data_3COQ
# 
_entry.id   3COQ 
# 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.313 
_audit_conform.dict_location   http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic 
# 
loop_
_database_2.database_id 
_database_2.database_code 
PDB   3COQ         
NDB   PD1101       
RCSB  RCSB047032   
WWPDB D_1000047032 
# 
_pdbx_database_status.entry_id                        3COQ 
_pdbx_database_status.deposit_site                    RCSB 
_pdbx_database_status.process_site                    RCSB 
_pdbx_database_status.recvd_initial_deposition_date   2008-03-29 
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.status_code_sf                  REL 
_pdbx_database_status.status_code_mr                  ? 
_pdbx_database_status.SG_entry                        ? 
_pdbx_database_status.pdb_format_compatible           Y 
_pdbx_database_status.status_code_cs                  ? 
_pdbx_database_status.methods_development_category    ? 
# 
loop_
_audit_author.name 
_audit_author.pdbx_ordinal 
'Hong, M.'         1 
'Fitzgerald, M.X.' 2 
'Harper, S.'       3 
'Luo, C.'          4 
'Speicher, D.W.'   5 
# 
_citation.id                        primary 
_citation.title                     'Structural basis for dimerization in DNA recognition by gal4.' 
_citation.journal_abbrev            Structure 
_citation.journal_volume            16 
_citation.page_first                1019 
_citation.page_last                 1026 
_citation.year                      2008 
_citation.journal_id_ASTM           STRUE6 
_citation.country                   UK 
_citation.journal_id_ISSN           0969-2126 
_citation.journal_id_CSD            2005 
_citation.book_publisher            ? 
_citation.pdbx_database_id_PubMed   18611375 
_citation.pdbx_database_id_DOI      10.1016/j.str.2008.03.015 
# 
loop_
_citation_author.citation_id 
_citation_author.name 
_citation_author.ordinal 
_citation_author.identifier_ORCID 
primary 'Hong, M.'         1 ? 
primary 'Fitzgerald, M.X.' 2 ? 
primary 'Harper, S.'       3 ? 
primary 'Luo, C.'          4 ? 
primary 'Speicher, D.W.'   5 ? 
primary 'Marmorstein, R.'  6 ? 
# 
_cell.length_a           126.495 
_cell.length_b           40.829 
_cell.length_c           90.418 
_cell.angle_alpha        90.000 
_cell.angle_beta         95.880 
_cell.angle_gamma        90.000 
_cell.entry_id           3COQ 
_cell.pdbx_unique_axis   ? 
_cell.Z_PDB              8 
_cell.length_a_esd       ? 
_cell.length_b_esd       ? 
_cell.length_c_esd       ? 
_cell.angle_alpha_esd    ? 
_cell.angle_beta_esd     ? 
_cell.angle_gamma_esd    ? 
# 
_symmetry.space_group_name_H-M             'C 1 2 1' 
_symmetry.entry_id                         3COQ 
_symmetry.Int_Tables_number                5 
_symmetry.pdbx_full_space_group_name_H-M   ? 
_symmetry.cell_setting                     ? 
_symmetry.space_group_name_Hall            ? 
# 
loop_
_entity.id 
_entity.type 
_entity.src_method 
_entity.pdbx_description 
_entity.formula_weight 
_entity.pdbx_number_of_molecules 
_entity.pdbx_ec 
_entity.pdbx_mutation 
_entity.pdbx_fragment 
_entity.details 
1 polymer     syn 
;DNA (5'-D(*DAP*DCP*DCP*DGP*DGP*DAP*DGP*DGP*DAP*DCP*DAP*DGP*DTP*DCP*DCP*DTP*DCP*DCP*DGP*DG)-3')
;
6144.968  1  ? ? ?                                                      ? 
2 polymer     syn 
;DNA (5'-D(*DTP*DCP*DCP*DGP*DGP*DAP*DGP*DGP*DAP*DCP*DTP*DGP*DTP*DCP*DCP*DTP*DCP*DCP*DGP*DG)-3')
;
6126.940  1  ? ? ?                                                      ? 
3 polymer     man 'Regulatory protein GAL4'                                                                        10484.505 2  ? 
? 'DNA binding domain with complete dimerization domain' ? 
4 non-polymer syn '(4S)-2-METHYL-2,4-PENTANEDIOL'                                                                  118.174   1  ? 
? ?                                                      ? 
5 non-polymer syn 'ZINC ION'                                                                                       65.409    4  ? 
? ?                                                      ? 
6 water       nat water                                                                                            18.015    33 ? 
? ?                                                      ? 
# 
loop_
_entity_poly.entity_id 
_entity_poly.type 
_entity_poly.nstd_linkage 
_entity_poly.nstd_monomer 
_entity_poly.pdbx_seq_one_letter_code 
_entity_poly.pdbx_seq_one_letter_code_can 
_entity_poly.pdbx_strand_id 
_entity_poly.pdbx_target_identifier 
1 polydeoxyribonucleotide no no '(DA)(DC)(DC)(DG)(DG)(DA)(DG)(DG)(DA)(DC)(DA)(DG)(DT)(DC)(DC)(DT)(DC)(DC)(DG)(DG)'           
ACCGGAGGACAGTCCTCCGG                                                                         D   ? 
2 polydeoxyribonucleotide no no '(DT)(DC)(DC)(DG)(DG)(DA)(DG)(DG)(DA)(DC)(DT)(DG)(DT)(DC)(DC)(DT)(DC)(DC)(DG)(DG)'           
TCCGGAGGACTGTCCTCCGG                                                                         E   ? 
3 'polypeptide(L)'        no no 
;EQACDICRLKKLKCSKEKPKCAKCLKNNWECRYSPKTKRSPLTRAHLTEVESRLERLEQLFLLIFPREDLDMILKMDSLQ
DIKALLTGL
;
;EQACDICRLKKLKCSKEKPKCAKCLKNNWECRYSPKTKRSPLTRAHLTEVESRLERLEQLFLLIFPREDLDMILKMDSLQ
DIKALLTGL
;
A,B ? 
# 
loop_
_entity_poly_seq.entity_id 
_entity_poly_seq.num 
_entity_poly_seq.mon_id 
_entity_poly_seq.hetero 
1 1  DA  n 
1 2  DC  n 
1 3  DC  n 
1 4  DG  n 
1 5  DG  n 
1 6  DA  n 
1 7  DG  n 
1 8  DG  n 
1 9  DA  n 
1 10 DC  n 
1 11 DA  n 
1 12 DG  n 
1 13 DT  n 
1 14 DC  n 
1 15 DC  n 
1 16 DT  n 
1 17 DC  n 
1 18 DC  n 
1 19 DG  n 
1 20 DG  n 
2 1  DT  n 
2 2  DC  n 
2 3  DC  n 
2 4  DG  n 
2 5  DG  n 
2 6  DA  n 
2 7  DG  n 
2 8  DG  n 
2 9  DA  n 
2 10 DC  n 
2 11 DT  n 
2 12 DG  n 
2 13 DT  n 
2 14 DC  n 
2 15 DC  n 
2 16 DT  n 
2 17 DC  n 
2 18 DC  n 
2 19 DG  n 
2 20 DG  n 
3 1  GLU n 
3 2  GLN n 
3 3  ALA n 
3 4  CYS n 
3 5  ASP n 
3 6  ILE n 
3 7  CYS n 
3 8  ARG n 
3 9  LEU n 
3 10 LYS n 
3 11 LYS n 
3 12 LEU n 
3 13 LYS n 
3 14 CYS n 
3 15 SER n 
3 16 LYS n 
3 17 GLU n 
3 18 LYS n 
3 19 PRO n 
3 20 LYS n 
3 21 CYS n 
3 22 ALA n 
3 23 LYS n 
3 24 CYS n 
3 25 LEU n 
3 26 LYS n 
3 27 ASN n 
3 28 ASN n 
3 29 TRP n 
3 30 GLU n 
3 31 CYS n 
3 32 ARG n 
3 33 TYR n 
3 34 SER n 
3 35 PRO n 
3 36 LYS n 
3 37 THR n 
3 38 LYS n 
3 39 ARG n 
3 40 SER n 
3 41 PRO n 
3 42 LEU n 
3 43 THR n 
3 44 ARG n 
3 45 ALA n 
3 46 HIS n 
3 47 LEU n 
3 48 THR n 
3 49 GLU n 
3 50 VAL n 
3 51 GLU n 
3 52 SER n 
3 53 ARG n 
3 54 LEU n 
3 55 GLU n 
3 56 ARG n 
3 57 LEU n 
3 58 GLU n 
3 59 GLN n 
3 60 LEU n 
3 61 PHE n 
3 62 LEU n 
3 63 LEU n 
3 64 ILE n 
3 65 PHE n 
3 66 PRO n 
3 67 ARG n 
3 68 GLU n 
3 69 ASP n 
3 70 LEU n 
3 71 ASP n 
3 72 MET n 
3 73 ILE n 
3 74 LEU n 
3 75 LYS n 
3 76 MET n 
3 77 ASP n 
3 78 SER n 
3 79 LEU n 
3 80 GLN n 
3 81 ASP n 
3 82 ILE n 
3 83 LYS n 
3 84 ALA n 
3 85 LEU n 
3 86 LEU n 
3 87 THR n 
3 88 GLY n 
3 89 LEU n 
# 
_entity_src_gen.entity_id                          3 
_entity_src_gen.pdbx_src_id                        1 
_entity_src_gen.pdbx_alt_source_flag               sample 
_entity_src_gen.pdbx_seq_type                      ? 
_entity_src_gen.pdbx_beg_seq_num                   ? 
_entity_src_gen.pdbx_end_seq_num                   ? 
_entity_src_gen.gene_src_common_name               
;Baker's yeast
;
_entity_src_gen.gene_src_genus                     ? 
_entity_src_gen.pdbx_gene_src_gene                 GAL4 
_entity_src_gen.gene_src_species                   ? 
_entity_src_gen.gene_src_strain                    ? 
_entity_src_gen.gene_src_tissue                    ? 
_entity_src_gen.gene_src_tissue_fraction           ? 
_entity_src_gen.gene_src_details                   ? 
_entity_src_gen.pdbx_gene_src_fragment             ? 
_entity_src_gen.pdbx_gene_src_scientific_name      'Saccharomyces cerevisiae' 
_entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id     4932 
_entity_src_gen.pdbx_gene_src_variant              ? 
_entity_src_gen.pdbx_gene_src_cell_line            ? 
_entity_src_gen.pdbx_gene_src_atcc                 ? 
_entity_src_gen.pdbx_gene_src_organ                ? 
_entity_src_gen.pdbx_gene_src_organelle            ? 
_entity_src_gen.pdbx_gene_src_cell                 ? 
_entity_src_gen.pdbx_gene_src_cellular_location    ? 
_entity_src_gen.host_org_common_name               ? 
_entity_src_gen.pdbx_host_org_scientific_name      'Escherichia coli' 
_entity_src_gen.pdbx_host_org_ncbi_taxonomy_id     562 
_entity_src_gen.host_org_genus                     ? 
_entity_src_gen.pdbx_host_org_gene                 ? 
_entity_src_gen.pdbx_host_org_organ                ? 
_entity_src_gen.host_org_species                   ? 
_entity_src_gen.pdbx_host_org_tissue               ? 
_entity_src_gen.pdbx_host_org_tissue_fraction      ? 
_entity_src_gen.pdbx_host_org_strain               ? 
_entity_src_gen.pdbx_host_org_variant              ? 
_entity_src_gen.pdbx_host_org_cell_line            ? 
_entity_src_gen.pdbx_host_org_atcc                 ? 
_entity_src_gen.pdbx_host_org_culture_collection   ? 
_entity_src_gen.pdbx_host_org_cell                 ? 
_entity_src_gen.pdbx_host_org_organelle            ? 
_entity_src_gen.pdbx_host_org_cellular_location    ? 
_entity_src_gen.pdbx_host_org_vector_type          plasmid 
_entity_src_gen.pdbx_host_org_vector               ? 
_entity_src_gen.host_org_details                   ? 
_entity_src_gen.expression_system_id               ? 
_entity_src_gen.plasmid_name                       ? 
_entity_src_gen.plasmid_details                    ? 
_entity_src_gen.pdbx_description                   ? 
# 
loop_
_pdbx_entity_src_syn.entity_id 
_pdbx_entity_src_syn.pdbx_src_id 
_pdbx_entity_src_syn.pdbx_alt_source_flag 
_pdbx_entity_src_syn.pdbx_beg_seq_num 
_pdbx_entity_src_syn.pdbx_end_seq_num 
_pdbx_entity_src_syn.organism_scientific 
_pdbx_entity_src_syn.organism_common_name 
_pdbx_entity_src_syn.ncbi_taxonomy_id 
_pdbx_entity_src_syn.details 
1 1 sample ? ? 'synthetic construct' ? 32630 ? 
2 1 sample ? ? 'synthetic construct' ? 32630 ? 
# 
loop_
_struct_ref.id 
_struct_ref.db_name 
_struct_ref.db_code 
_struct_ref.pdbx_db_accession 
_struct_ref.entity_id 
_struct_ref.pdbx_seq_one_letter_code 
_struct_ref.pdbx_align_begin 
_struct_ref.pdbx_db_isoform 
1 UNP GAL4_YEAST P04386 3 
;EQACDICRLKKLKCSKEKPKCAKCLKNNWECRYSPKTKRSPLTRAHLTEVESRLERLEQLFLLIFPREDLDMILKMDSLQ
DIKALLTGL
;
8 ? 
2 PDB 3COQ       3COQ   1 ?                                                                                            ? ? 
3 PDB 3COQ       3COQ   2 ?                                                                                            ? ? 
# 
loop_
_struct_ref_seq.align_id 
_struct_ref_seq.ref_id 
_struct_ref_seq.pdbx_PDB_id_code 
_struct_ref_seq.pdbx_strand_id 
_struct_ref_seq.seq_align_beg 
_struct_ref_seq.pdbx_seq_align_beg_ins_code 
_struct_ref_seq.seq_align_end 
_struct_ref_seq.pdbx_seq_align_end_ins_code 
_struct_ref_seq.pdbx_db_accession 
_struct_ref_seq.db_align_beg 
_struct_ref_seq.pdbx_db_align_beg_ins_code 
_struct_ref_seq.db_align_end 
_struct_ref_seq.pdbx_db_align_end_ins_code 
_struct_ref_seq.pdbx_auth_seq_align_beg 
_struct_ref_seq.pdbx_auth_seq_align_end 
1 1 3COQ A 1 ? 89 ? P04386 8  ? 96 ? 8  96 
2 1 3COQ B 1 ? 89 ? P04386 8  ? 96 ? 8  96 
3 2 3COQ D 1 ? 20 ? 3COQ   1  ? 20 ? 1  20 
4 3 3COQ E 1 ? 20 ? 3COQ   21 ? 40 ? 21 40 
# 
loop_
_chem_comp.id 
_chem_comp.type 
_chem_comp.mon_nstd_flag 
_chem_comp.name 
_chem_comp.pdbx_synonyms 
_chem_comp.formula 
_chem_comp.formula_weight 
ALA 'L-peptide linking' y ALANINE                              ? 'C3 H7 N O2'      89.093  
ARG 'L-peptide linking' y ARGININE                             ? 'C6 H15 N4 O2 1'  175.209 
ASN 'L-peptide linking' y ASPARAGINE                           ? 'C4 H8 N2 O3'     132.118 
ASP 'L-peptide linking' y 'ASPARTIC ACID'                      ? 'C4 H7 N O4'      133.103 
CYS 'L-peptide linking' y CYSTEINE                             ? 'C3 H7 N O2 S'    121.158 
DA  'DNA linking'       y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 
DC  'DNA linking'       y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE"  ? 'C9 H14 N3 O7 P'  307.197 
DG  'DNA linking'       y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 
DT  'DNA linking'       y "THYMIDINE-5'-MONOPHOSPHATE"         ? 'C10 H15 N2 O8 P' 322.208 
GLN 'L-peptide linking' y GLUTAMINE                            ? 'C5 H10 N2 O3'    146.144 
GLU 'L-peptide linking' y 'GLUTAMIC ACID'                      ? 'C5 H9 N O4'      147.129 
GLY 'peptide linking'   y GLYCINE                              ? 'C2 H5 N O2'      75.067  
HIS 'L-peptide linking' y HISTIDINE                            ? 'C6 H10 N3 O2 1'  156.162 
HOH non-polymer         . WATER                                ? 'H2 O'            18.015  
ILE 'L-peptide linking' y ISOLEUCINE                           ? 'C6 H13 N O2'     131.173 
LEU 'L-peptide linking' y LEUCINE                              ? 'C6 H13 N O2'     131.173 
LYS 'L-peptide linking' y LYSINE                               ? 'C6 H15 N2 O2 1'  147.195 
MET 'L-peptide linking' y METHIONINE                           ? 'C5 H11 N O2 S'   149.211 
MPD non-polymer         . '(4S)-2-METHYL-2,4-PENTANEDIOL'      ? 'C6 H14 O2'       118.174 
PHE 'L-peptide linking' y PHENYLALANINE                        ? 'C9 H11 N O2'     165.189 
PRO 'L-peptide linking' y PROLINE                              ? 'C5 H9 N O2'      115.130 
SER 'L-peptide linking' y SERINE                               ? 'C3 H7 N O3'      105.093 
THR 'L-peptide linking' y THREONINE                            ? 'C4 H9 N O3'      119.119 
TRP 'L-peptide linking' y TRYPTOPHAN                           ? 'C11 H12 N2 O2'   204.225 
TYR 'L-peptide linking' y TYROSINE                             ? 'C9 H11 N O3'     181.189 
VAL 'L-peptide linking' y VALINE                               ? 'C5 H11 N O2'     117.146 
ZN  non-polymer         . 'ZINC ION'                           ? 'Zn 2'            65.409  
# 
_exptl.crystals_number   1 
_exptl.entry_id          3COQ 
_exptl.method            'X-RAY DIFFRACTION' 
# 
_exptl_crystal.id                    1 
_exptl_crystal.density_Matthews      3.49 
_exptl_crystal.density_meas          ? 
_exptl_crystal.density_percent_sol   64.79 
_exptl_crystal.description           ? 
_exptl_crystal.F_000                 ? 
_exptl_crystal.preparation           ? 
# 
_exptl_crystal_grow.crystal_id      1 
_exptl_crystal_grow.method          'VAPOR DIFFUSION' 
_exptl_crystal_grow.pH              5.5 
_exptl_crystal_grow.temp            298 
_exptl_crystal_grow.pdbx_details    
'40mM Mg(OAc)2, 25mM sodium phosphate, 5% PEG400, 5% MPD, pH 5.5, VAPOR DIFFUSION, temperature 298K' 
_exptl_crystal_grow.temp_details    ? 
_exptl_crystal_grow.pdbx_pH_range   . 
# 
loop_
_exptl_crystal_grow_comp.crystal_id 
_exptl_crystal_grow_comp.id 
_exptl_crystal_grow_comp.sol_id 
_exptl_crystal_grow_comp.name 
_exptl_crystal_grow_comp.conc 
_exptl_crystal_grow_comp.volume 
_exptl_crystal_grow_comp.details 
1 1 1 'Mg(OAc)2'         ? ? ? 
1 2 1 'sodium phosphate' ? ? ? 
1 3 1 PEG400             ? ? ? 
1 4 1 MPD                ? ? ? 
1 5 2 'Mg(OAc)2'         ? ? ? 
1 6 2 'sodium phosphate' ? ? ? 
1 7 2 PEG400             ? ? ? 
1 8 2 MPD                ? ? ? 
# 
loop_
_diffrn.id 
_diffrn.ambient_temp 
_diffrn.ambient_temp_details 
_diffrn.crystal_id 
_diffrn.pdbx_serial_crystal_experiment 
1 298 ? 1 ? 
2 ?   ? 1 ? 
# 
loop_
_diffrn_radiation.diffrn_id 
_diffrn_radiation.pdbx_diffrn_protocol 
_diffrn_radiation.monochromator 
_diffrn_radiation.wavelength_id 
_diffrn_radiation.pdbx_monochromatic_or_laue_m_l 
_diffrn_radiation.pdbx_scattering_type 
1 MAD                 ? 1 M x-ray 
2 'SINGLE WAVELENGTH' ? 1 M x-ray 
# 
loop_
_diffrn_radiation_wavelength.id 
_diffrn_radiation_wavelength.wavelength 
_diffrn_radiation_wavelength.wt 
1 1.2823 1.0 
2 1.2830 1.0 
3 1.2448 1.0 
# 
loop_
_diffrn_source.diffrn_id 
_diffrn_source.source 
_diffrn_source.type 
_diffrn_source.pdbx_wavelength_list 
_diffrn_source.pdbx_wavelength 
_diffrn_source.pdbx_synchrotron_site 
_diffrn_source.pdbx_synchrotron_beamline 
1 SYNCHROTRON 'NSLS BEAMLINE X25' 1.2823,1.2830,1.2448 ? NSLS  X25 
2 SYNCHROTRON 'CHESS BEAMLINE F1' ?                    ? CHESS F1  
# 
_reflns.entry_id                     3COQ 
_reflns.d_resolution_high            2.40 
_reflns.d_resolution_low             50.000 
_reflns.number_obs                   18311 
_reflns.pdbx_Rmerge_I_obs            0.066 
_reflns.pdbx_netI_over_sigmaI        16.400 
_reflns.pdbx_chi_squared             1.079 
_reflns.pdbx_redundancy              3.700 
_reflns.percent_possible_obs         98.100 
_reflns.observed_criterion_sigma_F   ? 
_reflns.observed_criterion_sigma_I   ? 
_reflns.number_all                   ? 
_reflns.pdbx_Rsym_value              ? 
_reflns.B_iso_Wilson_estimate        ? 
_reflns.R_free_details               ? 
_reflns.pdbx_scaling_rejects         ? 
_reflns.limit_h_max                  ? 
_reflns.limit_h_min                  ? 
_reflns.limit_k_max                  ? 
_reflns.limit_k_min                  ? 
_reflns.limit_l_max                  ? 
_reflns.limit_l_min                  ? 
_reflns.observed_criterion_F_max     ? 
_reflns.observed_criterion_F_min     ? 
_reflns.pdbx_ordinal                 1 
_reflns.pdbx_diffrn_id               1,2 
# 
_reflns_shell.d_res_high             2.40 
_reflns_shell.d_res_low              2.49 
_reflns_shell.number_measured_obs    ? 
_reflns_shell.number_measured_all    ? 
_reflns_shell.number_unique_obs      ? 
_reflns_shell.Rmerge_I_obs           0.417 
_reflns_shell.meanI_over_sigI_obs    ? 
_reflns_shell.pdbx_Rsym_value        ? 
_reflns_shell.pdbx_chi_squared       0.963 
_reflns_shell.pdbx_redundancy        3.50 
_reflns_shell.percent_possible_obs   ? 
_reflns_shell.number_unique_all      1758 
_reflns_shell.percent_possible_all   97.00 
_reflns_shell.pdbx_ordinal           1 
_reflns_shell.pdbx_diffrn_id         1,2 
# 
_refine.entry_id                                 3COQ 
_refine.ls_d_res_high                            2.40 
_refine.ls_d_res_low                             28.940 
_refine.pdbx_ls_sigma_F                          0.00 
_refine.ls_percent_reflns_obs                    96.910 
_refine.ls_number_reflns_obs                     14040 
_refine.pdbx_ls_cross_valid_method               THROUGHOUT 
_refine.pdbx_R_Free_selection_details            RANDOM 
_refine.ls_R_factor_obs                          0.213 
_refine.ls_R_factor_R_work                       0.207 
_refine.ls_R_factor_R_free                       0.269 
_refine.ls_percent_reflns_R_free                 9.300 
_refine.ls_number_reflns_R_free                  1304 
_refine.B_iso_mean                               48.172 
_refine.aniso_B[1][1]                            0.190 
_refine.aniso_B[2][2]                            -0.170 
_refine.aniso_B[3][3]                            0.020 
_refine.aniso_B[1][2]                            0.000 
_refine.aniso_B[1][3]                            0.230 
_refine.aniso_B[2][3]                            0.000 
_refine.correlation_coeff_Fo_to_Fc               0.948 
_refine.correlation_coeff_Fo_to_Fc_free          0.911 
_refine.pdbx_overall_ESU_R                       0.457 
_refine.pdbx_overall_ESU_R_Free                  0.312 
_refine.overall_SU_ML                            0.227 
_refine.overall_SU_B                             21.794 
_refine.solvent_model_details                    MASK 
_refine.pdbx_solvent_vdw_probe_radii             1.400 
_refine.pdbx_solvent_ion_probe_radii             0.800 
_refine.pdbx_solvent_shrinkage_radii             0.800 
_refine.pdbx_method_to_determine_struct          ? 
_refine.pdbx_stereochemistry_target_values       'MAXIMUM LIKELIHOOD' 
_refine.pdbx_ls_sigma_I                          ? 
_refine.ls_number_reflns_all                     ? 
_refine.ls_R_factor_all                          ? 
_refine.ls_redundancy_reflns_obs                 ? 
_refine.pdbx_data_cutoff_high_absF               ? 
_refine.pdbx_data_cutoff_low_absF                ? 
_refine.ls_number_parameters                     ? 
_refine.ls_number_restraints                     ? 
_refine.ls_R_factor_R_free_error                 ? 
_refine.ls_R_factor_R_free_error_details         ? 
_refine.pdbx_starting_model                      ? 
_refine.pdbx_stereochem_target_val_spec_case     ? 
_refine.solvent_model_param_bsol                 ? 
_refine.solvent_model_param_ksol                 ? 
_refine.occupancy_max                            ? 
_refine.occupancy_min                            ? 
_refine.pdbx_isotropic_thermal_model             ? 
_refine.details                                  ? 
_refine.overall_SU_R_Cruickshank_DPI             ? 
_refine.overall_SU_R_free                        ? 
_refine.pdbx_data_cutoff_high_rms_absF           ? 
_refine.ls_wR_factor_R_free                      ? 
_refine.ls_wR_factor_R_work                      ? 
_refine.overall_FOM_free_R_set                   ? 
_refine.overall_FOM_work_R_set                   ? 
_refine.pdbx_overall_phase_error                 ? 
_refine.B_iso_min                                ? 
_refine.B_iso_max                                ? 
_refine.pdbx_refine_id                           'X-RAY DIFFRACTION' 
_refine.pdbx_TLS_residual_ADP_flag               'LIKELY RESIDUAL' 
_refine.pdbx_diffrn_id                           1 
_refine.pdbx_overall_SU_R_free_Cruickshank_DPI   ? 
_refine.pdbx_overall_SU_R_Blow_DPI               ? 
_refine.pdbx_overall_SU_R_free_Blow_DPI          ? 
# 
_refine_hist.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_refine_hist.cycle_id                         LAST 
_refine_hist.pdbx_number_atoms_protein        1454 
_refine_hist.pdbx_number_atoms_nucleic_acid   814 
_refine_hist.pdbx_number_atoms_ligand         12 
_refine_hist.number_atoms_solvent             33 
_refine_hist.number_atoms_total               2313 
_refine_hist.d_res_high                       2.40 
_refine_hist.d_res_low                        28.940 
# 
loop_
_refine_ls_restr.type 
_refine_ls_restr.number 
_refine_ls_restr.dev_ideal 
_refine_ls_restr.dev_ideal_target 
_refine_ls_restr.weight 
_refine_ls_restr.pdbx_refine_id 
_refine_ls_restr.pdbx_restraint_function 
r_bond_refined_d         2391 0.030  0.022  ? 'X-RAY DIFFRACTION' ? 
r_angle_refined_deg      3380 3.337  2.432  ? 'X-RAY DIFFRACTION' ? 
r_dihedral_angle_1_deg   176  8.318  5.000  ? 'X-RAY DIFFRACTION' ? 
r_dihedral_angle_2_deg   60   36.995 23.667 ? 'X-RAY DIFFRACTION' ? 
r_dihedral_angle_3_deg   330  24.666 15.000 ? 'X-RAY DIFFRACTION' ? 
r_dihedral_angle_4_deg   14   19.743 15.000 ? 'X-RAY DIFFRACTION' ? 
r_chiral_restr           386  0.174  0.200  ? 'X-RAY DIFFRACTION' ? 
r_gen_planes_refined     1440 0.013  0.020  ? 'X-RAY DIFFRACTION' ? 
r_nbd_refined            1047 0.297  0.200  ? 'X-RAY DIFFRACTION' ? 
r_nbtor_refined          1527 0.341  0.200  ? 'X-RAY DIFFRACTION' ? 
r_xyhbond_nbd_refined    117  0.195  0.200  ? 'X-RAY DIFFRACTION' ? 
r_symmetry_vdw_refined   50   0.276  0.200  ? 'X-RAY DIFFRACTION' ? 
r_symmetry_hbond_refined 7    0.177  0.200  ? 'X-RAY DIFFRACTION' ? 
r_mcbond_it              933  1.604  1.500  ? 'X-RAY DIFFRACTION' ? 
r_mcangle_it             1446 2.632  2.000  ? 'X-RAY DIFFRACTION' ? 
r_scbond_it              1933 3.053  3.000  ? 'X-RAY DIFFRACTION' ? 
r_scangle_it             1934 4.456  4.500  ? 'X-RAY DIFFRACTION' ? 
# 
_refine_ls_shell.d_res_high                       2.40 
_refine_ls_shell.d_res_low                        2.667 
_refine_ls_shell.pdbx_total_number_of_bins_used   20 
_refine_ls_shell.percent_reflns_obs               92.230 
_refine_ls_shell.number_reflns_R_work             889 
_refine_ls_shell.R_factor_all                     ? 
_refine_ls_shell.R_factor_R_work                  0.386 
_refine_ls_shell.R_factor_R_free                  0.377 
_refine_ls_shell.percent_reflns_R_free            ? 
_refine_ls_shell.number_reflns_R_free             96 
_refine_ls_shell.R_factor_R_free_error            ? 
_refine_ls_shell.number_reflns_all                985 
_refine_ls_shell.number_reflns_obs                ? 
_refine_ls_shell.redundancy_reflns_obs            ? 
_refine_ls_shell.pdbx_refine_id                   'X-RAY DIFFRACTION' 
# 
_struct.entry_id                  3COQ 
_struct.title                     'Structural Basis for Dimerization in DNA Recognition by Gal4' 
_struct.pdbx_descriptor           'Regulatory protein GAL4/DNA Complex' 
_struct.pdbx_model_details        ? 
_struct.pdbx_CASP_flag            ? 
_struct.pdbx_model_type_details   ? 
# 
_struct_keywords.entry_id        3COQ 
_struct_keywords.text            
;helix bundle, Protein-DNA complex, zinc binuclear cluster, Activator, Carbohydrate metabolism, DNA-binding, Galactose metabolism, Metal-binding, Nucleus, Phosphoprotein, Transcription, Transcription regulation, Transcription-DNA COMPLEX
;
_struct_keywords.pdbx_keywords   Transcription/DNA 
# 
loop_
_struct_asym.id 
_struct_asym.pdbx_blank_PDB_chainid_flag 
_struct_asym.pdbx_modified 
_struct_asym.entity_id 
_struct_asym.details 
A N N 1 ? 
B N N 2 ? 
C N N 3 ? 
D N N 3 ? 
E N N 4 ? 
F N N 5 ? 
G N N 5 ? 
H N N 5 ? 
I N N 5 ? 
J N N 6 ? 
K N N 6 ? 
L N N 6 ? 
M N N 6 ? 
# 
loop_
_struct_conf.conf_type_id 
_struct_conf.id 
_struct_conf.pdbx_PDB_helix_id 
_struct_conf.beg_label_comp_id 
_struct_conf.beg_label_asym_id 
_struct_conf.beg_label_seq_id 
_struct_conf.pdbx_beg_PDB_ins_code 
_struct_conf.end_label_comp_id 
_struct_conf.end_label_asym_id 
_struct_conf.end_label_seq_id 
_struct_conf.pdbx_end_PDB_ins_code 
_struct_conf.beg_auth_comp_id 
_struct_conf.beg_auth_asym_id 
_struct_conf.beg_auth_seq_id 
_struct_conf.end_auth_comp_id 
_struct_conf.end_auth_asym_id 
_struct_conf.end_auth_seq_id 
_struct_conf.pdbx_PDB_helix_class 
_struct_conf.details 
_struct_conf.pdbx_PDB_helix_length 
HELX_P HELX_P1  1  CYS C 4  ? LYS C 11 ? CYS A 11 LYS A 18 1 ? 8  
HELX_P HELX_P2  2  CYS C 21 ? ASN C 27 ? CYS A 28 ASN A 34 1 ? 7  
HELX_P HELX_P3  3  THR C 43 ? PHE C 65 ? THR A 50 PHE A 72 1 ? 23 
HELX_P HELX_P4  4  ASP C 69 ? MET C 76 ? ASP A 76 MET A 83 1 ? 8  
HELX_P HELX_P5  5  SER C 78 ? THR C 87 ? SER A 85 THR A 94 1 ? 10 
HELX_P HELX_P6  6  CYS D 4  ? LYS D 11 ? CYS B 11 LYS B 18 1 ? 8  
HELX_P HELX_P7  7  CYS D 21 ? ASN D 28 ? CYS B 28 ASN B 35 1 ? 8  
HELX_P HELX_P8  8  THR D 43 ? PHE D 65 ? THR B 50 PHE B 72 1 ? 23 
HELX_P HELX_P9  9  PRO D 66 ? LYS D 75 ? PRO B 73 LYS B 82 1 ? 10 
HELX_P HELX_P10 10 SER D 78 ? GLY D 88 ? SER B 85 GLY B 95 1 ? 11 
# 
_struct_conf_type.id          HELX_P 
_struct_conf_type.criteria    ? 
_struct_conf_type.reference   ? 
# 
loop_
_struct_conn.id 
_struct_conn.conn_type_id 
_struct_conn.pdbx_leaving_atom_flag 
_struct_conn.pdbx_PDB_id 
_struct_conn.ptnr1_label_asym_id 
_struct_conn.ptnr1_label_comp_id 
_struct_conn.ptnr1_label_seq_id 
_struct_conn.ptnr1_label_atom_id 
_struct_conn.pdbx_ptnr1_label_alt_id 
_struct_conn.pdbx_ptnr1_PDB_ins_code 
_struct_conn.pdbx_ptnr1_standard_comp_id 
_struct_conn.ptnr1_symmetry 
_struct_conn.ptnr2_label_asym_id 
_struct_conn.ptnr2_label_comp_id 
_struct_conn.ptnr2_label_seq_id 
_struct_conn.ptnr2_label_atom_id 
_struct_conn.pdbx_ptnr2_label_alt_id 
_struct_conn.pdbx_ptnr2_PDB_ins_code 
_struct_conn.ptnr1_auth_asym_id 
_struct_conn.ptnr1_auth_comp_id 
_struct_conn.ptnr1_auth_seq_id 
_struct_conn.ptnr2_auth_asym_id 
_struct_conn.ptnr2_auth_comp_id 
_struct_conn.ptnr2_auth_seq_id 
_struct_conn.ptnr2_symmetry 
_struct_conn.pdbx_ptnr3_label_atom_id 
_struct_conn.pdbx_ptnr3_label_seq_id 
_struct_conn.pdbx_ptnr3_label_comp_id 
_struct_conn.pdbx_ptnr3_label_asym_id 
_struct_conn.pdbx_ptnr3_label_alt_id 
_struct_conn.pdbx_ptnr3_PDB_ins_code 
_struct_conn.details 
_struct_conn.pdbx_dist_value 
_struct_conn.pdbx_value_order 
metalc1  metalc ? ? C CYS 4  SG ? ? ? 1_555 G ZN .  ZN ? ? A CYS 11 A ZN 1002 1_555 ? ? ? ? ? ? ?            2.584 ? 
metalc2  metalc ? ? C CYS 4  SG ? ? ? 1_555 F ZN .  ZN ? ? A CYS 11 A ZN 1001 1_555 ? ? ? ? ? ? ?            2.488 ? 
metalc3  metalc ? ? C CYS 7  SG ? ? ? 1_555 F ZN .  ZN ? ? A CYS 14 A ZN 1001 1_555 ? ? ? ? ? ? ?            2.315 ? 
metalc4  metalc ? ? C CYS 21 SG ? ? ? 1_555 G ZN .  ZN ? ? A CYS 28 A ZN 1002 1_555 ? ? ? ? ? ? ?            2.316 ? 
metalc5  metalc ? ? C CYS 21 SG ? ? ? 1_555 F ZN .  ZN ? ? A CYS 28 A ZN 1001 1_555 ? ? ? ? ? ? ?            2.525 ? 
metalc6  metalc ? ? C CYS 24 SG ? ? ? 1_555 G ZN .  ZN ? ? A CYS 31 A ZN 1002 1_555 ? ? ? ? ? ? ?            2.279 ? 
metalc7  metalc ? ? C CYS 31 SG ? ? ? 1_555 G ZN .  ZN ? ? A CYS 38 A ZN 1002 1_555 ? ? ? ? ? ? ?            2.341 ? 
metalc8  metalc ? ? D CYS 4  SG ? ? ? 1_555 H ZN .  ZN ? ? B CYS 11 B ZN 1    1_555 ? ? ? ? ? ? ?            2.230 ? 
metalc9  metalc ? ? D CYS 4  SG ? ? ? 1_555 I ZN .  ZN ? ? B CYS 11 B ZN 2    1_555 ? ? ? ? ? ? ?            2.579 ? 
metalc10 metalc ? ? D CYS 7  SG ? ? ? 1_555 H ZN .  ZN ? ? B CYS 14 B ZN 1    1_555 ? ? ? ? ? ? ?            2.224 ? 
metalc11 metalc ? ? D CYS 14 SG ? ? ? 1_555 H ZN .  ZN ? ? B CYS 21 B ZN 1    1_555 ? ? ? ? ? ? ?            2.226 ? 
metalc12 metalc ? ? D CYS 21 SG ? ? ? 1_555 H ZN .  ZN ? ? B CYS 28 B ZN 1    1_555 ? ? ? ? ? ? ?            2.692 ? 
metalc13 metalc ? ? D CYS 21 SG ? ? ? 1_555 I ZN .  ZN ? ? B CYS 28 B ZN 2    1_555 ? ? ? ? ? ? ?            2.577 ? 
metalc14 metalc ? ? D CYS 24 SG ? ? ? 1_555 I ZN .  ZN ? ? B CYS 31 B ZN 2    1_555 ? ? ? ? ? ? ?            1.955 ? 
metalc15 metalc ? ? D CYS 31 SG ? ? ? 1_555 I ZN .  ZN ? ? B CYS 38 B ZN 2    1_555 ? ? ? ? ? ? ?            2.022 ? 
hydrog1  hydrog ? ? A DC  2  N3 ? ? ? 1_555 B DG 20 N1 ? ? D DC  2  E DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog2  hydrog ? ? A DC  2  N4 ? ? ? 1_555 B DG 20 O6 ? ? D DC  2  E DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog3  hydrog ? ? A DC  2  O2 ? ? ? 1_555 B DG 20 N2 ? ? D DC  2  E DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog4  hydrog ? ? A DC  3  N3 ? ? ? 1_555 B DG 19 N1 ? ? D DC  3  E DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog5  hydrog ? ? A DC  3  N4 ? ? ? 1_555 B DG 19 O6 ? ? D DC  3  E DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog6  hydrog ? ? A DC  3  O2 ? ? ? 1_555 B DG 19 N2 ? ? D DC  3  E DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog7  hydrog ? ? A DG  4  N1 ? ? ? 1_555 B DC 18 N3 ? ? D DG  4  E DC 38   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog8  hydrog ? ? A DG  4  N2 ? ? ? 1_555 B DC 18 O2 ? ? D DG  4  E DC 38   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog9  hydrog ? ? A DG  4  O6 ? ? ? 1_555 B DC 18 N4 ? ? D DG  4  E DC 38   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog10 hydrog ? ? A DG  5  N1 ? ? ? 1_555 B DC 17 N3 ? ? D DG  5  E DC 37   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog11 hydrog ? ? A DG  5  N2 ? ? ? 1_555 B DC 17 O2 ? ? D DG  5  E DC 37   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog12 hydrog ? ? A DG  5  O6 ? ? ? 1_555 B DC 17 N4 ? ? D DG  5  E DC 37   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog13 hydrog ? ? A DA  6  N1 ? ? ? 1_555 B DT 16 N3 ? ? D DA  6  E DT 36   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog14 hydrog ? ? A DA  6  N6 ? ? ? 1_555 B DT 16 O4 ? ? D DA  6  E DT 36   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog15 hydrog ? ? A DG  7  N1 ? ? ? 1_555 B DC 15 N3 ? ? D DG  7  E DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog16 hydrog ? ? A DG  7  N2 ? ? ? 1_555 B DC 15 O2 ? ? D DG  7  E DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog17 hydrog ? ? A DG  7  O6 ? ? ? 1_555 B DC 15 N4 ? ? D DG  7  E DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog18 hydrog ? ? A DG  8  N1 ? ? ? 1_555 B DC 14 N3 ? ? D DG  8  E DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog19 hydrog ? ? A DG  8  N2 ? ? ? 1_555 B DC 14 O2 ? ? D DG  8  E DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog20 hydrog ? ? A DG  8  O6 ? ? ? 1_555 B DC 14 N4 ? ? D DG  8  E DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog21 hydrog ? ? A DA  9  N1 ? ? ? 1_555 B DT 13 N3 ? ? D DA  9  E DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog22 hydrog ? ? A DA  9  N6 ? ? ? 1_555 B DT 13 O4 ? ? D DA  9  E DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog23 hydrog ? ? A DC  10 N3 ? ? ? 1_555 B DG 12 N1 ? ? D DC  10 E DG 32   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog24 hydrog ? ? A DC  10 N4 ? ? ? 1_555 B DG 12 O6 ? ? D DC  10 E DG 32   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog25 hydrog ? ? A DC  10 O2 ? ? ? 1_555 B DG 12 N2 ? ? D DC  10 E DG 32   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog26 hydrog ? ? A DA  11 N1 ? ? ? 1_555 B DT 11 N3 ? ? D DA  11 E DT 31   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog27 hydrog ? ? A DA  11 N6 ? ? ? 1_555 B DT 11 O4 ? ? D DA  11 E DT 31   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog28 hydrog ? ? A DG  12 N1 ? ? ? 1_555 B DC 10 N3 ? ? D DG  12 E DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog29 hydrog ? ? A DG  12 N2 ? ? ? 1_555 B DC 10 O2 ? ? D DG  12 E DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog30 hydrog ? ? A DG  12 O6 ? ? ? 1_555 B DC 10 N4 ? ? D DG  12 E DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog31 hydrog ? ? A DT  13 N3 ? ? ? 1_555 B DA 9  N1 ? ? D DT  13 E DA 29   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog32 hydrog ? ? A DT  13 O4 ? ? ? 1_555 B DA 9  N6 ? ? D DT  13 E DA 29   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog33 hydrog ? ? A DC  14 N3 ? ? ? 1_555 B DG 8  N1 ? ? D DC  14 E DG 28   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog34 hydrog ? ? A DC  14 N4 ? ? ? 1_555 B DG 8  O6 ? ? D DC  14 E DG 28   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog35 hydrog ? ? A DC  14 O2 ? ? ? 1_555 B DG 8  N2 ? ? D DC  14 E DG 28   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog36 hydrog ? ? A DC  15 N3 ? ? ? 1_555 B DG 7  N1 ? ? D DC  15 E DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog37 hydrog ? ? A DC  15 N4 ? ? ? 1_555 B DG 7  O6 ? ? D DC  15 E DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog38 hydrog ? ? A DC  15 O2 ? ? ? 1_555 B DG 7  N2 ? ? D DC  15 E DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog39 hydrog ? ? A DT  16 N3 ? ? ? 1_555 B DA 6  N1 ? ? D DT  16 E DA 26   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog40 hydrog ? ? A DT  16 O4 ? ? ? 1_555 B DA 6  N6 ? ? D DT  16 E DA 26   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog41 hydrog ? ? A DC  17 N3 ? ? ? 1_555 B DG 5  N1 ? ? D DC  17 E DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog42 hydrog ? ? A DC  17 N4 ? ? ? 1_555 B DG 5  O6 ? ? D DC  17 E DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog43 hydrog ? ? A DC  17 O2 ? ? ? 1_555 B DG 5  N2 ? ? D DC  17 E DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog44 hydrog ? ? A DC  18 N3 ? ? ? 1_555 B DG 4  N1 ? ? D DC  18 E DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog45 hydrog ? ? A DC  18 N4 ? ? ? 1_555 B DG 4  O6 ? ? D DC  18 E DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog46 hydrog ? ? A DC  18 O2 ? ? ? 1_555 B DG 4  N2 ? ? D DC  18 E DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog47 hydrog ? ? A DG  19 N1 ? ? ? 1_555 B DC 3  N3 ? ? D DG  19 E DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog48 hydrog ? ? A DG  19 N2 ? ? ? 1_555 B DC 3  O2 ? ? D DG  19 E DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog49 hydrog ? ? A DG  19 O6 ? ? ? 1_555 B DC 3  N4 ? ? D DG  19 E DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog50 hydrog ? ? A DG  20 N1 ? ? ? 1_555 B DC 2  N3 ? ? D DG  20 E DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog51 hydrog ? ? A DG  20 N2 ? ? ? 1_555 B DC 2  O2 ? ? D DG  20 E DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog52 hydrog ? ? A DG  20 O6 ? ? ? 1_555 B DC 2  N4 ? ? D DG  20 E DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
# 
loop_
_struct_conn_type.id 
_struct_conn_type.criteria 
_struct_conn_type.reference 
metalc ? ? 
hydrog ? ? 
# 
loop_
_struct_mon_prot_cis.pdbx_id 
_struct_mon_prot_cis.label_comp_id 
_struct_mon_prot_cis.label_seq_id 
_struct_mon_prot_cis.label_asym_id 
_struct_mon_prot_cis.label_alt_id 
_struct_mon_prot_cis.pdbx_PDB_ins_code 
_struct_mon_prot_cis.auth_comp_id 
_struct_mon_prot_cis.auth_seq_id 
_struct_mon_prot_cis.auth_asym_id 
_struct_mon_prot_cis.pdbx_label_comp_id_2 
_struct_mon_prot_cis.pdbx_label_seq_id_2 
_struct_mon_prot_cis.pdbx_label_asym_id_2 
_struct_mon_prot_cis.pdbx_PDB_ins_code_2 
_struct_mon_prot_cis.pdbx_auth_comp_id_2 
_struct_mon_prot_cis.pdbx_auth_seq_id_2 
_struct_mon_prot_cis.pdbx_auth_asym_id_2 
_struct_mon_prot_cis.pdbx_PDB_model_num 
_struct_mon_prot_cis.pdbx_omega_angle 
1 LYS 18 C . ? LYS 25 A PRO 19 C ? PRO 26 A 1 5.06  
2 LYS 18 D . ? LYS 25 B PRO 19 D ? PRO 26 B 1 14.31 
# 
loop_
_struct_site.id 
_struct_site.pdbx_evidence_code 
_struct_site.pdbx_auth_asym_id 
_struct_site.pdbx_auth_comp_id 
_struct_site.pdbx_auth_seq_id 
_struct_site.pdbx_auth_ins_code 
_struct_site.pdbx_num_residues 
_struct_site.details 
AC1 Software ? ? ? ? 4 'BINDING SITE FOR RESIDUE ZN A 1001' 
AC2 Software ? ? ? ? 4 'BINDING SITE FOR RESIDUE ZN A 1002' 
AC3 Software ? ? ? ? 4 'BINDING SITE FOR RESIDUE ZN B 1'    
AC4 Software ? ? ? ? 4 'BINDING SITE FOR RESIDUE ZN B 2'    
AC5 Software ? ? ? ? 7 'BINDING SITE FOR RESIDUE MPD D 100' 
