#   2ZI0 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.279 
PDB   2ZI0         
NDB   PR0334       
RCSB  RCSB027996   
WWPDB D_1000027996 
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.entry_id                        2ZI0 
_pdbx_database_status.recvd_initial_deposition_date   2008-02-12 
_pdbx_database_status.deposit_site                    PDBJ 
_pdbx_database_status.process_site                    PDBJ 
_pdbx_database_status.status_code_sf                  REL 
_pdbx_database_status.status_code_mr                  ? 
_pdbx_database_status.SG_entry                        ? 
_pdbx_database_status.pdb_format_compatible           Y 
_pdbx_database_status.status_code_cs                  ? 
_pdbx_database_status.methods_development_category    ? 
'Yuan, Y.A.'  1 
'Chen, H.-Y.' 2 
#                        primary 
_citation.title                     'Structural basis for RNA-silencing suppression by Tomato aspermy virus protein 2b' 
_citation.journal_abbrev            'Embo Rep.' 
_citation.journal_volume            9 
_citation.page_first                754 
_citation.page_last                 760 
_citation.year                      2008 
_citation.journal_id_ASTM           ?                   UK 
_citation.journal_id_ISSN           1469-221X 
_citation.journal_id_CSD            ? 
_citation.book_publisher            ? 
_citation.pdbx_database_id_PubMed   18600235 
_citation.pdbx_database_id_DOI      10.1038/embor.2008.118 
primary 'Chen, H.-Y.' 1 
primary 'Yang, J.'    2 
primary 'Lin, C.'     3 
primary 'Yuan, Y.A.'  4 
_cell.entry_id           2ZI0 
_cell.length_a           86.455 
_cell.length_b           122.043 
_cell.length_c           28.193 
_cell.angle_alpha        90.00 
_cell.angle_beta         90.00 
_cell.angle_gamma        90.00 
_cell.Z_PDB              8 
_cell.pdbx_unique_axis   ? 
_cell.length_a_esd       ? 
_cell.length_b_esd       ? 
_cell.length_c_esd       ? 
_cell.angle_alpha_esd    ? 
_cell.angle_beta_esd     ? 
_cell.angle_gamma_esd    ? 
_symmetry.entry_id                         2ZI0 
_symmetry.space_group_name_H-M             'P 21 21 2' 
_symmetry.pdbx_full_space_group_name_H-M   ? 
_symmetry.cell_setting                     ? 
_symmetry.Int_Tables_number                18 
_symmetry.space_group_name_Hall            ? 
1 polymer man 'Protein 2b'                                                                     9140.991 2  ? ? 'UNP residues 1-69' 
2 polymer syn 
6651.948 2  ? ? ?                   ? 
3 water   nat water                                                                            18.015   18 ? ? ?                   
1 Tav2b 
2 siRNA 
1 'polypeptide(L)'   no yes 
2 polyribonucleotide no no  AGACAGCAUUAUGCUGUCUUU                                                                  
AGACAGCAUUAUGCUGUCUUU                                                       C,D ? 
1 1  MSE n 
1 2  ALA n 
1 3  SER n 
1 4  ILE n 
1 5  GLU n 
1 6  ILE n 
1 7  PRO n 
1 8  LEU n 
1 9  HIS n 
1 10 GLU n 
1 11 ILE n 
1 12 ILE n 
1 13 ARG n 
1 14 LYS n 
1 15 LEU n 
1 16 GLU n 
1 17 ARG n 
1 18 MSE n 
1 19 ASN n 
1 20 GLN n 
1 21 LYS n 
1 22 LYS n 
1 23 GLN n 
1 24 ALA n 
1 25 GLN n 
1 26 ARG n 
1 27 LYS n 
1 28 ARG n 
1 29 HIS n 
1 30 LYS n 
1 31 LEU n 
1 32 ASN n 
1 33 ARG n 
1 34 LYS n 
1 35 GLU n 
1 36 ARG n 
1 37 GLY n 
1 38 HIS n 
1 39 LYS n 
1 40 SER n 
1 41 PRO n 
1 42 SER n 
1 43 GLU n 
1 44 GLN n 
1 45 ARG n 
1 46 ARG n 
1 47 SER n 
1 48 GLU n 
1 49 LEU n 
1 50 TRP n 
1 51 HIS n 
1 52 ALA n 
1 53 ARG n 
1 54 GLN n 
1 55 VAL n 
1 56 GLU n 
1 57 LEU n 
1 58 SER n 
1 59 ALA n 
1 60 ILE n 
1 61 ASN n 
1 62 SER n 
1 63 ASP n 
1 64 ASN n 
1 65 SER n 
1 66 SER n 
1 67 ASP n 
1 68 GLU n 
1 69 GLY n 
1 70 HIS n 
1 71 HIS n 
1 72 HIS n 
1 73 HIS n 
1 74 HIS n 
1 75 HIS n 
2 1  A   n 
2 2  G   n 
2 3  A   n 
2 4  C   n 
2 5  A   n 
2 6  G   n 
2 7  C   n 
2 8  A   n 
2 9  U   n 
2 10 U   n 
2 11 A   n 
2 12 U   n 
2 13 G   n 
2 14 C   n 
2 15 U   n 
2 16 G   n 
2 17 U   n 
2 18 C   n 
2 19 U   n 
2 20 U   n 
2 21 U   n 
_entity_src_gen.entity_id                          1 
_entity_src_gen.pdbx_src_id                        1 
_entity_src_gen.pdbx_alt_source_flag               sample 
_entity_src_gen.pdbx_seq_type                      ? 
_entity_src_gen.pdbx_beg_seq_num                   ? 
_entity_src_gen.pdbx_end_seq_num                   ? 
_entity_src_gen.gene_src_common_name               TAV 
_entity_src_gen.gene_src_genus                     ? 
_entity_src_gen.pdbx_gene_src_gene                 RNA4A 
_entity_src_gen.gene_src_species                   ? 
_entity_src_gen.gene_src_strain                    ? 
_entity_src_gen.gene_src_tissue                    ? 
_entity_src_gen.gene_src_tissue_fraction           ? 
_entity_src_gen.gene_src_details                   ? 
_entity_src_gen.pdbx_gene_src_fragment             ? 
_entity_src_gen.pdbx_gene_src_scientific_name      'Tomato aspermy virus' 
_entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id     12315 
_entity_src_gen.pdbx_gene_src_variant              ? 
_entity_src_gen.pdbx_gene_src_cell_line            ? 
_entity_src_gen.pdbx_gene_src_atcc                 ? 
_entity_src_gen.pdbx_gene_src_organ                ? 
_entity_src_gen.pdbx_gene_src_organelle            ? 
_entity_src_gen.pdbx_gene_src_cell                 ? 
_entity_src_gen.pdbx_gene_src_cellular_location    ? 
_entity_src_gen.host_org_common_name               ? 
_entity_src_gen.pdbx_host_org_scientific_name      'Escherichia coli' 
_entity_src_gen.pdbx_host_org_ncbi_taxonomy_id     469008 
_entity_src_gen.host_org_genus                     ? 
_entity_src_gen.pdbx_host_org_gene                 ? 
_entity_src_gen.pdbx_host_org_organ                ? 
_entity_src_gen.host_org_species                   ? 
_entity_src_gen.pdbx_host_org_tissue               ? 
_entity_src_gen.pdbx_host_org_tissue_fraction      ? 
_entity_src_gen.pdbx_host_org_strain               'BL21(DE3)' 
_entity_src_gen.pdbx_host_org_variant              ? 
_entity_src_gen.pdbx_host_org_cell_line            ? 
_entity_src_gen.pdbx_host_org_atcc                 ? 
_entity_src_gen.pdbx_host_org_culture_collection   ? 
_entity_src_gen.pdbx_host_org_cell                 ? 
_entity_src_gen.pdbx_host_org_organelle            ? 
_entity_src_gen.pdbx_host_org_cellular_location    ? 
_entity_src_gen.pdbx_host_org_vector_type          plasmid 
_entity_src_gen.pdbx_host_org_vector               ? 
_entity_src_gen.host_org_details                   ? 
_entity_src_gen.expression_system_id               ? 
_entity_src_gen.plasmid_name                       pET28b 
_entity_src_gen.plasmid_details                    ? 
_entity_src_gen.pdbx_description                   ? 
2 PDB 2ZI0    2ZI0   2 AGACAGCAUUAUGCUGUCUUU                                                 1 ? 
1 1 2ZI0 A 1 ? 69 ? Q8UYT3 1 ? 69 ? 1 69 
2 1 2ZI0 B 1 ? 69 ? Q8UYT3 1 ? 69 ? 1 69 
3 2 2ZI0 C 1 ? 21 ? 2ZI0   1 ? 21 ? 1 21 
4 2 2ZI0 D 1 ? 21 ? 2ZI0   1 ? 21 ? 1 21 
1 2ZI0 HIS A 70 ? UNP Q8UYT3 ? ? 'EXPRESSION TAG' 70 1  
1 2ZI0 HIS A 71 ? UNP Q8UYT3 ? ? 'EXPRESSION TAG' 71 2  
1 2ZI0 HIS A 72 ? UNP Q8UYT3 ? ? 'EXPRESSION TAG' 72 3  
1 2ZI0 HIS A 73 ? UNP Q8UYT3 ? ? 'EXPRESSION TAG' 73 4  
1 2ZI0 HIS A 74 ? UNP Q8UYT3 ? ? 'EXPRESSION TAG' 74 5  
1 2ZI0 HIS A 75 ? UNP Q8UYT3 ? ? 'EXPRESSION TAG' 75 6  
2 2ZI0 HIS B 70 ? UNP Q8UYT3 ? ? 'EXPRESSION TAG' 70 7  
2 2ZI0 HIS B 71 ? UNP Q8UYT3 ? ? 'EXPRESSION TAG' 71 8  
2 2ZI0 HIS B 72 ? UNP Q8UYT3 ? ? 'EXPRESSION TAG' 72 9  
2 2ZI0 HIS B 73 ? UNP Q8UYT3 ? ? 'EXPRESSION TAG' 73 10 
2 2ZI0 HIS B 74 ? UNP Q8UYT3 ? ? 'EXPRESSION TAG' 74 11 
2 2ZI0 HIS B 75 ? UNP Q8UYT3 ? ? 'EXPRESSION TAG' 75 12 
A   'RNA linking'       y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 
ALA 'L-peptide linking' y ALANINE                      ? 'C3 H7 N O2'      89.093  
ARG 'L-peptide linking' y ARGININE                     ? 'C6 H15 N4 O2 1'  175.209 
ASN 'L-peptide linking' y ASPARAGINE                   ? 'C4 H8 N2 O3'     132.118 
ASP 'L-peptide linking' y 'ASPARTIC ACID'              ? 'C4 H7 N O4'      133.103 
C   'RNA linking'       y "CYTIDINE-5'-MONOPHOSPHATE"  ? 'C9 H14 N3 O8 P'  323.197 
G   'RNA linking'       y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 
GLN 'L-peptide linking' y GLUTAMINE                    ? 'C5 H10 N2 O3'    146.144 
GLU 'L-peptide linking' y 'GLUTAMIC ACID'              ? 'C5 H9 N O4'      147.129 
GLY 'peptide linking'   y GLYCINE                      ? 'C2 H5 N O2'      75.067  
HIS 'L-peptide linking' y HISTIDINE                    ? 'C6 H10 N3 O2 1'  156.162 
HOH non-polymer         . WATER                        ? 'H2 O'            18.015  
ILE 'L-peptide linking' y ISOLEUCINE                   ? 'C6 H13 N O2'     131.173 
LEU 'L-peptide linking' y LEUCINE                      ? 'C6 H13 N O2'     131.173 
LYS 'L-peptide linking' y LYSINE                       ? 'C6 H15 N2 O2 1'  147.195 
MSE 'L-peptide linking' n SELENOMETHIONINE             ? 'C5 H11 N O2 Se'  196.106 
PRO 'L-peptide linking' y PROLINE                      ? 'C5 H9 N O2'      115.130 
SER 'L-peptide linking' y SERINE                       ? 'C3 H7 N O3'      105.093 
TRP 'L-peptide linking' y TRYPTOPHAN                   ? 'C11 H12 N2 O2'   204.225 
U   'RNA linking'       y "URIDINE-5'-MONOPHOSPHATE"   ? 'C9 H13 N2 O9 P'  324.181 
VAL 'L-peptide linking' y VALINE                       ? 'C5 H11 N O2'     117.146 
_exptl.entry_id          2ZI0 
_exptl.method            'X-RAY DIFFRACTION' 
_exptl.crystals_number   1 
#                    1 
_exptl_crystal.density_meas          ? 
_exptl_crystal.density_Matthews      2.35 
_exptl_crystal.density_percent_sol   47.76 
_exptl_crystal.description           ? 
_exptl_crystal.F_000                 ? 
_exptl_crystal.preparation           ? 
_exptl_crystal_grow.crystal_id      1 
_exptl_crystal_grow.method          'VAPOR DIFFUSION, HANGING DROP' 
_exptl_crystal_grow.temp            298 
_exptl_crystal_grow.temp_details    ? 
_exptl_crystal_grow.pH              6.0 
'25% PEG 1500, 1.0M Ammonium formate, 100mM MES, pH 6.0, VAPOR DIFFUSION, HANGING DROP, temperature 298K' 
_exptl_crystal_grow.pdbx_pH_range   . 
1 1 1 MES                ? ? ? 
1 2 1 'Ammonium formate' ? ? ? 
1 3 1 PEG                ? ? ? 
1 4 1 HOH                ? ? ? 
1 5 2 MES                ? ? ? 
1 6 2 'Ammonium formate' ? ? ? 
1 7 2 PEG                ? ? ? 
1 8 2 HOH                ? ? ? 
#                     1 
_diffrn.ambient_temp           100 
_diffrn.ambient_temp_details   ? 
_diffrn.crystal_id             1 
_diffrn_detector.diffrn_id              1 
_diffrn_detector.detector               CCD 
_diffrn_detector.type                   'ADSC QUANTUM 315' 
_diffrn_detector.pdbx_collection_date   2007-07-07 
_diffrn_detector.details                ? 
_diffrn_radiation.diffrn_id                        1 
_diffrn_radiation.wavelength_id                    1 
_diffrn_radiation.pdbx_monochromatic_or_laue_m_l   M 
_diffrn_radiation.monochromator                    ? 
_diffrn_radiation.pdbx_diffrn_protocol             MAD 
_diffrn_radiation.pdbx_scattering_type             x-ray 
1 0.9794 1.0 
2 0.9790 1.0 
_diffrn_source.diffrn_id                   1 
_diffrn_source.source                      SYNCHROTRON 
_diffrn_source.type                        'NSLS BEAMLINE X12C' 
_diffrn_source.pdbx_synchrotron_site       NSLS 
_diffrn_source.pdbx_synchrotron_beamline   X12C 
_diffrn_source.pdbx_wavelength             ? 
_diffrn_source.pdbx_wavelength_list        '0.9794, 0.9790' 
_reflns.entry_id                     2ZI0 
_reflns.observed_criterion_sigma_F   2.0 
_reflns.observed_criterion_sigma_I   2.0 
_reflns.d_resolution_high            2.8 
_reflns.d_resolution_low             50 
_reflns.number_all                   7336 
_reflns.number_obs                   7336 
_reflns.percent_possible_obs         100 
_reflns.pdbx_Rmerge_I_obs            ? 
_reflns.pdbx_Rsym_value              0.107 
_reflns.pdbx_netI_over_sigmaI        20.8 
_reflns.B_iso_Wilson_estimate        ? 
_reflns.pdbx_redundancy              7.8 
_reflns.R_free_details               ? 
_reflns.pdbx_chi_squared             ? 
_reflns.pdbx_scaling_rejects         ? 
_reflns.pdbx_ordinal                 1 
_reflns.pdbx_diffrn_id               1 
_reflns_shell.d_res_high             2.8 
_reflns_shell.d_res_low              2.9 
_reflns_shell.percent_possible_all   100 
_reflns_shell.Rmerge_I_obs           ? 
_reflns_shell.pdbx_Rsym_value        0.488 
_reflns_shell.meanI_over_sigI_obs    4.44 
_reflns_shell.pdbx_redundancy        7.8 
_reflns_shell.percent_possible_obs   ? 
_reflns_shell.number_unique_all      ? 
_reflns_shell.number_measured_all    ? 
_reflns_shell.number_measured_obs    ? 
_reflns_shell.number_unique_obs      ? 
_reflns_shell.pdbx_chi_squared       ? 
_reflns_shell.pdbx_ordinal           1 
_reflns_shell.pdbx_diffrn_id         1 
_refine.entry_id                                 2ZI0 
_refine.ls_number_reflns_obs                     7336 
_refine.ls_number_reflns_all                     ? 
_refine.pdbx_ls_sigma_I                          ? 
_refine.pdbx_ls_sigma_F                          ? 
_refine.pdbx_data_cutoff_high_absF               ? 
_refine.pdbx_data_cutoff_low_absF                ? 
_refine.pdbx_data_cutoff_high_rms_absF           ? 
_refine.ls_d_res_low                             49.85 
_refine.ls_d_res_high                            2.82 
_refine.ls_percent_reflns_obs                    99.51 
_refine.ls_R_factor_obs                          0.21648 
_refine.ls_R_factor_all                          ? 
_refine.ls_R_factor_R_work                       0.2137 
_refine.ls_R_factor_R_free                       0.27599 
_refine.ls_R_factor_R_free_error                 ? 
_refine.ls_R_factor_R_free_error_details         ? 
_refine.ls_percent_reflns_R_free                 4.6 
_refine.ls_number_reflns_R_free                  353 
_refine.ls_number_parameters                     ? 
_refine.ls_number_restraints                     ? 
_refine.occupancy_min                            ? 
_refine.occupancy_max                            ? 
_refine.correlation_coeff_Fo_to_Fc               0.924 
_refine.correlation_coeff_Fo_to_Fc_free          0.844 
_refine.B_iso_mean                               20.782 
_refine.aniso_B[1][1]                            0.84 
_refine.aniso_B[2][2]                            -0.22 
_refine.aniso_B[3][3]                            -0.63 
_refine.aniso_B[1][2]                            0.00 
_refine.aniso_B[1][3]                            0.00 
_refine.aniso_B[2][3]                            0.00 
_refine.solvent_model_details                    MASK 
_refine.solvent_model_param_ksol                 ? 
_refine.solvent_model_param_bsol                 ? 
_refine.pdbx_solvent_vdw_probe_radii             1.20 
_refine.pdbx_solvent_ion_probe_radii             0.80 
_refine.pdbx_solvent_shrinkage_radii             0.80 
_refine.pdbx_ls_cross_valid_method               THROUGHOUT 
_refine.details                                  'HYDROGENS HAVE BEEN ADDED IN THE RIDING POSITIONS' 
_refine.pdbx_starting_model                      ? 
_refine.pdbx_method_to_determine_struct          MAD 
_refine.pdbx_isotropic_thermal_model             ? 
_refine.pdbx_stereochemistry_target_values       'MAXIMUM LIKELIHOOD' 
_refine.pdbx_stereochem_target_val_spec_case     ? 
_refine.pdbx_R_Free_selection_details            RANDOM 
_refine.pdbx_overall_ESU_R                       3.944 
_refine.pdbx_overall_ESU_R_Free                  0.394 
_refine.overall_SU_ML                            0.265 
_refine.overall_SU_B                             27.231 
_refine.ls_redundancy_reflns_obs                 ? 
_refine.overall_SU_R_Cruickshank_DPI             ? 
_refine.overall_SU_R_free                        ? 
_refine.ls_wR_factor_R_free                      ? 
_refine.ls_wR_factor_R_work                      ? 
_refine.overall_FOM_free_R_set                   ? 
_refine.overall_FOM_work_R_set                   ? 
_refine.pdbx_overall_phase_error                 ? 
_refine.pdbx_refine_id                           'X-RAY DIFFRACTION' 
_refine.pdbx_TLS_residual_ADP_flag               'LIKELY RESIDUAL' 
_refine.pdbx_diffrn_id                           1 
_refine.pdbx_overall_SU_R_free_Cruickshank_DPI   ? 
_refine.pdbx_overall_SU_R_Blow_DPI               ? 
_refine.pdbx_overall_SU_R_free_Blow_DPI          ? 
_refine_hist.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_refine_hist.cycle_id                         LAST 
_refine_hist.pdbx_number_atoms_protein        993 
_refine_hist.pdbx_number_atoms_nucleic_acid   810 
_refine_hist.pdbx_number_atoms_ligand         0 
_refine_hist.number_atoms_solvent             18 
_refine_hist.number_atoms_total               1821 
_refine_hist.d_res_high                       2.82 
_refine_hist.d_res_low                        49.85 
r_bond_refined_d         0.009  0.021  ? 1911 'X-RAY DIFFRACTION' ? 
r_angle_refined_deg      1.527  2.485  ? 2738 'X-RAY DIFFRACTION' ? 
r_dihedral_angle_1_deg   4.981  5.000  ? 113  'X-RAY DIFFRACTION' ? 
r_dihedral_angle_2_deg   34.593 22.203 ? 59   'X-RAY DIFFRACTION' ? 
r_dihedral_angle_3_deg   21.110 15.000 ? 228  'X-RAY DIFFRACTION' ? 
r_dihedral_angle_4_deg   21.969 15.000 ? 18   'X-RAY DIFFRACTION' ? 
r_chiral_restr           0.073  0.200  ? 323  'X-RAY DIFFRACTION' ? 
r_gen_planes_refined     0.004  0.020  ? 1136 'X-RAY DIFFRACTION' ? 
r_nbd_refined            0.196  0.200  ? 718  'X-RAY DIFFRACTION' ? 
r_nbtor_refined          0.282  0.200  ? 1250 'X-RAY DIFFRACTION' ? 
r_xyhbond_nbd_refined    0.193  0.200  ? 47   'X-RAY DIFFRACTION' ? 
r_symmetry_vdw_refined   0.211  0.200  ? 41   'X-RAY DIFFRACTION' ? 
r_symmetry_hbond_refined 0.340  0.200  ? 4    'X-RAY DIFFRACTION' ? 
r_mcbond_it              0.970  1.500  ? 599  'X-RAY DIFFRACTION' ? 
r_mcangle_it             1.364  2.000  ? 925  'X-RAY DIFFRACTION' ? 
r_scbond_it              1.147  3.000  ? 1698 'X-RAY DIFFRACTION' ? 
r_scangle_it             1.916  4.500  ? 1813 'X-RAY DIFFRACTION' ? 
_refine_ls_shell.pdbx_total_number_of_bins_used   20 
_refine_ls_shell.d_res_high                       2.818 
_refine_ls_shell.d_res_low                        2.891 
_refine_ls_shell.number_reflns_R_work             473 
_refine_ls_shell.R_factor_R_work                  0.281 
_refine_ls_shell.percent_reflns_obs               93.30 
_refine_ls_shell.R_factor_R_free                  0.322 
_refine_ls_shell.R_factor_R_free_error            ? 
_refine_ls_shell.percent_reflns_R_free            ? 
_refine_ls_shell.number_reflns_R_free             14 
_refine_ls_shell.number_reflns_all                ? 
_refine_ls_shell.R_factor_all                     ? 
_refine_ls_shell.number_reflns_obs                ? 
_refine_ls_shell.redundancy_reflns_obs            ? 
_refine_ls_shell.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_struct.entry_id                  2ZI0 
_struct.title                     'Crystal structure of Tav2b/siRNA complex' 
_struct.pdbx_descriptor           'Protein 2b/RNA Complex' 
_struct.pdbx_model_details        ? 
_struct.pdbx_CASP_flag            N 
_struct.pdbx_model_type_details   ? 
_struct_keywords.entry_id        2ZI0 
_struct_keywords.pdbx_keywords   'GENE REGULATION/RNA' 
_struct_keywords.text            'RNAi suppression, Nucleus, Suppressor of RNA silencing, GENE REGULATION-RNA COMPLEX' 
A N N 1 ? 
B N N 1 ? 
C N N 2 ? 
D N N 2 ? 
E N N 3 ? 
F N N 3 ? 
G N N 3 ? 
H N N 3 ? 
#        1 
_struct_biol.details   ? 
HELX_P HELX_P1 1 PRO A 7  ? ARG A 36 ? PRO A 7  ARG A 36 1 ? 30 
HELX_P HELX_P2 2 SER A 40 ? SER A 62 ? SER A 40 SER A 62 1 ? 23 
HELX_P HELX_P3 3 PRO B 7  ? GLY B 37 ? PRO B 7  GLY B 37 1 ? 31 
HELX_P HELX_P4 4 SER B 40 ? SER B 58 ? SER B 40 SER B 58 1 ? 19 
#          HELX_P 
_struct_conf_type.criteria    ? 
_struct_conf_type.reference   ? 
covale1  covale ? ? A ARG 17 C  ? ? ? 1_555 A MSE 18 N  ? ? A ARG 17 A MSE 18 1_555 ? ? ? ? ? ? ?            1.332 ? 
covale2  covale ? ? A MSE 18 C  ? ? ? 1_555 A ASN 19 N  ? ? A MSE 18 A ASN 19 1_555 ? ? ? ? ? ? ?            1.322 ? 
covale3  covale ? ? B ARG 17 C  ? ? ? 1_555 B MSE 18 N  ? ? B ARG 17 B MSE 18 1_555 ? ? ? ? ? ? ?            1.330 ? 
covale4  covale ? ? B MSE 18 C  ? ? ? 1_555 B ASN 19 N  ? ? B MSE 18 B ASN 19 1_555 ? ? ? ? ? ? ?            1.326 ? 
hydrog1  hydrog ? ? C A   1  N1 ? ? ? 1_555 D U   19 N3 ? ? C A   1  D U   19 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog2  hydrog ? ? C A   1  N6 ? ? ? 1_555 D U   19 O4 ? ? C A   1  D U   19 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog3  hydrog ? ? C G   2  N1 ? ? ? 1_555 D C   18 N3 ? ? C G   2  D C   18 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog4  hydrog ? ? C G   2  N2 ? ? ? 1_555 D C   18 O2 ? ? C G   2  D C   18 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog5  hydrog ? ? C G   2  O6 ? ? ? 1_555 D C   18 N4 ? ? C G   2  D C   18 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog6  hydrog ? ? C A   3  N1 ? ? ? 1_555 D U   17 N3 ? ? C A   3  D U   17 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog7  hydrog ? ? C A   3  N6 ? ? ? 1_555 D U   17 O4 ? ? C A   3  D U   17 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog8  hydrog ? ? C C   4  N3 ? ? ? 1_555 D G   16 N1 ? ? C C   4  D G   16 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog9  hydrog ? ? C C   4  N4 ? ? ? 1_555 D G   16 O6 ? ? C C   4  D G   16 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog10 hydrog ? ? C C   4  O2 ? ? ? 1_555 D G   16 N2 ? ? C C   4  D G   16 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog11 hydrog ? ? C A   5  N1 ? ? ? 1_555 D U   15 N3 ? ? C A   5  D U   15 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog12 hydrog ? ? C A   5  N6 ? ? ? 1_555 D U   15 O4 ? ? C A   5  D U   15 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog13 hydrog ? ? C G   6  N1 ? ? ? 1_555 D C   14 N3 ? ? C G   6  D C   14 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog14 hydrog ? ? C G   6  N2 ? ? ? 1_555 D C   14 O2 ? ? C G   6  D C   14 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog15 hydrog ? ? C G   6  O6 ? ? ? 1_555 D C   14 N4 ? ? C G   6  D C   14 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog16 hydrog ? ? C C   7  N3 ? ? ? 1_555 D G   13 N1 ? ? C C   7  D G   13 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog17 hydrog ? ? C C   7  N4 ? ? ? 1_555 D G   13 O6 ? ? C C   7  D G   13 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog18 hydrog ? ? C C   7  O2 ? ? ? 1_555 D G   13 N2 ? ? C C   7  D G   13 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog19 hydrog ? ? C A   8  N1 ? ? ? 1_555 D U   12 N3 ? ? C A   8  D U   12 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog20 hydrog ? ? C A   8  N6 ? ? ? 1_555 D U   12 O4 ? ? C A   8  D U   12 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog21 hydrog ? ? C U   9  N3 ? ? ? 1_555 D A   11 N1 ? ? C U   9  D A   11 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog22 hydrog ? ? C U   9  O4 ? ? ? 1_555 D A   11 N6 ? ? C U   9  D A   11 1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog23 hydrog ? ? C A   11 N1 ? ? ? 1_555 D U   9  N3 ? ? C A   11 D U   9  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog24 hydrog ? ? C A   11 N6 ? ? ? 1_555 D U   9  O4 ? ? C A   11 D U   9  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog25 hydrog ? ? C U   12 N3 ? ? ? 1_555 D A   8  N1 ? ? C U   12 D A   8  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog26 hydrog ? ? C U   12 O4 ? ? ? 1_555 D A   8  N6 ? ? C U   12 D A   8  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog27 hydrog ? ? C G   13 N1 ? ? ? 1_555 D C   7  N3 ? ? C G   13 D C   7  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog28 hydrog ? ? C G   13 N2 ? ? ? 1_555 D C   7  O2 ? ? C G   13 D C   7  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog29 hydrog ? ? C G   13 O6 ? ? ? 1_555 D C   7  N4 ? ? C G   13 D C   7  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog30 hydrog ? ? C C   14 N3 ? ? ? 1_555 D G   6  N1 ? ? C C   14 D G   6  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog31 hydrog ? ? C C   14 N4 ? ? ? 1_555 D G   6  O6 ? ? C C   14 D G   6  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog32 hydrog ? ? C C   14 O2 ? ? ? 1_555 D G   6  N2 ? ? C C   14 D G   6  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog33 hydrog ? ? C U   15 N3 ? ? ? 1_555 D A   5  N1 ? ? C U   15 D A   5  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog34 hydrog ? ? C U   15 O4 ? ? ? 1_555 D A   5  N6 ? ? C U   15 D A   5  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog35 hydrog ? ? C G   16 N1 ? ? ? 1_555 D C   4  N3 ? ? C G   16 D C   4  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog36 hydrog ? ? C G   16 N2 ? ? ? 1_555 D C   4  O2 ? ? C G   16 D C   4  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog37 hydrog ? ? C G   16 O6 ? ? ? 1_555 D C   4  N4 ? ? C G   16 D C   4  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog38 hydrog ? ? C U   17 N3 ? ? ? 1_555 D A   3  N1 ? ? C U   17 D A   3  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog39 hydrog ? ? C U   17 O4 ? ? ? 1_555 D A   3  N6 ? ? C U   17 D A   3  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog40 hydrog ? ? C C   18 N3 ? ? ? 1_555 D G   2  N1 ? ? C C   18 D G   2  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog41 hydrog ? ? C C   18 N4 ? ? ? 1_555 D G   2  O6 ? ? C C   18 D G   2  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog42 hydrog ? ? C C   18 O2 ? ? ? 1_555 D G   2  N2 ? ? C C   18 D G   2  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog43 hydrog ? ? C U   19 N3 ? ? ? 1_555 D A   1  N1 ? ? C U   19 D A   1  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog44 hydrog ? ? C U   19 O4 ? ? ? 1_555 D A   1  N6 ? ? C U   19 D A   1  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
covale ? ? 
hydrog ? ? 
