#   2R5Y 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.351 
PDB   2R5Y         pdb_00002r5y 10.2210/pdb2r5y/pdb 
NDB   PD1071       ?            ?                   
RCSB  RCSB044466   ?            ?                   
WWPDB D_1000044466 ?            ?                   
PDB 1B8I 'Structure of the homeotic UBX/EXD/DNA ternary complex'                          unspecified 
PDB 2R5Z 'Structure of Scr/Exd complex bound to a DNA sequence derived from the fkh gene' unspecified 
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.entry_id                        2R5Y 
_pdbx_database_status.recvd_initial_deposition_date   2007-09-04 
_pdbx_database_status.deposit_site                    RCSB 
_pdbx_database_status.process_site                    RCSB 
_pdbx_database_status.status_code_sf                  REL 
_pdbx_database_status.status_code_mr                  ? 
_pdbx_database_status.SG_entry                        ? 
_pdbx_database_status.pdb_format_compatible           Y 
_pdbx_database_status.status_code_cs                  ? 
_pdbx_database_status.status_code_nmr_data            ? 
_pdbx_database_status.methods_development_category    ? 
'Aggarwal, A.K.' 1 
'Passner, J.M.'  2 
'Jain, R.'       3 
#                        primary 
_citation.title                     'Functional specificity of a Hox protein mediated by the recognition of minor groove structure' 
_citation.journal_abbrev            'Cell(Cambridge,Mass.)' 
_citation.journal_volume            131 
_citation.page_first                530 
_citation.page_last                 543 
_citation.year                      2007 
_citation.journal_id_ASTM           CELLB5                   US 
_citation.journal_id_ISSN           0092-8674 
_citation.journal_id_CSD            0998 
_citation.book_publisher            ? 
_citation.pdbx_database_id_PubMed   17981120 
_citation.pdbx_database_id_DOI      10.1016/j.cell.2007.09.024 
primary 'Joshi, R.'       1  ? 
primary 'Passner, J.M.'   2  ? 
primary 'Rohs, R.'        3  ? 
primary 'Jain, R.'        4  ? 
primary 'Sosinsky, A.'    5  ? 
primary 'Crickmore, M.A.' 6  ? 
primary 'Jacob, V.'       7  ? 
primary 'Aggarwal, A.K.'  8  ? 
primary 'Honig, B.'       9  ? 
primary 'Mann, R.S.'      10 ? 
_cell.entry_id           2R5Y 
_cell.length_a           65.310 
_cell.length_b           65.310 
_cell.length_c           200.300 
_cell.angle_alpha        90.00 
_cell.angle_beta         90.00 
_cell.angle_gamma        90.00 
_cell.Z_PDB              8 
_cell.pdbx_unique_axis   ? 
_cell.length_a_esd       ? 
_cell.length_b_esd       ? 
_cell.length_c_esd       ? 
_cell.angle_alpha_esd    ? 
_cell.angle_beta_esd     ? 
_cell.angle_gamma_esd    ? 
_symmetry.entry_id                         2R5Y 
_symmetry.space_group_name_H-M             'P 43 21 2' 
_symmetry.pdbx_full_space_group_name_H-M   ? 
_symmetry.cell_setting                     ? 
_symmetry.Int_Tables_number                96 
_symmetry.space_group_name_Hall            ? 
1 polymer syn 
6154.987  1   ? ? ?                                       ? 
2 polymer syn 
6110.995  1   ? ? ?                                       ? 
3 polymer man 'Homeotic protein Sex combs reduced'                                                             10967.711 1   ? ? 
'Homeobox DNA-binding domain'           ? 
4 polymer man 'Homeobox protein extradenticle'                                                                 7553.561  1   ? ? 
'Homeobox TALE-type DNA-binding domain' ? 
5 water   nat water                                                                                            18.015    103 ? ? ? 
_entity_name_com.entity_id   4        Dpbx 
1 polydeoxyribonucleotide no no '(DA)(DC)(DT)(DC)(DT)(DA)(DT)(DG)(DA)(DT)(DT)(DT)(DA)(DT)(DG)(DG)(DG)(DC)(DT)(DG)'          
ACTCTATGATTTATGGGCTG                                                                        C ? 
2 polydeoxyribonucleotide no no '(DT)(DC)(DA)(DG)(DC)(DC)(DC)(DA)(DT)(DA)(DA)(DA)(DT)(DC)(DA)(DT)(DA)(DG)(DA)(DG)'          
TCAGCCCATAAATCATAGAG                                                                        D ? 
3 'polypeptide(L)'        no no 
A ? 
1 1  DA  n 
1 2  DC  n 
1 3  DT  n 
1 4  DC  n 
1 5  DT  n 
1 6  DA  n 
1 7  DT  n 
1 8  DG  n 
1 9  DA  n 
1 10 DT  n 
1 11 DT  n 
1 12 DT  n 
1 13 DA  n 
1 14 DT  n 
1 15 DG  n 
1 16 DG  n 
1 17 DG  n 
1 18 DC  n 
1 19 DT  n 
1 20 DG  n 
2 1  DT  n 
2 2  DC  n 
2 3  DA  n 
2 4  DG  n 
2 5  DC  n 
2 6  DC  n 
2 7  DC  n 
2 8  DA  n 
2 9  DT  n 
2 10 DA  n 
2 11 DA  n 
2 12 DA  n 
2 13 DT  n 
2 14 DC  n 
2 15 DA  n 
2 16 DT  n 
2 17 DA  n 
2 18 DG  n 
2 19 DA  n 
2 20 DG  n 
3 1  GLY n 
3 2  LYS n 
3 3  LYS n 
3 4  ASN n 
3 5  PRO n 
3 6  PRO n 
3 7  GLN n 
3 8  ILE n 
3 9  TYR n 
3 10 PRO n 
3 11 TRP n 
3 12 MET n 
3 13 LYS n 
3 14 ARG n 
3 15 VAL n 
3 16 HIS n 
3 17 LEU n 
3 18 GLY n 
3 19 THR n 
3 20 SER n 
3 21 THR n 
3 22 VAL n 
3 23 ASN n 
3 24 ALA n 
3 25 ASN n 
3 26 GLY n 
3 27 GLU n 
3 28 THR n 
3 29 LYS n 
3 30 ARG n 
3 31 GLN n 
3 32 ARG n 
3 33 THR n 
3 34 SER n 
3 35 TYR n 
3 36 THR n 
3 37 ARG n 
3 38 TYR n 
3 39 GLN n 
3 40 THR n 
3 41 LEU n 
3 42 GLU n 
3 43 LEU n 
3 44 GLU n 
3 45 LYS n 
3 46 GLU n 
3 47 PHE n 
3 48 HIS n 
3 49 PHE n 
3 50 ASN n 
3 51 ARG n 
3 52 TYR n 
3 53 LEU n 
3 54 THR n 
3 55 ARG n 
3 56 ARG n 
3 57 ARG n 
3 58 ARG n 
3 59 ILE n 
3 60 GLU n 
3 61 ILE n 
3 62 ALA n 
3 63 HIS n 
3 64 ALA n 
3 65 LEU n 
3 66 SER n 
3 67 LEU n 
3 68 THR n 
3 69 GLU n 
3 70 ARG n 
3 71 GLN n 
3 72 ILE n 
3 73 LYS n 
3 74 ILE n 
3 75 TRP n 
3 76 PHE n 
3 77 GLN n 
3 78 ASN n 
3 79 ARG n 
3 80 ARG n 
3 81 MET n 
3 82 LYS n 
3 83 TRP n 
3 84 LYS n 
3 85 LYS n 
3 86 GLU n 
3 87 HIS n 
3 88 LYS n 
4 1  ALA n 
4 2  ARG n 
4 3  ARG n 
4 4  LYS n 
4 5  ARG n 
4 6  ARG n 
4 7  ASN n 
4 8  PHE n 
4 9  SER n 
4 10 LYS n 
4 11 GLN n 
4 12 ALA n 
4 13 SER n 
4 14 GLU n 
4 15 ILE n 
4 16 LEU n 
4 17 ASN n 
4 18 GLU n 
4 19 TYR n 
4 20 PHE n 
4 21 TYR n 
4 22 SER n 
4 23 HIS n 
4 24 LEU n 
4 25 SER n 
4 26 ASN n 
4 27 PRO n 
4 28 TYR n 
4 29 PRO n 
4 30 SER n 
4 31 GLU n 
4 32 GLU n 
4 33 ALA n 
4 34 LYS n 
4 35 GLU n 
4 36 GLU n 
4 37 LEU n 
4 38 ALA n 
4 39 ARG n 
4 40 LYS n 
4 41 CYS n 
4 42 GLY n 
4 43 ILE n 
4 44 THR n 
4 45 VAL n 
4 46 SER n 
4 47 GLN n 
4 48 VAL n 
4 49 SER n 
4 50 ASN n 
4 51 TRP n 
4 52 PHE n 
4 53 GLY n 
4 54 ASN n 
4 55 LYS n 
4 56 ARG n 
4 57 ILE n 
4 58 ARG n 
4 59 TYR n 
4 60 LYS n 
4 61 LYS n 
4 62 ASN n 
4 63 ILE n 
3 1 sample ? ? ? 'fruit fly' Drosophila Scr ? ? ? ? ? ? 'Drosophila melanogaster' 7227 ? ? ? ? ? ? ? ? 'Escherichia coli' 562 
Escherichia ? ? ? ? ? 'BL21(DE3)pLysS' ? ? ? ? ? ? ? plasmid ? ? ? pET-3A ? ? 
4 1 sample ? ? ? 'fruit fly' Drosophila exd ? ? ? ? ? ? 'Drosophila melanogaster' 7227 ? ? ? ? ? ? ? ? 'Escherichia coli' 562 
Escherichia ? ? ? ? ? 'Bl21(DE3)pLysS' ? ? ? ? ? ? ? plasmid ? ? ? pET-3A ? ? 
1 1 sample ? ? 'synthetic construct' ? 32630 ? 
2 1 sample ? ? 'synthetic construct' ? 32630 ? 
1 UNP SCR_DROME P09077 3 
298 ? 
3 PDB 2R5Y      2R5Y   1 ACTCTATGATTTATGGGCTG                                                                       1   ? 
4 PDB 2R5Y      2R5Y   2 TCAGCCCATAAATCATAGAG                                                                       1   ? 
1 1 2R5Y A 2 ? 88 ? P09077 298 ? 384 ? 75  161 
2 2 2R5Y B 1 ? 63 ? P40427 238 ? 300 ? 201 260 
3 3 2R5Y C 1 ? 20 ? 2R5Y   1   ? 20  ? 1   20  
4 4 2R5Y D 1 ? 20 ? 2R5Y   21  ? 40  ? 21  40  
1 2R5Y GLY A 1  ? UNP P09077 ?   ?   'expression tag'      74  1 
1 2R5Y SER A 66 ? UNP P09077 CYS 362 'engineered mutation' 139 2 
ALA 'L-peptide linking' y ALANINE                              ? 'C3 H7 N O2'      89.093  
ARG 'L-peptide linking' y ARGININE                             ? 'C6 H15 N4 O2 1'  175.209 
ASN 'L-peptide linking' y ASPARAGINE                           ? 'C4 H8 N2 O3'     132.118 
CYS 'L-peptide linking' y CYSTEINE                             ? 'C3 H7 N O2 S'    121.158 
DA  'DNA linking'       y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 
DC  'DNA linking'       y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE"  ? 'C9 H14 N3 O7 P'  307.197 
DG  'DNA linking'       y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 
DT  'DNA linking'       y "THYMIDINE-5'-MONOPHOSPHATE"         ? 'C10 H15 N2 O8 P' 322.208 
GLN 'L-peptide linking' y GLUTAMINE                            ? 'C5 H10 N2 O3'    146.144 
GLU 'L-peptide linking' y 'GLUTAMIC ACID'                      ? 'C5 H9 N O4'      147.129 
GLY 'peptide linking'   y GLYCINE                              ? 'C2 H5 N O2'      75.067  
HIS 'L-peptide linking' y HISTIDINE                            ? 'C6 H10 N3 O2 1'  156.162 
HOH non-polymer         . WATER                                ? 'H2 O'            18.015  
ILE 'L-peptide linking' y ISOLEUCINE                           ? 'C6 H13 N O2'     131.173 
LEU 'L-peptide linking' y LEUCINE                              ? 'C6 H13 N O2'     131.173 
LYS 'L-peptide linking' y LYSINE                               ? 'C6 H15 N2 O2 1'  147.195 
MET 'L-peptide linking' y METHIONINE                           ? 'C5 H11 N O2 S'   149.211 
PHE 'L-peptide linking' y PHENYLALANINE                        ? 'C9 H11 N O2'     165.189 
PRO 'L-peptide linking' y PROLINE                              ? 'C5 H9 N O2'      115.130 
SER 'L-peptide linking' y SERINE                               ? 'C3 H7 N O3'      105.093 
THR 'L-peptide linking' y THREONINE                            ? 'C4 H9 N O3'      119.119 
TRP 'L-peptide linking' y TRYPTOPHAN                           ? 'C11 H12 N2 O2'   204.225 
TYR 'L-peptide linking' y TYROSINE                             ? 'C9 H11 N O3'     181.189 
VAL 'L-peptide linking' y VALINE                               ? 'C5 H11 N O2'     117.146 
_exptl.entry_id          2R5Y 
_exptl.method            'X-RAY DIFFRACTION' 
_exptl.crystals_number   1 
#                    1 
_exptl_crystal.density_meas          ? 
_exptl_crystal.density_Matthews      3.47 
_exptl_crystal.density_percent_sol   64.54 
_exptl_crystal.description           ? 
_exptl_crystal.F_000                 ? 
_exptl_crystal.preparation           ? 
_exptl_crystal_grow.crystal_id      1 
_exptl_crystal_grow.method          'VAPOR DIFFUSION, HANGING DROP' 
_exptl_crystal_grow.temp            277 
_exptl_crystal_grow.temp_details    ? 
_exptl_crystal_grow.pH              8.7 
;20% MPD, 10-14% PEG 4000, 0.2M sodium acetate, 0.2M potassium chloride, 0.1M Tris , pH 8.7, VAPOR DIFFUSION, HANGING DROP, temperature 277K
_exptl_crystal_grow.pdbx_pH_range   . 
1 1  1 MPD                  ? ? ? 
1 2  2 MPD                  ? ? ? 
1 3  1 'PEG 4000'           ? ? ? 
1 4  2 'PEG 4000'           ? ? ? 
1 5  1 'sodium acetate'     ? ? ? 
1 6  2 'sodium acetate'     ? ? ? 
1 7  1 'potassium chloride' ? ? ? 
1 8  2 'potassium chloride' ? ? ? 
1 9  1 Tris                 ? ? ? 
1 10 2 Tris                 ? ? ? 
#                     1 
_diffrn.ambient_temp           110 
_diffrn.ambient_temp_details   ? 
_diffrn.crystal_id             1 
_diffrn_detector.diffrn_id              1 
_diffrn_detector.detector               CCD 
_diffrn_detector.type                   'ADSC QUANTUM 315' 
_diffrn_detector.pdbx_collection_date   2004-03-05 
_diffrn_detector.details                'double crystal monochromator' 
_diffrn_radiation.diffrn_id                        1 
_diffrn_radiation.wavelength_id                    1 
_diffrn_radiation.pdbx_monochromatic_or_laue_m_l   M 
_diffrn_radiation.monochromator                    'Si(111)' 
_diffrn_radiation.pdbx_diffrn_protocol             'SINGLE WAVELENGTH' 
_diffrn_radiation.pdbx_scattering_type             x-ray 
#           1 
_diffrn_radiation_wavelength.wavelength   1.1 
_diffrn_radiation_wavelength.wt           1.0 
_diffrn_source.diffrn_id                   1 
_diffrn_source.source                      SYNCHROTRON 
_diffrn_source.type                        'NSLS BEAMLINE X25' 
_diffrn_source.pdbx_synchrotron_site       NSLS 
_diffrn_source.pdbx_synchrotron_beamline   X25 
_diffrn_source.pdbx_wavelength             ? 
_diffrn_source.pdbx_wavelength_list        1.1 
_reflns.entry_id                     2R5Y 
_reflns.observed_criterion_sigma_I   ? 
_reflns.observed_criterion_sigma_F   -3 
_reflns.d_resolution_low             50 
_reflns.d_resolution_high            2.6 
_reflns.number_obs                   13550 
_reflns.number_all                   13684 
_reflns.percent_possible_obs         97.8 
_reflns.pdbx_Rmerge_I_obs            0.099 
_reflns.pdbx_Rsym_value              0.099 
_reflns.pdbx_netI_over_sigmaI        36 
_reflns.B_iso_Wilson_estimate        56.0 
_reflns.pdbx_redundancy              23.2 
_reflns.R_free_details               ? 
_reflns.pdbx_chi_squared             ? 
_reflns.pdbx_scaling_rejects         ? 
_reflns.pdbx_diffrn_id               1 
_reflns.pdbx_ordinal                 1 
_reflns_shell.d_res_high             2.60 
_reflns_shell.d_res_low              2.69 
_reflns_shell.percent_possible_all   100 
_reflns_shell.Rmerge_I_obs           0.356 
_reflns_shell.pdbx_Rsym_value        0.356 
_reflns_shell.meanI_over_sigI_obs    9.7 
_reflns_shell.pdbx_redundancy        1.86 
_reflns_shell.percent_possible_obs   ? 
_reflns_shell.number_unique_all      1371 
_reflns_shell.number_measured_all    ? 
_reflns_shell.number_measured_obs    ? 
_reflns_shell.number_unique_obs      ? 
_reflns_shell.pdbx_chi_squared       ? 
_reflns_shell.pdbx_diffrn_id         ? 
_reflns_shell.pdbx_ordinal           1 
_refine.entry_id                                 2R5Y 
_refine.ls_number_reflns_obs                     13429 
_refine.ls_number_reflns_all                     14460 
_refine.pdbx_ls_sigma_I                          ? 
_refine.pdbx_ls_sigma_F                          0.0 
_refine.pdbx_data_cutoff_high_absF               541221.77 
_refine.pdbx_data_cutoff_low_absF                0.000000 
_refine.pdbx_data_cutoff_high_rms_absF           ? 
_refine.ls_d_res_low                             11.96 
_refine.ls_d_res_high                            2.60 
_refine.ls_percent_reflns_obs                    96.3 
_refine.ls_R_factor_obs                          0.255 
_refine.ls_R_factor_all                          ? 
_refine.ls_R_factor_R_work                       0.255 
_refine.ls_R_factor_R_free                       0.299 
_refine.ls_R_factor_R_free_error                 0.009 
_refine.ls_R_factor_R_free_error_details         ? 
_refine.ls_percent_reflns_R_free                 7.7 
_refine.ls_number_reflns_R_free                  1031 
_refine.ls_number_parameters                     ? 
_refine.ls_number_restraints                     ? 
_refine.occupancy_min                            ? 
_refine.occupancy_max                            ? 
_refine.correlation_coeff_Fo_to_Fc               ? 
_refine.correlation_coeff_Fo_to_Fc_free          ? 
_refine.B_iso_mean                               57.9 
_refine.aniso_B[1][1]                            -0.58 
_refine.aniso_B[2][2]                            -0.58 
_refine.aniso_B[3][3]                            1.16 
_refine.aniso_B[1][2]                            0.00 
_refine.aniso_B[1][3]                            0.00 
_refine.aniso_B[2][3]                            0.00 
_refine.solvent_model_details                    'FLAT MODEL' 
_refine.solvent_model_param_ksol                 0.308333 
_refine.solvent_model_param_bsol                 37.2994 
_refine.pdbx_solvent_vdw_probe_radii             ? 
_refine.pdbx_solvent_ion_probe_radii             ? 
_refine.pdbx_solvent_shrinkage_radii             ? 
_refine.pdbx_ls_cross_valid_method               THROUGHOUT 
_refine.details                                  ? 
_refine.pdbx_starting_model                      'PDB entry 1B8I' 
_refine.pdbx_method_to_determine_struct          'MOLECULAR REPLACEMENT' 
_refine.pdbx_isotropic_thermal_model             RESTRAINED 
_refine.pdbx_stereochemistry_target_values       'Engh & Huber' 
_refine.pdbx_stereochem_target_val_spec_case     ? 
_refine.pdbx_R_Free_selection_details            RANDOM 
_refine.pdbx_overall_ESU_R                       ? 
_refine.pdbx_overall_ESU_R_Free                  ? 
_refine.overall_SU_ML                            ? 
_refine.overall_SU_B                             ? 
_refine.ls_redundancy_reflns_obs                 ? 
_refine.overall_SU_R_Cruickshank_DPI             ? 
_refine.overall_SU_R_free                        ? 
_refine.ls_wR_factor_R_free                      ? 
_refine.ls_wR_factor_R_work                      ? 
_refine.overall_FOM_free_R_set                   ? 
_refine.overall_FOM_work_R_set                   ? 
_refine.pdbx_overall_phase_error                 ? 
_refine.pdbx_refine_id                           'X-RAY DIFFRACTION' 
_refine.pdbx_diffrn_id                           1 
_refine.pdbx_TLS_residual_ADP_flag               ? 
_refine.pdbx_overall_SU_R_free_Cruickshank_DPI   ? 
_refine.pdbx_overall_SU_R_Blow_DPI               ? 
_refine.pdbx_overall_SU_R_free_Blow_DPI          ? 
_refine_analyze.entry_id                        2R5Y 
_refine_analyze.Luzzati_coordinate_error_obs    0.43 
_refine_analyze.Luzzati_sigma_a_obs             0.39 
_refine_analyze.Luzzati_d_res_low_obs           5.00 
_refine_analyze.Luzzati_coordinate_error_free   0.51 
_refine_analyze.Luzzati_sigma_a_free            0.47 
_refine_analyze.Luzzati_d_res_low_free          ? 
_refine_analyze.number_disordered_residues      ? 
_refine_analyze.occupancy_sum_hydrogen          ? 
_refine_analyze.occupancy_sum_non_hydrogen      ? 
_refine_analyze.pdbx_refine_id                  'X-RAY DIFFRACTION' 
_refine_hist.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_refine_hist.cycle_id                         LAST 
_refine_hist.pdbx_number_atoms_protein        1149 
_refine_hist.pdbx_number_atoms_nucleic_acid   814 
_refine_hist.pdbx_number_atoms_ligand         0 
_refine_hist.number_atoms_solvent             103 
_refine_hist.number_atoms_total               2066 
_refine_hist.d_res_high                       2.60 
_refine_hist.d_res_low                        11.96 
c_bond_d           0.006 ?    ? ? 'X-RAY DIFFRACTION' ? 
c_angle_deg        1.1   ?    ? ? 'X-RAY DIFFRACTION' ? 
c_dihedral_angle_d 18.0  ?    ? ? 'X-RAY DIFFRACTION' ? 
c_improper_angle_d 1.13  ?    ? ? 'X-RAY DIFFRACTION' ? 
c_mcbond_it        1.58  1.50 ? ? 'X-RAY DIFFRACTION' ? 
c_mcangle_it       2.70  2.00 ? ? 'X-RAY DIFFRACTION' ? 
c_scbond_it        2.07  2.00 ? ? 'X-RAY DIFFRACTION' ? 
c_scangle_it       3.32  2.50 ? ? 'X-RAY DIFFRACTION' ? 
_refine_ls_shell.pdbx_total_number_of_bins_used   6 
_refine_ls_shell.d_res_high                       2.60 
_refine_ls_shell.d_res_low                        2.76 
_refine_ls_shell.number_reflns_R_work             1980 
_refine_ls_shell.R_factor_R_work                  0.394 
_refine_ls_shell.percent_reflns_obs               94.8 
_refine_ls_shell.R_factor_R_free                  0.414 
_refine_ls_shell.R_factor_R_free_error            0.033 
_refine_ls_shell.percent_reflns_R_free            7.3 
_refine_ls_shell.number_reflns_R_free             155 
_refine_ls_shell.number_reflns_all                ? 
_refine_ls_shell.R_factor_all                     ? 
_refine_ls_shell.number_reflns_obs                2252 
_refine_ls_shell.redundancy_reflns_obs            ? 
_refine_ls_shell.pdbx_refine_id                   'X-RAY DIFFRACTION' 
1 protein_rep.param 'X-RAY DIFFRACTION' 
2 dna-rna_rep.param 'X-RAY DIFFRACTION' 
3 water_rep.param   'X-RAY DIFFRACTION' 
_struct.entry_id                  2R5Y 
_struct.title                     'Structure of Scr/Exd complex bound to a consensus Hox-Exd site' 
_struct.pdbx_model_details        ? 
_struct.pdbx_CASP_flag            N 
_struct.pdbx_model_type_details   ? 
_struct_keywords.entry_id        2R5Y 
_struct_keywords.pdbx_keywords   TRANSCRIPTION/DNA 
;Homeodomain, homeotic proteins, specificity, Developmental protein, DNA-binding, Homeobox, Nucleus, Transcription, Transcription regulation, TRANSCRIPTION-DNA COMPLEX
A N N 1 ? 
B N N 2 ? 
C N N 3 ? 
D N N 4 ? 
E N N 5 ? 
F N N 5 ? 
G N N 5 ? 
H N N 5 ? 
HELX_P HELX_P1 1 TYR C 9  ? LYS C 13 ? TYR A 82  LYS A 86  5 ? 5  
HELX_P HELX_P2 2 THR C 36 ? HIS C 48 ? THR A 109 HIS A 121 1 ? 13 
HELX_P HELX_P3 3 THR C 54 ? LEU C 65 ? THR A 127 LEU A 138 1 ? 12 
HELX_P HELX_P4 4 THR C 68 ? LYS C 85 ? THR A 141 LYS A 158 1 ? 18 
HELX_P HELX_P5 5 SER D 9  ? HIS D 23 ? SER B 209 HIS B 223 1 ? 15 
HELX_P HELX_P6 6 SER D 30 ? GLY D 42 ? SER B 227 GLY B 239 1 ? 13 
HELX_P HELX_P7 7 THR D 44 ? ASN D 62 ? THR B 241 ASN B 259 1 ? 19 
#          HELX_P 
_struct_conf_type.criteria    ? 
_struct_conf_type.reference   ? 
hydrog1  hydrog ? ? A DC 2  O2 ? ? ? 1_555 B DG 20 N2 ? ? C DC 2  D DG 40 1_555 ? ? ? ? ? ? 'DC-DG PAIR' ? ? ? 
hydrog2  hydrog ? ? A DT 3  N3 ? ? ? 1_555 B DA 19 N1 ? ? C DT 3  D DA 39 1_555 ? ? ? ? ? ? 'DT-DA PAIR' ? ? ? 
hydrog3  hydrog ? ? A DC 4  O2 ? ? ? 1_555 B DG 18 N2 ? ? C DC 4  D DG 38 1_555 ? ? ? ? ? ? 'DC-DG PAIR' ? ? ? 
hydrog4  hydrog ? ? A DT 5  N3 ? ? ? 1_555 B DA 17 N1 ? ? C DT 5  D DA 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog5  hydrog ? ? A DT 5  O4 ? ? ? 1_555 B DA 17 N6 ? ? C DT 5  D DA 37 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog6  hydrog ? ? A DA 6  N1 ? ? ? 1_555 B DT 16 N3 ? ? C DA 6  D DT 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog7  hydrog ? ? A DA 6  N6 ? ? ? 1_555 B DT 16 O4 ? ? C DA 6  D DT 36 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog8  hydrog ? ? A DT 7  N3 ? ? ? 1_555 B DA 15 N1 ? ? C DT 7  D DA 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog9  hydrog ? ? A DT 7  O4 ? ? ? 1_555 B DA 15 N6 ? ? C DT 7  D DA 35 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog10 hydrog ? ? A DG 8  N1 ? ? ? 1_555 B DC 14 N3 ? ? C DG 8  D DC 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog11 hydrog ? ? A DG 8  N2 ? ? ? 1_555 B DC 14 O2 ? ? C DG 8  D DC 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog12 hydrog ? ? A DG 8  O6 ? ? ? 1_555 B DC 14 N4 ? ? C DG 8  D DC 34 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog13 hydrog ? ? A DA 9  N1 ? ? ? 1_555 B DT 13 N3 ? ? C DA 9  D DT 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog14 hydrog ? ? A DA 9  N6 ? ? ? 1_555 B DT 13 O4 ? ? C DA 9  D DT 33 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog15 hydrog ? ? A DT 10 N3 ? ? ? 1_555 B DA 12 N1 ? ? C DT 10 D DA 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog16 hydrog ? ? A DT 10 O4 ? ? ? 1_555 B DA 12 N6 ? ? C DT 10 D DA 32 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog17 hydrog ? ? A DT 11 N3 ? ? ? 1_555 B DA 11 N1 ? ? C DT 11 D DA 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog18 hydrog ? ? A DT 11 O4 ? ? ? 1_555 B DA 11 N6 ? ? C DT 11 D DA 31 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog19 hydrog ? ? A DT 12 N3 ? ? ? 1_555 B DA 10 N1 ? ? C DT 12 D DA 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog20 hydrog ? ? A DT 12 O4 ? ? ? 1_555 B DA 10 N6 ? ? C DT 12 D DA 30 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog21 hydrog ? ? A DA 13 N1 ? ? ? 1_555 B DT 9  N3 ? ? C DA 13 D DT 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog22 hydrog ? ? A DA 13 N6 ? ? ? 1_555 B DT 9  O4 ? ? C DA 13 D DT 29 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog23 hydrog ? ? A DT 14 N3 ? ? ? 1_555 B DA 8  N1 ? ? C DT 14 D DA 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog24 hydrog ? ? A DT 14 O4 ? ? ? 1_555 B DA 8  N6 ? ? C DT 14 D DA 28 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog25 hydrog ? ? A DG 15 N1 ? ? ? 1_555 B DC 7  N3 ? ? C DG 15 D DC 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog26 hydrog ? ? A DG 15 N2 ? ? ? 1_555 B DC 7  O2 ? ? C DG 15 D DC 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog27 hydrog ? ? A DG 15 O6 ? ? ? 1_555 B DC 7  N4 ? ? C DG 15 D DC 27 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog28 hydrog ? ? A DG 16 N1 ? ? ? 1_555 B DC 6  N3 ? ? C DG 16 D DC 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog29 hydrog ? ? A DG 16 N2 ? ? ? 1_555 B DC 6  O2 ? ? C DG 16 D DC 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog30 hydrog ? ? A DG 16 O6 ? ? ? 1_555 B DC 6  N4 ? ? C DG 16 D DC 26 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog31 hydrog ? ? A DG 17 N1 ? ? ? 1_555 B DC 5  N3 ? ? C DG 17 D DC 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog32 hydrog ? ? A DG 17 N2 ? ? ? 1_555 B DC 5  O2 ? ? C DG 17 D DC 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog33 hydrog ? ? A DG 17 O6 ? ? ? 1_555 B DC 5  N4 ? ? C DG 17 D DC 25 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog34 hydrog ? ? A DC 18 O2 ? ? ? 1_555 B DG 4  N2 ? ? C DC 18 D DG 24 1_555 ? ? ? ? ? ? 'DC-DG PAIR' ? ? ? 
hydrog35 hydrog ? ? A DG 20 N1 ? ? ? 1_555 B DC 2  N3 ? ? C DG 20 D DC 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog36 hydrog ? ? A DG 20 N2 ? ? ? 1_555 B DC 2  O2 ? ? C DG 20 D DC 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
hydrog37 hydrog ? ? A DG 20 O6 ? ? ? 1_555 B DC 2  N4 ? ? C DG 20 D DC 22 1_555 ? ? ? ? ? ? WATSON-CRICK ? ? ? 
#          hydrog 
_struct_conn_type.criteria    ? 
_struct_conn_type.reference   ? 
_database_PDB_matrix.entry_id          2R5Y 
_database_PDB_matrix.origx[1][1]       1.000000 
_database_PDB_matrix.origx[1][2]       0.000000 
_database_PDB_matrix.origx[1][3]       0.000000 
_database_PDB_matrix.origx[2][1]       0.000000 
_database_PDB_matrix.origx[2][2]       1.000000 
_database_PDB_matrix.origx[2][3]       0.000000 
_database_PDB_matrix.origx[3][1]       0.000000 
_database_PDB_matrix.origx[3][2]       0.000000 
_database_PDB_matrix.origx[3][3]       1.000000 
_database_PDB_matrix.origx_vector[1]   0.00000 
_database_PDB_matrix.origx_vector[2]   0.00000 
_database_PDB_matrix.origx_vector[3]   0.00000 
_atom_sites.entry_id                    2R5Y 
_atom_sites.fract_transf_matrix[1][1]   0.015312 
_atom_sites.fract_transf_matrix[1][2]   0.000000 
_atom_sites.fract_transf_matrix[1][3]   0.000000 
_atom_sites.fract_transf_matrix[2][1]   0.000000 
_atom_sites.fract_transf_matrix[2][2]   0.015312 
_atom_sites.fract_transf_matrix[2][3]   0.000000 
_atom_sites.fract_transf_matrix[3][1]   0.000000 
_atom_sites.fract_transf_matrix[3][2]   0.000000 
_atom_sites.fract_transf_matrix[3][3]   0.004993 
_atom_sites.fract_transf_vector[1]      0.00000 
_atom_sites.fract_transf_vector[2]      0.00000 
_atom_sites.fract_transf_vector[3]      0.00000 
ATOM   1    O "O5'" . DA  A 1 1  ? 49.869 -16.410 14.289  1.00 110.62 ? 1    DA  C "O5'" 1 
ATOM   2    C "C5'" . DA  A 1 1  ? 51.238 -16.084 14.042  1.00 109.60 ? 1    DA  C "C5'" 1 
ATOM   3    C "C4'" . DA  A 1 1  ? 51.985 -15.713 15.303  1.00 108.61 ? 1    DA  C "C4'" 1 
ATOM   4    O "O4'" . DA  A 1 1  ? 53.336 -15.338 14.957  1.00 106.95 ? 1    DA  C "O4'" 1 
ATOM   5    C "C3'" . DA  A 1 1  ? 51.407 -14.520 16.056  1.00 108.18 ? 1    DA  C "C3'" 1 
ATOM   6    O "O3'" . DA  A 1 1  ? 51.626 -14.673 17.461  1.00 108.95 ? 1    DA  C "O3'" 1 
ATOM   7    C "C2'" . DA  A 1 1  ? 52.178 -13.341 15.491  1.00 106.52 ? 1    DA  C "C2'" 1 
ATOM   8    C "C1'" . DA  A 1 1  ? 53.526 -13.937 15.100  1.00 104.71 ? 1    DA  C "C1'" 1 
ATOM   9    N N9    . DA  A 1 1  ? 53.997 -13.445 13.810  1.00 102.10 ? 1    DA  C N9    1 
ATOM   10   C C8    . DA  A 1 1  ? 53.231 -13.169 12.704  1.00 101.05 ? 1    DA  C C8    1 
ATOM   11   N N7    . DA  A 1 1  ? 53.921 -12.762 11.671  1.00 99.80  ? 1    DA  C N7    1 
ATOM   12   C C5    . DA  A 1 1  ? 55.232 -12.764 12.127  1.00 99.01  ? 1    DA  C C5    1 
ATOM   13   C C6    . DA  A 1 1  ? 56.443 -12.427 11.507  1.00 97.99  ? 1    DA  C C6    1 
ATOM   14   N N6    . DA  A 1 1  ? 56.533 -12.011 10.243  1.00 97.66  ? 1    DA  C N6    1 
ATOM   15   N N1    . DA  A 1 1  ? 57.573 -12.534 12.242  1.00 97.43  ? 1    DA  C N1    1 
ATOM   16   C C2    . DA  A 1 1  ? 57.475 -12.952 13.511  1.00 97.51  ? 1    DA  C C2    1 
ATOM   17   N N3    . DA  A 1 1  ? 56.393 -13.298 14.205  1.00 98.40  ? 1    DA  C N3    1 
ATOM   18   C C4    . DA  A 1 1  ? 55.291 -13.179 13.445  1.00 99.72  ? 1    DA  C C4    1 
ATOM   19   P P     . DC  A 1 2  ? 51.127 -13.529 18.473  1.00 109.40 ? 2    DC  C P     1 
ATOM   20   O OP1   . DC  A 1 2  ? 50.852 -14.153 19.794  1.00 109.69 ? 2    DC  C OP1   1 
ATOM   21   O OP2   . DC  A 1 2  ? 50.057 -12.754 17.786  1.00 109.30 ? 2    DC  C OP2   1 
ATOM   22   O "O5'" . DC  A 1 2  ? 52.410 -12.602 18.630  1.00 107.78 ? 2    DC  C "O5'" 1 
ATOM   23   C "C5'" . DC  A 1 2  ? 53.602 -13.115 19.215  1.00 105.41 ? 2    DC  C "C5'" 1 
ATOM   24   C "C4'" . DC  A 1 2  ? 54.640 -12.024 19.329  1.00 104.25 ? 2    DC  C "C4'" 1 
ATOM   25   O "O4'" . DC  A 1 2  ? 55.260 -11.750 18.043  1.00 103.16 ? 2    DC  C "O4'" 1 
ATOM   26   C "C3'" . DC  A 1 2  ? 54.107 -10.683 19.840  1.00 103.56 ? 2    DC  C "C3'" 1 
ATOM   27   O "O3'" . DC  A 1 2  ? 55.062 -10.124 20.737  1.00 103.86 ? 2    DC  C "O3'" 1 
ATOM   28   C "C2'" . DC  A 1 2  ? 54.050 -9.834  18.585  1.00 102.42 ? 2    DC  C "C2'" 1 
ATOM   29   C "C1'" . DC  A 1 2  ? 55.265 -10.347 17.836  1.00 101.39 ? 2    DC  C "C1'" 1 
ATOM   30   N N1    . DC  A 1 2  ? 55.282 -10.078 16.386  1.00 98.95  ? 2    DC  C N1    1 
ATOM   31   C C2    . DC  A 1 2  ? 56.514 -9.869  15.764  1.00 97.06  ? 2    DC  C C2    1 
ATOM   32   O O2    . DC  A 1 2  ? 57.547 -9.983  16.431  1.00 95.51  ? 2    DC  C O2    1 
ATOM   33   N N3    . DC  A 1 2  ? 56.551 -9.555  14.452  1.00 96.04  ? 2    DC  C N3    1 
ATOM   34   C C4    . DC  A 1 2  ? 55.420 -9.462  13.758  1.00 95.97  ? 2    DC  C C4    1 
ATOM   35   N N4    . DC  A 1 2  ? 55.513 -9.128  12.474  1.00 95.48  ? 2    DC  C N4    1 