# 
loop_
_struct_site_gen.id 
_struct_site_gen.site_id 
_struct_site_gen.pdbx_num_res 
_struct_site_gen.label_comp_id 
_struct_site_gen.label_asym_id 
_struct_site_gen.label_seq_id 
_struct_site_gen.pdbx_auth_ins_code 
_struct_site_gen.auth_comp_id 
_struct_site_gen.auth_asym_id 
_struct_site_gen.auth_seq_id 
_struct_site_gen.label_atom_id 
_struct_site_gen.label_alt_id 
_struct_site_gen.symmetry 
_struct_site_gen.details 
1  AC1 4 CYS C 4  ? CYS A 11 . ? 1_555 ? 
2  AC1 4 CYS C 7  ? CYS A 14 . ? 1_555 ? 
3  AC1 4 CYS C 14 ? CYS A 21 . ? 1_555 ? 
4  AC1 4 CYS C 21 ? CYS A 28 . ? 1_555 ? 
5  AC2 4 CYS C 4  ? CYS A 11 . ? 1_555 ? 
6  AC2 4 CYS C 21 ? CYS A 28 . ? 1_555 ? 
7  AC2 4 CYS C 24 ? CYS A 31 . ? 1_555 ? 
8  AC2 4 CYS C 31 ? CYS A 38 . ? 1_555 ? 
9  AC3 4 CYS D 4  ? CYS B 11 . ? 1_555 ? 
10 AC3 4 CYS D 7  ? CYS B 14 . ? 1_555 ? 
11 AC3 4 CYS D 14 ? CYS B 21 . ? 1_555 ? 
12 AC3 4 CYS D 21 ? CYS B 28 . ? 1_555 ? 
13 AC4 4 CYS D 4  ? CYS B 11 . ? 1_555 ? 
14 AC4 4 CYS D 21 ? CYS B 28 . ? 1_555 ? 
15 AC4 4 CYS D 24 ? CYS B 31 . ? 1_555 ? 
16 AC4 4 CYS D 31 ? CYS B 38 . ? 1_555 ? 
17 AC5 7 LEU C 42 ? LEU A 49 . ? 1_555 ? 
18 AC5 7 DA  A 11 ? DA  D 11 . ? 1_555 ? 
19 AC5 7 DG  A 12 ? DG  D 12 . ? 1_555 ? 
20 AC5 7 DT  A 13 ? DT  D 13 . ? 1_555 ? 
21 AC5 7 DT  B 11 ? DT  E 31 . ? 1_555 ? 
22 AC5 7 DG  B 12 ? DG  E 32 . ? 1_555 ? 
23 AC5 7 DT  B 13 ? DT  E 33 . ? 1_555 ? 
# 
_atom_sites.entry_id                    3COQ 
_atom_sites.fract_transf_matrix[1][1]   0.007905 
_atom_sites.fract_transf_matrix[1][2]   0.000000 
_atom_sites.fract_transf_matrix[1][3]   0.000814 
_atom_sites.fract_transf_matrix[2][1]   0.000000 
_atom_sites.fract_transf_matrix[2][2]   0.024492 
_atom_sites.fract_transf_matrix[2][3]   0.000000 
_atom_sites.fract_transf_matrix[3][1]   0.000000 
_atom_sites.fract_transf_matrix[3][2]   0.000000 
_atom_sites.fract_transf_matrix[3][3]   0.011118 
_atom_sites.fract_transf_vector[1]      0.000000 
_atom_sites.fract_transf_vector[2]      0.000000 
_atom_sites.fract_transf_vector[3]      0.000000 
# 
loop_
_atom_type.symbol 
C  
N  
O  
P  
S  
ZN 
# 
loop_
_atom_site.group_PDB 
_atom_site.id 
_atom_site.type_symbol 
_atom_site.label_atom_id 
_atom_site.label_alt_id 
_atom_site.label_comp_id 
_atom_site.label_asym_id 
_atom_site.label_entity_id 
_atom_site.label_seq_id 
_atom_site.pdbx_PDB_ins_code 
_atom_site.Cartn_x 
_atom_site.Cartn_y 
_atom_site.Cartn_z 
_atom_site.occupancy 
_atom_site.B_iso_or_equiv 
_atom_site.pdbx_formal_charge 
_atom_site.auth_seq_id 
_atom_site.auth_comp_id 
_atom_site.auth_asym_id 
_atom_site.auth_atom_id 
_atom_site.pdbx_PDB_model_num 
ATOM   1    O  "O5'" . DA  A 1 1  ? 47.766  3.640   101.239 1.00 67.65 ? 1    DA  D "O5'" 1 
ATOM   2    C  "C5'" . DA  A 1 1  ? 49.126  3.914   101.657 1.00 67.89 ? 1    DA  D "C5'" 1 
ATOM   3    C  "C4'" . DA  A 1 1  ? 49.283  4.696   102.983 1.00 67.54 ? 1    DA  D "C4'" 1 
ATOM   4    O  "O4'" . DA  A 1 1  ? 49.813  6.018   102.674 1.00 65.71 ? 1    DA  D "O4'" 1 
ATOM   5    C  "C3'" . DA  A 1 1  ? 48.062  4.990   103.893 1.00 67.20 ? 1    DA  D "C3'" 1 
ATOM   6    O  "O3'" . DA  A 1 1  ? 48.394  5.149   105.330 1.00 67.29 ? 1    DA  D "O3'" 1 
ATOM   7    C  "C2'" . DA  A 1 1  ? 47.528  6.278   103.259 1.00 63.87 ? 1    DA  D "C2'" 1 
ATOM   8    C  "C1'" . DA  A 1 1  ? 48.807  6.996   102.815 1.00 60.20 ? 1    DA  D "C1'" 1 
ATOM   9    N  N9    . DA  A 1 1  ? 48.785  7.495   101.474 1.00 57.87 ? 1    DA  D N9    1 
ATOM   10   C  C8    . DA  A 1 1  ? 48.489  6.839   100.310 1.00 59.44 ? 1    DA  D C8    1 
ATOM   11   N  N7    . DA  A 1 1  ? 48.579  7.546   99.202  1.00 57.36 ? 1    DA  D N7    1 
ATOM   12   C  C5    . DA  A 1 1  ? 48.977  8.763   99.696  1.00 57.19 ? 1    DA  D C5    1 
ATOM   13   C  C6    . DA  A 1 1  ? 49.244  9.955   99.019  1.00 57.83 ? 1    DA  D C6    1 
ATOM   14   N  N6    . DA  A 1 1  ? 49.168  10.143  97.686  1.00 58.48 ? 1    DA  D N6    1 
ATOM   15   N  N1    . DA  A 1 1  ? 49.600  10.946  99.845  1.00 59.74 ? 1    DA  D N1    1 
ATOM   16   C  C2    . DA  A 1 1  ? 49.685  10.748  101.199 1.00 58.97 ? 1    DA  D C2    1 
ATOM   17   N  N3    . DA  A 1 1  ? 49.478  9.674   101.959 1.00 56.19 ? 1    DA  D N3    1 
ATOM   18   C  C4    . DA  A 1 1  ? 49.112  8.732   101.100 1.00 56.99 ? 1    DA  D C4    1 
ATOM   19   P  P     . DC  A 1 2  ? 47.200  5.371   106.386 1.00 70.39 ? 2    DC  D P     1 
ATOM   20   O  OP1   . DC  A 1 2  ? 47.619  5.149   107.780 1.00 69.70 ? 2    DC  D OP1   1 
ATOM   21   O  OP2   . DC  A 1 2  ? 45.977  4.724   105.798 1.00 69.22 ? 2    DC  D OP2   1 
ATOM   22   O  "O5'" . DC  A 1 2  ? 47.007  6.937   106.405 1.00 69.27 ? 2    DC  D "O5'" 1 
ATOM   23   C  "C5'" . DC  A 1 2  ? 47.906  7.807   107.090 1.00 67.52 ? 2    DC  D "C5'" 1 
ATOM   24   C  "C4'" . DC  A 1 2  ? 47.305  9.160   106.774 1.00 65.83 ? 2    DC  D "C4'" 1 
ATOM   25   O  "O4'" . DC  A 1 2  ? 47.227  9.389   105.328 1.00 63.31 ? 2    DC  D "O4'" 1 
ATOM   26   C  "C3'" . DC  A 1 2  ? 45.858  9.233   107.243 1.00 64.65 ? 2    DC  D "C3'" 1 
ATOM   27   O  "O3'" . DC  A 1 2  ? 45.926  10.034  108.405 1.00 63.77 ? 2    DC  D "O3'" 1 
ATOM   28   C  "C2'" . DC  A 1 2  ? 45.025  9.734   106.033 1.00 62.69 ? 2    DC  D "C2'" 1 
ATOM   29   C  "C1'" . DC  A 1 2  ? 46.112  10.215  105.048 1.00 58.95 ? 2    DC  D "C1'" 1 
ATOM   30   N  N1    . DC  A 1 2  ? 45.916  10.229  103.514 1.00 55.29 ? 2    DC  D N1    1 
ATOM   31   C  C2    . DC  A 1 2  ? 46.209  11.410  102.768 1.00 55.06 ? 2    DC  D C2    1 
ATOM   32   O  O2    . DC  A 1 2  ? 46.584  12.463  103.356 1.00 55.55 ? 2    DC  D O2    1 
ATOM   33   N  N3    . DC  A 1 2  ? 46.066  11.400  101.407 1.00 52.51 ? 2    DC  D N3    1 
ATOM   34   C  C4    . DC  A 1 2  ? 45.671  10.290  100.773 1.00 53.61 ? 2    DC  D C4    1 
ATOM   35   N  N4    . DC  A 1 2  ? 45.513  10.328  99.424  1.00 53.43 ? 2    DC  D N4    1 
ATOM   36   C  C5    . DC  A 1 2  ? 45.397  9.097   101.522 1.00 52.92 ? 2    DC  D C5    1 
ATOM   37   C  C6    . DC  A 1 2  ? 45.530  9.106   102.857 1.00 52.97 ? 2    DC  D C6    1 
ATOM   38   P  P     . DC  A 1 3  ? 44.576  10.524  109.064 1.00 65.37 ? 3    DC  D P     1 
ATOM   39   O  OP1   . DC  A 1 3  ? 44.932  11.009  110.441 1.00 60.10 ? 3    DC  D OP1   1 
ATOM   40   O  OP2   . DC  A 1 3  ? 43.552  9.486   108.759 1.00 63.30 ? 3    DC  D OP2   1 
ATOM   41   O  "O5'" . DC  A 1 3  ? 44.229  11.783  108.139 1.00 59.65 ? 3    DC  D "O5'" 1 
ATOM   42   C  "C5'" . DC  A 1 3  ? 44.944  12.972  108.332 1.00 55.23 ? 3    DC  D "C5'" 1 
ATOM   43   C  "C4'" . DC  A 1 3  ? 44.121  14.018  107.648 1.00 55.33 ? 3    DC  D "C4'" 1 
ATOM   44   O  "O4'" . DC  A 1 3  ? 43.960  13.700  106.223 1.00 53.74 ? 3    DC  D "O4'" 1 
ATOM   45   C  "C3'" . DC  A 1 3  ? 42.698  14.160  108.147 1.00 52.65 ? 3    DC  D "C3'" 1 
ATOM   46   O  "O3'" . DC  A 1 3  ? 42.428  15.507  107.876 1.00 52.04 ? 3    DC  D "O3'" 1 
ATOM   47   C  "C2'" . DC  A 1 3  ? 41.935  13.207  107.207 1.00 50.26 ? 3    DC  D "C2'" 1 
ATOM   48   C  "C1'" . DC  A 1 3  ? 42.598  13.574  105.860 1.00 46.46 ? 3    DC  D "C1'" 1 
ATOM   49   N  N1    . DC  A 1 3  ? 42.461  12.621  104.672 1.00 44.53 ? 3    DC  D N1    1 
ATOM   50   C  C2    . DC  A 1 3  ? 42.779  12.990  103.356 1.00 43.88 ? 3    DC  D C2    1 
ATOM   51   O  O2    . DC  A 1 3  ? 43.150  14.145  103.190 1.00 44.29 ? 3    DC  D O2    1 
ATOM   52   N  N3    . DC  A 1 3  ? 42.666  12.097  102.306 1.00 43.71 ? 3    DC  D N3    1 
ATOM   53   C  C4    . DC  A 1 3  ? 42.247  10.837  102.540 1.00 44.86 ? 3    DC  D C4    1 
ATOM   54   N  N4    . DC  A 1 3  ? 42.128  9.935   101.566 1.00 42.90 ? 3    DC  D N4    1 
ATOM   55   C  C5    . DC  A 1 3  ? 41.946  10.424  103.865 1.00 46.70 ? 3    DC  D C5    1 
ATOM   56   C  C6    . DC  A 1 3  ? 42.059  11.325  104.875 1.00 47.44 ? 3    DC  D C6    1 
ATOM   57   P  P     . DG  A 1 4  ? 41.868  16.322  109.095 1.00 55.22 ? 4    DG  D P     1 
ATOM   58   O  OP1   . DG  A 1 4  ? 43.034  16.077  109.987 1.00 57.65 ? 4    DG  D OP1   1 
ATOM   59   O  OP2   . DG  A 1 4  ? 40.527  15.872  109.483 1.00 53.85 ? 4    DG  D OP2   1 
ATOM   60   O  "O5'" . DG  A 1 4  ? 41.658  17.841  108.628 1.00 52.56 ? 4    DG  D "O5'" 1 
ATOM   61   C  "C5'" . DG  A 1 4  ? 42.734  18.429  107.964 1.00 52.93 ? 4    DG  D "C5'" 1 
ATOM   62   C  "C4'" . DG  A 1 4  ? 42.210  19.394  106.924 1.00 53.17 ? 4    DG  D "C4'" 1 
ATOM   63   O  "O4'" . DG  A 1 4  ? 42.019  18.660  105.682 1.00 53.19 ? 4    DG  D "O4'" 1 
ATOM   64   C  "C3'" . DG  A 1 4  ? 40.909  20.148  107.237 1.00 51.87 ? 4    DG  D "C3'" 1 
ATOM   65   O  "O3'" . DG  A 1 4  ? 41.177  21.381  106.582 1.00 53.31 ? 4    DG  D "O3'" 1 
ATOM   66   C  "C2'" . DG  A 1 4  ? 39.888  19.294  106.489 1.00 52.29 ? 4    DG  D "C2'" 1 
ATOM   67   C  "C1'" . DG  A 1 4  ? 40.664  18.818  105.229 1.00 48.89 ? 4    DG  D "C1'" 1 
ATOM   68   N  N9    . DG  A 1 4  ? 40.292  17.497  104.722 1.00 47.85 ? 4    DG  D N9    1 
ATOM   69   C  C8    . DG  A 1 4  ? 39.897  16.429  105.511 1.00 46.05 ? 4    DG  D C8    1 
ATOM   70   N  N7    . DG  A 1 4  ? 39.638  15.332  104.861 1.00 45.36 ? 4    DG  D N7    1 
ATOM   71   C  C5    . DG  A 1 4  ? 39.898  15.667  103.530 1.00 47.29 ? 4    DG  D C5    1 
ATOM   72   C  C6    . DG  A 1 4  ? 39.807  14.854  102.358 1.00 47.25 ? 4    DG  D C6    1 
ATOM   73   O  O6    . DG  A 1 4  ? 39.469  13.680  102.239 1.00 46.58 ? 4    DG  D O6    1 
ATOM   74   N  N1    . DG  A 1 4  ? 40.159  15.537  101.224 1.00 45.77 ? 4    DG  D N1    1 
ATOM   75   C  C2    . DG  A 1 4  ? 40.565  16.841  101.260 1.00 45.20 ? 4    DG  D C2    1 
ATOM   76   N  N2    . DG  A 1 4  ? 40.810  17.307  100.049 1.00 45.98 ? 4    DG  D N2    1 
ATOM   77   N  N3    . DG  A 1 4  ? 40.684  17.647  102.320 1.00 43.41 ? 4    DG  D N3    1 
ATOM   78   C  C4    . DG  A 1 4  ? 40.298  17.002  103.430 1.00 46.31 ? 4    DG  D C4    1 
ATOM   79   P  P     . DG  A 1 5  ? 40.215  22.659  106.391 1.00 59.44 ? 5    DG  D P     1 
ATOM   80   O  OP1   . DG  A 1 5  ? 41.276  23.674  106.279 1.00 60.05 ? 5    DG  D OP1   1 
ATOM   81   O  OP2   . DG  A 1 5  ? 39.207  22.614  107.452 1.00 60.56 ? 5    DG  D OP2   1 
ATOM   82   O  "O5'" . DG  A 1 5  ? 39.365  22.764  105.016 1.00 54.97 ? 5    DG  D "O5'" 1 
ATOM   83   C  "C5'" . DG  A 1 5  ? 39.880  22.017  103.941 1.00 55.53 ? 5    DG  D "C5'" 1 
ATOM   84   C  "C4'" . DG  A 1 5  ? 38.921  21.722  102.806 1.00 55.58 ? 5    DG  D "C4'" 1 
ATOM   85   O  "O4'" . DG  A 1 5  ? 38.700  20.293  102.751 1.00 55.08 ? 5    DG  D "O4'" 1 
ATOM   86   C  "C3'" . DG  A 1 5  ? 37.517  22.318  102.829 1.00 56.58 ? 5    DG  D "C3'" 1 
ATOM   87   O  "O3'" . DG  A 1 5  ? 37.009  22.320  101.489 1.00 60.05 ? 5    DG  D "O3'" 1 
ATOM   88   C  "C2'" . DG  A 1 5  ? 36.804  21.255  103.636 1.00 55.40 ? 5    DG  D "C2'" 1 
ATOM   89   C  "C1'" . DG  A 1 5  ? 37.301  20.094  102.798 1.00 49.72 ? 5    DG  D "C1'" 1 
ATOM   90   N  N9    . DG  A 1 5  ? 36.976  18.818  103.364 1.00 47.19 ? 5    DG  D N9    1 
ATOM   91   C  C8    . DG  A 1 5  ? 36.733  18.488  104.644 1.00 46.25 ? 5    DG  D C8    1 
ATOM   92   N  N7    . DG  A 1 5  ? 36.484  17.211  104.797 1.00 47.04 ? 5    DG  D N7    1 
ATOM   93   C  C5    . DG  A 1 5  ? 36.547  16.650  103.527 1.00 48.24 ? 5    DG  D C5    1 
ATOM   94   C  C6    . DG  A 1 5  ? 36.341  15.319  103.057 1.00 45.93 ? 5    DG  D C6    1 
ATOM   95   O  O6    . DG  A 1 5  ? 36.052  14.285  103.683 1.00 46.10 ? 5    DG  D O6    1 
ATOM   96   N  N1    . DG  A 1 5  ? 36.510  15.245  101.699 1.00 45.32 ? 5    DG  D N1    1 
ATOM   97   C  C2    . DG  A 1 5  ? 36.857  16.297  100.880 1.00 48.76 ? 5    DG  D C2    1 
ATOM   98   N  N2    . DG  A 1 5  ? 37.006  16.034  99.571  1.00 47.08 ? 5    DG  D N2    1 
ATOM   99   N  N3    . DG  A 1 5  ? 37.033  17.568  101.285 1.00 51.05 ? 5    DG  D N3    1 
ATOM   100  C  C4    . DG  A 1 5  ? 36.869  17.657  102.637 1.00 50.23 ? 5    DG  D C4    1 
ATOM   101  P  P     . DA  A 1 6  ? 36.559  23.757  100.918 1.00 64.28 ? 6    DA  D P     1 
ATOM   102  O  OP1   . DA  A 1 6  ? 37.647  24.604  101.496 1.00 63.30 ? 6    DA  D OP1   1 
ATOM   103  O  OP2   . DA  A 1 6  ? 35.131  24.004  101.212 1.00 58.90 ? 6    DA  D OP2   1 
ATOM   104  O  "O5'" . DA  A 1 6  ? 36.719  23.755  99.333  1.00 60.07 ? 6    DA  D "O5'" 1 
ATOM   105  C  "C5'" . DA  A 1 6  ? 37.555  22.775  98.781  1.00 56.46 ? 6    DA  D "C5'" 1 
ATOM   106  C  "C4'" . DA  A 1 6  ? 36.905  22.033  97.604  1.00 54.83 ? 6    DA  D "C4'" 1 
ATOM   107  O  "O4'" . DA  A 1 6  ? 36.424  20.720  98.030  1.00 51.58 ? 6    DA  D "O4'" 1 
ATOM   108  C  "C3'" . DA  A 1 6  ? 35.727  22.695  96.872  1.00 53.59 ? 6    DA  D "C3'" 1 
ATOM   109  O  "O3'" . DA  A 1 6  ? 35.879  22.345  95.501  1.00 52.19 ? 6    DA  D "O3'" 1 
ATOM   110  C  "C2'" . DA  A 1 6  ? 34.497  22.038  97.570  1.00 49.62 ? 6    DA  D "C2'" 1 
ATOM   111  C  "C1'" . DA  A 1 6  ? 35.012  20.617  97.880  1.00 46.33 ? 6    DA  D "C1'" 1 
ATOM   112  N  N9    . DA  A 1 6  ? 34.621  19.942  99.114  1.00 46.53 ? 6    DA  D N9    1 
ATOM   113  C  C8    . DA  A 1 6  ? 34.555  20.442  100.397 1.00 45.25 ? 6    DA  D C8    1 
ATOM   114  N  N7    . DA  A 1 6  ? 34.188  19.530  101.289 1.00 44.95 ? 6    DA  D N7    1 
ATOM   115  C  C5    . DA  A 1 6  ? 34.001  18.350  100.587 1.00 44.94 ? 6    DA  D C5    1 
ATOM   116  C  C6    . DA  A 1 6  ? 33.623  17.009  100.953 1.00 44.08 ? 6    DA  D C6    1 
ATOM   117  N  N6    . DA  A 1 6  ? 33.293  16.576  102.171 1.00 39.78 ? 6    DA  D N6    1 
ATOM   118  N  N1    . DA  A 1 6  ? 33.538  16.094  99.925  1.00 45.30 ? 6    DA  D N1    1 
ATOM   119  C  C2    . DA  A 1 6  ? 33.835  16.477  98.653  1.00 43.12 ? 6    DA  D C2    1 
ATOM   120  N  N3    . DA  A 1 6  ? 34.230  17.674  98.201  1.00 42.22 ? 6    DA  D N3    1 
ATOM   121  C  C4    . DA  A 1 6  ? 34.285  18.586  99.222  1.00 47.16 ? 6    DA  D C4    1 
ATOM   122  P  P     . DG  A 1 7  ? 34.798  22.914  94.465  1.00 56.14 ? 7    DG  D P     1 
ATOM   123  O  OP1   . DG  A 1 7  ? 35.655  23.622  93.490  1.00 53.52 ? 7    DG  D OP1   1 
ATOM   124  O  OP2   . DG  A 1 7  ? 33.654  23.503  95.190  1.00 55.30 ? 7    DG  D OP2   1 
ATOM   125  O  "O5'" . DG  A 1 7  ? 34.004  21.717  93.735  1.00 55.27 ? 7    DG  D "O5'" 1 
ATOM   126  C  "C5'" . DG  A 1 7  ? 34.257  20.337  93.949  1.00 53.12 ? 7    DG  D "C5'" 1 
ATOM   127  C  "C4'" . DG  A 1 7  ? 32.991  19.516  94.064  1.00 49.41 ? 7    DG  D "C4'" 1 
ATOM   128  O  "O4'" . DG  A 1 7  ? 32.764  19.259  95.466  1.00 50.91 ? 7    DG  D "O4'" 1 
ATOM   129  C  "C3'" . DG  A 1 7  ? 31.718  20.175  93.591  1.00 50.32 ? 7    DG  D "C3'" 1 
ATOM   130  O  "O3'" . DG  A 1 7  ? 31.243  19.394  92.479  1.00 51.27 ? 7    DG  D "O3'" 1 
ATOM   131  C  "C2'" . DG  A 1 7  ? 30.753  20.194  94.819  1.00 50.27 ? 7    DG  D "C2'" 1 
ATOM   132  C  "C1'" . DG  A 1 7  ? 31.356  19.069  95.652  1.00 52.09 ? 7    DG  D "C1'" 1 
ATOM   133  N  N9    . DG  A 1 7  ? 31.153  19.093  97.099  1.00 51.77 ? 7    DG  D N9    1 
ATOM   134  C  C8    . DG  A 1 7  ? 31.412  20.203  97.867  1.00 52.15 ? 7    DG  D C8    1 
ATOM   135  N  N7    . DG  A 1 7  ? 31.223  20.051  99.151  1.00 53.01 ? 7    DG  D N7    1 
ATOM   136  C  C5    . DG  A 1 7  ? 30.804  18.723  99.255  1.00 51.62 ? 7    DG  D C5    1 
ATOM   137  C  C6    . DG  A 1 7  ? 30.433  18.056  100.456 1.00 51.13 ? 7    DG  D C6    1 
ATOM   138  O  O6    . DG  A 1 7  ? 30.436  18.588  101.681 1.00 50.79 ? 7    DG  D O6    1 
ATOM   139  N  N1    . DG  A 1 7  ? 30.025  16.733  100.101 1.00 48.62 ? 7    DG  D N1    1 
ATOM   140  C  C2    . DG  A 1 7  ? 29.999  16.176  98.810  1.00 50.48 ? 7    DG  D C2    1 
ATOM   141  N  N2    . DG  A 1 7  ? 29.605  14.887  98.673  1.00 48.16 ? 7    DG  D N2    1 
ATOM   142  N  N3    . DG  A 1 7  ? 30.347  16.845  97.706  1.00 50.08 ? 7    DG  D N3    1 
ATOM   143  C  C4    . DG  A 1 7  ? 30.746  18.108  97.996  1.00 52.45 ? 7    DG  D C4    1 
ATOM   144  P  P     . DG  A 1 8  ? 29.907  19.755  91.644  1.00 56.53 ? 8    DG  D P     1 
ATOM   145  O  OP1   . DG  A 1 8  ? 30.057  19.104  90.336  1.00 56.65 ? 8    DG  D OP1   1 
ATOM   146  O  OP2   . DG  A 1 8  ? 29.456  21.180  91.893  1.00 55.83 ? 8    DG  D OP2   1 
ATOM   147  O  "O5'" . DG  A 1 8  ? 28.759  18.870  92.358  1.00 58.50 ? 8    DG  D "O5'" 1 
ATOM   148  C  "C5'" . DG  A 1 8  ? 28.849  17.438  92.414  1.00 52.61 ? 8    DG  D "C5'" 1 
ATOM   149  C  "C4'" . DG  A 1 8  ? 27.707  17.090  93.334  1.00 53.00 ? 8    DG  D "C4'" 1 
ATOM   150  O  "O4'" . DG  A 1 8  ? 27.991  17.499  94.720  1.00 50.70 ? 8    DG  D "O4'" 1 
ATOM   151  C  "C3'" . DG  A 1 8  ? 26.369  17.734  92.961  1.00 51.82 ? 8    DG  D "C3'" 1 
ATOM   152  O  "O3'" . DG  A 1 8  ? 25.363  16.747  92.976  1.00 54.18 ? 8    DG  D "O3'" 1 
ATOM   153  C  "C2'" . DG  A 1 8  ? 26.105  18.753  94.064  1.00 46.83 ? 8    DG  D "C2'" 1 
ATOM   154  C  "C1'" . DG  A 1 8  ? 26.735  17.987  95.236  1.00 47.85 ? 8    DG  D "C1'" 1 
ATOM   155  N  N9    . DG  A 1 8  ? 27.060  18.742  96.482  1.00 47.31 ? 8    DG  D N9    1 
ATOM   156  C  C8    . DG  A 1 8  ? 27.515  20.063  96.633  1.00 43.78 ? 8    DG  D C8    1 
ATOM   157  N  N7    . DG  A 1 8  ? 27.725  20.432  97.840  1.00 45.50 ? 8    DG  D N7    1 
ATOM   158  C  C5    . DG  A 1 8  ? 27.422  19.234  98.562  1.00 47.46 ? 8    DG  D C5    1 
ATOM   159  C  C6    . DG  A 1 8  ? 27.425  18.940  99.934  1.00 44.48 ? 8    DG  D C6    1 
ATOM   160  O  O6    . DG  A 1 8  ? 27.791  19.686  100.830 1.00 45.34 ? 8    DG  D O6    1 
ATOM   161  N  N1    . DG  A 1 8  ? 26.977  17.659  100.261 1.00 44.28 ? 8    DG  D N1    1 
ATOM   162  C  C2    . DG  A 1 8  ? 26.599  16.710  99.345  1.00 44.89 ? 8    DG  D C2    1 
ATOM   163  N  N2    . DG  A 1 8  ? 26.195  15.509  99.824  1.00 44.04 ? 8    DG  D N2    1 
ATOM   164  N  N3    . DG  A 1 8  ? 26.601  16.939  98.037  1.00 44.94 ? 8    DG  D N3    1 
ATOM   165  C  C4    . DG  A 1 8  ? 27.021  18.196  97.736  1.00 47.73 ? 8    DG  D C4    1 
ATOM   166  P  P     . DA  A 1 9  ? 24.001  16.997  92.120  1.00 58.63 ? 9    DA  D P     1 
ATOM   167  O  OP1   . DA  A 1 9  ? 24.200  16.387  90.843  1.00 55.41 ? 9    DA  D OP1   1 
ATOM   168  O  OP2   . DA  A 1 9  ? 23.485  18.396  92.191  1.00 52.76 ? 9    DA  D OP2   1 
ATOM   169  O  "O5'" . DA  A 1 9  ? 23.093  15.841  92.777  1.00 57.14 ? 9    DA  D "O5'" 1 
ATOM   170  C  "C5'" . DA  A 1 9  ? 23.784  14.566  93.035  1.00 52.32 ? 9    DA  D "C5'" 1 
ATOM   171  C  "C4'" . DA  A 1 9  ? 23.164  13.987  94.312  1.00 50.93 ? 9    DA  D "C4'" 1 
ATOM   172  O  "O4'" . DA  A 1 9  ? 23.506  14.739  95.503  1.00 44.15 ? 9    DA  D "O4'" 1 
ATOM   173  C  "C3'" . DA  A 1 9  ? 21.631  13.983  94.282  1.00 50.86 ? 9    DA  D "C3'" 1 
ATOM   174  O  "O3'" . DA  A 1 9  ? 21.117  12.930  95.125  1.00 51.86 ? 9    DA  D "O3'" 1 
ATOM   175  C  "C2'" . DA  A 1 9  ? 21.337  15.367  94.801  1.00 48.15 ? 9    DA  D "C2'" 1 
ATOM   176  C  "C1'" . DA  A 1 9  ? 22.338  15.359  95.974  1.00 44.01 ? 9    DA  D "C1'" 1 
ATOM   177  N  N9    . DA  A 1 9  ? 22.711  16.682  96.411  1.00 43.23 ? 9    DA  D N9    1 
ATOM   178  C  C8    . DA  A 1 9  ? 22.818  17.824  95.652  1.00 42.13 ? 9    DA  D C8    1 
ATOM   179  N  N7    . DA  A 1 9  ? 23.183  18.885  96.350  1.00 41.69 ? 9    DA  D N7    1 
ATOM   180  C  C5    . DA  A 1 9  ? 23.321  18.373  97.615  1.00 41.68 ? 9    DA  D C5    1 
ATOM   181  C  C6    . DA  A 1 9  ? 23.716  18.961  98.795  1.00 42.10 ? 9    DA  D C6    1 
ATOM   182  N  N6    . DA  A 1 9  ? 24.044  20.233  98.858  1.00 42.55 ? 9    DA  D N6    1 
ATOM   183  N  N1    . DA  A 1 9  ? 23.804  18.214  99.893  1.00 40.27 ? 9    DA  D N1    1 
ATOM   184  C  C2    . DA  A 1 9  ? 23.503  16.932  99.793  1.00 41.23 ? 9    DA  D C2    1 
ATOM   185  N  N3    . DA  A 1 9  ? 23.120  16.223  98.744  1.00 43.13 ? 9    DA  D N3    1 
ATOM   186  C  C4    . DA  A 1 9  ? 23.052  17.030  97.674  1.00 43.22 ? 9    DA  D C4    1 
ATOM   187  P  P     . DC  A 1 10 ? 19.511  12.641  95.151  1.00 55.73 ? 10   DC  D P     1 
ATOM   188  O  OP1   . DC  A 1 10 ? 19.539  11.150  95.196  1.00 49.40 ? 10   DC  D OP1   1 
ATOM   189  O  OP2   . DC  A 1 10 ? 18.721  13.447  94.179  1.00 53.88 ? 10   DC  D OP2   1 
ATOM   190  O  "O5'" . DC  A 1 10 ? 19.084  13.245  96.622  1.00 54.22 ? 10   DC  D "O5'" 1 
ATOM   191  C  "C5'" . DC  A 1 10 ? 20.005  12.927  97.692  1.00 47.88 ? 10   DC  D "C5'" 1 
ATOM   192  C  "C4'" . DC  A 1 10 ? 19.575  13.514  98.976  1.00 47.48 ? 10   DC  D "C4'" 1 
ATOM   193  O  "O4'" . DC  A 1 10 ? 20.091  14.855  99.168  1.00 47.71 ? 10   DC  D "O4'" 1 
ATOM   194  C  "C3'" . DC  A 1 10 ? 18.099  13.622  99.098  1.00 48.60 ? 10   DC  D "C3'" 1 
ATOM   195  O  "O3'" . DC  A 1 10 ? 18.045  13.271  100.406 1.00 51.21 ? 10   DC  D "O3'" 1 
ATOM   196  C  "C2'" . DC  A 1 10 ? 17.773  15.106  98.925  1.00 46.14 ? 10   DC  D "C2'" 1 
ATOM   197  C  "C1'" . DC  A 1 10 ? 19.034  15.752  99.444  1.00 46.86 ? 10   DC  D "C1'" 1 
ATOM   198  N  N1    . DC  A 1 10 ? 19.488  17.122  98.984  1.00 48.11 ? 10   DC  D N1    1 
ATOM   199  C  C2    . DC  A 1 10 ? 20.054  17.961  99.999  1.00 50.04 ? 10   DC  D C2    1 
ATOM   200  O  O2    . DC  A 1 10 ? 20.121  17.582  101.156 1.00 48.80 ? 10   DC  D O2    1 
ATOM   201  N  N3    . DC  A 1 10 ? 20.509  19.208  99.734  1.00 49.70 ? 10   DC  D N3    1 
ATOM   202  C  C4    . DC  A 1 10 ? 20.440  19.633  98.445  1.00 49.27 ? 10   DC  D C4    1 
ATOM   203  N  N4    . DC  A 1 10 ? 20.925  20.865  98.250  1.00 46.26 ? 10   DC  D N4    1 
ATOM   204  C  C5    . DC  A 1 10 ? 19.866  18.840  97.375  1.00 46.02 ? 10   DC  D C5    1 
ATOM   205  C  C6    . DC  A 1 10 ? 19.418  17.599  97.698  1.00 46.11 ? 10   DC  D C6    1 
ATOM   206  P  P     . DA  A 1 11 ? 16.694  12.652  100.911 1.00 53.96 ? 11   DA  D P     1 
ATOM   207  O  OP1   . DA  A 1 11 ? 17.274  11.343  101.285 1.00 48.32 ? 11   DA  D OP1   1 
ATOM   208  O  OP2   . DA  A 1 11 ? 15.512  12.989  100.150 1.00 44.86 ? 11   DA  D OP2   1 
ATOM   209  O  "O5'" . DA  A 1 11 ? 16.318  13.470  102.203 1.00 50.47 ? 11   DA  D "O5'" 1 
ATOM   210  C  "C5'" . DA  A 1 11 ? 17.324  13.431  103.201 1.00 47.44 ? 11   DA  D "C5'" 1 
ATOM   211  C  "C4'" . DA  A 1 11 ? 17.002  14.515  104.187 1.00 44.79 ? 11   DA  D "C4'" 1 
ATOM   212  O  "O4'" . DA  A 1 11 ? 17.477  15.815  103.697 1.00 43.68 ? 11   DA  D "O4'" 1 
ATOM   213  C  "C3'" . DA  A 1 11 ? 15.494  14.651  104.578 1.00 41.52 ? 11   DA  D "C3'" 1 
ATOM   214  O  "O3'" . DA  A 1 11 ? 15.595  14.858  105.991 1.00 33.85 ? 11   DA  D "O3'" 1 
ATOM   215  C  "C2'" . DA  A 1 11 ? 15.075  15.931  103.857 1.00 42.14 ? 11   DA  D "C2'" 1 
ATOM   216  C  "C1'" . DA  A 1 11 ? 16.396  16.756  103.704 1.00 42.35 ? 11   DA  D "C1'" 1 
ATOM   217  N  N9    . DA  A 1 11 ? 16.482  17.636  102.555 1.00 41.06 ? 11   DA  D N9    1 
ATOM   218  C  C8    . DA  A 1 11 ? 16.105  17.405  101.251 1.00 42.88 ? 11   DA  D C8    1 
ATOM   219  N  N7    . DA  A 1 11 ? 16.299  18.400  100.355 1.00 42.72 ? 11   DA  D N7    1 
ATOM   220  C  C5    . DA  A 1 11 ? 16.822  19.371  101.202 1.00 45.63 ? 11   DA  D C5    1 
ATOM   221  C  C6    . DA  A 1 11 ? 17.242  20.720  100.951 1.00 46.08 ? 11   DA  D C6    1 
ATOM   222  N  N6    . DA  A 1 11 ? 17.191  21.174  99.699  1.00 40.31 ? 11   DA  D N6    1 
ATOM   223  N  N1    . DA  A 1 11 ? 17.732  21.505  102.016 1.00 43.38 ? 11   DA  D N1    1 
ATOM   224  C  C2    . DA  A 1 11 ? 17.809  20.853  103.186 1.00 41.53 ? 11   DA  D C2    1 
ATOM   225  N  N3    . DA  A 1 11 ? 17.458  19.592  103.522 1.00 38.03 ? 11   DA  D N3    1 
ATOM   226  C  C4    . DA  A 1 11 ? 16.936  18.911  102.530 1.00 42.28 ? 11   DA  D C4    1 
ATOM   227  P  P     . DG  A 1 12 ? 14.340  14.932  106.854 1.00 35.67 ? 12   DG  D P     1 
ATOM   228  O  OP1   . DG  A 1 12 ? 14.951  14.445  108.118 1.00 35.50 ? 12   DG  D OP1   1 
ATOM   229  O  OP2   . DG  A 1 12 ? 13.140  14.201  106.316 1.00 35.08 ? 12   DG  D OP2   1 
ATOM   230  O  "O5'" . DG  A 1 12 ? 14.017  16.513  106.837 1.00 37.28 ? 12   DG  D "O5'" 1 
ATOM   231  C  "C5'" . DG  A 1 12 ? 14.745  17.377  107.631 1.00 34.85 ? 12   DG  D "C5'" 1 
ATOM   232  C  "C4'" . DG  A 1 12 ? 14.201  18.762  107.410 1.00 39.12 ? 12   DG  D "C4'" 1 
ATOM   233  O  "O4'" . DG  A 1 12 ? 14.515  19.133  106.053 1.00 37.20 ? 12   DG  D "O4'" 1 
ATOM   234  C  "C3'" . DG  A 1 12 ? 12.683  18.849  107.557 1.00 34.02 ? 12   DG  D "C3'" 1 
ATOM   235  O  "O3'" . DG  A 1 12 ? 12.468  19.836  108.621 1.00 29.51 ? 12   DG  D "O3'" 1 
ATOM   236  C  "C2'" . DG  A 1 12 ? 12.321  19.245  106.155 1.00 30.34 ? 12   DG  D "C2'" 1 
ATOM   237  C  "C1'" . DG  A 1 12 ? 13.527  19.980  105.619 1.00 31.20 ? 12   DG  D "C1'" 1 
ATOM   238  N  N9    . DG  A 1 12 ? 13.582  20.096  104.147 1.00 33.60 ? 12   DG  D N9    1 
ATOM   239  C  C8    . DG  A 1 12 ? 13.131  19.151  103.228 1.00 32.61 ? 12   DG  D C8    1 
ATOM   240  N  N7    . DG  A 1 12 ? 13.321  19.543  101.993 1.00 32.61 ? 12   DG  D N7    1 
ATOM   241  C  C5    . DG  A 1 12 ? 13.901  20.816  102.077 1.00 33.31 ? 12   DG  D C5    1 
ATOM   242  C  C6    . DG  A 1 12 ? 14.205  21.754  101.043 1.00 30.97 ? 12   DG  D C6    1 
ATOM   243  O  O6    . DG  A 1 12 ? 14.063  21.567  99.758  1.00 31.33 ? 12   DG  D O6    1 
ATOM   244  N  N1    . DG  A 1 12 ? 14.715  22.942  101.595 1.00 28.34 ? 12   DG  D N1    1 
ATOM   245  C  C2    . DG  A 1 12 ? 14.888  23.201  102.970 1.00 35.10 ? 12   DG  D C2    1 
ATOM   246  N  N2    . DG  A 1 12 ? 15.411  24.416  103.442 1.00 30.74 ? 12   DG  D N2    1 
ATOM   247  N  N3    . DG  A 1 12 ? 14.487  22.309  103.894 1.00 35.26 ? 12   DG  D N3    1 
ATOM   248  C  C4    . DG  A 1 12 ? 14.033  21.160  103.397 1.00 34.43 ? 12   DG  D C4    1 
ATOM   249  P  P     . DT  A 1 13 ? 11.438  20.995  108.732 1.00 33.16 ? 13   DT  D P     1 
ATOM   250  O  OP1   . DT  A 1 13 ? 11.330  21.425  110.133 1.00 30.35 ? 13   DT  D OP1   1 
ATOM   251  O  OP2   . DT  A 1 13 ? 10.102  20.810  108.019 1.00 34.60 ? 13   DT  D OP2   1 
ATOM   252  O  "O5'" . DT  A 1 13 ? 12.247  22.047  107.783 1.00 28.05 ? 13   DT  D "O5'" 1 
ATOM   253  C  "C5'" . DT  A 1 13 ? 13.370  22.530  108.298 1.00 27.29 ? 13   DT  D "C5'" 1 
ATOM   254  C  "C4'" . DT  A 1 13 ? 13.602  24.010  108.070 1.00 29.41 ? 13   DT  D "C4'" 1 
ATOM   255  O  "O4'" . DT  A 1 13 ? 13.513  24.341  106.656 1.00 31.86 ? 13   DT  D "O4'" 1 
ATOM   256  C  "C3'" . DT  A 1 13 ? 12.723  25.029  108.769 1.00 31.21 ? 13   DT  D "C3'" 1 
ATOM   257  O  "O3'" . DT  A 1 13 ? 13.626  26.155  108.947 1.00 30.72 ? 13   DT  D "O3'" 1 
ATOM   258  C  "C2'" . DT  A 1 13 ? 11.718  25.283  107.674 1.00 32.55 ? 13   DT  D "C2'" 1 
ATOM   259  C  "C1'" . DT  A 1 13 ? 12.548  25.311  106.371 1.00 37.00 ? 13   DT  D "C1'" 1 
ATOM   260  N  N1    . DT  A 1 13 ? 12.028  24.625  105.016 1.00 40.94 ? 13   DT  D N1    1 
ATOM   261  C  C2    . DT  A 1 13 ? 12.301  25.241  103.838 1.00 37.91 ? 13   DT  D C2    1 
ATOM   262  O  O2    . DT  A 1 13 ? 12.933  26.262  103.755 1.00 40.08 ? 13   DT  D O2    1 
ATOM   263  N  N3    . DT  A 1 13 ? 11.887  24.577  102.766 1.00 38.88 ? 13   DT  D N3    1 
ATOM   264  C  C4    . DT  A 1 13 ? 11.165  23.395  102.619 1.00 40.33 ? 13   DT  D C4    1 
ATOM   265  O  O4    . DT  A 1 13 ? 10.816  22.865  101.523 1.00 40.77 ? 13   DT  D O4    1 
ATOM   266  C  C5    . DT  A 1 13 ? 10.862  22.815  103.865 1.00 40.24 ? 13   DT  D C5    1 
ATOM   267  C  C7    . DT  A 1 13 ? 9.975   21.607  103.831 1.00 35.24 ? 13   DT  D C7    1 
ATOM   268  C  C6    . DT  A 1 13 ? 11.323  23.426  104.991 1.00 41.33 ? 13   DT  D C6    1 
ATOM   269  P  P     . DC  A 1 14 ? 13.090  27.254  109.888 1.00 32.67 ? 14   DC  D P     1 
ATOM   270  O  OP1   . DC  A 1 14 ? 14.294  27.971  110.397 1.00 35.91 ? 14   DC  D OP1   1 
ATOM   271  O  OP2   . DC  A 1 14 ? 12.128  26.669  110.852 1.00 29.75 ? 14   DC  D OP2   1 
ATOM   272  O  "O5'" . DC  A 1 14 ? 12.265  28.189  108.910 1.00 33.76 ? 14   DC  D "O5'" 1 
ATOM   273  C  "C5'" . DC  A 1 14 ? 12.991  28.884  107.896 1.00 33.76 ? 14   DC  D "C5'" 1 
ATOM   274  C  "C4'" . DC  A 1 14 ? 11.979  29.646  106.986 1.00 36.48 ? 14   DC  D "C4'" 1 
ATOM   275  O  "O4'" . DC  A 1 14 ? 11.364  28.854  105.844 1.00 27.83 ? 14   DC  D "O4'" 1 
ATOM   276  C  "C3'" . DC  A 1 14 ? 10.795  30.268  107.727 1.00 37.73 ? 14   DC  D "C3'" 1 
ATOM   277  O  "O3'" . DC  A 1 14 ? 10.564  31.517  106.964 1.00 38.21 ? 14   DC  D "O3'" 1 
ATOM   278  C  "C2'" . DC  A 1 14 ? 9.687   29.215  107.574 1.00 34.18 ? 14   DC  D "C2'" 1 
ATOM   279  C  "C1'" . DC  A 1 14 ? 9.977   28.792  106.103 1.00 34.55 ? 14   DC  D "C1'" 1 
ATOM   280  N  N1    . DC  A 1 14 ? 9.356   27.555  105.529 1.00 36.09 ? 14   DC  D N1    1 
ATOM   281  C  C2    . DC  A 1 14 ? 9.422   27.501  104.132 1.00 34.42 ? 14   DC  D C2    1 
ATOM   282  O  O2    . DC  A 1 14 ? 10.001  28.421  103.544 1.00 34.37 ? 14   DC  D O2    1 
ATOM   283  N  N3    . DC  A 1 14 ? 8.869   26.454  103.509 1.00 31.24 ? 14   DC  D N3    1 
ATOM   284  C  C4    . DC  A 1 14 ? 8.280   25.485  104.227 1.00 31.83 ? 14   DC  D C4    1 
ATOM   285  N  N4    . DC  A 1 14 ? 7.776   24.487  103.518 1.00 32.05 ? 14   DC  D N4    1 
ATOM   286  C  C5    . DC  A 1 14 ? 8.220   25.455  105.664 1.00 29.24 ? 14   DC  D C5    1 
ATOM   287  C  C6    . DC  A 1 14 ? 8.785   26.536  106.271 1.00 30.56 ? 14   DC  D C6    1 
ATOM   288  P  P     . DC  A 1 15 ? 10.710  32.842  107.841 1.00 40.81 ? 15   DC  D P     1 
ATOM   289  O  OP1   . DC  A 1 15 ? 12.153  32.875  108.030 1.00 41.18 ? 15   DC  D OP1   1 
ATOM   290  O  OP2   . DC  A 1 15 ? 9.725   32.869  108.984 1.00 41.05 ? 15   DC  D OP2   1 
ATOM   291  O  "O5'" . DC  A 1 15 ? 10.272  33.828  106.638 1.00 44.25 ? 15   DC  D "O5'" 1 
ATOM   292  C  "C5'" . DC  A 1 15 ? 8.867   33.692  106.249 1.00 40.76 ? 15   DC  D "C5'" 1 
ATOM   293  C  "C4'" . DC  A 1 15 ? 8.853   33.655  104.737 1.00 41.72 ? 15   DC  D "C4'" 1 
ATOM   294  O  "O4'" . DC  A 1 15 ? 9.245   32.351  104.224 1.00 38.03 ? 15   DC  D "O4'" 1 
ATOM   295  C  "C3'" . DC  A 1 15 ? 7.532   34.068  104.064 1.00 42.51 ? 15   DC  D "C3'" 1 
ATOM   296  O  "O3'" . DC  A 1 15 ? 7.542   35.423  103.642 1.00 42.44 ? 15   DC  D "O3'" 1 
ATOM   297  C  "C2'" . DC  A 1 15 ? 7.649   33.283  102.784 1.00 44.19 ? 15   DC  D "C2'" 1 
ATOM   298  C  "C1'" . DC  A 1 15 ? 8.460   32.044  103.121 1.00 36.30 ? 15   DC  D "C1'" 1 
ATOM   299  N  N1    . DC  A 1 15 ? 7.604   30.808  103.363 1.00 39.24 ? 15   DC  D N1    1 
ATOM   300  C  C2    . DC  A 1 15 ? 7.189   30.105  102.223 1.00 36.52 ? 15   DC  D C2    1 
ATOM   301  O  O2    . DC  A 1 15 ? 7.505   30.591  101.099 1.00 39.02 ? 15   DC  D O2    1 
ATOM   302  N  N3    . DC  A 1 15 ? 6.504   28.955  102.324 1.00 30.92 ? 15   DC  D N3    1 
ATOM   303  C  C4    . DC  A 1 15 ? 6.172   28.523  103.504 1.00 37.30 ? 15   DC  D C4    1 
ATOM   304  N  N4    . DC  A 1 15 ? 5.453   27.378  103.537 1.00 36.07 ? 15   DC  D N4    1 
ATOM   305  C  C5    . DC  A 1 15 ? 6.558   29.218  104.725 1.00 39.65 ? 15   DC  D C5    1 
ATOM   306  C  C6    . DC  A 1 15 ? 7.250   30.359  104.606 1.00 39.35 ? 15   DC  D C6    1 
ATOM   307  P  P     . DT  A 1 16 ? 6.174   36.264  103.470 1.00 42.82 ? 16   DT  D P     1 
ATOM   308  O  OP1   . DT  A 1 16 ? 6.820   37.577  103.553 1.00 46.22 ? 16   DT  D OP1   1 
ATOM   309  O  OP2   . DT  A 1 16 ? 5.084   35.972  104.406 1.00 44.89 ? 16   DT  D OP2   1 
ATOM   310  O  "O5'" . DT  A 1 16 ? 5.790   35.927  101.962 1.00 41.50 ? 16   DT  D "O5'" 1 
ATOM   311  C  "C5'" . DT  A 1 16 ? 6.856   35.893  100.977 1.00 38.94 ? 16   DT  D "C5'" 1 
ATOM   312  C  "C4'" . DT  A 1 16 ? 6.178   35.426  99.710  1.00 40.66 ? 16   DT  D "C4'" 1 
ATOM   313  O  "O4'" . DT  A 1 16 ? 5.956   34.008  99.810  1.00 38.84 ? 16   DT  D "O4'" 1 
ATOM   314  C  "C3'" . DT  A 1 16 ? 4.781   36.007  99.402  1.00 40.03 ? 16   DT  D "C3'" 1 
ATOM   315  O  "O3'" . DT  A 1 16 ? 4.616   36.191  97.980  1.00 41.77 ? 16   DT  D "O3'" 1 
ATOM   316  C  "C2'" . DT  A 1 16 ? 3.803   34.948  99.875  1.00 38.11 ? 16   DT  D "C2'" 1 
ATOM   317  C  "C1'" . DT  A 1 16 ? 4.622   33.676  99.596  1.00 38.04 ? 16   DT  D "C1'" 1 
ATOM   318  N  N1    . DT  A 1 16 ? 4.242   32.622  100.559 1.00 39.28 ? 16   DT  D N1    1 
ATOM   319  C  C2    . DT  A 1 16 ? 3.737   31.381  100.148 1.00 39.30 ? 16   DT  D C2    1 
ATOM   320  O  O2    . DT  A 1 16 ? 3.555   30.998  99.039  1.00 37.64 ? 16   DT  D O2    1 
ATOM   321  N  N3    . DT  A 1 16 ? 3.396   30.484  101.096 1.00 40.04 ? 16   DT  D N3    1 
ATOM   322  C  C4    . DT  A 1 16 ? 3.466   30.690  102.434 1.00 40.98 ? 16   DT  D C4    1 
ATOM   323  O  O4    . DT  A 1 16 ? 3.097   29.734  103.122 1.00 40.84 ? 16   DT  D O4    1 
ATOM   324  C  C5    . DT  A 1 16 ? 4.021   32.021  102.874 1.00 40.55 ? 16   DT  D C5    1 
ATOM   325  C  C7    . DT  A 1 16 ? 4.170   32.452  104.323 1.00 27.28 ? 16   DT  D C7    1 
ATOM   326  C  C6    . DT  A 1 16 ? 4.358   32.916  101.905 1.00 38.39 ? 16   DT  D C6    1 
ATOM   327  P  P     . DC  A 1 17 ? 3.431   37.083  97.400  1.00 41.08 ? 17   DC  D P     1 
ATOM   328  O  OP1   . DC  A 1 17 ? 4.031   37.547  96.135  1.00 41.64 ? 17   DC  D OP1   1 
ATOM   329  O  OP2   . DC  A 1 17 ? 2.980   38.058  98.381  1.00 40.40 ? 17   DC  D OP2   1 
ATOM   330  O  "O5'" . DC  A 1 17 ? 2.173   36.092  97.169  1.00 42.13 ? 17   DC  D "O5'" 1 
ATOM   331  C  "C5'" . DC  A 1 17 ? 2.429   34.917  96.392  1.00 42.40 ? 17   DC  D "C5'" 1 
ATOM   332  C  "C4'" . DC  A 1 17 ? 1.261   33.971  96.463  1.00 42.80 ? 17   DC  D "C4'" 1 
ATOM   333  O  "O4'" . DC  A 1 17 ? 1.251   33.406  97.797  1.00 41.98 ? 17   DC  D "O4'" 1 
ATOM   334  C  "C3'" . DC  A 1 17 ? -0.145  34.562  96.288  1.00 40.49 ? 17   DC  D "C3'" 1 
ATOM   335  O  "O3'" . DC  A 1 17 ? -1.021  33.648  95.631  1.00 41.50 ? 17   DC  D "O3'" 1 
ATOM   336  C  "C2'" . DC  A 1 17 ? -0.688  34.624  97.699  1.00 40.27 ? 17   DC  D "C2'" 1 
ATOM   337  C  "C1'" . DC  A 1 17 ? -0.105  33.296  98.162  1.00 41.32 ? 17   DC  D "C1'" 1 
ATOM   338  N  N1    . DC  A 1 17 ? -0.024  32.924  99.574  1.00 39.40 ? 17   DC  D N1    1 
ATOM   339  C  C2    . DC  A 1 17 ? -0.213  31.569  99.781  1.00 41.52 ? 17   DC  D C2    1 
ATOM   340  O  O2    . DC  A 1 17 ? -0.444  30.894  98.738  1.00 40.71 ? 17   DC  D O2    1 
ATOM   341  N  N3    . DC  A 1 17 ? -0.073  31.116  101.093 1.00 44.97 ? 17   DC  D N3    1 
ATOM   342  C  C4    . DC  A 1 17 ? 0.225   32.003  102.117 1.00 43.29 ? 17   DC  D C4    1 
ATOM   343  N  N4    . DC  A 1 17 ? 0.309   31.596  103.386 1.00 38.88 ? 17   DC  D N4    1 
ATOM   344  C  C5    . DC  A 1 17 ? 0.388   33.410  101.864 1.00 42.54 ? 17   DC  D C5    1 
ATOM   345  C  C6    . DC  A 1 17 ? 0.240   33.812  100.585 1.00 40.73 ? 17   DC  D C6    1 
ATOM   346  P  P     . DC  A 1 18 ? -1.687  34.195  94.295  1.00 47.19 ? 18   DC  D P     1 
ATOM   347  O  OP1   . DC  A 1 18 ? -0.495  34.617  93.444  1.00 43.69 ? 18   DC  D OP1   1 
ATOM   348  O  OP2   . DC  A 1 18 ? -2.769  35.052  94.852  1.00 38.92 ? 18   DC  D OP2   1 
ATOM   349  O  "O5'" . DC  A 1 18 ? -2.302  32.961  93.504  1.00 44.43 ? 18   DC  D "O5'" 1 
ATOM   350  C  "C5'" . DC  A 1 18 ? -1.375  31.896  93.266  1.00 44.18 ? 18   DC  D "C5'" 1 
ATOM   351  C  "C4'" . DC  A 1 18 ? -2.047  30.610  93.680  1.00 46.77 ? 18   DC  D "C4'" 1 
ATOM   352  O  "O4'" . DC  A 1 18 ? -2.129  30.471  95.130  1.00 42.13 ? 18   DC  D "O4'" 1 
ATOM   353  C  "C3'" . DC  A 1 18 ? -3.492  30.520  93.152  1.00 49.27 ? 18   DC  D "C3'" 1 
ATOM   354  O  "O3'" . DC  A 1 18 ? -3.764  29.194  92.754  1.00 49.83 ? 18   DC  D "O3'" 1 
ATOM   355  C  "C2'" . DC  A 1 18 ? -4.328  30.874  94.384  1.00 49.69 ? 18   DC  D "C2'" 1 
ATOM   356  C  "C1'" . DC  A 1 18 ? -3.469  30.217  95.480  1.00 46.80 ? 18   DC  D "C1'" 1 
ATOM   357  N  N1    . DC  A 1 18 ? -3.612  30.736  96.846  1.00 47.29 ? 18   DC  D N1    1 
ATOM   358  C  C2    . DC  A 1 18 ? -3.830  29.812  97.895  1.00 48.46 ? 18   DC  D C2    1 
ATOM   359  O  O2    . DC  A 1 18 ? -3.940  28.611  97.633  1.00 47.72 ? 18   DC  D O2    1 
ATOM   360  N  N3    . DC  A 1 18 ? -3.928  30.252  99.185  1.00 48.73 ? 18   DC  D N3    1 
ATOM   361  C  C4    . DC  A 1 18 ? -3.789  31.571  99.447  1.00 47.32 ? 18   DC  D C4    1 
ATOM   362  N  N4    . DC  A 1 18 ? -3.871  31.953  100.730 1.00 46.63 ? 18   DC  D N4    1 
ATOM   363  C  C5    . DC  A 1 18 ? -3.568  32.527  98.398  1.00 46.91 ? 18   DC  D C5    1 
ATOM   364  C  C6    . DC  A 1 18 ? -3.480  32.077  97.115  1.00 47.41 ? 18   DC  D C6    1 
ATOM   365  P  P     . DG  A 1 19 ? -4.771  28.856  91.571  1.00 53.59 ? 19   DG  D P     1 
ATOM   366  O  OP1   . DG  A 1 19 ? -4.056  27.741  90.894  1.00 51.89 ? 19   DG  D OP1   1 
ATOM   367  O  OP2   . DG  A 1 19 ? -5.264  30.085  90.879  1.00 45.49 ? 19   DG  D OP2   1 
ATOM   368  O  "O5'" . DG  A 1 19 ? -5.952  28.219  92.436  1.00 52.67 ? 19   DG  D "O5'" 1 
ATOM   369  C  "C5'" . DG  A 1 19 ? -5.742  27.062  93.263  1.00 47.51 ? 19   DG  D "C5'" 1 
ATOM   370  C  "C4'" . DG  A 1 19 ? -6.965  26.848  94.143  1.00 44.61 ? 19   DG  D "C4'" 1 
ATOM   371  O  "O4'" . DG  A 1 19 ? -6.768  27.738  95.273  1.00 42.00 ? 19   DG  D "O4'" 1 
ATOM   372  C  "C3'" . DG  A 1 19 ? -8.373  27.175  93.593  1.00 44.17 ? 19   DG  D "C3'" 1 
ATOM   373  O  "O3'" . DG  A 1 19 ? -9.226  26.264  94.190  1.00 46.37 ? 19   DG  D "O3'" 1 
ATOM   374  C  "C2'" . DG  A 1 19 ? -8.708  28.548  94.187  1.00 41.32 ? 19   DG  D "C2'" 1 
ATOM   375  C  "C1'" . DG  A 1 19 ? -7.982  28.430  95.541  1.00 43.38 ? 19   DG  D "C1'" 1 
ATOM   376  N  N9    . DG  A 1 19 ? -7.660  29.660  96.284  1.00 44.45 ? 19   DG  D N9    1 
ATOM   377  C  C8    . DG  A 1 19 ? -7.483  30.947  95.773  1.00 43.75 ? 19   DG  D C8    1 
ATOM   378  N  N7    . DG  A 1 19 ? -7.231  31.842  96.703  1.00 44.33 ? 19   DG  D N7    1 
ATOM   379  C  C5    . DG  A 1 19 ? -7.233  31.113  97.903  1.00 43.32 ? 19   DG  D C5    1 
ATOM   380  C  C6    . DG  A 1 19 ? -7.022  31.576  99.213  1.00 42.44 ? 19   DG  D C6    1 
ATOM   381  O  O6    . DG  A 1 19 ? -6.737  32.741  99.539  1.00 41.36 ? 19   DG  D O6    1 
ATOM   382  N  N1    . DG  A 1 19 ? -7.131  30.518  100.132 1.00 43.29 ? 19   DG  D N1    1 
ATOM   383  C  C2    . DG  A 1 19 ? -7.407  29.186  99.787  1.00 42.89 ? 19   DG  D C2    1 
ATOM   384  N  N2    . DG  A 1 19 ? -7.486  28.281  100.766 1.00 41.96 ? 19   DG  D N2    1 
ATOM   385  N  N3    . DG  A 1 19 ? -7.581  28.733  98.565  1.00 40.97 ? 19   DG  D N3    1 
ATOM   386  C  C4    . DG  A 1 19 ? -7.485  29.759  97.671  1.00 44.61 ? 19   DG  D C4    1 
ATOM   387  P  P     . DG  A 1 20 ? -10.234 25.365  93.374  1.00 50.29 ? 20   DG  D P     1 
ATOM   388  O  OP1   . DG  A 1 20 ? -9.432  24.535  92.450  1.00 50.61 ? 20   DG  D OP1   1 
ATOM   389  O  OP2   . DG  A 1 20 ? -11.368 26.218  92.898  1.00 47.64 ? 20   DG  D OP2   1 
ATOM   390  O  "O5'" . DG  A 1 20 ? -10.826 24.392  94.509  1.00 50.61 ? 20   DG  D "O5'" 1 