_database_PDB_matrix.entry_id          2ZI0 
_database_PDB_matrix.origx[1][1]       1.000000 
_database_PDB_matrix.origx[1][2]       0.000000 
_database_PDB_matrix.origx[1][3]       0.000000 
_database_PDB_matrix.origx[2][1]       0.000000 
_database_PDB_matrix.origx[2][2]       1.000000 
_database_PDB_matrix.origx[2][3]       0.000000 
_database_PDB_matrix.origx[3][1]       0.000000 
_database_PDB_matrix.origx[3][2]       0.000000 
_database_PDB_matrix.origx[3][3]       1.000000 
_database_PDB_matrix.origx_vector[1]   0.00000 
_database_PDB_matrix.origx_vector[2]   0.00000 
_database_PDB_matrix.origx_vector[3]   0.00000 
_atom_sites.entry_id                    2ZI0 
_atom_sites.fract_transf_matrix[1][1]   0.011567 
_atom_sites.fract_transf_matrix[1][2]   0.000000 
_atom_sites.fract_transf_matrix[1][3]   0.000000 
_atom_sites.fract_transf_matrix[2][1]   0.000000 
_atom_sites.fract_transf_matrix[2][2]   0.008194 
_atom_sites.fract_transf_matrix[2][3]   0.000000 
_atom_sites.fract_transf_matrix[3][1]   0.000000 
_atom_sites.fract_transf_matrix[3][2]   0.000000 
_atom_sites.fract_transf_matrix[3][3]   0.035470 
_atom_sites.fract_transf_vector[1]      0.00000 
_atom_sites.fract_transf_vector[2]      0.00000 
_atom_sites.fract_transf_vector[3]      0.00000 
ATOM   1    N  N     . GLU A 1 5  ? 13.226  -51.373 -9.712  1.00 30.53 ? 5  GLU A N     1 
ATOM   2    C  CA    . GLU A 1 5  ? 12.014  -52.238 -9.520  1.00 30.54 ? 5  GLU A CA    1 
ATOM   3    C  C     . GLU A 1 5  ? 11.603  -53.007 -10.789 1.00 29.53 ? 5  GLU A C     1 
ATOM   4    O  O     . GLU A 1 5  ? 11.960  -52.623 -11.910 1.00 29.86 ? 5  GLU A O     1 
ATOM   5    C  CB    . GLU A 1 5  ? 10.856  -51.384 -9.014  1.00 31.08 ? 5  GLU A CB    1 
ATOM   6    C  CG    . GLU A 1 5  ? 11.121  -50.785 -7.631  1.00 34.30 ? 5  GLU A CG    1 
ATOM   7    C  CD    . GLU A 1 5  ? 10.334  -51.497 -6.526  1.00 38.40 ? 5  GLU A CD    1 
ATOM   8    O  OE1   . GLU A 1 5  ? 9.377   -52.241 -6.869  1.00 39.26 ? 5  GLU A OE1   1 
ATOM   9    O  OE2   . GLU A 1 5  ? 10.666  -51.300 -5.325  1.00 39.16 ? 5  GLU A OE2   1 
ATOM   10   N  N     . ILE A 1 6  ? 10.850  -54.091 -10.618 1.00 27.98 ? 6  ILE A N     1 
ATOM   11   C  CA    . ILE A 1 6  ? 10.516  -54.964 -11.751 1.00 26.27 ? 6  ILE A CA    1 
ATOM   12   C  C     . ILE A 1 6  ? 9.395   -54.378 -12.617 1.00 24.32 ? 6  ILE A C     1 
ATOM   13   O  O     . ILE A 1 6  ? 8.301   -54.095 -12.111 1.00 24.82 ? 6  ILE A O     1 
ATOM   14   C  CB    . ILE A 1 6  ? 10.132  -56.402 -11.303 1.00 26.83 ? 6  ILE A CB    1 
ATOM   15   C  CG1   . ILE A 1 6  ? 10.755  -56.769 -9.943  1.00 27.16 ? 6  ILE A CG1   1 
ATOM   16   C  CG2   . ILE A 1 6  ? 10.481  -57.421 -12.406 1.00 27.77 ? 6  ILE A CG2   1 
ATOM   17   C  CD1   . ILE A 1 6  ? 9.826   -56.489 -8.724  1.00 28.17 ? 6  ILE A CD1   1 
ATOM   18   N  N     . PRO A 1 7  ? 9.669   -54.174 -13.916 1.00 22.17 ? 7  PRO A N     1 
ATOM   19   C  CA    . PRO A 1 7  ? 8.700   -53.615 -14.849 1.00 20.69 ? 7  PRO A CA    1 
ATOM   20   C  C     . PRO A 1 7  ? 7.498   -54.519 -15.070 1.00 19.35 ? 7  PRO A C     1 
ATOM   21   O  O     . PRO A 1 7  ? 7.652   -55.731 -15.173 1.00 19.49 ? 7  PRO A O     1 
ATOM   22   C  CB    . PRO A 1 7  ? 9.501   -53.482 -16.146 1.00 20.70 ? 7  PRO A CB    1 
ATOM   23   C  CG    . PRO A 1 7  ? 10.616  -54.421 -16.009 1.00 21.34 ? 7  PRO A CG    1 
ATOM   24   C  CD    . PRO A 1 7  ? 10.959  -54.444 -14.568 1.00 21.90 ? 7  PRO A CD    1 
ATOM   25   N  N     . LEU A 1 8  ? 6.314   -53.924 -15.169 1.00 17.66 ? 8  LEU A N     1 
ATOM   26   C  CA    . LEU A 1 8  ? 5.068   -54.679 -15.297 1.00 16.43 ? 8  LEU A CA    1 
ATOM   27   C  C     . LEU A 1 8  ? 5.004   -55.623 -16.497 1.00 15.60 ? 8  LEU A C     1 
ATOM   28   O  O     . LEU A 1 8  ? 4.389   -56.669 -16.395 1.00 15.45 ? 8  LEU A O     1 
ATOM   29   C  CB    . LEU A 1 8  ? 3.845   -53.747 -15.286 1.00 16.30 ? 8  LEU A CB    1 
ATOM   30   C  CG    . LEU A 1 8  ? 2.434   -54.353 -15.272 1.00 16.55 ? 8  LEU A CG    1 
ATOM   31   C  CD1   . LEU A 1 8  ? 2.250   -55.327 -14.121 1.00 15.97 ? 8  LEU A CD1   1 
ATOM   32   C  CD2   . LEU A 1 8  ? 1.350   -53.284 -15.227 1.00 16.29 ? 8  LEU A CD2   1 
ATOM   33   N  N     . HIS A 1 9  ? 5.620   -55.276 -17.623 1.00 14.85 ? 9  HIS A N     1 
ATOM   34   C  CA    . HIS A 1 9  ? 5.575   -56.186 -18.769 1.00 14.41 ? 9  HIS A CA    1 
ATOM   35   C  C     . HIS A 1 9  ? 6.295   -57.495 -18.459 1.00 14.37 ? 9  HIS A C     1 
ATOM   36   O  O     . HIS A 1 9  ? 5.900   -58.558 -18.948 1.00 14.42 ? 9  HIS A O     1 
ATOM   37   C  CB    . HIS A 1 9  ? 6.080   -55.549 -20.081 1.00 14.36 ? 9  HIS A CB    1 
ATOM   38   C  CG    . HIS A 1 9  ? 7.524   -55.177 -20.060 1.00 14.23 ? 9  HIS A CG    1 
ATOM   39   N  ND1   . HIS A 1 9  ? 7.954   -53.884 -19.861 1.00 15.06 ? 9  HIS A ND1   1 
ATOM   40   C  CD2   . HIS A 1 9  ? 8.641   -55.926 -20.198 1.00 14.68 ? 9  HIS A CD2   1 
ATOM   41   C  CE1   . HIS A 1 9  ? 9.274   -53.850 -19.877 1.00 14.25 ? 9  HIS A CE1   1 
ATOM   42   N  NE2   . HIS A 1 9  ? 9.716   -55.078 -20.074 1.00 14.96 ? 9  HIS A NE2   1 
ATOM   43   N  N     . GLU A 1 10 ? 7.337   -57.423 -17.633 1.00 14.26 ? 10 GLU A N     1 
ATOM   44   C  CA    . GLU A 1 10 ? 8.030   -58.628 -17.218 1.00 14.23 ? 10 GLU A CA    1 
ATOM   45   C  C     . GLU A 1 10 ? 7.116   -59.513 -16.375 1.00 13.87 ? 10 GLU A C     1 
ATOM   46   O  O     . GLU A 1 10 ? 7.035   -60.722 -16.607 1.00 14.07 ? 10 GLU A O     1 
ATOM   47   C  CB    . GLU A 1 10 ? 9.353   -58.315 -16.517 1.00 14.51 ? 10 GLU A CB    1 
ATOM   48   C  CG    . GLU A 1 10 ? 10.522  -58.009 -17.483 1.00 16.40 ? 10 GLU A CG    1 
ATOM   49   C  CD    . GLU A 1 10 ? 10.568  -58.934 -18.723 1.00 18.65 ? 10 GLU A CD    1 
ATOM   50   O  OE1   . GLU A 1 10 ? 10.670  -60.182 -18.570 1.00 18.18 ? 10 GLU A OE1   1 
ATOM   51   O  OE2   . GLU A 1 10 ? 10.505  -58.394 -19.858 1.00 19.35 ? 10 GLU A OE2   1 
ATOM   52   N  N     . ILE A 1 11 ? 6.400   -58.917 -15.432 1.00 13.12 ? 11 ILE A N     1 
ATOM   53   C  CA    . ILE A 1 11 ? 5.378   -59.658 -14.709 1.00 13.24 ? 11 ILE A CA    1 
ATOM   54   C  C     . ILE A 1 11 ? 4.418   -60.350 -15.695 1.00 13.35 ? 11 ILE A C     1 
ATOM   55   O  O     . ILE A 1 11 ? 4.029   -61.509 -15.483 1.00 13.63 ? 11 ILE A O     1 
ATOM   56   C  CB    . ILE A 1 11 ? 4.589   -58.740 -13.743 1.00 13.37 ? 11 ILE A CB    1 
ATOM   57   C  CG1   . ILE A 1 11 ? 5.544   -58.073 -12.746 1.00 13.57 ? 11 ILE A CG1   1 
ATOM   58   C  CG2   . ILE A 1 11 ? 3.464   -59.500 -13.029 1.00 12.28 ? 11 ILE A CG2   1 
ATOM   59   C  CD1   . ILE A 1 11 ? 4.895   -56.979 -11.914 1.00 13.60 ? 11 ILE A CD1   1 
ATOM   60   N  N     . ILE A 1 12 ? 4.060   -59.646 -16.772 1.00 13.13 ? 12 ILE A N     1 
ATOM   61   C  CA    . ILE A 1 12 ? 3.116   -60.162 -17.753 1.00 13.21 ? 12 ILE A CA    1 
ATOM   62   C  C     . ILE A 1 12 ? 3.696   -61.345 -18.516 1.00 14.41 ? 12 ILE A C     1 
ATOM   63   O  O     . ILE A 1 12 ? 3.025   -62.360 -18.690 1.00 14.53 ? 12 ILE A O     1 
ATOM   64   C  CB    . ILE A 1 12 ? 2.599   -59.072 -18.717 1.00 12.72 ? 12 ILE A CB    1 
ATOM   65   C  CG1   . ILE A 1 12 ? 1.680   -58.104 -17.971 1.00 11.09 ? 12 ILE A CG1   1 
ATOM   66   C  CG2   . ILE A 1 12 ? 1.842   -59.700 -19.880 1.00 12.55 ? 12 ILE A CG2   1 
ATOM   67   C  CD1   . ILE A 1 12 ? 1.167   -56.976 -18.801 1.00 8.40  ? 12 ILE A CD1   1 
ATOM   68   N  N     . ARG A 1 13 ? 4.949   -61.231 -18.948 1.00 15.74 ? 13 ARG A N     1 
ATOM   69   C  CA    . ARG A 1 13 ? 5.583   -62.315 -19.695 1.00 16.94 ? 13 ARG A CA    1 
ATOM   70   C  C     . ARG A 1 13 ? 5.806   -63.539 -18.844 1.00 17.08 ? 13 ARG A C     1 
ATOM   71   O  O     . ARG A 1 13 ? 5.805   -64.651 -19.362 1.00 17.18 ? 13 ARG A O     1 
ATOM   72   C  CB    . ARG A 1 13 ? 6.895   -61.866 -20.343 1.00 16.90 ? 13 ARG A CB    1 
ATOM   73   C  CG    . ARG A 1 13 ? 6.660   -61.091 -21.646 1.00 18.41 ? 13 ARG A CG    1 
ATOM   74   C  CD    . ARG A 1 13 ? 7.934   -60.473 -22.212 1.00 18.69 ? 13 ARG A CD    1 
ATOM   75   N  NE    . ARG A 1 13 ? 7.689   -59.092 -22.636 1.00 22.37 ? 13 ARG A NE    1 
ATOM   76   C  CZ    . ARG A 1 13 ? 8.593   -58.298 -23.212 1.00 24.05 ? 13 ARG A CZ    1 
ATOM   77   N  NH1   . ARG A 1 13 ? 9.825   -58.741 -23.461 1.00 24.39 ? 13 ARG A NH1   1 
ATOM   78   N  NH2   . ARG A 1 13 ? 8.257   -57.053 -23.550 1.00 24.46 ? 13 ARG A NH2   1 
ATOM   79   N  N     . LYS A 1 14 ? 5.990   -63.350 -17.538 1.00 17.94 ? 14 LYS A N     1 
ATOM   80   C  CA    . LYS A 1 14 ? 6.238   -64.488 -16.658 1.00 18.54 ? 14 LYS A CA    1 
ATOM   81   C  C     . LYS A 1 14 ? 4.950   -65.268 -16.478 1.00 18.85 ? 14 LYS A C     1 
ATOM   82   O  O     . LYS A 1 14 ? 4.925   -66.485 -16.657 1.00 19.01 ? 14 LYS A O     1 
ATOM   83   C  CB    . LYS A 1 14 ? 6.820   -64.065 -15.314 1.00 18.58 ? 14 LYS A CB    1 
ATOM   84   C  CG    . LYS A 1 14 ? 7.706   -65.138 -14.683 1.00 19.92 ? 14 LYS A CG    1 
ATOM   85   C  CD    . LYS A 1 14 ? 7.192   -65.532 -13.294 1.00 22.07 ? 14 LYS A CD    1 
ATOM   86   C  CE    . LYS A 1 14 ? 8.055   -66.618 -12.648 1.00 23.58 ? 14 LYS A CE    1 
ATOM   87   N  NZ    . LYS A 1 14 ? 9.304   -66.052 -12.058 1.00 23.12 ? 14 LYS A NZ    1 
ATOM   88   N  N     . LEU A 1 15 ? 3.867   -64.568 -16.171 1.00 19.39 ? 15 LEU A N     1 
ATOM   89   C  CA    . LEU A 1 15 ? 2.569   -65.222 -16.151 1.00 20.07 ? 15 LEU A CA    1 
ATOM   90   C  C     . LEU A 1 15 ? 2.263   -65.932 -17.469 1.00 20.84 ? 15 LEU A C     1 
ATOM   91   O  O     . LEU A 1 15 ? 1.699   -67.011 -17.451 1.00 21.15 ? 15 LEU A O     1 
ATOM   92   C  CB    . LEU A 1 15 ? 1.449   -64.239 -15.796 1.00 19.79 ? 15 LEU A CB    1 
ATOM   93   C  CG    . LEU A 1 15 ? 1.384   -63.689 -14.371 1.00 18.38 ? 15 LEU A CG    1 
ATOM   94   C  CD1   . LEU A 1 15 ? 0.016   -63.117 -14.137 1.00 18.36 ? 15 LEU A CD1   1 
ATOM   95   C  CD2   . LEU A 1 15 ? 1.677   -64.740 -13.341 1.00 16.53 ? 15 LEU A CD2   1 
ATOM   96   N  N     . GLU A 1 16 ? 2.630   -65.330 -18.600 1.00 21.99 ? 16 GLU A N     1 
ATOM   97   C  CA    . GLU A 1 16 ? 2.444   -65.952 -19.915 1.00 23.56 ? 16 GLU A CA    1 
ATOM   98   C  C     . GLU A 1 16 ? 3.259   -67.235 -20.106 1.00 24.67 ? 16 GLU A C     1 
ATOM   99   O  O     . GLU A 1 16 ? 2.738   -68.228 -20.625 1.00 24.69 ? 16 GLU A O     1 
ATOM   100  C  CB    . GLU A 1 16 ? 2.751   -64.968 -21.038 1.00 23.18 ? 16 GLU A CB    1 
ATOM   101  C  CG    . GLU A 1 16 ? 1.530   -64.439 -21.762 1.00 23.96 ? 16 GLU A CG    1 
ATOM   102  C  CD    . GLU A 1 16 ? 1.854   -63.258 -22.691 1.00 24.76 ? 16 GLU A CD    1 
ATOM   103  O  OE1   . GLU A 1 16 ? 2.758   -63.372 -23.558 1.00 25.92 ? 16 GLU A OE1   1 
ATOM   104  O  OE2   . GLU A 1 16 ? 1.190   -62.209 -22.558 1.00 26.53 ? 16 GLU A OE2   1 
ATOM   105  N  N     . ARG A 1 17 ? 4.535   -67.206 -19.711 1.00 26.31 ? 17 ARG A N     1 
ATOM   106  C  CA    . ARG A 1 17 ? 5.364   -68.410 -19.684 1.00 28.14 ? 17 ARG A CA    1 
ATOM   107  C  C     . ARG A 1 17 ? 4.669   -69.473 -18.816 1.00 28.40 ? 17 ARG A C     1 
ATOM   108  O  O     . ARG A 1 17 ? 4.589   -70.644 -19.199 1.00 28.20 ? 17 ARG A O     1 
ATOM   109  C  CB    . ARG A 1 17 ? 6.786   -68.103 -19.175 1.00 28.22 ? 17 ARG A CB    1 
ATOM   110  C  CG    . ARG A 1 17 ? 7.899   -68.080 -20.252 1.00 29.90 ? 17 ARG A CG    1 
ATOM   111  C  CD    . ARG A 1 17 ? 9.218   -67.385 -19.777 1.00 30.29 ? 17 ARG A CD    1 
ATOM   112  N  NE    . ARG A 1 17 ? 9.163   -65.914 -19.874 1.00 35.55 ? 17 ARG A NE    1 
ATOM   113  C  CZ    . ARG A 1 17 ? 10.205  -65.093 -20.103 1.00 37.97 ? 17 ARG A CZ    1 
ATOM   114  N  NH1   . ARG A 1 17 ? 11.435  -65.569 -20.290 1.00 38.60 ? 17 ARG A NH1   1 
ATOM   115  N  NH2   . ARG A 1 17 ? 10.019  -63.769 -20.166 1.00 38.38 ? 17 ARG A NH2   1 
HETATM 116  N  N     . MSE A 1 18 ? 4.129   -69.044 -17.677 1.00 28.95 ? 18 MSE A N     1 
HETATM 117  C  CA    . MSE A 1 18 ? 3.442   -69.942 -16.754 1.00 31.00 ? 18 MSE A CA    1 
HETATM 118  C  C     . MSE A 1 18 ? 2.166   -70.565 -17.284 1.00 28.36 ? 18 MSE A C     1 
HETATM 119  O  O     . MSE A 1 18 ? 1.988   -71.773 -17.199 1.00 28.50 ? 18 MSE A O     1 
HETATM 120  C  CB    . MSE A 1 18 ? 3.153   -69.241 -15.446 1.00 30.21 ? 18 MSE A CB    1 
HETATM 121  C  CG    . MSE A 1 18 ? 4.224   -69.439 -14.441 1.00 32.95 ? 18 MSE A CG    1 
HETATM 122  SE SE    . MSE A 1 18 ? 3.993   -68.183 -12.981 1.00 40.87 ? 18 MSE A SE    1 
HETATM 123  C  CE    . MSE A 1 18 ? 2.025   -68.298 -12.744 1.00 39.49 ? 18 MSE A CE    1 
ATOM   124  N  N     . ASN A 1 19 ? 1.274   -69.740 -17.806 1.00 26.94 ? 19 ASN A N     1 
ATOM   125  C  CA    . ASN A 1 19 ? 0.086   -70.229 -18.475 1.00 25.53 ? 19 ASN A CA    1 
ATOM   126  C  C     . ASN A 1 19 ? 0.383   -71.257 -19.590 1.00 25.76 ? 19 ASN A C     1 
ATOM   127  O  O     . ASN A 1 19 ? -0.308  -72.275 -19.683 1.00 25.50 ? 19 ASN A O     1 
ATOM   128  C  CB    . ASN A 1 19 ? -0.713  -69.058 -19.031 1.00 24.84 ? 19 ASN A CB    1 
ATOM   129  C  CG    . ASN A 1 19 ? -2.096  -69.458 -19.435 1.00 22.56 ? 19 ASN A CG    1 
ATOM   130  O  OD1   . ASN A 1 19 ? -2.809  -70.111 -18.678 1.00 19.56 ? 19 ASN A OD1   1 
ATOM   131  N  ND2   . ASN A 1 19 ? -2.481  -69.094 -20.644 1.00 19.80 ? 19 ASN A ND2   1 
ATOM   132  N  N     . GLN A 1 20 ? 1.397   -70.979 -20.426 1.00 25.49 ? 20 GLN A N     1 
ATOM   133  C  CA    . GLN A 1 20 ? 1.898   -71.929 -21.424 1.00 25.60 ? 20 GLN A CA    1 
ATOM   134  C  C     . GLN A 1 20 ? 2.262   -73.289 -20.835 1.00 24.79 ? 20 GLN A C     1 
ATOM   135  O  O     . GLN A 1 20 ? 1.944   -74.319 -21.420 1.00 24.89 ? 20 GLN A O     1 
ATOM   136  C  CB    . GLN A 1 20 ? 3.130   -71.382 -22.137 1.00 25.62 ? 20 GLN A CB    1 
ATOM   137  C  CG    . GLN A 1 20 ? 2.837   -70.492 -23.343 1.00 27.57 ? 20 GLN A CG    1 
ATOM   138  C  CD    . GLN A 1 20 ? 4.113   -70.110 -24.103 1.00 27.93 ? 20 GLN A CD    1 
ATOM   139  O  OE1   . GLN A 1 20 ? 4.664   -70.921 -24.875 1.00 30.73 ? 20 GLN A OE1   1 
ATOM   140  N  NE2   . GLN A 1 20 ? 4.592   -68.871 -23.886 1.00 28.78 ? 20 GLN A NE2   1 
ATOM   141  N  N     . LYS A 1 21 ? 2.946   -73.302 -19.694 1.00 23.81 ? 21 LYS A N     1 
ATOM   142  C  CA    . LYS A 1 21 ? 3.300   -74.563 -19.075 1.00 23.03 ? 21 LYS A CA    1 
ATOM   143  C  C     . LYS A 1 21 ? 2.053   -75.322 -18.636 1.00 22.76 ? 21 LYS A C     1 
ATOM   144  O  O     . LYS A 1 21 ? 1.992   -76.535 -18.806 1.00 23.24 ? 21 LYS A O     1 
ATOM   145  C  CB    . LYS A 1 21 ? 4.287   -74.386 -17.905 1.00 23.30 ? 21 LYS A CB    1 
ATOM   146  C  CG    . LYS A 1 21 ? 5.702   -73.921 -18.303 1.00 23.21 ? 21 LYS A CG    1 
ATOM   147  C  CD    . LYS A 1 21 ? 6.174   -74.591 -19.602 1.00 24.30 ? 21 LYS A CD    1 
ATOM   148  C  CE    . LYS A 1 21 ? 7.652   -74.380 -19.899 1.00 23.46 ? 21 LYS A CE    1 
ATOM   149  N  NZ    . LYS A 1 21 ? 8.108   -75.526 -20.726 1.00 22.19 ? 21 LYS A NZ    1 
ATOM   150  N  N     . LYS A 1 22 ? 1.057   -74.621 -18.092 1.00 22.06 ? 22 LYS A N     1 
ATOM   151  C  CA    . LYS A 1 22 ? -0.163  -75.282 -17.625 1.00 21.37 ? 22 LYS A CA    1 
ATOM   152  C  C     . LYS A 1 22 ? -0.895  -75.925 -18.773 1.00 20.40 ? 22 LYS A C     1 
ATOM   153  O  O     . LYS A 1 22 ? -1.375  -77.036 -18.648 1.00 20.88 ? 22 LYS A O     1 
ATOM   154  C  CB    . LYS A 1 22 ? -1.104  -74.323 -16.911 1.00 21.54 ? 22 LYS A CB    1 
ATOM   155  C  CG    . LYS A 1 22 ? -0.548  -73.753 -15.641 1.00 23.94 ? 22 LYS A CG    1 
ATOM   156  C  CD    . LYS A 1 22 ? -1.660  -73.313 -14.699 1.00 28.24 ? 22 LYS A CD    1 
ATOM   157  C  CE    . LYS A 1 22 ? -1.017  -72.761 -13.428 1.00 32.13 ? 22 LYS A CE    1 
ATOM   158  N  NZ    . LYS A 1 22 ? -1.771  -73.094 -12.178 1.00 33.80 ? 22 LYS A NZ    1 
ATOM   159  N  N     . GLN A 1 23 ? -0.975  -75.233 -19.895 1.00 19.20 ? 23 GLN A N     1 
ATOM   160  C  CA    . GLN A 1 23 ? -1.615  -75.787 -21.066 1.00 18.32 ? 23 GLN A CA    1 
ATOM   161  C  C     . GLN A 1 23 ? -0.863  -76.993 -21.617 1.00 17.45 ? 23 GLN A C     1 
ATOM   162  O  O     . GLN A 1 23 ? -1.472  -77.942 -22.114 1.00 17.54 ? 23 GLN A O     1 
ATOM   163  C  CB    . GLN A 1 23 ? -1.735  -74.730 -22.139 1.00 18.24 ? 23 GLN A CB    1 
ATOM   164  C  CG    . GLN A 1 23 ? -2.625  -73.606 -21.743 1.00 19.52 ? 23 GLN A CG    1 
ATOM   165  C  CD    . GLN A 1 23 ? -2.729  -72.589 -22.847 1.00 22.82 ? 23 GLN A CD    1 
ATOM   166  O  OE1   . GLN A 1 23 ? -1.768  -71.868 -23.127 1.00 23.87 ? 23 GLN A OE1   1 
ATOM   167  N  NE2   . GLN A 1 23 ? -3.896  -72.528 -23.500 1.00 23.19 ? 23 GLN A NE2   1 
ATOM   168  N  N     . ALA A 1 24 ? 0.457   -76.963 -21.519 1.00 16.15 ? 24 ALA A N     1 
ATOM   169  C  CA    . ALA A 1 24 ? 1.253   -78.063 -22.011 1.00 15.24 ? 24 ALA A CA    1 
ATOM   170  C  C     . ALA A 1 24 ? 1.023   -79.308 -21.144 1.00 15.13 ? 24 ALA A C     1 
ATOM   171  O  O     . ALA A 1 24 ? 0.831   -80.408 -21.671 1.00 15.07 ? 24 ALA A O     1 
ATOM   172  C  CB    . ALA A 1 24 ? 2.722   -77.673 -22.077 1.00 14.74 ? 24 ALA A CB    1 
ATOM   173  N  N     . GLN A 1 25 ? 1.022   -79.125 -19.823 1.00 14.85 ? 25 GLN A N     1 
ATOM   174  C  CA    . GLN A 1 25 ? 0.705   -80.194 -18.886 1.00 15.02 ? 25 GLN A CA    1 
ATOM   175  C  C     . GLN A 1 25 ? -0.669  -80.798 -19.165 1.00 14.85 ? 25 GLN A C     1 
ATOM   176  O  O     . GLN A 1 25 ? -0.808  -82.018 -19.271 1.00 15.02 ? 25 GLN A O     1 
ATOM   177  C  CB    . GLN A 1 25 ? 0.742   -79.685 -17.446 1.00 15.13 ? 25 GLN A CB    1 
ATOM   178  C  CG    . GLN A 1 25 ? 2.144   -79.588 -16.879 1.00 17.62 ? 25 GLN A CG    1 
ATOM   179  C  CD    . GLN A 1 25 ? 2.220   -78.765 -15.590 1.00 19.88 ? 25 GLN A CD    1 
ATOM   180  O  OE1   . GLN A 1 25 ? 1.450   -77.823 -15.382 1.00 21.63 ? 25 GLN A OE1   1 
ATOM   181  N  NE2   . GLN A 1 25 ? 3.171   -79.107 -14.732 1.00 20.67 ? 25 GLN A NE2   1 
ATOM   182  N  N     . ARG A 1 26 ? -1.682  -79.944 -19.280 1.00 14.41 ? 26 ARG A N     1 
ATOM   183  C  CA    . ARG A 1 26 ? -3.040  -80.404 -19.472 1.00 14.51 ? 26 ARG A CA    1 
ATOM   184  C  C     . ARG A 1 26 ? -3.143  -81.199 -20.772 1.00 13.97 ? 26 ARG A C     1 
ATOM   185  O  O     . ARG A 1 26 ? -3.843  -82.218 -20.835 1.00 14.04 ? 26 ARG A O     1 
ATOM   186  C  CB    . ARG A 1 26 ? -4.010  -79.224 -19.472 1.00 14.34 ? 26 ARG A CB    1 
ATOM   187  C  CG    . ARG A 1 26 ? -5.429  -79.607 -19.855 1.00 15.57 ? 26 ARG A CG    1 
ATOM   188  C  CD    . ARG A 1 26 ? -6.388  -78.411 -19.864 1.00 16.42 ? 26 ARG A CD    1 
ATOM   189  N  NE    . ARG A 1 26 ? -6.731  -77.991 -18.503 1.00 19.88 ? 26 ARG A NE    1 
ATOM   190  C  CZ    . ARG A 1 26 ? -6.332  -76.852 -17.949 1.00 21.16 ? 26 ARG A CZ    1 
ATOM   191  N  NH1   . ARG A 1 26 ? -5.577  -75.989 -18.646 1.00 21.15 ? 26 ARG A NH1   1 
ATOM   192  N  NH2   . ARG A 1 26 ? -6.711  -76.571 -16.704 1.00 21.06 ? 26 ARG A NH2   1 
ATOM   193  N  N     . LYS A 1 27 ? -2.446  -80.729 -21.808 1.00 13.24 ? 27 LYS A N     1 
ATOM   194  C  CA    . LYS A 1 27 ? -2.467  -81.382 -23.101 1.00 12.01 ? 27 LYS A CA    1 
ATOM   195  C  C     . LYS A 1 27 ? -1.819  -82.755 -22.955 1.00 12.05 ? 27 LYS A C     1 
ATOM   196  O  O     . LYS A 1 27 ? -2.340  -83.743 -23.463 1.00 12.36 ? 27 LYS A O     1 
ATOM   197  C  CB    . LYS A 1 27 ? -1.739  -80.536 -24.136 1.00 11.76 ? 27 LYS A CB    1 
ATOM   198  C  CG    . LYS A 1 27 ? -1.860  -81.048 -25.557 1.00 11.00 ? 27 LYS A CG    1 
ATOM   199  C  CD    . LYS A 1 27 ? -0.629  -80.700 -26.370 1.00 9.30  ? 27 LYS A CD    1 
ATOM   200  C  CE    . LYS A 1 27 ? -0.586  -81.495 -27.675 1.00 9.38  ? 27 LYS A CE    1 
ATOM   201  N  NZ    . LYS A 1 27 ? 0.480   -81.034 -28.625 1.00 7.38  ? 27 LYS A NZ    1 
ATOM   202  N  N     . ARG A 1 28 ? -0.697  -82.819 -22.247 1.00 11.42 ? 28 ARG A N     1 
ATOM   203  C  CA    . ARG A 1 28 ? -0.018  -84.072 -22.030 1.00 11.36 ? 28 ARG A CA    1 
ATOM   204  C  C     . ARG A 1 28 ? -0.897  -85.074 -21.264 1.00 11.87 ? 28 ARG A C     1 
ATOM   205  O  O     . ARG A 1 28 ? -0.853  -86.276 -21.525 1.00 12.01 ? 28 ARG A O     1 
ATOM   206  C  CB    . ARG A 1 28 ? 1.279   -83.832 -21.263 1.00 11.61 ? 28 ARG A CB    1 
ATOM   207  C  CG    . ARG A 1 28 ? 2.525   -83.676 -22.108 1.00 11.08 ? 28 ARG A CG    1 
ATOM   208  C  CD    . ARG A 1 28 ? 3.737   -83.491 -21.202 1.00 12.59 ? 28 ARG A CD    1 
ATOM   209  N  NE    . ARG A 1 28 ? 4.122   -82.082 -21.071 1.00 15.48 ? 28 ARG A NE    1 
ATOM   210  C  CZ    . ARG A 1 28 ? 4.178   -81.376 -19.941 1.00 16.75 ? 28 ARG A CZ    1 
ATOM   211  N  NH1   . ARG A 1 28 ? 3.881   -81.908 -18.754 1.00 14.77 ? 28 ARG A NH1   1 
ATOM   212  N  NH2   . ARG A 1 28 ? 4.561   -80.100 -20.008 1.00 20.10 ? 28 ARG A NH2   1 
ATOM   213  N  N     . HIS A 1 29 ? -1.684  -84.584 -20.313 1.00 12.21 ? 29 HIS A N     1 
ATOM   214  C  CA    . HIS A 1 29 ? -2.475  -85.446 -19.439 1.00 12.75 ? 29 HIS A CA    1 
ATOM   215  C  C     . HIS A 1 29 ? -3.739  -85.880 -20.183 1.00 13.07 ? 29 HIS A C     1 
ATOM   216  O  O     . HIS A 1 29 ? -4.150  -87.028 -20.116 1.00 13.46 ? 29 HIS A O     1 
ATOM   217  C  CB    . HIS A 1 29 ? -2.784  -84.699 -18.135 1.00 12.88 ? 29 HIS A CB    1 
ATOM   218  C  CG    . HIS A 1 29 ? -3.545  -85.495 -17.116 1.00 14.90 ? 29 HIS A CG    1 
ATOM   219  N  ND1   . HIS A 1 29 ? -4.304  -84.897 -16.128 1.00 15.83 ? 29 HIS A ND1   1 
ATOM   220  C  CD2   . HIS A 1 29 ? -3.672  -86.832 -16.925 1.00 15.80 ? 29 HIS A CD2   1 
ATOM   221  C  CE1   . HIS A 1 29 ? -4.862  -85.830 -15.375 1.00 15.18 ? 29 HIS A CE1   1 
ATOM   222  N  NE2   . HIS A 1 29 ? -4.498  -87.012 -15.840 1.00 15.65 ? 29 HIS A NE2   1 
ATOM   223  N  N     . LYS A 1 30 ? -4.335  -84.960 -20.923 1.00 13.39 ? 30 LYS A N     1 
ATOM   224  C  CA    . LYS A 1 30 ? -5.467  -85.271 -21.765 1.00 13.57 ? 30 LYS A CA    1 
ATOM   225  C  C     . LYS A 1 30 ? -5.138  -86.400 -22.719 1.00 13.39 ? 30 LYS A C     1 
ATOM   226  O  O     . LYS A 1 30 ? -5.924  -87.332 -22.834 1.00 13.71 ? 30 LYS A O     1 
ATOM   227  C  CB    . LYS A 1 30 ? -5.859  -84.045 -22.580 1.00 14.13 ? 30 LYS A CB    1 
ATOM   228  C  CG    . LYS A 1 30 ? -7.253  -84.114 -23.167 1.00 15.82 ? 30 LYS A CG    1 
ATOM   229  C  CD    . LYS A 1 30 ? -7.761  -82.722 -23.520 1.00 19.07 ? 30 LYS A CD    1 
ATOM   230  C  CE    . LYS A 1 30 ? -7.151  -82.232 -24.831 1.00 21.33 ? 30 LYS A CE    1 
ATOM   231  N  NZ    . LYS A 1 30 ? -7.693  -83.036 -25.950 1.00 23.28 ? 30 LYS A NZ    1 
ATOM   232  N  N     . LEU A 1 31 ? -3.991  -86.310 -23.404 1.00 13.11 ? 31 LEU A N     1 
ATOM   233  C  CA    . LEU A 1 31 ? -3.625  -87.278 -24.440 1.00 12.82 ? 31 LEU A CA    1 
ATOM   234  C  C     . LEU A 1 31 ? -3.254  -88.618 -23.844 1.00 13.71 ? 31 LEU A C     1 
ATOM   235  O  O     . LEU A 1 31 ? -3.566  -89.640 -24.434 1.00 14.37 ? 31 LEU A O     1 
ATOM   236  C  CB    . LEU A 1 31 ? -2.480  -86.782 -25.319 1.00 12.02 ? 31 LEU A CB    1 
ATOM   237  C  CG    . LEU A 1 31 ? -2.654  -85.537 -26.195 1.00 10.54 ? 31 LEU A CG    1 
ATOM   238  C  CD1   . LEU A 1 31 ? -1.362  -85.302 -26.983 1.00 8.83  ? 31 LEU A CD1   1 
ATOM   239  C  CD2   . LEU A 1 31 ? -3.897  -85.564 -27.112 1.00 5.74  ? 31 LEU A CD2   1 
ATOM   240  N  N     . ASN A 1 32 ? -2.584  -88.618 -22.693 1.00 14.03 ? 32 ASN A N     1 
ATOM   241  C  CA    . ASN A 1 32 ? -2.390  -89.831 -21.923 1.00 14.52 ? 32 ASN A CA    1 
ATOM   242  C  C     . ASN A 1 32 ? -3.718  -90.556 -21.660 1.00 15.40 ? 32 ASN A C     1 
ATOM   243  O  O     . ASN A 1 32 ? -3.824  -91.779 -21.872 1.00 15.85 ? 32 ASN A O     1 
ATOM   244  C  CB    . ASN A 1 32 ? -1.734  -89.516 -20.570 1.00 14.84 ? 32 ASN A CB    1 
ATOM   245  C  CG    . ASN A 1 32 ? -0.268  -89.115 -20.694 1.00 13.92 ? 32 ASN A CG    1 
ATOM   246  O  OD1   . ASN A 1 32 ? 0.354   -89.299 -21.743 1.00 11.53 ? 32 ASN A OD1   1 
ATOM   247  N  ND2   . ASN A 1 32 ? 0.290   -88.568 -19.608 1.00 11.42 ? 32 ASN A ND2   1 
ATOM   248  N  N     . ARG A 1 33 ? -4.725  -89.816 -21.190 1.00 15.40 ? 33 ARG A N     1 
ATOM   249  C  CA    . ARG A 1 33 ? -5.997  -90.436 -20.806 1.00 15.83 ? 33 ARG A CA    1 
ATOM   250  C  C     . ARG A 1 33 ? -6.724  -91.031 -22.002 1.00 16.42 ? 33 ARG A C     1 
ATOM   251  O  O     . ARG A 1 33 ? -7.170  -92.182 -21.954 1.00 16.36 ? 33 ARG A O     1 
ATOM   252  C  CB    . ARG A 1 33 ? -6.881  -89.441 -20.066 1.00 15.60 ? 33 ARG A CB    1 
ATOM   253  C  CG    . ARG A 1 33 ? -6.219  -88.939 -18.788 1.00 16.07 ? 33 ARG A CG    1 
ATOM   254  C  CD    . ARG A 1 33 ? -6.817  -87.655 -18.295 1.00 14.85 ? 33 ARG A CD    1 
ATOM   255  N  NE    . ARG A 1 33 ? -7.603  -87.875 -17.087 1.00 15.82 ? 33 ARG A NE    1 
ATOM   256  C  CZ    . ARG A 1 33 ? -8.920  -87.823 -17.046 1.00 14.72 ? 33 ARG A CZ    1 
ATOM   257  N  NH1   . ARG A 1 33 ? -9.606  -87.572 -18.149 1.00 17.70 ? 33 ARG A NH1   1 
ATOM   258  N  NH2   . ARG A 1 33 ? -9.544  -88.010 -15.913 1.00 13.31 ? 33 ARG A NH2   1 
ATOM   259  N  N     . LYS A 1 34 ? -6.813  -90.236 -23.070 1.00 16.81 ? 34 LYS A N     1 
ATOM   260  C  CA    . LYS A 1 34 ? -7.410  -90.618 -24.343 1.00 17.34 ? 34 LYS A CA    1 
ATOM   261  C  C     . LYS A 1 34 ? -6.829  -91.939 -24.832 1.00 17.82 ? 34 LYS A C     1 
ATOM   262  O  O     . LYS A 1 34 ? -7.549  -92.825 -25.281 1.00 18.24 ? 34 LYS A O     1 
ATOM   263  C  CB    . LYS A 1 34 ? -7.134  -89.503 -25.352 1.00 17.57 ? 34 LYS A CB    1 
ATOM   264  C  CG    . LYS A 1 34 ? -8.086  -89.389 -26.530 1.00 18.62 ? 34 LYS A CG    1 
ATOM   265  C  CD    . LYS A 1 34 ? -7.411  -89.891 -27.816 1.00 20.99 ? 34 LYS A CD    1 
ATOM   266  C  CE    . LYS A 1 34 ? -8.257  -89.608 -29.061 1.00 21.57 ? 34 LYS A CE    1 
ATOM   267  N  NZ    . LYS A 1 34 ? -8.406  -88.130 -29.270 1.00 23.29 ? 34 LYS A NZ    1 
ATOM   268  N  N     . GLU A 1 35 ? -5.519  -92.073 -24.700 1.00 18.26 ? 35 GLU A N     1 
ATOM   269  C  CA    . GLU A 1 35 ? -4.785  -93.252 -25.124 1.00 18.94 ? 35 GLU A CA    1 