ATOM   36   C C5    . DC  A 1 2  ? 54.147 -9.701  14.354  1.00 96.52  ? 2    DC  C C5    1 
ATOM   37   C C6    . DC  A 1 2  ? 54.124 -10.005 15.660  1.00 98.10  ? 2    DC  C C6    1 
ATOM   38   P P     . DT  A 1 3  ? 54.723 -8.772  21.535  1.00 104.27 ? 3    DT  C P     1 
ATOM   39   O OP1   . DT  A 1 3  ? 53.927 -9.110  22.740  1.00 104.34 ? 3    DT  C OP1   1 
ATOM   40   O OP2   . DT  A 1 3  ? 54.193 -7.782  20.558  1.00 104.17 ? 3    DT  C OP2   1 
ATOM   41   O "O5'" . DT  A 1 3  ? 56.165 -8.303  22.004  1.00 101.96 ? 3    DT  C "O5'" 1 
ATOM   42   C "C5'" . DT  A 1 3  ? 57.272 -9.188  21.885  1.00 100.09 ? 3    DT  C "C5'" 1 
ATOM   43   C "C4'" . DT  A 1 3  ? 58.417 -8.492  21.189  1.00 99.25  ? 3    DT  C "C4'" 1 
ATOM   44   O "O4'" . DT  A 1 3  ? 58.147 -8.330  19.773  1.00 98.55  ? 3    DT  C "O4'" 1 
ATOM   45   C "C3'" . DT  A 1 3  ? 58.690 -7.091  21.728  1.00 98.44  ? 3    DT  C "C3'" 1 
ATOM   46   O "O3'" . DT  A 1 3  ? 60.092 -6.870  21.785  1.00 96.93  ? 3    DT  C "O3'" 1 
ATOM   47   C "C2'" . DT  A 1 3  ? 58.076 -6.184  20.678  1.00 98.44  ? 3    DT  C "C2'" 1 
ATOM   48   C "C1'" . DT  A 1 3  ? 58.354 -6.973  19.414  1.00 97.45  ? 3    DT  C "C1'" 1 
ATOM   49   N N1    . DT  A 1 3  ? 57.485 -6.658  18.266  1.00 95.89  ? 3    DT  C N1    1 
ATOM   50   C C2    . DT  A 1 3  ? 58.100 -6.372  17.070  1.00 95.13  ? 3    DT  C C2    1 
ATOM   51   O O2    . DT  A 1 3  ? 59.315 -6.356  16.936  1.00 94.74  ? 3    DT  C O2    1 
ATOM   52   N N3    . DT  A 1 3  ? 57.239 -6.102  16.033  1.00 93.84  ? 3    DT  C N3    1 
ATOM   53   C C4    . DT  A 1 3  ? 55.858 -6.090  16.076  1.00 93.29  ? 3    DT  C C4    1 
ATOM   54   O O4    . DT  A 1 3  ? 55.213 -5.851  15.059  1.00 91.49  ? 3    DT  C O4    1 
ATOM   55   C C5    . DT  A 1 3  ? 55.281 -6.380  17.369  1.00 93.97  ? 3    DT  C C5    1 
ATOM   56   C C7    . DT  A 1 3  ? 53.792 -6.366  17.517  1.00 94.40  ? 3    DT  C C7    1 
ATOM   57   C C6    . DT  A 1 3  ? 56.112 -6.651  18.384  1.00 94.68  ? 3    DT  C C6    1 
ATOM   58   P P     . DC  A 1 4  ? 60.702 -6.031  23.000  1.00 96.74  ? 4    DC  C P     1 
ATOM   59   O OP1   . DC  A 1 4  ? 61.270 -6.979  23.990  1.00 97.24  ? 4    DC  C OP1   1 
ATOM   60   O OP2   . DC  A 1 4  ? 59.662 -5.054  23.424  1.00 96.21  ? 4    DC  C OP2   1 
ATOM   61   O "O5'" . DC  A 1 4  ? 61.900 -5.238  22.327  1.00 94.43  ? 4    DC  C "O5'" 1 
ATOM   62   C "C5'" . DC  A 1 4  ? 61.832 -3.830  22.151  1.00 90.00  ? 4    DC  C "C5'" 1 
ATOM   63   C "C4'" . DC  A 1 4  ? 62.258 -3.459  20.751  1.00 86.16  ? 4    DC  C "C4'" 1 
ATOM   64   O "O4'" . DC  A 1 4  ? 61.192 -3.741  19.802  1.00 83.41  ? 4    DC  C "O4'" 1 
ATOM   65   C "C3'" . DC  A 1 4  ? 62.570 -1.972  20.605  1.00 84.29  ? 4    DC  C "C3'" 1 
ATOM   66   O "O3'" . DC  A 1 4  ? 63.686 -1.826  19.742  1.00 83.47  ? 4    DC  C "O3'" 1 
ATOM   67   C "C2'" . DC  A 1 4  ? 61.324 -1.412  19.951  1.00 82.47  ? 4    DC  C "C2'" 1 
ATOM   68   C "C1'" . DC  A 1 4  ? 60.888 -2.563  19.068  1.00 81.04  ? 4    DC  C "C1'" 1 
ATOM   69   N N1    . DC  A 1 4  ? 59.448 -2.561  18.752  1.00 78.04  ? 4    DC  C N1    1 
ATOM   70   C C2    . DC  A 1 4  ? 59.058 -2.441  17.415  1.00 76.59  ? 4    DC  C C2    1 
ATOM   71   O O2    . DC  A 1 4  ? 59.931 -2.382  16.544  1.00 76.36  ? 4    DC  C O2    1 
ATOM   72   N N3    . DC  A 1 4  ? 57.743 -2.392  17.105  1.00 75.51  ? 4    DC  C N3    1 
ATOM   73   C C4    . DC  A 1 4  ? 56.828 -2.465  18.072  1.00 75.56  ? 4    DC  C C4    1 
ATOM   74   N N4    . DC  A 1 4  ? 55.543 -2.394  17.718  1.00 74.27  ? 4    DC  C N4    1 
ATOM   75   C C5    . DC  A 1 4  ? 57.193 -2.607  19.444  1.00 75.48  ? 4    DC  C C5    1 
ATOM   76   C C6    . DC  A 1 4  ? 58.505 -2.654  19.736  1.00 76.10  ? 4    DC  C C6    1 
ATOM   77   P P     . DT  A 1 5  ? 64.929 -0.922  20.193  1.00 83.19  ? 5    DT  C P     1 
ATOM   78   O OP1   . DT  A 1 5  ? 65.950 -1.764  20.870  1.00 82.89  ? 5    DT  C OP1   1 
ATOM   79   O OP2   . DT  A 1 5  ? 64.356 0.253   20.904  1.00 84.05  ? 5    DT  C OP2   1 
ATOM   80   O "O5'" . DT  A 1 5  ? 65.526 -0.465  18.792  1.00 81.38  ? 5    DT  C "O5'" 1 
ATOM   81   C "C5'" . DT  A 1 5  ? 65.586 -1.383  17.701  1.00 77.36  ? 5    DT  C "C5'" 1 
ATOM   82   C "C4'" . DT  A 1 5  ? 65.153 -0.709  16.421  1.00 73.70  ? 5    DT  C "C4'" 1 
ATOM   83   O "O4'" . DT  A 1 5  ? 63.708 -0.682  16.291  1.00 70.81  ? 5    DT  C "O4'" 1 
ATOM   84   C "C3'" . DT  A 1 5  ? 65.618 0.741   16.298  1.00 74.18  ? 5    DT  C "C3'" 1 
ATOM   85   O "O3'" . DT  A 1 5  ? 66.111 0.972   14.990  1.00 75.53  ? 5    DT  C "O3'" 1 
ATOM   86   C "C2'" . DT  A 1 5  ? 64.346 1.547   16.503  1.00 71.54  ? 5    DT  C "C2'" 1 
ATOM   87   C "C1'" . DT  A 1 5  ? 63.301 0.623   15.912  1.00 68.75  ? 5    DT  C "C1'" 1 
ATOM   88   N N1    . DT  A 1 5  ? 61.903 0.830   16.370  1.00 64.41  ? 5    DT  C N1    1 
ATOM   89   C C2    . DT  A 1 5  ? 60.912 0.751   15.415  1.00 63.10  ? 5    DT  C C2    1 
ATOM   90   O O2    . DT  A 1 5  ? 61.147 0.557   14.227  1.00 63.63  ? 5    DT  C O2    1 
ATOM   91   N N3    . DT  A 1 5  ? 59.632 0.913   15.896  1.00 61.15  ? 5    DT  C N3    1 
ATOM   92   C C4    . DT  A 1 5  ? 59.258 1.151   17.202  1.00 60.71  ? 5    DT  C C4    1 
ATOM   93   O O4    . DT  A 1 5  ? 58.059 1.249   17.491  1.00 59.77  ? 5    DT  C O4    1 
ATOM   94   C C5    . DT  A 1 5  ? 60.351 1.260   18.145  1.00 60.74  ? 5    DT  C C5    1 
ATOM   95   C C7    . DT  A 1 5  ? 60.040 1.580   19.575  1.00 59.07  ? 5    DT  C C7    1 
ATOM   96   C C6    . DT  A 1 5  ? 61.600 1.080   17.691  1.00 62.46  ? 5    DT  C C6    1 
ATOM   97   P P     . DA  A 1 6  ? 67.302 2.016   14.770  1.00 75.86  ? 6    DA  C P     1 
ATOM   98   O OP1   . DA  A 1 6  ? 68.573 1.252   14.831  1.00 77.31  ? 6    DA  C OP1   1 
ATOM   99   O OP2   . DA  A 1 6  ? 67.090 3.168   15.680  1.00 76.40  ? 6    DA  C OP2   1 
ATOM   100  O "O5'" . DA  A 1 6  ? 67.045 2.499   13.281  1.00 73.06  ? 6    DA  C "O5'" 1 
ATOM   101  C "C5'" . DA  A 1 6  ? 66.419 1.621   12.357  1.00 67.13  ? 6    DA  C "C5'" 1 
ATOM   102  C "C4'" . DA  A 1 6  ? 65.220 2.287   11.727  1.00 62.66  ? 6    DA  C "C4'" 1 
ATOM   103  O "O4'" . DA  A 1 6  ? 64.114 2.384   12.663  1.00 60.71  ? 6    DA  C "O4'" 1 
ATOM   104  C "C3'" . DA  A 1 6  ? 65.471 3.703   11.205  1.00 60.76  ? 6    DA  C "C3'" 1 
ATOM   105  O "O3'" . DA  A 1 6  ? 64.958 3.801   9.878   1.00 60.56  ? 6    DA  C "O3'" 1 
ATOM   106  C "C2'" . DA  A 1 6  ? 64.686 4.586   12.164  1.00 58.73  ? 6    DA  C "C2'" 1 
ATOM   107  C "C1'" . DA  A 1 6  ? 63.539 3.676   12.563  1.00 57.53  ? 6    DA  C "C1'" 1 
ATOM   108  N N9    . DA  A 1 6  ? 62.898 3.992   13.842  1.00 52.42  ? 6    DA  C N9    1 
ATOM   109  C C8    . DA  A 1 6  ? 63.497 4.298   15.037  1.00 50.36  ? 6    DA  C C8    1 
ATOM   110  N N7    . DA  A 1 6  ? 62.650 4.523   16.010  1.00 48.10  ? 6    DA  C N7    1 
ATOM   111  C C5    . DA  A 1 6  ? 61.408 4.354   15.417  1.00 47.21  ? 6    DA  C C5    1 
ATOM   112  C C6    . DA  A 1 6  ? 60.095 4.453   15.925  1.00 46.70  ? 6    DA  C C6    1 
ATOM   113  N N6    . DA  A 1 6  ? 59.813 4.726   17.202  1.00 47.23  ? 6    DA  C N6    1 
ATOM   114  N N1    . DA  A 1 6  ? 59.070 4.252   15.064  1.00 45.82  ? 6    DA  C N1    1 
ATOM   115  C C2    . DA  A 1 6  ? 59.362 3.959   13.785  1.00 46.80  ? 6    DA  C C2    1 
ATOM   116  N N3    . DA  A 1 6  ? 60.553 3.826   13.197  1.00 46.69  ? 6    DA  C N3    1 
ATOM   117  C C4    . DA  A 1 6  ? 61.544 4.039   14.079  1.00 48.57  ? 6    DA  C C4    1 
ATOM   118  P P     . DT  A 1 7  ? 65.087 5.179   9.069   1.00 61.00  ? 7    DT  C P     1 
ATOM   119  O OP1   . DT  A 1 7  ? 65.566 4.873   7.696   1.00 59.38  ? 7    DT  C OP1   1 
ATOM   120  O OP2   . DT  A 1 7  ? 65.835 6.143   9.911   1.00 62.23  ? 7    DT  C OP2   1 
ATOM   121  O "O5'" . DT  A 1 7  ? 63.579 5.680   9.011   1.00 59.01  ? 7    DT  C "O5'" 1 
ATOM   122  C "C5'" . DT  A 1 7  ? 62.535 4.784   8.653   1.00 58.37  ? 7    DT  C "C5'" 1 
ATOM   123  C "C4'" . DT  A 1 7  ? 61.227 5.532   8.589   1.00 57.91  ? 7    DT  C "C4'" 1 
ATOM   124  O "O4'" . DT  A 1 7  ? 60.674 5.690   9.915   1.00 57.93  ? 7    DT  C "O4'" 1 
ATOM   125  C "C3'" . DT  A 1 7  ? 61.397 6.943   8.032   1.00 58.59  ? 7    DT  C "C3'" 1 
ATOM   126  O "O3'" . DT  A 1 7  ? 60.262 7.290   7.244   1.00 57.79  ? 7    DT  C "O3'" 1 
ATOM   127  C "C2'" . DT  A 1 7  ? 61.473 7.802   9.282   1.00 56.89  ? 7    DT  C "C2'" 1 
ATOM   128  C "C1'" . DT  A 1 7  ? 60.504 7.071   10.195  1.00 56.62  ? 7    DT  C "C1'" 1 
ATOM   129  N N1    . DT  A 1 7  ? 60.691 7.274   11.648  1.00 53.23  ? 7    DT  C N1    1 
ATOM   130  C C2    . DT  A 1 7  ? 59.561 7.248   12.423  1.00 50.66  ? 7    DT  C C2    1 
ATOM   131  O O2    . DT  A 1 7  ? 58.444 7.063   11.956  1.00 47.22  ? 7    DT  C O2    1 
ATOM   132  N N3    . DT  A 1 7  ? 59.782 7.447   13.764  1.00 49.63  ? 7    DT  C N3    1 
ATOM   133  C C4    . DT  A 1 7  ? 61.000 7.673   14.386  1.00 51.97  ? 7    DT  C C4    1 
ATOM   134  O O4    . DT  A 1 7  ? 61.051 7.852   15.609  1.00 52.11  ? 7    DT  C O4    1 
ATOM   135  C C5    . DT  A 1 7  ? 62.145 7.683   13.507  1.00 51.02  ? 7    DT  C C5    1 
ATOM   136  C C7    . DT  A 1 7  ? 63.502 7.917   14.092  1.00 48.32  ? 7    DT  C C7    1 
ATOM   137  C C6    . DT  A 1 7  ? 61.937 7.484   12.199  1.00 51.56  ? 7    DT  C C6    1 
ATOM   138  P P     . DG  A 1 8  ? 60.398 8.419   6.113   1.00 59.68  ? 8    DG  C P     1 
ATOM   139  O OP1   . DG  A 1 8  ? 60.180 7.733   4.807   1.00 56.11  ? 8    DG  C OP1   1 
ATOM   140  O OP2   . DG  A 1 8  ? 61.620 9.235   6.342   1.00 55.48  ? 8    DG  C OP2   1 
ATOM   141  O "O5'" . DG  A 1 8  ? 59.149 9.357   6.407   1.00 53.93  ? 8    DG  C "O5'" 1 
ATOM   142  C "C5'" . DG  A 1 8  ? 57.846 8.819   6.318   1.00 48.39  ? 8    DG  C "C5'" 1 
ATOM   143  C "C4'" . DG  A 1 8  ? 56.866 9.679   7.074   1.00 43.48  ? 8    DG  C "C4'" 1 
ATOM   144  O "O4'" . DG  A 1 8  ? 57.088 9.548   8.496   1.00 40.89  ? 8    DG  C "O4'" 1 
ATOM   145  C "C3'" . DG  A 1 8  ? 56.920 11.170  6.753   1.00 39.63  ? 8    DG  C "C3'" 1 
ATOM   146  O "O3'" . DG  A 1 8  ? 55.570 11.618  6.620   1.00 38.73  ? 8    DG  C "O3'" 1 
ATOM   147  C "C2'" . DG  A 1 8  ? 57.622 11.766  7.962   1.00 36.57  ? 8    DG  C "C2'" 1 
ATOM   148  C "C1'" . DG  A 1 8  ? 57.199 10.830  9.079   1.00 38.28  ? 8    DG  C "C1'" 1 
ATOM   149  N N9    . DG  A 1 8  ? 58.116 10.744  10.213  1.00 34.63  ? 8    DG  C N9    1 
ATOM   150  C C8    . DG  A 1 8  ? 59.486 10.666  10.178  1.00 35.70  ? 8    DG  C C8    1 
ATOM   151  N N7    . DG  A 1 8  ? 60.030 10.665  11.366  1.00 35.13  ? 8    DG  C N7    1 
ATOM   152  C C5    . DG  A 1 8  ? 58.948 10.718  12.235  1.00 33.71  ? 8    DG  C C5    1 
ATOM   153  C C6    . DG  A 1 8  ? 58.912 10.730  13.653  1.00 33.22  ? 8    DG  C C6    1 
ATOM   154  O O6    . DG  A 1 8  ? 59.859 10.688  14.446  1.00 32.78  ? 8    DG  C O6    1 
ATOM   155  N N1    . DG  A 1 8  ? 57.606 10.794  14.131  1.00 34.50  ? 8    DG  C N1    1 
ATOM   156  C C2    . DG  A 1 8  ? 56.482 10.841  13.341  1.00 36.83  ? 8    DG  C C2    1 
ATOM   157  N N2    . DG  A 1 8  ? 55.306 10.911  13.979  1.00 33.18  ? 8    DG  C N2    1 
ATOM   158  N N3    . DG  A 1 8  ? 56.509 10.825  12.017  1.00 35.05  ? 8    DG  C N3    1 
ATOM   159  C C4    . DG  A 1 8  ? 57.764 10.761  11.539  1.00 33.53  ? 8    DG  C C4    1 
ATOM   160  P P     . DA  A 1 9  ? 55.244 13.158  6.308   1.00 40.56  ? 9    DA  C P     1 
ATOM   161  O OP1   . DA  A 1 9  ? 54.121 13.124  5.323   1.00 37.63  ? 9    DA  C OP1   1 
ATOM   162  O OP2   . DA  A 1 9  ? 56.474 13.940  6.002   1.00 37.62  ? 9    DA  C OP2   1 
ATOM   163  O "O5'" . DA  A 1 9  ? 54.685 13.660  7.712   1.00 40.11  ? 9    DA  C "O5'" 1 
ATOM   164  C "C5'" . DA  A 1 9  ? 53.744 12.855  8.415   1.00 37.63  ? 9    DA  C "C5'" 1 
ATOM   165  C "C4'" . DA  A 1 9  ? 53.411 13.470  9.752   1.00 38.56  ? 9    DA  C "C4'" 1 
ATOM   166  O "O4'" . DA  A 1 9  ? 54.466 13.212  10.707  1.00 38.50  ? 9    DA  C "O4'" 1 
ATOM   167  C "C3'" . DA  A 1 9  ? 53.165 14.978  9.766   1.00 37.00  ? 9    DA  C "C3'" 1 
ATOM   168  O "O3'" . DA  A 1 9  ? 51.919 15.223  10.419  1.00 37.30  ? 9    DA  C "O3'" 1 
ATOM   169  C "C2'" . DA  A 1 9  ? 54.353 15.538  10.545  1.00 34.06  ? 9    DA  C "C2'" 1 
ATOM   170  C "C1'" . DA  A 1 9  ? 54.749 14.385  11.452  1.00 33.31  ? 9    DA  C "C1'" 1 
ATOM   171  N N9    . DA  A 1 9  ? 56.166 14.330  11.810  1.00 32.80  ? 9    DA  C N9    1 
ATOM   172  C C8    . DA  A 1 9  ? 57.227 14.340  10.939  1.00 34.40  ? 9    DA  C C8    1 
ATOM   173  N N7    . DA  A 1 9  ? 58.394 14.220  11.520  1.00 29.99  ? 9    DA  C N7    1 
ATOM   174  C C5    . DA  A 1 9  ? 58.085 14.142  12.870  1.00 32.07  ? 9    DA  C C5    1 
ATOM   175  C C6    . DA  A 1 9  ? 58.894 13.992  14.018  1.00 30.84  ? 9    DA  C C6    1 
ATOM   176  N N6    . DA  A 1 9  ? 60.227 13.894  13.978  1.00 27.88  ? 9    DA  C N6    1 
ATOM   177  N N1    . DA  A 1 9  ? 58.274 13.939  15.218  1.00 28.52  ? 9    DA  C N1    1 
ATOM   178  C C2    . DA  A 1 9  ? 56.935 14.029  15.251  1.00 30.70  ? 9    DA  C C2    1 
ATOM   179  N N3    . DA  A 1 9  ? 56.070 14.167  14.245  1.00 34.36  ? 9    DA  C N3    1 
ATOM   180  C C4    . DA  A 1 9  ? 56.716 14.218  13.064  1.00 33.09  ? 9    DA  C C4    1 
ATOM   181  P P     . DT  A 1 10 ? 51.441 16.726  10.705  1.00 40.63  ? 10   DT  C P     1 
ATOM   182  O OP1   . DT  A 1 10 ? 49.959 16.691  10.606  1.00 38.67  ? 10   DT  C OP1   1 
ATOM   183  O OP2   . DT  A 1 10 ? 52.218 17.732  9.916   1.00 41.37  ? 10   DT  C OP2   1 
ATOM   184  O "O5'" . DT  A 1 10 ? 51.870 16.956  12.216  1.00 37.73  ? 10   DT  C "O5'" 1 
ATOM   185  C "C5'" . DT  A 1 10 ? 51.517 16.011  13.207  1.00 40.65  ? 10   DT  C "C5'" 1 
ATOM   186  C "C4'" . DT  A 1 10 ? 51.897 16.531  14.569  1.00 44.96  ? 10   DT  C "C4'" 1 
ATOM   187  O "O4'" . DT  A 1 10 ? 53.322 16.373  14.777  1.00 45.28  ? 10   DT  C "O4'" 1 
ATOM   188  C "C3'" . DT  A 1 10 ? 51.581 18.011  14.815  1.00 45.80  ? 10   DT  C "C3'" 1 
ATOM   189  O "O3'" . DT  A 1 10 ? 51.030 18.135  16.131  1.00 49.97  ? 10   DT  C "O3'" 1 
ATOM   190  C "C2'" . DT  A 1 10 ? 52.942 18.685  14.709  1.00 43.79  ? 10   DT  C "C2'" 1 
ATOM   191  C "C1'" . DT  A 1 10 ? 53.878 17.597  15.222  1.00 44.82  ? 10   DT  C "C1'" 1 
ATOM   192  N N1    . DT  A 1 10 ? 55.279 17.634  14.758  1.00 44.54  ? 10   DT  C N1    1 
ATOM   193  C C2    . DT  A 1 10 ? 56.248 17.421  15.706  1.00 45.89  ? 10   DT  C C2    1 
ATOM   194  O O2    . DT  A 1 10 ? 55.988 17.252  16.880  1.00 47.46  ? 10   DT  C O2    1 
ATOM   195  N N3    . DT  A 1 10 ? 57.534 17.406  15.227  1.00 45.12  ? 10   DT  C N3    1 
ATOM   196  C C4    . DT  A 1 10 ? 57.935 17.579  13.913  1.00 42.98  ? 10   DT  C C4    1 
ATOM   197  O O4    . DT  A 1 10 ? 59.133 17.524  13.622  1.00 42.98  ? 10   DT  C O4    1 
ATOM   198  C C5    . DT  A 1 10 ? 56.864 17.817  12.970  1.00 43.43  ? 10   DT  C C5    1 
ATOM   199  C C7    . DT  A 1 10 ? 57.205 18.013  11.522  1.00 42.20  ? 10   DT  C C7    1 
ATOM   200  C C6    . DT  A 1 10 ? 55.604 17.844  13.436  1.00 42.40  ? 10   DT  C C6    1 
ATOM   201  P P     . DT  A 1 11 ? 50.475 19.554  16.666  1.00 50.81  ? 11   DT  C P     1 
ATOM   202  O OP1   . DT  A 1 11 ? 49.105 19.309  17.184  1.00 50.57  ? 11   DT  C OP1   1 
ATOM   203  O OP2   . DT  A 1 11 ? 50.706 20.648  15.689  1.00 49.71  ? 11   DT  C OP2   1 
ATOM   204  O "O5'" . DT  A 1 11 ? 51.449 19.851  17.885  1.00 46.89  ? 11   DT  C "O5'" 1 
ATOM   205  C "C5'" . DT  A 1 11 ? 51.803 18.811  18.771  1.00 42.06  ? 11   DT  C "C5'" 1 
ATOM   206  C "C4'" . DT  A 1 11 ? 53.007 19.207  19.591  1.00 42.95  ? 11   DT  C "C4'" 1 
ATOM   207  O "O4'" . DT  A 1 11 ? 54.220 19.165  18.802  1.00 42.73  ? 11   DT  C "O4'" 1 
ATOM   208  C "C3'" . DT  A 1 11 ? 52.962 20.596  20.231  1.00 43.39  ? 11   DT  C "C3'" 1 
ATOM   209  O "O3'" . DT  A 1 11 ? 53.484 20.471  21.559  1.00 47.35  ? 11   DT  C "O3'" 1 
ATOM   210  C "C2'" . DT  A 1 11 ? 53.932 21.398  19.382  1.00 41.47  ? 11   DT  C "C2'" 1 
ATOM   211  C "C1'" . DT  A 1 11 ? 54.972 20.341  19.069  1.00 42.03  ? 11   DT  C "C1'" 1 
ATOM   212  N N1    . DT  A 1 11 ? 55.857 20.603  17.911  1.00 39.82  ? 11   DT  C N1    1 
ATOM   213  C C2    . DT  A 1 11 ? 57.222 20.543  18.127  1.00 36.97  ? 11   DT  C C2    1 
ATOM   214  O O2    . DT  A 1 11 ? 57.707 20.379  19.227  1.00 34.18  ? 11   DT  C O2    1 
ATOM   215  N N3    . DT  A 1 11 ? 57.997 20.699  17.003  1.00 36.82  ? 11   DT  C N3    1 
ATOM   216  C C4    . DT  A 1 11 ? 57.550 20.936  15.719  1.00 37.97  ? 11   DT  C C4    1 
ATOM   217  O O4    . DT  A 1 11 ? 58.360 21.009  14.803  1.00 38.26  ? 11   DT  C O4    1 
ATOM   218  C C5    . DT  A 1 11 ? 56.103 21.063  15.575  1.00 37.34  ? 11   DT  C C5    1 
ATOM   219  C C7    . DT  A 1 11 ? 55.533 21.405  14.237  1.00 32.88  ? 11   DT  C C7    1 
ATOM   220  C C6    . DT  A 1 11 ? 55.340 20.877  16.662  1.00 38.28  ? 11   DT  C C6    1 
ATOM   221  P P     . DT  A 1 12 ? 53.154 21.584  22.670  1.00 49.38  ? 12   DT  C P     1 
ATOM   222  O OP1   . DT  A 1 12 ? 52.469 20.877  23.794  1.00 51.00  ? 12   DT  C OP1   1 
ATOM   223  O OP2   . DT  A 1 12 ? 52.494 22.740  22.011  1.00 47.99  ? 12   DT  C OP2   1 
ATOM   224  O "O5'" . DT  A 1 12 ? 54.600 21.997  23.180  1.00 46.31  ? 12   DT  C "O5'" 1 
ATOM   225  C "C5'" . DT  A 1 12 ? 54.965 23.351  23.375  1.00 45.86  ? 12   DT  C "C5'" 1 
ATOM   226  C "C4'" . DT  A 1 12 ? 56.470 23.459  23.450  1.00 44.96  ? 12   DT  C "C4'" 1 
ATOM   227  O "O4'" . DT  A 1 12 ? 57.083 23.018  22.211  1.00 42.23  ? 12   DT  C "O4'" 1 
ATOM   228  C "C3'" . DT  A 1 12 ? 56.991 24.868  23.705  1.00 44.01  ? 12   DT  C "C3'" 1 
ATOM   229  O "O3'" . DT  A 1 12 ? 58.041 24.809  24.674  1.00 42.72  ? 12   DT  C "O3'" 1 
ATOM   230  C "C2'" . DT  A 1 12 ? 57.503 25.317  22.347  1.00 43.45  ? 12   DT  C "C2'" 1 
ATOM   231  C "C1'" . DT  A 1 12 ? 57.973 24.017  21.727  1.00 40.86  ? 12   DT  C "C1'" 1 
ATOM   232  N N1    . DT  A 1 12 ? 57.937 23.997  20.245  1.00 35.70  ? 12   DT  C N1    1 
ATOM   233  C C2    . DT  A 1 12 ? 59.118 23.757  19.582  1.00 34.10  ? 12   DT  C C2    1 
ATOM   234  O O2    . DT  A 1 12 ? 60.165 23.545  20.158  1.00 34.94  ? 12   DT  C O2    1 
ATOM   235  N N3    . DT  A 1 12 ? 59.028 23.771  18.215  1.00 32.28  ? 12   DT  C N3    1 
ATOM   236  C C4    . DT  A 1 12 ? 57.901 23.995  17.465  1.00 34.05  ? 12   DT  C C4    1 
ATOM   237  O O4    . DT  A 1 12 ? 57.982 24.018  16.247  1.00 34.16  ? 12   DT  C O4    1 
ATOM   238  C C5    . DT  A 1 12 ? 56.691 24.212  18.219  1.00 32.77  ? 12   DT  C C5    1 
ATOM   239  C C7    . DT  A 1 12 ? 55.411 24.425  17.479  1.00 30.84  ? 12   DT  C C7    1 
ATOM   240  C C6    . DT  A 1 12 ? 56.769 24.212  19.557  1.00 31.44  ? 12   DT  C C6    1 
ATOM   241  P P     . DA  A 1 13 ? 58.593 26.165  25.310  1.00 46.08  ? 13   DA  C P     1 
ATOM   242  O OP1   . DA  A 1 13 ? 59.362 25.857  26.543  1.00 45.49  ? 13   DA  C OP1   1 
ATOM   243  O OP2   . DA  A 1 13 ? 57.434 27.100  25.369  1.00 42.02  ? 13   DA  C OP2   1 
ATOM   244  O "O5'" . DA  A 1 13 ? 59.641 26.651  24.221  1.00 46.26  ? 13   DA  C "O5'" 1 
ATOM   245  C "C5'" . DA  A 1 13 ? 60.854 25.937  24.053  1.00 46.31  ? 13   DA  C "C5'" 1 
ATOM   246  C "C4'" . DA  A 1 13 ? 61.737 26.613  23.031  1.00 46.40  ? 13   DA  C "C4'" 1 
ATOM   247  O "O4'" . DA  A 1 13 ? 61.349 26.274  21.674  1.00 44.17  ? 13   DA  C "O4'" 1 
ATOM   248  C "C3'" . DA  A 1 13 ? 61.786 28.142  23.107  1.00 47.50  ? 13   DA  C "C3'" 1 
ATOM   249  O "O3'" . DA  A 1 13 ? 63.151 28.544  23.217  1.00 50.81  ? 13   DA  C "O3'" 1 
ATOM   250  C "C2'" . DA  A 1 13 ? 61.179 28.591  21.783  1.00 44.51  ? 13   DA  C "C2'" 1 
ATOM   251  C "C1'" . DA  A 1 13 ? 61.514 27.426  20.868  1.00 42.25  ? 13   DA  C "C1'" 1 
ATOM   252  N N9    . DA  A 1 13 ? 60.677 27.290  19.669  1.00 37.25  ? 13   DA  C N9    1 
ATOM   253  C C8    . DA  A 1 13 ? 59.302 27.339  19.576  1.00 36.36  ? 13   DA  C C8    1 
ATOM   254  N N7    . DA  A 1 13 ? 58.851 27.256  18.344  1.00 34.75  ? 13   DA  C N7    1 
ATOM   255  C C5    . DA  A 1 13 ? 60.004 27.128  17.574  1.00 32.56  ? 13   DA  C C5    1 
ATOM   256  C C6    . DA  A 1 13 ? 60.209 27.006  16.182  1.00 29.53  ? 13   DA  C C6    1 
ATOM   257  N N6    . DA  A 1 13 ? 59.227 27.042  15.279  1.00 25.19  ? 13   DA  C N6    1 
ATOM   258  N N1    . DA  A 1 13 ? 61.479 26.862  15.740  1.00 29.25  ? 13   DA  C N1    1 
ATOM   259  C C2    . DA  A 1 13 ? 62.476 26.870  16.636  1.00 30.94  ? 13   DA  C C2    1 
ATOM   260  N N3    . DA  A 1 13 ? 62.413 26.997  17.966  1.00 34.39  ? 13   DA  C N3    1 
ATOM   261  C C4    . DA  A 1 13 ? 61.134 27.122  18.377  1.00 33.60  ? 13   DA  C C4    1 
ATOM   262  P P     . DT  A 1 14 ? 63.535 30.102  23.272  1.00 54.19  ? 14   DT  C P     1 
ATOM   263  O OP1   . DT  A 1 14 ? 64.384 30.306  24.480  1.00 50.75  ? 14   DT  C OP1   1 
ATOM   264  O OP2   . DT  A 1 14 ? 62.306 30.917  23.088  1.00 49.58  ? 14   DT  C OP2   1 
ATOM   265  O "O5'" . DT  A 1 14 ? 64.472 30.239  21.993  1.00 52.30  ? 14   DT  C "O5'" 1 
ATOM   266  C "C5'" . DT  A 1 14 ? 65.484 29.264  21.772  1.00 52.33  ? 14   DT  C "C5'" 1 
ATOM   267  C "C4'" . DT  A 1 14 ? 66.306 29.620  20.558  1.00 54.61  ? 14   DT  C "C4'" 1 
ATOM   268  O "O4'" . DT  A 1 14 ? 65.637 29.243  19.325  1.00 53.60  ? 14   DT  C "O4'" 1 
ATOM   269  C "C3'" . DT  A 1 14 ? 66.633 31.115  20.459  1.00 55.44  ? 14   DT  C "C3'" 1 
ATOM   270  O "O3'" . DT  A 1 14 ? 68.023 31.258  20.126  1.00 59.63  ? 14   DT  C "O3'" 1 
ATOM   271  C "C2'" . DT  A 1 14 ? 65.706 31.613  19.367  1.00 52.63  ? 14   DT  C "C2'" 1 
ATOM   272  C "C1'" . DT  A 1 14 ? 65.549 30.390  18.474  1.00 49.36  ? 14   DT  C "C1'" 1 
ATOM   273  N N1    . DT  A 1 14 ? 64.252 30.350  17.772  1.00 45.68  ? 14   DT  C N1    1 
ATOM   274  C C2    . DT  A 1 14 ? 64.223 30.122  16.409  1.00 44.44  ? 14   DT  C C2    1 
ATOM   275  O O2    . DT  A 1 14 ? 65.217 29.984  15.725  1.00 44.16  ? 14   DT  C O2    1 
ATOM   276  N N3    . DT  A 1 14 ? 62.971 30.077  15.872  1.00 40.78  ? 14   DT  C N3    1 
ATOM   277  C C4    . DT  A 1 14 ? 61.769 30.235  16.532  1.00 41.56  ? 14   DT  C C4    1 
ATOM   278  O O4    . DT  A 1 14 ? 60.712 30.130  15.910  1.00 40.64  ? 14   DT  C O4    1 
ATOM   279  C C5    . DT  A 1 14 ? 61.873 30.494  17.942  1.00 40.50  ? 14   DT  C C5    1 
ATOM   280  C C7    . DT  A 1 14 ? 60.619 30.678  18.735  1.00 40.00  ? 14   DT  C C7    1 
ATOM   281  C C6    . DT  A 1 14 ? 63.095 30.540  18.483  1.00 41.82  ? 14   DT  C C6    1 
ATOM   282  P P     . DG  A 1 15 ? 68.754 32.697  20.197  1.00 62.76  ? 15   DG  C P     1 
ATOM   283  O OP1   . DG  A 1 15 ? 70.194 32.503  20.534  1.00 61.48  ? 15   DG  C OP1   1 
ATOM   284  O OP2   . DG  A 1 15 ? 67.933 33.627  21.029  1.00 62.56  ? 15   DG  C OP2   1 
ATOM   285  O "O5'" . DG  A 1 15 ? 68.706 33.170  18.675  1.00 61.57  ? 15   DG  C "O5'" 1 
ATOM   286  C "C5'" . DG  A 1 15 ? 69.259 32.350  17.647  1.00 60.57  ? 15   DG  C "C5'" 1 
ATOM   287  C "C4'" . DG  A 1 15 ? 69.002 32.944  16.280  1.00 60.86  ? 15   DG  C "C4'" 1 
ATOM   288  O "O4'" . DG  A 1 15 ? 67.662 32.667  15.797  1.00 58.58  ? 15   DG  C "O4'" 1 
ATOM   289  C "C3'" . DG  A 1 15 ? 69.194 34.455  16.157  1.00 61.86  ? 15   DG  C "C3'" 1 
ATOM   290  O "O3'" . DG  A 1 15 ? 69.885 34.709  14.930  1.00 67.47  ? 15   DG  C "O3'" 1 
ATOM   291  C "C2'" . DG  A 1 15 ? 67.767 34.977  16.073  1.00 58.00  ? 15   DG  C "C2'" 1 
ATOM   292  C "C1'" . DG  A 1 15 ? 67.073 33.862  15.306  1.00 53.96  ? 15   DG  C "C1'" 1 
ATOM   293  N N9    . DG  A 1 15 ? 65.632 33.769  15.524  1.00 49.63  ? 15   DG  C N9    1 
ATOM   294  C C8    . DG  A 1 15 ? 64.979 33.910  16.724  1.00 47.85  ? 15   DG  C C8    1 
ATOM   295  N N7    . DG  A 1 15 ? 63.688 33.767  16.626  1.00 47.41  ? 15   DG  C N7    1 
ATOM   296  C C5    . DG  A 1 15 ? 63.466 33.522  15.278  1.00 44.32  ? 15   DG  C C5    1 
ATOM   297  C C6    . DG  A 1 15 ? 62.259 33.289  14.583  1.00 44.86  ? 15   DG  C C6    1 
ATOM   298  O O6    . DG  A 1 15 ? 61.104 33.266  15.028  1.00 46.49  ? 15   DG  C O6    1 
ATOM   299  N N1    . DG  A 1 15 ? 62.479 33.070  13.228  1.00 43.39  ? 15   DG  C N1    1 
ATOM   300  C C2    . DG  A 1 15 ? 63.707 33.085  12.618  1.00 46.02  ? 15   DG  C C2    1 
ATOM   301  N N2    . DG  A 1 15 ? 63.699 32.846  11.294  1.00 43.99  ? 15   DG  C N2    1 
ATOM   302  N N3    . DG  A 1 15 ? 64.852 33.315  13.257  1.00 43.80  ? 15   DG  C N3    1 
ATOM   303  C C4    . DG  A 1 15 ? 64.655 33.520  14.579  1.00 46.09  ? 15   DG  C C4    1 
ATOM   304  P P     . DG  A 1 16 ? 70.846 35.989  14.782  1.00 69.70  ? 16   DG  C P     1 
ATOM   305  O OP1   . DG  A 1 16 ? 72.261 35.533  14.864  1.00 69.97  ? 16   DG  C OP1   1 
ATOM   306  O OP2   . DG  A 1 16 ? 70.344 37.009  15.748  1.00 68.03  ? 16   DG  C OP2   1 
ATOM   307  O "O5'" . DG  A 1 16 ? 70.551 36.446  13.277  1.00 68.56  ? 16   DG  C "O5'" 1 
ATOM   308  C "C5'" . DG  A 1 16 ? 70.410 35.475  12.233  1.00 68.37  ? 16   DG  C "C5'" 1 
ATOM   309  C "C4'" . DG  A 1 16 ? 69.428 35.950  11.185  1.00 67.98  ? 16   DG  C "C4'" 1 
ATOM   310  O "O4'" . DG  A 1 16 ? 68.041 35.676  11.518  1.00 65.37  ? 16   DG  C "O4'" 1 
ATOM   311  C "C3'" . DG  A 1 16 ? 69.503 37.441  10.866  1.00 69.32  ? 16   DG  C "C3'" 1 
ATOM   312  O "O3'" . DG  A 1 16 ? 69.542 37.618  9.451   1.00 73.27  ? 16   DG  C "O3'" 1 
ATOM   313  C "C2'" . DG  A 1 16 ? 68.214 38.005  11.446  1.00 66.85  ? 16   DG  C "C2'" 1 
ATOM   314  C "C1'" . DG  A 1 16 ? 67.249 36.842  11.299  1.00 63.18  ? 16   DG  C "C1'" 1 
ATOM   315  N N9    . DG  A 1 16 ? 66.114 36.818  12.227  1.00 58.76  ? 16   DG  C N9    1 
ATOM   316  C C8    . DG  A 1 16 ? 66.145 36.993  13.594  1.00 57.43  ? 16   DG  C C8    1 
ATOM   317  N N7    . DG  A 1 16 ? 64.972 36.896  14.153  1.00 55.75  ? 16   DG  C N7    1 
ATOM   318  C C5    . DG  A 1 16 ? 64.113 36.647  13.099  1.00 54.67  ? 16   DG  C C5    1 
ATOM   319  C C6    . DG  A 1 16 ? 62.718 36.450  13.103  1.00 55.07  ? 16   DG  C C6    1 
ATOM   320  O O6    . DG  A 1 16 ? 61.956 36.454  14.073  1.00 56.50  ? 16   DG  C O6    1 
ATOM   321  N N1    . DG  A 1 16 ? 62.222 36.229  11.822  1.00 53.10  ? 16   DG  C N1    1 
ATOM   322  C C2    . DG  A 1 16 ? 62.988 36.209  10.687  1.00 53.59  ? 16   DG  C C2    1 
ATOM   323  N N2    . DG  A 1 16 ? 62.341 35.985  9.553   1.00 49.62  ? 16   DG  C N2    1 
ATOM   324  N N3    . DG  A 1 16 ? 64.299 36.392  10.670  1.00 52.54  ? 16   DG  C N3    1 
ATOM   325  C C4    . DG  A 1 16 ? 64.794 36.604  11.904  1.00 55.35  ? 16   DG  C C4    1 
ATOM   326  P P     . DG  A 1 17 ? 70.206 38.936  8.833   1.00 76.55  ? 17   DG  C P     1 
ATOM   327  O OP1   . DG  A 1 17 ? 71.450 38.566  8.103   1.00 75.61  ? 17   DG  C OP1   1 
ATOM   328  O OP2   . DG  A 1 17 ? 70.268 39.920  9.955   1.00 75.66  ? 17   DG  C OP2   1 
ATOM   329  O "O5'" . DG  A 1 17 ? 69.117 39.373  7.759   1.00 73.71  ? 17   DG  C "O5'" 1 
ATOM   330  C "C5'" . DG  A 1 17 ? 68.453 38.390  6.974   1.00 72.31  ? 17   DG  C "C5'" 1 
ATOM   331  C "C4'" . DG  A 1 17 ? 67.056 38.848  6.631   1.00 72.10  ? 17   DG  C "C4'" 1 
ATOM   332  O "O4'" . DG  A 1 17 ? 66.145 38.658  7.741   1.00 70.03  ? 17   DG  C "O4'" 1 
ATOM   333  C "C3'" . DG  A 1 17 ? 66.959 40.323  6.247   1.00 73.60  ? 17   DG  C "C3'" 1 
ATOM   334  O "O3'" . DG  A 1 17 ? 66.135 40.477  5.097   1.00 75.87  ? 17   DG  C "O3'" 1 
ATOM   335  C "C2'" . DG  A 1 17 ? 66.293 40.973  7.449   1.00 70.90  ? 17   DG  C "C2'" 1 
ATOM   336  C "C1'" . DG  A 1 17 ? 65.410 39.855  7.969   1.00 68.13  ? 17   DG  C "C1'" 1 
ATOM   337  N N9    . DG  A 1 17 ? 65.081 39.927  9.393   1.00 62.96  ? 17   DG  C N9    1 
ATOM   338  C C8    . DG  A 1 17 ? 65.947 40.125  10.445  1.00 61.62  ? 17   DG  C C8    1 
ATOM   339  N N7    . DG  A 1 17 ? 65.354 40.127  11.607  1.00 59.21  ? 17   DG  C N7    1 
ATOM   340  C C5    . DG  A 1 17 ? 64.016 39.915  11.307  1.00 59.17  ? 17   DG  C C5    1 
ATOM   341  C C6    . DG  A 1 17 ? 62.892 39.810  12.164  1.00 59.15  ? 17   DG  C C6    1 
ATOM   342  O O6    . DG  A 1 17 ? 62.856 39.872  13.405  1.00 60.25  ? 17   DG  C O6    1 
ATOM   343  N N1    . DG  A 1 17 ? 61.717 39.612  11.442  1.00 56.43  ? 17   DG  C N1    1 
ATOM   344  C C2    . DG  A 1 17 ? 61.635 39.521  10.077  1.00 55.36  ? 17   DG  C C2    1 
ATOM   345  N N2    . DG  A 1 17 ? 60.405 39.349  9.571   1.00 52.33  ? 17   DG  C N2    1 
ATOM   346  N N3    . DG  A 1 17 ? 62.681 39.600  9.268   1.00 55.26  ? 17   DG  C N3    1 
ATOM   347  C C4    . DG  A 1 17 ? 63.830 39.799  9.945   1.00 58.50  ? 17   DG  C C4    1 
ATOM   348  P P     . DC  A 1 18 ? 65.831 41.945  4.544   1.00 77.30  ? 18   DC  C P     1 
ATOM   349  O OP1   . DC  A 1 18 ? 65.821 41.860  3.062   1.00 77.29  ? 18   DC  C OP1   1 
ATOM   350  O OP2   . DC  A 1 18 ? 66.757 42.890  5.232   1.00 74.98  ? 18   DC  C OP2   1 
ATOM   351  O "O5'" . DC  A 1 18 ? 64.346 42.213  5.042   1.00 77.51  ? 18   DC  C "O5'" 1 
ATOM   352  C "C5'" . DC  A 1 18 ? 63.284 41.377  4.603   1.00 78.97  ? 18   DC  C "C5'" 1 
ATOM   353  C "C4'" . DC  A 1 18 ? 61.960 41.949  5.044   1.00 80.66  ? 18   DC  C "C4'" 1 
ATOM   354  O "O4'" . DC  A 1 18 ? 61.849 41.844  6.483   1.00 80.28  ? 18   DC  C "O4'" 1 
ATOM   355  C "C3'" . DC  A 1 18 ? 61.786 43.427  4.711   1.00 81.81  ? 18   DC  C "C3'" 1 
ATOM   356  O "O3'" . DC  A 1 18 ? 60.436 43.679  4.330   1.00 84.71  ? 18   DC  C "O3'" 1 
ATOM   357  C "C2'" . DC  A 1 18 ? 62.127 44.122  6.017   1.00 81.14  ? 18   DC  C "C2'" 1 