ATOM   391  C  "C5'" . DG  A 1 20 ? -10.082 23.608  95.463  1.00 46.91 ? 20   DG  D "C5'" 1 
ATOM   392  C  "C4'" . DG  A 1 20 ? -10.838 23.487  96.789  1.00 47.72 ? 20   DG  D "C4'" 1 
ATOM   393  O  "O4'" . DG  A 1 20 ? -10.523 24.679  97.539  1.00 47.98 ? 20   DG  D "O4'" 1 
ATOM   394  C  "C3'" . DG  A 1 20 ? -12.371 23.440  96.773  1.00 50.65 ? 20   DG  D "C3'" 1 
ATOM   395  O  "O3'" . DG  A 1 20 ? -12.882 22.602  97.779  1.00 54.71 ? 20   DG  D "O3'" 1 
ATOM   396  C  "C2'" . DG  A 1 20 ? -12.859 24.837  97.133  1.00 50.08 ? 20   DG  D "C2'" 1 
ATOM   397  C  "C1'" . DG  A 1 20 ? -11.672 25.392  97.904  1.00 51.78 ? 20   DG  D "C1'" 1 
ATOM   398  N  N9    . DG  A 1 20 ? -11.441 26.809  97.652  1.00 52.29 ? 20   DG  D N9    1 
ATOM   399  C  C8    . DG  A 1 20 ? -11.391 27.480  96.449  1.00 52.83 ? 20   DG  D C8    1 
ATOM   400  N  N7    . DG  A 1 20 ? -11.186 28.763  96.589  1.00 54.28 ? 20   DG  D N7    1 
ATOM   401  C  C5    . DG  A 1 20 ? -11.069 28.936  97.970  1.00 53.81 ? 20   DG  D C5    1 
ATOM   402  C  C6    . DG  A 1 20 ? -10.832 30.112  98.732  1.00 53.40 ? 20   DG  D C6    1 
ATOM   403  O  O6    . DG  A 1 20 ? -10.695 31.279  98.321  1.00 52.52 ? 20   DG  D O6    1 
ATOM   404  N  N1    . DG  A 1 20 ? -10.812 29.825  100.093 1.00 51.93 ? 20   DG  D N1    1 
ATOM   405  C  C2    . DG  A 1 20 ? -11.005 28.573  100.636 1.00 51.77 ? 20   DG  D C2    1 
ATOM   406  N  N2    . DG  A 1 20 ? -10.945 28.487  101.973 1.00 52.29 ? 20   DG  D N2    1 
ATOM   407  N  N3    . DG  A 1 20 ? -11.227 27.469  99.942  1.00 50.15 ? 20   DG  D N3    1 
ATOM   408  C  C4    . DG  A 1 20 ? -11.237 27.738  98.628  1.00 51.61 ? 20   DG  D C4    1 
ATOM   409  O  "O5'" . DT  B 2 1  ? -12.950 39.454  101.980 1.00 63.62 ? 21   DT  E "O5'" 1 
ATOM   410  C  "C5'" . DT  B 2 1  ? -13.778 39.722  103.135 1.00 64.19 ? 21   DT  E "C5'" 1 
ATOM   411  C  "C4'" . DT  B 2 1  ? -13.875 38.565  104.138 1.00 61.09 ? 21   DT  E "C4'" 1 
ATOM   412  O  "O4'" . DT  B 2 1  ? -14.224 37.268  103.530 1.00 59.42 ? 21   DT  E "O4'" 1 
ATOM   413  C  "C3'" . DT  B 2 1  ? -12.584 38.280  104.861 1.00 59.85 ? 21   DT  E "C3'" 1 
ATOM   414  O  "O3'" . DT  B 2 1  ? -12.926 37.639  106.038 1.00 60.81 ? 21   DT  E "O3'" 1 
ATOM   415  C  "C2'" . DT  B 2 1  ? -11.911 37.294  103.908 1.00 56.70 ? 21   DT  E "C2'" 1 
ATOM   416  C  "C1'" . DT  B 2 1  ? -13.111 36.388  103.581 1.00 54.10 ? 21   DT  E "C1'" 1 
ATOM   417  N  N1    . DT  B 2 1  ? -13.090 35.741  102.214 1.00 52.86 ? 21   DT  E N1    1 
ATOM   418  C  C2    . DT  B 2 1  ? -13.469 34.430  102.161 1.00 50.89 ? 21   DT  E C2    1 
ATOM   419  O  O2    . DT  B 2 1  ? -13.823 33.805  103.125 1.00 52.30 ? 21   DT  E O2    1 
ATOM   420  N  N3    . DT  B 2 1  ? -13.435 33.858  100.933 1.00 51.15 ? 21   DT  E N3    1 
ATOM   421  C  C4    . DT  B 2 1  ? -13.095 34.422  99.707  1.00 51.55 ? 21   DT  E C4    1 
ATOM   422  O  O4    . DT  B 2 1  ? -13.147 33.762  98.638  1.00 51.13 ? 21   DT  E O4    1 
ATOM   423  C  C5    . DT  B 2 1  ? -12.700 35.810  99.819  1.00 48.98 ? 21   DT  E C5    1 
ATOM   424  C  C7    . DT  B 2 1  ? -12.332 36.534  98.567  1.00 51.33 ? 21   DT  E C7    1 
ATOM   425  C  C6    . DT  B 2 1  ? -12.711 36.397  101.031 1.00 49.89 ? 21   DT  E C6    1 
ATOM   426  P  P     . DC  B 2 2  ? -11.708 37.464  107.050 1.00 63.05 ? 22   DC  E P     1 
ATOM   427  O  OP1   . DC  B 2 2  ? -12.320 37.581  108.393 1.00 62.94 ? 22   DC  E OP1   1 
ATOM   428  O  OP2   . DC  B 2 2  ? -10.553 38.264  106.596 1.00 62.91 ? 22   DC  E OP2   1 
ATOM   429  O  "O5'" . DC  B 2 2  ? -11.255 35.957  106.901 1.00 64.14 ? 22   DC  E "O5'" 1 
ATOM   430  C  "C5'" . DC  B 2 2  ? -12.183 35.012  107.433 1.00 66.20 ? 22   DC  E "C5'" 1 
ATOM   431  C  "C4'" . DC  B 2 2  ? -11.550 33.671  107.216 1.00 64.26 ? 22   DC  E "C4'" 1 
ATOM   432  O  "O4'" . DC  B 2 2  ? -11.609 33.327  105.803 1.00 62.03 ? 22   DC  E "O4'" 1 
ATOM   433  C  "C3'" . DC  B 2 2  ? -10.098 33.703  107.649 1.00 64.85 ? 22   DC  E "C3'" 1 
ATOM   434  O  "O3'" . DC  B 2 2  ? -10.169 32.892  108.828 1.00 66.92 ? 22   DC  E "O3'" 1 
ATOM   435  C  "C2'" . DC  B 2 2  ? -9.326  33.196  106.419 1.00 62.95 ? 22   DC  E "C2'" 1 
ATOM   436  C  "C1'" . DC  B 2 2  ? -10.422 32.723  105.426 1.00 60.45 ? 22   DC  E "C1'" 1 
ATOM   437  N  N1    . DC  B 2 2  ? -10.203 32.919  103.942 1.00 58.20 ? 22   DC  E N1    1 
ATOM   438  C  C2    . DC  B 2 2  ? -10.491 31.848  103.074 1.00 58.52 ? 22   DC  E C2    1 
ATOM   439  O  O2    . DC  B 2 2  ? -10.955 30.799  103.548 1.00 56.85 ? 22   DC  E O2    1 
ATOM   440  N  N3    . DC  B 2 2  ? -10.253 31.990  101.734 1.00 58.87 ? 22   DC  E N3    1 
ATOM   441  C  C4    . DC  B 2 2  ? -9.777  33.154  101.266 1.00 57.92 ? 22   DC  E C4    1 
ATOM   442  N  N4    . DC  B 2 2  ? -9.579  33.285  99.949  1.00 56.79 ? 22   DC  E N4    1 
ATOM   443  C  C5    . DC  B 2 2  ? -9.489  34.242  102.147 1.00 56.50 ? 22   DC  E C5    1 
ATOM   444  C  C6    . DC  B 2 2  ? -9.695  34.085  103.456 1.00 55.98 ? 22   DC  E C6    1 
ATOM   445  P  P     . DC  B 2 3  ? -8.935  32.248  109.604 1.00 68.47 ? 23   DC  E P     1 
ATOM   446  O  OP1   . DC  B 2 3  ? -8.987  32.829  110.963 1.00 67.83 ? 23   DC  E OP1   1 
ATOM   447  O  OP2   . DC  B 2 3  ? -7.723  32.371  108.739 1.00 69.25 ? 23   DC  E OP2   1 
ATOM   448  O  "O5'" . DC  B 2 3  ? -9.362  30.711  109.750 1.00 65.28 ? 23   DC  E "O5'" 1 
ATOM   449  C  "C5'" . DC  B 2 3  ? -8.409  29.700  109.660 1.00 61.67 ? 23   DC  E "C5'" 1 
ATOM   450  C  "C4'" . DC  B 2 3  ? -8.114  29.099  108.291 1.00 56.07 ? 23   DC  E "C4'" 1 
ATOM   451  O  "O4'" . DC  B 2 3  ? -8.286  29.895  107.083 1.00 54.53 ? 23   DC  E "O4'" 1 
ATOM   452  C  "C3'" . DC  B 2 3  ? -6.637  28.739  108.276 1.00 53.44 ? 23   DC  E "C3'" 1 
ATOM   453  O  "O3'" . DC  B 2 3  ? -6.563  27.436  107.861 1.00 55.64 ? 23   DC  E "O3'" 1 
ATOM   454  C  "C2'" . DC  B 2 3  ? -6.017  29.636  107.240 1.00 48.52 ? 23   DC  E "C2'" 1 
ATOM   455  C  "C1'" . DC  B 2 3  ? -7.127  29.629  106.228 1.00 49.75 ? 23   DC  E "C1'" 1 
ATOM   456  N  N1    . DC  B 2 3  ? -6.886  30.697  105.185 1.00 48.84 ? 23   DC  E N1    1 
ATOM   457  C  C2    . DC  B 2 3  ? -7.005  30.481  103.801 1.00 49.80 ? 23   DC  E C2    1 
ATOM   458  O  O2    . DC  B 2 3  ? -7.318  29.362  103.428 1.00 51.39 ? 23   DC  E O2    1 
ATOM   459  N  N3    . DC  B 2 3  ? -6.790  31.467  102.863 1.00 49.63 ? 23   DC  E N3    1 
ATOM   460  C  C4    . DC  B 2 3  ? -6.453  32.683  103.289 1.00 50.00 ? 23   DC  E C4    1 
ATOM   461  N  N4    . DC  B 2 3  ? -6.228  33.643  102.388 1.00 48.68 ? 23   DC  E N4    1 
ATOM   462  C  C5    . DC  B 2 3  ? -6.294  32.941  104.697 1.00 51.92 ? 23   DC  E C5    1 
ATOM   463  C  C6    . DC  B 2 3  ? -6.501  31.949  105.590 1.00 51.42 ? 23   DC  E C6    1 
ATOM   464  P  P     . DG  B 2 4  ? -5.935  26.501  108.970 1.00 60.56 ? 24   DG  E P     1 
ATOM   465  O  OP1   . DG  B 2 4  ? -7.014  26.274  109.936 1.00 59.59 ? 24   DG  E OP1   1 
ATOM   466  O  OP2   . DG  B 2 4  ? -4.666  27.144  109.420 1.00 61.02 ? 24   DG  E OP2   1 
ATOM   467  O  "O5'" . DG  B 2 4  ? -5.597  25.147  108.165 1.00 58.23 ? 24   DG  E "O5'" 1 
ATOM   468  C  "C5'" . DG  B 2 4  ? -6.705  24.318  107.807 1.00 56.93 ? 24   DG  E "C5'" 1 
ATOM   469  C  "C4'" . DG  B 2 4  ? -6.423  23.648  106.471 1.00 54.61 ? 24   DG  E "C4'" 1 
ATOM   470  O  "O4'" . DG  B 2 4  ? -6.318  24.668  105.439 1.00 52.41 ? 24   DG  E "O4'" 1 
ATOM   471  C  "C3'" . DG  B 2 4  ? -5.136  22.836  106.401 1.00 52.49 ? 24   DG  E "C3'" 1 
ATOM   472  O  "O3'" . DG  B 2 4  ? -5.343  21.777  105.483 1.00 55.25 ? 24   DG  E "O3'" 1 
ATOM   473  C  "C2'" . DG  B 2 4  ? -4.148  23.838  105.817 1.00 49.28 ? 24   DG  E "C2'" 1 
ATOM   474  C  "C1'" . DG  B 2 4  ? -5.051  24.552  104.804 1.00 49.21 ? 24   DG  E "C1'" 1 
ATOM   475  N  N9    . DG  B 2 4  ? -4.656  25.934  104.536 1.00 48.92 ? 24   DG  E N9    1 
ATOM   476  C  C8    . DG  B 2 4  ? -4.268  26.843  105.522 1.00 47.18 ? 24   DG  E C8    1 
ATOM   477  N  N7    . DG  B 2 4  ? -3.910  28.005  105.041 1.00 46.04 ? 24   DG  E N7    1 
ATOM   478  C  C5    . DG  B 2 4  ? -4.132  27.880  103.664 1.00 46.56 ? 24   DG  E C5    1 
ATOM   479  C  C6    . DG  B 2 4  ? -3.949  28.859  102.655 1.00 46.77 ? 24   DG  E C6    1 
ATOM   480  O  O6    . DG  B 2 4  ? -3.558  30.035  102.818 1.00 45.13 ? 24   DG  E O6    1 
ATOM   481  N  N1    . DG  B 2 4  ? -4.250  28.343  101.377 1.00 47.45 ? 24   DG  E N1    1 
ATOM   482  C  C2    . DG  B 2 4  ? -4.680  27.039  101.148 1.00 47.40 ? 24   DG  E C2    1 
ATOM   483  N  N2    . DG  B 2 4  ? -4.917  26.720  99.865  1.00 45.73 ? 24   DG  E N2    1 
ATOM   484  N  N3    . DG  B 2 4  ? -4.846  26.114  102.105 1.00 46.76 ? 24   DG  E N3    1 
ATOM   485  C  C4    . DG  B 2 4  ? -4.563  26.604  103.330 1.00 46.55 ? 24   DG  E C4    1 
ATOM   486  P  P     . DG  B 2 5  ? -4.212  20.626  105.291 1.00 61.46 ? 25   DG  E P     1 
ATOM   487  O  OP1   . DG  B 2 5  ? -4.961  19.366  104.994 1.00 61.31 ? 25   DG  E OP1   1 
ATOM   488  O  OP2   . DG  B 2 5  ? -3.241  20.725  106.419 1.00 58.59 ? 25   DG  E OP2   1 
ATOM   489  O  "O5'" . DG  B 2 5  ? -3.309  20.926  104.002 1.00 58.28 ? 25   DG  E "O5'" 1 
ATOM   490  C  "C5'" . DG  B 2 5  ? -3.839  21.018  102.700 1.00 57.36 ? 25   DG  E "C5'" 1 
ATOM   491  C  "C4'" . DG  B 2 5  ? -2.855  21.828  101.883 1.00 54.40 ? 25   DG  E "C4'" 1 
ATOM   492  O  "O4'" . DG  B 2 5  ? -2.825  23.230  102.297 1.00 55.41 ? 25   DG  E "O4'" 1 
ATOM   493  C  "C3'" . DG  B 2 5  ? -1.447  21.335  102.061 1.00 51.77 ? 25   DG  E "C3'" 1 
ATOM   494  O  "O3'" . DG  B 2 5  ? -0.875  21.552  100.857 1.00 51.08 ? 25   DG  E "O3'" 1 
ATOM   495  C  "C2'" . DG  B 2 5  ? -0.883  22.340  103.037 1.00 52.16 ? 25   DG  E "C2'" 1 
ATOM   496  C  "C1'" . DG  B 2 5  ? -1.452  23.525  102.319 1.00 52.91 ? 25   DG  E "C1'" 1 
ATOM   497  N  N9    . DG  B 2 5  ? -1.176  24.740  103.006 1.00 53.49 ? 25   DG  E N9    1 
ATOM   498  C  C8    . DG  B 2 5  ? -0.975  24.899  104.361 1.00 52.89 ? 25   DG  E C8    1 
ATOM   499  N  N7    . DG  B 2 5  ? -0.742  26.134  104.717 1.00 50.92 ? 25   DG  E N7    1 
ATOM   500  C  C5    . DG  B 2 5  ? -0.804  26.838  103.500 1.00 53.03 ? 25   DG  E C5    1 
ATOM   501  C  C6    . DG  B 2 5  ? -0.582  28.206  103.205 1.00 50.20 ? 25   DG  E C6    1 
ATOM   502  O  O6    . DG  B 2 5  ? -0.297  29.149  103.916 1.00 51.45 ? 25   DG  E O6    1 
ATOM   503  N  N1    . DG  B 2 5  ? -0.700  28.510  101.891 1.00 51.64 ? 25   DG  E N1    1 
ATOM   504  C  C2    . DG  B 2 5  ? -0.973  27.603  100.928 1.00 53.33 ? 25   DG  E C2    1 
ATOM   505  N  N2    . DG  B 2 5  ? -1.033  28.197  99.732  1.00 53.16 ? 25   DG  E N2    1 
ATOM   506  N  N3    . DG  B 2 5  ? -1.159  26.294  101.126 1.00 54.28 ? 25   DG  E N3    1 
ATOM   507  C  C4    . DG  B 2 5  ? -1.077  25.986  102.440 1.00 54.81 ? 25   DG  E C4    1 
ATOM   508  P  P     . DA  B 2 6  ? -0.493  20.211  100.119 1.00 54.50 ? 26   DA  E P     1 
ATOM   509  O  OP1   . DA  B 2 6  ? -1.694  19.339  100.349 1.00 55.01 ? 26   DA  E OP1   1 
ATOM   510  O  OP2   . DA  B 2 6  ? 0.839   19.740  100.340 1.00 43.78 ? 26   DA  E OP2   1 
ATOM   511  O  "O5'" . DA  B 2 6  ? -0.319  20.683  98.622  1.00 51.06 ? 26   DA  E "O5'" 1 
ATOM   512  C  "C5'" . DA  B 2 6  ? -1.293  21.447  97.942  1.00 45.93 ? 26   DA  E "C5'" 1 
ATOM   513  C  "C4'" . DA  B 2 6  ? -0.590  22.390  96.965  1.00 44.55 ? 26   DA  E "C4'" 1 
ATOM   514  O  "O4'" . DA  B 2 6  ? -0.203  23.654  97.619  1.00 42.60 ? 26   DA  E "O4'" 1 
ATOM   515  C  "C3'" . DA  B 2 6  ? 0.701   21.851  96.332  1.00 47.60 ? 26   DA  E "C3'" 1 
ATOM   516  O  "O3'" . DA  B 2 6  ? 0.551   22.109  94.944  1.00 47.15 ? 26   DA  E "O3'" 1 
ATOM   517  C  "C2'" . DA  B 2 6  ? 1.903   22.550  97.068  1.00 40.21 ? 26   DA  E "C2'" 1 
ATOM   518  C  "C1'" . DA  B 2 6  ? 1.219   23.833  97.563  1.00 43.85 ? 26   DA  E "C1'" 1 
ATOM   519  N  N9    . DA  B 2 6  ? 1.533   24.331  98.888  1.00 45.34 ? 26   DA  E N9    1 
ATOM   520  C  C8    . DA  B 2 6  ? 1.506   23.662  100.075 1.00 44.33 ? 26   DA  E C8    1 
ATOM   521  N  N7    . DA  B 2 6  ? 1.760   24.422  101.108 1.00 45.45 ? 26   DA  E N7    1 
ATOM   522  C  C5    . DA  B 2 6  ? 1.997   25.680  100.593 1.00 46.29 ? 26   DA  E C5    1 
ATOM   523  C  C6    . DA  B 2 6  ? 2.350   26.939  101.180 1.00 43.89 ? 26   DA  E C6    1 
ATOM   524  N  N6    . DA  B 2 6  ? 2.532   27.127  102.492 1.00 39.11 ? 26   DA  E N6    1 
ATOM   525  N  N1    . DA  B 2 6  ? 2.504   28.007  100.343 1.00 43.89 ? 26   DA  E N1    1 
ATOM   526  C  C2    . DA  B 2 6  ? 2.278   27.807  99.045  1.00 43.89 ? 26   DA  E C2    1 
ATOM   527  N  N3    . DA  B 2 6  ? 1.945   26.675  98.359  1.00 42.91 ? 26   DA  E N3    1 
ATOM   528  C  C4    . DA  B 2 6  ? 1.821   25.641  99.208  1.00 47.23 ? 26   DA  E C4    1 
ATOM   529  P  P     . DG  B 2 7  ? 1.812   22.021  93.919  1.00 52.14 ? 27   DG  E P     1 
ATOM   530  O  OP1   . DG  B 2 7  ? 1.164   22.115  92.578  1.00 51.33 ? 27   DG  E OP1   1 
ATOM   531  O  OP2   . DG  B 2 7  ? 2.658   20.865  94.201  1.00 51.86 ? 27   DG  E OP2   1 
ATOM   532  O  "O5'" . DG  B 2 7  ? 2.725   23.312  94.186  1.00 50.62 ? 27   DG  E "O5'" 1 
ATOM   533  C  "C5'" . DG  B 2 7  ? 2.353   24.454  93.409  1.00 46.52 ? 27   DG  E "C5'" 1 
ATOM   534  C  "C4'" . DG  B 2 7  ? 3.298   25.570  93.659  1.00 46.25 ? 27   DG  E "C4'" 1 
ATOM   535  O  "O4'" . DG  B 2 7  ? 3.431   25.899  95.070  1.00 41.37 ? 27   DG  E "O4'" 1 
ATOM   536  C  "C3'" . DG  B 2 7  ? 4.631   25.035  93.211  1.00 47.38 ? 27   DG  E "C3'" 1 
ATOM   537  O  "O3'" . DG  B 2 7  ? 4.996   26.105  92.421  1.00 52.21 ? 27   DG  E "O3'" 1 
ATOM   538  C  "C2'" . DG  B 2 7  ? 5.455   24.942  94.494  1.00 45.00 ? 27   DG  E "C2'" 1 
ATOM   539  C  "C1'" . DG  B 2 7  ? 4.753   25.902  95.472  1.00 42.41 ? 27   DG  E "C1'" 1 
ATOM   540  N  N9    . DG  B 2 7  ? 4.810   25.554  96.914  1.00 44.12 ? 27   DG  E N9    1 
ATOM   541  C  C8    . DG  B 2 7  ? 4.520   24.365  97.480  1.00 43.37 ? 27   DG  E C8    1 
ATOM   542  N  N7    . DG  B 2 7  ? 4.691   24.307  98.774  1.00 43.22 ? 27   DG  E N7    1 
ATOM   543  C  C5    . DG  B 2 7  ? 5.129   25.555  99.116  1.00 43.69 ? 27   DG  E C5    1 
ATOM   544  C  C6    . DG  B 2 7  ? 5.432   26.100  100.407 1.00 44.36 ? 27   DG  E C6    1 
ATOM   545  O  O6    . DG  B 2 7  ? 5.397   25.483  101.525 1.00 43.15 ? 27   DG  E O6    1 
ATOM   546  N  N1    . DG  B 2 7  ? 5.864   27.430  100.319 1.00 41.22 ? 27   DG  E N1    1 
ATOM   547  C  C2    . DG  B 2 7  ? 5.949   28.122  99.147  1.00 40.88 ? 27   DG  E C2    1 
ATOM   548  N  N2    . DG  B 2 7  ? 6.384   29.393  99.169  1.00 41.44 ? 27   DG  E N2    1 
ATOM   549  N  N3    . DG  B 2 7  ? 5.652   27.610  97.968  1.00 42.83 ? 27   DG  E N3    1 
ATOM   550  C  C4    . DG  B 2 7  ? 5.236   26.322  98.001  1.00 43.18 ? 27   DG  E C4    1 
ATOM   551  P  P     . DG  B 2 8  ? 6.292   26.049  91.527  1.00 53.00 ? 28   DG  E P     1 
ATOM   552  O  OP1   . DG  B 2 8  ? 5.995   26.939  90.366  1.00 50.70 ? 28   DG  E OP1   1 
ATOM   553  O  OP2   . DG  B 2 8  ? 6.603   24.586  91.383  1.00 55.15 ? 28   DG  E OP2   1 
ATOM   554  O  "O5'" . DG  B 2 8  ? 7.517   26.683  92.359  1.00 48.30 ? 28   DG  E "O5'" 1 
ATOM   555  C  "C5'" . DG  B 2 8  ? 7.575   27.958  92.971  1.00 42.09 ? 28   DG  E "C5'" 1 
ATOM   556  C  "C4'" . DG  B 2 8  ? 8.756   27.812  93.918  1.00 44.72 ? 28   DG  E "C4'" 1 
ATOM   557  O  "O4'" . DG  B 2 8  ? 8.373   27.044  95.119  1.00 45.70 ? 28   DG  E "O4'" 1 
ATOM   558  C  "C3'" . DG  B 2 8  ? 9.984   27.054  93.401  1.00 43.05 ? 28   DG  E "C3'" 1 
ATOM   559  O  "O3'" . DG  B 2 8  ? 11.008  27.896  93.632  1.00 43.55 ? 28   DG  E "O3'" 1 
ATOM   560  C  "C2'" . DG  B 2 8  ? 10.099  25.802  94.280  1.00 39.03 ? 28   DG  E "C2'" 1 
ATOM   561  C  "C1'" . DG  B 2 8  ? 9.534   26.378  95.575  1.00 43.21 ? 28   DG  E "C1'" 1 
ATOM   562  N  N9    . DG  B 2 8  ? 9.112   25.519  96.702  1.00 44.38 ? 28   DG  E N9    1 
ATOM   563  C  C8    . DG  B 2 8  ? 8.656   24.195  96.707  1.00 44.62 ? 28   DG  E C8    1 
ATOM   564  N  N7    . DG  B 2 8  ? 8.389   23.706  97.911  1.00 43.62 ? 28   DG  E N7    1 
ATOM   565  C  C5    . DG  B 2 8  ? 8.618   24.809  98.751  1.00 41.49 ? 28   DG  E C5    1 
ATOM   566  C  C6    . DG  B 2 8  ? 8.488   24.892  100.147 1.00 41.15 ? 28   DG  E C6    1 
ATOM   567  O  O6    . DG  B 2 8  ? 8.094   23.971  100.927 1.00 41.76 ? 28   DG  E O6    1 
ATOM   568  N  N1    . DG  B 2 8  ? 8.885   26.172  100.595 1.00 43.19 ? 28   DG  E N1    1 
ATOM   569  C  C2    . DG  B 2 8  ? 9.325   27.245  99.792  1.00 44.57 ? 28   DG  E C2    1 
ATOM   570  N  N2    . DG  B 2 8  ? 9.705   28.425  100.357 1.00 40.87 ? 28   DG  E N2    1 
ATOM   571  N  N3    . DG  B 2 8  ? 9.438   27.133  98.458  1.00 44.64 ? 28   DG  E N3    1 
ATOM   572  C  C4    . DG  B 2 8  ? 9.070   25.907  98.028  1.00 42.90 ? 28   DG  E C4    1 
ATOM   573  P  P     . DA  B 2 9  ? 12.056  28.052  92.413  1.00 51.97 ? 29   DA  E P     1 
ATOM   574  O  OP1   . DA  B 2 9  ? 11.366  28.801  91.307  1.00 49.76 ? 29   DA  E OP1   1 
ATOM   575  O  OP2   . DA  B 2 9  ? 12.706  26.734  92.139  1.00 48.34 ? 29   DA  E OP2   1 
ATOM   576  O  "O5'" . DA  B 2 9  ? 13.034  29.091  93.165  1.00 47.58 ? 29   DA  E "O5'" 1 
ATOM   577  C  "C5'" . DA  B 2 9  ? 12.242  30.130  93.876  1.00 47.30 ? 29   DA  E "C5'" 1 
ATOM   578  C  "C4'" . DA  B 2 9  ? 12.948  30.717  95.104  1.00 48.73 ? 29   DA  E "C4'" 1 
ATOM   579  O  "O4'" . DA  B 2 9  ? 12.641  30.012  96.338  1.00 45.73 ? 29   DA  E "O4'" 1 
ATOM   580  C  "C3'" . DA  B 2 9  ? 14.505  30.743  95.105  1.00 49.30 ? 29   DA  E "C3'" 1 
ATOM   581  O  "O3'" . DA  B 2 9  ? 14.940  31.696  96.072  1.00 49.30 ? 29   DA  E "O3'" 1 
ATOM   582  C  "C2'" . DA  B 2 9  ? 14.858  29.354  95.586  1.00 44.51 ? 29   DA  E "C2'" 1 
ATOM   583  C  "C1'" . DA  B 2 9  ? 13.827  29.251  96.715  1.00 42.70 ? 29   DA  E "C1'" 1 
ATOM   584  N  N9    . DA  B 2 9  ? 13.388  27.867  96.904  1.00 42.40 ? 29   DA  E N9    1 
ATOM   585  C  C8    . DA  B 2 9  ? 13.249  26.856  95.949  1.00 43.36 ? 29   DA  E C8    1 
ATOM   586  N  N7    . DA  B 2 9  ? 12.809  25.705  96.478  1.00 44.10 ? 29   DA  E N7    1 
ATOM   587  C  C5    . DA  B 2 9  ? 12.623  25.984  97.832  1.00 41.80 ? 29   DA  E C5    1 
ATOM   588  C  C6    . DA  B 2 9  ? 12.153  25.219  98.949  1.00 43.55 ? 29   DA  E C6    1 
ATOM   589  N  N6    . DA  B 2 9  ? 11.760  23.938  99.016  1.00 40.31 ? 29   DA  E N6    1 
ATOM   590  N  N1    . DA  B 2 9  ? 12.108  25.878  100.103 1.00 41.27 ? 29   DA  E N1    1 
ATOM   591  C  C2    . DA  B 2 9  ? 12.537  27.138  100.111 1.00 42.06 ? 29   DA  E C2    1 
ATOM   592  N  N3    . DA  B 2 9  ? 12.985  27.949  99.187  1.00 38.55 ? 29   DA  E N3    1 
ATOM   593  C  C4    . DA  B 2 9  ? 12.996  27.300  98.071  1.00 39.19 ? 29   DA  E C4    1 
ATOM   594  P  P     . DC  B 2 10 ? 16.485  32.046  96.171  1.00 53.98 ? 30   DC  E P     1 
ATOM   595  O  OP1   . DC  B 2 10 ? 16.388  33.497  96.487  1.00 52.08 ? 30   DC  E OP1   1 
ATOM   596  O  OP2   . DC  B 2 10 ? 17.391  31.500  95.151  1.00 45.32 ? 30   DC  E OP2   1 
ATOM   597  O  "O5'" . DC  B 2 10 ? 16.886  31.242  97.518  1.00 56.53 ? 30   DC  E "O5'" 1 
ATOM   598  C  "C5'" . DC  B 2 10 ? 15.922  31.308  98.631  1.00 53.71 ? 30   DC  E "C5'" 1 
ATOM   599  C  "C4'" . DC  B 2 10 ? 16.344  30.496  99.860  1.00 54.20 ? 30   DC  E "C4'" 1 
ATOM   600  O  "O4'" . DC  B 2 10 ? 15.793  29.153  99.822  1.00 53.47 ? 30   DC  E "O4'" 1 
ATOM   601  C  "C3'" . DC  B 2 10 ? 17.836  30.328  100.090 1.00 53.91 ? 30   DC  E "C3'" 1 
ATOM   602  O  "O3'" . DC  B 2 10 ? 18.059  30.595  101.422 1.00 54.78 ? 30   DC  E "O3'" 1 
ATOM   603  C  "C2'" . DC  B 2 10 ? 18.123  28.870  99.777  1.00 50.44 ? 30   DC  E "C2'" 1 
ATOM   604  C  "C1'" . DC  B 2 10 ? 16.788  28.241  100.144 1.00 46.47 ? 30   DC  E "C1'" 1 
ATOM   605  N  N1    . DC  B 2 10 ? 16.412  26.955  99.484  1.00 44.98 ? 30   DC  E N1    1 
ATOM   606  C  C2    . DC  B 2 10 ? 15.887  25.985  100.339 1.00 44.07 ? 30   DC  E C2    1 
ATOM   607  O  O2    . DC  B 2 10 ? 15.763  26.311  101.492 1.00 43.16 ? 30   DC  E O2    1 
ATOM   608  N  N3    . DC  B 2 10 ? 15.510  24.752  99.911  1.00 43.20 ? 30   DC  E N3    1 
ATOM   609  C  C4    . DC  B 2 10 ? 15.627  24.450  98.612  1.00 40.56 ? 30   DC  E C4    1 
ATOM   610  N  N4    . DC  B 2 10 ? 15.233  23.226  98.246  1.00 38.48 ? 30   DC  E N4    1 
ATOM   611  C  C5    . DC  B 2 10 ? 16.194  25.415  97.697  1.00 40.23 ? 30   DC  E C5    1 
ATOM   612  C  C6    . DC  B 2 10 ? 16.554  26.656  98.154  1.00 41.12 ? 30   DC  E C6    1 
ATOM   613  P  P     . DT  B 2 11 ? 19.604  30.915  101.759 1.00 59.89 ? 31   DT  E P     1 
ATOM   614  O  OP1   . DT  B 2 11 ? 19.606  32.346  102.155 1.00 56.12 ? 31   DT  E OP1   1 
ATOM   615  O  OP2   . DT  B 2 11 ? 20.677  30.305  100.933 1.00 52.72 ? 31   DT  E OP2   1 
ATOM   616  O  "O5'" . DT  B 2 11 ? 19.556  30.000  103.074 1.00 53.88 ? 31   DT  E "O5'" 1 
ATOM   617  C  "C5'" . DT  B 2 11 ? 18.595  30.204  104.091 1.00 41.80 ? 31   DT  E "C5'" 1 
ATOM   618  C  "C4'" . DT  B 2 11 ? 18.699  29.010  105.009 1.00 42.63 ? 31   DT  E "C4'" 1 
ATOM   619  O  "O4'" . DT  B 2 11 ? 18.410  27.760  104.288 1.00 38.18 ? 31   DT  E "O4'" 1 
ATOM   620  C  "C3'" . DT  B 2 11 ? 20.140  28.831  105.551 1.00 41.69 ? 31   DT  E "C3'" 1 
ATOM   621  O  "O3'" . DT  B 2 11 ? 20.014  28.568  106.891 1.00 36.81 ? 31   DT  E "O3'" 1 
ATOM   622  C  "C2'" . DT  B 2 11 ? 20.766  27.713  104.682 1.00 37.16 ? 31   DT  E "C2'" 1 
ATOM   623  C  "C1'" . DT  B 2 11 ? 19.533  26.899  104.315 1.00 39.73 ? 31   DT  E "C1'" 1 
ATOM   624  N  N1    . DT  B 2 11 ? 19.478  26.111  103.089 1.00 42.67 ? 31   DT  E N1    1 
ATOM   625  C  C2    . DT  B 2 11 ? 18.857  24.851  103.181 1.00 45.24 ? 31   DT  E C2    1 
ATOM   626  O  O2    . DT  B 2 11 ? 18.394  24.279  104.079 1.00 48.87 ? 31   DT  E O2    1 
ATOM   627  N  N3    . DT  B 2 11 ? 18.723  24.069  102.110 1.00 49.48 ? 31   DT  E N3    1 
ATOM   628  C  C4    . DT  B 2 11 ? 19.138  24.452  100.873 1.00 45.93 ? 31   DT  E C4    1 
ATOM   629  O  O4    . DT  B 2 11 ? 18.898  23.581  100.048 1.00 47.51 ? 31   DT  E O4    1 
ATOM   630  C  C5    . DT  B 2 11 ? 19.812  25.754  100.732 1.00 44.61 ? 31   DT  E C5    1 
ATOM   631  C  C7    . DT  B 2 11 ? 20.488  26.129  99.395  1.00 43.72 ? 31   DT  E C7    1 
ATOM   632  C  C6    . DT  B 2 11 ? 19.922  26.546  101.851 1.00 40.88 ? 31   DT  E C6    1 
ATOM   633  P  P     . DG  B 2 12 ? 21.317  28.443  107.755 1.00 43.57 ? 32   DG  E P     1 
ATOM   634  O  OP1   . DG  B 2 12 ? 20.826  28.783  109.093 1.00 42.12 ? 32   DG  E OP1   1 
ATOM   635  O  OP2   . DG  B 2 12 ? 22.545  28.955  107.173 1.00 39.26 ? 32   DG  E OP2   1 
ATOM   636  O  "O5'" . DG  B 2 12 ? 21.694  26.853  107.777 1.00 39.86 ? 32   DG  E "O5'" 1 
ATOM   637  C  "C5'" . DG  B 2 12 ? 20.782  25.895  108.172 1.00 30.52 ? 32   DG  E "C5'" 1 
ATOM   638  C  "C4'" . DG  B 2 12 ? 21.444  24.595  107.890 1.00 33.51 ? 32   DG  E "C4'" 1 
ATOM   639  O  "O4'" . DG  B 2 12 ? 21.250  24.485  106.499 1.00 32.89 ? 32   DG  E "O4'" 1 
ATOM   640  C  "C3'" . DG  B 2 12 ? 22.973  24.437  108.073 1.00 31.83 ? 32   DG  E "C3'" 1 
ATOM   641  O  "O3'" . DG  B 2 12 ? 23.155  23.357  108.932 1.00 28.53 ? 32   DG  E "O3'" 1 
ATOM   642  C  "C2'" . DG  B 2 12 ? 23.405  24.069  106.713 1.00 32.35 ? 32   DG  E "C2'" 1 
ATOM   643  C  "C1'" . DG  B 2 12 ? 22.166  23.613  106.003 1.00 34.48 ? 32   DG  E "C1'" 1 
ATOM   644  N  N9    . DG  B 2 12 ? 22.286  23.818  104.532 1.00 37.67 ? 32   DG  E N9    1 
ATOM   645  C  C8    . DG  B 2 12 ? 22.866  24.844  103.804 1.00 35.02 ? 32   DG  E C8    1 
ATOM   646  N  N7    . DG  B 2 12 ? 22.773  24.539  102.516 1.00 37.37 ? 32   DG  E N7    1 
ATOM   647  C  C5    . DG  B 2 12 ? 22.178  23.275  102.365 1.00 34.53 ? 32   DG  E C5    1 
ATOM   648  C  C6    . DG  B 2 12 ? 21.833  22.446  101.233 1.00 35.46 ? 32   DG  E C6    1 
ATOM   649  O  O6    . DG  B 2 12 ? 21.990  22.622  99.947  1.00 36.82 ? 32   DG  E O6    1 
ATOM   650  N  N1    . DG  B 2 12 ? 21.252  21.236  101.638 1.00 33.56 ? 32   DG  E N1    1 
ATOM   651  C  C2    . DG  B 2 12 ? 21.026  20.910  102.978 1.00 38.13 ? 32   DG  E C2    1 
ATOM   652  N  N2    . DG  B 2 12 ? 20.468  19.697  103.260 1.00 36.65 ? 32   DG  E N2    1 
ATOM   653  N  N3    . DG  B 2 12 ? 21.335  21.683  104.001 1.00 36.12 ? 32   DG  E N3    1 
ATOM   654  C  C4    . DG  B 2 12 ? 21.905  22.832  103.618 1.00 36.58 ? 32   DG  E C4    1 
ATOM   655  P  P     . DT  B 2 13 ? 24.145  22.139  108.929 1.00 31.06 ? 33   DT  E P     1 
ATOM   656  O  OP1   . DT  B 2 13 ? 23.996  21.683  110.297 1.00 30.22 ? 33   DT  E OP1   1 
ATOM   657  O  OP2   . DT  B 2 13 ? 25.580  22.388  108.647 1.00 26.91 ? 33   DT  E OP2   1 
ATOM   658  O  "O5'" . DT  B 2 13 ? 23.448  21.153  107.901 1.00 31.23 ? 33   DT  E "O5'" 1 
ATOM   659  C  "C5'" . DT  B 2 13 ? 22.204  20.696  108.325 1.00 32.97 ? 33   DT  E "C5'" 1 
ATOM   660  C  "C4'" . DT  B 2 13 ? 21.908  19.305  107.815 1.00 32.63 ? 33   DT  E "C4'" 1 
ATOM   661  O  "O4'" . DT  B 2 13 ? 22.028  19.227  106.345 1.00 33.05 ? 33   DT  E "O4'" 1 
ATOM   662  C  "C3'" . DT  B 2 13 ? 22.835  18.252  108.380 1.00 33.53 ? 33   DT  E "C3'" 1 
ATOM   663  O  "O3'" . DT  B 2 13 ? 21.969  17.066  108.417 1.00 34.81 ? 33   DT  E "O3'" 1 
ATOM   664  C  "C2'" . DT  B 2 13 ? 23.880  18.153  107.321 1.00 33.23 ? 33   DT  E "C2'" 1 
ATOM   665  C  "C1'" . DT  B 2 13 ? 23.055  18.303  106.013 1.00 35.59 ? 33   DT  E "C1'" 1 
ATOM   666  N  N1    . DT  B 2 13 ? 23.651  19.046  104.804 1.00 35.75 ? 33   DT  E N1    1 
ATOM   667  C  C2    . DT  B 2 13 ? 23.480  18.519  103.573 1.00 34.42 ? 33   DT  E C2    1 
ATOM   668  O  O2    . DT  B 2 13 ? 22.880  17.521  103.360 1.00 34.92 ? 33   DT  E O2    1 
ATOM   669  N  N3    . DT  B 2 13 ? 23.983  19.213  102.558 1.00 32.25 ? 33   DT  E N3    1 
ATOM   670  C  C4    . DT  B 2 13 ? 24.661  20.377  102.598 1.00 29.78 ? 33   DT  E C4    1 
ATOM   671  O  O4    . DT  B 2 13 ? 24.981  20.846  101.537 1.00 35.01 ? 33   DT  E O4    1 
ATOM   672  C  C5    . DT  B 2 13 ? 24.863  20.948  103.868 1.00 30.85 ? 33   DT  E C5    1 
ATOM   673  C  C7    . DT  B 2 13 ? 25.672  22.181  104.081 1.00 22.94 ? 33   DT  E C7    1 
ATOM   674  C  C6    . DT  B 2 13 ? 24.367  20.233  104.921 1.00 36.54 ? 33   DT  E C6    1 
ATOM   675  P  P     . DC  B 2 14 ? 22.348  15.705  109.184 1.00 32.19 ? 34   DC  E P     1 
ATOM   676  O  OP1   . DC  B 2 14 ? 21.029  15.120  109.425 1.00 29.14 ? 34   DC  E OP1   1 
ATOM   677  O  OP2   . DC  B 2 14 ? 23.211  15.932  110.339 1.00 34.37 ? 34   DC  E OP2   1 
ATOM   678  O  "O5'" . DC  B 2 14 ? 23.303  14.921  108.150 1.00 35.77 ? 34   DC  E "O5'" 1 
ATOM   679  C  "C5'" . DC  B 2 14 ? 22.739  14.514  106.850 1.00 39.86 ? 34   DC  E "C5'" 1 
ATOM   680  C  "C4'" . DC  B 2 14 ? 23.836  13.882  105.959 1.00 40.51 ? 34   DC  E "C4'" 1 
ATOM   681  O  "O4'" . DC  B 2 14 ? 24.465  14.989  105.337 1.00 32.59 ? 34   DC  E "O4'" 1 
ATOM   682  C  "C3'" . DC  B 2 14 ? 24.996  13.229  106.697 1.00 41.35 ? 34   DC  E "C3'" 1 
ATOM   683  O  "O3'" . DC  B 2 14 ? 25.432  12.048  106.061 1.00 44.23 ? 34   DC  E "O3'" 1 
ATOM   684  C  "C2'" . DC  B 2 14 ? 26.109  14.260  106.639 1.00 38.32 ? 34   DC  E "C2'" 1 
ATOM   685  C  "C1'" . DC  B 2 14 ? 25.776  14.797  105.279 1.00 34.51 ? 34   DC  E "C1'" 1 
ATOM   686  N  N1    . DC  B 2 14 ? 26.408  16.051  104.917 1.00 36.05 ? 34   DC  E N1    1 
ATOM   687  C  C2    . DC  B 2 14 ? 26.431  16.247  103.544 1.00 36.44 ? 34   DC  E C2    1 
ATOM   688  O  O2    . DC  B 2 14 ? 25.860  15.334  102.910 1.00 38.64 ? 34   DC  E O2    1 
ATOM   689  N  N3    . DC  B 2 14 ? 27.025  17.359  103.008 1.00 36.06 ? 34   DC  E N3    1 
ATOM   690  C  C4    . DC  B 2 14 ? 27.597  18.186  103.904 1.00 35.73 ? 34   DC  E C4    1 
ATOM   691  N  N4    . DC  B 2 14 ? 28.149  19.300  103.475 1.00 36.69 ? 34   DC  E N4    1 
ATOM   692  C  C5    . DC  B 2 14 ? 27.544  18.030  105.329 1.00 32.81 ? 34   DC  E C5    1 
ATOM   693  C  C6    . DC  B 2 14 ? 26.907  16.960  105.820 1.00 28.61 ? 34   DC  E C6    1 
ATOM   694  P  P     . DC  B 2 15 ? 24.914  10.613  106.572 1.00 45.55 ? 35   DC  E P     1 
ATOM   695  O  OP1   . DC  B 2 15 ? 23.443  10.644  106.372 1.00 45.40 ? 35   DC  E OP1   1 
ATOM   696  O  OP2   . DC  B 2 15 ? 25.497  10.139  107.793 1.00 40.21 ? 35   DC  E OP2   1 
ATOM   697  O  "O5'" . DC  B 2 15 ? 25.579  9.717   105.392 1.00 47.87 ? 35   DC  E "O5'" 1 
ATOM   698  C  "C5'" . DC  B 2 15 ? 26.921  9.934   104.909 1.00 46.51 ? 35   DC  E "C5'" 1 
ATOM   699  C  "C4'" . DC  B 2 15 ? 26.970  10.168  103.400 1.00 45.12 ? 35   DC  E "C4'" 1 
ATOM   700  O  "O4'" . DC  B 2 15 ? 26.749  11.562  103.088 1.00 42.45 ? 35   DC  E "O4'" 1 
ATOM   701  C  "C3'" . DC  B 2 15 ? 28.288  9.808   102.699 1.00 46.09 ? 35   DC  E "C3'" 1 
ATOM   702  O  "O3'" . DC  B 2 15 ? 28.265  8.444   102.348 1.00 45.40 ? 35   DC  E "O3'" 1 
ATOM   703  C  "C2'" . DC  B 2 15 ? 28.253  10.695  101.462 1.00 44.33 ? 35   DC  E "C2'" 1 
ATOM   704  C  "C1'" . DC  B 2 15 ? 27.564  11.933  102.004 1.00 41.10 ? 35   DC  E "C1'" 1 
ATOM   705  N  N1    . DC  B 2 15 ? 28.368  13.091  102.531 1.00 42.16 ? 35   DC  E N1    1 
ATOM   706  C  C2    . DC  B 2 15 ? 28.857  14.007  101.586 1.00 40.35 ? 35   DC  E C2    1 
ATOM   707  O  O2    . DC  B 2 15 ? 28.710  13.780  100.351 1.00 44.41 ? 35   DC  E O2    1 
ATOM   708  N  N3    . DC  B 2 15 ? 29.496  15.105  102.014 1.00 37.52 ? 35   DC  E N3    1 
ATOM   709  C  C4    . DC  B 2 15 ? 29.710  15.329  103.328 1.00 40.62 ? 35   DC  E C4    1 
ATOM   710  N  N4    . DC  B 2 15 ? 30.405  16.472  103.651 1.00 39.07 ? 35   DC  E N4    1 
ATOM   711  C  C5    . DC  B 2 15 ? 29.192  14.421  104.328 1.00 40.27 ? 35   DC  E C5    1 
ATOM   712  C  C6    . DC  B 2 15 ? 28.542  13.319  103.894 1.00 42.58 ? 35   DC  E C6    1 
ATOM   713  P  P     . DT  B 2 16 ? 29.587  7.628   101.983 1.00 49.78 ? 36   DT  E P     1 
ATOM   714  O  OP1   . DT  B 2 16 ? 29.035  6.296   101.636 1.00 49.06 ? 36   DT  E OP1   1 
ATOM   715  O  OP2   . DT  B 2 16 ? 30.758  7.845   102.845 1.00 45.56 ? 36   DT  E OP2   1 
ATOM   716  O  "O5'" . DT  B 2 16 ? 30.040  8.372   100.671 1.00 49.00 ? 36   DT  E "O5'" 1 
ATOM   717  C  "C5'" . DT  B 2 16 ? 29.312  8.105   99.541  1.00 47.98 ? 36   DT  E "C5'" 1 
ATOM   718  C  "C4'" . DT  B 2 16 ? 30.098  8.814   98.467  1.00 47.99 ? 36   DT  E "C4'" 1 
ATOM   719  O  "O4'" . DT  B 2 16 ? 30.172  10.204  98.807  1.00 44.29 ? 36   DT  E "O4'" 1 
ATOM   720  C  "C3'" . DT  B 2 16 ? 31.546  8.320   98.260  1.00 47.22 ? 36   DT  E "C3'" 1 
ATOM   721  O  "O3'" . DT  B 2 16 ? 31.718  8.387   96.854  1.00 46.95 ? 36   DT  E "O3'" 1 
ATOM   722  C  "C2'" . DT  B 2 16 ? 32.406  9.385   98.873  1.00 44.98 ? 36   DT  E "C2'" 1 
ATOM   723  C  "C1'" . DT  B 2 16 ? 31.483  10.616  98.788  1.00 42.73 ? 36   DT  E "C1'" 1 
ATOM   724  N  N1    . DT  B 2 16 ? 31.753  11.519  99.861  1.00 41.84 ? 36   DT  E N1    1 
ATOM   725  C  C2    . DT  B 2 16 ? 32.208  12.776  99.497  1.00 41.77 ? 36   DT  E C2    1 
ATOM   726  O  O2    . DT  B 2 16 ? 32.321  13.117  98.381  1.00 39.44 ? 36   DT  E O2    1 
ATOM   727  N  N3    . DT  B 2 16 ? 32.552  13.664  100.471 1.00 42.14 ? 36   DT  E N3    1 
ATOM   728  C  C4    . DT  B 2 16 ? 32.542  13.366  101.827 1.00 42.66 ? 36   DT  E C4    1 
ATOM   729  O  O4    . DT  B 2 16 ? 32.892  14.252  102.618 1.00 43.76 ? 36   DT  E O4    1 
ATOM   730  C  C5    . DT  B 2 16 ? 32.097  12.007  102.193 1.00 40.18 ? 36   DT  E C5    1 
ATOM   731  C  C7    . DT  B 2 16 ? 31.991  11.592  103.621 1.00 34.58 ? 36   DT  E C7    1 
ATOM   732  C  C6    . DT  B 2 16 ? 31.738  11.134  101.197 1.00 43.14 ? 36   DT  E C6    1 
ATOM   733  P  P     . DC  B 2 17 ? 32.793  7.532   96.097  1.00 46.60 ? 37   DC  E P     1 
ATOM   734  O  OP1   . DC  B 2 17 ? 32.199  7.506   94.721  1.00 47.50 ? 37   DC  E OP1   1 
ATOM   735  O  OP2   . DC  B 2 17 ? 33.220  6.317   96.846  1.00 39.33 ? 37   DC  E OP2   1 
ATOM   736  O  "O5'" . DC  B 2 17 ? 34.001  8.569   96.135  1.00 43.63 ? 37   DC  E "O5'" 1 
ATOM   737  C  "C5'" . DC  B 2 17 ? 33.849  9.808   95.454  1.00 39.55 ? 37   DC  E "C5'" 1 
ATOM   738  C  "C4'" . DC  B 2 17 ? 35.013  10.718  95.753  1.00 36.57 ? 37   DC  E "C4'" 1 
ATOM   739  O  "O4'" . DC  B 2 17 ? 34.981  11.019  97.149  1.00 36.23 ? 37   DC  E "O4'" 1 
ATOM   740  C  "C3'" . DC  B 2 17 ? 36.385  10.064  95.559  1.00 37.44 ? 37   DC  E "C3'" 1 
ATOM   741  O  "O3'" . DC  B 2 17 ? 37.282  11.014  94.954  1.00 38.27 ? 37   DC  E "O3'" 1 
ATOM   742  C  "C2'" . DC  B 2 17 ? 36.792  9.620   96.973  1.00 35.31 ? 37   DC  E "C2'" 1 
ATOM   743  C  "C1'" . DC  B 2 17 ? 36.291  10.902  97.630  1.00 35.05 ? 37   DC  E "C1'" 1 
ATOM   744  N  N1    . DC  B 2 17 ? 36.017  11.026  99.044  1.00 35.93 ? 37   DC  E N1    1 
ATOM   745  C  C2    . DC  B 2 17 ? 36.244  12.287  99.569  1.00 37.81 ? 37   DC  E C2    1 
ATOM   746  O  O2    . DC  B 2 17 ? 36.712  13.088  98.770  1.00 40.47 ? 37   DC  E O2    1 
ATOM   747  N  N3    . DC  B 2 17 ? 35.997  12.591  100.852 1.00 36.99 ? 37   DC  E N3    1 
ATOM   748  C  C4    . DC  B 2 17 ? 35.554  11.645  101.674 1.00 39.99 ? 37   DC  E C4    1 
ATOM   749  N  N4    . DC  B 2 17 ? 35.312  11.913  102.997 1.00 38.76 ? 37   DC  E N4    1 
ATOM   750  C  C5    . DC  B 2 17 ? 35.281  10.352  101.132 1.00 40.03 ? 37   DC  E C5    1 
ATOM   751  C  C6    . DC  B 2 17 ? 35.537  10.064  99.841  1.00 36.36 ? 37   DC  E C6    1 
ATOM   752  P  P     . DC  B 2 18 ? 38.122  10.629  93.628  1.00 40.56 ? 38   DC  E P     1 
ATOM   753  O  OP1   . DC  B 2 18 ? 37.059  10.106  92.753  1.00 44.77 ? 38   DC  E OP1   1 
ATOM   754  O  OP2   . DC  B 2 18 ? 39.322  9.862   93.994  1.00 41.93 ? 38   DC  E OP2   1 
ATOM   755  O  "O5'" . DC  B 2 18 ? 38.591  12.056  93.028  1.00 38.62 ? 38   DC  E "O5'" 1 
ATOM   756  C  "C5'" . DC  B 2 18 ? 37.626  13.126  92.793  1.00 30.91 ? 38   DC  E "C5'" 1 
ATOM   757  C  "C4'" . DC  B 2 18 ? 38.318  14.367  93.348  1.00 34.77 ? 38   DC  E "C4'" 1 
ATOM   758  O  "O4'" . DC  B 2 18 ? 38.373  14.367  94.813  1.00 33.28 ? 38   DC  E "O4'" 1 
ATOM   759  C  "C3'" . DC  B 2 18 ? 39.756  14.507  92.894  1.00 37.66 ? 38   DC  E "C3'" 1 
ATOM   760  O  "O3'" . DC  B 2 18 ? 39.868  15.754  92.241  1.00 42.42 ? 38   DC  E "O3'" 1 
ATOM   761  C  "C2'" . DC  B 2 18 ? 40.654  14.355  94.127  1.00 32.74 ? 38   DC  E "C2'" 1 
ATOM   762  C  "C1'" . DC  B 2 18 ? 39.674  14.586  95.261  1.00 36.43 ? 38   DC  E "C1'" 1 
ATOM   763  N  N1    . DC  B 2 18 ? 39.738  13.726  96.502  1.00 36.50 ? 38   DC  E N1    1 
ATOM   764  C  C2    . DC  B 2 18 ? 39.770  14.421  97.705  1.00 36.25 ? 38   DC  E C2    1 
ATOM   765  O  O2    . DC  B 2 18 ? 39.741  15.635  97.567  1.00 38.04 ? 38   DC  E O2    1 
ATOM   766  N  N3    . DC  B 2 18 ? 39.797  13.793  98.933  1.00 38.57 ? 38   DC  E N3    1 
ATOM   767  C  C4    . DC  B 2 18 ? 39.834  12.435  98.913  1.00 40.26 ? 38   DC  E C4    1 
ATOM   768  N  N4    . DC  B 2 18 ? 39.874  11.803  100.089 1.00 38.15 ? 38   DC  E N4    1 
ATOM   769  C  C5    . DC  B 2 18 ? 39.849  11.664  97.683  1.00 37.61 ? 38   DC  E C5    1 
ATOM   770  C  C6    . DC  B 2 18 ? 39.785  12.348  96.519  1.00 37.66 ? 38   DC  E C6    1 
ATOM   771  P  P     . DG  B 2 19 ? 41.272  16.121  91.587  1.00 48.53 ? 39   DG  E P     1 
ATOM   772  O  OP1   . DG  B 2 19 ? 40.992  17.364  90.869  1.00 48.63 ? 39   DG  E OP1   1 
ATOM   773  O  OP2   . DG  B 2 19 ? 42.049  14.970  91.053  1.00 47.02 ? 39   DG  E OP2   1 
ATOM   774  O  "O5'" . DG  B 2 19 ? 42.068  16.477  92.911  1.00 50.94 ? 39   DG  E "O5'" 1 
ATOM   775  C  "C5'" . DG  B 2 19 ? 42.161  17.804  93.413  1.00 52.69 ? 39   DG  E "C5'" 1 
ATOM   776  C  "C4'" . DG  B 2 19 ? 43.430  17.880  94.272  1.00 50.77 ? 39   DG  E "C4'" 1 
ATOM   777  O  "O4'" . DG  B 2 19 ? 43.245  16.938  95.379  1.00 48.05 ? 39   DG  E "O4'" 1 
ATOM   778  C  "C3'" . DG  B 2 19 ? 44.728  17.536  93.523  1.00 50.61 ? 39   DG  E "C3'" 1 
ATOM   779  O  "O3'" . DG  B 2 19 ? 45.762  18.682  93.366  1.00 55.35 ? 39   DG  E "O3'" 1 
ATOM   780  C  "C2'" . DG  B 2 19 ? 45.120  16.156  94.127  1.00 45.44 ? 39   DG  E "C2'" 1 
ATOM   781  C  "C1'" . DG  B 2 19 ? 44.420  16.108  95.505  1.00 44.91 ? 39   DG  E "C1'" 1 
ATOM   782  N  N9    . DG  B 2 19 ? 44.017  14.792  96.140  1.00 44.85 ? 39   DG  E N9    1 
ATOM   783  C  C8    . DG  B 2 19 ? 43.778  13.551  95.520  1.00 42.38 ? 39   DG  E C8    1 
ATOM   784  N  N7    . DG  B 2 19 ? 43.383  12.590  96.333  1.00 41.12 ? 39   DG  E N7    1 
ATOM   785  C  C5    . DG  B 2 19 ? 43.356  13.210  97.603  1.00 42.85 ? 39   DG  E C5    1 
ATOM   786  C  C6    . DG  B 2 19 ? 43.057  12.666  98.897  1.00 43.60 ? 39   DG  E C6    1 
ATOM   787  O  O6    . DG  B 2 19 ? 42.697  11.537  99.282  1.00 43.08 ? 39   DG  E O6    1 
ATOM   788  N  N1    . DG  B 2 19 ? 43.147  13.627  99.869  1.00 42.72 ? 39   DG  E N1    1 
ATOM   789  C  C2    . DG  B 2 19 ? 43.510  14.925  99.662  1.00 41.29 ? 39   DG  E C2    1 
ATOM   790  N  N2    . DG  B 2 19 ? 43.515  15.594  100.818 1.00 41.94 ? 39   DG  E N2    1 
ATOM   791  N  N3    . DG  B 2 19 ? 43.810  15.487  98.498  1.00 39.15 ? 39   DG  E N3    1 
ATOM   792  C  C4    . DG  B 2 19 ? 43.725  14.564  97.504  1.00 42.73 ? 39   DG  E C4    1 
ATOM   793  P  P     . DG  B 2 20 ? 46.516  19.638  94.477  1.00 58.35 ? 40   DG  E P     1 
ATOM   794  O  OP1   . DG  B 2 20 ? 45.696  20.841  94.629  1.00 58.24 ? 40   DG  E OP1   1 
ATOM   795  O  OP2   . DG  B 2 20 ? 47.948  19.824  94.195  1.00 54.86 ? 40   DG  E OP2   1 
ATOM   796  O  "O5'" . DG  B 2 20 ? 46.418  18.861  95.861  1.00 58.74 ? 40   DG  E "O5'" 1 
ATOM   797  C  "C5'" . DG  B 2 20 ? 45.655  19.417  96.969  1.00 59.87 ? 40   DG  E "C5'" 1 
ATOM   798  C  "C4'" . DG  B 2 20 ? 46.541  20.008  98.065  1.00 57.77 ? 40   DG  E "C4'" 1 
ATOM   799  O  "O4'" . DG  B 2 20 ? 46.846  18.963  99.018  1.00 56.65 ? 40   DG  E "O4'" 1 
ATOM   800  C  "C3'" . DG  B 2 20 ? 47.918  20.502  97.620  1.00 56.75 ? 40   DG  E "C3'" 1 
ATOM   801  O  "O3'" . DG  B 2 20 ? 48.505  21.221  98.675  1.00 55.46 ? 40   DG  E "O3'" 1 
ATOM   802  C  "C2'" . DG  B 2 20 ? 48.666  19.192  97.430  1.00 56.57 ? 40   DG  E "C2'" 1 
ATOM   803  C  "C1'" . DG  B 2 20 ? 47.978  18.299  98.484  1.00 55.36 ? 40   DG  E "C1'" 1 
ATOM   804  N  N9    . DG  B 2 20 ? 47.674  16.927  98.013  1.00 55.73 ? 40   DG  E N9    1 
ATOM   805  C  C8    . DG  B 2 20 ? 47.771  16.341  96.732  1.00 55.25 ? 40   DG  E C8    1 
ATOM   806  N  N7    . DG  B 2 20 ? 47.467  15.052  96.695  1.00 54.03 ? 40   DG  E N7    1 
ATOM   807  C  C5    . DG  B 2 20 ? 47.162  14.781  98.037  1.00 54.54 ? 40   DG  E C5    1 
ATOM   808  C  C6    . DG  B 2 20 ? 46.777  13.572  98.644  1.00 54.76 ? 40   DG  E C6    1 
ATOM   809  O  O6    . DG  B 2 20 ? 46.634  12.488  98.038  1.00 56.02 ? 40   DG  E O6    1 