ATOM   270  C  C     . GLU A 1 35 ? -5.103  -94.482 -24.266 1.00 17.92 ? 35 GLU A C     1 
ATOM   271  O  O     . GLU A 1 35 ? -5.077  -95.609 -24.756 1.00 18.32 ? 35 GLU A O     1 
ATOM   272  C  CB    . GLU A 1 35 ? -3.288  -92.917 -25.133 1.00 18.75 ? 35 GLU A CB    1 
ATOM   273  C  CG    . GLU A 1 35 ? -2.338  -94.037 -24.789 1.00 20.89 ? 35 GLU A CG    1 
ATOM   274  C  CD    . GLU A 1 35 ? -0.883  -93.668 -25.095 1.00 21.93 ? 35 GLU A CD    1 
ATOM   275  O  OE1   . GLU A 1 35 ? -0.444  -92.525 -24.791 1.00 23.86 ? 35 GLU A OE1   1 
ATOM   276  O  OE2   . GLU A 1 35 ? -0.174  -94.540 -25.648 1.00 26.66 ? 35 GLU A OE2   1 
ATOM   277  N  N     . ARG A 1 36 ? -5.405  -94.265 -22.991 1.00 16.98 ? 36 ARG A N     1 
ATOM   278  C  CA    . ARG A 1 36 ? -5.812  -95.348 -22.109 1.00 15.47 ? 36 ARG A CA    1 
ATOM   279  C  C     . ARG A 1 36 ? -7.325  -95.527 -22.170 1.00 15.04 ? 36 ARG A C     1 
ATOM   280  O  O     . ARG A 1 36 ? -7.869  -96.407 -21.508 1.00 14.64 ? 36 ARG A O     1 
ATOM   281  C  CB    . ARG A 1 36 ? -5.429  -95.034 -20.667 1.00 15.27 ? 36 ARG A CB    1 
ATOM   282  C  CG    . ARG A 1 36 ? -3.968  -95.112 -20.348 1.00 14.59 ? 36 ARG A CG    1 
ATOM   283  C  CD    . ARG A 1 36 ? -3.758  -94.924 -18.854 1.00 13.54 ? 36 ARG A CD    1 
ATOM   284  N  NE    . ARG A 1 36 ? -3.483  -93.543 -18.456 1.00 15.47 ? 36 ARG A NE    1 
ATOM   285  C  CZ    . ARG A 1 36 ? -4.322  -92.745 -17.782 1.00 15.86 ? 36 ARG A CZ    1 
ATOM   286  N  NH1   . ARG A 1 36 ? -5.538  -93.148 -17.437 1.00 15.54 ? 36 ARG A NH1   1 
ATOM   287  N  NH2   . ARG A 1 36 ? -3.948  -91.519 -17.454 1.00 16.41 ? 36 ARG A NH2   1 
ATOM   288  N  N     . GLY A 1 37 ? -8.000  -94.666 -22.933 1.00 14.64 ? 37 GLY A N     1 
ATOM   289  C  CA    . GLY A 1 37 ? -9.459  -94.642 -22.981 1.00 14.37 ? 37 GLY A CA    1 
ATOM   290  C  C     . GLY A 1 37 ? -10.113 -94.328 -21.646 1.00 14.54 ? 37 GLY A C     1 
ATOM   291  O  O     . GLY A 1 37 ? -11.216 -94.789 -21.359 1.00 14.51 ? 37 GLY A O     1 
ATOM   292  N  N     . HIS A 1 38 ? -9.431  -93.547 -20.815 1.00 14.74 ? 38 HIS A N     1 
ATOM   293  C  CA    . HIS A 1 38 ? -10.003 -93.124 -19.554 1.00 14.62 ? 38 HIS A CA    1 
ATOM   294  C  C     . HIS A 1 38 ? -10.793 -91.826 -19.712 1.00 14.16 ? 38 HIS A C     1 
ATOM   295  O  O     . HIS A 1 38 ? -10.305 -90.873 -20.319 1.00 14.18 ? 38 HIS A O     1 
ATOM   296  C  CB    . HIS A 1 38 ? -8.921  -92.948 -18.489 1.00 14.92 ? 38 HIS A CB    1 
ATOM   297  C  CG    . HIS A 1 38 ? -9.470  -92.531 -17.157 1.00 17.05 ? 38 HIS A CG    1 
ATOM   298  N  ND1   . HIS A 1 38 ? -9.957  -93.435 -16.238 1.00 18.23 ? 38 HIS A ND1   1 
ATOM   299  C  CD2   . HIS A 1 38 ? -9.665  -91.302 -16.616 1.00 18.59 ? 38 HIS A CD2   1 
ATOM   300  C  CE1   . HIS A 1 38 ? -10.398 -92.785 -15.175 1.00 19.77 ? 38 HIS A CE1   1 
ATOM   301  N  NE2   . HIS A 1 38 ? -10.235 -91.489 -15.380 1.00 19.60 ? 38 HIS A NE2   1 
ATOM   302  N  N     . LYS A 1 39 ? -12.008 -91.810 -19.158 1.00 13.55 ? 39 LYS A N     1 
ATOM   303  C  CA    . LYS A 1 39 ? -12.843 -90.610 -19.052 1.00 12.93 ? 39 LYS A CA    1 
ATOM   304  C  C     . LYS A 1 39 ? -13.326 -90.426 -17.622 1.00 12.90 ? 39 LYS A C     1 
ATOM   305  O  O     . LYS A 1 39 ? -13.327 -91.372 -16.844 1.00 12.93 ? 39 LYS A O     1 
ATOM   306  C  CB    . LYS A 1 39 ? -14.030 -90.695 -20.006 1.00 12.63 ? 39 LYS A CB    1 
ATOM   307  C  CG    . LYS A 1 39 ? -13.617 -90.437 -21.433 1.00 12.44 ? 39 LYS A CG    1 
ATOM   308  C  CD    . LYS A 1 39 ? -14.770 -90.243 -22.375 1.00 13.16 ? 39 LYS A CD    1 
ATOM   309  C  CE    . LYS A 1 39 ? -14.204 -89.843 -23.731 1.00 15.72 ? 39 LYS A CE    1 
ATOM   310  N  NZ    . LYS A 1 39 ? -14.813 -90.643 -24.831 1.00 17.43 ? 39 LYS A NZ    1 
ATOM   311  N  N     . SER A 1 40 ? -13.696 -89.207 -17.246 1.00 13.06 ? 40 SER A N     1 
ATOM   312  C  CA    . SER A 1 40 ? -14.221 -88.999 -15.895 1.00 12.86 ? 40 SER A CA    1 
ATOM   313  C  C     . SER A 1 40 ? -15.731 -89.136 -16.014 1.00 13.07 ? 40 SER A C     1 
ATOM   314  O  O     . SER A 1 40 ? -16.261 -89.084 -17.131 1.00 13.40 ? 40 SER A O     1 
ATOM   315  C  CB    . SER A 1 40 ? -13.789 -87.643 -15.294 1.00 12.64 ? 40 SER A CB    1 
ATOM   316  O  OG    . SER A 1 40 ? -14.397 -86.530 -15.931 1.00 11.34 ? 40 SER A OG    1 
ATOM   317  N  N     . PRO A 1 41 ? -16.432 -89.346 -14.888 1.00 12.93 ? 41 PRO A N     1 
ATOM   318  C  CA    . PRO A 1 41 ? -17.879 -89.419 -15.007 1.00 12.77 ? 41 PRO A CA    1 
ATOM   319  C  C     . PRO A 1 41 ? -18.489 -88.218 -15.729 1.00 12.97 ? 41 PRO A C     1 
ATOM   320  O  O     . PRO A 1 41 ? -19.504 -88.386 -16.422 1.00 13.08 ? 41 PRO A O     1 
ATOM   321  C  CB    . PRO A 1 41 ? -18.343 -89.479 -13.557 1.00 12.80 ? 41 PRO A CB    1 
ATOM   322  C  CG    . PRO A 1 41 ? -17.189 -90.101 -12.828 1.00 12.62 ? 41 PRO A CG    1 
ATOM   323  C  CD    . PRO A 1 41 ? -15.975 -89.564 -13.500 1.00 12.81 ? 41 PRO A CD    1 
ATOM   324  N  N     . SER A 1 42 ? -17.888 -87.031 -15.593 1.00 12.90 ? 42 SER A N     1 
ATOM   325  C  CA    . SER A 1 42 ? -18.442 -85.831 -16.251 1.00 13.16 ? 42 SER A CA    1 
ATOM   326  C  C     . SER A 1 42 ? -18.055 -85.739 -17.715 1.00 13.15 ? 42 SER A C     1 
ATOM   327  O  O     . SER A 1 42 ? -18.880 -85.406 -18.550 1.00 12.92 ? 42 SER A O     1 
ATOM   328  C  CB    . SER A 1 42 ? -18.120 -84.536 -15.502 1.00 13.07 ? 42 SER A CB    1 
ATOM   329  O  OG    . SER A 1 42 ? -16.732 -84.397 -15.243 1.00 14.87 ? 42 SER A OG    1 
ATOM   330  N  N     . GLU A 1 43 ? -16.803 -86.046 -18.028 1.00 13.82 ? 43 GLU A N     1 
ATOM   331  C  CA    . GLU A 1 43 ? -16.395 -86.221 -19.414 1.00 14.68 ? 43 GLU A CA    1 
ATOM   332  C  C     . GLU A 1 43 ? -17.307 -87.233 -20.114 1.00 14.95 ? 43 GLU A C     1 
ATOM   333  O  O     . GLU A 1 43 ? -17.727 -87.019 -21.256 1.00 15.10 ? 43 GLU A O     1 
ATOM   334  C  CB    . GLU A 1 43 ? -14.959 -86.728 -19.483 1.00 14.99 ? 43 GLU A CB    1 
ATOM   335  C  CG    . GLU A 1 43 ? -13.890 -85.674 -19.332 1.00 16.14 ? 43 GLU A CG    1 
ATOM   336  C  CD    . GLU A 1 43 ? -12.514 -86.296 -19.100 1.00 19.33 ? 43 GLU A CD    1 
ATOM   337  O  OE1   . GLU A 1 43 ? -12.401 -87.252 -18.276 1.00 20.07 ? 43 GLU A OE1   1 
ATOM   338  O  OE2   . GLU A 1 43 ? -11.542 -85.823 -19.732 1.00 19.10 ? 43 GLU A OE2   1 
ATOM   339  N  N     . GLN A 1 44 ? -17.615 -88.328 -19.418 1.00 15.31 ? 44 GLN A N     1 
ATOM   340  C  CA    . GLN A 1 44 ? -18.418 -89.399 -19.987 1.00 15.71 ? 44 GLN A CA    1 
ATOM   341  C  C     . GLN A 1 44 ? -19.842 -88.930 -20.255 1.00 15.70 ? 44 GLN A C     1 
ATOM   342  O  O     . GLN A 1 44 ? -20.326 -89.017 -21.381 1.00 15.74 ? 44 GLN A O     1 
ATOM   343  C  CB    . GLN A 1 44 ? -18.408 -90.605 -19.070 1.00 15.91 ? 44 GLN A CB    1 
ATOM   344  C  CG    . GLN A 1 44 ? -18.821 -91.907 -19.739 1.00 17.95 ? 44 GLN A CG    1 
ATOM   345  C  CD    . GLN A 1 44 ? -18.983 -93.022 -18.729 1.00 20.80 ? 44 GLN A CD    1 
ATOM   346  O  OE1   . GLN A 1 44 ? -18.271 -93.068 -17.710 1.00 22.27 ? 44 GLN A OE1   1 
ATOM   347  N  NE2   . GLN A 1 44 ? -19.932 -93.918 -18.984 1.00 20.97 ? 44 GLN A NE2   1 
ATOM   348  N  N     . ARG A 1 45 ? -20.498 -88.413 -19.223 1.00 15.68 ? 45 ARG A N     1 
ATOM   349  C  CA    . ARG A 1 45 ? -21.818 -87.816 -19.357 1.00 15.63 ? 45 ARG A CA    1 
ATOM   350  C  C     . ARG A 1 45 ? -21.826 -86.877 -20.538 1.00 15.44 ? 45 ARG A C     1 
ATOM   351  O  O     . ARG A 1 45 ? -22.735 -86.919 -21.358 1.00 15.77 ? 45 ARG A O     1 
ATOM   352  C  CB    . ARG A 1 45 ? -22.146 -87.030 -18.092 1.00 15.57 ? 45 ARG A CB    1 
ATOM   353  C  CG    . ARG A 1 45 ? -23.577 -86.534 -17.954 1.00 16.32 ? 45 ARG A CG    1 
ATOM   354  C  CD    . ARG A 1 45 ? -23.775 -85.801 -16.619 1.00 16.93 ? 45 ARG A CD    1 
ATOM   355  N  NE    . ARG A 1 45 ? -22.946 -86.379 -15.549 1.00 19.55 ? 45 ARG A NE    1 
ATOM   356  C  CZ    . ARG A 1 45 ? -22.004 -85.718 -14.870 1.00 20.23 ? 45 ARG A CZ    1 
ATOM   357  N  NH1   . ARG A 1 45 ? -21.767 -84.422 -15.105 1.00 19.43 ? 45 ARG A NH1   1 
ATOM   358  N  NH2   . ARG A 1 45 ? -21.305 -86.354 -13.933 1.00 21.17 ? 45 ARG A NH2   1 
ATOM   359  N  N     . ARG A 1 46 ? -20.796 -86.040 -20.634 1.00 15.48 ? 46 ARG A N     1 
ATOM   360  C  CA    . ARG A 1 46 ? -20.764 -84.979 -21.629 1.00 15.34 ? 46 ARG A CA    1 
ATOM   361  C  C     . ARG A 1 46 ? -20.699 -85.534 -23.052 1.00 15.15 ? 46 ARG A C     1 
ATOM   362  O  O     . ARG A 1 46 ? -21.503 -85.131 -23.896 1.00 15.06 ? 46 ARG A O     1 
ATOM   363  C  CB    . ARG A 1 46 ? -19.638 -83.994 -21.326 1.00 15.59 ? 46 ARG A CB    1 
ATOM   364  C  CG    . ARG A 1 46 ? -19.385 -82.921 -22.380 1.00 16.95 ? 46 ARG A CG    1 
ATOM   365  C  CD    . ARG A 1 46 ? -18.774 -81.673 -21.763 1.00 18.58 ? 46 ARG A CD    1 
ATOM   366  N  NE    . ARG A 1 46 ? -17.820 -81.971 -20.690 1.00 19.42 ? 46 ARG A NE    1 
ATOM   367  C  CZ    . ARG A 1 46 ? -16.510 -82.142 -20.866 1.00 20.63 ? 46 ARG A CZ    1 
ATOM   368  N  NH1   . ARG A 1 46 ? -15.969 -82.055 -22.073 1.00 21.62 ? 46 ARG A NH1   1 
ATOM   369  N  NH2   . ARG A 1 46 ? -15.725 -82.394 -19.826 1.00 21.94 ? 46 ARG A NH2   1 
ATOM   370  N  N     . SER A 1 47 ? -19.787 -86.470 -23.321 1.00 14.69 ? 47 SER A N     1 
ATOM   371  C  CA    . SER A 1 47 ? -19.766 -87.100 -24.655 1.00 14.85 ? 47 SER A CA    1 
ATOM   372  C  C     . SER A 1 47 ? -21.068 -87.816 -24.998 1.00 14.23 ? 47 SER A C     1 
ATOM   373  O  O     . SER A 1 47 ? -21.526 -87.771 -26.134 1.00 14.24 ? 47 SER A O     1 
ATOM   374  C  CB    . SER A 1 47 ? -18.582 -88.046 -24.840 1.00 14.72 ? 47 SER A CB    1 
ATOM   375  O  OG    . SER A 1 47 ? -18.362 -88.785 -23.664 1.00 16.75 ? 47 SER A OG    1 
ATOM   376  N  N     . GLU A 1 48 ? -21.668 -88.469 -24.015 1.00 13.88 ? 48 GLU A N     1 
ATOM   377  C  CA    . GLU A 1 48 ? -22.905 -89.182 -24.255 1.00 13.66 ? 48 GLU A CA    1 
ATOM   378  C  C     . GLU A 1 48 ? -24.044 -88.261 -24.642 1.00 13.89 ? 48 GLU A C     1 
ATOM   379  O  O     . GLU A 1 48 ? -24.800 -88.563 -25.557 1.00 13.96 ? 48 GLU A O     1 
ATOM   380  C  CB    . GLU A 1 48 ? -23.258 -90.065 -23.074 1.00 13.50 ? 48 GLU A CB    1 
ATOM   381  C  CG    . GLU A 1 48 ? -22.457 -91.352 -23.097 1.00 12.50 ? 48 GLU A CG    1 
ATOM   382  C  CD    . GLU A 1 48 ? -22.756 -92.247 -21.931 1.00 11.44 ? 48 GLU A CD    1 
ATOM   383  O  OE1   . GLU A 1 48 ? -23.925 -92.293 -21.499 1.00 11.55 ? 48 GLU A OE1   1 
ATOM   384  O  OE2   . GLU A 1 48 ? -21.816 -92.904 -21.446 1.00 10.58 ? 48 GLU A OE2   1 
ATOM   385  N  N     . LEU A 1 49 ? -24.147 -87.116 -23.988 1.00 14.28 ? 49 LEU A N     1 
ATOM   386  C  CA    . LEU A 1 49 ? -25.120 -86.123 -24.420 1.00 14.84 ? 49 LEU A CA    1 
ATOM   387  C  C     . LEU A 1 49 ? -24.890 -85.686 -25.876 1.00 15.19 ? 49 LEU A C     1 
ATOM   388  O  O     . LEU A 1 49 ? -25.839 -85.542 -26.643 1.00 15.06 ? 49 LEU A O     1 
ATOM   389  C  CB    . LEU A 1 49 ? -25.157 -84.939 -23.447 1.00 14.72 ? 49 LEU A CB    1 
ATOM   390  C  CG    . LEU A 1 49 ? -26.204 -85.181 -22.347 1.00 15.09 ? 49 LEU A CG    1 
ATOM   391  C  CD1   . LEU A 1 49 ? -25.759 -84.690 -20.973 1.00 15.00 ? 49 LEU A CD1   1 
ATOM   392  C  CD2   . LEU A 1 49 ? -27.561 -84.586 -22.746 1.00 15.82 ? 49 LEU A CD2   1 
ATOM   393  N  N     . TRP A 1 50 ? -23.624 -85.520 -26.246 1.00 15.96 ? 50 TRP A N     1 
ATOM   394  C  CA    . TRP A 1 50 ? -23.227 -85.109 -27.585 1.00 16.69 ? 50 TRP A CA    1 
ATOM   395  C  C     . TRP A 1 50 ? -23.595 -86.138 -28.663 1.00 16.75 ? 50 TRP A C     1 
ATOM   396  O  O     . TRP A 1 50 ? -24.190 -85.787 -29.684 1.00 16.74 ? 50 TRP A O     1 
ATOM   397  C  CB    . TRP A 1 50 ? -21.724 -84.815 -27.616 1.00 17.58 ? 50 TRP A CB    1 
ATOM   398  C  CG    . TRP A 1 50 ? -21.265 -84.158 -28.880 1.00 18.54 ? 50 TRP A CG    1 
ATOM   399  C  CD1   . TRP A 1 50 ? -21.325 -82.828 -29.175 1.00 19.49 ? 50 TRP A CD1   1 
ATOM   400  C  CD2   . TRP A 1 50 ? -20.683 -84.800 -30.026 1.00 19.92 ? 50 TRP A CD2   1 
ATOM   401  N  NE1   . TRP A 1 50 ? -20.809 -82.597 -30.429 1.00 20.37 ? 50 TRP A NE1   1 
ATOM   402  C  CE2   . TRP A 1 50 ? -20.410 -83.789 -30.976 1.00 20.01 ? 50 TRP A CE2   1 
ATOM   403  C  CE3   . TRP A 1 50 ? -20.373 -86.135 -30.346 1.00 20.83 ? 50 TRP A CE3   1 
ATOM   404  C  CZ2   . TRP A 1 50 ? -19.835 -84.065 -32.227 1.00 19.38 ? 50 TRP A CZ2   1 
ATOM   405  C  CZ3   . TRP A 1 50 ? -19.800 -86.415 -31.605 1.00 19.76 ? 50 TRP A CZ3   1 
ATOM   406  C  CH2   . TRP A 1 50 ? -19.542 -85.379 -32.524 1.00 19.44 ? 50 TRP A CH2   1 
ATOM   407  N  N     . HIS A 1 51 ? -23.238 -87.399 -28.433 1.00 16.98 ? 51 HIS A N     1 
ATOM   408  C  CA    . HIS A 1 51 ? -23.545 -88.475 -29.370 1.00 17.21 ? 51 HIS A CA    1 
ATOM   409  C  C     . HIS A 1 51 ? -25.051 -88.653 -29.553 1.00 18.28 ? 51 HIS A C     1 
ATOM   410  O  O     . HIS A 1 51 ? -25.521 -88.918 -30.662 1.00 18.35 ? 51 HIS A O     1 
ATOM   411  C  CB    . HIS A 1 51 ? -22.914 -89.775 -28.908 1.00 16.63 ? 51 HIS A CB    1 
ATOM   412  C  CG    . HIS A 1 51 ? -21.434 -89.833 -29.115 1.00 14.94 ? 51 HIS A CG    1 
ATOM   413  N  ND1   . HIS A 1 51 ? -20.863 -90.227 -30.305 1.00 13.82 ? 51 HIS A ND1   1 
ATOM   414  C  CD2   . HIS A 1 51 ? -20.407 -89.564 -28.279 1.00 12.56 ? 51 HIS A CD2   1 
ATOM   415  C  CE1   . HIS A 1 51 ? -19.549 -90.189 -30.197 1.00 11.46 ? 51 HIS A CE1   1 
ATOM   416  N  NE2   . HIS A 1 51 ? -19.247 -89.785 -28.979 1.00 11.10 ? 51 HIS A NE2   1 
ATOM   417  N  N     . ALA A 1 52 ? -25.803 -88.495 -28.465 1.00 19.50 ? 52 ALA A N     1 
ATOM   418  C  CA    . ALA A 1 52 ? -27.257 -88.571 -28.518 1.00 20.85 ? 52 ALA A CA    1 
ATOM   419  C  C     . ALA A 1 52 ? -27.813 -87.471 -29.407 1.00 22.04 ? 52 ALA A C     1 
ATOM   420  O  O     . ALA A 1 52 ? -28.741 -87.695 -30.175 1.00 22.27 ? 52 ALA A O     1 
ATOM   421  C  CB    . ALA A 1 52 ? -27.853 -88.485 -27.117 1.00 20.47 ? 52 ALA A CB    1 
ATOM   422  N  N     . ARG A 1 53 ? -27.219 -86.287 -29.307 1.00 23.93 ? 53 ARG A N     1 
ATOM   423  C  CA    . ARG A 1 53 ? -27.692 -85.107 -30.021 1.00 25.71 ? 53 ARG A CA    1 
ATOM   424  C  C     . ARG A 1 53 ? -27.337 -85.155 -31.506 1.00 26.45 ? 53 ARG A C     1 
ATOM   425  O  O     . ARG A 1 53 ? -28.111 -84.678 -32.332 1.00 26.32 ? 53 ARG A O     1 
ATOM   426  C  CB    . ARG A 1 53 ? -27.127 -83.846 -29.369 1.00 26.00 ? 53 ARG A CB    1 
ATOM   427  C  CG    . ARG A 1 53 ? -27.961 -82.593 -29.582 1.00 28.00 ? 53 ARG A CG    1 
ATOM   428  C  CD    . ARG A 1 53 ? -27.339 -81.435 -28.804 1.00 30.87 ? 53 ARG A CD    1 
ATOM   429  N  NE    . ARG A 1 53 ? -27.528 -80.146 -29.475 1.00 32.95 ? 53 ARG A NE    1 
ATOM   430  C  CZ    . ARG A 1 53 ? -26.699 -79.110 -29.357 1.00 33.56 ? 53 ARG A CZ    1 
ATOM   431  N  NH1   . ARG A 1 53 ? -25.608 -79.198 -28.600 1.00 34.49 ? 53 ARG A NH1   1 
ATOM   432  N  NH2   . ARG A 1 53 ? -26.956 -77.982 -30.004 1.00 33.96 ? 53 ARG A NH2   1 
ATOM   433  N  N     . GLN A 1 54 ? -26.174 -85.727 -31.831 1.00 27.58 ? 54 GLN A N     1 
ATOM   434  C  CA    . GLN A 1 54 ? -25.771 -85.974 -33.221 1.00 28.86 ? 54 GLN A CA    1 
ATOM   435  C  C     . GLN A 1 54 ? -26.756 -86.892 -33.939 1.00 29.92 ? 54 GLN A C     1 
ATOM   436  O  O     . GLN A 1 54 ? -27.080 -86.673 -35.108 1.00 30.06 ? 54 GLN A O     1 
ATOM   437  C  CB    . GLN A 1 54 ? -24.371 -86.598 -33.299 1.00 28.72 ? 54 GLN A CB    1 
ATOM   438  C  CG    . GLN A 1 54 ? -23.240 -85.786 -32.666 1.00 29.14 ? 54 GLN A CG    1 
ATOM   439  C  CD    . GLN A 1 54 ? -23.296 -84.313 -33.012 1.00 29.26 ? 54 GLN A CD    1 
ATOM   440  O  OE1   . GLN A 1 54 ? -23.296 -83.939 -34.187 1.00 28.41 ? 54 GLN A OE1   1 
ATOM   441  N  NE2   . GLN A 1 54 ? -23.347 -83.465 -31.986 1.00 29.00 ? 54 GLN A NE2   1 
ATOM   442  N  N     . VAL A 1 55 ? -27.211 -87.925 -33.234 1.00 31.42 ? 55 VAL A N     1 
ATOM   443  C  CA    . VAL A 1 55 ? -28.208 -88.856 -33.753 1.00 33.02 ? 55 VAL A CA    1 
ATOM   444  C  C     . VAL A 1 55 ? -29.519 -88.120 -34.033 1.00 34.38 ? 55 VAL A C     1 
ATOM   445  O  O     . VAL A 1 55 ? -30.108 -88.276 -35.107 1.00 34.33 ? 55 VAL A O     1 
ATOM   446  C  CB    . VAL A 1 55 ? -28.428 -90.061 -32.792 1.00 32.78 ? 55 VAL A CB    1 
ATOM   447  C  CG1   . VAL A 1 55 ? -29.655 -90.866 -33.184 1.00 32.77 ? 55 VAL A CG1   1 
ATOM   448  C  CG2   . VAL A 1 55 ? -27.202 -90.959 -32.773 1.00 32.76 ? 55 VAL A CG2   1 
ATOM   449  N  N     . GLU A 1 56 ? -29.950 -87.301 -33.076 1.00 36.21 ? 56 GLU A N     1 
ATOM   450  C  CA    . GLU A 1 56 ? -31.190 -86.543 -33.210 1.00 38.26 ? 56 GLU A CA    1 
ATOM   451  C  C     . GLU A 1 56 ? -31.156 -85.547 -34.366 1.00 39.47 ? 56 GLU A C     1 
ATOM   452  O  O     . GLU A 1 56 ? -32.123 -85.447 -35.117 1.00 39.76 ? 56 GLU A O     1 
ATOM   453  C  CB    . GLU A 1 56 ? -31.547 -85.831 -31.904 1.00 38.10 ? 56 GLU A CB    1 
ATOM   454  C  CG    . GLU A 1 56 ? -32.994 -85.345 -31.851 1.00 38.50 ? 56 GLU A CG    1 
ATOM   455  C  CD    . GLU A 1 56 ? -33.472 -85.020 -30.438 1.00 38.81 ? 56 GLU A CD    1 
ATOM   456  O  OE1   . GLU A 1 56 ? -32.629 -84.673 -29.570 1.00 39.23 ? 56 GLU A OE1   1 
ATOM   457  O  OE2   . GLU A 1 56 ? -34.702 -85.107 -30.203 1.00 38.67 ? 56 GLU A OE2   1 
ATOM   458  N  N     . LEU A 1 57 ? -30.047 -84.822 -34.505 1.00 41.24 ? 57 LEU A N     1 
ATOM   459  C  CA    . LEU A 1 57 ? -29.900 -83.816 -35.558 1.00 43.05 ? 57 LEU A CA    1 
ATOM   460  C  C     . LEU A 1 57 ? -29.940 -84.412 -36.964 1.00 44.60 ? 57 LEU A C     1 
ATOM   461  O  O     . LEU A 1 57 ? -30.449 -83.776 -37.891 1.00 44.78 ? 57 LEU A O     1 
ATOM   462  C  CB    . LEU A 1 57 ? -28.627 -82.981 -35.368 1.00 42.84 ? 57 LEU A CB    1 
ATOM   463  C  CG    . LEU A 1 57 ? -28.548 -81.969 -34.213 1.00 42.74 ? 57 LEU A CG    1 
ATOM   464  C  CD1   . LEU A 1 57 ? -27.210 -81.242 -34.244 1.00 42.24 ? 57 LEU A CD1   1 
ATOM   465  C  CD2   . LEU A 1 57 ? -29.704 -80.966 -34.215 1.00 41.98 ? 57 LEU A CD2   1 
ATOM   466  N  N     . SER A 1 58 ? -29.415 -85.629 -37.114 1.00 46.56 ? 58 SER A N     1 
ATOM   467  C  CA    . SER A 1 58 ? -29.457 -86.347 -38.399 1.00 48.50 ? 58 SER A CA    1 
ATOM   468  C  C     . SER A 1 58 ? -30.836 -86.968 -38.683 1.00 49.98 ? 58 SER A C     1 
ATOM   469  O  O     . SER A 1 58 ? -31.122 -87.384 -39.810 1.00 49.97 ? 58 SER A O     1 
ATOM   470  C  CB    . SER A 1 58 ? -28.347 -87.398 -38.464 1.00 48.29 ? 58 SER A CB    1 
ATOM   471  O  OG    . SER A 1 58 ? -27.095 -86.819 -38.123 1.00 48.26 ? 58 SER A OG    1 
ATOM   472  N  N     . ALA A 1 59 ? -31.672 -87.026 -37.644 1.00 52.12 ? 59 ALA A N     1 
ATOM   473  C  CA    . ALA A 1 59 ? -33.073 -87.459 -37.742 1.00 54.12 ? 59 ALA A CA    1 
ATOM   474  C  C     . ALA A 1 59 ? -33.973 -86.287 -38.171 1.00 55.57 ? 59 ALA A C     1 
ATOM   475  O  O     . ALA A 1 59 ? -35.105 -86.486 -38.638 1.00 55.84 ? 59 ALA A O     1 
ATOM   476  C  CB    . ALA A 1 59 ? -33.546 -88.058 -36.410 1.00 53.74 ? 59 ALA A CB    1 
ATOM   477  N  N     . ILE A 1 60 ? -33.455 -85.069 -37.998 1.00 57.35 ? 60 ILE A N     1 
ATOM   478  C  CA    . ILE A 1 60 ? -34.030 -83.861 -38.598 1.00 59.01 ? 60 ILE A CA    1 
ATOM   479  C  C     . ILE A 1 60 ? -33.484 -83.693 -40.027 1.00 60.15 ? 60 ILE A C     1 
ATOM   480  O  O     . ILE A 1 60 ? -34.146 -83.116 -40.890 1.00 60.23 ? 60 ILE A O     1 
ATOM   481  C  CB    . ILE A 1 60 ? -33.720 -82.596 -37.753 1.00 58.90 ? 60 ILE A CB    1 
ATOM   482  C  CG1   . ILE A 1 60 ? -33.919 -82.883 -36.258 1.00 59.04 ? 60 ILE A CG1   1 
ATOM   483  C  CG2   . ILE A 1 60 ? -34.597 -81.419 -38.194 1.00 59.14 ? 60 ILE A CG2   1 
ATOM   484  C  CD1   . ILE A 1 60 ? -33.384 -81.802 -35.325 1.00 59.12 ? 60 ILE A CD1   1 
ATOM   485  N  N     . ASN A 1 61 ? -32.278 -84.215 -40.264 1.00 61.78 ? 61 ASN A N     1 
ATOM   486  C  CA    . ASN A 1 61 ? -31.642 -84.191 -41.589 1.00 63.31 ? 61 ASN A CA    1 
ATOM   487  C  C     . ASN A 1 61 ? -32.232 -85.202 -42.585 1.00 64.27 ? 61 ASN A C     1 
ATOM   488  O  O     . ASN A 1 61 ? -32.124 -85.015 -43.799 1.00 64.43 ? 61 ASN A O     1 
ATOM   489  C  CB    . ASN A 1 61 ? -30.115 -84.362 -41.476 1.00 63.39 ? 61 ASN A CB    1 
ATOM   490  C  CG    . ASN A 1 61 ? -29.390 -83.069 -41.048 1.00 63.99 ? 61 ASN A CG    1 
ATOM   491  O  OD1   . ASN A 1 61 ? -30.001 -82.118 -40.542 1.00 63.86 ? 61 ASN A OD1   1 
ATOM   492  N  ND2   . ASN A 1 61 ? -28.072 -83.043 -41.252 1.00 64.32 ? 61 ASN A ND2   1 
ATOM   493  N  N     . SER A 1 62 ? -32.843 -86.271 -42.072 1.00 65.54 ? 62 SER A N     1 
ATOM   494  C  CA    . SER A 1 62 ? -33.624 -87.197 -42.911 1.00 66.73 ? 62 SER A CA    1 
ATOM   495  C  C     . SER A 1 62 ? -35.002 -86.606 -43.260 1.00 67.45 ? 62 SER A C     1 
ATOM   496  O  O     . SER A 1 62 ? -35.604 -86.972 -44.273 1.00 67.60 ? 62 SER A O     1 
ATOM   497  C  CB    . SER A 1 62 ? -33.775 -88.576 -42.244 1.00 66.75 ? 62 SER A CB    1 
ATOM   498  O  OG    . SER A 1 62 ? -34.584 -88.515 -41.076 1.00 66.91 ? 62 SER A OG    1 
ATOM   499  N  N     . ASP A 1 63 ? -35.485 -85.691 -42.416 1.00 68.25 ? 63 ASP A N     1 
ATOM   500  C  CA    . ASP A 1 63 ? -36.727 -84.947 -42.655 1.00 68.95 ? 63 ASP A CA    1 
ATOM   501  C  C     . ASP A 1 63 ? -36.548 -83.875 -43.756 1.00 69.14 ? 63 ASP A C     1 
ATOM   502  O  O     . ASP A 1 63 ? -37.238 -82.841 -43.761 1.00 69.18 ? 63 ASP A O     1 
ATOM   503  C  CB    . ASP A 1 63 ? -37.226 -84.322 -41.334 1.00 69.15 ? 63 ASP A CB    1 
ATOM   504  C  CG    . ASP A 1 63 ? -38.708 -83.906 -41.381 1.00 70.01 ? 63 ASP A CG    1 
ATOM   505  O  OD1   . ASP A 1 63 ? -39.553 -84.669 -41.929 1.00 70.96 ? 63 ASP A OD1   1 
ATOM   506  O  OD2   . ASP A 1 63 ? -39.029 -82.807 -40.852 1.00 70.22 ? 63 ASP A OD2   1 
ATOM   507  N  N     . ASN A 1 64 ? -35.622 -84.134 -44.686 1.00 69.32 ? 64 ASN A N     1 
ATOM   508  C  CA    . ASN A 1 64 ? -35.382 -83.255 -45.837 1.00 69.40 ? 64 ASN A CA    1 
ATOM   509  C  C     . ASN A 1 64 ? -36.003 -83.803 -47.123 1.00 69.38 ? 64 ASN A C     1 
ATOM   510  O  O     . ASN A 1 64 ? -36.841 -83.148 -47.750 1.00 69.34 ? 64 ASN A O     1 
ATOM   511  C  CB    . ASN A 1 64 ? -33.879 -83.008 -46.037 1.00 69.38 ? 64 ASN A CB    1 
ATOM   512  C  CG    . ASN A 1 64 ? -33.312 -81.969 -45.069 1.00 69.42 ? 64 ASN A CG    1 
ATOM   513  O  OD1   . ASN A 1 64 ? -33.913 -80.919 -44.832 1.00 68.66 ? 64 ASN A OD1   1 
ATOM   514  N  ND2   . ASN A 1 64 ? -32.136 -82.257 -44.520 1.00 69.66 ? 64 ASN A ND2   1 
ATOM   515  N  N     . ILE B 1 4  ? -12.590 -57.516 -17.709 1.00 39.91 ? 4  ILE B N     1 
ATOM   516  C  CA    . ILE B 1 4  ? -12.593 -56.257 -16.901 1.00 39.74 ? 4  ILE B CA    1 
ATOM   517  C  C     . ILE B 1 4  ? -12.890 -56.479 -15.394 1.00 39.39 ? 4  ILE B C     1 
ATOM   518  O  O     . ILE B 1 4  ? -12.037 -56.195 -14.536 1.00 39.60 ? 4  ILE B O     1 
ATOM   519  C  CB    . ILE B 1 4  ? -13.523 -55.141 -17.524 1.00 39.85 ? 4  ILE B CB    1 
ATOM   520  C  CG1   . ILE B 1 4  ? -14.657 -55.738 -18.379 1.00 40.27 ? 4  ILE B CG1   1 
ATOM   521  C  CG2   . ILE B 1 4  ? -12.698 -54.150 -18.353 1.00 40.05 ? 4  ILE B CG2   1 
ATOM   522  C  CD1   . ILE B 1 4  ? -15.734 -54.718 -18.827 1.00 39.82 ? 4  ILE B CD1   1 
ATOM   523  N  N     . GLU B 1 5  ? -14.068 -57.035 -15.098 1.00 38.34 ? 5  GLU B N     1 
ATOM   524  C  CA    . GLU B 1 5  ? -14.653 -57.043 -13.749 1.00 37.31 ? 5  GLU B CA    1 
ATOM   525  C  C     . GLU B 1 5  ? -14.151 -58.144 -12.790 1.00 36.00 ? 5  GLU B C     1 
ATOM   526  O  O     . GLU B 1 5  ? -14.947 -58.987 -12.335 1.00 36.10 ? 5  GLU B O     1 
ATOM   527  C  CB    . GLU B 1 5  ? -16.188 -57.101 -13.864 1.00 37.21 ? 5  GLU B CB    1 
ATOM   528  C  CG    . GLU B 1 5  ? -16.764 -56.066 -14.818 1.00 37.84 ? 5  GLU B CG    1 
ATOM   529  C  CD    . GLU B 1 5  ? -18.277 -56.110 -14.908 1.00 38.13 ? 5  GLU B CD    1 
ATOM   530  O  OE1   . GLU B 1 5  ? -18.938 -56.078 -13.841 1.00 40.16 ? 5  GLU B OE1   1 
ATOM   531  O  OE2   . GLU B 1 5  ? -18.806 -56.155 -16.044 1.00 38.32 ? 5  GLU B OE2   1 
ATOM   532  N  N     . ILE B 1 6  ? -12.851 -58.132 -12.477 1.00 33.99 ? 6  ILE B N     1 
ATOM   533  C  CA    . ILE B 1 6  ? -12.253 -59.088 -11.509 1.00 32.03 ? 6  ILE B CA    1 
ATOM   534  C  C     . ILE B 1 6  ? -11.274 -58.389 -10.556 1.00 29.53 ? 6  ILE B C     1 
ATOM   535  O  O     . ILE B 1 6  ? -10.251 -57.861 -11.012 1.00 29.48 ? 6  ILE B O     1 
ATOM   536  C  CB    . ILE B 1 6  ? -11.499 -60.258 -12.201 1.00 32.56 ? 6  ILE B CB    1 
ATOM   537  C  CG1   . ILE B 1 6  ? -12.416 -61.038 -13.151 1.00 33.66 ? 6  ILE B CG1   1 
ATOM   538  C  CG2   . ILE B 1 6  ? -10.913 -61.206 -11.147 1.00 33.02 ? 6  ILE B CG2   1 
ATOM   539  C  CD1   . ILE B 1 6  ? -11.698 -61.619 -14.377 1.00 36.19 ? 6  ILE B CD1   1 
ATOM   540  N  N     . PRO B 1 7  ? -11.569 -58.406 -9.240  1.00 27.01 ? 7  PRO B N     1 
ATOM   541  C  CA    . PRO B 1 7  ? -10.849 -57.587 -8.262  1.00 25.25 ? 7  PRO B CA    1 
ATOM   542  C  C     . PRO B 1 7  ? -9.353  -57.881 -8.194  1.00 23.50 ? 7  PRO B C     1 
ATOM   543  O  O     . PRO B 1 7  ? -8.927  -59.004 -8.439  1.00 23.41 ? 7  PRO B O     1 
ATOM   544  C  CB    . PRO B 1 7  ? -11.524 -57.950 -6.930  1.00 25.18 ? 7  PRO B CB    1 
ATOM   545  C  CG    . PRO B 1 7  ? -12.840 -58.505 -7.298  1.00 25.55 ? 7  PRO B CG    1 
ATOM   546  C  CD    . PRO B 1 7  ? -12.620 -59.211 -8.596  1.00 26.74 ? 7  PRO B CD    1 
ATOM   547  N  N     . LEU B 1 8  ? -8.567  -56.869 -7.857  1.00 21.70 ? 8  LEU B N     1 
ATOM   548  C  CA    . LEU B 1 8  ? -7.132  -57.043 -7.719  1.00 20.11 ? 8  LEU B CA    1 
ATOM   549  C  C     . LEU B 1 8  ? -6.749  -57.978 -6.566  1.00 19.60 ? 8  LEU B C     1 
ATOM   550  O  O     . LEU B 1 8  ? -5.818  -58.769 -6.703  1.00 19.59 ? 8  LEU B O     1 
ATOM   551  C  CB    . LEU B 1 8  ? -6.433  -55.695 -7.567  1.00 19.60 ? 8  LEU B CB    1 
ATOM   552  C  CG    . LEU B 1 8  ? -4.942  -55.683 -7.884  1.00 17.92 ? 8  LEU B CG    1 
ATOM   553  C  CD1   . LEU B 1 8  ? -4.714  -56.049 -9.317  1.00 17.26 ? 8  LEU B CD1   1 
