ? 12 DT  F "C4'"  1  
ATOM 1152  O "O4'"  . DT  B 2 12 ? -5.575  12.508  6.655   1.00 3.11  ? 12 DT  F "O4'"  1  
ATOM 1153  C "C3'"  . DT  B 2 12 ? -4.148  13.060  8.441   1.00 3.37  ? 12 DT  F "C3'"  1  
ATOM 1154  O "O3'"  . DT  B 2 12 ? -3.748  11.775  8.901   1.00 3.42  ? 12 DT  F "O3'"  1  
ATOM 1155  C "C2'"  . DT  B 2 12 ? -3.432  13.401  7.149   1.00 3.19  ? 12 DT  F "C2'"  1  
ATOM 1156  C "C1'"  . DT  B 2 12 ? -4.257  12.635  6.126   1.00 3.03  ? 12 DT  F "C1'"  1  
ATOM 1157  N N1     . DT  B 2 12 ? -4.321  13.220  4.765   1.00 2.89  ? 12 DT  F N1     1  
ATOM 1158  C C2     . DT  B 2 12 ? -4.264  12.337  3.704   1.00 2.77  ? 12 DT  F C2     1  
ATOM 1159  O O2     . DT  B 2 12 ? -4.224  11.125  3.847   1.00 2.77  ? 12 DT  F O2     1  
ATOM 1160  N N3     . DT  B 2 12 ? -4.253  12.922  2.468   1.00 2.69  ? 12 DT  F N3     1  
ATOM 1161  C C4     . DT  B 2 12 ? -4.299  14.267  2.182   1.00 2.73  ? 12 DT  F C4     1  
ATOM 1162  O O4     . DT  B 2 12 ? -4.232  14.645  1.012   1.00 2.69  ? 12 DT  F O4     1  
ATOM 1163  C C5     . DT  B 2 12 ? -4.384  15.140  3.335   1.00 2.85  ? 12 DT  F C5     1  
ATOM 1164  C C7     . DT  B 2 12 ? -4.399  16.620  3.116   1.00 2.95  ? 12 DT  F C7     1  
ATOM 1165  C C6     . DT  B 2 12 ? -4.400  14.582  4.559   1.00 2.93  ? 12 DT  F C6     1  
ATOM 1166  H "H5'"  . DT  B 2 12 ? -6.833  14.468  7.095   1.00 3.26  ? 12 DT  F "H5'"  1  
ATOM 1167  H "H5''" . DT  B 2 12 ? -7.086  14.290  8.840   1.00 3.51  ? 12 DT  F "H5''" 1  
ATOM 1168  H "H4'"  . DT  B 2 12 ? -6.117  12.314  8.711   1.00 3.41  ? 12 DT  F "H4'"  1  
ATOM 1169  H "H3'"  . DT  B 2 12 ? -3.983  13.800  9.224   1.00 3.52  ? 12 DT  F "H3'"  1  
ATOM 1170  H "H2'"  . DT  B 2 12 ? -3.433  14.475  6.962   1.00 3.21  ? 12 DT  F "H2'"  1  
ATOM 1171  H "H2''" . DT  B 2 12 ? -2.395  13.074  7.177   1.00 3.18  ? 12 DT  F "H2''" 1  
ATOM 1172  H "H1'"  . DT  B 2 12 ? -3.864  11.619  6.026   1.00 3.00  ? 12 DT  F "H1'"  1  
ATOM 1173  H H3     . DT  B 2 12 ? -4.193  12.302  1.673   1.00 2.64  ? 12 DT  F H3     1  
ATOM 1174  H H71    . DT  B 2 12 ? -4.202  17.130  4.059   1.00 3.12  ? 12 DT  F H71    1  
ATOM 1175  H H72    . DT  B 2 12 ? -3.632  16.889  2.391   1.00 3.09  ? 12 DT  F H72    1  
ATOM 1176  H H73    . DT  B 2 12 ? -5.377  16.922  2.738   1.00 3.19  ? 12 DT  F H73    1  
ATOM 1177  H H6     . DT  B 2 12 ? -4.482  15.236  5.426   1.00 3.05  ? 12 DT  F H6     1  
ATOM 1178  P P      . DA  B 2 13 ? -2.430  11.609  9.794   1.00 3.57  ? 13 DA  F P      1  
ATOM 1179  O OP1    . DA  B 2 13 ? -2.787  10.983  11.091  1.00 3.86  ? 13 DA  F OP1    1  
ATOM 1180  O OP2    . DA  B 2 13 ? -1.661  12.880  9.777   1.00 3.52  ? 13 DA  F OP2    1  
ATOM 1181  O "O5'"  . DA  B 2 13 ? -1.646  10.538  8.919   1.00 3.53  ? 13 DA  F "O5'"  1  
ATOM 1182  C "C5'"  . DA  B 2 13 ? -2.363  9.800   7.925   1.00 3.46  ? 13 DA  F "C5'"  1  
ATOM 1183  C "C4'"  . DA  B 2 13 ? -1.419  9.036   7.029   1.00 3.40  ? 13 DA  F "C4'"  1  
ATOM 1184  O "O4'"  . DA  B 2 13 ? -1.411  9.654   5.722   1.00 3.22  ? 13 DA  F "O4'"  1  
ATOM 1185  C "C3'"  . DA  B 2 13 ? 0.027   9.091   7.507   1.00 3.45  ? 13 DA  F "C3'"  1  
ATOM 1186  O "O3'"  . DA  B 2 13 ? 0.727   7.979   6.962   1.00 3.50  ? 13 DA  F "O3'"  1  
ATOM 1187  C "C2'"  . DA  B 2 13 ? 0.543   10.370  6.869   1.00 3.30  ? 13 DA  F "C2'"  1  
ATOM 1188  C "C1'"  . DA  B 2 13 ? -0.192  10.352  5.530   1.00 3.15  ? 13 DA  F "C1'"  1  
ATOM 1189  N N9     . DA  B 2 13 ? -0.474  11.640  4.893   1.00 3.03  ? 13 DA  F N9     1  
ATOM 1190  C C8     . DA  B 2 13 ? -0.697  12.880  5.434   1.00 3.06  ? 13 DA  F C8     1  
ATOM 1191  N N7     . DA  B 2 13 ? -0.876  13.824  4.535   1.00 2.97  ? 13 DA  F N7     1  
ATOM 1192  C C5     . DA  B 2 13 ? -0.766  13.155  3.323   1.00 2.86  ? 13 DA  F C5     1  
ATOM 1193  C C6     . DA  B 2 13 ? -0.848  13.588  1.979   1.00 2.77  ? 13 DA  F C6     1  
ATOM 1194  N N6     . DA  B 2 13 ? -1.058  14.855  1.611   1.00 2.78  ? 13 DA  F N6     1  
ATOM 1195  N N1     . DA  B 2 13 ? -0.697  12.655  1.012   1.00 2.73  ? 13 DA  F N1     1  
ATOM 1196  C C2     . DA  B 2 13 ? -0.474  11.386  1.371   1.00 2.78  ? 13 DA  F C2     1  
ATOM 1197  N N3     . DA  B 2 13 ? -0.371  10.862  2.590   1.00 2.87  ? 13 DA  F N3     1  
ATOM 1198  C C4     . DA  B 2 13 ? -0.529  11.810  3.530   1.00 2.90  ? 13 DA  F C4     1  
ATOM 1199  H "H5'"  . DA  B 2 13 ? -2.951  10.486  7.319   1.00 3.37  ? 13 DA  F "H5'"  1  
ATOM 1200  H "H5''" . DA  B 2 13 ? -3.036  9.094   8.413   1.00 3.59  ? 13 DA  F "H5''" 1  
ATOM 1201  H "H4'"  . DA  B 2 13 ? -1.724  7.987   7.022   1.00 3.49  ? 13 DA  F "H4'"  1  
ATOM 1202  H "H3'"  . DA  B 2 13 ? 0.103   9.092   8.592   1.00 3.59  ? 13 DA  F "H3'"  1  
ATOM 1203  H "H2'"  . DA  B 2 13 ? 0.284   11.240  7.470   1.00 3.32  ? 13 DA  F "H2'"  1  
ATOM 1204  H "H2''" . DA  B 2 13 ? 1.630   10.356  6.770   1.00 3.30  ? 13 DA  F "H2''" 1  
ATOM 1205  H "H1'"  . DA  B 2 13 ? 0.382   9.762   4.814   1.00 3.13  ? 13 DA  F "H1'"  1  
ATOM 1206  H H8     . DA  B 2 13 ? -0.713  13.067  6.496   1.00 3.19  ? 13 DA  F H8     1  
ATOM 1207  H H61    . DA  B 2 13 ? -1.170  15.576  2.310   1.00 2.85  ? 13 DA  F H61    1  
ATOM 1208  H H62    . DA  B 2 13 ? -1.090  15.100  0.632   1.00 2.75  ? 13 DA  F H62    1  
ATOM 1209  H H2     . DA  B 2 13 ? -0.362  10.679  0.548   1.00 2.78  ? 13 DA  F H2     1  
ATOM 1210  P P      . DA  B 2 14 ? 1.536   6.985   7.911   1.00 3.60  ? 14 DA  F P      1  
ATOM 1211  O OP1    . DA  B 2 14 ? 0.682   6.570   9.049   1.00 3.81  ? 14 DA  F OP1    1  
ATOM 1212  O OP2    . DA  B 2 14 ? 2.874   7.573   8.168   1.00 3.60  ? 14 DA  F OP2    1  
ATOM 1213  O "O5'"  . DA  B 2 14 ? 1.715   5.732   6.952   1.00 3.55  ? 14 DA  F "O5'"  1  
ATOM 1214  C "C5'"  . DA  B 2 14 ? 0.743   5.492   5.939   1.00 3.47  ? 14 DA  F "C5'"  1  
ATOM 1215  C "C4'"  . DA  B 2 14 ? 1.400   5.120   4.629   1.00 3.38  ? 14 DA  F "C4'"  1  
ATOM 1216  O "O4'"  . DA  B 2 14 ? 1.350   6.264   3.733   1.00 3.17  ? 14 DA  F "O4'"  1  
ATOM 1217  C "C3'"  . DA  B 2 14 ? 2.888   4.799   4.738   1.00 3.45  ? 14 DA  F "C3'"  1  
ATOM 1218  O "O3'"  . DA  B 2 14 ? 3.258   3.981   3.638   1.00 3.46  ? 14 DA  F "O3'"  1  
ATOM 1219  C "C2'"  . DA  B 2 14 ? 3.557   6.151   4.607   1.00 3.30  ? 14 DA  F "C2'"  1  
ATOM 1220  C "C1'"  . DA  B 2 14 ? 2.651   6.845   3.606   1.00 3.12  ? 14 DA  F "C1'"  1  
ATOM 1221  N N9     . DA  B 2 14 ? 2.563   8.300   3.748   1.00 3.00  ? 14 DA  F N9     1  
ATOM 1222  C C8     . DA  B 2 14 ? 2.473   9.053   4.890   1.00 3.05  ? 14 DA  F C8     1  
ATOM 1223  N N7     . DA  B 2 14 ? 2.474   10.348  4.671   1.00 2.96  ? 14 DA  F N7     1  
ATOM 1224  C C5     . DA  B 2 14 ? 2.559   10.453  3.289   1.00 2.83  ? 14 DA  F C5     1  
ATOM 1225  C C6     . DA  B 2 14 ? 2.607   11.566  2.418   1.00 2.72  ? 14 DA  F C6     1  
ATOM 1226  N N6     . DA  B 2 14 ? 2.575   12.834  2.829   1.00 2.73  ? 14 DA  F N6     1  
ATOM 1227  N N1     . DA  B 2 14 ? 2.692   11.322  1.091   1.00 2.66  ? 14 DA  F N1     1  
ATOM 1228  C C2     . DA  B 2 14 ? 2.728   10.049  0.676   1.00 2.70  ? 14 DA  F C2     1  
ATOM 1229  N N3     . DA  B 2 14 ? 2.691   8.925   1.393   1.00 2.80  ? 14 DA  F N3     1  
ATOM 1230  C C4     . DA  B 2 14 ? 2.606   9.200   2.708   1.00 2.85  ? 14 DA  F C4     1  
ATOM 1231  H "H5'"  . DA  B 2 14 ? 0.143   6.391   5.791   1.00 3.37  ? 14 DA  F "H5'"  1  
ATOM 1232  H "H5''" . DA  B 2 14 ? 0.088   4.678   6.250   1.00 3.59  ? 14 DA  F "H5''" 1  
ATOM 1233  H "H4'"  . DA  B 2 14 ? 0.902   4.233   4.236   1.00 3.44  ? 14 DA  F "H4'"  1  
ATOM 1234  H "H3'"  . DA  B 2 14 ? 3.130   4.295   5.673   1.00 3.61  ? 14 DA  F "H3'"  1  
ATOM 1235  H "H2'"  . DA  B 2 14 ? 3.591   6.671   5.565   1.00 3.35  ? 14 DA  F "H2'"  1  
ATOM 1236  H "H2''" . DA  B 2 14 ? 4.582   6.052   4.252   1.00 3.29  ? 14 DA  F "H2''" 1  
ATOM 1237  H "H1'"  . DA  B 2 14 ? 2.994   6.633   2.590   1.00 3.07  ? 14 DA  F "H1'"  1  
ATOM 1238  H H8     . DA  B 2 14 ? 2.408   8.622   5.877   1.00 3.19  ? 14 DA  F H8     1  
ATOM 1239  H H61    . DA  B 2 14 ? 2.514   13.043  3.815   1.00 2.81  ? 14 DA  F H61    1  
ATOM 1240  H H62    . DA  B 2 14 ? 2.613   13.590  2.157   1.00 2.69  ? 14 DA  F H62    1  
ATOM 1241  H H2     . DA  B 2 14 ? 2.795   9.913   -0.403  1.00 2.69  ? 14 DA  F H2     1  
ATOM 1242  P P      . DT  B 2 15 ? 4.640   3.181   3.656   1.00 3.61  ? 15 DT  F P      1  
ATOM 1243  O OP1    . DT  B 2 15 ? 4.373   1.723   3.723   1.00 3.87  ? 15 DT  F OP1    1  
ATOM 1244  O OP2    . DT  B 2 15 ? 5.550   3.810   4.647   1.00 3.59  ? 15 DT  F OP2    1  
ATOM 1245  O "O5'"  . DT  B 2 15 ? 5.172   3.538   2.202   1.00 3.50  ? 15 DT  F "O5'"  1  
ATOM 1246  C "C5'"  . DT  B 2 15 ? 4.250   4.074   1.249   1.00 3.39  ? 15 DT  F "C5'"  1  
ATOM 1247  C "C4'"  . DT  B 2 15 ? 4.955   4.546   -0.001  1.00 3.31  ? 15 DT  F "C4'"  1  
ATOM 1248  O "O4'"  . DT  B 2 15 ? 4.922   5.996   -0.041  1.00 3.13  ? 15 DT  F "O4'"  1  
ATOM 1249  C "C3'"  . DT  B 2 15 ? 6.437   4.194   -0.051  1.00 3.38  ? 15 DT  F "C3'"  1  
ATOM 1250  O "O3'"  . DT  B 2 15 ? 6.854   4.176   -1.412  1.00 3.40  ? 15 DT  F "O3'"  1  
ATOM 1251  C "C2'"  . DT  B 2 15 ? 7.092   5.353   0.677   1.00 3.23  ? 15 DT  F "C2'"  1  
ATOM 1252  C "C1'"  . DT  B 2 15 ? 6.213   6.521   0.248   1.00 3.08  ? 15 DT  F "C1'"  1  
ATOM 1253  N N1     . DT  B 2 15 ? 6.086   7.647   1.207   1.00 2.97  ? 15 DT  F N1     1  
ATOM 1254  C C2     . DT  B 2 15 ? 6.047   8.916   0.663   1.00 2.83  ? 15 DT  F C2     1  
ATOM 1255  O O2     . DT  B 2 15 ? 6.059   9.125   -0.539  1.00 2.82  ? 15 DT  F O2     1  
ATOM 1256  N N3     . DT  B 2 15 ? 5.997   9.934   1.577   1.00 2.77  ? 15 DT  F N3     1  
ATOM 1257  C C4     . DT  B 2 15 ? 5.974   9.821   2.949   1.00 2.85  ? 15 DT  F C4     1  
ATOM 1258  O O4     . DT  B 2 15 ? 5.981   10.836  3.644   1.00 2.84  ? 15 DT  F O4     1  
ATOM 1259  C C5     . DT  B 2 15 ? 5.990   8.461   3.456   1.00 2.99  ? 15 DT  F C5     1  
ATOM 1260  C C7     . DT  B 2 15 ? 5.981   8.241   4.935   1.00 3.13  ? 15 DT  F C7     1  
ATOM 1261  C C6     . DT  B 2 15 ? 6.039   7.451   2.572   1.00 3.04  ? 15 DT  F C6     1  
ATOM 1262  H "H5'"  . DT  B 2 15 ? 3.718   4.914   1.694   1.00 3.29  ? 15 DT  F "H5'"  1  
ATOM 1263  H "H5''" . DT  B 2 15 ? 3.528   3.306   0.975   1.00 3.49  ? 15 DT  F "H5''" 1  
ATOM 1264  H "H4'"  . DT  B 2 15 ? 4.480   4.073   -0.862  1.00 3.38  ? 15 DT  F "H4'"  1  
ATOM 1265  H "H3'"  . DT  B 2 15 ? 6.644   3.231   0.414   1.00 3.52  ? 15 DT  F "H3'"  1  
ATOM 1266  H "H2'"  . DT  B 2 15 ? 7.083   5.200   1.756   1.00 3.28  ? 15 DT  F "H2'"  1  
ATOM 1267  H "H2''" . DT  B 2 15 ? 8.128   5.474   0.370   1.00 3.23  ? 15 DT  F "H2''" 1  
ATOM 1268  H "H1'"  . DT  B 2 15 ? 6.594   6.936   -0.690  1.00 3.04  ? 15 DT  F "H1'"  1  
ATOM 1269  H H3     . DT  B 2 15 ? 5.982   10.874  1.203   1.00 2.70  ? 15 DT  F H3     1  
ATOM 1270  H H71    . DT  B 2 15 ? 6.454   7.285   5.162   1.00 3.02  ? 15 DT  F H71    1  
ATOM 1271  H H72    . DT  B 2 15 ? 6.528   9.044   5.428   1.00 3.25  ? 15 DT  F H72    1  
ATOM 1272  H H73    . DT  B 2 15 ? 4.952   8.230   5.293   1.00 3.61  ? 15 DT  F H73    1  
ATOM 1273  H H6     . DT  B 2 15 ? 6.043   6.429   2.953   1.00 3.18  ? 15 DT  F H6     1  
ATOM 1274  P P      . DT  B 2 16 ? 8.168   3.378   -1.847  1.00 3.52  ? 16 DT  F P      1  
ATOM 1275  O OP1    . DT  B 2 16 ? 7.796   2.037   -2.368  1.00 3.75  ? 16 DT  F OP1    1  
ATOM 1276  O OP2    . DT  B 2 16 ? 9.146   3.487   -0.738  1.00 3.55  ? 16 DT  F OP2    1  
ATOM 1277  O "O5'"  . DT  B 2 16 ? 8.671   4.276   -3.060  1.00 3.38  ? 16 DT  F "O5'"  1  
ATOM 1278  C "C5'"  . DT  B 2 16 ? 7.761   5.206   -3.645  1.00 3.24  ? 16 DT  F "C5'"  1  
ATOM 1279  C "C4'"  . DT  B 2 16 ? 8.489   6.323   -4.354  1.00 3.15  ? 16 DT  F "C4'"  1  
ATOM 1280  O "O4'"  . DT  B 2 16 ? 8.475   7.505   -3.516  1.00 2.98  ? 16 DT  F "O4'"  1  
ATOM 1281  C "C3'"  . DT  B 2 16 ? 9.970   6.055   -4.604  1.00 3.22  ? 16 DT  F "C3'"  1  
ATOM 1282  O "O3'"  . DT  B 2 16 ? 10.375  6.893   -5.679  1.00 3.21  ? 16 DT  F "O3'"  1  
ATOM 1283  C "C2'"  . DT  B 2 16 ? 10.634  6.524   -3.324  1.00 3.11  ? 16 DT  F "C2'"  1  
ATOM 1284  C "C1'"  . DT  B 2 16 ? 9.769   7.728   -2.966  1.00 2.95  ? 16 DT  F "C1'"  1  
ATOM 1285  N N1     . DT  B 2 16 ? 9.645   8.052   -1.529  1.00 2.89  ? 16 DT  F N1     1  
ATOM 1286  C C2     . DT  B 2 16 ? 9.526   9.388   -1.206  1.00 2.76  ? 16 DT  F C2     1  
ATOM 1287  O O2     . DT  B 2 16 ? 9.458   10.273  -2.043  1.00 2.69  ? 16 DT  F O2     1  
ATOM 1288  N N3     . DT  B 2 16 ? 9.492   9.654   0.137   1.00 2.76  ? 16 DT  F N3     1  
ATOM 1289  C C4     . DT  B 2 16 ? 9.555   8.743   1.166   1.00 2.89  ? 16 DT  F C4     1  
ATOM 1290  O O4     . DT  B 2 16 ? 9.564   9.139   2.331   1.00 2.92  ? 16 DT  F O4     1  
ATOM 1291  C C5     . DT  B 2 16 ? 9.656   7.359   0.759   1.00 3.02  ? 16 DT  F C5     1  
ATOM 1292  C C7     . DT  B 2 16 ? 9.787   6.308   1.814   1.00 3.20  ? 16 DT  F C7     1  
ATOM 1293  C C6     . DT  B 2 16 ? 9.685   7.079   -0.553  1.00 3.01  ? 16 DT  F C6     1  
ATOM 1294  H "H5'"  . DT  B 2 16 ? 7.130   5.634   -2.865  1.00 3.14  ? 16 DT  F "H5'"  1  
ATOM 1295  H "H5''" . DT  B 2 16 ? 7.127   4.688   -4.364  1.00 3.35  ? 16 DT  F "H5''" 1  
ATOM 1296  H "H4'"  . DT  B 2 16 ? 8.019   6.473   -5.327  1.00 3.20  ? 16 DT  F "H4'"  1  
ATOM 1297  H "H3'"  . DT  B 2 16 ? 10.174  5.012   -4.841  1.00 3.37  ? 16 DT  F "H3'"  1  
ATOM 1298  H "H2'"  . DT  B 2 16 ? 10.599  5.748   -2.560  1.00 3.18  ? 16 DT  F "H2'"  1  
ATOM 1299  H "H2''" . DT  B 2 16 ? 11.681  6.768   -3.489  1.00 3.11  ? 16 DT  F "H2''" 1  
ATOM 1300  H "H1'"  . DT  B 2 16 ? 10.165  8.616   -3.466  1.00 2.90  ? 16 DT  F "H1'"  1  
ATOM 1301  H H3     . DT  B 2 16 ? 9.427   10.626  0.402   1.00 2.70  ? 16 DT  F H3     1  
ATOM 1302  H H71    . DT  B 2 16 ? 8.896   6.308   2.439   1.00 2.98  ? 16 DT  F H71    1  
ATOM 1303  H H72    . DT  B 2 16 ? 10.661  6.521   2.429   1.00 3.70  ? 16 DT  F H72    1  
ATOM 1304  H H73    . DT  B 2 16 ? 9.903   5.331   1.345   1.00 3.47  ? 16 DT  F H73    1  
ATOM 1305  H H6     . DT  B 2 16 ? 9.739   6.035   -0.862  1.00 3.14  ? 16 DT  F H6     1  
ATOM 1306  P P      . DG  B 2 17 ? 11.691  6.570   -6.528  1.00 3.40  ? 17 DG  F P      1  
ATOM 1307  O OP1    . DG  B 2 17 ? 11.351  5.727   -7.705  1.00 3.58  ? 17 DG  F OP1    1  
ATOM 1308  O OP2    . DG  B 2 17 ? 12.760  6.134   -5.597  1.00 3.47  ? 17 DG  F OP2    1  
ATOM 1309  O "O5'"  . DG  B 2 17 ? 12.043  8.037   -7.035  1.00 3.37  ? 17 DG  F "O5'"  1  
ATOM 1310  C "C5'"  . DG  B 2 17 ? 11.019  9.031   -6.989  1.00 3.26  ? 17 DG  F "C5'"  1  
ATOM 1311  C "C4'"  . DG  B 2 17 ? 11.595  10.426  -6.937  1.00 3.18  ? 17 DG  F "C4'"  1  
ATOM 1312  O "O4'"  . DG  B 2 17 ? 11.501  10.925  -5.576  1.00 3.00  ? 17 DG  F "O4'"  1  
ATOM 1313  C "C3'"  . DG  B 2 17 ? 13.080  10.528  -7.270  1.00 3.24  ? 17 DG  F "C3'"  1  
ATOM 1314  O "O3'"  . DG  B 2 17 ? 13.340  11.859  -7.696  1.00 3.24  ? 17 DG  F "O3'"  1  
ATOM 1315  C "C2'"  . DG  B 2 17 ? 13.757  10.275  -5.938  1.00 3.13  ? 17 DG  F "C2'"  1  
ATOM 1316  C "C1'"  . DG  B 2 17 ? 12.792  10.944  -4.968  1.00 2.97  ? 17 DG  F "C1'"  1  
ATOM 1317  N N9     . DG  B 2 17 ? 12.718  10.345  -3.638  1.00 2.91  ? 17 DG  F N9     1  
ATOM 1318  C C8     . DG  B 2 17 ? 12.680  9.012   -3.313  1.00 2.99  ? 17 DG  F C8     1  
ATOM 1319  N N7     . DG  B 2 17 ? 12.674  8.792   -2.024  1.00 2.96  ? 17 DG  F N7     1  
ATOM 1320  C C5     . DG  B 2 17 ? 12.703  10.062  -1.458  1.00 2.84  ? 17 DG  F C5     1  
ATOM 1321  C C6     . DG  B 2 17 ? 12.716  10.471  -0.088  1.00 2.80  ? 17 DG  F C6     1  
ATOM 1322  O O6     . DG  B 2 17 ? 12.720  9.768   0.937   1.00 2.86  ? 17 DG  F O6     1  
ATOM 1323  N N1     . DG  B 2 17 ? 12.738  11.858  0.029   1.00 2.72  ? 17 DG  F N1     1  
ATOM 1324  C C2     . DG  B 2 17 ? 12.748  12.739  -1.026  1.00 2.69  ? 17 DG  F C2     1  
ATOM 1325  N N2     . DG  B 2 17 ? 12.770  14.041  -0.709  1.00 2.67  ? 17 DG  F N2     1  
ATOM 1326  N N3     . DG  B 2 17 ? 12.742  12.374  -2.299  1.00 2.74  ? 17 DG  F N3     1  
ATOM 1327  C C4     . DG  B 2 17 ? 12.717  11.029  -2.441  1.00 2.80  ? 17 DG  F C4     1  
ATOM 1328  H "H5'"  . DG  B 2 17 ? 10.400  8.870   -6.106  1.00 3.16  ? 17 DG  F "H5'"  1  
ATOM 1329  H "H5''" . DG  B 2 17 ? 10.392  8.944   -7.877  1.00 3.38  ? 17 DG  F "H5''" 1  
ATOM 1330  H "H4'"  . DG  B 2 17 ? 11.061  11.041  -7.662  1.00 3.22  ? 17 DG  F "H4'"  1  
ATOM 1331  H "H3'"  . DG  B 2 17 ? 13.378  9.823   -8.043  1.00 3.39  ? 17 DG  F "H3'"  1  
ATOM 1332  H "H2'"  . DG  B 2 17 ? 13.862  9.207   -5.746  1.00 3.19  ? 17 DG  F "H2'"  1  
ATOM 1333  H "H2''" . DG  B 2 17 ? 14.753  10.710  -5.916  1.00 3.13  ? 17 DG  F "H2''" 1  
ATOM 1334  H "H1'"  . DG  B 2 17 ? 13.066  11.995  -4.845  1.00 2.92  ? 17 DG  F "H1'"  1  
ATOM 1335  H H8     . DG  B 2 17 ? 12.660  8.225   -4.053  1.00 3.11  ? 17 DG  F H8     1  
ATOM 1336  H H1     . DG  B 2 17 ? 12.744  12.252  0.961   1.00 2.73  ? 17 DG  F H1     1  
ATOM 1337  H H21    . DG  B 2 17 ? 12.779  14.738  -1.441  1.00 2.69  ? 17 DG  F H21    1  
ATOM 1338  H H22    . DG  B 2 17 ? 12.776  14.330  0.259   1.00 2.68  ? 17 DG  F H22    1  
ATOM 1339  P P      . DT  B 2 18 ? 14.646  12.207  -8.551  1.00 3.36  ? 18 DT  F P      1  
ATOM 1340  O OP1    . DT  B 2 18 ? 14.271  12.405  -9.974  1.00 3.53  ? 18 DT  F OP1    1  
ATOM 1341  O OP2    . DT  B 2 18 ? 15.731  11.254  -8.199  1.00 3.38  ? 18 DT  F OP2    1  
ATOM 1342  O "O5'"  . DT  B 2 18 ? 14.988  13.630  -7.930  1.00 3.25  ? 18 DT  F "O5'"  1  
ATOM 1343  C "C5'"  . DT  B 2 18 ? 13.962  14.320  -7.215  1.00 3.14  ? 18 DT  F "C5'"  1  
ATOM 1344  C "C4'"  . DT  B 2 18 ? 14.524  15.469  -6.412  1.00 3.08  ? 18 DT  F "C4'"  1  
ATOM 1345  O "O4'"  . DT  B 2 18 ? 14.526  15.099  -5.009  1.00 2.95  ? 18 DT  F "O4'"  1  
ATOM 1346  C "C3'"  . DT  B 2 18 ? 15.980  15.798  -6.722  1.00 3.15  ? 18 DT  F "C3'"  1  
ATOM 1347  O "O3'"  . DT  B 2 18 ? 16.233  17.157  -6.384  1.00 3.16  ? 18 DT  F "O3'"  1  
ATOM 1348  C "C2'"  . DT  B 2 18 ? 16.751  14.870  -5.806  1.00 3.07  ? 18 DT  F "C2'"  1  
ATOM 1349  C "C1'"  . DT  B 2 18 ? 15.859  14.837  -4.574  1.00 2.94  ? 18 DT  F "C1'"  1  
ATOM 1350  N N1     . DT  B 2 18 ? 15.893  13.580  -3.799  1.00 2.90  ? 18 DT  F N1     1  
ATOM 1351  C C2     . DT  B 2 18 ? 15.848  13.693  -2.425  1.00 2.83  ? 18 DT  F C2     1  
ATOM 1352  O O2     . DT  B 2 18 ? 15.702  14.759  -1.849  1.00 2.80  ? 18 DT  F O2     1  
ATOM 1353  N N3     . DT  B 2 18 ? 15.980  12.512  -1.746  1.00 2.84  ? 18 DT  F N3     1  
ATOM 1354  C C4     . DT  B 2 18 ? 16.135  11.254  -2.288  1.00 2.92  ? 18 DT  F C4     1  
ATOM 1355  O O4     . DT  B 2 18 ? 16.293  10.286  -1.545  1.00 2.97  ? 18 DT  F O4     1  
ATOM 1356  C C5     . DT  B 2 18 ? 16.141  11.201  -3.734  1.00 2.99  ? 18 DT  F C5     1  
ATOM 1357  C C7     . DT  B 2 18 ? 16.378  9.886   -4.408  1.00 3.12  ? 18 DT  F C7     1  
ATOM 1358  C C6     . DT  B 2 18 ? 16.009  12.351  -4.414  1.00 2.98  ? 18 DT  F C6     1  
ATOM 1359  H "H5'"  . DT  B 2 18 ? 13.463  13.626  -6.540  1.00 3.07  ? 18 DT  F "H5'"  1  
ATOM 1360  H "H5''" . DT  B 2 18 ? 13.231  14.711  -7.922  1.00 3.20  ? 18 DT  F "H5''" 1  
ATOM 1361  H "H4'"  . DT  B 2 18 ? 13.934  16.360  -6.630  1.00 3.12  ? 18 DT  F "H4'"  1  
ATOM 1362  H "H3'"  . DT  B 2 18 ? 16.213  15.634  -7.772  1.00 3.27  ? 18 DT  F "H3'"  1  
ATOM 1363  H "H2'"  . DT  B 2 18 ? 16.874  13.884  -6.255  1.00 3.12  ? 18 DT  F "H2'"  1  
ATOM 1364  H "H2''" . DT  B 2 18 ? 17.745  15.259  -5.590  1.00 3.08  ? 18 DT  F "H2''" 1  
ATOM 1365  H "H1'"  . DT  B 2 18 ? 16.134  15.648  -3.898  1.00 2.91  ? 18 DT  F "H1'"  1  
ATOM 1366  H H3     . DT  B 2 18 ? 15.985  12.576  -0.738  1.00 2.82  ? 18 DT  F H3     1  
ATOM 1367  H H71    . DT  B 2 18 ? 16.564  10.048  -5.470  1.00 3.62  ? 18 DT  F H71    1  
ATOM 1368  H H72    . DT  B 2 18 ? 17.243  9.399   -3.959  1.00 2.90  ? 18 DT  F H72    1  
ATOM 1369  H H73    . DT  B 2 18 ? 15.500  9.252   -4.285  1.00 3.33  ? 18 DT  F H73    1  
ATOM 1370  H H6     . DT  B 2 18 ? 15.987  12.311  -5.503  1.00 3.07  ? 18 DT  F H6     1  
ATOM 1371  P P      . DC  B 2 19 ? 17.526  17.898  -6.959  1.00 3.27  ? 19 DC  F P      1  
ATOM 1372  O OP1    . DC  B 2 19 ? 17.135  19.202  -7.551  1.00 3.45  ? 19 DC  F OP1    1  
ATOM 1373  O OP2    . DC  B 2 19 ? 18.316  16.932  -7.762  1.00 3.38  ? 19 DC  F OP2    1  
ATOM 1374  O "O5'"  . DC  B 2 19 ? 18.303  18.177  -5.600  1.00 3.13  ? 19 DC  F "O5'"  1  
ATOM 1375  C "C5'"  . DC  B 2 19 ? 17.581  18.139  -4.364  1.00 3.03  ? 19 DC  F "C5'"  1  
ATOM 1376  C "C4'"  . DC  B 2 19 ? 18.507  18.354  -3.192  1.00 3.03  ? 19 DC  F "C4'"  1  
ATOM 1377  O "O4'"  . DC  B 2 19 ? 18.634  17.116  -2.458  1.00 2.96  ? 19 DC  F "O4'"  1  
ATOM 1378  C "C3'"  . DC  B 2 19 ? 19.923  18.713  -3.622  1.00 3.12  ? 19 DC  F "C3'"  1  
ATOM 1379  O "O3'"  . DC  B 2 19 ? 20.555  19.401  -2.548  1.00 3.19  ? 19 DC  F "O3'"  1  
ATOM 1380  C "C2'"  . DC  B 2 19 ? 20.569  17.350  -3.815  1.00 3.09  ? 19 DC  F "C2'"  1  
ATOM 1381  C "C1'"  . DC  B 2 19 ? 19.911  16.547  -2.691  1.00 3.01  ? 19 DC  F "C1'"  1  
ATOM 1382  N N1     . DC  B 2 19 ? 19.751  15.090  -2.878  1.00 2.97  ? 19 DC  F N1     1  
ATOM 1383  C C2     . DC  B 2 19 ? 19.738  14.283  -1.730  1.00 2.95  ? 19 DC  F C2     1  
ATOM 1384  O O2     . DC  B 2 19 ? 19.819  14.821  -0.615  1.00 2.96  ? 19 DC  F O2     1  
ATOM 1385  N N3     . DC  B 2 19 ? 19.639  12.943  -1.859  1.00 2.96  ? 19 DC  F N3     1  
ATOM 1386  C C4     . DC  B 2 19 ? 19.549  12.395  -3.071  1.00 3.00  ? 19 DC  F C4     1  
ATOM 1387  N N4     . DC  B 2 19 ? 19.472  11.061  -3.144  1.00 3.07  ? 19 DC  F N4     1  
ATOM 1388  C C5     . DC  B 2 19 ? 19.539  13.189  -4.260  1.00 3.03  ? 19 DC  F C5     1  
ATOM 1389  C C6     . DC  B 2 19 ? 19.639  14.522  -4.117  1.00 3.01  ? 19 DC  F C6     1  
ATOM 1390  H "H5'"  . DC  B 2 19 ? 17.096  17.171  -4.258  1.00 2.95  ? 19 DC  F "H5'"  1  
ATOM 1391  H "H5''" . DC  B 2 19 ? 16.819  18.917  -4.361  1.00 3.07  ? 19 DC  F "H5''" 1  
ATOM 1392  H "H4'"  . DC  B 2 19 ? 18.123  19.186  -2.598  1.00 3.07  ? 19 DC  F "H4'"  1  
ATOM 1393  H "H3'"  . DC  B 2 19 ? 19.939  19.326  -4.522  1.00 3.19  ? 19 DC  F "H3'"  1  
ATOM 1394  H "H2'"  . DC  B 2 19 ? 20.342  16.944  -4.801  1.00 3.10  ? 19 DC  F "H2'"  1  
ATOM 1395  H "H2''" . DC  B 2 19 ? 21.653  17.412  -3.736  1.00 3.16  ? 19 DC  F "H2''" 1  
ATOM 1396  H "H1'"  . DC  B 2 19 ? 20.481  16.691  -1.770  1.00 3.05  ? 19 DC  F "H1'"  1  
ATOM 1397  H H41    . DC  B 2 19 ? 19.406  10.609  -4.045  1.00 3.14  ? 19 DC  F H41    1  
ATOM 1398  H H42    . DC  B 2 19 ? 19.496  10.505  -2.302  1.00 3.08  ? 19 DC  F H42    1  
ATOM 1399  H H5     . DC  B 2 19 ? 19.456  12.730  -5.246  1.00 3.10  ? 19 DC  F H5     1  
ATOM 1400  H H6     . DC  B 2 19 ? 19.632  15.156  -5.002  1.00 3.06  ? 19 DC  F H6     1  
ATOM 1401  P P      . DA  B 2 20 ? 21.250  20.818  -2.794  1.00 3.29  ? 20 DA  F P      1  
ATOM 1402  O OP1    . DA  B 2 20 ? 20.267  21.772  -3.366  1.00 3.42  ? 20 DA  F OP1    1  
ATOM 1403  O OP2    . DA  B 2 20 ? 22.541  20.588  -3.491  1.00 3.33  ? 20 DA  F OP2    1  
ATOM 1404  O "O5'"  . DA  B 2 20 ? 21.559  21.281  -1.303  1.00 3.30  ? 20 DA  F "O5'"  1  
ATOM 1405  C "C5'"  . DA  B 2 20 ? 20.660  20.927  -0.254  1.00 3.24  ? 20 DA  F "C5'"  1  
ATOM 1406  C "C4'"  . DA  B 2 20 ? 21.412  20.431  0.961   1.00 3.24  ? 20 DA  F "C4'"  1  
ATOM 1407  O "O4'"  . DA  B 2 20 ? 21.506  18.986  0.902   1.00 3.14  ? 20 DA  F "O4'"  1  
ATOM 1408  C "C3'"  . DA  B 2 20 ? 22.862  20.905  1.021   1.00 3.33  ? 20 DA  F "C3'"  1  
ATOM 1409  O "O3'"  . DA  B 2 20 ? 23.299  20.844  2.376   1.00 3.39  ? 20 DA  F "O3'"  1  
ATOM 1410  C "C2'"  . DA  B 2 20 ? 23.607  19.862  0.214   1.00 3.24  ? 20 DA  F "C2'"  1  
ATOM 1411  C "C1'"  . DA  B 2 20 ? 22.839  18.599  0.578   1.00 3.14  ? 20 DA  F "C1'"  1  
ATOM 1412  N N9     . DA  B 2 20 ? 22.811  17.554  -0.444  1.00 3.07  ? 20 DA  F N9     1  
ATOM 1413  C C8     . DA  B 2 20 ? 22.785  17.677  -1.807  1.00 3.09  ? 20 DA  F C8     1  
ATOM 1414  N N7     . DA  B 2 20 ? 22.820  16.529  -2.443  1.00 3.07  ? 20 DA  F N7     1  
ATOM 1415  C C5     . DA  B 2 20 ? 22.862  15.586  -1.426  1.00 3.03  ? 20 DA  F C5     1  
ATOM 1416  C C6     . DA  B 2 20 ? 22.915  14.177  -1.438  1.00 3.03  ? 20 DA  F C6     1  
ATOM 1417  N N6     . DA  B 2 20 ? 22.940  13.444  -2.551  1.00 3.08  ? 20 DA  F N6     1  
ATOM 1418  N N1     . DA  B 2 20 ? 22.945  13.539  -0.247  1.00 3.03  ? 20 DA  F N1     1  
ATOM 1419  C C2     . DA  B 2 20 ? 22.925  14.274  0.873   1.00 3.04  ? 20 DA  F C2     1  
ATOM 1420  N N3     . DA  B 2 20 ? 22.879  15.599  1.011   1.00 3.04  ? 20 DA  F N3     1  
ATOM 1421  C C4     . DA  B 2 20 ? 22.848  16.202  -0.190  1.00 3.03  ? 20 DA  F C4     1  
ATOM 1422  H "H5'"  . DA  B 2 20 ? 19.988  20.141  -0.600  1.00 3.15  ? 20 DA  F "H5'"  1  
ATOM 1423  H "H5''" . DA  B 2 20 ? 20.068  21.798  0.028   1.00 3.34  ? 20 DA  F "H5''" 1  
ATOM 1424  H "H4'"  . DA  B 2 20 ? 20.908  20.806  1.853   1.00 3.30  ? 20 DA  F "H4'"  1  
ATOM 1425  H "H3'"  . DA  B 2 20 ? 22.984  21.915  0.635   1.00 3.41  ? 20 DA  F "H3'"  1  
ATOM 1426  H "H2'"  . DA  B 2 20 ? 23.557  20.081  -0.853  1.00 3.25  ? 20 DA  F "H2'"  1  
ATOM 1427  H "H2''" . DA  B 2 20 ? 24.659  19.829  0.485   1.00 3.28  ? 20 DA  F "H2''" 1  
ATOM 1428  H "H1'"  . DA  B 2 20 ? 23.265  18.162  1.484   1.00 3.16  ? 20 DA  F "H1'"  1  
ATOM 1429  H H8     . DA  B 2 20 ? 22.743  18.630  -2.312  1.00 3.16  ? 20 DA  F H8     1  
ATOM 1430  H H61    . DA  B 2 20 ? 22.919  13.905  -3.450  1.00 3.11  ? 20 DA  F H61    1  
ATOM 1431  H H62    . DA  B 2 20 ? 22.989  12.437  -2.497  1.00 3.11  ? 20 DA  F H62    1  
ATOM 1432  H H2     . DA  B 2 20 ? 22.945  13.708  1.804   1.00 3.08  ? 20 DA  F H2     1  
ATOM 1433  P P      . DA  B 2 21 ? 24.531  21.734  2.876   1.00 3.56  ? 21 DA  F P      1  
ATOM 1434  O OP1    . DA  B 2 21 ? 24.025  23.022  3.412   1.00 3.72  ? 21 DA  F OP1    1  
ATOM 1435  O OP2    . DA  B 2 21 ? 25.571  21.739  1.815   1.00 3.55  ? 21 DA  F OP2    1  
ATOM 1436  O "O5'"  . DA  B 2 21 ? 25.069  20.856  4.091   1.00 3.59  ? 21 DA  F "O5'"  1  
ATOM 1437  C "C5'"  . DA  B 2 21 ? 24.152  20.039  4.817   1.00 3.62  ? 21 DA  F "C5'"  1  
ATOM 1438  C "C4'"  . DA  B 2 21 ? 24.855  18.900  5.520   1.00 3.63  ? 21 DA  F "C4'"  1  
ATOM 1439  O "O4'"  . DA  B 2 21 ? 24.812  17.721  4.672   1.00 3.47  ? 21 DA  F "O4'"  1  
ATOM 1440  C "C3'"  . DA  B 2 21 ? 26.342  19.114  5.785   1.00 3.74  ? 21 DA  F "C3'"  1  
ATOM 1441  O "O3'"  . DA  B 2 21 ? 26.730  18.276  6.870   1.00 3.83  ? 21 DA  F "O3'"  1  
ATOM 1442  C "C2'"  . DA  B 2 21 ? 27.000  18.634  4.508   1.00 3.62  ? 21 DA  F "C2'"  1  
ATOM 1443  C "C1'"  . DA  B 2 21 ? 26.102  17.471  4.115   1.00 3.48  ? 21 DA  F "C1'"  1  
ATOM 1444  N N9     . DA  B 2 21 ? 25.975  17.248  2.674   1.00 3.36  ? 21 DA  F N9     1  
ATOM 1445  C C8     . DA  B 2 21 ? 25.761  18.166  1.682   1.00 3.34  ? 21 DA  F C8     1  
ATOM 1446  N N7     . DA  B 2 21 ? 25.737  17.647  0.476   1.00 3.27  ? 21 DA  F N7     1  
ATOM 1447  C C5     . DA  B 2 21 ? 25.943  16.292  0.692   1.00 3.24  ? 21 DA  F C5     1  
ATOM 1448  C C6     . DA  B 2 21 ? 26.031  15.191  -0.184  1.00 3.22  ? 21 DA  F C6     1  
ATOM 1449  N N6     . DA  B 2 21 ? 25.924  15.286  -1.513  1.00 3.22  ? 21 DA  F N6     1  
ATOM 1450  N N1     . DA  B 2 21 ? 26.237  13.971  0.359   1.00 3.25  ? 21 DA  F N1     1  
ATOM 1451  C C2     . DA  B 2 21 ? 26.354  13.874  1.689   1.00 3.30  ? 21 DA  F C2     1  
ATOM 1452  N N3     . DA  B 2 21 ? 26.296  14.831  2.613   1.00 3.33  ? 21 DA  F N3     1  
ATOM 1453  C C4     . DA  B 2 21 ? 26.084  16.031  2.042   1.00 3.30  ? 21 DA  F C4     1  
ATOM 1454  H "H5'"  . DA  B 2 21 ? 23.411  19.627  4.130   1.00 3.57  ? 21 DA  F "H5'"  1  
ATOM 1455  H "H5''" . DA  B 2 21 ? 23.640  20.647  5.561   1.00 3.73  ? 21 DA  F "H5''" 1  
ATOM 1456  H "H4'"  . DA  B 2 21 ? 24.373  18.753  6.487   1.00 3.70  ? 21 DA  F "H4'"  1  
ATOM 1457  H "H3'"  . DA  B 2 21 ? 26.572  20.153  6.016   1.00 3.85  ? 21 DA  F "H3'"  1  
ATOM 1458  H "H2'"  . DA  B 2 21 ? 27.017  19.417  3.750   1.00 3.61  ? 21 DA  F "H2'"  1  
ATOM 1459  H "H2''" . DA  B 2 21 ? 28.028  18.325  4.685   1.00 3.67  ? 21 DA  F "H2''" 1  
ATOM 1460  H "H1'"  . DA  B 2 21 ? 26.472  16.546  4.564   1.00 3.51  ? 21 DA  F "H1'"  1  
ATOM 1461  H H8     . DA  B 2 21 ? 25.632  19.219  1.875   1.00 3.40  ? 21 DA  F H8     1  
ATOM 1462  H H61    . DA  B 2 21 ? 25.774  16.194  -1.934  1.00 3.23  ? 21 DA  F H61    1  
ATOM 1463  H H62    . DA  B 2 21 ? 25.996  14.466  -2.099  1.00 3.24  ? 21 DA  F H62    1  
ATOM 1464  H H2     . DA  B 2 21 ? 26.520  12.866  2.072   1.00 3.35  ? 21 DA  F H2     1  
ATOM 1465  P P      . DT  B 2 22 ? 28.079  18.565  7.680   1.00 4.02  ? 22 DT  F P      1  
ATOM 1466  O OP1    . DT  B 2 22 ? 27.754  18.983  9.065   1.00 4.22  ? 22 DT  F OP1    1  
ATOM 1467  O OP2    . DT  B 2 22 ? 28.971  19.407  6.845   1.00 4.00  ? 22 DT  F OP2    1  
ATOM 1468  O "O5'"  . DT  B 2 22 ? 28.692  17.096  7.732   1.00 4.01  ? 22 DT  F "O5'"  1  
ATOM 1469  C "C5'"  . DT  B 2 22 ? 27.843  15.987  7.423   1.00 3.92  ? 22 DT  F "C5'"  1  
ATOM 1470  C "C4'"  . DT  B 2 22 ? 28.634  14.711  7.263   1.00 3.94  ? 22 DT  F "C4'"  1  
ATOM 1471  O "O4'"  . DT  B 2 22 ? 28.673  14.352  5.861   1.00 3.78  ? 22 DT  F "O4'"  1  
ATOM 1472  C "C3'"  . DT  B 2 22 ? 30.100  14.805  7.674   1.00 4.06  ? 22 DT  F "C3'"  1  
ATOM 1473  O "O3'"  . DT  B 2 22 ? 30.548  13.488  7.978   1.00 4.14  ? 22 DT  F "O3'"  1  
ATOM 1474  C "C2'"  . DT  B 2 22 ? 30.779  15.304  6.413   1.00 3.94  ? 22 DT  F "C2'"  1  
ATOM 1475  C "C1'"  . DT  B 2 22 ? 29.970  14.599  5.330   1.00 3.79  ? 22 DT  F "C1'"  1  
ATOM 1476  N N1     . DT  B 2 22 ? 29.834  15.307  4.038   1.00 3.66  ? 22 DT  F N1     1  
ATOM 1477  C C2     . DT  B 2 22 ? 29.821  14.519  2.906   1.00 3.58  ? 22 DT  F C2     1  
ATOM 1478  O O2     . DT  B 2 22 ? 29.875  13.301  2.944   1.00 3.62  ? 22 DT  F O2     1  
ATOM 1479  N N3     . DT  B 2 22 ? 29.745  15.208  1.727   1.00 3.50  ? 22 DT  F N3     1  
ATOM 1480  C C4     . DT  B 2 22 ? 29.673  16.571  1.562   1.00 3.49  ? 22 DT  F C4     1  
ATOM 1481  O O4     . DT  B 2 22 ? 29.648  17.048  0.427   1.00 3.45  ? 22 DT  F O4     1  
ATOM 1482  C C5     . DT  B 2 22 ? 29.669  17.342  2.789   1.00 3.57  ? 22 DT  F C5     1  
ATOM 1483  C C7     . DT  B 2 22 ? 29.608  18.834  2.698   1.00 3.61  ? 22 DT  F C7     1  
ATOM 1484  C C6     . DT  B 2 22 ? 29.745  16.682  3.957   1.00 3.65  ? 22 DT  F C6     1  
ATOM 1485  H "H5'"  . DT  B 2 22 ? 27.308  16.190  6.495   1.00 3.79  ? 22 DT  F "H5'"  1  
ATOM 1486  H "H5''" . DT  B 2 22 ? 27.117  15.854  8.225   1.00 3.99  ? 22 DT  F "H5''" 1  
ATOM 1487  H "H4'"  . DT  B 2 22 ? 28.173  13.948  7.892   1.00 4.01  ? 22 DT  F "H4'"  1  
ATOM 1488  H "H3'"  . DT  B 2 22 ? 30.249  15.459  8.530   1.00 4.17  ? 22 DT  F "H3'"  1  
ATOM 1489  H "H2'"  . DT  B 2 22 ? 30.716  16.389  6.336   1.00 3.92  ? 22 DT  F "H2'"  1  
ATOM 1490  H "H2''" . DT  B 2 22 ? 31.834  15.038  6.402   1.00 3.99  ? 22 DT  F "H2''" 1  
ATOM 1491  H "H1'"  . DT  B 2 22 ? 30.413  13.621  5.121   1.00 3.82  ? 22 DT  F "H1'"  1  
ATOM 1492  H H3     . DT  B 2 22 ? 29.754  14.658  0.881   1.00 3.47  ? 22 DT  F H3     1  
ATOM 1493  H H71    . DT  B 2 22 ? 28.745  19.127  2.101   1.00 3.93  ? 22 DT  F H71    1  
ATOM 1494  H H72    . DT  B 2 22 ? 29.515  19.258  3.699   1.00 3.63  ? 22 DT  F H72    1  
ATOM 1495  H H73    . DT  B 2 22 ? 30.518  19.207  2.230   1.00 3.75  ? 22 DT  F H73    1  
ATOM 1496  H H6     . DT  B 2 22 ? 29.736  17.258  4.881   1.00 3.75  ? 22 DT  F H6     1  
ATOM 1497  P P      . DC  B 2 23 ? 31.816  13.254  8.928   1.00 4.31  ? 23 DC  F P      1  
ATOM 1498  O OP1    . DC  B 2 23 ? 31.370  12.980  10.316  1.00 4.46  ? 23 DC  F OP1    1  
ATOM 1499  O OP2    . DC  B 2 23 ? 32.808  14.327  8.671   1.00 4.34  ? 23 DC  F OP2    1  
ATOM 1500  O "O5'"  . DC  B 2 23 ? 32.380  11.893  8.327   1.00 4.26  ? 23 DC  F "O5'"  1  
ATOM 1501  C "C5'"  . DC  B 2 23 ? 31.516  11.075  7.535   1.00 4.12  ? 23 DC  F "C5'"  1  
ATOM 1502  C "C4'"  . DC  B 2 23 ? 32.302  10.153  6.634   1.00 4.10  ? 23 DC  F "C4'"  1  
ATOM 1503  O "O4'"  . DC  B 2 23 ? 32.361  10.733  5.308   1.00 3.93  ? 23 DC  F "O4'"  1  
ATOM 1504  C "C3'"  . DC  B 2 23 ? 33.759  9.962   7.039   1.00 4.26  ? 23 DC  F "C3'"  1  
ATOM 1505  O "O3'"  . DC  B 2 23 ? 34.201  8.719   6.499   1.00 4.32  ? 23 DC  F "O3'"  1  
ATOM 1506  C "C2'"  . DC  B 2 23 ? 34.456  11.125  6.355   1.00 4.15  ? 23 DC  F "C2'"  1  
ATOM 1507  C "C1'"  . DC  B 2 23 ? 33.667  11.238  5.051   1.00 3.96  ? 23 DC  F "C1'"  1  
ATOM 1508  N N1     . DC  B 2 23 ? 33.541  12.586  4.460   1.00 3.84  ? 23 DC  F N1     1  
ATOM 1509  C C2     . DC  B 2 23 ? 33.455  12.693  3.063   1.00 3.70  ? 23 DC  F C2     1  
ATOM 1510  O O2     . DC  B 2 23 ? 33.468  11.658  2.378   1.00 3.69  ? 23 DC  F O2     1  
ATOM 1511  N N3     . DC  B 2 23 ? 33.362  13.916  2.494   1.00 3.63  ? 23 DC  F N3     1  
ATOM 1512  C C4     . DC  B 2 23 ? 33.356  15.009  3.260   1.00 3.69  ? 23 DC  F C4     1  
ATOM 1513  N N4     . DC  B 2 23 ? 33.271  16.196  2.649   1.00 3.66  ? 23 DC  F N4     1  
ATOM 1514  C C5     . DC  B 2 23 ? 33.436  14.933  4.683   1.00 3.84  ? 23 DC  F C5     1  
ATOM 1515  C C6     . DC  B 2 23 ? 33.521  13.711  5.237   1.00 3.91  ? 23 DC  F C6     1  
ATOM 1516  H "H5'"  . DC  B 2 23 ? 30.877  11.709  6.921   1.00 3.94  ? 23 DC  F "H5'"  1  
ATOM 1517  H "H5''" . DC  B 2 23 ? 30.888  10.472  8.192   1.00 4.22  ? 23 DC  F "H5''" 1  
ATOM 1518  H "H4'"  . DC  B 2 23 ? 31.828  9.170   6.659   1.00 4.15  ? 23 DC  F "H4'"  1  
ATOM 1519  H "H3'"  . DC  B 2 23 ? 33.888  9.966   8.121   1.00 4.40  ? 23 DC  F "H3'"  1  
ATOM 1520  H "H2'"  . DC  B 2 23 ? 34.393  12.030  6.956   1.00 4.18  ? 23 DC  F "H2'"  1  
ATOM 1521  H "H2''" . DC  B 2 23 ? 35.512  10.915  6.201   1.00 4.22  ? 23 DC  F "H2''" 1  
ATOM 1522  H "H1'"  . DC  B 2 23 ? 34.113  10.588  4.296   1.00 3.96  ? 23 DC  F "H1'"  1  
ATOM 1523  H H41    . DC  B 2 23 ? 33.265  17.043  3.200   1.00 3.74  ? 23 DC  F H41    1  
ATOM 1524  H H42    . DC  B 2 23 ? 33.225  16.253  1.643   1.00 3.58  ? 23 DC  F H42    1  
ATOM 1525  H H5     . DC  B 2 23 ? 33.432  15.834  5.298   1.00 3.92  ? 23 DC  F H5     1  
ATOM 1526  H H6     . DC  B 2 23 ? 33.570  13.620  6.321   1.00 4.04  ? 23 DC  F H6     1  
ATOM 1527  P P      . DA  B 2 24 ? 35.354  7.876   7.226   1.00 4.55  ? 24 DA  F P      1  
ATOM 1528  O OP1    . DA  B 2 24 ? 34.755  7.057   8.310   1.00 4.76  ? 24 DA  F OP1    1  
ATOM 1529  O OP2    . DA  B 2 24 ? 36.488  8.782   7.534   1.00 4.56  ? 24 DA  F OP2    1  
ATOM 1530  O "O5'"  . DA  B 2 24 ? 35.803  6.890   6.059   1.00 4.54  ? 24 DA  F "O5'"  1  
ATOM 1531  C "C5'"  . DA  B 2 24 ? 34.917  6.631   4.966   1.00 4.44  ? 24 DA  F "C5'"  1  
ATOM 1532  C "C4'"  . DA  B 2 24 ? 35.690  6.387   3.690   1.00 4.40  ? 24 DA  F "C4'"  1  
ATOM 1533  O "O4'"  . DA  B 2 24 ? 35.733  7.618   2.928   1.00 4.22  ? 24 DA  F "O4'"  1  
ATOM 1534  C "C3'"  . DA  B 2 24 ? 37.151  6.004   3.883   1.00 4.55  ? 24 DA  F "C3'"  1  
ATOM 1535  O "O3'"  . DA  B 2 24 ? 37.609  5.274   2.744   1.00 4.59  ? 24 DA  F "O3'"  1  
ATOM 1536  C "C2'"  . DA  B 2 24 ? 37.847  7.349   3.968   1.00 4.45  ? 24 DA  F "C2'"  1  
ATOM 1537  C "C1'"  . DA  B 2 24 ? 37.038  8.192   2.991   1.00 4.24  ? 24 DA  F "C1'"  1  
ATOM 1538  N N9     . DA  B 2 24 ? 36.905  9.602   3.357   1.00 4.13  ? 24 DA  F N9     1  
ATOM 1539  C C8     . DA  B 2 24 ? 36.874  10.150  4.613   1.00 4.18  ? 24 DA  F C8     1  
ATOM 1540  N N7     . DA  B 2 24 ? 36.751  11.455  4.621   1.00 4.09  ? 24 DA  F N7     1  
ATOM 1541  C C5     . DA  B 2 24 ? 36.695  11.792  3.276   1.00 3.96  ? 24 DA  F C5     1  
ATOM 1542  C C6     . DA  B 2 24 ? 36.564  13.026  2.613   1.00 3.85  ? 24 DA  F C6     1  
ATOM 1543  N N6     . DA  B 2 24 ? 36.455  14.199  3.245   1.00 3.85  ? 24 DA  F N6     1  
ATOM 1544  N N1     . DA  B 2 24 ? 36.546  13.015  1.262   1.00 3.78  ? 24 DA  F N1     1  
ATOM 1545  C C2     . DA  B 2 24 ? 36.653  11.839  0.629   1.00 3.82  ? 24 DA  F C2     1  
ATOM 1546  N N3     . DA  B 2 24 ? 36.778  10.615  1.142   1.00 3.93  ? 24 DA  F N3     1  
ATOM 1547  C C4     . DA  B 2 24 ? 36.792  10.661  2.485   1.00 3.99  ? 24 DA  F C4     1  
ATOM 1548  H "H5'"  . DA  B 2 24 ? 34.255  7.487   4.822   1.00 4.31  ? 24 DA  F "H5'"  1  
ATOM 1549  H "H5''" . DA  B 2 24 ? 34.314  5.752   5.188   1.00 4.53  ? 24 DA  F "H5''" 1  
ATOM 1550  H "H4'"  . DA  B 2 24 ? 35.209  5.564   3.157   1.00 4.44  ? 24 DA  F "H4'"  1  
ATOM 1551  H "H3'"  . DA  B 2 24 ? 37.293  5.406   4.783   1.00 4.69  ? 24 DA  F "H3'"  1  
ATOM 1552  H "H2'"  . DA  B 2 24 ? 37.821  7.749   4.981   1.00 4.49  ? 24 DA  F "H2'"  1  
ATOM 1553  H "H2''" . DA  B 2 24 ? 38.892  7.272   3.671   1.00 4.50  ? 24 DA  F "H2''" 1  
ATOM 1554  H "H1'"  . DA  B 2 24 ? 37.470  8.137   1.991   1.00 4.22  ? 24 DA  F "H1'"  1  
ATOM 1555  H H8     . DA  B 2 24 ? 36.946  9.560   5.513   1.00 4.31  ? 24 DA  F H8     1  
ATOM 1556  H H61    . DA  B 2 24 ? 36.465  14.225  4.255   1.00 3.92  ? 24 DA  F H61    1  
ATOM 1557  H H62    . DA  B 2 24 ? 36.368  15.061  2.724   1.00 3.79  ? 24 DA  F H62    1  
ATOM 1558  H H2     . DA  B 2 24 ? 36.640  11.892  -0.458  1.00 3.80  ? 24 DA  F H2     1  
ATOM 1559  P P      . DT  B 2 25 ? 38.815  4.228   2.896   1.00 4.80  ? 25 DT  F P      1  
ATOM 1560  O OP1    . DT  B 2 25 ? 38.288  2.849   2.723   1.00 4.96  ? 25 DT  F OP1    1  
ATOM 1561  O OP2    . DT  B 2 25 ? 39.575  4.573   4.125   1.00 4.88  ? 25 DT  F OP2    1  
ATOM 1562  O "O5'"  . DT  B 2 25 ? 39.730  4.571   1.638   1.00 4.77  ? 25 DT  F "O5'"  1  
ATOM 1563  C "C5'"  . DT  B 2 25 ? 39.179  5.247   0.505   1.00 4.60  ? 25 DT  F "C5'"  1  
ATOM 1564  C "C4'"  . DT  B 2 25 ? 40.277  5.715   -0.421  1.00 4.61  ? 25 DT  F "C4'"  1  
ATOM 1565  O "O4'"  . DT  B 2 25 ? 40.394  7.153   -0.306  1.00 4.44  ? 25 DT  F "O4'"  1  
ATOM 1566  C "C3'"  . DT  B 2 25 ? 41.669  5.179   -0.105  1.00 4.79  ? 25 DT  F "C3'"  1  
ATOM 1567  O "O3'"  . DT  B 2 25 ? 42.475  5.165   -1.284  1.00 4.86  ? 25 DT  F "O3'"  1  
ATOM 1568  C "C2'"  . DT  B 2 25 ? 42.184  6.180   0.912   1.00 4.72  ? 25 DT  F "C2'"  1  
ATOM 1569  C "C1'"  . DT  B 2 25 ? 41.571  7.493   0.420   1.00 4.50  ? 25 DT  F "C1'"  1  
ATOM 1570  N N1     . DT  B 2 25 ? 41.193  8.474   1.469   1.00 4.39  ? 25 DT  F N1     1  
ATOM 1571  C C2     . DT  B 2 25 ? 40.999  9.781   1.071   1.00 4.24  ? 25 DT  F C2     1  
ATOM 1572  O O2     . DT  B 2 25 ? 41.117  10.152  -0.088  1.00 4.18  ? 25 DT  F O2     1  
ATOM 1573  N N3     . DT  B 2 25 ? 40.661  10.645  2.079   1.00 4.19  ? 25 DT  F N3     1  
ATOM 1574  C C4     . DT  B 2 25 ? 40.498  10.344  3.415   1.00 4.28  ? 25 DT  F C4     1  
ATOM 1575  O O4     . DT  B 2 25 ? 40.178  11.229  4.207   1.00 4.26  ? 25 DT  F O4     1  
ATOM 1576  C C5     . DT  B 2 25 ? 40.713  8.960   3.767   1.00 4.44  ? 25 DT  F C5     1  
ATOM 1577  C C7     . DT  B 2 25 ? 40.579  8.550   5.201   1.00 4.59  ? 25 DT  F C7     1  
ATOM 1578  C C6     . DT  B 2 25 ? 41.044  8.099   2.793   1.00 4.49  ? 25 DT  F C6     1  
ATOM 1579  H "H5'"  . DT  B 2 25 ? 38.601  6.110   0.839   1.00 4.45  ? 25 DT  F "H5'"  1  
ATOM 1580  H "H5''" . DT  B 2 25 ? 38.521  4.569   -0.039  1.00 4.64  ? 25 DT  F "H5''" 1  
ATOM 1581  H "H4'"  . DT  B 2 25 ? 40.030  5.382   -1.431  1.00 4.64  ? 25 DT  F "H4'"  1  
ATOM 1582  H "H3'"  . DT  B 2 25 ? 41.616  4.171   0.308   1.00 4.93  ? 25 DT  F "H3'"  1  
ATOM 1583  H "HO3'" . DT  B 2 25 ? 42.206  4.393   -1.794  1.00 4.98  ? 25 DT  F "HO3'" 1  
ATOM 1584  H "H2'"  . DT  B 2 25 ? 41.857  5.921   1.917   1.00 4.76  ? 25 DT  F "H2'"  1  
ATOM 1585  H "H2''" . DT  B 2 25 ? 43.273  6.211   0.921   1.00 4.80  ? 25 DT  F "H2''" 1  
ATOM 1586  H "H1'"  . DT  B 2 25 ? 42.250  7.990   -0.276  1.00 4.49  ? 25 DT  F "H1'"  1  
ATOM 1587  H H3     . DT  B 2 25 ? 40.527  11.610  1.810   1.00 4.09  ? 25 DT  F H3     1  
ATOM 1588  H H71    . DT  B 2 25 ? 39.682  9.003   5.626   1.00 4.79  ? 25 DT  F H71    1  
ATOM 1589  H H72    . DT  B 2 25 ? 41.454  8.884   5.759   1.00 4.67  ? 25 DT  F H72    1  
ATOM 1590  H H73    . DT  B 2 25 ? 40.501  7.464   5.264   1.00 4.73  ? 25 DT  F H73    1  
ATOM 1591  H H6     . DT  B 2 25 ? 41.198  7.055   3.060   1.00 4.63  ? 25 DT  F H6     1  
ATOM 1592  N N      . MET C 3 1  ? 8.413   -22.577 -13.446 1.00 9.42  ? 1  MET A N      1  
ATOM 1593  C CA     . MET C 3 1  ? 8.984   -21.782 -12.339 1.00 8.94  ? 1  MET A CA     1  
ATOM 1594  C C      . MET C 3 1  ? 10.499  -21.747 -12.441 1.00 8.70  ? 1  MET A C      1  
ATOM 1595  O O      . MET C 3 1  ? 11.139  -22.777 -12.628 1.00 9.04  ? 1  MET A O      1  
ATOM 1596  C CB     . MET C 3 1  ? 8.579   -22.368 -10.984 1.00 9.01  ? 1  MET A CB     1  
ATOM 1597  C CG     . MET C 3 1  ? 9.203   -21.646 -9.800  1.00 8.76  ? 1  MET A CG     1  
ATOM 1598  S SD     . MET C 3 1  ? 8.730   -19.906 -9.719  1.00 8.62  ? 1  MET A SD     1  
ATOM 1599  C CE     . MET C 3 1  ? 9.639   -19.377 -8.268  1.00 8.77  ? 1  MET A CE     1  
ATOM 1600  H H1     . MET C 3 1  ? 7.375   -22.568 -13.396 1.00 9.79  ? 1  MET A H1     1  
ATOM 1601  H H2     . MET C 3 1  ? 8.745   -23.560 -13.386 1.00 9.68  ? 1  MET A H2     1  
ATOM 1602  H H3     . MET C 3 1  ? 8.709   -22.179 -14.359 1.00 9.36  ? 1  MET A H3     1  
ATOM 1603  H HA     . MET C 3 1  ? 8.604   -20.773 -12.415 1.00 8.90  ? 1  MET A HA     1  
ATOM 1604  H HB2    . MET C 3 1  ? 7.505   -22.315 -10.886 1.00 9.21  ? 1  MET A HB2    1  
ATOM 1605  H HB3    . MET C 3 1  ? 8.883   -23.403 -10.948 1.00 9.28  ? 1  MET A HB3    1  
ATOM 1606  H HG2    . MET C 3 1  ? 8.884   -22.133 -8.891  1.00 8.87  ? 1  MET A HG2    1  
ATOM 1607  H HG3    . MET C 3 1  ? 10.279  -21.709 -9.882  1.00 8.79  ? 1  MET A HG3    1  
ATOM 1608  H HE1    . MET C 3 1  ? 9.394   -20.020 -7.436  1.00 9.00  ? 1  MET A HE1    1  
ATOM 1609  H HE2    . MET C 3 1  ? 9.371   -18.359 -8.027  1.00 8.51  ? 1  MET A HE2    1  
ATOM 1610  H HE3    . MET C 3 1  ? 10.700  -19.433 -8.467  1.00 9.17  ? 1  MET A HE3    1  
ATOM 1611  N N      . LYS C 3 2  ? 11.062  -20.560 -12.321 1.00 8.23  ? 2  LYS A N      1  
ATOM 1612  C CA     . LYS C 3 2  ? 12.501  -20.382 -12.385 1.00 8.08  ? 2  LYS A CA     1  
ATOM 1613  C C      . LYS C 3 2  ? 12.944  -19.356 -11.353 1.00 7.26  ? 2  LYS A C      1  
ATOM 1614  O O      . LYS C 3 2  ? 12.150  -18.934 -10.510 1.00 6.99  ? 2  LYS A O      1  
ATOM 1615  C CB     . LYS C 3 2  ? 12.932  -19.946 -13.790 1.00 8.57  ? 2  LYS A CB     1  
ATOM 1616  C CG     . LYS C 3 2  ? 13.304  -21.106 -14.704 1.00 9.05  ? 2  LYS A CG     1  
ATOM 1617  C CD     . LYS C 3 2  ? 14.528  -21.849 -14.195 1.00 9.63  ? 2  LYS A CD     1  
ATOM 1618  C CE     . LYS C 3 2  ? 14.840  -23.065 -15.047 1.00 10.41 ? 2  LYS A CE     1  
ATOM 1619  N NZ     . LYS C 3 2  ? 15.914  -23.893 -14.440 1.00 10.67 ? 2  LYS A NZ     1  
ATOM 1620  H H      . LYS C 3 2  ? 10.492  -19.772 -12.173 1.00 8.05  ? 2  LYS A H      1  
ATOM 1621  H HA     . LYS C 3 2  ? 12.959  -21.329 -12.151 1.00 8.37  ? 2  LYS A HA     1  
ATOM 1622  H HB2    . LYS C 3 2  ? 12.121  -19.400 -14.250 1.00 8.84  ? 2  LYS A HB2    1  
ATOM 1623  H HB3    . LYS C 3 2  ? 13.789  -19.293 -13.705 1.00 8.56  ? 2  LYS A HB3    1  
ATOM 1624  H HG2    . LYS C 3 2  ? 12.473  -21.795 -14.752 1.00 9.18  ? 2  LYS A HG2    1  
ATOM 1625  H HG3    . LYS C 3 2  ? 13.513  -20.722 -15.691 1.00 9.11  ? 2  LYS A HG3    1  
ATOM 1626  H HD2    . LYS C 3 2  ? 15.377  -21.183 -14.219 1.00 9.71  ? 2  LYS A HD2    1  
ATOM 1627  H HD3    . LYS C 3 2  ? 14.348  -22.169 -13.181 1.00 9.66  ? 2  LYS A HD3    1  
ATOM 1628  H HE2    . LYS C 3 2  ? 13.946  -23.662 -15.143 1.00 10.56 ? 2  LYS A HE2    1  
ATOM 1629  H HE3    . LYS C 3 2  ? 15.161  -22.737 -16.023 1.00 10.83 ? 2  LYS A HE3    1  
ATOM 1630  H HZ1    . LYS C 3 2  ? 16.769  -23.321 -14.296 1.00 10.77 ? 2  LYS A HZ1    1  
ATOM 1631  H HZ2    . LYS C 3 2  ? 16.148  -24.692 -15.064 1.00 10.89 ? 2  LYS A HZ2    1  
ATOM 1632  H HZ3    . LYS C 3 2  ? 15.602  -24.268 -13.520 1.00 10.71 ? 2  LYS A HZ3    1  
ATOM 1633  N N      . SER C 3 3  ? 14.204  -18.965 -11.414 1.00 7.07  ? 3  SER A N      1  
ATOM 1634  C CA     . SER C 3 3  ? 14.742  -17.986 -10.488 1.00 6.44  ? 3  SER A CA     1  
ATOM 1635  C C      . SER C 3 3  ? 14.216  -16.594 -10.816 1.00 5.75  ? 3  SER A C      1  
ATOM 1636  O O      . SER C 3 3  ? 14.823  -15.853 -11.591 1.00 5.87  ? 3  SER A O      1  
ATOM 1637  C CB     . SER C 3 3  ? 16.265  -18.009 -10.551 1.00 6.82  ? 3  SER A CB     1  
ATOM 1638  O OG     . SER C 3 3  ? 16.746  -19.345 -10.623 1.00 7.75  ? 3  SER A OG     1  
ATOM 1639  H H      . SER C 3 3  ? 14.794  -19.348 -12.096 1.00 7.50  ? 3  SER A H      1  
ATOM 1640  H HA     . SER C 3 3  ? 14.425  -18.257 -9.493  1.00 6.49  ? 3  SER A HA     1  
ATOM 1641  H HB2    . SER C 3 3  ? 16.592  -17.475 -11.429 1.00 6.85  ? 3  SER A HB2    1  
ATOM 1642  H HB3    . SER C 3 3  ? 16.671  -17.538 -9.668  1.00 6.58  ? 3  SER A HB3    1  
ATOM 1643  H HG     . SER C 3 3  ? 17.341  -19.507 -9.881  1.00 7.99  ? 3  SER A HG     1  
ATOM 1644  N N      . THR C 3 4  ? 13.071  -16.255 -10.244 1.00 5.27  ? 4  THR A N      1  
ATOM 1645  C CA     . THR C 3 4  ? 12.460  -14.960 -10.469 1.00 4.91  ? 4  THR A CA     1  
ATOM 1646  C C      . THR C 3 4  ? 11.468  -14.637 -9.350  1.00 4.22  ? 4  THR A C      1  
ATOM 1647  O O      . THR C 3 4  ? 10.928  -15.541 -8.700  1.00 4.57  ? 4  THR A O      1  
ATOM 1648  C CB     . THR C 3 4  ? 11.753  -14.914 -11.844 1.00 5.28  ? 4  THR A CB     1  
ATOM 1649  O OG1    . THR C 3 4  ? 11.386  -13.565 -12.179 1.00 5.60  ? 4  THR A OG1    1  
ATOM 1650  C CG2    . THR C 3 4  ? 10.516  -15.802 -11.857 1.00 5.66  ? 4  THR A CG2    1  
ATOM 1651  H H      . THR C 3 4  ? 12.617  -16.898 -9.661  1.00 5.36  ? 4  THR A H      1  
ATOM 1652  H HA     . THR C 3 4  ? 13.245  -14.216 -10.464 1.00 5.19  ? 4  THR A HA     1  
ATOM 1653  H HB     . THR C 3 4  ? 12.444  -15.281 -12.589 1.00 5.29  ? 4  THR A HB     1  
ATOM 1654  H HG1    . THR C 3 4  ? 11.960  -12.944 -11.690 1.00 5.83  ? 4  THR A HG1    1  
ATOM 1655  H HG21   . THR C 3 4  ? 10.049  -15.756 -12.828 1.00 5.87  ? 4  THR A HG21   1  
ATOM 1656  H HG22   . THR C 3 4  ? 9.821   -15.460 -11.105 1.00 5.84  ? 4  THR A HG22   1  
ATOM 1657  H HG23   . THR C 3 4  ? 10.803  -16.822 -11.644 1.00 5.88  ? 4  THR A HG23   1  
ATOM 1658  N N      . GLY C 3 5  ? 11.252  -13.352 -9.114  1.00 3.57  ? 5  GLY A N      1  
ATOM 1659  C CA     . GLY C 3 5  ? 10.336  -12.930 -8.079  1.00 3.11  ? 5  GLY A CA     1  
ATOM 1660  C C      . GLY C 3 5  ? 9.589   -11.672 -8.465  1.00 3.03  ? 5  GLY A C      1  
ATOM 1661  O O      . GLY C 3 5  ? 9.367   -11.411 -9.648  1.00 3.23  ? 5  GLY A O      1  
ATOM 1662  H H      . GLY C 3 5  ? 11.721  -12.675 -9.659  1.00 3.69  ? 5  GLY A H      1  
ATOM 1663  H HA2    . GLY C 3 5  ? 9.624   -13.722 -7.897  1.00 3.03  ? 5  GLY A HA2    1  
ATOM 1664  H HA3    . GLY C 3 5  ? 10.893  -12.742 -7.173  1.00 3.29  ? 5  GLY A HA3    1  
ATOM 1665  N N      . ILE C 3 6  ? 9.208   -10.889 -7.469  1.00 2.92  ? 6  ILE A N      1  
ATOM 1666  C CA     . ILE C 3 6  ? 8.479   -9.652  -7.705  1.00 3.06  ? 6  ILE A CA     1  
ATOM 1667  C C      . ILE C 3 6  ? 9.445   -8.530  -8.063  1.00 2.71  ? 6  ILE A C      1  
ATOM 1668  O O      . ILE C 3 6  ? 10.419  -8.290  -7.348  1.00 2.39  ? 6  ILE A O      1  
ATOM 1669  C CB     . ILE C 3 6  ? 7.654   -9.241  -6.464  1.00 3.43  ? 6  ILE A CB     1  
ATOM 1670  C CG1    . ILE C 3 6  ? 6.746   -10.391 -6.013  1.00 4.06  ? 6  ILE A CG1    1  
ATOM 1671  C CG2    . ILE C 3 6  ? 6.831   -7.992  -6.756  1.00 3.61  ? 6  ILE A CG2    1  
ATOM 1672  C CD1    . ILE C 3 6  ? 6.155   -10.192 -4.634  1.00 4.68  ? 6  ILE A CD1    1  
ATOM 1673  H H      . ILE C 3 6  ? 9.434   -11.144 -6.547  1.00 2.85  ? 6  ILE A H      1  
ATOM 1674  H HA     . ILE C 3 6  ? 7.801   -9.813  -8.531  1.00 3.34  ? 6  ILE A HA     1  
ATOM 1675  H HB     . ILE C 3 6  ? 8.341   -9.008  -5.667  1.00 3.68  ? 6  ILE A HB     1  
ATOM 1676  H HG12   . ILE C 3 6  ? 5.928   -10.490 -6.710  1.00 4.46  ? 6  ILE A HG12   1  
ATOM 1677  H HG13   . ILE C 3 6  ? 7.316   -11.310 -6.000  1.00 4.17  ? 6  ILE A HG13   1  
ATOM 1678  H HG21   . ILE C 3 6  ? 6.241   -7.737  -5.887  1.00 3.63  ? 6  ILE A HG21   1  
ATOM 1679  H HG22   . ILE C 3 6  ? 6.177   -8.177  -7.594  1.00 3.76  ? 6  ILE A HG22   1  
ATOM 1680  H HG23   . ILE C 3 6  ? 7.495   -7.172  -6.992  1.00 4.17  ? 6  ILE A HG23   1  
ATOM 1681  H HD11   . ILE C 3 6  ? 5.535   -11.040 -4.380  1.00 4.86  ? 6  ILE A HD11   1  
ATOM 1682  H HD12   . ILE C 3 6  ? 5.557   -9.293  -4.627  1.00 4.83  ? 6  ILE A HD12   1  
ATOM 1683  H HD13   . ILE C 3 6  ? 6.951   -10.099 -3.910  1.00 5.18  ? 6  ILE A HD13   1  
ATOM 1684  N N      . VAL C 3 7  ? 9.191   -7.855  -9.172  1.00 2.84  ? 7  VAL A N      1  
ATOM 1685  C CA     . VAL C 3 7  ? 10.048  -6.760  -9.597  1.00 2.57  ? 7  VAL A CA     1  
ATOM 1686  C C      . VAL C 3 7  ? 9.733   -5.496  -8.800  1.00 2.52  ? 7  VAL A C      1  
ATOM 1687  O O      . VAL C 3 7  ? 8.643   -4.930  -8.903  1.00 2.85  ? 7  VAL A O      1  
ATOM 1688  C CB     . VAL C 3 7  ? 9.917   -6.482  -11.111 1.00 2.76  ? 7  VAL A CB     1  
ATOM 1689  C CG1    . VAL C 3 7  ? 10.684  -7.529  -11.903 1.00 2.58  ? 7  VAL A CG1    1  
ATOM 1690  C CG2    . VAL C 3 7  ? 8.456   -6.463  -11.538 1.00 3.27  ? 7  VAL A CG2    1  
ATOM 1691  H H      . VAL C 3 7  ? 8.405   -8.091  -9.711  1.00 3.14  ? 7  VAL A H      1  
ATOM 1692  H HA     . VAL C 3 7  ? 11.070  -7.051  -9.396  1.00 2.34  ? 7  VAL A HA     1  
ATOM 1693  H HB     . VAL C 3 7  ? 10.347  -5.513  -11.321 1.00 3.10  ? 7  VAL A HB     1  
ATOM 1694  H HG11   . VAL C 3 7  ? 10.214  -8.494  -11.771 1.00 2.66  ? 7  VAL A HG11   1  
ATOM 1695  H HG12   . VAL C 3 7  ? 11.704  -7.574  -11.548 1.00 2.92  ? 7  VAL A HG12   1  
ATOM 1696  H HG13   . VAL C 3 7  ? 10.677  -7.264  -12.949 1.00 2.77  ? 7  VAL A HG13   1  
ATOM 1697  H HG21   . VAL C 3 7  ? 7.903   -5.793  -10.895 1.00 3.64  ? 7  VAL A HG21   1  
ATOM 1698  H HG22   . VAL C 3 7  ? 8.047   -7.458  -11.460 1.00 3.56  ? 7  VAL A HG22   1  
ATOM 1699  H HG23   . VAL C 3 7  ? 8.384   -6.123  -12.559 1.00 3.52  ? 7  VAL A HG23   1  
ATOM 1700  N N      . ARG C 3 8  ? 10.684  -5.068  -7.989  1.00 2.19  ? 8  ARG A N      1  
ATOM 1701  C CA     . ARG C 3 8  ? 10.506  -3.885  -7.163  1.00 2.20  ? 8  ARG A CA     1  
ATOM 1702  C C      . ARG C 3 8  ? 11.388  -2.742  -7.639  1.00 1.94  ? 8  ARG A C      1  
ATOM 1703  O O      . ARG C 3 8  ? 12.570  -2.931  -7.929  1.00 1.81  ? 8  ARG A O      1  
ATOM 1704  C CB     . ARG C 3 8  ? 10.828  -4.221  -5.709  1.00 2.23  ? 8  ARG A CB     1  
ATOM 1705  C CG     . ARG C 3 8  ? 11.023  -3.006  -4.812  1.00 2.58  ? 8  ARG A CG     1  
ATOM 1706  C CD     . ARG C 3 8  ? 9.937   -2.910  -3.752  1.00 3.00  ? 8  ARG A CD     1  
ATOM 1707  N NE     . ARG C 3 8  ? 8.706   -2.308  -4.265  1.00 3.39  ? 8  ARG A NE     1  
ATOM 1708  C CZ     . ARG C 3 8  ? 8.241   -1.118  -3.880  1.00 3.81  ? 8  ARG A CZ     1  
ATOM 1709  N NH1    . ARG C 3 8  ? 8.887   -0.416  -2.957  1.00 3.99  ? 8  ARG A NH1    1  
ATOM 1710  N NH2    . ARG C 3 8  ? 7.121   -0.638  -4.410  1.00 4.45  ? 8  ARG A NH2    1  
ATOM 1711  H H      . ARG C 3 8  ? 11.535  -5.561  -7.942  1.00 1.98  ? 8  ARG A H      1  
ATOM 1712  H HA     . ARG C 3 8  ? 9.473   -3.582  -7.232  1.00 2.48  ? 8  ARG A HA     1  
ATOM 1713  H HB2    . ARG C 3 8  ? 10.022  -4.813  -5.305  1.00 2.27  ? 8  ARG A HB2    1  
ATOM 1714  H HB3    . ARG C 3 8  ? 11.735  -4.805  -5.685  1.00 2.32  ? 8  ARG A HB3    1  
ATOM 1715  H HG2    . ARG C 3 8  ? 11.984  -3.083  -4.324  1.00 2.91  ? 8  ARG A HG2    1  
ATOM 1716  H HG3    . ARG C 3 8  ? 10.998  -2.115  -5.422  1.00 2.88  ? 8  ARG A HG3    1  
ATOM 1717  H HD2    . ARG C 3 8  ? 9.714   -3.905  -3.396  1.00 3.47  ? 8  ARG A HD2    1  
ATOM 1718  H HD3    . ARG C 3 8  ? 10.305  -2.311  -2.932  1.00 3.15  ? 8  ARG A HD3    1  
ATOM 1719  H HE     . ARG C 3 8  ? 8.196   -2.824  -4.933  1.00 3.69  ? 8  ARG A HE     1  
ATOM 1720  H HH11   . ARG C 3 8  ? 9.729   -0.776  -2.540  1.00 3.89  ? 8  ARG A HH11   1  
ATOM 1721  H HH12   . ARG C 3 8  ? 8.539   0.483   -2.675  1.00 4.50  ? 8  ARG A HH12   1  
ATOM 1722  H HH21   . ARG C 3 8  ? 6.621   -1.170  -5.102  1.00 4.75  ? 8  ARG A HH21   1  
ATOM 1723  H HH22   . ARG C 3 8  ? 6.771   0.261   -4.129  1.00 4.86  ? 8  ARG A HH22   1  
ATOM 1724  N N      . LYS C 3 9  ? 10.802  -1.559  -7.715  1.00 2.12  ? 9  LYS A N      1  
ATOM 1725  C CA     . LYS C 3 9  ? 11.522  -0.372  -8.137  1.00 2.02  ? 9  LYS A CA     1  
ATOM 1726  C C      . LYS C 3 9  ? 11.804  0.511   -6.926  1.00 2.02  ? 9  LYS A C      1  
ATOM 1727  O O      . LYS C 3 9  ? 10.883  0.967   -6.247  1.00 2.29  ? 9  LYS A O      1  
ATOM 1728  C CB     . LYS C 3 9  ? 10.715  0.403   -9.187  1.00 2.40  ? 9  LYS A CB     1  
ATOM 1729  C CG     . LYS C 3 9  ? 11.507  0.740   -10.446 1.00 2.65  ? 9  LYS A CG     1  
ATOM 1730  C CD     . LYS C 3 9  ? 12.610  1.758   -10.175 1.00 2.53  ? 9  LYS A CD     1  
ATOM 1731  C CE     . LYS C 3 9  ? 12.044  3.153   -9.963  1.00 2.83  ? 9  LYS A CE     1  
ATOM 1732  N NZ     . LYS C 3 9  ? 13.103  4.146   -9.639  1.00 2.89  ? 9  LYS A NZ     1  
ATOM 1733  H H      . LYS C 3 9  ? 9.852   -1.481  -7.473  1.00 2.45  ? 9  LYS A H      1  
ATOM 1734  H HA     . LYS C 3 9  ? 12.460  -0.687  -8.570  1.00 1.88  ? 9  LYS A HA     1  
ATOM 1735  H HB2    . LYS C 3 9  ? 9.861   -0.192  -9.476  1.00 2.89  ? 9  LYS A HB2    1  
ATOM 1736  H HB3    . LYS C 3 9  ? 10.368  1.325   -8.748  1.00 2.65  ? 9  LYS A HB3    1  
ATOM 1737  H HG2    . LYS C 3 9  ? 11.954  -0.165  -10.831 1.00 2.99  ? 9  LYS A HG2    1  
ATOM 1738  H HG3    . LYS C 3 9  ? 10.830  1.147   -11.183 1.00 3.17  ? 9  LYS A HG3    1  
ATOM 1739  H HD2    . LYS C 3 9  ? 13.153  1.462   -9.290  1.00 3.02  ? 9  LYS A HD2    1  
ATOM 1740  H HD3    . LYS C 3 9  ? 13.283  1.778   -11.022 1.00 2.42  ? 9  LYS A HD3    1  
ATOM 1741  H HE2    . LYS C 3 9  ? 11.541  3.461   -10.865 1.00 3.05  ? 9  LYS A HE2    1  
ATOM 1742  H HE3    . LYS C 3 9  ? 11.333  3.119   -9.150  1.00 3.36  ? 9  LYS A HE3    1  
ATOM 1743  H HZ1    . LYS C 3 9  ? 13.767  4.237   -10.434 1.00 2.69  ? 9  LYS A HZ1    1  
ATOM 1744  H HZ2    . LYS C 3 9  ? 13.632  3.845   -8.791  1.00 3.25  ? 9  LYS A HZ2    1  
ATOM 1745  H HZ3    . LYS C 3 9  ? 12.673  5.077   -9.450  1.00 3.36  ? 9  LYS A HZ3    1  
ATOM 1746  N N      . VAL C 3 10 ? 13.078  0.737   -6.659  1.00 1.92  ? 10 VAL A N      1  
ATOM 1747  C CA     . VAL C 3 10 ? 13.494  1.561   -5.534  1.00 2.17  ? 10 VAL A CA     1  
ATOM 1748  C C      . VAL C 3 10 ? 14.130  2.844   -6.055  1.00 2.21  ? 10 VAL A C      1  
ATOM 1749  O O      . VAL C 3 10 ? 13.867  3.246   -7.189  1.00 2.33  ? 10 VAL A O      1  
ATOM 1750  C CB     . VAL C 3 10 ? 14.484  0.809   -4.609  1.00 2.38  ? 10 VAL A CB     1  
ATOM 1751  C CG1    . VAL C 3 10 ? 13.816  -0.418  -4.008  1.00 2.94  ? 10 VAL A CG1    1  
ATOM 1752  C CG2    . VAL C 3 10 ? 15.749  0.410   -5.361  1.00 2.48  ? 10 VAL A CG2    1  
ATOM 1753  H H      . VAL C 3 10 ? 13.766  0.366   -7.258  1.00 1.82  ? 10 VAL A H      1  
ATOM 1754  H HA     . VAL C 3 10 ? 12.612  1.811   -4.961  1.00 2.43  ? 10 VAL A HA     1  
ATOM 1755  H HB     . VAL C 3 10 ? 14.765  1.470   -3.800  1.00 2.79  ? 10 VAL A HB     1  
ATOM 1756  H HG11   . VAL C 3 10 ? 12.938  -0.116  -3.456  1.00 3.49  ? 10 VAL A HG11   1  
ATOM 1757  H HG12   . VAL C 3 10 ? 14.505  -0.916  -3.342  1.00 2.94  ? 10 VAL A HG12   1  
ATOM 1758  H HG13   . VAL C 3 10 ? 13.527  -1.093  -4.799  1.00 3.46  ? 10 VAL A HG13   1  
ATOM 1759  H HG21   . VAL C 3 10 ? 15.477  -0.039  -6.304  1.00 2.72  ? 10 VAL A HG21   1  
ATOM 1760  H HG22   . VAL C 3 10 ? 16.310  -0.301  -4.772  1.00 2.77  ? 10 VAL A HG22   1  
ATOM 1761  H HG23   . VAL C 3 10 ? 16.355  1.287   -5.540  1.00 2.82  ? 10 VAL A HG23   1  
ATOM 1762  N N      . ASP C 3 11 ? 14.952  3.490   -5.244  1.00 2.44  ? 11 ASP A N      1  
ATOM 1763  C CA     . ASP C 3 11 ? 15.616  4.715   -5.668  1.00 2.64  ? 11 ASP A CA     1  
ATOM 1764  C C      . ASP C 3 11 ? 16.823  4.379   -6.540  1.00 2.26  ? 11 ASP A C      1  
ATOM 1765  O O      . ASP C 3 11 ? 17.562  3.439   -6.256  1.00 2.29  ? 11 ASP A O      1  
ATOM 1766  C CB     . ASP C 3 11 ? 16.038  5.544   -4.452  1.00 3.30  ? 11 ASP A CB     1  
ATOM 1767  C CG     . ASP C 3 11 ? 16.904  6.735   -4.807  1.00 3.91  ? 11 ASP A CG     1  
ATOM 1768  O OD1    . ASP C 3 11 ? 16.655  7.370   -5.851  1.00 4.32  ? 11 ASP A OD1    1  
ATOM 1769  O OD2    . ASP C 3 11 ? 17.842  7.036   -4.037  1.00 4.44  ? 11 ASP A OD2    1  
ATOM 1770  H H      . ASP C 3 11 ? 15.128  3.135   -4.347  1.00 2.66  ? 11 ASP A H      1  
ATOM 1771  H HA     . ASP C 3 11 ? 14.912  5.285   -6.256  1.00 2.89  ? 11 ASP A HA     1  
ATOM 1772  H HB2    . ASP C 3 11 ? 15.154  5.909   -3.952  1.00 3.60  ? 11 ASP A HB2    1  
ATOM 1773  H HB3    . ASP C 3 11 ? 16.592  4.911   -3.777  1.00 3.58  ? 11 ASP A HB3    1  
ATOM 1774  N N      . GLU C 3 12 ? 17.024  5.160   -7.591  1.00 2.34  ? 12 GLU A N      1  
ATOM 1775  C CA     . GLU C 3 12 ? 18.128  4.935   -8.518  1.00 2.35  ? 12 GLU A CA     1  
ATOM 1776  C C      . GLU C 3 12 ? 19.470  5.329   -7.904  1.00 2.39  ? 12 GLU A C      1  
ATOM 1777  O O      . GLU C 3 12 ? 20.518  5.189   -8.538  1.00 2.96  ? 12 GLU A O      1  
ATOM 1778  C CB     . GLU C 3 12 ? 17.899  5.707   -9.816  1.00 2.80  ? 12 GLU A CB     1  
ATOM 1779  C CG     . GLU C 3 12 ? 17.421  7.133   -9.605  1.00 3.27  ? 12 GLU A CG     1  
ATOM 1780  C CD     . GLU C 3 12 ? 17.237  7.876   -10.906 1.00 3.38  ? 12 GLU A CD     1  
ATOM 1781  O OE1    . GLU C 3 12 ? 16.174  7.723   -11.543 1.00 3.61  ? 12 GLU A OE1    1  
ATOM 1782  O OE2    . GLU C 3 12 ? 18.160  8.612   -11.310 1.00 3.59  ? 12 GLU A OE2    1  
ATOM 1783  H H      . GLU C 3 12 ? 16.425  5.923   -7.738  1.00 2.67  ? 12 GLU A H      1  
ATOM 1784  H HA     . GLU C 3 12 ? 18.154  3.881   -8.744  1.00 2.40  ? 12 GLU A HA     1  
ATOM 1785  H HB2    . GLU C 3 12 ? 18.827  5.739   -10.367 1.00 3.20  ? 12 GLU A HB2    1  
ATOM 1786  H HB3    . GLU C 3 12 ? 17.159  5.185   -10.405 1.00 3.01  ? 12 GLU A HB3    1  
ATOM 1787  H HG2    . GLU C 3 12 ? 16.474  7.109   -9.090  1.00 3.59  ? 12 GLU A HG2    1  
ATOM 1788  H HG3    . GLU C 3 12 ? 18.144  7.663   -9.001  1.00 3.79  ? 12 GLU A HG3    1  
ATOM 1789  N N      . LEU C 3 13 ? 19.433  5.840   -6.684  1.00 2.11  ? 13 LEU A N      1  
ATOM 1790  C CA     . LEU C 3 13 ? 20.644  6.233   -5.986  1.00 2.49  ? 13 LEU A CA     1  
ATOM 1791  C C      . LEU C 3 13 ? 20.785  5.439   -4.685  1.00 2.18  ? 13 LEU A C      1  
ATOM 1792  O O      . LEU C 3 13 ? 21.717  5.655   -3.907  1.00 2.48  ? 13 LEU A O      1  
ATOM 1793  C CB     . LEU C 3 13 ? 20.623  7.738   -5.697  1.00 2.96  ? 13 LEU A CB     1  
ATOM 1794  C CG     . LEU C 3 13 ? 21.999  8.410   -5.637  1.00 3.69  ? 13 LEU A CG     1  
ATOM 1795  C CD1    . LEU C 3 13 ? 22.680  8.371   -6.998  1.00 4.35  ? 13 LEU A CD1    1  
ATOM 1796  C CD2    . LEU C 3 13 ? 21.868  9.845   -5.151  1.00 3.80  ? 13 LEU A CD2    1  
ATOM 1797  H H      . LEU C 3 13 ? 18.564  5.971   -6.248  1.00 1.89  ? 13 LEU A H      1  
ATOM 1798  H HA     . LEU C 3 13 ? 21.484  6.009   -6.627  1.00 3.08  ? 13 LEU A HA     1  
ATOM 1799  H HB2    . LEU C 3 13 ? 20.040  8.224   -6.467  1.00 3.08  ? 13 LEU A HB2    1  
ATOM 1800  H HB3    . LEU C 3 13 ? 20.133  7.893   -4.748  1.00 3.10  ? 13 LEU A HB3    1  
ATOM 1801  H HG     . LEU C 3 13 ? 22.624  7.874   -4.938  1.00 4.19  ? 13 LEU A HG     1  
ATOM 1802  H HD11   . LEU C 3 13 ? 22.965  7.355   -7.233  1.00 4.63  ? 13 LEU A HD11   1  
ATOM 1803  H HD12   . LEU C 3 13 ? 23.560  8.996   -6.977  1.00 4.45  ? 13 LEU A HD12   1  
ATOM 1804  H HD13   . LEU C 3 13 ? 21.998  8.736   -7.752  1.00 4.91  ? 13 LEU A HD13   1  
ATOM 1805  H HD21   . LEU C 3 13 ? 22.844  10.304  -5.116  1.00 4.15  ? 13 LEU A HD21   1  
ATOM 1806  H HD22   . LEU C 3 13 ? 21.431  9.852   -4.163  1.00 3.57  ? 13 LEU A HD22   1  
ATOM 1807  H HD23   . LEU C 3 13 ? 21.236  10.398  -5.828  1.00 4.26  ? 13 LEU A HD23   1  
ATOM 1808  N N      . GLY C 3 14 ? 19.854  4.515   -4.459  1.00 1.99  ? 14 GLY A N      1  
ATOM 1809  C CA     . GLY C 3 14 ? 19.876  3.700   -3.261  1.00 1.97  ? 14 GLY A CA     1  
ATOM 1810  C C      . GLY C 3 14 ? 18.485  3.483   -2.698  1.00 1.71  ? 14 GLY A C      1  
ATOM 1811  O O      . GLY C 3 14 ? 17.574  3.126   -3.434  1.00 2.09  ? 14 GLY A O      1  
ATOM 1812  H H      . GLY C 3 14 ? 19.138  4.384   -5.119  1.00 2.16  ? 14 GLY A H      1  
ATOM 1813  H HA2    . GLY C 3 14 ? 20.315  2.742   -3.499  1.00 2.02  ? 14 GLY A HA2    1  
ATOM 1814  H HA3    . GLY C 3 14 ? 20.483  4.189   -2.514  1.00 2.40  ? 14 GLY A HA3    1  
ATOM 1815  N N      . ARG C 3 15 ? 18.342  3.695   -1.388  1.00 1.49  ? 15 ARG A N      1  
ATOM 1816  C CA     . ARG C 3 15 ? 17.059  3.550   -0.682  1.00 1.33  ? 15 ARG A CA     1  
ATOM 1817  C C      . ARG C 3 15 ? 16.311  2.282   -1.080  1.00 1.18  ? 15 ARG A C      1  
ATOM 1818  O O      . ARG C 3 15 ? 15.411  2.313   -1.921  1.00 1.44  ? 15 ARG A O      1  
ATOM 1819  C CB     . ARG C 3 15 ? 16.168  4.772   -0.922  1.00 1.57  ? 15 ARG A CB     1  
ATOM 1820  C CG     . ARG C 3 15 ? 16.210  5.803   0.197   1.00 1.95  ? 15 ARG A CG     1  
ATOM 1821  C CD     . ARG C 3 15 ? 17.598  6.402   0.354   1.00 2.00  ? 15 ARG A CD     1  
ATOM 1822  N NE     . ARG C 3 15 ? 18.159  6.803   -0.931  1.00 2.25  ? 15 ARG A NE     1  
ATOM 1823  C CZ     . ARG C 3 15 ? 19.456  6.931   -1.172  1.00 2.73  ? 15 ARG A CZ     1  
ATOM 1824  N NH1    . ARG C 3 15 ? 20.347  6.746   -0.199  1.00 2.96  ? 15 ARG A NH1    1  
ATOM 1825  N NH2    . ARG C 3 15 ? 19.861  7.249   -2.389  1.00 3.61  ? 15 ARG A NH2    1  
ATOM 1826  H H      . ARG C 3 15 ? 19.128  3.964   -0.875  1.00 1.77  ? 15 ARG A H      1  
ATOM 1827  H HA     . ARG C 3 15 ? 17.279  3.490   0.373   1.00 1.58  ? 15 ARG A HA     1  
ATOM 1828  H HB2    . ARG C 3 15 ? 16.485  5.256   -1.834  1.00 1.96  ? 15 ARG A HB2    1  
ATOM 1829  H HB3    . ARG C 3 15 ? 15.147  4.442   -1.041  1.00 2.05  ? 15 ARG A HB3    1  
ATOM 1830  H HG2    . ARG C 3 15 ? 15.511  6.596   -0.030  1.00 2.54  ? 15 ARG A HG2    1  
ATOM 1831  H HG3    . ARG C 3 15 ? 15.927  5.326   1.124   1.00 2.50  ? 15 ARG A HG3    1  
ATOM 1832  H HD2    . ARG C 3 15 ? 17.535  7.267   0.997   1.00 2.35  ? 15 ARG A HD2    1  
ATOM 1833  H HD3    . ARG C 3 15 ? 18.246  5.665   0.805   1.00 2.50  ? 15 ARG A HD3    1  
ATOM 1834  H HE     . ARG C 3 15 ? 17.524  6.964   -1.672  1.00 2.67  ? 15 ARG A HE     1  
ATOM 1835  H HH11   . ARG C 3 15 ? 20.040  6.512   0.727   1.00 2.87  ? 15 ARG A HH11   1  
ATOM 1836  H HH12   . ARG C 3 15 ? 21.324  6.837   -0.388  1.00 3.64  ? 15 ARG A HH12   1  
ATOM 1837  H HH21   . ARG C 3 15 ? 19.174  7.389   -3.129  1.00 3.95  ? 15 ARG A HH21   1  
ATOM 1838  H HH22   . ARG C 3 15 ? 20.834  7.337   -2.597  1.00 4.19  ? 15 ARG A HH22   1  
ATOM 1839  N N      . VAL C 3 16 ? 16.675  1.174   -0.458  1.00 1.08  ? 16 VAL A N      1  
ATOM 1840  C CA     . VAL C 3 16 ? 16.038  -0.098  -0.744  1.00 1.38  ? 16 VAL A CA     1  
ATOM 1841  C C      . VAL C 3 16 ? 14.708  -0.188  -0.009  1.00 1.45  ? 16 VAL A C      1  
ATOM 1842  O O      . VAL C 3 16 ? 14.619  -0.714  1.102   1.00 1.71  ? 16 VAL A O      1  
ATOM 1843  C CB     . VAL C 3 16 ? 16.934  -1.290  -0.353  1.00 1.72  ? 16 VAL A CB     1  
ATOM 1844  C CG1    . VAL C 3 16 ? 16.322  -2.602  -0.826  1.00 2.33  ? 16 VAL A CG1    1  
ATOM 1845  C CG2    . VAL C 3 16 ? 18.331  -1.114  -0.926  1.00 1.93  ? 16 VAL A CG2    1  
ATOM 1846  H H      . VAL C 3 16 ? 17.377  1.213   0.227   1.00 1.05  ? 16 VAL A H      1  
ATOM 1847  H HA     . VAL C 3 16 ? 15.855  -0.145  -1.808  1.00 1.57  ? 16 VAL A HA     1  
ATOM 1848  H HB     . VAL C 3 16 ? 17.010  -1.320  0.724   1.00 2.20  ? 16 VAL A HB     1  
ATOM 1849  H HG11   . VAL C 3 16 ? 16.313  -2.625  -1.906  1.00 2.75  ? 16 VAL A HG11   1  
ATOM 1850  H HG12   . VAL C 3 16 ? 15.311  -2.681  -0.456  1.00 2.59  ? 16 VAL A HG12   1  
ATOM 1851  H HG13   . VAL C 3 16 ? 16.908  -3.430  -0.454  1.00 2.71  ? 16 VAL A HG13   1  
ATOM 1852  H HG21   . VAL C 3 16 ? 18.724  -0.151  -0.629  1.00 2.11  ? 16 VAL A HG21   1  
ATOM 1853  H HG22   . VAL C 3 16 ? 18.285  -1.168  -2.003  1.00 2.35  ? 16 VAL A HG22   1  
ATOM 1854  H HG23   . VAL C 3 16 ? 18.973  -1.897  -0.553  1.00 2.47  ? 16 VAL A HG23   1  
ATOM 1855  N N      . VAL C 3 17 ? 13.683  0.370   -0.622  1.00 1.49  ? 17 VAL A N      1  
ATOM 1856  C CA     . VAL C 3 17 ? 12.355  0.362   -0.046  1.00 1.72  ? 17 VAL A CA     1  
ATOM 1857  C C      . VAL C 3 17 ? 11.631  -0.934  -0.391  1.00 1.82  ? 17 VAL A C      1  
ATOM 1858  O O      . VAL C 3 17 ? 11.181  -1.130  -1.521  1.00 1.91  ? 17 VAL A O      1  
ATOM 1859  C CB     . VAL C 3 17 ? 11.524  1.575   -0.516  1.00 2.00  ? 17 VAL A CB     1  
ATOM 1860  C CG1    . VAL C 3 17 ? 11.976  2.828   0.213   1.00 2.31  ? 17 VAL A CG1    1  
ATOM 1861  C CG2    . VAL C 3 17 ? 11.630  1.774   -2.023  1.00 2.41  ? 17 VAL A CG2    1  
ATOM 1862  H H      . VAL C 3 17 ? 13.827  0.801   -1.492  1.00 1.53  ? 17 VAL A H      1  
ATOM 1863  H HA     . VAL C 3 17 ? 12.462  0.424   1.028   1.00 1.78  ? 17 VAL A HA     1  
ATOM 1864  H HB     . VAL C 3 17 ? 10.487  1.393   -0.269  1.00 2.15  ? 17 VAL A HB     1  
ATOM 1865  H HG11   . VAL C 3 17 ? 11.145  3.244   0.765   1.00 2.72  ? 17 VAL A HG11   1  
ATOM 1866  H HG12   . VAL C 3 17 ? 12.332  3.552   -0.504  1.00 2.41  ? 17 VAL A HG12   1  
ATOM 1867  H HG13   . VAL C 3 17 ? 12.774  2.578   0.897   1.00 2.63  ? 17 VAL A HG13   1  
ATOM 1868  H HG21   . VAL C 3 17 ? 11.239  0.901   -2.528  1.00 2.58  ? 17 VAL A HG21   1  
ATOM 1869  H HG22   . VAL C 3 17 ? 12.664  1.917   -2.298  1.00 2.95  ? 17 VAL A HG22   1  
ATOM 1870  H HG23   . VAL C 3 17 ? 11.059  2.643   -2.312  1.00 2.64  ? 17 VAL A HG23   1  
ATOM 1871  N N      . ILE C 3 18 ? 11.552  -1.830  0.588   1.00 1.96  ? 18 ILE A N      1  
ATOM 1872  C CA     . ILE C 3 18 ? 10.888  -3.115  0.407   1.00 2.11  ? 18 ILE A CA     1  
ATOM 1873  C C      . ILE C 3 18 ? 9.417   -2.925  0.033   1.00 2.07  ? 18 ILE A C      1  
ATOM 1874  O O      . ILE C 3 18 ? 8.822   -1.888  0.348   1.00 1.99  ? 18 ILE A O      1  
ATOM 1875  C CB     . ILE C 3 18 ? 11.004  -4.000  1.673   1.00 2.26  ? 18 ILE A CB     1  
ATOM 1876  C CG1    . ILE C 3 18 ? 10.700  -3.183  2.934   1.00 2.70  ? 18 ILE A CG1    1  
ATOM 1877  C CG2    . ILE C 3 18 ? 12.394  -4.619  1.758   1.00 2.76  ? 18 ILE A CG2    1  
ATOM 1878  C CD1    . ILE C 3 18 ? 10.621  -4.016  4.199   1.00 3.15  ? 18 ILE A CD1    1  
ATOM 1879  H H      . ILE C 3 18 ? 11.959  -1.624  1.455   1.00 2.07  ? 18 ILE A H      1  
ATOM 1880  H HA     . ILE C 3 18 ? 11.384  -3.626  -0.405  1.00 2.25  ? 18 ILE A HA     1  
ATOM 1881  H HB     . ILE C 3 18 ? 10.286  -4.801  1.593   1.00 2.54  ? 18 ILE A HB     1  
ATOM 1882  H HG12   . ILE C 3 18 ? 11.475  -2.444  3.073   1.00 3.05  ? 18 ILE A HG12   1  
ATOM 1883  H HG13   . ILE C 3 18 ? 9.754   -2.680  2.809   1.00 3.02  ? 18 ILE A HG13   1  
ATOM 1884  H HG21   . ILE C 3 18 ? 12.621  -5.128  0.833   1.00 3.20  ? 18 ILE A HG21   1  
ATOM 1885  H HG22   . ILE C 3 18 ? 12.425  -5.326  2.574   1.00 3.05  ? 18 ILE A HG22   1  
ATOM 1886  H HG23   . ILE C 3 18 ? 13.124  -3.841  1.930   1.00 3.12  ? 18 ILE A HG23   1  
ATOM 1887  H HD11   . ILE C 3 18 ? 10.414  -3.373  5.042   1.00 2.90  ? 18 ILE A HD11   1  
ATOM 1888  H HD12   . ILE C 3 18 ? 11.562  -4.524  4.357   1.00 3.65  ? 18 ILE A HD12   1  
ATOM 1889  H HD13   . ILE C 3 18 ? 9.831   -4.745  4.100   1.00 3.73  ? 18 ILE A HD13   1  
ATOM 1890  N N      . PRO C 3 19 ? 8.823   -3.924  -0.653  1.00 2.24  ? 19 PRO A N      1  
ATOM 1891  C CA     . PRO C 3 19 ? 7.427   -3.876  -1.103  1.00 2.33  ? 19 PRO A CA     1  
ATOM 1892  C C      . PRO C 3 19 ? 6.469   -3.356  -0.046  1.00 2.21  ? 19 PRO A C      1  
ATOM 1893  O O      . PRO C 3 19 ? 6.389   -3.893  1.062   1.00 2.24  ? 19 PRO A O      1  
ATOM 1894  C CB     . PRO C 3 19 ? 7.116   -5.332  -1.424  1.00 2.68  ? 19 PRO A CB     1  
ATOM 1895  C CG     . PRO C 3 19 ? 8.420   -5.908  -1.841  1.00 2.71  ? 19 PRO A CG     1  
ATOM 1896  C CD     . PRO C 3 19 ? 9.473   -5.195  -1.037  1.00 2.49  ? 19 PRO A CD     1  
ATOM 1897  H HA     . PRO C 3 19 ? 7.324   -3.281  -1.999  1.00 2.37  ? 19 PRO A HA     1  
ATOM 1898  H HB2    . PRO C 3 19 ? 6.725   -5.823  -0.544  1.00 2.83  ? 19 PRO A HB2    1  
ATOM 1899  H HB3    . PRO C 3 19 ? 6.391   -5.380  -2.222  1.00 2.87  ? 19 PRO A HB3    1  
ATOM 1900  H HG2    . PRO C 3 19 ? 8.438   -6.965  -1.624  1.00 2.93  ? 19 PRO A HG2    1  
ATOM 1901  H HG3    . PRO C 3 19 ? 8.575   -5.738  -2.895  1.00 2.74  ? 19 PRO A HG3    1  
ATOM 1902  H HD2    . PRO C 3 19 ? 9.730   -5.772  -0.163  1.00 2.57  ? 19 PRO A HD2    1  
ATOM 1903  H HD3    . PRO C 3 19 ? 10.347  -5.013  -1.642  1.00 2.53  ? 19 PRO A HD3    1  
ATOM 1904  N N      . ILE C 3 20 ? 5.736   -2.314  -0.408  1.00 2.25  ? 20 ILE A N      1  
ATOM 1905  C CA     . ILE C 3 20 ? 4.769   -1.700  0.488   1.00 2.31  ? 20 ILE A CA     1  
ATOM 1906  C C      . ILE C 3 20 ? 3.676   -2.701  0.824   1.00 2.29  ? 20 ILE A C      1  
ATOM 1907  O O      . ILE C 3 20 ? 3.155   -2.732  1.942   1.00 2.31  ? 20 ILE A O      1  
ATOM 1908  C CB     . ILE C 3 20 ? 4.126   -0.450  -0.144  1.00 2.64  ? 20 ILE A CB     1  
ATOM 1909  C CG1    . ILE C 3 20 ? 5.143   0.334   -0.977  1.00 3.09  ? 20 ILE A CG1    1  
ATOM 1910  C CG2    . ILE C 3 20 ? 3.547   0.438   0.942   1.00 2.66  ? 20 ILE A CG2    1  
ATOM 1911  C CD1    . ILE C 3 20 ? 4.499   1.331   -1.916  1.00 3.73  ? 20 ILE A CD1    1  
ATOM 1912  H H      . ILE C 3 20 ? 5.841   -1.957  -1.314  1.00 2.34  ? 20 ILE A H      1  
ATOM 1913  H HA     . ILE C 3 20 ? 5.279   -1.410  1.392   1.00 2.31  ? 20 ILE A HA     1  
ATOM 1914  H HB     . ILE C 3 20 ? 3.316   -0.769  -0.783  1.00 3.18  ? 20 ILE A HB     1  
ATOM 1915  H HG12   . ILE C 3 20 ? 5.800   0.878   -0.314  1.00 3.10  ? 20 ILE A HG12   1  
ATOM 1916  H HG13   . ILE C 3 20 ? 5.727   -0.353  -1.571  1.00 3.55  ? 20 ILE A HG13   1  
ATOM 1917  H HG21   . ILE C 3 20 ? 4.349   0.946   1.458   1.00 3.10  ? 20 ILE A HG21   1  
ATOM 1918  H HG22   . ILE C 3 20 ? 2.994   -0.167  1.645   1.00 2.87  ? 20 ILE A HG22   1  
ATOM 1919  H HG23   . ILE C 3 20 ? 2.886   1.168   0.497   1.00 2.68  ? 20 ILE A HG23   1  
ATOM 1920  H HD11   . ILE C 3 20 ? 3.870   2.002   -1.349  1.00 4.13  ? 20 ILE A HD11   1  
ATOM 1921  H HD12   . ILE C 3 20 ? 3.898   0.806   -2.644  1.00 4.11  ? 20 ILE A HD12   1  
ATOM 1922  H HD13   . ILE C 3 20 ? 5.266   1.896   -2.426  1.00 3.89  ? 20 ILE A HD13   1  
ATOM 1923  N N      . GLU C 3 21 ? 3.357   -3.529  -0.160  1.00 2.40  ? 21 GLU A N      1  
ATOM 1924  C CA     . GLU C 3 21 ? 2.343   -4.558  -0.018  1.00 2.55  ? 21 GLU A CA     1  
ATOM 1925  C C      . GLU C 3 21 ? 2.687   -5.507  1.130   1.00 2.53  ? 21 GLU A C      1  
ATOM 1926  O O      . GLU C 3 21 ? 1.869   -5.734  2.018   1.00 2.62  ? 21 GLU A O      1  
ATOM 1927  C CB     . GLU C 3 21 ? 2.186   -5.341  -1.332  1.00 2.83  ? 21 GLU A CB     1  
ATOM 1928  C CG     . GLU C 3 21 ? 3.504   -5.673  -2.022  1.00 3.28  ? 21 GLU A CG     1  
ATOM 1929  C CD     . GLU C 3 21 ? 3.907   -4.639  -3.057  1.00 3.81  ? 21 GLU A CD     1  
ATOM 1930  O OE1    . GLU C 3 21 ? 4.071   -3.453  -2.692  1.00 4.31  ? 21 GLU A OE1    1  
ATOM 1931  O OE2    . GLU C 3 21 ? 4.074   -5.007  -4.236  1.00 4.00  ? 21 GLU A OE2    1  
ATOM 1932  H H      . GLU C 3 21 ? 3.821   -3.436  -1.025  1.00 2.47  ? 21 GLU A H      1  
ATOM 1933  H HA     . GLU C 3 21 ? 1.408   -4.064  0.209   1.00 2.63  ? 21 GLU A HA     1  
ATOM 1934  H HB2    . GLU C 3 21 ? 1.672   -6.268  -1.122  1.00 3.00  ? 21 GLU A HB2    1  
ATOM 1935  H HB3    . GLU C 3 21 ? 1.586   -4.757  -2.013  1.00 3.13  ? 21 GLU A HB3    1  
ATOM 1936  H HG2    . GLU C 3 21 ? 4.281   -5.728  -1.275  1.00 3.56  ? 21 GLU A HG2    1  
ATOM 1937  H HG3    . GLU C 3 21 ? 3.409   -6.631  -2.511  1.00 3.51  ? 21 GLU A HG3    1  
ATOM 1938  N N      . LEU C 3 22 ? 3.908   -6.034  1.124   1.00 2.56  ? 22 LEU A N      1  
ATOM 1939  C CA     . LEU C 3 22 ? 4.351   -6.962  2.160   1.00 2.73  ? 22 LEU A CA     1  
ATOM 1940  C C      . LEU C 3 22 ? 4.492   -6.243  3.497   1.00 2.66  ? 22 LEU A C      1  
ATOM 1941  O O      . LEU C 3 22 ? 4.214   -6.812  4.553   1.00 2.89  ? 22 LEU A O      1  
ATOM 1942  C CB     . LEU C 3 22 ? 5.683   -7.607  1.761   1.00 2.88  ? 22 LEU A CB     1  
ATOM 1943  C CG     . LEU C 3 22 ? 6.182   -8.710  2.699   1.00 3.13  ? 22 LEU A CG     1  
ATOM 1944  C CD1    . LEU C 3 22 ? 5.190   -9.864  2.752   1.00 3.46  ? 22 LEU A CD1    1  
ATOM 1945  C CD2    . LEU C 3 22 ? 7.547   -9.209  2.253   1.00 3.58  ? 22 LEU A CD2    1  
ATOM 1946  H H      . LEU C 3 22 ? 4.529   -5.788  0.409   1.00 2.55  ? 22 LEU A H      1  
ATOM 1947  H HA     . LEU C 3 22 ? 3.602   -7.733  2.258   1.00 2.93  ? 22 LEU A HA     1  
ATOM 1948  H HB2    . LEU C 3 22 ? 5.571   -8.031  0.773   1.00 2.96  ? 22 LEU A HB2    1  
ATOM 1949  H HB3    . LEU C 3 22 ? 6.435   -6.833  1.718   1.00 3.14  ? 22 LEU A HB3    1  
ATOM 1950  H HG     . LEU C 3 22 ? 6.282   -8.307  3.697   1.00 3.38  ? 22 LEU A HG     1  
ATOM 1951  H HD11   . LEU C 3 22 ? 5.645   -10.705 3.255   1.00 3.47  ? 22 LEU A HD11   1  
ATOM 1952  H HD12   . LEU C 3 22 ? 4.917   -10.152 1.748   1.00 3.60  ? 22 LEU A HD12   1  
ATOM 1953  H HD13   . LEU C 3 22 ? 4.306   -9.559  3.293   1.00 4.10  ? 22 LEU A HD13   1  
ATOM 1954  H HD21   . LEU C 3 22 ? 7.478   -9.582  1.242   1.00 3.78  ? 22 LEU A HD21   1  
ATOM 1955  H HD22   . LEU C 3 22 ? 7.871   -10.004 2.909   1.00 3.76  ? 22 LEU A HD22   1  
ATOM 1956  H HD23   . LEU C 3 22 ? 8.260   -8.398  2.292   1.00 4.07  ? 22 LEU A HD23   1  
ATOM 1957  N N      . ARG C 3 23 ? 4.907   -4.983  3.434   1.00 2.45  ? 23 ARG A N      1  
ATOM 1958  C CA     . ARG C 3 23 ? 5.093   -4.168  4.627   1.00 2.52  ? 23 ARG A CA     1  
ATOM 1959  C C      . ARG C 3 23 ? 3.816   -4.093  5.460   1.00 2.63  ? 23 ARG A C      1  
ATOM 1960  O O      . ARG C 3 23 ? 3.846   -4.308  6.672   1.00 2.93  ? 23 ARG A O      1  
ATOM 1961  C CB     . ARG C 3 23 ? 5.545   -2.760  4.241   1.00 2.40  ? 23 ARG A CB     1  
ATOM 1962  C CG     . ARG C 3 23 ? 7.030   -2.659  3.942   1.00 2.60  ? 23 ARG A CG     1  
ATOM 1963  C CD     . ARG C 3 23 ? 7.417   -1.257  3.499   1.00 2.56  ? 23 ARG A CD     1  
ATOM 1964  N NE     . ARG C 3 23 ? 7.255   -0.273  4.567   1.00 2.36  ? 23 ARG A NE     1  
ATOM 1965  C CZ     . ARG C 3 23 ? 7.492   1.030   4.417   1.00 2.51  ? 23 ARG A CZ     1  
ATOM 1966  N NH1    . ARG C 3 23 ? 7.888   1.506   3.240   1.00 2.95  ? 23 ARG A NH1    1  
ATOM 1967  N NH2    . ARG C 3 23 ? 7.337   1.860   5.441   1.00 2.84  ? 23 ARG A NH2    1  
ATOM 1968  H H      . ARG C 3 23 ? 5.097   -4.587  2.555   1.00 2.33  ? 23 ARG A H      1  
ATOM 1969  H HA     . ARG C 3 23 ? 5.865   -4.629  5.223   1.00 2.71  ? 23 ARG A HA     1  
ATOM 1970  H HB2    . ARG C 3 23 ? 5.001   -2.451  3.359   1.00 2.40  ? 23 ARG A HB2    1  
ATOM 1971  H HB3    . ARG C 3 23 ? 5.315   -2.086  5.051   1.00 2.58  ? 23 ARG A HB3    1  
ATOM 1972  H HG2    . ARG C 3 23 ? 7.584   -2.909  4.834   1.00 3.08  ? 23 ARG A HG2    1  
ATOM 1973  H HG3    . ARG C 3 23 ? 7.278   -3.356  3.154   1.00 2.87  ? 23 ARG A HG3    1  
ATOM 1974  H HD2    . ARG C 3 23 ? 8.450   -1.264  3.187   1.00 2.85  ? 23 ARG A HD2    1  
ATOM 1975  H HD3    . ARG C 3 23 ? 6.793   -0.974  2.664   1.00 3.10  ? 23 ARG A HD3    1  
ATOM 1976  H HE     . ARG C 3 23 ? 6.956   -0.605  5.446   1.00 2.59  ? 23 ARG A HE     1  
ATOM 1977  H HH11   . ARG C 3 23 ? 8.007   0.887   2.463   1.00 3.27  ? 23 ARG A HH11   1  
ATOM 1978  H HH12   . ARG C 3 23 ? 8.081   2.482   3.130   1.00 3.29  ? 23 ARG A HH12   1  
ATOM 1979  H HH21   . ARG C 3 23 ? 7.042   1.511   6.346   1.00 3.19  ? 23 ARG A HH21   1  
ATOM 1980  H HH22   . ARG C 3 23 ? 7.499   2.842   5.323   1.00 3.10  ? 23 ARG A HH22   1  
ATOM 1981  N N      . ARG C 3 24 ? 2.695   -3.811  4.807   1.00 2.51  ? 24 ARG A N      1  
ATOM 1982  C CA     . ARG C 3 24 ? 1.417   -3.701  5.506   1.00 2.71  ? 24 ARG A CA     1  
ATOM 1983  C C      . ARG C 3 24 ? 0.750   -5.063  5.690   1.00 2.99  ? 24 ARG A C      1  
ATOM 1984  O O      . ARG C 3 24 ? 0.040   -5.279  6.671   1.00 3.26  ? 24 ARG A O      1  
ATOM 1985  C CB     . ARG C 3 24 ? 0.482   -2.740  4.769   1.00 2.66  ? 24 ARG A CB     1  
ATOM 1986  C CG     . ARG C 3 24 ? 0.855   -1.281  4.970   1.00 2.96  ? 24 ARG A CG     1  
ATOM 1987  C CD     . ARG C 3 24 ? -0.152  -0.347  4.327   1.00 2.99  ? 24 ARG A CD     1  
ATOM 1988  N NE     . ARG C 3 24 ? -0.127  -0.436  2.872   1.00 3.21  ? 24 ARG A NE     1  
ATOM 1989  C CZ     . ARG C 3 24 ? 0.284   0.540   2.068   1.00 3.47  ? 24 ARG A CZ     1  
ATOM 1990  N NH1    . ARG C 3 24 ? 0.701   1.696   2.568   1.00 3.72  ? 24 ARG A NH1    1  
ATOM 1991  N NH2    . ARG C 3 24 ? 0.280   0.360   0.758   1.00 3.87  ? 24 ARG A NH2    1  
ATOM 1992  H H      . ARG C 3 24 ? 2.725   -3.671  3.833   1.00 2.37  ? 24 ARG A H      1  
ATOM 1993  H HA     . ARG C 3 24 ? 1.623   -3.292  6.485   1.00 2.83  ? 24 ARG A HA     1  
ATOM 1994  H HB2    . ARG C 3 24 ? 0.516   -2.959  3.710   1.00 2.72  ? 24 ARG A HB2    1  
ATOM 1995  H HB3    . ARG C 3 24 ? -0.526  -2.885  5.128   1.00 2.73  ? 24 ARG A HB3    1  
ATOM 1996  H HG2    . ARG C 3 24 ? 0.899   -1.073  6.028   1.00 3.19  ? 24 ARG A HG2    1  
ATOM 1997  H HG3    . ARG C 3 24 ? 1.826   -1.107  4.527   1.00 3.50  ? 24 ARG A HG3    1  
ATOM 1998  H HD2    . ARG C 3 24 ? -1.140  -0.607  4.676   1.00 3.28  ? 24 ARG A HD2    1  
ATOM 1999  H HD3    . ARG C 3 24 ? 0.078   0.666   4.621   1.00 3.17  ? 24 ARG A HD3    1  
ATOM 2000  H HE     . ARG C 3 24 ? -0.443  -1.292  2.463   1.00 3.46  ? 24 ARG A HE     1  
ATOM 2001  H HH11   . ARG C 3 24 ? 0.713   1.845   3.557   1.00 3.79  ? 24 ARG A HH11   1  
ATOM 2002  H HH12   . ARG C 3 24 ? 1.006   2.427   1.951   1.00 4.10  ? 24 ARG A HH12   1  
ATOM 2003  H HH21   . ARG C 3 24 ? -0.034  -0.523  0.366   1.00 4.15  ? 24 ARG A HH21   1  
ATOM 2004  H HH22   . ARG C 3 24 ? 0.590   1.094   0.148   1.00 4.12  ? 24 ARG A HH22   1  
ATOM 2005  N N      . THR C 3 25 ? 0.979   -5.976  4.754   1.00 3.03  ? 25 THR A N      1  
ATOM 2006  C CA     . THR C 3 25 ? 0.396   -7.313  4.837   1.00 3.39  ? 25 THR A CA     1  
ATOM 2007  C C      . THR C 3 25 ? 0.956   -8.083  6.035   1.00 3.47  ? 25 THR A C      1  
ATOM 2008  O O      . THR C 3 25 ? 0.201   -8.663  6.821   1.00 3.75  ? 25 THR A O      1  
ATOM 2009  C CB     . THR C 3 25 ? 0.641   -8.120  3.540   1.00 3.50  ? 25 THR A CB     1  
ATOM 2010  O OG1    . THR C 3 25 ? -0.030  -7.492  2.443   1.00 3.20  ? 25 THR A OG1    1  
ATOM 2011  C CG2    . THR C 3 25 ? 0.154   -9.554  3.681   1.00 4.09  ? 25 THR A CG2    1  
ATOM 2012  H H      . THR C 3 25 ? 1.538   -5.743  3.981   1.00 2.86  ? 25 THR A H      1  
ATOM 2013  H HA     . THR C 3 25 ? -0.670  -7.199  4.968   1.00 3.68  ? 25 THR A HA     1  
ATOM 2014  H HB     . THR C 3 25 ? 1.703   -8.137  3.338   1.00 3.63  ? 25 THR A HB     1  
ATOM 2015  H HG1    . THR C 3 25 ? 0.495   -6.740  2.142   1.00 2.99  ? 25 THR A HG1    1  
ATOM 2016  H HG21   . THR C 3 25 ? 0.251   -10.064 2.734   1.00 4.10  ? 25 THR A HG21   1  
ATOM 2017  H HG22   . THR C 3 25 ? -0.881  -9.555  3.989   1.00 4.39  ? 25 THR A HG22   1  
ATOM 2018  H HG23   . THR C 3 25 ? 0.750   -10.060 4.423   1.00 4.55  ? 25 THR A HG23   1  
ATOM 2019  N N      . LEU C 3 26 ? 2.276   -8.068  6.178   1.00 3.35  ? 26 LEU A N      1  
ATOM 2020  C CA     . LEU C 3 26 ? 2.937   -8.768  7.271   1.00 3.52  ? 26 LEU A CA     1  
ATOM 2021  C C      . LEU C 3 26 ? 2.984   -7.895  8.519   1.00 3.46  ? 26 LEU A C      1  
ATOM 2022  O O      . LEU C 3 26 ? 2.993   -8.399  9.639   1.00 3.77  ? 26 LEU A O      1  
ATOM 2023  C CB     . LEU C 3 26 ? 4.361   -9.168  6.857   1.00 3.60  ? 26 LEU A CB     1  
ATOM 2024  C CG     . LEU C 3 26 ? 4.994   -10.310 7.665   1.00 3.95  ? 26 LEU A CG     1  
ATOM 2025  C CD1    . LEU C 3 26 ? 5.920   -11.131 6.785   1.00 4.49  ? 26 LEU A CD1    1  
ATOM 2026  C CD2    . LEU C 3 26 ? 5.754   -9.768  8.867   1.00 4.24  ? 26 LEU A CD2    1  
ATOM 2027  H H      . LEU C 3 26 ? 2.823   -7.573  5.530   1.00 3.22  ? 26 LEU A H      1  
ATOM 2028  H HA     . LEU C 3 26 ? 2.370   -9.660  7.491   1.00 3.86  ? 26 LEU A HA     1  
ATOM 2029  H HB2    . LEU C 3 26 ? 4.339   -9.461  5.817   1.00 3.61  ? 26 LEU A HB2    1  
ATOM 2030  H HB3    . LEU C 3 26 ? 4.994   -8.299  6.952   1.00 3.67  ? 26 LEU A HB3    1  
ATOM 2031  H HG     . LEU C 3 26 ? 4.214   -10.962 8.026   1.00 4.03  ? 26 LEU A HG     1  
ATOM 2032  H HD11   . LEU C 3 26 ? 6.391   -11.902 7.377   1.00 4.86  ? 26 LEU A HD11   1  
ATOM 2033  H HD12   . LEU C 3 26 ? 6.677   -10.489 6.360   1.00 4.43  ? 26 LEU A HD12   1  
ATOM 2034  H HD13   . LEU C 3 26 ? 5.346   -11.586 5.991   1.00 4.96  ? 26 LEU A HD13   1  
ATOM 2035  H HD21   . LEU C 3 26 ? 6.621   -9.222  8.531   1.00 4.62  ? 26 LEU A HD21   1  
ATOM 2036  H HD22   . LEU C 3 26 ? 6.067   -10.589 9.495   1.00 4.56  ? 26 LEU A HD22   1  
ATOM 2037  H HD23   . LEU C 3 26 ? 5.110   -9.107  9.431   1.00 4.21  ? 26 LEU A HD23   1  
ATOM 2038  N N      . GLY C 3 27 ? 2.998   -6.586  8.323   1.00 3.32  ? 27 GLY A N      1  
ATOM 2039  C CA     . GLY C 3 27 ? 3.064   -5.686  9.451   1.00 3.54  ? 27 GLY A CA     1  
ATOM 2040  C C      . GLY C 3 27 ? 4.484   -5.551  9.948   1.00 3.50  ? 27 GLY A C      1  
ATOM 2041  O O      . GLY C 3 27 ? 4.789   -5.860  11.100  1.00 3.74  ? 27 GLY A O      1  
ATOM 2042  H H      . GLY C 3 27 ? 2.966   -6.230  7.412   1.00 3.26  ? 27 GLY A H      1  
ATOM 2043  H HA2    . GLY C 3 27 ? 2.699   -4.715  9.149   1.00 3.70  ? 27 GLY A HA2    1  
ATOM 2044  H HA3    . GLY C 3 27 ? 2.445   -6.069  10.247  1.00 3.81  ? 27 GLY A HA3    1  
ATOM 2045  N N      . ILE C 3 28 ? 5.356   -5.106  9.061   1.00 3.43  ? 28 ILE A N      1  
ATOM 2046  C CA     . ILE C 3 28 ? 6.762   -4.939  9.381   1.00 3.53  ? 28 ILE A CA     1  
ATOM 2047  C C      . ILE C 3 28 ? 7.036   -3.529  9.885   1.00 3.70  ? 28 ILE A C      1  
ATOM 2048  O O      . ILE C 3 28 ? 7.017   -2.575  9.110   1.00 3.85  ? 28 ILE A O      1  
ATOM 2049  C CB     . ILE C 3 28 ? 7.653   -5.217  8.150   1.00 3.59  ? 28 ILE A CB     1  
ATOM 2050  C CG1    . ILE C 3 28 ? 7.282   -6.561  7.513   1.00 3.56  ? 28 ILE A CG1    1  
ATOM 2051  C CG2    . ILE C 3 28 ? 9.125   -5.196  8.544   1.00 3.82  ? 28 ILE A CG2    1  
ATOM 2052  C CD1    . ILE C 3 28 ? 7.870   -6.764  6.131   1.00 4.11  ? 28 ILE A CD1    1  
ATOM 2053  H H      . ILE C 3 28 ? 5.038   -4.863  8.164   1.00 3.48  ? 28 ILE A H      1  
ATOM 2054  H HA     . ILE C 3 28 ? 7.017   -5.647  10.154  1.00 3.68  ? 28 ILE A HA     1  
ATOM 2055  H HB     . ILE C 3 28 ? 7.487   -4.428  7.431   1.00 3.85  ? 28 ILE A HB     1  
ATOM 2056  H HG12   . ILE C 3 28 ? 7.637   -7.362  8.143   1.00 3.58  ? 28 ILE A HG12   1  
ATOM 2057  H HG13   . ILE C 3 28 ? 6.207   -6.625  7.428   1.00 3.48  ? 28 ILE A HG13   1  
ATOM 2058  H HG21   . ILE C 3 28 ? 9.287   -5.873  9.369   1.00 4.27  ? 28 ILE A HG21   1  
ATOM 2059  H HG22   . ILE C 3 28 ? 9.404   -4.197  8.842   1.00 3.84  ? 28 ILE A HG22   1  
ATOM 2060  H HG23   . ILE C 3 28 ? 9.726   -5.502  7.702   1.00 4.02  ? 28 ILE A HG23   1  
ATOM 2061  H HD11   . ILE C 3 28 ? 8.934   -6.581  6.163   1.00 4.16  ? 28 ILE A HD11   1  
ATOM 2062  H HD12   . ILE C 3 28 ? 7.408   -6.074  5.439   1.00 4.42  ? 28 ILE A HD12   1  
ATOM 2063  H HD13   . ILE C 3 28 ? 7.687   -7.777  5.804   1.00 4.53  ? 28 ILE A HD13   1  
ATOM 2064  N N      . ALA C 3 29 ? 7.273   -3.402  11.183  1.00 3.97  ? 29 ALA A N      1  
ATOM 2065  C CA     . ALA C 3 29 ? 7.565   -2.107  11.777  1.00 4.40  ? 29 ALA A CA     1  
ATOM 2066  C C      . ALA C 3 29 ? 8.917   -1.604  11.284  1.00 4.50  ? 29 ALA A C      1  
ATOM 2067  O O      . ALA C 3 29 ? 9.942   -2.247  11.501  1.00 4.84  ? 29 ALA A O      1  
ATOM 2068  C CB     . ALA C 3 29 ? 7.556   -2.204  13.291  1.00 4.99  ? 29 ALA A CB     1  
ATOM 2069  H H      . ALA C 3 29 ? 7.252   -4.198  11.754  1.00 4.06  ? 29 ALA A H      1  
ATOM 2070  H HA     . ALA C 3 29 ? 6.794   -1.415  11.471  1.00 4.46  ? 29 ALA A HA     1  
ATOM 2071  H HB1    . ALA C 3 29 ? 6.639   -2.673  13.617  1.00 5.43  ? 29 ALA A HB1    1  
ATOM 2072  H HB2    . ALA C 3 29 ? 7.625   -1.214  13.715  1.00 5.13  ? 29 ALA A HB2    1  
ATOM 2073  H HB3    . ALA C 3 29 ? 8.399   -2.794  13.616  1.00 5.19  ? 29 ALA A HB3    1  
ATOM 2074  N N      . GLU C 3 30 ? 8.921   -0.457  10.627  1.00 4.48  ? 30 GLU A N      1  
ATOM 2075  C CA     . GLU C 3 30 ? 10.150  0.103   10.084  1.00 4.68  ? 30 GLU A CA     1  
ATOM 2076  C C      . GLU C 3 30 ? 10.806  1.081   11.062  1.00 3.97  ? 30 GLU A C      1  
ATOM 2077  O O      . GLU C 3 30 ? 11.115  2.223   10.713  1.00 3.91  ? 30 GLU A O      1  
ATOM 2078  C CB     . GLU C 3 30 ? 9.880   0.779   8.729   1.00 5.46  ? 30 GLU A CB     1  
ATOM 2079  C CG     . GLU C 3 30 ? 8.903   1.950   8.785   1.00 5.90  ? 30 GLU A CG     1  
ATOM 2080  C CD     . GLU C 3 30 ? 7.468   1.518   8.974   1.00 5.90  ? 30 GLU A CD     1  
ATOM 2081  O OE1    . GLU C 3 30 ? 6.782   1.252   7.966   1.00 6.17  ? 30 GLU A OE1    1  
ATOM 2082  O OE2    . GLU C 3 30 ? 7.019   1.441   10.135  1.00 5.95  ? 30 GLU A OE2    1  
ATOM 2083  H H      . GLU C 3 30 ? 8.075   0.034   10.507  1.00 4.52  ? 30 GLU A H      1  
ATOM 2084  H HA     . GLU C 3 30 ? 10.830  -0.720  9.925   1.00 5.01  ? 30 GLU A HA     1  
ATOM 2085  H HB2    . GLU C 3 30 ? 10.817  1.141   8.334   1.00 5.81  ? 30 GLU A HB2    1  
ATOM 2086  H HB3    . GLU C 3 30 ? 9.479   0.040   8.050   1.00 5.72  ? 30 GLU A HB3    1  
ATOM 2087  H HG2    . GLU C 3 30 ? 9.178   2.590   9.609   1.00 6.04  ? 30 GLU A HG2    1  
ATOM 2088  H HG3    . GLU C 3 30 ? 8.978   2.503   7.861   1.00 6.43  ? 30 GLU A HG3    1  
ATOM 2089  N N      . LYS C 3 31 ? 11.041  0.624   12.284  1.00 3.71  ? 31 LYS A N      1  
ATOM 2090  C CA     . LYS C 3 31 ? 11.664  1.465   13.299  1.00 3.23  ? 31 LYS A CA     1  
ATOM 2091  C C      . LYS C 3 31 ? 12.738  0.699   14.071  1.00 3.19  ? 31 LYS A C      1  
ATOM 2092  O O      . LYS C 3 31 ? 13.252  1.182   15.082  1.00 3.55  ? 31 LYS A O      1  
ATOM 2093  C CB     . LYS C 3 31 ? 10.605  2.021   14.261  1.00 3.32  ? 31 LYS A CB     1  
ATOM 2094  C CG     . LYS C 3 31 ? 9.714   0.962   14.883  1.00 3.39  ? 31 LYS A CG     1  
ATOM 2095  C CD     . LYS C 3 31 ? 8.606   1.596   15.713  1.00 3.62  ? 31 LYS A CD     1  
ATOM 2096  C CE     . LYS C 3 31 ? 7.625   0.554   16.228  1.00 4.00  ? 31 LYS A CE     1  
ATOM 2097  N NZ     . LYS C 3 31 ? 6.475   1.173   16.940  1.00 4.12  ? 31 LYS A NZ     1  
ATOM 2098  H H      . LYS C 3 31 ? 10.791  -0.300  12.508  1.00 4.04  ? 31 LYS A H      1  
ATOM 2099  H HA     . LYS C 3 31 ? 12.135  2.292   12.789  1.00 3.14  ? 31 LYS A HA     1  
ATOM 2100  H HB2    . LYS C 3 31 ? 11.103  2.551   15.059  1.00 3.36  ? 31 LYS A HB2    1  
ATOM 2101  H HB3    . LYS C 3 31 ? 9.978   2.714   13.722  1.00 3.83  ? 31 LYS A HB3    1  
ATOM 2102  H HG2    . LYS C 3 31 ? 9.270   0.371   14.097  1.00 3.77  ? 31 LYS A HG2    1  
ATOM 2103  H HG3    . LYS C 3 31 ? 10.315  0.331   15.518  1.00 3.51  ? 31 LYS A HG3    1  
ATOM 2104  H HD2    . LYS C 3 31 ? 9.045   2.106   16.557  1.00 3.70  ? 31 LYS A HD2    1  
ATOM 2105  H HD3    . LYS C 3 31 ? 8.073   2.307   15.100  1.00 4.00  ? 31 LYS A HD3    1  
ATOM 2106  H HE2    . LYS C 3 31 ? 7.252   -0.012  15.388  1.00 4.49  ? 31 LYS A HE2    1  
ATOM 2107  H HE3    . LYS C 3 31 ? 8.144   -0.108  16.904  1.00 4.24  ? 31 LYS A HE3    1  
ATOM 2108  H HZ1    . LYS C 3 31 ? 5.906   1.737   16.275  1.00 4.34  ? 31 LYS A HZ1    1  
ATOM 2109  H HZ2    . LYS C 3 31 ? 6.815   1.795   17.702  1.00 4.28  ? 31 LYS A HZ2    1  
ATOM 2110  H HZ3    . LYS C 3 31 ? 5.871   0.434   17.354  1.00 4.31  ? 31 LYS A HZ3    1  
ATOM 2111  N N      . ASP C 3 32 ? 13.087  -0.483  13.587  1.00 2.99  ? 32 ASP A N      1  
ATOM 2112  C CA     . ASP C 3 32 ? 14.101  -1.304  14.242  1.00 3.08  ? 32 ASP A CA     1  
ATOM 2113  C C      . ASP C 3 32 ? 15.191  -1.697  13.250  1.00 2.73  ? 32 ASP A C      1  
ATOM 2114  O O      . ASP C 3 32 ? 15.309  -1.097  12.178  1.00 2.48  ? 32 ASP A O      1  
ATOM 2115  C CB     . ASP C 3 32 ? 13.472  -2.548  14.891  1.00 3.32  ? 32 ASP A CB     1  
ATOM 2116  C CG     . ASP C 3 32 ? 12.414  -3.203  14.030  1.00 3.53  ? 32 ASP A CG     1  
ATOM 2117  O OD1    . ASP C 3 32 ? 12.754  -3.741  12.960  1.00 3.52  ? 32 ASP A OD1    1  
ATOM 2118  O OD2    . ASP C 3 32 ? 11.231  -3.195  14.432  1.00 3.98  ? 32 ASP A OD2    1  
ATOM 2119  H H      . ASP C 3 32 ? 12.673  -0.806  12.759  1.00 2.94  ? 32 ASP A H      1  
ATOM 2120  H HA     . ASP C 3 32 ? 14.551  -0.700  15.017  1.00 3.43  ? 32 ASP A HA     1  
ATOM 2121  H HB2    . ASP C 3 32 ? 14.245  -3.275  15.086  1.00 3.82  ? 32 ASP A HB2    1  
ATOM 2122  H HB3    . ASP C 3 32 ? 13.017  -2.261  15.828  1.00 3.27  ? 32 ASP A HB3    1  
ATOM 2123  N N      . ALA C 3 33 ? 15.997  -2.683  13.614  1.00 2.86  ? 33 ALA A N      1  
ATOM 2124  C CA     . ALA C 3 33 ? 17.081  -3.132  12.755  1.00 2.64  ? 33 ALA A CA     1  
ATOM 2125  C C      . ALA C 3 33 ? 16.750  -4.462  12.090  1.00 2.57  ? 33 ALA A C      1  
ATOM 2126  O O      . ALA C 3 33 ? 16.242  -5.384  12.732  1.00 2.95  ? 33 ALA A O      1  
ATOM 2127  C CB     . ALA C 3 33 ? 18.376  -3.236  13.550  1.00 2.88  ? 33 ALA A CB     1  
ATOM 2128  H H      . ALA C 3 33 ? 15.854  -3.126  14.478  1.00 3.19  ? 33 ALA A H      1  
ATOM 2129  H HA     . ALA C 3 33 ? 17.221  -2.391  11.986  1.00 2.49  ? 33 ALA A HA     1  
ATOM 2130  H HB1    . ALA C 3 33 ? 19.193  -3.465  12.882  1.00 3.39  ? 33 ALA A HB1    1  
ATOM 2131  H HB2    . ALA C 3 33 ? 18.284  -4.019  14.288  1.00 2.91  ? 33 ALA A HB2    1  
ATOM 2132  H HB3    . ALA C 3 33 ? 18.570  -2.296  14.047  1.00 3.02  ? 33 ALA A HB3    1  
ATOM 2133  N N      . LEU C 3 34 ? 17.046  -4.554  10.801  1.00 2.26  ? 34 LEU A N      1  
ATOM 2134  C CA     . LEU C 3 34 ? 16.789  -5.766  10.041  1.00 2.32  ? 34 LEU A CA     1  
ATOM 2135  C C      . LEU C 3 34 ? 18.103  -6.409  9.618   1.00 2.39  ? 34 LEU A C      1  
ATOM 2136  O O      . LEU C 3 34 ? 19.064  -5.710  9.282   1.00 2.36  ? 34 LEU A O      1  
ATOM 2137  C CB     . LEU C 3 34 ? 15.934  -5.461  8.808   1.00 2.27  ? 34 LEU A CB     1  
ATOM 2138  C CG     . LEU C 3 34 ? 14.429  -5.683  8.987   1.00 2.34  ? 34 LEU A CG     1  
ATOM 2139  C CD1    . LEU C 3 34 ? 13.820  -4.616  9.880   1.00 2.42  ? 34 LEU A CD1    1  
ATOM 2140  C CD2    . LEU C 3 34 ? 13.731  -5.706  7.639   1.00 2.95  ? 34 LEU A CD2    1  
ATOM 2141  H H      . LEU C 3 34 ? 17.466  -3.787  10.348  1.00 2.12  ? 34 LEU A H      1  
ATOM 2142  H HA     . LEU C 3 34 ? 16.252  -6.452  10.682  1.00 2.54  ? 34 LEU A HA     1  
ATOM 2143  H HB2    . LEU C 3 34 ? 16.097  -4.429  8.529   1.00 2.14  ? 34 LEU A HB2    1  
ATOM 2144  H HB3    . LEU C 3 34 ? 16.270  -6.090  8.000   1.00 2.63  ? 34 LEU A HB3    1  
ATOM 2145  H HG     . LEU C 3 34 ? 14.270  -6.640  9.461   1.00 2.59  ? 34 LEU A HG     1  
ATOM 2146  H HD11   . LEU C 3 34 ? 12.765  -4.814  10.005  1.00 2.71  ? 34 LEU A HD11   1  
ATOM 2147  H HD12   . LEU C 3 34 ? 13.953  -3.646  9.427   1.00 2.88  ? 34 LEU A HD12   1  
ATOM 2148  H HD13   . LEU C 3 34 ? 14.305  -4.634  10.845  1.00 2.55  ? 34 LEU A HD13   1  
ATOM 2149  H HD21   . LEU C 3 34 ? 13.872  -4.756  7.144   1.00 3.37  ? 34 LEU A HD21   1  
ATOM 2150  H HD22   . LEU C 3 34 ? 12.676  -5.886  7.783   1.00 3.24  ? 34 LEU A HD22   1  
ATOM 2151  H HD23   . LEU C 3 34 ? 14.151  -6.495  7.032   1.00 3.24  ? 34 LEU A HD23   1  
ATOM 2152  N N      . GLU C 3 35 ? 18.144  -7.734  9.647   1.00 2.56  ? 35 GLU A N      1  
ATOM 2153  C CA     . GLU C 3 35 ? 19.337  -8.476  9.272   1.00 2.71  ? 35 GLU A CA     1  
ATOM 2154  C C      . GLU C 3 35 ? 19.544  -8.409  7.766   1.00 2.54  ? 35 GLU A C      1  
ATOM 2155  O O      . GLU C 3 35 ? 18.613  -8.637  6.992   1.00 2.56  ? 35 GLU A O      1  
ATOM 2156  C CB     . GLU C 3 35 ? 19.227  -9.941  9.710   1.00 3.09  ? 35 GLU A CB     1  
ATOM 2157  C CG     . GLU C 3 35 ? 19.071  -10.122 11.211  1.00 3.03  ? 35 GLU A CG     1  
ATOM 2158  C CD     . GLU C 3 35 ? 19.326  -11.547 11.659  1.00 3.26  ? 35 GLU A CD     1  
ATOM 2159  O OE1    . GLU C 3 35 ? 18.418  -12.392 11.524  1.00 3.51  ? 35 GLU A OE1    1  
ATOM 2160  O OE2    . GLU C 3 35 ? 20.440  -11.831 12.152  1.00 3.42  ? 35 GLU A OE2    1  
ATOM 2161  H H      . GLU C 3 35 ? 17.337  -8.230  9.902   1.00 2.63  ? 35 GLU A H      1  
ATOM 2162  H HA     . GLU C 3 35 ? 20.185  -8.021  9.763   1.00 2.73  ? 35 GLU A HA     1  
ATOM 2163  H HB2    . GLU C 3 35 ? 18.368  -10.384 9.225   1.00 3.47  ? 35 GLU A HB2    1  
ATOM 2164  H HB3    . GLU C 3 35 ? 20.117  -10.466 9.394   1.00 3.37  ? 35 GLU A HB3    1  
ATOM 2165  H HG2    . GLU C 3 35 ? 19.769  -9.471  11.716  1.00 3.01  ? 35 GLU A HG2    1  
ATOM 2166  H HG3    . GLU C 3 35 ? 18.063  -9.850  11.487  1.00 3.31  ? 35 GLU A HG3    1  
ATOM 2167  N N      . ILE C 3 36 ? 20.762  -8.088  7.364   1.00 2.46  ? 36 ILE A N      1  
ATOM 2168  C CA     . ILE C 3 36 ? 21.103  -7.986  5.957   1.00 2.36  ? 36 ILE A CA     1  
ATOM 2169  C C      . ILE C 3 36 ? 22.354  -8.802  5.664   1.00 2.57  ? 36 ILE A C      1  
ATOM 2170  O O      . ILE C 3 36 ? 23.467  -8.391  6.012   1.00 2.75  ? 36 ILE A O      1  
ATOM 2171  C CB     . ILE C 3 36 ? 21.344  -6.520  5.531   1.00 2.21  ? 36 ILE A CB     1  
ATOM 2172  C CG1    . ILE C 3 36 ? 20.126  -5.652  5.856   1.00 2.05  ? 36 ILE A CG1    1  
ATOM 2173  C CG2    . ILE C 3 36 ? 21.666  -6.444  4.044   1.00 2.44  ? 36 ILE A CG2    1  
ATOM 2174  C CD1    . ILE C 3 36 ? 20.364  -4.174  5.651   1.00 2.06  ? 36 ILE A CD1    1  
ATOM 2175  H H      . ILE C 3 36 ? 21.458  -7.929  8.036   1.00 2.55  ? 36 ILE A H      1  
ATOM 2176  H HA     . ILE C 3 36 ? 20.278  -8.382  5.379   1.00 2.30  ? 36 ILE A HA     1  
ATOM 2177  H HB     . ILE C 3 36 ? 22.198  -6.148  6.076   1.00 2.32  ? 36 ILE A HB     1  
ATOM 2178  H HG12   . ILE C 3 36 ? 19.306  -5.943  5.219   1.00 2.16  ? 36 ILE A HG12   1  
ATOM 2179  H HG13   . ILE C 3 36 ? 19.846  -5.805  6.889   1.00 2.09  ? 36 ILE A HG13   1  
ATOM 2180  H HG21   . ILE C 3 36 ? 22.601  -6.947  3.854   1.00 2.74  ? 36 ILE A HG21   1  
ATOM 2181  H HG22   . ILE C 3 36 ? 21.744  -5.409  3.746   1.00 2.44  ? 36 ILE A HG22   1  
ATOM 2182  H HG23   . ILE C 3 36 ? 20.880  -6.923  3.481   1.00 2.87  ? 36 ILE A HG23   1  
ATOM 2183  H HD11   . ILE C 3 36 ? 21.261  -3.878  6.174   1.00 2.27  ? 36 ILE A HD11   1  
ATOM 2184  H HD12   . ILE C 3 36 ? 19.523  -3.617  6.037   1.00 2.29  ? 36 ILE A HD12   1  
ATOM 2185  H HD13   . ILE C 3 36 ? 20.478  -3.972  4.597   1.00 2.18  ? 36 ILE A HD13   1  
ATOM 2186  N N      . TYR C 3 37 ? 22.167  -9.967  5.058   1.00 2.61  ? 37 TYR A N      1  
ATOM 2187  C CA     . TYR C 3 37 ? 23.288  -10.833 4.712   1.00 2.85  ? 37 TYR A CA     1  
ATOM 2188  C C      . TYR C 3 37 ? 23.574  -10.751 3.215   1.00 2.71  ? 37 TYR A C      1  
ATOM 2189  O O      . TYR C 3 37 ? 22.668  -10.901 2.397   1.00 2.62  ? 37 TYR A O      1  
ATOM 2190  C CB     . TYR C 3 37 ? 22.999  -12.284 5.118   1.00 3.15  ? 37 TYR A CB     1  
ATOM 2191  C CG     . TYR C 3 37 ? 24.171  -13.222 4.903   1.00 3.72  ? 37 TYR A CG     1  
ATOM 2192  C CD1    . TYR C 3 37 ? 25.153  -13.370 5.876   1.00 3.83  ? 37 TYR A CD1    1  
ATOM 2193  C CD2    . TYR C 3 37 ? 24.301  -13.949 3.724   1.00 4.42  ? 37 TYR A CD2    1  
ATOM 2194  C CE1    . TYR C 3 37 ? 26.228  -14.215 5.680   1.00 4.59  ? 37 TYR A CE1    1  
ATOM 2195  C CE2    . TYR C 3 37 ? 25.376  -14.792 3.522   1.00 5.19  ? 37 TYR A CE2    1  
ATOM 2196  C CZ     . TYR C 3 37 ? 26.337  -14.921 4.503   1.00 5.25  ? 37 TYR A CZ     1  
ATOM 2197  O OH     . TYR C 3 37 ? 27.413  -15.755 4.299   1.00 6.13  ? 37 TYR A OH     1  
ATOM 2198  H H      . TYR C 3 37 ? 21.249  -10.251 4.839   1.00 2.52  ? 37 TYR A H      1  
ATOM 2199  H HA     . TYR C 3 37 ? 24.154  -10.481 5.251   1.00 2.97  ? 37 TYR A HA     1  
ATOM 2200  H HB2    . TYR C 3 37 ? 22.741  -12.312 6.166   1.00 3.21  ? 37 TYR A HB2    1  
ATOM 2201  H HB3    . TYR C 3 37 ? 22.167  -12.652 4.538   1.00 3.22  ? 37 TYR A HB3    1  
ATOM 2202  H HD1    . TYR C 3 37 ? 25.065  -12.817 6.799   1.00 3.50  ? 37 TYR A HD1    1  
ATOM 2203  H HD2    . TYR C 3 37 ? 23.547  -13.847 2.959   1.00 4.50  ? 37 TYR A HD2    1  
ATOM 2204  H HE1    . TYR C 3 37 ? 26.981  -14.317 6.448   1.00 4.79  ? 37 TYR A HE1    1  
ATOM 2205  H HE2    . TYR C 3 37 ? 25.459  -15.349 2.599   1.00 5.83  ? 37 TYR A HE2    1  
ATOM 2206  H HH     . TYR C 3 37 ? 27.851  -15.516 3.471   1.00 6.41  ? 37 TYR A HH     1  
ATOM 2207  N N      . VAL C 3 38 ? 24.828  -10.514 2.863   1.00 2.76  ? 38 VAL A N      1  
ATOM 2208  C CA     . VAL C 3 38 ? 25.218  -10.404 1.465   1.00 2.73  ? 38 VAL A CA     1  
ATOM 2209  C C      . VAL C 3 38 ? 25.641  -11.762 0.911   1.00 2.96  ? 38 VAL A C      1  
ATOM 2210  O O      . VAL C 3 38 ? 26.527  -12.419 1.460   1.00 3.18  ? 38 VAL A O      1  
ATOM 2211  C CB     . VAL C 3 38 ? 26.372  -9.397  1.277   1.00 2.80  ? 38 VAL A CB     1  
ATOM 2212  C CG1    . VAL C 3 38 ? 26.583  -9.091  -0.200  1.00 3.00  ? 38 VAL A CG1    1  
ATOM 2213  C CG2    . VAL C 3 38 ? 26.102  -8.121  2.061   1.00 2.86  ? 38 VAL A CG2    1  
ATOM 2214  H H      . VAL C 3 38 ? 25.515  -10.420 3.561   1.00 2.88  ? 38 VAL A H      1  
ATOM 2215  H HA     . VAL C 3 38 ? 24.364  -10.050 0.908   1.00 2.55  ? 38 VAL A HA     1  
ATOM 2216  H HB     . VAL C 3 38 ? 27.277  -9.844  1.662   1.00 3.11  ? 38 VAL A HB     1  
ATOM 2217  H HG11   . VAL C 3 38 ? 27.390  -8.383  -0.310  1.00 3.14  ? 38 VAL A HG11   1  
ATOM 2218  H HG12   . VAL C 3 38 ? 25.677  -8.673  -0.614  1.00 3.15  ? 38 VAL A HG12   1  
ATOM 2219  H HG13   . VAL C 3 38 ? 26.830  -10.004 -0.725  1.00 3.43  ? 38 VAL A HG13   1  
ATOM 2220  H HG21   . VAL C 3 38 ? 25.981  -8.361  3.108   1.00 2.95  ? 38 VAL A HG21   1  
ATOM 2221  H HG22   . VAL C 3 38 ? 25.201  -7.656  1.692   1.00 3.04  ? 38 VAL A HG22   1  
ATOM 2222  H HG23   . VAL C 3 38 ? 26.934  -7.441  1.943   1.00 3.23  ? 38 VAL A HG23   1  
ATOM 2223  N N      . ASP C 3 39 ? 24.994  -12.183 -0.165  1.00 2.96  ? 39 ASP A N      1  
ATOM 2224  C CA     . ASP C 3 39 ? 25.302  -13.456 -0.798  1.00 3.23  ? 39 ASP A CA     1  
ATOM 2225  C C      . ASP C 3 39 ? 25.574  -13.255 -2.287  1.00 3.17  ? 39 ASP A C      1  
ATOM 2226  O O      . ASP C 3 39 ? 24.656  -13.294 -3.109  1.00 2.95  ? 39 ASP A O      1  
ATOM 2227  C CB     . ASP C 3 39 ? 24.158  -14.453 -0.590  1.00 3.30  ? 39 ASP A CB     1  
ATOM 2228  C CG     . ASP C 3 39 ? 24.413  -15.780 -1.280  1.00 3.45  ? 39 ASP A CG     1  
ATOM 2229  O OD1    . ASP C 3 39 ? 25.329  -16.512 -0.855  1.00 3.68  ? 39 ASP A OD1    1  
ATOM 2230  O OD2    . ASP C 3 39 ? 23.687  -16.106 -2.243  1.00 3.49  ? 39 ASP A OD2    1  
ATOM 2231  H H      . ASP C 3 39 ? 24.280  -11.619 -0.550  1.00 2.80  ? 39 ASP A H      1  
ATOM 2232  H HA     . ASP C 3 39 ? 26.195  -13.846 -0.335  1.00 3.52  ? 39 ASP A HA     1  
ATOM 2233  H HB2    . ASP C 3 39 ? 24.041  -14.639 0.468   1.00 3.52  ? 39 ASP A HB2    1  
ATOM 2234  H HB3    . ASP C 3 39 ? 23.243  -14.031 -0.982  1.00 3.21  ? 39 ASP A HB3    1  
ATOM 2235  N N      . ASP C 3 40 ? 26.842  -13.009 -2.606  1.00 3.47  ? 40 ASP A N      1  
ATOM 2236  C CA     . ASP C 3 40 ? 27.303  -12.793 -3.981  1.00 3.59  ? 40 ASP A CA     1  
ATOM 2237  C C      . ASP C 3 40 ? 26.725  -11.513 -4.581  1.00 3.42  ? 40 ASP A C      1  
ATOM 2238  O O      . ASP C 3 40 ? 27.372  -10.465 -4.560  1.00 3.67  ? 40 ASP A O      1  
ATOM 2239  C CB     . ASP C 3 40 ? 26.970  -13.992 -4.872  1.00 3.58  ? 40 ASP A CB     1  
ATOM 2240  C CG     . ASP C 3 40 ? 28.117  -14.356 -5.789  1.00 3.92  ? 40 ASP A CG     1  
ATOM 2241  O OD1    . ASP C 3 40 ? 28.354  -13.630 -6.778  1.00 4.28  ? 40 ASP A OD1    1  
ATOM 2242  O OD2    . ASP C 3 40 ? 28.782  -15.383 -5.531  1.00 4.13  ? 40 ASP A OD2    1  
ATOM 2243  H H      . ASP C 3 40 ? 27.503  -12.971 -1.884  1.00 3.67  ? 40 ASP A H      1  
ATOM 2244  H HA     . ASP C 3 40 ? 28.376  -12.686 -3.941  1.00 3.94  ? 40 ASP A HA     1  
ATOM 2245  H HB2    . ASP C 3 40 ? 26.745  -14.846 -4.250  1.00 3.56  ? 40 ASP A HB2    1  
ATOM 2246  H HB3    . ASP C 3 40 ? 26.109  -13.757 -5.478  1.00 3.58  ? 40 ASP A HB3    1  
ATOM 2247  N N      . GLU C 3 41 ? 25.512  -11.598 -5.113  1.00 3.09  ? 41 GLU A N      1  
ATOM 2248  C CA     . GLU C 3 41 ? 24.858  -10.446 -5.719  1.00 2.97  ? 41 GLU A CA     1  
ATOM 2249  C C      . GLU C 3 41 ? 23.450  -10.262 -5.167  1.00 2.57  ? 41 GLU A C      1  
ATOM 2250  O O      . GLU C 3 41 ? 22.686  -9.426  -5.651  1.00 2.46  ? 41 GLU A O      1  
ATOM 2251  C CB     . GLU C 3 41 ? 24.813  -10.585 -7.249  1.00 3.05  ? 41 GLU A CB     1  
ATOM 2252  C CG     . GLU C 3 41 ? 24.751  -12.023 -7.750  1.00 2.79  ? 41 GLU A CG     1  
ATOM 2253  C CD     . GLU C 3 41 ? 23.509  -12.762 -7.294  1.00 2.87  ? 41 GLU A CD     1  
ATOM 2254  O OE1    . GLU C 3 41 ? 22.436  -12.564 -7.900  1.00 3.04  ? 41 GLU A OE1    1  
ATOM 2255  O OE2    . GLU C 3 41 ? 23.608  -13.562 -6.335  1.00 3.17  ? 41 GLU A OE2    1  
ATOM 2256  H H      . GLU C 3 41 ? 25.040  -12.459 -5.095  1.00 3.00  ? 41 GLU A H      1  
ATOM 2257  H HA     . GLU C 3 41 ? 25.440  -9.571  -5.468  1.00 3.21  ? 41 GLU A HA     1  
ATOM 2258  H HB2    . GLU C 3 41 ? 23.940  -10.065 -7.619  1.00 2.99  ? 41 GLU A HB2    1  
ATOM 2259  H HB3    . GLU C 3 41 ? 25.695  -10.121 -7.665  1.00 3.57  ? 41 GLU A HB3    1  
ATOM 2260  H HG2    . GLU C 3 41 ? 24.764  -12.013 -8.829  1.00 3.17  ? 41 GLU A HG2    1  
ATOM 2261  H HG3    . GLU C 3 41 ? 25.620  -12.552 -7.387  1.00 2.71  ? 41 GLU A HG3    1  
ATOM 2262  N N      . LYS C 3 42 ? 23.109  -11.043 -4.155  1.00 2.46  ? 42 LYS A N      1  
ATOM 2263  C CA     . LYS C 3 42 ? 21.796  -10.957 -3.544  1.00 2.19  ? 42 LYS A CA     1  
ATOM 2264  C C      . LYS C 3 42 ? 21.941  -10.682 -2.053  1.00 2.18  ? 42 LYS A C      1  
ATOM 2265  O O      . LYS C 3 42 ? 22.942  -11.051 -1.444  1.00 2.40  ? 42 LYS A O      1  
ATOM 2266  C CB     . LYS C 3 42 ? 20.998  -12.249 -3.785  1.00 2.18  ? 42 LYS A CB     1  
ATOM 2267  C CG     . LYS C 3 42 ? 21.454  -13.426 -2.938  1.00 2.55  ? 42 LYS A CG     1  
ATOM 2268  C CD     . LYS C 3 42 ? 20.748  -14.715 -3.330  1.00 2.38  ? 42 LYS A CD     1  
ATOM 2269  C CE     . LYS C 3 42 ? 21.271  -15.272 -4.647  1.00 2.67  ? 42 LYS A CE     1  
ATOM 2270  N NZ     . LYS C 3 42 ? 22.750  -15.404 -4.644  1.00 2.91  ? 42 LYS A NZ     1  
ATOM 2271  H H      . LYS C 3 42 ? 23.763  -11.684 -3.800  1.00 2.65  ? 42 LYS A H      1  
ATOM 2272  H HA     . LYS C 3 42 ? 21.273  -10.129 -4.002  1.00 2.12  ? 42 LYS A HA     1  
ATOM 2273  H HB2    . LYS C 3 42 ? 19.957  -12.061 -3.565  1.00 2.34  ? 42 LYS A HB2    1  
ATOM 2274  H HB3    . LYS C 3 42 ? 21.091  -12.527 -4.825  1.00 2.28  ? 42 LYS A HB3    1  
ATOM 2275  H HG2    . LYS C 3 42 ? 22.518  -13.558 -3.069  1.00 2.96  ? 42 LYS A HG2    1  
ATOM 2276  H HG3    . LYS C 3 42 ? 21.240  -13.212 -1.901  1.00 3.17  ? 42 LYS A HG3    1  
ATOM 2277  H HD2    . LYS C 3 42 ? 20.909  -15.448 -2.555  1.00 2.81  ? 42 LYS A HD2    1  
ATOM 2278  H HD3    . LYS C 3 42 ? 19.690  -14.520 -3.427  1.00 2.34  ? 42 LYS A HD3    1  
ATOM 2279  H HE2    . LYS C 3 42 ? 20.835  -16.246 -4.808  1.00 2.79  ? 42 LYS A HE2    1  
ATOM 2280  H HE3    . LYS C 3 42 ? 20.978  -14.609 -5.449  1.00 3.18  ? 42 LYS A HE3    1  
ATOM 2281  H HZ1    . LYS C 3 42 ? 23.101  -15.500 -3.664  1.00 2.95  ? 42 LYS A HZ1    1  
ATOM 2282  H HZ2    . LYS C 3 42 ? 23.190  -14.561 -5.082  1.00 3.14  ? 42 LYS A HZ2    1  
ATOM 2283  H HZ3    . LYS C 3 42 ? 23.034  -16.245 -5.183  1.00 3.37  ? 42 LYS A HZ3    1  
ATOM 2284  N N      . ILE C 3 43 ? 20.959  -10.018 -1.473  1.00 2.00  ? 43 ILE A N      1  
ATOM 2285  C CA     . ILE C 3 43 ? 20.994  -9.704  -0.053  1.00 2.02  ? 43 ILE A CA     1  
ATOM 2286  C C      . ILE C 3 43 ? 19.751  -10.237 0.642   1.00 2.02  ? 43 ILE A C      1  
ATOM 2287  O O      . ILE C 3 43 ? 18.626  -10.011 0.192   1.00 1.94  ? 43 ILE A O      1  
ATOM 2288  C CB     . ILE C 3 43 ? 21.124  -8.184  0.205   1.00 1.95  ? 43 ILE A CB     1  
ATOM 2289  C CG1    . ILE C 3 43 ? 20.182  -7.394  -0.711  1.00 1.91  ? 43 ILE A CG1    1  
ATOM 2290  C CG2    . ILE C 3 43 ? 22.567  -7.738  0.013   1.00 2.26  ? 43 ILE A CG2    1  
ATOM 2291  C CD1    . ILE C 3 43 ? 20.235  -5.898  -0.495  1.00 1.91  ? 43 ILE A CD1    1  
ATOM 2292  H H      . ILE C 3 43 ? 20.183  -9.734  -2.012  1.00 1.90  ? 43 ILE A H      1  
ATOM 2293  H HA     . ILE C 3 43 ? 21.863  -10.191 0.368   1.00 2.17  ? 43 ILE A HA     1  
ATOM 2294  H HB     . ILE C 3 43 ? 20.852  -7.994  1.233   1.00 2.11  ? 43 ILE A HB     1  
ATOM 2295  H HG12   . ILE C 3 43 ? 20.445  -7.588  -1.740  1.00 2.12  ? 43 ILE A HG12   1  
ATOM 2296  H HG13   . ILE C 3 43 ? 19.167  -7.717  -0.534  1.00 2.08  ? 43 ILE A HG13   1  
ATOM 2297  H HG21   . ILE C 3 43 ? 22.920  -8.070  -0.952  1.00 2.57  ? 43 ILE A HG21   1  
ATOM 2298  H HG22   . ILE C 3 43 ? 23.184  -8.166  0.789   1.00 2.60  ? 43 ILE A HG22   1  
ATOM 2299  H HG23   . ILE C 3 43 ? 22.620  -6.660  0.065   1.00 2.52  ? 43 ILE A HG23   1  
ATOM 2300  H HD11   . ILE C 3 43 ? 19.560  -5.407  -1.182  1.00 2.09  ? 43 ILE A HD11   1  
ATOM 2301  H HD12   . ILE C 3 43 ? 21.241  -5.546  -0.665  1.00 2.07  ? 43 ILE A HD12   1  
ATOM 2302  H HD13   . ILE C 3 43 ? 19.942  -5.672  0.518   1.00 2.23  ? 43 ILE A HD13   1  
ATOM 2303  N N      . ILE C 3 44 ? 19.961  -10.963 1.726   1.00 2.17  ? 44 ILE A N      1  
ATOM 2304  C CA     . ILE C 3 44 ? 18.866  -11.535 2.488   1.00 2.25  ? 44 ILE A CA     1  
ATOM 2305  C C      . ILE C 3 44 ? 18.435  -10.580 3.590   1.00 2.25  ? 44 ILE A C      1  
ATOM 2306  O O      . ILE C 3 44 ? 19.178  -10.345 4.547   1.00 2.37  ? 44 ILE A O      1  
ATOM 2307  C CB     . ILE C 3 44 ? 19.259  -12.893 3.111   1.00 2.49  ? 44 ILE A CB     1  
ATOM 2308  C CG1    . ILE C 3 44 ? 19.856  -13.818 2.042   1.00 2.52  ? 44 ILE A CG1    1  
ATOM 2309  C CG2    . ILE C 3 44 ? 18.049  -13.547 3.766   1.00 2.65  ? 44 ILE A CG2    1  
ATOM 2310  C CD1    . ILE C 3 44 ? 20.499  -15.069 2.605   1.00 3.10  ? 44 ILE A CD1    1  
ATOM 2311  H H      . ILE C 3 44 ? 20.887  -11.115 2.029   1.00 2.27  ? 44 ILE A H      1  
ATOM 2312  H HA     . ILE C 3 44 ? 18.035  -11.693 1.817   1.00 2.19  ? 44 ILE A HA     1  
ATOM 2313  H HB     . ILE C 3 44 ? 19.998  -12.712 3.877   1.00 2.56  ? 44 ILE A HB     1  
ATOM 2314  H HG12   . ILE C 3 44 ? 19.072  -14.125 1.366   1.00 2.33  ? 44 ILE A HG12   1  
ATOM 2315  H HG13   . ILE C 3 44 ? 20.610  -13.277 1.488   1.00 2.50  ? 44 ILE A HG13   1  
ATOM 2316  H HG21   . ILE C 3 44 ? 17.230  -13.572 3.063   1.00 2.65  ? 44 ILE A HG21   1  
ATOM 2317  H HG22   . ILE C 3 44 ? 17.758  -12.977 4.635   1.00 3.05  ? 44 ILE A HG22   1  
ATOM 2318  H HG23   . ILE C 3 44 ? 18.299  -14.555 4.063   1.00 2.80  ? 44 ILE A HG23   1  
ATOM 2319  H HD11   . ILE C 3 44 ? 21.231  -14.796 3.350   1.00 3.42  ? 44 ILE A HD11   1  
ATOM 2320  H HD12   . ILE C 3 44 ? 20.984  -15.613 1.809   1.00 3.51  ? 44 ILE A HD12   1  
ATOM 2321  H HD13   . ILE C 3 44 ? 19.739  -15.690 3.057   1.00 3.28  ? 44 ILE A HD13   1  
ATOM 2322  N N      . LEU C 3 45 ? 17.247  -10.013 3.426   1.00 2.16  ? 45 LEU A N      1  
ATOM 2323  C CA     . LEU C 3 45 ? 16.693  -9.084  4.398   1.00 2.18  ? 45 LEU A CA     1  
ATOM 2324  C C      . LEU C 3 45 ? 15.641  -9.779  5.247   1.00 2.40  ? 45 LEU A C      1  
ATOM 2325  O O      . LEU C 3 45 ? 14.644  -10.282 4.727   1.00 2.44  ? 45 LEU A O      1  
ATOM 2326  C CB     . LEU C 3 45 ? 16.066  -7.884  3.692   1.00 2.04  ? 45 LEU A CB     1  
ATOM 2327  C CG     . LEU C 3 45 ? 16.965  -6.655  3.556   1.00 1.73  ? 45 LEU A CG     1  
ATOM 2328  C CD1    . LEU C 3 45 ? 18.171  -6.951  2.682   1.00 2.00  ? 45 LEU A CD1    1  
ATOM 2329  C CD2    . LEU C 3 45 ? 16.173  -5.492  2.988   1.00 2.05  ? 45 LEU A CD2    1  
ATOM 2330  H H      . LEU C 3 45 ? 16.722  -10.222 2.619   1.00 2.12  ? 45 LEU A H      1  
ATOM 2331  H HA     . LEU C 3 45 ? 17.497  -8.743  5.034   1.00 2.20  ? 45 LEU A HA     1  
ATOM 2332  H HB2    . LEU C 3 45 ? 15.765  -8.194  2.702   1.00 2.22  ? 45 LEU A HB2    1  
ATOM 2333  H HB3    . LEU C 3 45 ? 15.184  -7.594  4.243   1.00 2.29  ? 45 LEU A HB3    1  
ATOM 2334  H HG     . LEU C 3 45 ? 17.323  -6.371  4.533   1.00 1.92  ? 45 LEU A HG     1  
ATOM 2335  H HD11   . LEU C 3 45 ? 18.756  -7.740  3.130   1.00 2.58  ? 45 LEU A HD11   1  
ATOM 2336  H HD12   . LEU C 3 45 ? 18.774  -6.060  2.588   1.00 2.44  ? 45 LEU A HD12   1  
ATOM 2337  H HD13   . LEU C 3 45 ? 17.835  -7.263  1.704   1.00 2.03  ? 45 LEU A HD13   1  
ATOM 2338  H HD21   . LEU C 3 45 ? 15.636  -5.819  2.111   1.00 2.36  ? 45 LEU A HD21   1  
ATOM 2339  H HD22   . LEU C 3 45 ? 16.849  -4.694  2.718   1.00 2.44  ? 45 LEU A HD22   1  
ATOM 2340  H HD23   . LEU C 3 45 ? 15.471  -5.138  3.728   1.00 2.33  ? 45 LEU A HD23   1  
ATOM 2341  N N      . LYS C 3 46 ? 15.855  -9.809  6.550   1.00 2.58  ? 46 LYS A N      1  
ATOM 2342  C CA     . LYS C 3 46 ? 14.915  -10.451 7.451   1.00 2.82  ? 46 LYS A CA     1  
ATOM 2343  C C      . LYS C 3 46 ? 15.063  -9.904  8.863   1.00 2.81  ? 46 LYS A C      1  
ATOM 2344  O O      . LYS C 3 46 ? 15.939  -9.091  9.131   1.00 2.75  ? 46 LYS A O      1  
ATOM 2345  C CB     . LYS C 3 46 ? 15.143  -11.967 7.456   1.00 3.13  ? 46 LYS A CB     1  
ATOM 2346  C CG     . LYS C 3 46 ? 16.479  -12.374 8.053   1.00 3.35  ? 46 LYS A CG     1  
ATOM 2347  C CD     . LYS C 3 46 ? 16.727  -13.866 7.906   1.00 3.93  ? 46 LYS A CD     1  
ATOM 2348  C CE     . LYS C 3 46 ? 17.611  -14.399 9.023   1.00 4.67  ? 46 LYS A CE     1  
ATOM 2349  N NZ     . LYS C 3 46 ? 16.980  -14.241 10.361  1.00 5.39  ? 46 LYS A NZ     1  
ATOM 2350  H H      . LYS C 3 46 ? 16.665  -9.385  6.917   1.00 2.58  ? 46 LYS A H      1  
ATOM 2351  H HA     . LYS C 3 46 ? 13.918  -10.245 7.095   1.00 2.86  ? 46 LYS A HA     1  
ATOM 2352  H HB2    . LYS C 3 46 ? 14.358  -12.436 8.031   1.00 3.28  ? 46 LYS A HB2    1  
ATOM 2353  H HB3    . LYS C 3 46 ? 15.101  -12.333 6.440   1.00 3.44  ? 46 LYS A HB3    1  
ATOM 2354  H HG2    . LYS C 3 46 ? 17.266  -11.835 7.547   1.00 3.43  ? 46 LYS A HG2    1  
ATOM 2355  H HG3    . LYS C 3 46 ? 16.482  -12.118 9.103   1.00 3.46  ? 46 LYS A HG3    1  
ATOM 2356  H HD2    . LYS C 3 46 ? 15.780  -14.381 7.932   1.00 4.11  ? 46 LYS A HD2    1  
ATOM 2357  H HD3    . LYS C 3 46 ? 17.212  -14.048 6.958   1.00 4.05  ? 46 LYS A HD3    1  
ATOM 2358  H HE2    . LYS C 3 46 ? 17.800  -15.446 8.845   1.00 4.68  ? 46 LYS A HE2    1  
ATOM 2359  H HE3    . LYS C 3 46 ? 18.547  -13.858 9.010   1.00 5.02  ? 46 LYS A HE3    1  
ATOM 2360  H HZ1    . LYS C 3 46 ? 17.356  -13.386 10.835  1.00 5.69  ? 46 LYS A HZ1    1  
ATOM 2361  H HZ2    . LYS C 3 46 ? 17.186  -15.069 10.953  1.00 5.79  ? 46 LYS A HZ2    1  
ATOM 2362  H HZ3    . LYS C 3 46 ? 15.950  -14.146 10.266  1.00 5.54  ? 46 LYS A HZ3    1  
ATOM 2363  N N      . LYS C 3 47 ? 14.197  -10.339 9.758   1.00 2.96  ? 47 LYS A N      1  
ATOM 2364  C CA     . LYS C 3 47 ? 14.262  -9.911  11.142  1.00 3.04  ? 47 LYS A CA     1  
ATOM 2365  C C      . LYS C 3 47 ? 14.910  -11.011 11.970  1.00 3.03  ? 47 LYS A C      1  
ATOM 2366  O O      . LYS C 3 47 ? 15.236  -12.073 11.435  1.00 3.11  ? 47 LYS A O      1  
ATOM 2367  C CB     . LYS C 3 47 ? 12.866  -9.567  11.668  1.00 3.21  ? 47 LYS A CB     1  
ATOM 2368  C CG     . LYS C 3 47 ? 12.421  -8.159  11.296  1.00 3.01  ? 47 LYS A CG     1  
ATOM 2369  C CD     . LYS C 3 47 ? 10.962  -7.917  11.645  1.00 3.27  ? 47 LYS A CD     1  
ATOM 2370  C CE     . LYS C 3 47 ? 10.635  -6.431  11.705  1.00 3.39  ? 47 LYS A CE     1  
ATOM 2371  N NZ     . LYS C 3 47 ? 11.140  -5.801  12.953  1.00 4.14  ? 47 LYS A NZ     1  
ATOM 2372  H H      . LYS C 3 47 ? 13.505  -10.974 9.484   1.00 3.08  ? 47 LYS A H      1  
ATOM 2373  H HA     . LYS C 3 47 ? 14.886  -9.028  11.189  1.00 3.12  ? 47 LYS A HA     1  
ATOM 2374  H HB2    . LYS C 3 47 ? 12.155  -10.270 11.260  1.00 3.49  ? 47 LYS A HB2    1  
ATOM 2375  H HB3    . LYS C 3 47 ? 12.867  -9.650  12.743  1.00 3.60  ? 47 LYS A HB3    1  
ATOM 2376  H HG2    . LYS C 3 47 ? 13.031  -7.444  11.828  1.00 3.20  ? 47 LYS A HG2    1  
ATOM 2377  H HG3    . LYS C 3 47 ? 12.552  -8.024  10.232  1.00 2.96  ? 47 LYS A HG3    1  
ATOM 2378  H HD2    . LYS C 3 47 ? 10.343  -8.379  10.891  1.00 3.46  ? 47 LYS A HD2    1  
ATOM 2379  H HD3    . LYS C 3 47 ? 10.753  -8.361  12.608  1.00 3.71  ? 47 LYS A HD3    1  
ATOM 2380  H HE2    . LYS C 3 47 ? 11.084  -5.940  10.855  1.00 3.29  ? 47 LYS A HE2    1  
ATOM 2381  H HE3    . LYS C 3 47 ? 9.562   -6.314  11.663  1.00 3.58  ? 47 LYS A HE3    1  
ATOM 2382  H HZ1    . LYS C 3 47 ? 10.345  -5.459  13.529  1.00 4.42  ? 47 LYS A HZ1    1  
ATOM 2383  H HZ2    . LYS C 3 47 ? 11.763  -4.988  12.729  1.00 4.42  ? 47 LYS A HZ2    1  
ATOM 2384  H HZ3    . LYS C 3 47 ? 11.682  -6.490  13.511  1.00 4.58  ? 47 LYS A HZ3    1  
ATOM 2385  N N      . TYR C 3 48 ? 15.090  -10.759 13.261  1.00 3.23  ? 48 TYR A N      1  
ATOM 2386  C CA     . TYR C 3 48 ? 15.717  -11.727 14.160  1.00 3.41  ? 48 TYR A CA     1  
ATOM 2387  C C      . TYR C 3 48 ? 14.954  -13.049 14.160  1.00 3.51  ? 48 TYR A C      1  
ATOM 2388  O O      . TYR C 3 48 ? 15.552  -14.128 14.136  1.00 4.04  ? 48 TYR A O      1  
ATOM 2389  C CB     . TYR C 3 48 ? 15.781  -11.158 15.578  1.00 3.76  ? 48 TYR A CB     1  
ATOM 2390  C CG     . TYR C 3 48 ? 16.291  -9.734  15.633  1.00 3.76  ? 48 TYR A CG     1  
ATOM 2391  C CD1    . TYR C 3 48 ? 17.653  -9.467  15.625  1.00 4.27  ? 48 TYR A CD1    1  
ATOM 2392  C CD2    . TYR C 3 48 ? 15.412  -8.658  15.684  1.00 3.81  ? 48 TYR A CD2    1  