ATOM   358  C "C1'" . DC  A 1 18 ? 61.636 43.123  7.051   1.00 80.61  ? 18   DC  C "C1'" 1 
ATOM   359  N N1    . DC  A 1 18 ? 62.341 43.164  8.344   1.00 80.45  ? 18   DC  C N1    1 
ATOM   360  C C2    . DC  A 1 18 ? 61.584 43.180  9.522   1.00 80.05  ? 18   DC  C C2    1 
ATOM   361  O O2    . DC  A 1 18 ? 60.347 43.154  9.439   1.00 80.79  ? 18   DC  C O2    1 
ATOM   362  N N3    . DC  A 1 18 ? 62.215 43.220  10.717  1.00 79.45  ? 18   DC  C N3    1 
ATOM   363  C C4    . DC  A 1 18 ? 63.548 43.241  10.765  1.00 80.43  ? 18   DC  C C4    1 
ATOM   364  N N4    . DC  A 1 18 ? 64.126 43.271  11.967  1.00 80.52  ? 18   DC  C N4    1 
ATOM   365  C C5    . DC  A 1 18 ? 64.347 43.228  9.581   1.00 80.31  ? 18   DC  C C5    1 
ATOM   366  C C6    . DC  A 1 18 ? 63.707 43.187  8.402   1.00 80.77  ? 18   DC  C C6    1 
ATOM   367  P P     . DT  A 1 19 ? 60.083 44.990  3.470   1.00 87.38  ? 19   DT  C P     1 
ATOM   368  O OP1   . DT  A 1 19 ? 59.629 44.566  2.118   1.00 86.34  ? 19   DT  C OP1   1 
ATOM   369  O OP2   . DT  A 1 19 ? 61.218 45.940  3.601   1.00 87.09  ? 19   DT  C OP2   1 
ATOM   370  O "O5'" . DT  A 1 19 ? 58.834 45.586  4.254   1.00 87.88  ? 19   DT  C "O5'" 1 
ATOM   371  C "C5'" . DT  A 1 19 ? 57.744 44.741  4.608   1.00 90.05  ? 19   DT  C "C5'" 1 
ATOM   372  C "C4'" . DT  A 1 19 ? 56.972 45.333  5.761   1.00 91.36  ? 19   DT  C "C4'" 1 
ATOM   373  O "O4'" . DT  A 1 19 ? 57.731 45.224  6.991   1.00 90.07  ? 19   DT  C "O4'" 1 
ATOM   374  C "C3'" . DT  A 1 19 ? 56.624 46.815  5.605   1.00 92.92  ? 19   DT  C "C3'" 1 
ATOM   375  O "O3'" . DT  A 1 19 ? 55.287 47.041  6.050   1.00 95.37  ? 19   DT  C "O3'" 1 
ATOM   376  C "C2'" . DT  A 1 19 ? 57.599 47.505  6.544   1.00 91.03  ? 19   DT  C "C2'" 1 
ATOM   377  C "C1'" . DT  A 1 19 ? 57.710 46.477  7.652   1.00 89.54  ? 19   DT  C "C1'" 1 
ATOM   378  N N1    . DT  A 1 19 ? 58.915 46.577  8.502   1.00 87.53  ? 19   DT  C N1    1 
ATOM   379  C C2    . DT  A 1 19 ? 58.742 46.462  9.865   1.00 86.65  ? 19   DT  C C2    1 
ATOM   380  O O2    . DT  A 1 19 ? 57.648 46.292  10.381  1.00 86.82  ? 19   DT  C O2    1 
ATOM   381  N N3    . DT  A 1 19 ? 59.900 46.552  10.603  1.00 84.86  ? 19   DT  C N3    1 
ATOM   382  C C4    . DT  A 1 19 ? 61.181 46.746  10.122  1.00 84.31  ? 19   DT  C C4    1 
ATOM   383  O O4    . DT  A 1 19 ? 62.132 46.781  10.901  1.00 83.06  ? 19   DT  C O4    1 
ATOM   384  C C5    . DT  A 1 19 ? 61.285 46.882  8.684   1.00 84.27  ? 19   DT  C C5    1 
ATOM   385  C C7    . DT  A 1 19 ? 62.628 47.130  8.077   1.00 83.10  ? 19   DT  C C7    1 
ATOM   386  C C6    . DT  A 1 19 ? 60.162 46.785  7.956   1.00 85.74  ? 19   DT  C C6    1 
ATOM   387  P P     . DG  A 1 20 ? 54.493 48.348  5.562   1.00 97.26  ? 20   DG  C P     1 
ATOM   388  O OP1   . DG  A 1 20 ? 53.742 48.020  4.317   1.00 96.57  ? 20   DG  C OP1   1 
ATOM   389  O OP2   . DG  A 1 20 ? 55.467 49.469  5.555   1.00 97.16  ? 20   DG  C OP2   1 
ATOM   390  O "O5'" . DG  A 1 20 ? 53.447 48.595  6.740   1.00 97.03  ? 20   DG  C "O5'" 1 
ATOM   391  C "C5'" . DG  A 1 20 ? 52.741 47.500  7.330   1.00 97.01  ? 20   DG  C "C5'" 1 
ATOM   392  C "C4'" . DG  A 1 20 ? 52.494 47.757  8.800   1.00 96.42  ? 20   DG  C "C4'" 1 
ATOM   393  O "O4'" . DG  A 1 20 ? 53.764 47.834  9.490   1.00 95.52  ? 20   DG  C "O4'" 1 
ATOM   394  C "C3'" . DG  A 1 20 ? 51.779 49.070  9.112   1.00 96.31  ? 20   DG  C "C3'" 1 
ATOM   395  O "O3'" . DG  A 1 20 ? 51.109 48.962  10.376  1.00 96.55  ? 20   DG  C "O3'" 1 
ATOM   396  C "C2'" . DG  A 1 20 ? 52.935 50.031  9.312   1.00 95.46  ? 20   DG  C "C2'" 1 
ATOM   397  C "C1'" . DG  A 1 20 ? 53.951 49.144  10.017  1.00 94.34  ? 20   DG  C "C1'" 1 
ATOM   398  N N9    . DG  A 1 20 ? 55.343 49.521  9.789   1.00 92.47  ? 20   DG  C N9    1 
ATOM   399  C C8    . DG  A 1 20 ? 55.904 49.987  8.624   1.00 91.52  ? 20   DG  C C8    1 
ATOM   400  N N7    . DG  A 1 20 ? 57.183 50.226  8.732   1.00 90.61  ? 20   DG  C N7    1 
ATOM   401  C C5    . DG  A 1 20 ? 57.484 49.900  10.048  1.00 89.87  ? 20   DG  C C5    1 
ATOM   402  C C6    . DG  A 1 20 ? 58.718 49.946  10.750  1.00 89.23  ? 20   DG  C C6    1 
ATOM   403  O O6    . DG  A 1 20 ? 59.829 50.296  10.336  1.00 88.47  ? 20   DG  C O6    1 
ATOM   404  N N1    . DG  A 1 20 ? 58.573 49.525  12.070  1.00 88.87  ? 20   DG  C N1    1 
ATOM   405  C C2    . DG  A 1 20 ? 57.394 49.114  12.646  1.00 89.57  ? 20   DG  C C2    1 
ATOM   406  N N2    . DG  A 1 20 ? 57.457 48.747  13.941  1.00 88.65  ? 20   DG  C N2    1 
ATOM   407  N N3    . DG  A 1 20 ? 56.237 49.066  12.002  1.00 89.81  ? 20   DG  C N3    1 
ATOM   408  C C4    . DG  A 1 20 ? 56.357 49.469  10.716  1.00 90.73  ? 20   DG  C C4    1 
ATOM   409  O "O5'" . DT  B 2 1  ? 66.314 54.985  14.150  1.00 100.19 ? 21   DT  D "O5'" 1 
ATOM   410  C "C5'" . DT  B 2 1  ? 66.001 53.841  14.939  1.00 98.56  ? 21   DT  D "C5'" 1 
ATOM   411  C "C4'" . DT  B 2 1  ? 65.071 54.186  16.080  1.00 98.19  ? 21   DT  D "C4'" 1 
ATOM   412  O "O4'" . DT  B 2 1  ? 63.839 54.719  15.546  1.00 96.81  ? 21   DT  D "O4'" 1 
ATOM   413  C "C3'" . DT  B 2 1  ? 64.674 52.984  16.929  1.00 98.19  ? 21   DT  D "C3'" 1 
ATOM   414  O "O3'" . DT  B 2 1  ? 64.554 53.344  18.305  1.00 99.36  ? 21   DT  D "O3'" 1 
ATOM   415  C "C2'" . DT  B 2 1  ? 63.342 52.550  16.348  1.00 97.00  ? 21   DT  D "C2'" 1 
ATOM   416  C "C1'" . DT  B 2 1  ? 62.754 53.824  15.759  1.00 95.50  ? 21   DT  D "C1'" 1 
ATOM   417  N N1    . DT  B 2 1  ? 62.114 53.602  14.447  1.00 93.93  ? 21   DT  D N1    1 
ATOM   418  C C2    . DT  B 2 1  ? 60.741 53.490  14.373  1.00 93.41  ? 21   DT  D C2    1 
ATOM   419  O O2    . DT  B 2 1  ? 60.010 53.528  15.348  1.00 93.74  ? 21   DT  D O2    1 
ATOM   420  N N3    . DT  B 2 1  ? 60.251 53.319  13.101  1.00 92.25  ? 21   DT  D N3    1 
ATOM   421  C C4    . DT  B 2 1  ? 60.979 53.234  11.929  1.00 92.37  ? 21   DT  D C4    1 
ATOM   422  O O4    . DT  B 2 1  ? 60.400 53.088  10.854  1.00 91.23  ? 21   DT  D O4    1 
ATOM   423  C C5    . DT  B 2 1  ? 62.412 53.335  12.086  1.00 92.77  ? 21   DT  D C5    1 
ATOM   424  C C7    . DT  B 2 1  ? 63.284 53.225  10.875  1.00 92.92  ? 21   DT  D C7    1 
ATOM   425  C C6    . DT  B 2 1  ? 62.899 53.518  13.319  1.00 93.09  ? 21   DT  D C6    1 
ATOM   426  P P     . DC  B 2 2  ? 64.813 52.230  19.432  1.00 100.32 ? 22   DC  D P     1 
ATOM   427  O OP1   . DC  B 2 2  ? 64.649 52.811  20.787  1.00 100.70 ? 22   DC  D OP1   1 
ATOM   428  O OP2   . DC  B 2 2  ? 66.090 51.549  19.076  1.00 100.62 ? 22   DC  D OP2   1 
ATOM   429  O "O5'" . DC  B 2 2  ? 63.622 51.197  19.206  1.00 99.17  ? 22   DC  D "O5'" 1 
ATOM   430  C "C5'" . DC  B 2 2  ? 62.274 51.541  19.495  1.00 96.30  ? 22   DC  D "C5'" 1 
ATOM   431  C "C4'" . DC  B 2 2  ? 61.360 50.402  19.103  1.00 95.18  ? 22   DC  D "C4'" 1 
ATOM   432  O "O4'" . DC  B 2 2  ? 61.139 50.430  17.674  1.00 94.91  ? 22   DC  D "O4'" 1 
ATOM   433  C "C3'" . DC  B 2 2  ? 61.900 49.002  19.423  1.00 94.29  ? 22   DC  D "C3'" 1 
ATOM   434  O "O3'" . DC  B 2 2  ? 60.870 48.177  19.950  1.00 92.81  ? 22   DC  D "O3'" 1 
ATOM   435  C "C2'" . DC  B 2 2  ? 62.298 48.438  18.071  1.00 93.82  ? 22   DC  D "C2'" 1 
ATOM   436  C "C1'" . DC  B 2 2  ? 61.335 49.133  17.132  1.00 93.80  ? 22   DC  D "C1'" 1 
ATOM   437  N N1    . DC  B 2 2  ? 61.795 49.284  15.735  1.00 93.10  ? 22   DC  D N1    1 
ATOM   438  C C2    . DC  B 2 2  ? 60.829 49.476  14.749  1.00 93.01  ? 22   DC  D C2    1 
ATOM   439  O O2    . DC  B 2 2  ? 59.640 49.535  15.092  1.00 92.63  ? 22   DC  D O2    1 
ATOM   440  N N3    . DC  B 2 2  ? 61.210 49.597  13.451  1.00 92.96  ? 22   DC  D N3    1 
ATOM   441  C C4    . DC  B 2 2  ? 62.506 49.539  13.129  1.00 93.42  ? 22   DC  D C4    1 
ATOM   442  N N4    . DC  B 2 2  ? 62.836 49.662  11.840  1.00 93.99  ? 22   DC  D N4    1 
ATOM   443  C C5    . DC  B 2 2  ? 63.519 49.352  14.119  1.00 92.93  ? 22   DC  D C5    1 
ATOM   444  C C6    . DC  B 2 2  ? 63.123 49.231  15.397  1.00 92.80  ? 22   DC  D C6    1 
ATOM   445  P P     . DA  B 2 3  ? 61.178 47.225  21.202  1.00 91.49  ? 23   DA  D P     1 
ATOM   446  O OP1   . DA  B 2 3  ? 61.539 48.109  22.337  1.00 91.98  ? 23   DA  D OP1   1 
ATOM   447  O OP2   . DA  B 2 3  ? 62.119 46.149  20.780  1.00 91.88  ? 23   DA  D OP2   1 
ATOM   448  O "O5'" . DA  B 2 3  ? 59.757 46.572  21.486  1.00 87.53  ? 23   DA  D "O5'" 1 
ATOM   449  C "C5'" . DA  B 2 3  ? 58.603 47.390  21.637  1.00 81.21  ? 23   DA  D "C5'" 1 
ATOM   450  C "C4'" . DA  B 2 3  ? 57.436 46.777  20.901  1.00 78.65  ? 23   DA  D "C4'" 1 
ATOM   451  O "O4'" . DA  B 2 3  ? 57.696 46.795  19.478  1.00 75.79  ? 23   DA  D "O4'" 1 
ATOM   452  C "C3'" . DA  B 2 3  ? 57.170 45.314  21.253  1.00 78.49  ? 23   DA  D "C3'" 1 
ATOM   453  O "O3'" . DA  B 2 3  ? 55.757 45.069  21.212  1.00 80.98  ? 23   DA  D "O3'" 1 
ATOM   454  C "C2'" . DA  B 2 3  ? 57.947 44.551  20.196  1.00 75.42  ? 23   DA  D "C2'" 1 
ATOM   455  C "C1'" . DA  B 2 3  ? 57.877 45.466  18.981  1.00 73.20  ? 23   DA  D "C1'" 1 
ATOM   456  N N9    . DA  B 2 3  ? 59.104 45.464  18.177  1.00 69.30  ? 23   DA  D N9    1 
ATOM   457  C C8    . DA  B 2 3  ? 60.397 45.333  18.629  1.00 66.92  ? 23   DA  D C8    1 
ATOM   458  N N7    . DA  B 2 3  ? 61.304 45.423  17.683  1.00 62.78  ? 23   DA  D N7    1 
ATOM   459  C C5    . DA  B 2 3  ? 60.558 45.614  16.524  1.00 62.89  ? 23   DA  D C5    1 
ATOM   460  C C6    . DA  B 2 3  ? 60.922 45.792  15.162  1.00 62.12  ? 23   DA  D C6    1 
ATOM   461  N N6    . DA  B 2 3  ? 62.188 45.802  14.708  1.00 59.97  ? 23   DA  D N6    1 
ATOM   462  N N1    . DA  B 2 3  ? 59.919 45.962  14.266  1.00 61.14  ? 23   DA  D N1    1 
ATOM   463  C C2    . DA  B 2 3  ? 58.652 45.942  14.705  1.00 62.49  ? 23   DA  D C2    1 
ATOM   464  N N3    . DA  B 2 3  ? 58.189 45.779  15.942  1.00 63.16  ? 23   DA  D N3    1 
ATOM   465  C C4    . DA  B 2 3  ? 59.201 45.624  16.813  1.00 64.56  ? 23   DA  D C4    1 
ATOM   466  P P     . DG  B 2 4  ? 55.195 43.566  21.209  1.00 81.92  ? 24   DG  D P     1 
ATOM   467  O OP1   . DG  B 2 4  ? 53.761 43.574  21.618  1.00 80.24  ? 24   DG  D OP1   1 
ATOM   468  O OP2   . DG  B 2 4  ? 56.179 42.739  21.968  1.00 82.37  ? 24   DG  D OP2   1 
ATOM   469  O "O5'" . DG  B 2 4  ? 55.213 43.188  19.663  1.00 79.16  ? 24   DG  D "O5'" 1 
ATOM   470  C "C5'" . DG  B 2 4  ? 54.304 43.823  18.767  1.00 75.67  ? 24   DG  D "C5'" 1 
ATOM   471  C "C4'" . DG  B 2 4  ? 54.243 43.080  17.453  1.00 72.08  ? 24   DG  D "C4'" 1 
ATOM   472  O "O4'" . DG  B 2 4  ? 55.480 43.267  16.716  1.00 69.55  ? 24   DG  D "O4'" 1 
ATOM   473  C "C3'" . DG  B 2 4  ? 54.039 41.573  17.591  1.00 70.30  ? 24   DG  D "C3'" 1 
ATOM   474  O "O3'" . DG  B 2 4  ? 53.033 41.152  16.674  1.00 71.08  ? 24   DG  D "O3'" 1 
ATOM   475  C "C2'" . DG  B 2 4  ? 55.404 40.983  17.270  1.00 68.12  ? 24   DG  D "C2'" 1 
ATOM   476  C "C1'" . DG  B 2 4  ? 56.043 42.016  16.351  1.00 65.19  ? 24   DG  D "C1'" 1 
ATOM   477  N N9    . DG  B 2 4  ? 57.494 42.115  16.502  1.00 59.12  ? 24   DG  D N9    1 
ATOM   478  C C8    . DG  B 2 4  ? 58.211 41.979  17.666  1.00 58.70  ? 24   DG  D C8    1 
ATOM   479  N N7    . DG  B 2 4  ? 59.502 42.067  17.492  1.00 55.52  ? 24   DG  D N7    1 
ATOM   480  C C5    . DG  B 2 4  ? 59.645 42.280  16.132  1.00 54.60  ? 24   DG  D C5    1 
ATOM   481  C C6    . DG  B 2 4  ? 60.817 42.429  15.357  1.00 54.77  ? 24   DG  D C6    1 
ATOM   482  O O6    . DG  B 2 4  ? 62.003 42.375  15.731  1.00 55.89  ? 24   DG  D O6    1 
ATOM   483  N N1    . DG  B 2 4  ? 60.517 42.643  14.016  1.00 53.30  ? 24   DG  D N1    1 
ATOM   484  C C2    . DG  B 2 4  ? 59.247 42.685  13.490  1.00 54.17  ? 24   DG  D C2    1 
ATOM   485  N N2    . DG  B 2 4  ? 59.162 42.888  12.167  1.00 55.27  ? 24   DG  D N2    1 
ATOM   486  N N3    . DG  B 2 4  ? 58.141 42.533  14.208  1.00 54.56  ? 24   DG  D N3    1 
ATOM   487  C C4    . DG  B 2 4  ? 58.415 42.335  15.510  1.00 55.54  ? 24   DG  D C4    1 
ATOM   488  P P     . DC  B 2 5  ? 52.731 39.588  16.465  1.00 72.62  ? 25   DC  D P     1 
ATOM   489  O OP1   . DC  B 2 5  ? 51.259 39.385  16.621  1.00 70.87  ? 25   DC  D OP1   1 
ATOM   490  O OP2   . DC  B 2 5  ? 53.670 38.786  17.291  1.00 72.52  ? 25   DC  D OP2   1 
ATOM   491  O "O5'" . DC  B 2 5  ? 53.121 39.412  14.935  1.00 69.46  ? 25   DC  D "O5'" 1 
ATOM   492  C "C5'" . DC  B 2 5  ? 52.786 40.427  13.999  1.00 63.38  ? 25   DC  D "C5'" 1 
ATOM   493  C "C4'" . DC  B 2 5  ? 53.293 40.047  12.633  1.00 60.71  ? 25   DC  D "C4'" 1 
ATOM   494  O "O4'" . DC  B 2 5  ? 54.682 40.437  12.634  1.00 58.53  ? 25   DC  D "O4'" 1 
ATOM   495  C "C3'" . DC  B 2 5  ? 53.245 38.545  12.310  1.00 59.81  ? 25   DC  D "C3'" 1 
ATOM   496  O "O3'" . DC  B 2 5  ? 52.666 38.243  11.032  1.00 58.99  ? 25   DC  D "O3'" 1 
ATOM   497  C "C2'" . DC  B 2 5  ? 54.699 38.111  12.358  1.00 59.33  ? 25   DC  D "C2'" 1 
ATOM   498  C "C1'" . DC  B 2 5  ? 55.494 39.397  12.170  1.00 56.06  ? 25   DC  D "C1'" 1 
ATOM   499  N N1    . DC  B 2 5  ? 56.739 39.421  12.947  1.00 53.98  ? 25   DC  D N1    1 
ATOM   500  C C2    . DC  B 2 5  ? 57.950 39.621  12.268  1.00 53.40  ? 25   DC  D C2    1 
ATOM   501  O O2    . DC  B 2 5  ? 57.923 39.852  11.053  1.00 56.62  ? 25   DC  D O2    1 
ATOM   502  N N3    . DC  B 2 5  ? 59.115 39.563  12.955  1.00 50.30  ? 25   DC  D N3    1 
ATOM   503  C C4    . DC  B 2 5  ? 59.100 39.343  14.277  1.00 48.61  ? 25   DC  D C4    1 
ATOM   504  N N4    . DC  B 2 5  ? 60.273 39.291  14.916  1.00 46.24  ? 25   DC  D N4    1 
ATOM   505  C C5    . DC  B 2 5  ? 57.879 39.168  15.001  1.00 47.95  ? 25   DC  D C5    1 
ATOM   506  C C6    . DC  B 2 5  ? 56.730 39.222  14.303  1.00 51.37  ? 25   DC  D C6    1 
ATOM   507  P P     . DC  B 2 6  ? 52.382 36.701  10.623  1.00 59.69  ? 26   DC  D P     1 
ATOM   508  O OP1   . DC  B 2 6  ? 51.187 36.622  9.736   1.00 60.12  ? 26   DC  D OP1   1 
ATOM   509  O OP2   . DC  B 2 6  ? 52.420 35.864  11.842  1.00 58.88  ? 26   DC  D OP2   1 
ATOM   510  O "O5'" . DC  B 2 6  ? 53.649 36.363  9.715   1.00 61.25  ? 26   DC  D "O5'" 1 
ATOM   511  C "C5'" . DC  B 2 6  ? 53.960 37.188  8.591   1.00 56.26  ? 26   DC  D "C5'" 1 
ATOM   512  C "C4'" . DC  B 2 6  ? 55.211 36.702  7.897   1.00 56.62  ? 26   DC  D "C4'" 1 
ATOM   513  O "O4'" . DC  B 2 6  ? 56.413 36.935  8.674   1.00 54.55  ? 26   DC  D "O4'" 1 
ATOM   514  C "C3'" . DC  B 2 6  ? 55.207 35.219  7.546   1.00 55.86  ? 26   DC  D "C3'" 1 
ATOM   515  O "O3'" . DC  B 2 6  ? 55.748 35.076  6.238   1.00 57.11  ? 26   DC  D "O3'" 1 
ATOM   516  C "C2'" . DC  B 2 6  ? 56.111 34.605  8.600   1.00 54.45  ? 26   DC  D "C2'" 1 
ATOM   517  C "C1'" . DC  B 2 6  ? 57.122 35.713  8.857   1.00 53.43  ? 26   DC  D "C1'" 1 
ATOM   518  N N1    . DC  B 2 6  ? 57.727 35.737  10.209  1.00 51.60  ? 26   DC  D N1    1 
ATOM   519  C C2    . DC  B 2 6  ? 59.126 35.776  10.329  1.00 49.31  ? 26   DC  D C2    1 
ATOM   520  O O2    . DC  B 2 6  ? 59.811 35.726  9.306   1.00 49.91  ? 26   DC  D O2    1 
ATOM   521  N N3    . DC  B 2 6  ? 59.689 35.863  11.557  1.00 47.15  ? 26   DC  D N3    1 
ATOM   522  C C4    . DC  B 2 6  ? 58.912 35.905  12.642  1.00 46.72  ? 26   DC  D C4    1 
ATOM   523  N N4    . DC  B 2 6  ? 59.505 36.018  13.842  1.00 45.41  ? 26   DC  D N4    1 
ATOM   524  C C5    . DC  B 2 6  ? 57.490 35.838  12.554  1.00 46.37  ? 26   DC  D C5    1 
ATOM   525  C C6    . DC  B 2 6  ? 56.945 35.748  11.331  1.00 49.79  ? 26   DC  D C6    1 
ATOM   526  P P     . DC  B 2 7  ? 55.560 33.702  5.446   1.00 59.65  ? 27   DC  D P     1 
ATOM   527  O OP1   . DC  B 2 7  ? 55.328 34.002  4.016   1.00 59.68  ? 27   DC  D OP1   1 
ATOM   528  O OP2   . DC  B 2 7  ? 54.596 32.851  6.179   1.00 59.12  ? 27   DC  D OP2   1 
ATOM   529  O "O5'" . DC  B 2 7  ? 57.002 33.077  5.590   1.00 56.31  ? 27   DC  D "O5'" 1 
ATOM   530  C "C5'" . DC  B 2 7  ? 58.135 33.908  5.442   1.00 54.64  ? 27   DC  D "C5'" 1 
ATOM   531  C "C4'" . DC  B 2 7  ? 59.382 33.109  5.713   1.00 53.80  ? 27   DC  D "C4'" 1 
ATOM   532  O "O4'" . DC  B 2 7  ? 59.826 33.282  7.084   1.00 53.47  ? 27   DC  D "O4'" 1 
ATOM   533  C "C3'" . DC  B 2 7  ? 59.179 31.610  5.502   1.00 53.16  ? 27   DC  D "C3'" 1 
ATOM   534  O "O3'" . DC  B 2 7  ? 60.256 31.126  4.704   1.00 53.40  ? 27   DC  D "O3'" 1 
ATOM   535  C "C2'" . DC  B 2 7  ? 59.186 31.043  6.919   1.00 51.68  ? 27   DC  D "C2'" 1 
ATOM   536  C "C1'" . DC  B 2 7  ? 60.081 32.018  7.675   1.00 49.95  ? 27   DC  D "C1'" 1 
ATOM   537  N N1    . DC  B 2 7  ? 59.836 32.144  9.132   1.00 47.81  ? 27   DC  D N1    1 
ATOM   538  C C2    . DC  B 2 7  ? 60.929 32.397  9.990   1.00 46.37  ? 27   DC  D C2    1 
ATOM   539  O O2    . DC  B 2 7  ? 62.066 32.522  9.507   1.00 48.52  ? 27   DC  D O2    1 
ATOM   540  N N3    . DC  B 2 7  ? 60.715 32.505  11.318  1.00 46.32  ? 27   DC  D N3    1 
ATOM   541  C C4    . DC  B 2 7  ? 59.478 32.387  11.804  1.00 47.01  ? 27   DC  D C4    1 
ATOM   542  N N4    . DC  B 2 7  ? 59.312 32.516  13.126  1.00 45.29  ? 27   DC  D N4    1 
ATOM   543  C C5    . DC  B 2 7  ? 58.353 32.133  10.962  1.00 43.89  ? 27   DC  D C5    1 
ATOM   544  C C6    . DC  B 2 7  ? 58.576 32.019  9.646   1.00 45.91  ? 27   DC  D C6    1 
ATOM   545  P P     . DA  B 2 8  ? 60.302 29.587  4.254   1.00 51.75  ? 28   DA  D P     1 
ATOM   546  O OP1   . DA  B 2 8  ? 60.644 29.510  2.813   1.00 53.87  ? 28   DA  D OP1   1 
ATOM   547  O OP2   . DA  B 2 8  ? 59.069 28.910  4.756   1.00 49.18  ? 28   DA  D OP2   1 
ATOM   548  O "O5'" . DA  B 2 8  ? 61.602 29.095  5.014   1.00 49.12  ? 28   DA  D "O5'" 1 
ATOM   549  C "C5'" . DA  B 2 8  ? 62.789 29.868  4.956   1.00 46.82  ? 28   DA  D "C5'" 1 
ATOM   550  C "C4'" . DA  B 2 8  ? 63.806 29.311  5.918   1.00 47.57  ? 28   DA  D "C4'" 1 
ATOM   551  O "O4'" . DA  B 2 8  ? 63.453 29.671  7.282   1.00 46.98  ? 28   DA  D "O4'" 1 
ATOM   552  C "C3'" . DA  B 2 8  ? 63.878 27.785  5.877   1.00 46.83  ? 28   DA  D "C3'" 1 
ATOM   553  O "O3'" . DA  B 2 8  ? 65.243 27.372  5.851   1.00 47.99  ? 28   DA  D "O3'" 1 
ATOM   554  C "C2'" . DA  B 2 8  ? 63.139 27.349  7.138   1.00 44.23  ? 28   DA  D "C2'" 1 
ATOM   555  C "C1'" . DA  B 2 8  ? 63.370 28.511  8.096   1.00 41.67  ? 28   DA  D "C1'" 1 
ATOM   556  N N9    . DA  B 2 8  ? 62.328 28.733  9.117   1.00 36.12  ? 28   DA  D N9    1 
ATOM   557  C C8    . DA  B 2 8  ? 60.955 28.635  9.005   1.00 35.69  ? 28   DA  D C8    1 
ATOM   558  N N7    . DA  B 2 8  ? 60.309 28.854  10.128  1.00 30.19  ? 28   DA  D N7    1 
ATOM   559  C C5    . DA  B 2 8  ? 61.318 29.129  11.037  1.00 31.97  ? 28   DA  D C5    1 
ATOM   560  C C6    . DA  B 2 8  ? 61.288 29.458  12.408  1.00 31.49  ? 28   DA  D C6    1 
ATOM   561  N N6    . DA  B 2 8  ? 60.165 29.560  13.119  1.00 31.43  ? 28   DA  D N6    1 
ATOM   562  N N1    . DA  B 2 8  ? 62.468 29.684  13.027  1.00 32.20  ? 28   DA  D N1    1 
ATOM   563  C C2    . DA  B 2 8  ? 63.599 29.587  12.302  1.00 33.33  ? 28   DA  D C2    1 
ATOM   564  N N3    . DA  B 2 8  ? 63.755 29.289  11.008  1.00 32.15  ? 28   DA  D N3    1 
ATOM   565  C C4    . DA  B 2 8  ? 62.565 29.068  10.427  1.00 31.83  ? 28   DA  D C4    1 
ATOM   566  P P     . DT  B 2 9  ? 65.604 25.809  5.830   1.00 48.74  ? 29   DT  D P     1 
ATOM   567  O OP1   . DT  B 2 9  ? 66.916 25.663  5.159   1.00 47.96  ? 29   DT  D OP1   1 
ATOM   568  O OP2   . DT  B 2 9  ? 64.414 25.078  5.313   1.00 46.74  ? 29   DT  D OP2   1 
ATOM   569  O "O5'" . DT  B 2 9  ? 65.838 25.502  7.373   1.00 48.36  ? 29   DT  D "O5'" 1 
ATOM   570  C "C5'" . DT  B 2 9  ? 66.706 26.356  8.114   1.00 44.66  ? 29   DT  D "C5'" 1 
ATOM   571  C "C4'" . DT  B 2 9  ? 66.760 25.961  9.571   1.00 43.40  ? 29   DT  D "C4'" 1 
ATOM   572  O "O4'" . DT  B 2 9  ? 65.628 26.487  10.320  1.00 40.68  ? 29   DT  D "O4'" 1 
ATOM   573  C "C3'" . DT  B 2 9  ? 66.859 24.466  9.878   1.00 39.22  ? 29   DT  D "C3'" 1 
ATOM   574  O "O3'" . DT  B 2 9  ? 68.053 24.255  10.633  1.00 40.74  ? 29   DT  D "O3'" 1 
ATOM   575  C "C2'" . DT  B 2 9  ? 65.587 24.180  10.668  1.00 39.36  ? 29   DT  D "C2'" 1 
ATOM   576  C "C1'" . DT  B 2 9  ? 65.211 25.535  11.269  1.00 37.03  ? 29   DT  D "C1'" 1 
ATOM   577  N N1    . DT  B 2 9  ? 63.760 25.745  11.531  1.00 33.56  ? 29   DT  D N1    1 
ATOM   578  C C2    . DT  B 2 9  ? 63.373 26.193  12.789  1.00 32.75  ? 29   DT  D C2    1 
ATOM   579  O O2    . DT  B 2 9  ? 64.162 26.505  13.668  1.00 36.57  ? 29   DT  D O2    1 
ATOM   580  N N3    . DT  B 2 9  ? 62.015 26.270  12.977  1.00 27.98  ? 29   DT  D N3    1 
ATOM   581  C C4    . DT  B 2 9  ? 61.027 25.963  12.063  1.00 26.77  ? 29   DT  D C4    1 
ATOM   582  O O4    . DT  B 2 9  ? 59.838 26.044  12.386  1.00 21.62  ? 29   DT  D O4    1 
ATOM   583  C C5    . DT  B 2 9  ? 61.500 25.543  10.764  1.00 24.35  ? 29   DT  D C5    1 
ATOM   584  C C7    . DT  B 2 9  ? 60.494 25.202  9.713   1.00 22.09  ? 29   DT  D C7    1 
ATOM   585  C C6    . DT  B 2 9  ? 62.822 25.469  10.561  1.00 27.96  ? 29   DT  D C6    1 
ATOM   586  P P     . DA  B 2 10 ? 68.461 22.781  11.137  1.00 43.50  ? 30   DA  D P     1 
ATOM   587  O OP1   . DA  B 2 10 ? 69.939 22.636  11.020  1.00 39.02  ? 30   DA  D OP1   1 
ATOM   588  O OP2   . DA  B 2 10 ? 67.580 21.750  10.548  1.00 39.82  ? 30   DA  D OP2   1 
ATOM   589  O "O5'" . DA  B 2 10 ? 68.132 22.903  12.688  1.00 44.56  ? 30   DA  D "O5'" 1 
ATOM   590  C "C5'" . DA  B 2 10 ? 68.642 24.014  13.415  1.00 40.06  ? 30   DA  D "C5'" 1 
ATOM   591  C "C4'" . DA  B 2 10 ? 68.346 23.867  14.884  1.00 41.66  ? 30   DA  D "C4'" 1 
ATOM   592  O "O4'" . DA  B 2 10 ? 66.959 24.168  15.147  1.00 38.95  ? 30   DA  D "O4'" 1 
ATOM   593  C "C3'" . DA  B 2 10 ? 68.623 22.492  15.491  1.00 40.68  ? 30   DA  D "C3'" 1 
ATOM   594  O "O3'" . DA  B 2 10 ? 69.316 22.684  16.726  1.00 42.94  ? 30   DA  D "O3'" 1 
ATOM   595  C "C2'" . DA  B 2 10 ? 67.233 21.906  15.691  1.00 37.96  ? 30   DA  D "C2'" 1 
ATOM   596  C "C1'" . DA  B 2 10 ? 66.362 23.142  15.910  1.00 36.57  ? 30   DA  D "C1'" 1 
ATOM   597  N N9    . DA  B 2 10 ? 64.988 23.050  15.429  1.00 34.16  ? 30   DA  D N9    1 
ATOM   598  C C8    . DA  B 2 10 ? 64.605 22.744  14.153  1.00 33.50  ? 30   DA  D C8    1 
ATOM   599  N N7    . DA  B 2 10 ? 63.312 22.823  13.958  1.00 33.18  ? 30   DA  D N7    1 
ATOM   600  C C5    . DA  B 2 10 ? 62.806 23.188  15.198  1.00 31.46  ? 30   DA  D C5    1 
ATOM   601  C C6    . DA  B 2 10 ? 61.499 23.434  15.649  1.00 29.31  ? 30   DA  D C6    1 
ATOM   602  N N6    . DA  B 2 10 ? 60.416 23.367  14.870  1.00 26.44  ? 30   DA  D N6    1 
ATOM   603  N N1    . DA  B 2 10 ? 61.335 23.757  16.945  1.00 29.92  ? 30   DA  D N1    1 
ATOM   604  C C2    . DA  B 2 10 ? 62.419 23.827  17.729  1.00 31.11  ? 30   DA  D C2    1 
ATOM   605  N N3    . DA  B 2 10 ? 63.701 23.631  17.420  1.00 32.41  ? 30   DA  D N3    1 
ATOM   606  C C4    . DA  B 2 10 ? 63.826 23.310  16.120  1.00 31.65  ? 30   DA  D C4    1 
ATOM   607  P P     . DA  B 2 11 ? 70.148 21.478  17.386  1.00 45.72  ? 31   DA  D P     1 
ATOM   608  O OP1   . DA  B 2 11 ? 71.092 22.098  18.347  1.00 44.37  ? 31   DA  D OP1   1 
ATOM   609  O OP2   . DA  B 2 11 ? 70.660 20.541  16.349  1.00 43.88  ? 31   DA  D OP2   1 
ATOM   610  O "O5'" . DA  B 2 11 ? 69.034 20.759  18.248  1.00 45.83  ? 31   DA  D "O5'" 1 
ATOM   611  C "C5'" . DA  B 2 11 ? 68.399 21.486  19.283  1.00 43.92  ? 31   DA  D "C5'" 1 
ATOM   612  C "C4'" . DA  B 2 11 ? 67.233 20.711  19.837  1.00 43.24  ? 31   DA  D "C4'" 1 
ATOM   613  O "O4'" . DA  B 2 11 ? 66.044 20.865  19.027  1.00 41.77  ? 31   DA  D "O4'" 1 
ATOM   614  C "C3'" . DA  B 2 11 ? 67.450 19.211  20.016  1.00 45.56  ? 31   DA  D "C3'" 1 
ATOM   615  O "O3'" . DA  B 2 11 ? 67.089 18.907  21.354  1.00 50.70  ? 31   DA  D "O3'" 1 
ATOM   616  C "C2'" . DA  B 2 11 ? 66.467 18.579  19.036  1.00 41.97  ? 31   DA  D "C2'" 1 
ATOM   617  C "C1'" . DA  B 2 11 ? 65.363 19.629  18.967  1.00 39.65  ? 31   DA  D "C1'" 1 
ATOM   618  N N9    . DA  B 2 11 ? 64.519 19.637  17.767  1.00 34.87  ? 31   DA  D N9    1 
ATOM   619  C C8    . DA  B 2 11 ? 64.871 19.348  16.478  1.00 33.48  ? 31   DA  D C8    1 
ATOM   620  N N7    . DA  B 2 11 ? 63.880 19.466  15.621  1.00 35.93  ? 31   DA  D N7    1 
ATOM   621  C C5    . DA  B 2 11 ? 62.800 19.850  16.403  1.00 31.99  ? 31   DA  D C5    1 
ATOM   622  C C6    . DA  B 2 11 ? 61.441 20.137  16.097  1.00 32.26  ? 31   DA  D C6    1 
ATOM   623  N N6    . DA  B 2 11 ? 60.925 20.110  14.865  1.00 29.39  ? 31   DA  D N6    1 
ATOM   624  N N1    . DA  B 2 11 ? 60.624 20.466  17.122  1.00 31.50  ? 31   DA  D N1    1 
ATOM   625  C C2    . DA  B 2 11 ? 61.142 20.523  18.346  1.00 29.20  ? 31   DA  D C2    1 
ATOM   626  N N3    . DA  B 2 11 ? 62.396 20.295  18.755  1.00 33.02  ? 31   DA  D N3    1 
ATOM   627  C C4    . DA  B 2 11 ? 63.180 19.953  17.726  1.00 33.43  ? 31   DA  D C4    1 
ATOM   628  P P     . DA  B 2 12 ? 67.479 17.492  21.986  1.00 53.00  ? 32   DA  D P     1 
ATOM   629  O OP1   . DA  B 2 12 ? 68.416 17.716  23.114  1.00 52.16  ? 32   DA  D OP1   1 
ATOM   630  O OP2   . DA  B 2 12 ? 67.865 16.587  20.889  1.00 54.76  ? 32   DA  D OP2   1 
ATOM   631  O "O5'" . DA  B 2 12 ? 66.082 17.044  22.584  1.00 49.04  ? 32   DA  D "O5'" 1 
ATOM   632  C "C5'" . DA  B 2 12 ? 65.338 17.983  23.326  1.00 45.23  ? 32   DA  D "C5'" 1 
ATOM   633  C "C4'" . DA  B 2 12 ? 63.868 17.685  23.227  1.00 42.97  ? 32   DA  D "C4'" 1 
ATOM   634  O "O4'" . DA  B 2 12 ? 63.378 17.897  21.880  1.00 42.38  ? 32   DA  D "O4'" 1 
ATOM   635  C "C3'" . DA  B 2 12 ? 63.468 16.263  23.618  1.00 40.68  ? 32   DA  D "C3'" 1 
ATOM   636  O "O3'" . DA  B 2 12 ? 62.355 16.391  24.501  1.00 42.47  ? 32   DA  D "O3'" 1 
ATOM   637  C "C2'" . DA  B 2 12 ? 63.050 15.631  22.299  1.00 38.80  ? 32   DA  D "C2'" 1 
ATOM   638  C "C1'" . DA  B 2 12 ? 62.505 16.835  21.543  1.00 40.72  ? 32   DA  D "C1'" 1 
ATOM   639  N N9    . DA  B 2 12 ? 62.474 16.725  20.083  1.00 39.70  ? 32   DA  D N9    1 
ATOM   640  C C8    . DA  B 2 12 ? 63.508 16.396  19.242  1.00 36.50  ? 32   DA  D C8    1 
ATOM   641  N N7    . DA  B 2 12 ? 63.175 16.386  17.973  1.00 37.62  ? 32   DA  D N7    1 
ATOM   642  C C5    . DA  B 2 12 ? 61.830 16.732  17.974  1.00 34.92  ? 32   DA  D C5    1 
ATOM   643  C C6    . DA  B 2 12 ? 60.887 16.888  16.936  1.00 35.08  ? 32   DA  D C6    1 
ATOM   644  N N6    . DA  B 2 12 ? 61.167 16.731  15.636  1.00 28.01  ? 32   DA  D N6    1 
ATOM   645  N N1    . DA  B 2 12 ? 59.622 17.219  17.284  1.00 35.38  ? 32   DA  D N1    1 
ATOM   646  C C2    . DA  B 2 12 ? 59.339 17.387  18.583  1.00 35.49  ? 32   DA  D C2    1 
ATOM   647  N N3    . DA  B 2 12 ? 60.136 17.276  19.641  1.00 34.67  ? 32   DA  D N3    1 
ATOM   648  C C4    . DA  B 2 12 ? 61.382 16.940  19.267  1.00 36.40  ? 32   DA  D C4    1 
ATOM   649  P P     . DT  B 2 13 ? 61.766 15.107  25.253  1.00 43.97  ? 33   DT  D P     1 
ATOM   650  O OP1   . DT  B 2 13 ? 61.302 15.568  26.592  1.00 46.51  ? 33   DT  D OP1   1 
ATOM   651  O OP2   . DT  B 2 13 ? 62.746 13.997  25.160  1.00 42.31  ? 33   DT  D OP2   1 
ATOM   652  O "O5'" . DT  B 2 13 ? 60.495 14.745  24.371  1.00 40.88  ? 33   DT  D "O5'" 1 
ATOM   653  C "C5'" . DT  B 2 13 ? 59.457 15.690  24.192  1.00 39.19  ? 33   DT  D "C5'" 1 
ATOM   654  C "C4'" . DT  B 2 13 ? 58.380 15.110  23.310  1.00 43.10  ? 33   DT  D "C4'" 1 
ATOM   655  O "O4'" . DT  B 2 13 ? 58.746 15.173  21.910  1.00 42.48  ? 33   DT  D "O4'" 1 
ATOM   656  C "C3'" . DT  B 2 13 ? 58.036 13.642  23.584  1.00 44.36  ? 33   DT  D "C3'" 1 
ATOM   657  O "O3'" . DT  B 2 13 ? 56.631 13.483  23.412  1.00 49.27  ? 33   DT  D "O3'" 1 
ATOM   658  C "C2'" . DT  B 2 13 ? 58.733 12.912  22.448  1.00 41.92  ? 33   DT  D "C2'" 1 
ATOM   659  C "C1'" . DT  B 2 13 ? 58.502 13.903  21.327  1.00 40.72  ? 33   DT  D "C1'" 1 
ATOM   660  N N1    . DT  B 2 13 ? 59.343 13.774  20.118  1.00 38.21  ? 33   DT  D N1    1 
ATOM   661  C C2    . DT  B 2 13 ? 58.728 14.015  18.904  1.00 36.46  ? 33   DT  D C2    1 
ATOM   662  O O2    . DT  B 2 13 ? 57.546 14.306  18.804  1.00 35.19  ? 33   DT  D O2    1 
ATOM   663  N N3    . DT  B 2 13 ? 59.546 13.900  17.810  1.00 35.27  ? 33   DT  D N3    1 
ATOM   664  C C4    . DT  B 2 13 ? 60.886 13.568  17.804  1.00 37.27  ? 33   DT  D C4    1 
ATOM   665  O O4    . DT  B 2 13 ? 61.491 13.493  16.738  1.00 36.07  ? 33   DT  D O4    1 
ATOM   666  C C5    . DT  B 2 13 ? 61.473 13.322  19.119  1.00 36.92  ? 33   DT  D C5    1 
ATOM   667  C C7    . DT  B 2 13 ? 62.925 12.965  19.215  1.00 34.26  ? 33   DT  D C7    1 
ATOM   668  C C6    . DT  B 2 13 ? 60.676 13.431  20.193  1.00 35.47  ? 33   DT  D C6    1 
ATOM   669  P P     . DC  B 2 14 ? 55.864 12.295  24.158  1.00 50.57  ? 34   DC  D P     1 
ATOM   670  O OP1   . DC  B 2 14 ? 55.365 12.823  25.452  1.00 52.61  ? 34   DC  D OP1   1 
ATOM   671  O OP2   . DC  B 2 14 ? 56.753 11.106  24.135  1.00 49.12  ? 34   DC  D OP2   1 
ATOM   672  O "O5'" . DC  B 2 14 ? 54.618 12.043  23.205  1.00 47.18  ? 34   DC  D "O5'" 1 
ATOM   673  C "C5'" . DC  B 2 14 ? 53.895 13.141  22.678  1.00 48.58  ? 34   DC  D "C5'" 1 
ATOM   674  C "C4'" . DC  B 2 14 ? 53.324 12.802  21.322  1.00 53.04  ? 34   DC  D "C4'" 1 
ATOM   675  O "O4'" . DC  B 2 14 ? 54.347 12.845  20.299  1.00 53.04  ? 34   DC  D "O4'" 1 
ATOM   676  C "C3'" . DC  B 2 14 ? 52.675 11.426  21.214  1.00 55.84  ? 34   DC  D "C3'" 1 
ATOM   677  O "O3'" . DC  B 2 14 ? 51.424 11.536  20.552  1.00 62.77  ? 34   DC  D "O3'" 1 
ATOM   678  C "C2'" . DC  B 2 14 ? 53.652 10.629  20.366  1.00 53.72  ? 34   DC  D "C2'" 1 
ATOM   679  C "C1'" . DC  B 2 14 ? 54.233 11.703  19.470  1.00 51.66  ? 34   DC  D "C1'" 1 