ATOM   554  C  CD2   . LEU B 1 8  ? -4.347  -54.326 -7.615  1.00 17.80 ? 8  LEU B CD2   1 
ATOM   555  N  N     . HIS B 1 9  ? -7.461  -57.901 -5.446  1.00 18.71 ? 9  HIS B N     1 
ATOM   556  C  CA    . HIS B 1 9  ? -7.153  -58.762 -4.312  1.00 18.41 ? 9  HIS B CA    1 
ATOM   557  C  C     . HIS B 1 9  ? -7.305  -60.259 -4.617  1.00 18.21 ? 9  HIS B C     1 
ATOM   558  O  O     . HIS B 1 9  ? -6.646  -61.079 -3.983  1.00 17.92 ? 9  HIS B O     1 
ATOM   559  C  CB    . HIS B 1 9  ? -7.916  -58.353 -3.036  1.00 18.70 ? 9  HIS B CB    1 
ATOM   560  C  CG    . HIS B 1 9  ? -9.411  -58.465 -3.135  1.00 19.11 ? 9  HIS B CG    1 
ATOM   561  N  ND1   . HIS B 1 9  ? -10.226 -57.377 -3.377  1.00 19.09 ? 9  HIS B ND1   1 
ATOM   562  C  CD2   . HIS B 1 9  ? -10.240 -59.527 -2.996  1.00 19.03 ? 9  HIS B CD2   1 
ATOM   563  C  CE1   . HIS B 1 9  ? -11.489 -57.767 -3.396  1.00 18.83 ? 9  HIS B CE1   1 
ATOM   564  N  NE2   . HIS B 1 9  ? -11.525 -59.067 -3.167  1.00 18.95 ? 9  HIS B NE2   1 
ATOM   565  N  N     . GLU B 1 10 ? -8.154  -60.608 -5.588  1.00 18.01 ? 10 GLU B N     1 
ATOM   566  C  CA    . GLU B 1 10 ? -8.301  -62.000 -6.042  1.00 17.74 ? 10 GLU B CA    1 
ATOM   567  C  C     . GLU B 1 10 ? -7.052  -62.464 -6.765  1.00 17.46 ? 10 GLU B C     1 
ATOM   568  O  O     . GLU B 1 10 ? -6.575  -63.583 -6.558  1.00 17.53 ? 10 GLU B O     1 
ATOM   569  C  CB    . GLU B 1 10 ? -9.504  -62.171 -6.972  1.00 17.60 ? 10 GLU B CB    1 
ATOM   570  C  CG    . GLU B 1 10 ? -10.843 -61.847 -6.340  1.00 19.32 ? 10 GLU B CG    1 
ATOM   571  C  CD    . GLU B 1 10 ? -11.187 -62.768 -5.195  1.00 21.37 ? 10 GLU B CD    1 
ATOM   572  O  OE1   . GLU B 1 10 ? -10.752 -63.936 -5.225  1.00 24.02 ? 10 GLU B OE1   1 
ATOM   573  O  OE2   . GLU B 1 10 ? -11.889 -62.334 -4.263  1.00 22.05 ? 10 GLU B OE2   1 
ATOM   574  N  N     . ILE B 1 11 ? -6.533  -61.601 -7.630  1.00 17.09 ? 11 ILE B N     1 
ATOM   575  C  CA    . ILE B 1 11 ? -5.295  -61.877 -8.332  1.00 16.65 ? 11 ILE B CA    1 
ATOM   576  C  C     . ILE B 1 11 ? -4.177  -62.108 -7.308  1.00 16.42 ? 11 ILE B C     1 
ATOM   577  O  O     . ILE B 1 11 ? -3.468  -63.113 -7.389  1.00 16.71 ? 11 ILE B O     1 
ATOM   578  C  CB    . ILE B 1 11 ? -4.932  -60.726 -9.294  1.00 16.67 ? 11 ILE B CB    1 
ATOM   579  C  CG1   . ILE B 1 11 ? -6.018  -60.572 -10.368 1.00 16.81 ? 11 ILE B CG1   1 
ATOM   580  C  CG2   . ILE B 1 11 ? -3.537  -60.931 -9.895  1.00 15.92 ? 11 ILE B CG2   1 
ATOM   581  C  CD1   . ILE B 1 11 ? -5.883  -59.297 -11.208 1.00 16.79 ? 11 ILE B CD1   1 
ATOM   582  N  N     . ILE B 1 12 ? -4.040  -61.199 -6.340  1.00 15.66 ? 12 ILE B N     1 
ATOM   583  C  CA    . ILE B 1 12 ? -3.003  -61.324 -5.320  1.00 15.26 ? 12 ILE B CA    1 
ATOM   584  C  C     . ILE B 1 12 ? -3.108  -62.652 -4.563  1.00 16.03 ? 12 ILE B C     1 
ATOM   585  O  O     . ILE B 1 12 ? -2.098  -63.323 -4.377  1.00 15.90 ? 12 ILE B O     1 
ATOM   586  C  CB    . ILE B 1 12 ? -2.986  -60.119 -4.366  1.00 14.70 ? 12 ILE B CB    1 
ATOM   587  C  CG1   . ILE B 1 12 ? -2.578  -58.861 -5.125  1.00 13.23 ? 12 ILE B CG1   1 
ATOM   588  C  CG2   . ILE B 1 12 ? -2.017  -60.344 -3.233  1.00 14.62 ? 12 ILE B CG2   1 
ATOM   589  C  CD1   . ILE B 1 12 ? -2.955  -57.588 -4.439  1.00 10.37 ? 12 ILE B CD1   1 
ATOM   590  N  N     . ARG B 1 13 ? -4.331  -63.020 -4.165  1.00 16.97 ? 13 ARG B N     1 
ATOM   591  C  CA    . ARG B 1 13 ? -4.660  -64.300 -3.522  1.00 18.13 ? 13 ARG B CA    1 
ATOM   592  C  C     . ARG B 1 13 ? -4.343  -65.518 -4.388  1.00 18.45 ? 13 ARG B C     1 
ATOM   593  O  O     . ARG B 1 13 ? -3.694  -66.462 -3.933  1.00 18.45 ? 13 ARG B O     1 
ATOM   594  C  CB    . ARG B 1 13 ? -6.143  -64.340 -3.156  1.00 17.98 ? 13 ARG B CB    1 
ATOM   595  C  CG    . ARG B 1 13 ? -6.432  -64.182 -1.679  1.00 19.54 ? 13 ARG B CG    1 
ATOM   596  C  CD    . ARG B 1 13 ? -7.940  -64.163 -1.382  1.00 20.03 ? 13 ARG B CD    1 
ATOM   597  N  NE    . ARG B 1 13 ? -8.481  -62.801 -1.418  1.00 24.34 ? 13 ARG B NE    1 
ATOM   598  C  CZ    . ARG B 1 13 ? -8.447  -61.947 -0.389  1.00 26.26 ? 13 ARG B CZ    1 
ATOM   599  N  NH1   . ARG B 1 13 ? -7.901  -62.324 0.770   1.00 27.00 ? 13 ARG B NH1   1 
ATOM   600  N  NH2   . ARG B 1 13 ? -8.958  -60.715 -0.514  1.00 25.07 ? 13 ARG B NH2   1 
ATOM   601  N  N     . LYS B 1 14 ? -4.818  -65.508 -5.629  1.00 19.16 ? 14 LYS B N     1 
ATOM   602  C  CA    . LYS B 1 14 ? -4.526  -66.587 -6.563  1.00 20.05 ? 14 LYS B CA    1 
ATOM   603  C  C     . LYS B 1 14 ? -3.011  -66.840 -6.632  1.00 20.40 ? 14 LYS B C     1 
ATOM   604  O  O     . LYS B 1 14 ? -2.551  -67.979 -6.502  1.00 20.63 ? 14 LYS B O     1 
ATOM   605  C  CB    . LYS B 1 14 ? -5.135  -66.293 -7.944  1.00 20.15 ? 14 LYS B CB    1 
ATOM   606  C  CG    . LYS B 1 14 ? -4.603  -67.163 -9.062  1.00 22.25 ? 14 LYS B CG    1 
ATOM   607  C  CD    . LYS B 1 14 ? -5.700  -67.864 -9.875  1.00 24.74 ? 14 LYS B CD    1 
ATOM   608  C  CE    . LYS B 1 14 ? -5.241  -69.290 -10.214 1.00 25.88 ? 14 LYS B CE    1 
ATOM   609  N  NZ    . LYS B 1 14 ? -5.713  -69.762 -11.546 1.00 27.02 ? 14 LYS B NZ    1 
ATOM   610  N  N     . LEU B 1 15 ? -2.241  -65.771 -6.792  1.00 20.98 ? 15 LEU B N     1 
ATOM   611  C  CA    . LEU B 1 15 ? -0.789  -65.877 -6.843  1.00 21.71 ? 15 LEU B CA    1 
ATOM   612  C  C     . LEU B 1 15 ? -0.139  -66.312 -5.519  1.00 22.25 ? 15 LEU B C     1 
ATOM   613  O  O     . LEU B 1 15 ? 0.880   -66.993 -5.530  1.00 21.73 ? 15 LEU B O     1 
ATOM   614  C  CB    . LEU B 1 15 ? -0.184  -64.569 -7.341  1.00 21.64 ? 15 LEU B CB    1 
ATOM   615  C  CG    . LEU B 1 15 ? -0.443  -64.245 -8.811  1.00 21.52 ? 15 LEU B CG    1 
ATOM   616  C  CD1   . LEU B 1 15 ? 0.059   -62.859 -9.105  1.00 22.65 ? 15 LEU B CD1   1 
ATOM   617  C  CD2   . LEU B 1 15 ? 0.238   -65.245 -9.713  1.00 22.00 ? 15 LEU B CD2   1 
ATOM   618  N  N     . GLU B 1 16 ? -0.725  -65.912 -4.391  1.00 23.34 ? 16 GLU B N     1 
ATOM   619  C  CA    . GLU B 1 16 ? -0.301  -66.421 -3.092  1.00 24.74 ? 16 GLU B CA    1 
ATOM   620  C  C     . GLU B 1 16 ? -0.526  -67.933 -3.016  1.00 25.85 ? 16 GLU B C     1 
ATOM   621  O  O     . GLU B 1 16 ? 0.329   -68.656 -2.504  1.00 25.82 ? 16 GLU B O     1 
ATOM   622  C  CB    . GLU B 1 16 ? -1.014  -65.707 -1.943  1.00 24.38 ? 16 GLU B CB    1 
ATOM   623  C  CG    . GLU B 1 16 ? -0.237  -64.538 -1.359  1.00 25.59 ? 16 GLU B CG    1 
ATOM   624  C  CD    . GLU B 1 16 ? -1.139  -63.489 -0.692  1.00 28.17 ? 16 GLU B CD    1 
ATOM   625  O  OE1   . GLU B 1 16 ? -2.378  -63.574 -0.869  1.00 28.99 ? 16 GLU B OE1   1 
ATOM   626  O  OE2   . GLU B 1 16 ? -0.617  -62.572 0.002   1.00 28.26 ? 16 GLU B OE2   1 
ATOM   627  N  N     . ARG B 1 17 ? -1.659  -68.402 -3.540  1.00 27.13 ? 17 ARG B N     1 
ATOM   628  C  CA    . ARG B 1 17 ? -1.958  -69.829 -3.573  1.00 28.67 ? 17 ARG B CA    1 
ATOM   629  C  C     . ARG B 1 17 ? -0.920  -70.573 -4.411  1.00 29.42 ? 17 ARG B C     1 
ATOM   630  O  O     . ARG B 1 17 ? -0.335  -71.563 -3.961  1.00 29.21 ? 17 ARG B O     1 
ATOM   631  C  CB    . ARG B 1 17 ? -3.363  -70.089 -4.128  1.00 28.53 ? 17 ARG B CB    1 
ATOM   632  C  CG    . ARG B 1 17 ? -4.512  -70.030 -3.107  1.00 29.58 ? 17 ARG B CG    1 
ATOM   633  C  CD    . ARG B 1 17 ? -5.780  -70.739 -3.637  1.00 30.17 ? 17 ARG B CD    1 
ATOM   634  N  NE    . ARG B 1 17 ? -6.336  -70.070 -4.818  1.00 33.57 ? 17 ARG B NE    1 
ATOM   635  C  CZ    . ARG B 1 17 ? -7.238  -69.082 -4.786  1.00 34.92 ? 17 ARG B CZ    1 
ATOM   636  N  NH1   . ARG B 1 17 ? -7.735  -68.640 -3.634  1.00 34.98 ? 17 ARG B NH1   1 
ATOM   637  N  NH2   . ARG B 1 17 ? -7.656  -68.534 -5.922  1.00 35.23 ? 17 ARG B NH2   1 
HETATM 638  N  N     . MSE B 1 18 ? -0.682  -70.078 -5.622  1.00 30.27 ? 18 MSE B N     1 
HETATM 639  C  CA    . MSE B 1 18 ? 0.264   -70.702 -6.541  1.00 32.67 ? 18 MSE B CA    1 
HETATM 640  C  C     . MSE B 1 18 ? 1.673   -70.772 -5.990  1.00 29.68 ? 18 MSE B C     1 
HETATM 641  O  O     . MSE B 1 18 ? 2.404   -71.708 -6.267  1.00 29.82 ? 18 MSE B O     1 
HETATM 642  C  CB    . MSE B 1 18 ? 0.312   -69.928 -7.843  1.00 32.23 ? 18 MSE B CB    1 
HETATM 643  C  CG    . MSE B 1 18 ? -1.034  -69.696 -8.489  1.00 36.49 ? 18 MSE B CG    1 
HETATM 644  SE SE    . MSE B 1 18 ? -0.760  -68.976 -10.292 1.00 43.32 ? 18 MSE B SE    1 
HETATM 645  C  CE    . MSE B 1 18 ? 0.205   -70.562 -10.998 1.00 42.14 ? 18 MSE B CE    1 
ATOM   646  N  N     . ASN B 1 19 ? 2.052   -69.751 -5.234  1.00 27.94 ? 19 ASN B N     1 
ATOM   647  C  CA    . ASN B 1 19 ? 3.355   -69.670 -4.620  1.00 25.67 ? 19 ASN B CA    1 
ATOM   648  C  C     . ASN B 1 19 ? 3.519   -70.623 -3.448  1.00 24.93 ? 19 ASN B C     1 
ATOM   649  O  O     . ASN B 1 19 ? 4.616   -71.106 -3.240  1.00 25.09 ? 19 ASN B O     1 
ATOM   650  C  CB    . ASN B 1 19 ? 3.625   -68.234 -4.186  1.00 25.53 ? 19 ASN B CB    1 
ATOM   651  C  CG    . ASN B 1 19 ? 5.055   -68.005 -3.720  1.00 24.06 ? 19 ASN B CG    1 
ATOM   652  O  OD1   . ASN B 1 19 ? 6.026   -68.341 -4.412  1.00 20.99 ? 19 ASN B OD1   1 
ATOM   653  N  ND2   . ASN B 1 19 ? 5.187   -67.392 -2.545  1.00 22.44 ? 19 ASN B ND2   1 
ATOM   654  N  N     . GLN B 1 20 ? 2.459   -70.898 -2.680  1.00 23.91 ? 20 GLN B N     1 
ATOM   655  C  CA    . GLN B 1 20 ? 2.562   -71.912 -1.611  1.00 23.24 ? 20 GLN B CA    1 
ATOM   656  C  C     . GLN B 1 20 ? 2.783   -73.302 -2.225  1.00 22.28 ? 20 GLN B C     1 
ATOM   657  O  O     . GLN B 1 20 ? 3.512   -74.114 -1.669  1.00 21.90 ? 20 GLN B O     1 
ATOM   658  C  CB    . GLN B 1 20 ? 1.338   -71.983 -0.671  1.00 23.45 ? 20 GLN B CB    1 
ATOM   659  C  CG    . GLN B 1 20 ? 0.603   -70.687 -0.341  1.00 25.33 ? 20 GLN B CG    1 
ATOM   660  C  CD    . GLN B 1 20 ? 1.062   -70.009 0.941   1.00 26.91 ? 20 GLN B CD    1 
ATOM   661  O  OE1   . GLN B 1 20 ? 0.288   -69.879 1.903   1.00 27.79 ? 20 GLN B OE1   1 
ATOM   662  N  NE2   . GLN B 1 20 ? 2.314   -69.552 0.958   1.00 27.22 ? 20 GLN B NE2   1 
ATOM   663  N  N     . LYS B 1 21 ? 2.137   -73.558 -3.362  1.00 21.29 ? 21 LYS B N     1 
ATOM   664  C  CA    . LYS B 1 21 ? 2.211   -74.843 -4.055  1.00 20.45 ? 21 LYS B CA    1 
ATOM   665  C  C     . LYS B 1 21 ? 3.578   -75.025 -4.684  1.00 19.74 ? 21 LYS B C     1 
ATOM   666  O  O     . LYS B 1 21 ? 4.051   -76.153 -4.819  1.00 19.81 ? 21 LYS B O     1 
ATOM   667  C  CB    . LYS B 1 21 ? 1.134   -74.956 -5.151  1.00 20.78 ? 21 LYS B CB    1 
ATOM   668  C  CG    . LYS B 1 21 ? -0.317  -74.716 -4.695  1.00 21.76 ? 21 LYS B CG    1 
ATOM   669  C  CD    . LYS B 1 21 ? -1.010  -76.010 -4.290  1.00 24.02 ? 21 LYS B CD    1 
ATOM   670  C  CE    . LYS B 1 21 ? -1.944  -75.823 -3.095  1.00 25.68 ? 21 LYS B CE    1 
ATOM   671  N  NZ    . LYS B 1 21 ? -2.062  -77.113 -2.326  1.00 26.53 ? 21 LYS B NZ    1 
ATOM   672  N  N     . LYS B 1 22 ? 4.212   -73.924 -5.079  1.00 18.71 ? 22 LYS B N     1 
ATOM   673  C  CA    . LYS B 1 22 ? 5.579   -74.001 -5.595  1.00 17.99 ? 22 LYS B CA    1 
ATOM   674  C  C     . LYS B 1 22 ? 6.552   -74.328 -4.478  1.00 16.59 ? 22 LYS B C     1 
ATOM   675  O  O     . LYS B 1 22 ? 7.416   -75.181 -4.647  1.00 16.83 ? 22 LYS B O     1 
ATOM   676  C  CB    . LYS B 1 22 ? 5.999   -72.726 -6.322  1.00 18.44 ? 22 LYS B CB    1 
ATOM   677  C  CG    . LYS B 1 22 ? 5.392   -72.588 -7.695  1.00 20.88 ? 22 LYS B CG    1 
ATOM   678  C  CD    . LYS B 1 22 ? 6.129   -71.569 -8.562  1.00 25.61 ? 22 LYS B CD    1 
ATOM   679  C  CE    . LYS B 1 22 ? 5.535   -71.594 -9.991  1.00 28.64 ? 22 LYS B CE    1 
ATOM   680  N  NZ    . LYS B 1 22 ? 6.180   -70.602 -10.914 1.00 30.28 ? 22 LYS B NZ    1 
ATOM   681  N  N     . GLN B 1 23 ? 6.397   -73.660 -3.339  1.00 14.96 ? 23 GLN B N     1 
ATOM   682  C  CA    . GLN B 1 23 ? 7.174   -73.968 -2.143  1.00 13.73 ? 23 GLN B CA    1 
ATOM   683  C  C     . GLN B 1 23 ? 6.942   -75.392 -1.631  1.00 12.72 ? 23 GLN B C     1 
ATOM   684  O  O     . GLN B 1 23 ? 7.845   -76.028 -1.098  1.00 12.61 ? 23 GLN B O     1 
ATOM   685  C  CB    . GLN B 1 23 ? 6.846   -72.979 -1.043  1.00 13.56 ? 23 GLN B CB    1 
ATOM   686  C  CG    . GLN B 1 23 ? 7.115   -71.548 -1.406  1.00 14.62 ? 23 GLN B CG    1 
ATOM   687  C  CD    . GLN B 1 23 ? 6.868   -70.625 -0.240  1.00 17.07 ? 23 GLN B CD    1 
ATOM   688  O  OE1   . GLN B 1 23 ? 5.813   -70.666 0.398   1.00 18.50 ? 23 GLN B OE1   1 
ATOM   689  N  NE2   . GLN B 1 23 ? 7.852   -69.794 0.066   1.00 17.75 ? 23 GLN B NE2   1 
ATOM   690  N  N     . ALA B 1 24 ? 5.727   -75.893 -1.802  1.00 11.90 ? 24 ALA B N     1 
ATOM   691  C  CA    . ALA B 1 24 ? 5.380   -77.226 -1.357  1.00 11.16 ? 24 ALA B CA    1 
ATOM   692  C  C     . ALA B 1 24 ? 6.125   -78.224 -2.210  1.00 11.18 ? 24 ALA B C     1 
ATOM   693  O  O     . ALA B 1 24 ? 6.623   -79.217 -1.708  1.00 11.23 ? 24 ALA B O     1 
ATOM   694  C  CB    . ALA B 1 24 ? 3.899   -77.446 -1.445  1.00 10.42 ? 24 ALA B CB    1 
ATOM   695  N  N     . GLN B 1 25 ? 6.223   -77.942 -3.501  1.00 11.42 ? 25 GLN B N     1 
ATOM   696  C  CA    . GLN B 1 25 ? 6.956   -78.811 -4.404  1.00 11.59 ? 25 GLN B CA    1 
ATOM   697  C  C     . GLN B 1 25 ? 8.463   -78.824 -4.144  1.00 11.18 ? 25 GLN B C     1 
ATOM   698  O  O     . GLN B 1 25 ? 9.069   -79.884 -4.146  1.00 11.40 ? 25 GLN B O     1 
ATOM   699  C  CB    . GLN B 1 25 ? 6.645   -78.450 -5.836  1.00 11.45 ? 25 GLN B CB    1 
ATOM   700  C  CG    . GLN B 1 25 ? 5.268   -78.886 -6.188  1.00 14.85 ? 25 GLN B CG    1 
ATOM   701  C  CD    . GLN B 1 25 ? 4.685   -78.127 -7.361  1.00 21.04 ? 25 GLN B CD    1 
ATOM   702  O  OE1   . GLN B 1 25 ? 5.397   -77.403 -8.078  1.00 23.67 ? 25 GLN B OE1   1 
ATOM   703  N  NE2   . GLN B 1 25 ? 3.366   -78.277 -7.562  1.00 23.21 ? 25 GLN B NE2   1 
ATOM   704  N  N     . ARG B 1 26 ? 9.073   -77.670 -3.918  1.00 10.80 ? 26 ARG B N     1 
ATOM   705  C  CA    . ARG B 1 26 ? 10.478  -77.669 -3.546  1.00 11.12 ? 26 ARG B CA    1 
ATOM   706  C  C     . ARG B 1 26 ? 10.715  -78.517 -2.331  1.00 10.86 ? 26 ARG B C     1 
ATOM   707  O  O     . ARG B 1 26 ? 11.682  -79.282 -2.293  1.00 10.85 ? 26 ARG B O     1 
ATOM   708  C  CB    . ARG B 1 26 ? 10.973  -76.279 -3.218  1.00 11.45 ? 26 ARG B CB    1 
ATOM   709  C  CG    . ARG B 1 26 ? 11.475  -75.600 -4.406  1.00 13.30 ? 26 ARG B CG    1 
ATOM   710  C  CD    . ARG B 1 26 ? 12.433  -74.513 -4.061  1.00 14.32 ? 26 ARG B CD    1 
ATOM   711  N  NE    . ARG B 1 26 ? 12.292  -73.513 -5.104  1.00 15.21 ? 26 ARG B NE    1 
ATOM   712  C  CZ    . ARG B 1 26 ? 12.917  -73.550 -6.274  1.00 14.05 ? 26 ARG B CZ    1 
ATOM   713  N  NH1   . ARG B 1 26 ? 13.772  -74.525 -6.565  1.00 13.02 ? 26 ARG B NH1   1 
ATOM   714  N  NH2   . ARG B 1 26 ? 12.680  -72.590 -7.148  1.00 13.95 ? 26 ARG B NH2   1 
ATOM   715  N  N     . LYS B 1 27 ? 9.852   -78.365 -1.328  1.00 10.14 ? 27 LYS B N     1 
ATOM   716  C  CA    . LYS B 1 27 ? 10.064  -79.054 -0.081  1.00 10.03 ? 27 LYS B CA    1 
ATOM   717  C  C     . LYS B 1 27 ? 10.025  -80.549 -0.347  1.00 9.98  ? 27 LYS B C     1 
ATOM   718  O  O     . LYS B 1 27 ? 10.913  -81.278 0.071   1.00 9.96  ? 27 LYS B O     1 
ATOM   719  C  CB    . LYS B 1 27 ? 9.024   -78.647 0.961   1.00 10.30 ? 27 LYS B CB    1 
ATOM   720  C  CG    . LYS B 1 27 ? 9.333   -79.157 2.353   1.00 9.83  ? 27 LYS B CG    1 
ATOM   721  C  CD    . LYS B 1 27 ? 8.059   -79.394 3.118   1.00 10.85 ? 27 LYS B CD    1 
ATOM   722  C  CE    . LYS B 1 27 ? 8.358   -79.878 4.529   1.00 11.35 ? 27 LYS B CE    1 
ATOM   723  N  NZ    . LYS B 1 27 ? 7.339   -79.378 5.482   1.00 10.47 ? 27 LYS B NZ    1 
ATOM   724  N  N     . ARG B 1 28 ? 9.010   -80.999 -1.073  1.00 9.94  ? 28 ARG B N     1 
ATOM   725  C  CA    . ARG B 1 28 ? 8.887   -82.401 -1.369  1.00 10.33 ? 28 ARG B CA    1 
ATOM   726  C  C     . ARG B 1 28 ? 10.083  -82.892 -2.159  1.00 11.29 ? 28 ARG B C     1 
ATOM   727  O  O     . ARG B 1 28 ? 10.679  -83.905 -1.806  1.00 12.12 ? 28 ARG B O     1 
ATOM   728  C  CB    . ARG B 1 28 ? 7.575   -82.708 -2.081  1.00 9.91  ? 28 ARG B CB    1 
ATOM   729  C  CG    . ARG B 1 28 ? 6.432   -82.865 -1.100  1.00 9.38  ? 28 ARG B CG    1 
ATOM   730  C  CD    . ARG B 1 28 ? 5.228   -83.561 -1.679  1.00 8.31  ? 28 ARG B CD    1 
ATOM   731  N  NE    . ARG B 1 28 ? 4.859   -83.044 -2.988  1.00 8.68  ? 28 ARG B NE    1 
ATOM   732  C  CZ    . ARG B 1 28 ? 4.211   -81.907 -3.215  1.00 8.32  ? 28 ARG B CZ    1 
ATOM   733  N  NH1   . ARG B 1 28 ? 3.841   -81.109 -2.217  1.00 7.15  ? 28 ARG B NH1   1 
ATOM   734  N  NH2   . ARG B 1 28 ? 3.946   -81.569 -4.467  1.00 10.57 ? 28 ARG B NH2   1 
ATOM   735  N  N     . HIS B 1 29 ? 10.448  -82.164 -3.208  1.00 11.85 ? 29 HIS B N     1 
ATOM   736  C  CA    . HIS B 1 29 ? 11.600  -82.514 -4.012  1.00 12.49 ? 29 HIS B CA    1 
ATOM   737  C  C     . HIS B 1 29 ? 12.891  -82.448 -3.172  1.00 12.73 ? 29 HIS B C     1 
ATOM   738  O  O     . HIS B 1 29 ? 13.701  -83.370 -3.207  1.00 13.01 ? 29 HIS B O     1 
ATOM   739  C  CB    . HIS B 1 29 ? 11.669  -81.608 -5.246  1.00 12.61 ? 29 HIS B CB    1 
ATOM   740  C  CG    . HIS B 1 29 ? 12.592  -82.104 -6.314  1.00 14.75 ? 29 HIS B CG    1 
ATOM   741  N  ND1   . HIS B 1 29 ? 13.150  -81.269 -7.261  1.00 16.62 ? 29 HIS B ND1   1 
ATOM   742  C  CD2   . HIS B 1 29 ? 13.069  -83.346 -6.580  1.00 16.63 ? 29 HIS B CD2   1 
ATOM   743  C  CE1   . HIS B 1 29 ? 13.929  -81.977 -8.065  1.00 16.87 ? 29 HIS B CE1   1 
ATOM   744  N  NE2   . HIS B 1 29 ? 13.898  -83.240 -7.673  1.00 16.91 ? 29 HIS B NE2   1 
ATOM   745  N  N     . LYS B 1 30 ? 13.072  -81.378 -2.402  1.00 12.55 ? 30 LYS B N     1 
ATOM   746  C  CA    . LYS B 1 30 ? 14.282  -81.225 -1.595  1.00 12.81 ? 30 LYS B CA    1 
ATOM   747  C  C     . LYS B 1 30 ? 14.467  -82.432 -0.647  1.00 12.65 ? 30 LYS B C     1 
ATOM   748  O  O     . LYS B 1 30 ? 15.528  -83.069 -0.637  1.00 12.76 ? 30 LYS B O     1 
ATOM   749  C  CB    . LYS B 1 30 ? 14.254  -79.894 -0.816  1.00 12.58 ? 30 LYS B CB    1 
ATOM   750  C  CG    . LYS B 1 30 ? 15.558  -79.492 -0.110  1.00 12.61 ? 30 LYS B CG    1 
ATOM   751  C  CD    . LYS B 1 30 ? 15.315  -78.373 0.921   1.00 13.53 ? 30 LYS B CD    1 
ATOM   752  C  CE    . LYS B 1 30 ? 14.803  -78.951 2.251   1.00 16.88 ? 30 LYS B CE    1 
ATOM   753  N  NZ    . LYS B 1 30 ? 13.784  -78.128 3.005   1.00 18.19 ? 30 LYS B NZ    1 
ATOM   754  N  N     . LEU B 1 31 ? 13.426  -82.740 0.127   1.00 12.19 ? 31 LEU B N     1 
ATOM   755  C  CA    . LEU B 1 31 ? 13.462  -83.827 1.099   1.00 11.60 ? 31 LEU B CA    1 
ATOM   756  C  C     . LEU B 1 31 ? 13.698  -85.172 0.413   1.00 11.31 ? 31 LEU B C     1 
ATOM   757  O  O     . LEU B 1 31 ? 14.481  -85.995 0.914   1.00 11.18 ? 31 LEU B O     1 
ATOM   758  C  CB    . LEU B 1 31 ? 12.163  -83.880 1.925   1.00 11.41 ? 31 LEU B CB    1 
ATOM   759  C  CG    . LEU B 1 31 ? 11.786  -82.684 2.801   1.00 11.20 ? 31 LEU B CG    1 
ATOM   760  C  CD1   . LEU B 1 31 ? 10.596  -83.023 3.691   1.00 12.00 ? 31 LEU B CD1   1 
ATOM   761  C  CD2   . LEU B 1 31 ? 12.951  -82.196 3.643   1.00 11.38 ? 31 LEU B CD2   1 
ATOM   762  N  N     . ASN B 1 32 ? 13.026  -85.387 -0.720  1.00 10.46 ? 32 ASN B N     1 
ATOM   763  C  CA    . ASN B 1 32 ? 13.224  -86.589 -1.506  1.00 10.47 ? 32 ASN B CA    1 
ATOM   764  C  C     . ASN B 1 32 ? 14.689  -86.786 -1.856  1.00 10.90 ? 32 ASN B C     1 
ATOM   765  O  O     . ASN B 1 32 ? 15.210  -87.895 -1.751  1.00 11.70 ? 32 ASN B O     1 
ATOM   766  C  CB    . ASN B 1 32 ? 12.390  -86.563 -2.788  1.00 10.65 ? 32 ASN B CB    1 
ATOM   767  C  CG    . ASN B 1 32 ? 10.906  -86.782 -2.532  1.00 9.73  ? 32 ASN B CG    1 
ATOM   768  O  OD1   . ASN B 1 32 ? 10.501  -87.152 -1.432  1.00 7.86  ? 32 ASN B OD1   1 
ATOM   769  N  ND2   . ASN B 1 32 ? 10.090  -86.537 -3.551  1.00 8.32  ? 32 ASN B ND2   1 
ATOM   770  N  N     . ARG B 1 33 ? 15.357  -85.713 -2.259  1.00 10.87 ? 33 ARG B N     1 
ATOM   771  C  CA    . ARG B 1 33 ? 16.760  -85.797 -2.585  1.00 11.00 ? 33 ARG B CA    1 
ATOM   772  C  C     . ARG B 1 33 ? 17.587  -86.121 -1.357  1.00 11.58 ? 33 ARG B C     1 
ATOM   773  O  O     . ARG B 1 33 ? 18.524  -86.889 -1.459  1.00 11.74 ? 33 ARG B O     1 
ATOM   774  C  CB    . ARG B 1 33 ? 17.277  -84.503 -3.189  1.00 11.16 ? 33 ARG B CB    1 
ATOM   775  C  CG    . ARG B 1 33 ? 16.396  -83.831 -4.220  1.00 10.71 ? 33 ARG B CG    1 
ATOM   776  C  CD    . ARG B 1 33 ? 17.160  -82.640 -4.776  1.00 8.85  ? 33 ARG B CD    1 
ATOM   777  N  NE    . ARG B 1 33 ? 17.374  -82.810 -6.200  1.00 5.96  ? 33 ARG B NE    1 
ATOM   778  C  CZ    . ARG B 1 33 ? 18.468  -82.464 -6.868  1.00 3.34  ? 33 ARG B CZ    1 
ATOM   779  N  NH1   . ARG B 1 33 ? 19.524  -81.932 -6.260  1.00 2.00  ? 33 ARG B NH1   1 
ATOM   780  N  NH2   . ARG B 1 33 ? 18.489  -82.684 -8.176  1.00 4.45  ? 33 ARG B NH2   1 
ATOM   781  N  N     . LYS B 1 34 ? 17.266  -85.519 -0.210  1.00 12.43 ? 34 LYS B N     1 
ATOM   782  C  CA    . LYS B 1 34 ? 17.967  -85.817 1.047   1.00 13.29 ? 34 LYS B CA    1 
ATOM   783  C  C     . LYS B 1 34 ? 17.943  -87.315 1.369   1.00 13.03 ? 34 LYS B C     1 
ATOM   784  O  O     . LYS B 1 34 ? 18.964  -87.897 1.734   1.00 12.60 ? 34 LYS B O     1 
ATOM   785  C  CB    . LYS B 1 34 ? 17.369  -85.053 2.230   1.00 13.60 ? 34 LYS B CB    1 
ATOM   786  C  CG    . LYS B 1 34 ? 18.053  -83.752 2.577   1.00 17.17 ? 34 LYS B CG    1 
ATOM   787  C  CD    . LYS B 1 34 ? 17.819  -83.387 4.067   1.00 20.71 ? 34 LYS B CD    1 
ATOM   788  C  CE    . LYS B 1 34 ? 17.708  -81.857 4.284   1.00 22.33 ? 34 LYS B CE    1 
ATOM   789  N  NZ    . LYS B 1 34 ? 17.969  -81.425 5.708   1.00 21.21 ? 34 LYS B NZ    1 
ATOM   790  N  N     . GLU B 1 35 ? 16.776  -87.933 1.238   1.00 13.15 ? 35 GLU B N     1 
ATOM   791  C  CA    . GLU B 1 35 ? 16.648  -89.349 1.550   1.00 13.73 ? 35 GLU B CA    1 
ATOM   792  C  C     . GLU B 1 35 ? 17.602  -90.172 0.711   1.00 13.73 ? 35 GLU B C     1 
ATOM   793  O  O     . GLU B 1 35 ? 18.273  -91.057 1.234   1.00 14.81 ? 35 GLU B O     1 
ATOM   794  C  CB    . GLU B 1 35 ? 15.219  -89.836 1.353   1.00 13.80 ? 35 GLU B CB    1 
ATOM   795  C  CG    . GLU B 1 35 ? 14.292  -89.385 2.480   1.00 15.11 ? 35 GLU B CG    1 
ATOM   796  C  CD    . GLU B 1 35 ? 12.851  -89.448 2.091   1.00 16.22 ? 35 GLU B CD    1 
ATOM   797  O  OE1   . GLU B 1 35 ? 12.561  -89.981 1.001   1.00 18.20 ? 35 GLU B OE1   1 
ATOM   798  O  OE2   . GLU B 1 35 ? 12.009  -88.952 2.859   1.00 18.38 ? 35 GLU B OE2   1 
ATOM   799  N  N     . ARG B 1 36 ? 17.691  -89.860 -0.576  1.00 12.94 ? 36 ARG B N     1 
ATOM   800  C  CA    . ARG B 1 36 ? 18.544  -90.604 -1.473  1.00 12.01 ? 36 ARG B CA    1 
ATOM   801  C  C     . ARG B 1 36 ? 20.000  -90.158 -1.384  1.00 11.53 ? 36 ARG B C     1 
ATOM   802  O  O     . ARG B 1 36 ? 20.857  -90.728 -2.039  1.00 11.68 ? 36 ARG B O     1 
ATOM   803  C  CB    . ARG B 1 36 ? 18.027  -90.462 -2.900  1.00 12.28 ? 36 ARG B CB    1 
ATOM   804  C  CG    . ARG B 1 36 ? 16.708  -91.184 -3.166  1.00 12.44 ? 36 ARG B CG    1 
ATOM   805  C  CD    . ARG B 1 36 ? 16.234  -90.984 -4.621  1.00 11.92 ? 36 ARG B CD    1 
ATOM   806  N  NE    . ARG B 1 36 ? 15.581  -89.689 -4.822  1.00 10.56 ? 36 ARG B NE    1 
ATOM   807  C  CZ    . ARG B 1 36 ? 16.050  -88.702 -5.584  1.00 9.60  ? 36 ARG B CZ    1 
ATOM   808  N  NH1   . ARG B 1 36 ? 17.194  -88.820 -6.241  1.00 9.02  ? 36 ARG B NH1   1 
ATOM   809  N  NH2   . ARG B 1 36 ? 15.366  -87.580 -5.688  1.00 9.85  ? 36 ARG B NH2   1 
ATOM   810  N  N     . GLY B 1 37 ? 20.279  -89.141 -0.579  1.00 11.10 ? 37 GLY B N     1 
ATOM   811  C  CA    . GLY B 1 37 ? 21.624  -88.565 -0.485  1.00 10.74 ? 37 GLY B CA    1 
ATOM   812  C  C     . GLY B 1 37 ? 22.116  -87.908 -1.765  1.00 10.98 ? 37 GLY B C     1 
ATOM   813  O  O     . GLY B 1 37 ? 23.315  -87.862 -2.017  1.00 11.15 ? 37 GLY B O     1 
ATOM   814  N  N     . HIS B 1 38 ? 21.194  -87.388 -2.572  1.00 11.19 ? 38 HIS B N     1 
ATOM   815  C  CA    . HIS B 1 38 ? 21.528  -86.825 -3.873  1.00 11.61 ? 38 HIS B CA    1 
ATOM   816  C  C     . HIS B 1 38 ? 21.750  -85.300 -3.834  1.00 11.90 ? 38 HIS B C     1 
ATOM   817  O  O     . HIS B 1 38 ? 20.881  -84.546 -3.389  1.00 12.10 ? 38 HIS B O     1 
ATOM   818  C  CB    . HIS B 1 38 ? 20.430  -87.201 -4.875  1.00 11.72 ? 38 HIS B CB    1 
ATOM   819  C  CG    . HIS B 1 38 ? 20.642  -86.661 -6.261  1.00 12.50 ? 38 HIS B CG    1 
ATOM   820  N  ND1   . HIS B 1 38 ? 21.182  -87.416 -7.280  1.00 12.95 ? 38 HIS B ND1   1 
ATOM   821  C  CD2   . HIS B 1 38 ? 20.362  -85.450 -6.800  1.00 12.57 ? 38 HIS B CD2   1 
ATOM   822  C  CE1   . HIS B 1 38 ? 21.240  -86.689 -8.383  1.00 13.50 ? 38 HIS B CE1   1 
ATOM   823  N  NE2   . HIS B 1 38 ? 20.746  -85.492 -8.119  1.00 13.33 ? 38 HIS B NE2   1 
ATOM   824  N  N     . LYS B 1 39 ? 22.917  -84.861 -4.304  1.00 12.06 ? 39 LYS B N     1 
ATOM   825  C  CA    . LYS B 1 39 ? 23.211  -83.444 -4.513  1.00 12.25 ? 39 LYS B CA    1 
ATOM   826  C  C     . LYS B 1 39 ? 23.473  -83.183 -5.985  1.00 12.69 ? 39 LYS B C     1 
ATOM   827  O  O     . LYS B 1 39 ? 23.986  -84.043 -6.688  1.00 13.10 ? 39 LYS B O     1 
ATOM   828  C  CB    . LYS B 1 39 ? 24.450  -83.025 -3.735  1.00 12.11 ? 39 LYS B CB    1 
ATOM   829  C  CG    . LYS B 1 39 ? 24.326  -83.174 -2.245  1.00 12.59 ? 39 LYS B CG    1 
ATOM   830  C  CD    . LYS B 1 39 ? 25.294  -82.267 -1.512  1.00 13.18 ? 39 LYS B CD    1 
ATOM   831  C  CE    . LYS B 1 39 ? 25.433  -82.705 -0.065  1.00 14.18 ? 39 LYS B CE    1 
ATOM   832  N  NZ    . LYS B 1 39 ? 24.092  -83.007 0.509   1.00 14.09 ? 39 LYS B NZ    1 
ATOM   833  N  N     . SER B 1 40 ? 23.128  -81.993 -6.459  1.00 13.15 ? 40 SER B N     1 
ATOM   834  C  CA    . SER B 1 40 ? 23.562  -81.558 -7.781  1.00 13.20 ? 40 SER B CA    1 
ATOM   835  C  C     . SER B 1 40 ? 25.032  -81.208 -7.678  1.00 13.29 ? 40 SER B C     1 
ATOM   836  O  O     . SER B 1 40 ? 25.515  -80.926 -6.583  1.00 13.58 ? 40 SER B O     1 