ATOM 2393  C CE1    . TYR C 3 48 ? 18.126  -8.170  15.667  1.00 4.75  ? 48 TYR A CE1    1  
ATOM 2394  C CE2    . TYR C 3 48 ? 15.877  -7.358  15.726  1.00 4.24  ? 48 TYR A CE2    1  
ATOM 2395  C CZ     . TYR C 3 48 ? 17.234  -7.119  15.718  1.00 4.67  ? 48 TYR A CZ     1  
ATOM 2396  O OH     . TYR C 3 48 ? 17.700  -5.827  15.761  1.00 5.42  ? 48 TYR A OH     1  
ATOM 2397  H H      . TYR C 3 48 ? 14.789  -9.902  13.625  1.00 3.46  ? 48 TYR A H      1  
ATOM 2398  H HA     . TYR C 3 48 ? 16.722  -11.905 13.806  1.00 3.41  ? 48 TYR A HA     1  
ATOM 2399  H HB2    . TYR C 3 48 ? 14.792  -11.173 16.008  1.00 4.02  ? 48 TYR A HB2    1  
ATOM 2400  H HB3    . TYR C 3 48 ? 16.439  -11.771 16.176  1.00 4.13  ? 48 TYR A HB3    1  
ATOM 2401  H HD1    . TYR C 3 48 ? 18.349  -10.290 15.585  1.00 4.60  ? 48 TYR A HD1    1  
ATOM 2402  H HD2    . TYR C 3 48 ? 14.348  -8.848  15.692  1.00 3.88  ? 48 TYR A HD2    1  
ATOM 2403  H HE1    . TYR C 3 48 ? 19.189  -7.982  15.660  1.00 5.42  ? 48 TYR A HE1    1  
ATOM 2404  H HE2    . TYR C 3 48 ? 15.178  -6.535  15.766  1.00 4.54  ? 48 TYR A HE2    1  
ATOM 2405  H HH     . TYR C 3 48 ? 18.523  -5.768  15.264  1.00 5.69  ? 48 TYR A HH     1  
ATOM 2406  N N      . LYS C 3 49 ? 13.634  -12.958 14.184  1.00 3.27  ? 49 LYS A N      1  
ATOM 2407  C CA     . LYS C 3 49 ? 12.780  -14.135 14.177  1.00 3.48  ? 49 LYS A CA     1  
ATOM 2408  C C      . LYS C 3 49 ? 11.374  -13.757 13.718  1.00 3.56  ? 49 LYS A C      1  
ATOM 2409  O O      . LYS C 3 49 ? 10.473  -13.559 14.535  1.00 3.61  ? 49 LYS A O      1  
ATOM 2410  C CB     . LYS C 3 49 ? 12.737  -14.775 15.573  1.00 3.58  ? 49 LYS A CB     1  
ATOM 2411  C CG     . LYS C 3 49 ? 12.038  -16.124 15.613  1.00 3.53  ? 49 LYS A CG     1  
ATOM 2412  C CD     . LYS C 3 49 ? 12.828  -17.194 14.877  1.00 3.56  ? 49 LYS A CD     1  
ATOM 2413  C CE     . LYS C 3 49 ? 12.011  -18.466 14.700  1.00 4.05  ? 49 LYS A CE     1  
ATOM 2414  N NZ     . LYS C 3 49 ? 12.752  -19.502 13.931  1.00 4.54  ? 49 LYS A NZ     1  
ATOM 2415  H H      . LYS C 3 49 ? 13.218  -12.068 14.206  1.00 3.15  ? 49 LYS A H      1  
ATOM 2416  H HA     . LYS C 3 49 ? 13.196  -14.840 13.475  1.00 3.85  ? 49 LYS A HA     1  
ATOM 2417  H HB2    . LYS C 3 49 ? 13.750  -14.911 15.922  1.00 4.12  ? 49 LYS A HB2    1  
ATOM 2418  H HB3    . LYS C 3 49 ? 12.223  -14.105 16.246  1.00 3.68  ? 49 LYS A HB3    1  
ATOM 2419  H HG2    . LYS C 3 49 ? 11.922  -16.423 16.645  1.00 3.85  ? 49 LYS A HG2    1  
ATOM 2420  H HG3    . LYS C 3 49 ? 11.065  -16.025 15.154  1.00 3.72  ? 49 LYS A HG3    1  
ATOM 2421  H HD2    . LYS C 3 49 ? 13.107  -16.817 13.905  1.00 3.80  ? 49 LYS A HD2    1  
ATOM 2422  H HD3    . LYS C 3 49 ? 13.717  -17.423 15.446  1.00 3.60  ? 49 LYS A HD3    1  
ATOM 2423  H HE2    . LYS C 3 49 ? 11.767  -18.859 15.674  1.00 4.22  ? 49 LYS A HE2    1  
ATOM 2424  H HE3    . LYS C 3 49 ? 11.101  -18.221 14.173  1.00 4.36  ? 49 LYS A HE3    1  
ATOM 2425  H HZ1    . LYS C 3 49 ? 13.565  -19.844 14.482  1.00 4.73  ? 49 LYS A HZ1    1  
ATOM 2426  H HZ2    . LYS C 3 49 ? 13.099  -19.105 13.035  1.00 4.54  ? 49 LYS A HZ2    1  
ATOM 2427  H HZ3    . LYS C 3 49 ? 12.127  -20.307 13.722  1.00 5.07  ? 49 LYS A HZ3    1  
ATOM 2428  N N      . PRO C 3 50 ? 11.168  -13.654 12.397  1.00 3.93  ? 50 PRO A N      1  
ATOM 2429  C CA     . PRO C 3 50 ? 9.880   -13.285 11.825  1.00 4.32  ? 50 PRO A CA     1  
ATOM 2430  C C      . PRO C 3 50 ? 8.911   -14.461 11.773  1.00 4.44  ? 50 PRO A C      1  
ATOM 2431  O O      . PRO C 3 50 ? 7.739   -14.299 11.441  1.00 4.67  ? 50 PRO A O      1  
ATOM 2432  C CB     . PRO C 3 50 ? 10.226  -12.809 10.407  1.00 5.02  ? 50 PRO A CB     1  
ATOM 2433  C CG     . PRO C 3 50 ? 11.702  -13.006 10.236  1.00 4.95  ? 50 PRO A CG     1  
ATOM 2434  C CD     . PRO C 3 50 ? 12.165  -13.893 11.354  1.00 4.35  ? 50 PRO A CD     1  
ATOM 2435  H HA     . PRO C 3 50 ? 9.426   -12.474 12.377  1.00 4.33  ? 50 PRO A HA     1  
ATOM 2436  H HB2    . PRO C 3 50 ? 9.669   -13.389 9.689   1.00 5.51  ? 50 PRO A HB2    1  
ATOM 2437  H HB3    . PRO C 3 50 ? 9.960   -11.767 10.307  1.00 5.30  ? 50 PRO A HB3    1  
ATOM 2438  H HG2    . PRO C 3 50 ? 11.899  -13.476 9.285   1.00 5.33  ? 50 PRO A HG2    1  
ATOM 2439  H HG3    . PRO C 3 50 ? 12.203  -12.051 10.289  1.00 5.17  ? 50 PRO A HG3    1  
ATOM 2440  H HD2    . PRO C 3 50 ? 12.159  -14.925 11.043  1.00 4.52  ? 50 PRO A HD2    1  
ATOM 2441  H HD3    . PRO C 3 50 ? 13.150  -13.600 11.686  1.00 4.31  ? 50 PRO A HD3    1  
ATOM 2442  N N      . ASN C 3 51 ? 9.406   -15.646 12.101  1.00 4.53  ? 51 ASN A N      1  
ATOM 2443  C CA     . ASN C 3 51 ? 8.579   -16.845 12.092  1.00 4.92  ? 51 ASN A CA     1  
ATOM 2444  C C      . ASN C 3 51 ? 8.095   -17.166 13.502  1.00 4.67  ? 51 ASN A C      1  
ATOM 2445  O O      . ASN C 3 51 ? 7.620   -18.265 13.778  1.00 5.06  ? 51 ASN A O      1  
ATOM 2446  C CB     . ASN C 3 51 ? 9.355   -18.031 11.513  1.00 5.53  ? 51 ASN A CB     1  
ATOM 2447  C CG     . ASN C 3 51 ? 8.443   -19.061 10.875  1.00 6.17  ? 51 ASN A CG     1  
ATOM 2448  O OD1    . ASN C 3 51 ? 7.313   -18.757 10.494  1.00 6.38  ? 51 ASN A OD1    1  
ATOM 2449  N ND2    . ASN C 3 51 ? 8.936   -20.280 10.737  1.00 6.68  ? 51 ASN A ND2    1  
ATOM 2450  H H      . ASN C 3 51 ? 10.353  -15.718 12.347  1.00 4.51  ? 51 ASN A H      1  
ATOM 2451  H HA     . ASN C 3 51 ? 7.719   -16.650 11.466  1.00 5.22  ? 51 ASN A HA     1  
ATOM 2452  H HB2    . ASN C 3 51 ? 10.047  -17.676 10.766  1.00 5.79  ? 51 ASN A HB2    1  
ATOM 2453  H HB3    . ASN C 3 51 ? 9.906   -18.511 12.308  1.00 5.42  ? 51 ASN A HB3    1  
ATOM 2454  H HD21   . ASN C 3 51 ? 9.852   -20.446 11.049  1.00 6.71  ? 51 ASN A HD21   1  
ATOM 2455  H HD22   . ASN C 3 51 ? 8.367   -20.970 10.333  1.00 7.13  ? 51 ASN A HD22   1  
ATOM 2456  N N      . MET C 3 52 ? 8.226   -16.193 14.394  1.00 4.34  ? 52 MET A N      1  
ATOM 2457  C CA     . MET C 3 52 ? 7.797   -16.353 15.780  1.00 4.46  ? 52 MET A CA     1  
ATOM 2458  C C      . MET C 3 52 ? 7.389   -15.001 16.351  1.00 4.21  ? 52 MET A C      1  
ATOM 2459  O O      . MET C 3 52 ? 7.611   -14.706 17.529  1.00 4.29  ? 52 MET A O      1  
ATOM 2460  C CB     . MET C 3 52 ? 8.924   -16.965 16.614  1.00 4.75  ? 52 MET A CB     1  
ATOM 2461  C CG     . MET C 3 52 ? 8.442   -17.882 17.725  1.00 5.28  ? 52 MET A CG     1  
ATOM 2462  S SD     . MET C 3 52 ? 9.785   -18.828 18.471  1.00 5.49  ? 52 MET A SD     1  
ATOM 2463  C CE     . MET C 3 52 ? 8.864   -19.911 19.563  1.00 6.47  ? 52 MET A CE     1  
ATOM 2464  H H      . MET C 3 52 ? 8.621   -15.340 14.114  1.00 4.28  ? 52 MET A H      1  
ATOM 2465  H HA     . MET C 3 52 ? 6.942   -17.015 15.795  1.00 4.84  ? 52 MET A HA     1  
ATOM 2466  H HB2    . MET C 3 52 ? 9.568   -17.536 15.961  1.00 4.93  ? 52 MET A HB2    1  
ATOM 2467  H HB3    . MET C 3 52 ? 9.500   -16.166 17.059  1.00 4.78  ? 52 MET A HB3    1  
ATOM 2468  H HG2    . MET C 3 52 ? 7.974   -17.283 18.493  1.00 5.58  ? 52 MET A HG2    1  
ATOM 2469  H HG3    . MET C 3 52 ? 7.718   -18.570 17.315  1.00 5.57  ? 52 MET A HG3    1  
ATOM 2470  H HE1    . MET C 3 52 ? 9.524   -20.666 19.966  1.00 6.78  ? 52 MET A HE1    1  
ATOM 2471  H HE2    . MET C 3 52 ? 8.070   -20.389 19.009  1.00 6.77  ? 52 MET A HE2    1  
ATOM 2472  H HE3    . MET C 3 52 ? 8.442   -19.332 20.371  1.00 6.78  ? 52 MET A HE3    1  
ATOM 2473  N N      . THR C 3 53 ? 6.795   -14.180 15.495  1.00 4.22  ? 53 THR A N      1  
ATOM 2474  C CA     . THR C 3 53 ? 6.352   -12.851 15.881  1.00 4.28  ? 53 THR A CA     1  
ATOM 2475  C C      . THR C 3 53 ? 4.829   -12.789 15.948  1.00 3.69  ? 53 THR A C      1  
ATOM 2476  O O      . THR C 3 53 ? 4.253   -12.502 16.997  1.00 3.33  ? 53 THR A O      1  
ATOM 2477  C CB     . THR C 3 53 ? 6.864   -11.791 14.889  1.00 5.06  ? 53 THR A CB     1  
ATOM 2478  O OG1    . THR C 3 53 ? 7.959   -12.326 14.129  1.00 5.43  ? 53 THR A OG1    1  
ATOM 2479  C CG2    . THR C 3 53 ? 7.312   -10.536 15.623  1.00 5.77  ? 53 THR A CG2    1  
ATOM 2480  H H      . THR C 3 53 ? 6.647   -14.482 14.571  1.00 4.41  ? 53 THR A H      1  
ATOM 2481  H HA     . THR C 3 53 ? 6.758   -12.630 16.857  1.00 4.47  ? 53 THR A HA     1  
ATOM 2482  H HB     . THR C 3 53 ? 6.059   -11.529 14.216  1.00 5.19  ? 53 THR A HB     1  
ATOM 2483  H HG1    . THR C 3 53 ? 8.767   -12.292 14.657  1.00 5.53  ? 53 THR A HG1    1  
ATOM 2484  H HG21   . THR C 3 53 ? 6.513   -10.188 16.261  1.00 5.72  ? 53 THR A HG21   1  
ATOM 2485  H HG22   . THR C 3 53 ? 7.559   -9.767  14.906  1.00 6.49  ? 53 THR A HG22   1  
ATOM 2486  H HG23   . THR C 3 53 ? 8.181   -10.761 16.225  1.00 5.90  ? 53 THR A HG23   1  
ATOM 2487  N N      . CYS C 3 54 ? 4.183   -13.076 14.827  1.00 3.94  ? 54 CYS A N      1  
ATOM 2488  C CA     . CYS C 3 54 ? 2.729   -13.059 14.758  1.00 3.75  ? 54 CYS A CA     1  
ATOM 2489  C C      . CYS C 3 54 ? 2.173   -14.464 14.931  1.00 4.01  ? 54 CYS A C      1  
ATOM 2490  O O      . CYS C 3 54 ? 0.969   -14.651 15.096  1.00 4.55  ? 54 CYS A O      1  
ATOM 2491  C CB     . CYS C 3 54 ? 2.261   -12.476 13.425  1.00 4.03  ? 54 CYS A CB     1  
ATOM 2492  S SG     . CYS C 3 54 ? 1.848   -10.702 13.495  1.00 4.29  ? 54 CYS A SG     1  
ATOM 2493  H H      . CYS C 3 54 ? 4.696   -13.302 14.020  1.00 4.46  ? 54 CYS A H      1  
ATOM 2494  H HA     . CYS C 3 54 ? 2.366   -12.436 15.561  1.00 3.73  ? 54 CYS A HA     1  
ATOM 2495  H HB2    . CYS C 3 54 ? 3.042   -12.603 12.692  1.00 4.57  ? 54 CYS A HB2    1  
ATOM 2496  H HB3    . CYS C 3 54 ? 1.378   -13.007 13.099  1.00 3.99  ? 54 CYS A HB3    1  
ATOM 2497  N N      . GLN C 3 55 ? 3.065   -15.443 14.898  1.00 4.10  ? 55 GLN A N      1  
ATOM 2498  C CA     . GLN C 3 55 ? 2.688   -16.842 15.050  1.00 4.86  ? 55 GLN A CA     1  
ATOM 2499  C C      . GLN C 3 55 ? 2.261   -17.121 16.488  1.00 5.60  ? 55 GLN A C      1  
ATOM 2500  O O      . GLN C 3 55 ? 2.907   -16.664 17.433  1.00 5.68  ? 55 GLN A O      1  
ATOM 2501  C CB     . GLN C 3 55 ? 3.855   -17.756 14.655  1.00 5.19  ? 55 GLN A CB     1  
ATOM 2502  C CG     . GLN C 3 55 ? 4.179   -17.750 13.163  1.00 5.83  ? 55 GLN A CG     1  
ATOM 2503  C CD     . GLN C 3 55 ? 4.743   -16.426 12.679  1.00 6.33  ? 55 GLN A CD     1  
ATOM 2504  O OE1    . GLN C 3 55 ? 5.403   -15.703 13.430  1.00 6.58  ? 55 GLN A OE1    1  
ATOM 2505  N NE2    . GLN C 3 55 ? 4.477   -16.091 11.429  1.00 6.80  ? 55 GLN A NE2    1  
ATOM 2506  H H      . GLN C 3 55 ? 4.012   -15.218 14.768  1.00 3.96  ? 55 GLN A H      1  
ATOM 2507  H HA     . GLN C 3 55 ? 1.852   -17.033 14.395  1.00 5.13  ? 55 GLN A HA     1  
ATOM 2508  H HB2    . GLN C 3 55 ? 4.737   -17.439 15.190  1.00 4.96  ? 55 GLN A HB2    1  
ATOM 2509  H HB3    . GLN C 3 55 ? 3.616   -18.769 14.945  1.00 5.65  ? 55 GLN A HB3    1  
ATOM 2510  H HG2    . GLN C 3 55 ? 4.907   -18.524 12.963  1.00 6.14  ? 55 GLN A HG2    1  
ATOM 2511  H HG3    . GLN C 3 55 ? 3.274   -17.962 12.613  1.00 6.01  ? 55 GLN A HG3    1  
ATOM 2512  H HE21   . GLN C 3 55 ? 3.932   -16.705 10.888  1.00 6.82  ? 55 GLN A HE21   1  
ATOM 2513  H HE22   . GLN C 3 55 ? 4.841   -15.245 11.088  1.00 7.28  ? 55 GLN A HE22   1  
ATOM 2514  N N      . MET D 3 1  ? 35.762  -6.425  7.035   1.00 7.62  ? 1  MET B N      1  
ATOM 2515  C CA     . MET D 3 1  ? 36.176  -6.435  8.431   1.00 7.52  ? 1  MET B CA     1  
ATOM 2516  C C      . MET D 3 1  ? 35.245  -5.546  9.245   1.00 6.95  ? 1  MET B C      1  
ATOM 2517  O O      . MET D 3 1  ? 35.085  -5.716  10.456  1.00 7.17  ? 1  MET B O      1  
ATOM 2518  C CB     . MET D 3 1  ? 37.622  -5.946  8.550   1.00 7.80  ? 1  MET B CB     1  
ATOM 2519  C CG     . MET D 3 1  ? 38.209  -6.084  9.944   1.00 8.70  ? 1  MET B CG     1  
ATOM 2520  S SD     . MET D 3 1  ? 39.861  -5.369  10.066  1.00 9.39  ? 1  MET B SD     1  
ATOM 2521  C CE     . MET D 3 1  ? 40.766  -6.418  8.928   1.00 10.28 ? 1  MET B CE     1  
ATOM 2522  H H1     . MET D 3 1  ? 36.268  -6.955  6.383   1.00 7.71  ? 1  MET B H1     1  
ATOM 2523  H HA     . MET D 3 1  ? 36.109  -7.448  8.796   1.00 7.92  ? 1  MET B HA     1  
ATOM 2524  H HB2    . MET D 3 1  ? 38.236  -6.516  7.869   1.00 7.78  ? 1  MET B HB2    1  
ATOM 2525  H HB3    . MET D 3 1  ? 37.662  -4.904  8.267   1.00 7.57  ? 1  MET B HB3    1  
ATOM 2526  H HG2    . MET D 3 1  ? 37.560  -5.581  10.645  1.00 8.80  ? 1  MET B HG2    1  
ATOM 2527  H HG3    . MET D 3 1  ? 38.266  -7.133  10.195  1.00 9.08  ? 1  MET B HG3    1  
ATOM 2528  H HE1    . MET D 3 1  ? 41.809  -6.144  8.940   1.00 10.55 ? 1  MET B HE1    1  
ATOM 2529  H HE2    . MET D 3 1  ? 40.372  -6.293  7.930   1.00 10.27 ? 1  MET B HE2    1  
ATOM 2530  H HE3    . MET D 3 1  ? 40.662  -7.451  9.228   1.00 10.76 ? 1  MET B HE3    1  
ATOM 2531  N N      . LYS D 3 2  ? 34.618  -4.611  8.552   1.00 6.47  ? 2  LYS B N      1  
ATOM 2532  C CA     . LYS D 3 2  ? 33.687  -3.682  9.173   1.00 6.17  ? 2  LYS B CA     1  
ATOM 2533  C C      . LYS D 3 2  ? 32.269  -4.240  9.083   1.00 5.73  ? 2  LYS B C      1  
ATOM 2534  O O      . LYS D 3 2  ? 32.084  -5.453  8.953   1.00 5.67  ? 2  LYS B O      1  
ATOM 2535  C CB     . LYS D 3 2  ? 33.769  -2.315  8.479   1.00 6.23  ? 2  LYS B CB     1  
ATOM 2536  C CG     . LYS D 3 2  ? 35.189  -1.805  8.283   1.00 6.85  ? 2  LYS B CG     1  
ATOM 2537  C CD     . LYS D 3 2  ? 35.205  -0.474  7.544   1.00 7.29  ? 2  LYS B CD     1  
ATOM 2538  C CE     . LYS D 3 2  ? 36.616  -0.060  7.163   1.00 8.14  ? 2  LYS B CE     1  
ATOM 2539  N NZ     . LYS D 3 2  ? 36.668  1.337   6.651   1.00 9.03  ? 2  LYS B NZ     1  
ATOM 2540  H H      . LYS D 3 2  ? 34.776  -4.552  7.586   1.00 6.51  ? 2  LYS B H      1  
ATOM 2541  H HA     . LYS D 3 2  ? 33.961  -3.574  10.212  1.00 6.56  ? 2  LYS B HA     1  
ATOM 2542  H HB2    . LYS D 3 2  ? 33.300  -2.387  7.509   1.00 6.03  ? 2  LYS B HB2    1  
ATOM 2543  H HB3    . LYS D 3 2  ? 33.231  -1.593  9.075   1.00 6.37  ? 2  LYS B HB3    1  
ATOM 2544  H HG2    . LYS D 3 2  ? 35.649  -1.670  9.250   1.00 7.04  ? 2  LYS B HG2    1  
ATOM 2545  H HG3    . LYS D 3 2  ? 35.748  -2.533  7.714   1.00 7.11  ? 2  LYS B HG3    1  
ATOM 2546  H HD2    . LYS D 3 2  ? 34.613  -0.563  6.645   1.00 7.37  ? 2  LYS B HD2    1  
ATOM 2547  H HD3    . LYS D 3 2  ? 34.778  0.284   8.181   1.00 7.21  ? 2  LYS B HD3    1  
ATOM 2548  H HE2    . LYS D 3 2  ? 37.246  -0.138  8.034   1.00 8.28  ? 2  LYS B HE2    1  
ATOM 2549  H HE3    . LYS D 3 2  ? 36.978  -0.730  6.399   1.00 8.16  ? 2  LYS B HE3    1  
ATOM 2550  H HZ1    . LYS D 3 2  ? 37.616  1.548   6.282   1.00 9.42  ? 2  LYS B HZ1    1  
ATOM 2551  H HZ2    . LYS D 3 2  ? 36.456  2.009   7.417   1.00 9.37  ? 2  LYS B HZ2    1  
ATOM 2552  H HZ3    . LYS D 3 2  ? 35.975  1.469   5.886   1.00 9.16  ? 2  LYS B HZ3    1  
ATOM 2553  N N      . SER D 3 3  ? 31.269  -3.373  9.148   1.00 5.70  ? 3  SER B N      1  
ATOM 2554  C CA     . SER D 3 3  ? 29.886  -3.807  9.054   1.00 5.49  ? 3  SER B CA     1  
ATOM 2555  C C      . SER D 3 3  ? 29.462  -3.894  7.586   1.00 4.85  ? 3  SER B C      1  
ATOM 2556  O O      . SER D 3 3  ? 28.599  -3.140  7.132   1.00 4.85  ? 3  SER B O      1  
ATOM 2557  C CB     . SER D 3 3  ? 28.976  -2.839  9.816   1.00 5.99  ? 3  SER B CB     1  
ATOM 2558  O OG     . SER D 3 3  ? 29.351  -2.746  11.181  1.00 6.58  ? 3  SER B OG     1  
ATOM 2559  H H      . SER D 3 3  ? 31.462  -2.415  9.254   1.00 6.01  ? 3  SER B H      1  
ATOM 2560  H HA     . SER D 3 3  ? 29.814  -4.787  9.500   1.00 5.74  ? 3  SER B HA     1  
ATOM 2561  H HB2    . SER D 3 3  ? 29.050  -1.859  9.372   1.00 6.04  ? 3  SER B HB2    1  
ATOM 2562  H HB3    . SER D 3 3  ? 27.956  -3.185  9.757   1.00 6.12  ? 3  SER B HB3    1  
ATOM 2563  H HG     . SER D 3 3  ? 30.311  -2.861  11.257  1.00 6.91  ? 3  SER B HG     1  
ATOM 2564  N N      . THR D 3 4  ? 30.085  -4.805  6.846   1.00 4.64  ? 4  THR B N      1  
ATOM 2565  C CA     . THR D 3 4  ? 29.786  -4.987  5.432   1.00 4.40  ? 4  THR B CA     1  
ATOM 2566  C C      . THR D 3 4  ? 28.482  -5.756  5.230   1.00 4.10  ? 4  THR B C      1  
ATOM 2567  O O      . THR D 3 4  ? 27.748  -5.514  4.275   1.00 4.57  ? 4  THR B O      1  
ATOM 2568  C CB     . THR D 3 4  ? 30.936  -5.727  4.722   1.00 4.92  ? 4  THR B CB     1  
ATOM 2569  O OG1    . THR D 3 4  ? 31.639  -6.558  5.661   1.00 5.34  ? 4  THR B OG1    1  
ATOM 2570  C CG2    . THR D 3 4  ? 31.902  -4.736  4.087   1.00 5.32  ? 4  THR B CG2    1  
ATOM 2571  H H      . THR D 3 4  ? 30.775  -5.370  7.261   1.00 4.91  ? 4  THR B H      1  
ATOM 2572  H HA     . THR D 3 4  ? 29.687  -4.009  4.983   1.00 4.48  ? 4  THR B HA     1  
ATOM 2573  H HB     . THR D 3 4  ? 30.520  -6.348  3.942   1.00 5.11  ? 4  THR B HB     1  
ATOM 2574  H HG1    . THR D 3 4  ? 32.232  -7.152  5.181   1.00 5.76  ? 4  THR B HG1    1  
ATOM 2575  H HG21   . THR D 3 4  ? 32.452  -4.220  4.861   1.00 5.51  ? 4  THR B HG21   1  
ATOM 2576  H HG22   . THR D 3 4  ? 31.346  -4.017  3.503   1.00 5.83  ? 4  THR B HG22   1  
ATOM 2577  H HG23   . THR D 3 4  ? 32.591  -5.265  3.446   1.00 5.27  ? 4  THR B HG23   1  
ATOM 2578  N N      . GLY D 3 5  ? 28.200  -6.681  6.134   1.00 3.71  ? 5  GLY B N      1  
ATOM 2579  C CA     . GLY D 3 5  ? 26.985  -7.463  6.042   1.00 3.67  ? 5  GLY B CA     1  
ATOM 2580  C C      . GLY D 3 5  ? 26.652  -8.124  7.359   1.00 3.66  ? 5  GLY B C      1  
ATOM 2581  O O      . GLY D 3 5  ? 27.480  -8.847  7.912   1.00 4.11  ? 5  GLY B O      1  
ATOM 2582  H H      . GLY D 3 5  ? 28.828  -6.844  6.872   1.00 3.74  ? 5  GLY B H      1  
ATOM 2583  H HA2    . GLY D 3 5  ? 26.169  -6.815  5.754   1.00 3.73  ? 5  GLY B HA2    1  
ATOM 2584  H HA3    . GLY D 3 5  ? 27.114  -8.225  5.289   1.00 3.88  ? 5  GLY B HA3    1  
ATOM 2585  N N      . ILE D 3 6  ? 25.446  -7.876  7.864   1.00 3.28  ? 6  ILE B N      1  
ATOM 2586  C CA     . ILE D 3 6  ? 25.008  -8.438  9.138   1.00 3.42  ? 6  ILE B CA     1  
ATOM 2587  C C      . ILE D 3 6  ? 23.627  -7.895  9.538   1.00 3.07  ? 6  ILE B C      1  
ATOM 2588  O O      . ILE D 3 6  ? 22.646  -8.639  9.552   1.00 2.86  ? 6  ILE B O      1  
ATOM 2589  C CB     . ILE D 3 6  ? 26.044  -8.188  10.280  1.00 3.65  ? 6  ILE B CB     1  
ATOM 2590  C CG1    . ILE D 3 6  ? 25.499  -8.691  11.622  1.00 3.79  ? 6  ILE B CG1    1  
ATOM 2591  C CG2    . ILE D 3 6  ? 26.448  -6.715  10.372  1.00 3.94  ? 6  ILE B CG2    1  
ATOM 2592  C CD1    . ILE D 3 6  ? 26.458  -8.511  12.782  1.00 4.25  ? 6  ILE B CD1    1  
ATOM 2593  H H      . ILE D 3 6  ? 24.813  -7.336  7.342   1.00 3.01  ? 6  ILE B H      1  
ATOM 2594  H HA     . ILE D 3 6  ? 24.923  -9.509  9.000   1.00 3.82  ? 6  ILE B HA     1  
ATOM 2595  H HB     . ILE D 3 6  ? 26.933  -8.751  10.039  1.00 4.03  ? 6  ILE B HB     1  
ATOM 2596  H HG12   . ILE D 3 6  ? 24.591  -8.157  11.858  1.00 3.94  ? 6  ILE B HG12   1  
ATOM 2597  H HG13   . ILE D 3 6  ? 25.276  -9.745  11.537  1.00 3.89  ? 6  ILE B HG13   1  
ATOM 2598  H HG21   . ILE D 3 6  ? 25.708  -6.172  10.941  1.00 4.47  ? 6  ILE B HG21   1  
ATOM 2599  H HG22   . ILE D 3 6  ? 26.514  -6.297  9.378   1.00 3.96  ? 6  ILE B HG22   1  
ATOM 2600  H HG23   . ILE D 3 6  ? 27.409  -6.635  10.860  1.00 4.07  ? 6  ILE B HG23   1  
ATOM 2601  H HD11   . ILE D 3 6  ? 26.780  -7.482  12.827  1.00 4.18  ? 6  ILE B HD11   1  
ATOM 2602  H HD12   . ILE D 3 6  ? 27.316  -9.152  12.642  1.00 4.44  ? 6  ILE B HD12   1  
ATOM 2603  H HD13   . ILE D 3 6  ? 25.961  -8.770  13.705  1.00 4.85  ? 6  ILE B HD13   1  
ATOM 2604  N N      . VAL D 3 7  ? 23.543  -6.599  9.822   1.00 3.14  ? 7  VAL B N      1  
ATOM 2605  C CA     . VAL D 3 7  ? 22.288  -5.981  10.234  1.00 2.90  ? 7  VAL B CA     1  
ATOM 2606  C C      . VAL D 3 7  ? 22.403  -4.455  10.177  1.00 2.74  ? 7  VAL B C      1  
ATOM 2607  O O      . VAL D 3 7  ? 23.481  -3.905  10.402  1.00 2.98  ? 7  VAL B O      1  
ATOM 2608  C CB     . VAL D 3 7  ? 21.904  -6.426  11.673  1.00 3.05  ? 7  VAL B CB     1  
ATOM 2609  C CG1    . VAL D 3 7  ? 22.926  -5.937  12.692  1.00 3.30  ? 7  VAL B CG1    1  
ATOM 2610  C CG2    . VAL D 3 7  ? 20.510  -5.954  12.052  1.00 3.32  ? 7  VAL B CG2    1  
ATOM 2611  H H      . VAL D 3 7  ? 24.345  -6.040  9.758   1.00 3.45  ? 7  VAL B H      1  
ATOM 2612  H HA     . VAL D 3 7  ? 21.513  -6.305  9.552   1.00 2.79  ? 7  VAL B HA     1  
ATOM 2613  H HB     . VAL D 3 7  ? 21.904  -7.507  11.697  1.00 3.28  ? 7  VAL B HB     1  
ATOM 2614  H HG11   . VAL D 3 7  ? 22.584  -6.177  13.687  1.00 3.45  ? 7  VAL B HG11   1  
ATOM 2615  H HG12   . VAL D 3 7  ? 23.044  -4.867  12.600  1.00 3.39  ? 7  VAL B HG12   1  
ATOM 2616  H HG13   . VAL D 3 7  ? 23.873  -6.420  12.511  1.00 3.82  ? 7  VAL B HG13   1  
ATOM 2617  H HG21   . VAL D 3 7  ? 20.257  -6.331  13.031  1.00 4.04  ? 7  VAL B HG21   1  
ATOM 2618  H HG22   . VAL D 3 7  ? 19.796  -6.321  11.328  1.00 3.26  ? 7  VAL B HG22   1  
ATOM 2619  H HG23   . VAL D 3 7  ? 20.487  -4.876  12.065  1.00 3.43  ? 7  VAL B HG23   1  
ATOM 2620  N N      . ARG D 3 8  ? 21.306  -3.785  9.849   1.00 2.47  ? 8  ARG B N      1  
ATOM 2621  C CA     . ARG D 3 8  ? 21.285  -2.327  9.783   1.00 2.41  ? 8  ARG B CA     1  
ATOM 2622  C C      . ARG D 3 8  ? 19.898  -1.807  10.129  1.00 2.19  ? 8  ARG B C      1  
ATOM 2623  O O      . ARG D 3 8  ? 18.900  -2.500  9.926   1.00 2.12  ? 8  ARG B O      1  
ATOM 2624  C CB     . ARG D 3 8  ? 21.700  -1.827  8.395   1.00 2.58  ? 8  ARG B CB     1  
ATOM 2625  C CG     . ARG D 3 8  ? 23.190  -1.549  8.271   1.00 2.91  ? 8  ARG B CG     1  
ATOM 2626  C CD     . ARG D 3 8  ? 23.460  -0.321  7.413   1.00 3.08  ? 8  ARG B CD     1  
ATOM 2627  N NE     . ARG D 3 8  ? 24.720  0.331   7.776   1.00 3.51  ? 8  ARG B NE     1  
ATOM 2628  C CZ     . ARG D 3 8  ? 24.914  1.650   7.760   1.00 3.91  ? 8  ARG B CZ     1  
ATOM 2629  N NH1    . ARG D 3 8  ? 23.963  2.466   7.321   1.00 4.06  ? 8  ARG B NH1    1  
ATOM 2630  N NH2    . ARG D 3 8  ? 26.071  2.150   8.174   1.00 4.47  ? 8  ARG B NH2    1  
ATOM 2631  H H      . ARG D 3 8  ? 20.480  -4.283  9.647   1.00 2.43  ? 8  ARG B H      1  
ATOM 2632  H HA     . ARG D 3 8  ? 21.986  -1.956  10.515  1.00 2.53  ? 8  ARG B HA     1  
ATOM 2633  H HB2    . ARG D 3 8  ? 21.430  -2.572  7.662   1.00 2.62  ? 8  ARG B HB2    1  
ATOM 2634  H HB3    . ARG D 3 8  ? 21.166  -0.914  8.180   1.00 2.79  ? 8  ARG B HB3    1  
ATOM 2635  H HG2    . ARG D 3 8  ? 23.599  -1.384  9.257   1.00 3.08  ? 8  ARG B HG2    1  
ATOM 2636  H HG3    . ARG D 3 8  ? 23.668  -2.407  7.820   1.00 3.40  ? 8  ARG B HG3    1  
ATOM 2637  H HD2    . ARG D 3 8  ? 23.506  -0.621  6.376   1.00 3.51  ? 8  ARG B HD2    1  
ATOM 2638  H HD3    . ARG D 3 8  ? 22.652  0.381   7.549   1.00 2.92  ? 8  ARG B HD3    1  
ATOM 2639  H HE     . ARG D 3 8  ? 25.459  -0.251  8.074   1.00 3.74  ? 8  ARG B HE     1  
ATOM 2640  H HH11   . ARG D 3 8  ? 23.090  2.093   6.996   1.00 3.86  ? 8  ARG B HH11   1  
ATOM 2641  H HH12   . ARG D 3 8  ? 24.107  3.462   7.324   1.00 4.57  ? 8  ARG B HH12   1  
ATOM 2642  H HH21   . ARG D 3 8  ? 26.800  1.537   8.496   1.00 4.64  ? 8  ARG B HH21   1  
ATOM 2643  H HH22   . ARG D 3 8  ? 26.220  3.143   8.179   1.00 4.88  ? 8  ARG B HH22   1  
ATOM 2644  N N      . LYS D 3 9  ? 19.840  -0.594  10.660  1.00 2.21  ? 9  LYS B N      1  
ATOM 2645  C CA     . LYS D 3 9  ? 18.571  0.012   11.028  1.00 2.17  ? 9  LYS B CA     1  
ATOM 2646  C C      . LYS D 3 9  ? 17.833  0.517   9.794   1.00 2.30  ? 9  LYS B C      1  
ATOM 2647  O O      . LYS D 3 9  ? 18.436  1.096   8.882   1.00 2.44  ? 9  LYS B O      1  
ATOM 2648  C CB     . LYS D 3 9  ? 18.785  1.166   12.022  1.00 2.23  ? 9  LYS B CB     1  
ATOM 2649  C CG     . LYS D 3 9  ? 19.433  2.404   11.407  1.00 2.61  ? 9  LYS B CG     1  
ATOM 2650  C CD     . LYS D 3 9  ? 18.399  3.468   11.058  1.00 2.83  ? 9  LYS B CD     1  
ATOM 2651  C CE     . LYS D 3 9  ? 18.958  4.505   10.092  1.00 3.20  ? 9  LYS B CE     1  
ATOM 2652  N NZ     . LYS D 3 9  ? 19.090  3.972   8.704   1.00 3.40  ? 9  LYS B NZ     1  
ATOM 2653  H H      . LYS D 3 9  ? 20.671  -0.095  10.813  1.00 2.33  ? 9  LYS B H      1  
ATOM 2654  H HA     . LYS D 3 9  ? 17.972  -0.747  11.500  1.00 2.16  ? 9  LYS B HA     1  
ATOM 2655  H HB2    . LYS D 3 9  ? 17.825  1.454   12.428  1.00 2.40  ? 9  LYS B HB2    1  
ATOM 2656  H HB3    . LYS D 3 9  ? 19.416  0.820   12.827  1.00 2.23  ? 9  LYS B HB3    1  
ATOM 2657  H HG2    . LYS D 3 9  ? 20.137  2.819   12.110  1.00 3.07  ? 9  LYS B HG2    1  
ATOM 2658  H HG3    . LYS D 3 9  ? 19.950  2.112   10.508  1.00 2.94  ? 9  LYS B HG3    1  
ATOM 2659  H HD2    . LYS D 3 9  ? 17.548  2.987   10.599  1.00 2.93  ? 9  LYS B HD2    1  
ATOM 2660  H HD3    . LYS D 3 9  ? 18.086  3.963   11.965  1.00 3.25  ? 9  LYS B HD3    1  
ATOM 2661  H HE2    . LYS D 3 9  ? 18.295  5.356   10.077  1.00 3.40  ? 9  LYS B HE2    1  
ATOM 2662  H HE3    . LYS D 3 9  ? 19.931  4.816   10.444  1.00 3.61  ? 9  LYS B HE3    1  
ATOM 2663  H HZ1    . LYS D 3 9  ? 20.062  4.108   8.357   1.00 3.62  ? 9  LYS B HZ1    1  
ATOM 2664  H HZ2    . LYS D 3 9  ? 18.432  4.476   8.061   1.00 3.49  ? 9  LYS B HZ2    1  
ATOM 2665  H HZ3    . LYS D 3 9  ? 18.864  2.955   8.683   1.00 3.60  ? 9  LYS B HZ3    1  
ATOM 2666  N N      . VAL D 3 10 ? 16.534  0.294   9.763   1.00 2.38  ? 10 VAL B N      1  
ATOM 2667  C CA     . VAL D 3 10 ? 15.725  0.758   8.654   1.00 2.63  ? 10 VAL B CA     1  
ATOM 2668  C C      . VAL D 3 10 ? 15.315  2.197   8.919   1.00 2.70  ? 10 VAL B C      1  
ATOM 2669  O O      . VAL D 3 10 ? 15.080  2.581   10.068  1.00 2.95  ? 10 VAL B O      1  
ATOM 2670  C CB     . VAL D 3 10 ? 14.479  -0.126  8.419   1.00 2.83  ? 10 VAL B CB     1  
ATOM 2671  C CG1    . VAL D 3 10 ? 14.890  -1.498  7.915   1.00 3.48  ? 10 VAL B CG1    1  
ATOM 2672  C CG2    . VAL D 3 10 ? 13.652  -0.251  9.687   1.00 3.16  ? 10 VAL B CG2    1  
ATOM 2673  H H      . VAL D 3 10 ? 16.105  -0.180  10.511  1.00 2.37  ? 10 VAL B H      1  
ATOM 2674  H HA     . VAL D 3 10 ? 16.338  0.731   7.762   1.00 2.83  ? 10 VAL B HA     1  
ATOM 2675  H HB     . VAL D 3 10 ? 13.868  0.341   7.658   1.00 2.91  ? 10 VAL B HB     1  
ATOM 2676  H HG11   . VAL D 3 10 ? 14.008  -2.065  7.652   1.00 4.11  ? 10 VAL B HG11   1  
ATOM 2677  H HG12   . VAL D 3 10 ? 15.434  -2.016  8.690   1.00 3.75  ? 10 VAL B HG12   1  
ATOM 2678  H HG13   . VAL D 3 10 ? 15.520  -1.387  7.045   1.00 3.62  ? 10 VAL B HG13   1  
ATOM 2679  H HG21   . VAL D 3 10 ? 12.815  -0.908  9.509   1.00 3.65  ? 10 VAL B HG21   1  
ATOM 2680  H HG22   . VAL D 3 10 ? 13.289  0.725   9.974   1.00 3.30  ? 10 VAL B HG22   1  
ATOM 2681  H HG23   . VAL D 3 10 ? 14.264  -0.656  10.478  1.00 3.41  ? 10 VAL B HG23   1  
ATOM 2682  N N      . ASP D 3 11 ? 15.266  2.995   7.869   1.00 2.72  ? 11 ASP B N      1  
ATOM 2683  C CA     . ASP D 3 11 ? 14.914  4.401   7.996   1.00 2.95  ? 11 ASP B CA     1  
ATOM 2684  C C      . ASP D 3 11 ? 13.485  4.567   8.485   1.00 2.65  ? 11 ASP B C      1  
ATOM 2685  O O      . ASP D 3 11 ? 12.618  3.746   8.181   1.00 2.94  ? 11 ASP B O      1  
ATOM 2686  C CB     . ASP D 3 11 ? 15.092  5.123   6.662   1.00 3.34  ? 11 ASP B CB     1  
ATOM 2687  C CG     . ASP D 3 11 ? 16.545  5.240   6.249   1.00 3.95  ? 11 ASP B CG     1  
ATOM 2688  O OD1    . ASP D 3 11 ? 17.422  5.258   7.136   1.00 4.19  ? 11 ASP B OD1    1  
ATOM 2689  O OD2    . ASP D 3 11 ? 16.809  5.322   5.031   1.00 4.52  ? 11 ASP B OD2    1  
ATOM 2690  H H      . ASP D 3 11 ? 15.466  2.630   6.979   1.00 2.74  ? 11 ASP B H      1  
ATOM 2691  H HA     . ASP D 3 11 ? 15.583  4.842   8.721   1.00 3.29  ? 11 ASP B HA     1  
ATOM 2692  H HB2    . ASP D 3 11 ? 14.561  4.582   5.893   1.00 3.51  ? 11 ASP B HB2    1  
ATOM 2693  H HB3    . ASP D 3 11 ? 14.680  6.118   6.744   1.00 3.48  ? 11 ASP B HB3    1  
ATOM 2694  N N      . GLU D 3 12 ? 13.246  5.653   9.216   1.00 2.56  ? 12 GLU B N      1  
ATOM 2695  C CA     . GLU D 3 12 ? 11.922  5.960   9.771   1.00 2.40  ? 12 GLU B CA     1  
ATOM 2696  C C      . GLU D 3 12 ? 10.868  6.132   8.676   1.00 2.08  ? 12 GLU B C      1  
ATOM 2697  O O      . GLU D 3 12 ? 9.669   6.090   8.941   1.00 2.31  ? 12 GLU B O      1  
ATOM 2698  C CB     . GLU D 3 12 ? 11.994  7.234   10.619  1.00 2.96  ? 12 GLU B CB     1  
ATOM 2699  C CG     . GLU D 3 12 ? 12.881  7.109   11.849  1.00 3.22  ? 12 GLU B CG     1  
ATOM 2700  C CD     . GLU D 3 12 ? 12.305  6.189   12.904  1.00 4.14  ? 12 GLU B CD     1  
ATOM 2701  O OE1    . GLU D 3 12 ? 12.438  4.955   12.766  1.00 4.89  ? 12 GLU B OE1    1  
ATOM 2702  O OE2    . GLU D 3 12 ? 11.718  6.696   13.883  1.00 4.45  ? 12 GLU B OE2    1  
ATOM 2703  H H      . GLU D 3 12 ? 13.988  6.263   9.406   1.00 2.92  ? 12 GLU B H      1  
ATOM 2704  H HA     . GLU D 3 12 ? 11.633  5.137   10.406  1.00 2.45  ? 12 GLU B HA     1  
ATOM 2705  H HB2    . GLU D 3 12 ? 12.381  8.037   10.007  1.00 3.25  ? 12 GLU B HB2    1  
ATOM 2706  H HB3    . GLU D 3 12 ? 10.998  7.492   10.946  1.00 3.21  ? 12 GLU B HB3    1  
ATOM 2707  H HG2    . GLU D 3 12 ? 13.841  6.722   11.545  1.00 3.52  ? 12 GLU B HG2    1  
ATOM 2708  H HG3    . GLU D 3 12 ? 13.011  8.090   12.281  1.00 2.98  ? 12 GLU B HG3    1  
ATOM 2709  N N      . LEU D 3 13 ? 11.325  6.324   7.446   1.00 2.05  ? 13 LEU B N      1  
ATOM 2710  C CA     . LEU D 3 13 ? 10.431  6.501   6.310   1.00 2.22  ? 13 LEU B CA     1  
ATOM 2711  C C      . LEU D 3 13 ? 10.132  5.155   5.654   1.00 2.08  ? 13 LEU B C      1  
ATOM 2712  O O      . LEU D 3 13 ? 9.485   5.093   4.610   1.00 2.31  ? 13 LEU B O      1  
ATOM 2713  C CB     . LEU D 3 13 ? 11.050  7.460   5.282   1.00 2.93  ? 13 LEU B CB     1  
ATOM 2714  C CG     . LEU D 3 13 ? 10.925  8.963   5.598   1.00 3.33  ? 13 LEU B CG     1  
ATOM 2715  C CD1    . LEU D 3 13 ? 9.473   9.344   5.856   1.00 3.43  ? 13 LEU B CD1    1  
ATOM 2716  C CD2    . LEU D 3 13 ? 11.797  9.346   6.789   1.00 3.82  ? 13 LEU B CD2    1  
ATOM 2717  H H      . LEU D 3 13 ? 12.292  6.338   7.299   1.00 2.28  ? 13 LEU B H      1  
ATOM 2718  H HA     . LEU D 3 13 ? 9.508   6.924   6.675   1.00 2.35  ? 13 LEU B HA     1  
ATOM 2719  H HB2    . LEU D 3 13 ? 12.101  7.221   5.190   1.00 3.17  ? 13 LEU B HB2    1  
ATOM 2720  H HB3    . LEU D 3 13 ? 10.578  7.278   4.328   1.00 3.33  ? 13 LEU B HB3    1  
ATOM 2721  H HG     . LEU D 3 13 ? 11.266  9.528   4.742   1.00 3.80  ? 13 LEU B HG     1  
ATOM 2722  H HD11   . LEU D 3 13 ? 9.392   10.417  5.955   1.00 3.86  ? 13 LEU B HD11   1  
ATOM 2723  H HD12   . LEU D 3 13 ? 9.133   8.874   6.766   1.00 3.47  ? 13 LEU B HD12   1  
ATOM 2724  H HD13   . LEU D 3 13 ? 8.860   9.013   5.030   1.00 3.59  ? 13 LEU B HD13   1  
ATOM 2725  H HD21   . LEU D 3 13 ? 11.475  8.796   7.662   1.00 4.06  ? 13 LEU B HD21   1  
ATOM 2726  H HD22   . LEU D 3 13 ? 11.706  10.406  6.977   1.00 4.23  ? 13 LEU B HD22   1  
ATOM 2727  H HD23   . LEU D 3 13 ? 12.829  9.107   6.574   1.00 4.00  ? 13 LEU B HD23   1  
ATOM 2728  N N      . GLY D 3 14 ? 10.616  4.081   6.271   1.00 2.28  ? 14 GLY B N      1  
ATOM 2729  C CA     . GLY D 3 14 ? 10.395  2.751   5.738   1.00 2.47  ? 14 GLY B CA     1  
ATOM 2730  C C      . GLY D 3 14 ? 11.311  2.442   4.574   1.00 2.30  ? 14 GLY B C      1  
ATOM 2731  O O      . GLY D 3 14 ? 10.858  2.009   3.515   1.00 2.70  ? 14 GLY B O      1  
ATOM 2732  H H      . GLY D 3 14 ? 11.131  4.193   7.101   1.00 2.63  ? 14 GLY B H      1  
ATOM 2733  H HA2    . GLY D 3 14 ? 10.569  2.028   6.521   1.00 2.68  ? 14 GLY B HA2    1  
ATOM 2734  H HA3    . GLY D 3 14 ? 9.370   2.672   5.410   1.00 2.75  ? 14 GLY B HA3    1  
ATOM 2735  N N      . ARG D 3 15 ? 12.602  2.670   4.765   1.00 1.98  ? 15 ARG B N      1  
ATOM 2736  C CA     . ARG D 3 15 ? 13.579  2.418   3.716   1.00 1.99  ? 15 ARG B CA     1  
ATOM 2737  C C      . ARG D 3 15 ? 14.780  1.679   4.280   1.00 1.92  ? 15 ARG B C      1  
ATOM 2738  O O      . ARG D 3 15 ? 15.335  2.081   5.300   1.00 2.13  ? 15 ARG B O      1  
ATOM 2739  C CB     . ARG D 3 15 ? 14.060  3.732   3.081   1.00 2.07  ? 15 ARG B CB     1  
ATOM 2740  C CG     . ARG D 3 15 ? 13.053  4.871   3.151   1.00 2.75  ? 15 ARG B CG     1  
ATOM 2741  C CD     . ARG D 3 15 ? 13.672  6.190   2.713   1.00 2.68  ? 15 ARG B CD     1  
ATOM 2742  N NE     . ARG D 3 15 ? 14.917  6.471   3.426   1.00 2.84  ? 15 ARG B NE     1  
ATOM 2743  C CZ     . ARG D 3 15 ? 15.487  7.668   3.506   1.00 3.25  ? 15 ARG B CZ     1  
ATOM 2744  N NH1    . ARG D 3 15 ? 14.931  8.722   2.921   1.00 3.51  ? 15 ARG B NH1    1  
ATOM 2745  N NH2    . ARG D 3 15 ? 16.623  7.799   4.175   1.00 3.78  ? 15 ARG B NH2    1  
ATOM 2746  H H      . ARG D 3 15 ? 12.908  2.996   5.636   1.00 1.97  ? 15 ARG B H      1  
ATOM 2747  H HA     . ARG D 3 15 ? 13.111  1.807   2.959   1.00 2.31  ? 15 ARG B HA     1  
ATOM 2748  H HB2    . ARG D 3 15 ? 14.961  4.047   3.587   1.00 1.97  ? 15 ARG B HB2    1  
ATOM 2749  H HB3    . ARG D 3 15 ? 14.292  3.550   2.041   1.00 2.31  ? 15 ARG B HB3    1  
ATOM 2750  H HG2    . ARG D 3 15 ? 12.219  4.643   2.503   1.00 3.33  ? 15 ARG B HG2    1  
ATOM 2751  H HG3    . ARG D 3 15 ? 12.704  4.968   4.170   1.00 3.14  ? 15 ARG B HG3    1  
ATOM 2752  H HD2    . ARG D 3 15 ? 13.879  6.144   1.654   1.00 3.11  ? 15 ARG B HD2    1  
ATOM 2753  H HD3    . ARG D 3 15 ? 12.968  6.984   2.908   1.00 2.62  ? 15 ARG B HD3    1  
ATOM 2754  H HE     . ARG D 3 15 ? 15.365  5.709   3.876   1.00 3.01  ? 15 ARG B HE     1  
ATOM 2755  H HH11   . ARG D 3 15 ? 14.074  8.621   2.412   1.00 3.46  ? 15 ARG B HH11   1  
ATOM 2756  H HH12   . ARG D 3 15 ? 15.365  9.621   2.988   1.00 3.99  ? 15 ARG B HH12   1  
ATOM 2757  H HH21   . ARG D 3 15 ? 17.041  6.985   4.616   1.00 3.95  ? 15 ARG B HH21   1  
ATOM 2758  H HH22   . ARG D 3 15 ? 17.070  8.689   4.258   1.00 4.22  ? 15 ARG B HH22   1  
ATOM 2759  N N      . VAL D 3 16 ? 15.162  0.590   3.640   1.00 1.76  ? 16 VAL B N      1  
ATOM 2760  C CA     . VAL D 3 16 ? 16.324  -0.163  4.070   1.00 1.84  ? 16 VAL B CA     1  
ATOM 2761  C C      . VAL D 3 16 ? 17.530  0.353   3.305   1.00 1.47  ? 16 VAL B C      1  
ATOM 2762  O O      . VAL D 3 16 ? 17.431  0.652   2.116   1.00 1.17  ? 16 VAL B O      1  
ATOM 2763  C CB     . VAL D 3 16 ? 16.163  -1.680  3.828   1.00 2.17  ? 16 VAL B CB     1  
ATOM 2764  C CG1    . VAL D 3 16 ? 17.229  -2.456  4.587   1.00 1.98  ? 16 VAL B CG1    1  
ATOM 2765  C CG2    . VAL D 3 16 ? 14.769  -2.143  4.227   1.00 3.00  ? 16 VAL B CG2    1  
ATOM 2766  H H      . VAL D 3 16 ? 14.658  0.286   2.854   1.00 1.69  ? 16 VAL B H      1  
ATOM 2767  H HA     . VAL D 3 16 ? 16.469  0.011   5.126   1.00 2.16  ? 16 VAL B HA     1  
ATOM 2768  H HB     . VAL D 3 16 ? 16.296  -1.872  2.775   1.00 2.57  ? 16 VAL B HB     1  
ATOM 2769  H HG11   . VAL D 3 16 ? 18.201  -2.228  4.174   1.00 2.19  ? 16 VAL B HG11   1  
ATOM 2770  H HG12   . VAL D 3 16 ? 17.038  -3.515  4.494   1.00 2.06  ? 16 VAL B HG12   1  
ATOM 2771  H HG13   . VAL D 3 16 ? 17.206  -2.176  5.630   1.00 2.41  ? 16 VAL B HG13   1  
ATOM 2772  H HG21   . VAL D 3 16 ? 14.542  -1.786  5.220   1.00 3.32  ? 16 VAL B HG21   1  
ATOM 2773  H HG22   . VAL D 3 16 ? 14.728  -3.222  4.215   1.00 3.50  ? 16 VAL B HG22   1  
ATOM 2774  H HG23   . VAL D 3 16 ? 14.045  -1.748  3.529   1.00 3.34  ? 16 VAL B HG23   1  
ATOM 2775  N N      . VAL D 3 17 ? 18.658  0.494   3.970   1.00 1.69  ? 17 VAL B N      1  
ATOM 2776  C CA     . VAL D 3 17 ? 19.838  1.009   3.304   1.00 1.67  ? 17 VAL B CA     1  
ATOM 2777  C C      . VAL D 3 17 ? 21.003  0.040   3.369   1.00 1.60  ? 17 VAL B C      1  
ATOM 2778  O O      . VAL D 3 17 ? 21.137  -0.742  4.313   1.00 1.68  ? 17 VAL B O      1  
ATOM 2779  C CB     . VAL D 3 17 ? 20.272  2.366   3.881   1.00 2.19  ? 17 VAL B CB     1  
ATOM 2780  C CG1    . VAL D 3 17 ? 19.312  3.460   3.433   1.00 2.26  ? 17 VAL B CG1    1  
ATOM 2781  C CG2    . VAL D 3 17 ? 20.353  2.299   5.403   1.00 2.91  ? 17 VAL B CG2    1  
ATOM 2782  H H      . VAL D 3 17 ? 18.702  0.244   4.917   1.00 2.00  ? 17 VAL B H      1  
ATOM 2783  H HA     . VAL D 3 17 ? 19.582  1.160   2.265   1.00 1.51  ? 17 VAL B HA     1  
ATOM 2784  H HB     . VAL D 3 17 ? 21.254  2.600   3.497   1.00 2.65  ? 17 VAL B HB     1  
ATOM 2785  H HG11   . VAL D 3 17 ? 19.830  4.407   3.405   1.00 2.62  ? 17 VAL B HG11   1  
ATOM 2786  H HG12   . VAL D 3 17 ? 18.487  3.523   4.128   1.00 2.46  ? 17 VAL B HG12   1  
ATOM 2787  H HG13   . VAL D 3 17 ? 18.936  3.228   2.448   1.00 2.52  ? 17 VAL B HG13   1  
ATOM 2788  H HG21   . VAL D 3 17 ? 19.356  2.306   5.818   1.00 3.46  ? 17 VAL B HG21   1  
ATOM 2789  H HG22   . VAL D 3 17 ? 20.905  3.149   5.775   1.00 3.01  ? 17 VAL B HG22   1  
ATOM 2790  H HG23   . VAL D 3 17 ? 20.858  1.388   5.694   1.00 3.36  ? 17 VAL B HG23   1  
ATOM 2791  N N      . ILE D 3 18 ? 21.835  0.108   2.346   1.00 1.68  ? 18 ILE B N      1  
ATOM 2792  C CA     . ILE D 3 18 ? 23.009  -0.734  2.244   1.00 1.70  ? 18 ILE B CA     1  
ATOM 2793  C C      . ILE D 3 18 ? 24.127  -0.151  3.101   1.00 1.87  ? 18 ILE B C      1  
ATOM 2794  O O      . ILE D 3 18 ? 24.326  1.064   3.107   1.00 2.02  ? 18 ILE B O      1  
ATOM 2795  C CB     . ILE D 3 18 ? 23.479  -0.840  0.769   1.00 1.81  ? 18 ILE B CB     1  
ATOM 2796  C CG1    . ILE D 3 18 ? 22.335  -1.339  -0.124  1.00 2.02  ? 18 ILE B CG1    1  
ATOM 2797  C CG2    . ILE D 3 18 ? 24.696  -1.751  0.641   1.00 2.44  ? 18 ILE B CG2    1  
ATOM 2798  C CD1    . ILE D 3 18 ? 21.740  -2.655  0.327   1.00 2.41  ? 18 ILE B CD1    1  
ATOM 2799  H H      . ILE D 3 18 ? 21.657  0.755   1.636   1.00 1.85  ? 18 ILE B H      1  
ATOM 2800  H HA     . ILE D 3 18 ? 22.755  -1.720  2.601   1.00 1.70  ? 18 ILE B HA     1  
ATOM 2801  H HB     . ILE D 3 18 ? 23.768  0.147   0.441   1.00 2.23  ? 18 ILE B HB     1  
ATOM 2802  H HG12   . ILE D 3 18 ? 21.544  -0.607  -0.126  1.00 2.41  ? 18 ILE B HG12   1  
ATOM 2803  H HG13   . ILE D 3 18 ? 22.702  -1.469  -1.132  1.00 2.38  ? 18 ILE B HG13   1  
ATOM 2804  H HG21   . ILE D 3 18 ? 24.431  -2.751  0.951   1.00 2.67  ? 18 ILE B HG21   1  
ATOM 2805  H HG22   . ILE D 3 18 ? 25.491  -1.379  1.271   1.00 2.85  ? 18 ILE B HG22   1  
ATOM 2806  H HG23   . ILE D 3 18 ? 25.028  -1.767  -0.386  1.00 2.95  ? 18 ILE B HG23   1  
ATOM 2807  H HD11   . ILE D 3 18 ? 22.529  -3.385  0.450   1.00 2.77  ? 18 ILE B HD11   1  
ATOM 2808  H HD12   . ILE D 3 18 ? 21.038  -3.006  -0.415  1.00 2.68  ? 18 ILE B HD12   1  
ATOM 2809  H HD13   . ILE D 3 18 ? 21.231  -2.515  1.268   1.00 2.74  ? 18 ILE B HD13   1  
ATOM 2810  N N      . PRO D 3 19 ? 24.828  -0.998  3.875   1.00 2.00  ? 19 PRO B N      1  
ATOM 2811  C CA     . PRO D 3 19 ? 25.934  -0.565  4.727   1.00 2.32  ? 19 PRO B CA     1  
ATOM 2812  C C      . PRO D 3 19 ? 26.927  0.317   3.975   1.00 2.55  ? 19 PRO B C      1  
ATOM 2813  O O      . PRO D 3 19 ? 27.350  -0.016  2.863   1.00 2.57  ? 19 PRO B O      1  
ATOM 2814  C CB     . PRO D 3 19 ? 26.602  -1.875  5.169   1.00 2.38  ? 19 PRO B CB     1  
ATOM 2815  C CG     . PRO D 3 19 ? 25.922  -2.968  4.407   1.00 2.18  ? 19 PRO B CG     1  
ATOM 2816  C CD     . PRO D 3 19 ? 24.582  -2.438  3.999   1.00 1.95  ? 19 PRO B CD     1  
ATOM 2817  H HA     . PRO D 3 19 ? 25.574  -0.033  5.595   1.00 2.47  ? 19 PRO B HA     1  
ATOM 2818  H HB2    . PRO D 3 19 ? 27.657  -1.834  4.940   1.00 2.48  ? 19 PRO B HB2    1  
ATOM 2819  H HB3    . PRO D 3 19 ? 26.470  -2.001  6.234   1.00 2.61  ? 19 PRO B HB3    1  
ATOM 2820  H HG2    . PRO D 3 19 ? 26.503  -3.219  3.532   1.00 2.22  ? 19 PRO B HG2    1  
ATOM 2821  H HG3    . PRO D 3 19 ? 25.804  -3.835  5.040   1.00 2.31  ? 19 PRO B HG3    1  
ATOM 2822  H HD2    . PRO D 3 19 ? 24.281  -2.863  3.053   1.00 1.87  ? 19 PRO B HD2    1  
ATOM 2823  H HD3    . PRO D 3 19 ? 23.842  -2.641  4.760   1.00 1.93  ? 19 PRO B HD3    1  
ATOM 2824  N N      . ILE D 3 20 ? 27.295  1.437   4.595   1.00 2.83  ? 20 ILE B N      1  
ATOM 2825  C CA     . ILE D 3 20 ? 28.221  2.396   3.995   1.00 3.18  ? 20 ILE B CA     1  
ATOM 2826  C C      . ILE D 3 20 ? 29.510  1.727   3.554   1.00 3.16  ? 20 ILE B C      1  
ATOM 2827  O O      . ILE D 3 20 ? 29.920  1.845   2.403   1.00 3.19  ? 20 ILE B O      1  
ATOM 2828  C CB     . ILE D 3 20 ? 28.584  3.532   4.974   1.00 3.64  ? 20 ILE B CB     1  
ATOM 2829  C CG1    . ILE D 3 20 ? 27.350  3.977   5.769   1.00 3.46  ? 20 ILE B CG1    1  
ATOM 2830  C CG2    . ILE D 3 20 ? 29.199  4.704   4.219   1.00 4.28  ? 20 ILE B CG2    1  
ATOM 2831  C CD1    . ILE D 3 20 ? 27.528  5.299   6.485   1.00 4.11  ? 20 ILE B CD1    1  
ATOM 2832  H H      . ILE D 3 20 ? 26.931  1.625   5.484   1.00 2.87  ? 20 ILE B H      1  
ATOM 2833  H HA     . ILE D 3 20 ? 27.740  2.833   3.132   1.00 3.27  ? 20 ILE B HA     1  
ATOM 2834  H HB     . ILE D 3 20 ? 29.326  3.154   5.662   1.00 4.11  ? 20 ILE B HB     1  
ATOM 2835  H HG12   . ILE D 3 20 ? 26.509  4.071   5.101   1.00 3.48  ? 20 ILE B HG12   1  
ATOM 2836  H HG13   . ILE D 3 20 ? 27.127  3.229   6.513   1.00 3.32  ? 20 ILE B HG13   1  
ATOM 2837  H HG21   . ILE D 3 20 ? 30.173  4.422   3.847   1.00 4.27  ? 20 ILE B HG21   1  
ATOM 2838  H HG22   . ILE D 3 20 ? 29.299  5.548   4.886   1.00 4.81  ? 20 ILE B HG22   1  
ATOM 2839  H HG23   . ILE D 3 20 ? 28.562  4.973   3.390   1.00 4.65  ? 20 ILE B HG23   1  
ATOM 2840  H HD11   . ILE D 3 20 ? 27.760  6.073   5.766   1.00 4.24  ? 20 ILE B HD11   1  
ATOM 2841  H HD12   . ILE D 3 20 ? 28.336  5.216   7.196   1.00 4.33  ? 20 ILE B HD12   1  
ATOM 2842  H HD13   . ILE D 3 20 ? 26.618  5.554   7.003   1.00 4.58  ? 20 ILE B HD13   1  
ATOM 2843  N N      . GLU D 3 21 ? 30.132  1.017   4.481   1.00 3.20  ? 21 GLU B N      1  
ATOM 2844  C CA     . GLU D 3 21 ? 31.391  0.329   4.224   1.00 3.27  ? 21 GLU B CA     1  
ATOM 2845  C C      . GLU D 3 21 ? 31.306  -0.609  3.020   1.00 3.10  ? 21 GLU B C      1  
ATOM 2846  O O      . GLU D 3 21 ? 32.271  -0.749  2.272   1.00 3.21  ? 21 GLU B O      1  
ATOM 2847  C CB     . GLU D 3 21 ? 31.818  -0.453  5.466   1.00 3.38  ? 21 GLU B CB     1  
ATOM 2848  C CG     . GLU D 3 21 ? 31.912  0.404   6.720   1.00 3.76  ? 21 GLU B CG     1  
ATOM 2849  C CD     . GLU D 3 21 ? 30.652  0.357   7.559   1.00 4.28  ? 21 GLU B CD     1  
ATOM 2850  O OE1    . GLU D 3 21 ? 29.663  1.034   7.200   1.00 4.52  ? 21 GLU B OE1    1  
ATOM 2851  O OE2    . GLU D 3 21 ? 30.644  -0.358  8.581   1.00 4.74  ? 21 GLU B OE2    1  
ATOM 2852  H H      . GLU D 3 21 ? 29.736  0.962   5.384   1.00 3.24  ? 21 GLU B H      1  
ATOM 2853  H HA     . GLU D 3 21 ? 32.136  1.082   4.020   1.00 3.47  ? 21 GLU B HA     1  
ATOM 2854  H HB2    . GLU D 3 21 ? 31.098  -1.239  5.645   1.00 3.06  ? 21 GLU B HB2    1  
ATOM 2855  H HB3    . GLU D 3 21 ? 32.785  -0.897  5.282   1.00 3.78  ? 21 GLU B HB3    1  
ATOM 2856  H HG2    . GLU D 3 21 ? 32.738  0.054   7.322   1.00 4.02  ? 21 GLU B HG2    1  
ATOM 2857  H HG3    . GLU D 3 21 ? 32.092  1.427   6.424   1.00 3.94  ? 21 GLU B HG3    1  
ATOM 2858  N N      . LEU D 3 22 ? 30.152  -1.230  2.819   1.00 2.95  ? 22 LEU B N      1  
ATOM 2859  C CA     . LEU D 3 22 ? 29.974  -2.157  1.710   1.00 2.91  ? 22 LEU B CA     1  
ATOM 2860  C C      . LEU D 3 22 ? 29.975  -1.423  0.369   1.00 2.98  ? 22 LEU B C      1  
ATOM 2861  O O      . LEU D 3 22 ? 30.802  -1.705  -0.502  1.00 3.11  ? 22 LEU B O      1  
ATOM 2862  C CB     . LEU D 3 22 ? 28.667  -2.942  1.878   1.00 2.92  ? 22 LEU B CB     1  
ATOM 2863  C CG     . LEU D 3 22 ? 28.395  -3.993  0.800   1.00 3.31  ? 22 LEU B CG     1  
ATOM 2864  C CD1    . LEU D 3 22 ? 29.451  -5.089  0.831   1.00 3.49  ? 22 LEU B CD1    1  
ATOM 2865  C CD2    . LEU D 3 22 ? 27.011  -4.591  0.980   1.00 3.65  ? 22 LEU B CD2    1  
ATOM 2866  H H      . LEU D 3 22 ? 29.398  -1.049  3.417   1.00 2.94  ? 22 LEU B H      1  
ATOM 2867  H HA     . LEU D 3 22 ? 30.801  -2.850  1.726   1.00 2.96  ? 22 LEU B HA     1  
ATOM 2868  H HB2    . LEU D 3 22 ? 28.693  -3.438  2.837   1.00 2.80  ? 22 LEU B HB2    1  
ATOM 2869  H HB3    . LEU D 3 22 ? 27.847  -2.238  1.878   1.00 3.16  ? 22 LEU B HB3    1  
ATOM 2870  H HG     . LEU D 3 22 ? 28.432  -3.518  -0.168  1.00 3.86  ? 22 LEU B HG     1  
ATOM 2871  H HD11   . LEU D 3 22 ? 29.523  -5.489  1.832   1.00 3.56  ? 22 LEU B HD11   1  
ATOM 2872  H HD12   . LEU D 3 22 ? 30.404  -4.680  0.537   1.00 3.83  ? 22 LEU B HD12   1  
ATOM 2873  H HD13   . LEU D 3 22 ? 29.171  -5.879  0.147   1.00 3.78  ? 22 LEU B HD13   1  
ATOM 2874  H HD21   . LEU D 3 22 ? 26.884  -5.412  0.292   1.00 3.81  ? 22 LEU B HD21   1  
ATOM 2875  H HD22   . LEU D 3 22 ? 26.265  -3.837  0.781   1.00 3.96  ? 22 LEU B HD22   1  
ATOM 2876  H HD23   . LEU D 3 22 ? 26.903  -4.950  1.993   1.00 4.02  ? 22 LEU B HD23   1  
ATOM 2877  N N      . ARG D 3 23 ? 29.080  -0.452  0.228   1.00 3.00  ? 23 ARG B N      1  
ATOM 2878  C CA     . ARG D 3 23 ? 28.948  0.304   -1.019  1.00 3.16  ? 23 ARG B CA     1  
ATOM 2879  C C      . ARG D 3 23 ? 30.145  1.214   -1.283  1.00 3.44  ? 23 ARG B C      1  
ATOM 2880  O O      . ARG D 3 23 ? 30.511  1.441   -2.434  1.00 3.73  ? 23 ARG B O      1  
ATOM 2881  C CB     . ARG D 3 23 ? 27.667  1.141   -0.994  1.00 3.11  ? 23 ARG B CB     1  
ATOM 2882  C CG     . ARG D 3 23 ? 26.730  0.852   -2.157  1.00 3.11  ? 23 ARG B CG     1  
ATOM 2883  C CD     . ARG D 3 23 ? 27.298  1.359   -3.475  1.00 2.93  ? 23 ARG B CD     1  
ATOM 2884  N NE     . ARG D 3 23 ? 26.615  0.769   -4.626  1.00 3.12  ? 23 ARG B NE     1  
ATOM 2885  C CZ     . ARG D 3 23 ? 26.786  1.172   -5.885  1.00 3.24  ? 23 ARG B CZ     1  
ATOM 2886  N NH1    . ARG D 3 23 ? 27.606  2.176   -6.161  1.00 3.16  ? 23 ARG B NH1    1  
ATOM 2887  N NH2    . ARG D 3 23 ? 26.132  0.565   -6.866  1.00 3.98  ? 23 ARG B NH2    1  
ATOM 2888  H H      . ARG D 3 23 ? 28.493  -0.233  0.985   1.00 2.97  ? 23 ARG B H      1  
ATOM 2889  H HA     . ARG D 3 23 ? 28.876  -0.410  -1.826  1.00 3.24  ? 23 ARG B HA     1  
ATOM 2890  H HB2    . ARG D 3 23 ? 27.136  0.941   -0.074  1.00 3.43  ? 23 ARG B HB2    1  
ATOM 2891  H HB3    . ARG D 3 23 ? 27.932  2.188   -1.026  1.00 3.17  ? 23 ARG B HB3    1  
ATOM 2892  H HG2    . ARG D 3 23 ? 26.583  -0.216  -2.230  1.00 3.36  ? 23 ARG B HG2    1  
ATOM 2893  H HG3    . ARG D 3 23 ? 25.781  1.336   -1.973  1.00 3.50  ? 23 ARG B HG3    1  
ATOM 2894  H HD2    . ARG D 3 23 ? 27.187  2.433   -3.512  1.00 2.92  ? 23 ARG B HD2    1  
ATOM 2895  H HD3    . ARG D 3 23 ? 28.348  1.106   -3.522  1.00 3.32  ? 23 ARG B HD3    1  
ATOM 2896  H HE     . ARG D 3 23 ? 25.998  0.024   -4.448  1.00 3.58  ? 23 ARG B HE     1  
ATOM 2897  H HH11   . ARG D 3 23 ? 28.103  2.641   -5.424  1.00 3.10  ? 23 ARG B HH11   1  
ATOM 2898  H HH12   . ARG D 3 23 ? 27.741  2.473   -7.111  1.00 3.55  ? 23 ARG B HH12   1  
ATOM 2899  H HH21   . ARG D 3 23 ? 25.510  -0.199  -6.659  1.00 4.46  ? 23 ARG B HH21   1  
ATOM 2900  H HH22   . ARG D 3 23 ? 26.252  0.863   -7.826  1.00 4.30  ? 23 ARG B HH22   1  
ATOM 2901  N N      . ARG D 3 24 ? 30.749  1.728   -0.225  1.00 3.48  ? 24 ARG B N      1  
ATOM 2902  C CA     . ARG D 3 24 ? 31.888  2.631   -0.357  1.00 3.87  ? 24 ARG B CA     1  
ATOM 2903  C C      . ARG D 3 24 ? 33.156  1.889   -0.783  1.00 4.04  ? 24 ARG B C      1  
ATOM 2904  O O      . ARG D 3 24 ? 34.055  2.484   -1.380  1.00 4.52  ? 24 ARG B O      1  
ATOM 2905  C CB     . ARG D 3 24 ? 32.127  3.373   0.961   1.00 4.01  ? 24 ARG B CB     1  
ATOM 2906  C CG     . ARG D 3 24 ? 33.106  4.528   0.853   1.00 4.30  ? 24 ARG B CG     1  
ATOM 2907  C CD     . ARG D 3 24 ? 32.662  5.713   1.700   1.00 4.43  ? 24 ARG B CD     1  
ATOM 2908  N NE     . ARG D 3 24 ? 31.655  6.532   1.019   1.00 4.34  ? 24 ARG B NE     1  
ATOM 2909  C CZ     . ARG D 3 24 ? 31.954  7.562   0.223   1.00 4.44  ? 24 ARG B CZ     1  
ATOM 2910  N NH1    . ARG D 3 24 ? 33.223  7.899   0.023   1.00 4.57  ? 24 ARG B NH1    1  
ATOM 2911  N NH2    . ARG D 3 24 ? 30.986  8.265   -0.361  1.00 4.80  ? 24 ARG B NH2    1  
ATOM 2912  H H      . ARG D 3 24 ? 30.416  1.502   0.675   1.00 3.34  ? 24 ARG B H      1  
ATOM 2913  H HA     . ARG D 3 24 ? 31.642  3.354   -1.121  1.00 4.06  ? 24 ARG B HA     1  
ATOM 2914  H HB2    . ARG D 3 24 ? 31.185  3.763   1.312   1.00 3.97  ? 24 ARG B HB2    1  
ATOM 2915  H HB3    . ARG D 3 24 ? 32.509  2.671   1.689   1.00 4.21  ? 24 ARG B HB3    1  
ATOM 2916  H HG2    . ARG D 3 24 ? 34.076  4.197   1.192   1.00 4.69  ? 24 ARG B HG2    1  
ATOM 2917  H HG3    . ARG D 3 24 ? 33.170  4.839   -0.180  1.00 4.44  ? 24 ARG B HG3    1  
ATOM 2918  H HD2    . ARG D 3 24 ? 32.243  5.341   2.622   1.00 4.66  ? 24 ARG B HD2    1  
ATOM 2919  H HD3    . ARG D 3 24 ? 33.523  6.328   1.920   1.00 4.80  ? 24 ARG B HD3    1  
ATOM 2920  H HE     . ARG D 3 24 ? 30.712  6.301   1.163   1.00 4.48  ? 24 ARG B HE     1  
ATOM 2921  H HH11   . ARG D 3 24 ? 33.960  7.383   0.470   1.00 4.63  ? 24 ARG B HH11   1  
ATOM 2922  H HH12   . ARG D 3 24 ? 33.453  8.664   -0.585  1.00 4.84  ? 24 ARG B HH12   1  
ATOM 2923  H HH21   . ARG D 3 24 ? 30.023  8.026   -0.206  1.00 5.00  ? 24 ARG B HH21   1  
ATOM 2924  H HH22   . ARG D 3 24 ? 31.216  9.035   -0.964  1.00 5.09  ? 24 ARG B HH22   1  
ATOM 2925  N N      . THR D 3 25 ? 33.233  0.598   -0.487  1.00 3.71  ? 25 THR B N      1  
ATOM 2926  C CA     . THR D 3 25 ? 34.411  -0.182  -0.847  1.00 3.88  ? 25 THR B CA     1  
ATOM 2927  C C      . THR D 3 25 ? 34.191  -0.989  -2.127  1.00 3.93  ? 25 THR B C      1  
ATOM 2928  O O      . THR D 3 25 ? 35.045  -0.992  -3.018  1.00 4.17  ? 25 THR B O      1  
ATOM 2929  C CB     . THR D 3 25 ? 34.823  -1.135  0.292   1.00 3.79  ? 25 THR B CB     1  
ATOM 2930  O OG1    . THR D 3 25 ? 34.739  -0.449  1.548   1.00 3.61  ? 25 THR B OG1    1  
ATOM 2931  C CG2    . THR D 3 25 ? 36.240  -1.656  0.083   1.00 4.41  ? 25 THR B CG2    1  
ATOM 2932  H H      . THR D 3 25 ? 32.488  0.162   -0.020  1.00 3.40  ? 25 THR B H      1  
ATOM 2933  H HA     . THR D 3 25 ? 35.225  0.510   -1.011  1.00 4.12  ? 25 THR B HA     1  
ATOM 2934  H HB     . THR D 3 25 ? 34.144  -1.974  0.303   1.00 3.73  ? 25 THR B HB     1  
ATOM 2935  H HG1    . THR D 3 25 ? 33.813  -0.426  1.835   1.00 3.42  ? 25 THR B HG1    1  
ATOM 2936  H HG21   . THR D 3 25 ? 36.336  -2.036  -0.923  1.00 4.69  ? 25 THR B HG21   1  
ATOM 2937  H HG22   . THR D 3 25 ? 36.440  -2.449  0.787   1.00 4.85  ? 25 THR B HG22   1  
ATOM 2938  H HG23   . THR D 3 25 ? 36.947  -0.853  0.235   1.00 4.44  ? 25 THR B HG23   1  
ATOM 2939  N N      . LEU D 3 26 ? 33.044  -1.653  -2.231  1.00 3.82  ? 26 LEU B N      1  
ATOM 2940  C CA     . LEU D 3 26 ? 32.752  -2.472  -3.401  1.00 3.97  ? 26 LEU B CA     1  
ATOM 2941  C C      . LEU D 3 26 ? 31.369  -2.183  -3.972  1.00 3.98  ? 26 LEU B C      1  
ATOM 2942  O O      . LEU D 3 26 ? 30.354  -2.622  -3.428  1.00 4.65  ? 26 LEU B O      1  
ATOM 2943  C CB     . LEU D 3 26 ? 32.858  -3.960  -3.050  1.00 4.17  ? 26 LEU B CB     1  
ATOM 2944  C CG     . LEU D 3 26 ? 34.274  -4.469  -2.765  1.00 4.38  ? 26 LEU B CG     1  
ATOM 2945  C CD1    . LEU D 3 26 ? 34.398  -4.918  -1.316  1.00 4.85  ? 26 LEU B CD1    1  
ATOM 2946  C CD2    . LEU D 3 26 ? 34.631  -5.606  -3.710  1.00 4.74  ? 26 LEU B CD2    1  
ATOM 2947  H H      . LEU D 3 26 ? 32.373  -1.583  -1.513  1.00 3.72  ? 26 LEU B H      1  
ATOM 2948  H HA     . LEU D 3 26 ? 33.488  -2.241  -4.155  1.00 4.17  ? 26 LEU B HA     1  
ATOM 2949  H HB2    . LEU D 3 26 ? 32.250  -4.143  -2.177  1.00 4.27  ? 26 LEU B HB2    1  
ATOM 2950  H HB3    . LEU D 3 26 ? 32.454  -4.531  -3.874  1.00 4.41  ? 26 LEU B HB3    1  
ATOM 2951  H HG     . LEU D 3 26 ? 34.979  -3.666  -2.924  1.00 4.44  ? 26 LEU B HG     1  
ATOM 2952  H HD11   . LEU D 3 26 ? 34.022  -4.141  -0.667  1.00 5.35  ? 26 LEU B HD11   1  
ATOM 2953  H HD12   . LEU D 3 26 ? 35.437  -5.108  -1.086  1.00 5.08  ? 26 LEU B HD12   1  
ATOM 2954  H HD13   . LEU D 3 26 ? 33.826  -5.820  -1.166  1.00 4.83  ? 26 LEU B HD13   1  
ATOM 2955  H HD21   . LEU D 3 26 ? 34.464  -5.291  -4.730  1.00 4.76  ? 26 LEU B HD21   1  
ATOM 2956  H HD22   . LEU D 3 26 ? 34.013  -6.464  -3.492  1.00 5.04  ? 26 LEU B HD22   1  
ATOM 2957  H HD23   . LEU D 3 26 ? 35.671  -5.869  -3.581  1.00 5.02  ? 26 LEU B HD23   1  
ATOM 2958  N N      . GLY D 3 27 ? 31.334  -1.453  -5.076  1.00 3.54  ? 27 GLY B N      1  
ATOM 2959  C CA     . GLY D 3 27 ? 30.074  -1.149  -5.727  1.00 3.69  ? 27 GLY B CA     1  
ATOM 2960  C C      . GLY D 3 27 ? 29.655  -2.278  -6.646  1.00 3.35  ? 27 GLY B C      1  
ATOM 2961  O O      . GLY D 3 27 ? 29.427  -2.076  -7.838  1.00 3.67  ? 27 GLY B O      1  
ATOM 2962  H H      . GLY D 3 27 ? 32.171  -1.112  -5.455  1.00 3.37  ? 27 GLY B H      1  
ATOM 2963  H HA2    . GLY D 3 27 ? 29.313  -0.999  -4.976  1.00 3.98  ? 27 GLY B HA2    1  
ATOM 2964  H HA3    . GLY D 3 27 ? 30.184  -0.245  -6.308  1.00 4.09  ? 27 GLY B HA3    1  
ATOM 2965  N N      . ILE D 3 28 ? 29.556  -3.472  -6.079  1.00 3.04  ? 28 ILE B N      1  
ATOM 2966  C CA     . ILE D 3 28 ? 29.192  -4.667  -6.830  1.00 3.06  ? 28 ILE B CA     1  
ATOM 2967  C C      . ILE D 3 28 ? 27.681  -4.872  -6.889  1.00 3.03  ? 28 ILE B C      1  
ATOM 2968  O O      . ILE D 3 28 ? 27.204  -5.899  -7.374  1.00 3.20  ? 28 ILE B O      1  
ATOM 2969  C CB     . ILE D 3 28 ? 29.852  -5.923  -6.223  1.00 3.39  ? 28 ILE B CB     1  
ATOM 2970  C CG1    . ILE D 3 28 ? 29.635  -5.967  -4.706  1.00 3.37  ? 28 ILE B CG1    1  
ATOM 2971  C CG2    . ILE D 3 28 ? 31.338  -5.948  -6.553  1.00 4.01  ? 28 ILE B CG2    1  
ATOM 2972  C CD1    . ILE D 3 28 ? 30.184  -7.215  -4.042  1.00 3.80  ? 28 ILE B CD1    1  
ATOM 2973  H H      . ILE D 3 28 ? 29.735  -3.554  -5.116  1.00 3.08  ? 28 ILE B H      1  
ATOM 2974  H HA     . ILE D 3 28 ? 29.564  -4.550  -7.835  1.00 3.28  ? 28 ILE B HA     1  
ATOM 2975  H HB     . ILE D 3 28 ? 29.395  -6.792  -6.671  1.00 3.67  ? 28 ILE B HB     1  
ATOM 2976  H HG12   . ILE D 3 28 ? 30.121  -5.114  -4.256  1.00 3.58  ? 28 ILE B HG12   1  
ATOM 2977  H HG13   . ILE D 3 28 ? 28.575  -5.920  -4.501  1.00 3.30  ? 28 ILE B HG13   1  
ATOM 2978  H HG21   . ILE D 3 28 ? 31.780  -6.847  -6.151  1.00 4.49  ? 28 ILE B HG21   1  
ATOM 2979  H HG22   . ILE D 3 28 ? 31.818  -5.086  -6.114  1.00 4.26  ? 28 ILE B HG22   1  
ATOM 2980  H HG23   . ILE D 3 28 ? 31.468  -5.928  -7.624  1.00 4.19  ? 28 ILE B HG23   1  
ATOM 2981  H HD11   . ILE D 3 28 ? 31.255  -7.259  -4.183  1.00 4.14  ? 28 ILE B HD11   1  
ATOM 2982  H HD12   . ILE D 3 28 ? 29.728  -8.088  -4.483  1.00 4.28  ? 28 ILE B HD12   1  
ATOM 2983  H HD13   . ILE D 3 28 ? 29.962  -7.189  -2.984  1.00 3.69  ? 28 ILE B HD13   1  
ATOM 2984  N N      . ALA D 3 29 ? 26.933  -3.894  -6.402  1.00 3.27  ? 29 ALA B N      1  
ATOM 2985  C CA     . ALA D 3 29 ? 25.479  -3.970  -6.403  1.00 3.62  ? 29 ALA B CA     1  
ATOM 2986  C C      . ALA D 3 29 ? 24.878  -2.608  -6.715  1.00 3.51  ? 29 ALA B C      1  
ATOM 2987  O O      . ALA D 3 29 ? 24.982  -1.674  -5.913  1.00 3.86  ? 29 ALA B O      1  
ATOM 2988  C CB     . ALA D 3 29 ? 24.970  -4.480  -5.060  1.00 4.43  ? 29 ALA B CB     1  
ATOM 2989  H H      . ALA D 3 29 ? 27.369  -3.097  -6.039  1.00 3.48  ? 29 ALA B H      1  
ATOM 2990  H HA     . ALA D 3 29 ? 25.180  -4.671  -7.170  1.00 3.69  ? 29 ALA B HA     1  
ATOM 2991  H HB1    . ALA D 3 29 ? 25.379  -5.461  -4.869  1.00 4.65  ? 29 ALA B HB1    1  
ATOM 2992  H HB2    . ALA D 3 29 ? 23.891  -4.537  -5.082  1.00 4.89  ? 29 ALA B HB2    1  
ATOM 2993  H HB3    . ALA D 3 29 ? 25.278  -3.803  -4.277  1.00 4.68  ? 29 ALA B HB3    1  
ATOM 2994  N N      . GLU D 3 30 ? 24.280  -2.488  -7.895  1.00 3.46  ? 30 GLU B N      1  
ATOM 2995  C CA     . GLU D 3 30 ? 23.659  -1.240  -8.312  1.00 3.58  ? 30 GLU B CA     1  
ATOM 2996  C C      . GLU D 3 30 ? 22.361  -0.991  -7.552  1.00 3.18  ? 30 GLU B C      1  
ATOM 2997  O O      . GLU D 3 30 ? 21.873  -1.856  -6.827  1.00 3.51  ? 30 GLU B O      1  
ATOM 2998  C CB     . GLU D 3 30 ? 23.397  -1.234  -9.818  1.00 4.35  ? 30 GLU B CB     1  
ATOM 2999  C CG     . GLU D 3 30 ? 24.354  -0.337  -10.580 1.00 4.87  ? 30 GLU B CG     1  
ATOM 3000  C CD     . GLU D 3 30 ? 24.593  0.980   -9.873  1.00 5.07  ? 30 GLU B CD     1  
ATOM 3001  O OE1    . GLU D 3 30 ? 23.632  1.765   -9.719  1.00 5.08  ? 30 GLU B OE1    1  
ATOM 3002  O OE2    . GLU D 3 30 ? 25.740  1.227   -9.444  1.00 5.56  ? 30 GLU B OE2    1  
ATOM 3003  H H      . GLU D 3 30 ? 24.264  -3.258  -8.504  1.00 3.62  ? 30 GLU B H      1  
ATOM 3004  H HA     . GLU D 3 30 ? 24.348  -0.442  -8.078  1.00 3.74  ? 30 GLU B HA     1  
ATOM 3005  H HB2    . GLU D 3 30 ? 23.495  -2.241  -10.196 1.00 4.66  ? 30 GLU B HB2    1  
ATOM 3006  H HB3    . GLU D 3 30 ? 22.391  -0.884  -9.998  1.00 4.68  ? 30 GLU B HB3    1  
ATOM 3007  H HG2    . GLU D 3 30 ? 25.299  -0.846  -10.685 1.00 5.33  ? 30 GLU B HG2    1  
ATOM 3008  H HG3    . GLU D 3 30 ? 23.942  -0.134  -11.556 1.00 5.08  ? 30 GLU B HG3    1  
ATOM 3009  N N      . LYS D 3 31 ? 21.806  0.193   -7.736  1.00 2.71  ? 31 LYS B N      1  
ATOM 3010  C CA     . LYS D 3 31 ? 20.579  0.573   -7.054  1.00 2.64  ? 31 LYS B CA     1  
ATOM 3011  C C      . LYS D 3 31 ? 19.593  1.215   -8.020  1.00 2.23  ? 31 LYS B C      1  
ATOM 3012  O O      . LYS D 3 31 ? 19.921  2.195   -8.690  1.00 2.37  ? 31 LYS B O      1  
ATOM 3013  C CB     . LYS D 3 31 ? 20.884  1.533   -5.893  1.00 3.12  ? 31 LYS B CB     1  
ATOM 3014  C CG     . LYS D 3 31 ? 22.272  2.171   -5.941  1.00 3.70  ? 31 LYS B CG     1  
ATOM 3015  C CD     . LYS D 3 31 ? 22.390  3.172   -7.077  1.00 4.02  ? 31 LYS B CD     1  
ATOM 3016  C CE     . LYS D 3 31 ? 23.792  3.748   -7.183  1.00 4.47  ? 31 LYS B CE     1  
ATOM 3017  N NZ     . LYS D 3 31 ? 24.102  4.172   -8.572  1.00 4.47  ? 31 LYS B NZ     1  
ATOM 3018  H H      . LYS D 3 31 ? 22.223  0.828   -8.361  1.00 2.63  ? 31 LYS B H      1  
ATOM 3019  H HA     . LYS D 3 31 ? 20.136  -0.327  -6.653  1.00 2.90  ? 31 LYS B HA     1  
ATOM 3020  H HB2    . LYS D 3 31 ? 20.150  2.328   -5.900  1.00 3.09  ? 31 LYS B HB2    1  
ATOM 3021  H HB3    . LYS D 3 31 ? 20.796  0.991   -4.963  1.00 3.52  ? 31 LYS B HB3    1  
ATOM 3022  H HG2    . LYS D 3 31 ? 22.457  2.679   -5.007  1.00 3.87  ? 31 LYS B HG2    1  
ATOM 3023  H HG3    . LYS D 3 31 ? 23.011  1.394   -6.081  1.00 4.03  ? 31 LYS B HG3    1  
ATOM 3024  H HD2    . LYS D 3 31 ? 22.148  2.676   -8.005  1.00 4.01  ? 31 LYS B HD2    1  
ATOM 3025  H HD3    . LYS D 3 31 ? 21.692  3.978   -6.908  1.00 4.34  ? 31 LYS B HD3    1  
ATOM 3026  H HE2    . LYS D 3 31 ? 23.866  4.603   -6.529  1.00 4.96  ? 31 LYS B HE2    1  
ATOM 3027  H HE3    . LYS D 3 31 ? 24.504  2.995   -6.875  1.00 4.78  ? 31 LYS B HE3    1  
ATOM 3028  H HZ1    . LYS D 3 31 ? 23.394  4.856   -8.905  1.00 4.57  ? 31 LYS B HZ1    1  
ATOM 3029  H HZ2    . LYS D 3 31 ? 24.094  3.343   -9.208  1.00 4.42  ? 31 LYS B HZ2    1  
ATOM 3030  H HZ3    . LYS D 3 31 ? 25.044  4.617   -8.611  1.00 4.89  ? 31 LYS B HZ3    1  
ATOM 3031  N N      . ASP D 3 32 ? 18.402  0.630   -8.101  1.00 2.16  ? 32 ASP B N      1  
ATOM 3032  C CA     . ASP D 3 32 ? 17.325  1.120   -8.967  1.00 2.20  ? 32 ASP B CA     1  
ATOM 3033  C C      . ASP D 3 32 ? 16.151  0.159   -8.902  1.00 1.94  ? 32 ASP B C      1  
ATOM 3034  O O      . ASP D 3 32 ? 15.038  0.533   -8.542  1.00 2.05  ? 32 ASP B O      1  
ATOM 3035  C CB     . ASP D 3 32 ? 17.788  1.260   -10.422 1.00 2.40  ? 32 ASP B CB     1  
ATOM 3036  C CG     . ASP D 3 32 ? 16.665  1.690   -11.346 1.00 3.06  ? 32 ASP B CG     1  
ATOM 3037  O OD1    . ASP D 3 32 ? 16.066  2.764   -11.112 1.00 3.96  ? 32 ASP B OD1    1  
ATOM 3038  O OD2    . ASP D 3 32 ? 16.385  0.961   -12.322 1.00 3.01  ? 32 ASP B OD2    1  
ATOM 3039  H H      . ASP D 3 32 ? 18.237  -0.167  -7.557  1.00 2.38  ? 32 ASP B H      1  
ATOM 3040  H HA     . ASP D 3 32 ? 17.011  2.086   -8.596  1.00 2.67  ? 32 ASP B HA     1  
ATOM 3041  H HB2    . ASP D 3 32 ? 18.575  1.996   -10.473 1.00 2.66  ? 32 ASP B HB2    1  
ATOM 3042  H HB3    . ASP D 3 32 ? 18.170  0.307   -10.765 1.00 2.18  ? 32 ASP B HB3    1  
ATOM 3043  N N      . ALA D 3 33 ? 16.420  -1.093  -9.233  1.00 1.84  ? 33 ALA B N      1  
ATOM 3044  C CA     . ALA D 3 33 ? 15.406  -2.131  -9.210  1.00 1.77  ? 33 ALA B CA     1  
ATOM 3045  C C      . ALA D 3 33 ? 16.003  -3.415  -8.662  1.00 1.64  ? 33 ALA B C      1  
ATOM 3046  O O      . ALA D 3 33 ? 17.199  -3.659  -8.812  1.00 1.77  ? 33 ALA B O      1  
ATOM 3047  C CB     . ALA D 3 33 ? 14.838  -2.351  -10.604 1.00 1.98  ? 33 ALA B CB     1  
ATOM 3048  H H      . ALA D 3 33 ? 17.333  -1.331  -9.499  1.00 1.99  ? 33 ALA B H      1  
ATOM 3049  H HA     . ALA D 3 33 ? 14.605  -1.808  -8.561  1.00 1.79  ? 33 ALA B HA     1  
ATOM 3050  H HB1    . ALA D 3 33 ? 14.283  -1.477  -10.910 1.00 2.71  ? 33 ALA B HB1    1  
ATOM 3051  H HB2    . ALA D 3 33 ? 14.184  -3.210  -10.595 1.00 2.11  ? 33 ALA B HB2    1  
ATOM 3052  H HB3    . ALA D 3 33 ? 15.648  -2.523  -11.297 1.00 1.95  ? 33 ALA B HB3    1  
ATOM 3053  N N      . LEU D 3 34 ? 15.177  -4.228  -8.023  1.00 1.54  ? 34 LEU B N      1  
ATOM 3054  C CA     . LEU D 3 34 ? 15.632  -5.486  -7.441  1.00 1.50  ? 34 LEU B CA     1  
ATOM 3055  C C      . LEU D 3 34 ? 14.515  -6.523  -7.471  1.00 1.64  ? 34 LEU B C      1  
ATOM 3056  O O      . LEU D 3 34 ? 13.334  -6.172  -7.520  1.00 1.65  ? 34 LEU B O      1  
ATOM 3057  C CB     . LEU D 3 34 ? 16.086  -5.272  -5.990  1.00 1.43  ? 34 LEU B CB     1  
ATOM 3058  C CG     . LEU D 3 34 ? 17.345  -4.422  -5.805  1.00 1.73  ? 34 LEU B CG     1  
ATOM 3059  C CD1    . LEU D 3 34 ? 17.405  -3.861  -4.397  1.00 2.40  ? 34 LEU B CD1    1  
ATOM 3060  C CD2    . LEU D 3 34 ? 18.593  -5.237  -6.102  1.00 1.89  ? 34 LEU B CD2    1  
ATOM 3061  H H      . LEU D 3 34 ? 14.229  -3.979  -7.943  1.00 1.62  ? 34 LEU B H      1  
ATOM 3062  H HA     . LEU D 3 34 ? 16.464  -5.846  -8.026  1.00 1.51  ? 34 LEU B HA     1  
ATOM 3063  H HB2    . LEU D 3 34 ? 15.280  -4.799  -5.451  1.00 1.65  ? 34 LEU B HB2    1  
ATOM 3064  H HB3    . LEU D 3 34 ? 16.269  -6.241  -5.549  1.00 1.60  ? 34 LEU B HB3    1  
ATOM 3065  H HG     . LEU D 3 34 ? 17.316  -3.590  -6.493  1.00 2.25  ? 34 LEU B HG     1  
ATOM 3066  H HD11   . LEU D 3 34 ? 18.372  -3.412  -4.229  1.00 2.95  ? 34 LEU B HD11   1  
ATOM 3067  H HD12   . LEU D 3 34 ? 17.248  -4.659  -3.685  1.00 2.67  ? 34 LEU B HD12   1  
ATOM 3068  H HD13   . LEU D 3 34 ? 16.636  -3.114  -4.275  1.00 2.78  ? 34 LEU B HD13   1  
ATOM 3069  H HD21   . LEU D 3 34 ? 18.483  -5.730  -7.054  1.00 2.12  ? 34 LEU B HD21   1  
ATOM 3070  H HD22   . LEU D 3 34 ? 18.734  -5.976  -5.325  1.00 2.47  ? 34 LEU B HD22   1  
ATOM 3071  H HD23   . LEU D 3 34 ? 19.451  -4.581  -6.133  1.00 2.10  ? 34 LEU B HD23   1  
ATOM 3072  N N      . GLU D 3 35 ? 14.891  -7.795  -7.450  1.00 1.82  ? 35 GLU B N      1  
ATOM 3073  C CA     . GLU D 3 35 ? 13.920  -8.877  -7.450  1.00 2.02  ? 35 GLU B CA     1  
ATOM 3074  C C      . GLU D 3 35 ? 13.608  -9.286  -6.019  1.00 1.95  ? 35 GLU B C      1  
ATOM 3075  O O      . GLU D 3 35 ? 14.510  -9.618  -5.249  1.00 1.91  ? 35 GLU B O      1  
ATOM 3076  C CB     . GLU D 3 35 ? 14.435  -10.079 -8.238  1.00 2.29  ? 35 GLU B CB     1  
ATOM 3077  C CG     . GLU D 3 35 ? 14.004  -10.090 -9.697  1.00 2.57  ? 35 GLU B CG     1  
ATOM 3078  C CD     . GLU D 3 35 ? 13.993  -11.485 -10.286 1.00 2.74  ? 35 GLU B CD     1  
ATOM 3079  O OE1    . GLU D 3 35 ? 15.056  -12.148 -10.283 1.00 3.00  ? 35 GLU B OE1    1  
ATOM 3080  O OE2    . GLU D 3 35 ? 12.921  -11.929 -10.746 1.00 2.97  ? 35 GLU B OE2    1  
ATOM 3081  H H      . GLU D 3 35 ? 15.850  -8.010  -7.419  1.00 1.85  ? 35 GLU B H      1  
ATOM 3082  H HA     . GLU D 3 35 ? 13.015  -8.511  -7.911  1.00 2.12  ? 35 GLU B HA     1  
ATOM 3083  H HB2    . GLU D 3 35 ? 15.515  -10.079 -8.206  1.00 2.50  ? 35 GLU B HB2    1  
ATOM 3084  H HB3    . GLU D 3 35 ? 14.071  -10.983 -7.771  1.00 2.33  ? 35 GLU B HB3    1  
ATOM 3085  H HG2    . GLU D 3 35 ? 13.008  -9.679  -9.769  1.00 2.61  ? 35 GLU B HG2    1  
ATOM 3086  H HG3    . GLU D 3 35 ? 14.688  -9.479  -10.268 1.00 3.12  ? 35 GLU B HG3    1  
ATOM 3087  N N      . ILE D 3 36 ? 12.334  -9.242  -5.668  1.00 2.02  ? 36 ILE B N      1  
ATOM 3088  C CA     . ILE D 3 36 ? 11.894  -9.589  -4.328  1.00 2.04  ? 36 ILE B CA     1  
ATOM 3089  C C      . ILE D 3 36 ? 11.490  -11.052 -4.227  1.00 2.29  ? 36 ILE B C      1  
ATOM 3090  O O      . ILE D 3 36 ? 10.508  -11.481 -4.838  1.00 2.50  ? 36 ILE B O      1  
ATOM 3091  C CB     . ILE D 3 36 ? 10.691  -8.730  -3.890  1.00 2.10  ? 36 ILE B CB     1  
ATOM 3092  C CG1    . ILE D 3 36 ? 10.938  -7.244  -4.178  1.00 1.97  ? 36 ILE B CG1    1  
ATOM 3093  C CG2    . ILE D 3 36 ? 10.383  -8.952  -2.414  1.00 2.32  ? 36 ILE B CG2    1  
ATOM 3094  C CD1    . ILE D 3 36 ? 12.138  -6.663  -3.461  1.00 2.25  ? 36 ILE B CD1    1  
ATOM 3095  H H      . ILE D 3 36 ? 11.665  -8.957  -6.332  1.00 2.12  ? 36 ILE B H      1  
ATOM 3096  H HA     . ILE D 3 36 ? 12.712  -9.401  -3.649  1.00 1.89  ? 36 ILE B HA     1  
ATOM 3097  H HB     . ILE D 3 36 ? 9.833   -9.055  -4.455  1.00 2.33  ? 36 ILE B HB     1  
ATOM 3098  H HG12   . ILE D 3 36 ? 11.094  -7.111  -5.238  1.00 2.16  ? 36 ILE B HG12   1  
ATOM 3099  H HG13   . ILE D 3 36 ? 10.068  -6.681  -3.875  1.00 2.09  ? 36 ILE B HG13   1  
ATOM 3100  H HG21   . ILE D 3 36 ? 11.105  -8.421  -1.811  1.00 2.19  ? 36 ILE B HG21   1  
ATOM 3101  H HG22   . ILE D 3 36 ? 10.435  -10.006 -2.191  1.00 2.73  ? 36 ILE B HG22   1  
ATOM 3102  H HG23   . ILE D 3 36 ? 9.392   -8.587  -2.194  1.00 2.68  ? 36 ILE B HG23   1  
ATOM 3103  H HD11   . ILE D 3 36 ? 12.077  -6.899  -2.408  1.00 2.23  ? 36 ILE B HD11   1  
ATOM 3104  H HD12   . ILE D 3 36 ? 12.149  -5.591  -3.586  1.00 2.79  ? 36 ILE B HD12   1  
ATOM 3105  H HD13   . ILE D 3 36 ? 13.043  -7.081  -3.874  1.00 2.68  ? 36 ILE B HD13   1  
ATOM 3106  N N      . TYR D 3 37 ? 12.257  -11.811 -3.463  1.00 2.32  ? 37 TYR B N      1  
ATOM 3107  C CA     . TYR D 3 37 ? 11.964  -13.213 -3.240  1.00 2.59  ? 37 TYR B CA     1  
ATOM 3108  C C      . TYR D 3 37 ? 11.433  -13.390 -1.825  1.00 2.61  ? 37 TYR B C      1  
ATOM 3109  O O      . TYR D 3 37 ? 12.202  -13.421 -0.860  1.00 2.58  ? 37 TYR B O      1  
ATOM 3110  C CB     . TYR D 3 37 ? 13.211  -14.079 -3.436  1.00 2.75  ? 37 TYR B CB     1  
ATOM 3111  C CG     . TYR D 3 37 ? 13.712  -14.148 -4.859  1.00 2.85  ? 37 TYR B CG     1  
ATOM 3112  C CD1    . TYR D 3 37 ? 14.485  -13.128 -5.392  1.00 3.50  ? 37 TYR B CD1    1  
ATOM 3113  C CD2    . TYR D 3 37 ? 13.427  -15.244 -5.663  1.00 2.77  ? 37 TYR B CD2    1  
ATOM 3114  C CE1    . TYR D 3 37 ? 14.957  -13.195 -6.684  1.00 3.95  ? 37 TYR B CE1    1  
ATOM 3115  C CE2    . TYR D 3 37 ? 13.903  -15.319 -6.958  1.00 3.20  ? 37 TYR B CE2    1  
ATOM 3116  C CZ     . TYR D 3 37 ? 14.667  -14.289 -7.462  1.00 3.75  ? 37 TYR B CZ     1  
ATOM 3117  O OH     . TYR D 3 37 ? 15.148  -14.352 -8.748  1.00 4.39  ? 37 TYR B OH     1  
ATOM 3118  H H      . TYR D 3 37 ? 13.056  -11.418 -3.042  1.00 2.19  ? 37 TYR B H      1  
ATOM 3119  H HA     . TYR D 3 37 ? 11.204  -13.515 -3.946  1.00 2.72  ? 37 TYR B HA     1  
ATOM 3120  H HB2    . TYR D 3 37 ? 14.009  -13.684 -2.830  1.00 3.12  ? 37 TYR B HB2    1  
ATOM 3121  H HB3    . TYR D 3 37 ? 12.991  -15.087 -3.114  1.00 2.73  ? 37 TYR B HB3    1  
ATOM 3122  H HD1    . TYR D 3 37 ? 14.713  -12.266 -4.781  1.00 3.87  ? 37 TYR B HD1    1  
ATOM 3123  H HD2    . TYR D 3 37 ? 12.825  -16.045 -5.264  1.00 2.73  ? 37 TYR B HD2    1  
ATOM 3124  H HE1    . TYR D 3 37 ? 15.554  -12.391 -7.079  1.00 4.64  ? 37 TYR B HE1    1  
ATOM 3125  H HE2    . TYR D 3 37 ? 13.671  -16.179 -7.571  1.00 3.38  ? 37 TYR B HE2    1  
ATOM 3126  H HH     . TYR D 3 37 ? 14.996  -13.501 -9.190  1.00 4.65  ? 37 TYR B HH     1  
ATOM 3127  N N      . VAL D 3 38 ? 10.117  -13.461 -1.698  1.00 2.74  ? 38 VAL B N      1  
ATOM 3128  C CA     . VAL D 3 38 ? 9.494   -13.638 -0.397  1.00 2.84  ? 38 VAL B CA     1  
ATOM 3129  C C      . VAL D 3 38 ? 9.605   -15.097 0.026   1.00 3.25  ? 38 VAL B C      1  
ATOM 3130  O O      . VAL D 3 38 ? 8.749   -15.921 -0.291  1.00 3.60  ? 38 VAL B O      1  
ATOM 3131  C CB     . VAL D 3 38 ? 8.009   -13.208 -0.395  1.00 2.93  ? 38 VAL B CB     1  
ATOM 3132  C CG1    . VAL D 3 38 ? 7.426   -13.283 1.010   1.00 3.28  ? 38 VAL B CG1    1  
ATOM 3133  C CG2    . VAL D 3 38 ? 7.859   -11.802 -0.961  1.00 3.00  ? 38 VAL B CG2    1  
ATOM 3134  H H      . VAL D 3 38 ? 9.554   -13.411 -2.500  1.00 2.83  ? 38 VAL B H      1  
ATOM 3135  H HA     . VAL D 3 38 ? 10.029  -13.025 0.314   1.00 2.65  ? 38 VAL B HA     1  
ATOM 3136  H HB     . VAL D 3 38 ? 7.457   -13.887 -1.026  1.00 3.20  ? 38 VAL B HB     1  
ATOM 3137  H HG11   . VAL D 3 38 ? 6.351   -13.191 0.959   1.00 3.34  ? 38 VAL B HG11   1  
ATOM 3138  H HG12   . VAL D 3 38 ? 7.827   -12.480 1.609   1.00 3.80  ? 38 VAL B HG12   1  
ATOM 3139  H HG13   . VAL D 3 38 ? 7.687   -14.231 1.458   1.00 3.54  ? 38 VAL B HG13   1  
ATOM 3140  H HG21   . VAL D 3 38 ? 8.544   -11.136 -0.456  1.00 3.20  ? 38 VAL B HG21   1  
ATOM 3141  H HG22   . VAL D 3 38 ? 6.847   -11.457 -0.808  1.00 3.30  ? 38 VAL B HG22   1  
ATOM 3142  H HG23   . VAL D 3 38 ? 8.077   -11.814 -2.018  1.00 3.24  ? 38 VAL B HG23   1  
ATOM 3143  N N      . ASP D 3 39 ? 10.680  -15.417 0.721   1.00 3.28  ? 39 ASP B N      1  
ATOM 3144  C CA     . ASP D 3 39 ? 10.913  -16.776 1.167   1.00 3.71  ? 39 ASP B CA     1  
ATOM 3145  C C      . ASP D 3 39 ? 10.325  -16.989 2.553   1.00 3.82  ? 39 ASP B C      1  
ATOM 3146  O O      . ASP D 3 39 ? 11.041  -16.974 3.557   1.00 3.70  ? 39 ASP B O      1  
ATOM 3147  C CB     . ASP D 3 39 ? 12.406  -17.097 1.161   1.00 3.79  ? 39 ASP B CB     1  
ATOM 3148  C CG     . ASP D 3 39 ? 12.668  -18.584 1.157   1.00 4.29  ? 39 ASP B CG     1  
ATOM 3149  O OD1    . ASP D 3 39 ? 12.735  -19.185 2.246   1.00 4.31  ? 39 ASP B OD1    1  
ATOM 3150  O OD2    . ASP D 3 39 ? 12.809  -19.162 0.057   1.00 4.74  ? 39 ASP B OD2    1  
ATOM 3151  H H      . ASP D 3 39 ? 11.331  -14.716 0.951   1.00 3.03  ? 39 ASP B H      1  
ATOM 3152  H HA     . ASP D 3 39 ? 10.413  -17.438 0.475   1.00 3.96  ? 39 ASP B HA     1  
ATOM 3153  H HB2    . ASP D 3 39 ? 12.858  -16.669 0.279   1.00 3.74  ? 39 ASP B HB2    1  
ATOM 3154  H HB3    . ASP D 3 39 ? 12.865  -16.670 2.040   1.00 3.61  ? 39 ASP B HB3    1  
ATOM 3155  N N      . ASP D 3 40 ? 9.006   -17.149 2.588   1.00 4.14  ? 40 ASP B N      1  
ATOM 3156  C CA     . ASP D 3 40 ? 8.257   -17.377 3.823   1.00 4.34  ? 40 ASP B CA     1  
ATOM 3157  C C      . ASP D 3 40 ? 8.299   -16.168 4.756   1.00 3.97  ? 40 ASP B C      1  
ATOM 3158  O O      . ASP D 3 40 ? 7.349   -15.389 4.803   1.00 3.99  ? 40 ASP B O      1  
ATOM 3159  C CB     . ASP D 3 40 ? 8.762   -18.625 4.548   1.00 4.62  ? 40 ASP B CB     1  
ATOM 3160  C CG     . ASP D 3 40 ? 7.762   -19.136 5.563   1.00 4.88  ? 40 ASP B CG     1  
ATOM 3161  O OD1    . ASP D 3 40 ? 6.641   -19.516 5.165   1.00 4.81  ? 40 ASP B OD1    1  
ATOM 3162  O OD2    . ASP D 3 40 ? 8.089   -19.167 6.765   1.00 5.38  ? 40 ASP B OD2    1  
ATOM 3163  H H      . ASP D 3 40 ? 8.508   -17.108 1.742   1.00 4.29  ? 40 ASP B H      1  
ATOM 3164  H HA     . ASP D 3 40 ? 7.228   -17.545 3.541   1.00 4.66  ? 40 ASP B HA     1  
ATOM 3165  H HB2    . ASP D 3 40 ? 8.947   -19.404 3.824   1.00 4.59  ? 40 ASP B HB2    1  
ATOM 3166  H HB3    . ASP D 3 40 ? 9.681   -18.391 5.061   1.00 4.81  ? 40 ASP B HB3    1  
ATOM 3167  N N      . GLU D 3 41 ? 9.395   -16.000 5.488   1.00 3.76  ? 41 GLU B N      1  
ATOM 3168  C CA     . GLU D 3 41 ? 9.520   -14.884 6.422   1.00 3.52  ? 41 GLU B CA     1  
ATOM 3169  C C      . GLU D 3 41 ? 10.734  -14.009 6.117   1.00 3.14  ? 41 GLU B C      1  
ATOM 3170  O O      . GLU D 3 41 ? 10.925  -12.968 6.747   1.00 3.03  ? 41 GLU B O      1  
ATOM 3171  C CB     . GLU D 3 41 ? 9.595   -15.397 7.863   1.00 3.70  ? 41 GLU B CB     1  
ATOM 3172  C CG     . GLU D 3 41 ? 10.066  -16.835 7.986   1.00 3.70  ? 41 GLU B CG     1  
ATOM 3173  C CD     . GLU D 3 41 ? 11.572  -16.966 7.927   1.00 3.35  ? 41 GLU B CD     1  
ATOM 3174  O OE1    . GLU D 3 41 ? 12.235  -16.693 8.950   1.00 3.36  ? 41 GLU B OE1    1  
ATOM 3175  O OE2    . GLU D 3 41 ? 12.100  -17.353 6.861   1.00 3.53  ? 41 GLU B OE2    1  
ATOM 3176  H H      . GLU D 3 41 ? 10.137  -16.638 5.400   1.00 3.87  ? 41 GLU B H      1  
ATOM 3177  H HA     . GLU D 3 41 ? 8.631   -14.279 6.320   1.00 3.59  ? 41 GLU B HA     1  
ATOM 3178  H HB2    . GLU D 3 41 ? 10.279  -14.773 8.416   1.00 3.94  ? 41 GLU B HB2    1  
ATOM 3179  H HB3    . GLU D 3 41 ? 8.614   -15.323 8.310   1.00 3.97  ? 41 GLU B HB3    1  
ATOM 3180  H HG2    . GLU D 3 41 ? 9.724   -17.233 8.926   1.00 3.97  ? 41 GLU B HG2    1  
ATOM 3181  H HG3    . GLU D 3 41 ? 9.638   -17.409 7.177   1.00 4.18  ? 41 GLU B HG3    1  
ATOM 3182  N N      . LYS D 3 42 ? 11.551  -14.421 5.157   1.00 3.05  ? 42 LYS B N      1  
ATOM 3183  C CA     . LYS D 3 42 ? 12.733  -13.647 4.797   1.00 2.79  ? 42 LYS B CA     1  
ATOM 3184  C C      . LYS D 3 42 ? 12.610  -13.105 3.381   1.00 2.62  ? 42 LYS B C      1  
ATOM 3185  O O      . LYS D 3 42 ? 12.152  -13.800 2.472   1.00 2.71  ? 42 LYS B O      1  
ATOM 3186  C CB     . LYS D 3 42 ? 14.011  -14.479 4.965   1.00 3.03  ? 42 LYS B CB     1  
ATOM 3187  C CG     . LYS D 3 42 ? 13.938  -15.870 4.357   1.00 3.52  ? 42 LYS B CG     1  
ATOM 3188  C CD     . LYS D 3 42 ? 14.875  -16.834 5.065   1.00 3.67  ? 42 LYS B CD     1  
ATOM 3189  C CE     . LYS D 3 42 ? 14.627  -18.271 4.639   1.00 4.32  ? 42 LYS B CE     1  
ATOM 3190  N NZ     . LYS D 3 42 ? 13.205  -18.673 4.824   1.00 4.35  ? 42 LYS B NZ     1  
ATOM 3191  H H      . LYS D 3 42 ? 11.351  -15.253 4.675   1.00 3.26  ? 42 LYS B H      1  
ATOM 3192  H HA     . LYS D 3 42 ? 12.780  -12.804 5.472   1.00 2.67  ? 42 LYS B HA     1  
ATOM 3193  H HB2    . LYS D 3 42 ? 14.833  -13.952 4.499   1.00 3.18  ? 42 LYS B HB2    1  
ATOM 3194  H HB3    . LYS D 3 42 ? 14.216  -14.582 6.021   1.00 3.14  ? 42 LYS B HB3    1  
ATOM 3195  H HG2    . LYS D 3 42 ? 12.925  -16.236 4.441   1.00 3.83  ? 42 LYS B HG2    1  
ATOM 3196  H HG3    . LYS D 3 42 ? 14.218  -15.813 3.316   1.00 3.92  ? 42 LYS B HG3    1  
ATOM 3197  H HD2    . LYS D 3 42 ? 15.894  -16.572 4.827   1.00 3.64  ? 42 LYS B HD2    1  
ATOM 3198  H HD3    . LYS D 3 42 ? 14.720  -16.753 6.132   1.00 3.66  ? 42 LYS B HD3    1  
ATOM 3199  H HE2    . LYS D 3 42 ? 14.889  -18.372 3.596   1.00 4.58  ? 42 LYS B HE2    1  
ATOM 3200  H HE3    . LYS D 3 42 ? 15.257  -18.920 5.231   1.00 4.86  ? 42 LYS B HE3    1  
ATOM 3201  H HZ1    . LYS D 3 42 ? 12.692  -18.606 3.916   1.00 4.40  ? 42 LYS B HZ1    1  
ATOM 3202  H HZ2    . LYS D 3 42 ? 12.738  -18.048 5.522   1.00 4.39  ? 42 LYS B HZ2    1  
ATOM 3203  H HZ3    . LYS D 3 42 ? 13.150  -19.651 5.167   1.00 4.60  ? 42 LYS B HZ3    1  
ATOM 3204  N N      . ILE D 3 43 ? 13.007  -11.857 3.211   1.00 2.42  ? 43 ILE B N      1  
ATOM 3205  C CA     . ILE D 3 43 ? 12.932  -11.195 1.921   1.00 2.27  ? 43 ILE B CA     1  
ATOM 3206  C C      . ILE D 3 43 ? 14.295  -11.182 1.241   1.00 2.15  ? 43 ILE B C      1  
ATOM 3207  O O      . ILE D 3 43 ? 15.154  -10.364 1.569   1.00 2.06  ? 43 ILE B O      1  
ATOM 3208  C CB     . ILE D 3 43 ? 12.431  -9.740  2.063   1.00 2.19  ? 43 ILE B CB     1  
ATOM 3209  C CG1    . ILE D 3 43 ? 11.344  -9.648  3.138   1.00 2.33  ? 43 ILE B CG1    1  
ATOM 3210  C CG2    . ILE D 3 43 ? 11.899  -9.231  0.733   1.00 2.17  ? 43 ILE B CG2    1  
ATOM 3211  C CD1    . ILE D 3 43 ? 11.058  -8.232  3.598   1.00 2.28  ? 43 ILE B CD1    1  
ATOM 3212  H H      . ILE D 3 43 ? 13.379  -11.363 3.979   1.00 2.40  ? 43 ILE B H      1  
ATOM 3213  H HA     . ILE D 3 43 ? 12.231  -11.740 1.306   1.00 2.38  ? 43 ILE B HA     1  
ATOM 3214  H HB     . ILE D 3 43 ? 13.266  -9.120  2.350   1.00 2.11  ? 43 ILE B HB     1  
ATOM 3215  H HG12   . ILE D 3 43 ? 10.427  -10.060 2.747   1.00 2.49  ? 43 ILE B HG12   1  
ATOM 3216  H HG13   . ILE D 3 43 ? 11.651  -10.221 4.000   1.00 2.56  ? 43 ILE B HG13   1  
ATOM 3217  H HG21   . ILE D 3 43 ? 12.605  -9.464  -0.051  1.00 2.30  ? 43 ILE B HG21   1  
ATOM 3218  H HG22   . ILE D 3 43 ? 11.761  -8.161  0.783   1.00 2.18  ? 43 ILE B HG22   1  
ATOM 3219  H HG23   . ILE D 3 43 ? 10.953  -9.706  0.519   1.00 2.55  ? 43 ILE B HG23   1  
ATOM 3220  H HD11   . ILE D 3 43 ? 11.961  -7.797  4.004   1.00 2.49  ? 43 ILE B HD11   1  
ATOM 3221  H HD12   . ILE D 3 43 ? 10.292  -8.251  4.359   1.00 2.19  ? 43 ILE B HD12   1  
ATOM 3222  H HD13   . ILE D 3 43 ? 10.719  -7.642  2.759   1.00 2.82  ? 43 ILE B HD13   1  
ATOM 3223  N N      . ILE D 3 44 ? 14.503  -12.099 0.311   1.00 2.23  ? 44 ILE B N      1  
ATOM 3224  C CA     . ILE D 3 44 ? 15.764  -12.165 -0.408  1.00 2.16  ? 44 ILE B CA     1  
ATOM 3225  C C      . ILE D 3 44 ? 15.709  -11.255 -1.628  1.00 2.04  ? 44 ILE B C      1  
ATOM 3226  O O      . ILE D 3 44 ? 14.848  -11.418 -2.492  1.00 2.13  ? 44 ILE B O      1  
ATOM 3227  C CB     . ILE D 3 44 ? 16.095  -13.607 -0.848  1.00 2.34  ? 44 ILE B CB     1  
ATOM 3228  C CG1    . ILE D 3 44 ? 16.006  -14.557 0.349   1.00 2.51  ? 44 ILE B CG1    1  
ATOM 3229  C CG2    . ILE D 3 44 ? 17.481  -13.671 -1.481  1.00 2.30  ? 44 ILE B CG2    1  
ATOM 3230  C CD1    . ILE D 3 44 ? 16.096  -16.024 -0.027  1.00 2.69  ? 44 ILE B CD1    1  
ATOM 3231  H H      . ILE D 3 44 ? 13.790  -12.743 0.096   1.00 2.38  ? 44 ILE B H      1  
ATOM 3232  H HA     . ILE D 3 44 ? 16.543  -11.819 0.255   1.00 2.13  ? 44 ILE B HA     1  
ATOM 3233  H HB     . ILE D 3 44 ? 15.374  -13.907 -1.590  1.00 2.42  ? 44 ILE B HB     1  
ATOM 3234  H HG12   . ILE D 3 44 ? 16.814  -14.341 1.033   1.00 2.49  ? 44 ILE B HG12   1  
ATOM 3235  H HG13   . ILE D 3 44 ? 15.062  -14.400 0.853   1.00 2.55  ? 44 ILE B HG13   1  
ATOM 3236  H HG21   . ILE D 3 44 ? 17.626  -14.639 -1.937  1.00 2.52  ? 44 ILE B HG21   1  
ATOM 3237  H HG22   . ILE D 3 44 ? 18.232  -13.516 -0.720  1.00 2.52  ? 44 ILE B HG22   1  
ATOM 3238  H HG23   . ILE D 3 44 ? 17.567  -12.903 -2.234  1.00 2.30  ? 44 ILE B HG23   1  
ATOM 3239  H HD11   . ILE D 3 44 ? 17.104  -16.256 -0.336  1.00 3.18  ? 44 ILE B HD11   1  
ATOM 3240  H HD12   . ILE D 3 44 ? 15.414  -16.230 -0.840  1.00 2.60  ? 44 ILE B HD12   1  
ATOM 3241  H HD13   . ILE D 3 44 ? 15.831  -16.631 0.826   1.00 2.93  ? 44 ILE B HD13   1  
ATOM 3242  N N      . LEU D 3 45 ? 16.613  -10.291 -1.688  1.00 1.88  ? 45 LEU B N      1  
ATOM 3243  C CA     . LEU D 3 45 ? 16.648  -9.353  -2.799  1.00 1.79  ? 45 LEU B CA     1  
ATOM 3244  C C      . LEU D 3 45 ? 17.762  -9.710  -3.769  1.00 1.83  ? 45 LEU B C      1  
ATOM 3245  O O      . LEU D 3 45 ? 18.933  -9.738  -3.394  1.00 1.94  ? 45 LEU B O      1  
ATOM 3246  C CB     . LEU D 3 45 ? 16.851  -7.924  -2.292  1.00 1.72  ? 45 LEU B CB     1  
ATOM 3247  C CG     . LEU D 3 45 ? 16.050  -7.547  -1.043  1.00 1.49  ? 45 LEU B CG     1  
ATOM 3248  C CD1    . LEU D 3 45 ? 16.346  -6.115  -0.641  1.00 1.60  ? 45 LEU B CD1    1  
ATOM 3249  C CD2    . LEU D 3 45 ? 14.561  -7.730  -1.280  1.00 2.36  ? 45 LEU B CD2    1  
ATOM 3250  H H      . LEU D 3 45 ? 17.280  -10.209 -0.968  1.00 1.88  ? 45 LEU B H      1  
ATOM 3251  H HA     . LEU D 3 45 ? 15.702  -9.412  -3.315  1.00 1.80  ? 45 LEU B HA     1  
ATOM 3252  H HB2    . LEU D 3 45 ? 17.901  -7.791  -2.075  1.00 1.95  ? 45 LEU B HB2    1  
ATOM 3253  H HB3    . LEU D 3 45 ? 16.579  -7.243  -3.085  1.00 2.19  ? 45 LEU B HB3    1  
ATOM 3254  H HG     . LEU D 3 45 ? 16.343  -8.190  -0.225  1.00 1.74  ? 45 LEU B HG     1  
ATOM 3255  H HD11   . LEU D 3 45 ? 17.336  -6.058  -0.214  1.00 2.13  ? 45 LEU B HD11   1  
ATOM 3256  H HD12   . LEU D 3 45 ? 15.619  -5.790  0.089   1.00 2.10  ? 45 LEU B HD12   1  
ATOM 3257  H HD13   . LEU D 3 45 ? 16.293  -5.477  -1.512  1.00 1.80  ? 45 LEU B HD13   1  
ATOM 3258  H HD21   . LEU D 3 45 ? 14.258  -7.143  -2.134  1.00 2.57  ? 45 LEU B HD21   1  
ATOM 3259  H HD22   . LEU D 3 45 ? 14.014  -7.405  -0.406  1.00 2.84  ? 45 LEU B HD22   1  
ATOM 3260  H HD23   . LEU D 3 45 ? 14.353  -8.772  -1.469  1.00 2.95  ? 45 LEU B HD23   1  
ATOM 3261  N N      . LYS D 3 46 ? 17.393  -9.983  -5.007  1.00 1.83  ? 46 LYS B N      1  
ATOM 3262  C CA     . LYS D 3 46 ? 18.362  -10.333 -6.036  1.00 1.90  ? 46 LYS B CA     1  
ATOM 3263  C C      . LYS D 3 46 ? 18.435  -9.224  -7.085  1.00 2.05  ? 46 LYS B C      1  
ATOM 3264  O O      . LYS D 3 46 ? 17.649  -8.276  -7.042  1.00 1.91  ? 46 LYS B O      1  
ATOM 3265  C CB     . LYS D 3 46 ? 17.978  -11.665 -6.691  1.00 1.85  ? 46 LYS B CB     1  
ATOM 3266  C CG     . LYS D 3 46 ? 19.158  -12.440 -7.255  1.00 2.24  ? 46 LYS B CG     1  
ATOM 3267  C CD     . LYS D 3 46 ? 18.707  -13.735 -7.914  1.00 2.19  ? 46 LYS B CD     1  
ATOM 3268  C CE     . LYS D 3 46 ? 19.870  -14.473 -8.557  1.00 2.77  ? 46 LYS B CE     1  
ATOM 3269  N NZ     . LYS D 3 46 ? 20.618  -13.608 -9.507  1.00 3.21  ? 46 LYS B NZ     1  
ATOM 3270  H H      . LYS D 3 46 ? 16.440  -9.937  -5.239  1.00 1.83  ? 46 LYS B H      1  
ATOM 3271  H HA     . LYS D 3 46 ? 19.325  -10.434 -5.565  1.00 1.95  ? 46 LYS B HA     1  
ATOM 3272  H HB2    . LYS D 3 46 ? 17.488  -12.285 -5.954  1.00 2.20  ? 46 LYS B HB2    1  
ATOM 3273  H HB3    . LYS D 3 46 ? 17.288  -11.468 -7.497  1.00 1.88  ? 46 LYS B HB3    1  
ATOM 3274  H HG2    . LYS D 3 46 ? 19.659  -11.830 -7.993  1.00 2.59  ? 46 LYS B HG2    1  
ATOM 3275  H HG3    . LYS D 3 46 ? 19.841  -12.672 -6.452  1.00 2.82  ? 46 LYS B HG3    1  
ATOM 3276  H HD2    . LYS D 3 46 ? 18.260  -14.371 -7.167  1.00 2.11  ? 46 LYS B HD2    1  
ATOM 3277  H HD3    . LYS D 3 46 ? 17.977  -13.505 -8.674  1.00 2.54  ? 46 LYS B HD3    1  
ATOM 3278  H HE2    . LYS D 3 46 ? 20.542  -14.808 -7.781  1.00 3.12  ? 46 LYS B HE2    1  
ATOM 3279  H HE3    . LYS D 3 46 ? 19.484  -15.329 -9.090  1.00 3.18  ? 46 LYS B HE3    1  
ATOM 3280  H HZ1    . LYS D 3 46 ? 21.149  -14.195 -10.180 1.00 3.60  ? 46 LYS B HZ1    1  
ATOM 3281  H HZ2    . LYS D 3 46 ? 21.295  -13.005 -8.986  1.00 3.67  ? 46 LYS B HZ2    1  
ATOM 3282  H HZ3    . LYS D 3 46 ? 19.962  -12.999 -10.038 1.00 3.29  ? 46 LYS B HZ3    1  
ATOM 3283  N N      . LYS D 3 47 ? 19.378  -9.346  -8.014  1.00 2.41  ? 47 LYS B N      1  
ATOM 3284  C CA     . LYS D 3 47 ? 19.561  -8.359  -9.078  1.00 2.65  ? 47 LYS B CA     1  
ATOM 3285  C C      . LYS D 3 47 ? 18.273  -8.140  -9.873  1.00 2.63  ? 47 LYS B C      1  
ATOM 3286  O O      . LYS D 3 47 ? 17.435  -9.035  -9.983  1.00 2.89  ? 47 LYS B O      1  
ATOM 3287  C CB     . LYS D 3 47 ? 20.676  -8.798  -10.027 1.00 2.89  ? 47 LYS B CB     1  
ATOM 3288  C CG     . LYS D 3 47 ? 22.026  -8.983  -9.351  1.00 2.96  ? 47 LYS B CG     1  
ATOM 3289  C CD     . LYS D 3 47 ? 23.119  -9.275  -10.367 1.00 3.38  ? 47 LYS B CD     1  
ATOM 3290  C CE     . LYS D 3 47 ? 23.370  -8.082  -11.278 1.00 3.60  ? 47 LYS B CE     1  
ATOM 3291  N NZ     . LYS D 3 47 ? 24.547  -8.291  -12.159 1.00 3.66  ? 47 LYS B NZ     1  
ATOM 3292  H H      . LYS D 3 47 ? 19.978  -10.118 -7.977  1.00 2.57  ? 47 LYS B H      1  
ATOM 3293  H HA     . LYS D 3 47 ? 19.845  -7.426  -8.616  1.00 2.77  ? 47 LYS B HA     1  
ATOM 3294  H HB2    . LYS D 3 47 ? 20.396  -9.736  -10.485 1.00 3.04  ? 47 LYS B HB2    1  
ATOM 3295  H HB3    . LYS D 3 47 ? 20.785  -8.051  -10.799 1.00 3.30  ? 47 LYS B HB3    1  
ATOM 3296  H HG2    . LYS D 3 47 ? 22.277  -8.079  -8.816  1.00 3.02  ? 47 LYS B HG2    1  
ATOM 3297  H HG3    . LYS D 3 47 ? 21.961  -9.809  -8.657  1.00 3.08  ? 47 LYS B HG3    1  
ATOM 3298  H HD2    . LYS D 3 47 ? 24.032  -9.514  -9.842  1.00 3.51  ? 47 LYS B HD2    1  
ATOM 3299  H HD3    . LYS D 3 47 ? 22.818  -10.118 -10.970 1.00 3.76  ? 47 LYS B HD3    1  
ATOM 3300  H HE2    . LYS D 3 47 ? 22.498  -7.927  -11.895 1.00 3.72  ? 47 LYS B HE2    1  
ATOM 3301  H HE3    . LYS D 3 47 ? 23.537  -7.206  -10.667 1.00 4.11  ? 47 LYS B HE3    1  
ATOM 3302  H HZ1    . LYS D 3 47 ? 24.611  -7.524  -12.859 1.00 4.02  ? 47 LYS B HZ1    1  
ATOM 3303  H HZ2    . LYS D 3 47 ? 24.460  -9.195  -12.664 1.00 3.69  ? 47 LYS B HZ2    1  
ATOM 3304  H HZ3    . LYS D 3 47 ? 25.421  -8.303  -11.595 1.00 3.79  ? 47 LYS B HZ3    1  
ATOM 3305  N N      . TYR D 3 48 ? 18.134  -6.944  -10.428 1.00 2.82  ? 48 TYR B N      1  
ATOM 3306  C CA     . TYR D 3 48 ? 16.956  -6.576  -11.209 1.00 2.91  ? 48 TYR B CA     1  
ATOM 3307  C C      . TYR D 3 48 ? 16.779  -7.462  -12.440 1.00 2.75  ? 48 TYR B C      1  
ATOM 3308  O O      . TYR D 3 48 ? 17.748  -7.840  -13.105 1.00 2.99  ? 48 TYR B O      1  
ATOM 3309  C CB     . TYR D 3 48 ? 17.042  -5.106  -11.635 1.00 3.61  ? 48 TYR B CB     1  
ATOM 3310  C CG     . TYR D 3 48 ? 18.440  -4.640  -11.998 1.00 3.83  ? 48 TYR B CG     1  
ATOM 3311  C CD1    . TYR D 3 48 ? 18.918  -4.753  -13.297 1.00 4.05  ? 48 TYR B CD1    1  
ATOM 3312  C CD2    . TYR D 3 48 ? 19.278  -4.083  -11.038 1.00 4.08  ? 48 TYR B CD2    1  
ATOM 3313  C CE1    . TYR D 3 48 ? 20.190  -4.327  -13.628 1.00 4.46  ? 48 TYR B CE1    1  
ATOM 3314  C CE2    . TYR D 3 48 ? 20.551  -3.654  -11.363 1.00 4.48  ? 48 TYR B CE2    1  
ATOM 3315  C CZ     . TYR D 3 48 ? 21.002  -3.779  -12.658 1.00 4.65  ? 48 TYR B CZ     1  
ATOM 3316  O OH     . TYR D 3 48 ? 22.269  -3.357  -12.986 1.00 5.20  ? 48 TYR B OH     1  
ATOM 3317  H H      . TYR D 3 48 ? 18.843  -6.282  -10.304 1.00 3.19  ? 48 TYR B H      1  
ATOM 3318  H HA     . TYR D 3 48 ? 16.093  -6.699  -10.574 1.00 2.86  ? 48 TYR B HA     1  
ATOM 3319  H HB2    . TYR D 3 48 ? 16.410  -4.952  -12.498 1.00 3.98  ? 48 TYR B HB2    1  
ATOM 3320  H HB3    . TYR D 3 48 ? 16.686  -4.486  -10.825 1.00 3.85  ? 48 TYR B HB3    1  
ATOM 3321  H HD1    . TYR D 3 48 ? 18.280  -5.182  -14.056 1.00 4.07  ? 48 TYR B HD1    1  
ATOM 3322  H HD2    . TYR D 3 48 ? 18.923  -3.988  -10.023 1.00 4.11  ? 48 TYR B HD2    1  
ATOM 3323  H HE1    . TYR D 3 48 ? 20.543  -4.425  -14.644 1.00 4.77  ? 48 TYR B HE1    1  
ATOM 3324  H HE2    . TYR D 3 48 ? 21.187  -3.223  -10.603 1.00 4.81  ? 48 TYR B HE2    1  
ATOM 3325  H HH     . TYR D 3 48 ? 22.225  -2.784  -13.761 1.00 5.30  ? 48 TYR B HH     1  
ATOM 3326  N N      . LYS D 3 49 ? 15.528  -7.784  -12.731 1.00 2.64  ? 49 LYS B N      1  
ATOM 3327  C CA     . LYS D 3 49 ? 15.170  -8.602  -13.880 1.00 2.68  ? 49 LYS B CA     1  
ATOM 3328  C C      . LYS D 3 49 ? 13.989  -7.962  -14.599 1.00 2.66  ? 49 LYS B C      1  
ATOM 3329  O O      . LYS D 3 49 ? 13.237  -7.206  -13.986 1.00 2.66  ? 49 LYS B O      1  
ATOM 3330  C CB     . LYS D 3 49 ? 14.791  -10.019 -13.444 1.00 2.92  ? 49 LYS B CB     1  
ATOM 3331  C CG     . LYS D 3 49 ? 15.952  -10.997 -13.444 1.00 3.67  ? 49 LYS B CG     1  
ATOM 3332  C CD     . LYS D 3 49 ? 15.473  -12.413 -13.724 1.00 4.07  ? 49 LYS B CD     1  
ATOM 3333  C CE     . LYS D 3 49 ? 16.521  -13.448 -13.345 1.00 4.67  ? 49 LYS B CE     1  
ATOM 3334  N NZ     . LYS D 3 49 ? 16.488  -13.762 -11.896 1.00 5.10  ? 49 LYS B NZ     1  
ATOM 3335  H H      . LYS D 3 49 ? 14.809  -7.449  -12.155 1.00 2.73  ? 49 LYS B H      1  
ATOM 3336  H HA     . LYS D 3 49 ? 16.019  -8.643  -14.546 1.00 2.83  ? 49 LYS B HA     1  
ATOM 3337  H HB2    . LYS D 3 49 ? 14.385  -9.980  -12.443 1.00 3.15  ? 49 LYS B HB2    1  
ATOM 3338  H HB3    . LYS D 3 49 ? 14.031  -10.397 -14.113 1.00 2.97  ? 49 LYS B HB3    1  
ATOM 3339  H HG2    . LYS D 3 49 ? 16.661  -10.705 -14.206 1.00 3.84  ? 49 LYS B HG2    1  
ATOM 3340  H HG3    . LYS D 3 49 ? 16.428  -10.972 -12.477 1.00 4.23  ? 49 LYS B HG3    1  
ATOM 3341  H HD2    . LYS D 3 49 ? 14.577  -12.598 -13.150 1.00 4.45  ? 49 LYS B HD2    1  
ATOM 3342  H HD3    . LYS D 3 49 ? 15.250  -12.505 -14.778 1.00 4.02  ? 49 LYS B HD3    1  
ATOM 3343  H HE2    . LYS D 3 49 ? 16.335  -14.355 -13.901 1.00 5.04  ? 49 LYS B HE2    1  
ATOM 3344  H HE3    . LYS D 3 49 ? 17.498  -13.063 -13.599 1.00 4.83  ? 49 LYS B HE3    1  
ATOM 3345  H HZ1    . LYS D 3 49 ? 15.991  -14.664 -11.737 1.00 5.19  ? 49 LYS B HZ1    1  
ATOM 3346  H HZ2    . LYS D 3 49 ? 15.988  -13.008 -11.374 1.00 5.48  ? 49 LYS B HZ2    1  
ATOM 3347  H HZ3    . LYS D 3 49 ? 17.456  -13.842 -11.526 1.00 5.34  ? 49 LYS B HZ3    1  
ATOM 3348  N N      . PRO D 3 50 ? 13.815  -8.235  -15.902 1.00 2.93  ? 50 PRO B N      1  
ATOM 3349  C CA     . PRO D 3 50 ? 12.696  -7.686  -16.672 1.00 2.99  ? 50 PRO B CA     1  
ATOM 3350  C C      . PRO D 3 50 ? 11.346  -8.132  -16.103 1.00 2.89  ? 50 PRO B C      1  
ATOM 3351  O O      . PRO D 3 50 ? 10.635  -7.336  -15.488 1.00 2.94  ? 50 PRO B O      1  
ATOM 3352  C CB     . PRO D 3 50 ? 12.908  -8.248  -18.086 1.00 3.55  ? 50 PRO B CB     1  
ATOM 3353  C CG     . PRO D 3 50 ? 13.849  -9.396  -17.921 1.00 3.81  ? 50 PRO B CG     1  
ATOM 3354  C CD     . PRO D 3 50 ? 14.701  -9.067  -16.730 1.00 3.45  ? 50 PRO B CD     1  
ATOM 3355  H HA     . PRO D 3 50 ? 12.729  -6.607  -16.701 1.00 3.07  ? 50 PRO B HA     1  
ATOM 3356  H HB2    . PRO D 3 50 ? 11.961  -8.572  -18.492 1.00 3.67  ? 50 PRO B HB2    1  
ATOM 3357  H HB3    . PRO D 3 50 ? 13.332  -7.483  -18.719 1.00 3.88  ? 50 PRO B HB3    1  
ATOM 3358  H HG2    . PRO D 3 50 ? 13.293  -10.304 -17.741 1.00 4.11  ? 50 PRO B HG2    1  
ATOM 3359  H HG3    . PRO D 3 50 ? 14.462  -9.499  -18.804 1.00 4.18  ? 50 PRO B HG3    1  
ATOM 3360  H HD2    . PRO D 3 50 ? 14.985  -9.969  -16.206 1.00 3.67  ? 50 PRO B HD2    1  
ATOM 3361  H HD3    . PRO D 3 50 ? 15.577  -8.512  -17.033 1.00 3.60  ? 50 PRO B HD3    1  
ATOM 3362  N N      . ASN D 3 51 ? 11.025  -9.415  -16.298 1.00 3.21  ? 51 ASN B N      1  
ATOM 3363  C CA     . ASN D 3 51 ? 9.776   -10.012 -15.809 1.00 3.58  ? 51 ASN B CA     1  
ATOM 3364  C C      . ASN D 3 51 ? 8.577   -9.101  -16.069 1.00 3.80  ? 51 ASN B C      1  
ATOM 3365  O O      . ASN D 3 51 ? 7.823   -8.754  -15.157 1.00 4.25  ? 51 ASN B O      1  
ATOM 3366  C CB     . ASN D 3 51 ? 9.884   -10.346 -14.315 1.00 3.65  ? 51 ASN B CB     1  
ATOM 3367  C CG     . ASN D 3 51 ? 8.753   -11.241 -13.833 1.00 4.52  ? 51 ASN B CG     1  
ATOM 3368  O OD1    . ASN D 3 51 ? 8.082   -11.900 -14.630 1.00 5.20  ? 51 ASN B OD1    1  
ATOM 3369  N ND2    . ASN D 3 51 ? 8.544   -11.283 -12.526 1.00 4.79  ? 51 ASN B ND2    1  
ATOM 3370  H H      . ASN D 3 51 ? 11.653  -9.984  -16.788 1.00 3.46  ? 51 ASN B H      1  
ATOM 3371  H HA     . ASN D 3 51 ? 9.627   -10.932 -16.355 1.00 4.06  ? 51 ASN B HA     1  
ATOM 3372  H HB2    . ASN D 3 51 ? 10.820  -10.850 -14.127 1.00 3.72  ? 51 ASN B HB2    1  
ATOM 3373  H HB3    . ASN D 3 51 ? 9.855   -9.428  -13.748 1.00 3.39  ? 51 ASN B HB3    1  
ATOM 3374  H HD21   . ASN D 3 51 ? 9.124   -10.744 -11.947 1.00 4.51  ? 51 ASN B HD21   1  
ATOM 3375  H HD22   . ASN D 3 51 ? 7.821   -11.854 -12.188 1.00 5.44  ? 51 ASN B HD22   1  
ATOM 3376  N N      . MET D 3 52 ? 8.420   -8.708  -17.322 1.00 3.93  ? 52 MET B N      1  
ATOM 3377  C CA     . MET D 3 52 ? 7.327   -7.838  -17.726 1.00 4.51  ? 52 MET B CA     1  
ATOM 3378  C C      . MET D 3 52 ? 6.041   -8.641  -17.882 1.00 4.64  ? 52 MET B C      1  
ATOM 3379  O O      . MET D 3 52 ? 5.992   -9.619  -18.633 1.00 4.72  ? 52 MET B O      1  
ATOM 3380  C CB     . MET D 3 52 ? 7.667   -7.115  -19.037 1.00 5.13  ? 52 MET B CB     1  
ATOM 3381  C CG     . MET D 3 52 ? 8.095   -8.047  -20.162 1.00 5.19  ? 52 MET B CG     1  
ATOM 3382  S SD     . MET D 3 52 ? 9.758   -8.711  -19.932 1.00 5.94  ? 52 MET B SD     1  
ATOM 3383  C CE     . MET D 3 52 ? 9.562   -10.343 -20.644 1.00 6.19  ? 52 MET B CE     1  
ATOM 3384  H H      . MET D 3 52 ? 9.056   -9.016  -18.001 1.00 3.93  ? 52 MET B H      1  
ATOM 3385  H HA     . MET D 3 52 ? 7.184   -7.106  -16.946 1.00 4.66  ? 52 MET B HA     1  
ATOM 3386  H HB2    . MET D 3 52 ? 6.795   -6.568  -19.367 1.00 5.48  ? 52 MET B HB2    1  
ATOM 3387  H HB3    . MET D 3 52 ? 8.470   -6.415  -18.853 1.00 5.57  ? 52 MET B HB3    1  
ATOM 3388  H HG2    . MET D 3 52 ? 7.399   -8.873  -20.209 1.00 4.95  ? 52 MET B HG2    1  
ATOM 3389  H HG3    . MET D 3 52 ? 8.066   -7.503  -21.092 1.00 5.42  ? 52 MET B HG3    1  
ATOM 3390  H HE1    . MET D 3 52 ? 8.792   -10.877 -20.110 1.00 6.43  ? 52 MET B HE1    1  
ATOM 3391  H HE2    . MET D 3 52 ? 10.494  -10.882 -20.566 1.00 6.28  ? 52 MET B HE2    1  
ATOM 3392  H HE3    . MET D 3 52 ? 9.284   -10.254 -21.682 1.00 6.35  ? 52 MET B HE3    1  
ATOM 3393  N N      . THR D 3 53 ? 5.012   -8.233  -17.160 1.00 4.77  ? 53 THR B N      1  
ATOM 3394  C CA     . THR D 3 53 ? 3.728   -8.909  -17.207 1.00 4.99  ? 53 THR B CA     1  
ATOM 3395  C C      . THR D 3 53 ? 2.810   -8.294  -18.264 1.00 4.92  ? 53 THR B C      1  
ATOM 3396  O O      . THR D 3 53 ? 2.051   -9.002  -18.934 1.00 5.08  ? 53 THR B O      1  
ATOM 3397  C CB     . THR D 3 53 ? 3.036   -8.864  -15.832 1.00 5.26  ? 53 THR B CB     1  
ATOM 3398  O OG1    . THR D 3 53 ? 3.792   -8.035  -14.934 1.00 5.25  ? 53 THR B OG1    1  
ATOM 3399  C CG2    . THR D 3 53 ? 2.910   -10.262 -15.251 1.00 5.42  ? 53 THR B CG2    1  
ATOM 3400  H H      . THR D 3 53 ? 5.118   -7.457  -16.570 1.00 4.79  ? 53 THR B H      1  
ATOM 3401  H HA     . THR D 3 53 ? 3.907   -9.942  -17.458 1.00 5.13  ? 53 THR B HA     1  
ATOM 3402  H HB     . THR D 3 53 ? 2.046   -8.447  -15.951 1.00 5.52  ? 53 THR B HB     1  
ATOM 3403  H HG1    . THR D 3 53 ? 3.239   -7.300  -14.635 1.00 5.36  ? 53 THR B HG1    1  
ATOM 3404  H HG21   . THR D 3 53 ? 2.383   -10.895 -15.949 1.00 5.68  ? 53 THR B HG21   1  
ATOM 3405  H HG22   . THR D 3 53 ? 2.362   -10.220 -14.320 1.00 5.63  ? 53 THR B HG22   1  
ATOM 3406  H HG23   . THR D 3 53 ? 3.895   -10.667 -15.074 1.00 5.39  ? 53 THR B HG23   1  
ATOM 3407  N N      . CYS D 3 54 ? 2.894   -6.979  -18.417 1.00 4.89  ? 54 CYS B N      1  
ATOM 3408  C CA     . CYS D 3 54 ? 2.069   -6.268  -19.381 1.00 4.84  ? 54 CYS B CA     1  
ATOM 3409  C C      . CYS D 3 54 ? 2.747   -4.964  -19.788 1.00 5.18  ? 54 CYS B C      1  
ATOM 3410  O O      . CYS D 3 54 ? 3.646   -4.480  -19.095 1.00 5.52  ? 54 CYS B O      1  
ATOM 3411  C CB     . CYS D 3 54 ? 0.688   -5.980  -18.782 1.00 4.63  ? 54 CYS B CB     1  
ATOM 3412  S SG     . CYS D 3 54 ? -0.555  -5.407  -19.990 1.00 4.47  ? 54 CYS B SG     1  
ATOM 3413  H H      . CYS D 3 54 ? 3.532   -6.470  -17.870 1.00 5.03  ? 54 CYS B H      1  
ATOM 3414  H HA     . CYS D 3 54 ? 1.956   -6.894  -20.255 1.00 4.82  ? 54 CYS B HA     1  
ATOM 3415  H HB2    . CYS D 3 54 ? 0.309   -6.882  -18.327 1.00 4.56  ? 54 CYS B HB2    1  
ATOM 3416  H HB3    . CYS D 3 54 ? 0.788   -5.215  -18.026 1.00 5.03  ? 54 CYS B HB3    1  
ATOM 3417  N N      . GLN D 3 55 ? 2.328   -4.409  -20.915 1.00 5.28  ? 55 GLN B N      1  
ATOM 3418  C CA     . GLN D 3 55 ? 2.887   -3.159  -21.407 1.00 5.65  ? 55 GLN B CA     1  
ATOM 3419  C C      . GLN D 3 55 ? 2.395   -1.987  -20.566 1.00 6.20  ? 55 GLN B C      1  
ATOM 3420  O O      . GLN D 3 55 ? 1.304   -2.040  -19.990 1.00 6.38  ? 55 GLN B O      1  
ATOM 3421  C CB     . GLN D 3 55 ? 2.499   -2.951  -22.870 1.00 5.50  ? 55 GLN B CB     1  
ATOM 3422  C CG     . GLN D 3 55 ? 3.127   -3.960  -23.815 1.00 5.31  ? 55 GLN B CG     1  
ATOM 3423  C CD     . GLN D 3 55 ? 2.748   -3.731  -25.267 1.00 5.64  ? 55 GLN B CD     1  
ATOM 3424  O OE1    . GLN D 3 55 ? 3.534   -4.005  -26.173 1.00 5.90  ? 55 GLN B OE1    1  
ATOM 3425  N NE2    . GLN D 3 55 ? 1.546   -3.231  -25.505 1.00 5.94  ? 55 GLN B NE2    1  
ATOM 3426  H H      . GLN D 3 55 ? 1.618   -4.849  -21.430 1.00 5.22  ? 55 GLN B H      1  
ATOM 3427  H HA     . GLN D 3 55 ? 3.962   -3.219  -21.330 1.00 5.91  ? 55 GLN B HA     1  
ATOM 3428  H HB2    . GLN D 3 55 ? 1.426   -3.031  -22.957 1.00 5.65  ? 55 GLN B HB2    1  
ATOM 3429  H HB3    . GLN D 3 55 ? 2.803   -1.963  -23.178 1.00 5.78  ? 55 GLN B HB3    1  
ATOM 3430  H HG2    . GLN D 3 55 ? 4.200   -3.897  -23.725 1.00 5.45  ? 55 GLN B HG2    1  
ATOM 3431  H HG3    . GLN D 3 55 ? 2.801   -4.950  -23.528 1.00 5.23  ? 55 GLN B HG3    1  
ATOM 3432  H HE21   . GLN D 3 55 ? 0.957   -3.029  -24.735 1.00 5.95  ? 55 GLN B HE21   1  
ATOM 3433  H HE22   . GLN D 3 55 ? 1.287   -3.082  -26.435 1.00 6.32  ? 55 GLN B HE22   1  
ATOM 3434  N N      . MET E 3 1  ? -35.642 -3.093  -4.976  1.00 6.49  ? 1  MET C N      1  
ATOM 3435  C CA     . MET E 3 1  ? -34.343 -2.464  -5.187  1.00 6.35  ? 1  MET C CA     1  
ATOM 3436  C C      . MET E 3 1  ? -33.261 -3.522  -5.346  1.00 6.05  ? 1  MET C C      1  
ATOM 3437  O O      . MET E 3 1  ? -32.111 -3.328  -4.944  1.00 6.52  ? 1  MET C O      1  
ATOM 3438  C CB     . MET E 3 1  ? -34.005 -1.531  -4.022  1.00 6.63  ? 1  MET C CB     1  
ATOM 3439  C CG     . MET E 3 1  ? -34.714 -0.189  -4.094  1.00 7.04  ? 1  MET C CG     1  
ATOM 3440  S SD     . MET E 3 1  ? -34.226 0.771   -5.544  1.00 7.43  ? 1  MET C SD     1  
ATOM 3441  C CE     . MET E 3 1  ? -32.563 1.266   -5.091  1.00 7.80  ? 1  MET C CE     1  
ATOM 3442  H H1     . MET E 3 1  ? -36.401 -2.805  -5.529  1.00 6.67  ? 1  MET C H1     1  
ATOM 3443  H HA     . MET E 3 1  ? -34.402 -1.887  -6.096  1.00 6.44  ? 1  MET C HA     1  
ATOM 3444  H HB2    . MET E 3 1  ? -34.284 -2.012  -3.096  1.00 6.66  ? 1  MET C HB2    1  
ATOM 3445  H HB3    . MET E 3 1  ? -32.941 -1.350  -4.016  1.00 6.83  ? 1  MET C HB3    1  
ATOM 3446  H HG2    . MET E 3 1  ? -35.780 -0.361  -4.135  1.00 7.25  ? 1  MET C HG2    1  
ATOM 3447  H HG3    . MET E 3 1  ? -34.475 0.377   -3.205  1.00 7.26  ? 1  MET C HG3    1  
ATOM 3448  H HE1    . MET E 3 1  ? -32.181 1.958   -5.826  1.00 7.87  ? 1  MET C HE1    1  
ATOM 3449  H HE2    . MET E 3 1  ? -31.927 0.393   -5.054  1.00 8.00  ? 1  MET C HE2    1  
ATOM 3450  H HE3    . MET E 3 1  ? -32.579 1.741   -4.121  1.00 8.00  ? 1  MET C HE3    1  
ATOM 3451  N N      . LYS E 3 2  ? -33.643 -4.642  -5.945  1.00 5.46  ? 2  LYS C N      1  
ATOM 3452  C CA     . LYS E 3 2  ? -32.726 -5.748  -6.167  1.00 5.21  ? 2  LYS C CA     1  
ATOM 3453  C C      . LYS E 3 2  ? -31.560 -5.329  -7.054  1.00 4.49  ? 2  LYS C C      1  
ATOM 3454  O O      . LYS E 3 2  ? -31.746 -4.848  -8.174  1.00 4.36  ? 2  LYS C O      1  
ATOM 3455  C CB     . LYS E 3 2  ? -33.460 -6.937  -6.789  1.00 5.55  ? 2  LYS C CB     1  
ATOM 3456  C CG     . LYS E 3 2  ? -34.343 -7.685  -5.805  1.00 6.15  ? 2  LYS C CG     1  
ATOM 3457  C CD     . LYS E 3 2  ? -33.521 -8.482  -4.802  1.00 6.70  ? 2  LYS C CD     1  
ATOM 3458  C CE     . LYS E 3 2  ? -34.262 -8.662  -3.485  1.00 7.72  ? 2  LYS C CE     1  
ATOM 3459  N NZ     . LYS E 3 2  ? -33.383 -9.240  -2.434  1.00 8.57  ? 2  LYS C NZ     1  
ATOM 3460  H H      . LYS E 3 2  ? -34.573 -4.725  -6.245  1.00 5.36  ? 2  LYS C H      1  
ATOM 3461  H HA     . LYS E 3 2  ? -32.338 -6.046  -5.205  1.00 5.60  ? 2  LYS C HA     1  
ATOM 3462  H HB2    . LYS E 3 2  ? -34.082 -6.582  -7.597  1.00 5.56  ? 2  LYS C HB2    1  
ATOM 3463  H HB3    . LYS E 3 2  ? -32.729 -7.628  -7.183  1.00 5.73  ? 2  LYS C HB3    1  
ATOM 3464  H HG2    . LYS E 3 2  ? -34.950 -6.972  -5.271  1.00 6.23  ? 2  LYS C HG2    1  
ATOM 3465  H HG3    . LYS E 3 2  ? -34.980 -8.361  -6.355  1.00 6.45  ? 2  LYS C HG3    1  
ATOM 3466  H HD2    . LYS E 3 2  ? -33.308 -9.454  -5.218  1.00 6.73  ? 2  LYS C HD2    1  
ATOM 3467  H HD3    . LYS E 3 2  ? -32.593 -7.961  -4.613  1.00 6.63  ? 2  LYS C HD3    1  
ATOM 3468  H HE2    . LYS E 3 2  ? -34.619 -7.699  -3.152  1.00 7.96  ? 2  LYS C HE2    1  
ATOM 3469  H HE3    . LYS E 3 2  ? -35.103 -9.320  -3.644  1.00 7.86  ? 2  LYS C HE3    1  
ATOM 3470  H HZ1    . LYS E 3 2  ? -32.460 -8.746  -2.424  1.00 9.03  ? 2  LYS C HZ1    1  
ATOM 3471  H HZ2    . LYS E 3 2  ? -33.217 -10.251 -2.615  1.00 8.65  ? 2  LYS C HZ2    1  
ATOM 3472  H HZ3    . LYS E 3 2  ? -33.828 -9.136  -1.500  1.00 8.87  ? 2  LYS C HZ3    1  
ATOM 3473  N N      . SER E 3 3  ? -30.361 -5.523  -6.541  1.00 4.33  ? 3  SER C N      1  
ATOM 3474  C CA     . SER E 3 3  ? -29.149 -5.177  -7.258  1.00 3.97  ? 3  SER C CA     1  
ATOM 3475  C C      . SER E 3 3  ? -28.231 -6.388  -7.295  1.00 3.58  ? 3  SER C C      1  
ATOM 3476  O O      . SER E 3 3  ? -27.008 -6.262  -7.372  1.00 3.59  ? 3  SER C O      1  
ATOM 3477  C CB     . SER E 3 3  ? -28.453 -3.994  -6.582  1.00 4.53  ? 3  SER C CB     1  
ATOM 3478  O OG     . SER E 3 3  ? -29.395 -3.030  -6.134  1.00 5.01  ? 3  SER C OG     1  
ATOM 3479  H H      . SER E 3 3  ? -30.283 -5.947  -5.651  1.00 4.67  ? 3  SER C H      1  
ATOM 3480  H HA     . SER E 3 3  ? -29.420 -4.907  -8.268  1.00 3.91  ? 3  SER C HA     1  
ATOM 3481  H HB2    . SER E 3 3  ? -27.891 -4.350  -5.733  1.00 4.76  ? 3  SER C HB2    1  
ATOM 3482  H HB3    . SER E 3 3  ? -27.781 -3.522  -7.285  1.00 4.58  ? 3  SER C HB3    1  
ATOM 3483  H HG     . SER E 3 3  ? -30.239 -3.467  -5.951  1.00 4.87  ? 3  SER C HG     1  
ATOM 3484  N N      . THR E 3 4  ? -28.846 -7.561  -7.215  1.00 3.52  ? 4  THR C N      1  
ATOM 3485  C CA     . THR E 3 4  ? -28.129 -8.824  -7.240  1.00 3.29  ? 4  THR C CA     1  
ATOM 3486  C C      . THR E 3 4  ? -27.337 -8.960  -8.540  1.00 2.83  ? 4  THR C C      1  
ATOM 3487  O O      . THR E 3 4  ? -27.901 -9.234  -9.604  1.00 3.10  ? 4  THR C O      1  
ATOM 3488  C CB     . THR E 3 4  ? -29.114 -10.000 -7.103  1.00 3.67  ? 4  THR C CB     1  
ATOM 3489  O OG1    . THR E 3 4  ? -30.164 -9.654  -6.183  1.00 4.25  ? 4  THR C OG1    1  
ATOM 3490  C CG2    . THR E 3 4  ? -28.407 -11.253 -6.614  1.00 3.77  ? 4  THR C CG2    1  
ATOM 3491  H H      . THR E 3 4  ? -29.822 -7.576  -7.129  1.00 3.81  ? 4  THR C H      1  
ATOM 3492  H HA     . THR E 3 4  ? -27.448 -8.846  -6.402  1.00 3.35  ? 4  THR C HA     1  
ATOM 3493  H HB     . THR E 3 4  ? -29.545 -10.201 -8.072  1.00 3.66  ? 4  THR C HB     1  
ATOM 3494  H HG1    . THR E 3 4  ? -29.895 -8.885  -5.647  1.00 4.42  ? 4  THR C HG1    1  
ATOM 3495  H HG21   . THR E 3 4  ? -28.234 -11.174 -5.552  1.00 3.87  ? 4  THR C HG21   1  
ATOM 3496  H HG22   . THR E 3 4  ? -27.461 -11.359 -7.127  1.00 3.61  ? 4  THR C HG22   1  
ATOM 3497  H HG23   . THR E 3 4  ? -29.024 -12.116 -6.816  1.00 4.15  ? 4  THR C HG23   1  
ATOM 3498  N N      . GLY E 3 5  ? -26.032 -8.745  -8.450  1.00 2.43  ? 5  GLY C N      1  
ATOM 3499  C CA     . GLY E 3 5  ? -25.186 -8.821  -9.620  1.00 2.18  ? 5  GLY C CA     1  
ATOM 3500  C C      . GLY E 3 5  ? -25.147 -7.495  -10.335 1.00 2.26  ? 5  GLY C C      1  
ATOM 3501  O O      . GLY E 3 5  ? -25.437 -7.410  -11.529 1.00 2.47  ? 5  GLY C O      1  
ATOM 3502  H H      . GLY E 3 5  ? -25.639 -8.514  -7.580  1.00 2.54  ? 5  GLY C H      1  
ATOM 3503  H HA2    . GLY E 3 5  ? -24.185 -9.094  -9.318  1.00 2.12  ? 5  GLY C HA2    1  
ATOM 3504  H HA3    . GLY E 3 5  ? -25.572 -9.571  -10.292 1.00 2.22  ? 5  GLY C HA3    1  
ATOM 3505  N N      . ILE E 3 6  ? -24.815 -6.451  -9.593  1.00 2.20  ? 6  ILE C N      1  
ATOM 3506  C CA     . ILE E 3 6  ? -24.754 -5.111  -10.153 1.00 2.35  ? 6  ILE C CA     1  
ATOM 3507  C C      . ILE E 3 6  ? -23.310 -4.654  -10.317 1.00 2.25  ? 6  ILE C C      1  
ATOM 3508  O O      . ILE E 3 6  ? -22.459 -4.923  -9.468  1.00 2.14  ? 6  ILE C O      1  
ATOM 3509  C CB     . ILE E 3 6  ? -25.532 -4.095  -9.280  1.00 2.47  ? 6  ILE C CB     1  
ATOM 3510  C CG1    . ILE E 3 6  ? -25.680 -2.757  -10.016 1.00 3.15  ? 6  ILE C CG1    1  
ATOM 3511  C CG2    . ILE E 3 6  ? -24.844 -3.890  -7.934  1.00 2.57  ? 6  ILE C CG2    1  
ATOM 3512  C CD1    . ILE E 3 6  ? -26.559 -1.759  -9.292  1.00 3.96  ? 6  ILE C CD1    1  
ATOM 3513  H H      . ILE E 3 6  ? -24.592 -6.588  -8.641  1.00 2.14  ? 6  ILE C H      1  
ATOM 3514  H HA     . ILE E 3 6  ? -25.219 -5.140  -11.128 1.00 2.50  ? 6  ILE C HA     1  
ATOM 3515  H HB     . ILE E 3 6  ? -26.515 -4.503  -9.093  1.00 2.36  ? 6  ILE C HB     1  
ATOM 3516  H HG12   . ILE E 3 6  ? -24.702 -2.310  -10.138 1.00 3.24  ? 6  ILE C HG12   1  
ATOM 3517  H HG13   . ILE E 3 6  ? -26.110 -2.937  -10.990 1.00 3.50  ? 6  ILE C HG13   1  
ATOM 3518  H HG21   . ILE E 3 6  ? -24.968 -4.774  -7.326  1.00 2.95  ? 6  ILE C HG21   1  
ATOM 3519  H HG22   . ILE E 3 6  ? -25.284 -3.042  -7.432  1.00 2.86  ? 6  ILE C HG22   1  
ATOM 3520  H HG23   . ILE E 3 6  ? -23.790 -3.707  -8.094  1.00 2.67  ? 6  ILE C HG23   1  
ATOM 3521  H HD11   . ILE E 3 6  ? -26.137 -1.543  -8.321  1.00 4.05  ? 6  ILE C HD11   1  
ATOM 3522  H HD12   . ILE E 3 6  ? -27.548 -2.175  -9.170  1.00 4.22  ? 6  ILE C HD12   1  
ATOM 3523  H HD13   . ILE E 3 6  ? -26.619 -0.847  -9.869  1.00 4.61  ? 6  ILE C HD13   1  
ATOM 3524  N N      . VAL E 3 7  ? -23.032 -3.988  -11.423 1.00 2.33  ? 7  VAL C N      1  
ATOM 3525  C CA     . VAL E 3 7  ? -21.697 -3.487  -11.685 1.00 2.28  ? 7  VAL C CA     1  
ATOM 3526  C C      . VAL E 3 7  ? -21.585 -2.044  -11.217 1.00 2.34  ? 7  VAL C C      1  
ATOM 3527  O O      . VAL E 3 7  ? -22.191 -1.142  -11.797 1.00 2.48  ? 7  VAL C O      1  
ATOM 3528  C CB     . VAL E 3 7  ? -21.330 -3.573  -13.181 1.00 2.36  ? 7  VAL C CB     1  
ATOM 3529  C CG1    . VAL E 3 7  ? -19.875 -3.192  -13.399 1.00 2.49  ? 7  VAL C CG1    1  
ATOM 3530  C CG2    . VAL E 3 7  ? -21.597 -4.967  -13.720 1.00 2.53  ? 7  VAL C CG2    1  
ATOM 3531  H H      . VAL E 3 7  ? -23.744 -3.825  -12.080 1.00 2.44  ? 7  VAL C H      1  
ATOM 3532  H HA     . VAL E 3 7  ? -20.997 -4.092  -11.126 1.00 2.19  ? 7  VAL C HA     1  
ATOM 3533  H HB     . VAL E 3 7  ? -21.950 -2.873  -13.726 1.00 2.57  ? 7  VAL C HB     1  
ATOM 3534  H HG11   . VAL E 3 7  ? -19.668 -3.154  -14.459 1.00 2.84  ? 7  VAL C HG11   1  
ATOM 3535  H HG12   . VAL E 3 7  ? -19.235 -3.929  -12.934 1.00 2.78  ? 7  VAL C HG12   1  
ATOM 3536  H HG13   . VAL E 3 7  ? -19.687 -2.225  -12.960 1.00 2.65  ? 7  VAL C HG13   1  
ATOM 3537  H HG21   . VAL E 3 7  ? -22.657 -5.165  -13.694 1.00 2.54  ? 7  VAL C HG21   1  
ATOM 3538  H HG22   . VAL E 3 7  ? -21.079 -5.694  -13.112 1.00 2.81  ? 7  VAL C HG22   1  
ATOM 3539  H HG23   . VAL E 3 7  ? -21.245 -5.033  -14.739 1.00 2.98  ? 7  VAL C HG23   1  
ATOM 3540  N N      . ARG E 3 8  ? -20.833 -1.839  -10.152 1.00 2.29  ? 8  ARG C N      1  
ATOM 3541  C CA     . ARG E 3 8  ? -20.640 -0.510  -9.602  1.00 2.40  ? 8  ARG C CA     1  
ATOM 3542  C C      . ARG E 3 8  ? -19.384 0.113   -10.188 1.00 2.12  ? 8  ARG C C      1  
ATOM 3543  O O      . ARG E 3 8  ? -18.339 -0.535  -10.262 1.00 1.97  ? 8  ARG C O      1  
ATOM 3544  C CB     . ARG E 3 8  ? -20.533 -0.577  -8.078  1.00 2.72  ? 8  ARG C CB     1  
ATOM 3545  C CG     . ARG E 3 8  ? -21.524 0.320   -7.346  1.00 2.85  ? 8  ARG C CG     1  
ATOM 3546  C CD     . ARG E 3 8  ? -22.963 0.003   -7.731  1.00 2.57  ? 8  ARG C CD     1  
ATOM 3547  N NE     . ARG E 3 8  ? -23.906 0.330   -6.659  1.00 2.72  ? 8  ARG C NE     1  
ATOM 3548  C CZ     . ARG E 3 8  ? -24.847 1.276   -6.743  1.00 3.13  ? 8  ARG C CZ     1  
ATOM 3549  N NH1    . ARG E 3 8  ? -24.987 1.992   -7.854  1.00 3.53  ? 8  ARG C NH1    1  
ATOM 3550  N NH2    . ARG E 3 8  ? -25.657 1.496   -5.712  1.00 3.60  ? 8  ARG C NH2    1  
ATOM 3551  H H      . ARG E 3 8  ? -20.378 -2.605  -9.730  1.00 2.23  ? 8  ARG C H      1  
ATOM 3552  H HA     . ARG E 3 8  ? -21.493 0.091   -9.874  1.00 2.59  ? 8  ARG C HA     1  
ATOM 3553  H HB2    . ARG E 3 8  ? -20.701 -1.596  -7.762  1.00 3.07  ? 8  ARG C HB2    1  
ATOM 3554  H HB3    . ARG E 3 8  ? -19.534 -0.283  -7.792  1.00 2.98  ? 8  ARG C HB3    1  
ATOM 3555  H HG2    . ARG E 3 8  ? -21.409 0.175   -6.283  1.00 3.10  ? 8  ARG C HG2    1  
ATOM 3556  H HG3    . ARG E 3 8  ? -21.313 1.350   -7.596  1.00 3.45  ? 8  ARG C HG3    1  
ATOM 3557  H HD2    . ARG E 3 8  ? -23.220 0.573   -8.610  1.00 3.13  ? 8  ARG C HD2    1  
ATOM 3558  H HD3    . ARG E 3 8  ? -23.038 -1.052  -7.954  1.00 2.33  ? 8  ARG C HD3    1  
ATOM 3559  H HE     . ARG E 3 8  ? -23.834 -0.191  -5.830  1.00 2.90  ? 8  ARG C HE     1  
ATOM 3560  H HH11   . ARG E 3 8  ? -24.386 1.829   -8.641  1.00 3.64  ? 8  ARG C HH11   1  
ATOM 3561  H HH12   . ARG E 3 8  ? -25.699 2.699   -7.916  1.00 4.00  ? 8  ARG C HH12   1  
ATOM 3562  H HH21   . ARG E 3 8  ? -25.566 0.957   -4.872  1.00 3.82  ? 8  ARG C HH21   1  
ATOM 3563  H HH22   . ARG E 3 8  ? -26.367 2.205   -5.771  1.00 3.98  ? 8  ARG C HH22   1  
ATOM 3564  N N      . LYS E 3 9  ? -19.486 1.359   -10.610 1.00 2.14  ? 9  LYS C N      1  
ATOM 3565  C CA     . LYS E 3 9  ? -18.353 2.056   -11.195 1.00 1.98  ? 9  LYS C CA     1  
ATOM 3566  C C      . LYS E 3 9  ? -17.427 2.593   -10.113 1.00 1.89  ? 9  LYS C C      1  
ATOM 3567  O O      . LYS E 3 9  ? -17.875 3.059   -9.064  1.00 2.00  ? 9  LYS C O      1  
ATOM 3568  C CB     . LYS E 3 9  ? -18.832 3.206   -12.084 1.00 2.06  ? 9  LYS C CB     1  
ATOM 3569  C CG     . LYS E 3 9  ? -19.642 4.254   -11.341 1.00 2.64  ? 9  LYS C CG     1  
ATOM 3570  C CD     . LYS E 3 9  ? -19.207 5.661   -11.714 1.00 2.61  ? 9  LYS C CD     1  
ATOM 3571  C CE     . LYS E 3 9  ? -19.807 6.691   -10.773 1.00 2.63  ? 9  LYS C CE     1  
ATOM 3572  N NZ     . LYS E 3 9  ? -19.686 8.070   -11.309 1.00 2.49  ? 9  LYS C NZ     1  
ATOM 3573  H H      . LYS E 3 9  ? -20.343 1.828   -10.518 1.00 2.32  ? 9  LYS C H      1  
ATOM 3574  H HA     . LYS E 3 9  ? -17.808 1.349   -11.801 1.00 1.98  ? 9  LYS C HA     1  
ATOM 3575  H HB2    . LYS E 3 9  ? -17.973 3.690   -12.519 1.00 2.29  ? 9  LYS C HB2    1  
ATOM 3576  H HB3    . LYS E 3 9  ? -19.447 2.801   -12.876 1.00 1.89  ? 9  LYS C HB3    1  
ATOM 3577  H HG2    . LYS E 3 9  ? -20.685 4.132   -11.592 1.00 2.95  ? 9  LYS C HG2    1  
ATOM 3578  H HG3    . LYS E 3 9  ? -19.509 4.112   -10.278 1.00 3.28  ? 9  LYS C HG3    1  
ATOM 3579  H HD2    . LYS E 3 9  ? -18.130 5.722   -11.659 1.00 3.00  ? 9  LYS C HD2    1  
ATOM 3580  H HD3    . LYS E 3 9  ? -19.531 5.873   -12.722 1.00 2.77  ? 9  LYS C HD3    1  
ATOM 3581  H HE2    . LYS E 3 9  ? -20.850 6.461   -10.627 1.00 3.02  ? 9  LYS C HE2    1  
ATOM 3582  H HE3    . LYS E 3 9  ? -19.292 6.636   -9.824  1.00 2.98  ? 9  LYS C HE3    1  
ATOM 3583  H HZ1    . LYS E 3 9  ? -20.287 8.721   -10.764 1.00 2.47  ? 9  LYS C HZ1    1  
ATOM 3584  H HZ2    . LYS E 3 9  ? -19.984 8.095   -12.304 1.00 2.83  ? 9  LYS C HZ2    1  
ATOM 3585  H HZ3    . LYS E 3 9  ? -18.693 8.393   -11.246 1.00 2.75  ? 9  LYS C HZ3    1  
ATOM 3586  N N      . VAL E 3 10 ? -16.134 2.516   -10.373 1.00 1.86  ? 10 VAL C N      1  
ATOM 3587  C CA     . VAL E 3 10 ? -15.135 3.005   -9.442  1.00 1.98  ? 10 VAL C CA     1  
ATOM 3588  C C      . VAL E 3 10 ? -14.571 4.325   -9.949  1.00 2.06  ? 10 VAL C C      1  
ATOM 3589  O O      . VAL E 3 10 ? -13.923 4.371   -10.995 1.00 2.49  ? 10 VAL C O      1  
ATOM 3590  C CB     . VAL E 3 10 ? -13.983 1.992   -9.249  1.00 2.07  ? 10 VAL C CB     1  
ATOM 3591  C CG1    . VAL E 3 10 ? -12.995 2.494   -8.203  1.00 2.70  ? 10 VAL C CG1    1  
ATOM 3592  C CG2    . VAL E 3 10 ? -14.528 0.625   -8.854  1.00 1.88  ? 10 VAL C CG2    1  
ATOM 3593  H H      . VAL E 3 10 ? -15.838 2.121   -11.224 1.00 1.86  ? 10 VAL C H      1  
ATOM 3594  H HA     . VAL E 3 10 ? -15.615 3.168   -8.486  1.00 2.14  ? 10 VAL C HA     1  
ATOM 3595  H HB     . VAL E 3 10 ? -13.459 1.889   -10.189 1.00 2.46  ? 10 VAL C HB     1  
ATOM 3596  H HG11   . VAL E 3 10 ? -12.527 3.402   -8.554  1.00 3.27  ? 10 VAL C HG11   1  
ATOM 3597  H HG12   . VAL E 3 10 ? -12.240 1.741   -8.030  1.00 2.94  ? 10 VAL C HG12   1  
ATOM 3598  H HG13   . VAL E 3 10 ? -13.522 2.695   -7.281  1.00 2.98  ? 10 VAL C HG13   1  
ATOM 3599  H HG21   . VAL E 3 10 ? -15.106 0.214   -9.670  1.00 2.01  ? 10 VAL C HG21   1  
ATOM 3600  H HG22   . VAL E 3 10 ? -15.160 0.728   -7.983  1.00 2.20  ? 10 VAL C HG22   1  
ATOM 3601  H HG23   . VAL E 3 10 ? -13.707 -0.038  -8.627  1.00 2.27  ? 10 VAL C HG23   1  
ATOM 3602  N N      . ASP E 3 11 ? -14.848 5.398   -9.224  1.00 2.03  ? 11 ASP C N      1  
ATOM 3603  C CA     . ASP E 3 11 ? -14.363 6.722   -9.599  1.00 2.16  ? 11 ASP C CA     1  
ATOM 3604  C C      . ASP E 3 11 ? -13.109 7.060   -8.800  1.00 2.11  ? 11 ASP C C      1  
ATOM 3605  O O      . ASP E 3 11 ? -12.431 6.155   -8.306  1.00 2.39  ? 11 ASP C O      1  
ATOM 3606  C CB     . ASP E 3 11 ? -15.454 7.776   -9.375  1.00 2.42  ? 11 ASP C CB     1  
ATOM 3607  C CG     . ASP E 3 11 ? -15.865 8.460   -10.666 1.00 2.88  ? 11 ASP C CG     1  
ATOM 3608  O OD1    . ASP E 3 11 ? -15.004 9.109   -11.298 1.00 3.57  ? 11 ASP C OD1    1  
ATOM 3609  O OD2    . ASP E 3 11 ? -17.046 8.352   -11.058 1.00 2.94  ? 11 ASP C OD2    1  
ATOM 3610  H H      . ASP E 3 11 ? -15.381 5.297   -8.412  1.00 2.18  ? 11 ASP C H      1  
ATOM 3611  H HA     . ASP E 3 11 ? -14.107 6.694   -10.647 1.00 2.39  ? 11 ASP C HA     1  
ATOM 3612  H HB2    . ASP E 3 11 ? -16.326 7.301   -8.948  1.00 2.43  ? 11 ASP C HB2    1  
ATOM 3613  H HB3    . ASP E 3 11 ? -15.086 8.527   -8.692  1.00 2.74  ? 11 ASP C HB3    1  
ATOM 3614  N N      . GLU E 3 12 ? -12.795 8.346   -8.671  1.00 2.07  ? 12 GLU C N      1  
ATOM 3615  C CA     . GLU E 3 12 ? -11.612 8.769   -7.920  1.00 2.20  ? 12 GLU C CA     1  
ATOM 3616  C C      . GLU E 3 12 ? -11.820 8.547   -6.425  1.00 2.26  ? 12 GLU C C      1  
ATOM 3617  O O      . GLU E 3 12 ? -12.150 9.478   -5.688  1.00 2.71  ? 12 GLU C O      1  
ATOM 3618  C CB     . GLU E 3 12 ? -11.286 10.243  -8.186  1.00 2.31  ? 12 GLU C CB     1  
ATOM 3619  C CG     . GLU E 3 12 ? -10.340 10.467  -9.355  1.00 2.29  ? 12 GLU C CG     1  
ATOM 3620  C CD     . GLU E 3 12 ? -11.051 10.470  -10.691 1.00 2.58  ? 12 GLU C CD     1  
ATOM 3621  O OE1    . GLU E 3 12 ? -11.979 11.285  -10.873 1.00 2.83  ? 12 GLU C OE1    1  
ATOM 3622  O OE2    . GLU E 3 12 ? -10.681 9.666   -11.573 1.00 3.21  ? 12 GLU C OE2    1  
ATOM 3623  H H      . GLU E 3 12 ? -13.371 9.025   -9.080  1.00 2.16  ? 12 GLU C H      1  
ATOM 3624  H HA     . GLU E 3 12 ? -10.782 8.161   -8.247  1.00 2.39  ? 12 GLU C HA     1  
ATOM 3625  H HB2    . GLU E 3 12 ? -12.205 10.772  -8.391  1.00 2.69  ? 12 GLU C HB2    1  
ATOM 3626  H HB3    . GLU E 3 12 ? -10.832 10.662  -7.300  1.00 2.39  ? 12 GLU C HB3    1  
ATOM 3627  H HG2    . GLU E 3 12 ? -9.852  11.421  -9.226  1.00 2.63  ? 12 GLU C HG2    1  
ATOM 3628  H HG3    . GLU E 3 12 ? -9.598  9.682   -9.358  1.00 2.56  ? 12 GLU C HG3    1  
ATOM 3629  N N      . LEU E 3 13 ? -11.645 7.307   -5.988  1.00 2.12  ? 13 LEU C N      1  
ATOM 3630  C CA     . LEU E 3 13 ? -11.817 6.952   -4.590  1.00 2.39  ? 13 LEU C CA     1  
ATOM 3631  C C      . LEU E 3 13 ? -10.831 5.868   -4.176  1.00 2.59  ? 13 LEU C C      1  
ATOM 3632  O O      . LEU E 3 13 ? -9.638  6.120   -4.017  1.00 3.01  ? 13 LEU C O      1  
ATOM 3633  C CB     . LEU E 3 13 ? -13.250 6.466   -4.331  1.00 2.41  ? 13 LEU C CB     1  
ATOM 3634  C CG     . LEU E 3 13 ? -14.299 7.561   -4.201  1.00 2.96  ? 13 LEU C CG     1  
