#   3G73 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.281 
PDB   3G73         
NDB   PD1230       
RCSB  RCSB051505   
WWPDB D_1000051505 
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.entry_id                        3G73 
_pdbx_database_status.recvd_initial_deposition_date   2009-02-09 
_pdbx_database_status.deposit_site                    RCSB 
_pdbx_database_status.process_site                    PDBJ 
_pdbx_database_status.status_code_sf                  REL 
_pdbx_database_status.status_code_mr                  ? 
_pdbx_database_status.SG_entry                        . 
_pdbx_database_status.pdb_format_compatible           Y 
_pdbx_database_status.status_code_cs                  ? 
'Littler, D.R.' 1 
'Perrakis, A.'  2 
'Hibbert, R.G.' 3 
'Medema, R.H.'  4 
#                        primary 
_citation.title                     'Structure of the FoxM1 DNA-recognition domain bound to a promoter sequence' 
_citation.journal_abbrev            'Nucleic Acids Res.' 
_citation.journal_volume            ? 
_citation.page_first                ? 
_citation.page_last                 ? 
_citation.year                      2010 
_citation.journal_id_ASTM           NARHAD                   UK 
_citation.journal_id_ISSN           1362-4962 
_citation.journal_id_CSD            0389 
_citation.book_publisher            ? 
_citation.pdbx_database_id_PubMed   20360045 
_citation.pdbx_database_id_DOI      10.1093/nar/gkq194 
primary 'Littler, D.R.'         1 
primary 'Alvarez-Fernandez, M.' 2 
primary 'Stein, A.'             3 
primary 'Hibbert, R.G.'         4 
primary 'Heidebrecht, T.'       5 
primary 'Aloy, P.'              6 
primary 'Medema, R.H.'          7 
primary 'Perrakis, A.'          8 
_cell.entry_id           3G73 
_cell.length_a           63.070 
_cell.length_b           119.750 
_cell.length_c           152.970 
_cell.angle_alpha        90.00 
_cell.angle_beta         90.00 
_cell.angle_gamma        90.00 
_cell.Z_PDB              16 
_cell.pdbx_unique_axis   ? 
_cell.length_a_esd       ? 
_cell.length_b_esd       ? 
_cell.length_c_esd       ? 
_cell.angle_alpha_esd    ? 
_cell.angle_beta_esd     ? 
_cell.angle_gamma_esd    ? 
_symmetry.entry_id                         3G73 
_symmetry.space_group_name_H-M             'C 2 2 21' 
_symmetry.pdbx_full_space_group_name_H-M   ? 
_symmetry.cell_setting                     ? 
_symmetry.Int_Tables_number                20 
_symmetry.space_group_name_Hall            ? 
1 polymer     man 'Forkhead box protein M1'                                                        16600.861 2   ? ? 
'DNA-binding domain, UNP residues 222-360' ?                                          
2 polymer     syn 
6430.198  1   ? ? ?                                          'Forkhead consensus sequence plus strand'  
3 polymer     syn 
6452.195  1   ? ? ?                                          'Forkhead consensus sequence minus strand' 
4 non-polymer syn 'MAGNESIUM ION'                                                                  24.305    2   ? ? ? ? 
5 water       nat water                                                                            18.015    163 ? ? ? ? 
_entity_name_com.entity_id   1        
;Forkhead-related protein FKHL16, Hepatocyte nuclear factor 3 forkhead homolog 11, HNF-3/fork-head homolog 11, HFH-11, Winged-helix factor from INS-1 cells, M-phase phosphoprotein 2, MPM-2 reactive phosphoprotein 2, Transcription factor Trident
1 'polypeptide(L)'        no no 
A,B ? 
2 polydeoxyribonucleotide no no 
3 polydeoxyribonucleotide no no 
1 1   GLY n 
1 2   PRO n 
1 3   GLY n 
1 4   PRO n 
1 5   SER n 
1 6   ARG n 
1 7   PRO n 
1 8   SER n 
1 9   ALA n 
1 10  SER n 
1 11  TRP n 
1 12  GLN n 
1 13  ASN n 
1 14  SER n 
1 15  VAL n 
1 16  SER n 
1 17  GLU n 
1 18  ARG n 
1 19  PRO n 
1 20  PRO n 
1 21  TYR n 
1 22  SER n 
1 23  TYR n 
1 24  MET n 
1 25  ALA n 
1 26  MET n 
1 27  ILE n 
1 28  GLN n 
1 29  PHE n 
1 30  ALA n 
1 31  ILE n 
1 32  ASN n 
1 33  SER n 
1 34  THR n 
1 35  GLU n 
1 36  ARG n 
1 37  LYS n 
1 38  ARG n 
1 39  MET n 
1 40  THR n 
1 41  LEU n 
1 42  LYS n 
1 43  ASP n 
1 44  ILE n 
1 45  TYR n 
1 46  THR n 
1 47  TRP n 
1 48  ILE n 
1 49  GLU n 
1 50  ASP n 
1 51  HIS n 
1 52  PHE n 
1 53  PRO n 
1 54  TYR n 
1 55  PHE n 
1 56  LYS n 
1 57  HIS n 
1 58  ILE n 
1 59  ALA n 
1 60  LYS n 
1 61  PRO n 
1 62  GLY n 
1 63  TRP n 
1 64  LYS n 
1 65  ASN n 
1 66  SER n 
1 67  ILE n 
1 68  ARG n 
1 69  HIS n 
1 70  ASN n 
1 71  LEU n 
1 72  SER n 
1 73  LEU n 
1 74  HIS n 
1 75  ASP n 
1 76  MET n 
1 77  PHE n 
1 78  VAL n 
1 79  ARG n 
1 80  GLU n 
1 81  THR n 
1 82  SER n 
1 83  ALA n 
1 84  ASN n 
1 85  GLY n 
1 86  LYS n 
1 87  VAL n 
1 88  SER n 
1 89  PHE n 
1 90  TRP n 
1 91  THR n 
1 92  ILE n 
1 93  HIS n 
1 94  PRO n 
1 95  SER n 
1 96  ALA n 
1 97  ASN n 
1 98  ARG n 
1 99  TYR n 
1 100 LEU n 
1 101 THR n 
1 102 LEU n 
1 103 ASP n 
1 104 GLN n 
1 105 VAL n 
1 106 PHE n 
1 107 LYS n 
1 108 PRO n 
1 109 LEU n 
1 110 ASP n 
1 111 PRO n 
1 112 GLY n 
1 113 SER n 
1 114 PRO n 
1 115 GLN n 
1 116 LEU n 
1 117 PRO n 
1 118 GLU n 
1 119 HIS n 
1 120 LEU n 
1 121 GLU n 
1 122 SER n 
1 123 GLN n 
1 124 GLN n 
1 125 LYS n 
1 126 ARG n 
1 127 PRO n 
1 128 ASN n 
1 129 PRO n 
1 130 GLU n 
1 131 LEU n 
1 132 ARG n 
1 133 ARG n 
1 134 ASN n 
1 135 MET n 
1 136 THR n 
1 137 ILE n 
1 138 LYS n 
1 139 THR n 
1 140 GLU n 
1 141 LEU n 
1 142 PRO n 
2 1   DA  n 
2 2   DA  n 
2 3   DA  n 
2 4   DT  n 
2 5   DT  n 
2 6   DG  n 
2 7   DT  n 
2 8   DT  n 
2 9   DT  n 
2 10  DA  n 
2 11  DT  n 
2 12  DA  n 
2 13  DA  n 
2 14  DA  n 
2 15  DC  n 
2 16  DA  n 
2 17  DG  n 
2 18  DC  n 
2 19  DC  n 
2 20  DC  n 
2 21  DG  n 
3 1   DT  n 
3 2   DT  n 
3 3   DC  n 
3 4   DG  n 
3 5   DG  n 
3 6   DG  n 
3 7   DC  n 
3 8   DT  n 
3 9   DG  n 
3 10  DT  n 
3 11  DT  n 
3 12  DT  n 
3 13  DA  n 
3 14  DT  n 
3 15  DA  n 
3 16  DA  n 
3 17  DA  n 
3 18  DC  n 
3 19  DA  n 
3 20  DA  n 
3 21  DT  n 
_entity_src_gen.entity_id                          1 
_entity_src_gen.pdbx_src_id                        1 
_entity_src_gen.pdbx_alt_source_flag               sample 
_entity_src_gen.pdbx_seq_type                      ? 
_entity_src_gen.pdbx_beg_seq_num                   ? 
_entity_src_gen.pdbx_end_seq_num                   ? 
_entity_src_gen.gene_src_common_name               Human 
_entity_src_gen.gene_src_genus                     ? 
_entity_src_gen.pdbx_gene_src_gene                 'FKHL16, FOXM1, HFH11, MPP2, WIN' 
_entity_src_gen.gene_src_species                   ? 
_entity_src_gen.gene_src_strain                    ? 
_entity_src_gen.gene_src_tissue                    ? 
_entity_src_gen.gene_src_tissue_fraction           ? 
_entity_src_gen.gene_src_details                   ? 
_entity_src_gen.pdbx_gene_src_fragment             ? 
_entity_src_gen.pdbx_gene_src_scientific_name      'Homo sapiens' 
_entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id     9606 
_entity_src_gen.pdbx_gene_src_variant              ? 
_entity_src_gen.pdbx_gene_src_cell_line            ? 
_entity_src_gen.pdbx_gene_src_atcc                 ? 
_entity_src_gen.pdbx_gene_src_organ                ? 
_entity_src_gen.pdbx_gene_src_organelle            ? 
_entity_src_gen.pdbx_gene_src_cell                 ? 
_entity_src_gen.pdbx_gene_src_cellular_location    ? 
_entity_src_gen.host_org_common_name               ? 
_entity_src_gen.pdbx_host_org_scientific_name      'Escherichia coli' 
_entity_src_gen.pdbx_host_org_ncbi_taxonomy_id     562 
_entity_src_gen.host_org_genus                     ? 
_entity_src_gen.pdbx_host_org_gene                 ? 
_entity_src_gen.pdbx_host_org_organ                ? 
_entity_src_gen.host_org_species                   ? 
_entity_src_gen.pdbx_host_org_tissue               ? 
_entity_src_gen.pdbx_host_org_tissue_fraction      ? 
_entity_src_gen.pdbx_host_org_strain               'BL21 (DE3)' 
_entity_src_gen.pdbx_host_org_variant              ? 
_entity_src_gen.pdbx_host_org_cell_line            ? 
_entity_src_gen.pdbx_host_org_atcc                 ? 
_entity_src_gen.pdbx_host_org_culture_collection   ? 
_entity_src_gen.pdbx_host_org_cell                 ? 
_entity_src_gen.pdbx_host_org_organelle            ? 
_entity_src_gen.pdbx_host_org_cellular_location    ? 
_entity_src_gen.pdbx_host_org_vector_type          PLASMID 
_entity_src_gen.pdbx_host_org_vector               ? 
_entity_src_gen.host_org_details                   ? 
_entity_src_gen.expression_system_id               ? 
_entity_src_gen.plasmid_name                       pET28-LIC 
_entity_src_gen.plasmid_details                    ? 
_entity_src_gen.pdbx_description                   ? 
2 1 sample ? ? ? ? ? 'DNA oligo' 
3 1 sample ? ? ? ? ? 'DNA oligo' 
1 UNP FOXM1_HUMAN Q08050 1 
222 ? 
2 PDB 3G73        3G73   2 AAATTGTTTATAAACAGCCCG 1   ? 
3 PDB 3G73        3G73   3 TTCGGGCTGTTTATAAACAAT 1   ? 
1 1 3G73 A 4 ? 142 ? Q08050 222 ? 360 ? 222 360 
2 1 3G73 B 4 ? 142 ? Q08050 222 ? 360 ? 222 360 
3 2 3G73 C 1 ? 21  ? 3G73   1   ? 21  ? 1   21  
4 3 3G73 D 1 ? 21  ? 3G73   1   ? 21  ? 1   21  
1 3G73 GLY A 1 ? UNP Q08050 ? ? 'EXPRESSION TAG' 219 1 
1 3G73 PRO A 2 ? UNP Q08050 ? ? 'EXPRESSION TAG' 220 2 
1 3G73 GLY A 3 ? UNP Q08050 ? ? 'EXPRESSION TAG' 221 3 
2 3G73 GLY B 1 ? UNP Q08050 ? ? 'EXPRESSION TAG' 219 4 
2 3G73 PRO B 2 ? UNP Q08050 ? ? 'EXPRESSION TAG' 220 5 
2 3G73 GLY B 3 ? UNP Q08050 ? ? 'EXPRESSION TAG' 221 6 
ALA 'L-peptide linking' y ALANINE                              ? 'C3 H7 N O2'      89.093  
ARG 'L-peptide linking' y ARGININE                             ? 'C6 H15 N4 O2 1'  175.209 
ASN 'L-peptide linking' y ASPARAGINE                           ? 'C4 H8 N2 O3'     132.118 
ASP 'L-peptide linking' y 'ASPARTIC ACID'                      ? 'C4 H7 N O4'      133.103 
DA  'DNA linking'       y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 
DC  'DNA linking'       y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE"  ? 'C9 H14 N3 O7 P'  307.197 
DG  'DNA linking'       y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 
DT  'DNA linking'       y "THYMIDINE-5'-MONOPHOSPHATE"         ? 'C10 H15 N2 O8 P' 322.208 
GLN 'L-peptide linking' y GLUTAMINE                            ? 'C5 H10 N2 O3'    146.144 
GLU 'L-peptide linking' y 'GLUTAMIC ACID'                      ? 'C5 H9 N O4'      147.129 
GLY 'peptide linking'   y GLYCINE                              ? 'C2 H5 N O2'      75.067  
HIS 'L-peptide linking' y HISTIDINE                            ? 'C6 H10 N3 O2 1'  156.162 
HOH non-polymer         . WATER                                ? 'H2 O'            18.015  
ILE 'L-peptide linking' y ISOLEUCINE                           ? 'C6 H13 N O2'     131.173 
LEU 'L-peptide linking' y LEUCINE                              ? 'C6 H13 N O2'     131.173 
LYS 'L-peptide linking' y LYSINE                               ? 'C6 H15 N2 O2 1'  147.195 
MET 'L-peptide linking' y METHIONINE                           ? 'C5 H11 N O2 S'   149.211 
MG  non-polymer         . 'MAGNESIUM ION'                      ? 'Mg 2'            24.305  
PHE 'L-peptide linking' y PHENYLALANINE                        ? 'C9 H11 N O2'     165.189 
PRO 'L-peptide linking' y PROLINE                              ? 'C5 H9 N O2'      115.130 
SER 'L-peptide linking' y SERINE                               ? 'C3 H7 N O3'      105.093 
THR 'L-peptide linking' y THREONINE                            ? 'C4 H9 N O3'      119.119 
TRP 'L-peptide linking' y TRYPTOPHAN                           ? 'C11 H12 N2 O2'   204.225 
TYR 'L-peptide linking' y TYROSINE                             ? 'C9 H11 N O3'     181.189 
VAL 'L-peptide linking' y VALINE                               ? 'C5 H11 N O2'     117.146 
_exptl.entry_id          3G73 
_exptl.method            'X-RAY DIFFRACTION' 
_exptl.crystals_number   1 
#                    1 
_exptl_crystal.density_meas          ? 
_exptl_crystal.density_Matthews      3.10 
_exptl_crystal.density_percent_sol   60.38 
_exptl_crystal.description           ? 
_exptl_crystal.F_000                 ? 
_exptl_crystal.preparation           ? 
_exptl_crystal_grow.crystal_id      1 
_exptl_crystal_grow.method          'VAPOR DIFFUSION, HANGING DROP' 
_exptl_crystal_grow.temp            291 
_exptl_crystal_grow.temp_details    ? 
_exptl_crystal_grow.pH              7.5 
;24% PEG3350, 0.2M Sodium Malonate, pH7.5, 3uL Protein at 12g/L mixed with DNA at 0.5mM added tO 3uL of reservoir, VAPOR DIFFUSION, HANGING DROP, temperature 291K
_exptl_crystal_grow.pdbx_pH_range   . 
1 1 1 PEG3350           ? ? ? 
1 2 1 'Sodium Malonate' ? ? ? 
1 3 1 HOH               ? ? ? 
1 4 2 PEG3350           ? ? ? 
1 5 2 'Sodium Malonate' ? ? ? 
1 6 2 HOH               ? ? ? 
#                     1 
_diffrn.ambient_temp           100.0 
_diffrn.ambient_temp_details   ? 
_diffrn.crystal_id             1 
_diffrn_detector.diffrn_id              1 
_diffrn_detector.detector               CCD 
_diffrn_detector.type                   'ADSC QUANTUM Q315r' 
_diffrn_detector.pdbx_collection_date   2008-11-01 
_diffrn_detector.details                ? 
_diffrn_radiation.diffrn_id                        1 
_diffrn_radiation.wavelength_id                    1 
_diffrn_radiation.pdbx_monochromatic_or_laue_m_l   M 
_diffrn_radiation.monochromator                    ? 
_diffrn_radiation.pdbx_diffrn_protocol             'SINGLE WAVELENGTH' 
_diffrn_radiation.pdbx_scattering_type             x-ray 
#           1 
_diffrn_radiation_wavelength.wavelength   1.0723 
_diffrn_radiation_wavelength.wt           1.0 
_diffrn_source.diffrn_id                   1 
_diffrn_source.source                      SYNCHROTRON 
_diffrn_source.type                        'ESRF BEAMLINE ID23-1' 
_diffrn_source.pdbx_synchrotron_site       ESRF 
_diffrn_source.pdbx_synchrotron_beamline   ID23-1 
_diffrn_source.pdbx_wavelength             1.0723 
_diffrn_source.pdbx_wavelength_list        1.0723 
_reflns.entry_id                     3G73 
_reflns.observed_criterion_sigma_I   0.000 
_reflns.observed_criterion_sigma_F   ? 
_reflns.d_resolution_low             76.000 
_reflns.d_resolution_high            2.200 
_reflns.number_obs                   27165 
_reflns.number_all                   ? 
_reflns.percent_possible_obs         91.4 
_reflns.pdbx_Rmerge_I_obs            0.05800 
_reflns.pdbx_Rsym_value              ? 
_reflns.pdbx_netI_over_sigmaI        16.1 
_reflns.B_iso_Wilson_estimate        48.1 
_reflns.pdbx_redundancy              5.0 
_reflns.R_free_details               ? 
_reflns.limit_h_max                  ? 
_reflns.limit_h_min                  ? 
_reflns.limit_k_max                  ? 
_reflns.limit_k_min                  ? 
_reflns.limit_l_max                  ? 
_reflns.limit_l_min                  ? 
_reflns.observed_criterion_F_max     ? 
_reflns.observed_criterion_F_min     ? 
_reflns.pdbx_chi_squared             ? 
_reflns.pdbx_scaling_rejects         ? 
_reflns.pdbx_ordinal                 1 
_reflns.pdbx_diffrn_id               1 
_reflns_shell.d_res_high             2.20 
_reflns_shell.d_res_low              2.32 
_reflns_shell.percent_possible_all   59.4 
_reflns_shell.Rmerge_I_obs           0.450 
_reflns_shell.pdbx_Rsym_value        ? 
_reflns_shell.meanI_over_sigI_obs    3.1 
_reflns_shell.pdbx_redundancy        4.4 
_reflns_shell.percent_possible_obs   ? 
_reflns_shell.number_unique_all      ? 
_reflns_shell.number_measured_all    ? 
_reflns_shell.number_measured_obs    ? 
_reflns_shell.number_unique_obs      ? 
_reflns_shell.pdbx_chi_squared       ? 
_reflns_shell.pdbx_ordinal           1 
_reflns_shell.pdbx_diffrn_id         1 
_refine.entry_id                                 3G73 
_refine.ls_number_reflns_obs                     25545 
_refine.ls_number_reflns_all                     ? 
_refine.pdbx_ls_sigma_I                          ? 
_refine.pdbx_ls_sigma_F                          ? 
_refine.pdbx_data_cutoff_high_absF               ? 
_refine.pdbx_data_cutoff_low_absF                ? 
_refine.pdbx_data_cutoff_high_rms_absF           ? 
_refine.ls_d_res_low                             32.94 
_refine.ls_d_res_high                            2.21 
_refine.ls_percent_reflns_obs                    91.44 
_refine.ls_R_factor_obs                          0.20557 
_refine.ls_R_factor_all                          ? 
_refine.ls_R_factor_R_work                       0.20400 
_refine.ls_R_factor_R_free                       0.23425 
_refine.ls_R_factor_R_free_error                 ? 
_refine.ls_R_factor_R_free_error_details         ? 
_refine.ls_percent_reflns_R_free                 5.2 
_refine.ls_number_reflns_R_free                  1389 
_refine.ls_number_parameters                     ? 
_refine.ls_number_restraints                     ? 
_refine.occupancy_min                            ? 
_refine.occupancy_max                            ? 
_refine.correlation_coeff_Fo_to_Fc               0.950 
_refine.correlation_coeff_Fo_to_Fc_free          0.939 
_refine.B_iso_mean                               19.230 
_refine.aniso_B[1][1]                            1.22 
_refine.aniso_B[2][2]                            0.23 
_refine.aniso_B[3][3]                            -1.45 
_refine.aniso_B[1][2]                            0.00 
_refine.aniso_B[1][3]                            0.00 
_refine.aniso_B[2][3]                            0.00 
_refine.solvent_model_details                    MASK 
_refine.solvent_model_param_ksol                 ? 
_refine.solvent_model_param_bsol                 ? 
_refine.pdbx_solvent_vdw_probe_radii             1.20 
_refine.pdbx_solvent_ion_probe_radii             0.80 
_refine.pdbx_solvent_shrinkage_radii             0.80 
_refine.pdbx_ls_cross_valid_method               THROUGHOUT 
_refine.details                                  'HYDROGENS HAVE BEEN ADDED IN THE RIDING POSITIONS' 
_refine.pdbx_starting_model                      'PDB ENTRY 2C6Y' 
_refine.pdbx_method_to_determine_struct          'MOLECULAR REPLACEMENT' 
_refine.pdbx_isotropic_thermal_model             ? 
_refine.pdbx_stereochemistry_target_values       'MAXIMUM LIKELIHOOD' 
_refine.pdbx_stereochem_target_val_spec_case     ? 
_refine.pdbx_R_Free_selection_details            RANDOM 
_refine.pdbx_overall_ESU_R                       0.195 
_refine.pdbx_overall_ESU_R_Free                  0.173 
_refine.overall_SU_ML                            0.105 
_refine.overall_SU_B                             9.275 
_refine.ls_redundancy_reflns_obs                 ? 
_refine.B_iso_min                                ? 
_refine.B_iso_max                                ? 
_refine.overall_SU_R_Cruickshank_DPI             ? 
_refine.overall_SU_R_free                        ? 
_refine.ls_wR_factor_R_free                      ? 
_refine.ls_wR_factor_R_work                      ? 
_refine.overall_FOM_free_R_set                   ? 
_refine.overall_FOM_work_R_set                   ? 
_refine.pdbx_refine_id                           'X-RAY DIFFRACTION' 
_refine.pdbx_overall_phase_error                 ? 
_refine.pdbx_TLS_residual_ADP_flag               'LIKELY RESIDUAL' 
_refine.pdbx_diffrn_id                           1 
_refine.pdbx_overall_SU_R_free_Cruickshank_DPI   ? 
_refine.pdbx_overall_SU_R_Blow_DPI               ? 
_refine.pdbx_overall_SU_R_free_Blow_DPI          ? 
_refine_hist.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_refine_hist.cycle_id                         LAST 
_refine_hist.pdbx_number_atoms_protein        1560 
_refine_hist.pdbx_number_atoms_nucleic_acid   861 
_refine_hist.pdbx_number_atoms_ligand         2 
_refine_hist.number_atoms_solvent             163 
_refine_hist.number_atoms_total               2586 
_refine_hist.d_res_high                       2.21 
_refine_hist.d_res_low                        32.94 
r_bond_refined_d             0.009  0.021  ? 2582 'X-RAY DIFFRACTION' ? 
r_bond_other_d               0.001  0.020  ? 1510 'X-RAY DIFFRACTION' ? 
r_angle_refined_deg          1.446  2.354  ? 3676 'X-RAY DIFFRACTION' ? 
r_angle_other_deg            0.922  3.000  ? 3694 'X-RAY DIFFRACTION' ? 
r_dihedral_angle_1_deg       5.831  5.000  ? 185  'X-RAY DIFFRACTION' ? 
r_dihedral_angle_2_deg       31.395 22.375 ? 80   'X-RAY DIFFRACTION' ? 
r_dihedral_angle_3_deg       13.639 15.000 ? 276  'X-RAY DIFFRACTION' ? 
r_dihedral_angle_4_deg       15.812 15.000 ? 12   'X-RAY DIFFRACTION' ? 
r_chiral_restr               0.066  0.200  ? 393  'X-RAY DIFFRACTION' ? 
r_gen_planes_refined         0.005  0.021  ? 2201 'X-RAY DIFFRACTION' ? 
r_gen_planes_other           0.001  0.020  ? 450  'X-RAY DIFFRACTION' ? 
r_nbd_refined                ?      ?      ? ?    'X-RAY DIFFRACTION' ? 
r_nbd_other                  ?      ?      ? ?    'X-RAY DIFFRACTION' ? 
r_nbtor_refined              ?      ?      ? ?    'X-RAY DIFFRACTION' ? 
r_nbtor_other                ?      ?      ? ?    'X-RAY DIFFRACTION' ? 
r_xyhbond_nbd_refined        ?      ?      ? ?    'X-RAY DIFFRACTION' ? 
r_xyhbond_nbd_other          ?      ?      ? ?    'X-RAY DIFFRACTION' ? 
r_metal_ion_refined          ?      ?      ? ?    'X-RAY DIFFRACTION' ? 
r_metal_ion_other            ?      ?      ? ?    'X-RAY DIFFRACTION' ? 
r_symmetry_vdw_refined       ?      ?      ? ?    'X-RAY DIFFRACTION' ? 
r_symmetry_vdw_other         ?      ?      ? ?    'X-RAY DIFFRACTION' ? 
r_symmetry_hbond_refined     ?      ?      ? ?    'X-RAY DIFFRACTION' ? 
r_symmetry_hbond_other       ?      ?      ? ?    'X-RAY DIFFRACTION' ? 
r_symmetry_metal_ion_refined ?      ?      ? ?    'X-RAY DIFFRACTION' ? 
r_symmetry_metal_ion_other   ?      ?      ? ?    'X-RAY DIFFRACTION' ? 
r_mcbond_it                  1.059  2.000  ? 933  'X-RAY DIFFRACTION' ? 
r_mcbond_other               0.211  2.000  ? 362  'X-RAY DIFFRACTION' ? 
r_mcangle_it                 1.782  3.000  ? 1523 'X-RAY DIFFRACTION' ? 
r_scbond_it                  0.965  2.000  ? 1649 'X-RAY DIFFRACTION' ? 
r_scangle_it                 1.545  3.000  ? 2152 'X-RAY DIFFRACTION' ? 
r_rigid_bond_restr           ?      ?      ? ?    'X-RAY DIFFRACTION' ? 
r_sphericity_free            ?      ?      ? ?    'X-RAY DIFFRACTION' ? 
r_sphericity_bonded          ?      ?      ? ?    'X-RAY DIFFRACTION' ? 
_refine_ls_shell.pdbx_total_number_of_bins_used   20 
_refine_ls_shell.d_res_high                       2.210 
_refine_ls_shell.d_res_low                        2.267 
_refine_ls_shell.number_reflns_R_work             1117 
_refine_ls_shell.R_factor_R_work                  0.331 
_refine_ls_shell.percent_reflns_obs               54.88 
_refine_ls_shell.R_factor_R_free                  0.409 
_refine_ls_shell.R_factor_R_free_error            ? 
_refine_ls_shell.percent_reflns_R_free            ? 
_refine_ls_shell.number_reflns_R_free             69 
_refine_ls_shell.number_reflns_all                ? 
_refine_ls_shell.R_factor_all                     ? 
_refine_ls_shell.number_reflns_obs                ? 
_refine_ls_shell.redundancy_reflns_obs            ? 
_refine_ls_shell.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_struct.entry_id                  3G73 
_struct.title                     'Structure of the FOXM1 DNA binding' 
_struct.pdbx_descriptor           'Forkhead box protein M1/DNA complex' 
_struct.pdbx_model_details        ? 
_struct.pdbx_CASP_flag            ? 
_struct.pdbx_model_type_details   ? 
_struct_keywords.entry_id        3G73 
_struct_keywords.pdbx_keywords   TRANSCRIPTION/DNA 
;DNA-Binding domain, Forkhead transcription factors, FOXM1, Winged helix, Forkhead, Transcription regulation, TRANSCRIPTION-DNA COMPLEX, Activator, DNA-binding, Nucleus, Phosphoprotein, Transcription
A N N 1 ? 
B N N 1 ? 
C N N 2 ? 
D N N 3 ? 
E N N 4 ? 
F N N 4 ? 
G N N 5 ? 
H N N 5 ? 
I N N 5 ? 
J N N 5 ? 
#        1 
_struct_biol.details   ? 
HELX_P HELX_P1  1  SER A 22  ? SER A 33  ? SER A 240 SER A 251 1 ? 12 
HELX_P HELX_P2  2  THR A 40  ? PHE A 52  ? THR A 258 PHE A 270 1 ? 13 
HELX_P HELX_P3  3  PRO A 53  ? ILE A 58  ? PRO A 271 ILE A 276 1 ? 6  
HELX_P HELX_P4  4  GLY A 62  ? HIS A 74  ? GLY A 280 HIS A 292 1 ? 13 
HELX_P HELX_P5  5  SER B 22  ? SER B 33  ? SER B 240 SER B 251 1 ? 12 
HELX_P HELX_P6  6  THR B 40  ? PHE B 52  ? THR B 258 PHE B 270 1 ? 13 
HELX_P HELX_P7  7  PHE B 52  ? ILE B 58  ? PHE B 270 ILE B 276 1 ? 7  
HELX_P HELX_P8  8  GLY B 62  ? HIS B 74  ? GLY B 280 HIS B 292 1 ? 13 
HELX_P HELX_P9  9  PRO B 94  ? ASN B 97  ? PRO B 312 ASN B 315 5 ? 4  
HELX_P HELX_P10 10 THR B 101 ? PHE B 106 ? THR B 319 PHE B 324 5 ? 6  
#          HELX_P 
_struct_conf_type.criteria    ? 
_struct_conf_type.reference   ? 
metalc1  metalc ? ? A LEU 71 O  ? ? ? 1_555 E MG  .  MG ? ? A LEU 289 A MG  996 1_555 ? ? ? ? ? ? ?            2.347 ? 
metalc2  metalc ? ? A HIS 74 O  ? ? ? 1_555 E MG  .  MG ? ? A HIS 292 A MG  996 1_555 ? ? ? ? ? ? ?            2.470 ? 
metalc3  metalc ? ? A PHE 77 O  ? ? ? 1_555 E MG  .  MG ? ? A PHE 295 A MG  996 1_555 ? ? ? ? ? ? ?            2.370 ? 
metalc4  metalc ? ? B LEU 71 O  ? ? ? 1_555 F MG  .  MG ? ? B LEU 289 B MG  996 1_555 ? ? ? ? ? ? ?            2.171 ? 
metalc5  metalc ? ? E MG  .  MG ? ? ? 1_555 G HOH .  O  ? ? A MG  996 A HOH 24  1_555 ? ? ? ? ? ? ?            2.319 ? 
metalc6  metalc ? ? F MG  .  MG ? ? ? 1_555 H HOH .  O  ? ? B MG  996 B HOH 49  1_555 ? ? ? ? ? ? ?            2.327 ? 
metalc7  metalc ? ? E MG  .  MG ? ? ? 1_555 J HOH .  O  ? ? A MG  996 D HOH 26  1_555 ? ? ? ? ? ? ?            2.503 ? 
metalc8  metalc ? ? F MG  .  MG ? ? ? 1_555 I HOH .  O  ? ? B MG  996 C HOH 46  1_555 ? ? ? ? ? ? ?            2.505 ? 
metalc9  metalc ? ? B PHE 77 O  ? ? ? 1_555 F MG  .  MG ? ? B PHE 295 B MG  996 1_555 ? ? ? ? ? ? ?            2.560 ? 
metalc10 metalc ? ? B HIS 74 O  ? ? ? 1_555 F MG  .  MG ? ? B HIS 292 B MG  996 1_555 ? ? ? ? ? ? ?            2.565 ? 
hydrog1  hydrog ? ? C DA  3  N1 ? ? ? 1_555 D DT  21 N3 ? ? C DA  3   D DT  21  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog2  hydrog ? ? C DA  3  N6 ? ? ? 1_555 D DT  21 O4 ? ? C DA  3   D DT  21  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog3  hydrog ? ? C DT  4  N3 ? ? ? 1_555 D DA  20 N1 ? ? C DT  4   D DA  20  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog4  hydrog ? ? C DT  4  O4 ? ? ? 1_555 D DA  20 N6 ? ? C DT  4   D DA  20  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog5  hydrog ? ? C DT  5  N3 ? ? ? 1_555 D DA  19 N1 ? ? C DT  5   D DA  19  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog6  hydrog ? ? C DT  5  O4 ? ? ? 1_555 D DA  19 N6 ? ? C DT  5   D DA  19  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog7  hydrog ? ? C DG  6  N1 ? ? ? 1_555 D DC  18 N3 ? ? C DG  6   D DC  18  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog8  hydrog ? ? C DG  6  N2 ? ? ? 1_555 D DC  18 O2 ? ? C DG  6   D DC  18  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog9  hydrog ? ? C DG  6  O6 ? ? ? 1_555 D DC  18 N4 ? ? C DG  6   D DC  18  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog10 hydrog ? ? C DT  7  N3 ? ? ? 1_555 D DA  17 N1 ? ? C DT  7   D DA  17  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog11 hydrog ? ? C DT  7  O4 ? ? ? 1_555 D DA  17 N6 ? ? C DT  7   D DA  17  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog12 hydrog ? ? C DT  8  N3 ? ? ? 1_555 D DA  16 N1 ? ? C DT  8   D DA  16  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog13 hydrog ? ? C DT  8  O4 ? ? ? 1_555 D DA  16 N6 ? ? C DT  8   D DA  16  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog14 hydrog ? ? C DT  9  N3 ? ? ? 1_555 D DA  15 N1 ? ? C DT  9   D DA  15  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog15 hydrog ? ? C DT  9  O4 ? ? ? 1_555 D DA  15 N6 ? ? C DT  9   D DA  15  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog16 hydrog ? ? C DA  10 N1 ? ? ? 1_555 D DT  14 N3 ? ? C DA  10  D DT  14  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog17 hydrog ? ? C DA  10 N6 ? ? ? 1_555 D DT  14 O4 ? ? C DA  10  D DT  14  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog18 hydrog ? ? C DT  11 N3 ? ? ? 1_555 D DA  13 N1 ? ? C DT  11  D DA  13  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog19 hydrog ? ? C DT  11 O4 ? ? ? 1_555 D DA  13 N6 ? ? C DT  11  D DA  13  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog20 hydrog ? ? C DA  12 N1 ? ? ? 1_555 D DT  12 N3 ? ? C DA  12  D DT  12  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog21 hydrog ? ? C DA  12 N6 ? ? ? 1_555 D DT  12 O4 ? ? C DA  12  D DT  12  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog22 hydrog ? ? C DA  13 N1 ? ? ? 1_555 D DT  11 N3 ? ? C DA  13  D DT  11  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog23 hydrog ? ? C DA  13 N6 ? ? ? 1_555 D DT  11 O4 ? ? C DA  13  D DT  11  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog24 hydrog ? ? C DA  14 N1 ? ? ? 1_555 D DT  10 N3 ? ? C DA  14  D DT  10  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog25 hydrog ? ? C DA  14 N6 ? ? ? 1_555 D DT  10 O4 ? ? C DA  14  D DT  10  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog26 hydrog ? ? C DC  15 N3 ? ? ? 1_555 D DG  9  N1 ? ? C DC  15  D DG  9   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog27 hydrog ? ? C DC  15 N4 ? ? ? 1_555 D DG  9  O6 ? ? C DC  15  D DG  9   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog28 hydrog ? ? C DC  15 O2 ? ? ? 1_555 D DG  9  N2 ? ? C DC  15  D DG  9   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog29 hydrog ? ? C DA  16 N1 ? ? ? 1_555 D DT  8  N3 ? ? C DA  16  D DT  8   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog30 hydrog ? ? C DA  16 N6 ? ? ? 1_555 D DT  8  O4 ? ? C DA  16  D DT  8   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog31 hydrog ? ? C DG  17 N1 ? ? ? 1_555 D DC  7  N3 ? ? C DG  17  D DC  7   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog32 hydrog ? ? C DG  17 N2 ? ? ? 1_555 D DC  7  O2 ? ? C DG  17  D DC  7   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog33 hydrog ? ? C DG  17 O6 ? ? ? 1_555 D DC  7  N4 ? ? C DG  17  D DC  7   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog34 hydrog ? ? C DC  18 N3 ? ? ? 1_555 D DG  6  N1 ? ? C DC  18  D DG  6   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog35 hydrog ? ? C DC  18 N4 ? ? ? 1_555 D DG  6  O6 ? ? C DC  18  D DG  6   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog36 hydrog ? ? C DC  18 O2 ? ? ? 1_555 D DG  6  N2 ? ? C DC  18  D DG  6   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog37 hydrog ? ? C DC  19 N3 ? ? ? 1_555 D DG  5  N1 ? ? C DC  19  D DG  5   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog38 hydrog ? ? C DC  19 N4 ? ? ? 1_555 D DG  5  O6 ? ? C DC  19  D DG  5   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog39 hydrog ? ? C DC  19 O2 ? ? ? 1_555 D DG  5  N2 ? ? C DC  19  D DG  5   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog40 hydrog ? ? C DC  20 N3 ? ? ? 1_555 D DG  4  N1 ? ? C DC  20  D DG  4   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog41 hydrog ? ? C DC  20 N4 ? ? ? 1_555 D DG  4  O6 ? ? C DC  20  D DG  4   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog42 hydrog ? ? C DC  20 O2 ? ? ? 1_555 D DG  4  N2 ? ? C DC  20  D DG  4   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog43 hydrog ? ? C DG  21 N1 ? ? ? 1_555 D DC  3  N3 ? ? C DG  21  D DC  3   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog44 hydrog ? ? C DG  21 N2 ? ? ? 1_555 D DC  3  O2 ? ? C DG  21  D DC  3   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog45 hydrog ? ? C DG  21 O6 ? ? ? 1_555 D DC  3  N4 ? ? C DG  21  D DC  3   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
metalc ? ? 
hydrog ? ? 
_struct_mon_prot_cis.pdbx_id                1 
_struct_mon_prot_cis.label_comp_id          GLY 
_struct_mon_prot_cis.label_seq_id           85 
_struct_mon_prot_cis.label_asym_id          A 
_struct_mon_prot_cis.label_alt_id           . 
_struct_mon_prot_cis.pdbx_PDB_ins_code      ? 
_struct_mon_prot_cis.auth_comp_id           GLY 
_struct_mon_prot_cis.auth_seq_id            303 
_struct_mon_prot_cis.auth_asym_id           A 
_struct_mon_prot_cis.pdbx_label_comp_id_2   LYS 
_struct_mon_prot_cis.pdbx_label_seq_id_2    86 
_struct_mon_prot_cis.pdbx_label_asym_id_2   A 
_struct_mon_prot_cis.pdbx_PDB_ins_code_2    ? 
_struct_mon_prot_cis.pdbx_auth_comp_id_2    LYS 
_struct_mon_prot_cis.pdbx_auth_seq_id_2     304 
_struct_mon_prot_cis.pdbx_auth_asym_id_2    A 
_struct_mon_prot_cis.pdbx_PDB_model_num     1 
_struct_mon_prot_cis.pdbx_omega_angle       -0.18 
A ? 3 ? 
B ? 3 ? 
A 1 2 ? anti-parallel 
A 2 3 ? anti-parallel 
B 1 2 ? anti-parallel 
B 2 3 ? anti-parallel 
A 1 ARG A 38 ? MET A 39 ? ARG A 256 MET A 257 
A 2 SER A 88 ? ILE A 92 ? SER A 306 ILE A 310 
A 3 PHE A 77 ? THR A 81 ? PHE A 295 THR A 299 
B 1 ARG B 38 ? MET B 39 ? ARG B 256 MET B 257 
B 2 SER B 88 ? ILE B 92 ? SER B 306 ILE B 310 
B 3 PHE B 77 ? THR B 81 ? PHE B 295 THR B 299 
A 1 2 N MET A 39 ? N MET A 257 O TRP A 90 ? O TRP A 308 
A 2 3 O PHE A 89 ? O PHE A 307 N GLU A 80 ? N GLU A 298 
B 1 2 N MET B 39 ? N MET B 257 O TRP B 90 ? O TRP B 308 
B 2 3 O PHE B 89 ? O PHE B 307 N GLU B 80 ? N GLU B 298 
AC1 Software ? ? ? ? 6 'BINDING SITE FOR RESIDUE MG A 996' 
AC2 Software ? ? ? ? 6 'BINDING SITE FOR RESIDUE MG B 996' 