ATOM   680  N N1    . DC  B 2 14 ? 55.569 11.394  18.927  1.00 50.88  ? 34   DC  D N1    1 
ATOM   681  C C2    . DC  B 2 14 ? 55.727 11.306  17.540  1.00 48.01  ? 34   DC  D C2    1 
ATOM   682  O O2    . DC  B 2 14 ? 54.747 11.481  16.821  1.00 48.28  ? 34   DC  D O2    1 
ATOM   683  N N3    . DC  B 2 14 ? 56.940 11.025  17.024  1.00 46.40  ? 34   DC  D N3    1 
ATOM   684  C C4    . DC  B 2 14 ? 57.977 10.819  17.837  1.00 47.65  ? 34   DC  D C4    1 
ATOM   685  N N4    . DC  B 2 14 ? 59.161 10.536  17.283  1.00 45.73  ? 34   DC  D N4    1 
ATOM   686  C C5    . DC  B 2 14 ? 57.849 10.895  19.258  1.00 48.39  ? 34   DC  D C5    1 
ATOM   687  C C6    . DC  B 2 14 ? 56.638 11.189  19.755  1.00 50.04  ? 34   DC  D C6    1 
ATOM   688  P P     . DA  B 2 15 ? 50.350 10.353  20.709  1.00 70.66  ? 35   DA  D P     1 
ATOM   689  O OP1   . DA  B 2 15 ? 49.096 10.864  21.330  1.00 70.95  ? 35   DA  D OP1   1 
ATOM   690  O OP2   . DA  B 2 15 ? 51.072 9.204   21.325  1.00 68.04  ? 35   DA  D OP2   1 
ATOM   691  O "O5'" . DA  B 2 15 ? 50.042 9.982   19.202  1.00 70.00  ? 35   DA  D "O5'" 1 
ATOM   692  C "C5'" . DA  B 2 15 ? 51.113 9.972   18.279  1.00 72.49  ? 35   DA  D "C5'" 1 
ATOM   693  C "C4'" . DA  B 2 15 ? 50.761 9.149   17.069  1.00 72.99  ? 35   DA  D "C4'" 1 
ATOM   694  O "O4'" . DA  B 2 15 ? 52.013 8.921   16.394  1.00 71.95  ? 35   DA  D "O4'" 1 
ATOM   695  C "C3'" . DA  B 2 15 ? 50.194 7.763   17.368  1.00 73.97  ? 35   DA  D "C3'" 1 
ATOM   696  O "O3'" . DA  B 2 15 ? 49.340 7.381   16.272  1.00 78.49  ? 35   DA  D "O3'" 1 
ATOM   697  C "C2'" . DA  B 2 15 ? 51.434 6.896   17.486  1.00 71.44  ? 35   DA  D "C2'" 1 
ATOM   698  C "C1'" . DA  B 2 15 ? 52.424 7.573   16.546  1.00 69.73  ? 35   DA  D "C1'" 1 
ATOM   699  N N9    . DA  B 2 15 ? 53.791 7.596   17.051  1.00 65.13  ? 35   DA  D N9    1 
ATOM   700  C C8    . DA  B 2 15 ? 54.195 7.591   18.358  1.00 63.55  ? 35   DA  D C8    1 
ATOM   701  N N7    . DA  B 2 15 ? 55.497 7.602   18.509  1.00 62.48  ? 35   DA  D N7    1 
ATOM   702  C C5    . DA  B 2 15 ? 55.983 7.620   17.207  1.00 60.87  ? 35   DA  D C5    1 
ATOM   703  C C6    . DA  B 2 15 ? 57.288 7.634   16.679  1.00 59.55  ? 35   DA  D C6    1 
ATOM   704  N N6    . DA  B 2 15 ? 58.395 7.632   17.427  1.00 56.80  ? 35   DA  D N6    1 
ATOM   705  N N1    . DA  B 2 15 ? 57.418 7.650   15.336  1.00 59.59  ? 35   DA  D N1    1 
ATOM   706  C C2    . DA  B 2 15 ? 56.309 7.654   14.585  1.00 60.02  ? 35   DA  D C2    1 
ATOM   707  N N3    . DA  B 2 15 ? 55.036 7.643   14.961  1.00 60.33  ? 35   DA  D N3    1 
ATOM   708  C C4    . DA  B 2 15 ? 54.940 7.623   16.301  1.00 61.94  ? 35   DA  D C4    1 
ATOM   709  P P     . DT  B 2 16 ? 48.650 5.917   16.231  1.00 81.02  ? 36   DT  D P     1 
ATOM   710  O OP1   . DT  B 2 16 ? 47.317 6.068   15.582  1.00 80.00  ? 36   DT  D OP1   1 
ATOM   711  O OP2   . DT  B 2 16 ? 48.744 5.297   17.582  1.00 78.44  ? 36   DT  D OP2   1 
ATOM   712  O "O5'" . DT  B 2 16 ? 49.575 5.086   15.231  1.00 78.34  ? 36   DT  D "O5'" 1 
ATOM   713  C "C5'" . DT  B 2 16 ? 49.884 5.593   13.932  1.00 75.06  ? 36   DT  D "C5'" 1 
ATOM   714  C "C4'" . DT  B 2 16 ? 51.001 4.790   13.306  1.00 72.96  ? 36   DT  D "C4'" 1 
ATOM   715  O "O4'" . DT  B 2 16 ? 52.260 5.050   13.977  1.00 72.53  ? 36   DT  D "O4'" 1 
ATOM   716  C "C3'" . DT  B 2 16 ? 50.807 3.272   13.360  1.00 72.07  ? 36   DT  D "C3'" 1 
ATOM   717  O "O3'" . DT  B 2 16 ? 51.269 2.698   12.143  1.00 71.79  ? 36   DT  D "O3'" 1 
ATOM   718  C "C2'" . DT  B 2 16 ? 51.756 2.843   14.464  1.00 71.73  ? 36   DT  D "C2'" 1 
ATOM   719  C "C1'" . DT  B 2 16 ? 52.891 3.809   14.219  1.00 71.78  ? 36   DT  D "C1'" 1 
ATOM   720  N N1    . DT  B 2 16 ? 53.864 3.972   15.312  1.00 71.78  ? 36   DT  D N1    1 
ATOM   721  C C2    . DT  B 2 16 ? 55.180 4.072   14.954  1.00 72.08  ? 36   DT  D C2    1 
ATOM   722  O O2    . DT  B 2 16 ? 55.549 4.051   13.795  1.00 72.76  ? 36   DT  D O2    1 
ATOM   723  N N3    . DT  B 2 16 ? 56.054 4.200   16.002  1.00 72.45  ? 36   DT  D N3    1 
ATOM   724  C C4    . DT  B 2 16 ? 55.743 4.234   17.347  1.00 72.69  ? 36   DT  D C4    1 
ATOM   725  O O4    . DT  B 2 16 ? 56.643 4.348   18.182  1.00 73.64  ? 36   DT  D O4    1 
ATOM   726  C C5    . DT  B 2 16 ? 54.334 4.127   17.653  1.00 71.70  ? 36   DT  D C5    1 
ATOM   727  C C7    . DT  B 2 16 ? 53.894 4.149   19.083  1.00 71.56  ? 36   DT  D C7    1 
ATOM   728  C C6    . DT  B 2 16 ? 53.477 4.009   16.633  1.00 71.88  ? 36   DT  D C6    1 
ATOM   729  P P     . DA  B 2 17 ? 50.215 2.191   11.056  1.00 72.57  ? 37   DA  D P     1 
ATOM   730  O OP1   . DA  B 2 17 ? 49.198 3.253   10.869  1.00 73.00  ? 37   DA  D OP1   1 
ATOM   731  O OP2   . DA  B 2 17 ? 49.794 0.824   11.425  1.00 73.92  ? 37   DA  D OP2   1 
ATOM   732  O "O5'" . DA  B 2 17 ? 51.082 2.109   9.734   1.00 73.41  ? 37   DA  D "O5'" 1 
ATOM   733  C "C5'" . DA  B 2 17 ? 51.701 3.274   9.213   1.00 73.81  ? 37   DA  D "C5'" 1 
ATOM   734  C "C4'" . DA  B 2 17 ? 53.051 2.919   8.637   1.00 74.75  ? 37   DA  D "C4'" 1 
ATOM   735  O "O4'" . DA  B 2 17 ? 54.030 2.713   9.684   1.00 74.07  ? 37   DA  D "O4'" 1 
ATOM   736  C "C3'" . DA  B 2 17 ? 53.052 1.646   7.794   1.00 74.90  ? 37   DA  D "C3'" 1 
ATOM   737  O "O3'" . DA  B 2 17 ? 53.871 1.881   6.641   1.00 77.11  ? 37   DA  D "O3'" 1 
ATOM   738  C "C2'" . DA  B 2 17 ? 53.587 0.590   8.749   1.00 73.80  ? 37   DA  D "C2'" 1 
ATOM   739  C "C1'" . DA  B 2 17 ? 54.526 1.375   9.659   1.00 73.20  ? 37   DA  D "C1'" 1 
ATOM   740  N N9    . DA  B 2 17 ? 54.593 0.922   11.053  1.00 71.48  ? 37   DA  D N9    1 
ATOM   741  C C8    . DA  B 2 17 ? 53.549 0.528   11.855  1.00 70.76  ? 37   DA  D C8    1 
ATOM   742  N N7    . DA  B 2 17 ? 53.894 0.304   13.101  1.00 69.95  ? 37   DA  D N7    1 
ATOM   743  C C5    . DA  B 2 17 ? 55.260 0.549   13.119  1.00 70.84  ? 37   DA  D C5    1 
ATOM   744  C C6    . DA  B 2 17 ? 56.219 0.522   14.155  1.00 71.46  ? 37   DA  D C6    1 
ATOM   745  N N6    . DA  B 2 17 ? 55.932 0.259   15.432  1.00 72.97  ? 37   DA  D N6    1 
ATOM   746  N N1    . DA  B 2 17 ? 57.501 0.791   13.830  1.00 71.81  ? 37   DA  D N1    1 
ATOM   747  C C2    . DA  B 2 17 ? 57.789 1.082   12.556  1.00 71.91  ? 37   DA  D C2    1 
ATOM   748  N N3    . DA  B 2 17 ? 56.978 1.162   11.502  1.00 71.92  ? 37   DA  D N3    1 
ATOM   749  C C4    . DA  B 2 17 ? 55.712 0.884   11.854  1.00 71.17  ? 37   DA  D C4    1 
ATOM   750  P P     . DG  B 2 18 ? 54.285 0.669   5.679   1.00 78.21  ? 38   DG  D P     1 
ATOM   751  O OP1   . DG  B 2 18 ? 54.644 1.245   4.353   1.00 78.63  ? 38   DG  D OP1   1 
ATOM   752  O OP2   . DG  B 2 18 ? 53.226 -0.380  5.768   1.00 78.39  ? 38   DG  D OP2   1 
ATOM   753  O "O5'" . DG  B 2 18 ? 55.619 0.136   6.362   1.00 77.91  ? 38   DG  D "O5'" 1 
ATOM   754  C "C5'" . DG  B 2 18 ? 56.121 -1.152  6.064   1.00 76.52  ? 38   DG  D "C5'" 1 
ATOM   755  C "C4'" . DG  B 2 18 ? 57.349 -1.442  6.893   1.00 75.15  ? 38   DG  D "C4'" 1 
ATOM   756  O "O4'" . DG  B 2 18 ? 57.090 -1.254  8.307   1.00 73.17  ? 38   DG  D "O4'" 1 
ATOM   757  C "C3'" . DG  B 2 18 ? 57.785 -2.893  6.742   1.00 75.83  ? 38   DG  D "C3'" 1 
ATOM   758  O "O3'" . DG  B 2 18 ? 59.202 -2.969  6.706   1.00 77.97  ? 38   DG  D "O3'" 1 
ATOM   759  C "C2'" . DG  B 2 18 ? 57.224 -3.565  7.980   1.00 74.60  ? 38   DG  D "C2'" 1 
ATOM   760  C "C1'" . DG  B 2 18 ? 57.362 -2.464  9.006   1.00 71.94  ? 38   DG  D "C1'" 1 
ATOM   761  N N9    . DG  B 2 18 ? 56.420 -2.577  10.116  1.00 69.03  ? 38   DG  D N9    1 
ATOM   762  C C8    . DG  B 2 18 ? 55.062 -2.782  10.049  1.00 67.99  ? 38   DG  D C8    1 
ATOM   763  N N7    . DG  B 2 18 ? 54.495 -2.835  11.223  1.00 66.16  ? 38   DG  D N7    1 
ATOM   764  C C5    . DG  B 2 18 ? 55.541 -2.653  12.114  1.00 65.63  ? 38   DG  D C5    1 
ATOM   765  C C6    . DG  B 2 18 ? 55.542 -2.596  13.527  1.00 64.79  ? 38   DG  D C6    1 
ATOM   766  O O6    . DG  B 2 18 ? 54.582 -2.676  14.305  1.00 64.86  ? 38   DG  D O6    1 
ATOM   767  N N1    . DG  B 2 18 ? 56.823 -2.402  14.025  1.00 64.58  ? 38   DG  D N1    1 
ATOM   768  C C2    . DG  B 2 18 ? 57.955 -2.251  13.261  1.00 65.03  ? 38   DG  D C2    1 
ATOM   769  N N2    . DG  B 2 18 ? 59.102 -2.041  13.924  1.00 64.29  ? 38   DG  D N2    1 
ATOM   770  N N3    . DG  B 2 18 ? 57.963 -2.292  11.944  1.00 65.08  ? 38   DG  D N3    1 
ATOM   771  C C4    . DG  B 2 18 ? 56.734 -2.496  11.443  1.00 66.36  ? 38   DG  D C4    1 
ATOM   772  P P     . DA  B 2 19 ? 59.908 -3.597  5.420   1.00 79.88  ? 39   DA  D P     1 
ATOM   773  O OP1   . DA  B 2 19 ? 59.638 -2.692  4.279   1.00 79.01  ? 39   DA  D OP1   1 
ATOM   774  O OP2   . DA  B 2 19 ? 59.476 -5.018  5.356   1.00 79.34  ? 39   DA  D OP2   1 
ATOM   775  O "O5'" . DA  B 2 19 ? 61.454 -3.548  5.784   1.00 79.80  ? 39   DA  D "O5'" 1 
ATOM   776  C "C5'" . DA  B 2 19 ? 62.015 -2.409  6.421   1.00 81.29  ? 39   DA  D "C5'" 1 
ATOM   777  C "C4'" . DA  B 2 19 ? 62.700 -2.823  7.701   1.00 83.82  ? 39   DA  D "C4'" 1 
ATOM   778  O "O4'" . DA  B 2 19 ? 61.715 -3.143  8.711   1.00 84.44  ? 39   DA  D "O4'" 1 
ATOM   779  C "C3'" . DA  B 2 19 ? 63.578 -4.066  7.575   1.00 85.57  ? 39   DA  D "C3'" 1 
ATOM   780  O "O3'" . DA  B 2 19 ? 64.716 -3.928  8.432   1.00 87.67  ? 39   DA  D "O3'" 1 
ATOM   781  C "C2'" . DA  B 2 19 ? 62.670 -5.177  8.074   1.00 84.80  ? 39   DA  D "C2'" 1 
ATOM   782  C "C1'" . DA  B 2 19 ? 61.924 -4.466  9.183   1.00 84.03  ? 39   DA  D "C1'" 1 
ATOM   783  N N9    . DA  B 2 19 ? 60.616 -5.020  9.529   1.00 83.27  ? 39   DA  D N9    1 
ATOM   784  C C8    . DA  B 2 19 ? 59.636 -5.503  8.696   1.00 82.84  ? 39   DA  D C8    1 
ATOM   785  N N7    . DA  B 2 19 ? 58.538 -5.857  9.321   1.00 82.39  ? 39   DA  D N7    1 
ATOM   786  C C5    . DA  B 2 19 ? 58.820 -5.604  10.657  1.00 82.48  ? 39   DA  D C5    1 
ATOM   787  C C6    . DA  B 2 19 ? 58.059 -5.753  11.833  1.00 82.51  ? 39   DA  D C6    1 
ATOM   788  N N6    . DA  B 2 19 ? 56.797 -6.193  11.847  1.00 82.69  ? 39   DA  D N6    1 
ATOM   789  N N1    . DA  B 2 19 ? 58.644 -5.423  13.008  1.00 81.84  ? 39   DA  D N1    1 
ATOM   790  C C2    . DA  B 2 19 ? 59.904 -4.968  12.990  1.00 81.66  ? 39   DA  D C2    1 
ATOM   791  N N3    . DA  B 2 19 ? 60.717 -4.775  11.952  1.00 82.09  ? 39   DA  D N3    1 
ATOM   792  C C4    . DA  B 2 19 ? 60.105 -5.113  10.803  1.00 82.63  ? 39   DA  D C4    1 
ATOM   793  P P     . DG  B 2 20 ? 66.067 -4.730  8.100   1.00 89.64  ? 40   DG  D P     1 
ATOM   794  O OP1   . DG  B 2 20 ? 67.216 -3.788  8.182   1.00 90.26  ? 40   DG  D OP1   1 
ATOM   795  O OP2   . DG  B 2 20 ? 65.817 -5.484  6.840   1.00 89.48  ? 40   DG  D OP2   1 
ATOM   796  O "O5'" . DG  B 2 20 ? 66.185 -5.766  9.301   1.00 88.17  ? 40   DG  D "O5'" 1 
ATOM   797  C "C5'" . DG  B 2 20 ? 65.023 -6.167  10.003  1.00 87.65  ? 40   DG  D "C5'" 1 
ATOM   798  C "C4'" . DG  B 2 20 ? 65.350 -6.432  11.452  1.00 87.49  ? 40   DG  D "C4'" 1 
ATOM   799  O "O4'" . DG  B 2 20 ? 64.101 -6.681  12.126  1.00 87.47  ? 40   DG  D "O4'" 1 
ATOM   800  C "C3'" . DG  B 2 20 ? 66.170 -7.695  11.673  1.00 87.30  ? 40   DG  D "C3'" 1 
ATOM   801  O "O3'" . DG  B 2 20 ? 66.693 -7.648  13.010  1.00 86.04  ? 40   DG  D "O3'" 1 
ATOM   802  C "C2'" . DG  B 2 20 ? 65.102 -8.773  11.600  1.00 86.67  ? 40   DG  D "C2'" 1 
ATOM   803  C "C1'" . DG  B 2 20 ? 63.865 -8.083  12.189  1.00 85.68  ? 40   DG  D "C1'" 1 
ATOM   804  N N9    . DG  B 2 20 ? 62.636 -8.334  11.446  1.00 82.94  ? 40   DG  D N9    1 
ATOM   805  C C8    . DG  B 2 20 ? 62.502 -8.445  10.083  1.00 81.71  ? 40   DG  D C8    1 
ATOM   806  N N7    . DG  B 2 20 ? 61.270 -8.645  9.704   1.00 81.12  ? 40   DG  D N7    1 
ATOM   807  C C5    . DG  B 2 20 ? 60.547 -8.675  10.888  1.00 80.42  ? 40   DG  D C5    1 
ATOM   808  C C6    . DG  B 2 20 ? 59.157 -8.859  11.111  1.00 79.77  ? 40   DG  D C6    1 
ATOM   809  O O6    . DG  B 2 20 ? 58.255 -9.037  10.277  1.00 78.34  ? 40   DG  D O6    1 
ATOM   810  N N1    . DG  B 2 20 ? 58.853 -8.815  12.468  1.00 79.41  ? 40   DG  D N1    1 
ATOM   811  C C2    . DG  B 2 20 ? 59.764 -8.617  13.478  1.00 80.02  ? 40   DG  D C2    1 
ATOM   812  N N2    . DG  B 2 20 ? 59.273 -8.592  14.724  1.00 80.52  ? 40   DG  D N2    1 
ATOM   813  N N3    . DG  B 2 20 ? 61.061 -8.451  13.282  1.00 80.17  ? 40   DG  D N3    1 
ATOM   814  C C4    . DG  B 2 20 ? 61.379 -8.488  11.972  1.00 81.32  ? 40   DG  D C4    1 
ATOM   815  N N     . GLY C 3 1  ? 75.073 1.761   14.413  1.00 58.62  ? 74   GLY A N     1 
ATOM   816  C CA    . GLY C 3 1  ? 74.067 2.871   14.349  1.00 58.26  ? 74   GLY A CA    1 
ATOM   817  C C     . GLY C 3 1  ? 74.715 4.246   14.435  1.00 56.88  ? 74   GLY A C     1 
ATOM   818  O O     . GLY C 3 1  ? 74.060 5.274   14.277  1.00 56.89  ? 74   GLY A O     1 
ATOM   819  N N     . LYS C 3 2  ? 76.022 4.250   14.664  1.00 54.89  ? 75   LYS A N     1 
ATOM   820  C CA    . LYS C 3 2  ? 76.814 5.465   14.800  1.00 54.08  ? 75   LYS A CA    1 
ATOM   821  C C     . LYS C 3 2  ? 77.281 6.040   13.456  1.00 54.36  ? 75   LYS A C     1 
ATOM   822  O O     . LYS C 3 2  ? 77.724 5.293   12.585  1.00 55.78  ? 75   LYS A O     1 
ATOM   823  C CB    . LYS C 3 2  ? 78.013 5.138   15.697  1.00 53.21  ? 75   LYS A CB    1 
ATOM   824  C CG    . LYS C 3 2  ? 79.378 5.623   15.243  1.00 53.61  ? 75   LYS A CG    1 
ATOM   825  C CD    . LYS C 3 2  ? 79.589 7.095   15.518  1.00 53.78  ? 75   LYS A CD    1 
ATOM   826  C CE    . LYS C 3 2  ? 81.071 7.438   15.464  1.00 54.95  ? 75   LYS A CE    1 
ATOM   827  N NZ    . LYS C 3 2  ? 81.335 8.896   15.645  1.00 54.75  ? 75   LYS A NZ    1 
ATOM   828  N N     . LYS C 3 3  ? 77.186 7.360   13.283  1.00 52.43  ? 76   LYS A N     1 
ATOM   829  C CA    . LYS C 3 3  ? 77.617 7.996   12.035  1.00 49.95  ? 76   LYS A CA    1 
ATOM   830  C C     . LYS C 3 3  ? 79.082 8.420   12.045  1.00 48.90  ? 76   LYS A C     1 
ATOM   831  O O     . LYS C 3 3  ? 79.577 8.978   13.012  1.00 48.75  ? 76   LYS A O     1 
ATOM   832  C CB    . LYS C 3 3  ? 76.749 9.212   11.728  1.00 50.15  ? 76   LYS A CB    1 
ATOM   833  C CG    . LYS C 3 3  ? 75.293 8.880   11.543  1.00 48.64  ? 76   LYS A CG    1 
ATOM   834  C CD    . LYS C 3 3  ? 75.090 7.967   10.356  1.00 45.97  ? 76   LYS A CD    1 
ATOM   835  C CE    . LYS C 3 3  ? 73.615 7.646   10.206  1.00 47.44  ? 76   LYS A CE    1 
ATOM   836  N NZ    . LYS C 3 3  ? 73.350 6.712   9.098   1.00 46.80  ? 76   LYS A NZ    1 
ATOM   837  N N     . ASN C 3 4  ? 79.764 8.174   10.938  1.00 48.02  ? 77   ASN A N     1 
ATOM   838  C CA    . ASN C 3 4  ? 81.170 8.510   10.817  1.00 47.70  ? 77   ASN A CA    1 
ATOM   839  C C     . ASN C 3 4  ? 81.466 9.462   9.673   1.00 47.29  ? 77   ASN A C     1 
ATOM   840  O O     . ASN C 3 4  ? 82.191 9.109   8.749   1.00 46.39  ? 77   ASN A O     1 
ATOM   841  C CB    . ASN C 3 4  ? 81.987 7.232   10.620  1.00 49.90  ? 77   ASN A CB    1 
ATOM   842  C CG    . ASN C 3 4  ? 82.014 6.369   11.857  1.00 50.64  ? 77   ASN A CG    1 
ATOM   843  O OD1   . ASN C 3 4  ? 82.483 6.803   12.909  1.00 52.12  ? 77   ASN A OD1   1 
ATOM   844  N ND2   . ASN C 3 4  ? 81.504 5.149   11.746  1.00 49.10  ? 77   ASN A ND2   1 
ATOM   845  N N     . PRO C 3 5  ? 80.929 10.689  9.724   1.00 47.79  ? 78   PRO A N     1 
ATOM   846  C CA    . PRO C 3 5  ? 81.194 11.639  8.640   1.00 47.48  ? 78   PRO A CA    1 
ATOM   847  C C     . PRO C 3 5  ? 82.686 11.763  8.328   1.00 48.86  ? 78   PRO A C     1 
ATOM   848  O O     . PRO C 3 5  ? 83.519 11.829  9.227   1.00 48.93  ? 78   PRO A O     1 
ATOM   849  C CB    . PRO C 3 5  ? 80.598 12.939  9.169   1.00 47.12  ? 78   PRO A CB    1 
ATOM   850  C CG    . PRO C 3 5  ? 80.734 12.794  10.663  1.00 47.06  ? 78   PRO A CG    1 
ATOM   851  C CD    . PRO C 3 5  ? 80.305 11.368  10.875  1.00 48.13  ? 78   PRO A CD    1 
ATOM   852  N N     . PRO C 3 6  ? 83.043 11.793  7.040   1.00 49.98  ? 79   PRO A N     1 
ATOM   853  C CA    . PRO C 3 6  ? 84.452 11.909  6.660   1.00 50.98  ? 79   PRO A CA    1 
ATOM   854  C C     . PRO C 3 6  ? 85.077 13.193  7.189   1.00 51.46  ? 79   PRO A C     1 
ATOM   855  O O     . PRO C 3 6  ? 86.297 13.350  7.187   1.00 53.43  ? 79   PRO A O     1 
ATOM   856  C CB    . PRO C 3 6  ? 84.392 11.885  5.136   1.00 50.31  ? 79   PRO A CB    1 
ATOM   857  C CG    . PRO C 3 6  ? 83.090 12.568  4.861   1.00 50.40  ? 79   PRO A CG    1 
ATOM   858  C CD    . PRO C 3 6  ? 82.172 11.917  5.860   1.00 48.61  ? 79   PRO A CD    1 
ATOM   859  N N     . GLN C 3 7  ? 84.229 14.105  7.642   1.00 51.98  ? 80   GLN A N     1 
ATOM   860  C CA    . GLN C 3 7  ? 84.676 15.390  8.160   1.00 53.17  ? 80   GLN A CA    1 
ATOM   861  C C     . GLN C 3 7  ? 83.538 16.026  8.968   1.00 52.65  ? 80   GLN A C     1 
ATOM   862  O O     . GLN C 3 7  ? 82.365 15.858  8.637   1.00 51.51  ? 80   GLN A O     1 
ATOM   863  C CB    . GLN C 3 7  ? 85.056 16.297  6.988   1.00 54.74  ? 80   GLN A CB    1 
ATOM   864  C CG    . GLN C 3 7  ? 85.792 17.568  7.371   1.00 59.14  ? 80   GLN A CG    1 
ATOM   865  C CD    . GLN C 3 7  ? 86.110 18.446  6.165   1.00 61.05  ? 80   GLN A CD    1 
ATOM   866  O OE1   . GLN C 3 7  ? 86.447 17.946  5.087   1.00 61.04  ? 80   GLN A OE1   1 
ATOM   867  N NE2   . GLN C 3 7  ? 86.020 19.761  6.349   1.00 61.21  ? 80   GLN A NE2   1 
ATOM   868  N N     . ILE C 3 8  ? 83.888 16.746  10.028  1.00 52.27  ? 81   ILE A N     1 
ATOM   869  C CA    . ILE C 3 8  ? 82.890 17.394  10.868  1.00 50.86  ? 81   ILE A CA    1 
ATOM   870  C C     . ILE C 3 8  ? 82.609 18.776  10.328  1.00 52.05  ? 81   ILE A C     1 
ATOM   871  O O     . ILE C 3 8  ? 83.456 19.657  10.427  1.00 54.24  ? 81   ILE A O     1 
ATOM   872  C CB    . ILE C 3 8  ? 83.380 17.559  12.314  1.00 49.83  ? 81   ILE A CB    1 
ATOM   873  C CG1   . ILE C 3 8  ? 83.659 16.195  12.948  1.00 50.23  ? 81   ILE A CG1   1 
ATOM   874  C CG2   . ILE C 3 8  ? 82.344 18.303  13.118  1.00 51.11  ? 81   ILE A CG2   1 
ATOM   875  C CD1   . ILE C 3 8  ? 82.441 15.325  13.110  1.00 51.64  ? 81   ILE A CD1   1 
ATOM   876  N N     . TYR C 3 9  ? 81.429 18.983  9.760   1.00 52.15  ? 82   TYR A N     1 
ATOM   877  C CA    . TYR C 3 9  ? 81.115 20.298  9.227   1.00 53.70  ? 82   TYR A CA    1 
ATOM   878  C C     . TYR C 3 9  ? 80.383 21.175  10.233  1.00 52.94  ? 82   TYR A C     1 
ATOM   879  O O     . TYR C 3 9  ? 79.785 20.685  11.187  1.00 53.14  ? 82   TYR A O     1 
ATOM   880  C CB    . TYR C 3 9  ? 80.302 20.177  7.939   1.00 57.09  ? 82   TYR A CB    1 
ATOM   881  C CG    . TYR C 3 9  ? 81.063 19.485  6.830   1.00 60.70  ? 82   TYR A CG    1 
ATOM   882  C CD1   . TYR C 3 9  ? 81.164 18.098  6.786   1.00 61.08  ? 82   TYR A CD1   1 
ATOM   883  C CD2   . TYR C 3 9  ? 81.722 20.221  5.848   1.00 61.36  ? 82   TYR A CD2   1 
ATOM   884  C CE1   . TYR C 3 9  ? 81.903 17.461  5.792   1.00 62.48  ? 82   TYR A CE1   1 
ATOM   885  C CE2   . TYR C 3 9  ? 82.466 19.592  4.853   1.00 62.22  ? 82   TYR A CE2   1 
ATOM   886  C CZ    . TYR C 3 9  ? 82.553 18.215  4.830   1.00 62.32  ? 82   TYR A CZ    1 
ATOM   887  O OH    . TYR C 3 9  ? 83.292 17.592  3.846   1.00 64.49  ? 82   TYR A OH    1 
ATOM   888  N N     . PRO C 3 10 ? 80.438 22.496  10.036  1.00 52.22  ? 83   PRO A N     1 
ATOM   889  C CA    . PRO C 3 10 ? 79.781 23.447  10.930  1.00 51.95  ? 83   PRO A CA    1 
ATOM   890  C C     . PRO C 3 10 ? 78.342 23.107  11.302  1.00 51.28  ? 83   PRO A C     1 
ATOM   891  O O     . PRO C 3 10 ? 78.027 22.985  12.486  1.00 51.21  ? 83   PRO A O     1 
ATOM   892  C CB    . PRO C 3 10 ? 79.900 24.758  10.167  1.00 52.02  ? 83   PRO A CB    1 
ATOM   893  C CG    . PRO C 3 10 ? 81.256 24.618  9.545   1.00 51.23  ? 83   PRO A CG    1 
ATOM   894  C CD    . PRO C 3 10 ? 81.231 23.203  9.012   1.00 52.37  ? 83   PRO A CD    1 
ATOM   895  N N     . TRP C 3 11 ? 77.471 22.946  10.308  1.00 50.23  ? 84   TRP A N     1 
ATOM   896  C CA    . TRP C 3 11 ? 76.069 22.636  10.593  1.00 49.25  ? 84   TRP A CA    1 
ATOM   897  C C     . TRP C 3 11 ? 75.945 21.462  11.557  1.00 50.04  ? 84   TRP A C     1 
ATOM   898  O O     . TRP C 3 11 ? 74.925 21.310  12.220  1.00 50.27  ? 84   TRP A O     1 
ATOM   899  C CB    . TRP C 3 11 ? 75.292 22.303  9.306   1.00 46.04  ? 84   TRP A CB    1 
ATOM   900  C CG    . TRP C 3 11 ? 75.595 20.932  8.742   1.00 44.83  ? 84   TRP A CG    1 
ATOM   901  C CD1   . TRP C 3 11 ? 76.614 20.596  7.888   1.00 45.41  ? 84   TRP A CD1   1 
ATOM   902  C CD2   . TRP C 3 11 ? 74.913 19.710  9.046   1.00 43.02  ? 84   TRP A CD2   1 
ATOM   903  N NE1   . TRP C 3 11 ? 76.606 19.244  7.647   1.00 44.77  ? 84   TRP A NE1   1 
ATOM   904  C CE2   . TRP C 3 11 ? 75.572 18.676  8.343   1.00 44.39  ? 84   TRP A CE2   1 
ATOM   905  C CE3   . TRP C 3 11 ? 73.812 19.388  9.844   1.00 40.24  ? 84   TRP A CE3   1 
ATOM   906  C CZ2   . TRP C 3 11 ? 75.164 17.343  8.417   1.00 42.99  ? 84   TRP A CZ2   1 
ATOM   907  C CZ3   . TRP C 3 11 ? 73.409 18.066  9.919   1.00 41.42  ? 84   TRP A CZ3   1 
ATOM   908  C CH2   . TRP C 3 11 ? 74.084 17.059  9.209   1.00 42.25  ? 84   TRP A CH2   1 
ATOM   909  N N     . MET C 3 12 ? 76.984 20.636  11.631  1.00 51.19  ? 85   MET A N     1 
ATOM   910  C CA    . MET C 3 12 ? 76.965 19.464  12.498  1.00 54.11  ? 85   MET A CA    1 
ATOM   911  C C     . MET C 3 12 ? 77.120 19.742  13.989  1.00 56.78  ? 85   MET A C     1 
ATOM   912  O O     . MET C 3 12 ? 76.896 18.856  14.810  1.00 56.33  ? 85   MET A O     1 
ATOM   913  C CB    . MET C 3 12 ? 78.029 18.461  12.037  1.00 52.18  ? 85   MET A CB    1 
ATOM   914  C CG    . MET C 3 12 ? 77.550 17.517  10.943  1.00 48.81  ? 85   MET A CG    1 
ATOM   915  S SD    . MET C 3 12 ? 78.889 16.775  9.987   1.00 48.46  ? 85   MET A SD    1 
ATOM   916  C CE    . MET C 3 12 ? 79.957 16.286  11.240  1.00 48.71  ? 85   MET A CE    1 
ATOM   917  N N     . LYS C 3 13 ? 77.498 20.965  14.343  1.00 60.99  ? 86   LYS A N     1 
ATOM   918  C CA    . LYS C 3 13 ? 77.655 21.326  15.750  1.00 64.96  ? 86   LYS A CA    1 
ATOM   919  C C     . LYS C 3 13 ? 76.294 21.694  16.350  1.00 68.24  ? 86   LYS A C     1 
ATOM   920  O O     . LYS C 3 13 ? 75.333 21.929  15.623  1.00 67.98  ? 86   LYS A O     1 
ATOM   921  C CB    . LYS C 3 13 ? 78.628 22.489  15.884  1.00 63.12  ? 86   LYS A CB    1 
ATOM   922  N N     . ARG C 3 14 ? 76.215 21.739  17.676  1.00 72.69  ? 87   ARG A N     1 
ATOM   923  C CA    . ARG C 3 14 ? 74.966 22.075  18.363  1.00 75.93  ? 87   ARG A CA    1 
ATOM   924  C C     . ARG C 3 14 ? 74.537 23.528  18.180  1.00 76.58  ? 87   ARG A C     1 
ATOM   925  O O     . ARG C 3 14 ? 75.293 24.353  17.669  1.00 76.27  ? 87   ARG A O     1 
ATOM   926  C CB    . ARG C 3 14 ? 75.093 21.777  19.860  1.00 78.34  ? 87   ARG A CB    1 
ATOM   927  C CG    . ARG C 3 14 ? 75.160 20.301  20.200  1.00 82.60  ? 87   ARG A CG    1 
ATOM   928  C CD    . ARG C 3 14 ? 73.850 19.618  19.850  1.00 86.72  ? 87   ARG A CD    1 
ATOM   929  N NE    . ARG C 3 14 ? 73.874 18.184  20.120  1.00 89.67  ? 87   ARG A NE    1 
ATOM   930  C CZ    . ARG C 3 14 ? 72.819 17.385  19.988  1.00 91.56  ? 87   ARG A CZ    1 
ATOM   931  N NH1   . ARG C 3 14 ? 71.655 17.884  19.589  1.00 92.97  ? 87   ARG A NH1   1 
ATOM   932  N NH2   . ARG C 3 14 ? 72.924 16.091  20.260  1.00 92.09  ? 87   ARG A NH2   1 
ATOM   933  N N     . VAL C 3 15 ? 73.315 23.826  18.617  1.00 77.80  ? 88   VAL A N     1 
ATOM   934  C CA    . VAL C 3 15 ? 72.742 25.169  18.530  1.00 78.42  ? 88   VAL A CA    1 
ATOM   935  C C     . VAL C 3 15 ? 71.352 25.217  19.174  1.00 78.16  ? 88   VAL A C     1 
ATOM   936  O O     . VAL C 3 15 ? 71.214 25.387  20.389  1.00 77.10  ? 88   VAL A O     1 
ATOM   937  C CB    . VAL C 3 15 ? 72.623 25.630  17.061  1.00 78.63  ? 88   VAL A CB    1 
ATOM   938  C CG1   . VAL C 3 15 ? 71.903 24.575  16.244  1.00 79.22  ? 88   VAL A CG1   1 
ATOM   939  C CG2   . VAL C 3 15 ? 71.872 26.943  16.989  1.00 79.22  ? 88   VAL A CG2   1 
ATOM   940  N N     . GLN C 3 31 ? 65.233 18.242  27.231  1.00 68.78  ? 104  GLN A N     1 
ATOM   941  C CA    . GLN C 3 31 ? 63.859 18.339  27.727  1.00 69.69  ? 104  GLN A CA    1 
ATOM   942  C C     . GLN C 3 31 ? 63.104 19.489  27.038  1.00 67.24  ? 104  GLN A C     1 
ATOM   943  O O     . GLN C 3 31 ? 63.589 20.618  26.987  1.00 68.01  ? 104  GLN A O     1 
ATOM   944  C CB    . GLN C 3 31 ? 63.866 18.548  29.253  1.00 71.95  ? 104  GLN A CB    1 
ATOM   945  C CG    . GLN C 3 31 ? 63.766 20.013  29.705  1.00 76.43  ? 104  GLN A CG    1 
ATOM   946  C CD    . GLN C 3 31 ? 64.740 20.382  30.825  1.00 78.91  ? 104  GLN A CD    1 
ATOM   947  O OE1   . GLN C 3 31 ? 64.553 21.388  31.519  1.00 79.29  ? 104  GLN A OE1   1 
ATOM   948  N NE2   . GLN C 3 31 ? 65.791 19.579  30.995  1.00 80.17  ? 104  GLN A NE2   1 
ATOM   949  N N     . ARG C 3 32 ? 61.926 19.187  26.499  1.00 65.01  ? 105  ARG A N     1 
ATOM   950  C CA    . ARG C 3 32 ? 61.090 20.177  25.816  1.00 62.05  ? 105  ARG A CA    1 
ATOM   951  C C     . ARG C 3 32 ? 59.711 20.160  26.478  1.00 61.09  ? 105  ARG A C     1 
ATOM   952  O O     . ARG C 3 32 ? 58.884 19.296  26.183  1.00 60.33  ? 105  ARG A O     1 
ATOM   953  C CB    . ARG C 3 32 ? 60.942 19.824  24.335  1.00 61.61  ? 105  ARG A CB    1 
ATOM   954  C CG    . ARG C 3 32 ? 60.289 20.919  23.500  1.00 60.29  ? 105  ARG A CG    1 
ATOM   955  C CD    . ARG C 3 32 ? 59.840 20.411  22.130  1.00 58.87  ? 105  ARG A CD    1 
ATOM   956  N NE    . ARG C 3 32 ? 58.385 20.487  22.020  1.00 59.75  ? 105  ARG A NE    1 
ATOM   957  C CZ    . ARG C 3 32 ? 57.585 19.449  21.792  1.00 56.47  ? 105  ARG A CZ    1 
ATOM   958  N NH1   . ARG C 3 32 ? 58.094 18.236  21.639  1.00 54.94  ? 105  ARG A NH1   1 
ATOM   959  N NH2   . ARG C 3 32 ? 56.273 19.628  21.733  1.00 53.15  ? 105  ARG A NH2   1 
ATOM   960  N N     . THR C 3 33 ? 59.470 21.119  27.368  1.00 59.05  ? 106  THR A N     1 
ATOM   961  C CA    . THR C 3 33 ? 58.210 21.192  28.091  1.00 57.63  ? 106  THR A CA    1 
ATOM   962  C C     . THR C 3 33 ? 56.979 21.085  27.194  1.00 56.11  ? 106  THR A C     1 
ATOM   963  O O     . THR C 3 33 ? 56.903 21.694  26.133  1.00 55.43  ? 106  THR A O     1 
ATOM   964  C CB    . THR C 3 33 ? 58.126 22.490  28.919  1.00 58.00  ? 106  THR A CB    1 
ATOM   965  O OG1   . THR C 3 33 ? 57.832 23.598  28.060  1.00 59.21  ? 106  THR A OG1   1 
ATOM   966  C CG2   . THR C 3 33 ? 59.457 22.746  29.622  1.00 59.47  ? 106  THR A CG2   1 
ATOM   967  N N     . SER C 3 34 ? 56.017 20.286  27.635  1.00 54.54  ? 107  SER A N     1 
ATOM   968  C CA    . SER C 3 34 ? 54.783 20.089  26.900  1.00 53.16  ? 107  SER A CA    1 
ATOM   969  C C     . SER C 3 34 ? 53.669 20.928  27.511  1.00 51.66  ? 107  SER A C     1 
ATOM   970  O O     . SER C 3 34 ? 53.628 21.131  28.721  1.00 52.08  ? 107  SER A O     1 
ATOM   971  C CB    . SER C 3 34 ? 54.373 18.620  26.955  1.00 53.97  ? 107  SER A CB    1 
ATOM   972  O OG    . SER C 3 34 ? 53.068 18.453  26.428  1.00 56.50  ? 107  SER A OG    1 
ATOM   973  N N     . TYR C 3 35 ? 52.757 21.409  26.680  1.00 48.31  ? 108  TYR A N     1 
ATOM   974  C CA    . TYR C 3 35 ? 51.665 22.191  27.204  1.00 46.15  ? 108  TYR A CA    1 
ATOM   975  C C     . TYR C 3 35 ? 50.561 21.241  27.630  1.00 45.89  ? 108  TYR A C     1 
ATOM   976  O O     . TYR C 3 35 ? 50.424 20.146  27.084  1.00 46.03  ? 108  TYR A O     1 
ATOM   977  C CB    . TYR C 3 35 ? 51.179 23.185  26.158  1.00 44.18  ? 108  TYR A CB    1 
ATOM   978  C CG    . TYR C 3 35 ? 52.163 24.308  25.889  1.00 41.75  ? 108  TYR A CG    1 
ATOM   979  C CD1   . TYR C 3 35 ? 53.342 24.425  26.624  1.00 39.77  ? 108  TYR A CD1   1 
ATOM   980  C CD2   . TYR C 3 35 ? 51.903 25.262  24.910  1.00 41.02  ? 108  TYR A CD2   1 
ATOM   981  C CE1   . TYR C 3 35 ? 54.234 25.462  26.389  1.00 39.88  ? 108  TYR A CE1   1 
ATOM   982  C CE2   . TYR C 3 35 ? 52.786 26.305  24.669  1.00 41.56  ? 108  TYR A CE2   1 
ATOM   983  C CZ    . TYR C 3 35 ? 53.949 26.401  25.409  1.00 41.85  ? 108  TYR A CZ    1 
ATOM   984  O OH    . TYR C 3 35 ? 54.818 27.438  25.159  1.00 40.65  ? 108  TYR A OH    1 
ATOM   985  N N     . THR C 3 36 ? 49.793 21.659  28.626  1.00 45.11  ? 109  THR A N     1 
ATOM   986  C CA    . THR C 3 36 ? 48.710 20.851  29.172  1.00 43.26  ? 109  THR A CA    1 
ATOM   987  C C     . THR C 3 36 ? 47.483 20.931  28.302  1.00 44.92  ? 109  THR A C     1 
ATOM   988  O O     . THR C 3 36 ? 47.344 21.859  27.504  1.00 45.09  ? 109  THR A O     1 
ATOM   989  C CB    . THR C 3 36 ? 48.327 21.336  30.575  1.00 41.75  ? 109  THR A CB    1 
ATOM   990  O OG1   . THR C 3 36 ? 47.746 22.645  30.491  1.00 38.01  ? 109  THR A OG1   1 
ATOM   991  C CG2   . THR C 3 36 ? 49.565 21.401  31.459  1.00 40.19  ? 109  THR A CG2   1 
ATOM   992  N N     . ARG C 3 37 ? 46.587 19.963  28.464  1.00 46.91  ? 110  ARG A N     1 
ATOM   993  C CA    . ARG C 3 37 ? 45.356 19.950  27.687  1.00 49.93  ? 110  ARG A CA    1 
ATOM   994  C C     . ARG C 3 37 ? 44.676 21.305  27.813  1.00 48.63  ? 110  ARG A C     1 
ATOM   995  O O     . ARG C 3 37 ? 44.211 21.867  26.819  1.00 48.80  ? 110  ARG A O     1 
ATOM   996  C CB    . ARG C 3 37 ? 44.400 18.851  28.176  1.00 53.09  ? 110  ARG A CB    1 
ATOM   997  C CG    . ARG C 3 37 ? 44.976 17.445  28.108  1.00 60.65  ? 110  ARG A CG    1 
ATOM   998  C CD    . ARG C 3 37 ? 43.893 16.372  27.925  1.00 66.18  ? 110  ARG A CD    1 
ATOM   999  N NE    . ARG C 3 37 ? 43.329 16.380  26.572  1.00 71.42  ? 110  ARG A NE    1 
ATOM   1000 C CZ    . ARG C 3 37 ? 42.448 15.491  26.117  1.00 72.76  ? 110  ARG A CZ    1 
ATOM   1001 N NH1   . ARG C 3 37 ? 42.017 14.511  26.901  1.00 73.42  ? 110  ARG A NH1   1 