ATOM 3635  C CD1    . LEU E 3 13 ? -15.251 7.537   -5.389  1.00 3.39  ? 13 LEU C CD1    1  
ATOM 3636  C CD2    . LEU E 3 13 ? -15.061 7.396   -2.897  1.00 3.26  ? 13 LEU C CD2    1  
ATOM 3637  H H      . LEU E 3 13 ? -11.402 6.606   -6.633  1.00 2.08  ? 13 LEU C H      1  
ATOM 3638  H HA     . LEU E 3 13 ? -11.633 7.834   -3.998  1.00 2.75  ? 13 LEU C HA     1  
ATOM 3639  H HB2    . LEU E 3 13 ? -13.540 5.818   -5.146  1.00 2.12  ? 13 LEU C HB2    1  
ATOM 3640  H HB3    . LEU E 3 13 ? -13.252 5.888   -3.418  1.00 2.77  ? 13 LEU C HB3    1  
ATOM 3641  H HG     . LEU E 3 13 ? -13.809 8.522   -4.186  1.00 3.52  ? 13 LEU C HG     1  
ATOM 3642  H HD11   . LEU E 3 13 ? -15.860 8.430   -5.382  1.00 3.74  ? 13 LEU C HD11   1  
ATOM 3643  H HD12   . LEU E 3 13 ? -15.887 6.666   -5.322  1.00 3.77  ? 13 LEU C HD12   1  
ATOM 3644  H HD13   . LEU E 3 13 ? -14.683 7.497   -6.306  1.00 3.47  ? 13 LEU C HD13   1  
ATOM 3645  H HD21   . LEU E 3 13 ? -15.603 6.463   -2.915  1.00 3.64  ? 13 LEU C HD21   1  
ATOM 3646  H HD22   . LEU E 3 13 ? -15.754 8.213   -2.780  1.00 3.38  ? 13 LEU C HD22   1  
ATOM 3647  H HD23   . LEU E 3 13 ? -14.366 7.392   -2.071  1.00 3.59  ? 13 LEU C HD23   1  
ATOM 3648  N N      . GLY E 3 14 ? -11.346 4.657   -4.021  1.00 2.60  ? 14 GLY C N      1  
ATOM 3649  C CA     . GLY E 3 14 ? -10.534 3.534   -3.607  1.00 2.93  ? 14 GLY C CA     1  
ATOM 3650  C C      . GLY E 3 14 ? -11.386 2.469   -2.953  1.00 2.93  ? 14 GLY C C      1  
ATOM 3651  O O      . GLY E 3 14 ? -11.100 1.281   -3.060  1.00 3.16  ? 14 GLY C O      1  
ATOM 3652  H H      . GLY E 3 14 ? -12.299 4.519   -4.204  1.00 2.61  ? 14 GLY C H      1  
ATOM 3653  H HA2    . GLY E 3 14 ? -10.042 3.116   -4.472  1.00 2.99  ? 14 GLY C HA2    1  
ATOM 3654  H HA3    . GLY E 3 14 ? -9.790  3.873   -2.903  1.00 3.24  ? 14 GLY C HA3    1  
ATOM 3655  N N      . ARG E 3 15 ? -12.445 2.910   -2.281  1.00 2.87  ? 15 ARG C N      1  
ATOM 3656  C CA     . ARG E 3 15 ? -13.373 2.002   -1.616  1.00 3.01  ? 15 ARG C CA     1  
ATOM 3657  C C      . ARG E 3 15 ? -14.760 2.165   -2.225  1.00 2.89  ? 15 ARG C C      1  
ATOM 3658  O O      . ARG E 3 15 ? -15.017 3.155   -2.912  1.00 3.22  ? 15 ARG C O      1  
ATOM 3659  C CB     . ARG E 3 15 ? -13.404 2.248   -0.102  1.00 3.28  ? 15 ARG C CB     1  
ATOM 3660  C CG     . ARG E 3 15 ? -13.953 3.606   0.324   1.00 3.70  ? 15 ARG C CG     1  
ATOM 3661  C CD     . ARG E 3 15 ? -14.125 3.669   1.838   1.00 4.16  ? 15 ARG C CD     1  
ATOM 3662  N NE     . ARG E 3 15 ? -14.625 4.964   2.304   1.00 4.39  ? 15 ARG C NE     1  
ATOM 3663  C CZ     . ARG E 3 15 ? -15.206 5.151   3.492   1.00 4.65  ? 15 ARG C CZ     1  
ATOM 3664  N NH1    . ARG E 3 15 ? -15.397 4.131   4.319   1.00 4.84  ? 15 ARG C NH1    1  
ATOM 3665  N NH2    . ARG E 3 15 ? -15.609 6.360   3.858   1.00 5.05  ? 15 ARG C NH2    1  
ATOM 3666  H H      . ARG E 3 15 ? -12.615 3.871   -2.241  1.00 2.85  ? 15 ARG C H      1  
ATOM 3667  H HA     . ARG E 3 15 ? -13.032 0.995   -1.802  1.00 3.22  ? 15 ARG C HA     1  
ATOM 3668  H HB2    . ARG E 3 15 ? -14.016 1.485   0.356   1.00 3.27  ? 15 ARG C HB2    1  
ATOM 3669  H HB3    . ARG E 3 15 ? -12.397 2.158   0.281   1.00 3.61  ? 15 ARG C HB3    1  
ATOM 3670  H HG2    . ARG E 3 15 ? -13.261 4.376   0.017   1.00 3.80  ? 15 ARG C HG2    1  
ATOM 3671  H HG3    . ARG E 3 15 ? -14.911 3.766   -0.147  1.00 4.04  ? 15 ARG C HG3    1  
ATOM 3672  H HD2    . ARG E 3 15 ? -14.821 2.901   2.139   1.00 4.35  ? 15 ARG C HD2    1  
ATOM 3673  H HD3    . ARG E 3 15 ? -13.167 3.480   2.300   1.00 4.59  ? 15 ARG C HD3    1  
ATOM 3674  H HE     . ARG E 3 15 ? -14.503 5.734   1.708   1.00 4.60  ? 15 ARG C HE     1  
ATOM 3675  H HH11   . ARG E 3 15 ? -15.113 3.207   4.063   1.00 4.80  ? 15 ARG C HH11   1  
ATOM 3676  H HH12   . ARG E 3 15 ? -15.823 4.290   5.224   1.00 5.23  ? 15 ARG C HH12   1  
ATOM 3677  H HH21   . ARG E 3 15 ? -15.483 7.145   3.250   1.00 5.26  ? 15 ARG C HH21   1  
ATOM 3678  H HH22   . ARG E 3 15 ? -16.039 6.492   4.772   1.00 5.35  ? 15 ARG C HH22   1  
ATOM 3679  N N      . VAL E 3 16 ? -15.658 1.221   -1.968  1.00 2.57  ? 16 VAL C N      1  
ATOM 3680  C CA     . VAL E 3 16 ? -16.997 1.292   -2.551  1.00 2.50  ? 16 VAL C CA     1  
ATOM 3681  C C      . VAL E 3 16 ? -18.086 1.065   -1.504  1.00 2.47  ? 16 VAL C C      1  
ATOM 3682  O O      . VAL E 3 16 ? -17.842 1.189   -0.303  1.00 2.49  ? 16 VAL C O      1  
ATOM 3683  C CB     . VAL E 3 16 ? -17.165 0.276   -3.708  1.00 2.38  ? 16 VAL C CB     1  
ATOM 3684  C CG1    . VAL E 3 16 ? -16.388 0.722   -4.939  1.00 2.64  ? 16 VAL C CG1    1  
ATOM 3685  C CG2    . VAL E 3 16 ? -16.731 -1.117  -3.279  1.00 2.56  ? 16 VAL C CG2    1  
ATOM 3686  H H      . VAL E 3 16 ? -15.431 0.480   -1.359  1.00 2.49  ? 16 VAL C H      1  
ATOM 3687  H HA     . VAL E 3 16 ? -17.119 2.284   -2.958  1.00 2.73  ? 16 VAL C HA     1  
ATOM 3688  H HB     . VAL E 3 16 ? -18.209 0.236   -3.974  1.00 2.57  ? 16 VAL C HB     1  
ATOM 3689  H HG11   . VAL E 3 16 ? -15.328 0.643   -4.747  1.00 3.02  ? 16 VAL C HG11   1  
ATOM 3690  H HG12   . VAL E 3 16 ? -16.635 1.747   -5.167  1.00 2.88  ? 16 VAL C HG12   1  
ATOM 3691  H HG13   . VAL E 3 16 ? -16.652 0.092   -5.776  1.00 2.89  ? 16 VAL C HG13   1  
ATOM 3692  H HG21   . VAL E 3 16 ? -15.773 -1.060  -2.786  1.00 2.79  ? 16 VAL C HG21   1  
ATOM 3693  H HG22   . VAL E 3 16 ? -16.651 -1.749  -4.149  1.00 2.85  ? 16 VAL C HG22   1  
ATOM 3694  H HG23   . VAL E 3 16 ? -17.463 -1.528  -2.600  1.00 2.86  ? 16 VAL C HG23   1  
ATOM 3695  N N      . VAL E 3 17 ? -19.288 0.743   -1.964  1.00 2.57  ? 17 VAL C N      1  
ATOM 3696  C CA     . VAL E 3 17 ? -20.417 0.505   -1.074  1.00 2.70  ? 17 VAL C CA     1  
ATOM 3697  C C      . VAL E 3 17 ? -21.091 -0.826  -1.377  1.00 2.55  ? 17 VAL C C      1  
ATOM 3698  O O      . VAL E 3 17 ? -20.709 -1.534  -2.308  1.00 2.64  ? 17 VAL C O      1  
ATOM 3699  C CB     . VAL E 3 17 ? -21.481 1.614   -1.188  1.00 3.05  ? 17 VAL C CB     1  
ATOM 3700  C CG1    . VAL E 3 17 ? -21.101 2.823   -0.354  1.00 3.44  ? 17 VAL C CG1    1  
ATOM 3701  C CG2    . VAL E 3 17 ? -21.699 2.005   -2.642  1.00 3.34  ? 17 VAL C CG2    1  
ATOM 3702  H H      . VAL E 3 17 ? -19.420 0.652   -2.930  1.00 2.64  ? 17 VAL C H      1  
ATOM 3703  H HA     . VAL E 3 17 ? -20.047 0.490   -0.059  1.00 2.79  ? 17 VAL C HA     1  
ATOM 3704  H HB     . VAL E 3 17 ? -22.411 1.223   -0.805  1.00 3.13  ? 17 VAL C HB     1  
ATOM 3705  H HG11   . VAL E 3 17 ? -20.215 3.282   -0.770  1.00 3.62  ? 17 VAL C HG11   1  
ATOM 3706  H HG12   . VAL E 3 17 ? -20.904 2.513   0.661   1.00 3.67  ? 17 VAL C HG12   1  
ATOM 3707  H HG13   . VAL E 3 17 ? -21.912 3.535   -0.361  1.00 3.81  ? 17 VAL C HG13   1  
ATOM 3708  H HG21   . VAL E 3 17 ? -22.496 2.729   -2.703  1.00 3.59  ? 17 VAL C HG21   1  
ATOM 3709  H HG22   . VAL E 3 17 ? -21.964 1.128   -3.214  1.00 3.58  ? 17 VAL C HG22   1  
ATOM 3710  H HG23   . VAL E 3 17 ? -20.791 2.434   -3.040  1.00 3.56  ? 17 VAL C HG23   1  
ATOM 3711  N N      . ILE E 3 18 ? -22.108 -1.143  -0.591  1.00 2.49  ? 18 ILE C N      1  
ATOM 3712  C CA     . ILE E 3 18 ? -22.865 -2.373  -0.750  1.00 2.44  ? 18 ILE C CA     1  
ATOM 3713  C C      . ILE E 3 18 ? -24.312 -2.027  -1.087  1.00 2.40  ? 18 ILE C C      1  
ATOM 3714  O O      . ILE E 3 18 ? -24.879 -1.124  -0.473  1.00 2.42  ? 18 ILE C O      1  
ATOM 3715  C CB     . ILE E 3 18 ? -22.843 -3.225  0.542   1.00 2.59  ? 18 ILE C CB     1  
ATOM 3716  C CG1    . ILE E 3 18 ? -21.528 -3.020  1.300   1.00 2.79  ? 18 ILE C CG1    1  
ATOM 3717  C CG2    . ILE E 3 18 ? -23.038 -4.698  0.212   1.00 2.73  ? 18 ILE C CG2    1  
ATOM 3718  C CD1    . ILE E 3 18 ? -21.556 -3.553  2.716   1.00 3.34  ? 18 ILE C CD1    1  
ATOM 3719  H H      . ILE E 3 18 ? -22.372 -0.521  0.115   1.00 2.58  ? 18 ILE C H      1  
ATOM 3720  H HA     . ILE E 3 18 ? -22.430 -2.946  -1.557  1.00 2.45  ? 18 ILE C HA     1  
ATOM 3721  H HB     . ILE E 3 18 ? -23.664 -2.910  1.169   1.00 3.05  ? 18 ILE C HB     1  
ATOM 3722  H HG12   . ILE E 3 18 ? -20.734 -3.525  0.772   1.00 3.09  ? 18 ILE C HG12   1  
ATOM 3723  H HG13   . ILE E 3 18 ? -21.309 -1.963  1.346   1.00 3.02  ? 18 ILE C HG13   1  
ATOM 3724  H HG21   . ILE E 3 18 ? -24.008 -4.841  -0.239  1.00 3.15  ? 18 ILE C HG21   1  
ATOM 3725  H HG22   . ILE E 3 18 ? -22.974 -5.282  1.119   1.00 2.86  ? 18 ILE C HG22   1  
ATOM 3726  H HG23   . ILE E 3 18 ? -22.269 -5.018  -0.476  1.00 2.99  ? 18 ILE C HG23   1  
ATOM 3727  H HD11   . ILE E 3 18 ? -22.566 -3.508  3.099   1.00 3.72  ? 18 ILE C HD11   1  
ATOM 3728  H HD12   . ILE E 3 18 ? -20.910 -2.952  3.338   1.00 3.62  ? 18 ILE C HD12   1  
ATOM 3729  H HD13   . ILE E 3 18 ? -21.213 -4.576  2.722   1.00 3.70  ? 18 ILE C HD13   1  
ATOM 3730  N N      . PRO E 3 19 ? -24.915 -2.713  -2.081  1.00 2.44  ? 19 PRO C N      1  
ATOM 3731  C CA     . PRO E 3 19 ? -26.309 -2.474  -2.484  1.00 2.54  ? 19 PRO C CA     1  
ATOM 3732  C C      . PRO E 3 19 ? -27.266 -2.448  -1.296  1.00 2.66  ? 19 PRO C C      1  
ATOM 3733  O O      . PRO E 3 19 ? -27.090 -3.197  -0.336  1.00 2.62  ? 19 PRO C O      1  
ATOM 3734  C CB     . PRO E 3 19 ? -26.621 -3.665  -3.386  1.00 2.61  ? 19 PRO C CB     1  
ATOM 3735  C CG     . PRO E 3 19 ? -25.308 -4.046  -3.972  1.00 2.60  ? 19 PRO C CG     1  
ATOM 3736  C CD     . PRO E 3 19 ? -24.281 -3.759  -2.907  1.00 2.52  ? 19 PRO C CD     1  
ATOM 3737  H HA     . PRO E 3 19 ? -26.407 -1.556  -3.045  1.00 2.59  ? 19 PRO C HA     1  
ATOM 3738  H HB2    . PRO E 3 19 ? -27.037 -4.467  -2.795  1.00 2.62  ? 19 PRO C HB2    1  
ATOM 3739  H HB3    . PRO E 3 19 ? -27.325 -3.369  -4.148  1.00 2.71  ? 19 PRO C HB3    1  
ATOM 3740  H HG2    . PRO E 3 19 ? -25.308 -5.098  -4.219  1.00 2.64  ? 19 PRO C HG2    1  
ATOM 3741  H HG3    . PRO E 3 19 ? -25.110 -3.453  -4.854  1.00 2.67  ? 19 PRO C HG3    1  
ATOM 3742  H HD2    . PRO E 3 19 ? -24.088 -4.646  -2.322  1.00 2.55  ? 19 PRO C HD2    1  
ATOM 3743  H HD3    . PRO E 3 19 ? -23.368 -3.395  -3.353  1.00 2.59  ? 19 PRO C HD3    1  
ATOM 3744  N N      . ILE E 3 20 ? -28.286 -1.599  -1.384  1.00 2.90  ? 20 ILE C N      1  
ATOM 3745  C CA     . ILE E 3 20 ? -29.277 -1.444  -0.318  1.00 3.12  ? 20 ILE C CA     1  
ATOM 3746  C C      . ILE E 3 20 ? -29.905 -2.781  0.088   1.00 3.09  ? 20 ILE C C      1  
ATOM 3747  O O      . ILE E 3 20 ? -30.031 -3.072  1.277   1.00 3.15  ? 20 ILE C O      1  
ATOM 3748  C CB     . ILE E 3 20 ? -30.388 -0.444  -0.726  1.00 3.52  ? 20 ILE C CB     1  
ATOM 3749  C CG1    . ILE E 3 20 ? -31.546 -0.475  0.279   1.00 3.92  ? 20 ILE C CG1    1  
ATOM 3750  C CG2    . ILE E 3 20 ? -30.885 -0.727  -2.137  1.00 3.85  ? 20 ILE C CG2    1  
ATOM 3751  C CD1    . ILE E 3 20 ? -32.653 0.508   -0.040  1.00 4.46  ? 20 ILE C CD1    1  
ATOM 3752  H H      . ILE E 3 20 ? -28.378 -1.058  -2.199  1.00 2.97  ? 20 ILE C H      1  
ATOM 3753  H HA     . ILE E 3 20 ? -28.764 -1.035  0.543   1.00 3.13  ? 20 ILE C HA     1  
ATOM 3754  H HB     . ILE E 3 20 ? -29.956 0.544   -0.726  1.00 3.60  ? 20 ILE C HB     1  
ATOM 3755  H HG12   . ILE E 3 20 ? -31.975 -1.464  0.293   1.00 4.17  ? 20 ILE C HG12   1  
ATOM 3756  H HG13   . ILE E 3 20 ? -31.166 -0.238  1.264   1.00 3.94  ? 20 ILE C HG13   1  
ATOM 3757  H HG21   . ILE E 3 20 ? -31.778 -0.149  -2.325  1.00 4.06  ? 20 ILE C HG21   1  
ATOM 3758  H HG22   . ILE E 3 20 ? -31.109 -1.778  -2.237  1.00 3.95  ? 20 ILE C HG22   1  
ATOM 3759  H HG23   . ILE E 3 20 ? -30.123 -0.451  -2.851  1.00 4.19  ? 20 ILE C HG23   1  
ATOM 3760  H HD11   . ILE E 3 20 ? -33.145 0.212   -0.956  1.00 4.88  ? 20 ILE C HD11   1  
ATOM 3761  H HD12   . ILE E 3 20 ? -32.233 1.496   -0.159  1.00 4.70  ? 20 ILE C HD12   1  
ATOM 3762  H HD13   . ILE E 3 20 ? -33.370 0.516   0.766   1.00 4.59  ? 20 ILE C HD13   1  
ATOM 3763  N N      . GLU E 3 21 ? -30.274 -3.596  -0.895  1.00 3.07  ? 21 GLU C N      1  
ATOM 3764  C CA     . GLU E 3 21 ? -30.894 -4.889  -0.616  1.00 3.12  ? 21 GLU C CA     1  
ATOM 3765  C C      . GLU E 3 21 ? -29.929 -5.815  0.127   1.00 3.02  ? 21 GLU C C      1  
ATOM 3766  O O      . GLU E 3 21 ? -30.320 -6.508  1.068   1.00 3.15  ? 21 GLU C O      1  
ATOM 3767  C CB     . GLU E 3 21 ? -31.393 -5.544  -1.911  1.00 3.16  ? 21 GLU C CB     1  
ATOM 3768  C CG     . GLU E 3 21 ? -30.293 -5.876  -2.904  1.00 3.57  ? 21 GLU C CG     1  
ATOM 3769  C CD     . GLU E 3 21 ? -30.459 -7.257  -3.499  1.00 3.79  ? 21 GLU C CD     1  
ATOM 3770  O OE1    . GLU E 3 21 ? -30.947 -8.158  -2.787  1.00 4.18  ? 21 GLU C OE1    1  
ATOM 3771  O OE2    . GLU E 3 21 ? -30.107 -7.445  -4.679  1.00 4.07  ? 21 GLU C OE2    1  
ATOM 3772  H H      . GLU E 3 21 ? -30.129 -3.321  -1.824  1.00 3.07  ? 21 GLU C H      1  
ATOM 3773  H HA     . GLU E 3 21 ? -31.743 -4.706  0.026   1.00 3.30  ? 21 GLU C HA     1  
ATOM 3774  H HB2    . GLU E 3 21 ? -31.908 -6.460  -1.663  1.00 3.21  ? 21 GLU C HB2    1  
ATOM 3775  H HB3    . GLU E 3 21 ? -32.090 -4.871  -2.392  1.00 3.24  ? 21 GLU C HB3    1  
ATOM 3776  H HG2    . GLU E 3 21 ? -30.312 -5.150  -3.703  1.00 4.24  ? 21 GLU C HG2    1  
ATOM 3777  H HG3    . GLU E 3 21 ? -29.341 -5.831  -2.397  1.00 3.62  ? 21 GLU C HG3    1  
ATOM 3778  N N      . LEU E 3 22 ? -28.665 -5.801  -0.274  1.00 2.89  ? 22 LEU C N      1  
ATOM 3779  C CA     . LEU E 3 22 ? -27.657 -6.631  0.366   1.00 2.93  ? 22 LEU C CA     1  
ATOM 3780  C C      . LEU E 3 22 ? -27.372 -6.104  1.764   1.00 3.06  ? 22 LEU C C      1  
ATOM 3781  O O      . LEU E 3 22 ? -27.269 -6.867  2.720   1.00 3.27  ? 22 LEU C O      1  
ATOM 3782  C CB     . LEU E 3 22 ? -26.365 -6.653  -0.456  1.00 2.89  ? 22 LEU C CB     1  
ATOM 3783  C CG     . LEU E 3 22 ? -26.148 -7.906  -1.309  1.00 2.93  ? 22 LEU C CG     1  
ATOM 3784  C CD1    . LEU E 3 22 ? -26.960 -7.837  -2.592  1.00 3.53  ? 22 LEU C CD1    1  
ATOM 3785  C CD2    . LEU E 3 22 ? -24.671 -8.079  -1.624  1.00 3.05  ? 22 LEU C CD2    1  
ATOM 3786  H H      . LEU E 3 22 ? -28.405 -5.212  -1.008  1.00 2.84  ? 22 LEU C H      1  
ATOM 3787  H HA     . LEU E 3 22 ? -28.048 -7.636  0.443   1.00 3.00  ? 22 LEU C HA     1  
ATOM 3788  H HB2    . LEU E 3 22 ? -26.366 -5.794  -1.113  1.00 3.23  ? 22 LEU C HB2    1  
ATOM 3789  H HB3    . LEU E 3 22 ? -25.531 -6.561  0.224   1.00 3.00  ? 22 LEU C HB3    1  
ATOM 3790  H HG     . LEU E 3 22 ? -26.475 -8.775  -0.754  1.00 3.10  ? 22 LEU C HG     1  
ATOM 3791  H HD11   . LEU E 3 22 ? -26.807 -8.741  -3.162  1.00 3.94  ? 22 LEU C HD11   1  
ATOM 3792  H HD12   . LEU E 3 22 ? -26.641 -6.984  -3.174  1.00 3.77  ? 22 LEU C HD12   1  
ATOM 3793  H HD13   . LEU E 3 22 ? -28.008 -7.738  -2.352  1.00 3.90  ? 22 LEU C HD13   1  
ATOM 3794  H HD21   . LEU E 3 22 ? -24.221 -7.110  -1.781  1.00 3.08  ? 22 LEU C HD21   1  
ATOM 3795  H HD22   . LEU E 3 22 ? -24.559 -8.675  -2.518  1.00 3.25  ? 22 LEU C HD22   1  
ATOM 3796  H HD23   . LEU E 3 22 ? -24.182 -8.573  -0.798  1.00 3.42  ? 22 LEU C HD23   1  
ATOM 3797  N N      . ARG E 3 23 ? -27.280 -4.786  1.864   1.00 3.02  ? 23 ARG C N      1  
ATOM 3798  C CA     . ARG E 3 23 ? -27.011 -4.107  3.124   1.00 3.21  ? 23 ARG C CA     1  
ATOM 3799  C C      . ARG E 3 23 ? -28.085 -4.437  4.158   1.00 3.42  ? 23 ARG C C      1  
ATOM 3800  O O      . ARG E 3 23 ? -27.780 -4.717  5.315   1.00 3.69  ? 23 ARG C O      1  
ATOM 3801  C CB     . ARG E 3 23 ? -26.943 -2.596  2.882   1.00 3.19  ? 23 ARG C CB     1  
ATOM 3802  C CG     . ARG E 3 23 ? -26.429 -1.790  4.064   1.00 3.39  ? 23 ARG C CG     1  
ATOM 3803  C CD     . ARG E 3 23 ? -25.896 -0.436  3.614   1.00 3.56  ? 23 ARG C CD     1  
ATOM 3804  N NE     . ARG E 3 23 ? -25.851 0.535   4.705   1.00 3.56  ? 23 ARG C NE     1  
ATOM 3805  C CZ     . ARG E 3 23 ? -25.228 1.712   4.633   1.00 3.81  ? 23 ARG C CZ     1  
ATOM 3806  N NH1    . ARG E 3 23 ? -24.575 2.059   3.527   1.00 4.22  ? 23 ARG C NH1    1  
ATOM 3807  N NH2    . ARG E 3 23 ? -25.260 2.545   5.663   1.00 4.06  ? 23 ARG C NH2    1  
ATOM 3808  H H      . ARG E 3 23 ? -27.395 -4.245  1.050   1.00 2.91  ? 23 ARG C H      1  
ATOM 3809  H HA     . ARG E 3 23 ? -26.056 -4.451  3.489   1.00 3.33  ? 23 ARG C HA     1  
ATOM 3810  H HB2    . ARG E 3 23 ? -26.290 -2.410  2.041   1.00 2.93  ? 23 ARG C HB2    1  
ATOM 3811  H HB3    . ARG E 3 23 ? -27.933 -2.241  2.638   1.00 3.64  ? 23 ARG C HB3    1  
ATOM 3812  H HG2    . ARG E 3 23 ? -27.240 -1.633  4.760   1.00 3.97  ? 23 ARG C HG2    1  
ATOM 3813  H HG3    . ARG E 3 23 ? -25.635 -2.339  4.548   1.00 3.24  ? 23 ARG C HG3    1  
ATOM 3814  H HD2    . ARG E 3 23 ? -24.895 -0.567  3.225   1.00 4.03  ? 23 ARG C HD2    1  
ATOM 3815  H HD3    . ARG E 3 23 ? -26.535 -0.053  2.833   1.00 3.69  ? 23 ARG C HD3    1  
ATOM 3816  H HE     . ARG E 3 23 ? -26.326 0.299   5.537   1.00 3.69  ? 23 ARG C HE     1  
ATOM 3817  H HH11   . ARG E 3 23 ? -24.550 1.440   2.742   1.00 4.36  ? 23 ARG C HH11   1  
ATOM 3818  H HH12   . ARG E 3 23 ? -24.100 2.943   3.480   1.00 4.63  ? 23 ARG C HH12   1  
ATOM 3819  H HH21   . ARG E 3 23 ? -25.754 2.294   6.508   1.00 4.21  ? 23 ARG C HH21   1  
ATOM 3820  H HH22   . ARG E 3 23 ? -24.806 3.441   5.605   1.00 4.36  ? 23 ARG C HH22   1  
ATOM 3821  N N      . ARG E 3 24 ? -29.340 -4.419  3.725   1.00 3.40  ? 24 ARG C N      1  
ATOM 3822  C CA     . ARG E 3 24 ? -30.460 -4.713  4.608   1.00 3.72  ? 24 ARG C CA     1  
ATOM 3823  C C      . ARG E 3 24 ? -30.464 -6.186  5.012   1.00 3.87  ? 24 ARG C C      1  
ATOM 3824  O O      . ARG E 3 24 ? -30.740 -6.522  6.166   1.00 4.25  ? 24 ARG C O      1  
ATOM 3825  C CB     . ARG E 3 24 ? -31.782 -4.351  3.925   1.00 3.76  ? 24 ARG C CB     1  
ATOM 3826  C CG     . ARG E 3 24 ? -32.946 -4.209  4.892   1.00 3.89  ? 24 ARG C CG     1  
ATOM 3827  C CD     . ARG E 3 24 ? -32.880 -2.898  5.663   1.00 4.12  ? 24 ARG C CD     1  
ATOM 3828  N NE     . ARG E 3 24 ? -33.119 -1.741  4.797   1.00 4.21  ? 24 ARG C NE     1  
ATOM 3829  C CZ     . ARG E 3 24 ? -32.424 -0.604  4.851   1.00 4.54  ? 24 ARG C CZ     1  
ATOM 3830  N NH1    . ARG E 3 24 ? -31.433 -0.469  5.722   1.00 4.79  ? 24 ARG C NH1    1  
ATOM 3831  N NH2    . ARG E 3 24 ? -32.720 0.400   4.029   1.00 5.04  ? 24 ARG C NH2    1  
ATOM 3832  H H      . ARG E 3 24 ? -29.519 -4.189  2.785   1.00 3.24  ? 24 ARG C H      1  
ATOM 3833  H HA     . ARG E 3 24 ? -30.347 -4.112  5.496   1.00 3.90  ? 24 ARG C HA     1  
ATOM 3834  H HB2    . ARG E 3 24 ? -31.659 -3.413  3.402   1.00 3.69  ? 24 ARG C HB2    1  
ATOM 3835  H HB3    . ARG E 3 24 ? -32.029 -5.120  3.208   1.00 4.00  ? 24 ARG C HB3    1  
ATOM 3836  H HG2    . ARG E 3 24 ? -33.870 -4.238  4.334   1.00 4.14  ? 24 ARG C HG2    1  
ATOM 3837  H HG3    . ARG E 3 24 ? -32.920 -5.032  5.592   1.00 3.98  ? 24 ARG C HG3    1  
ATOM 3838  H HD2    . ARG E 3 24 ? -33.631 -2.913  6.439   1.00 4.30  ? 24 ARG C HD2    1  
ATOM 3839  H HD3    . ARG E 3 24 ? -31.903 -2.806  6.112   1.00 4.54  ? 24 ARG C HD3    1  
ATOM 3840  H HE     . ARG E 3 24 ? -33.850 -1.817  4.140   1.00 4.36  ? 24 ARG C HE     1  
ATOM 3841  H HH11   . ARG E 3 24 ? -31.201 -1.222  6.345   1.00 4.77  ? 24 ARG C HH11   1  
ATOM 3842  H HH12   . ARG E 3 24 ? -30.905 0.383   5.760   1.00 5.26  ? 24 ARG C HH12   1  
ATOM 3843  H HH21   . ARG E 3 24 ? -33.469 0.305   3.365   1.00 5.21  ? 24 ARG C HH21   1  
ATOM 3844  H HH22   . ARG E 3 24 ? -32.200 1.256   4.067   1.00 5.48  ? 24 ARG C HH22   1  
ATOM 3845  N N      . THR E 3 25 ? -30.135 -7.054  4.065   1.00 3.63  ? 25 THR C N      1  
ATOM 3846  C CA     . THR E 3 25 ? -30.109 -8.488  4.316   1.00 3.81  ? 25 THR C CA     1  
ATOM 3847  C C      . THR E 3 25 ? -28.946 -8.875  5.235   1.00 3.96  ? 25 THR C C      1  
ATOM 3848  O O      . THR E 3 25 ? -29.048 -9.835  6.003   1.00 4.29  ? 25 THR C O      1  
ATOM 3849  C CB     . THR E 3 25 ? -30.012 -9.281  2.993   1.00 3.61  ? 25 THR C CB     1  
ATOM 3850  O OG1    . THR E 3 25 ? -31.060 -8.871  2.099   1.00 3.45  ? 25 THR C OG1    1  
ATOM 3851  C CG2    . THR E 3 25 ? -30.116 -10.782 3.238   1.00 3.93  ? 25 THR C CG2    1  
ATOM 3852  H H      . THR E 3 25 ? -29.905 -6.721  3.172   1.00 3.37  ? 25 THR C H      1  
ATOM 3853  H HA     . THR E 3 25 ? -31.037 -8.752  4.802   1.00 4.06  ? 25 THR C HA     1  
ATOM 3854  H HB     . THR E 3 25 ? -29.056 -9.072  2.534   1.00 3.55  ? 25 THR C HB     1  
ATOM 3855  H HG1    . THR E 3 25 ? -30.852 -7.998  1.732   1.00 3.04  ? 25 THR C HG1    1  
ATOM 3856  H HG21   . THR E 3 25 ? -29.371 -11.081 3.961   1.00 4.21  ? 25 THR C HG21   1  
ATOM 3857  H HG22   . THR E 3 25 ? -29.949 -11.311 2.312   1.00 4.14  ? 25 THR C HG22   1  
ATOM 3858  H HG23   . THR E 3 25 ? -31.100 -11.021 3.617   1.00 3.96  ? 25 THR C HG23   1  
ATOM 3859  N N      . LEU E 3 26 ? -27.851 -8.117  5.161   1.00 3.78  ? 26 LEU C N      1  
ATOM 3860  C CA     . LEU E 3 26 ? -26.672 -8.384  5.985   1.00 3.98  ? 26 LEU C CA     1  
ATOM 3861  C C      . LEU E 3 26 ? -27.035 -8.420  7.464   1.00 4.07  ? 26 LEU C C      1  
ATOM 3862  O O      . LEU E 3 26 ? -26.578 -9.295  8.205   1.00 4.60  ? 26 LEU C O      1  
ATOM 3863  C CB     . LEU E 3 26 ? -25.586 -7.329  5.740   1.00 3.89  ? 26 LEU C CB     1  
ATOM 3864  C CG     . LEU E 3 26 ? -24.832 -7.457  4.412   1.00 4.26  ? 26 LEU C CG     1  
ATOM 3865  C CD1    . LEU E 3 26 ? -23.938 -6.250  4.189   1.00 4.08  ? 26 LEU C CD1    1  
ATOM 3866  C CD2    . LEU E 3 26 ? -24.014 -8.740  4.383   1.00 5.02  ? 26 LEU C CD2    1  
ATOM 3867  H H      . LEU E 3 26 ? -27.834 -7.365  4.529   1.00 3.57  ? 26 LEU C H      1  
ATOM 3868  H HA     . LEU E 3 26 ? -26.289 -9.351  5.700   1.00 4.30  ? 26 LEU C HA     1  
ATOM 3869  H HB2    . LEU E 3 26 ? -26.048 -6.353  5.774   1.00 3.53  ? 26 LEU C HB2    1  
ATOM 3870  H HB3    . LEU E 3 26 ? -24.867 -7.394  6.543   1.00 4.08  ? 26 LEU C HB3    1  
ATOM 3871  H HG     . LEU E 3 26 ? -25.545 -7.495  3.601   1.00 4.45  ? 26 LEU C HG     1  
ATOM 3872  H HD11   . LEU E 3 26 ? -23.040 -6.346  4.783   1.00 4.36  ? 26 LEU C HD11   1  
ATOM 3873  H HD12   . LEU E 3 26 ? -24.467 -5.354  4.480   1.00 4.02  ? 26 LEU C HD12   1  
ATOM 3874  H HD13   . LEU E 3 26 ? -23.674 -6.186  3.144   1.00 4.23  ? 26 LEU C HD13   1  
ATOM 3875  H HD21   . LEU E 3 26 ? -23.454 -8.789  3.460   1.00 5.06  ? 26 LEU C HD21   1  
ATOM 3876  H HD22   . LEU E 3 26 ? -24.678 -9.590  4.444   1.00 5.30  ? 26 LEU C HD22   1  
ATOM 3877  H HD23   . LEU E 3 26 ? -23.333 -8.753  5.221   1.00 5.57  ? 26 LEU C HD23   1  
ATOM 3878  N N      . GLY E 3 27 ? -27.874 -7.479  7.882   1.00 3.74  ? 27 GLY C N      1  
ATOM 3879  C CA     . GLY E 3 27 ? -28.294 -7.419  9.270   1.00 3.94  ? 27 GLY C CA     1  
ATOM 3880  C C      . GLY E 3 27 ? -27.153 -7.071  10.195  1.00 3.84  ? 27 GLY C C      1  
ATOM 3881  O O      . GLY E 3 27 ? -27.013 -7.650  11.274  1.00 4.08  ? 27 GLY C O      1  
ATOM 3882  H H      . GLY E 3 27 ? -28.217 -6.823  7.241   1.00 3.52  ? 27 GLY C H      1  
ATOM 3883  H HA2    . GLY E 3 27 ? -29.069 -6.674  9.371   1.00 3.96  ? 27 GLY C HA2    1  
ATOM 3884  H HA3    . GLY E 3 27 ? -28.692 -8.379  9.556   1.00 4.35  ? 27 GLY C HA3    1  
ATOM 3885  N N      . ILE E 3 28 ? -26.343 -6.121  9.770   1.00 3.67  ? 28 ILE C N      1  
ATOM 3886  C CA     . ILE E 3 28 ? -25.194 -5.685  10.543  1.00 3.75  ? 28 ILE C CA     1  
ATOM 3887  C C      . ILE E 3 28 ? -25.325 -4.213  10.893  1.00 3.63  ? 28 ILE C C      1  
ATOM 3888  O O      . ILE E 3 28 ? -26.316 -3.567  10.546  1.00 3.75  ? 28 ILE C O      1  
ATOM 3889  C CB     . ILE E 3 28 ? -23.879 -5.901  9.762   1.00 3.97  ? 28 ILE C CB     1  
ATOM 3890  C CG1    . ILE E 3 28 ? -23.903 -5.122  8.442   1.00 3.91  ? 28 ILE C CG1    1  
ATOM 3891  C CG2    . ILE E 3 28 ? -23.645 -7.383  9.504   1.00 4.47  ? 28 ILE C CG2    1  
ATOM 3892  C CD1    . ILE E 3 28 ? -22.589 -5.152  7.696   1.00 4.18  ? 28 ILE C CD1    1  
ATOM 3893  H H      . ILE E 3 28 ? -26.531 -5.685  8.913   1.00 3.61  ? 28 ILE C H      1  
ATOM 3894  H HA     . ILE E 3 28 ? -25.156 -6.264  11.452  1.00 3.93  ? 28 ILE C HA     1  
ATOM 3895  H HB     . ILE E 3 28 ? -23.066 -5.536  10.370  1.00 3.97  ? 28 ILE C HB     1  
ATOM 3896  H HG12   . ILE E 3 28 ? -24.659 -5.542  7.795   1.00 4.03  ? 28 ILE C HG12   1  
ATOM 3897  H HG13   . ILE E 3 28 ? -24.143 -4.089  8.646   1.00 3.74  ? 28 ILE C HG13   1  
ATOM 3898  H HG21   . ILE E 3 28 ? -22.722 -7.512  8.958   1.00 4.75  ? 28 ILE C HG21   1  
ATOM 3899  H HG22   . ILE E 3 28 ? -24.464 -7.780  8.924   1.00 4.77  ? 28 ILE C HG22   1  
ATOM 3900  H HG23   . ILE E 3 28 ? -23.582 -7.908  10.444  1.00 4.53  ? 28 ILE C HG23   1  
ATOM 3901  H HD11   . ILE E 3 28 ? -21.821 -4.700  8.304   1.00 4.60  ? 28 ILE C HD11   1  
ATOM 3902  H HD12   . ILE E 3 28 ? -22.688 -4.602  6.772   1.00 4.24  ? 28 ILE C HD12   1  
ATOM 3903  H HD13   . ILE E 3 28 ? -22.321 -6.177  7.480   1.00 4.29  ? 28 ILE C HD13   1  
ATOM 3904  N N      . ALA E 3 29 ? -24.340 -3.689  11.596  1.00 3.56  ? 29 ALA C N      1  
ATOM 3905  C CA     . ALA E 3 29 ? -24.348 -2.289  11.965  1.00 3.56  ? 29 ALA C CA     1  
ATOM 3906  C C      . ALA E 3 29 ? -23.715 -1.462  10.853  1.00 3.59  ? 29 ALA C C      1  
ATOM 3907  O O      . ALA E 3 29 ? -23.144 -2.015  9.911   1.00 3.52  ? 29 ALA C O      1  
ATOM 3908  C CB     . ALA E 3 29 ? -23.619 -2.074  13.282  1.00 3.69  ? 29 ALA C CB     1  
ATOM 3909  H H      . ALA E 3 29 ? -23.586 -4.261  11.874  1.00 3.64  ? 29 ALA C H      1  
ATOM 3910  H HA     . ALA E 3 29 ? -25.375 -1.985  12.088  1.00 3.54  ? 29 ALA C HA     1  
ATOM 3911  H HB1    . ALA E 3 29 ? -23.858 -2.879  13.962  1.00 4.15  ? 29 ALA C HB1    1  
ATOM 3912  H HB2    . ALA E 3 29 ? -23.931 -1.136  13.716  1.00 3.62  ? 29 ALA C HB2    1  
ATOM 3913  H HB3    . ALA E 3 29 ? -22.555 -2.051  13.106  1.00 3.80  ? 29 ALA C HB3    1  
ATOM 3914  N N      . GLU E 3 30 ? -23.831 -0.147  10.946  1.00 3.82  ? 30 GLU C N      1  
ATOM 3915  C CA     . GLU E 3 30 ? -23.256 0.734   9.940   1.00 3.96  ? 30 GLU C CA     1  
ATOM 3916  C C      . GLU E 3 30 ? -21.737 0.667   10.023  1.00 3.71  ? 30 GLU C C      1  
ATOM 3917  O O      . GLU E 3 30 ? -21.050 0.537   9.012   1.00 3.69  ? 30 GLU C O      1  
ATOM 3918  C CB     . GLU E 3 30 ? -23.746 2.172   10.137  1.00 4.52  ? 30 GLU C CB     1  
ATOM 3919  C CG     . GLU E 3 30 ? -25.263 2.297   10.183  1.00 4.94  ? 30 GLU C CG     1  
ATOM 3920  C CD     . GLU E 3 30 ? -25.924 1.947   8.864   1.00 5.13  ? 30 GLU C CD     1  
ATOM 3921  O OE1    . GLU E 3 30 ? -26.049 0.742   8.551   1.00 5.13  ? 30 GLU C OE1    1  
ATOM 3922  O OE2    . GLU E 3 30 ? -26.325 2.877   8.133   1.00 5.58  ? 30 GLU C OE2    1  
ATOM 3923  H H      . GLU E 3 30 ? -24.305 0.242   11.713  1.00 3.97  ? 30 GLU C H      1  
ATOM 3924  H HA     . GLU E 3 30 ? -23.570 0.381   8.967   1.00 3.97  ? 30 GLU C HA     1  
ATOM 3925  H HB2    . GLU E 3 30 ? -23.346 2.555   11.065  1.00 4.42  ? 30 GLU C HB2    1  
ATOM 3926  H HB3    . GLU E 3 30 ? -23.382 2.779   9.322   1.00 4.96  ? 30 GLU C HB3    1  
ATOM 3927  H HG2    . GLU E 3 30 ? -25.643 1.634   10.945  1.00 5.33  ? 30 GLU C HG2    1  
ATOM 3928  H HG3    . GLU E 3 30 ? -25.519 3.316   10.436  1.00 5.09  ? 30 GLU C HG3    1  
ATOM 3929  N N      . LYS E 3 31 ? -21.228 0.719   11.247  1.00 3.70  ? 31 LYS C N      1  
ATOM 3930  C CA     . LYS E 3 31 ? -19.797 0.652   11.493  1.00 3.70  ? 31 LYS C CA     1  
ATOM 3931  C C      . LYS E 3 31 ? -19.410 -0.738  11.973  1.00 3.31  ? 31 LYS C C      1  
ATOM 3932  O O      . LYS E 3 31 ? -18.568 -0.887  12.855  1.00 3.59  ? 31 LYS C O      1  
ATOM 3933  C CB     . LYS E 3 31 ? -19.384 1.692   12.537  1.00 4.26  ? 31 LYS C CB     1  
ATOM 3934  C CG     . LYS E 3 31 ? -19.726 3.118   12.148  1.00 4.94  ? 31 LYS C CG     1  
ATOM 3935  C CD     . LYS E 3 31 ? -19.267 4.112   13.202  1.00 5.14  ? 31 LYS C CD     1  
ATOM 3936  C CE     . LYS E 3 31 ? -20.015 3.934   14.513  1.00 4.81  ? 31 LYS C CE     1  
ATOM 3937  N NZ     . LYS E 3 31 ? -19.643 4.972   15.511  1.00 4.79  ? 31 LYS C NZ     1  
ATOM 3938  H H      . LYS E 3 31 ? -21.838 0.808   12.012  1.00 3.82  ? 31 LYS C H      1  
ATOM 3939  H HA     . LYS E 3 31 ? -19.287 0.857   10.565  1.00 3.71  ? 31 LYS C HA     1  
ATOM 3940  H HB2    . LYS E 3 31 ? -19.882 1.467   13.467  1.00 4.26  ? 31 LYS C HB2    1  
ATOM 3941  H HB3    . LYS E 3 31 ? -18.317 1.629   12.687  1.00 4.42  ? 31 LYS C HB3    1  
ATOM 3942  H HG2    . LYS E 3 31 ? -19.239 3.349   11.214  1.00 5.05  ? 31 LYS C HG2    1  
ATOM 3943  H HG3    . LYS E 3 31 ? -20.798 3.200   12.026  1.00 5.51  ? 31 LYS C HG3    1  
ATOM 3944  H HD2    . LYS E 3 31 ? -18.213 3.969   13.382  1.00 5.64  ? 31 LYS C HD2    1  
ATOM 3945  H HD3    . LYS E 3 31 ? -19.437 5.112   12.835  1.00 5.40  ? 31 LYS C HD3    1  
ATOM 3946  H HE2    . LYS E 3 31 ? -21.076 3.996   14.320  1.00 5.04  ? 31 LYS C HE2    1  
ATOM 3947  H HE3    . LYS E 3 31 ? -19.782 2.960   14.915  1.00 4.79  ? 31 LYS C HE3    1  
ATOM 3948  H HZ1    . LYS E 3 31 ? -20.071 4.755   16.434  1.00 4.98  ? 31 LYS C HZ1    1  
ATOM 3949  H HZ2    . LYS E 3 31 ? -19.978 5.906   15.201  1.00 4.75  ? 31 LYS C HZ2    1  
ATOM 3950  H HZ3    . LYS E 3 31 ? -18.610 5.010   15.623  1.00 5.03  ? 31 LYS C HZ3    1  
ATOM 3951  N N      . ASP E 3 32 ? -20.033 -1.753  11.391  1.00 2.82  ? 32 ASP C N      1  
ATOM 3952  C CA     . ASP E 3 32 ? -19.753 -3.136  11.763  1.00 2.51  ? 32 ASP C CA     1  
ATOM 3953  C C      . ASP E 3 32 ? -18.450 -3.613  11.129  1.00 2.36  ? 32 ASP C C      1  
ATOM 3954  O O      . ASP E 3 32 ? -17.623 -2.807  10.704  1.00 2.39  ? 32 ASP C O      1  
ATOM 3955  C CB     . ASP E 3 32 ? -20.903 -4.049  11.330  1.00 2.40  ? 32 ASP C CB     1  
ATOM 3956  C CG     . ASP E 3 32 ? -21.184 -5.146  12.338  1.00 2.44  ? 32 ASP C CG     1  
ATOM 3957  O OD1    . ASP E 3 32 ? -20.233 -5.852  12.743  1.00 2.57  ? 32 ASP C OD1    1  
ATOM 3958  O OD2    . ASP E 3 32 ? -22.360 -5.307  12.728  1.00 2.74  ? 32 ASP C OD2    1  
ATOM 3959  H H      . ASP E 3 32 ? -20.693 -1.570  10.690  1.00 2.80  ? 32 ASP C H      1  
ATOM 3960  H HA     . ASP E 3 32 ? -19.656 -3.178  12.837  1.00 2.62  ? 32 ASP C HA     1  
ATOM 3961  H HB2    . ASP E 3 32 ? -21.798 -3.456  11.212  1.00 2.66  ? 32 ASP C HB2    1  
ATOM 3962  H HB3    . ASP E 3 32 ? -20.653 -4.508  10.385  1.00 2.47  ? 32 ASP C HB3    1  
ATOM 3963  N N      . ALA E 3 33 ? -18.272 -4.923  11.069  1.00 2.26  ? 33 ALA C N      1  
ATOM 3964  C CA     . ALA E 3 33 ? -17.079 -5.504  10.484  1.00 2.13  ? 33 ALA C CA     1  
ATOM 3965  C C      . ALA E 3 33 ? -17.441 -6.624  9.516   1.00 2.00  ? 33 ALA C C      1  
ATOM 3966  O O      . ALA E 3 33 ? -18.291 -7.462  9.813   1.00 1.97  ? 33 ALA C O      1  
ATOM 3967  C CB     . ALA E 3 33 ? -16.151 -6.018  11.575  1.00 2.13  ? 33 ALA C CB     1  
ATOM 3968  H H      . ALA E 3 33 ? -18.968 -5.521  11.434  1.00 2.32  ? 33 ALA C H      1  
ATOM 3969  H HA     . ALA E 3 33 ? -16.562 -4.725  9.941   1.00 2.17  ? 33 ALA C HA     1  
ATOM 3970  H HB1    . ALA E 3 33 ? -15.143 -6.075  11.192  1.00 2.07  ? 33 ALA C HB1    1  
ATOM 3971  H HB2    . ALA E 3 33 ? -16.470 -7.001  11.888  1.00 2.49  ? 33 ALA C HB2    1  
ATOM 3972  H HB3    . ALA E 3 33 ? -16.178 -5.344  12.418  1.00 2.43  ? 33 ALA C HB3    1  
ATOM 3973  N N      . LEU E 3 34 ? -16.808 -6.622  8.354   1.00 1.98  ? 34 LEU C N      1  
ATOM 3974  C CA     . LEU E 3 34 ? -17.055 -7.652  7.350   1.00 1.88  ? 34 LEU C CA     1  
ATOM 3975  C C      . LEU E 3 34 ? -15.833 -8.545  7.200   1.00 1.83  ? 34 LEU C C      1  
ATOM 3976  O O      . LEU E 3 34 ? -14.707 -8.050  7.137   1.00 1.90  ? 34 LEU C O      1  
ATOM 3977  C CB     . LEU E 3 34 ? -17.401 -7.017  6.002   1.00 1.96  ? 34 LEU C CB     1  
ATOM 3978  C CG     . LEU E 3 34 ? -18.744 -6.289  5.953   1.00 2.28  ? 34 LEU C CG     1  
ATOM 3979  C CD1    . LEU E 3 34 ? -18.832 -5.422  4.710   1.00 2.66  ? 34 LEU C CD1    1  
ATOM 3980  C CD2    . LEU E 3 34 ? -19.892 -7.285  5.982   1.00 2.54  ? 34 LEU C CD2    1  
ATOM 3981  H H      . LEU E 3 34 ? -16.161 -5.904  8.160   1.00 2.05  ? 34 LEU C H      1  
ATOM 3982  H HA     . LEU E 3 34 ? -17.889 -8.250  7.684   1.00 1.86  ? 34 LEU C HA     1  
ATOM 3983  H HB2    . LEU E 3 34 ? -16.621 -6.312  5.751   1.00 2.16  ? 34 LEU C HB2    1  
ATOM 3984  H HB3    . LEU E 3 34 ? -17.411 -7.796  5.253   1.00 1.94  ? 34 LEU C HB3    1  
ATOM 3985  H HG     . LEU E 3 34 ? -18.833 -5.647  6.817   1.00 2.55  ? 34 LEU C HG     1  
ATOM 3986  H HD11   . LEU E 3 34 ? -18.785 -6.049  3.831   1.00 2.68  ? 34 LEU C HD11   1  
ATOM 3987  H HD12   . LEU E 3 34 ? -18.010 -4.724  4.699   1.00 3.25  ? 34 LEU C HD12   1  
ATOM 3988  H HD13   . LEU E 3 34 ? -19.766 -4.880  4.717   1.00 2.94  ? 34 LEU C HD13   1  
ATOM 3989  H HD21   . LEU E 3 34 ? -19.696 -8.041  6.728   1.00 2.69  ? 34 LEU C HD21   1  
ATOM 3990  H HD22   . LEU E 3 34 ? -19.990 -7.752  5.014   1.00 2.80  ? 34 LEU C HD22   1  
ATOM 3991  H HD23   . LEU E 3 34 ? -20.808 -6.768  6.226   1.00 2.97  ? 34 LEU C HD23   1  
ATOM 3992  N N      . GLU E 3 35 ? -16.056 -9.855  7.157   1.00 1.76  ? 35 GLU C N      1  
ATOM 3993  C CA     . GLU E 3 35 ? -14.964 -10.814 7.010   1.00 1.73  ? 35 GLU C CA     1  
ATOM 3994  C C      . GLU E 3 35 ? -14.541 -10.901 5.551   1.00 1.68  ? 35 GLU C C      1  
ATOM 3995  O O      . GLU E 3 35 ? -15.238 -11.488 4.723   1.00 1.65  ? 35 GLU C O      1  
ATOM 3996  C CB     . GLU E 3 35 ? -15.375 -12.197 7.522   1.00 1.70  ? 35 GLU C CB     1  
ATOM 3997  C CG     . GLU E 3 35 ? -14.193 -13.131 7.738   1.00 1.90  ? 35 GLU C CG     1  
ATOM 3998  C CD     . GLU E 3 35 ? -14.602 -14.534 8.141   1.00 1.93  ? 35 GLU C CD     1  
ATOM 3999  O OE1    . GLU E 3 35 ? -15.488 -14.678 9.006   1.00 2.16  ? 35 GLU C OE1    1  
ATOM 4000  O OE2    . GLU E 3 35 ? -14.024 -15.503 7.604   1.00 2.25  ? 35 GLU C OE2    1  
ATOM 4001  H H      . GLU E 3 35 ? -16.980 -10.185 7.217   1.00 1.76  ? 35 GLU C H      1  
ATOM 4002  H HA     . GLU E 3 35 ? -14.127 -10.457 7.593   1.00 1.80  ? 35 GLU C HA     1  
ATOM 4003  H HB2    . GLU E 3 35 ? -15.894 -12.082 8.461   1.00 1.96  ? 35 GLU C HB2    1  
ATOM 4004  H HB3    . GLU E 3 35 ? -16.041 -12.653 6.804   1.00 2.12  ? 35 GLU C HB3    1  
ATOM 4005  H HG2    . GLU E 3 35 ? -13.628 -13.188 6.819   1.00 2.44  ? 35 GLU C HG2    1  
ATOM 4006  H HG3    . GLU E 3 35 ? -13.568 -12.718 8.515   1.00 2.26  ? 35 GLU C HG3    1  
ATOM 4007  N N      . ILE E 3 36 ? -13.398 -10.319 5.245   1.00 1.72  ? 36 ILE C N      1  
ATOM 4008  C CA     . ILE E 3 36 ? -12.887 -10.307 3.891   1.00 1.71  ? 36 ILE C CA     1  
ATOM 4009  C C      . ILE E 3 36 ? -12.040 -11.546 3.606   1.00 1.71  ? 36 ILE C C      1  
ATOM 4010  O O      . ILE E 3 36 ? -11.042 -11.799 4.292   1.00 1.73  ? 36 ILE C O      1  
ATOM 4011  C CB     . ILE E 3 36 ? -12.039 -9.043  3.637   1.00 1.79  ? 36 ILE C CB     1  
ATOM 4012  C CG1    . ILE E 3 36 ? -12.697 -7.814  4.275   1.00 2.06  ? 36 ILE C CG1    1  
ATOM 4013  C CG2    . ILE E 3 36 ? -11.853 -8.826  2.146   1.00 1.62  ? 36 ILE C CG2    1  
ATOM 4014  C CD1    . ILE E 3 36 ? -11.814 -6.582  4.279   1.00 2.24  ? 36 ILE C CD1    1  
ATOM 4015  H H      . ILE E 3 36 ? -12.873 -9.886  5.958   1.00 1.79  ? 36 ILE C H      1  
ATOM 4016  H HA     . ILE E 3 36 ? -13.730 -10.293 3.216   1.00 1.68  ? 36 ILE C HA     1  
ATOM 4017  H HB     . ILE E 3 36 ? -11.066 -9.194  4.081   1.00 2.02  ? 36 ILE C HB     1  
ATOM 4018  H HG12   . ILE E 3 36 ? -13.595 -7.574  3.728   1.00 2.08  ? 36 ILE C HG12   1  
ATOM 4019  H HG13   . ILE E 3 36 ? -12.954 -8.044  5.300   1.00 2.36  ? 36 ILE C HG13   1  
ATOM 4020  H HG21   . ILE E 3 36 ? -11.276 -7.928  1.983   1.00 1.84  ? 36 ILE C HG21   1  
ATOM 4021  H HG22   . ILE E 3 36 ? -12.818 -8.726  1.673   1.00 1.77  ? 36 ILE C HG22   1  
ATOM 4022  H HG23   . ILE E 3 36 ? -11.330 -9.671  1.724   1.00 1.79  ? 36 ILE C HG23   1  
ATOM 4023  H HD11   . ILE E 3 36 ? -11.527 -6.342  3.266   1.00 2.43  ? 36 ILE C HD11   1  
ATOM 4024  H HD12   . ILE E 3 36 ? -10.929 -6.771  4.869   1.00 2.32  ? 36 ILE C HD12   1  
ATOM 4025  H HD13   . ILE E 3 36 ? -12.358 -5.752  4.702   1.00 2.73  ? 36 ILE C HD13   1  
ATOM 4026  N N      . TYR E 3 37 ? -12.467 -12.318 2.608   1.00 1.73  ? 37 TYR C N      1  
ATOM 4027  C CA     . TYR E 3 37 ? -11.766 -13.526 2.178   1.00 1.77  ? 37 TYR C CA     1  
ATOM 4028  C C      . TYR E 3 37 ? -11.679 -13.530 0.650   1.00 1.80  ? 37 TYR C C      1  
ATOM 4029  O O      . TYR E 3 37 ? -12.555 -12.994 -0.013  1.00 1.82  ? 37 TYR C O      1  
ATOM 4030  C CB     . TYR E 3 37 ? -12.496 -14.779 2.682   1.00 1.79  ? 37 TYR C CB     1  
ATOM 4031  C CG     . TYR E 3 37 ? -11.674 -16.044 2.595   1.00 1.77  ? 37 TYR C CG     1  
ATOM 4032  C CD1    . TYR E 3 37 ? -10.507 -16.184 3.333   1.00 2.12  ? 37 TYR C CD1    1  
ATOM 4033  C CD2    . TYR E 3 37 ? -12.065 -17.097 1.781   1.00 1.70  ? 37 TYR C CD2    1  
ATOM 4034  C CE1    . TYR E 3 37 ? -9.751  -17.337 3.262   1.00 2.31  ? 37 TYR C CE1    1  
ATOM 4035  C CE2    . TYR E 3 37 ? -11.316 -18.254 1.704   1.00 1.83  ? 37 TYR C CE2    1  
ATOM 4036  C CZ     . TYR E 3 37 ? -10.159 -18.370 2.446   1.00 2.10  ? 37 TYR C CZ     1  
ATOM 4037  O OH     . TYR E 3 37 ? -9.410  -19.523 2.371   1.00 2.40  ? 37 TYR C OH     1  
ATOM 4038  H H      . TYR E 3 37 ? -13.298 -12.070 2.140   1.00 1.75  ? 37 TYR C H      1  
ATOM 4039  H HA     . TYR E 3 37 ? -10.767 -13.501 2.590   1.00 1.81  ? 37 TYR C HA     1  
ATOM 4040  H HB2    . TYR E 3 37 ? -12.768 -14.635 3.717   1.00 1.95  ? 37 TYR C HB2    1  
ATOM 4041  H HB3    . TYR E 3 37 ? -13.394 -14.925 2.098   1.00 1.83  ? 37 TYR C HB3    1  
ATOM 4042  H HD1    . TYR E 3 37 ? -10.191 -15.372 3.970   1.00 2.40  ? 37 TYR C HD1    1  
ATOM 4043  H HD2    . TYR E 3 37 ? -12.971 -17.004 1.200   1.00 1.77  ? 37 TYR C HD2    1  
ATOM 4044  H HE1    . TYR E 3 37 ? -8.847  -17.427 3.846   1.00 2.74  ? 37 TYR C HE1    1  
ATOM 4045  H HE2    . TYR E 3 37 ? -11.636 -19.062 1.065   1.00 1.93  ? 37 TYR C HE2    1  
ATOM 4046  H HH     . TYR E 3 37 ? -9.406  -19.842 1.459   1.00 2.65  ? 37 TYR C HH     1  
ATOM 4047  N N      . VAL E 3 38 ? -10.624 -14.106 0.088   1.00 1.91  ? 38 VAL C N      1  
ATOM 4048  C CA     . VAL E 3 38 ? -10.467 -14.131 -1.371  1.00 1.98  ? 38 VAL C CA     1  
ATOM 4049  C C      . VAL E 3 38 ? -10.943 -15.441 -1.990  1.00 1.96  ? 38 VAL C C      1  
ATOM 4050  O O      . VAL E 3 38 ? -11.140 -16.442 -1.298  1.00 2.00  ? 38 VAL C O      1  
ATOM 4051  C CB     . VAL E 3 38 ? -9.009  -13.885 -1.817  1.00 2.17  ? 38 VAL C CB     1  
ATOM 4052  C CG1    . VAL E 3 38 ? -8.807  -12.429 -2.202  1.00 2.55  ? 38 VAL C CG1    1  
ATOM 4053  C CG2    . VAL E 3 38 ? -8.020  -14.302 -0.735  1.00 2.22  ? 38 VAL C CG2    1  
ATOM 4054  H H      . VAL E 3 38 ? -9.935  -14.512 0.656   1.00 2.01  ? 38 VAL C H      1  
ATOM 4055  H HA     . VAL E 3 38 ? -11.072 -13.331 -1.772  1.00 2.02  ? 38 VAL C HA     1  
ATOM 4056  H HB     . VAL E 3 38 ? -8.821  -14.490 -2.695  1.00 2.26  ? 38 VAL C HB     1  
ATOM 4057  H HG11   . VAL E 3 38 ? -9.283  -12.238 -3.152  1.00 2.75  ? 38 VAL C HG11   1  
ATOM 4058  H HG12   . VAL E 3 38 ? -7.752  -12.221 -2.281  1.00 2.75  ? 38 VAL C HG12   1  
ATOM 4059  H HG13   . VAL E 3 38 ? -9.245  -11.793 -1.447  1.00 3.02  ? 38 VAL C HG13   1  
ATOM 4060  H HG21   . VAL E 3 38 ? -7.014  -14.084 -1.061  1.00 2.38  ? 38 VAL C HG21   1  
ATOM 4061  H HG22   . VAL E 3 38 ? -8.115  -15.362 -0.548  1.00 2.27  ? 38 VAL C HG22   1  
ATOM 4062  H HG23   . VAL E 3 38 ? -8.231  -13.757 0.173   1.00 2.71  ? 38 VAL C HG23   1  
ATOM 4063  N N      . ASP E 3 39 ? -11.127 -15.406 -3.306  1.00 2.00  ? 39 ASP C N      1  
ATOM 4064  C CA     . ASP E 3 39 ? -11.564 -16.563 -4.078  1.00 2.06  ? 39 ASP C CA     1  
ATOM 4065  C C      . ASP E 3 39 ? -10.982 -16.486 -5.486  1.00 2.17  ? 39 ASP C C      1  
ATOM 4066  O O      . ASP E 3 39 ? -11.621 -15.956 -6.402  1.00 2.20  ? 39 ASP C O      1  
ATOM 4067  C CB     . ASP E 3 39 ? -13.091 -16.621 -4.141  1.00 2.10  ? 39 ASP C CB     1  
ATOM 4068  C CG     . ASP E 3 39 ? -13.594 -17.951 -4.659  1.00 2.21  ? 39 ASP C CG     1  
ATOM 4069  O OD1    . ASP E 3 39 ? -13.118 -18.998 -4.172  1.00 2.29  ? 39 ASP C OD1    1  
ATOM 4070  O OD2    . ASP E 3 39 ? -14.477 -17.958 -5.543  1.00 2.29  ? 39 ASP C OD2    1  
ATOM 4071  H H      . ASP E 3 39 ? -10.972 -14.558 -3.781  1.00 2.05  ? 39 ASP C H      1  
ATOM 4072  H HA     . ASP E 3 39 ? -11.193 -17.453 -3.592  1.00 2.09  ? 39 ASP C HA     1  
ATOM 4073  H HB2    . ASP E 3 39 ? -13.493 -16.466 -3.150  1.00 2.09  ? 39 ASP C HB2    1  
ATOM 4074  H HB3    . ASP E 3 39 ? -13.449 -15.841 -4.795  1.00 2.14  ? 39 ASP C HB3    1  
ATOM 4075  N N      . ASP E 3 40 ? -9.752  -16.992 -5.632  1.00 2.29  ? 40 ASP C N      1  
ATOM 4076  C CA     . ASP E 3 40 ? -9.019  -16.983 -6.908  1.00 2.45  ? 40 ASP C CA     1  
ATOM 4077  C C      . ASP E 3 40 ? -8.611  -15.557 -7.274  1.00 2.44  ? 40 ASP C C      1  
ATOM 4078  O O      . ASP E 3 40 ? -7.451  -15.170 -7.120  1.00 2.60  ? 40 ASP C O      1  
ATOM 4079  C CB     . ASP E 3 40 ? -9.839  -17.617 -8.042  1.00 2.56  ? 40 ASP C CB     1  
ATOM 4080  C CG     . ASP E 3 40 ? -9.103  -17.600 -9.370  1.00 2.79  ? 40 ASP C CG     1  
ATOM 4081  O OD1    . ASP E 3 40 ? -7.986  -18.157 -9.447  1.00 3.00  ? 40 ASP C OD1    1  
ATOM 4082  O OD2    . ASP E 3 40 ? -9.637  -17.031 -10.345 1.00 2.98  ? 40 ASP C OD2    1  
ATOM 4083  H H      . ASP E 3 40 ? -9.315  -17.389 -4.846  1.00 2.30  ? 40 ASP C H      1  
ATOM 4084  H HA     . ASP E 3 40 ? -8.120  -17.563 -6.763  1.00 2.59  ? 40 ASP C HA     1  
ATOM 4085  H HB2    . ASP E 3 40 ? -10.060 -18.642 -7.788  1.00 2.77  ? 40 ASP C HB2    1  
ATOM 4086  H HB3    . ASP E 3 40 ? -10.765 -17.072 -8.157  1.00 2.52  ? 40 ASP C HB3    1  
ATOM 4087  N N      . GLU E 3 41 ? -9.569  -14.787 -7.765  1.00 2.35  ? 41 GLU C N      1  
ATOM 4088  C CA     . GLU E 3 41 ? -9.338  -13.393 -8.118  1.00 2.40  ? 41 GLU C CA     1  
ATOM 4089  C C      . GLU E 3 41 ? -10.541 -12.562 -7.696  1.00 2.30  ? 41 GLU C C      1  
ATOM 4090  O O      . GLU E 3 41 ? -10.617 -11.361 -7.956  1.00 2.42  ? 41 GLU C O      1  
ATOM 4091  C CB     . GLU E 3 41 ? -9.070  -13.234 -9.616  1.00 2.58  ? 41 GLU C CB     1  
ATOM 4092  C CG     . GLU E 3 41 ? -10.215 -13.681 -10.508 1.00 2.76  ? 41 GLU C CG     1  
ATOM 4093  C CD     . GLU E 3 41 ? -10.023 -13.257 -11.948 1.00 2.87  ? 41 GLU C CD     1  
ATOM 4094  O OE1    . GLU E 3 41 ? -8.888  -13.364 -12.460 1.00 3.12  ? 41 GLU C OE1    1  
ATOM 4095  O OE2    . GLU E 3 41 ? -11.002 -12.807 -12.576 1.00 3.14  ? 41 GLU C OE2    1  
ATOM 4096  H H      . GLU E 3 41 ? -10.462 -15.173 -7.900  1.00 2.32  ? 41 GLU C H      1  
ATOM 4097  H HA     . GLU E 3 41 ? -8.473  -13.053 -7.567  1.00 2.46  ? 41 GLU C HA     1  
ATOM 4098  H HB2    . GLU E 3 41 ? -8.869  -12.193 -9.823  1.00 2.79  ? 41 GLU C HB2    1  
ATOM 4099  H HB3    . GLU E 3 41 ? -8.196  -13.815 -9.873  1.00 2.77  ? 41 GLU C HB3    1  
ATOM 4100  H HG2    . GLU E 3 41 ? -10.280 -14.758 -10.472 1.00 3.03  ? 41 GLU C HG2    1  
ATOM 4101  H HG3    . GLU E 3 41 ? -11.135 -13.252 -10.139 1.00 3.11  ? 41 GLU C HG3    1  
ATOM 4102  N N      . LYS E 3 42 ? -11.483 -13.232 -7.043  1.00 2.21  ? 42 LYS C N      1  
ATOM 4103  C CA     . LYS E 3 42 ? -12.693 -12.599 -6.549  1.00 2.18  ? 42 LYS C CA     1  
ATOM 4104  C C      . LYS E 3 42 ? -12.607 -12.478 -5.037  1.00 2.07  ? 42 LYS C C      1  
ATOM 4105  O O      . LYS E 3 42 ? -11.634 -12.929 -4.431  1.00 2.13  ? 42 LYS C O      1  
ATOM 4106  C CB     . LYS E 3 42 ? -13.924 -13.421 -6.934  1.00 2.23  ? 42 LYS C CB     1  
ATOM 4107  C CG     . LYS E 3 42 ? -14.019 -13.728 -8.420  1.00 2.57  ? 42 LYS C CG     1  
ATOM 4108  C CD     . LYS E 3 42 ? -15.094 -14.765 -8.710  1.00 2.83  ? 42 LYS C CD     1  
ATOM 4109  C CE     . LYS E 3 42 ? -14.715 -16.136 -8.169  1.00 2.80  ? 42 LYS C CE     1  
ATOM 4110  N NZ     . LYS E 3 42 ? -15.744 -17.161 -8.490  1.00 2.96  ? 42 LYS C NZ     1  
ATOM 4111  H H      . LYS E 3 42 ? -11.349 -14.187 -6.870  1.00 2.25  ? 42 LYS C H      1  
ATOM 4112  H HA     . LYS E 3 42 ? -12.765 -11.613 -6.983  1.00 2.28  ? 42 LYS C HA     1  
ATOM 4113  H HB2    . LYS E 3 42 ? -13.899 -14.356 -6.398  1.00 2.16  ? 42 LYS C HB2    1  
ATOM 4114  H HB3    . LYS E 3 42 ? -14.812 -12.877 -6.645  1.00 2.57  ? 42 LYS C HB3    1  
ATOM 4115  H HG2    . LYS E 3 42 ? -14.259 -12.819 -8.950  1.00 2.89  ? 42 LYS C HG2    1  
ATOM 4116  H HG3    . LYS E 3 42 ? -13.066 -14.104 -8.761  1.00 2.87  ? 42 LYS C HG3    1  
ATOM 4117  H HD2    . LYS E 3 42 ? -16.018 -14.452 -8.247  1.00 3.24  ? 42 LYS C HD2    1  
ATOM 4118  H HD3    . LYS E 3 42 ? -15.232 -14.836 -9.778  1.00 3.05  ? 42 LYS C HD3    1  
ATOM 4119  H HE2    . LYS E 3 42 ? -13.773 -16.436 -8.606  1.00 2.94  ? 42 LYS C HE2    1  
ATOM 4120  H HE3    . LYS E 3 42 ? -14.608 -16.070 -7.097  1.00 3.01  ? 42 LYS C HE3    1  
ATOM 4121  H HZ1    . LYS E 3 42 ? -16.661 -16.885 -8.086  1.00 3.32  ? 42 LYS C HZ1    1  
ATOM 4122  H HZ2    . LYS E 3 42 ? -15.470 -18.082 -8.094  1.00 3.03  ? 42 LYS C HZ2    1  
ATOM 4123  H HZ3    . LYS E 3 42 ? -15.848 -17.256 -9.522  1.00 3.22  ? 42 LYS C HZ3    1  
ATOM 4124  N N      . ILE E 3 43 ? -13.614 -11.880 -4.428  1.00 1.95  ? 43 ILE C N      1  
ATOM 4125  C CA     . ILE E 3 43 ? -13.623 -11.705 -2.988  1.00 1.89  ? 43 ILE C CA     1  
ATOM 4126  C C      . ILE E 3 43 ? -14.950 -12.141 -2.376  1.00 1.84  ? 43 ILE C C      1  
ATOM 4127  O O      . ILE E 3 43 ? -16.020 -11.866 -2.916  1.00 1.87  ? 43 ILE C O      1  
ATOM 4128  C CB     . ILE E 3 43 ? -13.361 -10.226 -2.606  1.00 1.94  ? 43 ILE C CB     1  
ATOM 4129  C CG1    . ILE E 3 43 ? -12.170 -9.663  -3.386  1.00 1.99  ? 43 ILE C CG1    1  
ATOM 4130  C CG2    . ILE E 3 43 ? -13.115 -10.098 -1.110  1.00 1.94  ? 43 ILE C CG2    1  
ATOM 4131  C CD1    . ILE E 3 43 ? -12.046 -8.161  -3.292  1.00 2.32  ? 43 ILE C CD1    1  
ATOM 4132  H H      . ILE E 3 43 ? -14.367 -11.533 -4.960  1.00 1.94  ? 43 ILE C H      1  
ATOM 4133  H HA     . ILE E 3 43 ? -12.830 -12.308 -2.572  1.00 1.88  ? 43 ILE C HA     1  
ATOM 4134  H HB     . ILE E 3 43 ? -14.242 -9.653  -2.849  1.00 1.96  ? 43 ILE C HB     1  
ATOM 4135  H HG12   . ILE E 3 43 ? -11.259 -10.095 -3.000  1.00 2.14  ? 43 ILE C HG12   1  
ATOM 4136  H HG13   . ILE E 3 43 ? -12.274 -9.924  -4.428  1.00 2.02  ? 43 ILE C HG13   1  
ATOM 4137  H HG21   . ILE E 3 43 ? -12.956 -9.060  -0.858  1.00 2.35  ? 43 ILE C HG21   1  
ATOM 4138  H HG22   . ILE E 3 43 ? -12.241 -10.672 -0.840  1.00 1.98  ? 43 ILE C HG22   1  
ATOM 4139  H HG23   . ILE E 3 43 ? -13.974 -10.472 -0.570  1.00 2.17  ? 43 ILE C HG23   1  
ATOM 4140  H HD11   . ILE E 3 43 ? -12.036 -7.866  -2.253  1.00 2.88  ? 43 ILE C HD11   1  
ATOM 4141  H HD12   . ILE E 3 43 ? -12.884 -7.699  -3.791  1.00 2.33  ? 43 ILE C HD12   1  
ATOM 4142  H HD13   . ILE E 3 43 ? -11.126 -7.847  -3.764  1.00 2.70  ? 43 ILE C HD13   1  
ATOM 4143  N N      . ILE E 3 44 ? -14.859 -12.828 -1.252  1.00 1.79  ? 44 ILE C N      1  
ATOM 4144  C CA     . ILE E 3 44 ? -16.023 -13.289 -0.522  1.00 1.77  ? 44 ILE C CA     1  
ATOM 4145  C C      . ILE E 3 44 ? -16.056 -12.597 0.836   1.00 1.75  ? 44 ILE C C      1  
ATOM 4146  O O      . ILE E 3 44 ? -15.198 -12.843 1.688   1.00 1.74  ? 44 ILE C O      1  
ATOM 4147  C CB     . ILE E 3 44 ? -16.003 -14.822 -0.324  1.00 1.77  ? 44 ILE C CB     1  
ATOM 4148  C CG1    . ILE E 3 44 ? -15.956 -15.538 -1.677  1.00 1.99  ? 44 ILE C CG1    1  
ATOM 4149  C CG2    . ILE E 3 44 ? -17.216 -15.275 0.479   1.00 2.10  ? 44 ILE C CG2    1  
ATOM 4150  C CD1    . ILE E 3 44 ? -15.722 -17.028 -1.563  1.00 2.27  ? 44 ILE C CD1    1  
ATOM 4151  H H      . ILE E 3 44 ? -13.966 -13.029 -0.890  1.00 1.79  ? 44 ILE C H      1  
ATOM 4152  H HA     . ILE E 3 44 ? -16.907 -13.019 -1.083  1.00 1.80  ? 44 ILE C HA     1  
ATOM 4153  H HB     . ILE E 3 44 ? -15.117 -15.076 0.238   1.00 1.73  ? 44 ILE C HB     1  
ATOM 4154  H HG12   . ILE E 3 44 ? -16.895 -15.387 -2.191  1.00 2.27  ? 44 ILE C HG12   1  
ATOM 4155  H HG13   . ILE E 3 44 ? -15.156 -15.120 -2.270  1.00 2.25  ? 44 ILE C HG13   1  
ATOM 4156  H HG21   . ILE E 3 44 ? -18.114 -14.894 0.017   1.00 2.34  ? 44 ILE C HG21   1  
ATOM 4157  H HG22   . ILE E 3 44 ? -17.141 -14.896 1.488   1.00 2.47  ? 44 ILE C HG22   1  
ATOM 4158  H HG23   . ILE E 3 44 ? -17.251 -16.354 0.500   1.00 2.50  ? 44 ILE C HG23   1  
ATOM 4159  H HD11   . ILE E 3 44 ? -14.820 -17.206 -0.999  1.00 2.58  ? 44 ILE C HD11   1  
ATOM 4160  H HD12   . ILE E 3 44 ? -15.618 -17.453 -2.550  1.00 2.55  ? 44 ILE C HD12   1  
ATOM 4161  H HD13   . ILE E 3 44 ? -16.560 -17.487 -1.058  1.00 2.59  ? 44 ILE C HD13   1  
ATOM 4162  N N      . LEU E 3 45 ? -17.016 -11.708 1.025   1.00 1.78  ? 45 LEU C N      1  
ATOM 4163  C CA     . LEU E 3 45 ? -17.136 -10.983 2.278   1.00 1.78  ? 45 LEU C CA     1  
ATOM 4164  C C      . LEU E 3 45 ? -18.272 -11.551 3.112   1.00 1.78  ? 45 LEU C C      1  
ATOM 4165  O O      . LEU E 3 45 ? -19.433 -11.535 2.699   1.00 1.88  ? 45 LEU C O      1  
ATOM 4166  C CB     . LEU E 3 45 ? -17.351 -9.485  2.031   1.00 1.85  ? 45 LEU C CB     1  
ATOM 4167  C CG     . LEU E 3 45 ? -16.209 -8.776  1.297   1.00 2.24  ? 45 LEU C CG     1  
ATOM 4168  C CD1    . LEU E 3 45 ? -16.483 -8.717  -0.199  1.00 2.43  ? 45 LEU C CD1    1  
ATOM 4169  C CD2    . LEU E 3 45 ? -16.000 -7.377  1.861   1.00 2.44  ? 45 LEU C CD2    1  
ATOM 4170  H H      . LEU E 3 45 ? -17.671 -11.544 0.306   1.00 1.81  ? 45 LEU C H      1  
ATOM 4171  H HA     . LEU E 3 45 ? -16.212 -11.117 2.821   1.00 1.76  ? 45 LEU C HA     1  
ATOM 4172  H HB2    . LEU E 3 45 ? -18.251 -9.362  1.452   1.00 1.73  ? 45 LEU C HB2    1  
ATOM 4173  H HB3    . LEU E 3 45 ? -17.488 -9.001  2.987   1.00 2.00  ? 45 LEU C HB3    1  
ATOM 4174  H HG     . LEU E 3 45 ? -15.298 -9.336  1.443   1.00 2.88  ? 45 LEU C HG     1  
ATOM 4175  H HD11   . LEU E 3 45 ? -15.648 -8.250  -0.698  1.00 2.81  ? 45 LEU C HD11   1  
ATOM 4176  H HD12   . LEU E 3 45 ? -17.378 -8.142  -0.380  1.00 2.52  ? 45 LEU C HD12   1  
ATOM 4177  H HD13   . LEU E 3 45 ? -16.616 -9.719  -0.580  1.00 2.87  ? 45 LEU C HD13   1  
ATOM 4178  H HD21   . LEU E 3 45 ? -15.870 -7.437  2.931   1.00 2.92  ? 45 LEU C HD21   1  
ATOM 4179  H HD22   . LEU E 3 45 ? -16.860 -6.764  1.634   1.00 2.57  ? 45 LEU C HD22   1  
ATOM 4180  H HD23   . LEU E 3 45 ? -15.118 -6.939  1.415   1.00 2.77  ? 45 LEU C HD23   1  
ATOM 4181  N N      . LYS E 3 46 ? -17.924 -12.067 4.277   1.00 1.74  ? 46 LYS C N      1  
ATOM 4182  C CA     . LYS E 3 46 ? -18.902 -12.651 5.180   1.00 1.77  ? 46 LYS C CA     1  
ATOM 4183  C C      . LYS E 3 46 ? -19.274 -11.644 6.266   1.00 1.78  ? 46 LYS C C      1  
ATOM 4184  O O      . LYS E 3 46 ? -18.806 -10.502 6.248   1.00 1.86  ? 46 LYS C O      1  
ATOM 4185  C CB     . LYS E 3 46 ? -18.351 -13.931 5.812   1.00 1.76  ? 46 LYS C CB     1  
ATOM 4186  C CG     . LYS E 3 46 ? -17.420 -14.722 4.903   1.00 1.86  ? 46 LYS C CG     1  
ATOM 4187  C CD     . LYS E 3 46 ? -16.828 -15.913 5.634   1.00 1.92  ? 46 LYS C CD     1  
ATOM 4188  C CE     . LYS E 3 46 ? -15.656 -16.521 4.881   1.00 2.45  ? 46 LYS C CE     1  
ATOM 4189  N NZ     . LYS E 3 46 ? -14.789 -17.324 5.783   1.00 3.02  ? 46 LYS C NZ     1  
ATOM 4190  H H      . LYS E 3 46 ? -16.976 -12.043 4.547   1.00 1.75  ? 46 LYS C H      1  
ATOM 4191  H HA     . LYS E 3 46 ? -19.784 -12.889 4.607   1.00 1.89  ? 46 LYS C HA     1  
ATOM 4192  H HB2    . LYS E 3 46 ? -17.808 -13.671 6.708   1.00 1.89  ? 46 LYS C HB2    1  
ATOM 4193  H HB3    . LYS E 3 46 ? -19.181 -14.568 6.080   1.00 2.17  ? 46 LYS C HB3    1  
ATOM 4194  H HG2    . LYS E 3 46 ? -17.976 -15.075 4.047   1.00 2.40  ? 46 LYS C HG2    1  
ATOM 4195  H HG3    . LYS E 3 46 ? -16.617 -14.078 4.573   1.00 2.13  ? 46 LYS C HG3    1  
ATOM 4196  H HD2    . LYS E 3 46 ? -16.485 -15.590 6.606   1.00 2.39  ? 46 LYS C HD2    1  
ATOM 4197  H HD3    . LYS E 3 46 ? -17.595 -16.664 5.753   1.00 1.86  ? 46 LYS C HD3    1  
ATOM 4198  H HE2    . LYS E 3 46 ? -16.036 -17.161 4.097   1.00 2.74  ? 46 LYS C HE2    1  
ATOM 4199  H HE3    . LYS E 3 46 ? -15.070 -15.725 4.445   1.00 2.69  ? 46 LYS C HE3    1  
ATOM 4200  H HZ1    . LYS E 3 46 ? -14.006 -17.752 5.248   1.00 3.24  ? 46 LYS C HZ1    1  
ATOM 4201  H HZ2    . LYS E 3 46 ? -15.342 -18.080 6.232   1.00 3.51  ? 46 LYS C HZ2    1  
ATOM 4202  H HZ3    . LYS E 3 46 ? -14.389 -16.711 6.533   1.00 3.25  ? 46 LYS C HZ3    1  
ATOM 4203  N N      . LYS E 3 47 ? -20.100 -12.071 7.214   1.00 1.78  ? 47 LYS C N      1  
ATOM 4204  C CA     . LYS E 3 47 ? -20.538 -11.199 8.299   1.00 1.85  ? 47 LYS C CA     1  
ATOM 4205  C C      . LYS E 3 47 ? -19.434 -11.022 9.342   1.00 1.93  ? 47 LYS C C      1  
ATOM 4206  O O      . LYS E 3 47 ? -18.312 -11.502 9.163   1.00 2.19  ? 47 LYS C O      1  
ATOM 4207  C CB     . LYS E 3 47 ? -21.791 -11.769 8.968   1.00 1.93  ? 47 LYS C CB     1  
ATOM 4208  C CG     . LYS E 3 47 ? -22.933 -12.042 8.000   1.00 2.08  ? 47 LYS C CG     1  
ATOM 4209  C CD     . LYS E 3 47 ? -24.076 -12.776 8.685   1.00 2.26  ? 47 LYS C CD     1  
ATOM 4210  C CE     . LYS E 3 47 ? -24.906 -13.577 7.694   1.00 2.71  ? 47 LYS C CE     1  
ATOM 4211  N NZ     . LYS E 3 47 ? -25.948 -14.398 8.371   1.00 2.96  ? 47 LYS C NZ     1  
ATOM 4212  H H      . LYS E 3 47 ? -20.417 -13.000 7.191   1.00 1.78  ? 47 LYS C H      1  
ATOM 4213  H HA     . LYS E 3 47 ? -20.775 -10.235 7.874   1.00 1.92  ? 47 LYS C HA     1  
ATOM 4214  H HB2    . LYS E 3 47 ? -21.531 -12.695 9.458   1.00 2.33  ? 47 LYS C HB2    1  
ATOM 4215  H HB3    . LYS E 3 47 ? -22.137 -11.065 9.712   1.00 2.09  ? 47 LYS C HB3    1  
ATOM 4216  H HG2    . LYS E 3 47 ? -23.301 -11.101 7.616   1.00 2.22  ? 47 LYS C HG2    1  
ATOM 4217  H HG3    . LYS E 3 47 ? -22.564 -12.646 7.184   1.00 2.63  ? 47 LYS C HG3    1  
ATOM 4218  H HD2    . LYS E 3 47 ? -23.666 -13.449 9.420   1.00 2.53  ? 47 LYS C HD2    1  
ATOM 4219  H HD3    . LYS E 3 47 ? -24.711 -12.053 9.172   1.00 2.36  ? 47 LYS C HD3    1  
ATOM 4220  H HE2    . LYS E 3 47 ? -25.390 -12.894 7.012   1.00 2.83  ? 47 LYS C HE2    1  
ATOM 4221  H HE3    . LYS E 3 47 ? -24.249 -14.230 7.141   1.00 3.18  ? 47 LYS C HE3    1  
ATOM 4222  H HZ1    . LYS E 3 47 ? -25.511 -15.033 9.071   1.00 2.96  ? 47 LYS C HZ1    1  
ATOM 4223  H HZ2    . LYS E 3 47 ? -26.464 -14.979 7.672   1.00 3.20  ? 47 LYS C HZ2    1  
ATOM 4224  H HZ3    . LYS E 3 47 ? -26.631 -13.783 8.860   1.00 3.37  ? 47 LYS C HZ3    1  
ATOM 4225  N N      . TYR E 3 48 ? -19.772 -10.342 10.431  1.00 2.23  ? 48 TYR C N      1  
ATOM 4226  C CA     . TYR E 3 48 ? -18.830 -10.086 11.519  1.00 2.39  ? 48 TYR C CA     1  
ATOM 4227  C C      . TYR E 3 48 ? -18.316 -11.385 12.134  1.00 2.15  ? 48 TYR C C      1  
ATOM 4228  O O      . TYR E 3 48 ? -19.045 -12.378 12.230  1.00 2.21  ? 48 TYR C O      1  
ATOM 4229  C CB     . TYR E 3 48 ? -19.480 -9.213  12.600  1.00 3.00  ? 48 TYR C CB     1  
ATOM 4230  C CG     . TYR E 3 48 ? -20.886 -9.631  12.975  1.00 3.03  ? 48 TYR C CG     1  
ATOM 4231  C CD1    . TYR E 3 48 ? -21.109 -10.602 13.943  1.00 3.08  ? 48 TYR C CD1    1  
ATOM 4232  C CD2    . TYR E 3 48 ? -21.989 -9.051  12.363  1.00 3.24  ? 48 TYR C CD2    1  
ATOM 4233  C CE1    . TYR E 3 48 ? -22.391 -10.984 14.288  1.00 3.45  ? 48 TYR C CE1    1  
ATOM 4234  C CE2    . TYR E 3 48 ? -23.274 -9.427  12.703  1.00 3.54  ? 48 TYR C CE2    1  
ATOM 4235  C CZ     . TYR E 3 48 ? -23.469 -10.395 13.664  1.00 3.69  ? 48 TYR C CZ     1  
ATOM 4236  O OH     . TYR E 3 48 ? -24.747 -10.774 14.005  1.00 4.20  ? 48 TYR C OH     1  
ATOM 4237  H H      . TYR E 3 48 ? -20.683 -9.995  10.506  1.00 2.60  ? 48 TYR C H      1  
ATOM 4238  H HA     . TYR E 3 48 ? -17.989 -9.551  11.101  1.00 2.57  ? 48 TYR C HA     1  
ATOM 4239  H HB2    . TYR E 3 48 ? -18.877 -9.259  13.493  1.00 3.37  ? 48 TYR C HB2    1  
ATOM 4240  H HB3    . TYR E 3 48 ? -19.518 -8.191  12.251  1.00 3.36  ? 48 TYR C HB3    1  
ATOM 4241  H HD1    . TYR E 3 48 ? -20.262 -11.062 14.430  1.00 2.97  ? 48 TYR C HD1    1  
ATOM 4242  H HD2    . TYR E 3 48 ? -21.833 -8.294  11.608  1.00 3.31  ? 48 TYR C HD2    1  
ATOM 4243  H HE1    . TYR E 3 48 ? -22.544 -11.743 15.042  1.00 3.66  ? 48 TYR C HE1    1  
ATOM 4244  H HE2    . TYR E 3 48 ? -24.118 -8.965  12.216  1.00 3.76  ? 48 TYR C HE2    1  
ATOM 4245  H HH     . TYR E 3 48 ? -25.191 -11.137 13.227  1.00 4.26  ? 48 TYR C HH     1  
ATOM 4246  N N      . LYS E 3 49 ? -17.054 -11.362 12.544  1.00 2.22  ? 49 LYS C N      1  
ATOM 4247  C CA     . LYS E 3 49 ? -16.402 -12.514 13.147  1.00 2.29  ? 49 LYS C CA     1  
ATOM 4248  C C      . LYS E 3 49 ? -15.183 -12.055 13.938  1.00 2.48  ? 49 LYS C C      1  
ATOM 4249  O O      . LYS E 3 49 ? -14.502 -11.114 13.531  1.00 2.62  ? 49 LYS C O      1  
ATOM 4250  C CB     . LYS E 3 49 ? -15.973 -13.506 12.059  1.00 2.60  ? 49 LYS C CB     1  
ATOM 4251  C CG     . LYS E 3 49 ? -16.777 -14.797 12.047  1.00 2.71  ? 49 LYS C CG     1  
ATOM 4252  C CD     . LYS E 3 49 ? -16.003 -15.953 12.660  1.00 2.93  ? 49 LYS C CD     1  
ATOM 4253  C CE     . LYS E 3 49 ? -15.624 -16.995 11.612  1.00 3.24  ? 49 LYS C CE     1  
ATOM 4254  N NZ     . LYS E 3 49 ? -14.557 -16.515 10.696  1.00 3.12  ? 49 LYS C NZ     1  
ATOM 4255  H H      . LYS E 3 49 ? -16.542 -10.532 12.445  1.00 2.45  ? 49 LYS C H      1  
ATOM 4256  H HA     . LYS E 3 49 ? -17.103 -12.991 13.815  1.00 2.32  ? 49 LYS C HA     1  
ATOM 4257  H HB2    . LYS E 3 49 ? -16.087 -13.030 11.097  1.00 3.14  ? 49 LYS C HB2    1  
ATOM 4258  H HB3    . LYS E 3 49 ? -14.931 -13.754 12.205  1.00 2.84  ? 49 LYS C HB3    1  
ATOM 4259  H HG2    . LYS E 3 49 ? -17.685 -14.649 12.612  1.00 2.84  ? 49 LYS C HG2    1  
ATOM 4260  H HG3    . LYS E 3 49 ? -17.023 -15.044 11.026  1.00 3.22  ? 49 LYS C HG3    1  
ATOM 4261  H HD2    . LYS E 3 49 ? -15.102 -15.571 13.118  1.00 3.09  ? 49 LYS C HD2    1  
ATOM 4262  H HD3    . LYS E 3 49 ? -16.617 -16.423 13.412  1.00 3.36  ? 49 LYS C HD3    1  
ATOM 4263  H HE2    . LYS E 3 49 ? -15.275 -17.882 12.117  1.00 3.55  ? 49 LYS C HE2    1  
ATOM 4264  H HE3    . LYS E 3 49 ? -16.502 -17.238 11.030  1.00 3.71  ? 49 LYS C HE3    1  
ATOM 4265  H HZ1    . LYS E 3 49 ? -14.941 -15.802 10.032  1.00 3.41  ? 49 LYS C HZ1    1  
ATOM 4266  H HZ2    . LYS E 3 49 ? -14.173 -17.311 10.149  1.00 2.66  ? 49 LYS C HZ2    1  
ATOM 4267  H HZ3    . LYS E 3 49 ? -13.782 -16.082 11.243  1.00 3.66  ? 49 LYS C HZ3    1  
ATOM 4268  N N      . PRO E 3 50 ? -14.902 -12.683 15.089  1.00 2.65  ? 50 PRO C N      1  
ATOM 4269  C CA     . PRO E 3 50 ? -13.745 -12.327 15.914  1.00 3.00  ? 50 PRO C CA     1  
ATOM 4270  C C      . PRO E 3 50 ? -12.429 -12.823 15.309  1.00 3.20  ? 50 PRO C C      1  
ATOM 4271  O O      . PRO E 3 50 ? -11.753 -13.684 15.874  1.00 3.50  ? 50 PRO C O      1  
ATOM 4272  C CB     . PRO E 3 50 ? -14.033 -13.023 17.246  1.00 3.22  ? 50 PRO C CB     1  
ATOM 4273  C CG     . PRO E 3 50 ? -14.886 -14.189 16.889  1.00 3.12  ? 50 PRO C CG     1  
ATOM 4274  C CD     . PRO E 3 50 ? -15.703 -13.765 15.697  1.00 2.73  ? 50 PRO C CD     1  
ATOM 4275  H HA     . PRO E 3 50 ? -13.685 -11.259 16.067  1.00 3.05  ? 50 PRO C HA     1  
ATOM 4276  H HB2    . PRO E 3 50 ? -13.102 -13.336 17.699  1.00 3.45  ? 50 PRO C HB2    1  
ATOM 4277  H HB3    . PRO E 3 50 ? -14.551 -12.342 17.906  1.00 3.39  ? 50 PRO C HB3    1  
ATOM 4278  H HG2    . PRO E 3 50 ? -14.264 -15.032 16.635  1.00 3.30  ? 50 PRO C HG2    1  
ATOM 4279  H HG3    . PRO E 3 50 ? -15.534 -14.437 17.719  1.00 3.33  ? 50 PRO C HG3    1  
ATOM 4280  H HD2    . PRO E 3 50 ? -15.822 -14.588 15.008  1.00 2.73  ? 50 PRO C HD2    1  
ATOM 4281  H HD3    . PRO E 3 50 ? -16.667 -13.397 16.016  1.00 2.66  ? 50 PRO C HD3    1  
ATOM 4282  N N      . ASN E 3 51 ? -12.082 -12.289 14.147  1.00 3.15  ? 51 ASN C N      1  
ATOM 4283  C CA     . ASN E 3 51 ? -10.853 -12.661 13.463  1.00 3.43  ? 51 ASN C CA     1  
ATOM 4284  C C      . ASN E 3 51 ? -9.920  -11.464 13.379  1.00 3.57  ? 51 ASN C C      1  
ATOM 4285  O O      . ASN E 3 51 ? -10.178 -10.510 12.642  1.00 3.68  ? 51 ASN C O      1  
ATOM 4286  C CB     . ASN E 3 51 ? -11.152 -13.187 12.056  1.00 3.38  ? 51 ASN C CB     1  
ATOM 4287  C CG     . ASN E 3 51 ? -11.618 -14.633 12.058  1.00 3.44  ? 51 ASN C CG     1  
ATOM 4288  O OD1    . ASN E 3 51 ? -12.817 -14.916 12.107  1.00 3.72  ? 51 ASN C OD1    1  
ATOM 4289  N ND2    . ASN E 3 51 ? -10.671 -15.559 12.007  1.00 3.72  ? 51 ASN C ND2    1  
ATOM 4290  H H      . ASN E 3 51 ? -12.676 -11.625 13.734  1.00 3.00  ? 51 ASN C H      1  
ATOM 4291  H HA     . ASN E 3 51 ? -10.373 -13.441 14.037  1.00 3.72  ? 51 ASN C HA     1  
ATOM 4292  H HB2    . ASN E 3 51 ? -11.924 -12.581 11.609  1.00 3.67  ? 51 ASN C HB2    1  
ATOM 4293  H HB3    . ASN E 3 51 ? -10.257 -13.118 11.457  1.00 3.46  ? 51 ASN C HB3    1  
ATOM 4294  H HD21   . ASN E 3 51 ? -9.735  -15.266 11.974  1.00 3.90  ? 51 ASN C HD21   1  
ATOM 4295  H HD22   . ASN E 3 51 ? -10.944 -16.501 12.007  1.00 4.02  ? 51 ASN C HD22   1  
ATOM 4296  N N      . MET E 3 52 ? -8.849  -11.505 14.153  1.00 3.70  ? 52 MET C N      1  
ATOM 4297  C CA     . MET E 3 52 ? -7.879  -10.423 14.164  1.00 3.97  ? 52 MET C CA     1  
ATOM 4298  C C      . MET E 3 52 ? -6.545  -10.914 13.620  1.00 3.92  ? 52 MET C C      1  
ATOM 4299  O O      . MET E 3 52 ? -6.274  -12.117 13.615  1.00 4.06  ? 52 MET C O      1  
ATOM 4300  C CB     . MET E 3 52 ? -7.710  -9.873  15.586  1.00 4.32  ? 52 MET C CB     1  
ATOM 4301  C CG     . MET E 3 52 ? -7.360  -8.391  15.646  1.00 4.86  ? 52 MET C CG     1  
ATOM 4302  S SD     . MET E 3 52 ? -5.585  -8.076  15.635  1.00 5.47  ? 52 MET C SD     1  
ATOM 4303  C CE     . MET E 3 52 ? -5.120  -8.676  17.259  1.00 6.01  ? 52 MET C CE     1  
ATOM 4304  H H      . MET E 3 52 ? -8.700  -12.287 14.727  1.00 3.69  ? 52 MET C H      1  
ATOM 4305  H HA     . MET E 3 52 ? -8.251  -9.639  13.524  1.00 4.15  ? 52 MET C HA     1  
ATOM 4306  H HB2    . MET E 3 52 ? -8.633  -10.021 16.126  1.00 4.47  ? 52 MET C HB2    1  
ATOM 4307  H HB3    . MET E 3 52 ? -6.926  -10.425 16.078  1.00 4.42  ? 52 MET C HB3    1  
ATOM 4308  H HG2    . MET E 3 52 ? -7.801  -7.899  14.794  1.00 5.22  ? 52 MET C HG2    1  
ATOM 4309  H HG3    . MET E 3 52 ? -7.778  -7.977  16.551  1.00 4.97  ? 52 MET C HG3    1  
ATOM 4310  H HE1    . MET E 3 52 ? -4.063  -8.512  17.413  1.00 6.32  ? 52 MET C HE1    1  
ATOM 4311  H HE2    . MET E 3 52 ? -5.334  -9.733  17.330  1.00 6.13  ? 52 MET C HE2    1  
ATOM 4312  H HE3    . MET E 3 52 ? -5.680  -8.144  18.012  1.00 6.26  ? 52 MET C HE3    1  
ATOM 4313  N N      . THR E 3 53 ? -5.724  -9.986  13.161  1.00 4.09  ? 53 THR C N      1  
ATOM 4314  C CA     . THR E 3 53 ? -4.426  -10.312 12.609  1.00 4.24  ? 53 THR C CA     1  
ATOM 4315  C C      . THR E 3 53 ? -3.487  -10.834 13.693  1.00 3.94  ? 53 THR C C      1  
ATOM 4316  O O      . THR E 3 53 ? -3.346  -10.215 14.749  1.00 4.29  ? 53 THR C O      1  
ATOM 4317  C CB     . THR E 3 53 ? -3.812  -9.071  11.941  1.00 5.13  ? 53 THR C CB     1  
ATOM 4318  O OG1    . THR E 3 53 ? -4.587  -7.909  12.286  1.00 5.62  ? 53 THR C OG1    1  
ATOM 4319  C CG2    . THR E 3 53 ? -3.777  -9.229  10.427  1.00 5.57  ? 53 THR C CG2    1  
ATOM 4320  H H      . THR E 3 53 ? -5.990  -9.042  13.207  1.00 4.36  ? 53 THR C H      1  
ATOM 4321  H HA     . THR E 3 53 ? -4.560  -11.077 11.859  1.00 4.28  ? 53 THR C HA     1  
ATOM 4322  H HB     . THR E 3 53 ? -2.801  -8.949  12.303  1.00 5.37  ? 53 THR C HB     1  
ATOM 4323  H HG1    . THR E 3 53 ? -4.195  -7.482  13.060  1.00 5.95  ? 53 THR C HG1    1  
ATOM 4324  H HG21   . THR E 3 53 ? -4.784  -9.346  10.054  1.00 5.60  ? 53 THR C HG21   1  
ATOM 4325  H HG22   . THR E 3 53 ? -3.194  -10.102 10.167  1.00 5.71  ? 53 THR C HG22   1  
ATOM 4326  H HG23   . THR E 3 53 ? -3.328  -8.353  9.984   1.00 6.01  ? 53 THR C HG23   1  
ATOM 4327  N N      . CYS E 3 54 ? -2.866  -11.981 13.426  1.00 3.72  ? 54 CYS C N      1  
ATOM 4328  C CA     . CYS E 3 54 ? -1.938  -12.610 14.366  1.00 3.72  ? 54 CYS C CA     1  
ATOM 4329  C C      . CYS E 3 54 ? -2.670  -13.028 15.639  1.00 3.77  ? 54 CYS C C      1  
ATOM 4330  O O      . CYS E 3 54 ? -2.093  -13.046 16.729  1.00 4.12  ? 54 CYS C O      1  
ATOM 4331  C CB     . CYS E 3 54 ? -0.781  -11.660 14.707  1.00 3.72  ? 54 CYS C CB     1  
ATOM 4332  S SG     . CYS E 3 54 ? -0.174  -10.680 13.290  1.00 3.83  ? 54 CYS C SG     1  
ATOM 4333  H H      . CYS E 3 54 ? -3.044  -12.426 12.570  1.00 3.86  ? 54 CYS C H      1  
ATOM 4334  H HA     . CYS E 3 54 ? -1.538  -13.493 13.890  1.00 4.08  ? 54 CYS C HA     1  
ATOM 4335  H HB2    . CYS E 3 54 ? -1.108  -10.967 15.468  1.00 4.02  ? 54 CYS C HB2    1  
ATOM 4336  H HB3    . CYS E 3 54 ? 0.049   -12.239 15.088  1.00 3.87  ? 54 CYS C HB3    1  
ATOM 4337  N N      . GLN E 3 55 ? -3.945  -13.373 15.490  1.00 3.86  ? 55 GLN C N      1  
ATOM 4338  C CA     . GLN E 3 55 ? -4.769  -13.786 16.620  1.00 4.24  ? 55 GLN C CA     1  
ATOM 4339  C C      . GLN E 3 55 ? -5.913  -14.676 16.149  1.00 4.59  ? 55 GLN C C      1  
ATOM 4340  O O      . GLN E 3 55 ? -5.885  -15.194 15.029  1.00 4.51  ? 55 GLN C O      1  
ATOM 4341  C CB     . GLN E 3 55 ? -5.316  -12.552 17.347  1.00 4.49  ? 55 GLN C CB     1  
ATOM 4342  C CG     . GLN E 3 55 ? -6.204  -12.867 18.546  1.00 4.59  ? 55 GLN C CG     1  
ATOM 4343  C CD     . GLN E 3 55 ? -5.534  -13.785 19.549  1.00 4.82  ? 55 GLN C CD     1  
ATOM 4344  O OE1    . GLN E 3 55 ? -5.687  -15.005 19.491  1.00 4.93  ? 55 GLN C OE1    1  
ATOM 4345  N NE2    . GLN E 3 55 ? -4.784  -13.210 20.472  1.00 5.31  ? 55 GLN C NE2    1  
ATOM 4346  H H      . GLN E 3 55 ? -4.344  -13.355 14.590  1.00 3.96  ? 55 GLN C H      1  
ATOM 4347  H HA     . GLN E 3 55 ? -4.146  -14.349 17.299  1.00 4.35  ? 55 GLN C HA     1  
ATOM 4348  H HB2    . GLN E 3 55 ? -4.484  -11.959 17.695  1.00 4.55  ? 55 GLN C HB2    1  
ATOM 4349  H HB3    . GLN E 3 55 ? -5.891  -11.966 16.646  1.00 4.93  ? 55 GLN C HB3    1  
ATOM 4350  H HG2    . GLN E 3 55 ? -6.455  -11.942 19.043  1.00 4.65  ? 55 GLN C HG2    1  
ATOM 4351  H HG3    . GLN E 3 55 ? -7.110  -13.340 18.194  1.00 4.89  ? 55 GLN C HG3    1  
ATOM 4352  H HE21   . GLN E 3 55 ? -4.705  -12.230 20.462  1.00 5.48  ? 55 GLN C HE21   1  
ATOM 4353  H HE22   . GLN E 3 55 ? -4.332  -13.784 21.128  1.00 5.70  ? 55 GLN C HE22   1  
ATOM 4354  N N      . MET F 3 1  ? -5.095  -4.841  5.692   1.00 3.34  ? 1  MET D N      1  
ATOM 4355  C CA     . MET F 3 1  ? -5.925  -6.009  5.969   1.00 2.92  ? 1  MET D CA     1  
ATOM 4356  C C      . MET F 3 1  ? -6.151  -6.818  4.701   1.00 2.85  ? 1  MET D C      1  
ATOM 4357  O O      . MET F 3 1  ? -6.855  -6.381  3.789   1.00 3.13  ? 1  MET D O      1  
ATOM 4358  C CB     . MET F 3 1  ? -7.277  -5.589  6.558   1.00 3.00  ? 1  MET D CB     1  
ATOM 4359  C CG     . MET F 3 1  ? -7.170  -4.721  7.801   1.00 3.12  ? 1  MET D CG     1  
ATOM 4360  S SD     . MET F 3 1  ? -6.945  -2.974  7.404   1.00 3.32  ? 1  MET D SD     1  
ATOM 4361  C CE     . MET F 3 1  ? -6.556  -2.308  9.020   1.00 3.69  ? 1  MET D CE     1  
ATOM 4362  H H1     . MET F 3 1  ? -5.470  -3.946  5.843   1.00 3.71  ? 1  MET D H1     1  
ATOM 4363  H HA     . MET F 3 1  ? -5.404  -6.625  6.686   1.00 2.81  ? 1  MET D HA     1  
ATOM 4364  H HB2    . MET F 3 1  ? -7.824  -5.034  5.809   1.00 3.29  ? 1  MET D HB2    1  
ATOM 4365  H HB3    . MET F 3 1  ? -7.837  -6.477  6.811   1.00 2.89  ? 1  MET D HB3    1  
ATOM 4366  H HG2    . MET F 3 1  ? -8.076  -4.829  8.379   1.00 3.09  ? 1  MET D HG2    1  
ATOM 4367  H HG3    . MET F 3 1  ? -6.327  -5.055  8.388   1.00 3.31  ? 1  MET D HG3    1  
ATOM 4368  H HE1    . MET F 3 1  ? -5.890  -1.467  8.910   1.00 3.76  ? 1  MET D HE1    1  
ATOM 4369  H HE2    . MET F 3 1  ? -6.081  -3.071  9.618   1.00 3.86  ? 1  MET D HE2    1  
ATOM 4370  H HE3    . MET F 3 1  ? -7.465  -1.984  9.503   1.00 4.11  ? 1  MET D HE3    1  
ATOM 4371  N N      . LYS F 3 2  ? -5.536  -7.986  4.637   1.00 2.64  ? 2  LYS D N      1  
ATOM 4372  C CA     . LYS F 3 2  ? -5.680  -8.854  3.482   1.00 2.57  ? 2  LYS D CA     1  
ATOM 4373  C C      . LYS F 3 2  ? -6.963  -9.670  3.584   1.00 2.33  ? 2  LYS D C      1  
ATOM 4374  O O      . LYS F 3 2  ? -7.575  -9.760  4.651   1.00 2.18  ? 2  LYS D O      1  
ATOM 4375  C CB     . LYS F 3 2  ? -4.473  -9.782  3.351   1.00 2.62  ? 2  LYS D CB     1  
ATOM 4376  C CG     . LYS F 3 2  ? -3.322  -9.178  2.568   1.00 3.03  ? 2  LYS D CG     1  
ATOM 4377  C CD     . LYS F 3 2  ? -3.619  -9.162  1.079   1.00 3.33  ? 2  LYS D CD     1  
ATOM 4378  C CE     . LYS F 3 2  ? -2.438  -8.652  0.274   1.00 3.17  ? 2  LYS D CE     1  
ATOM 4379  N NZ     . LYS F 3 2  ? -2.660  -8.804  -1.189  1.00 3.57  ? 2  LYS D NZ     1  
ATOM 4380  H H      . LYS F 3 2  ? -4.974  -8.275  5.390   1.00 2.64  ? 2  LYS D H      1  
ATOM 4381  H HA     . LYS F 3 2  ? -5.739  -8.228  2.605   1.00 2.71  ? 2  LYS D HA     1  
ATOM 4382  H HB2    . LYS F 3 2  ? -4.117  -10.035 4.336   1.00 2.46  ? 2  LYS D HB2    1  
ATOM 4383  H HB3    . LYS F 3 2  ? -4.782  -10.686 2.848   1.00 2.59  ? 2  LYS D HB3    1  
ATOM 4384  H HG2    . LYS F 3 2  ? -3.159  -8.164  2.904   1.00 3.15  ? 2  LYS D HG2    1  
ATOM 4385  H HG3    . LYS F 3 2  ? -2.435  -9.766  2.743   1.00 3.04  ? 2  LYS D HG3    1  
ATOM 4386  H HD2    . LYS F 3 2  ? -3.847  -10.167 0.760   1.00 3.50  ? 2  LYS D HD2    1  
ATOM 4387  H HD3    . LYS F 3 2  ? -4.470  -8.523  0.896   1.00 3.74  ? 2  LYS D HD3    1  
ATOM 4388  H HE2    . LYS F 3 2  ? -2.290  -7.607  0.500   1.00 3.25  ? 2  LYS D HE2    1  
ATOM 4389  H HE3    . LYS F 3 2  ? -1.557  -9.210  0.556   1.00 2.98  ? 2  LYS D HE3    1  
ATOM 4390  H HZ1    . LYS F 3 2  ? -3.452  -8.209  -1.499  1.00 3.85  ? 2  LYS D HZ1    1  
ATOM 4391  H HZ2    . LYS F 3 2  ? -2.877  -9.793  -1.418  1.00 3.96  ? 2  LYS D HZ2    1  
ATOM 4392  H HZ3    . LYS F 3 2  ? -1.807  -8.523  -1.713  1.00 3.57  ? 2  LYS D HZ3    1  
ATOM 4393  N N      . SER F 3 3  ? -7.352  -10.283 2.481   1.00 2.36  ? 3  SER D N      1  
ATOM 4394  C CA     . SER F 3 3  ? -8.563  -11.082 2.437   1.00 2.17  ? 3  SER D CA     1  
ATOM 4395  C C      . SER F 3 3  ? -8.292  -12.520 2.879   1.00 2.05  ? 3  SER D C      1  
ATOM 4396  O O      . SER F 3 3  ? -8.746  -13.477 2.253   1.00 1.96  ? 3  SER D O      1  
ATOM 4397  C CB     . SER F 3 3  ? -9.133  -11.044 1.024   1.00 2.26  ? 3  SER D CB     1  
ATOM 4398  O OG     . SER F 3 3  ? -9.128  -9.718  0.524   1.00 2.64  ? 3  SER D OG     1  
ATOM 4399  H H      . SER F 3 3  ? -6.804  -10.206 1.667   1.00 2.54  ? 3  SER D H      1  
ATOM 4400  H HA     . SER F 3 3  ? -9.277  -10.639 3.113   1.00 2.09  ? 3  SER D HA     1  
ATOM 4401  H HB2    . SER F 3 3  ? -8.532  -11.665 0.377   1.00 2.20  ? 3  SER D HB2    1  
ATOM 4402  H HB3    . SER F 3 3  ? -10.148 -11.411 1.035   1.00 2.27  ? 3  SER D HB3    1  
ATOM 4403  H HG     . SER F 3 3  ? -9.021  -9.105  1.256   1.00 2.94  ? 3  SER D HG     1  
ATOM 4404  N N      . THR F 3 4  ? -7.563  -12.668 3.973   1.00 2.09  ? 4  THR D N      1  
ATOM 4405  C CA     . THR F 3 4  ? -7.240  -13.983 4.502   1.00 2.02  ? 4  THR D CA     1  
ATOM 4406  C C      . THR F 3 4  ? -8.290  -14.412 5.528   1.00 1.93  ? 4  THR D C      1  
ATOM 4407  O O      . THR F 3 4  ? -8.032  -15.249 6.393   1.00 2.03  ? 4  THR D O      1  
ATOM 4408  C CB     . THR F 3 4  ? -5.847  -13.978 5.161   1.00 2.19  ? 4  THR D CB     1  
ATOM 4409  O OG1    . THR F 3 4  ? -5.108  -12.829 4.722   1.00 2.44  ? 4  THR D OG1    1  
ATOM 4410  C CG2    . THR F 3 4  ? -5.072  -15.242 4.814   1.00 2.14  ? 4  THR D CG2    1  
ATOM 4411  H H      . THR F 3 4  ? -7.233  -11.870 4.441   1.00 2.18  ? 4  THR D H      1  
ATOM 4412  H HA     . THR F 3 4  ? -7.236  -14.686 3.681   1.00 1.97  ? 4  THR D HA     1  
ATOM 4413  H HB     . THR F 3 4  ? -5.971  -13.930 6.232   1.00 2.27  ? 4  THR D HB     1  
ATOM 4414  H HG1    . THR F 3 4  ? -5.108  -12.801 3.757   1.00 2.69  ? 4  THR D HG1    1  
ATOM 4415  H HG21   . THR F 3 4  ? -4.904  -15.279 3.748   1.00 2.26  ? 4  THR D HG21   1  
ATOM 4416  H HG22   . THR F 3 4  ? -5.639  -16.109 5.120   1.00 2.00  ? 4  THR D HG22   1  
ATOM 4417  H HG23   . THR F 3 4  ? -4.122  -15.233 5.329   1.00 2.41  ? 4  THR D HG23   1  
ATOM 4418  N N      . GLY F 3 5  ? -9.484  -13.846 5.409   1.00 1.80  ? 5  GLY D N      1  
ATOM 4419  C CA     . GLY F 3 5  ? -10.547 -14.151 6.340   1.00 1.76  ? 5  GLY D CA     1  
ATOM 4420  C C      . GLY F 3 5  ? -10.472 -13.238 7.537   1.00 1.86  ? 5  GLY D C      1  
ATOM 4421  O O      . GLY F 3 5  ? -10.611 -13.676 8.681   1.00 1.92  ? 5  GLY D O      1  
ATOM 4422  H H      . GLY F 3 5  ? -9.644  -13.208 4.679   1.00 1.77  ? 5  GLY D H      1  
ATOM 4423  H HA2    . GLY F 3 5  ? -11.500 -14.021 5.845   1.00 1.70  ? 5  GLY D HA2    1  
ATOM 4424  H HA3    . GLY F 3 5  ? -10.451 -15.174 6.668   1.00 1.76  ? 5  GLY D HA3    1  
ATOM 4425  N N      . ILE F 3 6  ? -10.253 -11.956 7.266   1.00 1.92  ? 6  ILE D N      1  
ATOM 4426  C CA     . ILE F 3 6  ? -10.120 -10.960 8.321   1.00 2.05  ? 6  ILE D CA     1  
ATOM 4427  C C      . ILE F 3 6  ? -11.230 -9.923  8.227   1.00 2.01  ? 6  ILE D C      1  
ATOM 4428  O O      . ILE F 3 6  ? -11.593 -9.484  7.136   1.00 1.92  ? 6  ILE D O      1  
ATOM 4429  C CB     . ILE F 3 6  ? -8.748  -10.252 8.249   1.00 2.19  ? 6  ILE D CB     1  
ATOM 4430  C CG1    . ILE F 3 6  ? -7.625  -11.282 8.095   1.00 2.30  ? 6  ILE D CG1    1  
ATOM 4431  C CG2    . ILE F 3 6  ? -8.518  -9.400  9.493   1.00 2.34  ? 6  ILE D CG2    1  
ATOM 4432  C CD1    . ILE F 3 6  ? -6.295  -10.673 7.718   1.00 2.45  ? 6  ILE D CD1    1  
ATOM 4433  H H      . ILE F 3 6  ? -10.205 -11.667 6.323   1.00 1.90  ? 6  ILE D H      1  
ATOM 4434  H HA     . ILE F 3 6  ? -10.193 -11.466 9.273   1.00 2.12  ? 6  ILE D HA     1  
ATOM 4435  H HB     . ILE F 3 6  ? -8.748  -9.598  7.389   1.00 2.14  ? 6  ILE D HB     1  
ATOM 4436  H HG12   . ILE F 3 6  ? -7.495  -11.804 9.032   1.00 2.35  ? 6  ILE D HG12   1  
ATOM 4437  H HG13   . ILE F 3 6  ? -7.897  -11.992 7.328   1.00 2.27  ? 6  ILE D HG13   1  
ATOM 4438  H HG21   . ILE F 3 6  ? -9.359  -8.740  9.637   1.00 2.46  ? 6  ILE D HG21   1  
ATOM 4439  H HG22   . ILE F 3 6  ? -7.618  -8.815  9.369   1.00 2.33  ? 6  ILE D HG22   1  
ATOM 4440  H HG23   . ILE F 3 6  ? -8.413  -10.042 10.355  1.00 2.53  ? 6  ILE D HG23   1  
ATOM 4441  H HD11   . ILE F 3 6  ? -5.563  -11.457 7.585   1.00 2.66  ? 6  ILE D HD11   1  
ATOM 4442  H HD12   . ILE F 3 6  ? -5.972  -10.008 8.503   1.00 2.73  ? 6  ILE D HD12   1  
ATOM 4443  H HD13   . ILE F 3 6  ? -6.401  -10.118 6.797   1.00 2.58  ? 6  ILE D HD13   1  
ATOM 4444  N N      . VAL F 3 7  ? -11.771 -9.537  9.372   1.00 2.09  ? 7  VAL D N      1  
ATOM 4445  C CA     . VAL F 3 7  ? -12.844 -8.556  9.410   1.00 2.09  ? 7  VAL D CA     1  
ATOM 4446  C C      . VAL F 3 7  ? -12.295 -7.135  9.501   1.00 2.19  ? 7  VAL D C      1  
ATOM 4447  O O      . VAL F 3 7  ? -11.211 -6.908  10.046  1.00 2.34  ? 7  VAL D O      1  
ATOM 4448  C CB     . VAL F 3 7  ? -13.808 -8.804  10.591  1.00 2.20  ? 7  VAL D CB     1  
ATOM 4449  C CG1    . VAL F 3 7  ? -14.483 -10.156 10.451  1.00 2.09  ? 7  VAL D CG1    1  
ATOM 4450  C CG2    . VAL F 3 7  ? -13.082 -8.693  11.926  1.00 2.61  ? 7  VAL D CG2    1  
ATOM 4451  H H      . VAL F 3 7  ? -11.435 -9.913  10.212  1.00 2.17  ? 7  VAL D H      1  
ATOM 4452  H HA     . VAL F 3 7  ? -13.408 -8.652  8.494   1.00 1.98  ? 7  VAL D HA     1  
ATOM 4453  H HB     . VAL F 3 7  ? -14.575 -8.046  10.563  1.00 2.29  ? 7  VAL D HB     1  
ATOM 4454  H HG11   . VAL F 3 7  ? -13.737 -10.913 10.256  1.00 2.18  ? 7  VAL D HG11   1  
ATOM 4455  H HG12   . VAL F 3 7  ? -15.186 -10.122 9.632   1.00 2.48  ? 7  VAL D HG12   1  
ATOM 4456  H HG13   . VAL F 3 7  ? -15.007 -10.395 11.365  1.00 2.15  ? 7  VAL D HG13   1  
ATOM 4457  H HG21   . VAL F 3 7  ? -13.795 -8.784  12.733  1.00 2.99  ? 7  VAL D HG21   1  
ATOM 4458  H HG22   . VAL F 3 7  ? -12.589 -7.735  11.987  1.00 2.78  ? 7  VAL D HG22   1  
ATOM 4459  H HG23   . VAL F 3 7  ? -12.346 -9.481  12.007  1.00 2.73  ? 7  VAL D HG23   1  
ATOM 4460  N N      . ARG F 3 8  ? -13.037 -6.185  8.950   1.00 2.16  ? 8  ARG D N      1  
ATOM 4461  C CA     . ARG F 3 8  ? -12.638 -4.788  8.984   1.00 2.29  ? 8  ARG D CA     1  
ATOM 4462  C C      . ARG F 3 8  ? -13.861 -3.896  9.150   1.00 2.31  ? 8  ARG D C      1  
ATOM 4463  O O      . ARG F 3 8  ? -14.963 -4.264  8.734   1.00 2.19  ? 8  ARG D O      1  
ATOM 4464  C CB     . ARG F 3 8  ? -11.884 -4.400  7.711   1.00 2.29  ? 8  ARG D CB     1  
ATOM 4465  C CG     . ARG F 3 8  ? -10.864 -3.294  7.941   1.00 2.48  ? 8  ARG D CG     1  
ATOM 4466  C CD     . ARG F 3 8  ? -10.804 -2.324  6.772   1.00 2.52  ? 8  ARG D CD     1  
ATOM 4467  N NE     . ARG F 3 8  ? -9.614  -1.472  6.844   1.00 2.58  ? 8  ARG D NE     1  
ATOM 4468  C CZ     . ARG F 3 8  ? -9.638  -0.145  6.999   1.00 2.66  ? 8  ARG D CZ     1  
ATOM 4469  N NH1    . ARG F 3 8  ? -10.790 0.508   7.104   1.00 2.72  ? 8  ARG D NH1    1  
ATOM 4470  N NH2    . ARG F 3 8  ? -8.498  0.531   7.058   1.00 2.77  ? 8  ARG D NH2    1  
ATOM 4471  H H      . ARG F 3 8  ? -13.877 -6.431  8.506   1.00 2.09  ? 8  ARG D H      1  
ATOM 4472  H HA     . ARG F 3 8  ? -11.987 -4.649  9.834   1.00 2.43  ? 8  ARG D HA     1  
ATOM 4473  H HB2    . ARG F 3 8  ? -11.369 -5.269  7.327   1.00 2.23  ? 8  ARG D HB2    1  
ATOM 4474  H HB3    . ARG F 3 8  ? -12.594 -4.057  6.972   1.00 2.25  ? 8  ARG D HB3    1  
ATOM 4475  H HG2    . ARG F 3 8  ? -11.137 -2.746  8.830   1.00 2.59  ? 8  ARG D HG2    1  
ATOM 4476  H HG3    . ARG F 3 8  ? -9.888  -3.738  8.079   1.00 2.62  ? 8  ARG D HG3    1  
ATOM 4477  H HD2    . ARG F 3 8  ? -10.778 -2.890  5.851   1.00 2.58  ? 8  ARG D HD2    1  
ATOM 4478  H HD3    . ARG F 3 8  ? -11.686 -1.703  6.786   1.00 2.58  ? 8  ARG D HD3    1  
ATOM 4479  H HE     . ARG F 3 8  ? -8.741  -1.924  6.778   1.00 2.62  ? 8  ARG D HE     1  
ATOM 4480  H HH11   . ARG F 3 8  ? -11.660 0.012   7.068   1.00 2.70  ? 8  ARG D HH11   1  
ATOM 4481  H HH12   . ARG F 3 8  ? -10.793 1.508   7.216   1.00 2.83  ? 8  ARG D HH12   1  
ATOM 4482  H HH21   . ARG F 3 8  ? -7.623  0.053   6.987   1.00 2.81  ? 8  ARG D HH21   1  
ATOM 4483  H HH22   . ARG F 3 8  ? -8.510  1.531   7.173   1.00 2.87  ? 8  ARG D HH22   1  
ATOM 4484  N N      . LYS F 3 9  ? -13.651 -2.737  9.770   1.00 2.49  ? 9  LYS D N      1  
ATOM 4485  C CA     . LYS F 3 9  ? -14.716 -1.767  10.004  1.00 2.55  ? 9  LYS D CA     1  
ATOM 4486  C C      . LYS F 3 9  ? -15.282 -1.242  8.690   1.00 2.53  ? 9  LYS D C      1  
ATOM 4487  O O      . LYS F 3 9  ? -14.552 -1.086  7.707   1.00 2.58  ? 9  LYS D O      1  
ATOM 4488  C CB     . LYS F 3 9  ? -14.185 -0.598  10.841  1.00 2.77  ? 9  LYS D CB     1  
ATOM 4489  C CG     . LYS F 3 9  ? -12.924 0.042   10.270  1.00 2.97  ? 9  LYS D CG     1  
ATOM 4490  C CD     . LYS F 3 9  ? -12.560 1.331   10.990  1.00 2.92  ? 9  LYS D CD     1  
ATOM 4491  C CE     . LYS F 3 9  ? -13.470 2.477   10.578  1.00 3.10  ? 9  LYS D CE     1  
ATOM 4492  N NZ     . LYS F 3 9  ? -13.047 3.771   11.182  1.00 3.15  ? 9  LYS D NZ     1  
ATOM 4493  H H      . LYS F 3 9  ? -12.749 -2.527  10.084  1.00 2.60  ? 9  LYS D H      1  
ATOM 4494  H HA     . LYS F 3 9  ? -15.503 -2.261  10.550  1.00 2.48  ? 9  LYS D HA     1  
ATOM 4495  H HB2    . LYS F 3 9  ? -14.953 0.160   10.910  1.00 3.04  ? 9  LYS D HB2    1  
ATOM 4496  H HB3    . LYS F 3 9  ? -13.960 -0.959  11.833  1.00 3.06  ? 9  LYS D HB3    1  
ATOM 4497  H HG2    . LYS F 3 9  ? -12.104 -0.653  10.369  1.00 3.45  ? 9  LYS D HG2    1  
ATOM 4498  H HG3    . LYS F 3 9  ? -13.086 0.261   9.223   1.00 3.27  ? 9  LYS D HG3    1  
ATOM 4499  H HD2    . LYS F 3 9  ? -12.654 1.177   12.055  1.00 2.95  ? 9  LYS D HD2    1  
ATOM 4500  H HD3    . LYS F 3 9  ? -11.539 1.589   10.750  1.00 3.34  ? 9  LYS D HD3    1  
ATOM 4501  H HE2    . LYS F 3 9  ? -13.445 2.566   9.501   1.00 3.65  ? 9  LYS D HE2    1  
ATOM 4502  H HE3    . LYS F 3 9  ? -14.476 2.250   10.894  1.00 3.25  ? 9  LYS D HE3    1  
ATOM 4503  H HZ1    . LYS F 3 9  ? -12.217 4.148   10.680  1.00 3.61  ? 9  LYS D HZ1    1  
ATOM 4504  H HZ2    . LYS F 3 9  ? -12.797 3.634   12.182  1.00 3.21  ? 9  LYS D HZ2    1  
ATOM 4505  H HZ3    . LYS F 3 9  ? -13.820 4.465   11.126  1.00 3.14  ? 9  LYS D HZ3    1  
ATOM 4506  N N      . VAL F 3 10 ? -16.583 -0.980  8.685   1.00 2.48  ? 10 VAL D N      1  
ATOM 4507  C CA     . VAL F 3 10 ? -17.258 -0.467  7.501   1.00 2.50  ? 10 VAL D CA     1  
ATOM 4508  C C      . VAL F 3 10 ? -17.122 1.061   7.414   1.00 2.74  ? 10 VAL D C      1  
ATOM 4509  O O      . VAL F 3 10 ? -16.104 1.564   6.941   1.00 3.08  ? 10 VAL D O      1  
ATOM 4510  C CB     . VAL F 3 10 ? -18.750 -0.879  7.474   1.00 2.43  ? 10 VAL D CB     1  
ATOM 4511  C CG1    . VAL F 3 10 ? -19.367 -0.604  6.113   1.00 2.62  ? 10 VAL D CG1    1  
ATOM 4512  C CG2    . VAL F 3 10 ? -18.904 -2.350  7.834   1.00 2.73  ? 10 VAL D CG2    1  
ATOM 4513  H H      . VAL F 3 10 ? -17.105 -1.150  9.500   1.00 2.46  ? 10 VAL D H      1  
ATOM 4514  H HA     . VAL F 3 10 ? -16.774 -0.903  6.638   1.00 2.49  ? 10 VAL D HA     1  
ATOM 4515  H HB     . VAL F 3 10 ? -19.279 -0.294  8.212   1.00 2.68  ? 10 VAL D HB     1  
ATOM 4516  H HG11   . VAL F 3 10 ? -20.421 -0.840  6.140   1.00 2.67  ? 10 VAL D HG11   1  
ATOM 4517  H HG12   . VAL F 3 10 ? -18.880 -1.216  5.366   1.00 2.86  ? 10 VAL D HG12   1  
ATOM 4518  H HG13   . VAL F 3 10 ? -19.239 0.436   5.865   1.00 3.13  ? 10 VAL D HG13   1  
ATOM 4519  H HG21   . VAL F 3 10 ? -19.951 -2.584  7.960   1.00 2.85  ? 10 VAL D HG21   1  
ATOM 4520  H HG22   . VAL F 3 10 ? -18.375 -2.552  8.754   1.00 2.98  ? 10 VAL D HG22   1  
ATOM 4521  H HG23   . VAL F 3 10 ? -18.492 -2.960  7.043   1.00 3.19  ? 10 VAL D HG23   1  
ATOM 4522  N N      . ASP F 3 11 ? -18.127 1.799   7.896   1.00 2.92  ? 11 ASP D N      1  
ATOM 4523  C CA     . ASP F 3 11 ? -18.097 3.265   7.844   1.00 3.22  ? 11 ASP D CA     1  
ATOM 4524  C C      . ASP F 3 11 ? -19.287 3.858   8.587   1.00 3.43  ? 11 ASP D C      1  
ATOM 4525  O O      . ASP F 3 11 ? -20.308 3.196   8.758   1.00 3.45  ? 11 ASP D O      1  
ATOM 4526  C CB     . ASP F 3 11 ? -18.122 3.741   6.386   1.00 3.38  ? 11 ASP D CB     1  
ATOM 4527  C CG     . ASP F 3 11 ? -17.977 5.245   6.236   1.00 4.07  ? 11 ASP D CG     1  
ATOM 4528  O OD1    . ASP F 3 11 ? -19.006 5.953   6.215   1.00 4.59  ? 11 ASP D OD1    1  
ATOM 4529  O OD2    . ASP F 3 11 ? -16.832 5.719   6.100   1.00 4.36  ? 11 ASP D OD2    1  
ATOM 4530  H H      . ASP F 3 11 ? -18.903 1.353   8.301   1.00 3.08  ? 11 ASP D H      1  
ATOM 4531  H HA     . ASP F 3 11 ? -17.184 3.600   8.311   1.00 3.31  ? 11 ASP D HA     1  
ATOM 4532  H HB2    . ASP F 3 11 ? -17.311 3.272   5.853   1.00 3.15  ? 11 ASP D HB2    1  
ATOM 4533  H HB3    . ASP F 3 11 ? -19.059 3.443   5.937   1.00 3.54  ? 11 ASP D HB3    1  
ATOM 4534  N N      . GLU F 3 12 ? -19.154 5.110   9.010   1.00 3.72  ? 12 GLU D N      1  
ATOM 4535  C CA     . GLU F 3 12 ? -20.218 5.810   9.724   1.00 4.06  ? 12 GLU D CA     1  
ATOM 4536  C C      . GLU F 3 12 ? -21.491 5.875   8.883   1.00 4.06  ? 12 GLU D C      1  
ATOM 4537  O O      . GLU F 3 12 ? -22.603 5.870   9.419   1.00 4.17  ? 12 GLU D O      1  
ATOM 4538  C CB     . GLU F 3 12 ? -19.770 7.230   10.083  1.00 4.47  ? 12 GLU D CB     1  
ATOM 4539  C CG     . GLU F 3 12 ? -18.630 7.279   11.090  1.00 4.95  ? 12 GLU D CG     1  
ATOM 4540  C CD     . GLU F 3 12 ? -19.107 7.563   12.501  1.00 5.61  ? 12 GLU D CD     1  
ATOM 4541  O OE1    . GLU F 3 12 ? -20.328 7.460   12.761  1.00 5.97  ? 12 GLU D OE1    1  
ATOM 4542  O OE2    . GLU F 3 12 ? -18.263 7.900   13.358  1.00 6.06  ? 12 GLU D OE2    1  
ATOM 4543  H H      . GLU F 3 12 ? -18.310 5.580   8.837   1.00 3.78  ? 12 GLU D H      1  
ATOM 4544  H HA     . GLU F 3 12 ? -20.427 5.263   10.632  1.00 4.11  ? 12 GLU D HA     1  
ATOM 4545  H HB2    . GLU F 3 12 ? -19.447 7.730   9.182   1.00 4.71  ? 12 GLU D HB2    1  
ATOM 4546  H HB3    . GLU F 3 12 ? -20.611 7.764   10.499  1.00 4.53  ? 12 GLU D HB3    1  
ATOM 4547  H HG2    . GLU F 3 12 ? -18.119 6.327   11.084  1.00 5.01  ? 12 GLU D HG2    1  
ATOM 4548  H HG3    . GLU F 3 12 ? -17.940 8.057   10.796  1.00 5.18  ? 12 GLU D HG3    1  
ATOM 4549  N N      . LEU F 3 13 ? -21.322 5.936   7.566   1.00 3.98  ? 13 LEU D N      1  
ATOM 4550  C CA     . LEU F 3 13 ? -22.451 6.000   6.645   1.00 4.04  ? 13 LEU D CA     1  
ATOM 4551  C C      . LEU F 3 13 ? -22.566 4.707   5.838   1.00 3.72  ? 13 LEU D C      1  
ATOM 4552  O O      . LEU F 3 13 ? -23.353 4.618   4.892   1.00 3.86  ? 13 LEU D O      1  
ATOM 4553  C CB     . LEU F 3 13 ? -22.306 7.198   5.697   1.00 4.23  ? 13 LEU D CB     1  
ATOM 4554  C CG     . LEU F 3 13 ? -22.858 8.538   6.207   1.00 4.64  ? 13 LEU D CG     1  
ATOM 4555  C CD1    . LEU F 3 13 ? -24.243 8.363   6.810   1.00 4.84  ? 13 LEU D CD1    1  
ATOM 4556  C CD2    . LEU F 3 13 ? -21.908 9.163   7.217   1.00 4.84  ? 13 LEU D CD2    1  
ATOM 4557  H H      . LEU F 3 13 ? -20.403 5.940   7.197   1.00 3.93  ? 13 LEU D H      1  
ATOM 4558  H HA     . LEU F 3 13 ? -23.347 6.122   7.231   1.00 4.26  ? 13 LEU D HA     1  
ATOM 4559  H HB2    . LEU F 3 13 ? -21.255 7.329   5.487   1.00 4.21  ? 13 LEU D HB2    1  
ATOM 4560  H HB3    . LEU F 3 13 ? -22.810 6.959   4.772   1.00 4.16  ? 13 LEU D HB3    1  
ATOM 4561  H HG     . LEU F 3 13 ? -22.948 9.219   5.371   1.00 4.78  ? 13 LEU D HG     1  
ATOM 4562  H HD11   . LEU F 3 13 ? -24.158 7.870   7.768   1.00 5.29  ? 13 LEU D HD11   1  
ATOM 4563  H HD12   . LEU F 3 13 ? -24.849 7.763   6.150   1.00 4.84  ? 13 LEU D HD12   1  
ATOM 4564  H HD13   . LEU F 3 13 ? -24.704 9.330   6.941   1.00 4.86  ? 13 LEU D HD13   1  
ATOM 4565  H HD21   . LEU F 3 13 ? -21.842 8.529   8.088   1.00 5.25  ? 13 LEU D HD21   1  
ATOM 4566  H HD22   . LEU F 3 13 ? -22.281 10.137  7.505   1.00 4.85  ? 13 LEU D HD22   1  
ATOM 4567  H HD23   . LEU F 3 13 ? -20.930 9.269   6.773   1.00 4.86  ? 13 LEU D HD23   1  
ATOM 4568  N N      . GLY F 3 14 ? -21.778 3.706   6.212   1.00 3.43  ? 14 GLY D N      1  
ATOM 4569  C CA     . GLY F 3 14 ? -21.811 2.432   5.515   1.00 3.21  ? 14 GLY D CA     1  
ATOM 4570  C C      . GLY F 3 14 ? -21.090 2.467   4.177   1.00 2.98  ? 14 GLY D C      1  
ATOM 4571  O O      . GLY F 3 14 ? -21.675 2.826   3.152   1.00 3.03  ? 14 GLY D O      1  
ATOM 4572  H H      . GLY F 3 14 ? -21.175 3.831   6.977   1.00 3.46  ? 14 GLY D H      1  
ATOM 4573  H HA2    . GLY F 3 14 ? -21.346 1.684   6.139   1.00 3.18  ? 14 GLY D HA2    1  
ATOM 4574  H HA3    . GLY F 3 14 ? -22.842 2.155   5.349   1.00 3.31  ? 14 GLY D HA3    1  
ATOM 4575  N N      . ARG F 3 15 ? -19.819 2.094   4.192   1.00 2.93  ? 15 ARG D N      1  
ATOM 4576  C CA     . ARG F 3 15 ? -18.994 2.073   2.994   1.00 2.78  ? 15 ARG D CA     1  
ATOM 4577  C C      . ARG F 3 15 ? -17.907 1.018   3.149   1.00 2.58  ? 15 ARG D C      1  
ATOM 4578  O O      . ARG F 3 15 ? -17.115 1.085   4.085   1.00 2.54  ? 15 ARG D O      1  
ATOM 4579  C CB     . ARG F 3 15 ? -18.366 3.451   2.792   1.00 3.05  ? 15 ARG D CB     1  
ATOM 4580  C CG     . ARG F 3 15 ? -18.077 3.806   1.345   1.00 3.37  ? 15 ARG D CG     1  
ATOM 4581  C CD     . ARG F 3 15 ? -18.009 5.312   1.152   1.00 3.86  ? 15 ARG D CD     1  
ATOM 4582  N NE     . ARG F 3 15 ? -19.281 5.961   1.477   1.00 3.88  ? 15 ARG D NE     1  
ATOM 4583  C CZ     . ARG F 3 15 ? -19.559 6.511   2.661   1.00 4.15  ? 15 ARG D CZ     1  
ATOM 4584  N NH1    . ARG F 3 15 ? -18.623 6.581   3.599   1.00 4.50  ? 15 ARG D NH1    1  
ATOM 4585  N NH2    . ARG F 3 15 ? -20.768 7.010   2.896   1.00 4.51  ? 15 ARG D NH2    1  
ATOM 4586  H H      . ARG F 3 15 ? -19.413 1.836   5.046   1.00 3.12  ? 15 ARG D H      1  
ATOM 4587  H HA     . ARG F 3 15 ? -19.615 1.829   2.146   1.00 2.71  ? 15 ARG D HA     1  
ATOM 4588  H HB2    . ARG F 3 15 ? -19.037 4.196   3.192   1.00 3.18  ? 15 ARG D HB2    1  
ATOM 4589  H HB3    . ARG F 3 15 ? -17.437 3.489   3.341   1.00 3.12  ? 15 ARG D HB3    1  
ATOM 4590  H HG2    . ARG F 3 15 ? -17.129 3.374   1.059   1.00 3.49  ? 15 ARG D HG2    1  
ATOM 4591  H HG3    . ARG F 3 15 ? -18.860 3.407   0.721   1.00 3.42  ? 15 ARG D HG3    1  
ATOM 4592  H HD2    . ARG F 3 15 ? -17.236 5.710   1.794   1.00 4.34  ? 15 ARG D HD2    1  
ATOM 4593  H HD3    . ARG F 3 15 ? -17.761 5.520   0.121   1.00 4.12  ? 15 ARG D HD3    1  
ATOM 4594  H HE     . ARG F 3 15 ? -19.974 5.960   0.782   1.00 4.00  ? 15 ARG D HE     1  
ATOM 4595  H HH11   . ARG F 3 15 ? -17.704 6.228   3.421   1.00 4.57  ? 15 ARG D HH11   1  
ATOM 4596  H HH12   . ARG F 3 15 ? -18.837 6.956   4.510   1.00 4.93  ? 15 ARG D HH12   1  
ATOM 4597  H HH21   . ARG F 3 15 ? -21.474 6.977   2.187   1.00 4.63  ? 15 ARG D HH21   1  
ATOM 4598  H HH22   . ARG F 3 15 ? -20.980 7.419   3.787   1.00 4.89  ? 15 ARG D HH22   1  
ATOM 4599  N N      . VAL F 3 16 ? -17.863 0.048   2.242   1.00 2.56  ? 16 VAL D N      1  
ATOM 4600  C CA     . VAL F 3 16 ? -16.864 -1.006  2.335   1.00 2.47  ? 16 VAL D CA     1  
ATOM 4601  C C      . VAL F 3 16 ? -15.488 -0.468  1.949   1.00 2.50  ? 16 VAL D C      1  
ATOM 4602  O O      . VAL F 3 16 ? -15.231 -0.107  0.793   1.00 2.53  ? 16 VAL D O      1  
ATOM 4603  C CB     . VAL F 3 16 ? -17.233 -2.265  1.503   1.00 2.44  ? 16 VAL D CB     1  
ATOM 4604  C CG1    . VAL F 3 16 ? -17.588 -1.914  0.069   1.00 2.75  ? 16 VAL D CG1    1  
ATOM 4605  C CG2    . VAL F 3 16 ? -16.103 -3.287  1.542   1.00 2.57  ? 16 VAL D CG2    1  
ATOM 4606  H H      . VAL F 3 16 ? -18.483 0.064   1.484   1.00 2.68  ? 16 VAL D H      1  
ATOM 4607  H HA     . VAL F 3 16 ? -16.820 -1.304  3.375   1.00 2.50  ? 16 VAL D HA     1  
ATOM 4608  H HB     . VAL F 3 16 ? -18.103 -2.718  1.955   1.00 2.56  ? 16 VAL D HB     1  
ATOM 4609  H HG11   . VAL F 3 16 ? -16.727 -1.486  -0.421  1.00 2.92  ? 16 VAL D HG11   1  
ATOM 4610  H HG12   . VAL F 3 16 ? -18.397 -1.199  0.064   1.00 3.11  ? 16 VAL D HG12   1  
ATOM 4611  H HG13   . VAL F 3 16 ? -17.894 -2.805  -0.457  1.00 3.09  ? 16 VAL D HG13   1  
ATOM 4612  H HG21   . VAL F 3 16 ? -15.900 -3.561  2.567   1.00 2.77  ? 16 VAL D HG21   1  
ATOM 4613  H HG22   . VAL F 3 16 ? -15.213 -2.857  1.103   1.00 2.89  ? 16 VAL D HG22   1  
ATOM 4614  H HG23   . VAL F 3 16 ? -16.391 -4.166  0.986   1.00 2.82  ? 16 VAL D HG23   1  
ATOM 4615  N N      . VAL F 3 17 ? -14.630 -0.383  2.956   1.00 2.62  ? 17 VAL D N      1  
ATOM 4616  C CA     . VAL F 3 17 ? -13.277 0.120   2.791   1.00 2.74  ? 17 VAL D CA     1  
ATOM 4617  C C      . VAL F 3 17 ? -12.388 -0.913  2.120   1.00 2.75  ? 17 VAL D C      1  
ATOM 4618  O O      . VAL F 3 17 ? -12.217 -2.023  2.626   1.00 2.88  ? 17 VAL D O      1  
ATOM 4619  C CB     . VAL F 3 17 ? -12.652 0.504   4.146   1.00 2.96  ? 17 VAL D CB     1  
ATOM 4620  C CG1    . VAL F 3 17 ? -11.312 1.189   3.945   1.00 2.93  ? 17 VAL D CG1    1  
ATOM 4621  C CG2    . VAL F 3 17 ? -13.591 1.396   4.937   1.00 3.36  ? 17 VAL D CG2    1  
ATOM 4622  H H      . VAL F 3 17 ? -14.918 -0.677  3.844   1.00 2.71  ? 17 VAL D H      1  
ATOM 4623  H HA     . VAL F 3 17 ? -13.320 1.005   2.174   1.00 2.73  ? 17 VAL D HA     1  
ATOM 4624  H HB     . VAL F 3 17 ? -12.487 -0.402  4.714   1.00 3.02  ? 17 VAL D HB     1  
ATOM 4625  H HG11   . VAL F 3 17 ? -10.945 1.547   4.897   1.00 3.17  ? 17 VAL D HG11   1  
ATOM 4626  H HG12   . VAL F 3 17 ? -11.430 2.022   3.268   1.00 3.06  ? 17 VAL D HG12   1  
ATOM 4627  H HG13   . VAL F 3 17 ? -10.605 0.486   3.531   1.00 3.05  ? 17 VAL D HG13   1  
ATOM 4628  H HG21   . VAL F 3 17 ? -13.208 1.526   5.938   1.00 3.93  ? 17 VAL D HG21   1  
ATOM 4629  H HG22   . VAL F 3 17 ? -14.568 0.939   4.979   1.00 3.49  ? 17 VAL D HG22   1  
ATOM 4630  H HG23   . VAL F 3 17 ? -13.663 2.357   4.451   1.00 3.36  ? 17 VAL D HG23   1  
ATOM 4631  N N      . ILE F 3 18 ? -11.833 -0.542  0.980   1.00 2.75  ? 18 ILE D N      1  
ATOM 4632  C CA     . ILE F 3 18 ? -10.945 -1.423  0.250   1.00 2.83  ? 18 ILE D CA     1  
ATOM 4633  C C      . ILE F 3 18 ? -9.497  -1.046  0.534   1.00 2.99  ? 18 ILE D C      1  
ATOM 4634  O O      . ILE F 3 18 ? -9.040  0.026   0.135   1.00 3.08  ? 18 ILE D O      1  
ATOM 4635  C CB     . ILE F 3 18 ? -11.209 -1.385  -1.274  1.00 2.80  ? 18 ILE D CB     1  
ATOM 4636  C CG1    . ILE F 3 18 ? -12.642 -1.835  -1.578  1.00 2.75  ? 18 ILE D CG1    1  
ATOM 4637  C CG2    . ILE F 3 18 ? -10.208 -2.266  -2.014  1.00 2.86  ? 18 ILE D CG2    1  
ATOM 4638  C CD1    . ILE F 3 18 ? -12.996 -1.795  -3.050  1.00 2.91  ? 18 ILE D CD1    1  
ATOM 4639  H H      . ILE F 3 18 ? -12.020 0.349   0.625   1.00 2.77  ? 18 ILE D H      1  
ATOM 4640  H HA     . ILE F 3 18 ? -11.118 -2.431  0.600   1.00 2.89  ? 18 ILE D HA     1  
ATOM 4641  H HB     . ILE F 3 18 ? -11.075 -0.370  -1.616  1.00 3.26  ? 18 ILE D HB     1  
ATOM 4642  H HG12   . ILE F 3 18 ? -12.770 -2.852  -1.239  1.00 2.68  ? 18 ILE D HG12   1  
ATOM 4643  H HG13   . ILE F 3 18 ? -13.333 -1.195  -1.051  1.00 3.12  ? 18 ILE D HG13   1  
ATOM 4644  H HG21   . ILE F 3 18 ? -9.254  -1.762  -2.065  1.00 2.98  ? 18 ILE D HG21   1  
ATOM 4645  H HG22   . ILE F 3 18 ? -10.567 -2.458  -3.015  1.00 3.04  ? 18 ILE D HG22   1  
ATOM 4646  H HG23   . ILE F 3 18 ? -10.093 -3.203  -1.488  1.00 3.26  ? 18 ILE D HG23   1  
ATOM 4647  H HD11   . ILE F 3 18 ? -12.969 -0.774  -3.402  1.00 3.31  ? 18 ILE D HD11   1  
ATOM 4648  H HD12   . ILE F 3 18 ? -13.987 -2.200  -3.192  1.00 3.17  ? 18 ILE D HD12   1  
ATOM 4649  H HD13   . ILE F 3 18 ? -12.284 -2.386  -3.606  1.00 2.88  ? 18 ILE D HD13   1  
ATOM 4650  N N      . PRO F 3 19 ? -8.771  -1.908  1.263   1.00 3.11  ? 19 PRO D N      1  
ATOM 4651  C CA     . PRO F 3 19 ? -7.370  -1.670  1.608   1.00 3.35  ? 19 PRO D CA     1  
ATOM 4652  C C      . PRO F 3 19 ? -6.497  -1.455  0.380   1.00 3.34  ? 19 PRO D C      1  
ATOM 4653  O O      . PRO F 3 19 ? -6.777  -1.988  -0.698  1.00 3.15  ? 19 PRO D O      1  
ATOM 4654  C CB     . PRO F 3 19 ? -6.950  -2.950  2.336   1.00 3.46  ? 19 PRO D CB     1  
ATOM 4655  C CG     . PRO F 3 19 ? -8.220  -3.538  2.836   1.00 3.38  ? 19 PRO D CG     1  
ATOM 4656  C CD     . PRO F 3 19 ? -9.266  -3.179  1.822   1.00 3.11  ? 19 PRO D CD     1  
ATOM 4657  H HA     . PRO F 3 19 ? -7.267  -0.825  2.273   1.00 3.54  ? 19 PRO D HA     1  
ATOM 4658  H HB2    . PRO F 3 19 ? -6.452  -3.612  1.643   1.00 3.36  ? 19 PRO D HB2    1  
ATOM 4659  H HB3    . PRO F 3 19 ? -6.281  -2.705  3.149   1.00 3.77  ? 19 PRO D HB3    1  
ATOM 4660  H HG2    . PRO F 3 19 ? -8.122  -4.611  2.912   1.00 3.38  ? 19 PRO D HG2    1  
ATOM 4661  H HG3    . PRO F 3 19 ? -8.469  -3.113  3.797   1.00 3.62  ? 19 PRO D HG3    1  
ATOM 4662  H HD2    . PRO F 3 19 ? -9.327  -3.940  1.058   1.00 3.00  ? 19 PRO D HD2    1  
ATOM 4663  H HD3    . PRO F 3 19 ? -10.223 -3.044  2.301   1.00 3.14  ? 19 PRO D HD3    1  
ATOM 4664  N N      . ILE F 3 20 ? -5.437  -0.680  0.567   1.00 3.59  ? 20 ILE D N      1  
ATOM 4665  C CA     . ILE F 3 20 ? -4.488  -0.359  -0.494  1.00 3.70  ? 20 ILE D CA     1  
ATOM 4666  C C      . ILE F 3 20 ? -4.057  -1.607  -1.255  1.00 3.61  ? 20 ILE D C      1  
ATOM 4667  O O      . ILE F 3 20 ? -4.225  -1.697  -2.472  1.00 3.50  ? 20 ILE D O      1  
ATOM 4668  C CB     . ILE F 3 20 ? -3.221  0.321   0.075   1.00 4.08  ? 20 ILE D CB     1  
ATOM 4669  C CG1    . ILE F 3 20 ? -3.580  1.282   1.213   1.00 4.29  ? 20 ILE D CG1    1  
ATOM 4670  C CG2    . ILE F 3 20 ? -2.471  1.052   -1.029  1.00 4.37  ? 20 ILE D CG2    1  
ATOM 4671  C CD1    . ILE F 3 20 ? -3.422  0.679   2.592   1.00 4.82  ? 20 ILE D CD1    1  
ATOM 4672  H H      . ILE F 3 20 ? -5.288  -0.298  1.457   1.00 3.75  ? 20 ILE D H      1  
ATOM 4673  H HA     . ILE F 3 20 ? -4.964  0.326   -1.179  1.00 3.64  ? 20 ILE D HA     1  
ATOM 4674  H HB     . ILE F 3 20 ? -2.573  -0.453  0.461   1.00 4.35  ? 20 ILE D HB     1  
ATOM 4675  H HG12   . ILE F 3 20 ? -2.941  2.151   1.158   1.00 4.32  ? 20 ILE D HG12   1  
ATOM 4676  H HG13   . ILE F 3 20 ? -4.610  1.590   1.101   1.00 4.37  ? 20 ILE D HG13   1  
ATOM 4677  H HG21   . ILE F 3 20 ? -3.177  1.557   -1.670  1.00 4.27  ? 20 ILE D HG21   1  
ATOM 4678  H HG22   . ILE F 3 20 ? -1.900  0.343   -1.607  1.00 4.67  ? 20 ILE D HG22   1  
ATOM 4679  H HG23   . ILE F 3 20 ? -1.804  1.780   -0.589  1.00 4.78  ? 20 ILE D HG23   1  
ATOM 4680  H HD11   . ILE F 3 20 ? -2.371  0.546   2.808   1.00 4.83  ? 20 ILE D HD11   1  
ATOM 4681  H HD12   . ILE F 3 20 ? -3.919  -0.280  2.624   1.00 5.14  ? 20 ILE D HD12   1  
ATOM 4682  H HD13   . ILE F 3 20 ? -3.860  1.336   3.328   1.00 5.12  ? 20 ILE D HD13   1  
ATOM 4683  N N      . GLU F 3 21 ? -3.518  -2.570  -0.523  1.00 3.70  ? 21 GLU D N      1  
ATOM 4684  C CA     . GLU F 3 21 ? -3.040  -3.813  -1.109  1.00 3.72  ? 21 GLU D CA     1  
ATOM 4685  C C      . GLU F 3 21 ? -4.144  -4.561  -1.840  1.00 3.44  ? 21 GLU D C      1  
ATOM 4686  O O      . GLU F 3 21 ? -3.904  -5.125  -2.901  1.00 3.43  ? 21 GLU D O      1  
ATOM 4687  C CB     . GLU F 3 21 ? -2.421  -4.705  -0.034  1.00 3.96  ? 21 GLU D CB     1  
ATOM 4688  C CG     . GLU F 3 21 ? -0.986  -4.335  0.296   1.00 4.01  ? 21 GLU D CG     1  
ATOM 4689  C CD     . GLU F 3 21 ? -0.831  -2.866  0.626   1.00 4.53  ? 21 GLU D CD     1  
ATOM 4690  O OE1    . GLU F 3 21 ? -1.268  -2.457  1.716   1.00 4.98  ? 21 GLU D OE1    1  
ATOM 4691  O OE2    . GLU F 3 21 ? -0.292  -2.111  -0.214  1.00 4.84  ? 21 GLU D OE2    1  
ATOM 4692  H H      . GLU F 3 21 ? -3.420  -2.433  0.444   1.00 3.81  ? 21 GLU D H      1  
ATOM 4693  H HA     . GLU F 3 21 ? -2.274  -3.558  -1.826  1.00 3.85  ? 21 GLU D HA     1  
ATOM 4694  H HB2    . GLU F 3 21 ? -3.007  -4.623  0.870   1.00 4.29  ? 21 GLU D HB2    1  
ATOM 4695  H HB3    . GLU F 3 21 ? -2.439  -5.729  -0.375  1.00 4.07  ? 21 GLU D HB3    1  
ATOM 4696  H HG2    . GLU F 3 21 ? -0.661  -4.916  1.147   1.00 4.50  ? 21 GLU D HG2    1  
ATOM 4697  H HG3    . GLU F 3 21 ? -0.363  -4.565  -0.557  1.00 3.70  ? 21 GLU D HG3    1  
ATOM 4698  N N      . LEU F 3 22 ? -5.350  -4.556  -1.286  1.00 3.25  ? 22 LEU D N      1  
ATOM 4699  C CA     . LEU F 3 22 ? -6.473  -5.246  -1.915  1.00 3.03  ? 22 LEU D CA     1  
ATOM 4700  C C      . LEU F 3 22 ? -6.824  -4.584  -3.245  1.00 2.86  ? 22 LEU D C      1  
ATOM 4701  O O      . LEU F 3 22 ? -7.065  -5.265  -4.243  1.00 2.82  ? 22 LEU D O      1  
ATOM 4702  C CB     . LEU F 3 22 ? -7.690  -5.268  -0.985  1.00 2.93  ? 22 LEU D CB     1  
ATOM 4703  C CG     . LEU F 3 22 ? -8.889  -6.077  -1.498  1.00 2.96  ? 22 LEU D CG     1  
ATOM 4704  C CD1    . LEU F 3 22 ? -8.465  -7.487  -1.892  1.00 3.24  ? 22 LEU D CD1    1  
ATOM 4705  C CD2    . LEU F 3 22 ? -9.987  -6.128  -0.447  1.00 2.99  ? 22 LEU D CD2    1  
ATOM 4706  H H      . LEU F 3 22 ? -5.490  -4.072  -0.447  1.00 3.30  ? 22 LEU D H      1  
ATOM 4707  H HA     . LEU F 3 22 ? -6.162  -6.261  -2.109  1.00 3.13  ? 22 LEU D HA     1  
ATOM 4708  H HB2    . LEU F 3 22 ? -7.382  -5.682  -0.037  1.00 3.23  ? 22 LEU D HB2    1  
ATOM 4709  H HB3    . LEU F 3 22 ? -8.013  -4.250  -0.826  1.00 2.82  ? 22 LEU D HB3    1  
ATOM 4710  H HG     . LEU F 3 22 ? -9.290  -5.594  -2.378  1.00 3.45  ? 22 LEU D HG     1  
ATOM 4711  H HD11   . LEU F 3 22 ? -9.336  -8.061  -2.172  1.00 3.51  ? 22 LEU D HD11   1  
ATOM 4712  H HD12   . LEU F 3 22 ? -7.973  -7.963  -1.056  1.00 3.29  ? 22 LEU D HD12   1  
ATOM 4713  H HD13   . LEU F 3 22 ? -7.784  -7.437  -2.729  1.00 3.75  ? 22 LEU D HD13   1  
ATOM 4714  H HD21   . LEU F 3 22 ? -9.574  -6.476  0.487   1.00 3.00  ? 22 LEU D HD21   1  
ATOM 4715  H HD22   . LEU F 3 22 ? -10.764 -6.805  -0.771  1.00 3.21  ? 22 LEU D HD22   1  
ATOM 4716  H HD23   . LEU F 3 22 ? -10.402 -5.139  -0.313  1.00 3.53  ? 22 LEU D HD23   1  
ATOM 4717  N N      . ARG F 3 23 ? -6.826  -3.255  -3.256  1.00 2.83  ? 23 ARG D N      1  
ATOM 4718  C CA     . ARG F 3 23 ? -7.125  -2.498  -4.468  1.00 2.74  ? 23 ARG D CA     1  
ATOM 4719  C C      . ARG F 3 23 ? -6.086  -2.813  -5.540  1.00 2.88  ? 23 ARG D C      1  
ATOM 4720  O O      . ARG F 3 23 ? -6.411  -2.982  -6.718  1.00 2.82  ? 23 ARG D O      1  
ATOM 4721  C CB     . ARG F 3 23 ? -7.125  -0.994  -4.173  1.00 2.83  ? 23 ARG D CB     1  
ATOM 4722  C CG     . ARG F 3 23 ? -8.259  -0.237  -4.842  1.00 2.35  ? 23 ARG D CG     1  
ATOM 4723  C CD     . ARG F 3 23 ? -7.866  1.200   -5.158  1.00 2.25  ? 23 ARG D CD     1  
ATOM 4724  N NE     . ARG F 3 23 ? -7.183  1.306   -6.448  1.00 2.04  ? 23 ARG D NE     1  
ATOM 4725  C CZ     . ARG F 3 23 ? -6.966  2.451   -7.100  1.00 2.21  ? 23 ARG D CZ     1  
ATOM 4726  N NH1    . ARG F 3 23 ? -7.303  3.613   -6.558  1.00 2.81  ? 23 ARG D NH1    1  
ATOM 4727  N NH2    . ARG F 3 23 ? -6.383  2.430   -8.290  1.00 2.34  ? 23 ARG D NH2    1  
ATOM 4728  H H      . ARG F 3 23 ? -6.627  -2.769  -2.422  1.00 2.92  ? 23 ARG D H      1  
ATOM 4729  H HA     . ARG F 3 23 ? -8.101  -2.793  -4.823  1.00 2.59  ? 23 ARG D HA     1  
ATOM 4730  H HB2    . ARG F 3 23 ? -7.206  -0.849  -3.107  1.00 3.33  ? 23 ARG D HB2    1  
ATOM 4731  H HB3    . ARG F 3 23 ? -6.190  -0.572  -4.514  1.00 3.14  ? 23 ARG D HB3    1  
ATOM 4732  H HG2    . ARG F 3 23 ? -8.519  -0.736  -5.763  1.00 2.40  ? 23 ARG D HG2    1  
ATOM 4733  H HG3    . ARG F 3 23 ? -9.112  -0.230  -4.180  1.00 2.65  ? 23 ARG D HG3    1  
ATOM 4734  H HD2    . ARG F 3 23 ? -8.758  1.808   -5.183  1.00 2.68  ? 23 ARG D HD2    1  
ATOM 4735  H HD3    . ARG F 3 23 ? -7.207  1.557   -4.382  1.00 2.54  ? 23 ARG D HD3    1  
ATOM 4736  H HE     . ARG F 3 23 ? -6.878  0.466   -6.861  1.00 2.20  ? 23 ARG D HE     1  
ATOM 4737  H HH11   . ARG F 3 23 ? -7.724  3.644   -5.652  1.00 3.08  ? 23 ARG D HH11   1  
ATOM 4738  H HH12   . ARG F 3 23 ? -7.126  4.476   -7.058  1.00 3.24  ? 23 ARG D HH12   1  
ATOM 4739  H HH21   . ARG F 3 23 ? -6.109  1.555   -8.702  1.00 2.49  ? 23 ARG D HH21   1  
ATOM 4740  H HH22   . ARG F 3 23 ? -6.212  3.295   -8.792  1.00 2.65  ? 23 ARG D HH22   1  
ATOM 4741  N N      . ARG F 3 24 ? -4.837  -2.907  -5.107  1.00 3.13  ? 24 ARG D N      1  
ATOM 4742  C CA     . ARG F 3 24 ? -3.728  -3.208  -5.999  1.00 3.36  ? 24 ARG D CA     1  
ATOM 4743  C C      . ARG F 3 24 ? -3.773  -4.669  -6.453  1.00 3.36  ? 24 ARG D C      1  
ATOM 4744  O O      . ARG F 3 24 ? -3.376  -4.992  -7.572  1.00 3.44  ? 24 ARG D O      1  
ATOM 4745  C CB     . ARG F 3 24 ? -2.403  -2.901  -5.300  1.00 3.68  ? 24 ARG D CB     1  
ATOM 4746  C CG     . ARG F 3 24 ? -2.252  -1.440  -4.897  1.00 4.43  ? 24 ARG D CG     1  
ATOM 4747  C CD     . ARG F 3 24 ? -1.114  -1.246  -3.906  1.00 4.76  ? 24 ARG D CD     1  
ATOM 4748  N NE     . ARG F 3 24 ? 0.190   -1.503  -4.509  1.00 5.12  ? 24 ARG D NE     1  
ATOM 4749  C CZ     . ARG F 3 24 ? 1.242   -1.967  -3.840  1.00 5.53  ? 24 ARG D CZ     1  
ATOM 4750  N NH1    . ARG F 3 24 ? 1.166   -2.204  -2.534  1.00 5.69  ? 24 ARG D NH1    1  
ATOM 4751  N NH2    . ARG F 3 24 ? 2.380   -2.191  -4.478  1.00 6.10  ? 24 ARG D NH2    1  
ATOM 4752  H H      . ARG F 3 24 ? -4.654  -2.758  -4.153  1.00 3.20  ? 24 ARG D H      1  
ATOM 4753  H HA     . ARG F 3 24 ? -3.821  -2.575  -6.867  1.00 3.34  ? 24 ARG D HA     1  
ATOM 4754  H HB2    . ARG F 3 24 ? -2.334  -3.508  -4.410  1.00 3.84  ? 24 ARG D HB2    1  
ATOM 4755  H HB3    . ARG F 3 24 ? -1.590  -3.156  -5.964  1.00 3.45  ? 24 ARG D HB3    1  
ATOM 4756  H HG2    . ARG F 3 24 ? -2.052  -0.852  -5.779  1.00 4.63  ? 24 ARG D HG2    1  
ATOM 4757  H HG3    . ARG F 3 24 ? -3.173  -1.106  -4.442  1.00 4.80  ? 24 ARG D HG3    1  
ATOM 4758  H HD2    . ARG F 3 24 ? -1.139  -0.230  -3.545  1.00 5.01  ? 24 ARG D HD2    1  
ATOM 4759  H HD3    . ARG F 3 24 ? -1.255  -1.926  -3.078  1.00 4.87  ? 24 ARG D HD3    1  
ATOM 4760  H HE     . ARG F 3 24 ? 0.282   -1.324  -5.474  1.00 5.30  ? 24 ARG D HE     1  
ATOM 4761  H HH11   . ARG F 3 24 ? 0.309   -2.036  -2.030  1.00 5.49  ? 24 ARG D HH11   1  
ATOM 4762  H HH12   . ARG F 3 24 ? 1.964   -2.554  -2.043  1.00 6.21  ? 24 ARG D HH12   1  
ATOM 4763  H HH21   . ARG F 3 24 ? 2.449   -2.010  -5.463  1.00 6.25  ? 24 ARG D HH21   1  
ATOM 4764  H HH22   . ARG F 3 24 ? 3.180   -2.556  -3.979  1.00 6.55  ? 24 ARG D HH22   1  
ATOM 4765  N N      . THR F 3 25 ? -4.267  -5.548  -5.584  1.00 3.30  ? 25 THR D N      1  
ATOM 4766  C CA     . THR F 3 25 ? -4.375  -6.968  -5.907  1.00 3.37  ? 25 THR D CA     1  
ATOM 4767  C C      . THR F 3 25 ? -5.414  -7.178  -7.005  1.00 3.17  ? 25 THR D C      1  
ATOM 4768  O O      . THR F 3 25 ? -5.198  -7.951  -7.938  1.00 3.23  ? 25 THR D O      1  
ATOM 4769  C CB     . THR F 3 25 ? -4.760  -7.811  -4.670  1.00 3.49  ? 25 THR D CB     1  
ATOM 4770  O OG1    . THR F 3 25 ? -3.807  -7.605  -3.617  1.00 3.66  ? 25 THR D OG1    1  
ATOM 4771  C CG2    . THR F 3 25 ? -4.826  -9.293  -5.016  1.00 3.73  ? 25 THR D CG2    1  
ATOM 4772  H H      . THR F 3 25 ? -4.564  -5.234  -4.703  1.00 3.25  ? 25 THR D H      1  
ATOM 4773  H HA     . THR F 3 25 ? -3.412  -7.303  -6.264  1.00 3.56  ? 25 THR D HA     1  
ATOM 4774  H HB     . THR F 3 25 ? -5.734  -7.495  -4.328  1.00 3.37  ? 25 THR D HB     1  
ATOM 4775  H HG1    . THR F 3 25 ? -3.548  -6.673  -3.598  1.00 3.57  ? 25 THR D HG1    1  
ATOM 4776  H HG21   . THR F 3 25 ? -5.147  -9.851  -4.149  1.00 3.46  ? 25 THR D HG21   1  
ATOM 4777  H HG22   . THR F 3 25 ? -3.849  -9.635  -5.323  1.00 4.04  ? 25 THR D HG22   1  
ATOM 4778  H HG23   . THR F 3 25 ? -5.530  -9.445  -5.821  1.00 4.20  ? 25 THR D HG23   1  
ATOM 4779  N N      . LEU F 3 26 ? -6.537  -6.471  -6.891  1.00 2.97  ? 26 LEU D N      1  
ATOM 4780  C CA     . LEU F 3 26 ? -7.606  -6.564  -7.878  1.00 2.82  ? 26 LEU D CA     1  
ATOM 4781  C C      . LEU F 3 26 ? -7.145  -5.989  -9.214  1.00 2.76  ? 26 LEU D C      1  
ATOM 4782  O O      . LEU F 3 26 ? -7.587  -6.425  -10.276 1.00 2.80  ? 26 LEU D O      1  
ATOM 4783  C CB     . LEU F 3 26 ? -8.852  -5.817  -7.390  1.00 2.62  ? 26 LEU D CB     1  
ATOM 4784  C CG     . LEU F 3 26 ? -9.616  -6.491  -6.248  1.00 2.66  ? 26 LEU D CG     1  
ATOM 4785  C CD1    . LEU F 3 26 ? -10.577 -5.505  -5.603  1.00 2.52  ? 26 LEU D CD1    1  
ATOM 4786  C CD2    . LEU F 3 26 ? -10.374 -7.709  -6.757  1.00 2.88  ? 26 LEU D CD2    1  
ATOM 4787  H H      . LEU F 3 26 ? -6.653  -5.874  -6.119  1.00 2.96  ? 26 LEU D H      1  
ATOM 4788  H HA     . LEU F 3 26 ? -7.849  -7.608  -8.011  1.00 2.97  ? 26 LEU D HA     1  
ATOM 4789  H HB2    . LEU F 3 26 ? -8.549  -4.833  -7.060  1.00 2.60  ? 26 LEU D HB2    1  
ATOM 4790  H HB3    . LEU F 3 26 ? -9.528  -5.704  -8.225  1.00 2.53  ? 26 LEU D HB3    1  
ATOM 4791  H HG     . LEU F 3 26 ? -8.914  -6.821  -5.495  1.00 2.77  ? 26 LEU D HG     1  
ATOM 4792  H HD11   . LEU F 3 26 ? -10.055 -4.588  -5.375  1.00 2.47  ? 26 LEU D HD11   1  
ATOM 4793  H HD12   . LEU F 3 26 ? -10.972 -5.930  -4.692  1.00 2.75  ? 26 LEU D HD12   1  
ATOM 4794  H HD13   . LEU F 3 26 ? -11.390 -5.296  -6.284  1.00 2.50  ? 26 LEU D HD13   1  
ATOM 4795  H HD21   . LEU F 3 26 ? -9.695  -8.362  -7.285  1.00 2.88  ? 26 LEU D HD21   1  
ATOM 4796  H HD22   . LEU F 3 26 ? -11.160 -7.390  -7.425  1.00 3.28  ? 26 LEU D HD22   1  
ATOM 4797  H HD23   . LEU F 3 26 ? -10.807 -8.239  -5.921  1.00 3.05  ? 26 LEU D HD23   1  
ATOM 4798  N N      . GLY F 3 27 ? -6.240  -5.016  -9.145  1.00 2.76  ? 27 GLY D N      1  
ATOM 4799  C CA     . GLY F 3 27 ? -5.724  -4.387  -10.345 1.00 2.79  ? 27 GLY D CA     1  
ATOM 4800  C C      . GLY F 3 27 ? -6.682  -3.361  -10.905 1.00 2.43  ? 27 GLY D C      1  
ATOM 4801  O O      . GLY F 3 27 ? -6.653  -3.054  -12.096 1.00 2.53  ? 27 GLY D O      1  
ATOM 4802  H H      . GLY F 3 27 ? -5.913  -4.729  -8.267  1.00 2.81  ? 27 GLY D H      1  
ATOM 4803  H HA2    . GLY F 3 27 ? -4.787  -3.902  -10.114 1.00 2.92  ? 27 GLY D HA2    1  
ATOM 4804  H HA3    . GLY F 3 27 ? -5.549  -5.148  -11.092 1.00 3.04  ? 27 GLY D HA3    1  
ATOM 4805  N N      . ILE F 3 28 ? -7.527  -2.823  -10.037 1.00 2.15  ? 28 ILE D N      1  
ATOM 4806  C CA     . ILE F 3 28 ? -8.513  -1.837  -10.448 1.00 1.93  ? 28 ILE D CA     1  
ATOM 4807  C C      . ILE F 3 28 ? -7.982  -0.420  -10.286 1.00 1.89  ? 28 ILE D C      1  
ATOM 4808  O O      . ILE F 3 28 ? -7.235  -0.119  -9.349  1.00 1.99  ? 28 ILE D O      1  
ATOM 4809  C CB     . ILE F 3 28 ? -9.834  -1.979  -9.661  1.00 1.87  ? 28 ILE D CB     1  
ATOM 4810  C CG1    . ILE F 3 28 ? -9.569  -1.964  -8.150  1.00 1.98  ? 28 ILE D CG1    1  
ATOM 4811  C CG2    . ILE F 3 28 ? -10.552 -3.259  -10.069 1.00 2.04  ? 28 ILE D CG2    1  
ATOM 4812  C CD1    . ILE F 3 28 ? -10.819 -1.806  -7.312  1.00 2.03  ? 28 ILE D CD1    1  
ATOM 4813  H H      . ILE F 3 28 ? -7.477  -3.086  -9.097  1.00 2.21  ? 28 ILE D H      1  
ATOM 4814  H HA     . ILE F 3 28 ? -8.727  -2.004  -11.493 1.00 2.01  ? 28 ILE D HA     1  
ATOM 4815  H HB     . ILE F 3 28 ? -10.468 -1.145  -9.915  1.00 1.87  ? 28 ILE D HB     1  
ATOM 4816  H HG12   . ILE F 3 28 ? -9.099  -2.894  -7.867  1.00 2.15  ? 28 ILE D HG12   1  
ATOM 4817  H HG13   . ILE F 3 28 ? -8.906  -1.145  -7.917  1.00 2.06  ? 28 ILE D HG13   1  
ATOM 4818  H HG21   . ILE F 3 28 ? -11.510 -3.309  -9.576  1.00 2.23  ? 28 ILE D HG21   1  
ATOM 4819  H HG22   . ILE F 3 28 ? -9.954  -4.113  -9.783  1.00 2.01  ? 28 ILE D HG22   1  
ATOM 4820  H HG23   . ILE F 3 28 ? -10.698 -3.262  -11.140 1.00 2.32  ? 28 ILE D HG23   1  
ATOM 4821  H HD11   . ILE F 3 28 ? -10.553 -1.821  -6.265  1.00 2.18  ? 28 ILE D HD11   1  
ATOM 4822  H HD12   . ILE F 3 28 ? -11.499 -2.619  -7.524  1.00 2.27  ? 28 ILE D HD12   1  
ATOM 4823  H HD13   . ILE F 3 28 ? -11.296 -0.866  -7.547  1.00 2.35  ? 28 ILE D HD13   1  
ATOM 4824  N N      . ALA F 3 29 ? -8.359  0.437   -11.217 1.00 1.96  ? 29 ALA D N      1  
ATOM 4825  C CA     . ALA F 3 29 ? -7.947  1.828   -11.196 1.00 2.15  ? 29 ALA D CA     1  
ATOM 4826  C C      . ALA F 3 29 ? -9.086  2.711   -10.702 1.00 2.06  ? 29 ALA D C      1  
ATOM 4827  O O      . ALA F 3 29 ? -10.162 2.215   -10.364 1.00 2.05  ? 29 ALA D O      1  
ATOM 4828  C CB     . ALA F 3 29 ? -7.497  2.262   -12.582 1.00 2.46  ? 29 ALA D CB     1  
ATOM 4829  H H      . ALA F 3 29 ? -8.932  0.117   -11.956 1.00 2.03  ? 29 ALA D H      1  
ATOM 4830  H HA     . ALA F 3 29 ? -7.109  1.922   -10.521 1.00 2.29  ? 29 ALA D HA     1  
ATOM 4831  H HB1    . ALA F 3 29 ? -7.180  3.294   -12.549 1.00 2.81  ? 29 ALA D HB1    1  
ATOM 4832  H HB2    . ALA F 3 29 ? -8.318  2.160   -13.276 1.00 2.65  ? 29 ALA D HB2    1  
ATOM 4833  H HB3    . ALA F 3 29 ? -6.674  1.642   -12.905 1.00 2.63  ? 29 ALA D HB3    1  
ATOM 4834  N N      . GLU F 3 30 ? -8.861  4.018   -10.691 1.00 2.11  ? 30 GLU D N      1  
ATOM 4835  C CA     . GLU F 3 30 ? -9.873  4.970   -10.239 1.00 2.12  ? 30 GLU D CA     1  
ATOM 4836  C C      . GLU F 3 30 ? -10.875 5.265   -11.355 1.00 2.13  ? 30 GLU D C      1  
ATOM 4837  O O      . GLU F 3 30 ? -11.550 6.296   -11.357 1.00 2.29  ? 30 GLU D O      1  
ATOM 4838  C CB     . GLU F 3 30 ? -9.229  6.275   -9.740  1.00 2.35  ? 30 GLU D CB     1  
ATOM 4839  C CG     . GLU F 3 30 ? -7.758  6.442   -10.100 1.00 2.29  ? 30 GLU D CG     1  
ATOM 4840  C CD     . GLU F 3 30 ? -6.843  5.575   -9.255  1.00 2.93  ? 30 GLU D CD     1  
ATOM 4841  O OE1    . GLU F 3 30 ? -6.755  5.806   -8.032  1.00 3.40  ? 30 GLU D OE1    1  
ATOM 4842  O OE2    . GLU F 3 30 ? -6.220  4.645   -9.806  1.00 3.35  ? 30 GLU D OE2    1  
ATOM 4843  H H      . GLU F 3 30 ? -7.985  4.354   -10.985 1.00 2.23  ? 30 GLU D H      1  
ATOM 4844  H HA     . GLU F 3 30 ? -10.404 4.509   -9.418  1.00 2.06  ? 30 GLU D HA     1  
ATOM 4845  H HB2    . GLU F 3 30 ? -9.770  7.108   -10.160 1.00 2.64  ? 30 GLU D HB2    1  
ATOM 4846  H HB3    . GLU F 3 30 ? -9.316  6.311   -8.664  1.00 2.53  ? 30 GLU D HB3    1  
ATOM 4847  H HG2    . GLU F 3 30 ? -7.623  6.178   -11.137 1.00 2.34  ? 30 GLU D HG2    1  
ATOM 4848  H HG3    . GLU F 3 30 ? -7.485  7.477   -9.955  1.00 2.32  ? 30 GLU D HG3    1  
ATOM 4849  N N      . LYS F 3 31 ? -10.954 4.347   -12.305 1.00 2.11  ? 31 LYS D N      1  
ATOM 4850  C CA     . LYS F 3 31 ? -11.865 4.455   -13.433 1.00 2.19  ? 31 LYS D CA     1  
ATOM 4851  C C      . LYS F 3 31 ? -12.294 3.061   -13.863 1.00 2.13  ? 31 LYS D C      1  
ATOM 4852  O O      . LYS F 3 31 ? -12.586 2.819   -15.033 1.00 2.24  ? 31 LYS D O      1  
ATOM 4853  C CB     . LYS F 3 31 ? -11.196 5.185   -14.602 1.00 2.43  ? 31 LYS D CB     1  
ATOM 4854  C CG     . LYS F 3 31 ? -11.311 6.698   -14.521 1.00 2.63  ? 31 LYS D CG     1  
ATOM 4855  C CD     . LYS F 3 31 ? -12.744 7.164   -14.726 1.00 2.78  ? 31 LYS D CD     1  
ATOM 4856  C CE     . LYS F 3 31 ? -12.994 8.497   -14.048 1.00 3.09  ? 31 LYS D CE     1  
ATOM 4857  N NZ     . LYS F 3 31 ? -12.786 8.415   -12.578 1.00 3.44  ? 31 LYS D NZ     1  
ATOM 4858  H H      . LYS F 3 31 ? -10.372 3.561   -12.246 1.00 2.16  ? 31 LYS D H      1  
ATOM 4859  H HA     . LYS F 3 31 ? -12.734 5.010   -13.111 1.00 2.19  ? 31 LYS D HA     1  
ATOM 4860  H HB2    . LYS F 3 31 ? -10.147 4.924   -14.619 1.00 2.43  ? 31 LYS D HB2    1  
ATOM 4861  H HB3    . LYS F 3 31 ? -11.653 4.859   -15.525 1.00 2.56  ? 31 LYS D HB3    1  
ATOM 4862  H HG2    . LYS F 3 31 ? -10.975 7.023   -13.548 1.00 3.02  ? 31 LYS D HG2    1  
ATOM 4863  H HG3    . LYS F 3 31 ? -10.687 7.139   -15.285 1.00 2.71  ? 31 LYS D HG3    1  
ATOM 4864  H HD2    . LYS F 3 31 ? -12.929 7.272   -15.784 1.00 2.80  ? 31 LYS D HD2    1  
ATOM 4865  H HD3    . LYS F 3 31 ? -13.419 6.428   -14.313 1.00 3.06  ? 31 LYS D HD3    1  
ATOM 4866  H HE2    . LYS F 3 31 ? -12.316 9.231   -14.460 1.00 3.09  ? 31 LYS D HE2    1  
ATOM 4867  H HE3    . LYS F 3 31 ? -14.013 8.796   -14.243 1.00 3.54  ? 31 LYS D HE3    1  
ATOM 4868  H HZ1    . LYS F 3 31 ? -11.997 9.038   -12.287 1.00 3.54  ? 31 LYS D HZ1    1  
ATOM 4869  H HZ2    . LYS F 3 31 ? -12.555 7.438   -12.301 1.00 3.57  ? 31 LYS D HZ2    1  
ATOM 4870  H HZ3    . LYS F 3 31 ? -13.653 8.712   -12.075 1.00 4.00  ? 31 LYS D HZ3    1  
ATOM 4871  N N      . ASP F 3 32 ? -12.343 2.150   -12.900 1.00 2.06  ? 32 ASP D N      1  
ATOM 4872  C CA     . ASP F 3 32 ? -12.709 0.766   -13.175 1.00 2.06  ? 32 ASP D CA     1  
ATOM 4873  C C      . ASP F 3 32 ? -14.132 0.467   -12.727 1.00 1.99  ? 32 ASP D C      1  
ATOM 4874  O O      . ASP F 3 32 ? -14.952 1.375   -12.580 1.00 1.95  ? 32 ASP D O      1  
ATOM 4875  C CB     . ASP F 3 32 ? -11.730 -0.191  -12.493 1.00 2.10  ? 32 ASP D CB     1  