ATOM   837  C  CB    . SER B 1 40 ? 22.776  -80.323 -8.213  1.00 13.45 ? 40 SER B CB    1 
ATOM   838  O  OG    . SER B 1 40 ? 23.006  -79.228 -7.332  1.00 12.95 ? 40 SER B OG    1 
ATOM   839  N  N     . PRO B 1 41 ? 25.763  -81.248 -8.801  1.00 13.55 ? 41 PRO B N     1 
ATOM   840  C  CA    . PRO B 1 41 ? 27.151  -80.784 -8.814  1.00 13.65 ? 41 PRO B CA    1 
ATOM   841  C  C     . PRO B 1 41 ? 27.380  -79.481 -8.048  1.00 13.95 ? 41 PRO B C     1 
ATOM   842  O  O     . PRO B 1 41 ? 28.340  -79.387 -7.286  1.00 13.43 ? 41 PRO B O     1 
ATOM   843  C  CB    . PRO B 1 41 ? 27.428  -80.592 -10.303 1.00 13.62 ? 41 PRO B CB    1 
ATOM   844  C  CG    . PRO B 1 41 ? 26.605  -81.654 -10.956 1.00 13.54 ? 41 PRO B CG    1 
ATOM   845  C  CD    . PRO B 1 41 ? 25.354  -81.779 -10.118 1.00 13.77 ? 41 PRO B CD    1 
ATOM   846  N  N     . SER B 1 42 ? 26.504  -78.493 -8.238  1.00 14.88 ? 42 SER B N     1 
ATOM   847  C  CA    . SER B 1 42 ? 26.660  -77.202 -7.555  1.00 15.87 ? 42 SER B CA    1 
ATOM   848  C  C     . SER B 1 42 ? 26.470  -77.313 -6.037  1.00 16.41 ? 42 SER B C     1 
ATOM   849  O  O     . SER B 1 42 ? 27.214  -76.706 -5.269  1.00 16.26 ? 42 SER B O     1 
ATOM   850  C  CB    . SER B 1 42 ? 25.736  -76.131 -8.155  1.00 15.69 ? 42 SER B CB    1 
ATOM   851  O  OG    . SER B 1 42 ? 24.464  -76.100 -7.520  1.00 16.52 ? 42 SER B OG    1 
ATOM   852  N  N     . GLU B 1 43 ? 25.474  -78.096 -5.624  1.00 17.60 ? 43 GLU B N     1 
ATOM   853  C  CA    . GLU B 1 43 ? 25.205  -78.367 -4.211  1.00 18.71 ? 43 GLU B CA    1 
ATOM   854  C  C     . GLU B 1 43 ? 26.394  -79.041 -3.522  1.00 19.53 ? 43 GLU B C     1 
ATOM   855  O  O     . GLU B 1 43 ? 26.656  -78.778 -2.347  1.00 19.75 ? 43 GLU B O     1 
ATOM   856  C  CB    . GLU B 1 43 ? 23.954  -79.230 -4.055  1.00 18.67 ? 43 GLU B CB    1 
ATOM   857  C  CG    . GLU B 1 43 ? 22.627  -78.511 -4.244  1.00 18.48 ? 43 GLU B CG    1 
ATOM   858  C  CD    . GLU B 1 43 ? 21.465  -79.479 -4.528  1.00 18.90 ? 43 GLU B CD    1 
ATOM   859  O  OE1   . GLU B 1 43 ? 21.084  -80.269 -3.627  1.00 17.04 ? 43 GLU B OE1   1 
ATOM   860  O  OE2   . GLU B 1 43 ? 20.926  -79.441 -5.662  1.00 19.49 ? 43 GLU B OE2   1 
ATOM   861  N  N     . GLN B 1 44 ? 27.103  -79.906 -4.251  1.00 20.56 ? 44 GLN B N     1 
ATOM   862  C  CA    . GLN B 1 44 ? 28.363  -80.493 -3.769  1.00 21.86 ? 44 GLN B CA    1 
ATOM   863  C  C     . GLN B 1 44 ? 29.451  -79.440 -3.536  1.00 22.49 ? 44 GLN B C     1 
ATOM   864  O  O     . GLN B 1 44 ? 30.026  -79.386 -2.446  1.00 22.70 ? 44 GLN B O     1 
ATOM   865  C  CB    . GLN B 1 44 ? 28.883  -81.570 -4.727  1.00 21.78 ? 44 GLN B CB    1 
ATOM   866  C  CG    . GLN B 1 44 ? 28.325  -82.959 -4.482  1.00 22.66 ? 44 GLN B CG    1 
ATOM   867  C  CD    . GLN B 1 44 ? 28.486  -83.885 -5.695  1.00 23.80 ? 44 GLN B CD    1 
ATOM   868  O  OE1   . GLN B 1 44 ? 27.969  -83.611 -6.785  1.00 24.34 ? 44 GLN B OE1   1 
ATOM   869  N  NE2   . GLN B 1 44 ? 29.196  -84.997 -5.499  1.00 24.97 ? 44 GLN B NE2   1 
ATOM   870  N  N     . ARG B 1 45 ? 29.733  -78.621 -4.556  1.00 23.49 ? 45 ARG B N     1 
ATOM   871  C  CA    . ARG B 1 45 ? 30.699  -77.521 -4.439  1.00 24.54 ? 45 ARG B CA    1 
ATOM   872  C  C     . ARG B 1 45 ? 30.423  -76.674 -3.209  1.00 25.00 ? 45 ARG B C     1 
ATOM   873  O  O     . ARG B 1 45 ? 31.299  -76.531 -2.346  1.00 25.22 ? 45 ARG B O     1 
ATOM   874  C  CB    . ARG B 1 45 ? 30.708  -76.637 -5.690  1.00 24.36 ? 45 ARG B CB    1 
ATOM   875  C  CG    . ARG B 1 45 ? 31.942  -76.812 -6.564  1.00 25.04 ? 45 ARG B CG    1 
ATOM   876  C  CD    . ARG B 1 45 ? 31.804  -76.138 -7.928  1.00 25.63 ? 45 ARG B CD    1 
ATOM   877  N  NE    . ARG B 1 45 ? 30.776  -76.766 -8.772  1.00 29.25 ? 45 ARG B NE    1 
ATOM   878  C  CZ    . ARG B 1 45 ? 30.624  -76.540 -10.081 1.00 30.31 ? 45 ARG B CZ    1 
ATOM   879  N  NH1   . ARG B 1 45 ? 31.445  -75.698 -10.713 1.00 30.58 ? 45 ARG B NH1   1 
ATOM   880  N  NH2   . ARG B 1 45 ? 29.656  -77.159 -10.762 1.00 28.89 ? 45 ARG B NH2   1 
ATOM   881  N  N     . ARG B 1 46 ? 29.197  -76.149 -3.125  1.00 25.59 ? 46 ARG B N     1 
ATOM   882  C  CA    . ARG B 1 46 ? 28.752  -75.313 -2.008  1.00 26.24 ? 46 ARG B CA    1 
ATOM   883  C  C     . ARG B 1 46 ? 29.018  -75.915 -0.638  1.00 27.08 ? 46 ARG B C     1 
ATOM   884  O  O     . ARG B 1 46 ? 29.499  -75.220 0.262   1.00 27.00 ? 46 ARG B O     1 
ATOM   885  C  CB    . ARG B 1 46 ? 27.264  -75.020 -2.121  1.00 26.15 ? 46 ARG B CB    1 
ATOM   886  C  CG    . ARG B 1 46 ? 26.920  -73.661 -2.695  1.00 25.97 ? 46 ARG B CG    1 
ATOM   887  C  CD    . ARG B 1 46 ? 25.448  -73.362 -2.464  1.00 25.08 ? 46 ARG B CD    1 
ATOM   888  N  NE    . ARG B 1 46 ? 24.593  -74.056 -3.423  1.00 23.69 ? 46 ARG B NE    1 
ATOM   889  C  CZ    . ARG B 1 46 ? 23.382  -74.524 -3.144  1.00 24.64 ? 46 ARG B CZ    1 
ATOM   890  N  NH1   . ARG B 1 46 ? 22.873  -74.392 -1.930  1.00 24.71 ? 46 ARG B NH1   1 
ATOM   891  N  NH2   . ARG B 1 46 ? 22.672  -75.140 -4.082  1.00 26.88 ? 46 ARG B NH2   1 
ATOM   892  N  N     . SER B 1 47 ? 28.694  -77.200 -0.483  1.00 28.18 ? 47 SER B N     1 
ATOM   893  C  CA    . SER B 1 47 ? 28.831  -77.879 0.804   1.00 29.23 ? 47 SER B CA    1 
ATOM   894  C  C     . SER B 1 47 ? 30.291  -78.153 1.151   1.00 29.80 ? 47 SER B C     1 
ATOM   895  O  O     . SER B 1 47 ? 30.664  -78.120 2.321   1.00 29.93 ? 47 SER B O     1 
ATOM   896  C  CB    . SER B 1 47 ? 28.024  -79.172 0.831   1.00 29.23 ? 47 SER B CB    1 
ATOM   897  O  OG    . SER B 1 47 ? 28.836  -80.291 0.522   1.00 30.38 ? 47 SER B OG    1 
ATOM   898  N  N     . GLU B 1 48 ? 31.111  -78.422 0.137   1.00 30.62 ? 48 GLU B N     1 
ATOM   899  C  CA    . GLU B 1 48 ? 32.548  -78.585 0.345   1.00 31.53 ? 48 GLU B CA    1 
ATOM   900  C  C     . GLU B 1 48 ? 33.189  -77.282 0.808   1.00 32.22 ? 48 GLU B C     1 
ATOM   901  O  O     . GLU B 1 48 ? 33.956  -77.272 1.772   1.00 32.24 ? 48 GLU B O     1 
ATOM   902  C  CB    . GLU B 1 48 ? 33.232  -79.067 -0.927  1.00 31.43 ? 48 GLU B CB    1 
ATOM   903  C  CG    . GLU B 1 48 ? 33.170  -80.556 -1.138  1.00 31.62 ? 48 GLU B CG    1 
ATOM   904  C  CD    . GLU B 1 48 ? 33.765  -80.959 -2.466  1.00 32.14 ? 48 GLU B CD    1 
ATOM   905  O  OE1   . GLU B 1 48 ? 34.916  -80.548 -2.746  1.00 32.60 ? 48 GLU B OE1   1 
ATOM   906  O  OE2   . GLU B 1 48 ? 33.083  -81.681 -3.231  1.00 31.94 ? 48 GLU B OE2   1 
ATOM   907  N  N     . LEU B 1 49 ? 32.863  -76.189 0.117   1.00 33.16 ? 49 LEU B N     1 
ATOM   908  C  CA    . LEU B 1 49 ? 33.395  -74.867 0.442   1.00 34.09 ? 49 LEU B CA    1 
ATOM   909  C  C     . LEU B 1 49 ? 32.975  -74.406 1.836   1.00 34.75 ? 49 LEU B C     1 
ATOM   910  O  O     . LEU B 1 49 ? 33.726  -73.692 2.510   1.00 34.82 ? 49 LEU B O     1 
ATOM   911  C  CB    . LEU B 1 49 ? 32.967  -73.829 -0.603  1.00 34.09 ? 49 LEU B CB    1 
ATOM   912  C  CG    . LEU B 1 49 ? 33.503  -73.886 -2.041  1.00 34.30 ? 49 LEU B CG    1 
ATOM   913  C  CD1   . LEU B 1 49 ? 33.053  -72.639 -2.806  1.00 34.07 ? 49 LEU B CD1   1 
ATOM   914  C  CD2   . LEU B 1 49 ? 35.023  -74.028 -2.100  1.00 34.21 ? 49 LEU B CD2   1 
ATOM   915  N  N     . TRP B 1 50 ? 31.779  -74.818 2.259   1.00 35.50 ? 50 TRP B N     1 
ATOM   916  C  CA    . TRP B 1 50 ? 31.294  -74.527 3.602   1.00 36.33 ? 50 TRP B CA    1 
ATOM   917  C  C     . TRP B 1 50 ? 32.063  -75.321 4.654   1.00 36.60 ? 50 TRP B C     1 
ATOM   918  O  O     . TRP B 1 50 ? 32.589  -74.739 5.609   1.00 36.61 ? 50 TRP B O     1 
ATOM   919  C  CB    . TRP B 1 50 ? 29.796  -74.809 3.724   1.00 36.85 ? 50 TRP B CB    1 
ATOM   920  C  CG    . TRP B 1 50 ? 29.214  -74.324 5.022   1.00 37.59 ? 50 TRP B CG    1 
ATOM   921  C  CD1   . TRP B 1 50 ? 28.777  -73.059 5.300   1.00 38.14 ? 50 TRP B CD1   1 
ATOM   922  C  CD2   . TRP B 1 50 ? 29.022  -75.087 6.224   1.00 38.42 ? 50 TRP B CD2   1 
ATOM   923  N  NE1   . TRP B 1 50 ? 28.319  -72.989 6.594   1.00 38.55 ? 50 TRP B NE1   1 
ATOM   924  C  CE2   . TRP B 1 50 ? 28.458  -74.217 7.185   1.00 38.66 ? 50 TRP B CE2   1 
ATOM   925  C  CE3   . TRP B 1 50 ? 29.274  -76.420 6.582   1.00 38.72 ? 50 TRP B CE3   1 
ATOM   926  C  CZ2   . TRP B 1 50 ? 28.132  -74.639 8.485   1.00 38.30 ? 50 TRP B CZ2   1 
ATOM   927  C  CZ3   . TRP B 1 50 ? 28.954  -76.839 7.881   1.00 38.31 ? 50 TRP B CZ3   1 
ATOM   928  C  CH2   . TRP B 1 50 ? 28.388  -75.949 8.812   1.00 38.04 ? 50 TRP B CH2   1 
ATOM   929  N  N     . HIS B 1 51 ? 32.121  -76.644 4.471   1.00 36.90 ? 51 HIS B N     1 
ATOM   930  C  CA    . HIS B 1 51 ? 32.847  -77.541 5.376   1.00 37.21 ? 51 HIS B CA    1 
ATOM   931  C  C     . HIS B 1 51 ? 34.330  -77.156 5.479   1.00 37.57 ? 51 HIS B C     1 
ATOM   932  O  O     . HIS B 1 51 ? 34.940  -77.319 6.537   1.00 37.42 ? 51 HIS B O     1 
ATOM   933  C  CB    . HIS B 1 51 ? 32.689  -79.010 4.952   1.00 37.08 ? 51 HIS B CB    1 
ATOM   934  C  CG    . HIS B 1 51 ? 31.355  -79.614 5.298   1.00 37.14 ? 51 HIS B CG    1 
ATOM   935  N  ND1   . HIS B 1 51 ? 30.921  -79.780 6.597   1.00 37.37 ? 51 HIS B ND1   1 
ATOM   936  C  CD2   . HIS B 1 51 ? 30.376  -80.125 4.512   1.00 36.85 ? 51 HIS B CD2   1 
ATOM   937  C  CE1   . HIS B 1 51 ? 29.727  -80.347 6.596   1.00 36.44 ? 51 HIS B CE1   1 
ATOM   938  N  NE2   . HIS B 1 51 ? 29.373  -80.565 5.343   1.00 36.43 ? 51 HIS B NE2   1 
ATOM   939  N  N     . ALA B 1 52 ? 34.886  -76.631 4.383   1.00 38.08 ? 52 ALA B N     1 
ATOM   940  C  CA    . ALA B 1 52 ? 36.257  -76.105 4.346   1.00 38.55 ? 52 ALA B CA    1 
ATOM   941  C  C     . ALA B 1 52 ? 36.429  -74.859 5.218   1.00 39.05 ? 52 ALA B C     1 
ATOM   942  O  O     . ALA B 1 52 ? 37.400  -74.764 5.972   1.00 39.21 ? 52 ALA B O     1 
ATOM   943  C  CB    . ALA B 1 52 ? 36.687  -75.813 2.908   1.00 38.37 ? 52 ALA B CB    1 
ATOM   944  N  N     . ARG B 1 53 ? 35.494  -73.911 5.110   1.00 39.68 ? 53 ARG B N     1 
ATOM   945  C  CA    . ARG B 1 53 ? 35.486  -72.695 5.944   1.00 40.27 ? 53 ARG B CA    1 
ATOM   946  C  C     . ARG B 1 53 ? 35.295  -73.015 7.429   1.00 40.38 ? 53 ARG B C     1 
ATOM   947  O  O     . ARG B 1 53 ? 35.863  -72.340 8.292   1.00 40.40 ? 53 ARG B O     1 
ATOM   948  C  CB    . ARG B 1 53 ? 34.375  -71.737 5.504   1.00 40.49 ? 53 ARG B CB    1 
ATOM   949  C  CG    . ARG B 1 53 ? 34.658  -70.908 4.255   1.00 41.43 ? 53 ARG B CG    1 
ATOM   950  C  CD    . ARG B 1 53 ? 33.374  -70.190 3.835   1.00 42.87 ? 53 ARG B CD    1 
ATOM   951  N  NE    . ARG B 1 53 ? 33.488  -69.435 2.583   1.00 44.11 ? 53 ARG B NE    1 
ATOM   952  C  CZ    . ARG B 1 53 ? 32.453  -69.091 1.806   1.00 44.90 ? 53 ARG B CZ    1 
ATOM   953  N  NH1   . ARG B 1 53 ? 31.202  -69.434 2.125   1.00 44.42 ? 53 ARG B NH1   1 
ATOM   954  N  NH2   . ARG B 1 53 ? 32.669  -68.403 0.691   1.00 45.16 ? 53 ARG B NH2   1 
ATOM   955  N  N     . GLN B 1 54 ? 34.489  -74.040 7.709   1.00 40.55 ? 54 GLN B N     1 
ATOM   956  C  CA    . GLN B 1 54 ? 34.187  -74.471 9.078   1.00 40.70 ? 54 GLN B CA    1 
ATOM   957  C  C     . GLN B 1 54 ? 35.351  -75.171 9.777   1.00 40.77 ? 54 GLN B C     1 
ATOM   958  O  O     . GLN B 1 54 ? 35.575  -74.951 10.967  1.00 40.75 ? 54 GLN B O     1 
ATOM   959  C  CB    . GLN B 1 54 ? 32.948  -75.371 9.096   1.00 40.72 ? 54 GLN B CB    1 
ATOM   960  C  CG    . GLN B 1 54 ? 31.628  -74.618 8.950   1.00 41.09 ? 54 GLN B CG    1 
ATOM   961  C  CD    . GLN B 1 54 ? 31.227  -73.861 10.208  1.00 41.15 ? 54 GLN B CD    1 
ATOM   962  O  OE1   . GLN B 1 54 ? 31.715  -74.146 11.300  1.00 42.12 ? 54 GLN B OE1   1 
ATOM   963  N  NE2   . GLN B 1 54 ? 30.335  -72.892 10.057  1.00 40.96 ? 54 GLN B NE2   1 
ATOM   964  N  N     . VAL B 1 55 ? 36.071  -76.016 9.038   1.00 40.95 ? 55 VAL B N     1 
ATOM   965  C  CA    . VAL B 1 55 ? 37.246  -76.737 9.550   1.00 41.11 ? 55 VAL B CA    1 
ATOM   966  C  C     . VAL B 1 55 ? 38.440  -75.780 9.733   1.00 41.30 ? 55 VAL B C     1 
ATOM   967  O  O     . VAL B 1 55 ? 39.280  -75.966 10.630  1.00 41.30 ? 55 VAL B O     1 
ATOM   968  C  CB    . VAL B 1 55 ? 37.616  -77.953 8.636   1.00 41.11 ? 55 VAL B CB    1 
ATOM   969  C  CG1   . VAL B 1 55 ? 38.951  -78.588 9.033   1.00 40.99 ? 55 VAL B CG1   1 
ATOM   970  C  CG2   . VAL B 1 55 ? 36.512  -79.009 8.669   1.00 41.24 ? 55 VAL B CG2   1 
ATOM   971  N  N     . GLU B 1 56 ? 38.491  -74.747 8.890   1.00 41.32 ? 56 GLU B N     1 
ATOM   972  C  CA    . GLU B 1 56 ? 39.525  -73.713 8.968   1.00 41.26 ? 56 GLU B CA    1 
ATOM   973  C  C     . GLU B 1 56 ? 39.417  -72.880 10.251  1.00 41.26 ? 56 GLU B C     1 
ATOM   974  O  O     . GLU B 1 56 ? 40.420  -72.352 10.737  1.00 41.27 ? 56 GLU B O     1 
ATOM   975  C  CB    . GLU B 1 56 ? 39.446  -72.807 7.742   1.00 41.22 ? 56 GLU B CB    1 
ATOM   976  C  CG    . GLU B 1 56 ? 40.746  -72.114 7.385   1.00 40.98 ? 56 GLU B CG    1 
ATOM   977  C  CD    . GLU B 1 56 ? 40.701  -71.476 6.008   1.00 40.90 ? 56 GLU B CD    1 
ATOM   978  O  OE1   . GLU B 1 56 ? 39.607  -71.061 5.565   1.00 40.83 ? 56 GLU B OE1   1 
ATOM   979  O  OE2   . GLU B 1 56 ? 41.764  -71.388 5.364   1.00 40.89 ? 56 GLU B OE2   1 
ATOM   980  N  N     . LEU B 1 57 ? 38.198  -72.767 10.783  1.00 41.24 ? 57 LEU B N     1 
ATOM   981  C  CA    . LEU B 1 57 ? 37.944  -72.071 12.049  1.00 41.16 ? 57 LEU B CA    1 
ATOM   982  C  C     . LEU B 1 57 ? 38.588  -72.795 13.235  1.00 41.11 ? 57 LEU B C     1 
ATOM   983  O  O     . LEU B 1 57 ? 39.318  -72.183 14.017  1.00 41.12 ? 57 LEU B O     1 
ATOM   984  C  CB    . LEU B 1 57 ? 36.434  -71.877 12.284  1.00 41.11 ? 57 LEU B CB    1 
ATOM   985  C  CG    . LEU B 1 57 ? 35.658  -70.857 11.432  1.00 41.06 ? 57 LEU B CG    1 
ATOM   986  C  CD1   . LEU B 1 57 ? 34.145  -70.996 11.629  1.00 40.23 ? 57 LEU B CD1   1 
ATOM   987  C  CD2   . LEU B 1 57 ? 36.108  -69.421 11.716  1.00 40.76 ? 57 LEU B CD2   1 
ATOM   988  N  N     . SER B 1 58 ? 38.326  -74.097 13.351  1.00 41.06 ? 58 SER B N     1 
ATOM   989  C  CA    . SER B 1 58 ? 38.887  -74.916 14.428  1.00 41.01 ? 58 SER B CA    1 
ATOM   990  C  C     . SER B 1 58 ? 40.337  -75.303 14.149  1.00 40.95 ? 58 SER B C     1 
ATOM   991  O  O     . SER B 1 58 ? 41.244  -74.929 14.894  1.00 40.87 ? 58 SER B O     1 
ATOM   992  C  CB    . SER B 1 58 ? 38.038  -76.172 14.649  1.00 40.98 ? 58 SER B CB    1 
ATOM   993  O  OG    . SER B 1 58 ? 37.966  -76.958 13.471  1.00 40.88 ? 58 SER B OG    1 
ATOM   994  P  P     . A   C 2 1  ? 26.265  -81.770 3.829   1.00 32.81 ? 1  A   C P     1 
ATOM   995  O  OP1   . A   C 2 1  ? 25.533  -82.925 3.258   1.00 32.31 ? 1  A   C OP1   1 
ATOM   996  O  OP2   . A   C 2 1  ? 27.654  -81.933 4.323   1.00 31.80 ? 1  A   C OP2   1 
ATOM   997  O  "O5'" . A   C 2 1  ? 25.353  -81.223 5.020   1.00 34.16 ? 1  A   C "O5'" 1 
ATOM   998  C  "C5'" . A   C 2 1  ? 25.725  -81.390 6.390   1.00 36.87 ? 1  A   C "C5'" 1 
ATOM   999  C  "C4'" . A   C 2 1  ? 25.193  -80.233 7.213   1.00 38.52 ? 1  A   C "C4'" 1 
ATOM   1000 O  "O4'" . A   C 2 1  ? 26.122  -79.120 7.174   1.00 39.54 ? 1  A   C "O4'" 1 
ATOM   1001 C  "C3'" . A   C 2 1  ? 23.917  -79.623 6.665   1.00 39.29 ? 1  A   C "C3'" 1 
ATOM   1002 O  "O3'" . A   C 2 1  ? 22.783  -80.406 7.003   1.00 39.53 ? 1  A   C "O3'" 1 
ATOM   1003 C  "C2'" . A   C 2 1  ? 23.935  -78.245 7.315   1.00 39.48 ? 1  A   C "C2'" 1 
ATOM   1004 O  "O2'" . A   C 2 1  ? 23.515  -78.270 8.664   1.00 39.00 ? 1  A   C "O2'" 1 
ATOM   1005 C  "C1'" . A   C 2 1  ? 25.412  -77.894 7.180   1.00 40.62 ? 1  A   C "C1'" 1 
ATOM   1006 N  N9    . A   C 2 1  ? 25.706  -77.166 5.944   1.00 41.37 ? 1  A   C N9    1 
ATOM   1007 C  C8    . A   C 2 1  ? 26.160  -77.688 4.760   1.00 41.62 ? 1  A   C C8    1 
ATOM   1008 N  N7    . A   C 2 1  ? 26.336  -76.802 3.806   1.00 41.87 ? 1  A   C N7    1 
ATOM   1009 C  C5    . A   C 2 1  ? 25.972  -75.610 4.407   1.00 41.96 ? 1  A   C C5    1 
ATOM   1010 C  C6    . A   C 2 1  ? 25.932  -74.286 3.923   1.00 41.62 ? 1  A   C C6    1 
ATOM   1011 N  N6    . A   C 2 1  ? 26.286  -73.958 2.675   1.00 41.15 ? 1  A   C N6    1 
ATOM   1012 N  N1    . A   C 2 1  ? 25.516  -73.320 4.779   1.00 41.62 ? 1  A   C N1    1 
ATOM   1013 C  C2    . A   C 2 1  ? 25.164  -73.661 6.032   1.00 41.45 ? 1  A   C C2    1 
ATOM   1014 N  N3    . A   C 2 1  ? 25.161  -74.869 6.599   1.00 41.31 ? 1  A   C N3    1 
ATOM   1015 C  C4    . A   C 2 1  ? 25.577  -75.810 5.726   1.00 41.76 ? 1  A   C C4    1 
ATOM   1016 P  P     . G   C 2 2  ? 21.370  -80.025 6.367   1.00 39.78 ? 2  G   C P     1 
ATOM   1017 O  OP1   . G   C 2 2  ? 20.406  -81.126 6.609   1.00 40.40 ? 2  G   C OP1   1 
ATOM   1018 O  OP2   . G   C 2 2  ? 21.588  -79.536 4.981   1.00 39.86 ? 2  G   C OP2   1 
ATOM   1019 O  "O5'" . G   C 2 2  ? 20.952  -78.804 7.304   1.00 38.71 ? 2  G   C "O5'" 1 
ATOM   1020 C  "C5'" . G   C 2 2  ? 19.898  -77.989 6.853   1.00 37.00 ? 2  G   C "C5'" 1 
ATOM   1021 C  "C4'" . G   C 2 2  ? 20.303  -76.533 6.904   1.00 34.97 ? 2  G   C "C4'" 1 
ATOM   1022 O  "O4'" . G   C 2 2  ? 21.568  -76.247 6.262   1.00 34.52 ? 2  G   C "O4'" 1 
ATOM   1023 C  "C3'" . G   C 2 2  ? 19.409  -75.646 6.088   1.00 33.25 ? 2  G   C "C3'" 1 
ATOM   1024 O  "O3'" . G   C 2 2  ? 18.104  -75.673 6.610   1.00 31.15 ? 2  G   C "O3'" 1 
ATOM   1025 C  "C2'" . G   C 2 2  ? 20.179  -74.339 6.240   1.00 33.34 ? 2  G   C "C2'" 1 
ATOM   1026 O  "O2'" . G   C 2 2  ? 20.134  -73.767 7.535   1.00 33.63 ? 2  G   C "O2'" 1 
ATOM   1027 C  "C1'" . G   C 2 2  ? 21.594  -74.852 5.977   1.00 33.30 ? 2  G   C "C1'" 1 
ATOM   1028 N  N9    . G   C 2 2  ? 22.088  -74.600 4.613   1.00 33.36 ? 2  G   C N9    1 
ATOM   1029 C  C8    . G   C 2 2  ? 22.466  -75.534 3.674   1.00 33.13 ? 2  G   C C8    1 
ATOM   1030 N  N7    . G   C 2 2  ? 22.873  -75.016 2.547   1.00 32.92 ? 2  G   C N7    1 
ATOM   1031 C  C5    . G   C 2 2  ? 22.762  -73.646 2.741   1.00 32.85 ? 2  G   C C5    1 
ATOM   1032 C  C6    . G   C 2 2  ? 23.056  -72.569 1.866   1.00 32.77 ? 2  G   C C6    1 
ATOM   1033 O  O6    . G   C 2 2  ? 23.494  -72.612 0.709   1.00 32.78 ? 2  G   C O6    1 
ATOM   1034 N  N1    . G   C 2 2  ? 22.796  -71.332 2.455   1.00 33.11 ? 2  G   C N1    1 
ATOM   1035 C  C2    . G   C 2 2  ? 22.314  -71.154 3.732   1.00 33.01 ? 2  G   C C2    1 
ATOM   1036 N  N2    . G   C 2 2  ? 22.123  -69.892 4.142   1.00 32.86 ? 2  G   C N2    1 
ATOM   1037 N  N3    . G   C 2 2  ? 22.043  -72.154 4.559   1.00 33.21 ? 2  G   C N3    1 
ATOM   1038 C  C4    . G   C 2 2  ? 22.282  -73.372 4.005   1.00 33.16 ? 2  G   C C4    1 
ATOM   1039 P  P     . A   C 2 3  ? 16.950  -75.653 5.515   1.00 32.37 ? 3  A   C P     1 
ATOM   1040 O  OP1   . A   C 2 3  ? 15.668  -76.083 6.117   1.00 33.12 ? 3  A   C OP1   1 
ATOM   1041 O  OP2   . A   C 2 3  ? 17.388  -76.379 4.303   1.00 32.46 ? 3  A   C OP2   1 
ATOM   1042 O  "O5'" . A   C 2 3  ? 16.898  -74.075 5.194   1.00 31.42 ? 3  A   C "O5'" 1 
ATOM   1043 C  "C5'" . A   C 2 3  ? 16.680  -73.085 6.224   1.00 28.13 ? 3  A   C "C5'" 1 
ATOM   1044 C  "C4'" . A   C 2 3  ? 16.608  -71.657 5.682   1.00 25.58 ? 3  A   C "C4'" 1 
ATOM   1045 O  "O4'" . A   C 2 3  ? 17.947  -71.199 5.354   1.00 24.15 ? 3  A   C "O4'" 1 
ATOM   1046 C  "C3'" . A   C 2 3  ? 15.802  -71.428 4.398   1.00 24.22 ? 3  A   C "C3'" 1 
ATOM   1047 O  "O3'" . A   C 2 3  ? 14.399  -71.226 4.609   1.00 23.45 ? 3  A   C "O3'" 1 
ATOM   1048 C  "C2'" . A   C 2 3  ? 16.482  -70.193 3.801   1.00 23.36 ? 3  A   C "C2'" 1 
ATOM   1049 O  "O2'" . A   C 2 3  ? 16.075  -68.956 4.364   1.00 21.36 ? 3  A   C "O2'" 1 
ATOM   1050 C  "C1'" . A   C 2 3  ? 17.939  -70.498 4.119   1.00 22.91 ? 3  A   C "C1'" 1 
ATOM   1051 N  N9    . A   C 2 3  ? 18.598  -71.265 3.053   1.00 22.57 ? 3  A   C N9    1 
ATOM   1052 C  C8    . A   C 2 3  ? 18.714  -72.623 2.934   1.00 22.19 ? 3  A   C C8    1 
ATOM   1053 N  N7    . A   C 2 3  ? 19.357  -73.010 1.858   1.00 22.37 ? 3  A   C N7    1 
ATOM   1054 C  C5    . A   C 2 3  ? 19.695  -71.826 1.222   1.00 22.53 ? 3  A   C C5    1 
ATOM   1055 C  C6    . A   C 2 3  ? 20.388  -71.537 0.022   1.00 22.33 ? 3  A   C C6    1 
ATOM   1056 N  N6    . A   C 2 3  ? 20.898  -72.473 -0.780  1.00 21.89 ? 3  A   C N6    1 
ATOM   1057 N  N1    . A   C 2 3  ? 20.541  -70.238 -0.332  1.00 22.45 ? 3  A   C N1    1 
ATOM   1058 C  C2    . A   C 2 3  ? 20.035  -69.284 0.464   1.00 22.30 ? 3  A   C C2    1 
ATOM   1059 N  N3    . A   C 2 3  ? 19.365  -69.431 1.611   1.00 22.52 ? 3  A   C N3    1 
ATOM   1060 C  C4    . A   C 2 3  ? 19.227  -70.737 1.943   1.00 22.81 ? 3  A   C C4    1 
ATOM   1061 P  P     . C   C 2 4  ? 13.379  -71.673 3.453   1.00 25.15 ? 4  C   C P     1 
ATOM   1062 O  OP1   . C   C 2 4  ? 11.997  -71.337 3.870   1.00 25.17 ? 4  C   C OP1   1 
ATOM   1063 O  OP2   . C   C 2 4  ? 13.704  -73.073 3.077   1.00 24.80 ? 4  C   C OP2   1 
ATOM   1064 O  "O5'" . C   C 2 4  ? 13.739  -70.719 2.216   1.00 24.00 ? 4  C   C "O5'" 1 
ATOM   1065 C  "C5'" . C   C 2 4  ? 13.276  -69.372 2.211   1.00 22.76 ? 4  C   C "C5'" 1 
ATOM   1066 C  "C4'" . C   C 2 4  ? 13.922  -68.614 1.072   1.00 21.42 ? 4  C   C "C4'" 1 
ATOM   1067 O  "O4'" . C   C 2 4  ? 15.339  -68.918 1.014   1.00 20.96 ? 4  C   C "O4'" 1 
ATOM   1068 C  "C3'" . C   C 2 4  ? 13.475  -69.022 -0.322  1.00 20.03 ? 4  C   C "C3'" 1 
ATOM   1069 O  "O3'" . C   C 2 4  ? 12.182  -68.542 -0.640  1.00 18.23 ? 4  C   C "O3'" 1 
ATOM   1070 C  "C2'" . C   C 2 4  ? 14.581  -68.365 -1.144  1.00 19.22 ? 4  C   C "C2'" 1 
ATOM   1071 O  "O2'" . C   C 2 4  ? 14.460  -66.956 -1.234  1.00 18.65 ? 4  C   C "O2'" 1 
ATOM   1072 C  "C1'" . C   C 2 4  ? 15.801  -68.757 -0.316  1.00 18.57 ? 4  C   C "C1'" 1 
ATOM   1073 N  N1    . C   C 2 4  ? 16.431  -70.024 -0.808  1.00 17.95 ? 4  C   C N1    1 
ATOM   1074 C  C2    . C   C 2 4  ? 17.248  -69.986 -1.949  1.00 17.30 ? 4  C   C C2    1 
ATOM   1075 O  O2    . C   C 2 4  ? 17.436  -68.910 -2.534  1.00 16.81 ? 4  C   C O2    1 
ATOM   1076 N  N3    . C   C 2 4  ? 17.804  -71.146 -2.392  1.00 16.89 ? 4  C   C N3    1 
ATOM   1077 C  C4    . C   C 2 4  ? 17.577  -72.293 -1.753  1.00 16.77 ? 4  C   C C4    1 
ATOM   1078 N  N4    . C   C 2 4  ? 18.143  -73.394 -2.239  1.00 16.73 ? 4  C   C N4    1 
ATOM   1079 C  C5    . C   C 2 4  ? 16.756  -72.358 -0.592  1.00 17.22 ? 4  C   C C5    1 
ATOM   1080 C  C6    . C   C 2 4  ? 16.206  -71.211 -0.160  1.00 17.95 ? 4  C   C C6    1 
ATOM   1081 P  P     . A   C 2 5  ? 11.319  -69.355 -1.719  1.00 19.64 ? 5  A   C P     1 
ATOM   1082 O  OP1   . A   C 2 5  ? 10.042  -68.615 -1.790  1.00 20.27 ? 5  A   C OP1   1 
ATOM   1083 O  OP2   . A   C 2 5  ? 11.344  -70.816 -1.436  1.00 19.42 ? 5  A   C OP2   1 
ATOM   1084 O  "O5'" . A   C 2 5  ? 12.063  -69.177 -3.130  1.00 17.75 ? 5  A   C "O5'" 1 
ATOM   1085 C  "C5'" . A   C 2 5  ? 12.002  -67.919 -3.747  1.00 15.08 ? 5  A   C "C5'" 1 
ATOM   1086 C  "C4'" . A   C 2 5  ? 13.067  -67.789 -4.801  1.00 13.41 ? 5  A   C "C4'" 1 
ATOM   1087 O  "O4'" . A   C 2 5  ? 14.384  -68.245 -4.383  1.00 13.70 ? 5  A   C "O4'" 1 
ATOM   1088 C  "C3'" . A   C 2 5  ? 12.776  -68.601 -6.033  1.00 12.22 ? 5  A   C "C3'" 1 
ATOM   1089 O  "O3'" . A   C 2 5  ? 11.698  -67.980 -6.682  1.00 10.79 ? 5  A   C "O3'" 1 
ATOM   1090 C  "C2'" . A   C 2 5  ? 14.124  -68.421 -6.722  1.00 12.27 ? 5  A   C "C2'" 1 
ATOM   1091 O  "O2'" . A   C 2 5  ? 14.269  -67.103 -7.218  1.00 9.82  ? 5  A   C "O2'" 1 
ATOM   1092 C  "C1'" . A   C 2 5  ? 15.070  -68.705 -5.543  1.00 14.34 ? 5  A   C "C1'" 1 
ATOM   1093 N  N9    . A   C 2 5  ? 15.412  -70.132 -5.364  1.00 15.18 ? 5  A   C N9    1 
ATOM   1094 C  C8    . A   C 2 5  ? 14.898  -70.996 -4.427  1.00 14.94 ? 5  A   C C8    1 
ATOM   1095 N  N7    . A   C 2 5  ? 15.370  -72.214 -4.488  1.00 14.06 ? 5  A   C N7    1 
ATOM   1096 C  C5    . A   C 2 5  ? 16.262  -72.163 -5.542  1.00 14.89 ? 5  A   C C5    1 
ATOM   1097 C  C6    . A   C 2 5  ? 17.097  -73.143 -6.125  1.00 14.92 ? 5  A   C C6    1 
ATOM   1098 N  N6    . A   C 2 5  ? 17.172  -74.416 -5.703  1.00 15.13 ? 5  A   C N6    1 
ATOM   1099 N  N1    . A   C 2 5  ? 17.858  -72.766 -7.168  1.00 15.25 ? 5  A   C N1    1 
ATOM   1100 C  C2    . A   C 2 5  ? 17.801  -71.499 -7.606  1.00 15.25 ? 5  A   C C2    1 
ATOM   1101 N  N3    . A   C 2 5  ? 17.062  -70.496 -7.142  1.00 16.04 ? 5  A   C N3    1 
ATOM   1102 C  C4    . A   C 2 5  ? 16.302  -70.894 -6.099  1.00 15.52 ? 5  A   C C4    1 
ATOM   1103 P  P     . G   C 2 6  ? 10.940  -68.734 -7.865  1.00 9.98  ? 6  G   C P     1 
ATOM   1104 O  OP1   . G   C 2 6  ? 9.791   -67.871 -8.219  1.00 10.52 ? 6  G   C OP1   1 
ATOM   1105 O  OP2   . G   C 2 6  ? 10.704  -70.142 -7.496  1.00 10.10 ? 6  G   C OP2   1 
ATOM   1106 O  "O5'" . G   C 2 6  ? 12.018  -68.763 -9.062  1.00 12.32 ? 6  G   C "O5'" 1 
ATOM   1107 C  "C5'" . G   C 2 6  ? 12.430  -67.588 -9.789  1.00 13.09 ? 6  G   C "C5'" 1 
ATOM   1108 C  "C4'" . G   C 2 6  ? 13.463  -67.944 -10.845 1.00 14.34 ? 6  G   C "C4'" 1 
ATOM   1109 O  "O4'" . G   C 2 6  ? 14.665  -68.435 -10.206 1.00 15.13 ? 6  G   C "O4'" 1 
ATOM   1110 C  "C3'" . G   C 2 6  ? 13.134  -69.074 -11.819 1.00 14.06 ? 6  G   C "C3'" 1 
ATOM   1111 O  "O3'" . G   C 2 6  ? 12.322  -68.603 -12.845 1.00 14.85 ? 6  G   C "O3'" 1 
ATOM   1112 C  "C2'" . G   C 2 6  ? 14.532  -69.431 -12.324 1.00 13.69 ? 6  G   C "C2'" 1 
ATOM   1113 O  "O2'" . G   C 2 6  ? 15.128  -68.495 -13.206 1.00 12.03 ? 6  G   C "O2'" 1 
ATOM   1114 C  "C1'" . G   C 2 6  ? 15.282  -69.430 -11.003 1.00 14.70 ? 6  G   C "C1'" 1 
ATOM   1115 N  N9    . G   C 2 6  ? 15.147  -70.706 -10.313 1.00 14.91 ? 6  G   C N9    1 
ATOM   1116 C  C8    . G   C 2 6  ? 14.311  -70.955 -9.272  1.00 14.74 ? 6  G   C C8    1 
ATOM   1117 N  N7    . G   C 2 6  ? 14.379  -72.178 -8.847  1.00 15.51 ? 6  G   C N7    1 
ATOM   1118 C  C5    . G   C 2 6  ? 15.311  -72.795 -9.645  1.00 15.48 ? 6  G   C C5    1 
ATOM   1119 C  C6    . G   C 2 6  ? 15.781  -74.137 -9.618  1.00 15.38 ? 6  G   C C6    1 