1  AC1 6 HOH G .  ? HOH A 24  . ? 1_555 ? 
2  AC1 6 LEU A 71 ? LEU A 289 . ? 1_555 ? 
3  AC1 6 SER A 72 ? SER A 290 . ? 1_555 ? 
4  AC1 6 HIS A 74 ? HIS A 292 . ? 1_555 ? 
5  AC1 6 PHE A 77 ? PHE A 295 . ? 1_555 ? 
6  AC1 6 HOH J .  ? HOH D 26  . ? 1_555 ? 
7  AC2 6 HOH H .  ? HOH B 49  . ? 1_555 ? 
8  AC2 6 LEU B 71 ? LEU B 289 . ? 1_555 ? 
9  AC2 6 SER B 72 ? SER B 290 . ? 1_555 ? 
10 AC2 6 HIS B 74 ? HIS B 292 . ? 1_555 ? 
11 AC2 6 PHE B 77 ? PHE B 295 . ? 1_555 ? 
12 AC2 6 HOH I .  ? HOH C 46  . ? 1_555 ? 
_database_PDB_matrix.entry_id          3G73 
_database_PDB_matrix.origx[1][1]       1.000000 
_database_PDB_matrix.origx[1][2]       0.000000 
_database_PDB_matrix.origx[1][3]       0.000000 
_database_PDB_matrix.origx[2][1]       0.000000 
_database_PDB_matrix.origx[2][2]       1.000000 
_database_PDB_matrix.origx[2][3]       0.000000 
_database_PDB_matrix.origx[3][1]       0.000000 
_database_PDB_matrix.origx[3][2]       0.000000 
_database_PDB_matrix.origx[3][3]       1.000000 
_database_PDB_matrix.origx_vector[1]   0.00000 
_database_PDB_matrix.origx_vector[2]   0.00000 
_database_PDB_matrix.origx_vector[3]   0.00000 
_atom_sites.entry_id                    3G73 
_atom_sites.fract_transf_matrix[1][1]   0.015855 
_atom_sites.fract_transf_matrix[1][2]   0.000000 
_atom_sites.fract_transf_matrix[1][3]   0.000000 
_atom_sites.fract_transf_matrix[2][1]   0.000000 
_atom_sites.fract_transf_matrix[2][2]   0.008351 
_atom_sites.fract_transf_matrix[2][3]   0.000000 
_atom_sites.fract_transf_matrix[3][1]   0.000000 
_atom_sites.fract_transf_matrix[3][2]   0.000000 
_atom_sites.fract_transf_matrix[3][3]   0.006537 
_atom_sites.fract_transf_vector[1]      0.00000 
_atom_sites.fract_transf_vector[2]      0.00000 
_atom_sites.fract_transf_vector[3]      0.00000 
ATOM   1    N  N     . SER A 1 14  ? 21.364  40.072 -13.197 1.00 39.35 ? 232 SER A N     1 
ATOM   2    C  CA    . SER A 1 14  ? 22.401  39.348 -12.409 1.00 38.82 ? 232 SER A CA    1 
ATOM   3    C  C     . SER A 1 14  ? 21.829  38.065 -11.805 1.00 37.91 ? 232 SER A C     1 
ATOM   4    O  O     . SER A 1 14  ? 20.969  38.107 -10.920 1.00 39.29 ? 232 SER A O     1 
ATOM   5    C  CB    . SER A 1 14  ? 22.959  40.255 -11.318 1.00 39.15 ? 232 SER A CB    1 
ATOM   6    O  OG    . SER A 1 14  ? 23.624  39.504 -10.318 1.00 39.72 ? 232 SER A OG    1 
ATOM   7    N  N     . VAL A 1 15  ? 22.348  36.929 -12.266 1.00 36.29 ? 233 VAL A N     1 
ATOM   8    C  CA    . VAL A 1 15  ? 21.752  35.612 -12.003 1.00 34.65 ? 233 VAL A CA    1 
ATOM   9    C  C     . VAL A 1 15  ? 21.815  35.129 -10.544 1.00 32.90 ? 233 VAL A C     1 
ATOM   10   O  O     . VAL A 1 15  ? 21.026  34.265 -10.165 1.00 32.03 ? 233 VAL A O     1 
ATOM   11   C  CB    . VAL A 1 15  ? 22.366  34.524 -12.955 1.00 34.42 ? 233 VAL A CB    1 
ATOM   12   C  CG1   . VAL A 1 15  ? 21.844  33.126 -12.635 1.00 34.14 ? 233 VAL A CG1   1 
ATOM   13   C  CG2   . VAL A 1 15  ? 22.056  34.855 -14.395 1.00 33.68 ? 233 VAL A CG2   1 
ATOM   14   N  N     . SER A 1 16  ? 22.718  35.679 -9.725  1.00 31.23 ? 234 SER A N     1 
ATOM   15   C  CA    . SER A 1 16  ? 22.912  35.156 -8.357  1.00 29.80 ? 234 SER A CA    1 
ATOM   16   C  C     . SER A 1 16  ? 22.485  36.073 -7.195  1.00 28.46 ? 234 SER A C     1 
ATOM   17   O  O     . SER A 1 16  ? 22.841  35.828 -6.045  1.00 26.99 ? 234 SER A O     1 
ATOM   18   C  CB    . SER A 1 16  ? 24.365  34.713 -8.165  1.00 30.19 ? 234 SER A CB    1 
ATOM   19   O  OG    . SER A 1 16  ? 25.219  35.813 -7.925  1.00 30.32 ? 234 SER A OG    1 
ATOM   20   N  N     . GLU A 1 17  ? 21.711  37.112 -7.488  1.00 28.28 ? 235 GLU A N     1 
ATOM   21   C  CA    . GLU A 1 17  ? 21.138  37.969 -6.442  1.00 28.39 ? 235 GLU A CA    1 
ATOM   22   C  C     . GLU A 1 17  ? 19.898  37.291 -5.858  1.00 27.21 ? 235 GLU A C     1 
ATOM   23   O  O     . GLU A 1 17  ? 19.339  36.393 -6.493  1.00 26.96 ? 235 GLU A O     1 
ATOM   24   C  CB    . GLU A 1 17  ? 20.768  39.329 -7.021  1.00 29.52 ? 235 GLU A CB    1 
ATOM   25   C  CG    . GLU A 1 17  ? 21.969  40.158 -7.426  1.00 30.49 ? 235 GLU A CG    1 
ATOM   26   C  CD    . GLU A 1 17  ? 21.616  41.248 -8.414  1.00 31.39 ? 235 GLU A CD    1 
ATOM   27   O  OE1   . GLU A 1 17  ? 20.478  41.239 -8.935  1.00 32.52 ? 235 GLU A OE1   1 
ATOM   28   O  OE2   . GLU A 1 17  ? 22.482  42.111 -8.680  1.00 32.04 ? 235 GLU A OE2   1 
ATOM   29   N  N     . ARG A 1 18  ? 19.473  37.714 -4.663  1.00 25.39 ? 236 ARG A N     1 
ATOM   30   C  CA    . ARG A 1 18  ? 18.310  37.103 -4.004  1.00 25.30 ? 236 ARG A CA    1 
ATOM   31   C  C     . ARG A 1 18  ? 16.989  37.291 -4.789  1.00 22.77 ? 236 ARG A C     1 
ATOM   32   O  O     . ARG A 1 18  ? 16.610  38.406 -5.115  1.00 22.56 ? 236 ARG A O     1 
ATOM   33   C  CB    . ARG A 1 18  ? 18.122  37.637 -2.577  1.00 26.12 ? 236 ARG A CB    1 
ATOM   34   C  CG    . ARG A 1 18  ? 17.179  36.744 -1.764  1.00 27.59 ? 236 ARG A CG    1 
ATOM   35   C  CD    . ARG A 1 18  ? 16.552  37.418 -0.557  1.00 28.56 ? 236 ARG A CD    1 
ATOM   36   N  NE    . ARG A 1 18  ? 15.664  36.469 0.128   1.00 29.74 ? 236 ARG A NE    1 
ATOM   37   C  CZ    . ARG A 1 18  ? 15.930  35.838 1.274   1.00 30.70 ? 236 ARG A CZ    1 
ATOM   38   N  NH1   . ARG A 1 18  ? 17.072  36.043 1.931   1.00 31.11 ? 236 ARG A NH1   1 
ATOM   39   N  NH2   . ARG A 1 18  ? 15.036  34.994 1.784   1.00 31.12 ? 236 ARG A NH2   1 
ATOM   40   N  N     . PRO A 1 19  ? 16.270  36.202 -5.068  1.00 21.37 ? 237 PRO A N     1 
ATOM   41   C  CA    . PRO A 1 19  ? 15.044  36.339 -5.878  1.00 20.69 ? 237 PRO A CA    1 
ATOM   42   C  C     . PRO A 1 19  ? 13.910  37.091 -5.170  1.00 19.03 ? 237 PRO A C     1 
ATOM   43   O  O     . PRO A 1 19  ? 13.860  37.108 -3.949  1.00 18.59 ? 237 PRO A O     1 
ATOM   44   C  CB    . PRO A 1 19  ? 14.614  34.888 -6.129  1.00 20.92 ? 237 PRO A CB    1 
ATOM   45   C  CG    . PRO A 1 19  ? 15.691  34.033 -5.563  1.00 21.31 ? 237 PRO A CG    1 
ATOM   46   C  CD    . PRO A 1 19  ? 16.442  34.833 -4.570  1.00 21.26 ? 237 PRO A CD    1 
ATOM   47   N  N     . PRO A 1 20  ? 12.983  37.691 -5.936  1.00 18.02 ? 238 PRO A N     1 
ATOM   48   C  CA    . PRO A 1 20  ? 11.862  38.382 -5.321  1.00 17.47 ? 238 PRO A CA    1 
ATOM   49   C  C     . PRO A 1 20  ? 10.679  37.436 -5.078  1.00 17.47 ? 238 PRO A C     1 
ATOM   50   O  O     . PRO A 1 20  ? 9.540   37.795 -5.341  1.00 18.90 ? 238 PRO A O     1 
ATOM   51   C  CB    . PRO A 1 20  ? 11.524  39.448 -6.367  1.00 17.30 ? 238 PRO A CB    1 
ATOM   52   C  CG    . PRO A 1 20  ? 11.797  38.776 -7.663  1.00 16.87 ? 238 PRO A CG    1 
ATOM   53   C  CD    . PRO A 1 20  ? 12.921  37.783 -7.405  1.00 17.54 ? 238 PRO A CD    1 
ATOM   54   N  N     . TYR A 1 21  ? 10.960  36.231 -4.598  1.00 17.45 ? 239 TYR A N     1 
ATOM   55   C  CA    . TYR A 1 21  ? 9.931   35.253 -4.278  1.00 18.30 ? 239 TYR A CA    1 
ATOM   56   C  C     . TYR A 1 21  ? 10.057  34.780 -2.837  1.00 17.41 ? 239 TYR A C     1 
ATOM   57   O  O     . TYR A 1 21  ? 11.162  34.573 -2.328  1.00 16.45 ? 239 TYR A O     1 
ATOM   58   C  CB    . TYR A 1 21  ? 10.041  34.029 -5.187  1.00 19.04 ? 239 TYR A CB    1 
ATOM   59   C  CG    . TYR A 1 21  ? 10.010  34.364 -6.647  1.00 20.61 ? 239 TYR A CG    1 
ATOM   60   C  CD1   . TYR A 1 21  ? 8.921   35.020 -7.198  1.00 21.17 ? 239 TYR A CD1   1 
ATOM   61   C  CD2   . TYR A 1 21  ? 11.063  34.016 -7.484  1.00 21.24 ? 239 TYR A CD2   1 
ATOM   62   C  CE1   . TYR A 1 21  ? 8.880   35.331 -8.530  1.00 21.54 ? 239 TYR A CE1   1 
ATOM   63   C  CE2   . TYR A 1 21  ? 11.032  34.330 -8.825  1.00 21.66 ? 239 TYR A CE2   1 
ATOM   64   C  CZ    . TYR A 1 21  ? 9.937   34.987 -9.340  1.00 21.73 ? 239 TYR A CZ    1 
ATOM   65   O  OH    . TYR A 1 21  ? 9.890   35.300 -10.671 1.00 22.14 ? 239 TYR A OH    1 
ATOM   66   N  N     . SER A 1 22  ? 8.915   34.572 -2.192  1.00 16.44 ? 240 SER A N     1 
ATOM   67   C  CA    . SER A 1 22  ? 8.906   34.060 -0.834  1.00 15.28 ? 240 SER A CA    1 
ATOM   68   C  C     . SER A 1 22  ? 9.301   32.589 -0.851  1.00 15.60 ? 240 SER A C     1 
ATOM   69   O  O     . SER A 1 22  ? 9.197   31.911 -1.878  1.00 16.19 ? 240 SER A O     1 
ATOM   70   C  CB    . SER A 1 22  ? 7.527   34.246 -0.208  1.00 13.87 ? 240 SER A CB    1 
ATOM   71   O  OG    . SER A 1 22  ? 6.570   33.488 -0.924  1.00 13.99 ? 240 SER A OG    1 
ATOM   72   N  N     . TYR A 1 23  ? 9.764   32.084 0.279   1.00 16.52 ? 241 TYR A N     1 
ATOM   73   C  CA    . TYR A 1 23  ? 10.011  30.646 0.377   1.00 18.94 ? 241 TYR A CA    1 
ATOM   74   C  C     . TYR A 1 23  ? 8.794   29.809 -0.060  1.00 21.54 ? 241 TYR A C     1 
ATOM   75   O  O     . TYR A 1 23  ? 8.949   28.760 -0.720  1.00 21.35 ? 241 TYR A O     1 
ATOM   76   C  CB    . TYR A 1 23  ? 10.410  30.254 1.782   1.00 18.64 ? 241 TYR A CB    1 
ATOM   77   C  CG    . TYR A 1 23  ? 11.798  30.703 2.152   1.00 19.17 ? 241 TYR A CG    1 
ATOM   78   C  CD1   . TYR A 1 23  ? 12.004  31.590 3.195   1.00 17.64 ? 241 TYR A CD1   1 
ATOM   79   C  CD2   . TYR A 1 23  ? 12.910  30.240 1.438   1.00 19.39 ? 241 TYR A CD2   1 
ATOM   80   C  CE1   . TYR A 1 23  ? 13.294  32.014 3.533   1.00 19.52 ? 241 TYR A CE1   1 
ATOM   81   C  CE2   . TYR A 1 23  ? 14.197  30.653 1.766   1.00 19.86 ? 241 TYR A CE2   1 
ATOM   82   C  CZ    . TYR A 1 23  ? 14.387  31.528 2.817   1.00 19.48 ? 241 TYR A CZ    1 
ATOM   83   O  OH    . TYR A 1 23  ? 15.652  31.934 3.128   1.00 18.74 ? 241 TYR A OH    1 
ATOM   84   N  N     . MET A 1 24  ? 7.603   30.281 0.316   1.00 21.15 ? 242 MET A N     1 
ATOM   85   C  CA    . MET A 1 24  ? 6.346   29.613 -0.033  1.00 21.95 ? 242 MET A CA    1 
ATOM   86   C  C     . MET A 1 24  ? 6.152   29.549 -1.564  1.00 18.93 ? 242 MET A C     1 
ATOM   87   O  O     . MET A 1 24  ? 5.767   28.527 -2.090  1.00 19.71 ? 242 MET A O     1 
ATOM   88   C  CB    . MET A 1 24  ? 5.165   30.335 0.656   1.00 22.05 ? 242 MET A CB    1 
ATOM   89   C  CG    . MET A 1 24  ? 3.808   29.704 0.426   1.00 24.16 ? 242 MET A CG    1 
ATOM   90   S  SD    . MET A 1 24  ? 2.399   30.809 0.805   1.00 24.00 ? 242 MET A SD    1 
ATOM   91   C  CE    . MET A 1 24  ? 2.477   31.863 -0.630  1.00 25.02 ? 242 MET A CE    1 
ATOM   92   N  N     . ALA A 1 25  ? 6.399   30.645 -2.265  1.00 17.37 ? 243 ALA A N     1 
ATOM   93   C  CA    . ALA A 1 25  ? 6.351   30.638 -3.737  1.00 18.04 ? 243 ALA A CA    1 
ATOM   94   C  C     . ALA A 1 25  ? 7.364   29.646 -4.351  1.00 18.43 ? 243 ALA A C     1 
ATOM   95   O  O     . ALA A 1 25  ? 7.020   28.831 -5.216  1.00 17.42 ? 243 ALA A O     1 
ATOM   96   C  CB    . ALA A 1 25  ? 6.584   32.035 -4.280  1.00 17.01 ? 243 ALA A CB    1 
ATOM   97   N  N     . MET A 1 26  ? 8.598   29.689 -3.869  1.00 19.53 ? 244 MET A N     1 
ATOM   98   C  CA    . MET A 1 26  ? 9.666   28.879 -4.456  1.00 19.48 ? 244 MET A CA    1 
ATOM   99   C  C     . MET A 1 26  ? 9.414   27.393 -4.205  1.00 19.19 ? 244 MET A C     1 
ATOM   100  O  O     . MET A 1 26  ? 9.704   26.556 -5.057  1.00 20.03 ? 244 MET A O     1 
ATOM   101  C  CB    . MET A 1 26  ? 11.032  29.306 -3.919  1.00 19.10 ? 244 MET A CB    1 
ATOM   102  C  CG    . MET A 1 26  ? 11.459  30.683 -4.372  1.00 19.52 ? 244 MET A CG    1 
ATOM   103  S  SD    . MET A 1 26  ? 13.114  31.147 -3.769  1.00 20.18 ? 244 MET A SD    1 
ATOM   104  C  CE    . MET A 1 26  ? 12.801  31.530 -2.039  1.00 19.54 ? 244 MET A CE    1 
ATOM   105  N  N     . ILE A 1 27  ? 8.870   27.066 -3.041  1.00 19.72 ? 245 ILE A N     1 
ATOM   106  C  CA    . ILE A 1 27  ? 8.507   25.686 -2.751  1.00 19.25 ? 245 ILE A CA    1 
ATOM   107  C  C     . ILE A 1 27  ? 7.451   25.212 -3.772  1.00 19.38 ? 245 ILE A C     1 
ATOM   108  O  O     . ILE A 1 27  ? 7.558   24.098 -4.313  1.00 18.65 ? 245 ILE A O     1 
ATOM   109  C  CB    . ILE A 1 27  ? 7.996   25.509 -1.303  1.00 19.33 ? 245 ILE A CB    1 
ATOM   110  C  CG1   . ILE A 1 27  ? 9.148   25.668 -0.291  1.00 19.33 ? 245 ILE A CG1   1 
ATOM   111  C  CG2   . ILE A 1 27  ? 7.372   24.128 -1.127  1.00 19.48 ? 245 ILE A CG2   1 
ATOM   112  C  CD1   . ILE A 1 27  ? 8.697   26.011 1.154   1.00 18.33 ? 245 ILE A CD1   1 
ATOM   113  N  N     . GLN A 1 28  ? 6.471   26.066 -4.078  1.00 19.21 ? 246 GLN A N     1 
ATOM   114  C  CA    . GLN A 1 28  ? 5.444   25.692 -5.044  1.00 20.44 ? 246 GLN A CA    1 
ATOM   115  C  C     . GLN A 1 28  ? 6.031   25.465 -6.435  1.00 19.66 ? 246 GLN A C     1 
ATOM   116  O  O     . GLN A 1 28  ? 5.643   24.521 -7.126  1.00 18.62 ? 246 GLN A O     1 
ATOM   117  C  CB    . GLN A 1 28  ? 4.343   26.745 -5.145  1.00 21.99 ? 246 GLN A CB    1 
ATOM   118  C  CG    . GLN A 1 28  ? 3.541   26.937 -3.896  1.00 23.71 ? 246 GLN A CG    1 
ATOM   119  C  CD    . GLN A 1 28  ? 2.559   28.066 -4.053  1.00 24.36 ? 246 GLN A CD    1 
ATOM   120  O  OE1   . GLN A 1 28  ? 1.510   27.898 -4.664  1.00 26.12 ? 246 GLN A OE1   1 
ATOM   121  N  NE2   . GLN A 1 28  ? 2.903   29.232 -3.529  1.00 25.44 ? 246 GLN A NE2   1 
ATOM   122  N  N     . PHE A 1 29  ? 6.936   26.352 -6.847  1.00 18.71 ? 247 PHE A N     1 
ATOM   123  C  CA    . PHE A 1 29  ? 7.570   26.243 -8.148  1.00 18.88 ? 247 PHE A CA    1 
ATOM   124  C  C     . PHE A 1 29  ? 8.265   24.902 -8.248  1.00 18.13 ? 247 PHE A C     1 
ATOM   125  O  O     . PHE A 1 29  ? 8.198   24.223 -9.268  1.00 19.95 ? 247 PHE A O     1 
ATOM   126  C  CB    . PHE A 1 29  ? 8.625   27.337 -8.359  1.00 19.27 ? 247 PHE A CB    1 
ATOM   127  C  CG    . PHE A 1 29  ? 8.078   28.737 -8.498  1.00 20.00 ? 247 PHE A CG    1 
ATOM   128  C  CD1   . PHE A 1 29  ? 6.831   28.989 -9.069  1.00 21.19 ? 247 PHE A CD1   1 
ATOM   129  C  CD2   . PHE A 1 29  ? 8.850   29.818 -8.104  1.00 20.36 ? 247 PHE A CD2   1 
ATOM   130  C  CE1   . PHE A 1 29  ? 6.366   30.295 -9.209  1.00 21.01 ? 247 PHE A CE1   1 
ATOM   131  C  CE2   . PHE A 1 29  ? 8.394   31.116 -8.249  1.00 20.48 ? 247 PHE A CE2   1 
ATOM   132  C  CZ    . PHE A 1 29  ? 7.154   31.356 -8.793  1.00 20.65 ? 247 PHE A CZ    1 
ATOM   133  N  N     . ALA A 1 30  ? 8.941   24.538 -7.176  1.00 17.29 ? 248 ALA A N     1 
ATOM   134  C  CA    . ALA A 1 30  ? 9.714   23.316 -7.135  1.00 17.52 ? 248 ALA A CA    1 
ATOM   135  C  C     . ALA A 1 30  ? 8.802   22.110 -7.287  1.00 17.01 ? 248 ALA A C     1 
ATOM   136  O  O     . ALA A 1 30  ? 9.000   21.296 -8.178  1.00 18.25 ? 248 ALA A O     1 
ATOM   137  C  CB    . ALA A 1 30  ? 10.521  23.241 -5.826  1.00 16.00 ? 248 ALA A CB    1 
ATOM   138  N  N     . ILE A 1 31  ? 7.787   22.011 -6.434  1.00 17.50 ? 249 ILE A N     1 
ATOM   139  C  CA    . ILE A 1 31  ? 6.854   20.887 -6.491  1.00 16.42 ? 249 ILE A CA    1 
ATOM   140  C  C     . ILE A 1 31  ? 6.095   20.838 -7.827  1.00 16.29 ? 249 ILE A C     1 
ATOM   141  O  O     . ILE A 1 31  ? 5.892   19.759 -8.399  1.00 16.63 ? 249 ILE A O     1 
ATOM   142  C  CB    . ILE A 1 31  ? 5.840   20.932 -5.327  1.00 15.70 ? 249 ILE A CB    1 
ATOM   143  C  CG1   . ILE A 1 31  ? 6.565   20.750 -3.988  1.00 15.49 ? 249 ILE A CG1   1 
ATOM   144  C  CG2   . ILE A 1 31  ? 4.754   19.858 -5.514  1.00 14.30 ? 249 ILE A CG2   1 
ATOM   145  C  CD1   . ILE A 1 31  ? 5.715   21.109 -2.766  1.00 14.83 ? 249 ILE A CD1   1 
ATOM   146  N  N     . ASN A 1 32  ? 5.675   21.993 -8.329  1.00 15.99 ? 250 ASN A N     1 
ATOM   147  C  CA    . ASN A 1 32  ? 4.913   22.016 -9.574  1.00 17.18 ? 250 ASN A CA    1 
ATOM   148  C  C     . ASN A 1 32  ? 5.748   21.733 -10.824 1.00 16.87 ? 250 ASN A C     1 
ATOM   149  O  O     . ASN A 1 32  ? 5.182   21.583 -11.901 1.00 15.95 ? 250 ASN A O     1 
ATOM   150  C  CB    . ASN A 1 32  ? 4.150   23.335 -9.733  1.00 18.67 ? 250 ASN A CB    1 
ATOM   151  C  CG    . ASN A 1 32  ? 2.921   23.407 -8.839  1.00 19.92 ? 250 ASN A CG    1 
ATOM   152  O  OD1   . ASN A 1 32  ? 2.374   22.373 -8.436  1.00 20.16 ? 250 ASN A OD1   1 
ATOM   153  N  ND2   . ASN A 1 32  ? 2.478   24.625 -8.530  1.00 19.80 ? 250 ASN A ND2   1 
ATOM   154  N  N     . SER A 1 33  ? 7.072   21.660 -10.683 1.00 16.32 ? 251 SER A N     1 
ATOM   155  C  CA    . SER A 1 33  ? 7.948   21.335 -11.817 1.00 16.71 ? 251 SER A CA    1 
ATOM   156  C  C     . SER A 1 33  ? 7.920   19.842 -12.149 1.00 17.22 ? 251 SER A C     1 
ATOM   157  O  O     . SER A 1 33  ? 8.369   19.446 -13.200 1.00 17.93 ? 251 SER A O     1 
ATOM   158  C  CB    . SER A 1 33  ? 9.386   21.805 -11.551 1.00 16.63 ? 251 SER A CB    1 
ATOM   159  O  OG    . SER A 1 33  ? 10.046  21.031 -10.561 1.00 16.47 ? 251 SER A OG    1 
ATOM   160  N  N     . THR A 1 34  ? 7.359   19.026 -11.263 1.00 18.53 ? 252 THR A N     1 
ATOM   161  C  CA    . THR A 1 34  ? 7.330   17.581 -11.436 1.00 18.91 ? 252 THR A CA    1 
ATOM   162  C  C     . THR A 1 34  ? 5.999   17.135 -12.035 1.00 20.91 ? 252 THR A C     1 
ATOM   163  O  O     . THR A 1 34  ? 4.962   17.750 -11.782 1.00 21.51 ? 252 THR A O     1 
ATOM   164  C  CB    . THR A 1 34  ? 7.518   16.892 -10.082 1.00 19.03 ? 252 THR A CB    1 
ATOM   165  O  OG1   . THR A 1 34  ? 6.418   17.229 -9.219  1.00 17.70 ? 252 THR A OG1   1 
ATOM   166  C  CG2   . THR A 1 34  ? 8.832   17.348 -9.432  1.00 18.28 ? 252 THR A CG2   1 
ATOM   167  N  N     . GLU A 1 35  ? 6.028   16.062 -12.820 1.00 21.59 ? 253 GLU A N     1 
ATOM   168  C  CA    . GLU A 1 35  ? 4.816   15.506 -13.425 1.00 22.80 ? 253 GLU A CA    1 
ATOM   169  C  C     . GLU A 1 35  ? 3.822   15.013 -12.366 1.00 23.56 ? 253 GLU A C     1 
ATOM   170  O  O     . GLU A 1 35  ? 2.613   15.169 -12.525 1.00 24.44 ? 253 GLU A O     1 
ATOM   171  C  CB    . GLU A 1 35  ? 5.200   14.367 -14.374 1.00 23.06 ? 253 GLU A CB    1 
ATOM   172  C  CG    . GLU A 1 35  ? 4.074   13.704 -15.131 1.00 23.47 ? 253 GLU A CG    1 
ATOM   173  C  CD    . GLU A 1 35  ? 4.500   12.365 -15.714 1.00 23.89 ? 253 GLU A CD    1 
ATOM   174  O  OE1   . GLU A 1 35  ? 4.906   11.482 -14.930 1.00 24.50 ? 253 GLU A OE1   1 
ATOM   175  O  OE2   . GLU A 1 35  ? 4.431   12.187 -16.949 1.00 23.96 ? 253 GLU A OE2   1 
ATOM   176  N  N     . ARG A 1 36  ? 4.337   14.426 -11.292 1.00 23.65 ? 254 ARG A N     1 
ATOM   177  C  CA    . ARG A 1 36  ? 3.503   13.884 -10.226 1.00 24.18 ? 254 ARG A CA    1 
ATOM   178  C  C     . ARG A 1 36  ? 3.085   14.941 -9.202  1.00 23.21 ? 254 ARG A C     1 
ATOM   179  O  O     . ARG A 1 36  ? 2.362   14.630 -8.263  1.00 22.17 ? 254 ARG A O     1 
ATOM   180  C  CB    . ARG A 1 36  ? 4.259   12.769 -9.496  1.00 25.86 ? 254 ARG A CB    1 
ATOM   181  C  CG    . ARG A 1 36  ? 4.607   11.569 -10.351 1.00 26.95 ? 254 ARG A CG    1 
ATOM   182  C  CD    . ARG A 1 36  ? 3.402   10.710 -10.591 1.00 28.56 ? 254 ARG A CD    1 
ATOM   183  N  NE    . ARG A 1 36  ? 2.876   10.126 -9.353  1.00 30.17 ? 254 ARG A NE    1 
ATOM   184  C  CZ    . ARG A 1 36  ? 3.090   8.876  -8.932  1.00 31.45 ? 254 ARG A CZ    1 
ATOM   185  N  NH1   . ARG A 1 36  ? 3.840   8.022  -9.630  1.00 31.68 ? 254 ARG A NH1   1 
ATOM   186  N  NH2   . ARG A 1 36  ? 2.540   8.469  -7.791  1.00 32.01 ? 254 ARG A NH2   1 
ATOM   187  N  N     . LYS A 1 37  ? 3.567   16.172 -9.367  1.00 22.85 ? 255 LYS A N     1 
ATOM   188  C  CA    . LYS A 1 37  ? 3.296   17.267 -8.435  1.00 22.03 ? 255 LYS A CA    1 
ATOM   189  C  C     . LYS A 1 37  ? 3.647   16.897 -6.996  1.00 21.56 ? 255 LYS A C     1 
ATOM   190  O  O     . LYS A 1 37  ? 2.889   17.163 -6.062  1.00 20.29 ? 255 LYS A O     1 
ATOM   191  C  CB    . LYS A 1 37  ? 1.843   17.734 -8.550  1.00 22.82 ? 255 LYS A CB    1 
ATOM   192  C  CG    . LYS A 1 37  ? 1.411   18.066 -9.982  1.00 23.22 ? 255 LYS A CG    1 
ATOM   193  C  CD    . LYS A 1 37  ? 2.202   19.232 -10.573 1.00 23.57 ? 255 LYS A CD    1 
ATOM   194  C  CE    . LYS A 1 37  ? 1.727   19.544 -11.988 1.00 23.82 ? 255 LYS A CE    1 
ATOM   195  N  NZ    . LYS A 1 37  ? 2.375   20.767 -12.559 1.00 24.09 ? 255 LYS A NZ    1 
ATOM   196  N  N     . ARG A 1 38  ? 4.811   16.274 -6.834  1.00 21.15 ? 256 ARG A N     1 
ATOM   197  C  CA    . ARG A 1 38  ? 5.355   15.964 -5.518  1.00 21.07 ? 256 ARG A CA    1 
ATOM   198  C  C     . ARG A 1 38  ? 6.878   15.964 -5.580  1.00 20.37 ? 256 ARG A C     1 
ATOM   199  O  O     . ARG A 1 38  ? 7.468   15.774 -6.642  1.00 19.21 ? 256 ARG A O     1 
ATOM   200  C  CB    . ARG A 1 38  ? 4.839   14.614 -5.028  1.00 21.74 ? 256 ARG A CB    1 
ATOM   201  C  CG    . ARG A 1 38  ? 5.423   13.441 -5.781  1.00 23.41 ? 256 ARG A CG    1 
ATOM   202  C  CD    . ARG A 1 38  ? 4.713   12.160 -5.457  1.00 24.01 ? 256 ARG A CD    1 
ATOM   203  N  NE    . ARG A 1 38  ? 5.305   11.039 -6.177  1.00 25.08 ? 256 ARG A NE    1 
ATOM   204  C  CZ    . ARG A 1 38  ? 4.892   9.779  -6.073  1.00 26.24 ? 256 ARG A CZ    1 
ATOM   205  N  NH1   . ARG A 1 38  ? 5.489   8.824  -6.771  1.00 26.45 ? 256 ARG A NH1   1 
ATOM   206  N  NH2   . ARG A 1 38  ? 3.878   9.465  -5.274  1.00 27.45 ? 256 ARG A NH2   1 
ATOM   207  N  N     . MET A 1 39  ? 7.516   16.189 -4.440  1.00 20.12 ? 257 MET A N     1 
ATOM   208  C  CA    . MET A 1 39  ? 8.968   16.286 -4.406  1.00 20.28 ? 257 MET A CA    1 
ATOM   209  C  C     . MET A 1 39  ? 9.477   16.066 -2.993  1.00 18.72 ? 257 MET A C     1 
ATOM   210  O  O     . MET A 1 39  ? 8.890   16.578 -2.029  1.00 18.68 ? 257 MET A O     1 
ATOM   211  C  CB    . MET A 1 39  ? 9.401   17.662 -4.919  1.00 21.85 ? 257 MET A CB    1 
ATOM   212  C  CG    . MET A 1 39  ? 10.886  17.834 -5.117  1.00 23.32 ? 257 MET A CG    1 
ATOM   213  S  SD    . MET A 1 39  ? 11.266  19.403 -5.927  1.00 25.39 ? 257 MET A SD    1 
ATOM   214  C  CE    . MET A 1 39  ? 11.461  18.908 -7.634  1.00 22.62 ? 257 MET A CE    1 
ATOM   215  N  N     . THR A 1 40  ? 10.554  15.295 -2.873  1.00 16.06 ? 258 THR A N     1 
ATOM   216  C  CA    . THR A 1 40  ? 11.238  15.121 -1.599  1.00 15.93 ? 258 THR A CA    1 
ATOM   217  C  C     . THR A 1 40  ? 11.881  16.440 -1.146  1.00 16.20 ? 258 THR A C     1 
ATOM   218  O  O     . THR A 1 40  ? 12.184  17.315 -1.965  1.00 16.04 ? 258 THR A O     1 
ATOM   219  C  CB    . THR A 1 40  ? 12.362  14.072 -1.696  1.00 15.58 ? 258 THR A CB    1 
ATOM   220  O  OG1   . THR A 1 40  ? 13.376  14.566 -2.582  1.00 15.81 ? 258 THR A OG1   1 
ATOM   221  C  CG2   . THR A 1 40  ? 11.825  12.728 -2.198  1.00 13.76 ? 258 THR A CG2   1 
ATOM   222  N  N     . LEU A 1 41  ? 12.104  16.572 0.159   1.00 16.38 ? 259 LEU A N     1 
ATOM   223  C  CA    . LEU A 1 41  ? 12.743  17.774 0.700   1.00 16.67 ? 259 LEU A CA    1 
ATOM   224  C  C     . LEU A 1 41  ? 14.114  18.035 0.056   1.00 16.95 ? 259 LEU A C     1 
ATOM   225  O  O     . LEU A 1 41  ? 14.397  19.163 -0.347  1.00 17.39 ? 259 LEU A O     1 
ATOM   226  C  CB    . LEU A 1 41  ? 12.878  17.684 2.223   1.00 17.00 ? 259 LEU A CB    1 
ATOM   227  C  CG    . LEU A 1 41  ? 13.521  18.866 2.972   1.00 17.05 ? 259 LEU A CG    1 
ATOM   228  C  CD1   . LEU A 1 41  ? 12.680  20.148 2.851   1.00 16.80 ? 259 LEU A CD1   1 
ATOM   229  C  CD2   . LEU A 1 41  ? 13.775  18.491 4.437   1.00 15.81 ? 259 LEU A CD2   1 
ATOM   230  N  N     . LYS A 1 42  ? 14.951  17.002 -0.056  1.00 17.05 ? 260 LYS A N     1 
ATOM   231  C  CA    . LYS A 1 42  ? 16.265  17.157 -0.678  1.00 18.07 ? 260 LYS A CA    1 
ATOM   232  C  C     . LYS A 1 42  ? 16.114  17.749 -2.066  1.00 17.95 ? 260 LYS A C     1 
ATOM   233  O  O     . LYS A 1 42  ? 16.807  18.695 -2.432  1.00 18.24 ? 260 LYS A O     1 
ATOM   234  C  CB    . LYS A 1 42  ? 16.986  15.815 -0.807  1.00 19.33 ? 260 LYS A CB    1 
ATOM   235  C  CG    . LYS A 1 42  ? 17.661  15.340 0.446   1.00 20.41 ? 260 LYS A CG    1 
ATOM   236  C  CD    . LYS A 1 42  ? 18.375  13.995 0.223   1.00 20.95 ? 260 LYS A CD    1 
ATOM   237  C  CE    . LYS A 1 42  ? 18.519  13.198 1.523   1.00 21.22 ? 260 LYS A CE    1 
ATOM   238  N  NZ    . LYS A 1 42  ? 19.084  11.831 1.292   1.00 21.92 ? 260 LYS A NZ    1 
ATOM   239  N  N     . ASP A 1 43  ? 15.198  17.184 -2.843  1.00 17.40 ? 261 ASP A N     1 
ATOM   240  C  CA    . ASP A 1 43  ? 14.993  17.655 -4.204  1.00 17.28 ? 261 ASP A CA    1 
ATOM   241  C  C     . ASP A 1 43  ? 14.513  19.095 -4.251  1.00 17.51 ? 261 ASP A C     1 
ATOM   242  O  O     . ASP A 1 43  ? 14.865  19.806 -5.180  1.00 18.81 ? 261 ASP A O     1 
ATOM   243  C  CB    . ASP A 1 43  ? 14.059  16.716 -4.968  1.00 17.56 ? 261 ASP A CB    1 
ATOM   244  C  CG    . ASP A 1 43  ? 14.749  15.430 -5.380  1.00 17.97 ? 261 ASP A CG    1 
ATOM   245  O  OD1   . ASP A 1 43  ? 15.976  15.319 -5.194  1.00 18.46 ? 261 ASP A OD1   1 
ATOM   246  O  OD2   . ASP A 1 43  ? 14.079  14.532 -5.916  1.00 18.93 ? 261 ASP A OD2   1 
ATOM   247  N  N     . ILE A 1 44  ? 13.742  19.531 -3.246  1.00 17.26 ? 262 ILE A N     1 
ATOM   248  C  CA    . ILE A 1 44  ? 13.317  20.933 -3.157  1.00 16.80 ? 262 ILE A CA    1 
ATOM   249  C  C     . ILE A 1 44  ? 14.518  21.851 -2.893  1.00 17.44 ? 262 ILE A C     1 
ATOM   250  O  O     . ILE A 1 44  ? 14.632  22.925 -3.502  1.00 17.97 ? 262 ILE A O     1 
ATOM   251  C  CB    . ILE A 1 44  ? 12.221  21.148 -2.066  1.00 17.07 ? 262 ILE A CB    1 
ATOM   252  C  CG1   . ILE A 1 44  ? 10.916  20.449 -2.463  1.00 17.35 ? 262 ILE A CG1   1 
ATOM   253  C  CG2   . ILE A 1 44  ? 11.945  22.609 -1.842  1.00 16.21 ? 262 ILE A CG2   1 
ATOM   254  C  CD1   . ILE A 1 44  ? 9.897   20.386 -1.329  1.00 16.78 ? 262 ILE A CD1   1 
ATOM   255  N  N     . TYR A 1 45  ? 15.417  21.439 -1.998  1.00 17.38 ? 263 TYR A N     1 
ATOM   256  C  CA    . TYR A 1 45  ? 16.645  22.207 -1.781  1.00 18.15 ? 263 TYR A CA    1 
ATOM   257  C  C     . TYR A 1 45  ? 17.379  22.333 -3.098  1.00 17.60 ? 263 TYR A C     1 
ATOM   258  O  O     . TYR A 1 45  ? 17.769  23.431 -3.500  1.00 17.70 ? 263 TYR A O     1 
ATOM   259  C  CB    . TYR A 1 45  ? 17.599  21.525 -0.789  1.00 18.32 ? 263 TYR A CB    1 
ATOM   260  C  CG    . TYR A 1 45  ? 17.123  21.406 0.639   1.00 18.87 ? 263 TYR A CG    1 
ATOM   261  C  CD1   . TYR A 1 45  ? 16.319  22.388 1.240   1.00 19.86 ? 263 TYR A CD1   1 
ATOM   262  C  CD2   . TYR A 1 45  ? 17.526  20.323 1.418   1.00 18.70 ? 263 TYR A CD2   1 
ATOM   263  C  CE1   . TYR A 1 45  ? 15.917  22.274 2.585   1.00 18.61 ? 263 TYR A CE1   1 
ATOM   264  C  CE2   . TYR A 1 45  ? 17.128  20.195 2.731   1.00 18.27 ? 263 TYR A CE2   1 
ATOM   265  C  CZ    . TYR A 1 45  ? 16.328  21.172 3.317   1.00 18.59 ? 263 TYR A CZ    1 
ATOM   266  O  OH    . TYR A 1 45  ? 15.965  21.011 4.647   1.00 18.58 ? 263 TYR A OH    1 
ATOM   267  N  N     . THR A 1 46  ? 17.579  21.192 -3.753  1.00 17.61 ? 264 THR A N     1 
ATOM   268  C  CA    . THR A 1 46  ? 18.311  21.129 -5.029  1.00 16.97 ? 264 THR A CA    1 
ATOM   269  C  C     . THR A 1 46  ? 17.671  21.996 -6.110  1.00 16.74 ? 264 THR A C     1 
ATOM   270  O  O     . THR A 1 46  ? 18.374  22.697 -6.842  1.00 17.98 ? 264 THR A O     1 
ATOM   271  C  CB    . THR A 1 46  ? 18.394  19.682 -5.545  1.00 16.31 ? 264 THR A CB    1 
ATOM   272  O  OG1   . THR A 1 46  ? 19.170  18.913 -4.635  1.00 15.74 ? 264 THR A OG1   1 
ATOM   273  C  CG2   . THR A 1 46  ? 19.041  19.613 -6.923  1.00 16.22 ? 264 THR A CG2   1 
ATOM   274  N  N     . TRP A 1 47  ? 16.348  21.944 -6.217  1.00 16.42 ? 265 TRP A N     1 
ATOM   275  C  CA    . TRP A 1 47  ? 15.644  22.701 -7.258  1.00 16.49 ? 265 TRP A CA    1 
ATOM   276  C  C     . TRP A 1 47  ? 15.857  24.196 -7.042  1.00 16.62 ? 265 TRP A C     1 
ATOM   277  O  O     . TRP A 1 47  ? 16.201  24.925 -7.969  1.00 17.30 ? 265 TRP A O     1 
ATOM   278  C  CB    . TRP A 1 47  ? 14.155  22.357 -7.282  1.00 16.45 ? 265 TRP A CB    1 
ATOM   279  C  CG    . TRP A 1 47  ? 13.443  22.948 -8.444  1.00 16.61 ? 265 TRP A CG    1 
ATOM   280  C  CD1   . TRP A 1 47  ? 13.163  22.331 -9.620  1.00 17.48 ? 265 TRP A CD1   1 
ATOM   281  C  CD2   . TRP A 1 47  ? 12.924  24.278 -8.555  1.00 16.25 ? 265 TRP A CD2   1 
ATOM   282  N  NE1   . TRP A 1 47  ? 12.512  23.192 -10.465 1.00 17.84 ? 265 TRP A NE1   1 
ATOM   283  C  CE2   . TRP A 1 47  ? 12.349  24.395 -9.832  1.00 17.13 ? 265 TRP A CE2   1 
ATOM   284  C  CE3   . TRP A 1 47  ? 12.897  25.382 -7.704  1.00 16.02 ? 265 TRP A CE3   1 
ATOM   285  C  CZ2   . TRP A 1 47  ? 11.757  25.576 -10.283 1.00 17.39 ? 265 TRP A CZ2   1 
ATOM   286  C  CZ3   . TRP A 1 47  ? 12.307  26.550 -8.150  1.00 16.58 ? 265 TRP A CZ3   1 
ATOM   287  C  CH2   . TRP A 1 47  ? 11.747  26.642 -9.423  1.00 17.12 ? 265 TRP A CH2   1 
ATOM   288  N  N     . ILE A 1 48  ? 15.682  24.639 -5.805  1.00 17.79 ? 266 ILE A N     1 
ATOM   289  C  CA    . ILE A 1 48  ? 15.868  26.047 -5.447  1.00 19.26 ? 266 ILE A CA    1 
ATOM   290  C  C     . ILE A 1 48  ? 17.326  26.502 -5.654  1.00 18.62 ? 266 ILE A C     1 
ATOM   291  O  O     . ILE A 1 48  ? 17.565  27.550 -6.264  1.00 17.53 ? 266 ILE A O     1 
ATOM   292  C  CB    . ILE A 1 48  ? 15.387  26.325 -3.998  1.00 19.86 ? 266 ILE A CB    1 
ATOM   293  C  CG1   . ILE A 1 48  ? 13.858  26.225 -3.940  1.00 20.75 ? 266 ILE A CG1   1 
ATOM   294  C  CG2   . ILE A 1 48  ? 15.830  27.711 -3.541  1.00 20.49 ? 266 ILE A CG2   1 
ATOM   295  C  CD1   . ILE A 1 48  ? 13.278  26.007 -2.556  1.00 20.46 ? 266 ILE A CD1   1 
ATOM   296  N  N     . GLU A 1 49  ? 18.285  25.704 -5.178  1.00 18.79 ? 267 GLU A N     1 
ATOM   297  C  CA    . GLU A 1 49  ? 19.712  25.961 -5.443  1.00 19.48 ? 267 GLU A CA    1 
ATOM   298  C  C     . GLU A 1 49  ? 19.981  26.100 -6.934  1.00 18.55 ? 267 GLU A C     1 
ATOM   299  O  O     . GLU A 1 49  ? 20.625  27.053 -7.355  1.00 16.76 ? 267 GLU A O     1 
ATOM   300  C  CB    . GLU A 1 49  ? 20.597  24.838 -4.882  1.00 20.49 ? 267 GLU A CB    1 
ATOM   301  C  CG    . GLU A 1 49  ? 20.774  24.902 -3.362  1.00 21.89 ? 267 GLU A CG    1 
ATOM   302  C  CD    . GLU A 1 49  ? 21.539  23.724 -2.796  1.00 22.17 ? 267 GLU A CD    1 
ATOM   303  O  OE1   . GLU A 1 49  ? 21.665  22.699 -3.494  1.00 23.16 ? 267 GLU A OE1   1 
ATOM   304  O  OE2   . GLU A 1 49  ? 22.008  23.822 -1.647  1.00 22.39 ? 267 GLU A OE2   1 
ATOM   305  N  N     . ASP A 1 50  ? 19.480  25.148 -7.720  1.00 18.20 ? 268 ASP A N     1 
ATOM   306  C  CA    . ASP A 1 50  ? 19.691  25.148 -9.179  1.00 18.81 ? 268 ASP A CA    1 
ATOM   307  C  C     . ASP A 1 50  ? 19.136  26.404 -9.854  1.00 17.71 ? 268 ASP A C     1 
ATOM   308  O  O     . ASP A 1 50  ? 19.768  26.963 -10.740 1.00 16.72 ? 268 ASP A O     1 
ATOM   309  C  CB    . ASP A 1 50  ? 19.043  23.914 -9.833  1.00 20.20 ? 268 ASP A CB    1 
ATOM   310  C  CG    . ASP A 1 50  ? 19.786  22.608 -9.530  1.00 21.56 ? 268 ASP A CG    1 
ATOM   311  O  OD1   . ASP A 1 50  ? 20.912  22.647 -8.984  1.00 21.68 ? 268 ASP A OD1   1 
ATOM   312  O  OD2   . ASP A 1 50  ? 19.228  21.534 -9.848  1.00 22.42 ? 268 ASP A OD2   1 
ATOM   313  N  N     . HIS A 1 51  ? 17.958  26.841 -9.423  1.00 16.98 ? 269 HIS A N     1 
ATOM   314  C  CA    . HIS A 1 51  ? 17.243  27.924 -10.096 1.00 17.20 ? 269 HIS A CA    1 
ATOM   315  C  C     . HIS A 1 51  ? 17.497  29.319 -9.523  1.00 17.89 ? 269 HIS A C     1 
ATOM   316  O  O     . HIS A 1 51  ? 17.354  30.313 -10.233 1.00 16.90 ? 269 HIS A O     1 
ATOM   317  C  CB    . HIS A 1 51  ? 15.752  27.608 -10.112 1.00 16.42 ? 269 HIS A CB    1 
ATOM   318  C  CG    . HIS A 1 51  ? 15.418  26.445 -10.990 1.00 15.97 ? 269 HIS A CG    1 
ATOM   319  N  ND1   . HIS A 1 51  ? 15.446  25.141 -10.541 1.00 15.32 ? 269 HIS A ND1   1 
ATOM   320  C  CD2   . HIS A 1 51  ? 15.095  26.387 -12.304 1.00 14.23 ? 269 HIS A CD2   1 
ATOM   321  C  CE1   . HIS A 1 51  ? 15.141  24.333 -11.542 1.00 15.35 ? 269 HIS A CE1   1 
ATOM   322  N  NE2   . HIS A 1 51  ? 14.911  25.065 -12.617 1.00 13.71 ? 269 HIS A NE2   1 
ATOM   323  N  N     . PHE A 1 52  ? 17.875  29.393 -8.251  1.00 18.13 ? 270 PHE A N     1 
ATOM   324  C  CA    . PHE A 1 52  ? 18.147  30.663 -7.617  1.00 17.86 ? 270 PHE A CA    1 
ATOM   325  C  C     . PHE A 1 52  ? 19.508  30.561 -6.937  1.00 18.05 ? 270 PHE A C     1 
ATOM   326  O  O     . PHE A 1 52  ? 19.563  30.373 -5.720  1.00 18.75 ? 270 PHE A O     1 
ATOM   327  C  CB    . PHE A 1 52  ? 17.054  30.962 -6.592  1.00 18.48 ? 270 PHE A CB    1 
ATOM   328  C  CG    . PHE A 1 52  ? 15.659  30.935 -7.153  1.00 18.76 ? 270 PHE A CG    1 
ATOM   329  C  CD1   . PHE A 1 52  ? 14.799  29.879 -6.864  1.00 19.67 ? 270 PHE A CD1   1 
ATOM   330  C  CD2   . PHE A 1 52  ? 15.193  31.957 -7.958  1.00 19.75 ? 270 PHE A CD2   1 
ATOM   331  C  CE1   . PHE A 1 52  ? 13.514  29.845 -7.371  1.00 18.48 ? 270 PHE A CE1   1 
ATOM   332  C  CE2   . PHE A 1 52  ? 13.897  31.926 -8.472  1.00 20.06 ? 270 PHE A CE2   1 
ATOM   333  C  CZ    . PHE A 1 52  ? 13.063  30.866 -8.171  1.00 19.45 ? 270 PHE A CZ    1 
ATOM   334  N  N     . PRO A 1 53  ? 20.609  30.674 -7.721  1.00 16.61 ? 271 PRO A N     1 
ATOM   335  C  CA    . PRO A 1 53  ? 21.980  30.465 -7.253  1.00 16.64 ? 271 PRO A CA    1 
ATOM   336  C  C     . PRO A 1 53  ? 22.372  31.232 -5.986  1.00 17.04 ? 271 PRO A C     1 
ATOM   337  O  O     . PRO A 1 53  ? 23.343  30.857 -5.325  1.00 16.89 ? 271 PRO A O     1 
ATOM   338  C  CB    . PRO A 1 53  ? 22.839  30.933 -8.429  1.00 16.46 ? 271 PRO A CB    1 
ATOM   339  C  CG    . PRO A 1 53  ? 21.963  30.830 -9.615  1.00 16.05 ? 271 PRO A CG    1 
ATOM   340  C  CD    . PRO A 1 53  ? 20.572  31.050 -9.146  1.00 16.33 ? 271 PRO A CD    1 
ATOM   341  N  N     . TYR A 1 54  ? 21.644  32.295 -5.664  1.00 16.48 ? 272 TYR A N     1 
ATOM   342  C  CA    . TYR A 1 54  ? 21.778  32.946 -4.369  1.00 16.78 ? 272 TYR A CA    1 
ATOM   343  C  C     . TYR A 1 54  ? 21.801  31.934 -3.214  1.00 17.04 ? 272 TYR A C     1 
ATOM   344  O  O     . TYR A 1 54  ? 22.612  32.043 -2.302  1.00 15.73 ? 272 TYR A O     1 
ATOM   345  C  CB    . TYR A 1 54  ? 20.640  33.948 -4.169  1.00 16.93 ? 272 TYR A CB    1 
ATOM   346  C  CG    . TYR A 1 54  ? 20.569  34.538 -2.777  1.00 17.10 ? 272 TYR A CG    1 
ATOM   347  C  CD1   . TYR A 1 54  ? 21.279  35.684 -2.449  1.00 16.93 ? 272 TYR A CD1   1 
ATOM   348  C  CD2   . TYR A 1 54  ? 19.787  33.946 -1.791  1.00 17.83 ? 272 TYR A CD2   1 
ATOM   349  C  CE1   . TYR A 1 54  ? 21.208  36.232 -1.181  1.00 17.46 ? 272 TYR A CE1   1 
ATOM   350  C  CE2   . TYR A 1 54  ? 19.715  34.484 -0.519  1.00 17.97 ? 272 TYR A CE2   1 
ATOM   351  C  CZ    . TYR A 1 54  ? 20.428  35.627 -0.228  1.00 18.32 ? 272 TYR A CZ    1 
ATOM   352  O  OH    . TYR A 1 54  ? 20.364  36.164 1.028   1.00 20.69 ? 272 TYR A OH    1 
ATOM   353  N  N     . PHE A 1 55  ? 20.902  30.958 -3.250  1.00 17.22 ? 273 PHE A N     1 
ATOM   354  C  CA    . PHE A 1 55  ? 20.847  29.953 -2.210  1.00 17.67 ? 273 PHE A CA    1 
ATOM   355  C  C     . PHE A 1 55  ? 21.968  28.912 -2.295  1.00 17.93 ? 273 PHE A C     1 
ATOM   356  O  O     . PHE A 1 55  ? 22.263  28.271 -1.304  1.00 19.23 ? 273 PHE A O     1 
ATOM   357  C  CB    . PHE A 1 55  ? 19.457  29.293 -2.165  1.00 18.93 ? 273 PHE A CB    1 
ATOM   358  C  CG    . PHE A 1 55  ? 18.358  30.262 -1.845  1.00 18.36 ? 273 PHE A CG    1 
ATOM   359  C  CD1   . PHE A 1 55  ? 17.544  30.766 -2.849  1.00 18.06 ? 273 PHE A CD1   1 
ATOM   360  C  CD2   . PHE A 1 55  ? 18.187  30.722 -0.552  1.00 18.84 ? 273 PHE A CD2   1 
ATOM   361  C  CE1   . PHE A 1 55  ? 16.574  31.704 -2.571  1.00 17.98 ? 273 PHE A CE1   1 
ATOM   362  C  CE2   . PHE A 1 55  ? 17.205  31.648 -0.256  1.00 18.74 ? 273 PHE A CE2   1 
ATOM   363  C  CZ    . PHE A 1 55  ? 16.399  32.146 -1.272  1.00 18.69 ? 273 PHE A CZ    1 
ATOM   364  N  N     . LYS A 1 56  ? 22.598  28.745 -3.452  1.00 18.31 ? 274 LYS A N     1 
ATOM   365  C  CA    . LYS A 1 56  ? 23.731  27.823 -3.573  1.00 18.64 ? 274 LYS A CA    1 
ATOM   366  C  C     . LYS A 1 56  ? 25.048  28.475 -3.155  1.00 19.28 ? 274 LYS A C     1 