ATOM 4876  C CG     . ASP F 3 32 ? -10.813 -0.870  -13.489 1.00 2.39  ? 32 ASP D CG     1  
ATOM 4877  O OD1    . ASP F 3 32 ? -11.311 -1.348  -14.528 1.00 2.57  ? 32 ASP D OD1    1  
ATOM 4878  O OD2    . ASP F 3 32 ? -9.592  -0.924  -13.237 1.00 2.66  ? 32 ASP D OD2    1  
ATOM 4879  H H      . ASP F 3 32 ? -12.148 2.421   -11.978 1.00 2.07  ? 32 ASP D H      1  
ATOM 4880  H HA     . ASP F 3 32 ? -12.649 0.620   -14.242 1.00 2.17  ? 32 ASP D HA     1  
ATOM 4881  H HB2    . ASP F 3 32 ? -11.123 0.362   -11.791 1.00 2.11  ? 32 ASP D HB2    1  
ATOM 4882  H HB3    . ASP F 3 32 ? -12.283 -0.951  -11.964 1.00 2.09  ? 32 ASP D HB3    1  
ATOM 4883  N N      . ALA F 3 33 ? -14.426 -0.810  -12.522 1.00 2.09  ? 33 ALA D N      1  
ATOM 4884  C CA     . ALA F 3 33 ? -15.748 -1.236  -12.094 1.00 2.08  ? 33 ALA D CA     1  
ATOM 4885  C C      . ALA F 3 33 ? -15.654 -2.500  -11.248 1.00 2.11  ? 33 ALA D C      1  
ATOM 4886  O O      . ALA F 3 33 ? -14.661 -3.225  -11.320 1.00 2.30  ? 33 ALA D O      1  
ATOM 4887  C CB     . ALA F 3 33 ? -16.640 -1.477  -13.304 1.00 2.18  ? 33 ALA D CB     1  
ATOM 4888  H H      . ALA F 3 33 ? -13.732 -1.488  -12.662 1.00 2.25  ? 33 ALA D H      1  
ATOM 4889  H HA     . ALA F 3 33 ? -16.184 -0.443  -11.502 1.00 2.02  ? 33 ALA D HA     1  
ATOM 4890  H HB1    . ALA F 3 33 ? -16.629 -0.604  -13.939 1.00 2.51  ? 33 ALA D HB1    1  
ATOM 4891  H HB2    . ALA F 3 33 ? -17.650 -1.669  -12.975 1.00 2.35  ? 33 ALA D HB2    1  
ATOM 4892  H HB3    . ALA F 3 33 ? -16.273 -2.329  -13.856 1.00 2.18  ? 33 ALA D HB3    1  
ATOM 4893  N N      . LEU F 3 34 ? -16.677 -2.746  -10.442 1.00 2.00  ? 34 LEU D N      1  
ATOM 4894  C CA     . LEU F 3 34 ? -16.725 -3.924  -9.585  1.00 2.02  ? 34 LEU D CA     1  
ATOM 4895  C C      . LEU F 3 34 ? -18.126 -4.527  -9.603  1.00 2.03  ? 34 LEU D C      1  
ATOM 4896  O O      . LEU F 3 34 ? -19.113 -3.812  -9.418  1.00 2.06  ? 34 LEU D O      1  
ATOM 4897  C CB     . LEU F 3 34 ? -16.343 -3.552  -8.148  1.00 2.04  ? 34 LEU D CB     1  
ATOM 4898  C CG     . LEU F 3 34 ? -14.858 -3.261  -7.916  1.00 2.04  ? 34 LEU D CG     1  
ATOM 4899  C CD1    . LEU F 3 34 ? -14.652 -2.597  -6.567  1.00 2.11  ? 34 LEU D CD1    1  
ATOM 4900  C CD2    . LEU F 3 34 ? -14.039 -4.540  -8.005  1.00 2.04  ? 34 LEU D CD2    1  
ATOM 4901  H H      . LEU F 3 34 ? -17.427 -2.107  -10.414 1.00 1.95  ? 34 LEU D H      1  
ATOM 4902  H HA     . LEU F 3 34 ? -16.022 -4.648  -9.966  1.00 2.05  ? 34 LEU D HA     1  
ATOM 4903  H HB2    . LEU F 3 34 ? -16.907 -2.675  -7.868  1.00 2.07  ? 34 LEU D HB2    1  
ATOM 4904  H HB3    . LEU F 3 34 ? -16.632 -4.366  -7.500  1.00 2.07  ? 34 LEU D HB3    1  
ATOM 4905  H HG     . LEU F 3 34 ? -14.508 -2.582  -8.680  1.00 2.06  ? 34 LEU D HG     1  
ATOM 4906  H HD11   . LEU F 3 34 ? -15.043 -1.590  -6.597  1.00 2.17  ? 34 LEU D HD11   1  
ATOM 4907  H HD12   . LEU F 3 34 ? -13.598 -2.566  -6.340  1.00 2.53  ? 34 LEU D HD12   1  
ATOM 4908  H HD13   . LEU F 3 34 ? -15.169 -3.162  -5.806  1.00 2.21  ? 34 LEU D HD13   1  
ATOM 4909  H HD21   . LEU F 3 34 ? -13.056 -4.364  -7.593  1.00 2.34  ? 34 LEU D HD21   1  
ATOM 4910  H HD22   . LEU F 3 34 ? -13.948 -4.838  -9.040  1.00 2.10  ? 34 LEU D HD22   1  
ATOM 4911  H HD23   . LEU F 3 34 ? -14.529 -5.323  -7.446  1.00 2.11  ? 34 LEU D HD23   1  
ATOM 4912  N N      . GLU F 3 35 ? -18.221 -5.828  -9.830  1.00 2.04  ? 35 GLU D N      1  
ATOM 4913  C CA     . GLU F 3 35 ? -19.515 -6.486  -9.858  1.00 2.06  ? 35 GLU D CA     1  
ATOM 4914  C C      . GLU F 3 35 ? -19.847 -7.031  -8.477  1.00 2.03  ? 35 GLU D C      1  
ATOM 4915  O O      . GLU F 3 35 ? -19.127 -7.874  -7.937  1.00 2.05  ? 35 GLU D O      1  
ATOM 4916  C CB     . GLU F 3 35 ? -19.544 -7.609  -10.896 1.00 2.10  ? 35 GLU D CB     1  
ATOM 4917  C CG     . GLU F 3 35 ? -20.947 -8.120  -11.181 1.00 2.17  ? 35 GLU D CG     1  
ATOM 4918  C CD     . GLU F 3 35 ? -20.974 -9.251  -12.184 1.00 2.22  ? 35 GLU D CD     1  
ATOM 4919  O OE1    . GLU F 3 35 ? -20.891 -8.978  -13.398 1.00 2.34  ? 35 GLU D OE1    1  
ATOM 4920  O OE2    . GLU F 3 35 ? -21.085 -10.422 -11.767 1.00 2.24  ? 35 GLU D OE2    1  
ATOM 4921  H H      . GLU F 3 35 ? -17.404 -6.359  -9.959  1.00 2.06  ? 35 GLU D H      1  
ATOM 4922  H HA     . GLU F 3 35 ? -20.255 -5.744  -10.124 1.00 2.08  ? 35 GLU D HA     1  
ATOM 4923  H HB2    . GLU F 3 35 ? -19.118 -7.245  -11.819 1.00 2.14  ? 35 GLU D HB2    1  
ATOM 4924  H HB3    . GLU F 3 35 ? -18.949 -8.432  -10.535 1.00 2.06  ? 35 GLU D HB3    1  
ATOM 4925  H HG2    . GLU F 3 35 ? -21.382 -8.471  -10.258 1.00 2.13  ? 35 GLU D HG2    1  
ATOM 4926  H HG3    . GLU F 3 35 ? -21.539 -7.303  -11.567 1.00 2.24  ? 35 GLU D HG3    1  
ATOM 4927  N N      . ILE F 3 36 ? -20.931 -6.532  -7.909  1.00 2.02  ? 36 ILE D N      1  
ATOM 4928  C CA     . ILE F 3 36 ? -21.364 -6.944  -6.585  1.00 2.02  ? 36 ILE D CA     1  
ATOM 4929  C C      . ILE F 3 36 ? -22.488 -7.969  -6.668  1.00 2.01  ? 36 ILE D C      1  
ATOM 4930  O O      . ILE F 3 36 ? -23.609 -7.654  -7.084  1.00 2.08  ? 36 ILE D O      1  
ATOM 4931  C CB     . ILE F 3 36 ? -21.848 -5.741  -5.749  1.00 2.09  ? 36 ILE D CB     1  
ATOM 4932  C CG1    . ILE F 3 36 ? -20.936 -4.529  -5.972  1.00 2.10  ? 36 ILE D CG1    1  
ATOM 4933  C CG2    . ILE F 3 36 ? -21.897 -6.109  -4.271  1.00 2.14  ? 36 ILE D CG2    1  
ATOM 4934  C CD1    . ILE F 3 36 ? -21.458 -3.251  -5.352  1.00 2.33  ? 36 ILE D CD1    1  
ATOM 4935  H H      . ILE F 3 36 ? -21.463 -5.867  -8.401  1.00 2.03  ? 36 ILE D H      1  
ATOM 4936  H HA     . ILE F 3 36 ? -20.519 -7.389  -6.080  1.00 2.00  ? 36 ILE D HA     1  
ATOM 4937  H HB     . ILE F 3 36 ? -22.849 -5.493  -6.066  1.00 2.15  ? 36 ILE D HB     1  
ATOM 4938  H HG12   . ILE F 3 36 ? -19.968 -4.731  -5.539  1.00 2.19  ? 36 ILE D HG12   1  
ATOM 4939  H HG13   . ILE F 3 36 ? -20.822 -4.362  -7.034  1.00 1.97  ? 36 ILE D HG13   1  
ATOM 4940  H HG21   . ILE F 3 36 ? -22.441 -7.034  -4.146  1.00 2.35  ? 36 ILE D HG21   1  
ATOM 4941  H HG22   . ILE F 3 36 ? -22.394 -5.322  -3.723  1.00 2.55  ? 36 ILE D HG22   1  
ATOM 4942  H HG23   . ILE F 3 36 ? -20.892 -6.228  -3.893  1.00 1.99  ? 36 ILE D HG23   1  
ATOM 4943  H HD11   . ILE F 3 36 ? -20.822 -2.426  -5.638  1.00 2.69  ? 36 ILE D HD11   1  
ATOM 4944  H HD12   . ILE F 3 36 ? -21.461 -3.350  -4.276  1.00 2.73  ? 36 ILE D HD12   1  
ATOM 4945  H HD13   . ILE F 3 36 ? -22.465 -3.067  -5.698  1.00 2.27  ? 36 ILE D HD13   1  
ATOM 4946  N N      . TYR F 3 37 ? -22.171 -9.194  -6.286  1.00 1.98  ? 37 TYR D N      1  
ATOM 4947  C CA     . TYR F 3 37 ? -23.133 -10.285 -6.282  1.00 1.97  ? 37 TYR D CA     1  
ATOM 4948  C C      . TYR F 3 37 ? -23.292 -10.790 -4.849  1.00 1.95  ? 37 TYR D C      1  
ATOM 4949  O O      . TYR F 3 37 ? -22.624 -10.296 -3.941  1.00 1.94  ? 37 TYR D O      1  
ATOM 4950  C CB     . TYR F 3 37 ? -22.665 -11.410 -7.218  1.00 1.95  ? 37 TYR D CB     1  
ATOM 4951  C CG     . TYR F 3 37 ? -23.744 -12.411 -7.587  1.00 1.98  ? 37 TYR D CG     1  
ATOM 4952  C CD1    . TYR F 3 37 ? -24.879 -12.013 -8.281  1.00 2.05  ? 37 TYR D CD1    1  
ATOM 4953  C CD2    . TYR F 3 37 ? -23.622 -13.752 -7.245  1.00 2.00  ? 37 TYR D CD2    1  
ATOM 4954  C CE1    . TYR F 3 37 ? -25.862 -12.921 -8.625  1.00 2.12  ? 37 TYR D CE1    1  
ATOM 4955  C CE2    . TYR F 3 37 ? -24.602 -14.667 -7.585  1.00 2.08  ? 37 TYR D CE2    1  
ATOM 4956  C CZ     . TYR F 3 37 ? -25.719 -14.247 -8.275  1.00 2.13  ? 37 TYR D CZ     1  
ATOM 4957  O OH     . TYR F 3 37 ? -26.697 -15.155 -8.619  1.00 2.24  ? 37 TYR D OH     1  
ATOM 4958  H H      . TYR F 3 37 ? -21.250 -9.376  -5.988  1.00 1.98  ? 37 TYR D H      1  
ATOM 4959  H HA     . TYR F 3 37 ? -24.081 -9.899  -6.628  1.00 2.01  ? 37 TYR D HA     1  
ATOM 4960  H HB2    . TYR F 3 37 ? -22.297 -10.973 -8.133  1.00 1.94  ? 37 TYR D HB2    1  
ATOM 4961  H HB3    . TYR F 3 37 ? -21.861 -11.952 -6.741  1.00 1.94  ? 37 TYR D HB3    1  
ATOM 4962  H HD1    . TYR F 3 37 ? -24.990 -10.974 -8.554  1.00 2.07  ? 37 TYR D HD1    1  
ATOM 4963  H HD2    . TYR F 3 37 ? -22.746 -14.078 -6.704  1.00 2.00  ? 37 TYR D HD2    1  
ATOM 4964  H HE1    . TYR F 3 37 ? -26.737 -12.590 -9.165  1.00 2.21  ? 37 TYR D HE1    1  
ATOM 4965  H HE2    . TYR F 3 37 ? -24.489 -15.705 -7.309  1.00 2.12  ? 37 TYR D HE2    1  
ATOM 4966  H HH     . TYR F 3 37 ? -26.802 -15.161 -9.581  1.00 2.08  ? 37 TYR D HH     1  
ATOM 4967  N N      . VAL F 3 38 ? -24.166 -11.758 -4.638  1.00 1.99  ? 38 VAL D N      1  
ATOM 4968  C CA     . VAL F 3 38 ? -24.388 -12.296 -3.306  1.00 2.00  ? 38 VAL D CA     1  
ATOM 4969  C C      . VAL F 3 38 ? -24.614 -13.801 -3.362  1.00 1.98  ? 38 VAL D C      1  
ATOM 4970  O O      . VAL F 3 38 ? -25.269 -14.308 -4.272  1.00 1.99  ? 38 VAL D O      1  
ATOM 4971  C CB     . VAL F 3 38 ? -25.593 -11.607 -2.615  1.00 2.06  ? 38 VAL D CB     1  
ATOM 4972  C CG1    . VAL F 3 38 ? -26.834 -11.683 -3.483  1.00 2.14  ? 38 VAL D CG1    1  
ATOM 4973  C CG2    . VAL F 3 38 ? -25.864 -12.203 -1.239  1.00 2.03  ? 38 VAL D CG2    1  
ATOM 4974  H H      . VAL F 3 38 ? -24.668 -12.130 -5.392  1.00 2.05  ? 38 VAL D H      1  
ATOM 4975  H HA     . VAL F 3 38 ? -23.505 -12.101 -2.717  1.00 1.98  ? 38 VAL D HA     1  
ATOM 4976  H HB     . VAL F 3 38 ? -25.348 -10.564 -2.484  1.00 2.10  ? 38 VAL D HB     1  
ATOM 4977  H HG11   . VAL F 3 38 ? -27.013 -12.710 -3.766  1.00 2.15  ? 38 VAL D HG11   1  
ATOM 4978  H HG12   . VAL F 3 38 ? -26.686 -11.085 -4.370  1.00 2.19  ? 38 VAL D HG12   1  
ATOM 4979  H HG13   . VAL F 3 38 ? -27.683 -11.307 -2.931  1.00 2.17  ? 38 VAL D HG13   1  
ATOM 4980  H HG21   . VAL F 3 38 ? -26.100 -13.253 -1.341  1.00 2.10  ? 38 VAL D HG21   1  
ATOM 4981  H HG22   . VAL F 3 38 ? -26.696 -11.690 -0.780  1.00 2.19  ? 38 VAL D HG22   1  
ATOM 4982  H HG23   . VAL F 3 38 ? -24.986 -12.091 -0.619  1.00 2.16  ? 38 VAL D HG23   1  
ATOM 4983  N N      . ASP F 3 39 ? -24.026 -14.503 -2.408  1.00 1.97  ? 39 ASP D N      1  
ATOM 4984  C CA     . ASP F 3 39 ? -24.181 -15.945 -2.305  1.00 1.97  ? 39 ASP D CA     1  
ATOM 4985  C C      . ASP F 3 39 ? -24.805 -16.266 -0.960  1.00 1.99  ? 39 ASP D C      1  
ATOM 4986  O O      . ASP F 3 39 ? -24.132 -16.198 0.068   1.00 1.97  ? 39 ASP D O      1  
ATOM 4987  C CB     . ASP F 3 39 ? -22.836 -16.668 -2.454  1.00 1.92  ? 39 ASP D CB     1  
ATOM 4988  C CG     . ASP F 3 39 ? -22.986 -18.180 -2.459  1.00 1.92  ? 39 ASP D CG     1  
ATOM 4989  O OD1    . ASP F 3 39 ? -23.209 -18.756 -3.546  1.00 1.92  ? 39 ASP D OD1    1  
ATOM 4990  O OD2    . ASP F 3 39 ? -22.886 -18.803 -1.382  1.00 1.95  ? 39 ASP D OD2    1  
ATOM 4991  H H      . ASP F 3 39 ? -23.475 -14.034 -1.742  1.00 1.99  ? 39 ASP D H      1  
ATOM 4992  H HA     . ASP F 3 39 ? -24.850 -16.264 -3.089  1.00 2.00  ? 39 ASP D HA     1  
ATOM 4993  H HB2    . ASP F 3 39 ? -22.375 -16.368 -3.383  1.00 1.90  ? 39 ASP D HB2    1  
ATOM 4994  H HB3    . ASP F 3 39 ? -22.191 -16.391 -1.632  1.00 1.93  ? 39 ASP D HB3    1  
ATOM 4995  N N      . ASP F 3 40 ? -26.099 -16.559 -0.969  1.00 2.07  ? 40 ASP D N      1  
ATOM 4996  C CA     . ASP F 3 40 ? -26.843 -16.874 0.251   1.00 2.12  ? 40 ASP D CA     1  
ATOM 4997  C C      . ASP F 3 40 ? -26.985 -15.621 1.115   1.00 2.16  ? 40 ASP D C      1  
ATOM 4998  O O      . ASP F 3 40 ? -27.981 -14.904 1.020   1.00 2.23  ? 40 ASP D O      1  
ATOM 4999  C CB     . ASP F 3 40 ? -26.169 -17.991 1.056   1.00 2.08  ? 40 ASP D CB     1  
ATOM 5000  C CG     . ASP F 3 40 ? -26.340 -19.361 0.436   1.00 2.48  ? 40 ASP D CG     1  
ATOM 5001  O OD1    . ASP F 3 40 ? -26.988 -19.470 -0.627  1.00 2.76  ? 40 ASP D OD1    1  
ATOM 5002  O OD2    . ASP F 3 40 ? -25.821 -20.342 1.014   1.00 2.75  ? 40 ASP D OD2    1  
ATOM 5003  H H      . ASP F 3 40 ? -26.582 -16.547 -1.827  1.00 2.11  ? 40 ASP D H      1  
ATOM 5004  H HA     . ASP F 3 40 ? -27.828 -17.202 -0.043  1.00 2.19  ? 40 ASP D HA     1  
ATOM 5005  H HB2    . ASP F 3 40 ? -25.111 -17.784 1.128   1.00 2.04  ? 40 ASP D HB2    1  
ATOM 5006  H HB3    . ASP F 3 40 ? -26.592 -18.010 2.049   1.00 2.13  ? 40 ASP D HB3    1  
ATOM 5007  N N      . GLU F 3 41 ? -25.980 -15.357 1.950   1.00 2.13  ? 41 GLU D N      1  
ATOM 5008  C CA     . GLU F 3 41 ? -25.983 -14.183 2.820   1.00 2.18  ? 41 GLU D CA     1  
ATOM 5009  C C      . GLU F 3 41 ? -24.598 -13.532 2.848   1.00 2.09  ? 41 GLU D C      1  
ATOM 5010  O O      . GLU F 3 41 ? -24.295 -12.740 3.741   1.00 2.11  ? 41 GLU D O      1  
ATOM 5011  C CB     . GLU F 3 41 ? -26.393 -14.551 4.253   1.00 2.27  ? 41 GLU D CB     1  
ATOM 5012  C CG     . GLU F 3 41 ? -27.814 -15.067 4.395   1.00 2.34  ? 41 GLU D CG     1  
ATOM 5013  C CD     . GLU F 3 41 ? -28.153 -15.397 5.834   1.00 2.23  ? 41 GLU D CD     1  
ATOM 5014  O OE1    . GLU F 3 41 ? -27.276 -15.931 6.548   1.00 2.32  ? 41 GLU D OE1    1  
ATOM 5015  O OE2    . GLU F 3 41 ? -29.288 -15.116 6.270   1.00 2.35  ? 41 GLU D OE2    1  
ATOM 5016  H H      . GLU F 3 41 ? -25.213 -15.968 1.979   1.00 2.09  ? 41 GLU D H      1  
ATOM 5017  H HA     . GLU F 3 41 ? -26.696 -13.475 2.422   1.00 2.24  ? 41 GLU D HA     1  
ATOM 5018  H HB2    . GLU F 3 41 ? -25.724 -15.313 4.621   1.00 2.39  ? 41 GLU D HB2    1  
ATOM 5019  H HB3    . GLU F 3 41 ? -26.292 -13.673 4.877   1.00 2.33  ? 41 GLU D HB3    1  
ATOM 5020  H HG2    . GLU F 3 41 ? -28.497 -14.309 4.042   1.00 2.42  ? 41 GLU D HG2    1  
ATOM 5021  H HG3    . GLU F 3 41 ? -27.923 -15.959 3.798   1.00 2.75  ? 41 GLU D HG3    1  
ATOM 5022  N N      . LYS F 3 42 ? -23.754 -13.876 1.880   1.00 2.03  ? 42 LYS D N      1  
ATOM 5023  C CA     . LYS F 3 42 ? -22.402 -13.319 1.815   1.00 1.96  ? 42 LYS D CA     1  
ATOM 5024  C C      . LYS F 3 42 ? -22.226 -12.476 0.553   1.00 1.94  ? 42 LYS D C      1  
ATOM 5025  O O      . LYS F 3 42 ? -22.836 -12.757 -0.480  1.00 1.97  ? 42 LYS D O      1  
ATOM 5026  C CB     . LYS F 3 42 ? -21.352 -14.440 1.867   1.00 1.94  ? 42 LYS D CB     1  
ATOM 5027  C CG     . LYS F 3 42 ? -21.217 -15.218 0.568   1.00 1.96  ? 42 LYS D CG     1  
ATOM 5028  C CD     . LYS F 3 42 ? -20.741 -16.647 0.799   1.00 2.01  ? 42 LYS D CD     1  
ATOM 5029  C CE     . LYS F 3 42 ? -21.780 -17.472 1.542   1.00 2.29  ? 42 LYS D CE     1  
ATOM 5030  N NZ     . LYS F 3 42 ? -21.817 -18.880 1.068   1.00 2.34  ? 42 LYS D NZ     1  
ATOM 5031  H H      . LYS F 3 42 ? -24.046 -14.511 1.191   1.00 2.05  ? 42 LYS D H      1  
ATOM 5032  H HA     . LYS F 3 42 ? -22.272 -12.680 2.676   1.00 1.98  ? 42 LYS D HA     1  
ATOM 5033  H HB2    . LYS F 3 42 ? -20.391 -14.006 2.101   1.00 1.89  ? 42 LYS D HB2    1  
ATOM 5034  H HB3    . LYS F 3 42 ? -21.622 -15.133 2.649   1.00 1.98  ? 42 LYS D HB3    1  
ATOM 5035  H HG2    . LYS F 3 42 ? -22.180 -15.247 0.080   1.00 2.04  ? 42 LYS D HG2    1  
ATOM 5036  H HG3    . LYS F 3 42 ? -20.507 -14.710 -0.066  1.00 1.93  ? 42 LYS D HG3    1  
ATOM 5037  H HD2    . LYS F 3 42 ? -20.547 -17.110 -0.156  1.00 2.11  ? 42 LYS D HD2    1  
ATOM 5038  H HD3    . LYS F 3 42 ? -19.829 -16.625 1.380   1.00 2.19  ? 42 LYS D HD3    1  
ATOM 5039  H HE2    . LYS F 3 42 ? -21.546 -17.463 2.596   1.00 2.53  ? 42 LYS D HE2    1  
ATOM 5040  H HE3    . LYS F 3 42 ? -22.751 -17.025 1.386   1.00 2.68  ? 42 LYS D HE3    1  
ATOM 5041  H HZ1    . LYS F 3 42 ? -20.861 -19.290 1.081   1.00 2.48  ? 42 LYS D HZ1    1  
ATOM 5042  H HZ2    . LYS F 3 42 ? -22.189 -18.921 0.090   1.00 2.65  ? 42 LYS D HZ2    1  
ATOM 5043  H HZ3    . LYS F 3 42 ? -22.434 -19.448 1.684   1.00 2.55  ? 42 LYS D HZ3    1  
ATOM 5044  N N      . ILE F 3 43 ? -21.387 -11.452 0.642   1.00 1.90  ? 43 ILE D N      1  
ATOM 5045  C CA     . ILE F 3 43 ? -21.143 -10.561 -0.483  1.00 1.90  ? 43 ILE D CA     1  
ATOM 5046  C C      . ILE F 3 43 ? -20.055 -11.114 -1.390  1.00 1.89  ? 43 ILE D C      1  
ATOM 5047  O O      . ILE F 3 43 ? -18.939 -11.388 -0.944  1.00 1.91  ? 43 ILE D O      1  
ATOM 5048  C CB     . ILE F 3 43 ? -20.729 -9.150  -0.021  1.00 1.90  ? 43 ILE D CB     1  
ATOM 5049  C CG1    . ILE F 3 43 ? -21.589 -8.693  1.160   1.00 1.91  ? 43 ILE D CG1    1  
ATOM 5050  C CG2    . ILE F 3 43 ? -20.837 -8.164  -1.176  1.00 1.99  ? 43 ILE D CG2    1  
ATOM 5051  C CD1    . ILE F 3 43 ? -21.047 -7.470  1.869   1.00 1.97  ? 43 ILE D CD1    1  
ATOM 5052  H H      . ILE F 3 43 ? -20.902 -11.302 1.484   1.00 1.89  ? 43 ILE D H      1  
ATOM 5053  H HA     . ILE F 3 43 ? -22.060 -10.478 -1.048  1.00 1.93  ? 43 ILE D HA     1  
ATOM 5054  H HB     . ILE F 3 43 ? -19.698 -9.188  0.286   1.00 1.88  ? 43 ILE D HB     1  
ATOM 5055  H HG12   . ILE F 3 43 ? -22.582 -8.457  0.807   1.00 1.98  ? 43 ILE D HG12   1  
ATOM 5056  H HG13   . ILE F 3 43 ? -21.650 -9.496  1.880   1.00 1.95  ? 43 ILE D HG13   1  
ATOM 5057  H HG21   . ILE F 3 43 ? -21.811 -8.253  -1.636  1.00 1.93  ? 43 ILE D HG21   1  
ATOM 5058  H HG22   . ILE F 3 43 ? -20.072 -8.381  -1.905  1.00 2.14  ? 43 ILE D HG22   1  
ATOM 5059  H HG23   . ILE F 3 43 ? -20.704 -7.159  -0.804  1.00 2.33  ? 43 ILE D HG23   1  
ATOM 5060  H HD11   . ILE F 3 43 ? -21.775 -7.112  2.580   1.00 2.10  ? 43 ILE D HD11   1  
ATOM 5061  H HD12   . ILE F 3 43 ? -20.842 -6.695  1.145   1.00 2.09  ? 43 ILE D HD12   1  
ATOM 5062  H HD13   . ILE F 3 43 ? -20.135 -7.730  2.386   1.00 2.45  ? 43 ILE D HD13   1  
ATOM 5063  N N      . ILE F 3 44 ? -20.393 -11.284 -2.656  1.00 1.87  ? 44 ILE D N      1  
ATOM 5064  C CA     . ILE F 3 44 ? -19.451 -11.786 -3.642  1.00 1.88  ? 44 ILE D CA     1  
ATOM 5065  C C      . ILE F 3 44 ? -18.955 -10.634 -4.503  1.00 1.88  ? 44 ILE D C      1  
ATOM 5066  O O      . ILE F 3 44 ? -19.676 -10.134 -5.369  1.00 1.91  ? 44 ILE D O      1  
ATOM 5067  C CB     . ILE F 3 44 ? -20.086 -12.869 -4.545  1.00 1.93  ? 44 ILE D CB     1  
ATOM 5068  C CG1    . ILE F 3 44 ? -20.582 -14.050 -3.705  1.00 1.97  ? 44 ILE D CG1    1  
ATOM 5069  C CG2    . ILE F 3 44 ? -19.094 -13.345 -5.601  1.00 1.96  ? 44 ILE D CG2    1  
ATOM 5070  C CD1    . ILE F 3 44 ? -19.499 -14.711 -2.879  1.00 2.00  ? 44 ILE D CD1    1  
ATOM 5071  H H      . ILE F 3 44 ? -21.304 -11.052 -2.942  1.00 1.87  ? 44 ILE D H      1  
ATOM 5072  H HA     . ILE F 3 44 ? -18.615 -12.221 -3.117  1.00 1.87  ? 44 ILE D HA     1  
ATOM 5073  H HB     . ILE F 3 44 ? -20.928 -12.426 -5.054  1.00 1.94  ? 44 ILE D HB     1  
ATOM 5074  H HG12   . ILE F 3 44 ? -21.348 -13.704 -3.027  1.00 1.97  ? 44 ILE D HG12   1  
ATOM 5075  H HG13   . ILE F 3 44 ? -21.003 -14.799 -4.361  1.00 2.02  ? 44 ILE D HG13   1  
ATOM 5076  H HG21   . ILE F 3 44 ? -19.568 -14.075 -6.239  1.00 2.06  ? 44 ILE D HG21   1  
ATOM 5077  H HG22   . ILE F 3 44 ? -18.240 -13.792 -5.115  1.00 2.16  ? 44 ILE D HG22   1  
ATOM 5078  H HG23   . ILE F 3 44 ? -18.771 -12.504 -6.196  1.00 2.24  ? 44 ILE D HG23   1  
ATOM 5079  H HD11   . ILE F 3 44 ? -19.893 -15.602 -2.416  1.00 2.06  ? 44 ILE D HD11   1  
ATOM 5080  H HD12   . ILE F 3 44 ? -19.161 -14.026 -2.115  1.00 2.35  ? 44 ILE D HD12   1  
ATOM 5081  H HD13   . ILE F 3 44 ? -18.670 -14.974 -3.518  1.00 2.28  ? 44 ILE D HD13   1  
ATOM 5082  N N      . LEU F 3 45 ? -17.733 -10.206 -4.255  1.00 1.86  ? 45 LEU D N      1  
ATOM 5083  C CA     . LEU F 3 45 ? -17.152 -9.104  -5.001  1.00 1.88  ? 45 LEU D CA     1  
ATOM 5084  C C      . LEU F 3 45 ? -16.303 -9.621  -6.153  1.00 1.90  ? 45 LEU D C      1  
ATOM 5085  O O      . LEU F 3 45 ? -15.330 -10.349 -5.947  1.00 1.88  ? 45 LEU D O      1  
ATOM 5086  C CB     . LEU F 3 45 ? -16.306 -8.217  -4.081  1.00 1.89  ? 45 LEU D CB     1  
ATOM 5087  C CG     . LEU F 3 45 ? -16.820 -6.785  -3.892  1.00 2.30  ? 45 LEU D CG     1  
ATOM 5088  C CD1    . LEU F 3 45 ? -15.874 -5.992  -3.003  1.00 2.77  ? 45 LEU D CD1    1  
ATOM 5089  C CD2    . LEU F 3 45 ? -16.990 -6.090  -5.237  1.00 2.35  ? 45 LEU D CD2    1  
ATOM 5090  H H      . LEU F 3 45 ? -17.196 -10.656 -3.561  1.00 1.86  ? 45 LEU D H      1  
ATOM 5091  H HA     . LEU F 3 45 ? -17.962 -8.517  -5.405  1.00 1.90  ? 45 LEU D HA     1  
ATOM 5092  H HB2    . LEU F 3 45 ? -16.258 -8.690  -3.109  1.00 1.80  ? 45 LEU D HB2    1  
ATOM 5093  H HB3    . LEU F 3 45 ? -15.308 -8.166  -4.486  1.00 2.02  ? 45 LEU D HB3    1  
ATOM 5094  H HG     . LEU F 3 45 ? -17.785 -6.816  -3.404  1.00 2.73  ? 45 LEU D HG     1  
ATOM 5095  H HD11   . LEU F 3 45 ? -14.882 -6.013  -3.427  1.00 2.83  ? 45 LEU D HD11   1  
ATOM 5096  H HD12   . LEU F 3 45 ? -15.854 -6.431  -2.015  1.00 3.08  ? 45 LEU D HD12   1  
ATOM 5097  H HD13   . LEU F 3 45 ? -16.214 -4.969  -2.936  1.00 3.29  ? 45 LEU D HD13   1  
ATOM 5098  H HD21   . LEU F 3 45 ? -17.041 -5.021  -5.086  1.00 2.62  ? 45 LEU D HD21   1  
ATOM 5099  H HD22   . LEU F 3 45 ? -17.902 -6.430  -5.706  1.00 2.54  ? 45 LEU D HD22   1  
ATOM 5100  H HD23   . LEU F 3 45 ? -16.149 -6.323  -5.873  1.00 2.50  ? 45 LEU D HD23   1  
ATOM 5101  N N      . LYS F 3 46 ? -16.690 -9.264  -7.365  1.00 1.97  ? 46 LYS D N      1  
ATOM 5102  C CA     . LYS F 3 46 ? -15.957 -9.674  -8.550  1.00 2.01  ? 46 LYS D CA     1  
ATOM 5103  C C      . LYS F 3 46 ? -15.266 -8.470  -9.172  1.00 2.02  ? 46 LYS D C      1  
ATOM 5104  O O      . LYS F 3 46 ? -15.833 -7.375  -9.218  1.00 1.98  ? 46 LYS D O      1  
ATOM 5105  C CB     . LYS F 3 46 ? -16.897 -10.332 -9.559  1.00 2.07  ? 46 LYS D CB     1  
ATOM 5106  C CG     . LYS F 3 46 ? -17.458 -11.661 -9.083  1.00 2.16  ? 46 LYS D CG     1  
ATOM 5107  C CD     . LYS F 3 46 ? -18.698 -12.054 -9.869  1.00 2.21  ? 46 LYS D CD     1  
ATOM 5108  C CE     . LYS F 3 46 ? -18.376 -12.374 -11.320 1.00 2.28  ? 46 LYS D CE     1  
ATOM 5109  N NZ     . LYS F 3 46 ? -19.609 -12.566 -12.126 1.00 2.36  ? 46 LYS D NZ     1  
ATOM 5110  H H      . LYS F 3 46 ? -17.494 -8.705  -7.469  1.00 2.02  ? 46 LYS D H      1  
ATOM 5111  H HA     . LYS F 3 46 ? -15.206 -10.389 -8.250  1.00 2.01  ? 46 LYS D HA     1  
ATOM 5112  H HB2    . LYS F 3 46 ? -17.723 -9.666  -9.753  1.00 2.02  ? 46 LYS D HB2    1  
ATOM 5113  H HB3    . LYS F 3 46 ? -16.358 -10.502 -10.478 1.00 2.15  ? 46 LYS D HB3    1  
ATOM 5114  H HG2    . LYS F 3 46 ? -16.705 -12.425 -9.210  1.00 2.24  ? 46 LYS D HG2    1  
ATOM 5115  H HG3    . LYS F 3 46 ? -17.717 -11.578 -8.037  1.00 2.13  ? 46 LYS D HG3    1  
ATOM 5116  H HD2    . LYS F 3 46 ? -19.140 -12.924 -9.411  1.00 2.27  ? 46 LYS D HD2    1  
ATOM 5117  H HD3    . LYS F 3 46 ? -19.401 -11.234 -9.841  1.00 2.17  ? 46 LYS D HD3    1  
ATOM 5118  H HE2    . LYS F 3 46 ? -17.807 -11.557 -11.737 1.00 2.23  ? 46 LYS D HE2    1  
ATOM 5119  H HE3    . LYS F 3 46 ? -17.785 -13.278 -11.356 1.00 2.35  ? 46 LYS D HE3    1  
ATOM 5120  H HZ1    . LYS F 3 46 ? -19.365 -12.708 -13.126 1.00 2.33  ? 46 LYS D HZ1    1  
ATOM 5121  H HZ2    . LYS F 3 46 ? -20.224 -11.723 -12.046 1.00 2.63  ? 46 LYS D HZ2    1  
ATOM 5122  H HZ3    . LYS F 3 46 ? -20.137 -13.399 -11.786 1.00 2.33  ? 46 LYS D HZ3    1  
ATOM 5123  N N      . LYS F 3 47 ? -14.041 -8.673  -9.640  1.00 2.14  ? 47 LYS D N      1  
ATOM 5124  C CA     . LYS F 3 47 ? -13.267 -7.601  -10.247 1.00 2.20  ? 47 LYS D CA     1  
ATOM 5125  C C      . LYS F 3 47 ? -13.883 -7.148  -11.569 1.00 2.19  ? 47 LYS D C      1  
ATOM 5126  O O      . LYS F 3 47 ? -14.871 -7.720  -12.041 1.00 2.31  ? 47 LYS D O      1  
ATOM 5127  C CB     . LYS F 3 47 ? -11.819 -8.056  -10.467 1.00 2.23  ? 47 LYS D CB     1  
ATOM 5128  C CG     . LYS F 3 47 ? -11.659 -9.102  -11.563 1.00 2.36  ? 47 LYS D CG     1  
ATOM 5129  C CD     . LYS F 3 47 ? -10.225 -9.603  -11.663 1.00 2.60  ? 47 LYS D CD     1  
ATOM 5130  C CE     . LYS F 3 47 ? -9.806  -9.820  -13.113 1.00 2.72  ? 47 LYS D CE     1  
ATOM 5131  N NZ     . LYS F 3 47 ? -8.561  -10.629 -13.219 1.00 2.99  ? 47 LYS D NZ     1  
ATOM 5132  H H      . LYS F 3 47 ? -13.646 -9.565  -9.571  1.00 2.23  ? 47 LYS D H      1  
ATOM 5133  H HA     . LYS F 3 47 ? -13.270 -6.769  -9.561  1.00 2.33  ? 47 LYS D HA     1  
ATOM 5134  H HB2    . LYS F 3 47 ? -11.222 -7.197  -10.731 1.00 2.40  ? 47 LYS D HB2    1  
ATOM 5135  H HB3    . LYS F 3 47 ? -11.443 -8.473  -9.544  1.00 2.29  ? 47 LYS D HB3    1  
ATOM 5136  H HG2    . LYS F 3 47 ? -12.304 -9.939  -11.344 1.00 2.31  ? 47 LYS D HG2    1  
ATOM 5137  H HG3    . LYS F 3 47 ? -11.945 -8.664  -12.507 1.00 2.75  ? 47 LYS D HG3    1  
ATOM 5138  H HD2    . LYS F 3 47 ? -9.566  -8.876  -11.213 1.00 3.24  ? 47 LYS D HD2    1  
ATOM 5139  H HD3    . LYS F 3 47 ? -10.144 -10.541 -11.131 1.00 2.68  ? 47 LYS D HD3    1  
ATOM 5140  H HE2    . LYS F 3 47 ? -10.602 -10.332 -13.634 1.00 2.87  ? 47 LYS D HE2    1  
ATOM 5141  H HE3    . LYS F 3 47 ? -9.638  -8.857  -13.573 1.00 3.14  ? 47 LYS D HE3    1  
ATOM 5142  H HZ1    . LYS F 3 47 ? -8.744  -11.615 -12.923 1.00 3.15  ? 47 LYS D HZ1    1  
ATOM 5143  H HZ2    . LYS F 3 47 ? -7.820  -10.226 -12.609 1.00 3.09  ? 47 LYS D HZ2    1  
ATOM 5144  H HZ3    . LYS F 3 47 ? -8.216  -10.630 -14.199 1.00 3.50  ? 47 LYS D HZ3    1  
ATOM 5145  N N      . TYR F 3 48 ? -13.293 -6.117  -12.157 1.00 2.32  ? 48 TYR D N      1  
ATOM 5146  C CA     . TYR F 3 48 ? -13.759 -5.580  -13.429 1.00 2.42  ? 48 TYR D CA     1  
ATOM 5147  C C      . TYR F 3 48 ? -13.651 -6.636  -14.528 1.00 2.32  ? 48 TYR D C      1  
ATOM 5148  O O      . TYR F 3 48 ? -12.846 -7.568  -14.434 1.00 2.31  ? 48 TYR D O      1  
ATOM 5149  C CB     . TYR F 3 48 ? -12.943 -4.338  -13.815 1.00 2.68  ? 48 TYR D CB     1  
ATOM 5150  C CG     . TYR F 3 48 ? -11.507 -4.635  -14.202 1.00 2.65  ? 48 TYR D CG     1  
ATOM 5151  C CD1    . TYR F 3 48 ? -10.577 -5.032  -13.249 1.00 2.58  ? 48 TYR D CD1    1  
ATOM 5152  C CD2    . TYR F 3 48 ? -11.083 -4.518  -15.520 1.00 2.88  ? 48 TYR D CD2    1  
ATOM 5153  C CE1    . TYR F 3 48 ? -9.269  -5.306  -13.597 1.00 2.75  ? 48 TYR D CE1    1  
ATOM 5154  C CE2    . TYR F 3 48 ? -9.776  -4.790  -15.876 1.00 3.03  ? 48 TYR D CE2    1  
ATOM 5155  C CZ     . TYR F 3 48 ? -8.873  -5.184  -14.910 1.00 2.96  ? 48 TYR D CZ     1  
ATOM 5156  O OH     . TYR F 3 48 ? -7.572  -5.466  -15.260 1.00 3.26  ? 48 TYR D OH     1  
ATOM 5157  H H      . TYR F 3 48 ? -12.526 -5.698  -11.719 1.00 2.52  ? 48 TYR D H      1  
ATOM 5158  H HA     . TYR F 3 48 ? -14.796 -5.300  -13.312 1.00 2.54  ? 48 TYR D HA     1  
ATOM 5159  H HB2    . TYR F 3 48 ? -13.419 -3.852  -14.653 1.00 2.89  ? 48 TYR D HB2    1  
ATOM 5160  H HB3    . TYR F 3 48 ? -12.926 -3.657  -12.976 1.00 2.84  ? 48 TYR D HB3    1  
ATOM 5161  H HD1    . TYR F 3 48 ? -10.889 -5.127  -12.220 1.00 2.53  ? 48 TYR D HD1    1  
ATOM 5162  H HD2    . TYR F 3 48 ? -11.793 -4.209  -16.274 1.00 3.06  ? 48 TYR D HD2    1  
ATOM 5163  H HE1    . TYR F 3 48 ? -8.563  -5.613  -12.839 1.00 2.83  ? 48 TYR D HE1    1  
ATOM 5164  H HE2    . TYR F 3 48 ? -9.466  -4.692  -16.905 1.00 3.29  ? 48 TYR D HE2    1  
ATOM 5165  H HH     . TYR F 3 48 ? -7.201  -4.720  -15.746 1.00 3.39  ? 48 TYR D HH     1  
ATOM 5166  N N      . LYS F 3 49 ? -14.471 -6.502  -15.555 1.00 2.43  ? 49 LYS D N      1  
ATOM 5167  C CA     . LYS F 3 49 ? -14.451 -7.435  -16.668 1.00 2.54  ? 49 LYS D CA     1  
ATOM 5168  C C      . LYS F 3 49 ? -13.529 -6.910  -17.761 1.00 2.74  ? 49 LYS D C      1  
ATOM 5169  O O      . LYS F 3 49 ? -13.858 -5.936  -18.438 1.00 2.90  ? 49 LYS D O      1  
ATOM 5170  C CB     . LYS F 3 49 ? -15.866 -7.646  -17.214 1.00 2.77  ? 49 LYS D CB     1  
ATOM 5171  C CG     . LYS F 3 49 ? -15.945 -8.670  -18.333 1.00 3.43  ? 49 LYS D CG     1  
ATOM 5172  C CD     . LYS F 3 49 ? -15.712 -10.083 -17.820 1.00 3.61  ? 49 LYS D CD     1  
ATOM 5173  C CE     . LYS F 3 49 ? -15.643 -11.088 -18.960 1.00 4.50  ? 49 LYS D CE     1  
ATOM 5174  N NZ     . LYS F 3 49 ? -16.916 -11.162 -19.724 1.00 5.03  ? 49 LYS D NZ     1  
ATOM 5175  H H      . LYS F 3 49 ? -15.104 -5.753  -15.569 1.00 2.55  ? 49 LYS D H      1  
ATOM 5176  H HA     . LYS F 3 49 ? -14.066 -8.378  -16.310 1.00 2.55  ? 49 LYS D HA     1  
ATOM 5177  H HB2    . LYS F 3 49 ? -16.504 -7.980  -16.409 1.00 2.96  ? 49 LYS D HB2    1  
ATOM 5178  H HB3    . LYS F 3 49 ? -16.236 -6.704  -17.588 1.00 2.89  ? 49 LYS D HB3    1  
ATOM 5179  H HG2    . LYS F 3 49 ? -16.924 -8.619  -18.784 1.00 3.74  ? 49 LYS D HG2    1  
ATOM 5180  H HG3    . LYS F 3 49 ? -15.195 -8.435  -19.073 1.00 4.02  ? 49 LYS D HG3    1  
ATOM 5181  H HD2    . LYS F 3 49 ? -14.780 -10.107 -17.276 1.00 3.72  ? 49 LYS D HD2    1  
ATOM 5182  H HD3    . LYS F 3 49 ? -16.522 -10.354 -17.157 1.00 3.52  ? 49 LYS D HD3    1  
ATOM 5183  H HE2    . LYS F 3 49 ? -14.852 -10.793 -19.634 1.00 4.99  ? 49 LYS D HE2    1  
ATOM 5184  H HE3    . LYS F 3 49 ? -15.421 -12.062 -18.551 1.00 4.71  ? 49 LYS D HE3    1  
ATOM 5185  H HZ1    . LYS F 3 49 ? -16.991 -10.352 -20.375 1.00 5.45  ? 49 LYS D HZ1    1  
ATOM 5186  H HZ2    . LYS F 3 49 ? -17.726 -11.148 -19.076 1.00 5.25  ? 49 LYS D HZ2    1  
ATOM 5187  H HZ3    . LYS F 3 49 ? -16.946 -12.043 -20.281 1.00 5.18  ? 49 LYS D HZ3    1  
ATOM 5188  N N      . PRO F 3 50 ? -12.352 -7.534  -17.931 1.00 2.97  ? 50 PRO D N      1  
ATOM 5189  C CA     . PRO F 3 50 ? -11.384 -7.118  -18.947 1.00 3.37  ? 50 PRO D CA     1  
ATOM 5190  C C      . PRO F 3 50 ? -11.972 -7.185  -20.352 1.00 3.52  ? 50 PRO D C      1  
ATOM 5191  O O      . PRO F 3 50 ? -12.119 -6.160  -21.017 1.00 3.73  ? 50 PRO D O      1  
ATOM 5192  C CB     . PRO F 3 50 ? -10.236 -8.119  -18.795 1.00 3.70  ? 50 PRO D CB     1  
ATOM 5193  C CG     . PRO F 3 50 ? -10.394 -8.685  -17.425 1.00 3.68  ? 50 PRO D CG     1  
ATOM 5194  C CD     . PRO F 3 50 ? -11.872 -8.689  -17.153 1.00 3.11  ? 50 PRO D CD     1  
ATOM 5195  H HA     . PRO F 3 50 ? -11.019 -6.117  -18.760 1.00 3.54  ? 50 PRO D HA     1  
ATOM 5196  H HB2    . PRO F 3 50 ? -10.325 -8.886  -19.552 1.00 3.92  ? 50 PRO D HB2    1  
ATOM 5197  H HB3    . PRO F 3 50 ? -9.293  -7.607  -18.903 1.00 3.92  ? 50 PRO D HB3    1  
ATOM 5198  H HG2    . PRO F 3 50 ? -10.003 -9.690  -17.396 1.00 3.95  ? 50 PRO D HG2    1  
ATOM 5199  H HG3    . PRO F 3 50 ? -9.882  -8.061  -16.706 1.00 3.95  ? 50 PRO D HG3    1  
ATOM 5200  H HD2    . PRO F 3 50 ? -12.321 -9.606  -17.505 1.00 3.11  ? 50 PRO D HD2    1  
ATOM 5201  H HD3    . PRO F 3 50 ? -12.065 -8.554  -16.097 1.00 3.01  ? 50 PRO D HD3    1  
ATOM 5202  N N      . ASN F 3 51 ? -12.313 -8.401  -20.792 1.00 3.54  ? 51 ASN D N      1  
ATOM 5203  C CA     . ASN F 3 51 ? -12.895 -8.631  -22.122 1.00 3.82  ? 51 ASN D CA     1  
ATOM 5204  C C      . ASN F 3 51 ? -11.959 -8.126  -23.220 1.00 4.05  ? 51 ASN D C      1  
ATOM 5205  O O      . ASN F 3 51 ? -12.382 -7.861  -24.347 1.00 4.51  ? 51 ASN D O      1  
ATOM 5206  C CB     . ASN F 3 51 ? -14.262 -7.946  -22.240 1.00 3.94  ? 51 ASN D CB     1  
ATOM 5207  C CG     . ASN F 3 51 ? -15.340 -8.881  -22.755 1.00 4.25  ? 51 ASN D CG     1  
ATOM 5208  O OD1    . ASN F 3 51 ? -15.883 -9.692  -22.005 1.00 4.62  ? 51 ASN D OD1    1  
ATOM 5209  N ND2    . ASN F 3 51 ? -15.670 -8.767  -24.029 1.00 4.36  ? 51 ASN D ND2    1  
ATOM 5210  H H      . ASN F 3 51 ? -12.165 -9.173  -20.203 1.00 3.44  ? 51 ASN D H      1  
ATOM 5211  H HA     . ASN F 3 51 ? -13.026 -9.697  -22.243 1.00 3.88  ? 51 ASN D HA     1  
ATOM 5212  H HB2    . ASN F 3 51 ? -14.562 -7.584  -21.269 1.00 3.84  ? 51 ASN D HB2    1  
ATOM 5213  H HB3    . ASN F 3 51 ? -14.181 -7.110  -22.919 1.00 4.12  ? 51 ASN D HB3    1  
ATOM 5214  H HD21   . ASN F 3 51 ? -15.210 -8.092  -24.572 1.00 4.24  ? 51 ASN D HD21   1  
ATOM 5215  H HD22   . ASN F 3 51 ? -16.366 -9.361  -24.383 1.00 4.70  ? 51 ASN D HD22   1  
ATOM 5216  N N      . MET F 3 52 ? -10.685 -8.008  -22.876 1.00 3.89  ? 52 MET D N      1  
ATOM 5217  C CA     . MET F 3 52 ? -9.660  -7.531  -23.788 1.00 4.11  ? 52 MET D CA     1  
ATOM 5218  C C      . MET F 3 52 ? -8.299  -7.960  -23.266 1.00 4.21  ? 52 MET D C      1  
ATOM 5219  O O      . MET F 3 52 ? -8.069  -7.937  -22.057 1.00 4.26  ? 52 MET D O      1  
ATOM 5220  C CB     . MET F 3 52 ? -9.725  -6.001  -23.900 1.00 3.98  ? 52 MET D CB     1  
ATOM 5221  C CG     . MET F 3 52 ? -8.581  -5.391  -24.694 1.00 4.25  ? 52 MET D CG     1  
ATOM 5222  S SD     . MET F 3 52 ? -8.532  -3.593  -24.573 1.00 5.29  ? 52 MET D SD     1  
ATOM 5223  C CE     . MET F 3 52 ? -6.889  -3.261  -25.204 1.00 5.24  ? 52 MET D CE     1  
ATOM 5224  H H      . MET F 3 52 ? -10.419 -8.257  -21.967 1.00 3.72  ? 52 MET D H      1  
ATOM 5225  H HA     . MET F 3 52 ? -9.829  -7.974  -24.757 1.00 4.46  ? 52 MET D HA     1  
ATOM 5226  H HB2    . MET F 3 52 ? -10.653 -5.727  -24.379 1.00 4.11  ? 52 MET D HB2    1  
ATOM 5227  H HB3    . MET F 3 52 ? -9.706  -5.582  -22.905 1.00 4.04  ? 52 MET D HB3    1  
ATOM 5228  H HG2    . MET F 3 52 ? -7.651  -5.787  -24.317 1.00 4.07  ? 52 MET D HG2    1  
ATOM 5229  H HG3    . MET F 3 52 ? -8.694  -5.667  -25.732 1.00 4.54  ? 52 MET D HG3    1  
ATOM 5230  H HE1    . MET F 3 52 ? -6.157  -3.726  -24.561 1.00 5.30  ? 52 MET D HE1    1  
ATOM 5231  H HE2    . MET F 3 52 ? -6.724  -2.195  -25.228 1.00 5.38  ? 52 MET D HE2    1  
ATOM 5232  H HE3    . MET F 3 52 ? -6.798  -3.662  -26.202 1.00 5.43  ? 52 MET D HE3    1  
ATOM 5233  N N      . THR F 3 53 ? -7.411  -8.369  -24.162 1.00 4.51  ? 53 THR D N      1  
ATOM 5234  C CA     . THR F 3 53 ? -6.078  -8.792  -23.768 1.00 4.79  ? 53 THR D CA     1  
ATOM 5235  C C      . THR F 3 53 ? -5.273  -7.606  -23.234 1.00 4.68  ? 53 THR D C      1  
ATOM 5236  O O      . THR F 3 53 ? -5.469  -6.467  -23.669 1.00 5.07  ? 53 THR D O      1  
ATOM 5237  C CB     . THR F 3 53 ? -5.339  -9.442  -24.953 1.00 5.33  ? 53 THR D CB     1  
ATOM 5238  O OG1    . THR F 3 53 ? -5.837  -8.906  -26.188 1.00 5.34  ? 53 THR D OG1    1  
ATOM 5239  C CG2    . THR F 3 53 ? -5.529  -10.951 -24.941 1.00 5.83  ? 53 THR D CG2    1  
ATOM 5240  H H      . THR F 3 53 ? -7.653  -8.389  -25.112 1.00 4.70  ? 53 THR D H      1  
ATOM 5241  H HA     . THR F 3 53 ? -6.181  -9.527  -22.983 1.00 4.81  ? 53 THR D HA     1  
ATOM 5242  H HB     . THR F 3 53 ? -4.284  -9.224  -24.870 1.00 5.49  ? 53 THR D HB     1  
ATOM 5243  H HG1    . THR F 3 53 ? -5.265  -8.182  -26.477 1.00 5.61  ? 53 THR D HG1    1  
ATOM 5244  H HG21   . THR F 3 53 ? -6.582  -11.180 -25.005 1.00 6.55  ? 53 THR D HG21   1  
ATOM 5245  H HG22   . THR F 3 53 ? -5.127  -11.358 -24.025 1.00 5.92  ? 53 THR D HG22   1  
ATOM 5246  H HG23   . THR F 3 53 ? -5.013  -11.386 -25.785 1.00 5.63  ? 53 THR D HG23   1  
ATOM 5247  N N      . CYS F 3 54 ? -4.393  -7.874  -22.280 1.00 4.39  ? 54 CYS D N      1  
ATOM 5248  C CA     . CYS F 3 54 ? -3.570  -6.832  -21.681 1.00 4.37  ? 54 CYS D CA     1  
ATOM 5249  C C      . CYS F 3 54 ? -2.579  -6.284  -22.703 1.00 4.49  ? 54 CYS D C      1  
ATOM 5250  O O      . CYS F 3 54 ? -1.626  -6.962  -23.092 1.00 4.52  ? 54 CYS D O      1  
ATOM 5251  C CB     . CYS F 3 54 ? -2.826  -7.379  -20.460 1.00 4.51  ? 54 CYS D CB     1  
ATOM 5252  S SG     . CYS F 3 54 ? -2.316  -6.107  -19.255 1.00 4.38  ? 54 CYS D SG     1  
ATOM 5253  H H      . CYS F 3 54 ? -4.292  -8.800  -21.969 1.00 4.35  ? 54 CYS D H      1  
ATOM 5254  H HA     . CYS F 3 54 ? -4.223  -6.033  -21.368 1.00 4.34  ? 54 CYS D HA     1  
ATOM 5255  H HB2    . CYS F 3 54 ? -3.464  -8.082  -19.945 1.00 4.61  ? 54 CYS D HB2    1  
ATOM 5256  H HB3    . CYS F 3 54 ? -1.933  -7.889  -20.793 1.00 5.00  ? 54 CYS D HB3    1  
ATOM 5257  N N      . GLN F 3 55 ? -2.821  -5.060  -23.147 1.00 4.76  ? 55 GLN D N      1  
ATOM 5258  C CA     . GLN F 3 55 ? -1.963  -4.415  -24.127 1.00 5.08  ? 55 GLN D CA     1  
ATOM 5259  C C      . GLN F 3 55 ? -1.665  -2.986  -23.701 1.00 5.21  ? 55 GLN D C      1  
ATOM 5260  O O      . GLN F 3 55 ? -0.509  -2.548  -23.838 1.00 5.47  ? 55 GLN D O      1  
ATOM 5261  C CB     . GLN F 3 55 ? -2.628  -4.419  -25.505 1.00 5.24  ? 55 GLN D CB     1  
ATOM 5262  C CG     . GLN F 3 55 ? -2.681  -5.795  -26.150 1.00 5.68  ? 55 GLN D CG     1  
ATOM 5263  C CD     . GLN F 3 55 ? -3.789  -5.926  -27.178 1.00 6.49  ? 55 GLN D CD     1  
ATOM 5264  O OE1    . GLN F 3 55 ? -4.374  -6.995  -27.341 1.00 6.91  ? 55 GLN D OE1    1  
ATOM 5265  N NE2    . GLN F 3 55 ? -4.079  -4.850  -27.885 1.00 7.00  ? 55 GLN D NE2    1  
ATOM 5266  O OXT    . GLN F 3 55 ? -2.594  -2.313  -23.207 1.00 5.42  ? 55 GLN D OXT    1  
ATOM 5267  H H      . GLN F 3 55 ? -3.597  -4.570  -22.801 1.00 4.87  ? 55 GLN D H      1  
ATOM 5268  H HA     . GLN F 3 55 ? -1.037  -4.970  -24.178 1.00 5.45  ? 55 GLN D HA     1  
ATOM 5269  H HB2    . GLN F 3 55 ? -3.639  -4.051  -25.407 1.00 5.33  ? 55 GLN D HB2    1  
ATOM 5270  H HB3    . GLN F 3 55 ? -2.077  -3.761  -26.157 1.00 5.29  ? 55 GLN D HB3    1  
ATOM 5271  H HG2    . GLN F 3 55 ? -1.738  -5.984  -26.640 1.00 5.74  ? 55 GLN D HG2    1  
ATOM 5272  H HG3    . GLN F 3 55 ? -2.837  -6.533  -25.377 1.00 5.66  ? 55 GLN D HG3    1  
ATOM 5273  H HE21   . GLN F 3 55 ? -3.569  -4.030  -27.709 1.00 6.90  ? 55 GLN D HE21   1  
ATOM 5274  H HE22   . GLN F 3 55 ? -4.794  -4.911  -28.551 1.00 7.62  ? 55 GLN D HE22   1  
ATOM 5275  O "O5'"  . DA  A 1 1  ? 43.100  19.787  2.331   1.00 4.09  ? 1  DA  E "O5'"  2  
ATOM 5276  C "C5'"  . DA  A 1 1  ? 44.016  20.066  1.266   1.00 4.09  ? 1  DA  E "C5'"  2  
ATOM 5277  C "C4'"  . DA  A 1 1  ? 43.652  19.293  0.020   1.00 4.00  ? 1  DA  E "C4'"  2  
ATOM 5278  O "O4'"  . DA  A 1 1  ? 43.869  17.885  0.275   1.00 3.96  ? 1  DA  E "O4'"  2  
ATOM 5279  C "C3'"  . DA  A 1 1  ? 42.180  19.401  -0.371  1.00 3.93  ? 1  DA  E "C3'"  2  
ATOM 5280  O "O3'"  . DA  A 1 1  ? 42.002  19.096  -1.754  1.00 3.91  ? 1  DA  E "O3'"  2  
ATOM 5281  C "C2'"  . DA  A 1 1  ? 41.539  18.295  0.442   1.00 3.85  ? 1  DA  E "C2'"  2  
ATOM 5282  C "C1'"  . DA  A 1 1  ? 42.619  17.222  0.425   1.00 3.87  ? 1  DA  E "C1'"  2  
ATOM 5283  N N9     . DA  A 1 1  ? 42.678  16.379  1.619   1.00 3.89  ? 1  DA  E N9     2  
ATOM 5284  C C8     . DA  A 1 1  ? 42.673  16.751  2.941   1.00 3.95  ? 1  DA  E C8     2  
ATOM 5285  N N7     . DA  A 1 1  ? 42.709  15.739  3.774   1.00 3.99  ? 1  DA  E N7     2  
ATOM 5286  C C5     . DA  A 1 1  ? 42.746  14.625  2.946   1.00 3.95  ? 1  DA  E C5     2  
ATOM 5287  C C6     . DA  A 1 1  ? 42.792  13.244  3.214   1.00 3.99  ? 1  DA  E C6     2  
ATOM 5288  N N6     . DA  A 1 1  ? 42.802  12.732  4.443   1.00 4.09  ? 1  DA  E N6     2  
ATOM 5289  N N1     . DA  A 1 1  ? 42.823  12.400  2.160   1.00 3.97  ? 1  DA  E N1     2  
ATOM 5290  C C2     . DA  A 1 1  ? 42.809  12.916  0.926   1.00 3.91  ? 1  DA  E C2     2  
ATOM 5291  N N3     . DA  A 1 1  ? 42.763  14.192  0.546   1.00 3.87  ? 1  DA  E N3     2  
ATOM 5292  C C4     . DA  A 1 1  ? 42.734  15.006  1.617   1.00 3.89  ? 1  DA  E C4     2  
ATOM 5293  H "H5'"  . DA  A 1 1  ? 45.026  19.790  1.574   1.00 4.15  ? 1  DA  E "H5'"  2  
ATOM 5294  H "H5''" . DA  A 1 1  ? 43.996  21.131  1.040   1.00 4.15  ? 1  DA  E "H5''" 2  
ATOM 5295  H "H4'"  . DA  A 1 1  ? 44.240  19.685  -0.810  1.00 4.05  ? 1  DA  E "H4'"  2  
ATOM 5296  H "H3'"  . DA  A 1 1  ? 41.768  20.385  -0.147  1.00 3.97  ? 1  DA  E "H3'"  2  
ATOM 5297  H "H2'"  . DA  A 1 1  ? 41.301  18.627  1.452   1.00 3.88  ? 1  DA  E "H2'"  2  
ATOM 5298  H "H2''" . DA  A 1 1  ? 40.616  17.952  -0.019  1.00 3.78  ? 1  DA  E "H2''" 2  
ATOM 5299  H "H1'"  . DA  A 1 1  ? 42.492  16.571  -0.442  1.00 3.83  ? 1  DA  E "H1'"  2  
ATOM 5300  H H8     . DA  A 1 1  ? 42.642  17.782  3.264   1.00 3.99  ? 1  DA  E H8     2  
ATOM 5301  H H61    . DA  A 1 1  ? 42.776  13.354  5.238   1.00 4.13  ? 1  DA  E H61    2  
ATOM 5302  H H62    . DA  A 1 1  ? 42.836  11.730  4.578   1.00 4.14  ? 1  DA  E H62    2  
ATOM 5303  H H2     . DA  A 1 1  ? 42.840  12.186  0.115   1.00 3.93  ? 1  DA  E H2     2  
ATOM 5304  H "HO5'" . DA  A 1 1  ? 43.597  19.322  3.011   1.00 4.25  ? 1  DA  E "HO5'" 2  
ATOM 5305  P P      . DT  A 1 2  ? 40.743  19.696  -2.566  1.00 3.90  ? 2  DT  E P      2  
ATOM 5306  O OP1    . DT  A 1 2  ? 41.183  20.855  -3.384  1.00 4.01  ? 2  DT  E OP1    2  
ATOM 5307  O OP2    . DT  A 1 2  ? 39.611  19.855  -1.617  1.00 3.83  ? 2  DT  E OP2    2  
ATOM 5308  O "O5'"  . DT  A 1 2  ? 40.397  18.495  -3.555  1.00 3.87  ? 2  DT  E "O5'"  2  
ATOM 5309  C "C5'"  . DT  A 1 2  ? 41.221  17.326  -3.564  1.00 3.88  ? 2  DT  E "C5'"  2  
ATOM 5310  C "C4'"  . DT  A 1 2  ? 40.421  16.097  -3.934  1.00 3.85  ? 2  DT  E "C4'"  2  
ATOM 5311  O "O4'"  . DT  A 1 2  ? 40.236  15.280  -2.753  1.00 3.78  ? 2  DT  E "O4'"  2  
ATOM 5312  C "C3'"  . DT  A 1 2  ? 39.006  16.384  -4.428  1.00 3.81  ? 2  DT  E "C3'"  2  
ATOM 5313  O "O3'"  . DT  A 1 2  ? 38.576  15.266  -5.204  1.00 3.84  ? 2  DT  E "O3'"  2  
ATOM 5314  C "C2'"  . DT  A 1 2  ? 38.200  16.444  -3.144  1.00 3.70  ? 2  DT  E "C2'"  2  
ATOM 5315  C "C1'"  . DT  A 1 2  ? 38.888  15.371  -2.306  1.00 3.69  ? 2  DT  E "C1'"  2  
ATOM 5316  N N1     . DT  A 1 2  ? 38.882  15.551  -0.836  1.00 3.65  ? 2  DT  E N1     2  
ATOM 5317  C C2     . DT  A 1 2  ? 39.003  14.404  -0.080  1.00 3.65  ? 2  DT  E C2     2  
ATOM 5318  O O2     . DT  A 1 2  ? 39.137  13.294  -0.572  1.00 3.68  ? 2  DT  E O2     2  
ATOM 5319  N N3     . DT  A 1 2  ? 38.958  14.599  1.274   1.00 3.66  ? 2  DT  E N3     2  
ATOM 5320  C C4     . DT  A 1 2  ? 38.814  15.796  1.937   1.00 3.67  ? 2  DT  E C4     2  
ATOM 5321  O O4     . DT  A 1 2  ? 38.784  15.810  3.168   1.00 3.71  ? 2  DT  E O4     2  
ATOM 5322  C C5     . DT  A 1 2  ? 38.702  16.964  1.090   1.00 3.67  ? 2  DT  E C5     2  
ATOM 5323  C C7     . DT  A 1 2  ? 38.543  18.306  1.732   1.00 3.71  ? 2  DT  E C7     2  
ATOM 5324  C C6     . DT  A 1 2  ? 38.743  16.791  -0.243  1.00 3.66  ? 2  DT  E C6     2  
ATOM 5325  H "H5'"  . DT  A 1 2  ? 41.653  17.180  -2.574  1.00 3.86  ? 2  DT  E "H5'"  2  
ATOM 5326  H "H5''" . DT  A 1 2  ? 42.028  17.454  -4.285  1.00 3.97  ? 2  DT  E "H5''" 2  
ATOM 5327  H "H4'"  . DT  A 1 2  ? 40.948  15.582  -4.739  1.00 3.93  ? 2  DT  E "H4'"  2  
ATOM 5328  H "H3'"  . DT  A 1 2  ? 38.948  17.298  -5.017  1.00 3.87  ? 2  DT  E "H3'"  2  
ATOM 5329  H "H2'"  . DT  A 1 2  ? 38.265  17.431  -2.688  1.00 3.70  ? 2  DT  E "H2'"  2  
ATOM 5330  H "H2''" . DT  A 1 2  ? 37.147  16.243  -3.331  1.00 3.66  ? 2  DT  E "H2''" 2  
ATOM 5331  H "H1'"  . DT  A 1 2  ? 38.429  14.401  -2.514  1.00 3.68  ? 2  DT  E "H1'"  2  
ATOM 5332  H H3     . DT  A 1 2  ? 39.027  13.777  1.856   1.00 3.69  ? 2  DT  E H3     2  
ATOM 5333  H H71    . DT  A 1 2  ? 39.097  19.053  1.164   1.00 3.72  ? 2  DT  E H71    2  
ATOM 5334  H H72    . DT  A 1 2  ? 38.928  18.268  2.750   1.00 3.79  ? 2  DT  E H72    2  
ATOM 5335  H H73    . DT  A 1 2  ? 37.488  18.577  1.753   1.00 3.98  ? 2  DT  E H73    2  
ATOM 5336  H H6     . DT  A 1 2  ? 38.667  17.669  -0.882  1.00 3.69  ? 2  DT  E H6     2  
ATOM 5337  P P      . DG  A 1 3  ? 37.457  15.438  -6.340  1.00 3.88  ? 3  DG  E P      2  
ATOM 5338  O OP1    . DG  A 1 3  ? 38.097  15.869  -7.608  1.00 4.05  ? 3  DG  E OP1    2  
ATOM 5339  O OP2    . DG  A 1 3  ? 36.327  16.225  -5.783  1.00 3.77  ? 3  DG  E OP2    2  
ATOM 5340  O "O5'"  . DG  A 1 3  ? 36.962  13.935  -6.519  1.00 3.91  ? 3  DG  E "O5'"  2  
ATOM 5341  C "C5'"  . DG  A 1 3  ? 37.832  12.860  -6.159  1.00 3.87  ? 3  DG  E "C5'"  2  
ATOM 5342  C "C4'"  . DG  A 1 3  ? 37.048  11.656  -5.686  1.00 3.85  ? 3  DG  E "C4'"  2  
ATOM 5343  O "O4'"  . DG  A 1 3  ? 36.962  11.689  -4.240  1.00 3.72  ? 3  DG  E "O4'"  2  
ATOM 5344  C "C3'"  . DG  A 1 3  ? 35.596  11.623  -6.156  1.00 3.85  ? 3  DG  E "C3'"  2  
ATOM 5345  O "O3'"  . DG  A 1 3  ? 35.148  10.269  -6.127  1.00 3.91  ? 3  DG  E "O3'"  2  
ATOM 5346  C "C2'"  . DG  A 1 3  ? 34.876  12.432  -5.095  1.00 3.69  ? 3  DG  E "C2'"  2  
ATOM 5347  C "C1'"  . DG  A 1 3  ? 35.647  12.046  -3.837  1.00 3.63  ? 3  DG  E "C1'"  2  
ATOM 5348  N N9     . DG  A 1 3  ? 35.732  13.066  -2.795  1.00 3.54  ? 3  DG  E N9     2  
ATOM 5349  C C8     . DG  A 1 3  ? 35.791  14.426  -2.949  1.00 3.53  ? 3  DG  E C8     2  
ATOM 5350  N N7     . DG  A 1 3  ? 35.845  15.073  -1.816  1.00 3.49  ? 3  DG  E N7     2  
ATOM 5351  C C5     . DG  A 1 3  ? 35.822  14.074  -0.852  1.00 3.46  ? 3  DG  E C5     2  
ATOM 5352  C C6     . DG  A 1 3  ? 35.856  14.160  0.571   1.00 3.46  ? 3  DG  E C6     2  
ATOM 5353  O O6     . DG  A 1 3  ? 35.919  15.170  1.285   1.00 3.47  ? 3  DG  E O6     2  
ATOM 5354  N N1     . DG  A 1 3  ? 35.811  12.900  1.160   1.00 3.48  ? 3  DG  E N1     2  
ATOM 5355  C C2     . DG  A 1 3  ? 35.741  11.711  0.475   1.00 3.51  ? 3  DG  E C2     2  
ATOM 5356  N N2     . DG  A 1 3  ? 35.705  10.596  1.219   1.00 3.58  ? 3  DG  E N2     2  
ATOM 5357  N N3     . DG  A 1 3  ? 35.711  11.619  -0.846  1.00 3.53  ? 3  DG  E N3     2  
ATOM 5358  C C4     . DG  A 1 3  ? 35.753  12.830  -1.439  1.00 3.50  ? 3  DG  E C4     2  
ATOM 5359  H "H5'"  . DG  A 1 3  ? 38.500  13.183  -5.362  1.00 3.75  ? 3  DG  E "H5'"  2  
ATOM 5360  H "H5''" . DG  A 1 3  ? 38.428  12.571  -7.025  1.00 4.01  ? 3  DG  E "H5''" 2  
ATOM 5361  H "H4'"  . DG  A 1 3  ? 37.532  10.761  -6.075  1.00 3.94  ? 3  DG  E "H4'"  2  
ATOM 5362  H "H3'"  . DG  A 1 3  ? 35.479  12.035  -7.156  1.00 3.94  ? 3  DG  E "H3'"  2  
ATOM 5363  H "H2'"  . DG  A 1 3  ? 34.941  13.501  -5.304  1.00 3.68  ? 3  DG  E "H2'"  2  
ATOM 5364  H "H2''" . DG  A 1 3  ? 33.821  12.177  -5.050  1.00 3.67  ? 3  DG  E "H2''" 2  
ATOM 5365  H "H1'"  . DG  A 1 3  ? 35.200  11.154  -3.391  1.00 3.62  ? 3  DG  E "H1'"  2  
ATOM 5366  H H8     . DG  A 1 3  ? 35.788  14.915  -3.913  1.00 3.59  ? 3  DG  E H8     2  
ATOM 5367  H H1     . DG  A 1 3  ? 35.828  12.859  2.170   1.00 3.51  ? 3  DG  E H1     2  
ATOM 5368  H H21    . DG  A 1 3  ? 35.655  9.697   0.762   1.00 3.63  ? 3  DG  E H21    2  
ATOM 5369  H H22    . DG  A 1 3  ? 35.723  10.638  2.231   1.00 3.60  ? 3  DG  E H22    2  
ATOM 5370  P P      . DA  A 1 4  ? 33.957  9.785   -7.084  1.00 4.02  ? 4  DA  E P      2  
ATOM 5371  O OP1    . DA  A 1 4  ? 34.523  9.164   -8.310  1.00 4.23  ? 4  DA  E OP1    2  
ATOM 5372  O OP2    . DA  A 1 4  ? 32.970  10.889  -7.211  1.00 3.94  ? 4  DA  E OP2    2  
ATOM 5373  O "O5'"  . DA  A 1 4  ? 33.297  8.615   -6.223  1.00 4.02  ? 4  DA  E "O5'"  2  
ATOM 5374  C "C5'"  . DA  A 1 4  ? 34.116  7.552   -5.735  1.00 4.12  ? 4  DA  E "C5'"  2  
ATOM 5375  C "C4'"  . DA  A 1 4  ? 33.595  7.004   -4.423  1.00 4.06  ? 4  DA  E "C4'"  2  
ATOM 5376  O "O4'"  . DA  A 1 4  ? 33.664  8.040   -3.411  1.00 3.92  ? 4  DA  E "O4'"  2  
ATOM 5377  C "C3'"  . DA  A 1 4  ? 32.121  6.607   -4.458  1.00 4.01  ? 4  DA  E "C3'"  2  
ATOM 5378  O "O3'"  . DA  A 1 4  ? 31.862  5.664   -3.420  1.00 4.04  ? 4  DA  E "O3'"  2  
ATOM 5379  C "C2'"  . DA  A 1 4  ? 31.402  7.897   -4.124  1.00 3.84  ? 4  DA  E "C2'"  2  
ATOM 5380  C "C1'"  . DA  A 1 4  ? 32.354  8.520   -3.116  1.00 3.79  ? 4  DA  E "C1'"  2  
ATOM 5381  N N9     . DA  A 1 4  ? 32.363  9.981   -3.064  1.00 3.68  ? 4  DA  E N9     2  
ATOM 5382  C C8     . DA  A 1 4  ? 32.341  10.895  -4.083  1.00 3.67  ? 4  DA  E C8     2  
ATOM 5383  N N7     . DA  A 1 4  ? 32.314  12.144  -3.674  1.00 3.58  ? 4  DA  E N7     2  
ATOM 5384  C C5     . DA  A 1 4  ? 32.322  12.041  -2.290  1.00 3.52  ? 4  DA  E C5     2  
ATOM 5385  C C6     . DA  A 1 4  ? 32.297  13.007  -1.260  1.00 3.46  ? 4  DA  E C6     2  
ATOM 5386  N N6     . DA  A 1 4  ? 32.252  14.326  -1.473  1.00 3.44  ? 4  DA  E N6     2  
ATOM 5387  N N1     . DA  A 1 4  ? 32.318  12.563  0.017   1.00 3.47  ? 4  DA  E N1     2  
ATOM 5388  C C2     . DA  A 1 4  ? 32.356  11.241  0.236   1.00 3.54  ? 4  DA  E C2     2  
ATOM 5389  N N3     . DA  A 1 4  ? 32.376  10.242  -0.642  1.00 3.60  ? 4  DA  E N3     2  
ATOM 5390  C C4     . DA  A 1 4  ? 32.360  10.715  -1.900  1.00 3.58  ? 4  DA  E C4     2  
ATOM 5391  H "H5'"  . DA  A 1 4  ? 35.132  7.918   -5.586  1.00 4.16  ? 4  DA  E "H5'"  2  
ATOM 5392  H "H5''" . DA  A 1 4  ? 34.137  6.747   -6.469  1.00 4.28  ? 4  DA  E "H5''" 2  
ATOM 5393  H "H4'"  . DA  A 1 4  ? 34.169  6.108   -4.175  1.00 4.16  ? 4  DA  E "H4'"  2  
ATOM 5394  H "H3'"  . DA  A 1 4  ? 31.827  6.192   -5.420  1.00 4.10  ? 4  DA  E "H3'"  2  
ATOM 5395  H "H2'"  . DA  A 1 4  ? 31.271  8.519   -5.009  1.00 3.84  ? 4  DA  E "H2'"  2  
ATOM 5396  H "H2''" . DA  A 1 4  ? 30.414  7.702   -3.712  1.00 3.78  ? 4  DA  E "H2''" 2  
ATOM 5397  H "H1'"  . DA  A 1 4  ? 32.111  8.159   -2.113  1.00 3.77  ? 4  DA  E "H1'"  2  
ATOM 5398  H H8     . DA  A 1 4  ? 32.339  10.615  -5.124  1.00 3.76  ? 4  DA  E H8     2  
ATOM 5399  H H61    . DA  A 1 4  ? 32.233  14.681  -2.419  1.00 3.46  ? 4  DA  E H61    2  
ATOM 5400  H H62    . DA  A 1 4  ? 32.228  14.972  -0.697  1.00 3.42  ? 4  DA  E H62    2  
ATOM 5401  H H2     . DA  A 1 4  ? 32.372  10.942  1.283   1.00 3.58  ? 4  DA  E H2     2  
ATOM 5402  P P      . DT  A 1 5  ? 30.601  4.679   -3.513  1.00 4.10  ? 5  DT  E P      2  
ATOM 5403  O OP1    . DT  A 1 5  ? 31.027  3.358   -4.039  1.00 4.31  ? 5  DT  E OP1    2  
ATOM 5404  O OP2    . DT  A 1 5  ? 29.488  5.408   -4.175  1.00 4.01  ? 5  DT  E OP2    2  
ATOM 5405  O "O5'"  . DT  A 1 5  ? 30.221  4.496   -1.977  1.00 4.05  ? 5  DT  E "O5'"  2  
ATOM 5406  C "C5'"  . DT  A 1 5  ? 31.153  4.890   -0.967  1.00 4.03  ? 5  DT  E "C5'"  2  
ATOM 5407  C "C4'"  . DT  A 1 5  ? 30.466  5.075   0.365   1.00 3.97  ? 5  DT  E "C4'"  2  
ATOM 5408  O "O4'"  . DT  A 1 5  ? 30.389  6.493   0.659   1.00 3.80  ? 5  DT  E "O4'"  2  
ATOM 5409  C "C3'"  . DT  A 1 5  ? 29.015  4.599   0.388   1.00 3.95  ? 5  DT  E "C3'"  2  
ATOM 5410  O "O3'"  . DT  A 1 5  ? 28.628  4.334   1.734   1.00 3.98  ? 5  DT  E "O3'"  2  
ATOM 5411  C "C2'"  . DT  A 1 5  ? 28.250  5.810   -0.107  1.00 3.75  ? 5  DT  E "C2'"  2  
ATOM 5412  C "C1'"  . DT  A 1 5  ? 29.051  6.952   0.501   1.00 3.67  ? 5  DT  E "C1'"  2  
ATOM 5413  N N1     . DT  A 1 5  ? 29.054  8.229   -0.249  1.00 3.55  ? 5  DT  E N1     2  
ATOM 5414  C C2     . DT  A 1 5  ? 29.052  9.385   0.504   1.00 3.45  ? 5  DT  E C2     2  
ATOM 5415  O O2     . DT  A 1 5  ? 29.090  9.387   1.724   1.00 3.47  ? 5  DT  E O2     2  
ATOM 5416  N N3     . DT  A 1 5  ? 29.001  10.544  -0.221  1.00 3.36  ? 5  DT  E N3     2  
ATOM 5417  C C4     . DT  A 1 5  ? 28.952  10.667  -1.592  1.00 3.38  ? 5  DT  E C4     2  
ATOM 5418  O O4     . DT  A 1 5  ? 28.875  11.783  -2.102  1.00 3.33  ? 5  DT  E O4     2  
ATOM 5419  C C5     . DT  A 1 5  ? 28.970  9.418   -2.326  1.00 3.49  ? 5  DT  E C5     2  
ATOM 5420  C C7     . DT  A 1 5  ? 28.840  9.459   -3.816  1.00 3.56  ? 5  DT  E C7     2  
ATOM 5421  C C6     . DT  A 1 5  ? 29.030  8.270   -1.628  1.00 3.57  ? 5  DT  E C6     2  
ATOM 5422  H "H5'"  . DT  A 1 5  ? 31.626  5.829   -1.257  1.00 3.95  ? 5  DT  E "H5'"  2  
ATOM 5423  H "H5''" . DT  A 1 5  ? 31.922  4.125   -0.864  1.00 4.18  ? 5  DT  E "H5''" 2  
ATOM 5424  H "H4'"  . DT  A 1 5  ? 31.010  4.500   1.115   1.00 4.08  ? 5  DT  E "H4'"  2  
ATOM 5425  H "H3'"  . DT  A 1 5  ? 28.861  3.715   -0.228  1.00 4.05  ? 5  DT  E "H3'"  2  
ATOM 5426  H "H2'"  . DT  A 1 5  ? 28.234  5.849   -1.196  1.00 3.76  ? 5  DT  E "H2'"  2  
ATOM 5427  H "H2''" . DT  A 1 5  ? 27.219  5.787   0.234   1.00 3.70  ? 5  DT  E "H2''" 2  
ATOM 5428  H "H1'"  . DT  A 1 5  ? 28.675  7.164   1.505   1.00 3.65  ? 5  DT  E "H1'"  2  
ATOM 5429  H H3     . DT  A 1 5  ? 28.985  11.404  0.309   1.00 3.31  ? 5  DT  E H3     2  
ATOM 5430  H H71    . DT  A 1 5  ? 28.617  8.460   -4.190  1.00 3.50  ? 5  DT  E H71    2  
ATOM 5431  H H72    . DT  A 1 5  ? 28.034  10.139  -4.091  1.00 3.89  ? 5  DT  E H72    2  
ATOM 5432  H H73    . DT  A 1 5  ? 29.774  9.811   -4.253  1.00 3.66  ? 5  DT  E H73    2  
ATOM 5433  H H6     . DT  A 1 5  ? 29.063  7.330   -2.178  1.00 3.68  ? 5  DT  E H6     2  
ATOM 5434  P P      . DT  A 1 6  ? 27.393  3.358   2.053   1.00 4.05  ? 6  DT  E P      2  
ATOM 5435  O OP1    . DT  A 1 6  ? 27.898  1.996   2.355   1.00 4.28  ? 6  DT  E OP1    2  
ATOM 5436  O OP2    . DT  A 1 6  ? 26.353  3.542   1.012   1.00 3.94  ? 6  DT  E OP2    2  
ATOM 5437  O "O5'"  . DT  A 1 6  ? 26.848  3.991   3.408   1.00 3.99  ? 6  DT  E "O5'"  2  
ATOM 5438  C "C5'"  . DT  A 1 6  ? 27.685  4.881   4.146   1.00 3.96  ? 6  DT  E "C5'"  2  
ATOM 5439  C "C4'"  . DT  A 1 6  ? 26.869  5.837   4.985   1.00 3.86  ? 6  DT  E "C4'"  2  
ATOM 5440  O "O4'"  . DT  A 1 6  ? 26.760  7.101   4.285   1.00 3.65  ? 6  DT  E "O4'"  2  
ATOM 5441  C "C3'"  . DT  A 1 6  ? 25.424  5.402   5.221   1.00 3.87  ? 6  DT  E "C3'"  2  
ATOM 5442  O "O3'"  . DT  A 1 6  ? 24.953  6.044   6.406   1.00 3.87  ? 6  DT  E "O3'"  2  
ATOM 5443  C "C2'"  . DT  A 1 6  ? 24.701  5.950   4.006   1.00 3.69  ? 6  DT  E "C2'"  2  
ATOM 5444  C "C1'"  . DT  A 1 6  ? 25.444  7.262   3.769   1.00 3.54  ? 6  DT  E "C1'"  2  
ATOM 5445  N N1     . DT  A 1 6  ? 25.525  7.742   2.368   1.00 3.42  ? 6  DT  E N1     2  
ATOM 5446  C C2     . DT  A 1 6  ? 25.611  9.107   2.188   1.00 3.29  ? 6  DT  E C2     2  
ATOM 5447  O O2     . DT  A 1 6  ? 25.676  9.899   3.115   1.00 3.27  ? 6  DT  E O2     2  
ATOM 5448  N N3     . DT  A 1 6  ? 25.616  9.517   0.881   1.00 3.22  ? 6  DT  E N3     2  
ATOM 5449  C C4     . DT  A 1 6  ? 25.556  8.722   -0.242  1.00 3.28  ? 6  DT  E C4     2  
ATOM 5450  O O4     . DT  A 1 6  ? 25.539  9.243   -1.360  1.00 3.25  ? 6  DT  E O4     2  
ATOM 5451  C C5     . DT  A 1 6  ? 25.491  7.298   0.014   1.00 3.42  ? 6  DT  E C5     2  
ATOM 5452  C C7     . DT  A 1 6  ? 25.400  6.359   -1.150  1.00 3.54  ? 6  DT  E C7     2  
ATOM 5453  C C6     . DT  A 1 6  ? 25.486  6.878   1.291   1.00 3.48  ? 6  DT  E C6     2  
ATOM 5454  H "H5'"  . DT  A 1 6  ? 28.302  5.456   3.455   1.00 3.89  ? 6  DT  E "H5'"  2  
ATOM 5455  H "H5''" . DT  A 1 6  ? 28.336  4.304   4.803   1.00 4.12  ? 6  DT  E "H5''" 2  
ATOM 5456  H "H4'"  . DT  A 1 6  ? 27.344  5.922   5.962   1.00 3.94  ? 6  DT  E "H4'"  2  
ATOM 5457  H "H3'"  . DT  A 1 6  ? 25.331  4.322   5.320   1.00 4.03  ? 6  DT  E "H3'"  2  
ATOM 5458  H "H2'"  . DT  A 1 6  ? 24.784  5.270   3.161   1.00 3.74  ? 6  DT  E "H2'"  2  
ATOM 5459  H "H2''" . DT  A 1 6  ? 23.640  6.087   4.207   1.00 3.64  ? 6  DT  E "H2''" 2  
ATOM 5460  H "H1'"  . DT  A 1 6  ? 24.977  8.055   4.357   1.00 3.47  ? 6  DT  E "H1'"  2  
ATOM 5461  H H3     . DT  A 1 6  ? 25.646  10.514  0.724   1.00 3.14  ? 6  DT  E H3     2  
ATOM 5462  H H71    . DT  A 1 6  ? 26.277  6.480   -1.786  1.00 3.87  ? 6  DT  E H71    2  
ATOM 5463  H H72    . DT  A 1 6  ? 25.354  5.332   -0.788  1.00 3.48  ? 6  DT  E H72    2  
ATOM 5464  H H73    . DT  A 1 6  ? 24.502  6.578   -1.727  1.00 3.74  ? 6  DT  E H73    2  
ATOM 5465  H H6     . DT  A 1 6  ? 25.454  5.806   1.484   1.00 3.61  ? 6  DT  E H6     2  
ATOM 5466  P P      . DG  A 1 7  ? 23.766  5.397   7.280   1.00 4.01  ? 7  DG  E P      2  
ATOM 5467  O OP1    . DG  A 1 7  ? 24.342  4.444   8.261   1.00 4.24  ? 7  DG  E OP1    2  
ATOM 5468  O OP2    . DG  A 1 7  ? 22.687  4.945   6.363   1.00 3.96  ? 7  DG  E OP2    2  
ATOM 5469  O "O5'"  . DG  A 1 7  ? 23.252  6.672   8.081   1.00 3.93  ? 7  DG  E "O5'"  2  
ATOM 5470  C "C5'"  . DG  A 1 7  ? 24.126  7.790   8.254   1.00 3.84  ? 7  DG  E "C5'"  2  
ATOM 5471  C "C4'"  . DG  A 1 7  ? 23.349  9.067   8.467   1.00 3.74  ? 7  DG  E "C4'"  2  
ATOM 5472  O "O4'"  . DG  A 1 7  ? 23.410  9.863   7.258   1.00 3.56  ? 7  DG  E "O4'"  2  
ATOM 5473  C "C3'"  . DG  A 1 7  ? 21.857  8.861   8.711   1.00 3.71  ? 7  DG  E "C3'"  2  
ATOM 5474  O "O3'"  . DG  A 1 7  ? 21.345  10.014  9.370   1.00 3.70  ? 7  DG  E "O3'"  2  
ATOM 5475  C "C2'"  . DG  A 1 7  ? 21.279  8.814   7.312   1.00 3.53  ? 7  DG  E "C2'"  2  
ATOM 5476  C "C1'"  . DG  A 1 7  ? 22.152  9.830   6.590   1.00 3.43  ? 7  DG  E "C1'"  2  
ATOM 5477  N N9     . DG  A 1 7  ? 22.368  9.590   5.168   1.00 3.33  ? 7  DG  E N9     2  
ATOM 5478  C C8     . DG  A 1 7  ? 22.639  8.399   4.543   1.00 3.39  ? 7  DG  E C8     2  
ATOM 5479  N N7     . DG  A 1 7  ? 22.735  8.507   3.245   1.00 3.31  ? 7  DG  E N7     2  
ATOM 5480  C C5     . DG  A 1 7  ? 22.521  9.858   2.998   1.00 3.19  ? 7  DG  E C5     2  
ATOM 5481  C C6     . DG  A 1 7  ? 22.499  10.582  1.774   1.00 3.10  ? 7  DG  E C6     2  
ATOM 5482  O O6     . DG  A 1 7  ? 22.673  10.162  0.624   1.00 3.12  ? 7  DG  E O6     2  
ATOM 5483  N N1     . DG  A 1 7  ? 22.245  11.934  1.981   1.00 3.02  ? 7  DG  E N1     2  
ATOM 5484  C C2     . DG  A 1 7  ? 22.040  12.519  3.204   1.00 3.05  ? 7  DG  E C2     2  
ATOM 5485  N N2     . DG  A 1 7  ? 21.813  13.842  3.197   1.00 3.02  ? 7  DG  E N2     2  
ATOM 5486  N N3     . DG  A 1 7  ? 22.058  11.858  4.352   1.00 3.14  ? 7  DG  E N3     2  
ATOM 5487  C C4     . DG  A 1 7  ? 22.301  10.540  4.174   1.00 3.20  ? 7  DG  E C4     2  
ATOM 5488  H "H5'"  . DG  A 1 7  ? 24.752  7.900   7.368   1.00 3.75  ? 7  DG  E "H5'"  2  
ATOM 5489  H "H5''" . DG  A 1 7  ? 24.768  7.619   9.119   1.00 3.99  ? 7  DG  E "H5''" 2  
ATOM 5490  H "H4'"  . DG  A 1 7  ? 23.754  9.572   9.345   1.00 3.83  ? 7  DG  E "H4'"  2  
ATOM 5491  H "H3'"  . DG  A 1 7  ? 21.648  7.966   9.295   1.00 3.84  ? 7  DG  E "H3'"  2  
ATOM 5492  H "H2'"  . DG  A 1 7  ? 21.366  7.815   6.882   1.00 3.57  ? 7  DG  E "H2'"  2  
ATOM 5493  H "H2''" . DG  A 1 7  ? 20.225  9.075   7.312   1.00 3.47  ? 7  DG  E "H2''" 2  
ATOM 5494  H "H1'"  . DG  A 1 7  ? 21.717  10.825  6.693   1.00 3.36  ? 7  DG  E "H1'"  2  
ATOM 5495  H H8     . DG  A 1 7  ? 22.756  7.466   5.075   1.00 3.51  ? 7  DG  E H8     2  
ATOM 5496  H H1     . DG  A 1 7  ? 22.205  12.525  1.161   1.00 2.98  ? 7  DG  E H1     2  
ATOM 5497  H H21    . DG  A 1 7  ? 21.657  14.331  4.069   1.00 3.07  ? 7  DG  E H21    2  
ATOM 5498  H H22    . DG  A 1 7  ? 21.791  14.361  2.329   1.00 2.97  ? 7  DG  E H22    2  
ATOM 5499  P P      . DA  A 1 8  ? 19.982  9.943   10.201  1.00 3.78  ? 8  DA  E P      2  
ATOM 5500  O OP1    . DA  A 1 8  ? 20.281  9.776   11.647  1.00 4.00  ? 8  DA  E OP1    2  
ATOM 5501  O OP2    . DA  A 1 8  ? 19.064  8.991   9.527   1.00 3.71  ? 8  DA  E OP2    2  
ATOM 5502  O "O5'"  . DA  A 1 8  ? 19.429  11.419  9.971   1.00 3.67  ? 8  DA  E "O5'"  2  
ATOM 5503  C "C5'"  . DA  A 1 8  ? 20.342  12.435  9.553   1.00 3.62  ? 8  DA  E "C5'"  2  
ATOM 5504  C "C4'"  . DA  A 1 8  ? 19.646  13.540  8.790   1.00 3.48  ? 8  DA  E "C4'"  2  
ATOM 5505  O "O4'"  . DA  A 1 8  ? 19.708  13.254  7.369   1.00 3.28  ? 8  DA  E "O4'"  2  
ATOM 5506  C "C3'"  . DA  A 1 8  ? 18.154  13.679  9.079   1.00 3.49  ? 8  DA  E "C3'"  2  
ATOM 5507  O "O3'"  . DA  A 1 8  ? 17.766  15.006  8.728   1.00 3.45  ? 8  DA  E "O3'"  2  
ATOM 5508  C "C2'"  . DA  A 1 8  ? 17.515  12.704  8.107   1.00 3.33  ? 8  DA  E "C2'"  2  
ATOM 5509  C "C1'"  . DA  A 1 8  ? 18.427  12.850  6.896   1.00 3.19  ? 8  DA  E "C1'"  2  
ATOM 5510  N N9     . DA  A 1 8  ? 18.568  11.674  6.036   1.00 3.12  ? 8  DA  E N9     2  
ATOM 5511  C C8     . DA  A 1 8  ? 18.644  10.345  6.363   1.00 3.21  ? 8  DA  E C8     2  
ATOM 5512  N N7     . DA  A 1 8  ? 18.714  9.547   5.321   1.00 3.15  ? 8  DA  E N7     2  
ATOM 5513  C C5     . DA  A 1 8  ? 18.690  10.413  4.235   1.00 3.01  ? 8  DA  E C5     2  
ATOM 5514  C C6     . DA  A 1 8  ? 18.728  10.197  2.840   1.00 2.94  ? 8  DA  E C6     2  
ATOM 5515  N N6     . DA  A 1 8  ? 18.793  8.990   2.274   1.00 3.00  ? 8  DA  E N6     2  
ATOM 5516  N N1     . DA  A 1 8  ? 18.689  11.281  2.036   1.00 2.86  ? 8  DA  E N1     2  
ATOM 5517  C C2     . DA  A 1 8  ? 18.613  12.494  2.598   1.00 2.85  ? 8  DA  E C2     2  
ATOM 5518  N N3     . DA  A 1 8  ? 18.566  12.824  3.887   1.00 2.91  ? 8  DA  E N3     2  
ATOM 5519  C C4     . DA  A 1 8  ? 18.611  11.725  4.661   1.00 2.99  ? 8  DA  E C4     2  
ATOM 5520  H "H5'"  . DA  A 1 8  ? 21.104  11.989  8.913   1.00 3.56  ? 8  DA  E "H5'"  2  
ATOM 5521  H "H5''" . DA  A 1 8  ? 20.828  12.866  10.429  1.00 3.77  ? 8  DA  E "H5''" 2  
ATOM 5522  H "H4'"  . DA  A 1 8  ? 20.116  14.486  9.063   1.00 3.54  ? 8  DA  E "H4'"  2  
ATOM 5523  H "H3'"  . DA  A 1 8  ? 17.909  13.476  10.118  1.00 3.65  ? 8  DA  E "H3'"  2  
ATOM 5524  H "H2'"  . DA  A 1 8  ? 17.517  11.690  8.507   1.00 3.41  ? 8  DA  E "H2'"  2  
ATOM 5525  H "H2''" . DA  A 1 8  ? 16.479  12.973  7.899   1.00 3.28  ? 8  DA  E "H2''" 2  
ATOM 5526  H "H1'"  . DA  A 1 8  ? 18.061  13.668  6.269   1.00 3.11  ? 8  DA  E "H1'"  2  
ATOM 5527  H H8     . DA  A 1 8  ? 18.638  9.989   7.381   1.00 3.35  ? 8  DA  E H8     2  
ATOM 5528  H H61    . DA  A 1 8  ? 18.817  8.177   2.872   1.00 3.09  ? 8  DA  E H61    2  
ATOM 5529  H H62    . DA  A 1 8  ? 18.821  8.901   1.267   1.00 2.98  ? 8  DA  E H62    2  
ATOM 5530  H H2     . DA  A 1 8  ? 18.590  13.332  1.901   1.00 2.82  ? 8  DA  E H2     2  
ATOM 5531  P P      . DC  A 1 9  ? 16.457  15.674  9.363   1.00 3.55  ? 9  DC  E P      2  
ATOM 5532  O OP1    . DC  A 1 9  ? 16.842  16.514  10.524  1.00 3.78  ? 9  DC  E OP1    2  
ATOM 5533  O OP2    . DC  A 1 9  ? 15.408  14.634  9.524   1.00 3.53  ? 9  DC  E OP2    2  
ATOM 5534  O "O5'"  . DC  A 1 9  ? 16.016  16.632  8.169   1.00 3.41  ? 9  DC  E "O5'"  2  
ATOM 5535  C "C5'"  . DC  A 1 9  ? 16.947  16.918  7.121   1.00 3.31  ? 9  DC  E "C5'"  2  
ATOM 5536  C "C4'"  . DC  A 1 9  ? 16.245  17.469  5.901   1.00 3.19  ? 9  DC  E "C4'"  2  
ATOM 5537  O "O4'"  . DC  A 1 9  ? 16.257  16.464  4.858   1.00 3.02  ? 9  DC  E "O4'"  2  
ATOM 5538  C "C3'"  . DC  A 1 9  ? 14.769  17.782  6.124   1.00 3.21  ? 9  DC  E "C3'"  2  
ATOM 5539  O "O3'"  . DC  A 1 9  ? 14.361  18.754  5.158   1.00 3.17  ? 9  DC  E "O3'"  2  
ATOM 5540  C "C2'"  . DC  A 1 9  ? 14.092  16.454  5.839   1.00 3.09  ? 9  DC  E "C2'"  2  
ATOM 5541  C "C1'"  . DC  A 1 9  ? 14.956  15.908  4.705   1.00 2.96  ? 9  DC  E "C1'"  2  
ATOM 5542  N N1     . DC  A 1 9  ? 15.067  14.441  4.603   1.00 2.92  ? 9  DC  E N1     2  
ATOM 5543  C C2     . DC  A 1 9  ? 15.035  13.865  3.322   1.00 2.80  ? 9  DC  E C2     2  
ATOM 5544  O O2     . DC  A 1 9  ? 14.953  14.606  2.330   1.00 2.74  ? 9  DC  E O2     2  
ATOM 5545  N N3     . DC  A 1 9  ? 15.093  12.521  3.197   1.00 2.81  ? 9  DC  E N3     2  
ATOM 5546  C C4     . DC  A 1 9  ? 15.182  11.754  4.284   1.00 2.93  ? 9  DC  E C4     2  
ATOM 5547  N N4     . DC  A 1 9  ? 15.214  10.429  4.105   1.00 2.98  ? 9  DC  E N4     2  
ATOM 5548  C C5     . DC  A 1 9  ? 15.234  12.310  5.599   1.00 3.04  ? 9  DC  E C5     2  
ATOM 5549  C C6     . DC  A 1 9  ? 15.178  13.648  5.710   1.00 3.03  ? 9  DC  E C6     2  
ATOM 5550  H "H5'"  . DC  A 1 9  ? 17.476  16.003  6.845   1.00 3.24  ? 9  DC  E "H5'"  2  
ATOM 5551  H "H5''" . DC  A 1 9  ? 17.674  17.653  7.471   1.00 3.41  ? 9  DC  E "H5''" 2  
ATOM 5552  H "H4'"  . DC  A 1 9  ? 16.734  18.401  5.618   1.00 3.23  ? 9  DC  E "H4'"  2  
ATOM 5553  H "H3'"  . DC  A 1 9  ? 14.574  18.151  7.131   1.00 3.36  ? 9  DC  E "H3'"  2  
ATOM 5554  H "H2'"  . DC  A 1 9  ? 14.111  15.810  6.719   1.00 3.17  ? 9  DC  E "H2'"  2  
ATOM 5555  H "H2''" . DC  A 1 9  ? 13.051  16.593  5.564   1.00 3.06  ? 9  DC  E "H2''" 2  
ATOM 5556  H "H1'"  . DC  A 1 9  ? 14.573  16.275  3.749   1.00 2.89  ? 9  DC  E "H1'"  2  
ATOM 5557  H H41    . DC  A 1 9  ? 15.275  9.817   4.907   1.00 3.10  ? 9  DC  E H41    2  
ATOM 5558  H H42    . DC  A 1 9  ? 15.177  10.045  3.172   1.00 2.94  ? 9  DC  E H42    2  
ATOM 5559  H H5     . DC  A 1 9  ? 15.314  11.673  6.481   1.00 3.17  ? 9  DC  E H5     2  
ATOM 5560  H H6     . DC  A 1 9  ? 15.223  14.106  6.698   1.00 3.15  ? 9  DC  E H6     2  
ATOM 5561  P P      . DA  A 1 10 ? 13.122  19.727  5.455   1.00 3.27  ? 10 DA  E P      2  
ATOM 5562  O OP1    . DA  A 1 10 ? 13.622  21.012  6.010   1.00 3.48  ? 10 DA  E OP1    2  
ATOM 5563  O OP2    . DA  A 1 10 ? 12.083  18.965  6.192   1.00 3.27  ? 10 DA  E OP2    2  
ATOM 5564  O "O5'"  . DA  A 1 10 ? 12.574  20.015  3.986   1.00 3.16  ? 10 DA  E "O5'"  2  
ATOM 5565  C "C5'"  . DA  A 1 10 ? 13.497  20.255  2.925   1.00 3.07  ? 10 DA  E "C5'"  2  
ATOM 5566  C "C4'"  . DA  A 1 10 ? 12.913  19.863  1.586   1.00 2.98  ? 10 DA  E "C4'"  2  
ATOM 5567  O "O4'"  . DA  A 1 10 ? 12.983  18.424  1.435   1.00 2.83  ? 10 DA  E "O4'"  2  
ATOM 5568  C "C3'"  . DA  A 1 10 ? 11.428  20.188  1.439   1.00 3.01  ? 10 DA  E "C3'"  2  
ATOM 5569  O "O3'"  . DA  A 1 10 ? 11.129  20.256  0.045   1.00 3.00  ? 10 DA  E "O3'"  2  
ATOM 5570  C "C2'"  . DA  A 1 10 ? 10.742  18.968  2.021   1.00 2.90  ? 10 DA  E "C2'"  2  
ATOM 5571  C "C1'"  . DA  A 1 10 ? 11.684  17.859  1.568   1.00 2.79  ? 10 DA  E "C1'"  2  
ATOM 5572  N N9     . DA  A 1 10 ? 11.755  16.671  2.419   1.00 2.75  ? 10 DA  E N9     2  
ATOM 5573  C C8     . DA  A 1 10 ? 11.762  16.566  3.785   1.00 2.84  ? 10 DA  E C8     2  
ATOM 5574  N N7     . DA  A 1 10 ? 11.791  15.325  4.220   1.00 2.83  ? 10 DA  E N7     2  
ATOM 5575  C C5     . DA  A 1 10 ? 11.807  14.564  3.058   1.00 2.73  ? 10 DA  E C5     2  
ATOM 5576  C C6     . DA  A 1 10 ? 11.834  13.172  2.830   1.00 2.72  ? 10 DA  E C6     2  
ATOM 5577  N N6     . DA  A 1 10 ? 11.840  12.258  3.803   1.00 2.82  ? 10 DA  E N6     2  
ATOM 5578  N N1     . DA  A 1 10 ? 11.849  12.746  1.547   1.00 2.66  ? 10 DA  E N1     2  
ATOM 5579  C C2     . DA  A 1 10 ? 11.833  13.661  0.568   1.00 2.62  ? 10 DA  E C2     2  
ATOM 5580  N N3     . DA  A 1 10 ? 11.804  14.989  0.657   1.00 2.63  ? 10 DA  E N3     2  
ATOM 5581  C C4     . DA  A 1 10 ? 11.793  15.381  1.944   1.00 2.68  ? 10 DA  E C4     2  
ATOM 5582  H "H5'"  . DA  A 1 10 ? 14.406  19.677  3.098   1.00 3.04  ? 10 DA  E "H5'"  2  
ATOM 5583  H "H5''" . DA  A 1 10 ? 13.753  21.313  2.901   1.00 3.16  ? 10 DA  E "H5''" 2  
ATOM 5584  H "H4'"  . DA  A 1 10 ? 13.444  20.413  0.808   1.00 3.02  ? 10 DA  E "H4'"  2  
ATOM 5585  H "H3'"  . DA  A 1 10 ? 11.151  21.118  1.929   1.00 3.14  ? 10 DA  E "H3'"  2  
ATOM 5586  H "H2'"  . DA  A 1 10 ? 10.679  19.037  3.108   1.00 2.97  ? 10 DA  E "H2'"  2  
ATOM 5587  H "H2''" . DA  A 1 10 ? 9.726   18.873  1.648   1.00 2.88  ? 10 DA  E "H2''" 2  
ATOM 5588  H "H1'"  . DA  A 1 10 ? 11.391  17.524  0.569   1.00 2.74  ? 10 DA  E "H1'"  2  
ATOM 5589  H H8     . DA  A 1 10 ? 11.743  17.422  4.443   1.00 2.94  ? 10 DA  E H8     2  
ATOM 5590  H H61    . DA  A 1 10 ? 11.826  12.561  4.766   1.00 2.90  ? 10 DA  E H61    2  
ATOM 5591  H H62    . DA  A 1 10 ? 11.852  11.276  3.574   1.00 2.85  ? 10 DA  E H62    2  
ATOM 5592  H H2     . DA  A 1 10 ? 11.843  13.260  -0.446  1.00 2.61  ? 10 DA  E H2     2  
ATOM 5593  P P      . DA  A 1 11 ? 9.846   21.062  -0.484  1.00 3.11  ? 11 DA  E P      2  
ATOM 5594  O OP1    . DA  A 1 11 ? 10.258  22.421  -0.920  1.00 3.30  ? 11 DA  E OP1    2  
ATOM 5595  O OP2    . DA  A 1 11 ? 8.745   20.905  0.499   1.00 3.11  ? 11 DA  E OP2    2  
ATOM 5596  O "O5'"  . DA  A 1 11 ? 9.480   20.210  -1.780  1.00 3.03  ? 11 DA  E "O5'"  2  
ATOM 5597  C "C5'"  . DA  A 1 11 ? 10.470  19.349  -2.349  1.00 2.98  ? 11 DA  E "C5'"  2  
ATOM 5598  C "C4'"  . DA  A 1 11 ? 9.846   18.290  -3.231  1.00 2.92  ? 11 DA  E "C4'"  2  
ATOM 5599  O "O4'"  . DA  A 1 11 ? 9.908   17.011  -2.550  1.00 2.76  ? 11 DA  E "O4'"  2  
ATOM 5600  C "C3'"  . DA  A 1 11 ? 8.361   18.486  -3.528  1.00 2.96  ? 11 DA  E "C3'"  2  
ATOM 5601  O "O3'"  . DA  A 1 11 ? 8.040   17.750  -4.704  1.00 2.99  ? 11 DA  E "O3'"  2  
ATOM 5602  C "C2'"  . DA  A 1 11 ? 7.679   17.814  -2.355  1.00 2.84  ? 11 DA  E "C2'"  2  
ATOM 5603  C "C1'"  . DA  A 1 11 ? 8.609   16.639  -2.093  1.00 2.71  ? 11 DA  E "C1'"  2  
ATOM 5604  N N9     . DA  A 1 11 ? 8.689   16.188  -0.704  1.00 2.64  ? 11 DA  E N9     2  
ATOM 5605  C C8     . DA  A 1 11 ? 8.774   16.926  0.445   1.00 2.69  ? 11 DA  E C8     2  
ATOM 5606  N N7     . DA  A 1 11 ? 8.776   16.203  1.541   1.00 2.67  ? 11 DA  E N7     2  
ATOM 5607  C C5     . DA  A 1 11 ? 8.690   14.896  1.078   1.00 2.60  ? 11 DA  E C5     2  
ATOM 5608  C C6     . DA  A 1 11 ? 8.639   13.649  1.742   1.00 2.60  ? 11 DA  E C6     2  
ATOM 5609  N N6     . DA  A 1 11 ? 8.650   13.510  3.070   1.00 2.67  ? 11 DA  E N6     2  
ATOM 5610  N N1     . DA  A 1 11 ? 8.566   12.536  0.978   1.00 2.59  ? 11 DA  E N1     2  
ATOM 5611  C C2     . DA  A 1 11 ? 8.536   12.673  -0.354  1.00 2.58  ? 11 DA  E C2     2  
ATOM 5612  N N3     . DA  A 1 11 ? 8.568   13.785  -1.088  1.00 2.58  ? 11 DA  E N3     2  
ATOM 5613  C C4     . DA  A 1 11 ? 8.649   14.872  -0.303  1.00 2.59  ? 11 DA  E C4     2  
ATOM 5614  H "H5'"  . DA  A 1 11 ? 11.027  18.860  -1.548  1.00 2.95  ? 11 DA  E "H5'"  2  
ATOM 5615  H "H5''" . DA  A 1 11 ? 11.163  19.942  -2.948  1.00 3.06  ? 11 DA  E "H5''" 2  
ATOM 5616  H "H4'"  . DA  A 1 11 ? 10.369  18.296  -4.187  1.00 2.98  ? 11 DA  E "H4'"  2  
ATOM 5617  H "H3'"  . DA  A 1 11 ? 8.091   19.534  -3.649  1.00 3.09  ? 11 DA  E "H3'"  2  
ATOM 5618  H "H2'"  . DA  A 1 11 ? 7.605   18.483  -1.498  1.00 2.88  ? 11 DA  E "H2'"  2  
ATOM 5619  H "H2''" . DA  A 1 11 ? 6.669   17.499  -2.614  1.00 2.83  ? 11 DA  E "H2''" 2  
ATOM 5620  H "H1'"  . DA  A 1 11 ? 8.298   15.785  -2.698  1.00 2.69  ? 11 DA  E "H1'"  2  
ATOM 5621  H H8     . DA  A 1 11 ? 8.822   18.003  0.445   1.00 2.77  ? 11 DA  E H8     2  
ATOM 5622  H H61    . DA  A 1 11 ? 8.696   14.333  3.655   1.00 2.73  ? 11 DA  E H61    2  
ATOM 5623  H H62    . DA  A 1 11 ? 8.595   12.593  3.490   1.00 2.71  ? 11 DA  E H62    2  
ATOM 5624  H H2     . DA  A 1 11 ? 8.476   11.742  -0.918  1.00 2.61  ? 11 DA  E H2     2  
ATOM 5625  P P      . DT  A 1 12 ? 6.736   18.100  -5.564  1.00 3.13  ? 12 DT  E P      2  
ATOM 5626  O OP1    . DT  A 1 12 ? 7.118   18.938  -6.729  1.00 3.34  ? 12 DT  E OP1    2  
ATOM 5627  O OP2    . DT  A 1 12 ? 5.666   18.561  -4.643  1.00 3.10  ? 12 DT  E OP2    2  
ATOM 5628  O "O5'"  . DT  A 1 12 ? 6.358   16.647  -6.090  1.00 3.07  ? 12 DT  E "O5'"  2  
ATOM 5629  C "C5'"  . DT  A 1 12 ? 7.330   15.605  -5.977  1.00 2.99  ? 12 DT  E "C5'"  2  
ATOM 5630  C "C4'"  . DT  A 1 12 ? 6.694   14.237  -6.074  1.00 2.96  ? 12 DT  E "C4'"  2  
ATOM 5631  O "O4'"  . DT  A 1 12 ? 6.701   13.616  -4.764  1.00 2.81  ? 12 DT  E "O4'"  2  
ATOM 5632  C "C3'"  . DT  A 1 12 ? 5.222   14.257  -6.477  1.00 3.02  ? 12 DT  E "C3'"  2  
ATOM 5633  O "O3'"  . DT  A 1 12 ? 4.892   12.979  -7.010  1.00 3.08  ? 12 DT  E "O3'"  2  
ATOM 5634  C "C2'"  . DT  A 1 12 ? 4.499   14.424  -5.153  1.00 2.88  ? 12 DT  E "C2'"  2  
ATOM 5635  C "C1'"  . DT  A 1 12 ? 5.383   13.602  -4.225  1.00 2.76  ? 12 DT  E "C1'"  2  
ATOM 5636  N N1     . DT  A 1 12 ? 5.417   14.004  -2.798  1.00 2.66  ? 12 DT  E N1     2  
ATOM 5637  C C2     . DT  A 1 12 ? 5.425   12.972  -1.880  1.00 2.61  ? 12 DT  E C2     2  
ATOM 5638  O O2     . DT  A 1 12 ? 5.467   11.795  -2.201  1.00 2.63  ? 12 DT  E O2     2  
ATOM 5639  N N3     . DT  A 1 12 ? 5.380   13.364  -0.571  1.00 2.58  ? 12 DT  E N3     2  
ATOM 5640  C C4     . DT  A 1 12 ? 5.337   14.652  -0.090  1.00 2.61  ? 12 DT  E C4     2  
ATOM 5641  O O4     . DT  A 1 12 ? 5.251   14.846  1.125   1.00 2.64  ? 12 DT  E O4     2  
ATOM 5642  C C5     . DT  A 1 12 ? 5.356   15.691  -1.099  1.00 2.67  ? 12 DT  E C5     2  
ATOM 5643  C C7     . DT  A 1 12 ? 5.250   17.119  -0.663  1.00 2.76  ? 12 DT  E C7     2  
ATOM 5644  C C6     . DT  A 1 12 ? 5.404   15.322  -2.395  1.00 2.69  ? 12 DT  E C6     2  
ATOM 5645  H "H5'"  . DT  A 1 12 ? 7.841   15.690  -5.017  1.00 2.89  ? 12 DT  E "H5'"  2  
ATOM 5646  H "H5''" . DT  A 1 12 ? 8.065   15.709  -6.775  1.00 3.09  ? 12 DT  E "H5''" 2  
ATOM 5647  H "H4'"  . DT  A 1 12 ? 7.231   13.665  -6.834  1.00 3.04  ? 12 DT  E "H4'"  2  
ATOM 5648  H "H3'"  . DT  A 1 12 ? 4.992   15.040  -7.197  1.00 3.14  ? 12 DT  E "H3'"  2  
ATOM 5649  H "H2'"  . DT  A 1 12 ? 4.449   15.472  -4.857  1.00 2.90  ? 12 DT  E "H2'"  2  
ATOM 5650  H "H2''" . DT  A 1 12 ? 3.480   14.047  -5.210  1.00 2.89  ? 12 DT  E "H2''" 2  
ATOM 5651  H "H1'"  . DT  A 1 12 ? 5.055   12.559  -4.256  1.00 2.77  ? 12 DT  E "H1'"  2  
ATOM 5652  H H3     . DT  A 1 12 ? 5.353   12.625  0.121   1.00 2.58  ? 12 DT  E H3     2  
ATOM 5653  H H71    . DT  A 1 12 ? 4.971   17.743  -1.512  1.00 2.87  ? 12 DT  E H71    2  
ATOM 5654  H H72    . DT  A 1 12 ? 4.490   17.204  0.114   1.00 3.10  ? 12 DT  E H72    2  
ATOM 5655  H H73    . DT  A 1 12 ? 6.209   17.451  -0.267  1.00 2.88  ? 12 DT  E H73    2  
ATOM 5656  H H6     . DT  A 1 12 ? 5.434   16.100  -3.156  1.00 2.78  ? 12 DT  E H6     2  
ATOM 5657  P P      . DT  A 1 13 ? 3.626   12.789  -7.969  1.00 3.22  ? 13 DT  E P      2  
ATOM 5658  O OP1    . DT  A 1 13 ? 4.069   12.786  -9.386  1.00 3.44  ? 13 DT  E OP1    2  
ATOM 5659  O OP2    . DT  A 1 13 ? 2.543   13.713  -7.540  1.00 3.18  ? 13 DT  E OP2    2  
ATOM 5660  O "O5'"  . DT  A 1 13 ? 3.206   11.306  -7.573  1.00 3.19  ? 13 DT  E "O5'"  2  
ATOM 5661  C "C5'"  . DT  A 1 13 ? 4.137   10.495  -6.851  1.00 3.11  ? 13 DT  E "C5'"  2  
ATOM 5662  C "C4'"  . DT  A 1 13 ? 3.453   9.330   -6.175  1.00 3.08  ? 13 DT  E "C4'"  2  
ATOM 5663  O "O4'"  . DT  A 1 13 ? 3.408   9.570   -4.746  1.00 2.92  ? 13 DT  E "O4'"  2  
ATOM 5664  C "C3'"  . DT  A 1 13 ? 1.992   9.147   -6.575  1.00 3.14  ? 13 DT  E "C3'"  2  
ATOM 5665  O "O3'"  . DT  A 1 13 ? 1.639   7.791   -6.315  1.00 3.18  ? 13 DT  E "O3'"  2  
ATOM 5666  C "C2'"  . DT  A 1 13 ? 1.250   10.055  -5.613  1.00 3.02  ? 13 DT  E "C2'"  2  
ATOM 5667  C "C1'"  . DT  A 1 13 ? 2.079   9.892   -4.346  1.00 2.89  ? 13 DT  E "C1'"  2  
ATOM 5668  N N1     . DT  A 1 13 ? 2.106   11.031  -3.399  1.00 2.79  ? 13 DT  E N1     2  
ATOM 5669  C C2     . DT  A 1 13 ? 2.081   10.707  -2.055  1.00 2.73  ? 13 DT  E C2     2  
ATOM 5670  O O2     . DT  A 1 13 ? 2.089   9.556   -1.647  1.00 2.75  ? 13 DT  E O2     2  
ATOM 5671  N N3     . DT  A 1 13 ? 2.041   11.777  -1.203  1.00 2.69  ? 13 DT  E N3     2  
ATOM 5672  C C4     . DT  A 1 13 ? 2.032   13.110  -1.543  1.00 2.72  ? 13 DT  E C4     2  
ATOM 5673  O O4     . DT  A 1 13 ? 1.970   13.965  -0.659  1.00 2.73  ? 13 DT  E O4     2  
ATOM 5674  C C5     . DT  A 1 13 ? 2.079   13.385  -2.966  1.00 2.79  ? 13 DT  E C5     2  
ATOM 5675  C C7     . DT  A 1 13 ? 2.007   14.807  -3.423  1.00 2.87  ? 13 DT  E C7     2  
ATOM 5676  C C6     . DT  A 1 13 ? 2.124   12.346  -3.818  1.00 2.82  ? 13 DT  E C6     2  
ATOM 5677  H "H5'"  . DT  A 1 13 ? 4.634   11.102  -6.094  1.00 3.03  ? 13 DT  E "H5'"  2  
ATOM 5678  H "H5''" . DT  A 1 13 ? 4.888   10.108  -7.540  1.00 3.20  ? 13 DT  E "H5''" 2  
ATOM 5679  H "H4'"  . DT  A 1 13 ? 3.981   8.416   -6.449  1.00 3.15  ? 13 DT  E "H4'"  2  
ATOM 5680  H "H3'"  . DT  A 1 13 ? 1.814   9.387   -7.622  1.00 3.26  ? 13 DT  E "H3'"  2  
ATOM 5681  H "H2'"  . DT  A 1 13 ? 1.241   11.084  -5.970  1.00 3.04  ? 13 DT  E "H2'"  2  
ATOM 5682  H "H2''" . DT  A 1 13 ? 0.215   9.743   -5.494  1.00 3.03  ? 13 DT  E "H2''" 2  
ATOM 5683  H "H1'"  . DT  A 1 13 ? 1.711   9.023   -3.792  1.00 2.88  ? 13 DT  E "H1'"  2  
ATOM 5684  H H3     . DT  A 1 13 ? 2.000   11.573  -0.212  1.00 2.67  ? 13 DT  E H3     2  
ATOM 5685  H H71    . DT  A 1 13 ? 2.961   15.300  -3.235  1.00 3.45  ? 13 DT  E H71    2  
ATOM 5686  H H72    . DT  A 1 13 ? 1.787   14.837  -4.489  1.00 2.94  ? 13 DT  E H72    2  
ATOM 5687  H H73    . DT  A 1 13 ? 1.220   15.325  -2.877  1.00 2.79  ? 13 DT  E H73    2  
ATOM 5688  H H6     . DT  A 1 13 ? 2.179   12.550  -4.886  1.00 2.91  ? 13 DT  E H6     2  
ATOM 5689  P P      . DA  A 1 14 ? 0.401   7.105   -7.067  1.00 3.32  ? 14 DA  E P      2  
ATOM 5690  O OP1    . DA  A 1 14 ? 0.889   6.318   -8.227  1.00 3.54  ? 14 DA  E OP1    2  
ATOM 5691  O OP2    . DA  A 1 14 ? -0.669  8.118   -7.261  1.00 3.28  ? 14 DA  E OP2    2  
ATOM 5692  O "O5'"  . DA  A 1 14 ? -0.075  6.080   -5.945  1.00 3.29  ? 14 DA  E "O5'"  2  
ATOM 5693  C "C5'"  . DA  A 1 14 ? 0.817   5.770   -4.872  1.00 3.23  ? 14 DA  E "C5'"  2  
ATOM 5694  C "C4'"  . DA  A 1 14 ? 0.072   5.291   -3.648  1.00 3.17  ? 14 DA  E "C4'"  2  
ATOM 5695  O "O4'"  . DA  A 1 14 ? -0.009  6.376   -2.689  1.00 2.99  ? 14 DA  E "O4'"  2  
ATOM 5696  C "C3'"  . DA  A 1 14 ? -1.382  4.894   -3.892  1.00 3.24  ? 14 DA  E "C3'"  2  
ATOM 5697  O "O3'"  . DA  A 1 14 ? -1.778  4.015   -2.846  1.00 3.27  ? 14 DA  E "O3'"  2  
ATOM 5698  C "C2'"  . DA  A 1 14 ? -2.129  6.205   -3.750  1.00 3.08  ? 14 DA  E "C2'"  2  
ATOM 5699  C "C1'"  . DA  A 1 14 ? -1.338  6.891   -2.646  1.00 2.94  ? 14 DA  E "C1'"  2  
ATOM 5700  N N9     . DA  A 1 14 ? -1.296  8.353   -2.705  1.00 2.83  ? 14 DA  E N9     2  
ATOM 5701  C C8     . DA  A 1 14 ? -1.267  9.180   -3.798  1.00 2.86  ? 14 DA  E C8     2  
ATOM 5702  N N7     . DA  A 1 14 ? -1.287  10.459  -3.494  1.00 2.79  ? 14 DA  E N7     2  
ATOM 5703  C C5     . DA  A 1 14 ? -1.329  10.471  -2.105  1.00 2.69  ? 14 DA  E C5     2  
ATOM 5704  C C6     . DA  A 1 14 ? -1.375  11.519  -1.159  1.00 2.63  ? 14 DA  E C6     2  
ATOM 5705  N N6     . DA  A 1 14 ? -1.402  12.816  -1.479  1.00 2.65  ? 14 DA  E N6     2  
ATOM 5706  N N1     . DA  A 1 14 ? -1.400  11.183  0.149   1.00 2.61  ? 14 DA  E N1     2  
ATOM 5707  C C2     . DA  A 1 14 ? -1.387  9.885   0.476   1.00 2.64  ? 14 DA  E C2     2  
ATOM 5708  N N3     . DA  A 1 14 ? -1.352  8.815   -0.315  1.00 2.70  ? 14 DA  E N3     2  
ATOM 5709  C C4     . DA  A 1 14 ? -1.323  9.182   -1.608  1.00 2.72  ? 14 DA  E C4     2  
ATOM 5710  H "H5'"  . DA  A 1 14 ? 1.388   6.662   -4.612  1.00 3.10  ? 14 DA  E "H5'"  2  
ATOM 5711  H "H5''" . DA  A 1 14 ? 1.507   4.992   -5.189  1.00 3.37  ? 14 DA  E "H5''" 2  
ATOM 5712  H "H4'"  . DA  A 1 14 ? 0.587   4.409   -3.262  1.00 3.26  ? 14 DA  E "H4'"  2  
ATOM 5713  H "H3'"  . DA  A 1 14 ? -1.526  4.419   -4.859  1.00 3.37  ? 14 DA  E "H3'"  2  
ATOM 5714  H "H2'"  . DA  A 1 14 ? -2.113  6.771   -4.681  1.00 3.11  ? 14 DA  E "H2'"  2  
ATOM 5715  H "H2''" . DA  A 1 14 ? -3.170  6.035   -3.490  1.00 3.09  ? 14 DA  E "H2''" 2  
ATOM 5716  H "H1'"  . DA  A 1 14 ? -1.751  6.613   -1.674  1.00 2.93  ? 14 DA  E "H1'"  2  
ATOM 5717  H H8     . DA  A 1 14 ? -1.238  8.815   -4.813  1.00 2.98  ? 14 DA  E H8     2  
ATOM 5718  H H61    . DA  A 1 14 ? -1.390  13.095  -2.450  1.00 2.71  ? 14 DA  E H61    2  
ATOM 5719  H H62    . DA  A 1 14 ? -1.444  13.521  -0.757  1.00 2.65  ? 14 DA  E H62    2  
ATOM 5720  H H2     . DA  A 1 14 ? -1.409  9.674   1.546   1.00 2.67  ? 14 DA  E H2     2  
ATOM 5721  P P      . DT  A 1 15 ? -3.016  3.021   -3.036  1.00 3.41  ? 15 DT  E P      2  
ATOM 5722  O OP1    . DT  A 1 15 ? -2.525  1.695   -3.494  1.00 3.62  ? 15 DT  E OP1    2  
ATOM 5723  O OP2    . DT  A 1 15 ? -4.084  3.713   -3.800  1.00 3.38  ? 15 DT  E OP2    2  
ATOM 5724  O "O5'"  . DT  A 1 15 ? -3.493  2.878   -1.524  1.00 3.36  ? 15 DT  E "O5'"  2  
ATOM 5725  C "C5'"  . DT  A 1 15 ? -2.590  3.243   -0.480  1.00 3.28  ? 15 DT  E "C5'"  2  
ATOM 5726  C "C4'"  . DT  A 1 15 ? -3.323  3.542   0.805   1.00 3.23  ? 15 DT  E "C4'"  2  
ATOM 5727  O "O4'"  . DT  A 1 15 ? -3.370  4.979   0.996   1.00 3.05  ? 15 DT  E "O4'"  2  
ATOM 5728  C "C3'"  . DT  A 1 15 ? -4.788  3.111   0.794   1.00 3.30  ? 15 DT  E "C3'"  2  
ATOM 5729  O "O3'"  . DT  A 1 15 ? -5.231  2.966   2.137   1.00 3.35  ? 15 DT  E "O3'"  2  
ATOM 5730  C "C2'"  . DT  A 1 15 ? -5.497  4.301   0.183   1.00 3.15  ? 15 DT  E "C2'"  2  
ATOM 5731  C "C1'"  . DT  A 1 15 ? -4.689  5.457   0.753   1.00 3.01  ? 15 DT  E "C1'"  2  
ATOM 5732  N N1     . DT  A 1 15 ? -4.634  6.691   -0.061  1.00 2.88  ? 15 DT  E N1     2  
ATOM 5733  C C2     . DT  A 1 15 ? -4.645  7.879   0.640   1.00 2.79  ? 15 DT  E C2     2  
ATOM 5734  O O2     . DT  A 1 15 ? -4.625  7.933   1.859   1.00 2.81  ? 15 DT  E O2     2  
ATOM 5735  N N3     . DT  A 1 15 ? -4.682  9.004   -0.136  1.00 2.73  ? 15 DT  E N3     2  
ATOM 5736  C C4     . DT  A 1 15 ? -4.699  9.068   -1.510  1.00 2.76  ? 15 DT  E C4     2  
ATOM 5737  O O4     . DT  A 1 15 ? -4.783  10.161  -2.067  1.00 2.75  ? 15 DT  E O4     2  
ATOM 5738  C C5     . DT  A 1 15 ? -4.660  7.791   -2.189  1.00 2.86  ? 15 DT  E C5     2  
ATOM 5739  C C7     . DT  A 1 15 ? -4.757  7.770   -3.683  1.00 2.97  ? 15 DT  E C7     2  
ATOM 5740  C C6     . DT  A 1 15 ? -4.617  6.672   -1.443  1.00 2.92  ? 15 DT  E C6     2  
ATOM 5741  H "H5'"  . DT  A 1 15 ? -2.025  4.125   -0.782  1.00 3.17  ? 15 DT  E "H5'"  2  
ATOM 5742  H "H5''" . DT  A 1 15 ? -1.892  2.424   -0.302  1.00 3.38  ? 15 DT  E "H5''" 2  
ATOM 5743  H "H4'"  . DT  A 1 15 ? -2.831  3.005   1.618   1.00 3.32  ? 15 DT  E "H4'"  2  
ATOM 5744  H "H3'"  . DT  A 1 15 ? -4.946  2.187   0.244   1.00 3.42  ? 15 DT  E "H3'"  2  
ATOM 5745  H "H2'"  . DT  A 1 15 ? -5.460  4.266   -0.906  1.00 3.16  ? 15 DT  E "H2'"  2  
ATOM 5746  H "H2''" . DT  A 1 15 ? -6.545  4.326   0.474   1.00 3.15  ? 15 DT  E "H2''" 2  
ATOM 5747  H "H1'"  . DT  A 1 15 ? -5.097  5.733   1.730   1.00 3.00  ? 15 DT  E "H1'"  2  
ATOM 5748  H H3     . DT  A 1 15 ? -4.722  9.888   0.348   1.00 2.69  ? 15 DT  E H3     2  
ATOM 5749  H H71    . DT  A 1 15 ? -5.555  8.440   -4.004  1.00 3.26  ? 15 DT  E H71    2  
ATOM 5750  H H72    . DT  A 1 15 ? -4.976  6.758   -4.024  1.00 3.18  ? 15 DT  E H72    2  
ATOM 5751  H H73    . DT  A 1 15 ? -3.814  8.102   -4.115  1.00 2.91  ? 15 DT  E H73    2  
ATOM 5752  H H6     . DT  A 1 15 ? -4.563  5.710   -1.949  1.00 3.03  ? 15 DT  E H6     2  
ATOM 5753  P P      . DT  A 1 16 ? -6.532  2.095   2.484   1.00 3.49  ? 16 DT  E P      2  
ATOM 5754  O OP1    . DT  A 1 16 ? -6.130  0.736   2.929   1.00 3.70  ? 16 DT  E OP1    2  
ATOM 5755  O OP2    . DT  A 1 16 ? -7.524  2.248   1.391   1.00 3.45  ? 16 DT  E OP2    2  
ATOM 5756  O "O5'"  . DT  A 1 16 ? -7.059  2.899   3.753   1.00 3.44  ? 16 DT  E "O5'"  2  
ATOM 5757  C "C5'"  . DT  A 1 16 ? -6.162  3.806   4.398   1.00 3.36  ? 16 DT  E "C5'"  2  
ATOM 5758  C "C4'"  . DT  A 1 16 ? -6.900  4.877   5.167   1.00 3.31  ? 16 DT  E "C4'"  2  
ATOM 5759  O "O4'"  . DT  A 1 16 ? -6.879  6.110   4.405   1.00 3.14  ? 16 DT  E "O4'"  2  
ATOM 5760  C "C3'"  . DT  A 1 16 ? -8.383  4.594   5.383   1.00 3.39  ? 16 DT  E "C3'"  2  
ATOM 5761  O "O3'"  . DT  A 1 16 ? -8.799  5.379   6.495   1.00 3.44  ? 16 DT  E "O3'"  2  
ATOM 5762  C "C2'"  . DT  A 1 16 ? -9.034  5.142   4.126   1.00 3.26  ? 16 DT  E "C2'"  2  
ATOM 5763  C "C1'"  . DT  A 1 16 ? -8.168  6.365   3.861   1.00 3.11  ? 16 DT  E "C1'"  2  
ATOM 5764  N N1     . DT  A 1 16 ? -8.036  6.809   2.457   1.00 3.01  ? 16 DT  E N1     2  
ATOM 5765  C C2     . DT  A 1 16 ? -7.998  8.174   2.265   1.00 2.92  ? 16 DT  E C2     2  
ATOM 5766  O O2     . DT  A 1 16 ? -8.010  8.974   3.187   1.00 2.93  ? 16 DT  E O2     2  
ATOM 5767  N N3     . DT  A 1 16 ? -7.947  8.570   0.959   1.00 2.87  ? 16 DT  E N3     2  
ATOM 5768  C C4     . DT  A 1 16 ? -7.920  7.764   -0.155  1.00 2.90  ? 16 DT  E C4     2  
ATOM 5769  O O4     . DT  A 1 16 ? -7.892  8.275   -1.273  1.00 2.90  ? 16 DT  E O4     2  
ATOM 5770  C C5     . DT  A 1 16 ? -7.942  6.339   0.111   1.00 2.99  ? 16 DT  E C5     2  
ATOM 5771  C C7     . DT  A 1 16 ? -7.977  5.391   -1.046  1.00 3.08  ? 16 DT  E C7     2  
ATOM 5772  C C6     . DT  A 1 16 ? -7.990  5.932   1.393   1.00 3.04  ? 16 DT  E C6     2  
ATOM 5773  H "H5'"  . DT  A 1 16 ? -5.532  4.282   3.649   1.00 3.25  ? 16 DT  E "H5'"  2  
ATOM 5774  H "H5''" . DT  A 1 16 ? -5.526  3.253   5.091   1.00 3.46  ? 16 DT  E "H5''" 2  
ATOM 5775  H "H4'"  . DT  A 1 16 ? -6.441  4.967   6.152   1.00 3.38  ? 16 DT  E "H4'"  2  
ATOM 5776  H "H3'"  . DT  A 1 16 ? -8.592  3.541   5.561   1.00 3.52  ? 16 DT  E "H3'"  2  
ATOM 5777  H "H2'"  . DT  A 1 16 ? -8.987  4.419   3.312   1.00 3.28  ? 16 DT  E "H2'"  2  
ATOM 5778  H "H2''" . DT  A 1 16 ? -10.084 5.375   4.293   1.00 3.27  ? 16 DT  E "H2''" 2  
ATOM 5779  H "H1'"  . DT  A 1 16 ? -8.570  7.211   4.425   1.00 3.10  ? 16 DT  E "H1'"  2  
ATOM 5780  H H3     . DT  A 1 16 ? -7.955  9.567   0.793   1.00 2.84  ? 16 DT  E H3     2  
ATOM 5781  H H71    . DT  A 1 16 ? -8.173  4.381   -0.686  1.00 3.29  ? 16 DT  E H71    2  
ATOM 5782  H H72    . DT  A 1 16 ? -8.767  5.688   -1.736  1.00 3.10  ? 16 DT  E H72    2  
ATOM 5783  H H73    . DT  A 1 16 ? -7.019  5.414   -1.565  1.00 3.40  ? 16 DT  E H73    2  
ATOM 5784  H H6     . DT  A 1 16 ? -7.990  4.861   1.600   1.00 3.13  ? 16 DT  E H6     2  
ATOM 5785  P P      . DG  A 1 17 ? -10.091 4.983   7.347   1.00 3.61  ? 17 DG  E P      2  
ATOM 5786  O OP1    . DG  A 1 17 ? -9.671  4.235   8.554   1.00 3.84  ? 17 DG  E OP1    2  
ATOM 5787  O OP2    . DG  A 1 17 ? -11.123 4.405   6.446   1.00 3.56  ? 17 DG  E OP2    2  
ATOM 5788  O "O5'"  . DG  A 1 17 ? -10.573 6.427   7.812   1.00 3.57  ? 17 DG  E "O5'"  2  
ATOM 5789  C "C5'"  . DG  A 1 17 ? -9.620  7.494   7.857   1.00 3.50  ? 17 DG  E "C5'"  2  
ATOM 5790  C "C4'"  . DG  A 1 17 ? -10.299 8.841   7.940   1.00 3.48  ? 17 DG  E "C4'"  2  
ATOM 5791  O "O4'"  . DG  A 1 17 ? -10.183 9.512   6.661   1.00 3.30  ? 17 DG  E "O4'"  2  
ATOM 5792  C "C3'"  . DG  A 1 17 ? -11.803 8.759   8.190   1.00 3.57  ? 17 DG  E "C3'"  2  
ATOM 5793  O "O3'"  . DG  A 1 17 ? -12.231 10.010  8.718   1.00 3.64  ? 17 DG  E "O3'"  2  
ATOM 5794  C "C2'"  . DG  A 1 17 ? -12.384 8.622   6.797   1.00 3.42  ? 17 DG  E "C2'"  2  
ATOM 5795  C "C1'"  . DG  A 1 17 ? -11.443 9.511   6.000   1.00 3.27  ? 17 DG  E "C1'"  2  
ATOM 5796  N N9     . DG  A 1 17 ? -11.261 9.170   4.593   1.00 3.14  ? 17 DG  E N9     2  
ATOM 5797  C C8     . DG  A 1 17 ? -11.026 7.938   4.036   1.00 3.13  ? 17 DG  E C8     2  
ATOM 5798  N N7     . DG  A 1 17 ? -10.973 7.965   2.730   1.00 3.04  ? 17 DG  E N7     2  
ATOM 5799  C C5     . DG  A 1 17 ? -11.174 9.303   2.407   1.00 2.98  ? 17 DG  E C5     2  
ATOM 5800  C C6     . DG  A 1 17 ? -11.227 9.955   1.143   1.00 2.92  ? 17 DG  E C6     2  
ATOM 5801  O O6     . DG  A 1 17 ? -11.106 9.465   0.017   1.00 2.91  ? 17 DG  E O6     2  
ATOM 5802  N N1     . DG  A 1 17 ? -11.451 11.321  1.279   1.00 2.93  ? 17 DG  E N1     2  
ATOM 5803  C C2     . DG  A 1 17 ? -11.601 11.982  2.472   1.00 2.99  ? 17 DG  E C2     2  
ATOM 5804  N N2     . DG  A 1 17 ? -11.802 13.307  2.396   1.00 3.04  ? 17 DG  E N2     2  
ATOM 5805  N N3     . DG  A 1 17 ? -11.553 11.391  3.654   1.00 3.05  ? 17 DG  E N3     2  
ATOM 5806  C C4     . DG  A 1 17 ? -11.340 10.059  3.547   1.00 3.04  ? 17 DG  E C4     2  
ATOM 5807  H "H5'"  . DG  A 1 17 ? -9.002  7.463   6.960   1.00 3.39  ? 17 DG  E "H5'"  2  
ATOM 5808  H "H5''" . DG  A 1 17 ? -8.980  7.370   8.731   1.00 3.59  ? 17 DG  E "H5''" 2  
ATOM 5809  H "H4'"  . DG  A 1 17 ? -9.861  9.396   8.769   1.00 3.57  ? 17 DG  E "H4'"  2  
ATOM 5810  H "H3'"  . DG  A 1 17 ? -12.077 7.948   8.862   1.00 3.69  ? 17 DG  E "H3'"  2  
ATOM 5811  H "H2'"  . DG  A 1 17 ? -12.358 7.586   6.458   1.00 3.41  ? 17 DG  E "H2'"  2  
ATOM 5812  H "H2''" . DG  A 1 17 ? -13.421 8.945   6.769   1.00 3.44  ? 17 DG  E "H2''" 2  
ATOM 5813  H "H1'"  . DG  A 1 17 ? -11.808 10.541  6.036   1.00 3.28  ? 17 DG  E "H1'"  2  
ATOM 5814  H H8     . DG  A 1 17 ? -10.902 7.038   4.618   1.00 3.22  ? 17 DG  E H8     2  
ATOM 5815  H H1     . DG  A 1 17 ? -11.507 11.864  0.427   1.00 2.92  ? 17 DG  E H1     2  
ATOM 5816  H H21    . DG  A 1 17 ? -11.919 13.848  3.241   1.00 3.12  ? 17 DG  E H21    2  
ATOM 5817  H H22    . DG  A 1 17 ? -11.840 13.768  1.495   1.00 3.03  ? 17 DG  E H22    2  
ATOM 5818  P P      . DG  A 1 18 ? -13.604 10.134  9.527   1.00 3.81  ? 18 DG  E P      2  
ATOM 5819  O OP1    . DG  A 1 18 ? -13.323 10.149  10.985  1.00 4.03  ? 18 DG  E OP1    2  
ATOM 5820  O OP2    . DG  A 1 18 ? -14.577 9.157   8.976   1.00 3.77  ? 18 DG  E OP2    2  
ATOM 5821  O "O5'"  . DG  A 1 18 ? -14.037 11.601  9.087   1.00 3.80  ? 18 DG  E "O5'"  2  
ATOM 5822  C "C5'"  . DG  A 1 18 ? -13.090 12.418  8.391   1.00 3.73  ? 18 DG  E "C5'"  2  
ATOM 5823  C "C4'"  . DG  A 1 18 ? -13.770 13.517  7.607   1.00 3.69  ? 18 DG  E "C4'"  2  
ATOM 5824  O "O4'"  . DG  A 1 18 ? -13.712 13.202  6.194   1.00 3.50  ? 18 DG  E "O4'"  2  
ATOM 5825  C "C3'"  . DG  A 1 18 ? -15.260 13.654  7.908   1.00 3.79  ? 18 DG  E "C3'"  2  
ATOM 5826  O "O3'"  . DG  A 1 18 ? -15.663 14.973  7.550   1.00 3.83  ? 18 DG  E "O3'"  2  
ATOM 5827  C "C2'"  . DG  A 1 18 ? -15.899 12.665  6.955   1.00 3.66  ? 18 DG  E "C2'"  2  
ATOM 5828  C "C1'"  . DG  A 1 18 ? -14.999 12.806  5.735   1.00 3.49  ? 18 DG  E "C1'"  2  
ATOM 5829  N N9     . DG  A 1 18 ? -14.873 11.633  4.876   1.00 3.37  ? 18 DG  E N9     2  
ATOM 5830  C C8     . DG  A 1 18 ? -14.789 10.311  5.235   1.00 3.38  ? 18 DG  E C8     2  
ATOM 5831  N N7     . DG  A 1 18 ? -14.739 9.501   4.210   1.00 3.30  ? 18 DG  E N7     2  
ATOM 5832  C C5     . DG  A 1 18 ? -14.791 10.345  3.105   1.00 3.23  ? 18 DG  E C5     2  
ATOM 5833  C C6     . DG  A 1 18 ? -14.780 10.055  1.707   1.00 3.17  ? 18 DG  E C6     2  
ATOM 5834  O O6     . DG  A 1 18 ? -14.722 8.950   1.141   1.00 3.16  ? 18 DG  E O6     2  
ATOM 5835  N N1     . DG  A 1 18 ? -14.851 11.217  0.944   1.00 3.15  ? 18 DG  E N1     2  
ATOM 5836  C C2     . DG  A 1 18 ? -14.915 12.492  1.451   1.00 3.20  ? 18 DG  E C2     2  
ATOM 5837  N N2     . DG  A 1 18 ? -14.969 13.492  0.555   1.00 3.22  ? 18 DG  E N2     2  
ATOM 5838  N N3     . DG  A 1 18 ? -14.923 12.774  2.740   1.00 3.26  ? 18 DG  E N3     2  
ATOM 5839  C C4     . DG  A 1 18 ? -14.861 11.663  3.503   1.00 3.27  ? 18 DG  E C4     2  
ATOM 5840  H "H5'"  . DG  A 1 18 ? -12.516 11.797  7.701   1.00 3.60  ? 18 DG  E "H5'"  2  
ATOM 5841  H "H5''" . DG  A 1 18 ? -12.405 12.870  9.107   1.00 3.84  ? 18 DG  E "H5''" 2  
ATOM 5842  H "H4'"  . DG  A 1 18 ? -13.297 14.465  7.866   1.00 3.75  ? 18 DG  E "H4'"  2  
ATOM 5843  H "H3'"  . DG  A 1 18 ? -15.493 13.459  8.953   1.00 3.93  ? 18 DG  E "H3'"  2  
ATOM 5844  H "H2'"  . DG  A 1 18 ? -15.877 11.655  7.367   1.00 3.67  ? 18 DG  E "H2'"  2  
ATOM 5845  H "H2''" . DG  A 1 18 ? -16.939 12.913  6.770   1.00 3.69  ? 18 DG  E "H2''" 2  
ATOM 5846  H "H1'"  . DG  A 1 18 ? -15.366 13.626  5.111   1.00 3.48  ? 18 DG  E "H1'"  2  
ATOM 5847  H H8     . DG  A 1 18 ? -14.781 9.976   6.261   1.00 3.48  ? 18 DG  E H8     2  
ATOM 5848  H H1     . DG  A 1 18 ? -14.858 11.115  -0.061  1.00 3.14  ? 18 DG  E H1     2  
ATOM 5849  H H21    . DG  A 1 18 ? -15.018 14.452  0.865   1.00 3.27  ? 18 DG  E H21    2  
ATOM 5850  H H22    . DG  A 1 18 ? -14.965 13.298  -0.439  1.00 3.20  ? 18 DG  E H22    2  
ATOM 5851  P P      . DA  A 1 19 ? -16.971 15.630  8.195   1.00 4.01  ? 19 DA  E P      2  
ATOM 5852  O OP1    . DA  A 1 19 ? -16.587 16.480  9.352   1.00 4.19  ? 19 DA  E OP1    2  
ATOM 5853  O OP2    . DA  A 1 19 ? -17.997 14.572  8.370   1.00 4.02  ? 19 DA  E OP2    2  
ATOM 5854  O "O5'"  . DA  A 1 19 ? -17.440 16.590  7.016   1.00 3.96  ? 19 DA  E "O5'"  2  
ATOM 5855  C "C5'"  . DA  A 1 19 ? -16.510 16.942  5.989   1.00 3.84  ? 19 DA  E "C5'"  2  
ATOM 5856  C "C4'"  . DA  A 1 19 ? -17.220 17.318  4.709   1.00 3.81  ? 19 DA  E "C4'"  2  
ATOM 5857  O "O4'"  . DA  A 1 19 ? -17.195 16.188  3.804   1.00 3.64  ? 19 DA  E "O4'"  2  
ATOM 5858  C "C3'"  . DA  A 1 19 ? -18.703 17.634  4.885   1.00 3.92  ? 19 DA  E "C3'"  2  
ATOM 5859  O "O3'"  . DA  A 1 19 ? -19.111 18.442  3.781   1.00 3.96  ? 19 DA  E "O3'"  2  
ATOM 5860  C "C2'"  . DA  A 1 19 ? -19.362 16.273  4.777   1.00 3.82  ? 19 DA  E "C2'"  2  
ATOM 5861  C "C1'"  . DA  A 1 19 ? -18.489 15.601  3.727   1.00 3.66  ? 19 DA  E "C1'"  2  
ATOM 5862  N N9     . DA  A 1 19 ? -18.370 14.146  3.826   1.00 3.56  ? 19 DA  E N9     2  
ATOM 5863  C C8     . DA  A 1 19 ? -18.280 13.348  4.935   1.00 3.59  ? 19 DA  E C8     2  
ATOM 5864  N N7     . DA  A 1 19 ? -18.225 12.065  4.660   1.00 3.52  ? 19 DA  E N7     2  
ATOM 5865  C C5     . DA  A 1 19 ? -18.281 12.019  3.273   1.00 3.43  ? 19 DA  E C5     2  
ATOM 5866  C C6     . DA  A 1 19 ? -18.270 10.950  2.352   1.00 3.36  ? 19 DA  E C6     2  
ATOM 5867  N N6     . DA  A 1 19 ? -18.200 9.665   2.700   1.00 3.36  ? 19 DA  E N6     2  
ATOM 5868  N N1     . DA  A 1 19 ? -18.340 11.254  1.038   1.00 3.33  ? 19 DA  E N1     2  
ATOM 5869  C C2     . DA  A 1 19 ? -18.417 12.543  0.681   1.00 3.36  ? 19 DA  E C2     2  
ATOM 5870  N N3     . DA  A 1 19 ? -18.433 13.628  1.448   1.00 3.43  ? 19 DA  E N3     2  
ATOM 5871  C C4     . DA  A 1 19 ? -18.363 13.294  2.748   1.00 3.45  ? 19 DA  E C4     2  
ATOM 5872  H "H5'"  . DA  A 1 19 ? -15.851 16.096  5.792   1.00 3.73  ? 19 DA  E "H5'"  2  
ATOM 5873  H "H5''" . DA  A 1 19 ? -15.907 17.788  6.320   1.00 3.92  ? 19 DA  E "H5''" 2  
ATOM 5874  H "H4'"  . DA  A 1 19 ? -16.744 18.214  4.306   1.00 3.85  ? 19 DA  E "H4'"  2  
ATOM 5875  H "H3'"  . DA  A 1 19 ? -18.912 18.142  5.824   1.00 4.06  ? 19 DA  E "H3'"  2  
ATOM 5876  H "H2'"  . DA  A 1 19 ? -19.333 15.748  5.732   1.00 3.86  ? 19 DA  E "H2'"  2  
ATOM 5877  H "H2''" . DA  A 1 19 ? -20.406 16.364  4.496   1.00 3.86  ? 19 DA  E "H2''" 2  
ATOM 5878  H "H1'"  . DA  A 1 19 ? -18.877 15.830  2.732   1.00 3.64  ? 19 DA  E "H1'"  2  
ATOM 5879  H H8     . DA  A 1 19 ? -18.268 13.738  5.942   1.00 3.70  ? 19 DA  E H8     2  
ATOM 5880  H H61    . DA  A 1 19 ? -18.150 9.416   3.678   1.00 3.42  ? 19 DA  E H61    2  
ATOM 5881  H H62    . DA  A 1 19 ? -18.193 8.948   1.989   1.00 3.35  ? 19 DA  E H62    2  
ATOM 5882  H H2     . DA  A 1 19 ? -18.474 12.729  -0.391  1.00 3.37  ? 19 DA  E H2     2  
ATOM 5883  P P      . DA  A 1 20 ? -20.395 19.388  3.895   1.00 4.14  ? 20 DA  E P      2  
ATOM 5884  O OP1    . DA  A 1 20 ? -19.981 20.739  4.347   1.00 4.31  ? 20 DA  E OP1    2  
ATOM 5885  O OP2    . DA  A 1 20 ? -21.451 18.658  4.635   1.00 4.16  ? 20 DA  E OP2    2  
ATOM 5886  O "O5'"  . DA  A 1 20 ? -20.851 19.479  2.371   1.00 4.09  ? 20 DA  E "O5'"  2  
ATOM 5887  C "C5'"  . DA  A 1 20 ? -19.884 19.281  1.337   1.00 3.97  ? 20 DA  E "C5'"  2  
ATOM 5888  C "C4'"  . DA  A 1 20 ? -20.528 18.797  0.057   1.00 3.94  ? 20 DA  E "C4'"  2  
ATOM 5889  O "O4'"  . DA  A 1 20 ? -20.450 17.351  0.002   1.00 3.79  ? 20 DA  E "O4'"  2  
ATOM 5890  C "C3'"  . DA  A 1 20 ? -22.021 19.095  -0.059  1.00 4.07  ? 20 DA  E "C3'"  2  
ATOM 5891  O "O3'"  . DA  A 1 20 ? -22.377 19.052  -1.438  1.00 4.11  ? 20 DA  E "O3'"  2  
ATOM 5892  C "C2'"  . DA  A 1 20 ? -22.671 17.915  0.636   1.00 3.98  ? 20 DA  E "C2'"  2  
ATOM 5893  C "C1'"  . DA  A 1 20 ? -21.736 16.786  0.236   1.00 3.81  ? 20 DA  E "C1'"  2  
ATOM 5894  N N9     . DA  A 1 20 ? -21.622 15.683  1.189   1.00 3.72  ? 20 DA  E N9     2  
ATOM 5895  C C8     . DA  A 1 20 ? -21.506 15.713  2.551   1.00 3.76  ? 20 DA  E C8     2  
ATOM 5896  N N7     . DA  A 1 20 ? -21.476 14.524  3.107   1.00 3.69  ? 20 DA  E N7     2  
ATOM 5897  C C5     . DA  A 1 20 ? -21.580 13.652  2.030   1.00 3.58  ? 20 DA  E C5     2  
ATOM 5898  C C6     . DA  A 1 20 ? -21.619 12.246  1.942   1.00 3.50  ? 20 DA  E C6     2  
ATOM 5899  N N6     . DA  A 1 20 ? -21.563 11.431  2.998   1.00 3.51  ? 20 DA  E N6     2  
ATOM 5900  N N1     . DA  A 1 20 ? -21.724 11.698  0.709   1.00 3.45  ? 20 DA  E N1     2  
ATOM 5901  C C2     . DA  A 1 20 ? -21.789 12.513  -0.352  1.00 3.48  ? 20 DA  E C2     2  
ATOM 5902  N N3     . DA  A 1 20 ? -21.767 13.841  -0.393  1.00 3.55  ? 20 DA  E N3     2  
ATOM 5903  C C4     . DA  A 1 20 ? -21.659 14.354  0.843   1.00 3.60  ? 20 DA  E C4     2  
ATOM 5904  H "H5'"  . DA  A 1 20 ? -19.150 18.544  1.666   1.00 3.87  ? 20 DA  E "H5'"  2  
ATOM 5905  H "H5''" . DA  A 1 20 ? -19.371 20.221  1.137   1.00 4.02  ? 20 DA  E "H5''" 2  
ATOM 5906  H "H4'"  . DA  A 1 20 ? -20.036 19.292  -0.779  1.00 3.98  ? 20 DA  E "H4'"  2  
ATOM 5907  H "H3'"  . DA  A 1 20 ? -22.291 20.056  0.373   1.00 4.20  ? 20 DA  E "H3'"  2  
ATOM 5908  H "H2'"  . DA  A 1 20 ? -22.704 18.060  1.715   1.00 4.01  ? 20 DA  E "H2'"  2  
ATOM 5909  H "H2''" . DA  A 1 20 ? -23.693 17.774  0.297   1.00 4.03  ? 20 DA  E "H2''" 2  
ATOM 5910  H "H1'"  . DA  A 1 20 ? -22.066 16.360  -0.717  1.00 3.80  ? 20 DA  E "H1'"  2  
ATOM 5911  H H8     . DA  A 1 20 ? -21.456 16.631  3.115   1.00 3.88  ? 20 DA  E H8     2  
ATOM 5912  H H61    . DA  A 1 20 ? -21.488 11.822  3.925   1.00 3.58  ? 20 DA  E H61    2  
ATOM 5913  H H62    . DA  A 1 20 ? -21.601 10.429  2.880   1.00 3.48  ? 20 DA  E H62    2  
ATOM 5914  H H2     . DA  A 1 20 ? -21.873 12.016  -1.319  1.00 3.46  ? 20 DA  E H2     2  
ATOM 5915  P P      . DA  A 1 21 ? -23.696 19.783  -1.965  1.00 4.29  ? 21 DA  E P      2  
ATOM 5916  O OP1    . DA  A 1 21 ? -23.334 21.100  -2.548  1.00 4.45  ? 21 DA  E OP1    2  
ATOM 5917  O OP2    . DA  A 1 21 ? -24.748 19.705  -0.919  1.00 4.32  ? 21 DA  E OP2    2  
ATOM 5918  O "O5'"  . DA  A 1 21 ? -24.104 18.820  -3.167  1.00 4.25  ? 21 DA  E "O5'"  2  
ATOM 5919  C "C5'"  . DA  A 1 21 ? -23.149 17.873  -3.650  1.00 4.13  ? 21 DA  E "C5'"  2  
ATOM 5920  C "C4'"  . DA  A 1 21 ? -23.817 16.746  -4.405  1.00 4.09  ? 21 DA  E "C4'"  2  
ATOM 5921  O "O4'"  . DA  A 1 21 ? -23.809 15.555  -3.579  1.00 3.92  ? 21 DA  E "O4'"  2  
ATOM 5922  C "C3'"  . DA  A 1 21 ? -25.292 16.966  -4.733  1.00 4.23  ? 21 DA  E "C3'"  2  
ATOM 5923  O "O3'"  . DA  A 1 21 ? -25.628 16.117  -5.828  1.00 4.26  ? 21 DA  E "O3'"  2  
ATOM 5924  C "C2'"  . DA  A 1 21 ? -26.005 16.465  -3.492  1.00 4.14  ? 21 DA  E "C2'"  2  
ATOM 5925  C "C1'"  . DA  A 1 21 ? -25.122 15.295  -3.087  1.00 3.95  ? 21 DA  E "C1'"  2  
ATOM 5926  N N9     . DA  A 1 21 ? -25.054 15.000  -1.655  1.00 3.85  ? 21 DA  E N9     2  
ATOM 5927  C C8     . DA  A 1 21 ? -24.967 15.844  -0.580  1.00 3.90  ? 21 DA  E C8     2  
ATOM 5928  N N7     . DA  A 1 21 ? -24.972 15.225  0.581   1.00 3.84  ? 21 DA  E N7     2  
ATOM 5929  C C5     . DA  A 1 21 ? -25.067 13.882  0.241   1.00 3.74  ? 21 DA  E C5     2  
ATOM 5930  C C6     . DA  A 1 21 ? -25.126 12.702  1.012   1.00 3.68  ? 21 DA  E C6     2  
ATOM 5931  N N6     . DA  A 1 21 ? -25.113 12.679  2.348   1.00 3.71  ? 21 DA  E N6     2  
ATOM 5932  N N1     . DA  A 1 21 ? -25.208 11.524  0.353   1.00 3.62  ? 21 DA  E N1     2  
ATOM 5933  C C2     . DA  A 1 21 ? -25.235 11.541  -0.987  1.00 3.64  ? 21 DA  E C2     2  
ATOM 5934  N N3     . DA  A 1 21 ? -25.193 12.578  -1.816  1.00 3.71  ? 21 DA  E N3     2  
ATOM 5935  C C4     . DA  A 1 21 ? -25.106 13.730  -1.132  1.00 3.75  ? 21 DA  E C4     2  
ATOM 5936  H "H5'"  . DA  A 1 21 ? -22.594 17.456  -2.809  1.00 4.01  ? 21 DA  E "H5'"  2  
ATOM 5937  H "H5''" . DA  A 1 21 ? -22.448 18.376  -4.317  1.00 4.19  ? 21 DA  E "H5''" 2  
ATOM 5938  H "H4'"  . DA  A 1 21 ? -23.295 16.618  -5.351  1.00 4.12  ? 21 DA  E "H4'"  2  
ATOM 5939  H "H3'"  . DA  A 1 21 ? -25.515 18.002  -4.973  1.00 4.38  ? 21 DA  E "H3'"  2  
ATOM 5940  H "H2'"  . DA  A 1 21 ? -26.049 17.237  -2.721  1.00 4.19  ? 21 DA  E "H2'"  2  
ATOM 5941  H "H2''" . DA  A 1 21 ? -27.028 16.168  -3.715  1.00 4.20  ? 21 DA  E "H2''" 2  
ATOM 5942  H "H1'"  . DA  A 1 21 ? -25.468 14.388  -3.592  1.00 3.92  ? 21 DA  E "H1'"  2  
ATOM 5943  H H8     . DA  A 1 21 ? -24.911 16.918  -0.676  1.00 4.01  ? 21 DA  E H8     2  
ATOM 5944  H H61    . DA  A 1 21 ? -25.058 13.545  2.865   1.00 3.78  ? 21 DA  E H61    2  
ATOM 5945  H H62    . DA  A 1 21 ? -25.164 11.799  2.840   1.00 3.69  ? 21 DA  E H62    2  
ATOM 5946  H H2     . DA  A 1 21 ? -25.300 10.565  -1.466  1.00 3.63  ? 21 DA  E H2     2  
ATOM 5947  P P      . DC  A 1 22 ? -26.905 16.422  -6.744  1.00 4.46  ? 22 DC  E P      2  
ATOM 5948  O OP1    . DC  A 1 22 ? -26.483 17.158  -7.960  1.00 4.62  ? 22 DC  E OP1    2  
ATOM 5949  O OP2    . DC  A 1 22 ? -27.987 16.974  -5.888  1.00 4.50  ? 22 DC  E OP2    2  
ATOM 5950  O "O5'"  . DC  A 1 22 ? -27.312 14.942  -7.170  1.00 4.40  ? 22 DC  E "O5'"  2  
ATOM 5951  C "C5'"  . DC  A 1 22 ? -26.362 13.887  -6.997  1.00 4.27  ? 22 DC  E "C5'"  2  
ATOM 5952  C "C4'"  . DC  A 1 22 ? -27.032 12.532  -6.971  1.00 4.24  ? 22 DC  E "C4'"  2  
ATOM 5953  O "O4'"  . DC  A 1 22 ? -27.036 12.032  -5.610  1.00 4.10  ? 22 DC  E "O4'"  2  
ATOM 5954  C "C3'"  . DC  A 1 22 ? -28.505 12.535  -7.374  1.00 4.36  ? 22 DC  E "C3'"  2  
ATOM 5955  O "O3'"  . DC  A 1 22 ? -28.847 11.212  -7.779  1.00 4.37  ? 22 DC  E "O3'"  2  
ATOM 5956  C "C2'"  . DC  A 1 22 ? -29.223 12.840  -6.074  1.00 4.29  ? 22 DC  E "C2'"  2  
ATOM 5957  C "C1'"  . DC  A 1 22 ? -28.351 12.099  -5.070  1.00 4.13  ? 22 DC  E "C1'"  2  
ATOM 5958  N N1     . DC  A 1 22 ? -28.297 12.651  -3.704  1.00 4.06  ? 22 DC  E N1     2  
ATOM 5959  C C2     . DC  A 1 22 ? -28.375 11.749  -2.636  1.00 3.97  ? 22 DC  E C2     2  
ATOM 5960  O O2     . DC  A 1 22 ? -28.418 10.535  -2.881  1.00 3.95  ? 22 DC  E O2     2  
ATOM 5961  N N3     . DC  A 1 22 ? -28.404 12.217  -1.370  1.00 3.95  ? 22 DC  E N3     2  
ATOM 5962  C C4     . DC  A 1 22 ? -28.352 13.528  -1.144  1.00 4.01  ? 22 DC  E C4     2  
ATOM 5963  N N4     . DC  A 1 22 ? -28.420 13.937  0.126   1.00 4.02  ? 22 DC  E N4     2  
ATOM 5964  C C5     . DC  A 1 22 ? -28.237 14.475  -2.210  1.00 4.09  ? 22 DC  E C5     2  
ATOM 5965  C C6     . DC  A 1 22 ? -28.211 13.993  -3.465  1.00 4.12  ? 22 DC  E C6     2  
ATOM 5966  H "H5'"  . DC  A 1 22 ? -25.826 14.034  -6.059  1.00 4.16  ? 22 DC  E "H5'"  2  
ATOM 5967  H "H5''" . DC  A 1 22 ? -25.646 13.909  -7.817  1.00 4.31  ? 22 DC  E "H5''" 2  
ATOM 5968  H "H4'"  . DC  A 1 22 ? -26.506 11.881  -7.671  1.00 4.25  ? 22 DC  E "H4'"  2  
ATOM 5969  H "H3'"  . DC  A 1 22 ? -28.721 13.245  -8.169  1.00 4.48  ? 22 DC  E "H3'"  2  
ATOM 5970  H "H2'"  . DC  A 1 22 ? -29.253 13.912  -5.883  1.00 4.34  ? 22 DC  E "H2'"  2  
ATOM 5971  H "H2''" . DC  A 1 22 ? -30.252 12.487  -6.099  1.00 4.34  ? 22 DC  E "H2''" 2  
ATOM 5972  H "H1'"  . DC  A 1 22 ? -28.700 11.067  -4.988  1.00 4.11  ? 22 DC  E "H1'"  2  
ATOM 5973  H H41    . DC  A 1 22 ? -28.391 14.923  0.343   1.00 4.08  ? 22 DC  E H41    2  
ATOM 5974  H H42    . DC  A 1 22 ? -28.510 13.262  0.870   1.00 3.98  ? 22 DC  E H42    2  
ATOM 5975  H H5     . DC  A 1 22 ? -28.175 15.544  -2.013  1.00 4.16  ? 22 DC  E H5     2  
ATOM 5976  H H6     . DC  A 1 22 ? -28.119 14.686  -4.303  1.00 4.21  ? 22 DC  E H6     2  
ATOM 5977  P P      . DC  A 1 23 ? -30.120 10.937  -8.711  1.00 4.53  ? 23 DC  E P      2  
ATOM 5978  O OP1    . DC  A 1 23 ? -29.687 10.797  -10.124 1.00 4.67  ? 23 DC  E OP1    2  
ATOM 5979  O OP2    . DC  A 1 23 ? -31.196 11.901  -8.362  1.00 4.58  ? 23 DC  E OP2    2  
ATOM 5980  O "O5'"  . DC  A 1 23 ? -30.545 9.498   -8.174  1.00 4.47  ? 23 DC  E "O5'"  2  
ATOM 5981  C "C5'"  . DC  A 1 23 ? -29.602 8.745   -7.402  1.00 4.34  ? 23 DC  E "C5'"  2  
ATOM 5982  C "C4'"  . DC  A 1 23 ? -30.276 7.661   -6.591  1.00 4.30  ? 23 DC  E "C4'"  2  
ATOM 5983  O "O4'"  . DC  A 1 23 ? -30.284 8.052   -5.195  1.00 4.18  ? 23 DC  E "O4'"  2  
ATOM 5984  C "C3'"  . DC  A 1 23 ? -31.747 7.432   -6.929  1.00 4.42  ? 23 DC  E "C3'"  2  
ATOM 5985  O "O3'"  . DC  A 1 23 ? -32.106 6.122   -6.495  1.00 4.42  ? 23 DC  E "O3'"  2  
ATOM 5986  C "C2'"  . DC  A 1 23 ? -32.466 8.439   -6.055  1.00 4.38  ? 23 DC  E "C2'"  2  
ATOM 5987  C "C1'"  . DC  A 1 23 ? -31.600 8.425   -4.800  1.00 4.23  ? 23 DC  E "C1'"  2  
ATOM 5988  N N1     . DC  A 1 23 ? -31.549 9.676   -4.020  1.00 4.19  ? 23 DC  E N1     2  
ATOM 5989  C C2     . DC  A 1 23 ? -31.647 9.581   -2.624  1.00 4.13  ? 23 DC  E C2     2  
ATOM 5990  O O2     . DC  A 1 23 ? -31.713 8.458   -2.104  1.00 4.11  ? 23 DC  E O2     2  
ATOM 5991  N N3     . DC  A 1 23 ? -31.668 10.709  -1.879  1.00 4.13  ? 23 DC  E N3     2  
ATOM 5992  C C4     . DC  A 1 23 ? -31.591 11.900  -2.473  1.00 4.19  ? 23 DC  E C4     2  
ATOM 5993  N N4     . DC  A 1 23 ? -31.646 12.985  -1.693  1.00 4.22  ? 23 DC  E N4     2  
ATOM 5994  C C5     . DC  A 1 23 ? -31.462 12.030  -3.891  1.00 4.24  ? 23 DC  E C5     2  
ATOM 5995  C C6     . DC  A 1 23 ? -31.440 10.900  -4.619  1.00 4.24  ? 23 DC  E C6     2  
ATOM 5996  H "H5'"  . DC  A 1 23 ? -29.075 9.415   -6.723  1.00 4.25  ? 23 DC  E "H5'"  2  
ATOM 5997  H "H5''" . DC  A 1 23 ? -28.877 8.282   -8.071  1.00 4.37  ? 23 DC  E "H5''" 2  
ATOM 5998  H "H4'"  . DC  A 1 23 ? -29.753 6.722   -6.779  1.00 4.30  ? 23 DC  E "H4'"  2  
ATOM 5999  H "H3'"  . DC  A 1 23 ? -31.956 7.549   -7.990  1.00 4.53  ? 23 DC  E "H3'"  2  
ATOM 6000  H "H2'"  . DC  A 1 23 ? -32.496 9.421   -6.526  1.00 4.43  ? 23 DC  E "H2'"  2  
ATOM 6001  H "H2''" . DC  A 1 23 ? -33.493 8.135   -5.866  1.00 4.42  ? 23 DC  E "H2''" 2  
ATOM 6002  H "H1'"  . DC  A 1 23 ? -31.955 7.638   -4.129  1.00 4.21  ? 23 DC  E "H1'"  2  
ATOM 6003  H H41    . DC  A 1 23 ? -31.596 13.908  -2.099  1.00 4.28  ? 23 DC  E H41    2  
ATOM 6004  H H42    . DC  A 1 23 ? -31.747 12.892  -0.693  1.00 4.21  ? 23 DC  E H42    2  
ATOM 6005  H H5     . DC  A 1 23 ? -31.387 13.008  -4.364  1.00 4.31  ? 23 DC  E H5     2  
ATOM 6006  H H6     . DC  A 1 23 ? -31.333 10.961  -5.702  1.00 4.31  ? 23 DC  E H6     2  
ATOM 6007  P P      . DT  A 1 24 ? -33.369 5.369   -7.125  1.00 4.57  ? 24 DT  E P      2  
ATOM 6008  O OP1    . DT  A 1 24 ? -32.913 4.422   -8.174  1.00 4.69  ? 24 DT  E OP1    2  
ATOM 6009  O OP2    . DT  A 1 24 ? -34.413 6.376   -7.449  1.00 4.65  ? 24 DT  E OP2    2  
ATOM 6010  O "O5'"  . DT  A 1 24 ? -33.854 4.520   -5.867  1.00 4.52  ? 24 DT  E "O5'"  2  
ATOM 6011  C "C5'"  . DT  A 1 24 ? -32.996 4.423   -4.724  1.00 4.39  ? 24 DT  E "C5'"  2  
ATOM 6012  C "C4'"  . DT  A 1 24 ? -33.764 4.032   -3.481  1.00 4.38  ? 24 DT  E "C4'"  2  
ATOM 6013  O "O4'"  . DT  A 1 24 ? -33.895 5.194   -2.625  1.00 4.31  ? 24 DT  E "O4'"  2  
ATOM 6014  C "C3'"  . DT  A 1 24 ? -35.197 3.565   -3.710  1.00 4.51  ? 24 DT  E "C3'"  2  
ATOM 6015  O "O3'"  . DT  A 1 24 ? -35.592 2.745   -2.607  1.00 4.53  ? 24 DT  E "O3'"  2  
ATOM 6016  C "C2'"  . DT  A 1 24 ? -35.984 4.860   -3.702  1.00 4.50  ? 24 DT  E "C2'"  2  
ATOM 6017  C "C1'"  . DT  A 1 24 ? -35.233 5.678   -2.660  1.00 4.38  ? 24 DT  E "C1'"  2  
ATOM 6018  N N1     . DT  A 1 24 ? -35.204 7.145   -2.870  1.00 4.37  ? 24 DT  E N1     2  
ATOM 6019  C C2     . DT  A 1 24 ? -35.172 7.919   -1.734  1.00 4.32  ? 24 DT  E C2     2  
ATOM 6020  O O2     . DT  A 1 24 ? -35.142 7.444   -0.613  1.00 4.29  ? 24 DT  E O2     2  
ATOM 6021  N N3     . DT  A 1 24 ? -35.177 9.271   -1.956  1.00 4.34  ? 24 DT  E N3     2  
ATOM 6022  C C4     . DT  A 1 24 ? -35.205 9.914   -3.174  1.00 4.40  ? 24 DT  E C4     2  
ATOM 6023  O O4     . DT  A 1 24 ? -35.193 11.144  -3.216  1.00 4.44  ? 24 DT  E O4     2  
ATOM 6024  C C5     . DT  A 1 24 ? -35.233 9.042   -4.331  1.00 4.45  ? 24 DT  E C5     2  
ATOM 6025  C C7     . DT  A 1 24 ? -35.313 9.657   -5.695  1.00 4.57  ? 24 DT  E C7     2  
ATOM 6026  C C6     . DT  A 1 24 ? -35.224 7.714   -4.130  1.00 4.43  ? 24 DT  E C6     2  
ATOM 6027  H "H5'"  . DT  A 1 24 ? -32.513 5.388   -4.553  1.00 4.31  ? 24 DT  E "H5'"  2  
ATOM 6028  H "H5''" . DT  A 1 24 ? -32.228 3.675   -4.912  1.00 4.40  ? 24 DT  E "H5''" 2  
ATOM 6029  H "H4'"  . DT  A 1 24 ? -33.232 3.207   -3.007  1.00 4.37  ? 24 DT  E "H4'"  2  
ATOM 6030  H "H3'"  . DT  A 1 24 ? -35.305 3.012   -4.640  1.00 4.59  ? 24 DT  E "H3'"  2  
ATOM 6031  H "H2'"  . DT  A 1 24 ? -35.975 5.332   -4.684  1.00 4.54  ? 24 DT  E "H2'"  2  
ATOM 6032  H "H2''" . DT  A 1 24 ? -37.023 4.691   -3.429  1.00 4.56  ? 24 DT  E "H2''" 2  
ATOM 6033  H "H1'"  . DT  A 1 24 ? -35.659 5.496   -1.672  1.00 4.39  ? 24 DT  E "H1'"  2  
ATOM 6034  H H3     . DT  A 1 24 ? -35.174 9.858   -1.134  1.00 4.33  ? 24 DT  E H3     2  
ATOM 6035  H H71    . DT  A 1 24 ? -35.340 8.870   -6.448  1.00 4.76  ? 24 DT  E H71    2  
ATOM 6036  H H72    . DT  A 1 24 ? -34.441 10.288  -5.859  1.00 4.52  ? 24 DT  E H72    2  
ATOM 6037  H H73    . DT  A 1 24 ? -36.218 10.260  -5.769  1.00 4.85  ? 24 DT  E H73    2  
ATOM 6038  H H6     . DT  A 1 24 ? -35.231 7.057   -4.999  1.00 4.49  ? 24 DT  E H6     2  
ATOM 6039  P P      . DT  A 1 25 ? -36.718 1.622   -2.798  1.00 4.67  ? 25 DT  E P      2  
ATOM 6040  O OP1    . DT  A 1 25 ? -36.070 0.329   -3.136  1.00 4.74  ? 25 DT  E OP1    2  
ATOM 6041  O OP2    . DT  A 1 25 ? -37.771 2.170   -3.690  1.00 4.74  ? 25 DT  E OP2    2  
ATOM 6042  O "O5'"  . DT  A 1 25 ? -37.326 1.489   -1.333  1.00 4.68  ? 25 DT  E "O5'"  2  
ATOM 6043  C "C5'"  . DT  A 1 25 ? -36.608 1.998   -0.203  1.00 4.59  ? 25 DT  E "C5'"  2  
ATOM 6044  C "C4'"  . DT  A 1 25 ? -37.509 2.080   1.009   1.00 4.64  ? 25 DT  E "C4'"  2  
ATOM 6045  O "O4'"  . DT  A 1 25 ? -37.816 3.472   1.253   1.00 4.57  ? 25 DT  E "O4'"  2  
ATOM 6046  C "C3'"  . DT  A 1 25 ? -38.863 1.396   0.856   1.00 4.76  ? 25 DT  E "C3'"  2  
ATOM 6047  O "O3'"  . DT  A 1 25 ? -39.387 0.999   2.129   1.00 4.84  ? 25 DT  E "O3'"  2  
ATOM 6048  C "C2'"  . DT  A 1 25 ? -39.712 2.485   0.226   1.00 4.73  ? 25 DT  E "C2'"  2  
ATOM 6049  C "C1'"  . DT  A 1 25 ? -39.160 3.753   0.878   1.00 4.62  ? 25 DT  E "C1'"  2  
ATOM 6050  N N1     . DT  A 1 25 ? -39.151 4.968   0.028   1.00 4.56  ? 25 DT  E N1     2  
ATOM 6051  C C2     . DT  A 1 25 ? -39.188 6.194   0.665   1.00 4.53  ? 25 DT  E C2     2  
ATOM 6052  O O2     . DT  A 1 25 ? -39.206 6.318   1.880   1.00 4.54  ? 25 DT  E O2     2  
ATOM 6053  N N3     . DT  A 1 25 ? -39.199 7.275   -0.177  1.00 4.51  ? 25 DT  E N3     2  
ATOM 6054  C C4     . DT  A 1 25 ? -39.175 7.260   -1.556  1.00 4.53  ? 25 DT  E C4     2  
ATOM 6055  O O4     . DT  A 1 25 ? -39.174 8.318   -2.179  1.00 4.55  ? 25 DT  E O4     2  
ATOM 6056  C C5     . DT  A 1 25 ? -39.133 5.947   -2.155  1.00 4.57  ? 25 DT  E C5     2  
ATOM 6057  C C7     . DT  A 1 25 ? -39.155 5.837   -3.648  1.00 4.64  ? 25 DT  E C7     2  
ATOM 6058  C C6     . DT  A 1 25 ? -39.117 4.877   -1.349  1.00 4.58  ? 25 DT  E C6     2  
ATOM 6059  H "H5'"  . DT  A 1 25 ? -36.226 2.993   -0.430  1.00 4.50  ? 25 DT  E "H5'"  2  
ATOM 6060  H "H5''" . DT  A 1 25 ? -35.770 1.339   0.022   1.00 4.60  ? 25 DT  E "H5''" 2  
ATOM 6061  H "H4'"  . DT  A 1 25 ? -36.997 1.596   1.842   1.00 4.66  ? 25 DT  E "H4'"  2  
ATOM 6062  H "H3'"  . DT  A 1 25 ? -38.786 0.520   0.210   1.00 4.83  ? 25 DT  E "H3'"  2  
ATOM 6063  H "HO3'" . DT  A 1 25 ? -39.811 1.769   2.520   1.00 4.80  ? 25 DT  E "HO3'" 2  
ATOM 6064  H "H2'"  . DT  A 1 25 ? -39.602 2.494   -0.856  1.00 4.73  ? 25 DT  E "H2'"  2  
ATOM 6065  H "H2''" . DT  A 1 25 ? -40.768 2.341   0.446   1.00 4.80  ? 25 DT  E "H2''" 2  
ATOM 6066  H "H1'"  . DT  A 1 25 ? -39.714 3.982   1.791   1.00 4.65  ? 25 DT  E "H1'"  2  
ATOM 6067  H H3     . DT  A 1 25 ? -39.250 8.186   0.257   1.00 4.51  ? 25 DT  E H3     2  
ATOM 6068  H H71    . DT  A 1 25 ? -40.092 6.243   -4.029  1.00 4.78  ? 25 DT  E H71    2  
ATOM 6069  H H72    . DT  A 1 25 ? -38.320 6.399   -4.065  1.00 4.58  ? 25 DT  E H72    2  
ATOM 6070  H H73    . DT  A 1 25 ? -39.070 4.791   -3.939  1.00 4.72  ? 25 DT  E H73    2  
ATOM 6071  H H6     . DT  A 1 25 ? -39.066 3.891   -1.805  1.00 4.63  ? 25 DT  E H6     2  
ATOM 6072  O "O5'"  . DA  B 2 1  ? -38.962 17.214  1.808   1.00 5.07  ? 1  DA  F "O5'"  2  
ATOM 6073  C "C5'"  . DA  B 2 1  ? -39.936 17.616  2.772   1.00 5.14  ? 1  DA  F "C5'"  2  
ATOM 6074  C "C4'"  . DA  B 2 1  ? -39.937 16.702  3.976   1.00 5.09  ? 1  DA  F "C4'"  2  
ATOM 6075  O "O4'"  . DA  B 2 1  ? -40.428 15.402  3.560   1.00 4.99  ? 1  DA  F "O4'"  2  
ATOM 6076  C "C3'"  . DA  B 2 1  ? -38.567 16.423  4.587   1.00 5.01  ? 1  DA  F "C3'"  2  
ATOM 6077  O "O3'"  . DA  B 2 1  ? -38.679 16.068  5.970   1.00 5.06  ? 1  DA  F "O3'"  2  
ATOM 6078  C "C2'"  . DA  B 2 1  ? -38.075 15.247  3.770   1.00 4.84  ? 1  DA  F "C2'"  2  
ATOM 6079  C "C1'"  . DA  B 2 1  ? -39.351 14.469  3.493   1.00 4.85  ? 1  DA  F "C1'"  2  
ATOM 6080  N N9     . DA  B 2 1  ? -39.373 13.838  2.173   1.00 4.77  ? 1  DA  F N9     2  
ATOM 6081  C C8     . DA  B 2 1  ? -39.432 14.469  0.955   1.00 4.80  ? 1  DA  F C8     2  
ATOM 6082  N N7     . DA  B 2 1  ? -39.422 13.648  -0.067  1.00 4.74  ? 1  DA  F N7     2  
ATOM 6083  C C5     . DA  B 2 1  ? -39.355 12.391  0.516   1.00 4.66  ? 1  DA  F C5     2  
ATOM 6084  C C6     . DA  B 2 1  ? -39.312 11.099  -0.034  1.00 4.60  ? 1  DA  F C6     2  
ATOM 6085  N N6     . DA  B 2 1  ? -39.333 10.853  -1.344  1.00 4.61  ? 1  DA  F N6     2  
ATOM 6086  N N1     . DA  B 2 1  ? -39.244 10.055  0.820   1.00 4.56  ? 1  DA  F N1     2  
ATOM 6087  C C2     . DA  B 2 1  ? -39.224 10.302  2.135   1.00 4.58  ? 1  DA  F C2     2  
ATOM 6088  N N3     . DA  B 2 1  ? -39.260 11.474  2.775   1.00 4.64  ? 1  DA  F N3     2  
ATOM 6089  C C4     . DA  B 2 1  ? -39.325 12.491  1.897   1.00 4.67  ? 1  DA  F C4     2  
ATOM 6090  H "H5'"  . DA  B 2 1  ? -40.927 17.597  2.315   1.00 5.11  ? 1  DA  F "H5'"  2  
ATOM 6091  H "H5''" . DA  B 2 1  ? -39.722 18.633  3.103   1.00 5.29  ? 1  DA  F "H5''" 2  
ATOM 6092  H "H4'"  . DA  B 2 1  ? -40.544 17.166  4.751   1.00 5.20  ? 1  DA  F "H4'"  2  
ATOM 6093  H "H3'"  . DA  B 2 1  ? -37.910 17.290  4.490   1.00 5.05  ? 1  DA  F "H3'"  2  
ATOM 6094  H "H2'"  . DA  B 2 1  ? -37.583 15.572  2.854   1.00 4.80  ? 1  DA  F "H2'"  2  
ATOM 6095  H "H2''" . DA  B 2 1  ? -37.366 14.643  4.332   1.00 4.77  ? 1  DA  F "H2''" 2  
ATOM 6096  H "H1'"  . DA  B 2 1  ? -39.519 13.702  4.252   1.00 4.84  ? 1  DA  F "H1'"  2  
ATOM 6097  H H8     . DA  B 2 1  ? -39.483 15.542  0.847   1.00 4.89  ? 1  DA  F H8     2  
ATOM 6098  H H61    . DA  B 2 1  ? -39.383 11.621  -2.000  1.00 4.67  ? 1  DA  F H61    2  
ATOM 6099  H H62    . DA  B 2 1  ? -39.297 9.900   -1.680  1.00 4.59  ? 1  DA  F H62    2  
ATOM 6100  H H2     . DA  B 2 1  ? -39.168 9.420   2.774   1.00 4.56  ? 1  DA  F H2     2  
ATOM 6101  H "HO5'" . DA  B 2 1  ? -39.354 17.377  0.943   1.00 4.98  ? 1  DA  F "HO5'" 2  
ATOM 6102  P P      . DA  B 2 2  ? -37.434 16.325  6.970   1.00 5.09  ? 2  DA  F P      2  
ATOM 6103  O OP1    . DA  B 2 2  ? -37.930 16.902  8.244   1.00 5.28  ? 2  DA  F OP1    2  
ATOM 6104  O OP2    . DA  B 2 2  ? -36.363 17.026  6.215   1.00 5.05  ? 2  DA  F OP2    2  
ATOM 6105  O "O5'"  . DA  B 2 2  ? -36.925 14.848  7.278   1.00 4.95  ? 2  DA  F "O5'"  2  
ATOM 6106  C "C5'"  . DA  B 2 2  ? -37.761 13.729  6.989   1.00 4.89  ? 2  DA  F "C5'"  2  
ATOM 6107  C "C4'"  . DA  B 2 2  ? -36.962 12.446  7.007   1.00 4.77  ? 2  DA  F "C4'"  2  
ATOM 6108  O "O4'"  . DA  B 2 2  ? -36.777 11.986  5.648   1.00 4.64  ? 2  DA  F "O4'"  2  
ATOM 6109  C "C3'"  . DA  B 2 2  ? -35.545 12.595  7.558   1.00 4.73  ? 2  DA  F "C3'"  2  
ATOM 6110  O "O3'"  . DA  B 2 2  ? -35.111 11.308  7.997   1.00 4.68  ? 2  DA  F "O3'"  2  
ATOM 6111  C "C2'"  . DA  B 2 2  ? -34.743 13.005  6.337   1.00 4.61  ? 2  DA  F "C2'"  2  
ATOM 6112  C "C1'"  . DA  B 2 2  ? -35.431 12.201  5.242   1.00 4.54  ? 2  DA  F "C1'"  2  
ATOM 6113  N N9     . DA  B 2 2  ? -35.426 12.779  3.897   1.00 4.50  ? 2  DA  F N9     2  
ATOM 6114  C C8     . DA  B 2 2  ? -35.396 14.085  3.479   1.00 4.56  ? 2  DA  F C8     2  
ATOM 6115  N N7     . DA  B 2 2  ? -35.374 14.219  2.171   1.00 4.53  ? 2  DA  F N7     2  
ATOM 6116  C C5     . DA  B 2 2  ? -35.390 12.912  1.702   1.00 4.44  ? 2  DA  F C5     2  
ATOM 6117  C C6     . DA  B 2 2  ? -35.373 12.361  0.403   1.00 4.40  ? 2  DA  F C6     2  