ATOM   810  N  N1    . DG  B 2 20 ? 46.602  13.726  100.035 1.00 53.40 ? 40   DG  E N1    1 
ATOM   811  C  C2    . DG  B 2 20 ? 46.779  14.915  100.749 1.00 53.27 ? 40   DG  E C2    1 
ATOM   812  N  N2    . DG  B 2 20 ? 46.589  14.948  102.092 1.00 54.01 ? 40   DG  E N2    1 
ATOM   813  N  N3    . DG  B 2 20 ? 47.116  16.055  100.182 1.00 51.72 ? 40   DG  E N3    1 
ATOM   814  C  C4    . DG  B 2 20 ? 47.295  15.904  98.850  1.00 53.88 ? 40   DG  E C4    1 
ATOM   815  N  N     . GLU C 3 1  ? 26.631  3.531   95.847  1.00 60.37 ? 8    GLU A N     1 
ATOM   816  C  CA    . GLU C 3 1  ? 26.245  4.795   96.532  1.00 60.12 ? 8    GLU A CA    1 
ATOM   817  C  C     . GLU C 3 1  ? 26.782  4.838   97.971  1.00 59.44 ? 8    GLU A C     1 
ATOM   818  O  O     . GLU C 3 1  ? 27.588  5.712   98.303  1.00 59.54 ? 8    GLU A O     1 
ATOM   819  C  CB    . GLU C 3 1  ? 24.741  5.034   96.484  1.00 59.90 ? 8    GLU A CB    1 
ATOM   820  C  CG    . GLU C 3 1  ? 24.345  6.546   96.384  1.00 62.63 ? 8    GLU A CG    1 
ATOM   821  C  CD    . GLU C 3 1  ? 25.482  7.546   96.748  1.00 63.58 ? 8    GLU A CD    1 
ATOM   822  O  OE1   . GLU C 3 1  ? 25.295  8.367   97.688  1.00 64.76 ? 8    GLU A OE1   1 
ATOM   823  O  OE2   . GLU C 3 1  ? 26.545  7.522   96.092  1.00 58.35 ? 8    GLU A OE2   1 
ATOM   824  N  N     . GLN C 3 2  ? 26.351  3.908   98.819  1.00 58.24 ? 9    GLN A N     1 
ATOM   825  C  CA    . GLN C 3 2  ? 27.050  3.707   100.075 1.00 57.13 ? 9    GLN A CA    1 
ATOM   826  C  C     . GLN C 3 2  ? 28.436  3.207   99.738  1.00 55.38 ? 9    GLN A C     1 
ATOM   827  O  O     . GLN C 3 2  ? 28.615  2.338   98.870  1.00 55.77 ? 9    GLN A O     1 
ATOM   828  C  CB    . GLN C 3 2  ? 26.346  2.674   100.922 1.00 58.31 ? 9    GLN A CB    1 
ATOM   829  C  CG    . GLN C 3 2  ? 25.975  3.157   102.306 1.00 62.11 ? 9    GLN A CG    1 
ATOM   830  C  CD    . GLN C 3 2  ? 26.556  2.274   103.394 1.00 66.16 ? 9    GLN A CD    1 
ATOM   831  O  OE1   . GLN C 3 2  ? 27.759  1.995   103.402 1.00 66.20 ? 9    GLN A OE1   1 
ATOM   832  N  NE2   . GLN C 3 2  ? 25.709  1.851   104.336 1.00 67.07 ? 9    GLN A NE2   1 
ATOM   833  N  N     . ALA C 3 3  ? 29.422  3.794   100.396 1.00 53.09 ? 10   ALA A N     1 
ATOM   834  C  CA    . ALA C 3 3  ? 30.808  3.391   100.292 1.00 49.99 ? 10   ALA A CA    1 
ATOM   835  C  C     . ALA C 3 3  ? 31.078  2.445   101.445 1.00 49.54 ? 10   ALA A C     1 
ATOM   836  O  O     . ALA C 3 3  ? 30.278  2.372   102.360 1.00 49.50 ? 10   ALA A O     1 
ATOM   837  C  CB    . ALA C 3 3  ? 31.703  4.601   100.370 1.00 48.62 ? 10   ALA A CB    1 
ATOM   838  N  N     . CYS C 3 4  ? 32.208  1.745   101.430 1.00 49.69 ? 11   CYS A N     1 
ATOM   839  C  CA    . CYS C 3 4  ? 32.467  0.671   102.402 1.00 51.00 ? 11   CYS A CA    1 
ATOM   840  C  C     . CYS C 3 4  ? 33.151  1.241   103.637 1.00 50.94 ? 11   CYS A C     1 
ATOM   841  O  O     . CYS C 3 4  ? 33.907  2.215   103.507 1.00 50.42 ? 11   CYS A O     1 
ATOM   842  C  CB    . CYS C 3 4  ? 33.298  -0.489  101.784 1.00 50.58 ? 11   CYS A CB    1 
ATOM   843  S  SG    . CYS C 3 4  ? 35.139  -0.286  101.884 1.00 53.01 ? 11   CYS A SG    1 
ATOM   844  N  N     . ASP C 3 5  ? 32.899  0.618   104.800 1.00 51.15 ? 12   ASP A N     1 
ATOM   845  C  CA    . ASP C 3 5  ? 33.393  1.074   106.115 1.00 51.99 ? 12   ASP A CA    1 
ATOM   846  C  C     . ASP C 3 5  ? 34.797  1.690   105.993 1.00 52.47 ? 12   ASP A C     1 
ATOM   847  O  O     . ASP C 3 5  ? 35.099  2.844   106.402 1.00 52.41 ? 12   ASP A O     1 
ATOM   848  C  CB    . ASP C 3 5  ? 33.419  -0.122  107.090 1.00 52.17 ? 12   ASP A CB    1 
ATOM   849  C  CG    . ASP C 3 5  ? 31.997  -0.512  107.695 1.00 54.35 ? 12   ASP A CG    1 
ATOM   850  O  OD1   . ASP C 3 5  ? 30.918  0.146   107.473 1.00 50.24 ? 12   ASP A OD1   1 
ATOM   851  O  OD2   . ASP C 3 5  ? 31.997  -1.537  108.440 1.00 57.10 ? 12   ASP A OD2   1 
ATOM   852  N  N     . ILE C 3 6  ? 35.651  0.885   105.375 1.00 53.26 ? 13   ILE A N     1 
ATOM   853  C  CA    . ILE C 3 6  ? 37.046  1.177   105.194 1.00 53.37 ? 13   ILE A CA    1 
ATOM   854  C  C     . ILE C 3 6  ? 37.267  2.294   104.171 1.00 52.17 ? 13   ILE A C     1 
ATOM   855  O  O     . ILE C 3 6  ? 37.803  3.352   104.536 1.00 51.71 ? 13   ILE A O     1 
ATOM   856  C  CB    . ILE C 3 6  ? 37.718  -0.122  104.777 1.00 55.33 ? 13   ILE A CB    1 
ATOM   857  C  CG1   . ILE C 3 6  ? 37.348  -1.283  105.774 1.00 58.61 ? 13   ILE A CG1   1 
ATOM   858  C  CG2   . ILE C 3 6  ? 39.246  0.066   104.441 1.00 55.71 ? 13   ILE A CG2   1 
ATOM   859  C  CD1   . ILE C 3 6  ? 37.935  -1.183  107.239 1.00 64.16 ? 13   ILE A CD1   1 
ATOM   860  N  N     . CYS C 3 7  ? 36.857  2.103   102.908 1.00 50.85 ? 14   CYS A N     1 
ATOM   861  C  CA    . CYS C 3 7  ? 36.987  3.220   101.968 1.00 49.90 ? 14   CYS A CA    1 
ATOM   862  C  C     . CYS C 3 7  ? 36.457  4.475   102.687 1.00 50.84 ? 14   CYS A C     1 
ATOM   863  O  O     . CYS C 3 7  ? 36.991  5.557   102.510 1.00 50.83 ? 14   CYS A O     1 
ATOM   864  C  CB    . CYS C 3 7  ? 36.256  3.034   100.612 1.00 49.73 ? 14   CYS A CB    1 
ATOM   865  S  SG    . CYS C 3 7  ? 36.656  1.568   99.518  1.00 41.27 ? 14   CYS A SG    1 
ATOM   866  N  N     . ARG C 3 8  ? 35.416  4.305   103.514 1.00 52.19 ? 15   ARG A N     1 
ATOM   867  C  CA    . ARG C 3 8  ? 34.792  5.386   104.304 1.00 52.55 ? 15   ARG A CA    1 
ATOM   868  C  C     . ARG C 3 8  ? 35.867  5.995   105.254 1.00 53.10 ? 15   ARG A C     1 
ATOM   869  O  O     . ARG C 3 8  ? 36.121  7.205   105.190 1.00 52.91 ? 15   ARG A O     1 
ATOM   870  C  CB    . ARG C 3 8  ? 33.547  4.847   105.049 1.00 52.44 ? 15   ARG A CB    1 
ATOM   871  C  CG    . ARG C 3 8  ? 32.632  5.839   105.789 1.00 53.45 ? 15   ARG A CG    1 
ATOM   872  C  CD    . ARG C 3 8  ? 31.236  5.943   105.137 1.00 61.36 ? 15   ARG A CD    1 
ATOM   873  N  NE    . ARG C 3 8  ? 30.136  5.235   105.814 1.00 64.55 ? 15   ARG A NE    1 
ATOM   874  C  CZ    . ARG C 3 8  ? 28.901  5.070   105.315 1.00 66.79 ? 15   ARG A CZ    1 
ATOM   875  N  NH1   . ARG C 3 8  ? 28.586  5.530   104.104 1.00 68.79 ? 15   ARG A NH1   1 
ATOM   876  N  NH2   . ARG C 3 8  ? 27.971  4.422   106.019 1.00 66.67 ? 15   ARG A NH2   1 
ATOM   877  N  N     . LEU C 3 9  ? 36.537  5.177   106.071 1.00 53.17 ? 16   LEU A N     1 
ATOM   878  C  CA    . LEU C 3 9  ? 37.530  5.719   106.950 1.00 54.66 ? 16   LEU A CA    1 
ATOM   879  C  C     . LEU C 3 9  ? 38.786  6.176   106.240 1.00 54.77 ? 16   LEU A C     1 
ATOM   880  O  O     . LEU C 3 9  ? 39.460  7.117   106.675 1.00 54.77 ? 16   LEU A O     1 
ATOM   881  C  CB    . LEU C 3 9  ? 37.935  4.658   107.882 1.00 56.45 ? 16   LEU A CB    1 
ATOM   882  C  CG    . LEU C 3 9  ? 37.695  4.825   109.353 1.00 61.60 ? 16   LEU A CG    1 
ATOM   883  C  CD1   . LEU C 3 9  ? 36.434  4.007   109.728 1.00 63.44 ? 16   LEU A CD1   1 
ATOM   884  C  CD2   . LEU C 3 9  ? 39.048  4.173   109.894 1.00 64.42 ? 16   LEU A CD2   1 
ATOM   885  N  N     . LYS C 3 10 ? 39.127  5.514   105.145 1.00 54.16 ? 17   LYS A N     1 
ATOM   886  C  CA    . LYS C 3 10 ? 40.313  5.916   104.458 1.00 53.99 ? 17   LYS A CA    1 
ATOM   887  C  C     . LYS C 3 10 ? 40.034  7.021   103.472 1.00 53.43 ? 17   LYS A C     1 
ATOM   888  O  O     . LYS C 3 10 ? 40.936  7.704   102.978 1.00 53.79 ? 17   LYS A O     1 
ATOM   889  C  CB    . LYS C 3 10 ? 40.958  4.723   103.829 1.00 54.81 ? 17   LYS A CB    1 
ATOM   890  C  CG    . LYS C 3 10 ? 41.342  3.668   104.922 1.00 57.48 ? 17   LYS A CG    1 
ATOM   891  C  CD    . LYS C 3 10 ? 42.540  2.740   104.537 1.00 60.97 ? 17   LYS A CD    1 
ATOM   892  C  CE    . LYS C 3 10 ? 43.097  1.902   105.736 1.00 59.72 ? 17   LYS A CE    1 
ATOM   893  N  NZ    . LYS C 3 10 ? 43.767  2.788   106.748 1.00 63.86 ? 17   LYS A NZ    1 
ATOM   894  N  N     . LYS C 3 11 ? 38.763  7.225   103.195 1.00 52.55 ? 18   LYS A N     1 
ATOM   895  C  CA    . LYS C 3 11 ? 38.382  8.266   102.280 1.00 51.33 ? 18   LYS A CA    1 
ATOM   896  C  C     . LYS C 3 11 ? 38.841  8.121   100.811 1.00 50.82 ? 18   LYS A C     1 
ATOM   897  O  O     . LYS C 3 11 ? 39.113  9.137   100.149 1.00 49.91 ? 18   LYS A O     1 
ATOM   898  C  CB    . LYS C 3 11 ? 38.864  9.601   102.840 1.00 51.95 ? 18   LYS A CB    1 
ATOM   899  C  CG    . LYS C 3 11 ? 37.957  10.172  103.970 1.00 51.22 ? 18   LYS A CG    1 
ATOM   900  C  CD    . LYS C 3 11 ? 38.456  11.533  104.398 1.00 49.34 ? 18   LYS A CD    1 
ATOM   901  C  CE    . LYS C 3 11 ? 37.938  11.981  105.766 1.00 48.06 ? 18   LYS A CE    1 
ATOM   902  N  NZ    . LYS C 3 11 ? 37.900  13.500  105.583 1.00 48.60 ? 18   LYS A NZ    1 
ATOM   903  N  N     . LEU C 3 12 ? 38.877  6.906   100.273 1.00 50.31 ? 19   LEU A N     1 
ATOM   904  C  CA    . LEU C 3 12 ? 39.247  6.744   98.849  1.00 51.74 ? 19   LEU A CA    1 
ATOM   905  C  C     . LEU C 3 12 ? 37.996  6.385   98.167  1.00 52.50 ? 19   LEU A C     1 
ATOM   906  O  O     . LEU C 3 12 ? 37.005  6.181   98.836  1.00 53.23 ? 19   LEU A O     1 
ATOM   907  C  CB    . LEU C 3 12 ? 40.202  5.607   98.624  1.00 51.41 ? 19   LEU A CB    1 
ATOM   908  C  CG    . LEU C 3 12 ? 41.024  5.491   99.893  1.00 50.03 ? 19   LEU A CG    1 
ATOM   909  C  CD1   . LEU C 3 12 ? 41.250  4.086   100.100 1.00 46.53 ? 19   LEU A CD1   1 
ATOM   910  C  CD2   . LEU C 3 12 ? 42.276  6.282   99.752  1.00 50.71 ? 19   LEU A CD2   1 
ATOM   911  N  N     . LYS C 3 13 ? 38.040  6.325   96.839  1.00 52.35 ? 20   LYS A N     1 
ATOM   912  C  CA    . LYS C 3 13 ? 36.852  6.095   96.044  1.00 51.37 ? 20   LYS A CA    1 
ATOM   913  C  C     . LYS C 3 13 ? 36.493  4.665   96.312  1.00 50.60 ? 20   LYS A C     1 
ATOM   914  O  O     . LYS C 3 13 ? 37.379  3.862   96.394  1.00 50.76 ? 20   LYS A O     1 
ATOM   915  C  CB    . LYS C 3 13 ? 37.219  6.276   94.578  1.00 50.94 ? 20   LYS A CB    1 
ATOM   916  C  CG    . LYS C 3 13 ? 36.082  6.140   93.632  1.00 51.80 ? 20   LYS A CG    1 
ATOM   917  C  CD    . LYS C 3 13 ? 36.171  7.180   92.513  1.00 53.66 ? 20   LYS A CD    1 
ATOM   918  C  CE    . LYS C 3 13 ? 35.289  6.814   91.334  1.00 52.33 ? 20   LYS A CE    1 
ATOM   919  N  NZ    . LYS C 3 13 ? 36.001  5.616   90.725  1.00 52.52 ? 20   LYS A NZ    1 
ATOM   920  N  N     . CYS C 3 14 ? 35.224  4.334   96.497  1.00 50.03 ? 21   CYS A N     1 
ATOM   921  C  CA    . CYS C 3 14 ? 34.874  2.940   96.677  1.00 51.48 ? 21   CYS A CA    1 
ATOM   922  C  C     . CYS C 3 14 ? 34.370  2.335   95.359  1.00 53.85 ? 21   CYS A C     1 
ATOM   923  O  O     . CYS C 3 14 ? 33.618  3.016   94.653  1.00 52.78 ? 21   CYS A O     1 
ATOM   924  C  CB    . CYS C 3 14 ? 33.813  2.765   97.715  1.00 50.15 ? 21   CYS A CB    1 
ATOM   925  S  SG    . CYS C 3 14 ? 33.890  1.173   98.401  1.00 48.53 ? 21   CYS A SG    1 
ATOM   926  N  N     . SER C 3 15 ? 34.789  1.091   95.025  1.00 56.50 ? 22   SER A N     1 
ATOM   927  C  CA    . SER C 3 15 ? 34.253  0.431   93.822  1.00 60.14 ? 22   SER A CA    1 
ATOM   928  C  C     . SER C 3 15 ? 32.789  0.061   94.096  1.00 62.84 ? 22   SER A C     1 
ATOM   929  O  O     . SER C 3 15 ? 31.942  0.111   93.180  1.00 63.49 ? 22   SER A O     1 
ATOM   930  C  CB    . SER C 3 15 ? 35.063  -0.791  93.397  1.00 59.79 ? 22   SER A CB    1 
ATOM   931  O  OG    . SER C 3 15 ? 34.601  -1.995  93.985  1.00 59.82 ? 22   SER A OG    1 
ATOM   932  N  N     . LYS C 3 16 ? 32.513  -0.268  95.373  1.00 65.50 ? 23   LYS A N     1 
ATOM   933  C  CA    . LYS C 3 16 ? 31.156  -0.555  95.936  1.00 67.79 ? 23   LYS A CA    1 
ATOM   934  C  C     . LYS C 3 16 ? 30.586  -1.989  95.695  1.00 69.32 ? 23   LYS A C     1 
ATOM   935  O  O     . LYS C 3 16 ? 29.522  -2.349  96.259  1.00 69.65 ? 23   LYS A O     1 
ATOM   936  C  CB    . LYS C 3 16 ? 30.130  0.548   95.586  1.00 67.65 ? 23   LYS A CB    1 
ATOM   937  C  CG    . LYS C 3 16 ? 30.503  1.913   96.129  1.00 67.63 ? 23   LYS A CG    1 
ATOM   938  C  CD    . LYS C 3 16 ? 29.800  3.021   95.393  1.00 67.28 ? 23   LYS A CD    1 
ATOM   939  C  CE    . LYS C 3 16 ? 30.632  4.289   95.465  1.00 67.37 ? 23   LYS A CE    1 
ATOM   940  N  NZ    . LYS C 3 16 ? 29.718  5.444   95.281  1.00 69.30 ? 23   LYS A NZ    1 
ATOM   941  N  N     . GLU C 3 17 ? 31.318  -2.800  94.913  1.00 70.77 ? 24   GLU A N     1 
ATOM   942  C  CA    . GLU C 3 17 ? 30.875  -4.155  94.558  1.00 72.41 ? 24   GLU A CA    1 
ATOM   943  C  C     . GLU C 3 17 ? 30.633  -4.971  95.840  1.00 73.41 ? 24   GLU A C     1 
ATOM   944  O  O     . GLU C 3 17 ? 31.312  -4.765  96.861  1.00 73.87 ? 24   GLU A O     1 
ATOM   945  C  CB    . GLU C 3 17 ? 31.808  -4.847  93.502  1.00 72.35 ? 24   GLU A CB    1 
ATOM   946  C  CG    . GLU C 3 17 ? 33.271  -5.184  93.922  1.00 72.64 ? 24   GLU A CG    1 
ATOM   947  C  CD    . GLU C 3 17 ? 34.346  -4.990  92.808  1.00 72.19 ? 24   GLU A CD    1 
ATOM   948  O  OE1   . GLU C 3 17 ? 34.036  -4.442  91.729  1.00 72.08 ? 24   GLU A OE1   1 
ATOM   949  O  OE2   . GLU C 3 17 ? 35.525  -5.368  93.027  1.00 71.26 ? 24   GLU A OE2   1 
ATOM   950  N  N     . LYS C 3 18 ? 29.620  -5.834  95.805  1.00 74.21 ? 25   LYS A N     1 
ATOM   951  C  CA    . LYS C 3 18 ? 29.266  -6.653  96.960  1.00 74.87 ? 25   LYS A CA    1 
ATOM   952  C  C     . LYS C 3 18 ? 29.579  -8.123  96.612  1.00 75.08 ? 25   LYS A C     1 
ATOM   953  O  O     . LYS C 3 18 ? 29.473  -8.499  95.443  1.00 75.04 ? 25   LYS A O     1 
ATOM   954  C  CB    . LYS C 3 18 ? 27.800  -6.371  97.402  1.00 75.08 ? 25   LYS A CB    1 
ATOM   955  C  CG    . LYS C 3 18 ? 27.570  -4.899  97.953  1.00 75.17 ? 25   LYS A CG    1 
ATOM   956  C  CD    . LYS C 3 18 ? 26.438  -4.732  99.013  1.00 74.88 ? 25   LYS A CD    1 
ATOM   957  C  CE    . LYS C 3 18 ? 25.080  -4.188  98.461  1.00 74.14 ? 25   LYS A CE    1 
ATOM   958  N  NZ    . LYS C 3 18 ? 24.080  -5.255  98.136  1.00 71.46 ? 25   LYS A NZ    1 
ATOM   959  N  N     . PRO C 3 19 ? 30.025  -8.946  97.598  1.00 75.51 ? 26   PRO A N     1 
ATOM   960  C  CA    . PRO C 3 19 ? 30.193  -8.717  99.054  1.00 75.85 ? 26   PRO A CA    1 
ATOM   961  C  C     . PRO C 3 19 ? 31.505  -8.041  99.463  1.00 76.18 ? 26   PRO A C     1 
ATOM   962  O  O     . PRO C 3 19 ? 31.497  -7.178  100.341 1.00 76.12 ? 26   PRO A O     1 
ATOM   963  C  CB    . PRO C 3 19 ? 30.124  -10.124 99.642  1.00 75.70 ? 26   PRO A CB    1 
ATOM   964  C  CG    . PRO C 3 19 ? 30.609  -11.038 98.519  1.00 75.69 ? 26   PRO A CG    1 
ATOM   965  C  CD    . PRO C 3 19 ? 30.444  -10.308 97.207  1.00 75.36 ? 26   PRO A CD    1 
ATOM   966  N  N     . LYS C 3 20 ? 32.612  -8.432  98.834  1.00 76.47 ? 27   LYS A N     1 
ATOM   967  C  CA    . LYS C 3 20 ? 33.906  -7.753  99.011  1.00 76.87 ? 27   LYS A CA    1 
ATOM   968  C  C     . LYS C 3 20 ? 34.174  -6.769  97.818  1.00 77.11 ? 27   LYS A C     1 
ATOM   969  O  O     . LYS C 3 20 ? 33.904  -7.139  96.658  1.00 77.23 ? 27   LYS A O     1 
ATOM   970  C  CB    . LYS C 3 20 ? 35.040  -8.799  99.179  1.00 77.05 ? 27   LYS A CB    1 
ATOM   971  C  CG    . LYS C 3 20 ? 34.958  -9.672  100.463 1.00 77.23 ? 27   LYS A CG    1 
ATOM   972  C  CD    . LYS C 3 20 ? 35.957  -10.854 100.463 1.00 76.79 ? 27   LYS A CD    1 
ATOM   973  C  CE    . LYS C 3 20 ? 37.164  -10.613 101.394 1.00 76.31 ? 27   LYS A CE    1 
ATOM   974  N  NZ    . LYS C 3 20 ? 38.419  -10.137 100.716 1.00 75.28 ? 27   LYS A NZ    1 
ATOM   975  N  N     . CYS C 3 21 ? 34.672  -5.541  98.097  1.00 76.67 ? 28   CYS A N     1 
ATOM   976  C  CA    . CYS C 3 21 ? 34.969  -4.519  97.047  1.00 75.98 ? 28   CYS A CA    1 
ATOM   977  C  C     . CYS C 3 21 ? 36.466  -4.381  96.672  1.00 76.26 ? 28   CYS A C     1 
ATOM   978  O  O     . CYS C 3 21 ? 37.334  -4.893  97.395  1.00 76.34 ? 28   CYS A O     1 
ATOM   979  C  CB    . CYS C 3 21 ? 34.419  -3.162  97.464  1.00 75.78 ? 28   CYS A CB    1 
ATOM   980  S  SG    . CYS C 3 21 ? 35.330  -2.423  98.803  1.00 72.74 ? 28   CYS A SG    1 
ATOM   981  N  N     . ALA C 3 22 ? 36.746  -3.718  95.534  1.00 76.26 ? 29   ALA A N     1 
ATOM   982  C  CA    . ALA C 3 22 ? 38.117  -3.323  95.086  1.00 75.88 ? 29   ALA A CA    1 
ATOM   983  C  C     . ALA C 3 22 ? 39.252  -3.657  96.072  1.00 75.42 ? 29   ALA A C     1 
ATOM   984  O  O     . ALA C 3 22 ? 39.657  -4.812  96.187  1.00 75.61 ? 29   ALA A O     1 
ATOM   985  C  CB    . ALA C 3 22 ? 38.143  -1.796  94.759  1.00 76.32 ? 29   ALA A CB    1 
ATOM   986  N  N     . LYS C 3 23 ? 39.746  -2.626  96.771  1.00 74.90 ? 30   LYS A N     1 
ATOM   987  C  CA    . LYS C 3 23 ? 40.732  -2.743  97.864  1.00 74.24 ? 30   LYS A CA    1 
ATOM   988  C  C     . LYS C 3 23 ? 40.475  -3.911  98.815  1.00 73.74 ? 30   LYS A C     1 
ATOM   989  O  O     . LYS C 3 23 ? 41.361  -4.755  99.027  1.00 74.67 ? 30   LYS A O     1 
ATOM   990  C  CB    . LYS C 3 23 ? 40.782  -1.457  98.715  1.00 74.50 ? 30   LYS A CB    1 
ATOM   991  C  CG    . LYS C 3 23 ? 41.682  -0.326  98.222  1.00 74.90 ? 30   LYS A CG    1 
ATOM   992  C  CD    . LYS C 3 23 ? 42.565  0.187   99.380  1.00 74.38 ? 30   LYS A CD    1 
ATOM   993  C  CE    . LYS C 3 23 ? 43.546  1.331   98.998  1.00 74.96 ? 30   LYS A CE    1 
ATOM   994  N  NZ    . LYS C 3 23 ? 43.863  1.549   97.545  1.00 72.48 ? 30   LYS A NZ    1 
ATOM   995  N  N     . CYS C 3 24 ? 39.272  -3.961  99.394  1.00 72.75 ? 31   CYS A N     1 
ATOM   996  C  CA    . CYS C 3 24 ? 38.950  -4.947  100.447 1.00 71.62 ? 31   CYS A CA    1 
ATOM   997  C  C     . CYS C 3 24 ? 39.168  -6.396  99.902  1.00 71.79 ? 31   CYS A C     1 
ATOM   998  O  O     . CYS C 3 24 ? 39.526  -7.299  100.657 1.00 71.07 ? 31   CYS A O     1 
ATOM   999  C  CB    . CYS C 3 24 ? 37.543  -4.719  101.106 1.00 71.33 ? 31   CYS A CB    1 
ATOM   1000 S  SG    . CYS C 3 24 ? 37.099  -3.195  102.313 1.00 67.96 ? 31   CYS A SG    1 
ATOM   1001 N  N     . LEU C 3 25 ? 38.994  -6.602  98.593  1.00 71.76 ? 32   LEU A N     1 
ATOM   1002 C  CA    . LEU C 3 25 ? 39.349  -7.890  98.026  1.00 72.52 ? 32   LEU A CA    1 
ATOM   1003 C  C     . LEU C 3 25 ? 40.855  -7.975  97.918  1.00 73.12 ? 32   LEU A C     1 
ATOM   1004 O  O     . LEU C 3 25 ? 41.456  -8.950  98.401  1.00 72.64 ? 32   LEU A O     1 
ATOM   1005 C  CB    . LEU C 3 25 ? 38.671  -8.175  96.672  1.00 72.66 ? 32   LEU A CB    1 
ATOM   1006 C  CG    . LEU C 3 25 ? 38.651  -9.660  96.195  1.00 71.81 ? 32   LEU A CG    1 
ATOM   1007 C  CD1   . LEU C 3 25 ? 38.390  -10.706 97.319  1.00 69.38 ? 32   LEU A CD1   1 
ATOM   1008 C  CD2   . LEU C 3 25 ? 37.664  -9.874  95.021  1.00 72.05 ? 32   LEU A CD2   1 
ATOM   1009 N  N     . LYS C 3 26 ? 41.444  -6.930  97.321  1.00 73.75 ? 33   LYS A N     1 
ATOM   1010 C  CA    . LYS C 3 26 ? 42.892  -6.830  97.122  1.00 74.30 ? 33   LYS A CA    1 
ATOM   1011 C  C     . LYS C 3 26 ? 43.611  -7.106  98.419  1.00 74.91 ? 33   LYS A C     1 
ATOM   1012 O  O     . LYS C 3 26 ? 44.046  -8.208  98.654  1.00 74.92 ? 33   LYS A O     1 
ATOM   1013 C  CB    . LYS C 3 26 ? 43.290  -5.449  96.616  1.00 73.85 ? 33   LYS A CB    1 
ATOM   1014 C  CG    . LYS C 3 26 ? 42.862  -5.136  95.207  1.00 73.57 ? 33   LYS A CG    1 
ATOM   1015 C  CD    . LYS C 3 26 ? 43.808  -4.129  94.593  1.00 72.99 ? 33   LYS A CD    1 
ATOM   1016 C  CE    . LYS C 3 26 ? 45.242  -4.451  95.002  1.00 72.74 ? 33   LYS A CE    1 
ATOM   1017 N  NZ    . LYS C 3 26 ? 46.181  -4.382  93.850  1.00 72.98 ? 33   LYS A NZ    1 
ATOM   1018 N  N     . ASN C 3 27 ? 43.691  -6.102  99.278  1.00 76.10 ? 34   ASN A N     1 
ATOM   1019 C  CA    . ASN C 3 27 ? 44.438  -6.191  100.532 1.00 77.26 ? 34   ASN A CA    1 
ATOM   1020 C  C     . ASN C 3 27 ? 43.870  -7.214  101.481 1.00 77.50 ? 34   ASN A C     1 
ATOM   1021 O  O     . ASN C 3 27 ? 44.183  -7.207  102.686 1.00 77.05 ? 34   ASN A O     1 
ATOM   1022 C  CB    . ASN C 3 27 ? 44.452  -4.820  101.201 1.00 77.95 ? 34   ASN A CB    1 
ATOM   1023 C  CG    . ASN C 3 27 ? 45.430  -3.869  100.538 1.00 79.11 ? 34   ASN A CG    1 
ATOM   1024 O  OD1   . ASN C 3 27 ? 45.035  -2.850  99.934  1.00 77.93 ? 34   ASN A OD1   1 
ATOM   1025 N  ND2   . ASN C 3 27 ? 46.728  -4.220  100.618 1.00 79.15 ? 34   ASN A ND2   1 
ATOM   1026 N  N     . ASN C 3 28 ? 43.035  -8.083  100.900 1.00 78.28 ? 35   ASN A N     1 
ATOM   1027 C  CA    . ASN C 3 28 ? 42.357  -9.159  101.589 1.00 79.21 ? 35   ASN A CA    1 
ATOM   1028 C  C     . ASN C 3 28 ? 41.847  -8.580  102.894 1.00 80.15 ? 35   ASN A C     1 
ATOM   1029 O  O     . ASN C 3 28 ? 42.364  -8.876  103.979 1.00 80.33 ? 35   ASN A O     1 
ATOM   1030 C  CB    . ASN C 3 28 ? 43.323  -10.323 101.801 1.00 79.33 ? 35   ASN A CB    1 
ATOM   1031 C  CG    . ASN C 3 28 ? 42.620  -11.640 102.010 1.00 78.93 ? 35   ASN A CG    1 
ATOM   1032 O  OD1   . ASN C 3 28 ? 41.623  -11.718 102.737 1.00 77.89 ? 35   ASN A OD1   1 
ATOM   1033 N  ND2   . ASN C 3 28 ? 43.150  -12.695 101.387 1.00 77.13 ? 35   ASN A ND2   1 
ATOM   1034 N  N     . TRP C 3 29 ? 40.849  -7.709  102.756 1.00 81.07 ? 36   TRP A N     1 
ATOM   1035 C  CA    . TRP C 3 29 ? 40.349  -6.902  103.854 1.00 81.79 ? 36   TRP A CA    1 
ATOM   1036 C  C     . TRP C 3 29 ? 38.898  -7.202  104.275 1.00 81.50 ? 36   TRP A C     1 
ATOM   1037 O  O     . TRP C 3 29 ? 38.067  -7.677  103.476 1.00 81.34 ? 36   TRP A O     1 
ATOM   1038 C  CB    . TRP C 3 29 ? 40.551  -5.416  103.540 1.00 82.84 ? 36   TRP A CB    1 
ATOM   1039 C  CG    . TRP C 3 29 ? 41.749  -4.822  104.225 1.00 84.83 ? 36   TRP A CG    1 
ATOM   1040 C  CD1   . TRP C 3 29 ? 42.366  -5.315  105.339 1.00 86.21 ? 36   TRP A CD1   1 
ATOM   1041 C  CD2   . TRP C 3 29 ? 42.457  -3.607  103.875 1.00 85.89 ? 36   TRP A CD2   1 
ATOM   1042 N  NE1   . TRP C 3 29 ? 43.412  -4.498  105.694 1.00 87.60 ? 36   TRP A NE1   1 
ATOM   1043 C  CE2   . TRP C 3 29 ? 43.492  -3.443  104.819 1.00 86.37 ? 36   TRP A CE2   1 
ATOM   1044 C  CE3   . TRP C 3 29 ? 42.326  -2.654  102.852 1.00 86.00 ? 36   TRP A CE3   1 
ATOM   1045 C  CZ2   . TRP C 3 29 ? 44.399  -2.356  104.776 1.00 85.43 ? 36   TRP A CZ2   1 
ATOM   1046 C  CZ3   . TRP C 3 29 ? 43.235  -1.561  102.815 1.00 85.39 ? 36   TRP A CZ3   1 
ATOM   1047 C  CH2   . TRP C 3 29 ? 44.249  -1.431  103.770 1.00 85.05 ? 36   TRP A CH2   1 
ATOM   1048 N  N     . GLU C 3 30 ? 38.634  -6.931  105.554 1.00 81.10 ? 37   GLU A N     1 
ATOM   1049 C  CA    . GLU C 3 30 ? 37.350  -7.173  106.220 1.00 80.36 ? 37   GLU A CA    1 
ATOM   1050 C  C     . GLU C 3 30 ? 36.276  -6.105  105.772 1.00 80.04 ? 37   GLU A C     1 
ATOM   1051 O  O     . GLU C 3 30 ? 35.984  -5.128  106.512 1.00 80.19 ? 37   GLU A O     1 
ATOM   1052 C  CB    . GLU C 3 30 ? 37.635  -7.163  107.737 1.00 80.75 ? 37   GLU A CB    1 
ATOM   1053 C  CG    . GLU C 3 30 ? 36.597  -7.799  108.647 1.00 82.33 ? 37   GLU A CG    1 
ATOM   1054 C  CD    . GLU C 3 30 ? 36.314  -6.937  109.920 1.00 84.18 ? 37   GLU A CD    1 
ATOM   1055 O  OE1   . GLU C 3 30 ? 35.869  -5.764  109.810 1.00 80.27 ? 37   GLU A OE1   1 
ATOM   1056 O  OE2   . GLU C 3 30 ? 36.541  -7.453  111.038 1.00 86.29 ? 37   GLU A OE2   1 
ATOM   1057 N  N     . CYS C 3 31 ? 35.706  -6.306  104.565 1.00 78.61 ? 38   CYS A N     1 
ATOM   1058 C  CA    . CYS C 3 31 ? 34.858  -5.304  103.835 1.00 78.34 ? 38   CYS A CA    1 
ATOM   1059 C  C     . CYS C 3 31 ? 33.427  -5.206  104.321 1.00 77.70 ? 38   CYS A C     1 
ATOM   1060 O  O     . CYS C 3 31 ? 32.593  -6.044  103.950 1.00 77.38 ? 38   CYS A O     1 
ATOM   1061 C  CB    . CYS C 3 31 ? 34.795  -5.628  102.332 1.00 78.12 ? 38   CYS A CB    1 
ATOM   1062 S  SG    . CYS C 3 31 ? 33.753  -4.557  101.245 1.00 76.24 ? 38   CYS A SG    1 
ATOM   1063 N  N     . ARG C 3 32 ? 33.117  -4.180  105.117 1.00 77.09 ? 39   ARG A N     1 
ATOM   1064 C  CA    . ARG C 3 32 ? 31.709  -4.005  105.530 1.00 76.31 ? 39   ARG A CA    1 
ATOM   1065 C  C     . ARG C 3 32 ? 31.009  -2.754  105.014 1.00 74.03 ? 39   ARG A C     1 
ATOM   1066 O  O     . ARG C 3 32 ? 31.628  -1.704  104.867 1.00 73.75 ? 39   ARG A O     1 
ATOM   1067 C  CB    . ARG C 3 32 ? 31.498  -4.273  107.032 1.00 76.26 ? 39   ARG A CB    1 
ATOM   1068 C  CG    . ARG C 3 32 ? 31.380  -5.825  107.352 1.00 78.42 ? 39   ARG A CG    1 
ATOM   1069 C  CD    . ARG C 3 32 ? 31.996  -6.265  108.703 1.00 78.54 ? 39   ARG A CD    1 
ATOM   1070 N  NE    . ARG C 3 32 ? 31.461  -5.531  109.862 1.00 83.36 ? 39   ARG A NE    1 
ATOM   1071 C  CZ    . ARG C 3 32 ? 31.888  -4.333  110.298 1.00 86.35 ? 39   ARG A CZ    1 
ATOM   1072 N  NH1   . ARG C 3 32 ? 32.881  -3.659  109.675 1.00 86.77 ? 39   ARG A NH1   1 
ATOM   1073 N  NH2   . ARG C 3 32 ? 31.304  -3.790  111.372 1.00 87.29 ? 39   ARG A NH2   1 
ATOM   1074 N  N     . TYR C 3 33 ? 29.744  -2.947  104.649 1.00 72.32 ? 40   TYR A N     1 
ATOM   1075 C  CA    . TYR C 3 33 ? 28.779  -1.881  104.384 1.00 71.11 ? 40   TYR A CA    1 
ATOM   1076 C  C     . TYR C 3 33 ? 27.875  -1.704  105.609 1.00 69.75 ? 40   TYR A C     1 
ATOM   1077 O  O     . TYR C 3 33 ? 26.745  -2.159  105.620 1.00 69.23 ? 40   TYR A O     1 
ATOM   1078 C  CB    . TYR C 3 33 ? 27.970  -2.189  103.105 1.00 71.16 ? 40   TYR A CB    1 
ATOM   1079 C  CG    . TYR C 3 33 ? 28.872  -2.223  101.898 1.00 71.44 ? 40   TYR A CG    1 
ATOM   1080 C  CD1   . TYR C 3 33 ? 29.486  -3.409  101.500 1.00 72.12 ? 40   TYR A CD1   1 
ATOM   1081 C  CD2   . TYR C 3 33 ? 29.163  -1.060  101.185 1.00 71.96 ? 40   TYR A CD2   1 
ATOM   1082 C  CE1   . TYR C 3 33 ? 30.361  -3.450  100.407 1.00 72.74 ? 40   TYR A CE1   1 
ATOM   1083 C  CE2   . TYR C 3 33 ? 30.035  -1.075  100.090 1.00 73.14 ? 40   TYR A CE2   1 
ATOM   1084 C  CZ    . TYR C 3 33 ? 30.638  -2.282  99.705  1.00 73.16 ? 40   TYR A CZ    1 
ATOM   1085 O  OH    . TYR C 3 33 ? 31.510  -2.333  98.636  1.00 72.11 ? 40   TYR A OH    1 
ATOM   1086 N  N     . SER C 3 34 ? 28.402  -1.072  106.643 1.00 68.63 ? 41   SER A N     1 
ATOM   1087 C  CA    . SER C 3 34 ? 27.660  -0.927  107.880 1.00 69.79 ? 41   SER A CA    1 
ATOM   1088 C  C     . SER C 3 34 ? 26.377  -0.087  107.731 1.00 69.27 ? 41   SER A C     1 
ATOM   1089 O  O     . SER C 3 34 ? 26.360  0.899   106.994 1.00 68.44 ? 41   SER A O     1 
ATOM   1090 C  CB    . SER C 3 34 ? 28.543  -0.333  108.982 1.00 70.48 ? 41   SER A CB    1 
ATOM   1091 O  OG    . SER C 3 34 ? 29.541  -1.281  109.343 1.00 72.73 ? 41   SER A OG    1 
ATOM   1092 N  N     . PRO C 3 35 ? 25.291  -0.500  108.426 1.00 69.20 ? 42   PRO A N     1 
ATOM   1093 C  CA    . PRO C 3 35 ? 23.993  0.165   108.257 1.00 68.77 ? 42   PRO A CA    1 
ATOM   1094 C  C     . PRO C 3 35 ? 23.955  1.632   108.705 1.00 67.91 ? 42   PRO A C     1 
ATOM   1095 O  O     . PRO C 3 35 ? 24.697  2.079   109.572 1.00 67.10 ? 42   PRO A O     1 
ATOM   1096 C  CB    . PRO C 3 35 ? 23.030  -0.697  109.066 1.00 68.52 ? 42   PRO A CB    1 
ATOM   1097 C  CG    . PRO C 3 35 ? 23.881  -1.411  110.025 1.00 69.72 ? 42   PRO A CG    1 
ATOM   1098 C  CD    . PRO C 3 35 ? 25.213  -1.619  109.384 1.00 69.46 ? 42   PRO A CD    1 
ATOM   1099 N  N     . LYS C 3 36 ? 23.092  2.340   108.006 1.00 67.79 ? 43   LYS A N     1 
ATOM   1100 C  CA    . LYS C 3 36 ? 22.876  3.791   108.050 1.00 68.23 ? 43   LYS A CA    1 
ATOM   1101 C  C     . LYS C 3 36 ? 22.508  4.334   109.439 1.00 66.36 ? 43   LYS A C     1 
ATOM   1102 O  O     . LYS C 3 36 ? 21.352  4.153   109.908 1.00 66.87 ? 43   LYS A O     1 
ATOM   1103 C  CB    . LYS C 3 36 ? 21.731  4.093   107.053 1.00 68.93 ? 43   LYS A CB    1 
ATOM   1104 C  CG    . LYS C 3 36 ? 21.138  2.805   106.343 1.00 69.72 ? 43   LYS A CG    1 
ATOM   1105 C  CD    . LYS C 3 36 ? 20.035  3.173   105.309 1.00 70.86 ? 43   LYS A CD    1 
ATOM   1106 C  CE    . LYS C 3 36 ? 20.586  3.672   103.926 1.00 74.56 ? 43   LYS A CE    1 
ATOM   1107 N  NZ    . LYS C 3 36 ? 21.060  2.625   102.926 1.00 69.28 ? 43   LYS A NZ    1 
ATOM   1108 N  N     . THR C 3 37 ? 23.474  5.004   110.062 1.00 63.26 ? 44   THR A N     1 
ATOM   1109 C  CA    . THR C 3 37 ? 23.479  5.302   111.498 1.00 60.97 ? 44   THR A CA    1 
ATOM   1110 C  C     . THR C 3 37 ? 22.529  6.538   111.998 1.00 59.61 ? 44   THR A C     1 
ATOM   1111 O  O     . THR C 3 37 ? 22.770  7.759   111.638 1.00 57.75 ? 44   THR A O     1 
ATOM   1112 C  CB    . THR C 3 37 ? 24.981  5.458   111.875 1.00 63.05 ? 44   THR A CB    1 
ATOM   1113 O  OG1   . THR C 3 37 ? 25.129  5.656   113.291 1.00 68.27 ? 44   THR A OG1   1 
ATOM   1114 C  CG2   . THR C 3 37 ? 25.705  6.641   111.031 1.00 62.60 ? 44   THR A CG2   1 
ATOM   1115 N  N     . LYS C 3 38 ? 21.470  6.238   112.771 1.00 55.93 ? 45   LYS A N     1 
ATOM   1116 C  CA    . LYS C 3 38 ? 20.507  7.314   113.082 1.00 55.74 ? 45   LYS A CA    1 
ATOM   1117 C  C     . LYS C 3 38 ? 20.791  8.421   114.088 1.00 51.63 ? 45   LYS A C     1 
ATOM   1118 O  O     . LYS C 3 38 ? 21.494  8.274   115.107 1.00 50.84 ? 45   LYS A O     1 
ATOM   1119 C  CB    . LYS C 3 38 ? 19.085  6.886   113.254 1.00 56.27 ? 45   LYS A CB    1 
ATOM   1120 C  CG    . LYS C 3 38 ? 18.526  6.509   111.889 1.00 62.72 ? 45   LYS A CG    1 
ATOM   1121 C  CD    . LYS C 3 38 ? 18.986  5.090   111.456 1.00 65.61 ? 45   LYS A CD    1 
ATOM   1122 C  CE    . LYS C 3 38 ? 18.017  4.482   110.423 1.00 70.04 ? 45   LYS A CE    1 
ATOM   1123 N  NZ    . LYS C 3 38 ? 16.594  4.389   110.973 1.00 70.16 ? 45   LYS A NZ    1 
ATOM   1124 N  N     . ARG C 3 39 ? 20.234  9.553   113.684 1.00 45.99 ? 46   ARG A N     1 
ATOM   1125 C  CA    . ARG C 3 39 ? 20.458  10.817  114.273 1.00 40.89 ? 46   ARG A CA    1 
ATOM   1126 C  C     . ARG C 3 39 ? 19.050  11.268  114.647 1.00 35.68 ? 46   ARG A C     1 
ATOM   1127 O  O     . ARG C 3 39 ? 18.043  10.727  114.163 1.00 33.54 ? 46   ARG A O     1 
ATOM   1128 C  CB    . ARG C 3 39 ? 21.025  11.752  113.204 1.00 40.55 ? 46   ARG A CB    1 
ATOM   1129 C  CG    . ARG C 3 39 ? 22.132  11.205  112.381 1.00 44.26 ? 46   ARG A CG    1 
ATOM   1130 C  CD    . ARG C 3 39 ? 23.471  11.872  112.852 1.00 53.21 ? 46   ARG A CD    1 
ATOM   1131 N  NE    . ARG C 3 39 ? 24.478  12.307  111.860 1.00 59.50 ? 46   ARG A NE    1 
ATOM   1132 C  CZ    . ARG C 3 39 ? 25.461  13.165  112.205 1.00 67.17 ? 46   ARG A CZ    1 
ATOM   1133 N  NH1   . ARG C 3 39 ? 25.548  13.598  113.494 1.00 66.61 ? 46   ARG A NH1   1 
ATOM   1134 N  NH2   . ARG C 3 39 ? 26.375  13.597  111.309 1.00 65.82 ? 46   ARG A NH2   1 
ATOM   1135 N  N     . SER C 3 40 ? 18.922  12.301  115.434 1.00 30.27 ? 47   SER A N     1 
ATOM   1136 C  CA    . SER C 3 40 ? 17.551  12.599  115.680 1.00 25.79 ? 47   SER A CA    1 
ATOM   1137 C  C     . SER C 3 40 ? 17.217  13.545  114.565 1.00 24.30 ? 47   SER A C     1 
ATOM   1138 O  O     . SER C 3 40 ? 18.035  14.150  113.859 1.00 21.74 ? 47   SER A O     1 
ATOM   1139 C  CB    . SER C 3 40 ? 17.524  13.226  116.993 1.00 26.30 ? 47   SER A CB    1 
ATOM   1140 O  OG    . SER C 3 40 ? 18.641  14.114  116.897 1.00 24.47 ? 47   SER A OG    1 
ATOM   1141 N  N     . PRO C 3 41 ? 15.977  13.660  114.325 1.00 23.93 ? 48   PRO A N     1 
ATOM   1142 C  CA    . PRO C 3 41 ? 15.542  14.460  113.130 1.00 23.43 ? 48   PRO A CA    1 
ATOM   1143 C  C     . PRO C 3 41 ? 15.991  15.905  113.246 1.00 21.48 ? 48   PRO A C     1 
ATOM   1144 O  O     . PRO C 3 41 ? 15.775  16.478  114.240 1.00 21.16 ? 48   PRO A O     1 
ATOM   1145 C  CB    . PRO C 3 41 ? 14.045  14.433  113.181 1.00 21.57 ? 48   PRO A CB    1 
ATOM   1146 C  CG    . PRO C 3 41 ? 13.674  13.588  114.375 1.00 23.67 ? 48   PRO A CG    1 
ATOM   1147 C  CD    . PRO C 3 41 ? 14.919  13.026  115.080 1.00 24.46 ? 48   PRO A CD    1 
ATOM   1148 N  N     . LEU C 3 42 ? 16.595  16.463  112.229 1.00 19.99 ? 49   LEU A N     1 
ATOM   1149 C  CA    . LEU C 3 42 ? 16.771  17.812  112.289 1.00 19.83 ? 49   LEU A CA    1 
ATOM   1150 C  C     . LEU C 3 42 ? 15.477  18.495  111.780 1.00 23.11 ? 49   LEU A C     1 
ATOM   1151 O  O     . LEU C 3 42 ? 15.386  18.849  110.580 1.00 25.86 ? 49   LEU A O     1 
ATOM   1152 C  CB    . LEU C 3 42 ? 18.044  18.145  111.483 1.00 17.94 ? 49   LEU A CB    1 
ATOM   1153 C  CG    . LEU C 3 42 ? 18.623  19.554  111.696 1.00 16.36 ? 49   LEU A CG    1 
ATOM   1154 C  CD1   . LEU C 3 42 ? 19.150  19.716  113.046 1.00 20.83 ? 49   LEU A CD1   1 
ATOM   1155 C  CD2   . LEU C 3 42 ? 19.768  19.749  110.748 1.00 17.90 ? 49   LEU A CD2   1 
ATOM   1156 N  N     . THR C 3 43 ? 14.446  18.713  112.584 1.00 21.30 ? 50   THR A N     1 
ATOM   1157 C  CA    . THR C 3 43 ? 13.444  19.561  112.029 1.00 21.26 ? 50   THR A CA    1 
ATOM   1158 C  C     . THR C 3 43 ? 13.219  20.765  112.956 1.00 22.35 ? 50   THR A C     1 
ATOM   1159 O  O     . THR C 3 43 ? 13.558  20.703  114.111 1.00 25.24 ? 50   THR A O     1 
ATOM   1160 C  CB    . THR C 3 43 ? 12.176  18.794  112.002 1.00 21.25 ? 50   THR A CB    1 
ATOM   1161 O  OG1   . THR C 3 43 ? 11.958  18.244  113.307 1.00 23.06 ? 50   THR A OG1   1 
ATOM   1162 C  CG2   . THR C 3 43 ? 12.246  17.624  111.074 1.00 21.71 ? 50   THR A CG2   1 
ATOM   1163 N  N     . ARG C 3 44 ? 12.457  21.774  112.598 1.00 20.65 ? 51   ARG A N     1 
ATOM   1164 C  CA    . ARG C 3 44 ? 12.302  22.871  113.510 1.00 18.64 ? 51   ARG A CA    1 
ATOM   1165 C  C     . ARG C 3 44 ? 11.556  22.403  114.688 1.00 20.40 ? 51   ARG A C     1 
ATOM   1166 O  O     . ARG C 3 44 ? 11.769  22.910  115.811 1.00 22.61 ? 51   ARG A O     1 
ATOM   1167 C  CB    . ARG C 3 44 ? 11.508  24.030  112.851 1.00 18.39 ? 51   ARG A CB    1 
ATOM   1168 C  CG    . ARG C 3 44 ? 11.070  25.198  113.804 1.00 13.77 ? 51   ARG A CG    1 
ATOM   1169 C  CD    . ARG C 3 44 ? 12.295  25.885  114.504 1.00 9.82  ? 51   ARG A CD    1 
ATOM   1170 N  NE    . ARG C 3 44 ? 13.125  26.520  113.492 1.00 11.92 ? 51   ARG A NE    1 
ATOM   1171 C  CZ    . ARG C 3 44 ? 14.341  27.035  113.753 1.00 24.04 ? 51   ARG A CZ    1 
ATOM   1172 N  NH1   . ARG C 3 44 ? 14.776  27.031  115.037 1.00 19.23 ? 51   ARG A NH1   1 
ATOM   1173 N  NH2   . ARG C 3 44 ? 15.177  27.500  112.736 1.00 18.93 ? 51   ARG A NH2   1 
ATOM   1174 N  N     . ALA C 3 45 ? 10.652  21.434  114.485 1.00 20.68 ? 52   ALA A N     1 
ATOM   1175 C  CA    . ALA C 3 45 ? 9.636   21.082  115.543 1.00 18.96 ? 52   ALA A CA    1 
ATOM   1176 C  C     . ALA C 3 45 ? 10.361  20.301  116.579 1.00 20.18 ? 52   ALA A C     1 
ATOM   1177 O  O     . ALA C 3 45 ? 10.064  20.340  117.772 1.00 20.76 ? 52   ALA A O     1 
ATOM   1178 C  CB    . ALA C 3 45 ? 8.568   20.233  114.957 1.00 17.98 ? 52   ALA A CB    1 
ATOM   1179 N  N     . HIS C 3 46 ? 11.382  19.585  116.136 1.00 19.89 ? 53   HIS A N     1 
ATOM   1180 C  CA    . HIS C 3 46 ? 12.048  18.816  117.081 1.00 20.04 ? 53   HIS A CA    1 
ATOM   1181 C  C     . HIS C 3 46 ? 13.083  19.593  117.780 1.00 21.54 ? 53   HIS A C     1 
ATOM   1182 O  O     . HIS C 3 46 ? 13.196  19.318  118.948 1.00 20.45 ? 53   HIS A O     1 
ATOM   1183 C  CB    . HIS C 3 46 ? 12.661  17.628  116.494 1.00 17.30 ? 53   HIS A CB    1 
ATOM   1184 C  CG    . HIS C 3 46 ? 13.567  16.895  117.434 1.00 22.56 ? 53   HIS A CG    1 
ATOM   1185 N  ND1   . HIS C 3 46 ? 13.097  16.005  118.391 1.00 20.07 ? 53   HIS A ND1   1 
ATOM   1186 C  CD2   . HIS C 3 46 ? 14.924  16.846  117.517 1.00 26.03 ? 53   HIS A CD2   1 
ATOM   1187 C  CE1   . HIS C 3 46 ? 14.119  15.444  119.020 1.00 20.55 ? 53   HIS A CE1   1 
ATOM   1188 N  NE2   . HIS C 3 46 ? 15.242  15.924  118.499 1.00 28.18 ? 53   HIS A NE2   1 
ATOM   1189 N  N     . LEU C 3 47 ? 13.881  20.469  117.090 1.00 21.54 ? 54   LEU A N     1 
ATOM   1190 C  CA    . LEU C 3 47 ? 14.675  21.453  117.829 1.00 22.44 ? 54   LEU A CA    1 
ATOM   1191 C  C     . LEU C 3 47 ? 13.859  22.103  118.923 1.00 23.38 ? 54   LEU A C     1 
ATOM   1192 O  O     . LEU C 3 47 ? 14.327  22.289  120.006 1.00 25.42 ? 54   LEU A O     1 
ATOM   1193 C  CB    . LEU C 3 47 ? 15.010  22.679  117.017 1.00 21.33 ? 54   LEU A CB    1 
ATOM   1194 C  CG    . LEU C 3 47 ? 16.430  23.227  117.247 1.00 23.49 ? 54   LEU A CG    1 
ATOM   1195 C  CD1   . LEU C 3 47 ? 16.598  24.442  116.692 1.00 19.93 ? 54   LEU A CD1   1 
ATOM   1196 C  CD2   . LEU C 3 47 ? 17.096  23.272  118.660 1.00 19.68 ? 54   LEU A CD2   1 
ATOM   1197 N  N     . THR C 3 48 ? 12.624  22.492  118.623 1.00 23.31 ? 55   THR A N     1 
ATOM   1198 C  CA    . THR C 3 48 ? 11.840  23.270  119.561 1.00 23.58 ? 55   THR A CA    1 
ATOM   1199 C  C     . THR C 3 48 ? 11.365  22.380  120.689 1.00 23.94 ? 55   THR A C     1 
ATOM   1200 O  O     . THR C 3 48 ? 11.277  22.852  121.772 1.00 23.99 ? 55   THR A O     1 
ATOM   1201 C  CB    . THR C 3 48 ? 10.583  23.744  118.785 1.00 24.31 ? 55   THR A CB    1 
ATOM   1202 O  OG1   . THR C 3 48 ? 11.043  24.547  117.708 1.00 32.23 ? 55   THR A OG1   1 
ATOM   1203 C  CG2   . THR C 3 48 ? 9.573   24.566  119.583 1.00 15.82 ? 55   THR A CG2   1 
ATOM   1204 N  N     . GLU C 3 49 ? 10.983  21.132  120.452 1.00 25.87 ? 56   GLU A N     1 
ATOM   1205 C  CA    . GLU C 3 49 ? 10.564  20.264  121.551 1.00 26.79 ? 56   GLU A CA    1 
ATOM   1206 C  C     . GLU C 3 49 ? 11.775  20.162  122.458 1.00 27.74 ? 56   GLU A C     1 
ATOM   1207 O  O     . GLU C 3 49 ? 11.642  20.390  123.681 1.00 29.80 ? 56   GLU A O     1 
ATOM   1208 C  CB    . GLU C 3 49 ? 10.218  18.834  121.103 1.00 30.21 ? 56   GLU A CB    1 
ATOM   1209 C  CG    . GLU C 3 49 ? 9.471   17.899  122.160 1.00 32.44 ? 56   GLU A CG    1 
ATOM   1210 C  CD    . GLU C 3 49 ? 8.238   18.624  122.886 1.00 49.40 ? 56   GLU A CD    1 
ATOM   1211 O  OE1   . GLU C 3 49 ? 8.150   18.729  124.204 1.00 51.98 ? 56   GLU A OE1   1 
ATOM   1212 O  OE2   . GLU C 3 49 ? 7.345   19.103  122.102 1.00 50.41 ? 56   GLU A OE2   1 
ATOM   1213 N  N     . VAL C 3 50 ? 12.965  19.934  121.920 1.00 23.93 ? 57   VAL A N     1 
ATOM   1214 C  CA    . VAL C 3 50 ? 14.048  19.739  122.791 1.00 23.54 ? 57   VAL A CA    1 
ATOM   1215 C  C     . VAL C 3 50 ? 14.348  21.087  123.472 1.00 25.43 ? 57   VAL A C     1 
ATOM   1216 O  O     . VAL C 3 50 ? 14.465  21.142  124.689 1.00 24.56 ? 57   VAL A O     1 
ATOM   1217 C  CB    . VAL C 3 50 ? 15.234  19.310  122.037 1.00 24.17 ? 57   VAL A CB    1 
ATOM   1218 C  CG1   . VAL C 3 50 ? 16.420  19.454  122.794 1.00 24.29 ? 57   VAL A CG1   1 
ATOM   1219 C  CG2   . VAL C 3 50 ? 15.123  17.906  121.620 1.00 17.93 ? 57   VAL A CG2   1 
ATOM   1220 N  N     . GLU C 3 51 ? 14.378  22.198  122.758 1.00 25.04 ? 58   GLU A N     1 
ATOM   1221 C  CA    . GLU C 3 51 ? 14.540  23.429  123.524 1.00 26.38 ? 58   GLU A CA    1 
ATOM   1222 C  C     . GLU C 3 51 ? 13.429  23.654  124.609 1.00 26.58 ? 58   GLU A C     1 
ATOM   1223 O  O     . GLU C 3 51 ? 13.701  24.195  125.686 1.00 26.50 ? 58   GLU A O     1 
ATOM   1224 C  CB    . GLU C 3 51 ? 14.687  24.642  122.633 1.00 25.05 ? 58   GLU A CB    1 
ATOM   1225 C  CG    . GLU C 3 51 ? 15.747  24.570  121.550 1.00 24.94 ? 58   GLU A CG    1 
ATOM   1226 C  CD    . GLU C 3 51 ? 15.640  25.703  120.407 1.00 32.36 ? 58   GLU A CD    1 
ATOM   1227 O  OE1   . GLU C 3 51 ? 16.623  25.929  119.713 1.00 42.73 ? 58   GLU A OE1   1 