ATOM   367  O  O     . LYS A 1 56  ? 25.940  27.782 -2.684  1.00 20.42 ? 274 LYS A O     1 
ATOM   368  C  CB    . LYS A 1 56  ? 23.821  27.247 -5.001  1.00 19.25 ? 274 LYS A CB    1 
ATOM   369  C  CG    . LYS A 1 56  ? 25.115  26.479 -5.310  1.00 19.20 ? 274 LYS A CG    1 
ATOM   370  C  CD    . LYS A 1 56  ? 24.966  25.476 -6.455  0.72 19.08 ? 274 LYS A CD    1 
ATOM   371  C  CE    . LYS A 1 56  ? 24.278  26.043 -7.692  0.48 18.25 ? 274 LYS A CE    1 
ATOM   372  N  NZ    . LYS A 1 56  ? 24.228  25.033 -8.777  1.00 16.69 ? 274 LYS A NZ    1 
ATOM   373  N  N     . HIS A 1 57  ? 25.161  29.799 -3.288  1.00 19.23 ? 275 HIS A N     1 
ATOM   374  C  CA    . HIS A 1 57  ? 26.442  30.482 -3.124  1.00 18.97 ? 275 HIS A CA    1 
ATOM   375  C  C     . HIS A 1 57  ? 26.506  31.535 -2.040  1.00 19.12 ? 275 HIS A C     1 
ATOM   376  O  O     . HIS A 1 57  ? 27.591  31.831 -1.560  1.00 20.76 ? 275 HIS A O     1 
ATOM   377  C  CB    . HIS A 1 57  ? 26.845  31.169 -4.424  1.00 19.55 ? 275 HIS A CB    1 
ATOM   378  C  CG    . HIS A 1 57  ? 27.063  30.227 -5.563  1.00 20.25 ? 275 HIS A CG    1 
ATOM   379  N  ND1   . HIS A 1 57  ? 27.950  29.176 -5.503  1.00 19.88 ? 275 HIS A ND1   1 
ATOM   380  C  CD2   . HIS A 1 57  ? 26.515  30.189 -6.800  1.00 20.60 ? 275 HIS A CD2   1 
ATOM   381  C  CE1   . HIS A 1 57  ? 27.934  28.524 -6.652  1.00 20.52 ? 275 HIS A CE1   1 
ATOM   382  N  NE2   . HIS A 1 57  ? 27.067  29.116 -7.455  1.00 20.53 ? 275 HIS A NE2   1 
ATOM   383  N  N     . ILE A 1 58  ? 25.385  32.137 -1.672  1.00 18.50 ? 276 ILE A N     1 
ATOM   384  C  CA    . ILE A 1 58  ? 25.423  33.265 -0.761  1.00 18.67 ? 276 ILE A CA    1 
ATOM   385  C  C     . ILE A 1 58  ? 24.671  33.011 0.551   1.00 19.75 ? 276 ILE A C     1 
ATOM   386  O  O     . ILE A 1 58  ? 25.261  33.131 1.628   1.00 20.66 ? 276 ILE A O     1 
ATOM   387  C  CB    . ILE A 1 58  ? 24.906  34.541 -1.450  1.00 18.09 ? 276 ILE A CB    1 
ATOM   388  C  CG1   . ILE A 1 58  ? 25.718  34.789 -2.723  1.00 18.57 ? 276 ILE A CG1   1 
ATOM   389  C  CG2   . ILE A 1 58  ? 25.026  35.732 -0.508  1.00 17.95 ? 276 ILE A CG2   1 
ATOM   390  C  CD1   . ILE A 1 58  ? 25.717  36.211 -3.187  1.00 18.75 ? 276 ILE A CD1   1 
ATOM   391  N  N     . ALA A 1 59  ? 23.392  32.653 0.464   1.00 18.91 ? 277 ALA A N     1 
ATOM   392  C  CA    . ALA A 1 59  ? 22.571  32.418 1.654   1.00 19.49 ? 277 ALA A CA    1 
ATOM   393  C  C     . ALA A 1 59  ? 23.309  31.619 2.732   1.00 20.60 ? 277 ALA A C     1 
ATOM   394  O  O     . ALA A 1 59  ? 23.951  30.610 2.440   1.00 21.02 ? 277 ALA A O     1 
ATOM   395  C  CB    . ALA A 1 59  ? 21.304  31.714 1.282   1.00 17.73 ? 277 ALA A CB    1 
ATOM   396  N  N     . LYS A 1 60  ? 23.220  32.095 3.973   1.00 21.79 ? 278 LYS A N     1 
ATOM   397  C  CA    . LYS A 1 60  ? 23.651  31.328 5.148   1.00 22.04 ? 278 LYS A CA    1 
ATOM   398  C  C     . LYS A 1 60  ? 22.913  29.993 5.211   1.00 21.14 ? 278 LYS A C     1 
ATOM   399  O  O     . LYS A 1 60  ? 21.796  29.873 4.702   1.00 20.67 ? 278 LYS A O     1 
ATOM   400  C  CB    . LYS A 1 60  ? 23.361  32.100 6.439   1.00 22.20 ? 278 LYS A CB    1 
ATOM   401  C  CG    . LYS A 1 60  ? 24.242  33.311 6.652   1.00 23.25 ? 278 LYS A CG    1 
ATOM   402  C  CD    . LYS A 1 60  ? 23.953  33.988 7.981   1.00 23.99 ? 278 LYS A CD    1 
ATOM   403  C  CE    . LYS A 1 60  ? 22.535  34.539 8.065   1.00 24.06 ? 278 LYS A CE    1 
ATOM   404  N  NZ    . LYS A 1 60  ? 22.383  35.432 9.265   1.00 24.75 ? 278 LYS A NZ    1 
ATOM   405  N  N     . PRO A 1 61  ? 23.526  28.989 5.851   1.00 20.23 ? 279 PRO A N     1 
ATOM   406  C  CA    . PRO A 1 61  ? 22.918  27.656 5.992   1.00 20.38 ? 279 PRO A CA    1 
ATOM   407  C  C     . PRO A 1 61  ? 21.428  27.607 6.426   1.00 19.32 ? 279 PRO A C     1 
ATOM   408  O  O     . PRO A 1 61  ? 20.695  26.727 5.987   1.00 21.96 ? 279 PRO A O     1 
ATOM   409  C  CB    . PRO A 1 61  ? 23.791  26.996 7.050   1.00 19.94 ? 279 PRO A CB    1 
ATOM   410  C  CG    . PRO A 1 61  ? 25.119  27.655 6.911   1.00 20.30 ? 279 PRO A CG    1 
ATOM   411  C  CD    . PRO A 1 61  ? 24.899  29.033 6.381   1.00 20.13 ? 279 PRO A CD    1 
ATOM   412  N  N     . GLY A 1 62  ? 20.985  28.537 7.259   1.00 17.92 ? 280 GLY A N     1 
ATOM   413  C  CA    . GLY A 1 62  ? 19.612  28.534 7.778   1.00 16.54 ? 280 GLY A CA    1 
ATOM   414  C  C     . GLY A 1 62  ? 18.472  28.668 6.773   1.00 16.85 ? 280 GLY A C     1 
ATOM   415  O  O     . GLY A 1 62  ? 17.295  28.526 7.142   1.00 16.30 ? 280 GLY A O     1 
ATOM   416  N  N     . TRP A 1 63  ? 18.774  28.935 5.508   1.00 15.56 ? 281 TRP A N     1 
ATOM   417  C  CA    . TRP A 1 63  ? 17.696  29.032 4.537   1.00 17.49 ? 281 TRP A CA    1 
ATOM   418  C  C     . TRP A 1 63  ? 16.930  27.694 4.459   1.00 17.35 ? 281 TRP A C     1 
ATOM   419  O  O     . TRP A 1 63  ? 15.735  27.672 4.201   1.00 16.15 ? 281 TRP A O     1 
ATOM   420  C  CB    . TRP A 1 63  ? 18.206  29.480 3.160   1.00 18.10 ? 281 TRP A CB    1 
ATOM   421  C  CG    . TRP A 1 63  ? 18.986  28.444 2.380   1.00 19.06 ? 281 TRP A CG    1 
ATOM   422  C  CD1   . TRP A 1 63  ? 20.331  28.218 2.432   1.00 19.81 ? 281 TRP A CD1   1 
ATOM   423  C  CD2   . TRP A 1 63  ? 18.467  27.528 1.415   1.00 19.83 ? 281 TRP A CD2   1 
ATOM   424  N  NE1   . TRP A 1 63  ? 20.685  27.205 1.570   1.00 20.02 ? 281 TRP A NE1   1 
ATOM   425  C  CE2   . TRP A 1 63  ? 19.558  26.772 0.922   1.00 21.37 ? 281 TRP A CE2   1 
ATOM   426  C  CE3   . TRP A 1 63  ? 17.193  27.283 0.902   1.00 20.23 ? 281 TRP A CE3   1 
ATOM   427  C  CZ2   . TRP A 1 63  ? 19.406  25.780 -0.058  1.00 21.24 ? 281 TRP A CZ2   1 
ATOM   428  C  CZ3   . TRP A 1 63  ? 17.040  26.294 -0.058  1.00 21.02 ? 281 TRP A CZ3   1 
ATOM   429  C  CH2   . TRP A 1 63  ? 18.142  25.546 -0.523  1.00 21.33 ? 281 TRP A CH2   1 
ATOM   430  N  N     . LYS A 1 64  ? 17.641  26.594 4.681   1.00 15.96 ? 282 LYS A N     1 
ATOM   431  C  CA    . LYS A 1 64  ? 17.054  25.272 4.652   1.00 15.10 ? 282 LYS A CA    1 
ATOM   432  C  C     . LYS A 1 64  ? 16.114  25.056 5.834   1.00 14.37 ? 282 LYS A C     1 
ATOM   433  O  O     . LYS A 1 64  ? 15.083  24.435 5.677   1.00 14.54 ? 282 LYS A O     1 
ATOM   434  C  CB    . LYS A 1 64  ? 18.155  24.205 4.674   1.00 15.63 ? 282 LYS A CB    1 
ATOM   435  C  CG    . LYS A 1 64  ? 18.905  24.082 3.359   1.00 15.84 ? 282 LYS A CG    1 
ATOM   436  C  CD    . LYS A 1 64  ? 19.931  22.938 3.383   1.00 14.66 ? 282 LYS A CD    1 
ATOM   437  C  CE    . LYS A 1 64  ? 20.617  22.777 2.020   1.00 14.35 ? 282 LYS A CE    1 
ATOM   438  N  NZ    . LYS A 1 64  ? 21.611  21.640 2.010   1.00 14.34 ? 282 LYS A NZ    1 
ATOM   439  N  N     . ASN A 1 65  ? 16.493  25.550 7.006   1.00 13.76 ? 283 ASN A N     1 
ATOM   440  C  CA    . ASN A 1 65  ? 15.612  25.595 8.172   1.00 17.20 ? 283 ASN A CA    1 
ATOM   441  C  C     . ASN A 1 65  ? 14.317  26.339 7.794   1.00 16.99 ? 283 ASN A C     1 
ATOM   442  O  O     . ASN A 1 65  ? 13.214  25.880 8.107   1.00 17.26 ? 283 ASN A O     1 
ATOM   443  C  CB    . ASN A 1 65  ? 16.365  26.268 9.347   1.00 18.24 ? 283 ASN A CB    1 
ATOM   444  C  CG    . ASN A 1 65  ? 15.571  26.314 10.656  1.00 20.06 ? 283 ASN A CG    1 
ATOM   445  O  OD1   . ASN A 1 65  ? 14.368  26.064 10.697  1.00 21.63 ? 283 ASN A OD1   1 
ATOM   446  N  ND2   . ASN A 1 65  ? 16.267  26.663 11.755  1.00 21.23 ? 283 ASN A ND2   1 
ATOM   447  N  N     . SER A 1 66  ? 14.464  27.444 7.065   1.00 15.78 ? 284 SER A N     1 
ATOM   448  C  CA    . SER A 1 66  ? 13.325  28.258 6.678   1.00 17.13 ? 284 SER A CA    1 
ATOM   449  C  C     . SER A 1 66  ? 12.415  27.513 5.702   1.00 18.42 ? 284 SER A C     1 
ATOM   450  O  O     . SER A 1 66  ? 11.201  27.646 5.780   1.00 17.46 ? 284 SER A O     1 
ATOM   451  C  CB    . SER A 1 66  ? 13.778  29.604 6.097   1.00 16.08 ? 284 SER A CB    1 
ATOM   452  O  OG    . SER A 1 66  ? 14.400  30.404 7.097   1.00 14.93 ? 284 SER A OG    1 
ATOM   453  N  N     . ILE A 1 67  ? 12.994  26.719 4.802   1.00 19.22 ? 285 ILE A N     1 
ATOM   454  C  CA    . ILE A 1 67  ? 12.186  25.866 3.921   1.00 18.81 ? 285 ILE A CA    1 
ATOM   455  C  C     . ILE A 1 67  ? 11.354  24.887 4.756   1.00 19.45 ? 285 ILE A C     1 
ATOM   456  O  O     . ILE A 1 67  ? 10.152  24.747 4.530   1.00 20.43 ? 285 ILE A O     1 
ATOM   457  C  CB    . ILE A 1 67  ? 13.058  25.068 2.933   1.00 18.68 ? 285 ILE A CB    1 
ATOM   458  C  CG1   . ILE A 1 67  ? 13.658  25.991 1.861   1.00 19.05 ? 285 ILE A CG1   1 
ATOM   459  C  CG2   . ILE A 1 67  ? 12.264  23.919 2.287   1.00 17.72 ? 285 ILE A CG2   1 
ATOM   460  C  CD1   . ILE A 1 67  ? 12.628  26.627 0.907   1.00 18.94 ? 285 ILE A CD1   1 
ATOM   461  N  N     . ARG A 1 68  ? 11.979  24.229 5.734   1.00 17.62 ? 286 ARG A N     1 
ATOM   462  C  CA    . ARG A 1 68  ? 11.270  23.215 6.506   1.00 16.82 ? 286 ARG A CA    1 
ATOM   463  C  C     . ARG A 1 68  ? 10.166  23.870 7.348   1.00 16.28 ? 286 ARG A C     1 
ATOM   464  O  O     . ARG A 1 68  ? 9.079   23.323 7.481   1.00 16.40 ? 286 ARG A O     1 
ATOM   465  C  CB    . ARG A 1 68  ? 12.232  22.408 7.398   1.00 16.61 ? 286 ARG A CB    1 
ATOM   466  C  CG    . ARG A 1 68  ? 13.279  21.588 6.598   1.00 16.51 ? 286 ARG A CG    1 
ATOM   467  C  CD    . ARG A 1 68  ? 13.948  20.547 7.473   1.00 15.95 ? 286 ARG A CD    1 
ATOM   468  N  NE    . ARG A 1 68  ? 14.602  21.136 8.635   1.00 15.78 ? 286 ARG A NE    1 
ATOM   469  C  CZ    . ARG A 1 68  ? 15.758  21.799 8.609   1.00 16.43 ? 286 ARG A CZ    1 
ATOM   470  N  NH1   . ARG A 1 68  ? 16.417  22.012 7.483   1.00 16.36 ? 286 ARG A NH1   1 
ATOM   471  N  NH2   . ARG A 1 68  ? 16.246  22.291 9.726   1.00 17.95 ? 286 ARG A NH2   1 
ATOM   472  N  N     . HIS A 1 69  ? 10.479  25.026 7.925   1.00 14.88 ? 287 HIS A N     1 
ATOM   473  C  CA    . HIS A 1 69  ? 9.513   25.850 8.650   1.00 14.43 ? 287 HIS A CA    1 
ATOM   474  C  C     . HIS A 1 69  ? 8.270   26.153 7.807   1.00 15.40 ? 287 HIS A C     1 
ATOM   475  O  O     . HIS A 1 69  ? 7.140   25.989 8.295   1.00 14.05 ? 287 HIS A O     1 
ATOM   476  C  CB    . HIS A 1 69  ? 10.189  27.148 9.101   1.00 13.49 ? 287 HIS A CB    1 
ATOM   477  C  CG    . HIS A 1 69  ? 9.256   28.165 9.670   1.00 12.23 ? 287 HIS A CG    1 
ATOM   478  N  ND1   . HIS A 1 69  ? 8.824   28.135 10.979  1.00 12.61 ? 287 HIS A ND1   1 
ATOM   479  C  CD2   . HIS A 1 69  ? 8.674   29.250 9.105   1.00 12.18 ? 287 HIS A CD2   1 
ATOM   480  C  CE1   . HIS A 1 69  ? 8.020   29.161 11.197  1.00 13.02 ? 287 HIS A CE1   1 
ATOM   481  N  NE2   . HIS A 1 69  ? 7.912   29.854 10.076  1.00 13.09 ? 287 HIS A NE2   1 
ATOM   482  N  N     . ASN A 1 70  ? 8.483   26.596 6.565   1.00 15.41 ? 288 ASN A N     1 
ATOM   483  C  CA    . ASN A 1 70  ? 7.376   26.877 5.637   1.00 17.75 ? 288 ASN A CA    1 
ATOM   484  C  C     . ASN A 1 70  ? 6.534   25.656 5.257   1.00 18.43 ? 288 ASN A C     1 
ATOM   485  O  O     . ASN A 1 70  ? 5.309   25.745 5.180   1.00 17.81 ? 288 ASN A O     1 
ATOM   486  C  CB    . ASN A 1 70  ? 7.874   27.558 4.366   1.00 16.78 ? 288 ASN A CB    1 
ATOM   487  C  CG    . ASN A 1 70  ? 8.011   29.041 4.544   1.00 17.48 ? 288 ASN A CG    1 
ATOM   488  O  OD1   . ASN A 1 70  ? 7.090   29.781 4.213   1.00 17.35 ? 288 ASN A OD1   1 
ATOM   489  N  ND2   . ASN A 1 70  ? 9.151   29.494 5.126   1.00 16.70 ? 288 ASN A ND2   1 
ATOM   490  N  N     . LEU A 1 71  ? 7.206   24.535 5.014   1.00 17.72 ? 289 LEU A N     1 
ATOM   491  C  CA    . LEU A 1 71  ? 6.527   23.275 4.780   1.00 17.57 ? 289 LEU A CA    1 
ATOM   492  C  C     . LEU A 1 71  ? 5.555   22.904 5.898   1.00 17.17 ? 289 LEU A C     1 
ATOM   493  O  O     . LEU A 1 71  ? 4.417   22.544 5.611   1.00 16.62 ? 289 LEU A O     1 
ATOM   494  C  CB    . LEU A 1 71  ? 7.539   22.156 4.536   1.00 17.73 ? 289 LEU A CB    1 
ATOM   495  C  CG    . LEU A 1 71  ? 8.277   22.274 3.191   1.00 18.08 ? 289 LEU A CG    1 
ATOM   496  C  CD1   . LEU A 1 71  ? 9.391   21.240 3.132   1.00 17.12 ? 289 LEU A CD1   1 
ATOM   497  C  CD2   . LEU A 1 71  ? 7.331   22.148 2.001   1.00 15.11 ? 289 LEU A CD2   1 
ATOM   498  N  N     . SER A 1 72  ? 5.995   23.011 7.154   1.00 16.97 ? 290 SER A N     1 
ATOM   499  C  CA    . SER A 1 72  ? 5.137   22.724 8.309   1.00 17.94 ? 290 SER A CA    1 
ATOM   500  C  C     . SER A 1 72  ? 4.098   23.806 8.590   1.00 17.49 ? 290 SER A C     1 
ATOM   501  O  O     . SER A 1 72  ? 2.969   23.497 8.972   1.00 17.83 ? 290 SER A O     1 
ATOM   502  C  CB    . SER A 1 72  ? 5.974   22.510 9.572   1.00 18.45 ? 290 SER A CB    1 
ATOM   503  O  OG    . SER A 1 72  ? 6.717   21.314 9.466   1.00 20.68 ? 290 SER A OG    1 
ATOM   504  N  N     . LEU A 1 73  ? 4.479   25.063 8.397   1.00 17.31 ? 291 LEU A N     1 
ATOM   505  C  CA    . LEU A 1 73  ? 3.614   26.197 8.717   1.00 17.50 ? 291 LEU A CA    1 
ATOM   506  C  C     . LEU A 1 73  ? 2.370   26.258 7.842   1.00 15.83 ? 291 LEU A C     1 
ATOM   507  O  O     . LEU A 1 73  ? 1.289   26.463 8.341   1.00 13.79 ? 291 LEU A O     1 
ATOM   508  C  CB    . LEU A 1 73  ? 4.385   27.520 8.571   1.00 18.39 ? 291 LEU A CB    1 
ATOM   509  C  CG    . LEU A 1 73  ? 3.640   28.811 8.937   1.00 19.96 ? 291 LEU A CG    1 
ATOM   510  C  CD1   . LEU A 1 73  ? 3.056   28.689 10.324  1.00 19.51 ? 291 LEU A CD1   1 
ATOM   511  C  CD2   . LEU A 1 73  ? 4.565   30.043 8.836   1.00 20.48 ? 291 LEU A CD2   1 
ATOM   512  N  N     . HIS A 1 74  ? 2.552   26.116 6.535   1.00 15.34 ? 292 HIS A N     1 
ATOM   513  C  CA    . HIS A 1 74  ? 1.480   26.321 5.582   1.00 15.59 ? 292 HIS A CA    1 
ATOM   514  C  C     . HIS A 1 74  ? 0.727   25.032 5.299   1.00 15.24 ? 292 HIS A C     1 
ATOM   515  O  O     . HIS A 1 74  ? 1.315   24.037 4.869   1.00 13.72 ? 292 HIS A O     1 
ATOM   516  C  CB    . HIS A 1 74  ? 2.038   26.898 4.288   1.00 15.91 ? 292 HIS A CB    1 
ATOM   517  C  CG    . HIS A 1 74  ? 2.696   28.226 4.472   1.00 17.65 ? 292 HIS A CG    1 
ATOM   518  N  ND1   . HIS A 1 74  ? 1.985   29.371 4.775   1.00 17.57 ? 292 HIS A ND1   1 
ATOM   519  C  CD2   . HIS A 1 74  ? 3.998   28.594 4.416   1.00 17.05 ? 292 HIS A CD2   1 
ATOM   520  C  CE1   . HIS A 1 74  ? 2.819   30.389 4.884   1.00 17.25 ? 292 HIS A CE1   1 
ATOM   521  N  NE2   . HIS A 1 74  ? 4.046   29.947 4.661   1.00 17.45 ? 292 HIS A NE2   1 
ATOM   522  N  N     . ASP A 1 75  ? -0.584  25.069 5.529   1.00 15.53 ? 293 ASP A N     1 
ATOM   523  C  CA    . ASP A 1 75  ? -1.441  23.894 5.327   1.00 15.94 ? 293 ASP A CA    1 
ATOM   524  C  C     . ASP A 1 75  ? -1.565  23.463 3.862   1.00 15.15 ? 293 ASP A C     1 
ATOM   525  O  O     . ASP A 1 75  ? -1.939  22.341 3.590   1.00 14.33 ? 293 ASP A O     1 
ATOM   526  C  CB    . ASP A 1 75  ? -2.818  24.122 5.957   1.00 16.67 ? 293 ASP A CB    1 
ATOM   527  C  CG    . ASP A 1 75  ? -2.773  24.071 7.476   1.00 18.32 ? 293 ASP A CG    1 
ATOM   528  O  OD1   . ASP A 1 75  ? -1.805  23.491 8.026   1.00 20.29 ? 293 ASP A OD1   1 
ATOM   529  O  OD2   . ASP A 1 75  ? -3.691  24.615 8.120   1.00 17.71 ? 293 ASP A OD2   1 
ATOM   530  N  N     . MET A 1 76  ? -1.212  24.331 2.925   1.00 16.46 ? 294 MET A N     1 
ATOM   531  C  CA    . MET A 1 76  ? -1.167  23.933 1.517   1.00 18.24 ? 294 MET A CA    1 
ATOM   532  C  C     . MET A 1 76  ? -0.078  22.899 1.213   1.00 17.69 ? 294 MET A C     1 
ATOM   533  O  O     . MET A 1 76  ? -0.182  22.173 0.233   1.00 17.16 ? 294 MET A O     1 
ATOM   534  C  CB    . MET A 1 76  ? -1.014  25.142 0.590   1.00 20.37 ? 294 MET A CB    1 
ATOM   535  C  CG    . MET A 1 76  ? 0.281   25.933 0.719   1.00 22.52 ? 294 MET A CG    1 
ATOM   536  S  SD    . MET A 1 76  ? 0.511   27.000 -0.746  1.00 26.63 ? 294 MET A SD    1 
ATOM   537  C  CE    . MET A 1 76  ? 0.223   25.847 -2.073  1.00 25.21 ? 294 MET A CE    1 
ATOM   538  N  N     . PHE A 1 77  ? 0.960   22.833 2.038   1.00 17.33 ? 295 PHE A N     1 
ATOM   539  C  CA    . PHE A 1 77  ? 2.007   21.831 1.847   1.00 16.96 ? 295 PHE A CA    1 
ATOM   540  C  C     . PHE A 1 77  ? 1.697   20.630 2.713   1.00 17.43 ? 295 PHE A C     1 
ATOM   541  O  O     . PHE A 1 77  ? 1.687   20.725 3.955   1.00 16.57 ? 295 PHE A O     1 
ATOM   542  C  CB    . PHE A 1 77  ? 3.383   22.394 2.154   1.00 16.76 ? 295 PHE A CB    1 
ATOM   543  C  CG    . PHE A 1 77  ? 3.731   23.596 1.325   1.00 17.75 ? 295 PHE A CG    1 
ATOM   544  C  CD1   . PHE A 1 77  ? 4.200   24.762 1.927   1.00 17.36 ? 295 PHE A CD1   1 
ATOM   545  C  CD2   . PHE A 1 77  ? 3.569   23.576 -0.062  1.00 17.39 ? 295 PHE A CD2   1 
ATOM   546  C  CE1   . PHE A 1 77  ? 4.518   25.866 1.172   1.00 17.20 ? 295 PHE A CE1   1 
ATOM   547  C  CE2   . PHE A 1 77  ? 3.894   24.685 -0.826  1.00 18.08 ? 295 PHE A CE2   1 
ATOM   548  C  CZ    . PHE A 1 77  ? 4.362   25.837 -0.207  1.00 17.48 ? 295 PHE A CZ    1 
ATOM   549  N  N     . VAL A 1 78  ? 1.414   19.515 2.033   1.00 17.06 ? 296 VAL A N     1 
ATOM   550  C  CA    . VAL A 1 78  ? 0.965   18.290 2.671   1.00 17.05 ? 296 VAL A CA    1 
ATOM   551  C  C     . VAL A 1 78  ? 1.997   17.199 2.426   1.00 18.96 ? 296 VAL A C     1 
ATOM   552  O  O     . VAL A 1 78  ? 2.443   16.964 1.301   1.00 19.30 ? 296 VAL A O     1 
ATOM   553  C  CB    . VAL A 1 78  ? -0.427  17.838 2.137   1.00 16.75 ? 296 VAL A CB    1 
ATOM   554  C  CG1   . VAL A 1 78  ? -0.856  16.485 2.765   1.00 13.65 ? 296 VAL A CG1   1 
ATOM   555  C  CG2   . VAL A 1 78  ? -1.488  18.930 2.392   1.00 15.83 ? 296 VAL A CG2   1 
ATOM   556  N  N     . ARG A 1 79  ? 2.365   16.526 3.497   1.00 20.80 ? 297 ARG A N     1 
ATOM   557  C  CA    . ARG A 1 79  ? 3.338   15.461 3.434   1.00 22.97 ? 297 ARG A CA    1 
ATOM   558  C  C     . ARG A 1 79  ? 2.658   14.129 3.089   1.00 24.41 ? 297 ARG A C     1 
ATOM   559  O  O     . ARG A 1 79  ? 1.652   13.780 3.678   1.00 24.87 ? 297 ARG A O     1 
ATOM   560  C  CB    . ARG A 1 79  ? 4.032   15.382 4.780   1.00 23.25 ? 297 ARG A CB    1 
ATOM   561  C  CG    . ARG A 1 79  ? 5.262   14.565 4.777   1.00 24.02 ? 297 ARG A CG    1 
ATOM   562  C  CD    . ARG A 1 79  ? 5.975   14.719 6.075   1.00 24.88 ? 297 ARG A CD    1 
ATOM   563  N  NE    . ARG A 1 79  ? 6.756   13.533 6.349   1.00 26.02 ? 297 ARG A NE    1 
ATOM   564  C  CZ    . ARG A 1 79  ? 6.264   12.421 6.869   1.00 26.86 ? 297 ARG A CZ    1 
ATOM   565  N  NH1   . ARG A 1 79  ? 4.976   12.330 7.189   1.00 27.45 ? 297 ARG A NH1   1 
ATOM   566  N  NH2   . ARG A 1 79  ? 7.071   11.391 7.068   1.00 27.62 ? 297 ARG A NH2   1 
ATOM   567  N  N     . GLU A 1 80  ? 3.203   13.411 2.111   1.00 27.04 ? 298 GLU A N     1 
ATOM   568  C  CA    . GLU A 1 80  ? 2.696   12.105 1.707   1.00 29.53 ? 298 GLU A CA    1 
ATOM   569  C  C     . GLU A 1 80  ? 3.808   11.077 1.817   1.00 30.69 ? 298 GLU A C     1 
ATOM   570  O  O     . GLU A 1 80  ? 4.831   11.194 1.140   1.00 30.89 ? 298 GLU A O     1 
ATOM   571  C  CB    . GLU A 1 80  ? 2.202   12.141 0.261   1.00 30.99 ? 298 GLU A CB    1 
ATOM   572  C  CG    . GLU A 1 80  ? 0.837   12.764 0.090   1.00 32.44 ? 298 GLU A CG    1 
ATOM   573  C  CD    . GLU A 1 80  ? 0.216   12.478 -1.270  1.00 33.68 ? 298 GLU A CD    1 
ATOM   574  O  OE1   . GLU A 1 80  ? 0.957   12.142 -2.229  1.00 33.77 ? 298 GLU A OE1   1 
ATOM   575  O  OE2   . GLU A 1 80  ? -1.029  12.596 -1.369  1.00 34.87 ? 298 GLU A OE2   1 
ATOM   576  N  N     . THR A 1 81  ? 3.616   10.080 2.672   1.00 31.62 ? 299 THR A N     1 
ATOM   577  C  CA    . THR A 1 81  ? 4.586   9.003  2.808   1.00 32.94 ? 299 THR A CA    1 
ATOM   578  C  C     . THR A 1 81  ? 4.223   7.851  1.879   1.00 33.49 ? 299 THR A C     1 
ATOM   579  O  O     . THR A 1 81  ? 3.060   7.457  1.777   1.00 33.81 ? 299 THR A O     1 
ATOM   580  C  CB    . THR A 1 81  ? 4.713   8.506  4.262   1.00 33.33 ? 299 THR A CB    1 
ATOM   581  O  OG1   . THR A 1 81  ? 3.414   8.257  4.815   1.00 33.71 ? 299 THR A OG1   1 
ATOM   582  C  CG2   . THR A 1 81  ? 5.445   9.546  5.109   1.00 33.62 ? 299 THR A CG2   1 
ATOM   583  N  N     . SER A 1 82  ? 5.241   7.321  1.207   1.00 34.20 ? 300 SER A N     1 
ATOM   584  C  CA    . SER A 1 82  ? 5.064   6.319  0.162   1.00 34.72 ? 300 SER A CA    1 
ATOM   585  C  C     . SER A 1 82  ? 4.553   4.989  0.711   1.00 34.48 ? 300 SER A C     1 
ATOM   586  O  O     . SER A 1 82  ? 4.742   4.672  1.889   1.00 34.19 ? 300 SER A O     1 
ATOM   587  C  CB    . SER A 1 82  ? 6.390   6.102  -0.574  1.00 34.98 ? 300 SER A CB    1 
ATOM   588  O  OG    . SER A 1 82  ? 6.218   5.259  -1.696  1.00 35.92 ? 300 SER A OG    1 
ATOM   589  N  N     . ALA A 1 83  ? 3.923   4.210  -0.169  1.00 34.91 ? 301 ALA A N     1 
ATOM   590  C  CA    . ALA A 1 83  ? 3.361   2.897  0.176   1.00 34.85 ? 301 ALA A CA    1 
ATOM   591  C  C     . ALA A 1 83  ? 4.373   1.944  0.817   1.00 35.16 ? 301 ALA A C     1 
ATOM   592  O  O     . ALA A 1 83  ? 3.984   0.958  1.435   1.00 35.53 ? 301 ALA A O     1 
ATOM   593  C  CB    . ALA A 1 83  ? 2.759   2.249  -1.064  1.00 34.58 ? 301 ALA A CB    1 
ATOM   594  N  N     . ASN A 1 84  ? 5.662   2.258  0.678   1.00 35.81 ? 302 ASN A N     1 
ATOM   595  C  CA    . ASN A 1 84  ? 6.759   1.391  1.135   1.00 35.91 ? 302 ASN A CA    1 
ATOM   596  C  C     . ASN A 1 84  ? 6.875   1.259  2.646   1.00 35.95 ? 302 ASN A C     1 
ATOM   597  O  O     . ASN A 1 84  ? 7.007   0.153  3.170   1.00 36.33 ? 302 ASN A O     1 
ATOM   598  C  CB    . ASN A 1 84  ? 8.120   1.878  0.594   1.00 35.95 ? 302 ASN A CB    1 
ATOM   599  C  CG    . ASN A 1 84  ? 7.998   2.712  -0.671  1.00 35.92 ? 302 ASN A CG    1 
ATOM   600  O  OD1   . ASN A 1 84  ? 7.226   2.387  -1.574  1.00 35.97 ? 302 ASN A OD1   1 
ATOM   601  N  ND2   . ASN A 1 84  ? 8.758   3.802  -0.734  1.00 35.84 ? 302 ASN A ND2   1 
ATOM   602  N  N     . GLY A 1 85  ? 6.836   2.391  3.337   1.00 36.02 ? 303 GLY A N     1 
ATOM   603  C  CA    . GLY A 1 85  ? 7.177   2.432  4.746   1.00 35.71 ? 303 GLY A CA    1 
ATOM   604  C  C     . GLY A 1 85  ? 8.680   2.560  4.959   1.00 35.43 ? 303 GLY A C     1 
ATOM   605  O  O     . GLY A 1 85  ? 9.300   1.600  5.403   1.00 35.53 ? 303 GLY A O     1 
ATOM   606  N  N     . LYS A 1 86  ? 9.301   3.703  4.648   1.00 35.04 ? 304 LYS A N     1 
ATOM   607  C  CA    . LYS A 1 86  ? 8.661   4.898  4.096   1.00 34.76 ? 304 LYS A CA    1 
ATOM   608  C  C     . LYS A 1 86  ? 9.651   5.730  3.263   1.00 34.05 ? 304 LYS A C     1 
ATOM   609  O  O     . LYS A 1 86  ? 10.847  5.782  3.556   1.00 34.10 ? 304 LYS A O     1 
ATOM   610  C  CB    . LYS A 1 86  ? 8.116   5.791  5.225   1.00 35.53 ? 304 LYS A CB    1 
ATOM   611  C  CG    . LYS A 1 86  ? 6.824   5.305  5.864   1.00 36.19 ? 304 LYS A CG    1 
ATOM   612  C  CD    . LYS A 1 86  ? 6.150   6.330  6.761   1.00 36.61 ? 304 LYS A CD    1 
ATOM   613  C  CE    . LYS A 1 86  ? 4.736   5.852  7.123   1.00 36.89 ? 304 LYS A CE    1 
ATOM   614  N  NZ    . LYS A 1 86  ? 4.006   6.789  8.022   1.00 37.16 ? 304 LYS A NZ    1 
ATOM   615  N  N     . VAL A 1 87  ? 9.132   6.369  2.219   1.00 32.88 ? 305 VAL A N     1 
ATOM   616  C  CA    . VAL A 1 87  ? 9.789   7.501  1.563   1.00 31.38 ? 305 VAL A CA    1 
ATOM   617  C  C     . VAL A 1 87  ? 8.744   8.606  1.526   1.00 29.93 ? 305 VAL A C     1 
ATOM   618  O  O     . VAL A 1 87  ? 7.576   8.333  1.261   1.00 29.45 ? 305 VAL A O     1 
ATOM   619  C  CB    . VAL A 1 87  ? 10.224  7.160  0.134   1.00 31.43 ? 305 VAL A CB    1 
ATOM   620  C  CG1   . VAL A 1 87  ? 10.910  8.362  -0.513  1.00 31.30 ? 305 VAL A CG1   1 
ATOM   621  C  CG2   . VAL A 1 87  ? 11.136  5.937  0.137   1.00 31.50 ? 305 VAL A CG2   1 
ATOM   622  N  N     . SER A 1 88  ? 9.126   9.846  1.805   1.00 28.62 ? 306 SER A N     1 
ATOM   623  C  CA    . SER A 1 88  ? 8.109   10.884 1.949   1.00 27.05 ? 306 SER A CA    1 
ATOM   624  C  C     . SER A 1 88  ? 8.308   12.048 0.990   1.00 25.35 ? 306 SER A C     1 
ATOM   625  O  O     . SER A 1 88  ? 9.424   12.525 0.796   1.00 26.26 ? 306 SER A O     1 
ATOM   626  C  CB    . SER A 1 88  ? 8.008   11.345 3.406   1.00 27.65 ? 306 SER A CB    1 
ATOM   627  O  OG    . SER A 1 88  ? 8.680   12.562 3.644   1.00 28.83 ? 306 SER A OG    1 
ATOM   628  N  N     . PHE A 1 89  ? 7.207   12.481 0.380   1.00 22.93 ? 307 PHE A N     1 
ATOM   629  C  CA    . PHE A 1 89  ? 7.206   13.597 -0.553  1.00 21.25 ? 307 PHE A CA    1 
ATOM   630  C  C     . PHE A 1 89  ? 6.393   14.741 0.022   1.00 19.43 ? 307 PHE A C     1 
ATOM   631  O  O     . PHE A 1 89  ? 5.467   14.530 0.798   1.00 18.73 ? 307 PHE A O     1 
ATOM   632  C  CB    . PHE A 1 89  ? 6.566   13.191 -1.882  1.00 21.91 ? 307 PHE A CB    1 
ATOM   633  C  CG    . PHE A 1 89  ? 7.242   12.035 -2.573  1.00 21.72 ? 307 PHE A CG    1 
ATOM   634  C  CD1   . PHE A 1 89  ? 8.168   12.256 -3.585  1.00 21.89 ? 307 PHE A CD1   1 
ATOM   635  C  CD2   . PHE A 1 89  ? 6.932   10.725 -2.231  1.00 21.99 ? 307 PHE A CD2   1 
ATOM   636  C  CE1   . PHE A 1 89  ? 8.788   11.180 -4.241  1.00 21.58 ? 307 PHE A CE1   1 
ATOM   637  C  CE2   . PHE A 1 89  ? 7.549   9.645  -2.880  1.00 21.83 ? 307 PHE A CE2   1 
ATOM   638  C  CZ    . PHE A 1 89  ? 8.479   9.881  -3.883  1.00 21.36 ? 307 PHE A CZ    1 
ATOM   639  N  N     . TRP A 1 90  ? 6.746   15.951 -0.379  1.00 18.22 ? 308 TRP A N     1 
ATOM   640  C  CA    . TRP A 1 90  ? 5.932   17.122 -0.125  1.00 17.23 ? 308 TRP A CA    1 
ATOM   641  C  C     . TRP A 1 90  ? 5.092   17.393 -1.355  1.00 17.16 ? 308 TRP A C     1 
ATOM   642  O  O     . TRP A 1 90  ? 5.576   17.303 -2.488  1.00 17.43 ? 308 TRP A O     1 
ATOM   643  C  CB    . TRP A 1 90  ? 6.792   18.323 0.247   1.00 16.99 ? 308 TRP A CB    1 
ATOM   644  C  CG    . TRP A 1 90  ? 7.313   18.200 1.665   1.00 17.27 ? 308 TRP A CG    1 
ATOM   645  C  CD1   . TRP A 1 90  ? 8.541   17.762 2.045   1.00 17.11 ? 308 TRP A CD1   1 
ATOM   646  C  CD2   . TRP A 1 90  ? 6.591   18.472 2.875   1.00 17.12 ? 308 TRP A CD2   1 
ATOM   647  N  NE1   . TRP A 1 90  ? 8.643   17.764 3.416   1.00 17.28 ? 308 TRP A NE1   1 
ATOM   648  C  CE2   . TRP A 1 90  ? 7.463   18.201 3.950   1.00 17.59 ? 308 TRP A CE2   1 
ATOM   649  C  CE3   . TRP A 1 90  ? 5.307   18.953 3.150   1.00 17.21 ? 308 TRP A CE3   1 
ATOM   650  C  CZ2   . TRP A 1 90  ? 7.088   18.374 5.278   1.00 18.07 ? 308 TRP A CZ2   1 
ATOM   651  C  CZ3   . TRP A 1 90  ? 4.931   19.130 4.468   1.00 17.16 ? 308 TRP A CZ3   1 
ATOM   652  C  CH2   . TRP A 1 90  ? 5.815   18.846 5.517   1.00 18.11 ? 308 TRP A CH2   1 
ATOM   653  N  N     . THR A 1 91  ? 3.812   17.663 -1.116  1.00 16.64 ? 309 THR A N     1 
ATOM   654  C  CA    . THR A 1 91  ? 2.843   17.907 -2.176  1.00 16.08 ? 309 THR A CA    1 
ATOM   655  C  C     . THR A 1 91  ? 2.127   19.196 -1.878  1.00 16.78 ? 309 THR A C     1 
ATOM   656  O  O     . THR A 1 91  ? 2.208   19.731 -0.759  1.00 16.78 ? 309 THR A O     1 
ATOM   657  C  CB    . THR A 1 91  ? 1.774   16.810 -2.237  1.00 15.66 ? 309 THR A CB    1 
ATOM   658  O  OG1   . THR A 1 91  ? 1.029   16.802 -1.008  1.00 14.93 ? 309 THR A OG1   1 
ATOM   659  C  CG2   . THR A 1 91  ? 2.406   15.457 -2.449  1.00 15.65 ? 309 THR A CG2   1 
ATOM   660  N  N     . ILE A 1 92  ? 1.400   19.680 -2.872  1.00 17.12 ? 310 ILE A N     1 
ATOM   661  C  CA    . ILE A 1 92  ? 0.505   20.795 -2.666  1.00 17.52 ? 310 ILE A CA    1 
ATOM   662  C  C     . ILE A 1 92  ? -0.895  20.231 -2.558  1.00 17.47 ? 310 ILE A C     1 
ATOM   663  O  O     . ILE A 1 92  ? -1.330  19.425 -3.391  1.00 18.18 ? 310 ILE A O     1 
ATOM   664  C  CB    . ILE A 1 92  ? 0.573   21.796 -3.813  1.00 18.19 ? 310 ILE A CB    1 
ATOM   665  C  CG1   . ILE A 1 92  ? 1.965   22.412 -3.889  1.00 18.57 ? 310 ILE A CG1   1 
ATOM   666  C  CG2   . ILE A 1 92  ? -0.465  22.887 -3.632  1.00 18.36 ? 310 ILE A CG2   1 
ATOM   667  C  CD1   . ILE A 1 92  ? 2.199   23.144 -5.167  1.00 20.06 ? 310 ILE A CD1   1 
ATOM   668  N  N     . HIS A 1 93  ? -1.601  20.660 -1.518  1.00 17.81 ? 311 HIS A N     1 
ATOM   669  C  CA    . HIS A 1 93  ? -2.995  20.317 -1.331  1.00 17.46 ? 311 HIS A CA    1 
ATOM   670  C  C     . HIS A 1 93  ? -3.733  20.415 -2.672  1.00 18.66 ? 311 HIS A C     1 
ATOM   671  O  O     . HIS A 1 93  ? -3.629  21.426 -3.359  1.00 17.58 ? 311 HIS A O     1 
ATOM   672  C  CB    . HIS A 1 93  ? -3.610  21.261 -0.299  1.00 17.86 ? 311 HIS A CB    1 
ATOM   673  C  CG    . HIS A 1 93  ? -4.981  20.861 0.149   1.00 17.51 ? 311 HIS A CG    1 
ATOM   674  N  ND1   . HIS A 1 93  ? -6.030  20.696 -0.726  1.00 16.52 ? 311 HIS A ND1   1 
ATOM   675  C  CD2   . HIS A 1 93  ? -5.474  20.605 1.383   1.00 17.27 ? 311 HIS A CD2   1 
ATOM   676  C  CE1   . HIS A 1 93  ? -7.111  20.345 -0.053  1.00 17.59 ? 311 HIS A CE1   1 
ATOM   677  N  NE2   . HIS A 1 93  ? -6.801  20.290 1.230   1.00 17.73 ? 311 HIS A NE2   1 
ATOM   678  N  N     . PRO A 1 94  ? -4.466  19.354 -3.054  1.00 21.24 ? 312 PRO A N     1 
ATOM   679  C  CA    . PRO A 1 94  ? -5.198  19.268 -4.328  1.00 22.61 ? 312 PRO A CA    1 
ATOM   680  C  C     . PRO A 1 94  ? -6.123  20.450 -4.661  1.00 23.91 ? 312 PRO A C     1 
ATOM   681  O  O     . PRO A 1 94  ? -6.303  20.774 -5.838  1.00 24.95 ? 312 PRO A O     1 
ATOM   682  C  CB    . PRO A 1 94  ? -6.063  18.011 -4.150  1.00 22.64 ? 312 PRO A CB    1 
ATOM   683  C  CG    . PRO A 1 94  ? -5.352  17.186 -3.162  1.00 22.34 ? 312 PRO A CG    1 
ATOM   684  C  CD    . PRO A 1 94  ? -4.590  18.112 -2.265  1.00 21.67 ? 312 PRO A CD    1 
ATOM   685  N  N     . SER A 1 95  ? -6.744  21.037 -3.640  1.00 23.75 ? 313 SER A N     1 
ATOM   686  C  CA    . SER A 1 95  ? -7.647  22.173 -3.814  1.00 23.82 ? 313 SER A CA    1 
ATOM   687  C  C     . SER A 1 95  ? -6.906  23.511 -3.757  1.00 24.32 ? 313 SER A C     1 
ATOM   688  O  O     . SER A 1 95  ? -7.504  24.557 -3.985  1.00 23.20 ? 313 SER A O     1 
ATOM   689  C  CB    . SER A 1 95  ? -8.745  22.148 -2.740  1.00 23.91 ? 313 SER A CB    1 
ATOM   690  O  OG    . SER A 1 95  ? -9.554  20.983 -2.848  1.00 23.87 ? 313 SER A OG    1 
ATOM   691  N  N     . ALA A 1 96  ? -5.615  23.481 -3.440  1.00 25.84 ? 314 ALA A N     1 
ATOM   692  C  CA    . ALA A 1 96  ? -4.813  24.706 -3.342  1.00 27.86 ? 314 ALA A CA    1 
ATOM   693  C  C     . ALA A 1 96  ? -4.011  25.001 -4.597  1.00 29.97 ? 314 ALA A C     1 
ATOM   694  O  O     . ALA A 1 96  ? -3.643  26.151 -4.848  1.00 31.74 ? 314 ALA A O     1 
ATOM   695  C  CB    . ALA A 1 96  ? -3.865  24.626 -2.155  1.00 27.46 ? 314 ALA A CB    1 
ATOM   696  N  N     . ASN A 1 97  ? -3.733  23.970 -5.385  1.00 31.73 ? 315 ASN A N     1 
ATOM   697  C  CA    . ASN A 1 97  ? -2.712  24.081 -6.412  1.00 31.92 ? 315 ASN A CA    1 
ATOM   698  C  C     . ASN A 1 97  ? -3.164  24.905 -7.606  1.00 32.13 ? 315 ASN A C     1 
ATOM   699  O  O     . ASN A 1 97  ? -4.062  24.506 -8.352  1.00 32.24 ? 315 ASN A O     1 
ATOM   700  C  CB    . ASN A 1 97  ? -2.251  22.699 -6.873  1.00 32.07 ? 315 ASN A CB    1 
ATOM   701  C  CG    . ASN A 1 97  ? -0.868  22.732 -7.486  1.00 31.70 ? 315 ASN A CG    1 
ATOM   702  O  OD1   . ASN A 1 97  ? -0.363  23.794 -7.857  1.00 31.39 ? 315 ASN A OD1   1 
ATOM   703  N  ND2   . ASN A 1 97  ? -0.242  21.569 -7.581  1.00 31.01 ? 315 ASN A ND2   1 
ATOM   704  N  N     . ARG A 1 98  ? -2.517  26.054 -7.779  1.00 32.42 ? 316 ARG A N     1 
ATOM   705  C  CA    . ARG A 1 98  ? -2.752  26.922 -8.926  1.00 33.27 ? 316 ARG A CA    1 
ATOM   706  C  C     . ARG A 1 98  ? -1.883  26.502 -10.106 1.00 32.89 ? 316 ARG A C     1 
ATOM   707  O  O     . ARG A 1 98  ? -2.015  27.040 -11.199 1.00 32.31 ? 316 ARG A O     1 
ATOM   708  C  CB    . ARG A 1 98  ? -2.433  28.370 -8.560  1.00 34.41 ? 316 ARG A CB    1 
ATOM   709  C  CG    . ARG A 1 98  ? -3.110  28.875 -7.275  1.00 35.87 ? 316 ARG A CG    1 
ATOM   710  C  CD    . ARG A 1 98  ? -2.761  30.336 -6.974  1.00 36.71 ? 316 ARG A CD    1 
ATOM   711  N  NE    . ARG A 1 98  ? -2.977  31.200 -8.142  1.00 37.76 ? 316 ARG A NE    1 
ATOM   712  C  CZ    . ARG A 1 98  ? -2.781  32.519 -8.164  1.00 38.15 ? 316 ARG A CZ    1 
ATOM   713  N  NH1   . ARG A 1 98  ? -2.996  33.192 -9.287  1.00 38.33 ? 316 ARG A NH1   1 
ATOM   714  N  NH2   . ARG A 1 98  ? -2.384  33.173 -7.077  1.00 38.61 ? 316 ARG A NH2   1 
ATOM   715  N  N     . TYR A 1 99  ? -0.982  25.548 -9.868  1.00 33.60 ? 317 TYR A N     1 
ATOM   716  C  CA    . TYR A 1 99  ? 0.030   25.131 -10.838 1.00 33.82 ? 317 TYR A CA    1 
ATOM   717  C  C     . TYR A 1 99  ? 0.889   26.299 -11.300 1.00 33.87 ? 317 TYR A C     1 
ATOM   718  O  O     . TYR A 1 99  ? 1.268   26.388 -12.458 1.00 33.85 ? 317 TYR A O     1 
ATOM   719  C  CB    . TYR A 1 99  ? -0.609  24.375 -12.003 1.00 33.93 ? 317 TYR A CB    1 
ATOM   720  C  CG    . TYR A 1 99  ? -1.405  23.206 -11.495 1.00 34.57 ? 317 TYR A CG    1 
ATOM   721  C  CD1   . TYR A 1 99  ? -2.786  23.155 -11.647 1.00 34.60 ? 317 TYR A CD1   1 
ATOM   722  C  CD2   . TYR A 1 99  ? -0.779  22.176 -10.794 1.00 35.02 ? 317 TYR A CD2   1 
ATOM   723  C  CE1   . TYR A 1 99  ? -3.520  22.090 -11.152 1.00 34.88 ? 317 TYR A CE1   1 
ATOM   724  C  CE2   . TYR A 1 99  ? -1.505  21.106 -10.295 1.00 35.03 ? 317 TYR A CE2   1 
ATOM   725  C  CZ    . TYR A 1 99  ? -2.873  21.070 -10.476 1.00 35.16 ? 317 TYR A CZ    1 
ATOM   726  O  OH    . TYR A 1 99  ? -3.595  20.010 -9.981  1.00 35.74 ? 317 TYR A OH    1 
ATOM   727  N  N     . LEU A 1 100 ? 1.196   27.186 -10.361 1.00 34.56 ? 318 LEU A N     1 
ATOM   728  C  CA    . LEU A 1 100 ? 2.237   28.181 -10.555 1.00 35.30 ? 318 LEU A CA    1 
ATOM   729  C  C     . LEU A 1 100 ? 3.543   27.440 -10.831 1.00 35.20 ? 318 LEU A C     1 
ATOM   730  O  O     . LEU A 1 100 ? 4.080   26.782 -9.935  1.00 34.50 ? 318 LEU A O     1 
ATOM   731  C  CB    . LEU A 1 100 ? 2.412   29.049 -9.291  1.00 35.22 ? 318 LEU A CB    1 
ATOM   732  C  CG    . LEU A 1 100 ? 1.227   29.871 -8.775  1.00 35.34 ? 318 LEU A CG    1 
ATOM   733  C  CD1   . LEU A 1 100 ? 1.665   30.730 -7.601  1.00 34.74 ? 318 LEU A CD1   1 
ATOM   734  C  CD2   . LEU A 1 100 ? 0.589   30.728 -9.886  1.00 35.54 ? 318 LEU A CD2   1 
ATOM   735  N  N     . THR A 1 101 ? 4.011   27.506 -12.074 1.00 35.37 ? 319 THR A N     1 
ATOM   736  C  CA    . THR A 1 101 ? 5.374   27.104 -12.423 1.00 36.08 ? 319 THR A CA    1 
ATOM   737  C  C     . THR A 1 101 ? 6.221   28.351 -12.700 1.00 36.28 ? 319 THR A C     1 
ATOM   738  O  O     . THR A 1 101 ? 5.679   29.418 -13.005 1.00 36.86 ? 319 THR A O     1 
ATOM   739  C  CB    . THR A 1 101 ? 5.400   26.197 -13.654 1.00 35.69 ? 319 THR A CB    1 
ATOM   740  O  OG1   . THR A 1 101 ? 4.753   26.858 -14.744 1.00 36.31 ? 319 THR A OG1   1 
ATOM   741  C  CG2   . THR A 1 101 ? 4.697   24.890 -13.362 1.00 35.53 ? 319 THR A CG2   1 
ATOM   742  N  N     . LEU A 1 102 ? 7.543   28.211 -12.600 1.00 36.09 ? 320 LEU A N     1 
ATOM   743  C  CA    . LEU A 1 102 ? 8.468   29.352 -12.721 1.00 35.81 ? 320 LEU A CA    1 
ATOM   744  C  C     . LEU A 1 102 ? 8.358   30.068 -14.076 1.00 36.00 ? 320 LEU A C     1 
ATOM   745  O  O     . LEU A 1 102 ? 8.652   31.254 -14.178 1.00 36.84 ? 320 LEU A O     1 
ATOM   746  C  CB    . LEU A 1 102 ? 9.915   28.902 -12.469 1.00 35.05 ? 320 LEU A CB    1 
ATOM   747  C  CG    . LEU A 1 102 ? 10.989  29.991 -12.339 1.00 34.93 ? 320 LEU A CG    1 
ATOM   748  C  CD1   . LEU A 1 102 ? 10.739  30.851 -11.111 1.00 34.61 ? 320 LEU A CD1   1 
ATOM   749  C  CD2   . LEU A 1 102 ? 12.389  29.393 -12.278 1.00 34.38 ? 320 LEU A CD2   1 
ATOM   750  N  N     . ASP A 1 103 ? 7.922   29.353 -15.106 1.00 36.55 ? 321 ASP A N     1 
ATOM   751  C  CA    . ASP A 1 103 ? 7.676   29.959 -16.418 1.00 36.85 ? 321 ASP A CA    1 
ATOM   752  C  C     . ASP A 1 103 ? 6.347   30.702 -16.443 1.00 36.68 ? 321 ASP A C     1 