ATOM   1002 N NH2   . ARG C 3 37 ? 41.999 15.579  24.872  1.00 73.33  ? 110  ARG A NH2   1 
ATOM   1003 N N     . TYR C 3 38 ? 44.640 21.831  29.038  1.00 47.36  ? 111  TYR A N     1 
ATOM   1004 C CA    . TYR C 3 38 ? 44.008 23.114  29.303  1.00 45.70  ? 111  TYR A CA    1 
ATOM   1005 C C     . TYR C 3 38 ? 44.700 24.222  28.533  1.00 45.83  ? 111  TYR A C     1 
ATOM   1006 O O     . TYR C 3 38 ? 44.066 24.930  27.755  1.00 46.98  ? 111  TYR A O     1 
ATOM   1007 C CB    . TYR C 3 38 ? 44.029 23.444  30.802  1.00 43.42  ? 111  TYR A CB    1 
ATOM   1008 C CG    . TYR C 3 38 ? 43.286 24.722  31.143  1.00 39.83  ? 111  TYR A CG    1 
ATOM   1009 C CD1   . TYR C 3 38 ? 41.898 24.814  30.969  1.00 38.85  ? 111  TYR A CD1   1 
ATOM   1010 C CD2   . TYR C 3 38 ? 43.971 25.850  31.598  1.00 39.66  ? 111  TYR A CD2   1 
ATOM   1011 C CE1   . TYR C 3 38 ? 41.206 25.994  31.234  1.00 36.87  ? 111  TYR A CE1   1 
ATOM   1012 C CE2   . TYR C 3 38 ? 43.289 27.051  31.869  1.00 39.53  ? 111  TYR A CE2   1 
ATOM   1013 C CZ    . TYR C 3 38 ? 41.908 27.113  31.682  1.00 39.34  ? 111  TYR A CZ    1 
ATOM   1014 O OH    . TYR C 3 38 ? 41.239 28.295  31.923  1.00 39.12  ? 111  TYR A OH    1 
ATOM   1015 N N     . GLN C 3 39 ? 45.999 24.377  28.736  1.00 45.79  ? 112  GLN A N     1 
ATOM   1016 C CA    . GLN C 3 39 ? 46.717 25.423  28.022  1.00 47.32  ? 112  GLN A CA    1 
ATOM   1017 C C     . GLN C 3 39 ? 46.444 25.332  26.522  1.00 48.57  ? 112  GLN A C     1 
ATOM   1018 O O     . GLN C 3 39 ? 45.975 26.291  25.911  1.00 48.46  ? 112  GLN A O     1 
ATOM   1019 C CB    . GLN C 3 39 ? 48.211 25.312  28.286  1.00 46.13  ? 112  GLN A CB    1 
ATOM   1020 C CG    . GLN C 3 39 ? 48.575 25.474  29.742  1.00 43.19  ? 112  GLN A CG    1 
ATOM   1021 C CD    . GLN C 3 39 ? 50.049 25.276  29.985  1.00 42.57  ? 112  GLN A CD    1 
ATOM   1022 O OE1   . GLN C 3 39 ? 50.630 24.282  29.541  1.00 43.55  ? 112  GLN A OE1   1 
ATOM   1023 N NE2   . GLN C 3 39 ? 50.668 26.216  30.696  1.00 38.82  ? 112  GLN A NE2   1 
ATOM   1024 N N     . THR C 3 40 ? 46.715 24.174  25.934  1.00 49.80  ? 113  THR A N     1 
ATOM   1025 C CA    . THR C 3 40 ? 46.489 23.992  24.507  1.00 51.72  ? 113  THR A CA    1 
ATOM   1026 C C     . THR C 3 40 ? 45.047 24.318  24.111  1.00 53.59  ? 113  THR A C     1 
ATOM   1027 O O     . THR C 3 40 ? 44.810 25.140  23.227  1.00 53.32  ? 113  THR A O     1 
ATOM   1028 C CB    . THR C 3 40 ? 46.816 22.546  24.063  1.00 51.65  ? 113  THR A CB    1 
ATOM   1029 O OG1   . THR C 3 40 ? 48.179 22.243  24.373  1.00 53.71  ? 113  THR A OG1   1 
ATOM   1030 C CG2   . THR C 3 40 ? 46.622 22.388  22.570  1.00 51.26  ? 113  THR A CG2   1 
ATOM   1031 N N     . LEU C 3 41 ? 44.085 23.680  24.771  1.00 56.05  ? 114  LEU A N     1 
ATOM   1032 C CA    . LEU C 3 41 ? 42.678 23.907  24.457  1.00 57.16  ? 114  LEU A CA    1 
ATOM   1033 C C     . LEU C 3 41 ? 42.338 25.394  24.485  1.00 56.91  ? 114  LEU A C     1 
ATOM   1034 O O     . LEU C 3 41 ? 41.725 25.907  23.554  1.00 57.56  ? 114  LEU A O     1 
ATOM   1035 C CB    . LEU C 3 41 ? 41.779 23.167  25.448  1.00 59.41  ? 114  LEU A CB    1 
ATOM   1036 C CG    . LEU C 3 41 ? 40.344 22.942  24.957  1.00 62.13  ? 114  LEU A CG    1 
ATOM   1037 C CD1   . LEU C 3 41 ? 40.317 21.670  24.111  1.00 63.83  ? 114  LEU A CD1   1 
ATOM   1038 C CD2   . LEU C 3 41 ? 39.383 22.805  26.130  1.00 61.80  ? 114  LEU A CD2   1 
ATOM   1039 N N     . GLU C 3 42 ? 42.734 26.082  25.552  1.00 55.76  ? 115  GLU A N     1 
ATOM   1040 C CA    . GLU C 3 42 ? 42.463 27.509  25.668  1.00 55.19  ? 115  GLU A CA    1 
ATOM   1041 C C     . GLU C 3 42 ? 43.108 28.296  24.527  1.00 55.50  ? 115  GLU A C     1 
ATOM   1042 O O     . GLU C 3 42 ? 42.435 29.079  23.858  1.00 56.13  ? 115  GLU A O     1 
ATOM   1043 C CB    . GLU C 3 42 ? 42.947 28.038  27.018  1.00 55.37  ? 115  GLU A CB    1 
ATOM   1044 C CG    . GLU C 3 42 ? 42.192 27.446  28.205  1.00 55.80  ? 115  GLU A CG    1 
ATOM   1045 C CD    . GLU C 3 42 ? 40.690 27.692  28.136  1.00 56.30  ? 115  GLU A CD    1 
ATOM   1046 O OE1   . GLU C 3 42 ? 40.269 28.861  28.286  1.00 53.05  ? 115  GLU A OE1   1 
ATOM   1047 O OE2   . GLU C 3 42 ? 39.931 26.714  27.929  1.00 59.10  ? 115  GLU A OE2   1 
ATOM   1048 N N     . LEU C 3 43 ? 44.405 28.100  24.304  1.00 53.74  ? 116  LEU A N     1 
ATOM   1049 C CA    . LEU C 3 43 ? 45.094 28.790  23.218  1.00 52.06  ? 116  LEU A CA    1 
ATOM   1050 C C     . LEU C 3 43 ? 44.366 28.573  21.888  1.00 53.14  ? 116  LEU A C     1 
ATOM   1051 O O     . LEU C 3 43 ? 44.123 29.510  21.128  1.00 51.58  ? 116  LEU A O     1 
ATOM   1052 C CB    . LEU C 3 43 ? 46.519 28.270  23.095  1.00 49.08  ? 116  LEU A CB    1 
ATOM   1053 C CG    . LEU C 3 43 ? 47.500 28.751  24.155  1.00 48.97  ? 116  LEU A CG    1 
ATOM   1054 C CD1   . LEU C 3 43 ? 48.787 27.961  24.042  1.00 47.83  ? 116  LEU A CD1   1 
ATOM   1055 C CD2   . LEU C 3 43 ? 47.768 30.236  23.974  1.00 46.42  ? 116  LEU A CD2   1 
ATOM   1056 N N     . GLU C 3 44 ? 44.024 27.322  21.615  1.00 54.76  ? 117  GLU A N     1 
ATOM   1057 C CA    . GLU C 3 44 ? 43.327 26.956  20.391  1.00 57.81  ? 117  GLU A CA    1 
ATOM   1058 C C     . GLU C 3 44 ? 42.019 27.734  20.355  1.00 60.14  ? 117  GLU A C     1 
ATOM   1059 O O     . GLU C 3 44 ? 41.588 28.219  19.312  1.00 60.20  ? 117  GLU A O     1 
ATOM   1060 C CB    . GLU C 3 44 ? 43.042 25.453  20.403  1.00 57.85  ? 117  GLU A CB    1 
ATOM   1061 C CG    . GLU C 3 44 ? 42.904 24.802  19.041  1.00 60.57  ? 117  GLU A CG    1 
ATOM   1062 C CD    . GLU C 3 44 ? 44.206 24.793  18.253  1.00 61.39  ? 117  GLU A CD    1 
ATOM   1063 O OE1   . GLU C 3 44 ? 45.226 24.282  18.771  1.00 61.83  ? 117  GLU A OE1   1 
ATOM   1064 O OE2   . GLU C 3 44 ? 44.202 25.293  17.109  1.00 61.39  ? 117  GLU A OE2   1 
ATOM   1065 N N     . LYS C 3 45 ? 41.402 27.853  21.524  1.00 63.86  ? 118  LYS A N     1 
ATOM   1066 C CA    . LYS C 3 45 ? 40.134 28.557  21.700  1.00 66.25  ? 118  LYS A CA    1 
ATOM   1067 C C     . LYS C 3 45 ? 40.285 30.060  21.404  1.00 66.35  ? 118  LYS A C     1 
ATOM   1068 O O     . LYS C 3 45 ? 39.440 30.662  20.746  1.00 66.33  ? 118  LYS A O     1 
ATOM   1069 C CB    . LYS C 3 45 ? 39.655 28.329  23.138  1.00 68.47  ? 118  LYS A CB    1 
ATOM   1070 C CG    . LYS C 3 45 ? 38.179 28.581  23.422  1.00 70.83  ? 118  LYS A CG    1 
ATOM   1071 C CD    . LYS C 3 45 ? 37.856 28.114  24.846  1.00 72.16  ? 118  LYS A CD    1 
ATOM   1072 C CE    . LYS C 3 45 ? 36.419 28.413  25.247  1.00 74.27  ? 118  LYS A CE    1 
ATOM   1073 N NZ    . LYS C 3 45 ? 36.105 27.896  26.612  1.00 74.48  ? 118  LYS A NZ    1 
ATOM   1074 N N     . GLU C 3 46 ? 41.370 30.652  21.887  1.00 66.66  ? 119  GLU A N     1 
ATOM   1075 C CA    . GLU C 3 46 ? 41.641 32.070  21.679  1.00 68.49  ? 119  GLU A CA    1 
ATOM   1076 C C     . GLU C 3 46 ? 41.908 32.364  20.209  1.00 69.48  ? 119  GLU A C     1 
ATOM   1077 O O     . GLU C 3 46 ? 41.357 33.308  19.642  1.00 69.32  ? 119  GLU A O     1 
ATOM   1078 C CB    . GLU C 3 46 ? 42.862 32.493  22.503  1.00 70.13  ? 119  GLU A CB    1 
ATOM   1079 C CG    . GLU C 3 46 ? 42.585 33.568  23.542  1.00 74.45  ? 119  GLU A CG    1 
ATOM   1080 C CD    . GLU C 3 46 ? 42.161 34.886  22.920  1.00 76.78  ? 119  GLU A CD    1 
ATOM   1081 O OE1   . GLU C 3 46 ? 43.006 35.536  22.260  1.00 77.04  ? 119  GLU A OE1   1 
ATOM   1082 O OE2   . GLU C 3 46 ? 40.979 35.266  23.088  1.00 77.62  ? 119  GLU A OE2   1 
ATOM   1083 N N     . PHE C 3 47 ? 42.768 31.546  19.607  1.00 69.73  ? 120  PHE A N     1 
ATOM   1084 C CA    . PHE C 3 47 ? 43.157 31.684  18.205  1.00 69.16  ? 120  PHE A CA    1 
ATOM   1085 C C     . PHE C 3 47 ? 41.963 31.736  17.251  1.00 70.66  ? 120  PHE A C     1 
ATOM   1086 O O     . PHE C 3 47 ? 42.030 32.379  16.205  1.00 70.67  ? 120  PHE A O     1 
ATOM   1087 C CB    . PHE C 3 47 ? 44.084 30.523  17.811  1.00 65.75  ? 120  PHE A CB    1 
ATOM   1088 C CG    . PHE C 3 47 ? 44.587 30.590  16.397  1.00 59.83  ? 120  PHE A CG    1 
ATOM   1089 C CD1   . PHE C 3 47 ? 45.422 31.622  15.989  1.00 57.87  ? 120  PHE A CD1   1 
ATOM   1090 C CD2   . PHE C 3 47 ? 44.231 29.614  15.476  1.00 58.97  ? 120  PHE A CD2   1 
ATOM   1091 C CE1   . PHE C 3 47 ? 45.896 31.679  14.684  1.00 56.39  ? 120  PHE A CE1   1 
ATOM   1092 C CE2   . PHE C 3 47 ? 44.700 29.663  14.166  1.00 57.95  ? 120  PHE A CE2   1 
ATOM   1093 C CZ    . PHE C 3 47 ? 45.534 30.698  13.771  1.00 55.62  ? 120  PHE A CZ    1 
ATOM   1094 N N     . HIS C 3 48 ? 40.877 31.057  17.608  1.00 72.86  ? 121  HIS A N     1 
ATOM   1095 C CA    . HIS C 3 48 ? 39.686 31.043  16.766  1.00 76.07  ? 121  HIS A CA    1 
ATOM   1096 C C     . HIS C 3 48 ? 38.871 32.326  16.944  1.00 76.85  ? 121  HIS A C     1 
ATOM   1097 O O     . HIS C 3 48 ? 37.922 32.576  16.205  1.00 76.56  ? 121  HIS A O     1 
ATOM   1098 C CB    . HIS C 3 48 ? 38.825 29.828  17.099  1.00 78.89  ? 121  HIS A CB    1 
ATOM   1099 C CG    . HIS C 3 48 ? 37.583 29.722  16.271  1.00 83.30  ? 121  HIS A CG    1 
ATOM   1100 N ND1   . HIS C 3 48 ? 37.612 29.500  14.911  1.00 85.14  ? 121  HIS A ND1   1 
ATOM   1101 C CD2   . HIS C 3 48 ? 36.274 29.793  16.614  1.00 84.88  ? 121  HIS A CD2   1 
ATOM   1102 C CE1   . HIS C 3 48 ? 36.374 29.435  14.451  1.00 86.69  ? 121  HIS A CE1   1 
ATOM   1103 N NE2   . HIS C 3 48 ? 35.543 29.609  15.464  1.00 86.60  ? 121  HIS A NE2   1 
ATOM   1104 N N     . PHE C 3 49 ? 39.255 33.131  17.931  1.00 77.99  ? 122  PHE A N     1 
ATOM   1105 C CA    . PHE C 3 49 ? 38.587 34.400  18.219  1.00 79.26  ? 122  PHE A CA    1 
ATOM   1106 C C     . PHE C 3 49 ? 39.276 35.487  17.418  1.00 78.75  ? 122  PHE A C     1 
ATOM   1107 O O     . PHE C 3 49 ? 38.655 36.459  16.996  1.00 78.83  ? 122  PHE A O     1 
ATOM   1108 C CB    . PHE C 3 49 ? 38.694 34.730  19.709  1.00 81.55  ? 122  PHE A CB    1 
ATOM   1109 C CG    . PHE C 3 49 ? 38.173 36.096  20.076  1.00 83.36  ? 122  PHE A CG    1 
ATOM   1110 C CD1   . PHE C 3 49 ? 36.819 36.403  19.946  1.00 84.10  ? 122  PHE A CD1   1 
ATOM   1111 C CD2   . PHE C 3 49 ? 39.035 37.069  20.583  1.00 84.22  ? 122  PHE A CD2   1 
ATOM   1112 C CE1   . PHE C 3 49 ? 36.331 37.658  20.320  1.00 84.67  ? 122  PHE A CE1   1 
ATOM   1113 C CE2   . PHE C 3 49 ? 38.558 38.327  20.960  1.00 84.96  ? 122  PHE A CE2   1 
ATOM   1114 C CZ    . PHE C 3 49 ? 37.203 38.622  20.829  1.00 85.05  ? 122  PHE A CZ    1 
ATOM   1115 N N     . ASN C 3 50 ? 40.576 35.310  17.230  1.00 78.01  ? 123  ASN A N     1 
ATOM   1116 C CA    . ASN C 3 50 ? 41.388 36.247  16.472  1.00 78.74  ? 123  ASN A CA    1 
ATOM   1117 C C     . ASN C 3 50 ? 42.810 35.720  16.372  1.00 77.17  ? 123  ASN A C     1 
ATOM   1118 O O     . ASN C 3 50 ? 43.517 35.596  17.373  1.00 77.24  ? 123  ASN A O     1 
ATOM   1119 C CB    . ASN C 3 50 ? 41.378 37.640  17.119  1.00 80.94  ? 123  ASN A CB    1 
ATOM   1120 C CG    . ASN C 3 50 ? 41.768 37.613  18.583  1.00 82.76  ? 123  ASN A CG    1 
ATOM   1121 O OD1   . ASN C 3 50 ? 42.005 38.659  19.191  1.00 83.65  ? 123  ASN A OD1   1 
ATOM   1122 N ND2   . ASN C 3 50 ? 41.827 36.417  19.163  1.00 84.41  ? 123  ASN A ND2   1 
ATOM   1123 N N     . ARG C 3 51 ? 43.219 35.410  15.149  1.00 75.75  ? 124  ARG A N     1 
ATOM   1124 C CA    . ARG C 3 51 ? 44.543 34.873  14.894  1.00 74.29  ? 124  ARG A CA    1 
ATOM   1125 C C     . ARG C 3 51 ? 45.678 35.800  15.338  1.00 72.97  ? 124  ARG A C     1 
ATOM   1126 O O     . ARG C 3 51 ? 46.847 35.423  15.300  1.00 72.20  ? 124  ARG A O     1 
ATOM   1127 C CB    . ARG C 3 51 ? 44.652 34.507  13.407  1.00 74.53  ? 124  ARG A CB    1 
ATOM   1128 C CG    . ARG C 3 51 ? 43.532 33.554  12.968  1.00 75.53  ? 124  ARG A CG    1 
ATOM   1129 C CD    . ARG C 3 51 ? 43.753 32.914  11.597  1.00 78.68  ? 124  ARG A CD    1 
ATOM   1130 N NE    . ARG C 3 51 ? 43.622 33.857  10.488  1.00 82.15  ? 124  ARG A NE    1 
ATOM   1131 C CZ    . ARG C 3 51 ? 44.645 34.443  9.872   1.00 84.42  ? 124  ARG A CZ    1 
ATOM   1132 N NH1   . ARG C 3 51 ? 45.892 34.183  10.251  1.00 84.64  ? 124  ARG A NH1   1 
ATOM   1133 N NH2   . ARG C 3 51 ? 44.422 35.294  8.876   1.00 85.15  ? 124  ARG A NH2   1 
ATOM   1134 N N     . TYR C 3 52 ? 45.334 37.007  15.779  1.00 72.23  ? 125  TYR A N     1 
ATOM   1135 C CA    . TYR C 3 52 ? 46.342 37.950  16.249  1.00 71.41  ? 125  TYR A CA    1 
ATOM   1136 C C     . TYR C 3 52 ? 45.984 38.496  17.632  1.00 72.11  ? 125  TYR A C     1 
ATOM   1137 O O     . TYR C 3 52 ? 44.810 38.618  17.981  1.00 71.93  ? 125  TYR A O     1 
ATOM   1138 C CB    . TYR C 3 52 ? 46.527 39.081  15.235  1.00 70.84  ? 125  TYR A CB    1 
ATOM   1139 C CG    . TYR C 3 52 ? 47.080 38.600  13.907  1.00 69.56  ? 125  TYR A CG    1 
ATOM   1140 C CD1   . TYR C 3 52 ? 46.258 37.952  12.979  1.00 68.46  ? 125  TYR A CD1   1 
ATOM   1141 C CD2   . TYR C 3 52 ? 48.438 38.745  13.598  1.00 69.26  ? 125  TYR A CD2   1 
ATOM   1142 C CE1   . TYR C 3 52 ? 46.774 37.457  11.778  1.00 68.64  ? 125  TYR A CE1   1 
ATOM   1143 C CE2   . TYR C 3 52 ? 48.966 38.253  12.397  1.00 68.12  ? 125  TYR A CE2   1 
ATOM   1144 C CZ    . TYR C 3 52 ? 48.128 37.610  11.496  1.00 68.71  ? 125  TYR A CZ    1 
ATOM   1145 O OH    . TYR C 3 52 ? 48.640 37.111  10.321  1.00 66.88  ? 125  TYR A OH    1 
ATOM   1146 N N     . LEU C 3 53 ? 47.011 38.813  18.414  1.00 73.54  ? 126  LEU A N     1 
ATOM   1147 C CA    . LEU C 3 53 ? 46.849 39.295  19.787  1.00 74.56  ? 126  LEU A CA    1 
ATOM   1148 C C     . LEU C 3 53 ? 47.337 40.713  20.057  1.00 75.46  ? 126  LEU A C     1 
ATOM   1149 O O     . LEU C 3 53 ? 48.318 41.177  19.469  1.00 74.44  ? 126  LEU A O     1 
ATOM   1150 C CB    . LEU C 3 53 ? 47.589 38.357  20.745  1.00 74.84  ? 126  LEU A CB    1 
ATOM   1151 C CG    . LEU C 3 53 ? 46.873 37.235  21.500  1.00 75.70  ? 126  LEU A CG    1 
ATOM   1152 C CD1   . LEU C 3 53 ? 45.729 36.660  20.686  1.00 75.70  ? 126  LEU A CD1   1 
ATOM   1153 C CD2   . LEU C 3 53 ? 47.909 36.167  21.851  1.00 75.50  ? 126  LEU A CD2   1 
ATOM   1154 N N     . THR C 3 54 ? 46.654 41.379  20.982  1.00 76.11  ? 127  THR A N     1 
ATOM   1155 C CA    . THR C 3 54 ? 47.005 42.733  21.387  1.00 76.51  ? 127  THR A CA    1 
ATOM   1156 C C     . THR C 3 54 ? 47.922 42.606  22.600  1.00 76.95  ? 127  THR A C     1 
ATOM   1157 O O     . THR C 3 54 ? 47.804 41.657  23.368  1.00 76.77  ? 127  THR A O     1 
ATOM   1158 C CB    . THR C 3 54 ? 45.748 43.529  21.782  1.00 76.18  ? 127  THR A CB    1 
ATOM   1159 O OG1   . THR C 3 54 ? 45.293 43.103  23.072  1.00 75.05  ? 127  THR A OG1   1 
ATOM   1160 C CG2   . THR C 3 54 ? 44.631 43.284  20.775  1.00 75.48  ? 127  THR A CG2   1 
ATOM   1161 N N     . ARG C 3 55 ? 48.839 43.550  22.770  1.00 78.87  ? 128  ARG A N     1 
ATOM   1162 C CA    . ARG C 3 55 ? 49.768 43.521  23.903  1.00 80.80  ? 128  ARG A CA    1 
ATOM   1163 C C     . ARG C 3 55 ? 49.049 43.205  25.222  1.00 80.53  ? 128  ARG A C     1 
ATOM   1164 O O     . ARG C 3 55 ? 49.594 42.523  26.093  1.00 80.26  ? 128  ARG A O     1 
ATOM   1165 C CB    . ARG C 3 55 ? 50.494 44.869  24.017  1.00 82.60  ? 128  ARG A CB    1 
ATOM   1166 C CG    . ARG C 3 55 ? 51.542 44.946  25.120  1.00 85.26  ? 128  ARG A CG    1 
ATOM   1167 C CD    . ARG C 3 55 ? 52.749 44.065  24.828  1.00 87.36  ? 128  ARG A CD    1 
ATOM   1168 N NE    . ARG C 3 55 ? 53.842 44.320  25.765  1.00 90.09  ? 128  ARG A NE    1 
ATOM   1169 C CZ    . ARG C 3 55 ? 55.072 43.827  25.640  1.00 92.15  ? 128  ARG A CZ    1 
ATOM   1170 N NH1   . ARG C 3 55 ? 55.378 43.042  24.610  1.00 93.07  ? 128  ARG A NH1   1 
ATOM   1171 N NH2   . ARG C 3 55 ? 56.002 44.126  26.543  1.00 91.98  ? 128  ARG A NH2   1 
ATOM   1172 N N     . ARG C 3 56 ? 47.824 43.703  25.358  1.00 80.15  ? 129  ARG A N     1 
ATOM   1173 C CA    . ARG C 3 56 ? 47.035 43.481  26.562  1.00 80.44  ? 129  ARG A CA    1 
ATOM   1174 C C     . ARG C 3 56 ? 46.556 42.036  26.651  1.00 79.40  ? 129  ARG A C     1 
ATOM   1175 O O     . ARG C 3 56 ? 46.908 41.313  27.583  1.00 79.76  ? 129  ARG A O     1 
ATOM   1176 C CB    . ARG C 3 56 ? 45.829 44.430  26.585  1.00 82.36  ? 129  ARG A CB    1 
ATOM   1177 C CG    . ARG C 3 56 ? 45.022 44.408  27.889  1.00 84.96  ? 129  ARG A CG    1 
ATOM   1178 C CD    . ARG C 3 56 ? 43.992 45.537  27.928  1.00 87.89  ? 129  ARG A CD    1 
ATOM   1179 N NE    . ARG C 3 56 ? 42.632 45.090  27.622  1.00 89.92  ? 129  ARG A NE    1 
ATOM   1180 C CZ    . ARG C 3 56 ? 41.625 45.912  27.333  1.00 90.52  ? 129  ARG A CZ    1 
ATOM   1181 N NH1   . ARG C 3 56 ? 41.827 47.224  27.304  1.00 90.25  ? 129  ARG A NH1   1 
ATOM   1182 N NH2   . ARG C 3 56 ? 40.412 45.427  27.087  1.00 90.23  ? 129  ARG A NH2   1 
ATOM   1183 N N     . ARG C 3 57 ? 45.746 41.624  25.680  1.00 77.97  ? 130  ARG A N     1 
ATOM   1184 C CA    . ARG C 3 57 ? 45.206 40.266  25.636  1.00 76.87  ? 130  ARG A CA    1 
ATOM   1185 C C     . ARG C 3 57 ? 46.321 39.236  25.833  1.00 75.89  ? 130  ARG A C     1 
ATOM   1186 O O     . ARG C 3 57 ? 46.132 38.203  26.476  1.00 75.41  ? 130  ARG A O     1 
ATOM   1187 C CB    . ARG C 3 57 ? 44.514 40.027  24.291  1.00 76.72  ? 130  ARG A CB    1 
ATOM   1188 C CG    . ARG C 3 57 ? 43.892 38.655  24.138  1.00 77.95  ? 130  ARG A CG    1 
ATOM   1189 C CD    . ARG C 3 57 ? 42.740 38.457  25.103  1.00 79.94  ? 130  ARG A CD    1 
ATOM   1190 N NE    . ARG C 3 57 ? 42.167 37.117  24.998  1.00 83.12  ? 130  ARG A NE    1 
ATOM   1191 C CZ    . ARG C 3 57 ? 41.183 36.658  25.767  1.00 83.67  ? 130  ARG A CZ    1 
ATOM   1192 N NH1   . ARG C 3 57 ? 40.653 37.432  26.704  1.00 85.16  ? 130  ARG A NH1   1 
ATOM   1193 N NH2   . ARG C 3 57 ? 40.728 35.424  25.602  1.00 84.54  ? 130  ARG A NH2   1 
ATOM   1194 N N     . ARG C 3 58 ? 47.487 39.542  25.280  1.00 74.13  ? 131  ARG A N     1 
ATOM   1195 C CA    . ARG C 3 58 ? 48.641 38.664  25.367  1.00 72.59  ? 131  ARG A CA    1 
ATOM   1196 C C     . ARG C 3 58 ? 49.048 38.460  26.816  1.00 71.94  ? 131  ARG A C     1 
ATOM   1197 O O     . ARG C 3 58 ? 49.374 37.346  27.233  1.00 71.64  ? 131  ARG A O     1 
ATOM   1198 C CB    . ARG C 3 58 ? 49.805 39.269  24.580  1.00 73.04  ? 131  ARG A CB    1 
ATOM   1199 C CG    . ARG C 3 58 ? 50.569 38.265  23.751  1.00 72.28  ? 131  ARG A CG    1 
ATOM   1200 C CD    . ARG C 3 58 ? 51.946 38.017  24.320  1.00 72.46  ? 131  ARG A CD    1 
ATOM   1201 N NE    . ARG C 3 58 ? 52.820 39.183  24.219  1.00 72.90  ? 131  ARG A NE    1 
ATOM   1202 C CZ    . ARG C 3 58 ? 53.031 39.880  23.104  1.00 73.48  ? 131  ARG A CZ    1 
ATOM   1203 N NH1   . ARG C 3 58 ? 52.420 39.545  21.972  1.00 73.73  ? 131  ARG A NH1   1 
ATOM   1204 N NH2   . ARG C 3 58 ? 53.883 40.897  23.114  1.00 72.60  ? 131  ARG A NH2   1 
ATOM   1205 N N     . ILE C 3 59 ? 49.025 39.550  27.576  1.00 70.82  ? 132  ILE A N     1 
ATOM   1206 C CA    . ILE C 3 59 ? 49.389 39.521  28.983  1.00 68.55  ? 132  ILE A CA    1 
ATOM   1207 C C     . ILE C 3 59 ? 48.341 38.818  29.841  1.00 67.32  ? 132  ILE A C     1 
ATOM   1208 O O     . ILE C 3 59 ? 48.683 37.981  30.678  1.00 66.53  ? 132  ILE A O     1 
ATOM   1209 C CB    . ILE C 3 59 ? 49.608 40.952  29.525  1.00 69.73  ? 132  ILE A CB    1 
ATOM   1210 C CG1   . ILE C 3 59 ? 50.908 41.528  28.956  1.00 69.10  ? 132  ILE A CG1   1 
ATOM   1211 C CG2   . ILE C 3 59 ? 49.638 40.943  31.053  1.00 69.84  ? 132  ILE A CG2   1 
ATOM   1212 C CD1   . ILE C 3 59 ? 52.142 40.786  29.399  1.00 68.39  ? 132  ILE A CD1   1 
ATOM   1213 N N     . GLU C 3 60 ? 47.066 39.137  29.646  1.00 65.77  ? 133  GLU A N     1 
ATOM   1214 C CA    . GLU C 3 60 ? 46.063 38.481  30.463  1.00 65.50  ? 133  GLU A CA    1 
ATOM   1215 C C     . GLU C 3 60 ? 45.996 36.976  30.220  1.00 64.08  ? 133  GLU A C     1 
ATOM   1216 O O     . GLU C 3 60 ? 45.733 36.207  31.150  1.00 64.41  ? 133  GLU A O     1 
ATOM   1217 C CB    . GLU C 3 60 ? 44.683 39.130  30.293  1.00 66.81  ? 133  GLU A CB    1 
ATOM   1218 C CG    . GLU C 3 60 ? 44.216 39.385  28.884  1.00 71.54  ? 133  GLU A CG    1 
ATOM   1219 C CD    . GLU C 3 60 ? 42.845 40.059  28.858  1.00 74.39  ? 133  GLU A CD    1 
ATOM   1220 O OE1   . GLU C 3 60 ? 42.707 41.158  29.443  1.00 75.30  ? 133  GLU A OE1   1 
ATOM   1221 O OE2   . GLU C 3 60 ? 41.904 39.491  28.258  1.00 75.44  ? 133  GLU A OE2   1 
ATOM   1222 N N     . ILE C 3 61 ? 46.261 36.547  28.988  1.00 61.57  ? 134  ILE A N     1 
ATOM   1223 C CA    . ILE C 3 61 ? 46.228 35.122  28.670  1.00 57.42  ? 134  ILE A CA    1 
ATOM   1224 C C     . ILE C 3 61 ? 47.467 34.408  29.219  1.00 55.17  ? 134  ILE A C     1 
ATOM   1225 O O     . ILE C 3 61 ? 47.389 33.265  29.656  1.00 52.68  ? 134  ILE A O     1 
ATOM   1226 C CB    . ILE C 3 61 ? 46.124 34.884  27.147  1.00 58.48  ? 134  ILE A CB    1 
ATOM   1227 C CG1   . ILE C 3 61 ? 46.033 33.384  26.871  1.00 60.13  ? 134  ILE A CG1   1 
ATOM   1228 C CG2   . ILE C 3 61 ? 47.333 35.475  26.434  1.00 57.29  ? 134  ILE A CG2   1 
ATOM   1229 C CD1   . ILE C 3 61 ? 45.725 33.047  25.437  1.00 63.68  ? 134  ILE A CD1   1 
ATOM   1230 N N     . ALA C 3 62 ? 48.606 35.091  29.204  1.00 53.04  ? 135  ALA A N     1 
ATOM   1231 C CA    . ALA C 3 62 ? 49.836 34.513  29.722  1.00 54.16  ? 135  ALA A CA    1 
ATOM   1232 C C     . ALA C 3 62 ? 49.682 34.212  31.220  1.00 57.02  ? 135  ALA A C     1 
ATOM   1233 O O     . ALA C 3 62 ? 50.056 33.129  31.688  1.00 56.99  ? 135  ALA A O     1 
ATOM   1234 C CB    . ALA C 3 62 ? 50.991 35.467  29.499  1.00 52.21  ? 135  ALA A CB    1 
ATOM   1235 N N     . HIS C 3 63 ? 49.134 35.173  31.969  1.00 57.88  ? 136  HIS A N     1 
ATOM   1236 C CA    . HIS C 3 63 ? 48.925 35.003  33.407  1.00 57.25  ? 136  HIS A CA    1 
ATOM   1237 C C     . HIS C 3 63 ? 47.888 33.916  33.670  1.00 55.75  ? 136  HIS A C     1 
ATOM   1238 O O     . HIS C 3 63 ? 48.031 33.113  34.597  1.00 55.03  ? 136  HIS A O     1 
ATOM   1239 C CB    . HIS C 3 63 ? 48.452 36.316  34.055  1.00 58.82  ? 136  HIS A CB    1 
ATOM   1240 C CG    . HIS C 3 63 ? 49.553 37.301  34.313  1.00 60.34  ? 136  HIS A CG    1 
ATOM   1241 N ND1   . HIS C 3 63 ? 50.717 36.962  34.971  1.00 60.49  ? 136  HIS A ND1   1 
ATOM   1242 C CD2   . HIS C 3 63 ? 49.648 38.626  34.040  1.00 61.41  ? 136  HIS A CD2   1 
ATOM   1243 C CE1   . HIS C 3 63 ? 51.480 38.035  35.094  1.00 61.28  ? 136  HIS A CE1   1 
ATOM   1244 N NE2   . HIS C 3 63 ? 50.855 39.058  34.538  1.00 61.13  ? 136  HIS A NE2   1 
ATOM   1245 N N     . ALA C 3 64 ? 46.851 33.888  32.846  1.00 52.91  ? 137  ALA A N     1 
ATOM   1246 C CA    . ALA C 3 64 ? 45.793 32.909  33.017  1.00 52.95  ? 137  ALA A CA    1 
ATOM   1247 C C     . ALA C 3 64 ? 46.238 31.471  32.769  1.00 53.16  ? 137  ALA A C     1 
ATOM   1248 O O     . ALA C 3 64 ? 45.588 30.539  33.241  1.00 52.22  ? 137  ALA A O     1 
ATOM   1249 C CB    . ALA C 3 64 ? 44.617 33.250  32.103  1.00 51.04  ? 137  ALA A CB    1 
ATOM   1250 N N     . LEU C 3 65 ? 47.336 31.289  32.038  1.00 52.75  ? 138  LEU A N     1 
ATOM   1251 C CA    . LEU C 3 65 ? 47.807 29.944  31.729  1.00 53.24  ? 138  LEU A CA    1 
ATOM   1252 C C     . LEU C 3 65 ? 49.192 29.594  32.285  1.00 53.88  ? 138  LEU A C     1 
ATOM   1253 O O     . LEU C 3 65 ? 49.812 28.623  31.858  1.00 54.73  ? 138  LEU A O     1 
ATOM   1254 C CB    . LEU C 3 65 ? 47.787 29.725  30.210  1.00 52.55  ? 138  LEU A CB    1 
ATOM   1255 C CG    . LEU C 3 65 ? 46.452 29.860  29.459  1.00 52.43  ? 138  LEU A CG    1 
ATOM   1256 C CD1   . LEU C 3 65 ? 46.687 29.656  27.977  1.00 51.62  ? 138  LEU A CD1   1 
ATOM   1257 C CD2   . LEU C 3 65 ? 45.443 28.836  29.957  1.00 54.29  ? 138  LEU A CD2   1 
ATOM   1258 N N     . SER C 3 66 ? 49.683 30.379  33.230  1.00 53.51  ? 139  SER A N     1 
ATOM   1259 C CA    . SER C 3 66 ? 50.980 30.097  33.836  1.00 54.87  ? 139  SER A CA    1 
ATOM   1260 C C     . SER C 3 66 ? 52.122 30.098  32.825  1.00 54.95  ? 139  SER A C     1 
ATOM   1261 O O     . SER C 3 66 ? 53.207 29.578  33.098  1.00 56.83  ? 139  SER A O     1 
ATOM   1262 C CB    . SER C 3 66 ? 50.946 28.737  34.554  1.00 55.67  ? 139  SER A CB    1 
ATOM   1263 O OG    . SER C 3 66 ? 49.908 28.675  35.521  1.00 54.90  ? 139  SER A OG    1 
ATOM   1264 N N     . LEU C 3 67 ? 51.876 30.674  31.656  1.00 53.70  ? 140  LEU A N     1 
ATOM   1265 C CA    . LEU C 3 67 ? 52.896 30.767  30.619  1.00 52.38  ? 140  LEU A CA    1 
ATOM   1266 C C     . LEU C 3 67 ? 53.351 32.228  30.518  1.00 53.49  ? 140  LEU A C     1 
ATOM   1267 O O     . LEU C 3 67 ? 52.640 33.136  30.956  1.00 53.86  ? 140  LEU A O     1 
ATOM   1268 C CB    . LEU C 3 67 ? 52.319 30.301  29.278  1.00 50.41  ? 140  LEU A CB    1 
ATOM   1269 C CG    . LEU C 3 67 ? 51.951 28.815  29.181  1.00 50.44  ? 140  LEU A CG    1 
ATOM   1270 C CD1   . LEU C 3 67 ? 51.140 28.538  27.919  1.00 46.60  ? 140  LEU A CD1   1 
ATOM   1271 C CD2   . LEU C 3 67 ? 53.235 27.980  29.215  1.00 47.98  ? 140  LEU A CD2   1 
ATOM   1272 N N     . THR C 3 68 ? 54.530 32.461  29.951  1.00 53.95  ? 141  THR A N     1 
ATOM   1273 C CA    . THR C 3 68 ? 55.017 33.825  29.804  1.00 55.53  ? 141  THR A CA    1 
ATOM   1274 C C     . THR C 3 68 ? 54.415 34.484  28.566  1.00 57.07  ? 141  THR A C     1 
ATOM   1275 O O     . THR C 3 68 ? 53.669 33.865  27.803  1.00 55.69  ? 141  THR A O     1 
ATOM   1276 C CB    . THR C 3 68 ? 56.547 33.887  29.663  1.00 55.38  ? 141  THR A CB    1 
ATOM   1277 O OG1   . THR C 3 68 ? 56.937 33.231  28.455  1.00 57.07  ? 141  THR A OG1   1 
ATOM   1278 C CG2   . THR C 3 68 ? 57.222 33.217  30.840  1.00 55.64  ? 141  THR A CG2   1 
ATOM   1279 N N     . GLU C 3 69 ? 54.756 35.754  28.381  1.00 59.15  ? 142  GLU A N     1 
ATOM   1280 C CA    . GLU C 3 69 ? 54.278 36.547  27.256  1.00 59.87  ? 142  GLU A CA    1 
ATOM   1281 C C     . GLU C 3 69 ? 54.922 35.991  25.993  1.00 58.41  ? 142  GLU A C     1 
ATOM   1282 O O     . GLU C 3 69 ? 54.259 35.747  24.982  1.00 56.17  ? 142  GLU A O     1 
ATOM   1283 C CB    . GLU C 3 69 ? 54.711 37.996  27.447  1.00 63.33  ? 142  GLU A CB    1 
ATOM   1284 C CG    . GLU C 3 69 ? 53.684 39.026  27.052  1.00 68.62  ? 142  GLU A CG    1 
ATOM   1285 C CD    . GLU C 3 69 ? 54.265 40.429  27.041  1.00 71.40  ? 142  GLU A CD    1 
ATOM   1286 O OE1   . GLU C 3 69 ? 54.906 40.823  28.046  1.00 72.20  ? 142  GLU A OE1   1 
ATOM   1287 O OE2   . GLU C 3 69 ? 54.077 41.132  26.025  1.00 72.70  ? 142  GLU A OE2   1 
ATOM   1288 N N     . ARG C 3 70 ? 56.232 35.802  26.077  1.00 56.81  ? 143  ARG A N     1 
ATOM   1289 C CA    . ARG C 3 70 ? 57.001 35.269  24.978  1.00 57.44  ? 143  ARG A CA    1 
ATOM   1290 C C     . ARG C 3 70 ? 56.335 33.994  24.483  1.00 56.09  ? 143  ARG A C     1 
ATOM   1291 O O     . ARG C 3 70 ? 55.921 33.903  23.330  1.00 57.56  ? 143  ARG A O     1 
ATOM   1292 C CB    . ARG C 3 70 ? 58.424 34.978  25.447  1.00 59.34  ? 143  ARG A CB    1 
ATOM   1293 C CG    . ARG C 3 70 ? 59.352 34.508  24.357  1.00 63.27  ? 143  ARG A CG    1 
ATOM   1294 C CD    . ARG C 3 70 ? 60.805 34.599  24.791  1.00 66.56  ? 143  ARG A CD    1 
ATOM   1295 N NE    . ARG C 3 70 ? 61.698 34.051  23.775  1.00 71.77  ? 143  ARG A NE    1 
ATOM   1296 C CZ    . ARG C 3 70 ? 61.833 34.542  22.544  1.00 74.58  ? 143  ARG A CZ    1 
ATOM   1297 N NH1   . ARG C 3 70 ? 61.135 35.608  22.166  1.00 74.50  ? 143  ARG A NH1   1 
ATOM   1298 N NH2   . ARG C 3 70 ? 62.656 33.954  21.682  1.00 75.94  ? 143  ARG A NH2   1 
ATOM   1299 N N     . GLN C 3 71 ? 56.209 33.018  25.369  1.00 54.53  ? 144  GLN A N     1 
ATOM   1300 C CA    . GLN C 3 71 ? 55.593 31.749  25.011  1.00 53.17  ? 144  GLN A CA    1 
ATOM   1301 C C     . GLN C 3 71 ? 54.231 31.906  24.351  1.00 52.19  ? 144  GLN A C     1 
ATOM   1302 O O     . GLN C 3 71 ? 53.851 31.082  23.525  1.00 53.94  ? 144  GLN A O     1 
ATOM   1303 C CB    . GLN C 3 71 ? 55.452 30.857  26.241  1.00 53.31  ? 144  GLN A CB    1 
ATOM   1304 C CG    . GLN C 3 71 ? 56.758 30.432  26.861  1.00 52.83  ? 144  GLN A CG    1 
ATOM   1305 C CD    . GLN C 3 71 ? 56.541 29.697  28.167  1.00 54.89  ? 144  GLN A CD    1 
ATOM   1306 O OE1   . GLN C 3 71 ? 56.017 30.262  29.131  1.00 54.86  ? 144  GLN A OE1   1 
ATOM   1307 N NE2   . GLN C 3 71 ? 56.934 28.427  28.206  1.00 53.60  ? 144  GLN A NE2   1 
ATOM   1308 N N     . ILE C 3 72 ? 53.483 32.943  24.702  1.00 50.20  ? 145  ILE A N     1 
ATOM   1309 C CA    . ILE C 3 72 ? 52.181 33.111  24.074  1.00 50.32  ? 145  ILE A CA    1 
ATOM   1310 C C     . ILE C 3 72 ? 52.362 33.703  22.685  1.00 50.33  ? 145  ILE A C     1 
ATOM   1311 O O     . ILE C 3 72 ? 51.663 33.330  21.743  1.00 49.38  ? 145  ILE A O     1 
ATOM   1312 C CB    . ILE C 3 72 ? 51.256 34.033  24.886  1.00 50.66  ? 145  ILE A CB    1 
ATOM   1313 C CG1   . ILE C 3 72 ? 50.935 33.395  26.241  1.00 49.72  ? 145  ILE A CG1   1 
ATOM   1314 C CG2   . ILE C 3 72 ? 49.961 34.265  24.108  1.00 50.40  ? 145  ILE A CG2   1 
ATOM   1315 C CD1   . ILE C 3 72 ? 50.201 32.066  26.124  1.00 49.10  ? 145  ILE A CD1   1 
ATOM   1316 N N     . LYS C 3 73 ? 53.315 34.625  22.570  1.00 50.30  ? 146  LYS A N     1 
ATOM   1317 C CA    . LYS C 3 73 ? 53.604 35.284  21.301  1.00 50.78  ? 146  LYS A CA    1 
ATOM   1318 C C     . LYS C 3 73 ? 54.022 34.201  20.320  1.00 50.54  ? 146  LYS A C     1 
ATOM   1319 O O     . LYS C 3 73 ? 53.446 34.053  19.238  1.00 49.41  ? 146  LYS A O     1 
ATOM   1320 C CB    . LYS C 3 73 ? 54.750 36.291  21.472  1.00 51.71  ? 146  LYS A CB    1 
ATOM   1321 C CG    . LYS C 3 73 ? 55.042 37.128  20.239  1.00 54.04  ? 146  LYS A CG    1 
ATOM   1322 C CD    . LYS C 3 73 ? 56.540 37.163  19.899  1.00 57.49  ? 146  LYS A CD    1 
ATOM   1323 C CE    . LYS C 3 73 ? 57.413 37.675  21.054  1.00 59.23  ? 146  LYS A CE    1 