ATOM   1228 O  OE2   . GLU C 3 51 ? 14.620  26.412  120.132 1.00 39.61 ? 58   GLU A OE2   1 
ATOM   1229 N  N     . SER C 3 52 ? 12.195  23.156  124.453 1.00 26.16 ? 59   SER A N     1 
ATOM   1230 C  CA    . SER C 3 52 ? 11.360  23.409  125.555 1.00 26.10 ? 59   SER A CA    1 
ATOM   1231 C  C     . SER C 3 52 ? 11.704  22.512  126.699 1.00 27.14 ? 59   SER A C     1 
ATOM   1232 O  O     . SER C 3 52 ? 11.451  22.932  127.833 1.00 29.98 ? 59   SER A O     1 
ATOM   1233 C  CB    . SER C 3 52 ? 9.958   23.217  125.201 1.00 26.44 ? 59   SER A CB    1 
ATOM   1234 O  OG    . SER C 3 52 ? 9.716   24.080  124.143 1.00 32.61 ? 59   SER A OG    1 
ATOM   1235 N  N     . ARG C 3 53 ? 12.269  21.323  126.494 1.00 23.66 ? 60   ARG A N     1 
ATOM   1236 C  CA    . ARG C 3 53 ? 12.530  20.583  127.650 1.00 24.00 ? 60   ARG A CA    1 
ATOM   1237 C  C     . ARG C 3 53 ? 13.707  21.235  128.380 1.00 24.84 ? 60   ARG A C     1 
ATOM   1238 O  O     . ARG C 3 53 ? 13.654  21.466  129.580 1.00 24.86 ? 60   ARG A O     1 
ATOM   1239 C  CB    . ARG C 3 53 ? 12.880  19.162  127.324 1.00 25.23 ? 60   ARG A CB    1 
ATOM   1240 C  CG    . ARG C 3 53 ? 11.705  18.362  126.839 1.00 25.78 ? 60   ARG A CG    1 
ATOM   1241 C  CD    . ARG C 3 53 ? 12.156  17.092  126.056 1.00 34.18 ? 60   ARG A CD    1 
ATOM   1242 N  NE    . ARG C 3 53 ? 10.910  16.517  125.732 1.00 43.41 ? 60   ARG A NE    1 
ATOM   1243 C  CZ    . ARG C 3 53 ? 10.329  15.630  126.504 1.00 49.29 ? 60   ARG A CZ    1 
ATOM   1244 N  NH1   . ARG C 3 53 ? 10.994  15.070  127.525 1.00 51.36 ? 60   ARG A NH1   1 
ATOM   1245 N  NH2   . ARG C 3 53 ? 9.109   15.265  126.194 1.00 53.70 ? 60   ARG A NH2   1 
ATOM   1246 N  N     . LEU C 3 54 ? 14.732  21.603  127.646 1.00 23.30 ? 61   LEU A N     1 
ATOM   1247 C  CA    . LEU C 3 54 ? 15.901  22.078  128.225 1.00 23.40 ? 61   LEU A CA    1 
ATOM   1248 C  C     . LEU C 3 54 ? 15.559  23.296  129.043 1.00 25.85 ? 61   LEU A C     1 
ATOM   1249 O  O     . LEU C 3 54 ? 16.073  23.398  130.158 1.00 26.91 ? 61   LEU A O     1 
ATOM   1250 C  CB    . LEU C 3 54 ? 16.836  22.588  127.137 1.00 24.10 ? 61   LEU A CB    1 
ATOM   1251 C  CG    . LEU C 3 54 ? 18.116  23.248  127.687 1.00 21.59 ? 61   LEU A CG    1 
ATOM   1252 C  CD1   . LEU C 3 54 ? 18.868  22.355  128.734 1.00 20.50 ? 61   LEU A CD1   1 
ATOM   1253 C  CD2   . LEU C 3 54 ? 19.121  23.590  126.608 1.00 20.03 ? 61   LEU A CD2   1 
ATOM   1254 N  N     . GLU C 3 55 ? 14.699  24.214  128.545 1.00 24.62 ? 62   GLU A N     1 
ATOM   1255 C  CA    . GLU C 3 55 ? 14.334  25.373  129.327 1.00 23.45 ? 62   GLU A CA    1 
ATOM   1256 C  C     . GLU C 3 55 ? 13.705  24.980  130.632 1.00 22.09 ? 62   GLU A C     1 
ATOM   1257 O  O     . GLU C 3 55 ? 13.878  25.627  131.668 1.00 21.96 ? 62   GLU A O     1 
ATOM   1258 C  CB    . GLU C 3 55 ? 13.277  26.215  128.623 1.00 25.69 ? 62   GLU A CB    1 
ATOM   1259 C  CG    . GLU C 3 55 ? 13.876  27.452  128.006 1.00 37.93 ? 62   GLU A CG    1 
ATOM   1260 C  CD    . GLU C 3 55 ? 14.345  28.575  129.096 1.00 51.74 ? 62   GLU A CD    1 
ATOM   1261 O  OE1   . GLU C 3 55 ? 15.211  29.455  128.756 1.00 60.29 ? 62   GLU A OE1   1 
ATOM   1262 O  OE2   . GLU C 3 55 ? 13.872  28.628  130.274 1.00 50.62 ? 62   GLU A OE2   1 
ATOM   1263 N  N     . ARG C 3 56 ? 12.896  23.964  130.640 1.00 20.59 ? 63   ARG A N     1 
ATOM   1264 C  CA    . ARG C 3 56 ? 12.234  23.740  131.876 1.00 19.92 ? 63   ARG A CA    1 
ATOM   1265 C  C     . ARG C 3 56 ? 13.246  23.215  132.852 1.00 19.43 ? 63   ARG A C     1 
ATOM   1266 O  O     . ARG C 3 56 ? 13.307  23.740  134.004 1.00 17.68 ? 63   ARG A O     1 
ATOM   1267 C  CB    . ARG C 3 56 ? 11.205  22.710  131.647 1.00 20.98 ? 63   ARG A CB    1 
ATOM   1268 C  CG    . ARG C 3 56 ? 10.163  23.199  130.657 1.00 22.59 ? 63   ARG A CG    1 
ATOM   1269 C  CD    . ARG C 3 56 ? 9.248   21.959  130.342 1.00 22.67 ? 63   ARG A CD    1 
ATOM   1270 N  NE    . ARG C 3 56 ? 8.169   22.409  129.508 1.00 24.27 ? 63   ARG A NE    1 
ATOM   1271 C  CZ    . ARG C 3 56 ? 8.007   21.962  128.274 1.00 24.84 ? 63   ARG A CZ    1 
ATOM   1272 N  NH1   . ARG C 3 56 ? 8.899   21.043  127.848 1.00 26.40 ? 63   ARG A NH1   1 
ATOM   1273 N  NH2   . ARG C 3 56 ? 7.073   22.514  127.453 1.00 20.04 ? 63   ARG A NH2   1 
ATOM   1274 N  N     . LEU C 3 57 ? 14.101  22.278  132.431 1.00 18.46 ? 64   LEU A N     1 
ATOM   1275 C  CA    . LEU C 3 57 ? 15.125  21.837  133.403 1.00 21.92 ? 64   LEU A CA    1 
ATOM   1276 C  C     . LEU C 3 57 ? 16.010  23.001  133.696 1.00 21.81 ? 64   LEU A C     1 
ATOM   1277 O  O     . LEU C 3 57 ? 16.448  23.103  134.820 1.00 24.68 ? 64   LEU A O     1 
ATOM   1278 C  CB    . LEU C 3 57 ? 16.066  20.769  132.941 1.00 22.31 ? 64   LEU A CB    1 
ATOM   1279 C  CG    . LEU C 3 57 ? 15.437  19.408  133.099 1.00 29.26 ? 64   LEU A CG    1 
ATOM   1280 C  CD1   . LEU C 3 57 ? 16.458  18.429  132.574 1.00 27.73 ? 64   LEU A CD1   1 
ATOM   1281 C  CD2   . LEU C 3 57 ? 15.212  19.175  134.571 1.00 22.54 ? 64   LEU A CD2   1 
ATOM   1282 N  N     . GLU C 3 58 ? 16.309  23.879  132.756 1.00 18.36 ? 65   GLU A N     1 
ATOM   1283 C  CA    . GLU C 3 58 ? 17.219  24.895  133.112 1.00 20.65 ? 65   GLU A CA    1 
ATOM   1284 C  C     . GLU C 3 58 ? 16.680  25.758  134.306 1.00 21.53 ? 65   GLU A C     1 
ATOM   1285 O  O     . GLU C 3 58 ? 17.466  26.248  135.193 1.00 21.32 ? 65   GLU A O     1 
ATOM   1286 C  CB    . GLU C 3 58 ? 17.494  25.830  131.935 1.00 21.94 ? 65   GLU A CB    1 
ATOM   1287 C  CG    . GLU C 3 58 ? 18.765  26.668  132.193 1.00 27.58 ? 65   GLU A CG    1 
ATOM   1288 C  CD    . GLU C 3 58 ? 20.021  25.791  131.907 1.00 36.11 ? 65   GLU A CD    1 
ATOM   1289 O  OE1   . GLU C 3 58 ? 20.087  25.251  130.768 1.00 42.30 ? 65   GLU A OE1   1 
ATOM   1290 O  OE2   . GLU C 3 58 ? 20.903  25.626  132.772 1.00 33.35 ? 65   GLU A OE2   1 
ATOM   1291 N  N     . GLN C 3 59 ? 15.366  25.958  134.270 1.00 20.67 ? 66   GLN A N     1 
ATOM   1292 C  CA    . GLN C 3 59 ? 14.637  26.752  135.264 1.00 21.18 ? 66   GLN A CA    1 
ATOM   1293 C  C     . GLN C 3 59 ? 14.627  26.025  136.609 1.00 19.77 ? 66   GLN A C     1 
ATOM   1294 O  O     . GLN C 3 59 ? 14.875  26.671  137.651 1.00 20.30 ? 66   GLN A O     1 
ATOM   1295 C  CB    . GLN C 3 59 ? 13.174  26.965  134.876 1.00 19.95 ? 66   GLN A CB    1 
ATOM   1296 C  CG    . GLN C 3 59 ? 13.029  27.809  133.710 1.00 17.86 ? 66   GLN A CG    1 
ATOM   1297 C  CD    . GLN C 3 59 ? 13.210  29.327  134.011 1.00 14.58 ? 66   GLN A CD    1 
ATOM   1298 O  OE1   . GLN C 3 59 ? 13.739  30.012  133.193 1.00 21.90 ? 66   GLN A OE1   1 
ATOM   1299 N  NE2   . GLN C 3 59 ? 12.629  29.843  135.056 1.00 17.59 ? 66   GLN A NE2   1 
ATOM   1300 N  N     . LEU C 3 60 ? 14.335  24.726  136.571 1.00 18.75 ? 67   LEU A N     1 
ATOM   1301 C  CA    . LEU C 3 60 ? 14.345  23.902  137.776 1.00 18.17 ? 67   LEU A CA    1 
ATOM   1302 C  C     . LEU C 3 60 ? 15.717  23.948  138.381 1.00 17.84 ? 67   LEU A C     1 
ATOM   1303 O  O     . LEU C 3 60 ? 15.838  24.196  139.574 1.00 16.66 ? 67   LEU A O     1 
ATOM   1304 C  CB    . LEU C 3 60 ? 13.976  22.516  137.430 1.00 18.25 ? 67   LEU A CB    1 
ATOM   1305 C  CG    . LEU C 3 60 ? 13.392  21.568  138.473 1.00 22.60 ? 67   LEU A CG    1 
ATOM   1306 C  CD1   . LEU C 3 60 ? 14.516  20.917  139.161 1.00 22.78 ? 67   LEU A CD1   1 
ATOM   1307 C  CD2   . LEU C 3 60 ? 12.331  22.239  139.559 1.00 18.25 ? 67   LEU A CD2   1 
ATOM   1308 N  N     . PHE C 3 61 ? 16.781  23.899  137.585 1.00 19.16 ? 68   PHE A N     1 
ATOM   1309 C  CA    . PHE C 3 61 ? 18.083  24.044  138.210 1.00 20.08 ? 68   PHE A CA    1 
ATOM   1310 C  C     . PHE C 3 61 ? 18.432  25.418  138.610 1.00 23.85 ? 68   PHE A C     1 
ATOM   1311 O  O     . PHE C 3 61 ? 19.364  25.547  139.397 1.00 29.51 ? 68   PHE A O     1 
ATOM   1312 C  CB    . PHE C 3 61 ? 19.173  23.440  137.390 1.00 19.51 ? 68   PHE A CB    1 
ATOM   1313 C  CG    . PHE C 3 61 ? 19.174  21.934  137.438 1.00 24.84 ? 68   PHE A CG    1 
ATOM   1314 C  CD1   . PHE C 3 61 ? 19.956  21.242  138.350 1.00 25.81 ? 68   PHE A CD1   1 
ATOM   1315 C  CD2   . PHE C 3 61 ? 18.308  21.219  136.727 1.00 26.49 ? 68   PHE A CD2   1 
ATOM   1316 C  CE1   . PHE C 3 61 ? 19.892  19.873  138.450 1.00 28.52 ? 68   PHE A CE1   1 
ATOM   1317 C  CE2   . PHE C 3 61 ? 18.273  19.787  136.823 1.00 26.81 ? 68   PHE A CE2   1 
ATOM   1318 C  CZ    . PHE C 3 61 ? 19.054  19.145  137.631 1.00 25.03 ? 68   PHE A CZ    1 
ATOM   1319 N  N     . LEU C 3 62 ? 17.776  26.512  138.162 1.00 22.81 ? 69   LEU A N     1 
ATOM   1320 C  CA    . LEU C 3 62 ? 18.167  27.766  138.756 1.00 21.22 ? 69   LEU A CA    1 
ATOM   1321 C  C     . LEU C 3 62 ? 17.782  27.744  140.191 1.00 22.20 ? 69   LEU A C     1 
ATOM   1322 O  O     . LEU C 3 62 ? 18.434  28.315  140.964 1.00 23.31 ? 69   LEU A O     1 
ATOM   1323 C  CB    . LEU C 3 62 ? 17.369  28.868  138.151 1.00 22.77 ? 69   LEU A CB    1 
ATOM   1324 C  CG    . LEU C 3 62 ? 17.752  30.327  138.048 1.00 21.74 ? 69   LEU A CG    1 
ATOM   1325 C  CD1   . LEU C 3 62 ? 16.490  30.995  138.262 1.00 20.83 ? 69   LEU A CD1   1 
ATOM   1326 C  CD2   . LEU C 3 62 ? 18.701  30.862  139.025 1.00 24.51 ? 69   LEU A CD2   1 
ATOM   1327 N  N     . LEU C 3 63 ? 16.676  27.129  140.555 1.00 22.63 ? 70   LEU A N     1 
ATOM   1328 C  CA    . LEU C 3 63 ? 16.325  27.047  141.948 1.00 23.50 ? 70   LEU A CA    1 
ATOM   1329 C  C     . LEU C 3 63 ? 17.160  26.023  142.710 1.00 25.05 ? 70   LEU A C     1 
ATOM   1330 O  O     . LEU C 3 63 ? 17.337  26.173  143.871 1.00 22.71 ? 70   LEU A O     1 
ATOM   1331 C  CB    . LEU C 3 63 ? 14.853  26.710  142.120 1.00 22.40 ? 70   LEU A CB    1 
ATOM   1332 C  CG    . LEU C 3 63 ? 13.952  27.456  141.124 1.00 20.67 ? 70   LEU A CG    1 
ATOM   1333 C  CD1   . LEU C 3 63 ? 12.503  26.910  141.100 1.00 15.53 ? 70   LEU A CD1   1 
ATOM   1334 C  CD2   . LEU C 3 63 ? 13.946  28.830  141.606 1.00 8.86  ? 70   LEU A CD2   1 
ATOM   1335 N  N     . ILE C 3 64 ? 17.633  24.946  142.094 1.00 28.21 ? 71   ILE A N     1 
ATOM   1336 C  CA    . ILE C 3 64 ? 18.386  23.980  142.956 1.00 30.75 ? 71   ILE A CA    1 
ATOM   1337 C  C     . ILE C 3 64 ? 19.718  24.645  143.193 1.00 32.43 ? 71   ILE A C     1 
ATOM   1338 O  O     . ILE C 3 64 ? 20.168  24.716  144.317 1.00 30.92 ? 71   ILE A O     1 
ATOM   1339 C  CB    . ILE C 3 64 ? 18.748  22.626  142.317 1.00 30.88 ? 71   ILE A CB    1 
ATOM   1340 C  CG1   . ILE C 3 64 ? 17.522  21.759  142.051 1.00 31.12 ? 71   ILE A CG1   1 
ATOM   1341 C  CG2   . ILE C 3 64 ? 19.766  21.918  143.168 1.00 29.38 ? 71   ILE A CG2   1 
ATOM   1342 C  CD1   . ILE C 3 64 ? 16.375  22.411  142.656 1.00 36.67 ? 71   ILE A CD1   1 
ATOM   1343 N  N     . PHE C 3 65 ? 20.360  25.111  142.121 1.00 34.17 ? 72   PHE A N     1 
ATOM   1344 C  CA    . PHE C 3 65 ? 21.601  25.741  142.327 1.00 37.48 ? 72   PHE A CA    1 
ATOM   1345 C  C     . PHE C 3 65 ? 21.520  27.245  142.078 1.00 40.30 ? 72   PHE A C     1 
ATOM   1346 O  O     . PHE C 3 65 ? 21.865  27.701  141.014 1.00 39.36 ? 72   PHE A O     1 
ATOM   1347 C  CB    . PHE C 3 65 ? 22.570  25.103  141.430 1.00 37.31 ? 72   PHE A CB    1 
ATOM   1348 C  CG    . PHE C 3 65 ? 22.680  23.625  141.611 1.00 39.32 ? 72   PHE A CG    1 
ATOM   1349 C  CD1   . PHE C 3 65 ? 22.188  22.753  140.644 1.00 41.97 ? 72   PHE A CD1   1 
ATOM   1350 C  CD2   . PHE C 3 65 ? 23.308  23.081  142.732 1.00 42.28 ? 72   PHE A CD2   1 
ATOM   1351 C  CE1   . PHE C 3 65 ? 22.300  21.331  140.753 1.00 40.95 ? 72   PHE A CE1   1 
ATOM   1352 C  CE2   . PHE C 3 65 ? 23.407  21.684  142.859 1.00 43.76 ? 72   PHE A CE2   1 
ATOM   1353 C  CZ    . PHE C 3 65 ? 22.915  20.808  141.842 1.00 40.30 ? 72   PHE A CZ    1 
ATOM   1354 N  N     . PRO C 3 66 ? 21.035  28.022  143.057 1.00 43.06 ? 73   PRO A N     1 
ATOM   1355 C  CA    . PRO C 3 66 ? 21.051  29.461  142.765 1.00 47.16 ? 73   PRO A CA    1 
ATOM   1356 C  C     . PRO C 3 66 ? 22.501  30.010  142.585 1.00 49.70 ? 73   PRO A C     1 
ATOM   1357 O  O     . PRO C 3 66 ? 22.704  31.001  141.840 1.00 49.22 ? 73   PRO A O     1 
ATOM   1358 C  CB    . PRO C 3 66 ? 20.328  30.114  143.994 1.00 46.47 ? 73   PRO A CB    1 
ATOM   1359 C  CG    . PRO C 3 66 ? 19.727  29.019  144.747 1.00 45.88 ? 73   PRO A CG    1 
ATOM   1360 C  CD    . PRO C 3 66 ? 20.458  27.731  144.370 1.00 43.30 ? 73   PRO A CD    1 
ATOM   1361 N  N     . ARG C 3 67 ? 23.452  29.334  143.262 1.00 52.56 ? 74   ARG A N     1 
ATOM   1362 C  CA    . ARG C 3 67 ? 24.885  29.656  143.262 1.00 55.58 ? 74   ARG A CA    1 
ATOM   1363 C  C     . ARG C 3 67 ? 25.711  28.652  142.443 1.00 57.65 ? 74   ARG A C     1 
ATOM   1364 O  O     . ARG C 3 67 ? 25.991  27.481  142.873 1.00 58.92 ? 74   ARG A O     1 
ATOM   1365 C  CB    . ARG C 3 67 ? 25.431  29.809  144.709 1.00 56.16 ? 74   ARG A CB    1 
ATOM   1366 C  CG    . ARG C 3 67 ? 24.707  30.866  145.546 1.00 56.74 ? 74   ARG A CG    1 
ATOM   1367 C  CD    . ARG C 3 67 ? 24.602  32.149  144.752 1.00 59.76 ? 74   ARG A CD    1 
ATOM   1368 N  NE    . ARG C 3 67 ? 24.026  33.285  145.489 1.00 67.96 ? 74   ARG A NE    1 
ATOM   1369 C  CZ    . ARG C 3 67 ? 24.698  34.136  146.304 1.00 69.80 ? 74   ARG A CZ    1 
ATOM   1370 N  NH1   . ARG C 3 67 ? 25.998  33.960  146.560 1.00 69.90 ? 74   ARG A NH1   1 
ATOM   1371 N  NH2   . ARG C 3 67 ? 24.068  35.176  146.888 1.00 69.92 ? 74   ARG A NH2   1 
ATOM   1372 N  N     . GLU C 3 68 ? 25.916  29.097  141.200 1.00 59.17 ? 75   GLU A N     1 
ATOM   1373 C  CA    . GLU C 3 68 ? 27.078  28.876  140.332 1.00 59.94 ? 75   GLU A CA    1 
ATOM   1374 C  C     . GLU C 3 68 ? 27.764  27.540  140.211 1.00 58.50 ? 75   GLU A C     1 
ATOM   1375 O  O     . GLU C 3 68 ? 27.559  26.583  140.956 1.00 58.45 ? 75   GLU A O     1 
ATOM   1376 C  CB    . GLU C 3 68 ? 28.132  30.069  140.507 1.00 60.69 ? 75   GLU A CB    1 
ATOM   1377 C  CG    . GLU C 3 68 ? 29.472  30.074  139.588 1.00 60.73 ? 75   GLU A CG    1 
ATOM   1378 C  CD    . GLU C 3 68 ? 30.689  30.931  140.160 1.00 63.39 ? 75   GLU A CD    1 
ATOM   1379 O  OE1   . GLU C 3 68 ? 30.800  31.117  141.402 1.00 67.38 ? 75   GLU A OE1   1 
ATOM   1380 O  OE2   . GLU C 3 68 ? 31.550  31.424  139.359 1.00 66.54 ? 75   GLU A OE2   1 
ATOM   1381 N  N     . ASP C 3 69 ? 28.727  27.655  139.316 1.00 58.15 ? 76   ASP A N     1 
ATOM   1382 C  CA    . ASP C 3 69 ? 29.141  26.755  138.283 1.00 57.88 ? 76   ASP A CA    1 
ATOM   1383 C  C     . ASP C 3 69 ? 28.484  25.396  138.197 1.00 56.74 ? 76   ASP A C     1 
ATOM   1384 O  O     . ASP C 3 69 ? 29.126  24.348  138.231 1.00 56.99 ? 76   ASP A O     1 
ATOM   1385 C  CB    . ASP C 3 69 ? 30.677  26.778  138.114 1.00 59.46 ? 76   ASP A CB    1 
ATOM   1386 C  CG    . ASP C 3 69 ? 31.113  26.655  136.617 1.00 63.89 ? 76   ASP A CG    1 
ATOM   1387 O  OD1   . ASP C 3 69 ? 30.640  27.432  135.733 1.00 65.26 ? 76   ASP A OD1   1 
ATOM   1388 O  OD2   . ASP C 3 69 ? 31.932  25.746  136.311 1.00 69.44 ? 76   ASP A OD2   1 
ATOM   1389 N  N     . LEU C 3 70 ? 27.173  25.438  138.055 1.00 55.07 ? 77   LEU A N     1 
ATOM   1390 C  CA    . LEU C 3 70 ? 26.397  24.319  137.621 1.00 54.69 ? 77   LEU A CA    1 
ATOM   1391 C  C     . LEU C 3 70 ? 27.156  23.629  136.471 1.00 55.33 ? 77   LEU A C     1 
ATOM   1392 O  O     . LEU C 3 70 ? 27.123  22.389  136.310 1.00 54.71 ? 77   LEU A O     1 
ATOM   1393 C  CB    . LEU C 3 70 ? 25.049  24.816  137.145 1.00 52.96 ? 77   LEU A CB    1 
ATOM   1394 C  CG    . LEU C 3 70 ? 23.898  23.823  137.128 1.00 52.16 ? 77   LEU A CG    1 
ATOM   1395 C  CD1   . LEU C 3 70 ? 22.842  24.298  136.169 1.00 48.59 ? 77   LEU A CD1   1 
ATOM   1396 C  CD2   . LEU C 3 70 ? 24.372  22.592  136.661 1.00 45.79 ? 77   LEU A CD2   1 
ATOM   1397 N  N     . ASP C 3 71 ? 27.878  24.447  135.713 1.00 54.87 ? 78   ASP A N     1 
ATOM   1398 C  CA    . ASP C 3 71 ? 28.683  23.940  134.631 1.00 55.85 ? 78   ASP A CA    1 
ATOM   1399 C  C     . ASP C 3 71 ? 29.879  23.133  135.156 1.00 54.22 ? 78   ASP A C     1 
ATOM   1400 O  O     . ASP C 3 71 ? 30.477  22.337  134.439 1.00 52.60 ? 78   ASP A O     1 
ATOM   1401 C  CB    . ASP C 3 71 ? 29.136  25.121  133.745 1.00 57.52 ? 78   ASP A CB    1 
ATOM   1402 C  CG    . ASP C 3 71 ? 28.171  25.408  132.518 1.00 64.53 ? 78   ASP A CG    1 
ATOM   1403 O  OD1   . ASP C 3 71 ? 26.920  25.711  132.704 1.00 69.26 ? 78   ASP A OD1   1 
ATOM   1404 O  OD2   . ASP C 3 71 ? 28.712  25.414  131.356 1.00 70.22 ? 78   ASP A OD2   1 
ATOM   1405 N  N     . MET C 3 72 ? 30.251  23.357  136.399 1.00 54.03 ? 79   MET A N     1 
ATOM   1406 C  CA    . MET C 3 72 ? 31.402  22.654  136.933 1.00 56.45 ? 79   MET A CA    1 
ATOM   1407 C  C     . MET C 3 72 ? 30.853  21.270  137.077 1.00 53.21 ? 79   MET A C     1 
ATOM   1408 O  O     . MET C 3 72 ? 31.389  20.315  136.475 1.00 53.54 ? 79   MET A O     1 
ATOM   1409 C  CB    . MET C 3 72 ? 31.873  23.260  138.282 1.00 56.35 ? 79   MET A CB    1 
ATOM   1410 C  CG    . MET C 3 72 ? 31.741  22.335  139.572 1.00 61.56 ? 79   MET A CG    1 
ATOM   1411 S  SD    . MET C 3 72 ? 31.379  23.067  141.292 1.00 65.49 ? 79   MET A SD    1 
ATOM   1412 C  CE    . MET C 3 72 ? 32.120  24.777  141.342 1.00 68.42 ? 79   MET A CE    1 
ATOM   1413 N  N     . ILE C 3 73 ? 29.719  21.195  137.796 1.00 50.50 ? 80   ILE A N     1 
ATOM   1414 C  CA    . ILE C 3 73 ? 29.017  19.945  138.032 1.00 47.10 ? 80   ILE A CA    1 
ATOM   1415 C  C     . ILE C 3 73 ? 28.674  19.252  136.755 1.00 46.16 ? 80   ILE A C     1 
ATOM   1416 O  O     . ILE C 3 73 ? 28.797  18.056  136.692 1.00 46.11 ? 80   ILE A O     1 
ATOM   1417 C  CB    . ILE C 3 73 ? 27.703  20.129  138.718 1.00 47.11 ? 80   ILE A CB    1 
ATOM   1418 C  CG1   . ILE C 3 73 ? 27.740  21.312  139.634 1.00 47.20 ? 80   ILE A CG1   1 
ATOM   1419 C  CG2   . ILE C 3 73 ? 27.262  18.858  139.358 1.00 40.80 ? 80   ILE A CG2   1 
ATOM   1420 C  CD1   . ILE C 3 73 ? 26.790  21.130  140.816 1.00 50.99 ? 80   ILE A CD1   1 
ATOM   1421 N  N     . LEU C 3 74 ? 28.175  19.972  135.760 1.00 44.77 ? 81   LEU A N     1 
ATOM   1422 C  CA    . LEU C 3 74 ? 27.721  19.314  134.561 1.00 45.55 ? 81   LEU A CA    1 
ATOM   1423 C  C     . LEU C 3 74 ? 28.825  18.589  133.817 1.00 46.12 ? 81   LEU A C     1 
ATOM   1424 O  O     . LEU C 3 74 ? 28.569  17.688  133.029 1.00 47.11 ? 81   LEU A O     1 
ATOM   1425 C  CB    . LEU C 3 74 ? 27.015  20.272  133.614 1.00 46.91 ? 81   LEU A CB    1 
ATOM   1426 C  CG    . LEU C 3 74 ? 25.676  20.846  134.046 1.00 46.57 ? 81   LEU A CG    1 
ATOM   1427 C  CD1   . LEU C 3 74 ? 25.138  21.528  132.903 1.00 48.37 ? 81   LEU A CD1   1 
ATOM   1428 C  CD2   . LEU C 3 74 ? 24.729  19.825  134.418 1.00 40.82 ? 81   LEU A CD2   1 
ATOM   1429 N  N     . LYS C 3 75 ? 30.061  18.941  134.110 1.00 46.84 ? 82   LYS A N     1 
ATOM   1430 C  CA    . LYS C 3 75 ? 31.205  18.302  133.444 1.00 47.73 ? 82   LYS A CA    1 
ATOM   1431 C  C     . LYS C 3 75 ? 31.762  17.026  134.128 1.00 47.20 ? 82   LYS A C     1 
ATOM   1432 O  O     . LYS C 3 75 ? 32.505  16.226  133.565 1.00 47.85 ? 82   LYS A O     1 
ATOM   1433 C  CB    . LYS C 3 75 ? 32.284  19.339  133.192 1.00 47.54 ? 82   LYS A CB    1 
ATOM   1434 C  CG    . LYS C 3 75 ? 32.032  20.015  131.792 1.00 50.95 ? 82   LYS A CG    1 
ATOM   1435 C  CD    . LYS C 3 75 ? 33.091  21.038  131.444 1.00 56.51 ? 82   LYS A CD    1 
ATOM   1436 C  CE    . LYS C 3 75 ? 32.606  22.445  131.758 1.00 60.55 ? 82   LYS A CE    1 
ATOM   1437 N  NZ    . LYS C 3 75 ? 33.755  23.405  132.009 1.00 65.58 ? 82   LYS A NZ    1 
ATOM   1438 N  N     . MET C 3 76 ? 31.368  16.814  135.356 1.00 45.87 ? 83   MET A N     1 
ATOM   1439 C  CA    . MET C 3 76 ? 31.849  15.676  136.041 1.00 44.47 ? 83   MET A CA    1 
ATOM   1440 C  C     . MET C 3 76 ? 31.137  14.438  135.524 1.00 41.39 ? 83   MET A C     1 
ATOM   1441 O  O     . MET C 3 76 ? 30.042  14.527  134.927 1.00 38.57 ? 83   MET A O     1 
ATOM   1442 C  CB    . MET C 3 76 ? 31.645  15.863  137.527 1.00 44.06 ? 83   MET A CB    1 
ATOM   1443 C  CG    . MET C 3 76 ? 32.543  16.903  138.092 1.00 41.36 ? 83   MET A CG    1 
ATOM   1444 S  SD    . MET C 3 76 ? 32.114  16.753  139.848 1.00 50.71 ? 83   MET A SD    1 
ATOM   1445 C  CE    . MET C 3 76 ? 30.751  17.881  139.812 1.00 39.35 ? 83   MET A CE    1 
ATOM   1446 N  N     . ASP C 3 77 ? 31.826  13.310  135.775 1.00 40.22 ? 84   ASP A N     1 
ATOM   1447 C  CA    . ASP C 3 77 ? 31.587  12.029  135.119 1.00 38.14 ? 84   ASP A CA    1 
ATOM   1448 C  C     . ASP C 3 77 ? 31.467  11.039  136.228 1.00 36.22 ? 84   ASP A C     1 
ATOM   1449 O  O     . ASP C 3 77 ? 30.888  9.979   136.049 1.00 38.40 ? 84   ASP A O     1 
ATOM   1450 C  CB    . ASP C 3 77 ? 32.735  11.620  134.221 1.00 37.74 ? 84   ASP A CB    1 
ATOM   1451 C  CG    . ASP C 3 77 ? 32.526  10.246  133.595 1.00 43.62 ? 84   ASP A CG    1 
ATOM   1452 O  OD1   . ASP C 3 77 ? 33.128  9.241   134.105 1.00 49.94 ? 84   ASP A OD1   1 
ATOM   1453 O  OD2   . ASP C 3 77 ? 31.753  10.120  132.622 1.00 42.95 ? 84   ASP A OD2   1 
ATOM   1454 N  N     . SER C 3 78 ? 31.978  11.326  137.395 1.00 33.42 ? 85   SER A N     1 
ATOM   1455 C  CA    . SER C 3 78 ? 31.812  10.343  138.403 1.00 30.55 ? 85   SER A CA    1 
ATOM   1456 C  C     . SER C 3 78 ? 30.509  10.451  139.249 1.00 30.89 ? 85   SER A C     1 
ATOM   1457 O  O     . SER C 3 78 ? 30.200  11.478  139.799 1.00 32.25 ? 85   SER A O     1 
ATOM   1458 C  CB    . SER C 3 78 ? 32.954  10.381  139.313 1.00 28.87 ? 85   SER A CB    1 
ATOM   1459 O  OG    . SER C 3 78 ? 32.401  9.797   140.499 1.00 30.44 ? 85   SER A OG    1 
ATOM   1460 N  N     . LEU C 3 79 ? 29.776  9.374   139.370 1.00 30.16 ? 86   LEU A N     1 
ATOM   1461 C  CA    . LEU C 3 79 ? 28.587  9.314   140.135 1.00 31.07 ? 86   LEU A CA    1 
ATOM   1462 C  C     . LEU C 3 79 ? 28.834  9.449   141.643 1.00 33.03 ? 86   LEU A C     1 
ATOM   1463 O  O     . LEU C 3 79 ? 28.269  10.340  142.241 1.00 34.91 ? 86   LEU A O     1 
ATOM   1464 C  CB    . LEU C 3 79 ? 27.934  7.967   139.877 1.00 29.91 ? 86   LEU A CB    1 
ATOM   1465 C  CG    . LEU C 3 79 ? 26.725  7.847   138.986 1.00 28.88 ? 86   LEU A CG    1 
ATOM   1466 C  CD1   . LEU C 3 79 ? 26.661  8.916   137.928 1.00 30.92 ? 86   LEU A CD1   1 
ATOM   1467 C  CD2   . LEU C 3 79 ? 26.786  6.567   138.360 1.00 25.21 ? 86   LEU A CD2   1 
ATOM   1468 N  N     . GLN C 3 80 ? 29.608  8.577   142.294 1.00 35.02 ? 87   GLN A N     1 
ATOM   1469 C  CA    . GLN C 3 80 ? 29.968  8.868   143.684 1.00 37.28 ? 87   GLN A CA    1 
ATOM   1470 C  C     . GLN C 3 80 ? 30.293  10.381  143.735 1.00 38.37 ? 87   GLN A C     1 
ATOM   1471 O  O     . GLN C 3 80 ? 29.681  11.114  144.493 1.00 38.87 ? 87   GLN A O     1 
ATOM   1472 C  CB    . GLN C 3 80 ? 31.197  8.121   144.252 1.00 37.62 ? 87   GLN A CB    1 
ATOM   1473 C  CG    . GLN C 3 80 ? 31.527  6.622   143.938 1.00 43.52 ? 87   GLN A CG    1 
ATOM   1474 C  CD    . GLN C 3 80 ? 30.589  5.584   144.592 1.00 49.53 ? 87   GLN A CD    1 
ATOM   1475 O  OE1   . GLN C 3 80 ? 30.989  4.407   144.865 1.00 49.41 ? 87   GLN A OE1   1 
ATOM   1476 N  NE2   . GLN C 3 80 ? 29.316  6.006   144.823 1.00 50.13 ? 87   GLN A NE2   1 
ATOM   1477 N  N     . ASP C 3 81 ? 31.234  10.860  142.915 1.00 39.08 ? 88   ASP A N     1 
ATOM   1478 C  CA    . ASP C 3 81 ? 31.783  12.194  143.163 1.00 39.51 ? 88   ASP A CA    1 
ATOM   1479 C  C     . ASP C 3 81 ? 30.674  13.202  143.143 1.00 39.56 ? 88   ASP A C     1 
ATOM   1480 O  O     . ASP C 3 81 ? 30.565  14.033  144.060 1.00 40.32 ? 88   ASP A O     1 
ATOM   1481 C  CB    . ASP C 3 81 ? 32.724  12.608  142.075 1.00 39.49 ? 88   ASP A CB    1 
ATOM   1482 C  CG    . ASP C 3 81 ? 34.147  12.239  142.347 1.00 43.33 ? 88   ASP A CG    1 
ATOM   1483 O  OD1   . ASP C 3 81 ? 34.494  11.485  143.357 1.00 43.28 ? 88   ASP A OD1   1 
ATOM   1484 O  OD2   . ASP C 3 81 ? 34.915  12.714  141.464 1.00 43.69 ? 88   ASP A OD2   1 
ATOM   1485 N  N     . ILE C 3 82 ? 29.854  13.143  142.087 1.00 38.19 ? 89   ILE A N     1 
ATOM   1486 C  CA    . ILE C 3 82 ? 28.817  14.087  141.972 1.00 36.53 ? 89   ILE A CA    1 
ATOM   1487 C  C     . ILE C 3 82 ? 27.897  13.993  143.190 1.00 39.61 ? 89   ILE A C     1 
ATOM   1488 O  O     . ILE C 3 82 ? 27.320  14.991  143.621 1.00 40.23 ? 89   ILE A O     1 
ATOM   1489 C  CB    . ILE C 3 82 ? 28.017  13.879  140.755 1.00 34.39 ? 89   ILE A CB    1 
ATOM   1490 C  CG1   . ILE C 3 82 ? 28.816  14.226  139.508 1.00 29.29 ? 89   ILE A CG1   1 
ATOM   1491 C  CG2   . ILE C 3 82 ? 26.713  14.676  140.871 1.00 28.86 ? 89   ILE A CG2   1 
ATOM   1492 C  CD1   . ILE C 3 82 ? 28.022  13.816  138.211 1.00 21.58 ? 89   ILE A CD1   1 
ATOM   1493 N  N     . LYS C 3 83 ? 27.765  12.812  143.767 1.00 41.33 ? 90   LYS A N     1 
ATOM   1494 C  CA    . LYS C 3 83 ? 26.791  12.687  144.814 1.00 44.76 ? 90   LYS A CA    1 
ATOM   1495 C  C     . LYS C 3 83 ? 27.454  13.133  146.116 1.00 44.67 ? 90   LYS A C     1 
ATOM   1496 O  O     . LYS C 3 83 ? 26.780  13.413  147.099 1.00 44.99 ? 90   LYS A O     1 
ATOM   1497 C  CB    . LYS C 3 83 ? 26.284  11.246  144.876 1.00 44.29 ? 90   LYS A CB    1 
ATOM   1498 C  CG    . LYS C 3 83 ? 24.896  11.033  145.504 1.00 49.33 ? 90   LYS A CG    1 
ATOM   1499 C  CD    . LYS C 3 83 ? 24.630  9.461   145.777 1.00 48.85 ? 90   LYS A CD    1 
ATOM   1500 C  CE    . LYS C 3 83 ? 24.434  8.615   144.394 1.00 51.88 ? 90   LYS A CE    1 
ATOM   1501 N  NZ    . LYS C 3 83 ? 24.110  7.097   144.423 1.00 54.02 ? 90   LYS A NZ    1 
ATOM   1502 N  N     . ALA C 3 84 ? 28.783  13.192  146.141 1.00 45.85 ? 91   ALA A N     1 
ATOM   1503 C  CA    . ALA C 3 84 ? 29.485  13.509  147.399 1.00 46.84 ? 91   ALA A CA    1 
ATOM   1504 C  C     . ALA C 3 84 ? 29.273  15.002  147.501 1.00 47.74 ? 91   ALA A C     1 
ATOM   1505 O  O     . ALA C 3 84 ? 28.911  15.548  148.545 1.00 48.23 ? 91   ALA A O     1 
ATOM   1506 C  CB    . ALA C 3 84 ? 30.972  13.160  147.316 1.00 45.95 ? 91   ALA A CB    1 
ATOM   1507 N  N     . LEU C 3 85 ? 29.405  15.611  146.338 1.00 47.94 ? 92   LEU A N     1 
ATOM   1508 C  CA    . LEU C 3 85 ? 29.304  17.008  146.149 1.00 48.67 ? 92   LEU A CA    1 
ATOM   1509 C  C     . LEU C 3 85 ? 27.959  17.466  146.570 1.00 49.63 ? 92   LEU A C     1 
ATOM   1510 O  O     . LEU C 3 85 ? 27.823  18.351  147.388 1.00 51.27 ? 92   LEU A O     1 
ATOM   1511 C  CB    . LEU C 3 85 ? 29.479  17.259  144.659 1.00 48.99 ? 92   LEU A CB    1 
ATOM   1512 C  CG    . LEU C 3 85 ? 29.911  18.567  144.036 1.00 46.79 ? 92   LEU A CG    1 
ATOM   1513 C  CD1   . LEU C 3 85 ? 28.681  19.425  144.075 1.00 46.11 ? 92   LEU A CD1   1 
ATOM   1514 C  CD2   . LEU C 3 85 ? 31.076  19.123  144.808 1.00 45.81 ? 92   LEU A CD2   1 
ATOM   1515 N  N     . LEU C 3 86 ? 26.937  16.869  146.016 1.00 50.46 ? 93   LEU A N     1 
ATOM   1516 C  CA    . LEU C 3 86 ? 25.640  17.417  146.220 1.00 51.36 ? 93   LEU A CA    1 
ATOM   1517 C  C     . LEU C 3 86 ? 25.266  17.320  147.671 1.00 52.83 ? 93   LEU A C     1 
ATOM   1518 O  O     . LEU C 3 86 ? 24.514  18.133  148.179 1.00 52.64 ? 93   LEU A O     1 
ATOM   1519 C  CB    . LEU C 3 86 ? 24.664  16.638  145.409 1.00 50.74 ? 93   LEU A CB    1 
ATOM   1520 C  CG    . LEU C 3 86 ? 24.961  16.874  143.945 1.00 49.26 ? 93   LEU A CG    1 
ATOM   1521 C  CD1   . LEU C 3 86 ? 24.178  15.838  143.235 1.00 47.15 ? 93   LEU A CD1   1 
ATOM   1522 C  CD2   . LEU C 3 86 ? 24.525  18.265  143.553 1.00 50.69 ? 93   LEU A CD2   1 
ATOM   1523 N  N     . THR C 3 87 ? 25.805  16.345  148.371 1.00 54.26 ? 94   THR A N     1 
ATOM   1524 C  CA    . THR C 3 87 ? 25.379  16.228  149.748 1.00 56.93 ? 94   THR A CA    1 
ATOM   1525 C  C     . THR C 3 87 ? 25.862  17.394  150.593 1.00 58.15 ? 94   THR A C     1 
ATOM   1526 O  O     . THR C 3 87 ? 25.461  17.511  151.745 1.00 57.94 ? 94   THR A O     1 
ATOM   1527 C  CB    . THR C 3 87 ? 25.653  14.850  150.376 1.00 56.75 ? 94   THR A CB    1 
ATOM   1528 O  OG1   . THR C 3 87 ? 27.018  14.487  150.153 1.00 57.99 ? 94   THR A OG1   1 
ATOM   1529 C  CG2   . THR C 3 87 ? 24.744  13.836  149.728 1.00 56.88 ? 94   THR A CG2   1 
ATOM   1530 N  N     . GLY C 3 88 ? 26.685  18.264  149.982 1.00 59.95 ? 95   GLY A N     1 
ATOM   1531 C  CA    . GLY C 3 88 ? 26.766  19.716  150.329 1.00 61.13 ? 95   GLY A CA    1 
ATOM   1532 C  C     . GLY C 3 88 ? 25.616  20.521  149.693 1.00 61.91 ? 95   GLY A C     1 
ATOM   1533 O  O     . GLY C 3 88 ? 25.819  21.447  148.868 1.00 60.73 ? 95   GLY A O     1 
ATOM   1534 N  N     . LEU C 3 89 ? 24.399  20.108  150.072 1.00 63.38 ? 96   LEU A N     1 
ATOM   1535 C  CA    . LEU C 3 89 ? 23.118  20.820  149.816 1.00 64.70 ? 96   LEU A CA    1 
ATOM   1536 C  C     . LEU C 3 89 ? 22.744  21.703  151.041 1.00 64.95 ? 96   LEU A C     1 
ATOM   1537 O  O     . LEU C 3 89 ? 21.557  21.934  151.351 1.00 65.46 ? 96   LEU A O     1 
ATOM   1538 C  CB    . LEU C 3 89 ? 21.982  19.813  149.487 1.00 64.18 ? 96   LEU A CB    1 
ATOM   1539 C  CG    . LEU C 3 89 ? 21.914  19.433  147.985 1.00 66.13 ? 96   LEU A CG    1 
ATOM   1540 C  CD1   . LEU C 3 89 ? 21.415  17.999  147.765 1.00 63.44 ? 96   LEU A CD1   1 
ATOM   1541 C  CD2   . LEU C 3 89 ? 21.164  20.483  147.046 1.00 65.45 ? 96   LEU A CD2   1 
ATOM   1542 N  N     . GLU D 3 1  ? 10.908  40.228  97.930  1.00 63.64 ? 8    GLU B N     1 
ATOM   1543 C  CA    . GLU D 3 1  ? 10.257  39.022  98.475  1.00 63.86 ? 8    GLU B CA    1 
ATOM   1544 C  C     . GLU D 3 1  ? 9.257   39.220  99.638  1.00 62.97 ? 8    GLU B C     1 
ATOM   1545 O  O     . GLU D 3 1  ? 8.187   38.588  99.639  1.00 62.44 ? 8    GLU B O     1 
ATOM   1546 C  CB    . GLU D 3 1  ? 11.336  38.037  98.903  1.00 65.28 ? 8    GLU B CB    1 
ATOM   1547 C  CG    . GLU D 3 1  ? 11.847  37.224  97.741  1.00 67.92 ? 8    GLU B CG    1 
ATOM   1548 C  CD    . GLU D 3 1  ? 11.021  35.973  97.545  1.00 70.46 ? 8    GLU B CD    1 
ATOM   1549 O  OE1   . GLU D 3 1  ? 11.650  34.867  97.711  1.00 69.10 ? 8    GLU B OE1   1 
ATOM   1550 O  OE2   . GLU D 3 1  ? 9.776   36.138  97.258  1.00 67.93 ? 8    GLU B OE2   1 
ATOM   1551 N  N     . GLN D 3 2  ? 9.603   40.062  100.627 1.00 61.44 ? 9    GLN B N     1 
ATOM   1552 C  CA    . GLN D 3 2  ? 8.820   40.140  101.891 1.00 60.04 ? 9    GLN B CA    1 
ATOM   1553 C  C     . GLN D 3 2  ? 7.460   40.763  101.692 1.00 57.87 ? 9    GLN B C     1 
ATOM   1554 O  O     . GLN D 3 2  ? 7.333   41.824  101.108 1.00 58.11 ? 9    GLN B O     1 
ATOM   1555 C  CB    . GLN D 3 2  ? 9.595   40.854  103.018 1.00 60.17 ? 9    GLN B CB    1 
ATOM   1556 C  CG    . GLN D 3 2  ? 8.866   41.011  104.411 1.00 61.32 ? 9    GLN B CG    1 
ATOM   1557 C  CD    . GLN D 3 2  ? 9.823   41.448  105.616 1.00 62.31 ? 9    GLN B CD    1 
ATOM   1558 O  OE1   . GLN D 3 2  ? 11.021  41.070  105.716 1.00 64.11 ? 9    GLN B OE1   1 
ATOM   1559 N  NE2   . GLN D 3 2  ? 9.260   42.227  106.524 1.00 64.26 ? 9    GLN B NE2   1 
ATOM   1560 N  N     . ALA D 3 3  ? 6.443   40.068  102.168 1.00 55.19 ? 10   ALA B N     1 
ATOM   1561 C  CA    . ALA D 3 3  ? 5.103   40.561  102.119 1.00 52.61 ? 10   ALA B CA    1 
ATOM   1562 C  C     . ALA D 3 3  ? 4.860   41.400  103.373 1.00 52.49 ? 10   ALA B C     1 
ATOM   1563 O  O     . ALA D 3 3  ? 5.527   41.203  104.451 1.00 52.22 ? 10   ALA B O     1 
ATOM   1564 C  CB    . ALA D 3 3  ? 4.114   39.411  102.003 1.00 50.99 ? 10   ALA B CB    1 
ATOM   1565 N  N     . CYS D 3 4  ? 3.917   42.330  103.223 1.00 50.32 ? 11   CYS B N     1 
ATOM   1566 C  CA    . CYS D 3 4  ? 3.562   43.240  104.269 1.00 50.60 ? 11   CYS B CA    1 
ATOM   1567 C  C     . CYS D 3 4  ? 2.833   42.473  105.343 1.00 52.47 ? 11   CYS B C     1 
ATOM   1568 O  O     . CYS D 3 4  ? 2.221   41.427  105.052 1.00 52.27 ? 11   CYS B O     1 
ATOM   1569 C  CB    . CYS D 3 4  ? 2.682   44.386  103.735 1.00 49.82 ? 11   CYS B CB    1 
ATOM   1570 S  SG    . CYS D 3 4  ? 0.921   43.966  103.544 1.00 45.95 ? 11   CYS B SG    1 
ATOM   1571 N  N     . ASP D 3 5  ? 2.866   42.999  106.578 1.00 54.19 ? 12   ASP B N     1 
ATOM   1572 C  CA    . ASP D 3 5  ? 2.298   42.299  107.741 1.00 56.57 ? 12   ASP B CA    1 
ATOM   1573 C  C     . ASP D 3 5  ? 0.865   41.786  107.602 1.00 57.25 ? 12   ASP B C     1 
ATOM   1574 O  O     . ASP D 3 5  ? 0.538   40.648  107.990 1.00 57.97 ? 12   ASP B O     1 
ATOM   1575 C  CB    . ASP D 3 5  ? 2.471   43.158  108.952 1.00 56.68 ? 12   ASP B CB    1 
ATOM   1576 C  CG    . ASP D 3 5  ? 3.907   43.214  109.376 1.00 62.21 ? 12   ASP B CG    1 
ATOM   1577 O  OD1   . ASP D 3 5  ? 4.826   42.836  108.556 1.00 66.75 ? 12   ASP B OD1   1 
ATOM   1578 O  OD2   . ASP D 3 5  ? 4.114   43.597  110.545 1.00 65.87 ? 12   ASP B OD2   1 
ATOM   1579 N  N     . ILE D 3 6  ? 0.062   42.610  106.953 1.00 57.50 ? 13   ILE B N     1 
ATOM   1580 C  CA    . ILE D 3 6  ? -1.343  42.401  106.824 1.00 57.87 ? 13   ILE B CA    1 
ATOM   1581 C  C     . ILE D 3 6  ? -1.600  41.343  105.715 1.00 57.86 ? 13   ILE B C     1 
ATOM   1582 O  O     . ILE D 3 6  ? -2.292  40.330  105.945 1.00 58.00 ? 13   ILE B O     1 
ATOM   1583 C  CB    . ILE D 3 6  ? -2.022  43.821  106.596 1.00 58.63 ? 13   ILE B CB    1 
ATOM   1584 C  CG1   . ILE D 3 6  ? -1.806  44.762  107.842 1.00 59.18 ? 13   ILE B CG1   1 
ATOM   1585 C  CG2   . ILE D 3 6  ? -3.513  43.712  106.184 1.00 56.69 ? 13   ILE B CG2   1 
ATOM   1586 C  CD1   . ILE D 3 6  ? -0.304  45.277  108.127 1.00 55.01 ? 13   ILE B CD1   1 
ATOM   1587 N  N     . CYS D 3 7  ? -1.042  41.556  104.525 1.00 57.16 ? 14   CYS B N     1 
ATOM   1588 C  CA    . CYS D 3 7  ? -1.107  40.501  103.517 1.00 56.95 ? 14   CYS B CA    1 
ATOM   1589 C  C     . CYS D 3 7  ? -0.616  39.152  104.108 1.00 57.90 ? 14   CYS B C     1 
ATOM   1590 O  O     . CYS D 3 7  ? -1.203  38.114  103.794 1.00 57.11 ? 14   CYS B O     1 
ATOM   1591 C  CB    . CYS D 3 7  ? -0.339  40.834  102.203 1.00 57.05 ? 14   CYS B CB    1 
ATOM   1592 S  SG    . CYS D 3 7  ? -0.650  42.466  101.333 1.00 52.64 ? 14   CYS B SG    1 
ATOM   1593 N  N     . ARG D 3 8  ? 0.431   39.162  104.961 1.00 58.57 ? 15   ARG B N     1 
ATOM   1594 C  CA    . ARG D 3 8  ? 0.928   37.898  105.522 1.00 59.72 ? 15   ARG B CA    1 
ATOM   1595 C  C     . ARG D 3 8  ? -0.215  37.356  106.335 1.00 59.20 ? 15   ARG B C     1 
ATOM   1596 O  O     . ARG D 3 8  ? -0.558  36.184  106.218 1.00 58.93 ? 15   ARG B O     1 
ATOM   1597 C  CB    . ARG D 3 8  ? 2.210   37.986  106.413 1.00 60.20 ? 15   ARG B CB    1 
ATOM   1598 C  CG    . ARG D 3 8  ? 3.467   38.633  105.769 1.00 62.57 ? 15   ARG B CG    1 
ATOM   1599 C  CD    . ARG D 3 8  ? 4.541   39.141  106.792 1.00 60.59 ? 15   ARG B CD    1 
ATOM   1600 N  NE    . ARG D 3 8  ? 5.679   38.232  106.858 1.00 59.60 ? 15   ARG B NE    1 
ATOM   1601 C  CZ    . ARG D 3 8  ? 6.938   38.575  107.133 1.00 59.67 ? 15   ARG B CZ    1 
ATOM   1602 N  NH1   . ARG D 3 8  ? 7.323   39.803  107.404 1.00 60.13 ? 15   ARG B NH1   1 
ATOM   1603 N  NH2   . ARG D 3 8  ? 7.847   37.645  107.141 1.00 65.24 ? 15   ARG B NH2   1 
ATOM   1604 N  N     . LEU D 3 9  ? -0.824  38.210  107.142 1.00 59.11 ? 16   LEU B N     1 
ATOM   1605 C  CA    . LEU D 3 9  ? -1.750  37.701  108.109 1.00 59.90 ? 16   LEU B CA    1 
ATOM   1606 C  C     . LEU D 3 9  ? -2.958  37.224  107.359 1.00 59.64 ? 16   LEU B C     1 
ATOM   1607 O  O     . LEU D 3 9  ? -3.604  36.269  107.751 1.00 58.82 ? 16   LEU B O     1 
ATOM   1608 C  CB    . LEU D 3 9  ? -2.110  38.778  109.102 1.00 61.03 ? 16   LEU B CB    1 
ATOM   1609 C  CG    . LEU D 3 9  ? -2.526  38.369  110.510 1.00 63.54 ? 16   LEU B CG    1 
ATOM   1610 C  CD1   . LEU D 3 9  ? -1.588  37.365  111.052 1.00 64.49 ? 16   LEU B CD1   1 
ATOM   1611 C  CD2   . LEU D 3 9  ? -2.522  39.636  111.387 1.00 66.75 ? 16   LEU B CD2   1 
ATOM   1612 N  N     . LYS D 3 10 ? -3.240  37.855  106.234 1.00 59.91 ? 17   LYS B N     1 
ATOM   1613 C  CA    . LYS D 3 10 ? -4.424  37.467  105.516 1.00 60.14 ? 17   LYS B CA    1 
ATOM   1614 C  C     . LYS D 3 10 ? -4.197  36.404  104.442 1.00 59.80 ? 17   LYS B C     1 
ATOM   1615 O  O     . LYS D 3 10 ? -5.143  35.717  104.017 1.00 59.75 ? 17   LYS B O     1 
ATOM   1616 C  CB    . LYS D 3 10 ? -5.139  38.685  104.971 1.00 60.22 ? 17   LYS B CB    1 
ATOM   1617 C  CG    . LYS D 3 10 ? -6.161  39.217  105.914 1.00 61.04 ? 17   LYS B CG    1 
ATOM   1618 C  CD    . LYS D 3 10 ? -7.060  40.317  105.208 1.00 64.36 ? 17   LYS B CD    1 
ATOM   1619 C  CE    . LYS D 3 10 ? -7.973  41.162  106.169 1.00 60.40 ? 17   LYS B CE    1 
ATOM   1620 N  NZ    . LYS D 3 10 ? -8.202  40.495  107.487 1.00 59.73 ? 17   LYS B NZ    1 
ATOM   1621 N  N     . LYS D 3 11 ? -2.951  36.265  104.009 1.00 59.46 ? 18   LYS B N     1 
ATOM   1622 C  CA    . LYS D 3 11 ? -2.577  35.252  103.009 1.00 59.29 ? 18   LYS B CA    1 
ATOM   1623 C  C     . LYS D 3 11 ? -3.033  35.533  101.543 1.00 60.05 ? 18   LYS B C     1 
ATOM   1624 O  O     . LYS D 3 11 ? -3.283  34.634  100.736 1.00 59.87 ? 18   LYS B O     1 
ATOM   1625 C  CB    . LYS D 3 11 ? -2.966  33.856  103.460 1.00 58.43 ? 18   LYS B CB    1 
ATOM   1626 C  CG    . LYS D 3 11 ? -2.343  33.433  104.725 1.00 55.75 ? 18   LYS B CG    1 
ATOM   1627 C  CD    . LYS D 3 11 ? -2.405  31.944  104.814 1.00 52.31 ? 18   LYS B CD    1 
ATOM   1628 C  CE    . LYS D 3 11 ? -2.300  31.449  106.241 1.00 50.17 ? 18   LYS B CE    1 
ATOM   1629 N  NZ    . LYS D 3 11 ? -2.361  29.951  106.203 1.00 50.03 ? 18   LYS B NZ    1 
ATOM   1630 N  N     . LEU D 3 12 ? -3.046  36.805  101.201 1.00 61.11 ? 19   LEU B N     1 
ATOM   1631 C  CA    . LEU D 3 12 ? -3.317  37.235  99.834  1.00 63.23 ? 19   LEU B CA    1 
ATOM   1632 C  C     . LEU D 3 12 ? -2.019  37.828  99.259  1.00 64.25 ? 19   LEU B C     1 
ATOM   1633 O  O     . LEU D 3 12 ? -1.177  38.358  100.021 1.00 64.16 ? 19   LEU B O     1 
ATOM   1634 C  CB    . LEU D 3 12 ? -4.490  38.261  99.796  1.00 63.05 ? 19   LEU B CB    1 
ATOM   1635 C  CG    . LEU D 3 12 ? -5.662  37.880  100.743 1.00 63.04 ? 19   LEU B CG    1 
ATOM   1636 C  CD1   . LEU D 3 12 ? -5.757  38.806  102.005 1.00 60.11 ? 19   LEU B CD1   1 
ATOM   1637 C  CD2   . LEU D 3 12 ? -7.038  37.598  100.028 1.00 64.72 ? 19   LEU B CD2   1 
ATOM   1638 N  N     . LYS D 3 13 ? -1.869  37.722  97.926  1.00 64.96 ? 20   LYS B N     1 
ATOM   1639 C  CA    . LYS D 3 13 ? -0.756  38.337  97.194  1.00 64.99 ? 20   LYS B CA    1 
ATOM   1640 C  C     . LYS D 3 13 ? -0.543  39.797  97.647  1.00 65.16 ? 20   LYS B C     1 
ATOM   1641 O  O     . LYS D 3 13 ? -1.508  40.573  97.829  1.00 64.55 ? 20   LYS B O     1 
ATOM   1642 C  CB    . LYS D 3 13 ? -1.027  38.245  95.705  1.00 64.61 ? 20   LYS B CB    1 
ATOM   1643 C  CG    . LYS D 3 13 ? 0.148   38.494  94.836  1.00 66.27 ? 20   LYS B CG    1 
ATOM   1644 C  CD    . LYS D 3 13 ? 0.331   37.286  93.925  1.00 71.55 ? 20   LYS B CD    1 
ATOM   1645 C  CE    . LYS D 3 13 ? 1.294   37.593  92.785  1.00 73.47 ? 20   LYS B CE    1 
ATOM   1646 N  NZ    . LYS D 3 13 ? 0.943   38.972  92.340  1.00 70.94 ? 20   LYS B NZ    1 