ATOM 6118  N N6     . DA  B 2 2  ? -35.336 13.088  -0.715  1.00 4.45  ? 2  DA  F N6     2  
ATOM 6119  N N1     . DA  B 2 2  ? -35.395 11.014  0.294   1.00 4.34  ? 2  DA  F N1     2  
ATOM 6120  C C2     . DA  B 2 2  ? -35.431 10.280  1.414   1.00 4.33  ? 2  DA  F C2     2  
ATOM 6121  N N3     . DA  B 2 2  ? -35.448 10.679  2.678   1.00 4.36  ? 2  DA  F N3     2  
ATOM 6122  C C4     . DA  B 2 2  ? -35.426 12.018  2.755   1.00 4.42  ? 2  DA  F C4     2  
ATOM 6123  H "H5'"  . DA  B 2 2  ? -38.209 13.853  6.003   1.00 4.86  ? 2  DA  F "H5'"  2  
ATOM 6124  H "H5''" . DA  B 2 2  ? -38.555 13.664  7.733   1.00 5.00  ? 2  DA  F "H5''" 2  
ATOM 6125  H "H4'"  . DA  B 2 2  ? -37.482 11.730  7.644   1.00 4.82  ? 2  DA  F "H4'"  2  
ATOM 6126  H "H3'"  . DA  B 2 2  ? -35.488 13.312  8.374   1.00 4.84  ? 2  DA  F "H3'"  2  
ATOM 6127  H "H2'"  . DA  B 2 2  ? -34.814 14.080  6.165   1.00 4.68  ? 2  DA  F "H2'"  2  
ATOM 6128  H "H2''" . DA  B 2 2  ? -33.691 12.767  6.458   1.00 4.54  ? 2  DA  F "H2''" 2  
ATOM 6129  H "H1'"  . DA  B 2 2  ? -34.968 11.213  5.174   1.00 4.45  ? 2  DA  F "H1'"  2  
ATOM 6130  H H8     . DA  B 2 2  ? -35.388 14.924  4.158   1.00 4.65  ? 2  DA  F H8     2  
ATOM 6131  H H61    . DA  B 2 2  ? -35.317 14.096  -0.650  1.00 4.51  ? 2  DA  F H61    2  
ATOM 6132  H H62    . DA  B 2 2  ? -35.327 12.636  -1.619  1.00 4.45  ? 2  DA  F H62    2  
ATOM 6133  H H2     . DA  B 2 2  ? -35.448 9.203   1.268   1.00 4.30  ? 2  DA  F H2     2  
ATOM 6134  P P      . DG  B 2 3  ? -33.960 11.158  9.102   1.00 4.72  ? 3  DG  F P      2  
ATOM 6135  O OP1    . DG  B 2 3  ? -34.571 11.172  10.454  1.00 4.90  ? 3  DG  F OP1    2  
ATOM 6136  O OP2    . DG  B 2 3  ? -32.866 12.110  8.779   1.00 4.67  ? 3  DG  F OP2    2  
ATOM 6137  O "O5'"  . DG  B 2 3  ? -33.451 9.680   8.799   1.00 4.59  ? 3  DG  F "O5'"  2  
ATOM 6138  C "C5'"  . DG  B 2 3  ? -34.379 8.726   8.289   1.00 4.62  ? 3  DG  F "C5'"  2  
ATOM 6139  C "C4'"  . DG  B 2 3  ? -33.687 7.656   7.474   1.00 4.50  ? 3  DG  F "C4'"  2  
ATOM 6140  O "O4'"  . DG  B 2 3  ? -33.689 8.040   6.077   1.00 4.40  ? 3  DG  F "O4'"  2  
ATOM 6141  C "C3'"  . DG  B 2 3  ? -32.207 7.466   7.806   1.00 4.44  ? 3  DG  F "C3'"  2  
ATOM 6142  O "O3'"  . DG  B 2 3  ? -31.836 6.159   7.380   1.00 4.40  ? 3  DG  F "O3'"  2  
ATOM 6143  C "C2'"  . DG  B 2 3  ? -31.512 8.485   6.928   1.00 4.33  ? 3  DG  F "C2'"  2  
ATOM 6144  C "C1'"  . DG  B 2 3  ? -32.379 8.437   5.680   1.00 4.29  ? 3  DG  F "C1'"  2  
ATOM 6145  N N9     . DG  B 2 3  ? -32.452 9.667   4.897   1.00 4.26  ? 3  DG  F N9     2  
ATOM 6146  C C8     . DG  B 2 3  ? -32.570 10.957  5.346   1.00 4.34  ? 3  DG  F C8     2  
ATOM 6147  N N7     . DG  B 2 3  ? -32.531 11.843  4.385   1.00 4.31  ? 3  DG  F N7     2  
ATOM 6148  C C5     . DG  B 2 3  ? -32.388 11.087  3.228   1.00 4.22  ? 3  DG  F C5     2  
ATOM 6149  C C6     . DG  B 2 3  ? -32.278 11.486  1.861   1.00 4.18  ? 3  DG  F C6     2  
ATOM 6150  O O6     . DG  B 2 3  ? -32.279 12.628  1.382   1.00 4.23  ? 3  DG  F O6     2  
ATOM 6151  N N1     . DG  B 2 3  ? -32.152 10.386  1.018   1.00 4.12  ? 3  DG  F N1     2  
ATOM 6152  C C2     . DG  B 2 3  ? -32.135 9.076   1.424   1.00 4.10  ? 3  DG  F C2     2  
ATOM 6153  N N2     . DG  B 2 3  ? -32.008 8.156   0.458   1.00 4.07  ? 3  DG  F N2     2  
ATOM 6154  N N3     . DG  B 2 3  ? -32.232 8.693   2.686   1.00 4.13  ? 3  DG  F N3     2  
ATOM 6155  C C4     . DG  B 2 3  ? -32.354 9.742   3.527   1.00 4.19  ? 3  DG  F C4     2  
ATOM 6156  H "H5'"  . DG  B 2 3  ? -35.111 9.235   7.657   1.00 4.68  ? 3  DG  F "H5'"  2  
ATOM 6157  H "H5''" . DG  B 2 3  ? -34.902 8.252   9.119   1.00 4.70  ? 3  DG  F "H5''" 2  
ATOM 6158  H "H4'"  . DG  B 2 3  ? -34.187 6.707   7.667   1.00 4.55  ? 3  DG  F "H4'"  2  
ATOM 6159  H "H3'"  . DG  B 2 3  ? -31.996 7.591   8.866   1.00 4.53  ? 3  DG  F "H3'"  2  
ATOM 6160  H "H2'"  . DG  B 2 3  ? -31.513 9.470   7.394   1.00 4.38  ? 3  DG  F "H2'"  2  
ATOM 6161  H "H2''" . DG  B 2 3  ? -30.474 8.211   6.751   1.00 4.25  ? 3  DG  F "H2''" 2  
ATOM 6162  H "H1'"  . DG  B 2 3  ? -32.010 7.652   5.016   1.00 4.23  ? 3  DG  F "H1'"  2  
ATOM 6163  H H8     . DG  B 2 3  ? -32.679 11.213  6.389   1.00 4.43  ? 3  DG  F H8     2  
ATOM 6164  H H1     . DG  B 2 3  ? -32.064 10.569  0.028   1.00 4.12  ? 3  DG  F H1     2  
ATOM 6165  H H21    . DG  B 2 3  ? -31.989 7.175   0.692   1.00 4.08  ? 3  DG  F H21    2  
ATOM 6166  H H22    . DG  B 2 3  ? -31.924 8.428   -0.512  1.00 4.08  ? 3  DG  F H22    2  
ATOM 6167  P P      . DG  B 2 4  ? -30.516 5.454   7.950   1.00 4.39  ? 4  DG  F P      2  
ATOM 6168  O OP1    . DG  B 2 4  ? -30.893 4.421   8.945   1.00 4.55  ? 4  DG  F OP1    2  
ATOM 6169  O OP2    . DG  B 2 4  ? -29.520 6.496   8.310   1.00 4.36  ? 4  DG  F OP2    2  
ATOM 6170  O "O5'"  . DG  B 2 4  ? -30.011 4.710   6.636   1.00 4.26  ? 4  DG  F "O5'"  2  
ATOM 6171  C "C5'"  . DG  B 2 4  ? -30.951 4.473   5.587   1.00 4.23  ? 4  DG  F "C5'"  2  
ATOM 6172  C "C4'"  . DG  B 2 4  ? -30.271 4.064   4.302   1.00 4.14  ? 4  DG  F "C4'"  2  
ATOM 6173  O "O4'"  . DG  B 2 4  ? -30.334 5.171   3.364   1.00 4.05  ? 4  DG  F "O4'"  2  
ATOM 6174  C "C3'"  . DG  B 2 4  ? -28.781 3.764   4.429   1.00 4.09  ? 4  DG  F "C3'"  2  
ATOM 6175  O "O3'"  . DG  B 2 4  ? -28.404 2.924   3.345   1.00 4.08  ? 4  DG  F "O3'"  2  
ATOM 6176  C "C2'"  . DG  B 2 4  ? -28.133 5.123   4.259   1.00 3.98  ? 4  DG  F "C2'"  2  
ATOM 6177  C "C1'"  . DG  B 2 4  ? -29.046 5.771   3.232   1.00 3.95  ? 4  DG  F "C1'"  2  
ATOM 6178  N N9     . DG  B 2 4  ? -29.161 7.223   3.325   1.00 3.92  ? 4  DG  F N9     2  
ATOM 6179  C C8     . DG  B 2 4  ? -29.320 7.992   4.449   1.00 3.97  ? 4  DG  F C8     2  
ATOM 6180  N N7     . DG  B 2 4  ? -29.314 9.276   4.202   1.00 3.96  ? 4  DG  F N7     2  
ATOM 6181  C C5     . DG  B 2 4  ? -29.151 9.357   2.824   1.00 3.89  ? 4  DG  F C5     2  
ATOM 6182  C C6     . DG  B 2 4  ? -29.059 10.492  1.961   1.00 3.88  ? 4  DG  F C6     2  
ATOM 6183  O O6     . DG  B 2 4  ? -29.101 11.697  2.253   1.00 3.93  ? 4  DG  F O6     2  
ATOM 6184  N N1     . DG  B 2 4  ? -28.902 10.110  0.633   1.00 3.85  ? 4  DG  F N1     2  
ATOM 6185  C C2     . DG  B 2 4  ? -28.839 8.812   0.187   1.00 3.83  ? 4  DG  F C2     2  
ATOM 6186  N N2     . DG  B 2 4  ? -28.692 8.643   -1.133  1.00 3.85  ? 4  DG  F N2     2  
ATOM 6187  N N3     . DG  B 2 4  ? -28.919 7.755   0.973   1.00 3.84  ? 4  DG  F N3     2  
ATOM 6188  C C4     . DG  B 2 4  ? -29.073 8.099   2.269   1.00 3.87  ? 4  DG  F C4     2  
ATOM 6189  H "H5'"  . DG  B 2 4  ? -31.526 5.382   5.408   1.00 4.20  ? 4  DG  F "H5'"  2  
ATOM 6190  H "H5''" . DG  B 2 4  ? -31.634 3.681   5.888   1.00 4.32  ? 4  DG  F "H5''" 2  
ATOM 6191  H "H4'"  . DG  B 2 4  ? -30.752 3.156   3.936   1.00 4.20  ? 4  DG  F "H4'"  2  
ATOM 6192  H "H3'"  . DG  B 2 4  ? -28.535 3.287   5.375   1.00 4.17  ? 4  DG  F "H3'"  2  
ATOM 6193  H "H2'"  . DG  B 2 4  ? -28.114 5.674   5.200   1.00 4.01  ? 4  DG  F "H2'"  2  
ATOM 6194  H "H2''" . DG  B 2 4  ? -27.106 5.030   3.915   1.00 3.92  ? 4  DG  F "H2''" 2  
ATOM 6195  H "H1'"  . DG  B 2 4  ? -28.692 5.534   2.227   1.00 3.91  ? 4  DG  F "H1'"  2  
ATOM 6196  H H8     . DG  B 2 4  ? -29.428 7.577   5.439   1.00 4.05  ? 4  DG  F H8     2  
ATOM 6197  H H1     . DG  B 2 4  ? -28.821 10.847  -0.054  1.00 3.86  ? 4  DG  F H1     2  
ATOM 6198  H H21    . DG  B 2 4  ? -28.643 7.708   -1.513  1.00 3.86  ? 4  DG  F H21    2  
ATOM 6199  H H22    . DG  B 2 4  ? -28.626 9.442   -1.751  1.00 3.86  ? 4  DG  F H22    2  
ATOM 6200  P P      . DT  B 2 5  ? -27.022 2.123   3.375   1.00 4.08  ? 5  DT  F P      2  
ATOM 6201  O OP1    . DT  B 2 5  ? -27.291 0.664   3.428   1.00 4.21  ? 5  DT  F OP1    2  
ATOM 6202  O OP2    . DT  B 2 5  ? -26.114 2.739   4.378   1.00 4.04  ? 5  DT  F OP2    2  
ATOM 6203  O "O5'"  . DT  B 2 5  ? -26.476 2.476   1.922   1.00 4.00  ? 5  DT  F "O5'"  2  
ATOM 6204  C "C5'"  . DT  B 2 5  ? -27.406 2.935   0.940   1.00 3.98  ? 5  DT  F "C5'"  2  
ATOM 6205  C "C4'"  . DT  B 2 5  ? -26.719 3.383   -0.331  1.00 3.90  ? 5  DT  F "C4'"  2  
ATOM 6206  O "O4'"  . DT  B 2 5  ? -26.765 4.829   -0.405  1.00 3.81  ? 5  DT  F "O4'"  2  
ATOM 6207  C "C3'"  . DT  B 2 5  ? -25.234 3.050   -0.432  1.00 3.86  ? 5  DT  F "C3'"  2  
ATOM 6208  O "O3'"  . DT  B 2 5  ? -24.878 3.041   -1.814  1.00 3.86  ? 5  DT  F "O3'"  2  
ATOM 6209  C "C2'"  . DT  B 2 5  ? -24.566 4.220   0.257   1.00 3.74  ? 5  DT  F "C2'"  2  
ATOM 6210  C "C1'"  . DT  B 2 5  ? -25.473 5.372   -0.145  1.00 3.72  ? 5  DT  F "C1'"  2  
ATOM 6211  N N1     . DT  B 2 5  ? -25.588 6.482   0.826   1.00 3.68  ? 5  DT  F N1     2  
ATOM 6212  C C2     . DT  B 2 5  ? -25.579 7.751   0.294   1.00 3.63  ? 5  DT  F C2     2  
ATOM 6213  O O2     . DT  B 2 5  ? -25.545 7.966   -0.906  1.00 3.63  ? 5  DT  F O2     2  
ATOM 6214  N N3     . DT  B 2 5  ? -25.611 8.761   1.215   1.00 3.63  ? 5  DT  F N3     2  
ATOM 6215  C C4     . DT  B 2 5  ? -25.658 8.638   2.585   1.00 3.68  ? 5  DT  F C4     2  
ATOM 6216  O O4     . DT  B 2 5  ? -25.626 9.648   3.289   1.00 3.71  ? 5  DT  F O4     2  
ATOM 6217  C C5     . DT  B 2 5  ? -25.691 7.277   3.082   1.00 3.73  ? 5  DT  F C5     2  
ATOM 6218  C C7     . DT  B 2 5  ? -25.696 7.049   4.561   1.00 3.82  ? 5  DT  F C7     2  
ATOM 6219  C C6     . DT  B 2 5  ? -25.665 6.272   2.188   1.00 3.72  ? 5  DT  F C6     2  
ATOM 6220  H "H5'"  . DT  B 2 5  ? -27.974 3.772   1.347   1.00 3.95  ? 5  DT  F "H5'"  2  
ATOM 6221  H "H5''" . DT  B 2 5  ? -28.099 2.131   0.697   1.00 4.08  ? 5  DT  F "H5''" 2  
ATOM 6222  H "H4'"  . DT  B 2 5  ? -27.215 2.892   -1.170  1.00 3.97  ? 5  DT  F "H4'"  2  
ATOM 6223  H "H3'"  . DT  B 2 5  ? -24.991 2.094   0.022   1.00 3.93  ? 5  DT  F "H3'"  2  
ATOM 6224  H "H2'"  . DT  B 2 5  ? -24.536 4.077   1.338   1.00 3.76  ? 5  DT  F "H2'"  2  
ATOM 6225  H "H2''" . DT  B 2 5  ? -23.542 4.345   -0.086  1.00 3.68  ? 5  DT  F "H2''" 2  
ATOM 6226  H "H1'"  . DT  B 2 5  ? -25.122 5.799   -1.088  1.00 3.68  ? 5  DT  F "H1'"  2  
ATOM 6227  H H3     . DT  B 2 5  ? -25.584 9.702   0.847   1.00 3.62  ? 5  DT  F H3     2  
ATOM 6228  H H71    . DT  B 2 5  ? -25.499 5.997   4.768   1.00 4.07  ? 5  DT  F H71    2  
ATOM 6229  H H72    . DT  B 2 5  ? -24.919 7.659   5.025   1.00 4.12  ? 5  DT  F H72    2  
ATOM 6230  H H73    . DT  B 2 5  ? -26.666 7.326   4.970   1.00 3.63  ? 5  DT  F H73    2  
ATOM 6231  H H6     . DT  B 2 5  ? -25.710 5.247   2.556   1.00 3.79  ? 5  DT  F H6     2  
ATOM 6232  P P      . DT  B 2 6  ? -23.528 2.330   -2.312  1.00 3.87  ? 6  DT  F P      2  
ATOM 6233  O OP1    . DT  B 2 6  ? -23.859 1.085   -3.049  1.00 4.03  ? 6  DT  F OP1    2  
ATOM 6234  O OP2    . DT  B 2 6  ? -22.576 2.283   -1.173  1.00 3.82  ? 6  DT  F OP2    2  
ATOM 6235  O "O5'"  . DT  B 2 6  ? -23.018 3.410   -3.362  1.00 3.79  ? 6  DT  F "O5'"  2  
ATOM 6236  C "C5'"  . DT  B 2 6  ? -23.959 4.351   -3.886  1.00 3.79  ? 6  DT  F "C5'"  2  
ATOM 6237  C "C4'"  . DT  B 2 6  ? -23.279 5.441   -4.682  1.00 3.74  ? 6  DT  F "C4'"  2  
ATOM 6238  O "O4'"  . DT  B 2 6  ? -23.330 6.677   -3.927  1.00 3.64  ? 6  DT  F "O4'"  2  
ATOM 6239  C "C3'"  . DT  B 2 6  ? -21.792 5.222   -4.949  1.00 3.71  ? 6  DT  F "C3'"  2  
ATOM 6240  O "O3'"  . DT  B 2 6  ? -21.427 5.982   -6.098  1.00 3.75  ? 6  DT  F "O3'"  2  
ATOM 6241  C "C2'"  . DT  B 2 6  ? -21.130 5.805   -3.718  1.00 3.57  ? 6  DT  F "C2'"  2  
ATOM 6242  C "C1'"  . DT  B 2 6  ? -22.038 6.984   -3.408  1.00 3.54  ? 6  DT  F "C1'"  2  
ATOM 6243  N N1     . DT  B 2 6  ? -22.152 7.347   -1.979  1.00 3.48  ? 6  DT  F N1     2  
ATOM 6244  C C2     . DT  B 2 6  ? -22.150 8.692   -1.679  1.00 3.43  ? 6  DT  F C2     2  
ATOM 6245  O O2     . DT  B 2 6  ? -22.127 9.565   -2.531  1.00 3.44  ? 6  DT  F O2     2  
ATOM 6246  N N3     . DT  B 2 6  ? -22.177 8.984   -0.344  1.00 3.41  ? 6  DT  F N3     2  
ATOM 6247  C C4     . DT  B 2 6  ? -22.214 8.089   0.702   1.00 3.44  ? 6  DT  F C4     2  
ATOM 6248  O O4     . DT  B 2 6  ? -22.183 8.502   1.859   1.00 3.46  ? 6  DT  F O4     2  
ATOM 6249  C C5     . DT  B 2 6  ? -22.244 6.695   0.322   1.00 3.49  ? 6  DT  F C5     2  
ATOM 6250  C C7     . DT  B 2 6  ? -22.240 5.659   1.401   1.00 3.57  ? 6  DT  F C7     2  
ATOM 6251  C C6     . DT  B 2 6  ? -22.221 6.389   -0.988  1.00 3.51  ? 6  DT  F C6     2  
ATOM 6252  H "H5'"  . DT  B 2 6  ? -24.507 4.806   -3.060  1.00 3.75  ? 6  DT  F "H5'"  2  
ATOM 6253  H "H5''" . DT  B 2 6  ? -24.665 3.832   -4.533  1.00 3.89  ? 6  DT  F "H5''" 2  
ATOM 6254  H "H4'"  . DT  B 2 6  ? -23.772 5.506   -5.652  1.00 3.83  ? 6  DT  F "H4'"  2  
ATOM 6255  H "H3'"  . DT  B 2 6  ? -21.551 4.172   -5.103  1.00 3.79  ? 6  DT  F "H3'"  2  
ATOM 6256  H "H2'"  . DT  B 2 6  ? -21.099 5.080   -2.904  1.00 3.57  ? 6  DT  F "H2'"  2  
ATOM 6257  H "H2''" . DT  B 2 6  ? -20.105 6.107   -3.927  1.00 3.53  ? 6  DT  F "H2''" 2  
ATOM 6258  H "H1'"  . DT  B 2 6  ? -21.685 7.870   -3.945  1.00 3.53  ? 6  DT  F "H1'"  2  
ATOM 6259  H H3     . DT  B 2 6  ? -22.148 9.963   -0.103  1.00 3.40  ? 6  DT  F H3     2  
ATOM 6260  H H71    . DT  B 2 6  ? -21.628 6.008   2.232   1.00 3.50  ? 6  DT  F H71    2  
ATOM 6261  H H72    . DT  B 2 6  ? -21.828 4.726   1.013   1.00 3.83  ? 6  DT  F H72    2  
ATOM 6262  H H73    . DT  B 2 6  ? -23.257 5.491   1.749   1.00 3.86  ? 6  DT  F H73    2  
ATOM 6263  H H6     . DT  B 2 6  ? -22.260 5.340   -1.279  1.00 3.57  ? 6  DT  F H6     2  
ATOM 6264  P P      . DT  B 2 7  ? -20.080 5.656   -6.903  1.00 3.81  ? 7  DT  F P      2  
ATOM 6265  O OP1    . DT  B 2 7  ? -20.408 5.020   -8.204  1.00 4.01  ? 7  DT  F OP1    2  
ATOM 6266  O OP2    . DT  B 2 7  ? -19.117 5.004   -5.984  1.00 3.72  ? 7  DT  F OP2    2  
ATOM 6267  O "O5'"  . DT  B 2 7  ? -19.574 7.135   -7.199  1.00 3.78  ? 7  DT  F "O5'"  2  
ATOM 6268  C "C5'"  . DT  B 2 7  ? -20.501 8.210   -7.046  1.00 3.78  ? 7  DT  F "C5'"  2  
ATOM 6269  C "C4'"  . DT  B 2 7  ? -19.799 9.545   -7.002  1.00 3.73  ? 7  DT  F "C4'"  2  
ATOM 6270  O "O4'"  . DT  B 2 7  ? -19.801 10.034  -5.637  1.00 3.60  ? 7  DT  F "O4'"  2  
ATOM 6271  C "C3'"  . DT  B 2 7  ? -18.324 9.509   -7.385  1.00 3.71  ? 7  DT  F "C3'"  2  
ATOM 6272  O "O3'"  . DT  B 2 7  ? -17.962 10.818  -7.800  1.00 3.75  ? 7  DT  F "O3'"  2  
ATOM 6273  C "C2'"  . DT  B 2 7  ? -17.631 9.178   -6.079  1.00 3.56  ? 7  DT  F "C2'"  2  
ATOM 6274  C "C1'"  . DT  B 2 7  ? -18.494 9.926   -5.075  1.00 3.50  ? 7  DT  F "C1'"  2  
ATOM 6275  N N1     . DT  B 2 7  ? -18.583 9.334   -3.720  1.00 3.41  ? 7  DT  F N1     2  
ATOM 6276  C C2     . DT  B 2 7  ? -18.644 10.220  -2.664  1.00 3.37  ? 7  DT  F C2     2  
ATOM 6277  O O2     . DT  B 2 7  ? -18.685 11.429  -2.813  1.00 3.40  ? 7  DT  F O2     2  
ATOM 6278  N N3     . DT  B 2 7  ? -18.656 9.639   -1.425  1.00 3.33  ? 7  DT  F N3     2  
ATOM 6279  C C4     . DT  B 2 7  ? -18.625 8.294   -1.135  1.00 3.33  ? 7  DT  F C4     2  
ATOM 6280  O O4     . DT  B 2 7  ? -18.610 7.922   0.042   1.00 3.34  ? 7  DT  F O4     2  
ATOM 6281  C C5     . DT  B 2 7  ? -18.586 7.414   -2.285  1.00 3.38  ? 7  DT  F C5     2  
ATOM 6282  C C7     . DT  B 2 7  ? -18.515 5.936   -2.058  1.00 3.43  ? 7  DT  F C7     2  
ATOM 6283  C C6     . DT  B 2 7  ? -18.572 7.968   -3.512  1.00 3.42  ? 7  DT  F C6     2  
ATOM 6284  H "H5'"  . DT  B 2 7  ? -21.064 8.074   -6.122  1.00 3.72  ? 7  DT  F "H5'"  2  
ATOM 6285  H "H5''" . DT  B 2 7  ? -21.198 8.208   -7.885  1.00 3.90  ? 7  DT  F "H5''" 2  
ATOM 6286  H "H4'"  . DT  B 2 7  ? -20.296 10.216  -7.705  1.00 3.83  ? 7  DT  F "H4'"  2  
ATOM 6287  H "H3'"  . DT  B 2 7  ? -18.118 8.792   -8.177  1.00 3.80  ? 7  DT  F "H3'"  2  
ATOM 6288  H "H2'"  . DT  B 2 7  ? -17.624 8.103   -5.900  1.00 3.56  ? 7  DT  F "H2'"  2  
ATOM 6289  H "H2''" . DT  B 2 7  ? -16.594 9.513   -6.086  1.00 3.52  ? 7  DT  F "H2''" 2  
ATOM 6290  H "H1'"  . DT  B 2 7  ? -18.120 10.948  -4.963  1.00 3.49  ? 7  DT  F "H1'"  2  
ATOM 6291  H H3     . DT  B 2 7  ? -18.668 10.274  -0.641  1.00 3.32  ? 7  DT  F H3     2  
ATOM 6292  H H71    . DT  B 2 7  ? -17.629 5.703   -1.469  1.00 3.56  ? 7  DT  F H71    2  
ATOM 6293  H H72    . DT  B 2 7  ? -19.403 5.607   -1.520  1.00 3.67  ? 7  DT  F H72    2  
ATOM 6294  H H73    . DT  B 2 7  ? -18.457 5.420   -3.016  1.00 3.55  ? 7  DT  F H73    2  
ATOM 6295  H H6     . DT  B 2 7  ? -18.554 7.310   -4.379  1.00 3.50  ? 7  DT  F H6     2  
ATOM 6296  P P      . DC  B 2 8  ? -16.646 11.067  -8.669  1.00 3.80  ? 8  DC  F P      2  
ATOM 6297  O OP1    . DC  B 2 8  ? -17.011 11.291  -10.091 1.00 4.02  ? 8  DC  F OP1    2  
ATOM 6298  O OP2    . DC  B 2 8  ? -15.646 10.026  -8.321  1.00 3.71  ? 8  DC  F OP2    2  
ATOM 6299  O "O5'"  . DC  B 2 8  ? -16.169 12.447  -8.037  1.00 3.74  ? 8  DC  F "O5'"  2  
ATOM 6300  C "C5'"  . DC  B 2 8  ? -17.077 13.153  -7.187  1.00 3.71  ? 8  DC  F "C5'"  2  
ATOM 6301  C "C4'"  . DC  B 2 8  ? -16.359 14.146  -6.307  1.00 3.63  ? 8  DC  F "C4'"  2  
ATOM 6302  O "O4'"  . DC  B 2 8  ? -16.314 13.632  -4.953  1.00 3.50  ? 8  DC  F "O4'"  2  
ATOM 6303  C "C3'"  . DC  B 2 8  ? -14.898 14.389  -6.669  1.00 3.60  ? 8  DC  F "C3'"  2  
ATOM 6304  O "O3'"  . DC  B 2 8  ? -14.531 15.659  -6.137  1.00 3.60  ? 8  DC  F "O3'"  2  
ATOM 6305  C "C2'"  . DC  B 2 8  ? -14.165 13.295  -5.915  1.00 3.46  ? 8  DC  F "C2'"  2  
ATOM 6306  C "C1'"  . DC  B 2 8  ? -14.994 13.201  -4.638  1.00 3.40  ? 8  DC  F "C1'"  2  
ATOM 6307  N N1     . DC  B 2 8  ? -15.063 11.880  -3.980  1.00 3.33  ? 8  DC  F N1     2  
ATOM 6308  C C2     . DC  B 2 8  ? -15.070 11.846  -2.580  1.00 3.25  ? 8  DC  F C2     2  
ATOM 6309  O O2     . DC  B 2 8  ? -15.053 12.917  -1.956  1.00 3.24  ? 8  DC  F O2     2  
ATOM 6310  N N3     . DC  B 2 8  ? -15.093 10.655  -1.941  1.00 3.22  ? 8  DC  F N3     2  
ATOM 6311  C C4     . DC  B 2 8  ? -15.112 9.523   -2.645  1.00 3.27  ? 8  DC  F C4     2  
ATOM 6312  N N4     . DC  B 2 8  ? -15.118 8.371   -1.964  1.00 3.28  ? 8  DC  F N4     2  
ATOM 6313  C C5     . DC  B 2 8  ? -15.122 9.523   -4.074  1.00 3.36  ? 8  DC  F C5     2  
ATOM 6314  C C6     . DC  B 2 8  ? -15.100 10.716  -4.695  1.00 3.39  ? 8  DC  F C6     2  
ATOM 6315  H "H5'"  . DC  B 2 8  ? -17.610 12.440  -6.557  1.00 3.66  ? 8  DC  F "H5'"  2  
ATOM 6316  H "H5''" . DC  B 2 8  ? -17.802 13.688  -7.801  1.00 3.83  ? 8  DC  F "H5''" 2  
ATOM 6317  H "H4'"  . DC  B 2 8  ? -16.874 15.104  -6.388  1.00 3.71  ? 8  DC  F "H4'"  2  
ATOM 6318  H "H3'"  . DC  B 2 8  ? -14.724 14.366  -7.742  1.00 3.70  ? 8  DC  F "H3'"  2  
ATOM 6319  H "H2'"  . DC  B 2 8  ? -14.163 12.361  -6.477  1.00 3.49  ? 8  DC  F "H2'"  2  
ATOM 6320  H "H2''" . DC  B 2 8  ? -13.127 13.568  -5.740  1.00 3.41  ? 8  DC  F "H2''" 2  
ATOM 6321  H "H1'"  . DC  B 2 8  ? -14.605 13.910  -3.902  1.00 3.37  ? 8  DC  F "H1'"  2  
ATOM 6322  H H41    . DC  B 2 8  ? -15.130 7.493   -2.467  1.00 3.34  ? 8  DC  F H41    2  
ATOM 6323  H H42    . DC  B 2 8  ? -15.095 8.377   -0.954  1.00 3.24  ? 8  DC  F H42    2  
ATOM 6324  H H5     . DC  B 2 8  ? -15.143 8.590   -4.639  1.00 3.43  ? 8  DC  F H5     2  
ATOM 6325  H H6     . DC  B 2 8  ? -15.112 10.753  -5.784  1.00 3.49  ? 8  DC  F H6     2  
ATOM 6326  P P      . DC  B 2 9  ? -13.313 16.486  -6.755  1.00 3.64  ? 9  DC  F P      2  
ATOM 6327  O OP1    . DC  B 2 9  ? -13.809 17.347  -7.858  1.00 3.85  ? 9  DC  F OP1    2  
ATOM 6328  O OP2    . DC  B 2 9  ? -12.181 15.555  -6.998  1.00 3.57  ? 9  DC  F OP2    2  
ATOM 6329  O "O5'"  . DC  B 2 9  ? -12.939 17.420  -5.518  1.00 3.55  ? 9  DC  F "O5'"  2  
ATOM 6330  C "C5'"  . DC  B 2 9  ? -13.920 17.643  -4.505  1.00 3.52  ? 9  DC  F "C5'"  2  
ATOM 6331  C "C4'"  . DC  B 2 9  ? -13.284 17.990  -3.178  1.00 3.45  ? 9  DC  F "C4'"  2  
ATOM 6332  O "O4'"  . DC  B 2 9  ? -13.309 16.820  -2.320  1.00 3.30  ? 9  DC  F "O4'"  2  
ATOM 6333  C "C3'"  . DC  B 2 9  ? -11.806 18.368  -3.247  1.00 3.43  ? 9  DC  F "C3'"  2  
ATOM 6334  O "O3'"  . DC  B 2 9  ? -11.497 19.135  -2.088  1.00 3.46  ? 9  DC  F "O3'"  2  
ATOM 6335  C "C2'"  . DC  B 2 9  ? -11.095 17.035  -3.159  1.00 3.27  ? 9  DC  F "C2'"  2  
ATOM 6336  C "C1'"  . DC  B 2 9  ? -11.994 16.278  -2.199  1.00 3.20  ? 9  DC  F "C1'"  2  
ATOM 6337  N N1     . DC  B 2 9  ? -12.028 14.815  -2.380  1.00 3.10  ? 9  DC  F N1     2  
ATOM 6338  C C2     . DC  B 2 9  ? -12.019 14.007  -1.236  1.00 3.03  ? 9  DC  F C2     2  
ATOM 6339  O O2     . DC  B 2 9  ? -12.073 14.544  -0.119  1.00 3.05  ? 9  DC  F O2     2  
ATOM 6340  N N3     . DC  B 2 9  ? -11.950 12.665  -1.371  1.00 2.97  ? 9  DC  F N3     2  
ATOM 6341  C C4     . DC  B 2 9  ? -11.898 12.121  -2.587  1.00 2.99  ? 9  DC  F C4     2  
ATOM 6342  N N4     . DC  B 2 9  ? -11.793 10.794  -2.670  1.00 2.98  ? 9  DC  F N4     2  
ATOM 6343  C C5     . DC  B 2 9  ? -11.943 12.914  -3.773  1.00 3.08  ? 9  DC  F C5     2  
ATOM 6344  C C6     . DC  B 2 9  ? -12.020 14.246  -3.623  1.00 3.13  ? 9  DC  F C6     2  
ATOM 6345  H "H5'"  . DC  B 2 9  ? -14.524 16.742  -4.382  1.00 3.48  ? 9  DC  F "H5'"  2  
ATOM 6346  H "H5''" . DC  B 2 9  ? -14.572 18.463  -4.807  1.00 3.62  ? 9  DC  F "H5''" 2  
ATOM 6347  H "H4'"  . DC  B 2 9  ? -13.816 18.847  -2.761  1.00 3.55  ? 9  DC  F "H4'"  2  
ATOM 6348  H "H3'"  . DC  B 2 9  ? -11.560 18.929  -4.147  1.00 3.54  ? 9  DC  F "H3'"  2  
ATOM 6349  H "H2'"  . DC  B 2 9  ? -11.032 16.554  -4.135  1.00 3.29  ? 9  DC  F "H2'"  2  
ATOM 6350  H "H2''" . DC  B 2 9  ? -10.077 17.154  -2.790  1.00 3.22  ? 9  DC  F "H2''" 2  
ATOM 6351  H "H1'"  . DC  B 2 9  ? -11.672 16.471  -1.174  1.00 3.17  ? 9  DC  F "H1'"  2  
ATOM 6352  H H41    . DC  B 2 9  ? -11.747 10.350  -3.575  1.00 3.03  ? 9  DC  F H41    2  
ATOM 6353  H H42    . DC  B 2 9  ? -11.733 10.237  -1.829  1.00 2.95  ? 9  DC  F H42    2  
ATOM 6354  H H5     . DC  B 2 9  ? -11.906 12.455  -4.761  1.00 3.14  ? 9  DC  F H5     2  
ATOM 6355  H H6     . DC  B 2 9  ? -12.080 14.880  -4.508  1.00 3.23  ? 9  DC  F H6     2  
ATOM 6356  P P      . DA  B 2 10 ? -10.158 20.008  -2.015  1.00 3.53  ? 10 DA  F P      2  
ATOM 6357  O OP1    . DA  B 2 10 ? -10.502 21.452  -2.056  1.00 3.73  ? 10 DA  F OP1    2  
ATOM 6358  O OP2    . DA  B 2 10 ? -9.161  19.461  -2.970  1.00 3.44  ? 10 DA  F OP2    2  
ATOM 6359  O "O5'"  . DA  B 2 10 ? -9.690  19.648  -0.537  1.00 3.47  ? 10 DA  F "O5'"  2  
ATOM 6360  C "C5'"  . DA  B 2 10 ? -10.638 19.055  0.355   1.00 3.48  ? 10 DA  F "C5'"  2  
ATOM 6361  C "C4'"  . DA  B 2 10 ? -9.976  18.545  1.614   1.00 3.42  ? 10 DA  F "C4'"  2  
ATOM 6362  O "O4'"  . DA  B 2 10 ? -9.972  17.097  1.590   1.00 3.28  ? 10 DA  F "O4'"  2  
ATOM 6363  C "C3'"  . DA  B 2 10 ? -8.508  18.932  1.762   1.00 3.40  ? 10 DA  F "C3'"  2  
ATOM 6364  O "O3'"  . DA  B 2 10 ? -8.182  18.869  3.148   1.00 3.46  ? 10 DA  F "O3'"  2  
ATOM 6365  C "C2'"  . DA  B 2 10 ? -7.786  17.830  1.011   1.00 3.23  ? 10 DA  F "C2'"  2  
ATOM 6366  C "C1'"  . DA  B 2 10 ? -8.655  16.618  1.337   1.00 3.17  ? 10 DA  F "C1'"  2  
ATOM 6367  N N9     . DA  B 2 10 ? -8.711  15.562  0.325   1.00 3.06  ? 10 DA  F N9     2  
ATOM 6368  C C8     . DA  B 2 10 ? -8.822  15.648  -1.040  1.00 3.09  ? 10 DA  F C8     2  
ATOM 6369  N N7     . DA  B 2 10 ? -8.800  14.484  -1.646  1.00 3.02  ? 10 DA  F N7     2  
ATOM 6370  C C5     . DA  B 2 10 ? -8.665  13.568  -0.611  1.00 2.94  ? 10 DA  F C5     2  
ATOM 6371  C C6     . DA  B 2 10 ? -8.571  12.160  -0.588  1.00 2.89  ? 10 DA  F C6     2  
ATOM 6372  N N6     . DA  B 2 10 ? -8.586  11.392  -1.681  1.00 2.91  ? 10 DA  F N6     2  
ATOM 6373  N N1     . DA  B 2 10 ? -8.451  11.559  0.617   1.00 2.87  ? 10 DA  F N1     2  
ATOM 6374  C C2     . DA  B 2 10 ? -8.424  12.325  1.715   1.00 2.90  ? 10 DA  F C2     2  
ATOM 6375  N N3     . DA  B 2 10 ? -8.499  13.650  1.821   1.00 2.96  ? 10 DA  F N3     2  
ATOM 6376  C C4     . DA  B 2 10 ? -8.620  14.218  0.608   1.00 2.97  ? 10 DA  F C4     2  
ATOM 6377  H "H5'"  . DA  B 2 10 ? -11.132 18.223  -0.145  1.00 3.42  ? 10 DA  F "H5'"  2  
ATOM 6378  H "H5''" . DA  B 2 10 ? -11.390 19.795  0.629   1.00 3.61  ? 10 DA  F "H5''" 2  
ATOM 6379  H "H4'"  . DA  B 2 10 ? -10.507 18.965  2.469   1.00 3.54  ? 10 DA  F "H4'"  2  
ATOM 6380  H "H3'"  . DA  B 2 10 ? -8.299  19.926  1.371   1.00 3.50  ? 10 DA  F "H3'"  2  
ATOM 6381  H "H2'"  . DA  B 2 10 ? -7.756  18.038  -0.059  1.00 3.23  ? 10 DA  F "H2'"  2  
ATOM 6382  H "H2''" . DA  B 2 10 ? -6.759  17.730  1.349   1.00 3.19  ? 10 DA  F "H2''" 2  
ATOM 6383  H "H1'"  . DA  B 2 10 ? -8.308  16.163  2.267   1.00 3.16  ? 10 DA  F "H1'"  2  
ATOM 6384  H H8     . DA  B 2 10 ? -8.907  16.587  -1.563  1.00 3.19  ? 10 DA  F H8     2  
ATOM 6385  H H61    . DA  B 2 10 ? -8.670  11.827  -2.590  1.00 2.96  ? 10 DA  F H61    2  
ATOM 6386  H H62    . DA  B 2 10 ? -8.504  10.387  -1.611  1.00 2.90  ? 10 DA  F H62    2  
ATOM 6387  H H2     . DA  B 2 10 ? -8.327  11.786  2.659   1.00 2.92  ? 10 DA  F H2     2  
ATOM 6388  P P      . DA  B 2 11 ? -6.946  19.701  3.742   1.00 3.52  ? 11 DA  F P      2  
ATOM 6389  O OP1    . DA  B 2 11 ? -7.424  21.003  4.271   1.00 3.72  ? 11 DA  F OP1    2  
ATOM 6390  O OP2    . DA  B 2 11 ? -5.835  19.671  2.758   1.00 3.45  ? 11 DA  F OP2    2  
ATOM 6391  O "O5'"  . DA  B 2 11 ? -6.538  18.782  4.976   1.00 3.45  ? 11 DA  F "O5'"  2  
ATOM 6392  C "C5'"  . DA  B 2 11 ? -7.481  17.831  5.470   1.00 3.42  ? 11 DA  F "C5'"  2  
ATOM 6393  C "C4'"  . DA  B 2 11 ? -6.801  16.729  6.248   1.00 3.37  ? 11 DA  F "C4'"  2  
ATOM 6394  O "O4'"  . DA  B 2 11 ? -6.801  15.520  5.448   1.00 3.20  ? 11 DA  F "O4'"  2  
ATOM 6395  C "C3'"  . DA  B 2 11 ? -5.329  16.962  6.571   1.00 3.38  ? 11 DA  F "C3'"  2  
ATOM 6396  O "O3'"  . DA  B 2 11 ? -4.985  16.176  7.708   1.00 3.44  ? 11 DA  F "O3'"  2  
ATOM 6397  C "C2'"  . DA  B 2 11 ? -4.613  16.437  5.344   1.00 3.19  ? 11 DA  F "C2'"  2  
ATOM 6398  C "C1'"  . DA  B 2 11 ? -5.486  15.256  4.954   1.00 3.10  ? 11 DA  F "C1'"  2  
ATOM 6399  N N9     . DA  B 2 11 ? -5.550  14.993  3.517   1.00 2.97  ? 11 DA  F N9     2  
ATOM 6400  C C8     . DA  B 2 11 ? -5.718  15.884  2.491   1.00 2.99  ? 11 DA  F C8     2  
ATOM 6401  N N7     . DA  B 2 11 ? -5.685  15.334  1.300   1.00 2.90  ? 11 DA  F N7     2  
ATOM 6402  C C5     . DA  B 2 11 ? -5.486  13.985  1.562   1.00 2.81  ? 11 DA  F C5     2  
ATOM 6403  C C6     . DA  B 2 11 ? -5.354  12.862  0.722   1.00 2.74  ? 11 DA  F C6     2  
ATOM 6404  N N6     . DA  B 2 11 ? -5.399  12.920  -0.611  1.00 2.75  ? 11 DA  F N6     2  
ATOM 6405  N N1     . DA  B 2 11 ? -5.168  11.657  1.308   1.00 2.72  ? 11 DA  F N1     2  
ATOM 6406  C C2     . DA  B 2 11 ? -5.117  11.596  2.646   1.00 2.77  ? 11 DA  F C2     2  
ATOM 6407  N N3     . DA  B 2 11 ? -5.224  12.579  3.538   1.00 2.85  ? 11 DA  F N3     2  
ATOM 6408  C C4     . DA  B 2 11 ? -5.409  13.760  2.924   1.00 2.86  ? 11 DA  F C4     2  
ATOM 6409  H "H5'"  . DA  B 2 11 ? -8.023  17.390  4.633   1.00 3.33  ? 11 DA  F "H5'"  2  
ATOM 6410  H "H5''" . DA  B 2 11 ? -8.193  18.334  6.123   1.00 3.56  ? 11 DA  F "H5''" 2  
ATOM 6411  H "H4'"  . DA  B 2 11 ? -7.323  16.615  7.199   1.00 3.48  ? 11 DA  F "H4'"  2  
ATOM 6412  H "H3'"  . DA  B 2 11 ? -5.116  18.011  6.769   1.00 3.49  ? 11 DA  F "H3'"  2  
ATOM 6413  H "H2'"  . DA  B 2 11 ? -4.561  17.191  4.560   1.00 3.19  ? 11 DA  F "H2'"  2  
ATOM 6414  H "H2''" . DA  B 2 11 ? -3.591  16.141  5.579   1.00 3.17  ? 11 DA  F "H2''" 2  
ATOM 6415  H "H1'"  . DA  B 2 11 ? -5.132  14.348  5.446   1.00 3.08  ? 11 DA  F "H1'"  2  
ATOM 6416  H H8     . DA  B 2 11 ? -5.857  16.942  2.650   1.00 3.09  ? 11 DA  F H8     2  
ATOM 6417  H H61    . DA  B 2 11 ? -5.534  13.805  -1.076  1.00 2.80  ? 11 DA  F H61    2  
ATOM 6418  H H62    . DA  B 2 11 ? -5.304  12.080  -1.164  1.00 2.73  ? 11 DA  F H62    2  
ATOM 6419  H H2     . DA  B 2 11 ? -4.968  10.601  3.064   1.00 2.79  ? 11 DA  F H2     2  
ATOM 6420  P P      . DT  B 2 12 ? -3.654  16.493  8.533   1.00 3.55  ? 12 DT  F P      2  
ATOM 6421  O OP1    . DT  B 2 12 ? -3.992  16.736  9.958   1.00 3.80  ? 12 DT  F OP1    2  
ATOM 6422  O OP2    . DT  B 2 12 ? -2.850  17.496  7.787   1.00 3.48  ? 12 DT  F OP2    2  
ATOM 6423  O "O5'"  . DT  B 2 12 ? -2.918  15.087  8.426   1.00 3.46  ? 12 DT  F "O5'"  2  
ATOM 6424  C "C5'"  . DT  B 2 12 ? -3.674  13.932  8.046   1.00 3.38  ? 12 DT  F "C5'"  2  
ATOM 6425  C "C4'"  . DT  B 2 12 ? -2.779  12.732  7.855   1.00 3.31  ? 12 DT  F "C4'"  2  
ATOM 6426  O "O4'"  . DT  B 2 12 ? -2.696  12.426  6.445   1.00 3.11  ? 12 DT  F "O4'"  2  
ATOM 6427  C "C3'"  . DT  B 2 12 ? -1.339  12.975  8.293   1.00 3.37  ? 12 DT  F "C3'"  2  
ATOM 6428  O "O3'"  . DT  B 2 12 ? -0.735  11.708  8.543   1.00 3.42  ? 12 DT  F "O3'"  2  
ATOM 6429  C "C2'"  . DT  B 2 12 ? -0.707  13.576  7.048   1.00 3.19  ? 12 DT  F "C2'"  2  
ATOM 6430  C "C1'"  . DT  B 2 12 ? -1.424  12.796  5.948   1.00 3.03  ? 12 DT  F "C1'"  2  
ATOM 6431  N N1     . DT  B 2 12 ? -1.599  13.448  4.633   1.00 2.89  ? 12 DT  F N1     2  
ATOM 6432  C C2     . DT  B 2 12 ? -1.618  12.598  3.547   1.00 2.77  ? 12 DT  F C2     2  
ATOM 6433  O O2     . DT  B 2 12 ? -1.554  11.384  3.653   1.00 2.77  ? 12 DT  F O2     2  
ATOM 6434  N N3     . DT  B 2 12 ? -1.715  13.218  2.333   1.00 2.69  ? 12 DT  F N3     2  
ATOM 6435  C C4     . DT  B 2 12 ? -1.804  14.568  2.091   1.00 2.73  ? 12 DT  F C4     2  
ATOM 6436  O O4     . DT  B 2 12 ? -1.837  14.976  0.929   1.00 2.69  ? 12 DT  F O4     2  
ATOM 6437  C C5     . DT  B 2 12 ? -1.806  15.409  3.277   1.00 2.85  ? 12 DT  F C5     2  
ATOM 6438  C C7     . DT  B 2 12 ? -1.901  16.894  3.114   1.00 2.95  ? 12 DT  F C7     2  
ATOM 6439  C C6     . DT  B 2 12 ? -1.709  14.815  4.478   1.00 2.93  ? 12 DT  F C6     2  
ATOM 6440  H "H5'"  . DT  B 2 12 ? -4.197  14.135  7.112   1.00 3.26  ? 12 DT  F "H5'"  2  
ATOM 6441  H "H5''" . DT  B 2 12 ? -4.407  13.706  8.819   1.00 3.51  ? 12 DT  F "H5''" 2  
ATOM 6442  H "H4'"  . DT  B 2 12 ? -3.170  11.914  8.461   1.00 3.41  ? 12 DT  F "H4'"  2  
ATOM 6443  H "H3'"  . DT  B 2 12 ? -1.266  13.614  9.172   1.00 3.52  ? 12 DT  F "H3'"  2  
ATOM 6444  H "H2'"  . DT  B 2 12 ? -0.898  14.648  6.985   1.00 3.21  ? 12 DT  F "H2'"  2  
ATOM 6445  H "H2''" . DT  B 2 12 ? 0.372   13.439  7.048   1.00 3.18  ? 12 DT  F "H2''" 2  
ATOM 6446  H "H1'"  . DT  B 2 12 ? -0.888  11.862  5.770   1.00 3.00  ? 12 DT  F "H1'"  2  
ATOM 6447  H H3     . DT  B 2 12 ? -1.707  12.616  1.522   1.00 2.64  ? 12 DT  F H3     2  
ATOM 6448  H H71    . DT  B 2 12 ? -1.153  17.230  2.396   1.00 3.12  ? 12 DT  F H71    2  
ATOM 6449  H H72    . DT  B 2 12 ? -2.896  17.159  2.754   1.00 3.09  ? 12 DT  F H72    2  
ATOM 6450  H H73    . DT  B 2 12 ? -1.722  17.377  4.075   1.00 3.19  ? 12 DT  F H73    2  
ATOM 6451  H H6     . DT  B 2 12 ? -1.720  15.441  5.369   1.00 3.05  ? 12 DT  F H6     2  
ATOM 6452  P P      . DA  B 2 13 ? 0.032   11.422  9.918   1.00 3.57  ? 13 DA  F P      2  
ATOM 6453  O OP1    . DA  B 2 13 ? -0.901  11.621  11.054  1.00 3.86  ? 13 DA  F OP1    2  
ATOM 6454  O OP2    . DA  B 2 13 ? 1.327   12.149  9.893   1.00 3.52  ? 13 DA  F OP2    2  
ATOM 6455  O "O5'"  . DA  B 2 13 ? 0.319   9.865   9.773   1.00 3.53  ? 13 DA  F "O5'"  2  
ATOM 6456  C "C5'"  . DA  B 2 13 ? -0.599  9.059   9.036   1.00 3.46  ? 13 DA  F "C5'"  2  
ATOM 6457  C "C4'"  . DA  B 2 13 ? 0.124   8.030   8.198   1.00 3.40  ? 13 DA  F "C4'"  2  
ATOM 6458  O "O4'"  . DA  B 2 13 ? 0.149   8.477   6.815   1.00 3.22  ? 13 DA  F "O4'"  2  
ATOM 6459  C "C3'"  . DA  B 2 13 ? 1.596   7.850   8.556   1.00 3.45  ? 13 DA  F "C3'"  2  
ATOM 6460  O "O3'"  . DA  B 2 13 ? 2.000   6.562   8.110   1.00 3.50  ? 13 DA  F "O3'"  2  
ATOM 6461  C "C2'"  . DA  B 2 13 ? 2.299   8.911   7.735   1.00 3.30  ? 13 DA  F "C2'"  2  
ATOM 6462  C "C1'"  . DA  B 2 13 ? 1.466   8.908   6.465   1.00 3.15  ? 13 DA  F "C1'"  2  
ATOM 6463  N N9     . DA  B 2 13 ? 1.399   10.187  5.756   1.00 3.03  ? 13 DA  F N9     2  
ATOM 6464  C C8     . DA  B 2 13 ? 1.301   11.453  6.268   1.00 3.06  ? 13 DA  F C8     2  
ATOM 6465  N N7     . DA  B 2 13 ? 1.328   12.397  5.356   1.00 2.97  ? 13 DA  F N7     2  
ATOM 6466  C C5     . DA  B 2 13 ? 1.445   11.703  4.159   1.00 2.86  ? 13 DA  F C5     2  
ATOM 6467  C C6     . DA  B 2 13 ? 1.532   12.128  2.815   1.00 2.77  ? 13 DA  F C6     2  
ATOM 6468  N N6     . DA  B 2 13 ? 1.522   13.410  2.437   1.00 2.78  ? 13 DA  F N6     2  
ATOM 6469  N N1     . DA  B 2 13 ? 1.638   11.177  1.862   1.00 2.73  ? 13 DA  F N1     2  
ATOM 6470  C C2     . DA  B 2 13 ? 1.659   9.891   2.241   1.00 2.78  ? 13 DA  F C2     2  
ATOM 6471  N N3     . DA  B 2 13 ? 1.586   9.371   3.466   1.00 2.87  ? 13 DA  F N3     2  
ATOM 6472  C C4     . DA  B 2 13 ? 1.480   10.341  4.389   1.00 2.90  ? 13 DA  F C4     2  
ATOM 6473  H "H5'"  . DA  B 2 13 ? -1.195  9.695   8.379   1.00 3.37  ? 13 DA  F "H5'"  2  
ATOM 6474  H "H5''" . DA  B 2 13 ? -1.265  8.545   9.726   1.00 3.59  ? 13 DA  F "H5''" 2  
ATOM 6475  H "H4'"  . DA  B 2 13 ? -0.366  7.066   8.338   1.00 3.49  ? 13 DA  F "H4'"  2  
ATOM 6476  H "H3'"  . DA  B 2 13 ? 1.777   7.947   9.625   1.00 3.59  ? 13 DA  F "H3'"  2  
ATOM 6477  H "H2'"  . DA  B 2 13 ? 2.279   9.877   8.240   1.00 3.32  ? 13 DA  F "H2'"  2  
ATOM 6478  H "H2''" . DA  B 2 13 ? 3.343   8.655   7.570   1.00 3.30  ? 13 DA  F "H2''" 2  
ATOM 6479  H "H1'"  . DA  B 2 13 ? 1.862   8.166   5.767   1.00 3.13  ? 13 DA  F "H1'"  2  
ATOM 6480  H H8     . DA  B 2 13 ? 1.209   11.655  7.325   1.00 3.19  ? 13 DA  F H8     2  
ATOM 6481  H H61    . DA  B 2 13 ? 1.448   14.138  3.133   1.00 2.85  ? 13 DA  F H61    2  
ATOM 6482  H H62    . DA  B 2 13 ? 1.595   13.652  1.458   1.00 2.75  ? 13 DA  F H62    2  
ATOM 6483  H H2     . DA  B 2 13 ? 1.752   9.166   1.430   1.00 2.78  ? 13 DA  F H2     2  
ATOM 6484  P P      . DA  B 2 14 ? 3.346   5.893   8.654   1.00 3.60  ? 14 DA  F P      2  
ATOM 6485  O OP1    . DA  B 2 14 ? 3.013   4.753   9.545   1.00 3.81  ? 14 DA  F OP1    2  
ATOM 6486  O OP2    . DA  B 2 14 ? 4.262   6.962   9.131   1.00 3.60  ? 14 DA  F OP2    2  
ATOM 6487  O "O5'"  . DA  B 2 14 ? 3.916   5.316   7.284   1.00 3.55  ? 14 DA  F "O5'"  2  
ATOM 6488  C "C5'"  . DA  B 2 14 ? 3.011   5.160   6.187   1.00 3.47  ? 14 DA  F "C5'"  2  
ATOM 6489  C "C4'"  . DA  B 2 14 ? 3.734   4.818   4.906   1.00 3.38  ? 14 DA  F "C4'"  2  
ATOM 6490  O "O4'"  . DA  B 2 14 ? 3.691   5.966   4.019   1.00 3.17  ? 14 DA  F "O4'"  2  
ATOM 6491  C "C3'"  . DA  B 2 14 ? 5.221   4.515   5.056   1.00 3.45  ? 14 DA  F "C3'"  2  
ATOM 6492  O "O3'"  . DA  B 2 14 ? 5.625   3.717   3.948   1.00 3.46  ? 14 DA  F "O3'"  2  
ATOM 6493  C "C2'"  . DA  B 2 14 ? 5.865   5.885   4.971   1.00 3.30  ? 14 DA  F "C2'"  2  
ATOM 6494  C "C1'"  . DA  B 2 14 ? 4.972   6.586   3.956   1.00 3.12  ? 14 DA  F "C1'"  2  
ATOM 6495  N N9     . DA  B 2 14 ? 4.824   8.032   4.139   1.00 3.00  ? 14 DA  F N9     2  
ATOM 6496  C C8     . DA  B 2 14 ? 4.627   8.748   5.292   1.00 3.05  ? 14 DA  F C8     2  
ATOM 6497  N N7     . DA  B 2 14 ? 4.590   10.049  5.108   1.00 2.96  ? 14 DA  F N7     2  
ATOM 6498  C C5     . DA  B 2 14 ? 4.767   10.198  3.739   1.00 2.83  ? 14 DA  F C5     2  
ATOM 6499  C C6     . DA  B 2 14 ? 4.833   11.334  2.904   1.00 2.72  ? 14 DA  F C6     2  
ATOM 6500  N N6     . DA  B 2 14 ? 4.743   12.593  3.347   1.00 2.73  ? 14 DA  F N6     2  
ATOM 6501  N N1     . DA  B 2 14 ? 5.008   11.129  1.578   1.00 2.66  ? 14 DA  F N1     2  
ATOM 6502  C C2     . DA  B 2 14 ? 5.119   9.870   1.134   1.00 2.70  ? 14 DA  F C2     2  
ATOM 6503  N N3     . DA  B 2 14 ? 5.082   8.727   1.818   1.00 2.80  ? 14 DA  F N3     2  
ATOM 6504  C C4     . DA  B 2 14 ? 4.900   8.963   3.129   1.00 2.85  ? 14 DA  F C4     2  
ATOM 6505  H "H5'"  . DA  B 2 14 ? 2.454   6.087   6.042   1.00 3.37  ? 14 DA  F "H5'"  2  
ATOM 6506  H "H5''" . DA  B 2 14 ? 2.305   4.363   6.414   1.00 3.59  ? 14 DA  F "H5''" 2  
ATOM 6507  H "H4'"  . DA  B 2 14 ? 3.268   3.928   4.483   1.00 3.44  ? 14 DA  F "H4'"  2  
ATOM 6508  H "H3'"  . DA  B 2 14 ? 5.442   3.998   5.988   1.00 3.61  ? 14 DA  F "H3'"  2  
ATOM 6509  H "H2'"  . DA  B 2 14 ? 5.861   6.383   5.941   1.00 3.35  ? 14 DA  F "H2'"  2  
ATOM 6510  H "H2''" . DA  B 2 14 ? 6.901   5.812   4.646   1.00 3.29  ? 14 DA  F "H2''" 2  
ATOM 6511  H "H1'"  . DA  B 2 14 ? 5.356   6.417   2.947   1.00 3.07  ? 14 DA  F "H1'"  2  
ATOM 6512  H H8     . DA  B 2 14 ? 4.519   8.286   6.260   1.00 3.19  ? 14 DA  F H8     2  
ATOM 6513  H H61    . DA  B 2 14 ? 4.619   12.770  4.334   1.00 2.81  ? 14 DA  F H61    2  
ATOM 6514  H H62    . DA  B 2 14 ? 4.810   13.367  2.701   1.00 2.69  ? 14 DA  F H62    2  
ATOM 6515  H H2     . DA  B 2 14 ? 5.258   9.765   0.057   1.00 2.69  ? 14 DA  F H2     2  
ATOM 6516  P P      . DT  B 2 15 ? 6.997   2.898   3.990   1.00 3.61  ? 15 DT  F P      2  
ATOM 6517  O OP1    . DT  B 2 15 ? 6.718   1.440   4.049   1.00 3.87  ? 15 DT  F OP1    2  
ATOM 6518  O OP2    . DT  B 2 15 ? 7.886   3.517   5.005   1.00 3.59  ? 15 DT  F OP2    2  
ATOM 6519  O "O5'"  . DT  B 2 15 ? 7.548   3.241   2.539   1.00 3.50  ? 15 DT  F "O5'"  2  
ATOM 6520  C "C5'"  . DT  B 2 15 ? 6.615   3.696   1.558   1.00 3.39  ? 15 DT  F "C5'"  2  
ATOM 6521  C "C4'"  . DT  B 2 15 ? 7.305   4.167   0.300   1.00 3.31  ? 15 DT  F "C4'"  2  
ATOM 6522  O "O4'"  . DT  B 2 15 ? 7.220   5.613   0.230   1.00 3.13  ? 15 DT  F "O4'"  2  
ATOM 6523  C "C3'"  . DT  B 2 15 ? 8.800   3.875   0.235   1.00 3.38  ? 15 DT  F "C3'"  2  
ATOM 6524  O "O3'"  . DT  B 2 15 ? 9.187   3.871   -1.135  1.00 3.40  ? 15 DT  F "O3'"  2  
ATOM 6525  C "C2'"  . DT  B 2 15 ? 9.419   5.066   0.937   1.00 3.23  ? 15 DT  F "C2'"  2  
ATOM 6526  C "C1'"  . DT  B 2 15 ? 8.492   6.192   0.507   1.00 3.08  ? 15 DT  F "C1'"  2  
ATOM 6527  N N1     . DT  B 2 15 ? 8.337   7.309   1.469   1.00 2.97  ? 15 DT  F N1     2  
ATOM 6528  C C2     . DT  B 2 15 ? 8.331   8.583   0.937   1.00 2.83  ? 15 DT  F C2     2  
ATOM 6529  O O2     . DT  B 2 15 ? 8.381   8.804   -0.262  1.00 2.82  ? 15 DT  F O2     2  
ATOM 6530  N N3     . DT  B 2 15 ? 8.268   9.592   1.857   1.00 2.77  ? 15 DT  F N3     2  
ATOM 6531  C C4     . DT  B 2 15 ? 8.203   9.468   3.226   1.00 2.85  ? 15 DT  F C4     2  
ATOM 6532  O O4     . DT  B 2 15 ? 8.215   10.476  3.929   1.00 2.84  ? 15 DT  F O4     2  
ATOM 6533  C C5     . DT  B 2 15 ? 8.186   8.107   3.723   1.00 2.99  ? 15 DT  F C5     2  
ATOM 6534  C C7     . DT  B 2 15 ? 8.173   7.882   5.203   1.00 3.13  ? 15 DT  F C7     2  
ATOM 6535  C C6     . DT  B 2 15 ? 8.242   7.102   2.831   1.00 3.04  ? 15 DT  F C6     2  
ATOM 6536  H "H5'"  . DT  B 2 15 ? 6.029   4.518   1.969   1.00 3.29  ? 15 DT  F "H5'"  2  
ATOM 6537  H "H5''" . DT  B 2 15 ? 5.937   2.880   1.301   1.00 3.49  ? 15 DT  F "H5''" 2  
ATOM 6538  H "H4'"  . DT  B 2 15 ? 6.843   3.664   -0.549  1.00 3.38  ? 15 DT  F "H4'"  2  
ATOM 6539  H "H3'"  . DT  B 2 15 ? 9.057   2.924   0.698   1.00 3.52  ? 15 DT  F "H3'"  2  
ATOM 6540  H "H2'"  . DT  B 2 15 ? 9.429   4.927   2.018   1.00 3.28  ? 15 DT  F "H2'"  2  
ATOM 6541  H "H2''" . DT  B 2 15 ? 10.447  5.221   0.619   1.00 3.23  ? 15 DT  F "H2''" 2  
ATOM 6542  H "H1'"  . DT  B 2 15 ? 8.849   6.620   -0.433  1.00 3.04  ? 15 DT  F "H1'"  2  
ATOM 6543  H H3     . DT  B 2 15 ? 8.285   10.536  1.495   1.00 2.70  ? 15 DT  F H3     2  
ATOM 6544  H H71    . DT  B 2 15 ? 8.811   8.620   5.687   1.00 3.02  ? 15 DT  F H71    2  
ATOM 6545  H H72    . DT  B 2 15 ? 7.155   7.984   5.579   1.00 3.25  ? 15 DT  F H72    2  
ATOM 6546  H H73    . DT  B 2 15 ? 8.545   6.881   5.425   1.00 3.61  ? 15 DT  F H73    2  
ATOM 6547  H H6     . DT  B 2 15 ? 8.210   6.077   3.200   1.00 3.18  ? 15 DT  F H6     2  
ATOM 6548  P P      . DT  B 2 16 ? 10.559  3.193   -1.594  1.00 3.52  ? 16 DT  F P      2  
ATOM 6549  O OP1    . DT  B 2 16 ? 10.285  1.909   -2.289  1.00 3.75  ? 16 DT  F OP1    2  
ATOM 6550  O OP2    . DT  B 2 16 ? 11.510  3.223   -0.455  1.00 3.55  ? 16 DT  F OP2    2  
ATOM 6551  O "O5'"  . DT  B 2 16 ? 11.042  4.261   -2.669  1.00 3.38  ? 16 DT  F "O5'"  2  
ATOM 6552  C "C5'"  . DT  B 2 16 ? 10.096  5.210   -3.170  1.00 3.24  ? 16 DT  F "C5'"  2  
ATOM 6553  C "C4'"  . DT  B 2 16 ? 10.783  6.351   -3.882  1.00 3.15  ? 16 DT  F "C4'"  2  
ATOM 6554  O "O4'"  . DT  B 2 16 ? 10.706  7.539   -3.054  1.00 2.98  ? 16 DT  F "O4'"  2  
ATOM 6555  C "C3'"  . DT  B 2 16 ? 12.277  6.126   -4.097  1.00 3.22  ? 16 DT  F "C3'"  2  
ATOM 6556  O "O3'"  . DT  B 2 16 ? 12.698  6.936   -5.189  1.00 3.21  ? 16 DT  F "O3'"  2  
ATOM 6557  C "C2'"  . DT  B 2 16 ? 12.890  6.640   -2.809  1.00 3.11  ? 16 DT  F "C2'"  2  
ATOM 6558  C "C1'"  . DT  B 2 16 ? 11.980  7.820   -2.490  1.00 2.95  ? 16 DT  F "C1'"  2  
ATOM 6559  N N1     . DT  B 2 16 ? 11.821  8.168   -1.061  1.00 2.89  ? 16 DT  F N1     2  
ATOM 6560  C C2     . DT  B 2 16 ? 11.727  9.511   -0.754  1.00 2.76  ? 16 DT  F C2     2  
ATOM 6561  O O2     . DT  B 2 16 ? 11.721  10.391  -1.599  1.00 2.69  ? 16 DT  F O2     2  
ATOM 6562  N N3     . DT  B 2 16 ? 11.647  9.791   0.582   1.00 2.76  ? 16 DT  F N3     2  
ATOM 6563  C C4     . DT  B 2 16 ? 11.644  8.890   1.621   1.00 2.89  ? 16 DT  F C4     2  
ATOM 6564  O O4     . DT  B 2 16 ? 11.606  9.295   2.780   1.00 2.92  ? 16 DT  F O4     2  
ATOM 6565  C C5     . DT  B 2 16 ? 11.724  7.501   1.232   1.00 3.02  ? 16 DT  F C5     2  
ATOM 6566  C C7     . DT  B 2 16 ? 11.790  6.462   2.303   1.00 3.20  ? 16 DT  F C7     2  
ATOM 6567  C C6     . DT  B 2 16 ? 11.798  7.206   -0.075  1.00 3.01  ? 16 DT  F C6     2  
ATOM 6568  H "H5'"  . DT  B 2 16 ? 9.512   5.612   -2.341  1.00 3.14  ? 16 DT  F "H5'"  2  
ATOM 6569  H "H5''" . DT  B 2 16 ? 9.422   4.716   -3.868  1.00 3.35  ? 16 DT  F "H5''" 2  
ATOM 6570  H "H4'"  . DT  B 2 16 ? 10.324  6.469   -4.864  1.00 3.20  ? 16 DT  F "H4'"  2  
ATOM 6571  H "H3'"  . DT  B 2 16 ? 12.512  5.083   -4.295  1.00 3.37  ? 16 DT  F "H3'"  2  
ATOM 6572  H "H2'"  . DT  B 2 16 ? 12.860  5.876   -2.031  1.00 3.18  ? 16 DT  F "H2'"  2  
ATOM 6573  H "H2''" . DT  B 2 16 ? 13.931  6.912   -2.951  1.00 3.11  ? 16 DT  F "H2''" 2  
ATOM 6574  H "H1'"  . DT  B 2 16 ? 12.352  8.711   -3.001  1.00 2.90  ? 16 DT  F "H1'"  2  
ATOM 6575  H H3     . DT  B 2 16 ? 11.593  10.770  0.838   1.00 2.70  ? 16 DT  F H3     2  
ATOM 6576  H H71    . DT  B 2 16 ? 10.811  6.358   2.770   1.00 2.98  ? 16 DT  F H71    2  
ATOM 6577  H H72    . DT  B 2 16 ? 12.520  6.762   3.055   1.00 3.70  ? 16 DT  F H72    2  
ATOM 6578  H H73    . DT  B 2 16 ? 12.088  5.510   1.867   1.00 3.47  ? 16 DT  F H73    2  
ATOM 6579  H H6     . DT  B 2 16 ? 11.841  6.158   -0.370  1.00 3.14  ? 16 DT  F H6     2  
ATOM 6580  P P      . DG  B 2 17 ? 14.009  6.557   -6.032  1.00 3.40  ? 17 DG  F P      2  
ATOM 6581  O OP1    . DG  B 2 17 ? 13.639  5.645   -7.145  1.00 3.58  ? 17 DG  F OP1    2  
ATOM 6582  O OP2    . DG  B 2 17 ? 15.073  6.159   -5.082  1.00 3.47  ? 17 DG  F OP2    2  
ATOM 6583  O "O5'"  . DG  B 2 17 ? 14.378  7.975   -6.654  1.00 3.37  ? 17 DG  F "O5'"  2  
ATOM 6584  C "C5'"  . DG  B 2 17 ? 13.332  8.917   -6.886  1.00 3.26  ? 17 DG  F "C5'"  2  
ATOM 6585  C "C4'"  . DG  B 2 17 ? 13.827  10.343  -6.788  1.00 3.18  ? 17 DG  F "C4'"  2  
ATOM 6586  O "O4'"  . DG  B 2 17 ? 13.653  10.812  -5.423  1.00 3.00  ? 17 DG  F "O4'"  2  
ATOM 6587  C "C3'"  . DG  B 2 17 ? 15.319  10.527  -7.055  1.00 3.24  ? 17 DG  F "C3'"  2  
ATOM 6588  O "O3'"  . DG  B 2 17 ? 15.552  11.868  -7.476  1.00 3.24  ? 17 DG  F "O3'"  2  
ATOM 6589  C "C2'"  . DG  B 2 17 ? 15.952  10.293  -5.700  1.00 3.13  ? 17 DG  F "C2'"  2  
ATOM 6590  C "C1'"  . DG  B 2 17 ? 14.918  10.892  -4.763  1.00 2.97  ? 17 DG  F "C1'"  2  
ATOM 6591  N N9     . DG  B 2 17 ? 14.839  10.258  -3.452  1.00 2.91  ? 17 DG  F N9     2  
ATOM 6592  C C8     . DG  B 2 17 ? 14.828  8.917   -3.171  1.00 2.99  ? 17 DG  F C8     2  
ATOM 6593  N N7     . DG  B 2 17 ? 14.826  8.656   -1.891  1.00 2.96  ? 17 DG  F N7     2  
ATOM 6594  C C5     . DG  B 2 17 ? 14.825  9.905   -1.285  1.00 2.84  ? 17 DG  F C5     2  
ATOM 6595  C C6     . DG  B 2 17 ? 14.830  10.264  0.094   1.00 2.80  ? 17 DG  F C6     2  
ATOM 6596  O O6     . DG  B 2 17 ? 14.846  9.523   1.093   1.00 2.86  ? 17 DG  F O6     2  
ATOM 6597  N N1     . DG  B 2 17 ? 14.821  11.644  0.262   1.00 2.72  ? 17 DG  F N1     2  
ATOM 6598  C C2     . DG  B 2 17 ? 14.810  12.562  -0.760  1.00 2.69  ? 17 DG  F C2     2  
ATOM 6599  N N2     . DG  B 2 17 ? 14.799  13.851  -0.396  1.00 2.67  ? 17 DG  F N2     2  
ATOM 6600  N N3     . DG  B 2 17 ? 14.810  12.243  -2.046  1.00 2.74  ? 17 DG  F N3     2  
ATOM 6601  C C4     . DG  B 2 17 ? 14.816  10.904  -2.234  1.00 2.80  ? 17 DG  F C4     2  
ATOM 6602  H "H5'"  . DG  B 2 17 ? 12.542  8.767   -6.148  1.00 3.16  ? 17 DG  F "H5'"  2  
ATOM 6603  H "H5''" . DG  B 2 17 ? 12.915  8.758   -7.880  1.00 3.38  ? 17 DG  F "H5''" 2  
ATOM 6604  H "H4'"  . DG  B 2 17 ? 13.289  10.940  -7.526  1.00 3.22  ? 17 DG  F "H4'"  2  
ATOM 6605  H "H3'"  . DG  B 2 17 ? 15.684  9.836   -7.813  1.00 3.39  ? 17 DG  F "H3'"  2  
ATOM 6606  H "H2'"  . DG  B 2 17 ? 16.111  9.230   -5.515  1.00 3.19  ? 17 DG  F "H2'"  2  
ATOM 6607  H "H2''" . DG  B 2 17 ? 16.920  10.786  -5.625  1.00 3.13  ? 17 DG  F "H2''" 2  
ATOM 6608  H "H1'"  . DG  B 2 17 ? 15.127  11.952  -4.608  1.00 2.92  ? 17 DG  F "H1'"  2  
ATOM 6609  H H8     . DG  B 2 17 ? 14.828  8.154   -3.935  1.00 3.11  ? 17 DG  F H8     2  
ATOM 6610  H H1     . DG  B 2 17 ? 14.823  11.995  1.210   1.00 2.73  ? 17 DG  F H1     2  
ATOM 6611  H H21    . DG  B 2 17 ? 14.789  14.576  -1.100  1.00 2.69  ? 17 DG  F H21    2  
ATOM 6612  H H22    . DG  B 2 17 ? 14.801  14.107  0.583   1.00 2.68  ? 17 DG  F H22    2  
ATOM 6613  P P      . DT  B 2 18 ? 16.930  12.259  -8.200  1.00 3.36  ? 18 DT  F P      2  
ATOM 6614  O OP1    . DT  B 2 18 ? 16.643  13.015  -9.447  1.00 3.53  ? 18 DT  F OP1    2  
ATOM 6615  O OP2    . DT  B 2 18 ? 17.811  11.066  -8.251  1.00 3.38  ? 18 DT  F OP2    2  
ATOM 6616  O "O5'"  . DT  B 2 18 ? 17.528  13.279  -7.135  1.00 3.25  ? 18 DT  F "O5'"  2  
ATOM 6617  C "C5'"  . DT  B 2 18 ? 16.636  13.916  -6.219  1.00 3.14  ? 18 DT  F "C5'"  2  
ATOM 6618  C "C4'"  . DT  B 2 18 ? 17.367  14.896  -5.336  1.00 3.08  ? 18 DT  F "C4'"  2  
ATOM 6619  O "O4'"  . DT  B 2 18 ? 17.403  14.379  -3.985  1.00 2.95  ? 18 DT  F "O4'"  2  
ATOM 6620  C "C3'"  . DT  B 2 18 ? 18.828  15.107  -5.711  1.00 3.15  ? 18 DT  F "C3'"  2  
ATOM 6621  O "O3'"  . DT  B 2 18 ? 19.219  16.374  -5.202  1.00 3.16  ? 18 DT  F "O3'"  2  
ATOM 6622  C "C2'"  . DT  B 2 18 ? 19.537  13.997  -4.957  1.00 3.07  ? 18 DT  F "C2'"  2  
ATOM 6623  C "C1'"  . DT  B 2 18 ? 18.714  13.930  -3.672  1.00 2.94  ? 18 DT  F "C1'"  2  
ATOM 6624  N N1     . DT  B 2 18 ? 18.618  12.617  -2.994  1.00 2.90  ? 18 DT  F N1     2  
ATOM 6625  C C2     . DT  B 2 18 ? 18.571  12.647  -1.616  1.00 2.83  ? 18 DT  F C2     2  
ATOM 6626  O O2     . DT  B 2 18 ? 18.572  13.684  -0.975  1.00 2.80  ? 18 DT  F O2     2  
ATOM 6627  N N3     . DT  B 2 18 ? 18.521  11.420  -1.015  1.00 2.84  ? 18 DT  F N3     2  
ATOM 6628  C C4     . DT  B 2 18 ? 18.505  10.190  -1.629  1.00 2.92  ? 18 DT  F C4     2  
ATOM 6629  O O4     . DT  B 2 18 ? 18.462  9.168   -0.941  1.00 2.97  ? 18 DT  F O4     2  
ATOM 6630  C C5     . DT  B 2 18 ? 18.544  10.225  -3.081  1.00 2.99  ? 18 DT  F C5     2  
ATOM 6631  C C7     . DT  B 2 18 ? 18.546  8.934   -3.836  1.00 3.12  ? 18 DT  F C7     2  
ATOM 6632  C C6     . DT  B 2 18 ? 18.594  11.424  -3.688  1.00 2.98  ? 18 DT  F C6     2  
ATOM 6633  H "H5'"  . DT  B 2 18 ? 16.164  13.162  -5.593  1.00 3.07  ? 18 DT  F "H5'"  2  
ATOM 6634  H "H5''" . DT  B 2 18 ? 15.866  14.448  -6.774  1.00 3.20  ? 18 DT  F "H5''" 2  
ATOM 6635  H "H4'"  . DT  B 2 18 ? 16.868  15.864  -5.420  1.00 3.12  ? 18 DT  F "H4'"  2  
ATOM 6636  H "H3'"  . DT  B 2 18 ? 18.990  15.067  -6.786  1.00 3.27  ? 18 DT  F "H3'"  2  
ATOM 6637  H "H2'"  . DT  B 2 18 ? 19.508  13.062  -5.515  1.00 3.12  ? 18 DT  F "H2'"  2  
ATOM 6638  H "H2''" . DT  B 2 18 ? 20.583  14.241  -4.790  1.00 3.08  ? 18 DT  F "H2''" 2  
ATOM 6639  H "H1'"  . DT  B 2 18 ? 19.118  14.639  -2.946  1.00 2.91  ? 18 DT  F "H1'"  2  
ATOM 6640  H H3     . DT  B 2 18 ? 18.503  11.423  -0.006  1.00 2.82  ? 18 DT  F H3     2  
ATOM 6641  H H71    . DT  B 2 18 ? 18.203  9.108   -4.856  1.00 3.62  ? 18 DT  F H71    2  
ATOM 6642  H H72    . DT  B 2 18 ? 19.557  8.527   -3.859  1.00 2.90  ? 18 DT  F H72    2  
ATOM 6643  H H73    . DT  B 2 18 ? 17.880  8.225   -3.343  1.00 3.33  ? 18 DT  F H73    2  
ATOM 6644  H H6     . DT  B 2 18 ? 18.616  11.455  -4.777  1.00 3.07  ? 18 DT  F H6     2  
ATOM 6645  P P      . DC  B 2 19 ? 20.421  17.191  -5.865  1.00 3.27  ? 19 DC  F P      2  
ATOM 6646  O OP1    . DC  B 2 19 ? 19.923  17.976  -7.022  1.00 3.45  ? 19 DC  F OP1    2  
ATOM 6647  O OP2    . DC  B 2 19 ? 21.585  16.285  -6.039  1.00 3.38  ? 19 DC  F OP2    2  
ATOM 6648  O "O5'"  . DC  B 2 19 ? 20.743  18.202  -4.682  1.00 3.13  ? 19 DC  F "O5'"  2  
ATOM 6649  C "C5'"  . DC  B 2 19 ? 19.724  18.472  -3.719  1.00 3.03  ? 19 DC  F "C5'"  2  
ATOM 6650  C "C4'"  . DC  B 2 19 ? 20.310  18.832  -2.374  1.00 3.03  ? 19 DC  F "C4'"  2  
ATOM 6651  O "O4'"  . DC  B 2 19 ? 20.349  17.641  -1.542  1.00 2.96  ? 19 DC  F "O4'"  2  
ATOM 6652  C "C3'"  . DC  B 2 19 ? 21.761  19.298  -2.431  1.00 3.12  ? 19 DC  F "C3'"  2  
ATOM 6653  O "O3'"  . DC  B 2 19 ? 22.033  20.102  -1.290  1.00 3.19  ? 19 DC  F "O3'"  2  
ATOM 6654  C "C2'"  . DC  B 2 19 ? 22.551  18.009  -2.352  1.00 3.09  ? 19 DC  F "C2'"  2  
ATOM 6655  C "C1'"  . DC  B 2 19 ? 21.694  17.180  -1.410  1.00 3.01  ? 19 DC  F "C1'"  2  
ATOM 6656  N N1     . DC  B 2 19 ? 21.751  15.719  -1.612  1.00 2.97  ? 19 DC  F N1     2  
ATOM 6657  C C2     . DC  B 2 19 ? 21.728  14.891  -0.480  1.00 2.95  ? 19 DC  F C2     2  
ATOM 6658  O O2     . DC  B 2 19 ? 21.575  15.406  0.640   1.00 2.96  ? 19 DC  F O2     2  
ATOM 6659  N N3     . DC  B 2 19 ? 21.873  13.554  -0.632  1.00 2.96  ? 19 DC  F N3     2  
ATOM 6660  C C4     . DC  B 2 19 ? 22.030  13.036  -1.852  1.00 3.00  ? 19 DC  F C4     2  
ATOM 6661  N N4     . DC  B 2 19 ? 22.209  11.716  -1.952  1.00 3.07  ? 19 DC  F N4     2  
ATOM 6662  C C5     . DC  B 2 19 ? 22.021  13.849  -3.024  1.00 3.03  ? 19 DC  F C5     2  
ATOM 6663  C C6     . DC  B 2 19 ? 21.871  15.174  -2.858  1.00 3.01  ? 19 DC  F C6     2  
ATOM 6664  H "H5'"  . DC  B 2 19 ? 19.095  17.590  -3.604  1.00 2.95  ? 19 DC  F "H5'"  2  
ATOM 6665  H "H5''" . DC  B 2 19 ? 19.108  19.300  -4.066  1.00 3.07  ? 19 DC  F "H5''" 2  
ATOM 6666  H "H4'"  . DC  B 2 19 ? 19.720  19.645  -1.950  1.00 3.07  ? 19 DC  F "H4'"  2  
ATOM 6667  H "H3'"  . DC  B 2 19 ? 21.968  19.865  -3.337  1.00 3.19  ? 19 DC  F "H3'"  2  
ATOM 6668  H "H2'"  . DC  B 2 19 ? 22.653  17.547  -3.333  1.00 3.10  ? 19 DC  F "H2'"  2  
ATOM 6669  H "H2''" . DC  B 2 19 ? 23.553  18.186  -1.969  1.00 3.16  ? 19 DC  F "H2''" 2  
ATOM 6670  H "H1'"  . DC  B 2 19 ? 21.992  17.377  -0.377  1.00 3.05  ? 19 DC  F "H1'"  2  
ATOM 6671  H H41    . DC  B 2 19 ? 22.339  11.289  -2.861  1.00 3.14  ? 19 DC  F H41    2  
ATOM 6672  H H42    . DC  B 2 19 ? 22.236  11.141  -1.121  1.00 3.08  ? 19 DC  F H42    2  
ATOM 6673  H H5     . DC  B 2 19 ? 22.139  13.412  -4.013  1.00 3.10  ? 19 DC  F H5     2  
ATOM 6674  H H6     . DC  B 2 19 ? 21.841  15.820  -3.734  1.00 3.06  ? 19 DC  F H6     2  
ATOM 6675  P P      . DA  B 2 20 ? 23.313  21.056  -1.270  1.00 3.29  ? 20 DA  F P      2  
ATOM 6676  O OP1    . DA  B 2 20 ? 22.896  22.448  -0.970  1.00 3.42  ? 20 DA  F OP1    2  
ATOM 6677  O OP2    . DA  B 2 20 ? 24.141  20.779  -2.471  1.00 3.33  ? 20 DA  F OP2    2  
ATOM 6678  O "O5'"  . DA  B 2 20 ? 24.067  20.483  0.005   1.00 3.30  ? 20 DA  F "O5'"  2  
ATOM 6679  C "C5'"  . DA  B 2 20 ? 23.337  19.698  0.953   1.00 3.24  ? 20 DA  F "C5'"  2  
ATOM 6680  C "C4'"  . DA  B 2 20 ? 24.262  19.078  1.972   1.00 3.24  ? 20 DA  F "C4'"  2  
ATOM 6681  O "O4'"  . DA  B 2 20 ? 24.352  17.657  1.726   1.00 3.14  ? 20 DA  F "O4'"  2  
ATOM 6682  C "C3'"  . DA  B 2 20 ? 25.692  19.592  1.859   1.00 3.33  ? 20 DA  F "C3'"  2  
ATOM 6683  O "O3'"  . DA  B 2 20 ? 26.340  19.383  3.110   1.00 3.39  ? 20 DA  F "O3'"  2  
ATOM 6684  C "C2'"  . DA  B 2 20 ? 26.305  18.665  0.821   1.00 3.24  ? 20 DA  F "C2'"  2  
ATOM 6685  C "C1'"  . DA  B 2 20 ? 25.617  17.347  1.163   1.00 3.14  ? 20 DA  F "C1'"  2  
ATOM 6686  N N9     . DA  B 2 20 ? 25.434  16.381  0.078   1.00 3.07  ? 20 DA  F N9     2  
ATOM 6687  C C8     . DA  B 2 20 ? 25.290  16.563  -1.275  1.00 3.09  ? 20 DA  F C8     2  
ATOM 6688  N N7     . DA  B 2 20 ? 25.195  15.439  -1.950  1.00 3.07  ? 20 DA  F N7     2  
ATOM 6689  C C5     . DA  B 2 20 ? 25.279  14.454  -0.974  1.00 3.03  ? 20 DA  F C5     2  
ATOM 6690  C C6     . DA  B 2 20 ? 25.251  13.044  -1.034  1.00 3.03  ? 20 DA  F C6     2  
ATOM 6691  N N6     . DA  B 2 20 ? 25.140  12.345  -2.166  1.00 3.08  ? 20 DA  F N6     2  
ATOM 6692  N N1     . DA  B 2 20 ? 25.350  12.366  0.131   1.00 3.03  ? 20 DA  F N1     2  
ATOM 6693  C C2     . DA  B 2 20 ? 25.478  13.059  1.269   1.00 3.04  ? 20 DA  F C2     2  
ATOM 6694  N N3     . DA  B 2 20 ? 25.520  14.375  1.452   1.00 3.04  ? 20 DA  F N3     2  
ATOM 6695  C C4     . DA  B 2 20 ? 25.414  15.022  0.278   1.00 3.03  ? 20 DA  F C4     2  
ATOM 6696  H "H5'"  . DA  B 2 20 ? 22.804  18.906  0.432   1.00 3.15  ? 20 DA  F "H5'"  2  
ATOM 6697  H "H5''" . DA  B 2 20 ? 22.615  20.330  1.468   1.00 3.34  ? 20 DA  F "H5''" 2  
ATOM 6698  H "H4'"  . DA  B 2 20 ? 23.898  19.337  2.969   1.00 3.30  ? 20 DA  F "H4'"  2  
ATOM 6699  H "H3'"  . DA  B 2 20 ? 25.738  20.641  1.579   1.00 3.41  ? 20 DA  F "H3'"  2  
ATOM 6700  H "H2'"  . DA  B 2 20 ? 26.072  19.001  -0.191  1.00 3.25  ? 20 DA  F "H2'"  2  
ATOM 6701  H "H2''" . DA  B 2 20 ? 27.390  18.632  0.910   1.00 3.28  ? 20 DA  F "H2''" 2  
ATOM 6702  H "H1'"  . DA  B 2 20 ? 26.183  16.842  1.949   1.00 3.16  ? 20 DA  F "H1'"  2  
ATOM 6703  H H8     . DA  B 2 20 ? 25.265  17.536  -1.740  1.00 3.16  ? 20 DA  F H8     2  
ATOM 6704  H H61    . DA  B 2 20 ? 25.070  12.826  -3.052  1.00 3.11  ? 20 DA  F H61    2  
ATOM 6705  H H62    . DA  B 2 20 ? 25.122  11.335  -2.139  1.00 3.11  ? 20 DA  F H62    2  
ATOM 6706  H H2     . DA  B 2 20 ? 25.560  12.459  2.175   1.00 3.08  ? 20 DA  F H2     2  
ATOM 6707  P P      . DA  B 2 21 ? 27.122  20.571  3.830   1.00 3.56  ? 21 DA  F P      2  
ATOM 6708  O OP1    . DA  B 2 21 ? 26.187  21.690  4.108   1.00 3.72  ? 21 DA  F OP1    2  
ATOM 6709  O OP2    . DA  B 2 21 ? 28.370  20.826  3.067   1.00 3.55  ? 21 DA  F OP2    2  
ATOM 6710  O "O5'"  . DA  B 2 21 ? 27.515  19.891  5.212   1.00 3.59  ? 21 DA  F "O5'"  2  
ATOM 6711  C "C5'"  . DA  B 2 21 ? 26.556  19.086  5.892   1.00 3.62  ? 21 DA  F "C5'"  2  
ATOM 6712  C "C4'"  . DA  B 2 21 ? 27.201  17.874  6.525   1.00 3.63  ? 21 DA  F "C4'"  2  
ATOM 6713  O "O4'"  . DA  B 2 21 ? 27.187  16.775  5.576   1.00 3.47  ? 21 DA  F "O4'"  2  
ATOM 6714  C "C3'"  . DA  B 2 21 ? 28.679  18.044  6.873   1.00 3.74  ? 21 DA  F "C3'"  2  
ATOM 6715  O "O3'"  . DA  B 2 21 ? 29.009  17.108  7.893   1.00 3.83  ? 21 DA  F "O3'"  2  
ATOM 6716  C "C2'"  . DA  B 2 21 ? 29.392  17.663  5.593   1.00 3.62  ? 21 DA  F "C2'"  2  
ATOM 6717  C "C1'"  . DA  B 2 21 ? 28.504  16.548  5.070   1.00 3.48  ? 21 DA  F "C1'"  2  
ATOM 6718  N N9     . DA  B 2 21 ? 28.457  16.398  3.614   1.00 3.36  ? 21 DA  F N9     2  
ATOM 6719  C C8     . DA  B 2 21 ? 28.372  17.353  2.635   1.00 3.34  ? 21 DA  F C8     2  
ATOM 6720  N N7     . DA  B 2 21 ? 28.400  16.866  1.416   1.00 3.27  ? 21 DA  F N7     2  
ATOM 6721  C C5     . DA  B 2 21 ? 28.504  15.495  1.608   1.00 3.24  ? 21 DA  F C5     2  
ATOM 6722  C C6     . DA  B 2 21 ? 28.577  14.409  0.709   1.00 3.22  ? 21 DA  F C6     2  
ATOM 6723  N N6     . DA  B 2 21 ? 28.556  14.541  -0.620  1.00 3.22  ? 21 DA  F N6     2  
ATOM 6724  N N1     . DA  B 2 21 ? 28.675  13.168  1.232   1.00 3.25  ? 21 DA  F N1     2  
ATOM 6725  C C2     . DA  B 2 21 ? 28.698  13.033  2.564   1.00 3.30  ? 21 DA  F C2     2  
ATOM 6726  N N3     . DA  B 2 21 ? 28.632  13.970  3.506   1.00 3.33  ? 21 DA  F N3     2  
ATOM 6727  C C4     . DA  B 2 21 ? 28.535  15.193  2.956   1.00 3.30  ? 21 DA  F C4     2  
ATOM 6728  H "H5'"  . DA  B 2 21 ? 25.796  18.751  5.184   1.00 3.57  ? 21 DA  F "H5'"  2  
ATOM 6729  H "H5''" . DA  B 2 21 ? 26.076  19.675  6.671   1.00 3.73  ? 21 DA  F "H5''" 2  
ATOM 6730  H "H4'"  . DA  B 2 21 ? 26.674  17.655  7.455   1.00 3.70  ? 21 DA  F "H4'"  2  
ATOM 6731  H "H3'"  . DA  B 2 21 ? 28.910  19.055  7.207   1.00 3.85  ? 21 DA  F "H3'"  2  
ATOM 6732  H "H2'"  . DA  B 2 21 ? 29.445  18.507  4.903   1.00 3.61  ? 21 DA  F "H2'"  2  
ATOM 6733  H "H2''" . DA  B 2 21 ? 30.412  17.333  5.788   1.00 3.67  ? 21 DA  F "H2''" 2  
ATOM 6734  H "H1'"  . DA  B 2 21 ? 28.836  15.592  5.487   1.00 3.51  ? 21 DA  F "H1'"  2  
ATOM 6735  H H8     . DA  B 2 21 ? 28.291  18.409  2.844   1.00 3.40  ? 21 DA  F H8     2  
ATOM 6736  H H61    . DA  B 2 21 ? 28.485  15.460  -1.032  1.00 3.23  ? 21 DA  F H61    2  
ATOM 6737  H H62    . DA  B 2 21 ? 28.611  13.728  -1.215  1.00 3.24  ? 21 DA  F H62    2  
ATOM 6738  H H2     . DA  B 2 21 ? 28.783  12.010  2.928   1.00 3.35  ? 21 DA  F H2     2  
ATOM 6739  P P      . DT  B 2 22 ? 30.328  17.299  8.778   1.00 4.02  ? 22 DT  F P      2  
ATOM 6740  O OP1    . DT  B 2 22 ? 29.946  17.568  10.186  1.00 4.22  ? 22 DT  F OP1    2  
ATOM 6741  O OP2    . DT  B 2 22 ? 31.255  18.226  8.077   1.00 4.00  ? 22 DT  F OP2    2  
ATOM 6742  O "O5'"  . DT  B 2 22 ? 30.935  15.828  8.702   1.00 4.01  ? 22 DT  F "O5'"  2  
ATOM 6743  C "C5'"  . DT  B 2 22 ? 30.082  14.736  8.334   1.00 3.92  ? 22 DT  F "C5'"  2  
ATOM 6744  C "C4'"  . DT  B 2 22 ? 30.868  13.455  8.186   1.00 3.94  ? 22 DT  F "C4'"  2  
ATOM 6745  O "O4'"  . DT  B 2 22 ? 30.940  13.109  6.781   1.00 3.78  ? 22 DT  F "O4'"  2  
ATOM 6746  C "C3'"  . DT  B 2 22 ? 32.321  13.556  8.638   1.00 4.06  ? 22 DT  F "C3'"  2  
ATOM 6747  O "O3'"  . DT  B 2 22 ? 32.787  12.251  8.972   1.00 4.14  ? 22 DT  F "O3'"  2  
ATOM 6748  C "C2'"  . DT  B 2 22 ? 33.028  14.060  7.393   1.00 3.94  ? 22 DT  F "C2'"  2  
ATOM 6749  C "C1'"  . DT  B 2 22 ? 32.253  13.354  6.284   1.00 3.79  ? 22 DT  F "C1'"  2  
ATOM 6750  N N1     . DT  B 2 22 ? 32.148  14.066  4.983   1.00 3.66  ? 22 DT  F N1     2  
ATOM 6751  C C2     . DT  B 2 22 ? 32.140  13.279  3.847   1.00 3.58  ? 22 DT  F C2     2  
ATOM 6752  O O2     . DT  B 2 22 ? 32.181  12.061  3.879   1.00 3.62  ? 22 DT  F O2     2  
ATOM 6753  N N3     . DT  B 2 22 ? 32.083  13.973  2.667   1.00 3.50  ? 22 DT  F N3     2  
ATOM 6754  C C4     . DT  B 2 22 ? 32.028  15.339  2.503   1.00 3.49  ? 22 DT  F C4     2  
ATOM 6755  O O4     . DT  B 2 22 ? 32.011  15.818  1.367   1.00 3.45  ? 22 DT  F O4     2  
ATOM 6756  C C5     . DT  B 2 22 ? 32.024  16.108  3.735   1.00 3.57  ? 22 DT  F C5     2  
ATOM 6757  C C7     . DT  B 2 22 ? 31.987  17.602  3.651   1.00 3.61  ? 22 DT  F C7     2  
ATOM 6758  C C6     . DT  B 2 22 ? 32.080  15.444  4.903   1.00 3.65  ? 22 DT  F C6     2  
ATOM 6759  H "H5'"  . DT  B 2 22 ? 29.592  14.961  7.388   1.00 3.79  ? 22 DT  F "H5'"  2  
ATOM 6760  H "H5''" . DT  B 2 22 ? 29.321  14.596  9.102   1.00 3.99  ? 22 DT  F "H5''" 2  
ATOM 6761  H "H4'"  . DT  B 2 22 ? 30.390  12.690  8.801   1.00 4.01  ? 22 DT  F "H4'"  2  
ATOM 6762  H "H3'"  . DT  B 2 22 ? 32.439  14.224  9.490   1.00 4.17  ? 22 DT  F "H3'"  2  
ATOM 6763  H "H2'"  . DT  B 2 22 ? 32.963  15.145  7.317   1.00 3.92  ? 22 DT  F "H2'"  2  
ATOM 6764  H "H2''" . DT  B 2 22 ? 34.080  13.801  7.412   1.00 3.99  ? 22 DT  F "H2''" 2  
ATOM 6765  H "H1'"  . DT  B 2 22 ? 32.703  12.376  6.088   1.00 3.82  ? 22 DT  F "H1'"  2  
ATOM 6766  H H3     . DT  B 2 22 ? 32.094  13.418  1.822   1.00 3.47  ? 22 DT  F H3     2  
ATOM 6767  H H71    . DT  B 2 22 ? 32.668  17.942  2.871   1.00 3.93  ? 22 DT  F H71    2  
ATOM 6768  H H72    . DT  B 2 22 ? 30.973  17.927  3.417   1.00 3.63  ? 22 DT  F H72    2  
ATOM 6769  H H73    . DT  B 2 22 ? 32.293  18.028  4.607   1.00 3.75  ? 22 DT  F H73    2  
ATOM 6770  H H6     . DT  B 2 22 ? 32.073  16.019  5.828   1.00 3.75  ? 22 DT  F H6     2  
ATOM 6771  P P      . DC  B 2 23 ? 34.004  12.060  9.998   1.00 4.31  ? 23 DC  F P      2  
ATOM 6772  O OP1    . DC  B 2 23 ? 33.470  11.874  11.371  1.00 4.46  ? 23 DC  F OP1    2  
ATOM 6773  O OP2    . DC  B 2 23 ? 35.005  13.126  9.736   1.00 4.34  ? 23 DC  F OP2    2  
ATOM 6774  O "O5'"  . DC  B 2 23 ? 34.606  10.672  9.503   1.00 4.26  ? 23 DC  F "O5'"  2  
ATOM 6775  C "C5'"  . DC  B 2 23 ? 33.728  9.684   8.965   1.00 4.12  ? 23 DC  F "C5'"  2  
ATOM 6776  C "C4'"  . DC  B 2 23 ? 34.440  8.799   7.968   1.00 4.10  ? 23 DC  F "C4'"  2  
ATOM 6777  O "O4'"  . DC  B 2 23 ? 34.524  9.488   6.695   1.00 3.93  ? 23 DC  F "O4'"  2  
ATOM 6778  C "C3'"  . DC  B 2 23 ? 35.889  8.490   8.334   1.00 4.26  ? 23 DC  F "C3'"  2  
ATOM 6779  O "O3'"  . DC  B 2 23 ? 36.273  7.284   7.676   1.00 4.32  ? 23 DC  F "O3'"  2  
ATOM 6780  C "C2'"  . DC  B 2 23 ? 36.652  9.659   7.741   1.00 4.15  ? 23 DC  F "C2'"  2  
ATOM 6781  C "C1'"  . DC  B 2 23 ? 35.859  9.921   6.465   1.00 3.96  ? 23 DC  F "C1'"  2  
ATOM 6782  N N1     . DC  B 2 23 ? 35.839  11.307  5.962   1.00 3.84  ? 23 DC  F N1     2  
ATOM 6783  C C2     . DC  B 2 23 ? 35.743  11.503  4.579   1.00 3.70  ? 23 DC  F C2     2  
ATOM 6784  O O2     . DC  B 2 23 ? 35.641  10.516  3.836   1.00 3.69  ? 23 DC  F O2     2  
ATOM 6785  N N3     . DC  B 2 23 ? 35.768  12.760  4.084   1.00 3.63  ? 23 DC  F N3     2  
ATOM 6786  C C4     . DC  B 2 23 ? 35.878  13.799  4.910   1.00 3.69  ? 23 DC  F C4     2  
ATOM 6787  N N4     . DC  B 2 23 ? 35.913  15.021  4.372   1.00 3.66  ? 23 DC  F N4     2  
ATOM 6788  C C5     . DC  B 2 23 ? 35.959  13.632  6.325   1.00 3.84  ? 23 DC  F C5     2  
ATOM 6789  C C6     . DC  B 2 23 ? 35.932  12.379  6.804   1.00 3.91  ? 23 DC  F C6     2  
ATOM 6790  H "H5'"  . DC  B 2 23 ? 32.891  10.176  8.467   1.00 3.94  ? 23 DC  F "H5'"  2  
ATOM 6791  H "H5''" . DC  B 2 23 ? 33.344  9.064   9.775   1.00 4.22  ? 23 DC  F "H5''" 2  
ATOM 6792  H "H4'"  . DC  B 2 23 ? 33.909  7.847   7.916   1.00 4.15  ? 23 DC  F "H4'"  2  
ATOM 6793  H "H3'"  . DC  B 2 23 ? 36.029  8.391   9.409   1.00 4.40  ? 23 DC  F "H3'"  2  
ATOM 6794  H "H2'"  . DC  B 2 23 ? 36.642  10.513  8.418   1.00 4.18  ? 23 DC  F "H2'"  2  
ATOM 6795  H "H2''" . DC  B 2 23 ? 37.695  9.402   7.565   1.00 4.22  ? 23 DC  F "H2''" 2  
ATOM 6796  H "H1'"  . DC  B 2 23 ? 36.253  9.291   5.661   1.00 3.96  ? 23 DC  F "H1'"  2  
ATOM 6797  H H41    . DC  B 2 23 ? 35.997  15.830  4.974   1.00 3.74  ? 23 DC  F H41    2  
ATOM 6798  H H42    . DC  B 2 23 ? 35.874  15.144  3.370   1.00 3.58  ? 23 DC  F H42    2  
ATOM 6799  H H5     . DC  B 2 23 ? 36.038  14.491  6.992   1.00 3.92  ? 23 DC  F H5     2  
ATOM 6800  H H6     . DC  B 2 23 ? 35.982  12.218  7.880   1.00 4.04  ? 23 DC  F H6     2  
ATOM 6801  P P      . DA  B 2 24 ? 37.452  6.377   8.268   1.00 4.55  ? 24 DA  F P      2  
ATOM 6802  O OP1    . DA  B 2 24 ? 36.880  5.358   9.182   1.00 4.76  ? 24 DA  F OP1    2  
ATOM 6803  O OP2    . DA  B 2 24 ? 38.536  7.271   8.753   1.00 4.56  ? 24 DA  F OP2    2  
ATOM 6804  O "O5'"  . DA  B 2 24 ? 37.979  5.628   6.965   1.00 4.54  ? 24 DA  F "O5'"  2  
ATOM 6805  C "C5'"  . DA  B 2 24 ? 37.073  5.330   5.902   1.00 4.44  ? 24 DA  F "C5'"  2  
ATOM 6806  C "C4'"  . DA  B 2 24 ? 37.803  5.199   4.584   1.00 4.40  ? 24 DA  F "C4'"  2  
ATOM 6807  O "O4'"  . DA  B 2 24 ? 37.846  6.496   3.939   1.00 4.22  ? 24 DA  F "O4'"  2  
ATOM 6808  C "C3'"  . DA  B 2 24 ? 39.266  4.777   4.689   1.00 4.55  ? 24 DA  F "C3'"  2  
ATOM 6809  O "O3'"  . DA  B 2 24 ? 39.673  4.168   3.464   1.00 4.59  ? 24 DA  F "O3'"  2  
ATOM 6810  C "C2'"  . DA  B 2 24 ? 39.988  6.097   4.878   1.00 4.45  ? 24 DA  F "C2'"  2  
ATOM 6811  C "C1'"  . DA  B 2 24 ? 39.162  7.038   4.014   1.00 4.24  ? 24 DA  F "C1'"  2  
ATOM 6812  N N9     . DA  B 2 24 ? 39.077  8.416   4.498   1.00 4.13  ? 24 DA  F N9     2  
ATOM 6813  C C8     . DA  B 2 24 ? 39.024  8.867   5.792   1.00 4.18  ? 24 DA  F C8     2  
ATOM 6814  N N7     . DA  B 2 24 ? 38.963  10.173  5.897   1.00 4.09  ? 24 DA  F N7     2  
ATOM 6815  C C5     . DA  B 2 24 ? 38.976  10.614  4.580   1.00 3.96  ? 24 DA  F C5     2  
ATOM 6816  C C6     . DA  B 2 24 ? 38.933  11.901  4.008   1.00 3.85  ? 24 DA  F C6     2  
ATOM 6817  N N6     . DA  B 2 24 ? 38.862  13.029  4.720   1.00 3.85  ? 24 DA  F N6     2  
ATOM 6818  N N1     . DA  B 2 24 ? 38.965  11.989  2.661   1.00 3.78  ? 24 DA  F N1     2  
ATOM 6819  C C2     . DA  B 2 24 ? 39.036  10.857  1.944   1.00 3.82  ? 24 DA  F C2     2  
ATOM 6820  N N3     . DA  B 2 24 ? 39.079  9.597   2.366   1.00 3.93  ? 24 DA  F N3     2  
ATOM 6821  C C4     . DA  B 2 24 ? 39.045  9.541   3.709   1.00 3.99  ? 24 DA  F C4     2  
ATOM 6822  H "H5'"  . DA  B 2 24 ? 36.335  6.128   5.820   1.00 4.31  ? 24 DA  F "H5'"  2  
ATOM 6823  H "H5''" . DA  B 2 24 ? 36.559  4.394   6.115   1.00 4.53  ? 24 DA  F "H5''" 2  
ATOM 6824  H "H4'"  . DA  B 2 24 ? 37.292  4.438   3.990   1.00 4.44  ? 24 DA  F "H4'"  2  
ATOM 6825  H "H3'"  . DA  B 2 24 ? 39.428  4.089   5.516   1.00 4.69  ? 24 DA  F "H3'"  2  
ATOM 6826  H "H2'"  . DA  B 2 24 ? 39.999  6.399   5.924   1.00 4.49  ? 24 DA  F "H2'"  2  
ATOM 6827  H "H2''" . DA  B 2 24 ? 41.021  6.034   4.543   1.00 4.50  ? 24 DA  F "H2''" 2  
ATOM 6828  H "H1'"  . DA  B 2 24 ? 39.559  7.064   2.997   1.00 4.22  ? 24 DA  F "H1'"  2  
ATOM 6829  H H8     . DA  B 2 24 ? 39.037  8.205   6.647   1.00 4.31  ? 24 DA  F H8     2  
ATOM 6830  H H61    . DA  B 2 24 ? 38.838  12.974  5.729   1.00 3.92  ? 24 DA  F H61    2  
ATOM 6831  H H62    . DA  B 2 24 ? 38.830  13.930  4.265   1.00 3.79  ? 24 DA  F H62    2  
ATOM 6832  H H2     . DA  B 2 24 ? 39.061  10.989  0.864   1.00 3.80  ? 24 DA  F H2     2  
ATOM 6833  P P      . DT  B 2 25 ? 40.881  3.116   3.453   1.00 4.80  ? 25 DT  F P      2  
ATOM 6834  O OP1    . DT  B 2 25 ? 40.330  1.737   3.423   1.00 4.96  ? 25 DT  F OP1    2  
ATOM 6835  O OP2    . DT  B 2 25 ? 41.843  3.500   4.517   1.00 4.88  ? 25 DT  F OP2    2  
ATOM 6836  O "O5'"  . DT  B 2 25 ? 41.564  3.400   2.042   1.00 4.77  ? 25 DT  F "O5'"  2  
ATOM 6837  C "C5'"  . DT  B 2 25 ? 40.844  4.101   1.025   1.00 4.60  ? 25 DT  F "C5'"  2  
ATOM 6838  C "C4'"  . DT  B 2 25 ? 41.778  4.565   -0.070  1.00 4.61  ? 25 DT  F "C4'"  2  
ATOM 6839  O "O4'"  . DT  B 2 25 ? 41.952  5.995   0.050   1.00 4.44  ? 25 DT  F "O4'"  2  
ATOM 6840  C "C3'"  . DT  B 2 25 ? 43.190  3.990   -0.007  1.00 4.79  ? 25 DT  F "C3'"  2  
ATOM 6841  O "O3'"  . DT  B 2 25 ? 43.804  3.993   -1.298  1.00 4.86  ? 25 DT  F "O3'"  2  
ATOM 6842  C "C2'"  . DT  B 2 25 ? 43.899  4.957   0.921   1.00 4.72  ? 25 DT  F "C2'"  2  
ATOM 6843  C "C1'"  . DT  B 2 25 ? 43.247  6.293   0.567   1.00 4.50  ? 25 DT  F "C1'"  2  
ATOM 6844  N N1     . DT  B 2 25 ? 43.087  7.254   1.685   1.00 4.39  ? 25 DT  F N1     2  
ATOM 6845  C C2     . DT  B 2 25 ? 43.009  8.595   1.365   1.00 4.24  ? 25 DT  F C2     2  
ATOM 6846  O O2     . DT  B 2 25 ? 43.035  9.012   0.216   1.00 4.18  ? 25 DT  F O2     2  
ATOM 6847  N N3     . DT  B 2 25 ? 42.900  9.437   2.440   1.00 4.19  ? 25 DT  F N3     2  
ATOM 6848  C C4     . DT  B 2 25 ? 42.855  9.086   3.771   1.00 4.28  ? 25 DT  F C4     2  
ATOM 6849  O O4     . DT  B 2 25 ? 42.758  9.960   4.630   1.00 4.26  ? 25 DT  F O4     2  
ATOM 6850  C C5     . DT  B 2 25 ? 42.926  7.668   4.040   1.00 4.44  ? 25 DT  F C5     2  
ATOM 6851  C C7     . DT  B 2 25 ? 42.900  7.202   5.462   1.00 4.59  ? 25 DT  F C7     2  
ATOM 6852  C C6     . DT  B 2 25 ? 43.031  6.826   3.000   1.00 4.49  ? 25 DT  F C6     2  
ATOM 6853  H "H5'"  . DT  B 2 25 ? 40.349  4.969   1.461   1.00 4.45  ? 25 DT  F "H5'"  2  
ATOM 6854  H "H5''" . DT  B 2 25 ? 40.090  3.443   0.594   1.00 4.64  ? 25 DT  F "H5''" 2  
ATOM 6855  H "H4'"  . DT  B 2 25 ? 41.350  4.259   -1.026  1.00 4.64  ? 25 DT  F "H4'"  2  
ATOM 6856  H "H3'"  . DT  B 2 25 ? 43.185  2.975   0.387   1.00 4.93  ? 25 DT  F "H3'"  2  
ATOM 6857  H "HO3'" . DT  B 2 25 ? 43.777  3.092   -1.639  1.00 4.98  ? 25 DT  F "HO3'" 2  
ATOM 6858  H "H2'"  . DT  B 2 25 ? 43.745  4.686   1.964   1.00 4.76  ? 25 DT  F "H2'"  2  
ATOM 6859  H "H2''" . DT  B 2 25 ? 44.973  4.966   0.740   1.00 4.80  ? 25 DT  F "H2''" 2  
ATOM 6860  H "H1'"  . DT  B 2 25 ? 43.808  6.788   -0.228  1.00 4.49  ? 25 DT  F "H1'"  2  
ATOM 6861  H H3     . DT  B 2 25 ? 42.856  10.425  2.237   1.00 4.09  ? 25 DT  F H3     2  
ATOM 6862  H H71    . DT  B 2 25 ? 42.863  6.114   5.489   1.00 4.79  ? 25 DT  F H71    2  
ATOM 6863  H H72    . DT  B 2 25 ? 42.020  7.608   5.961   1.00 4.67  ? 25 DT  F H72    2  
ATOM 6864  H H73    . DT  B 2 25 ? 43.798  7.546   5.973   1.00 4.73  ? 25 DT  F H73    2  
ATOM 6865  H H6     . DT  B 2 25 ? 43.069  5.757   3.203   1.00 4.63  ? 25 DT  F H6     2  
ATOM 6866  N N      . MET C 3 1  ? -3.875  -5.472  3.369   1.00 9.42  ? 1  MET A N      2  
ATOM 6867  C CA     . MET C 3 1  ? -2.549  -4.861  3.139   1.00 8.94  ? 1  MET A CA     2  
ATOM 6868  C C      . MET C 3 1  ? -1.456  -5.692  3.797   1.00 8.70  ? 1  MET A C      2  
ATOM 6869  O O      . MET C 3 1  ? -1.057  -5.432  4.932   1.00 9.04  ? 1  MET A O      2  
ATOM 6870  C CB     . MET C 3 1  ? -2.522  -3.427  3.683   1.00 9.01  ? 1  MET A CB     2  
ATOM 6871  C CG     . MET C 3 1  ? -1.344  -2.603  3.183   1.00 8.76  ? 1  MET A CG     2  
ATOM 6872  S SD     . MET C 3 1  ? -1.241  -0.983  3.970   1.00 8.62  ? 1  MET A SD     2  
ATOM 6873  C CE     . MET C 3 1  ? -2.605  -0.137  3.172   1.00 8.77  ? 1  MET A CE     2  
ATOM 6874  H H1     . MET C 3 1  ? -4.061  -5.555  4.390   1.00 9.79  ? 1  MET A H1     2  
ATOM 6875  H H2     . MET C 3 1  ? -3.914  -6.420  2.943   1.00 9.68  ? 1  MET A H2     2  
ATOM 6876  H H3     . MET C 3 1  ? -4.621  -4.880  2.939   1.00 9.36  ? 1  MET A H3     2  
ATOM 6877  H HA     . MET C 3 1  ? -2.369  -4.837  2.074   1.00 8.90  ? 1  MET A HA     2  
ATOM 6878  H HB2    . MET C 3 1  ? -3.434  -2.927  3.389   1.00 9.21  ? 1  MET A HB2    2  
ATOM 6879  H HB3    . MET C 3 1  ? -2.475  -3.464  4.762   1.00 9.28  ? 1  MET A HB3    2  
ATOM 6880  H HG2    . MET C 3 1  ? -0.434  -3.143  3.383   1.00 8.87  ? 1  MET A HG2    2  
ATOM 6881  H HG3    . MET C 3 1  ? -1.449  -2.462  2.117   1.00 8.79  ? 1  MET A HG3    2  
ATOM 6882  H HE1    . MET C 3 1  ? -3.515  -0.696  3.326   1.00 9.00  ? 1  MET A HE1    2  
ATOM 6883  H HE2    . MET C 3 1  ? -2.408  -0.054  2.115   1.00 8.51  ? 1  MET A HE2    2  
ATOM 6884  H HE3    . MET C 3 1  ? -2.714  0.851   3.596   1.00 9.17  ? 1  MET A HE3    2  
ATOM 6885  N N      . LYS C 3 2  ? -0.993  -6.707  3.083   1.00 8.23  ? 2  LYS A N      2  
ATOM 6886  C CA     . LYS C 3 2  ? 0.062   -7.585  3.570   1.00 8.08  ? 2  LYS A CA     2  
ATOM 6887  C C      . LYS C 3 2  ? 0.583   -8.444  2.427   1.00 7.26  ? 2  LYS A C      2  
ATOM 6888  O O      . LYS C 3 2  ? -0.196  -8.959  1.626   1.00 6.99  ? 2  LYS A O      2  
ATOM 6889  C CB     . LYS C 3 2  ? -0.426  -8.470  4.734   1.00 8.57  ? 2  LYS A CB     2  
ATOM 6890  C CG     . LYS C 3 2  ? -1.660  -9.314  4.424   1.00 9.05  ? 2  LYS A CG     2  
ATOM 6891  C CD     . LYS C 3 2  ? -1.299  -10.774 4.176   1.00 9.63  ? 2  LYS A CD     2  
ATOM 6892  C CE     . LYS C 3 2  ? -0.853  -11.474 5.452   1.00 10.41 ? 2  LYS A CE     2  
ATOM 6893  N NZ     . LYS C 3 2  ? -0.361  -12.851 5.191   1.00 10.67 ? 2  LYS A NZ     2  
ATOM 6894  H H      . LYS C 3 2  ? -1.362  -6.868  2.185   1.00 8.05  ? 2  LYS A H      2  
ATOM 6895  H HA     . LYS C 3 2  ? 0.868   -6.958  3.923   1.00 8.37  ? 2  LYS A HA     2  
ATOM 6896  H HB2    . LYS C 3 2  ? 0.375   -9.140  5.011   1.00 8.84  ? 2  LYS A HB2    2  
ATOM 6897  H HB3    . LYS C 3 2  ? -0.654  -7.835  5.579   1.00 8.56  ? 2  LYS A HB3    2  
ATOM 6898  H HG2    . LYS C 3 2  ? -2.337  -9.260  5.263   1.00 9.18  ? 2  LYS A HG2    2  
ATOM 6899  H HG3    . LYS C 3 2  ? -2.145  -8.919  3.543   1.00 9.11  ? 2  LYS A HG3    2  
ATOM 6900  H HD2    . LYS C 3 2  ? -2.165  -11.286 3.784   1.00 9.71  ? 2  LYS A HD2    2  
ATOM 6901  H HD3    . LYS C 3 2  ? -0.499  -10.819 3.452   1.00 9.66  ? 2  LYS A HD3    2  
ATOM 6902  H HE2    . LYS C 3 2  ? -0.058  -10.901 5.904   1.00 10.56 ? 2  LYS A HE2    2  
ATOM 6903  H HE3    . LYS C 3 2  ? -1.689  -11.524 6.133   1.00 10.83 ? 2  LYS A HE3    2  
ATOM 6904  H HZ1    . LYS C 3 2  ? 0.396   -12.831 4.478   1.00 10.77 ? 2  LYS A HZ1    2  
ATOM 6905  H HZ2    . LYS C 3 2  ? -1.133  -13.450 4.844   1.00 10.89 ? 2  LYS A HZ2    2  
ATOM 6906  H HZ3    . LYS C 3 2  ? 0.016   -13.267 6.067   1.00 10.71 ? 2  LYS A HZ3    2  
ATOM 6907  N N      . SER C 3 3  ? 1.897   -8.576  2.347   1.00 7.07  ? 3  SER A N      2  
ATOM 6908  C CA     . SER C 3 3  ? 2.525   -9.360  1.296   1.00 6.44  ? 3  SER A CA     2  
ATOM 6909  C C      . SER C 3 3  ? 3.717   -10.125 1.856   1.00 5.75  ? 3  SER A C      2  
ATOM 6910  O O      . SER C 3 3  ? 4.136   -9.882  2.988   1.00 5.87  ? 3  SER A O      2  
ATOM 6911  C CB     . SER C 3 3  ? 2.986   -8.443  0.162   1.00 6.82  ? 3  SER A CB     2  
ATOM 6912  O OG     . SER C 3 3  ? 1.974   -7.514  -0.195  1.00 7.75  ? 3  SER A OG     2  
ATOM 6913  H H      . SER C 3 3  ? 2.464   -8.141  3.014   1.00 7.50  ? 3  SER A H      2  
ATOM 6914  H HA     . SER C 3 3  ? 1.797   -10.061 0.915   1.00 6.49  ? 3  SER A HA     2  
ATOM 6915  H HB2    . SER C 3 3  ? 3.862   -7.897  0.479   1.00 6.85  ? 3  SER A HB2    2  
ATOM 6916  H HB3    . SER C 3 3  ? 3.230   -9.042  -0.702  1.00 6.58  ? 3  SER A HB3    2  
ATOM 6917  H HG     . SER C 3 3  ? 2.388   -6.704  -0.513  1.00 7.99  ? 3  SER A HG     2  
ATOM 6918  N N      . THR C 3 4  ? 4.248   -11.051 1.074   1.00 5.27  ? 4  THR A N      2  
ATOM 6919  C CA     . THR C 3 4  ? 5.400   -11.834 1.494   1.00 4.91  ? 4  THR A CA     2  
ATOM 6920  C C      . THR C 3 4  ? 6.687   -11.164 1.024   1.00 4.22  ? 4  THR A C      2  
ATOM 6921  O O      . THR C 3 4  ? 7.596   -10.900 1.815   1.00 4.57  ? 4  THR A O      2  
ATOM 6922  C CB     . THR C 3 4  ? 5.333   -13.264 0.926   1.00 5.28  ? 4  THR A CB     2  
ATOM 6923  O OG1    . THR C 3 4  ? 3.978   -13.733 0.955   1.00 5.60  ? 4  THR A OG1    2  
ATOM 6924  C CG2    . THR C 3 4  ? 6.222   -14.208 1.722   1.00 5.66  ? 4  THR A CG2    2  
ATOM 6925  H H      . THR C 3 4  ? 3.853   -11.220 0.192   1.00 5.36  ? 4  THR A H      2  
ATOM 6926  H HA     . THR C 3 4  ? 5.399   -11.889 2.572   1.00 5.19  ? 4  THR A HA     2  
ATOM 6927  H HB     . THR C 3 4  ? 5.676   -13.245 -0.097  1.00 5.29  ? 4  THR A HB     2  
ATOM 6928  H HG1    . THR C 3 4  ? 3.792   -14.109 1.823   1.00 5.83  ? 4  THR A HG1    2  
ATOM 6929  H HG21   . THR C 3 4  ? 7.231   -13.824 1.739   1.00 5.87  ? 4  THR A HG21   2  
ATOM 6930  H HG22   . THR C 3 4  ? 6.217   -15.181 1.258   1.00 5.84  ? 4  THR A HG22   2  
ATOM 6931  H HG23   . THR C 3 4  ? 5.849   -14.289 2.733   1.00 5.88  ? 4  THR A HG23   2  
ATOM 6932  N N      . GLY C 3 5  ? 6.750   -10.895 -0.271  1.00 3.57  ? 5  GLY A N      2  
ATOM 6933  C CA     . GLY C 3 5  ? 7.905   -10.245 -0.844  1.00 3.11  ? 5  GLY A CA     2  
ATOM 6934  C C      . GLY C 3 5  ? 7.593   -8.812  -1.212  1.00 3.03  ? 5  GLY A C      2  
ATOM 6935  O O      . GLY C 3 5  ? 6.933   -8.554  -2.221  1.00 3.23  ? 5  GLY A O      2  
ATOM 6936  H H      . GLY C 3 5  ? 5.993   -11.136 -0.847  1.00 3.69  ? 5  GLY A H      2  
ATOM 6937  H HA2    . GLY C 3 5  ? 8.714   -10.259 -0.127  1.00 3.03  ? 5  GLY A HA2    2  
ATOM 6938  H HA3    . GLY C 3 5  ? 8.210   -10.778 -1.730  1.00 3.29  ? 5  GLY A HA3    2  
ATOM 6939  N N      . ILE C 3 6  ? 8.041   -7.882  -0.386  1.00 2.92  ? 6  ILE A N      2  
ATOM 6940  C CA     . ILE C 3 6  ? 7.794   -6.471  -0.626  1.00 3.06  ? 6  ILE A CA     2  
ATOM 6941  C C      . ILE C 3 6  ? 8.845   -5.905  -1.576  1.00 2.71  ? 6  ILE A C      2  
ATOM 6942  O O      . ILE C 3 6  ? 10.041  -5.928  -1.286  1.00 2.39  ? 6  ILE A O      2  
ATOM 6943  C CB     . ILE C 3 6  ? 7.772   -5.665  0.697   1.00 3.43  ? 6  ILE A CB     2  
ATOM 6944  C CG1    . ILE C 3 6  ? 6.548   -6.056  1.533   1.00 4.06  ? 6  ILE A CG1    2  
ATOM 6945  C CG2    . ILE C 3 6  ? 7.758   -4.166  0.421   1.00 3.61  ? 6  ILE A CG2    2  
ATOM 6946  C CD1    . ILE C 3 6  ? 6.768   -7.248  2.439   1.00 4.68  ? 6  ILE A CD1    2  
ATOM 6947  H H      . ILE C 3 6  ? 8.569   -8.152  0.398   1.00 2.85  ? 6  ILE A H      2  
ATOM 6948  H HA     . ILE C 3 6  ? 6.822   -6.382  -1.091  1.00 3.34  ? 6  ILE A HA     2  
ATOM 6949  H HB     . ILE C 3 6  ? 8.669   -5.897  1.251   1.00 3.68  ? 6  ILE A HB     2  
ATOM 6950  H HG12   . ILE C 3 6  ? 6.264   -5.222  2.152   1.00 4.46  ? 6  ILE A HG12   2  
ATOM 6951  H HG13   . ILE C 3 6  ? 5.732   -6.295  0.867   1.00 4.17  ? 6  ILE A HG13   2  
ATOM 6952  H HG21   . ILE C 3 6  ? 6.850   -3.907  -0.102  1.00 3.63  ? 6  ILE A HG21   2  
ATOM 6953  H HG22   . ILE C 3 6  ? 8.611   -3.904  -0.187  1.00 3.76  ? 6  ILE A HG22   2  
ATOM 6954  H HG23   . ILE C 3 6  ? 7.803   -3.626  1.355   1.00 4.17  ? 6  ILE A HG23   2  
ATOM 6955  H HD11   . ILE C 3 6  ? 7.156   -8.074  1.861   1.00 4.86  ? 6  ILE A HD11   2  
ATOM 6956  H HD12   . ILE C 3 6  ? 5.829   -7.534  2.888   1.00 4.83  ? 6  ILE A HD12   2  
ATOM 6957  H HD13   . ILE C 3 6  ? 7.472   -6.986  3.215   1.00 5.18  ? 6  ILE A HD13   2  
ATOM 6958  N N      . VAL C 3 7  ? 8.386   -5.418  -2.719  1.00 2.84  ? 7  VAL A N      2  
ATOM 6959  C CA     . VAL C 3 7  ? 9.266   -4.857  -3.736  1.00 2.57  ? 7  VAL A CA     2  
ATOM 6960  C C      . VAL C 3 7  ? 9.669   -3.425  -3.388  1.00 2.52  ? 7  VAL A C      2  
ATOM 6961  O O      . VAL C 3 7  ? 8.834   -2.610  -2.992  1.00 2.85  ? 7  VAL A O      2  
ATOM 6962  C CB     . VAL C 3 7  ? 8.591   -4.873  -5.126  1.00 2.76  ? 7  VAL A CB     2  
ATOM 6963  C CG1    . VAL C 3 7  ? 9.514   -4.298  -6.193  1.00 2.58  ? 7  VAL A CG1    2  
ATOM 6964  C CG2    . VAL C 3 7  ? 8.161   -6.285  -5.492  1.00 3.27  ? 7  VAL A CG2    2  
ATOM 6965  H H      . VAL C 3 7  ? 7.418   -5.434  -2.886  1.00 3.14  ? 7  VAL A H      2  
ATOM 6966  H HA     . VAL C 3 7  ? 10.155  -5.470  -3.784  1.00 2.34  ? 7  VAL A HA     2  
ATOM 6967  H HB     . VAL C 3 7  ? 7.707   -4.254  -5.080  1.00 3.10  ? 7  VAL A HB     2  
ATOM 6968  H HG11   . VAL C 3 7  ? 10.345  -4.971  -6.352  1.00 2.66  ? 7  VAL A HG11   2  
ATOM 6969  H HG12   . VAL C 3 7  ? 9.888   -3.340  -5.864  1.00 2.92  ? 7  VAL A HG12   2  
ATOM 6970  H HG13   . VAL C 3 7  ? 8.968   -4.173  -7.117  1.00 2.77  ? 7  VAL A HG13   2  
ATOM 6971  H HG21   . VAL C 3 7  ? 9.029   -6.930  -5.523  1.00 3.64  ? 7  VAL A HG21   2  
ATOM 6972  H HG22   . VAL C 3 7  ? 7.682   -6.279  -6.459  1.00 3.56  ? 7  VAL A HG22   2  
ATOM 6973  H HG23   . VAL C 3 7  ? 7.467   -6.653  -4.751  1.00 3.52  ? 7  VAL A HG23   2  
ATOM 6974  N N      . ARG C 3 8  ? 10.954  -3.138  -3.527  1.00 2.19  ? 8  ARG A N      2  
ATOM 6975  C CA     . ARG C 3 8  ? 11.498  -1.813  -3.258  1.00 2.20  ? 8  ARG A CA     2  
ATOM 6976  C C      . ARG C 3 8  ? 12.299  -1.353  -4.469  1.00 1.94  ? 8  ARG A C      2  
ATOM 6977  O O      . ARG C 3 8  ? 12.623  -2.162  -5.335  1.00 1.81  ? 8  ARG A O      2  
ATOM 6978  C CB     . ARG C 3 8  ? 12.387  -1.834  -2.010  1.00 2.23  ? 8  ARG A CB     2  
ATOM 6979  C CG     . ARG C 3 8  ? 11.803  -1.088  -0.817  1.00 2.58  ? 8  ARG A CG     2  
ATOM 6980  C CD     . ARG C 3 8  ? 10.534  -1.750  -0.310  1.00 3.00  ? 8  ARG A CD     2  
ATOM 6981  N NE     . ARG C 3 8  ? 10.099  -1.198  0.975   1.00 3.39  ? 8  ARG A NE     2  
ATOM 6982  C CZ     . ARG C 3 8  ? 8.892   -0.674  1.194   1.00 3.81  ? 8  ARG A CZ     2  
ATOM 6983  N NH1    . ARG C 3 8  ? 8.002   -0.602  0.210   1.00 3.99  ? 8  ARG A NH1    2  
ATOM 6984  N NH2    . ARG C 3 8  ? 8.580   -0.217  2.401   1.00 4.45  ? 8  ARG A NH2    2  
ATOM 6985  H H      . ARG C 3 8  ? 11.565  -3.846  -3.842  1.00 1.98  ? 8  ARG A H      2  
ATOM 6986  H HA     . ARG C 3 8  ? 10.673  -1.135  -3.100  1.00 2.48  ? 8  ARG A HA     2  
ATOM 6987  H HB2    . ARG C 3 8  ? 12.550  -2.861  -1.719  1.00 2.27  ? 8  ARG A HB2    2  
ATOM 6988  H HB3    . ARG C 3 8  ? 13.339  -1.386  -2.258  1.00 2.32  ? 8  ARG A HB3    2  
ATOM 6989  H HG2    . ARG C 3 8  ? 12.530  -1.074  -0.019  1.00 2.91  ? 8  ARG A HG2    2  
ATOM 6990  H HG3    . ARG C 3 8  ? 11.575  -0.074  -1.116  1.00 2.88  ? 8  ARG A HG3    2  
ATOM 6991  H HD2    . ARG C 3 8  ? 9.752   -1.601  -1.039  1.00 3.47  ? 8  ARG A HD2    2  
ATOM 6992  H HD3    . ARG C 3 8  ? 10.718  -2.806  -0.193  1.00 3.15  ? 8  ARG A HD3    2  
ATOM 6993  H HE     . ARG C 3 8  ? 10.742  -1.228  1.721   1.00 3.69  ? 8  ARG A HE     2  
ATOM 6994  H HH11   . ARG C 3 8  ? 8.227   -0.938  -0.706  1.00 3.89  ? 8  ARG A HH11   2  
ATOM 6995  H HH12   . ARG C 3 8  ? 7.089   -0.220  0.384   1.00 4.50  ? 8  ARG A HH12   2  
ATOM 6996  H HH21   . ARG C 3 8  ? 9.250   -0.263  3.147   1.00 4.75  ? 8  ARG A HH21   2  
ATOM 6997  H HH22   . ARG C 3 8  ? 7.670   0.178   2.570   1.00 4.86  ? 8  ARG A HH22   2  
ATOM 6998  N N      . LYS C 3 9  ? 12.623  -0.074  -4.533  1.00 2.12  ? 9  LYS A N      2  
ATOM 6999  C CA     . LYS C 3 9  ? 13.375  0.461   -5.665  1.00 2.02  ? 9  LYS A CA     2  
ATOM 7000  C C      . LYS C 3 9  ? 14.876  0.413   -5.408  1.00 2.02  ? 9  LYS A C      2  
ATOM 7001  O O      . LYS C 3 9  ? 15.343  0.822   -4.344  1.00 2.29  ? 9  LYS A O      2  
ATOM 7002  C CB     . LYS C 3 9  ? 12.945  1.899   -5.959  1.00 2.40  ? 9  LYS A CB     2  
ATOM 7003  C CG     . LYS C 3 9  ? 11.438  2.076   -6.065  1.00 2.65  ? 9  LYS A CG     2  
ATOM 7004  C CD     . LYS C 3 9  ? 11.085  3.417   -6.684  1.00 2.53  ? 9  LYS A CD     2  
ATOM 7005  C CE     . LYS C 3 9  ? 11.264  3.398   -8.195  1.00 2.83  ? 9  LYS A CE     2  
ATOM 7006  N NZ     . LYS C 3 9  ? 11.382  4.767   -8.758  1.00 2.89  ? 9  LYS A NZ     2  
ATOM 7007  H H      . LYS C 3 9  ? 12.360  0.526   -3.806  1.00 2.45  ? 9  LYS A H      2  
ATOM 7008  H HA     . LYS C 3 9  ? 13.157  -0.153  -6.527  1.00 1.88  ? 9  LYS A HA     2  
ATOM 7009  H HB2    . LYS C 3 9  ? 13.305  2.541   -5.167  1.00 2.89  ? 9  LYS A HB2    2  
ATOM 7010  H HB3    . LYS C 3 9  ? 13.389  2.212   -6.892  1.00 2.65  ? 9  LYS A HB3    2  
ATOM 7011  H HG2    . LYS C 3 9  ? 11.036  1.289   -6.683  1.00 2.99  ? 9  LYS A HG2    2  
ATOM 7012  H HG3    . LYS C 3 9  ? 11.005  2.021   -5.077  1.00 3.17  ? 9  LYS A HG3    2  
ATOM 7013  H HD2    . LYS C 3 9  ? 10.055  3.650   -6.455  1.00 3.02  ? 9  LYS A HD2    2  
ATOM 7014  H HD3    . LYS C 3 9  ? 11.729  4.175   -6.262  1.00 2.42  ? 9  LYS A HD3    2  
ATOM 7015  H HE2    . LYS C 3 9  ? 12.158  2.842   -8.433  1.00 3.05  ? 9  LYS A HE2    2  
ATOM 7016  H HE3    . LYS C 3 9  ? 10.410  2.910   -8.638  1.00 3.36  ? 9  LYS A HE3    2  
ATOM 7017  H HZ1    . LYS C 3 9  ? 11.433  4.726   -9.795  1.00 2.69  ? 9  LYS A HZ1    2  
ATOM 7018  H HZ2    . LYS C 3 9  ? 12.244  5.231   -8.403  1.00 3.25  ? 9  LYS A HZ2    2  
ATOM 7019  H HZ3    . LYS C 3 9  ? 10.559  5.340   -8.485  1.00 3.36  ? 9  LYS A HZ3    2  
ATOM 7020  N N      . VAL C 3 10 ? 15.625  -0.105  -6.378  1.00 1.92  ? 10 VAL A N      2  
ATOM 7021  C CA     . VAL C 3 10 ? 17.074  -0.181  -6.256  1.00 2.17  ? 10 VAL A CA     2  
ATOM 7022  C C      . VAL C 3 10 ? 17.701  1.075   -6.828  1.00 2.21  ? 10 VAL A C      2  
ATOM 7023  O O      . VAL C 3 10 ? 18.033  1.135   -8.012  1.00 2.33  ? 10 VAL A O      2  
ATOM 7024  C CB     . VAL C 3 10 ? 17.677  -1.408  -6.981  1.00 2.38  ? 10 VAL A CB     2  
ATOM 7025  C CG1    . VAL C 3 10 ? 19.176  -1.508  -6.728  1.00 2.94  ? 10 VAL A CG1    2  
ATOM 7026  C CG2    . VAL C 3 10 ? 16.987  -2.683  -6.552  1.00 2.48  ? 10 VAL A CG2    2  
ATOM 7027  H H      . VAL C 3 10 ? 15.195  -0.440  -7.195  1.00 1.82  ? 10 VAL A H      2  
ATOM 7028  H HA     . VAL C 3 10 ? 17.316  -0.249  -5.204  1.00 2.43  ? 10 VAL A HA     2  
ATOM 7029  H HB     . VAL C 3 10 ? 17.526  -1.280  -8.042  1.00 2.79  ? 10 VAL A HB     2  
ATOM 7030  H HG11   . VAL C 3 10 ? 19.539  -2.455  -7.102  1.00 3.49  ? 10 VAL A HG11   2  
ATOM 7031  H HG12   . VAL C 3 10 ? 19.367  -1.443  -5.667  1.00 2.94  ? 10 VAL A HG12   2  
ATOM 7032  H HG13   . VAL C 3 10 ? 19.686  -0.703  -7.235  1.00 3.46  ? 10 VAL A HG13   2  
ATOM 7033  H HG21   . VAL C 3 10 ? 17.309  -2.946  -5.556  1.00 2.72  ? 10 VAL A HG21   2  
ATOM 7034  H HG22   . VAL C 3 10 ? 17.242  -3.479  -7.235  1.00 2.77  ? 10 VAL A HG22   2  
ATOM 7035  H HG23   . VAL C 3 10 ? 15.918  -2.533  -6.556  1.00 2.82  ? 10 VAL A HG23   2  
ATOM 7036  N N      . ASP C 3 11 ? 17.826  2.088   -5.996  1.00 2.44  ? 11 ASP A N      2  
ATOM 7037  C CA     . ASP C 3 11 ? 18.417  3.343   -6.412  1.00 2.64  ? 11 ASP A CA     2  
ATOM 7038  C C      . ASP C 3 11 ? 19.896  3.366   -6.050  1.00 2.26  ? 11 ASP A C      2  
ATOM 7039  O O      . ASP C 3 11 ? 20.479  2.332   -5.721  1.00 2.29  ? 11 ASP A O      2  
ATOM 7040  C CB     . ASP C 3 11 ? 17.688  4.518   -5.763  1.00 3.30  ? 11 ASP A CB     2  
ATOM 7041  C CG     . ASP C 3 11 ? 17.971  4.615   -4.285  1.00 3.91  ? 11 ASP A CG     2  
ATOM 7042  O OD1    . ASP C 3 11 ? 17.700  3.637   -3.565  1.00 4.44  ? 11 ASP A OD1    2  
ATOM 7043  O OD2    . ASP C 3 11 ? 18.440  5.680   -3.838  1.00 4.32  ? 11 ASP A OD2    2  
ATOM 7044  H H      . ASP C 3 11 ? 17.515  1.990   -5.069  1.00 2.66  ? 11 ASP A H      2  
ATOM 7045  H HA     . ASP C 3 11 ? 18.318  3.416   -7.485  1.00 2.89  ? 11 ASP A HA     2  
ATOM 7046  H HB2    . ASP C 3 11 ? 18.005  5.438   -6.233  1.00 3.60  ? 11 ASP A HB2    2  
ATOM 7047  H HB3    . ASP C 3 11 ? 16.624  4.395   -5.901  1.00 3.58  ? 11 ASP A HB3    2  
ATOM 7048  N N      . GLU C 3 12 ? 20.499  4.542   -6.084  1.00 2.34  ? 12 GLU A N      2  
ATOM 7049  C CA     . GLU C 3 12 ? 21.911  4.668   -5.784  1.00 2.35  ? 12 GLU A CA     2  
ATOM 7050  C C      . GLU C 3 12 ? 22.154  4.792   -4.286  1.00 2.39  ? 12 GLU A C      2  
ATOM 7051  O O      . GLU C 3 12 ? 23.280  4.604   -3.819  1.00 2.96  ? 12 GLU A O      2  
ATOM 7052  C CB     . GLU C 3 12 ? 22.508  5.867   -6.523  1.00 2.80  ? 12 GLU A CB     2  
ATOM 7053  C CG     . GLU C 3 12 ? 22.252  7.200   -5.847  1.00 3.27  ? 12 GLU A CG     2  
ATOM 7054  C CD     . GLU C 3 12 ? 23.206  8.272   -6.321  1.00 3.38  ? 12 GLU A CD     2  
ATOM 7055  O OE1    . GLU C 3 12 ? 24.432  8.084   -6.179  1.00 3.59  ? 12 GLU A OE1    2  
ATOM 7056  O OE2    . GLU C 3 12 ? 22.733  9.308   -6.836  1.00 3.61  ? 12 GLU A OE2    2  
ATOM 7057  H H      . GLU C 3 12 ? 19.979  5.343   -6.297  1.00 2.67  ? 12 GLU A H      2  
ATOM 7058  H HA     . GLU C 3 12 ? 22.398  3.769   -6.137  1.00 2.40  ? 12 GLU A HA     2  
ATOM 7059  H HB2    . GLU C 3 12 ? 23.575  5.726   -6.598  1.00 3.20  ? 12 GLU A HB2    2  
ATOM 7060  H HB3    . GLU C 3 12 ? 22.089  5.904   -7.517  1.00 3.01  ? 12 GLU A HB3    2  
ATOM 7061  H HG2    . GLU C 3 12 ? 21.241  7.514   -6.061  1.00 3.59  ? 12 GLU A HG2    2  
ATOM 7062  H HG3    . GLU C 3 12 ? 22.372  7.080   -4.780  1.00 3.79  ? 12 GLU A HG3    2  
ATOM 7063  N N      . LEU C 3 13 ? 21.102  5.097   -3.537  1.00 2.11  ? 13 LEU A N      2  
ATOM 7064  C CA     . LEU C 3 13 ? 21.211  5.253   -2.097  1.00 2.49  ? 13 LEU A CA     2  
ATOM 7065  C C      . LEU C 3 13 ? 20.639  4.047   -1.361  1.00 2.18  ? 13 LEU A C      2  
ATOM 7066  O O      . LEU C 3 13 ? 20.724  3.976   -0.138  1.00 2.48  ? 13 LEU A O      2  
ATOM 7067  C CB     . LEU C 3 13 ? 20.485  6.524   -1.649  1.00 2.96  ? 13 LEU A CB     2  
ATOM 7068  C CG     . LEU C 3 13 ? 21.378  7.641   -1.106  1.00 3.69  ? 13 LEU A CG     2  
ATOM 7069  C CD1    . LEU C 3 13 ? 22.177  7.156   0.098   1.00 4.35  ? 13 LEU A CD1    2  
ATOM 7070  C CD2    . LEU C 3 13 ? 22.298  8.174   -2.196  1.00 3.80  ? 13 LEU A CD2    2  
ATOM 7071  H H      . LEU C 3 13 ? 20.220  5.227   -3.965  1.00 1.89  ? 13 LEU A H      2  
ATOM 7072  H HA     . LEU C 3 13 ? 22.257  5.345   -1.854  1.00 3.08  ? 13 LEU A HA     2  
ATOM 7073  H HB2    . LEU C 3 13 ? 19.933  6.910   -2.491  1.00 3.08  ? 13 LEU A HB2    2  
ATOM 7074  H HB3    . LEU C 3 13 ? 19.781  6.253   -0.876  1.00 3.10  ? 13 LEU A HB3    2  
ATOM 7075  H HG     . LEU C 3 13 ? 20.752  8.459   -0.774  1.00 4.19  ? 13 LEU A HG     2  
ATOM 7076  H HD11   . LEU C 3 13 ? 21.510  7.005   0.934   1.00 4.63  ? 13 LEU A HD11   2  
ATOM 7077  H HD12   . LEU C 3 13 ? 22.919  7.893   0.360   1.00 4.45  ? 13 LEU A HD12   2  
ATOM 7078  H HD13   . LEU C 3 13 ? 22.666  6.224   -0.143  1.00 4.91  ? 13 LEU A HD13   2  
ATOM 7079  H HD21   . LEU C 3 13 ? 22.958  8.918   -1.776  1.00 4.15  ? 13 LEU A HD21   2  
ATOM 7080  H HD22   . LEU C 3 13 ? 21.706  8.620   -2.981  1.00 3.57  ? 13 LEU A HD22   2  
ATOM 7081  H HD23   . LEU C 3 13 ? 22.883  7.361   -2.603  1.00 4.26  ? 13 LEU A HD23   2  
ATOM 7082  N N      . GLY C 3 14 ? 20.033  3.123   -2.099  1.00 1.99  ? 14 GLY A N      2  
ATOM 7083  C CA     . GLY C 3 14 ? 19.457  1.931   -1.490  1.00 1.97  ? 14 GLY A CA     2  
ATOM 7084  C C      . GLY C 3 14 ? 18.347  2.261   -0.509  1.00 1.71  ? 14 GLY A C      2  
ATOM 7085  O O      . GLY C 3 14 ? 18.574  2.312   0.700   1.00 2.09  ? 14 GLY A O      2  
ATOM 7086  H H      . GLY C 3 14 ? 19.957  3.259   -3.067  1.00 2.16  ? 14 GLY A H      2  
ATOM 7087  H HA2    . GLY C 3 14 ? 19.059  1.298   -2.270  1.00 2.02  ? 14 GLY A HA2    2  
ATOM 7088  H HA3    . GLY C 3 14 ? 20.237  1.394   -0.970  1.00 2.40  ? 14 GLY A HA3    2  
ATOM 7089  N N      . ARG C 3 15 ? 17.150  2.502   -1.028  1.00 1.49  ? 15 ARG A N      2  
ATOM 7090  C CA     . ARG C 3 15 ? 16.004  2.850   -0.193  1.00 1.33  ? 15 ARG A CA     2  
ATOM 7091  C C      . ARG C 3 15 ? 15.463  1.643   0.561   1.00 1.18  ? 15 ARG A C      2  
ATOM 7092  O O      . ARG C 3 15 ? 14.523  0.986   0.110   1.00 1.44  ? 15 ARG A O      2  
ATOM 7093  C CB     . ARG C 3 15 ? 14.884  3.474   -1.040  1.00 1.57  ? 15 ARG A CB     2  
ATOM 7094  C CG     . ARG C 3 15 ? 15.362  4.500   -2.058  1.00 1.95  ? 15 ARG A CG     2  
ATOM 7095  C CD     . ARG C 3 15 ? 15.951  5.742   -1.402  1.00 2.00  ? 15 ARG A CD     2  
ATOM 7096  N NE     . ARG C 3 15 ? 17.221  5.463   -0.740  1.00 2.25  ? 15 ARG A NE     2  
ATOM 7097  C CZ     . ARG C 3 15 ? 17.631  6.064   0.368   1.00 2.73  ? 15 ARG A CZ     2  
ATOM 7098  N NH1    . ARG C 3 15 ? 16.922  7.067   0.877   1.00 2.96  ? 15 ARG A NH1    2  
ATOM 7099  N NH2    . ARG C 3 15 ? 18.755  5.673   0.956   1.00 3.61  ? 15 ARG A NH2    2  
ATOM 7100  H H      . ARG C 3 15 ? 17.038  2.462   -2.007  1.00 1.77  ? 15 ARG A H      2  
ATOM 7101  H HA     . ARG C 3 15 ? 16.338  3.581   0.527   1.00 1.58  ? 15 ARG A HA     2  
ATOM 7102  H HB2    . ARG C 3 15 ? 14.373  2.686   -1.573  1.00 1.96  ? 15 ARG A HB2    2  
ATOM 7103  H HB3    . ARG C 3 15 ? 14.182  3.959   -0.379  1.00 2.05  ? 15 ARG A HB3    2  
ATOM 7104  H HG2    . ARG C 3 15 ? 16.122  4.047   -2.677  1.00 2.54  ? 15 ARG A HG2    2  
ATOM 7105  H HG3    . ARG C 3 15 ? 14.526  4.791   -2.676  1.00 2.50  ? 15 ARG A HG3    2  
ATOM 7106  H HD2    . ARG C 3 15 ? 16.109  6.494   -2.159  1.00 2.35  ? 15 ARG A HD2    2  
ATOM 7107  H HD3    . ARG C 3 15 ? 15.248  6.111   -0.669  1.00 2.50  ? 15 ARG A HD3    2  
ATOM 7108  H HE     . ARG C 3 15 ? 17.786  4.760   -1.139  1.00 2.67  ? 15 ARG A HE     2  
ATOM 7109  H HH11   . ARG C 3 15 ? 16.083  7.367   0.420   1.00 2.87  ? 15 ARG A HH11   2  
ATOM 7110  H HH12   . ARG C 3 15 ? 17.224  7.527   1.710   1.00 3.64  ? 15 ARG A HH12   2  
ATOM 7111  H HH21   . ARG C 3 15 ? 19.296  4.917   0.558   1.00 3.95  ? 15 ARG A HH21   2  
ATOM 7112  H HH22   . ARG C 3 15 ? 19.073  6.120   1.788   1.00 4.19  ? 15 ARG A HH22   2  
ATOM 7113  N N      . VAL C 3 16 ? 16.052  1.349   1.711   1.00 1.08  ? 16 VAL A N      2  
ATOM 7114  C CA     . VAL C 3 16 ? 15.602  0.228   2.515   1.00 1.38  ? 16 VAL A CA     2  
ATOM 7115  C C      . VAL C 3 16 ? 14.670  0.716   3.611   1.00 1.45  ? 16 VAL A C      2  
ATOM 7116  O O      . VAL C 3 16 ? 15.109  1.180   4.661   1.00 1.71  ? 16 VAL A O      2  
ATOM 7117  C CB     . VAL C 3 16 ? 16.777  -0.550  3.130   1.00 1.72  ? 16 VAL A CB     2  
ATOM 7118  C CG1    . VAL C 3 16 ? 16.279  -1.772  3.889   1.00 2.33  ? 16 VAL A CG1    2  
ATOM 7119  C CG2    . VAL C 3 16 ? 17.750  -0.955  2.041   1.00 1.93  ? 16 VAL A CG2    2  
ATOM 7120  H H      . VAL C 3 16 ? 16.812  1.893   2.024   1.00 1.05  ? 16 VAL A H      2  
ATOM 7121  H HA     . VAL C 3 16 ? 15.051  -0.443  1.868   1.00 1.57  ? 16 VAL A HA     2  
ATOM 7122  H HB     . VAL C 3 16 ? 17.295  0.096   3.823   1.00 2.20  ? 16 VAL A HB     2  
ATOM 7123  H HG11   . VAL C 3 16 ? 17.116  -2.270  4.357   1.00 2.75  ? 16 VAL A HG11   2  
ATOM 7124  H HG12   . VAL C 3 16 ? 15.793  -2.449  3.202   1.00 2.59  ? 16 VAL A HG12   2  
ATOM 7125  H HG13   . VAL C 3 16 ? 15.574  -1.463  4.648   1.00 2.71  ? 16 VAL A HG13   2  
ATOM 7126  H HG21   . VAL C 3 16 ? 17.218  -1.471  1.257   1.00 2.11  ? 16 VAL A HG21   2  
ATOM 7127  H HG22   . VAL C 3 16 ? 18.502  -1.609  2.454   1.00 2.35  ? 16 VAL A HG22   2  
ATOM 7128  H HG23   . VAL C 3 16 ? 18.221  -0.073  1.634   1.00 2.47  ? 16 VAL A HG23   2  
ATOM 7129  N N      . VAL C 3 17 ? 13.380  0.643   3.338   1.00 1.49  ? 17 VAL A N      2  
ATOM 7130  C CA     . VAL C 3 17 ? 12.372  1.076   4.288   1.00 1.72  ? 17 VAL A CA     2  
ATOM 7131  C C      . VAL C 3 17 ? 11.513  -0.102  4.710   1.00 1.82  ? 17 VAL A C      2  
ATOM 7132  O O      . VAL C 3 17 ? 11.042  -0.865  3.856   1.00 1.91  ? 17 VAL A O      2  
ATOM 7133  C CB     . VAL C 3 17 ? 11.461  2.170   3.692   1.00 2.00  ? 17 VAL A CB     2  
ATOM 7134  C CG1    . VAL C 3 17 ? 10.852  3.022   4.791   1.00 2.31  ? 17 VAL A CG1    2  
ATOM 7135  C CG2    . VAL C 3 17 ? 12.229  3.032   2.709   1.00 2.41  ? 17 VAL A CG2    2  
ATOM 7136  H H      . VAL C 3 17 ? 13.096  0.285   2.471   1.00 1.53  ? 17 VAL A H      2  
ATOM 7137  H HA     . VAL C 3 17 ? 12.875  1.480   5.155   1.00 1.78  ? 17 VAL A HA     2  
ATOM 7138  H HB     . VAL C 3 17 ? 10.656  1.688   3.158   1.00 2.15  ? 17 VAL A HB     2  
ATOM 7139  H HG11   . VAL C 3 17 ? 10.164  2.424   5.370   1.00 2.72  ? 17 VAL A HG11   2  
ATOM 7140  H HG12   . VAL C 3 17 ? 10.323  3.854   4.351   1.00 2.41  ? 17 VAL A HG12   2  
ATOM 7141  H HG13   . VAL C 3 17 ? 11.636  3.393   5.436   1.00 2.63  ? 17 VAL A HG13   2  
ATOM 7142  H HG21   . VAL C 3 17 ? 12.810  2.401   2.053   1.00 2.58  ? 17 VAL A HG21   2  
ATOM 7143  H HG22   . VAL C 3 17 ? 12.890  3.693   3.249   1.00 2.95  ? 17 VAL A HG22   2  
ATOM 7144  H HG23   . VAL C 3 17 ? 11.534  3.617   2.126   1.00 2.64  ? 17 VAL A HG23   2  
ATOM 7145  N N      . ILE C 3 18 ? 11.316  -0.247  6.014   1.00 1.96  ? 18 ILE A N      2  
ATOM 7146  C CA     . ILE C 3 18 ? 10.506  -1.335  6.550   1.00 2.11  ? 18 ILE A CA     2  
ATOM 7147  C C      . ILE C 3 18 ? 9.083   -1.249  6.002   1.00 2.07  ? 18 ILE A C      2  
ATOM 7148  O O      . ILE C 3 18 ? 8.457   -0.186  6.048   1.00 1.99  ? 18 ILE A O      2  
ATOM 7149  C CB     . ILE C 3 18 ? 10.483  -1.324  8.103   1.00 2.26  ? 18 ILE A CB     2  
ATOM 7150  C CG1    . ILE C 3 18 ? 11.805  -1.853  8.665   1.00 2.70  ? 18 ILE A CG1    2  
ATOM 7151  C CG2    . ILE C 3 18 ? 9.322   -2.148  8.647   1.00 2.76  ? 18 ILE A CG2    2  
ATOM 7152  C CD1    . ILE C 3 18 ? 12.860  -0.785  8.853   1.00 3.15  ? 18 ILE A CD1    2  
ATOM 7153  H H      . ILE C 3 18 ? 11.721  0.402   6.631   1.00 2.07  ? 18 ILE A H      2  
ATOM 7154  H HA     . ILE C 3 18 ? 10.948  -2.263  6.223   1.00 2.25  ? 18 ILE A HA     2  
ATOM 7155  H HB     . ILE C 3 18 ? 10.347  -0.303  8.428   1.00 2.54  ? 18 ILE A HB     2  
ATOM 7156  H HG12   . ILE C 3 18 ? 11.622  -2.307  9.628   1.00 3.05  ? 18 ILE A HG12   2  
ATOM 7157  H HG13   . ILE C 3 18 ? 12.203  -2.598  7.992   1.00 3.02  ? 18 ILE A HG13   2  
ATOM 7158  H HG21   . ILE C 3 18 ? 9.280   -3.095  8.131   1.00 3.20  ? 18 ILE A HG21   2  
ATOM 7159  H HG22   . ILE C 3 18 ? 8.398   -1.611  8.496   1.00 3.05  ? 18 ILE A HG22   2  
ATOM 7160  H HG23   . ILE C 3 18 ? 9.471   -2.323  9.703   1.00 3.12  ? 18 ILE A HG23   2  
ATOM 7161  H HD11   . ILE C 3 18 ? 12.982  -0.235  7.932   1.00 2.90  ? 18 ILE A HD11   2  
ATOM 7162  H HD12   . ILE C 3 18 ? 13.796  -1.250  9.122   1.00 3.65  ? 18 ILE A HD12   2  
ATOM 7163  H HD13   . ILE C 3 18 ? 12.552  -0.110  9.637   1.00 3.73  ? 18 ILE A HD13   2  
ATOM 7164  N N      . PRO C 3 19 ? 8.576   -2.357  5.434   1.00 2.24  ? 19 PRO A N      2  
ATOM 7165  C CA     . PRO C 3 19 ? 7.224   -2.425  4.864   1.00 2.33  ? 19 PRO A CA     2  
ATOM 7166  C C      . PRO C 3 19 ? 6.153   -1.878  5.802   1.00 2.21  ? 19 PRO A C      2  
ATOM 7167  O O      . PRO C 3 19 ? 6.105   -2.230  6.983   1.00 2.24  ? 19 PRO A O      2  
ATOM 7168  C CB     . PRO C 3 19 ? 7.014   -3.921  4.649   1.00 2.68  ? 19 PRO A CB     2  
ATOM 7169  C CG     . PRO C 3 19 ? 8.380   -4.465  4.431   1.00 2.71  ? 19 PRO A CG     2  
ATOM 7170  C CD     . PRO C 3 19 ? 9.297   -3.639  5.292   1.00 2.49  ? 19 PRO A CD     2  
ATOM 7171  H HA     . PRO C 3 19 ? 7.167   -1.911  3.916   1.00 2.37  ? 19 PRO A HA     2  
ATOM 7172  H HB2    . PRO C 3 19 ? 6.551   -4.349  5.525   1.00 2.83  ? 19 PRO A HB2    2  
ATOM 7173  H HB3    . PRO C 3 19 ? 6.384   -4.078  3.788   1.00 2.87  ? 19 PRO A HB3    2  
ATOM 7174  H HG2    . PRO C 3 19 ? 8.415   -5.502  4.735   1.00 2.93  ? 19 PRO A HG2    2  
ATOM 7175  H HG3    . PRO C 3 19 ? 8.655   -4.367  3.392   1.00 2.74  ? 19 PRO A HG3    2  
ATOM 7176  H HD2    . PRO C 3 19 ? 9.436   -4.112  6.252   1.00 2.57  ? 19 PRO A HD2    2  
ATOM 7177  H HD3    . PRO C 3 19 ? 10.248  -3.495  4.800   1.00 2.53  ? 19 PRO A HD3    2  
ATOM 7178  N N      . ILE C 3 20 ? 5.295   -1.020  5.273   1.00 2.25  ? 20 ILE A N      2  
ATOM 7179  C CA     . ILE C 3 20 ? 4.227   -0.436  6.063   1.00 2.31  ? 20 ILE A CA     2  
ATOM 7180  C C      . ILE C 3 20 ? 3.026   -1.372  6.081   1.00 2.29  ? 20 ILE A C      2  
ATOM 7181  O O      . ILE C 3 20 ? 2.237   -1.373  7.023   1.00 2.31  ? 20 ILE A O      2  
ATOM 7182  C CB     . ILE C 3 20 ? 3.813   0.954   5.527   1.00 2.64  ? 20 ILE A CB     2  
ATOM 7183  C CG1    . ILE C 3 20 ? 2.810   1.609   6.473   1.00 3.09  ? 20 ILE A CG1    2  
ATOM 7184  C CG2    . ILE C 3 20 ? 3.235   0.853   4.122   1.00 2.66  ? 20 ILE A CG2    2  
ATOM 7185  C CD1    . ILE C 3 20 ? 3.406   2.000   7.809   1.00 3.73  ? 20 ILE A CD1    2  
ATOM 7186  H H      . ILE C 3 20 ? 5.369   -0.787  4.321   1.00 2.34  ? 20 ILE A H      2  
ATOM 7187  H HA     . ILE C 3 20 ? 4.590   -0.318  7.073   1.00 2.31  ? 20 ILE A HA     2  
ATOM 7188  H HB     . ILE C 3 20 ? 4.699   1.568   5.477   1.00 3.18  ? 20 ILE A HB     2  
ATOM 7189  H HG12   . ILE C 3 20 ? 2.416   2.499   6.010   1.00 3.10  ? 20 ILE A HG12   2  
ATOM 7190  H HG13   . ILE C 3 20 ? 2.001   0.918   6.661   1.00 3.55  ? 20 ILE A HG13   2  
ATOM 7191  H HG21   . ILE C 3 20 ? 3.947   0.365   3.474   1.00 3.10  ? 20 ILE A HG21   2  
ATOM 7192  H HG22   . ILE C 3 20 ? 3.028   1.845   3.746   1.00 2.87  ? 20 ILE A HG22   2  
ATOM 7193  H HG23   . ILE C 3 20 ? 2.320   0.280   4.150   1.00 2.68  ? 20 ILE A HG23   2  
ATOM 7194  H HD11   . ILE C 3 20 ? 3.707   1.113   8.343   1.00 4.13  ? 20 ILE A HD11   2  
ATOM 7195  H HD12   . ILE C 3 20 ? 2.668   2.534   8.389   1.00 4.11  ? 20 ILE A HD12   2  
ATOM 7196  H HD13   . ILE C 3 20 ? 4.264   2.634   7.646   1.00 3.89  ? 20 ILE A HD13   2  
ATOM 7197  N N      . GLU C 3 21 ? 2.929   -2.193  5.045   1.00 2.40  ? 21 GLU A N      2  
ATOM 7198  C CA     . GLU C 3 21 ? 1.841   -3.150  4.903   1.00 2.55  ? 21 GLU A CA     2  
ATOM 7199  C C      . GLU C 3 21 ? 1.753   -4.051  6.129   1.00 2.53  ? 21 GLU A C      2  
ATOM 7200  O O      . GLU C 3 21 ? 0.708   -4.152  6.772   1.00 2.62  ? 21 GLU A O      2  
ATOM 7201  C CB     . GLU C 3 21 ? 2.049   -3.993  3.638   1.00 2.83  ? 21 GLU A CB     2  
ATOM 7202  C CG     . GLU C 3 21 ? 2.192   -3.167  2.365   1.00 3.28  ? 21 GLU A CG     2  
ATOM 7203  C CD     . GLU C 3 21 ? 3.635   -2.873  1.999   1.00 3.81  ? 21 GLU A CD     2  
ATOM 7204  O OE1    . GLU C 3 21 ? 4.343   -2.227  2.801   1.00 4.31  ? 21 GLU A OE1    2  
ATOM 7205  O OE2    . GLU C 3 21 ? 4.058   -3.273  0.896   1.00 4.00  ? 21 GLU A OE2    2  
ATOM 7206  H H      . GLU C 3 21 ? 3.619   -2.148  4.338   1.00 2.47  ? 21 GLU A H      2  
ATOM 7207  H HA     . GLU C 3 21 ? 0.921   -2.595  4.812   1.00 2.63  ? 21 GLU A HA     2  
ATOM 7208  H HB2    . GLU C 3 21 ? 2.944   -4.586  3.757   1.00 3.00  ? 21 GLU A HB2    2  
ATOM 7209  H HB3    . GLU C 3 21 ? 1.203   -4.654  3.520   1.00 3.13  ? 21 GLU A HB3    2  
ATOM 7210  H HG2    . GLU C 3 21 ? 1.738   -3.709  1.549   1.00 3.56  ? 21 GLU A HG2    2  
ATOM 7211  H HG3    . GLU C 3 21 ? 1.673   -2.229  2.503   1.00 3.51  ? 21 GLU A HG3    2  
ATOM 7212  N N      . LEU C 3 22 ? 2.876   -4.667  6.476   1.00 2.56  ? 22 LEU A N      2  
ATOM 7213  C CA     . LEU C 3 22 ? 2.941   -5.565  7.622   1.00 2.73  ? 22 LEU A CA     2  
ATOM 7214  C C      . LEU C 3 22 ? 2.820   -4.796  8.935   1.00 2.66  ? 22 LEU A C      2  
ATOM 7215  O O      . LEU C 3 22 ? 2.584   -5.384  9.991   1.00 2.89  ? 22 LEU A O      2  
ATOM 7216  C CB     . LEU C 3 22 ? 4.248   -6.359  7.598   1.00 2.88  ? 22 LEU A CB     2  
ATOM 7217  C CG     . LEU C 3 22 ? 4.448   -7.246  6.365   1.00 3.13  ? 22 LEU A CG     2  
ATOM 7218  C CD1    . LEU C 3 22 ? 5.858   -7.808  6.329   1.00 3.46  ? 22 LEU A CD1    2  
ATOM 7219  C CD2    . LEU C 3 22 ? 3.423   -8.372  6.346   1.00 3.58  ? 22 LEU A CD2    2  
ATOM 7220  H H      . LEU C 3 22 ? 3.684   -4.514  5.940   1.00 2.55  ? 22 LEU A H      2  
ATOM 7221  H HA     . LEU C 3 22 ? 2.113   -6.255  7.548   1.00 2.93  ? 22 LEU A HA     2  
ATOM 7222  H HB2    . LEU C 3 22 ? 5.068   -5.658  7.652   1.00 2.96  ? 22 LEU A HB2    2  
ATOM 7223  H HB3    . LEU C 3 22 ? 4.277   -6.987  8.476   1.00 3.14  ? 22 LEU A HB3    2  
ATOM 7224  H HG     . LEU C 3 22 ? 4.307   -6.652  5.474   1.00 3.38  ? 22 LEU A HG     2  
ATOM 7225  H HD11   . LEU C 3 22 ? 6.570   -6.996  6.333   1.00 3.47  ? 22 LEU A HD11   2  
ATOM 7226  H HD12   . LEU C 3 22 ? 5.987   -8.396  5.431   1.00 3.60  ? 22 LEU A HD12   2  
ATOM 7227  H HD13   . LEU C 3 22 ? 6.020   -8.434  7.194   1.00 4.10  ? 22 LEU A HD13   2  
ATOM 7228  H HD21   . LEU C 3 22 ? 3.619   -9.025  5.508   1.00 3.78  ? 22 LEU A HD21   2  
ATOM 7229  H HD22   . LEU C 3 22 ? 2.431   -7.955  6.253   1.00 3.76  ? 22 LEU A HD22   2  
ATOM 7230  H HD23   . LEU C 3 22 ? 3.491   -8.937  7.265   1.00 4.07  ? 22 LEU A HD23   2  
ATOM 7231  N N      . ARG C 3 23 ? 2.982   -3.481  8.870   1.00 2.45  ? 23 ARG A N      2  
ATOM 7232  C CA     . ARG C 3 23 ? 2.876   -2.645  10.055  1.00 2.52  ? 23 ARG A CA     2  
ATOM 7233  C C      . ARG C 3 23 ? 1.422   -2.249  10.299  1.00 2.63  ? 23 ARG A C      2  
ATOM 7234  O O      . ARG C 3 23 ? 1.004   -2.043  11.437  1.00 2.93  ? 23 ARG A O      2  
ATOM 7235  C CB     . ARG C 3 23 ? 3.756   -1.398  9.920   1.00 2.40  ? 23 ARG A CB     2  
ATOM 7236  C CG     . ARG C 3 23 ? 5.219   -1.649  10.257  1.00 2.60  ? 23 ARG A CG     2  
ATOM 7237  C CD     . ARG C 3 23 ? 5.999   -0.351  10.388  1.00 2.56  ? 23 ARG A CD     2  
ATOM 7238  N NE     . ARG C 3 23 ? 6.437   0.169   9.090   1.00 2.36  ? 23 ARG A NE     2  
ATOM 7239  C CZ     . ARG C 3 23 ? 7.034   1.354   8.931   1.00 2.51  ? 23 ARG A CZ     2  
ATOM 7240  N NH1    . ARG C 3 23 ? 7.255   2.133   9.985   1.00 2.95  ? 23 ARG A NH1    2  
ATOM 7241  N NH2    . ARG C 3 23 ? 7.420   1.753   7.723   1.00 2.84  ? 23 ARG A NH2    2  
ATOM 7242  H H      . ARG C 3 23 ? 3.166   -3.062  8.003   1.00 2.33  ? 23 ARG A H      2  
ATOM 7243  H HA     . ARG C 3 23 ? 3.222   -3.229  10.895  1.00 2.71  ? 23 ARG A HA     2  
ATOM 7244  H HB2    . ARG C 3 23 ? 3.699   -1.041  8.904   1.00 2.40  ? 23 ARG A HB2    2  
ATOM 7245  H HB3    . ARG C 3 23 ? 3.381   -0.633  10.582  1.00 2.58  ? 23 ARG A HB3    2  
ATOM 7246  H HG2    . ARG C 3 23 ? 5.276   -2.183  11.195  1.00 3.08  ? 23 ARG A HG2    2  
ATOM 7247  H HG3    . ARG C 3 23 ? 5.659   -2.248  9.473   1.00 2.87  ? 23 ARG A HG3    2  
ATOM 7248  H HD2    . ARG C 3 23 ? 5.370   0.387   10.865  1.00 2.85  ? 23 ARG A HD2    2  
ATOM 7249  H HD3    . ARG C 3 23 ? 6.869   -0.530  11.002  1.00 3.10  ? 23 ARG A HD3    2  
ATOM 7250  H HE     . ARG C 3 23 ? 6.288   -0.401  8.302   1.00 2.59  ? 23 ARG A HE     2  
ATOM 7251  H HH11   . ARG C 3 23 ? 6.974   1.834   10.905  1.00 3.27  ? 23 ARG A HH11   2  
ATOM 7252  H HH12   . ARG C 3 23 ? 7.720   3.016   9.873   1.00 3.29  ? 23 ARG A HH12   2  
ATOM 7253  H HH21   . ARG C 3 23 ? 7.272   1.163   6.923   1.00 3.19  ? 23 ARG A HH21   2  
ATOM 7254  H HH22   . ARG C 3 23 ? 7.867   2.640   7.606   1.00 3.10  ? 23 ARG A HH22   2  
ATOM 7255  N N      . ARG C 3 24 ? 0.652   -2.158  9.222   1.00 2.51  ? 24 ARG A N      2  
ATOM 7256  C CA     . ARG C 3 24 ? -0.758  -1.796  9.316   1.00 2.71  ? 24 ARG A CA     2  
ATOM 7257  C C      . ARG C 3 24 ? -1.589  -2.989  9.779   1.00 2.99  ? 24 ARG A C      2  
ATOM 7258  O O      . ARG C 3 24 ? -2.619  -2.824  10.435  1.00 3.26  ? 24 ARG A O      2  
ATOM 7259  C CB     . ARG C 3 24 ? -1.278  -1.306  7.963   1.00 2.66  ? 24 ARG A CB     2  
ATOM 7260  C CG     . ARG C 3 24 ? -0.568  -0.067  7.436   1.00 2.96  ? 24 ARG A CG     2  
ATOM 7261  C CD     . ARG C 3 24 ? -1.060  1.205   8.111   1.00 2.99  ? 24 ARG A CD     2  
ATOM 7262  N NE     . ARG C 3 24 ? -0.697  2.400   7.346   1.00 3.21  ? 24 ARG A NE     2  
ATOM 7263  C CZ     . ARG C 3 24 ? -0.377  3.573   7.887   1.00 3.47  ? 24 ARG A CZ     2  
ATOM 7264  N NH1    . ARG C 3 24 ? -0.357  3.724   9.205   1.00 3.72  ? 24 ARG A NH1    2  
ATOM 7265  N NH2    . ARG C 3 24 ? -0.075  4.598   7.098   1.00 3.87  ? 24 ARG A NH2    2  
ATOM 7266  H H      . ARG C 3 24 ? 1.044   -2.328  8.336   1.00 2.37  ? 24 ARG A H      2  
ATOM 7267  H HA     . ARG C 3 24 ? -0.851  -1.002  10.041  1.00 2.83  ? 24 ARG A HA     2  
ATOM 7268  H HB2    . ARG C 3 24 ? -1.156  -2.097  7.238   1.00 2.72  ? 24 ARG A HB2    2  
ATOM 7269  H HB3    . ARG C 3 24 ? -2.329  -1.079  8.057   1.00 2.73  ? 24 ARG A HB3    2  
ATOM 7270  H HG2    . ARG C 3 24 ? 0.490   -0.169  7.615   1.00 3.19  ? 24 ARG A HG2    2  
ATOM 7271  H HG3    . ARG C 3 24 ? -0.746  0.010   6.372   1.00 3.50  ? 24 ARG A HG3    2  
ATOM 7272  H HD2    . ARG C 3 24 ? -2.135  1.159   8.198   1.00 3.28  ? 24 ARG A HD2    2  
ATOM 7273  H HD3    . ARG C 3 24 ? -0.625  1.270   9.097   1.00 3.17  ? 24 ARG A HD3    2  
ATOM 7274  H HE     . ARG C 3 24 ? -0.697  2.321   6.366   1.00 3.46  ? 24 ARG A HE     2  
ATOM 7275  H HH11   . ARG C 3 24 ? -0.582  2.953   9.803   1.00 3.79  ? 24 ARG A HH11   2  
ATOM 7276  H HH12   . ARG C 3 24 ? -0.127  4.613   9.611   1.00 4.10  ? 24 ARG A HH12   2  
ATOM 7277  H HH21   . ARG C 3 24 ? -0.093  4.484   6.101   1.00 4.15  ? 24 ARG A HH21   2  
ATOM 7278  H HH22   . ARG C 3 24 ? 0.179   5.484   7.492   1.00 4.12  ? 24 ARG A HH22   2  
ATOM 7279  N N      . THR C 3 25 ? -1.135  -4.188  9.438   1.00 3.03  ? 25 THR A N      2  
ATOM 7280  C CA     . THR C 3 25 ? -1.841  -5.409  9.808   1.00 3.39  ? 25 THR A CA     2  
ATOM 7281  C C      . THR C 3 25 ? -1.372  -5.963  11.148  1.00 3.47  ? 25 THR A C      2  
ATOM 7282  O O      . THR C 3 25 ? -2.176  -6.184  12.055  1.00 3.75  ? 25 THR A O      2  
ATOM 7283  C CB     . THR C 3 25 ? -1.663  -6.491  8.728   1.00 3.50  ? 25 THR A CB     2  
ATOM 7284  O OG1    . THR C 3 25 ? -0.362  -6.377  8.126   1.00 3.20  ? 25 THR A OG1    2  
ATOM 7285  C CG2    . THR C 3 25 ? -2.743  -6.365  7.666   1.00 4.09  ? 25 THR A CG2    2  
ATOM 7286  H H      . THR C 3 25 ? -0.309  -4.256  8.918   1.00 2.86  ? 25 THR A H      2  
ATOM 7287  H HA     . THR C 3 25 ? -2.893  -5.176  9.879   1.00 3.68  ? 25 THR A HA     2  
ATOM 7288  H HB     . THR C 3 25 ? -1.750  -7.460  9.196   1.00 3.63  ? 25 THR A HB     2  
ATOM 7289  H HG1    . THR C 3 25 ? -0.426  -5.854  7.316   1.00 2.99  ? 25 THR A HG1    2  
ATOM 7290  H HG21   . THR C 3 25 ? -2.757  -5.353  7.285   1.00 4.10  ? 25 THR A HG21   2  
ATOM 7291  H HG22   . THR C 3 25 ? -3.703  -6.601  8.100   1.00 4.39  ? 25 THR A HG22   2  
ATOM 7292  H HG23   . THR C 3 25 ? -2.535  -7.051  6.859   1.00 4.55  ? 25 THR A HG23   2  
ATOM 7293  N N      . LEU C 3 26 ? -0.073  -6.190  11.273  1.00 3.35  ? 26 LEU A N      2  
ATOM 7294  C CA     . LEU C 3 26 ? 0.484   -6.740  12.500  1.00 3.52  ? 26 LEU A CA     2  
ATOM 7295  C C      . LEU C 3 26 ? 1.149   -5.656  13.343  1.00 3.46  ? 26 LEU A C      2  
ATOM 7296  O O      . LEU C 3 26 ? 0.857   -5.515  14.530  1.00 3.77  ? 26 LEU A O      2  
ATOM 7297  C CB     . LEU C 3 26 ? 1.494   -7.843  12.170  1.00 3.60  ? 26 LEU A CB     2  
ATOM 7298  C CG     . LEU C 3 26 ? 1.012   -8.879  11.148  1.00 3.95  ? 26 LEU A CG     2  
ATOM 7299  C CD1    . LEU C 3 26 ? 2.144   -9.810  10.754  1.00 4.49  ? 26 LEU A CD1    2  
ATOM 7300  C CD2    . LEU C 3 26 ? -0.165  -9.675  11.699  1.00 4.24  ? 26 LEU A CD2    2  
ATOM 7301  H H      . LEU C 3 26 ? 0.522   -5.989  10.520  1.00 3.22  ? 26 LEU A H      2  
ATOM 7302  H HA     . LEU C 3 26 ? -0.326  -7.170  13.066  1.00 3.86  ? 26 LEU A HA     2  
ATOM 7303  H HB2    . LEU C 3 26 ? 2.390   -7.376  11.788  1.00 3.61  ? 26 LEU A HB2    2  
ATOM 7304  H HB3    . LEU C 3 26 ? 1.740   -8.361  13.085  1.00 3.67  ? 26 LEU A HB3    2  
ATOM 7305  H HG     . LEU C 3 26 ? 0.679   -8.366  10.256  1.00 4.03  ? 26 LEU A HG     2  
ATOM 7306  H HD11   . LEU C 3 26 ? 2.649   -10.158 11.642  1.00 4.86  ? 26 LEU A HD11   2  
ATOM 7307  H HD12   . LEU C 3 26 ? 2.842   -9.278  10.123  1.00 4.43  ? 26 LEU A HD12   2  
ATOM 7308  H HD13   . LEU C 3 26 ? 1.743   -10.654 10.216  1.00 4.96  ? 26 LEU A HD13   2  
ATOM 7309  H HD21   . LEU C 3 26 ? -0.998  -9.010  11.876  1.00 4.62  ? 26 LEU A HD21   2  
ATOM 7310  H HD22   . LEU C 3 26 ? 0.122   -10.144 12.628  1.00 4.56  ? 26 LEU A HD22   2  
ATOM 7311  H HD23   . LEU C 3 26 ? -0.453  -10.434 10.987  1.00 4.21  ? 26 LEU A HD23   2  
ATOM 7312  N N      . GLY C 3 27 ? 2.040   -4.895  12.726  1.00 3.32  ? 27 GLY A N      2  
ATOM 7313  C CA     . GLY C 3 27 ? 2.732   -3.841  13.438  1.00 3.54  ? 27 GLY A CA     2  
ATOM 7314  C C      . GLY C 3 27 ? 4.135   -4.256  13.830  1.00 3.50  ? 27 GLY A C      2  
ATOM 7315  O O      . GLY C 3 27 ? 4.526   -4.125  14.987  1.00 3.74  ? 27 GLY A O      2  
ATOM 7316  H H      . GLY C 3 27 ? 2.234   -5.056  11.776  1.00 3.26  ? 27 GLY A H      2  
ATOM 7317  H HA2    . GLY C 3 27 ? 2.784   -2.967  12.807  1.00 3.70  ? 27 GLY A HA2    2  
ATOM 7318  H HA3    . GLY C 3 27 ? 2.177   -3.596  14.333  1.00 3.81  ? 27 GLY A HA3    2  
ATOM 7319  N N      . ILE C 3 28 ? 4.889   -4.765  12.862  1.00 3.43  ? 28 ILE A N      2  
ATOM 7320  C CA     . ILE C 3 28 ? 6.259   -5.211  13.106  1.00 3.53  ? 28 ILE A CA     2  
ATOM 7321  C C      . ILE C 3 28 ? 7.167   -4.043  13.487  1.00 3.70  ? 28 ILE A C      2  
ATOM 7322  O O      . ILE C 3 28 ? 6.975   -2.920  13.021  1.00 3.85  ? 28 ILE A O      2  
ATOM 7323  C CB     . ILE C 3 28 ? 6.853   -5.931  11.878  1.00 3.59  ? 28 ILE A CB     2  
ATOM 7324  C CG1    . ILE C 3 28 ? 6.638   -5.100  10.608  1.00 3.56  ? 28 ILE A CG1    2  
ATOM 7325  C CG2    . ILE C 3 28 ? 6.232   -7.312  11.731  1.00 3.82  ? 28 ILE A CG2    2  
ATOM 7326  C CD1    . ILE C 3 28 ? 7.412   -5.604  9.409   1.00 4.11  ? 28 ILE A CD1    2  
ATOM 7327  H H      . ILE C 3 28 ? 4.520   -4.840  11.961  1.00 3.48  ? 28 ILE A H      2  
ATOM 7328  H HA     . ILE C 3 28 ? 6.235   -5.912  13.926  1.00 3.68  ? 28 ILE A HA     2  
ATOM 7329  H HB     . ILE C 3 28 ? 7.916   -6.054  12.040  1.00 3.85  ? 28 ILE A HB     2  
ATOM 7330  H HG12   . ILE C 3 28 ? 5.589   -5.110  10.351  1.00 3.58  ? 28 ILE A HG12   2  
ATOM 7331  H HG13   . ILE C 3 28 ? 6.947   -4.083  10.797  1.00 3.48  ? 28 ILE A HG13   2  
ATOM 7332  H HG21   . ILE C 3 28 ? 5.156   -7.218  11.688  1.00 4.27  ? 28 ILE A HG21   2  
ATOM 7333  H HG22   . ILE C 3 28 ? 6.508   -7.923  12.579  1.00 3.84  ? 28 ILE A HG22   2  
ATOM 7334  H HG23   . ILE C 3 28 ? 6.591   -7.776  10.823  1.00 4.02  ? 28 ILE A HG23   2  
ATOM 7335  H HD11   . ILE C 3 28 ? 7.217   -4.964  8.562   1.00 4.16  ? 28 ILE A HD11   2  
ATOM 7336  H HD12   . ILE C 3 28 ? 7.103   -6.615  9.176   1.00 4.42  ? 28 ILE A HD12   2  
ATOM 7337  H HD13   . ILE C 3 28 ? 8.468   -5.593  9.636   1.00 4.53  ? 28 ILE A HD13   2  
ATOM 7338  N N      . ALA C 3 29 ? 8.149   -4.322  14.337  1.00 3.97  ? 29 ALA A N      2  
ATOM 7339  C CA     . ALA C 3 29 ? 9.091   -3.305  14.792  1.00 4.40  ? 29 ALA A CA     2  
ATOM 7340  C C      . ALA C 3 29 ? 9.944   -2.786  13.640  1.00 4.50  ? 29 ALA A C      2  
ATOM 7341  O O      . ALA C 3 29 ? 10.411  -3.565  12.803  1.00 4.84  ? 29 ALA A O      2  
ATOM 7342  C CB     . ALA C 3 29 ? 9.975   -3.870  15.889  1.00 4.99  ? 29 ALA A CB     2  
ATOM 7343  H H      . ALA C 3 29 ? 8.248   -5.241  14.665  1.00 4.06  ? 29 ALA A H      2  
ATOM 7344  H HA     . ALA C 3 29 ? 8.523   -2.484  15.207  1.00 4.46  ? 29 ALA A HA     2  
ATOM 7345  H HB1    . ALA C 3 29 ? 9.642   -4.866  16.143  1.00 5.43  ? 29 ALA A HB1    2  
ATOM 7346  H HB2    . ALA C 3 29 ? 9.910   -3.236  16.762  1.00 5.13  ? 29 ALA A HB2    2  
ATOM 7347  H HB3    . ALA C 3 29 ? 10.998  -3.908  15.546  1.00 5.19  ? 29 ALA A HB3    2  
ATOM 7348  N N      . GLU C 3 30 ? 10.142  -1.477  13.593  1.00 4.48  ? 30 GLU A N      2  
ATOM 7349  C CA     . GLU C 3 30 ? 10.935  -0.863  12.540  1.00 4.68  ? 30 GLU A CA     2  
ATOM 7350  C C      . GLU C 3 30 ? 12.039  0.030   13.111  1.00 3.97  ? 30 GLU A C      2  
ATOM 7351  O O      . GLU C 3 30 ? 13.154  0.044   12.595  1.00 3.91  ? 30 GLU A O      2  
ATOM 7352  C CB     . GLU C 3 30 ? 10.031  -0.060  11.586  1.00 5.46  ? 30 GLU A CB     2  
ATOM 7353  C CG     . GLU C 3 30 ? 9.498   1.251   12.157  1.00 5.90  ? 30 GLU A CG     2  
ATOM 7354  C CD     . GLU C 3 30 ? 8.430   1.045   13.213  1.00 5.90  ? 30 GLU A CD     2  
ATOM 7355  O OE1    . GLU C 3 30 ? 8.786   0.742   14.373  1.00 5.95  ? 30 GLU A OE1    2  
ATOM 7356  O OE2    . GLU C 3 30 ? 7.233   1.185   12.883  1.00 6.17  ? 30 GLU A OE2    2  
ATOM 7357  H H      . GLU C 3 30 ? 9.732   -0.901  14.279  1.00 4.52  ? 30 GLU A H      2  
ATOM 7358  H HA     . GLU C 3 30 ? 11.402  -1.660  11.981  1.00 5.01  ? 30 GLU A HA     2  
ATOM 7359  H HB2    . GLU C 3 30 ? 10.590  0.169   10.691  1.00 5.81  ? 30 GLU A HB2    2  