ATOM   753  O  O     . ASP A 1 103 ? 6.215   31.767 -15.841 1.00 36.62 ? 321 ASP A O     1 
ATOM   754  C  CB    . ASP A 1 103 ? 7.693   28.886 -17.501 1.00 37.24 ? 321 ASP A CB    1 
ATOM   755  C  CG    . ASP A 1 103 ? 9.006   28.135 -17.549 1.00 37.88 ? 321 ASP A CG    1 
ATOM   756  O  OD1   . ASP A 1 103 ? 9.731   28.141 -16.525 1.00 38.84 ? 321 ASP A OD1   1 
ATOM   757  O  OD2   . ASP A 1 103 ? 9.315   27.540 -18.603 1.00 38.42 ? 321 ASP A OD2   1 
ATOM   758  N  N     . SER B 1 16  ? 8.742   36.542 40.172  1.00 53.32 ? 234 SER B N     1 
ATOM   759  C  CA    . SER B 1 16  ? 8.402   36.971 38.763  1.00 52.62 ? 234 SER B CA    1 
ATOM   760  C  C     . SER B 1 16  ? 9.413   36.486 37.712  1.00 50.77 ? 234 SER B C     1 
ATOM   761  O  O     . SER B 1 16  ? 10.245  37.271 37.198  1.00 53.42 ? 234 SER B O     1 
ATOM   762  C  CB    . SER B 1 16  ? 8.283   38.504 38.673  1.00 53.69 ? 234 SER B CB    1 
ATOM   763  O  OG    . SER B 1 16  ? 8.351   38.958 37.326  1.00 54.17 ? 234 SER B OG    1 
ATOM   764  N  N     . GLU B 1 17  ? 9.343   35.201 37.379  1.00 44.96 ? 235 GLU B N     1 
ATOM   765  C  CA    . GLU B 1 17  ? 10.031  34.716 36.195  1.00 40.40 ? 235 GLU B CA    1 
ATOM   766  C  C     . GLU B 1 17  ? 9.021   34.608 35.056  1.00 35.63 ? 235 GLU B C     1 
ATOM   767  O  O     . GLU B 1 17  ? 7.803   34.625 35.272  1.00 32.35 ? 235 GLU B O     1 
ATOM   768  C  CB    . GLU B 1 17  ? 10.716  33.371 36.440  1.00 40.55 ? 235 GLU B CB    1 
ATOM   769  C  CG    . GLU B 1 17  ? 12.163  33.507 36.862  1.00 41.51 ? 235 GLU B CG    1 
ATOM   770  C  CD    . GLU B 1 17  ? 12.856  32.171 36.989  1.00 42.20 ? 235 GLU B CD    1 
ATOM   771  O  OE1   . GLU B 1 17  ? 12.368  31.190 36.389  1.00 43.01 ? 235 GLU B OE1   1 
ATOM   772  O  OE2   . GLU B 1 17  ? 13.889  32.103 37.692  1.00 42.49 ? 235 GLU B OE2   1 
ATOM   773  N  N     . ARG B 1 18  ? 9.555   34.519 33.846  1.00 30.76 ? 236 ARG B N     1 
ATOM   774  C  CA    . ARG B 1 18  ? 8.758   34.289 32.664  1.00 28.28 ? 236 ARG B CA    1 
ATOM   775  C  C     . ARG B 1 18  ? 8.017   32.981 32.867  1.00 26.00 ? 236 ARG B C     1 
ATOM   776  O  O     . ARG B 1 18  ? 8.632   31.979 33.231  1.00 26.38 ? 236 ARG B O     1 
ATOM   777  C  CB    . ARG B 1 18  ? 9.653   34.183 31.432  1.00 27.21 ? 236 ARG B CB    1 
ATOM   778  C  CG    . ARG B 1 18  ? 8.897   33.836 30.190  1.00 26.63 ? 236 ARG B CG    1 
ATOM   779  C  CD    . ARG B 1 18  ? 9.741   34.028 28.973  1.00 25.57 ? 236 ARG B CD    1 
ATOM   780  N  NE    . ARG B 1 18  ? 8.902   34.074 27.776  1.00 24.97 ? 236 ARG B NE    1 
ATOM   781  C  CZ    . ARG B 1 18  ? 9.220   34.712 26.655  1.00 23.77 ? 236 ARG B CZ    1 
ATOM   782  N  NH1   . ARG B 1 18  ? 8.376   34.705 25.630  1.00 24.16 ? 236 ARG B NH1   1 
ATOM   783  N  NH2   . ARG B 1 18  ? 10.364  35.383 26.563  1.00 23.45 ? 236 ARG B NH2   1 
ATOM   784  N  N     . PRO B 1 19  ? 6.698   32.993 32.658  1.00 23.06 ? 237 PRO B N     1 
ATOM   785  C  CA    . PRO B 1 19  ? 5.917   31.803 32.918  1.00 22.33 ? 237 PRO B CA    1 
ATOM   786  C  C     . PRO B 1 19  ? 6.134   30.745 31.838  1.00 20.95 ? 237 PRO B C     1 
ATOM   787  O  O     . PRO B 1 19  ? 6.527   31.077 30.729  1.00 19.89 ? 237 PRO B O     1 
ATOM   788  C  CB    . PRO B 1 19  ? 4.480   32.330 32.901  1.00 22.62 ? 237 PRO B CB    1 
ATOM   789  C  CG    . PRO B 1 19  ? 4.533   33.505 32.020  1.00 22.71 ? 237 PRO B CG    1 
ATOM   790  C  CD    . PRO B 1 19  ? 5.843   34.138 32.294  1.00 22.92 ? 237 PRO B CD    1 
ATOM   791  N  N     . PRO B 1 20  ? 5.872   29.477 32.159  1.00 20.10 ? 238 PRO B N     1 
ATOM   792  C  CA    . PRO B 1 20  ? 6.180   28.422 31.214  1.00 20.15 ? 238 PRO B CA    1 
ATOM   793  C  C     . PRO B 1 20  ? 4.998   28.117 30.313  1.00 20.25 ? 238 PRO B C     1 
ATOM   794  O  O     . PRO B 1 20  ? 4.676   26.952 30.125  1.00 21.35 ? 238 PRO B O     1 
ATOM   795  C  CB    . PRO B 1 20  ? 6.477   27.232 32.134  1.00 20.02 ? 238 PRO B CB    1 
ATOM   796  C  CG    . PRO B 1 20  ? 5.507   27.429 33.279  1.00 19.63 ? 238 PRO B CG    1 
ATOM   797  C  CD    . PRO B 1 20  ? 5.380   28.937 33.441  1.00 19.93 ? 238 PRO B CD    1 
ATOM   798  N  N     . TYR B 1 21  ? 4.356   29.159 29.784  1.00 19.71 ? 239 TYR B N     1 
ATOM   799  C  CA    . TYR B 1 21  ? 3.238   29.023 28.844  1.00 19.51 ? 239 TYR B CA    1 
ATOM   800  C  C     . TYR B 1 21  ? 3.528   29.841 27.591  1.00 18.75 ? 239 TYR B C     1 
ATOM   801  O  O     . TYR B 1 21  ? 4.166   30.894 27.658  1.00 19.63 ? 239 TYR B O     1 
ATOM   802  C  CB    . TYR B 1 21  ? 1.911   29.432 29.516  1.00 18.50 ? 239 TYR B CB    1 
ATOM   803  C  CG    . TYR B 1 21  ? 1.680   28.590 30.728  1.00 18.10 ? 239 TYR B CG    1 
ATOM   804  C  CD1   . TYR B 1 21  ? 1.329   27.251 30.599  1.00 17.53 ? 239 TYR B CD1   1 
ATOM   805  C  CD2   . TYR B 1 21  ? 1.896   29.096 32.002  1.00 17.65 ? 239 TYR B CD2   1 
ATOM   806  C  CE1   . TYR B 1 21  ? 1.162   26.445 31.713  1.00 17.15 ? 239 TYR B CE1   1 
ATOM   807  C  CE2   . TYR B 1 21  ? 1.743   28.300 33.123  1.00 17.25 ? 239 TYR B CE2   1 
ATOM   808  C  CZ    . TYR B 1 21  ? 1.372   26.979 32.978  1.00 17.17 ? 239 TYR B CZ    1 
ATOM   809  O  OH    . TYR B 1 21  ? 1.225   26.195 34.100  1.00 16.94 ? 239 TYR B OH    1 
ATOM   810  N  N     . SER B 1 22  ? 3.089   29.327 26.451  1.00 18.59 ? 240 SER B N     1 
ATOM   811  C  CA    . SER B 1 22  ? 3.263   29.999 25.162  1.00 18.86 ? 240 SER B CA    1 
ATOM   812  C  C     . SER B 1 22  ? 2.380   31.239 25.089  1.00 18.71 ? 240 SER B C     1 
ATOM   813  O  O     . SER B 1 22  ? 1.405   31.344 25.836  1.00 19.47 ? 240 SER B O     1 
ATOM   814  C  CB    . SER B 1 22  ? 2.847   29.059 24.045  1.00 18.53 ? 240 SER B CB    1 
ATOM   815  O  OG    . SER B 1 22  ? 1.455   28.786 24.141  1.00 16.87 ? 240 SER B OG    1 
ATOM   816  N  N     . TYR B 1 23  ? 2.683   32.155 24.177  1.00 17.56 ? 241 TYR B N     1 
ATOM   817  C  CA    . TYR B 1 23  ? 1.784   33.297 23.939  1.00 18.84 ? 241 TYR B CA    1 
ATOM   818  C  C     . TYR B 1 23  ? 0.364   32.832 23.534  1.00 19.10 ? 241 TYR B C     1 
ATOM   819  O  O     . TYR B 1 23  ? -0.651  33.402 23.970  1.00 19.30 ? 241 TYR B O     1 
ATOM   820  C  CB    . TYR B 1 23  ? 2.336   34.219 22.857  1.00 19.39 ? 241 TYR B CB    1 
ATOM   821  C  CG    . TYR B 1 23  ? 3.533   35.054 23.278  1.00 19.50 ? 241 TYR B CG    1 
ATOM   822  C  CD1   . TYR B 1 23  ? 4.757   34.932 22.631  1.00 19.08 ? 241 TYR B CD1   1 
ATOM   823  C  CD2   . TYR B 1 23  ? 3.429   35.968 24.314  1.00 19.50 ? 241 TYR B CD2   1 
ATOM   824  C  CE1   . TYR B 1 23  ? 5.851   35.698 23.017  1.00 18.71 ? 241 TYR B CE1   1 
ATOM   825  C  CE2   . TYR B 1 23  ? 4.506   36.736 24.705  1.00 18.40 ? 241 TYR B CE2   1 
ATOM   826  C  CZ    . TYR B 1 23  ? 5.711   36.597 24.053  1.00 17.79 ? 241 TYR B CZ    1 
ATOM   827  O  OH    . TYR B 1 23  ? 6.762   37.361 24.456  1.00 15.76 ? 241 TYR B OH    1 
ATOM   828  N  N     . MET B 1 24  ? 0.301   31.806 22.699  1.00 18.42 ? 242 MET B N     1 
ATOM   829  C  CA    . MET B 1 24  ? -0.980  31.235 22.269  1.00 20.31 ? 242 MET B CA    1 
ATOM   830  C  C     . MET B 1 24  ? -1.802  30.771 23.501  1.00 20.57 ? 242 MET B C     1 
ATOM   831  O  O     . MET B 1 24  ? -3.013  31.025 23.587  1.00 19.57 ? 242 MET B O     1 
ATOM   832  C  CB    . MET B 1 24  ? -0.722  30.077 21.292  1.00 21.96 ? 242 MET B CB    1 
ATOM   833  C  CG    . MET B 1 24  ? -1.958  29.430 20.689  1.00 24.86 ? 242 MET B CG    1 
ATOM   834  S  SD    . MET B 1 24  ? -1.619  27.767 20.027  1.00 27.86 ? 242 MET B SD    1 
ATOM   835  C  CE    . MET B 1 24  ? -1.507  26.874 21.558  1.00 24.34 ? 242 MET B CE    1 
ATOM   836  N  N     . ALA B 1 25  ? -1.135  30.130 24.462  1.00 18.14 ? 243 ALA B N     1 
ATOM   837  C  CA    . ALA B 1 25  ? -1.808  29.652 25.667  1.00 17.94 ? 243 ALA B CA    1 
ATOM   838  C  C     . ALA B 1 25  ? -2.297  30.823 26.509  1.00 17.89 ? 243 ALA B C     1 
ATOM   839  O  O     . ALA B 1 25  ? -3.437  30.827 26.966  1.00 18.89 ? 243 ALA B O     1 
ATOM   840  C  CB    . ALA B 1 25  ? -0.875  28.738 26.494  1.00 17.01 ? 243 ALA B CB    1 
ATOM   841  N  N     . MET B 1 26  ? -1.442  31.823 26.717  1.00 17.84 ? 244 MET B N     1 
ATOM   842  C  CA    . MET B 1 26  ? -1.807  32.962 27.570  1.00 17.51 ? 244 MET B CA    1 
ATOM   843  C  C     . MET B 1 26  ? -2.934  33.803 26.963  1.00 16.77 ? 244 MET B C     1 
ATOM   844  O  O     . MET B 1 26  ? -3.783  34.362 27.680  1.00 15.89 ? 244 MET B O     1 
ATOM   845  C  CB    . MET B 1 26  ? -0.584  33.834 27.856  1.00 18.21 ? 244 MET B CB    1 
ATOM   846  C  CG    . MET B 1 26  ? 0.480   33.107 28.689  1.00 19.62 ? 244 MET B CG    1 
ATOM   847  S  SD    . MET B 1 26  ? 1.809   34.195 29.199  1.00 21.35 ? 244 MET B SD    1 
ATOM   848  C  CE    . MET B 1 26  ? 2.823   34.208 27.707  1.00 18.44 ? 244 MET B CE    1 
ATOM   849  N  N     . ILE B 1 27  ? -2.940  33.899 25.643  1.00 17.02 ? 245 ILE B N     1 
ATOM   850  C  CA    . ILE B 1 27  ? -3.998  34.630 24.940  1.00 16.56 ? 245 ILE B CA    1 
ATOM   851  C  C     . ILE B 1 27  ? -5.342  33.965 25.201  1.00 16.91 ? 245 ILE B C     1 
ATOM   852  O  O     . ILE B 1 27  ? -6.331  34.641 25.446  1.00 16.30 ? 245 ILE B O     1 
ATOM   853  C  CB    . ILE B 1 27  ? -3.730  34.711 23.436  1.00 17.38 ? 245 ILE B CB    1 
ATOM   854  C  CG1   . ILE B 1 27  ? -2.570  35.686 23.166  1.00 17.74 ? 245 ILE B CG1   1 
ATOM   855  C  CG2   . ILE B 1 27  ? -4.990  35.180 22.680  1.00 17.03 ? 245 ILE B CG2   1 
ATOM   856  C  CD1   . ILE B 1 27  ? -1.880  35.493 21.803  1.00 16.86 ? 245 ILE B CD1   1 
ATOM   857  N  N     . GLN B 1 28  ? -5.359  32.637 25.182  1.00 17.45 ? 246 GLN B N     1 
ATOM   858  C  CA    . GLN B 1 28  ? -6.562  31.874 25.497  1.00 17.33 ? 246 GLN B CA    1 
ATOM   859  C  C     . GLN B 1 28  ? -7.015  32.099 26.938  1.00 17.87 ? 246 GLN B C     1 
ATOM   860  O  O     . GLN B 1 28  ? -8.212  32.224 27.191  1.00 17.76 ? 246 GLN B O     1 
ATOM   861  C  CB    . GLN B 1 28  ? -6.343  30.381 25.233  1.00 17.88 ? 246 GLN B CB    1 
ATOM   862  C  CG    . GLN B 1 28  ? -6.168  30.042 23.763  1.00 18.24 ? 246 GLN B CG    1 
ATOM   863  C  CD    . GLN B 1 28  ? -5.853  28.573 23.527  1.00 19.18 ? 246 GLN B CD    1 
ATOM   864  O  OE1   . GLN B 1 28  ? -6.739  27.725 23.590  1.00 20.06 ? 246 GLN B OE1   1 
ATOM   865  N  NE2   . GLN B 1 28  ? -4.597  28.271 23.228  1.00 18.92 ? 246 GLN B NE2   1 
ATOM   866  N  N     . PHE B 1 29  ? -6.064  32.160 27.874  1.00 18.53 ? 247 PHE B N     1 
ATOM   867  C  CA    . PHE B 1 29  ? -6.394  32.432 29.270  1.00 18.81 ? 247 PHE B CA    1 
ATOM   868  C  C     . PHE B 1 29  ? -7.132  33.766 29.363  1.00 18.62 ? 247 PHE B C     1 
ATOM   869  O  O     . PHE B 1 29  ? -8.150  33.877 30.047  1.00 19.31 ? 247 PHE B O     1 
ATOM   870  C  CB    . PHE B 1 29  ? -5.139  32.501 30.169  1.00 19.00 ? 247 PHE B CB    1 
ATOM   871  C  CG    . PHE B 1 29  ? -4.346  31.203 30.277  1.00 18.90 ? 247 PHE B CG    1 
ATOM   872  C  CD1   . PHE B 1 29  ? -4.931  29.961 30.063  1.00 18.90 ? 247 PHE B CD1   1 
ATOM   873  C  CD2   . PHE B 1 29  ? -2.999  31.246 30.632  1.00 19.67 ? 247 PHE B CD2   1 
ATOM   874  C  CE1   . PHE B 1 29  ? -4.194  28.786 30.187  1.00 18.63 ? 247 PHE B CE1   1 
ATOM   875  C  CE2   . PHE B 1 29  ? -2.246  30.074 30.754  1.00 19.61 ? 247 PHE B CE2   1 
ATOM   876  C  CZ    . PHE B 1 29  ? -2.857  28.835 30.532  1.00 19.35 ? 247 PHE B CZ    1 
ATOM   877  N  N     . ALA B 1 30  ? -6.602  34.772 28.672  1.00 18.68 ? 248 ALA B N     1 
ATOM   878  C  CA    . ALA B 1 30  ? -7.146  36.116 28.734  1.00 18.53 ? 248 ALA B CA    1 
ATOM   879  C  C     . ALA B 1 30  ? -8.562  36.110 28.184  1.00 19.19 ? 248 ALA B C     1 
ATOM   880  O  O     . ALA B 1 30  ? -9.489  36.557 28.859  1.00 21.01 ? 248 ALA B O     1 
ATOM   881  C  CB    . ALA B 1 30  ? -6.261  37.102 27.960  1.00 17.63 ? 248 ALA B CB    1 
ATOM   882  N  N     . ILE B 1 31  ? -8.731  35.562 26.982  1.00 17.77 ? 249 ILE B N     1 
ATOM   883  C  CA    . ILE B 1 31  ? -10.029 35.599 26.310  1.00 17.62 ? 249 ILE B CA    1 
ATOM   884  C  C     . ILE B 1 31  ? -11.067 34.813 27.100  1.00 17.53 ? 249 ILE B C     1 
ATOM   885  O  O     . ILE B 1 31  ? -12.209 35.262 27.282  1.00 16.89 ? 249 ILE B O     1 
ATOM   886  C  CB    . ILE B 1 31  ? -9.951  35.048 24.863  1.00 16.43 ? 249 ILE B CB    1 
ATOM   887  C  CG1   . ILE B 1 31  ? -9.056  35.951 24.006  1.00 16.90 ? 249 ILE B CG1   1 
ATOM   888  C  CG2   . ILE B 1 31  ? -11.368 34.931 24.258  1.00 15.10 ? 249 ILE B CG2   1 
ATOM   889  C  CD1   . ILE B 1 31  ? -8.860  35.483 22.558  1.00 17.59 ? 249 ILE B CD1   1 
ATOM   890  N  N     . ASN B 1 32  ? -10.655 33.647 27.586  1.00 17.67 ? 250 ASN B N     1 
ATOM   891  C  CA    . ASN B 1 32  ? -11.567 32.785 28.314  1.00 18.08 ? 250 ASN B CA    1 
ATOM   892  C  C     . ASN B 1 32  ? -11.871 33.246 29.725  1.00 17.57 ? 250 ASN B C     1 
ATOM   893  O  O     . ASN B 1 32  ? -12.756 32.691 30.357  1.00 17.22 ? 250 ASN B O     1 
ATOM   894  C  CB    . ASN B 1 32  ? -11.068 31.343 28.311  1.00 17.56 ? 250 ASN B CB    1 
ATOM   895  C  CG    . ASN B 1 32  ? -11.238 30.698 26.972  1.00 16.74 ? 250 ASN B CG    1 
ATOM   896  O  OD1   . ASN B 1 32  ? -12.125 31.085 26.214  1.00 17.28 ? 250 ASN B OD1   1 
ATOM   897  N  ND2   . ASN B 1 32  ? -10.397 29.718 26.659  1.00 15.06 ? 250 ASN B ND2   1 
ATOM   898  N  N     . SER B 1 33  ? -11.167 34.272 30.200  1.00 18.96 ? 251 SER B N     1 
ATOM   899  C  CA    . SER B 1 33  ? -11.472 34.866 31.506  1.00 19.15 ? 251 SER B CA    1 
ATOM   900  C  C     . SER B 1 33  ? -12.721 35.745 31.475  1.00 19.39 ? 251 SER B C     1 
ATOM   901  O  O     . SER B 1 33  ? -13.252 36.074 32.525  1.00 20.98 ? 251 SER B O     1 
ATOM   902  C  CB    . SER B 1 33  ? -10.294 35.691 32.028  1.00 18.70 ? 251 SER B CB    1 
ATOM   903  O  OG    . SER B 1 33  ? -10.105 36.865 31.253  1.00 19.93 ? 251 SER B OG    1 
ATOM   904  N  N     . THR B 1 34  ? -13.198 36.124 30.294  1.00 19.71 ? 252 THR B N     1 
ATOM   905  C  CA    . THR B 1 34  ? -14.363 37.010 30.195  1.00 20.26 ? 252 THR B CA    1 
ATOM   906  C  C     . THR B 1 34  ? -15.681 36.237 30.088  1.00 21.34 ? 252 THR B C     1 
ATOM   907  O  O     . THR B 1 34  ? -15.700 35.061 29.713  1.00 21.47 ? 252 THR B O     1 
ATOM   908  C  CB    . THR B 1 34  ? -14.241 37.937 28.996  1.00 20.11 ? 252 THR B CB    1 
ATOM   909  O  OG1   . THR B 1 34  ? -14.240 37.152 27.802  1.00 20.89 ? 252 THR B OG1   1 
ATOM   910  C  CG2   . THR B 1 34  ? -12.943 38.749 29.081  1.00 19.81 ? 252 THR B CG2   1 
ATOM   911  N  N     . GLU B 1 35  ? -16.783 36.904 30.428  1.00 22.16 ? 253 GLU B N     1 
ATOM   912  C  CA    . GLU B 1 35  ? -18.103 36.289 30.313  1.00 23.26 ? 253 GLU B CA    1 
ATOM   913  C  C     . GLU B 1 35  ? -18.344 35.857 28.871  1.00 23.06 ? 253 GLU B C     1 
ATOM   914  O  O     . GLU B 1 35  ? -18.714 34.710 28.615  1.00 23.35 ? 253 GLU B O     1 
ATOM   915  C  CB    . GLU B 1 35  ? -19.228 37.236 30.776  1.00 24.24 ? 253 GLU B CB    1 
ATOM   916  C  CG    . GLU B 1 35  ? -19.729 36.987 32.197  1.00 25.96 ? 253 GLU B CG    1 
ATOM   917  C  CD    . GLU B 1 35  ? -20.998 37.778 32.527  1.00 27.34 ? 253 GLU B CD    1 
ATOM   918  O  OE1   . GLU B 1 35  ? -21.028 38.994 32.239  1.00 29.08 ? 253 GLU B OE1   1 
ATOM   919  O  OE2   . GLU B 1 35  ? -21.966 37.194 33.076  1.00 27.64 ? 253 GLU B OE2   1 
ATOM   920  N  N     . ARG B 1 36  ? -18.107 36.764 27.931  1.00 22.30 ? 254 ARG B N     1 
ATOM   921  C  CA    . ARG B 1 36  ? -18.516 36.526 26.546  1.00 23.13 ? 254 ARG B CA    1 
ATOM   922  C  C     . ARG B 1 36  ? -17.473 35.860 25.643  1.00 22.76 ? 254 ARG B C     1 
ATOM   923  O  O     . ARG B 1 36  ? -17.702 35.733 24.446  1.00 23.34 ? 254 ARG B O     1 
ATOM   924  C  CB    . ARG B 1 36  ? -19.043 37.824 25.945  1.00 24.30 ? 254 ARG B CB    1 
ATOM   925  C  CG    . ARG B 1 36  ? -20.325 38.253 26.654  1.00 25.63 ? 254 ARG B CG    1 
ATOM   926  C  CD    . ARG B 1 36  ? -20.904 39.516 26.112  1.00 26.81 ? 254 ARG B CD    1 
ATOM   927  N  NE    . ARG B 1 36  ? -21.458 39.318 24.776  1.00 28.02 ? 254 ARG B NE    1 
ATOM   928  C  CZ    . ARG B 1 36  ? -22.402 40.076 24.228  1.00 28.36 ? 254 ARG B CZ    1 
ATOM   929  N  NH1   . ARG B 1 36  ? -22.935 41.094 24.899  1.00 29.25 ? 254 ARG B NH1   1 
ATOM   930  N  NH2   . ARG B 1 36  ? -22.823 39.805 22.998  1.00 28.81 ? 254 ARG B NH2   1 
ATOM   931  N  N     . LYS B 1 37  ? -16.355 35.417 26.222  1.00 21.93 ? 255 LYS B N     1 
ATOM   932  C  CA    . LYS B 1 37  ? -15.279 34.734 25.480  1.00 21.27 ? 255 LYS B CA    1 
ATOM   933  C  C     . LYS B 1 37  ? -14.783 35.553 24.288  1.00 21.19 ? 255 LYS B C     1 
ATOM   934  O  O     . LYS B 1 37  ? -14.550 35.035 23.176  1.00 21.05 ? 255 LYS B O     1 
ATOM   935  C  CB    . LYS B 1 37  ? -15.715 33.329 25.059  1.00 20.86 ? 255 LYS B CB    1 
ATOM   936  C  CG    . LYS B 1 37  ? -16.407 32.524 26.168  1.00 20.29 ? 255 LYS B CG    1 
ATOM   937  C  CD    . LYS B 1 37  ? -15.596 32.476 27.456  1.00 20.56 ? 255 LYS B CD    1 
ATOM   938  C  CE    . LYS B 1 37  ? -16.427 31.908 28.610  1.00 20.65 ? 255 LYS B CE    1 
ATOM   939  N  NZ    . LYS B 1 37  ? -15.620 31.894 29.838  1.00 19.98 ? 255 LYS B NZ    1 
ATOM   940  N  N     . ARG B 1 38  ? -14.605 36.842 24.556  1.00 21.16 ? 256 ARG B N     1 
ATOM   941  C  CA    . ARG B 1 38  ? -14.092 37.785 23.586  1.00 21.59 ? 256 ARG B CA    1 
ATOM   942  C  C     . ARG B 1 38  ? -13.361 38.908 24.311  1.00 20.87 ? 256 ARG B C     1 
ATOM   943  O  O     . ARG B 1 38  ? -13.775 39.308 25.390  1.00 22.04 ? 256 ARG B O     1 
ATOM   944  C  CB    . ARG B 1 38  ? -15.235 38.342 22.744  1.00 21.53 ? 256 ARG B CB    1 
ATOM   945  C  CG    . ARG B 1 38  ? -16.305 39.072 23.530  1.00 22.83 ? 256 ARG B CG    1 
ATOM   946  C  CD    . ARG B 1 38  ? -17.362 39.605 22.599  1.00 22.94 ? 256 ARG B CD    1 
ATOM   947  N  NE    . ARG B 1 38  ? -18.291 40.499 23.277  1.00 23.66 ? 256 ARG B NE    1 
ATOM   948  C  CZ    . ARG B 1 38  ? -19.229 41.205 22.653  1.00 24.15 ? 256 ARG B CZ    1 
ATOM   949  N  NH1   . ARG B 1 38  ? -19.355 41.124 21.332  1.00 24.71 ? 256 ARG B NH1   1 
ATOM   950  N  NH2   . ARG B 1 38  ? -20.038 41.999 23.342  1.00 24.19 ? 256 ARG B NH2   1 
ATOM   951  N  N     . MET B 1 39  ? -12.283 39.415 23.717  1.00 20.28 ? 257 MET B N     1 
ATOM   952  C  CA    . MET B 1 39  ? -11.457 40.437 24.354  1.00 20.07 ? 257 MET B CA    1 
ATOM   953  C  C     . MET B 1 39  ? -10.722 41.296 23.336  1.00 20.12 ? 257 MET B C     1 
ATOM   954  O  O     . MET B 1 39  ? -10.196 40.786 22.345  1.00 20.45 ? 257 MET B O     1 
ATOM   955  C  CB    . MET B 1 39  ? -10.423 39.768 25.277  1.00 20.70 ? 257 MET B CB    1 
ATOM   956  C  CG    . MET B 1 39  ? -9.731  40.731 26.233  1.00 20.98 ? 257 MET B CG    1 
ATOM   957  S  SD    . MET B 1 39  ? -8.635  39.922 27.425  1.00 21.48 ? 257 MET B SD    1 
ATOM   958  C  CE    . MET B 1 39  ? -9.671  39.847 28.878  1.00 18.86 ? 257 MET B CE    1 
ATOM   959  N  N     . THR B 1 40  ? -10.646 42.595 23.599  1.00 19.80 ? 258 THR B N     1 
ATOM   960  C  CA    . THR B 1 40  ? -9.860  43.491 22.757  1.00 20.49 ? 258 THR B CA    1 
ATOM   961  C  C     . THR B 1 40  ? -8.366  43.265 22.979  1.00 21.11 ? 258 THR B C     1 
ATOM   962  O  O     . THR B 1 40  ? -7.953  42.779 24.031  1.00 22.44 ? 258 THR B O     1 
ATOM   963  C  CB    . THR B 1 40  ? -10.147 44.947 23.073  1.00 20.03 ? 258 THR B CB    1 
ATOM   964  O  OG1   . THR B 1 40  ? -9.753  45.204 24.423  1.00 21.47 ? 258 THR B OG1   1 
ATOM   965  C  CG2   . THR B 1 40  ? -11.643 45.270 22.891  1.00 18.97 ? 258 THR B CG2   1 
ATOM   966  N  N     . LEU B 1 41  ? -7.565  43.646 21.987  1.00 21.11 ? 259 LEU B N     1 
ATOM   967  C  CA    . LEU B 1 41  ? -6.119  43.545 22.062  1.00 19.66 ? 259 LEU B CA    1 
ATOM   968  C  C     . LEU B 1 41  ? -5.546  44.205 23.298  1.00 20.17 ? 259 LEU B C     1 
ATOM   969  O  O     . LEU B 1 41  ? -4.677  43.632 23.953  1.00 18.65 ? 259 LEU B O     1 
ATOM   970  C  CB    . LEU B 1 41  ? -5.461  44.181 20.835  1.00 18.97 ? 259 LEU B CB    1 
ATOM   971  C  CG    . LEU B 1 41  ? -3.932  44.088 20.805  1.00 17.99 ? 259 LEU B CG    1 
ATOM   972  C  CD1   . LEU B 1 41  ? -3.451  42.635 20.958  1.00 15.82 ? 259 LEU B CD1   1 
ATOM   973  C  CD2   . LEU B 1 41  ? -3.400  44.717 19.524  1.00 17.83 ? 259 LEU B CD2   1 
ATOM   974  N  N     . LYS B 1 42  ? -5.997  45.420 23.596  1.00 20.89 ? 260 LYS B N     1 
ATOM   975  C  CA    . LYS B 1 42  ? -5.446  46.175 24.722  1.00 21.90 ? 260 LYS B CA    1 
ATOM   976  C  C     . LYS B 1 42  ? -5.753  45.476 26.051  1.00 21.85 ? 260 LYS B C     1 
ATOM   977  O  O     . LYS B 1 42  ? -4.960  45.537 26.992  1.00 21.87 ? 260 LYS B O     1 
ATOM   978  C  CB    . LYS B 1 42  ? -6.004  47.604 24.746  1.00 23.33 ? 260 LYS B CB    1 
ATOM   979  C  CG    . LYS B 1 42  ? -5.351  48.514 25.787  1.00 24.29 ? 260 LYS B CG    1 
ATOM   980  C  CD    . LYS B 1 42  ? -6.278  49.631 26.256  1.00 25.46 ? 260 LYS B CD    1 
ATOM   981  C  CE    . LYS B 1 42  ? -5.932  50.075 27.682  1.00 26.01 ? 260 LYS B CE    1 
ATOM   982  N  NZ    . LYS B 1 42  ? -7.095  50.688 28.403  1.00 25.81 ? 260 LYS B NZ    1 
ATOM   983  N  N     . ASP B 1 43  ? -6.922  44.849 26.134  1.00 21.60 ? 261 ASP B N     1 
ATOM   984  C  CA    . ASP B 1 43  ? -7.301  44.106 27.324  1.00 20.74 ? 261 ASP B CA    1 
ATOM   985  C  C     . ASP B 1 43  ? -6.506  42.815 27.416  1.00 20.57 ? 261 ASP B C     1 
ATOM   986  O  O     . ASP B 1 43  ? -6.286  42.316 28.513  1.00 20.25 ? 261 ASP B O     1 
ATOM   987  C  CB    . ASP B 1 43  ? -8.798  43.793 27.328  1.00 20.33 ? 261 ASP B CB    1 
ATOM   988  C  CG    . ASP B 1 43  ? -9.649  45.000 27.655  1.00 20.75 ? 261 ASP B CG    1 
ATOM   989  O  OD1   . ASP B 1 43  ? -9.143  45.921 28.329  1.00 20.69 ? 261 ASP B OD1   1 
ATOM   990  O  OD2   . ASP B 1 43  ? -10.832 45.017 27.239  1.00 20.38 ? 261 ASP B OD2   1 
ATOM   991  N  N     . ILE B 1 44  ? -6.084  42.261 26.280  1.00 19.99 ? 262 ILE B N     1 
ATOM   992  C  CA    . ILE B 1 44  ? -5.249  41.061 26.311  1.00 19.70 ? 262 ILE B CA    1 
ATOM   993  C  C     . ILE B 1 44  ? -3.890  41.439 26.878  1.00 20.17 ? 262 ILE B C     1 
ATOM   994  O  O     . ILE B 1 44  ? -3.365  40.725 27.736  1.00 21.39 ? 262 ILE B O     1 
ATOM   995  C  CB    . ILE B 1 44  ? -5.149  40.368 24.934  1.00 19.99 ? 262 ILE B CB    1 
ATOM   996  C  CG1   . ILE B 1 44  ? -6.503  39.782 24.547  1.00 18.88 ? 262 ILE B CG1   1 
ATOM   997  C  CG2   . ILE B 1 44  ? -4.086  39.227 24.923  1.00 18.63 ? 262 ILE B CG2   1 
ATOM   998  C  CD1   . ILE B 1 44  ? -6.612  39.415 23.066  1.00 18.21 ? 262 ILE B CD1   1 
ATOM   999  N  N     . TYR B 1 45  ? -3.346  42.578 26.440  1.00 20.04 ? 263 TYR B N     1 
ATOM   1000 C  CA    . TYR B 1 45  ? -2.074  43.077 26.960  1.00 19.36 ? 263 TYR B CA    1 
ATOM   1001 C  C     . TYR B 1 45  ? -2.161  43.217 28.471  1.00 20.32 ? 263 TYR B C     1 
ATOM   1002 O  O     . TYR B 1 45  ? -1.350  42.651 29.206  1.00 20.85 ? 263 TYR B O     1 
ATOM   1003 C  CB    . TYR B 1 45  ? -1.729  44.463 26.399  1.00 19.33 ? 263 TYR B CB    1 
ATOM   1004 C  CG    . TYR B 1 45  ? -1.345  44.570 24.939  1.00 19.37 ? 263 TYR B CG    1 
ATOM   1005 C  CD1   . TYR B 1 45  ? -0.694  43.531 24.265  1.00 19.66 ? 263 TYR B CD1   1 
ATOM   1006 C  CD2   . TYR B 1 45  ? -1.595  45.751 24.240  1.00 19.62 ? 263 TYR B CD2   1 
ATOM   1007 C  CE1   . TYR B 1 45  ? -0.325  43.657 22.931  1.00 18.98 ? 263 TYR B CE1   1 
ATOM   1008 C  CE2   . TYR B 1 45  ? -1.229  45.891 22.910  1.00 19.83 ? 263 TYR B CE2   1 
ATOM   1009 C  CZ    . TYR B 1 45  ? -0.593  44.844 22.263  1.00 19.40 ? 263 TYR B CZ    1 
ATOM   1010 O  OH    . TYR B 1 45  ? -0.241  44.993 20.954  1.00 18.25 ? 263 TYR B OH    1 
ATOM   1011 N  N     . THR B 1 46  ? -3.151  43.992 28.921  1.00 19.62 ? 264 THR B N     1 
ATOM   1012 C  CA    . THR B 1 46  ? -3.388  44.239 30.335  1.00 18.23 ? 264 THR B CA    1 
ATOM   1013 C  C     . THR B 1 46  ? -3.559  42.954 31.138  1.00 17.99 ? 264 THR B C     1 
ATOM   1014 O  O     . THR B 1 46  ? -2.998  42.815 32.226  1.00 17.21 ? 264 THR B O     1 
ATOM   1015 C  CB    . THR B 1 46  ? -4.655  45.104 30.545  1.00 18.54 ? 264 THR B CB    1 
ATOM   1016 O  OG1   . THR B 1 46  ? -4.471  46.379 29.931  1.00 19.19 ? 264 THR B OG1   1 
ATOM   1017 C  CG2   . THR B 1 46  ? -4.931  45.325 32.041  1.00 16.87 ? 264 THR B CG2   1 
ATOM   1018 N  N     . TRP B 1 47  ? -4.355  42.028 30.618  1.00 17.60 ? 265 TRP B N     1 
ATOM   1019 C  CA    . TRP B 1 47  ? -4.580  40.764 31.309  1.00 17.63 ? 265 TRP B CA    1 
ATOM   1020 C  C     . TRP B 1 47  ? -3.257  40.020 31.516  1.00 17.70 ? 265 TRP B C     1 
ATOM   1021 O  O     . TRP B 1 47  ? -2.988  39.536 32.598  1.00 18.01 ? 265 TRP B O     1 
ATOM   1022 C  CB    . TRP B 1 47  ? -5.568  39.877 30.543  1.00 17.87 ? 265 TRP B CB    1 
ATOM   1023 C  CG    . TRP B 1 47  ? -6.008  38.702 31.350  1.00 18.62 ? 265 TRP B CG    1 
ATOM   1024 C  CD1   . TRP B 1 47  ? -7.161  38.588 32.097  1.00 18.87 ? 265 TRP B CD1   1 
ATOM   1025 C  CD2   . TRP B 1 47  ? -5.290  37.481 31.531  1.00 18.55 ? 265 TRP B CD2   1 
ATOM   1026 N  NE1   . TRP B 1 47  ? -7.201  37.360 32.712  1.00 18.45 ? 265 TRP B NE1   1 
ATOM   1027 C  CE2   . TRP B 1 47  ? -6.062  36.665 32.390  1.00 18.40 ? 265 TRP B CE2   1 
ATOM   1028 C  CE3   . TRP B 1 47  ? -4.062  36.996 31.053  1.00 18.52 ? 265 TRP B CE3   1 
ATOM   1029 C  CZ2   . TRP B 1 47  ? -5.641  35.389 32.791  1.00 19.07 ? 265 TRP B CZ2   1 
ATOM   1030 C  CZ3   . TRP B 1 47  ? -3.645  35.733 31.454  1.00 19.26 ? 265 TRP B CZ3   1 
ATOM   1031 C  CH2   . TRP B 1 47  ? -4.434  34.943 32.319  1.00 19.03 ? 265 TRP B CH2   1 
ATOM   1032 N  N     . ILE B 1 48  ? -2.434  39.937 30.475  1.00 19.28 ? 266 ILE B N     1 
ATOM   1033 C  CA    . ILE B 1 48  ? -1.174  39.202 30.564  1.00 19.61 ? 266 ILE B CA    1 
ATOM   1034 C  C     . ILE B 1 48  ? -0.248  39.882 31.582  1.00 20.20 ? 266 ILE B C     1 
ATOM   1035 O  O     . ILE B 1 48  ? 0.312   39.216 32.464  1.00 19.01 ? 266 ILE B O     1 
ATOM   1036 C  CB    . ILE B 1 48  ? -0.512  39.017 29.174  1.00 19.54 ? 266 ILE B CB    1 
ATOM   1037 C  CG1   . ILE B 1 48  ? -1.393  38.100 28.310  1.00 20.92 ? 266 ILE B CG1   1 
ATOM   1038 C  CG2   . ILE B 1 48  ? 0.843   38.374 29.313  1.00 19.22 ? 266 ILE B CG2   1 
ATOM   1039 C  CD1   . ILE B 1 48  ? -0.902  37.848 26.859  1.00 20.19 ? 266 ILE B CD1   1 
ATOM   1040 N  N     . GLU B 1 49  ? -0.142  41.208 31.488  1.00 21.04 ? 267 GLU B N     1 
ATOM   1041 C  CA    . GLU B 1 49  ? 0.642   42.013 32.432  1.00 20.89 ? 267 GLU B CA    1 
ATOM   1042 C  C     . GLU B 1 49  ? 0.234   41.789 33.880  1.00 21.04 ? 267 GLU B C     1 
ATOM   1043 O  O     . GLU B 1 49  ? 1.085   41.628 34.758  1.00 21.14 ? 267 GLU B O     1 
ATOM   1044 C  CB    . GLU B 1 49  ? 0.489   43.502 32.118  1.00 21.28 ? 267 GLU B CB    1 
ATOM   1045 C  CG    . GLU B 1 49  ? 1.329   43.967 30.947  1.00 22.91 ? 267 GLU B CG    1 
ATOM   1046 C  CD    . GLU B 1 49  ? 1.032   45.399 30.529  1.00 23.40 ? 267 GLU B CD    1 
ATOM   1047 O  OE1   . GLU B 1 49  ? 0.298   46.104 31.239  1.00 23.69 ? 267 GLU B OE1   1 
ATOM   1048 O  OE2   . GLU B 1 49  ? 1.542   45.823 29.479  1.00 25.10 ? 267 GLU B OE2   1 
ATOM   1049 N  N     . ASP B 1 50  ? -1.070  41.813 34.124  1.00 20.72 ? 268 ASP B N     1 
ATOM   1050 C  CA    . ASP B 1 50  ? -1.597  41.692 35.479  1.00 21.52 ? 268 ASP B CA    1 
ATOM   1051 C  C     . ASP B 1 50  ? -1.331  40.322 36.104  1.00 21.25 ? 268 ASP B C     1 
ATOM   1052 O  O     . ASP B 1 50  ? -1.068  40.238 37.306  1.00 20.80 ? 268 ASP B O     1 
ATOM   1053 C  CB    . ASP B 1 50  ? -3.105  41.987 35.509  1.00 21.50 ? 268 ASP B CB    1 
ATOM   1054 C  CG    . ASP B 1 50  ? -3.423  43.475 35.341  1.00 22.13 ? 268 ASP B CG    1 
ATOM   1055 O  OD1   . ASP B 1 50  ? -2.477  44.294 35.297  1.00 21.91 ? 268 ASP B OD1   1 
ATOM   1056 O  OD2   . ASP B 1 50  ? -4.626  43.816 35.247  1.00 21.28 ? 268 ASP B OD2   1 
ATOM   1057 N  N     . HIS B 1 51  ? -1.414  39.262 35.301  1.00 19.91 ? 269 HIS B N     1 
ATOM   1058 C  CA    . HIS B 1 51  ? -1.287  37.898 35.826  1.00 19.78 ? 269 HIS B CA    1 
ATOM   1059 C  C     . HIS B 1 51  ? 0.129   37.365 35.730  1.00 19.56 ? 269 HIS B C     1 
ATOM   1060 O  O     . HIS B 1 51  ? 0.491   36.468 36.478  1.00 18.25 ? 269 HIS B O     1 
ATOM   1061 C  CB    . HIS B 1 51  ? -2.260  36.952 35.118  1.00 19.60 ? 269 HIS B CB    1 
ATOM   1062 C  CG    . HIS B 1 51  ? -3.693  37.262 35.404  1.00 19.41 ? 269 HIS B CG    1 
ATOM   1063 N  ND1   . HIS B 1 51  ? -4.380  38.267 34.752  1.00 19.15 ? 269 HIS B ND1   1 
ATOM   1064 C  CD2   . HIS B 1 51  ? -4.559  36.735 36.300  1.00 18.83 ? 269 HIS B CD2   1 
ATOM   1065 C  CE1   . HIS B 1 51  ? -5.611  38.336 35.226  1.00 17.67 ? 269 HIS B CE1   1 
ATOM   1066 N  NE2   . HIS B 1 51  ? -5.750  37.410 36.156  1.00 18.45 ? 269 HIS B NE2   1 
ATOM   1067 N  N     . PHE B 1 52  ? 0.931   37.923 34.826  1.00 19.58 ? 270 PHE B N     1 
ATOM   1068 C  CA    . PHE B 1 52  ? 2.308   37.483 34.650  1.00 18.96 ? 270 PHE B CA    1 
ATOM   1069 C  C     . PHE B 1 52  ? 3.226   38.681 34.596  1.00 19.13 ? 270 PHE B C     1 
ATOM   1070 O  O     . PHE B 1 52  ? 3.588   39.128 33.510  1.00 19.59 ? 270 PHE B O     1 
ATOM   1071 C  CB    . PHE B 1 52  ? 2.451   36.697 33.357  1.00 20.01 ? 270 PHE B CB    1 
ATOM   1072 C  CG    . PHE B 1 52  ? 1.624   35.466 33.307  1.00 19.82 ? 270 PHE B CG    1 
ATOM   1073 C  CD1   . PHE B 1 52  ? 0.523   35.392 32.473  1.00 19.90 ? 270 PHE B CD1   1 
ATOM   1074 C  CD2   . PHE B 1 52  ? 1.943   34.383 34.097  1.00 20.59 ? 270 PHE B CD2   1 
ATOM   1075 C  CE1   . PHE B 1 52  ? -0.242  34.249 32.425  1.00 20.64 ? 270 PHE B CE1   1 
ATOM   1076 C  CE2   . PHE B 1 52  ? 1.183   33.231 34.052  1.00 21.76 ? 270 PHE B CE2   1 
ATOM   1077 C  CZ    . PHE B 1 52  ? 0.084   33.163 33.225  1.00 20.85 ? 270 PHE B CZ    1 
ATOM   1078 N  N     . PRO B 1 53  ? 3.622   39.196 35.765  1.00 19.21 ? 271 PRO B N     1 
ATOM   1079 C  CA    . PRO B 1 53  ? 4.308   40.477 35.838  1.00 19.13 ? 271 PRO B CA    1 
ATOM   1080 C  C     . PRO B 1 53  ? 5.676   40.519 35.161  1.00 19.03 ? 271 PRO B C     1 
ATOM   1081 O  O     . PRO B 1 53  ? 6.239   41.616 35.012  1.00 19.50 ? 271 PRO B O     1 
ATOM   1082 C  CB    . PRO B 1 53  ? 4.449   40.714 37.346  1.00 18.88 ? 271 PRO B CB    1 
ATOM   1083 C  CG    . PRO B 1 53  ? 4.359   39.384 37.956  1.00 18.98 ? 271 PRO B CG    1 
ATOM   1084 C  CD    . PRO B 1 53  ? 3.390   38.636 37.104  1.00 19.36 ? 271 PRO B CD    1 
ATOM   1085 N  N     . TYR B 1 54  ? 6.223   39.359 34.788  1.00 18.81 ? 272 TYR B N     1 
ATOM   1086 C  CA    . TYR B 1 54  ? 7.382   39.319 33.889  1.00 18.43 ? 272 TYR B CA    1 
ATOM   1087 C  C     . TYR B 1 54  ? 7.160   40.245 32.689  1.00 18.67 ? 272 TYR B C     1 
ATOM   1088 O  O     . TYR B 1 54  ? 8.060   41.001 32.307  1.00 17.10 ? 272 TYR B O     1 
ATOM   1089 C  CB    . TYR B 1 54  ? 7.652   37.904 33.379  1.00 18.46 ? 272 TYR B CB    1 
ATOM   1090 C  CG    . TYR B 1 54  ? 8.725   37.835 32.304  1.00 18.68 ? 272 TYR B CG    1 
ATOM   1091 C  CD1   . TYR B 1 54  ? 10.073  37.789 32.643  1.00 19.64 ? 272 TYR B CD1   1 
ATOM   1092 C  CD2   . TYR B 1 54  ? 8.383   37.816 30.945  1.00 20.23 ? 272 TYR B CD2   1 
ATOM   1093 C  CE1   . TYR B 1 54  ? 11.067  37.725 31.666  1.00 20.70 ? 272 TYR B CE1   1 
ATOM   1094 C  CE2   . TYR B 1 54  ? 9.365   37.743 29.948  1.00 21.12 ? 272 TYR B CE2   1 
ATOM   1095 C  CZ    . TYR B 1 54  ? 10.704  37.706 30.320  1.00 22.72 ? 272 TYR B CZ    1 
ATOM   1096 O  OH    . TYR B 1 54  ? 11.684  37.641 29.358  1.00 25.32 ? 272 TYR B OH    1 
ATOM   1097 N  N     . PHE B 1 55  ? 5.963   40.191 32.105  1.00 18.21 ? 273 PHE B N     1 
ATOM   1098 C  CA    . PHE B 1 55  ? 5.676   40.994 30.918  1.00 19.63 ? 273 PHE B CA    1 
ATOM   1099 C  C     . PHE B 1 55  ? 5.398   42.453 31.244  1.00 21.72 ? 273 PHE B C     1 
ATOM   1100 O  O     . PHE B 1 55  ? 5.652   43.319 30.421  1.00 23.70 ? 273 PHE B O     1 
ATOM   1101 C  CB    . PHE B 1 55  ? 4.526   40.391 30.120  1.00 18.10 ? 273 PHE B CB    1 
ATOM   1102 C  CG    . PHE B 1 55  ? 4.849   39.063 29.549  1.00 16.42 ? 273 PHE B CG    1 
ATOM   1103 C  CD1   . PHE B 1 55  ? 4.420   37.900 30.170  1.00 16.04 ? 273 PHE B CD1   1 
ATOM   1104 C  CD2   . PHE B 1 55  ? 5.628   38.965 28.415  1.00 17.04 ? 273 PHE B CD2   1 
ATOM   1105 C  CE1   . PHE B 1 55  ? 4.758   36.651 29.658  1.00 15.95 ? 273 PHE B CE1   1 
ATOM   1106 C  CE2   . PHE B 1 55  ? 5.965   37.716 27.887  1.00 16.69 ? 273 PHE B CE2   1 
ATOM   1107 C  CZ    . PHE B 1 55  ? 5.533   36.562 28.514  1.00 16.56 ? 273 PHE B CZ    1 
ATOM   1108 N  N     . LYS B 1 56  ? 4.868   42.722 32.432  1.00 24.12 ? 274 LYS B N     1 
ATOM   1109 C  CA    . LYS B 1 56  ? 4.685   44.097 32.899  1.00 24.61 ? 274 LYS B CA    1 
ATOM   1110 C  C     . LYS B 1 56  ? 6.015   44.784 33.196  1.00 24.34 ? 274 LYS B C     1 
ATOM   1111 O  O     . LYS B 1 56  ? 6.162   45.970 32.931  1.00 23.94 ? 274 LYS B O     1 
ATOM   1112 C  CB    . LYS B 1 56  ? 3.801   44.121 34.152  1.00 25.75 ? 274 LYS B CB    1 
ATOM   1113 C  CG    . LYS B 1 56  ? 3.310   45.514 34.562  1.00 26.80 ? 274 LYS B CG    1 
ATOM   1114 C  CD    . LYS B 1 56  ? 2.792   45.530 36.003  1.00 28.01 ? 274 LYS B CD    1 
ATOM   1115 C  CE    . LYS B 1 56  ? 1.269   45.538 36.103  1.00 28.73 ? 274 LYS B CE    1 
ATOM   1116 N  NZ    . LYS B 1 56  ? 0.746   46.947 36.213  1.00 28.99 ? 274 LYS B NZ    1 
ATOM   1117 N  N     . HIS B 1 57  ? 6.977   44.044 33.744  1.00 24.80 ? 275 HIS B N     1 
ATOM   1118 C  CA    . HIS B 1 57  ? 8.175   44.652 34.322  1.00 25.10 ? 275 HIS B CA    1 
ATOM   1119 C  C     . HIS B 1 57  ? 9.513   44.282 33.679  1.00 24.49 ? 275 HIS B C     1 
ATOM   1120 O  O     . HIS B 1 57  ? 10.466  45.039 33.816  1.00 24.08 ? 275 HIS B O     1 
ATOM   1121 C  CB    . HIS B 1 57  ? 8.268   44.309 35.814  1.00 26.10 ? 275 HIS B CB    1 
ATOM   1122 C  CG    . HIS B 1 57  ? 7.142   44.851 36.636  1.00 27.12 ? 275 HIS B CG    1 
ATOM   1123 N  ND1   . HIS B 1 57  ? 6.821   46.190 36.667  1.00 27.97 ? 275 HIS B ND1   1 
ATOM   1124 C  CD2   . HIS B 1 57  ? 6.280   44.237 37.479  1.00 27.70 ? 275 HIS B CD2   1 
ATOM   1125 C  CE1   . HIS B 1 57  ? 5.800   46.377 37.486  1.00 27.89 ? 275 HIS B CE1   1 
ATOM   1126 N  NE2   . HIS B 1 57  ? 5.451   45.207 37.989  1.00 27.71 ? 275 HIS B NE2   1 
ATOM   1127 N  N     . ILE B 1 58  ? 9.617   43.127 33.029  1.00 23.94 ? 276 ILE B N     1 
ATOM   1128 C  CA    . ILE B 1 58  ? 10.923  42.669 32.527  1.00 24.45 ? 276 ILE B CA    1 
ATOM   1129 C  C     . ILE B 1 58  ? 10.992  42.554 31.010  1.00 23.80 ? 276 ILE B C     1 
ATOM   1130 O  O     . ILE B 1 58  ? 11.931  43.041 30.402  1.00 24.52 ? 276 ILE B O     1 
ATOM   1131 C  CB    . ILE B 1 58  ? 11.336  41.322 33.149  1.00 25.28 ? 276 ILE B CB    1 
ATOM   1132 C  CG1   . ILE B 1 58  ? 11.581  41.477 34.650  1.00 26.16 ? 276 ILE B CG1   1 
ATOM   1133 C  CG2   . ILE B 1 58  ? 12.605  40.792 32.495  1.00 24.96 ? 276 ILE B CG2   1 
ATOM   1134 C  CD1   . ILE B 1 58  ? 11.615  40.144 35.389  1.00 26.93 ? 276 ILE B CD1   1 
ATOM   1135 N  N     . ALA B 1 59  ? 10.006  41.915 30.396  1.00 23.91 ? 277 ALA B N     1 
ATOM   1136 C  CA    . ALA B 1 59  ? 10.042  41.664 28.955  1.00 23.66 ? 277 ALA B CA    1 
ATOM   1137 C  C     . ALA B 1 59  ? 10.376  42.920 28.159  1.00 23.92 ? 277 ALA B C     1 