ATOM   1647 N  N     . CYS D 3 14 ? 0.715   40.130  97.926  1.00 64.83 ? 21   CYS B N     1 
ATOM   1648 C  CA    . CYS D 3 14 ? 1.076   41.491  98.246  1.00 64.84 ? 21   CYS B CA    1 
ATOM   1649 C  C     . CYS D 3 14 ? 1.746   42.193  97.007  1.00 65.23 ? 21   CYS B C     1 
ATOM   1650 O  O     . CYS D 3 14 ? 2.547   41.572  96.281  1.00 64.32 ? 21   CYS B O     1 
ATOM   1651 C  CB    . CYS D 3 14 ? 1.977   41.481  99.461  1.00 63.80 ? 21   CYS B CB    1 
ATOM   1652 S  SG    . CYS D 3 14 ? 2.514   43.107  99.947  1.00 65.03 ? 21   CYS B SG    1 
ATOM   1653 N  N     . SER D 3 15 ? 1.407   43.463  96.740  1.00 65.74 ? 22   SER B N     1 
ATOM   1654 C  CA    . SER D 3 15 ? 2.071   44.166  95.623  1.00 66.70 ? 22   SER B CA    1 
ATOM   1655 C  C     . SER D 3 15 ? 3.531   44.467  95.972  1.00 67.42 ? 22   SER B C     1 
ATOM   1656 O  O     . SER D 3 15 ? 4.409   44.417  95.114  1.00 66.39 ? 22   SER B O     1 
ATOM   1657 C  CB    . SER D 3 15 ? 1.320   45.424  95.214  1.00 66.08 ? 22   SER B CB    1 
ATOM   1658 O  OG    . SER D 3 15 ? 1.141   46.263  96.326  1.00 65.33 ? 22   SER B OG    1 
ATOM   1659 N  N     . LYS D 3 16 ? 3.759   44.762  97.251  1.00 69.23 ? 23   LYS B N     1 
ATOM   1660 C  CA    . LYS D 3 16 ? 5.098   44.807  97.882  1.00 71.33 ? 23   LYS B CA    1 
ATOM   1661 C  C     . LYS D 3 16 ? 5.882   46.087  97.611  1.00 72.97 ? 23   LYS B C     1 
ATOM   1662 O  O     . LYS D 3 16 ? 7.047   46.191  98.035  1.00 73.32 ? 23   LYS B O     1 
ATOM   1663 C  CB    . LYS D 3 16 ? 5.982   43.595  97.514  1.00 70.80 ? 23   LYS B CB    1 
ATOM   1664 C  CG    . LYS D 3 16 ? 5.368   42.248  97.745  1.00 70.34 ? 23   LYS B CG    1 
ATOM   1665 C  CD    . LYS D 3 16 ? 6.415   41.190  97.725  1.00 69.92 ? 23   LYS B CD    1 
ATOM   1666 C  CE    . LYS D 3 16 ? 5.796   39.844  97.668  1.00 67.54 ? 23   LYS B CE    1 
ATOM   1667 N  NZ    . LYS D 3 16 ? 6.843   39.042  97.009  1.00 71.11 ? 23   LYS B NZ    1 
ATOM   1668 N  N     . GLU D 3 17 ? 5.238   47.045  96.936  1.00 74.51 ? 24   GLU B N     1 
ATOM   1669 C  CA    . GLU D 3 17 ? 5.857   48.308  96.483  1.00 76.33 ? 24   GLU B CA    1 
ATOM   1670 C  C     . GLU D 3 17 ? 6.334   49.229  97.626  1.00 77.03 ? 24   GLU B C     1 
ATOM   1671 O  O     . GLU D 3 17 ? 6.303   48.827  98.803  1.00 77.59 ? 24   GLU B O     1 
ATOM   1672 C  CB    . GLU D 3 17 ? 4.847   49.022  95.610  1.00 76.41 ? 24   GLU B CB    1 
ATOM   1673 C  CG    . GLU D 3 17 ? 3.420   48.664  96.022  1.00 78.57 ? 24   GLU B CG    1 
ATOM   1674 C  CD    . GLU D 3 17 ? 2.375   48.947  94.935  1.00 81.19 ? 24   GLU B CD    1 
ATOM   1675 O  OE1   . GLU D 3 17 ? 2.704   48.827  93.721  1.00 80.64 ? 24   GLU B OE1   1 
ATOM   1676 O  OE2   . GLU D 3 17 ? 1.216   49.271  95.312  1.00 80.87 ? 24   GLU B OE2   1 
ATOM   1677 N  N     . LYS D 3 18 ? 6.784   50.451  97.307  1.00 77.48 ? 25   LYS B N     1 
ATOM   1678 C  CA    . LYS D 3 18 ? 7.303   51.353  98.370  1.00 77.82 ? 25   LYS B CA    1 
ATOM   1679 C  C     . LYS D 3 18 ? 6.808   52.816  98.349  1.00 78.23 ? 25   LYS B C     1 
ATOM   1680 O  O     . LYS D 3 18 ? 6.992   53.522  97.353  1.00 78.46 ? 25   LYS B O     1 
ATOM   1681 C  CB    . LYS D 3 18 ? 8.841   51.245  98.484  1.00 77.95 ? 25   LYS B CB    1 
ATOM   1682 C  CG    . LYS D 3 18 ? 9.329   49.959  99.161  1.00 75.17 ? 25   LYS B CG    1 
ATOM   1683 C  CD    . LYS D 3 18 ? 9.191   50.042  100.648 1.00 73.69 ? 25   LYS B CD    1 
ATOM   1684 C  CE    . LYS D 3 18 ? 9.215   48.639  101.352 1.00 74.84 ? 25   LYS B CE    1 
ATOM   1685 N  NZ    . LYS D 3 18 ? 9.834   47.484  100.629 1.00 71.19 ? 25   LYS B NZ    1 
ATOM   1686 N  N     . PRO D 3 19 ? 6.214   53.294  99.469  1.00 78.58 ? 26   PRO B N     1 
ATOM   1687 C  CA    . PRO D 3 19 ? 6.223   52.706  100.812 1.00 78.81 ? 26   PRO B CA    1 
ATOM   1688 C  C     . PRO D 3 19 ? 5.181   51.601  100.978 1.00 79.15 ? 26   PRO B C     1 
ATOM   1689 O  O     . PRO D 3 19 ? 5.554   50.445  101.098 1.00 79.26 ? 26   PRO B O     1 
ATOM   1690 C  CB    . PRO D 3 19 ? 5.913   53.901  101.715 1.00 78.66 ? 26   PRO B CB    1 
ATOM   1691 C  CG    . PRO D 3 19 ? 5.049   54.788  100.866 1.00 78.45 ? 26   PRO B CG    1 
ATOM   1692 C  CD    . PRO D 3 19 ? 5.385   54.518  99.416  1.00 78.51 ? 26   PRO B CD    1 
ATOM   1693 N  N     . LYS D 3 20 ? 3.900   51.963  100.966 1.00 79.92 ? 27   LYS B N     1 
ATOM   1694 C  CA    . LYS D 3 20 ? 2.771   51.026  101.085 1.00 80.67 ? 27   LYS B CA    1 
ATOM   1695 C  C     . LYS D 3 20 ? 2.641   50.072  99.884  1.00 80.20 ? 27   LYS B C     1 
ATOM   1696 O  O     . LYS D 3 20 ? 3.583   49.869  99.116  1.00 80.49 ? 27   LYS B O     1 
ATOM   1697 C  CB    . LYS D 3 20 ? 1.438   51.794  101.198 1.00 81.12 ? 27   LYS B CB    1 
ATOM   1698 C  CG    . LYS D 3 20 ? 1.223   52.705  102.415 1.00 82.27 ? 27   LYS B CG    1 
ATOM   1699 C  CD    . LYS D 3 20 ? 0.033   53.667  102.125 1.00 81.98 ? 27   LYS B CD    1 
ATOM   1700 C  CE    . LYS D 3 20 ? -0.579  54.323  103.388 1.00 83.08 ? 27   LYS B CE    1 
ATOM   1701 N  NZ    . LYS D 3 20 ? -1.387  53.356  104.214 1.00 83.42 ? 27   LYS B NZ    1 
ATOM   1702 N  N     . CYS D 3 21 ? 1.436   49.523  99.725  1.00 79.52 ? 28   CYS B N     1 
ATOM   1703 C  CA    . CYS D 3 21 ? 1.116   48.536  98.695  1.00 78.40 ? 28   CYS B CA    1 
ATOM   1704 C  C     . CYS D 3 21 ? -0.412  48.503  98.451  1.00 78.92 ? 28   CYS B C     1 
ATOM   1705 O  O     . CYS D 3 21 ? -1.191  48.957  99.305  1.00 78.34 ? 28   CYS B O     1 
ATOM   1706 C  CB    . CYS D 3 21 ? 1.629   47.159  99.123  1.00 77.87 ? 28   CYS B CB    1 
ATOM   1707 S  SG    . CYS D 3 21 ? 0.866   46.579  100.650 1.00 72.91 ? 28   CYS B SG    1 
ATOM   1708 N  N     . ALA D 3 22 ? -0.821  47.940  97.308  1.00 79.51 ? 29   ALA B N     1 
ATOM   1709 C  CA    . ALA D 3 22 ? -2.215  48.007  96.819  1.00 80.45 ? 29   ALA B CA    1 
ATOM   1710 C  C     . ALA D 3 22 ? -3.326  47.906  97.883  1.00 80.87 ? 29   ALA B C     1 
ATOM   1711 O  O     . ALA D 3 22 ? -4.084  48.863  98.054  1.00 81.76 ? 29   ALA B O     1 
ATOM   1712 C  CB    . ALA D 3 22 ? -2.476  47.039  95.616  1.00 80.42 ? 29   ALA B CB    1 
ATOM   1713 N  N     . LYS D 3 23 ? -3.431  46.797  98.607  1.00 80.69 ? 30   LYS B N     1 
ATOM   1714 C  CA    . LYS D 3 23 ? -4.571  46.647  99.529  1.00 80.79 ? 30   LYS B CA    1 
ATOM   1715 C  C     . LYS D 3 23 ? -4.483  47.436  100.876 1.00 80.43 ? 30   LYS B C     1 
ATOM   1716 O  O     . LYS D 3 23 ? -5.517  47.885  101.410 1.00 81.01 ? 30   LYS B O     1 
ATOM   1717 C  CB    . LYS D 3 23 ? -4.999  45.167  99.705  1.00 80.71 ? 30   LYS B CB    1 
ATOM   1718 C  CG    . LYS D 3 23 ? -4.899  44.323  98.413  1.00 82.59 ? 30   LYS B CG    1 
ATOM   1719 C  CD    . LYS D 3 23 ? -3.639  43.390  98.460  1.00 86.24 ? 30   LYS B CD    1 
ATOM   1720 C  CE    . LYS D 3 23 ? -2.804  43.428  97.159  1.00 87.44 ? 30   LYS B CE    1 
ATOM   1721 N  NZ    . LYS D 3 23 ? -3.534  42.885  95.960  1.00 88.13 ? 30   LYS B NZ    1 
ATOM   1722 N  N     . CYS D 3 24 ? -3.280  47.642  101.414 1.00 79.57 ? 31   CYS B N     1 
ATOM   1723 C  CA    . CYS D 3 24 ? -3.153  48.525  102.576 1.00 78.03 ? 31   CYS B CA    1 
ATOM   1724 C  C     . CYS D 3 24 ? -3.487  49.982  102.093 1.00 78.25 ? 31   CYS B C     1 
ATOM   1725 O  O     . CYS D 3 24 ? -4.262  50.703  102.731 1.00 77.16 ? 31   CYS B O     1 
ATOM   1726 C  CB    . CYS D 3 24 ? -1.776  48.362  103.295 1.00 78.28 ? 31   CYS B CB    1 
ATOM   1727 S  SG    . CYS D 3 24 ? -1.241  46.671  104.318 1.00 74.62 ? 31   CYS B SG    1 
ATOM   1728 N  N     . LEU D 3 25 ? -2.958  50.367  100.928 1.00 78.04 ? 32   LEU B N     1 
ATOM   1729 C  CA    . LEU D 3 25 ? -3.209  51.692  100.331 1.00 78.23 ? 32   LEU B CA    1 
ATOM   1730 C  C     . LEU D 3 25 ? -4.690  51.950  100.022 1.00 78.63 ? 32   LEU B C     1 
ATOM   1731 O  O     . LEU D 3 25 ? -5.299  52.869  100.581 1.00 78.02 ? 32   LEU B O     1 
ATOM   1732 C  CB    . LEU D 3 25 ? -2.403  51.874  99.026  1.00 78.23 ? 32   LEU B CB    1 
ATOM   1733 C  CG    . LEU D 3 25 ? -2.867  52.962  98.028  1.00 75.82 ? 32   LEU B CG    1 
ATOM   1734 C  CD1   . LEU D 3 25 ? -2.135  54.258  98.313  1.00 73.59 ? 32   LEU B CD1   1 
ATOM   1735 C  CD2   . LEU D 3 25 ? -2.684  52.510  96.566  1.00 73.29 ? 32   LEU B CD2   1 
ATOM   1736 N  N     . LYS D 3 26 ? -5.208  51.158  99.075  1.00 78.99 ? 33   LYS B N     1 
ATOM   1737 C  CA    . LYS D 3 26 ? -6.616  51.058  98.746  1.00 79.32 ? 33   LYS B CA    1 
ATOM   1738 C  C     . LYS D 3 26 ? -7.410  50.970  100.029 1.00 79.79 ? 33   LYS B C     1 
ATOM   1739 O  O     . LYS D 3 26 ? -7.908  51.962  100.522 1.00 79.91 ? 33   LYS B O     1 
ATOM   1740 C  CB    . LYS D 3 26 ? -6.888  49.767  97.965  1.00 79.35 ? 33   LYS B CB    1 
ATOM   1741 C  CG    . LYS D 3 26 ? -6.458  49.684  96.513  1.00 78.30 ? 33   LYS B CG    1 
ATOM   1742 C  CD    . LYS D 3 26 ? -7.500  48.830  95.802  1.00 77.04 ? 33   LYS B CD    1 
ATOM   1743 C  CE    . LYS D 3 26 ? -8.869  49.567  95.812  1.00 75.58 ? 33   LYS B CE    1 
ATOM   1744 N  NZ    . LYS D 3 26 ? -10.038 48.686  96.100  1.00 73.19 ? 33   LYS B NZ    1 
ATOM   1745 N  N     . ASN D 3 27 ? -7.478  49.768  100.589 1.00 80.67 ? 34   ASN B N     1 
ATOM   1746 C  CA    . ASN D 3 27 ? -8.427  49.447  101.648 1.00 81.42 ? 34   ASN B CA    1 
ATOM   1747 C  C     . ASN D 3 27 ? -8.380  50.393  102.828 1.00 81.71 ? 34   ASN B C     1 
ATOM   1748 O  O     . ASN D 3 27 ? -9.258  50.358  103.698 1.00 81.45 ? 34   ASN B O     1 
ATOM   1749 C  CB    . ASN D 3 27 ? -8.222  48.012  102.137 1.00 81.42 ? 34   ASN B CB    1 
ATOM   1750 C  CG    . ASN D 3 27 ? -9.537  47.282  102.336 1.00 81.94 ? 34   ASN B CG    1 
ATOM   1751 O  OD1   . ASN D 3 27 ? -9.763  46.237  101.725 1.00 82.10 ? 34   ASN B OD1   1 
ATOM   1752 N  ND2   . ASN D 3 27 ? -10.428 47.846  103.166 1.00 80.24 ? 34   ASN B ND2   1 
ATOM   1753 N  N     . ASN D 3 28 ? -7.350  51.236  102.833 1.00 82.33 ? 35   ASN B N     1 
ATOM   1754 C  CA    . ASN D 3 28 ? -7.074  52.178  103.914 1.00 83.05 ? 35   ASN B CA    1 
ATOM   1755 C  C     . ASN D 3 28 ? -6.587  51.542  105.225 1.00 83.49 ? 35   ASN B C     1 
ATOM   1756 O  O     . ASN D 3 28 ? -7.340  51.453  106.225 1.00 83.45 ? 35   ASN B O     1 
ATOM   1757 C  CB    . ASN D 3 28 ? -8.257  53.094  104.176 1.00 83.34 ? 35   ASN B CB    1 
ATOM   1758 C  CG    . ASN D 3 28 ? -7.839  54.375  104.834 1.00 84.06 ? 35   ASN B CG    1 
ATOM   1759 O  OD1   . ASN D 3 28 ? -8.436  55.442  104.607 1.00 83.97 ? 35   ASN B OD1   1 
ATOM   1760 N  ND2   . ASN D 3 28 ? -6.785  54.293  105.639 1.00 83.33 ? 35   ASN B ND2   1 
ATOM   1761 N  N     . TRP D 3 29 ? -5.315  51.113  105.186 1.00 83.58 ? 36   TRP B N     1 
ATOM   1762 C  CA    . TRP D 3 29 ? -4.595  50.489  106.315 1.00 83.11 ? 36   TRP B CA    1 
ATOM   1763 C  C     . TRP D 3 29 ? -3.086  50.903  106.381 1.00 81.86 ? 36   TRP B C     1 
ATOM   1764 O  O     . TRP D 3 29 ? -2.494  51.284  105.360 1.00 81.81 ? 36   TRP B O     1 
ATOM   1765 C  CB    . TRP D 3 29 ? -4.787  48.959  106.270 1.00 83.91 ? 36   TRP B CB    1 
ATOM   1766 C  CG    . TRP D 3 29 ? -6.137  48.461  106.834 1.00 85.37 ? 36   TRP B CG    1 
ATOM   1767 C  CD1   . TRP D 3 29 ? -6.964  49.101  107.767 1.00 86.30 ? 36   TRP B CD1   1 
ATOM   1768 C  CD2   . TRP D 3 29 ? -6.783  47.217  106.529 1.00 86.30 ? 36   TRP B CD2   1 
ATOM   1769 N  NE1   . TRP D 3 29 ? -8.069  48.321  108.032 1.00 86.36 ? 36   TRP B NE1   1 
ATOM   1770 C  CE2   . TRP D 3 29 ? -7.985  47.164  107.291 1.00 87.06 ? 36   TRP B CE2   1 
ATOM   1771 C  CE3   . TRP D 3 29 ? -6.465  46.134  105.689 1.00 86.60 ? 36   TRP B CE3   1 
ATOM   1772 C  CZ2   . TRP D 3 29 ? -8.867  46.061  107.227 1.00 87.02 ? 36   TRP B CZ2   1 
ATOM   1773 C  CZ3   . TRP D 3 29 ? -7.343  45.036  105.634 1.00 85.98 ? 36   TRP B CZ3   1 
ATOM   1774 C  CH2   . TRP D 3 29 ? -8.525  45.010  106.401 1.00 86.02 ? 36   TRP B CH2   1 
ATOM   1775 N  N     . GLU D 3 30 ? -2.485  50.863  107.576 1.00 80.26 ? 37   GLU B N     1 
ATOM   1776 C  CA    . GLU D 3 30 ? -1.064  51.230  107.751 1.00 78.76 ? 37   GLU B CA    1 
ATOM   1777 C  C     . GLU D 3 30 ? -0.163  50.002  107.459 1.00 77.26 ? 37   GLU B C     1 
ATOM   1778 O  O     . GLU D 3 30 ? -0.020  49.091  108.284 1.00 77.06 ? 37   GLU B O     1 
ATOM   1779 C  CB    . GLU D 3 30 ? -0.837  51.856  109.140 1.00 79.10 ? 37   GLU B CB    1 
ATOM   1780 C  CG    . GLU D 3 30 ? 0.443   52.716  109.326 1.00 80.54 ? 37   GLU B CG    1 
ATOM   1781 C  CD    . GLU D 3 30 ? 1.471   52.045  110.289 1.00 82.80 ? 37   GLU B CD    1 
ATOM   1782 O  OE1   . GLU D 3 30 ? 1.160   50.969  110.853 1.00 81.72 ? 37   GLU B OE1   1 
ATOM   1783 O  OE2   . GLU D 3 30 ? 2.584   52.591  110.502 1.00 83.19 ? 37   GLU B OE2   1 
ATOM   1784 N  N     . CYS D 3 31 ? 0.404   49.983  106.251 1.00 74.72 ? 38   CYS B N     1 
ATOM   1785 C  CA    . CYS D 3 31 ? 1.164   48.856  105.719 1.00 73.82 ? 38   CYS B CA    1 
ATOM   1786 C  C     . CYS D 3 31 ? 2.526   48.821  106.345 1.00 74.23 ? 38   CYS B C     1 
ATOM   1787 O  O     . CYS D 3 31 ? 3.253   49.824  106.283 1.00 74.14 ? 38   CYS B O     1 
ATOM   1788 C  CB    . CYS D 3 31 ? 1.388   49.069  104.240 1.00 73.58 ? 38   CYS B CB    1 
ATOM   1789 S  SG    . CYS D 3 31 ? 1.928   47.664  103.301 1.00 70.68 ? 38   CYS B SG    1 
ATOM   1790 N  N     . ARG D 3 32 ? 2.889   47.676  106.931 1.00 74.24 ? 39   ARG B N     1 
ATOM   1791 C  CA    . ARG D 3 32 ? 4.255   47.491  107.453 1.00 74.63 ? 39   ARG B CA    1 
ATOM   1792 C  C     . ARG D 3 32 ? 5.011   46.252  106.984 1.00 72.75 ? 39   ARG B C     1 
ATOM   1793 O  O     . ARG D 3 32 ? 4.433   45.188  106.758 1.00 72.39 ? 39   ARG B O     1 
ATOM   1794 C  CB    . ARG D 3 32 ? 4.305   47.592  108.985 1.00 74.75 ? 39   ARG B CB    1 
ATOM   1795 C  CG    . ARG D 3 32 ? 4.954   48.928  109.531 1.00 78.39 ? 39   ARG B CG    1 
ATOM   1796 C  CD    . ARG D 3 32 ? 4.304   49.431  110.860 1.00 80.79 ? 39   ARG B CD    1 
ATOM   1797 N  NE    . ARG D 3 32 ? 4.209   48.361  111.870 1.00 89.02 ? 39   ARG B NE    1 
ATOM   1798 C  CZ    . ARG D 3 32 ? 3.245   47.426  111.927 1.00 92.64 ? 39   ARG B CZ    1 
ATOM   1799 N  NH1   . ARG D 3 32 ? 2.240   47.405  111.036 1.00 94.33 ? 39   ARG B NH1   1 
ATOM   1800 N  NH2   . ARG D 3 32 ? 3.286   46.491  112.881 1.00 92.96 ? 39   ARG B NH2   1 
ATOM   1801 N  N     . TYR D 3 33 ? 6.322   46.439  106.837 1.00 71.40 ? 40   TYR B N     1 
ATOM   1802 C  CA    . TYR D 3 33 ? 7.284   45.338  106.733 1.00 69.55 ? 40   TYR B CA    1 
ATOM   1803 C  C     . TYR D 3 33 ? 8.111   45.159  108.062 1.00 68.73 ? 40   TYR B C     1 
ATOM   1804 O  O     . TYR D 3 33 ? 9.176   45.771  108.284 1.00 67.48 ? 40   TYR B O     1 
ATOM   1805 C  CB    . TYR D 3 33 ? 8.134   45.453  105.437 1.00 69.63 ? 40   TYR B CB    1 
ATOM   1806 C  CG    . TYR D 3 33 ? 7.321   45.656  104.133 1.00 68.72 ? 40   TYR B CG    1 
ATOM   1807 C  CD1   . TYR D 3 33 ? 7.096   46.941  103.608 1.00 70.94 ? 40   TYR B CD1   1 
ATOM   1808 C  CD2   . TYR D 3 33 ? 6.803   44.564  103.432 1.00 67.08 ? 40   TYR B CD2   1 
ATOM   1809 C  CE1   . TYR D 3 33 ? 6.346   47.131  102.407 1.00 71.71 ? 40   TYR B CE1   1 
ATOM   1810 C  CE2   . TYR D 3 33 ? 6.079   44.715  102.261 1.00 68.66 ? 40   TYR B CE2   1 
ATOM   1811 C  CZ    . TYR D 3 33 ? 5.837   46.004  101.735 1.00 71.54 ? 40   TYR B CZ    1 
ATOM   1812 O  OH    . TYR D 3 33 ? 5.090   46.154  100.567 1.00 68.86 ? 40   TYR B OH    1 
ATOM   1813 N  N     . SER D 3 34 ? 7.554   44.331  108.955 1.00 68.45 ? 41   SER B N     1 
ATOM   1814 C  CA    . SER D 3 34 ? 8.250   43.797  110.150 1.00 67.73 ? 41   SER B CA    1 
ATOM   1815 C  C     . SER D 3 34 ? 9.568   43.068  109.838 1.00 66.79 ? 41   SER B C     1 
ATOM   1816 O  O     . SER D 3 34 ? 9.635   42.372  108.833 1.00 66.83 ? 41   SER B O     1 
ATOM   1817 C  CB    . SER D 3 34 ? 7.319   42.826  110.888 1.00 68.01 ? 41   SER B CB    1 
ATOM   1818 O  OG    . SER D 3 34 ? 6.357   43.500  111.685 1.00 67.49 ? 41   SER B OG    1 
ATOM   1819 N  N     . PRO D 3 35 ? 10.623  43.239  110.685 1.00 66.66 ? 42   PRO B N     1 
ATOM   1820 C  CA    . PRO D 3 35 ? 11.851  42.412  110.691 1.00 66.41 ? 42   PRO B CA    1 
ATOM   1821 C  C     . PRO D 3 35 ? 11.545  40.947  110.758 1.00 66.41 ? 42   PRO B C     1 
ATOM   1822 O  O     . PRO D 3 35 ? 10.565  40.568  111.368 1.00 66.01 ? 42   PRO B O     1 
ATOM   1823 C  CB    . PRO D 3 35 ? 12.500  42.807  111.999 1.00 66.47 ? 42   PRO B CB    1 
ATOM   1824 C  CG    . PRO D 3 35 ? 12.199  44.283  112.070 1.00 65.30 ? 42   PRO B CG    1 
ATOM   1825 C  CD    . PRO D 3 35 ? 10.743  44.321  111.685 1.00 66.59 ? 42   PRO B CD    1 
ATOM   1826 N  N     . LYS D 3 36 ? 12.348  40.129  110.085 1.00 67.44 ? 43   LYS B N     1 
ATOM   1827 C  CA    . LYS D 3 36 ? 12.269  38.658  110.218 1.00 67.97 ? 43   LYS B CA    1 
ATOM   1828 C  C     . LYS D 3 36 ? 12.435  38.332  111.697 1.00 67.29 ? 43   LYS B C     1 
ATOM   1829 O  O     . LYS D 3 36 ? 13.154  39.021  112.439 1.00 67.40 ? 43   LYS B O     1 
ATOM   1830 C  CB    . LYS D 3 36 ? 13.342  37.956  109.362 1.00 67.94 ? 43   LYS B CB    1 
ATOM   1831 C  CG    . LYS D 3 36 ? 14.658  38.823  109.181 1.00 71.20 ? 43   LYS B CG    1 
ATOM   1832 C  CD    . LYS D 3 36 ? 15.319  38.840  107.735 1.00 69.93 ? 43   LYS B CD    1 
ATOM   1833 C  CE    . LYS D 3 36 ? 14.499  39.582  106.685 1.00 69.99 ? 43   LYS B CE    1 
ATOM   1834 N  NZ    . LYS D 3 36 ? 15.067  39.341  105.328 1.00 70.71 ? 43   LYS B NZ    1 
ATOM   1835 N  N     . THR D 3 37 ? 11.739  37.303  112.138 1.00 66.82 ? 44   THR B N     1 
ATOM   1836 C  CA    . THR D 3 37 ? 11.844  36.864  113.515 1.00 66.17 ? 44   THR B CA    1 
ATOM   1837 C  C     . THR D 3 37 ? 13.163  36.054  113.771 1.00 64.14 ? 44   THR B C     1 
ATOM   1838 O  O     . THR D 3 37 ? 13.491  35.144  113.012 1.00 63.61 ? 44   THR B O     1 
ATOM   1839 C  CB    . THR D 3 37 ? 10.542  36.117  113.853 1.00 66.95 ? 44   THR B CB    1 
ATOM   1840 O  OG1   . THR D 3 37 ? 10.030  36.613  115.098 1.00 70.60 ? 44   THR B OG1   1 
ATOM   1841 C  CG2   . THR D 3 37 ? 10.720  34.621  113.878 1.00 66.87 ? 44   THR B CG2   1 
ATOM   1842 N  N     . LYS D 3 38 ? 13.934  36.445  114.784 1.00 62.15 ? 45   LYS B N     1 
ATOM   1843 C  CA    . LYS D 3 38 ? 15.133  35.675  115.196 1.00 61.94 ? 45   LYS B CA    1 
ATOM   1844 C  C     . LYS D 3 38 ? 14.726  34.307  115.756 1.00 58.58 ? 45   LYS B C     1 
ATOM   1845 O  O     . LYS D 3 38 ? 13.879  34.214  116.639 1.00 58.08 ? 45   LYS B O     1 
ATOM   1846 C  CB    . LYS D 3 38 ? 16.030  36.440  116.229 1.00 62.90 ? 45   LYS B CB    1 
ATOM   1847 C  CG    . LYS D 3 38 ? 17.400  37.012  115.673 1.00 64.23 ? 45   LYS B CG    1 
ATOM   1848 C  CD    . LYS D 3 38 ? 18.000  38.270  116.500 1.00 64.68 ? 45   LYS B CD    1 
ATOM   1849 C  CE    . LYS D 3 38 ? 17.461  39.754  116.169 1.00 62.58 ? 45   LYS B CE    1 
ATOM   1850 N  NZ    . LYS D 3 38 ? 17.139  40.183  114.761 1.00 59.99 ? 45   LYS B NZ    1 
ATOM   1851 N  N     . ARG D 3 39 ? 15.289  33.249  115.194 1.00 54.31 ? 46   ARG B N     1 
ATOM   1852 C  CA    . ARG D 3 39 ? 14.984  31.923  115.678 1.00 50.67 ? 46   ARG B CA    1 
ATOM   1853 C  C     . ARG D 3 39 ? 16.302  31.235  115.959 1.00 44.23 ? 46   ARG B C     1 
ATOM   1854 O  O     . ARG D 3 39 ? 17.338  31.769  115.627 1.00 43.47 ? 46   ARG B O     1 
ATOM   1855 C  CB    . ARG D 3 39 ? 14.105  31.163  114.689 1.00 48.81 ? 46   ARG B CB    1 
ATOM   1856 C  CG    . ARG D 3 39 ? 14.104  31.693  113.272 1.00 57.13 ? 46   ARG B CG    1 
ATOM   1857 C  CD    . ARG D 3 39 ? 12.918  30.973  112.329 1.00 58.60 ? 46   ARG B CD    1 
ATOM   1858 N  NE    . ARG D 3 39 ? 11.713  30.538  113.091 1.00 66.59 ? 46   ARG B NE    1 
ATOM   1859 C  CZ    . ARG D 3 39 ? 10.475  30.447  112.606 1.00 69.30 ? 46   ARG B CZ    1 
ATOM   1860 N  NH1   . ARG D 3 39 ? 10.217  30.779  111.335 1.00 70.95 ? 46   ARG B NH1   1 
ATOM   1861 N  NH2   . ARG D 3 39 ? 9.497   30.051  113.420 1.00 72.04 ? 46   ARG B NH2   1 
ATOM   1862 N  N     . SER D 3 40 ? 16.310  30.076  116.588 1.00 38.42 ? 47   SER B N     1 
ATOM   1863 C  CA    . SER D 3 40 ? 17.647  29.483  116.828 1.00 33.50 ? 47   SER B CA    1 
ATOM   1864 C  C     . SER D 3 40 ? 18.096  28.788  115.557 1.00 30.07 ? 47   SER B C     1 
ATOM   1865 O  O     . SER D 3 40 ? 17.287  28.436  114.744 1.00 30.28 ? 47   SER B O     1 
ATOM   1866 C  CB    . SER D 3 40 ? 17.580  28.554  117.989 1.00 32.35 ? 47   SER B CB    1 
ATOM   1867 O  OG    . SER D 3 40 ? 16.566  27.625  117.733 1.00 28.04 ? 47   SER B OG    1 
ATOM   1868 N  N     . PRO D 3 41 ? 19.380  28.700  115.320 1.00 27.57 ? 48   PRO B N     1 
ATOM   1869 C  CA    . PRO D 3 41 ? 19.826  28.017  114.077 1.00 25.22 ? 48   PRO B CA    1 
ATOM   1870 C  C     . PRO D 3 41 ? 19.450  26.572  114.087 1.00 23.93 ? 48   PRO B C     1 
ATOM   1871 O  O     . PRO D 3 41 ? 19.674  25.950  115.090 1.00 25.49 ? 48   PRO B O     1 
ATOM   1872 C  CB    . PRO D 3 41 ? 21.343  28.103  114.144 1.00 22.89 ? 48   PRO B CB    1 
ATOM   1873 C  CG    . PRO D 3 41 ? 21.702  28.602  115.486 1.00 24.98 ? 48   PRO B CG    1 
ATOM   1874 C  CD    . PRO D 3 41 ? 20.510  29.307  116.060 1.00 27.21 ? 48   PRO B CD    1 
ATOM   1875 N  N     . LEU D 3 42 ? 18.941  26.046  112.984 1.00 20.93 ? 49   LEU B N     1 
ATOM   1876 C  CA    . LEU D 3 42 ? 18.597  24.708  112.890 1.00 21.27 ? 49   LEU B CA    1 
ATOM   1877 C  C     . LEU D 3 42 ? 19.805  24.081  112.190 1.00 22.43 ? 49   LEU B C     1 
ATOM   1878 O  O     . LEU D 3 42 ? 19.772  23.880  110.953 1.00 24.47 ? 49   LEU B O     1 
ATOM   1879 C  CB    . LEU D 3 42 ? 17.335  24.575  111.978 1.00 21.37 ? 49   LEU B CB    1 
ATOM   1880 C  CG    . LEU D 3 42 ? 16.696  23.167  111.922 1.00 22.57 ? 49   LEU B CG    1 
ATOM   1881 C  CD1   . LEU D 3 42 ? 16.265  22.653  113.267 1.00 23.58 ? 49   LEU B CD1   1 
ATOM   1882 C  CD2   . LEU D 3 42 ? 15.515  23.041  110.961 1.00 20.20 ? 49   LEU B CD2   1 
ATOM   1883 N  N     . THR D 3 43 ? 20.886  23.904  112.920 1.00 20.97 ? 50   THR B N     1 
ATOM   1884 C  CA    . THR D 3 43 ? 21.993  23.143  112.436 1.00 21.69 ? 50   THR B CA    1 
ATOM   1885 C  C     . THR D 3 43 ? 22.137  21.871  113.298 1.00 21.71 ? 50   THR B C     1 
ATOM   1886 O  O     . THR D 3 43 ? 21.555  21.690  114.354 1.00 20.97 ? 50   THR B O     1 
ATOM   1887 C  CB    . THR D 3 43 ? 23.289  23.949  112.659 1.00 22.48 ? 50   THR B CB    1 
ATOM   1888 O  OG1   . THR D 3 43 ? 23.421  24.129  114.088 1.00 26.43 ? 50   THR B OG1   1 
ATOM   1889 C  CG2   . THR D 3 43 ? 23.189  25.344  112.103 1.00 19.76 ? 50   THR B CG2   1 
ATOM   1890 N  N     . ARG D 3 44 ? 23.034  21.033  112.922 1.00 20.94 ? 51   ARG B N     1 
ATOM   1891 C  CA    . ARG D 3 44 ? 23.085  19.848  113.560 1.00 21.22 ? 51   ARG B CA    1 
ATOM   1892 C  C     . ARG D 3 44 ? 23.906  20.102  114.790 1.00 23.18 ? 51   ARG B C     1 
ATOM   1893 O  O     . ARG D 3 44 ? 23.656  19.417  115.862 1.00 24.93 ? 51   ARG B O     1 
ATOM   1894 C  CB    . ARG D 3 44 ? 23.838  18.861  112.679 1.00 21.08 ? 51   ARG B CB    1 
ATOM   1895 C  CG    . ARG D 3 44 ? 24.345  17.695  113.580 1.00 21.05 ? 51   ARG B CG    1 
ATOM   1896 C  CD    . ARG D 3 44 ? 23.598  16.516  113.063 1.00 23.06 ? 51   ARG B CD    1 
ATOM   1897 N  NE    . ARG D 3 44 ? 22.518  16.093  113.873 1.00 13.38 ? 51   ARG B NE    1 
ATOM   1898 C  CZ    . ARG D 3 44 ? 21.315  15.680  113.495 1.00 16.39 ? 51   ARG B CZ    1 
ATOM   1899 N  NH1   . ARG D 3 44 ? 20.905  15.551  112.182 1.00 17.61 ? 51   ARG B NH1   1 
ATOM   1900 N  NH2   . ARG D 3 44 ? 20.504  15.341  114.521 1.00 16.13 ? 51   ARG B NH2   1 
ATOM   1901 N  N     . ALA D 3 45 ? 24.922  21.004  114.669 1.00 21.68 ? 52   ALA B N     1 
ATOM   1902 C  CA    . ALA D 3 45 ? 25.843  21.316  115.854 1.00 20.25 ? 52   ALA B CA    1 
ATOM   1903 C  C     . ALA D 3 45 ? 24.886  21.906  116.879 1.00 21.77 ? 52   ALA B C     1 
ATOM   1904 O  O     . ALA D 3 45 ? 24.925  21.622  118.043 1.00 21.57 ? 52   ALA B O     1 
ATOM   1905 C  CB    . ALA D 3 45 ? 26.917  22.372  115.507 1.00 15.72 ? 52   ALA B CB    1 
ATOM   1906 N  N     . HIS D 3 46 ? 23.953  22.741  116.446 1.00 22.31 ? 53   HIS B N     1 
ATOM   1907 C  CA    . HIS D 3 46 ? 23.168  23.294  117.500 1.00 23.48 ? 53   HIS B CA    1 
ATOM   1908 C  C     . HIS D 3 46 ? 22.141  22.392  118.074 1.00 23.89 ? 53   HIS B C     1 
ATOM   1909 O  O     . HIS D 3 46 ? 22.039  22.392  119.263 1.00 24.94 ? 53   HIS B O     1 
ATOM   1910 C  CB    . HIS D 3 46 ? 22.580  24.615  117.141 1.00 23.48 ? 53   HIS B CB    1 
ATOM   1911 C  CG    . HIS D 3 46 ? 21.678  25.187  118.181 1.00 24.42 ? 53   HIS B CG    1 
ATOM   1912 N  ND1   . HIS D 3 46 ? 22.165  25.877  119.292 1.00 23.26 ? 53   HIS B ND1   1 
ATOM   1913 C  CD2   . HIS D 3 46 ? 20.325  25.283  118.217 1.00 20.24 ? 53   HIS B CD2   1 
ATOM   1914 C  CE1   . HIS D 3 46 ? 21.124  26.301  119.995 1.00 20.90 ? 53   HIS B CE1   1 
ATOM   1915 N  NE2   . HIS D 3 46 ? 20.005  25.927  119.384 1.00 20.54 ? 53   HIS B NE2   1 
ATOM   1916 N  N     . LEU D 3 47 ? 21.421  21.591  117.299 1.00 22.18 ? 54   LEU B N     1 
ATOM   1917 C  CA    . LEU D 3 47 ? 20.608  20.586  117.920 1.00 21.18 ? 54   LEU B CA    1 
ATOM   1918 C  C     . LEU D 3 47 ? 21.390  19.689  118.880 1.00 21.73 ? 54   LEU B C     1 
ATOM   1919 O  O     . LEU D 3 47 ? 20.879  19.329  119.948 1.00 21.77 ? 54   LEU B O     1 
ATOM   1920 C  CB    . LEU D 3 47 ? 20.173  19.578  116.930 1.00 20.94 ? 54   LEU B CB    1 
ATOM   1921 C  CG    . LEU D 3 47 ? 18.806  18.940  117.088 1.00 20.56 ? 54   LEU B CG    1 
ATOM   1922 C  CD1   . LEU D 3 47 ? 18.951  17.635  116.603 1.00 20.83 ? 54   LEU B CD1   1 
ATOM   1923 C  CD2   . LEU D 3 47 ? 18.146  18.818  118.449 1.00 13.17 ? 54   LEU B CD2   1 
ATOM   1924 N  N     . THR D 3 48 ? 22.587  19.278  118.515 1.00 19.37 ? 55   THR B N     1 
ATOM   1925 C  CA    . THR D 3 48 ? 23.408  18.515  119.446 1.00 19.40 ? 55   THR B CA    1 
ATOM   1926 C  C     . THR D 3 48 ? 23.849  19.270  120.704 1.00 21.10 ? 55   THR B C     1 
ATOM   1927 O  O     . THR D 3 48 ? 23.933  18.684  121.769 1.00 21.59 ? 55   THR B O     1 
ATOM   1928 C  CB    . THR D 3 48 ? 24.673  18.099  118.683 1.00 20.67 ? 55   THR B CB    1 
ATOM   1929 O  OG1   . THR D 3 48 ? 24.190  17.351  117.589 1.00 25.07 ? 55   THR B OG1   1 
ATOM   1930 C  CG2   . THR D 3 48 ? 25.727  17.212  119.458 1.00 12.48 ? 55   THR B CG2   1 
ATOM   1931 N  N     . GLU D 3 49 ? 24.216  20.547  120.623 1.00 23.89 ? 56   GLU B N     1 
ATOM   1932 C  CA    . GLU D 3 49 ? 24.443  21.329  121.892 1.00 26.63 ? 56   GLU B CA    1 
ATOM   1933 C  C     . GLU D 3 49 ? 23.267  21.130  122.802 1.00 24.56 ? 56   GLU B C     1 
ATOM   1934 O  O     . GLU D 3 49 ? 23.464  20.707  123.937 1.00 26.03 ? 56   GLU B O     1 
ATOM   1935 C  CB    . GLU D 3 49 ? 24.542  22.821  121.706 1.00 27.99 ? 56   GLU B CB    1 
ATOM   1936 C  CG    . GLU D 3 49 ? 25.921  23.350  121.673 1.00 41.02 ? 56   GLU B CG    1 
ATOM   1937 C  CD    . GLU D 3 49 ? 26.106  24.641  120.733 1.00 53.10 ? 56   GLU B CD    1 
ATOM   1938 O  OE1   . GLU D 3 49 ? 25.138  25.287  120.128 1.00 56.30 ? 56   GLU B OE1   1 
ATOM   1939 O  OE2   . GLU D 3 49 ? 27.318  24.949  120.581 1.00 59.84 ? 56   GLU B OE2   1 
ATOM   1940 N  N     . VAL D 3 50 ? 22.078  21.396  122.293 1.00 20.79 ? 57   VAL B N     1 
ATOM   1941 C  CA    . VAL D 3 50 ? 20.942  21.377  123.070 1.00 21.27 ? 57   VAL B CA    1 
ATOM   1942 C  C     . VAL D 3 50 ? 20.520  19.940  123.443 1.00 23.30 ? 57   VAL B C     1 
ATOM   1943 O  O     . VAL D 3 50 ? 20.177  19.768  124.518 1.00 23.72 ? 57   VAL B O     1 
ATOM   1944 C  CB    . VAL D 3 50 ? 19.858  21.964  122.288 1.00 23.34 ? 57   VAL B CB    1 
ATOM   1945 C  CG1   . VAL D 3 50 ? 18.626  21.468  122.753 1.00 22.48 ? 57   VAL B CG1   1 
ATOM   1946 C  CG2   . VAL D 3 50 ? 19.827  23.554  122.357 1.00 17.25 ? 57   VAL B CG2   1 
ATOM   1947 N  N     . GLU D 3 51 ? 20.605  18.885  122.625 1.00 23.07 ? 58   GLU B N     1 
ATOM   1948 C  CA    . GLU D 3 51 ? 20.187  17.634  123.118 1.00 22.90 ? 58   GLU B CA    1 
ATOM   1949 C  C     . GLU D 3 51 ? 21.205  17.186  124.156 1.00 23.54 ? 58   GLU B C     1 
ATOM   1950 O  O     . GLU D 3 51 ? 20.868  16.508  125.105 1.00 21.81 ? 58   GLU B O     1 
ATOM   1951 C  CB    . GLU D 3 51 ? 20.133  16.502  122.058 1.00 22.74 ? 58   GLU B CB    1 
ATOM   1952 C  CG    . GLU D 3 51 ? 19.158  16.800  120.941 1.00 25.36 ? 58   GLU B CG    1 
ATOM   1953 C  CD    . GLU D 3 51 ? 19.440  16.033  119.668 1.00 30.26 ? 58   GLU B CD    1 
ATOM   1954 O  OE1   . GLU D 3 51 ? 18.454  15.676  118.984 1.00 35.53 ? 58   GLU B OE1   1 
ATOM   1955 O  OE2   . GLU D 3 51 ? 20.611  15.778  119.316 1.00 36.22 ? 58   GLU B OE2   1 
ATOM   1956 N  N     . SER D 3 52 ? 22.456  17.554  124.028 1.00 22.75 ? 59   SER B N     1 
ATOM   1957 C  CA    . SER D 3 52 ? 23.328  16.890  124.915 1.00 23.48 ? 59   SER B CA    1 
ATOM   1958 C  C     . SER D 3 52 ? 23.390  17.593  126.294 1.00 24.79 ? 59   SER B C     1 
ATOM   1959 O  O     . SER D 3 52 ? 23.675  16.967  127.344 1.00 27.06 ? 59   SER B O     1 
ATOM   1960 C  CB    . SER D 3 52 ? 24.638  16.797  124.223 1.00 23.95 ? 59   SER B CB    1 
ATOM   1961 O  OG    . SER D 3 52 ? 25.219  17.909  124.649 1.00 25.23 ? 59   SER B OG    1 
ATOM   1962 N  N     . ARG D 3 53 ? 22.954  18.846  126.356 1.00 24.86 ? 60   ARG B N     1 
ATOM   1963 C  CA    . ARG D 3 53 ? 22.883  19.527  127.673 1.00 24.24 ? 60   ARG B CA    1 
ATOM   1964 C  C     . ARG D 3 53 ? 21.587  19.098  128.271 1.00 22.61 ? 60   ARG B C     1 
ATOM   1965 O  O     . ARG D 3 53 ? 21.449  18.864  129.434 1.00 23.27 ? 60   ARG B O     1 
ATOM   1966 C  CB    . ARG D 3 53 ? 22.856  21.059  127.502 1.00 21.69 ? 60   ARG B CB    1 
ATOM   1967 C  CG    . ARG D 3 53 ? 22.709  21.753  128.756 1.00 23.55 ? 60   ARG B CG    1 
ATOM   1968 C  CD    . ARG D 3 53 ? 22.716  23.408  128.679 1.00 28.51 ? 60   ARG B CD    1 
ATOM   1969 N  NE    . ARG D 3 53 ? 22.649  23.984  130.070 1.00 28.69 ? 60   ARG B NE    1 
ATOM   1970 C  CZ    . ARG D 3 53 ? 23.661  24.131  130.930 1.00 28.56 ? 60   ARG B CZ    1 
ATOM   1971 N  NH1   . ARG D 3 53 ? 24.960  23.847  130.594 1.00 29.71 ? 60   ARG B NH1   1 
ATOM   1972 N  NH2   . ARG D 3 53 ? 23.357  24.576  132.167 1.00 26.65 ? 60   ARG B NH2   1 
ATOM   1973 N  N     . LEU D 3 54 ? 20.557  18.972  127.494 1.00 21.23 ? 61   LEU B N     1 
ATOM   1974 C  CA    . LEU D 3 54 ? 19.376  18.495  128.151 1.00 20.07 ? 61   LEU B CA    1 
ATOM   1975 C  C     . LEU D 3 54 ? 19.707  17.163  128.694 1.00 20.70 ? 61   LEU B C     1 
ATOM   1976 O  O     . LEU D 3 54 ? 19.389  16.836  129.813 1.00 23.14 ? 61   LEU B O     1 
ATOM   1977 C  CB    . LEU D 3 54 ? 18.282  18.410  127.190 1.00 19.01 ? 61   LEU B CB    1 
ATOM   1978 C  CG    . LEU D 3 54 ? 17.150  17.507  127.600 1.00 21.44 ? 61   LEU B CG    1 
ATOM   1979 C  CD1   . LEU D 3 54 ? 16.317  18.088  128.704 1.00 20.26 ? 61   LEU B CD1   1 
ATOM   1980 C  CD2   . LEU D 3 54 ? 16.256  17.391  126.498 1.00 17.00 ? 61   LEU B CD2   1 
ATOM   1981 N  N     . GLU D 3 55 ? 20.468  16.353  128.020 1.00 22.22 ? 62   GLU B N     1 
ATOM   1982 C  CA    . GLU D 3 55 ? 20.658  14.987  128.599 1.00 23.32 ? 62   GLU B CA    1 
ATOM   1983 C  C     . GLU D 3 55 ? 21.432  15.076  129.898 1.00 25.35 ? 62   GLU B C     1 
ATOM   1984 O  O     . GLU D 3 55 ? 21.180  14.372  130.850 1.00 26.09 ? 62   GLU B O     1 
ATOM   1985 C  CB    . GLU D 3 55 ? 21.463  14.133  127.692 1.00 21.50 ? 62   GLU B CB    1 
ATOM   1986 C  CG    . GLU D 3 55 ? 21.476  12.752  128.111 1.00 26.97 ? 62   GLU B CG    1 
ATOM   1987 C  CD    . GLU D 3 55 ? 21.894  11.807  126.950 1.00 35.50 ? 62   GLU B CD    1 
ATOM   1988 O  OE1   . GLU D 3 55 ? 23.129  11.649  126.700 1.00 30.65 ? 62   GLU B OE1   1 
ATOM   1989 O  OE2   . GLU D 3 55 ? 20.959  11.188  126.328 1.00 39.21 ? 62   GLU B OE2   1 
ATOM   1990 N  N     . ARG D 3 56 ? 22.425  15.906  129.949 1.00 26.30 ? 63   ARG B N     1 
ATOM   1991 C  CA    . ARG D 3 56 ? 23.222  15.915  131.153 1.00 27.57 ? 63   ARG B CA    1 
ATOM   1992 C  C     . ARG D 3 56 ? 22.465  16.535  132.332 1.00 26.36 ? 63   ARG B C     1 
ATOM   1993 O  O     . ARG D 3 56 ? 22.657  16.091  133.520 1.00 26.62 ? 63   ARG B O     1 
ATOM   1994 C  CB    . ARG D 3 56 ? 24.590  16.526  130.837 1.00 29.38 ? 63   ARG B CB    1 
ATOM   1995 C  CG    . ARG D 3 56 ? 25.402  16.661  132.017 1.00 37.68 ? 63   ARG B CG    1 
ATOM   1996 C  CD    . ARG D 3 56 ? 25.538  15.391  132.914 1.00 41.37 ? 63   ARG B CD    1 
ATOM   1997 N  NE    . ARG D 3 56 ? 26.971  15.150  133.084 1.00 46.61 ? 63   ARG B NE    1 
ATOM   1998 C  CZ    . ARG D 3 56 ? 27.653  14.389  132.209 1.00 46.04 ? 63   ARG B CZ    1 
ATOM   1999 N  NH1   . ARG D 3 56 ? 27.029  13.760  131.214 1.00 40.25 ? 63   ARG B NH1   1 
ATOM   2000 N  NH2   . ARG D 3 56 ? 28.939  14.215  132.356 1.00 47.40 ? 63   ARG B NH2   1 
ATOM   2001 N  N     . LEU D 3 57 ? 21.464  17.392  132.045 1.00 25.00 ? 64   LEU B N     1 
ATOM   2002 C  CA    . LEU D 3 57 ? 20.698  17.960  133.195 1.00 24.04 ? 64   LEU B CA    1 
ATOM   2003 C  C     . LEU D 3 57 ? 19.794  16.893  133.583 1.00 23.47 ? 64   LEU B C     1 
ATOM   2004 O  O     . LEU D 3 57 ? 19.658  16.604  134.734 1.00 22.09 ? 64   LEU B O     1 
ATOM   2005 C  CB    . LEU D 3 57 ? 19.900  19.211  132.899 1.00 25.47 ? 64   LEU B CB    1 
ATOM   2006 C  CG    . LEU D 3 57 ? 20.419  20.659  133.126 1.00 25.63 ? 64   LEU B CG    1 
ATOM   2007 C  CD1   . LEU D 3 57 ? 21.809  20.708  133.593 1.00 23.96 ? 64   LEU B CD1   1 
ATOM   2008 C  CD2   . LEU D 3 57 ? 20.241  21.467  131.905 1.00 21.26 ? 64   LEU B CD2   1 
ATOM   2009 N  N     . GLU D 3 58 ? 19.269  16.139  132.631 1.00 24.57 ? 65   GLU B N     1 
ATOM   2010 C  CA    . GLU D 3 58 ? 18.495  14.948  133.106 1.00 25.11 ? 65   GLU B CA    1 
ATOM   2011 C  C     . GLU D 3 58 ? 19.342  14.004  133.911 1.00 23.87 ? 65   GLU B C     1 
ATOM   2012 O  O     . GLU D 3 58 ? 18.881  13.512  134.866 1.00 24.99 ? 65   GLU B O     1 
ATOM   2013 C  CB    . GLU D 3 58 ? 17.920  14.191  131.988 1.00 26.61 ? 65   GLU B CB    1 
ATOM   2014 C  CG    . GLU D 3 58 ? 16.859  14.957  131.262 1.00 30.87 ? 65   GLU B CG    1 
ATOM   2015 C  CD    . GLU D 3 58 ? 16.456  14.332  129.944 1.00 36.02 ? 65   GLU B CD    1 
ATOM   2016 O  OE1   . GLU D 3 58 ? 17.265  13.625  129.273 1.00 42.91 ? 65   GLU B OE1   1 
ATOM   2017 O  OE2   . GLU D 3 58 ? 15.298  14.541  129.567 1.00 39.05 ? 65   GLU B OE2   1 
ATOM   2018 N  N     . GLN D 3 59 ? 20.614  13.830  133.624 1.00 22.94 ? 66   GLN B N     1 
ATOM   2019 C  CA    . GLN D 3 59 ? 21.356  12.778  134.345 1.00 22.13 ? 66   GLN B CA    1 
ATOM   2020 C  C     . GLN D 3 59 ? 21.575  13.268  135.784 1.00 23.40 ? 66   GLN B C     1 
ATOM   2021 O  O     . GLN D 3 59 ? 21.401  12.560  136.721 1.00 20.40 ? 66   GLN B O     1 
ATOM   2022 C  CB    . GLN D 3 59 ? 22.683  12.558  133.672 1.00 21.34 ? 66   GLN B CB    1 
ATOM   2023 C  CG    . GLN D 3 59 ? 22.630  11.630  132.402 1.00 20.98 ? 66   GLN B CG    1 
ATOM   2024 C  CD    . GLN D 3 59 ? 23.926  11.737  131.568 1.00 22.85 ? 66   GLN B CD    1 
ATOM   2025 O  OE1   . GLN D 3 59 ? 24.403  12.829  131.220 1.00 28.24 ? 66   GLN B OE1   1 
ATOM   2026 N  NE2   . GLN D 3 59 ? 24.509  10.586  131.253 1.00 31.48 ? 66   GLN B NE2   1 
ATOM   2027 N  N     . LEU D 3 60 ? 21.857  14.563  135.933 1.00 24.04 ? 67   LEU B N     1 
ATOM   2028 C  CA    . LEU D 3 60 ? 22.108  15.100  137.226 1.00 22.66 ? 67   LEU B CA    1 
ATOM   2029 C  C     . LEU D 3 60 ? 20.796  15.093  138.009 1.00 21.97 ? 67   LEU B C     1 
ATOM   2030 O  O     . LEU D 3 60 ? 20.740  14.718  139.214 1.00 21.68 ? 67   LEU B O     1 
ATOM   2031 C  CB    . LEU D 3 60 ? 22.698  16.488  136.990 1.00 22.94 ? 67   LEU B CB    1 
ATOM   2032 C  CG    . LEU D 3 60 ? 23.471  17.242  138.078 1.00 28.38 ? 67   LEU B CG    1 
ATOM   2033 C  CD1   . LEU D 3 60 ? 23.301  18.809  137.947 1.00 27.64 ? 67   LEU B CD1   1 
ATOM   2034 C  CD2   . LEU D 3 60 ? 23.368  16.847  139.630 1.00 23.88 ? 67   LEU B CD2   1 
ATOM   2035 N  N     . PHE D 3 61 ? 19.693  15.385  137.317 1.00 22.02 ? 68   PHE B N     1 
ATOM   2036 C  CA    . PHE D 3 61 ? 18.393  15.488  138.009 1.00 21.80 ? 68   PHE B CA    1 
ATOM   2037 C  C     . PHE D 3 61 ? 18.056  14.155  138.726 1.00 22.99 ? 68   PHE B C     1 
ATOM   2038 O  O     . PHE D 3 61 ? 17.502  14.136  139.760 1.00 22.90 ? 68   PHE B O     1 
ATOM   2039 C  CB    . PHE D 3 61 ? 17.318  15.727  136.965 1.00 22.45 ? 68   PHE B CB    1 
ATOM   2040 C  CG    . PHE D 3 61 ? 15.945  15.682  137.520 1.00 24.38 ? 68   PHE B CG    1 
ATOM   2041 C  CD1   . PHE D 3 61 ? 15.329  14.477  137.743 1.00 25.97 ? 68   PHE B CD1   1 
ATOM   2042 C  CD2   . PHE D 3 61 ? 15.307  16.866  137.955 1.00 29.79 ? 68   PHE B CD2   1 
ATOM   2043 C  CE1   . PHE D 3 61 ? 14.090  14.463  138.270 1.00 29.55 ? 68   PHE B CE1   1 
ATOM   2044 C  CE2   . PHE D 3 61 ? 14.057  16.848  138.587 1.00 24.29 ? 68   PHE B CE2   1 
ATOM   2045 C  CZ    . PHE D 3 61 ? 13.442  15.719  138.726 1.00 25.89 ? 68   PHE B CZ    1 
ATOM   2046 N  N     . LEU D 3 62 ? 18.395  13.045  138.101 1.00 21.02 ? 69   LEU B N     1 
ATOM   2047 C  CA    . LEU D 3 62 ? 18.159  11.763  138.581 1.00 21.46 ? 69   LEU B CA    1 
ATOM   2048 C  C     . LEU D 3 62 ? 19.038  11.343  139.747 1.00 23.17 ? 69   LEU B C     1 
ATOM   2049 O  O     . LEU D 3 62 ? 18.807  10.240  140.266 1.00 22.68 ? 69   LEU B O     1 
ATOM   2050 C  CB    . LEU D 3 62 ? 18.518  10.795  137.426 1.00 21.72 ? 69   LEU B CB    1 
ATOM   2051 C  CG    . LEU D 3 62 ? 17.300  10.158  136.851 1.00 20.77 ? 69   LEU B CG    1 
ATOM   2052 C  CD1   . LEU D 3 62 ? 16.022  10.835  137.219 1.00 21.94 ? 69   LEU B CD1   1 
ATOM   2053 C  CD2   . LEU D 3 62 ? 17.392  9.788   135.476 1.00 20.49 ? 69   LEU B CD2   1 
ATOM   2054 N  N     . LEU D 3 63 ? 20.091  12.080  140.083 1.00 23.05 ? 70   LEU B N     1 
ATOM   2055 C  CA    . LEU D 3 63 ? 20.823  11.778  141.307 1.00 24.80 ? 70   LEU B CA    1 
ATOM   2056 C  C     . LEU D 3 63 ? 20.132  12.484  142.425 1.00 27.41 ? 70   LEU B C     1 
ATOM   2057 O  O     . LEU D 3 63 ? 20.375  12.245  143.609 1.00 28.73 ? 70   LEU B O     1 
ATOM   2058 C  CB    . LEU D 3 63 ? 22.224  12.365  141.267 1.00 24.39 ? 70   LEU B CB    1 
ATOM   2059 C  CG    . LEU D 3 63 ? 22.982  11.522  140.268 1.00 25.28 ? 70   LEU B CG    1 
ATOM   2060 C  CD1   . LEU D 3 63 ? 24.083  12.311  139.640 1.00 23.46 ? 70   LEU B CD1   1 
ATOM   2061 C  CD2   . LEU D 3 63 ? 23.559  10.343  141.005 1.00 28.38 ? 70   LEU B CD2   1 
ATOM   2062 N  N     . ILE D 3 64 ? 19.250  13.395  142.085 1.00 28.67 ? 71   ILE B N     1 
ATOM   2063 C  CA    . ILE D 3 64 ? 18.632  14.085  143.159 1.00 28.24 ? 71   ILE B CA    1 
ATOM   2064 C  C     . ILE D 3 64 ? 17.259  13.639  143.353 1.00 28.56 ? 71   ILE B C     1 