ATOM   1120 O  O6    . G   C 2 6  ? 15.449  -75.066 -8.850  1.00 14.37 ? 6  G   C O6    1 
ATOM   1121 N  N1    . G   C 2 6  ? 16.738  -74.342 -10.619 1.00 15.22 ? 6  G   C N1    1 
ATOM   1122 C  C2    . G   C 2 6  ? 17.175  -73.375 -11.504 1.00 15.05 ? 6  G   C C2    1 
ATOM   1123 N  N2    . G   C 2 6  ? 18.100  -73.757 -12.389 1.00 15.30 ? 6  G   C N2    1 
ATOM   1124 N  N3    . G   C 2 6  ? 16.740  -72.120 -11.529 1.00 15.25 ? 6  G   C N3    1 
ATOM   1125 C  C4    . G   C 2 6  ? 15.804  -71.895 -10.566 1.00 15.67 ? 6  G   C C4    1 
ATOM   1126 P  P     . C   C 2 7  ? 11.296  -69.543 -13.620 1.00 17.93 ? 7  C   C P     1 
ATOM   1127 O  OP1   . C   C 2 7  ? 10.550  -68.588 -14.474 1.00 18.54 ? 7  C   C OP1   1 
ATOM   1128 O  OP2   . C   C 2 7  ? 10.583  -70.453 -12.689 1.00 17.77 ? 7  C   C OP2   1 
ATOM   1129 O  "O5'" . C   C 2 7  ? 12.190  -70.501 -14.548 1.00 17.83 ? 7  C   C "O5'" 1 
ATOM   1130 C  "C5'" . C   C 2 7  ? 12.999  -69.936 -15.562 1.00 16.70 ? 7  C   C "C5'" 1 
ATOM   1131 C  "C4'" . C   C 2 7  ? 13.919  -70.982 -16.138 1.00 15.59 ? 7  C   C "C4'" 1 
ATOM   1132 O  "O4'" . C   C 2 7  ? 14.862  -71.366 -15.112 1.00 15.18 ? 7  C   C "O4'" 1 
ATOM   1133 C  "C3'" . C   C 2 7  ? 13.272  -72.300 -16.546 1.00 14.56 ? 7  C   C "C3'" 1 
ATOM   1134 O  "O3'" . C   C 2 7  ? 12.705  -72.200 -17.809 1.00 14.45 ? 7  C   C "O3'" 1 
ATOM   1135 C  "C2'" . C   C 2 7  ? 14.535  -73.156 -16.572 1.00 14.60 ? 7  C   C "C2'" 1 
ATOM   1136 O  "O2'" . C   C 2 7  ? 15.432  -72.887 -17.625 1.00 12.53 ? 7  C   C "O2'" 1 
ATOM   1137 C  "C1'" . C   C 2 7  ? 15.160  -72.743 -15.248 1.00 14.44 ? 7  C   C "C1'" 1 
ATOM   1138 N  N1    . C   C 2 7  ? 14.598  -73.570 -14.108 1.00 15.07 ? 7  C   C N1    1 
ATOM   1139 C  C2    . C   C 2 7  ? 15.154  -74.834 -13.872 1.00 14.92 ? 7  C   C C2    1 
ATOM   1140 O  O2    . C   C 2 7  ? 16.084  -75.232 -14.580 1.00 14.19 ? 7  C   C O2    1 
ATOM   1141 N  N3    . C   C 2 7  ? 14.658  -75.589 -12.856 1.00 15.47 ? 7  C   C N3    1 
ATOM   1142 C  C4    . C   C 2 7  ? 13.653  -75.153 -12.104 1.00 13.78 ? 7  C   C C4    1 
ATOM   1143 N  N4    . C   C 2 7  ? 13.241  -75.965 -11.140 1.00 13.71 ? 7  C   C N4    1 
ATOM   1144 C  C5    . C   C 2 7  ? 13.059  -73.876 -12.312 1.00 14.24 ? 7  C   C C5    1 
ATOM   1145 C  C6    . C   C 2 7  ? 13.553  -73.133 -13.318 1.00 15.09 ? 7  C   C C6    1 
ATOM   1146 P  P     . A   C 2 8  ? 11.362  -72.923 -18.304 1.00 17.50 ? 8  A   C P     1 
ATOM   1147 O  OP1   . A   C 2 8  ? 11.105  -72.184 -19.556 1.00 20.24 ? 8  A   C OP1   1 
ATOM   1148 O  OP2   . A   C 2 8  ? 10.239  -73.032 -17.332 1.00 16.91 ? 8  A   C OP2   1 
ATOM   1149 O  "O5'" . A   C 2 8  ? 11.836  -74.407 -18.639 1.00 15.80 ? 8  A   C "O5'" 1 
ATOM   1150 C  "C5'" . A   C 2 8  ? 12.869  -74.635 -19.555 1.00 15.90 ? 8  A   C "C5'" 1 
ATOM   1151 C  "C4'" . A   C 2 8  ? 13.399  -76.025 -19.322 1.00 16.05 ? 8  A   C "C4'" 1 
ATOM   1152 O  "O4'" . A   C 2 8  ? 14.118  -76.110 -18.065 1.00 16.08 ? 8  A   C "O4'" 1 
ATOM   1153 C  "C3'" . A   C 2 8  ? 12.344  -77.104 -19.188 1.00 16.18 ? 8  A   C "C3'" 1 
ATOM   1154 O  "O3'" . A   C 2 8  ? 11.828  -77.408 -20.471 1.00 15.57 ? 8  A   C "O3'" 1 
ATOM   1155 C  "C2'" . A   C 2 8  ? 13.223  -78.209 -18.610 1.00 16.61 ? 8  A   C "C2'" 1 
ATOM   1156 O  "O2'" . A   C 2 8  ? 14.068  -78.773 -19.601 1.00 17.45 ? 8  A   C "O2'" 1 
ATOM   1157 C  "C1'" . A   C 2 8  ? 14.005  -77.416 -17.559 1.00 16.14 ? 8  A   C "C1'" 1 
ATOM   1158 N  N9    . A   C 2 8  ? 13.274  -77.386 -16.301 1.00 16.51 ? 8  A   C N9    1 
ATOM   1159 C  C8    . A   C 2 8  ? 12.508  -76.391 -15.751 1.00 16.68 ? 8  A   C C8    1 
ATOM   1160 N  N7    . A   C 2 8  ? 11.964  -76.721 -14.594 1.00 16.97 ? 8  A   C N7    1 
ATOM   1161 C  C5    . A   C 2 8  ? 12.396  -78.025 -14.372 1.00 16.56 ? 8  A   C C5    1 
ATOM   1162 C  C6    . A   C 2 8  ? 12.190  -78.972 -13.340 1.00 16.20 ? 8  A   C C6    1 
ATOM   1163 N  N6    . A   C 2 8  ? 11.462  -78.788 -12.235 1.00 15.82 ? 8  A   C N6    1 
ATOM   1164 N  N1    . A   C 2 8  ? 12.784  -80.175 -13.471 1.00 17.27 ? 8  A   C N1    1 
ATOM   1165 C  C2    . A   C 2 8  ? 13.540  -80.438 -14.546 1.00 17.30 ? 8  A   C C2    1 
ATOM   1166 N  N3    . A   C 2 8  ? 13.811  -79.638 -15.577 1.00 17.20 ? 8  A   C N3    1 
ATOM   1167 C  C4    . A   C 2 8  ? 13.204  -78.442 -15.422 1.00 17.13 ? 8  A   C C4    1 
ATOM   1168 P  P     . U   C 2 9  ? 10.450  -78.201 -20.679 1.00 15.75 ? 9  U   C P     1 
ATOM   1169 O  OP1   . U   C 2 9  ? 10.226  -78.366 -22.139 1.00 15.63 ? 9  U   C OP1   1 
ATOM   1170 O  OP2   . U   C 2 9  ? 9.409   -77.495 -19.877 1.00 16.44 ? 9  U   C OP2   1 
ATOM   1171 O  "O5'" . U   C 2 9  ? 10.809  -79.629 -20.043 1.00 15.22 ? 9  U   C "O5'" 1 
ATOM   1172 C  "C5'" . U   C 2 9  ? 11.586  -80.562 -20.823 1.00 15.55 ? 9  U   C "C5'" 1 
ATOM   1173 C  "C4'" . U   C 2 9  ? 11.596  -81.956 -20.221 1.00 14.13 ? 9  U   C "C4'" 1 
ATOM   1174 O  "O4'" . U   C 2 9  ? 12.261  -81.872 -18.939 1.00 13.97 ? 9  U   C "O4'" 1 
ATOM   1175 C  "C3'" . U   C 2 9  ? 10.225  -82.500 -19.860 1.00 13.71 ? 9  U   C "C3'" 1 
ATOM   1176 O  "O3'" . U   C 2 9  ? 9.606   -83.067 -20.964 1.00 13.60 ? 9  U   C "O3'" 1 
ATOM   1177 C  "C2'" . U   C 2 9  ? 10.603  -83.508 -18.785 1.00 14.85 ? 9  U   C "C2'" 1 
ATOM   1178 O  "O2'" . U   C 2 9  ? 11.289  -84.652 -19.241 1.00 16.19 ? 9  U   C "O2'" 1 
ATOM   1179 C  "C1'" . U   C 2 9  ? 11.583  -82.669 -17.990 1.00 14.07 ? 9  U   C "C1'" 1 
ATOM   1180 N  N1    . U   C 2 9  ? 10.894  -81.865 -16.928 1.00 13.64 ? 9  U   C N1    1 
ATOM   1181 C  C2    . U   C 2 9  ? 10.586  -82.537 -15.758 1.00 15.09 ? 9  U   C C2    1 
ATOM   1182 O  O2    . U   C 2 9  ? 10.854  -83.707 -15.563 1.00 15.97 ? 9  U   C O2    1 
ATOM   1183 N  N3    . U   C 2 9  ? 9.953   -81.803 -14.792 1.00 16.04 ? 9  U   C N3    1 
ATOM   1184 C  C4    . U   C 2 9  ? 9.597   -80.477 -14.881 1.00 14.85 ? 9  U   C C4    1 
ATOM   1185 O  O4    . U   C 2 9  ? 9.039   -79.982 -13.916 1.00 13.74 ? 9  U   C O4    1 
ATOM   1186 C  C5    . U   C 2 9  ? 9.941   -79.827 -16.132 1.00 15.30 ? 9  U   C C5    1 
ATOM   1187 C  C6    . U   C 2 9  ? 10.563  -80.531 -17.096 1.00 13.52 ? 9  U   C C6    1 
ATOM   1188 P  P     . U   C 2 10 ? 8.003   -83.085 -21.115 1.00 15.84 ? 10 U   C P     1 
ATOM   1189 O  OP1   . U   C 2 10 ? 7.783   -83.851 -22.368 1.00 17.75 ? 10 U   C OP1   1 
ATOM   1190 O  OP2   . U   C 2 10 ? 7.413   -81.738 -20.970 1.00 15.31 ? 10 U   C OP2   1 
ATOM   1191 O  "O5'" . U   C 2 10 ? 7.491   -83.970 -19.896 1.00 15.13 ? 10 U   C "O5'" 1 
ATOM   1192 C  "C5'" . U   C 2 10 ? 7.686   -85.357 -19.894 1.00 14.71 ? 10 U   C "C5'" 1 
ATOM   1193 C  "C4'" . U   C 2 10 ? 7.338   -85.879 -18.522 1.00 16.31 ? 10 U   C "C4'" 1 
ATOM   1194 O  "O4'" . U   C 2 10 ? 8.078   -85.170 -17.480 1.00 17.16 ? 10 U   C "O4'" 1 
ATOM   1195 C  "C3'" . U   C 2 10 ? 5.899   -85.675 -18.092 1.00 16.13 ? 10 U   C "C3'" 1 
ATOM   1196 O  "O3'" . U   C 2 10 ? 5.073   -86.559 -18.800 1.00 15.31 ? 10 U   C "O3'" 1 
ATOM   1197 C  "C2'" . U   C 2 10 ? 6.064   -85.988 -16.597 1.00 17.14 ? 10 U   C "C2'" 1 
ATOM   1198 O  "O2'" . U   C 2 10 ? 6.228   -87.361 -16.283 1.00 17.83 ? 10 U   C "O2'" 1 
ATOM   1199 C  "C1'" . U   C 2 10 ? 7.337   -85.205 -16.271 1.00 15.90 ? 10 U   C "C1'" 1 
ATOM   1200 N  N1    . U   C 2 10 ? 6.949   -83.831 -15.915 1.00 15.89 ? 10 U   C N1    1 
ATOM   1201 C  C2    . U   C 2 10 ? 6.390   -83.596 -14.676 1.00 15.72 ? 10 U   C C2    1 
ATOM   1202 O  O2    . U   C 2 10 ? 6.242   -84.477 -13.846 1.00 16.21 ? 10 U   C O2    1 
ATOM   1203 N  N3    . U   C 2 10 ? 6.033   -82.285 -14.442 1.00 15.02 ? 10 U   C N3    1 
ATOM   1204 C  C4    . U   C 2 10 ? 6.182   -81.228 -15.327 1.00 15.34 ? 10 U   C C4    1 
ATOM   1205 O  O4    . U   C 2 10 ? 5.816   -80.107 -15.014 1.00 15.97 ? 10 U   C O4    1 
ATOM   1206 C  C5    . U   C 2 10 ? 6.760   -81.548 -16.599 1.00 16.13 ? 10 U   C C5    1 
ATOM   1207 C  C6    . U   C 2 10 ? 7.111   -82.813 -16.837 1.00 16.17 ? 10 U   C C6    1 
ATOM   1208 P  P     . A   C 2 11 ? 3.475   -86.453 -18.731 1.00 16.70 ? 11 A   C P     1 
ATOM   1209 O  OP1   . A   C 2 11 ? 2.948   -87.255 -19.859 1.00 18.61 ? 11 A   C OP1   1 
ATOM   1210 O  OP2   . A   C 2 11 ? 3.071   -85.030 -18.632 1.00 15.12 ? 11 A   C OP2   1 
ATOM   1211 O  "O5'" . A   C 2 11 ? 3.106   -87.266 -17.402 1.00 16.12 ? 11 A   C "O5'" 1 
ATOM   1212 C  "C5'" . A   C 2 11 ? 3.260   -88.690 -17.346 1.00 16.77 ? 11 A   C "C5'" 1 
ATOM   1213 C  "C4'" . A   C 2 11 ? 2.854   -89.221 -15.971 1.00 17.90 ? 11 A   C "C4'" 1 
ATOM   1214 O  "O4'" . A   C 2 11 ? 3.536   -88.488 -14.908 1.00 17.29 ? 11 A   C "O4'" 1 
ATOM   1215 C  "C3'" . A   C 2 11 ? 1.378   -89.048 -15.602 1.00 17.56 ? 11 A   C "C3'" 1 
ATOM   1216 O  "O3'" . A   C 2 11 ? 0.571   -89.987 -16.278 1.00 16.81 ? 11 A   C "O3'" 1 
ATOM   1217 C  "C2'" . A   C 2 11 ? 1.471   -89.270 -14.097 1.00 17.65 ? 11 A   C "C2'" 1 
ATOM   1218 O  "O2'" . A   C 2 11 ? 1.631   -90.631 -13.771 1.00 20.61 ? 11 A   C "O2'" 1 
ATOM   1219 C  "C1'" . A   C 2 11 ? 2.718   -88.459 -13.744 1.00 16.22 ? 11 A   C "C1'" 1 
ATOM   1220 N  N9    . A   C 2 11 ? 2.346   -87.075 -13.493 1.00 15.70 ? 11 A   C N9    1 
ATOM   1221 C  C8    . A   C 2 11 ? 2.654   -85.999 -14.282 1.00 15.98 ? 11 A   C C8    1 
ATOM   1222 N  N7    . A   C 2 11 ? 2.162   -84.860 -13.831 1.00 16.57 ? 11 A   C N7    1 
ATOM   1223 C  C5    . A   C 2 11 ? 1.475   -85.218 -12.682 1.00 15.79 ? 11 A   C C5    1 
ATOM   1224 C  C6    . A   C 2 11 ? 0.733   -84.467 -11.740 1.00 16.34 ? 11 A   C C6    1 
ATOM   1225 N  N6    . A   C 2 11 ? 0.560   -83.144 -11.821 1.00 15.12 ? 11 A   C N6    1 
ATOM   1226 N  N1    . A   C 2 11 ? 0.183   -85.135 -10.694 1.00 16.20 ? 11 A   C N1    1 
ATOM   1227 C  C2    . A   C 2 11 ? 0.377   -86.460 -10.609 1.00 15.81 ? 11 A   C C2    1 
ATOM   1228 N  N3    . A   C 2 11 ? 1.059   -87.256 -11.434 1.00 15.18 ? 11 A   C N3    1 
ATOM   1229 C  C4    . A   C 2 11 ? 1.586   -86.577 -12.456 1.00 15.04 ? 11 A   C C4    1 
ATOM   1230 P  P     . U   C 2 12 ? -0.960  -89.714 -16.693 1.00 18.05 ? 12 U   C P     1 
ATOM   1231 O  OP1   . U   C 2 12 ? -1.459  -90.848 -17.513 1.00 17.60 ? 12 U   C OP1   1 
ATOM   1232 O  OP2   . U   C 2 12 ? -1.177  -88.369 -17.272 1.00 19.75 ? 12 U   C OP2   1 
ATOM   1233 O  "O5'" . U   C 2 12 ? -1.585  -89.765 -15.229 1.00 17.08 ? 12 U   C "O5'" 1 
ATOM   1234 C  "C5'" . U   C 2 12 ? -1.736  -91.007 -14.569 1.00 16.20 ? 12 U   C "C5'" 1 
ATOM   1235 C  "C4'" . U   C 2 12 ? -2.333  -90.742 -13.213 1.00 16.23 ? 12 U   C "C4'" 1 
ATOM   1236 O  "O4'" . U   C 2 12 ? -1.596  -89.688 -12.554 1.00 16.34 ? 12 U   C "O4'" 1 
ATOM   1237 C  "C3'" . U   C 2 12 ? -3.702  -90.111 -13.273 1.00 16.92 ? 12 U   C "C3'" 1 
ATOM   1238 O  "O3'" . U   C 2 12 ? -4.654  -91.063 -13.591 1.00 16.10 ? 12 U   C "O3'" 1 
ATOM   1239 C  "C2'" . U   C 2 12 ? -3.825  -89.609 -11.843 1.00 16.70 ? 12 U   C "C2'" 1 
ATOM   1240 O  "O2'" . U   C 2 12 ? -3.957  -90.657 -10.904 1.00 17.62 ? 12 U   C "O2'" 1 
ATOM   1241 C  "C1'" . U   C 2 12 ? -2.461  -88.959 -11.705 1.00 16.05 ? 12 U   C "C1'" 1 
ATOM   1242 N  N1    . U   C 2 12 ? -2.476  -87.517 -12.070 1.00 15.97 ? 12 U   C N1    1 
ATOM   1243 C  C2    . U   C 2 12 ? -3.174  -86.637 -11.248 1.00 17.15 ? 12 U   C C2    1 
ATOM   1244 O  O2    . U   C 2 12 ? -3.771  -87.000 -10.245 1.00 18.05 ? 12 U   C O2    1 
ATOM   1245 N  N3    . U   C 2 12 ? -3.159  -85.309 -11.622 1.00 15.50 ? 12 U   C N3    1 
ATOM   1246 C  C4    . U   C 2 12 ? -2.512  -84.792 -12.727 1.00 16.77 ? 12 U   C C4    1 
ATOM   1247 O  O4    . U   C 2 12 ? -2.571  -83.584 -12.944 1.00 16.88 ? 12 U   C O4    1 
ATOM   1248 C  C5    . U   C 2 12 ? -1.803  -85.764 -13.541 1.00 16.81 ? 12 U   C C5    1 
ATOM   1249 C  C6    . U   C 2 12 ? -1.813  -87.061 -13.191 1.00 15.55 ? 12 U   C C6    1 
ATOM   1250 P  P     . G   C 2 13 ? -5.945  -90.636 -14.414 1.00 17.24 ? 13 G   C P     1 
ATOM   1251 O  OP1   . G   C 2 13 ? -6.466  -91.893 -14.998 1.00 20.21 ? 13 G   C OP1   1 
ATOM   1252 O  OP2   . G   C 2 13 ? -5.649  -89.516 -15.327 1.00 18.25 ? 13 G   C OP2   1 
ATOM   1253 O  "O5'" . G   C 2 13 ? -6.972  -90.153 -13.302 1.00 15.73 ? 13 G   C "O5'" 1 
ATOM   1254 C  "C5'" . G   C 2 13 ? -7.279  -91.004 -12.224 1.00 16.12 ? 13 G   C "C5'" 1 
ATOM   1255 C  "C4'" . G   C 2 13 ? -7.997  -90.196 -11.161 1.00 17.66 ? 13 G   C "C4'" 1 
ATOM   1256 O  "O4'" . G   C 2 13 ? -7.111  -89.230 -10.529 1.00 17.98 ? 13 G   C "O4'" 1 
ATOM   1257 C  "C3'" . G   C 2 13 ? -9.085  -89.290 -11.698 1.00 17.30 ? 13 G   C "C3'" 1 
ATOM   1258 O  "O3'" . G   C 2 13 ? -10.180 -90.072 -12.111 1.00 15.48 ? 13 G   C "O3'" 1 
ATOM   1259 C  "C2'" . G   C 2 13 ? -9.286  -88.444 -10.439 1.00 17.97 ? 13 G   C "C2'" 1 
ATOM   1260 O  "O2'" . G   C 2 13 ? -9.832  -89.150 -9.351  1.00 16.95 ? 13 G   C "O2'" 1 
ATOM   1261 C  "C1'" . G   C 2 13 ? -7.836  -88.086 -10.152 1.00 17.46 ? 13 G   C "C1'" 1 
ATOM   1262 N  N9    . G   C 2 13 ? -7.407  -86.978 -10.979 1.00 17.31 ? 13 G   C N9    1 
ATOM   1263 C  C8    . G   C 2 13 ? -6.713  -87.036 -12.160 1.00 18.30 ? 13 G   C C8    1 
ATOM   1264 N  N7    . G   C 2 13 ? -6.501  -85.859 -12.691 1.00 18.55 ? 13 G   C N7    1 
ATOM   1265 C  C5    . G   C 2 13 ? -7.090  -84.969 -11.811 1.00 17.50 ? 13 G   C C5    1 
ATOM   1266 C  C6    . G   C 2 13 ? -7.171  -83.559 -11.864 1.00 17.97 ? 13 G   C C6    1 
ATOM   1267 O  O6    . G   C 2 13 ? -6.708  -82.796 -12.734 1.00 18.72 ? 13 G   C O6    1 
ATOM   1268 N  N1    . G   C 2 13 ? -7.862  -83.038 -10.774 1.00 17.58 ? 13 G   C N1    1 
ATOM   1269 C  C2    . G   C 2 13 ? -8.409  -83.796 -9.762  1.00 18.29 ? 13 G   C C2    1 
ATOM   1270 N  N2    . G   C 2 13 ? -9.052  -83.133 -8.787  1.00 18.28 ? 13 G   C N2    1 
ATOM   1271 N  N3    . G   C 2 13 ? -8.329  -85.123 -9.698  1.00 18.87 ? 13 G   C N3    1 
ATOM   1272 C  C4    . G   C 2 13 ? -7.653  -85.642 -10.754 1.00 17.98 ? 13 G   C C4    1 
ATOM   1273 P  P     . C   C 2 14 ? -11.361 -89.493 -13.004 1.00 12.86 ? 14 C   C P     1 
ATOM   1274 O  OP1   . C   C 2 14 ? -12.397 -90.529 -13.086 1.00 15.48 ? 14 C   C OP1   1 
ATOM   1275 O  OP2   . C   C 2 14 ? -10.846 -88.975 -14.262 1.00 14.81 ? 14 C   C OP2   1 
ATOM   1276 O  "O5'" . C   C 2 14 ? -11.910 -88.299 -12.098 1.00 13.98 ? 14 C   C "O5'" 1 
ATOM   1277 C  "C5'" . C   C 2 14 ? -12.855 -88.523 -11.071 1.00 11.34 ? 14 C   C "C5'" 1 
ATOM   1278 C  "C4'" . C   C 2 14 ? -13.184 -87.196 -10.438 1.00 11.76 ? 14 C   C "C4'" 1 
ATOM   1279 O  "O4'" . C   C 2 14 ? -11.948 -86.469 -10.178 1.00 12.88 ? 14 C   C "O4'" 1 
ATOM   1280 C  "C3'" . C   C 2 14 ? -13.985 -86.269 -11.337 1.00 12.27 ? 14 C   C "C3'" 1 
ATOM   1281 O  "O3'" . C   C 2 14 ? -15.364 -86.517 -11.204 1.00 13.01 ? 14 C   C "O3'" 1 
ATOM   1282 C  "C2'" . C   C 2 14 ? -13.639 -84.930 -10.713 1.00 13.03 ? 14 C   C "C2'" 1 
ATOM   1283 O  "O2'" . C   C 2 14 ? -14.410 -84.697 -9.564  1.00 14.01 ? 14 C   C "O2'" 1 
ATOM   1284 C  "C1'" . C   C 2 14 ? -12.158 -85.078 -10.375 1.00 13.11 ? 14 C   C "C1'" 1 
ATOM   1285 N  N1    . C   C 2 14 ? -11.370 -84.525 -11.523 1.00 13.53 ? 14 C   C N1    1 
ATOM   1286 C  C2    . C   C 2 14 ? -11.249 -83.134 -11.648 1.00 13.90 ? 14 C   C C2    1 
ATOM   1287 O  O2    . C   C 2 14 ? -11.760 -82.403 -10.787 1.00 15.33 ? 14 C   C O2    1 
ATOM   1288 N  N3    . C   C 2 14 ? -10.562 -82.617 -12.699 1.00 13.69 ? 14 C   C N3    1 
ATOM   1289 C  C4    . C   C 2 14 ? -10.006 -83.423 -13.607 1.00 13.72 ? 14 C   C C4    1 
ATOM   1290 N  N4    . C   C 2 14 ? -9.334  -82.861 -14.614 1.00 13.67 ? 14 C   C N4    1 
ATOM   1291 C  C5    . C   C 2 14 ? -10.121 -84.844 -13.520 1.00 14.72 ? 14 C   C C5    1 
ATOM   1292 C  C6    . C   C 2 14 ? -10.809 -85.343 -12.477 1.00 14.69 ? 14 C   C C6    1 
ATOM   1293 P  P     . U   C 2 15 ? -16.467 -85.879 -12.177 1.00 12.38 ? 15 U   C P     1 
ATOM   1294 O  OP1   . U   C 2 15 ? -17.760 -86.454 -11.782 1.00 13.13 ? 15 U   C OP1   1 
ATOM   1295 O  OP2   . U   C 2 15 ? -15.994 -85.997 -13.579 1.00 13.12 ? 15 U   C OP2   1 
ATOM   1296 O  "O5'" . U   C 2 15 ? -16.439 -84.334 -11.774 1.00 13.65 ? 15 U   C "O5'" 1 
ATOM   1297 C  "C5'" . U   C 2 15 ? -17.169 -83.734 -10.701 1.00 12.62 ? 15 U   C "C5'" 1 
ATOM   1298 C  "C4'" . U   C 2 15 ? -16.855 -82.243 -10.731 1.00 12.76 ? 15 U   C "C4'" 1 
ATOM   1299 O  "O4'" . U   C 2 15 ? -15.426 -82.014 -10.879 1.00 11.17 ? 15 U   C "O4'" 1 
ATOM   1300 C  "C3'" . U   C 2 15 ? -17.432 -81.532 -11.941 1.00 12.62 ? 15 U   C "C3'" 1 
ATOM   1301 O  "O3'" . U   C 2 15 ? -18.780 -81.249 -11.699 1.00 11.40 ? 15 U   C "O3'" 1 
ATOM   1302 C  "C2'" . U   C 2 15 ? -16.568 -80.277 -11.990 1.00 13.71 ? 15 U   C "C2'" 1 
ATOM   1303 O  "O2'" . U   C 2 15 ? -16.955 -79.280 -11.062 1.00 15.66 ? 15 U   C "O2'" 1 
ATOM   1304 C  "C1'" . U   C 2 15 ? -15.210 -80.835 -11.609 1.00 12.50 ? 15 U   C "C1'" 1 
ATOM   1305 N  N1    . U   C 2 15 ? -14.422 -81.201 -12.783 1.00 13.52 ? 15 U   C N1    1 
ATOM   1306 C  C2    . U   C 2 15 ? -13.914 -80.207 -13.603 1.00 13.88 ? 15 U   C C2    1 
ATOM   1307 O  O2    . U   C 2 15 ? -14.101 -79.031 -13.390 1.00 15.23 ? 15 U   C O2    1 
ATOM   1308 N  N3    . U   C 2 15 ? -13.176 -80.632 -14.682 1.00 14.03 ? 15 U   C N3    1 
ATOM   1309 C  C4    . U   C 2 15 ? -12.902 -81.957 -15.002 1.00 14.21 ? 15 U   C C4    1 
ATOM   1310 O  O4    . U   C 2 15 ? -12.221 -82.232 -15.985 1.00 14.55 ? 15 U   C O4    1 
ATOM   1311 C  C5    . U   C 2 15 ? -13.467 -82.935 -14.104 1.00 14.75 ? 15 U   C C5    1 
ATOM   1312 C  C6    . U   C 2 15 ? -14.188 -82.533 -13.049 1.00 13.72 ? 15 U   C C6    1 
ATOM   1313 P  P     . G   C 2 16 ? -19.797 -81.028 -12.899 1.00 10.38 ? 16 G   C P     1 
ATOM   1314 O  OP1   . G   C 2 16 ? -21.189 -80.957 -12.396 1.00 9.93  ? 16 G   C OP1   1 
ATOM   1315 O  OP2   . G   C 2 16 ? -19.461 -81.976 -13.987 1.00 11.33 ? 16 G   C OP2   1 
ATOM   1316 O  "O5'" . G   C 2 16 ? -19.363 -79.561 -13.329 1.00 12.97 ? 16 G   C "O5'" 1 
ATOM   1317 C  "C5'" . G   C 2 16 ? -19.586 -78.428 -12.492 1.00 12.89 ? 16 G   C "C5'" 1 
ATOM   1318 C  "C4'" . G   C 2 16 ? -19.067 -77.204 -13.215 1.00 12.69 ? 16 G   C "C4'" 1 
ATOM   1319 O  "O4'" . G   C 2 16 ? -17.631 -77.321 -13.371 1.00 12.24 ? 16 G   C "O4'" 1 
ATOM   1320 C  "C3'" . G   C 2 16 ? -19.569 -77.081 -14.644 1.00 12.48 ? 16 G   C "C3'" 1 
ATOM   1321 O  "O3'" . G   C 2 16 ? -20.858 -76.522 -14.637 1.00 12.41 ? 16 G   C "O3'" 1 
ATOM   1322 C  "C2'" . G   C 2 16 ? -18.542 -76.092 -15.142 1.00 12.27 ? 16 G   C "C2'" 1 
ATOM   1323 O  "O2'" . G   C 2 16 ? -18.779 -74.828 -14.571 1.00 12.83 ? 16 G   C "O2'" 1 
ATOM   1324 C  "C1'" . G   C 2 16 ? -17.266 -76.686 -14.573 1.00 12.96 ? 16 G   C "C1'" 1 
ATOM   1325 N  N9    . G   C 2 16 ? -16.590 -77.618 -15.483 1.00 13.75 ? 16 G   C N9    1 
ATOM   1326 C  C8    . G   C 2 16 ? -16.580 -79.006 -15.463 1.00 13.54 ? 16 G   C C8    1 
ATOM   1327 N  N7    . G   C 2 16 ? -15.864 -79.525 -16.430 1.00 13.18 ? 16 G   C N7    1 
ATOM   1328 C  C5    . G   C 2 16 ? -15.361 -78.425 -17.137 1.00 13.57 ? 16 G   C C5    1 
ATOM   1329 C  C6    . G   C 2 16 ? -14.522 -78.328 -18.291 1.00 13.42 ? 16 G   C C6    1 
ATOM   1330 O  O6    . G   C 2 16 ? -14.019 -79.232 -18.959 1.00 13.60 ? 16 G   C O6    1 
ATOM   1331 N  N1    . G   C 2 16 ? -14.267 -77.009 -18.687 1.00 13.78 ? 16 G   C N1    1 
ATOM   1332 C  C2    . G   C 2 16 ? -14.769 -75.898 -18.040 1.00 13.54 ? 16 G   C C2    1 
ATOM   1333 N  N2    . G   C 2 16 ? -14.438 -74.696 -18.536 1.00 13.06 ? 16 G   C N2    1 
ATOM   1334 N  N3    . G   C 2 16 ? -15.549 -75.971 -16.962 1.00 13.79 ? 16 G   C N3    1 
ATOM   1335 C  C4    . G   C 2 16 ? -15.805 -77.248 -16.562 1.00 13.78 ? 16 G   C C4    1 
ATOM   1336 P  P     . U   C 2 17 ? -21.740 -76.346 -15.962 1.00 13.61 ? 17 U   C P     1 
ATOM   1337 O  OP1   . U   C 2 17 ? -23.027 -75.722 -15.557 1.00 12.37 ? 17 U   C OP1   1 
ATOM   1338 O  OP2   . U   C 2 17 ? -21.713 -77.664 -16.643 1.00 13.62 ? 17 U   C OP2   1 
ATOM   1339 O  "O5'" . U   C 2 17 ? -20.975 -75.312 -16.921 1.00 12.96 ? 17 U   C "O5'" 1 
ATOM   1340 C  "C5'" . U   C 2 17 ? -21.089 -73.906 -16.792 1.00 12.32 ? 17 U   C "C5'" 1 
ATOM   1341 C  "C4'" . U   C 2 17 ? -20.256 -73.228 -17.873 1.00 12.60 ? 17 U   C "C4'" 1 
ATOM   1342 O  "O4'" . U   C 2 17 ? -18.848 -73.597 -17.861 1.00 11.02 ? 17 U   C "O4'" 1 
ATOM   1343 C  "C3'" . U   C 2 17 ? -20.686 -73.557 -19.295 1.00 12.68 ? 17 U   C "C3'" 1 
ATOM   1344 O  "O3'" . U   C 2 17 ? -21.800 -72.781 -19.621 1.00 12.28 ? 17 U   C "O3'" 1 
ATOM   1345 C  "C2'" . U   C 2 17 ? -19.462 -73.134 -20.093 1.00 12.00 ? 17 U   C "C2'" 1 
ATOM   1346 O  "O2'" . U   C 2 17 ? -19.330 -71.734 -20.186 1.00 12.68 ? 17 U   C "O2'" 1 
ATOM   1347 C  "C1'" . U   C 2 17 ? -18.374 -73.682 -19.199 1.00 11.75 ? 17 U   C "C1'" 1 
ATOM   1348 N  N1    . U   C 2 17 ? -17.982 -75.088 -19.570 1.00 12.58 ? 17 U   C N1    1 
ATOM   1349 C  C2    . U   C 2 17 ? -17.169 -75.277 -20.676 1.00 13.26 ? 17 U   C C2    1 
ATOM   1350 O  O2    . U   C 2 17 ? -16.750 -74.368 -21.394 1.00 13.82 ? 17 U   C O2    1 
ATOM   1351 N  N3    . U   C 2 17 ? -16.851 -76.591 -20.926 1.00 12.89 ? 17 U   C N3    1 
ATOM   1352 C  C4    . U   C 2 17 ? -17.247 -77.710 -20.222 1.00 12.36 ? 17 U   C C4    1 
ATOM   1353 O  O4    . U   C 2 17 ? -16.865 -78.815 -20.591 1.00 12.78 ? 17 U   C O4    1 
ATOM   1354 C  C5    . U   C 2 17 ? -18.094 -77.443 -19.093 1.00 12.33 ? 17 U   C C5    1 
ATOM   1355 C  C6    . U   C 2 17 ? -18.417 -76.172 -18.819 1.00 12.36 ? 17 U   C C6    1 
ATOM   1356 P  P     . C   C 2 18 ? -22.789 -73.239 -20.784 1.00 13.01 ? 18 C   C P     1 
ATOM   1357 O  OP1   . C   C 2 18 ? -23.891 -72.231 -20.811 1.00 12.13 ? 18 C   C OP1   1 
ATOM   1358 O  OP2   . C   C 2 18 ? -23.064 -74.690 -20.632 1.00 10.60 ? 18 C   C OP2   1 
ATOM   1359 O  "O5'" . C   C 2 18 ? -21.896 -73.021 -22.098 1.00 14.70 ? 18 C   C "O5'" 1 
ATOM   1360 C  "C5'" . C   C 2 18 ? -21.823 -71.748 -22.727 1.00 16.41 ? 18 C   C "C5'" 1 
ATOM   1361 C  "C4'" . C   C 2 18 ? -20.846 -71.819 -23.875 1.00 18.00 ? 18 C   C "C4'" 1 
ATOM   1362 O  "O4'" . C   C 2 18 ? -19.633 -72.509 -23.466 1.00 17.07 ? 18 C   C "O4'" 1 
ATOM   1363 C  "C3'" . C   C 2 18 ? -21.345 -72.671 -25.023 1.00 19.59 ? 18 C   C "C3'" 1 
ATOM   1364 O  "O3'" . C   C 2 18 ? -22.233 -71.968 -25.866 1.00 21.31 ? 18 C   C "O3'" 1 
ATOM   1365 C  "C2'" . C   C 2 18 ? -20.040 -73.016 -25.727 1.00 19.43 ? 18 C   C "C2'" 1 
ATOM   1366 O  "O2'" . C   C 2 18 ? -19.525 -71.907 -26.446 1.00 21.36 ? 18 C   C "O2'" 1 
ATOM   1367 C  "C1'" . C   C 2 18 ? -19.155 -73.314 -24.533 1.00 16.81 ? 18 C   C "C1'" 1 
ATOM   1368 N  N1    . C   C 2 18 ? -19.109 -74.760 -24.127 1.00 16.94 ? 18 C   C N1    1 
ATOM   1369 C  C2    . C   C 2 18 ? -18.301 -75.648 -24.860 1.00 16.00 ? 18 C   C C2    1 
ATOM   1370 O  O2    . C   C 2 18 ? -17.668 -75.224 -25.835 1.00 15.15 ? 18 C   C O2    1 
ATOM   1371 N  N3    . C   C 2 18 ? -18.242 -76.955 -24.472 1.00 15.05 ? 18 C   C N3    1 
ATOM   1372 C  C4    . C   C 2 18 ? -18.936 -77.384 -23.413 1.00 14.88 ? 18 C   C C4    1 
ATOM   1373 N  N4    . C   C 2 18 ? -18.830 -78.672 -23.093 1.00 15.96 ? 18 C   C N4    1 
ATOM   1374 C  C5    . C   C 2 18 ? -19.763 -76.514 -22.645 1.00 14.59 ? 18 C   C C5    1 
ATOM   1375 C  C6    . C   C 2 18 ? -19.813 -75.228 -23.033 1.00 16.53 ? 18 C   C C6    1 
ATOM   1376 P  P     . U   C 2 19 ? -23.356 -72.866 -26.568 1.00 24.46 ? 19 U   C P     1 
ATOM   1377 O  OP1   . U   C 2 19 ? -24.461 -72.012 -27.049 1.00 24.28 ? 19 U   C OP1   1 
ATOM   1378 O  OP2   . U   C 2 19 ? -23.689 -73.954 -25.621 1.00 25.16 ? 19 U   C OP2   1 
ATOM   1379 O  "O5'" . U   C 2 19 ? -22.592 -73.519 -27.823 1.00 25.95 ? 19 U   C "O5'" 1 
ATOM   1380 C  "C5'" . U   C 2 19 ? -21.694 -72.811 -28.679 1.00 28.38 ? 19 U   C "C5'" 1 
ATOM   1381 C  "C4'" . U   C 2 19 ? -21.004 -73.795 -29.605 1.00 30.73 ? 19 U   C "C4'" 1 
ATOM   1382 O  "O4'" . U   C 2 19 ? -20.045 -74.595 -28.879 1.00 30.21 ? 19 U   C "O4'" 1 
ATOM   1383 C  "C3'" . U   C 2 19 ? -21.935 -74.846 -30.181 1.00 33.25 ? 19 U   C "C3'" 1 
ATOM   1384 O  "O3'" . U   C 2 19 ? -22.591 -74.322 -31.302 1.00 38.38 ? 19 U   C "O3'" 1 
ATOM   1385 C  "C2'" . U   C 2 19 ? -20.990 -75.971 -30.569 1.00 31.83 ? 19 U   C "C2'" 1 
ATOM   1386 O  "O2'" . U   C 2 19 ? -20.264 -75.722 -31.760 1.00 32.31 ? 19 U   C "O2'" 1 
ATOM   1387 C  "C1'" . U   C 2 19 ? -20.026 -75.919 -29.400 1.00 29.27 ? 19 U   C "C1'" 1 
ATOM   1388 N  N1    . U   C 2 19 ? -20.270 -76.930 -28.317 1.00 27.62 ? 19 U   C N1    1 
ATOM   1389 C  C2    . U   C 2 19 ? -19.614 -78.130 -28.413 1.00 26.71 ? 19 U   C C2    1 
ATOM   1390 O  O2    . U   C 2 19 ? -18.880 -78.409 -29.335 1.00 27.14 ? 19 U   C O2    1 
ATOM   1391 N  N3    . U   C 2 19 ? -19.839 -79.006 -27.388 1.00 26.86 ? 19 U   C N3    1 
ATOM   1392 C  C4    . U   C 2 19 ? -20.645 -78.806 -26.297 1.00 26.95 ? 19 U   C C4    1 
ATOM   1393 O  O4    . U   C 2 19 ? -20.746 -79.697 -25.472 1.00 27.39 ? 19 U   C O4    1 
ATOM   1394 C  C5    . U   C 2 19 ? -21.305 -77.531 -26.252 1.00 27.05 ? 19 U   C C5    1 
ATOM   1395 C  C6    . U   C 2 19 ? -21.094 -76.655 -27.242 1.00 27.45 ? 19 U   C C6    1 
ATOM   1396 P  P     . U   C 2 20 ? -23.971 -75.002 -31.713 1.00 43.43 ? 20 U   C P     1 
ATOM   1397 O  OP1   . U   C 2 20 ? -24.810 -73.912 -32.279 1.00 43.12 ? 20 U   C OP1   1 
ATOM   1398 O  OP2   . U   C 2 20 ? -23.597 -76.216 -32.491 1.00 42.80 ? 20 U   C OP2   1 
ATOM   1399 P  P     . A   D 2 1  ? -15.789 -89.724 -27.633 1.00 24.40 ? 1  A   D P     1 
ATOM   1400 O  OP1   . A   D 2 1  ? -17.055 -90.370 -28.003 1.00 24.33 ? 1  A   D OP1   1 
ATOM   1401 O  OP2   . A   D 2 1  ? -14.599 -90.575 -27.367 1.00 23.16 ? 1  A   D OP2   1 
ATOM   1402 O  "O5'" . A   D 2 1  ? -15.470 -88.703 -28.812 1.00 24.81 ? 1  A   D "O5'" 1 