ATOM   1324 N NZ    . LYS C 3 73 ? 57.164 39.104  21.404  1.00 60.61  ? 146  LYS A NZ    1 
ATOM   1325 N N     . ILE C 3 74 ? 55.024 33.431  20.731  1.00 48.30  ? 147  ILE A N     1 
ATOM   1326 C CA    . ILE C 3 74 ? 55.544 32.359  19.917  1.00 45.77  ? 147  ILE A CA    1 
ATOM   1327 C C     . ILE C 3 74 ? 54.497 31.312  19.596  1.00 45.73  ? 147  ILE A C     1 
ATOM   1328 O O     . ILE C 3 74 ? 54.429 30.837  18.462  1.00 45.86  ? 147  ILE A O     1 
ATOM   1329 C CB    . ILE C 3 74 ? 56.719 31.700  20.607  1.00 45.22  ? 147  ILE A CB    1 
ATOM   1330 C CG1   . ILE C 3 74 ? 57.875 32.688  20.637  1.00 42.17  ? 147  ILE A CG1   1 
ATOM   1331 C CG2   . ILE C 3 74 ? 57.082 30.404  19.903  1.00 45.09  ? 147  ILE A CG2   1 
ATOM   1332 C CD1   . ILE C 3 74 ? 59.137 32.151  21.199  1.00 43.08  ? 147  ILE A CD1   1 
ATOM   1333 N N     . TRP C 3 75 ? 53.669 30.951  20.573  1.00 44.68  ? 148  TRP A N     1 
ATOM   1334 C CA    . TRP C 3 75 ? 52.650 29.941  20.301  1.00 43.17  ? 148  TRP A CA    1 
ATOM   1335 C C     . TRP C 3 75 ? 51.741 30.425  19.204  1.00 44.60  ? 148  TRP A C     1 
ATOM   1336 O O     . TRP C 3 75 ? 51.285 29.634  18.392  1.00 49.13  ? 148  TRP A O     1 
ATOM   1337 C CB    . TRP C 3 75 ? 51.788 29.629  21.518  1.00 38.74  ? 148  TRP A CB    1 
ATOM   1338 C CG    . TRP C 3 75 ? 50.864 28.451  21.268  1.00 35.45  ? 148  TRP A CG    1 
ATOM   1339 C CD1   . TRP C 3 75 ? 51.118 27.135  21.537  1.00 32.45  ? 148  TRP A CD1   1 
ATOM   1340 C CD2   . TRP C 3 75 ? 49.564 28.485  20.657  1.00 34.24  ? 148  TRP A CD2   1 
ATOM   1341 N NE1   . TRP C 3 75 ? 50.066 26.352  21.134  1.00 30.42  ? 148  TRP A NE1   1 
ATOM   1342 C CE2   . TRP C 3 75 ? 49.098 27.152  20.589  1.00 33.77  ? 148  TRP A CE2   1 
ATOM   1343 C CE3   . TRP C 3 75 ? 48.748 29.513  20.160  1.00 34.32  ? 148  TRP A CE3   1 
ATOM   1344 C CZ2   . TRP C 3 75 ? 47.846 26.819  20.040  1.00 34.48  ? 148  TRP A CZ2   1 
ATOM   1345 C CZ3   . TRP C 3 75 ? 47.496 29.180  19.613  1.00 31.81  ? 148  TRP A CZ3   1 
ATOM   1346 C CH2   . TRP C 3 75 ? 47.063 27.847  19.560  1.00 32.87  ? 148  TRP A CH2   1 
ATOM   1347 N N     . PHE C 3 76 ? 51.460 31.724  19.172  1.00 46.01  ? 149  PHE A N     1 
ATOM   1348 C CA    . PHE C 3 76 ? 50.577 32.250  18.128  1.00 45.56  ? 149  PHE A CA    1 
ATOM   1349 C C     . PHE C 3 76 ? 51.287 32.335  16.791  1.00 43.74  ? 149  PHE A C     1 
ATOM   1350 O O     . PHE C 3 76 ? 50.692 32.073  15.748  1.00 42.77  ? 149  PHE A O     1 
ATOM   1351 C CB    . PHE C 3 76 ? 49.996 33.611  18.524  1.00 44.68  ? 149  PHE A CB    1 
ATOM   1352 C CG    . PHE C 3 76 ? 48.662 33.504  19.203  1.00 47.04  ? 149  PHE A CG    1 
ATOM   1353 C CD1   . PHE C 3 76 ? 48.567 33.057  20.523  1.00 47.80  ? 149  PHE A CD1   1 
ATOM   1354 C CD2   . PHE C 3 76 ? 47.489 33.768  18.502  1.00 47.57  ? 149  PHE A CD2   1 
ATOM   1355 C CE1   . PHE C 3 76 ? 47.327 32.869  21.125  1.00 47.11  ? 149  PHE A CE1   1 
ATOM   1356 C CE2   . PHE C 3 76 ? 46.238 33.582  19.101  1.00 48.54  ? 149  PHE A CE2   1 
ATOM   1357 C CZ    . PHE C 3 76 ? 46.159 33.132  20.410  1.00 46.99  ? 149  PHE A CZ    1 
ATOM   1358 N N     . GLN C 3 77 ? 52.564 32.686  16.832  1.00 44.09  ? 150  GLN A N     1 
ATOM   1359 C CA    . GLN C 3 77 ? 53.356 32.756  15.623  1.00 45.71  ? 150  GLN A CA    1 
ATOM   1360 C C     . GLN C 3 77 ? 53.293 31.367  14.952  1.00 46.55  ? 150  GLN A C     1 
ATOM   1361 O O     . GLN C 3 77 ? 52.868 31.241  13.791  1.00 44.96  ? 150  GLN A O     1 
ATOM   1362 C CB    . GLN C 3 77 ? 54.792 33.120  15.970  1.00 48.39  ? 150  GLN A CB    1 
ATOM   1363 C CG    . GLN C 3 77 ? 55.589 33.512  14.763  1.00 55.82  ? 150  GLN A CG    1 
ATOM   1364 C CD    . GLN C 3 77 ? 54.817 34.495  13.908  1.00 60.49  ? 150  GLN A CD    1 
ATOM   1365 O OE1   . GLN C 3 77 ? 54.546 35.625  14.335  1.00 63.97  ? 150  GLN A OE1   1 
ATOM   1366 N NE2   . GLN C 3 77 ? 54.437 34.068  12.701  1.00 60.31  ? 150  GLN A NE2   1 
ATOM   1367 N N     . ASN C 3 78 ? 53.679 30.331  15.702  1.00 45.31  ? 151  ASN A N     1 
ATOM   1368 C CA    . ASN C 3 78 ? 53.652 28.963  15.200  1.00 43.56  ? 151  ASN A CA    1 
ATOM   1369 C C     . ASN C 3 78 ? 52.250 28.590  14.770  1.00 44.52  ? 151  ASN A C     1 
ATOM   1370 O O     . ASN C 3 78 ? 52.058 27.890  13.777  1.00 45.77  ? 151  ASN A O     1 
ATOM   1371 C CB    . ASN C 3 78 ? 54.091 27.961  16.269  1.00 42.45  ? 151  ASN A CB    1 
ATOM   1372 C CG    . ASN C 3 78 ? 55.556 28.052  16.585  1.00 43.57  ? 151  ASN A CG    1 
ATOM   1373 O OD1   . ASN C 3 78 ? 56.360 28.418  15.734  1.00 46.24  ? 151  ASN A OD1   1 
ATOM   1374 N ND2   . ASN C 3 78 ? 55.923 27.702  17.809  1.00 44.61  ? 151  ASN A ND2   1 
ATOM   1375 N N     . ARG C 3 79 ? 51.256 29.056  15.510  1.00 43.94  ? 152  ARG A N     1 
ATOM   1376 C CA    . ARG C 3 79 ? 49.899 28.680  15.166  1.00 44.82  ? 152  ARG A CA    1 
ATOM   1377 C C     . ARG C 3 79 ? 49.479 29.203  13.803  1.00 45.41  ? 152  ARG A C     1 
ATOM   1378 O O     . ARG C 3 79 ? 48.677 28.574  13.120  1.00 43.37  ? 152  ARG A O     1 
ATOM   1379 C CB    . ARG C 3 79 ? 48.919 29.150  16.242  1.00 42.57  ? 152  ARG A CB    1 
ATOM   1380 C CG    . ARG C 3 79 ? 47.512 28.630  16.026  1.00 39.39  ? 152  ARG A CG    1 
ATOM   1381 C CD    . ARG C 3 79 ? 47.467 27.112  16.079  1.00 43.10  ? 152  ARG A CD    1 
ATOM   1382 N NE    . ARG C 3 79 ? 46.159 26.605  15.668  1.00 44.36  ? 152  ARG A NE    1 
ATOM   1383 C CZ    . ARG C 3 79 ? 45.788 26.441  14.403  1.00 46.02  ? 152  ARG A CZ    1 
ATOM   1384 N NH1   . ARG C 3 79 ? 46.635 26.736  13.418  1.00 44.23  ? 152  ARG A NH1   1 
ATOM   1385 N NH2   . ARG C 3 79 ? 44.568 26.000  14.122  1.00 43.86  ? 152  ARG A NH2   1 
ATOM   1386 N N     . ARG C 3 80 ? 50.011 30.355  13.412  1.00 48.32  ? 153  ARG A N     1 
ATOM   1387 C CA    . ARG C 3 80 ? 49.666 30.917  12.111  1.00 53.25  ? 153  ARG A CA    1 
ATOM   1388 C C     . ARG C 3 80 ? 50.380 30.131  11.017  1.00 56.48  ? 153  ARG A C     1 
ATOM   1389 O O     . ARG C 3 80 ? 49.773 29.792  9.999   1.00 57.35  ? 153  ARG A O     1 
ATOM   1390 C CB    . ARG C 3 80 ? 50.055 32.393  12.025  1.00 52.35  ? 153  ARG A CB    1 
ATOM   1391 C CG    . ARG C 3 80 ? 49.299 33.267  13.000  1.00 51.61  ? 153  ARG A CG    1 
ATOM   1392 C CD    . ARG C 3 80 ? 49.573 34.739  12.788  1.00 50.75  ? 153  ARG A CD    1 
ATOM   1393 N NE    . ARG C 3 80 ? 49.335 35.446  14.034  1.00 52.84  ? 153  ARG A NE    1 
ATOM   1394 C CZ    . ARG C 3 80 ? 50.293 35.842  14.866  1.00 52.62  ? 153  ARG A CZ    1 
ATOM   1395 N NH1   . ARG C 3 80 ? 51.571 35.621  14.576  1.00 49.92  ? 153  ARG A NH1   1 
ATOM   1396 N NH2   . ARG C 3 80 ? 49.963 36.419  16.015  1.00 53.46  ? 153  ARG A NH2   1 
ATOM   1397 N N     . MET C 3 81 ? 51.660 29.832  11.229  1.00 57.38  ? 154  MET A N     1 
ATOM   1398 C CA    . MET C 3 81 ? 52.412 29.065  10.247  1.00 59.50  ? 154  MET A CA    1 
ATOM   1399 C C     . MET C 3 81 ? 51.632 27.810  9.913   1.00 60.20  ? 154  MET A C     1 
ATOM   1400 O O     . MET C 3 81 ? 51.550 27.411  8.757   1.00 60.57  ? 154  MET A O     1 
ATOM   1401 C CB    . MET C 3 81 ? 53.786 28.697  10.794  1.00 59.85  ? 154  MET A CB    1 
ATOM   1402 C CG    . MET C 3 81 ? 54.671 29.905  11.016  1.00 63.75  ? 154  MET A CG    1 
ATOM   1403 S SD    . MET C 3 81 ? 54.870 30.886  9.507   1.00 66.61  ? 154  MET A SD    1 
ATOM   1404 C CE    . MET C 3 81 ? 53.440 32.009  9.626   1.00 65.48  ? 154  MET A CE    1 
ATOM   1405 N N     . LYS C 3 82 ? 51.054 27.197  10.940  1.00 61.68  ? 155  LYS A N     1 
ATOM   1406 C CA    . LYS C 3 82 ? 50.261 25.992  10.760  1.00 62.40  ? 155  LYS A CA    1 
ATOM   1407 C C     . LYS C 3 82 ? 48.955 26.346  10.067  1.00 64.14  ? 155  LYS A C     1 
ATOM   1408 O O     . LYS C 3 82 ? 48.415 25.558  9.298   1.00 63.76  ? 155  LYS A O     1 
ATOM   1409 C CB    . LYS C 3 82 ? 49.955 25.337  12.106  1.00 60.25  ? 155  LYS A CB    1 
ATOM   1410 C CG    . LYS C 3 82 ? 48.916 24.239  11.992  1.00 60.21  ? 155  LYS A CG    1 
ATOM   1411 C CD    . LYS C 3 82 ? 48.511 23.662  13.334  1.00 60.50  ? 155  LYS A CD    1 
ATOM   1412 C CE    . LYS C 3 82 ? 47.442 22.592  13.154  1.00 60.44  ? 155  LYS A CE    1 
ATOM   1413 N NZ    . LYS C 3 82 ? 47.060 21.956  14.443  1.00 64.04  ? 155  LYS A NZ    1 
ATOM   1414 N N     . TRP C 3 83 ? 48.444 27.536  10.343  1.00 67.18  ? 156  TRP A N     1 
ATOM   1415 C CA    . TRP C 3 83 ? 47.204 27.957  9.723   1.00 72.71  ? 156  TRP A CA    1 
ATOM   1416 C C     . TRP C 3 83 ? 47.487 28.313  8.268   1.00 76.12  ? 156  TRP A C     1 
ATOM   1417 O O     . TRP C 3 83 ? 46.673 28.042  7.385   1.00 75.82  ? 156  TRP A O     1 
ATOM   1418 C CB    . TRP C 3 83 ? 46.619 29.160  10.453  1.00 73.45  ? 156  TRP A CB    1 
ATOM   1419 C CG    . TRP C 3 83 ? 45.260 29.522  9.962   1.00 74.97  ? 156  TRP A CG    1 
ATOM   1420 C CD1   . TRP C 3 83 ? 44.076 28.931  10.301  1.00 75.35  ? 156  TRP A CD1   1 
ATOM   1421 C CD2   . TRP C 3 83 ? 44.946 30.533  9.005   1.00 76.49  ? 156  TRP A CD2   1 
ATOM   1422 N NE1   . TRP C 3 83 ? 43.041 29.514  9.612   1.00 75.48  ? 156  TRP A NE1   1 
ATOM   1423 C CE2   . TRP C 3 83 ? 43.546 30.500  8.808   1.00 76.36  ? 156  TRP A CE2   1 
ATOM   1424 C CE3   . TRP C 3 83 ? 45.712 31.465  8.289   1.00 76.89  ? 156  TRP A CE3   1 
ATOM   1425 C CZ2   . TRP C 3 83 ? 42.893 31.365  7.923   1.00 78.21  ? 156  TRP A CZ2   1 
ATOM   1426 C CZ3   . TRP C 3 83 ? 45.066 32.326  7.409   1.00 78.31  ? 156  TRP A CZ3   1 
ATOM   1427 C CH2   . TRP C 3 83 ? 43.666 32.269  7.234   1.00 78.95  ? 156  TRP A CH2   1 
ATOM   1428 N N     . LYS C 3 84 ? 48.642 28.929  8.030   1.00 80.04  ? 157  LYS A N     1 
ATOM   1429 C CA    . LYS C 3 84 ? 49.056 29.300  6.683   1.00 83.52  ? 157  LYS A CA    1 
ATOM   1430 C C     . LYS C 3 84 ? 49.135 27.980  5.939   1.00 85.52  ? 157  LYS A C     1 
ATOM   1431 O O     . LYS C 3 84 ? 48.549 27.817  4.870   1.00 86.05  ? 157  LYS A O     1 
ATOM   1432 C CB    . LYS C 3 84 ? 50.433 29.961  6.711   1.00 84.51  ? 157  LYS A CB    1 
ATOM   1433 C CG    . LYS C 3 84 ? 50.957 30.386  5.351   1.00 86.06  ? 157  LYS A CG    1 
ATOM   1434 C CD    . LYS C 3 84 ? 52.396 30.896  5.443   1.00 87.47  ? 157  LYS A CD    1 
ATOM   1435 C CE    . LYS C 3 84 ? 53.363 29.793  5.892   1.00 87.76  ? 157  LYS A CE    1 
ATOM   1436 N NZ    . LYS C 3 84 ? 54.781 30.268  5.994   1.00 86.80  ? 157  LYS A NZ    1 
ATOM   1437 N N     . LYS C 3 85 ? 49.874 27.039  6.518   1.00 87.72  ? 158  LYS A N     1 
ATOM   1438 C CA    . LYS C 3 85 ? 49.997 25.711  5.937   1.00 89.83  ? 158  LYS A CA    1 
ATOM   1439 C C     . LYS C 3 85 ? 48.589 25.135  6.033   1.00 91.54  ? 158  LYS A C     1 
ATOM   1440 O O     . LYS C 3 85 ? 47.729 25.705  6.707   1.00 90.68  ? 158  LYS A O     1 
ATOM   1441 C CB    . LYS C 3 85 ? 51.000 24.865  6.741   1.00 89.77  ? 158  LYS A CB    1 
ATOM   1442 C CG    . LYS C 3 85 ? 51.011 23.378  6.399   1.00 91.03  ? 158  LYS A CG    1 
ATOM   1443 C CD    . LYS C 3 85 ? 51.100 23.164  4.895   1.00 93.07  ? 158  LYS A CD    1 
ATOM   1444 C CE    . LYS C 3 85 ? 50.815 21.720  4.512   1.00 94.47  ? 158  LYS A CE    1 
ATOM   1445 N NZ    . LYS C 3 85 ? 50.670 21.553  3.033   1.00 95.36  ? 158  LYS A NZ    1 
ATOM   1446 N N     . GLU C 3 86 ? 48.341 24.018  5.365   1.00 93.98  ? 159  GLU A N     1 
ATOM   1447 C CA    . GLU C 3 86 ? 47.010 23.439  5.406   1.00 95.98  ? 159  GLU A CA    1 
ATOM   1448 C C     . GLU C 3 86 ? 46.017 24.469  4.875   1.00 97.36  ? 159  GLU A C     1 
ATOM   1449 O O     . GLU C 3 86 ? 44.836 24.432  5.210   1.00 97.74  ? 159  GLU A O     1 
ATOM   1450 C CB    . GLU C 3 86 ? 46.650 23.051  6.842   1.00 95.97  ? 159  GLU A CB    1 
ATOM   1451 N N     . HIS C 3 87 ? 46.535 25.380  4.051   1.00 99.10  ? 160  HIS A N     1 
ATOM   1452 C CA    . HIS C 3 87 ? 45.803 26.467  3.387   1.00 100.58 ? 160  HIS A CA    1 
ATOM   1453 C C     . HIS C 3 87 ? 44.539 27.045  4.025   1.00 100.72 ? 160  HIS A C     1 
ATOM   1454 O O     . HIS C 3 87 ? 44.039 28.071  3.562   1.00 101.03 ? 160  HIS A O     1 
ATOM   1455 C CB    . HIS C 3 87 ? 45.512 26.063  1.929   1.00 102.58 ? 160  HIS A CB    1 
ATOM   1456 C CG    . HIS C 3 87 ? 46.752 25.844  1.121   1.00 104.23 ? 160  HIS A CG    1 
ATOM   1457 N ND1   . HIS C 3 87 ? 46.720 25.351  -0.165  1.00 105.26 ? 160  HIS A ND1   1 
ATOM   1458 C CD2   . HIS C 3 87 ? 48.060 26.031  1.422   1.00 105.21 ? 160  HIS A CD2   1 
ATOM   1459 C CE1   . HIS C 3 87 ? 47.955 25.241  -0.619  1.00 106.72 ? 160  HIS A CE1   1 
ATOM   1460 N NE2   . HIS C 3 87 ? 48.789 25.646  0.324   1.00 107.12 ? 160  HIS A NE2   1 
ATOM   1461 N N     . LYS C 3 88 ? 44.014 26.392  5.058   1.00 101.00 ? 161  LYS A N     1 
ATOM   1462 C CA    . LYS C 3 88 ? 42.801 26.849  5.729   1.00 101.22 ? 161  LYS A CA    1 
ATOM   1463 C C     . LYS C 3 88 ? 43.066 28.013  6.672   1.00 101.36 ? 161  LYS A C     1 
ATOM   1464 O O     . LYS C 3 88 ? 44.220 28.495  6.710   1.00 101.70 ? 161  LYS A O     1 
ATOM   1465 C CB    . LYS C 3 88 ? 42.145 25.687  6.502   1.00 100.03 ? 161  LYS A CB    1 
ATOM   1466 O OXT   . LYS C 3 88 ? 42.111 28.421  7.374   1.00 101.18 ? 161  LYS A OXT   1 
ATOM   1467 N N     . ARG D 4 5  ? 48.755 6.498   6.701   1.00 87.98  ? 205  ARG B N     1 
ATOM   1468 C CA    . ARG D 4 5  ? 50.104 7.107   6.572   1.00 87.68  ? 205  ARG B CA    1 
ATOM   1469 C C     . ARG D 4 5  ? 51.207 6.067   6.325   1.00 86.01  ? 205  ARG B C     1 
ATOM   1470 O O     . ARG D 4 5  ? 51.752 5.484   7.264   1.00 85.94  ? 205  ARG B O     1 
ATOM   1471 C CB    . ARG D 4 5  ? 50.454 7.919   7.829   1.00 89.40  ? 205  ARG B CB    1 
ATOM   1472 C CG    . ARG D 4 5  ? 51.905 8.387   7.844   1.00 91.12  ? 205  ARG B CG    1 
ATOM   1473 C CD    . ARG D 4 5  ? 52.325 8.846   9.215   1.00 92.25  ? 205  ARG B CD    1 
ATOM   1474 N NE    . ARG D 4 5  ? 53.752 8.615   9.409   1.00 94.60  ? 205  ARG B NE    1 
ATOM   1475 C CZ    . ARG D 4 5  ? 54.423 8.907   10.519  1.00 95.80  ? 205  ARG B CZ    1 
ATOM   1476 N NH1   . ARG D 4 5  ? 53.805 9.456   11.556  1.00 95.47  ? 205  ARG B NH1   1 
ATOM   1477 N NH2   . ARG D 4 5  ? 55.718 8.633   10.596  1.00 97.05  ? 205  ARG B NH2   1 
ATOM   1478 N N     . ARG D 4 6  ? 51.544 5.851   5.057   1.00 83.33  ? 206  ARG B N     1 
ATOM   1479 C CA    . ARG D 4 6  ? 52.584 4.899   4.693   1.00 79.91  ? 206  ARG B CA    1 
ATOM   1480 C C     . ARG D 4 6  ? 53.916 5.638   4.590   1.00 75.29  ? 206  ARG B C     1 
ATOM   1481 O O     . ARG D 4 6  ? 53.972 6.867   4.697   1.00 75.11  ? 206  ARG B O     1 
ATOM   1482 C CB    . ARG D 4 6  ? 52.268 4.242   3.343   1.00 83.52  ? 206  ARG B CB    1 
ATOM   1483 C CG    . ARG D 4 6  ? 50.938 3.484   3.282   1.00 87.55  ? 206  ARG B CG    1 
ATOM   1484 C CD    . ARG D 4 6  ? 50.989 2.172   4.056   1.00 90.93  ? 206  ARG B CD    1 
ATOM   1485 N NE    . ARG D 4 6  ? 49.687 1.499   4.077   1.00 93.91  ? 206  ARG B NE    1 
ATOM   1486 C CZ    . ARG D 4 6  ? 49.452 0.324   4.662   1.00 95.07  ? 206  ARG B CZ    1 
ATOM   1487 N NH1   . ARG D 4 6  ? 50.434 -0.324  5.281   1.00 95.01  ? 206  ARG B NH1   1 
ATOM   1488 N NH2   . ARG D 4 6  ? 48.229 -0.201  4.642   1.00 95.08  ? 206  ARG B NH2   1 
ATOM   1489 N N     . ASN D 4 7  ? 54.987 4.880   4.389   1.00 69.94  ? 207  ASN B N     1 
ATOM   1490 C CA    . ASN D 4 7  ? 56.320 5.454   4.253   1.00 64.73  ? 207  ASN B CA    1 
ATOM   1491 C C     . ASN D 4 7  ? 56.614 5.755   2.798   1.00 60.58  ? 207  ASN B C     1 
ATOM   1492 O O     . ASN D 4 7  ? 55.957 5.232   1.907   1.00 60.42  ? 207  ASN B O     1 
ATOM   1493 C CB    . ASN D 4 7  ? 57.364 4.489   4.806   1.00 63.53  ? 207  ASN B CB    1 
ATOM   1494 C CG    . ASN D 4 7  ? 57.350 4.439   6.308   1.00 62.75  ? 207  ASN B CG    1 
ATOM   1495 O OD1   . ASN D 4 7  ? 56.305 4.623   6.926   1.00 62.97  ? 207  ASN B OD1   1 
ATOM   1496 N ND2   . ASN D 4 7  ? 58.506 4.185   6.910   1.00 63.21  ? 207  ASN B ND2   1 
ATOM   1497 N N     . PHE D 4 8  ? 57.598 6.611   2.561   1.00 57.43  ? 208  PHE B N     1 
ATOM   1498 C CA    . PHE D 4 8  ? 57.982 6.980   1.198   1.00 53.73  ? 208  PHE B CA    1 
ATOM   1499 C C     . PHE D 4 8  ? 58.504 5.752   0.474   1.00 51.39  ? 208  PHE B C     1 
ATOM   1500 O O     . PHE D 4 8  ? 59.028 4.838   1.108   1.00 49.25  ? 208  PHE B O     1 
ATOM   1501 C CB    . PHE D 4 8  ? 59.052 8.067   1.248   1.00 51.74  ? 208  PHE B CB    1 
ATOM   1502 C CG    . PHE D 4 8  ? 58.587 9.333   1.906   1.00 50.62  ? 208  PHE B CG    1 
ATOM   1503 C CD1   . PHE D 4 8  ? 59.496 10.205  2.489   1.00 49.01  ? 208  PHE B CD1   1 
ATOM   1504 C CD2   . PHE D 4 8  ? 57.233 9.658   1.935   1.00 48.42  ? 208  PHE B CD2   1 
ATOM   1505 C CE1   . PHE D 4 8  ? 59.065 11.379  3.088   1.00 49.10  ? 208  PHE B CE1   1 
ATOM   1506 C CE2   . PHE D 4 8  ? 56.793 10.834  2.534   1.00 46.76  ? 208  PHE B CE2   1 
ATOM   1507 C CZ    . PHE D 4 8  ? 57.707 11.694  3.110   1.00 47.33  ? 208  PHE B CZ    1 
ATOM   1508 N N     . SER D 4 9  ? 58.354 5.728   -0.848  1.00 49.98  ? 209  SER B N     1 
ATOM   1509 C CA    . SER D 4 9  ? 58.808 4.583   -1.643  1.00 49.89  ? 209  SER B CA    1 
ATOM   1510 C C     . SER D 4 9  ? 60.311 4.332   -1.521  1.00 50.96  ? 209  SER B C     1 
ATOM   1511 O O     . SER D 4 9  ? 61.058 5.167   -0.995  1.00 49.74  ? 209  SER B O     1 
ATOM   1512 C CB    . SER D 4 9  ? 58.453 4.783   -3.117  1.00 48.48  ? 209  SER B CB    1 
ATOM   1513 O OG    . SER D 4 9  ? 59.056 5.957   -3.645  1.00 48.65  ? 209  SER B OG    1 
ATOM   1514 N N     . LYS D 4 10 ? 60.759 3.185   -2.017  1.00 51.00  ? 210  LYS B N     1 
ATOM   1515 C CA    . LYS D 4 10 ? 62.173 2.872   -1.940  1.00 53.99  ? 210  LYS B CA    1 
ATOM   1516 C C     . LYS D 4 10 ? 63.003 3.828   -2.792  1.00 52.60  ? 210  LYS B C     1 
ATOM   1517 O O     . LYS D 4 10 ? 64.123 4.187   -2.424  1.00 49.80  ? 210  LYS B O     1 
ATOM   1518 C CB    . LYS D 4 10 ? 62.453 1.438   -2.393  1.00 57.08  ? 210  LYS B CB    1 
ATOM   1519 C CG    . LYS D 4 10 ? 63.928 1.061   -2.204  1.00 62.83  ? 210  LYS B CG    1 
ATOM   1520 C CD    . LYS D 4 10 ? 64.265 -0.382  -2.595  1.00 65.31  ? 210  LYS B CD    1 
ATOM   1521 C CE    . LYS D 4 10 ? 65.652 -0.761  -2.068  1.00 65.50  ? 210  LYS B CE    1 
ATOM   1522 N NZ    . LYS D 4 10 ? 66.134 -2.063  -2.600  1.00 66.39  ? 210  LYS B NZ    1 
ATOM   1523 N N     . GLN D 4 11 ? 62.446 4.246   -3.923  1.00 51.75  ? 211  GLN B N     1 
ATOM   1524 C CA    . GLN D 4 11 ? 63.166 5.139   -4.808  1.00 53.05  ? 211  GLN B CA    1 
ATOM   1525 C C     . GLN D 4 11 ? 63.258 6.557   -4.263  1.00 50.64  ? 211  GLN B C     1 
ATOM   1526 O O     . GLN D 4 11 ? 64.259 7.250   -4.477  1.00 50.71  ? 211  GLN B O     1 
ATOM   1527 C CB    . GLN D 4 11 ? 62.520 5.182   -6.193  1.00 57.01  ? 211  GLN B CB    1 
ATOM   1528 C CG    . GLN D 4 11 ? 63.489 5.698   -7.269  1.00 63.60  ? 211  GLN B CG    1 
ATOM   1529 C CD    . GLN D 4 11 ? 62.795 6.369   -8.439  1.00 67.33  ? 211  GLN B CD    1 
ATOM   1530 O OE1   . GLN D 4 11 ? 63.440 6.772   -9.411  1.00 68.96  ? 211  GLN B OE1   1 
ATOM   1531 N NE2   . GLN D 4 11 ? 61.475 6.505   -8.348  1.00 69.71  ? 211  GLN B NE2   1 
ATOM   1532 N N     . ALA D 4 12 ? 62.217 6.994   -3.565  1.00 46.68  ? 212  ALA B N     1 
ATOM   1533 C CA    . ALA D 4 12 ? 62.214 8.337   -3.009  1.00 43.73  ? 212  ALA B CA    1 
ATOM   1534 C C     . ALA D 4 12 ? 63.285 8.502   -1.920  1.00 41.48  ? 212  ALA B C     1 
ATOM   1535 O O     . ALA D 4 12 ? 63.964 9.529   -1.842  1.00 40.97  ? 212  ALA B O     1 
ATOM   1536 C CB    . ALA D 4 12 ? 60.831 8.662   -2.455  1.00 44.32  ? 212  ALA B CB    1 
ATOM   1537 N N     . SER D 4 13 ? 63.439 7.486   -1.086  1.00 38.97  ? 213  SER B N     1 
ATOM   1538 C CA    . SER D 4 13 ? 64.416 7.543   -0.025  1.00 38.39  ? 213  SER B CA    1 
ATOM   1539 C C     . SER D 4 13 ? 65.819 7.515   -0.581  1.00 39.77  ? 213  SER B C     1 
ATOM   1540 O O     . SER D 4 13 ? 66.712 8.175   -0.050  1.00 41.33  ? 213  SER B O     1 
ATOM   1541 C CB    . SER D 4 13 ? 64.221 6.379   0.942   1.00 37.53  ? 213  SER B CB    1 
ATOM   1542 O OG    . SER D 4 13 ? 63.094 6.605   1.761   1.00 38.94  ? 213  SER B OG    1 
ATOM   1543 N N     . GLU D 4 14 ? 66.025 6.736   -1.639  1.00 40.68  ? 214  GLU B N     1 
ATOM   1544 C CA    . GLU D 4 14 ? 67.350 6.641   -2.244  1.00 40.31  ? 214  GLU B CA    1 
ATOM   1545 C C     . GLU D 4 14 ? 67.702 7.991   -2.805  1.00 39.55  ? 214  GLU B C     1 
ATOM   1546 O O     . GLU D 4 14 ? 68.843 8.442   -2.697  1.00 40.91  ? 214  GLU B O     1 
ATOM   1547 C CB    . GLU D 4 14 ? 67.392 5.609   -3.381  1.00 41.70  ? 214  GLU B CB    1 
ATOM   1548 C CG    . GLU D 4 14 ? 67.280 4.157   -2.948  1.00 44.07  ? 214  GLU B CG    1 
ATOM   1549 C CD    . GLU D 4 14 ? 67.307 3.200   -4.129  1.00 49.85  ? 214  GLU B CD    1 
ATOM   1550 O OE1   . GLU D 4 14 ? 66.773 3.572   -5.203  1.00 49.46  ? 214  GLU B OE1   1 
ATOM   1551 O OE2   . GLU D 4 14 ? 67.848 2.075   -3.982  1.00 51.92  ? 214  GLU B OE2   1 
ATOM   1552 N N     . ILE D 4 15 ? 66.715 8.644   -3.405  1.00 38.04  ? 215  ILE B N     1 
ATOM   1553 C CA    . ILE D 4 15 ? 66.950 9.949   -3.996  1.00 38.72  ? 215  ILE B CA    1 
ATOM   1554 C C     . ILE D 4 15 ? 67.290 11.016  -2.952  1.00 40.54  ? 215  ILE B C     1 
ATOM   1555 O O     . ILE D 4 15 ? 68.216 11.807  -3.144  1.00 41.65  ? 215  ILE B O     1 
ATOM   1556 C CB    . ILE D 4 15 ? 65.729 10.397  -4.814  1.00 37.53  ? 215  ILE B CB    1 
ATOM   1557 C CG1   . ILE D 4 15 ? 65.562 9.465   -6.017  1.00 38.10  ? 215  ILE B CG1   1 
ATOM   1558 C CG2   . ILE D 4 15 ? 65.907 11.846  -5.281  1.00 37.04  ? 215  ILE B CG2   1 
ATOM   1559 C CD1   . ILE D 4 15 ? 64.304 9.706   -6.835  1.00 37.86  ? 215  ILE B CD1   1 
ATOM   1560 N N     . LEU D 4 16 ? 66.536 11.029  -1.854  1.00 39.35  ? 216  LEU B N     1 
ATOM   1561 C CA    . LEU D 4 16 ? 66.736 12.001  -0.787  1.00 39.67  ? 216  LEU B CA    1 
ATOM   1562 C C     . LEU D 4 16 ? 68.062 11.739  -0.069  1.00 39.43  ? 216  LEU B C     1 
ATOM   1563 O O     . LEU D 4 16 ? 68.837 12.671  0.194   1.00 38.37  ? 216  LEU B O     1 
ATOM   1564 C CB    . LEU D 4 16 ? 65.552 11.939  0.207   1.00 39.48  ? 216  LEU B CB    1 
ATOM   1565 C CG    . LEU D 4 16 ? 64.166 12.291  -0.365  1.00 39.78  ? 216  LEU B CG    1 
ATOM   1566 C CD1   . LEU D 4 16 ? 63.069 11.891  0.611   1.00 41.63  ? 216  LEU B CD1   1 
ATOM   1567 C CD2   . LEU D 4 16 ? 64.090 13.776  -0.659  1.00 35.60  ? 216  LEU B CD2   1 
ATOM   1568 N N     . ASN D 4 17 ? 68.317 10.472  0.244   1.00 36.88  ? 217  ASN B N     1 
ATOM   1569 C CA    . ASN D 4 17 ? 69.550 10.090  0.912   1.00 37.02  ? 217  ASN B CA    1 
ATOM   1570 C C     . ASN D 4 17 ? 70.753 10.417  0.010   1.00 36.43  ? 217  ASN B C     1 
ATOM   1571 O O     . ASN D 4 17 ? 71.794 10.876  0.486   1.00 35.99  ? 217  ASN B O     1 
ATOM   1572 C CB    . ASN D 4 17 ? 69.523 8.595   1.250   1.00 38.15  ? 217  ASN B CB    1 
ATOM   1573 C CG    . ASN D 4 17 ? 68.768 8.289   2.547   1.00 41.11  ? 217  ASN B CG    1 
ATOM   1574 O OD1   . ASN D 4 17 ? 68.203 7.209   2.704   1.00 42.97  ? 217  ASN B OD1   1 
ATOM   1575 N ND2   . ASN D 4 17 ? 68.779 9.226   3.483   1.00 40.70  ? 217  ASN B ND2   1 
ATOM   1576 N N     . GLU D 4 18 ? 70.606 10.191  -1.291  1.00 35.13  ? 218  GLU B N     1 
ATOM   1577 C CA    . GLU D 4 18 ? 71.686 10.488  -2.221  1.00 35.76  ? 218  GLU B CA    1 
ATOM   1578 C C     . GLU D 4 18 ? 71.912 11.986  -2.234  1.00 34.35  ? 218  GLU B C     1 
ATOM   1579 O O     . GLU D 4 18 ? 73.052 12.450  -2.154  1.00 35.46  ? 218  GLU B O     1 
ATOM   1580 C CB    . GLU D 4 18 ? 71.368 10.016  -3.653  1.00 34.67  ? 218  GLU B CB    1 
ATOM   1581 C CG    . GLU D 4 18 ? 72.295 10.649  -4.683  1.00 35.75  ? 218  GLU B CG    1 
ATOM   1582 C CD    . GLU D 4 18 ? 72.043 10.205  -6.112  1.00 38.59  ? 218  GLU B CD    1 
ATOM   1583 O OE1   . GLU D 4 18 ? 71.052 9.476   -6.351  1.00 42.86  ? 218  GLU B OE1   1 
ATOM   1584 O OE2   . GLU D 4 18 ? 72.839 10.599  -6.999  1.00 34.83  ? 218  GLU B OE2   1 
ATOM   1585 N N     . TYR D 4 19 ? 70.842 12.758  -2.344  1.00 31.77  ? 219  TYR B N     1 
ATOM   1586 C CA    . TYR D 4 19 ? 71.057 14.184  -2.349  1.00 34.24  ? 219  TYR B CA    1 
ATOM   1587 C C     . TYR D 4 19 ? 71.706 14.554  -1.022  1.00 34.26  ? 219  TYR B C     1 
ATOM   1588 O O     . TYR D 4 19 ? 72.771 15.170  -0.990  1.00 35.85  ? 219  TYR B O     1 
ATOM   1589 C CB    . TYR D 4 19 ? 69.755 14.959  -2.519  1.00 33.44  ? 219  TYR B CB    1 
ATOM   1590 C CG    . TYR D 4 19 ? 69.991 16.454  -2.608  1.00 35.20  ? 219  TYR B CG    1 
ATOM   1591 C CD1   . TYR D 4 19 ? 70.019 17.104  -3.837  1.00 33.79  ? 219  TYR B CD1   1 
ATOM   1592 C CD2   . TYR D 4 19 ? 70.187 17.222  -1.455  1.00 35.21  ? 219  TYR B CD2   1 
ATOM   1593 C CE1   . TYR D 4 19 ? 70.231 18.480  -3.918  1.00 34.96  ? 219  TYR B CE1   1 
ATOM   1594 C CE2   . TYR D 4 19 ? 70.398 18.591  -1.530  1.00 34.66  ? 219  TYR B CE2   1 
ATOM   1595 C CZ    . TYR D 4 19 ? 70.417 19.215  -2.762  1.00 35.06  ? 219  TYR B CZ    1 
ATOM   1596 O OH    . TYR D 4 19 ? 70.602 20.580  -2.832  1.00 37.15  ? 219  TYR B OH    1 
ATOM   1597 N N     . PHE D 4 20 ? 71.081 14.139  0.074   1.00 33.47  ? 220  PHE B N     1 
ATOM   1598 C CA    . PHE D 4 20 ? 71.600 14.468  1.389   1.00 34.57  ? 220  PHE B CA    1 
ATOM   1599 C C     . PHE D 4 20 ? 73.095 14.222  1.584   1.00 36.15  ? 220  PHE B C     1 
ATOM   1600 O O     . PHE D 4 20 ? 73.850 15.144  1.894   1.00 34.53  ? 220  PHE B O     1 
ATOM   1601 C CB    . PHE D 4 20 ? 70.853 13.703  2.462   1.00 32.68  ? 220  PHE B CB    1 
ATOM   1602 C CG    . PHE D 4 20 ? 71.274 14.068  3.840   1.00 31.04  ? 220  PHE B CG    1 
ATOM   1603 C CD1   . PHE D 4 20 ? 70.788 15.224  4.439   1.00 30.79  ? 220  PHE B CD1   1 
ATOM   1604 C CD2   . PHE D 4 20 ? 72.162 13.269  4.545   1.00 29.98  ? 220  PHE B CD2   1 
ATOM   1605 C CE1   . PHE D 4 20 ? 71.174 15.580  5.726   1.00 27.85  ? 220  PHE B CE1   1 
ATOM   1606 C CE2   . PHE D 4 20 ? 72.558 13.623  5.841   1.00 30.46  ? 220  PHE B CE2   1 
ATOM   1607 C CZ    . PHE D 4 20 ? 72.060 14.779  6.427   1.00 29.11  ? 220  PHE B CZ    1 
ATOM   1608 N N     . TYR D 4 21 ? 73.511 12.969  1.412   1.00 37.60  ? 221  TYR B N     1 
ATOM   1609 C CA    . TYR D 4 21 ? 74.903 12.588  1.603   1.00 37.21  ? 221  TYR B CA    1 
ATOM   1610 C C     . TYR D 4 21 ? 75.839 13.218  0.572   1.00 38.27  ? 221  TYR B C     1 
ATOM   1611 O O     . TYR D 4 21 ? 77.037 13.397  0.829   1.00 38.36  ? 221  TYR B O     1 
ATOM   1612 C CB    . TYR D 4 21 ? 75.028 11.066  1.568   1.00 36.40  ? 221  TYR B CB    1 
ATOM   1613 C CG    . TYR D 4 21 ? 74.330 10.356  2.709   1.00 36.28  ? 221  TYR B CG    1 
ATOM   1614 C CD1   . TYR D 4 21 ? 73.338 9.409   2.459   1.00 34.68  ? 221  TYR B CD1   1 
ATOM   1615 C CD2   . TYR D 4 21 ? 74.691 10.603  4.040   1.00 36.36  ? 221  TYR B CD2   1 
ATOM   1616 C CE1   . TYR D 4 21 ? 72.719 8.719   3.487   1.00 35.64  ? 221  TYR B CE1   1 
ATOM   1617 C CE2   . TYR D 4 21 ? 74.081 9.917   5.085   1.00 36.12  ? 221  TYR B CE2   1 
ATOM   1618 C CZ    . TYR D 4 21 ? 73.094 8.972   4.802   1.00 38.45  ? 221  TYR B CZ    1 
ATOM   1619 O OH    . TYR D 4 21 ? 72.499 8.268   5.820   1.00 37.43  ? 221  TYR B OH    1 
ATOM   1620 N N     . SER D 4 22 ? 75.300 13.558  -0.591  1.00 38.29  ? 222  SER B N     1 
ATOM   1621 C CA    . SER D 4 22 ? 76.125 14.180  -1.614  1.00 40.02  ? 222  SER B CA    1 
ATOM   1622 C C     . SER D 4 22 ? 76.393 15.628  -1.230  1.00 40.58  ? 222  SER B C     1 
ATOM   1623 O O     . SER D 4 22 ? 77.364 16.233  -1.686  1.00 42.08  ? 222  SER B O     1 
ATOM   1624 C CB    . SER D 4 22 ? 75.437 14.124  -2.984  1.00 38.99  ? 222  SER B CB    1 
ATOM   1625 O OG    . SER D 4 22 ? 75.425 12.800  -3.493  1.00 37.84  ? 222  SER B OG    1 
ATOM   1626 N N     . HIS D 4 23 ? 75.529 16.179  -0.387  1.00 40.33  ? 223  HIS B N     1 
ATOM   1627 C CA    . HIS D 4 23 ? 75.685 17.555  0.060   1.00 41.62  ? 223  HIS B CA    1 
ATOM   1628 C C     . HIS D 4 23 ? 75.966 17.629  1.573   1.00 41.40  ? 223  HIS B C     1 
ATOM   1629 O O     . HIS D 4 23 ? 75.537 18.585  2.235   1.00 40.57  ? 223  HIS B O     1 
ATOM   1630 C CB    . HIS D 4 23 ? 74.414 18.365  -0.256  1.00 42.31  ? 223  HIS B CB    1 
ATOM   1631 C CG    . HIS D 4 23 ? 74.186 18.621  -1.718  1.00 45.00  ? 223  HIS B CG    1 
ATOM   1632 N ND1   . HIS D 4 23 ? 73.824 17.629  -2.607  1.00 44.95  ? 223  HIS B ND1   1 
ATOM   1633 C CD2   . HIS D 4 23 ? 74.234 19.769  -2.439  1.00 43.59  ? 223  HIS B CD2   1 
ATOM   1634 C CE1   . HIS D 4 23 ? 73.656 18.154  -3.807  1.00 41.63  ? 223  HIS B CE1   1 
ATOM   1635 N NE2   . HIS D 4 23 ? 73.898 19.450  -3.732  1.00 42.05  ? 223  HIS B NE2   1 
ATOM   1636 N N     . LEU D 4 24 ? 76.685 16.647  2.117   1.00 39.68  ? 1223 LEU B N     1 
ATOM   1637 C CA    . LEU D 4 24 ? 76.960 16.641  3.559   1.00 41.79  ? 1223 LEU B CA    1 
ATOM   1638 C C     . LEU D 4 24 ? 77.557 17.923  4.122   1.00 43.12  ? 1223 LEU B C     1 
ATOM   1639 O O     . LEU D 4 24 ? 77.341 18.253  5.286   1.00 43.22  ? 1223 LEU B O     1 
ATOM   1640 C CB    . LEU D 4 24 ? 77.883 15.487  3.957   1.00 39.55  ? 1223 LEU B CB    1 
ATOM   1641 C CG    . LEU D 4 24 ? 77.245 14.320  4.709   1.00 37.63  ? 1223 LEU B CG    1 
ATOM   1642 C CD1   . LEU D 4 24 ? 78.319 13.546  5.459   1.00 35.79  ? 1223 LEU B CD1   1 
ATOM   1643 C CD2   . LEU D 4 24 ? 76.202 14.836  5.669   1.00 35.74  ? 1223 LEU B CD2   1 
ATOM   1644 N N     . SER D 4 25 ? 78.308 18.645  3.302   1.00 44.57  ? 1224 SER B N     1 
ATOM   1645 C CA    . SER D 4 25 ? 78.939 19.874  3.763   1.00 45.44  ? 1224 SER B CA    1 