ATOM   2065 O  O     . ILE D 3 64 ? 16.809  13.610  144.451 1.00 30.56 ? 71   ILE B O     1 
ATOM   2066 C  CB    . ILE D 3 64 ? 18.525  15.575  142.895 1.00 28.96 ? 71   ILE B CB    1 
ATOM   2067 C  CG1   . ILE D 3 64 ? 19.931  16.159  142.848 1.00 25.60 ? 71   ILE B CG1   1 
ATOM   2068 C  CG2   . ILE D 3 64 ? 17.756  16.142  144.035 1.00 32.47 ? 71   ILE B CG2   1 
ATOM   2069 C  CD1   . ILE D 3 64 ? 20.139  17.448  142.056 1.00 23.22 ? 71   ILE B CD1   1 
ATOM   2070 N  N     . PHE D 3 65 ? 16.523  13.333  142.306 1.00 28.27 ? 72   PHE B N     1 
ATOM   2071 C  CA    . PHE D 3 65 ? 15.110  12.993  142.557 1.00 28.20 ? 72   PHE B CA    1 
ATOM   2072 C  C     . PHE D 3 65 ? 14.623  11.918  141.704 1.00 27.62 ? 72   PHE B C     1 
ATOM   2073 O  O     . PHE D 3 65 ? 15.250  11.570  140.776 1.00 27.90 ? 72   PHE B O     1 
ATOM   2074 C  CB    . PHE D 3 65 ? 14.213  14.098  142.110 1.00 28.68 ? 72   PHE B CB    1 
ATOM   2075 C  CG    . PHE D 3 65 ? 14.498  15.337  142.680 1.00 29.56 ? 72   PHE B CG    1 
ATOM   2076 C  CD1   . PHE D 3 65 ? 14.939  16.372  141.855 1.00 31.32 ? 72   PHE B CD1   1 
ATOM   2077 C  CD2   . PHE D 3 65 ? 14.322  15.538  144.059 1.00 35.23 ? 72   PHE B CD2   1 
ATOM   2078 C  CE1   . PHE D 3 65 ? 15.139  17.614  142.359 1.00 27.33 ? 72   PHE B CE1   1 
ATOM   2079 C  CE2   . PHE D 3 65 ? 14.547  16.841  144.587 1.00 32.35 ? 72   PHE B CE2   1 
ATOM   2080 C  CZ    . PHE D 3 65 ? 14.955  17.864  143.666 1.00 26.81 ? 72   PHE B CZ    1 
ATOM   2081 N  N     . PRO D 3 66 ? 13.432  11.443  141.972 1.00 28.09 ? 73   PRO B N     1 
ATOM   2082 C  CA    . PRO D 3 66 ? 13.041  10.250  141.321 1.00 28.77 ? 73   PRO B CA    1 
ATOM   2083 C  C     . PRO D 3 66 ? 12.742  10.438  139.869 1.00 28.99 ? 73   PRO B C     1 
ATOM   2084 O  O     . PRO D 3 66 ? 12.370  11.513  139.429 1.00 27.07 ? 73   PRO B O     1 
ATOM   2085 C  CB    . PRO D 3 66 ? 11.747  9.921   142.089 1.00 29.13 ? 73   PRO B CB    1 
ATOM   2086 C  CG    . PRO D 3 66 ? 12.012  10.455  143.431 1.00 26.77 ? 73   PRO B CG    1 
ATOM   2087 C  CD    . PRO D 3 66 ? 12.414  11.809  142.946 1.00 26.99 ? 73   PRO B CD    1 
ATOM   2088 N  N     . ARG D 3 67 ? 12.792  9.353   139.133 1.00 30.01 ? 74   ARG B N     1 
ATOM   2089 C  CA    . ARG D 3 67 ? 12.551  9.529   137.688 1.00 31.62 ? 74   ARG B CA    1 
ATOM   2090 C  C     . ARG D 3 67 ? 11.136  10.038  137.433 1.00 31.91 ? 74   ARG B C     1 
ATOM   2091 O  O     . ARG D 3 67 ? 10.954  10.939  136.664 1.00 31.28 ? 74   ARG B O     1 
ATOM   2092 C  CB    . ARG D 3 67 ? 12.906  8.264   136.847 1.00 30.45 ? 74   ARG B CB    1 
ATOM   2093 C  CG    . ARG D 3 67 ? 12.209  8.166   135.563 1.00 30.41 ? 74   ARG B CG    1 
ATOM   2094 C  CD    . ARG D 3 67 ? 12.866  8.784   134.429 1.00 34.24 ? 74   ARG B CD    1 
ATOM   2095 N  NE    . ARG D 3 67 ? 13.528  7.732   133.638 1.00 44.15 ? 74   ARG B NE    1 
ATOM   2096 C  CZ    . ARG D 3 67 ? 13.268  7.364   132.373 1.00 38.61 ? 74   ARG B CZ    1 
ATOM   2097 N  NH1   . ARG D 3 67 ? 12.269  7.881   131.718 1.00 36.12 ? 74   ARG B NH1   1 
ATOM   2098 N  NH2   . ARG D 3 67 ? 14.030  6.434   131.786 1.00 36.79 ? 74   ARG B NH2   1 
ATOM   2099 N  N     . GLU D 3 68 ? 10.149  9.465   138.106 1.00 32.81 ? 75   GLU B N     1 
ATOM   2100 C  CA    . GLU D 3 68 ? 8.804   9.982   137.967 1.00 34.44 ? 75   GLU B CA    1 
ATOM   2101 C  C     . GLU D 3 68 ? 8.766   11.514  138.021 1.00 34.05 ? 75   GLU B C     1 
ATOM   2102 O  O     . GLU D 3 68 ? 7.978   12.121  137.320 1.00 35.40 ? 75   GLU B O     1 
ATOM   2103 C  CB    . GLU D 3 68 ? 7.879   9.378   138.998 1.00 33.97 ? 75   GLU B CB    1 
ATOM   2104 C  CG    . GLU D 3 68 ? 8.042   9.971   140.378 1.00 42.71 ? 75   GLU B CG    1 
ATOM   2105 C  CD    . GLU D 3 68 ? 7.024   9.367   141.371 1.00 52.46 ? 75   GLU B CD    1 
ATOM   2106 O  OE1   . GLU D 3 68 ? 7.303   9.313   142.626 1.00 53.37 ? 75   GLU B OE1   1 
ATOM   2107 O  OE2   . GLU D 3 68 ? 5.955   8.920   140.848 1.00 54.32 ? 75   GLU B OE2   1 
ATOM   2108 N  N     . ASP D 3 69 ? 9.622   12.165  138.801 1.00 33.49 ? 76   ASP B N     1 
ATOM   2109 C  CA    . ASP D 3 69 ? 9.584   13.619  138.766 1.00 33.29 ? 76   ASP B CA    1 
ATOM   2110 C  C     . ASP D 3 69 ? 10.179  14.137  137.491 1.00 33.73 ? 76   ASP B C     1 
ATOM   2111 O  O     . ASP D 3 69 ? 9.677   15.066  136.956 1.00 35.07 ? 76   ASP B O     1 
ATOM   2112 C  CB    . ASP D 3 69 ? 10.159  14.259  140.048 1.00 32.44 ? 76   ASP B CB    1 
ATOM   2113 C  CG    . ASP D 3 69 ? 9.444   13.713  141.248 1.00 33.63 ? 76   ASP B CG    1 
ATOM   2114 O  OD1   . ASP D 3 69 ? 8.246   13.622  141.010 1.00 39.64 ? 76   ASP B OD1   1 
ATOM   2115 O  OD2   . ASP D 3 69 ? 9.979   13.258  142.315 1.00 28.18 ? 76   ASP B OD2   1 
ATOM   2116 N  N     . LEU D 3 70 ? 11.232  13.533  136.963 1.00 34.33 ? 77   LEU B N     1 
ATOM   2117 C  CA    . LEU D 3 70 ? 11.775  14.019  135.716 1.00 33.95 ? 77   LEU B CA    1 
ATOM   2118 C  C     . LEU D 3 70 ? 10.675  14.282  134.696 1.00 35.85 ? 77   LEU B C     1 
ATOM   2119 O  O     . LEU D 3 70 ? 10.622  15.356  134.059 1.00 36.67 ? 77   LEU B O     1 
ATOM   2120 C  CB    . LEU D 3 70 ? 12.673  12.984  135.111 1.00 32.96 ? 77   LEU B CB    1 
ATOM   2121 C  CG    . LEU D 3 70 ? 13.990  13.477  134.605 1.00 26.77 ? 77   LEU B CG    1 
ATOM   2122 C  CD1   . LEU D 3 70 ? 14.103  12.697  133.548 1.00 14.52 ? 77   LEU B CD1   1 
ATOM   2123 C  CD2   . LEU D 3 70 ? 13.872  14.978  134.223 1.00 22.95 ? 77   LEU B CD2   1 
ATOM   2124 N  N     . ASP D 3 71 ? 9.765   13.337  134.606 1.00 36.80 ? 78   ASP B N     1 
ATOM   2125 C  CA    . ASP D 3 71 ? 8.795   13.307  133.554 1.00 39.29 ? 78   ASP B CA    1 
ATOM   2126 C  C     . ASP D 3 71 ? 7.767   14.395  133.779 1.00 40.64 ? 78   ASP B C     1 
ATOM   2127 O  O     . ASP D 3 71 ? 7.163   14.851  132.833 1.00 40.42 ? 78   ASP B O     1 
ATOM   2128 C  CB    . ASP D 3 71 ? 8.081   11.960  133.645 1.00 40.54 ? 78   ASP B CB    1 
ATOM   2129 C  CG    . ASP D 3 71 ? 9.062   10.724  133.473 1.00 45.98 ? 78   ASP B CG    1 
ATOM   2130 O  OD1   . ASP D 3 71 ? 9.876   10.664  132.454 1.00 44.71 ? 78   ASP B OD1   1 
ATOM   2131 O  OD2   . ASP D 3 71 ? 8.986   9.823   134.376 1.00 52.03 ? 78   ASP B OD2   1 
ATOM   2132 N  N     . MET D 3 72 ? 7.507   14.754  135.039 1.00 40.79 ? 79   MET B N     1 
ATOM   2133 C  CA    . MET D 3 72 ? 6.575   15.778  135.267 1.00 44.35 ? 79   MET B CA    1 
ATOM   2134 C  C     . MET D 3 72 ? 7.196   17.139  134.802 1.00 43.46 ? 79   MET B C     1 
ATOM   2135 O  O     . MET D 3 72 ? 6.561   17.906  134.083 1.00 45.29 ? 79   MET B O     1 
ATOM   2136 C  CB    . MET D 3 72 ? 6.164   15.789  136.722 1.00 43.83 ? 79   MET B CB    1 
ATOM   2137 C  CG    . MET D 3 72 ? 5.219   14.629  137.216 1.00 47.46 ? 79   MET B CG    1 
ATOM   2138 S  SD    . MET D 3 72 ? 5.146   14.764  139.098 1.00 55.83 ? 79   MET B SD    1 
ATOM   2139 C  CE    . MET D 3 72 ? 4.441   13.152  139.674 1.00 49.76 ? 79   MET B CE    1 
ATOM   2140 N  N     . ILE D 3 73 ? 8.444   17.423  135.150 1.00 40.86 ? 80   ILE B N     1 
ATOM   2141 C  CA    . ILE D 3 73 ? 8.957   18.708  134.894 1.00 38.79 ? 80   ILE B CA    1 
ATOM   2142 C  C     . ILE D 3 73 ? 9.106   18.872  133.468 1.00 37.71 ? 80   ILE B C     1 
ATOM   2143 O  O     . ILE D 3 73 ? 8.915   19.983  132.971 1.00 37.05 ? 80   ILE B O     1 
ATOM   2144 C  CB    . ILE D 3 73 ? 10.351  18.869  135.428 1.00 38.35 ? 80   ILE B CB    1 
ATOM   2145 C  CG1   . ILE D 3 73 ? 10.317  18.198  136.732 1.00 44.60 ? 80   ILE B CG1   1 
ATOM   2146 C  CG2   . ILE D 3 73 ? 10.621  20.328  135.713 1.00 33.77 ? 80   ILE B CG2   1 
ATOM   2147 C  CD1   . ILE D 3 73 ? 9.512   19.140  137.787 1.00 48.96 ? 80   ILE B CD1   1 
ATOM   2148 N  N     . LEU D 3 74 ? 9.584   17.816  132.824 1.00 37.55 ? 81   LEU B N     1 
ATOM   2149 C  CA    . LEU D 3 74 ? 9.912   17.909  131.423 1.00 37.78 ? 81   LEU B CA    1 
ATOM   2150 C  C     . LEU D 3 74 ? 8.619   18.371  130.733 1.00 38.48 ? 81   LEU B C     1 
ATOM   2151 O  O     . LEU D 3 74 ? 8.659   19.039  129.710 1.00 36.72 ? 81   LEU B O     1 
ATOM   2152 C  CB    . LEU D 3 74 ? 10.273  16.549  130.904 1.00 38.62 ? 81   LEU B CB    1 
ATOM   2153 C  CG    . LEU D 3 74 ? 11.713  16.135  131.103 1.00 38.11 ? 81   LEU B CG    1 
ATOM   2154 C  CD1   . LEU D 3 74 ? 11.885  14.693  130.635 1.00 31.46 ? 81   LEU B CD1   1 
ATOM   2155 C  CD2   . LEU D 3 74 ? 12.634  17.035  130.350 1.00 39.31 ? 81   LEU B CD2   1 
ATOM   2156 N  N     . LYS D 3 75 ? 7.456   18.105  131.321 1.00 39.25 ? 82   LYS B N     1 
ATOM   2157 C  CA    . LYS D 3 75 ? 6.317   18.774  130.746 1.00 41.38 ? 82   LYS B CA    1 
ATOM   2158 C  C     . LYS D 3 75 ? 5.768   20.065  131.319 1.00 40.89 ? 82   LYS B C     1 
ATOM   2159 O  O     . LYS D 3 75 ? 4.708   20.448  130.893 1.00 42.73 ? 82   LYS B O     1 
ATOM   2160 C  CB    . LYS D 3 75 ? 5.132   17.822  130.330 1.00 43.07 ? 82   LYS B CB    1 
ATOM   2161 C  CG    . LYS D 3 75 ? 4.748   16.547  131.154 1.00 44.95 ? 82   LYS B CG    1 
ATOM   2162 C  CD    . LYS D 3 75 ? 3.400   15.806  130.574 1.00 45.60 ? 82   LYS B CD    1 
ATOM   2163 C  CE    . LYS D 3 75 ? 3.263   14.293  130.953 1.00 49.54 ? 82   LYS B CE    1 
ATOM   2164 N  NZ    . LYS D 3 75 ? 4.577   13.554  130.640 1.00 55.69 ? 82   LYS B NZ    1 
ATOM   2165 N  N     . MET D 3 76 ? 6.370   20.777  132.255 1.00 39.14 ? 83   MET B N     1 
ATOM   2166 C  CA    . MET D 3 76 ? 5.517   21.784  132.886 1.00 37.86 ? 83   MET B CA    1 
ATOM   2167 C  C     . MET D 3 76 ? 5.758   23.018  132.138 1.00 35.92 ? 83   MET B C     1 
ATOM   2168 O  O     . MET D 3 76 ? 6.903   23.329  131.838 1.00 33.47 ? 83   MET B O     1 
ATOM   2169 C  CB    . MET D 3 76 ? 5.857   22.028  134.346 1.00 36.53 ? 83   MET B CB    1 
ATOM   2170 C  CG    . MET D 3 76 ? 6.127   20.787  135.059 1.00 39.34 ? 83   MET B CG    1 
ATOM   2171 S  SD    . MET D 3 76 ? 5.769   20.854  136.848 1.00 43.35 ? 83   MET B SD    1 
ATOM   2172 C  CE    . MET D 3 76 ? 6.730   22.322  137.096 1.00 48.51 ? 83   MET B CE    1 
ATOM   2173 N  N     . ASP D 3 77 ? 4.683   23.767  131.875 1.00 35.93 ? 84   ASP B N     1 
ATOM   2174 C  CA    . ASP D 3 77 ? 4.833   25.133  131.348 1.00 35.07 ? 84   ASP B CA    1 
ATOM   2175 C  C     . ASP D 3 77 ? 4.736   26.252  132.392 1.00 35.64 ? 84   ASP B C     1 
ATOM   2176 O  O     . ASP D 3 77 ? 5.059   27.384  132.073 1.00 36.42 ? 84   ASP B O     1 
ATOM   2177 C  CB    . ASP D 3 77 ? 3.832   25.373  130.241 1.00 35.05 ? 84   ASP B CB    1 
ATOM   2178 C  CG    . ASP D 3 77 ? 4.044   26.730  129.518 1.00 39.57 ? 84   ASP B CG    1 
ATOM   2179 O  OD1   . ASP D 3 77 ? 5.077   26.918  128.787 1.00 41.14 ? 84   ASP B OD1   1 
ATOM   2180 O  OD2   . ASP D 3 77 ? 3.150   27.617  129.676 1.00 43.38 ? 84   ASP B OD2   1 
ATOM   2181 N  N     . SER D 3 78 ? 4.362   25.977  133.640 1.00 34.66 ? 85   SER B N     1 
ATOM   2182 C  CA    . SER D 3 78 ? 4.078   27.077  134.540 1.00 35.12 ? 85   SER B CA    1 
ATOM   2183 C  C     . SER D 3 78 ? 5.266   27.267  135.457 1.00 35.52 ? 85   SER B C     1 
ATOM   2184 O  O     . SER D 3 78 ? 5.734   26.276  136.035 1.00 35.11 ? 85   SER B O     1 
ATOM   2185 C  CB    . SER D 3 78 ? 2.802   26.784  135.373 1.00 34.57 ? 85   SER B CB    1 
ATOM   2186 O  OG    . SER D 3 78 ? 2.829   27.382  136.664 1.00 34.82 ? 85   SER B OG    1 
ATOM   2187 N  N     . LEU D 3 79 ? 5.732   28.511  135.635 1.00 34.53 ? 86   LEU B N     1 
ATOM   2188 C  CA    . LEU D 3 79 ? 6.810   28.688  136.558 1.00 35.85 ? 86   LEU B CA    1 
ATOM   2189 C  C     . LEU D 3 79 ? 6.419   28.382  138.040 1.00 38.06 ? 86   LEU B C     1 
ATOM   2190 O  O     . LEU D 3 79 ? 7.328   27.917  138.771 1.00 39.95 ? 86   LEU B O     1 
ATOM   2191 C  CB    . LEU D 3 79 ? 7.503   30.037  136.402 1.00 34.09 ? 86   LEU B CB    1 
ATOM   2192 C  CG    . LEU D 3 79 ? 8.458   30.267  135.195 1.00 35.55 ? 86   LEU B CG    1 
ATOM   2193 C  CD1   . LEU D 3 79 ? 8.576   31.804  134.950 1.00 34.74 ? 86   LEU B CD1   1 
ATOM   2194 C  CD2   . LEU D 3 79 ? 9.851   29.715  135.277 1.00 26.53 ? 86   LEU B CD2   1 
ATOM   2195 N  N     . GLN D 3 80 ? 5.168   28.659  138.526 1.00 38.06 ? 87   GLN B N     1 
ATOM   2196 C  CA    . GLN D 3 80 ? 4.744   28.206  139.894 1.00 38.49 ? 87   GLN B CA    1 
ATOM   2197 C  C     . GLN D 3 80 ? 4.879   26.637  139.962 1.00 38.59 ? 87   GLN B C     1 
ATOM   2198 O  O     . GLN D 3 80 ? 5.384   26.035  140.911 1.00 38.12 ? 87   GLN B O     1 
ATOM   2199 C  CB    . GLN D 3 80 ? 3.295   28.546  140.216 1.00 37.14 ? 87   GLN B CB    1 
ATOM   2200 C  CG    . GLN D 3 80 ? 2.988   30.030  140.461 1.00 44.23 ? 87   GLN B CG    1 
ATOM   2201 C  CD    . GLN D 3 80 ? 1.716   30.261  141.340 1.00 44.01 ? 87   GLN B CD    1 
ATOM   2202 O  OE1   . GLN D 3 80 ? 0.718   29.541  141.201 1.00 52.95 ? 87   GLN B OE1   1 
ATOM   2203 N  NE2   . GLN D 3 80 ? 1.774   31.235  142.246 1.00 42.92 ? 87   GLN B NE2   1 
ATOM   2204 N  N     . ASP D 3 81 ? 4.464   25.953  138.921 1.00 37.59 ? 88   ASP B N     1 
ATOM   2205 C  CA    . ASP D 3 81 ? 4.523   24.550  139.074 1.00 37.48 ? 88   ASP B CA    1 
ATOM   2206 C  C     . ASP D 3 81 ? 5.975   24.102  139.133 1.00 36.38 ? 88   ASP B C     1 
ATOM   2207 O  O     . ASP D 3 81 ? 6.269   23.214  139.938 1.00 37.57 ? 88   ASP B O     1 
ATOM   2208 C  CB    . ASP D 3 81 ? 3.641   23.782  138.041 1.00 37.62 ? 88   ASP B CB    1 
ATOM   2209 C  CG    . ASP D 3 81 ? 2.137   24.263  138.050 1.00 39.65 ? 88   ASP B CG    1 
ATOM   2210 O  OD1   . ASP D 3 81 ? 1.667   25.120  138.899 1.00 37.22 ? 88   ASP B OD1   1 
ATOM   2211 O  OD2   . ASP D 3 81 ? 1.421   23.783  137.144 1.00 43.57 ? 88   ASP B OD2   1 
ATOM   2212 N  N     . ILE D 3 82 ? 6.889   24.696  138.362 1.00 33.50 ? 89   ILE B N     1 
ATOM   2213 C  CA    . ILE D 3 82 ? 8.242   24.198  138.455 1.00 32.46 ? 89   ILE B CA    1 
ATOM   2214 C  C     . ILE D 3 82 ? 8.729   24.500  139.875 1.00 33.90 ? 89   ILE B C     1 
ATOM   2215 O  O     . ILE D 3 82 ? 9.503   23.774  140.438 1.00 34.41 ? 89   ILE B O     1 
ATOM   2216 C  CB    . ILE D 3 82 ? 9.179   24.812  137.413 1.00 32.27 ? 89   ILE B CB    1 
ATOM   2217 C  CG1   . ILE D 3 82 ? 8.766   24.370  136.045 1.00 28.97 ? 89   ILE B CG1   1 
ATOM   2218 C  CG2   . ILE D 3 82 ? 10.675  24.442  137.644 1.00 28.70 ? 89   ILE B CG2   1 
ATOM   2219 C  CD1   . ILE D 3 82 ? 9.391   25.103  134.956 1.00 23.18 ? 89   ILE B CD1   1 
ATOM   2220 N  N     . LYS D 3 83 ? 8.243   25.528  140.521 1.00 35.01 ? 90   LYS B N     1 
ATOM   2221 C  CA    . LYS D 3 83 ? 8.859   25.812  141.799 1.00 36.65 ? 90   LYS B CA    1 
ATOM   2222 C  C     . LYS D 3 83 ? 8.300   24.996  142.942 1.00 37.86 ? 90   LYS B C     1 
ATOM   2223 O  O     . LYS D 3 83 ? 9.031   24.601  143.870 1.00 37.59 ? 90   LYS B O     1 
ATOM   2224 C  CB    . LYS D 3 83 ? 8.848   27.286  142.086 1.00 35.27 ? 90   LYS B CB    1 
ATOM   2225 C  CG    . LYS D 3 83 ? 9.660   27.652  143.241 1.00 36.85 ? 90   LYS B CG    1 
ATOM   2226 C  CD    . LYS D 3 83 ? 9.117   28.937  143.799 1.00 38.96 ? 90   LYS B CD    1 
ATOM   2227 C  CE    . LYS D 3 83 ? 10.105  29.653  144.664 1.00 41.69 ? 90   LYS B CE    1 
ATOM   2228 N  NZ    . LYS D 3 83 ? 9.511   31.029  145.035 1.00 46.02 ? 90   LYS B NZ    1 
ATOM   2229 N  N     . ALA D 3 84 ? 7.008   24.741  142.857 1.00 40.11 ? 91   ALA B N     1 
ATOM   2230 C  CA    . ALA D 3 84 ? 6.271   23.955  143.865 1.00 42.75 ? 91   ALA B CA    1 
ATOM   2231 C  C     . ALA D 3 84 ? 6.799   22.502  143.884 1.00 44.30 ? 91   ALA B C     1 
ATOM   2232 O  O     . ALA D 3 84 ? 6.986   21.864  144.919 1.00 42.52 ? 91   ALA B O     1 
ATOM   2233 C  CB    . ALA D 3 84 ? 4.771   23.985  143.532 1.00 42.50 ? 91   ALA B CB    1 
ATOM   2234 N  N     . LEU D 3 85 ? 7.111   22.037  142.689 1.00 47.16 ? 92   LEU B N     1 
ATOM   2235 C  CA    . LEU D 3 85 ? 7.671   20.728  142.508 1.00 49.87 ? 92   LEU B CA    1 
ATOM   2236 C  C     . LEU D 3 85 ? 8.861   20.565  143.415 1.00 50.46 ? 92   LEU B C     1 
ATOM   2237 O  O     . LEU D 3 85 ? 9.116   19.483  143.969 1.00 52.00 ? 92   LEU B O     1 
ATOM   2238 C  CB    . LEU D 3 85 ? 8.129   20.568  141.054 1.00 50.56 ? 92   LEU B CB    1 
ATOM   2239 C  CG    . LEU D 3 85 ? 8.362   19.123  140.664 1.00 53.76 ? 92   LEU B CG    1 
ATOM   2240 C  CD1   . LEU D 3 85 ? 9.826   18.664  141.011 1.00 58.82 ? 92   LEU B CD1   1 
ATOM   2241 C  CD2   . LEU D 3 85 ? 7.270   18.266  141.393 1.00 54.30 ? 92   LEU B CD2   1 
ATOM   2242 N  N     . LEU D 3 86 ? 9.586   21.651  143.552 1.00 50.51 ? 93   LEU B N     1 
ATOM   2243 C  CA    . LEU D 3 86 ? 10.859  21.619  144.148 1.00 50.64 ? 93   LEU B CA    1 
ATOM   2244 C  C     . LEU D 3 86 ? 10.631  21.748  145.613 1.00 51.81 ? 93   LEU B C     1 
ATOM   2245 O  O     . LEU D 3 86 ? 11.394  21.205  146.381 1.00 54.31 ? 93   LEU B O     1 
ATOM   2246 C  CB    . LEU D 3 86 ? 11.625  22.825  143.647 1.00 50.77 ? 93   LEU B CB    1 
ATOM   2247 C  CG    . LEU D 3 86 ? 13.130  22.710  143.559 1.00 48.63 ? 93   LEU B CG    1 
ATOM   2248 C  CD1   . LEU D 3 86 ? 13.641  23.883  144.368 1.00 47.47 ? 93   LEU B CD1   1 
ATOM   2249 C  CD2   . LEU D 3 86 ? 13.651  21.391  144.121 1.00 41.18 ? 93   LEU B CD2   1 
ATOM   2250 N  N     . THR D 3 87 ? 9.576   22.464  145.993 1.00 52.13 ? 94   THR B N     1 
ATOM   2251 C  CA    . THR D 3 87 ? 9.165   22.694  147.364 1.00 51.96 ? 94   THR B CA    1 
ATOM   2252 C  C     . THR D 3 87 ? 8.639   21.470  148.089 1.00 53.90 ? 94   THR B C     1 
ATOM   2253 O  O     . THR D 3 87 ? 8.865   21.345  149.283 1.00 55.48 ? 94   THR B O     1 
ATOM   2254 C  CB    . THR D 3 87 ? 8.037   23.716  147.348 1.00 51.91 ? 94   THR B CB    1 
ATOM   2255 O  OG1   . THR D 3 87 ? 8.566   24.923  146.797 1.00 51.47 ? 94   THR B OG1   1 
ATOM   2256 C  CG2   . THR D 3 87 ? 7.419   23.958  148.770 1.00 48.79 ? 94   THR B CG2   1 
ATOM   2257 N  N     . GLY D 3 88 ? 7.865   20.610  147.416 1.00 55.22 ? 95   GLY B N     1 
ATOM   2258 C  CA    . GLY D 3 88 ? 7.576   19.277  147.931 1.00 56.48 ? 95   GLY B CA    1 
ATOM   2259 C  C     . GLY D 3 88 ? 8.876   18.478  148.007 1.00 57.97 ? 95   GLY B C     1 
ATOM   2260 O  O     . GLY D 3 88 ? 8.857   17.295  148.320 1.00 58.59 ? 95   GLY B O     1 
ATOM   2261 N  N     . LEU D 3 89 ? 10.015  19.120  147.704 1.00 58.88 ? 96   LEU B N     1 
ATOM   2262 C  CA    . LEU D 3 89 ? 11.381  18.571  147.939 1.00 58.92 ? 96   LEU B CA    1 
ATOM   2263 C  C     . LEU D 3 89 ? 11.540  17.143  147.476 1.00 58.23 ? 96   LEU B C     1 
ATOM   2264 O  O     . LEU D 3 89 ? 11.124  16.852  146.375 1.00 57.78 ? 96   LEU B O     1 
ATOM   2265 C  CB    . LEU D 3 89 ? 11.734  18.619  149.417 1.00 59.62 ? 96   LEU B CB    1 
ATOM   2266 C  CG    . LEU D 3 89 ? 11.802  19.942  150.198 1.00 60.21 ? 96   LEU B CG    1 
ATOM   2267 C  CD1   . LEU D 3 89 ? 12.026  19.511  151.670 1.00 55.85 ? 96   LEU B CD1   1 
ATOM   2268 C  CD2   . LEU D 3 89 ? 12.847  21.060  149.616 1.00 56.28 ? 96   LEU B CD2   1 
HETATM 2269 C  C1    . MPD E 4 .  ? 17.701  20.236  108.184 1.00 30.41 ? 100  MPD D C1    1 
HETATM 2270 C  C2    . MPD E 4 .  ? 18.112  19.990  106.616 1.00 30.30 ? 100  MPD D C2    1 
HETATM 2271 O  O2    . MPD E 4 .  ? 19.352  20.785  106.175 1.00 19.11 ? 100  MPD D O2    1 
HETATM 2272 C  CM    . MPD E 4 .  ? 18.342  18.522  106.273 1.00 28.71 ? 100  MPD D CM    1 
HETATM 2273 C  C3    . MPD E 4 .  ? 16.840  20.567  105.941 1.00 32.81 ? 100  MPD D C3    1 
HETATM 2274 C  C4    . MPD E 4 .  ? 16.577  22.014  106.561 1.00 35.95 ? 100  MPD D C4    1 
HETATM 2275 O  O4    . MPD E 4 .  ? 17.277  23.175  106.045 1.00 34.01 ? 100  MPD D O4    1 
HETATM 2276 C  C5    . MPD E 4 .  ? 15.171  22.449  106.718 1.00 40.82 ? 100  MPD D C5    1 
HETATM 2277 ZN ZN    . ZN  F 5 .  ? 34.959  -0.003  99.419  1.00 77.47 ? 1001 ZN  A ZN    1 
HETATM 2278 ZN ZN    . ZN  G 5 .  ? 35.227  -2.745  101.094 1.00 77.62 ? 1002 ZN  A ZN    1 
HETATM 2279 ZN ZN    . ZN  H 5 .  ? 0.986   43.973  101.315 1.00 82.27 ? 1    ZN  B ZN    1 
HETATM 2280 ZN ZN    . ZN  I 5 .  ? 0.321   46.445  103.165 1.00 95.03 ? 2    ZN  B ZN    1 
HETATM 2281 O  O     . HOH J 6 .  ? 9.555   20.847  111.833 1.00 28.67 ? 101  HOH D O     1 
HETATM 2282 O  O     . HOH J 6 .  ? 6.533   22.838  105.291 1.00 35.49 ? 102  HOH D O     1 
HETATM 2283 O  O     . HOH J 6 .  ? 20.383  15.613  103.767 1.00 53.24 ? 103  HOH D O     1 
HETATM 2284 O  O     . HOH J 6 .  ? 35.447  16.296  95.628  1.00 50.98 ? 104  HOH D O     1 
HETATM 2285 O  O     . HOH J 6 .  ? 9.277   20.499  101.217 1.00 44.42 ? 105  HOH D O     1 
HETATM 2286 O  O     . HOH J 6 .  ? 11.935  29.434  103.382 1.00 45.32 ? 106  HOH D O     1 
HETATM 2287 O  O     . HOH J 6 .  ? 30.041  22.456  101.979 1.00 54.94 ? 107  HOH D O     1 
HETATM 2288 O  O     . HOH J 6 .  ? 28.241  23.258  98.923  1.00 43.14 ? 108  HOH D O     1 
HETATM 2289 O  O     . HOH J 6 .  ? 16.310  27.605  108.705 1.00 43.01 ? 109  HOH D O     1 
HETATM 2290 O  O     . HOH J 6 .  ? 9.783   26.168  109.886 1.00 39.79 ? 110  HOH D O     1 
HETATM 2291 O  O     . HOH K 6 .  ? 26.667  23.505  101.259 1.00 44.82 ? 41   HOH E O     1 
HETATM 2292 O  O     . HOH K 6 .  ? 26.750  24.802  108.359 1.00 49.97 ? 42   HOH E O     1 
HETATM 2293 O  O     . HOH K 6 .  ? 26.020  21.859  112.181 1.00 32.26 ? 43   HOH E O     1 
HETATM 2294 O  O     . HOH K 6 .  ? 23.480  24.329  98.865  1.00 37.44 ? 44   HOH E O     1 
HETATM 2295 O  O     . HOH K 6 .  ? 20.111  24.403  97.806  1.00 53.73 ? 45   HOH E O     1 
HETATM 2296 O  O     . HOH K 6 .  ? 24.236  26.264  100.883 1.00 50.66 ? 46   HOH E O     1 
HETATM 2297 O  O     . HOH K 6 .  ? 7.674   23.073  93.299  1.00 62.48 ? 47   HOH E O     1 
HETATM 2298 O  O     . HOH K 6 .  ? 4.095   29.555  94.558  1.00 54.30 ? 48   HOH E O     1 
HETATM 2299 O  O     . HOH K 6 .  ? 6.216   22.208  101.393 1.00 49.13 ? 49   HOH E O     1 
HETATM 2300 O  O     . HOH K 6 .  ? 12.185  29.917  100.075 1.00 58.35 ? 50   HOH E O     1 
HETATM 2301 O  O     . HOH L 6 .  ? 41.993  1.290   108.329 1.00 56.34 ? 1003 HOH A O     1 
HETATM 2302 O  O     . HOH L 6 .  ? 7.802   21.254  118.577 1.00 34.16 ? 1004 HOH A O     1 
HETATM 2303 O  O     . HOH L 6 .  ? 30.669  12.233  131.528 1.00 38.17 ? 1005 HOH A O     1 
HETATM 2304 O  O     . HOH L 6 .  ? 7.372   21.535  121.500 1.00 46.62 ? 1006 HOH A O     1 
HETATM 2305 O  O     . HOH M 6 .  ? 21.994  13.425  123.438 1.00 40.82 ? 97   HOH B O     1 
HETATM 2306 O  O     . HOH M 6 .  ? 10.031  7.342   139.875 1.00 29.08 ? 98   HOH B O     1 
HETATM 2307 O  O     . HOH M 6 .  ? 0.052   29.036  107.078 1.00 71.78 ? 99   HOH B O     1 
HETATM 2308 O  O     . HOH M 6 .  ? 10.678  11.538  130.551 1.00 43.90 ? 100  HOH B O     1 
HETATM 2309 O  O     . HOH M 6 .  ? 25.131  26.187  114.515 1.00 47.35 ? 101  HOH B O     1 
HETATM 2310 O  O     . HOH M 6 .  ? 27.106  20.892  118.752 1.00 28.58 ? 102  HOH B O     1 
HETATM 2311 O  O     . HOH M 6 .  ? 18.763  14.942  124.677 1.00 28.76 ? 103  HOH B O     1 
HETATM 2312 O  O     . HOH M 6 .  ? 22.714  13.860  120.134 1.00 35.98 ? 104  HOH B O     1 
HETATM 2313 O  O     . HOH M 6 .  ? 16.559  14.236  120.839 1.00 54.46 ? 105  HOH B O     1 
# 
loop_
_pdbx_poly_seq_scheme.asym_id 
_pdbx_poly_seq_scheme.entity_id 
_pdbx_poly_seq_scheme.seq_id 
_pdbx_poly_seq_scheme.mon_id 
_pdbx_poly_seq_scheme.ndb_seq_num 
_pdbx_poly_seq_scheme.pdb_seq_num 
_pdbx_poly_seq_scheme.auth_seq_num 
_pdbx_poly_seq_scheme.pdb_mon_id 
_pdbx_poly_seq_scheme.auth_mon_id 
_pdbx_poly_seq_scheme.pdb_strand_id 
_pdbx_poly_seq_scheme.pdb_ins_code 
_pdbx_poly_seq_scheme.hetero 
A 1 1  DA  1  1  1  DA  A   D . n 
A 1 2  DC  2  2  2  DC  C   D . n 
A 1 3  DC  3  3  3  DC  C   D . n 
A 1 4  DG  4  4  4  DG  G   D . n 
A 1 5  DG  5  5  5  DG  G   D . n 
A 1 6  DA  6  6  6  DA  A   D . n 
A 1 7  DG  7  7  7  DG  G   D . n 
A 1 8  DG  8  8  8  DG  G   D . n 
A 1 9  DA  9  9  9  DA  A   D . n 
A 1 10 DC  10 10 10 DC  C   D . n 
A 1 11 DA  11 11 11 DA  A   D . n 
A 1 12 DG  12 12 12 DG  G   D . n 
A 1 13 DT  13 13 13 DT  T   D . n 
A 1 14 DC  14 14 14 DC  C   D . n 
A 1 15 DC  15 15 15 DC  C   D . n 
A 1 16 DT  16 16 16 DT  T   D . n 
A 1 17 DC  17 17 17 DC  C   D . n 
A 1 18 DC  18 18 18 DC  C   D . n 
A 1 19 DG  19 19 19 DG  G   D . n 
A 1 20 DG  20 20 20 DG  G   D . n 
B 2 1  DT  1  21 21 DT  T   E . n 
B 2 2  DC  2  22 22 DC  C   E . n 
B 2 3  DC  3  23 23 DC  C   E . n 
B 2 4  DG  4  24 24 DG  G   E . n 
B 2 5  DG  5  25 25 DG  G   E . n 
B 2 6  DA  6  26 26 DA  A   E . n 
B 2 7  DG  7  27 27 DG  G   E . n 
B 2 8  DG  8  28 28 DG  G   E . n 
B 2 9  DA  9  29 29 DA  A   E . n 
B 2 10 DC  10 30 30 DC  C   E . n 
B 2 11 DT  11 31 31 DT  T   E . n 
B 2 12 DG  12 32 32 DG  G   E . n 
B 2 13 DT  13 33 33 DT  T   E . n 
B 2 14 DC  14 34 34 DC  C   E . n 
B 2 15 DC  15 35 35 DC  C   E . n 
B 2 16 DT  16 36 36 DT  T   E . n 
B 2 17 DC  17 37 37 DC  C   E . n 
B 2 18 DC  18 38 38 DC  C   E . n 
B 2 19 DG  19 39 39 DG  G   E . n 
B 2 20 DG  20 40 40 DG  G   E . n 
C 3 1  GLU 1  8  8  GLU GLU A . n 
C 3 2  GLN 2  9  9  GLN GLN A . n 
C 3 3  ALA 3  10 10 ALA ALA A . n 
C 3 4  CYS 4  11 11 CYS CYS A . n 
C 3 5  ASP 5  12 12 ASP ASP A . n 
C 3 6  ILE 6  13 13 ILE ILE A . n 
C 3 7  CYS 7  14 14 CYS CYS A . n 
C 3 8  ARG 8  15 15 ARG ARG A . n 
C 3 9  LEU 9  16 16 LEU LEU A . n 
C 3 10 LYS 10 17 17 LYS LYS A . n 
C 3 11 LYS 11 18 18 LYS LYS A . n 
C 3 12 LEU 12 19 19 LEU LEU A . n 
C 3 13 LYS 13 20 20 LYS LYS A . n 
C 3 14 CYS 14 21 21 CYS CYS A . n 
C 3 15 SER 15 22 22 SER SER A . n 
C 3 16 LYS 16 23 23 LYS LYS A . n 
C 3 17 GLU 17 24 24 GLU GLU A . n 
C 3 18 LYS 18 25 25 LYS LYS A . n 
C 3 19 PRO 19 26 26 PRO PRO A . n 
C 3 20 LYS 20 27 27 LYS LYS A . n 
C 3 21 CYS 21 28 28 CYS CYS A . n 
C 3 22 ALA 22 29 29 ALA ALA A . n 
C 3 23 LYS 23 30 30 LYS LYS A . n 
C 3 24 CYS 24 31 31 CYS CYS A . n 
C 3 25 LEU 25 32 32 LEU LEU A . n 
C 3 26 LYS 26 33 33 LYS LYS A . n 
C 3 27 ASN 27 34 34 ASN ASN A . n 
C 3 28 ASN 28 35 35 ASN ASN A . n 
C 3 29 TRP 29 36 36 TRP TRP A . n 
C 3 30 GLU 30 37 37 GLU GLU A . n 
C 3 31 CYS 31 38 38 CYS CYS A . n 
C 3 32 ARG 32 39 39 ARG ARG A . n 
C 3 33 TYR 33 40 40 TYR TYR A . n 
C 3 34 SER 34 41 41 SER SER A . n 
C 3 35 PRO 35 42 42 PRO PRO A . n 
C 3 36 LYS 36 43 43 LYS LYS A . n 
C 3 37 THR 37 44 44 THR THR A . n 
C 3 38 LYS 38 45 45 LYS LYS A . n 
C 3 39 ARG 39 46 46 ARG ARG A . n 
C 3 40 SER 40 47 47 SER SER A . n 
C 3 41 PRO 41 48 48 PRO PRO A . n 
C 3 42 LEU 42 49 49 LEU LEU A . n 
C 3 43 THR 43 50 50 THR THR A . n 
C 3 44 ARG 44 51 51 ARG ARG A . n 
C 3 45 ALA 45 52 52 ALA ALA A . n 
C 3 46 HIS 46 53 53 HIS HIS A . n 
C 3 47 LEU 47 54 54 LEU LEU A . n 
C 3 48 THR 48 55 55 THR THR A . n 
C 3 49 GLU 49 56 56 GLU GLU A . n 
C 3 50 VAL 50 57 57 VAL VAL A . n 
C 3 51 GLU 51 58 58 GLU GLU A . n 
C 3 52 SER 52 59 59 SER SER A . n 
C 3 53 ARG 53 60 60 ARG ARG A . n 
C 3 54 LEU 54 61 61 LEU LEU A . n 
C 3 55 GLU 55 62 62 GLU GLU A . n 
C 3 56 ARG 56 63 63 ARG ARG A . n 
C 3 57 LEU 57 64 64 LEU LEU A . n 
C 3 58 GLU 58 65 65 GLU GLU A . n 
C 3 59 GLN 59 66 66 GLN GLN A . n 
C 3 60 LEU 60 67 67 LEU LEU A . n 
C 3 61 PHE 61 68 68 PHE PHE A . n 
C 3 62 LEU 62 69 69 LEU LEU A . n 
C 3 63 LEU 63 70 70 LEU LEU A . n 
C 3 64 ILE 64 71 71 ILE ILE A . n 
C 3 65 PHE 65 72 72 PHE PHE A . n 
C 3 66 PRO 66 73 73 PRO PRO A . n 
C 3 67 ARG 67 74 74 ARG ARG A . n 
C 3 68 GLU 68 75 75 GLU GLU A . n 
C 3 69 ASP 69 76 76 ASP ASP A . n 
C 3 70 LEU 70 77 77 LEU LEU A . n 
C 3 71 ASP 71 78 78 ASP ASP A . n 
C 3 72 MET 72 79 79 MET MET A . n 
C 3 73 ILE 73 80 80 ILE ILE A . n 
C 3 74 LEU 74 81 81 LEU LEU A . n 
C 3 75 LYS 75 82 82 LYS LYS A . n 
C 3 76 MET 76 83 83 MET MET A . n 
C 3 77 ASP 77 84 84 ASP ASP A . n 
C 3 78 SER 78 85 85 SER SER A . n 
C 3 79 LEU 79 86 86 LEU LEU A . n 
C 3 80 GLN 80 87 87 GLN GLN A . n 
C 3 81 ASP 81 88 88 ASP ASP A . n 
C 3 82 ILE 82 89 89 ILE ILE A . n 
C 3 83 LYS 83 90 90 LYS LYS A . n 
C 3 84 ALA 84 91 91 ALA ALA A . n 
C 3 85 LEU 85 92 92 LEU LEU A . n 
C 3 86 LEU 86 93 93 LEU LEU A . n 
C 3 87 THR 87 94 94 THR THR A . n 
C 3 88 GLY 88 95 95 GLY GLY A . n 
C 3 89 LEU 89 96 96 LEU LEU A . n 
D 3 1  GLU 1  8  8  GLU GLU B . n 
D 3 2  GLN 2  9  9  GLN GLN B . n 
D 3 3  ALA 3  10 10 ALA ALA B . n 
D 3 4  CYS 4  11 11 CYS CYS B . n 
D 3 5  ASP 5  12 12 ASP ASP B . n 
D 3 6  ILE 6  13 13 ILE ILE B . n 
D 3 7  CYS 7  14 14 CYS CYS B . n 
D 3 8  ARG 8  15 15 ARG ARG B . n 
D 3 9  LEU 9  16 16 LEU LEU B . n 
D 3 10 LYS 10 17 17 LYS LYS B . n 
D 3 11 LYS 11 18 18 LYS LYS B . n 
D 3 12 LEU 12 19 19 LEU LEU B . n 
D 3 13 LYS 13 20 20 LYS LYS B . n 
D 3 14 CYS 14 21 21 CYS CYS B . n 
D 3 15 SER 15 22 22 SER SER B . n 
D 3 16 LYS 16 23 23 LYS LYS B . n 
D 3 17 GLU 17 24 24 GLU GLU B . n 
D 3 18 LYS 18 25 25 LYS LYS B . n 
D 3 19 PRO 19 26 26 PRO PRO B . n 
D 3 20 LYS 20 27 27 LYS LYS B . n 
D 3 21 CYS 21 28 28 CYS CYS B . n 
D 3 22 ALA 22 29 29 ALA ALA B . n 
D 3 23 LYS 23 30 30 LYS LYS B . n 
D 3 24 CYS 24 31 31 CYS CYS B . n 
D 3 25 LEU 25 32 32 LEU LEU B . n 
D 3 26 LYS 26 33 33 LYS LYS B . n 
D 3 27 ASN 27 34 34 ASN ASN B . n 
D 3 28 ASN 28 35 35 ASN ASN B . n 
D 3 29 TRP 29 36 36 TRP TRP B . n 
D 3 30 GLU 30 37 37 GLU GLU B . n 
D 3 31 CYS 31 38 38 CYS CYS B . n 
D 3 32 ARG 32 39 39 ARG ARG B . n 
D 3 33 TYR 33 40 40 TYR TYR B . n 
D 3 34 SER 34 41 41 SER SER B . n 
D 3 35 PRO 35 42 42 PRO PRO B . n 
D 3 36 LYS 36 43 43 LYS LYS B . n 
D 3 37 THR 37 44 44 THR THR B . n 
D 3 38 LYS 38 45 45 LYS LYS B . n 
D 3 39 ARG 39 46 46 ARG ARG B . n 
D 3 40 SER 40 47 47 SER SER B . n 
D 3 41 PRO 41 48 48 PRO PRO B . n 
D 3 42 LEU 42 49 49 LEU LEU B . n 
D 3 43 THR 43 50 50 THR THR B . n 
D 3 44 ARG 44 51 51 ARG ARG B . n 
D 3 45 ALA 45 52 52 ALA ALA B . n 
D 3 46 HIS 46 53 53 HIS HIS B . n 
D 3 47 LEU 47 54 54 LEU LEU B . n 
D 3 48 THR 48 55 55 THR THR B . n 
D 3 49 GLU 49 56 56 GLU GLU B . n 
D 3 50 VAL 50 57 57 VAL VAL B . n 
D 3 51 GLU 51 58 58 GLU GLU B . n 
D 3 52 SER 52 59 59 SER SER B . n 
D 3 53 ARG 53 60 60 ARG ARG B . n 
D 3 54 LEU 54 61 61 LEU LEU B . n 
D 3 55 GLU 55 62 62 GLU GLU B . n 
D 3 56 ARG 56 63 63 ARG ARG B . n 
D 3 57 LEU 57 64 64 LEU LEU B . n 
D 3 58 GLU 58 65 65 GLU GLU B . n 
D 3 59 GLN 59 66 66 GLN GLN B . n 
D 3 60 LEU 60 67 67 LEU LEU B . n 
D 3 61 PHE 61 68 68 PHE PHE B . n 
D 3 62 LEU 62 69 69 LEU LEU B . n 
D 3 63 LEU 63 70 70 LEU LEU B . n 
D 3 64 ILE 64 71 71 ILE ILE B . n 
D 3 65 PHE 65 72 72 PHE PHE B . n 
D 3 66 PRO 66 73 73 PRO PRO B . n 
D 3 67 ARG 67 74 74 ARG ARG B . n 
D 3 68 GLU 68 75 75 GLU GLU B . n 
D 3 69 ASP 69 76 76 ASP ASP B . n 
D 3 70 LEU 70 77 77 LEU LEU B . n 
D 3 71 ASP 71 78 78 ASP ASP B . n 
D 3 72 MET 72 79 79 MET MET B . n 
D 3 73 ILE 73 80 80 ILE ILE B . n 
D 3 74 LEU 74 81 81 LEU LEU B . n 
D 3 75 LYS 75 82 82 LYS LYS B . n 
D 3 76 MET 76 83 83 MET MET B . n 
D 3 77 ASP 77 84 84 ASP ASP B . n 
D 3 78 SER 78 85 85 SER SER B . n 
D 3 79 LEU 79 86 86 LEU LEU B . n 
D 3 80 GLN 80 87 87 GLN GLN B . n 
D 3 81 ASP 81 88 88 ASP ASP B . n 
D 3 82 ILE 82 89 89 ILE ILE B . n 
D 3 83 LYS 83 90 90 LYS LYS B . n 
D 3 84 ALA 84 91 91 ALA ALA B . n 
D 3 85 LEU 85 92 92 LEU LEU B . n 
D 3 86 LEU 86 93 93 LEU LEU B . n 
D 3 87 THR 87 94 94 THR THR B . n 
D 3 88 GLY 88 95 95 GLY GLY B . n 
D 3 89 LEU 89 96 96 LEU LEU B . n 
# 
loop_
_pdbx_nonpoly_scheme.asym_id 
_pdbx_nonpoly_scheme.entity_id 
_pdbx_nonpoly_scheme.mon_id 
_pdbx_nonpoly_scheme.ndb_seq_num 
_pdbx_nonpoly_scheme.pdb_seq_num 
_pdbx_nonpoly_scheme.auth_seq_num 
_pdbx_nonpoly_scheme.pdb_mon_id 
_pdbx_nonpoly_scheme.auth_mon_id 
_pdbx_nonpoly_scheme.pdb_strand_id 
_pdbx_nonpoly_scheme.pdb_ins_code 
E 4 MPD 1  100  100  MPD MPD D . 
F 5 ZN  1  1001 1001 ZN  ZN2 A . 
G 5 ZN  1  1002 1002 ZN  ZN2 A . 
H 5 ZN  1  1    1    ZN  ZN2 B . 
I 5 ZN  1  2    2    ZN  ZN2 B . 
J 6 HOH 1  101  15   HOH HOH D . 
J 6 HOH 2  102  26   HOH HOH D . 
J 6 HOH 3  103  27   HOH HOH D . 
J 6 HOH 4  104  35   HOH HOH D . 
J 6 HOH 5  105  37   HOH HOH D . 
J 6 HOH 6  106  39   HOH HOH D . 
J 6 HOH 7  107  62   HOH HOH D . 
J 6 HOH 8  108  63   HOH HOH D . 
J 6 HOH 9  109  65   HOH HOH D . 
J 6 HOH 10 110  73   HOH HOH D . 
K 6 HOH 1  41   10   HOH HOH E . 
K 6 HOH 2  42   22   HOH HOH E . 
K 6 HOH 3  43   34   HOH HOH E . 
K 6 HOH 4  44   48   HOH HOH E . 
K 6 HOH 5  45   51   HOH HOH E . 
K 6 HOH 6  46   56   HOH HOH E . 
K 6 HOH 7  47   60   HOH HOH E . 
K 6 HOH 8  48   61   HOH HOH E . 
K 6 HOH 9  49   64   HOH HOH E . 
K 6 HOH 10 50   71   HOH HOH E . 
L 6 HOH 1  1003 18   HOH HOH A . 
L 6 HOH 2  1004 19   HOH HOH A . 
L 6 HOH 3  1005 32   HOH HOH A . 
L 6 HOH 4  1006 36   HOH HOH A . 
M 6 HOH 1  97   14   HOH HOH B . 
M 6 HOH 2  98   25   HOH HOH B . 
M 6 HOH 3  99   33   HOH HOH B . 
M 6 HOH 4  100  38   HOH HOH B . 
M 6 HOH 5  101  46   HOH HOH B . 
M 6 HOH 6  102  55   HOH HOH B . 
M 6 HOH 7  103  57   HOH HOH B . 
M 6 HOH 8  104  74   HOH HOH B . 
M 6 HOH 9  105  75   HOH HOH B . 
# 
_pdbx_struct_assembly.id                   1 
_pdbx_struct_assembly.details              author_and_software_defined_assembly 
_pdbx_struct_assembly.method_details       PISA 
_pdbx_struct_assembly.oligomeric_details   tetrameric 
_pdbx_struct_assembly.oligomeric_count     4 
# 
_pdbx_struct_assembly_gen.assembly_id       1 
_pdbx_struct_assembly_gen.oper_expression   1 
_pdbx_struct_assembly_gen.asym_id_list      A,B,C,D,E,F,G,H,I,J,K,L,M 
# 
loop_
_pdbx_struct_assembly_prop.biol_id 
_pdbx_struct_assembly_prop.type 
_pdbx_struct_assembly_prop.value 
_pdbx_struct_assembly_prop.details 
1 'ABSA (A^2)' 8210  ? 
1 MORE         -70.8 ? 
1 'SSA (A^2)'  17740 ? 
# 
_pdbx_struct_oper_list.id                   1 
_pdbx_struct_oper_list.type                 'identity operation' 
_pdbx_struct_oper_list.name                 1_555 
_pdbx_struct_oper_list.symmetry_operation   x,y,z 
_pdbx_struct_oper_list.matrix[1][1]         1.0000000000 
_pdbx_struct_oper_list.matrix[1][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[1][3]         0.0000000000 
_pdbx_struct_oper_list.vector[1]            0.0000000000 
_pdbx_struct_oper_list.matrix[2][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[2][2]         1.0000000000 
_pdbx_struct_oper_list.matrix[2][3]         0.0000000000 
_pdbx_struct_oper_list.vector[2]            0.0000000000 
_pdbx_struct_oper_list.matrix[3][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][3]         1.0000000000 
_pdbx_struct_oper_list.vector[3]            0.0000000000 
# 
loop_
_pdbx_struct_conn_angle.id 
_pdbx_struct_conn_angle.ptnr1_label_atom_id 
_pdbx_struct_conn_angle.ptnr1_label_alt_id 
_pdbx_struct_conn_angle.ptnr1_label_asym_id 
_pdbx_struct_conn_angle.ptnr1_label_comp_id 
_pdbx_struct_conn_angle.ptnr1_label_seq_id 
_pdbx_struct_conn_angle.ptnr1_auth_atom_id 
_pdbx_struct_conn_angle.ptnr1_auth_asym_id 
_pdbx_struct_conn_angle.ptnr1_auth_comp_id 
_pdbx_struct_conn_angle.ptnr1_auth_seq_id 
_pdbx_struct_conn_angle.ptnr1_PDB_ins_code 
_pdbx_struct_conn_angle.ptnr1_symmetry 
_pdbx_struct_conn_angle.ptnr2_label_atom_id 
_pdbx_struct_conn_angle.ptnr2_label_alt_id 
_pdbx_struct_conn_angle.ptnr2_label_asym_id 
_pdbx_struct_conn_angle.ptnr2_label_comp_id 
_pdbx_struct_conn_angle.ptnr2_label_seq_id 
_pdbx_struct_conn_angle.ptnr2_auth_atom_id 
_pdbx_struct_conn_angle.ptnr2_auth_asym_id 
_pdbx_struct_conn_angle.ptnr2_auth_comp_id 
_pdbx_struct_conn_angle.ptnr2_auth_seq_id 
_pdbx_struct_conn_angle.ptnr2_PDB_ins_code 
_pdbx_struct_conn_angle.ptnr2_symmetry 
_pdbx_struct_conn_angle.ptnr3_label_atom_id 
_pdbx_struct_conn_angle.ptnr3_label_alt_id 
_pdbx_struct_conn_angle.ptnr3_label_asym_id 
_pdbx_struct_conn_angle.ptnr3_label_comp_id 
_pdbx_struct_conn_angle.ptnr3_label_seq_id 
_pdbx_struct_conn_angle.ptnr3_auth_atom_id 
_pdbx_struct_conn_angle.ptnr3_auth_asym_id 
_pdbx_struct_conn_angle.ptnr3_auth_comp_id 
_pdbx_struct_conn_angle.ptnr3_auth_seq_id 
_pdbx_struct_conn_angle.ptnr3_PDB_ins_code 
_pdbx_struct_conn_angle.ptnr3_symmetry 
_pdbx_struct_conn_angle.value 
_pdbx_struct_conn_angle.value_esd 
1  SG ? C CYS 4  ? A CYS 11 ? 1_555 ZN ? G ZN . ? A ZN 1002 ? 1_555 SG ? C CYS 21 ? A CYS 28 ? 1_555 99.9  ? 
2  SG ? C CYS 4  ? A CYS 11 ? 1_555 ZN ? G ZN . ? A ZN 1002 ? 1_555 SG ? C CYS 24 ? A CYS 31 ? 1_555 93.0  ? 
3  SG ? C CYS 21 ? A CYS 28 ? 1_555 ZN ? G ZN . ? A ZN 1002 ? 1_555 SG ? C CYS 24 ? A CYS 31 ? 1_555 121.3 ? 
4  SG ? C CYS 4  ? A CYS 11 ? 1_555 ZN ? G ZN . ? A ZN 1002 ? 1_555 SG ? C CYS 31 ? A CYS 38 ? 1_555 134.1 ? 
5  SG ? C CYS 21 ? A CYS 28 ? 1_555 ZN ? G ZN . ? A ZN 1002 ? 1_555 SG ? C CYS 31 ? A CYS 38 ? 1_555 101.5 ? 
6  SG ? C CYS 24 ? A CYS 31 ? 1_555 ZN ? G ZN . ? A ZN 1002 ? 1_555 SG ? C CYS 31 ? A CYS 38 ? 1_555 109.3 ? 
7  SG ? C CYS 4  ? A CYS 11 ? 1_555 ZN ? F ZN . ? A ZN 1001 ? 1_555 SG ? C CYS 7  ? A CYS 14 ? 1_555 89.0  ? 
8  SG ? C CYS 4  ? A CYS 11 ? 1_555 ZN ? F ZN . ? A ZN 1001 ? 1_555 SG ? C CYS 21 ? A CYS 28 ? 1_555 97.0  ? 
9  SG ? C CYS 7  ? A CYS 14 ? 1_555 ZN ? F ZN . ? A ZN 1001 ? 1_555 SG ? C CYS 21 ? A CYS 28 ? 1_555 123.6 ? 
10 SG ? D CYS 4  ? B CYS 11 ? 1_555 ZN ? H ZN . ? B ZN 1    ? 1_555 SG ? D CYS 7  ? B CYS 14 ? 1_555 88.2  ? 
11 SG ? D CYS 4  ? B CYS 11 ? 1_555 ZN ? H ZN . ? B ZN 1    ? 1_555 SG ? D CYS 14 ? B CYS 21 ? 1_555 129.3 ? 
12 SG ? D CYS 7  ? B CYS 14 ? 1_555 ZN ? H ZN . ? B ZN 1    ? 1_555 SG ? D CYS 14 ? B CYS 21 ? 1_555 104.3 ? 
13 SG ? D CYS 4  ? B CYS 11 ? 1_555 ZN ? H ZN . ? B ZN 1    ? 1_555 SG ? D CYS 21 ? B CYS 28 ? 1_555 104.4 ? 
14 SG ? D CYS 7  ? B CYS 14 ? 1_555 ZN ? H ZN . ? B ZN 1    ? 1_555 SG ? D CYS 21 ? B CYS 28 ? 1_555 128.7 ? 
15 SG ? D CYS 14 ? B CYS 21 ? 1_555 ZN ? H ZN . ? B ZN 1    ? 1_555 SG ? D CYS 21 ? B CYS 28 ? 1_555 104.8 ? 
16 SG ? D CYS 4  ? B CYS 11 ? 1_555 ZN ? I ZN . ? B ZN 2    ? 1_555 SG ? D CYS 21 ? B CYS 28 ? 1_555 98.3  ? 
17 SG ? D CYS 4  ? B CYS 11 ? 1_555 ZN ? I ZN . ? B ZN 2    ? 1_555 SG ? D CYS 24 ? B CYS 31 ? 1_555 102.1 ? 
18 SG ? D CYS 21 ? B CYS 28 ? 1_555 ZN ? I ZN . ? B ZN 2    ? 1_555 SG ? D CYS 24 ? B CYS 31 ? 1_555 137.6 ? 
19 SG ? D CYS 4  ? B CYS 11 ? 1_555 ZN ? I ZN . ? B ZN 2    ? 1_555 SG ? D CYS 31 ? B CYS 38 ? 1_555 112.6 ? 
20 SG ? D CYS 21 ? B CYS 28 ? 1_555 ZN ? I ZN . ? B ZN 2    ? 1_555 SG ? D CYS 31 ? B CYS 38 ? 1_555 82.3  ? 
21 SG ? D CYS 24 ? B CYS 31 ? 1_555 ZN ? I ZN . ? B ZN 2    ? 1_555 SG ? D CYS 31 ? B CYS 38 ? 1_555 121.7 ? 
# 
loop_
_pdbx_audit_revision_history.ordinal 
_pdbx_audit_revision_history.data_content_type 
_pdbx_audit_revision_history.major_revision 
_pdbx_audit_revision_history.minor_revision 
_pdbx_audit_revision_history.revision_date 
1 'Structure model' 1 0 2008-07-01 
2 'Structure model' 1 1 2011-07-13 
3 'Structure model' 1 2 2017-10-25 
4 'Structure model' 1 3 2019-07-24 
# 
_pdbx_audit_revision_details.ordinal             1 
_pdbx_audit_revision_details.revision_ordinal    1 
_pdbx_audit_revision_details.data_content_type   'Structure model' 
_pdbx_audit_revision_details.provider            repository 
_pdbx_audit_revision_details.type                'Initial release' 
_pdbx_audit_revision_details.description         ? 