ATOM 7360  H HB3    . GLU C 3 30 ? 9.185   -0.677  11.319  1.00 5.72  ? 30 GLU A HB3    2  
ATOM 7361  H HG2    . GLU C 3 30 ? 10.319  1.795   12.600  1.00 6.04  ? 30 GLU A HG2    2  
ATOM 7362  H HG3    . GLU C 3 30 ? 9.080   1.832   11.351  1.00 6.43  ? 30 GLU A HG3    2  
ATOM 7363  N N      . LYS C 3 31 ? 11.726  0.758   14.180  1.00 3.71  ? 31 LYS A N      2  
ATOM 7364  C CA     . LYS C 3 31 ? 12.686  1.670   14.797  1.00 3.23  ? 31 LYS A CA     2  
ATOM 7365  C C      . LYS C 3 31 ? 13.692  0.939   15.686  1.00 3.19  ? 31 LYS A C      2  
ATOM 7366  O O      . LYS C 3 31 ? 13.478  0.779   16.893  1.00 3.55  ? 31 LYS A O      2  
ATOM 7367  C CB     . LYS C 3 31 ? 11.952  2.735   15.614  1.00 3.32  ? 31 LYS A CB     2  
ATOM 7368  C CG     . LYS C 3 31 ? 10.868  3.454   14.833  1.00 3.39  ? 31 LYS A CG     2  
ATOM 7369  C CD     . LYS C 3 31 ? 10.086  4.412   15.715  1.00 3.62  ? 31 LYS A CD     2  
ATOM 7370  C CE     . LYS C 3 31 ? 8.788   4.838   15.051  1.00 4.00  ? 31 LYS A CE     2  
ATOM 7371  N NZ     . LYS C 3 31 ? 8.080   5.880   15.839  1.00 4.12  ? 31 LYS A NZ     2  
ATOM 7372  H H      . LYS C 3 31 ? 10.820  0.690   14.556  1.00 4.04  ? 31 LYS A H      2  
ATOM 7373  H HA     . LYS C 3 31 ? 13.225  2.158   14.001  1.00 3.14  ? 31 LYS A HA     2  
ATOM 7374  H HB2    . LYS C 3 31 ? 11.494  2.264   16.471  1.00 3.36  ? 31 LYS A HB2    2  
ATOM 7375  H HB3    . LYS C 3 31 ? 12.668  3.470   15.955  1.00 3.83  ? 31 LYS A HB3    2  
ATOM 7376  H HG2    . LYS C 3 31 ? 11.327  4.013   14.032  1.00 3.77  ? 31 LYS A HG2    2  
ATOM 7377  H HG3    . LYS C 3 31 ? 10.190  2.722   14.421  1.00 3.51  ? 31 LYS A HG3    2  
ATOM 7378  H HD2    . LYS C 3 31 ? 9.856   3.925   16.651  1.00 3.70  ? 31 LYS A HD2    2  
ATOM 7379  H HD3    . LYS C 3 31 ? 10.690  5.287   15.903  1.00 4.00  ? 31 LYS A HD3    2  
ATOM 7380  H HE2    . LYS C 3 31 ? 9.011   5.227   14.069  1.00 4.49  ? 31 LYS A HE2    2  
ATOM 7381  H HE3    . LYS C 3 31 ? 8.148   3.972   14.958  1.00 4.24  ? 31 LYS A HE3    2  
ATOM 7382  H HZ1    . LYS C 3 31 ? 7.235   6.204   15.328  1.00 4.34  ? 31 LYS A HZ1    2  
ATOM 7383  H HZ2    . LYS C 3 31 ? 8.709   6.699   16.004  1.00 4.28  ? 31 LYS A HZ2    2  
ATOM 7384  H HZ3    . LYS C 3 31 ? 7.787   5.493   16.758  1.00 4.31  ? 31 LYS A HZ3    2  
ATOM 7385  N N      . ASP C 3 32 ? 14.783  0.490   15.079  1.00 2.99  ? 32 ASP A N      2  
ATOM 7386  C CA     . ASP C 3 32 ? 15.848  -0.201  15.799  1.00 3.08  ? 32 ASP A CA     2  
ATOM 7387  C C      . ASP C 3 32 ? 17.090  -0.320  14.922  1.00 2.73  ? 32 ASP A C      2  
ATOM 7388  O O      . ASP C 3 32 ? 17.151  0.273   13.840  1.00 2.48  ? 32 ASP A O      2  
ATOM 7389  C CB     . ASP C 3 32 ? 15.392  -1.581  16.304  1.00 3.32  ? 32 ASP A CB     2  
ATOM 7390  C CG     . ASP C 3 32 ? 14.725  -2.438  15.244  1.00 3.53  ? 32 ASP A CG     2  
ATOM 7391  O OD1    . ASP C 3 32 ? 13.486  -2.349  15.092  1.00 3.98  ? 32 ASP A OD1    2  
ATOM 7392  O OD2    . ASP C 3 32 ? 15.427  -3.228  14.578  1.00 3.52  ? 32 ASP A OD2    2  
ATOM 7393  H H      . ASP C 3 32 ? 14.872  0.619   14.109  1.00 2.94  ? 32 ASP A H      2  
ATOM 7394  H HA     . ASP C 3 32 ? 16.100  0.410   16.652  1.00 3.43  ? 32 ASP A HA     2  
ATOM 7395  H HB2    . ASP C 3 32 ? 16.249  -2.118  16.677  1.00 3.82  ? 32 ASP A HB2    2  
ATOM 7396  H HB3    . ASP C 3 32 ? 14.690  -1.438  17.112  1.00 3.27  ? 32 ASP A HB3    2  
ATOM 7397  N N      . ALA C 3 33 ? 18.087  -1.053  15.401  1.00 2.86  ? 33 ALA A N      2  
ATOM 7398  C CA     . ALA C 3 33 ? 19.330  -1.234  14.661  1.00 2.64  ? 33 ALA A CA     2  
ATOM 7399  C C      . ALA C 3 33 ? 19.332  -2.569  13.930  1.00 2.57  ? 33 ALA A C      2  
ATOM 7400  O O      . ALA C 3 33 ? 19.234  -3.629  14.545  1.00 2.95  ? 33 ALA A O      2  
ATOM 7401  C CB     . ALA C 3 33 ? 20.520  -1.142  15.602  1.00 2.88  ? 33 ALA A CB     2  
ATOM 7402  H H      . ALA C 3 33 ? 17.984  -1.488  16.270  1.00 3.19  ? 33 ALA A H      2  
ATOM 7403  H HA     . ALA C 3 33 ? 19.408  -0.437  13.938  1.00 2.49  ? 33 ALA A HA     2  
ATOM 7404  H HB1    . ALA C 3 33 ? 20.567  -0.150  16.023  1.00 3.39  ? 33 ALA A HB1    2  
ATOM 7405  H HB2    . ALA C 3 33 ? 21.429  -1.345  15.057  1.00 2.91  ? 33 ALA A HB2    2  
ATOM 7406  H HB3    . ALA C 3 33 ? 20.408  -1.867  16.395  1.00 3.02  ? 33 ALA A HB3    2  
ATOM 7407  N N      . LEU C 3 34 ? 19.458  -2.515  12.617  1.00 2.26  ? 34 LEU A N      2  
ATOM 7408  C CA     . LEU C 3 34 ? 19.459  -3.717  11.804  1.00 2.32  ? 34 LEU A CA     2  
ATOM 7409  C C      . LEU C 3 34 ? 20.865  -4.020  11.302  1.00 2.39  ? 34 LEU A C      2  
ATOM 7410  O O      . LEU C 3 34 ? 21.580  -3.118  10.854  1.00 2.36  ? 34 LEU A O      2  
ATOM 7411  C CB     . LEU C 3 34 ? 18.500  -3.560  10.617  1.00 2.27  ? 34 LEU A CB     2  
ATOM 7412  C CG     . LEU C 3 34 ? 17.010  -3.459  10.978  1.00 2.34  ? 34 LEU A CG     2  
ATOM 7413  C CD1    . LEU C 3 34 ? 16.634  -2.041  11.390  1.00 2.42  ? 34 LEU A CD1    2  
ATOM 7414  C CD2    . LEU C 3 34 ? 16.153  -3.910  9.809   1.00 2.95  ? 34 LEU A CD2    2  
ATOM 7415  H H      . LEU C 3 34 ? 19.567  -1.640  12.182  1.00 2.12  ? 34 LEU A H      2  
ATOM 7416  H HA     . LEU C 3 34 ? 19.123  -4.538  12.423  1.00 2.54  ? 34 LEU A HA     2  
ATOM 7417  H HB2    . LEU C 3 34 ? 18.778  -2.667  10.076  1.00 2.14  ? 34 LEU A HB2    2  
ATOM 7418  H HB3    . LEU C 3 34 ? 18.632  -4.409  9.965   1.00 2.63  ? 34 LEU A HB3    2  
ATOM 7419  H HG     . LEU C 3 34 ? 16.805  -4.111  11.811  1.00 2.59  ? 34 LEU A HG     2  
ATOM 7420  H HD11   . LEU C 3 34 ? 16.807  -1.367  10.563  1.00 2.71  ? 34 LEU A HD11   2  
ATOM 7421  H HD12   . LEU C 3 34 ? 17.236  -1.738  12.234  1.00 2.88  ? 34 LEU A HD12   2  
ATOM 7422  H HD13   . LEU C 3 34 ? 15.590  -2.011  11.665  1.00 2.55  ? 34 LEU A HD13   2  
ATOM 7423  H HD21   . LEU C 3 34 ? 16.190  -3.165  9.029   1.00 3.37  ? 34 LEU A HD21   2  
ATOM 7424  H HD22   . LEU C 3 34 ? 15.132  -4.034  10.141  1.00 3.24  ? 34 LEU A HD22   2  
ATOM 7425  H HD23   . LEU C 3 34 ? 16.526  -4.849  9.429   1.00 3.24  ? 34 LEU A HD23   2  
ATOM 7426  N N      . GLU C 3 35 ? 21.269  -5.279  11.397  1.00 2.56  ? 35 GLU A N      2  
ATOM 7427  C CA     . GLU C 3 35 ? 22.587  -5.679  10.933  1.00 2.71  ? 35 GLU A CA     2  
ATOM 7428  C C      . GLU C 3 35 ? 22.500  -6.241  9.522   1.00 2.54  ? 35 GLU A C      2  
ATOM 7429  O O      . GLU C 3 35 ? 21.882  -7.280  9.281   1.00 2.56  ? 35 GLU A O      2  
ATOM 7430  C CB     . GLU C 3 35 ? 23.239  -6.684  11.887  1.00 3.09  ? 35 GLU A CB     2  
ATOM 7431  C CG     . GLU C 3 35 ? 22.351  -7.851  12.274  1.00 3.03  ? 35 GLU A CG     2  
ATOM 7432  C CD     . GLU C 3 35 ? 23.070  -8.849  13.154  1.00 3.26  ? 35 GLU A CD     2  
ATOM 7433  O OE1    . GLU C 3 35 ? 23.437  -8.490  14.293  1.00 3.42  ? 35 GLU A OE1    2  
ATOM 7434  O OE2    . GLU C 3 35 ? 23.270  -10.001 12.715  1.00 3.51  ? 35 GLU A OE2    2  
ATOM 7435  H H      . GLU C 3 35 ? 20.666  -5.954  11.776  1.00 2.63  ? 35 GLU A H      2  
ATOM 7436  H HA     . GLU C 3 35 ? 23.197  -4.792  10.901  1.00 2.73  ? 35 GLU A HA     2  
ATOM 7437  H HB2    . GLU C 3 35 ? 24.127  -7.080  11.418  1.00 3.47  ? 35 GLU A HB2    2  
ATOM 7438  H HB3    . GLU C 3 35 ? 23.524  -6.164  12.789  1.00 3.37  ? 35 GLU A HB3    2  
ATOM 7439  H HG2    . GLU C 3 35 ? 21.493  -7.474  12.808  1.00 3.01  ? 35 GLU A HG2    2  
ATOM 7440  H HG3    . GLU C 3 35 ? 22.026  -8.353  11.377  1.00 3.31  ? 35 GLU A HG3    2  
ATOM 7441  N N      . ILE C 3 36 ? 23.102  -5.521  8.590   1.00 2.46  ? 36 ILE A N      2  
ATOM 7442  C CA     . ILE C 3 36 ? 23.111  -5.916  7.195   1.00 2.36  ? 36 ILE A CA     2  
ATOM 7443  C C      . ILE C 3 36 ? 24.270  -6.867  6.924   1.00 2.57  ? 36 ILE A C      2  
ATOM 7444  O O      . ILE C 3 36 ? 25.410  -6.438  6.730   1.00 2.75  ? 36 ILE A O      2  
ATOM 7445  C CB     . ILE C 3 36 ? 23.223  -4.688  6.266   1.00 2.21  ? 36 ILE A CB     2  
ATOM 7446  C CG1    . ILE C 3 36 ? 22.181  -3.631  6.649   1.00 2.05  ? 36 ILE A CG1    2  
ATOM 7447  C CG2    . ILE C 3 36 ? 23.050  -5.110  4.812   1.00 2.44  ? 36 ILE A CG2    2  
ATOM 7448  C CD1    . ILE C 3 36 ? 22.533  -2.233  6.185   1.00 2.06  ? 36 ILE A CD1    2  
ATOM 7449  H H      . ILE C 3 36 ? 23.567  -4.695  8.854   1.00 2.55  ? 36 ILE A H      2  
ATOM 7450  H HA     . ILE C 3 36 ? 22.181  -6.422  6.982   1.00 2.30  ? 36 ILE A HA     2  
ATOM 7451  H HB     . ILE C 3 36 ? 24.212  -4.268  6.379   1.00 2.32  ? 36 ILE A HB     2  
ATOM 7452  H HG12   . ILE C 3 36 ? 21.234  -3.895  6.207   1.00 2.16  ? 36 ILE A HG12   2  
ATOM 7453  H HG13   . ILE C 3 36 ? 22.078  -3.609  7.725   1.00 2.09  ? 36 ILE A HG13   2  
ATOM 7454  H HG21   . ILE C 3 36 ? 23.097  -4.240  4.173   1.00 2.74  ? 36 ILE A HG21   2  
ATOM 7455  H HG22   . ILE C 3 36 ? 22.092  -5.592  4.689   1.00 2.44  ? 36 ILE A HG22   2  
ATOM 7456  H HG23   . ILE C 3 36 ? 23.837  -5.799  4.542   1.00 2.87  ? 36 ILE A HG23   2  
ATOM 7457  H HD11   . ILE C 3 36 ? 22.736  -2.249  5.126   1.00 2.27  ? 36 ILE A HD11   2  
ATOM 7458  H HD12   . ILE C 3 36 ? 23.410  -1.889  6.715   1.00 2.29  ? 36 ILE A HD12   2  
ATOM 7459  H HD13   . ILE C 3 36 ? 21.706  -1.568  6.385   1.00 2.18  ? 36 ILE A HD13   2  
ATOM 7460  N N      . TYR C 3 37 ? 23.976  -8.156  6.937   1.00 2.61  ? 37 TYR A N      2  
ATOM 7461  C CA     . TYR C 3 37 ? 24.985  -9.173  6.696   1.00 2.85  ? 37 TYR A CA     2  
ATOM 7462  C C      . TYR C 3 37 ? 24.841  -9.725  5.284   1.00 2.71  ? 37 TYR A C      2  
ATOM 7463  O O      . TYR C 3 37 ? 23.754  -10.134 4.880   1.00 2.62  ? 37 TYR A O      2  
ATOM 7464  C CB     . TYR C 3 37 ? 24.848  -10.303 7.720   1.00 3.15  ? 37 TYR A CB     2  
ATOM 7465  C CG     . TYR C 3 37 ? 25.954  -11.330 7.643   1.00 3.72  ? 37 TYR A CG     2  
ATOM 7466  C CD1    . TYR C 3 37 ? 27.269  -10.982 7.920   1.00 3.83  ? 37 TYR A CD1    2  
ATOM 7467  C CD2    . TYR C 3 37 ? 25.684  -12.647 7.290   1.00 4.42  ? 37 TYR A CD2    2  
ATOM 7468  C CE1    . TYR C 3 37 ? 28.284  -11.913 7.845   1.00 4.59  ? 37 TYR A CE1    2  
ATOM 7469  C CE2    . TYR C 3 37 ? 26.697  -13.585 7.213   1.00 5.19  ? 37 TYR A CE2    2  
ATOM 7470  C CZ     . TYR C 3 37 ? 27.993  -13.211 7.492   1.00 5.25  ? 37 TYR A CZ     2  
ATOM 7471  O OH     . TYR C 3 37 ? 29.006  -14.140 7.415   1.00 6.13  ? 37 TYR A OH     2  
ATOM 7472  H H      . TYR C 3 37 ? 23.047  -8.435  7.108   1.00 2.52  ? 37 TYR A H      2  
ATOM 7473  H HA     . TYR C 3 37 ? 25.957  -8.713  6.798   1.00 2.97  ? 37 TYR A HA     2  
ATOM 7474  H HB2    . TYR C 3 37 ? 24.858  -9.880  8.714   1.00 3.21  ? 37 TYR A HB2    2  
ATOM 7475  H HB3    . TYR C 3 37 ? 23.910  -10.812 7.559   1.00 3.22  ? 37 TYR A HB3    2  
ATOM 7476  H HD1    . TYR C 3 37 ? 27.494  -9.962  8.198   1.00 3.50  ? 37 TYR A HD1    2  
ATOM 7477  H HD2    . TYR C 3 37 ? 24.667  -12.937 7.073   1.00 4.50  ? 37 TYR A HD2    2  
ATOM 7478  H HE1    . TYR C 3 37 ? 29.301  -11.621 8.063   1.00 4.79  ? 37 TYR A HE1    2  
ATOM 7479  H HE2    . TYR C 3 37 ? 26.469  -14.605 6.937   1.00 5.83  ? 37 TYR A HE2    2  
ATOM 7480  H HH     . TYR C 3 37 ? 29.690  -13.917 8.059   1.00 6.41  ? 37 TYR A HH     2  
ATOM 7481  N N      . VAL C 3 38 ? 25.930  -9.725  4.533   1.00 2.76  ? 38 VAL A N      2  
ATOM 7482  C CA     . VAL C 3 38 ? 25.902  -10.227 3.167   1.00 2.73  ? 38 VAL A CA     2  
ATOM 7483  C C      . VAL C 3 38 ? 26.043  -11.745 3.149   1.00 2.96  ? 38 VAL A C      2  
ATOM 7484  O O      . VAL C 3 38 ? 26.792  -12.321 3.940   1.00 3.18  ? 38 VAL A O      2  
ATOM 7485  C CB     . VAL C 3 38 ? 27.005  -9.583  2.288   1.00 2.80  ? 38 VAL A CB     2  
ATOM 7486  C CG1    . VAL C 3 38 ? 27.011  -8.073  2.463   1.00 3.00  ? 38 VAL A CG1    2  
ATOM 7487  C CG2    . VAL C 3 38 ? 28.382  -10.155 2.598   1.00 2.86  ? 38 VAL A CG2    2  
ATOM 7488  H H      . VAL C 3 38 ? 26.775  -9.387  4.908   1.00 2.88  ? 38 VAL A H      2  
ATOM 7489  H HA     . VAL C 3 38 ? 24.941  -9.965  2.745   1.00 2.55  ? 38 VAL A HA     2  
ATOM 7490  H HB     . VAL C 3 38 ? 26.777  -9.797  1.254   1.00 3.11  ? 38 VAL A HB     2  
ATOM 7491  H HG11   . VAL C 3 38 ? 26.221  -7.637  1.873   1.00 3.14  ? 38 VAL A HG11   2  
ATOM 7492  H HG12   . VAL C 3 38 ? 27.962  -7.681  2.141   1.00 3.15  ? 38 VAL A HG12   2  
ATOM 7493  H HG13   . VAL C 3 38 ? 26.858  -7.831  3.506   1.00 3.43  ? 38 VAL A HG13   2  
ATOM 7494  H HG21   . VAL C 3 38 ? 28.640  -9.940  3.625   1.00 2.95  ? 38 VAL A HG21   2  
ATOM 7495  H HG22   . VAL C 3 38 ? 29.115  -9.706  1.941   1.00 3.04  ? 38 VAL A HG22   2  
ATOM 7496  H HG23   . VAL C 3 38 ? 28.369  -11.225 2.446   1.00 3.23  ? 38 VAL A HG23   2  
ATOM 7497  N N      . ASP C 3 39 ? 25.302  -12.390 2.262   1.00 2.96  ? 39 ASP A N      2  
ATOM 7498  C CA     . ASP C 3 39 ? 25.345  -13.840 2.139   1.00 3.23  ? 39 ASP A CA     2  
ATOM 7499  C C      . ASP C 3 39 ? 25.040  -14.265 0.712   1.00 3.17  ? 39 ASP A C      2  
ATOM 7500  O O      . ASP C 3 39 ? 23.994  -13.915 0.162   1.00 2.95  ? 39 ASP A O      2  
ATOM 7501  C CB     . ASP C 3 39 ? 24.349  -14.502 3.094   1.00 3.30  ? 39 ASP A CB     2  
ATOM 7502  C CG     . ASP C 3 39 ? 24.327  -16.014 2.949   1.00 3.45  ? 39 ASP A CG     2  
ATOM 7503  O OD1    . ASP C 3 39 ? 25.370  -16.655 3.209   1.00 3.68  ? 39 ASP A OD1    2  
ATOM 7504  O OD2    . ASP C 3 39 ? 23.267  -16.567 2.579   1.00 3.49  ? 39 ASP A OD2    2  
ATOM 7505  H H      . ASP C 3 39 ? 24.702  -11.877 1.672   1.00 2.80  ? 39 ASP A H      2  
ATOM 7506  H HA     . ASP C 3 39 ? 26.343  -14.163 2.393   1.00 3.52  ? 39 ASP A HA     2  
ATOM 7507  H HB2    . ASP C 3 39 ? 24.621  -14.261 4.112   1.00 3.52  ? 39 ASP A HB2    2  
ATOM 7508  H HB3    . ASP C 3 39 ? 23.359  -14.123 2.890   1.00 3.21  ? 39 ASP A HB3    2  
ATOM 7509  N N      . ASP C 3 40 ? 25.965  -15.013 0.122   1.00 3.47  ? 40 ASP A N      2  
ATOM 7510  C CA     . ASP C 3 40 ? 25.828  -15.512 -1.244  1.00 3.59  ? 40 ASP A CA     2  
ATOM 7511  C C      . ASP C 3 40 ? 25.793  -14.351 -2.240  1.00 3.42  ? 40 ASP A C      2  
ATOM 7512  O O      . ASP C 3 40 ? 26.842  -13.833 -2.620  1.00 3.67  ? 40 ASP A O      2  
ATOM 7513  C CB     . ASP C 3 40 ? 24.586  -16.400 -1.380  1.00 3.58  ? 40 ASP A CB     2  
ATOM 7514  C CG     . ASP C 3 40 ? 24.522  -17.115 -2.714  1.00 3.92  ? 40 ASP A CG     2  
ATOM 7515  O OD1    . ASP C 3 40 ? 25.508  -17.787 -3.083  1.00 4.13  ? 40 ASP A OD1    2  
ATOM 7516  O OD2    . ASP C 3 40 ? 23.480  -17.011 -3.394  1.00 4.28  ? 40 ASP A OD2    2  
ATOM 7517  H H      . ASP C 3 40 ? 26.779  -15.235 0.623   1.00 3.67  ? 40 ASP A H      2  
ATOM 7518  H HA     . ASP C 3 40 ? 26.703  -16.108 -1.452  1.00 3.94  ? 40 ASP A HA     2  
ATOM 7519  H HB2    . ASP C 3 40 ? 24.595  -17.141 -0.595  1.00 3.56  ? 40 ASP A HB2    2  
ATOM 7520  H HB3    . ASP C 3 40 ? 23.701  -15.788 -1.278  1.00 3.58  ? 40 ASP A HB3    2  
ATOM 7521  N N      . GLU C 3 41 ? 24.599  -13.935 -2.645  1.00 3.09  ? 41 GLU A N      2  
ATOM 7522  C CA     . GLU C 3 41 ? 24.453  -12.824 -3.582  1.00 2.97  ? 41 GLU A CA     2  
ATOM 7523  C C      . GLU C 3 41 ? 23.378  -11.853 -3.097  1.00 2.57  ? 41 GLU A C      2  
ATOM 7524  O O      . GLU C 3 41 ? 22.939  -10.968 -3.833  1.00 2.46  ? 41 GLU A O      2  
ATOM 7525  C CB     . GLU C 3 41 ? 24.122  -13.336 -4.988  1.00 3.05  ? 41 GLU A CB     2  
ATOM 7526  C CG     . GLU C 3 41 ? 22.868  -14.194 -5.070  1.00 2.79  ? 41 GLU A CG     2  
ATOM 7527  C CD     . GLU C 3 41 ? 21.710  -13.467 -5.720  1.00 2.87  ? 41 GLU A CD     2  
ATOM 7528  O OE1    . GLU C 3 41 ? 21.664  -13.395 -6.965  1.00 3.04  ? 41 GLU A OE1    2  
ATOM 7529  O OE2    . GLU C 3 41 ? 20.835  -12.958 -4.993  1.00 3.17  ? 41 GLU A OE2    2  
ATOM 7530  H H      . GLU C 3 41 ? 23.797  -14.387 -2.313  1.00 3.00  ? 41 GLU A H      2  
ATOM 7531  H HA     . GLU C 3 41 ? 25.397  -12.302 -3.615  1.00 3.21  ? 41 GLU A HA     2  
ATOM 7532  H HB2    . GLU C 3 41 ? 23.986  -12.486 -5.639  1.00 2.99  ? 41 GLU A HB2    2  
ATOM 7533  H HB3    . GLU C 3 41 ? 24.955  -13.921 -5.350  1.00 3.57  ? 41 GLU A HB3    2  
ATOM 7534  H HG2    . GLU C 3 41 ? 23.089  -15.079 -5.649  1.00 3.17  ? 41 GLU A HG2    2  
ATOM 7535  H HG3    . GLU C 3 41 ? 22.580  -14.484 -4.071  1.00 2.71  ? 41 GLU A HG3    2  
ATOM 7536  N N      . LYS C 3 42 ? 22.971  -12.016 -1.847  1.00 2.46  ? 42 LYS A N      2  
ATOM 7537  C CA     . LYS C 3 42 ? 21.949  -11.164 -1.255  1.00 2.19  ? 42 LYS A CA     2  
ATOM 7538  C C      . LYS C 3 42 ? 22.378  -10.721 0.139   1.00 2.18  ? 42 LYS A C      2  
ATOM 7539  O O      . LYS C 3 42 ? 23.445  -11.104 0.618   1.00 2.40  ? 42 LYS A O      2  
ATOM 7540  C CB     . LYS C 3 42 ? 20.588  -11.880 -1.196  1.00 2.18  ? 42 LYS A CB     2  
ATOM 7541  C CG     . LYS C 3 42 ? 20.649  -13.330 -0.727  1.00 2.55  ? 42 LYS A CG     2  
ATOM 7542  C CD     . LYS C 3 42 ? 20.864  -14.283 -1.895  1.00 2.38  ? 42 LYS A CD     2  
ATOM 7543  C CE     . LYS C 3 42 ? 20.696  -15.734 -1.480  1.00 2.67  ? 42 LYS A CE     2  
ATOM 7544  N NZ     . LYS C 3 42 ? 20.893  -16.664 -2.625  1.00 2.91  ? 42 LYS A NZ     2  
ATOM 7545  H H      . LYS C 3 42 ? 23.384  -12.717 -1.294  1.00 2.65  ? 42 LYS A H      2  
ATOM 7546  H HA     . LYS C 3 42 ? 21.855  -10.287 -1.879  1.00 2.12  ? 42 LYS A HA     2  
ATOM 7547  H HB2    . LYS C 3 42 ? 19.945  -11.337 -0.520  1.00 2.34  ? 42 LYS A HB2    2  
ATOM 7548  H HB3    . LYS C 3 42 ? 20.147  -11.862 -2.182  1.00 2.28  ? 42 LYS A HB3    2  
ATOM 7549  H HG2    . LYS C 3 42 ? 21.469  -13.441 -0.034  1.00 2.96  ? 42 LYS A HG2    2  
ATOM 7550  H HG3    . LYS C 3 42 ? 19.721  -13.579 -0.234  1.00 3.17  ? 42 LYS A HG3    2  
ATOM 7551  H HD2    . LYS C 3 42 ? 20.148  -14.056 -2.670  1.00 2.81  ? 42 LYS A HD2    2  
ATOM 7552  H HD3    . LYS C 3 42 ? 21.862  -14.143 -2.276  1.00 2.34  ? 42 LYS A HD3    2  
ATOM 7553  H HE2    . LYS C 3 42 ? 21.418  -15.962 -0.714  1.00 2.79  ? 42 LYS A HE2    2  
ATOM 7554  H HE3    . LYS C 3 42 ? 19.700  -15.869 -1.085  1.00 3.18  ? 42 LYS A HE3    2  
ATOM 7555  H HZ1    . LYS C 3 42 ? 21.887  -16.632 -2.953  1.00 2.95  ? 42 LYS A HZ1    2  
ATOM 7556  H HZ2    . LYS C 3 42 ? 20.273  -16.399 -3.416  1.00 3.14  ? 42 LYS A HZ2    2  
ATOM 7557  H HZ3    . LYS C 3 42 ? 20.669  -17.639 -2.339  1.00 3.37  ? 42 LYS A HZ3    2  
ATOM 7558  N N      . ILE C 3 43 ? 21.553  -9.917  0.786   1.00 2.00  ? 43 ILE A N      2  
ATOM 7559  C CA     . ILE C 3 43 ? 21.867  -9.428  2.119   1.00 2.02  ? 43 ILE A CA     2  
ATOM 7560  C C      . ILE C 3 43 ? 20.759  -9.789  3.095   1.00 2.02  ? 43 ILE A C      2  
ATOM 7561  O O      . ILE C 3 43 ? 19.584  -9.806  2.735   1.00 1.94  ? 43 ILE A O      2  
ATOM 7562  C CB     . ILE C 3 43 ? 22.078  -7.897  2.138   1.00 1.95  ? 43 ILE A CB     2  
ATOM 7563  C CG1    . ILE C 3 43 ? 21.128  -7.213  1.154   1.00 1.91  ? 43 ILE A CG1    2  
ATOM 7564  C CG2    . ILE C 3 43 ? 23.520  -7.552  1.807   1.00 2.26  ? 43 ILE A CG2    2  
ATOM 7565  C CD1    . ILE C 3 43 ? 21.064  -5.711  1.306   1.00 1.91  ? 43 ILE A CD1    2  
ATOM 7566  H H      . ILE C 3 43 ? 20.702  -9.656  0.368   1.00 1.90  ? 43 ILE A H      2  
ATOM 7567  H HA     . ILE C 3 43 ? 22.784  -9.900  2.440   1.00 2.17  ? 43 ILE A HA     2  
ATOM 7568  H HB     . ILE C 3 43 ? 21.868  -7.540  3.136   1.00 2.11  ? 43 ILE A HB     2  
ATOM 7569  H HG12   . ILE C 3 43 ? 21.452  -7.425  0.147   1.00 2.12  ? 43 ILE A HG12   2  
ATOM 7570  H HG13   . ILE C 3 43 ? 20.133  -7.605  1.296   1.00 2.08  ? 43 ILE A HG13   2  
ATOM 7571  H HG21   . ILE C 3 43 ? 23.806  -8.032  0.882   1.00 2.57  ? 43 ILE A HG21   2  
ATOM 7572  H HG22   . ILE C 3 43 ? 24.163  -7.896  2.604   1.00 2.60  ? 43 ILE A HG22   2  
ATOM 7573  H HG23   . ILE C 3 43 ? 23.618  -6.482  1.703   1.00 2.52  ? 43 ILE A HG23   2  
ATOM 7574  H HD11   . ILE C 3 43 ? 20.664  -5.463  2.278   1.00 2.09  ? 43 ILE A HD11   2  
ATOM 7575  H HD12   . ILE C 3 43 ? 20.425  -5.300  0.538   1.00 2.07  ? 43 ILE A HD12   2  
ATOM 7576  H HD13   . ILE C 3 43 ? 22.056  -5.296  1.209   1.00 2.23  ? 43 ILE A HD13   2  
ATOM 7577  N N      . ILE C 3 44 ? 21.140  -10.100 4.319   1.00 2.17  ? 44 ILE A N      2  
ATOM 7578  C CA     . ILE C 3 44 ? 20.180  -10.455 5.349   1.00 2.25  ? 44 ILE A CA     2  
ATOM 7579  C C      . ILE C 3 44 ? 20.238  -9.453  6.494   1.00 2.25  ? 44 ILE A C      2  
ATOM 7580  O O      . ILE C 3 44 ? 21.261  -9.327  7.166   1.00 2.37  ? 44 ILE A O      2  
ATOM 7581  C CB     . ILE C 3 44 ? 20.435  -11.872 5.917   1.00 2.49  ? 44 ILE A CB     2  
ATOM 7582  C CG1    . ILE C 3 44 ? 20.549  -12.897 4.785   1.00 2.52  ? 44 ILE A CG1    2  
ATOM 7583  C CG2    . ILE C 3 44 ? 19.326  -12.272 6.882   1.00 2.65  ? 44 ILE A CG2    2  
ATOM 7584  C CD1    . ILE C 3 44 ? 20.928  -14.286 5.258   1.00 3.10  ? 44 ILE A CD1    2  
ATOM 7585  H H      . ILE C 3 44 ? 22.101  -10.089 4.541   1.00 2.27  ? 44 ILE A H      2  
ATOM 7586  H HA     . ILE C 3 44 ? 19.193  -10.434 4.909   1.00 2.19  ? 44 ILE A HA     2  
ATOM 7587  H HB     . ILE C 3 44 ? 21.364  -11.848 6.465   1.00 2.56  ? 44 ILE A HB     2  
ATOM 7588  H HG12   . ILE C 3 44 ? 19.600  -12.968 4.277   1.00 2.33  ? 44 ILE A HG12   2  
ATOM 7589  H HG13   . ILE C 3 44 ? 21.304  -12.567 4.085   1.00 2.50  ? 44 ILE A HG13   2  
ATOM 7590  H HG21   . ILE C 3 44 ? 18.385  -12.306 6.355   1.00 2.65  ? 44 ILE A HG21   2  
ATOM 7591  H HG22   . ILE C 3 44 ? 19.266  -11.548 7.680   1.00 3.05  ? 44 ILE A HG22   2  
ATOM 7592  H HG23   . ILE C 3 44 ? 19.544  -13.247 7.293   1.00 2.80  ? 44 ILE A HG23   2  
ATOM 7593  H HD11   . ILE C 3 44 ? 20.970  -14.954 4.412   1.00 3.42  ? 44 ILE A HD11   2  
ATOM 7594  H HD12   . ILE C 3 44 ? 20.188  -14.642 5.960   1.00 3.51  ? 44 ILE A HD12   2  
ATOM 7595  H HD13   . ILE C 3 44 ? 21.895  -14.254 5.738   1.00 3.28  ? 44 ILE A HD13   2  
ATOM 7596  N N      . LEU C 3 45 ? 19.148  -8.735  6.698   1.00 2.16  ? 45 LEU A N      2  
ATOM 7597  C CA     . LEU C 3 45 ? 19.064  -7.752  7.767   1.00 2.18  ? 45 LEU A CA     2  
ATOM 7598  C C      . LEU C 3 45 ? 18.427  -8.388  8.995   1.00 2.40  ? 45 LEU A C      2  
ATOM 7599  O O      . LEU C 3 45 ? 17.208  -8.543  9.071   1.00 2.44  ? 45 LEU A O      2  
ATOM 7600  C CB     . LEU C 3 45 ? 18.257  -6.527  7.317   1.00 2.04  ? 45 LEU A CB     2  
ATOM 7601  C CG     . LEU C 3 45 ? 19.047  -5.472  6.534   1.00 1.73  ? 45 LEU A CG     2  
ATOM 7602  C CD1    . LEU C 3 45 ? 19.207  -5.882  5.075   1.00 2.00  ? 45 LEU A CD1    2  
ATOM 7603  C CD2    . LEU C 3 45 ? 18.367  -4.114  6.635   1.00 2.05  ? 45 LEU A CD2    2  
ATOM 7604  H H      . LEU C 3 45 ? 18.365  -8.875  6.118   1.00 2.12  ? 45 LEU A H      2  
ATOM 7605  H HA     . LEU C 3 45 ? 20.067  -7.443  8.017   1.00 2.20  ? 45 LEU A HA     2  
ATOM 7606  H HB2    . LEU C 3 45 ? 17.444  -6.869  6.696   1.00 2.22  ? 45 LEU A HB2    2  
ATOM 7607  H HB3    . LEU C 3 45 ? 17.841  -6.052  8.193   1.00 2.29  ? 45 LEU A HB3    2  
ATOM 7608  H HG     . LEU C 3 45 ? 20.033  -5.382  6.964   1.00 1.92  ? 45 LEU A HG     2  
ATOM 7609  H HD11   . LEU C 3 45 ? 19.870  -5.188  4.576   1.00 2.58  ? 45 LEU A HD11   2  
ATOM 7610  H HD12   . LEU C 3 45 ? 18.241  -5.866  4.590   1.00 2.44  ? 45 LEU A HD12   2  
ATOM 7611  H HD13   . LEU C 3 45 ? 19.622  -6.877  5.023   1.00 2.03  ? 45 LEU A HD13   2  
ATOM 7612  H HD21   . LEU C 3 45 ? 18.950  -3.380  6.101   1.00 2.36  ? 45 LEU A HD21   2  
ATOM 7613  H HD22   . LEU C 3 45 ? 18.290  -3.827  7.672   1.00 2.44  ? 45 LEU A HD22   2  
ATOM 7614  H HD23   . LEU C 3 45 ? 17.379  -4.173  6.202   1.00 2.33  ? 45 LEU A HD23   2  
ATOM 7615  N N      . LYS C 3 46 ? 19.263  -8.788  9.938   1.00 2.58  ? 46 LYS A N      2  
ATOM 7616  C CA     . LYS C 3 46 ? 18.787  -9.424  11.156  1.00 2.82  ? 46 LYS A CA     2  
ATOM 7617  C C      . LYS C 3 46 ? 18.472  -8.386  12.224  1.00 2.81  ? 46 LYS A C      2  
ATOM 7618  O O      . LYS C 3 46 ? 19.204  -7.406  12.396  1.00 2.75  ? 46 LYS A O      2  
ATOM 7619  C CB     . LYS C 3 46 ? 19.824  -10.417 11.674  1.00 3.13  ? 46 LYS A CB     2  
ATOM 7620  C CG     . LYS C 3 46 ? 20.028  -11.609 10.750  1.00 3.35  ? 46 LYS A CG     2  
ATOM 7621  C CD     . LYS C 3 46 ? 21.431  -12.192 10.867  1.00 3.93  ? 46 LYS A CD     2  
ATOM 7622  C CE     . LYS C 3 46 ? 21.594  -13.044 12.118  1.00 4.67  ? 46 LYS A CE     2  
ATOM 7623  N NZ     . LYS C 3 46 ? 21.992  -12.238 13.302  1.00 5.39  ? 46 LYS A NZ     2  
ATOM 7624  H H      . LYS C 3 46 ? 20.227  -8.647  9.815   1.00 2.58  ? 46 LYS A H      2  
ATOM 7625  H HA     . LYS C 3 46 ? 17.880  -9.960  10.917  1.00 2.86  ? 46 LYS A HA     2  
ATOM 7626  H HB2    . LYS C 3 46 ? 20.769  -9.908  11.786  1.00 3.28  ? 46 LYS A HB2    2  
ATOM 7627  H HB3    . LYS C 3 46 ? 19.506  -10.785 12.638  1.00 3.44  ? 46 LYS A HB3    2  
ATOM 7628  H HG2    . LYS C 3 46 ? 19.311  -12.374 11.006  1.00 3.43  ? 46 LYS A HG2    2  
ATOM 7629  H HG3    . LYS C 3 46 ? 19.865  -11.290 9.732   1.00 3.46  ? 46 LYS A HG3    2  
ATOM 7630  H HD2    . LYS C 3 46 ? 21.625  -12.804 10.000  1.00 4.11  ? 46 LYS A HD2    2  
ATOM 7631  H HD3    . LYS C 3 46 ? 22.145  -11.380 10.901  1.00 4.05  ? 46 LYS A HD3    2  
ATOM 7632  H HE2    . LYS C 3 46 ? 20.654  -13.531 12.330  1.00 4.68  ? 46 LYS A HE2    2  
ATOM 7633  H HE3    . LYS C 3 46 ? 22.348  -13.792 11.931  1.00 5.02  ? 46 LYS A HE3    2  
ATOM 7634  H HZ1    . LYS C 3 46 ? 21.147  -11.896 13.798  1.00 5.69  ? 46 LYS A HZ1    2  
ATOM 7635  H HZ2    . LYS C 3 46 ? 22.561  -11.412 13.003  1.00 5.79  ? 46 LYS A HZ2    2  
ATOM 7636  H HZ3    . LYS C 3 46 ? 22.557  -12.815 13.955  1.00 5.54  ? 46 LYS A HZ3    2  
ATOM 7637  N N      . LYS C 3 47 ? 17.380  -8.608  12.932  1.00 2.96  ? 47 LYS A N      2  
ATOM 7638  C CA     . LYS C 3 47 ? 16.945  -7.708  13.982  1.00 3.04  ? 47 LYS A CA     2  
ATOM 7639  C C      . LYS C 3 47 ? 16.322  -8.500  15.124  1.00 3.03  ? 47 LYS A C      2  
ATOM 7640  O O      . LYS C 3 47 ? 16.422  -9.730  15.162  1.00 3.11  ? 47 LYS A O      2  
ATOM 7641  C CB     . LYS C 3 47 ? 15.940  -6.697  13.424  1.00 3.21  ? 47 LYS A CB     2  
ATOM 7642  C CG     . LYS C 3 47 ? 14.672  -7.330  12.862  1.00 3.01  ? 47 LYS A CG     2  
ATOM 7643  C CD     . LYS C 3 47 ? 13.708  -6.276  12.341  1.00 3.27  ? 47 LYS A CD     2  
ATOM 7644  C CE     . LYS C 3 47 ? 13.146  -5.421  13.466  1.00 3.39  ? 47 LYS A CE     2  
ATOM 7645  N NZ     . LYS C 3 47 ? 13.073  -3.988  13.082  1.00 4.14  ? 47 LYS A NZ     2  
ATOM 7646  H H      . LYS C 3 47 ? 16.842  -9.413  12.746  1.00 3.08  ? 47 LYS A H      2  
ATOM 7647  H HA     . LYS C 3 47 ? 17.812  -7.181  14.351  1.00 3.12  ? 47 LYS A HA     2  
ATOM 7648  H HB2    . LYS C 3 47 ? 15.655  -6.020  14.214  1.00 3.49  ? 47 LYS A HB2    2  
ATOM 7649  H HB3    . LYS C 3 47 ? 16.415  -6.134  12.635  1.00 3.60  ? 47 LYS A HB3    2  
ATOM 7650  H HG2    . LYS C 3 47 ? 14.940  -7.990  12.048  1.00 3.20  ? 47 LYS A HG2    2  
ATOM 7651  H HG3    . LYS C 3 47 ? 14.187  -7.896  13.642  1.00 2.96  ? 47 LYS A HG3    2  
ATOM 7652  H HD2    . LYS C 3 47 ? 14.233  -5.636  11.649  1.00 3.46  ? 47 LYS A HD2    2  
ATOM 7653  H HD3    . LYS C 3 47 ? 12.891  -6.766  11.831  1.00 3.71  ? 47 LYS A HD3    2  
ATOM 7654  H HE2    . LYS C 3 47 ? 12.154  -5.771  13.704  1.00 3.29  ? 47 LYS A HE2    2  
ATOM 7655  H HE3    . LYS C 3 47 ? 13.781  -5.521  14.333  1.00 3.58  ? 47 LYS A HE3    2  
ATOM 7656  H HZ1    . LYS C 3 47 ? 12.126  -3.763  12.708  1.00 4.42  ? 47 LYS A HZ1    2  
ATOM 7657  H HZ2    . LYS C 3 47 ? 13.784  -3.773  12.358  1.00 4.42  ? 47 LYS A HZ2    2  
ATOM 7658  H HZ3    . LYS C 3 47 ? 13.257  -3.383  13.919  1.00 4.58  ? 47 LYS A HZ3    2  
ATOM 7659  N N      . TYR C 3 48 ? 15.686  -7.800  16.052  1.00 3.23  ? 48 TYR A N      2  
ATOM 7660  C CA     . TYR C 3 48 ? 15.038  -8.451  17.180  1.00 3.41  ? 48 TYR A CA     2  
ATOM 7661  C C      . TYR C 3 48 ? 13.525  -8.384  17.024  1.00 3.51  ? 48 TYR A C      2  
ATOM 7662  O O      . TYR C 3 48 ? 12.994  -7.442  16.428  1.00 4.04  ? 48 TYR A O      2  
ATOM 7663  C CB     . TYR C 3 48 ? 15.474  -7.813  18.510  1.00 3.76  ? 48 TYR A CB     2  
ATOM 7664  C CG     . TYR C 3 48 ? 14.710  -6.561  18.903  1.00 3.76  ? 48 TYR A CG     2  
ATOM 7665  C CD1    . TYR C 3 48 ? 14.966  -5.341  18.284  1.00 4.27  ? 48 TYR A CD1    2  
ATOM 7666  C CD2    . TYR C 3 48 ? 13.725  -6.601  19.883  1.00 3.81  ? 48 TYR A CD2    2  
ATOM 7667  C CE1    . TYR C 3 48 ? 14.262  -4.203  18.631  1.00 4.75  ? 48 TYR A CE1    2  
ATOM 7668  C CE2    . TYR C 3 48 ? 13.020  -5.466  20.236  1.00 4.24  ? 48 TYR A CE2    2  
ATOM 7669  C CZ     . TYR C 3 48 ? 13.324  -4.262  19.644  1.00 4.67  ? 48 TYR A CZ     2  
ATOM 7670  O OH     . TYR C 3 48 ? 12.585  -3.139  19.949  1.00 5.42  ? 48 TYR A OH     2  
ATOM 7671  H H      . TYR C 3 48 ? 15.646  -6.824  15.974  1.00 3.46  ? 48 TYR A H      2  
ATOM 7672  H HA     . TYR C 3 48 ? 15.338  -9.489  17.173  1.00 3.41  ? 48 TYR A HA     2  
ATOM 7673  H HB2    . TYR C 3 48 ? 15.344  -8.533  19.301  1.00 4.02  ? 48 TYR A HB2    2  
ATOM 7674  H HB3    . TYR C 3 48 ? 16.520  -7.552  18.443  1.00 4.13  ? 48 TYR A HB3    2  
ATOM 7675  H HD1    . TYR C 3 48 ? 15.727  -5.290  17.520  1.00 4.60  ? 48 TYR A HD1    2  
ATOM 7676  H HD2    . TYR C 3 48 ? 13.514  -7.537  20.374  1.00 3.88  ? 48 TYR A HD2    2  
ATOM 7677  H HE1    . TYR C 3 48 ? 14.476  -3.265  18.139  1.00 5.42  ? 48 TYR A HE1    2  
ATOM 7678  H HE2    . TYR C 3 48 ? 12.260  -5.520  21.000  1.00 4.54  ? 48 TYR A HE2    2  
ATOM 7679  H HH     . TYR C 3 48 ? 12.331  -2.670  19.145  1.00 5.69  ? 48 TYR A HH     2  
ATOM 7680  N N      . LYS C 3 49 ? 12.839  -9.387  17.541  1.00 3.27  ? 49 LYS A N      2  
ATOM 7681  C CA     . LYS C 3 49 ? 11.390  -9.429  17.467  1.00 3.48  ? 49 LYS A CA     2  
ATOM 7682  C C      . LYS C 3 49 ? 10.794  -9.181  18.851  1.00 3.56  ? 49 LYS A C      2  
ATOM 7683  O O      . LYS C 3 49 ? 10.885  -10.032 19.738  1.00 3.61  ? 49 LYS A O      2  
ATOM 7684  C CB     . LYS C 3 49 ? 10.907  -10.769 16.886  1.00 3.58  ? 49 LYS A CB     2  
ATOM 7685  C CG     . LYS C 3 49 ? 11.532  -11.998 17.535  1.00 3.53  ? 49 LYS A CG     2  
ATOM 7686  C CD     . LYS C 3 49 ? 11.176  -13.271 16.781  1.00 3.56  ? 49 LYS A CD     2  
ATOM 7687  C CE     . LYS C 3 49 ? 11.717  -14.507 17.483  1.00 4.05  ? 49 LYS A CE     2  
ATOM 7688  N NZ     . LYS C 3 49 ? 11.834  -15.665 16.558  1.00 4.54  ? 49 LYS A NZ     2  
ATOM 7689  H H      . LYS C 3 49 ? 13.322  -10.116 17.991  1.00 3.15  ? 49 LYS A H      2  
ATOM 7690  H HA     . LYS C 3 49 ? 11.077  -8.631  16.811  1.00 3.85  ? 49 LYS A HA     2  
ATOM 7691  H HB2    . LYS C 3 49 ? 9.837   -10.833 17.007  1.00 4.12  ? 49 LYS A HB2    2  
ATOM 7692  H HB3    . LYS C 3 49 ? 11.141  -10.789 15.831  1.00 3.68  ? 49 LYS A HB3    2  
ATOM 7693  H HG2    . LYS C 3 49 ? 12.604  -11.884 17.540  1.00 3.85  ? 49 LYS A HG2    2  
ATOM 7694  H HG3    . LYS C 3 49 ? 11.173  -12.078 18.550  1.00 3.72  ? 49 LYS A HG3    2  
ATOM 7695  H HD2    . LYS C 3 49 ? 10.101  -13.349 16.715  1.00 3.80  ? 49 LYS A HD2    2  
ATOM 7696  H HD3    . LYS C 3 49 ? 11.596  -13.217 15.788  1.00 3.60  ? 49 LYS A HD3    2  
ATOM 7697  H HE2    . LYS C 3 49 ? 12.692  -14.279 17.885  1.00 4.22  ? 49 LYS A HE2    2  
ATOM 7698  H HE3    . LYS C 3 49 ? 11.048  -14.767 18.290  1.00 4.36  ? 49 LYS A HE3    2  
ATOM 7699  H HZ1    . LYS C 3 49 ? 12.130  -16.513 17.082  1.00 4.73  ? 49 LYS A HZ1    2  
ATOM 7700  H HZ2    . LYS C 3 49 ? 12.544  -15.462 15.818  1.00 4.54  ? 49 LYS A HZ2    2  
ATOM 7701  H HZ3    . LYS C 3 49 ? 10.918  -15.854 16.101  1.00 5.07  ? 49 LYS A HZ3    2  
ATOM 7702  N N      . PRO C 3 50 ? 10.196  -7.997  19.061  1.00 3.93  ? 50 PRO A N      2  
ATOM 7703  C CA     . PRO C 3 50 ? 9.605   -7.630  20.352  1.00 4.32  ? 50 PRO A CA     2  
ATOM 7704  C C      . PRO C 3 50 ? 8.433   -8.527  20.742  1.00 4.44  ? 50 PRO A C      2  
ATOM 7705  O O      . PRO C 3 50 ? 8.293   -8.909  21.902  1.00 4.67  ? 50 PRO A O      2  
ATOM 7706  C CB     . PRO C 3 50 ? 9.128   -6.188  20.142  1.00 5.02  ? 50 PRO A CB     2  
ATOM 7707  C CG     . PRO C 3 50 ? 9.015   -6.021  18.666  1.00 4.95  ? 50 PRO A CG     2  
ATOM 7708  C CD     . PRO C 3 50 ? 10.056  -6.918  18.063  1.00 4.35  ? 50 PRO A CD     2  
ATOM 7709  H HA     . PRO C 3 50 ? 10.345  -7.653  21.138  1.00 4.33  ? 50 PRO A HA     2  
ATOM 7710  H HB2    . PRO C 3 50 ? 8.174   -6.050  20.626  1.00 5.51  ? 50 PRO A HB2    2  
ATOM 7711  H HB3    . PRO C 3 50 ? 9.851   -5.506  20.560  1.00 5.30  ? 50 PRO A HB3    2  
ATOM 7712  H HG2    . PRO C 3 50 ? 8.028   -6.316  18.339  1.00 5.33  ? 50 PRO A HG2    2  
ATOM 7713  H HG3    . PRO C 3 50 ? 9.206   -4.992  18.399  1.00 5.17  ? 50 PRO A HG3    2  
ATOM 7714  H HD2    . PRO C 3 50 ? 9.714   -7.307  17.115  1.00 4.52  ? 50 PRO A HD2    2  
ATOM 7715  H HD3    . PRO C 3 50 ? 10.987  -6.384  17.940  1.00 4.31  ? 50 PRO A HD3    2  
ATOM 7716  N N      . ASN C 3 51 ? 7.610   -8.877  19.767  1.00 4.53  ? 51 ASN A N      2  
ATOM 7717  C CA     . ASN C 3 51 ? 6.449   -9.718  20.021  1.00 4.92  ? 51 ASN A CA     2  
ATOM 7718  C C      . ASN C 3 51 ? 6.602   -11.074 19.341  1.00 4.67  ? 51 ASN A C      2  
ATOM 7719  O O      . ASN C 3 51 ? 6.562   -11.179 18.114  1.00 5.06  ? 51 ASN A O      2  
ATOM 7720  C CB     . ASN C 3 51 ? 5.168   -9.025  19.541  1.00 5.53  ? 51 ASN A CB     2  
ATOM 7721  C CG     . ASN C 3 51 ? 3.899   -9.684  20.066  1.00 6.17  ? 51 ASN A CG     2  
ATOM 7722  O OD1    . ASN C 3 51 ? 3.854   -10.890 20.302  1.00 6.38  ? 51 ASN A OD1    2  
ATOM 7723  N ND2    . ASN C 3 51 ? 2.855   -8.892  20.244  1.00 6.68  ? 51 ASN A ND2    2  
ATOM 7724  H H      . ASN C 3 51 ? 7.797   -8.577  18.854  1.00 4.51  ? 51 ASN A H      2  
ATOM 7725  H HA     . ASN C 3 51 ? 6.385   -9.869  21.087  1.00 5.22  ? 51 ASN A HA     2  
ATOM 7726  H HB2    . ASN C 3 51 ? 5.177   -7.998  19.872  1.00 5.79  ? 51 ASN A HB2    2  
ATOM 7727  H HB3    . ASN C 3 51 ? 5.142   -9.049  18.462  1.00 5.42  ? 51 ASN A HB3    2  
ATOM 7728  H HD21   . ASN C 3 51 ? 2.955   -7.938  20.028  1.00 6.71  ? 51 ASN A HD21   2  
ATOM 7729  H HD22   . ASN C 3 51 ? 2.024   -9.285  20.586  1.00 7.13  ? 51 ASN A HD22   2  
ATOM 7730  N N      . MET C 3 52 ? 6.790   -12.106 20.151  1.00 4.34  ? 52 MET A N      2  
ATOM 7731  C CA     . MET C 3 52 ? 6.931   -13.468 19.650  1.00 4.46  ? 52 MET A CA     2  
ATOM 7732  C C      . MET C 3 52 ? 5.704   -14.290 20.032  1.00 4.21  ? 52 MET A C      2  
ATOM 7733  O O      . MET C 3 52 ? 5.602   -15.475 19.709  1.00 4.29  ? 52 MET A O      2  
ATOM 7734  C CB     . MET C 3 52 ? 8.200   -14.121 20.208  1.00 4.75  ? 52 MET A CB     2  
ATOM 7735  C CG     . MET C 3 52 ? 8.604   -15.397 19.480  1.00 5.28  ? 52 MET A CG     2  
ATOM 7736  S SD     . MET C 3 52 ? 10.017  -16.225 20.244  1.00 5.49  ? 52 MET A SD     2  
ATOM 7737  C CE     . MET C 3 52 ? 9.254   -16.902 21.720  1.00 6.47  ? 52 MET A CE     2  
ATOM 7738  H H      . MET C 3 52 ? 6.841   -11.947 21.120  1.00 4.28  ? 52 MET A H      2  
ATOM 7739  H HA     . MET C 3 52 ? 6.998   -13.422 18.575  1.00 4.84  ? 52 MET A HA     2  
ATOM 7740  H HB2    . MET C 3 52 ? 9.016   -13.417 20.132  1.00 4.93  ? 52 MET A HB2    2  
ATOM 7741  H HB3    . MET C 3 52 ? 8.038   -14.360 21.248  1.00 4.78  ? 52 MET A HB3    2  
ATOM 7742  H HG2    . MET C 3 52 ? 7.764   -16.077 19.477  1.00 5.58  ? 52 MET A HG2    2  
ATOM 7743  H HG3    . MET C 3 52 ? 8.860   -15.144 18.463  1.00 5.57  ? 52 MET A HG3    2  
ATOM 7744  H HE1    . MET C 3 52 ? 8.471   -17.590 21.439  1.00 6.78  ? 52 MET A HE1    2  
ATOM 7745  H HE2    . MET C 3 52 ? 8.833   -16.100 22.310  1.00 6.77  ? 52 MET A HE2    2  
ATOM 7746  H HE3    . MET C 3 52 ? 10.001  -17.424 22.299  1.00 6.78  ? 52 MET A HE3    2  
ATOM 7747  N N      . THR C 3 53 ? 4.764   -13.647 20.705  1.00 4.22  ? 53 THR A N      2  
ATOM 7748  C CA     . THR C 3 53 ? 3.543   -14.299 21.142  1.00 4.28  ? 53 THR A CA     2  
ATOM 7749  C C      . THR C 3 53 ? 2.459   -14.198 20.070  1.00 3.69  ? 53 THR A C      2  
ATOM 7750  O O      . THR C 3 53 ? 1.286   -13.984 20.377  1.00 3.33  ? 53 THR A O      2  
ATOM 7751  C CB     . THR C 3 53 ? 3.040   -13.672 22.455  1.00 5.06  ? 53 THR A CB     2  
ATOM 7752  O OG1    . THR C 3 53 ? 3.416   -12.287 22.508  1.00 5.43  ? 53 THR A OG1    2  
ATOM 7753  C CG2    . THR C 3 53 ? 3.616   -14.399 23.662  1.00 5.77  ? 53 THR A CG2    2  
ATOM 7754  H H      . THR C 3 53 ? 4.892   -12.694 20.910  1.00 4.41  ? 53 THR A H      2  
ATOM 7755  H HA     . THR C 3 53 ? 3.763   -15.341 21.321  1.00 4.47  ? 53 THR A HA     2  
ATOM 7756  H HB     . THR C 3 53 ? 1.961   -13.747 22.487  1.00 5.19  ? 53 THR A HB     2  
ATOM 7757  H HG1    . THR C 3 53 ? 3.107   -11.841 21.704  1.00 5.53  ? 53 THR A HG1    2  
ATOM 7758  H HG21   . THR C 3 53 ? 3.311   -13.894 24.565  1.00 5.72  ? 53 THR A HG21   2  
ATOM 7759  H HG22   . THR C 3 53 ? 4.694   -14.404 23.599  1.00 6.49  ? 53 THR A HG22   2  
ATOM 7760  H HG23   . THR C 3 53 ? 3.252   -15.415 23.678  1.00 5.90  ? 53 THR A HG23   2  
ATOM 7761  N N      . CYS C 3 54 ? 2.876   -14.368 18.816  1.00 3.94  ? 54 CYS A N      2  
ATOM 7762  C CA     . CYS C 3 54 ? 1.980   -14.303 17.667  1.00 3.75  ? 54 CYS A CA     2  
ATOM 7763  C C      . CYS C 3 54 ? 1.451   -12.887 17.468  1.00 4.01  ? 54 CYS A C      2  
ATOM 7764  O O      . CYS C 3 54 ? 0.397   -12.519 17.990  1.00 4.55  ? 54 CYS A O      2  
ATOM 7765  C CB     . CYS C 3 54 ? 0.818   -15.293 17.817  1.00 4.03  ? 54 CYS A CB     2  
ATOM 7766  S SG     . CYS C 3 54 ? -0.225  -15.440 16.328  1.00 4.29  ? 54 CYS A SG     2  
ATOM 7767  H H      . CYS C 3 54 ? 3.825   -14.546 18.658  1.00 4.46  ? 54 CYS A H      2  
ATOM 7768  H HA     . CYS C 3 54 ? 2.554   -14.576 16.794  1.00 3.73  ? 54 CYS A HA     2  
ATOM 7769  H HB2    . CYS C 3 54 ? 1.215   -16.272 18.038  1.00 4.57  ? 54 CYS A HB2    2  
ATOM 7770  H HB3    . CYS C 3 54 ? 0.186   -14.975 18.633  1.00 3.99  ? 54 CYS A HB3    2  
ATOM 7771  N N      . GLN C 3 55 ? 2.204   -12.089 16.730  1.00 4.10  ? 55 GLN A N      2  
ATOM 7772  C CA     . GLN C 3 55 ? 1.810   -10.715 16.455  1.00 4.86  ? 55 GLN A CA     2  
ATOM 7773  C C      . GLN C 3 55 ? 1.151   -10.622 15.086  1.00 5.60  ? 55 GLN A C      2  
ATOM 7774  O O      . GLN C 3 55 ? 1.420   -11.447 14.207  1.00 5.68  ? 55 GLN A O      2  
ATOM 7775  C CB     . GLN C 3 55 ? 3.021   -9.783  16.516  1.00 5.19  ? 55 GLN A CB     2  
ATOM 7776  C CG     . GLN C 3 55 ? 2.668   -8.318  16.302  1.00 5.83  ? 55 GLN A CG     2  
ATOM 7777  C CD     . GLN C 3 55 ? 3.842   -7.385  16.527  1.00 6.33  ? 55 GLN A CD     2  
ATOM 7778  O OE1    . GLN C 3 55 ? 4.997   -7.745  16.293  1.00 6.58  ? 55 GLN A OE1    2  
ATOM 7779  N NE2    . GLN C 3 55 ? 3.552   -6.178  16.983  1.00 6.80  ? 55 GLN A NE2    2  
ATOM 7780  H H      . GLN C 3 55 ? 3.049   -12.430 16.364  1.00 3.96  ? 55 GLN A H      2  
ATOM 7781  H HA     . GLN C 3 55 ? 1.097   -10.417 17.209  1.00 5.13  ? 55 GLN A HA     2  
ATOM 7782  H HB2    . GLN C 3 55 ? 3.489   -9.882  17.484  1.00 4.96  ? 55 GLN A HB2    2  
ATOM 7783  H HB3    . GLN C 3 55 ? 3.728   -10.076 15.754  1.00 5.65  ? 55 GLN A HB3    2  
ATOM 7784  H HG2    . GLN C 3 55 ? 2.321   -8.191  15.287  1.00 6.14  ? 55 GLN A HG2    2  
ATOM 7785  H HG3    . GLN C 3 55 ? 1.876   -8.049  16.985  1.00 6.01  ? 55 GLN A HG3    2  
ATOM 7786  H HE21   . GLN C 3 55 ? 2.608   -5.957  17.147  1.00 6.82  ? 55 GLN A HE21   2  
ATOM 7787  H HE22   . GLN C 3 55 ? 4.288   -5.551  17.132  1.00 7.28  ? 55 GLN A HE22   2  
ATOM 7788  N N      . MET D 3 1  ? 37.036  -1.437  2.216   1.00 7.62  ? 1  MET B N      2  
ATOM 7789  C CA     . MET D 3 1  ? 36.005  -1.471  1.190   1.00 7.52  ? 1  MET B CA     2  
ATOM 7790  C C      . MET D 3 1  ? 35.286  -2.818  1.196   1.00 6.95  ? 1  MET B C      2  
ATOM 7791  O O      . MET D 3 1  ? 35.869  -3.837  1.581   1.00 7.17  ? 1  MET B O      2  
ATOM 7792  C CB     . MET D 3 1  ? 36.622  -1.210  -0.188  1.00 7.80  ? 1  MET B CB     2  
ATOM 7793  C CG     . MET D 3 1  ? 35.600  -0.875  -1.263  1.00 8.70  ? 1  MET B CG     2  
ATOM 7794  S SD     . MET D 3 1  ? 36.332  -0.718  -2.904  1.00 9.39  ? 1  MET B SD     2  
ATOM 7795  C CE     . MET D 3 1  ? 34.912  -0.178  -3.854  1.00 10.28 ? 1  MET B CE     2  
ATOM 7796  H H1     . MET D 3 1  ? 37.734  -2.130  2.210   1.00 7.71  ? 1  MET B H1     2  
ATOM 7797  H HA     . MET D 3 1  ? 35.293  -0.692  1.410   1.00 7.92  ? 1  MET B HA     2  
ATOM 7798  H HB2    . MET D 3 1  ? 37.314  -0.383  -0.112  1.00 7.78  ? 1  MET B HB2    2  
ATOM 7799  H HB3    . MET D 3 1  ? 37.164  -2.093  -0.498  1.00 7.57  ? 1  MET B HB3    2  
ATOM 7800  H HG2    . MET D 3 1  ? 34.858  -1.661  -1.292  1.00 8.80  ? 1  MET B HG2    2  
ATOM 7801  H HG3    . MET D 3 1  ? 35.121  0.057   -1.006  1.00 9.08  ? 1  MET B HG3    2  
ATOM 7802  H HE1    . MET D 3 1  ? 34.539  0.752   -3.449  1.00 10.55 ? 1  MET B HE1    2  
ATOM 7803  H HE2    . MET D 3 1  ? 34.136  -0.929  -3.805  1.00 10.27 ? 1  MET B HE2    2  
ATOM 7804  H HE3    . MET D 3 1  ? 35.204  -0.030  -4.883  1.00 10.76 ? 1  MET B HE3    2  
ATOM 7805  N N      . LYS D 3 2  ? 34.021  -2.803  0.778   1.00 6.47  ? 2  LYS B N      2  
ATOM 7806  C CA     . LYS D 3 2  ? 33.192  -4.003  0.717   1.00 6.17  ? 2  LYS B CA     2  
ATOM 7807  C C      . LYS D 3 2  ? 33.036  -4.642  2.092   1.00 5.73  ? 2  LYS B C      2  
ATOM 7808  O O      . LYS D 3 2  ? 33.799  -5.530  2.469   1.00 5.67  ? 2  LYS B O      2  
ATOM 7809  C CB     . LYS D 3 2  ? 33.773  -5.011  -0.275  1.00 6.23  ? 2  LYS B CB     2  
ATOM 7810  C CG     . LYS D 3 2  ? 33.472  -4.671  -1.720  1.00 6.85  ? 2  LYS B CG     2  
ATOM 7811  C CD     . LYS D 3 2  ? 34.161  -5.632  -2.671  1.00 7.29  ? 2  LYS B CD     2  
ATOM 7812  C CE     . LYS D 3 2  ? 33.591  -5.527  -4.072  1.00 8.14  ? 2  LYS B CE     2  
ATOM 7813  N NZ     . LYS D 3 2  ? 34.365  -6.340  -5.043  1.00 9.03  ? 2  LYS B NZ     2  
ATOM 7814  H H      . LYS D 3 2  ? 33.623  -1.940  0.500   1.00 6.51  ? 2  LYS B H      2  
ATOM 7815  H HA     . LYS D 3 2  ? 32.216  -3.702  0.369   1.00 6.56  ? 2  LYS B HA     2  
ATOM 7816  H HB2    . LYS D 3 2  ? 34.845  -5.045  -0.150  1.00 6.03  ? 2  LYS B HB2    2  
ATOM 7817  H HB3    . LYS D 3 2  ? 33.365  -5.988  -0.063  1.00 6.37  ? 2  LYS B HB3    2  
ATOM 7818  H HG2    . LYS D 3 2  ? 32.406  -4.722  -1.878  1.00 7.04  ? 2  LYS B HG2    2  
ATOM 7819  H HG3    . LYS D 3 2  ? 33.820  -3.668  -1.921  1.00 7.11  ? 2  LYS B HG3    2  
ATOM 7820  H HD2    . LYS D 3 2  ? 35.215  -5.402  -2.703  1.00 7.37  ? 2  LYS B HD2    2  
ATOM 7821  H HD3    . LYS D 3 2  ? 34.022  -6.642  -2.310  1.00 7.21  ? 2  LYS B HD3    2  
ATOM 7822  H HE2    . LYS D 3 2  ? 32.569  -5.874  -4.061  1.00 8.28  ? 2  LYS B HE2    2  
ATOM 7823  H HE3    . LYS D 3 2  ? 33.616  -4.492  -4.381  1.00 8.16  ? 2  LYS B HE3    2  
ATOM 7824  H HZ1    . LYS D 3 2  ? 33.876  -6.359  -5.960  1.00 9.42  ? 2  LYS B HZ1    2  
ATOM 7825  H HZ2    . LYS D 3 2  ? 34.461  -7.317  -4.694  1.00 9.37  ? 2  LYS B HZ2    2  
ATOM 7826  H HZ3    . LYS D 3 2  ? 35.312  -5.934  -5.173  1.00 9.16  ? 2  LYS B HZ3    2  
ATOM 7827  N N      . SER D 3 3  ? 32.047  -4.180  2.841   1.00 5.70  ? 3  SER B N      2  
ATOM 7828  C CA     . SER D 3 3  ? 31.792  -4.704  4.171   1.00 5.49  ? 3  SER B CA     2  
ATOM 7829  C C      . SER D 3 3  ? 30.968  -5.989  4.094   1.00 4.85  ? 3  SER B C      2  
ATOM 7830  O O      . SER D 3 3  ? 30.023  -6.087  3.306   1.00 4.85  ? 3  SER B O      2  
ATOM 7831  C CB     . SER D 3 3  ? 31.060  -3.656  5.010   1.00 5.99  ? 3  SER B CB     2  
ATOM 7832  O OG     . SER D 3 3  ? 31.525  -2.349  4.712   1.00 6.58  ? 3  SER B OG     2  
ATOM 7833  H H      . SER D 3 3  ? 31.468  -3.475  2.486   1.00 6.01  ? 3  SER B H      2  
ATOM 7834  H HA     . SER D 3 3  ? 32.744  -4.924  4.629   1.00 5.74  ? 3  SER B HA     2  
ATOM 7835  H HB2    . SER D 3 3  ? 30.001  -3.703  4.801   1.00 6.04  ? 3  SER B HB2    2  
ATOM 7836  H HB3    . SER D 3 3  ? 31.230  -3.852  6.059   1.00 6.12  ? 3  SER B HB3    2  
ATOM 7837  H HG     . SER D 3 3  ? 32.329  -2.405  4.174   1.00 6.91  ? 3  SER B HG     2  
ATOM 7838  N N      . THR D 3 4  ? 31.339  -6.974  4.903   1.00 4.64  ? 4  THR B N      2  
ATOM 7839  C CA     . THR D 3 4  ? 30.636  -8.247  4.941   1.00 4.40  ? 4  THR B CA     2  
ATOM 7840  C C      . THR D 3 4  ? 29.394  -8.142  5.828   1.00 4.10  ? 4  THR B C      2  
ATOM 7841  O O      . THR D 3 4  ? 28.401  -8.844  5.624   1.00 4.57  ? 4  THR B O      2  
ATOM 7842  C CB     . THR D 3 4  ? 31.563  -9.360  5.473   1.00 4.92  ? 4  THR B CB     2  
ATOM 7843  O OG1    . THR D 3 4  ? 32.905  -9.126  5.022   1.00 5.34  ? 4  THR B OG1    2  
ATOM 7844  C CG2    . THR D 3 4  ? 31.105  -10.729 4.998   1.00 5.32  ? 4  THR B CG2    2  
ATOM 7845  H H      . THR D 3 4  ? 32.113  -6.842  5.492   1.00 4.91  ? 4  THR B H      2  
ATOM 7846  H HA     . THR D 3 4  ? 30.337  -8.498  3.935   1.00 4.48  ? 4  THR B HA     2  
ATOM 7847  H HB     . THR D 3 4  ? 31.544  -9.344  6.551   1.00 5.11  ? 4  THR B HB     2  
ATOM 7848  H HG1    . THR D 3 4  ? 33.525  -9.541  5.636   1.00 5.76  ? 4  THR B HG1    2  
ATOM 7849  H HG21   . THR D 3 4  ? 31.324  -10.840 3.946   1.00 5.51  ? 4  THR B HG21   2  
ATOM 7850  H HG22   . THR D 3 4  ? 30.041  -10.828 5.155   1.00 5.83  ? 4  THR B HG22   2  
ATOM 7851  H HG23   . THR D 3 4  ? 31.623  -11.496 5.556   1.00 5.27  ? 4  THR B HG23   2  
ATOM 7852  N N      . GLY D 3 5  ? 29.459  -7.247  6.805   1.00 3.71  ? 5  GLY B N      2  
ATOM 7853  C CA     . GLY D 3 5  ? 28.346  -7.044  7.712   1.00 3.67  ? 5  GLY B CA     2  
ATOM 7854  C C      . GLY D 3 5  ? 28.411  -5.680  8.361   1.00 3.66  ? 5  GLY B C      2  
ATOM 7855  O O      . GLY D 3 5  ? 29.417  -5.339  8.985   1.00 4.11  ? 5  GLY B O      2  
ATOM 7856  H H      . GLY D 3 5  ? 30.275  -6.710  6.909   1.00 3.74  ? 5  GLY B H      2  
ATOM 7857  H HA2    . GLY D 3 5  ? 27.418  -7.130  7.165   1.00 3.73  ? 5  GLY B HA2    2  
ATOM 7858  H HA3    . GLY D 3 5  ? 28.374  -7.800  8.481   1.00 3.88  ? 5  GLY B HA3    2  
ATOM 7859  N N      . ILE D 3 6  ? 27.355  -4.897  8.212   1.00 3.28  ? 6  ILE B N      2  
ATOM 7860  C CA     . ILE D 3 6  ? 27.318  -3.561  8.786   1.00 3.42  ? 6  ILE B CA     2  
ATOM 7861  C C      . ILE D 3 6  ? 25.992  -3.306  9.501   1.00 3.07  ? 6  ILE B C      2  
ATOM 7862  O O      . ILE D 3 6  ? 24.917  -3.490  8.930   1.00 2.86  ? 6  ILE B O      2  
ATOM 7863  C CB     . ILE D 3 6  ? 27.555  -2.483  7.699   1.00 3.65  ? 6  ILE B CB     2  
ATOM 7864  C CG1    . ILE D 3 6  ? 27.324  -1.077  8.258   1.00 3.79  ? 6  ILE B CG1    2  
ATOM 7865  C CG2    . ILE D 3 6  ? 26.659  -2.722  6.491   1.00 3.94  ? 6  ILE B CG2    2  
ATOM 7866  C CD1    . ILE D 3 6  ? 28.445  -0.581  9.142   1.00 4.25  ? 6  ILE B CD1    2  
ATOM 7867  H H      . ILE D 3 6  ? 26.575  -5.228  7.710   1.00 3.01  ? 6  ILE B H      2  
ATOM 7868  H HA     . ILE D 3 6  ? 28.119  -3.492  9.509   1.00 3.82  ? 6  ILE B HA     2  
ATOM 7869  H HB     . ILE D 3 6  ? 28.582  -2.566  7.370   1.00 4.03  ? 6  ILE B HB     2  
ATOM 7870  H HG12   . ILE D 3 6  ? 27.219  -0.383  7.438   1.00 3.94  ? 6  ILE B HG12   2  
ATOM 7871  H HG13   . ILE D 3 6  ? 26.416  -1.076  8.843   1.00 3.89  ? 6  ILE B HG13   2  
ATOM 7872  H HG21   . ILE D 3 6  ? 26.882  -1.991  5.727   1.00 4.47  ? 6  ILE B HG21   2  
ATOM 7873  H HG22   . ILE D 3 6  ? 25.624  -2.628  6.786   1.00 3.96  ? 6  ILE B HG22   2  
ATOM 7874  H HG23   . ILE D 3 6  ? 26.833  -3.715  6.101   1.00 4.07  ? 6  ILE B HG23   2  
ATOM 7875  H HD11   . ILE D 3 6  ? 29.320  -0.388  8.541   1.00 4.18  ? 6  ILE B HD11   2  
ATOM 7876  H HD12   . ILE D 3 6  ? 28.677  -1.329  9.887   1.00 4.44  ? 6  ILE B HD12   2  
ATOM 7877  H HD13   . ILE D 3 6  ? 28.136  0.329   9.631   1.00 4.85  ? 6  ILE B HD13   2  
ATOM 7878  N N      . VAL D 3 7  ? 26.076  -2.899  10.761  1.00 3.14  ? 7  VAL B N      2  
ATOM 7879  C CA     . VAL D 3 7  ? 24.887  -2.613  11.551  1.00 2.90  ? 7  VAL B CA     2  
ATOM 7880  C C      . VAL D 3 7  ? 24.564  -1.132  11.474  1.00 2.74  ? 7  VAL B C      2  
ATOM 7881  O O      . VAL D 3 7  ? 25.428  -0.294  11.726  1.00 2.98  ? 7  VAL B O      2  
ATOM 7882  C CB     . VAL D 3 7  ? 25.060  -3.020  13.032  1.00 3.05  ? 7  VAL B CB     2  
ATOM 7883  C CG1    . VAL D 3 7  ? 23.723  -2.967  13.763  1.00 3.30  ? 7  VAL B CG1    2  
ATOM 7884  C CG2    . VAL D 3 7  ? 25.678  -4.405  13.142  1.00 3.32  ? 7  VAL B CG2    2  
ATOM 7885  H H      . VAL D 3 7  ? 26.961  -2.774  11.167  1.00 3.45  ? 7  VAL B H      2  
ATOM 7886  H HA     . VAL D 3 7  ? 24.064  -3.172  11.133  1.00 2.79  ? 7  VAL B HA     2  
ATOM 7887  H HB     . VAL D 3 7  ? 25.728  -2.313  13.502  1.00 3.28  ? 7  VAL B HB     2  
ATOM 7888  H HG11   . VAL D 3 7  ? 23.829  -3.412  14.739  1.00 3.45  ? 7  VAL B HG11   2  
ATOM 7889  H HG12   . VAL D 3 7  ? 22.980  -3.511  13.196  1.00 3.39  ? 7  VAL B HG12   2  
ATOM 7890  H HG13   . VAL D 3 7  ? 23.410  -1.937  13.869  1.00 3.82  ? 7  VAL B HG13   2  
ATOM 7891  H HG21   . VAL D 3 7  ? 26.753  -4.327  13.070  1.00 4.04  ? 7  VAL B HG21   2  
ATOM 7892  H HG22   . VAL D 3 7  ? 25.310  -5.026  12.338  1.00 3.26  ? 7  VAL B HG22   2  
ATOM 7893  H HG23   . VAL D 3 7  ? 25.409  -4.846  14.089  1.00 3.43  ? 7  VAL B HG23   2  
ATOM 7894  N N      . ARG D 3 8  ? 23.332  -0.808  11.115  1.00 2.47  ? 8  ARG B N      2  
ATOM 7895  C CA     . ARG D 3 8  ? 22.924  0.585   10.995  1.00 2.41  ? 8  ARG B CA     2  
ATOM 7896  C C      . ARG D 3 8  ? 21.611  0.847   11.717  1.00 2.19  ? 8  ARG B C      2  
ATOM 7897  O O      . ARG D 3 8  ? 20.759  -0.035  11.827  1.00 2.12  ? 8  ARG B O      2  
ATOM 7898  C CB     . ARG D 3 8  ? 22.808  0.978   9.522   1.00 2.58  ? 8  ARG B CB     2  
ATOM 7899  C CG     . ARG D 3 8  ? 24.155  1.184   8.855   1.00 2.91  ? 8  ARG B CG     2  
ATOM 7900  C CD     . ARG D 3 8  ? 24.019  1.486   7.374   1.00 3.08  ? 8  ARG B CD     2  
ATOM 7901  N NE     . ARG D 3 8  ? 25.301  1.892   6.796   1.00 3.51  ? 8  ARG B NE     2  
ATOM 7902  C CZ     . ARG D 3 8  ? 25.806  1.404   5.667   1.00 3.91  ? 8  ARG B CZ     2  
ATOM 7903  N NH1    . ARG D 3 8  ? 25.088  0.588   4.907   1.00 4.06  ? 8  ARG B NH1    2  
ATOM 7904  N NH2    . ARG D 3 8  ? 27.020  1.768   5.278   1.00 4.47  ? 8  ARG B NH2    2  
ATOM 7905  H H      . ARG D 3 8  ? 22.676  -1.523  10.937  1.00 2.43  ? 8  ARG B H      2  
ATOM 7906  H HA     . ARG D 3 8  ? 23.691  1.188   11.454  1.00 2.53  ? 8  ARG B HA     2  
ATOM 7907  H HB2    . ARG D 3 8  ? 22.282  0.199   8.990   1.00 2.62  ? 8  ARG B HB2    2  
ATOM 7908  H HB3    . ARG D 3 8  ? 22.248  1.897   9.448   1.00 2.79  ? 8  ARG B HB3    2  
ATOM 7909  H HG2    . ARG D 3 8  ? 24.662  2.007   9.334   1.00 3.08  ? 8  ARG B HG2    2  
ATOM 7910  H HG3    . ARG D 3 8  ? 24.739  0.284   8.975   1.00 3.40  ? 8  ARG B HG3    2  
ATOM 7911  H HD2    . ARG D 3 8  ? 23.667  0.599   6.868   1.00 3.51  ? 8  ARG B HD2    2  
ATOM 7912  H HD3    . ARG D 3 8  ? 23.303  2.284   7.244   1.00 2.92  ? 8  ARG B HD3    2  
ATOM 7913  H HE     . ARG D 3 8  ? 25.832  2.547   7.304   1.00 3.74  ? 8  ARG B HE     2  
ATOM 7914  H HH11   . ARG D 3 8  ? 24.154  0.338   5.175   1.00 3.86  ? 8  ARG B HH11   2  
ATOM 7915  H HH12   . ARG D 3 8  ? 25.482  0.211   4.066   1.00 4.57  ? 8  ARG B HH12   2  
ATOM 7916  H HH21   . ARG D 3 8  ? 27.555  2.412   5.835   1.00 4.64  ? 8  ARG B HH21   2  
ATOM 7917  H HH22   . ARG D 3 8  ? 27.416  1.399   4.433   1.00 4.88  ? 8  ARG B HH22   2  
ATOM 7918  N N      . LYS D 3 9  ? 21.465  2.066   12.216  1.00 2.21  ? 9  LYS B N      2  
ATOM 7919  C CA     . LYS D 3 9  ? 20.265  2.469   12.933  1.00 2.17  ? 9  LYS B CA     2  
ATOM 7920  C C      . LYS D 3 9  ? 19.338  3.252   12.016  1.00 2.30  ? 9  LYS B C      2  
ATOM 7921  O O      . LYS D 3 9  ? 19.794  4.061   11.208  1.00 2.44  ? 9  LYS B O      2  
ATOM 7922  C CB     . LYS D 3 9  ? 20.630  3.326   14.151  1.00 2.23  ? 9  LYS B CB     2  
ATOM 7923  C CG     . LYS D 3 9  ? 21.646  4.420   13.848  1.00 2.61  ? 9  LYS B CG     2  
ATOM 7924  C CD     . LYS D 3 9  ? 21.591  5.544   14.872  1.00 2.83  ? 9  LYS B CD     2  
ATOM 7925  C CE     . LYS D 3 9  ? 20.784  6.730   14.359  1.00 3.20  ? 9  LYS B CE     2  
ATOM 7926  N NZ     . LYS D 3 9  ? 21.520  7.504   13.319  1.00 3.40  ? 9  LYS B NZ     2  
ATOM 7927  H H      . LYS D 3 9  ? 22.188  2.721   12.087  1.00 2.33  ? 9  LYS B H      2  
ATOM 7928  H HA     . LYS D 3 9  ? 19.758  1.576   13.267  1.00 2.16  ? 9  LYS B HA     2  
ATOM 7929  H HB2    . LYS D 3 9  ? 19.733  3.795   14.526  1.00 2.40  ? 9  LYS B HB2    2  
ATOM 7930  H HB3    . LYS D 3 9  ? 21.039  2.685   14.920  1.00 2.23  ? 9  LYS B HB3    2  
ATOM 7931  H HG2    . LYS D 3 9  ? 22.636  3.989   13.857  1.00 3.07  ? 9  LYS B HG2    2  
ATOM 7932  H HG3    . LYS D 3 9  ? 21.438  4.827   12.870  1.00 2.94  ? 9  LYS B HG3    2  
ATOM 7933  H HD2    . LYS D 3 9  ? 21.132  5.173   15.774  1.00 2.93  ? 9  LYS B HD2    2  
ATOM 7934  H HD3    . LYS D 3 9  ? 22.598  5.871   15.085  1.00 3.25  ? 9  LYS B HD3    2  
ATOM 7935  H HE2    . LYS D 3 9  ? 19.862  6.364   13.933  1.00 3.40  ? 9  LYS B HE2    2  
ATOM 7936  H HE3    . LYS D 3 9  ? 20.563  7.382   15.190  1.00 3.61  ? 9  LYS B HE3    2  
ATOM 7937  H HZ1    . LYS D 3 9  ? 22.370  7.942   13.730  1.00 3.62  ? 9  LYS B HZ1    2  
ATOM 7938  H HZ2    . LYS D 3 9  ? 20.915  8.256   12.934  1.00 3.49  ? 9  LYS B HZ2    2  
ATOM 7939  H HZ3    . LYS D 3 9  ? 21.809  6.880   12.539  1.00 3.60  ? 9  LYS B HZ3    2  
ATOM 7940  N N      . VAL D 3 10 ? 18.042  3.006   12.136  1.00 2.38  ? 10 VAL B N      2  
ATOM 7941  C CA     . VAL D 3 10 ? 17.063  3.703   11.313  1.00 2.63  ? 10 VAL B CA     2  
ATOM 7942  C C      . VAL D 3 10 ? 16.571  4.965   12.007  1.00 2.70  ? 10 VAL B C      2  
ATOM 7943  O O      . VAL D 3 10 ? 16.965  5.262   13.140  1.00 2.95  ? 10 VAL B O      2  
ATOM 7944  C CB     . VAL D 3 10 ? 15.846  2.813   10.981  1.00 2.83  ? 10 VAL B CB     2  
ATOM 7945  C CG1    . VAL D 3 10 ? 16.268  1.609   10.155  1.00 3.48  ? 10 VAL B CG1    2  
ATOM 7946  C CG2    . VAL D 3 10 ? 15.137  2.378   12.253  1.00 3.16  ? 10 VAL B CG2    2  
ATOM 7947  H H      . VAL D 3 10 ? 17.734  2.339   12.792  1.00 2.37  ? 10 VAL B H      2  
ATOM 7948  H HA     . VAL D 3 10 ? 17.544  3.983   10.387  1.00 2.83  ? 10 VAL B HA     2  
ATOM 7949  H HB     . VAL D 3 10 ? 15.153  3.394   10.392  1.00 2.91  ? 10 VAL B HB     2  
ATOM 7950  H HG11   . VAL D 3 10 ? 17.187  1.207   10.551  1.00 4.11  ? 10 VAL B HG11   2  
ATOM 7951  H HG12   . VAL D 3 10 ? 16.415  1.911   9.131   1.00 3.75  ? 10 VAL B HG12   2  
ATOM 7952  H HG13   . VAL D 3 10 ? 15.496  0.856   10.200  1.00 3.62  ? 10 VAL B HG13   2  
ATOM 7953  H HG21   . VAL D 3 10 ? 14.825  3.251   12.807  1.00 3.65  ? 10 VAL B HG21   2  
ATOM 7954  H HG22   . VAL D 3 10 ? 15.813  1.792   12.856  1.00 3.30  ? 10 VAL B HG22   2  
ATOM 7955  H HG23   . VAL D 3 10 ? 14.271  1.783   12.000  1.00 3.41  ? 10 VAL B HG23   2  
ATOM 7956  N N      . ASP D 3 11 ? 15.713  5.703   11.322  1.00 2.72  ? 11 ASP B N      2  
ATOM 7957  C CA     . ASP D 3 11 ? 15.153  6.930   11.862  1.00 2.95  ? 11 ASP B CA     2  
ATOM 7958  C C      . ASP D 3 11 ? 13.770  6.662   12.451  1.00 2.65  ? 11 ASP B C      2  
ATOM 7959  O O      . ASP D 3 11 ? 13.419  5.512   12.722  1.00 2.94  ? 11 ASP B O      2  
ATOM 7960  C CB     . ASP D 3 11 ? 15.085  8.010   10.774  1.00 3.34  ? 11 ASP B CB     2  
ATOM 7961  C CG     . ASP D 3 11 ? 13.947  7.806   9.790   1.00 3.95  ? 11 ASP B CG     2  
ATOM 7962  O OD1    . ASP D 3 11 ? 13.684  6.649   9.395   1.00 4.19  ? 11 ASP B OD1    2  
ATOM 7963  O OD2    . ASP D 3 11 ? 13.308  8.810   9.409   1.00 4.52  ? 11 ASP B OD2    2  
ATOM 7964  H H      . ASP D 3 11 ? 15.440  5.413   10.426  1.00 2.74  ? 11 ASP B H      2  
ATOM 7965  H HA     . ASP D 3 11 ? 15.806  7.269   12.651  1.00 3.29  ? 11 ASP B HA     2  
ATOM 7966  H HB2    . ASP D 3 11 ? 14.952  8.971   11.246  1.00 3.51  ? 11 ASP B HB2    2  
ATOM 7967  H HB3    . ASP D 3 11 ? 16.014  8.013   10.224  1.00 3.48  ? 11 ASP B HB3    2  
ATOM 7968  N N      . GLU D 3 12 ? 12.981  7.715   12.637  1.00 2.56  ? 12 GLU B N      2  
ATOM 7969  C CA     . GLU D 3 12 ? 11.645  7.581   13.210  1.00 2.40  ? 12 GLU B CA     2  
ATOM 7970  C C      . GLU D 3 12 ? 10.651  6.954   12.232  1.00 2.08  ? 12 GLU B C      2  
ATOM 7971  O O      . GLU D 3 12 ? 9.538   6.596   12.620  1.00 2.31  ? 12 GLU B O      2  
ATOM 7972  C CB     . GLU D 3 12 ? 11.130  8.944   13.675  1.00 2.96  ? 12 GLU B CB     2  
ATOM 7973  C CG     . GLU D 3 12 ? 11.419  9.229   15.138  1.00 3.22  ? 12 GLU B CG     2  
ATOM 7974  C CD     . GLU D 3 12 ? 10.948  8.113   16.045  1.00 4.14  ? 12 GLU B CD     2  
ATOM 7975  O OE1    . GLU D 3 12 ? 9.728   8.012   16.280  1.00 4.45  ? 12 GLU B OE1    2  
ATOM 7976  O OE2    . GLU D 3 12 ? 11.796  7.337   16.535  1.00 4.89  ? 12 GLU B OE2    2  
ATOM 7977  H H      . GLU D 3 12 ? 13.307  8.606   12.389  1.00 2.92  ? 12 GLU B H      2  
ATOM 7978  H HA     . GLU D 3 12 ? 11.728  6.935   14.071  1.00 2.45  ? 12 GLU B HA     2  
ATOM 7979  H HB2    . GLU D 3 12 ? 11.597  9.716   13.082  1.00 3.25  ? 12 GLU B HB2    2  
ATOM 7980  H HB3    . GLU D 3 12 ? 10.060  8.984   13.526  1.00 3.21  ? 12 GLU B HB3    2  
ATOM 7981  H HG2    . GLU D 3 12 ? 12.486  9.349   15.264  1.00 3.52  ? 12 GLU B HG2    2  
ATOM 7982  H HG3    . GLU D 3 12 ? 10.919  10.143  15.420  1.00 2.98  ? 12 GLU B HG3    2  
ATOM 7983  N N      . LEU D 3 13 ? 11.033  6.831   10.971  1.00 2.05  ? 13 LEU B N      2  
ATOM 7984  C CA     . LEU D 3 13 ? 10.148  6.236   9.982   1.00 2.22  ? 13 LEU B CA     2  
ATOM 7985  C C      . LEU D 3 13 ? 10.557  4.801   9.678   1.00 2.08  ? 13 LEU B C      2  
ATOM 7986  O O      . LEU D 3 13 ? 9.703   3.924   9.512   1.00 2.31  ? 13 LEU B O      2  
ATOM 7987  C CB     . LEU D 3 13 ? 10.120  7.068   8.700   1.00 2.93  ? 13 LEU B CB     2  
ATOM 7988  C CG     . LEU D 3 13 ? 8.984   8.095   8.614   1.00 3.33  ? 13 LEU B CG     2  
ATOM 7989  C CD1    . LEU D 3 13 ? 7.629   7.412   8.728   1.00 3.43  ? 13 LEU B CD1    2  
ATOM 7990  C CD2    . LEU D 3 13 ? 9.132   9.158   9.690   1.00 3.82  ? 13 LEU B CD2    2  
ATOM 7991  H H      . LEU D 3 13 ? 11.922  7.144   10.700  1.00 2.28  ? 13 LEU B H      2  
ATOM 7992  H HA     . LEU D 3 13 ? 9.155   6.221   10.405  1.00 2.35  ? 13 LEU B HA     2  
ATOM 7993  H HB2    . LEU D 3 13 ? 11.060  7.594   8.618   1.00 3.17  ? 13 LEU B HB2    2  
ATOM 7994  H HB3    . LEU D 3 13 ? 10.030  6.394   7.861   1.00 3.33  ? 13 LEU B HB3    2  
ATOM 7995  H HG     . LEU D 3 13 ? 9.027   8.587   7.652   1.00 3.80  ? 13 LEU B HG     2  
ATOM 7996  H HD11   . LEU D 3 13 ? 6.859   8.087   8.387   1.00 3.86  ? 13 LEU B HD11   2  
ATOM 7997  H HD12   . LEU D 3 13 ? 7.446   7.152   9.759   1.00 3.47  ? 13 LEU B HD12   2  
ATOM 7998  H HD13   . LEU D 3 13 ? 7.622   6.519   8.122   1.00 3.59  ? 13 LEU B HD13   2  
ATOM 7999  H HD21   . LEU D 3 13 ? 8.270   9.809   9.674   1.00 4.06  ? 13 LEU B HD21   2  
ATOM 8000  H HD22   . LEU D 3 13 ? 10.025  9.737   9.504   1.00 4.23  ? 13 LEU B HD22   2  
ATOM 8001  H HD23   . LEU D 3 13 ? 9.207   8.683   10.656  1.00 4.00  ? 13 LEU B HD23   2  
ATOM 8002  N N      . GLY D 3 14 ? 11.859  4.564   9.597   1.00 2.28  ? 14 GLY B N      2  
ATOM 8003  C CA     . GLY D 3 14 ? 12.346  3.226   9.335   1.00 2.47  ? 14 GLY B CA     2  
ATOM 8004  C C      . GLY D 3 14 ? 13.002  3.089   7.976   1.00 2.30  ? 14 GLY B C      2  
ATOM 8005  O O      . GLY D 3 14 ? 12.744  2.125   7.252   1.00 2.70  ? 14 GLY B O      2  
ATOM 8006  H H      . GLY D 3 14 ? 12.497  5.310   9.710   1.00 2.63  ? 14 GLY B H      2  
ATOM 8007  H HA2    . GLY D 3 14 ? 13.066  2.963   10.094  1.00 2.68  ? 14 GLY B HA2    2  
ATOM 8008  H HA3    . GLY D 3 14 ? 11.515  2.538   9.392   1.00 2.75  ? 14 GLY B HA3    2  
ATOM 8009  N N      . ARG D 3 15 ? 13.842  4.053   7.624   1.00 1.98  ? 15 ARG B N      2  
ATOM 8010  C CA     . ARG D 3 15 ? 14.546  4.023   6.343   1.00 1.99  ? 15 ARG B CA     2  
ATOM 8011  C C      . ARG D 3 15 ? 16.058  3.980   6.559   1.00 1.92  ? 15 ARG B C      2  
ATOM 8012  O O      . ARG D 3 15 ? 16.613  4.795   7.299   1.00 2.13  ? 15 ARG B O      2  
ATOM 8013  C CB     . ARG D 3 15 ? 14.151  5.233   5.489   1.00 2.07  ? 15 ARG B CB     2  
ATOM 8014  C CG     . ARG D 3 15 ? 14.132  6.551   6.252   1.00 2.75  ? 15 ARG B CG     2  
ATOM 8015  C CD     . ARG D 3 15 ? 12.979  7.443   5.814   1.00 2.68  ? 15 ARG B CD     2  
ATOM 8016  N NE     . ARG D 3 15 ? 12.654  8.447   6.826   1.00 2.84  ? 15 ARG B NE     2  
ATOM 8017  C CZ     . ARG D 3 15 ? 11.809  9.461   6.650   1.00 3.25  ? 15 ARG B CZ     2  
ATOM 8018  N NH1    . ARG D 3 15 ? 11.202  9.643   5.482   1.00 3.51  ? 15 ARG B NH1    2  
ATOM 8019  N NH2    . ARG D 3 15 ? 11.574  10.292  7.653   1.00 3.78  ? 15 ARG B NH2    2  
ATOM 8020  H H      . ARG D 3 15 ? 13.997  4.803   8.238   1.00 1.97  ? 15 ARG B H      2  
ATOM 8021  H HA     . ARG D 3 15 ? 14.247  3.121   5.828   1.00 2.31  ? 15 ARG B HA     2  
ATOM 8022  H HB2    . ARG D 3 15 ? 14.853  5.325   4.675   1.00 1.97  ? 15 ARG B HB2    2  
ATOM 8023  H HB3    . ARG D 3 15 ? 13.164  5.064   5.082   1.00 2.31  ? 15 ARG B HB3    2  
ATOM 8024  H HG2    . ARG D 3 15 ? 14.032  6.345   7.306   1.00 3.33  ? 15 ARG B HG2    2  
ATOM 8025  H HG3    . ARG D 3 15 ? 15.063  7.070   6.075   1.00 3.14  ? 15 ARG B HG3    2  
ATOM 8026  H HD2    . ARG D 3 15 ? 13.255  7.947   4.899   1.00 3.11  ? 15 ARG B HD2    2  
ATOM 8027  H HD3    . ARG D 3 15 ? 12.107  6.830   5.638   1.00 2.62  ? 15 ARG B HD3    2  
ATOM 8028  H HE     . ARG D 3 15 ? 13.090  8.349   7.715   1.00 3.01  ? 15 ARG B HE     2  
ATOM 8029  H HH11   . ARG D 3 15 ? 11.375  9.021   4.721   1.00 3.46  ? 15 ARG B HH11   2  
ATOM 8030  H HH12   . ARG D 3 15 ? 10.555  10.404  5.366   1.00 3.99  ? 15 ARG B HH12   2  
ATOM 8031  H HH21   . ARG D 3 15 ? 12.034  10.151  8.537   1.00 3.95  ? 15 ARG B HH21   2  
ATOM 8032  H HH22   . ARG D 3 15 ? 10.935  11.060  7.543   1.00 4.22  ? 15 ARG B HH22   2  
ATOM 8033  N N      . VAL D 3 16 ? 16.722  3.027   5.913   1.00 1.76  ? 16 VAL B N      2  
ATOM 8034  C CA     . VAL D 3 16 ? 18.164  2.869   6.054   1.00 1.84  ? 16 VAL B CA     2  
ATOM 8035  C C      . VAL D 3 16 ? 18.835  2.627   4.696   1.00 1.47  ? 16 VAL B C      2  
ATOM 8036  O O      . VAL D 3 16 ? 18.164  2.363   3.694   1.00 1.17  ? 16 VAL B O      2  
ATOM 8037  C CB     . VAL D 3 16 ? 18.492  1.707   7.031   1.00 2.17  ? 16 VAL B CB     2  
ATOM 8038  C CG1    . VAL D 3 16 ? 18.224  0.351   6.388   1.00 1.98  ? 16 VAL B CG1    2  
ATOM 8039  C CG2    . VAL D 3 16 ? 19.927  1.793   7.534   1.00 3.00  ? 16 VAL B CG2    2  
ATOM 8040  H H      . VAL D 3 16 ? 16.230  2.408   5.325   1.00 1.69  ? 16 VAL B H      2  
ATOM 8041  H HA     . VAL D 3 16 ? 18.556  3.784   6.476   1.00 2.16  ? 16 VAL B HA     2  
ATOM 8042  H HB     . VAL D 3 16 ? 17.839  1.799   7.883   1.00 2.57  ? 16 VAL B HB     2  
ATOM 8043  H HG11   . VAL D 3 16 ? 17.181  0.282   6.112   1.00 2.19  ? 16 VAL B HG11   2  
ATOM 8044  H HG12   . VAL D 3 16 ? 18.463  -0.436  7.089   1.00 2.06  ? 16 VAL B HG12   2  
ATOM 8045  H HG13   . VAL D 3 16 ? 18.836  0.246   5.506   1.00 2.41  ? 16 VAL B HG13   2  
ATOM 8046  H HG21   . VAL D 3 16 ? 20.608  1.609   6.715   1.00 3.32  ? 16 VAL B HG21   2  
ATOM 8047  H HG22   . VAL D 3 16 ? 20.085  1.051   8.304   1.00 3.50  ? 16 VAL B HG22   2  
ATOM 8048  H HG23   . VAL D 3 16 ? 20.108  2.777   7.941   1.00 3.34  ? 16 VAL B HG23   2  
ATOM 8049  N N      . VAL D 3 17 ? 20.161  2.748   4.678   1.00 1.69  ? 17 VAL B N      2  
ATOM 8050  C CA     . VAL D 3 17 ? 20.951  2.548   3.473   1.00 1.67  ? 17 VAL B CA     2  
ATOM 8051  C C      . VAL D 3 17 ? 21.742  1.239   3.558   1.00 1.60  ? 17 VAL B C      2  
ATOM 8052  O O      . VAL D 3 17 ? 22.244  0.873   4.625   1.00 1.68  ? 17 VAL B O      2  
ATOM 8053  C CB     . VAL D 3 17 ? 21.930  3.727   3.265   1.00 2.19  ? 17 VAL B CB     2  
ATOM 8054  C CG1    . VAL D 3 17 ? 22.817  3.502   2.048   1.00 2.26  ? 17 VAL B CG1    2  
ATOM 8055  C CG2    . VAL D 3 17 ? 21.164  5.035   3.137   1.00 2.91  ? 17 VAL B CG2    2  
ATOM 8056  H H      . VAL D 3 17 ? 20.622  2.980   5.507   1.00 2.00  ? 17 VAL B H      2  
ATOM 8057  H HA     . VAL D 3 17 ? 20.278  2.506   2.628   1.00 1.51  ? 17 VAL B HA     2  
ATOM 8058  H HB     . VAL D 3 17 ? 22.564  3.794   4.135   1.00 2.65  ? 17 VAL B HB     2  
ATOM 8059  H HG11   . VAL D 3 17 ? 22.199  3.292   1.187   1.00 2.62  ? 17 VAL B HG11   2  
ATOM 8060  H HG12   . VAL D 3 17 ? 23.476  2.666   2.231   1.00 2.46  ? 17 VAL B HG12   2  
ATOM 8061  H HG13   . VAL D 3 17 ? 23.403  4.389   1.860   1.00 2.52  ? 17 VAL B HG13   2  
ATOM 8062  H HG21   . VAL D 3 17 ? 21.862  5.857   3.077   1.00 3.46  ? 17 VAL B HG21   2  
ATOM 8063  H HG22   . VAL D 3 17 ? 20.525  5.168   3.997   1.00 3.01  ? 17 VAL B HG22   2  
ATOM 8064  H HG23   . VAL D 3 17 ? 20.561  5.013   2.241   1.00 3.36  ? 17 VAL B HG23   2  
ATOM 8065  N N      . ILE D 3 18 ? 21.837  0.538   2.436   1.00 1.68  ? 18 ILE B N      2  
ATOM 8066  C CA     . ILE D 3 18 ? 22.569  -0.724  2.360   1.00 1.70  ? 18 ILE B CA     2  
ATOM 8067  C C      . ILE D 3 18 ? 23.857  -0.545  1.556   1.00 1.87  ? 18 ILE B C      2  
ATOM 8068  O O      . ILE D 3 18 ? 24.070  0.517   0.977   1.00 2.02  ? 18 ILE B O      2  
ATOM 8069  C CB     . ILE D 3 18 ? 21.711  -1.825  1.705   1.00 1.81  ? 18 ILE B CB     2  
ATOM 8070  C CG1    . ILE D 3 18 ? 20.971  -1.268  0.483   1.00 2.02  ? 18 ILE B CG1    2  
ATOM 8071  C CG2    . ILE D 3 18 ? 20.747  -2.407  2.724   1.00 2.44  ? 18 ILE B CG2    2  
ATOM 8072  C CD1    . ILE D 3 18 ? 20.437  -2.337  -0.448  1.00 2.41  ? 18 ILE B CD1    2  
ATOM 8073  H H      . ILE D 3 18 ? 21.409  0.884   1.625   1.00 1.85  ? 18 ILE B H      2  
ATOM 8074  H HA     . ILE D 3 18 ? 22.817  -1.031  3.366   1.00 1.70  ? 18 ILE B HA     2  
ATOM 8075  H HB     . ILE D 3 18 ? 22.371  -2.616  1.384   1.00 2.23  ? 18 ILE B HB     2  
ATOM 8076  H HG12   . ILE D 3 18 ? 20.135  -0.673  0.817   1.00 2.41  ? 18 ILE B HG12   2  
ATOM 8077  H HG13   . ILE D 3 18 ? 21.648  -0.643  -0.083  1.00 2.38  ? 18 ILE B HG13   2  
ATOM 8078  H HG21   . ILE D 3 18 ? 21.294  -3.015  3.430   1.00 2.67  ? 18 ILE B HG21   2  
ATOM 8079  H HG22   . ILE D 3 18 ? 20.013  -3.017  2.219   1.00 2.85  ? 18 ILE B HG22   2  
ATOM 8080  H HG23   . ILE D 3 18 ? 20.252  -1.603  3.249   1.00 2.95  ? 18 ILE B HG23   2  
ATOM 8081  H HD11   . ILE D 3 18 ? 19.955  -1.870  -1.293  1.00 2.77  ? 18 ILE B HD11   2  
ATOM 8082  H HD12   . ILE D 3 18 ? 19.722  -2.952  0.080   1.00 2.68  ? 18 ILE B HD12   2  
ATOM 8083  H HD13   . ILE D 3 18 ? 21.254  -2.952  -0.795  1.00 2.74  ? 18 ILE B HD13   2  
ATOM 8084  N N      . PRO D 3 19 ? 24.748  -1.563  1.532   1.00 2.00  ? 19 PRO B N      2  
ATOM 8085  C CA     . PRO D 3 19 ? 26.006  -1.491  0.776   1.00 2.32  ? 19 PRO B CA     2  
ATOM 8086  C C      . PRO D 3 19 ? 25.770  -1.244  -0.712  1.00 2.55  ? 19 PRO B C      2  
ATOM 8087  O O      . PRO D 3 19 ? 25.400  -2.152  -1.459  1.00 2.57  ? 19 PRO B O      2  
ATOM 8088  C CB     . PRO D 3 19 ? 26.642  -2.871  0.992   1.00 2.38  ? 19 PRO B CB     2  
ATOM 8089  C CG     . PRO D 3 19 ? 26.012  -3.397  2.233   1.00 2.18  ? 19 PRO B CG     2  
ATOM 8090  C CD     . PRO D 3 19 ? 24.617  -2.846  2.248   1.00 1.95  ? 19 PRO B CD     2  
ATOM 8091  H HA     . PRO D 3 19 ? 26.657  -0.725  1.168   1.00 2.47  ? 19 PRO B HA     2  
ATOM 8092  H HB2    . PRO D 3 19 ? 26.426  -3.502  0.143   1.00 2.48  ? 19 PRO B HB2    2  
ATOM 8093  H HB3    . PRO D 3 19 ? 27.710  -2.765  1.106   1.00 2.61  ? 19 PRO B HB3    2  
ATOM 8094  H HG2    . PRO D 3 19 ? 25.988  -4.475  2.204   1.00 2.22  ? 19 PRO B HG2    2  
ATOM 8095  H HG3    . PRO D 3 19 ? 26.558  -3.055  3.100   1.00 2.31  ? 19 PRO B HG3    2  
ATOM 8096  H HD2    . PRO D 3 19 ? 23.948  -3.512  1.725   1.00 1.87  ? 19 PRO B HD2    2  
ATOM 8097  H HD3    . PRO D 3 19 ? 24.284  -2.689  3.262   1.00 1.93  ? 19 PRO B HD3    2  
ATOM 8098  N N      . ILE D 3 20 ? 25.998  -0.011  -1.141  1.00 2.83  ? 20 ILE B N      2  
ATOM 8099  C CA     . ILE D 3 20 ? 25.795  0.366   -2.530  1.00 3.18  ? 20 ILE B CA     2  
ATOM 8100  C C      . ILE D 3 20 ? 27.055  0.145   -3.366  1.00 3.16  ? 20 ILE B C      2  
ATOM 8101  O O      . ILE D 3 20 ? 27.055  0.390   -4.572  1.00 3.19  ? 20 ILE B O      2  
ATOM 8102  C CB     . ILE D 3 20 ? 25.335  1.834   -2.656  1.00 3.64  ? 20 ILE B CB     2  
ATOM 8103  C CG1    . ILE D 3 20 ? 26.362  2.781   -2.035  1.00 3.46  ? 20 ILE B CG1    2  
ATOM 8104  C CG2    . ILE D 3 20 ? 23.970  2.018   -2.003  1.00 4.28  ? 20 ILE B CG2    2  
ATOM 8105  C CD1    . ILE D 3 20 ? 27.003  3.711   -3.038  1.00 4.11  ? 20 ILE B CD1    2  
ATOM 8106  H H      . ILE D 3 20 ? 26.306  0.665   -0.500  1.00 2.87  ? 20 ILE B H      2  
ATOM 8107  H HA     . ILE D 3 20 ? 25.011  -0.264  -2.926  1.00 3.27  ? 20 ILE B HA     2  
ATOM 8108  H HB     . ILE D 3 20 ? 25.232  2.064   -3.706  1.00 4.11  ? 20 ILE B HB     2  
ATOM 8109  H HG12   . ILE D 3 20 ? 25.877  3.389   -1.288  1.00 3.48  ? 20 ILE B HG12   2  
ATOM 8110  H HG13   . ILE D 3 20 ? 27.145  2.202   -1.569  1.00 3.32  ? 20 ILE B HG13   2  
ATOM 8111  H HG21   . ILE D 3 20 ? 23.999  1.636   -0.992  1.00 4.27  ? 20 ILE B HG21   2  
ATOM 8112  H HG22   . ILE D 3 20 ? 23.224  1.480   -2.569  1.00 4.81  ? 20 ILE B HG22   2  
ATOM 8113  H HG23   . ILE D 3 20 ? 23.718  3.068   -1.984  1.00 4.65  ? 20 ILE B HG23   2  
ATOM 8114  H HD11   . ILE D 3 20 ? 27.661  4.395   -2.524  1.00 4.24  ? 20 ILE B HD11   2  
ATOM 8115  H HD12   . ILE D 3 20 ? 26.234  4.267   -3.552  1.00 4.33  ? 20 ILE B HD12   2  
ATOM 8116  H HD13   . ILE D 3 20 ? 27.570  3.135   -3.752  1.00 4.58  ? 20 ILE B HD13   2  
ATOM 8117  N N      . GLU D 3 21 ? 28.128  -0.310  -2.726  1.00 3.20  ? 21 GLU B N      2  
ATOM 8118  C CA     . GLU D 3 21 ? 29.378  -0.585  -3.433  1.00 3.27  ? 21 GLU B CA     2  
ATOM 8119  C C      . GLU D 3 21 ? 29.139  -1.613  -4.538  1.00 3.10  ? 21 GLU B C      2  
ATOM 8120  O O      . GLU D 3 21 ? 29.786  -1.587  -5.587  1.00 3.21  ? 21 GLU B O      2  
ATOM 8121  C CB     . GLU D 3 21 ? 30.447  -1.099  -2.464  1.00 3.38  ? 21 GLU B CB     2  
ATOM 8122  C CG     . GLU D 3 21 ? 31.140  -0.001  -1.671  1.00 3.76  ? 21 GLU B CG     2  
ATOM 8123  C CD     . GLU D 3 21 ? 31.546  -0.461  -0.287  1.00 4.28  ? 21 GLU B CD     2  
ATOM 8124  O OE1    . GLU D 3 21 ? 30.647  -0.731  0.532   1.00 4.52  ? 21 GLU B OE1    2  
ATOM 8125  O OE2    . GLU D 3 21 ? 32.753  -0.562  -0.008  1.00 4.74  ? 21 GLU B OE2    2  
ATOM 8126  H H      . GLU D 3 21 ? 28.085  -0.439  -1.752  1.00 3.24  ? 21 GLU B H      2  
ATOM 8127  H HA     . GLU D 3 21 ? 29.719  0.338   -3.878  1.00 3.47  ? 21 GLU B HA     2  
ATOM 8128  H HB2    . GLU D 3 21 ? 29.985  -1.780  -1.765  1.00 3.06  ? 21 GLU B HB2    2  
ATOM 8129  H HB3    . GLU D 3 21 ? 31.199  -1.633  -3.030  1.00 3.78  ? 21 GLU B HB3    2  
ATOM 8130  H HG2    . GLU D 3 21 ? 32.026  0.310   -2.205  1.00 4.02  ? 21 GLU B HG2    2  
ATOM 8131  H HG3    . GLU D 3 21 ? 30.467  0.838   -1.575  1.00 3.94  ? 21 GLU B HG3    2  
ATOM 8132  N N      . LEU D 3 22 ? 28.179  -2.500  -4.301  1.00 2.95  ? 22 LEU B N      2  
ATOM 8133  C CA     . LEU D 3 22 ? 27.832  -3.534  -5.262  1.00 2.91  ? 22 LEU B CA     2  
ATOM 8134  C C      . LEU D 3 22 ? 27.183  -2.919  -6.496  1.00 2.98  ? 22 LEU B C      2  
ATOM 8135  O O      . LEU D 3 22 ? 27.642  -3.138  -7.614  1.00 3.11  ? 22 LEU B O      2  
ATOM 8136  C CB     . LEU D 3 22 ? 26.893  -4.570  -4.629  1.00 2.92  ? 22 LEU B CB     2  
ATOM 8137  C CG     . LEU D 3 22 ? 27.549  -5.563  -3.661  1.00 3.31  ? 22 LEU B CG     2  
ATOM 8138  C CD1    . LEU D 3 22 ? 28.851  -6.104  -4.237  1.00 3.49  ? 22 LEU B CD1    2  
ATOM 8139  C CD2    . LEU D 3 22 ? 27.792  -4.916  -2.305  1.00 3.65  ? 22 LEU B CD2    2  
ATOM 8140  H H      . LEU D 3 22 ? 27.693  -2.459  -3.450  1.00 2.94  ? 22 LEU B H      2  
ATOM 8141  H HA     . LEU D 3 22 ? 28.745  -4.023  -5.559  1.00 2.96  ? 22 LEU B HA     2  
ATOM 8142  H HB2    . LEU D 3 22 ? 26.121  -4.038  -4.092  1.00 2.80  ? 22 LEU B HB2    2  
ATOM 8143  H HB3    . LEU D 3 22 ? 26.429  -5.134  -5.424  1.00 3.16  ? 22 LEU B HB3    2  
ATOM 8144  H HG     . LEU D 3 22 ? 26.881  -6.399  -3.514  1.00 3.86  ? 22 LEU B HG     2  
ATOM 8145  H HD11   . LEU D 3 22 ? 29.179  -6.949  -3.648  1.00 3.56  ? 22 LEU B HD11   2  
ATOM 8146  H HD12   . LEU D 3 22 ? 29.605  -5.332  -4.208  1.00 3.83  ? 22 LEU B HD12   2  
ATOM 8147  H HD13   . LEU D 3 22 ? 28.690  -6.417  -5.257  1.00 3.78  ? 22 LEU B HD13   2  
ATOM 8148  H HD21   . LEU D 3 22 ? 28.337  -3.993  -2.439  1.00 3.81  ? 22 LEU B HD21   2  
ATOM 8149  H HD22   . LEU D 3 22 ? 28.366  -5.587  -1.683  1.00 3.96  ? 22 LEU B HD22   2  
ATOM 8150  H HD23   . LEU D 3 22 ? 26.845  -4.707  -1.832  1.00 4.02  ? 22 LEU B HD23   2  
ATOM 8151  N N      . ARG D 3 23 ? 26.135  -2.125  -6.287  1.00 3.00  ? 23 ARG B N      2  
ATOM 8152  C CA     . ARG D 3 23 ? 25.442  -1.486  -7.400  1.00 3.16  ? 23 ARG B CA     2  
ATOM 8153  C C      . ARG D 3 23 ? 26.371  -0.524  -8.135  1.00 3.44  ? 23 ARG B C      2  
ATOM 8154  O O      . ARG D 3 23 ? 26.262  -0.353  -9.349  1.00 3.73  ? 23 ARG B O      2  
ATOM 8155  C CB     . ARG D 3 23 ? 24.172  -0.762  -6.931  1.00 3.11  ? 23 ARG B CB     2  
ATOM 8156  C CG     . ARG D 3 23 ? 24.411  0.308   -5.883  1.00 3.11  ? 23 ARG B CG     2  
ATOM 8157  C CD     . ARG D 3 23 ? 23.616  1.569   -6.181  1.00 2.93  ? 23 ARG B CD     2  
ATOM 8158  N NE     . ARG D 3 23 ? 24.115  2.264   -7.370  1.00 3.12  ? 23 ARG B NE     2  
ATOM 8159  C CZ     . ARG D 3 23 ? 24.808  3.406   -7.344  1.00 3.24  ? 23 ARG B CZ     2  
ATOM 8160  N NH1    . ARG D 3 23 ? 25.101  3.992   -6.183  1.00 3.16  ? 23 ARG B NH1    2  
ATOM 8161  N NH2    . ARG D 3 23 ? 25.201  3.966   -8.482  1.00 3.98  ? 23 ARG B NH2    2  
ATOM 8162  H H      . ARG D 3 23 ? 25.823  -1.971  -5.372  1.00 2.97  ? 23 ARG B H      2  
ATOM 8163  H HA     . ARG D 3 23 ? 25.157  -2.267  -8.089  1.00 3.24  ? 23 ARG B HA     2  
ATOM 8164  H HB2    . ARG D 3 23 ? 23.705  -0.296  -7.785  1.00 3.43  ? 23 ARG B HB2    2  
ATOM 8165  H HB3    . ARG D 3 23 ? 23.491  -1.492  -6.518  1.00 3.17  ? 23 ARG B HB3    2  
ATOM 8166  H HG2    . ARG D 3 23 ? 24.114  -0.073  -4.916  1.00 3.36  ? 23 ARG B HG2    2  
ATOM 8167  H HG3    . ARG D 3 23 ? 25.465  0.552   -5.868  1.00 3.50  ? 23 ARG B HG3    2  
ATOM 8168  H HD2    . ARG D 3 23 ? 22.583  1.296   -6.345  1.00 2.92  ? 23 ARG B HD2    2  
ATOM 8169  H HD3    . ARG D 3 23 ? 23.680  2.233   -5.331  1.00 3.32  ? 23 ARG B HD3    2  
ATOM 8170  H HE     . ARG D 3 23 ? 23.908  1.861   -8.245  1.00 3.58  ? 23 ARG B HE     2  
ATOM 8171  H HH11   . ARG D 3 23 ? 24.803  3.581   -5.316  1.00 3.10  ? 23 ARG B HH11   2  
ATOM 8172  H HH12   . ARG D 3 23 ? 25.606  4.859   -6.168  1.00 3.55  ? 23 ARG B HH12   2  
ATOM 8173  H HH21   . ARG D 3 23 ? 24.977  3.535   -9.362  1.00 4.46  ? 23 ARG B HH21   2  
ATOM 8174  H HH22   . ARG D 3 23 ? 25.716  4.829   -8.474  1.00 4.30  ? 23 ARG B HH22   2  
ATOM 8175  N N      . ARG D 3 24 ? 27.290  0.092   -7.395  1.00 3.48  ? 24 ARG B N      2  
ATOM 8176  C CA     . ARG D 3 24 ? 28.252  1.018   -7.985  1.00 3.87  ? 24 ARG B CA     2  
ATOM 8177  C C      . ARG D 3 24 ? 29.180  0.271   -8.932  1.00 4.04  ? 24 ARG B C      2  
ATOM 8178  O O      . ARG D 3 24 ? 29.494  0.747   -10.019 1.00 4.52  ? 24 ARG B O      2  
ATOM 8179  C CB     . ARG D 3 24 ? 29.077  1.709   -6.897  1.00 4.01  ? 24 ARG B CB     2  
ATOM 8180  C CG     . ARG D 3 24 ? 28.531  3.066   -6.480  1.00 4.30  ? 24 ARG B CG     2  
ATOM 8181  C CD     . ARG D 3 24 ? 28.993  4.173   -7.415  1.00 4.43  ? 24 ARG B CD     2  
ATOM 8182  N NE     . ARG D 3 24 ? 28.524  5.487   -6.974  1.00 4.34  ? 24 ARG B NE     2  
ATOM 8183  C CZ     . ARG D 3 24 ? 29.048  6.645   -7.377  1.00 4.44  ? 24 ARG B CZ     2  
ATOM 8184  N NH1    . ARG D 3 24 ? 30.070  6.661   -8.228  1.00 4.57  ? 24 ARG B NH1    2  
ATOM 8185  N NH2    . ARG D 3 24 ? 28.550  7.793   -6.933  1.00 4.80  ? 24 ARG B NH2    2  
ATOM 8186  H H      . ARG D 3 24 ? 27.318  -0.075  -6.427  1.00 3.34  ? 24 ARG B H      2  
ATOM 8187  H HA     . ARG D 3 24 ? 27.705  1.761   -8.543  1.00 4.06  ? 24 ARG B HA     2  
ATOM 8188  H HB2    . ARG D 3 24 ? 29.104  1.073   -6.022  1.00 3.97  ? 24 ARG B HB2    2  
ATOM 8189  H HB3    . ARG D 3 24 ? 30.084  1.845   -7.260  1.00 4.21  ? 24 ARG B HB3    2  
ATOM 8190  H HG2    . ARG D 3 24 ? 27.453  3.028   -6.494  1.00 4.69  ? 24 ARG B HG2    2  
ATOM 8191  H HG3    . ARG D 3 24 ? 28.872  3.288   -5.481  1.00 4.44  ? 24 ARG B HG3    2  
ATOM 8192  H HD2    . ARG D 3 24 ? 30.072  4.178   -7.440  1.00 4.66  ? 24 ARG B HD2    2  
ATOM 8193  H HD3    . ARG D 3 24 ? 28.610  3.977   -8.405  1.00 4.80  ? 24 ARG B HD3    2  
ATOM 8194  H HE     . ARG D 3 24 ? 27.773  5.505   -6.342  1.00 4.48  ? 24 ARG B HE     2  
ATOM 8195  H HH11   . ARG D 3 24 ? 30.454  5.801   -8.576  1.00 4.63  ? 24 ARG B HH11   2  
ATOM 8196  H HH12   . ARG D 3 24 ? 30.459  7.536   -8.531  1.00 4.84  ? 24 ARG B HH12   2  
ATOM 8197  H HH21   . ARG D 3 24 ? 27.775  7.795   -6.296  1.00 5.00  ? 24 ARG B HH21   2  
ATOM 8198  H HH22   . ARG D 3 24 ? 28.948  8.666   -7.232  1.00 5.09  ? 24 ARG B HH22   2  
ATOM 8199  N N      . THR D 3 25 ? 29.599  -0.916  -8.515  1.00 3.71  ? 25 THR B N      2  
ATOM 8200  C CA     . THR D 3 25 ? 30.485  -1.743  -9.317  1.00 3.88  ? 25 THR B CA     2  
ATOM 8201  C C      . THR D 3 25 ? 29.750  -2.293  -10.536 1.00 3.93  ? 25 THR B C      2  
ATOM 8202  O O      . THR D 3 25 ? 30.329  -2.441  -11.611 1.00 4.17  ? 25 THR B O      2  
ATOM 8203  C CB     . THR D 3 25 ? 31.053  -2.897  -8.473  1.00 3.79  ? 25 THR B CB     2  
ATOM 8204  O OG1    . THR D 3 25 ? 31.748  -2.363  -7.337  1.00 3.61  ? 25 THR B OG1    2  
ATOM 8205  C CG2    . THR D 3 25 ? 31.996  -3.768  -9.285  1.00 4.41  ? 25 THR B CG2    2  
ATOM 8206  H H      . THR D 3 25 ? 29.304  -1.248  -7.643  1.00 3.40  ? 25 THR B H      2  
ATOM 8207  H HA     . THR D 3 25 ? 31.310  -1.128  -9.652  1.00 4.12  ? 25 THR B HA     2  
ATOM 8208  H HB     . THR D 3 25 ? 30.230  -3.506  -8.127  1.00 3.73  ? 25 THR B HB     2  
ATOM 8209  H HG1    . THR D 3 25 ? 31.111  -2.149  -6.642  1.00 3.42  ? 25 THR B HG1    2  
ATOM 8210  H HG21   . THR D 3 25 ? 32.722  -3.143  -9.782  1.00 4.69  ? 25 THR B HG21   2  
ATOM 8211  H HG22   . THR D 3 25 ? 31.433  -4.322  -10.020 1.00 4.85  ? 25 THR B HG22   2  
ATOM 8212  H HG23   . THR D 3 25 ? 32.504  -4.456  -8.627  1.00 4.44  ? 25 THR B HG23   2  
ATOM 8213  N N      . LEU D 3 26 ? 28.466  -2.576  -10.360 1.00 3.82  ? 26 LEU B N      2  
ATOM 8214  C CA     . LEU D 3 26 ? 27.637  -3.096  -11.440 1.00 3.97  ? 26 LEU B CA     2  
ATOM 8215  C C      . LEU D 3 26 ? 27.393  -2.018  -12.491 1.00 3.98  ? 26 LEU B C      2  
ATOM 8216  O O      . LEU D 3 26 ? 27.136  -2.318  -13.659 1.00 4.65  ? 26 LEU B O      2  
ATOM 8217  C CB     . LEU D 3 26 ? 26.297  -3.602  -10.895 1.00 4.17  ? 26 LEU B CB     2  
ATOM 8218  C CG     . LEU D 3 26 ? 26.385  -4.822  -9.979  1.00 4.38  ? 26 LEU B CG     2  
ATOM 8219  C CD1    . LEU D 3 26 ? 25.085  -5.002  -9.213  1.00 4.85  ? 26 LEU B CD1    2  
ATOM 8220  C CD2    . LEU D 3 26 ? 26.705  -6.070  -10.786 1.00 4.74  ? 26 LEU B CD2    2  
ATOM 8221  H H      . LEU D 3 26 ? 28.068  -2.442  -9.473  1.00 3.72  ? 26 LEU B H      2  
ATOM 8222  H HA     . LEU D 3 26 ? 28.166  -3.918  -11.900 1.00 4.17  ? 26 LEU B HA     2  
ATOM 8223  H HB2    . LEU D 3 26 ? 25.830  -2.797  -10.345 1.00 4.27  ? 26 LEU B HB2    2  
ATOM 8224  H HB3    . LEU D 3 26 ? 25.666  -3.855  -11.734 1.00 4.41  ? 26 LEU B HB3    2  
ATOM 8225  H HG     . LEU D 3 26 ? 27.181  -4.674  -9.263  1.00 4.44  ? 26 LEU B HG     2  
ATOM 8226  H HD11   . LEU D 3 26 ? 24.256  -5.002  -9.904  1.00 5.35  ? 26 LEU B HD11   2  
ATOM 8227  H HD12   . LEU D 3 26 ? 24.969  -4.192  -8.511  1.00 5.08  ? 26 LEU B HD12   2  
ATOM 8228  H HD13   . LEU D 3 26 ? 25.111  -5.940  -8.680  1.00 4.83  ? 26 LEU B HD13   2  
ATOM 8229  H HD21   . LEU D 3 26 ? 27.626  -5.920  -11.328 1.00 4.76  ? 26 LEU B HD21   2  
ATOM 8230  H HD22   . LEU D 3 26 ? 25.903  -6.263  -11.482 1.00 5.04  ? 26 LEU B HD22   2  
ATOM 8231  H HD23   . LEU D 3 26 ? 26.811  -6.912  -10.119 1.00 5.02  ? 26 LEU B HD23   2  
ATOM 8232  N N      . GLY D 3 27 ? 27.463  -0.765  -12.064 1.00 3.54  ? 27 GLY B N      2  
ATOM 8233  C CA     . GLY D 3 27 ? 27.264  0.350   -12.969 1.00 3.69  ? 27 GLY B CA     2  
ATOM 8234  C C      . GLY D 3 27 ? 25.803  0.686   -13.168 1.00 3.35  ? 27 GLY B C      2  
ATOM 8235  O O      . GLY D 3 27 ? 25.421  1.237   -14.199 1.00 3.67  ? 27 GLY B O      2  
ATOM 8236  H H      . GLY D 3 27 ? 27.653  -0.593  -11.117 1.00 3.37  ? 27 GLY B H      2  
ATOM 8237  H HA2    . GLY D 3 27 ? 27.767  1.218   -12.571 1.00 3.98  ? 27 GLY B HA2    2  
ATOM 8238  H HA3    . GLY D 3 27 ? 27.699  0.105   -13.928 1.00 4.09  ? 27 GLY B HA3    2  
ATOM 8239  N N      . ILE D 3 28 ? 24.978  0.348   -12.186 1.00 3.04  ? 28 ILE B N      2  
ATOM 8240  C CA     . ILE D 3 28 ? 23.554  0.630   -12.269 1.00 3.06  ? 28 ILE B CA     2  
ATOM 8241  C C      . ILE D 3 28 ? 23.209  1.847   -11.417 1.00 3.03  ? 28 ILE B C      2  
ATOM 8242  O O      . ILE D 3 28 ? 23.826  2.085   -10.372 1.00 3.20  ? 28 ILE B O      2  
ATOM 8243  C CB     . ILE D 3 28 ? 22.693  -0.579  -11.839 1.00 3.39  ? 28 ILE B CB     2  
ATOM 8244  C CG1    . ILE D 3 28 ? 23.024  -1.003  -10.408 1.00 3.37  ? 28 ILE B CG1    2  
ATOM 8245  C CG2    . ILE D 3 28 ? 22.896  -1.745  -12.799 1.00 4.01  ? 28 ILE B CG2    2  
ATOM 8246  C CD1    . ILE D 3 28 ? 22.020  -1.964  -9.807  1.00 3.80  ? 28 ILE B CD1    2  
ATOM 8247  H H      . ILE D 3 28 ? 25.338  -0.087  -11.383 1.00 3.08  ? 28 ILE B H      2  
ATOM 8248  H HA     . ILE D 3 28 ? 23.327  0.855   -13.301 1.00 3.28  ? 28 ILE B HA     2  
ATOM 8249  H HB     . ILE D 3 28 ? 21.656  -0.286  -11.889 1.00 3.67  ? 28 ILE B HB     2  
ATOM 8250  H HG12   . ILE D 3 28 ? 23.988  -1.486  -10.400 1.00 3.58  ? 28 ILE B HG12   2  
ATOM 8251  H HG13   . ILE D 3 28 ? 23.061  -0.126  -9.779  1.00 3.30  ? 28 ILE B HG13   2  
ATOM 8252  H HG21   . ILE D 3 28 ? 22.640  -1.436  -13.803 1.00 4.49  ? 28 ILE B HG21   2  
ATOM 8253  H HG22   . ILE D 3 28 ? 22.262  -2.568  -12.504 1.00 4.26  ? 28 ILE B HG22   2  
ATOM 8254  H HG23   . ILE D 3 28 ? 23.929  -2.058  -12.768 1.00 4.19  ? 28 ILE B HG23   2  
ATOM 8255  H HD11   . ILE D 3 28 ? 22.100  -2.923  -10.301 1.00 4.14  ? 28 ILE B HD11   2  
ATOM 8256  H HD12   . ILE D 3 28 ? 21.023  -1.572  -9.939  1.00 4.28  ? 28 ILE B HD12   2  
ATOM 8257  H HD13   . ILE D 3 28 ? 22.224  -2.082  -8.753  1.00 3.69  ? 28 ILE B HD13   2  
ATOM 8258  N N      . ALA D 3 29 ? 22.231  2.617   -11.868 1.00 3.27  ? 29 ALA B N      2  
ATOM 8259  C CA     . ALA D 3 29 ? 21.822  3.824   -11.167 1.00 3.62  ? 29 ALA B CA     2  
ATOM 8260  C C      . ALA D 3 29 ? 20.588  3.594   -10.300 1.00 3.51  ? 29 ALA B C      2  
ATOM 8261  O O      . ALA D 3 29 ? 20.685  3.613   -9.076  1.00 3.86  ? 29 ALA B O      2  
ATOM 8262  C CB     . ALA D 3 29 ? 21.574  4.947   -12.158 1.00 4.43  ? 29 ALA B CB     2  
ATOM 8263  H H      . ALA D 3 29 ? 21.767  2.366   -12.694 1.00 3.48  ? 29 ALA B H      2  
ATOM 8264  H HA     . ALA D 3 29 ? 22.639  4.124   -10.529 1.00 3.69  ? 29 ALA B HA     2  
ATOM 8265  H HB1    . ALA D 3 29 ? 22.448  5.082   -12.776 1.00 4.65  ? 29 ALA B HB1    2  
ATOM 8266  H HB2    . ALA D 3 29 ? 21.366  5.862   -11.621 1.00 4.89  ? 29 ALA B HB2    2  
ATOM 8267  H HB3    . ALA D 3 29 ? 20.729  4.696   -12.778 1.00 4.68  ? 29 ALA B HB3    2  
ATOM 8268  N N      . GLU D 3 30 ? 19.427  3.390   -10.926 1.00 3.46  ? 30 GLU B N      2  
ATOM 8269  C CA     . GLU D 3 30 ? 18.192  3.177   -10.167 1.00 3.58  ? 30 GLU B CA     2  
ATOM 8270  C C      . GLU D 3 30 ? 17.106  2.499   -11.002 1.00 3.18  ? 30 GLU B C      2  
ATOM 8271  O O      . GLU D 3 30 ? 15.935  2.465   -10.612 1.00 3.51  ? 30 GLU B O      2  
ATOM 8272  C CB     . GLU D 3 30 ? 17.665  4.517   -9.626  1.00 4.35  ? 30 GLU B CB     2  
ATOM 8273  C CG     . GLU D 3 30 ? 17.060  5.432   -10.685 1.00 4.87  ? 30 GLU B CG     2  
ATOM 8274  C CD     . GLU D 3 30 ? 18.085  5.990   -11.649 1.00 5.07  ? 30 GLU B CD     2  
ATOM 8275  O OE1    . GLU D 3 30 ? 18.819  6.928   -11.267 1.00 5.56  ? 30 GLU B OE1    2  
ATOM 8276  O OE2    . GLU D 3 30 ? 18.166  5.493   -12.792 1.00 5.08  ? 30 GLU B OE2    2  
ATOM 8277  H H      . GLU D 3 30 ? 19.398  3.395   -11.907 1.00 3.62  ? 30 GLU B H      2  
ATOM 8278  H HA     . GLU D 3 30 ? 18.431  2.538   -9.332  1.00 3.74  ? 30 GLU B HA     2  
ATOM 8279  H HB2    . GLU D 3 30 ? 16.902  4.315   -8.887  1.00 4.66  ? 30 GLU B HB2    2  
ATOM 8280  H HB3    . GLU D 3 30 ? 18.477  5.043   -9.151  1.00 4.68  ? 30 GLU B HB3    2  
ATOM 8281  H HG2    . GLU D 3 30 ? 16.332  4.869   -11.248 1.00 5.33  ? 30 GLU B HG2    2  
ATOM 8282  H HG3    . GLU D 3 30 ? 16.568  6.255   -10.189 1.00 5.08  ? 30 GLU B HG3    2  
ATOM 8283  N N      . LYS D 3 31 ? 17.481  1.942   -12.138 1.00 2.71  ? 31 LYS B N      2  
ATOM 8284  C CA     . LYS D 3 31 ? 16.508  1.290   -13.001 1.00 2.64  ? 31 LYS B CA     2  
ATOM 8285  C C      . LYS D 3 31 ? 16.346  -0.187  -12.642 1.00 2.23  ? 31 LYS B C      2  
ATOM 8286  O O      . LYS D 3 31 ? 16.526  -1.066  -13.489 1.00 2.37  ? 31 LYS B O      2  
ATOM 8287  C CB     . LYS D 3 31 ? 16.913  1.448   -14.467 1.00 3.12  ? 31 LYS B CB     2  
ATOM 8288  C CG     . LYS D 3 31 ? 16.973  2.898   -14.930 1.00 3.70  ? 31 LYS B CG     2  
ATOM 8289  C CD     . LYS D 3 31 ? 15.587  3.513   -15.001 1.00 4.02  ? 31 LYS B CD     2  
ATOM 8290  C CE     . LYS D 3 31 ? 15.651  4.985   -15.377 1.00 4.47  ? 31 LYS B CE     2  
ATOM 8291  N NZ     . LYS D 3 31 ? 15.925  5.855   -14.205 1.00 4.47  ? 31 LYS B NZ     2  
ATOM 8292  H H      . LYS D 3 31 ? 18.428  1.957   -12.397 1.00 2.63  ? 31 LYS B H      2  
ATOM 8293  H HA     . LYS D 3 31 ? 15.560  1.784   -12.849 1.00 2.90  ? 31 LYS B HA     2  
ATOM 8294  H HB2    . LYS D 3 31 ? 17.886  1.005   -14.609 1.00 3.09  ? 31 LYS B HB2    2  
ATOM 8295  H HB3    . LYS D 3 31 ? 16.194  0.925   -15.083 1.00 3.52  ? 31 LYS B HB3    2  
ATOM 8296  H HG2    . LYS D 3 31 ? 17.575  3.466   -14.235 1.00 3.87  ? 31 LYS B HG2    2  
ATOM 8297  H HG3    . LYS D 3 31 ? 17.424  2.933   -15.910 1.00 4.03  ? 31 LYS B HG3    2  
ATOM 8298  H HD2    . LYS D 3 31 ? 15.012  2.987   -15.748 1.00 4.01  ? 31 LYS B HD2    2  
ATOM 8299  H HD3    . LYS D 3 31 ? 15.107  3.413   -14.039 1.00 4.34  ? 31 LYS B HD3    2  
ATOM 8300  H HE2    . LYS D 3 31 ? 16.440  5.117   -16.096 1.00 4.96  ? 31 LYS B HE2    2  
ATOM 8301  H HE3    . LYS D 3 31 ? 14.708  5.274   -15.818 1.00 4.78  ? 31 LYS B HE3    2  
ATOM 8302  H HZ1    . LYS D 3 31 ? 15.983  6.849   -14.507 1.00 4.57  ? 31 LYS B HZ1    2  
ATOM 8303  H HZ2    . LYS D 3 31 ? 16.831  5.588   -13.757 1.00 4.42  ? 31 LYS B HZ2    2  
ATOM 8304  H HZ3    . LYS D 3 31 ? 15.163  5.763   -13.504 1.00 4.89  ? 31 LYS B HZ3    2  
ATOM 8305  N N      . ASP D 3 32 ? 16.001  -0.456  -11.385 1.00 2.16  ? 32 ASP B N      2  
ATOM 8306  C CA     . ASP D 3 32 ? 15.809  -1.825  -10.921 1.00 2.20  ? 32 ASP B CA     2  
ATOM 8307  C C      . ASP D 3 32 ? 14.953  -1.856  -9.661  1.00 1.94  ? 32 ASP B C      2  
ATOM 8308  O O      . ASP D 3 32 ? 14.682  -0.815  -9.055  1.00 2.05  ? 32 ASP B O      2  
ATOM 8309  C CB     . ASP D 3 32 ? 17.152  -2.510  -10.664 1.00 2.40  ? 32 ASP B CB     2  
ATOM 8310  C CG     . ASP D 3 32 ? 17.156  -3.932  -11.179 1.00 3.06  ? 32 ASP B CG     2  
ATOM 8311  O OD1    . ASP D 3 32 ? 16.269  -4.722  -10.784 1.00 3.96  ? 32 ASP B OD1    2  
ATOM 8312  O OD2    . ASP D 3 32 ? 18.062  -4.275  -11.964 1.00 3.01  ? 32 ASP B OD2    2  
ATOM 8313  H H      . ASP D 3 32 ? 15.864  0.284   -10.752 1.00 2.38  ? 32 ASP B H      2  
ATOM 8314  H HA     . ASP D 3 32 ? 15.289  -2.363  -11.699 1.00 2.67  ? 32 ASP B HA     2  
ATOM 8315  H HB2    . ASP D 3 32 ? 17.936  -1.959  -11.163 1.00 2.66  ? 32 ASP B HB2    2  
ATOM 8316  H HB3    . ASP D 3 32 ? 17.346  -2.529  -9.603  1.00 2.18  ? 32 ASP B HB3    2  
ATOM 8317  N N      . ALA D 3 33 ? 14.542  -3.054  -9.263  1.00 1.84  ? 33 ALA B N      2  
ATOM 8318  C CA     . ALA D 3 33 ? 13.700  -3.235  -8.091  1.00 1.77  ? 33 ALA B CA     2  
ATOM 8319  C C      . ALA D 3 33 ? 14.129  -4.463  -7.296  1.00 1.64  ? 33 ALA B C      2  
ATOM 8320  O O      . ALA D 3 33 ? 14.335  -5.537  -7.861  1.00 1.77  ? 33 ALA B O      2  
ATOM 8321  C CB     . ALA D 3 33 ? 12.241  -3.361  -8.511  1.00 1.98  ? 33 ALA B CB     2  
ATOM 8322  H H      . ALA D 3 33 ? 14.837  -3.848  -9.767  1.00 1.99  ? 33 ALA B H      2  
ATOM 8323  H HA     . ALA D 3 33 ? 13.799  -2.359  -7.466  1.00 1.79  ? 33 ALA B HA     2  
ATOM 8324  H HB1    . ALA D 3 33 ? 11.605  -3.274  -7.642  1.00 2.71  ? 33 ALA B HB1    2  
ATOM 8325  H HB2    . ALA D 3 33 ? 12.083  -4.320  -8.980  1.00 2.11  ? 33 ALA B HB2    2  
ATOM 8326  H HB3    . ALA D 3 33 ? 12.001  -2.576  -9.213  1.00 1.95  ? 33 ALA B HB3    2  
ATOM 8327  N N      . LEU D 3 34 ? 14.251  -4.302  -5.987  1.00 1.54  ? 34 LEU B N      2  
ATOM 8328  C CA     . LEU D 3 34 ? 14.664  -5.392  -5.113  1.00 1.50  ? 34 LEU B CA     2  
ATOM 8329  C C      . LEU D 3 34 ? 13.455  -6.013  -4.430  1.00 1.64  ? 34 LEU B C      2  
ATOM 8330  O O      . LEU D 3 34 ? 12.370  -5.428  -4.413  1.00 1.65  ? 34 LEU B O      2  
ATOM 8331  C CB     . LEU D 3 34 ? 15.667  -4.896  -4.065  1.00 1.43  ? 34 LEU B CB     2  
ATOM 8332  C CG     . LEU D 3 34 ? 15.135  -3.859  -3.073  1.00 1.73  ? 34 LEU B CG     2  
ATOM 8333  C CD1    . LEU D 3 34 ? 14.973  -4.475  -1.694  1.00 2.40  ? 34 LEU B CD1    2  
ATOM 8334  C CD2    . LEU D 3 34 ? 16.059  -2.654  -3.010  1.00 1.89  ? 34 LEU B CD2    2  
ATOM 8335  H H      . LEU D 3 34 ? 14.043  -3.428  -5.595  1.00 1.62  ? 34 LEU B H      2  
ATOM 8336  H HA     . LEU D 3 34 ? 15.140  -6.143  -5.726  1.00 1.51  ? 34 LEU B HA     2  
ATOM 8337  H HB2    . LEU D 3 34 ? 16.014  -5.753  -3.505  1.00 1.65  ? 34 LEU B HB2    2  
ATOM 8338  H HB3    . LEU D 3 34 ? 16.509  -4.466  -4.582  1.00 1.60  ? 34 LEU B HB3    2  
ATOM 8339  H HG     . LEU D 3 34 ? 14.165  -3.520  -3.400  1.00 2.25  ? 34 LEU B HG     2  
ATOM 8340  H HD11   . LEU D 3 34 ? 14.657  -3.714  -0.996  1.00 2.95  ? 34 LEU B HD11   2  
ATOM 8341  H HD12   . LEU D 3 34 ? 15.917  -4.890  -1.371  1.00 2.67  ? 34 LEU B HD12   2  
ATOM 8342  H HD13   . LEU D 3 34 ? 14.231  -5.258  -1.734  1.00 2.78  ? 34 LEU B HD13   2  
ATOM 8343  H HD21   . LEU D 3 34 ? 17.052  -2.974  -2.728  1.00 2.12  ? 34 LEU B HD21   2  
ATOM 8344  H HD22   . LEU D 3 34 ? 15.686  -1.954  -2.278  1.00 2.47  ? 34 LEU B HD22   2  
ATOM 8345  H HD23   . LEU D 3 34 ? 16.097  -2.179  -3.978  1.00 2.10  ? 34 LEU B HD23   2  
ATOM 8346  N N      . GLU D 3 35 ? 13.646  -7.190  -3.857  1.00 1.82  ? 35 GLU B N      2  
ATOM 8347  C CA     . GLU D 3 35 ? 12.560  -7.884  -3.181  1.00 2.02  ? 35 GLU B CA     2  
ATOM 8348  C C      . GLU D 3 35 ? 12.926  -8.149  -1.726  1.00 1.95  ? 35 GLU B C      2  
ATOM 8349  O O      . GLU D 3 35 ? 13.981  -8.716  -1.432  1.00 1.91  ? 35 GLU B O      2  
ATOM 8350  C CB     . GLU D 3 35 ? 12.232  -9.193  -3.901  1.00 2.29  ? 35 GLU B CB     2  
ATOM 8351  C CG     . GLU D 3 35 ? 10.850  -9.739  -3.578  1.00 2.57  ? 35 GLU B CG     2  
ATOM 8352  C CD     . GLU D 3 35 ? 10.304  -10.620 -4.681  1.00 2.74  ? 35 GLU B CD     2  
ATOM 8353  O OE1    . GLU D 3 35 ? 11.084  -11.396 -5.276  1.00 3.00  ? 35 GLU B OE1    2  
ATOM 8354  O OE2    . GLU D 3 35 ? 9.092   -10.539 -4.965  1.00 2.97  ? 35 GLU B OE2    2  
ATOM 8355  H H      . GLU D 3 35 ? 14.546  -7.594  -3.872  1.00 1.85  ? 35 GLU B H      2  
ATOM 8356  H HA     . GLU D 3 35 ? 11.691  -7.242  -3.207  1.00 2.12  ? 35 GLU B HA     2  
ATOM 8357  H HB2    . GLU D 3 35 ? 12.290  -9.031  -4.967  1.00 2.50  ? 35 GLU B HB2    2  
ATOM 8358  H HB3    . GLU D 3 35 ? 12.961  -9.938  -3.619  1.00 2.33  ? 35 GLU B HB3    2  
ATOM 8359  H HG2    . GLU D 3 35 ? 10.909  -10.322 -2.670  1.00 2.61  ? 35 GLU B HG2    2  
ATOM 8360  H HG3    . GLU D 3 35 ? 10.175  -8.909  -3.430  1.00 3.12  ? 35 GLU B HG3    2  
ATOM 8361  N N      . ILE D 3 36 ? 12.054  -7.718  -0.825  1.00 2.02  ? 36 ILE B N      2  
ATOM 8362  C CA     . ILE D 3 36 ? 12.267  -7.892  0.603   1.00 2.04  ? 36 ILE B CA     2  
ATOM 8363  C C      . ILE D 3 36 ? 11.469  -9.074  1.138   1.00 2.29  ? 36 ILE B C      2  
ATOM 8364  O O      . ILE D 3 36 ? 10.236  -9.057  1.125   1.00 2.50  ? 36 ILE B O      2  
ATOM 8365  C CB     . ILE D 3 36 ? 11.863  -6.625  1.392   1.00 2.10  ? 36 ILE B CB     2  
ATOM 8366  C CG1    . ILE D 3 36 ? 12.683  -5.419  0.920   1.00 1.97  ? 36 ILE B CG1    2  
ATOM 8367  C CG2    . ILE D 3 36 ? 12.039  -6.847  2.889   1.00 2.32  ? 36 ILE B CG2    2  
ATOM 8368  C CD1    . ILE D 3 36 ? 12.408  -4.148  1.697   1.00 2.25  ? 36 ILE B CD1    2  
ATOM 8369  H H      . ILE D 3 36 ? 11.237  -7.262  -1.132  1.00 2.12  ? 36 ILE B H      2  
ATOM 8370  H HA     . ILE D 3 36 ? 13.320  -8.075  0.767   1.00 1.89  ? 36 ILE B HA     2  
ATOM 8371  H HB     . ILE D 3 36 ? 10.818  -6.432  1.206   1.00 2.33  ? 36 ILE B HB     2  
ATOM 8372  H HG12   . ILE D 3 36 ? 13.733  -5.646  1.021   1.00 2.16  ? 36 ILE B HG12   2  
ATOM 8373  H HG13   . ILE D 3 36 ? 12.459  -5.229  -0.119  1.00 2.09  ? 36 ILE B HG13   2  
ATOM 8374  H HG21   . ILE D 3 36 ? 12.648  -6.057  3.304   1.00 2.19  ? 36 ILE B HG21   2  
ATOM 8375  H HG22   . ILE D 3 36 ? 12.521  -7.800  3.057   1.00 2.73  ? 36 ILE B HG22   2  
ATOM 8376  H HG23   . ILE D 3 36 ? 11.070  -6.844  3.369   1.00 2.68  ? 36 ILE B HG23   2  
ATOM 8377  H HD11   . ILE D 3 36 ? 13.002  -3.344  1.291   1.00 2.23  ? 36 ILE B HD11   2  
ATOM 8378  H HD12   . ILE D 3 36 ? 12.665  -4.298  2.736   1.00 2.79  ? 36 ILE B HD12   2  
ATOM 8379  H HD13   . ILE D 3 36 ? 11.361  -3.896  1.619   1.00 2.68  ? 36 ILE B HD13   2  
ATOM 8380  N N      . TYR D 3 37 ? 12.175  -10.094 1.603   1.00 2.32  ? 37 TYR B N      2  
ATOM 8381  C CA     . TYR D 3 37 ? 11.538  -11.277 2.163   1.00 2.59  ? 37 TYR B CA     2  
ATOM 8382  C C      . TYR D 3 37 ? 11.623  -11.226 3.682   1.00 2.61  ? 37 TYR B C      2  
ATOM 8383  O O      . TYR D 3 37 ? 12.691  -11.439 4.258   1.00 2.58  ? 37 TYR B O      2  
ATOM 8384  C CB     . TYR D 3 37 ? 12.210  -12.557 1.652   1.00 2.75  ? 37 TYR B CB     2  
ATOM 8385  C CG     . TYR D 3 37 ? 12.383  -12.618 0.148   1.00 2.85  ? 37 TYR B CG     2  
ATOM 8386  C CD1    . TYR D 3 37 ? 11.351  -13.059 -0.673  1.00 2.77  ? 37 TYR B CD1    2  
ATOM 8387  C CD2    . TYR D 3 37 ? 13.571  -12.221 -0.451  1.00 3.50  ? 37 TYR B CD2    2  
ATOM 8388  C CE1    . TYR D 3 37 ? 11.502  -13.103 -2.046  1.00 3.20  ? 37 TYR B CE1    2  
ATOM 8389  C CE2    . TYR D 3 37 ? 13.730  -12.264 -1.822  1.00 3.95  ? 37 TYR B CE2    2  
ATOM 8390  C CZ     . TYR D 3 37 ? 12.706  -12.760 -2.613  1.00 3.75  ? 37 TYR B CZ     2  
ATOM 8391  O OH     . TYR D 3 37 ? 12.845  -12.742 -3.986  1.00 4.39  ? 37 TYR B OH     2  
ATOM 8392  H H      . TYR D 3 37 ? 13.162  -10.047 1.578   1.00 2.19  ? 37 TYR B H      2  
ATOM 8393  H HA     . TYR D 3 37 ? 10.500  -11.273 1.865   1.00 2.72  ? 37 TYR B HA     2  
ATOM 8394  H HB2    . TYR D 3 37 ? 13.189  -12.642 2.098   1.00 3.12  ? 37 TYR B HB2    2  
ATOM 8395  H HB3    . TYR D 3 37 ? 11.613  -13.405 1.951   1.00 2.73  ? 37 TYR B HB3    2  
ATOM 8396  H HD1    . TYR D 3 37 ? 10.419  -13.373 -0.223  1.00 2.73  ? 37 TYR B HD1    2  
ATOM 8397  H HD2    . TYR D 3 37 ? 14.383  -11.876 0.171   1.00 3.87  ? 37 TYR B HD2    2  
ATOM 8398  H HE1    . TYR D 3 37 ? 10.690  -13.449 -2.667  1.00 3.38  ? 37 TYR B HE1    2  
ATOM 8399  H HE2    . TYR D 3 37 ? 14.662  -11.949 -2.267  1.00 4.64  ? 37 TYR B HE2    2  
ATOM 8400  H HH     . TYR D 3 37 ? 13.594  -13.324 -4.212  1.00 4.65  ? 37 TYR B HH     2  
ATOM 8401  N N      . VAL D 3 38 ? 10.505  -10.937 4.329   1.00 2.74  ? 38 VAL B N      2  
ATOM 8402  C CA     . VAL D 3 38 ? 10.476  -10.848 5.783   1.00 2.84  ? 38 VAL B CA     2  
ATOM 8403  C C      . VAL D 3 38 ? 10.265  -12.223 6.414   1.00 3.25  ? 38 VAL B C      2  
ATOM 8404  O O      . VAL D 3 38 ? 9.167   -12.780 6.366   1.00 3.60  ? 38 VAL B O      2  
ATOM 8405  C CB     . VAL D 3 38 ? 9.373   -9.887  6.276   1.00 2.93  ? 38 VAL B CB     2  
ATOM 8406  C CG1    . VAL D 3 38 ? 9.457   -9.698  7.785   1.00 3.28  ? 38 VAL B CG1    2  
ATOM 8407  C CG2    . VAL D 3 38 ? 9.476   -8.544  5.572   1.00 3.00  ? 38 VAL B CG2    2  
ATOM 8408  H H      . VAL D 3 38 ? 9.681   -10.783 3.821   1.00 2.83  ? 38 VAL B H      2  
ATOM 8409  H HA     . VAL D 3 38 ? 11.429  -10.459 6.107   1.00 2.65  ? 38 VAL B HA     2  
ATOM 8410  H HB     . VAL D 3 38 ? 8.413   -10.321 6.040   1.00 3.20  ? 38 VAL B HB     2  
ATOM 8411  H HG11   . VAL D 3 38 ? 8.635   -9.081  8.117   1.00 3.34  ? 38 VAL B HG11   2  
ATOM 8412  H HG12   . VAL D 3 38 ? 10.391  -9.215  8.034   1.00 3.80  ? 38 VAL B HG12   2  
ATOM 8413  H HG13   . VAL D 3 38 ? 9.407   -10.660 8.274   1.00 3.54  ? 38 VAL B HG13   2  
ATOM 8414  H HG21   . VAL D 3 38 ? 10.442  -8.108  5.776   1.00 3.20  ? 38 VAL B HG21   2  
ATOM 8415  H HG22   . VAL D 3 38 ? 8.699   -7.891  5.937   1.00 3.30  ? 38 VAL B HG22   2  
ATOM 8416  H HG23   . VAL D 3 38 ? 9.358   -8.685  4.506   1.00 3.24  ? 38 VAL B HG23   2  
ATOM 8417  N N      . ASP D 3 39 ? 11.324  -12.765 6.994   1.00 3.28  ? 39 ASP B N      2  
ATOM 8418  C CA     . ASP D 3 39 ? 11.262  -14.066 7.643   1.00 3.71  ? 39 ASP B CA     2  
ATOM 8419  C C      . ASP D 3 39 ? 11.520  -13.925 9.139   1.00 3.82  ? 39 ASP B C      2  
ATOM 8420  O O      . ASP D 3 39 ? 12.651  -14.081 9.608   1.00 3.70  ? 39 ASP B O      2  
ATOM 8421  C CB     . ASP D 3 39 ? 12.269  -15.034 7.013   1.00 3.79  ? 39 ASP B CB     2  
ATOM 8422  C CG     . ASP D 3 39 ? 12.295  -16.381 7.709   1.00 4.29  ? 39 ASP B CG     2  
ATOM 8423  O OD1    . ASP D 3 39 ? 11.274  -17.098 7.670   1.00 4.74  ? 39 ASP B OD1    2  
ATOM 8424  O OD2    . ASP D 3 39 ? 13.341  -16.734 8.288   1.00 4.31  ? 39 ASP B OD2    2  
ATOM 8425  H H      . ASP D 3 39 ? 12.180  -12.279 6.981   1.00 3.03  ? 39 ASP B H      2  
ATOM 8426  H HA     . ASP D 3 39 ? 10.265  -14.456 7.500   1.00 3.96  ? 39 ASP B HA     2  
ATOM 8427  H HB2    . ASP D 3 39 ? 12.007  -15.192 5.979   1.00 3.74  ? 39 ASP B HB2    2  
ATOM 8428  H HB3    . ASP D 3 39 ? 13.257  -14.601 7.068   1.00 3.61  ? 39 ASP B HB3    2  
ATOM 8429  N N      . ASP D 3 40 ? 10.460  -13.599 9.873   1.00 4.14  ? 40 ASP B N      2  
ATOM 8430  C CA     . ASP D 3 40 ? 10.523  -13.428 11.325  1.00 4.34  ? 40 ASP B CA     2  
ATOM 8431  C C      . ASP D 3 40 ? 11.460  -12.284 11.709  1.00 3.97  ? 40 ASP B C      2  
ATOM 8432  O O      . ASP D 3 40 ? 11.084  -11.115 11.643  1.00 3.99  ? 40 ASP B O      2  
ATOM 8433  C CB     . ASP D 3 40 ? 10.974  -14.719 12.019  1.00 4.62  ? 40 ASP B CB     2  
ATOM 8434  C CG     . ASP D 3 40 ? 9.967   -15.845 11.917  1.00 4.88  ? 40 ASP B CG     2  
ATOM 8435  O OD1    . ASP D 3 40 ? 8.757   -15.569 12.037  1.00 4.81  ? 40 ASP B OD1    2  
ATOM 8436  O OD2    . ASP D 3 40 ? 10.370  -17.006 11.697  1.00 5.38  ? 40 ASP B OD2    2  
ATOM 8437  H H      . ASP D 3 40 ? 9.601   -13.462 9.422   1.00 4.29  ? 40 ASP B H      2  
ATOM 8438  H HA     . ASP D 3 40 ? 9.529   -13.181 11.666  1.00 4.66  ? 40 ASP B HA     2  
ATOM 8439  H HB2    . ASP D 3 40 ? 11.897  -15.052 11.568  1.00 4.59  ? 40 ASP B HB2    2  
ATOM 8440  H HB3    . ASP D 3 40 ? 11.149  -14.510 13.064  1.00 4.81  ? 40 ASP B HB3    2  
ATOM 8441  N N      . GLU D 3 41 ? 12.681  -12.625 12.107  1.00 3.76  ? 41 GLU B N      2  
ATOM 8442  C CA     . GLU D 3 41 ? 13.662  -11.628 12.505  1.00 3.52  ? 41 GLU B CA     2  
ATOM 8443  C C      . GLU D 3 41 ? 14.744  -11.482 11.439  1.00 3.14  ? 41 GLU B C      2  
ATOM 8444  O O      . GLU D 3 41 ? 15.690  -10.710 11.596  1.00 3.03  ? 41 GLU B O      2  
ATOM 8445  C CB     . GLU D 3 41 ? 14.296  -12.005 13.852  1.00 3.70  ? 41 GLU B CB     2  
ATOM 8446  C CG     . GLU D 3 41 ? 15.115  -13.290 13.820  1.00 3.70  ? 41 GLU B CG     2  
ATOM 8447  C CD     . GLU D 3 41 ? 14.258  -14.540 13.864  1.00 3.35  ? 41 GLU B CD     2  
ATOM 8448  O OE1    . GLU D 3 41 ? 13.890  -14.970 14.977  1.00 3.36  ? 41 GLU B OE1    2  
ATOM 8449  O OE2    . GLU D 3 41 ? 13.954  -15.103 12.789  1.00 3.53  ? 41 GLU B OE2    2  
ATOM 8450  H H      . GLU D 3 41 ? 12.930  -13.578 12.131  1.00 3.87  ? 41 GLU B H      2  
ATOM 8451  H HA     . GLU D 3 41 ? 13.150  -10.684 12.610  1.00 3.59  ? 41 GLU B HA     2  
ATOM 8452  H HB2    . GLU D 3 41 ? 14.943  -11.200 14.167  1.00 3.94  ? 41 GLU B HB2    2  
ATOM 8453  H HB3    . GLU D 3 41 ? 13.510  -12.125 14.584  1.00 3.97  ? 41 GLU B HB3    2  
ATOM 8454  H HG2    . GLU D 3 41 ? 15.695  -13.309 12.909  1.00 3.97  ? 41 GLU B HG2    2  
ATOM 8455  H HG3    . GLU D 3 41 ? 15.781  -13.298 14.669  1.00 4.18  ? 41 GLU B HG3    2  
ATOM 8456  N N      . LYS D 3 42 ? 14.592  -12.228 10.354  1.00 3.05  ? 42 LYS B N      2  
ATOM 8457  C CA     . LYS D 3 42 ? 15.552  -12.195 9.264   1.00 2.79  ? 42 LYS B CA     2  
ATOM 8458  C C      . LYS D 3 42 ? 14.948  -11.519 8.040   1.00 2.62  ? 42 LYS B C      2  
ATOM 8459  O O      . LYS D 3 42 ? 14.140  -12.112 7.326   1.00 2.71  ? 42 LYS B O      2  
ATOM 8460  C CB     . LYS D 3 42 ? 15.991  -13.615 8.893   1.00 3.03  ? 42 LYS B CB     2  
ATOM 8461  C CG     . LYS D 3 42 ? 16.311  -14.499 10.089  1.00 3.52  ? 42 LYS B CG     2  
ATOM 8462  C CD     . LYS D 3 42 ? 16.520  -15.945 9.665   1.00 3.67  ? 42 LYS B CD     2  
ATOM 8463  C CE     . LYS D 3 42 ? 15.860  -16.914 10.637  1.00 4.32  ? 42 LYS B CE     2  
ATOM 8464  N NZ     . LYS D 3 42 ? 14.389  -16.705 10.715  1.00 4.35  ? 42 LYS B NZ     2  
ATOM 8465  H H      . LYS D 3 42 ? 13.803  -12.810 10.280  1.00 3.26  ? 42 LYS B H      2  
ATOM 8466  H HA     . LYS D 3 42 ? 16.411  -11.632 9.590   1.00 2.67  ? 42 LYS B HA     2  
ATOM 8467  H HB2    . LYS D 3 42 ? 15.201  -14.085 8.327   1.00 3.18  ? 42 LYS B HB2    2  
ATOM 8468  H HB3    . LYS D 3 42 ? 16.873  -13.550 8.275   1.00 3.14  ? 42 LYS B HB3    2  
ATOM 8469  H HG2    . LYS D 3 42 ? 17.214  -14.140 10.560  1.00 3.83  ? 42 LYS B HG2    2  
ATOM 8470  H HG3    . LYS D 3 42 ? 15.492  -14.452 10.791  1.00 3.92  ? 42 LYS B HG3    2  
ATOM 8471  H HD2    . LYS D 3 42 ? 16.093  -16.085 8.683   1.00 3.64  ? 42 LYS B HD2    2  
ATOM 8472  H HD3    . LYS D 3 42 ? 17.580  -16.149 9.631   1.00 3.66  ? 42 LYS B HD3    2  
ATOM 8473  H HE2    . LYS D 3 42 ? 16.054  -17.924 10.305  1.00 4.58  ? 42 LYS B HE2    2  
ATOM 8474  H HE3    . LYS D 3 42 ? 16.289  -16.770 11.617  1.00 4.86  ? 42 LYS B HE3    2  
ATOM 8475  H HZ1    . LYS D 3 42 ? 13.936  -17.517 11.180  1.00 4.40  ? 42 LYS B HZ1    2  
ATOM 8476  H HZ2    . LYS D 3 42 ? 13.985  -16.599 9.756   1.00 4.39  ? 42 LYS B HZ2    2  
ATOM 8477  H HZ3    . LYS D 3 42 ? 14.180  -15.843 11.271  1.00 4.60  ? 42 LYS B HZ3    2  
ATOM 8478  N N      . ILE D 3 43 ? 15.327  -10.276 7.808   1.00 2.42  ? 43 ILE B N      2  
ATOM 8479  C CA     . ILE D 3 43 ? 14.829  -9.543  6.658   1.00 2.27  ? 43 ILE B CA     2  
ATOM 8480  C C      . ILE D 3 43 ? 15.779  -9.743  5.483   1.00 2.15  ? 43 ILE B C      2  
ATOM 8481  O O      . ILE D 3 43 ? 16.794  -9.055  5.360   1.00 2.06  ? 43 ILE B O      2  
ATOM 8482  C CB     . ILE D 3 43 ? 14.668  -8.039  6.961   1.00 2.19  ? 43 ILE B CB     2  
ATOM 8483  C CG1    . ILE D 3 43 ? 13.859  -7.842  8.247   1.00 2.33  ? 43 ILE B CG1    2  
ATOM 8484  C CG2    . ILE D 3 43 ? 13.994  -7.331  5.794   1.00 2.17  ? 43 ILE B CG2    2  
ATOM 8485  C CD1    . ILE D 3 43 ? 13.789  -6.403  8.709   1.00 2.28  ? 43 ILE B CD1    2  
ATOM 8486  H H      . ILE D 3 43 ? 15.960  -9.841  8.422   1.00 2.40  ? 43 ILE B H      2  
ATOM 8487  H HA     . ILE D 3 43 ? 13.860  -9.948  6.399   1.00 2.38  ? 43 ILE B HA     2  
ATOM 8488  H HB     . ILE D 3 43 ? 15.651  -7.613  7.092   1.00 2.11  ? 43 ILE B HB     2  
ATOM 8489  H HG12   . ILE D 3 43 ? 12.848  -8.185  8.082   1.00 2.49  ? 43 ILE B HG12   2  
ATOM 8490  H HG13   . ILE D 3 43 ? 14.309  -8.424  9.040   1.00 2.56  ? 43 ILE B HG13   2  
ATOM 8491  H HG21   . ILE D 3 43 ? 12.991  -7.710  5.671   1.00 2.30  ? 43 ILE B HG21   2  
ATOM 8492  H HG22   . ILE D 3 43 ? 14.558  -7.506  4.889   1.00 2.18  ? 43 ILE B HG22   2  
ATOM 8493  H HG23   . ILE D 3 43 ? 13.955  -6.271  5.993   1.00 2.55  ? 43 ILE B HG23   2  
ATOM 8494  H HD11   . ILE D 3 43 ? 13.107  -6.328  9.544   1.00 2.49  ? 43 ILE B HD11   2  
ATOM 8495  H HD12   . ILE D 3 43 ? 13.440  -5.780  7.900   1.00 2.19  ? 43 ILE B HD12   2  
ATOM 8496  H HD13   . ILE D 3 43 ? 14.771  -6.077  9.016   1.00 2.82  ? 43 ILE B HD13   2  
ATOM 8497  N N      . ILE D 3 44 ? 15.457  -10.708 4.637   1.00 2.23  ? 44 ILE B N      2  
ATOM 8498  C CA     . ILE D 3 44 ? 16.288  -11.030 3.483   1.00 2.16  ? 44 ILE B CA     2  
ATOM 8499  C C      . ILE D 3 44 ? 16.018  -10.070 2.330   1.00 2.04  ? 44 ILE B C      2  
ATOM 8500  O O      . ILE D 3 44 ? 14.886  -9.939  1.870   1.00 2.13  ? 44 ILE B O      2  
ATOM 8501  C CB     . ILE D 3 44 ? 16.056  -12.481 3.014   1.00 2.34  ? 44 ILE B CB     2  
ATOM 8502  C CG1    . ILE D 3 44 ? 16.119  -13.435 4.208   1.00 2.51  ? 44 ILE B CG1    2  
ATOM 8503  C CG2    . ILE D 3 44 ? 17.086  -12.870 1.962   1.00 2.30  ? 44 ILE B CG2    2  
ATOM 8504  C CD1    . ILE D 3 44 ? 15.604  -14.827 3.907   1.00 2.69  ? 44 ILE B CD1    2  
ATOM 8505  H H      . ILE D 3 44 ? 14.627  -11.212 4.783   1.00 2.38  ? 44 ILE B H      2  
ATOM 8506  H HA     . ILE D 3 44 ? 17.321  -10.932 3.782   1.00 2.13  ? 44 ILE B HA     2  
ATOM 8507  H HB     . ILE D 3 44 ? 15.079  -12.541 2.566   1.00 2.42  ? 44 ILE B HB     2  
ATOM 8508  H HG12   . ILE D 3 44 ? 17.144  -13.526 4.535   1.00 2.49  ? 44 ILE B HG12   2  
ATOM 8509  H HG13   . ILE D 3 44 ? 15.524  -13.028 5.014   1.00 2.55  ? 44 ILE B HG13   2  
ATOM 8510  H HG21   . ILE D 3 44 ? 17.098  -12.129 1.179   1.00 2.52  ? 44 ILE B HG21   2  
ATOM 8511  H HG22   . ILE D 3 44 ? 16.825  -13.829 1.544   1.00 2.52  ? 44 ILE B HG22   2  
ATOM 8512  H HG23   . ILE D 3 44 ? 18.063  -12.929 2.418   1.00 2.30  ? 44 ILE B HG23   2  
ATOM 8513  H HD11   . ILE D 3 44 ? 15.579  -15.408 4.816   1.00 3.18  ? 44 ILE B HD11   2  
ATOM 8514  H HD12   . ILE D 3 44 ? 16.257  -15.306 3.190   1.00 2.60  ? 44 ILE B HD12   2  
ATOM 8515  H HD13   . ILE D 3 44 ? 14.608  -14.760 3.496   1.00 2.93  ? 44 ILE B HD13   2  
ATOM 8516  N N      . LEU D 3 45 ? 17.066  -9.404  1.876   1.00 1.88  ? 45 LEU B N      2  
ATOM 8517  C CA     . LEU D 3 45 ? 16.963  -8.450  0.788   1.00 1.79  ? 45 LEU B CA     2  
ATOM 8518  C C      . LEU D 3 45 ? 17.752  -8.920  -0.423  1.00 1.83  ? 45 LEU B C      2  
ATOM 8519  O O      . LEU D 3 45 ? 18.982  -9.009  -0.380  1.00 1.94  ? 45 LEU B O      2  
ATOM 8520  C CB     . LEU D 3 45 ? 17.495  -7.088  1.236   1.00 1.72  ? 45 LEU B CB     2  
ATOM 8521  C CG     . LEU D 3 45 ? 16.439  -6.018  1.509   1.00 1.49  ? 45 LEU B CG     2  
ATOM 8522  C CD1    . LEU D 3 45 ? 15.704  -6.315  2.806   1.00 1.60  ? 45 LEU B CD1    2  
ATOM 8523  C CD2    . LEU D 3 45 ? 17.082  -4.639  1.562   1.00 2.36  ? 45 LEU B CD2    2  
ATOM 8524  H H      . LEU D 3 45 ? 17.945  -9.559  2.288   1.00 1.88  ? 45 LEU B H      2  
ATOM 8525  H HA     . LEU D 3 45 ? 15.925  -8.352  0.516   1.00 1.80  ? 45 LEU B HA     2  
ATOM 8526  H HB2    . LEU D 3 45 ? 18.068  -7.238  2.140   1.00 1.95  ? 45 LEU B HB2    2  
ATOM 8527  H HB3    . LEU D 3 45 ? 18.160  -6.716  0.471   1.00 2.19  ? 45 LEU B HB3    2  
ATOM 8528  H HG     . LEU D 3 45 ? 15.715  -6.020  0.705   1.00 1.74  ? 45 LEU B HG     2  
ATOM 8529  H HD11   . LEU D 3 45 ? 15.001  -5.521  3.011   1.00 2.13  ? 45 LEU B HD11   2  
ATOM 8530  H HD12   . LEU D 3 45 ? 16.415  -6.387  3.616   1.00 2.10  ? 45 LEU B HD12   2  
ATOM 8531  H HD13   . LEU D 3 45 ? 15.170  -7.250  2.711   1.00 1.80  ? 45 LEU B HD13   2  
ATOM 8532  H HD21   . LEU D 3 45 ? 16.313  -3.884  1.653   1.00 2.57  ? 45 LEU B HD21   2  
ATOM 8533  H HD22   . LEU D 3 45 ? 17.645  -4.468  0.656   1.00 2.84  ? 45 LEU B HD22   2  
ATOM 8534  H HD23   . LEU D 3 45 ? 17.743  -4.584  2.414   1.00 2.95  ? 45 LEU B HD23   2  
ATOM 8535  N N      . LYS D 3 46 ? 17.047  -9.240  -1.494  1.00 1.83  ? 46 LYS B N      2  
ATOM 8536  C CA     . LYS D 3 46 ? 17.694  -9.666  -2.720  1.00 1.90  ? 46 LYS B CA     2  
ATOM 8537  C C      . LYS D 3 46 ? 17.842  -8.464  -3.638  1.00 2.05  ? 46 LYS B C      2  
ATOM 8538  O O      . LYS D 3 46 ? 16.868  -7.740  -3.865  1.00 1.91  ? 46 LYS B O      2  
ATOM 8539  C CB     . LYS D 3 46 ? 16.900  -10.775 -3.414  1.00 1.85  ? 46 LYS B CB     2  
ATOM 8540  C CG     . LYS D 3 46 ? 17.657  -11.429 -4.553  1.00 2.24  ? 46 LYS B CG     2  
ATOM 8541  C CD     . LYS D 3 46 ? 16.779  -12.403 -5.317  1.00 2.19  ? 46 LYS B CD     2  
ATOM 8542  C CE     . LYS D 3 46 ? 17.564  -13.127 -6.401  1.00 2.77  ? 46 LYS B CE     2  
ATOM 8543  N NZ     . LYS D 3 46 ? 18.563  -14.070 -5.832  1.00 3.21  ? 46 LYS B NZ     2  
ATOM 8544  H H      . LYS D 3 46 ? 16.067  -9.178  -1.460  1.00 1.83  ? 46 LYS B H      2  
ATOM 8545  H HA     . LYS D 3 46 ? 18.678  -10.034 -2.463  1.00 1.95  ? 46 LYS B HA     2  
ATOM 8546  H HB2    . LYS D 3 46 ? 16.656  -11.538 -2.691  1.00 2.20  ? 46 LYS B HB2    2  
ATOM 8547  H HB3    . LYS D 3 46 ? 15.986  -10.358 -3.810  1.00 1.88  ? 46 LYS B HB3    2  
ATOM 8548  H HG2    . LYS D 3 46 ? 18.002  -10.661 -5.229  1.00 2.59  ? 46 LYS B HG2    2  
ATOM 8549  H HG3    . LYS D 3 46 ? 18.504  -11.964 -4.147  1.00 2.82  ? 46 LYS B HG3    2  
ATOM 8550  H HD2    . LYS D 3 46 ? 16.381  -13.130 -4.626  1.00 2.11  ? 46 LYS B HD2    2  
ATOM 8551  H HD3    . LYS D 3 46 ? 15.967  -11.856 -5.777  1.00 2.54  ? 46 LYS B HD3    2  
ATOM 8552  H HE2    . LYS D 3 46 ? 16.875  -13.679 -7.019  1.00 3.12  ? 46 LYS B HE2    2  
ATOM 8553  H HE3    . LYS D 3 46 ? 18.078  -12.393 -7.004  1.00 3.18  ? 46 LYS B HE3    2  
ATOM 8554  H HZ1    . LYS D 3 46 ? 18.124  -14.655 -5.095  1.00 3.60  ? 46 LYS B HZ1    2  
ATOM 8555  H HZ2    . LYS D 3 46 ? 19.364  -13.544 -5.413  1.00 3.67  ? 46 LYS B HZ2    2  
ATOM 8556  H HZ3    . LYS D 3 46 ? 18.930  -14.693 -6.579  1.00 3.29  ? 46 LYS B HZ3    2  
ATOM 8557  N N      . LYS D 3 47 ? 19.054  -8.263  -4.156  1.00 2.41  ? 47 LYS B N      2  
ATOM 8558  C CA     . LYS D 3 47 ? 19.347  -7.125  -5.024  1.00 2.65  ? 47 LYS B CA     2  
ATOM 8559  C C      . LYS D 3 47 ? 18.387  -7.060  -6.205  1.00 2.63  ? 47 LYS B C      2  
ATOM 8560  O O      . LYS D 3 47 ? 17.654  -6.086  -6.358  1.00 2.89  ? 47 LYS B O      2  
ATOM 8561  C CB     . LYS D 3 47 ? 20.788  -7.189  -5.543  1.00 2.89  ? 47 LYS B CB     2  
ATOM 8562  C CG     . LYS D 3 47 ? 21.842  -7.303  -4.449  1.00 2.96  ? 47 LYS B CG     2  
ATOM 8563  C CD     . LYS D 3 47 ? 23.233  -6.983  -4.984  1.00 3.38  ? 47 LYS B CD     2  
ATOM 8564  C CE     . LYS D 3 47 ? 24.141  -8.207  -4.987  1.00 3.60  ? 47 LYS B CE     2  
ATOM 8565  N NZ     . LYS D 3 47 ? 23.624  -9.299  -5.860  1.00 3.66  ? 47 LYS B NZ     2  
ATOM 8566  H H      . LYS D 3 47 ? 19.764  -8.908  -3.963  1.00 2.57  ? 47 LYS B H      2  
ATOM 8567  H HA     . LYS D 3 47 ? 19.231  -6.226  -4.438  1.00 2.77  ? 47 LYS B HA     2  
ATOM 8568  H HB2    . LYS D 3 47 ? 20.884  -8.042  -6.193  1.00 3.04  ? 47 LYS B HB2    2  
ATOM 8569  H HB3    . LYS D 3 47 ? 20.989  -6.293  -6.113  1.00 3.30  ? 47 LYS B HB3    2  
ATOM 8570  H HG2    . LYS D 3 47 ? 21.603  -6.607  -3.659  1.00 3.02  ? 47 LYS B HG2    2  
ATOM 8571  H HG3    . LYS D 3 47 ? 21.836  -8.310  -4.061  1.00 3.08  ? 47 LYS B HG3    2  
ATOM 8572  H HD2    . LYS D 3 47 ? 23.143  -6.615  -5.995  1.00 3.51  ? 47 LYS B HD2    2  
ATOM 8573  H HD3    . LYS D 3 47 ? 23.677  -6.220  -4.363  1.00 3.76  ? 47 LYS B HD3    2  
ATOM 8574  H HE2    . LYS D 3 47 ? 25.117  -7.909  -5.341  1.00 3.72  ? 47 LYS B HE2    2  
ATOM 8575  H HE3    . LYS D 3 47 ? 24.224  -8.576  -3.976  1.00 4.11  ? 47 LYS B HE3    2  
ATOM 8576  H HZ1    . LYS D 3 47 ? 24.410  -9.898  -6.187  1.00 4.02  ? 47 LYS B HZ1    2  
ATOM 8577  H HZ2    . LYS D 3 47 ? 23.143  -8.903  -6.690  1.00 3.69  ? 47 LYS B HZ2    2  
ATOM 8578  H HZ3    . LYS D 3 47 ? 22.951  -9.895  -5.329  1.00 3.79  ? 47 LYS B HZ3    2  
ATOM 8579  N N      . TYR D 3 48 ? 18.394  -8.097  -7.033  1.00 2.82  ? 48 TYR B N      2  
ATOM 8580  C CA     . TYR D 3 48 ? 17.521  -8.143  -8.194  1.00 2.91  ? 48 TYR B CA     2  
ATOM 8581  C C      . TYR D 3 48 ? 17.518  -9.531  -8.811  1.00 2.75  ? 48 TYR B C      2  
ATOM 8582  O O      . TYR D 3 48 ? 18.390  -10.351 -8.526  1.00 2.99  ? 48 TYR B O      2  
ATOM 8583  C CB     . TYR D 3 48 ? 17.960  -7.111  -9.248  1.00 3.61  ? 48 TYR B CB     2  
ATOM 8584  C CG     . TYR D 3 48 ? 19.390  -7.277  -9.726  1.00 3.83  ? 48 TYR B CG     2  
ATOM 8585  C CD1    . TYR D 3 48 ? 19.711  -8.196  -10.721 1.00 4.05  ? 48 TYR B CD1    2  
ATOM 8586  C CD2    . TYR D 3 48 ? 20.422  -6.517  -9.184  1.00 4.08  ? 48 TYR B CD2    2  
ATOM 8587  C CE1    . TYR D 3 48 ? 21.011  -8.353  -11.160 1.00 4.46  ? 48 TYR B CE1    2  
ATOM 8588  C CE2    . TYR D 3 48 ? 21.725  -6.668  -9.618  1.00 4.48  ? 48 TYR B CE2    2  
ATOM 8589  C CZ     . TYR D 3 48 ? 22.014  -7.588  -10.606 1.00 4.65  ? 48 TYR B CZ     2  
ATOM 8590  O OH     . TYR D 3 48 ? 23.313  -7.745  -11.041 1.00 5.20  ? 48 TYR B OH     2  
ATOM 8591  H H      . TYR D 3 48 ? 19.000  -8.848  -6.861  1.00 3.19  ? 48 TYR B H      2  
ATOM 8592  H HA     . TYR D 3 48 ? 16.520  -7.905  -7.866  1.00 2.86  ? 48 TYR B HA     2  
ATOM 8593  H HB2    . TYR D 3 48 ? 17.315  -7.194  -10.109 1.00 3.98  ? 48 TYR B HB2    2  
ATOM 8594  H HB3    . TYR D 3 48 ? 17.863  -6.120  -8.829  1.00 3.85  ? 48 TYR B HB3    2  
ATOM 8595  H HD1    . TYR D 3 48 ? 18.924  -8.795  -11.156 1.00 4.07  ? 48 TYR B HD1    2  
ATOM 8596  H HD2    . TYR D 3 48 ? 20.191  -5.796  -8.411  1.00 4.11  ? 48 TYR B HD2    2  
ATOM 8597  H HE1    . TYR D 3 48 ? 21.238  -9.070  -11.933 1.00 4.77  ? 48 TYR B HE1    2  
ATOM 8598  H HE2    . TYR D 3 48 ? 22.511  -6.070  -9.182  1.00 4.81  ? 48 TYR B HE2    2  
ATOM 8599  H HH     . TYR D 3 48 ? 23.425  -7.297  -11.889 1.00 5.30  ? 48 TYR B HH     2  
ATOM 8600  N N      . LYS D 3 49 ? 16.523  -9.781  -9.645  1.00 2.64  ? 49 LYS B N      2  