ATOM   1646 C C     . SER D 4 25 ? 77.948 21.019  3.958   1.00 45.65  ? 1224 SER B C     1 
ATOM   1647 O O     . SER D 4 25 ? 78.274 22.027  4.581   1.00 47.20  ? 1224 SER B O     1 
ATOM   1648 C CB    . SER D 4 25 ? 80.030 20.291  2.774   1.00 46.26  ? 1224 SER B CB    1 
ATOM   1649 O OG    . SER D 4 25 ? 79.490 20.531  1.487   1.00 47.92  ? 1224 SER B OG    1 
ATOM   1650 N N     . ASN D 4 26 ? 76.737 20.862  3.436   1.00 44.70  ? 1225 ASN B N     1 
ATOM   1651 C CA    . ASN D 4 26 ? 75.724 21.906  3.548   1.00 43.67  ? 1225 ASN B CA    1 
ATOM   1652 C C     . ASN D 4 26 ? 74.391 21.344  3.048   1.00 42.43  ? 1225 ASN B C     1 
ATOM   1653 O O     . ASN D 4 26 ? 73.923 21.675  1.956   1.00 42.07  ? 1225 ASN B O     1 
ATOM   1654 C CB    . ASN D 4 26 ? 76.162 23.117  2.716   1.00 44.66  ? 1225 ASN B CB    1 
ATOM   1655 C CG    . ASN D 4 26 ? 75.227 24.312  2.866   1.00 48.17  ? 1225 ASN B CG    1 
ATOM   1656 O OD1   . ASN D 4 26 ? 74.882 24.716  3.980   1.00 48.37  ? 1225 ASN B OD1   1 
ATOM   1657 N ND2   . ASN D 4 26 ? 74.825 24.897  1.732   1.00 49.37  ? 1225 ASN B ND2   1 
ATOM   1658 N N     . PRO D 4 27 ? 73.760 20.483  3.859   1.00 41.44  ? 224  PRO B N     1 
ATOM   1659 C CA    . PRO D 4 27 ? 72.480 19.819  3.576   1.00 40.71  ? 224  PRO B CA    1 
ATOM   1660 C C     . PRO D 4 27 ? 71.266 20.744  3.634   1.00 40.65  ? 224  PRO B C     1 
ATOM   1661 O O     . PRO D 4 27 ? 70.243 20.392  4.229   1.00 39.61  ? 224  PRO B O     1 
ATOM   1662 C CB    . PRO D 4 27 ? 72.392 18.744  4.658   1.00 40.70  ? 224  PRO B CB    1 
ATOM   1663 C CG    . PRO D 4 27 ? 73.763 18.717  5.303   1.00 42.44  ? 224  PRO B CG    1 
ATOM   1664 C CD    . PRO D 4 27 ? 74.240 20.119  5.199   1.00 40.55  ? 224  PRO B CD    1 
ATOM   1665 N N     . TYR D 4 28 ? 71.367 21.915  3.014   1.00 38.76  ? 225  TYR B N     1 
ATOM   1666 C CA    . TYR D 4 28 ? 70.264 22.861  3.045   1.00 39.02  ? 225  TYR B CA    1 
ATOM   1667 C C     . TYR D 4 28 ? 69.813 23.239  1.644   1.00 39.49  ? 225  TYR B C     1 
ATOM   1668 O O     . TYR D 4 28 ? 70.164 24.302  1.114   1.00 38.33  ? 225  TYR B O     1 
ATOM   1669 C CB    . TYR D 4 28 ? 70.657 24.108  3.856   1.00 36.46  ? 225  TYR B CB    1 
ATOM   1670 C CG    . TYR D 4 28 ? 70.957 23.809  5.310   1.00 34.26  ? 225  TYR B CG    1 
ATOM   1671 C CD1   . TYR D 4 28 ? 72.231 23.429  5.710   1.00 33.61  ? 225  TYR B CD1   1 
ATOM   1672 C CD2   . TYR D 4 28 ? 69.947 23.873  6.286   1.00 36.91  ? 225  TYR B CD2   1 
ATOM   1673 C CE1   . TYR D 4 28 ? 72.509 23.115  7.037   1.00 32.21  ? 225  TYR B CE1   1 
ATOM   1674 C CE2   . TYR D 4 28 ? 70.211 23.562  7.628   1.00 31.83  ? 225  TYR B CE2   1 
ATOM   1675 C CZ    . TYR D 4 28 ? 71.496 23.181  7.989   1.00 32.16  ? 225  TYR B CZ    1 
ATOM   1676 O OH    . TYR D 4 28 ? 71.780 22.841  9.286   1.00 29.13  ? 225  TYR B OH    1 
ATOM   1677 N N     . PRO D 4 29 ? 69.017 22.357  1.026   1.00 39.52  ? 226  PRO B N     1 
ATOM   1678 C CA    . PRO D 4 29 ? 68.504 22.572  -0.324  1.00 40.62  ? 226  PRO B CA    1 
ATOM   1679 C C     . PRO D 4 29 ? 67.663 23.830  -0.393  1.00 42.52  ? 226  PRO B C     1 
ATOM   1680 O O     . PRO D 4 29 ? 66.926 24.144  0.533   1.00 43.76  ? 226  PRO B O     1 
ATOM   1681 C CB    . PRO D 4 29 ? 67.693 21.304  -0.593  1.00 39.46  ? 226  PRO B CB    1 
ATOM   1682 C CG    . PRO D 4 29 ? 67.205 20.915  0.756   1.00 38.81  ? 226  PRO B CG    1 
ATOM   1683 C CD    . PRO D 4 29 ? 68.404 21.167  1.645   1.00 38.62  ? 226  PRO B CD    1 
ATOM   1684 N N     . SER D 4 30 ? 67.792 24.557  -1.494  1.00 45.17  ? 227  SER B N     1 
ATOM   1685 C CA    . SER D 4 30 ? 67.038 25.783  -1.701  1.00 47.21  ? 227  SER B CA    1 
ATOM   1686 C C     . SER D 4 30 ? 65.571 25.431  -1.935  1.00 48.87  ? 227  SER B C     1 
ATOM   1687 O O     . SER D 4 30 ? 65.192 24.259  -1.959  1.00 49.13  ? 227  SER B O     1 
ATOM   1688 C CB    . SER D 4 30 ? 67.566 26.507  -2.933  1.00 46.79  ? 227  SER B CB    1 
ATOM   1689 O OG    . SER D 4 30 ? 67.225 25.774  -4.104  1.00 49.72  ? 227  SER B OG    1 
ATOM   1690 N N     . GLU D 4 31 ? 64.749 26.455  -2.129  1.00 51.21  ? 228  GLU B N     1 
ATOM   1691 C CA    . GLU D 4 31 ? 63.332 26.249  -2.386  1.00 52.85  ? 228  GLU B CA    1 
ATOM   1692 C C     . GLU D 4 31 ? 63.165 25.489  -3.707  1.00 51.73  ? 228  GLU B C     1 
ATOM   1693 O O     . GLU D 4 31 ? 62.356 24.573  -3.816  1.00 50.47  ? 228  GLU B O     1 
ATOM   1694 C CB    . GLU D 4 31 ? 62.621 27.602  -2.448  1.00 56.00  ? 228  GLU B CB    1 
ATOM   1695 C CG    . GLU D 4 31 ? 61.115 27.500  -2.329  1.00 62.98  ? 228  GLU B CG    1 
ATOM   1696 C CD    . GLU D 4 31 ? 60.694 26.580  -1.187  1.00 67.80  ? 228  GLU B CD    1 
ATOM   1697 O OE1   . GLU D 4 31 ? 61.101 26.834  -0.025  1.00 69.07  ? 228  GLU B OE1   1 
ATOM   1698 O OE2   . GLU D 4 31 ? 59.962 25.597  -1.461  1.00 70.84  ? 228  GLU B OE2   1 
ATOM   1699 N N     . GLU D 4 32 ? 63.948 25.874  -4.707  1.00 52.51  ? 229  GLU B N     1 
ATOM   1700 C CA    . GLU D 4 32 ? 63.892 25.221  -6.006  1.00 52.93  ? 229  GLU B CA    1 
ATOM   1701 C C     . GLU D 4 32 ? 64.352 23.782  -5.901  1.00 50.40  ? 229  GLU B C     1 
ATOM   1702 O O     . GLU D 4 32 ? 63.727 22.878  -6.457  1.00 49.14  ? 229  GLU B O     1 
ATOM   1703 C CB    . GLU D 4 32 ? 64.789 25.936  -7.019  1.00 58.00  ? 229  GLU B CB    1 
ATOM   1704 C CG    . GLU D 4 32 ? 64.142 27.082  -7.779  1.00 62.57  ? 229  GLU B CG    1 
ATOM   1705 C CD    . GLU D 4 32 ? 64.860 27.362  -9.102  1.00 67.22  ? 229  GLU B CD    1 
ATOM   1706 O OE1   . GLU D 4 32 ? 66.066 27.713  -9.081  1.00 67.93  ? 229  GLU B OE1   1 
ATOM   1707 O OE2   . GLU D 4 32 ? 64.218 27.220  -10.168 1.00 68.79  ? 229  GLU B OE2   1 
ATOM   1708 N N     . ALA D 4 33 ? 65.465 23.575  -5.204  1.00 48.54  ? 230  ALA B N     1 
ATOM   1709 C CA    . ALA D 4 33 ? 66.003 22.231  -5.038  1.00 46.03  ? 230  ALA B CA    1 
ATOM   1710 C C     . ALA D 4 33 ? 64.983 21.343  -4.327  1.00 44.57  ? 230  ALA B C     1 
ATOM   1711 O O     . ALA D 4 33 ? 64.829 20.169  -4.666  1.00 45.30  ? 230  ALA B O     1 
ATOM   1712 C CB    . ALA D 4 33 ? 67.298 22.282  -4.258  1.00 46.20  ? 230  ALA B CB    1 
ATOM   1713 N N     . LYS D 4 34 ? 64.286 21.908  -3.344  1.00 42.14  ? 231  LYS B N     1 
ATOM   1714 C CA    . LYS D 4 34 ? 63.272 21.160  -2.615  1.00 40.94  ? 231  LYS B CA    1 
ATOM   1715 C C     . LYS D 4 34 ? 62.140 20.789  -3.579  1.00 42.07  ? 231  LYS B C     1 
ATOM   1716 O O     . LYS D 4 34 ? 61.595 19.668  -3.530  1.00 39.94  ? 231  LYS B O     1 
ATOM   1717 C CB    . LYS D 4 34 ? 62.726 21.983  -1.438  1.00 38.89  ? 231  LYS B CB    1 
ATOM   1718 C CG    . LYS D 4 34 ? 63.712 22.205  -0.280  1.00 36.08  ? 231  LYS B CG    1 
ATOM   1719 C CD    . LYS D 4 34 ? 63.027 22.871  0.916   1.00 35.09  ? 231  LYS B CD    1 
ATOM   1720 C CE    . LYS D 4 34 ? 64.002 23.227  2.032   1.00 35.45  ? 231  LYS B CE    1 
ATOM   1721 N NZ    . LYS D 4 34 ? 63.355 23.897  3.204   1.00 29.51  ? 231  LYS B NZ    1 
ATOM   1722 N N     . GLU D 4 35 ? 61.791 21.715  -4.468  1.00 42.04  ? 232  GLU B N     1 
ATOM   1723 C CA    . GLU D 4 35 ? 60.738 21.427  -5.437  1.00 45.94  ? 232  GLU B CA    1 
ATOM   1724 C C     . GLU D 4 35 ? 61.119 20.339  -6.448  1.00 44.78  ? 232  GLU B C     1 
ATOM   1725 O O     . GLU D 4 35 ? 60.290 19.505  -6.803  1.00 45.29  ? 232  GLU B O     1 
ATOM   1726 C CB    . GLU D 4 35 ? 60.332 22.701  -6.161  1.00 48.95  ? 232  GLU B CB    1 
ATOM   1727 C CG    . GLU D 4 35 ? 59.466 23.585  -5.298  1.00 57.03  ? 232  GLU B CG    1 
ATOM   1728 C CD    . GLU D 4 35 ? 59.681 25.056  -5.561  1.00 61.38  ? 232  GLU B CD    1 
ATOM   1729 O OE1   . GLU D 4 35 ? 58.972 25.877  -4.930  1.00 65.14  ? 232  GLU B OE1   1 
ATOM   1730 O OE2   . GLU D 4 35 ? 60.558 25.393  -6.390  1.00 63.72  ? 232  GLU B OE2   1 
ATOM   1731 N N     . GLU D 4 36 ? 62.369 20.341  -6.902  1.00 44.02  ? 233  GLU B N     1 
ATOM   1732 C CA    . GLU D 4 36 ? 62.830 19.341  -7.852  1.00 43.98  ? 233  GLU B CA    1 
ATOM   1733 C C     . GLU D 4 36 ? 62.883 17.967  -7.174  1.00 44.33  ? 233  GLU B C     1 
ATOM   1734 O O     . GLU D 4 36 ? 62.493 16.947  -7.760  1.00 42.16  ? 233  GLU B O     1 
ATOM   1735 C CB    . GLU D 4 36 ? 64.205 19.739  -8.392  1.00 45.79  ? 233  GLU B CB    1 
ATOM   1736 C CG    . GLU D 4 36 ? 64.867 18.705  -9.299  1.00 49.68  ? 233  GLU B CG    1 
ATOM   1737 C CD    . GLU D 4 36 ? 63.983 18.265  -10.454 1.00 53.09  ? 233  GLU B CD    1 
ATOM   1738 O OE1   . GLU D 4 36 ? 63.105 19.057  -10.878 1.00 54.72  ? 233  GLU B OE1   1 
ATOM   1739 O OE2   . GLU D 4 36 ? 64.181 17.129  -10.945 1.00 53.48  ? 233  GLU B OE2   1 
ATOM   1740 N N     . LEU D 4 37 ? 63.371 17.938  -5.937  1.00 44.40  ? 234  LEU B N     1 
ATOM   1741 C CA    . LEU D 4 37 ? 63.429 16.685  -5.196  1.00 45.06  ? 234  LEU B CA    1 
ATOM   1742 C C     . LEU D 4 37 ? 62.007 16.153  -4.999  1.00 45.16  ? 234  LEU B C     1 
ATOM   1743 O O     . LEU D 4 37 ? 61.760 14.956  -5.155  1.00 45.16  ? 234  LEU B O     1 
ATOM   1744 C CB    . LEU D 4 37 ? 64.098 16.893  -3.834  1.00 44.10  ? 234  LEU B CB    1 
ATOM   1745 C CG    . LEU D 4 37 ? 65.625 16.914  -3.844  1.00 43.92  ? 234  LEU B CG    1 
ATOM   1746 C CD1   . LEU D 4 37 ? 66.175 17.450  -2.525  1.00 41.60  ? 234  LEU B CD1   1 
ATOM   1747 C CD2   . LEU D 4 37 ? 66.119 15.513  -4.110  1.00 41.33  ? 234  LEU B CD2   1 
ATOM   1748 N N     . ALA D 4 38 ? 61.080 17.049  -4.667  1.00 44.51  ? 235  ALA B N     1 
ATOM   1749 C CA    . ALA D 4 38 ? 59.688 16.665  -4.450  1.00 46.17  ? 235  ALA B CA    1 
ATOM   1750 C C     . ALA D 4 38 ? 59.078 16.075  -5.711  1.00 47.62  ? 235  ALA B C     1 
ATOM   1751 O O     . ALA D 4 38 ? 58.355 15.074  -5.659  1.00 48.67  ? 235  ALA B O     1 
ATOM   1752 C CB    . ALA D 4 38 ? 58.869 17.871  -4.001  1.00 44.68  ? 235  ALA B CB    1 
ATOM   1753 N N     . ARG D 4 39 ? 59.372 16.702  -6.846  1.00 48.74  ? 236  ARG B N     1 
ATOM   1754 C CA    . ARG D 4 39 ? 58.848 16.248  -8.125  1.00 50.12  ? 236  ARG B CA    1 
ATOM   1755 C C     . ARG D 4 39 ? 59.310 14.824  -8.399  1.00 51.13  ? 236  ARG B C     1 
ATOM   1756 O O     . ARG D 4 39 ? 58.501 13.935  -8.671  1.00 51.78  ? 236  ARG B O     1 
ATOM   1757 C CB    . ARG D 4 39 ? 59.329 17.173  -9.252  1.00 50.02  ? 236  ARG B CB    1 
ATOM   1758 C CG    . ARG D 4 39 ? 58.653 16.945  -10.605 1.00 48.48  ? 236  ARG B CG    1 
ATOM   1759 C CD    . ARG D 4 39 ? 59.375 17.709  -11.719 1.00 47.63  ? 236  ARG B CD    1 
ATOM   1760 N NE    . ARG D 4 39 ? 60.724 17.182  -11.936 1.00 47.97  ? 236  ARG B NE    1 
ATOM   1761 C CZ    . ARG D 4 39 ? 60.989 15.984  -12.448 1.00 46.38  ? 236  ARG B CZ    1 
ATOM   1762 N NH1   . ARG D 4 39 ? 59.999 15.178  -12.811 1.00 45.38  ? 236  ARG B NH1   1 
ATOM   1763 N NH2   . ARG D 4 39 ? 62.245 15.577  -12.569 1.00 45.24  ? 236  ARG B NH2   1 
ATOM   1764 N N     . LYS D 4 40 ? 60.615 14.608  -8.303  1.00 51.69  ? 237  LYS B N     1 
ATOM   1765 C CA    . LYS D 4 40 ? 61.167 13.292  -8.577  1.00 52.28  ? 237  LYS B CA    1 
ATOM   1766 C C     . LYS D 4 40 ? 60.705 12.237  -7.596  1.00 51.54  ? 237  LYS B C     1 
ATOM   1767 O O     . LYS D 4 40 ? 60.519 11.084  -7.974  1.00 53.14  ? 237  LYS B O     1 
ATOM   1768 C CB    . LYS D 4 40 ? 62.695 13.335  -8.567  1.00 53.54  ? 237  LYS B CB    1 
ATOM   1769 C CG    . LYS D 4 40 ? 63.306 14.430  -9.423  1.00 52.68  ? 237  LYS B CG    1 
ATOM   1770 C CD    . LYS D 4 40 ? 64.663 14.000  -9.957  1.00 53.60  ? 237  LYS B CD    1 
ATOM   1771 C CE    . LYS D 4 40 ? 65.545 13.431  -8.874  1.00 51.79  ? 237  LYS B CE    1 
ATOM   1772 N NZ    . LYS D 4 40 ? 66.827 12.951  -9.424  1.00 52.67  ? 237  LYS B NZ    1 
ATOM   1773 N N     . CYS D 4 41 ? 60.529 12.627  -6.336  1.00 51.50  ? 238  CYS B N     1 
ATOM   1774 C CA    . CYS D 4 41 ? 60.104 11.687  -5.303  1.00 49.84  ? 238  CYS B CA    1 
ATOM   1775 C C     . CYS D 4 41 ? 58.598 11.499  -5.245  1.00 49.49  ? 238  CYS B C     1 
ATOM   1776 O O     . CYS D 4 41 ? 58.110 10.535  -4.661  1.00 50.50  ? 238  CYS B O     1 
ATOM   1777 C CB    . CYS D 4 41 ? 60.612 12.138  -3.937  1.00 48.09  ? 238  CYS B CB    1 
ATOM   1778 S SG    . CYS D 4 41 ? 62.386 12.119  -3.795  1.00 47.17  ? 238  CYS B SG    1 
ATOM   1779 N N     . GLY D 4 42 ? 57.858 12.419  -5.845  1.00 48.13  ? 239  GLY B N     1 
ATOM   1780 C CA    . GLY D 4 42 ? 56.418 12.286  -5.820  1.00 48.01  ? 239  GLY B CA    1 
ATOM   1781 C C     . GLY D 4 42 ? 55.796 12.595  -4.466  1.00 47.61  ? 239  GLY B C     1 
ATOM   1782 O O     . GLY D 4 42 ? 54.897 11.882  -4.009  1.00 47.83  ? 239  GLY B O     1 
ATOM   1783 N N     . ILE D 4 43 ? 56.283 13.650  -3.820  1.00 45.83  ? 240  ILE B N     1 
ATOM   1784 C CA    . ILE D 4 43 ? 55.759 14.079  -2.531  1.00 43.74  ? 240  ILE B CA    1 
ATOM   1785 C C     . ILE D 4 43 ? 55.668 15.602  -2.539  1.00 43.93  ? 240  ILE B C     1 
ATOM   1786 O O     . ILE D 4 43 ? 55.898 16.229  -3.567  1.00 45.33  ? 240  ILE B O     1 
ATOM   1787 C CB    . ILE D 4 43 ? 56.652 13.600  -1.364  1.00 42.03  ? 240  ILE B CB    1 
ATOM   1788 C CG1   . ILE D 4 43 ? 58.056 14.184  -1.484  1.00 40.04  ? 240  ILE B CG1   1 
ATOM   1789 C CG2   . ILE D 4 43 ? 56.732 12.096  -1.373  1.00 41.49  ? 240  ILE B CG2   1 
ATOM   1790 C CD1   . ILE D 4 43 ? 59.033 13.625  -0.458  1.00 34.83  ? 240  ILE B CD1   1 
ATOM   1791 N N     . THR D 4 44 ? 55.317 16.200  -1.407  1.00 44.42  ? 241  THR B N     1 
ATOM   1792 C CA    . THR D 4 44 ? 55.196 17.648  -1.328  1.00 42.79  ? 241  THR B CA    1 
ATOM   1793 C C     . THR D 4 44 ? 56.512 18.248  -0.874  1.00 43.21  ? 241  THR B C     1 
ATOM   1794 O O     . THR D 4 44 ? 57.344 17.563  -0.267  1.00 44.29  ? 241  THR B O     1 
ATOM   1795 C CB    . THR D 4 44 ? 54.123 18.050  -0.316  1.00 44.60  ? 241  THR B CB    1 
ATOM   1796 O OG1   . THR D 4 44 ? 54.552 17.677  1.005   1.00 46.22  ? 241  THR B OG1   1 
ATOM   1797 C CG2   . THR D 4 44 ? 52.806 17.359  -0.640  1.00 40.01  ? 241  THR B CG2   1 
ATOM   1798 N N     . VAL D 4 45 ? 56.705 19.529  -1.165  1.00 42.87  ? 242  VAL B N     1 
ATOM   1799 C CA    . VAL D 4 45 ? 57.927 20.211  -0.763  1.00 43.05  ? 242  VAL B CA    1 
ATOM   1800 C C     . VAL D 4 45 ? 57.980 20.223  0.762   1.00 43.23  ? 242  VAL B C     1 
ATOM   1801 O O     . VAL D 4 45 ? 59.044 20.136  1.370   1.00 44.71  ? 242  VAL B O     1 
ATOM   1802 C CB    . VAL D 4 45 ? 57.971 21.646  -1.340  1.00 43.00  ? 242  VAL B CB    1 
ATOM   1803 C CG1   . VAL D 4 45 ? 56.583 22.074  -1.740  1.00 44.88  ? 242  VAL B CG1   1 
ATOM   1804 C CG2   . VAL D 4 45 ? 58.563 22.619  -0.318  1.00 44.54  ? 242  VAL B CG2   1 
ATOM   1805 N N     . SER D 4 46 ? 56.808 20.313  1.372   1.00 42.63  ? 243  SER B N     1 
ATOM   1806 C CA    . SER D 4 46 ? 56.686 20.300  2.816   1.00 40.15  ? 243  SER B CA    1 
ATOM   1807 C C     . SER D 4 46 ? 57.222 18.959  3.367   1.00 38.75  ? 243  SER B C     1 
ATOM   1808 O O     . SER D 4 46 ? 57.938 18.937  4.383   1.00 36.75  ? 243  SER B O     1 
ATOM   1809 C CB    . SER D 4 46 ? 55.212 20.494  3.187   1.00 42.14  ? 243  SER B CB    1 
ATOM   1810 O OG    . SER D 4 46 ? 55.011 20.517  4.586   1.00 45.72  ? 243  SER B OG    1 
ATOM   1811 N N     . GLN D 4 47 ? 56.884 17.845  2.712   1.00 35.22  ? 244  GLN B N     1 
ATOM   1812 C CA    . GLN D 4 47 ? 57.377 16.553  3.180   1.00 33.45  ? 244  GLN B CA    1 
ATOM   1813 C C     . GLN D 4 47 ? 58.870 16.495  2.960   1.00 33.00  ? 244  GLN B C     1 
ATOM   1814 O O     . GLN D 4 47 ? 59.592 15.865  3.739   1.00 32.92  ? 244  GLN B O     1 
ATOM   1815 C CB    . GLN D 4 47 ? 56.696 15.392  2.469   1.00 36.39  ? 244  GLN B CB    1 
ATOM   1816 C CG    . GLN D 4 47 ? 55.202 15.258  2.775   1.00 38.14  ? 244  GLN B CG    1 
ATOM   1817 C CD    . GLN D 4 47 ? 54.506 14.286  1.845   1.00 38.39  ? 244  GLN B CD    1 
ATOM   1818 O OE1   . GLN D 4 47 ? 54.550 14.443  0.621   1.00 40.99  ? 244  GLN B OE1   1 
ATOM   1819 N NE2   . GLN D 4 47 ? 53.865 13.276  2.415   1.00 35.55  ? 244  GLN B NE2   1 
ATOM   1820 N N     . VAL D 4 48 ? 59.349 17.162  1.912   1.00 32.15  ? 245  VAL B N     1 
ATOM   1821 C CA    . VAL D 4 48 ? 60.792 17.193  1.675   1.00 30.79  ? 245  VAL B CA    1 
ATOM   1822 C C     . VAL D 4 48 ? 61.423 17.950  2.844   1.00 31.09  ? 245  VAL B C     1 
ATOM   1823 O O     . VAL D 4 48 ? 62.392 17.477  3.436   1.00 34.25  ? 245  VAL B O     1 
ATOM   1824 C CB    . VAL D 4 48 ? 61.168 17.898  0.347   1.00 28.47  ? 245  VAL B CB    1 
ATOM   1825 C CG1   . VAL D 4 48 ? 62.673 18.069  0.259   1.00 26.12  ? 245  VAL B CG1   1 
ATOM   1826 C CG2   . VAL D 4 48 ? 60.687 17.077  -0.822  1.00 29.53  ? 245  VAL B CG2   1 
ATOM   1827 N N     . SER D 4 49 ? 60.878 19.116  3.184   1.00 29.64  ? 246  SER B N     1 
ATOM   1828 C CA    . SER D 4 49 ? 61.422 19.873  4.310   1.00 32.93  ? 246  SER B CA    1 
ATOM   1829 C C     . SER D 4 49 ? 61.440 19.028  5.582   1.00 31.36  ? 246  SER B C     1 
ATOM   1830 O O     . SER D 4 49 ? 62.475 18.946  6.238   1.00 32.71  ? 246  SER B O     1 
ATOM   1831 C CB    . SER D 4 49 ? 60.629 21.165  4.571   1.00 34.56  ? 246  SER B CB    1 
ATOM   1832 O OG    . SER D 4 49 ? 61.025 22.221  3.711   1.00 36.29  ? 246  SER B OG    1 
ATOM   1833 N N     . ASN D 4 50 ? 60.319 18.406  5.941   1.00 30.93  ? 247  ASN B N     1 
ATOM   1834 C CA    . ASN D 4 50 ? 60.324 17.570  7.149   1.00 34.33  ? 247  ASN B CA    1 
ATOM   1835 C C     . ASN D 4 50 ? 61.448 16.549  7.030   1.00 33.31  ? 247  ASN B C     1 
ATOM   1836 O O     . ASN D 4 50 ? 62.210 16.341  7.977   1.00 31.40  ? 247  ASN B O     1 
ATOM   1837 C CB    . ASN D 4 50 ? 59.027 16.763  7.337   1.00 36.08  ? 247  ASN B CB    1 
ATOM   1838 C CG    . ASN D 4 50 ? 57.830 17.621  7.649   1.00 38.44  ? 247  ASN B CG    1 
ATOM   1839 O OD1   . ASN D 4 50 ? 57.957 18.791  8.022   1.00 37.57  ? 247  ASN B OD1   1 
ATOM   1840 N ND2   . ASN D 4 50 ? 56.643 17.032  7.512   1.00 38.15  ? 247  ASN B ND2   1 
ATOM   1841 N N     . TRP D 4 51 ? 61.526 15.912  5.857   1.00 32.53  ? 248  TRP B N     1 
ATOM   1842 C CA    . TRP D 4 51 ? 62.521 14.882  5.609   1.00 31.55  ? 248  TRP B CA    1 
ATOM   1843 C C     . TRP D 4 51 ? 63.927 15.383  5.856   1.00 31.00  ? 248  TRP B C     1 
ATOM   1844 O O     . TRP D 4 51 ? 64.709 14.718  6.511   1.00 30.91  ? 248  TRP B O     1 
ATOM   1845 C CB    . TRP D 4 51 ? 62.423 14.346  4.180   1.00 33.72  ? 248  TRP B CB    1 
ATOM   1846 C CG    . TRP D 4 51 ? 63.273 13.105  3.983   1.00 32.07  ? 248  TRP B CG    1 
ATOM   1847 C CD1   . TRP D 4 51 ? 62.886 11.807  4.174   1.00 29.13  ? 248  TRP B CD1   1 
ATOM   1848 C CD2   . TRP D 4 51 ? 64.678 13.069  3.711   1.00 29.59  ? 248  TRP B CD2   1 
ATOM   1849 N NE1   . TRP D 4 51 ? 63.965 10.971  4.055   1.00 31.31  ? 248  TRP B NE1   1 
ATOM   1850 C CE2   . TRP D 4 51 ? 65.080 11.715  3.772   1.00 32.42  ? 248  TRP B CE2   1 
ATOM   1851 C CE3   . TRP D 4 51 ? 65.638 14.048  3.426   1.00 31.33  ? 248  TRP B CE3   1 
ATOM   1852 C CZ2   . TRP D 4 51 ? 66.410 11.312  3.562   1.00 32.00  ? 248  TRP B CZ2   1 
ATOM   1853 C CZ3   . TRP D 4 51 ? 66.966 13.648  3.214   1.00 33.19  ? 248  TRP B CZ3   1 
ATOM   1854 C CH2   . TRP D 4 51 ? 67.333 12.290  3.286   1.00 34.03  ? 248  TRP B CH2   1 
ATOM   1855 N N     . PHE D 4 52 ? 64.265 16.552  5.341   1.00 30.80  ? 249  PHE B N     1 
ATOM   1856 C CA    . PHE D 4 52 ? 65.604 17.038  5.585   1.00 33.36  ? 249  PHE B CA    1 
ATOM   1857 C C     . PHE D 4 52 ? 65.782 17.427  7.052   1.00 34.43  ? 249  PHE B C     1 
ATOM   1858 O O     . PHE D 4 52 ? 66.858 17.193  7.642   1.00 34.46  ? 249  PHE B O     1 
ATOM   1859 C CB    . PHE D 4 52 ? 65.943 18.203  4.646   1.00 33.07  ? 249  PHE B CB    1 
ATOM   1860 C CG    . PHE D 4 52 ? 66.445 17.756  3.291   1.00 33.41  ? 249  PHE B CG    1 
ATOM   1861 C CD1   . PHE D 4 52 ? 65.564 17.531  2.231   1.00 34.15  ? 249  PHE B CD1   1 
ATOM   1862 C CD2   . PHE D 4 52 ? 67.798 17.517  3.094   1.00 33.78  ? 249  PHE B CD2   1 
ATOM   1863 C CE1   . PHE D 4 52 ? 66.030 17.073  1.002   1.00 33.96  ? 249  PHE B CE1   1 
ATOM   1864 C CE2   . PHE D 4 52 ? 68.277 17.059  1.869   1.00 35.31  ? 249  PHE B CE2   1 
ATOM   1865 C CZ    . PHE D 4 52 ? 67.395 16.836  0.822   1.00 35.36  ? 249  PHE B CZ    1 
ATOM   1866 N N     . GLY D 4 53 ? 64.733 18.005  7.645   1.00 32.55  ? 250  GLY B N     1 
ATOM   1867 C CA    . GLY D 4 53 ? 64.812 18.385  9.049   1.00 32.70  ? 250  GLY B CA    1 
ATOM   1868 C C     . GLY D 4 53 ? 65.178 17.196  9.932   1.00 31.57  ? 250  GLY B C     1 
ATOM   1869 O O     . GLY D 4 53 ? 66.158 17.225  10.677  1.00 31.39  ? 250  GLY B O     1 
ATOM   1870 N N     . ASN D 4 54 ? 64.398 16.128  9.822   1.00 31.37  ? 251  ASN B N     1 
ATOM   1871 C CA    . ASN D 4 54 ? 64.650 14.913  10.588  1.00 32.49  ? 251  ASN B CA    1 
ATOM   1872 C C     . ASN D 4 54 ? 66.013 14.294  10.274  1.00 32.26  ? 251  ASN B C     1 
ATOM   1873 O O     . ASN D 4 54 ? 66.709 13.814  11.173  1.00 32.54  ? 251  ASN B O     1 
ATOM   1874 C CB    . ASN D 4 54 ? 63.563 13.876  10.301  1.00 31.99  ? 251  ASN B CB    1 
ATOM   1875 C CG    . ASN D 4 54 ? 62.221 14.239  10.912  1.00 34.11  ? 251  ASN B CG    1 
ATOM   1876 O OD1   . ASN D 4 54 ? 61.175 13.909  10.366  1.00 37.09  ? 251  ASN B OD1   1 
ATOM   1877 N ND2   . ASN D 4 54 ? 62.246 14.897  12.053  1.00 34.76  ? 251  ASN B ND2   1 
ATOM   1878 N N     . LYS D 4 55 ? 66.391 14.300  9.000   1.00 30.91  ? 252  LYS B N     1 
ATOM   1879 C CA    . LYS D 4 55 ? 67.652 13.702  8.591   1.00 31.05  ? 252  LYS B CA    1 
ATOM   1880 C C     . LYS D 4 55 ? 68.821 14.457  9.201   1.00 32.91  ? 252  LYS B C     1 
ATOM   1881 O O     . LYS D 4 55 ? 69.724 13.873  9.807   1.00 31.07  ? 252  LYS B O     1 
ATOM   1882 C CB    . LYS D 4 55 ? 67.782 13.713  7.057   1.00 31.77  ? 252  LYS B CB    1 
ATOM   1883 C CG    . LYS D 4 55 ? 68.967 12.920  6.534   1.00 29.90  ? 252  LYS B CG    1 
ATOM   1884 C CD    . LYS D 4 55 ? 68.678 11.429  6.559   1.00 28.48  ? 252  LYS B CD    1 
ATOM   1885 C CE    . LYS D 4 55 ? 69.952 10.608  6.383   1.00 30.85  ? 252  LYS B CE    1 
ATOM   1886 N NZ    . LYS D 4 55 ? 69.707 9.133   6.276   1.00 28.15  ? 252  LYS B NZ    1 
ATOM   1887 N N     . ARG D 4 56 ? 68.795 15.769  9.035   1.00 33.84  ? 253  ARG B N     1 
ATOM   1888 C CA    . ARG D 4 56 ? 69.852 16.620  9.547   1.00 37.04  ? 253  ARG B CA    1 
ATOM   1889 C C     . ARG D 4 56 ? 70.077 16.418  11.055  1.00 38.42  ? 253  ARG B C     1 
ATOM   1890 O O     . ARG D 4 56 ? 71.206 16.240  11.515  1.00 38.96  ? 253  ARG B O     1 
ATOM   1891 C CB    . ARG D 4 56 ? 69.468 18.060  9.264   1.00 39.21  ? 253  ARG B CB    1 
ATOM   1892 C CG    . ARG D 4 56 ? 70.512 18.918  8.598   1.00 38.40  ? 253  ARG B CG    1 
ATOM   1893 C CD    . ARG D 4 56 ? 69.907 20.297  8.375   1.00 38.42  ? 253  ARG B CD    1 
ATOM   1894 N NE    . ARG D 4 56 ? 69.132 20.317  7.147   1.00 40.98  ? 253  ARG B NE    1 
ATOM   1895 C CZ    . ARG D 4 56 ? 67.898 20.778  7.018   1.00 39.60  ? 253  ARG B CZ    1 
ATOM   1896 N NH1   . ARG D 4 56 ? 67.239 21.274  8.052   1.00 38.95  ? 253  ARG B NH1   1 
ATOM   1897 N NH2   . ARG D 4 56 ? 67.326 20.747  5.825   1.00 42.31  ? 253  ARG B NH2   1 
ATOM   1898 N N     . ILE D 4 57 ? 68.991 16.435  11.816  1.00 38.06  ? 254  ILE B N     1 
ATOM   1899 C CA    . ILE D 4 57 ? 69.065 16.281  13.260  1.00 40.19  ? 254  ILE B CA    1 
ATOM   1900 C C     . ILE D 4 57 ? 69.437 14.867  13.712  1.00 41.50  ? 254  ILE B C     1 
ATOM   1901 O O     . ILE D 4 57 ? 70.343 14.676  14.532  1.00 42.69  ? 254  ILE B O     1 
ATOM   1902 C CB    . ILE D 4 57 ? 67.708 16.677  13.916  1.00 41.59  ? 254  ILE B CB    1 
ATOM   1903 C CG1   . ILE D 4 57 ? 67.597 18.203  14.039  1.00 43.40  ? 254  ILE B CG1   1 
ATOM   1904 C CG2   . ILE D 4 57 ? 67.595 16.070  15.303  1.00 39.74  ? 254  ILE B CG2   1 
ATOM   1905 C CD1   . ILE D 4 57 ? 68.043 18.983  12.831  1.00 41.51  ? 254  ILE B CD1   1 
ATOM   1906 N N     . ARG D 4 58 ? 68.724 13.876  13.194  1.00 39.81  ? 255  ARG B N     1 
ATOM   1907 C CA    . ARG D 4 58 ? 68.992 12.503  13.571  1.00 38.86  ? 255  ARG B CA    1 
ATOM   1908 C C     . ARG D 4 58 ? 70.419 12.086  13.211  1.00 39.03  ? 255  ARG B C     1 
ATOM   1909 O O     . ARG D 4 58 ? 70.994 11.218  13.865  1.00 40.06  ? 255  ARG B O     1 
ATOM   1910 C CB    . ARG D 4 58 ? 67.933 11.582  12.941  1.00 36.19  ? 255  ARG B CB    1 
ATOM   1911 C CG    . ARG D 4 58 ? 66.617 11.669  13.700  1.00 33.14  ? 255  ARG B CG    1 
ATOM   1912 C CD    . ARG D 4 58 ? 65.413 11.122  12.962  1.00 30.49  ? 255  ARG B CD    1 
ATOM   1913 N NE    . ARG D 4 58 ? 64.225 11.391  13.758  1.00 28.55  ? 255  ARG B NE    1 
ATOM   1914 C CZ    . ARG D 4 58 ? 62.966 11.276  13.344  1.00 32.19  ? 255  ARG B CZ    1 
ATOM   1915 N NH1   . ARG D 4 58 ? 62.671 10.881  12.111  1.00 29.04  ? 255  ARG B NH1   1 
ATOM   1916 N NH2   . ARG D 4 58 ? 61.983 11.595  14.175  1.00 33.83  ? 255  ARG B NH2   1 
ATOM   1917 N N     . TYR D 4 59 ? 70.996 12.726  12.199  1.00 37.79  ? 256  TYR B N     1 
ATOM   1918 C CA    . TYR D 4 59 ? 72.355 12.423  11.792  1.00 37.99  ? 256  TYR B CA    1 
ATOM   1919 C C     . TYR D 4 59 ? 73.375 12.975  12.795  1.00 39.36  ? 256  TYR B C     1 
ATOM   1920 O O     . TYR D 4 59 ? 74.167 12.224  13.353  1.00 37.99  ? 256  TYR B O     1 
ATOM   1921 C CB    . TYR D 4 59 ? 72.648 13.014  10.415  1.00 37.51  ? 256  TYR B CB    1 
ATOM   1922 C CG    . TYR D 4 59 ? 74.016 12.641  9.898   1.00 38.21  ? 256  TYR B CG    1 
ATOM   1923 C CD1   . TYR D 4 59 ? 74.187 11.548  9.045   1.00 37.43  ? 256  TYR B CD1   1 
ATOM   1924 C CD2   . TYR D 4 59 ? 75.146 13.358  10.286  1.00 37.16  ? 256  TYR B CD2   1 
ATOM   1925 C CE1   . TYR D 4 59 ? 75.446 11.183  8.589   1.00 36.19  ? 256  TYR B CE1   1 
ATOM   1926 C CE2   . TYR D 4 59 ? 76.410 12.998  9.842   1.00 37.44  ? 256  TYR B CE2   1 
ATOM   1927 C CZ    . TYR D 4 59 ? 76.556 11.911  8.992   1.00 38.77  ? 256  TYR B CZ    1 
ATOM   1928 O OH    . TYR D 4 59 ? 77.817 11.562  8.545   1.00 38.90  ? 256  TYR B OH    1 
ATOM   1929 N N     . LYS D 4 60 ? 73.371 14.286  13.019  1.00 41.18  ? 257  LYS B N     1 
ATOM   1930 C CA    . LYS D 4 60 ? 74.325 14.866  13.965  1.00 43.75  ? 257  LYS B CA    1 
ATOM   1931 C C     . LYS D 4 60 ? 74.142 14.250  15.352  1.00 44.69  ? 257  LYS B C     1 
ATOM   1932 O O     . LYS D 4 60 ? 75.077 14.229  16.149  1.00 45.00  ? 257  LYS B O     1 
ATOM   1933 C CB    . LYS D 4 60 ? 74.168 16.386  14.047  1.00 43.17  ? 257  LYS B CB    1 
ATOM   1934 C CG    . LYS D 4 60 ? 72.814 16.855  14.522  1.00 44.21  ? 257  LYS B CG    1 
ATOM   1935 C CD    . LYS D 4 60 ? 72.675 18.366  14.416  1.00 45.08  ? 257  LYS B CD    1 
ATOM   1936 C CE    . LYS D 4 60 ? 73.669 19.095  15.296  1.00 46.57  ? 257  LYS B CE    1 
ATOM   1937 N NZ    . LYS D 4 60 ? 73.380 20.555  15.300  1.00 48.04  ? 257  LYS B NZ    1 
ATOM   1938 N N     . LYS D 4 61 ? 72.938 13.747  15.624  1.00 44.94  ? 258  LYS B N     1 
ATOM   1939 C CA    . LYS D 4 61 ? 72.630 13.106  16.902  1.00 46.87  ? 258  LYS B CA    1 
ATOM   1940 C C     . LYS D 4 61 ? 73.394 11.795  17.106  1.00 46.04  ? 258  LYS B C     1 
ATOM   1941 O O     . LYS D 4 61 ? 73.678 11.409  18.239  1.00 45.45  ? 258  LYS B O     1 
ATOM   1942 C CB    . LYS D 4 61 ? 71.129 12.817  17.006  1.00 49.52  ? 258  LYS B CB    1 
ATOM   1943 C CG    . LYS D 4 61 ? 70.388 13.650  18.040  1.00 53.28  ? 258  LYS B CG    1 
ATOM   1944 C CD    . LYS D 4 61 ? 70.489 13.051  19.429  1.00 55.47  ? 258  LYS B CD    1 
ATOM   1945 C CE    . LYS D 4 61 ? 69.881 13.994  20.477  1.00 58.67  ? 258  LYS B CE    1 
ATOM   1946 N NZ    . LYS D 4 61 ? 70.072 13.507  21.880  1.00 57.71  ? 258  LYS B NZ    1 
ATOM   1947 N N     . ASN D 4 62 ? 73.707 11.097  16.019  1.00 44.05  ? 259  ASN B N     1 
ATOM   1948 C CA    . ASN D 4 62 ? 74.431 9.841   16.149  1.00 43.68  ? 259  ASN B CA    1 
ATOM   1949 C C     . ASN D 4 62 ? 75.913 9.954   15.842  1.00 43.43  ? 259  ASN B C     1 
ATOM   1950 O O     . ASN D 4 62 ? 76.571 8.941   15.612  1.00 43.41  ? 259  ASN B O     1 
ATOM   1951 C CB    . ASN D 4 62 ? 73.837 8.766   15.249  1.00 43.73  ? 259  ASN B CB    1 
ATOM   1952 C CG    . ASN D 4 62 ? 72.516 8.250   15.749  1.00 44.98  ? 259  ASN B CG    1 
ATOM   1953 O OD1   . ASN D 4 62 ? 72.238 7.061   15.640  1.00 45.38  ? 259  ASN B OD1   1 
ATOM   1954 N ND2   . ASN D 4 62 ? 71.683 9.137   16.284  1.00 47.68  ? 259  ASN B ND2   1 
ATOM   1955 N N     . ILE D 4 63 ? 76.434 11.175  15.807  1.00 42.19  ? 260  ILE B N     1 
ATOM   1956 C CA    . ILE D 4 63 ? 77.852 11.351  15.548  1.00 42.31  ? 260  ILE B CA    1 
ATOM   1957 C C     . ILE D 4 63 ? 78.620 11.026  16.826  1.00 45.14  ? 260  ILE B C     1 
ATOM   1958 O O     . ILE D 4 63 ? 79.492 10.130  16.766  1.00 46.08  ? 260  ILE B O     1 
ATOM   1959 C CB    . ILE D 4 63 ? 78.183 12.787  15.099  1.00 39.75  ? 260  ILE B CB    1 
ATOM   1960 C CG1   . ILE D 4 63 ? 77.618 13.028  13.700  1.00 39.95  ? 260  ILE B CG1   1 
ATOM   1961 C CG2   . ILE D 4 63 ? 79.694 12.994  15.073  1.00 37.40  ? 260  ILE B CG2   1 
ATOM   1962 C CD1   . ILE D 4 63 ? 77.905 14.407  13.128  1.00 37.33  ? 260  ILE B CD1   1 
ATOM   1963 O OXT   . ILE D 4 63 ? 78.328 11.665  17.868  1.00 46.86  ? 260  ILE B OXT   1 
HETATM 1964 O O     . HOH E 5 .  ? 55.051 15.726  18.904  1.00 23.54  ? 801  HOH C O     1 
HETATM 1965 O O     . HOH E 5 .  ? 61.913 -0.289  11.231  1.00 46.70  ? 804  HOH C O     1 
HETATM 1966 O O     . HOH E 5 .  ? 58.004 28.808  23.095  1.00 38.03  ? 806  HOH C O     1 
HETATM 1967 O O     . HOH E 5 .  ? 60.224 31.231  23.282  1.00 63.46  ? 808  HOH C O     1 