ATOM   1403 C  "C5'" . A   D 2 1  ? -15.462 -89.065 -30.180 1.00 24.88 ? 1  A   D "C5'" 1 
ATOM   1404 C  "C4'" . A   D 2 1  ? -15.422 -87.748 -30.922 1.00 25.12 ? 1  A   D "C4'" 1 
ATOM   1405 O  "O4'" . A   D 2 1  ? -16.709 -87.106 -30.760 1.00 25.83 ? 1  A   D "O4'" 1 
ATOM   1406 C  "C3'" . A   D 2 1  ? -14.470 -86.715 -30.328 1.00 24.84 ? 1  A   D "C3'" 1 
ATOM   1407 O  "O3'" . A   D 2 1  ? -13.141 -86.901 -30.743 1.00 23.61 ? 1  A   D "O3'" 1 
ATOM   1408 C  "C2'" . A   D 2 1  ? -15.039 -85.437 -30.906 1.00 25.63 ? 1  A   D "C2'" 1 
ATOM   1409 O  "O2'" . A   D 2 1  ? -14.770 -85.313 -32.292 1.00 25.00 ? 1  A   D "O2'" 1 
ATOM   1410 C  "C1'" . A   D 2 1  ? -16.524 -85.696 -30.672 1.00 26.37 ? 1  A   D "C1'" 1 
ATOM   1411 N  N9    . A   D 2 1  ? -17.087 -85.152 -29.423 1.00 26.55 ? 1  A   D N9    1 
ATOM   1412 C  C8    . A   D 2 1  ? -17.342 -85.786 -28.231 1.00 26.55 ? 1  A   D C8    1 
ATOM   1413 N  N7    . A   D 2 1  ? -17.867 -85.008 -27.302 1.00 26.49 ? 1  A   D N7    1 
ATOM   1414 C  C5    . A   D 2 1  ? -17.970 -83.770 -27.928 1.00 27.26 ? 1  A   D C5    1 
ATOM   1415 C  C6    . A   D 2 1  ? -18.455 -82.494 -27.508 1.00 26.91 ? 1  A   D C6    1 
ATOM   1416 N  N6    . A   D 2 1  ? -18.953 -82.233 -26.291 1.00 26.47 ? 1  A   D N6    1 
ATOM   1417 N  N1    . A   D 2 1  ? -18.410 -81.474 -28.402 1.00 26.38 ? 1  A   D N1    1 
ATOM   1418 C  C2    . A   D 2 1  ? -17.921 -81.706 -29.630 1.00 26.57 ? 1  A   D C2    1 
ATOM   1419 N  N3    . A   D 2 1  ? -17.446 -82.847 -30.142 1.00 26.83 ? 1  A   D N3    1 
ATOM   1420 C  C4    . A   D 2 1  ? -17.493 -83.847 -29.235 1.00 27.06 ? 1  A   D C4    1 
ATOM   1421 P  P     . G   D 2 2  ? -11.958 -86.261 -29.882 1.00 24.59 ? 2  G   D P     1 
ATOM   1422 O  OP1   . G   D 2 2  ? -10.673 -86.842 -30.340 1.00 24.22 ? 2  G   D OP1   1 
ATOM   1423 O  OP2   . G   D 2 2  ? -12.304 -86.169 -28.432 1.00 23.93 ? 2  G   D OP2   1 
ATOM   1424 O  "O5'" . G   D 2 2  ? -11.995 -84.787 -30.430 1.00 24.50 ? 2  G   D "O5'" 1 
ATOM   1425 C  "C5'" . G   D 2 2  ? -11.564 -83.790 -29.550 1.00 23.02 ? 2  G   D "C5'" 1 
ATOM   1426 C  "C4'" . G   D 2 2  ? -12.095 -82.502 -30.108 1.00 21.75 ? 2  G   D "C4'" 1 
ATOM   1427 O  "O4'" . G   D 2 2  ? -13.549 -82.491 -30.098 1.00 21.95 ? 2  G   D "O4'" 1 
ATOM   1428 C  "C3'" . G   D 2 2  ? -11.685 -81.339 -29.257 1.00 20.77 ? 2  G   D "C3'" 1 
ATOM   1429 O  "O3'" . G   D 2 2  ? -10.385 -81.014 -29.647 1.00 17.65 ? 2  G   D "O3'" 1 
ATOM   1430 C  "C2'" . G   D 2 2  ? -12.737 -80.342 -29.713 1.00 21.59 ? 2  G   D "C2'" 1 
ATOM   1431 O  "O2'" . G   D 2 2  ? -12.444 -79.896 -31.016 1.00 23.25 ? 2  G   D "O2'" 1 
ATOM   1432 C  "C1'" . G   D 2 2  ? -13.997 -81.213 -29.699 1.00 21.94 ? 2  G   D "C1'" 1 
ATOM   1433 N  N9    . G   D 2 2  ? -14.646 -81.305 -28.381 1.00 22.22 ? 2  G   D N9    1 
ATOM   1434 C  C8    . G   D 2 2  ? -14.716 -82.381 -27.519 1.00 22.01 ? 2  G   D C8    1 
ATOM   1435 N  N7    . G   D 2 2  ? -15.363 -82.134 -26.405 1.00 21.80 ? 2  G   D N7    1 
ATOM   1436 C  C5    . G   D 2 2  ? -15.754 -80.801 -26.532 1.00 22.27 ? 2  G   D C5    1 
ATOM   1437 C  C6    . G   D 2 2  ? -16.494 -79.947 -25.663 1.00 22.11 ? 2  G   D C6    1 
ATOM   1438 O  O6    . G   D 2 2  ? -16.983 -80.189 -24.549 1.00 22.49 ? 2  G   D O6    1 
ATOM   1439 N  N1    . G   D 2 2  ? -16.655 -78.672 -26.194 1.00 22.07 ? 2  G   D N1    1 
ATOM   1440 C  C2    . G   D 2 2  ? -16.179 -78.259 -27.413 1.00 21.91 ? 2  G   D C2    1 
ATOM   1441 N  N2    . G   D 2 2  ? -16.425 -76.992 -27.772 1.00 22.02 ? 2  G   D N2    1 
ATOM   1442 N  N3    . G   D 2 2  ? -15.503 -79.040 -28.234 1.00 22.35 ? 2  G   D N3    1 
ATOM   1443 C  C4    . G   D 2 2  ? -15.319 -80.287 -27.738 1.00 22.31 ? 2  G   D C4    1 
ATOM   1444 P  P     . A   D 2 3  ? -9.342  -80.461 -28.569 1.00 16.59 ? 3  A   D P     1 
ATOM   1445 O  OP1   . A   D 2 3  ? -8.085  -80.209 -29.298 1.00 18.56 ? 3  A   D OP1   1 
ATOM   1446 O  OP2   . A   D 2 3  ? -9.322  -81.282 -27.346 1.00 14.02 ? 3  A   D OP2   1 
ATOM   1447 O  "O5'" . A   D 2 3  ? -9.918  -78.997 -28.289 1.00 17.45 ? 3  A   D "O5'" 1 
ATOM   1448 C  "C5'" . A   D 2 3  ? -10.123 -78.106 -29.400 1.00 16.60 ? 3  A   D "C5'" 1 
ATOM   1449 C  "C4'" . A   D 2 3  ? -10.817 -76.837 -28.949 1.00 16.17 ? 3  A   D "C4'" 1 
ATOM   1450 O  "O4'" . A   D 2 3  ? -12.231 -77.087 -28.737 1.00 14.84 ? 3  A   D "O4'" 1 
ATOM   1451 C  "C3'" . A   D 2 3  ? -10.339 -76.292 -27.613 1.00 15.15 ? 3  A   D "C3'" 1 
ATOM   1452 O  "O3'" . A   D 2 3  ? -9.157  -75.572 -27.771 1.00 15.69 ? 3  A   D "O3'" 1 
ATOM   1453 C  "C2'" . A   D 2 3  ? -11.523 -75.405 -27.279 1.00 15.10 ? 3  A   D "C2'" 1 
ATOM   1454 O  "O2'" . A   D 2 3  ? -11.575 -74.249 -28.085 1.00 14.88 ? 3  A   D "O2'" 1 
ATOM   1455 C  "C1'" . A   D 2 3  ? -12.672 -76.356 -27.610 1.00 15.07 ? 3  A   D "C1'" 1 
ATOM   1456 N  N9    . A   D 2 3  ? -12.972 -77.254 -26.485 1.00 15.30 ? 3  A   D N9    1 
ATOM   1457 C  C8    . A   D 2 3  ? -12.498 -78.522 -26.256 1.00 15.29 ? 3  A   D C8    1 
ATOM   1458 N  N7    . A   D 2 3  ? -12.931 -79.080 -25.146 1.00 15.28 ? 3  A   D N7    1 
ATOM   1459 C  C5    . A   D 2 3  ? -13.752 -78.111 -24.596 1.00 15.51 ? 3  A   D C5    1 
ATOM   1460 C  C6    . A   D 2 3  ? -14.522 -78.074 -23.411 1.00 15.06 ? 3  A   D C6    1 
ATOM   1461 N  N6    . A   D 2 3  ? -14.589 -79.076 -22.533 1.00 15.06 ? 3  A   D N6    1 
ATOM   1462 N  N1    . A   D 2 3  ? -15.223 -76.946 -23.157 1.00 15.47 ? 3  A   D N1    1 
ATOM   1463 C  C2    . A   D 2 3  ? -15.159 -75.926 -24.032 1.00 15.55 ? 3  A   D C2    1 
ATOM   1464 N  N3    . A   D 2 3  ? -14.479 -75.841 -25.185 1.00 15.49 ? 3  A   D N3    1 
ATOM   1465 C  C4    . A   D 2 3  ? -13.783 -76.976 -25.407 1.00 15.72 ? 3  A   D C4    1 
ATOM   1466 P  P     . C   D 2 4  ? -8.062  -75.611 -26.606 1.00 20.08 ? 4  C   D P     1 
ATOM   1467 O  OP1   . C   D 2 4  ? -6.951  -74.721 -26.994 1.00 20.82 ? 4  C   D OP1   1 
ATOM   1468 O  OP2   . C   D 2 4  ? -7.742  -77.008 -26.237 1.00 20.49 ? 4  C   D OP2   1 
ATOM   1469 O  "O5'" . C   D 2 4  ? -8.800  -74.874 -25.393 1.00 21.12 ? 4  C   D "O5'" 1 
ATOM   1470 C  "C5'" . C   D 2 4  ? -8.919  -73.449 -25.457 1.00 21.94 ? 4  C   D "C5'" 1 
ATOM   1471 C  "C4'" . C   D 2 4  ? -9.771  -72.934 -24.324 1.00 21.92 ? 4  C   D "C4'" 1 
ATOM   1472 O  "O4'" . C   D 2 4  ? -11.063 -73.600 -24.340 1.00 21.53 ? 4  C   D "O4'" 1 
ATOM   1473 C  "C3'" . C   D 2 4  ? -9.261  -73.233 -22.918 1.00 20.87 ? 4  C   D "C3'" 1 
ATOM   1474 O  "O3'" . C   D 2 4  ? -8.189  -72.392 -22.546 1.00 21.06 ? 4  C   D "O3'" 1 
ATOM   1475 C  "C2'" . C   D 2 4  ? -10.541 -72.915 -22.160 1.00 20.33 ? 4  C   D "C2'" 1 
ATOM   1476 O  "O2'" . C   D 2 4  ? -10.861 -71.535 -22.236 1.00 18.90 ? 4  C   D "O2'" 1 
ATOM   1477 C  "C1'" . C   D 2 4  ? -11.506 -73.750 -22.993 1.00 20.27 ? 4  C   D "C1'" 1 
ATOM   1478 N  N1    . C   D 2 4  ? -11.564 -75.205 -22.562 1.00 19.86 ? 4  C   D N1    1 
ATOM   1479 C  C2    . C   D 2 4  ? -12.398 -75.553 -21.498 1.00 20.13 ? 4  C   D C2    1 
ATOM   1480 O  O2    . C   D 2 4  ? -13.060 -74.663 -20.961 1.00 20.35 ? 4  C   D O2    1 
ATOM   1481 N  N3    . C   D 2 4  ? -12.469 -76.847 -21.089 1.00 20.53 ? 4  C   D N3    1 
ATOM   1482 C  C4    . C   D 2 4  ? -11.731 -77.781 -21.700 1.00 20.19 ? 4  C   D C4    1 
ATOM   1483 N  N4    . C   D 2 4  ? -11.830 -79.045 -21.271 1.00 19.28 ? 4  C   D N4    1 
ATOM   1484 C  C5    . C   D 2 4  ? -10.864 -77.457 -22.786 1.00 19.60 ? 4  C   D C5    1 
ATOM   1485 C  C6    . C   D 2 4  ? -10.821 -76.176 -23.176 1.00 19.64 ? 4  C   D C6    1 
ATOM   1486 P  P     . A   D 2 5  ? -7.150  -72.894 -21.426 1.00 21.91 ? 5  A   D P     1 
ATOM   1487 O  OP1   . A   D 2 5  ? -6.111  -71.827 -21.285 1.00 20.41 ? 5  A   D OP1   1 
ATOM   1488 O  OP2   . A   D 2 5  ? -6.760  -74.295 -21.709 1.00 20.63 ? 5  A   D OP2   1 
ATOM   1489 O  "O5'" . A   D 2 5  ? -8.036  -72.928 -20.088 1.00 19.46 ? 5  A   D "O5'" 1 
ATOM   1490 C  "C5'" . A   D 2 5  ? -8.330  -71.718 -19.438 1.00 16.37 ? 5  A   D "C5'" 1 
ATOM   1491 C  "C4'" . A   D 2 5  ? -9.410  -71.946 -18.415 1.00 15.17 ? 5  A   D "C4'" 1 
ATOM   1492 O  "O4'" . A   D 2 5  ? -10.442 -72.851 -18.898 1.00 15.18 ? 5  A   D "O4'" 1 
ATOM   1493 C  "C3'" . A   D 2 5  ? -8.935  -72.620 -17.151 1.00 14.12 ? 5  A   D "C3'" 1 
ATOM   1494 O  "O3'" . A   D 2 5  ? -8.212  -71.701 -16.412 1.00 12.17 ? 5  A   D "O3'" 1 
ATOM   1495 C  "C2'" . A   D 2 5  ? -10.302 -72.952 -16.557 1.00 14.86 ? 5  A   D "C2'" 1 
ATOM   1496 O  "O2'" . A   D 2 5  ? -11.022 -71.806 -16.147 1.00 12.56 ? 5  A   D "O2'" 1 
ATOM   1497 C  "C1'" . A   D 2 5  ? -10.965 -73.579 -17.790 1.00 15.48 ? 5  A   D "C1'" 1 
ATOM   1498 N  N9    . A   D 2 5  ? -10.693 -75.025 -17.953 1.00 15.68 ? 5  A   D N9    1 
ATOM   1499 C  C8    . A   D 2 5  ? -9.843  -75.632 -18.849 1.00 15.37 ? 5  A   D C8    1 
ATOM   1500 N  N7    . A   D 2 5  ? -9.810  -76.942 -18.767 1.00 14.87 ? 5  A   D N7    1 
ATOM   1501 C  C5    . A   D 2 5  ? -10.699 -77.231 -17.745 1.00 14.83 ? 5  A   D C5    1 
ATOM   1502 C  C6    . A   D 2 5  ? -11.113 -78.444 -17.145 1.00 14.82 ? 5  A   D C6    1 
ATOM   1503 N  N6    . A   D 2 5  ? -10.670 -79.643 -17.521 1.00 15.00 ? 5  A   D N6    1 
ATOM   1504 N  N1    . A   D 2 5  ? -12.003 -78.386 -16.126 1.00 15.61 ? 5  A   D N1    1 
ATOM   1505 C  C2    . A   D 2 5  ? -12.453 -77.179 -15.743 1.00 15.82 ? 5  A   D C2    1 
ATOM   1506 N  N3    . A   D 2 5  ? -12.144 -75.963 -16.226 1.00 15.79 ? 5  A   D N3    1 
ATOM   1507 C  C4    . A   D 2 5  ? -11.250 -76.060 -17.231 1.00 15.48 ? 5  A   D C4    1 
ATOM   1508 P  P     . G   D 2 6  ? -7.097  -72.173 -15.372 1.00 12.51 ? 6  G   D P     1 
ATOM   1509 O  OP1   . G   D 2 6  ? -6.377  -70.954 -14.925 1.00 10.78 ? 6  G   D OP1   1 
ATOM   1510 O  OP2   . G   D 2 6  ? -6.342  -73.309 -15.977 1.00 12.91 ? 6  G   D OP2   1 
ATOM   1511 O  "O5'" . G   D 2 6  ? -7.947  -72.708 -14.121 1.00 12.41 ? 6  G   D "O5'" 1 
ATOM   1512 C  "C5'" . G   D 2 6  ? -8.806  -71.825 -13.407 1.00 12.33 ? 6  G   D "C5'" 1 
ATOM   1513 C  "C4'" . G   D 2 6  ? -9.698  -72.574 -12.441 1.00 12.92 ? 6  G   D "C4'" 1 
ATOM   1514 O  "O4'" . G   D 2 6  ? -10.578 -73.462 -13.160 1.00 12.80 ? 6  G   D "O4'" 1 
ATOM   1515 C  "C3'" . G   D 2 6  ? -8.979  -73.519 -11.498 1.00 13.42 ? 6  G   D "C3'" 1 
ATOM   1516 O  "O3'" . G   D 2 6  ? -8.380  -72.771 -10.461 1.00 16.02 ? 6  G   D "O3'" 1 
ATOM   1517 C  "C2'" . G   D 2 6  ? -10.133 -74.442 -11.072 1.00 12.32 ? 6  G   D "C2'" 1 
ATOM   1518 O  "O2'" . G   D 2 6  ? -11.105 -73.950 -10.152 1.00 9.49  ? 6  G   D "O2'" 1 
ATOM   1519 C  "C1'" . G   D 2 6  ? -10.773 -74.655 -12.433 1.00 12.61 ? 6  G   D "C1'" 1 
ATOM   1520 N  N9    . G   D 2 6  ? -10.159 -75.747 -13.169 1.00 12.69 ? 6  G   D N9    1 
ATOM   1521 C  C8    . G   D 2 6  ? -9.298  -75.651 -14.235 1.00 12.89 ? 6  G   D C8    1 
ATOM   1522 N  N7    . G   D 2 6  ? -8.895  -76.805 -14.692 1.00 13.03 ? 6  G   D N7    1 
ATOM   1523 C  C5    . G   D 2 6  ? -9.536  -77.723 -13.879 1.00 13.56 ? 6  G   D C5    1 
ATOM   1524 C  C6    . G   D 2 6  ? -9.490  -79.134 -13.901 1.00 13.43 ? 6  G   D C6    1 
ATOM   1525 O  O6    . G   D 2 6  ? -8.862  -79.859 -14.662 1.00 13.38 ? 6  G   D O6    1 
ATOM   1526 N  N1    . G   D 2 6  ? -10.272 -79.717 -12.912 1.00 13.38 ? 6  G   D N1    1 
ATOM   1527 C  C2    . G   D 2 6  ? -11.011 -79.007 -12.005 1.00 13.09 ? 6  G   D C2    1 
ATOM   1528 N  N2    . G   D 2 6  ? -11.680 -79.776 -11.150 1.00 13.35 ? 6  G   D N2    1 
ATOM   1529 N  N3    . G   D 2 6  ? -11.089 -77.677 -11.953 1.00 13.05 ? 6  G   D N3    1 
ATOM   1530 C  C4    . G   D 2 6  ? -10.322 -77.096 -12.927 1.00 13.91 ? 6  G   D C4    1 
ATOM   1531 P  P     . C   D 2 7  ? -7.090  -73.321 -9.707  1.00 19.31 ? 7  C   D P     1 
ATOM   1532 O  OP1   . C   D 2 7  ? -6.703  -72.179 -8.859  1.00 20.36 ? 7  C   D OP1   1 
ATOM   1533 O  OP2   . C   D 2 7  ? -6.132  -73.922 -10.678 1.00 20.61 ? 7  C   D OP2   1 
ATOM   1534 O  "O5'" . C   D 2 7  ? -7.579  -74.540 -8.773  1.00 19.67 ? 7  C   D "O5'" 1 
ATOM   1535 C  "C5'" . C   D 2 7  ? -8.525  -74.324 -7.727  1.00 21.01 ? 7  C   D "C5'" 1 
ATOM   1536 C  "C4'" . C   D 2 7  ? -9.029  -75.629 -7.132  1.00 20.62 ? 7  C   D "C4'" 1 
ATOM   1537 O  "O4'" . C   D 2 7  ? -9.789  -76.404 -8.105  1.00 20.26 ? 7  C   D "O4'" 1 
ATOM   1538 C  "C3'" . C   D 2 7  ? -7.941  -76.576 -6.664  1.00 20.63 ? 7  C   D "C3'" 1 
ATOM   1539 O  "O3'" . C   D 2 7  ? -7.550  -76.196 -5.385  1.00 20.73 ? 7  C   D "O3'" 1 
ATOM   1540 C  "C2'" . C   D 2 7  ? -8.734  -77.871 -6.648  1.00 20.16 ? 7  C   D "C2'" 1 
ATOM   1541 O  "O2'" . C   D 2 7  ? -9.650  -77.891 -5.575  1.00 20.33 ? 7  C   D "O2'" 1 
ATOM   1542 C  "C1'" . C   D 2 7  ? -9.470  -77.775 -7.984  1.00 19.30 ? 7  C   D "C1'" 1 
ATOM   1543 N  N1    . C   D 2 7  ? -8.621  -78.253 -9.166  1.00 19.45 ? 7  C   D N1    1 
ATOM   1544 C  C2    . C   D 2 7  ? -8.560  -79.621 -9.476  1.00 17.96 ? 7  C   D C2    1 
ATOM   1545 O  O2    . C   D 2 7  ? -9.202  -80.437 -8.806  1.00 17.78 ? 7  C   D O2    1 
ATOM   1546 N  N3    . C   D 2 7  ? -7.787  -80.020 -10.513 1.00 17.77 ? 7  C   D N3    1 
ATOM   1547 C  C4    . C   D 2 7  ? -7.099  -79.137 -11.219 1.00 17.56 ? 7  C   D C4    1 
ATOM   1548 N  N4    . C   D 2 7  ? -6.372  -79.607 -12.218 1.00 18.41 ? 7  C   D N4    1 
ATOM   1549 C  C5    . C   D 2 7  ? -7.120  -77.748 -10.940 1.00 17.91 ? 7  C   D C5    1 
ATOM   1550 C  C6    . C   D 2 7  ? -7.885  -77.359 -9.916  1.00 19.19 ? 7  C   D C6    1 
ATOM   1551 P  P     . A   D 2 8  ? -6.077  -76.469 -4.839  1.00 21.69 ? 8  A   D P     1 
ATOM   1552 O  OP1   . A   D 2 8  ? -6.060  -75.759 -3.534  1.00 21.26 ? 8  A   D OP1   1 
ATOM   1553 O  OP2   . A   D 2 8  ? -5.093  -76.147 -5.900  1.00 22.29 ? 8  A   D OP2   1 
ATOM   1554 O  "O5'" . A   D 2 8  ? -5.948  -78.056 -4.626  1.00 20.16 ? 8  A   D "O5'" 1 
ATOM   1555 C  "C5'" . A   D 2 8  ? -6.766  -78.778 -3.730  1.00 19.82 ? 8  A   D "C5'" 1 
ATOM   1556 C  "C4'" . A   D 2 8  ? -6.755  -80.251 -4.086  1.00 19.74 ? 8  A   D "C4'" 1 
ATOM   1557 O  "O4'" . A   D 2 8  ? -7.251  -80.470 -5.433  1.00 19.75 ? 8  A   D "O4'" 1 
ATOM   1558 C  "C3'" . A   D 2 8  ? -5.370  -80.865 -4.146  1.00 19.42 ? 8  A   D "C3'" 1 
ATOM   1559 O  "O3'" . A   D 2 8  ? -4.852  -81.114 -2.854  1.00 18.25 ? 8  A   D "O3'" 1 
ATOM   1560 C  "C2'" . A   D 2 8  ? -5.658  -82.144 -4.923  1.00 20.10 ? 8  A   D "C2'" 1 
ATOM   1561 O  "O2'" . A   D 2 8  ? -6.213  -83.184 -4.137  1.00 21.32 ? 8  A   D "O2'" 1 
ATOM   1562 C  "C1'" . A   D 2 8  ? -6.659  -81.638 -5.961  1.00 19.05 ? 8  A   D "C1'" 1 
ATOM   1563 N  N9    . A   D 2 8  ? -5.982  -81.335 -7.216  1.00 18.24 ? 8  A   D N9    1 
ATOM   1564 C  C8    . A   D 2 8  ? -5.662  -80.114 -7.741  1.00 18.74 ? 8  A   D C8    1 
ATOM   1565 N  N7    . A   D 2 8  ? -5.025  -80.176 -8.891  1.00 18.95 ? 8  A   D N7    1 
ATOM   1566 C  C5    . A   D 2 8  ? -4.916  -81.544 -9.125  1.00 18.66 ? 8  A   D C5    1 
ATOM   1567 C  C6    . A   D 2 8  ? -4.355  -82.312 -10.173 1.00 19.02 ? 8  A   D C6    1 
ATOM   1568 N  N6    . A   D 2 8  ? -3.769  -81.786 -11.259 1.00 17.96 ? 8  A   D N6    1 
ATOM   1569 N  N1    . A   D 2 8  ? -4.425  -83.668 -10.071 1.00 19.64 ? 8  A   D N1    1 
ATOM   1570 C  C2    . A   D 2 8  ? -5.016  -84.237 -9.011  1.00 18.66 ? 8  A   D C2    1 
ATOM   1571 N  N3    . A   D 2 8  ? -5.577  -83.612 -7.984  1.00 18.71 ? 8  A   D N3    1 
ATOM   1572 C  C4    . A   D 2 8  ? -5.499  -82.267 -8.101  1.00 18.33 ? 8  A   D C4    1 
ATOM   1573 P  P     . U   D 2 9  ? -3.280  -80.925 -2.656  1.00 16.96 ? 9  U   D P     1 
ATOM   1574 O  OP1   . U   D 2 9  ? -2.902  -80.847 -1.228  1.00 16.92 ? 9  U   D OP1   1 
ATOM   1575 O  OP2   . U   D 2 9  ? -2.904  -79.831 -3.580  1.00 18.66 ? 9  U   D OP2   1 
ATOM   1576 O  "O5'" . U   D 2 9  ? -2.762  -82.339 -3.156  1.00 16.33 ? 9  U   D "O5'" 1 
ATOM   1577 C  "C5'" . U   D 2 9  ? -3.117  -83.482 -2.372  1.00 14.16 ? 9  U   D "C5'" 1 
ATOM   1578 C  "C4'" . U   D 2 9  ? -2.763  -84.692 -3.187  1.00 13.30 ? 9  U   D "C4'" 1 
ATOM   1579 O  "O4'" . U   D 2 9  ? -3.344  -84.501 -4.490  1.00 15.46 ? 9  U   D "O4'" 1 
ATOM   1580 C  "C3'" . U   D 2 9  ? -1.308  -84.765 -3.570  1.00 12.96 ? 9  U   D "C3'" 1 
ATOM   1581 O  "O3'" . U   D 2 9  ? -0.525  -85.180 -2.474  1.00 12.37 ? 9  U   D "O3'" 1 
ATOM   1582 C  "C2'" . U   D 2 9  ? -1.387  -85.735 -4.744  1.00 14.16 ? 9  U   D "C2'" 1 
ATOM   1583 O  "O2'" . U   D 2 9  ? -1.653  -87.068 -4.416  1.00 16.77 ? 9  U   D "O2'" 1 
ATOM   1584 C  "C1'" . U   D 2 9  ? -2.630  -85.241 -5.454  1.00 14.23 ? 9  U   D "C1'" 1 
ATOM   1585 N  N1    . U   D 2 9  ? -2.202  -84.399 -6.576  1.00 14.33 ? 9  U   D N1    1 
ATOM   1586 C  C2    . U   D 2 9  ? -1.624  -85.063 -7.637  1.00 15.02 ? 9  U   D C2    1 
ATOM   1587 O  O2    . U   D 2 9  ? -1.516  -86.282 -7.641  1.00 14.19 ? 9  U   D O2    1 
ATOM   1588 N  N3    . U   D 2 9  ? -1.183  -84.249 -8.671  1.00 14.88 ? 9  U   D N3    1 
ATOM   1589 C  C4    . U   D 2 9  ? -1.274  -82.870 -8.723  1.00 13.75 ? 9  U   D C4    1 
ATOM   1590 O  O4    . U   D 2 9  ? -0.856  -82.274 -9.705  1.00 13.80 ? 9  U   D O4    1 
ATOM   1591 C  C5    . U   D 2 9  ? -1.883  -82.256 -7.571  1.00 13.91 ? 9  U   D C5    1 
ATOM   1592 C  C6    . U   D 2 9  ? -2.311  -83.020 -6.550  1.00 13.98 ? 9  U   D C6    1 
ATOM   1593 P  P     . U   D 2 10 ? 0.956   -84.603 -2.225  1.00 12.76 ? 10 U   D P     1 
ATOM   1594 O  OP1   . U   D 2 10 ? 1.535   -85.348 -1.086  1.00 16.09 ? 10 U   D OP1   1 
ATOM   1595 O  OP2   . U   D 2 10 ? 0.917   -83.130 -2.175  1.00 13.36 ? 10 U   D OP2   1 
ATOM   1596 O  "O5'" . U   D 2 10 ? 1.758   -85.135 -3.505  1.00 14.52 ? 10 U   D "O5'" 1 
ATOM   1597 C  "C5'" . U   D 2 10 ? 2.185   -86.509 -3.536  1.00 14.71 ? 10 U   D "C5'" 1 
ATOM   1598 C  "C4'" . U   D 2 10 ? 2.648   -86.868 -4.933  1.00 16.86 ? 10 U   D "C4'" 1 
ATOM   1599 O  "O4'" . U   D 2 10 ? 1.692   -86.434 -5.944  1.00 17.23 ? 10 U   D "O4'" 1 
ATOM   1600 C  "C3'" . U   D 2 10 ? 3.927   -86.176 -5.365  1.00 16.37 ? 10 U   D "C3'" 1 
ATOM   1601 O  "O3'" . U   D 2 10 ? 5.023   -86.823 -4.813  1.00 15.26 ? 10 U   D "O3'" 1 
ATOM   1602 C  "C2'" . U   D 2 10 ? 3.876   -86.346 -6.880  1.00 17.55 ? 10 U   D "C2'" 1 
ATOM   1603 O  "O2'" . U   D 2 10 ? 4.277   -87.624 -7.352  1.00 19.40 ? 10 U   D "O2'" 1 
ATOM   1604 C  "C1'" . U   D 2 10 ? 2.395   -86.097 -7.135  1.00 17.31 ? 10 U   D "C1'" 1 
ATOM   1605 N  N1    . U   D 2 10 ? 2.221   -84.673 -7.436  1.00 17.45 ? 10 U   D N1    1 
ATOM   1606 C  C2    . U   D 2 10 ? 2.661   -84.204 -8.661  1.00 17.56 ? 10 U   D C2    1 
ATOM   1607 O  O2    . U   D 2 10 ? 3.172   -84.933 -9.492  1.00 17.94 ? 10 U   D O2    1 
ATOM   1608 N  N3    . U   D 2 10 ? 2.473   -82.849 -8.864  1.00 17.60 ? 10 U   D N3    1 
ATOM   1609 C  C4    . U   D 2 10 ? 1.896   -81.952 -7.949  1.00 18.41 ? 10 U   D C4    1 
ATOM   1610 O  O4    . U   D 2 10 ? 1.780   -80.755 -8.227  1.00 18.14 ? 10 U   D O4    1 
ATOM   1611 C  C5    . U   D 2 10 ? 1.458   -82.523 -6.694  1.00 17.85 ? 10 U   D C5    1 
ATOM   1612 C  C6    . U   D 2 10 ? 1.640   -83.834 -6.493  1.00 18.30 ? 10 U   D C6    1 
ATOM   1613 P  P     . A   D 2 11 ? 6.384   -86.006 -4.635  1.00 14.93 ? 11 A   D P     1 
ATOM   1614 O  OP1   . A   D 2 11 ? 6.994   -86.390 -3.332  1.00 14.12 ? 11 A   D OP1   1 
ATOM   1615 O  OP2   . A   D 2 11 ? 6.098   -84.591 -4.972  1.00 15.16 ? 11 A   D OP2   1 
ATOM   1616 O  "O5'" . A   D 2 11 ? 7.314   -86.597 -5.791  1.00 15.21 ? 11 A   D "O5'" 1 
ATOM   1617 C  "C5'" . A   D 2 11 ? 7.428   -88.003 -6.012  1.00 14.63 ? 11 A   D "C5'" 1 
ATOM   1618 C  "C4'" . A   D 2 11 ? 8.037   -88.261 -7.387  1.00 14.02 ? 11 A   D "C4'" 1 
ATOM   1619 O  "O4'" . A   D 2 11 ? 7.166   -87.764 -8.438  1.00 13.61 ? 11 A   D "O4'" 1 
ATOM   1620 C  "C3'" . A   D 2 11 ? 9.339   -87.544 -7.705  1.00 13.31 ? 11 A   D "C3'" 1 
ATOM   1621 O  "O3'" . A   D 2 11 ? 10.441  -88.107 -7.027  1.00 10.61 ? 11 A   D "O3'" 1 
ATOM   1622 C  "C2'" . A   D 2 11 ? 9.377   -87.763 -9.220  1.00 14.58 ? 11 A   D "C2'" 1 
ATOM   1623 O  "O2'" . A   D 2 11 ? 9.768   -89.070 -9.580  1.00 17.38 ? 11 A   D "O2'" 1 
ATOM   1624 C  "C1'" . A   D 2 11 ? 7.927   -87.499 -9.602  1.00 13.80 ? 11 A   D "C1'" 1 
ATOM   1625 N  N9    . A   D 2 11 ? 7.767   -86.090 -9.918  1.00 13.85 ? 11 A   D N9    1 
ATOM   1626 C  C8    . A   D 2 11 ? 7.061   -85.177 -9.196  1.00 13.88 ? 11 A   D C8    1 
ATOM   1627 N  N7    . A   D 2 11 ? 7.111   -83.967 -9.703  1.00 14.11 ? 11 A   D N7    1 
ATOM   1628 C  C5    . A   D 2 11 ? 7.904   -84.091 -10.827 1.00 13.30 ? 11 A   D C5    1 
ATOM   1629 C  C6    . A   D 2 11 ? 8.341   -83.166 -11.797 1.00 14.23 ? 11 A   D C6    1 
ATOM   1630 N  N6    . A   D 2 11 ? 8.014   -81.862 -11.767 1.00 14.35 ? 11 A   D N6    1 
ATOM   1631 N  N1    . A   D 2 11 ? 9.129   -83.615 -12.809 1.00 14.12 ? 11 A   D N1    1 
ATOM   1632 C  C2    . A   D 2 11 ? 9.448   -84.915 -12.842 1.00 14.53 ? 11 A   D C2    1 
ATOM   1633 N  N3    . A   D 2 11 ? 9.100   -85.873 -11.967 1.00 15.43 ? 11 A   D N3    1 
ATOM   1634 C  C4    . A   D 2 11 ? 8.318   -85.394 -10.977 1.00 14.04 ? 11 A   D C4    1 
ATOM   1635 P  P     . U   D 2 12 ? 11.732  -87.218 -6.658  1.00 10.94 ? 12 U   D P     1 
ATOM   1636 O  OP1   . U   D 2 12 ? 12.760  -88.007 -5.941  1.00 11.65 ? 12 U   D OP1   1 
ATOM   1637 O  OP2   . U   D 2 12 ? 11.317  -85.950 -6.026  1.00 12.38 ? 12 U   D OP2   1 
ATOM   1638 O  "O5'" . U   D 2 12 ? 12.342  -86.956 -8.101  1.00 12.26 ? 12 U   D "O5'" 1 
ATOM   1639 C  "C5'" . U   D 2 12 ? 12.881  -88.033 -8.858  1.00 11.40 ? 12 U   D "C5'" 1 
ATOM   1640 C  "C4'" . U   D 2 12 ? 13.365  -87.522 -10.201 1.00 10.69 ? 12 U   D "C4'" 1 
ATOM   1641 O  "O4'" . U   D 2 12 ? 12.304  -86.818 -10.882 1.00 11.59 ? 12 U   D "O4'" 1 
ATOM   1642 C  "C3'" . U   D 2 12 ? 14.422  -86.452 -10.111 1.00 10.17 ? 12 U   D "C3'" 1 
ATOM   1643 O  "O3'" . U   D 2 12 ? 15.638  -87.017 -9.771  1.00 8.48  ? 12 U   D "O3'" 1 
ATOM   1644 C  "C2'" . U   D 2 12 ? 14.376  -85.954 -11.550 1.00 11.37 ? 12 U   D "C2'" 1 
ATOM   1645 O  "O2'" . U   D 2 12 ? 14.897  -86.886 -12.468 1.00 12.43 ? 12 U   D "O2'" 1 
ATOM   1646 C  "C1'" . U   D 2 12 ? 12.873  -85.846 -11.738 1.00 12.06 ? 12 U   D "C1'" 1 
ATOM   1647 N  N1    . U   D 2 12 ? 12.354  -84.507 -11.355 1.00 12.53 ? 12 U   D N1    1 
ATOM   1648 C  C2    . U   D 2 12 ? 12.585  -83.399 -12.170 1.00 13.88 ? 12 U   D C2    1 
ATOM   1649 O  O2    . U   D 2 12 ? 13.194  -83.403 -13.224 1.00 14.63 ? 12 U   D O2    1 
ATOM   1650 N  N3    . U   D 2 12 ? 12.061  -82.222 -11.704 1.00 14.61 ? 12 U   D N3    1 
ATOM   1651 C  C4    . U   D 2 12 ? 11.336  -82.040 -10.543 1.00 13.19 ? 12 U   D C4    1 
ATOM   1652 O  O4    . U   D 2 12 ? 10.942  -80.924 -10.292 1.00 13.48 ? 12 U   D O4    1 
ATOM   1653 C  C5    . U   D 2 12 ? 11.118  -83.216 -9.743  1.00 13.64 ? 12 U   D C5    1 
ATOM   1654 C  C6    . U   D 2 12 ? 11.628  -84.384 -10.178 1.00 12.88 ? 12 U   D C6    1 
ATOM   1655 P  P     . G   D 2 13 ? 16.782  -86.132 -9.115  1.00 8.97  ? 13 G   D P     1 
ATOM   1656 O  OP1   . G   D 2 13 ? 17.742  -87.093 -8.487  1.00 10.24 ? 13 G   D OP1   1 
ATOM   1657 O  OP2   . G   D 2 13 ? 16.139  -85.086 -8.285  1.00 10.02 ? 13 G   D OP2   1 
ATOM   1658 O  "O5'" . G   D 2 13 ? 17.460  -85.342 -10.312 1.00 7.43  ? 13 G   D "O5'" 1 
ATOM   1659 C  "C5'" . G   D 2 13 ? 18.116  -85.969 -11.373 1.00 9.01  ? 13 G   D "C5'" 1 
ATOM   1660 C  "C4'" . G   D 2 13 ? 18.490  -84.873 -12.353 1.00 11.60 ? 13 G   D "C4'" 1 
ATOM   1661 O  "O4'" . G   D 2 13 ? 17.276  -84.285 -12.892 1.00 11.80 ? 13 G   D "O4'" 1 
ATOM   1662 C  "C3'" . G   D 2 13 ? 19.199  -83.669 -11.750 1.00 12.83 ? 13 G   D "C3'" 1 
ATOM   1663 O  "O3'" . G   D 2 13 ? 20.558  -83.934 -11.542 1.00 11.91 ? 13 G   D "O3'" 1 
ATOM   1664 C  "C2'" . G   D 2 13 ? 18.988  -82.692 -12.894 1.00 14.38 ? 13 G   D "C2'" 1 
ATOM   1665 O  "O2'" . G   D 2 13 ? 19.876  -82.970 -13.962 1.00 17.66 ? 13 G   D "O2'" 1 
ATOM   1666 C  "C1'" . G   D 2 13 ? 17.519  -82.941 -13.236 1.00 13.60 ? 13 G   D "C1'" 1 
ATOM   1667 N  N9    . G   D 2 13 ? 16.669  -82.081 -12.402 1.00 14.49 ? 13 G   D N9    1 
ATOM   1668 C  C8    . G   D 2 13 ? 16.095  -82.400 -11.194 1.00 14.37 ? 13 G   D C8    1 
ATOM   1669 N  N7    . G   D 2 13 ? 15.410  -81.429 -10.667 1.00 14.01 ? 13 G   D N7    1 
ATOM   1670 C  C5    . G   D 2 13 ? 15.532  -80.382 -11.562 1.00 13.77 ? 13 G   D C5    1 
ATOM   1671 C  C6    . G   D 2 13 ? 15.009  -79.061 -11.507 1.00 14.53 ? 13 G   D C6    1 
ATOM   1672 O  O6    . G   D 2 13 ? 14.287  -78.519 -10.638 1.00 14.46 ? 13 G   D O6    1 
ATOM   1673 N  N1    . G   D 2 13 ? 15.379  -78.332 -12.632 1.00 14.64 ? 13 G   D N1    1 
ATOM   1674 C  C2    . G   D 2 13 ? 16.166  -78.800 -13.655 1.00 14.05 ? 13 G   D C2    1 
ATOM   1675 N  N2    . G   D 2 13 ? 16.411  -77.945 -14.647 1.00 13.91 ? 13 G   D N2    1 
ATOM   1676 N  N3    . G   D 2 13 ? 16.663  -80.023 -13.712 1.00 14.48 ? 13 G   D N3    1 
ATOM   1677 C  C4    . G   D 2 13 ? 16.307  -80.765 -12.633 1.00 14.22 ? 13 G   D C4    1 
ATOM   1678 P  P     . C   D 2 14 ? 21.469  -83.099 -10.526 1.00 12.21 ? 14 C   D P     1 
ATOM   1679 O  OP1   . C   D 2 14 ? 22.805  -83.747 -10.469 1.00 13.44 ? 14 C   D OP1   1 
ATOM   1680 O  OP2   . C   D 2 14 ? 20.790  -82.916 -9.238  1.00 12.54 ? 14 C   D OP2   1 
ATOM   1681 O  "O5'" . C   D 2 14 ? 21.586  -81.690 -11.281 1.00 12.81 ? 14 C   D "O5'" 1 
ATOM   1682 C  "C5'" . C   D 2 14 ? 22.375  -81.493 -12.459 1.00 11.48 ? 14 C   D "C5'" 1 
ATOM   1683 C  "C4'" . C   D 2 14 ? 22.072  -80.162 -13.135 1.00 11.15 ? 14 C   D "C4'" 1 
ATOM   1684 O  "O4'" . C   D 2 14 ? 20.639  -80.012 -13.370 1.00 11.51 ? 14 C   D "O4'" 1 
ATOM   1685 C  "C3'" . C   D 2 14 ? 22.450  -78.934 -12.326 1.00 10.89 ? 14 C   D "C3'" 1 
ATOM   1686 O  "O3'" . C   D 2 14 ? 23.796  -78.614 -12.502 1.00 10.70 ? 14 C   D "O3'" 1 