ATOM 8601  C CA     . LYS D 3 49 ? 16.392  -11.041 -10.351 1.00 2.68  ? 49 LYS B CA     2  
ATOM 8602  C C      . LYS D 3 49 ? 15.501  -10.824 -11.570 1.00 2.66  ? 49 LYS B C      2  
ATOM 8603  O O      . LYS D 3 49 ? 14.468  -10.159 -11.470 1.00 2.66  ? 49 LYS B O      2  
ATOM 8604  C CB     . LYS D 3 49 ? 15.843  -12.151 -9.427  1.00 2.92  ? 49 LYS B CB     2  
ATOM 8605  C CG     . LYS D 3 49 ? 14.347  -12.411 -9.533  1.00 3.67  ? 49 LYS B CG     2  
ATOM 8606  C CD     . LYS D 3 49 ? 13.540  -11.520 -8.601  1.00 4.07  ? 49 LYS B CD     2  
ATOM 8607  C CE     . LYS D 3 49 ? 12.050  -11.803 -8.721  1.00 4.67  ? 49 LYS B CE     2  
ATOM 8608  N NZ     . LYS D 3 49 ? 11.239  -10.879 -7.890  1.00 5.10  ? 49 LYS B NZ     2  
ATOM 8609  H H      . LYS D 3 49 ? 15.844  -9.086  -9.791  1.00 2.73  ? 49 LYS B H      2  
ATOM 8610  H HA     . LYS D 3 49 ? 17.379  -11.324 -10.691 1.00 2.83  ? 49 LYS B HA     2  
ATOM 8611  H HB2    . LYS D 3 49 ? 16.354  -13.073 -9.663  1.00 3.15  ? 49 LYS B HB2    2  
ATOM 8612  H HB3    . LYS D 3 49 ? 16.067  -11.886 -8.403  1.00 2.97  ? 49 LYS B HB3    2  
ATOM 8613  H HG2    . LYS D 3 49 ? 14.033  -12.227 -10.548 1.00 3.84  ? 49 LYS B HG2    2  
ATOM 8614  H HG3    . LYS D 3 49 ? 14.155  -13.445 -9.279  1.00 4.23  ? 49 LYS B HG3    2  
ATOM 8615  H HD2    . LYS D 3 49 ? 13.851  -11.705 -7.583  1.00 4.45  ? 49 LYS B HD2    2  
ATOM 8616  H HD3    . LYS D 3 49 ? 13.725  -10.488 -8.857  1.00 4.02  ? 49 LYS B HD3    2  
ATOM 8617  H HE2    . LYS D 3 49 ? 11.758  -11.691 -9.757  1.00 5.04  ? 49 LYS B HE2    2  
ATOM 8618  H HE3    . LYS D 3 49 ? 11.860  -12.818 -8.404  1.00 4.83  ? 49 LYS B HE3    2  
ATOM 8619  H HZ1    . LYS D 3 49 ? 11.319  -11.134 -6.879  1.00 5.19  ? 49 LYS B HZ1    2  
ATOM 8620  H HZ2    . LYS D 3 49 ? 10.240  -10.931 -8.170  1.00 5.48  ? 49 LYS B HZ2    2  
ATOM 8621  H HZ3    . LYS D 3 49 ? 11.570  -9.900  -8.015  1.00 5.34  ? 49 LYS B HZ3    2  
ATOM 8622  N N      . PRO D 3 50 ? 15.914  -11.326 -12.747 1.00 2.93  ? 50 PRO B N      2  
ATOM 8623  C CA     . PRO D 3 50 ? 15.139  -11.172 -13.980 1.00 2.99  ? 50 PRO B CA     2  
ATOM 8624  C C      . PRO D 3 50 ? 13.713  -11.698 -13.831 1.00 2.89  ? 50 PRO B C      2  
ATOM 8625  O O      . PRO D 3 50 ? 12.757  -10.919 -13.861 1.00 2.94  ? 50 PRO B O      2  
ATOM 8626  C CB     . PRO D 3 50 ? 15.914  -11.990 -15.022 1.00 3.55  ? 50 PRO B CB     2  
ATOM 8627  C CG     . PRO D 3 50 ? 16.898  -12.809 -14.250 1.00 3.81  ? 50 PRO B CG     2  
ATOM 8628  C CD     . PRO D 3 50 ? 17.164  -12.068 -12.974 1.00 3.45  ? 50 PRO B CD     2  
ATOM 8629  H HA     . PRO D 3 50 ? 15.102  -10.137 -14.291 1.00 3.07  ? 50 PRO B HA     2  
ATOM 8630  H HB2    . PRO D 3 50 ? 15.227  -12.619 -15.571 1.00 3.67  ? 50 PRO B HB2    2  
ATOM 8631  H HB3    . PRO D 3 50 ? 16.413  -11.318 -15.703 1.00 3.88  ? 50 PRO B HB3    2  
ATOM 8632  H HG2    . PRO D 3 50 ? 16.479  -13.780 -14.038 1.00 4.11  ? 50 PRO B HG2    2  
ATOM 8633  H HG3    . PRO D 3 50 ? 17.810  -12.913 -14.819 1.00 4.18  ? 50 PRO B HG3    2  
ATOM 8634  H HD2    . PRO D 3 50 ? 17.357  -12.760 -12.165 1.00 3.67  ? 50 PRO B HD2    2  
ATOM 8635  H HD3    . PRO D 3 50 ? 17.997  -11.392 -13.099 1.00 3.60  ? 50 PRO B HD3    2  
ATOM 8636  N N      . ASN D 3 51 ? 13.592  -13.015 -13.644 1.00 3.21  ? 51 ASN B N      2  
ATOM 8637  C CA     . ASN D 3 51 ? 12.300  -13.683 -13.489 1.00 3.58  ? 51 ASN B CA     2  
ATOM 8638  C C      . ASN D 3 51 ? 11.412  -13.459 -14.710 1.00 3.80  ? 51 ASN B C      2  
ATOM 8639  O O      . ASN D 3 51 ? 10.876  -12.367 -14.918 1.00 4.25  ? 51 ASN B O      2  
ATOM 8640  C CB     . ASN D 3 51 ? 11.587  -13.209 -12.216 1.00 3.65  ? 51 ASN B CB     2  
ATOM 8641  C CG     . ASN D 3 51 ? 10.335  -14.011 -11.912 1.00 4.52  ? 51 ASN B CG     2  
ATOM 8642  O OD1    . ASN D 3 51 ? 10.216  -15.177 -12.289 1.00 5.20  ? 51 ASN B OD1    2  
ATOM 8643  N ND2    . ASN D 3 51 ? 9.397   -13.394 -11.219 1.00 4.79  ? 51 ASN B ND2    2  
ATOM 8644  H H      . ASN D 3 51 ? 14.408  -13.560 -13.603 1.00 3.46  ? 51 ASN B H      2  
ATOM 8645  H HA     . ASN D 3 51 ? 12.491  -14.744 -13.402 1.00 4.06  ? 51 ASN B HA     2  
ATOM 8646  H HB2    . ASN D 3 51 ? 12.258  -13.302 -11.378 1.00 3.72  ? 51 ASN B HB2    2  
ATOM 8647  H HB3    . ASN D 3 51 ? 11.308  -12.172 -12.336 1.00 3.39  ? 51 ASN B HB3    2  
ATOM 8648  H HD21   . ASN D 3 51 ? 9.563   -12.467 -10.939 1.00 4.51  ? 51 ASN B HD21   2  
ATOM 8649  H HD22   . ASN D 3 51 ? 8.567   -13.879 -11.022 1.00 5.44  ? 51 ASN B HD22   2  
ATOM 8650  N N      . MET D 3 52 ? 11.267  -14.494 -15.520 1.00 3.93  ? 52 MET B N      2  
ATOM 8651  C CA     . MET D 3 52 ? 10.448  -14.409 -16.717 1.00 4.51  ? 52 MET B CA     2  
ATOM 8652  C C      . MET D 3 52 ? 8.969   -14.380 -16.344 1.00 4.64  ? 52 MET B C      2  
ATOM 8653  O O      . MET D 3 52 ? 8.288   -15.407 -16.359 1.00 4.72  ? 52 MET B O      2  
ATOM 8654  C CB     . MET D 3 52 ? 10.740  -15.586 -17.649 1.00 5.13  ? 52 MET B CB     2  
ATOM 8655  C CG     . MET D 3 52 ? 10.757  -15.212 -19.120 1.00 5.19  ? 52 MET B CG     2  
ATOM 8656  S SD     . MET D 3 52 ? 9.173   -14.587 -19.706 1.00 5.94  ? 52 MET B SD     2  
ATOM 8657  C CE     . MET D 3 52 ? 9.594   -14.176 -21.397 1.00 6.19  ? 52 MET B CE     2  
ATOM 8658  H H      . MET D 3 52 ? 11.721  -15.338 -15.305 1.00 3.93  ? 52 MET B H      2  
ATOM 8659  H HA     . MET D 3 52 ? 10.699  -13.488 -17.223 1.00 4.66  ? 52 MET B HA     2  
ATOM 8660  H HB2    . MET D 3 52 ? 11.705  -15.999 -17.396 1.00 5.48  ? 52 MET B HB2    2  
ATOM 8661  H HB3    . MET D 3 52 ? 9.984   -16.345 -17.501 1.00 5.57  ? 52 MET B HB3    2  
ATOM 8662  H HG2    . MET D 3 52 ? 11.504  -14.449 -19.274 1.00 4.95  ? 52 MET B HG2    2  
ATOM 8663  H HG3    . MET D 3 52 ? 11.018  -16.088 -19.695 1.00 5.42  ? 52 MET B HG3    2  
ATOM 8664  H HE1    . MET D 3 52 ? 8.704   -13.877 -21.927 1.00 6.43  ? 52 MET B HE1    2  
ATOM 8665  H HE2    . MET D 3 52 ? 10.026  -15.039 -21.880 1.00 6.28  ? 52 MET B HE2    2  
ATOM 8666  H HE3    . MET D 3 52 ? 10.306  -13.365 -21.404 1.00 6.35  ? 52 MET B HE3    2  
ATOM 8667  N N      . THR D 3 53 ? 8.482   -13.207 -15.980 1.00 4.77  ? 53 THR B N      2  
ATOM 8668  C CA     . THR D 3 53 ? 7.094   -13.041 -15.595 1.00 4.99  ? 53 THR B CA     2  
ATOM 8669  C C      . THR D 3 53 ? 6.215   -12.746 -16.802 1.00 4.92  ? 53 THR B C      2  
ATOM 8670  O O      . THR D 3 53 ? 6.647   -12.095 -17.758 1.00 5.08  ? 53 THR B O      2  
ATOM 8671  C CB     . THR D 3 53 ? 6.938   -11.903 -14.573 1.00 5.26  ? 53 THR B CB     2  
ATOM 8672  O OG1    . THR D 3 53 ? 7.985   -10.937 -14.753 1.00 5.25  ? 53 THR B OG1    2  
ATOM 8673  C CG2    . THR D 3 53 ? 6.965   -12.438 -13.149 1.00 5.42  ? 53 THR B CG2    2  
ATOM 8674  H H      . THR D 3 53 ? 9.077   -12.425 -15.954 1.00 4.79  ? 53 THR B H      2  
ATOM 8675  H HA     . THR D 3 53 ? 6.763   -13.960 -15.134 1.00 5.13  ? 53 THR B HA     2  
ATOM 8676  H HB     . THR D 3 53 ? 5.987   -11.421 -14.741 1.00 5.52  ? 53 THR B HB     2  
ATOM 8677  H HG1    . THR D 3 53 ? 7.600   -10.116 -15.100 1.00 5.36  ? 53 THR B HG1    2  
ATOM 8678  H HG21   . THR D 3 53 ? 6.811   -11.625 -12.456 1.00 5.68  ? 53 THR B HG21   2  
ATOM 8679  H HG22   . THR D 3 53 ? 7.923   -12.900 -12.953 1.00 5.63  ? 53 THR B HG22   2  
ATOM 8680  H HG23   . THR D 3 53 ? 6.181   -13.169 -13.025 1.00 5.39  ? 53 THR B HG23   2  
ATOM 8681  N N      . CYS D 3 54 ? 4.991   -13.241 -16.754 1.00 4.89  ? 54 CYS B N      2  
ATOM 8682  C CA     . CYS D 3 54 ? 4.037   -13.021 -17.822 1.00 4.84  ? 54 CYS B CA     2  
ATOM 8683  C C      . CYS D 3 54 ? 3.584   -11.570 -17.810 1.00 5.18  ? 54 CYS B C      2  
ATOM 8684  O O      . CYS D 3 54 ? 2.968   -11.112 -16.843 1.00 5.52  ? 54 CYS B O      2  
ATOM 8685  C CB     . CYS D 3 54 ? 2.838   -13.953 -17.645 1.00 4.63  ? 54 CYS B CB     2  
ATOM 8686  S SG     . CYS D 3 54 ? 2.535   -14.438 -15.909 1.00 4.47  ? 54 CYS B SG     2  
ATOM 8687  H H      . CYS D 3 54 ? 4.718   -13.770 -15.975 1.00 5.03  ? 54 CYS B H      2  
ATOM 8688  H HA     . CYS D 3 54 ? 4.522   -13.234 -18.761 1.00 4.82  ? 54 CYS B HA     2  
ATOM 8689  H HB2    . CYS D 3 54 ? 1.949   -13.461 -18.008 1.00 4.56  ? 54 CYS B HB2    2  
ATOM 8690  H HB3    . CYS D 3 54 ? 3.005   -14.854 -18.215 1.00 5.03  ? 54 CYS B HB3    2  
ATOM 8691  N N      . GLN D 3 55 ? 3.914   -10.839 -18.864 1.00 5.28  ? 55 GLN B N      2  
ATOM 8692  C CA     . GLN D 3 55 ? 3.538   -9.436  -18.964 1.00 5.65  ? 55 GLN B CA     2  
ATOM 8693  C C      . GLN D 3 55 ? 3.093   -9.101  -20.383 1.00 6.20  ? 55 GLN B C      2  
ATOM 8694  O O      . GLN D 3 55 ? 3.178   -9.944  -21.283 1.00 6.38  ? 55 GLN B O      2  
ATOM 8695  C CB     . GLN D 3 55 ? 4.709   -8.542  -18.552 1.00 5.50  ? 55 GLN B CB     2  
ATOM 8696  C CG     . GLN D 3 55 ? 5.059   -8.641  -17.076 1.00 5.31  ? 55 GLN B CG     2  
ATOM 8697  C CD     . GLN D 3 55 ? 6.445   -8.108  -16.762 1.00 5.64  ? 55 GLN B CD     2  
ATOM 8698  O OE1    . GLN D 3 55 ? 7.129   -8.607  -15.867 1.00 5.90  ? 55 GLN B OE1    2  
ATOM 8699  N NE2    . GLN D 3 55 ? 6.872   -7.095  -17.499 1.00 5.94  ? 55 GLN B NE2    2  
ATOM 8700  H H      . GLN D 3 55 ? 4.419   -11.252 -19.596 1.00 5.22  ? 55 GLN B H      2  
ATOM 8701  H HA     . GLN D 3 55 ? 2.712   -9.267  -18.290 1.00 5.91  ? 55 GLN B HA     2  
ATOM 8702  H HB2    . GLN D 3 55 ? 5.582   -8.820  -19.126 1.00 5.65  ? 55 GLN B HB2    2  
ATOM 8703  H HB3    . GLN D 3 55 ? 4.456   -7.517  -18.772 1.00 5.78  ? 55 GLN B HB3    2  
ATOM 8704  H HG2    . GLN D 3 55 ? 4.337   -8.070  -16.510 1.00 5.45  ? 55 GLN B HG2    2  
ATOM 8705  H HG3    . GLN D 3 55 ? 5.010   -9.677  -16.775 1.00 5.23  ? 55 GLN B HG3    2  
ATOM 8706  H HE21   . GLN D 3 55 ? 6.282   -6.747  -18.199 1.00 5.95  ? 55 GLN B HE21   2  
ATOM 8707  H HE22   . GLN D 3 55 ? 7.766   -6.733  -17.316 1.00 6.32  ? 55 GLN B HE22   2  
ATOM 8708  N N      . MET E 3 1  ? -35.092 -3.361  -6.811  1.00 6.49  ? 1  MET C N      2  
ATOM 8709  C CA     . MET E 3 1  ? -35.300 -3.074  -8.223  1.00 6.35  ? 1  MET C CA     2  
ATOM 8710  C C      . MET E 3 1  ? -34.804 -4.229  -9.076  1.00 6.05  ? 1  MET C C      2  
ATOM 8711  O O      . MET E 3 1  ? -35.598 -4.964  -9.662  1.00 6.52  ? 1  MET C O      2  
ATOM 8712  C CB     . MET E 3 1  ? -34.566 -1.790  -8.619  1.00 6.63  ? 1  MET C CB     2  
ATOM 8713  C CG     . MET E 3 1  ? -34.802 -0.635  -7.664  1.00 7.04  ? 1  MET C CG     2  
ATOM 8714  S SD     . MET E 3 1  ? -33.284 0.262   -7.289  1.00 7.43  ? 1  MET C SD     2  
ATOM 8715  C CE     . MET E 3 1  ? -33.772 1.106   -5.790  1.00 7.80  ? 1  MET C CE     2  
ATOM 8716  H H1     . MET E 3 1  ? -35.569 -4.113  -6.401  1.00 6.67  ? 1  MET C H1     2  
ATOM 8717  H HA     . MET E 3 1  ? -36.361 -2.945  -8.390  1.00 6.44  ? 1  MET C HA     2  
ATOM 8718  H HB2    . MET E 3 1  ? -33.506 -1.993  -8.648  1.00 6.66  ? 1  MET C HB2    2  
ATOM 8719  H HB3    . MET E 3 1  ? -34.891 -1.489  -9.603  1.00 6.83  ? 1  MET C HB3    2  
ATOM 8720  H HG2    . MET E 3 1  ? -35.509 0.048   -8.112  1.00 7.25  ? 1  MET C HG2    2  
ATOM 8721  H HG3    . MET E 3 1  ? -35.212 -1.025  -6.744  1.00 7.26  ? 1  MET C HG3    2  
ATOM 8722  H HE1    . MET E 3 1  ? -34.685 1.653   -5.969  1.00 7.87  ? 1  MET C HE1    2  
ATOM 8723  H HE2    . MET E 3 1  ? -32.993 1.792   -5.494  1.00 8.00  ? 1  MET C HE2    2  
ATOM 8724  H HE3    . MET E 3 1  ? -33.932 0.383   -5.004  1.00 8.00  ? 1  MET C HE3    2  
ATOM 8725  N N      . LYS E 3 2  ? -33.488 -4.396  -9.122  1.00 5.46  ? 2  LYS C N      2  
ATOM 8726  C CA     . LYS E 3 2  ? -32.880 -5.458  -9.908  1.00 5.21  ? 2  LYS C CA     2  
ATOM 8727  C C      . LYS E 3 2  ? -31.456 -5.734  -9.449  1.00 4.49  ? 2  LYS C C      2  
ATOM 8728  O O      . LYS E 3 2  ? -30.497 -5.363  -10.119 1.00 4.36  ? 2  LYS C O      2  
ATOM 8729  C CB     . LYS E 3 2  ? -32.873 -5.092  -11.396 1.00 5.55  ? 2  LYS C CB     2  
ATOM 8730  C CG     . LYS E 3 2  ? -33.823 -5.922  -12.240 1.00 6.15  ? 2  LYS C CG     2  
ATOM 8731  C CD     . LYS E 3 2  ? -33.498 -7.402  -12.159 1.00 6.70  ? 2  LYS C CD     2  
ATOM 8732  C CE     . LYS E 3 2  ? -34.287 -8.195  -13.179 1.00 7.72  ? 2  LYS C CE     2  
ATOM 8733  N NZ     . LYS E 3 2  ? -33.866 -7.879  -14.570 1.00 8.57  ? 2  LYS C NZ     2  
ATOM 8734  H H      . LYS E 3 2  ? -32.910 -3.793  -8.600  1.00 5.36  ? 2  LYS C H      2  
ATOM 8735  H HA     . LYS E 3 2  ? -33.468 -6.351  -9.769  1.00 5.60  ? 2  LYS C HA     2  
ATOM 8736  H HB2    . LYS E 3 2  ? -33.150 -4.054  -11.499 1.00 5.56  ? 2  LYS C HB2    2  
ATOM 8737  H HB3    . LYS E 3 2  ? -31.872 -5.230  -11.781 1.00 5.73  ? 2  LYS C HB3    2  
ATOM 8738  H HG2    . LYS E 3 2  ? -34.831 -5.769  -11.887 1.00 6.23  ? 2  LYS C HG2    2  
ATOM 8739  H HG3    . LYS E 3 2  ? -33.748 -5.602  -13.269 1.00 6.45  ? 2  LYS C HG3    2  
ATOM 8740  H HD2    . LYS E 3 2  ? -32.443 -7.541  -12.345 1.00 6.73  ? 2  LYS C HD2    2  
ATOM 8741  H HD3    . LYS E 3 2  ? -33.741 -7.761  -11.171 1.00 6.63  ? 2  LYS C HD3    2  
ATOM 8742  H HE2    . LYS E 3 2  ? -34.133 -9.248  -12.995 1.00 7.96  ? 2  LYS C HE2    2  
ATOM 8743  H HE3    . LYS E 3 2  ? -35.334 -7.959  -13.066 1.00 7.86  ? 2  LYS C HE3    2  
ATOM 8744  H HZ1    . LYS E 3 2  ? -34.029 -6.873  -14.777 1.00 9.03  ? 2  LYS C HZ1    2  
ATOM 8745  H HZ2    . LYS E 3 2  ? -34.411 -8.448  -15.244 1.00 8.65  ? 2  LYS C HZ2    2  
ATOM 8746  H HZ3    . LYS E 3 2  ? -32.855 -8.089  -14.697 1.00 8.87  ? 2  LYS C HZ3    2  
ATOM 8747  N N      . SER E 3 3  ? -31.319 -6.385  -8.307  1.00 4.33  ? 3  SER C N      2  
ATOM 8748  C CA     . SER E 3 3  ? -30.007 -6.719  -7.774  1.00 3.97  ? 3  SER C CA     2  
ATOM 8749  C C      . SER E 3 3  ? -29.520 -8.043  -8.363  1.00 3.58  ? 3  SER C C      2  
ATOM 8750  O O      . SER E 3 3  ? -29.019 -8.916  -7.651  1.00 3.59  ? 3  SER C O      2  
ATOM 8751  C CB     . SER E 3 3  ? -30.074 -6.794  -6.250  1.00 4.53  ? 3  SER C CB     2  
ATOM 8752  O OG     . SER E 3 3  ? -30.682 -5.628  -5.715  1.00 5.01  ? 3  SER C OG     2  
ATOM 8753  H H      . SER E 3 3  ? -32.120 -6.643  -7.803  1.00 4.67  ? 3  SER C H      2  
ATOM 8754  H HA     . SER E 3 3  ? -29.323 -5.934  -8.063  1.00 3.91  ? 3  SER C HA     2  
ATOM 8755  H HB2    . SER E 3 3  ? -30.656 -7.655  -5.957  1.00 4.76  ? 3  SER C HB2    2  
ATOM 8756  H HB3    . SER E 3 3  ? -29.075 -6.880  -5.849  1.00 4.58  ? 3  SER C HB3    2  
ATOM 8757  H HG     . SER E 3 3  ? -31.434 -5.883  -5.149  1.00 4.87  ? 3  SER C HG     2  
ATOM 8758  N N      . THR E 3 4  ? -29.666 -8.181  -9.671  1.00 3.52  ? 4  THR C N      2  
ATOM 8759  C CA     . THR E 3 4  ? -29.264 -9.391  -10.359 1.00 3.29  ? 4  THR C CA     2  
ATOM 8760  C C      . THR E 3 4  ? -28.152 -9.112  -11.371 1.00 2.83  ? 4  THR C C      2  
ATOM 8761  O O      . THR E 3 4  ? -28.412 -8.936  -12.563 1.00 3.10  ? 4  THR C O      2  
ATOM 8762  C CB     . THR E 3 4  ? -30.470 -10.034 -11.073 1.00 3.67  ? 4  THR C CB     2  
ATOM 8763  O OG1    . THR E 3 4  ? -31.648 -9.895  -10.259 1.00 4.25  ? 4  THR C OG1    2  
ATOM 8764  C CG2    . THR E 3 4  ? -30.217 -11.507 -11.359 1.00 3.77  ? 4  THR C CG2    2  
ATOM 8765  H H      . THR E 3 4  ? -30.053 -7.443  -10.189 1.00 3.81  ? 4  THR C H      2  
ATOM 8766  H HA     . THR E 3 4  ? -28.897 -10.089 -9.619  1.00 3.35  ? 4  THR C HA     2  
ATOM 8767  H HB     . THR E 3 4  ? -30.625 -9.521  -12.010 1.00 3.66  ? 4  THR C HB     2  
ATOM 8768  H HG1    . THR E 3 4  ? -31.986 -10.772 -10.032 1.00 4.42  ? 4  THR C HG1    2  
ATOM 8769  H HG21   . THR E 3 4  ? -30.217 -12.059 -10.431 1.00 3.87  ? 4  THR C HG21   2  
ATOM 8770  H HG22   . THR E 3 4  ? -29.258 -11.622 -11.844 1.00 3.61  ? 4  THR C HG22   2  
ATOM 8771  H HG23   . THR E 3 4  ? -30.994 -11.889 -12.004 1.00 4.15  ? 4  THR C HG23   2  
ATOM 8772  N N      . GLY E 3 5  ? -26.921 -9.043  -10.875 1.00 2.43  ? 5  GLY C N      2  
ATOM 8773  C CA     . GLY E 3 5  ? -25.779 -8.806  -11.735 1.00 2.18  ? 5  GLY C CA     2  
ATOM 8774  C C      . GLY E 3 5  ? -25.679 -7.366  -12.194 1.00 2.26  ? 5  GLY C C      2  
ATOM 8775  O O      . GLY E 3 5  ? -26.062 -7.035  -13.316 1.00 2.47  ? 5  GLY C O      2  
ATOM 8776  H H      . GLY E 3 5  ? -26.787 -9.153  -9.914  1.00 2.54  ? 5  GLY C H      2  
ATOM 8777  H HA2    . GLY E 3 5  ? -24.880 -9.065  -11.198 1.00 2.12  ? 5  GLY C HA2    2  
ATOM 8778  H HA3    . GLY E 3 5  ? -25.863 -9.443  -12.602 1.00 2.22  ? 5  GLY C HA3    2  
ATOM 8779  N N      . ILE E 3 6  ? -25.167 -6.505  -11.329 1.00 2.20  ? 6  ILE C N      2  
ATOM 8780  C CA     . ILE E 3 6  ? -25.021 -5.098  -11.662 1.00 2.35  ? 6  ILE C CA     2  
ATOM 8781  C C      . ILE E 3 6  ? -23.566 -4.768  -11.955 1.00 2.25  ? 6  ILE C C      2  
ATOM 8782  O O      . ILE E 3 6  ? -22.719 -4.803  -11.064 1.00 2.14  ? 6  ILE C O      2  
ATOM 8783  C CB     . ILE E 3 6  ? -25.544 -4.190  -10.528 1.00 2.47  ? 6  ILE C CB     2  
ATOM 8784  C CG1    . ILE E 3 6  ? -27.044 -4.419  -10.312 1.00 3.15  ? 6  ILE C CG1    2  
ATOM 8785  C CG2    . ILE E 3 6  ? -25.269 -2.723  -10.839 1.00 2.57  ? 6  ILE C CG2    2  
ATOM 8786  C CD1    . ILE E 3 6  ? -27.883 -4.199  -11.554 1.00 3.96  ? 6  ILE C CD1    2  
ATOM 8787  H H      . ILE E 3 6  ? -24.877 -6.824  -10.446 1.00 2.14  ? 6  ILE C H      2  
ATOM 8788  H HA     . ILE E 3 6  ? -25.606 -4.906  -12.549 1.00 2.50  ? 6  ILE C HA     2  
ATOM 8789  H HB     . ILE E 3 6  ? -25.016 -4.445  -9.622  1.00 2.36  ? 6  ILE C HB     2  
ATOM 8790  H HG12   . ILE E 3 6  ? -27.202 -5.436  -9.984  1.00 3.24  ? 6  ILE C HG12   2  
ATOM 8791  H HG13   . ILE E 3 6  ? -27.397 -3.743  -9.548  1.00 3.50  ? 6  ILE C HG13   2  
ATOM 8792  H HG21   . ILE E 3 6  ? -25.676 -2.480  -11.809 1.00 2.95  ? 6  ILE C HG21   2  
ATOM 8793  H HG22   . ILE E 3 6  ? -24.201 -2.550  -10.843 1.00 2.86  ? 6  ILE C HG22   2  
ATOM 8794  H HG23   . ILE E 3 6  ? -25.733 -2.102  -10.088 1.00 2.67  ? 6  ILE C HG23   2  
ATOM 8795  H HD11   . ILE E 3 6  ? -28.932 -4.268  -11.297 1.00 4.05  ? 6  ILE C HD11   2  
ATOM 8796  H HD12   . ILE E 3 6  ? -27.645 -4.952  -12.288 1.00 4.22  ? 6  ILE C HD12   2  
ATOM 8797  H HD13   . ILE E 3 6  ? -27.675 -3.220  -11.960 1.00 4.61  ? 6  ILE C HD13   2  
ATOM 8798  N N      . VAL E 3 7  ? -23.284 -4.466  -13.212 1.00 2.33  ? 7  VAL C N      2  
ATOM 8799  C CA     . VAL E 3 7  ? -21.933 -4.121  -13.633 1.00 2.28  ? 7  VAL C CA     2  
ATOM 8800  C C      . VAL E 3 7  ? -21.772 -2.606  -13.651 1.00 2.34  ? 7  VAL C C      2  
ATOM 8801  O O      . VAL E 3 7  ? -22.257 -1.932  -14.562 1.00 2.48  ? 7  VAL C O      2  
ATOM 8802  C CB     . VAL E 3 7  ? -21.593 -4.685  -15.031 1.00 2.36  ? 7  VAL C CB     2  
ATOM 8803  C CG1    . VAL E 3 7  ? -20.087 -4.797  -15.212 1.00 2.49  ? 7  VAL C CG1    2  
ATOM 8804  C CG2    . VAL E 3 7  ? -22.262 -6.031  -15.254 1.00 2.53  ? 7  VAL C CG2    2  
ATOM 8805  H H      . VAL E 3 7  ? -24.007 -4.465  -13.875 1.00 2.44  ? 7  VAL C H      2  
ATOM 8806  H HA     . VAL E 3 7  ? -21.240 -4.538  -12.915 1.00 2.19  ? 7  VAL C HA     2  
ATOM 8807  H HB     . VAL E 3 7  ? -21.969 -3.995  -15.772 1.00 2.57  ? 7  VAL C HB     2  
ATOM 8808  H HG11   . VAL E 3 7  ? -19.641 -3.816  -15.147 1.00 2.84  ? 7  VAL C HG11   2  
ATOM 8809  H HG12   . VAL E 3 7  ? -19.874 -5.226  -16.179 1.00 2.78  ? 7  VAL C HG12   2  
ATOM 8810  H HG13   . VAL E 3 7  ? -19.678 -5.432  -14.438 1.00 2.65  ? 7  VAL C HG13   2  
ATOM 8811  H HG21   . VAL E 3 7  ? -23.330 -5.930  -15.124 1.00 2.54  ? 7  VAL C HG21   2  
ATOM 8812  H HG22   . VAL E 3 7  ? -21.880 -6.747  -14.542 1.00 2.81  ? 7  VAL C HG22   2  
ATOM 8813  H HG23   . VAL E 3 7  ? -22.053 -6.375  -16.256 1.00 2.98  ? 7  VAL C HG23   2  
ATOM 8814  N N      . ARG E 3 8  ? -21.098 -2.081  -12.641 1.00 2.29  ? 8  ARG C N      2  
ATOM 8815  C CA     . ARG E 3 8  ? -20.887 -0.645  -12.524 1.00 2.40  ? 8  ARG C CA     2  
ATOM 8816  C C      . ARG E 3 8  ? -19.580 -0.353  -11.785 1.00 2.12  ? 8  ARG C C      2  
ATOM 8817  O O      . ARG E 3 8  ? -19.059 -1.210  -11.067 1.00 1.97  ? 8  ARG C O      2  
ATOM 8818  C CB     . ARG E 3 8  ? -22.072 -0.016  -11.777 1.00 2.72  ? 8  ARG C CB     2  
ATOM 8819  C CG     . ARG E 3 8  ? -21.965 1.490   -11.569 1.00 2.85  ? 8  ARG C CG     2  
ATOM 8820  C CD     . ARG E 3 8  ? -23.117 2.012   -10.725 1.00 2.57  ? 8  ARG C CD     2  
ATOM 8821  N NE     . ARG E 3 8  ? -22.817 3.315   -10.130 1.00 2.72  ? 8  ARG C NE     2  
ATOM 8822  C CZ     . ARG E 3 8  ? -23.663 3.994   -9.349  1.00 3.13  ? 8  ARG C CZ     2  
ATOM 8823  N NH1    . ARG E 3 8  ? -24.872 3.507   -9.089  1.00 3.53  ? 8  ARG C NH1    2  
ATOM 8824  N NH2    . ARG E 3 8  ? -23.306 5.164   -8.833  1.00 3.60  ? 8  ARG C NH2    2  
ATOM 8825  H H      . ARG E 3 8  ? -20.723 -2.679  -11.952 1.00 2.23  ? 8  ARG C H      2  
ATOM 8826  H HA     . ARG E 3 8  ? -20.834 -0.230  -13.517 1.00 2.59  ? 8  ARG C HA     2  
ATOM 8827  H HB2    . ARG E 3 8  ? -22.975 -0.213  -12.335 1.00 3.07  ? 8  ARG C HB2    2  
ATOM 8828  H HB3    . ARG E 3 8  ? -22.154 -0.484  -10.808 1.00 2.98  ? 8  ARG C HB3    2  
ATOM 8829  H HG2    . ARG E 3 8  ? -21.034 1.711   -11.066 1.00 3.10  ? 8  ARG C HG2    2  
ATOM 8830  H HG3    . ARG E 3 8  ? -21.983 1.980   -12.532 1.00 3.45  ? 8  ARG C HG3    2  
ATOM 8831  H HD2    . ARG E 3 8  ? -23.992 2.107   -11.351 1.00 3.13  ? 8  ARG C HD2    2  
ATOM 8832  H HD3    . ARG E 3 8  ? -23.316 1.304   -9.936  1.00 2.33  ? 8  ARG C HD3    2  
ATOM 8833  H HE     . ARG E 3 8  ? -21.932 3.703   -10.321 1.00 2.90  ? 8  ARG C HE     2  
ATOM 8834  H HH11   . ARG E 3 8  ? -25.155 2.628   -9.479  1.00 3.64  ? 8  ARG C HH11   2  
ATOM 8835  H HH12   . ARG E 3 8  ? -25.507 4.021   -8.506  1.00 4.00  ? 8  ARG C HH12   2  
ATOM 8836  H HH21   . ARG E 3 8  ? -22.396 5.542   -9.025  1.00 3.82  ? 8  ARG C HH21   2  
ATOM 8837  H HH22   . ARG E 3 8  ? -23.942 5.674   -8.249  1.00 3.98  ? 8  ARG C HH22   2  
ATOM 8838  N N      . LYS E 3 9  ? -19.037 0.843   -12.006 1.00 2.14  ? 9  LYS C N      2  
ATOM 8839  C CA     . LYS E 3 9  ? -17.812 1.275   -11.343 1.00 1.98  ? 9  LYS C CA     2  
ATOM 8840  C C      . LYS E 3 9  ? -18.023 1.285   -9.835  1.00 1.89  ? 9  LYS C C      2  
ATOM 8841  O O      . LYS E 3 9  ? -18.927 1.957   -9.344  1.00 2.00  ? 9  LYS C O      2  
ATOM 8842  C CB     . LYS E 3 9  ? -17.422 2.675   -11.825 1.00 2.06  ? 9  LYS C CB     2  
ATOM 8843  C CG     . LYS E 3 9  ? -16.204 3.252   -11.117 1.00 2.64  ? 9  LYS C CG     2  
ATOM 8844  C CD     . LYS E 3 9  ? -16.145 4.766   -11.252 1.00 2.61  ? 9  LYS C CD     2  
ATOM 8845  C CE     . LYS E 3 9  ? -17.157 5.451   -10.344 1.00 2.63  ? 9  LYS C CE     2  
ATOM 8846  N NZ     . LYS E 3 9  ? -17.287 6.898   -10.654 1.00 2.49  ? 9  LYS C NZ     2  
ATOM 8847  H H      . LYS E 3 9  ? -19.472 1.450   -12.643 1.00 2.32  ? 9  LYS C H      2  
ATOM 8848  H HA     . LYS E 3 9  ? -17.025 0.579   -11.585 1.00 1.98  ? 9  LYS C HA     2  
ATOM 8849  H HB2    . LYS E 3 9  ? -17.209 2.629   -12.881 1.00 2.29  ? 9  LYS C HB2    2  
ATOM 8850  H HB3    . LYS E 3 9  ? -18.254 3.343   -11.664 1.00 1.89  ? 9  LYS C HB3    2  
ATOM 8851  H HG2    . LYS E 3 9  ? -16.255 2.997   -10.072 1.00 2.95  ? 9  LYS C HG2    2  
ATOM 8852  H HG3    . LYS E 3 9  ? -15.311 2.825   -11.551 1.00 3.28  ? 9  LYS C HG3    2  
ATOM 8853  H HD2    . LYS E 3 9  ? -15.154 5.103   -10.986 1.00 3.00  ? 9  LYS C HD2    2  
ATOM 8854  H HD3    . LYS E 3 9  ? -16.355 5.034   -12.277 1.00 2.77  ? 9  LYS C HD3    2  
ATOM 8855  H HE2    . LYS E 3 9  ? -18.118 4.975   -10.471 1.00 3.02  ? 9  LYS C HE2    2  
ATOM 8856  H HE3    . LYS E 3 9  ? -16.836 5.338   -9.319  1.00 2.98  ? 9  LYS C HE3    2  
ATOM 8857  H HZ1    . LYS E 3 9  ? -17.949 7.352   -9.991  1.00 2.47  ? 9  LYS C HZ1    2  
ATOM 8858  H HZ2    . LYS E 3 9  ? -17.648 7.026   -11.620 1.00 2.83  ? 9  LYS C HZ2    2  
ATOM 8859  H HZ3    . LYS E 3 9  ? -16.357 7.371   -10.579 1.00 2.75  ? 9  LYS C HZ3    2  
ATOM 8860  N N      . VAL E 3 10 ? -17.193 0.533   -9.117  1.00 1.86  ? 10 VAL C N      2  
ATOM 8861  C CA     . VAL E 3 10 ? -17.301 0.430   -7.664  1.00 1.98  ? 10 VAL C CA     2  
ATOM 8862  C C      . VAL E 3 10 ? -17.324 1.800   -6.980  1.00 2.06  ? 10 VAL C C      2  
ATOM 8863  O O      . VAL E 3 10 ? -18.337 2.186   -6.399  1.00 2.49  ? 10 VAL C O      2  
ATOM 8864  C CB     . VAL E 3 10 ? -16.173 -0.439  -7.056  1.00 2.07  ? 10 VAL C CB     2  
ATOM 8865  C CG1    . VAL E 3 10 ? -16.557 -1.911  -7.109  1.00 2.70  ? 10 VAL C CG1    2  
ATOM 8866  C CG2    . VAL E 3 10 ? -14.845 -0.221  -7.771  1.00 1.88  ? 10 VAL C CG2    2  
ATOM 8867  H H      . VAL E 3 10 ? -16.489 0.031   -9.580  1.00 1.86  ? 10 VAL C H      2  
ATOM 8868  H HA     . VAL E 3 10 ? -18.237 -0.065  -7.452  1.00 2.14  ? 10 VAL C HA     2  
ATOM 8869  H HB     . VAL E 3 10 ? -16.051 -0.158  -6.020  1.00 2.46  ? 10 VAL C HB     2  
ATOM 8870  H HG11   . VAL E 3 10 ? -15.829 -2.493  -6.561  1.00 3.27  ? 10 VAL C HG11   2  
ATOM 8871  H HG12   . VAL E 3 10 ? -16.577 -2.241  -8.138  1.00 2.94  ? 10 VAL C HG12   2  
ATOM 8872  H HG13   . VAL E 3 10 ? -17.533 -2.046  -6.668  1.00 2.98  ? 10 VAL C HG13   2  
ATOM 8873  H HG21   . VAL E 3 10 ? -14.983 -0.336  -8.835  1.00 2.01  ? 10 VAL C HG21   2  
ATOM 8874  H HG22   . VAL E 3 10 ? -14.126 -0.945  -7.420  1.00 2.20  ? 10 VAL C HG22   2  
ATOM 8875  H HG23   . VAL E 3 10 ? -14.480 0.774   -7.560  1.00 2.27  ? 10 VAL C HG23   2  
ATOM 8876  N N      . ASP E 3 11 ? -16.214 2.519   -7.065  1.00 2.03  ? 11 ASP C N      2  
ATOM 8877  C CA     . ASP E 3 11 ? -16.076 3.841   -6.462  1.00 2.16  ? 11 ASP C CA     2  
ATOM 8878  C C      . ASP E 3 11 ? -14.663 4.328   -6.704  1.00 2.11  ? 11 ASP C C      2  
ATOM 8879  O O      . ASP E 3 11 ? -13.724 3.539   -6.632  1.00 2.39  ? 11 ASP C O      2  
ATOM 8880  C CB     . ASP E 3 11 ? -16.363 3.798   -4.953  1.00 2.42  ? 11 ASP C CB     2  
ATOM 8881  C CG     . ASP E 3 11 ? -15.777 4.974   -4.190  1.00 2.88  ? 11 ASP C CG     2  
ATOM 8882  O OD1    . ASP E 3 11 ? -16.055 6.137   -4.557  1.00 2.94  ? 11 ASP C OD1    2  
ATOM 8883  O OD2    . ASP E 3 11 ? -15.027 4.731   -3.214  1.00 3.57  ? 11 ASP C OD2    2  
ATOM 8884  H H      . ASP E 3 11 ? -15.448 2.147   -7.550  1.00 2.18  ? 11 ASP C H      2  
ATOM 8885  H HA     . ASP E 3 11 ? -16.773 4.510   -6.948  1.00 2.39  ? 11 ASP C HA     2  
ATOM 8886  H HB2    . ASP E 3 11 ? -17.431 3.792   -4.797  1.00 2.43  ? 11 ASP C HB2    2  
ATOM 8887  H HB3    . ASP E 3 11 ? -15.945 2.888   -4.545  1.00 2.74  ? 11 ASP C HB3    2  
ATOM 8888  N N      . GLU E 3 12 ? -14.505 5.613   -6.970  1.00 2.07  ? 12 GLU C N      2  
ATOM 8889  C CA     . GLU E 3 12 ? -13.190 6.180   -7.239  1.00 2.20  ? 12 GLU C CA     2  
ATOM 8890  C C      . GLU E 3 12 ? -12.433 6.453   -5.945  1.00 2.26  ? 12 GLU C C      2  
ATOM 8891  O O      . GLU E 3 12 ? -11.845 7.523   -5.760  1.00 2.71  ? 12 GLU C O      2  
ATOM 8892  C CB     . GLU E 3 12 ? -13.327 7.456   -8.062  1.00 2.31  ? 12 GLU C CB     2  
ATOM 8893  C CG     . GLU E 3 12 ? -13.350 7.192   -9.556  1.00 2.29  ? 12 GLU C CG     2  
ATOM 8894  C CD     . GLU E 3 12 ? -13.885 8.362   -10.346 1.00 2.58  ? 12 GLU C CD     2  
ATOM 8895  O OE1    . GLU E 3 12 ? -13.128 9.329   -10.569 1.00 3.21  ? 12 GLU C OE1    2  
ATOM 8896  O OE2    . GLU E 3 12 ? -15.066 8.316   -10.745 1.00 2.83  ? 12 GLU C OE2    2  
ATOM 8897  H H      . GLU E 3 12 ? -15.286 6.204   -6.956  1.00 2.16  ? 12 GLU C H      2  
ATOM 8898  H HA     . GLU E 3 12 ? -12.633 5.456   -7.812  1.00 2.39  ? 12 GLU C HA     2  
ATOM 8899  H HB2    . GLU E 3 12 ? -14.245 7.955   -7.787  1.00 2.69  ? 12 GLU C HB2    2  
ATOM 8900  H HB3    . GLU E 3 12 ? -12.492 8.104   -7.844  1.00 2.39  ? 12 GLU C HB3    2  
ATOM 8901  H HG2    . GLU E 3 12 ? -12.344 6.984   -9.888  1.00 2.63  ? 12 GLU C HG2    2  
ATOM 8902  H HG3    . GLU E 3 12 ? -13.976 6.333   -9.745  1.00 2.56  ? 12 GLU C HG3    2  
ATOM 8903  N N      . LEU E 3 13 ? -12.439 5.465   -5.066  1.00 2.12  ? 13 LEU C N      2  
ATOM 8904  C CA     . LEU E 3 13 ? -11.763 5.561   -3.790  1.00 2.39  ? 13 LEU C CA     2  
ATOM 8905  C C      . LEU E 3 13 ? -11.527 4.168   -3.217  1.00 2.59  ? 13 LEU C C      2  
ATOM 8906  O O      . LEU E 3 13 ? -10.384 3.759   -3.012  1.00 3.01  ? 13 LEU C O      2  
ATOM 8907  C CB     . LEU E 3 13 ? -12.586 6.414   -2.820  1.00 2.41  ? 13 LEU C CB     2  
ATOM 8908  C CG     . LEU E 3 13 ? -11.778 7.271   -1.854  1.00 2.96  ? 13 LEU C CG     2  
ATOM 8909  C CD1    . LEU E 3 13 ? -11.310 6.444   -0.668  1.00 3.39  ? 13 LEU C CD1    2  
ATOM 8910  C CD2    . LEU E 3 13 ? -10.594 7.902   -2.576  1.00 3.26  ? 13 LEU C CD2    2  
ATOM 8911  H H      . LEU E 3 13 ? -12.922 4.638   -5.289  1.00 2.08  ? 13 LEU C H      2  
ATOM 8912  H HA     . LEU E 3 13 ? -10.809 6.035   -3.956  1.00 2.75  ? 13 LEU C HA     2  
ATOM 8913  H HB2    . LEU E 3 13 ? -13.220 7.068   -3.403  1.00 2.12  ? 13 LEU C HB2    2  
ATOM 8914  H HB3    . LEU E 3 13 ? -13.217 5.755   -2.242  1.00 2.77  ? 13 LEU C HB3    2  
ATOM 8915  H HG     . LEU E 3 13 ? -12.405 8.067   -1.479  1.00 3.52  ? 13 LEU C HG     2  
ATOM 8916  H HD11   . LEU E 3 13 ? -12.161 6.172   -0.060  1.00 3.74  ? 13 LEU C HD11   2  
ATOM 8917  H HD12   . LEU E 3 13 ? -10.614 7.021   -0.078  1.00 3.77  ? 13 LEU C HD12   2  
ATOM 8918  H HD13   . LEU E 3 13 ? -10.826 5.549   -1.027  1.00 3.47  ? 13 LEU C HD13   2  
ATOM 8919  H HD21   . LEU E 3 13 ? -9.813  7.167   -2.696  1.00 3.64  ? 13 LEU C HD21   2  
ATOM 8920  H HD22   . LEU E 3 13 ? -10.219 8.735   -2.000  1.00 3.38  ? 13 LEU C HD22   2  
ATOM 8921  H HD23   . LEU E 3 13 ? -10.911 8.251   -3.548  1.00 3.59  ? 13 LEU C HD23   2  
ATOM 8922  N N      . GLY E 3 14 ? -12.610 3.441   -2.967  1.00 2.60  ? 14 GLY C N      2  
ATOM 8923  C CA     . GLY E 3 14 ? -12.483 2.098   -2.426  1.00 2.93  ? 14 GLY C CA     2  
ATOM 8924  C C      . GLY E 3 14 ? -13.807 1.478   -2.026  1.00 2.93  ? 14 GLY C C      2  
ATOM 8925  O O      . GLY E 3 14 ? -13.838 0.376   -1.480  1.00 3.16  ? 14 GLY C O      2  
ATOM 8926  H H      . GLY E 3 14 ? -13.502 3.823   -3.147  1.00 2.61  ? 14 GLY C H      2  
ATOM 8927  H HA2    . GLY E 3 14 ? -12.016 1.467   -3.168  1.00 2.99  ? 14 GLY C HA2    2  
ATOM 8928  H HA3    . GLY E 3 14 ? -11.845 2.139   -1.556  1.00 3.24  ? 14 GLY C HA3    2  
ATOM 8929  N N      . ARG E 3 15 ? -14.903 2.174   -2.283  1.00 2.87  ? 15 ARG C N      2  
ATOM 8930  C CA     . ARG E 3 15 ? -16.219 1.657   -1.934  1.00 3.01  ? 15 ARG C CA     2  
ATOM 8931  C C      . ARG E 3 15 ? -16.791 0.809   -3.065  1.00 2.89  ? 15 ARG C C      2  
ATOM 8932  O O      . ARG E 3 15 ? -16.218 0.736   -4.150  1.00 3.22  ? 15 ARG C O      2  
ATOM 8933  C CB     . ARG E 3 15 ? -17.183 2.799   -1.595  1.00 3.28  ? 15 ARG C CB     2  
ATOM 8934  C CG     . ARG E 3 15 ? -17.129 3.242   -0.139  1.00 3.70  ? 15 ARG C CG     2  
ATOM 8935  C CD     . ARG E 3 15 ? -15.955 4.170   0.129   1.00 4.16  ? 15 ARG C CD     2  
ATOM 8936  N NE     . ARG E 3 15 ? -15.947 4.647   1.512   1.00 4.39  ? 15 ARG C NE     2  
ATOM 8937  C CZ     . ARG E 3 15 ? -15.161 5.625   1.963   1.00 4.65  ? 15 ARG C CZ     2  
ATOM 8938  N NH1    . ARG E 3 15 ? -14.332 6.252   1.134   1.00 4.84  ? 15 ARG C NH1    2  
ATOM 8939  N NH2    . ARG E 3 15 ? -15.195 5.965   3.247   1.00 5.05  ? 15 ARG C NH2    2  
ATOM 8940  H H      . ARG E 3 15 ? -14.834 3.048   -2.731  1.00 2.85  ? 15 ARG C H      2  
ATOM 8941  H HA     . ARG E 3 15 ? -16.105 1.029   -1.064  1.00 3.22  ? 15 ARG C HA     2  
ATOM 8942  H HB2    . ARG E 3 15 ? -16.942 3.649   -2.216  1.00 3.27  ? 15 ARG C HB2    2  
ATOM 8943  H HB3    . ARG E 3 15 ? -18.191 2.478   -1.816  1.00 3.61  ? 15 ARG C HB3    2  
ATOM 8944  H HG2    . ARG E 3 15 ? -18.042 3.762   0.102   1.00 3.80  ? 15 ARG C HG2    2  
ATOM 8945  H HG3    . ARG E 3 15 ? -17.035 2.367   0.490   1.00 4.04  ? 15 ARG C HG3    2  
ATOM 8946  H HD2    . ARG E 3 15 ? -15.039 3.636   -0.064  1.00 4.35  ? 15 ARG C HD2    2  
ATOM 8947  H HD3    . ARG E 3 15 ? -16.021 5.019   -0.532  1.00 4.59  ? 15 ARG C HD3    2  
ATOM 8948  H HE     . ARG E 3 15 ? -16.551 4.197   2.145   1.00 4.60  ? 15 ARG C HE     2  
ATOM 8949  H HH11   . ARG E 3 15 ? -14.289 5.991   0.167   1.00 4.80  ? 15 ARG C HH11   2  
ATOM 8950  H HH12   . ARG E 3 15 ? -13.751 6.994   1.472   1.00 5.23  ? 15 ARG C HH12   2  
ATOM 8951  H HH21   . ARG E 3 15 ? -15.815 5.478   3.890   1.00 5.26  ? 15 ARG C HH21   2  
ATOM 8952  H HH22   . ARG E 3 15 ? -14.617 6.707   3.590   1.00 5.35  ? 15 ARG C HH22   2  
ATOM 8953  N N      . VAL E 3 16 ? -17.908 0.147   -2.789  1.00 2.57  ? 16 VAL C N      2  
ATOM 8954  C CA     . VAL E 3 16 ? -18.572 -0.696  -3.778  1.00 2.50  ? 16 VAL C CA     2  
ATOM 8955  C C      . VAL E 3 16 ? -20.030 -0.274  -3.964  1.00 2.47  ? 16 VAL C C      2  
ATOM 8956  O O      . VAL E 3 16 ? -20.743 -0.022  -2.989  1.00 2.49  ? 16 VAL C O      2  
ATOM 8957  C CB     . VAL E 3 16 ? -18.512 -2.188  -3.374  1.00 2.38  ? 16 VAL C CB     2  
ATOM 8958  C CG1    . VAL E 3 16 ? -19.290 -3.058  -4.359  1.00 2.64  ? 16 VAL C CG1    2  
ATOM 8959  C CG2    . VAL E 3 16 ? -17.066 -2.652  -3.283  1.00 2.56  ? 16 VAL C CG2    2  
ATOM 8960  H H      . VAL E 3 16 ? -18.287 0.213   -1.887  1.00 2.49  ? 16 VAL C H      2  
ATOM 8961  H HA     . VAL E 3 16 ? -18.053 -0.578  -4.717  1.00 2.73  ? 16 VAL C HA     2  
ATOM 8962  H HB     . VAL E 3 16 ? -18.962 -2.294  -2.398  1.00 2.57  ? 16 VAL C HB     2  
ATOM 8963  H HG11   . VAL E 3 16 ? -18.836 -2.985  -5.338  1.00 3.02  ? 16 VAL C HG11   2  
ATOM 8964  H HG12   . VAL E 3 16 ? -20.315 -2.719  -4.412  1.00 2.88  ? 16 VAL C HG12   2  
ATOM 8965  H HG13   . VAL E 3 16 ? -19.267 -4.086  -4.029  1.00 2.89  ? 16 VAL C HG13   2  
ATOM 8966  H HG21   . VAL E 3 16 ? -17.032 -3.670  -2.924  1.00 2.79  ? 16 VAL C HG21   2  
ATOM 8967  H HG22   . VAL E 3 16 ? -16.523 -2.012  -2.602  1.00 2.85  ? 16 VAL C HG22   2  
ATOM 8968  H HG23   . VAL E 3 16 ? -16.613 -2.601  -4.261  1.00 2.86  ? 16 VAL C HG23   2  
ATOM 8969  N N      . VAL E 3 17 ? -20.463 -0.203  -5.226  1.00 2.57  ? 17 VAL C N      2  
ATOM 8970  C CA     . VAL E 3 17 ? -21.832 0.182   -5.565  1.00 2.70  ? 17 VAL C CA     2  
ATOM 8971  C C      . VAL E 3 17 ? -22.789 -1.007  -5.506  1.00 2.55  ? 17 VAL C C      2  
ATOM 8972  O O      . VAL E 3 17 ? -23.452 -1.335  -6.489  1.00 2.64  ? 17 VAL C O      2  
ATOM 8973  C CB     . VAL E 3 17 ? -21.924 0.809   -6.976  1.00 3.05  ? 17 VAL C CB     2  
ATOM 8974  C CG1    . VAL E 3 17 ? -21.455 2.248   -6.950  1.00 3.44  ? 17 VAL C CG1    2  
ATOM 8975  C CG2    . VAL E 3 17 ? -21.125 -0.002  -7.989  1.00 3.34  ? 17 VAL C CG2    2  
ATOM 8976  H H      . VAL E 3 17 ? -19.837 -0.412  -5.949  1.00 2.64  ? 17 VAL C H      2  
ATOM 8977  H HA     . VAL E 3 17 ? -22.152 0.925   -4.848  1.00 2.79  ? 17 VAL C HA     2  
ATOM 8978  H HB     . VAL E 3 17 ? -22.962 0.801   -7.281  1.00 3.13  ? 17 VAL C HB     2  
ATOM 8979  H HG11   . VAL E 3 17 ? -21.300 2.597   -7.960  1.00 3.62  ? 17 VAL C HG11   2  
ATOM 8980  H HG12   . VAL E 3 17 ? -20.531 2.312   -6.398  1.00 3.67  ? 17 VAL C HG12   2  
ATOM 8981  H HG13   . VAL E 3 17 ? -22.205 2.860   -6.468  1.00 3.81  ? 17 VAL C HG13   2  
ATOM 8982  H HG21   . VAL E 3 17 ? -20.117 -0.134  -7.628  1.00 3.59  ? 17 VAL C HG21   2  
ATOM 8983  H HG22   . VAL E 3 17 ? -21.102 0.519   -8.935  1.00 3.58  ? 17 VAL C HG22   2  
ATOM 8984  H HG23   . VAL E 3 17 ? -21.587 -0.969  -8.122  1.00 3.56  ? 17 VAL C HG23   2  
ATOM 8985  N N      . ILE E 3 18 ? -22.859 -1.657  -4.358  1.00 2.49  ? 18 ILE C N      2  
ATOM 8986  C CA     . ILE E 3 18 ? -23.755 -2.789  -4.193  1.00 2.44  ? 18 ILE C CA     2  
ATOM 8987  C C      . ILE E 3 18 ? -25.188 -2.280  -4.022  1.00 2.40  ? 18 ILE C C      2  
ATOM 8988  O O      . ILE E 3 18 ? -25.438 -1.415  -3.186  1.00 2.42  ? 18 ILE C O      2  
ATOM 8989  C CB     . ILE E 3 18 ? -23.337 -3.681  -2.995  1.00 2.59  ? 18 ILE C CB     2  
ATOM 8990  C CG1    . ILE E 3 18 ? -24.476 -4.628  -2.598  1.00 2.79  ? 18 ILE C CG1    2  
ATOM 8991  C CG2    . ILE E 3 18 ? -22.899 -2.827  -1.814  1.00 2.73  ? 18 ILE C CG2    2  
ATOM 8992  C CD1    . ILE E 3 18 ? -24.120 -5.585  -1.480  1.00 3.34  ? 18 ILE C CD1    2  
ATOM 8993  H H      . ILE E 3 18 ? -22.307 -1.358  -3.604  1.00 2.58  ? 18 ILE C H      2  
ATOM 8994  H HA     . ILE E 3 18 ? -23.702 -3.382  -5.096  1.00 2.45  ? 18 ILE C HA     2  
ATOM 8995  H HB     . ILE E 3 18 ? -22.486 -4.271  -3.305  1.00 3.05  ? 18 ILE C HB     2  
ATOM 8996  H HG12   . ILE E 3 18 ? -25.325 -4.044  -2.276  1.00 3.09  ? 18 ILE C HG12   2  
ATOM 8997  H HG13   . ILE E 3 18 ? -24.759 -5.215  -3.461  1.00 3.02  ? 18 ILE C HG13   2  
ATOM 8998  H HG21   . ILE E 3 18 ? -23.698 -2.155  -1.543  1.00 3.15  ? 18 ILE C HG21   2  
ATOM 8999  H HG22   . ILE E 3 18 ? -22.024 -2.258  -2.089  1.00 2.86  ? 18 ILE C HG22   2  
ATOM 9000  H HG23   . ILE E 3 18 ? -22.664 -3.466  -0.974  1.00 2.99  ? 18 ILE C HG23   2  
ATOM 9001  H HD11   . ILE E 3 18 ? -23.119 -5.961  -1.634  1.00 3.72  ? 18 ILE C HD11   2  
ATOM 9002  H HD12   . ILE E 3 18 ? -24.816 -6.409  -1.476  1.00 3.62  ? 18 ILE C HD12   2  
ATOM 9003  H HD13   . ILE E 3 18 ? -24.169 -5.069  -0.531  1.00 3.70  ? 18 ILE C HD13   2  
ATOM 9004  N N      . PRO E 3 19 ? -26.127 -2.796  -4.838  1.00 2.44  ? 19 PRO C N      2  
ATOM 9005  C CA     . PRO E 3 19 ? -27.545 -2.402  -4.826  1.00 2.54  ? 19 PRO C CA     2  
ATOM 9006  C C      . PRO E 3 19 ? -28.086 -2.040  -3.440  1.00 2.66  ? 19 PRO C C      2  
ATOM 9007  O O      . PRO E 3 19 ? -27.993 -2.829  -2.492  1.00 2.62  ? 19 PRO C O      2  
ATOM 9008  C CB     . PRO E 3 19 ? -28.225 -3.652  -5.359  1.00 2.61  ? 19 PRO C CB     2  
ATOM 9009  C CG     . PRO E 3 19 ? -27.256 -4.217  -6.341  1.00 2.60  ? 19 PRO C CG     2  
ATOM 9010  C CD     . PRO E 3 19 ? -25.876 -3.826  -5.866  1.00 2.52  ? 19 PRO C CD     2  
ATOM 9011  H HA     . PRO E 3 19 ? -27.727 -1.581  -5.503  1.00 2.59  ? 19 PRO C HA     2  
ATOM 9012  H HB2    . PRO E 3 19 ? -28.409 -4.338  -4.545  1.00 2.62  ? 19 PRO C HB2    2  
ATOM 9013  H HB3    . PRO E 3 19 ? -29.158 -3.386  -5.833  1.00 2.71  ? 19 PRO C HB3    2  
ATOM 9014  H HG2    . PRO E 3 19 ? -27.348 -5.291  -6.372  1.00 2.64  ? 19 PRO C HG2    2  
ATOM 9015  H HG3    . PRO E 3 19 ? -27.444 -3.799  -7.321  1.00 2.67  ? 19 PRO C HG3    2  
ATOM 9016  H HD2    . PRO E 3 19 ? -25.372 -4.680  -5.439  1.00 2.55  ? 19 PRO C HD2    2  
ATOM 9017  H HD3    . PRO E 3 19 ? -25.299 -3.419  -6.683  1.00 2.59  ? 19 PRO C HD3    2  
ATOM 9018  N N      . ILE E 3 20 ? -28.651 -0.840  -3.335  1.00 2.90  ? 20 ILE C N      2  
ATOM 9019  C CA     . ILE E 3 20 ? -29.204 -0.344  -2.080  1.00 3.12  ? 20 ILE C CA     2  
ATOM 9020  C C      . ILE E 3 20 ? -30.386 -1.192  -1.612  1.00 3.09  ? 20 ILE C C      2  
ATOM 9021  O O      . ILE E 3 20 ? -30.514 -1.490  -0.424  1.00 3.15  ? 20 ILE C O      2  
ATOM 9022  C CB     . ILE E 3 20 ? -29.633 1.146   -2.195  1.00 3.52  ? 20 ILE C CB     2  
ATOM 9023  C CG1    . ILE E 3 20 ? -30.355 1.612   -0.925  1.00 3.92  ? 20 ILE C CG1    2  
ATOM 9024  C CG2    . ILE E 3 20 ? -30.516 1.366   -3.418  1.00 3.85  ? 20 ILE C CG2    2  
ATOM 9025  C CD1    . ILE E 3 20 ? -30.547 3.115   -0.852  1.00 4.46  ? 20 ILE C CD1    2  
ATOM 9026  H H      . ILE E 3 20 ? -28.690 -0.264  -4.131  1.00 2.97  ? 20 ILE C H      2  
ATOM 9027  H HA     . ILE E 3 20 ? -28.423 -0.409  -1.336  1.00 3.13  ? 20 ILE C HA     2  
ATOM 9028  H HB     . ILE E 3 20 ? -28.740 1.738   -2.323  1.00 3.60  ? 20 ILE C HB     2  
ATOM 9029  H HG12   . ILE E 3 20 ? -31.330 1.153   -0.887  1.00 4.17  ? 20 ILE C HG12   2  
ATOM 9030  H HG13   . ILE E 3 20 ? -29.783 1.305   -0.061  1.00 3.94  ? 20 ILE C HG13   2  
ATOM 9031  H HG21   . ILE E 3 20 ? -30.924 2.366   -3.394  1.00 4.06  ? 20 ILE C HG21   2  
ATOM 9032  H HG22   . ILE E 3 20 ? -31.323 0.648   -3.412  1.00 3.95  ? 20 ILE C HG22   2  
ATOM 9033  H HG23   . ILE E 3 20 ? -29.927 1.239   -4.312  1.00 4.19  ? 20 ILE C HG23   2  
ATOM 9034  H HD11   . ILE E 3 20 ? -31.021 3.373   0.085   1.00 4.88  ? 20 ILE C HD11   2  
ATOM 9035  H HD12   . ILE E 3 20 ? -31.169 3.437   -1.673  1.00 4.70  ? 20 ILE C HD12   2  
ATOM 9036  H HD13   . ILE E 3 20 ? -29.585 3.603   -0.917  1.00 4.59  ? 20 ILE C HD13   2  
ATOM 9037  N N      . GLU E 3 21 ? -31.227 -1.612  -2.552  1.00 3.07  ? 21 GLU C N      2  
ATOM 9038  C CA     . GLU E 3 21 ? -32.395 -2.416  -2.219  1.00 3.12  ? 21 GLU C CA     2  
ATOM 9039  C C      . GLU E 3 21 ? -31.973 -3.774  -1.662  1.00 3.02  ? 21 GLU C C      2  
ATOM 9040  O O      . GLU E 3 21 ? -32.658 -4.354  -0.819  1.00 3.15  ? 21 GLU C O      2  
ATOM 9041  C CB     . GLU E 3 21 ? -33.309 -2.575  -3.444  1.00 3.16  ? 21 GLU C CB     2  
ATOM 9042  C CG     . GLU E 3 21 ? -32.876 -3.649  -4.431  1.00 3.57  ? 21 GLU C CG     2  
ATOM 9043  C CD     . GLU E 3 21 ? -33.552 -4.984  -4.176  1.00 3.79  ? 21 GLU C CD     2  
ATOM 9044  O OE1    . GLU E 3 21 ? -34.765 -4.993  -3.867  1.00 4.18  ? 21 GLU C OE1    2  
ATOM 9045  O OE2    . GLU E 3 21 ? -32.876 -6.027  -4.287  1.00 4.07  ? 21 GLU C OE2    2  
ATOM 9046  H H      . GLU E 3 21 ? -31.057 -1.375  -3.489  1.00 3.07  ? 21 GLU C H      2  
ATOM 9047  H HA     . GLU E 3 21 ? -32.938 -1.889  -1.448  1.00 3.30  ? 21 GLU C HA     2  
ATOM 9048  H HB2    . GLU E 3 21 ? -34.304 -2.821  -3.100  1.00 3.21  ? 21 GLU C HB2    2  
ATOM 9049  H HB3    . GLU E 3 21 ? -33.347 -1.630  -3.967  1.00 3.24  ? 21 GLU C HB3    2  
ATOM 9050  H HG2    . GLU E 3 21 ? -33.124 -3.321  -5.429  1.00 4.24  ? 21 GLU C HG2    2  
ATOM 9051  H HG3    . GLU E 3 21 ? -31.806 -3.781  -4.352  1.00 3.62  ? 21 GLU C HG3    2  
ATOM 9052  N N      . LEU E 3 22 ? -30.827 -4.264  -2.118  1.00 2.89  ? 22 LEU C N      2  
ATOM 9053  C CA     . LEU E 3 22 ? -30.312 -5.545  -1.666  1.00 2.93  ? 22 LEU C CA     2  
ATOM 9054  C C      . LEU E 3 22 ? -29.946 -5.474  -0.191  1.00 3.06  ? 22 LEU C C      2  
ATOM 9055  O O      . LEU E 3 22 ? -30.399 -6.285  0.613   1.00 3.27  ? 22 LEU C O      2  
ATOM 9056  C CB     . LEU E 3 22 ? -29.090 -5.947  -2.491  1.00 2.89  ? 22 LEU C CB     2  
ATOM 9057  C CG     . LEU E 3 22 ? -28.565 -7.355  -2.225  1.00 2.93  ? 22 LEU C CG     2  
ATOM 9058  C CD1    . LEU E 3 22 ? -29.578 -8.395  -2.672  1.00 3.53  ? 22 LEU C CD1    2  
ATOM 9059  C CD2    . LEU E 3 22 ? -27.238 -7.565  -2.928  1.00 3.05  ? 22 LEU C CD2    2  
ATOM 9060  H H      . LEU E 3 22 ? -30.317 -3.750  -2.777  1.00 2.84  ? 22 LEU C H      2  
ATOM 9061  H HA     . LEU E 3 22 ? -31.087 -6.285  -1.801  1.00 3.00  ? 22 LEU C HA     2  
ATOM 9062  H HB2    . LEU E 3 22 ? -29.349 -5.872  -3.538  1.00 3.23  ? 22 LEU C HB2    2  
ATOM 9063  H HB3    . LEU E 3 22 ? -28.296 -5.246  -2.283  1.00 3.00  ? 22 LEU C HB3    2  
ATOM 9064  H HG     . LEU E 3 22 ? -28.407 -7.477  -1.164  1.00 3.10  ? 22 LEU C HG     2  
ATOM 9065  H HD11   . LEU E 3 22 ? -30.438 -8.370  -2.018  1.00 3.94  ? 22 LEU C HD11   2  
ATOM 9066  H HD12   . LEU E 3 22 ? -29.126 -9.373  -2.635  1.00 3.77  ? 22 LEU C HD12   2  
ATOM 9067  H HD13   . LEU E 3 22 ? -29.890 -8.179  -3.683  1.00 3.90  ? 22 LEU C HD13   2  
ATOM 9068  H HD21   . LEU E 3 22 ? -26.595 -6.716  -2.748  1.00 3.08  ? 22 LEU C HD21   2  
ATOM 9069  H HD22   . LEU E 3 22 ? -27.407 -7.670  -3.990  1.00 3.25  ? 22 LEU C HD22   2  
ATOM 9070  H HD23   . LEU E 3 22 ? -26.767 -8.459  -2.547  1.00 3.42  ? 22 LEU C HD23   2  
ATOM 9071  N N      . ARG E 3 23 ? -29.152 -4.471  0.162   1.00 3.02  ? 23 ARG C N      2  
ATOM 9072  C CA     . ARG E 3 23 ? -28.719 -4.289  1.542   1.00 3.21  ? 23 ARG C CA     2  
ATOM 9073  C C      . ARG E 3 23 ? -29.887 -3.882  2.430   1.00 3.42  ? 23 ARG C C      2  
ATOM 9074  O O      . ARG E 3 23 ? -29.877 -4.125  3.635   1.00 3.69  ? 23 ARG C O      2  
ATOM 9075  C CB     . ARG E 3 23 ? -27.595 -3.263  1.603   1.00 3.19  ? 23 ARG C CB     2  
ATOM 9076  C CG     . ARG E 3 23 ? -26.265 -3.828  1.137   1.00 3.39  ? 23 ARG C CG     2  
ATOM 9077  C CD     . ARG E 3 23 ? -25.239 -2.737  0.906   1.00 3.56  ? 23 ARG C CD     2  
ATOM 9078  N NE     . ARG E 3 23 ? -25.611 -1.864  -0.209  1.00 3.56  ? 23 ARG C NE     2  
ATOM 9079  C CZ     . ARG E 3 23 ? -25.781 -0.552  -0.095  1.00 3.81  ? 23 ARG C CZ     2  
ATOM 9080  N NH1    . ARG E 3 23 ? -25.616 0.034   1.080   1.00 4.22  ? 23 ARG C NH1    2  
ATOM 9081  N NH2    . ARG E 3 23 ? -26.105 0.176   -1.156  1.00 4.06  ? 23 ARG C NH2    2  
ATOM 9082  H H      . ARG E 3 23 ? -28.848 -3.838  -0.523  1.00 2.91  ? 23 ARG C H      2  
ATOM 9083  H HA     . ARG E 3 23 ? -28.343 -5.238  1.890   1.00 3.33  ? 23 ARG C HA     2  
ATOM 9084  H HB2    . ARG E 3 23 ? -27.851 -2.425  0.972   1.00 2.93  ? 23 ARG C HB2    2  
ATOM 9085  H HB3    . ARG E 3 23 ? -27.483 -2.922  2.619   1.00 3.64  ? 23 ARG C HB3    2  
ATOM 9086  H HG2    . ARG E 3 23 ? -25.890 -4.502  1.891   1.00 3.97  ? 23 ARG C HG2    2  
ATOM 9087  H HG3    . ARG E 3 23 ? -26.419 -4.368  0.214   1.00 3.24  ? 23 ARG C HG3    2  
ATOM 9088  H HD2    . ARG E 3 23 ? -25.155 -2.143  1.805   1.00 4.03  ? 23 ARG C HD2    2  
ATOM 9089  H HD3    . ARG E 3 23 ? -24.287 -3.195  0.689   1.00 3.69  ? 23 ARG C HD3    2  
ATOM 9090  H HE     . ARG E 3 23 ? -25.733 -2.283  -1.092  1.00 3.69  ? 23 ARG C HE     2  
ATOM 9091  H HH11   . ARG E 3 23 ? -25.363 -0.509  1.883   1.00 4.36  ? 23 ARG C HH11   2  
ATOM 9092  H HH12   . ARG E 3 23 ? -25.744 1.020   1.172   1.00 4.63  ? 23 ARG C HH12   2  
ATOM 9093  H HH21   . ARG E 3 23 ? -26.218 -0.265  -2.057  1.00 4.21  ? 23 ARG C HH21   2  
ATOM 9094  H HH22   . ARG E 3 23 ? -26.237 1.164   -1.074  1.00 4.36  ? 23 ARG C HH22   2  
ATOM 9095  N N      . ARG E 3 24 ? -30.895 -3.263  1.821   1.00 3.40  ? 24 ARG C N      2  
ATOM 9096  C CA     . ARG E 3 24 ? -32.096 -2.856  2.539   1.00 3.72  ? 24 ARG C CA     2  
ATOM 9097  C C      . ARG E 3 24 ? -32.834 -4.100  3.015   1.00 3.87  ? 24 ARG C C      2  
ATOM 9098  O O      . ARG E 3 24 ? -33.459 -4.107  4.076   1.00 4.25  ? 24 ARG C O      2  
ATOM 9099  C CB     . ARG E 3 24 ? -33.005 -2.018  1.630   1.00 3.76  ? 24 ARG C CB     2  
ATOM 9100  C CG     . ARG E 3 24 ? -34.355 -1.678  2.248   1.00 3.89  ? 24 ARG C CG     2  
ATOM 9101  C CD     . ARG E 3 24 ? -35.470 -1.708  1.211   1.00 4.12  ? 24 ARG C CD     2  
ATOM 9102  N NE     . ARG E 3 24 ? -35.581 -3.017  0.568   1.00 4.21  ? 24 ARG C NE     2  
ATOM 9103  C CZ     . ARG E 3 24 ? -35.734 -3.196  -0.745  1.00 4.54  ? 24 ARG C CZ     2  
ATOM 9104  N NH1    . ARG E 3 24 ? -35.907 -2.152  -1.552  1.00 4.79  ? 24 ARG C NH1    2  
ATOM 9105  N NH2    . ARG E 3 24 ? -35.729 -4.423  -1.251  1.00 5.04  ? 24 ARG C NH2    2  
ATOM 9106  H H      . ARG E 3 24 ? -30.823 -3.068  0.863   1.00 3.24  ? 24 ARG C H      2  
ATOM 9107  H HA     . ARG E 3 24 ? -31.800 -2.269  3.395   1.00 3.90  ? 24 ARG C HA     2  
ATOM 9108  H HB2    . ARG E 3 24 ? -32.501 -1.093  1.389   1.00 3.69  ? 24 ARG C HB2    2  
ATOM 9109  H HB3    . ARG E 3 24 ? -33.184 -2.567  0.716   1.00 4.00  ? 24 ARG C HB3    2  
ATOM 9110  H HG2    . ARG E 3 24 ? -34.574 -2.399  3.020   1.00 4.14  ? 24 ARG C HG2    2  
ATOM 9111  H HG3    . ARG E 3 24 ? -34.302 -0.689  2.680   1.00 3.98  ? 24 ARG C HG3    2  
ATOM 9112  H HD2    . ARG E 3 24 ? -36.406 -1.474  1.698   1.00 4.30  ? 24 ARG C HD2    2  
ATOM 9113  H HD3    . ARG E 3 24 ? -35.263 -0.964  0.458   1.00 4.54  ? 24 ARG C HD3    2  
ATOM 9114  H HE     . ARG E 3 24 ? -35.511 -3.811  1.151   1.00 4.36  ? 24 ARG C HE     2  
ATOM 9115  H HH11   . ARG E 3 24 ? -35.923 -1.223  -1.179  1.00 4.77  ? 24 ARG C HH11   2  
ATOM 9116  H HH12   . ARG E 3 24 ? -36.031 -2.291  -2.540  1.00 5.26  ? 24 ARG C HH12   2  
ATOM 9117  H HH21   . ARG E 3 24 ? -35.615 -5.217  -0.643  1.00 5.21  ? 24 ARG C HH21   2  
ATOM 9118  H HH22   . ARG E 3 24 ? -35.814 -4.568  -2.246  1.00 5.48  ? 24 ARG C HH22   2  
ATOM 9119  N N      . THR E 3 25 ? -32.737 -5.158  2.217   1.00 3.63  ? 25 THR C N      2  
ATOM 9120  C CA     . THR E 3 25 ? -33.379 -6.420  2.531   1.00 3.81  ? 25 THR C CA     2  
ATOM 9121  C C      . THR E 3 25 ? -32.477 -7.289  3.411   1.00 3.96  ? 25 THR C C      2  
ATOM 9122  O O      . THR E 3 25 ? -32.964 -8.046  4.255   1.00 4.29  ? 25 THR C O      2  
ATOM 9123  C CB     . THR E 3 25 ? -33.740 -7.178  1.239   1.00 3.61  ? 25 THR C CB     2  
ATOM 9124  O OG1    . THR E 3 25 ? -34.285 -6.262  0.280   1.00 3.45  ? 25 THR C OG1    2  
ATOM 9125  C CG2    . THR E 3 25 ? -34.747 -8.284  1.514   1.00 3.93  ? 25 THR C CG2    2  
ATOM 9126  H H      . THR E 3 25 ? -32.217 -5.081  1.389   1.00 3.37  ? 25 THR C H      2  
ATOM 9127  H HA     . THR E 3 25 ? -34.292 -6.205  3.066   1.00 4.06  ? 25 THR C HA     2  
ATOM 9128  H HB     . THR E 3 25 ? -32.840 -7.621  0.834   1.00 3.55  ? 25 THR C HB     2  
ATOM 9129  H HG1    . THR E 3 25 ? -33.564 -5.822  -0.190  1.00 3.04  ? 25 THR C HG1    2  
ATOM 9130  H HG21   . THR E 3 25 ? -34.335 -8.975  2.235   1.00 4.21  ? 25 THR C HG21   2  
ATOM 9131  H HG22   . THR E 3 25 ? -34.966 -8.807  0.595   1.00 4.14  ? 25 THR C HG22   2  
ATOM 9132  H HG23   . THR E 3 25 ? -35.657 -7.853  1.907   1.00 3.96  ? 25 THR C HG23   2  
ATOM 9133  N N      . LEU E 3 26 ? -31.166 -7.160  3.222   1.00 3.78  ? 26 LEU C N      2  
ATOM 9134  C CA     . LEU E 3 26 ? -30.198 -7.928  3.999   1.00 3.98  ? 26 LEU C CA     2  
ATOM 9135  C C      . LEU E 3 26 ? -30.124 -7.412  5.433   1.00 4.07  ? 26 LEU C C      2  
ATOM 9136  O O      . LEU E 3 26 ? -30.765 -7.963  6.329   1.00 4.60  ? 26 LEU C O      2  
ATOM 9137  C CB     . LEU E 3 26 ? -28.811 -7.881  3.346   1.00 3.89  ? 26 LEU C CB     2  
ATOM 9138  C CG     . LEU E 3 26 ? -28.699 -8.571  1.981   1.00 4.26  ? 26 LEU C CG     2  
ATOM 9139  C CD1    . LEU E 3 26 ? -27.287 -8.442  1.430   1.00 4.08  ? 26 LEU C CD1    2  
ATOM 9140  C CD2    . LEU E 3 26 ? -29.098 -10.037 2.086   1.00 5.02  ? 26 LEU C CD2    2  
ATOM 9141  H H      . LEU E 3 26 ? -30.841 -6.534  2.541   1.00 3.57  ? 26 LEU C H      2  
ATOM 9142  H HA     . LEU E 3 26 ? -30.539 -8.952  4.022   1.00 4.30  ? 26 LEU C HA     2  
ATOM 9143  H HB2    . LEU E 3 26 ? -28.529 -6.844  3.226   1.00 3.53  ? 26 LEU C HB2    2  
ATOM 9144  H HB3    . LEU E 3 26 ? -28.109 -8.348  4.019   1.00 4.08  ? 26 LEU C HB3    2  
ATOM 9145  H HG     . LEU E 3 26 ? -29.372 -8.091  1.285   1.00 4.45  ? 26 LEU C HG     2  
ATOM 9146  H HD11   . LEU E 3 26 ? -27.226 -8.947  0.479   1.00 4.36  ? 26 LEU C HD11   2  
ATOM 9147  H HD12   . LEU E 3 26 ? -26.588 -8.889  2.121   1.00 4.02  ? 26 LEU C HD12   2  
ATOM 9148  H HD13   . LEU E 3 26 ? -27.048 -7.397  1.299   1.00 4.23  ? 26 LEU C HD13   2  
ATOM 9149  H HD21   . LEU E 3 26 ? -30.161 -10.108 2.267   1.00 5.06  ? 26 LEU C HD21   2  
ATOM 9150  H HD22   . LEU E 3 26 ? -28.563 -10.500 2.902   1.00 5.30  ? 26 LEU C HD22   2  
ATOM 9151  H HD23   . LEU E 3 26 ? -28.854 -10.545 1.163   1.00 5.57  ? 26 LEU C HD23   2  
ATOM 9152  N N      . GLY E 3 27 ? -29.351 -6.353  5.646   1.00 3.74  ? 27 GLY C N      2  
ATOM 9153  C CA     . GLY E 3 27 ? -29.220 -5.784  6.972   1.00 3.94  ? 27 GLY C CA     2  
ATOM 9154  C C      . GLY E 3 27 ? -28.633 -6.766  7.967   1.00 3.84  ? 27 GLY C C      2  
ATOM 9155  O O      . GLY E 3 27 ? -29.253 -7.080  8.986   1.00 4.08  ? 27 GLY C O      2  
ATOM 9156  H H      . GLY E 3 27 ? -28.859 -5.952  4.893   1.00 3.52  ? 27 GLY C H      2  
ATOM 9157  H HA2    . GLY E 3 27 ? -28.577 -4.918  6.917   1.00 3.96  ? 27 GLY C HA2    2  
ATOM 9158  H HA3    . GLY E 3 27 ? -30.194 -5.474  7.318   1.00 4.35  ? 27 GLY C HA3    2  
ATOM 9159  N N      . ILE E 3 28 ? -27.434 -7.245  7.676   1.00 3.67  ? 28 ILE C N      2  
ATOM 9160  C CA     . ILE E 3 28 ? -26.762 -8.204  8.538   1.00 3.75  ? 28 ILE C CA     2  
ATOM 9161  C C      . ILE E 3 28 ? -25.484 -7.627  9.141   1.00 3.63  ? 28 ILE C C      2  
ATOM 9162  O O      . ILE E 3 28 ? -25.302 -7.685  10.358  1.00 3.75  ? 28 ILE C O      2  
ATOM 9163  C CB     . ILE E 3 28 ? -26.430 -9.518  7.797   1.00 3.97  ? 28 ILE C CB     2  
ATOM 9164  C CG1    . ILE E 3 28 ? -26.093 -9.250  6.326   1.00 3.91  ? 28 ILE C CG1    2  
ATOM 9165  C CG2    . ILE E 3 28 ? -27.594 -10.490 7.914   1.00 4.47  ? 28 ILE C CG2    2  
ATOM 9166  C CD1    . ILE E 3 28 ? -25.558 -10.465 5.597   1.00 4.18  ? 28 ILE C CD1    2  
ATOM 9167  H H      . ILE E 3 28 ? -26.976 -6.929  6.860   1.00 3.61  ? 28 ILE C H      2  
ATOM 9168  H HA     . ILE E 3 28 ? -27.439 -8.441  9.345   1.00 3.93  ? 28 ILE C HA     2  
ATOM 9169  H HB     . ILE E 3 28 ? -25.573 -9.965  8.279   1.00 3.97  ? 28 ILE C HB     2  
ATOM 9170  H HG12   . ILE E 3 28 ? -26.985 -8.921  5.812   1.00 4.03  ? 28 ILE C HG12   2  
ATOM 9171  H HG13   . ILE E 3 28 ? -25.344 -8.473  6.270   1.00 3.74  ? 28 ILE C HG13   2  
ATOM 9172  H HG21   . ILE E 3 28 ? -27.778 -10.708 8.955   1.00 4.75  ? 28 ILE C HG21   2  
ATOM 9173  H HG22   . ILE E 3 28 ? -27.354 -11.403 7.391   1.00 4.77  ? 28 ILE C HG22   2  
ATOM 9174  H HG23   . ILE E 3 28 ? -28.475 -10.045 7.476   1.00 4.53  ? 28 ILE C HG23   2  
ATOM 9175  H HD11   . ILE E 3 28 ? -25.492 -10.252 4.541   1.00 4.60  ? 28 ILE C HD11   2  
ATOM 9176  H HD12   . ILE E 3 28 ? -26.222 -11.300 5.756   1.00 4.24  ? 28 ILE C HD12   2  
ATOM 9177  H HD13   . ILE E 3 28 ? -24.578 -10.708 5.978   1.00 4.29  ? 28 ILE C HD13   2  
ATOM 9178  N N      . ALA E 3 29 ? -24.618 -7.053  8.304   1.00 3.56  ? 29 ALA C N      2  
ATOM 9179  C CA     . ALA E 3 29 ? -23.356 -6.488  8.783   1.00 3.56  ? 29 ALA C CA     2  
ATOM 9180  C C      . ALA E 3 29 ? -22.637 -5.684  7.698   1.00 3.59  ? 29 ALA C C      2  
ATOM 9181  O O      . ALA E 3 29 ? -21.441 -5.405  7.818   1.00 3.52  ? 29 ALA C O      2  
ATOM 9182  C CB     . ALA E 3 29 ? -22.443 -7.599  9.292   1.00 3.69  ? 29 ALA C CB     2  
ATOM 9183  H H      . ALA E 3 29 ? -24.839 -6.996  7.347   1.00 3.64  ? 29 ALA C H      2  
ATOM 9184  H HA     . ALA E 3 29 ? -23.579 -5.834  9.612   1.00 3.54  ? 29 ALA C HA     2  
ATOM 9185  H HB1    . ALA E 3 29 ? -22.204 -8.271  8.480   1.00 4.15  ? 29 ALA C HB1    2  
ATOM 9186  H HB2    . ALA E 3 29 ? -22.945 -8.148  10.076  1.00 3.62  ? 29 ALA C HB2    2  
ATOM 9187  H HB3    . ALA E 3 29 ? -21.531 -7.167  9.683   1.00 3.80  ? 29 ALA C HB3    2  
ATOM 9188  N N      . GLU E 3 30 ? -23.365 -5.283  6.659   1.00 3.82  ? 30 GLU C N      2  
ATOM 9189  C CA     . GLU E 3 30 ? -22.779 -4.515  5.557   1.00 3.96  ? 30 GLU C CA     2  
ATOM 9190  C C      . GLU E 3 30 ? -22.353 -3.121  6.016   1.00 3.71  ? 30 GLU C C      2  
ATOM 9191  O O      . GLU E 3 30 ? -21.659 -2.409  5.297   1.00 3.69  ? 30 GLU C O      2  
ATOM 9192  C CB     . GLU E 3 30 ? -23.762 -4.377  4.386   1.00 4.52  ? 30 GLU C CB     2  
ATOM 9193  C CG     . GLU E 3 30 ? -24.580 -5.626  4.098   1.00 4.94  ? 30 GLU C CG     2  
ATOM 9194  C CD     . GLU E 3 30 ? -25.882 -5.650  4.868   1.00 5.13  ? 30 GLU C CD     2  
ATOM 9195  O OE1    . GLU E 3 30 ? -25.874 -6.022  6.057   1.00 5.13  ? 30 GLU C OE1    2  
ATOM 9196  O OE2    . GLU E 3 30 ? -26.924 -5.316  4.273   1.00 5.58  ? 30 GLU C OE2    2  
ATOM 9197  H H      . GLU E 3 30 ? -24.323 -5.504  6.629   1.00 3.97  ? 30 GLU C H      2  
ATOM 9198  H HA     . GLU E 3 30 ? -21.905 -5.051  5.214   1.00 3.97  ? 30 GLU C HA     2  
ATOM 9199  H HB2    . GLU E 3 30 ? -24.445 -3.570  4.602   1.00 4.42  ? 30 GLU C HB2    2  
ATOM 9200  H HB3    . GLU E 3 30 ? -23.202 -4.129  3.496   1.00 4.96  ? 30 GLU C HB3    2  
ATOM 9201  H HG2    . GLU E 3 30 ? -24.800 -5.663  3.043   1.00 5.33  ? 30 GLU C HG2    2  
ATOM 9202  H HG3    . GLU E 3 30 ? -23.999 -6.490  4.376   1.00 5.09  ? 30 GLU C HG3    2  
ATOM 9203  N N      . LYS E 3 31 ? -22.790 -2.730  7.204   1.00 3.70  ? 31 LYS C N      2  
ATOM 9204  C CA     . LYS E 3 31 ? -22.448 -1.424  7.751   1.00 3.70  ? 31 LYS C CA     2  
ATOM 9205  C C      . LYS E 3 31 ? -21.459 -1.562  8.911   1.00 3.31  ? 31 LYS C C      2  
ATOM 9206  O O      . LYS E 3 31 ? -21.213 -0.604  9.643   1.00 3.59  ? 31 LYS C O      2  
ATOM 9207  C CB     . LYS E 3 31 ? -23.712 -0.700  8.224   1.00 4.26  ? 31 LYS C CB     2  
ATOM 9208  C CG     . LYS E 3 31 ? -24.746 -0.487  7.129   1.00 4.94  ? 31 LYS C CG     2  
ATOM 9209  C CD     . LYS E 3 31 ? -26.076 0.001   7.690   1.00 5.14  ? 31 LYS C CD     2  
ATOM 9210  C CE     . LYS E 3 31 ? -26.035 1.481   8.056   1.00 4.81  ? 31 LYS C CE     2  
ATOM 9211  N NZ     . LYS E 3 31 ? -25.570 1.709   9.454   1.00 4.79  ? 31 LYS C NZ     2  
ATOM 9212  H H      . LYS E 3 31 ? -23.361 -3.333  7.724   1.00 3.82  ? 31 LYS C H      2  
ATOM 9213  H HA     . LYS E 3 31 ? -21.988 -0.847  6.963   1.00 3.71  ? 31 LYS C HA     2  
ATOM 9214  H HB2    . LYS E 3 31 ? -24.169 -1.281  9.011   1.00 4.26  ? 31 LYS C HB2    2  
ATOM 9215  H HB3    . LYS E 3 31 ? -23.432 0.266   8.618   1.00 4.42  ? 31 LYS C HB3    2  
ATOM 9216  H HG2    . LYS E 3 31 ? -24.373 0.249   6.432   1.00 5.05  ? 31 LYS C HG2    2  
ATOM 9217  H HG3    . LYS E 3 31 ? -24.905 -1.422  6.614   1.00 5.51  ? 31 LYS C HG3    2  
ATOM 9218  H HD2    . LYS E 3 31 ? -26.846 -0.151  6.947   1.00 5.64  ? 31 LYS C HD2    2  
ATOM 9219  H HD3    . LYS E 3 31 ? -26.312 -0.573  8.573   1.00 5.40  ? 31 LYS C HD3    2  
ATOM 9220  H HE2    . LYS E 3 31 ? -25.363 1.984   7.379   1.00 5.04  ? 31 LYS C HE2    2  
ATOM 9221  H HE3    . LYS E 3 31 ? -27.029 1.893   7.945   1.00 4.79  ? 31 LYS C HE3    2  
ATOM 9222  H HZ1    . LYS E 3 31 ? -26.361 1.599   10.121  1.00 4.98  ? 31 LYS C HZ1    2  
ATOM 9223  H HZ2    . LYS E 3 31 ? -25.183 2.669   9.552   1.00 4.75  ? 31 LYS C HZ2    2  
ATOM 9224  H HZ3    . LYS E 3 31 ? -24.827 1.026   9.704   1.00 5.03  ? 31 LYS C HZ3    2  
ATOM 9225  N N      . ASP E 3 32 ? -20.888 -2.752  9.068   1.00 2.82  ? 32 ASP C N      2  
ATOM 9226  C CA     . ASP E 3 32 ? -19.940 -3.006  10.152  1.00 2.51  ? 32 ASP C CA     2  
ATOM 9227  C C      . ASP E 3 32 ? -18.586 -3.466  9.611   1.00 2.36  ? 32 ASP C C      2  
ATOM 9228  O O      . ASP E 3 32 ? -17.646 -2.674  9.513   1.00 2.39  ? 32 ASP C O      2  
ATOM 9229  C CB     . ASP E 3 32 ? -20.512 -4.053  11.118  1.00 2.40  ? 32 ASP C CB     2  
ATOM 9230  C CG     . ASP E 3 32 ? -19.545 -4.443  12.224  1.00 2.44  ? 32 ASP C CG     2  
ATOM 9231  O OD1    . ASP E 3 32 ? -19.137 -3.552  13.003  1.00 2.74  ? 32 ASP C OD1    2  
ATOM 9232  O OD2    . ASP E 3 32 ? -19.174 -5.634  12.310  1.00 2.57  ? 32 ASP C OD2    2  
ATOM 9233  H H      . ASP E 3 32 ? -21.101 -3.475  8.436   1.00 2.80  ? 32 ASP C H      2  
ATOM 9234  H HA     . ASP E 3 32 ? -19.800 -2.080  10.689  1.00 2.62  ? 32 ASP C HA     2  
ATOM 9235  H HB2    . ASP E 3 32 ? -21.405 -3.656  11.576  1.00 2.66  ? 32 ASP C HB2    2  
ATOM 9236  H HB3    . ASP E 3 32 ? -20.768 -4.944  10.560  1.00 2.47  ? 32 ASP C HB3    2  
ATOM 9237  N N      . ALA E 3 33 ? -18.497 -4.738  9.243   1.00 2.26  ? 33 ALA C N      2  
ATOM 9238  C CA     . ALA E 3 33 ? -17.264 -5.311  8.714   1.00 2.13  ? 33 ALA C CA     2  
ATOM 9239  C C      . ALA E 3 33 ? -17.593 -6.480  7.799   1.00 2.00  ? 33 ALA C C      2  
ATOM 9240  O O      . ALA E 3 33 ? -18.547 -7.213  8.052   1.00 1.97  ? 33 ALA C O      2  
ATOM 9241  C CB     . ALA E 3 33 ? -16.351 -5.760  9.848   1.00 2.13  ? 33 ALA C CB     2  
ATOM 9242  H H      . ALA E 3 33 ? -19.290 -5.312  9.317   1.00 2.32  ? 33 ALA C H      2  
ATOM 9243  H HA     . ALA E 3 33 ? -16.754 -4.550  8.144   1.00 2.17  ? 33 ALA C HA     2  
ATOM 9244  H HB1    . ALA E 3 33 ? -15.461 -6.214  9.435   1.00 2.07  ? 33 ALA C HB1    2  
ATOM 9245  H HB2    . ALA E 3 33 ? -16.870 -6.478  10.464  1.00 2.49  ? 33 ALA C HB2    2  
ATOM 9246  H HB3    . ALA E 3 33 ? -16.075 -4.906  10.447  1.00 2.43  ? 33 ALA C HB3    2  
ATOM 9247  N N      . LEU E 3 34 ? -16.807 -6.650  6.743   1.00 1.98  ? 34 LEU C N      2  
ATOM 9248  C CA     . LEU E 3 34 ? -17.041 -7.726  5.786   1.00 1.88  ? 34 LEU C CA     2  
ATOM 9249  C C      . LEU E 3 34 ? -15.852 -8.676  5.724   1.00 1.83  ? 34 LEU C C      2  
ATOM 9250  O O      . LEU E 3 34 ? -14.713 -8.278  5.960   1.00 1.90  ? 34 LEU C O      2  
ATOM 9251  C CB     . LEU E 3 34 ? -17.325 -7.151  4.394   1.00 1.96  ? 34 LEU C CB     2  
ATOM 9252  C CG     . LEU E 3 34 ? -16.228 -6.247  3.819   1.00 2.28  ? 34 LEU C CG     2  
ATOM 9253  C CD1    . LEU E 3 34 ? -15.350 -7.014  2.838   1.00 2.66  ? 34 LEU C CD1    2  
ATOM 9254  C CD2    . LEU E 3 34 ? -16.844 -5.031  3.144   1.00 2.54  ? 34 LEU C CD2    2  
ATOM 9255  H H      . LEU E 3 34 ? -16.042 -6.048  6.614   1.00 2.05  ? 34 LEU C H      2  
ATOM 9256  H HA     . LEU E 3 34 ? -17.904 -8.279  6.118   1.00 1.86  ? 34 LEU C HA     2  
ATOM 9257  H HB2    . LEU E 3 34 ? -17.477 -7.976  3.713   1.00 2.16  ? 34 LEU C HB2    2  
ATOM 9258  H HB3    . LEU E 3 34 ? -18.240 -6.578  4.446   1.00 1.94  ? 34 LEU C HB3    2  
ATOM 9259  H HG     . LEU E 3 34 ? -15.601 -5.898  4.626   1.00 2.55  ? 34 LEU C HG     2  
ATOM 9260  H HD11   . LEU E 3 34 ? -15.902 -7.198  1.929   1.00 2.68  ? 34 LEU C HD11   2  
ATOM 9261  H HD12   . LEU E 3 34 ? -15.057 -7.956  3.277   1.00 3.25  ? 34 LEU C HD12   2  
ATOM 9262  H HD13   . LEU E 3 34 ? -14.468 -6.432  2.613   1.00 2.94  ? 34 LEU C HD13   2  
ATOM 9263  H HD21   . LEU E 3 34 ? -17.229 -4.359  3.894   1.00 2.69  ? 34 LEU C HD21   2  
ATOM 9264  H HD22   . LEU E 3 34 ? -17.651 -5.348  2.499   1.00 2.80  ? 34 LEU C HD22   2  
ATOM 9265  H HD23   . LEU E 3 34 ? -16.092 -4.525  2.556   1.00 2.97  ? 34 LEU C HD23   2  
ATOM 9266  N N      . GLU E 3 35 ? -16.128 -9.930  5.401   1.00 1.76  ? 35 GLU C N      2  
ATOM 9267  C CA     . GLU E 3 35 ? -15.093 -10.943 5.298   1.00 1.73  ? 35 GLU C CA     2  
ATOM 9268  C C      . GLU E 3 35 ? -14.712 -11.166 3.841   1.00 1.68  ? 35 GLU C C      2  
ATOM 9269  O O      . GLU E 3 35 ? -15.545 -11.561 3.025   1.00 1.65  ? 35 GLU C O      2  
ATOM 9270  C CB     . GLU E 3 35 ? -15.570 -12.250 5.932   1.00 1.70  ? 35 GLU C CB     2  
ATOM 9271  C CG     . GLU E 3 35 ? -14.479 -13.295 6.062   1.00 1.90  ? 35 GLU C CG     2  
ATOM 9272  C CD     . GLU E 3 35 ? -14.898 -14.460 6.925   1.00 1.93  ? 35 GLU C CD     2  
ATOM 9273  O OE1    . GLU E 3 35 ? -15.805 -15.215 6.515   1.00 2.25  ? 35 GLU C OE1    2  
ATOM 9274  O OE2    . GLU E 3 35 ? -14.313 -14.636 8.012   1.00 2.16  ? 35 GLU C OE2    2  
ATOM 9275  H H      . GLU E 3 35 ? -17.065 -10.185 5.233   1.00 1.76  ? 35 GLU C H      2  
ATOM 9276  H HA     . GLU E 3 35 ? -14.228 -10.590 5.830   1.00 1.80  ? 35 GLU C HA     2  
ATOM 9277  H HB2    . GLU E 3 35 ? -15.956 -12.039 6.916   1.00 1.96  ? 35 GLU C HB2    2  
ATOM 9278  H HB3    . GLU E 3 35 ? -16.362 -12.662 5.323   1.00 2.12  ? 35 GLU C HB3    2  
ATOM 9279  H HG2    . GLU E 3 35 ? -14.231 -13.665 5.081   1.00 2.44  ? 35 GLU C HG2    2  
ATOM 9280  H HG3    . GLU E 3 35 ? -13.608 -12.835 6.506   1.00 2.26  ? 35 GLU C HG3    2  
ATOM 9281  N N      . ILE E 3 36 ? -13.453 -10.903 3.525   1.00 1.72  ? 36 ILE C N      2  
ATOM 9282  C CA     . ILE E 3 36 ? -12.948 -11.064 2.172   1.00 1.71  ? 36 ILE C CA     2  
ATOM 9283  C C      . ILE E 3 36 ? -12.524 -12.507 1.921   1.00 1.71  ? 36 ILE C C      2  
ATOM 9284  O O      . ILE E 3 36 ? -11.602 -13.014 2.571   1.00 1.73  ? 36 ILE C O      2  
ATOM 9285  C CB     . ILE E 3 36 ? -11.740 -10.143 1.896   1.00 1.79  ? 36 ILE C CB     2  
ATOM 9286  C CG1    . ILE E 3 36 ? -11.927 -8.782  2.570   1.00 2.06  ? 36 ILE C CG1    2  
ATOM 9287  C CG2    . ILE E 3 36 ? -11.537 -9.972  0.396   1.00 1.62  ? 36 ILE C CG2    2  
ATOM 9288  C CD1    . ILE E 3 36 ? -10.691 -8.294  3.290   1.00 2.24  ? 36 ILE C CD1    2  
ATOM 9289  H H      . ILE E 3 36 ? -12.838 -10.601 4.233   1.00 1.79  ? 36 ILE C H      2  
ATOM 9290  H HA     . ILE E 3 36 ? -13.739 -10.804 1.485   1.00 1.68  ? 36 ILE C HA     2  
ATOM 9291  H HB     . ILE E 3 36 ? -10.858 -10.618 2.299   1.00 2.02  ? 36 ILE C HB     2  
ATOM 9292  H HG12   . ILE E 3 36 ? -12.183 -8.048  1.821   1.00 2.08  ? 36 ILE C HG12   2  
ATOM 9293  H HG13   . ILE E 3 36 ? -12.729 -8.851  3.292   1.00 2.36  ? 36 ILE C HG13   2  
ATOM 9294  H HG21   . ILE E 3 36 ? -10.597 -9.475  0.213   1.00 1.84  ? 36 ILE C HG21   2  
ATOM 9295  H HG22   . ILE E 3 36 ? -12.344 -9.380  -0.012  1.00 1.77  ? 36 ILE C HG22   2  
ATOM 9296  H HG23   . ILE E 3 36 ? -11.529 -10.943 -0.080  1.00 1.79  ? 36 ILE C HG23   2  
ATOM 9297  H HD11   . ILE E 3 36 ? -10.590 -8.816  4.232   1.00 2.43  ? 36 ILE C HD11   2  
ATOM 9298  H HD12   . ILE E 3 36 ? -10.776 -7.234  3.475   1.00 2.32  ? 36 ILE C HD12   2  
ATOM 9299  H HD13   . ILE E 3 36 ? -9.819  -8.483  2.678   1.00 2.73  ? 36 ILE C HD13   2  
ATOM 9300  N N      . TYR E 3 37 ? -13.207 -13.152 0.983   1.00 1.73  ? 37 TYR C N      2  
ATOM 9301  C CA     . TYR E 3 37 ? -12.928 -14.532 0.613   1.00 1.77  ? 37 TYR C CA     2  
ATOM 9302  C C      . TYR E 3 37 ? -12.752 -14.652 -0.899  1.00 1.80  ? 37 TYR C C      2  
ATOM 9303  O O      . TYR E 3 37 ? -13.024 -13.707 -1.642  1.00 1.82  ? 37 TYR C O      2  
ATOM 9304  C CB     . TYR E 3 37 ? -14.078 -15.438 1.058   1.00 1.79  ? 37 TYR C CB     2  
ATOM 9305  C CG     . TYR E 3 37 ? -13.745 -16.341 2.221   1.00 1.77  ? 37 TYR C CG     2  
ATOM 9306  C CD1    . TYR E 3 37 ? -12.871 -17.410 2.069   1.00 1.70  ? 37 TYR C CD1    2  
ATOM 9307  C CD2    . TYR E 3 37 ? -14.312 -16.131 3.470   1.00 2.12  ? 37 TYR C CD2    2  
ATOM 9308  C CE1    . TYR E 3 37 ? -12.572 -18.243 3.130   1.00 1.83  ? 37 TYR C CE1    2  
ATOM 9309  C CE2    . TYR E 3 37 ? -14.020 -16.961 4.533   1.00 2.31  ? 37 TYR C CE2    2  
ATOM 9310  C CZ     . TYR E 3 37 ? -13.150 -18.014 4.360   1.00 2.10  ? 37 TYR C CZ     2  
ATOM 9311  O OH     . TYR E 3 37 ? -12.865 -18.838 5.423   1.00 2.40  ? 37 TYR C OH     2  
ATOM 9312  H H      . TYR E 3 37 ? -13.938 -12.683 0.518   1.00 1.75  ? 37 TYR C H      2  
ATOM 9313  H HA     . TYR E 3 37 ? -12.017 -14.842 1.107   1.00 1.81  ? 37 TYR C HA     2  
ATOM 9314  H HB2    . TYR E 3 37 ? -14.916 -14.824 1.348   1.00 1.95  ? 37 TYR C HB2    2  
ATOM 9315  H HB3    . TYR E 3 37 ? -14.371 -16.064 0.228   1.00 1.83  ? 37 TYR C HB3    2  
ATOM 9316  H HD1    . TYR E 3 37 ? -12.421 -17.584 1.103   1.00 1.77  ? 37 TYR C HD1    2  
ATOM 9317  H HD2    . TYR E 3 37 ? -14.994 -15.304 3.605   1.00 2.40  ? 37 TYR C HD2    2  
ATOM 9318  H HE1    . TYR E 3 37 ? -11.888 -19.070 2.992   1.00 1.93  ? 37 TYR C HE1    2  
ATOM 9319  H HE2    . TYR E 3 37 ? -14.470 -16.780 5.498   1.00 2.74  ? 37 TYR C HE2    2  
ATOM 9320  H HH     . TYR E 3 37 ? -11.911 -18.997 5.460   1.00 2.65  ? 37 TYR C HH     2  
ATOM 9321  N N      . VAL E 3 38 ? -12.311 -15.815 -1.347  1.00 1.91  ? 38 VAL C N      2  
ATOM 9322  C CA     . VAL E 3 38 ? -12.118 -16.069 -2.769  1.00 1.98  ? 38 VAL C CA     2  
ATOM 9323  C C      . VAL E 3 38 ? -12.985 -17.241 -3.206  1.00 1.96  ? 38 VAL C C      2  
ATOM 9324  O O      . VAL E 3 38 ? -13.125 -18.222 -2.468  1.00 2.00  ? 38 VAL C O      2  
ATOM 9325  C CB     . VAL E 3 38 ? -10.642 -16.366 -3.114  1.00 2.17  ? 38 VAL C CB     2  
ATOM 9326  C CG1    . VAL E 3 38 ? -9.841  -15.075 -3.169  1.00 2.55  ? 38 VAL C CG1    2  
ATOM 9327  C CG2    . VAL E 3 38 ? -10.025 -17.337 -2.114  1.00 2.22  ? 38 VAL C CG2    2  
ATOM 9328  H H      . VAL E 3 38 ? -12.122 -16.530 -0.708  1.00 2.01  ? 38 VAL C H      2  
ATOM 9329  H HA     . VAL E 3 38 ? -12.425 -15.183 -3.307  1.00 2.02  ? 38 VAL C HA     2  
ATOM 9330  H HB     . VAL E 3 38 ? -10.608 -16.821 -4.093  1.00 2.26  ? 38 VAL C HB     2  
ATOM 9331  H HG11   . VAL E 3 38 ? -9.945  -14.627 -4.147  1.00 2.75  ? 38 VAL C HG11   2  
ATOM 9332  H HG12   . VAL E 3 38 ? -8.799  -15.289 -2.980  1.00 2.75  ? 38 VAL C HG12   2  
ATOM 9333  H HG13   . VAL E 3 38 ? -10.210 -14.392 -2.420  1.00 3.02  ? 38 VAL C HG13   2  
ATOM 9334  H HG21   . VAL E 3 38 ? -10.214 -16.986 -1.110  1.00 2.38  ? 38 VAL C HG21   2  
ATOM 9335  H HG22   . VAL E 3 38 ? -8.958  -17.394 -2.279  1.00 2.27  ? 38 VAL C HG22   2  
ATOM 9336  H HG23   . VAL E 3 38 ? -10.460 -18.317 -2.243  1.00 2.71  ? 38 VAL C HG23   2  
ATOM 9337  N N      . ASP E 3 39 ? -13.572 -17.143 -4.389  1.00 2.00  ? 39 ASP C N      2  
ATOM 9338  C CA     . ASP E 3 39 ? -14.436 -18.203 -4.887  1.00 2.06  ? 39 ASP C CA     2  
ATOM 9339  C C      . ASP E 3 39 ? -14.126 -18.531 -6.342  1.00 2.17  ? 39 ASP C C      2  
ATOM 9340  O O      . ASP E 3 39 ? -14.665 -17.903 -7.259  1.00 2.20  ? 39 ASP C O      2  
ATOM 9341  C CB     . ASP E 3 39 ? -15.900 -17.789 -4.741  1.00 2.10  ? 39 ASP C CB     2  
ATOM 9342  C CG     . ASP E 3 39 ? -16.833 -18.971 -4.580  1.00 2.21  ? 39 ASP C CG     2  
ATOM 9343  O OD1    . ASP E 3 39 ? -16.781 -19.635 -3.527  1.00 2.29  ? 39 ASP C OD1    2  
ATOM 9344  O OD2    . ASP E 3 39 ? -17.616 -19.251 -5.513  1.00 2.29  ? 39 ASP C OD2    2  
ATOM 9345  H H      . ASP E 3 39 ? -13.426 -16.341 -4.941  1.00 2.05  ? 39 ASP C H      2  
ATOM 9346  H HA     . ASP E 3 39 ? -14.261 -19.083 -4.288  1.00 2.09  ? 39 ASP C HA     2  
ATOM 9347  H HB2    . ASP E 3 39 ? -16.002 -17.156 -3.873  1.00 2.09  ? 39 ASP C HB2    2  
ATOM 9348  H HB3    . ASP E 3 39 ? -16.198 -17.236 -5.620  1.00 2.14  ? 39 ASP C HB3    2  
ATOM 9349  N N      . ASP E 3 40 ? -13.225 -19.496 -6.532  1.00 2.29  ? 40 ASP C N      2  
ATOM 9350  C CA     . ASP E 3 40 ? -12.812 -19.967 -7.861  1.00 2.45  ? 40 ASP C CA     2  
ATOM 9351  C C      . ASP E 3 40 ? -12.025 -18.904 -8.621  1.00 2.44  ? 40 ASP C C      2  
ATOM 9352  O O      . ASP E 3 40 ? -10.798 -18.985 -8.728  1.00 2.60  ? 40 ASP C O      2  
ATOM 9353  C CB     . ASP E 3 40 ? -14.029 -20.427 -8.684  1.00 2.56  ? 40 ASP C CB     2  
ATOM 9354  C CG     . ASP E 3 40 ? -13.739 -20.555 -10.173 1.00 2.79  ? 40 ASP C CG     2  
ATOM 9355  O OD1    . ASP E 3 40 ? -12.922 -21.417 -10.563 1.00 3.00  ? 40 ASP C OD1    2  
ATOM 9356  O OD2    . ASP E 3 40 ? -14.339 -19.795 -10.963 1.00 2.98  ? 40 ASP C OD2    2  
ATOM 9357  H H      . ASP E 3 40 ? -12.808 -19.906 -5.743  1.00 2.30  ? 40 ASP C H      2  
ATOM 9358  H HA     . ASP E 3 40 ? -12.163 -20.816 -7.709  1.00 2.59  ? 40 ASP C HA     2  
ATOM 9359  H HB2    . ASP E 3 40 ? -14.355 -21.389 -8.322  1.00 2.77  ? 40 ASP C HB2    2  
ATOM 9360  H HB3    . ASP E 3 40 ? -14.826 -19.712 -8.555  1.00 2.52  ? 40 ASP C HB3    2  
ATOM 9361  N N      . GLU E 3 41 ? -12.726 -17.900 -9.115  1.00 2.35  ? 41 GLU C N      2  
ATOM 9362  C CA     . GLU E 3 41 ? -12.111 -16.834 -9.885  1.00 2.40  ? 41 GLU C CA     2  
ATOM 9363  C C      . GLU E 3 41 ? -12.593 -15.473 -9.390  1.00 2.30  ? 41 GLU C C      2  
ATOM 9364  O O      . GLU E 3 41 ? -11.846 -14.492 -9.405  1.00 2.42  ? 41 GLU C O      2  
ATOM 9365  C CB     . GLU E 3 41 ? -12.434 -17.032 -11.375 1.00 2.58  ? 41 GLU C CB     2  
ATOM 9366  C CG     . GLU E 3 41 ? -12.208 -15.802 -12.240 1.00 2.76  ? 41 GLU C CG     2  
ATOM 9367  C CD     . GLU E 3 41 ? -13.487 -15.034 -12.506 1.00 2.87  ? 41 GLU C CD     2  
ATOM 9368  O OE1    . GLU E 3 41 ? -14.478 -15.661 -12.942 1.00 3.14  ? 41 GLU C OE1    2  
ATOM 9369  O OE2    . GLU E 3 41 ? -13.496 -13.803 -12.286 1.00 3.12  ? 41 GLU C OE2    2  
ATOM 9370  H H      . GLU E 3 41 ? -13.692 -17.869 -8.938  1.00 2.32  ? 41 GLU C H      2  
ATOM 9371  H HA     . GLU E 3 41 ? -11.043 -16.897 -9.745  1.00 2.46  ? 41 GLU C HA     2  
ATOM 9372  H HB2    . GLU E 3 41 ? -11.815 -17.828 -11.760 1.00 2.79  ? 41 GLU C HB2    2  
ATOM 9373  H HB3    . GLU E 3 41 ? -13.470 -17.322 -11.470 1.00 2.77  ? 41 GLU C HB3    2  
ATOM 9374  H HG2    . GLU E 3 41 ? -11.517 -15.148 -11.731 1.00 3.03  ? 41 GLU C HG2    2  
ATOM 9375  H HG3    . GLU E 3 41 ? -11.784 -16.110 -13.184 1.00 3.11  ? 41 GLU C HG3    2  
ATOM 9376  N N      . LYS E 3 42 ? -13.836 -15.427 -8.931  1.00 2.21  ? 42 LYS C N      2  
ATOM 9377  C CA     . LYS E 3 42 ? -14.422 -14.190 -8.437  1.00 2.18  ? 42 LYS C CA     2  
ATOM 9378  C C      . LYS E 3 42 ? -14.148 -14.034 -6.949  1.00 2.07  ? 42 LYS C C      2  
ATOM 9379  O O      . LYS E 3 42 ? -13.638 -14.951 -6.299  1.00 2.13  ? 42 LYS C O      2  
ATOM 9380  C CB     . LYS E 3 42 ? -15.935 -14.138 -8.705  1.00 2.23  ? 42 LYS C CB     2  
ATOM 9381  C CG     . LYS E 3 42 ? -16.576 -15.492 -8.976  1.00 2.57  ? 42 LYS C CG     2  
ATOM 9382  C CD     . LYS E 3 42 ? -16.513 -15.851 -10.451 1.00 2.83  ? 42 LYS C CD     2  
ATOM 9383  C CE     . LYS E 3 42 ? -16.623 -17.353 -10.673 1.00 2.80  ? 42 LYS C CE     2  
ATOM 9384  N NZ     . LYS E 3 42 ? -15.865 -17.786 -11.877 1.00 2.96  ? 42 LYS C NZ     2  
ATOM 9385  H H      . LYS E 3 42 ? -14.365 -16.248 -8.901  1.00 2.25  ? 42 LYS C H      2  
ATOM 9386  H HA     . LYS E 3 42 ? -13.947 -13.372 -8.960  1.00 2.28  ? 42 LYS C HA     2  
ATOM 9387  H HB2    . LYS E 3 42 ? -16.421 -13.705 -7.844  1.00 2.16  ? 42 LYS C HB2    2  
ATOM 9388  H HB3    . LYS E 3 42 ? -16.113 -13.503 -9.561  1.00 2.57  ? 42 LYS C HB3    2  
ATOM 9389  H HG2    . LYS E 3 42 ? -16.055 -16.248 -8.410  1.00 2.89  ? 42 LYS C HG2    2  
ATOM 9390  H HG3    . LYS E 3 42 ? -17.610 -15.458 -8.667  1.00 2.87  ? 42 LYS C HG3    2  
ATOM 9391  H HD2    . LYS E 3 42 ? -17.328 -15.363 -10.964 1.00 3.24  ? 42 LYS C HD2    2  
ATOM 9392  H HD3    . LYS E 3 42 ? -15.574 -15.503 -10.855 1.00 3.05  ? 42 LYS C HD3    2  
ATOM 9393  H HE2    . LYS E 3 42 ? -16.230 -17.861 -9.808  1.00 2.94  ? 42 LYS C HE2    2  
ATOM 9394  H HE3    . LYS E 3 42 ? -17.664 -17.613 -10.802 1.00 3.01  ? 42 LYS C HE3    2  
ATOM 9395  H HZ1    . LYS E 3 42 ? -15.286 -16.996 -12.242 1.00 3.32  ? 42 LYS C HZ1    2  
ATOM 9396  H HZ2    . LYS E 3 42 ? -16.518 -18.093 -12.623 1.00 3.03  ? 42 LYS C HZ2    2  
ATOM 9397  H HZ3    . LYS E 3 42 ? -15.231 -18.583 -11.634 1.00 3.22  ? 42 LYS C HZ3    2  
ATOM 9398  N N      . ILE E 3 43 ? -14.480 -12.873 -6.416  1.00 1.95  ? 43 ILE C N      2  
ATOM 9399  C CA     . ILE E 3 43 ? -14.261 -12.594 -5.010  1.00 1.89  ? 43 ILE C CA     2  
ATOM 9400  C C      . ILE E 3 43 ? -15.591 -12.604 -4.267  1.00 1.84  ? 43 ILE C C      2  
ATOM 9401  O O      . ILE E 3 43 ? -16.601 -12.135 -4.790  1.00 1.87  ? 43 ILE C O      2  
ATOM 9402  C CB     . ILE E 3 43 ? -13.576 -11.216 -4.815  1.00 1.94  ? 43 ILE C CB     2  
ATOM 9403  C CG1    . ILE E 3 43 ? -12.351 -11.081 -5.732  1.00 1.99  ? 43 ILE C CG1    2  
ATOM 9404  C CG2    . ILE E 3 43 ? -13.178 -11.002 -3.360  1.00 1.94  ? 43 ILE C CG2    2  
ATOM 9405  C CD1    . ILE E 3 43 ? -11.257 -12.088 -5.449  1.00 2.32  ? 43 ILE C CD1    2  
ATOM 9406  H H      . ILE E 3 43 ? -14.907 -12.186 -6.979  1.00 1.94  ? 43 ILE C H      2  
ATOM 9407  H HA     . ILE E 3 43 ? -13.618 -13.362 -4.607  1.00 1.88  ? 43 ILE C HA     2  
ATOM 9408  H HB     . ILE E 3 43 ? -14.291 -10.452 -5.076  1.00 1.96  ? 43 ILE C HB     2  
ATOM 9409  H HG12   . ILE E 3 43 ? -12.661 -11.212 -6.757  1.00 2.14  ? 43 ILE C HG12   2  
ATOM 9410  H HG13   . ILE E 3 43 ? -11.931 -10.094 -5.613  1.00 2.02  ? 43 ILE C HG13   2  
ATOM 9411  H HG21   . ILE E 3 43 ? -12.895 -9.970  -3.211  1.00 2.35  ? 43 ILE C HG21   2  
ATOM 9412  H HG22   . ILE E 3 43 ? -12.345 -11.643 -3.116  1.00 1.98  ? 43 ILE C HG22   2  
ATOM 9413  H HG23   . ILE E 3 43 ? -14.014 -11.244 -2.719  1.00 2.17  ? 43 ILE C HG23   2  
ATOM 9414  H HD11   . ILE E 3 43 ? -11.632 -13.085 -5.627  1.00 2.88  ? 43 ILE C HD11   2  
ATOM 9415  H HD12   . ILE E 3 43 ? -10.945 -12.001 -4.418  1.00 2.33  ? 43 ILE C HD12   2  
ATOM 9416  H HD13   . ILE E 3 43 ? -10.415 -11.900 -6.099  1.00 2.70  ? 43 ILE C HD13   2  
ATOM 9417  N N      . ILE E 3 44 ? -15.594 -13.133 -3.054  1.00 1.79  ? 44 ILE C N      2  
ATOM 9418  C CA     . ILE E 3 44 ? -16.811 -13.205 -2.262  1.00 1.77  ? 44 ILE C CA     2  
ATOM 9419  C C      . ILE E 3 44 ? -16.648 -12.445 -0.947  1.00 1.75  ? 44 ILE C C      2  
ATOM 9420  O O      . ILE E 3 44 ? -15.616 -12.549 -0.279  1.00 1.74  ? 44 ILE C O      2  
ATOM 9421  C CB     . ILE E 3 44 ? -17.219 -14.685 -1.995  1.00 1.77  ? 44 ILE C CB     2  
ATOM 9422  C CG1    . ILE E 3 44 ? -18.358 -15.100 -2.928  1.00 1.99  ? 44 ILE C CG1    2  
ATOM 9423  C CG2    . ILE E 3 44 ? -17.633 -14.909 -0.544  1.00 2.10  ? 44 ILE C CG2    2  
ATOM 9424  C CD1    . ILE E 3 44 ? -18.004 -15.056 -4.400  1.00 2.27  ? 44 ILE C CD1    2  
ATOM 9425  H H      . ILE E 3 44 ? -14.754 -13.470 -2.672  1.00 1.79  ? 44 ILE C H      2  
ATOM 9426  H HA     . ILE E 3 44 ? -17.599 -12.738 -2.834  1.00 1.80  ? 44 ILE C HA     2  
ATOM 9427  H HB     . ILE E 3 44 ? -16.361 -15.309 -2.194  1.00 1.73  ? 44 ILE C HB     2  
ATOM 9428  H HG12   . ILE E 3 44 ? -18.658 -16.108 -2.690  1.00 2.27  ? 44 ILE C HG12   2  
ATOM 9429  H HG13   . ILE E 3 44 ? -19.195 -14.436 -2.771  1.00 2.25  ? 44 ILE C HG13   2  
ATOM 9430  H HG21   . ILE E 3 44 ? -16.786 -14.730 0.102   1.00 2.34  ? 44 ILE C HG21   2  
ATOM 9431  H HG22   . ILE E 3 44 ? -17.975 -15.926 -0.416  1.00 2.47  ? 44 ILE C HG22   2  
ATOM 9432  H HG23   . ILE E 3 44 ? -18.430 -14.226 -0.291  1.00 2.50  ? 44 ILE C HG23   2  
ATOM 9433  H HD11   . ILE E 3 44 ? -18.797 -15.512 -4.975  1.00 2.58  ? 44 ILE C HD11   2  
ATOM 9434  H HD12   . ILE E 3 44 ? -17.083 -15.592 -4.567  1.00 2.55  ? 44 ILE C HD12   2  
ATOM 9435  H HD13   . ILE E 3 44 ? -17.884 -14.028 -4.709  1.00 2.59  ? 44 ILE C HD13   2  
ATOM 9436  N N      . LEU E 3 45 ? -17.653 -11.653 -0.597  1.00 1.78  ? 45 LEU C N      2  
ATOM 9437  C CA     . LEU E 3 45 ? -17.631 -10.894 0.642   1.00 1.78  ? 45 LEU C CA     2  
ATOM 9438  C C      . LEU E 3 45 ? -18.705 -11.439 1.576   1.00 1.78  ? 45 LEU C C      2  
ATOM 9439  O O      . LEU E 3 45 ? -19.895 -11.408 1.254   1.00 1.88  ? 45 LEU C O      2  
ATOM 9440  C CB     . LEU E 3 45 ? -17.869 -9.400  0.379   1.00 1.85  ? 45 LEU C CB     2  
ATOM 9441  C CG     . LEU E 3 45 ? -17.174 -8.824  -0.863  1.00 2.24  ? 45 LEU C CG     2  
ATOM 9442  C CD1    . LEU E 3 45 ? -17.649 -7.408  -1.133  1.00 2.43  ? 45 LEU C CD1    2  
ATOM 9443  C CD2    . LEU E 3 45 ? -15.663 -8.850  -0.694  1.00 2.44  ? 45 LEU C CD2    2  
ATOM 9444  H H      . LEU E 3 45 ? -18.437 -11.581 -1.190  1.00 1.81  ? 45 LEU C H      2  
ATOM 9445  H HA     . LEU E 3 45 ? -16.661 -11.028 1.101   1.00 1.76  ? 45 LEU C HA     2  
ATOM 9446  H HB2    . LEU E 3 45 ? -18.930 -9.241  0.278   1.00 1.73  ? 45 LEU C HB2    2  
ATOM 9447  H HB3    . LEU E 3 45 ? -17.523 -8.848  1.240   1.00 2.00  ? 45 LEU C HB3    2  
ATOM 9448  H HG     . LEU E 3 45 ? -17.424 -9.428  -1.725  1.00 2.88  ? 45 LEU C HG     2  
ATOM 9449  H HD11   . LEU E 3 45 ? -17.358 -6.767  -0.313  1.00 2.81  ? 45 LEU C HD11   2  
ATOM 9450  H HD12   . LEU E 3 45 ? -18.725 -7.403  -1.230  1.00 2.52  ? 45 LEU C HD12   2  
ATOM 9451  H HD13   . LEU E 3 45 ? -17.202 -7.047  -2.048  1.00 2.87  ? 45 LEU C HD13   2  
ATOM 9452  H HD21   . LEU E 3 45 ? -15.334 -9.869  -0.569  1.00 2.92  ? 45 LEU C HD21   2  
ATOM 9453  H HD22   . LEU E 3 45 ? -15.392 -8.275  0.177   1.00 2.57  ? 45 LEU C HD22   2  
ATOM 9454  H HD23   . LEU E 3 45 ? -15.193 -8.423  -1.570  1.00 2.77  ? 45 LEU C HD23   2  
ATOM 9455  N N      . LYS E 3 46 ? -18.280 -11.961 2.715   1.00 1.74  ? 46 LYS C N      2  
ATOM 9456  C CA     . LYS E 3 46 ? -19.199 -12.527 3.691   1.00 1.77  ? 46 LYS C CA     2  
ATOM 9457  C C      . LYS E 3 46 ? -19.290 -11.648 4.927   1.00 1.78  ? 46 LYS C C      2  
ATOM 9458  O O      . LYS E 3 46 ? -18.788 -10.523 4.940   1.00 1.86  ? 46 LYS C O      2  
ATOM 9459  C CB     . LYS E 3 46 ? -18.746 -13.931 4.085   1.00 1.76  ? 46 LYS C CB     2  
ATOM 9460  C CG     . LYS E 3 46 ? -19.193 -15.007 3.117   1.00 1.86  ? 46 LYS C CG     2  
ATOM 9461  C CD     . LYS E 3 46 ? -18.816 -16.385 3.623   1.00 1.92  ? 46 LYS C CD     2  
ATOM 9462  C CE     . LYS E 3 46 ? -19.551 -17.482 2.874   1.00 2.45  ? 46 LYS C CE     2  
ATOM 9463  N NZ     . LYS E 3 46 ? -19.288 -18.820 3.464   1.00 3.02  ? 46 LYS C NZ     2  
ATOM 9464  H H      . LYS E 3 46 ? -17.315 -11.961 2.908   1.00 1.75  ? 46 LYS C H      2  
ATOM 9465  H HA     . LYS E 3 46 ? -20.177 -12.590 3.233   1.00 1.89  ? 46 LYS C HA     2  
ATOM 9466  H HB2    . LYS E 3 46 ? -17.668 -13.949 4.133   1.00 1.89  ? 46 LYS C HB2    2  
ATOM 9467  H HB3    . LYS E 3 46 ? -19.143 -14.166 5.061   1.00 2.17  ? 46 LYS C HB3    2  
ATOM 9468  H HG2    . LYS E 3 46 ? -20.266 -14.956 3.002   1.00 2.40  ? 46 LYS C HG2    2  
ATOM 9469  H HG3    . LYS E 3 46 ? -18.717 -14.839 2.162   1.00 2.13  ? 46 LYS C HG3    2  
ATOM 9470  H HD2    . LYS E 3 46 ? -17.754 -16.526 3.493   1.00 2.39  ? 46 LYS C HD2    2  
ATOM 9471  H HD3    . LYS E 3 46 ? -19.062 -16.451 4.673   1.00 1.86  ? 46 LYS C HD3    2  
ATOM 9472  H HE2    . LYS E 3 46 ? -20.611 -17.281 2.915   1.00 2.74  ? 46 LYS C HE2    2  
ATOM 9473  H HE3    . LYS E 3 46 ? -19.222 -17.480 1.847   1.00 2.69  ? 46 LYS C HE3    2  
ATOM 9474  H HZ1    . LYS E 3 46 ? -18.391 -19.204 3.098   1.00 3.24  ? 46 LYS C HZ1    2  
ATOM 9475  H HZ2    . LYS E 3 46 ? -20.056 -19.476 3.224   1.00 3.51  ? 46 LYS C HZ2    2  
ATOM 9476  H HZ3    . LYS E 3 46 ? -19.222 -18.747 4.498   1.00 3.25  ? 46 LYS C HZ3    2  
ATOM 9477  N N      . LYS E 3 47 ? -19.943 -12.165 5.962   1.00 1.78  ? 47 LYS C N      2  
ATOM 9478  C CA     . LYS E 3 47 ? -20.105 -11.435 7.212   1.00 1.85  ? 47 LYS C CA     2  
ATOM 9479  C C      . LYS E 3 47 ? -18.808 -11.452 8.017   1.00 1.93  ? 47 LYS C C      2  
ATOM 9480  O O      . LYS E 3 47 ? -18.060 -10.475 8.017   1.00 2.19  ? 47 LYS C O      2  
ATOM 9481  C CB     . LYS E 3 47 ? -21.248 -12.042 8.034   1.00 1.93  ? 47 LYS C CB     2  
ATOM 9482  C CG     . LYS E 3 47 ? -22.609 -11.943 7.359   1.00 2.08  ? 47 LYS C CG     2  
ATOM 9483  C CD     . LYS E 3 47 ? -23.651 -12.820 8.041   1.00 2.26  ? 47 LYS C CD     2  
ATOM 9484  C CE     . LYS E 3 47 ? -23.364 -14.298 7.830   1.00 2.71  ? 47 LYS C CE     2  
ATOM 9485  N NZ     . LYS E 3 47 ? -24.602 -15.115 7.897   1.00 2.96  ? 47 LYS C NZ     2  
ATOM 9486  H H      . LYS E 3 47 ? -20.326 -13.063 5.882   1.00 1.78  ? 47 LYS C H      2  
ATOM 9487  H HA     . LYS E 3 47 ? -20.351 -10.412 6.968   1.00 1.92  ? 47 LYS C HA     2  
ATOM 9488  H HB2    . LYS E 3 47 ? -21.033 -13.086 8.212   1.00 2.33  ? 47 LYS C HB2    2  
ATOM 9489  H HB3    . LYS E 3 47 ? -21.303 -11.528 8.984   1.00 2.09  ? 47 LYS C HB3    2  
ATOM 9490  H HG2    . LYS E 3 47 ? -22.942 -10.916 7.397   1.00 2.22  ? 47 LYS C HG2    2  
ATOM 9491  H HG3    . LYS E 3 47 ? -22.511 -12.251 6.330   1.00 2.63  ? 47 LYS C HG3    2  
ATOM 9492  H HD2    . LYS E 3 47 ? -23.646 -12.611 9.099   1.00 2.53  ? 47 LYS C HD2    2  
ATOM 9493  H HD3    . LYS E 3 47 ? -24.622 -12.590 7.631   1.00 2.36  ? 47 LYS C HD3    2  
ATOM 9494  H HE2    . LYS E 3 47 ? -22.909 -14.430 6.861   1.00 2.83  ? 47 LYS C HE2    2  
ATOM 9495  H HE3    . LYS E 3 47 ? -22.681 -14.631 8.598   1.00 3.18  ? 47 LYS C HE3    2  
ATOM 9496  H HZ1    . LYS E 3 47 ? -24.979 -15.118 8.864   1.00 2.96  ? 47 LYS C HZ1    2  
ATOM 9497  H HZ2    . LYS E 3 47 ? -24.399 -16.095 7.612   1.00 3.20  ? 47 LYS C HZ2    2  
ATOM 9498  H HZ3    . LYS E 3 47 ? -25.327 -14.722 7.253   1.00 3.37  ? 47 LYS C HZ3    2  
ATOM 9499  N N      . TYR E 3 48 ? -18.547 -12.575 8.686   1.00 2.23  ? 48 TYR C N      2  
ATOM 9500  C CA     . TYR E 3 48 ? -17.348 -12.735 9.507   1.00 2.39  ? 48 TYR C CA     2  
ATOM 9501  C C      . TYR E 3 48 ? -17.333 -14.101 10.178  1.00 2.15  ? 48 TYR C C      2  
ATOM 9502  O O      . TYR E 3 48 ? -18.387 -14.664 10.482  1.00 2.21  ? 48 TYR C O      2  
ATOM 9503  C CB     . TYR E 3 48 ? -17.268 -11.644 10.590  1.00 3.00  ? 48 TYR C CB     2  
ATOM 9504  C CG     . TYR E 3 48 ? -18.338 -11.751 11.659  1.00 3.03  ? 48 TYR C CG     2  
ATOM 9505  C CD1    . TYR E 3 48 ? -19.611 -11.238 11.446  1.00 3.24  ? 48 TYR C CD1    2  
ATOM 9506  C CD2    . TYR E 3 48 ? -18.076 -12.367 12.875  1.00 3.08  ? 48 TYR C CD2    2  
ATOM 9507  C CE1    . TYR E 3 48 ? -20.592 -11.338 12.411  1.00 3.54  ? 48 TYR C CE1    2  
ATOM 9508  C CE2    . TYR E 3 48 ? -19.053 -12.471 13.846  1.00 3.45  ? 48 TYR C CE2    2  
ATOM 9509  C CZ     . TYR E 3 48 ? -20.308 -11.956 13.609  1.00 3.69  ? 48 TYR C CZ     2  
ATOM 9510  O OH     . TYR E 3 48 ? -21.283 -12.060 14.577  1.00 4.20  ? 48 TYR C OH     2  
ATOM 9511  H H      . TYR E 3 48 ? -19.172 -13.325 8.619   1.00 2.60  ? 48 TYR C H      2  
ATOM 9512  H HA     . TYR E 3 48 ? -16.489 -12.655 8.862   1.00 2.57  ? 48 TYR C HA     2  
ATOM 9513  H HB2    . TYR E 3 48 ? -16.307 -11.707 11.080  1.00 3.37  ? 48 TYR C HB2    2  
ATOM 9514  H HB3    . TYR E 3 48 ? -17.362 -10.677 10.120  1.00 3.36  ? 48 TYR C HB3    2  
ATOM 9515  H HD1    . TYR E 3 48 ? -19.829 -10.754 10.505  1.00 3.31  ? 48 TYR C HD1    2  
ATOM 9516  H HD2    . TYR E 3 48 ? -17.090 -12.770 13.059  1.00 2.97  ? 48 TYR C HD2    2  
ATOM 9517  H HE1    . TYR E 3 48 ? -21.575 -10.931 12.225  1.00 3.76  ? 48 TYR C HE1    2  
ATOM 9518  H HE2    . TYR E 3 48 ? -18.829 -12.955 14.785  1.00 3.66  ? 48 TYR C HE2    2  
ATOM 9519  H HH     . TYR E 3 48 ? -22.128 -12.276 14.161  1.00 4.26  ? 48 TYR C HH     2  
ATOM 9520  N N      . LYS E 3 49 ? -16.145 -14.646 10.379  1.00 2.22  ? 49 LYS C N      2  
ATOM 9521  C CA     . LYS E 3 49 ? -16.006 -15.921 11.060  1.00 2.29  ? 49 LYS C CA     2  
ATOM 9522  C C      . LYS E 3 49 ? -15.532 -15.683 12.487  1.00 2.48  ? 49 LYS C C      2  
ATOM 9523  O O      . LYS E 3 49 ? -14.497 -15.048 12.699  1.00 2.62  ? 49 LYS C O      2  
ATOM 9524  C CB     . LYS E 3 49 ? -15.011 -16.837 10.347  1.00 2.60  ? 49 LYS C CB     2  
ATOM 9525  C CG     . LYS E 3 49 ? -15.487 -17.345 8.999   1.00 2.71  ? 49 LYS C CG     2  
ATOM 9526  C CD     . LYS E 3 49 ? -14.563 -18.430 8.458   1.00 2.93  ? 49 LYS C CD     2  
ATOM 9527  C CE     . LYS E 3 49 ? -13.099 -18.027 8.553   1.00 3.24  ? 49 LYS C CE     2  
ATOM 9528  N NZ     . LYS E 3 49 ? -12.795 -16.808 7.758   1.00 3.12  ? 49 LYS C NZ     2  
ATOM 9529  H H      . LYS E 3 49 ? -15.341 -14.192 10.040  1.00 2.45  ? 49 LYS C H      2  
ATOM 9530  H HA     . LYS E 3 49 ? -16.975 -16.393 11.083  1.00 2.32  ? 49 LYS C HA     2  
ATOM 9531  H HB2    . LYS E 3 49 ? -14.089 -16.298 10.195  1.00 3.14  ? 49 LYS C HB2    2  
ATOM 9532  H HB3    . LYS E 3 49 ? -14.815 -17.691 10.978  1.00 2.84  ? 49 LYS C HB3    2  
ATOM 9533  H HG2    . LYS E 3 49 ? -16.480 -17.752 9.108   1.00 2.84  ? 49 LYS C HG2    2  
ATOM 9534  H HG3    . LYS E 3 49 ? -15.508 -16.521 8.302   1.00 3.22  ? 49 LYS C HG3    2  
ATOM 9535  H HD2    . LYS E 3 49 ? -14.710 -19.333 9.031   1.00 3.09  ? 49 LYS C HD2    2  
ATOM 9536  H HD3    . LYS E 3 49 ? -14.808 -18.614 7.422   1.00 3.36  ? 49 LYS C HD3    2  
ATOM 9537  H HE2    . LYS E 3 49 ? -12.860 -17.840 9.587   1.00 3.55  ? 49 LYS C HE2    2  
ATOM 9538  H HE3    . LYS E 3 49 ? -12.494 -18.844 8.187   1.00 3.71  ? 49 LYS C HE3    2  
ATOM 9539  H HZ1    . LYS E 3 49 ? -11.843 -16.460 7.988   1.00 3.41  ? 49 LYS C HZ1    2  
ATOM 9540  H HZ2    . LYS E 3 49 ? -13.488 -16.050 7.969   1.00 2.66  ? 49 LYS C HZ2    2  
ATOM 9541  H HZ3    . LYS E 3 49 ? -12.836 -17.027 6.745   1.00 3.66  ? 49 LYS C HZ3    2  
ATOM 9542  N N      . PRO E 3 50 ? -16.283 -16.172 13.484  1.00 2.65  ? 50 PRO C N      2  
ATOM 9543  C CA     . PRO E 3 50 ? -15.916 -16.016 14.893  1.00 3.00  ? 50 PRO C CA     2  
ATOM 9544  C C      . PRO E 3 50 ? -14.575 -16.679 15.196  1.00 3.20  ? 50 PRO C C      2  
ATOM 9545  O O      . PRO E 3 50 ? -14.446 -17.907 15.144  1.00 3.50  ? 50 PRO C O      2  
ATOM 9546  C CB     . PRO E 3 50 ? -17.054 -16.711 15.651  1.00 3.22  ? 50 PRO C CB     2  
ATOM 9547  C CG     . PRO E 3 50 ? -17.712 -17.594 14.646  1.00 3.12  ? 50 PRO C CG     2  
ATOM 9548  C CD     . PRO E 3 50 ? -17.544 -16.911 13.320  1.00 2.73  ? 50 PRO C CD     2  
ATOM 9549  H HA     . PRO E 3 50 ? -15.871 -14.972 15.175  1.00 3.05  ? 50 PRO C HA     2  
ATOM 9550  H HB2    . PRO E 3 50 ? -16.645 -17.284 16.470  1.00 3.45  ? 50 PRO C HB2    2  
ATOM 9551  H HB3    . PRO E 3 50 ? -17.741 -15.970 16.032  1.00 3.39  ? 50 PRO C HB3    2  
ATOM 9552  H HG2    . PRO E 3 50 ? -17.228 -18.558 14.634  1.00 3.30  ? 50 PRO C HG2    2  
ATOM 9553  H HG3    . PRO E 3 50 ? -18.760 -17.702 14.882  1.00 3.33  ? 50 PRO C HG3    2  
ATOM 9554  H HD2    . PRO E 3 50 ? -17.466 -17.640 12.526  1.00 2.73  ? 50 PRO C HD2    2  
ATOM 9555  H HD3    . PRO E 3 50 ? -18.366 -16.233 13.135  1.00 2.66  ? 50 PRO C HD3    2  
ATOM 9556  N N      . ASN E 3 51 ? -13.574 -15.865 15.494  1.00 3.15  ? 51 ASN C N      2  
ATOM 9557  C CA     . ASN E 3 51 ? -12.247 -16.378 15.783  1.00 3.43  ? 51 ASN C CA     2  
ATOM 9558  C C      . ASN E 3 51 ? -11.537 -15.512 16.813  1.00 3.57  ? 51 ASN C C      2  
ATOM 9559  O O      . ASN E 3 51 ? -11.788 -14.311 16.914  1.00 3.68  ? 51 ASN C O      2  
ATOM 9560  C CB     . ASN E 3 51 ? -11.408 -16.468 14.499  1.00 3.38  ? 51 ASN C CB     2  
ATOM 9561  C CG     . ASN E 3 51 ? -10.914 -15.119 14.007  1.00 3.44  ? 51 ASN C CG     2  
ATOM 9562  O OD1    . ASN E 3 51 ? -9.840  -14.657 14.399  1.00 3.72  ? 51 ASN C OD1    2  
ATOM 9563  N ND2    . ASN E 3 51 ? -11.688 -14.483 13.140  1.00 3.72  ? 51 ASN C ND2    2  
ATOM 9564  H H      . ASN E 3 51 ? -13.735 -14.896 15.533  1.00 3.00  ? 51 ASN C H      2  
ATOM 9565  H HA     . ASN E 3 51 ? -12.365 -17.370 16.191  1.00 3.72  ? 51 ASN C HA     2  
ATOM 9566  H HB2    . ASN E 3 51 ? -10.549 -17.094 14.685  1.00 3.67  ? 51 ASN C HB2    2  
ATOM 9567  H HB3    . ASN E 3 51 ? -12.007 -16.914 13.719  1.00 3.46  ? 51 ASN C HB3    2  
ATOM 9568  H HD21   . ASN E 3 51 ? -12.531 -14.911 12.868  1.00 3.90  ? 51 ASN C HD21   2  
ATOM 9569  H HD22   . ASN E 3 51 ? -11.390 -13.613 12.803  1.00 4.02  ? 51 ASN C HD22   2  
ATOM 9570  N N      . MET E 3 52 ? -10.667 -16.139 17.584  1.00 3.70  ? 52 MET C N      2  
ATOM 9571  C CA     . MET E 3 52 ? -9.903  -15.440 18.605  1.00 3.97  ? 52 MET C CA     2  
ATOM 9572  C C      . MET E 3 52 ? -8.418  -15.749 18.457  1.00 3.92  ? 52 MET C C      2  
ATOM 9573  O O      . MET E 3 52 ? -7.561  -14.994 18.926  1.00 4.06  ? 52 MET C O      2  
ATOM 9574  C CB     . MET E 3 52 ? -10.381 -15.827 20.010  1.00 4.32  ? 52 MET C CB     2  
ATOM 9575  C CG     . MET E 3 52 ? -10.168 -17.294 20.357  1.00 4.86  ? 52 MET C CG     2  
ATOM 9576  S SD     . MET E 3 52 ? -11.487 -18.359 19.737  1.00 5.47  ? 52 MET C SD     2  
ATOM 9577  C CE     . MET E 3 52 ? -10.813 -19.984 20.077  1.00 6.01  ? 52 MET C CE     2  
ATOM 9578  H H      . MET E 3 52 ? -10.538 -17.105 17.467  1.00 3.69  ? 52 MET C H      2  
ATOM 9579  H HA     . MET E 3 52 ? -10.053 -14.380 18.463  1.00 4.15  ? 52 MET C HA     2  
ATOM 9580  H HB2    . MET E 3 52 ? -9.848  -15.230 20.734  1.00 4.47  ? 52 MET C HB2    2  
ATOM 9581  H HB3    . MET E 3 52 ? -11.436 -15.613 20.088  1.00 4.42  ? 52 MET C HB3    2  
ATOM 9582  H HG2    . MET E 3 52 ? -9.233  -17.618 19.927  1.00 5.22  ? 52 MET C HG2    2  
ATOM 9583  H HG3    . MET E 3 52 ? -10.121 -17.392 21.432  1.00 4.97  ? 52 MET C HG3    2  
ATOM 9584  H HE1    . MET E 3 52 ? -10.591 -20.069 21.130  1.00 6.32  ? 52 MET C HE1    2  
ATOM 9585  H HE2    . MET E 3 52 ? -9.909  -20.128 19.504  1.00 6.13  ? 52 MET C HE2    2  
ATOM 9586  H HE3    . MET E 3 52 ? -11.537 -20.737 19.801  1.00 6.26  ? 52 MET C HE3    2  
ATOM 9587  N N      . THR E 3 53 ? -8.121  -16.859 17.792  1.00 4.09  ? 53 THR C N      2  
ATOM 9588  C CA     . THR E 3 53 ? -6.748  -17.280 17.580  1.00 4.24  ? 53 THR C CA     2  
ATOM 9589  C C      . THR E 3 53 ? -6.171  -16.645 16.318  1.00 3.94  ? 53 THR C C      2  
ATOM 9590  O O      . THR E 3 53 ? -6.800  -16.670 15.259  1.00 4.29  ? 53 THR C O      2  
ATOM 9591  C CB     . THR E 3 53 ? -6.653  -18.812 17.454  1.00 5.13  ? 53 THR C CB     2  
ATOM 9592  O OG1    . THR E 3 53 ? -7.617  -19.437 18.313  1.00 5.62  ? 53 THR C OG1    2  
ATOM 9593  C CG2    . THR E 3 53 ? -5.262  -19.294 17.822  1.00 5.57  ? 53 THR C CG2    2  
ATOM 9594  H H      . THR E 3 53 ? -8.845  -17.411 17.433  1.00 4.36  ? 53 THR C H      2  
ATOM 9595  H HA     . THR E 3 53 ? -6.163  -16.971 18.433  1.00 4.28  ? 53 THR C HA     2  
ATOM 9596  H HB     . THR E 3 53 ? -6.855  -19.091 16.430  1.00 5.37  ? 53 THR C HB     2  
ATOM 9597  H HG1    . THR E 3 53 ? -8.275  -19.891 17.772  1.00 5.95  ? 53 THR C HG1    2  
ATOM 9598  H HG21   . THR E 3 53 ? -5.111  -19.183 18.886  1.00 5.60  ? 53 THR C HG21   2  
ATOM 9599  H HG22   . THR E 3 53 ? -4.526  -18.705 17.293  1.00 5.71  ? 53 THR C HG22   2  
ATOM 9600  H HG23   . THR E 3 53 ? -5.157  -20.333 17.550  1.00 6.01  ? 53 THR C HG23   2  
ATOM 9601  N N      . CYS E 3 54 ? -4.978  -16.075 16.438  1.00 3.72  ? 54 CYS C N      2  
ATOM 9602  C CA     . CYS E 3 54 ? -4.307  -15.449 15.304  1.00 3.72  ? 54 CYS C CA     2  
ATOM 9603  C C      . CYS E 3 54 ? -3.853  -16.507 14.301  1.00 3.77  ? 54 CYS C C      2  
ATOM 9604  O O      . CYS E 3 54 ? -3.683  -16.229 13.113  1.00 4.12  ? 54 CYS C O      2  
ATOM 9605  C CB     . CYS E 3 54 ? -3.105  -14.644 15.793  1.00 3.72  ? 54 CYS C CB     2  
ATOM 9606  S SG     . CYS E 3 54 ? -2.119  -15.507 17.059  1.00 3.83  ? 54 CYS C SG     2  
ATOM 9607  H H      . CYS E 3 54 ? -4.538  -16.065 17.318  1.00 3.86  ? 54 CYS C H      2  
ATOM 9608  H HA     . CYS E 3 54 ? -5.009  -14.782 14.823  1.00 4.08  ? 54 CYS C HA     2  
ATOM 9609  H HB2    . CYS E 3 54 ? -2.455  -14.434 14.955  1.00 4.02  ? 54 CYS C HB2    2  
ATOM 9610  H HB3    . CYS E 3 54 ? -3.450  -13.713 16.219  1.00 3.87  ? 54 CYS C HB3    2  
ATOM 9611  N N      . GLN E 3 55 ? -3.652  -17.722 14.794  1.00 3.86  ? 55 GLN C N      2  
ATOM 9612  C CA     . GLN E 3 55 ? -3.229  -18.835 13.953  1.00 4.24  ? 55 GLN C CA     2  
ATOM 9613  C C      . GLN E 3 55 ? -4.414  -19.406 13.184  1.00 4.59  ? 55 GLN C C      2  
ATOM 9614  O O      . GLN E 3 55 ? -5.549  -19.389 13.669  1.00 4.51  ? 55 GLN C O      2  
ATOM 9615  C CB     . GLN E 3 55 ? -2.582  -19.932 14.805  1.00 4.49  ? 55 GLN C CB     2  
ATOM 9616  C CG     . GLN E 3 55 ? -1.365  -19.457 15.577  1.00 4.59  ? 55 GLN C CG     2  
ATOM 9617  C CD     . GLN E 3 55 ? -0.263  -18.960 14.666  1.00 4.82  ? 55 GLN C CD     2  
ATOM 9618  O OE1    . GLN E 3 55 ? -0.229  -17.787 14.294  1.00 4.93  ? 55 GLN C OE1    2  
ATOM 9619  N NE2    . GLN E 3 55 ? 0.641   -19.851 14.292  1.00 5.31  ? 55 GLN C NE2    2  
ATOM 9620  H H      . GLN E 3 55 ? -3.793  -17.873 15.750  1.00 3.96  ? 55 GLN C H      2  
ATOM 9621  H HA     . GLN E 3 55 ? -2.500  -18.461 13.247  1.00 4.35  ? 55 GLN C HA     2  
ATOM 9622  H HB2    . GLN E 3 55 ? -3.310  -20.302 15.511  1.00 4.55  ? 55 GLN C HB2    2  
ATOM 9623  H HB3    . GLN E 3 55 ? -2.278  -20.742 14.160  1.00 4.93  ? 55 GLN C HB3    2  
ATOM 9624  H HG2    . GLN E 3 55 ? -1.661  -18.651 16.231  1.00 4.65  ? 55 GLN C HG2    2  
ATOM 9625  H HG3    . GLN E 3 55 ? -0.981  -20.278 16.168  1.00 4.89  ? 55 GLN C HG3    2  
ATOM 9626  H HE21   . GLN E 3 55 ? 0.548   -20.770 14.619  1.00 5.48  ? 55 GLN C HE21   2  
ATOM 9627  H HE22   . GLN E 3 55 ? 1.371   -19.555 13.704  1.00 5.70  ? 55 GLN C HE22   2  
ATOM 9628  N N      . MET F 3 1  ? -5.177  -6.804  5.549   1.00 3.34  ? 1  MET D N      2  
ATOM 9629  C CA     . MET F 3 1  ? -6.102  -7.905  5.313   1.00 2.92  ? 1  MET D CA     2  
ATOM 9630  C C      . MET F 3 1  ? -5.875  -8.506  3.931   1.00 2.85  ? 1  MET D C      2  
ATOM 9631  O O      . MET F 3 1  ? -5.200  -7.911  3.088   1.00 3.13  ? 1  MET D O      2  
ATOM 9632  C CB     . MET F 3 1  ? -7.555  -7.423  5.447   1.00 3.00  ? 1  MET D CB     2  
ATOM 9633  C CG     . MET F 3 1  ? -7.954  -7.052  6.869   1.00 3.12  ? 1  MET D CG     2  
ATOM 9634  S SD     . MET F 3 1  ? -7.249  -5.480  7.404   1.00 3.32  ? 1  MET D SD     2  
ATOM 9635  C CE     . MET F 3 1  ? -7.887  -5.364  9.073   1.00 3.69  ? 1  MET D CE     2  
ATOM 9636  H H1     . MET F 3 1  ? -5.512  -5.990  5.993   1.00 3.71  ? 1  MET D H1     2  
ATOM 9637  H HA     . MET F 3 1  ? -5.911  -8.662  6.058   1.00 2.81  ? 1  MET D HA     2  
ATOM 9638  H HB2    . MET F 3 1  ? -7.689  -6.552  4.824   1.00 3.29  ? 1  MET D HB2    2  
ATOM 9639  H HB3    . MET F 3 1  ? -8.215  -8.205  5.103   1.00 2.89  ? 1  MET D HB3    2  
ATOM 9640  H HG2    . MET F 3 1  ? -9.030  -6.983  6.922   1.00 3.09  ? 1  MET D HG2    2  
ATOM 9641  H HG3    . MET F 3 1  ? -7.612  -7.829  7.537   1.00 3.31  ? 1  MET D HG3    2  
ATOM 9642  H HE1    . MET F 3 1  ? -7.686  -4.379  9.469   1.00 3.76  ? 1  MET D HE1    2  
ATOM 9643  H HE2    . MET F 3 1  ? -7.407  -6.103  9.694   1.00 3.86  ? 1  MET D HE2    2  
ATOM 9644  H HE3    . MET F 3 1  ? -8.952  -5.540  9.064   1.00 4.11  ? 1  MET D HE3    2  
ATOM 9645  N N      . LYS F 3 2  ? -6.434  -9.685  3.710   1.00 2.64  ? 2  LYS D N      2  
ATOM 9646  C CA     . LYS F 3 2  ? -6.296  -10.375 2.437   1.00 2.57  ? 2  LYS D CA     2  
ATOM 9647  C C      . LYS F 3 2  ? -7.569  -11.145 2.113   1.00 2.33  ? 2  LYS D C      2  
ATOM 9648  O O      . LYS F 3 2  ? -8.488  -11.209 2.928   1.00 2.18  ? 2  LYS D O      2  
ATOM 9649  C CB     . LYS F 3 2  ? -5.100  -11.330 2.466   1.00 2.62  ? 2  LYS D CB     2  
ATOM 9650  C CG     . LYS F 3 2  ? -3.860  -10.786 1.773   1.00 3.03  ? 2  LYS D CG     2  
ATOM 9651  C CD     . LYS F 3 2  ? -4.046  -10.683 0.268   1.00 3.33  ? 2  LYS D CD     2  
ATOM 9652  C CE     . LYS F 3 2  ? -2.758  -10.257 -0.416  1.00 3.17  ? 2  LYS D CE     2  
ATOM 9653  N NZ     . LYS F 3 2  ? -2.912  -10.181 -1.892  1.00 3.57  ? 2  LYS D NZ     2  
ATOM 9654  H H      . LYS F 3 2  ? -6.965  -10.102 4.418   1.00 2.64  ? 2  LYS D H      2  
ATOM 9655  H HA     . LYS F 3 2  ? -6.134  -9.631  1.671   1.00 2.71  ? 2  LYS D HA     2  
ATOM 9656  H HB2    . LYS F 3 2  ? -4.847  -11.538 3.494   1.00 2.46  ? 2  LYS D HB2    2  
ATOM 9657  H HB3    . LYS F 3 2  ? -5.381  -12.254 1.979   1.00 2.59  ? 2  LYS D HB3    2  
ATOM 9658  H HG2    . LYS F 3 2  ? -3.646  -9.803  2.164   1.00 3.15  ? 2  LYS D HG2    2  
ATOM 9659  H HG3    . LYS F 3 2  ? -3.026  -11.443 1.979   1.00 3.04  ? 2  LYS D HG3    2  
ATOM 9660  H HD2    . LYS F 3 2  ? -4.346  -11.645 -0.118  1.00 3.50  ? 2  LYS D HD2    2  
ATOM 9661  H HD3    . LYS F 3 2  ? -4.812  -9.951  0.058   1.00 3.74  ? 2  LYS D HD3    2  
ATOM 9662  H HE2    . LYS F 3 2  ? -2.470  -9.288  -0.042  1.00 3.25  ? 2  LYS D HE2    2  
ATOM 9663  H HE3    . LYS F 3 2  ? -1.987  -10.976 -0.180  1.00 2.98  ? 2  LYS D HE3    2  
ATOM 9664  H HZ1    . LYS F 3 2  ? -2.032  -9.834  -2.323  1.00 3.85  ? 2  LYS D HZ1    2  
ATOM 9665  H HZ2    . LYS F 3 2  ? -3.685  -9.537  -2.144  1.00 3.96  ? 2  LYS D HZ2    2  
ATOM 9666  H HZ3    . LYS F 3 2  ? -3.122  -11.123 -2.276  1.00 3.57  ? 2  LYS D HZ3    2  
ATOM 9667  N N      . SER F 3 3  ? -7.603  -11.747 0.934   1.00 2.36  ? 3  SER D N      2  
ATOM 9668  C CA     . SER F 3 3  ? -8.762  -12.503 0.484   1.00 2.17  ? 3  SER D CA     2  
ATOM 9669  C C      . SER F 3 3  ? -8.705  -13.956 0.959   1.00 2.05  ? 3  SER D C      2  
ATOM 9670  O O      . SER F 3 3  ? -9.380  -14.828 0.412   1.00 1.96  ? 3  SER D O      2  
ATOM 9671  C CB     . SER F 3 3  ? -8.822  -12.445 -1.038  1.00 2.26  ? 3  SER D CB     2  
ATOM 9672  O OG     . SER F 3 3  ? -8.213  -11.255 -1.512  1.00 2.64  ? 3  SER D OG     2  
ATOM 9673  H H      . SER F 3 3  ? -6.827  -11.673 0.339   1.00 2.54  ? 3  SER D H      2  
ATOM 9674  H HA     . SER F 3 3  ? -9.645  -12.034 0.890   1.00 2.09  ? 3  SER D HA     2  
ATOM 9675  H HB2    . SER F 3 3  ? -8.299  -13.295 -1.452  1.00 2.20  ? 3  SER D HB2    2  
ATOM 9676  H HB3    . SER F 3 3  ? -9.853  -12.462 -1.362  1.00 2.27  ? 3  SER D HB3    2  
ATOM 9677  H HG     . SER F 3 3  ? -8.826  -10.520 -1.405  1.00 2.94  ? 3  SER D HG     2  
ATOM 9678  N N      . THR F 3 4  ? -7.908  -14.204 1.991   1.00 2.09  ? 4  THR D N      2  
ATOM 9679  C CA     . THR F 3 4  ? -7.757  -15.541 2.548   1.00 2.02  ? 4  THR D CA     2  
ATOM 9680  C C      . THR F 3 4  ? -8.838  -15.822 3.597   1.00 1.93  ? 4  THR D C      2  
ATOM 9681  O O      . THR F 3 4  ? -8.689  -16.711 4.439   1.00 2.03  ? 4  THR D O      2  
ATOM 9682  C CB     . THR F 3 4  ? -6.367  -15.695 3.201   1.00 2.19  ? 4  THR D CB     2  
ATOM 9683  O OG1    . THR F 3 4  ? -5.501  -14.627 2.771   1.00 2.44  ? 4  THR D OG1    2  
ATOM 9684  C CG2    . THR F 3 4  ? -5.744  -17.041 2.848   1.00 2.14  ? 4  THR D CG2    2  
ATOM 9685  H H      . THR F 3 4  ? -7.399  -13.468 2.388   1.00 2.18  ? 4  THR D H      2  
ATOM 9686  H HA     . THR F 3 4  ? -7.843  -16.259 1.746   1.00 1.97  ? 4  THR D HA     2  
ATOM 9687  H HB     . THR F 3 4  ? -6.483  -15.639 4.274   1.00 2.27  ? 4  THR D HB     2  
ATOM 9688  H HG1    . THR F 3 4  ? -5.203  -14.799 1.867   1.00 2.69  ? 4  THR D HG1    2  
ATOM 9689  H HG21   . THR F 3 4  ? -5.666  -17.135 1.774   1.00 2.26  ? 4  THR D HG21   2  
ATOM 9690  H HG22   . THR F 3 4  ? -6.366  -17.836 3.231   1.00 2.00  ? 4  THR D HG22   2  
ATOM 9691  H HG23   . THR F 3 4  ? -4.760  -17.113 3.289   1.00 2.41  ? 4  THR D HG23   2  
ATOM 9692  N N      . GLY F 3 5  ? -9.929  -15.072 3.527   1.00 1.80  ? 5  GLY D N      2  
ATOM 9693  C CA     . GLY F 3 5  ? -11.004 -15.230 4.481   1.00 1.76  ? 5  GLY D CA     2  
ATOM 9694  C C      . GLY F 3 5  ? -10.770 -14.372 5.698   1.00 1.86  ? 5  GLY D C      2  
ATOM 9695  O O      . GLY F 3 5  ? -10.824 -14.852 6.831   1.00 1.92  ? 5  GLY D O      2  
ATOM 9696  H H      . GLY F 3 5  ? -10.007 -14.402 2.815   1.00 1.77  ? 5  GLY D H      2  
ATOM 9697  H HA2    . GLY F 3 5  ? -11.935 -14.941 4.017   1.00 1.70  ? 5  GLY D HA2    2  
ATOM 9698  H HA3    . GLY F 3 5  ? -11.062 -16.264 4.784   1.00 1.76  ? 5  GLY D HA3    2  
ATOM 9699  N N      . ILE F 3 6  ? -10.514 -13.092 5.458   1.00 1.92  ? 6  ILE D N      2  
ATOM 9700  C CA     . ILE F 3 6  ? -10.230 -12.158 6.542   1.00 2.05  ? 6  ILE D CA     2  
ATOM 9701  C C      . ILE F 3 6  ? -11.212 -10.990 6.530   1.00 2.01  ? 6  ILE D C      2  
ATOM 9702  O O      . ILE F 3 6  ? -11.632 -10.533 5.470   1.00 1.92  ? 6  ILE D O      2  
ATOM 9703  C CB     . ILE F 3 6  ? -8.778  -11.623 6.453   1.00 2.19  ? 6  ILE D CB     2  
ATOM 9704  C CG1    . ILE F 3 6  ? -7.795  -12.786 6.268   1.00 2.30  ? 6  ILE D CG1    2  
ATOM 9705  C CG2    . ILE F 3 6  ? -8.424  -10.821 7.701   1.00 2.34  ? 6  ILE D CG2    2  
ATOM 9706  C CD1    . ILE F 3 6  ? -6.359  -12.348 6.073   1.00 2.45  ? 6  ILE D CD1    2  
ATOM 9707  H H      . ILE F 3 6  ? -10.550 -12.761 4.525   1.00 1.90  ? 6  ILE D H      2  
ATOM 9708  H HA     . ILE F 3 6  ? -10.336 -12.693 7.477   1.00 2.12  ? 6  ILE D HA     2  
ATOM 9709  H HB     . ILE F 3 6  ? -8.709  -10.964 5.601   1.00 2.14  ? 6  ILE D HB     2  
ATOM 9710  H HG12   . ILE F 3 6  ? -7.830  -13.422 7.141   1.00 2.35  ? 6  ILE D HG12   2  
ATOM 9711  H HG13   . ILE F 3 6  ? -8.087  -13.360 5.401   1.00 2.27  ? 6  ILE D HG13   2  
ATOM 9712  H HG21   . ILE F 3 6  ? -9.134  -10.017 7.823   1.00 2.46  ? 6  ILE D HG21   2  
ATOM 9713  H HG22   . ILE F 3 6  ? -7.432  -10.411 7.595   1.00 2.33  ? 6  ILE D HG22   2  
ATOM 9714  H HG23   . ILE F 3 6  ? -8.458  -11.467 8.566   1.00 2.53  ? 6  ILE D HG23   2  
ATOM 9715  H HD11   . ILE F 3 6  ? -6.026  -11.810 6.949   1.00 2.66  ? 6  ILE D HD11   2  
ATOM 9716  H HD12   . ILE F 3 6  ? -6.293  -11.704 5.208   1.00 2.73  ? 6  ILE D HD12   2  
ATOM 9717  H HD13   . ILE F 3 6  ? -5.735  -13.215 5.927   1.00 2.58  ? 6  ILE D HD13   2  
ATOM 9718  N N      . VAL F 3 7  ? -11.572 -10.514 7.711   1.00 2.09  ? 7  VAL D N      2  
ATOM 9719  C CA     . VAL F 3 7  ? -12.518 -9.414  7.837   1.00 2.09  ? 7  VAL D CA     2  
ATOM 9720  C C      . VAL F 3 7  ? -11.842 -8.049  7.730   1.00 2.19  ? 7  VAL D C      2  
ATOM 9721  O O      . VAL F 3 7  ? -10.692 -7.876  8.134   1.00 2.34  ? 7  VAL D O      2  
ATOM 9722  C CB     . VAL F 3 7  ? -13.286 -9.494  9.169   1.00 2.20  ? 7  VAL D CB     2  
ATOM 9723  C CG1    . VAL F 3 7  ? -14.293 -10.630 9.127   1.00 2.09  ? 7  VAL D CG1    2  
ATOM 9724  C CG2    . VAL F 3 7  ? -12.326 -9.672  10.337  1.00 2.61  ? 7  VAL D CG2    2  
ATOM 9725  H H      . VAL F 3 7  ? -11.189 -10.908 8.520   1.00 2.17  ? 7  VAL D H      2  
ATOM 9726  H HA     . VAL F 3 7  ? -13.233 -9.506  7.037   1.00 1.98  ? 7  VAL D HA     2  
ATOM 9727  H HB     . VAL F 3 7  ? -13.826 -8.568  9.307   1.00 2.29  ? 7  VAL D HB     2  
ATOM 9728  H HG11   . VAL F 3 7  ? -13.780 -11.561 8.932   1.00 2.18  ? 7  VAL D HG11   2  
ATOM 9729  H HG12   . VAL F 3 7  ? -15.011 -10.442 8.344   1.00 2.48  ? 7  VAL D HG12   2  
ATOM 9730  H HG13   . VAL F 3 7  ? -14.803 -10.692 10.076  1.00 2.15  ? 7  VAL D HG13   2  
ATOM 9731  H HG21   . VAL F 3 7  ? -11.630 -8.848  10.361  1.00 2.99  ? 7  VAL D HG21   2  
ATOM 9732  H HG22   . VAL F 3 7  ? -11.783 -10.599 10.222  1.00 2.78  ? 7  VAL D HG22   2  
ATOM 9733  H HG23   . VAL F 3 7  ? -12.886 -9.697  11.258  1.00 2.73  ? 7  VAL D HG23   2  
ATOM 9734  N N      . ARG F 3 8  ? -12.570 -7.090  7.172   1.00 2.16  ? 8  ARG D N      2  
ATOM 9735  C CA     . ARG F 3 8  ? -12.083 -5.728  7.015   1.00 2.29  ? 8  ARG D CA     2  
ATOM 9736  C C      . ARG F 3 8  ? -13.198 -4.753  7.385   1.00 2.31  ? 8  ARG D C      2  
ATOM 9737  O O      . ARG F 3 8  ? -14.376 -5.034  7.148   1.00 2.19  ? 8  ARG D O      2  
ATOM 9738  C CB     . ARG F 3 8  ? -11.610 -5.485  5.579   1.00 2.29  ? 8  ARG D CB     2  
ATOM 9739  C CG     . ARG F 3 8  ? -10.652 -4.311  5.432   1.00 2.48  ? 8  ARG D CG     2  
ATOM 9740  C CD     . ARG F 3 8  ? -11.312 -3.129  4.740   1.00 2.52  ? 8  ARG D CD     2  
ATOM 9741  N NE     . ARG F 3 8  ? -10.355 -2.056  4.448   1.00 2.58  ? 8  ARG D NE     2  
ATOM 9742  C CZ     . ARG F 3 8  ? -10.676 -0.765  4.370   1.00 2.66  ? 8  ARG D CZ     2  
ATOM 9743  N NH1    . ARG F 3 8  ? -11.929 -0.374  4.578   1.00 2.72  ? 8  ARG D NH1    2  
ATOM 9744  N NH2    . ARG F 3 8  ? -9.738  0.136   4.084   1.00 2.77  ? 8  ARG D NH2    2  
ATOM 9745  H H      . ARG F 3 8  ? -13.476 -7.311  6.849   1.00 2.09  ? 8  ARG D H      2  
ATOM 9746  H HA     . ARG F 3 8  ? -11.255 -5.586  7.694   1.00 2.43  ? 8  ARG D HA     2  
ATOM 9747  H HB2    . ARG F 3 8  ? -11.109 -6.373  5.226   1.00 2.23  ? 8  ARG D HB2    2  
ATOM 9748  H HB3    . ARG F 3 8  ? -12.470 -5.299  4.955   1.00 2.25  ? 8  ARG D HB3    2  
ATOM 9749  H HG2    . ARG F 3 8  ? -10.327 -4.001  6.414   1.00 2.59  ? 8  ARG D HG2    2  
ATOM 9750  H HG3    . ARG F 3 8  ? -9.798  -4.625  4.852   1.00 2.62  ? 8  ARG D HG3    2  
ATOM 9751  H HD2    . ARG F 3 8  ? -11.748 -3.471  3.813   1.00 2.58  ? 8  ARG D HD2    2  
ATOM 9752  H HD3    . ARG F 3 8  ? -12.090 -2.741  5.382   1.00 2.58  ? 8  ARG D HD3    2  
ATOM 9753  H HE     . ARG F 3 8  ? -9.416  -2.318  4.295   1.00 2.62  ? 8  ARG D HE     2  
ATOM 9754  H HH11   . ARG F 3 8  ? -12.641 -1.052  4.796   1.00 2.70  ? 8  ARG D HH11   2  
ATOM 9755  H HH12   . ARG F 3 8  ? -12.174 0.591   4.511   1.00 2.83  ? 8  ARG D HH12   2  
ATOM 9756  H HH21   . ARG F 3 8  ? -8.789  -0.160  3.923   1.00 2.81  ? 8  ARG D HH21   2  
ATOM 9757  H HH22   . ARG F 3 8  ? -9.968  1.107   4.029   1.00 2.87  ? 8  ARG D HH22   2  
ATOM 9758  N N      . LYS F 3 9  ? -12.823 -3.621  7.966   1.00 2.49  ? 9  LYS D N      2  
ATOM 9759  C CA     . LYS F 3 9  ? -13.787 -2.612  8.391   1.00 2.55  ? 9  LYS D CA     2  
ATOM 9760  C C      . LYS F 3 9  ? -14.524 -1.997  7.211   1.00 2.53  ? 9  LYS D C      2  
ATOM 9761  O O      . LYS F 3 9  ? -13.927 -1.692  6.176   1.00 2.58  ? 9  LYS D O      2  
ATOM 9762  C CB     . LYS F 3 9  ? -13.084 -1.498  9.175   1.00 2.77  ? 9  LYS D CB     2  
ATOM 9763  C CG     . LYS F 3 9  ? -14.040 -0.451  9.734   1.00 2.97  ? 9  LYS D CG     2  
ATOM 9764  C CD     . LYS F 3 9  ? -13.539 0.969   9.495   1.00 2.92  ? 9  LYS D CD     2  
ATOM 9765  C CE     . LYS F 3 9  ? -13.610 1.360   8.022   1.00 3.10  ? 9  LYS D CE     2  
ATOM 9766  N NZ     . LYS F 3 9  ? -13.508 2.833   7.826   1.00 3.15  ? 9  LYS D NZ     2  
ATOM 9767  H H      . LYS F 3 9  ? -11.867 -3.457  8.116   1.00 2.60  ? 9  LYS D H      2  
ATOM 9768  H HA     . LYS F 3 9  ? -14.505 -3.090  9.035   1.00 2.48  ? 9  LYS D HA     2  
ATOM 9769  H HB2    . LYS F 3 9  ? -12.546 -1.940  10.000  1.00 3.04  ? 9  LYS D HB2    2  
ATOM 9770  H HB3    . LYS F 3 9  ? -12.382 -1.001  8.521   1.00 3.06  ? 9  LYS D HB3    2  
ATOM 9771  H HG2    . LYS F 3 9  ? -15.001 -0.566  9.255   1.00 3.45  ? 9  LYS D HG2    2  
ATOM 9772  H HG3    . LYS F 3 9  ? -14.146 -0.609  10.797  1.00 3.27  ? 9  LYS D HG3    2  
ATOM 9773  H HD2    . LYS F 3 9  ? -14.147 1.653   10.066  1.00 2.95  ? 9  LYS D HD2    2  
ATOM 9774  H HD3    . LYS F 3 9  ? -12.514 1.033   9.827   1.00 3.34  ? 9  LYS D HD3    2  
ATOM 9775  H HE2    . LYS F 3 9  ? -12.799 0.880   7.494   1.00 3.65  ? 9  LYS D HE2    2  
ATOM 9776  H HE3    . LYS F 3 9  ? -14.551 1.017   7.619   1.00 3.25  ? 9  LYS D HE3    2  
ATOM 9777  H HZ1    . LYS F 3 9  ? -14.319 3.180   7.256   1.00 3.61  ? 9  LYS D HZ1    2  
ATOM 9778  H HZ2    . LYS F 3 9  ? -12.629 3.070   7.329   1.00 3.21  ? 9  LYS D HZ2    2  
ATOM 9779  H HZ3    . LYS F 3 9  ? -13.514 3.319   8.743   1.00 3.14  ? 9  LYS D HZ3    2  
ATOM 9780  N N      . VAL F 3 10 ? -15.825 -1.826  7.380   1.00 2.48  ? 10 VAL D N      2  
ATOM 9781  C CA     . VAL F 3 10 ? -16.656 -1.208  6.366   1.00 2.50  ? 10 VAL D CA     2  
ATOM 9782  C C      . VAL F 3 10 ? -16.529 0.309   6.486   1.00 2.74  ? 10 VAL D C      2  
ATOM 9783  O O      . VAL F 3 10 ? -15.797 0.934   5.726   1.00 3.08  ? 10 VAL D O      2  
ATOM 9784  C CB     . VAL F 3 10 ? -18.132 -1.648  6.515   1.00 2.43  ? 10 VAL D CB     2  
ATOM 9785  C CG1    . VAL F 3 10 ? -19.070 -0.739  5.736   1.00 2.62  ? 10 VAL D CG1    2  
ATOM 9786  C CG2    . VAL F 3 10 ? -18.308 -3.088  6.064   1.00 2.73  ? 10 VAL D CG2    2  
ATOM 9787  H H      . VAL F 3 10 ? -16.242 -2.129  8.219   1.00 2.46  ? 10 VAL D H      2  
ATOM 9788  H HA     . VAL F 3 10 ? -16.295 -1.520  5.397   1.00 2.49  ? 10 VAL D HA     2  
ATOM 9789  H HB     . VAL F 3 10 ? -18.397 -1.590  7.559   1.00 2.68  ? 10 VAL D HB     2  
ATOM 9790  H HG11   . VAL F 3 10 ? -20.088 -1.079  5.859   1.00 2.67  ? 10 VAL D HG11   2  
ATOM 9791  H HG12   . VAL F 3 10 ? -18.808 -0.762  4.691   1.00 2.86  ? 10 VAL D HG12   2  
ATOM 9792  H HG13   . VAL F 3 10 ? -18.980 0.272   6.107   1.00 3.13  ? 10 VAL D HG13   2  
ATOM 9793  H HG21   . VAL F 3 10 ? -19.195 -3.503  6.521   1.00 2.85  ? 10 VAL D HG21   2  
ATOM 9794  H HG22   . VAL F 3 10 ? -17.446 -3.667  6.356   1.00 2.98  ? 10 VAL D HG22   2  
ATOM 9795  H HG23   . VAL F 3 10 ? -18.411 -3.115  4.989   1.00 3.19  ? 10 VAL D HG23   2  
ATOM 9796  N N      . ASP F 3 11 ? -17.191 0.877   7.494   1.00 2.92  ? 11 ASP D N      2  
ATOM 9797  C CA     . ASP F 3 11 ? -17.162 2.315   7.757   1.00 3.22  ? 11 ASP D CA     2  
ATOM 9798  C C      . ASP F 3 11 ? -18.008 2.607   8.988   1.00 3.43  ? 11 ASP D C      2  
ATOM 9799  O O      . ASP F 3 11 ? -18.377 1.684   9.716   1.00 3.45  ? 11 ASP D O      2  
ATOM 9800  C CB     . ASP F 3 11 ? -17.665 3.131   6.553   1.00 3.38  ? 11 ASP D CB     2  
ATOM 9801  C CG     . ASP F 3 11 ? -16.590 4.046   5.980   1.00 4.07  ? 11 ASP D CG     2  
ATOM 9802  O OD1    . ASP F 3 11 ? -15.464 4.062   6.528   1.00 4.36  ? 11 ASP D OD1    2  
ATOM 9803  O OD2    . ASP F 3 11 ? -16.864 4.750   4.975   1.00 4.59  ? 11 ASP D OD2    2  
ATOM 9804  H H      . ASP F 3 11 ? -17.721 0.305   8.091   1.00 3.08  ? 11 ASP D H      2  
ATOM 9805  H HA     . ASP F 3 11 ? -16.139 2.589   7.968   1.00 3.31  ? 11 ASP D HA     2  
ATOM 9806  H HB2    . ASP F 3 11 ? -17.985 2.453   5.775   1.00 3.15  ? 11 ASP D HB2    2  
ATOM 9807  H HB3    . ASP F 3 11 ? -18.503 3.738   6.864   1.00 3.54  ? 11 ASP D HB3    2  
ATOM 9808  N N      . GLU F 3 12 ? -18.319 3.871   9.227   1.00 3.72  ? 12 GLU D N      2  
ATOM 9809  C CA     . GLU F 3 12 ? -19.122 4.252   10.387  1.00 4.06  ? 12 GLU D CA     2  
ATOM 9810  C C      . GLU F 3 12 ? -20.581 4.449   9.993   1.00 4.06  ? 12 GLU D C      2  
ATOM 9811  O O      . GLU F 3 12 ? -21.492 4.020   10.707  1.00 4.17  ? 12 GLU D O      2  
ATOM 9812  C CB     . GLU F 3 12 ? -18.576 5.529   11.051  1.00 4.47  ? 12 GLU D CB     2  
ATOM 9813  C CG     . GLU F 3 12 ? -17.480 6.235   10.259  1.00 4.95  ? 12 GLU D CG     2  
ATOM 9814  C CD     . GLU F 3 12 ? -18.009 6.969   9.043   1.00 5.61  ? 12 GLU D CD     2  
ATOM 9815  O OE1    . GLU F 3 12 ? -18.504 6.296   8.118   1.00 5.97  ? 12 GLU D OE1    2  
ATOM 9816  O OE2    . GLU F 3 12 ? -17.936 8.214   9.008   1.00 6.06  ? 12 GLU D OE2    2  
ATOM 9817  H H      . GLU F 3 12 ? -18.011 4.572   8.605   1.00 3.78  ? 12 GLU D H      2  
ATOM 9818  H HA     . GLU F 3 12 ? -19.066 3.441   11.099  1.00 4.11  ? 12 GLU D HA     2  
ATOM 9819  H HB2    . GLU F 3 12 ? -19.392 6.223   11.187  1.00 4.71  ? 12 GLU D HB2    2  
ATOM 9820  H HB3    . GLU F 3 12 ? -18.175 5.270   12.019  1.00 4.53  ? 12 GLU D HB3    2  
ATOM 9821  H HG2    . GLU F 3 12 ? -16.993 6.950   10.905  1.00 5.01  ? 12 GLU D HG2    2  
ATOM 9822  H HG3    . GLU F 3 12 ? -16.760 5.497   9.934   1.00 5.18  ? 12 GLU D HG3    2  
ATOM 9823  N N      . LEU F 3 13 ? -20.797 5.109   8.864   1.00 3.98  ? 13 LEU D N      2  
ATOM 9824  C CA     . LEU F 3 13 ? -22.142 5.362   8.367   1.00 4.04  ? 13 LEU D CA     2  
ATOM 9825  C C      . LEU F 3 13 ? -22.720 4.123   7.688   1.00 3.72  ? 13 LEU D C      2  
ATOM 9826  O O      . LEU F 3 13 ? -23.741 3.585   8.119   1.00 3.86  ? 13 LEU D O      2  
ATOM 9827  C CB     . LEU F 3 13 ? -22.140 6.539   7.383   1.00 4.23  ? 13 LEU D CB     2  
ATOM 9828  C CG     . LEU F 3 13 ? -22.626 7.878   7.951   1.00 4.64  ? 13 LEU D CG     2  
ATOM 9829  C CD1    . LEU F 3 13 ? -24.017 7.741   8.554   1.00 4.84  ? 13 LEU D CD1    2  
ATOM 9830  C CD2    . LEU F 3 13 ? -21.643 8.411   8.981   1.00 4.84  ? 13 LEU D CD2    2  
ATOM 9831  H H      . LEU F 3 13 ? -20.020 5.459   8.361   1.00 3.93  ? 13 LEU D H      2  
ATOM 9832  H HA     . LEU F 3 13 ? -22.763 5.614   9.212   1.00 4.26  ? 13 LEU D HA     2  
ATOM 9833  H HB2    . LEU F 3 13 ? -21.131 6.671   7.020   1.00 4.21  ? 13 LEU D HB2    2  
ATOM 9834  H HB3    . LEU F 3 13 ? -22.772 6.280   6.548   1.00 4.16  ? 13 LEU D HB3    2  
ATOM 9835  H HG     . LEU F 3 13 ? -22.687 8.597   7.145   1.00 4.78  ? 13 LEU D HG     2  
ATOM 9836  H HD11   . LEU F 3 13 ? -24.422 8.723   8.749   1.00 5.29  ? 13 LEU D HD11   2  
ATOM 9837  H HD12   . LEU F 3 13 ? -23.956 7.189   9.480   1.00 4.84  ? 13 LEU D HD12   2  
ATOM 9838  H HD13   . LEU F 3 13 ? -24.662 7.216   7.864   1.00 4.86  ? 13 LEU D HD13   2  
ATOM 9839  H HD21   . LEU F 3 13 ? -21.485 7.666   9.747   1.00 5.25  ? 13 LEU D HD21   2  
ATOM 9840  H HD22   . LEU F 3 13 ? -22.041 9.309   9.429   1.00 4.85  ? 13 LEU D HD22   2  
ATOM 9841  H HD23   . LEU F 3 13 ? -20.702 8.634   8.499   1.00 4.86  ? 13 LEU D HD23   2  
ATOM 9842  N N      . GLY F 3 14 ? -22.063 3.674   6.628   1.00 3.43  ? 14 GLY D N      2  