ATOM   1138 O  O     . ALA B 1 59  ? 9.900   44.009 28.469  1.00 23.56 ? 277 ALA B O     1 
ATOM   1139 C  CB    . ALA B 1 59  ? 8.724   41.099 28.482  1.00 22.82 ? 277 ALA B CB    1 
ATOM   1140 N  N     . LYS B 1 60  ? 11.184  42.751 27.119  1.00 24.51 ? 278 LYS B N     1 
ATOM   1141 C  CA    . LYS B 1 60  ? 11.429  43.818 26.152  1.00 25.18 ? 278 LYS B CA    1 
ATOM   1142 C  C     . LYS B 1 60  ? 10.098  44.183 25.477  1.00 24.03 ? 278 LYS B C     1 
ATOM   1143 O  O     . LYS B 1 60  ? 9.200   43.343 25.395  1.00 23.50 ? 278 LYS B O     1 
ATOM   1144 C  CB    . LYS B 1 60  ? 12.471  43.375 25.116  1.00 26.28 ? 278 LYS B CB    1 
ATOM   1145 C  CG    . LYS B 1 60  ? 13.814  42.944 25.738  1.00 27.69 ? 278 LYS B CG    1 
ATOM   1146 C  CD    . LYS B 1 60  ? 14.909  42.693 24.698  1.00 28.96 ? 278 LYS B CD    1 
ATOM   1147 C  CE    . LYS B 1 60  ? 14.481  41.672 23.632  1.00 29.95 ? 278 LYS B CE    1 
ATOM   1148 N  NZ    . LYS B 1 60  ? 15.588  41.356 22.667  1.00 30.59 ? 278 LYS B NZ    1 
ATOM   1149 N  N     . PRO B 1 61  ? 9.959   45.438 25.008  1.00 22.92 ? 279 PRO B N     1 
ATOM   1150 C  CA    . PRO B 1 61  ? 8.688   45.920 24.438  1.00 22.38 ? 279 PRO B CA    1 
ATOM   1151 C  C     . PRO B 1 61  ? 8.117   45.062 23.297  1.00 21.16 ? 279 PRO B C     1 
ATOM   1152 O  O     . PRO B 1 61  ? 6.907   45.068 23.086  1.00 21.73 ? 279 PRO B O     1 
ATOM   1153 C  CB    . PRO B 1 61  ? 9.038   47.317 23.905  1.00 22.84 ? 279 PRO B CB    1 
ATOM   1154 C  CG    . PRO B 1 61  ? 10.263  47.723 24.624  1.00 23.07 ? 279 PRO B CG    1 
ATOM   1155 C  CD    . PRO B 1 61  ? 11.010  46.471 24.968  1.00 23.23 ? 279 PRO B CD    1 
ATOM   1156 N  N     . GLY B 1 62  ? 8.977   44.336 22.581  1.00 19.15 ? 280 GLY B N     1 
ATOM   1157 C  CA    . GLY B 1 62  ? 8.555   43.482 21.470  1.00 18.52 ? 280 GLY B CA    1 
ATOM   1158 C  C     . GLY B 1 62  ? 7.583   42.362 21.829  1.00 18.16 ? 280 GLY B C     1 
ATOM   1159 O  O     . GLY B 1 62  ? 6.956   41.769 20.943  1.00 17.08 ? 280 GLY B O     1 
ATOM   1160 N  N     . TRP B 1 63  ? 7.441   42.057 23.112  1.00 16.27 ? 281 TRP B N     1 
ATOM   1161 C  CA    . TRP B 1 63  ? 6.469   41.055 23.509  1.00 17.32 ? 281 TRP B CA    1 
ATOM   1162 C  C     . TRP B 1 63  ? 5.066   41.383 22.987  1.00 17.85 ? 281 TRP B C     1 
ATOM   1163 O  O     . TRP B 1 63  ? 4.318   40.481 22.603  1.00 18.20 ? 281 TRP B O     1 
ATOM   1164 C  CB    . TRP B 1 63  ? 6.464   40.842 25.021  1.00 17.24 ? 281 TRP B CB    1 
ATOM   1165 C  CG    . TRP B 1 63  ? 5.713   41.821 25.821  1.00 18.18 ? 281 TRP B CG    1 
ATOM   1166 C  CD1   . TRP B 1 63  ? 6.189   42.979 26.353  1.00 19.01 ? 281 TRP B CD1   1 
ATOM   1167 C  CD2   . TRP B 1 63  ? 4.358   41.703 26.265  1.00 18.73 ? 281 TRP B CD2   1 
ATOM   1168 N  NE1   . TRP B 1 63  ? 5.207   43.608 27.073  1.00 19.00 ? 281 TRP B NE1   1 
ATOM   1169 C  CE2   . TRP B 1 63  ? 4.071   42.847 27.035  1.00 19.52 ? 281 TRP B CE2   1 
ATOM   1170 C  CE3   . TRP B 1 63  ? 3.359   40.754 26.075  1.00 19.54 ? 281 TRP B CE3   1 
ATOM   1171 C  CZ2   . TRP B 1 63  ? 2.826   43.061 27.620  1.00 20.04 ? 281 TRP B CZ2   1 
ATOM   1172 C  CZ3   . TRP B 1 63  ? 2.112   40.973 26.642  1.00 20.33 ? 281 TRP B CZ3   1 
ATOM   1173 C  CH2   . TRP B 1 63  ? 1.857   42.116 27.410  1.00 20.20 ? 281 TRP B CH2   1 
ATOM   1174 N  N     . LYS B 1 64  ? 4.715   42.666 22.959  1.00 17.50 ? 282 LYS B N     1 
ATOM   1175 C  CA    . LYS B 1 64  ? 3.424   43.076 22.405  1.00 17.69 ? 282 LYS B CA    1 
ATOM   1176 C  C     . LYS B 1 64  ? 3.303   42.750 20.905  1.00 17.58 ? 282 LYS B C     1 
ATOM   1177 O  O     . LYS B 1 64  ? 2.235   42.337 20.459  1.00 17.46 ? 282 LYS B O     1 
ATOM   1178 C  CB    . LYS B 1 64  ? 3.178   44.553 22.667  1.00 17.26 ? 282 LYS B CB    1 
ATOM   1179 C  CG    . LYS B 1 64  ? 2.903   44.829 24.131  1.00 17.66 ? 282 LYS B CG    1 
ATOM   1180 C  CD    . LYS B 1 64  ? 2.585   46.285 24.378  1.00 17.75 ? 282 LYS B CD    1 
ATOM   1181 C  CE    . LYS B 1 64  ? 2.209   46.531 25.827  1.00 17.65 ? 282 LYS B CE    1 
ATOM   1182 N  NZ    . LYS B 1 64  ? 2.001   47.981 26.069  1.00 18.73 ? 282 LYS B NZ    1 
ATOM   1183 N  N     . ASN B 1 65  ? 4.397   42.925 20.153  1.00 16.65 ? 283 ASN B N     1 
ATOM   1184 C  CA    A ASN B 1 65  ? 4.409   42.557 18.753  0.30 17.01 ? 283 ASN B CA    1 
ATOM   1185 C  CA    B ASN B 1 65  ? 4.479   42.538 18.736  0.70 17.45 ? 283 ASN B CA    1 
ATOM   1186 C  C     . ASN B 1 65  ? 4.169   41.048 18.616  1.00 18.61 ? 283 ASN B C     1 
ATOM   1187 O  O     . ASN B 1 65  ? 3.413   40.616 17.735  1.00 18.88 ? 283 ASN B O     1 
ATOM   1188 C  CB    A ASN B 1 65  ? 5.713   43.004 18.078  0.30 16.61 ? 283 ASN B CB    1 
ATOM   1189 C  CB    B ASN B 1 65  ? 5.890   42.856 18.172  0.70 18.24 ? 283 ASN B CB    1 
ATOM   1190 C  CG    A ASN B 1 65  ? 5.951   44.512 18.200  0.30 15.87 ? 283 ASN B CG    1 
ATOM   1191 C  CG    B ASN B 1 65  ? 6.060   42.541 16.660  0.70 18.88 ? 283 ASN B CG    1 
ATOM   1192 O  OD1   A ASN B 1 65  ? 5.076   45.254 18.643  0.03 15.57 ? 283 ASN B OD1   1 
ATOM   1193 O  OD1   B ASN B 1 65  ? 5.275   41.803 16.050  0.70 19.53 ? 283 ASN B OD1   1 
ATOM   1194 N  ND2   A ASN B 1 65  ? 7.143   44.959 17.824  0.30 15.08 ? 283 ASN B ND2   1 
ATOM   1195 N  ND2   B ASN B 1 65  ? 7.127   43.086 16.067  0.70 17.90 ? 283 ASN B ND2   1 
ATOM   1196 N  N     . SER B 1 66  ? 4.758   40.255 19.519  1.00 17.72 ? 284 SER B N     1 
ATOM   1197 C  CA    . SER B 1 66  ? 4.568   38.813 19.487  1.00 17.75 ? 284 SER B CA    1 
ATOM   1198 C  C     . SER B 1 66  ? 3.124   38.429 19.752  1.00 17.78 ? 284 SER B C     1 
ATOM   1199 O  O     . SER B 1 66  ? 2.634   37.487 19.161  1.00 18.84 ? 284 SER B O     1 
ATOM   1200 C  CB    . SER B 1 66  ? 5.491   38.109 20.485  1.00 17.70 ? 284 SER B CB    1 
ATOM   1201 O  OG    . SER B 1 66  ? 6.843   38.285 20.116  1.00 15.86 ? 284 SER B OG    1 
ATOM   1202 N  N     . ILE B 1 67  ? 2.439   39.144 20.639  1.00 18.06 ? 285 ILE B N     1 
ATOM   1203 C  CA    . ILE B 1 67  ? 1.014   38.906 20.840  1.00 17.98 ? 285 ILE B CA    1 
ATOM   1204 C  C     . ILE B 1 67  ? 0.232   39.136 19.544  1.00 18.59 ? 285 ILE B C     1 
ATOM   1205 O  O     . ILE B 1 67  ? -0.547  38.280 19.108  1.00 18.04 ? 285 ILE B O     1 
ATOM   1206 C  CB    . ILE B 1 67  ? 0.436   39.801 21.961  1.00 18.51 ? 285 ILE B CB    1 
ATOM   1207 C  CG1   . ILE B 1 67  ? 1.033   39.412 23.320  1.00 19.00 ? 285 ILE B CG1   1 
ATOM   1208 C  CG2   . ILE B 1 67  ? -1.096  39.698 22.013  1.00 16.33 ? 285 ILE B CG2   1 
ATOM   1209 C  CD1   . ILE B 1 67  ? 0.616   38.021 23.819  1.00 19.83 ? 285 ILE B CD1   1 
ATOM   1210 N  N     . ARG B 1 68  ? 0.448   40.282 18.911  1.00 19.59 ? 286 ARG B N     1 
ATOM   1211 C  CA    . ARG B 1 68  ? -0.268  40.590 17.661  1.00 18.86 ? 286 ARG B CA    1 
ATOM   1212 C  C     . ARG B 1 68  ? 0.048   39.536 16.592  1.00 18.32 ? 286 ARG B C     1 
ATOM   1213 O  O     . ARG B 1 68  ? -0.855  39.031 15.922  1.00 17.42 ? 286 ARG B O     1 
ATOM   1214 C  CB    . ARG B 1 68  ? 0.089   41.992 17.170  1.00 19.34 ? 286 ARG B CB    1 
ATOM   1215 C  CG    . ARG B 1 68  ? -0.379  43.104 18.118  1.00 19.36 ? 286 ARG B CG    1 
ATOM   1216 C  CD    . ARG B 1 68  ? -0.356  44.475 17.463  1.00 19.36 ? 286 ARG B CD    1 
ATOM   1217 N  NE    . ARG B 1 68  ? 0.962   44.867 16.951  1.00 19.62 ? 286 ARG B NE    1 
ATOM   1218 C  CZ    . ARG B 1 68  ? 1.992   45.261 17.702  1.00 20.28 ? 286 ARG B CZ    1 
ATOM   1219 N  NH1   . ARG B 1 68  ? 1.911   45.307 19.025  1.00 21.74 ? 286 ARG B NH1   1 
ATOM   1220 N  NH2   . ARG B 1 68  ? 3.124   45.613 17.134  1.00 21.14 ? 286 ARG B NH2   1 
ATOM   1221 N  N     . HIS B 1 69  ? 1.327   39.177 16.473  1.00 17.92 ? 287 HIS B N     1 
ATOM   1222 C  CA    . HIS B 1 69  ? 1.767   38.127 15.550  1.00 15.81 ? 287 HIS B CA    1 
ATOM   1223 C  C     . HIS B 1 69  ? 0.987   36.836 15.794  1.00 16.21 ? 287 HIS B C     1 
ATOM   1224 O  O     . HIS B 1 69  ? 0.461   36.232 14.857  1.00 14.83 ? 287 HIS B O     1 
ATOM   1225 C  CB    . HIS B 1 69  ? 3.272   37.883 15.697  1.00 14.38 ? 287 HIS B CB    1 
ATOM   1226 C  CG    . HIS B 1 69  ? 3.763   36.631 15.041  1.00 12.24 ? 287 HIS B CG    1 
ATOM   1227 N  ND1   . HIS B 1 69  ? 4.127   36.575 13.717  1.00 13.59 ? 287 HIS B ND1   1 
ATOM   1228 C  CD2   . HIS B 1 69  ? 3.989   35.394 15.542  1.00 13.57 ? 287 HIS B CD2   1 
ATOM   1229 C  CE1   . HIS B 1 69  ? 4.558   35.357 13.429  1.00 13.78 ? 287 HIS B CE1   1 
ATOM   1230 N  NE2   . HIS B 1 69  ? 4.486   34.621 14.521  1.00 14.06 ? 287 HIS B NE2   1 
ATOM   1231 N  N     . ASN B 1 70  ? 0.910   36.424 17.050  1.00 16.24 ? 288 ASN B N     1 
ATOM   1232 C  CA    . ASN B 1 70  ? 0.145   35.223 17.399  1.00 17.74 ? 288 ASN B CA    1 
ATOM   1233 C  C     . ASN B 1 70  ? -1.341  35.268 17.014  1.00 17.23 ? 288 ASN B C     1 
ATOM   1234 O  O     . ASN B 1 70  ? -1.861  34.308 16.460  1.00 17.11 ? 288 ASN B O     1 
ATOM   1235 C  CB    . ASN B 1 70  ? 0.312   34.866 18.882  1.00 17.53 ? 288 ASN B CB    1 
ATOM   1236 C  CG    . ASN B 1 70  ? 1.524   33.954 19.120  1.00 18.35 ? 288 ASN B CG    1 
ATOM   1237 O  OD1   . ASN B 1 70  ? 1.373   32.729 19.218  1.00 17.60 ? 288 ASN B OD1   1 
ATOM   1238 N  ND2   . ASN B 1 70  ? 2.738   34.546 19.160  1.00 16.36 ? 288 ASN B ND2   1 
ATOM   1239 N  N     . LEU B 1 71  ? -2.004  36.379 17.301  1.00 17.40 ? 289 LEU B N     1 
ATOM   1240 C  CA    . LEU B 1 71  ? -3.404  36.531 16.989  1.00 17.19 ? 289 LEU B CA    1 
ATOM   1241 C  C     . LEU B 1 71  ? -3.621  36.383 15.482  1.00 18.25 ? 289 LEU B C     1 
ATOM   1242 O  O     . LEU B 1 71  ? -4.528  35.662 15.065  1.00 18.69 ? 289 LEU B O     1 
ATOM   1243 C  CB    . LEU B 1 71  ? -3.950  37.877 17.507  1.00 16.92 ? 289 LEU B CB    1 
ATOM   1244 C  CG    . LEU B 1 71  ? -4.071  38.039 19.026  1.00 16.88 ? 289 LEU B CG    1 
ATOM   1245 C  CD1   . LEU B 1 71  ? -4.216  39.519 19.395  1.00 16.66 ? 289 LEU B CD1   1 
ATOM   1246 C  CD2   . LEU B 1 71  ? -5.229  37.204 19.630  1.00 15.40 ? 289 LEU B CD2   1 
ATOM   1247 N  N     . SER B 1 72  ? -2.785  37.029 14.668  1.00 19.47 ? 290 SER B N     1 
ATOM   1248 C  CA    . SER B 1 72  ? -2.924  36.923 13.201  1.00 20.49 ? 290 SER B CA    1 
ATOM   1249 C  C     . SER B 1 72  ? -2.460  35.585 12.646  1.00 19.98 ? 290 SER B C     1 
ATOM   1250 O  O     . SER B 1 72  ? -3.076  35.060 11.725  1.00 20.07 ? 290 SER B O     1 
ATOM   1251 C  CB    . SER B 1 72  ? -2.202  38.061 12.480  1.00 21.01 ? 290 SER B CB    1 
ATOM   1252 O  OG    . SER B 1 72  ? -2.835  39.296 12.748  1.00 20.70 ? 290 SER B OG    1 
ATOM   1253 N  N     . LEU B 1 73  ? -1.412  35.009 13.223  1.00 19.32 ? 291 LEU B N     1 
ATOM   1254 C  CA    . LEU B 1 73  ? -0.828  33.770 12.689  1.00 19.55 ? 291 LEU B CA    1 
ATOM   1255 C  C     . LEU B 1 73  ? -1.743  32.573 12.847  1.00 19.53 ? 291 LEU B C     1 
ATOM   1256 O  O     . LEU B 1 73  ? -1.900  31.785 11.927  1.00 19.29 ? 291 LEU B O     1 
ATOM   1257 C  CB    . LEU B 1 73  ? 0.485   33.426 13.395  1.00 19.65 ? 291 LEU B CB    1 
ATOM   1258 C  CG    . LEU B 1 73  ? 1.227   32.254 12.738  1.00 19.45 ? 291 LEU B CG    1 
ATOM   1259 C  CD1   . LEU B 1 73  ? 1.734   32.689 11.405  1.00 19.46 ? 291 LEU B CD1   1 
ATOM   1260 C  CD2   . LEU B 1 73  ? 2.357   31.747 13.601  1.00 20.60 ? 291 LEU B CD2   1 
ATOM   1261 N  N     . HIS B 1 74  ? -2.301  32.424 14.038  1.00 20.37 ? 292 HIS B N     1 
ATOM   1262 C  CA    . HIS B 1 74  ? -3.104  31.247 14.380  1.00 20.14 ? 292 HIS B CA    1 
ATOM   1263 C  C     . HIS B 1 74  ? -4.548  31.445 13.977  1.00 19.58 ? 292 HIS B C     1 
ATOM   1264 O  O     . HIS B 1 74  ? -5.197  32.427 14.370  1.00 17.29 ? 292 HIS B O     1 
ATOM   1265 C  CB    . HIS B 1 74  ? -2.994  30.965 15.871  1.00 20.07 ? 292 HIS B CB    1 
ATOM   1266 C  CG    . HIS B 1 74  ? -1.589  30.746 16.311  1.00 19.94 ? 292 HIS B CG    1 
ATOM   1267 N  ND1   . HIS B 1 74  ? -0.815  29.730 15.800  1.00 20.68 ? 292 HIS B ND1   1 
ATOM   1268 C  CD2   . HIS B 1 74  ? -0.792  31.445 17.151  1.00 19.22 ? 292 HIS B CD2   1 
ATOM   1269 C  CE1   . HIS B 1 74  ? 0.390   29.794 16.333  1.00 20.50 ? 292 HIS B CE1   1 
ATOM   1270 N  NE2   . HIS B 1 74  ? 0.427   30.822 17.159  1.00 19.30 ? 292 HIS B NE2   1 
ATOM   1271 N  N     . ASP B 1 75  ? -5.037  30.512 13.167  1.00 20.52 ? 293 ASP B N     1 
ATOM   1272 C  CA    . ASP B 1 75  ? -6.424  30.547 12.717  1.00 22.03 ? 293 ASP B CA    1 
ATOM   1273 C  C     . ASP B 1 75  ? -7.422  30.369 13.857  1.00 22.44 ? 293 ASP B C     1 
ATOM   1274 O  O     . ASP B 1 75  ? -8.566  30.789 13.725  1.00 22.62 ? 293 ASP B O     1 
ATOM   1275 C  CB    . ASP B 1 75  ? -6.670  29.490 11.658  1.00 21.67 ? 293 ASP B CB    1 
ATOM   1276 C  CG    . ASP B 1 75  ? -5.927  29.771 10.375  1.00 22.59 ? 293 ASP B CG    1 
ATOM   1277 O  OD1   . ASP B 1 75  ? -5.689  30.968 10.064  1.00 22.03 ? 293 ASP B OD1   1 
ATOM   1278 O  OD2   . ASP B 1 75  ? -5.599  28.780 9.676   1.00 23.39 ? 293 ASP B OD2   1 
ATOM   1279 N  N     . MET B 1 76  ? -6.984  29.778 14.971  1.00 23.53 ? 294 MET B N     1 
ATOM   1280 C  CA    . MET B 1 76  ? -7.848  29.620 16.144  1.00 24.02 ? 294 MET B CA    1 
ATOM   1281 C  C     . MET B 1 76  ? -8.262  30.964 16.723  1.00 22.41 ? 294 MET B C     1 
ATOM   1282 O  O     . MET B 1 76  ? -9.245  31.040 17.439  1.00 23.22 ? 294 MET B O     1 
ATOM   1283 C  CB    . MET B 1 76  ? -7.190  28.756 17.231  1.00 25.59 ? 294 MET B CB    1 
ATOM   1284 C  CG    . MET B 1 76  ? -6.047  29.402 17.995  1.00 27.65 ? 294 MET B CG    1 
ATOM   1285 S  SD    . MET B 1 76  ? -5.654  28.493 19.509  1.00 31.10 ? 294 MET B SD    1 
ATOM   1286 C  CE    . MET B 1 76  ? -6.994  29.002 20.575  1.00 30.91 ? 294 MET B CE    1 
ATOM   1287 N  N     . PHE B 1 77  ? -7.503  32.016 16.436  1.00 20.57 ? 295 PHE B N     1 
ATOM   1288 C  CA    . PHE B 1 77  ? -7.872  33.347 16.882  1.00 19.10 ? 295 PHE B CA    1 
ATOM   1289 C  C     . PHE B 1 77  ? -8.589  34.085 15.763  1.00 19.81 ? 295 PHE B C     1 
ATOM   1290 O  O     . PHE B 1 77  ? -8.033  34.316 14.687  1.00 19.83 ? 295 PHE B O     1 
ATOM   1291 C  CB    . PHE B 1 77  ? -6.649  34.110 17.346  1.00 18.52 ? 295 PHE B CB    1 
ATOM   1292 C  CG    . PHE B 1 77  ? -5.940  33.461 18.517  1.00 18.50 ? 295 PHE B CG    1 
ATOM   1293 C  CD1   . PHE B 1 77  ? -4.582  33.182 18.455  1.00 18.08 ? 295 PHE B CD1   1 
ATOM   1294 C  CD2   . PHE B 1 77  ? -6.636  33.134 19.678  1.00 18.28 ? 295 PHE B CD2   1 
ATOM   1295 C  CE1   . PHE B 1 77  ? -3.924  32.599 19.528  1.00 18.23 ? 295 PHE B CE1   1 
ATOM   1296 C  CE2   . PHE B 1 77  ? -5.987  32.544 20.756  1.00 18.41 ? 295 PHE B CE2   1 
ATOM   1297 C  CZ    . PHE B 1 77  ? -4.629  32.271 20.681  1.00 17.66 ? 295 PHE B CZ    1 
ATOM   1298 N  N     . VAL B 1 78  ? -9.843  34.419 16.025  1.00 20.58 ? 296 VAL B N     1 
ATOM   1299 C  CA    . VAL B 1 78  ? -10.729 34.984 15.020  1.00 20.96 ? 296 VAL B CA    1 
ATOM   1300 C  C     . VAL B 1 78  ? -11.144 36.360 15.489  1.00 21.44 ? 296 VAL B C     1 
ATOM   1301 O  O     . VAL B 1 78  ? -11.721 36.508 16.558  1.00 20.95 ? 296 VAL B O     1 
ATOM   1302 C  CB    . VAL B 1 78  ? -11.969 34.111 14.820  1.00 20.56 ? 296 VAL B CB    1 
ATOM   1303 C  CG1   . VAL B 1 78  ? -12.950 34.778 13.849  1.00 19.97 ? 296 VAL B CG1   1 
ATOM   1304 C  CG2   . VAL B 1 78  ? -11.568 32.742 14.314  1.00 20.16 ? 296 VAL B CG2   1 
ATOM   1305 N  N     . ARG B 1 79  ? -10.812 37.366 14.698  1.00 22.68 ? 297 ARG B N     1 
ATOM   1306 C  CA    . ARG B 1 79  ? -11.160 38.730 15.017  1.00 23.83 ? 297 ARG B CA    1 
ATOM   1307 C  C     . ARG B 1 79  ? -12.632 38.890 14.667  1.00 25.56 ? 297 ARG B C     1 
ATOM   1308 O  O     . ARG B 1 79  ? -13.115 38.268 13.727  1.00 25.29 ? 297 ARG B O     1 
ATOM   1309 C  CB    . ARG B 1 79  ? -10.305 39.684 14.200  1.00 23.91 ? 297 ARG B CB    1 
ATOM   1310 C  CG    . ARG B 1 79  ? -10.327 41.114 14.666  1.00 24.71 ? 297 ARG B CG    1 
ATOM   1311 C  CD    . ARG B 1 79  ? -9.887  42.077 13.559  1.00 25.33 ? 297 ARG B CD    1 
ATOM   1312 N  NE    . ARG B 1 79  ? -10.546 41.792 12.284  1.00 25.82 ? 297 ARG B NE    1 
ATOM   1313 C  CZ    . ARG B 1 79  ? -11.847 41.971 12.035  1.00 26.86 ? 297 ARG B CZ    1 
ATOM   1314 N  NH1   . ARG B 1 79  ? -12.673 42.449 12.971  1.00 27.78 ? 297 ARG B NH1   1 
ATOM   1315 N  NH2   . ARG B 1 79  ? -12.336 41.671 10.834  1.00 25.89 ? 297 ARG B NH2   1 
ATOM   1316 N  N     . GLU B 1 80  ? -13.342 39.702 15.439  1.00 27.13 ? 298 GLU B N     1 
ATOM   1317 C  CA    . GLU B 1 80  ? -14.768 39.869 15.267  1.00 29.08 ? 298 GLU B CA    1 
ATOM   1318 C  C     . GLU B 1 80  ? -15.183 41.244 15.706  1.00 29.16 ? 298 GLU B C     1 
ATOM   1319 O  O     . GLU B 1 80  ? -14.862 41.689 16.801  1.00 29.15 ? 298 GLU B O     1 
ATOM   1320 C  CB    . GLU B 1 80  ? -15.550 38.830 16.076  1.00 30.45 ? 298 GLU B CB    1 
ATOM   1321 C  CG    . GLU B 1 80  ? -15.488 37.429 15.484  1.00 31.54 ? 298 GLU B CG    1 
ATOM   1322 C  CD    . GLU B 1 80  ? -16.746 36.634 15.711  1.00 31.28 ? 298 GLU B CD    1 
ATOM   1323 O  OE1   . GLU B 1 80  ? -17.230 36.611 16.860  1.00 32.26 ? 298 GLU B OE1   1 
ATOM   1324 O  OE2   . GLU B 1 80  ? -17.238 36.028 14.742  1.00 30.78 ? 298 GLU B OE2   1 
ATOM   1325 N  N     . THR B 1 81  ? -15.906 41.920 14.837  1.00 29.40 ? 299 THR B N     1 
ATOM   1326 C  CA    . THR B 1 81  ? -16.453 43.197 15.183  1.00 30.19 ? 299 THR B CA    1 
ATOM   1327 C  C     . THR B 1 81  ? -17.761 42.923 15.904  1.00 30.53 ? 299 THR B C     1 
ATOM   1328 O  O     . THR B 1 81  ? -18.477 41.977 15.564  1.00 31.35 ? 299 THR B O     1 
ATOM   1329 C  CB    . THR B 1 81  ? -16.657 44.039 13.930  1.00 30.37 ? 299 THR B CB    1 
ATOM   1330 O  OG1   . THR B 1 81  ? -15.423 44.056 13.197  1.00 30.90 ? 299 THR B OG1   1 
ATOM   1331 C  CG2   . THR B 1 81  ? -17.066 45.452 14.293  1.00 29.67 ? 299 THR B CG2   1 
ATOM   1332 N  N     . SER B 1 82  ? -18.057 43.720 16.924  1.00 30.39 ? 300 SER B N     1 
ATOM   1333 C  CA    . SER B 1 82  ? -19.370 43.672 17.557  1.00 30.27 ? 300 SER B CA    1 
ATOM   1334 C  C     . SER B 1 82  ? -20.461 43.785 16.488  1.00 30.44 ? 300 SER B C     1 
ATOM   1335 O  O     . SER B 1 82  ? -20.186 44.178 15.349  1.00 29.95 ? 300 SER B O     1 
ATOM   1336 C  CB    . SER B 1 82  ? -19.503 44.800 18.583  1.00 30.06 ? 300 SER B CB    1 
ATOM   1337 O  OG    . SER B 1 82  ? -18.835 45.968 18.138  1.00 29.94 ? 300 SER B OG    1 
ATOM   1338 N  N     . ALA B 1 83  ? -21.692 43.429 16.847  1.00 30.94 ? 301 ALA B N     1 
ATOM   1339 C  CA    . ALA B 1 83  ? -22.821 43.615 15.942  1.00 31.47 ? 301 ALA B CA    1 
ATOM   1340 C  C     . ALA B 1 83  ? -22.987 45.104 15.634  1.00 32.13 ? 301 ALA B C     1 
ATOM   1341 O  O     . ALA B 1 83  ? -23.406 45.473 14.538  1.00 32.26 ? 301 ALA B O     1 
ATOM   1342 C  CB    . ALA B 1 83  ? -24.096 43.046 16.544  1.00 31.31 ? 301 ALA B CB    1 
ATOM   1343 N  N     . ASN B 1 84  ? -22.630 45.946 16.605  1.00 32.83 ? 302 ASN B N     1 
ATOM   1344 C  CA    . ASN B 1 84  ? -22.701 47.404 16.472  1.00 32.84 ? 302 ASN B CA    1 
ATOM   1345 C  C     . ASN B 1 84  ? -21.537 48.011 15.651  1.00 32.29 ? 302 ASN B C     1 
ATOM   1346 O  O     . ASN B 1 84  ? -21.512 49.215 15.387  1.00 31.64 ? 302 ASN B O     1 
ATOM   1347 C  CB    . ASN B 1 84  ? -22.769 48.023 17.876  1.00 33.37 ? 302 ASN B CB    1 
ATOM   1348 C  CG    . ASN B 1 84  ? -23.243 49.464 17.867  1.00 34.39 ? 302 ASN B CG    1 
ATOM   1349 O  OD1   . ASN B 1 84  ? -24.445 49.756 18.009  1.00 34.92 ? 302 ASN B OD1   1 
ATOM   1350 N  ND2   . ASN B 1 84  ? -22.298 50.380 17.702  1.00 34.91 ? 302 ASN B ND2   1 
ATOM   1351 N  N     . GLY B 1 85  ? -20.570 47.183 15.257  1.00 31.42 ? 303 GLY B N     1 
ATOM   1352 C  CA    . GLY B 1 85  ? -19.505 47.614 14.346  1.00 30.79 ? 303 GLY B CA    1 
ATOM   1353 C  C     . GLY B 1 85  ? -18.363 48.397 14.978  1.00 29.97 ? 303 GLY B C     1 
ATOM   1354 O  O     . GLY B 1 85  ? -17.354 48.658 14.323  1.00 29.71 ? 303 GLY B O     1 
ATOM   1355 N  N     . LYS B 1 86  ? -18.504 48.748 16.253  1.00 29.32 ? 304 LYS B N     1 
ATOM   1356 C  CA    . LYS B 1 86  ? -17.634 49.739 16.883  1.00 28.92 ? 304 LYS B CA    1 
ATOM   1357 C  C     . LYS B 1 86  ? -16.377 49.163 17.526  1.00 28.47 ? 304 LYS B C     1 
ATOM   1358 O  O     . LYS B 1 86  ? -15.331 49.814 17.522  1.00 29.35 ? 304 LYS B O     1 
ATOM   1359 C  CB    . LYS B 1 86  ? -18.426 50.550 17.913  1.00 29.14 ? 304 LYS B CB    1 
ATOM   1360 C  CG    . LYS B 1 86  ? -19.359 51.546 17.272  1.00 29.09 ? 304 LYS B CG    1 
ATOM   1361 C  CD    . LYS B 1 86  ? -19.948 52.500 18.291  1.00 29.49 ? 304 LYS B CD    1 
ATOM   1362 C  CE    . LYS B 1 86  ? -20.724 53.607 17.593  1.00 29.66 ? 304 LYS B CE    1 
ATOM   1363 N  NZ    . LYS B 1 86  ? -21.231 54.640 18.536  1.00 30.32 ? 304 LYS B NZ    1 
ATOM   1364 N  N     . VAL B 1 87  ? -16.473 47.956 18.076  1.00 27.21 ? 305 VAL B N     1 
ATOM   1365 C  CA    . VAL B 1 87  ? -15.341 47.331 18.760  1.00 25.83 ? 305 VAL B CA    1 
ATOM   1366 C  C     . VAL B 1 87  ? -14.858 46.113 17.990  1.00 25.72 ? 305 VAL B C     1 
ATOM   1367 O  O     . VAL B 1 87  ? -15.662 45.379 17.418  1.00 26.39 ? 305 VAL B O     1 
ATOM   1368 C  CB    . VAL B 1 87  ? -15.732 46.902 20.188  1.00 25.28 ? 305 VAL B CB    1 
ATOM   1369 C  CG1   . VAL B 1 87  ? -14.515 46.403 20.951  1.00 24.30 ? 305 VAL B CG1   1 
ATOM   1370 C  CG2   . VAL B 1 87  ? -16.390 48.067 20.928  1.00 23.89 ? 305 VAL B CG2   1 
ATOM   1371 N  N     . SER B 1 88  ? -13.541 45.912 17.975  1.00 25.00 ? 306 SER B N     1 
ATOM   1372 C  CA    . SER B 1 88  ? -12.930 44.718 17.401  1.00 24.32 ? 306 SER B CA    1 
ATOM   1373 C  C     . SER B 1 88  ? -12.466 43.806 18.536  1.00 23.93 ? 306 SER B C     1 
ATOM   1374 O  O     . SER B 1 88  ? -11.668 44.215 19.384  1.00 23.80 ? 306 SER B O     1 
ATOM   1375 C  CB    . SER B 1 88  ? -11.740 45.095 16.512  1.00 24.23 ? 306 SER B CB    1 
ATOM   1376 O  OG    . SER B 1 88  ? -11.100 43.941 15.989  1.00 23.75 ? 306 SER B OG    1 
ATOM   1377 N  N     . PHE B 1 89  ? -12.974 42.575 18.542  1.00 23.13 ? 307 PHE B N     1 
ATOM   1378 C  CA    . PHE B 1 89  ? -12.659 41.598 19.573  1.00 22.77 ? 307 PHE B CA    1 
ATOM   1379 C  C     . PHE B 1 89  ? -11.912 40.437 18.980  1.00 22.56 ? 307 PHE B C     1 
ATOM   1380 O  O     . PHE B 1 89  ? -12.146 40.064 17.825  1.00 22.50 ? 307 PHE B O     1 
ATOM   1381 C  CB    . PHE B 1 89  ? -13.927 41.008 20.177  1.00 23.23 ? 307 PHE B CB    1 
ATOM   1382 C  CG    . PHE B 1 89  ? -14.691 41.950 21.041  1.00 23.25 ? 307 PHE B CG    1 
ATOM   1383 C  CD1   . PHE B 1 89  ? -14.379 42.082 22.387  1.00 23.83 ? 307 PHE B CD1   1 
ATOM   1384 C  CD2   . PHE B 1 89  ? -15.747 42.680 20.522  1.00 23.66 ? 307 PHE B CD2   1 
ATOM   1385 C  CE1   . PHE B 1 89  ? -15.108 42.943 23.206  1.00 23.79 ? 307 PHE B CE1   1 
ATOM   1386 C  CE2   . PHE B 1 89  ? -16.481 43.546 21.329  1.00 23.70 ? 307 PHE B CE2   1 
ATOM   1387 C  CZ    . PHE B 1 89  ? -16.158 43.678 22.670  1.00 23.62 ? 307 PHE B CZ    1 
ATOM   1388 N  N     . TRP B 1 90  ? -11.036 39.850 19.790  1.00 19.67 ? 308 TRP B N     1 
ATOM   1389 C  CA    . TRP B 1 90  ? -10.501 38.549 19.496  1.00 18.80 ? 308 TRP B CA    1 
ATOM   1390 C  C     . TRP B 1 90  ? -11.296 37.489 20.232  1.00 18.36 ? 308 TRP B C     1 
ATOM   1391 O  O     . TRP B 1 90  ? -11.704 37.677 21.384  1.00 19.81 ? 308 TRP B O     1 
ATOM   1392 C  CB    . TRP B 1 90  ? -9.033  38.491 19.872  1.00 19.93 ? 308 TRP B CB    1 
ATOM   1393 C  CG    . TRP B 1 90  ? -8.249  39.385 18.984  1.00 20.77 ? 308 TRP B CG    1 
ATOM   1394 C  CD1   . TRP B 1 90  ? -7.852  40.664 19.246  1.00 20.31 ? 308 TRP B CD1   1 
ATOM   1395 C  CD2   . TRP B 1 90  ? -7.822  39.089 17.657  1.00 19.36 ? 308 TRP B CD2   1 
ATOM   1396 N  NE1   . TRP B 1 90  ? -7.166  41.169 18.171  1.00 20.50 ? 308 TRP B NE1   1 
ATOM   1397 C  CE2   . TRP B 1 90  ? -7.137  40.223 17.178  1.00 20.20 ? 308 TRP B CE2   1 
ATOM   1398 C  CE3   . TRP B 1 90  ? -7.936  37.972 16.831  1.00 19.57 ? 308 TRP B CE3   1 
ATOM   1399 C  CZ2   . TRP B 1 90  ? -6.575  40.274 15.900  1.00 19.26 ? 308 TRP B CZ2   1 
ATOM   1400 C  CZ3   . TRP B 1 90  ? -7.369  38.022 15.561  1.00 19.19 ? 308 TRP B CZ3   1 
ATOM   1401 C  CH2   . TRP B 1 90  ? -6.698  39.165 15.114  1.00 19.02 ? 308 TRP B CH2   1 
ATOM   1402 N  N     . THR B 1 91  ? -11.511 36.376 19.543  1.00 16.89 ? 309 THR B N     1 
ATOM   1403 C  CA    . THR B 1 91  ? -12.301 35.268 20.032  1.00 16.32 ? 309 THR B CA    1 
ATOM   1404 C  C     . THR B 1 91  ? -11.547 34.015 19.641  1.00 17.66 ? 309 THR B C     1 
ATOM   1405 O  O     . THR B 1 91  ? -10.530 34.089 18.922  1.00 18.21 ? 309 THR B O     1 
ATOM   1406 C  CB    . THR B 1 91  ? -13.686 35.227 19.343  1.00 16.24 ? 309 THR B CB    1 
ATOM   1407 O  OG1   . THR B 1 91  ? -13.491 35.065 17.936  1.00 16.66 ? 309 THR B OG1   1 
ATOM   1408 C  CG2   . THR B 1 91  ? -14.491 36.511 19.603  1.00 14.58 ? 309 THR B CG2   1 
ATOM   1409 N  N     . ILE B 1 92  ? -12.057 32.868 20.070  1.00 18.79 ? 310 ILE B N     1 
ATOM   1410 C  CA    . ILE B 1 92  ? -11.452 31.576 19.768  1.00 20.42 ? 310 ILE B CA    1 
ATOM   1411 C  C     . ILE B 1 92  ? -12.338 30.739 18.832  1.00 21.22 ? 310 ILE B C     1 
ATOM   1412 O  O     . ILE B 1 92  ? -13.541 30.648 19.023  1.00 20.09 ? 310 ILE B O     1 
ATOM   1413 C  CB    . ILE B 1 92  ? -11.162 30.798 21.064  1.00 21.12 ? 310 ILE B CB    1 
ATOM   1414 C  CG1   . ILE B 1 92  ? -10.153 31.574 21.921  1.00 22.09 ? 310 ILE B CG1   1 
ATOM   1415 C  CG2   . ILE B 1 92  ? -10.617 29.410 20.747  1.00 21.45 ? 310 ILE B CG2   1 
ATOM   1416 C  CD1   . ILE B 1 92  ? -10.063 31.089 23.384  1.00 22.90 ? 310 ILE B CD1   1 
ATOM   1417 N  N     . HIS B 1 93  ? -11.730 30.120 17.824  1.00 22.23 ? 311 HIS B N     1 
ATOM   1418 C  CA    . HIS B 1 93  ? -12.474 29.311 16.859  1.00 23.80 ? 311 HIS B CA    1 
ATOM   1419 C  C     . HIS B 1 93  ? -13.093 28.036 17.496  1.00 24.50 ? 311 HIS B C     1 
ATOM   1420 O  O     . HIS B 1 93  ? -12.391 27.283 18.169  1.00 23.15 ? 311 HIS B O     1 
ATOM   1421 C  CB    . HIS B 1 93  ? -11.561 28.926 15.690  1.00 24.36 ? 311 HIS B CB    1 
ATOM   1422 C  CG    . HIS B 1 93  ? -12.296 28.508 14.458  1.00 24.59 ? 311 HIS B CG    1 
ATOM   1423 N  ND1   . HIS B 1 93  ? -12.589 27.191 14.175  1.00 25.25 ? 311 HIS B ND1   1 
ATOM   1424 C  CD2   . HIS B 1 93  ? -12.785 29.233 13.425  1.00 24.86 ? 311 HIS B CD2   1 
ATOM   1425 C  CE1   . HIS B 1 93  ? -13.234 27.123 13.023  1.00 24.52 ? 311 HIS B CE1   1 
ATOM   1426 N  NE2   . HIS B 1 93  ? -13.365 28.348 12.547  1.00 24.60 ? 311 HIS B NE2   1 
ATOM   1427 N  N     . PRO B 1 94  ? -14.406 27.799 17.274  1.00 26.11 ? 312 PRO B N     1 
ATOM   1428 C  CA    . PRO B 1 94  ? -15.148 26.635 17.768  1.00 27.32 ? 312 PRO B CA    1 
ATOM   1429 C  C     . PRO B 1 94  ? -14.593 25.262 17.396  1.00 29.03 ? 312 PRO B C     1 
ATOM   1430 O  O     . PRO B 1 94  ? -14.702 24.343 18.193  1.00 29.49 ? 312 PRO B O     1 
ATOM   1431 C  CB    . PRO B 1 94  ? -16.521 26.808 17.126  1.00 27.23 ? 312 PRO B CB    1 
ATOM   1432 C  CG    . PRO B 1 94  ? -16.688 28.241 17.012  1.00 27.27 ? 312 PRO B CG    1 
ATOM   1433 C  CD    . PRO B 1 94  ? -15.325 28.788 16.682  1.00 26.71 ? 312 PRO B CD    1 
ATOM   1434 N  N     . SER B 1 95  ? -14.034 25.103 16.199  1.00 31.23 ? 313 SER B N     1 
ATOM   1435 C  CA    . SER B 1 95  ? -13.402 23.825 15.832  1.00 32.98 ? 313 SER B CA    1 
ATOM   1436 C  C     . SER B 1 95  ? -12.082 23.577 16.582  1.00 34.49 ? 313 SER B C     1 
ATOM   1437 O  O     . SER B 1 95  ? -11.484 22.510 16.453  1.00 35.48 ? 313 SER B O     1 
ATOM   1438 C  CB    . SER B 1 95  ? -13.171 23.721 14.321  1.00 32.78 ? 313 SER B CB    1 
ATOM   1439 O  OG    . SER B 1 95  ? -14.370 23.381 13.646  1.00 33.06 ? 313 SER B OG    1 
ATOM   1440 N  N     . ALA B 1 96  ? -11.620 24.555 17.350  1.00 35.81 ? 314 ALA B N     1 
ATOM   1441 C  CA    . ALA B 1 96  ? -10.425 24.370 18.159  1.00 37.51 ? 314 ALA B CA    1 
ATOM   1442 C  C     . ALA B 1 96  ? -10.486 25.200 19.422  1.00 38.40 ? 314 ALA B C     1 
ATOM   1443 O  O     . ALA B 1 96  ? -9.539  25.926 19.706  1.00 39.60 ? 314 ALA B O     1 
ATOM   1444 C  CB    . ALA B 1 96  ? -9.170  24.739 17.359  1.00 37.54 ? 314 ALA B CB    1 
ATOM   1445 N  N     . ASN B 1 97  ? -11.596 25.125 20.163  1.00 39.23 ? 315 ASN B N     1 
ATOM   1446 C  CA    . ASN B 1 97  ? -11.619 25.675 21.525  1.00 39.86 ? 315 ASN B CA    1 
ATOM   1447 C  C     . ASN B 1 97  ? -11.575 24.533 22.540  1.00 39.35 ? 315 ASN B C     1 
ATOM   1448 O  O     . ASN B 1 97  ? -12.577 23.847 22.782  1.00 39.28 ? 315 ASN B O     1 
ATOM   1449 C  CB    . ASN B 1 97  ? -12.816 26.608 21.799  1.00 40.25 ? 315 ASN B CB    1 
ATOM   1450 C  CG    . ASN B 1 97  ? -12.630 27.436 23.090  1.00 40.46 ? 315 ASN B CG    1 
ATOM   1451 O  OD1   . ASN B 1 97  ? -11.643 27.277 23.801  1.00 40.05 ? 315 ASN B OD1   1 
ATOM   1452 N  ND2   . ASN B 1 97  ? -13.579 28.318 23.383  1.00 41.17 ? 315 ASN B ND2   1 
ATOM   1453 N  N     . ARG B 1 98  ? -10.390 24.335 23.114  1.00 37.88 ? 316 ARG B N     1 
ATOM   1454 C  CA    . ARG B 1 98  ? -10.187 23.319 24.129  1.00 36.97 ? 316 ARG B CA    1 
ATOM   1455 C  C     . ARG B 1 98  ? -10.519 23.905 25.493  1.00 34.63 ? 316 ARG B C     1 
ATOM   1456 O  O     . ARG B 1 98  ? -10.533 23.211 26.500  1.00 34.56 ? 316 ARG B O     1 
ATOM   1457 C  CB    . ARG B 1 98  ? -8.764  22.765 24.021  1.00 38.14 ? 316 ARG B CB    1 
ATOM   1458 C  CG    . ARG B 1 98  ? -8.674  21.726 22.893  1.00 39.49 ? 316 ARG B CG    1 
ATOM   1459 C  CD    . ARG B 1 98  ? -7.440  21.846 21.995  1.00 40.55 ? 316 ARG B CD    1 
ATOM   1460 N  NE    . ARG B 1 98  ? -7.734  21.387 20.627  1.00 41.27 ? 316 ARG B NE    1 
ATOM   1461 C  CZ    . ARG B 1 98  ? -7.938  20.118 20.264  1.00 41.81 ? 316 ARG B CZ    1 
ATOM   1462 N  NH1   . ARG B 1 98  ? -7.887  19.128 21.153  1.00 42.19 ? 316 ARG B NH1   1 
ATOM   1463 N  NH2   . ARG B 1 98  ? -8.200  19.831 18.993  1.00 42.26 ? 316 ARG B NH2   1 
ATOM   1464 N  N     . TYR B 1 99  ? -10.847 25.191 25.484  1.00 32.27 ? 317 TYR B N     1 
ATOM   1465 C  CA    . TYR B 1 99  ? -11.250 25.938 26.663  1.00 30.53 ? 317 TYR B CA    1 
ATOM   1466 C  C     . TYR B 1 99  ? -10.189 25.969 27.770  1.00 27.69 ? 317 TYR B C     1 
ATOM   1467 O  O     . TYR B 1 99  ? -10.350 25.383 28.840  1.00 27.27 ? 317 TYR B O     1 
ATOM   1468 C  CB    . TYR B 1 99  ? -12.617 25.499 27.199  1.00 31.03 ? 317 TYR B CB    1 
ATOM   1469 C  CG    . TYR B 1 99  ? -13.160 26.576 28.103  1.00 32.45 ? 317 TYR B CG    1 
ATOM   1470 C  CD1   . TYR B 1 99  ? -13.472 27.836 27.586  1.00 32.99 ? 317 TYR B CD1   1 
ATOM   1471 C  CD2   . TYR B 1 99  ? -13.281 26.378 29.477  1.00 32.92 ? 317 TYR B CD2   1 
ATOM   1472 C  CE1   . TYR B 1 99  ? -13.929 28.855 28.402  1.00 33.59 ? 317 TYR B CE1   1 
ATOM   1473 C  CE2   . TYR B 1 99  ? -13.749 27.396 30.304  1.00 33.52 ? 317 TYR B CE2   1 
ATOM   1474 C  CZ    . TYR B 1 99  ? -14.068 28.631 29.755  1.00 33.80 ? 317 TYR B CZ    1 
ATOM   1475 O  OH    . TYR B 1 99  ? -14.525 29.649 30.551  1.00 35.04 ? 317 TYR B OH    1 
ATOM   1476 N  N     . LEU B 1 100 ? -9.111  26.676 27.497  1.00 24.72 ? 318 LEU B N     1 
ATOM   1477 C  CA    . LEU B 1 100 ? -8.030  26.880 28.417  1.00 23.86 ? 318 LEU B CA    1 
ATOM   1478 C  C     . LEU B 1 100 ? -8.292  28.065 29.297  1.00 22.39 ? 318 LEU B C     1 
ATOM   1479 O  O     . LEU B 1 100 ? -8.544  29.125 28.830  1.00 21.95 ? 318 LEU B O     1 
ATOM   1480 C  CB    . LEU B 1 100 ? -6.761  27.153 27.661  1.00 20.00 ? 318 LEU B CB    1 
ATOM   1481 C  CG    . LEU B 1 100 ? -6.108  26.069 26.850  1.00 20.00 ? 318 LEU B CG    1 
ATOM   1482 C  CD1   . LEU B 1 100 ? -4.740  26.482 26.435  1.00 20.00 ? 318 LEU B CD1   1 
ATOM   1483 C  CD2   . LEU B 1 100 ? -6.043  24.850 27.633  1.00 20.00 ? 318 LEU B CD2   1 
ATOM   1484 N  N     . THR B 1 101 ? -8.206  27.866 30.590  1.00 20.91 ? 319 THR B N     1 
ATOM   1485 C  CA    . THR B 1 101 ? -8.319  28.958 31.555  1.00 20.66 ? 319 THR B CA    1 
ATOM   1486 C  C     . THR B 1 101 ? -7.163  28.887 32.561  1.00 19.77 ? 319 THR B C     1 
ATOM   1487 O  O     . THR B 1 101 ? -6.684  27.792 32.882  1.00 18.89 ? 319 THR B O     1 
ATOM   1488 C  CB    . THR B 1 101 ? -9.636  28.860 32.336  1.00 20.58 ? 319 THR B CB    1 
ATOM   1489 O  OG1   . THR B 1 101 ? -9.751  27.541 32.868  1.00 19.96 ? 319 THR B OG1   1 
ATOM   1490 C  CG2   . THR B 1 101 ? -10.833 29.139 31.435  1.00 20.95 ? 319 THR B CG2   1 
ATOM   1491 N  N     . LEU B 1 102 ? -6.738  30.053 33.058  1.00 19.74 ? 320 LEU B N     1 
ATOM   1492 C  CA    . LEU B 1 102 ? -5.660  30.158 34.076  1.00 18.72 ? 320 LEU B CA    1 
ATOM   1493 C  C     . LEU B 1 102 ? -5.763  29.134 35.193  1.00 18.42 ? 320 LEU B C     1 
ATOM   1494 O  O     . LEU B 1 102 ? -4.773  28.483 35.522  1.00 17.00 ? 320 LEU B O     1 
ATOM   1495 C  CB    . LEU B 1 102 ? -5.623  31.550 34.716  1.00 17.98 ? 320 LEU B CB    1 
ATOM   1496 C  CG    . LEU B 1 102 ? -4.378  31.820 35.580  1.00 17.96 ? 320 LEU B CG    1 
ATOM   1497 C  CD1   . LEU B 1 102 ? -3.134  31.536 34.758  1.00 16.01 ? 320 LEU B CD1   1 
ATOM   1498 C  CD2   . LEU B 1 102 ? -4.341  33.242 36.173  1.00 14.62 ? 320 LEU B CD2   1 
ATOM   1499 N  N     . ASP B 1 103 ? -6.961  28.984 35.754  1.00 19.19 ? 321 ASP B N     1 
ATOM   1500 C  CA    . ASP B 1 103 ? -7.185  28.103 36.905  1.00 20.85 ? 321 ASP B CA    1 
ATOM   1501 C  C     . ASP B 1 103 ? -6.744  26.663 36.643  1.00 21.28 ? 321 ASP B C     1 
ATOM   1502 O  O     . ASP B 1 103 ? -6.426  25.931 37.577  1.00 21.09 ? 321 ASP B O     1 
ATOM   1503 C  CB    . ASP B 1 103 ? -8.656  28.140 37.359  1.00 22.20 ? 321 ASP B CB    1 
ATOM   1504 C  CG    . ASP B 1 103 ? -9.629  27.738 36.255  1.00 23.87 ? 321 ASP B CG    1 
ATOM   1505 O  OD1   . ASP B 1 103 ? -9.250  27.762 35.084  1.00 27.55 ? 321 ASP B OD1   1 
ATOM   1506 O  OD2   . ASP B 1 103 ? -10.785 27.398 36.541  1.00 26.32 ? 321 ASP B OD2   1 
ATOM   1507 N  N     . GLN B 1 104 ? -6.719  26.267 35.377  1.00 21.64 ? 322 GLN B N     1 
ATOM   1508 C  CA    . GLN B 1 104 ? -6.305  24.918 34.985  1.00 22.48 ? 322 GLN B CA    1 
ATOM   1509 C  C     . GLN B 1 104 ? -4.793  24.724 35.097  1.00 22.70 ? 322 GLN B C     1 
ATOM   1510 O  O     . GLN B 1 104 ? -4.322  23.595 35.111  1.00 23.45 ? 322 GLN B O     1 
ATOM   1511 C  CB    . GLN B 1 104 ? -6.783  24.601 33.552  1.00 22.35 ? 322 GLN B CB    1 
ATOM   1512 C  CG    . GLN B 1 104 ? -8.305  24.432 33.446  1.00 22.36 ? 322 GLN B CG    1 
ATOM   1513 C  CD    . GLN B 1 104 ? -8.855  24.550 32.014  1.00 23.34 ? 322 GLN B CD    1 
ATOM   1514 O  OE1   . GLN B 1 104 ? -8.113  24.647 31.044  1.00 23.65 ? 322 GLN B OE1   1 
ATOM   1515 N  NE2   . GLN B 1 104 ? -10.170 24.564 31.899  1.00 23.21 ? 322 GLN B NE2   1 
ATOM   1516 N  N     . VAL B 1 105 ? -4.040  25.812 35.205  1.00 22.98 ? 323 VAL B N     1 
ATOM   1517 C  CA    . VAL B 1 105 ? -2.585  25.730 35.299  1.00 23.72 ? 323 VAL B CA    1 
ATOM   1518 C  C     . VAL B 1 105 ? -2.059  25.535 36.725  1.00 22.76 ? 323 VAL B C     1 
ATOM   1519 O  O     . VAL B 1 105 ? -0.855  25.386 36.915  1.00 23.82 ? 323 VAL B O     1 
ATOM   1520 C  CB    . VAL B 1 105 ? -1.902  27.002 34.758  1.00 24.27 ? 323 VAL B CB    1 
ATOM   1521 C  CG1   . VAL B 1 105 ? -2.679  27.578 33.623  1.00 24.66 ? 323 VAL B CG1   1 
ATOM   1522 C  CG2   . VAL B 1 105 ? -1.708  28.055 35.878  1.00 25.38 ? 323 VAL B CG2   1 
ATOM   1523 N  N     . PHE B 1 106 ? -2.933  25.555 37.724  1.00 21.80 ? 324 PHE B N     1 