ATOM   1687 C  "C2'" . C   D 2 14 ? 21.519  -77.884 -12.936 1.00 12.23 ? 14 C   D "C2'" 1 
ATOM   1688 O  "O2'" . C   D 2 14 ? 21.931  -77.327 -14.164 1.00 12.35 ? 14 C   D "O2'" 1 
ATOM   1689 C  "C1'" . C   D 2 14 ? 20.232  -78.674 -13.116 1.00 12.64 ? 14 C   D "C1'" 1 
ATOM   1690 N  N1    . C   D 2 14 ? 19.369  -78.491 -11.866 1.00 13.97 ? 14 C   D N1    1 
ATOM   1691 C  C2    . C   D 2 14 ? 18.697  -77.266 -11.681 1.00 14.34 ? 14 C   D C2    1 
ATOM   1692 O  O2    . C   D 2 14 ? 18.801  -76.384 -12.543 1.00 14.45 ? 14 C   D O2    1 
ATOM   1693 N  N3    . C   D 2 14 ? 17.934  -77.076 -10.570 1.00 14.44 ? 14 C   D N3    1 
ATOM   1694 C  C4    . C   D 2 14 ? 17.822  -78.032 -9.651  1.00 13.66 ? 14 C   D C4    1 
ATOM   1695 N  N4    . C   D 2 14 ? 17.061  -77.772 -8.588  1.00 13.42 ? 14 C   D N4    1 
ATOM   1696 C  C5    . C   D 2 14 ? 18.498  -79.282 -9.794  1.00 14.30 ? 14 C   D C5    1 
ATOM   1697 C  C6    . C   D 2 14 ? 19.253  -79.463 -10.895 1.00 14.42 ? 14 C   D C6    1 
ATOM   1698 P  P     . U   D 2 15 ? 24.679  -77.815 -11.407 1.00 12.08 ? 15 U   D P     1 
ATOM   1699 O  OP1   . U   D 2 15 ? 26.083  -78.005 -11.828 1.00 12.16 ? 15 U   D OP1   1 
ATOM   1700 O  OP2   . U   D 2 15 ? 24.352  -78.186 -10.009 1.00 10.72 ? 15 U   D OP2   1 
ATOM   1701 O  "O5'" . U   D 2 15 ? 24.223  -76.294 -11.643 1.00 11.72 ? 15 U   D "O5'" 1 
ATOM   1702 C  "C5'" . U   D 2 15 ? 24.289  -75.653 -12.911 1.00 11.20 ? 15 U   D "C5'" 1 
ATOM   1703 C  "C4'" . U   D 2 15 ? 23.672  -74.263 -12.854 1.00 11.06 ? 15 U   D "C4'" 1 
ATOM   1704 O  "O4'" . U   D 2 15 ? 22.243  -74.410 -12.743 1.00 11.18 ? 15 U   D "O4'" 1 
ATOM   1705 C  "C3'" . U   D 2 15 ? 24.038  -73.403 -11.650 1.00 10.43 ? 15 U   D "C3'" 1 
ATOM   1706 O  "O3'" . U   D 2 15 ? 25.221  -72.673 -11.880 1.00 8.66  ? 15 U   D "O3'" 1 
ATOM   1707 C  "C2'" . U   D 2 15 ? 22.830  -72.483 -11.545 1.00 11.27 ? 15 U   D "C2'" 1 
ATOM   1708 O  "O2'" . U   D 2 15 ? 22.778  -71.470 -12.522 1.00 12.09 ? 15 U   D "O2'" 1 
ATOM   1709 C  "C1'" . U   D 2 15 ? 21.708  -73.436 -11.870 1.00 11.59 ? 15 U   D "C1'" 1 
ATOM   1710 N  N1    . U   D 2 15 ? 21.138  -74.095 -10.673 1.00 12.36 ? 15 U   D N1    1 
ATOM   1711 C  C2    . U   D 2 15 ? 20.213  -73.408 -9.888  1.00 11.72 ? 15 U   D C2    1 
ATOM   1712 O  O2    . U   D 2 15 ? 19.847  -72.275 -10.115 1.00 11.85 ? 15 U   D O2    1 
ATOM   1713 N  N3    . U   D 2 15 ? 19.732  -74.099 -8.804  1.00 11.17 ? 15 U   D N3    1 
ATOM   1714 C  C4    . U   D 2 15 ? 20.077  -75.392 -8.459  1.00 11.87 ? 15 U   D C4    1 
ATOM   1715 O  O4    . U   D 2 15 ? 19.577  -75.903 -7.480  1.00 12.11 ? 15 U   D O4    1 
ATOM   1716 C  C5    . U   D 2 15 ? 21.040  -76.045 -9.313  1.00 12.88 ? 15 U   D C5    1 
ATOM   1717 C  C6    . U   D 2 15 ? 21.531  -75.387 -10.369 1.00 12.29 ? 15 U   D C6    1 
ATOM   1718 P  P     . G   D 2 16 ? 26.096  -72.200 -10.631 1.00 8.28  ? 16 G   D P     1 
ATOM   1719 O  OP1   . G   D 2 16 ? 27.345  -71.603 -11.128 1.00 8.64  ? 16 G   D OP1   1 
ATOM   1720 O  OP2   . G   D 2 16 ? 26.135  -73.281 -9.620  1.00 8.30  ? 16 G   D OP2   1 
ATOM   1721 O  "O5'" . G   D 2 16 ? 25.231  -70.989 -10.061 1.00 10.82 ? 16 G   D "O5'" 1 
ATOM   1722 C  "C5'" . G   D 2 16 ? 25.061  -69.790 -10.827 1.00 11.25 ? 16 G   D "C5'" 1 
ATOM   1723 C  "C4'" . G   D 2 16 ? 24.034  -68.899 -10.162 1.00 11.34 ? 16 G   D "C4'" 1 
ATOM   1724 O  "O4'" . G   D 2 16 ? 22.785  -69.607 -9.961  1.00 10.44 ? 16 G   D "O4'" 1 
ATOM   1725 C  "C3'" . G   D 2 16 ? 24.412  -68.497 -8.747  1.00 12.02 ? 16 G   D "C3'" 1 
ATOM   1726 O  "O3'" . G   D 2 16 ? 25.461  -67.537 -8.763  1.00 11.65 ? 16 G   D "O3'" 1 
ATOM   1727 C  "C2'" . G   D 2 16 ? 23.054  -67.970 -8.293  1.00 12.38 ? 16 G   D "C2'" 1 
ATOM   1728 O  "O2'" . G   D 2 16 ? 22.694  -66.770 -8.935  1.00 12.31 ? 16 G   D "O2'" 1 
ATOM   1729 C  "C1'" . G   D 2 16 ? 22.153  -69.069 -8.822  1.00 11.72 ? 16 G   D "C1'" 1 
ATOM   1730 N  N9    . G   D 2 16 ? 21.852  -70.147 -7.886  1.00 12.15 ? 16 G   D N9    1 
ATOM   1731 C  C8    . G   D 2 16 ? 22.363  -71.421 -7.853  1.00 12.37 ? 16 G   D C8    1 
ATOM   1732 N  N7    . G   D 2 16 ? 21.864  -72.165 -6.890  1.00 12.39 ? 16 G   D N7    1 
ATOM   1733 C  C5    . G   D 2 16 ? 20.960  -71.331 -6.244  1.00 12.50 ? 16 G   D C5    1 
ATOM   1734 C  C6    . G   D 2 16 ? 20.105  -71.559 -5.135  1.00 12.34 ? 16 G   D C6    1 
ATOM   1735 O  O6    . G   D 2 16 ? 19.952  -72.588 -4.461  1.00 12.36 ? 16 G   D O6    1 
ATOM   1736 N  N1    . G   D 2 16 ? 19.357  -70.430 -4.818  1.00 12.42 ? 16 G   D N1    1 
ATOM   1737 C  C2    . G   D 2 16 ? 19.415  -69.228 -5.472  1.00 12.11 ? 16 G   D C2    1 
ATOM   1738 N  N2    . G   D 2 16 ? 18.622  -68.243 -5.030  1.00 12.17 ? 16 G   D N2    1 
ATOM   1739 N  N3    . G   D 2 16 ? 20.198  -69.009 -6.507  1.00 13.01 ? 16 G   D N3    1 
ATOM   1740 C  C4    . G   D 2 16 ? 20.941  -70.092 -6.847  1.00 12.85 ? 16 G   D C4    1 
ATOM   1741 P  P     . U   D 2 17 ? 26.043  -66.900 -7.417  1.00 12.98 ? 17 U   D P     1 
ATOM   1742 O  OP1   . U   D 2 17 ? 27.026  -65.840 -7.760  1.00 12.05 ? 17 U   D OP1   1 
ATOM   1743 O  OP2   . U   D 2 17 ? 26.472  -67.998 -6.520  1.00 12.94 ? 17 U   D OP2   1 
ATOM   1744 O  "O5'" . U   D 2 17 ? 24.701  -66.224 -6.855  1.00 14.20 ? 17 U   D "O5'" 1 
ATOM   1745 C  "C5'" . U   D 2 17 ? 24.613  -64.844 -6.534  1.00 15.71 ? 17 U   D "C5'" 1 
ATOM   1746 C  "C4'" . U   D 2 17 ? 23.512  -64.638 -5.514  1.00 16.66 ? 17 U   D "C4'" 1 
ATOM   1747 O  "O4'" . U   D 2 17 ? 22.505  -65.684 -5.612  1.00 15.59 ? 17 U   D "O4'" 1 
ATOM   1748 C  "C3'" . U   D 2 17 ? 24.000  -64.755 -4.080  1.00 17.51 ? 17 U   D "C3'" 1 
ATOM   1749 O  "O3'" . U   D 2 17 ? 24.655  -63.592 -3.642  1.00 19.31 ? 17 U   D "O3'" 1 
ATOM   1750 C  "C2'" . U   D 2 17 ? 22.700  -65.020 -3.337  1.00 17.24 ? 17 U   D "C2'" 1 
ATOM   1751 O  "O2'" . U   D 2 17 ? 21.881  -63.884 -3.162  1.00 18.24 ? 17 U   D "O2'" 1 
ATOM   1752 C  "C1'" . U   D 2 17 ? 22.038  -65.992 -4.305  1.00 16.41 ? 17 U   D "C1'" 1 
ATOM   1753 N  N1    . U   D 2 17 ? 22.306  -67.429 -3.943  1.00 16.44 ? 17 U   D N1    1 
ATOM   1754 C  C2    . U   D 2 17 ? 21.558  -68.001 -2.927  1.00 16.49 ? 17 U   D C2    1 
ATOM   1755 O  O2    . U   D 2 17 ? 20.702  -67.403 -2.311  1.00 16.74 ? 17 U   D O2    1 
ATOM   1756 N  N3    . U   D 2 17 ? 21.836  -69.314 -2.646  1.00 16.36 ? 17 U   D N3    1 
ATOM   1757 C  C4    . U   D 2 17 ? 22.781  -70.100 -3.272  1.00 16.26 ? 17 U   D C4    1 
ATOM   1758 O  O4    . U   D 2 17 ? 22.909  -71.259 -2.912  1.00 16.39 ? 17 U   D O4    1 
ATOM   1759 C  C5    . U   D 2 17 ? 23.534  -69.450 -4.317  1.00 16.17 ? 17 U   D C5    1 
ATOM   1760 C  C6    . U   D 2 17 ? 23.273  -68.167 -4.608  1.00 16.00 ? 17 U   D C6    1 
ATOM   1761 P  P     . C   D 2 18 ? 26.027  -63.799 -2.840  1.00 22.31 ? 18 C   D P     1 
ATOM   1762 O  OP1   . C   D 2 18 ? 26.867  -62.590 -3.012  1.00 22.02 ? 18 C   D OP1   1 
ATOM   1763 O  OP2   . C   D 2 18 ? 26.567  -65.121 -3.235  1.00 21.98 ? 18 C   D OP2   1 
ATOM   1764 O  "O5'" . C   D 2 18 ? 25.564  -63.832 -1.297  1.00 23.52 ? 18 C   D "O5'" 1 
ATOM   1765 C  "C5'" . C   D 2 18 ? 24.724  -62.796 -0.746  1.00 24.37 ? 18 C   D "C5'" 1 
ATOM   1766 C  "C4'" . C   D 2 18 ? 23.813  -63.297 0.373   1.00 24.94 ? 18 C   D "C4'" 1 
ATOM   1767 O  "O4'" . C   D 2 18 ? 22.897  -64.348 -0.069  1.00 23.89 ? 18 C   D "O4'" 1 
ATOM   1768 C  "C3'" . C   D 2 18 ? 24.552  -63.930 1.542   1.00 25.16 ? 18 C   D "C3'" 1 
ATOM   1769 O  "O3'" . C   D 2 18 ? 25.074  -62.949 2.415   1.00 26.49 ? 18 C   D "O3'" 1 
ATOM   1770 C  "C2'" . C   D 2 18 ? 23.464  -64.782 2.188   1.00 24.11 ? 18 C   D "C2'" 1 
ATOM   1771 O  "O2'" . C   D 2 18 ? 22.553  -64.048 2.973   1.00 23.92 ? 18 C   D "O2'" 1 
ATOM   1772 C  "C1'" . C   D 2 18 ? 22.771  -65.333 0.951   1.00 22.87 ? 18 C   D "C1'" 1 
ATOM   1773 N  N1    . C   D 2 18 ? 23.341  -66.672 0.529   1.00 22.42 ? 18 C   D N1    1 
ATOM   1774 C  C2    . C   D 2 18 ? 23.043  -67.822 1.290   1.00 22.07 ? 18 C   D C2    1 
ATOM   1775 O  O2    . C   D 2 18 ? 22.320  -67.722 2.297   1.00 21.93 ? 18 C   D O2    1 
ATOM   1776 N  N3    . C   D 2 18 ? 23.557  -69.025 0.901   1.00 21.24 ? 18 C   D N3    1 
ATOM   1777 C  C4    . C   D 2 18 ? 24.327  -69.116 -0.186  1.00 21.37 ? 18 C   D C4    1 
ATOM   1778 N  N4    . C   D 2 18 ? 24.799  -70.320 -0.526  1.00 21.58 ? 18 C   D N4    1 
ATOM   1779 C  C5    . C   D 2 18 ? 24.644  -67.966 -0.971  1.00 21.68 ? 18 C   D C5    1 
ATOM   1780 C  C6    . C   D 2 18 ? 24.140  -66.784 -0.580  1.00 21.92 ? 18 C   D C6    1 
ATOM   1781 P  P     . U   D 2 19 ? 26.427  -63.290 3.203   1.00 28.02 ? 19 U   D P     1 
ATOM   1782 O  OP1   . U   D 2 19 ? 26.819  -62.068 3.944   1.00 28.55 ? 19 U   D OP1   1 
ATOM   1783 O  OP2   . U   D 2 19 ? 27.386  -63.886 2.245   1.00 27.37 ? 19 U   D OP2   1 
ATOM   1784 O  "O5'" . U   D 2 19 ? 25.975  -64.408 4.266   1.00 29.83 ? 19 U   D "O5'" 1 
ATOM   1785 C  "C5'" . U   D 2 19 ? 25.073  -64.143 5.355   1.00 32.67 ? 19 U   D "C5'" 1 
ATOM   1786 C  "C4'" . U   D 2 19 ? 24.934  -65.381 6.227   1.00 35.54 ? 19 U   D "C4'" 1 
ATOM   1787 O  "O4'" . U   D 2 19 ? 24.486  -66.489 5.413   1.00 36.16 ? 19 U   D "O4'" 1 
ATOM   1788 C  "C3'" . U   D 2 19 ? 26.237  -65.855 6.861   1.00 37.74 ? 19 U   D "C3'" 1 
ATOM   1789 O  "O3'" . U   D 2 19 ? 26.330  -65.337 8.181   1.00 41.20 ? 19 U   D "O3'" 1 
ATOM   1790 C  "C2'" . U   D 2 19 ? 26.174  -67.383 6.855   1.00 36.88 ? 19 U   D "C2'" 1 
ATOM   1791 O  "O2'" . U   D 2 19 ? 25.819  -67.950 8.098   1.00 37.25 ? 19 U   D "O2'" 1 
ATOM   1792 C  "C1'" . U   D 2 19 ? 25.066  -67.698 5.864   1.00 35.74 ? 19 U   D "C1'" 1 
ATOM   1793 N  N1    . U   D 2 19 ? 25.559  -68.531 4.717   1.00 35.43 ? 19 U   D N1    1 
ATOM   1794 C  C2    . U   D 2 19 ? 25.326  -69.894 4.769   1.00 35.61 ? 19 U   D C2    1 
ATOM   1795 O  O2    . U   D 2 19 ? 24.738  -70.426 5.692   1.00 35.77 ? 19 U   D O2    1 
ATOM   1796 N  N3    . U   D 2 19 ? 25.793  -70.624 3.697   1.00 35.23 ? 19 U   D N3    1 
ATOM   1797 C  C4    . U   D 2 19 ? 26.469  -70.129 2.600   1.00 34.99 ? 19 U   D C4    1 
ATOM   1798 O  O4    . U   D 2 19 ? 26.826  -70.907 1.724   1.00 34.84 ? 19 U   D O4    1 
ATOM   1799 C  C5    . U   D 2 19 ? 26.688  -68.699 2.615   1.00 35.26 ? 19 U   D C5    1 
ATOM   1800 C  C6    . U   D 2 19 ? 26.237  -67.964 3.648   1.00 35.15 ? 19 U   D C6    1 
ATOM   1801 P  P     . U   D 2 20 ? 27.312  -64.111 8.498   1.00 44.26 ? 20 U   D P     1 
ATOM   1802 O  OP1   . U   D 2 20 ? 26.868  -63.549 9.804   1.00 44.11 ? 20 U   D OP1   1 
ATOM   1803 O  OP2   . U   D 2 20 ? 28.699  -64.612 8.277   1.00 44.26 ? 20 U   D OP2   1 
HETATM 1804 O  O     . HOH E 3 .  ? -4.883  -81.996 -15.574 1.00 2.00  ? 76 HOH A O     1 
HETATM 1805 O  O     . HOH E 3 .  ? 2.954   -80.952 -23.981 1.00 14.01 ? 77 HOH A O     1 
HETATM 1806 O  O     . HOH F 3 .  ? 12.705  -90.452 -3.338  1.00 17.94 ? 76 HOH B O     1 
HETATM 1807 O  O     . HOH F 3 .  ? 12.096  -77.913 -7.634  1.00 5.33  ? 77 HOH B O     1 
HETATM 1808 O  O     . HOH F 3 .  ? 24.392  -78.791 0.686   1.00 19.16 ? 78 HOH B O     1 
HETATM 1809 O  O     . HOH G 3 .  ? -19.854 -80.202 -17.599 1.00 7.21  ? 22 HOH C O     1 
HETATM 1810 O  O     . HOH G 3 .  ? -10.733 -86.316 -6.973  1.00 14.76 ? 23 HOH C O     1 
HETATM 1811 O  O     . HOH G 3 .  ? 10.823  -86.927 -15.414 1.00 23.93 ? 24 HOH C O     1 
HETATM 1812 O  O     . HOH G 3 .  ? -24.244 -78.859 -17.910 1.00 29.12 ? 25 HOH C O     1 
HETATM 1813 O  O     . HOH G 3 .  ? -13.384 -81.694 -7.989  1.00 6.43  ? 26 HOH C O     1 
HETATM 1814 O  O     . HOH H 3 .  ? -9.801  -68.411 -23.379 1.00 10.40 ? 23 HOH D O     1 
HETATM 1815 O  O     . HOH H 3 .  ? -3.809  -77.000 -9.432  1.00 15.69 ? 24 HOH D O     1 
HETATM 1816 O  O     . HOH H 3 .  ? 4.018   -82.136 -11.133 1.00 14.31 ? 25 HOH D O     1 
HETATM 1817 O  O     . HOH H 3 .  ? 4.643   -87.404 -10.438 1.00 11.56 ? 26 HOH D O     1 
HETATM 1818 O  O     . HOH H 3 .  ? 6.518   -86.461 -0.326  1.00 10.12 ? 27 HOH D O     1 
HETATM 1819 O  O     . HOH H 3 .  ? 19.061  -80.621 -16.640 1.00 2.00  ? 28 HOH D O     1 
HETATM 1820 O  O     . HOH H 3 .  ? 20.452  -75.114 -15.933 1.00 19.66 ? 29 HOH D O     1 
HETATM 1821 O  O     . HOH H 3 .  ? -16.240 -85.544 -24.535 1.00 11.50 ? 78 HOH D O     1 
A 1 1  MSE 1  1  ?  ?   ?   A . n 
A 1 2  ALA 2  2  ?  ?   ?   A . n 
A 1 3  SER 3  3  ?  ?   ?   A . n 
A 1 4  ILE 4  4  ?  ?   ?   A . n 
A 1 5  GLU 5  5  5  GLU GLU A . n 
A 1 6  ILE 6  6  6  ILE ILE A . n 
A 1 7  PRO 7  7  7  PRO PRO A . n 
A 1 8  LEU 8  8  8  LEU LEU A . n 
A 1 9  HIS 9  9  9  HIS HIS A . n 
A 1 10 GLU 10 10 10 GLU GLU A . n 
A 1 11 ILE 11 11 11 ILE ILE A . n 
A 1 12 ILE 12 12 12 ILE ILE A . n 
A 1 13 ARG 13 13 13 ARG ARG A . n 
A 1 14 LYS 14 14 14 LYS LYS A . n 
A 1 15 LEU 15 15 15 LEU LEU A . n 
A 1 16 GLU 16 16 16 GLU GLU A . n 
A 1 17 ARG 17 17 17 ARG ARG A . n 
A 1 18 MSE 18 18 18 MSE MSE A . n 
A 1 19 ASN 19 19 19 ASN ASN A . n 
A 1 20 GLN 20 20 20 GLN GLN A . n 
A 1 21 LYS 21 21 21 LYS LYS A . n 
A 1 22 LYS 22 22 22 LYS LYS A . n 
A 1 23 GLN 23 23 23 GLN GLN A . n 
A 1 24 ALA 24 24 24 ALA ALA A . n 
A 1 25 GLN 25 25 25 GLN GLN A . n 
A 1 26 ARG 26 26 26 ARG ARG A . n 
A 1 27 LYS 27 27 27 LYS LYS A . n 
A 1 28 ARG 28 28 28 ARG ARG A . n 
A 1 29 HIS 29 29 29 HIS HIS A . n 
A 1 30 LYS 30 30 30 LYS LYS A . n 
A 1 31 LEU 31 31 31 LEU LEU A . n 
A 1 32 ASN 32 32 32 ASN ASN A . n 
A 1 33 ARG 33 33 33 ARG ARG A . n 
A 1 34 LYS 34 34 34 LYS LYS A . n 
A 1 35 GLU 35 35 35 GLU GLU A . n 
A 1 36 ARG 36 36 36 ARG ARG A . n 
A 1 37 GLY 37 37 37 GLY GLY A . n 
A 1 38 HIS 38 38 38 HIS HIS A . n 
A 1 39 LYS 39 39 39 LYS LYS A . n 
A 1 40 SER 40 40 40 SER SER A . n 
A 1 41 PRO 41 41 41 PRO PRO A . n 
A 1 42 SER 42 42 42 SER SER A . n 
A 1 43 GLU 43 43 43 GLU GLU A . n 
A 1 44 GLN 44 44 44 GLN GLN A . n 
A 1 45 ARG 45 45 45 ARG ARG A . n 
A 1 46 ARG 46 46 46 ARG ARG A . n 
A 1 47 SER 47 47 47 SER SER A . n 
A 1 48 GLU 48 48 48 GLU GLU A . n 
A 1 49 LEU 49 49 49 LEU LEU A . n 
A 1 50 TRP 50 50 50 TRP TRP A . n 
A 1 51 HIS 51 51 51 HIS HIS A . n 
A 1 52 ALA 52 52 52 ALA ALA A . n 
A 1 53 ARG 53 53 53 ARG ARG A . n 
A 1 54 GLN 54 54 54 GLN GLN A . n 
A 1 55 VAL 55 55 55 VAL VAL A . n 
A 1 56 GLU 56 56 56 GLU GLU A . n 
A 1 57 LEU 57 57 57 LEU LEU A . n 
A 1 58 SER 58 58 58 SER SER A . n 
A 1 59 ALA 59 59 59 ALA ALA A . n 
A 1 60 ILE 60 60 60 ILE ILE A . n 
A 1 61 ASN 61 61 61 ASN ASN A . n 
A 1 62 SER 62 62 62 SER SER A . n 
A 1 63 ASP 63 63 63 ASP ASP A . n 
A 1 64 ASN 64 64 64 ASN ASN A . n 
A 1 65 SER 65 65 ?  ?   ?   A . n 
A 1 66 SER 66 66 ?  ?   ?   A . n 
A 1 67 ASP 67 67 ?  ?   ?   A . n 
A 1 68 GLU 68 68 ?  ?   ?   A . n 
A 1 69 GLY 69 69 ?  ?   ?   A . n 
A 1 70 HIS 70 70 ?  ?   ?   A . n 
A 1 71 HIS 71 71 ?  ?   ?   A . n 
A 1 72 HIS 72 72 ?  ?   ?   A . n 
A 1 73 HIS 73 73 ?  ?   ?   A . n 
A 1 74 HIS 74 74 ?  ?   ?   A . n 
A 1 75 HIS 75 75 ?  ?   ?   A . n 
B 1 1  MSE 1  1  ?  ?   ?   B . n 
B 1 2  ALA 2  2  ?  ?   ?   B . n 
B 1 3  SER 3  3  ?  ?   ?   B . n 
B 1 4  ILE 4  4  4  ILE ILE B . n 
B 1 5  GLU 5  5  5  GLU GLU B . n 
B 1 6  ILE 6  6  6  ILE ILE B . n 
B 1 7  PRO 7  7  7  PRO PRO B . n 
B 1 8  LEU 8  8  8  LEU LEU B . n 
B 1 9  HIS 9  9  9  HIS HIS B . n 
B 1 10 GLU 10 10 10 GLU GLU B . n 
B 1 11 ILE 11 11 11 ILE ILE B . n 
B 1 12 ILE 12 12 12 ILE ILE B . n 
B 1 13 ARG 13 13 13 ARG ARG B . n 
B 1 14 LYS 14 14 14 LYS LYS B . n 
B 1 15 LEU 15 15 15 LEU LEU B . n 
B 1 16 GLU 16 16 16 GLU GLU B . n 
B 1 17 ARG 17 17 17 ARG ARG B . n 
B 1 18 MSE 18 18 18 MSE MSE B . n 
B 1 19 ASN 19 19 19 ASN ASN B . n 
B 1 20 GLN 20 20 20 GLN GLN B . n 
B 1 21 LYS 21 21 21 LYS LYS B . n 
B 1 22 LYS 22 22 22 LYS LYS B . n 
B 1 23 GLN 23 23 23 GLN GLN B . n 
B 1 24 ALA 24 24 24 ALA ALA B . n 
B 1 25 GLN 25 25 25 GLN GLN B . n 
B 1 26 ARG 26 26 26 ARG ARG B . n 
B 1 27 LYS 27 27 27 LYS LYS B . n 
B 1 28 ARG 28 28 28 ARG ARG B . n 
B 1 29 HIS 29 29 29 HIS HIS B . n 
B 1 30 LYS 30 30 30 LYS LYS B . n 
B 1 31 LEU 31 31 31 LEU LEU B . n 
B 1 32 ASN 32 32 32 ASN ASN B . n 
B 1 33 ARG 33 33 33 ARG ARG B . n 
B 1 34 LYS 34 34 34 LYS LYS B . n 
B 1 35 GLU 35 35 35 GLU GLU B . n 
B 1 36 ARG 36 36 36 ARG ARG B . n 
B 1 37 GLY 37 37 37 GLY GLY B . n 
B 1 38 HIS 38 38 38 HIS HIS B . n 
B 1 39 LYS 39 39 39 LYS LYS B . n 
B 1 40 SER 40 40 40 SER SER B . n 
B 1 41 PRO 41 41 41 PRO PRO B . n 
B 1 42 SER 42 42 42 SER SER B . n 
B 1 43 GLU 43 43 43 GLU GLU B . n 
B 1 44 GLN 44 44 44 GLN GLN B . n 
B 1 45 ARG 45 45 45 ARG ARG B . n 
B 1 46 ARG 46 46 46 ARG ARG B . n 
B 1 47 SER 47 47 47 SER SER B . n 
B 1 48 GLU 48 48 48 GLU GLU B . n 
B 1 49 LEU 49 49 49 LEU LEU B . n 
B 1 50 TRP 50 50 50 TRP TRP B . n 
B 1 51 HIS 51 51 51 HIS HIS B . n 
B 1 52 ALA 52 52 52 ALA ALA B . n 
B 1 53 ARG 53 53 53 ARG ARG B . n 
B 1 54 GLN 54 54 54 GLN GLN B . n 
B 1 55 VAL 55 55 55 VAL VAL B . n 
B 1 56 GLU 56 56 56 GLU GLU B . n 
B 1 57 LEU 57 57 57 LEU LEU B . n 
B 1 58 SER 58 58 58 SER SER B . n 
B 1 59 ALA 59 59 ?  ?   ?   B . n 
B 1 60 ILE 60 60 ?  ?   ?   B . n 
B 1 61 ASN 61 61 ?  ?   ?   B . n 
B 1 62 SER 62 62 ?  ?   ?   B . n 
B 1 63 ASP 63 63 ?  ?   ?   B . n 
B 1 64 ASN 64 64 ?  ?   ?   B . n 
B 1 65 SER 65 65 ?  ?   ?   B . n 
B 1 66 SER 66 66 ?  ?   ?   B . n 
B 1 67 ASP 67 67 ?  ?   ?   B . n 
B 1 68 GLU 68 68 ?  ?   ?   B . n 
B 1 69 GLY 69 69 ?  ?   ?   B . n 
B 1 70 HIS 70 70 ?  ?   ?   B . n 
B 1 71 HIS 71 71 ?  ?   ?   B . n 
B 1 72 HIS 72 72 ?  ?   ?   B . n 
B 1 73 HIS 73 73 ?  ?   ?   B . n 
B 1 74 HIS 74 74 ?  ?   ?   B . n 
B 1 75 HIS 75 75 ?  ?   ?   B . n 
C 2 1  A   1  1  1  A   A   C . n 
C 2 2  G   2  2  2  G   G   C . n 
C 2 3  A   3  3  3  A   A   C . n 
C 2 4  C   4  4  4  C   C   C . n 
C 2 5  A   5  5  5  A   A   C . n 
C 2 6  G   6  6  6  G   G   C . n 
C 2 7  C   7  7  7  C   C   C . n 
C 2 8  A   8  8  8  A   A   C . n 
C 2 9  U   9  9  9  U   U   C . n 
C 2 10 U   10 10 10 U   U   C . n 
C 2 11 A   11 11 11 A   A   C . n 
C 2 12 U   12 12 12 U   U   C . n 
C 2 13 G   13 13 13 G   G   C . n 
C 2 14 C   14 14 14 C   C   C . n 
C 2 15 U   15 15 15 U   U   C . n 
C 2 16 G   16 16 16 G   G   C . n 
C 2 17 U   17 17 17 U   U   C . n 
C 2 18 C   18 18 18 C   C   C . n 
C 2 19 U   19 19 19 U   U   C . n 
C 2 20 U   20 20 20 U   U   C . n 
C 2 21 U   21 21 ?  ?   ?   C . n 
D 2 1  A   1  1  1  A   A   D . n 
D 2 2  G   2  2  2  G   G   D . n 
D 2 3  A   3  3  3  A   A   D . n 
D 2 4  C   4  4  4  C   C   D . n 
D 2 5  A   5  5  5  A   A   D . n 
D 2 6  G   6  6  6  G   G   D . n 
D 2 7  C   7  7  7  C   C   D . n 
D 2 8  A   8  8  8  A   A   D . n 
D 2 9  U   9  9  9  U   U   D . n 
D 2 10 U   10 10 10 U   U   D . n 
D 2 11 A   11 11 11 A   A   D . n 
D 2 12 U   12 12 12 U   U   D . n 
D 2 13 G   13 13 13 G   G   D . n 
D 2 14 C   14 14 14 C   C   D . n 
D 2 15 U   15 15 15 U   U   D . n 
D 2 16 G   16 16 16 G   G   D . n 
D 2 17 U   17 17 17 U   U   D . n 
D 2 18 C   18 18 18 C   C   D . n 
D 2 19 U   19 19 19 U   U   D . n 
D 2 20 U   20 20 20 U   U   D . n 
D 2 21 U   21 21 ?  ?   ?   D . n 
E 3 HOH 1 76 76 HOH HOH A . 
E 3 HOH 2 77 77 HOH HOH A . 
F 3 HOH 1 76 76 HOH HOH B . 
F 3 HOH 2 77 77 HOH HOH B . 
F 3 HOH 3 78 27 HOH HOH B . 
G 3 HOH 1 22 22 HOH HOH C . 
G 3 HOH 2 23 23 HOH HOH C . 
G 3 HOH 3 24 24 HOH HOH C . 
G 3 HOH 4 25 25 HOH HOH C . 
G 3 HOH 5 26 26 HOH HOH C . 
H 3 HOH 1 23 23 HOH HOH D . 
H 3 HOH 2 24 24 HOH HOH D . 
H 3 HOH 3 25 25 HOH HOH D . 
H 3 HOH 4 26 26 HOH HOH D . 
H 3 HOH 5 27 27 HOH HOH D . 
H 3 HOH 6 28 28 HOH HOH D . 
H 3 HOH 7 29 29 HOH HOH D . 
H 3 HOH 8 78 78 HOH HOH D . 
1 author_and_software_defined_assembly PISA tetrameric 4 
2 software_defined_assembly            PISA octameric  8 
1 1   A,B,C,D,E,F,G,H 
2 1,2 A,B,C,D,E,F,G,H 
1 'ABSA (A^2)' 6930  ? 
1 MORE         -56   ? 
1 'SSA (A^2)'  14370 ? 
2 'ABSA (A^2)' 18380 ? 
2 MORE         -149  ? 
2 'SSA (A^2)'  24210 ? 
1 'identity operation'         1_555 x,y,z     1.0000000000  0.0000000000 0.0000000000 0.0000000000 0.0000000000 1.0000000000  
0.0000000000 0.0000000000    0.0000000000 0.0000000000 1.0000000000 0.0000000000 
2 'crystal symmetry operation' 2_545 -x,-y-1,z -1.0000000000 0.0000000000 0.0000000000 0.0000000000 0.0000000000 -1.0000000000 
0.0000000000 -122.0430000000 0.0000000000 0.0000000000 1.0000000000 0.0000000000 
1 'Structure model' 1 0 2008-07-22 
2 'Structure model' 1 1 2011-07-13 
_pdbx_audit_revision_details.ordinal             1 
_pdbx_audit_revision_details.revision_ordinal    1 
_pdbx_audit_revision_details.data_content_type   'Structure model' 
_pdbx_audit_revision_details.provider            repository 
_pdbx_audit_revision_details.type                'Initial release' 
_pdbx_audit_revision_details.description         ? 
1 2 'Structure model' Advisory                    
2 2 'Structure model' 'Version format compliance' 
#               1 
_pdbx_refine_tls.details          ? 
_pdbx_refine_tls.method           refined 
_pdbx_refine_tls.origin_x         3.3926 
_pdbx_refine_tls.origin_y         -77.5938 
_pdbx_refine_tls.origin_z         -11.7571 
_pdbx_refine_tls.T[1][1]          -0.0411 
_pdbx_refine_tls.T[2][2]          -0.0703 
_pdbx_refine_tls.T[3][3]          -0.0589 
_pdbx_refine_tls.T[1][2]          0.0074 
_pdbx_refine_tls.T[1][3]          -0.0114 
_pdbx_refine_tls.T[2][3]          -0.0216 
_pdbx_refine_tls.L[1][1]          1.4280 
_pdbx_refine_tls.L[2][2]          1.7047 
_pdbx_refine_tls.L[3][3]          1.2975 
_pdbx_refine_tls.L[1][2]          -0.2619 
_pdbx_refine_tls.L[1][3]          -0.4154 
_pdbx_refine_tls.L[2][3]          -0.4410 
_pdbx_refine_tls.S[1][1]          -0.1038 
_pdbx_refine_tls.S[1][2]          -0.1022 
_pdbx_refine_tls.S[1][3]          0.2437 
_pdbx_refine_tls.S[2][1]          0.0441 
_pdbx_refine_tls.S[2][2]          0.0847 
_pdbx_refine_tls.S[2][3]          -0.1021 
_pdbx_refine_tls.S[3][1]          -0.2067 
_pdbx_refine_tls.S[3][2]          0.0717 
_pdbx_refine_tls.S[3][3]          0.0191 
_pdbx_refine_tls.pdbx_refine_id   'X-RAY DIFFRACTION' 
1 1 A 7 C 7 A 58 C 58 ? 'X-RAY DIFFRACTION' ? 
2 1 B 7 D 7 B 58 D 58 ? 'X-RAY DIFFRACTION' ? 
3 1 C 1 A 1 C 19 A 19 ? 'X-RAY DIFFRACTION' ? 
4 1 D 1 B 1 D 19 B 19 ? 'X-RAY DIFFRACTION' ? 
REFMAC   refinement        5.2.0019 ? 1 
HKL-2000 'data collection' .        ? 2 
HKL-2000 'data reduction'  .        ? 3 
HKL-2000 'data scaling'    .        ? 4 
SHARP    phasing           .        ? 5 
1 1 "O3'" C C 7  ? ? P     C A 8  ? ? OP2   C A 8  ? ? 117.59 110.50 7.09  1.10 Y 
2 1 "O4'" C U 9  ? ? "C1'" C U 9  ? ? N1    C U 9  ? ? 113.19 108.50 4.69  0.70 N 
3 1 "O4'" C C 14 ? ? "C1'" C C 14 ? ? N1    C C 14 ? ? 112.95 108.50 4.45  0.70 N 
4 1 "O5'" D A 1  ? ? "C5'" D A 1  ? ? "C4'" D A 1  ? ? 104.58 109.40 -4.82 0.80 N 
5 1 "O4'" D C 14 ? ? "C1'" D C 14 ? ? N1    D C 14 ? ? 114.84 108.50 6.34  0.70 N 
#              1 
_pdbx_validate_torsion.PDB_model_num   1 
_pdbx_validate_torsion.auth_comp_id    ASP 
_pdbx_validate_torsion.auth_asym_id    A 
_pdbx_validate_torsion.auth_seq_id     63 
_pdbx_validate_torsion.PDB_ins_code    ? 
_pdbx_validate_torsion.label_alt_id    ? 
_pdbx_validate_torsion.phi             -73.51 
_pdbx_validate_torsion.psi             28.43 
1  1 Y 1 C U 20 ? "O5'" ? C U 20 "O5'" 
2  1 Y 1 C U 20 ? "C5'" ? C U 20 "C5'" 
3  1 Y 1 C U 20 ? "C4'" ? C U 20 "C4'" 
4  1 Y 1 C U 20 ? "O4'" ? C U 20 "O4'" 
5  1 Y 1 C U 20 ? "C3'" ? C U 20 "C3'" 
6  1 Y 1 C U 20 ? "O3'" ? C U 20 "O3'" 
7  1 Y 1 C U 20 ? "C2'" ? C U 20 "C2'" 
8  1 Y 1 C U 20 ? "O2'" ? C U 20 "O2'" 
9  1 Y 1 C U 20 ? "C1'" ? C U 20 "C1'" 
10 1 Y 1 C U 20 ? N1    ? C U 20 N1    
11 1 Y 1 C U 20 ? C2    ? C U 20 C2    
12 1 Y 1 C U 20 ? O2    ? C U 20 O2    
13 1 Y 1 C U 20 ? N3    ? C U 20 N3    
14 1 Y 1 C U 20 ? C4    ? C U 20 C4    
15 1 Y 1 C U 20 ? O4    ? C U 20 O4    
16 1 Y 1 C U 20 ? C5    ? C U 20 C5    
17 1 Y 1 C U 20 ? C6    ? C U 20 C6    
18 1 Y 1 D U 20 ? "O5'" ? D U 20 "O5'" 
19 1 Y 1 D U 20 ? "C5'" ? D U 20 "C5'" 
20 1 Y 1 D U 20 ? "C4'" ? D U 20 "C4'" 
21 1 Y 1 D U 20 ? "O4'" ? D U 20 "O4'" 
22 1 Y 1 D U 20 ? "C3'" ? D U 20 "C3'" 
23 1 Y 1 D U 20 ? "O3'" ? D U 20 "O3'" 
24 1 Y 1 D U 20 ? "C2'" ? D U 20 "C2'" 
25 1 Y 1 D U 20 ? "O2'" ? D U 20 "O2'" 
26 1 Y 1 D U 20 ? "C1'" ? D U 20 "C1'" 
27 1 Y 1 D U 20 ? N1    ? D U 20 N1    
28 1 Y 1 D U 20 ? C2    ? D U 20 C2    
29 1 Y 1 D U 20 ? O2    ? D U 20 O2    
30 1 Y 1 D U 20 ? N3    ? D U 20 N3    
31 1 Y 1 D U 20 ? C4    ? D U 20 C4    
32 1 Y 1 D U 20 ? O4    ? D U 20 O4    
33 1 Y 1 D U 20 ? C5    ? D U 20 C5    
34 1 Y 1 D U 20 ? C6    ? D U 20 C6    
1  1 Y 1 A MSE 1  ? A MSE 1  
2  1 Y 1 A ALA 2  ? A ALA 2  
3  1 Y 1 A SER 3  ? A SER 3  
4  1 Y 1 A ILE 4  ? A ILE 4  
5  1 Y 1 A SER 65 ? A SER 65 
6  1 Y 1 A SER 66 ? A SER 66 
7  1 Y 1 A ASP 67 ? A ASP 67 
8  1 Y 1 A GLU 68 ? A GLU 68 
9  1 Y 1 A GLY 69 ? A GLY 69 
10 1 Y 1 A HIS 70 ? A HIS 70 
11 1 Y 1 A HIS 71 ? A HIS 71 
12 1 Y 1 A HIS 72 ? A HIS 72 
13 1 Y 1 A HIS 73 ? A HIS 73 
14 1 Y 1 A HIS 74 ? A HIS 74 
15 1 Y 1 A HIS 75 ? A HIS 75 
16 1 Y 1 B MSE 1  ? B MSE 1  
17 1 Y 1 B ALA 2  ? B ALA 2  
18 1 Y 1 B SER 3  ? B SER 3  
19 1 Y 1 B ALA 59 ? B ALA 59 
20 1 Y 1 B ILE 60 ? B ILE 60 
21 1 Y 1 B ASN 61 ? B ASN 61 
22 1 Y 1 B SER 62 ? B SER 62 
23 1 Y 1 B ASP 63 ? B ASP 63 
24 1 Y 1 B ASN 64 ? B ASN 64 
25 1 Y 1 B SER 65 ? B SER 65 
26 1 Y 1 B SER 66 ? B SER 66 
27 1 Y 1 B ASP 67 ? B ASP 67 
28 1 Y 1 B GLU 68 ? B GLU 68 
29 1 Y 1 B GLY 69 ? B GLY 69 
30 1 Y 1 B HIS 70 ? B HIS 70 
31 1 Y 1 B HIS 71 ? B HIS 71 
32 1 Y 1 B HIS 72 ? B HIS 72 
33 1 Y 1 B HIS 73 ? B HIS 73 
34 1 Y 1 B HIS 74 ? B HIS 74 
35 1 Y 1 B HIS 75 ? B HIS 75 
36 1 Y 1 C U   21 ? C U   21 
37 1 Y 1 D U   21 ? D U   21 
2ZI0 'a-form double helix'  
2ZI0 'mismatched base pair' 
_pdbx_entity_nonpoly.entity_id   3        water 
_pdbx_entity_nonpoly.comp_id     HOH 