ATOM 9843  C CA     . GLY F 3 14 ? -22.530 2.507   5.904   1.00 3.21  ? 14 GLY D CA     2  
ATOM 9844  C C      . GLY F 3 14 ? -22.034 2.485   4.472   1.00 2.98  ? 14 GLY D C      2  
ATOM 9845  O O      . GLY F 3 14 ? -22.824 2.409   3.530   1.00 3.03  ? 14 GLY D O      2  
ATOM 9846  H H      . GLY F 3 14 ? -21.254 4.140   6.332   1.00 3.46  ? 14 GLY D H      2  
ATOM 9847  H HA2    . GLY F 3 14 ? -22.183 1.618   6.411   1.00 3.18  ? 14 GLY D HA2    2  
ATOM 9848  H HA3    . GLY F 3 14 ? -23.609 2.508   5.897   1.00 3.31  ? 14 GLY D HA3    2  
ATOM 9849  N N      . ARG F 3 15 ? -20.721 2.568   4.312   1.00 2.93  ? 15 ARG D N      2  
ATOM 9850  C CA     . ARG F 3 15 ? -20.102 2.558   2.994   1.00 2.78  ? 15 ARG D CA     2  
ATOM 9851  C C      . ARG F 3 15 ? -19.167 1.366   2.893   1.00 2.58  ? 15 ARG D C      2  
ATOM 9852  O O      . ARG F 3 15 ? -18.176 1.294   3.614   1.00 2.54  ? 15 ARG D O      2  
ATOM 9853  C CB     . ARG F 3 15 ? -19.322 3.857   2.752   1.00 3.05  ? 15 ARG D CB     2  
ATOM 9854  C CG     . ARG F 3 15 ? -19.715 4.990   3.687   1.00 3.37  ? 15 ARG D CG     2  
ATOM 9855  C CD     . ARG F 3 15 ? -19.170 6.325   3.205   1.00 3.86  ? 15 ARG D CD     2  
ATOM 9856  N NE     . ARG F 3 15 ? -19.653 7.443   4.017   1.00 3.88  ? 15 ARG D NE     2  
ATOM 9857  C CZ     . ARG F 3 15 ? -19.101 7.816   5.172   1.00 4.15  ? 15 ARG D CZ     2  
ATOM 9858  N NH1    . ARG F 3 15 ? -18.054 7.163   5.654   1.00 4.50  ? 15 ARG D NH1    2  
ATOM 9859  N NH2    . ARG F 3 15 ? -19.601 8.840   5.846   1.00 4.51  ? 15 ARG D NH2    2  
ATOM 9860  H H      . ARG F 3 15 ? -20.147 2.619   5.103   1.00 3.12  ? 15 ARG D H      2  
ATOM 9861  H HA     . ARG F 3 15 ? -20.883 2.462   2.252   1.00 2.71  ? 15 ARG D HA     2  
ATOM 9862  H HB2    . ARG F 3 15 ? -18.268 3.659   2.887   1.00 3.18  ? 15 ARG D HB2    2  
ATOM 9863  H HB3    . ARG F 3 15 ? -19.491 4.181   1.736   1.00 3.12  ? 15 ARG D HB3    2  
ATOM 9864  H HG2    . ARG F 3 15 ? -20.792 5.047   3.741   1.00 3.49  ? 15 ARG D HG2    2  
ATOM 9865  H HG3    . ARG F 3 15 ? -19.315 4.784   4.670   1.00 3.42  ? 15 ARG D HG3    2  
ATOM 9866  H HD2    . ARG F 3 15 ? -18.091 6.297   3.252   1.00 4.34  ? 15 ARG D HD2    2  
ATOM 9867  H HD3    . ARG F 3 15 ? -19.478 6.477   2.181   1.00 4.12  ? 15 ARG D HD3    2  
ATOM 9868  H HE     . ARG F 3 15 ? -20.435 7.942   3.686   1.00 4.00  ? 15 ARG D HE     2  
ATOM 9869  H HH11   . ARG F 3 15 ? -17.662 6.381   5.153   1.00 4.57  ? 15 ARG D HH11   2  
ATOM 9870  H HH12   . ARG F 3 15 ? -17.669 7.419   6.547   1.00 4.93  ? 15 ARG D HH12   2  
ATOM 9871  H HH21   . ARG F 3 15 ? -20.398 9.338   5.492   1.00 4.63  ? 15 ARG D HH21   2  
ATOM 9872  H HH22   . ARG F 3 15 ? -19.188 9.122   6.719   1.00 4.89  ? 15 ARG D HH22   2  
ATOM 9873  N N      . VAL F 3 16 ? -19.484 0.432   2.006   1.00 2.56  ? 16 VAL D N      2  
ATOM 9874  C CA     . VAL F 3 16 ? -18.673 -0.767  1.844   1.00 2.47  ? 16 VAL D CA     2  
ATOM 9875  C C      . VAL F 3 16 ? -17.320 -0.440  1.210   1.00 2.50  ? 16 VAL D C      2  
ATOM 9876  O O      . VAL F 3 16 ? -17.203 -0.288  -0.009  1.00 2.53  ? 16 VAL D O      2  
ATOM 9877  C CB     . VAL F 3 16 ? -19.423 -1.847  1.025   1.00 2.44  ? 16 VAL D CB     2  
ATOM 9878  C CG1    . VAL F 3 16 ? -20.120 -1.239  -0.178  1.00 2.75  ? 16 VAL D CG1    2  
ATOM 9879  C CG2    . VAL F 3 16 ? -18.485 -2.967  0.595   1.00 2.57  ? 16 VAL D CG2    2  
ATOM 9880  H H      . VAL F 3 16 ? -20.273 0.557   1.438   1.00 2.68  ? 16 VAL D H      2  
ATOM 9881  H HA     . VAL F 3 16 ? -18.490 -1.169  2.828   1.00 2.50  ? 16 VAL D HA     2  
ATOM 9882  H HB     . VAL F 3 16 ? -20.182 -2.277  1.662   1.00 2.56  ? 16 VAL D HB     2  
ATOM 9883  H HG11   . VAL F 3 16 ? -19.474 -0.508  -0.639  1.00 2.92  ? 16 VAL D HG11   2  
ATOM 9884  H HG12   . VAL F 3 16 ? -21.037 -0.762  0.138   1.00 3.11  ? 16 VAL D HG12   2  
ATOM 9885  H HG13   . VAL F 3 16 ? -20.348 -2.018  -0.892  1.00 3.09  ? 16 VAL D HG13   2  
ATOM 9886  H HG21   . VAL F 3 16 ? -19.010 -3.642  -0.067  1.00 2.77  ? 16 VAL D HG21   2  
ATOM 9887  H HG22   . VAL F 3 16 ? -18.149 -3.507  1.466   1.00 2.89  ? 16 VAL D HG22   2  
ATOM 9888  H HG23   . VAL F 3 16 ? -17.633 -2.546  0.080   1.00 2.82  ? 16 VAL D HG23   2  
ATOM 9889  N N      . VAL F 3 17 ? -16.311 -0.280  2.063   1.00 2.62  ? 17 VAL D N      2  
ATOM 9890  C CA     . VAL F 3 17 ? -14.957 0.010   1.615   1.00 2.74  ? 17 VAL D CA     2  
ATOM 9891  C C      . VAL F 3 17 ? -14.154 -1.274  1.568   1.00 2.75  ? 17 VAL D C      2  
ATOM 9892  O O      . VAL F 3 17 ? -13.835 -1.856  2.608   1.00 2.88  ? 17 VAL D O      2  
ATOM 9893  C CB     . VAL F 3 17 ? -14.222 1.003   2.546   1.00 2.96  ? 17 VAL D CB     2  
ATOM 9894  C CG1    . VAL F 3 17 ? -12.997 1.587   1.852   1.00 2.93  ? 17 VAL D CG1    2  
ATOM 9895  C CG2    . VAL F 3 17 ? -15.150 2.108   3.009   1.00 3.36  ? 17 VAL D CG2    2  
ATOM 9896  H H      . VAL F 3 17 ? -16.487 -0.354  3.024   1.00 2.71  ? 17 VAL D H      2  
ATOM 9897  H HA     . VAL F 3 17 ? -15.010 0.435   0.622   1.00 2.73  ? 17 VAL D HA     2  
ATOM 9898  H HB     . VAL F 3 17 ? -13.884 0.457   3.416   1.00 3.02  ? 17 VAL D HB     2  
ATOM 9899  H HG11   . VAL F 3 17 ? -12.285 0.800   1.651   1.00 3.17  ? 17 VAL D HG11   2  
ATOM 9900  H HG12   . VAL F 3 17 ? -12.540 2.329   2.493   1.00 3.06  ? 17 VAL D HG12   2  
ATOM 9901  H HG13   . VAL F 3 17 ? -13.295 2.050   0.923   1.00 3.05  ? 17 VAL D HG13   2  
ATOM 9902  H HG21   . VAL F 3 17 ? -15.416 2.732   2.167   1.00 3.93  ? 17 VAL D HG21   2  
ATOM 9903  H HG22   . VAL F 3 17 ? -14.653 2.707   3.757   1.00 3.49  ? 17 VAL D HG22   2  
ATOM 9904  H HG23   . VAL F 3 17 ? -16.044 1.676   3.434   1.00 3.36  ? 17 VAL D HG23   2  
ATOM 9905  N N      . ILE F 3 18 ? -13.838 -1.720  0.372   1.00 2.75  ? 18 ILE D N      2  
ATOM 9906  C CA     . ILE F 3 18 ? -13.067 -2.931  0.210   1.00 2.83  ? 18 ILE D CA     2  
ATOM 9907  C C      . ILE F 3 18 ? -11.583 -2.596  0.130   1.00 2.99  ? 18 ILE D C      2  
ATOM 9908  O O      . ILE F 3 18 ? -11.216 -1.490  -0.271  1.00 3.08  ? 18 ILE D O      2  
ATOM 9909  C CB     . ILE F 3 18 ? -13.477 -3.725  -1.052  1.00 2.80  ? 18 ILE D CB     2  
ATOM 9910  C CG1    . ILE F 3 18 ? -13.398 -2.839  -2.298  1.00 2.75  ? 18 ILE D CG1    2  
ATOM 9911  C CG2    . ILE F 3 18 ? -14.874 -4.300  -0.888  1.00 2.86  ? 18 ILE D CG2    2  
ATOM 9912  C CD1    . ILE F 3 18 ? -13.405 -3.616  -3.596  1.00 2.91  ? 18 ILE D CD1    2  
ATOM 9913  H H      . ILE F 3 18 ? -14.108 -1.207  -0.424  1.00 2.77  ? 18 ILE D H      2  
ATOM 9914  H HA     . ILE F 3 18 ? -13.243 -3.554  1.075   1.00 2.89  ? 18 ILE D HA     2  
ATOM 9915  H HB     . ILE F 3 18 ? -12.789 -4.549  -1.167  1.00 3.26  ? 18 ILE D HB     2  
ATOM 9916  H HG12   . ILE F 3 18 ? -14.246 -2.170  -2.308  1.00 2.68  ? 18 ILE D HG12   2  
ATOM 9917  H HG13   . ILE F 3 18 ? -12.488 -2.260  -2.262  1.00 3.12  ? 18 ILE D HG13   2  
ATOM 9918  H HG21   . ILE F 3 18 ? -15.575 -3.496  -0.712  1.00 2.98  ? 18 ILE D HG21   2  
ATOM 9919  H HG22   . ILE F 3 18 ? -14.888 -4.981  -0.049  1.00 3.04  ? 18 ILE D HG22   2  
ATOM 9920  H HG23   . ILE F 3 18 ? -15.153 -4.829  -1.787  1.00 3.26  ? 18 ILE D HG23   2  
ATOM 9921  H HD11   . ILE F 3 18 ? -14.302 -4.215  -3.654  1.00 3.31  ? 18 ILE D HD11   2  
ATOM 9922  H HD12   . ILE F 3 18 ? -12.539 -4.260  -3.635  1.00 3.17  ? 18 ILE D HD12   2  
ATOM 9923  H HD13   . ILE F 3 18 ? -13.377 -2.926  -4.428  1.00 2.88  ? 18 ILE D HD13   2  
ATOM 9924  N N      . PRO F 3 19 ? -10.711 -3.533  0.531   1.00 3.11  ? 19 PRO D N      2  
ATOM 9925  C CA     . PRO F 3 19 ? -9.262  -3.322  0.494   1.00 3.35  ? 19 PRO D CA     2  
ATOM 9926  C C      . PRO F 3 19 ? -8.765  -3.029  -0.914  1.00 3.34  ? 19 PRO D C      2  
ATOM 9927  O O      . PRO F 3 19 ? -8.877  -3.867  -1.812  1.00 3.15  ? 19 PRO D O      2  
ATOM 9928  C CB     . PRO F 3 19 ? -8.683  -4.650  0.990   1.00 3.46  ? 19 PRO D CB     2  
ATOM 9929  C CG     . PRO F 3 19 ? -9.794  -5.300  1.738   1.00 3.38  ? 19 PRO D CG     2  
ATOM 9930  C CD     . PRO F 3 19 ? -11.060 -4.861  1.062   1.00 3.11  ? 19 PRO D CD     2  
ATOM 9931  H HA     . PRO F 3 19 ? -8.960  -2.523  1.153   1.00 3.54  ? 19 PRO D HA     2  
ATOM 9932  H HB2    . PRO F 3 19 ? -8.372  -5.246  0.143   1.00 3.36  ? 19 PRO D HB2    2  
ATOM 9933  H HB3    . PRO F 3 19 ? -7.834  -4.457  1.630   1.00 3.77  ? 19 PRO D HB3    2  
ATOM 9934  H HG2    . PRO F 3 19 ? -9.693  -6.373  1.685   1.00 3.38  ? 19 PRO D HG2    2  
ATOM 9935  H HG3    . PRO F 3 19 ? -9.786  -4.973  2.767   1.00 3.62  ? 19 PRO D HG3    2  
ATOM 9936  H HD2    . PRO F 3 19 ? -11.319 -5.542  0.263   1.00 3.00  ? 19 PRO D HD2    2  
ATOM 9937  H HD3    . PRO F 3 19 ? -11.867 -4.792  1.777   1.00 3.14  ? 19 PRO D HD3    2  
ATOM 9938  N N      . ILE F 3 20 ? -8.209  -1.841  -1.103  1.00 3.59  ? 20 ILE D N      2  
ATOM 9939  C CA     . ILE F 3 20 ? -7.686  -1.443  -2.399  1.00 3.70  ? 20 ILE D CA     2  
ATOM 9940  C C      . ILE F 3 20 ? -6.489  -2.312  -2.768  1.00 3.61  ? 20 ILE D C      2  
ATOM 9941  O O      . ILE F 3 20 ? -6.123  -2.440  -3.936  1.00 3.50  ? 20 ILE D O      2  
ATOM 9942  C CB     . ILE F 3 20 ? -7.288  0.051   -2.426  1.00 4.08  ? 20 ILE D CB     2  
ATOM 9943  C CG1    . ILE F 3 20 ? -6.369  0.403   -1.251  1.00 4.29  ? 20 ILE D CG1    2  
ATOM 9944  C CG2    . ILE F 3 20 ? -8.532  0.922   -2.403  1.00 4.37  ? 20 ILE D CG2    2  
ATOM 9945  C CD1    . ILE F 3 20 ? -4.900  0.174   -1.528  1.00 4.82  ? 20 ILE D CD1    2  
ATOM 9946  H H      . ILE F 3 20 ? -8.139  -1.223  -0.347  1.00 3.75  ? 20 ILE D H      2  
ATOM 9947  H HA     . ILE F 3 20 ? -8.467  -1.599  -3.131  1.00 3.64  ? 20 ILE D HA     2  
ATOM 9948  H HB     . ILE F 3 20 ? -6.765  0.244   -3.351  1.00 4.35  ? 20 ILE D HB     2  
ATOM 9949  H HG12   . ILE F 3 20 ? -6.495  1.446   -1.009  1.00 4.32  ? 20 ILE D HG12   2  
ATOM 9950  H HG13   . ILE F 3 20 ? -6.642  -0.197  -0.395  1.00 4.37  ? 20 ILE D HG13   2  
ATOM 9951  H HG21   . ILE F 3 20 ? -9.035  0.808   -1.455  1.00 4.27  ? 20 ILE D HG21   2  
ATOM 9952  H HG22   . ILE F 3 20 ? -9.195  0.619   -3.199  1.00 4.67  ? 20 ILE D HG22   2  
ATOM 9953  H HG23   . ILE F 3 20 ? -8.251  1.955   -2.541  1.00 4.78  ? 20 ILE D HG23   2  
ATOM 9954  H HD11   . ILE F 3 20 ? -4.328  0.373   -0.635  1.00 4.83  ? 20 ILE D HD11   2  
ATOM 9955  H HD12   . ILE F 3 20 ? -4.578  0.836   -2.318  1.00 5.14  ? 20 ILE D HD12   2  
ATOM 9956  H HD13   . ILE F 3 20 ? -4.746  -0.851  -1.831  1.00 5.12  ? 20 ILE D HD13   2  
ATOM 9957  N N      . GLU F 3 21 ? -5.889  -2.909  -1.749  1.00 3.70  ? 21 GLU D N      2  
ATOM 9958  C CA     . GLU F 3 21 ? -4.747  -3.786  -1.935  1.00 3.72  ? 21 GLU D CA     2  
ATOM 9959  C C      . GLU F 3 21 ? -5.156  -5.004  -2.758  1.00 3.44  ? 21 GLU D C      2  
ATOM 9960  O O      . GLU F 3 21 ? -4.334  -5.610  -3.444  1.00 3.43  ? 21 GLU D O      2  
ATOM 9961  C CB     . GLU F 3 21 ? -4.181  -4.216  -0.579  1.00 3.96  ? 21 GLU D CB     2  
ATOM 9962  C CG     . GLU F 3 21 ? -4.101  -3.081  0.433   1.00 4.01  ? 21 GLU D CG     2  
ATOM 9963  C CD     . GLU F 3 21 ? -5.354  -2.965  1.278   1.00 4.53  ? 21 GLU D CD     2  
ATOM 9964  O OE1    . GLU F 3 21 ? -5.527  -3.788  2.201   1.00 4.98  ? 21 GLU D OE1    2  
ATOM 9965  O OE2    . GLU F 3 21 ? -6.172  -2.063  1.018   1.00 4.84  ? 21 GLU D OE2    2  
ATOM 9966  H H      . GLU F 3 21 ? -6.217  -2.736  -0.837  1.00 3.81  ? 21 GLU D H      2  
ATOM 9967  H HA     . GLU F 3 21 ? -3.991  -3.238  -2.475  1.00 3.85  ? 21 GLU D HA     2  
ATOM 9968  H HB2    . GLU F 3 21 ? -4.808  -4.993  -0.169  1.00 4.29  ? 21 GLU D HB2    2  
ATOM 9969  H HB3    . GLU F 3 21 ? -3.185  -4.608  -0.725  1.00 4.07  ? 21 GLU D HB3    2  
ATOM 9970  H HG2    . GLU F 3 21 ? -3.259  -3.253  1.086   1.00 4.50  ? 21 GLU D HG2    2  
ATOM 9971  H HG3    . GLU F 3 21 ? -3.960  -2.151  -0.099  1.00 3.70  ? 21 GLU D HG3    2  
ATOM 9972  N N      . LEU F 3 22 ? -6.441  -5.345  -2.700  1.00 3.25  ? 22 LEU D N      2  
ATOM 9973  C CA     . LEU F 3 22 ? -6.965  -6.469  -3.462  1.00 3.03  ? 22 LEU D CA     2  
ATOM 9974  C C      . LEU F 3 22 ? -6.973  -6.116  -4.946  1.00 2.86  ? 22 LEU D C      2  
ATOM 9975  O O      . LEU F 3 22 ? -6.630  -6.941  -5.796  1.00 2.82  ? 22 LEU D O      2  
ATOM 9976  C CB     . LEU F 3 22 ? -8.379  -6.825  -2.985  1.00 2.93  ? 22 LEU D CB     2  
ATOM 9977  C CG     . LEU F 3 22 ? -9.138  -7.840  -3.853  1.00 2.96  ? 22 LEU D CG     2  
ATOM 9978  C CD1    . LEU F 3 22 ? -8.387  -9.162  -3.928  1.00 3.24  ? 22 LEU D CD1    2  
ATOM 9979  C CD2    . LEU F 3 22 ? -10.541 -8.062  -3.309  1.00 2.99  ? 22 LEU D CD2    2  
ATOM 9980  H H      . LEU F 3 22 ? -7.053  -4.824  -2.132  1.00 3.30  ? 22 LEU D H      2  
ATOM 9981  H HA     . LEU F 3 22 ? -6.311  -7.314  -3.303  1.00 3.13  ? 22 LEU D HA     2  
ATOM 9982  H HB2    . LEU F 3 22 ? -8.306  -7.223  -1.983  1.00 3.23  ? 22 LEU D HB2    2  
ATOM 9983  H HB3    . LEU F 3 22 ? -8.958  -5.914  -2.949  1.00 2.82  ? 22 LEU D HB3    2  
ATOM 9984  H HG     . LEU F 3 22 ? -9.226  -7.449  -4.855  1.00 3.45  ? 22 LEU D HG     2  
ATOM 9985  H HD11   . LEU F 3 22 ? -9.005  -9.900  -4.417  1.00 3.51  ? 22 LEU D HD11   2  
ATOM 9986  H HD12   . LEU F 3 22 ? -8.148  -9.500  -2.929  1.00 3.29  ? 22 LEU D HD12   2  
ATOM 9987  H HD13   . LEU F 3 22 ? -7.474  -9.028  -4.489  1.00 3.75  ? 22 LEU D HD13   2  
ATOM 9988  H HD21   . LEU F 3 22 ? -10.485 -8.612  -2.380  1.00 3.00  ? 22 LEU D HD21   2  
ATOM 9989  H HD22   . LEU F 3 22 ? -11.120 -8.624  -4.026  1.00 3.21  ? 22 LEU D HD22   2  
ATOM 9990  H HD23   . LEU F 3 22 ? -11.014 -7.108  -3.131  1.00 3.53  ? 22 LEU D HD23   2  
ATOM 9991  N N      . ARG F 3 23 ? -7.340  -4.870  -5.247  1.00 2.83  ? 23 ARG D N      2  
ATOM 9992  C CA     . ARG F 3 23 ? -7.379  -4.398  -6.626  1.00 2.74  ? 23 ARG D CA     2  
ATOM 9993  C C      . ARG F 3 23 ? -5.967  -4.406  -7.201  1.00 2.88  ? 23 ARG D C      2  
ATOM 9994  O O      . ARG F 3 23 ? -5.774  -4.572  -8.404  1.00 2.82  ? 23 ARG D O      2  
ATOM 9995  C CB     . ARG F 3 23 ? -8.013  -2.994  -6.712  1.00 2.83  ? 23 ARG D CB     2  
ATOM 9996  C CG     . ARG F 3 23 ? -7.017  -1.845  -6.664  1.00 2.35  ? 23 ARG D CG     2  
ATOM 9997  C CD     . ARG F 3 23 ? -7.698  -0.520  -6.351  1.00 2.25  ? 23 ARG D CD     2  
ATOM 9998  N NE     . ARG F 3 23 ? -6.722  0.532   -6.077  1.00 2.04  ? 23 ARG D NE     2  
ATOM 9999  C CZ     . ARG F 3 23 ? -7.035  1.804   -5.827  1.00 2.21  ? 23 ARG D CZ     2  
ATOM 10000 N NH1    . ARG F 3 23 ? -8.306  2.184   -5.766  1.00 2.81  ? 23 ARG D NH1    2  
ATOM 10001 N NH2    . ARG F 3 23 ? -6.074  2.694   -5.623  1.00 2.34  ? 23 ARG D NH2    2  
ATOM 10002 H H      . ARG F 3 23 ? -7.582  -4.255  -4.522  1.00 2.92  ? 23 ARG D H      2  
ATOM 10003 H HA     . ARG F 3 23 ? -7.984  -5.093  -7.190  1.00 2.59  ? 23 ARG D HA     2  
ATOM 10004 H HB2    . ARG F 3 23 ? -8.562  -2.921  -7.639  1.00 3.33  ? 23 ARG D HB2    2  
ATOM 10005 H HB3    . ARG F 3 23 ? -8.704  -2.880  -5.890  1.00 3.14  ? 23 ARG D HB3    2  
ATOM 10006 H HG2    . ARG F 3 23 ? -6.285  -2.048  -5.897  1.00 2.40  ? 23 ARG D HG2    2  
ATOM 10007 H HG3    . ARG F 3 23 ? -6.525  -1.766  -7.622  1.00 2.65  ? 23 ARG D HG3    2  
ATOM 10008 H HD2    . ARG F 3 23 ? -8.303  -0.226  -7.197  1.00 2.68  ? 23 ARG D HD2    2  
ATOM 10009 H HD3    . ARG F 3 23 ? -8.329  -0.649  -5.484  1.00 2.54  ? 23 ARG D HD3    2  
ATOM 10010 H HE     . ARG F 3 23 ? -5.773  0.276   -6.093  1.00 2.20  ? 23 ARG D HE     2  
ATOM 10011 H HH11   . ARG F 3 23 ? -9.039  1.519   -5.901  1.00 3.08  ? 23 ARG D HH11   2  
ATOM 10012 H HH12   . ARG F 3 23 ? -8.535  3.150   -5.599  1.00 3.24  ? 23 ARG D HH12   2  
ATOM 10013 H HH21   . ARG F 3 23 ? -5.108  2.414   -5.654  1.00 2.49  ? 23 ARG D HH21   2  
ATOM 10014 H HH22   . ARG F 3 23 ? -6.303  3.653   -5.449  1.00 2.65  ? 23 ARG D HH22   2  
ATOM 10015 N N      . ARG F 3 24 ? -4.986  -4.240  -6.315  1.00 3.13  ? 24 ARG D N      2  
ATOM 10016 C CA     . ARG F 3 24 ? -3.579  -4.255  -6.698  1.00 3.36  ? 24 ARG D CA     2  
ATOM 10017 C C      . ARG F 3 24 ? -3.180  -5.649  -7.162  1.00 3.36  ? 24 ARG D C      2  
ATOM 10018 O O      . ARG F 3 24 ? -2.583  -5.816  -8.225  1.00 3.44  ? 24 ARG D O      2  
ATOM 10019 C CB     . ARG F 3 24 ? -2.688  -3.844  -5.519  1.00 3.68  ? 24 ARG D CB     2  
ATOM 10020 C CG     . ARG F 3 24 ? -2.572  -2.345  -5.305  1.00 4.43  ? 24 ARG D CG     2  
ATOM 10021 C CD     . ARG F 3 24 ? -1.747  -2.041  -4.065  1.00 4.76  ? 24 ARG D CD     2  
ATOM 10022 N NE     . ARG F 3 24 ? -1.082  -0.743  -4.145  1.00 5.12  ? 24 ARG D NE     2  
ATOM 10023 C CZ     . ARG F 3 24 ? 0.143   -0.506  -3.677  1.00 5.53  ? 24 ARG D CZ     2  
ATOM 10024 N NH1    . ARG F 3 24 ? 0.845   -1.481  -3.112  1.00 5.69  ? 24 ARG D NH1    2  
ATOM 10025 N NH2    . ARG F 3 24 ? 0.666   0.708   -3.777  1.00 6.10  ? 24 ARG D NH2    2  
ATOM 10026 H H      . ARG F 3 24 ? -5.220  -4.100  -5.374  1.00 3.20  ? 24 ARG D H      2  
ATOM 10027 H HA     . ARG F 3 24 ? -3.441  -3.558  -7.512  1.00 3.34  ? 24 ARG D HA     2  
ATOM 10028 H HB2    . ARG F 3 24 ? -3.088  -4.279  -4.617  1.00 3.84  ? 24 ARG D HB2    2  
ATOM 10029 H HB3    . ARG F 3 24 ? -1.695  -4.238  -5.685  1.00 3.45  ? 24 ARG D HB3    2  
ATOM 10030 H HG2    . ARG F 3 24 ? -2.091  -1.902  -6.164  1.00 4.63  ? 24 ARG D HG2    2  
ATOM 10031 H HG3    . ARG F 3 24 ? -3.559  -1.926  -5.185  1.00 4.80  ? 24 ARG D HG3    2  
ATOM 10032 H HD2    . ARG F 3 24 ? -2.400  -2.045  -3.204  1.00 5.01  ? 24 ARG D HD2    2  
ATOM 10033 H HD3    . ARG F 3 24 ? -1.001  -2.813  -3.950  1.00 4.87  ? 24 ARG D HD3    2  
ATOM 10034 H HE     . ARG F 3 24 ? -1.582  -0.001  -4.566  1.00 5.30  ? 24 ARG D HE     2  
ATOM 10035 H HH11   . ARG F 3 24 ? 0.458   -2.403  -3.034  1.00 5.49  ? 24 ARG D HH11   2  
ATOM 10036 H HH12   . ARG F 3 24 ? 1.765   -1.299  -2.750  1.00 6.21  ? 24 ARG D HH12   2  
ATOM 10037 H HH21   . ARG F 3 24 ? 0.143   1.450   -4.207  1.00 6.25  ? 24 ARG D HH21   2  
ATOM 10038 H HH22   . ARG F 3 24 ? 1.590   0.888   -3.425  1.00 6.55  ? 24 ARG D HH22   2  
ATOM 10039 N N      . THR F 3 25 ? -3.522  -6.647  -6.350  1.00 3.30  ? 25 THR D N      2  
ATOM 10040 C CA     . THR F 3 25 ? -3.209  -8.035  -6.661  1.00 3.37  ? 25 THR D CA     2  
ATOM 10041 C C      . THR F 3 25 ? -3.916  -8.479  -7.941  1.00 3.17  ? 25 THR D C      2  
ATOM 10042 O O      . THR F 3 25 ? -3.329  -9.157  -8.784  1.00 3.23  ? 25 THR D O      2  
ATOM 10043 C CB     . THR F 3 25 ? -3.612  -8.967  -5.497  1.00 3.49  ? 25 THR D CB     2  
ATOM 10044 O OG1    . THR F 3 25 ? -3.235  -8.379  -4.241  1.00 3.66  ? 25 THR D OG1    2  
ATOM 10045 C CG2    . THR F 3 25 ? -2.951  -10.331 -5.637  1.00 3.73  ? 25 THR D CG2    2  
ATOM 10046 H H      . THR F 3 25 ? -3.998  -6.441  -5.515  1.00 3.25  ? 25 THR D H      2  
ATOM 10047 H HA     . THR F 3 25 ? -2.141  -8.113  -6.807  1.00 3.56  ? 25 THR D HA     2  
ATOM 10048 H HB     . THR F 3 25 ? -4.684  -9.101  -5.517  1.00 3.37  ? 25 THR D HB     2  
ATOM 10049 H HG1    . THR F 3 25 ? -2.460  -7.815  -4.367  1.00 3.57  ? 25 THR D HG1    2  
ATOM 10050 H HG21   . THR F 3 25 ? -1.886  -10.204 -5.764  1.00 3.46  ? 25 THR D HG21   2  
ATOM 10051 H HG22   . THR F 3 25 ? -3.357  -10.839 -6.499  1.00 4.04  ? 25 THR D HG22   2  
ATOM 10052 H HG23   . THR F 3 25 ? -3.141  -10.918 -4.751  1.00 4.20  ? 25 THR D HG23   2  
ATOM 10053 N N      . LEU F 3 26 ? -5.173  -8.078  -8.085  1.00 2.97  ? 26 LEU D N      2  
ATOM 10054 C CA     . LEU F 3 26 ? -5.963  -8.430  -9.260  1.00 2.82  ? 26 LEU D CA     2  
ATOM 10055 C C      . LEU F 3 26 ? -5.434  -7.720  -10.504 1.00 2.76  ? 26 LEU D C      2  
ATOM 10056 O O      . LEU F 3 26 ? -5.247  -8.336  -11.552 1.00 2.80  ? 26 LEU D O      2  
ATOM 10057 C CB     . LEU F 3 26 ? -7.432  -8.061  -9.036  1.00 2.62  ? 26 LEU D CB     2  
ATOM 10058 C CG     . LEU F 3 26 ? -8.131  -8.825  -7.908  1.00 2.66  ? 26 LEU D CG     2  
ATOM 10059 C CD1    . LEU F 3 26 ? -9.484  -8.200  -7.605  1.00 2.52  ? 26 LEU D CD1    2  
ATOM 10060 C CD2    . LEU F 3 26 ? -8.289  -10.294 -8.273  1.00 2.88  ? 26 LEU D CD2    2  
ATOM 10061 H H      . LEU F 3 26 ? -5.584  -7.535  -7.376  1.00 2.96  ? 26 LEU D H      2  
ATOM 10062 H HA     . LEU F 3 26 ? -5.886  -9.497  -9.408  1.00 2.97  ? 26 LEU D HA     2  
ATOM 10063 H HB2    . LEU F 3 26 ? -7.484  -7.005  -8.813  1.00 2.60  ? 26 LEU D HB2    2  
ATOM 10064 H HB3    . LEU F 3 26 ? -7.972  -8.244  -9.952  1.00 2.53  ? 26 LEU D HB3    2  
ATOM 10065 H HG     . LEU F 3 26 ? -7.528  -8.763  -7.013  1.00 2.77  ? 26 LEU D HG     2  
ATOM 10066 H HD11   . LEU F 3 26 ? -9.346  -7.168  -7.318  1.00 2.47  ? 26 LEU D HD11   2  
ATOM 10067 H HD12   . LEU F 3 26 ? -9.957  -8.738  -6.797  1.00 2.75  ? 26 LEU D HD12   2  
ATOM 10068 H HD13   . LEU F 3 26 ? -10.109 -8.249  -8.484  1.00 2.50  ? 26 LEU D HD13   2  
ATOM 10069 H HD21   . LEU F 3 26 ? -8.772  -10.817 -7.460  1.00 2.88  ? 26 LEU D HD21   2  
ATOM 10070 H HD22   . LEU F 3 26 ? -7.317  -10.728 -8.453  1.00 3.28  ? 26 LEU D HD22   2  
ATOM 10071 H HD23   . LEU F 3 26 ? -8.891  -10.380 -9.165  1.00 3.05  ? 26 LEU D HD23   2  
ATOM 10072 N N      . GLY F 3 27 ? -5.172  -6.428  -10.377 1.00 2.76  ? 27 GLY D N      2  
ATOM 10073 C CA     . GLY F 3 27 ? -4.681  -5.662  -11.503 1.00 2.79  ? 27 GLY D CA     2  
ATOM 10074 C C      . GLY F 3 27 ? -5.747  -4.743  -12.061 1.00 2.43  ? 27 GLY D C      2  
ATOM 10075 O O      . GLY F 3 27 ? -5.847  -4.552  -13.273 1.00 2.53  ? 27 GLY D O      2  
ATOM 10076 H H      . GLY F 3 27 ? -5.310  -5.989  -9.509  1.00 2.81  ? 27 GLY D H      2  
ATOM 10077 H HA2    . GLY F 3 27 ? -3.834  -5.070  -11.187 1.00 2.92  ? 27 GLY D HA2    2  
ATOM 10078 H HA3    . GLY F 3 27 ? -4.365  -6.343  -12.279 1.00 3.04  ? 27 GLY D HA3    2  
ATOM 10079 N N      . ILE F 3 28 ? -6.567  -4.198  -11.173 1.00 2.15  ? 28 ILE D N      2  
ATOM 10080 C CA     . ILE F 3 28 ? -7.637  -3.291  -11.560 1.00 1.93  ? 28 ILE D CA     2  
ATOM 10081 C C      . ILE F 3 28 ? -7.529  -1.990  -10.779 1.00 1.89  ? 28 ILE D C      2  
ATOM 10082 O O      . ILE F 3 28 ? -6.680  -1.856  -9.896  1.00 1.99  ? 28 ILE D O      2  
ATOM 10083 C CB     . ILE F 3 28 ? -9.036  -3.906  -11.329 1.00 1.87  ? 28 ILE D CB     2  
ATOM 10084 C CG1    . ILE F 3 28 ? -9.091  -4.644  -9.989  1.00 1.98  ? 28 ILE D CG1    2  
ATOM 10085 C CG2    . ILE F 3 28 ? -9.404  -4.840  -12.471 1.00 2.04  ? 28 ILE D CG2    2  
ATOM 10086 C CD1    . ILE F 3 28 ? -10.493 -4.809  -9.443  1.00 2.03  ? 28 ILE D CD1    2  
ATOM 10087 H H      . ILE F 3 28 ? -6.440  -4.400  -10.220 1.00 2.21  ? 28 ILE D H      2  
ATOM 10088 H HA     . ILE F 3 28 ? -7.528  -3.077  -12.613 1.00 2.01  ? 28 ILE D HA     2  
ATOM 10089 H HB     . ILE F 3 28 ? -9.756  -3.102  -11.313 1.00 1.87  ? 28 ILE D HB     2  
ATOM 10090 H HG12   . ILE F 3 28 ? -8.666  -5.629  -10.112 1.00 2.15  ? 28 ILE D HG12   2  
ATOM 10091 H HG13   . ILE F 3 28 ? -8.513  -4.097  -9.259  1.00 2.06  ? 28 ILE D HG13   2  
ATOM 10092 H HG21   . ILE F 3 28 ? -9.662  -4.259  -13.343 1.00 2.23  ? 28 ILE D HG21   2  
ATOM 10093 H HG22   . ILE F 3 28 ? -10.246 -5.450  -12.180 1.00 2.01  ? 28 ILE D HG22   2  
ATOM 10094 H HG23   . ILE F 3 28 ? -8.562  -5.475  -12.697 1.00 2.32  ? 28 ILE D HG23   2  
ATOM 10095 H HD11   . ILE F 3 28 ? -10.456 -5.353  -8.512  1.00 2.18  ? 28 ILE D HD11   2  
ATOM 10096 H HD12   . ILE F 3 28 ? -11.097 -5.354  -10.156 1.00 2.27  ? 28 ILE D HD12   2  
ATOM 10097 H HD13   . ILE F 3 28 ? -10.929 -3.835  -9.271  1.00 2.35  ? 28 ILE D HD13   2  
ATOM 10098 N N      . ALA F 3 29 ? -8.387  -1.037  -11.096 1.00 1.96  ? 29 ALA D N      2  
ATOM 10099 C CA     . ALA F 3 29 ? -8.382  0.248   -10.420 1.00 2.15  ? 29 ALA D CA     2  
ATOM 10100 C C      . ALA F 3 29 ? -9.745  0.526   -9.805  1.00 2.06  ? 29 ALA D C      2  
ATOM 10101 O O      . ALA F 3 29 ? -10.645 -0.309  -9.868  1.00 2.05  ? 29 ALA D O      2  
ATOM 10102 C CB     . ALA F 3 29 ? -7.989  1.350   -11.396 1.00 2.46  ? 29 ALA D CB     2  
ATOM 10103 H H      . ALA F 3 29 ? -9.058  -1.204  -11.804 1.00 2.03  ? 29 ALA D H      2  
ATOM 10104 H HA     . ALA F 3 29 ? -7.641  0.212   -9.635  1.00 2.29  ? 29 ALA D HA     2  
ATOM 10105 H HB1    . ALA F 3 29 ? -8.715  1.399   -12.194 1.00 2.81  ? 29 ALA D HB1    2  
ATOM 10106 H HB2    . ALA F 3 29 ? -7.015  1.132   -11.808 1.00 2.65  ? 29 ALA D HB2    2  
ATOM 10107 H HB3    . ALA F 3 29 ? -7.958  2.298   -10.877 1.00 2.63  ? 29 ALA D HB3    2  
ATOM 10108 N N      . GLU F 3 30 ? -9.892  1.698   -9.206  1.00 2.11  ? 30 GLU D N      2  
ATOM 10109 C CA     . GLU F 3 30 ? -11.152 2.080   -8.584  1.00 2.12  ? 30 GLU D CA     2  
ATOM 10110 C C      . GLU F 3 30 ? -12.146 2.544   -9.643  1.00 2.13  ? 30 GLU D C      2  
ATOM 10111 O O      . GLU F 3 30 ? -13.338 2.678   -9.383  1.00 2.29  ? 30 GLU D O      2  
ATOM 10112 C CB     . GLU F 3 30 ? -10.928 3.187   -7.549  1.00 2.35  ? 30 GLU D CB     2  
ATOM 10113 C CG     . GLU F 3 30 ? -10.236 4.421   -8.106  1.00 2.29  ? 30 GLU D CG     2  
ATOM 10114 C CD     . GLU F 3 30 ? -8.734  4.340   -7.982  1.00 2.93  ? 30 GLU D CD     2  
ATOM 10115 O OE1    . GLU F 3 30 ? -8.095  3.789   -8.901  1.00 3.35  ? 30 GLU D OE1    2  
ATOM 10116 O OE2    . GLU F 3 30 ? -8.188  4.838   -6.975  1.00 3.40  ? 30 GLU D OE2    2  
ATOM 10117 H H      . GLU F 3 30 ? -9.131  2.329   -9.182  1.00 2.23  ? 30 GLU D H      2  
ATOM 10118 H HA     . GLU F 3 30 ? -11.554 1.210   -8.086  1.00 2.06  ? 30 GLU D HA     2  
ATOM 10119 H HB2    . GLU F 3 30 ? -11.886 3.488   -7.150  1.00 2.64  ? 30 GLU D HB2    2  
ATOM 10120 H HB3    . GLU F 3 30 ? -10.322 2.795   -6.744  1.00 2.53  ? 30 GLU D HB3    2  
ATOM 10121 H HG2    . GLU F 3 30 ? -10.490 4.525   -9.151  1.00 2.34  ? 30 GLU D HG2    2  
ATOM 10122 H HG3    . GLU F 3 30 ? -10.582 5.287   -7.563  1.00 2.32  ? 30 GLU D HG3    2  
ATOM 10123 N N      . LYS F 3 31 ? -11.642 2.773   -10.848 1.00 2.11  ? 31 LYS D N      2  
ATOM 10124 C CA     . LYS F 3 31 ? -12.473 3.218   -11.957 1.00 2.19  ? 31 LYS D CA     2  
ATOM 10125 C C      . LYS F 3 31 ? -12.889 2.029   -12.816 1.00 2.13  ? 31 LYS D C      2  
ATOM 10126 O O      . LYS F 3 31 ? -13.149 2.172   -14.011 1.00 2.24  ? 31 LYS D O      2  
ATOM 10127 C CB     . LYS F 3 31 ? -11.723 4.248   -12.805 1.00 2.43  ? 31 LYS D CB     2  
ATOM 10128 C CG     . LYS F 3 31 ? -11.022 5.316   -11.981 1.00 2.63  ? 31 LYS D CG     2  
ATOM 10129 C CD     . LYS F 3 31 ? -10.695 6.540   -12.818 1.00 2.78  ? 31 LYS D CD     2  
ATOM 10130 C CE     . LYS F 3 31 ? -9.850  7.538   -12.041 1.00 3.09  ? 31 LYS D CE     2  
ATOM 10131 N NZ     . LYS F 3 31 ? -8.396  7.258   -12.159 1.00 3.44  ? 31 LYS D NZ     2  
ATOM 10132 H H      . LYS F 3 31 ? -10.682 2.631   -10.997 1.00 2.16  ? 31 LYS D H      2  
ATOM 10133 H HA     . LYS F 3 31 ? -13.359 3.677   -11.546 1.00 2.19  ? 31 LYS D HA     2  
ATOM 10134 H HB2    . LYS F 3 31 ? -10.981 3.736   -13.400 1.00 2.43  ? 31 LYS D HB2    2  
ATOM 10135 H HB3    . LYS F 3 31 ? -12.425 4.735   -13.465 1.00 2.56  ? 31 LYS D HB3    2  
ATOM 10136 H HG2    . LYS F 3 31 ? -11.667 5.611   -11.168 1.00 3.02  ? 31 LYS D HG2    2  
ATOM 10137 H HG3    . LYS F 3 31 ? -10.106 4.905   -11.585 1.00 2.71  ? 31 LYS D HG3    2  
ATOM 10138 H HD2    . LYS F 3 31 ? -10.147 6.229   -13.694 1.00 2.80  ? 31 LYS D HD2    2  
ATOM 10139 H HD3    . LYS F 3 31 ? -11.616 7.017   -13.116 1.00 3.06  ? 31 LYS D HD3    2  
ATOM 10140 H HE2    . LYS F 3 31 ? -10.046 8.530   -12.420 1.00 3.09  ? 31 LYS D HE2    2  
ATOM 10141 H HE3    . LYS F 3 31 ? -10.132 7.491   -11.001 1.00 3.54  ? 31 LYS D HE3    2  
ATOM 10142 H HZ1    . LYS F 3 31 ? -8.057  7.492   -13.116 1.00 3.54  ? 31 LYS D HZ1    2  
ATOM 10143 H HZ2    . LYS F 3 31 ? -8.206  6.252   -11.975 1.00 3.57  ? 31 LYS D HZ2    2  
ATOM 10144 H HZ3    . LYS F 3 31 ? -7.865  7.825   -11.472 1.00 4.00  ? 31 LYS D HZ3    2  
ATOM 10145 N N      . ASP F 3 32 ? -12.953 0.857   -12.197 1.00 2.06  ? 32 ASP D N      2  
ATOM 10146 C CA     . ASP F 3 32 ? -13.331 -0.364  -12.898 1.00 2.06  ? 32 ASP D CA     2  
ATOM 10147 C C      . ASP F 3 32 ? -14.784 -0.724  -12.623 1.00 1.99  ? 32 ASP D C      2  
ATOM 10148 O O      . ASP F 3 32 ? -15.279 -0.544  -11.509 1.00 1.95  ? 32 ASP D O      2  
ATOM 10149 C CB     . ASP F 3 32 ? -12.431 -1.530  -12.481 1.00 2.10  ? 32 ASP D CB     2  
ATOM 10150 C CG     . ASP F 3 32 ? -11.326 -1.799  -13.482 1.00 2.39  ? 32 ASP D CG     2  
ATOM 10151 O OD1    . ASP F 3 32 ? -11.602 -2.423  -14.531 1.00 2.57  ? 32 ASP D OD1    2  
ATOM 10152 O OD2    . ASP F 3 32 ? -10.176 -1.386  -13.229 1.00 2.66  ? 32 ASP D OD2    2  
ATOM 10153 H H      . ASP F 3 32 ? -12.749 0.811   -11.239 1.00 2.07  ? 32 ASP D H      2  
ATOM 10154 H HA     . ASP F 3 32 ? -13.211 -0.189  -13.957 1.00 2.17  ? 32 ASP D HA     2  
ATOM 10155 H HB2    . ASP F 3 32 ? -11.979 -1.301  -11.528 1.00 2.11  ? 32 ASP D HB2    2  
ATOM 10156 H HB3    . ASP F 3 32 ? -13.031 -2.423  -12.384 1.00 2.09  ? 32 ASP D HB3    2  
ATOM 10157 N N      . ALA F 3 33 ? -15.465 -1.223  -13.643 1.00 2.09  ? 33 ALA D N      2  
ATOM 10158 C CA     . ALA F 3 33 ? -16.857 -1.621  -13.511 1.00 2.08  ? 33 ALA D CA     2  
ATOM 10159 C C      . ALA F 3 33 ? -16.956 -3.097  -13.169 1.00 2.11  ? 33 ALA D C      2  
ATOM 10160 O O      . ALA F 3 33 ? -16.722 -3.961  -14.017 1.00 2.30  ? 33 ALA D O      2  
ATOM 10161 C CB     . ALA F 3 33 ? -17.620 -1.314  -14.788 1.00 2.18  ? 33 ALA D CB     2  
ATOM 10162 H H      . ALA F 3 33 ? -15.019 -1.326  -14.513 1.00 2.25  ? 33 ALA D H      2  
ATOM 10163 H HA     . ALA F 3 33 ? -17.296 -1.046  -12.709 1.00 2.02  ? 33 ALA D HA     2  
ATOM 10164 H HB1    . ALA F 3 33 ? -18.631 -1.681  -14.699 1.00 2.51  ? 33 ALA D HB1    2  
ATOM 10165 H HB2    . ALA F 3 33 ? -17.132 -1.792  -15.625 1.00 2.35  ? 33 ALA D HB2    2  
ATOM 10166 H HB3    . ALA F 3 33 ? -17.639 -0.246  -14.946 1.00 2.18  ? 33 ALA D HB3    2  
ATOM 10167 N N      . LEU F 3 34 ? -17.313 -3.386  -11.931 1.00 2.00  ? 34 LEU D N      2  
ATOM 10168 C CA     . LEU F 3 34 ? -17.422 -4.762  -11.480 1.00 2.02  ? 34 LEU D CA     2  
ATOM 10169 C C      . LEU F 3 34 ? -18.875 -5.203  -11.468 1.00 2.03  ? 34 LEU D C      2  
ATOM 10170 O O      . LEU F 3 34 ? -19.780 -4.368  -11.410 1.00 2.06  ? 34 LEU D O      2  
ATOM 10171 C CB     . LEU F 3 34 ? -16.812 -4.917  -10.085 1.00 2.04  ? 34 LEU D CB     2  
ATOM 10172 C CG     . LEU F 3 34 ? -15.318 -4.584  -9.985  1.00 2.04  ? 34 LEU D CG     2  
ATOM 10173 C CD1    . LEU F 3 34 ? -14.814 -4.798  -8.568  1.00 2.11  ? 34 LEU D CD1    2  
ATOM 10174 C CD2    . LEU F 3 34 ? -14.508 -5.426  -10.960 1.00 2.04  ? 34 LEU D CD2    2  
ATOM 10175 H H      . LEU F 3 34 ? -17.529 -2.654  -11.309 1.00 1.95  ? 34 LEU D H      2  
ATOM 10176 H HA     . LEU F 3 34 ? -16.876 -5.382  -12.175 1.00 2.05  ? 34 LEU D HA     2  
ATOM 10177 H HB2    . LEU F 3 34 ? -17.353 -4.269  -9.410  1.00 2.07  ? 34 LEU D HB2    2  
ATOM 10178 H HB3    . LEU F 3 34 ? -16.954 -5.938  -9.766  1.00 2.07  ? 34 LEU D HB3    2  
ATOM 10179 H HG     . LEU F 3 34 ? -15.171 -3.545  -10.238 1.00 2.06  ? 34 LEU D HG     2  
ATOM 10180 H HD11   . LEU F 3 34 ? -15.416 -4.221  -7.881  1.00 2.17  ? 34 LEU D HD11   2  
ATOM 10181 H HD12   . LEU F 3 34 ? -13.786 -4.479  -8.503  1.00 2.53  ? 34 LEU D HD12   2  
ATOM 10182 H HD13   . LEU F 3 34 ? -14.882 -5.846  -8.316  1.00 2.21  ? 34 LEU D HD13   2  
ATOM 10183 H HD21   . LEU F 3 34 ? -14.684 -6.473  -10.761 1.00 2.34  ? 34 LEU D HD21   2  
ATOM 10184 H HD22   . LEU F 3 34 ? -13.458 -5.208  -10.836 1.00 2.10  ? 34 LEU D HD22   2  
ATOM 10185 H HD23   . LEU F 3 34 ? -14.808 -5.194  -11.971 1.00 2.11  ? 34 LEU D HD23   2  
ATOM 10186 N N      . GLU F 3 35 ? -19.096 -6.507  -11.524 1.00 2.04  ? 35 GLU D N      2  
ATOM 10187 C CA     . GLU F 3 35 ? -20.444 -7.048  -11.519 1.00 2.06  ? 35 GLU D CA     2  
ATOM 10188 C C      . GLU F 3 35 ? -20.812 -7.540  -10.126 1.00 2.03  ? 35 GLU D C      2  
ATOM 10189 O O      . GLU F 3 35 ? -20.299 -8.555  -9.653  1.00 2.05  ? 35 GLU D O      2  
ATOM 10190 C CB     . GLU F 3 35 ? -20.581 -8.186  -12.534 1.00 2.10  ? 35 GLU D CB     2  
ATOM 10191 C CG     . GLU F 3 35 ? -21.997 -8.742  -12.643 1.00 2.17  ? 35 GLU D CG     2  
ATOM 10192 C CD     . GLU F 3 35 ? -22.093 -9.952  -13.551 1.00 2.22  ? 35 GLU D CD     2  
ATOM 10193 O OE1    . GLU F 3 35 ? -21.171 -10.179 -14.364 1.00 2.34  ? 35 GLU D OE1    2  
ATOM 10194 O OE2    . GLU F 3 35 ? -23.093 -10.694 -13.460 1.00 2.24  ? 35 GLU D OE2    2  
ATOM 10195 H H      . GLU F 3 35 ? -18.331 -7.122  -11.551 1.00 2.06  ? 35 GLU D H      2  
ATOM 10196 H HA     . GLU F 3 35 ? -21.119 -6.251  -11.792 1.00 2.08  ? 35 GLU D HA     2  
ATOM 10197 H HB2    . GLU F 3 35 ? -20.285 -7.823  -13.507 1.00 2.14  ? 35 GLU D HB2    2  
ATOM 10198 H HB3    . GLU F 3 35 ? -19.923 -8.991  -12.246 1.00 2.06  ? 35 GLU D HB3    2  
ATOM 10199 H HG2    . GLU F 3 35 ? -22.335 -9.027  -11.657 1.00 2.13  ? 35 GLU D HG2    2  
ATOM 10200 H HG3    . GLU F 3 35 ? -22.644 -7.968  -13.030 1.00 2.24  ? 35 GLU D HG3    2  
ATOM 10201 N N      . ILE F 3 36 ? -21.689 -6.805  -9.468  1.00 2.02  ? 36 ILE D N      2  
ATOM 10202 C CA     . ILE F 3 36 ? -22.129 -7.163  -8.132  1.00 2.02  ? 36 ILE D CA     2  
ATOM 10203 C C      . ILE F 3 36 ? -23.352 -8.071  -8.197  1.00 2.01  ? 36 ILE D C      2  
ATOM 10204 O O      . ILE F 3 36 ? -24.400 -7.694  -8.735  1.00 2.08  ? 36 ILE D O      2  
ATOM 10205 C CB     . ILE F 3 36 ? -22.461 -5.918  -7.276  1.00 2.09  ? 36 ILE D CB     2  
ATOM 10206 C CG1    . ILE F 3 36 ? -21.271 -4.958  -7.234  1.00 2.10  ? 36 ILE D CG1    2  
ATOM 10207 C CG2    . ILE F 3 36 ? -22.854 -6.329  -5.862  1.00 2.14  ? 36 ILE D CG2    2  
ATOM 10208 C CD1    . ILE F 3 36 ? -21.420 -3.764  -8.153  1.00 2.33  ? 36 ILE D CD1    2  
ATOM 10209 H H      . ILE F 3 36 ? -22.050 -5.994  -9.894  1.00 2.03  ? 36 ILE D H      2  
ATOM 10210 H HA     . ILE F 3 36 ? -21.323 -7.698  -7.652  1.00 2.00  ? 36 ILE D HA     2  
ATOM 10211 H HB     . ILE F 3 36 ? -23.303 -5.413  -7.727  1.00 2.15  ? 36 ILE D HB     2  
ATOM 10212 H HG12   . ILE F 3 36 ? -21.150 -4.587  -6.225  1.00 2.19  ? 36 ILE D HG12   2  
ATOM 10213 H HG13   . ILE F 3 36 ? -20.381 -5.493  -7.524  1.00 1.97  ? 36 ILE D HG13   2  
ATOM 10214 H HG21   . ILE F 3 36 ? -23.759 -6.917  -5.899  1.00 2.35  ? 36 ILE D HG21   2  
ATOM 10215 H HG22   . ILE F 3 36 ? -23.020 -5.446  -5.265  1.00 2.55  ? 36 ILE D HG22   2  
ATOM 10216 H HG23   . ILE F 3 36 ? -22.060 -6.916  -5.424  1.00 1.99  ? 36 ILE D HG23   2  
ATOM 10217 H HD11   . ILE F 3 36 ? -20.543 -3.138  -8.076  1.00 2.69  ? 36 ILE D HD11   2  
ATOM 10218 H HD12   . ILE F 3 36 ? -22.294 -3.195  -7.869  1.00 2.73  ? 36 ILE D HD12   2  
ATOM 10219 H HD13   . ILE F 3 36 ? -21.529 -4.108  -9.171  1.00 2.27  ? 36 ILE D HD13   2  
ATOM 10220 N N      . TYR F 3 37 ? -23.203 -9.269  -7.666  1.00 1.98  ? 37 TYR D N      2  
ATOM 10221 C CA     . TYR F 3 37 ? -24.280 -10.243 -7.641  1.00 1.97  ? 37 TYR D CA     2  
ATOM 10222 C C      . TYR F 3 37 ? -24.505 -10.700 -6.203  1.00 1.95  ? 37 TYR D C      2  
ATOM 10223 O O      . TYR F 3 37 ? -23.681 -10.426 -5.329  1.00 1.94  ? 37 TYR D O      2  
ATOM 10224 C CB     . TYR F 3 37 ? -23.934 -11.427 -8.558  1.00 1.95  ? 37 TYR D CB     2  
ATOM 10225 C CG     . TYR F 3 37 ? -25.077 -12.389 -8.802  1.00 1.98  ? 37 TYR D CG     2  
ATOM 10226 C CD1    . TYR F 3 37 ? -26.294 -11.946 -9.303  1.00 2.05  ? 37 TYR D CD1    2  
ATOM 10227 C CD2    . TYR F 3 37 ? -24.934 -13.745 -8.533  1.00 2.00  ? 37 TYR D CD2    2  
ATOM 10228 C CE1    . TYR F 3 37 ? -27.336 -12.824 -9.525  1.00 2.12  ? 37 TYR D CE1    2  
ATOM 10229 C CE2    . TYR F 3 37 ? -25.972 -14.629 -8.754  1.00 2.08  ? 37 TYR D CE2    2  
ATOM 10230 C CZ     . TYR F 3 37 ? -27.170 -14.164 -9.250  1.00 2.13  ? 37 TYR D CZ     2  
ATOM 10231 O OH     . TYR F 3 37 ? -28.210 -15.040 -9.470  1.00 2.24  ? 37 TYR D OH     2  
ATOM 10232 H H      . TYR F 3 37 ? -22.336 -9.509  -7.265  1.00 1.98  ? 37 TYR D H      2  
ATOM 10233 H HA     . TYR F 3 37 ? -25.177 -9.760  -8.003  1.00 2.01  ? 37 TYR D HA     2  
ATOM 10234 H HB2    . TYR F 3 37 ? -23.615 -11.047 -9.514  1.00 1.94  ? 37 TYR D HB2    2  
ATOM 10235 H HB3    . TYR F 3 37 ? -23.124 -11.986 -8.115  1.00 1.94  ? 37 TYR D HB3    2  
ATOM 10236 H HD1    . TYR F 3 37 ? -26.421 -10.895 -9.519  1.00 2.07  ? 37 TYR D HD1    2  
ATOM 10237 H HD2    . TYR F 3 37 ? -23.993 -14.107 -8.145  1.00 2.00  ? 37 TYR D HD2    2  
ATOM 10238 H HE1    . TYR F 3 37 ? -28.274 -12.460 -9.916  1.00 2.21  ? 37 TYR D HE1    2  
ATOM 10239 H HE2    . TYR F 3 37 ? -25.841 -15.679 -8.538  1.00 2.12  ? 37 TYR D HE2    2  
ATOM 10240 H HH     . TYR F 3 37 ? -28.069 -15.842 -8.952  1.00 2.08  ? 37 TYR D HH     2  
ATOM 10241 N N      . VAL F 3 38 ? -25.613 -11.371 -5.944  1.00 1.99  ? 38 VAL D N      2  
ATOM 10242 C CA     . VAL F 3 38 ? -25.911 -11.841 -4.598  1.00 2.00  ? 38 VAL D CA     2  
ATOM 10243 C C      . VAL F 3 38 ? -26.172 -13.341 -4.588  1.00 1.98  ? 38 VAL D C      2  
ATOM 10244 O O      . VAL F 3 38 ? -26.847 -13.875 -5.471  1.00 1.99  ? 38 VAL D O      2  
ATOM 10245 C CB     . VAL F 3 38 ? -27.121 -11.092 -3.995  1.00 2.06  ? 38 VAL D CB     2  
ATOM 10246 C CG1    . VAL F 3 38 ? -28.346 -11.231 -4.888  1.00 2.14  ? 38 VAL D CG1    2  
ATOM 10247 C CG2    . VAL F 3 38 ? -27.412 -11.584 -2.584  1.00 2.03  ? 38 VAL D CG2    2  
ATOM 10248 H H      . VAL F 3 38 ? -26.245 -11.558 -6.668  1.00 2.05  ? 38 VAL D H      2  
ATOM 10249 H HA     . VAL F 3 38 ? -25.049 -11.637 -3.979  1.00 1.98  ? 38 VAL D HA     2  
ATOM 10250 H HB     . VAL F 3 38 ? -26.869 -10.044 -3.939  1.00 2.10  ? 38 VAL D HB     2  
ATOM 10251 H HG11   . VAL F 3 38 ? -28.577 -12.279 -5.020  1.00 2.15  ? 38 VAL D HG11   2  
ATOM 10252 H HG12   . VAL F 3 38 ? -28.143 -10.783 -5.849  1.00 2.19  ? 38 VAL D HG12   2  
ATOM 10253 H HG13   . VAL F 3 38 ? -29.188 -10.733 -4.429  1.00 2.17  ? 38 VAL D HG13   2  
ATOM 10254 H HG21   . VAL F 3 38 ? -27.567 -12.653 -2.599  1.00 2.10  ? 38 VAL D HG21   2  
ATOM 10255 H HG22   . VAL F 3 38 ? -28.299 -11.097 -2.209  1.00 2.19  ? 38 VAL D HG22   2  
ATOM 10256 H HG23   . VAL F 3 38 ? -26.576 -11.350 -1.942  1.00 2.16  ? 38 VAL D HG23   2  
ATOM 10257 N N      . ASP F 3 39 ? -25.620 -14.016 -3.590  1.00 1.97  ? 39 ASP D N      2  
ATOM 10258 C CA     . ASP F 3 39 ? -25.801 -15.450 -3.446  1.00 1.97  ? 39 ASP D CA     2  
ATOM 10259 C C      . ASP F 3 39 ? -26.218 -15.788 -2.025  1.00 1.99  ? 39 ASP D C      2  
ATOM 10260 O O      . ASP F 3 39 ? -25.397 -15.745 -1.108  1.00 1.97  ? 39 ASP D O      2  
ATOM 10261 C CB     . ASP F 3 39 ? -24.516 -16.193 -3.798  1.00 1.92  ? 39 ASP D CB     2  
ATOM 10262 C CG     . ASP F 3 39 ? -24.709 -17.693 -3.836  1.00 1.92  ? 39 ASP D CG     2  
ATOM 10263 O OD1    . ASP F 3 39 ? -24.541 -18.348 -2.786  1.00 1.95  ? 39 ASP D OD1    2  
ATOM 10264 O OD2    . ASP F 3 39 ? -25.021 -18.227 -4.920  1.00 1.92  ? 39 ASP D OD2    2  
ATOM 10265 H H      . ASP F 3 39 ? -25.071 -13.534 -2.930  1.00 1.99  ? 39 ASP D H      2  
ATOM 10266 H HA     . ASP F 3 39 ? -26.583 -15.757 -4.122  1.00 2.00  ? 39 ASP D HA     2  
ATOM 10267 H HB2    . ASP F 3 39 ? -24.173 -15.869 -4.771  1.00 1.90  ? 39 ASP D HB2    2  
ATOM 10268 H HB3    . ASP F 3 39 ? -23.762 -15.963 -3.061  1.00 1.93  ? 39 ASP D HB3    2  
ATOM 10269 N N      . ASP F 3 40 ? -27.507 -16.082 -1.852  1.00 2.07  ? 40 ASP D N      2  
ATOM 10270 C CA     . ASP F 3 40 ? -28.072 -16.444 -0.550  1.00 2.12  ? 40 ASP D CA     2  
ATOM 10271 C C      . ASP F 3 40 ? -27.995 -15.273 0.435   1.00 2.16  ? 40 ASP D C      2  
ATOM 10272 O O      . ASP F 3 40 ? -28.976 -14.552 0.623   1.00 2.23  ? 40 ASP D O      2  
ATOM 10273 C CB     . ASP F 3 40 ? -27.376 -17.686 0.023   1.00 2.08  ? 40 ASP D CB     2  
ATOM 10274 C CG     . ASP F 3 40 ? -28.239 -18.931 -0.044  1.00 2.48  ? 40 ASP D CG     2  
ATOM 10275 O OD1    . ASP F 3 40 ? -28.289 -19.575 -1.114  1.00 2.76  ? 40 ASP D OD1    2  
ATOM 10276 O OD2    . ASP F 3 40 ? -28.856 -19.288 0.983   1.00 2.75  ? 40 ASP D OD2    2  
ATOM 10277 H H      . ASP F 3 40 ? -28.106 -16.039 -2.629  1.00 2.11  ? 40 ASP D H      2  
ATOM 10278 H HA     . ASP F 3 40 ? -29.116 -16.679 -0.708  1.00 2.19  ? 40 ASP D HA     2  
ATOM 10279 H HB2    . ASP F 3 40 ? -26.474 -17.875 -0.538  1.00 2.04  ? 40 ASP D HB2    2  
ATOM 10280 H HB3    . ASP F 3 40 ? -27.119 -17.503 1.055   1.00 2.13  ? 40 ASP D HB3    2  
ATOM 10281 N N      . GLU F 3 41 ? -26.834 -15.075 1.049   1.00 2.13  ? 41 GLU D N      2  
ATOM 10282 C CA     . GLU F 3 41 ? -26.645 -13.989 2.003   1.00 2.18  ? 41 GLU D CA     2  
ATOM 10283 C C      . GLU F 3 41 ? -25.213 -13.453 1.944   1.00 2.09  ? 41 GLU D C      2  
ATOM 10284 O O      . GLU F 3 41 ? -24.735 -12.822 2.886   1.00 2.11  ? 41 GLU D O      2  
ATOM 10285 C CB     . GLU F 3 41 ? -26.977 -14.461 3.423   1.00 2.27  ? 41 GLU D CB     2  
ATOM 10286 C CG     . GLU F 3 41 ? -27.432 -13.341 4.346   1.00 2.34  ? 41 GLU D CG     2  
ATOM 10287 C CD     . GLU F 3 41 ? -27.570 -13.783 5.788   1.00 2.23  ? 41 GLU D CD     2  
ATOM 10288 O OE1    . GLU F 3 41 ? -26.616 -14.374 6.332   1.00 2.32  ? 41 GLU D OE1    2  
ATOM 10289 O OE2    . GLU F 3 41 ? -28.638 -13.536 6.386   1.00 2.35  ? 41 GLU D OE2    2  
ATOM 10290 H H      . GLU F 3 41 ? -26.080 -15.671 0.849   1.00 2.09  ? 41 GLU D H      2  
ATOM 10291 H HA     . GLU F 3 41 ? -27.322 -13.191 1.733   1.00 2.24  ? 41 GLU D HA     2  
ATOM 10292 H HB2    . GLU F 3 41 ? -27.764 -15.197 3.370   1.00 2.39  ? 41 GLU D HB2    2  
ATOM 10293 H HB3    . GLU F 3 41 ? -26.098 -14.919 3.853   1.00 2.33  ? 41 GLU D HB3    2  
ATOM 10294 H HG2    . GLU F 3 41 ? -26.711 -12.541 4.299   1.00 2.42  ? 41 GLU D HG2    2  
ATOM 10295 H HG3    . GLU F 3 41 ? -28.390 -12.978 4.004   1.00 2.75  ? 41 GLU D HG3    2  
ATOM 10296 N N      . LYS F 3 42 ? -24.526 -13.703 0.837   1.00 2.03  ? 42 LYS D N      2  
ATOM 10297 C CA     . LYS F 3 42 ? -23.156 -13.226 0.675   1.00 1.96  ? 42 LYS D CA     2  
ATOM 10298 C C      . LYS F 3 42 ? -23.043 -12.359 -0.581  1.00 1.94  ? 42 LYS D C      2  
ATOM 10299 O O      . LYS F 3 42 ? -23.817 -12.529 -1.529  1.00 1.97  ? 42 LYS D O      2  
ATOM 10300 C CB     . LYS F 3 42 ? -22.166 -14.402 0.617   1.00 1.94  ? 42 LYS D CB     2  
ATOM 10301 C CG     . LYS F 3 42 ? -22.279 -15.256 -0.636  1.00 1.96  ? 42 LYS D CG     2  
ATOM 10302 C CD     . LYS F 3 42 ? -21.433 -16.521 -0.532  1.00 2.01  ? 42 LYS D CD     2  
ATOM 10303 C CE     . LYS F 3 42 ? -21.431 -17.299 -1.836  1.00 2.29  ? 42 LYS D CE     2  
ATOM 10304 N NZ     . LYS F 3 42 ? -20.826 -18.654 -1.692  1.00 2.34  ? 42 LYS D NZ     2  
ATOM 10305 H H      . LYS F 3 42 ? -24.949 -14.208 0.108   1.00 2.05  ? 42 LYS D H      2  
ATOM 10306 H HA     . LYS F 3 42 ? -22.923 -12.614 1.535   1.00 1.98  ? 42 LYS D HA     2  
ATOM 10307 H HB2    . LYS F 3 42 ? -21.161 -14.007 0.665   1.00 1.89  ? 42 LYS D HB2    2  
ATOM 10308 H HB3    . LYS F 3 42 ? -22.331 -15.037 1.477   1.00 1.98  ? 42 LYS D HB3    2  
ATOM 10309 H HG2    . LYS F 3 42 ? -23.314 -15.535 -0.774  1.00 2.04  ? 42 LYS D HG2    2  
ATOM 10310 H HG3    . LYS F 3 42 ? -21.945 -14.678 -1.484  1.00 1.93  ? 42 LYS D HG3    2  
ATOM 10311 H HD2    . LYS F 3 42 ? -20.418 -16.246 -0.292  1.00 2.11  ? 42 LYS D HD2    2  
ATOM 10312 H HD3    . LYS F 3 42 ? -21.832 -17.148 0.251   1.00 2.19  ? 42 LYS D HD3    2  
ATOM 10313 H HE2    . LYS F 3 42 ? -22.451 -17.405 -2.172  1.00 2.53  ? 42 LYS D HE2    2  
ATOM 10314 H HE3    . LYS F 3 42 ? -20.871 -16.738 -2.570  1.00 2.68  ? 42 LYS D HE3    2  
ATOM 10315 H HZ1    . LYS F 3 42 ? -20.816 -19.137 -2.614  1.00 2.48  ? 42 LYS D HZ1    2  
ATOM 10316 H HZ2    . LYS F 3 42 ? -21.378 -19.226 -1.023  1.00 2.65  ? 42 LYS D HZ2    2  
ATOM 10317 H HZ3    . LYS F 3 42 ? -19.848 -18.580 -1.342  1.00 2.55  ? 42 LYS D HZ3    2  
ATOM 10318 N N      . ILE F 3 43 ? -22.092 -11.430 -0.581  1.00 1.90  ? 43 ILE D N      2  
ATOM 10319 C CA     . ILE F 3 43 ? -21.892 -10.533 -1.714  1.00 1.90  ? 43 ILE D CA     2  
ATOM 10320 C C      . ILE F 3 43 ? -20.935 -11.143 -2.731  1.00 1.89  ? 43 ILE D C      2  
ATOM 10321 O O      . ILE F 3 43 ? -19.836 -11.581 -2.382  1.00 1.91  ? 43 ILE D O      2  
ATOM 10322 C CB     . ILE F 3 43 ? -21.348 -9.159  -1.260  1.00 1.90  ? 43 ILE D CB     2  
ATOM 10323 C CG1    . ILE F 3 43 ? -22.180 -8.608  -0.092  1.00 1.91  ? 43 ILE D CG1    2  
ATOM 10324 C CG2    . ILE F 3 43 ? -21.347 -8.177  -2.426  1.00 1.99  ? 43 ILE D CG2    2  
ATOM 10325 C CD1    . ILE F 3 43 ? -21.563 -7.399  0.582   1.00 1.97  ? 43 ILE D CD1    2  
ATOM 10326 H H      . ILE F 3 43 ? -21.499 -11.351 0.200   1.00 1.89  ? 43 ILE D H      2  
ATOM 10327 H HA     . ILE F 3 43 ? -22.851 -10.378 -2.188  1.00 1.93  ? 43 ILE D HA     2  
ATOM 10328 H HB     . ILE F 3 43 ? -20.328 -9.293  -0.937  1.00 1.88  ? 43 ILE D HB     2  
ATOM 10329 H HG12   . ILE F 3 43 ? -23.155 -8.320  -0.457  1.00 1.98  ? 43 ILE D HG12   2  
ATOM 10330 H HG13   . ILE F 3 43 ? -22.295 -9.381  0.655   1.00 1.95  ? 43 ILE D HG13   2  
ATOM 10331 H HG21   . ILE F 3 43 ? -20.694 -8.545  -3.203  1.00 1.93  ? 43 ILE D HG21   2  
ATOM 10332 H HG22   . ILE F 3 43 ? -20.994 -7.215  -2.085  1.00 2.14  ? 43 ILE D HG22   2  
ATOM 10333 H HG23   . ILE F 3 43 ? -22.350 -8.077  -2.813  1.00 2.33  ? 43 ILE D HG23   2  
ATOM 10334 H HD11   . ILE F 3 43 ? -22.182 -7.094  1.413   1.00 2.10  ? 43 ILE D HD11   2  
ATOM 10335 H HD12   . ILE F 3 43 ? -21.492 -6.588  -0.129  1.00 2.09  ? 43 ILE D HD12   2  
ATOM 10336 H HD13   . ILE F 3 43 ? -20.576 -7.650  0.941   1.00 2.45  ? 43 ILE D HD13   2  
ATOM 10337 N N      . ILE F 3 44 ? -21.371 -11.188 -3.981  1.00 1.87  ? 44 ILE D N      2  
ATOM 10338 C CA     . ILE F 3 44 ? -20.563 -11.730 -5.063  1.00 1.88  ? 44 ILE D CA     2  
ATOM 10339 C C      . ILE F 3 44 ? -19.903 -10.595 -5.833  1.00 1.88  ? 44 ILE D C      2  
ATOM 10340 O O      . ILE F 3 44 ? -20.588 -9.780  -6.454  1.00 1.91  ? 44 ILE D O      2  
ATOM 10341 C CB     . ILE F 3 44 ? -21.411 -12.568 -6.046  1.00 1.93  ? 44 ILE D CB     2  
ATOM 10342 C CG1    . ILE F 3 44 ? -22.300 -13.568 -5.293  1.00 1.97  ? 44 ILE D CG1    2  
ATOM 10343 C CG2    . ILE F 3 44 ? -20.519 -13.293 -7.048  1.00 1.96  ? 44 ILE D CG2    2  
ATOM 10344 C CD1    . ILE F 3 44 ? -21.526 -14.626 -4.539  1.00 2.00  ? 44 ILE D CD1    2  
ATOM 10345 H H      . ILE F 3 44 ? -22.268 -10.842 -4.188  1.00 1.87  ? 44 ILE D H      2  
ATOM 10346 H HA     . ILE F 3 44 ? -19.800 -12.361 -4.635  1.00 1.87  ? 44 ILE D HA     2  
ATOM 10347 H HB     . ILE F 3 44 ? -22.042 -11.887 -6.595  1.00 1.94  ? 44 ILE D HB     2  
ATOM 10348 H HG12   . ILE F 3 44 ? -22.910 -13.034 -4.579  1.00 1.97  ? 44 ILE D HG12   2  
ATOM 10349 H HG13   . ILE F 3 44 ? -22.942 -14.070 -6.003  1.00 2.02  ? 44 ILE D HG13   2  
ATOM 10350 H HG21   . ILE F 3 44 ? -19.960 -14.065 -6.538  1.00 2.06  ? 44 ILE D HG21   2  
ATOM 10351 H HG22   . ILE F 3 44 ? -19.834 -12.589 -7.496  1.00 2.16  ? 44 ILE D HG22   2  
ATOM 10352 H HG23   . ILE F 3 44 ? -21.130 -13.740 -7.818  1.00 2.24  ? 44 ILE D HG23   2  
ATOM 10353 H HD11   . ILE F 3 44 ? -22.214 -15.266 -4.010  1.00 2.06  ? 44 ILE D HD11   2  
ATOM 10354 H HD12   . ILE F 3 44 ? -20.859 -14.152 -3.836  1.00 2.35  ? 44 ILE D HD12   2  
ATOM 10355 H HD13   . ILE F 3 44 ? -20.953 -15.218 -5.239  1.00 2.28  ? 44 ILE D HD13   2  
ATOM 10356 N N      . LEU F 3 45 ? -18.585 -10.542 -5.794  1.00 1.86  ? 45 LEU D N      2  
ATOM 10357 C CA     . LEU F 3 45 ? -17.854 -9.500  -6.486  1.00 1.88  ? 45 LEU D CA     2  
ATOM 10358 C C      . LEU F 3 45 ? -17.188 -10.066 -7.737  1.00 1.90  ? 45 LEU D C      2  
ATOM 10359 O O      . LEU F 3 45 ? -16.092 -10.634 -7.674  1.00 1.88  ? 45 LEU D O      2  
ATOM 10360 C CB     . LEU F 3 45 ? -16.807 -8.878  -5.558  1.00 1.89  ? 45 LEU D CB     2  
ATOM 10361 C CG     . LEU F 3 45 ? -16.363 -7.460  -5.922  1.00 2.30  ? 45 LEU D CG     2  
ATOM 10362 C CD1    . LEU F 3 45 ? -17.462 -6.456  -5.605  1.00 2.77  ? 45 LEU D CD1    2  
ATOM 10363 C CD2    . LEU F 3 45 ? -15.090 -7.098  -5.175  1.00 2.35  ? 45 LEU D CD2    2  
ATOM 10364 H H      . LEU F 3 45 ? -18.085 -11.232 -5.299  1.00 1.86  ? 45 LEU D H      2  
ATOM 10365 H HA     . LEU F 3 45 ? -18.561 -8.741  -6.782  1.00 1.90  ? 45 LEU D HA     2  
ATOM 10366 H HB2    . LEU F 3 45 ? -17.214 -8.856  -4.557  1.00 1.80  ? 45 LEU D HB2    2  
ATOM 10367 H HB3    . LEU F 3 45 ? -15.937 -9.515  -5.559  1.00 2.02  ? 45 LEU D HB3    2  
ATOM 10368 H HG     . LEU F 3 45 ? -16.156 -7.410  -6.982  1.00 2.73  ? 45 LEU D HG     2  
ATOM 10369 H HD11   . LEU F 3 45 ? -17.617 -6.419  -4.536  1.00 2.83  ? 45 LEU D HD11   2  
ATOM 10370 H HD12   . LEU F 3 45 ? -18.378 -6.759  -6.091  1.00 3.08  ? 45 LEU D HD12   2  
ATOM 10371 H HD13   . LEU F 3 45 ? -17.172 -5.479  -5.961  1.00 3.29  ? 45 LEU D HD13   2  
ATOM 10372 H HD21   . LEU F 3 45 ? -14.721 -6.148  -5.532  1.00 2.62  ? 45 LEU D HD21   2  
ATOM 10373 H HD22   . LEU F 3 45 ? -14.343 -7.860  -5.344  1.00 2.54  ? 45 LEU D HD22   2  
ATOM 10374 H HD23   . LEU F 3 45 ? -15.302 -7.028  -4.118  1.00 2.50  ? 45 LEU D HD23   2  
ATOM 10375 N N      . LYS F 3 46 ? -17.871 -9.934  -8.865  1.00 1.97  ? 46 LYS D N      2  
ATOM 10376 C CA     . LYS F 3 46 ? -17.355 -10.424 -10.136 1.00 2.01  ? 46 LYS D CA     2  
ATOM 10377 C C      . LYS F 3 46 ? -16.587 -9.331  -10.863 1.00 2.02  ? 46 LYS D C      2  
ATOM 10378 O O      . LYS F 3 46 ? -16.780 -8.145  -10.599 1.00 1.98  ? 46 LYS D O      2  
ATOM 10379 C CB     . LYS F 3 46 ? -18.495 -10.916 -11.021 1.00 2.07  ? 46 LYS D CB     2  
ATOM 10380 C CG     . LYS F 3 46 ? -18.996 -12.303 -10.671 1.00 2.16  ? 46 LYS D CG     2  
ATOM 10381 C CD     . LYS F 3 46 ? -20.140 -12.712 -11.581 1.00 2.21  ? 46 LYS D CD     2  
ATOM 10382 C CE     . LYS F 3 46 ? -19.661 -13.003 -12.995 1.00 2.28  ? 46 LYS D CE     2  
ATOM 10383 N NZ     . LYS F 3 46 ? -20.751 -12.846 -13.994 1.00 2.36  ? 46 LYS D NZ     2  
ATOM 10384 H H      . LYS F 3 46 ? -18.747 -9.488  -8.846  1.00 2.02  ? 46 LYS D H      2  
ATOM 10385 H HA     . LYS F 3 46 ? -16.689 -11.245 -9.930  1.00 2.01  ? 46 LYS D HA     2  
ATOM 10386 H HB2    . LYS F 3 46 ? -19.323 -10.229 -10.933 1.00 2.02  ? 46 LYS D HB2    2  
ATOM 10387 H HB3    . LYS F 3 46 ? -18.155 -10.926 -12.046 1.00 2.15  ? 46 LYS D HB3    2  
ATOM 10388 H HG2    . LYS F 3 46 ? -18.186 -13.010 -10.782 1.00 2.24  ? 46 LYS D HG2    2  
ATOM 10389 H HG3    . LYS F 3 46 ? -19.342 -12.302 -9.647  1.00 2.13  ? 46 LYS D HG3    2  
ATOM 10390 H HD2    . LYS F 3 46 ? -20.609 -13.597 -11.182 1.00 2.27  ? 46 LYS D HD2    2  
ATOM 10391 H HD3    . LYS F 3 46 ? -20.860 -11.907 -11.615 1.00 2.17  ? 46 LYS D HD3    2  
ATOM 10392 H HE2    . LYS F 3 46 ? -18.861 -12.322 -13.239 1.00 2.23  ? 46 LYS D HE2    2  
ATOM 10393 H HE3    . LYS F 3 46 ? -19.293 -14.017 -13.033 1.00 2.35  ? 46 LYS D HE3    2  
ATOM 10394 H HZ1    . LYS F 3 46 ? -20.967 -11.831 -14.132 1.00 2.33  ? 46 LYS D HZ1    2  
ATOM 10395 H HZ2    . LYS F 3 46 ? -21.611 -13.328 -13.668 1.00 2.63  ? 46 LYS D HZ2    2  
ATOM 10396 H HZ3    . LYS F 3 46 ? -20.462 -13.252 -14.907 1.00 2.33  ? 46 LYS D HZ3    2  
ATOM 10397 N N      . LYS F 3 47 ? -15.736 -9.734  -11.792 1.00 2.14  ? 47 LYS D N      2  
ATOM 10398 C CA     . LYS F 3 47 ? -14.938 -8.786  -12.552 1.00 2.20  ? 47 LYS D CA     2  
ATOM 10399 C C      . LYS F 3 47 ? -15.095 -9.025  -14.049 1.00 2.19  ? 47 LYS D C      2  
ATOM 10400 O O      . LYS F 3 47 ? -15.762 -8.254  -14.739 1.00 2.31  ? 47 LYS D O      2  
ATOM 10401 C CB     . LYS F 3 47 ? -13.460 -8.871  -12.141 1.00 2.23  ? 47 LYS D CB     2  
ATOM 10402 C CG     . LYS F 3 47 ? -13.015 -10.255 -11.679 1.00 2.36  ? 47 LYS D CG     2  
ATOM 10403 C CD     . LYS F 3 47 ? -11.558 -10.247 -11.243 1.00 2.60  ? 47 LYS D CD     2  
ATOM 10404 C CE     . LYS F 3 47 ? -11.097 -11.620 -10.785 1.00 2.72  ? 47 LYS D CE     2  
ATOM 10405 N NZ     . LYS F 3 47 ? -11.137 -12.626 -11.879 1.00 2.99  ? 47 LYS D NZ     2  
ATOM 10406 H H      . LYS F 3 47 ? -15.656 -10.692 -11.984 1.00 2.23  ? 47 LYS D H      2  
ATOM 10407 H HA     . LYS F 3 47 ? -15.306 -7.796  -12.324 1.00 2.33  ? 47 LYS D HA     2  
ATOM 10408 H HB2    . LYS F 3 47 ? -12.850 -8.588  -12.986 1.00 2.40  ? 47 LYS D HB2    2  
ATOM 10409 H HB3    . LYS F 3 47 ? -13.284 -8.174  -11.335 1.00 2.29  ? 47 LYS D HB3    2  
ATOM 10410 H HG2    . LYS F 3 47 ? -13.629 -10.562 -10.845 1.00 2.31  ? 47 LYS D HG2    2  
ATOM 10411 H HG3    . LYS F 3 47 ? -13.134 -10.954 -12.494 1.00 2.75  ? 47 LYS D HG3    2  
ATOM 10412 H HD2    . LYS F 3 47 ? -10.946 -9.934  -12.076 1.00 3.24  ? 47 LYS D HD2    2  
ATOM 10413 H HD3    . LYS F 3 47 ? -11.444 -9.550  -10.427 1.00 2.68  ? 47 LYS D HD3    2  
ATOM 10414 H HE2    . LYS F 3 47 ? -10.085 -11.539 -10.420 1.00 2.87  ? 47 LYS D HE2    2  
ATOM 10415 H HE3    . LYS F 3 47 ? -11.740 -11.948 -9.982  1.00 3.14  ? 47 LYS D HE3    2  
ATOM 10416 H HZ1    . LYS F 3 47 ? -10.568 -13.457 -11.620 1.00 3.15  ? 47 LYS D HZ1    2  
ATOM 10417 H HZ2    . LYS F 3 47 ? -10.754 -12.222 -12.758 1.00 3.09  ? 47 LYS D HZ2    2  
ATOM 10418 H HZ3    . LYS F 3 47 ? -12.122 -12.935 -12.051 1.00 3.50  ? 47 LYS D HZ3    2  
ATOM 10419 N N      . TYR F 3 48 ? -14.510 -10.111 -14.537 1.00 2.32  ? 48 TYR D N      2  
ATOM 10420 C CA     . TYR F 3 48 ? -14.569 -10.459 -15.949 1.00 2.42  ? 48 TYR D CA     2  
ATOM 10421 C C      . TYR F 3 48 ? -14.097 -11.894 -16.139 1.00 2.32  ? 48 TYR D C      2  
ATOM 10422 O O      . TYR F 3 48 ? -13.596 -12.514 -15.198 1.00 2.31  ? 48 TYR D O      2  
ATOM 10423 C CB     . TYR F 3 48 ? -13.707 -9.496  -16.788 1.00 2.68  ? 48 TYR D CB     2  
ATOM 10424 C CG     . TYR F 3 48 ? -12.241 -9.472  -16.397 1.00 2.65  ? 48 TYR D CG     2  
ATOM 10425 C CD1    . TYR F 3 48 ? -11.772 -8.594  -15.427 1.00 2.58  ? 48 TYR D CD1    2  
ATOM 10426 C CD2    . TYR F 3 48 ? -11.329 -10.334 -16.993 1.00 2.88  ? 48 TYR D CD2    2  
ATOM 10427 C CE1    . TYR F 3 48 ? -10.440 -8.578  -15.062 1.00 2.75  ? 48 TYR D CE1    2  
ATOM 10428 C CE2    . TYR F 3 48 ? -9.996  -10.322 -16.635 1.00 3.03  ? 48 TYR D CE2    2  
ATOM 10429 C CZ     . TYR F 3 48 ? -9.555  -9.445  -15.670 1.00 2.96  ? 48 TYR D CZ     2  
ATOM 10430 O OH     . TYR F 3 48 ? -8.227  -9.439  -15.302 1.00 3.26  ? 48 TYR D OH     2  
ATOM 10431 H H      . TYR F 3 48 ? -14.035 -10.712 -13.925 1.00 2.52  ? 48 TYR D H      2  
ATOM 10432 H HA     . TYR F 3 48 ? -15.597 -10.383 -16.268 1.00 2.54  ? 48 TYR D HA     2  
ATOM 10433 H HB2    . TYR F 3 48 ? -13.763 -9.787  -17.825 1.00 2.89  ? 48 TYR D HB2    2  
ATOM 10434 H HB3    . TYR F 3 48 ? -14.094 -8.493  -16.681 1.00 2.84  ? 48 TYR D HB3    2  
ATOM 10435 H HD1    . TYR F 3 48 ? -12.467 -7.915  -14.954 1.00 2.53  ? 48 TYR D HD1    2  
ATOM 10436 H HD2    . TYR F 3 48 ? -11.676 -11.021 -17.752 1.00 3.06  ? 48 TYR D HD2    2  
ATOM 10437 H HE1    . TYR F 3 48 ? -10.094 -7.888  -14.307 1.00 2.83  ? 48 TYR D HE1    2  
ATOM 10438 H HE2    . TYR F 3 48 ? -9.305  -11.001 -17.111 1.00 3.29  ? 48 TYR D HE2    2  
ATOM 10439 H HH     . TYR F 3 48 ? -8.164  -9.352  -14.340 1.00 3.39  ? 48 TYR D HH     2  
ATOM 10440 N N      . LYS F 3 49 ? -14.255 -12.421 -17.344 1.00 2.43  ? 49 LYS D N      2  
ATOM 10441 C CA     . LYS F 3 49 ? -13.831 -13.781 -17.634 1.00 2.54  ? 49 LYS D CA     2  
ATOM 10442 C C      . LYS F 3 49 ? -12.324 -13.824 -17.859 1.00 2.74  ? 49 LYS D C      2  
ATOM 10443 O O      . LYS F 3 49 ? -11.786 -13.028 -18.634 1.00 2.90  ? 49 LYS D O      2  
ATOM 10444 C CB     . LYS F 3 49 ? -14.566 -14.336 -18.860 1.00 2.77  ? 49 LYS D CB     2  
ATOM 10445 C CG     . LYS F 3 49 ? -16.068 -14.478 -18.659 1.00 3.43  ? 49 LYS D CG     2  
ATOM 10446 C CD     . LYS F 3 49 ? -16.391 -15.294 -17.416 1.00 3.61  ? 49 LYS D CD     2  
ATOM 10447 C CE     . LYS F 3 49 ? -17.882 -15.528 -17.267 1.00 4.50  ? 49 LYS D CE     2  
ATOM 10448 N NZ     . LYS F 3 49 ? -18.403 -16.489 -18.273 1.00 5.03  ? 49 LYS D NZ     2  
ATOM 10449 H H      . LYS F 3 49 ? -14.656 -11.880 -18.057 1.00 2.55  ? 49 LYS D H      2  
ATOM 10450 H HA     . LYS F 3 49 ? -14.068 -14.390 -16.774 1.00 2.55  ? 49 LYS D HA     2  
ATOM 10451 H HB2    . LYS F 3 49 ? -14.399 -13.673 -19.698 1.00 2.96  ? 49 LYS D HB2    2  
ATOM 10452 H HB3    . LYS F 3 49 ? -14.164 -15.309 -19.098 1.00 2.89  ? 49 LYS D HB3    2  
ATOM 10453 H HG2    . LYS F 3 49 ? -16.498 -13.495 -18.555 1.00 3.74  ? 49 LYS D HG2    2  
ATOM 10454 H HG3    . LYS F 3 49 ? -16.493 -14.971 -19.522 1.00 4.02  ? 49 LYS D HG3    2  
ATOM 10455 H HD2    . LYS F 3 49 ? -15.893 -16.248 -17.485 1.00 3.72  ? 49 LYS D HD2    2  
ATOM 10456 H HD3    . LYS F 3 49 ? -16.031 -14.760 -16.547 1.00 3.52  ? 49 LYS D HD3    2  
ATOM 10457 H HE2    . LYS F 3 49 ? -18.072 -15.921 -16.280 1.00 4.99  ? 49 LYS D HE2    2  
ATOM 10458 H HE3    . LYS F 3 49 ? -18.391 -14.584 -17.384 1.00 4.71  ? 49 LYS D HE3    2  
ATOM 10459 H HZ1    . LYS F 3 49 ? -19.396 -16.718 -18.071 1.00 5.45  ? 49 LYS D HZ1    2  
ATOM 10460 H HZ2    . LYS F 3 49 ? -17.848 -17.368 -18.253 1.00 5.25  ? 49 LYS D HZ2    2  
ATOM 10461 H HZ3    . LYS F 3 49 ? -18.343 -16.081 -19.226 1.00 5.18  ? 49 LYS D HZ3    2  
ATOM 10462 N N      . PRO F 3 50 ? -11.625 -14.746 -17.179 1.00 2.97  ? 50 PRO D N      2  
ATOM 10463 C CA     . PRO F 3 50 ? -10.173 -14.882 -17.299 1.00 3.37  ? 50 PRO D CA     2  
ATOM 10464 C C      . PRO F 3 50 ? -9.760  -15.422 -18.672 1.00 3.52  ? 50 PRO D C      2  
ATOM 10465 O O      . PRO F 3 50 ? -9.854  -14.708 -19.672 1.00 3.73  ? 50 PRO D O      2  
ATOM 10466 C CB     . PRO F 3 50 ? -9.819  -15.864 -16.173 1.00 3.70  ? 50 PRO D CB     2  
ATOM 10467 C CG     . PRO F 3 50 ? -11.056 -16.670 -15.977 1.00 3.68  ? 50 PRO D CG     2  
ATOM 10468 C CD     . PRO F 3 50 ? -12.203 -15.736 -16.249 1.00 3.11  ? 50 PRO D CD     2  
ATOM 10469 H HA     . PRO F 3 50 ? -9.676  -13.939 -17.125 1.00 3.54  ? 50 PRO D HA     2  
ATOM 10470 H HB2    . PRO F 3 50 ? -8.983  -16.478 -16.474 1.00 3.92  ? 50 PRO D HB2    2  
ATOM 10471 H HB3    . PRO F 3 50 ? -9.562  -15.314 -15.279 1.00 3.92  ? 50 PRO D HB3    2  
ATOM 10472 H HG2    . PRO F 3 50 ? -11.068 -17.495 -16.675 1.00 3.95  ? 50 PRO D HG2    2  
ATOM 10473 H HG3    . PRO F 3 50 ? -11.103 -17.037 -14.963 1.00 3.95  ? 50 PRO D HG3    2  
ATOM 10474 H HD2    . PRO F 3 50 ? -13.020 -16.266 -16.714 1.00 3.11  ? 50 PRO D HD2    2  
ATOM 10475 H HD3    . PRO F 3 50 ? -12.529 -15.262 -15.334 1.00 3.01  ? 50 PRO D HD3    2  
ATOM 10476 N N      . ASN F 3 51 ? -9.318  -16.684 -18.722 1.00 3.54  ? 51 ASN D N      2  
ATOM 10477 C CA     . ASN F 3 51 ? -8.881  -17.316 -19.971 1.00 3.82  ? 51 ASN D CA     2  
ATOM 10478 C C      . ASN F 3 51 ? -7.837  -16.446 -20.664 1.00 4.05  ? 51 ASN D C      2  
ATOM 10479 O O      . ASN F 3 51 ? -7.754  -16.402 -21.895 1.00 4.51  ? 51 ASN D O      2  
ATOM 10480 C CB     . ASN F 3 51 ? -10.075 -17.558 -20.910 1.00 3.94  ? 51 ASN D CB     2  
ATOM 10481 C CG     . ASN F 3 51 ? -11.180 -18.382 -20.269 1.00 4.25  ? 51 ASN D CG     2  
ATOM 10482 O OD1    . ASN F 3 51 ? -10.941 -19.173 -19.357 1.00 4.62  ? 51 ASN D OD1    2  
ATOM 10483 N ND2    . ASN F 3 51 ? -12.402 -18.198 -20.743 1.00 4.36  ? 51 ASN D ND2    2  
ATOM 10484 H H      . ASN F 3 51 ? -9.296  -17.211 -17.898 1.00 3.44  ? 51 ASN D H      2  
ATOM 10485 H HA     . ASN F 3 51 ? -8.430  -18.266 -19.722 1.00 3.88  ? 51 ASN D HA     2  
ATOM 10486 H HB2    . ASN F 3 51 ? -10.490 -16.606 -21.203 1.00 3.84  ? 51 ASN D HB2    2  
ATOM 10487 H HB3    . ASN F 3 51 ? -9.728  -18.079 -21.791 1.00 4.12  ? 51 ASN D HB3    2  
ATOM 10488 H HD21   . ASN F 3 51 ? -12.525 -17.543 -21.468 1.00 4.24  ? 51 ASN D HD21   2  
ATOM 10489 H HD22   . ASN F 3 51 ? -13.134 -18.729 -20.361 1.00 4.70  ? 51 ASN D HD22   2  
ATOM 10490 N N      . MET F 3 52 ? -7.034  -15.766 -19.860 1.00 3.89  ? 52 MET D N      2  
ATOM 10491 C CA     . MET F 3 52 ? -6.010  -14.869 -20.367 1.00 4.11  ? 52 MET D CA     2  
ATOM 10492 C C      . MET F 3 52 ? -4.784  -14.908 -19.468 1.00 4.21  ? 52 MET D C      2  
ATOM 10493 O O      . MET F 3 52 ? -4.905  -15.006 -18.247 1.00 4.26  ? 52 MET D O      2  
ATOM 10494 C CB     . MET F 3 52 ? -6.562  -13.440 -20.449 1.00 3.98  ? 52 MET D CB     2  
ATOM 10495 C CG     . MET F 3 52 ? -5.573  -12.416 -20.987 1.00 4.25  ? 52 MET D CG     2  
ATOM 10496 S SD     . MET F 3 52 ? -5.085  -12.745 -22.693 1.00 5.29  ? 52 MET D SD     2  
ATOM 10497 C CE     . MET F 3 52 ? -3.977  -11.371 -22.999 1.00 5.24  ? 52 MET D CE     2  
ATOM 10498 H H      . MET F 3 52 ? -7.121  -15.885 -18.889 1.00 3.72  ? 52 MET D H      2  
ATOM 10499 H HA     . MET F 3 52 ? -5.734  -15.201 -21.355 1.00 4.46  ? 52 MET D HA     2  
ATOM 10500 H HB2    . MET F 3 52 ? -7.431  -13.441 -21.093 1.00 4.11  ? 52 MET D HB2    2  
ATOM 10501 H HB3    . MET F 3 52 ? -6.864  -13.129 -19.460 1.00 4.04  ? 52 MET D HB3    2  
ATOM 10502 H HG2    . MET F 3 52 ? -6.032  -11.438 -20.941 1.00 4.07  ? 52 MET D HG2    2  
ATOM 10503 H HG3    . MET F 3 52 ? -4.689  -12.426 -20.365 1.00 4.54  ? 52 MET D HG3    2  
ATOM 10504 H HE1    . MET F 3 52 ? -3.080  -11.496 -22.412 1.00 5.30  ? 52 MET D HE1    2  
ATOM 10505 H HE2    . MET F 3 52 ? -4.463  -10.447 -22.721 1.00 5.38  ? 52 MET D HE2    2  
ATOM 10506 H HE3    . MET F 3 52 ? -3.721  -11.342 -24.047 1.00 5.43  ? 52 MET D HE3    2  
ATOM 10507 N N      . THR F 3 53 ? -3.613  -14.836 -20.074 1.00 4.51  ? 53 THR D N      2  
ATOM 10508 C CA     . THR F 3 53 ? -2.367  -14.857 -19.336 1.00 4.79  ? 53 THR D CA     2  
ATOM 10509 C C      . THR F 3 53 ? -2.115  -13.514 -18.667 1.00 4.68  ? 53 THR D C      2  
ATOM 10510 O O      . THR F 3 53 ? -2.773  -12.519 -18.989 1.00 5.07  ? 53 THR D O      2  
ATOM 10511 C CB     . THR F 3 53 ? -1.192  -15.169 -20.273 1.00 5.33  ? 53 THR D CB     2  
ATOM 10512 O OG1    . THR F 3 53 ? -1.456  -14.610 -21.568 1.00 5.34  ? 53 THR D OG1    2  
ATOM 10513 C CG2    . THR F 3 53 ? -0.969  -16.665 -20.390 1.00 5.83  ? 53 THR D CG2    2  
ATOM 10514 H H      . THR F 3 53 ? -3.583  -14.755 -21.051 1.00 4.70  ? 53 THR D H      2  
ATOM 10515 H HA     . THR F 3 53 ? -2.427  -15.629 -18.584 1.00 4.81  ? 53 THR D HA     2  
ATOM 10516 H HB     . THR F 3 53 ? -0.299  -14.715 -19.866 1.00 5.49  ? 53 THR D HB     2  
ATOM 10517 H HG1    . THR F 3 53 ? -1.194  -15.240 -22.250 1.00 5.61  ? 53 THR D HG1    2  
ATOM 10518 H HG21   . THR F 3 53 ? -0.771  -17.078 -19.413 1.00 6.55  ? 53 THR D HG21   2  
ATOM 10519 H HG22   . THR F 3 53 ? -0.127  -16.855 -21.040 1.00 5.92  ? 53 THR D HG22   2  
ATOM 10520 H HG23   . THR F 3 53 ? -1.851  -17.129 -20.804 1.00 5.63  ? 53 THR D HG23   2  
ATOM 10521 N N      . CYS F 3 54 ? -1.180  -13.489 -17.733 1.00 4.39  ? 54 CYS D N      2  
ATOM 10522 C CA     . CYS F 3 54 ? -0.828  -12.261 -17.041 1.00 4.37  ? 54 CYS D CA     2  
ATOM 10523 C C      . CYS F 3 54 ? -0.215  -11.284 -18.030 1.00 4.49  ? 54 CYS D C      2  
ATOM 10524 O O      . CYS F 3 54 ? 0.704   -11.637 -18.773 1.00 4.52  ? 54 CYS D O      2  
ATOM 10525 C CB     . CYS F 3 54 ? 0.156   -12.557 -15.912 1.00 4.51  ? 54 CYS D CB     2  
ATOM 10526 S SG     . CYS F 3 54 ? 0.516   -14.331 -15.700 1.00 4.38  ? 54 CYS D SG     2  
ATOM 10527 H H      . CYS F 3 54 ? -0.713  -14.319 -17.497 1.00 4.35  ? 54 CYS D H      2  
ATOM 10528 H HA     . CYS F 3 54 ? -1.729  -11.832 -16.631 1.00 4.34  ? 54 CYS D HA     2  
ATOM 10529 H HB2    . CYS F 3 54 ? 1.089   -12.057 -16.118 1.00 4.61  ? 54 CYS D HB2    2  
ATOM 10530 H HB3    . CYS F 3 54 ? -0.249  -12.189 -14.981 1.00 5.00  ? 54 CYS D HB3    2  
ATOM 10531 N N      . GLN F 3 55 ? -0.747  -10.076 -18.073 1.00 4.76  ? 55 GLN D N      2  
ATOM 10532 C CA     . GLN F 3 55 ? -0.247  -9.060  -18.983 1.00 5.08  ? 55 GLN D CA     2  
ATOM 10533 C C      . GLN F 3 55 ? 0.081   -7.787  -18.218 1.00 5.21  ? 55 GLN D C      2  
ATOM 10534 O O      . GLN F 3 55 ? -0.855  -7.157  -17.685 1.00 5.47  ? 55 GLN D O      2  
ATOM 10535 C CB     . GLN F 3 55 ? -1.278  -8.773  -20.078 1.00 5.24  ? 55 GLN D CB     2  
ATOM 10536 C CG     . GLN F 3 55 ? -0.747  -8.955  -21.491 1.00 5.68  ? 55 GLN D CG     2  
ATOM 10537 C CD     . GLN F 3 55 ? -0.389  -10.396 -21.822 1.00 6.49  ? 55 GLN D CD     2  
ATOM 10538 O OE1    . GLN F 3 55 ? 0.532   -10.649 -22.598 1.00 6.91  ? 55 GLN D OE1    2  
ATOM 10539 N NE2    . GLN F 3 55 ? -1.110  -11.348 -21.247 1.00 7.00  ? 55 GLN D NE2    2  
ATOM 10540 O OXT    . GLN F 3 55 ? 1.270   -7.429  -18.139 1.00 5.42  ? 55 GLN D OXT    2  
ATOM 10541 H H      . GLN F 3 55 ? -1.491  -9.856  -17.473 1.00 4.87  ? 55 GLN D H      2  
ATOM 10542 H HA     . GLN F 3 55 ? 0.657   -9.434  -19.437 1.00 5.45  ? 55 GLN D HA     2  
ATOM 10543 H HB2    . GLN F 3 55 ? -2.121  -9.434  -19.948 1.00 5.33  ? 55 GLN D HB2    2  
ATOM 10544 H HB3    . GLN F 3 55 ? -1.616  -7.753  -19.977 1.00 5.29  ? 55 GLN D HB3    2  
ATOM 10545 H HG2    . GLN F 3 55 ? -1.501  -8.623  -22.188 1.00 5.74  ? 55 GLN D HG2    2  
ATOM 10546 H HG3    . GLN F 3 55 ? 0.138   -8.345  -21.607 1.00 5.66  ? 55 GLN D HG3    2  
ATOM 10547 H HE21   . GLN F 3 55 ? -1.832  -11.083 -20.638 1.00 6.90  ? 55 GLN D HE21   2  
ATOM 10548 H HE22   . GLN F 3 55 ? -0.892  -12.285 -21.453 1.00 7.62  ? 55 GLN D HE22   2  
ATOM 10549 O "O5'"  . DA  A 1 1  ? 42.996  18.288  5.383   1.00 4.09  ? 1  DA  E "O5'"  3  
ATOM 10550 C "C5'"  . DA  A 1 1  ? 43.882  19.037  4.546   1.00 4.09  ? 1  DA  E "C5'"  3  
ATOM 10551 C "C4'"  . DA  A 1 1  ? 43.409  19.021  3.111   1.00 4.00  ? 1  DA  E "C4'"  3  
ATOM 10552 O "O4'"  . DA  A 1 1  ? 43.480  17.661  2.623   1.00 3.96  ? 1  DA  E "O4'"  3  
ATOM 10553 C "C3'"  . DA  A 1 1  ? 41.953  19.433  2.915   1.00 3.93  ? 1  DA  E "C3'"  3  
ATOM 10554 O "O3'"  . DA  A 1 1  ? 41.745  19.892  1.577   1.00 3.91  ? 1  DA  E "O3'"  3  
ATOM 10555 C "C2'"  . DA  A 1 1  ? 41.208  18.130  3.118   1.00 3.85  ? 1  DA  E "C2'"  3  
ATOM 10556 C "C1'"  . DA  A 1 1  ? 42.171  17.111  2.520   1.00 3.87  ? 1  DA  E "C1'"  3  
ATOM 10557 N N9     . DA  A 1 1  ? 42.172  15.806  3.182   1.00 3.89  ? 1  DA  E N9     3  
ATOM 10558 C C8     . DA  A 1 1  ? 42.057  15.526  4.522   1.00 3.95  ? 1  DA  E C8     3  
ATOM 10559 N N7     . DA  A 1 1  ? 42.073  14.244  4.796   1.00 3.99  ? 1  DA  E N7     3  
ATOM 10560 C C5     . DA  A 1 1  ? 42.211  13.639  3.553   1.00 3.95  ? 1  DA  E C5     3  
ATOM 10561 C C6     . DA  A 1 1  ? 42.292  12.290  3.160   1.00 3.99  ? 1  DA  E C6     3  
ATOM 10562 N N6     . DA  A 1 1  ? 42.239  11.266  4.011   1.00 4.09  ? 1  DA  E N6     3  
ATOM 10563 N N1     . DA  A 1 1  ? 42.427  12.029  1.842   1.00 3.97  ? 1  DA  E N1     3  
ATOM 10564 C C2     . DA  A 1 1  ? 42.478  13.057  0.986   1.00 3.91  ? 1  DA  E C2     3  
ATOM 10565 N N3     . DA  A 1 1  ? 42.412  14.364  1.234   1.00 3.87  ? 1  DA  E N3     3  
ATOM 10566 C C4     . DA  A 1 1  ? 42.277  14.590  2.553   1.00 3.89  ? 1  DA  E C4     3  
ATOM 10567 H "H5'"  . DA  A 1 1  ? 44.881  18.602  4.594   1.00 4.15  ? 1  DA  E "H5'"  3  
ATOM 10568 H "H5''" . DA  A 1 1  ? 43.926  20.068  4.894   1.00 4.15  ? 1  DA  E "H5''" 3  
ATOM 10569 H "H4'"  . DA  A 1 1  ? 44.023  19.721  2.543   1.00 4.05  ? 1  DA  E "H4'"  3  
ATOM 10570 H "H3'"  . DA  A 1 1  ? 41.649  20.205  3.622   1.00 3.97  ? 1  DA  E "H3'"  3  
ATOM 10571 H "H2'"  . DA  A 1 1  ? 41.017  17.946  4.175   1.00 3.88  ? 1  DA  E "H2'"  3  
ATOM 10572 H "H2''" . DA  A 1 1  ? 40.249  18.143  2.610   1.00 3.78  ? 1  DA  E "H2''" 3  
ATOM 10573 H "H1'"  . DA  A 1 1  ? 41.959  16.957  1.462   1.00 3.83  ? 1  DA  E "H1'"  3  
ATOM 10574 H H8     . DA  A 1 1  ? 41.967  16.292  5.278   1.00 3.99  ? 1  DA  E H8     3  
ATOM 10575 H H61    . DA  A 1 1  ? 42.138  11.443  4.999   1.00 4.13  ? 1  DA  E H61    3  
ATOM 10576 H H62    . DA  A 1 1  ? 42.296  10.314  3.674   1.00 4.14  ? 1  DA  E H62    3  
ATOM 10577 H H2     . DA  A 1 1  ? 42.590  12.786  -0.064  1.00 3.93  ? 1  DA  E H2     3  
ATOM 10578 H "HO5'" . DA  A 1 1  ? 43.533  17.675  5.897   1.00 4.25  ? 1  DA  E "HO5'" 3  
ATOM 10579 P P      . DT  A 1 2  ? 40.538  20.912  1.243   1.00 3.90  ? 2  DT  E P      3  
ATOM 10580 O OP1    . DT  A 1 2  ? 41.060  22.303  1.189   1.00 4.01  ? 2  DT  E OP1    3  
ATOM 10581 O OP2    . DT  A 1 2  ? 39.392  20.590  2.128   1.00 3.83  ? 2  DT  E OP2    3  
ATOM 10582 O "O5'"  . DT  A 1 2  ? 40.146  20.465  -0.235  1.00 3.87  ? 2  DT  E "O5'"  3  
ATOM 10583 C "C5'"  . DT  A 1 2  ? 40.920  19.462  -0.891  1.00 3.88  ? 2  DT  E "C5'"  3  
ATOM 10584 C "C4'"  . DT  A 1 2  ? 40.070  18.644  -1.836  1.00 3.85  ? 2  DT  E "C4'"  3  
ATOM 10585 O "O4'"  . DT  A 1 2  ? 39.849  17.334  -1.262  1.00 3.78  ? 2  DT  E "O4'"  3  
ATOM 10586 C "C3'"  . DT  A 1 2  ? 38.669  19.196  -2.080  1.00 3.81  ? 2  DT  E "C3'"  3  
ATOM 10587 O "O3'"  . DT  A 1 2  ? 38.210  18.670  -3.325  1.00 3.84  ? 2  DT  E "O3'"  3  
ATOM 10588 C "C2'"  . DT  A 1 2  ? 37.861  18.597  -0.942  1.00 3.70  ? 2  DT  E "C2'"  3  
ATOM 10589 C "C1'"  . DT  A 1 2  ? 38.507  17.222  -0.803  1.00 3.69  ? 2  DT  E "C1'"  3  
ATOM 10590 N N1     . DT  A 1 2  ? 38.516  16.599  0.541   1.00 3.65  ? 2  DT  E N1     3  
ATOM 10591 C C2     . DT  A 1 2  ? 38.637  15.226  0.567   1.00 3.65  ? 2  DT  E C2     3  
ATOM 10592 O O2     . DT  A 1 2  ? 38.749  14.551  -0.443  1.00 3.68  ? 2  DT  E O2     3  
ATOM 10593 N N3     . DT  A 1 2  ? 38.616  14.669  1.815   1.00 3.66  ? 2  DT  E N3     3  
ATOM 10594 C C4     . DT  A 1 2  ? 38.491  15.326  3.019   1.00 3.67  ? 2  DT  E C4     3  
ATOM 10595 O O4     . DT  A 1 2  ? 38.473  14.679  4.066   1.00 3.71  ? 2  DT  E O4     3  
ATOM 10596 C C5     . DT  A 1 2  ? 38.372  16.768  2.926   1.00 3.67  ? 2  DT  E C5     3  
ATOM 10597 C C7     . DT  A 1 2  ? 38.224  17.563  4.184   1.00 3.71  ? 2  DT  E C7     3  
ATOM 10598 C C6     . DT  A 1 2  ? 38.393  17.331  1.706   1.00 3.66  ? 2  DT  E C6     3  
ATOM 10599 H "H5'"  . DT  A 1 2  ? 41.357  18.797  -0.146  1.00 3.86  ? 2  DT  E "H5'"  3  
ATOM 10600 H "H5''" . DT  A 1 2  ? 41.722  19.934  -1.456  1.00 3.97  ? 2  DT  E "H5''" 3  
ATOM 10601 H "H4'"  . DT  A 1 2  ? 40.575  18.614  -2.803  1.00 3.93  ? 2  DT  E "H4'"  3  
ATOM 10602 H "H3'"  . DT  A 1 2  ? 38.647  20.282  -2.099  1.00 3.87  ? 2  DT  E "H3'"  3  
ATOM 10603 H "H2'"  . DT  A 1 2  ? 37.961  19.194  -0.035  1.00 3.70  ? 2  DT  E "H2'"  3  
ATOM 10604 H "H2''" . DT  A 1 2  ? 36.802  18.559  -1.186  1.00 3.66  ? 2  DT  E "H2''" 3  
ATOM 10605 H "H1'"  . DT  A 1 2  ? 38.010  16.521  -1.478  1.00 3.68  ? 2  DT  E "H1'"  3  
ATOM 10606 H H3     . DT  A 1 2  ? 38.698  13.662  1.850   1.00 3.69  ? 2  DT  E H3     3  
ATOM 10607 H H71    . DT  A 1 2  ? 38.208  18.627  3.944   1.00 3.72  ? 2  DT  E H71    3  
ATOM 10608 H H72    . DT  A 1 2  ? 39.062  17.354  4.849   1.00 3.79  ? 2  DT  E H72    3  
ATOM 10609 H H73    . DT  A 1 2  ? 37.291  17.289  4.679   1.00 3.98  ? 2  DT  E H73    3  
ATOM 10610 H H6     . DT  A 1 2  ? 38.312  18.415  1.635   1.00 3.69  ? 2  DT  E H6     3  
ATOM 10611 P P      . DG  A 1 3  ? 37.120  19.456  -4.201  1.00 3.88  ? 3  DG  E P      3  
ATOM 10612 O OP1    . DG  A 1 3  ? 37.788  20.534  -4.973  1.00 4.05  ? 3  DG  E OP1    3  
ATOM 10613 O OP2    . DG  A 1 3  ? 35.964  19.787  -3.329  1.00 3.77  ? 3  DG  E OP2    3  
ATOM 10614 O "O5'"  . DG  A 1 3  ? 36.680  18.322  -5.226  1.00 3.91  ? 3  DG  E "O5'"  3  
ATOM 10615 C "C5'"  . DG  A 1 3  ? 37.557  17.220  -5.475  1.00 3.87  ? 3  DG  E "C5'"  3  
ATOM 10616 C "C4'"  . DG  A 1 3  ? 36.779  15.944  -5.699  1.00 3.85  ? 3  DG  E "C4'"  3  
ATOM 10617 O "O4'"  . DG  A 1 3  ? 36.691  15.218  -4.451  1.00 3.72  ? 3  DG  E "O4'"  3  
ATOM 10618 C "C3'"  . DG  A 1 3  ? 35.330  16.160  -6.120  1.00 3.85  ? 3  DG  E "C3'"  3  
ATOM 10619 O "O3'"  . DG  A 1 3  ? 34.877  14.983  -6.788  1.00 3.91  ? 3  DG  E "O3'"  3  
ATOM 10620 C "C2'"  . DG  A 1 3  ? 34.602  16.297  -4.796  1.00 3.69  ? 3  DG  E "C2'"  3  
ATOM 10621 C "C1'"  . DG  A 1 3  ? 35.370  15.309  -3.928  1.00 3.63  ? 3  DG  E "C1'"  3  
ATOM 10622 N N9     . DG  A 1 3  ? 35.446  15.617  -2.504  1.00 3.54  ? 3  DG  E N9     3  
ATOM 10623 C C8     . DG  A 1 3  ? 35.479  16.851  -1.908  1.00 3.53  ? 3  DG  E C8     3  
ATOM 10624 N N7     . DG  A 1 3  ? 35.520  16.791  -0.603  1.00 3.49  ? 3  DG  E N7     3  
ATOM 10625 C C5     . DG  A 1 3  ? 35.514  15.431  -0.322  1.00 3.46  ? 3  DG  E C5     3  
ATOM 10626 C C6     . DG  A 1 3  ? 35.540  14.744  0.923   1.00 3.46  ? 3  DG  E C6     3  
ATOM 10627 O O6     . DG  A 1 3  ? 35.581  15.218  2.067   1.00 3.47  ? 3  DG  E O6     3  
ATOM 10628 N N1     . DG  A 1 3  ? 35.521  13.365  0.748   1.00 3.48  ? 3  DG  E N1     3  
ATOM 10629 C C2     . DG  A 1 3  ? 35.478  12.724  -0.468  1.00 3.51  ? 3  DG  E C2     3  
ATOM 10630 N N2     . DG  A 1 3  ? 35.457  11.383  -0.434  1.00 3.58  ? 3  DG  E N2     3  
ATOM 10631 N N3     . DG  A 1 3  ? 35.456  13.351  -1.632  1.00 3.53  ? 3  DG  E N3     3  
ATOM 10632 C C4     . DG  A 1 3  ? 35.475  14.693  -1.485  1.00 3.50  ? 3  DG  E C4     3  
ATOM 10633 H "H5'"  . DG  A 1 3  ? 38.221  17.084  -4.620  1.00 3.75  ? 3  DG  E "H5'"  3  
ATOM 10634 H "H5''" . DG  A 1 3  ? 38.161  17.426  -6.358  1.00 4.01  ? 3  DG  E "H5''" 3  
ATOM 10635 H "H4'"  . DG  A 1 3  ? 37.267  15.383  -6.498  1.00 3.94  ? 3  DG  E "H4'"  3  
ATOM 10636 H "H3'"  . DG  A 1 3  ? 35.211  17.028  -6.766  1.00 3.94  ? 3  DG  E "H3'"  3  
ATOM 10637 H "H2'"  . DG  A 1 3  ? 34.668  17.317  -4.416  1.00 3.68  ? 3  DG  E "H2'"  3  
ATOM 10638 H "H2''" . DG  A 1 3  ? 33.548  16.059  -4.901  1.00 3.67  ? 3  DG  E "H2''" 3  
ATOM 10639 H "H1'"  . DG  A 1 3  ? 34.926  14.315  -4.025  1.00 3.62  ? 3  DG  E "H1'"  3  
ATOM 10640 H H8     . DG  A 1 3  ? 35.466  17.778  -2.459  1.00 3.59  ? 3  DG  E H8     3  
ATOM 10641 H H1     . DG  A 1 3  ? 35.536  12.792  1.582   1.00 3.51  ? 3  DG  E H1     3  
ATOM 10642 H H21    . DG  A 1 3  ? 35.424  10.857  -1.295  1.00 3.63  ? 3  DG  E H21    3  
ATOM 10643 H H22    . DG  A 1 3  ? 35.476  10.885  0.448   1.00 3.60  ? 3  DG  E H22    3  
ATOM 10644 P P      . DA  A 1 4  ? 33.674  15.057  -7.838  1.00 4.02  ? 4  DA  E P      3  
ATOM 10645 O OP1    . DA  A 1 4  ? 34.234  15.176  -9.208  1.00 4.23  ? 4  DA  E OP1    3  
ATOM 10646 O OP2    . DA  A 1 4  ? 32.690  16.060  -7.357  1.00 3.94  ? 4  DA  E OP2    3  
ATOM 10647 O "O5'"  . DA  A 1 4  ? 33.032  13.605  -7.701  1.00 4.02  ? 4  DA  E "O5'"  3  
ATOM 10648 C "C5'"  . DA  A 1 4  ? 33.856  12.454  -7.876  1.00 4.12  ? 4  DA  E "C5'"  3  
ATOM 10649 C "C4'"  . DA  A 1 4  ? 33.363  11.286  -7.053  1.00 4.06  ? 4  DA  E "C4'"  3  
ATOM 10650 O "O4'"  . DA  A 1 4  ? 33.461  11.614  -5.645  1.00 3.92  ? 4  DA  E "O4'"  3  
ATOM 10651 C "C3'"  . DA  A 1 4  ? 31.882  10.971  -7.266  1.00 4.01  ? 4  DA  E "C3'"  3  
ATOM 10652 O "O3'"  . DA  A 1 4  ? 31.627  9.624   -6.880  1.00 4.04  ? 4  DA  E "O3'"  3  
ATOM 10653 C "C2'"  . DA  A 1 4  ? 31.184  11.878  -6.275  1.00 3.84  ? 4  DA  E "C2'"  3  
ATOM 10654 C "C1'"  . DA  A 1 4  ? 32.163  11.852  -5.112  1.00 3.79  ? 4  DA  E "C1'"  3  
ATOM 10655 N N9     . DA  A 1 4  ? 32.188  13.041  -4.262  1.00 3.68  ? 4  DA  E N9     3  
ATOM 10656 C C8     . DA  A 1 4  ? 32.186  14.367  -4.599  1.00 3.67  ? 4  DA  E C8     3  
ATOM 10657 N N7     . DA  A 1 4  ? 32.161  15.177  -3.564  1.00 3.58  ? 4  DA  E N7     3  
ATOM 10658 C C5     . DA  A 1 4  ? 32.152  14.320  -2.471  1.00 3.52  ? 4  DA  E C5     3  
ATOM 10659 C C6     . DA  A 1 4  ? 32.119  14.549  -1.080  1.00 3.46  ? 4  DA  E C6     3  
ATOM 10660 N N6     . DA  A 1 4  ? 32.084  15.761  -0.524  1.00 3.44  ? 4  DA  E N6     3  
ATOM 10661 N N1     . DA  A 1 4  ? 32.122  13.469  -0.265  1.00 3.47  ? 4  DA  E N1     3  
ATOM 10662 C C2     . DA  A 1 4  ? 32.150  12.250  -0.818  1.00 3.54  ? 4  DA  E C2     3  
ATOM 10663 N N3     . DA  A 1 4  ? 32.179  11.909  -2.104  1.00 3.60  ? 4  DA  E N3     3  
ATOM 10664 C C4     . DA  A 1 4  ? 32.178  13.002  -2.886  1.00 3.58  ? 4  DA  E C4     3  
ATOM 10665 H "H5'"  . DA  A 1 4  ? 34.878  12.693  -7.576  1.00 4.16  ? 4  DA  E "H5'"  3  
ATOM 10666 H "H5''" . DA  A 1 4  ? 33.858  12.167  -8.925  1.00 4.28  ? 4  DA  E "H5''" 3  
ATOM 10667 H "H4'"  . DA  A 1 4  ? 33.930  10.399  -7.341  1.00 4.16  ? 4  DA  E "H4'"  3  
ATOM 10668 H "H3'"  . DA  A 1 4  ? 31.567  11.132  -8.294  1.00 4.10  ? 4  DA  E "H3'"  3  
ATOM 10669 H "H2'"  . DA  A 1 4  ? 31.049  12.880  -6.680  1.00 3.84  ? 4  DA  E "H2'"  3  
ATOM 10670 H "H2''" . DA  A 1 4  ? 30.199  11.494  -6.013  1.00 3.78  ? 4  DA  E "H2''" 3  
ATOM 10671 H "H1'"  . DA  A 1 4  ? 31.934  11.000  -4.469  1.00 3.77  ? 4  DA  E "H1'"  3  
ATOM 10672 H H8     . DA  A 1 4  ? 32.197  14.714  -5.620  1.00 3.76  ? 4  DA  E H8     3  
ATOM 10673 H H61    . DA  A 1 4  ? 32.076  16.584  -1.109  1.00 3.46  ? 4  DA  E H61    3  
ATOM 10674 H H62    . DA  A 1 4  ? 32.046  15.862  0.480   1.00 3.42  ? 4  DA  E H62    3  
ATOM 10675 H H2     . DA  A 1 4  ? 32.150  11.418  -0.115  1.00 3.58  ? 4  DA  E H2     3  
ATOM 10676 P P      . DT  A 1 5  ? 30.361  8.839   -7.466  1.00 4.10  ? 5  DT  E P      3  
ATOM 10677 O OP1    . DT  A 1 5  ? 30.791  7.968   -8.587  1.00 4.31  ? 5  DT  E OP1    3  
ATOM 10678 O OP2    . DT  A 1 5  ? 29.252  9.805   -7.671  1.00 4.01  ? 5  DT  E OP2    3  
ATOM 10679 O "O5'"  . DT  A 1 5  ? 29.980  7.899   -6.236  1.00 4.05  ? 5  DT  E "O5'"  3  
ATOM 10680 C "C5'"  . DT  A 1 5  ? 30.924  7.701   -5.182  1.00 4.03  ? 5  DT  E "C5'"  3  
ATOM 10681 C "C4'"  . DT  A 1 5  ? 30.263  7.108   -3.959  1.00 3.97  ? 5  DT  E "C4'"  3  
ATOM 10682 O "O4'"  . DT  A 1 5  ? 30.192  8.121   -2.925  1.00 3.80  ? 5  DT  E "O4'"  3  
ATOM 10683 C "C3'"  . DT  A 1 5  ? 28.815  6.676   -4.175  1.00 3.95  ? 5  DT  E "C3'"  3  
ATOM 10684 O "O3'"  . DT  A 1 5  ? 28.468  5.701   -3.194  1.00 3.98  ? 5  DT  E "O3'"  3  
ATOM 10685 C "C2'"  . DT  A 1 5  ? 28.035  7.948   -3.901  1.00 3.75  ? 5  DT  E "C2'"  3  
ATOM 10686 C "C1'"  . DT  A 1 5  ? 28.851  8.575   -2.780  1.00 3.67  ? 5  DT  E "C1'"  3  
ATOM 10687 N N1     . DT  A 1 5  ? 28.840  10.054  -2.697  1.00 3.55  ? 5  DT  E N1     3  
ATOM 10688 C C2     . DT  A 1 5  ? 28.835  10.600  -1.430  1.00 3.45  ? 5  DT  E C2     3  
ATOM 10689 O O2     . DT  A 1 5  ? 28.884  9.926   -0.414  1.00 3.47  ? 5  DT  E O2     3  
ATOM 10690 N N3     . DT  A 1 5  ? 28.768  11.965  -1.393  1.00 3.36  ? 5  DT  E N3     3  
ATOM 10691 C C4     . DT  A 1 5  ? 28.715  12.826  -2.465  1.00 3.38  ? 5  DT  E C4     3  
ATOM 10692 O O4     . DT  A 1 5  ? 28.631  14.038  -2.270  1.00 3.33  ? 5  DT  E O4     3  
ATOM 10693 C C5     . DT  A 1 5  ? 28.740  12.195  -3.766  1.00 3.49  ? 5  DT  E C5     3  
ATOM 10694 C C7     . DT  A 1 5  ? 28.646  13.060  -4.982  1.00 3.56  ? 5  DT  E C7     3  
ATOM 10695 C C6     . DT  A 1 5  ? 28.809  10.852  -3.824  1.00 3.57  ? 5  DT  E C6     3  
ATOM 10696 H "H5'"  . DT  A 1 5  ? 31.373  8.656   -4.912  1.00 3.95  ? 5  DT  E "H5'"  3  
ATOM 10697 H "H5''" . DT  A 1 5  ? 31.707  7.026   -5.519  1.00 4.18  ? 5  DT  E "H5''" 3  
ATOM 10698 H "H4'"  . DT  A 1 5  ? 30.825  6.220   -3.665  1.00 4.08  ? 5  DT  E "H4'"  3  
ATOM 10699 H "H3'"  . DT  A 1 5  ? 28.647  6.278   -5.173  1.00 4.05  ? 5  DT  E "H3'"  3  
ATOM 10700 H "H2'"  . DT  A 1 5  ? 27.992  8.583   -4.786  1.00 3.76  ? 5  DT  E "H2'"  3  
ATOM 10701 H "H2''" . DT  A 1 5  ? 27.011  7.726   -3.610  1.00 3.70  ? 5  DT  E "H2''" 3  
ATOM 10702 H "H1'"  . DT  A 1 5  ? 28.499  8.193   -1.816  1.00 3.65  ? 5  DT  E "H1'"  3  
ATOM 10703 H H3     . DT  A 1 5  ? 28.742  12.388  -0.475  1.00 3.31  ? 5  DT  E H3     3  
ATOM 10704 H H71    . DT  A 1 5  ? 27.850  13.793  -4.844  1.00 3.50  ? 5  DT  E H71    3  
ATOM 10705 H H72    . DT  A 1 5  ? 29.592  13.578  -5.134  1.00 3.89  ? 5  DT  E H72    3  
ATOM 10706 H H73    . DT  A 1 5  ? 28.422  12.444  -5.854  1.00 3.66  ? 5  DT  E H73    3  
ATOM 10707 H H6     . DT  A 1 5  ? 28.841  10.375  -4.801  1.00 3.68  ? 5  DT  E H6     3  
ATOM 10708 P P      . DT  A 1 6  ? 27.268  4.665   -3.457  1.00 4.05  ? 6  DT  E P      3  
ATOM 10709 O OP1    . DT  A 1 6  ? 27.828  3.381   -3.947  1.00 4.28  ? 6  DT  E OP1    3  
ATOM 10710 O OP2    . DT  A 1 6  ? 26.200  5.345   -4.231  1.00 3.94  ? 6  DT  E OP2    3  
ATOM 10711 O "O5'"  . DT  A 1 6  ? 26.741  4.441   -1.972  1.00 3.99  ? 6  DT  E "O5'"  3  
ATOM 10712 C "C5'"  . DT  A 1 6  ? 27.512  4.948   -0.880  1.00 3.96  ? 6  DT  E "C5'"  3  
ATOM 10713 C "C4'"  . DT  A 1 6  ? 26.651  5.195   0.336   1.00 3.86  ? 6  DT  E "C4'"  3  
ATOM 10714 O "O4'"  . DT  A 1 6  ? 26.474  6.621   0.504   1.00 3.65  ? 6  DT  E "O4'"  3  
ATOM 10715 C "C3'"  . DT  A 1 6  ? 25.233  4.640   0.235   1.00 3.87  ? 6  DT  E "C3'"  3  
ATOM 10716 O "O3'"  . DT  A 1 6  ? 24.735  4.447   1.557   1.00 3.87  ? 6  DT  E "O3'"  3  
ATOM 10717 C "C2'"  . DT  A 1 6  ? 24.476  5.761   -0.451  1.00 3.69  ? 6  DT  E "C2'"  3  
ATOM 10718 C "C1'"  . DT  A 1 6  ? 25.149  6.995   0.143   1.00 3.54  ? 6  DT  E "C1'"  3  
ATOM 10719 N N1     . DT  A 1 6  ? 25.208  8.201   -0.709  1.00 3.42  ? 6  DT  E N1     3  
ATOM 10720 C C2     . DT  A 1 6  ? 25.245  9.415   -0.055  1.00 3.29  ? 6  DT  E C2     3  
ATOM 10721 O O2     . DT  A 1 6  ? 25.267  9.516   1.161   1.00 3.27  ? 6  DT  E O2     3  
ATOM 10722 N N3     . DT  A 1 6  ? 25.255  10.510  -0.874  1.00 3.22  ? 6  DT  E N3     3  
ATOM 10723 C C4     . DT  A 1 6  ? 25.234  10.520  -2.250  1.00 3.28  ? 6  DT  E C4     3  
ATOM 10724 O O4     . DT  A 1 6  ? 25.238  11.593  -2.852  1.00 3.25  ? 6  DT  E O4     3  
ATOM 10725 C C5     . DT  A 1 6  ? 25.207  9.216   -2.876  1.00 3.42  ? 6  DT  E C5     3  
ATOM 10726 C C7     . DT  A 1 6  ? 25.149  9.136   -4.369  1.00 3.54  ? 6  DT  E C7     3  
ATOM 10727 C C6     . DT  A 1 6  ? 25.202  8.129   -2.087  1.00 3.48  ? 6  DT  E C6     3  
ATOM 10728 H "H5'"  . DT  A 1 6  ? 27.983  5.886   -1.175  1.00 3.89  ? 6  DT  E "H5'"  3  
ATOM 10729 H "H5''" . DT  A 1 6  ? 28.288  4.231   -0.621  1.00 4.12  ? 6  DT  E "H5''" 3  
ATOM 10730 H "H4'"  . DT  A 1 6  ? 27.126  4.710   1.191   1.00 3.94  ? 6  DT  E "H4'"  3  
ATOM 10731 H "H3'"  . DT  A 1 6  ? 25.196  3.702   -0.318  1.00 4.03  ? 6  DT  E "H3'"  3  
ATOM 10732 H "H2'"  . DT  A 1 6  ? 24.593  5.708   -1.533  1.00 3.74  ? 6  DT  E "H2'"  3  
ATOM 10733 H "H2''" . DT  A 1 6  ? 23.412  5.708   -0.238  1.00 3.64  ? 6  DT  E "H2''" 3  
ATOM 10734 H "H1'"  . DT  A 1 6  ? 24.642  7.274   1.069   1.00 3.47  ? 6  DT  E "H1'"  3  
ATOM 10735 H H3     . DT  A 1 6  ? 25.268  11.409  -0.415  1.00 3.14  ? 6  DT  E H3     3  
ATOM 10736 H H71    . DT  A 1 6  ? 25.103  8.093   -4.677  1.00 3.87  ? 6  DT  E H71    3  
ATOM 10737 H H72    . DT  A 1 6  ? 24.263  9.657   -4.727  1.00 3.48  ? 6  DT  E H72    3  
ATOM 10738 H H73    . DT  A 1 6  ? 26.037  9.602   -4.793  1.00 3.74  ? 6  DT  E H73    3  
ATOM 10739 H H6     . DT  A 1 6  ? 25.199  7.146   -2.557  1.00 3.61  ? 6  DT  E H6     3  
ATOM 10740 P P      . DG  A 1 7  ? 23.604  3.351   1.850   1.00 4.01  ? 7  DG  E P      3  
ATOM 10741 O OP1    . DG  A 1 7  ? 24.250  2.075   2.245   1.00 4.24  ? 7  DG  E OP1    3  
ATOM 10742 O OP2    . DG  A 1 7  ? 22.632  3.363   0.727   1.00 3.96  ? 7  DG  E OP2    3  
ATOM 10743 O "O5'"  . DG  A 1 7  ? 22.894  3.960   3.141   1.00 3.93  ? 7  DG  E "O5'"  3  
ATOM 10744 C "C5'"  . DG  A 1 7  ? 23.691  4.297   4.273   1.00 3.84  ? 7  DG  E "C5'"  3  
ATOM 10745 C "C4'"  . DG  A 1 7  ? 23.109  5.461   5.042   1.00 3.74  ? 7  DG  E "C4'"  3  
ATOM 10746 O "O4'"  . DG  A 1 7  ? 23.195  6.662   4.233   1.00 3.56  ? 7  DG  E "O4'"  3  
ATOM 10747 C "C3'"  . DG  A 1 7  ? 21.620  5.304   5.341   1.00 3.71  ? 7  DG  E "C3'"  3  
ATOM 10748 O "O3'"  . DG  A 1 7  ? 21.291  6.104   6.479   1.00 3.70  ? 7  DG  E "O3'"  3  
ATOM 10749 C "C2'"  . DG  A 1 7  ? 20.956  5.875   4.103   1.00 3.53  ? 7  DG  E "C2'"  3  
ATOM 10750 C "C1'"  . DG  A 1 7  ? 21.901  7.018   3.761   1.00 3.43  ? 7  DG  E "C1'"  3  
ATOM 10751 N N9     . DG  A 1 7  ? 21.976  7.403   2.353   1.00 3.33  ? 7  DG  E N9     3  
ATOM 10752 C C8     . DG  A 1 7  ? 21.979  6.594   1.248   1.00 3.39  ? 7  DG  E C8     3  
ATOM 10753 N N7     . DG  A 1 7  ? 21.971  7.258   0.121   1.00 3.31  ? 7  DG  E N7     3  
ATOM 10754 C C5     . DG  A 1 7  ? 21.980  8.593   0.509   1.00 3.19  ? 7  DG  E C5     3  
ATOM 10755 C C6     . DG  A 1 7  ? 21.970  9.791   -0.272  1.00 3.10  ? 7  DG  E C6     3  
ATOM 10756 O O6     . DG  A 1 7  ? 21.934  9.916   -1.506  1.00 3.12  ? 7  DG  E O6     3  
ATOM 10757 N N1     . DG  A 1 7  ? 21.995  10.927  0.534   1.00 3.02  ? 7  DG  E N1     3  
ATOM 10758 C C2     . DG  A 1 7  ? 22.018  10.918  1.908   1.00 3.05  ? 7  DG  E C2     3  
ATOM 10759 N N2     . DG  A 1 7  ? 22.041  12.119  2.504   1.00 3.02  ? 7  DG  E N2     3  
ATOM 10760 N N3     . DG  A 1 7  ? 22.020  9.818   2.642   1.00 3.14  ? 7  DG  E N3     3  
ATOM 10761 C C4     . DG  A 1 7  ? 22.000  8.700   1.883   1.00 3.20  ? 7  DG  E C4     3  
ATOM 10762 H "H5'"  . DG  A 1 7  ? 24.691  4.563   3.939   1.00 3.75  ? 7  DG  E "H5'"  3  
ATOM 10763 H "H5''" . DG  A 1 7  ? 23.758  3.435   4.936   1.00 3.99  ? 7  DG  E "H5''" 3  
ATOM 10764 H "H4'"  . DG  A 1 7  ? 23.630  5.534   5.998   1.00 3.83  ? 7  DG  E "H4'"  3  
ATOM 10765 H "H3'"  . DG  A 1 7  ? 21.350  4.266   5.525   1.00 3.84  ? 7  DG  E "H3'"  3  
ATOM 10766 H "H2'"  . DG  A 1 7  ? 20.904  5.131   3.308   1.00 3.57  ? 7  DG  E "H2'"  3  
ATOM 10767 H "H2''" . DG  A 1 7  ? 19.938  6.191   4.314   1.00 3.47  ? 7  DG  E "H2''" 3  
ATOM 10768 H "H1'"  . DG  A 1 7  ? 21.606  7.907   4.323   1.00 3.36  ? 7  DG  E "H1'"  3  
ATOM 10769 H H8     . DG  A 1 7  ? 21.989  5.517   1.302   1.00 3.51  ? 7  DG  E H8     3  
ATOM 10770 H H1     . DG  A 1 7  ? 21.995  11.827  0.073   1.00 2.98  ? 7  DG  E H1     3  
ATOM 10771 H H21    . DG  A 1 7  ? 22.061  12.187  3.512   1.00 3.07  ? 7  DG  E H21    3  
ATOM 10772 H H22    . DG  A 1 7  ? 22.032  12.967  1.946   1.00 2.97  ? 7  DG  E H22    3  
ATOM 10773 P P      . DA  A 1 8  ? 20.005  5.750   7.377   1.00 3.78  ? 8  DA  E P      3  
ATOM 10774 O OP1    . DA  A 1 8  ? 20.412  4.896   8.524   1.00 4.00  ? 8  DA  E OP1    3  
ATOM 10775 O OP2    . DA  A 1 8  ? 18.927  5.291   6.471   1.00 3.71  ? 8  DA  E OP2    3  
ATOM 10776 O "O5'"  . DA  A 1 8  ? 19.587  7.180   7.941   1.00 3.67  ? 8  DA  E "O5'"  3  
ATOM 10777 C "C5'"  . DA  A 1 8  ? 20.542  8.242   7.976   1.00 3.62  ? 8  DA  E "C5'"  3  
ATOM 10778 C "C4'"  . DA  A 1 8  ? 19.856  9.586   8.086   1.00 3.48  ? 8  DA  E "C4'"  3  
ATOM 10779 O "O4'"  . DA  A 1 8  ? 19.950  10.269  6.812   1.00 3.28  ? 8  DA  E "O4'"  3  
ATOM 10780 C "C3'"  . DA  A 1 8  ? 18.359  9.523   8.373   1.00 3.49  ? 8  DA  E "C3'"  3  
ATOM 10781 O "O3'"  . DA  A 1 8  ? 17.952  10.769  8.930   1.00 3.45  ? 8  DA  E "O3'"  3  
ATOM 10782 C "C2'"  . DA  A 1 8  ? 17.745  9.398   6.993   1.00 3.33  ? 8  DA  E "C2'"  3  
ATOM 10783 C "C1'"  . DA  A 1 8  ? 18.681  10.270  6.164   1.00 3.19  ? 8  DA  E "C1'"  3  
ATOM 10784 N N9     . DA  A 1 8  ? 18.853  9.859   4.773   1.00 3.12  ? 8  DA  E N9     3  
ATOM 10785 C C8     . DA  A 1 8  ? 19.150  8.620   4.274   1.00 3.21  ? 8  DA  E C8     3  
ATOM 10786 N N7     . DA  A 1 8  ? 19.197  8.575   2.964   1.00 3.15  ? 8  DA  E N7     3  
ATOM 10787 C C5     . DA  A 1 8  ? 18.917  9.877   2.574   1.00 3.01  ? 8  DA  E C5     3  
ATOM 10788 C C6     . DA  A 1 8  ? 18.813  10.493  1.308   1.00 2.94  ? 8  DA  E C6     3  
ATOM 10789 N N6     . DA  A 1 8  ? 18.975  9.850   0.149   1.00 3.00  ? 8  DA  E N6     3  
ATOM 10790 N N1     . DA  A 1 8  ? 18.527  11.813  1.276   1.00 2.86  ? 8  DA  E N1     3  
ATOM 10791 C C2     . DA  A 1 8  ? 18.357  12.463  2.436   1.00 2.85  ? 8  DA  E C2     3  
ATOM 10792 N N3     . DA  A 1 8  ? 18.427  11.994  3.681   1.00 2.91  ? 8  DA  E N3     3  
ATOM 10793 C C4     . DA  A 1 8  ? 18.714  10.681  3.680   1.00 2.99  ? 8  DA  E C4     3  
ATOM 10794 H "H5'"  . DA  A 1 8  ? 21.139  8.223   7.065   1.00 3.56  ? 8  DA  E "H5'"  3  
ATOM 10795 H "H5''" . DA  A 1 8  ? 21.200  8.110   8.833   1.00 3.77  ? 8  DA  E "H5''" 3  
ATOM 10796 H "H4'"  . DA  A 1 8  ? 20.319  10.133  8.907   1.00 3.54  ? 8  DA  E "H4'"  3  
ATOM 10797 H "H3'"  . DA  A 1 8  ? 18.093  8.705   9.042   1.00 3.65  ? 8  DA  E "H3'"  3  
ATOM 10798 H "H2'"  . DA  A 1 8  ? 17.742  8.360   6.658   1.00 3.41  ? 8  DA  E "H2'"  3  
ATOM 10799 H "H2''" . DA  A 1 8  ? 16.714  9.744   6.987   1.00 3.28  ? 8  DA  E "H2''" 3  
ATOM 10800 H "H1'"  . DA  A 1 8  ? 18.323  11.303  6.164   1.00 3.11  ? 8  DA  E "H1'"  3  
ATOM 10801 H H8     . DA  A 1 8  ? 19.325  7.762   4.903   1.00 3.35  ? 8  DA  E H8     3  
ATOM 10802 H H61    . DA  A 1 8  ? 19.188  8.865   0.131   1.00 3.09  ? 8  DA  E H61    3  
ATOM 10803 H H62    . DA  A 1 8  ? 18.874  10.351  -0.723  1.00 2.98  ? 8  DA  E H62    3  
ATOM 10804 H H2     . DA  A 1 8  ? 18.127  13.523  2.349   1.00 2.82  ? 8  DA  E H2     3  
ATOM 10805 P P      . DC  A 1 9  ? 16.604  10.886  9.787   1.00 3.55  ? 9  DC  E P      3  
ATOM 10806 O OP1    . DC  A 1 9  ? 16.931  10.850  11.235  1.00 3.78  ? 9  DC  E OP1    3  
ATOM 10807 O OP2    . DC  A 1 9  ? 15.599  9.941   9.237   1.00 3.53  ? 9  DC  E OP2    3  
ATOM 10808 O "O5'"  . DC  A 1 9  ? 16.167  12.369  9.404   1.00 3.41  ? 9  DC  E "O5'"  3  
ATOM 10809 C "C5'"  . DC  A 1 9  ? 17.089  13.195  8.683   1.00 3.31  ? 9  DC  E "C5'"  3  
ATOM 10810 C "C4'"  . DC  A 1 9  ? 16.378  14.311  7.955   1.00 3.19  ? 9  DC  E "C4'"  3  
ATOM 10811 O "O4'"  . DC  A 1 9  ? 16.387  14.028  6.534   1.00 3.02  ? 9  DC  E "O4'"  3  
ATOM 10812 C "C3'"  . DC  A 1 9  ? 14.901  14.445  8.314   1.00 3.21  ? 9  DC  E "C3'"  3  
ATOM 10813 O "O3'"  . DC  A 1 9  ? 14.492  15.776  8.005   1.00 3.17  ? 9  DC  E "O3'"  3  
ATOM 10814 C "C2'"  . DC  A 1 9  ? 14.228  13.478  7.360   1.00 3.09  ? 9  DC  E "C2'"  3  
ATOM 10815 C "C1'"  . DC  A 1 9  ? 15.085  13.637  6.111   1.00 2.96  ? 9  DC  E "C1'"  3  
ATOM 10816 N N1     . DC  A 1 9  ? 15.187  12.462  5.224   1.00 2.92  ? 9  DC  E N1     3  
ATOM 10817 C C2     . DC  A 1 9  ? 15.161  12.678  3.837   1.00 2.80  ? 9  DC  E C2     3  
ATOM 10818 O O2     . DC  A 1 9  ? 15.122  13.842  3.408   1.00 2.74  ? 9  DC  E O2     3  
ATOM 10819 N N3     . DC  A 1 9  ? 15.177  11.616  3.000   1.00 2.81  ? 9  DC  E N3     3  
ATOM 10820 C C4     . DC  A 1 9  ? 15.226  10.379  3.495   1.00 2.93  ? 9  DC  E C4     3  
ATOM 10821 N N4     . DC  A 1 9  ? 15.203  9.364   2.626   1.00 2.98  ? 9  DC  E N4     3  
ATOM 10822 C C5     . DC  A 1 9  ? 15.289  10.129  4.902   1.00 3.04  ? 9  DC  E C5     3  
ATOM 10823 C C6     . DC  A 1 9  ? 15.270  11.194  5.722   1.00 3.03  ? 9  DC  E C6     3  
ATOM 10824 H "H5'"  . DC  A 1 9  ? 17.627  12.586  7.957   1.00 3.24  ? 9  DC  E "H5'"  3  
ATOM 10825 H "H5''" . DC  A 1 9  ? 17.806  13.630  9.378   1.00 3.41  ? 9  DC  E "H5''" 3  
ATOM 10826 H "H4'"  . DC  A 1 9  ? 16.863  15.253  8.218   1.00 3.23  ? 9  DC  E "H4'"  3  
ATOM 10827 H "H3'"  . DC  A 1 9  ? 14.706  14.225  9.362   1.00 3.36  ? 9  DC  E "H3'"  3  
ATOM 10828 H "H2'"  . DC  A 1 9  ? 14.255  12.460  7.752   1.00 3.17  ? 9  DC  E "H2'"  3  
ATOM 10829 H "H2''" . DC  A 1 9  ? 13.183  13.735  7.213   1.00 3.06  ? 9  DC  E "H2''" 3  
ATOM 10830 H "H1'"  . DC  A 1 9  ? 14.696  14.464  5.510   1.00 2.89  ? 9  DC  E "H1'"  3  
ATOM 10831 H H41    . DC  A 1 9  ? 15.231  8.411   2.960   1.00 3.10  ? 9  DC  E H41    3  
ATOM 10832 H H42    . DC  A 1 9  ? 15.137  9.547   1.633   1.00 2.94  ? 9  DC  E H42    3  
ATOM 10833 H H5     . DC  A 1 9  ? 15.350  9.114   5.294   1.00 3.17  ? 9  DC  E H5     3  
ATOM 10834 H H6     . DC  A 1 9  ? 15.320  11.040  6.799   1.00 3.15  ? 9  DC  E H6     3  
ATOM 10835 P P      . DA  A 1 10 ? 13.204  16.419  8.705   1.00 3.27  ? 10 DA  E P      3  
ATOM 10836 O OP1    . DA  A 1 10 ? 13.626  17.212  9.886   1.00 3.48  ? 10 DA  E OP1    3  
ATOM 10837 O OP2    . DA  A 1 10 ? 12.181  15.352  8.860   1.00 3.27  ? 10 DA  E OP2    3  
ATOM 10838 O "O5'"  . DA  A 1 10 ? 12.715  17.419  7.565   1.00 3.16  ? 10 DA  E "O5'"  3  
ATOM 10839 C "C5'"  . DA  A 1 10 ? 13.644  17.829  6.558   1.00 3.07  ? 10 DA  E "C5'"  3  
ATOM 10840 C "C4'"  . DA  A 1 10 ? 12.939  18.258  5.291   1.00 2.98  ? 10 DA  E "C4'"  3  
ATOM 10841 O "O4'"  . DA  A 1 10 ? 12.970  17.169  4.335   1.00 2.83  ? 10 DA  E "O4'"  3  
ATOM 10842 C "C3'"  . DA  A 1 10 ? 11.457  18.577  5.451   1.00 3.01  ? 10 DA  E "C3'"  3  
ATOM 10843 O "O3'"  . DA  A 1 10 ? 11.082  19.433  4.375   1.00 3.00  ? 10 DA  E "O3'"  3  
ATOM 10844 C "C2'"  . DA  A 1 10 ? 10.791  17.226  5.283   1.00 2.90  ? 10 DA  E "C2'"  3  
ATOM 10845 C "C1'"  . DA  A 1 10 ? 11.677  16.580  4.225   1.00 2.79  ? 10 DA  E "C1'"  3  
ATOM 10846 N N9     . DA  A 1 10 ? 11.805  15.126  4.298   1.00 2.75  ? 10 DA  E N9     3  
ATOM 10847 C C8     . DA  A 1 10 ? 11.915  14.324  5.401   1.00 2.84  ? 10 DA  E C8     3  
ATOM 10848 N N7     . DA  A 1 10 ? 11.978  13.044  5.119   1.00 2.83  ? 10 DA  E N7     3  
ATOM 10849 C C5     . DA  A 1 10 ? 11.905  13.002  3.735   1.00 2.73  ? 10 DA  E C5     3  
ATOM 10850 C C6     . DA  A 1 10 ? 11.914  11.935  2.809   1.00 2.72  ? 10 DA  E C6     3  
ATOM 10851 N N6     . DA  A 1 10 ? 11.997  10.647  3.153   1.00 2.82  ? 10 DA  E N6     3  
ATOM 10852 N N1     . DA  A 1 10 ? 11.827  12.245  1.497   1.00 2.66  ? 10 DA  E N1     3  
ATOM 10853 C C2     . DA  A 1 10 ? 11.734  13.535  1.146   1.00 2.62  ? 10 DA  E C2     3  
ATOM 10854 N N3     . DA  A 1 10 ? 11.714  14.617  1.919   1.00 2.63  ? 10 DA  E N3     3  
ATOM 10855 C C4     . DA  A 1 10 ? 11.805  14.279  3.217   1.00 2.68  ? 10 DA  E C4     3  
ATOM 10856 H "H5'"  . DA  A 1 10 ? 14.314  17.001  6.326   1.00 3.04  ? 10 DA  E "H5'"  3  
ATOM 10857 H "H5''" . DA  A 1 10 ? 14.235  18.663  6.930   1.00 3.16  ? 10 DA  E "H5''" 3  
ATOM 10858 H "H4'"  . DA  A 1 10 ? 13.422  19.166  4.927   1.00 3.02  ? 10 DA  E "H4'"  3  
ATOM 10859 H "H3'"  . DA  A 1 10 ? 11.234  19.050  6.405   1.00 3.14  ? 10 DA  E "H3'"  3  
ATOM 10860 H "H2'"  . DA  A 1 10 ? 10.795  16.668  6.219   1.00 2.97  ? 10 DA  E "H2'"  3  
ATOM 10861 H "H2''" . DA  A 1 10 ? 9.754   17.335  4.982   1.00 2.88  ? 10 DA  E "H2''" 3  
ATOM 10862 H "H1'"  . DA  A 1 10 ? 11.302  16.829  3.230   1.00 2.74  ? 10 DA  E "H1'"  3  
ATOM 10863 H H8     . DA  A 1 10 ? 11.939  14.712  6.409   1.00 2.94  ? 10 DA  E H8     3  
ATOM 10864 H H61    . DA  A 1 10 ? 12.057  10.392  4.130   1.00 2.90  ? 10 DA  E H61    3  
ATOM 10865 H H62    . DA  A 1 10 ? 11.997  9.930   2.442   1.00 2.85  ? 10 DA  E H62    3  
ATOM 10866 H H2     . DA  A 1 10 ? 11.660  13.725  0.074   1.00 2.61  ? 10 DA  E H2     3  
ATOM 10867 P P      . DA  A 1 11 ? 9.791   20.370  4.483   1.00 3.11  ? 11 DA  E P      3  
ATOM 10868 O OP1    . DA  A 1 11 ? 10.187  21.726  4.940   1.00 3.30  ? 11 DA  E OP1    3  
ATOM 10869 O OP2    . DA  A 1 11 ? 8.739   19.627  5.220   1.00 3.11  ? 11 DA  E OP2    3  
ATOM 10870 O "O5'"  . DA  A 1 11 ? 9.361   20.451  2.952   1.00 3.03  ? 11 DA  E "O5'"  3  
ATOM 10871 C "C5'"  . DA  A 1 11 ? 10.329  20.145  1.947   1.00 2.98  ? 11 DA  E "C5'"  3  
ATOM 10872 C "C4'"  . DA  A 1 11 ? 9.674   19.726  0.650   1.00 2.92  ? 11 DA  E "C4'"  3  
ATOM 10873 O "O4'"  . DA  A 1 11 ? 9.715   18.279  0.547   1.00 2.76  ? 11 DA  E "O4'"  3  
ATOM 10874 C "C3'"  . DA  A 1 11 ? 8.190   20.070  0.543   1.00 2.96  ? 11 DA  E "C3'"  3  
ATOM 10875 O "O3'"  . DA  A 1 11 ? 7.825   20.089  -0.832  1.00 2.99  ? 11 DA  E "O3'"  3  
ATOM 10876 C "C2'"  . DA  A 1 11 ? 7.509   18.884  1.195   1.00 2.84  ? 11 DA  E "C2'"  3  
ATOM 10877 C "C1'"  . DA  A 1 11 ? 8.414   17.739  0.762   1.00 2.71  ? 11 DA  E "C1'"  3  
ATOM 10878 N N9     . DA  A 1 11 ? 8.499   16.612  1.691   1.00 2.64  ? 11 DA  E N9     3  
ATOM 10879 C C8     . DA  A 1 11 ? 8.587   16.622  3.058   1.00 2.69  ? 11 DA  E C8     3  
ATOM 10880 N N7     . DA  A 1 11 ? 8.586   15.425  3.597   1.00 2.67  ? 11 DA  E N7     3  
ATOM 10881 C C5     . DA  A 1 11 ? 8.498   14.567  2.508   1.00 2.60  ? 11 DA  E C5     3  
ATOM 10882 C C6     . DA  A 1 11 ? 8.445   13.160  2.403   1.00 2.60  ? 11 DA  E C6     3  
ATOM 10883 N N6     . DA  A 1 11 ? 8.457   12.331  3.451   1.00 2.67  ? 11 DA  E N6     3  
ATOM 10884 N N1     . DA  A 1 11 ? 8.366   12.626  1.162   1.00 2.59  ? 11 DA  E N1     3  
ATOM 10885 C C2     . DA  A 1 11 ? 8.336   13.454  0.110   1.00 2.58  ? 11 DA  E C2     3  
ATOM 10886 N N3     . DA  A 1 11 ? 8.372   14.785  0.082   1.00 2.58  ? 11 DA  E N3     3  
ATOM 10887 C C4     . DA  A 1 11 ? 8.455   15.286  1.327   1.00 2.59  ? 11 DA  E C4     3  
ATOM 10888 H "H5'"  . DA  A 1 11 ? 10.970  19.336  2.296   1.00 2.95  ? 11 DA  E "H5'"  3  
ATOM 10889 H "H5''" . DA  A 1 11 ? 10.946  21.025  1.761   1.00 3.06  ? 11 DA  E "H5''" 3  
ATOM 10890 H "H4'"  . DA  A 1 11 ? 10.184  20.236  -0.169  1.00 2.98  ? 11 DA  E "H4'"  3  
ATOM 10891 H "H3'"  . DA  A 1 11 ? 7.947   21.021  1.014   1.00 3.09  ? 11 DA  E "H3'"  3  
ATOM 10892 H "H2'"  . DA  A 1 11 ? 7.470   18.994  2.279   1.00 2.88  ? 11 DA  E "H2'"  3  
ATOM 10893 H "H2''" . DA  A 1 11 ? 6.486   18.771  0.838   1.00 2.83  ? 11 DA  E "H2''" 3  
ATOM 10894 H "H1'"  . DA  A 1 11 ? 8.075   17.347  -0.200  1.00 2.69  ? 11 DA  E "H1'"  3  
ATOM 10895 H H8     . DA  A 1 11 ? 8.642   17.531  3.635   1.00 2.77  ? 11 DA  E H8     3  
ATOM 10896 H H61    . DA  A 1 11 ? 8.507   12.702  4.389   1.00 2.73  ? 11 DA  E H61    3  
ATOM 10897 H H62    . DA  A 1 11 ? 8.406   11.332  3.308   1.00 2.71  ? 11 DA  E H62    3  
ATOM 10898 H H2     . DA  A 1 11 ? 8.277   12.968  -0.863  1.00 2.61  ? 11 DA  E H2     3  
ATOM 10899 P P      . DT  A 1 12 ? 6.510   20.860  -1.320  1.00 3.13  ? 12 DT  E P      3  
ATOM 10900 O OP1    . DT  A 1 12 ? 6.879   22.187  -1.874  1.00 3.34  ? 12 DT  E OP1    3  
ATOM 10901 O OP2    . DT  A 1 12 ? 5.483   20.765  -0.252  1.00 3.10  ? 12 DT  E OP2    3  
ATOM 10902 O "O5'"  . DT  A 1 12 ? 6.081   19.916  -2.528  1.00 3.07  ? 12 DT  E "O5'"  3  
ATOM 10903 C "C5'"  . DT  A 1 12 ? 7.020   18.950  -3.008  1.00 2.99  ? 12 DT  E "C5'"  3  
ATOM 10904 C "C4'"  . DT  A 1 12 ? 6.342   17.873  -3.821  1.00 2.96  ? 12 DT  E "C4'"  3  
ATOM 10905 O "O4'"  . DT  A 1 12 ? 6.340   16.638  -3.062  1.00 2.81  ? 12 DT  E "O4'"  3  
ATOM 10906 C "C3'"  . DT  A 1 12 ? 4.870   18.140  -4.117  1.00 3.02  ? 12 DT  E "C3'"  3  
ATOM 10907 O "O3'"  . DT  A 1 12 ? 4.513   17.381  -5.265  1.00 3.08  ? 12 DT  E "O3'"  3  
ATOM 10908 C "C2'"  . DT  A 1 12 ? 4.163   17.574  -2.900  1.00 2.88  ? 12 DT  E "C2'"  3  
ATOM 10909 C "C1'"  . DT  A 1 12 ? 5.027   16.359  -2.585  1.00 2.76  ? 12 DT  E "C1'"  3  
ATOM 10910 N N1     . DT  A 1 12 ? 5.096   15.930  -1.166  1.00 2.66  ? 12 DT  E N1     3  
ATOM 10911 C C2     . DT  A 1 12 ? 5.118   14.567  -0.942  1.00 2.61  ? 12 DT  E C2     3  
ATOM 10912 O O2     . DT  A 1 12 ? 5.137   13.746  -1.845  1.00 2.63  ? 12 DT  E O2     3  
ATOM 10913 N N3     . DT  A 1 12 ? 5.115   14.198  0.375   1.00 2.58  ? 12 DT  E N3     3  
ATOM 10914 C C4     . DT  A 1 12 ? 5.103   15.030  1.472   1.00 2.61  ? 12 DT  E C4     3  
ATOM 10915 O O4     . DT  A 1 12 ? 5.089   14.545  2.603   1.00 2.64  ? 12 DT  E O4     3  
ATOM 10916 C C5     . DT  A 1 12 ? 5.100   16.448  1.172   1.00 2.67  ? 12 DT  E C5     3  
ATOM 10917 C C7     . DT  A 1 12 ? 5.043   17.422  2.308   1.00 2.76  ? 12 DT  E C7     3  
ATOM 10918 C C6     . DT  A 1 12 ? 5.105   16.831  -0.119  1.00 2.69  ? 12 DT  E C6     3  
ATOM 10919 H "H5'"  . DT  A 1 12 ? 7.526   18.487  -2.160  1.00 2.89  ? 12 DT  E "H5'"  3  
ATOM 10920 H "H5''" . DT  A 1 12 ? 7.762   19.446  -3.633  1.00 3.09  ? 12 DT  E "H5''" 3  
ATOM 10921 H "H4'"  . DT  A 1 12 ? 6.857   17.795  -4.780  1.00 3.04  ? 12 DT  E "H4'"  3  
ATOM 10922 H "H3'"  . DT  A 1 12 ? 4.661   19.196  -4.284  1.00 3.14  ? 12 DT  E "H3'"  3  
ATOM 10923 H "H2'"  . DT  A 1 12 ? 4.145   18.294  -2.082  1.00 2.90  ? 12 DT  E "H2'"  3  
ATOM 10924 H "H2''" . DT  A 1 12 ? 3.131   17.311  -3.129  1.00 2.89  ? 12 DT  E "H2''" 3  
ATOM 10925 H "H1'"  . DT  A 1 12 ? 4.668   15.504  -3.164  1.00 2.77  ? 12 DT  E "H1'"  3  
ATOM 10926 H H3     . DT  A 1 12 ? 5.102   13.204  0.564   1.00 2.58  ? 12 DT  E H3     3  
ATOM 10927 H H71    . DT  A 1 12 ? 4.286   17.102  3.025   1.00 2.87  ? 12 DT  E H71    3  
ATOM 10928 H H72    . DT  A 1 12 ? 6.013   17.464  2.800   1.00 3.10  ? 12 DT  E H72    3  
ATOM 10929 H H73    . DT  A 1 12 ? 4.786   18.411  1.928   1.00 2.88  ? 12 DT  E H73    3  
ATOM 10930 H H6     . DT  A 1 12 ? 5.117   17.894  -0.348  1.00 2.78  ? 12 DT  E H6     3  
ATOM 10931 P P      . DT  A 1 13 ? 3.252   17.787  -6.159  1.00 3.22  ? 13 DT  E P      3  
ATOM 10932 O OP1    . DT  A 1 13 ? 3.704   18.581  -7.329  1.00 3.44  ? 13 DT  E OP1    3  
ATOM 10933 O OP2    . DT  A 1 13 ? 2.194   18.326  -5.267  1.00 3.18  ? 13 DT  E OP2    3  
ATOM 10934 O "O5'"  . DT  A 1 13 ? 2.809   16.346  -6.666  1.00 3.19  ? 13 DT  E "O5'"  3  
ATOM 10935 C "C5'"  . DT  A 1 13 ? 3.710   15.251  -6.489  1.00 3.11  ? 13 DT  E "C5'"  3  
ATOM 10936 C "C4'"  . DT  A 1 13 ? 2.976   13.932  -6.426  1.00 3.08  ? 13 DT  E "C4'"  3  
ATOM 10937 O "O4'"  . DT  A 1 13 ? 2.895   13.500  -5.047  1.00 2.92  ? 13 DT  E "O4'"  3  
ATOM 10938 C "C3'"  . DT  A 1 13 ? 1.526   14.006  -6.892  1.00 3.14  ? 13 DT  E "C3'"  3  
ATOM 10939 O "O3'"  . DT  A 1 13 ? 1.136   12.690  -7.279  1.00 3.18  ? 13 DT  E "O3'"  3  
ATOM 10940 C "C2'"  . DT  A 1 13 ? 0.778   14.410  -5.634  1.00 3.02  ? 13 DT  E "C2'"  3  
ATOM 10941 C "C1'"  . DT  A 1 13 ? 1.565   13.657  -4.568  1.00 2.89  ? 13 DT  E "C1'"  3  
ATOM 10942 N N1     . DT  A 1 13 ? 1.600   14.242  -3.211  1.00 2.79  ? 13 DT  E N1     3  
ATOM 10943 C C2     . DT  A 1 13 ? 1.720   13.351  -2.165  1.00 2.73  ? 13 DT  E C2     3  
ATOM 10944 O O2     . DT  A 1 13 ? 1.857   12.148  -2.326  1.00 2.75  ? 13 DT  E O2     3  
ATOM 10945 N N3     . DT  A 1 13 ? 1.675   13.913  -0.920  1.00 2.69  ? 13 DT  E N3     3  
ATOM 10946 C C4     . DT  A 1 13 ? 1.536   15.246  -0.615  1.00 2.72  ? 13 DT  E C4     3  
ATOM 10947 O O4     . DT  A 1 13 ? 1.473   15.598  0.565   1.00 2.73  ? 13 DT  E O4     3  
ATOM 10948 C C5     . DT  A 1 13 ? 1.440   16.133  -1.755  1.00 2.79  ? 13 DT  E C5     3  
ATOM 10949 C C7     . DT  A 1 13 ? 1.260   17.598  -1.515  1.00 2.87  ? 13 DT  E C7     3  
ATOM 10950 C C6     . DT  A 1 13 ? 1.484   15.598  -2.986  1.00 2.82  ? 13 DT  E C6     3  
ATOM 10951 H "H5'"  . DT  A 1 13 ? 4.268   15.388  -5.562  1.00 3.03  ? 13 DT  E "H5'"  3  
ATOM 10952 H "H5''" . DT  A 1 13 ? 4.412   15.222  -7.321  1.00 3.20  ? 13 DT  E "H5''" 3  
ATOM 10953 H "H4'"  . DT  A 1 13 ? 3.490   13.224  -7.078  1.00 3.15  ? 13 DT  E "H4'"  3  
ATOM 10954 H "H3'"  . DT  A 1 13 ? 1.387   14.699  -7.719  1.00 3.26  ? 13 DT  E "H3'"  3  
ATOM 10955 H "H2'"  . DT  A 1 13 ? 0.818   15.489  -5.490  1.00 3.04  ? 13 DT  E "H2'"  3  
ATOM 10956 H "H2''" . DT  A 1 13 ? -0.272  14.135  -5.695  1.00 3.03  ? 13 DT  E "H2''" 3  
ATOM 10957 H "H1'"  . DT  A 1 13 ? 1.158   12.646  -4.471  1.00 2.88  ? 13 DT  E "H1'"  3  
ATOM 10958 H H3     . DT  A 1 13 ? 1.726   13.277  -0.136  1.00 2.67  ? 13 DT  E H3     3  
ATOM 10959 H H71    . DT  A 1 13 ? 2.057   17.959  -0.864  1.00 3.45  ? 13 DT  E H71    3  
ATOM 10960 H H72    . DT  A 1 13 ? 1.298   18.130  -2.465  1.00 2.94  ? 13 DT  E H72    3  
ATOM 10961 H H73    . DT  A 1 13 ? 0.295   17.770  -1.037  1.00 2.79  ? 13 DT  E H73    3  
ATOM 10962 H H6     . DT  A 1 13 ? 1.428   16.265  -3.845  1.00 2.91  ? 13 DT  E H6     3  
ATOM 10963 P P      . DA  A 1 14 ? -0.057  12.462  -8.317  1.00 3.32  ? 14 DA  E P      3  
ATOM 10964 O OP1    . DA  A 1 14 ? 0.465   12.482  -9.705  1.00 3.54  ? 14 DA  E OP1    3  
ATOM 10965 O OP2    . DA  A 1 14 ? -1.186  13.350  -7.941  1.00 3.28  ? 14 DA  E OP2    3  
ATOM 10966 O "O5'"  . DA  A 1 14 ? -0.468  10.962  -7.970  1.00 3.29  ? 14 DA  E "O5'"  3  
ATOM 10967 C "C5'"  . DA  A 1 14 ? 0.481   10.118  -7.315  1.00 3.23  ? 14 DA  E "C5'"  3  
ATOM 10968 C "C4'"  . DA  A 1 14 ? -0.202  9.044   -6.500  1.00 3.17  ? 14 DA  E "C4'"  3  
ATOM 10969 O "O4'"  . DA  A 1 14 ? -0.172  9.424   -5.101  1.00 2.99  ? 14 DA  E "O4'"  3  
ATOM 10970 C "C3'"  . DA  A 1 14 ? -1.685  8.851   -6.804  1.00 3.24  ? 14 DA  E "C3'"  3  
ATOM 10971 O "O3'"  . DA  A 1 14 ? -2.069  7.553   -6.368  1.00 3.27  ? 14 DA  E "O3'"  3  
ATOM 10972 C "C2'"  . DA  A 1 14 ? -2.364  9.867   -5.908  1.00 3.08  ? 14 DA  E "C2'"  3  
ATOM 10973 C "C1'"  . DA  A 1 14 ? -1.473  9.828   -4.676  1.00 2.94  ? 14 DA  E "C1'"  3  
ATOM 10974 N N9     . DA  A 1 14 ? -1.380  11.081  -3.925  1.00 2.83  ? 14 DA  E N9     3  
ATOM 10975 C C8     . DA  A 1 14 ? -1.246  12.362  -4.385  1.00 2.86  ? 14 DA  E C8     3  
ATOM 10976 N N7     . DA  A 1 14 ? -1.252  13.270  -3.435  1.00 2.79  ? 14 DA  E N7     3  
ATOM 10977 C C5     . DA  A 1 14 ? -1.393  12.529  -2.269  1.00 2.69  ? 14 DA  E C5     3  
ATOM 10978 C C6     . DA  A 1 14 ? -1.475  12.899  -0.909  1.00 2.63  ? 14 DA  E C6     3  
ATOM 10979 N N6     . DA  A 1 14 ? -1.445  14.162  -0.475  1.00 2.65  ? 14 DA  E N6     3  
ATOM 10980 N N1     . DA  A 1 14 ? -1.604  11.908  0.002   1.00 2.61  ? 14 DA  E N1     3  
ATOM 10981 C C2     . DA  A 1 14 ? -1.655  10.642  -0.430  1.00 2.64  ? 14 DA  E C2     3  
ATOM 10982 N N3     . DA  A 1 14 ? -1.594  10.173  -1.674  1.00 2.70  ? 14 DA  E N3     3  
ATOM 10983 C C4     . DA  A 1 14 ? -1.460  11.180  -2.556  1.00 2.72  ? 14 DA  E C4     3  
ATOM 10984 H "H5'"  . DA  A 1 14 ? 1.103   10.722  -6.653  1.00 3.10  ? 14 DA  E "H5'"  3  
ATOM 10985 H "H5''" . DA  A 1 14 ? 1.119   9.642   -8.060  1.00 3.37  ? 14 DA  E "H5''" 3  
ATOM 10986 H "H4'"  . DA  A 1 14 ? 0.297   8.095   -6.703  1.00 3.26  ? 14 DA  E "H4'"  3  
ATOM 10987 H "H3'"  . DA  A 1 14 ? -1.919  8.980   -7.860  1.00 3.37  ? 14 DA  E "H3'"  3  
ATOM 10988 H "H2'"  . DA  A 1 14 ? -2.385  10.851  -6.374  1.00 3.11  ? 14 DA  E "H2'"  3  
ATOM 10989 H "H2''" . DA  A 1 14 ? -3.394  9.582   -5.700  1.00 3.09  ? 14 DA  E "H2''" 3  
ATOM 10990 H "H1'"  . DA  A 1 14 ? -1.833  9.059   -3.988  1.00 2.93  ? 14 DA  E "H1'"  3  
ATOM 10991 H H8     . DA  A 1 14 ? -1.145  12.604  -5.432  1.00 2.98  ? 14 DA  E H8     3  
ATOM 10992 H H61    . DA  A 1 14 ? -1.356  14.923  -1.135  1.00 2.71  ? 14 DA  E H61    3  
ATOM 10993 H H62    . DA  A 1 14 ? -1.524  14.363  0.514   1.00 2.65  ? 14 DA  E H62    3  
ATOM 10994 H H2     . DA  A 1 14 ? -1.763  9.886   0.350   1.00 2.67  ? 14 DA  E H2     3  
ATOM 10995 P P      . DT  A 1 15 ? -3.394  6.860   -6.934  1.00 3.41  ? 15 DT  E P      3  
ATOM 10996 O OP1    . DT  A 1 15 ? -3.038  5.933   -8.039  1.00 3.62  ? 15 DT  E OP1    3  
ATOM 10997 O OP2    . DT  A 1 15 ? -4.423  7.906   -7.156  1.00 3.38  ? 15 DT  E OP2    3  
ATOM 10998 O "O5'"  . DT  A 1 15 ? -3.821  5.999   -5.666  1.00 3.36  ? 15 DT  E "O5'"  3  
ATOM 10999 C "C5'"  . DT  A 1 15 ? -2.889  5.852   -4.592  1.00 3.28  ? 15 DT  E "C5'"  3  
ATOM 11000 C "C4'"  . DT  A 1 15 ? -3.579  5.459   -3.306  1.00 3.23  ? 15 DT  E "C4'"  3  
ATOM 11001 O "O4'"  . DT  A 1 15 ? -3.589  6.597   -2.409  1.00 3.05  ? 15 DT  E "O4'"  3  
ATOM 11002 C "C3'"  . DT  A 1 15 ? -5.052  5.093   -3.474  1.00 3.30  ? 15 DT  E "C3'"  3  
ATOM 11003 O "O3'"  . DT  A 1 15 ? -5.440  4.297   -2.361  1.00 3.35  ? 15 DT  E "O3'"  3  
ATOM 11004 C "C2'"  . DT  A 1 15 ? -5.758  6.430   -3.369  1.00 3.15  ? 15 DT  E "C2'"  3  
ATOM 11005 C "C1'"  . DT  A 1 15 ? -4.904  7.137   -2.326  1.00 3.01  ? 15 DT  E "C1'"  3  
ATOM 11006 N N1     . DT  A 1 15 ? -4.844  8.613   -2.399  1.00 2.88  ? 15 DT  E N1     3  
ATOM 11007 C C2     . DT  A 1 15 ? -4.874  9.278   -1.191  1.00 2.79  ? 15 DT  E C2     3  
ATOM 11008 O O2     . DT  A 1 15 ? -4.884  8.704   -0.114  1.00 2.81  ? 15 DT  E O2     3  
ATOM 11009 N N3     . DT  A 1 15 ? -4.895  10.642  -1.284  1.00 2.73  ? 15 DT  E N3     3  
ATOM 11010 C C4     . DT  A 1 15 ? -4.880  11.398  -2.432  1.00 2.76  ? 15 DT  E C4     3  
ATOM 11011 O O4     . DT  A 1 15 ? -4.952  12.625  -2.354  1.00 2.75  ? 15 DT  E O4     3  
ATOM 11012 C C5     . DT  A 1 15 ? -4.822  10.642  -3.669  1.00 2.86  ? 15 DT  E C5     3  
ATOM 11013 C C7     . DT  A 1 15 ? -4.853  11.387  -4.968  1.00 2.97  ? 15 DT  E C7     3  
ATOM 11014 C C6     . DT  A 1 15 ? -4.798  9.299   -3.596  1.00 2.92  ? 15 DT  E C6     3  
ATOM 11015 H "H5'"  . DT  A 1 15 ? -2.366  6.795   -4.439  1.00 3.17  ? 15 DT  E "H5'"  3  
ATOM 11016 H "H5''" . DT  A 1 15 ? -2.160  5.083   -4.849  1.00 3.38  ? 15 DT  E "H5''" 3  
ATOM 11017 H "H4'"  . DT  A 1 15 ? -3.070  4.583   -2.898  1.00 3.32  ? 15 DT  E "H4'"  3  
ATOM 11018 H "H3'"  . DT  A 1 15 ? -5.252  4.568   -4.405  1.00 3.42  ? 15 DT  E "H3'"  3  
ATOM 11019 H "H2'"  . DT  A 1 15 ? -5.760  6.953   -4.327  1.00 3.16  ? 15 DT  E "H2'"  3  
ATOM 11020 H "H2''" . DT  A 1 15 ? -6.793  6.306   -3.061  1.00 3.15  ? 15 DT  E "H2''" 3  
ATOM 11021 H "H1'"  . DT  A 1 15 ? -5.275  6.880   -1.330  1.00 3.00  ? 15 DT  E "H1'"  3  
ATOM 11022 H H3     . DT  A 1 15 ? -4.942  11.146  -0.409  1.00 2.69  ? 15 DT  E H3     3  
ATOM 11023 H H71    . DT  A 1 15 ? -5.574  12.203  -4.900  1.00 3.26  ? 15 DT  E H71    3  
ATOM 11024 H H72    . DT  A 1 15 ? -5.144  10.709  -5.770  1.00 3.18  ? 15 DT  E H72    3  
ATOM 11025 H H73    . DT  A 1 15 ? -3.866  11.794  -5.178  1.00 2.91  ? 15 DT  E H73    3  
ATOM 11026 H H6     . DT  A 1 15 ? -4.733  8.727   -4.521  1.00 3.03  ? 15 DT  E H6     3  
ATOM 11027 P P      . DT  A 1 16 ? -6.723  3.345   -2.437  1.00 3.49  ? 16 DT  E P      3  
ATOM 11028 O OP1    . DT  A 1 16 ? -6.289  1.948   -2.695  1.00 3.70  ? 16 DT  E OP1    3  
ATOM 11029 O OP2    . DT  A 1 16 ? -7.740  3.969   -3.318  1.00 3.45  ? 16 DT  E OP2    3  
ATOM 11030 O "O5'"  . DT  A 1 16 ? -7.212  3.437   -0.926  1.00 3.44  ? 16 DT  E "O5'"  3  
ATOM 11031 C "C5'"  . DT  A 1 16 ? -6.325  4.004   0.040   1.00 3.36  ? 16 DT  E "C5'"  3  
ATOM 11032 C "C4'"  . DT  A 1 16 ? -7.067  4.488   1.262   1.00 3.31  ? 16 DT  E "C4'"  3  
ATOM 11033 O "O4'"  . DT  A 1 16 ? -7.123  5.937   1.242   1.00 3.14  ? 16 DT  E "O4'"  3  
ATOM 11034 C "C3'"  . DT  A 1 16 ? -8.529  4.056   1.335   1.00 3.39  ? 16 DT  E "C3'"  3  
ATOM 11035 O "O3'"  . DT  A 1 16 ? -8.913  4.114   2.705   1.00 3.44  ? 16 DT  E "O3'"  3  
ATOM 11036 C "C2'"  . DT  A 1 16 ? -9.252  5.136   0.551   1.00 3.26  ? 16 DT  E "C2'"  3  
ATOM 11037 C "C1'"  . DT  A 1 16 ? -8.442  6.372   0.927   1.00 3.11  ? 16 DT  E "C1'"  3  
ATOM 11038 N N1     . DT  A 1 16 ? -8.376  7.471   -0.068  1.00 3.01  ? 16 DT  E N1     3  
ATOM 11039 C C2     . DT  A 1 16 ? -8.373  8.753   0.446   1.00 2.92  ? 16 DT  E C2     3  
ATOM 11040 O O2     . DT  A 1 16 ? -8.370  8.990   1.643   1.00 2.93  ? 16 DT  E O2     3  
ATOM 11041 N N3     . DT  A 1 16 ? -8.376  9.750   -0.491  1.00 2.87  ? 16 DT  E N3     3  
ATOM 11042 C C4     . DT  A 1 16 ? -8.370  9.607   -1.861  1.00 2.90  ? 16 DT  E C4     3  
ATOM 11043 O O4     . DT  A 1 16 ? -8.399  10.607  -2.578  1.00 2.90  ? 16 DT  E O4     3  
ATOM 11044 C C5     . DT  A 1 16 ? -8.352  8.236   -2.337  1.00 2.99  ? 16 DT  E C5     3  
ATOM 11045 C C7     . DT  A 1 16 ? -8.381  7.984   -3.813  1.00 3.08  ? 16 DT  E C7     3  
ATOM 11046 C C6     . DT  A 1 16 ? -8.349  7.243   -1.429  1.00 3.04  ? 16 DT  E C6     3  
ATOM 11047 H "H5'"  . DT  A 1 16 ? -5.795  4.846   -0.408  1.00 3.25  ? 16 DT  E "H5'"  3  
ATOM 11048 H "H5''" . DT  A 1 16 ? -5.597  3.255   0.347   1.00 3.46  ? 16 DT  E "H5''" 3  
ATOM 11049 H "H4'"  . DT  A 1 16 ? -6.568  4.084   2.145   1.00 3.38  ? 16 DT  E "H4'"  3  
ATOM 11050 H "H3'"  . DT  A 1 16 ? -8.688  3.052   0.941   1.00 3.52  ? 16 DT  E "H3'"  3  
ATOM 11051 H "H2'"  . DT  A 1 16 ? -9.221  4.931   -0.519  1.00 3.28  ? 16 DT  E "H2'"  3  
ATOM 11052 H "H2''" . DT  A 1 16 ? -10.300 5.200   0.839   1.00 3.27  ? 16 DT  E "H2''" 3  
ATOM 11053 H "H1'"  . DT  A 1 16 ? -8.849  6.798   1.848   1.00 3.10  ? 16 DT  E "H1'"  3  
ATOM 11054 H H3     . DT  A 1 16 ? -8.406  10.693  -0.128  1.00 2.84  ? 16 DT  E H3     3  
ATOM 11055 H H71    . DT  A 1 16 ? -7.440  8.308   -4.257  1.00 3.29  ? 16 DT  E H71    3  
ATOM 11056 H H72    . DT  A 1 16 ? -8.524  6.919   -3.998  1.00 3.10  ? 16 DT  E H72    3  
ATOM 11057 H H73    . DT  A 1 16 ? -9.204  8.542   -4.261  1.00 3.40  ? 16 DT  E H73    3  
ATOM 11058 H H6     . DT  A 1 16 ? -8.323  6.213   -1.782  1.00 3.13  ? 16 DT  E H6     3  
ATOM 11059 P P      . DG  A 1 17 ? -10.142 3.253   3.253   1.00 3.61  ? 17 DG  E P      3  
ATOM 11060 O OP1    . DG  A 1 17 ? -9.645  1.985   3.842   1.00 3.84  ? 17 DG  E OP1    3  
ATOM 11061 O OP2    . DG  A 1 17 ? -11.209 3.222   2.221   1.00 3.56  ? 17 DG  E OP2    3  
ATOM 11062 O "O5'"  . DG  A 1 17 ? -10.616 4.177   4.457   1.00 3.57  ? 17 DG  E "O5'"  3  
ATOM 11063 C "C5'"  . DG  A 1 17 ? -9.687  5.107   5.019   1.00 3.50  ? 17 DG  E "C5'"  3  
ATOM 11064 C "C4'"  . DG  A 1 17 ? -10.397 6.199   5.782   1.00 3.48  ? 17 DG  E "C4'"  3  
ATOM 11065 O "O4'"  . DG  A 1 17 ? -10.363 7.421   5.001   1.00 3.30  ? 17 DG  E "O4'"  3  
ATOM 11066 C "C3'"  . DG  A 1 17 ? -11.881 5.931   6.004   1.00 3.57  ? 17 DG  E "C3'"  3  
ATOM 11067 O "O3'"  . DG  A 1 17 ? -12.303 6.717   7.110   1.00 3.64  ? 17 DG  E "O3'"  3  
ATOM 11068 C "C2'"  . DG  A 1 17 ? -12.529 6.473   4.745   1.00 3.42  ? 17 DG  E "C2'"  3  
ATOM 11069 C "C1'"  . DG  A 1 17 ? -11.655 7.685   4.461   1.00 3.27  ? 17 DG  E "C1'"  3  
ATOM 11070 N N9     . DG  A 1 17 ? -11.528 8.068   3.059   1.00 3.14  ? 17 DG  E N9     3  
ATOM 11071 C C8     . DG  A 1 17 ? -11.364 7.256   1.967   1.00 3.13  ? 17 DG  E C8     3  
ATOM 11072 N N7     . DG  A 1 17 ? -11.343 7.911   0.836   1.00 3.04  ? 17 DG  E N7     3  
ATOM 11073 C C5     . DG  A 1 17 ? -11.495 9.241   1.208   1.00 2.98  ? 17 DG  E C5     3  
ATOM 11074 C C6     . DG  A 1 17 ? -11.555 10.428  0.418   1.00 2.92  ? 17 DG  E C6     3  
ATOM 11075 O O6     . DG  A 1 17 ? -11.485 10.544  -0.810  1.00 2.91  ? 17 DG  E O6     3  
ATOM 11076 N N1     . DG  A 1 17 ? -11.717 11.563  1.208   1.00 2.93  ? 17 DG  E N1     3  
ATOM 11077 C C2     . DG  A 1 17 ? -11.808 11.562  2.578   1.00 2.99  ? 17 DG  E C2     3  
ATOM 11078 N N2     . DG  A 1 17 ? -11.961 12.761  3.165   1.00 3.04  ? 17 DG  E N2     3  
ATOM 11079 N N3     . DG  A 1 17 ? -11.754 10.470  3.323   1.00 3.05  ? 17 DG  E N3     3  
ATOM 11080 C C4     . DG  A 1 17 ? -11.599 9.354   2.577   1.00 3.04  ? 17 DG  E C4     3  
ATOM 11081 H "H5'"  . DG  A 1 17 ? -9.097  5.558   4.222   1.00 3.39  ? 17 DG  E "H5'"  3  
ATOM 11082 H "H5''" . DG  A 1 17 ? -9.016  4.583   5.699   1.00 3.59  ? 17 DG  E "H5''" 3  
ATOM 11083 H "H4'"  . DG  A 1 17 ? -9.930  6.292   6.765   1.00 3.57  ? 17 DG  E "H4'"  3  
ATOM 11084 H "H3'"