HETATM 1968 O O     . HOH E 5 .  ? 50.035 23.474  21.362  1.00 50.22  ? 815  HOH C O     1 
HETATM 1969 O O     . HOH E 5 .  ? 72.639 33.235  12.340  1.00 71.34  ? 832  HOH C O     1 
HETATM 1970 O O     . HOH E 5 .  ? 58.765 14.038  5.418   1.00 45.25  ? 839  HOH C O     1 
HETATM 1971 O O     . HOH E 5 .  ? 58.788 -11.142 18.288  1.00 61.03  ? 848  HOH C O     1 
HETATM 1972 O O     . HOH E 5 .  ? 62.745 8.838   17.678  1.00 67.58  ? 850  HOH C O     1 
HETATM 1973 O O     . HOH E 5 .  ? 61.130 5.197   19.584  1.00 63.07  ? 852  HOH C O     1 
HETATM 1974 O O     . HOH E 5 .  ? 51.790 -8.042  18.908  1.00 57.06  ? 861  HOH C O     1 
HETATM 1975 O O     . HOH E 5 .  ? 57.641 21.814  11.559  1.00 45.54  ? 880  HOH C O     1 
HETATM 1976 O O     . HOH E 5 .  ? 53.575 19.268  11.215  1.00 57.40  ? 883  HOH C O     1 
HETATM 1977 O O     . HOH E 5 .  ? 50.790 19.771  8.664   1.00 64.89  ? 889  HOH C O     1 
HETATM 1978 O O     . HOH E 5 .  ? 65.934 35.361  20.051  1.00 68.54  ? 896  HOH C O     1 
HETATM 1979 O O     . HOH F 5 .  ? 63.525 19.080  12.620  1.00 59.32  ? 803  HOH D O     1 
HETATM 1980 O O     . HOH F 5 .  ? 52.424 -1.242  15.068  1.00 55.12  ? 807  HOH D O     1 
HETATM 1981 O O     . HOH F 5 .  ? 55.385 5.613   11.347  1.00 48.45  ? 811  HOH D O     1 
HETATM 1982 O O     . HOH F 5 .  ? 58.859 9.017   23.077  1.00 46.24  ? 823  HOH D O     1 
HETATM 1983 O O     . HOH F 5 .  ? 62.351 11.795  23.013  1.00 41.85  ? 827  HOH D O     1 
HETATM 1984 O O     . HOH F 5 .  ? 56.887 24.457  11.798  1.00 56.81  ? 829  HOH D O     1 
HETATM 1985 O O     . HOH F 5 .  ? 66.628 14.837  20.307  1.00 52.47  ? 833  HOH D O     1 
HETATM 1986 O O     . HOH F 5 .  ? 58.154 28.301  9.581   1.00 53.24  ? 840  HOH D O     1 
HETATM 1987 O O     . HOH F 5 .  ? 57.617 36.469  3.046   1.00 59.76  ? 849  HOH D O     1 
HETATM 1988 O O     . HOH F 5 .  ? 62.256 -7.651  15.425  1.00 60.98  ? 864  HOH D O     1 
HETATM 1989 O O     . HOH F 5 .  ? 50.655 33.989  7.728   1.00 63.67  ? 866  HOH D O     1 
HETATM 1990 O O     . HOH F 5 .  ? 61.220 9.495   21.552  1.00 68.91  ? 869  HOH D O     1 
HETATM 1991 O O     . HOH F 5 .  ? 56.786 24.967  8.926   1.00 57.46  ? 871  HOH D O     1 
HETATM 1992 O O     . HOH F 5 .  ? 64.864 14.929  16.044  1.00 48.61  ? 872  HOH D O     1 
HETATM 1993 O O     . HOH F 5 .  ? 52.383 7.034   21.663  1.00 56.63  ? 881  HOH D O     1 
HETATM 1994 O O     . HOH F 5 .  ? 67.074 14.303  17.976  1.00 52.34  ? 890  HOH D O     1 
HETATM 1995 O O     . HOH F 5 .  ? 69.105 -9.271  13.731  1.00 59.78  ? 901  HOH D O     1 
HETATM 1996 O O     . HOH G 5 .  ? 59.367 32.010  28.691  1.00 52.75  ? 814  HOH A O     1 
HETATM 1997 O O     . HOH G 5 .  ? 51.665 24.206  18.812  1.00 60.38  ? 816  HOH A O     1 
HETATM 1998 O O     . HOH G 5 .  ? 47.557 19.020  24.434  1.00 68.09  ? 818  HOH A O     1 
HETATM 1999 O O     . HOH G 5 .  ? 54.047 25.554  14.018  1.00 49.74  ? 819  HOH A O     1 
HETATM 2000 O O     . HOH G 5 .  ? 55.977 36.480  16.840  1.00 39.71  ? 820  HOH A O     1 
HETATM 2001 O O     . HOH G 5 .  ? 55.171 28.675  22.903  1.00 38.83  ? 826  HOH A O     1 
HETATM 2002 O O     . HOH G 5 .  ? 38.345 28.540  30.565  1.00 53.58  ? 828  HOH A O     1 
HETATM 2003 O O     . HOH G 5 .  ? 58.794 38.481  23.853  1.00 58.76  ? 830  HOH A O     1 
HETATM 2004 O O     . HOH G 5 .  ? 70.652 6.599   8.223   1.00 38.72  ? 835  HOH A O     1 
HETATM 2005 O O     . HOH G 5 .  ? 62.991 23.170  24.651  1.00 46.66  ? 842  HOH A O     1 
HETATM 2006 O O     . HOH G 5 .  ? 56.948 28.839  31.599  1.00 52.89  ? 843  HOH A O     1 
HETATM 2007 O O     . HOH G 5 .  ? 59.867 38.810  19.847  1.00 55.05  ? 844  HOH A O     1 
HETATM 2008 O O     . HOH G 5 .  ? 61.246 23.464  26.729  1.00 75.01  ? 846  HOH A O     1 
HETATM 2009 O O     . HOH G 5 .  ? 44.971 37.739  33.750  1.00 59.33  ? 847  HOH A O     1 
HETATM 2010 O O     . HOH G 5 .  ? 51.714 26.497  18.151  1.00 51.08  ? 851  HOH A O     1 
HETATM 2011 O O     . HOH G 5 .  ? 54.604 36.993  32.018  1.00 57.80  ? 855  HOH A O     1 
HETATM 2012 O O     . HOH G 5 .  ? 78.395 23.871  7.472   1.00 72.87  ? 856  HOH A O     1 
HETATM 2013 O O     . HOH G 5 .  ? 88.287 11.346  7.212   1.00 47.15  ? 858  HOH A O     1 
HETATM 2014 O O     . HOH G 5 .  ? 84.089 21.313  12.987  1.00 65.56  ? 865  HOH A O     1 
HETATM 2015 O O     . HOH G 5 .  ? 60.125 30.304  26.678  1.00 59.94  ? 868  HOH A O     1 
HETATM 2016 O O     . HOH G 5 .  ? 52.295 41.938  34.873  1.00 54.41  ? 874  HOH A O     1 
HETATM 2017 O O     . HOH G 5 .  ? 45.883 21.445  18.529  1.00 65.98  ? 875  HOH A O     1 
HETATM 2018 O O     . HOH G 5 .  ? 61.948 22.334  21.671  1.00 83.64  ? 876  HOH A O     1 
HETATM 2019 O O     . HOH G 5 .  ? 73.380 3.981   10.515  1.00 58.49  ? 877  HOH A O     1 
HETATM 2020 O O     . HOH G 5 .  ? 85.046 11.570  12.359  1.00 65.84  ? 878  HOH A O     1 
HETATM 2021 O O     . HOH G 5 .  ? 56.662 37.023  30.906  1.00 47.16  ? 888  HOH A O     1 
HETATM 2022 O O     . HOH G 5 .  ? 50.160 41.744  36.730  1.00 59.43  ? 893  HOH A O     1 
HETATM 2023 O O     . HOH G 5 .  ? 88.962 9.813   4.983   1.00 84.45  ? 895  HOH A O     1 
HETATM 2024 O O     . HOH G 5 .  ? 62.614 38.768  21.181  1.00 77.67  ? 897  HOH A O     1 
HETATM 2025 O O     . HOH G 5 .  ? 71.978 3.294   8.212   1.00 90.29  ? 898  HOH A O     1 
HETATM 2026 O O     . HOH G 5 .  ? 64.695 35.227  22.292  1.00 80.94  ? 899  HOH A O     1 
HETATM 2027 O O     . HOH G 5 .  ? 71.196 1.125   7.047   1.00 57.94  ? 900  HOH A O     1 
HETATM 2028 O O     . HOH G 5 .  ? 64.663 38.274  23.027  1.00 84.30  ? 902  HOH A O     1 
HETATM 2029 O O     . HOH H 5 .  ? 64.507 21.546  6.485   1.00 38.25  ? 802  HOH B O     1 
HETATM 2030 O O     . HOH H 5 .  ? 71.334 5.877   4.943   1.00 56.38  ? 805  HOH B O     1 
HETATM 2031 O O     . HOH H 5 .  ? 70.647 6.384   -1.678  1.00 45.61  ? 809  HOH B O     1 
HETATM 2032 O O     . HOH H 5 .  ? 80.026 16.631  0.924   1.00 61.34  ? 810  HOH B O     1 
HETATM 2033 O O     . HOH H 5 .  ? 62.288 12.750  -14.104 1.00 45.93  ? 812  HOH B O     1 
HETATM 2034 O O     . HOH H 5 .  ? 69.952 27.111  1.898   1.00 42.49  ? 813  HOH B O     1 
HETATM 2035 O O     . HOH H 5 .  ? 63.522 8.013   4.191   1.00 30.94  ? 817  HOH B O     1 
HETATM 2036 O O     . HOH H 5 .  ? 59.819 8.160   -7.032  1.00 69.31  ? 821  HOH B O     1 
HETATM 2037 O O     . HOH H 5 .  ? 69.432 12.706  -5.704  1.00 48.80  ? 822  HOH B O     1 
HETATM 2038 O O     . HOH H 5 .  ? 63.963 22.068  9.349   1.00 52.52  ? 824  HOH B O     1 
HETATM 2039 O O     . HOH H 5 .  ? 54.041 21.819  0.555   1.00 45.11  ? 825  HOH B O     1 
HETATM 2040 O O     . HOH H 5 .  ? 66.623 22.666  3.664   1.00 71.75  ? 831  HOH B O     1 
HETATM 2041 O O     . HOH H 5 .  ? 70.259 2.015   -4.506  1.00 58.07  ? 834  HOH B O     1 
HETATM 2042 O O     . HOH H 5 .  ? 71.111 21.440  -5.484  1.00 48.94  ? 836  HOH B O     1 
HETATM 2043 O O     . HOH H 5 .  ? 55.650 6.351   9.143   1.00 54.30  ? 837  HOH B O     1 
HETATM 2044 O O     . HOH H 5 .  ? 72.952 13.729  21.966  1.00 55.24  ? 838  HOH B O     1 
HETATM 2045 O O     . HOH H 5 .  ? 52.847 9.761   4.479   1.00 64.24  ? 841  HOH B O     1 
HETATM 2046 O O     . HOH H 5 .  ? 69.309 5.772   5.692   1.00 85.06  ? 845  HOH B O     1 
HETATM 2047 O O     . HOH H 5 .  ? 71.694 27.587  3.917   1.00 64.04  ? 853  HOH B O     1 
HETATM 2048 O O     . HOH H 5 .  ? 62.318 10.003  -10.706 1.00 57.99  ? 854  HOH B O     1 
HETATM 2049 O O     . HOH H 5 .  ? 60.421 24.391  6.222   1.00 43.81  ? 857  HOH B O     1 
HETATM 2050 O O     . HOH H 5 .  ? 66.990 16.294  -10.231 1.00 50.77  ? 859  HOH B O     1 
HETATM 2051 O O     . HOH H 5 .  ? 78.159 9.779   6.404   1.00 39.92  ? 860  HOH B O     1 
HETATM 2052 O O     . HOH H 5 .  ? 53.557 21.588  7.210   1.00 53.43  ? 862  HOH B O     1 
HETATM 2053 O O     . HOH H 5 .  ? 68.405 20.419  -7.191  1.00 47.52  ? 863  HOH B O     1 
HETATM 2054 O O     . HOH H 5 .  ? 78.207 19.750  -0.760  1.00 52.40  ? 867  HOH B O     1 
HETATM 2055 O O     . HOH H 5 .  ? 72.896 22.347  -0.592  1.00 55.34  ? 870  HOH B O     1 
HETATM 2056 O O     . HOH H 5 .  ? 72.085 27.013  7.048   1.00 60.70  ? 873  HOH B O     1 
HETATM 2057 O O     . HOH H 5 .  ? 67.243 1.695   -7.413  1.00 59.13  ? 879  HOH B O     1 
HETATM 2058 O O     . HOH H 5 .  ? 70.600 24.238  -2.569  1.00 48.62  ? 882  HOH B O     1 
HETATM 2059 O O     . HOH H 5 .  ? 64.009 15.730  14.172  1.00 42.73  ? 884  HOH B O     1 
HETATM 2060 O O     . HOH H 5 .  ? 67.681 16.936  -7.591  1.00 55.66  ? 885  HOH B O     1 
HETATM 2061 O O     . HOH H 5 .  ? 67.603 14.393  -7.116  1.00 47.94  ? 886  HOH B O     1 
HETATM 2062 O O     . HOH H 5 .  ? 64.400 11.761  16.274  1.00 68.90  ? 887  HOH B O     1 
HETATM 2063 O O     . HOH H 5 .  ? 62.182 9.029   -13.667 1.00 70.96  ? 891  HOH B O     1 
HETATM 2064 O O     . HOH H 5 .  ? 72.704 29.682  7.531   1.00 78.16  ? 892  HOH B O     1 
HETATM 2065 O O     . HOH H 5 .  ? 55.457 24.323  0.972   1.00 77.09  ? 894  HOH B O     1 
HETATM 2066 O O     . HOH H 5 .  ? 65.609 9.560   -10.697 1.00 82.04  ? 903  HOH B O     1 
A 1 1  DA  1  1    1    DA  ADE C . n 
A 1 2  DC  2  2    2    DC  CYT C . n 
A 1 3  DT  3  3    3    DT  THY C . n 
A 1 4  DC  4  4    4    DC  CYT C . n 
A 1 5  DT  5  5    5    DT  THY C . n 
A 1 6  DA  6  6    6    DA  ADE C . n 
A 1 7  DT  7  7    7    DT  THY C . n 
A 1 8  DG  8  8    8    DG  GUA C . n 
A 1 9  DA  9  9    9    DA  ADE C . n 
A 1 10 DT  10 10   10   DT  THY C . n 
A 1 11 DT  11 11   11   DT  THY C . n 
A 1 12 DT  12 12   12   DT  THY C . n 
A 1 13 DA  13 13   13   DA  ADE C . n 
A 1 14 DT  14 14   14   DT  THY C . n 
A 1 15 DG  15 15   15   DG  GUA C . n 
A 1 16 DG  16 16   16   DG  GUA C . n 
A 1 17 DG  17 17   17   DG  GUA C . n 
A 1 18 DC  18 18   18   DC  CYT C . n 
A 1 19 DT  19 19   19   DT  THY C . n 
A 1 20 DG  20 20   20   DG  GUA C . n 
B 2 1  DT  1  21   21   DT  THY D . n 
B 2 2  DC  2  22   22   DC  CYT D . n 
B 2 3  DA  3  23   23   DA  ADE D . n 
B 2 4  DG  4  24   24   DG  GUA D . n 
B 2 5  DC  5  25   25   DC  CYT D . n 
B 2 6  DC  6  26   26   DC  CYT D . n 
B 2 7  DC  7  27   27   DC  CYT D . n 
B 2 8  DA  8  28   28   DA  ADE D . n 
B 2 9  DT  9  29   29   DT  THY D . n 
B 2 10 DA  10 30   30   DA  ADE D . n 
B 2 11 DA  11 31   31   DA  ADE D . n 
B 2 12 DA  12 32   32   DA  ADE D . n 
B 2 13 DT  13 33   33   DT  THY D . n 
B 2 14 DC  14 34   34   DC  CYT D . n 
B 2 15 DA  15 35   35   DA  ADE D . n 
B 2 16 DT  16 36   36   DT  THY D . n 
B 2 17 DA  17 37   37   DA  ADE D . n 
B 2 18 DG  18 38   38   DG  GUA D . n 
B 2 19 DA  19 39   39   DA  ADE D . n 
B 2 20 DG  20 40   40   DG  GUA D . n 
C 3 1  GLY 1  74   74   GLY GLY A . n 
C 3 2  LYS 2  75   75   LYS LYS A . n 
C 3 3  LYS 3  76   76   LYS LYS A . n 
C 3 4  ASN 4  77   77   ASN ASN A . n 
C 3 5  PRO 5  78   78   PRO PRO A . n 
C 3 6  PRO 6  79   79   PRO PRO A . n 
C 3 7  GLN 7  80   80   GLN GLN A . n 
C 3 8  ILE 8  81   81   ILE ILE A . n 
C 3 9  TYR 9  82   82   TYR TYR A . n 
C 3 10 PRO 10 83   83   PRO PRO A . n 
C 3 11 TRP 11 84   84   TRP TRP A . n 
C 3 12 MET 12 85   85   MET MET A . n 
C 3 13 LYS 13 86   86   LYS ALA A . n 
C 3 14 ARG 14 87   87   ARG ARG A . n 
C 3 15 VAL 15 88   88   VAL VAL A . n 
C 3 16 HIS 16 89   ?    ?   ?   A . n 
C 3 17 LEU 17 90   ?    ?   ?   A . n 
C 3 18 GLY 18 91   ?    ?   ?   A . n 
C 3 19 THR 19 92   ?    ?   ?   A . n 
C 3 20 SER 20 93   ?    ?   ?   A . n 
C 3 21 THR 21 94   ?    ?   ?   A . n 
C 3 22 VAL 22 95   ?    ?   ?   A . n 
C 3 23 ASN 23 96   ?    ?   ?   A . n 
C 3 24 ALA 24 97   ?    ?   ?   A . n 
C 3 25 ASN 25 98   ?    ?   ?   A . n 
C 3 26 GLY 26 99   ?    ?   ?   A . n 
C 3 27 GLU 27 100  ?    ?   ?   A . n 
C 3 28 THR 28 101  ?    ?   ?   A . n 
C 3 29 LYS 29 102  ?    ?   ?   A . n 
C 3 30 ARG 30 103  ?    ?   ?   A . n 
C 3 31 GLN 31 104  104  GLN GLN A . n 
C 3 32 ARG 32 105  105  ARG ARG A . n 
C 3 33 THR 33 106  106  THR THR A . n 
C 3 34 SER 34 107  107  SER SER A . n 
C 3 35 TYR 35 108  108  TYR TYR A . n 
C 3 36 THR 36 109  109  THR THR A . n 
C 3 37 ARG 37 110  110  ARG ARG A . n 
C 3 38 TYR 38 111  111  TYR TYR A . n 
C 3 39 GLN 39 112  112  GLN GLN A . n 
C 3 40 THR 40 113  113  THR THR A . n 
C 3 41 LEU 41 114  114  LEU LEU A . n 
C 3 42 GLU 42 115  115  GLU GLU A . n 
C 3 43 LEU 43 116  116  LEU LEU A . n 
C 3 44 GLU 44 117  117  GLU GLU A . n 
C 3 45 LYS 45 118  118  LYS LYS A . n 
C 3 46 GLU 46 119  119  GLU GLU A . n 
C 3 47 PHE 47 120  120  PHE PHE A . n 
C 3 48 HIS 48 121  121  HIS HIS A . n 
C 3 49 PHE 49 122  122  PHE PHE A . n 
C 3 50 ASN 50 123  123  ASN ASN A . n 
C 3 51 ARG 51 124  124  ARG ARG A . n 
C 3 52 TYR 52 125  125  TYR TYR A . n 
C 3 53 LEU 53 126  126  LEU LEU A . n 
C 3 54 THR 54 127  127  THR THR A . n 
C 3 55 ARG 55 128  128  ARG ARG A . n 
C 3 56 ARG 56 129  129  ARG ARG A . n 
C 3 57 ARG 57 130  130  ARG ARG A . n 
C 3 58 ARG 58 131  131  ARG ARG A . n 
C 3 59 ILE 59 132  132  ILE ILE A . n 
C 3 60 GLU 60 133  133  GLU GLU A . n 
C 3 61 ILE 61 134  134  ILE ILE A . n 
C 3 62 ALA 62 135  135  ALA ALA A . n 
C 3 63 HIS 63 136  136  HIS HIS A . n 
C 3 64 ALA 64 137  137  ALA ALA A . n 
C 3 65 LEU 65 138  138  LEU LEU A . n 
C 3 66 SER 66 139  139  SER SER A . n 
C 3 67 LEU 67 140  140  LEU LEU A . n 
C 3 68 THR 68 141  141  THR THR A . n 
C 3 69 GLU 69 142  142  GLU GLU A . n 
C 3 70 ARG 70 143  143  ARG ARG A . n 
C 3 71 GLN 71 144  144  GLN GLN A . n 
C 3 72 ILE 72 145  145  ILE ILE A . n 
C 3 73 LYS 73 146  146  LYS LYS A . n 
C 3 74 ILE 74 147  147  ILE ILE A . n 
C 3 75 TRP 75 148  148  TRP TRP A . n 
C 3 76 PHE 76 149  149  PHE PHE A . n 
C 3 77 GLN 77 150  150  GLN GLN A . n 
C 3 78 ASN 78 151  151  ASN ASN A . n 
C 3 79 ARG 79 152  152  ARG ARG A . n 
C 3 80 ARG 80 153  153  ARG ARG A . n 
C 3 81 MET 81 154  154  MET MET A . n 
C 3 82 LYS 82 155  155  LYS LYS A . n 
C 3 83 TRP 83 156  156  TRP TRP A . n 
C 3 84 LYS 84 157  157  LYS LYS A . n 
C 3 85 LYS 85 158  158  LYS LYS A . n 
C 3 86 GLU 86 159  159  GLU ALA A . n 
C 3 87 HIS 87 160  160  HIS HIS A . n 
C 3 88 LYS 88 161  161  LYS ALA A . n 
D 4 1  ALA 1  201  ?    ?   ?   B . n 
D 4 2  ARG 2  202  ?    ?   ?   B . n 
D 4 3  ARG 3  203  ?    ?   ?   B . n 
D 4 4  LYS 4  204  ?    ?   ?   B . n 
D 4 5  ARG 5  205  205  ARG ARG B . n 
D 4 6  ARG 6  206  206  ARG ARG B . n 
D 4 7  ASN 7  207  207  ASN ASN B . n 
D 4 8  PHE 8  208  208  PHE PHE B . n 
D 4 9  SER 9  209  209  SER SER B . n 
D 4 10 LYS 10 210  210  LYS LYS B . n 
D 4 11 GLN 11 211  211  GLN GLN B . n 
D 4 12 ALA 12 212  212  ALA ALA B . n 
D 4 13 SER 13 213  213  SER SER B . n 
D 4 14 GLU 14 214  214  GLU GLU B . n 
D 4 15 ILE 15 215  215  ILE ILE B . n 
D 4 16 LEU 16 216  216  LEU LEU B . n 
D 4 17 ASN 17 217  217  ASN ASN B . n 
D 4 18 GLU 18 218  218  GLU GLU B . n 
D 4 19 TYR 19 219  219  TYR TYR B . n 
D 4 20 PHE 20 220  220  PHE PHE B . n 
D 4 21 TYR 21 221  221  TYR TYR B . n 
D 4 22 SER 22 222  222  SER SER B . n 
D 4 23 HIS 23 223  223  HIS HIS B . n 
D 4 24 LEU 24 1223 1223 LEU LEU B . n 
D 4 25 SER 25 1224 1224 SER SER B . n 
D 4 26 ASN 26 1225 1225 ASN ASN B . n 
D 4 27 PRO 27 224  224  PRO PRO B . n 
D 4 28 TYR 28 225  225  TYR TYR B . n 
D 4 29 PRO 29 226  226  PRO PRO B . n 
D 4 30 SER 30 227  227  SER SER B . n 
D 4 31 GLU 31 228  228  GLU GLU B . n 
D 4 32 GLU 32 229  229  GLU GLU B . n 
D 4 33 ALA 33 230  230  ALA ALA B . n 
D 4 34 LYS 34 231  231  LYS LYS B . n 
D 4 35 GLU 35 232  232  GLU GLU B . n 
D 4 36 GLU 36 233  233  GLU GLU B . n 
D 4 37 LEU 37 234  234  LEU LEU B . n 
D 4 38 ALA 38 235  235  ALA ALA B . n 
D 4 39 ARG 39 236  236  ARG ARG B . n 
D 4 40 LYS 40 237  237  LYS LYS B . n 
D 4 41 CYS 41 238  238  CYS CYS B . n 
D 4 42 GLY 42 239  239  GLY GLY B . n 
D 4 43 ILE 43 240  240  ILE ILE B . n 
D 4 44 THR 44 241  241  THR THR B . n 
D 4 45 VAL 45 242  242  VAL VAL B . n 
D 4 46 SER 46 243  243  SER SER B . n 
D 4 47 GLN 47 244  244  GLN GLN B . n 
D 4 48 VAL 48 245  245  VAL VAL B . n 
D 4 49 SER 49 246  246  SER SER B . n 
D 4 50 ASN 50 247  247  ASN ASN B . n 
D 4 51 TRP 51 248  248  TRP TRP B . n 
D 4 52 PHE 52 249  249  PHE PHE B . n 
D 4 53 GLY 53 250  250  GLY GLY B . n 
D 4 54 ASN 54 251  251  ASN ASN B . n 
D 4 55 LYS 55 252  252  LYS LYS B . n 
D 4 56 ARG 56 253  253  ARG ARG B . n 
D 4 57 ILE 57 254  254  ILE ILE B . n 
D 4 58 ARG 58 255  255  ARG ARG B . n 
D 4 59 TYR 59 256  256  TYR TYR B . n 
D 4 60 LYS 60 257  257  LYS LYS B . n 
D 4 61 LYS 61 258  258  LYS LYS B . n 
D 4 62 ASN 62 259  259  ASN ASN B . n 
D 4 63 ILE 63 260  260  ILE ILE B . n 
E 5 HOH 1  801 801 HOH WAT C . 
E 5 HOH 2  804 804 HOH WAT C . 
E 5 HOH 3  806 806 HOH WAT C . 
E 5 HOH 4  808 808 HOH WAT C . 
E 5 HOH 5  815 815 HOH WAT C . 
E 5 HOH 6  832 832 HOH WAT C . 
E 5 HOH 7  839 839 HOH WAT C . 
E 5 HOH 8  848 848 HOH WAT C . 
E 5 HOH 9  850 850 HOH WAT C . 
E 5 HOH 10 852 852 HOH WAT C . 
E 5 HOH 11 861 861 HOH WAT C . 
E 5 HOH 12 880 880 HOH WAT C . 
E 5 HOH 13 883 883 HOH WAT C . 
E 5 HOH 14 889 889 HOH WAT C . 
E 5 HOH 15 896 896 HOH WAT C . 
F 5 HOH 1  803 803 HOH WAT D . 
F 5 HOH 2  807 807 HOH WAT D . 
F 5 HOH 3  811 811 HOH WAT D . 
F 5 HOH 4  823 823 HOH WAT D . 
F 5 HOH 5  827 827 HOH WAT D . 
F 5 HOH 6  829 829 HOH WAT D . 
F 5 HOH 7  833 833 HOH WAT D . 
F 5 HOH 8  840 840 HOH WAT D . 
F 5 HOH 9  849 849 HOH WAT D . 
F 5 HOH 10 864 864 HOH WAT D . 
F 5 HOH 11 866 866 HOH WAT D . 
F 5 HOH 12 869 869 HOH WAT D . 
F 5 HOH 13 871 871 HOH WAT D . 
F 5 HOH 14 872 872 HOH WAT D . 
F 5 HOH 15 881 881 HOH WAT D . 
F 5 HOH 16 890 890 HOH WAT D . 
F 5 HOH 17 901 901 HOH WAT D . 
G 5 HOH 1  814 814 HOH WAT A . 
G 5 HOH 2  816 816 HOH WAT A . 
G 5 HOH 3  818 818 HOH WAT A . 
G 5 HOH 4  819 819 HOH WAT A . 
G 5 HOH 5  820 820 HOH WAT A . 
G 5 HOH 6  826 826 HOH WAT A . 
G 5 HOH 7  828 828 HOH WAT A . 
G 5 HOH 8  830 830 HOH WAT A . 
G 5 HOH 9  835 835 HOH WAT A . 
G 5 HOH 10 842 842 HOH WAT A . 
G 5 HOH 11 843 843 HOH WAT A . 
G 5 HOH 12 844 844 HOH WAT A . 
G 5 HOH 13 846 846 HOH WAT A . 
G 5 HOH 14 847 847 HOH WAT A . 
G 5 HOH 15 851 851 HOH WAT A . 
G 5 HOH 16 855 855 HOH WAT A . 
G 5 HOH 17 856 856 HOH WAT A . 
G 5 HOH 18 858 858 HOH WAT A . 
G 5 HOH 19 865 865 HOH WAT A . 
G 5 HOH 20 868 868 HOH WAT A . 
G 5 HOH 21 874 874 HOH WAT A . 
G 5 HOH 22 875 875 HOH WAT A . 
G 5 HOH 23 876 876 HOH WAT A . 
G 5 HOH 24 877 877 HOH WAT A . 
G 5 HOH 25 878 878 HOH WAT A . 
G 5 HOH 26 888 888 HOH WAT A . 
G 5 HOH 27 893 893 HOH WAT A . 
G 5 HOH 28 895 895 HOH WAT A . 
G 5 HOH 29 897 897 HOH WAT A . 
G 5 HOH 30 898 898 HOH WAT A . 
G 5 HOH 31 899 899 HOH WAT A . 
G 5 HOH 32 900 900 HOH WAT A . 
G 5 HOH 33 902 902 HOH WAT A . 
H 5 HOH 1  802 802 HOH WAT B . 
H 5 HOH 2  805 805 HOH WAT B . 
H 5 HOH 3  809 809 HOH WAT B . 
H 5 HOH 4  810 810 HOH WAT B . 
H 5 HOH 5  812 812 HOH WAT B . 
H 5 HOH 6  813 813 HOH WAT B . 
H 5 HOH 7  817 817 HOH WAT B . 
H 5 HOH 8  821 821 HOH WAT B . 
H 5 HOH 9  822 822 HOH WAT B . 
H 5 HOH 10 824 824 HOH WAT B . 
H 5 HOH 11 825 825 HOH WAT B . 
H 5 HOH 12 831 831 HOH WAT B . 
H 5 HOH 13 834 834 HOH WAT B . 
H 5 HOH 14 836 836 HOH WAT B . 
H 5 HOH 15 837 837 HOH WAT B . 
H 5 HOH 16 838 838 HOH WAT B . 
H 5 HOH 17 841 841 HOH WAT B . 
H 5 HOH 18 845 845 HOH WAT B . 
H 5 HOH 19 853 853 HOH WAT B . 
H 5 HOH 20 854 854 HOH WAT B . 
H 5 HOH 21 857 857 HOH WAT B . 
H 5 HOH 22 859 859 HOH WAT B . 
H 5 HOH 23 860 860 HOH WAT B . 
H 5 HOH 24 862 862 HOH WAT B . 
H 5 HOH 25 863 863 HOH WAT B . 
H 5 HOH 26 867 867 HOH WAT B . 
H 5 HOH 27 870 870 HOH WAT B . 
H 5 HOH 28 873 873 HOH WAT B . 
H 5 HOH 29 879 879 HOH WAT B . 
H 5 HOH 30 882 882 HOH WAT B . 
H 5 HOH 31 884 884 HOH WAT B . 
H 5 HOH 32 885 885 HOH WAT B . 
H 5 HOH 33 886 886 HOH WAT B . 
H 5 HOH 34 887 887 HOH WAT B . 
H 5 HOH 35 891 891 HOH WAT B . 
H 5 HOH 36 892 892 HOH WAT B . 
H 5 HOH 37 894 894 HOH WAT B . 
H 5 HOH 38 903 903 HOH WAT B . 
#                   1 
_pdbx_struct_assembly.details              software_defined_assembly 
_pdbx_struct_assembly.method_details       PISA 
_pdbx_struct_assembly.oligomeric_details   tetrameric 
_pdbx_struct_assembly.oligomeric_count     4 
_pdbx_struct_assembly_gen.assembly_id       1 
_pdbx_struct_assembly_gen.oper_expression   1 
_pdbx_struct_assembly_gen.asym_id_list      A,B,C,D,E,F,G,H 
_pdbx_struct_assembly_prop.biol_id   1 
_pdbx_struct_assembly_prop.type      'ABSA (A^2)' 
_pdbx_struct_assembly_prop.value     6750 
_pdbx_struct_assembly_prop.details   ? 
#                   1 
_pdbx_struct_oper_list.type                 'identity operation'                 1_555 
_pdbx_struct_oper_list.symmetry_operation   x,y,z 
_pdbx_struct_oper_list.matrix[1][1]         1.0000000000 
_pdbx_struct_oper_list.matrix[1][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[1][3]         0.0000000000 
_pdbx_struct_oper_list.vector[1]            0.0000000000 
_pdbx_struct_oper_list.matrix[2][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[2][2]         1.0000000000 
_pdbx_struct_oper_list.matrix[2][3]         0.0000000000 
_pdbx_struct_oper_list.vector[2]            0.0000000000 
_pdbx_struct_oper_list.matrix[3][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][3]         1.0000000000 
_pdbx_struct_oper_list.vector[3]            0.0000000000 
1 'Structure model' 1 0 2008-02-05 
2 'Structure model' 1 1 2011-07-13 
3 'Structure model' 1 2 2021-10-20 
_pdbx_audit_revision_details.ordinal             1 
_pdbx_audit_revision_details.revision_ordinal    1 
_pdbx_audit_revision_details.data_content_type   'Structure model' 
_pdbx_audit_revision_details.provider            repository 
_pdbx_audit_revision_details.type                'Initial release' 
_pdbx_audit_revision_details.description         ? 
_pdbx_audit_revision_details.details             ? 
1 2 'Structure model' 'Version format compliance' 
2 3 'Structure model' 'Database references'       
3 3 'Structure model' 'Source and taxonomy'       
1 3 'Structure model' database_2          
2 3 'Structure model' pdbx_entity_src_syn 
3 3 'Structure model' struct_ref_seq_dif  
1 3 'Structure model' '_database_2.pdbx_DOI'                
2 3 'Structure model' '_database_2.pdbx_database_accession' 
3 3 'Structure model' '_struct_ref_seq_dif.details'         
CNS      refinement        1.1 ? 1 
HKL-2000 'data collection' .   ? 2 
HKL-2000 'data reduction'  .   ? 3 
HKL-2000 'data scaling'    .   ? 4 
AMoRE    phasing           .   ? 5 
1 1 OP2 C DT  14  ? ? O C HOH 808 ? ? 2.11 
2 1 O   A GLU 159 ? ? N A LYS 161 ? ? 2.13 
3 1 O   B HOH 805 ? ? O B HOH 845 ? ? 2.16 
1 1 ASN A 123  ? ? -176.71 114.96 
2 1 ARG A 124  ? ? -59.62  -5.90  
3 1 HIS A 160  ? ? 27.52   -11.00 
4 1 ASN B 1225 ? ? -171.28 74.38  
5 1 PRO B 224  ? ? -71.73  46.17  
#              1 
_pdbx_validate_planes.PDB_model_num   1 
_pdbx_validate_planes.auth_comp_id    DA 
_pdbx_validate_planes.auth_asym_id    D 
_pdbx_validate_planes.auth_seq_id     37 
_pdbx_validate_planes.PDB_ins_code    ? 
_pdbx_validate_planes.label_alt_id    ? 
_pdbx_validate_planes.rmsd            0.060 
_pdbx_validate_planes.type            'SIDE CHAIN' 
1  1 Y 1 A LYS 86  ? CG  ? C LYS 13 CG  
2  1 Y 1 A LYS 86  ? CD  ? C LYS 13 CD  
3  1 Y 1 A LYS 86  ? CE  ? C LYS 13 CE  
4  1 Y 1 A LYS 86  ? NZ  ? C LYS 13 NZ  
5  1 Y 1 A GLU 159 ? CG  ? C GLU 86 CG  
6  1 Y 1 A GLU 159 ? CD  ? C GLU 86 CD  
7  1 Y 1 A GLU 159 ? OE1 ? C GLU 86 OE1 
8  1 Y 1 A GLU 159 ? OE2 ? C GLU 86 OE2 
9  1 Y 1 A LYS 161 ? CG  ? C LYS 88 CG  
10 1 Y 1 A LYS 161 ? CD  ? C LYS 88 CD  
11 1 Y 1 A LYS 161 ? CE  ? C LYS 88 CE  
12 1 Y 1 A LYS 161 ? NZ  ? C LYS 88 NZ  
1  1 Y 1 A HIS 89  ? C HIS 16 
2  1 Y 1 A LEU 90  ? C LEU 17 
3  1 Y 1 A GLY 91  ? C GLY 18 
4  1 Y 1 A THR 92  ? C THR 19 
5  1 Y 1 A SER 93  ? C SER 20 
6  1 Y 1 A THR 94  ? C THR 21 
7  1 Y 1 A VAL 95  ? C VAL 22 
8  1 Y 1 A ASN 96  ? C ASN 23 
9  1 Y 1 A ALA 97  ? C ALA 24 
10 1 Y 1 A ASN 98  ? C ASN 25 
11 1 Y 1 A GLY 99  ? C GLY 26 
12 1 Y 1 A GLU 100 ? C GLU 27 
13 1 Y 1 A THR 101 ? C THR 28 
14 1 Y 1 A LYS 102 ? C LYS 29 
15 1 Y 1 A ARG 103 ? C ARG 30 
16 1 Y 1 B ALA 201 ? D ALA 1  
17 1 Y 1 B ARG 202 ? D ARG 2  
18 1 Y 1 B ARG 203 ? D ARG 3  
19 1 Y 1 B LYS 204 ? D LYS 4  
2R5Y 'double helix'        
2R5Y 'b-form double helix' 
1 A DC 2  1_555 B DG 20 1_555 -0.780 0.172  -0.064 -4.379  -16.613 10.521 1  C_DC2:DG40_D  C 2  ? D 40 ? ?  1 
1 A DT 3  1_555 B DA 19 1_555 -0.062 0.457  0.189  -10.384 -26.878 0.301  2  C_DT3:DA39_D  C 3  ? D 39 ? ?  ? 
1 A DC 4  1_555 B DG 18 1_555 -0.046 0.318  0.263  -9.820  -6.338  8.605  3  C_DC4:DG38_D  C 4  ? D 38 ? ?  1 
1 A DT 5  1_555 B DA 17 1_555 0.038  -0.001 0.238  1.866   -25.109 -1.405 4  C_DT5:DA37_D  C 5  ? D 37 ? 20 1 
1 A DA 6  1_555 B DT 16 1_555 -0.152 0.212  0.027  -5.807  -9.809  2.069  5  C_DA6:DT36_D  C 6  ? D 36 ? 20 1 
1 A DT 7  1_555 B DA 15 1_555 -0.042 -0.039 -0.141 -0.380  -10.146 7.728  6  C_DT7:DA35_D  C 7  ? D 35 ? 20 1 
1 A DG 8  1_555 B DC 14 1_555 0.239  -0.023 0.070  4.046   -9.199  -1.657 7  C_DG8:DC34_D  C 8  ? D 34 ? 19 1 
1 A DA 9  1_555 B DT 13 1_555 0.105  -0.042 -0.324 -3.760  -9.421  2.798  8  C_DA9:DT33_D  C 9  ? D 33 ? 20 1 
1 A DT 10 1_555 B DA 12 1_555 0.049  -0.047 -0.113 -0.021  -16.571 -1.241 9  C_DT10:DA32_D C 10 ? D 32 ? 20 1 
1 A DT 11 1_555 B DA 11 1_555 -0.319 -0.278 0.183  -10.749 -18.787 -0.841 10 C_DT11:DA31_D C 11 ? D 31 ? 20 1 
1 A DT 12 1_555 B DA 10 1_555 -0.041 -0.315 -0.278 -3.106  -13.996 4.943  11 C_DT12:DA30_D C 12 ? D 30 ? 20 1 
1 A DA 13 1_555 B DT 9  1_555 -0.249 -0.060 -0.103 -11.071 -7.709  3.521  12 C_DA13:DT29_D C 13 ? D 29 ? 20 1 
1 A DT 14 1_555 B DA 8  1_555 -0.406 -0.048 -0.093 -4.259  -5.334  -2.500 13 C_DT14:DA28_D C 14 ? D 28 ? 20 1 
1 A DG 15 1_555 B DC 7  1_555 0.380  -0.313 0.137  0.610   -4.247  1.067  14 C_DG15:DC27_D C 15 ? D 27 ? 19 1 
1 A DG 16 1_555 B DC 6  1_555 0.020  -0.454 0.235  6.569   -2.147  -2.705 15 C_DG16:DC26_D C 16 ? D 26 ? 19 1 
1 A DG 17 1_555 B DC 5  1_555 -0.121 -0.002 -0.146 -0.630  -13.676 1.041  16 C_DG17:DC25_D C 17 ? D 25 ? 19 1 
1 A DC 18 1_555 B DG 4  1_555 -0.462 0.930  0.509  -9.376  -4.729  16.472 17 C_DC18:DG24_D C 18 ? D 24 ? ?  1 
1 A DG 20 1_555 B DC 2  1_555 -0.940 -0.097 -0.011 -3.136  -17.968 10.748 18 C_DG20:DC22_D C 20 ? D 22 ? 19 1 
1 A DC 2  1_555 B DG 20 1_555 A DT 3  1_555 B DA 19 1_555 -0.625 0.468  3.472 -1.995 3.079  40.657 0.307  0.661  3.522 4.420   
2.864  40.815 1  CC_DC2DT3:DA39DG40_DD   C 2  ? D 40 ? C 3  ? D 39 ? 
1 A DT 3  1_555 B DA 19 1_555 A DC 4  1_555 B DG 18 1_555 1.014  1.313  3.524 2.443  -5.794 39.562 2.621  -1.185 3.361 -8.495  
-3.581 40.039 2  CC_DT3DC4:DG38DA39_DD   C 3  ? D 39 ? C 4  ? D 38 ? 
1 A DC 4  1_555 B DG 18 1_555 A DT 5  1_555 B DA 17 1_555 -1.301 0.498  2.970 -0.022 -1.404 34.827 1.025  2.169  2.949 -2.345  
0.037  34.855 3  CC_DC4DT5:DA37DG38_DD   C 4  ? D 38 ? C 5  ? D 37 ? 
1 A DT 5  1_555 B DA 17 1_555 A DA 6  1_555 B DT 16 1_555 1.097  1.497  3.543 2.207  -8.774 44.653 2.746  -1.214 3.256 -11.409 
-2.870 45.514 4  CC_DT5DA6:DT36DA37_DD   C 5  ? D 37 ? C 6  ? D 36 ? 
1 A DA 6  1_555 B DT 16 1_555 A DT 7  1_555 B DA 15 1_555 -0.044 -0.179 3.201 2.411  3.995  29.408 -1.164 0.577  3.136 7.807   
-4.712 29.768 5  CC_DA6DT7:DA35DT36_DD   C 6  ? D 36 ? C 7  ? D 35 ? 
1 A DT 7  1_555 B DA 15 1_555 A DG 8  1_555 B DC 14 1_555 -0.593 0.281  3.190 -4.295 10.363 37.041 -0.850 0.368  3.198 15.871  
6.579  38.645 6  CC_DT7DG8:DC34DA35_DD   C 7  ? D 35 ? C 8  ? D 34 ? 
1 A DG 8  1_555 B DC 14 1_555 A DA 9  1_555 B DT 13 1_555 0.565  -0.499 3.417 5.667  0.921  37.205 -0.899 -0.098 3.450 1.433   
-8.817 37.630 7  CC_DG8DA9:DT33DC34_DD   C 8  ? D 34 ? C 9  ? D 33 ? 
1 A DA 9  1_555 B DT 13 1_555 A DT 10 1_555 B DA 12 1_555 -0.446 -0.645 3.170 -1.239 1.376  32.158 -1.400 0.590  3.155 2.482   
2.235  32.210 8  CC_DA9DT10:DA32DT33_DD  C 9  ? D 33 ? C 10 ? D 32 ? 
1 A DT 10 1_555 B DA 12 1_555 A DT 11 1_555 B DA 11 1_555 -0.026 -0.155 3.519 -1.500 0.964  35.303 -0.408 -0.196 3.511 1.588   
2.472  35.346 9  CC_DT10DT11:DA31DA32_DD C 10 ? D 32 ? C 11 ? D 31 ? 
1 A DT 11 1_555 B DA 11 1_555 A DT 12 1_555 B DA 10 1_555 -0.141 0.078  3.053 2.505  7.672  34.286 -0.940 0.582  2.983 12.795  
-4.177 35.195 10 CC_DT11DT12:DA30DA31_DD C 11 ? D 31 ? C 12 ? D 30 ? 
1 A DT 12 1_555 B DA 10 1_555 A DA 13 1_555 B DT 9  1_555 0.714  -0.805 3.512 -0.053 7.554  33.043 -2.655 -1.234 3.253 13.069  
0.092  33.872 11 CC_DT12DA13:DT29DA30_DD C 12 ? D 30 ? C 13 ? D 29 ? 
1 A DA 13 1_555 B DT 9  1_555 A DT 14 1_555 B DA 8  1_555 -1.075 -0.880 3.100 -0.200 2.842  31.748 -2.087 1.923  3.018 5.183   
0.366  31.873 12 CC_DA13DT14:DA28DT29_DD C 13 ? D 29 ? C 14 ? D 28 ? 
1 A DT 14 1_555 B DA 8  1_555 A DG 15 1_555 B DC 7  1_555 0.198  0.124  3.233 -0.604 7.226  34.014 -0.888 -0.423 3.188 12.180  
1.018  34.756 13 CC_DT14DG15:DC27DA28_DD C 14 ? D 28 ? C 15 ? D 27 ? 
1 A DG 15 1_555 B DC 7  1_555 A DG 16 1_555 B DC 6  1_555 -0.549 -0.086 3.212 -3.068 1.786  31.596 -0.481 0.448  3.240 3.267   
5.611  31.790 14 CC_DG15DG16:DC26DC27_DD C 15 ? D 27 ? C 16 ? D 26 ? 
1 A DG 16 1_555 B DC 6  1_555 A DG 17 1_555 B DC 5  1_555 0.084  0.075  3.619 1.004  7.501  35.680 -1.035 0.021  3.562 12.075  
-1.615 36.448 15 CC_DG16DG17:DC25DC26_DD C 16 ? D 26 ? C 17 ? D 25 ? 
1 A DG 17 1_555 B DC 5  1_555 A DC 18 1_555 B DG 4  1_555 0.907  -0.341 3.320 -2.312 3.340  34.213 -1.096 -1.891 3.207 5.652   
3.913  34.446 16 CC_DG17DC18:DG24DC25_DD C 17 ? D 25 ? C 18 ? D 24 ? 
1 A DC 18 1_555 B DG 4  1_555 A DG 20 1_555 B DC 2  1_555 -1.203 2.797  6.620 7.496  -2.624 74.797 2.453  1.442  6.408 -2.155  
-6.154 75.156 17 CC_DC18DG20:DC22DG24_DD C 18 ? D 24 ? C 20 ? D 22 ? 
_pdbx_entity_nonpoly.entity_id   5        water 
_pdbx_entity_nonpoly.comp_id     HOH 