ATOM   1524 C  CA    . PHE B 1 106 ? -2.480  25.569 39.117  1.00 20.15 ? 324 PHE B CA    1 
ATOM   1525 C  C     . PHE B 1 106 ? -2.406  24.157 39.702  1.00 21.04 ? 324 PHE B C     1 
ATOM   1526 O  O     . PHE B 1 106 ? -3.384  23.424 39.664  1.00 21.42 ? 324 PHE B O     1 
ATOM   1527 C  CB    . PHE B 1 106 ? -3.397  26.462 39.963  1.00 18.91 ? 324 PHE B CB    1 
ATOM   1528 C  CG    . PHE B 1 106 ? -3.217  27.941 39.717  1.00 17.45 ? 324 PHE B CG    1 
ATOM   1529 C  CD1   . PHE B 1 106 ? -1.951  28.518 39.712  1.00 16.87 ? 324 PHE B CD1   1 
ATOM   1530 C  CD2   . PHE B 1 106 ? -4.322  28.765 39.527  1.00 17.32 ? 324 PHE B CD2   1 
ATOM   1531 C  CE1   . PHE B 1 106 ? -1.780  29.884 39.489  1.00 16.76 ? 324 PHE B CE1   1 
ATOM   1532 C  CE2   . PHE B 1 106 ? -4.164  30.134 39.309  1.00 17.61 ? 324 PHE B CE2   1 
ATOM   1533 C  CZ    . PHE B 1 106 ? -2.887  30.699 39.285  1.00 17.25 ? 324 PHE B CZ    1 
ATOM   1534 N  N     . LYS B 1 107 ? -1.229  23.775 40.199  1.00 21.70 ? 325 LYS B N     1 
ATOM   1535 C  CA    . LYS B 1 107 ? -1.042  22.520 40.925  1.00 23.25 ? 325 LYS B CA    1 
ATOM   1536 C  C     . LYS B 1 107 ? -1.425  22.750 42.360  1.00 23.64 ? 325 LYS B C     1 
ATOM   1537 O  O     . LYS B 1 107 ? -1.045  23.763 42.929  1.00 21.30 ? 325 LYS B O     1 
ATOM   1538 C  CB    . LYS B 1 107 ? 0.429   22.073 40.938  1.00 24.22 ? 325 LYS B CB    1 
ATOM   1539 C  CG    . LYS B 1 107 ? 0.982   21.635 39.600  1.00 25.43 ? 325 LYS B CG    1 
ATOM   1540 C  CD    . LYS B 1 107 ? 2.491   21.463 39.612  1.00 25.83 ? 325 LYS B CD    1 
ATOM   1541 C  CE    . LYS B 1 107 ? 2.927   20.313 40.462  1.00 26.38 ? 325 LYS B CE    1 
ATOM   1542 N  NZ    . LYS B 1 107 ? 4.334   19.953 40.139  1.00 27.69 ? 325 LYS B NZ    1 
ATOM   1543 N  N     . PRO B 1 108 ? -2.148  21.795 42.964  1.00 25.76 ? 326 PRO B N     1 
ATOM   1544 C  CA    . PRO B 1 108 ? -2.315  21.850 44.405  1.00 27.66 ? 326 PRO B CA    1 
ATOM   1545 C  C     . PRO B 1 108 ? -0.962  21.575 45.050  1.00 30.26 ? 326 PRO B C     1 
ATOM   1546 O  O     . PRO B 1 108 ? -0.166  20.819 44.492  1.00 29.45 ? 326 PRO B O     1 
ATOM   1547 C  CB    . PRO B 1 108 ? -3.312  20.723 44.687  1.00 27.08 ? 326 PRO B CB    1 
ATOM   1548 C  CG    . PRO B 1 108 ? -3.116  19.751 43.588  1.00 26.56 ? 326 PRO B CG    1 
ATOM   1549 C  CD    . PRO B 1 108 ? -2.650  20.531 42.392  1.00 26.13 ? 326 PRO B CD    1 
ATOM   1550 N  N     . LEU B 1 109 ? -0.688  22.199 46.190  1.00 34.15 ? 327 LEU B N     1 
ATOM   1551 C  CA    . LEU B 1 109 ? 0.635   22.079 46.801  1.00 37.83 ? 327 LEU B CA    1 
ATOM   1552 C  C     . LEU B 1 109 ? 0.875   20.694 47.415  1.00 42.53 ? 327 LEU B C     1 
ATOM   1553 O  O     . LEU B 1 109 ? 0.021   20.163 48.133  1.00 41.68 ? 327 LEU B O     1 
ATOM   1554 C  CB    . LEU B 1 109 ? 0.882   23.189 47.835  1.00 36.77 ? 327 LEU B CB    1 
ATOM   1555 C  CG    . LEU B 1 109 ? 1.361   24.533 47.271  1.00 36.14 ? 327 LEU B CG    1 
ATOM   1556 C  CD1   . LEU B 1 109 ? 1.635   25.522 48.389  1.00 35.65 ? 327 LEU B CD1   1 
ATOM   1557 C  CD2   . LEU B 1 109 ? 2.603   24.363 46.411  1.00 35.76 ? 327 LEU B CD2   1 
ATOM   1558 N  N     . ASP B 1 110 ? 2.039   20.123 47.088  1.00 49.17 ? 328 ASP B N     1 
ATOM   1559 C  CA    . ASP B 1 110 ? 2.514   18.846 47.638  1.00 54.50 ? 328 ASP B CA    1 
ATOM   1560 C  C     . ASP B 1 110 ? 3.758   19.080 48.494  1.00 55.51 ? 328 ASP B C     1 
ATOM   1561 O  O     . ASP B 1 110 ? 3.848   18.587 49.625  1.00 57.76 ? 328 ASP B O     1 
ATOM   1562 C  CB    . ASP B 1 110 ? 2.858   17.857 46.511  1.00 57.32 ? 328 ASP B CB    1 
ATOM   1563 C  CG    . ASP B 1 110 ? 1.623   17.368 45.740  1.00 60.25 ? 328 ASP B CG    1 
ATOM   1564 O  OD1   . ASP B 1 110 ? 0.487   17.396 46.295  1.00 62.08 ? 328 ASP B OD1   1 
ATOM   1565 O  OD2   . ASP B 1 110 ? 1.800   16.942 44.569  1.00 61.98 ? 328 ASP B OD2   1 
ATOM   1566 P  P     . DA  C 2 1   ? -1.829  66.171 8.342   1.00 31.07 ? 1   DA  C P     1 
ATOM   1567 O  OP1   . DA  C 2 1   ? -2.700  65.737 9.464   1.00 31.34 ? 1   DA  C OP1   1 
ATOM   1568 O  OP2   . DA  C 2 1   ? -1.435  67.600 8.204   1.00 31.12 ? 1   DA  C OP2   1 
ATOM   1569 O  "O5'" . DA  C 2 1   ? -0.534  65.226 8.326   1.00 29.51 ? 1   DA  C "O5'" 1 
ATOM   1570 C  "C5'" . DA  C 2 1   ? 0.596   65.527 9.126   1.00 28.15 ? 1   DA  C "C5'" 1 
ATOM   1571 C  "C4'" . DA  C 2 1   ? 0.505   64.885 10.501  1.00 27.20 ? 1   DA  C "C4'" 1 
ATOM   1572 O  "O4'" . DA  C 2 1   ? -0.867  64.540 10.837  1.00 25.93 ? 1   DA  C "O4'" 1 
ATOM   1573 C  "C3'" . DA  C 2 1   ? 1.336   63.608 10.666  1.00 26.99 ? 1   DA  C "C3'" 1 
ATOM   1574 O  "O3'" . DA  C 2 1   ? 2.492   63.814 11.505  1.00 27.80 ? 1   DA  C "O3'" 1 
ATOM   1575 C  "C2'" . DA  C 2 1   ? 0.384   62.558 11.242  1.00 26.23 ? 1   DA  C "C2'" 1 
ATOM   1576 C  "C1'" . DA  C 2 1   ? -0.953  63.270 11.445  1.00 25.06 ? 1   DA  C "C1'" 1 
ATOM   1577 N  N9    . DA  C 2 1   ? -2.074  62.535 10.854  1.00 23.18 ? 1   DA  C N9    1 
ATOM   1578 C  C8    . DA  C 2 1   ? -2.315  62.277 9.527   1.00 22.31 ? 1   DA  C C8    1 
ATOM   1579 N  N7    . DA  C 2 1   ? -3.404  61.575 9.300   1.00 21.00 ? 1   DA  C N7    1 
ATOM   1580 C  C5    . DA  C 2 1   ? -3.911  61.358 10.567  1.00 20.53 ? 1   DA  C C5    1 
ATOM   1581 C  C6    . DA  C 2 1   ? -5.051  60.680 11.029  1.00 19.57 ? 1   DA  C C6    1 
ATOM   1582 N  N6    . DA  C 2 1   ? -5.922  60.080 10.221  1.00 19.21 ? 1   DA  C N6    1 
ATOM   1583 N  N1    . DA  C 2 1   ? -5.263  60.643 12.359  1.00 19.38 ? 1   DA  C N1    1 
ATOM   1584 C  C2    . DA  C 2 1   ? -4.384  61.252 13.168  1.00 19.77 ? 1   DA  C C2    1 
ATOM   1585 N  N3    . DA  C 2 1   ? -3.281  61.922 12.855  1.00 20.32 ? 1   DA  C N3    1 
ATOM   1586 C  C4    . DA  C 2 1   ? -3.102  61.937 11.530  1.00 21.35 ? 1   DA  C C4    1 
ATOM   1587 P  P     . DA  C 2 2   ? 2.409   64.452 12.977  1.00 28.22 ? 2   DA  C P     1 
ATOM   1588 O  OP1   . DA  C 2 2   ? 1.112   65.149 13.153  1.00 28.17 ? 2   DA  C OP1   1 
ATOM   1589 O  OP2   . DA  C 2 2   ? 3.658   65.199 13.253  1.00 28.23 ? 2   DA  C OP2   1 
ATOM   1590 O  "O5'" . DA  C 2 2   ? 2.411   63.126 13.861  1.00 27.20 ? 2   DA  C "O5'" 1 
ATOM   1591 C  "C5'" . DA  C 2 2   ? 1.780   63.163 15.121  1.00 26.57 ? 2   DA  C "C5'" 1 
ATOM   1592 C  "C4'" . DA  C 2 2   ? 1.245   61.796 15.449  1.00 26.15 ? 2   DA  C "C4'" 1 
ATOM   1593 O  "O4'" . DA  C 2 2   ? 0.369   61.318 14.412  1.00 25.71 ? 2   DA  C "O4'" 1 
ATOM   1594 C  "C3'" . DA  C 2 2   ? 2.328   60.736 15.559  1.00 26.11 ? 2   DA  C "C3'" 1 
ATOM   1595 O  "O3'" . DA  C 2 2   ? 2.442   60.512 16.939  1.00 26.41 ? 2   DA  C "O3'" 1 
ATOM   1596 C  "C2'" . DA  C 2 2   ? 1.810   59.547 14.737  1.00 25.63 ? 2   DA  C "C2'" 1 
ATOM   1597 C  "C1'" . DA  C 2 2   ? 0.348   59.921 14.556  1.00 25.12 ? 2   DA  C "C1'" 1 
ATOM   1598 N  N9    . DA  C 2 2   ? -0.346  59.408 13.387  1.00 24.31 ? 2   DA  C N9    1 
ATOM   1599 C  C8    . DA  C 2 2   ? 0.064   59.427 12.082  1.00 24.01 ? 2   DA  C C8    1 
ATOM   1600 N  N7    . DA  C 2 2   ? -0.806  58.901 11.251  1.00 23.37 ? 2   DA  C N7    1 
ATOM   1601 C  C5    . DA  C 2 2   ? -1.855  58.524 12.071  1.00 22.79 ? 2   DA  C C5    1 
ATOM   1602 C  C6    . DA  C 2 2   ? -3.092  57.910 11.811  1.00 22.16 ? 2   DA  C C6    1 
ATOM   1603 N  N6    . DA  C 2 2   ? -3.482  57.560 10.584  1.00 21.23 ? 2   DA  C N6    1 
ATOM   1604 N  N1    . DA  C 2 2   ? -3.908  57.665 12.864  1.00 21.84 ? 2   DA  C N1    1 
ATOM   1605 C  C2    . DA  C 2 2   ? -3.510  58.028 14.094  1.00 21.93 ? 2   DA  C C2    1 
ATOM   1606 N  N3    . DA  C 2 2   ? -2.373  58.615 14.462  1.00 22.28 ? 2   DA  C N3    1 
ATOM   1607 C  C4    . DA  C 2 2   ? -1.588  58.834 13.393  1.00 23.21 ? 2   DA  C C4    1 
ATOM   1608 P  P     . DA  C 2 3   ? 3.388   59.401 17.567  1.00 26.23 ? 3   DA  C P     1 
ATOM   1609 O  OP1   . DA  C 2 3   ? 3.901   60.050 18.800  1.00 26.75 ? 3   DA  C OP1   1 
ATOM   1610 O  OP2   . DA  C 2 3   ? 4.292   58.815 16.546  1.00 25.80 ? 3   DA  C OP2   1 
ATOM   1611 O  "O5'" . DA  C 2 3   ? 2.326   58.289 17.965  1.00 25.40 ? 3   DA  C "O5'" 1 
ATOM   1612 C  "C5'" . DA  C 2 3   ? 1.198   58.668 18.747  1.00 24.33 ? 3   DA  C "C5'" 1 
ATOM   1613 C  "C4'" . DA  C 2 3   ? 0.245   57.500 18.757  1.00 23.58 ? 3   DA  C "C4'" 1 
ATOM   1614 O  "O4'" . DA  C 2 3   ? -0.254  57.281 17.413  1.00 22.73 ? 3   DA  C "O4'" 1 
ATOM   1615 C  "C3'" . DA  C 2 3   ? 0.900   56.193 19.179  1.00 23.20 ? 3   DA  C "C3'" 1 
ATOM   1616 O  "O3'" . DA  C 2 3   ? 0.105   55.620 20.213  1.00 24.12 ? 3   DA  C "O3'" 1 
ATOM   1617 C  "C2'" . DA  C 2 3   ? 0.971   55.379 17.880  1.00 22.19 ? 3   DA  C "C2'" 1 
ATOM   1618 C  "C1'" . DA  C 2 3   ? -0.244  55.901 17.129  1.00 21.33 ? 3   DA  C "C1'" 1 
ATOM   1619 N  N9    . DA  C 2 3   ? -0.238  55.761 15.674  1.00 19.31 ? 3   DA  C N9    1 
ATOM   1620 C  C8    . DA  C 2 3   ? 0.763   56.103 14.805  1.00 18.88 ? 3   DA  C C8    1 
ATOM   1621 N  N7    . DA  C 2 3   ? 0.475   55.874 13.544  1.00 18.02 ? 3   DA  C N7    1 
ATOM   1622 C  C5    . DA  C 2 3   ? -0.808  55.352 13.589  1.00 17.04 ? 3   DA  C C5    1 
ATOM   1623 C  C6    . DA  C 2 3   ? -1.694  54.900 12.586  1.00 16.12 ? 3   DA  C C6    1 
ATOM   1624 N  N6    . DA  C 2 3   ? -1.408  54.921 11.281  1.00 14.86 ? 3   DA  C N6    1 
ATOM   1625 N  N1    . DA  C 2 3   ? -2.906  54.433 12.979  1.00 16.01 ? 3   DA  C N1    1 
ATOM   1626 C  C2    . DA  C 2 3   ? -3.207  54.428 14.286  1.00 15.93 ? 3   DA  C C2    1 
ATOM   1627 N  N3    . DA  C 2 3   ? -2.458  54.829 15.314  1.00 16.37 ? 3   DA  C N3    1 
ATOM   1628 C  C4    . DA  C 2 3   ? -1.262  55.278 14.896  1.00 17.55 ? 3   DA  C C4    1 
ATOM   1629 P  P     . DT  C 2 4   ? 0.465   54.189 20.827  1.00 24.78 ? 4   DT  C P     1 
ATOM   1630 O  OP1   . DT  C 2 4   ? 0.133   54.260 22.271  1.00 25.07 ? 4   DT  C OP1   1 
ATOM   1631 O  OP2   . DT  C 2 4   ? 1.807   53.769 20.354  1.00 24.06 ? 4   DT  C OP2   1 
ATOM   1632 O  "O5'" . DT  C 2 4   ? -0.605  53.262 20.093  1.00 24.09 ? 4   DT  C "O5'" 1 
ATOM   1633 C  "C5'" . DT  C 2 4   ? -1.974  53.596 20.247  1.00 22.39 ? 4   DT  C "C5'" 1 
ATOM   1634 C  "C4'" . DT  C 2 4   ? -2.801  52.612 19.455  1.00 21.57 ? 4   DT  C "C4'" 1 
ATOM   1635 O  "O4'" . DT  C 2 4   ? -2.473  52.759 18.051  1.00 19.97 ? 4   DT  C "O4'" 1 
ATOM   1636 C  "C3'" . DT  C 2 4   ? -2.577  51.142 19.824  1.00 20.79 ? 4   DT  C "C3'" 1 
ATOM   1637 O  "O3'" . DT  C 2 4   ? -3.863  50.596 20.107  1.00 20.56 ? 4   DT  C "O3'" 1 
ATOM   1638 C  "C2'" . DT  C 2 4   ? -1.895  50.556 18.580  1.00 20.78 ? 4   DT  C "C2'" 1 
ATOM   1639 C  "C1'" . DT  C 2 4   ? -2.391  51.479 17.465  1.00 20.63 ? 4   DT  C "C1'" 1 
ATOM   1640 N  N1    . DT  C 2 4   ? -1.520  51.665 16.261  1.00 19.40 ? 4   DT  C N1    1 
ATOM   1641 C  C2    . DT  C 2 4   ? -2.018  51.415 14.995  1.00 19.07 ? 4   DT  C C2    1 
ATOM   1642 O  O2    . DT  C 2 4   ? -3.145  51.014 14.751  1.00 18.57 ? 4   DT  C O2    1 
ATOM   1643 N  N3    . DT  C 2 4   ? -1.123  51.654 13.986  1.00 19.13 ? 4   DT  C N3    1 
ATOM   1644 C  C4    . DT  C 2 4   ? 0.175   52.110 14.102  1.00 19.14 ? 4   DT  C C4    1 
ATOM   1645 O  O4    . DT  C 2 4   ? 0.869   52.294 13.110  1.00 18.89 ? 4   DT  C O4    1 
ATOM   1646 C  C5    . DT  C 2 4   ? 0.631   52.357 15.453  1.00 19.37 ? 4   DT  C C5    1 
ATOM   1647 C  C7    . DT  C 2 4   ? 2.021   52.856 15.717  1.00 19.38 ? 4   DT  C C7    1 
ATOM   1648 C  C6    . DT  C 2 4   ? -0.234  52.134 16.449  1.00 19.14 ? 4   DT  C C6    1 
ATOM   1649 P  P     . DT  C 2 5   ? -4.165  49.064 20.424  1.00 19.95 ? 5   DT  C P     1 
ATOM   1650 O  OP1   . DT  C 2 5   ? -5.436  49.002 21.178  1.00 18.84 ? 5   DT  C OP1   1 
ATOM   1651 O  OP2   . DT  C 2 5   ? -2.912  48.515 20.998  1.00 21.10 ? 5   DT  C OP2   1 
ATOM   1652 O  "O5'" . DT  C 2 5   ? -4.404  48.397 19.003  1.00 20.30 ? 5   DT  C "O5'" 1 
ATOM   1653 C  "C5'" . DT  C 2 5   ? -5.561  48.755 18.258  1.00 19.92 ? 5   DT  C "C5'" 1 
ATOM   1654 C  "C4'" . DT  C 2 5   ? -5.545  48.049 16.918  1.00 19.35 ? 5   DT  C "C4'" 1 
ATOM   1655 O  "O4'" . DT  C 2 5   ? -4.366  48.446 16.190  1.00 19.35 ? 5   DT  C "O4'" 1 
ATOM   1656 C  "C3'" . DT  C 2 5   ? -5.489  46.522 16.982  1.00 19.91 ? 5   DT  C "C3'" 1 
ATOM   1657 O  "O3'" . DT  C 2 5   ? -6.571  46.057 16.223  1.00 20.18 ? 5   DT  C "O3'" 1 
ATOM   1658 C  "C2'" . DT  C 2 5   ? -4.122  46.147 16.394  1.00 20.13 ? 5   DT  C "C2'" 1 
ATOM   1659 C  "C1'" . DT  C 2 5   ? -3.899  47.325 15.465  1.00 19.40 ? 5   DT  C "C1'" 1 
ATOM   1660 N  N1    . DT  C 2 5   ? -2.514  47.688 15.061  1.00 18.85 ? 5   DT  C N1    1 
ATOM   1661 C  C2    . DT  C 2 5   ? -2.225  47.720 13.710  1.00 18.21 ? 5   DT  C C2    1 
ATOM   1662 O  O2    . DT  C 2 5   ? -3.025  47.409 12.852  1.00 18.36 ? 5   DT  C O2    1 
ATOM   1663 N  N3    . DT  C 2 5   ? -0.946  48.098 13.403  1.00 17.66 ? 5   DT  C N3    1 
ATOM   1664 C  C4    . DT  C 2 5   ? 0.049   48.456 14.286  1.00 17.34 ? 5   DT  C C4    1 
ATOM   1665 O  O4    . DT  C 2 5   ? 1.161   48.786 13.902  1.00 16.96 ? 5   DT  C O4    1 
ATOM   1666 C  C5    . DT  C 2 5   ? -0.309  48.408 15.682  1.00 17.36 ? 5   DT  C C5    1 
ATOM   1667 C  C7    . DT  C 2 5   ? 0.721   48.779 16.707  1.00 16.19 ? 5   DT  C C7    1 
ATOM   1668 C  C6    . DT  C 2 5   ? -1.563  48.038 16.004  1.00 17.76 ? 5   DT  C C6    1 
ATOM   1669 P  P     . DG  C 2 6   ? -6.948  44.525 16.059  1.00 21.59 ? 6   DG  C P     1 
ATOM   1670 O  OP1   . DG  C 2 6   ? -8.400  44.391 15.805  1.00 20.59 ? 6   DG  C OP1   1 
ATOM   1671 O  OP2   . DG  C 2 6   ? -6.297  43.810 17.181  1.00 22.35 ? 6   DG  C OP2   1 
ATOM   1672 O  "O5'" . DG  C 2 6   ? -6.178  44.119 14.723  1.00 20.54 ? 6   DG  C "O5'" 1 
ATOM   1673 C  "C5'" . DG  C 2 6   ? -6.702  44.448 13.456  1.00 18.54 ? 6   DG  C "C5'" 1 
ATOM   1674 C  "C4'" . DG  C 2 6   ? -5.781  43.904 12.391  1.00 17.36 ? 6   DG  C "C4'" 1 
ATOM   1675 O  "O4'" . DG  C 2 6   ? -4.492  44.547 12.530  1.00 15.87 ? 6   DG  C "O4'" 1 
ATOM   1676 C  "C3'" . DG  C 2 6   ? -5.526  42.391 12.465  1.00 17.66 ? 6   DG  C "C3'" 1 
ATOM   1677 O  "O3'" . DG  C 2 6   ? -6.038  41.806 11.281  1.00 17.16 ? 6   DG  C "O3'" 1 
ATOM   1678 C  "C2'" . DG  C 2 6   ? -4.011  42.273 12.671  1.00 16.90 ? 6   DG  C "C2'" 1 
ATOM   1679 C  "C1'" . DG  C 2 6   ? -3.516  43.602 12.121  1.00 16.50 ? 6   DG  C "C1'" 1 
ATOM   1680 N  N9    . DG  C 2 6   ? -2.229  44.118 12.578  1.00 15.84 ? 6   DG  C N9    1 
ATOM   1681 C  C8    . DG  C 2 6   ? -1.834  44.385 13.866  1.00 16.20 ? 6   DG  C C8    1 
ATOM   1682 N  N7    . DG  C 2 6   ? -0.627  44.884 13.961  1.00 15.88 ? 6   DG  C N7    1 
ATOM   1683 C  C5    . DG  C 2 6   ? -0.193  44.946 12.644  1.00 16.02 ? 6   DG  C C5    1 
ATOM   1684 C  C6    . DG  C 2 6   ? 1.033   45.397 12.112  1.00 16.52 ? 6   DG  C C6    1 
ATOM   1685 O  O6    . DG  C 2 6   ? 2.000   45.846 12.733  1.00 17.63 ? 6   DG  C O6    1 
ATOM   1686 N  N1    . DG  C 2 6   ? 1.081   45.307 10.720  1.00 16.13 ? 6   DG  C N1    1 
ATOM   1687 C  C2    . DG  C 2 6   ? 0.056   44.835 9.936   1.00 16.60 ? 6   DG  C C2    1 
ATOM   1688 N  N2    . DG  C 2 6   ? 0.268   44.815 8.615   1.00 15.71 ? 6   DG  C N2    1 
ATOM   1689 N  N3    . DG  C 2 6   ? -1.114  44.406 10.420  1.00 16.81 ? 6   DG  C N3    1 
ATOM   1690 C  C4    . DG  C 2 6   ? -1.164  44.485 11.780  1.00 16.42 ? 6   DG  C C4    1 
ATOM   1691 P  P     . DT  C 2 7   ? -5.717  40.314 10.831  1.00 19.52 ? 7   DT  C P     1 
ATOM   1692 O  OP1   . DT  C 2 7   ? -6.828  39.925 9.950   1.00 20.04 ? 7   DT  C OP1   1 
ATOM   1693 O  OP2   . DT  C 2 7   ? -5.376  39.462 12.001  1.00 20.29 ? 7   DT  C OP2   1 
ATOM   1694 O  "O5'" . DT  C 2 7   ? -4.363  40.482 9.973   1.00 19.17 ? 7   DT  C "O5'" 1 
ATOM   1695 C  "C5'" . DT  C 2 7   ? -4.392  41.127 8.723   1.00 18.91 ? 7   DT  C "C5'" 1 
ATOM   1696 C  "C4'" . DT  C 2 7   ? -3.117  40.824 7.959   1.00 18.85 ? 7   DT  C "C4'" 1 
ATOM   1697 O  "O4'" . DT  C 2 7   ? -1.994  41.445 8.623   1.00 17.47 ? 7   DT  C "O4'" 1 
ATOM   1698 C  "C3'" . DT  C 2 7   ? -2.800  39.335 7.860   1.00 19.59 ? 7   DT  C "C3'" 1 
ATOM   1699 O  "O3'" . DT  C 2 7   ? -2.774  38.993 6.491   1.00 18.59 ? 7   DT  C "O3'" 1 
ATOM   1700 C  "C2'" . DT  C 2 7   ? -1.473  39.195 8.617   1.00 19.30 ? 7   DT  C "C2'" 1 
ATOM   1701 C  "C1'" . DT  C 2 7   ? -0.883  40.594 8.532   1.00 18.87 ? 7   DT  C "C1'" 1 
ATOM   1702 N  N1    . DT  C 2 7   ? 0.102   41.043 9.599   1.00 18.89 ? 7   DT  C N1    1 
ATOM   1703 C  C2    . DT  C 2 7   ? 1.323   41.553 9.205   1.00 19.14 ? 7   DT  C C2    1 
ATOM   1704 O  O2    . DT  C 2 7   ? 1.681   41.624 8.047   1.00 18.83 ? 7   DT  C O2    1 
ATOM   1705 N  N3    . DT  C 2 7   ? 2.140   41.964 10.219  1.00 18.74 ? 7   DT  C N3    1 
ATOM   1706 C  C4    . DT  C 2 7   ? 1.889   41.946 11.567  1.00 19.04 ? 7   DT  C C4    1 
ATOM   1707 O  O4    . DT  C 2 7   ? 2.729   42.371 12.369  1.00 18.49 ? 7   DT  C O4    1 
ATOM   1708 C  C5    . DT  C 2 7   ? 0.586   41.426 11.930  1.00 19.15 ? 7   DT  C C5    1 
ATOM   1709 C  C7    . DT  C 2 7   ? 0.150   41.347 13.369  1.00 17.48 ? 7   DT  C C7    1 
ATOM   1710 C  C6    . DT  C 2 7   ? -0.228  41.013 10.938  1.00 19.30 ? 7   DT  C C6    1 
ATOM   1711 P  P     . DT  C 2 8   ? -2.496  37.510 5.994   1.00 21.22 ? 8   DT  C P     1 
ATOM   1712 O  OP1   . DT  C 2 8   ? -3.187  37.406 4.685   1.00 23.08 ? 8   DT  C OP1   1 
ATOM   1713 O  OP2   . DT  C 2 8   ? -2.690  36.488 7.029   1.00 20.19 ? 8   DT  C OP2   1 
ATOM   1714 O  "O5'" . DT  C 2 8   ? -0.913  37.489 5.753   1.00 20.36 ? 8   DT  C "O5'" 1 
ATOM   1715 C  "C5'" . DT  C 2 8   ? -0.361  38.369 4.778   1.00 19.22 ? 8   DT  C "C5'" 1 
ATOM   1716 C  "C4'" . DT  C 2 8   ? 1.132   38.418 4.963   1.00 18.66 ? 8   DT  C "C4'" 1 
ATOM   1717 O  "O4'" . DT  C 2 8   ? 1.452   38.892 6.287   1.00 16.79 ? 8   DT  C "O4'" 1 
ATOM   1718 C  "C3'" . DT  C 2 8   ? 1.795   37.045 4.838   1.00 18.85 ? 8   DT  C "C3'" 1 
ATOM   1719 O  "O3'" . DT  C 2 8   ? 2.293   36.939 3.502   1.00 19.64 ? 8   DT  C "O3'" 1 
ATOM   1720 C  "C2'" . DT  C 2 8   ? 2.825   37.012 5.966   1.00 17.70 ? 8   DT  C "C2'" 1 
ATOM   1721 C  "C1'" . DT  C 2 8   ? 2.750   38.414 6.551   1.00 17.54 ? 8   DT  C "C1'" 1 
ATOM   1722 N  N1    . DT  C 2 8   ? 2.997   38.539 8.019   1.00 18.03 ? 8   DT  C N1    1 
ATOM   1723 C  C2    . DT  C 2 8   ? 4.110   39.231 8.459   1.00 17.69 ? 8   DT  C C2    1 
ATOM   1724 O  O2    . DT  C 2 8   ? 4.917   39.722 7.707   1.00 17.92 ? 8   DT  C O2    1 
ATOM   1725 N  N3    . DT  C 2 8   ? 4.251   39.317 9.820   1.00 17.12 ? 8   DT  C N3    1 
ATOM   1726 C  C4    . DT  C 2 8   ? 3.402   38.782 10.772  1.00 17.21 ? 8   DT  C C4    1 
ATOM   1727 O  O4    . DT  C 2 8   ? 3.605   38.904 11.988  1.00 16.97 ? 8   DT  C O4    1 
ATOM   1728 C  C5    . DT  C 2 8   ? 2.254   38.073 10.246  1.00 16.25 ? 8   DT  C C5    1 
ATOM   1729 C  C7    . DT  C 2 8   ? 1.262   37.461 11.192  1.00 17.29 ? 8   DT  C C7    1 
ATOM   1730 C  C6    . DT  C 2 8   ? 2.102   37.987 8.922   1.00 16.82 ? 8   DT  C C6    1 
ATOM   1731 P  P     . DT  C 2 9   ? 3.178   35.685 3.019   1.00 20.51 ? 9   DT  C P     1 
ATOM   1732 O  OP1   . DT  C 2 9   ? 3.157   35.776 1.558   1.00 21.26 ? 9   DT  C OP1   1 
ATOM   1733 O  OP2   . DT  C 2 9   ? 2.816   34.470 3.767   1.00 22.04 ? 9   DT  C OP2   1 
ATOM   1734 O  "O5'" . DT  C 2 9   ? 4.640   36.021 3.546   1.00 19.78 ? 9   DT  C "O5'" 1 
ATOM   1735 C  "C5'" . DT  C 2 9   ? 5.390   37.023 2.888   1.00 17.87 ? 9   DT  C "C5'" 1 
ATOM   1736 C  "C4'" . DT  C 2 9   ? 6.672   37.180 3.664   1.00 17.44 ? 9   DT  C "C4'" 1 
ATOM   1737 O  "O4'" . DT  C 2 9   ? 6.352   37.426 5.059   1.00 17.46 ? 9   DT  C "O4'" 1 
ATOM   1738 C  "C3'" . DT  C 2 9   ? 7.540   35.914 3.655   1.00 17.17 ? 9   DT  C "C3'" 1 
ATOM   1739 O  "O3'" . DT  C 2 9   ? 8.725   36.170 2.923   1.00 16.43 ? 9   DT  C "O3'" 1 
ATOM   1740 C  "C2'" . DT  C 2 9   ? 7.770   35.594 5.129   1.00 17.25 ? 9   DT  C "C2'" 1 
ATOM   1741 C  "C1'" . DT  C 2 9   ? 7.424   36.908 5.821   1.00 16.77 ? 9   DT  C "C1'" 1 
ATOM   1742 N  N1    . DT  C 2 9   ? 6.978   36.826 7.229   1.00 17.23 ? 9   DT  C N1    1 
ATOM   1743 C  C2    . DT  C 2 9   ? 7.681   37.499 8.206   1.00 18.08 ? 9   DT  C C2    1 
ATOM   1744 O  O2    . DT  C 2 9   ? 8.675   38.171 7.992   1.00 17.30 ? 9   DT  C O2    1 
ATOM   1745 N  N3    . DT  C 2 9   ? 7.166   37.346 9.469   1.00 18.29 ? 9   DT  C N3    1 
ATOM   1746 C  C4    . DT  C 2 9   ? 6.054   36.606 9.848   1.00 17.76 ? 9   DT  C C4    1 
ATOM   1747 O  O4    . DT  C 2 9   ? 5.671   36.567 11.010  1.00 17.58 ? 9   DT  C O4    1 
ATOM   1748 C  C5    . DT  C 2 9   ? 5.373   35.924 8.785   1.00 17.34 ? 9   DT  C C5    1 
ATOM   1749 C  C7    . DT  C 2 9   ? 4.156   35.091 9.074   1.00 16.46 ? 9   DT  C C7    1 
ATOM   1750 C  C6    . DT  C 2 9   ? 5.865   36.065 7.550   1.00 16.90 ? 9   DT  C C6    1 
ATOM   1751 P  P     . DA  C 2 10  ? 9.843   35.041 2.771   1.00 16.71 ? 10  DA  C P     1 
ATOM   1752 O  OP1   . DA  C 2 10  ? 10.606  35.420 1.572   1.00 16.32 ? 10  DA  C OP1   1 
ATOM   1753 O  OP2   . DA  C 2 10  ? 9.269   33.687 2.937   1.00 14.86 ? 10  DA  C OP2   1 
ATOM   1754 O  "O5'" . DA  C 2 10  ? 10.727  35.316 4.076   1.00 17.11 ? 10  DA  C "O5'" 1 
ATOM   1755 C  "C5'" . DA  C 2 10  ? 11.304  36.638 4.206   1.00 16.97 ? 10  DA  C "C5'" 1 
ATOM   1756 C  "C4'" . DA  C 2 10  ? 12.213  36.706 5.421   1.00 17.66 ? 10  DA  C "C4'" 1 
ATOM   1757 O  "O4'" . DA  C 2 10  ? 11.442  36.622 6.657   1.00 15.64 ? 10  DA  C "O4'" 1 
ATOM   1758 C  "C3'" . DA  C 2 10  ? 13.234  35.559 5.447   1.00 18.42 ? 10  DA  C "C3'" 1 
ATOM   1759 O  "O3'" . DA  C 2 10  ? 14.519  36.123 5.588   1.00 20.88 ? 10  DA  C "O3'" 1 
ATOM   1760 C  "C2'" . DA  C 2 10  ? 12.766  34.700 6.621   1.00 18.05 ? 10  DA  C "C2'" 1 
ATOM   1761 C  "C1'" . DA  C 2 10  ? 12.093  35.713 7.536   1.00 17.10 ? 10  DA  C "C1'" 1 
ATOM   1762 N  N9    . DA  C 2 10  ? 11.045  35.262 8.446   1.00 16.49 ? 10  DA  C N9    1 
ATOM   1763 C  C8    . DA  C 2 10  ? 9.911   34.578 8.140   1.00 16.62 ? 10  DA  C C8    1 
ATOM   1764 N  N7    . DA  C 2 10  ? 9.103   34.361 9.156   1.00 16.75 ? 10  DA  C N7    1 
ATOM   1765 C  C5    . DA  C 2 10  ? 9.749   34.960 10.203  1.00 16.81 ? 10  DA  C C5    1 
ATOM   1766 C  C6    . DA  C 2 10  ? 9.406   35.075 11.556  1.00 16.97 ? 10  DA  C C6    1 
ATOM   1767 N  N6    . DA  C 2 10  ? 8.280   34.570 12.083  1.00 16.25 ? 10  DA  C N6    1 
ATOM   1768 N  N1    . DA  C 2 10  ? 10.269  35.729 12.340  1.00 16.07 ? 10  DA  C N1    1 
ATOM   1769 C  C2    . DA  C 2 10  ? 11.376  36.231 11.803  1.00 16.84 ? 10  DA  C C2    1 
ATOM   1770 N  N3    . DA  C 2 10  ? 11.805  36.182 10.539  1.00 17.83 ? 10  DA  C N3    1 
ATOM   1771 C  C4    . DA  C 2 10  ? 10.935  35.524 9.785   1.00 16.61 ? 10  DA  C C4    1 
ATOM   1772 P  P     . DT  C 2 11  ? 15.869  35.273 5.461   1.00 20.88 ? 11  DT  C P     1 
ATOM   1773 O  OP1   . DT  C 2 11  ? 16.868  36.203 4.941   1.00 21.30 ? 11  DT  C OP1   1 
ATOM   1774 O  OP2   . DT  C 2 11  ? 15.605  33.956 4.845   1.00 21.95 ? 11  DT  C OP2   1 
ATOM   1775 O  "O5'" . DT  C 2 11  ? 16.150  34.956 7.011   1.00 22.02 ? 11  DT  C "O5'" 1 
ATOM   1776 C  "C5'" . DT  C 2 11  ? 16.450  35.996 7.938   1.00 20.67 ? 11  DT  C "C5'" 1 
ATOM   1777 C  "C4'" . DT  C 2 11  ? 16.483  35.434 9.347   1.00 20.29 ? 11  DT  C "C4'" 1 
ATOM   1778 O  "O4'" . DT  C 2 11  ? 15.151  35.072 9.778   1.00 19.37 ? 11  DT  C "O4'" 1 
ATOM   1779 C  "C3'" . DT  C 2 11  ? 17.339  34.172 9.515   1.00 19.76 ? 11  DT  C "C3'" 1 
ATOM   1780 O  "O3'" . DT  C 2 11  ? 18.454  34.521 10.330  1.00 20.38 ? 11  DT  C "O3'" 1 
ATOM   1781 C  "C2'" . DT  C 2 11  ? 16.386  33.147 10.132  1.00 18.76 ? 11  DT  C "C2'" 1 
ATOM   1782 C  "C1'" . DT  C 2 11  ? 15.277  34.018 10.693  1.00 18.50 ? 11  DT  C "C1'" 1 
ATOM   1783 N  N1    . DT  C 2 11  ? 13.935  33.375 10.827  1.00 18.39 ? 11  DT  C N1    1 
ATOM   1784 C  C2    . DT  C 2 11  ? 13.311  33.436 12.048  1.00 18.10 ? 11  DT  C C2    1 
ATOM   1785 O  O2    . DT  C 2 11  ? 13.794  33.976 13.016  1.00 18.40 ? 11  DT  C O2    1 
ATOM   1786 N  N3    . DT  C 2 11  ? 12.096  32.826 12.100  1.00 17.92 ? 11  DT  C N3    1 
ATOM   1787 C  C4    . DT  C 2 11  ? 11.428  32.188 11.077  1.00 17.72 ? 11  DT  C C4    1 
ATOM   1788 O  O4    . DT  C 2 11  ? 10.318  31.670 11.254  1.00 17.11 ? 11  DT  C O4    1 
ATOM   1789 C  C5    . DT  C 2 11  ? 12.136  32.153 9.816   1.00 17.36 ? 11  DT  C C5    1 
ATOM   1790 C  C7    . DT  C 2 11  ? 11.515  31.466 8.627   1.00 15.89 ? 11  DT  C C7    1 
ATOM   1791 C  C6    . DT  C 2 11  ? 13.332  32.742 9.754   1.00 17.09 ? 11  DT  C C6    1 
ATOM   1792 P  P     . DA  C 2 12  ? 19.614  33.482 10.707  1.00 22.00 ? 12  DA  C P     1 
ATOM   1793 O  OP1   . DA  C 2 12  ? 20.827  34.293 10.854  1.00 22.23 ? 12  DA  C OP1   1 
ATOM   1794 O  OP2   . DA  C 2 12  ? 19.605  32.311 9.802   1.00 23.78 ? 12  DA  C OP2   1 
ATOM   1795 O  "O5'" . DA  C 2 12  ? 19.066  32.923 12.106  1.00 23.32 ? 12  DA  C "O5'" 1 
ATOM   1796 C  "C5'" . DA  C 2 12  ? 18.790  33.811 13.204  1.00 22.79 ? 12  DA  C "C5'" 1 
ATOM   1797 C  "C4'" . DA  C 2 12  ? 18.350  33.015 14.415  1.00 22.09 ? 12  DA  C "C4'" 1 
ATOM   1798 O  "O4'" . DA  C 2 12  ? 16.972  32.636 14.218  1.00 21.26 ? 12  DA  C "O4'" 1 
ATOM   1799 C  "C3'" . DA  C 2 12  ? 19.119  31.711 14.663  1.00 22.34 ? 12  DA  C "C3'" 1 
ATOM   1800 O  "O3'" . DA  C 2 12  ? 19.770  31.837 15.916  1.00 24.63 ? 12  DA  C "O3'" 1 
ATOM   1801 C  "C2'" . DA  C 2 12  ? 18.056  30.609 14.603  1.00 21.96 ? 12  DA  C "C2'" 1 
ATOM   1802 C  "C1'" . DA  C 2 12  ? 16.748  31.374 14.813  1.00 20.70 ? 12  DA  C "C1'" 1 
ATOM   1803 N  N9    . DA  C 2 12  ? 15.562  30.859 14.151  1.00 19.59 ? 12  DA  C N9    1 
ATOM   1804 C  C8    . DA  C 2 12  ? 15.427  30.655 12.810  1.00 18.20 ? 12  DA  C C8    1 
ATOM   1805 N  N7    . DA  C 2 12  ? 14.255  30.199 12.454  1.00 17.08 ? 12  DA  C N7    1 
ATOM   1806 C  C5    . DA  C 2 12  ? 13.541  30.118 13.634  1.00 17.68 ? 12  DA  C C5    1 
ATOM   1807 C  C6    . DA  C 2 12  ? 12.204  29.714 13.917  1.00 17.38 ? 12  DA  C C6    1 
ATOM   1808 N  N6    . DA  C 2 12  ? 11.333  29.293 12.987  1.00 17.14 ? 12  DA  C N6    1 
ATOM   1809 N  N1    . DA  C 2 12  ? 11.813  29.740 15.202  1.00 16.30 ? 12  DA  C N1    1 
ATOM   1810 C  C2    . DA  C 2 12  ? 12.691  30.154 16.137  1.00 16.16 ? 12  DA  C C2    1 
ATOM   1811 N  N3    . DA  C 2 12  ? 13.951  30.579 15.993  1.00 17.02 ? 12  DA  C N3    1 
ATOM   1812 C  C4    . DA  C 2 12  ? 14.330  30.528 14.701  1.00 18.56 ? 12  DA  C C4    1 
ATOM   1813 P  P     . DA  C 2 13  ? 20.681  30.667 16.520  1.00 25.16 ? 13  DA  C P     1 
ATOM   1814 O  OP1   . DA  C 2 13  ? 21.576  31.319 17.481  1.00 25.69 ? 13  DA  C OP1   1 
ATOM   1815 O  OP2   . DA  C 2 13  ? 21.167  29.783 15.432  1.00 25.03 ? 13  DA  C OP2   1 
ATOM   1816 O  "O5'" . DA  C 2 13  ? 19.626  29.806 17.340  1.00 26.29 ? 13  DA  C "O5'" 1 
ATOM   1817 C  "C5'" . DA  C 2 13  ? 18.778  30.467 18.259  1.00 26.74 ? 13  DA  C "C5'" 1 
ATOM   1818 C  "C4'" . DA  C 2 13  ? 17.818  29.461 18.841  1.00 27.17 ? 13  DA  C "C4'" 1 
ATOM   1819 O  "O4'" . DA  C 2 13  ? 16.763  29.255 17.880  1.00 26.69 ? 13  DA  C "O4'" 1 
ATOM   1820 C  "C3'" . DA  C 2 13  ? 18.396  28.071 19.122  1.00 28.42 ? 13  DA  C "C3'" 1 
ATOM   1821 O  "O3'" . DA  C 2 13  ? 18.012  27.647 20.406  1.00 31.00 ? 13  DA  C "O3'" 1 
ATOM   1822 C  "C2'" . DA  C 2 13  ? 17.757  27.192 18.060  1.00 27.36 ? 13  DA  C "C2'" 1 
ATOM   1823 C  "C1'" . DA  C 2 13  ? 16.418  27.897 17.889  1.00 25.72 ? 13  DA  C "C1'" 1 
ATOM   1824 N  N9    . DA  C 2 13  ? 15.742  27.557 16.650  1.00 23.38 ? 13  DA  C N9    1 
ATOM   1825 C  C8    . DA  C 2 13  ? 16.298  27.514 15.404  1.00 22.44 ? 13  DA  C C8    1 
ATOM   1826 N  N7    . DA  C 2 13  ? 15.464  27.158 14.456  1.00 21.98 ? 13  DA  C N7    1 
ATOM   1827 C  C5    . DA  C 2 13  ? 14.271  26.962 15.133  1.00 22.25 ? 13  DA  C C5    1 
ATOM   1828 C  C6    . DA  C 2 13  ? 12.993  26.561 14.703  1.00 21.52 ? 13  DA  C C6    1 
ATOM   1829 N  N6    . DA  C 2 13  ? 12.720  26.310 13.422  1.00 21.02 ? 13  DA  C N6    1 
ATOM   1830 N  N1    . DA  C 2 13  ? 12.011  26.447 15.627  1.00 21.35 ? 13  DA  C N1    1 
ATOM   1831 C  C2    . DA  C 2 13  ? 12.311  26.718 16.902  1.00 21.82 ? 13  DA  C C2    1 
ATOM   1832 N  N3    . DA  C 2 13  ? 13.483  27.092 17.431  1.00 22.46 ? 13  DA  C N3    1 
ATOM   1833 C  C4    . DA  C 2 13  ? 14.430  27.197 16.488  1.00 22.70 ? 13  DA  C C4    1 
ATOM   1834 P  P     . DA  C 2 14  ? 18.820  26.497 21.162  1.00 32.61 ? 14  DA  C P     1 
ATOM   1835 O  OP1   . DA  C 2 14  ? 19.745  27.181 22.088  1.00 32.61 ? 14  DA  C OP1   1 
ATOM   1836 O  OP2   . DA  C 2 14  ? 19.318  25.495 20.181  1.00 32.01 ? 14  DA  C OP2   1 
ATOM   1837 O  "O5'" . DA  C 2 14  ? 17.681  25.801 22.043  1.00 31.01 ? 14  DA  C "O5'" 1 
ATOM   1838 C  "C5'" . DA  C 2 14  ? 16.452  26.432 22.417  1.00 29.11 ? 14  DA  C "C5'" 1 
ATOM   1839 C  "C4'" . DA  C 2 14  ? 15.386  25.360 22.408  1.00 28.26 ? 14  DA  C "C4'" 1 
ATOM   1840 O  "O4'" . DA  C 2 14  ? 14.879  25.232 21.056  1.00 26.14 ? 14  DA  C "O4'" 1 
ATOM   1841 C  "C3'" . DA  C 2 14  ? 15.896  23.972 22.800  1.00 28.15 ? 14  DA  C "C3'" 1 
ATOM   1842 O  "O3'" . DA  C 2 14  ? 15.013  23.408 23.733  1.00 30.40 ? 14  DA  C "O3'" 1 
ATOM   1843 C  "C2'" . DA  C 2 14  ? 15.942  23.196 21.483  1.00 26.98 ? 14  DA  C "C2'" 1 
ATOM   1844 C  "C1'" . DA  C 2 14  ? 14.824  23.867 20.699  1.00 25.38 ? 14  DA  C "C1'" 1 
ATOM   1845 N  N9    . DA  C 2 14  ? 14.904  23.814 19.241  1.00 23.48 ? 14  DA  C N9    1 
ATOM   1846 C  C8    . DA  C 2 14  ? 15.984  24.053 18.444  1.00 22.32 ? 14  DA  C C8    1 
ATOM   1847 N  N7    . DA  C 2 14  ? 15.726  23.950 17.162  1.00 21.51 ? 14  DA  C N7    1 
ATOM   1848 C  C5    . DA  C 2 14  ? 14.380  23.636 17.104  1.00 20.64 ? 14  DA  C C5    1 
ATOM   1849 C  C6    . DA  C 2 14  ? 13.489  23.392 16.028  1.00 19.59 ? 14  DA  C C6    1 
ATOM   1850 N  N6    . DA  C 2 14  ? 13.818  23.422 14.730  1.00 16.69 ? 14  DA  C N6    1 
ATOM   1851 N  N1    . DA  C 2 14  ? 12.213  23.101 16.345  1.00 19.34 ? 14  DA  C N1    1 
ATOM   1852 C  C2    . DA  C 2 14  ? 11.857  23.056 17.641  1.00 20.68 ? 14  DA  C C2    1 
ATOM   1853 N  N3    . DA  C 2 14  ? 12.598  23.264 18.728  1.00 20.14 ? 14  DA  C N3    1 
ATOM   1854 C  C4    . DA  C 2 14  ? 13.860  23.555 18.383  1.00 21.51 ? 14  DA  C C4    1 
ATOM   1855 P  P     . DC  C 2 15  ? 15.423  22.097 24.552  1.00 33.35 ? 15  DC  C P     1 
ATOM   1856 O  OP1   . DC  C 2 15  ? 14.722  22.204 25.845  1.00 32.98 ? 15  DC  C OP1   1 
ATOM   1857 O  OP2   . DC  C 2 15  ? 16.886  21.837 24.459  1.00 32.78 ? 15  DC  C OP2   1 
ATOM   1858 O  "O5'" . DC  C 2 15  ? 14.729  20.956 23.693  1.00 32.73 ? 15  DC  C "O5'" 1 
ATOM   1859 C  "C5'" . DC  C 2 15  ? 13.345  21.055 23.456  1.00 32.39 ? 15  DC  C "C5'" 1 
ATOM   1860 C  "C4'" . DC  C 2 15  ? 13.035  20.124 22.315  1.00 32.10 ? 15  DC  C "C4'" 1 
ATOM   1861 O  "O4'" . DC  C 2 15  ? 13.522  20.680 21.071  1.00 30.89 ? 15  DC  C "O4'" 1 
ATOM   1862 C  "C3'" . DC  C 2 15  ? 13.716  18.765 22.449  1.00 32.07 ? 15  DC  C "C3'" 1 
ATOM   1863 O  "O3'" . DC  C 2 15  ? 12.706  17.812 22.597  1.00 33.82 ? 15  DC  C "O3'" 1 
ATOM   1864 C  "C2'" . DC  C 2 15  ? 14.495  18.612 21.148  1.00 31.39 ? 15  DC  C "C2'" 1 
ATOM   1865 C  "C1'" . DC  C 2 15  ? 13.713  19.568 20.248  1.00 29.39 ? 15  DC  C "C1'" 1 
ATOM   1866 N  N1    . DC  C 2 15  ? 14.367  19.941 18.953  1.00 27.60 ? 15  DC  C N1    1 
ATOM   1867 C  C2    . DC  C 2 15  ? 13.563  19.961 17.797  1.00 26.01 ? 15  DC  C C2    1 
ATOM   1868 O  O2    . DC  C 2 15  ? 12.358  19.696 17.857  1.00 25.44 ? 15  DC  C O2    1 
ATOM   1869 N  N3    . DC  C 2 15  ? 14.123  20.259 16.609  1.00 25.20 ? 15  DC  C N3    1 
ATOM   1870 C  C4    . DC  C 2 15  ? 15.424  20.535 16.518  1.00 25.01 ? 15  DC  C C4    1 
ATOM   1871 N  N4    . DC  C 2 15  ? 15.874  20.826 15.294  1.00 22.83 ? 15  DC  C N4    1 
ATOM   1872 C  C5    . DC  C 2 15  ? 16.278  20.527 17.675  1.00 25.36 ? 15  DC  C C5    1 
ATOM   1873 C  C6    . DC  C 2 15  ? 15.707  20.230 18.862  1.00 26.00 ? 15  DC  C C6    1 
ATOM   1874 P  P     . DA  C 2 16  ? 13.016  16.369 23.190  1.00 34.99 ? 16  DA  C P     1 
ATOM   1875 O  OP1   . DA  C 2 16  ? 12.874  16.465 24.665  1.00 34.98 ? 16  DA  C OP1   1 
ATOM   1876 O  OP2   . DA  C 2 16  ? 14.274  15.852 22.600  1.00 34.98 ? 16  DA  C OP2   1 
ATOM   1877 O  "O5'" . DA  C 2 16  ? 11.798  15.521 22.597  1.00 34.34 ? 16  DA  C "O5'" 1 
ATOM   1878 C  "C5'" . DA  C 2 16  ? 10.651  16.090 21.974  1.00 33.76 ? 16  DA  C "C5'" 1 
ATOM   1879 C  "C4'" . DA  C 2 16  ? 10.337  15.290 20.730  1.00 33.32 ? 16  DA  C "C4'" 1 
ATOM   1880 O  "O4'" . DA  C 2 16  ? 11.080  15.862 19.632  1.00 32.50 ? 16  DA  C "O4'" 1 
ATOM   1881 C  "C3'" . DA  C 2 16  ? 10.732  13.817 20.804  1.00 33.60 ? 16  DA  C "C3'" 1 
ATOM   1882 O  "O3'" . DA  C 2 16  ? 9.640   12.999 20.406  1.00 35.29 ? 16  DA  C "O3'" 1 
ATOM   1883 C  "C2'" . DA  C 2 16  ? 11.946  13.712 19.878  1.00 32.72 ? 16  DA  C "C2'" 1 
ATOM   1884 C  "C1'" . DA  C 2 16  ? 11.708  14.844 18.883  1.00 31.63 ? 16  DA  C "C1'" 1 
ATOM   1885 N  N9    . DA  C 2 16  ? 12.892  15.445 18.262  1.00 29.44 ? 16  DA  C N9    1 
ATOM   1886 C  C8    . DA  C 2 16  ? 14.049  15.811 18.886  1.00 28.99 ? 16  DA  C C8    1 
ATOM   1887 N  N7    . DA  C 2 16  ? 14.933  16.350 18.080  1.00 28.50 ? 16  DA  C N7    1 
ATOM   1888 C  C5    . DA  C 2 16  ? 14.313  16.343 16.843  1.00 26.11 ? 16  DA  C C5    1 
ATOM   1889 C  C6    . DA  C 2 16  ? 14.727  16.769 15.567  1.00 24.02 ? 16  DA  C C6    1 
ATOM   1890 N  N6    . DA  C 2 16  ? 15.916  17.312 15.332  1.00 22.39 ? 16  DA  C N6    1 
ATOM   1891 N  N1    . DA  C 2 16  ? 13.876  16.613 14.532  1.00 23.08 ? 16  DA  C N1    1 
ATOM   1892 C  C2    . DA  C 2 16  ? 12.681  16.065 14.762  1.00 23.88 ? 16  DA  C C2    1 
ATOM   1893 N  N3    . DA  C 2 16  ? 12.177  15.624 15.917  1.00 25.75 ? 16  DA  C N3    1 
ATOM   1894 C  C4    . DA  C 2 16  ? 13.052  15.791 16.933  1.00 27.44 ? 16  DA  C C4    1 
ATOM   1895 P  P     . DG  C 2 17  ? 9.758   11.408 20.532  1.00 37.24 ? 17  DG  C P     1 
ATOM   1896 O  OP1   . DG  C 2 17  ? 8.431   10.891 20.929  1.00 37.73 ? 17  DG  C OP1   1 
ATOM   1897 O  OP2   . DG  C 2 17  ? 10.976  11.020 21.287  1.00 37.26 ? 17  DG  C OP2   1 
ATOM   1898 O  "O5'" . DG  C 2 17  ? 10.023  11.014 19.014  1.00 37.17 ? 17  DG  C "O5'" 1 
ATOM   1899 C  "C5'" . DG  C 2 17  ? 9.211   11.548 17.975  1.00 36.60 ? 17  DG  C "C5'" 1 
ATOM   1900 C  "C4'" . DG  C 2 17  ? 9.749   11.034 16.657  1.00 36.31 ? 17  DG  C "C4'" 1 
ATOM   1901 O  "O4'" . DG  C 2 17  ? 10.860  11.872 16.260  1.00 35.45 ? 17  DG  C "O4'" 1 
ATOM   1902 C  "C3'" . DG  C 2 17  ? 10.279  9.601  16.710  1.00 36.97 ? 17  DG  C "C3'" 1 
ATOM   1903 O  "O3'" . DG  C 2 17  ? 9.703   8.885  15.629  1.00 38.73 ? 17  DG  C "O3'" 1 
ATOM   1904 C  "C2'" . DG  C 2 17  ? 11.805  9.757  16.658  1.00 35.93 ? 17  DG  C "C2'" 1 
ATOM   1905 C  "C1'" . DG  C 2 17  ? 11.967  11.079 15.911  1.00 34.85 ? 17  DG  C "C1'" 1 
ATOM   1906 N  N9    . DG  C 2 17  ? 13.206  11.805 16.210  1.00 32.74 ? 17  DG  C N9    1 
ATOM   1907 C  C8    . DG  C 2 17  ? 13.851  11.954 17.422  1.00 31.98 ? 17  DG  C C8    1 
ATOM   1908 N  N7    . DG  C 2 17  ? 14.954  12.649 17.345  1.00 31.01 ? 17  DG  C N7    1 
ATOM   1909 C  C5    . DG  C 2 17  ? 15.043  12.981 15.992  1.00 29.47 ? 17  DG  C C5    1 