# 
loop_
_pdbx_audit_revision_group.ordinal 
_pdbx_audit_revision_group.revision_ordinal 
_pdbx_audit_revision_group.data_content_type 
_pdbx_audit_revision_group.group 
1 2 'Structure model' Advisory                    
2 2 'Structure model' 'Refinement description'    
3 2 'Structure model' 'Version format compliance' 
4 3 'Structure model' 'Refinement description'    
5 4 'Structure model' 'Data collection'           
6 4 'Structure model' 'Derived calculations'      
7 4 'Structure model' 'Refinement description'    
8 4 'Structure model' 'Source and taxonomy'       
# 
loop_
_pdbx_audit_revision_category.ordinal 
_pdbx_audit_revision_category.revision_ordinal 
_pdbx_audit_revision_category.data_content_type 
_pdbx_audit_revision_category.category 
1 3 'Structure model' software                    
2 4 'Structure model' diffrn                      
3 4 'Structure model' diffrn_radiation_wavelength 
4 4 'Structure model' diffrn_source               
5 4 'Structure model' entity_src_gen              
6 4 'Structure model' ndb_struct_na_base_pair     
7 4 'Structure model' pdbx_entity_src_syn         
8 4 'Structure model' software                    
# 
loop_
_pdbx_audit_revision_item.ordinal 
_pdbx_audit_revision_item.revision_ordinal 
_pdbx_audit_revision_item.data_content_type 
_pdbx_audit_revision_item.item 
1  4 'Structure model' '_diffrn_source.pdbx_wavelength_list'            
2  4 'Structure model' '_entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id' 
3  4 'Structure model' '_entity_src_gen.pdbx_host_org_ncbi_taxonomy_id' 
4  4 'Structure model' '_ndb_struct_na_base_pair.buckle'                
5  4 'Structure model' '_ndb_struct_na_base_pair.opening'               
6  4 'Structure model' '_software.classification'                       
7  4 'Structure model' '_software.contact_author'                       
8  4 'Structure model' '_software.contact_author_email'                 
9  4 'Structure model' '_software.language'                             
10 4 'Structure model' '_software.location'                             
11 4 'Structure model' '_software.name'                                 
12 4 'Structure model' '_software.type'                                 
13 4 'Structure model' '_software.version'                              
# 
loop_
_pdbx_refine_tls.pdbx_refine_id 
_pdbx_refine_tls.id 
_pdbx_refine_tls.details 
_pdbx_refine_tls.method 
_pdbx_refine_tls.origin_x 
_pdbx_refine_tls.origin_y 
_pdbx_refine_tls.origin_z 
_pdbx_refine_tls.T[1][1] 
_pdbx_refine_tls.T[2][2] 
_pdbx_refine_tls.T[3][3] 
_pdbx_refine_tls.T[1][2] 
_pdbx_refine_tls.T[1][3] 
_pdbx_refine_tls.T[2][3] 
_pdbx_refine_tls.L[1][1] 
_pdbx_refine_tls.L[2][2] 
_pdbx_refine_tls.L[3][3] 
_pdbx_refine_tls.L[1][2] 
_pdbx_refine_tls.L[1][3] 
_pdbx_refine_tls.L[2][3] 
_pdbx_refine_tls.S[1][1] 
_pdbx_refine_tls.S[2][2] 
_pdbx_refine_tls.S[3][3] 
_pdbx_refine_tls.S[1][2] 
_pdbx_refine_tls.S[1][3] 
_pdbx_refine_tls.S[2][3] 
_pdbx_refine_tls.S[2][1] 
_pdbx_refine_tls.S[3][1] 
_pdbx_refine_tls.S[3][2] 
'X-RAY DIFFRACTION' 1 ? refined 26.5547 11.4820 119.8274 0.0046  -0.4023 0.0886  -0.0180 -0.0243 0.0119  3.9151 0.8944 3.6602 
-1.2409 -1.6391 -0.1813 0.0084 -0.3943 0.3859 0.3831 -0.4762 -0.1464 0.3413  0.2909  -0.2695 
'X-RAY DIFFRACTION' 2 ? refined 9.4315  29.8245 119.8894 0.0099  -0.2720 0.0252  0.0420  0.0188  -0.0388 2.6633 1.8362 4.1381 
-1.1300 1.5699  -1.1633 0.0139 -0.4559 0.4420 0.2503 0.4275  0.0800  0.3904  -0.3453 -0.0135 
'X-RAY DIFFRACTION' 3 ? refined 19.8690 21.5164 100.9090 -0.1607 0.2817  -0.2349 0.2189  -0.0140 0.1032  8.3470 2.9700 0.9413 
-2.9739 -0.1201 0.1623  0.2689 -0.4235 0.1545 1.2570 0.1994  -0.1165 -0.0638 0.0590  0.1143  
'X-RAY DIFFRACTION' 4 ? refined 16.1531 22.3954 100.8826 -0.1676 0.2945  -0.2529 0.1864  0.0311  0.0468  6.9143 3.3132 0.8488 
-3.2903 0.8884  0.1924  0.2675 -0.3682 0.1008 1.1153 0.1416  0.0524  -0.1083 0.0235  0.0211  
# 
loop_
_pdbx_refine_tls_group.pdbx_refine_id 
_pdbx_refine_tls_group.id 
_pdbx_refine_tls_group.refine_tls_id 
_pdbx_refine_tls_group.beg_auth_asym_id 
_pdbx_refine_tls_group.beg_auth_seq_id 
_pdbx_refine_tls_group.end_auth_asym_id 
_pdbx_refine_tls_group.end_auth_seq_id 
_pdbx_refine_tls_group.selection_details 
_pdbx_refine_tls_group.beg_label_asym_id 
_pdbx_refine_tls_group.beg_label_seq_id 
_pdbx_refine_tls_group.end_label_asym_id 
_pdbx_refine_tls_group.end_label_seq_id 
_pdbx_refine_tls_group.selection 
'X-RAY DIFFRACTION' 1 1 A 8  A 96 ? . . . . ? 
'X-RAY DIFFRACTION' 2 2 B 8  B 96 ? . . . . ? 
'X-RAY DIFFRACTION' 3 3 D 1  D 20 ? . . . . ? 
'X-RAY DIFFRACTION' 4 4 E 21 E 40 ? . . . . ? 
# 
loop_
_phasing.method 
MAD 
MR  
# 
loop_
_software.name 
_software.version 
_software.date 
_software.type 
_software.contact_author 
_software.contact_author_email 
_software.classification 
_software.location 
_software.language 
_software.citation_id 
_software.pdbx_ordinal 
REFMAC      5.2.0019 ?                    program 'Murshudov, G.N.'    ccp4@dl.ac.uk            refinement        
http://www.ccp4.ac.uk/main.html                  Fortran_77 ? 1 
SCALEPACK   .        ?                    package 'Zbyszek Otwinowski' zbyszek@mix.swmed.edu    'data scaling'    
http://www.lnls.br/infra/linhasluz/denzo-hkl.htm ?          ? 2 
CNS         .        ?                    package 'Axel T. Brunger'    axel.brunger@yale.edu    refinement        
http://cns.csb.yale.edu/v1.1/                    Fortran_77 ? 3 
SOLVE       .        ?                    package 'Tom Terwilliger'    terwilliger@LANL.gov     phasing           
http://www.solve.lanl.gov/                       ?          ? 4 
DENZO       .        ?                    package 'Zbyszek Otwinowski' zbyszek@mix.swmed.edu    'data reduction'  
http://www.lnls.br/infra/linhasluz/denzo-hkl.htm ?          ? 5 
PDB_EXTRACT 3.005    'September 10, 2007' package PDB                  sw-help@rcsb.rutgers.edu 'data extraction' 
http://pdb.rutgers.edu/software/                 C++        ? 6 
HKL-2000    .        ?                    ?       ?                    ?                        'data collection' ? ?          ? 7 
CNS         .        ?                    ?       ?                    ?                        phasing           ? ?          ? 8 
# 
_pdbx_validate_close_contact.id               1 
_pdbx_validate_close_contact.PDB_model_num    1 
_pdbx_validate_close_contact.auth_atom_id_1   O2 
_pdbx_validate_close_contact.auth_asym_id_1   D 
_pdbx_validate_close_contact.auth_comp_id_1   DC 
_pdbx_validate_close_contact.auth_seq_id_1    14 
_pdbx_validate_close_contact.PDB_ins_code_1   ? 
_pdbx_validate_close_contact.label_alt_id_1   ? 
_pdbx_validate_close_contact.auth_atom_id_2   O 
_pdbx_validate_close_contact.auth_asym_id_2   D 
_pdbx_validate_close_contact.auth_comp_id_2   HOH 
_pdbx_validate_close_contact.auth_seq_id_2    106 
_pdbx_validate_close_contact.PDB_ins_code_2   ? 
_pdbx_validate_close_contact.label_alt_id_2   ? 
_pdbx_validate_close_contact.dist             2.19 
# 
_pdbx_validate_symm_contact.id                1 
_pdbx_validate_symm_contact.PDB_model_num     1 
_pdbx_validate_symm_contact.auth_atom_id_1    OE1 
_pdbx_validate_symm_contact.auth_asym_id_1    A 
_pdbx_validate_symm_contact.auth_comp_id_1    GLU 
_pdbx_validate_symm_contact.auth_seq_id_1     62 
_pdbx_validate_symm_contact.PDB_ins_code_1    ? 
_pdbx_validate_symm_contact.label_alt_id_1    ? 
_pdbx_validate_symm_contact.site_symmetry_1   1_555 
_pdbx_validate_symm_contact.auth_atom_id_2    O 
_pdbx_validate_symm_contact.auth_asym_id_2    B 
_pdbx_validate_symm_contact.auth_comp_id_2    LEU 
_pdbx_validate_symm_contact.auth_seq_id_2     69 
_pdbx_validate_symm_contact.PDB_ins_code_2    ? 
_pdbx_validate_symm_contact.label_alt_id_2    ? 
_pdbx_validate_symm_contact.site_symmetry_2   4_558 
_pdbx_validate_symm_contact.dist              2.04 
# 
loop_
_pdbx_validate_rmsd_bond.id 
_pdbx_validate_rmsd_bond.PDB_model_num 
_pdbx_validate_rmsd_bond.auth_atom_id_1 
_pdbx_validate_rmsd_bond.auth_asym_id_1 
_pdbx_validate_rmsd_bond.auth_comp_id_1 
_pdbx_validate_rmsd_bond.auth_seq_id_1 
_pdbx_validate_rmsd_bond.PDB_ins_code_1 
_pdbx_validate_rmsd_bond.label_alt_id_1 
_pdbx_validate_rmsd_bond.auth_atom_id_2 
_pdbx_validate_rmsd_bond.auth_asym_id_2 
_pdbx_validate_rmsd_bond.auth_comp_id_2 
_pdbx_validate_rmsd_bond.auth_seq_id_2 
_pdbx_validate_rmsd_bond.PDB_ins_code_2 
_pdbx_validate_rmsd_bond.label_alt_id_2 
_pdbx_validate_rmsd_bond.bond_value 
_pdbx_validate_rmsd_bond.bond_target_value 
_pdbx_validate_rmsd_bond.bond_deviation 
_pdbx_validate_rmsd_bond.bond_standard_deviation 
_pdbx_validate_rmsd_bond.linker_flag 
1  1 N9    D DA  1  ? ? C4    D DA  1  ? ? 1.333 1.374 -0.041 0.006 N 
2  1 C6    D DG  7  ? ? O6    D DG  7  ? ? 1.336 1.237 0.099  0.009 N 
3  1 C5    D DG  8  ? ? N7    D DG  8  ? ? 1.431 1.388 0.043  0.006 N 
4  1 "O3'" D DC  10 ? ? "C3'" D DC  10 ? ? 1.355 1.419 -0.064 0.006 N 
5  1 C6    D DA  11 ? ? N1    D DA  11 ? ? 1.411 1.351 0.060  0.007 N 
6  1 "O3'" D DA  11 ? ? P     D DG  12 ? ? 1.525 1.607 -0.082 0.012 Y 
7  1 C2    D DG  12 ? ? N2    D DG  12 ? ? 1.404 1.341 0.063  0.010 N 
8  1 C6    D DG  12 ? ? O6    D DG  12 ? ? 1.306 1.237 0.069  0.009 N 
9  1 "C1'" D DT  13 ? ? N1    D DT  13 ? ? 1.605 1.488 0.117  0.013 N 
10 1 "C5'" D DC  14 ? ? "C4'" D DC  14 ? ? 1.560 1.512 0.048  0.007 N 
11 1 "O4'" D DC  14 ? ? "C4'" D DC  14 ? ? 1.520 1.449 0.071  0.009 N 
12 1 C4    D DT  16 ? ? C5    D DT  16 ? ? 1.508 1.445 0.063  0.009 N 
13 1 N3    D DC  17 ? ? C4    D DC  17 ? ? 1.387 1.335 0.052  0.007 N 
14 1 "O3'" E DC  23 ? ? "C3'" E DC  23 ? ? 1.369 1.419 -0.050 0.006 N 
15 1 "O3'" E DG  25 ? ? "C3'" E DG  25 ? ? 1.351 1.419 -0.068 0.006 N 
16 1 "O3'" E DG  27 ? ? "C3'" E DG  27 ? ? 1.379 1.419 -0.040 0.006 N 
17 1 "O3'" E DG  28 ? ? "C3'" E DG  28 ? ? 1.346 1.419 -0.073 0.006 N 
18 1 N3    E DA  29 ? ? C4    E DA  29 ? ? 1.291 1.344 -0.053 0.006 N 
19 1 "O3'" E DC  30 ? ? "C3'" E DC  30 ? ? 1.377 1.419 -0.042 0.006 N 
20 1 "O3'" E DT  31 ? ? "C3'" E DT  31 ? ? 1.371 1.419 -0.048 0.006 N 
21 1 C2    E DT  31 ? ? O2    E DT  31 ? ? 1.161 1.220 -0.059 0.008 N 
22 1 C5    E DT  31 ? ? C7    E DT  31 ? ? 1.544 1.496 0.048  0.006 N 
23 1 C6    E DG  32 ? ? O6    E DG  32 ? ? 1.307 1.237 0.070  0.009 N 
24 1 "O4'" E DC  34 ? ? "C1'" E DC  34 ? ? 1.326 1.418 -0.092 0.012 N 
25 1 "O3'" E DG  39 ? ? "C3'" E DG  39 ? ? 1.551 1.435 0.116  0.013 N 
26 1 CB    A CYS 31 ? ? SG    A CYS 31 ? ? 1.994 1.818 0.176  0.017 N 
27 1 CD    A GLU 56 ? ? OE1   A GLU 56 ? ? 1.325 1.252 0.073  0.011 N 
28 1 CG    A GLU 58 ? ? CD    A GLU 58 ? ? 1.613 1.515 0.098  0.015 N 
29 1 CG    A GLU 62 ? ? CD    A GLU 62 ? ? 1.634 1.515 0.119  0.015 N 
30 1 CB    B CYS 31 ? ? SG    B CYS 31 ? ? 2.047 1.818 0.229  0.017 N 
31 1 CG    B ARG 46 ? ? CD    B ARG 46 ? ? 1.678 1.515 0.163  0.025 N 
32 1 CG    B GLU 56 ? ? CD    B GLU 56 ? ? 1.608 1.515 0.093  0.015 N 
33 1 CB    B SER 59 ? ? OG    B SER 59 ? ? 1.325 1.418 -0.093 0.013 N 
34 1 CE1   B PHE 68 ? ? CZ    B PHE 68 ? ? 1.485 1.369 0.116  0.019 N 
35 1 CB    B PHE 72 ? ? CG    B PHE 72 ? ? 1.393 1.509 -0.116 0.017 N 
# 
loop_
_pdbx_validate_rmsd_angle.id 
_pdbx_validate_rmsd_angle.PDB_model_num 
_pdbx_validate_rmsd_angle.auth_atom_id_1 
_pdbx_validate_rmsd_angle.auth_asym_id_1 
_pdbx_validate_rmsd_angle.auth_comp_id_1 
_pdbx_validate_rmsd_angle.auth_seq_id_1 
_pdbx_validate_rmsd_angle.PDB_ins_code_1 
_pdbx_validate_rmsd_angle.label_alt_id_1 
_pdbx_validate_rmsd_angle.auth_atom_id_2 
_pdbx_validate_rmsd_angle.auth_asym_id_2 
_pdbx_validate_rmsd_angle.auth_comp_id_2 
_pdbx_validate_rmsd_angle.auth_seq_id_2 
_pdbx_validate_rmsd_angle.PDB_ins_code_2 
_pdbx_validate_rmsd_angle.label_alt_id_2 
_pdbx_validate_rmsd_angle.auth_atom_id_3 
_pdbx_validate_rmsd_angle.auth_asym_id_3 
_pdbx_validate_rmsd_angle.auth_comp_id_3 
_pdbx_validate_rmsd_angle.auth_seq_id_3 
_pdbx_validate_rmsd_angle.PDB_ins_code_3 
_pdbx_validate_rmsd_angle.label_alt_id_3 
_pdbx_validate_rmsd_angle.angle_value 
_pdbx_validate_rmsd_angle.angle_target_value 
_pdbx_validate_rmsd_angle.angle_deviation 
_pdbx_validate_rmsd_angle.angle_standard_deviation 
_pdbx_validate_rmsd_angle.linker_flag 
1   1 "O4'" D DA  1  ? ? "C1'" D DA  1  ? ? N9    D DA  1  ? ? 99.16  108.00 -8.84  0.70 N 
2   1 C2    D DA  1  ? ? N3    D DA  1  ? ? C4    D DA  1  ? ? 104.24 110.60 -6.36  0.50 N 
3   1 C5    D DA  1  ? ? C6    D DA  1  ? ? N1    D DA  1  ? ? 112.56 117.70 -5.14  0.50 N 
4   1 "O5'" D DC  2  ? ? P     D DC  2  ? ? OP1   D DC  2  ? ? 99.96  105.70 -5.74  0.90 N 
5   1 "O5'" D DC  2  ? ? "C5'" D DC  2  ? ? "C4'" D DC  2  ? ? 101.23 109.40 -8.17  0.80 N 
6   1 N1    D DC  2  ? ? "C1'" D DC  2  ? ? "C2'" D DC  2  ? ? 123.13 114.30 8.83   1.40 N 
7   1 "O5'" D DC  3  ? ? "C5'" D DC  3  ? ? "C4'" D DC  3  ? ? 104.45 109.40 -4.95  0.80 N 
8   1 C6    D DC  3  ? ? N1    D DC  3  ? ? C2    D DC  3  ? ? 116.97 120.30 -3.33  0.40 N 
9   1 N3    D DC  3  ? ? C4    D DC  3  ? ? N4    D DC  3  ? ? 122.23 118.00 4.23   0.70 N 
10  1 N1    D DG  4  ? ? C2    D DG  4  ? ? N3    D DG  4  ? ? 128.52 123.90 4.62   0.60 N 
11  1 "C3'" D DG  4  ? ? "O3'" D DG  4  ? ? P     D DG  5  ? ? 129.06 119.70 9.36   1.20 Y 
12  1 "O3'" D DG  4  ? ? P     D DG  5  ? ? "O5'" D DG  5  ? ? 117.74 104.00 13.74  1.90 Y 
13  1 "C3'" D DG  5  ? ? "C2'" D DG  5  ? ? "C1'" D DG  5  ? ? 95.09  102.40 -7.31  0.80 N 
14  1 "O4'" D DG  5  ? ? "C1'" D DG  5  ? ? N9    D DG  5  ? ? 111.27 108.30 2.97   0.30 N 
15  1 C4    D DG  5  ? ? C5    D DG  5  ? ? N7    D DG  5  ? ? 107.75 110.80 -3.05  0.40 N 
16  1 "O4'" D DA  6  ? ? "C1'" D DA  6  ? ? N9    D DA  6  ? ? 102.12 108.00 -5.88  0.70 N 
17  1 "O5'" D DG  7  ? ? P     D DG  7  ? ? OP2   D DG  7  ? ? 97.87  105.70 -7.83  0.90 N 
18  1 C4    D DG  7  ? ? C5    D DG  7  ? ? C6    D DG  7  ? ? 122.78 118.80 3.98   0.60 N 
19  1 C5    D DG  7  ? ? C6    D DG  7  ? ? N1    D DG  7  ? ? 107.38 111.50 -4.12  0.50 N 
20  1 C6    D DG  7  ? ? C5    D DG  7  ? ? N7    D DG  7  ? ? 125.93 130.40 -4.47  0.60 N 
21  1 N1    D DG  7  ? ? C6    D DG  7  ? ? O6    D DG  7  ? ? 126.67 119.90 6.77   0.60 N 
22  1 "O5'" D DG  8  ? ? "C5'" D DG  8  ? ? "C4'" D DG  8  ? ? 101.92 109.40 -7.48  0.80 N 
23  1 C5    D DG  8  ? ? C6    D DG  8  ? ? N1    D DG  8  ? ? 114.88 111.50 3.38   0.50 N 
24  1 "O5'" D DA  9  ? ? P     D DA  9  ? ? OP1   D DA  9  ? ? 97.86  105.70 -7.84  0.90 N 
25  1 "C3'" D DA  9  ? ? "C2'" D DA  9  ? ? "C1'" D DA  9  ? ? 97.50  102.40 -4.90  0.80 N 
26  1 N3    D DC  10 ? ? C2    D DC  10 ? ? O2    D DC  10 ? ? 116.98 121.90 -4.92  0.70 N 
27  1 OP1   D DA  11 ? ? P     D DA  11 ? ? OP2   D DA  11 ? ? 131.28 119.60 11.68  1.50 N 
28  1 "O5'" D DA  11 ? ? P     D DA  11 ? ? OP2   D DA  11 ? ? 96.64  105.70 -9.06  0.90 N 
29  1 "O4'" D DA  11 ? ? "C1'" D DA  11 ? ? N9    D DA  11 ? ? 110.48 108.30 2.18   0.30 N 
30  1 C6    D DA  11 ? ? N1    D DA  11 ? ? C2    D DA  11 ? ? 114.07 118.60 -4.53  0.60 N 
31  1 C5    D DA  11 ? ? N7    D DA  11 ? ? C8    D DA  11 ? ? 99.44  103.90 -4.46  0.50 N 
32  1 N7    D DA  11 ? ? C8    D DA  11 ? ? N9    D DA  11 ? ? 117.68 113.80 3.88   0.50 N 
33  1 C5    D DA  11 ? ? C6    D DA  11 ? ? N6    D DA  11 ? ? 118.25 123.70 -5.45  0.80 N 
34  1 "O4'" D DG  12 ? ? "C1'" D DG  12 ? ? "C2'" D DG  12 ? ? 99.34  105.90 -6.56  0.80 N 
35  1 N1    D DG  12 ? ? C2    D DG  12 ? ? N2    D DG  12 ? ? 122.17 116.20 5.97   0.90 N 
36  1 "C3'" D DG  12 ? ? "O3'" D DG  12 ? ? P     D DT  13 ? ? 130.58 119.70 10.88  1.20 Y 
37  1 "O3'" D DG  12 ? ? P     D DT  13 ? ? OP2   D DT  13 ? ? 117.16 110.50 6.66   1.10 Y 
38  1 "O4'" D DT  13 ? ? "C1'" D DT  13 ? ? "C2'" D DT  13 ? ? 100.74 105.90 -5.16  0.80 N 
39  1 "O4'" D DT  13 ? ? "C1'" D DT  13 ? ? N1    D DT  13 ? ? 95.69  108.00 -12.31 0.70 N 
40  1 C2    D DT  13 ? ? N3    D DT  13 ? ? C4    D DT  13 ? ? 132.18 127.20 4.98   0.60 N 
41  1 N3    D DT  13 ? ? C4    D DT  13 ? ? C5    D DT  13 ? ? 111.59 115.20 -3.61  0.60 N 
42  1 N3    D DT  13 ? ? C4    D DT  13 ? ? O4    D DT  13 ? ? 126.11 119.90 6.21   0.60 N 
43  1 "C5'" D DC  14 ? ? "C4'" D DC  14 ? ? "O4'" D DC  14 ? ? 116.51 109.80 6.71   1.10 N 
44  1 "O4'" D DC  14 ? ? "C1'" D DC  14 ? ? "C2'" D DC  14 ? ? 110.12 106.80 3.32   0.50 N 
45  1 "O4'" D DC  14 ? ? "C1'" D DC  14 ? ? N1    D DC  14 ? ? 111.90 108.30 3.60   0.30 N 
46  1 N3    D DC  14 ? ? C4    D DC  14 ? ? C5    D DC  14 ? ? 124.59 121.90 2.69   0.40 N 
47  1 C4    D DC  14 ? ? C5    D DC  14 ? ? C6    D DC  14 ? ? 114.28 117.40 -3.12  0.50 N 
48  1 "O4'" D DC  15 ? ? "C1'" D DC  15 ? ? N1    D DC  15 ? ? 111.78 108.30 3.48   0.30 N 
49  1 "O3'" D DC  15 ? ? P     D DT  16 ? ? OP2   D DT  16 ? ? 117.26 110.50 6.76   1.10 Y 
50  1 "O5'" D DT  16 ? ? "C5'" D DT  16 ? ? "C4'" D DT  16 ? ? 104.28 109.40 -5.12  0.80 N 
51  1 N1    D DT  16 ? ? C2    D DT  16 ? ? N3    D DT  16 ? ? 118.28 114.60 3.68   0.60 N 
52  1 N1    D DT  16 ? ? C2    D DT  16 ? ? O2    D DT  16 ? ? 127.94 123.10 4.84   0.80 N 
53  1 N3    D DT  16 ? ? C2    D DT  16 ? ? O2    D DT  16 ? ? 113.78 122.30 -8.52  0.60 N 
54  1 N3    D DT  16 ? ? C4    D DT  16 ? ? O4    D DT  16 ? ? 114.65 119.90 -5.25  0.60 N 
55  1 C5    D DT  16 ? ? C4    D DT  16 ? ? O4    D DT  16 ? ? 129.13 124.90 4.23   0.70 N 
56  1 C4    D DT  16 ? ? C5    D DT  16 ? ? C7    D DT  16 ? ? 124.40 119.00 5.40   0.60 N 
57  1 C6    D DT  16 ? ? C5    D DT  16 ? ? C7    D DT  16 ? ? 117.91 122.90 -4.99  0.60 N 
58  1 "C3'" D DC  17 ? ? "C2'" D DC  17 ? ? "C1'" D DC  17 ? ? 96.34  102.40 -6.06  0.80 N 
59  1 "O4'" D DC  17 ? ? "C1'" D DC  17 ? ? N1    D DC  17 ? ? 102.52 108.00 -5.48  0.70 N 
60  1 C6    D DC  17 ? ? N1    D DC  17 ? ? C2    D DC  17 ? ? 123.38 120.30 3.08   0.40 N 
61  1 N1    D DC  17 ? ? C2    D DC  17 ? ? O2    D DC  17 ? ? 115.12 118.90 -3.78  0.60 N 
62  1 N3    D DC  17 ? ? C2    D DC  17 ? ? O2    D DC  17 ? ? 128.40 121.90 6.50   0.70 N 
63  1 "C5'" E DC  23 ? ? "C4'" E DC  23 ? ? "O4'" E DC  23 ? ? 120.43 109.80 10.63  1.10 N 
64  1 "O4'" E DC  23 ? ? "C1'" E DC  23 ? ? "C2'" E DC  23 ? ? 100.99 105.90 -4.91  0.80 N 
65  1 "O4'" E DC  23 ? ? "C1'" E DC  23 ? ? N1    E DC  23 ? ? 113.61 108.30 5.31   0.30 N 
66  1 C6    E DC  23 ? ? N1    E DC  23 ? ? C2    E DC  23 ? ? 117.06 120.30 -3.24  0.40 N 
67  1 "C3'" E DC  23 ? ? "O3'" E DC  23 ? ? P     E DG  24 ? ? 111.82 119.70 -7.88  1.20 Y 
68  1 "C1'" E DG  25 ? ? "O4'" E DG  25 ? ? "C4'" E DG  25 ? ? 103.06 110.10 -7.04  1.00 N 
69  1 "C3'" E DG  25 ? ? "C2'" E DG  25 ? ? "C1'" E DG  25 ? ? 94.29  102.40 -8.11  0.80 N 
70  1 "O4'" E DG  25 ? ? "C1'" E DG  25 ? ? N9    E DG  25 ? ? 112.12 108.30 3.82   0.30 N 
71  1 N1    E DG  25 ? ? C2    E DG  25 ? ? N2    E DG  25 ? ? 110.40 116.20 -5.80  0.90 N 
72  1 N3    E DG  25 ? ? C2    E DG  25 ? ? N2    E DG  25 ? ? 124.15 119.90 4.25   0.70 N 
73  1 N1    E DG  25 ? ? C6    E DG  25 ? ? O6    E DG  25 ? ? 114.47 119.90 -5.43  0.60 N 
74  1 "O5'" E DA  26 ? ? P     E DA  26 ? ? OP2   E DA  26 ? ? 98.18  105.70 -7.52  0.90 N 
75  1 "O4'" E DA  26 ? ? "C1'" E DA  26 ? ? "C2'" E DA  26 ? ? 110.48 106.80 3.68   0.50 N 
76  1 "O4'" E DA  26 ? ? "C1'" E DA  26 ? ? N9    E DA  26 ? ? 102.82 108.00 -5.18  0.70 N 
77  1 N3    E DG  27 ? ? C4    E DG  27 ? ? C5    E DG  27 ? ? 125.57 128.60 -3.03  0.50 N 
78  1 C8    E DG  27 ? ? N9    E DG  27 ? ? C4    E DG  27 ? ? 102.92 106.40 -3.48  0.40 N 
79  1 "O5'" E DG  28 ? ? "C5'" E DG  28 ? ? "C4'" E DG  28 ? ? 102.39 109.40 -7.01  0.80 N 
80  1 P     E DA  29 ? ? "O5'" E DA  29 ? ? "C5'" E DA  29 ? ? 110.49 120.90 -10.41 1.60 N 
81  1 N1    E DA  29 ? ? C2    E DA  29 ? ? N3    E DA  29 ? ? 133.85 129.30 4.55   0.50 N 
82  1 C2    E DA  29 ? ? N3    E DA  29 ? ? C4    E DA  29 ? ? 107.56 110.60 -3.04  0.50 N 
83  1 N9    E DA  29 ? ? C4    E DA  29 ? ? C5    E DA  29 ? ? 109.02 105.80 3.22   0.40 N 
84  1 N3    E DA  29 ? ? C4    E DA  29 ? ? N9    E DA  29 ? ? 122.44 127.40 -4.96  0.80 N 
85  1 N1    E DA  29 ? ? C6    E DA  29 ? ? N6    E DA  29 ? ? 114.83 118.60 -3.77  0.60 N 
86  1 C5    E DA  29 ? ? C6    E DA  29 ? ? N6    E DA  29 ? ? 130.14 123.70 6.44   0.80 N 
87  1 "O3'" E DA  29 ? ? P     E DC  30 ? ? OP2   E DC  30 ? ? 118.35 110.50 7.85   1.10 Y 
88  1 "O3'" E DC  30 ? ? P     E DT  31 ? ? "O5'" E DT  31 ? ? 91.69  104.00 -12.31 1.90 Y 
89  1 "O3'" E DC  30 ? ? P     E DT  31 ? ? OP2   E DT  31 ? ? 119.62 110.50 9.12   1.10 Y 
90  1 N1    E DT  31 ? ? C2    E DT  31 ? ? N3    E DT  31 ? ? 121.13 114.60 6.53   0.60 N 
91  1 C2    E DT  31 ? ? N3    E DT  31 ? ? C4    E DT  31 ? ? 122.35 127.20 -4.85  0.60 N 
92  1 N1    E DT  31 ? ? C2    E DT  31 ? ? O2    E DT  31 ? ? 131.87 123.10 8.77   0.80 N 
93  1 N3    E DT  31 ? ? C2    E DT  31 ? ? O2    E DT  31 ? ? 107.00 122.30 -15.30 0.60 N 
94  1 N3    E DT  31 ? ? C4    E DT  31 ? ? O4    E DT  31 ? ? 110.67 119.90 -9.23  0.60 N 
95  1 C5    E DT  31 ? ? C4    E DT  31 ? ? O4    E DT  31 ? ? 130.88 124.90 5.98   0.70 N 
96  1 "O5'" E DG  32 ? ? P     E DG  32 ? ? OP2   E DG  32 ? ? 98.82  105.70 -6.88  0.90 N 
97  1 "O4'" E DG  32 ? ? "C1'" E DG  32 ? ? "C2'" E DG  32 ? ? 100.90 105.90 -5.00  0.80 N 
98  1 C4    E DG  32 ? ? C5    E DG  32 ? ? N7    E DG  32 ? ? 106.24 110.80 -4.56  0.40 N 
99  1 C5    E DG  32 ? ? N7    E DG  32 ? ? C8    E DG  32 ? ? 109.92 104.30 5.62   0.50 N 
100 1 N7    E DG  32 ? ? C8    E DG  32 ? ? N9    E DG  32 ? ? 108.09 113.10 -5.01  0.50 N 
101 1 N9    E DG  32 ? ? C4    E DG  32 ? ? C5    E DG  32 ? ? 108.59 105.40 3.19   0.40 N 
102 1 N3    E DG  32 ? ? C4    E DG  32 ? ? N9    E DG  32 ? ? 122.32 126.00 -3.68  0.60 N 
103 1 C6    E DG  32 ? ? C5    E DG  32 ? ? N7    E DG  32 ? ? 134.54 130.40 4.14   0.60 N 
104 1 "C3'" E DG  32 ? ? "O3'" E DG  32 ? ? P     E DT  33 ? ? 133.11 119.70 13.41  1.20 Y 
105 1 "O3'" E DG  32 ? ? P     E DT  33 ? ? OP2   E DT  33 ? ? 118.70 110.50 8.20   1.10 Y 
106 1 OP1   E DT  33 ? ? P     E DT  33 ? ? OP2   E DT  33 ? ? 109.37 119.60 -10.23 1.50 N 
107 1 "O4'" E DT  33 ? ? "C1'" E DT  33 ? ? N1    E DT  33 ? ? 98.60  108.00 -9.40  0.70 N 
108 1 C4    E DT  33 ? ? C5    E DT  33 ? ? C7    E DT  33 ? ? 122.87 119.00 3.87   0.60 N 
109 1 "C3'" E DC  34 ? ? "C2'" E DC  34 ? ? "C1'" E DC  34 ? ? 96.61  102.40 -5.79  0.80 N 
110 1 C6    E DC  34 ? ? N1    E DC  34 ? ? C2    E DC  34 ? ? 123.41 120.30 3.11   0.40 N 
111 1 C2    E DC  34 ? ? N3    E DC  34 ? ? C4    E DC  34 ? ? 114.98 119.90 -4.92  0.50 N 
112 1 N3    E DC  34 ? ? C4    E DC  34 ? ? C5    E DC  34 ? ? 125.34 121.90 3.44   0.40 N 
113 1 C5    E DC  34 ? ? C6    E DC  34 ? ? N1    E DC  34 ? ? 117.40 121.00 -3.60  0.50 N 
114 1 N1    E DC  34 ? ? C2    E DC  34 ? ? O2    E DC  34 ? ? 113.04 118.90 -5.86  0.60 N 
115 1 N3    E DC  34 ? ? C2    E DC  34 ? ? O2    E DC  34 ? ? 126.35 121.90 4.45   0.70 N 
116 1 C5    E DC  34 ? ? C4    E DC  34 ? ? N4    E DC  34 ? ? 115.57 120.20 -4.63  0.70 N 
117 1 C2    E DC  34 ? ? N1    E DC  34 ? ? "C1'" E DC  34 ? ? 112.12 118.80 -6.68  1.10 N 
118 1 "O5'" E DT  36 ? ? "C5'" E DT  36 ? ? "C4'" E DT  36 ? ? 102.64 109.40 -6.76  0.80 N 
119 1 "O4'" E DT  36 ? ? "C1'" E DT  36 ? ? N1    E DT  36 ? ? 111.07 108.30 2.77   0.30 N 
120 1 N1    E DT  36 ? ? C2    E DT  36 ? ? N3    E DT  36 ? ? 119.11 114.60 4.51   0.60 N 
121 1 N3    E DT  36 ? ? C2    E DT  36 ? ? O2    E DT  36 ? ? 117.82 122.30 -4.48  0.60 N 
122 1 "C3'" E DC  37 ? ? "C2'" E DC  37 ? ? "C1'" E DC  37 ? ? 93.81  102.40 -8.59  0.80 N 
123 1 N1    E DC  37 ? ? "C1'" E DC  37 ? ? "C2'" E DC  37 ? ? 123.76 114.30 9.46   1.40 N 
124 1 "O4'" E DC  37 ? ? "C1'" E DC  37 ? ? N1    E DC  37 ? ? 98.71  108.00 -9.29  0.70 N 
125 1 N3    E DC  37 ? ? C4    E DC  37 ? ? C5    E DC  37 ? ? 118.25 121.90 -3.65  0.40 N 
126 1 C4    E DC  37 ? ? C5    E DC  37 ? ? C6    E DC  37 ? ? 121.39 117.40 3.99   0.50 N 
127 1 N1    E DC  37 ? ? C2    E DC  37 ? ? O2    E DC  37 ? ? 114.27 118.90 -4.63  0.60 N 
128 1 "O5'" E DC  38 ? ? "C5'" E DC  38 ? ? "C4'" E DC  38 ? ? 103.76 109.40 -5.64  0.80 N 
129 1 "O4'" E DC  38 ? ? "C1'" E DC  38 ? ? "C2'" E DC  38 ? ? 109.82 106.80 3.02   0.50 N 
130 1 "O4'" E DC  38 ? ? "C1'" E DC  38 ? ? N1    E DC  38 ? ? 102.37 108.00 -5.63  0.70 N 
131 1 C2    E DC  38 ? ? N3    E DC  38 ? ? C4    E DC  38 ? ? 116.26 119.90 -3.64  0.50 N 
132 1 N1    E DC  38 ? ? C2    E DC  38 ? ? O2    E DC  38 ? ? 113.48 118.90 -5.42  0.60 N 
133 1 N1    E DG  39 ? ? C2    E DG  39 ? ? N2    E DG  39 ? ? 110.27 116.20 -5.93  0.90 N 
134 1 N1    E DG  39 ? ? C6    E DG  39 ? ? O6    E DG  39 ? ? 115.81 119.90 -4.09  0.60 N 
135 1 C5    E DG  39 ? ? C6    E DG  39 ? ? O6    E DG  39 ? ? 133.02 128.60 4.42   0.60 N 
136 1 "C3'" E DG  39 ? ? "O3'" E DG  39 ? ? P     E DG  40 ? ? 131.69 119.70 11.99  1.20 Y 
137 1 "O4'" E DG  40 ? ? "C1'" E DG  40 ? ? "C2'" E DG  40 ? ? 110.02 106.80 3.22   0.50 N 
138 1 "O4'" E DG  40 ? ? "C1'" E DG  40 ? ? N9    E DG  40 ? ? 112.94 108.30 4.64   0.30 N 
139 1 N1    E DG  40 ? ? C6    E DG  40 ? ? O6    E DG  40 ? ? 123.96 119.90 4.06   0.60 N 
140 1 C5    E DG  40 ? ? C6    E DG  40 ? ? O6    E DG  40 ? ? 124.57 128.60 -4.03  0.60 N 
141 1 CB    A ASP 12 ? ? CG    A ASP 12 ? ? OD1   A ASP 12 ? ? 123.99 118.30 5.69   0.90 N 
142 1 CB    A LEU 16 ? ? CG    A LEU 16 ? ? CD2   A LEU 16 ? ? 98.70  111.00 -12.30 1.70 N 
143 1 CA    A CYS 31 ? ? CB    A CYS 31 ? ? SG    A CYS 31 ? ? 124.37 114.20 10.17  1.10 N 
144 1 CB    A LEU 54 ? ? CG    A LEU 54 ? ? CD2   A LEU 54 ? ? 122.58 111.00 11.58  1.70 N 
145 1 OE1   A GLU 58 ? ? CD    A GLU 58 ? ? OE2   A GLU 58 ? ? 114.73 123.30 -8.57  1.20 N 
146 1 NE    A ARG 63 ? ? CZ    A ARG 63 ? ? NH1   A ARG 63 ? ? 116.34 120.30 -3.96  0.50 N 
147 1 CB    A ASP 88 ? ? CG    A ASP 88 ? ? OD2   A ASP 88 ? ? 111.02 118.30 -7.28  0.90 N 
148 1 NE    B ARG 15 ? ? CZ    B ARG 15 ? ? NH1   B ARG 15 ? ? 123.99 120.30 3.69   0.50 N 
149 1 CA    B CYS 31 ? ? CB    B CYS 31 ? ? SG    B CYS 31 ? ? 123.13 114.20 8.93   1.10 N 
150 1 NE    B ARG 51 ? ? CZ    B ARG 51 ? ? NH1   B ARG 51 ? ? 124.67 120.30 4.37   0.50 N 
151 1 NE    B ARG 51 ? ? CZ    B ARG 51 ? ? NH2   B ARG 51 ? ? 113.95 120.30 -6.35  0.50 N 
152 1 CB    B LEU 54 ? ? CG    B LEU 54 ? ? CD2   B LEU 54 ? ? 121.28 111.00 10.28  1.70 N 
153 1 NE    B ARG 60 ? ? CZ    B ARG 60 ? ? NH2   B ARG 60 ? ? 117.11 120.30 -3.19  0.50 N 
154 1 CB    B LEU 67 ? ? CG    B LEU 67 ? ? CD2   B LEU 67 ? ? 122.21 111.00 11.21  1.70 N 
155 1 CB    B ASP 76 ? ? CG    B ASP 76 ? ? OD1   B ASP 76 ? ? 109.75 118.30 -8.55  0.90 N 
156 1 CB    B ASP 76 ? ? CG    B ASP 76 ? ? OD2   B ASP 76 ? ? 126.75 118.30 8.45   0.90 N 
157 1 CB    B LEU 77 ? ? CG    B LEU 77 ? ? CD1   B LEU 77 ? ? 98.73  111.00 -12.27 1.70 N 
# 
loop_
_pdbx_validate_torsion.id 
_pdbx_validate_torsion.PDB_model_num 
_pdbx_validate_torsion.auth_comp_id 
_pdbx_validate_torsion.auth_asym_id 
_pdbx_validate_torsion.auth_seq_id 
_pdbx_validate_torsion.PDB_ins_code 
_pdbx_validate_torsion.label_alt_id 
_pdbx_validate_torsion.phi 
_pdbx_validate_torsion.psi 
1  1 LYS A 23 ? ? 81.11   -5.18   
2  1 ALA A 29 ? ? -3.37   -104.08 
3  1 LYS A 33 ? ? -50.14  -81.11  
4  1 ASN A 34 ? ? -64.01  16.54   
5  1 TYR A 40 ? ? -100.18 76.13   
6  1 LYS A 43 ? ? -57.71  106.14  
7  1 GLU A 75 ? ? 42.22   177.29  
8  1 ASP A 76 ? ? -4.87   57.79   
9  1 LYS B 18 ? ? 73.09   33.95   
10 1 GLU B 24 ? ? -64.09  -173.43 
11 1 LYS B 27 ? ? -66.38  -159.21 
12 1 LYS B 33 ? ? -44.82  -81.60  
13 1 ASN B 35 ? ? 70.53   74.45   
# 
loop_
_pdbx_validate_peptide_omega.id 
_pdbx_validate_peptide_omega.PDB_model_num 
_pdbx_validate_peptide_omega.auth_comp_id_1 
_pdbx_validate_peptide_omega.auth_asym_id_1 
_pdbx_validate_peptide_omega.auth_seq_id_1 
_pdbx_validate_peptide_omega.PDB_ins_code_1 
_pdbx_validate_peptide_omega.label_alt_id_1 
_pdbx_validate_peptide_omega.auth_comp_id_2 
_pdbx_validate_peptide_omega.auth_asym_id_2 
_pdbx_validate_peptide_omega.auth_seq_id_2 
_pdbx_validate_peptide_omega.PDB_ins_code_2 
_pdbx_validate_peptide_omega.label_alt_id_2 
_pdbx_validate_peptide_omega.omega 
1 1 ARG A 74 ? ? GLU A 75 ? ? 147.38  
2 1 GLU A 75 ? ? ASP A 76 ? ? -138.93 
# 
loop_
_ndb_struct_conf_na.entry_id 
_ndb_struct_conf_na.feature 
3COQ 'double helix'        
3COQ 'b-form double helix' 
# 
loop_
_ndb_struct_na_base_pair.model_number 
_ndb_struct_na_base_pair.i_label_asym_id 
_ndb_struct_na_base_pair.i_label_comp_id 
_ndb_struct_na_base_pair.i_label_seq_id 
_ndb_struct_na_base_pair.i_symmetry 
_ndb_struct_na_base_pair.j_label_asym_id 
_ndb_struct_na_base_pair.j_label_comp_id 
_ndb_struct_na_base_pair.j_label_seq_id 
_ndb_struct_na_base_pair.j_symmetry 
_ndb_struct_na_base_pair.shear 
_ndb_struct_na_base_pair.stretch 
_ndb_struct_na_base_pair.stagger 
_ndb_struct_na_base_pair.buckle 
_ndb_struct_na_base_pair.propeller 
_ndb_struct_na_base_pair.opening 
_ndb_struct_na_base_pair.pair_number 
_ndb_struct_na_base_pair.pair_name 
_ndb_struct_na_base_pair.i_auth_asym_id 
_ndb_struct_na_base_pair.i_auth_seq_id 
_ndb_struct_na_base_pair.i_PDB_ins_code 
_ndb_struct_na_base_pair.j_auth_asym_id 
_ndb_struct_na_base_pair.j_auth_seq_id 
_ndb_struct_na_base_pair.j_PDB_ins_code 
_ndb_struct_na_base_pair.hbond_type_28 
_ndb_struct_na_base_pair.hbond_type_12 
1 A DC 2  1_555 B DG 20 1_555 0.118  -0.278 0.088  -6.676 -13.186 -1.251 1  D_DC2:DG40_E  D 2  ? E 40 ? 19 1 
1 A DC 3  1_555 B DG 19 1_555 0.752  -0.292 -0.276 0.256  -2.014  -1.445 2  D_DC3:DG39_E  D 3  ? E 39 ? 19 1 
1 A DG 4  1_555 B DC 18 1_555 -0.482 -0.163 -0.053 0.953  -20.397 -2.949 3  D_DG4:DC38_E  D 4  ? E 38 ? 19 1 
1 A DG 5  1_555 B DC 17 1_555 -0.291 -0.275 -0.078 1.309  7.383   -5.429 4  D_DG5:DC37_E  D 5  ? E 37 ? 19 1 
1 A DA 6  1_555 B DT 16 1_555 0.216  -0.262 -0.077 3.851  -12.728 -7.103 5  D_DA6:DT36_E  D 6  ? E 36 ? 20 1 
1 A DG 7  1_555 B DC 15 1_555 -0.267 -0.431 0.471  4.607  -13.812 5.153  6  D_DG7:DC35_E  D 7  ? E 35 ? 19 1 
1 A DG 8  1_555 B DC 14 1_555 -0.274 -0.315 0.182  5.933  -10.187 -7.309 7  D_DG8:DC34_E  D 8  ? E 34 ? 19 1 
1 A DA 9  1_555 B DT 13 1_555 0.279  -0.179 -0.007 10.181 -22.410 -0.631 8  D_DA9:DT33_E  D 9  ? E 33 ? 20 1 
1 A DC 10 1_555 B DG 12 1_555 -0.199 -0.036 -0.276 6.571  -12.399 -1.617 9  D_DC10:DG32_E D 10 ? E 32 ? 19 1 
1 A DA 11 1_555 B DT 11 1_555 0.459  -0.073 0.003  -5.246 -22.904 -1.029 10 D_DA11:DT31_E D 11 ? E 31 ? 20 1 
1 A DG 12 1_555 B DC 10 1_555 -0.065 -0.392 -0.058 -3.966 -10.615 -1.399 11 D_DG12:DC30_E D 12 ? E 30 ? 19 1 
1 A DT 13 1_555 B DA 9  1_555 -0.291 -0.060 -0.213 -6.668 -17.364 2.550  12 D_DT13:DA29_E D 13 ? E 29 ? 20 1 
1 A DC 14 1_555 B DG 8  1_555 0.006  -0.153 0.063  -6.092 -9.365  -7.515 13 D_DC14:DG28_E D 14 ? E 28 ? 19 1 
1 A DC 15 1_555 B DG 7  1_555 -0.219 -0.340 0.351  -2.362 -16.115 1.594  14 D_DC15:DG27_E D 15 ? E 27 ? 19 1 
1 A DT 16 1_555 B DA 6  1_555 -0.176 -0.132 0.104  -7.921 -7.970  0.162  15 D_DT16:DA26_E D 16 ? E 26 ? 20 1 
1 A DC 17 1_555 B DG 5  1_555 -0.087 -0.265 -0.365 1.428  1.193   -6.249 16 D_DC17:DG25_E D 17 ? E 25 ? 19 1 
1 A DC 18 1_555 B DG 4  1_555 0.108  -0.109 0.283  -4.870 -15.479 -5.799 17 D_DC18:DG24_E D 18 ? E 24 ? 19 1 
1 A DG 19 1_555 B DC 3  1_555 -0.483 -0.142 -0.013 1.968  -5.317  0.858  18 D_DG19:DC23_E D 19 ? E 23 ? 19 1 
1 A DG 20 1_555 B DC 2  1_555 -0.169 -0.258 0.160  -0.390 -14.406 -1.261 19 D_DG20:DC22_E D 20 ? E 22 ? 19 1 
# 
loop_
_ndb_struct_na_base_pair_step.model_number 
_ndb_struct_na_base_pair_step.i_label_asym_id_1 
_ndb_struct_na_base_pair_step.i_label_comp_id_1 
_ndb_struct_na_base_pair_step.i_label_seq_id_1 
_ndb_struct_na_base_pair_step.i_symmetry_1 
_ndb_struct_na_base_pair_step.j_label_asym_id_1 
_ndb_struct_na_base_pair_step.j_label_comp_id_1 
_ndb_struct_na_base_pair_step.j_label_seq_id_1 
_ndb_struct_na_base_pair_step.j_symmetry_1 
_ndb_struct_na_base_pair_step.i_label_asym_id_2 
_ndb_struct_na_base_pair_step.i_label_comp_id_2 
_ndb_struct_na_base_pair_step.i_label_seq_id_2 
_ndb_struct_na_base_pair_step.i_symmetry_2 
_ndb_struct_na_base_pair_step.j_label_asym_id_2 
_ndb_struct_na_base_pair_step.j_label_comp_id_2 
_ndb_struct_na_base_pair_step.j_label_seq_id_2 
_ndb_struct_na_base_pair_step.j_symmetry_2 
_ndb_struct_na_base_pair_step.shift 
_ndb_struct_na_base_pair_step.slide 
_ndb_struct_na_base_pair_step.rise 
_ndb_struct_na_base_pair_step.tilt 
_ndb_struct_na_base_pair_step.roll 
_ndb_struct_na_base_pair_step.twist 
_ndb_struct_na_base_pair_step.x_displacement 
_ndb_struct_na_base_pair_step.y_displacement 
_ndb_struct_na_base_pair_step.helical_rise 
_ndb_struct_na_base_pair_step.inclination 
_ndb_struct_na_base_pair_step.tip 
_ndb_struct_na_base_pair_step.helical_twist 
_ndb_struct_na_base_pair_step.step_number 
_ndb_struct_na_base_pair_step.step_name 
_ndb_struct_na_base_pair_step.i_auth_asym_id_1 
_ndb_struct_na_base_pair_step.i_auth_seq_id_1 
_ndb_struct_na_base_pair_step.i_PDB_ins_code_1 
_ndb_struct_na_base_pair_step.j_auth_asym_id_1 
_ndb_struct_na_base_pair_step.j_auth_seq_id_1 
_ndb_struct_na_base_pair_step.j_PDB_ins_code_1 
_ndb_struct_na_base_pair_step.i_auth_asym_id_2 
_ndb_struct_na_base_pair_step.i_auth_seq_id_2 
_ndb_struct_na_base_pair_step.i_PDB_ins_code_2 
_ndb_struct_na_base_pair_step.j_auth_asym_id_2 
_ndb_struct_na_base_pair_step.j_auth_seq_id_2 
_ndb_struct_na_base_pair_step.j_PDB_ins_code_2 
1 A DC 2  1_555 B DG 20 1_555 A DC 3  1_555 B DG 19 1_555 0.743  1.213  3.168 5.627  2.745  38.975 1.473  -0.438 3.314 4.082   
-8.368  39.455 1  DD_DC2DC3:DG39DG40_EE   D 2  ? E 40 ? D 3  ? E 39 ? 
1 A DC 3  1_555 B DG 19 1_555 A DG 4  1_555 B DC 18 1_555 -1.264 1.311  3.291 -4.474 8.246  32.479 0.813  1.392  3.643 14.372  
7.798   33.772 2  DD_DC3DG4:DC38DG39_EE   D 3  ? E 39 ? D 4  ? E 38 ? 
1 A DG 4  1_555 B DC 18 1_555 A DG 5  1_555 B DC 17 1_555 1.557  0.626  3.408 2.132  -9.523 37.628 2.141  -2.073 3.241 -14.469 
-3.239  38.828 3  DD_DG4DG5:DC37DC38_EE   D 4  ? E 38 ? D 5  ? E 37 ? 
1 A DG 5  1_555 B DC 17 1_555 A DA 6  1_555 B DT 16 1_555 -1.323 0.286  3.345 -4.726 7.217  37.807 -0.501 1.383  3.474 10.964  
7.180   38.744 4  DD_DG5DA6:DT36DC37_EE   D 5  ? E 37 ? D 6  ? E 36 ? 
1 A DA 6  1_555 B DT 16 1_555 A DG 7  1_555 B DC 15 1_555 0.580  -0.321 3.241 -6.832 3.201  31.654 -1.115 -2.193 3.008 5.766   
12.307  32.518 5  DD_DA6DG7:DC35DT36_EE   D 6  ? E 36 ? D 7  ? E 35 ? 
1 A DG 7  1_555 B DC 15 1_555 A DG 8  1_555 B DC 14 1_555 -0.024 0.008  3.177 4.213  3.266  32.552 -0.525 0.738  3.136 5.778   
-7.453  32.974 6  DD_DG7DG8:DC34DC35_EE   D 7  ? E 35 ? D 8  ? E 34 ? 
1 A DG 8  1_555 B DC 14 1_555 A DA 9  1_555 B DT 13 1_555 -0.682 1.017  3.321 0.470  -2.883 38.451 1.898  1.092  3.231 -4.369  
-0.712  38.558 7  DD_DG8DA9:DT33DC34_EE   D 8  ? E 34 ? D 9  ? E 33 ? 
1 A DA 9  1_555 B DT 13 1_555 A DC 10 1_555 B DG 12 1_555 0.675  -0.937 3.282 1.917  2.006  32.776 -1.998 -0.865 3.253 3.546   
-3.390  32.890 8  DD_DA9DC10:DG32DT33_EE  D 9  ? E 33 ? D 10 ? E 32 ? 
1 A DC 10 1_555 B DG 12 1_555 A DA 11 1_555 B DT 11 1_555 -0.807 0.391  3.693 -2.632 2.499  38.370 0.240  0.851  3.755 3.792   
3.994   38.535 9  DD_DC10DA11:DT31DG32_EE D 10 ? E 32 ? D 11 ? E 31 ? 
1 A DA 11 1_555 B DT 11 1_555 A DG 12 1_555 B DC 10 1_555 0.752  0.044  3.258 0.763  5.459  32.194 -0.869 -1.205 3.238 9.755   
-1.363  32.650 10 DD_DA11DG12:DC30DT31_EE D 11 ? E 31 ? D 12 ? E 30 ? 
1 A DG 12 1_555 B DC 10 1_555 A DT 13 1_555 B DA 9  1_555 -0.643 -0.779 3.373 1.171  -2.329 33.419 -0.954 1.314  3.395 -4.043  
-2.032  33.518 11 DD_DG12DT13:DA29DC30_EE D 12 ? E 30 ? D 13 ? E 29 ? 
1 A DT 13 1_555 B DA 9  1_555 A DC 14 1_555 B DG 8  1_555 0.707  1.316  3.245 0.229  0.697  37.819 1.941  -1.062 3.272 1.075   
-0.353  37.826 12 DD_DT13DC14:DG28DA29_EE D 13 ? E 29 ? D 14 ? E 28 ? 
1 A DC 14 1_555 B DG 8  1_555 A DC 15 1_555 B DG 7  1_555 -0.329 -0.095 3.250 -6.501 2.010  28.489 -0.626 -0.762 3.230 4.012   
12.977  29.274 13 DD_DC14DC15:DG27DG28_EE D 14 ? E 28 ? D 15 ? E 27 ? 
1 A DC 15 1_555 B DG 7  1_555 A DT 16 1_555 B DA 6  1_555 -0.072 -0.286 3.319 6.114  4.719  37.178 -1.047 0.898  3.209 7.305   
-9.465  37.944 14 DD_DC15DT16:DA26DG27_EE D 15 ? E 27 ? D 16 ? E 26 ? 
1 A DT 16 1_555 B DA 6  1_555 A DC 17 1_555 B DG 5  1_555 0.932  0.136  3.167 8.566  3.738  34.594 -0.320 -0.276 3.294 6.148   
-14.089 35.797 15 DD_DT16DC17:DG25DA26_EE D 16 ? E 26 ? D 17 ? E 25 ? 
1 A DC 17 1_555 B DG 5  1_555 A DC 18 1_555 B DG 4  1_555 -1.360 0.317  3.638 -7.550 -3.941 36.107 1.107  0.975  3.782 -6.252  
11.977  37.066 16 DD_DC17DC18:DG24DG25_EE D 17 ? E 25 ? D 18 ? E 24 ? 
1 A DC 18 1_555 B DG 4  1_555 A DG 19 1_555 B DC 3  1_555 1.349  1.086  3.156 4.124  1.451  36.265 1.534  -1.586 3.324 2.320   
-6.596  36.518 17 DD_DC18DG19:DC23DG24_EE D 18 ? E 24 ? D 19 ? E 23 ? 
1 A DG 19 1_555 B DC 3  1_555 A DG 20 1_555 B DC 2  1_555 -1.157 1.331  3.381 -4.784 4.724  38.895 1.371  1.105  3.623 7.030   
7.120   39.450 18 DD_DG19DG20:DC22DC23_EE D 19 ? E 23 ? D 20 ? E 22 ? 
# 
loop_
_pdbx_entity_nonpoly.entity_id 
_pdbx_entity_nonpoly.name 
_pdbx_entity_nonpoly.comp_id 
4 '(4S)-2-METHYL-2,4-PENTANEDIOL' MPD 
5 'ZINC ION'                      ZN  
6 water                           HOH 
#