ATOM   1910 C  C6    . DG  C 2 17  ? 16.019  13.718 15.285  1.00 27.30 ? 17  DG  C C6    1 
ATOM   1911 O  O6    . DG  C 2 17  ? 17.037  14.260 15.730  1.00 26.38 ? 17  DG  C O6    1 
ATOM   1912 N  N1    . DG  C 2 17  ? 15.729  13.799 13.926  1.00 26.69 ? 17  DG  C N1    1 
ATOM   1913 C  C2    . DG  C 2 17  ? 14.632  13.238 13.318  1.00 26.96 ? 17  DG  C C2    1 
ATOM   1914 N  N2    . DG  C 2 17  ? 14.499  13.406 12.001  1.00 26.00 ? 17  DG  C N2    1 
ATOM   1915 N  N3    . DG  C 2 17  ? 13.713  12.548 13.965  1.00 28.57 ? 17  DG  C N3    1 
ATOM   1916 C  C4    . DG  C 2 17  ? 13.981  12.462 15.288  1.00 30.27 ? 17  DG  C C4    1 
ATOM   1917 P  P     . DC  C 2 18  ? 10.138  7.403  15.227  1.00 39.70 ? 18  DC  C P     1 
ATOM   1918 O  OP1   . DC  C 2 18  ? 8.912   6.697  14.788  1.00 40.32 ? 18  DC  C OP1   1 
ATOM   1919 O  OP2   . DC  C 2 18  ? 10.982  6.798  16.289  1.00 40.17 ? 18  DC  C OP2   1 
ATOM   1920 O  "O5'" . DC  C 2 18  ? 11.038  7.733  13.941  1.00 39.62 ? 18  DC  C "O5'" 1 
ATOM   1921 C  "C5'" . DC  C 2 18  ? 10.599  8.747  13.005  1.00 39.53 ? 18  DC  C "C5'" 1 
ATOM   1922 C  "C4'" . DC  C 2 18  ? 11.453  8.801  11.751  1.00 38.93 ? 18  DC  C "C4'" 1 
ATOM   1923 O  "O4'" . DC  C 2 18  ? 12.593  9.663  12.000  1.00 37.77 ? 18  DC  C "O4'" 1 
ATOM   1924 C  "C3'" . DC  C 2 18  ? 11.993  7.439  11.327  1.00 38.94 ? 18  DC  C "C3'" 1 
ATOM   1925 O  "O3'" . DC  C 2 18  ? 12.013  7.278  9.904   1.00 39.89 ? 18  DC  C "O3'" 1 
ATOM   1926 C  "C2'" . DC  C 2 18  ? 13.379  7.438  11.964  1.00 38.31 ? 18  DC  C "C2'" 1 
ATOM   1927 C  "C1'" . DC  C 2 18  ? 13.781  8.911  11.921  1.00 37.45 ? 18  DC  C "C1'" 1 
ATOM   1928 N  N1    . DC  C 2 18  ? 14.731  9.335  13.013  1.00 35.98 ? 18  DC  C N1    1 
ATOM   1929 C  C2    . DC  C 2 18  ? 15.820  10.150 12.686  1.00 34.77 ? 18  DC  C C2    1 
ATOM   1930 O  O2    . DC  C 2 18  ? 15.968  10.517 11.517  1.00 34.27 ? 18  DC  C O2    1 
ATOM   1931 N  N3    . DC  C 2 18  ? 16.685  10.527 13.664  1.00 34.08 ? 18  DC  C N3    1 
ATOM   1932 C  C4    . DC  C 2 18  ? 16.494  10.116 14.919  1.00 34.26 ? 18  DC  C C4    1 
ATOM   1933 N  N4    . DC  C 2 18  ? 17.365  10.511 15.849  1.00 33.78 ? 18  DC  C N4    1 
ATOM   1934 C  C5    . DC  C 2 18  ? 15.399  9.282  15.279  1.00 34.76 ? 18  DC  C C5    1 
ATOM   1935 C  C6    . DC  C 2 18  ? 14.556  8.919  14.308  1.00 35.58 ? 18  DC  C C6    1 
ATOM   1936 P  P     . DC  C 2 19  ? 12.609  5.930  9.239   1.00 41.19 ? 19  DC  C P     1 
ATOM   1937 O  OP1   . DC  C 2 19  ? 11.842  5.645  8.002   1.00 41.22 ? 19  DC  C OP1   1 
ATOM   1938 O  OP2   . DC  C 2 19  ? 12.797  4.867  10.266  1.00 40.47 ? 19  DC  C OP2   1 
ATOM   1939 O  "O5'" . DC  C 2 19  ? 14.047  6.456  8.797   1.00 39.15 ? 19  DC  C "O5'" 1 
ATOM   1940 C  "C5'" . DC  C 2 19  ? 14.134  7.660  8.051   1.00 36.93 ? 19  DC  C "C5'" 1 
ATOM   1941 C  "C4'" . DC  C 2 19  ? 15.578  7.872  7.692   1.00 35.59 ? 19  DC  C "C4'" 1 
ATOM   1942 O  "O4'" . DC  C 2 19  ? 16.269  8.298  8.888   1.00 34.47 ? 19  DC  C "O4'" 1 
ATOM   1943 C  "C3'" . DC  C 2 19  ? 16.275  6.609  7.209   1.00 35.12 ? 19  DC  C "C3'" 1 
ATOM   1944 O  "O3'" . DC  C 2 19  ? 17.060  6.933  6.105   1.00 35.74 ? 19  DC  C "O3'" 1 
ATOM   1945 C  "C2'" . DC  C 2 19  ? 17.117  6.174  8.400   1.00 34.32 ? 19  DC  C "C2'" 1 
ATOM   1946 C  "C1'" . DC  C 2 19  ? 17.408  7.498  9.096   1.00 33.76 ? 19  DC  C "C1'" 1 
ATOM   1947 N  N1    . DC  C 2 19  ? 17.643  7.430  10.580  1.00 32.45 ? 19  DC  C N1    1 
ATOM   1948 C  C2    . DC  C 2 19  ? 18.792  8.004  11.136  1.00 31.47 ? 19  DC  C C2    1 
ATOM   1949 O  O2    . DC  C 2 19  ? 19.611  8.555  10.399  1.00 30.85 ? 19  DC  C O2    1 
ATOM   1950 N  N3    . DC  C 2 19  ? 18.982  7.937  12.478  1.00 30.91 ? 19  DC  C N3    1 
ATOM   1951 C  C4    . DC  C 2 19  ? 18.084  7.329  13.256  1.00 30.87 ? 19  DC  C C4    1 
ATOM   1952 N  N4    . DC  C 2 19  ? 18.328  7.290  14.569  1.00 30.45 ? 19  DC  C N4    1 
ATOM   1953 C  C5    . DC  C 2 19  ? 16.904  6.741  12.715  1.00 31.15 ? 19  DC  C C5    1 
ATOM   1954 C  C6    . DC  C 2 19  ? 16.730  6.817  11.390  1.00 31.78 ? 19  DC  C C6    1 
ATOM   1955 P  P     . DC  C 2 20  ? 17.617  5.820  5.110   1.00 36.77 ? 20  DC  C P     1 
ATOM   1956 O  OP1   . DC  C 2 20  ? 17.053  6.174  3.792   1.00 37.08 ? 20  DC  C OP1   1 
ATOM   1957 O  OP2   . DC  C 2 20  ? 17.442  4.453  5.662   1.00 36.35 ? 20  DC  C OP2   1 
ATOM   1958 O  "O5'" . DC  C 2 20  ? 19.184  6.125  5.100   1.00 36.42 ? 20  DC  C "O5'" 1 
ATOM   1959 C  "C5'" . DC  C 2 20  ? 19.725  7.356  5.596   1.00 36.11 ? 20  DC  C "C5'" 1 
ATOM   1960 C  "C4'" . DC  C 2 20  ? 21.123  7.128  6.132   1.00 36.07 ? 20  DC  C "C4'" 1 
ATOM   1961 O  "O4'" . DC  C 2 20  ? 21.068  6.952  7.575   1.00 35.84 ? 20  DC  C "O4'" 1 
ATOM   1962 C  "C3'" . DC  C 2 20  ? 21.802  5.873  5.594   1.00 35.77 ? 20  DC  C "C3'" 1 
ATOM   1963 O  "O3'" . DC  C 2 20  ? 23.197  6.069  5.460   1.00 36.27 ? 20  DC  C "O3'" 1 
ATOM   1964 C  "C2'" . DC  C 2 20  ? 21.473  4.834  6.658   1.00 35.40 ? 20  DC  C "C2'" 1 
ATOM   1965 C  "C1'" . DC  C 2 20  ? 21.620  5.686  7.915   1.00 35.06 ? 20  DC  C "C1'" 1 
ATOM   1966 N  N1    . DC  C 2 20  ? 20.944  5.207  9.172   1.00 33.90 ? 20  DC  C N1    1 
ATOM   1967 C  C2    . DC  C 2 20  ? 21.473  5.610  10.406  1.00 33.37 ? 20  DC  C C2    1 
ATOM   1968 O  O2    . DC  C 2 20  ? 22.480  6.329  10.433  1.00 32.63 ? 20  DC  C O2    1 
ATOM   1969 N  N3    . DC  C 2 20  ? 20.874  5.194  11.553  1.00 33.31 ? 20  DC  C N3    1 
ATOM   1970 C  C4    . DC  C 2 20  ? 19.790  4.414  11.499  1.00 33.45 ? 20  DC  C C4    1 
ATOM   1971 N  N4    . DC  C 2 20  ? 19.230  4.023  12.649  1.00 33.18 ? 20  DC  C N4    1 
ATOM   1972 C  C5    . DC  C 2 20  ? 19.228  3.999  10.256  1.00 33.47 ? 20  DC  C C5    1 
ATOM   1973 C  C6    . DC  C 2 20  ? 19.831  4.409  9.135   1.00 33.58 ? 20  DC  C C6    1 
ATOM   1974 P  P     . DG  C 2 21  ? 23.903  5.588  4.104   1.00 36.76 ? 21  DG  C P     1 
ATOM   1975 O  OP1   . DG  C 2 21  ? 23.239  6.344  3.017   1.00 36.98 ? 21  DG  C OP1   1 
ATOM   1976 O  OP2   . DG  C 2 21  ? 23.931  4.106  4.066   1.00 35.57 ? 21  DG  C OP2   1 
ATOM   1977 O  "O5'" . DG  C 2 21  ? 25.403  6.129  4.222   1.00 35.85 ? 21  DG  C "O5'" 1 
ATOM   1978 C  "C5'" . DG  C 2 21  ? 25.833  7.084  5.202   1.00 34.94 ? 21  DG  C "C5'" 1 
ATOM   1979 C  "C4'" . DG  C 2 21  ? 27.004  6.495  5.970   1.00 33.98 ? 21  DG  C "C4'" 1 
ATOM   1980 O  "O4'" . DG  C 2 21  ? 26.527  5.990  7.246   1.00 33.23 ? 21  DG  C "O4'" 1 
ATOM   1981 C  "C3'" . DG  C 2 21  ? 27.694  5.325  5.270   1.00 33.51 ? 21  DG  C "C3'" 1 
ATOM   1982 O  "O3'" . DG  C 2 21  ? 29.097  5.372  5.456   1.00 33.94 ? 21  DG  C "O3'" 1 
ATOM   1983 C  "C2'" . DG  C 2 21  ? 27.053  4.103  5.923   1.00 33.03 ? 21  DG  C "C2'" 1 
ATOM   1984 C  "C1'" . DG  C 2 21  ? 26.770  4.595  7.345   1.00 32.35 ? 21  DG  C "C1'" 1 
ATOM   1985 N  N9    . DG  C 2 21  ? 25.639  3.984  8.050   1.00 30.71 ? 21  DG  C N9    1 
ATOM   1986 C  C8    . DG  C 2 21  ? 24.572  3.292  7.524   1.00 30.34 ? 21  DG  C C8    1 
ATOM   1987 N  N7    . DG  C 2 21  ? 23.720  2.877  8.420   1.00 29.66 ? 21  DG  C N7    1 
ATOM   1988 C  C5    . DG  C 2 21  ? 24.254  3.319  9.617   1.00 28.52 ? 21  DG  C C5    1 
ATOM   1989 C  C6    . DG  C 2 21  ? 23.769  3.152  10.928  1.00 27.27 ? 21  DG  C C6    1 
ATOM   1990 O  O6    . DG  C 2 21  ? 22.739  2.568  11.284  1.00 26.67 ? 21  DG  C O6    1 
ATOM   1991 N  N1    . DG  C 2 21  ? 24.613  3.748  11.860  1.00 26.71 ? 21  DG  C N1    1 
ATOM   1992 C  C2    . DG  C 2 21  ? 25.778  4.413  11.554  1.00 26.73 ? 21  DG  C C2    1 
ATOM   1993 N  N2    . DG  C 2 21  ? 26.467  4.924  12.578  1.00 26.47 ? 21  DG  C N2    1 
ATOM   1994 N  N3    . DG  C 2 21  ? 26.243  4.575  10.326  1.00 27.56 ? 21  DG  C N3    1 
ATOM   1995 C  C4    . DG  C 2 21  ? 25.432  4.001  9.409   1.00 29.02 ? 21  DG  C C4    1 
ATOM   1996 P  P     . DT  D 3 1   ? 19.521  -7.007 13.193  1.00 23.00 ? 1   DT  D P     1 
ATOM   1997 O  OP1   . DT  D 3 1   ? 20.098  -5.672 12.855  1.00 21.89 ? 1   DT  D OP1   1 
ATOM   1998 O  OP2   . DT  D 3 1   ? 19.794  -8.225 12.385  1.00 21.96 ? 1   DT  D OP2   1 
ATOM   1999 O  "O5'" . DT  D 3 1   ? 19.818  -7.399 14.720  1.00 21.29 ? 1   DT  D "O5'" 1 
ATOM   2000 C  "C5'" . DT  D 3 1   ? 21.010  -8.074 15.103  1.00 19.72 ? 1   DT  D "C5'" 1 
ATOM   2001 C  "C4'" . DT  D 3 1   ? 22.071  -7.070 15.512  1.00 18.71 ? 1   DT  D "C4'" 1 
ATOM   2002 O  "O4'" . DT  D 3 1   ? 22.977  -6.843 14.416  1.00 17.51 ? 1   DT  D "O4'" 1 
ATOM   2003 C  "C3'" . DT  D 3 1   ? 21.615  -5.656 15.853  1.00 18.21 ? 1   DT  D "C3'" 1 
ATOM   2004 O  "O3'" . DT  D 3 1   ? 21.024  -5.623 17.134  1.00 19.06 ? 1   DT  D "O3'" 1 
ATOM   2005 C  "C2'" . DT  D 3 1   ? 22.936  -4.904 15.774  1.00 17.51 ? 1   DT  D "C2'" 1 
ATOM   2006 C  "C1'" . DT  D 3 1   ? 23.728  -5.692 14.740  1.00 16.64 ? 1   DT  D "C1'" 1 
ATOM   2007 N  N1    . DT  D 3 1   ? 24.023  -4.926 13.501  1.00 15.36 ? 1   DT  D N1    1 
ATOM   2008 C  C2    . DT  D 3 1   ? 25.012  -3.974 13.545  1.00 14.37 ? 1   DT  D C2    1 
ATOM   2009 O  O2    . DT  D 3 1   ? 25.646  -3.714 14.544  1.00 13.16 ? 1   DT  D O2    1 
ATOM   2010 N  N3    . DT  D 3 1   ? 25.230  -3.328 12.360  1.00 14.58 ? 1   DT  D N3    1 
ATOM   2011 C  C4    . DT  D 3 1   ? 24.570  -3.530 11.163  1.00 15.05 ? 1   DT  D C4    1 
ATOM   2012 O  O4    . DT  D 3 1   ? 24.842  -2.893 10.153  1.00 15.21 ? 1   DT  D O4    1 
ATOM   2013 C  C5    . DT  D 3 1   ? 23.546  -4.542 11.183  1.00 15.36 ? 1   DT  D C5    1 
ATOM   2014 C  C7    . DT  D 3 1   ? 22.760  -4.856 9.944   1.00 15.75 ? 1   DT  D C7    1 
ATOM   2015 C  C6    . DT  D 3 1   ? 23.325  -5.182 12.336  1.00 15.38 ? 1   DT  D C6    1 
ATOM   2016 P  P     . DT  D 3 2   ? 20.305  -4.325 17.732  1.00 20.79 ? 2   DT  D P     1 
ATOM   2017 O  OP1   . DT  D 3 2   ? 19.624  -4.832 18.941  1.00 21.44 ? 2   DT  D OP1   1 
ATOM   2018 O  OP2   . DT  D 3 2   ? 19.549  -3.592 16.682  1.00 20.13 ? 2   DT  D OP2   1 
ATOM   2019 O  "O5'" . DT  D 3 2   ? 21.513  -3.393 18.189  1.00 21.18 ? 2   DT  D "O5'" 1 
ATOM   2020 C  "C5'" . DT  D 3 2   ? 22.541  -3.918 19.013  1.00 21.91 ? 2   DT  D "C5'" 1 
ATOM   2021 C  "C4'" . DT  D 3 2   ? 23.652  -2.898 19.098  1.00 22.42 ? 2   DT  D "C4'" 1 
ATOM   2022 O  "O4'" . DT  D 3 2   ? 24.125  -2.531 17.775  1.00 22.19 ? 2   DT  D "O4'" 1 
ATOM   2023 C  "C3'" . DT  D 3 2   ? 23.203  -1.599 19.741  1.00 22.99 ? 2   DT  D "C3'" 1 
ATOM   2024 O  "O3'" . DT  D 3 2   ? 24.245  -1.178 20.613  1.00 24.13 ? 2   DT  D "O3'" 1 
ATOM   2025 C  "C2'" . DT  D 3 2   ? 22.934  -0.674 18.543  1.00 22.67 ? 2   DT  D "C2'" 1 
ATOM   2026 C  "C1'" . DT  D 3 2   ? 24.005  -1.134 17.559  1.00 22.35 ? 2   DT  D "C1'" 1 
ATOM   2027 N  N1    . DT  D 3 2   ? 23.763  -0.972 16.068  1.00 21.82 ? 2   DT  D N1    1 
ATOM   2028 C  C2    . DT  D 3 2   ? 24.729  -0.392 15.260  1.00 20.90 ? 2   DT  D C2    1 
ATOM   2029 O  O2    . DT  D 3 2   ? 25.783  0.052  15.669  1.00 20.56 ? 2   DT  D O2    1 
ATOM   2030 N  N3    . DT  D 3 2   ? 24.410  -0.340 13.928  1.00 20.45 ? 2   DT  D N3    1 
ATOM   2031 C  C4    . DT  D 3 2   ? 23.260  -0.801 13.321  1.00 20.84 ? 2   DT  D C4    1 
ATOM   2032 O  O4    . DT  D 3 2   ? 23.085  -0.698 12.111  1.00 20.69 ? 2   DT  D O4    1 
ATOM   2033 C  C5    . DT  D 3 2   ? 22.294  -1.401 14.212  1.00 21.19 ? 2   DT  D C5    1 
ATOM   2034 C  C7    . DT  D 3 2   ? 20.997  -1.945 13.688  1.00 21.15 ? 2   DT  D C7    1 
ATOM   2035 C  C6    . DT  D 3 2   ? 22.590  -1.459 15.517  1.00 21.64 ? 2   DT  D C6    1 
ATOM   2036 P  P     . DC  D 3 3   ? 24.086  0.155  21.477  1.00 25.51 ? 3   DC  D P     1 
ATOM   2037 O  OP1   . DC  D 3 3   ? 24.865  -0.061 22.717  1.00 25.39 ? 3   DC  D OP1   1 
ATOM   2038 O  OP2   . DC  D 3 3   ? 22.655  0.555  21.510  1.00 25.57 ? 3   DC  D OP2   1 
ATOM   2039 O  "O5'" . DC  D 3 3   ? 24.820  1.247  20.563  1.00 25.59 ? 3   DC  D "O5'" 1 
ATOM   2040 C  "C5'" . DC  D 3 3   ? 26.184  1.076  20.164  1.00 25.65 ? 3   DC  D "C5'" 1 
ATOM   2041 C  "C4'" . DC  D 3 3   ? 26.704  2.332  19.482  1.00 25.64 ? 3   DC  D "C4'" 1 
ATOM   2042 O  "O4'" . DC  D 3 3   ? 26.266  2.367  18.094  1.00 24.58 ? 3   DC  D "O4'" 1 
ATOM   2043 C  "C3'" . DC  D 3 3   ? 26.226  3.630  20.125  1.00 26.20 ? 3   DC  D "C3'" 1 
ATOM   2044 O  "O3'" . DC  D 3 3   ? 27.368  4.417  20.483  1.00 28.47 ? 3   DC  D "O3'" 1 
ATOM   2045 C  "C2'" . DC  D 3 3   ? 25.292  4.266  19.084  1.00 24.93 ? 3   DC  D "C2'" 1 
ATOM   2046 C  "C1'" . DC  D 3 3   ? 25.631  3.585  17.757  1.00 23.56 ? 3   DC  D "C1'" 1 
ATOM   2047 N  N1    . DC  D 3 3   ? 24.496  3.197  16.806  1.00 21.49 ? 3   DC  D N1    1 
ATOM   2048 C  C2    . DC  D 3 3   ? 24.663  3.316  15.410  1.00 19.53 ? 3   DC  D C2    1 
ATOM   2049 O  O2    . DC  D 3 3   ? 25.717  3.767  14.952  1.00 18.61 ? 3   DC  D O2    1 
ATOM   2050 N  N3    . DC  D 3 3   ? 23.657  2.935  14.575  1.00 18.11 ? 3   DC  D N3    1 
ATOM   2051 C  C4    . DC  D 3 3   ? 22.519  2.448  15.072  1.00 18.23 ? 3   DC  D C4    1 
ATOM   2052 N  N4    . DC  D 3 3   ? 21.558  2.088  14.220  1.00 17.33 ? 3   DC  D N4    1 
ATOM   2053 C  C5    . DC  D 3 3   ? 22.316  2.315  16.478  1.00 19.15 ? 3   DC  D C5    1 
ATOM   2054 C  C6    . DC  D 3 3   ? 23.317  2.687  17.292  1.00 20.42 ? 3   DC  D C6    1 
ATOM   2055 P  P     . DG  D 3 4   ? 27.216  5.853  21.185  1.00 30.99 ? 4   DG  D P     1 
ATOM   2056 O  OP1   . DG  D 3 4   ? 28.444  6.032  21.999  1.00 30.49 ? 4   DG  D OP1   1 
ATOM   2057 O  OP2   . DG  D 3 4   ? 25.860  6.004  21.774  1.00 31.02 ? 4   DG  D OP2   1 
ATOM   2058 O  "O5'" . DG  D 3 4   ? 27.229  6.870  19.949  1.00 30.29 ? 4   DG  D "O5'" 1 
ATOM   2059 C  "C5'" . DG  D 3 4   ? 28.220  6.714  18.945  1.00 30.19 ? 4   DG  D "C5'" 1 
ATOM   2060 C  "C4'" . DG  D 3 4   ? 27.950  7.682  17.828  1.00 29.62 ? 4   DG  D "C4'" 1 
ATOM   2061 O  "O4'" . DG  D 3 4   ? 26.864  7.169  17.025  1.00 28.73 ? 4   DG  D "O4'" 1 
ATOM   2062 C  "C3'" . DG  D 3 4   ? 27.513  9.047  18.313  1.00 30.10 ? 4   DG  D "C3'" 1 
ATOM   2063 O  "O3'" . DG  D 3 4   ? 28.134  9.992  17.498  1.00 31.72 ? 4   DG  D "O3'" 1 
ATOM   2064 C  "C2'" . DG  D 3 4   ? 25.991  9.009  18.156  1.00 29.45 ? 4   DG  D "C2'" 1 
ATOM   2065 C  "C1'" . DG  D 3 4   ? 25.835  8.128  16.925  1.00 28.48 ? 4   DG  D "C1'" 1 
ATOM   2066 N  N9    . DG  D 3 4   ? 24.584  7.384  16.794  1.00 26.86 ? 4   DG  D N9    1 
ATOM   2067 C  C8    . DG  D 3 4   ? 23.758  6.899  17.783  1.00 26.33 ? 4   DG  D C8    1 
ATOM   2068 N  N7    . DG  D 3 4   ? 22.714  6.259  17.330  1.00 25.35 ? 4   DG  D N7    1 
ATOM   2069 C  C5    . DG  D 3 4   ? 22.865  6.319  15.954  1.00 24.36 ? 4   DG  D C5    1 
ATOM   2070 C  C6    . DG  D 3 4   ? 22.045  5.799  14.935  1.00 23.15 ? 4   DG  D C6    1 
ATOM   2071 O  O6    . DG  D 3 4   ? 20.995  5.161  15.071  1.00 22.38 ? 4   DG  D O6    1 
ATOM   2072 N  N1    . DG  D 3 4   ? 22.557  6.082  13.670  1.00 22.79 ? 4   DG  D N1    1 
ATOM   2073 C  C2    . DG  D 3 4   ? 23.723  6.778  13.424  1.00 22.93 ? 4   DG  D C2    1 
ATOM   2074 N  N2    . DG  D 3 4   ? 24.077  6.961  12.146  1.00 22.86 ? 4   DG  D N2    1 
ATOM   2075 N  N3    . DG  D 3 4   ? 24.501  7.270  14.372  1.00 23.33 ? 4   DG  D N3    1 
ATOM   2076 C  C4    . DG  D 3 4   ? 24.008  7.004  15.606  1.00 24.99 ? 4   DG  D C4    1 
ATOM   2077 P  P     . DG  D 3 5   ? 28.099  11.542 17.883  1.00 33.90 ? 5   DG  D P     1 
ATOM   2078 O  OP1   . DG  D 3 5   ? 29.376  11.784 18.600  1.00 33.13 ? 5   DG  D OP1   1 
ATOM   2079 O  OP2   . DG  D 3 5   ? 26.786  11.917 18.464  1.00 32.93 ? 5   DG  D OP2   1 
ATOM   2080 O  "O5'" . DG  D 3 5   ? 28.142  12.260 16.455  1.00 32.79 ? 5   DG  D "O5'" 1 
ATOM   2081 C  "C5'" . DG  D 3 5   ? 28.616  11.571 15.291  1.00 32.09 ? 5   DG  D "C5'" 1 
ATOM   2082 C  "C4'" . DG  D 3 5   ? 27.640  11.832 14.172  1.00 31.21 ? 5   DG  D "C4'" 1 
ATOM   2083 O  "O4'" . DG  D 3 5   ? 26.431  11.051 14.330  1.00 30.41 ? 5   DG  D "O4'" 1 
ATOM   2084 C  "C3'" . DG  D 3 5   ? 27.154  13.267 14.137  1.00 31.02 ? 5   DG  D "C3'" 1 
ATOM   2085 O  "O3'" . DG  D 3 5   ? 27.136  13.617 12.806  1.00 31.91 ? 5   DG  D "O3'" 1 
ATOM   2086 C  "C2'" . DG  D 3 5   ? 25.748  13.224 14.728  1.00 29.97 ? 5   DG  D "C2'" 1 
ATOM   2087 C  "C1'" . DG  D 3 5   ? 25.304  11.890 14.156  1.00 29.03 ? 5   DG  D "C1'" 1 
ATOM   2088 N  N9    . DG  D 3 5   ? 24.185  11.228 14.807  1.00 27.07 ? 5   DG  D N9    1 
ATOM   2089 C  C8    . DG  D 3 5   ? 23.919  11.132 16.151  1.00 26.79 ? 5   DG  D C8    1 
ATOM   2090 N  N7    . DG  D 3 5   ? 22.841  10.447 16.420  1.00 26.14 ? 5   DG  D N7    1 
ATOM   2091 C  C5    . DG  D 3 5   ? 22.373  10.060 15.173  1.00 24.90 ? 5   DG  D C5    1 
ATOM   2092 C  C6    . DG  D 3 5   ? 21.236  9.298  14.822  1.00 24.06 ? 5   DG  D C6    1 
ATOM   2093 O  O6    . DG  D 3 5   ? 20.390  8.793  15.568  1.00 23.49 ? 5   DG  D O6    1 
ATOM   2094 N  N1    . DG  D 3 5   ? 21.126  9.151  13.444  1.00 23.77 ? 5   DG  D N1    1 
ATOM   2095 C  C2    . DG  D 3 5   ? 22.014  9.659  12.525  1.00 24.15 ? 5   DG  D C2    1 
ATOM   2096 N  N2    . DG  D 3 5   ? 21.755  9.404  11.242  1.00 24.34 ? 5   DG  D N2    1 
ATOM   2097 N  N3    . DG  D 3 5   ? 23.087  10.369 12.835  1.00 24.57 ? 5   DG  D N3    1 
ATOM   2098 C  C4    . DG  D 3 5   ? 23.194  10.531 14.174  1.00 25.47 ? 5   DG  D C4    1 
ATOM   2099 P  P     . DG  D 3 6   ? 27.302  15.141 12.417  1.00 33.02 ? 6   DG  D P     1 
ATOM   2100 O  OP1   . DG  D 3 6   ? 28.713  15.215 11.934  1.00 32.95 ? 6   DG  D OP1   1 
ATOM   2101 O  OP2   . DG  D 3 6   ? 26.788  15.997 13.515  1.00 32.84 ? 6   DG  D OP2   1 
ATOM   2102 O  "O5'" . DG  D 3 6   ? 26.280  15.239 11.195  1.00 30.26 ? 6   DG  D "O5'" 1 
ATOM   2103 C  "C5'" . DG  D 3 6   ? 26.360  14.214 10.195  1.00 28.37 ? 6   DG  D "C5'" 1 
ATOM   2104 C  "C4'" . DG  D 3 6   ? 25.005  13.987 9.571   1.00 26.62 ? 6   DG  D "C4'" 1 
ATOM   2105 O  "O4'" . DG  D 3 6   ? 24.097  13.339 10.498  1.00 25.53 ? 6   DG  D "O4'" 1 
ATOM   2106 C  "C3'" . DG  D 3 6   ? 24.316  15.278 9.163   1.00 25.64 ? 6   DG  D "C3'" 1 
ATOM   2107 O  "O3'" . DG  D 3 6   ? 23.800  15.013 7.889   1.00 25.15 ? 6   DG  D "O3'" 1 
ATOM   2108 C  "C2'" . DG  D 3 6   ? 23.270  15.483 10.259  1.00 24.68 ? 6   DG  D "C2'" 1 
ATOM   2109 C  "C1'" . DG  D 3 6   ? 22.875  14.036 10.511  1.00 24.04 ? 6   DG  D "C1'" 1 
ATOM   2110 N  N9    . DG  D 3 6   ? 22.227  13.748 11.783  1.00 22.80 ? 6   DG  D N9    1 
ATOM   2111 C  C8    . DG  D 3 6   ? 22.650  14.115 13.036  1.00 22.47 ? 6   DG  D C8    1 
ATOM   2112 N  N7    . DG  D 3 6   ? 21.861  13.705 13.993  1.00 21.59 ? 6   DG  D N7    1 
ATOM   2113 C  C5    . DG  D 3 6   ? 20.852  13.014 13.333  1.00 20.92 ? 6   DG  D C5    1 
ATOM   2114 C  C6    . DG  D 3 6   ? 19.708  12.338 13.838  1.00 20.21 ? 6   DG  D C6    1 
ATOM   2115 O  O6    . DG  D 3 6   ? 19.330  12.202 15.005  1.00 19.95 ? 6   DG  D O6    1 
ATOM   2116 N  N1    . DG  D 3 6   ? 18.949  11.774 12.828  1.00 19.45 ? 6   DG  D N1    1 
ATOM   2117 C  C2    . DG  D 3 6   ? 19.255  11.856 11.496  1.00 19.71 ? 6   DG  D C2    1 
ATOM   2118 N  N2    . DG  D 3 6   ? 18.407  11.252 10.667  1.00 20.46 ? 6   DG  D N2    1 
ATOM   2119 N  N3    . DG  D 3 6   ? 20.316  12.475 11.003  1.00 20.24 ? 6   DG  D N3    1 
ATOM   2120 C  C4    . DG  D 3 6   ? 21.069  13.033 11.975  1.00 21.19 ? 6   DG  D C4    1 
ATOM   2121 P  P     . DC  D 3 7   ? 23.106  16.138 7.017   1.00 25.00 ? 7   DC  D P     1 
ATOM   2122 O  OP1   . DC  D 3 7   ? 23.655  15.946 5.661   1.00 25.11 ? 7   DC  D OP1   1 
ATOM   2123 O  OP2   . DC  D 3 7   ? 23.133  17.452 7.718   1.00 25.18 ? 7   DC  D OP2   1 
ATOM   2124 O  "O5'" . DC  D 3 7   ? 21.593  15.650 7.053   1.00 22.90 ? 7   DC  D "O5'" 1 
ATOM   2125 C  "C5'" . DC  D 3 7   ? 21.292  14.339 6.607   1.00 20.07 ? 7   DC  D "C5'" 1 
ATOM   2126 C  "C4'" . DC  D 3 7   ? 19.803  14.127 6.765   1.00 18.86 ? 7   DC  D "C4'" 1 
ATOM   2127 O  "O4'" . DC  D 3 7   ? 19.498  14.058 8.185   1.00 17.64 ? 7   DC  D "O4'" 1 
ATOM   2128 C  "C3'" . DC  D 3 7   ? 18.927  15.242 6.179   1.00 16.51 ? 7   DC  D "C3'" 1 
ATOM   2129 O  "O3'" . DC  D 3 7   ? 17.942  14.632 5.350   1.00 15.04 ? 7   DC  D "O3'" 1 
ATOM   2130 C  "C2'" . DC  D 3 7   ? 18.398  15.963 7.426   1.00 16.89 ? 7   DC  D "C2'" 1 
ATOM   2131 C  "C1'" . DC  D 3 7   ? 18.364  14.845 8.462   1.00 17.23 ? 7   DC  D "C1'" 1 
ATOM   2132 N  N1    . DC  D 3 7   ? 18.503  15.157 9.919   1.00 16.74 ? 7   DC  D N1    1 
ATOM   2133 C  C2    . DC  D 3 7   ? 17.542  14.667 10.817  1.00 16.66 ? 7   DC  D C2    1 
ATOM   2134 O  O2    . DC  D 3 7   ? 16.585  14.016 10.380  1.00 16.87 ? 7   DC  D O2    1 
ATOM   2135 N  N3    . DC  D 3 7   ? 17.687  14.917 12.145  1.00 16.43 ? 7   DC  D N3    1 
ATOM   2136 C  C4    . DC  D 3 7   ? 18.749  15.613 12.587  1.00 16.97 ? 7   DC  D C4    1 
ATOM   2137 N  N4    . DC  D 3 7   ? 18.851  15.825 13.907  1.00 16.20 ? 7   DC  D N4    1 
ATOM   2138 C  C5    . DC  D 3 7   ? 19.746  16.120 11.689  1.00 16.24 ? 7   DC  D C5    1 
ATOM   2139 C  C6    . DC  D 3 7   ? 19.584  15.856 10.380  1.00 16.43 ? 7   DC  D C6    1 
ATOM   2140 P  P     . DT  D 3 8   ? 16.852  15.477 4.532   1.00 16.43 ? 8   DT  D P     1 
ATOM   2141 O  OP1   . DT  D 3 8   ? 16.455  14.690 3.362   1.00 14.46 ? 8   DT  D OP1   1 
ATOM   2142 O  OP2   . DT  D 3 8   ? 17.284  16.888 4.422   1.00 17.31 ? 8   DT  D OP2   1 
ATOM   2143 O  "O5'" . DT  D 3 8   ? 15.626  15.545 5.570   1.00 15.38 ? 8   DT  D "O5'" 1 
ATOM   2144 C  "C5'" . DT  D 3 8   ? 14.995  14.296 5.871   1.00 15.17 ? 8   DT  D "C5'" 1 
ATOM   2145 C  "C4'" . DT  D 3 8   ? 13.836  14.465 6.828   1.00 15.31 ? 8   DT  D "C4'" 1 
ATOM   2146 O  "O4'" . DT  D 3 8   ? 14.335  14.889 8.119   1.00 15.06 ? 8   DT  D "O4'" 1 
ATOM   2147 C  "C3'" . DT  D 3 8   ? 12.808  15.510 6.393   1.00 14.88 ? 8   DT  D "C3'" 1 
ATOM   2148 O  "O3'" . DT  D 3 8   ? 11.545  14.915 6.508   1.00 14.84 ? 8   DT  D "O3'" 1 
ATOM   2149 C  "C2'" . DT  D 3 8   ? 13.065  16.660 7.362   1.00 15.00 ? 8   DT  D "C2'" 1 
ATOM   2150 C  "C1'" . DT  D 3 8   ? 13.486  15.890 8.613   1.00 15.16 ? 8   DT  D "C1'" 1 
ATOM   2151 N  N1    . DT  D 3 8   ? 14.292  16.572 9.672   1.00 15.75 ? 8   DT  D N1    1 
ATOM   2152 C  C2    . DT  D 3 8   ? 13.900  16.449 10.982  1.00 15.64 ? 8   DT  D C2    1 
ATOM   2153 O  O2    . DT  D 3 8   ? 12.915  15.835 11.333  1.00 17.04 ? 8   DT  D O2    1 
ATOM   2154 N  N3    . DT  D 3 8   ? 14.707  17.094 11.880  1.00 15.67 ? 8   DT  D N3    1 
ATOM   2155 C  C4    . DT  D 3 8   ? 15.841  17.844 11.623  1.00 15.06 ? 8   DT  D C4    1 
ATOM   2156 O  O4    . DT  D 3 8   ? 16.494  18.371 12.521  1.00 13.48 ? 8   DT  D O4    1 
ATOM   2157 C  C5    . DT  D 3 8   ? 16.193  17.950 10.232  1.00 15.12 ? 8   DT  D C5    1 
ATOM   2158 C  C7    . DT  D 3 8   ? 17.409  18.736 9.825   1.00 15.54 ? 8   DT  D C7    1 
ATOM   2159 C  C6    . DT  D 3 8   ? 15.419  17.312 9.338   1.00 15.51 ? 8   DT  D C6    1 
ATOM   2160 P  P     . DG  D 3 9   ? 10.210  15.575 5.929   1.00 17.57 ? 9   DG  D P     1 
ATOM   2161 O  OP1   . DG  D 3 9   ? 9.380   14.500 5.349   1.00 14.90 ? 9   DG  D OP1   1 
ATOM   2162 O  OP2   . DG  D 3 9   ? 10.549  16.788 5.146   1.00 16.33 ? 9   DG  D OP2   1 
ATOM   2163 O  "O5'" . DG  D 3 9   ? 9.539   16.138 7.259   1.00 17.17 ? 9   DG  D "O5'" 1 
ATOM   2164 C  "C5'" . DG  D 3 9   ? 9.032   15.258 8.243   1.00 17.31 ? 9   DG  D "C5'" 1 
ATOM   2165 C  "C4'" . DG  D 3 9   ? 8.607   16.036 9.477   1.00 17.09 ? 9   DG  D "C4'" 1 
ATOM   2166 O  "O4'" . DG  D 3 9   ? 9.767   16.588 10.139  1.00 16.65 ? 9   DG  D "O4'" 1 
ATOM   2167 C  "C3'" . DG  D 3 9   ? 7.677   17.222 9.219   1.00 17.42 ? 9   DG  D "C3'" 1 
ATOM   2168 O  "O3'" . DG  D 3 9   ? 6.448   16.952 9.878   1.00 19.43 ? 9   DG  D "O3'" 1 
ATOM   2169 C  "C2'" . DG  D 3 9   ? 8.435   18.422 9.782   1.00 17.23 ? 9   DG  D "C2'" 1 
ATOM   2170 C  "C1'" . DG  D 3 9   ? 9.399   17.792 10.770  1.00 16.71 ? 9   DG  D "C1'" 1 
ATOM   2171 N  N9    . DG  D 3 9   ? 10.647  18.501 11.036  1.00 16.50 ? 9   DG  D N9    1 
ATOM   2172 C  C8    . DG  D 3 9   ? 11.577  18.953 10.121  1.00 16.62 ? 9   DG  D C8    1 
ATOM   2173 N  N7    . DG  D 3 9   ? 12.617  19.539 10.663  1.00 16.20 ? 9   DG  D N7    1 
ATOM   2174 C  C5    . DG  D 3 9   ? 12.365  19.466 12.035  1.00 16.70 ? 9   DG  D C5    1 
ATOM   2175 C  C6    . DG  D 3 9   ? 13.117  19.918 13.159  1.00 16.74 ? 9   DG  D C6    1 
ATOM   2176 O  O6    . DG  D 3 9   ? 14.206  20.499 13.189  1.00 16.37 ? 9   DG  D O6    1 
ATOM   2177 N  N1    . DG  D 3 9   ? 12.486  19.635 14.370  1.00 16.72 ? 9   DG  D N1    1 
ATOM   2178 C  C2    . DG  D 3 9   ? 11.265  18.993 14.489  1.00 17.33 ? 9   DG  D C2    1 
ATOM   2179 N  N2    . DG  D 3 9   ? 10.790  18.790 15.737  1.00 16.22 ? 9   DG  D N2    1 
ATOM   2180 N  N3    . DG  D 3 9   ? 10.555  18.569 13.448  1.00 16.72 ? 9   DG  D N3    1 
ATOM   2181 C  C4    . DG  D 3 9   ? 11.159  18.825 12.267  1.00 16.54 ? 9   DG  D C4    1 
ATOM   2182 P  P     . DT  D 3 10  ? 5.203   17.972 9.914   1.00 19.95 ? 10  DT  D P     1 
ATOM   2183 O  OP1   . DT  D 3 10  ? 4.018   17.102 9.986   1.00 19.95 ? 10  DT  D OP1   1 
ATOM   2184 O  OP2   . DT  D 3 10  ? 5.299   19.045 8.912   1.00 19.37 ? 10  DT  D OP2   1 
ATOM   2185 O  "O5'" . DT  D 3 10  ? 5.501   18.690 11.299  1.00 19.69 ? 10  DT  D "O5'" 1 
ATOM   2186 C  "C5'" . DT  D 3 10  ? 5.504   17.934 12.504  1.00 18.61 ? 10  DT  D "C5'" 1 
ATOM   2187 C  "C4'" . DT  D 3 10  ? 5.698   18.863 13.679  1.00 17.71 ? 10  DT  D "C4'" 1 
ATOM   2188 O  "O4'" . DT  D 3 10  ? 7.050   19.370 13.669  1.00 16.20 ? 10  DT  D "O4'" 1 
ATOM   2189 C  "C3'" . DT  D 3 10  ? 4.768   20.096 13.688  1.00 17.38 ? 10  DT  D "C3'" 1 
ATOM   2190 O  "O3'" . DT  D 3 10  ? 3.932   20.002 14.838  1.00 19.21 ? 10  DT  D "O3'" 1 
ATOM   2191 C  "C2'" . DT  D 3 10  ? 5.706   21.292 13.705  1.00 16.65 ? 10  DT  D "C2'" 1 
ATOM   2192 C  "C1'" . DT  D 3 10  ? 7.004   20.673 14.223  1.00 17.09 ? 10  DT  D "C1'" 1 
ATOM   2193 N  N1    . DT  D 3 10  ? 8.285   21.342 13.850  1.00 16.58 ? 10  DT  D N1    1 
ATOM   2194 C  C2    . DT  D 3 10  ? 9.141   21.782 14.842  1.00 17.07 ? 10  DT  D C2    1 
ATOM   2195 O  O2    . DT  D 3 10  ? 8.922   21.693 16.049  1.00 16.36 ? 10  DT  D O2    1 
ATOM   2196 N  N3    . DT  D 3 10  ? 10.294  22.357 14.373  1.00 16.32 ? 10  DT  D N3    1 
ATOM   2197 C  C4    . DT  D 3 10  ? 10.685  22.511 13.060  1.00 17.21 ? 10  DT  D C4    1 
ATOM   2198 O  O4    . DT  D 3 10  ? 11.759  23.026 12.778  1.00 16.58 ? 10  DT  D O4    1 
ATOM   2199 C  C5    . DT  D 3 10  ? 9.748   22.028 12.072  1.00 17.04 ? 10  DT  D C5    1 
ATOM   2200 C  C7    . DT  D 3 10  ? 10.052  22.149 10.611  1.00 16.37 ? 10  DT  D C7    1 
ATOM   2201 C  C6    . DT  D 3 10  ? 8.611   21.465 12.514  1.00 16.98 ? 10  DT  D C6    1 
ATOM   2202 P  P     . DT  D 3 11  ? 2.839   21.130 15.187  1.00 19.35 ? 11  DT  D P     1 
ATOM   2203 O  OP1   . DT  D 3 11  ? 1.849   20.443 16.019  1.00 20.26 ? 11  DT  D OP1   1 
ATOM   2204 O  OP2   . DT  D 3 11  ? 2.471   21.876 13.971  1.00 19.28 ? 11  DT  D OP2   1 
ATOM   2205 O  "O5'" . DT  D 3 11  ? 3.641   22.151 16.102  1.00 18.69 ? 11  DT  D "O5'" 1 
ATOM   2206 C  "C5'" . DT  D 3 11  ? 4.101   21.707 17.359  1.00 18.24 ? 11  DT  D "C5'" 1 
ATOM   2207 C  "C4'" . DT  D 3 11  ? 5.062   22.762 17.836  1.00 18.67 ? 11  DT  D "C4'" 1 
ATOM   2208 O  "O4'" . DT  D 3 11  ? 6.108   22.941 16.849  1.00 18.28 ? 11  DT  D "O4'" 1 
ATOM   2209 C  "C3'" . DT  D 3 11  ? 4.412   24.141 18.002  1.00 18.24 ? 11  DT  D "C3'" 1 
ATOM   2210 O  "O3'" . DT  D 3 11  ? 4.161   24.354 19.388  1.00 19.60 ? 11  DT  D "O3'" 1 
ATOM   2211 C  "C2'" . DT  D 3 11  ? 5.427   25.121 17.411  1.00 18.49 ? 11  DT  D "C2'" 1 
ATOM   2212 C  "C1'" . DT  D 3 11  ? 6.638   24.227 17.117  1.00 18.46 ? 11  DT  D "C1'" 1 
ATOM   2213 N  N1    . DT  D 3 11  ? 7.466   24.680 15.975  1.00 17.40 ? 11  DT  D N1    1 
ATOM   2214 C  C2    . DT  D 3 11  ? 8.692   25.228 16.234  1.00 18.17 ? 11  DT  D C2    1 
ATOM   2215 O  O2    . DT  D 3 11  ? 9.152   25.354 17.365  1.00 19.34 ? 11  DT  D O2    1 
ATOM   2216 N  N3    . DT  D 3 11  ? 9.367   25.620 15.111  1.00 18.10 ? 11  DT  D N3    1 
ATOM   2217 C  C4    . DT  D 3 11  ? 8.945   25.534 13.799  1.00 18.44 ? 11  DT  D C4    1 
ATOM   2218 O  O4    . DT  D 3 11  ? 9.652   25.921 12.874  1.00 19.53 ? 11  DT  D O4    1 
ATOM   2219 C  C5    . DT  D 3 11  ? 7.630   24.986 13.603  1.00 18.45 ? 11  DT  D C5    1 
ATOM   2220 C  C7    . DT  D 3 11  ? 7.035   24.833 12.233  1.00 18.03 ? 11  DT  D C7    1 
ATOM   2221 C  C6    . DT  D 3 11  ? 6.972   24.588 14.693  1.00 18.34 ? 11  DT  D C6    1 
ATOM   2222 P  P     . DT  D 3 12  ? 3.299   25.623 19.868  1.00 19.77 ? 12  DT  D P     1 
ATOM   2223 O  OP1   . DT  D 3 12  ? 2.615   25.257 21.120  1.00 18.20 ? 12  DT  D OP1   1 
ATOM   2224 O  OP2   . DT  D 3 12  ? 2.582   26.207 18.721  1.00 20.35 ? 12  DT  D OP2   1 
ATOM   2225 O  "O5'" . DT  D 3 12  ? 4.472   26.682 20.144  1.00 17.91 ? 12  DT  D "O5'" 1 
ATOM   2226 C  "C5'" . DT  D 3 12  ? 5.329   26.467 21.270  1.00 16.26 ? 12  DT  D "C5'" 1 
ATOM   2227 C  "C4'" . DT  D 3 12  ? 6.408   27.530 21.209  1.00 16.25 ? 12  DT  D "C4'" 1 
ATOM   2228 O  "O4'" . DT  D 3 12  ? 7.093   27.429 19.929  1.00 15.37 ? 12  DT  D "O4'" 1 
ATOM   2229 C  "C3'" . DT  D 3 12  ? 5.859   28.964 21.282  1.00 15.83 ? 12  DT  D "C3'" 1 
ATOM   2230 O  "O3'" . DT  D 3 12  ? 6.331   29.595 22.454  1.00 15.04 ? 12  DT  D "O3'" 1 
ATOM   2231 C  "C2'" . DT  D 3 12  ? 6.352   29.627 19.985  1.00 16.54 ? 12  DT  D "C2'" 1 
ATOM   2232 C  "C1'" . DT  D 3 12  ? 7.512   28.722 19.554  1.00 15.81 ? 12  DT  D "C1'" 1 
ATOM   2233 N  N1    . DT  D 3 12  ? 7.822   28.720 18.107  1.00 16.37 ? 12  DT  D N1    1 
ATOM   2234 C  C2    . DT  D 3 12  ? 9.090   29.031 17.647  1.00 16.45 ? 12  DT  D C2    1 
ATOM   2235 O  O2    . DT  D 3 12  ? 10.032  29.333 18.345  1.00 17.78 ? 12  DT  D O2    1 
ATOM   2236 N  N3    . DT  D 3 12  ? 9.231   29.001 16.285  1.00 15.87 ? 12  DT  D N3    1 
ATOM   2237 C  C4    . DT  D 3 12  ? 8.291   28.680 15.354  1.00 16.01 ? 12  DT  D C4    1 
ATOM   2238 O  O4    . DT  D 3 12  ? 8.565   28.672 14.160  1.00 16.68 ? 12  DT  D O4    1 
ATOM   2239 C  C5    . DT  D 3 12  ? 6.976   28.366 15.876  1.00 17.38 ? 12  DT  D C5    1 
ATOM   2240 C  C7    . DT  D 3 12  ? 5.842   28.026 14.933  1.00 17.42 ? 12  DT  D C7    1 
ATOM   2241 C  C6    . DT  D 3 12  ? 6.811   28.398 17.202  1.00 16.74 ? 12  DT  D C6    1 
ATOM   2242 P  P     . DA  D 3 13  ? 6.031   31.127 22.808  1.00 15.16 ? 13  DA  D P     1 
ATOM   2243 O  OP1   . DA  D 3 13  ? 6.095   31.230 24.273  1.00 14.32 ? 13  DA  D OP1   1 
ATOM   2244 O  OP2   . DA  D 3 13  ? 4.852   31.649 22.079  1.00 13.85 ? 13  DA  D OP2   1 
ATOM   2245 O  "O5'" . DA  D 3 13  ? 7.271   31.879 22.142  1.00 17.28 ? 13  DA  D "O5'" 1 
ATOM   2246 C  "C5'" . DA  D 3 13  ? 8.603   31.461 22.506  1.00 18.22 ? 13  DA  D "C5'" 1 
ATOM   2247 C  "C4'" . DA  D 3 13  ? 9.623   32.363 21.840  1.00 17.94 ? 13  DA  D "C4'" 1 
ATOM   2248 O  "O4'" . DA  D 3 13  ? 9.738   32.024 20.442  1.00 16.73 ? 13  DA  D "O4'" 1 
ATOM   2249 C  "C3'" . DA  D 3 13  ? 9.277   33.855 21.915  1.00 18.04 ? 13  DA  D "C3'" 1 
ATOM   2250 O  "O3'" . DA  D 3 13  ? 10.392  34.472 22.525  1.00 18.97 ? 13  DA  D "O3'" 1 
ATOM   2251 C  "C2'" . DA  D 3 13  ? 9.026   34.264 20.468  1.00 17.71 ? 13  DA  D "C2'" 1 
ATOM   2252 C  "C1'" . DA  D 3 13  ? 9.793   33.213 19.674  1.00 17.16 ? 13  DA  D "C1'" 1 
ATOM   2253 N  N9    . DA  D 3 13  ? 9.302   32.879 18.343  1.00 16.37 ? 13  DA  D N9    1 
ATOM   2254 C  C8    . DA  D 3 13  ? 8.065   32.390 18.022  1.00 16.46 ? 13  DA  D C8    1 
ATOM   2255 N  N7    . DA  D 3 13  ? 7.898   32.157 16.743  1.00 16.83 ? 13  DA  D N7    1 
ATOM   2256 C  C5    . DA  D 3 13  ? 9.120   32.484 16.182  1.00 17.14 ? 13  DA  D C5    1 
ATOM   2257 C  C6    . DA  D 3 13  ? 9.598   32.424 14.854  1.00 16.65 ? 13  DA  D C6    1 
ATOM   2258 N  N6    . DA  D 3 13  ? 8.860   32.020 13.830  1.00 16.19 ? 13  DA  D N6    1 
ATOM   2259 N  N1    . DA  D 3 13  ? 10.855  32.838 14.626  1.00 17.78 ? 13  DA  D N1    1 
ATOM   2260 C  C2    . DA  D 3 13  ? 11.607  33.245 15.667  1.00 16.85 ? 13  DA  D C2    1 
ATOM   2261 N  N3    . DA  D 3 13  ? 11.290  33.307 16.964  1.00 16.95 ? 13  DA  D N3    1 
ATOM   2262 C  C4    . DA  D 3 13  ? 10.009  32.918 17.158  1.00 17.21 ? 13  DA  D C4    1 
ATOM   2263 P  P     . DT  D 3 14  ? 10.415  35.973 23.030  1.00 21.17 ? 14  DT  D P     1 
ATOM   2264 O  OP1   . DT  D 3 14  ? 11.449  35.974 24.088  1.00 21.29 ? 14  DT  D OP1   1 
ATOM   2265 O  OP2   . DT  D 3 14  ? 9.063   36.507 23.311  1.00 20.28 ? 14  DT  D OP2   1 
ATOM   2266 O  "O5'" . DT  D 3 14  ? 10.927  36.780 21.742  1.00 20.94 ? 14  DT  D "O5'" 1 
ATOM   2267 C  "C5'" . DT  D 3 14  ? 12.325  36.698 21.406  1.00 19.88 ? 14  DT  D "C5'" 1 
ATOM   2268 C  "C4'" . DT  D 3 14  ? 12.577  37.291 20.037  1.00 19.35 ? 14  DT  D "C4'" 1 
ATOM   2269 O  "O4'" . DT  D 3 14  ? 11.817  36.560 19.046  1.00 19.52 ? 14  DT  D "O4'" 1 
ATOM   2270 C  "C3'" . DT  D 3 14  ? 12.135  38.740 19.891  1.00 19.19 ? 14  DT  D "C3'" 1 
ATOM   2271 O  "O3'" . DT  D 3 14  ? 13.307  39.560 19.910  1.00 19.96 ? 14  DT  D "O3'" 1 
ATOM   2272 C  "C2'" . DT  D 3 14  ? 11.351  38.783 18.571  1.00 18.96 ? 14  DT  D "C2'" 1 
ATOM   2273 C  "C1'" . DT  D 3 14  ? 11.617  37.426 17.952  1.00 18.87 ? 14  DT  D "C1'" 1 
ATOM   2274 N  N1    . DT  D 3 14  ? 10.525  36.836 17.113  1.00 19.41 ? 14  DT  D N1    1 
ATOM   2275 C  C2    . DT  D 3 14  ? 10.783  36.587 15.782  1.00 19.52 ? 14  DT  D C2    1 
ATOM   2276 O  O2    . DT  D 3 14  ? 11.848  36.831 15.250  1.00 19.22 ? 14  DT  D O2    1 
ATOM   2277 N  N3    . DT  D 3 14  ? 9.735   36.040 15.086  1.00 19.29 ? 14  DT  D N3    1 
ATOM   2278 C  C4    . DT  D 3 14  ? 8.484   35.708 15.561  1.00 18.62 ? 14  DT  D C4    1 
ATOM   2279 O  O4    . DT  D 3 14  ? 7.627   35.220 14.819  1.00 17.82 ? 14  DT  D O4    1 
ATOM   2280 C  C5    . DT  D 3 14  ? 8.267   36.007 16.950  1.00 18.15 ? 14  DT  D C5    1 
ATOM   2281 C  C7    . DT  D 3 14  ? 6.939   35.701 17.586  1.00 17.15 ? 14  DT  D C7    1 
ATOM   2282 C  C6    . DT  D 3 14  ? 9.281   36.547 17.654  1.00 18.61 ? 14  DT  D C6    1 
ATOM   2283 P  P     . DA  D 3 15  ? 13.206  41.152 19.869  1.00 20.02 ? 15  DA  D P     1 
ATOM   2284 O  OP1   . DA  D 3 15  ? 14.439  41.696 20.457  1.00 21.99 ? 15  DA  D OP1   1 
ATOM   2285 O  OP2   . DA  D 3 15  ? 11.885  41.589 20.380  1.00 22.52 ? 15  DA  D OP2   1 
ATOM   2286 O  "O5'" . DA  D 3 15  ? 13.184  41.434 18.294  1.00 21.51 ? 15  DA  D "O5'" 1 
ATOM   2287 C  "C5'" . DA  D 3 15  ? 14.164  40.848 17.431  1.00 20.86 ? 15  DA  D "C5'" 1 
ATOM   2288 C  "C4'" . DA  D 3 15  ? 13.933  41.240 15.986  1.00 20.56 ? 15  DA  D "C4'" 1 
ATOM   2289 O  "O4'" . DA  D 3 15  ? 12.912  40.378 15.449  1.00 19.88 ? 15  DA  D "O4'" 1 
ATOM   2290 C  "C3'" . DA  D 3 15  ? 13.462  42.672 15.745  1.00 21.92 ? 15  DA  D "C3'" 1 
ATOM   2291 O  "O3'" . DA  D 3 15  ? 14.454  43.332 14.955  1.00 24.10 ? 15  DA  D "O3'" 1 
ATOM   2292 C  "C2'" . DA  D 3 15  ? 12.079  42.533 15.083  1.00 21.52 ? 15  DA  D "C2'" 1 
ATOM   2293 C  "C1'" . DA  D 3 15  ? 12.111  41.106 14.537  1.00 20.67 ? 15  DA  D "C1'" 1 
ATOM   2294 N  N9    . DA  D 3 15  ? 10.835  40.404 14.482  1.00 19.50 ? 15  DA  D N9    1 
ATOM   2295 C  C8    . DA  D 3 15  ? 9.976   40.202 15.525  1.00 19.96 ? 15  DA  D C8    1 
ATOM   2296 N  N7    . DA  D 3 15  ? 8.906   39.507 15.220  1.00 19.58 ? 15  DA  D N7    1 
ATOM   2297 C  C5    . DA  D 3 15  ? 9.065   39.232 13.879  1.00 19.78 ? 15  DA  D C5    1 
ATOM   2298 C  C6    . DA  D 3 15  ? 8.263   38.540 12.956  1.00 19.53 ? 15  DA  D C6    1 
ATOM   2299 N  N6    . DA  D 3 15  ? 7.085   37.966 13.270  1.00 20.67 ? 15  DA  D N6    1 
ATOM   2300 N  N1    . DA  D 3 15  ? 8.718   38.464 11.685  1.00 18.57 ? 15  DA  D N1    1 
ATOM   2301 C  C2    . DA  D 3 15  ? 9.887   39.034 11.374  1.00 18.47 ? 15  DA  D C2    1 
ATOM   2302 N  N3    . DA  D 3 15  ? 10.728  39.713 12.152  1.00 19.28 ? 15  DA  D N3    1 
ATOM   2303 C  C4    . DA  D 3 15  ? 10.258  39.777 13.408  1.00 20.01 ? 15  DA  D C4    1 
ATOM   2304 P  P     . DA  D 3 16  ? 14.321  44.877 14.564  1.00 25.58 ? 16  DA  D P     1 
ATOM   2305 O  OP1   . DA  D 3 16  ? 15.683  45.376 14.263  1.00 27.13 ? 16  DA  D OP1   1 
ATOM   2306 O  OP2   . DA  D 3 16  ? 13.454  45.618 15.506  1.00 26.25 ? 16  DA  D OP2   1 
ATOM   2307 O  "O5'" . DA  D 3 16  ? 13.509  44.698 13.207  1.00 27.02 ? 16  DA  D "O5'" 1 
ATOM   2308 C  "C5'" . DA  D 3 16  ? 14.057  43.874 12.190  1.00 27.59 ? 16  DA  D "C5'" 1 
ATOM   2309 C  "C4'" . DA  D 3 16  ? 13.066  43.804 11.055  1.00 28.40 ? 16  DA  D "C4'" 1 
ATOM   2310 O  "O4'" . DA  D 3 16  ? 11.926  43.029 11.485  1.00 27.99 ? 16  DA  D "O4'" 1 
ATOM   2311 C  "C3'" . DA  D 3 16  ? 12.503  45.154 10.615  1.00 29.16 ? 16  DA  D "C3'" 1 
ATOM   2312 O  "O3'" . DA  D 3 16  ? 12.967  45.402 9.307   1.00 31.97 ? 16  DA  D "O3'" 1 
ATOM   2313 C  "C2'" . DA  D 3 16  ? 10.983  44.997 10.675  1.00 28.49 ? 16  DA  D "C2'" 1 
ATOM   2314 C  "C1'" . DA  D 3 16  ? 10.797  43.489 10.783  1.00 27.21 ? 16  DA  D "C1'" 1 
ATOM   2315 N  N9    . DA  D 3 16  ? 9.627   43.022 11.522  1.00 25.48 ? 16  DA  D N9    1 
ATOM   2316 C  C8    . DA  D 3 16  ? 9.303   43.290 12.819  1.00 24.70 ? 16  DA  D C8    1 
ATOM   2317 N  N7    . DA  D 3 16  ? 8.198   42.706 13.224  1.00 23.35 ? 16  DA  D N7    1 
ATOM   2318 C  C5    . DA  D 3 16  ? 7.770   42.015 12.109  1.00 22.63 ? 16  DA  D C5    1 
ATOM   2319 C  C6    . DA  D 3 16  ? 6.646   41.197 11.876  1.00 21.63 ? 16  DA  D C6    1 
ATOM   2320 N  N6    . DA  D 3 16  ? 5.737   40.954 12.812  1.00 21.62 ? 16  DA  D N6    1 
ATOM   2321 N  N1    . DA  D 3 16  ? 6.497   40.646 10.652  1.00 20.62 ? 16  DA  D N1    1 
ATOM   2322 C  C2    . DA  D 3 16  ? 7.435   40.904 9.728   1.00 21.60 ? 16  DA  D C2    1 
ATOM   2323 N  N3    . DA  D 3 16  ? 8.535   41.660 9.821   1.00 22.71 ? 16  DA  D N3    1 
ATOM   2324 C  C4    . DA  D 3 16  ? 8.642   42.190 11.052  1.00 23.43 ? 16  DA  D C4    1 
ATOM   2325 P  P     . DA  D 3 17  ? 12.818  46.829 8.603   1.00 33.49 ? 17  DA  D P     1 
ATOM   2326 O  OP1   . DA  D 3 17  ? 14.140  47.049 7.973   1.00 34.07 ? 17  DA  D OP1   1 
ATOM   2327 O  OP2   . DA  D 3 17  ? 12.186  47.815 9.523   1.00 32.90 ? 17  DA  D OP2   1 
ATOM   2328 O  "O5'" . DA  D 3 17  ? 11.724  46.563 7.465   1.00 31.55 ? 17  DA  D "O5'" 1 
ATOM   2329 C  "C5'" . DA  D 3 17  ? 11.732  45.443 6.589   1.00 28.75 ? 17  DA  D "C5'" 1 
ATOM   2330 C  "C4'" . DA  D 3 17  ? 10.340  45.383 5.993   1.00 27.52 ? 17  DA  D "C4'" 1 
ATOM   2331 O  "O4'" . DA  D 3 17  ? 9.399   44.809 6.946   1.00 24.92 ? 17  DA  D "O4'" 1 
ATOM   2332 C  "C3'" . DA  D 3 17  ? 9.795   46.765 5.643   1.00 27.07 ? 17  DA  D "C3'" 1 
ATOM   2333 O  "O3'" . DA  D 3 17  ? 9.190   46.712 4.375   1.00 28.54 ? 17  DA  D "O3'" 1 
ATOM   2334 C  "C2'" . DA  D 3 17  ? 8.804   47.056 6.767   1.00 26.17 ? 17  DA  D "C2'" 1 
ATOM   2335 C  "C1'" . DA  D 3 17  ? 8.275   45.658 7.051   1.00 25.04 ? 17  DA  D "C1'" 1 
ATOM   2336 N  N9    . DA  D 3 17  ? 7.646   45.447 8.359   1.00 23.28 ? 17  DA  D N9    1 
ATOM   2337 C  C8    . DA  D 3 17  ? 7.985   45.991 9.563   1.00 22.43 ? 17  DA  D C8    1 
ATOM   2338 N  N7    . DA  D 3 17  ? 7.233   45.582 10.561  1.00 22.41 ? 17  DA  D N7    1 
ATOM   2339 C  C5    . DA  D 3 17  ? 6.335   44.709 9.978   1.00 21.36 ? 17  DA  D C5    1 
ATOM   2340 C  C6    . DA  D 3 17  ? 5.265   43.947 10.495  1.00 20.64 ? 17  DA  D C6    1 
ATOM   2341 N  N6    . DA  D 3 17  ? 4.914   43.935 11.786  1.00 19.95 ? 17  DA  D N6    1 
ATOM   2342 N  N1    . DA  D 3 17  ? 4.571   43.171 9.633   1.00 20.12 ? 17  DA  D N1    1 
ATOM   2343 C  C2    . DA  D 3 17  ? 4.924   43.179 8.336   1.00 20.98 ? 17  DA  D C2    1 
ATOM   2344 N  N3    . DA  D 3 17  ? 5.903   43.870 7.737   1.00 21.45 ? 17  DA  D N3    1 
ATOM   2345 C  C4    . DA  D 3 17  ? 6.579   44.617 8.618   1.00 22.03 ? 17  DA  D C4    1 
ATOM   2346 P  P     . DC  D 3 18  ? 8.940   48.038 3.516   1.00 30.89 ? 18  DC  D P     1 
ATOM   2347 O  OP1   . DC  D 3 18  ? 9.358   47.687 2.144   1.00 31.21 ? 18  DC  D OP1   1 
ATOM   2348 O  OP2   . DC  D 3 18  ? 9.445   49.248 4.211   1.00 29.72 ? 18  DC  D OP2   1 
ATOM   2349 O  "O5'" . DC  D 3 18  ? 7.349   48.118 3.513   1.00 31.13 ? 18  DC  D "O5'" 1 
ATOM   2350 C  "C5'" . DC  D 3 18  ? 6.630   46.893 3.334   1.00 31.10 ? 18  DC  D "C5'" 1 
ATOM   2351 C  "C4'" . DC  D 3 18  ? 5.386   46.921 4.184   1.00 30.52 ? 18  DC  D "C4'" 1 
ATOM   2352 O  "O4'" . DC  D 3 18  ? 5.662   46.896 5.601   1.00 29.11 ? 18  DC  D "O4'" 1 
ATOM   2353 C  "C3'" . DC  D 3 18  ? 4.574   48.201 4.077   1.00 30.40 ? 18  DC  D "C3'" 1 
ATOM   2354 O  "O3'" . DC  D 3 18  ? 3.889   48.128 2.853   1.00 32.32 ? 18  DC  D "O3'" 1 
ATOM   2355 C  "C2'" . DC  D 3 18  ? 3.712   48.108 5.334   1.00 29.14 ? 18  DC  D "C2'" 1 
ATOM   2356 C  "C1'" . DC  D 3 18  ? 4.365   46.988 6.132   1.00 27.25 ? 18  DC  D "C1'" 1 
ATOM   2357 N  N1    . DC  D 3 18  ? 4.383   47.188 7.601   1.00 25.23 ? 18  DC  D N1    1 
ATOM   2358 C  C2    . DC  D 3 18  ? 3.522   46.404 8.381   1.00 23.63 ? 18  DC  D C2    1 
ATOM   2359 O  O2    . DC  D 3 18  ? 2.773   45.581 7.838   1.00 22.50 ? 18  DC  D O2    1 
ATOM   2360 N  N3    . DC  D 3 18  ? 3.521   46.566 9.721   1.00 22.87 ? 18  DC  D N3    1 
ATOM   2361 C  C4    . DC  D 3 18  ? 4.316   47.462 10.295  1.00 22.79 ? 18  DC  D C4    1 
ATOM   2362 N  N4    . DC  D 3 18  ? 4.252   47.561 11.632  1.00 22.38 ? 18  DC  D N4    1 
ATOM   2363 C  C5    . DC  D 3 18  ? 5.212   48.262 9.522   1.00 22.98 ? 18  DC  D C5    1 
ATOM   2364 C  C6    . DC  D 3 18  ? 5.210   48.096 8.191   1.00 23.89 ? 18  DC  D C6    1 
ATOM   2365 P  P     . DA  D 3 19  ? 2.745   49.149 2.426   1.00 33.19 ? 19  DA  D P     1 
ATOM   2366 O  OP1   . DA  D 3 19  ? 2.593   48.960 0.972   1.00 33.92 ? 19  DA  D OP1   1 
ATOM   2367 O  OP2   . DA  D 3 19  ? 3.021   50.477 3.021   1.00 34.05 ? 19  DA  D OP2   1 
ATOM   2368 O  "O5'" . DA  D 3 19  ? 1.453   48.573 3.155   1.00 32.81 ? 19  DA  D "O5'" 1 
ATOM   2369 C  "C5'" . DA  D 3 19  ? 1.120   47.210 2.981   1.00 32.20 ? 19  DA  D "C5'" 1 
ATOM   2370 C  "C4'" . DA  D 3 19  ? -0.232  46.959 3.605   1.00 31.53 ? 19  DA  D "C4'" 1 
ATOM   2371 O  "O4'" . DA  D 3 19  ? -0.149  46.947 5.055   1.00 30.28 ? 19  DA  D "O4'" 1 
ATOM   2372 C  "C3'" . DA  D 3 19  ? -1.261  48.025 3.277   1.00 30.97 ? 19  DA  D "C3'" 1 
ATOM   2373 O  "O3'" . DA  D 3 19  ? -2.488  47.372 3.208   1.00 31.94 ? 19  DA  D "O3'" 1 
ATOM   2374 C  "C2'" . DA  D 3 19  ? -1.174  48.993 4.452   1.00 30.35 ? 19  DA  D "C2'" 1 
ATOM   2375 C  "C1'" . DA  D 3 19  ? -0.885  48.031 5.596   1.00 29.44 ? 19  DA  D "C1'" 1 
ATOM   2376 N  N9    . DA  D 3 19  ? -0.095  48.570 6.695   1.00 27.46 ? 19  DA  D N9    1 
ATOM   2377 C  C8    . DA  D 3 19  ? 1.033   49.338 6.615   1.00 26.81 ? 19  DA  D C8    1 
ATOM   2378 N  N7    . DA  D 3 19  ? 1.536   49.655 7.786   1.00 26.06 ? 19  DA  D N7    1 
ATOM   2379 C  C5    . DA  D 3 19  ? 0.672   49.055 8.690   1.00 24.14 ? 19  DA  D C5    1 
ATOM   2380 C  C6    . DA  D 3 19  ? 0.647   49.024 10.095  1.00 22.32 ? 19  DA  D C6    1 
ATOM   2381 N  N6    . DA  D 3 19  ? 1.566   49.640 10.840  1.00 19.97 ? 19  DA  D N6    1 
ATOM   2382 N  N1    . DA  D 3 19  ? -0.365  48.349 10.689  1.00 21.68 ? 19  DA  D N1    1 
ATOM   2383 C  C2    . DA  D 3 19  ? -1.285  47.740 9.920   1.00 22.22 ? 19  DA  D C2    1 
ATOM   2384 N  N3    . DA  D 3 19  ? -1.357  47.690 8.588   1.00 23.15 ? 19  DA  D N3    1 
ATOM   2385 C  C4    . DA  D 3 19  ? -0.343  48.381 8.034   1.00 24.95 ? 19  DA  D C4    1 
ATOM   2386 P  P     . DA  D 3 20  ? -3.815  48.134 2.784   1.00 34.14 ? 20  DA  D P     1 
ATOM   2387 O  OP1   . DA  D 3 20  ? -4.470  47.179 1.860   1.00 34.94 ? 20  DA  D OP1   1 
ATOM   2388 O  OP2   . DA  D 3 20  ? -3.548  49.551 2.399   1.00 32.96 ? 20  DA  D OP2   1 
ATOM   2389 O  "O5'" . DA  D 3 20  ? -4.647  48.181 4.152   1.00 33.00 ? 20  DA  D "O5'" 1 
ATOM   2390 C  "C5'" . DA  D 3 20  ? -4.667  47.071 5.039   1.00 32.06 ? 20  DA  D "C5'" 1 
ATOM   2391 C  "C4'" . DA  D 3 20  ? -5.389  47.450 6.318   1.00 31.54 ? 20  DA  D "C4'" 1 
ATOM   2392 O  "O4'" . DA  D 3 20  ? -4.500  48.081 7.278   1.00 30.08 ? 20  DA  D "O4'" 1 
ATOM   2393 C  "C3'" . DA  D 3 20  ? -6.521  48.451 6.114   1.00 31.23 ? 20  DA  D "C3'" 1 
ATOM   2394 O  "O3'" . DA  D 3 20  ? -7.548  48.032 6.966   1.00 32.71 ? 20  DA  D "O3'" 1 
ATOM   2395 C  "C2'" . DA  D 3 20  ? -5.904  49.798 6.493   1.00 29.98 ? 20  DA  D "C2'" 1 
ATOM   2396 C  "C1'" . DA  D 3 20  ? -5.040  49.344 7.655   1.00 29.05 ? 20  DA  D "C1'" 1 
ATOM   2397 N  N9    . DA  D 3 20  ? -3.882  50.152 7.992   1.00 26.43 ? 20  DA  D N9    1 
ATOM   2398 C  C8    . DA  D 3 20  ? -3.008  50.773 7.151   1.00 25.50 ? 20  DA  D C8    1 
ATOM   2399 N  N7    . DA  D 3 20  ? -2.045  51.402 7.776   1.00 24.66 ? 20  DA  D N7    1 
ATOM   2400 C  C5    . DA  D 3 20  ? -2.299  51.155 9.112   1.00 23.34 ? 20  DA  D C5    1 
ATOM   2401 C  C6    . DA  D 3 20  ? -1.645  51.538 10.295  1.00 21.99 ? 20  DA  D C6    1 
ATOM   2402 N  N6    . DA  D 3 20  ? -0.535  52.274 10.314  1.00 20.29 ? 20  DA  D N6    1 
ATOM   2403 N  N1    . DA  D 3 20  ? -2.180  51.130 11.467  1.00 21.89 ? 20  DA  D N1    1 
ATOM   2404 C  C2    . DA  D 3 20  ? -3.295  50.384 11.450  1.00 22.42 ? 20  DA  D C2    1 
ATOM   2405 N  N3    . DA  D 3 20  ? -3.999  49.960 10.400  1.00 23.19 ? 20  DA  D N3    1 
ATOM   2406 C  C4    . DA  D 3 20  ? -3.433  50.383 9.259   1.00 24.16 ? 20  DA  D C4    1 
ATOM   2407 P  P     . DT  D 3 21  ? -8.999  48.687 6.957   1.00 35.33 ? 21  DT  D P     1 
ATOM   2408 O  OP1   . DT  D 3 21  ? -9.948  47.546 6.982   1.00 35.87 ? 21  DT  D OP1   1 
ATOM   2409 O  OP2   . DT  D 3 21  ? -9.145  49.814 5.981   1.00 33.88 ? 21  DT  D OP2   1 
ATOM   2410 O  "O5'" . DT  D 3 21  ? -8.931  49.322 8.407   1.00 32.89 ? 21  DT  D "O5'" 1 
ATOM   2411 C  "C5'" . DT  D 3 21  ? -8.742  48.463 9.500   1.00 31.37 ? 21  DT  D "C5'" 1 
ATOM   2412 C  "C4'" . DT  D 3 21  ? -8.668  49.351 10.708  1.00 29.92 ? 21  DT  D "C4'" 1 
ATOM   2413 O  "O4'" . DT  D 3 21  ? -7.456  50.118 10.581  1.00 28.66 ? 21  DT  D "O4'" 1 
ATOM   2414 C  "C3'" . DT  D 3 21  ? -9.805  50.361 10.813  1.00 28.93 ? 21  DT  D "C3'" 1 
ATOM   2415 O  "O3'" . DT  D 3 21  ? -10.372 50.259 12.097  1.00 29.41 ? 21  DT  D "O3'" 1 
ATOM   2416 C  "C2'" . DT  D 3 21  ? -9.129  51.706 10.560  1.00 28.05 ? 21  DT  D "C2'" 1 
ATOM   2417 C  "C1'" . DT  D 3 21  ? -7.727  51.398 11.073  1.00 27.38 ? 21  DT  D "C1'" 1 
ATOM   2418 N  N1    . DT  D 3 21  ? -6.585  52.237 10.619  1.00 25.64 ? 21  DT  D N1    1 
ATOM   2419 C  C2    . DT  D 3 21  ? -5.709  52.708 11.573  1.00 24.38 ? 21  DT  D C2    1 
ATOM   2420 O  O2    . DT  D 3 21  ? -5.823  52.494 12.763  1.00 22.91 ? 21  DT  D O2    1 
ATOM   2421 N  N3    . DT  D 3 21  ? -4.676  53.456 11.082  1.00 24.47 ? 21  DT  D N3    1 
ATOM   2422 C  C4    . DT  D 3 21  ? -4.428  53.775 9.763   1.00 25.03 ? 21  DT  D C4    1 
ATOM   2423 O  O4    . DT  D 3 21  ? -3.463  54.464 9.452   1.00 25.59 ? 21  DT  D O4    1 
ATOM   2424 C  C5    . DT  D 3 21  ? -5.377  53.252 8.804   1.00 25.40 ? 21  DT  D C5    1 
ATOM   2425 C  C7    . DT  D 3 21  ? -5.213  53.539 7.337   1.00 24.41 ? 21  DT  D C7    1 
ATOM   2426 C  C6    . DT  D 3 21  ? -6.396  52.506 9.274   1.00 25.39 ? 21  DT  D C6    1 
HETATM 2427 MG MG    . MG  E 4 .   ? 2.163   21.967 5.916   1.00 33.94 ? 996 MG  A MG    1 
HETATM 2428 MG MG    . MG  F 4 .   ? -5.793  34.779 13.538  1.00 36.92 ? 996 MG  B MG    1 
HETATM 2429 O  O     . HOH G 5 .   ? 6.608   32.359 6.439   1.00 28.80 ? 4   HOH A O     1 
HETATM 2430 O  O     . HOH G 5 .   ? 1.145   18.788 -5.390  1.00 22.40 ? 8   HOH A O     1 
HETATM 2431 O  O     . HOH G 5 .   ? 11.536  14.189 -5.369  1.00 18.11 ? 9   HOH A O     1 
HETATM 2432 O  O     . HOH G 5 .   ? 18.343  16.527 -5.070  1.00 29.74 ? 10  HOH A O     1 
HETATM 2433 O  O     . HOH G 5 .   ? 15.372  12.900 -3.020  1.00 24.61 ? 11  HOH A O     1 
HETATM 2434 O  O     . HOH G 5 .   ? 23.043  25.703 -0.230  1.00 30.06 ? 13  HOH A O     1 
HETATM 2435 O  O     . HOH G 5 .   ? 23.321  21.955 -0.273  1.00 26.57 ? 14  HOH A O     1 
HETATM 2436 O  O     . HOH G 5 .   ? 16.790  21.553 -10.739 1.00 27.53 ? 15  HOH A O     1 
HETATM 2437 O  O     . HOH G 5 .   ? 21.280  19.294 -9.541  1.00 19.87 ? 16  HOH A O     1 
HETATM 2438 O  O     . HOH G 5 .   ? 19.569  33.681 -7.264  1.00 11.39 ? 17  HOH A O     1 
HETATM 2439 O  O     . HOH G 5 .   ? 8.624   20.762 7.446   1.00 18.64 ? 18  HOH A O     1 
HETATM 2440 O  O     . HOH G 5 .   ? 0.655   22.119 7.671   1.00 20.85 ? 24  HOH A O     1 
HETATM 2441 O  O     . HOH G 5 .   ? -0.487  20.127 6.498   1.00 39.14 ? 25  HOH A O     1 
HETATM 2442 O  O     . HOH G 5 .   ? 1.754   17.552 6.101   1.00 14.59 ? 27  HOH A O     1 
HETATM 2443 O  O     . HOH G 5 .   ? -1.786  27.527 6.389   1.00 14.15 ? 28  HOH A O     1 
HETATM 2444 O  O     . HOH G 5 .   ? -1.314  27.366 3.451   1.00 18.15 ? 29  HOH A O     1 
HETATM 2445 O  O     . HOH G 5 .   ? 10.877  14.554 1.815   1.00 22.08 ? 30  HOH A O     1 
HETATM 2446 O  O     . HOH G 5 .   ? 12.709  13.422 3.234   1.00 26.93 ? 31  HOH A O     1 
HETATM 2447 O  O     . HOH G 5 .   ? 14.892  12.890 -7.858  1.00 35.78 ? 54  HOH A O     1 
HETATM 2448 O  O     . HOH G 5 .   ? 12.865  34.204 0.657   1.00 19.35 ? 55  HOH A O     1 
HETATM 2449 O  O     . HOH G 5 .   ? 14.203  34.786 -1.693  1.00 30.70 ? 56  HOH A O     1 
HETATM 2450 O  O     . HOH G 5 .   ? 3.949   34.151 -0.299  1.00 20.30 ? 57  HOH A O     1 
HETATM 2451 O  O     . HOH G 5 .   ? 3.992   34.839 -2.488  1.00 38.34 ? 58  HOH A O     1 
HETATM 2452 O  O     . HOH G 5 .   ? 6.481   35.595 -3.583  1.00 21.50 ? 59  HOH A O     1 
HETATM 2453 O  O     . HOH G 5 .   ? 8.283   25.503 -11.601 1.00 21.04 ? 60  HOH A O     1 
HETATM 2454 O  O     . HOH G 5 .   ? 11.850  19.075 -11.218 1.00 23.23 ? 61  HOH A O     1 
HETATM 2455 O  O     . HOH G 5 .   ? 6.946   13.517 -10.932 1.00 22.73 ? 62  HOH A O     1 
HETATM 2456 O  O     . HOH G 5 .   ? 7.700   11.992 -8.079  1.00 25.26 ? 63  HOH A O     1 
HETATM 2457 O  O     . HOH G 5 .   ? 23.463  25.984 2.271   1.00 34.03 ? 64  HOH A O     1 
HETATM 2458 O  O     . HOH G 5 .   ? 26.138  24.560 -1.613  1.00 24.34 ? 65  HOH A O     1 
HETATM 2459 O  O     . HOH G 5 .   ? 27.406  31.193 3.242   1.00 28.36 ? 66  HOH A O     1 
HETATM 2460 O  O     . HOH G 5 .   ? -1.612  19.582 -6.315  1.00 29.82 ? 69  HOH A O     1 
HETATM 2461 O  O     . HOH G 5 .   ? 20.786  40.074 -3.996  1.00 31.87 ? 79  HOH A O     1 
HETATM 2462 O  O     . HOH G 5 .   ? 21.220  20.612 -1.251  1.00 29.05 ? 82  HOH A O     1 
HETATM 2463 O  O     . HOH G 5 .   ? 9.632   24.321 -13.736 1.00 31.92 ? 86  HOH A O     1 
HETATM 2464 O  O     . HOH G 5 .   ? 22.317  21.994 -6.170  1.00 30.00 ? 96  HOH A O     1 
HETATM 2465 O  O     . HOH G 5 .   ? 24.918  21.801 -6.666  1.00 30.00 ? 97  HOH A O     1 
HETATM 2466 O  O     . HOH G 5 .   ? -2.593  20.713 5.447   1.00 34.96 ? 129 HOH A O     1 
HETATM 2467 O  O     . HOH G 5 .   ? 2.029   21.807 10.699  1.00 38.34 ? 131 HOH A O     1 
HETATM 2468 O  O     . HOH G 5 .   ? 20.657  19.365 1.199   1.00 22.40 ? 133 HOH A O     1 
HETATM 2469 O  O     . HOH G 5 .   ? 15.530  18.765 -7.801  1.00 27.13 ? 135 HOH A O     1 
HETATM 2470 O  O     . HOH G 5 .   ? 15.604  29.826 9.350   1.00 28.66 ? 136 HOH A O     1 
HETATM 2471 O  O     . HOH G 5 .   ? 13.303  23.709 10.595  1.00 25.57 ? 139 HOH A O     1 
HETATM 2472 O  O     . HOH G 5 .   ? 0.661   13.053 -5.059  1.00 35.17 ? 140 HOH A O     1 
HETATM 2473 O  O     . HOH G 5 .   ? 18.830  33.285 3.126   1.00 29.86 ? 157 HOH A O     1 
HETATM 2474 O  O     . HOH G 5 .   ? 20.743  19.162 3.910   1.00 31.85 ? 164 HOH A O     1 
HETATM 2475 O  O     . HOH G 5 .   ? 23.551  21.906 4.590   1.00 39.10 ? 169 HOH A O     1 
HETATM 2476 O  O     . HOH G 5 .   ? 23.599  19.842 -2.153  1.00 32.65 ? 170 HOH A O     1 
HETATM 2477 O  O     . HOH H 5 .   ? 5.448   36.687 35.354  1.00 13.17 ? 33  HOH B O     1 
HETATM 2478 O  O     . HOH H 5 .   ? 6.225   33.047 28.439  1.00 25.07 ? 35  HOH B O     1 
HETATM 2479 O  O     . HOH H 5 .   ? 1.964   26.818 26.770  1.00 24.60 ? 36  HOH B O     1 
HETATM 2480 O  O     . HOH H 5 .   ? -9.128  27.555 24.852  1.00 10.98 ? 41  HOH B O     1 
HETATM 2481 O  O     . HOH H 5 .   ? -1.320  42.282 39.005  1.00 10.37 ? 43  HOH B O     1 
HETATM 2482 O  O     . HOH H 5 .   ? -4.427  27.949 15.299  1.00 25.74 ? 45  HOH B O     1 
HETATM 2483 O  O     . HOH H 5 .   ? -9.033  35.184 11.834  0.50 2.24  ? 47  HOH B O     1 
HETATM 2484 O  O     . HOH H 5 .   ? -9.218  32.656 11.485  0.50 7.72  ? 48  HOH B O     1 
HETATM 2485 O  O     . HOH H 5 .   ? -5.855  33.632 11.514  1.00 35.21 ? 49  HOH B O     1 
HETATM 2486 O  O     . HOH H 5 .   ? -16.899 40.307 12.046  1.00 18.80 ? 50  HOH B O     1 
HETATM 2487 O  O     . HOH H 5 .   ? -20.760 42.912 12.444  1.00 22.74 ? 51  HOH B O     1 
HETATM 2488 O  O     . HOH H 5 .   ? -11.961 47.380 19.459  1.00 23.13 ? 52  HOH B O     1 
HETATM 2489 O  O     . HOH H 5 .   ? -9.018  44.009 19.202  1.00 20.57 ? 53  HOH B O     1 
HETATM 2490 O  O     . HOH H 5 .   ? -8.471  32.157 32.119  1.00 16.99 ? 70  HOH B O     1 
HETATM 2491 O  O     . HOH H 5 .   ? -9.217  30.925 35.845  1.00 21.63 ? 71  HOH B O     1 
HETATM 2492 O  O     . HOH H 5 .   ? 11.651  44.534 21.938  1.00 27.99 ? 72  HOH B O     1 
HETATM 2493 O  O     . HOH H 5 .   ? 7.882   39.916 18.396  1.00 21.21 ? 74  HOH B O     1 
HETATM 2494 O  O     . HOH H 5 .   ? -2.975  40.469 15.226  1.00 17.36 ? 76  HOH B O     1 
HETATM 2495 O  O     . HOH H 5 .   ? 10.240  38.782 25.939  1.00 38.98 ? 80  HOH B O     1 
HETATM 2496 O  O     . HOH H 5 .   ? -19.615 36.618 13.291  1.00 16.18 ? 81  HOH B O     1 
HETATM 2497 O  O     . HOH H 5 .   ? -0.051  31.066 7.903   1.00 31.76 ? 88  HOH B O     1 
HETATM 2498 O  O     . HOH H 5 .   ? -1.174  32.696 9.087   1.00 26.79 ? 89  HOH B O     1 
HETATM 2499 O  O     . HOH H 5 .   ? 3.164   42.617 15.144  1.00 26.74 ? 95  HOH B O     1 
HETATM 2500 O  O     . HOH H 5 .   ? 0.630   25.629 24.747  1.00 44.73 ? 106 HOH B O     1 
HETATM 2501 O  O     . HOH H 5 .   ? 9.458   43.935 17.647  1.00 28.37 ? 121 HOH B O     1 
HETATM 2502 O  O     . HOH H 5 .   ? -9.458  37.402 12.355  0.50 6.71  ? 128 HOH B O     1 
HETATM 2503 O  O     . HOH H 5 .   ? 3.523   47.622 20.326  1.00 26.73 ? 143 HOH B O     1 
HETATM 2504 O  O     . HOH H 5 .   ? 16.379  39.797 20.605  1.00 38.15 ? 147 HOH B O     1 
HETATM 2505 O  O     . HOH H 5 .   ? 10.943  32.038 25.726  1.00 40.52 ? 149 HOH B O     1 
HETATM 2506 O  O     . HOH H 5 .   ? 11.221  29.837 24.262  1.00 41.00 ? 150 HOH B O     1 
HETATM 2507 O  O     . HOH H 5 .   ? -3.104  28.321 12.301  1.00 28.07 ? 161 HOH B O     1 
HETATM 2508 O  O     . HOH I 5 .   ? 1.137   33.607 7.068   1.00 41.94 ? 22  HOH C O     1 
HETATM 2509 O  O     . HOH I 5 .   ? -0.337  35.199 8.512   1.00 30.13 ? 23  HOH C O     1 
HETATM 2510 O  O     . HOH I 5 .   ? 5.828   32.595 11.235  0.50 12.28 ? 24  HOH C O     1 
HETATM 2511 O  O     . HOH I 5 .   ? 7.155   32.489 9.166   1.00 21.83 ? 25  HOH C O     1 
HETATM 2512 O  O     . HOH I 5 .   ? 9.307   32.478 5.469   1.00 14.55 ? 26  HOH C O     1 
HETATM 2513 O  O     . HOH I 5 .   ? 7.169   32.125 2.604   1.00 18.23 ? 27  HOH C O     1 
HETATM 2514 O  O     . HOH I 5 .   ? 4.888   32.656 4.337   1.00 37.00 ? 28  HOH C O     1 
HETATM 2515 O  O     . HOH I 5 .   ? -6.465  36.856 12.309  1.00 19.54 ? 46  HOH C O     1 
HETATM 2516 O  O     . HOH I 5 .   ? 13.286  28.716 10.446  1.00 19.74 ? 68  HOH C O     1 
HETATM 2517 O  O     . HOH I 5 .   ? -3.688  42.716 16.519  1.00 21.12 ? 77  HOH C O     1 
HETATM 2518 O  O     . HOH I 5 .   ? 16.546  31.763 6.123   1.00 26.49 ? 83  HOH C O     1 
HETATM 2519 O  O     . HOH I 5 .   ? 19.042  31.823 7.181   1.00 28.54 ? 84  HOH C O     1 
HETATM 2520 O  O     . HOH I 5 .   ? 21.728  30.408 9.369   1.00 24.12 ? 85  HOH C O     1 
HETATM 2521 O  O     . HOH I 5 .   ? 17.831  29.822 10.549  1.00 31.34 ? 87  HOH C O     1 
HETATM 2522 O  O     . HOH I 5 .   ? -1.007  47.328 19.692  1.00 11.87 ? 92  HOH C O     1 
HETATM 2523 O  O     . HOH I 5 .   ? 0.788   48.965 20.557  1.00 16.68 ? 93  HOH C O     1 
HETATM 2524 O  O     . HOH I 5 .   ? 3.494   49.413 14.814  1.00 21.13 ? 94  HOH C O     1 
HETATM 2525 O  O     . HOH I 5 .   ? 2.407   38.146 0.513   1.00 45.73 ? 98  HOH C O     1 
HETATM 2526 O  O     . HOH I 5 .   ? 9.922   37.767 0.429   1.00 26.72 ? 99  HOH C O     1 
HETATM 2527 O  O     . HOH I 5 .   ? 21.080  33.766 17.823  1.00 45.95 ? 100 HOH C O     1 
HETATM 2528 O  O     . HOH I 5 .   ? 10.566  39.396 6.874   1.00 24.76 ? 101 HOH C O     1 
HETATM 2529 O  O     . HOH I 5 .   ? 22.399  30.124 19.775  1.00 42.00 ? 102 HOH C O     1 
HETATM 2530 O  O     . HOH I 5 .   ? 13.516  27.722 20.070  1.00 27.25 ? 110 HOH C O     1 
HETATM 2531 O  O     . HOH I 5 .   ? 11.200  23.723 20.856  1.00 30.28 ? 111 HOH C O     1 
HETATM 2532 O  O     . HOH I 5 .   ? -5.221  47.481 11.424  1.00 22.68 ? 124 HOH C O     1 
HETATM 2533 O  O     . HOH I 5 .   ? 2.097   42.219 5.548   1.00 36.27 ? 127 HOH C O     1 
HETATM 2534 O  O     . HOH I 5 .   ? 19.713  27.605 14.455  1.00 36.19 ? 137 HOH C O     1 
HETATM 2535 O  O     . HOH I 5 .   ? 17.871  24.237 15.518  1.00 35.86 ? 138 HOH C O     1 
HETATM 2536 O  O     . HOH I 5 .   ? 0.051   49.645 23.163  1.00 23.64 ? 142 HOH C O     1 
HETATM 2537 O  O     . HOH I 5 .   ? 15.195  31.586 18.329  1.00 24.66 ? 151 HOH C O     1 
HETATM 2538 O  O     . HOH I 5 .   ? 14.676  36.272 14.517  1.00 42.31 ? 152 HOH C O     1 
HETATM 2539 O  O     . HOH I 5 .   ? 13.795  37.883 10.206  1.00 29.13 ? 153 HOH C O     1 
HETATM 2540 O  O     . HOH I 5 .   ? 16.236  38.975 5.737   1.00 40.09 ? 156 HOH C O     1 
HETATM 2541 O  O     . HOH I 5 .   ? -3.030  45.341 8.573   1.00 33.55 ? 158 HOH C O     1 
HETATM 2542 O  O     . HOH I 5 .   ? -8.995  46.918 14.985  1.00 30.30 ? 159 HOH C O     1 
HETATM 2543 O  O     . HOH I 5 .   ? -7.268  47.596 21.793  1.00 13.33 ? 160 HOH C O     1 
HETATM 2544 O  O     . HOH I 5 .   ? 7.929   9.868  13.880  1.00 35.14 ? 162 HOH C O     1 
HETATM 2545 O  O     . HOH I 5 .   ? 16.495  29.418 22.839  1.00 48.79 ? 165 HOH C O     1 
HETATM 2546 O  O     . HOH I 5 .   ? 15.315  30.067 20.551  1.00 36.30 ? 166 HOH C O     1 
HETATM 2547 O  O     . HOH I 5 .   ? 1.630   51.489 18.879  1.00 36.55 ? 167 HOH C O     1 
HETATM 2548 O  O     . HOH I 5 .   ? 5.951   40.681 5.032   1.00 30.83 ? 168 HOH C O     1 
HETATM 2549 O  O     . HOH J 5 .   ? 5.907   31.183 13.133  0.50 11.47 ? 22  HOH D O     1 
HETATM 2550 O  O     . HOH J 5 .   ? 17.062  18.939 5.912   1.00 18.59 ? 23  HOH D O     1 
HETATM 2551 O  O     . HOH J 5 .   ? 10.750  19.084 6.744   1.00 19.20 ? 24  HOH D O     1 
HETATM 2552 O  O     . HOH J 5 .   ? 2.713   19.830 7.098   1.00 16.79 ? 26  HOH D O     1 
HETATM 2553 O  O     . HOH J 5 .   ? 14.608  14.525 1.617   1.00 11.96 ? 32  HOH D O     1 
HETATM 2554 O  O     . HOH J 5 .   ? 5.843   33.406 25.870  1.00 9.50  ? 34  HOH D O     1 
HETATM 2555 O  O     . HOH J 5 .   ? 1.082   26.548 22.720  1.00 17.61 ? 37  HOH D O     1 
HETATM 2556 O  O     . HOH J 5 .   ? 5.072   32.740 19.569  1.00 8.50  ? 38  HOH D O     1 
HETATM 2557 O  O     . HOH J 5 .   ? 4.095   31.245 17.424  1.00 23.53 ? 39  HOH D O     1 
HETATM 2558 O  O     . HOH J 5 .   ? 2.473   30.920 20.967  1.00 11.78 ? 40  HOH D O     1 
HETATM 2559 O  O     . HOH J 5 .   ? 5.377   32.048 15.402  1.00 15.20 ? 44  HOH D O     1 
HETATM 2560 O  O     . HOH J 5 .   ? 10.204  40.882 22.259  1.00 20.26 ? 73  HOH D O     1 
HETATM 2561 O  O     . HOH J 5 .   ? 6.482   39.307 16.385  1.00 29.49 ? 75  HOH D O     1 
HETATM 2562 O  O     . HOH J 5 .   ? 3.149   29.021 18.114  1.00 41.01 ? 78  HOH D O     1 
HETATM 2563 O  O     . HOH J 5 .   ? 3.692   24.431 14.024  1.00 35.42 ? 90  HOH D O     1 
HETATM 2564 O  O     . HOH J 5 .   ? 18.479  19.760 12.631  1.00 31.04 ? 103 HOH D O     1 
HETATM 2565 O  O     . HOH J 5 .   ? 4.626   14.744 10.834  1.00 43.51 ? 104 HOH D O     1 
HETATM 2566 O  O     . HOH J 5 .   ? 2.358   26.552 15.269  1.00 43.81 ? 105 HOH D O     1 
HETATM 2567 O  O     . HOH J 5 .   ? 12.980  32.209 21.046  1.00 31.16 ? 107 HOH D O     1 
HETATM 2568 O  O     . HOH J 5 .   ? 13.533  33.651 18.839  1.00 22.49 ? 108 HOH D O     1 
HETATM 2569 O  O     . HOH J 5 .   ? 11.719  29.712 20.411  1.00 23.39 ? 109 HOH D O     1 
HETATM 2570 O  O     . HOH J 5 .   ? 9.432   25.221 20.254  1.00 29.72 ? 112 HOH D O     1 
HETATM 2571 O  O     . HOH J 5 .   ? 7.404   23.683 20.658  1.00 52.96 ? 113 HOH D O     1 
HETATM 2572 O  O     . HOH J 5 .   ? 8.104   21.128 18.482  1.00 38.89 ? 114 HOH D O     1 
HETATM 2573 O  O     . HOH J 5 .   ? 8.056   17.862 16.325  1.00 46.79 ? 115 HOH D O     1 
HETATM 2574 O  O     . HOH J 5 .   ? 8.918   16.487 14.201  1.00 35.55 ? 116 HOH D O     1 
HETATM 2575 O  O     . HOH J 5 .   ? 10.923  14.020 11.268  1.00 26.31 ? 117 HOH D O     1 
HETATM 2576 O  O     . HOH J 5 .   ? 12.144  12.618 9.544   1.00 36.08 ? 118 HOH D O     1 
HETATM 2577 O  O     . HOH J 5 .   ? 14.947  12.173 9.268   1.00 21.11 ? 119 HOH D O     1 
HETATM 2578 O  O     . HOH J 5 .   ? 9.485   41.845 18.646  1.00 37.14 ? 122 HOH D O     1 
HETATM 2579 O  O     . HOH J 5 .   ? 8.400   38.337 22.127  1.00 29.93 ? 123 HOH D O     1 
HETATM 2580 O  O     . HOH J 5 .   ? -5.814  50.486 14.586  1.00 22.62 ? 125 HOH D O     1 
HETATM 2581 O  O     . HOH J 5 .   ? -1.324  44.240 5.886   1.00 46.86 ? 126 HOH D O     1 
HETATM 2582 O  O     . HOH J 5 .   ? 20.877  13.392 16.622  1.00 25.40 ? 130 HOH D O     1 
HETATM 2583 O  O     . HOH J 5 .   ? 2.725   15.890 8.129   1.00 22.10 ? 132 HOH D O     1 
HETATM 2584 O  O     . HOH J 5 .   ? 19.482  19.596 6.778   1.00 21.11 ? 134 HOH D O     1 
HETATM 2585 O  O     . HOH J 5 .   ? 7.700   46.765 13.027  1.00 31.61 ? 144 HOH D O     1 
HETATM 2586 O  O     . HOH J 5 .   ? 10.456  45.398 15.571  1.00 37.92 ? 145 HOH D O     1 
HETATM 2587 O  O     . HOH J 5 .   ? 15.196  44.329 19.309  1.00 35.34 ? 146 HOH D O     1 
HETATM 2588 O  O     . HOH J 5 .   ? 12.902  33.885 24.629  1.00 41.50 ? 148 HOH D O     1 
HETATM 2589 O  O     . HOH J 5 .   ? 13.098  40.595 10.911  1.00 30.02 ? 154 HOH D O     1 
HETATM 2590 O  O     . HOH J 5 .   ? 10.099  42.081 7.640   1.00 36.32 ? 155 HOH D O     1 
HETATM 2591 O  O     . HOH J 5 .   ? 20.944  18.379 8.635   1.00 28.98 ? 163 HOH D O     1 
A 1 1   GLY 1   219 ?   ?   ?   A . n 
A 1 2   PRO 2   220 ?   ?   ?   A . n 
A 1 3   GLY 3   221 ?   ?   ?   A . n 
A 1 4   PRO 4   222 ?   ?   ?   A . n 
A 1 5   SER 5   223 ?   ?   ?   A . n 
A 1 6   ARG 6   224 ?   ?   ?   A . n 
A 1 7   PRO 7   225 ?   ?   ?   A . n 
A 1 8   SER 8   226 ?   ?   ?   A . n 
A 1 9   ALA 9   227 ?   ?   ?   A . n 
A 1 10  SER 10  228 ?   ?   ?   A . n 
A 1 11  TRP 11  229 ?   ?   ?   A . n 
A 1 12  GLN 12  230 ?   ?   ?   A . n 
A 1 13  ASN 13  231 ?   ?   ?   A . n 
A 1 14  SER 14  232 232 SER SER A . n 
A 1 15  VAL 15  233 233 VAL VAL A . n 
A 1 16  SER 16  234 234 SER SER A . n 
A 1 17  GLU 17  235 235 GLU GLU A . n 
A 1 18  ARG 18  236 236 ARG ARG A . n 
A 1 19  PRO 19  237 237 PRO PRO A . n 
A 1 20  PRO 20  238 238 PRO PRO A . n 
A 1 21  TYR 21  239 239 TYR TYR A . n 
A 1 22  SER 22  240 240 SER SER A . n 
A 1 23  TYR 23  241 241 TYR TYR A . n 
A 1 24  MET 24  242 242 MET MET A . n 
A 1 25  ALA 25  243 243 ALA ALA A . n 
A 1 26  MET 26  244 244 MET MET A . n 
A 1 27  ILE 27  245 245 ILE ILE A . n 
A 1 28  GLN 28  246 246 GLN GLN A . n 
A 1 29  PHE 29  247 247 PHE PHE A . n 
A 1 30  ALA 30  248 248 ALA ALA A . n 
A 1 31  ILE 31  249 249 ILE ILE A . n 
A 1 32  ASN 32  250 250 ASN ASN A . n 
A 1 33  SER 33  251 251 SER SER A . n 
A 1 34  THR 34  252 252 THR THR A . n 
A 1 35  GLU 35  253 253 GLU GLU A . n 
A 1 36  ARG 36  254 254 ARG ARG A . n 
A 1 37  LYS 37  255 255 LYS LYS A . n 
A 1 38  ARG 38  256 256 ARG ARG A . n 
A 1 39  MET 39  257 257 MET MET A . n 
A 1 40  THR 40  258 258 THR THR A . n 
A 1 41  LEU 41  259 259 LEU LEU A . n 
A 1 42  LYS 42  260 260 LYS LYS A . n 
A 1 43  ASP 43  261 261 ASP ASP A . n 
A 1 44  ILE 44  262 262 ILE ILE A . n 
A 1 45  TYR 45  263 263 TYR TYR A . n 
A 1 46  THR 46  264 264 THR THR A . n 
A 1 47  TRP 47  265 265 TRP TRP A . n 
A 1 48  ILE 48  266 266 ILE ILE A . n 
A 1 49  GLU 49  267 267 GLU GLU A . n 
A 1 50  ASP 50  268 268 ASP ASP A . n 
A 1 51  HIS 51  269 269 HIS HIS A . n 
A 1 52  PHE 52  270 270 PHE PHE A . n 
A 1 53  PRO 53  271 271 PRO PRO A . n 
A 1 54  TYR 54  272 272 TYR TYR A . n 
A 1 55  PHE 55  273 273 PHE PHE A . n 
A 1 56  LYS 56  274 274 LYS LYS A . n 
A 1 57  HIS 57  275 275 HIS HIS A . n 
A 1 58  ILE 58  276 276 ILE ILE A . n 
A 1 59  ALA 59  277 277 ALA ALA A . n 
A 1 60  LYS 60  278 278 LYS LYS A . n 
A 1 61  PRO 61  279 279 PRO PRO A . n 
A 1 62  GLY 62  280 280 GLY GLY A . n 
A 1 63  TRP 63  281 281 TRP TRP A . n 
A 1 64  LYS 64  282 282 LYS LYS A . n 
A 1 65  ASN 65  283 283 ASN ASN A . n 
A 1 66  SER 66  284 284 SER SER A . n 
A 1 67  ILE 67  285 285 ILE ILE A . n 
A 1 68  ARG 68  286 286 ARG ARG A . n 
A 1 69  HIS 69  287 287 HIS HIS A . n 
A 1 70  ASN 70  288 288 ASN ASN A . n 
A 1 71  LEU 71  289 289 LEU LEU A . n 
A 1 72  SER 72  290 290 SER SER A . n 
A 1 73  LEU 73  291 291 LEU LEU A . n 
A 1 74  HIS 74  292 292 HIS HIS A . n 
A 1 75  ASP 75  293 293 ASP ASP A . n 
A 1 76  MET 76  294 294 MET MET A . n 
A 1 77  PHE 77  295 295 PHE PHE A . n 
A 1 78  VAL 78  296 296 VAL VAL A . n 
A 1 79  ARG 79  297 297 ARG ARG A . n 
A 1 80  GLU 80  298 298 GLU GLU A . n 
A 1 81  THR 81  299 299 THR THR A . n 
A 1 82  SER 82  300 300 SER SER A . n 
A 1 83  ALA 83  301 301 ALA ALA A . n 
A 1 84  ASN 84  302 302 ASN ASN A . n 
A 1 85  GLY 85  303 303 GLY GLY A . n 
A 1 86  LYS 86  304 304 LYS LYS A . n 
A 1 87  VAL 87  305 305 VAL VAL A . n 
A 1 88  SER 88  306 306 SER SER A . n 
A 1 89  PHE 89  307 307 PHE PHE A . n 
A 1 90  TRP 90  308 308 TRP TRP A . n 
A 1 91  THR 91  309 309 THR THR A . n 
A 1 92  ILE 92  310 310 ILE ILE A . n 
A 1 93  HIS 93  311 311 HIS HIS A . n 
A 1 94  PRO 94  312 312 PRO PRO A . n 
A 1 95  SER 95  313 313 SER SER A . n 
A 1 96  ALA 96  314 314 ALA ALA A . n 
A 1 97  ASN 97  315 315 ASN ASN A . n 
A 1 98  ARG 98  316 316 ARG ARG A . n 
A 1 99  TYR 99  317 317 TYR TYR A . n 
A 1 100 LEU 100 318 318 LEU LEU A . n 
A 1 101 THR 101 319 319 THR THR A . n 
A 1 102 LEU 102 320 320 LEU LEU A . n 
A 1 103 ASP 103 321 321 ASP ASP A . n 
A 1 104 GLN 104 322 ?   ?   ?   A . n 
A 1 105 VAL 105 323 ?   ?   ?   A . n 
A 1 106 PHE 106 324 ?   ?   ?   A . n 
A 1 107 LYS 107 325 ?   ?   ?   A . n 
A 1 108 PRO 108 326 ?   ?   ?   A . n 
A 1 109 LEU 109 327 ?   ?   ?   A . n 
A 1 110 ASP 110 328 ?   ?   ?   A . n 
A 1 111 PRO 111 329 ?   ?   ?   A . n 
A 1 112 GLY 112 330 ?   ?   ?   A . n 
A 1 113 SER 113 331 ?   ?   ?   A . n 
A 1 114 PRO 114 332 ?   ?   ?   A . n 
A 1 115 GLN 115 333 ?   ?   ?   A . n 
A 1 116 LEU 116 334 ?   ?   ?   A . n 
A 1 117 PRO 117 335 ?   ?   ?   A . n 
A 1 118 GLU 118 336 ?   ?   ?   A . n 
A 1 119 HIS 119 337 ?   ?   ?   A . n 
A 1 120 LEU 120 338 ?   ?   ?   A . n 
A 1 121 GLU 121 339 ?   ?   ?   A . n 
A 1 122 SER 122 340 ?   ?   ?   A . n 
A 1 123 GLN 123 341 ?   ?   ?   A . n 
A 1 124 GLN 124 342 ?   ?   ?   A . n 
A 1 125 LYS 125 343 ?   ?   ?   A . n 
A 1 126 ARG 126 344 ?   ?   ?   A . n 
A 1 127 PRO 127 345 ?   ?   ?   A . n 
A 1 128 ASN 128 346 ?   ?   ?   A . n 
A 1 129 PRO 129 347 ?   ?   ?   A . n 
A 1 130 GLU 130 348 ?   ?   ?   A . n 
A 1 131 LEU 131 349 ?   ?   ?   A . n 
A 1 132 ARG 132 350 ?   ?   ?   A . n 
A 1 133 ARG 133 351 ?   ?   ?   A . n 
A 1 134 ASN 134 352 ?   ?   ?   A . n 
A 1 135 MET 135 353 ?   ?   ?   A . n 
A 1 136 THR 136 354 ?   ?   ?   A . n 
A 1 137 ILE 137 355 ?   ?   ?   A . n 
A 1 138 LYS 138 356 ?   ?   ?   A . n 
A 1 139 THR 139 357 ?   ?   ?   A . n 
A 1 140 GLU 140 358 ?   ?   ?   A . n 
A 1 141 LEU 141 359 ?   ?   ?   A . n 
A 1 142 PRO 142 360 ?   ?   ?   A . n 
B 1 1   GLY 1   219 ?   ?   ?   B . n 
B 1 2   PRO 2   220 ?   ?   ?   B . n 
B 1 3   GLY 3   221 ?   ?   ?   B . n 
B 1 4   PRO 4   222 ?   ?   ?   B . n 
B 1 5   SER 5   223 ?   ?   ?   B . n 
B 1 6   ARG 6   224 ?   ?   ?   B . n 
B 1 7   PRO 7   225 ?   ?   ?   B . n 
B 1 8   SER 8   226 ?   ?   ?   B . n 
B 1 9   ALA 9   227 ?   ?   ?   B . n 
B 1 10  SER 10  228 ?   ?   ?   B . n 
B 1 11  TRP 11  229 ?   ?   ?   B . n 
B 1 12  GLN 12  230 ?   ?   ?   B . n 
B 1 13  ASN 13  231 ?   ?   ?   B . n 
B 1 14  SER 14  232 ?   ?   ?   B . n 
B 1 15  VAL 15  233 ?   ?   ?   B . n 
B 1 16  SER 16  234 234 SER SER B . n 
B 1 17  GLU 17  235 235 GLU GLU B . n 
B 1 18  ARG 18  236 236 ARG ARG B . n 
B 1 19  PRO 19  237 237 PRO PRO B . n 
B 1 20  PRO 20  238 238 PRO PRO B . n 
B 1 21  TYR 21  239 239 TYR TYR B . n 
B 1 22  SER 22  240 240 SER SER B . n 
B 1 23  TYR 23  241 241 TYR TYR B . n 
B 1 24  MET 24  242 242 MET MET B . n 
B 1 25  ALA 25  243 243 ALA ALA B . n 
B 1 26  MET 26  244 244 MET MET B . n 
B 1 27  ILE 27  245 245 ILE ILE B . n 
B 1 28  GLN 28  246 246 GLN GLN B . n 
B 1 29  PHE 29  247 247 PHE PHE B . n 
B 1 30  ALA 30  248 248 ALA ALA B . n 
B 1 31  ILE 31  249 249 ILE ILE B . n 
B 1 32  ASN 32  250 250 ASN ASN B . n 
B 1 33  SER 33  251 251 SER SER B . n 
B 1 34  THR 34  252 252 THR THR B . n 
B 1 35  GLU 35  253 253 GLU GLU B . n 
B 1 36  ARG 36  254 254 ARG ARG B . n 
B 1 37  LYS 37  255 255 LYS LYS B . n 
B 1 38  ARG 38  256 256 ARG ARG B . n 
B 1 39  MET 39  257 257 MET MET B . n 
B 1 40  THR 40  258 258 THR THR B . n 
B 1 41  LEU 41  259 259 LEU LEU B . n 
B 1 42  LYS 42  260 260 LYS LYS B . n 
B 1 43  ASP 43  261 261 ASP ASP B . n 
B 1 44  ILE 44  262 262 ILE ILE B . n 
B 1 45  TYR 45  263 263 TYR TYR B . n 
B 1 46  THR 46  264 264 THR THR B . n 
B 1 47  TRP 47  265 265 TRP TRP B . n 
B 1 48  ILE 48  266 266 ILE ILE B . n 
B 1 49  GLU 49  267 267 GLU GLU B . n 
B 1 50  ASP 50  268 268 ASP ASP B . n 
B 1 51  HIS 51  269 269 HIS HIS B . n 
B 1 52  PHE 52  270 270 PHE PHE B . n 
B 1 53  PRO 53  271 271 PRO PRO B . n 
B 1 54  TYR 54  272 272 TYR TYR B . n 
B 1 55  PHE 55  273 273 PHE PHE B . n 
B 1 56  LYS 56  274 274 LYS LYS B . n 
B 1 57  HIS 57  275 275 HIS HIS B . n 
B 1 58  ILE 58  276 276 ILE ILE B . n 
B 1 59  ALA 59  277 277 ALA ALA B . n 
B 1 60  LYS 60  278 278 LYS LYS B . n 
B 1 61  PRO 61  279 279 PRO PRO B . n 
B 1 62  GLY 62  280 280 GLY GLY B . n 
B 1 63  TRP 63  281 281 TRP TRP B . n 
B 1 64  LYS 64  282 282 LYS LYS B . n 
B 1 65  ASN 65  283 283 ASN ASN B . n 
B 1 66  SER 66  284 284 SER SER B . n 
B 1 67  ILE 67  285 285 ILE ILE B . n 
B 1 68  ARG 68  286 286 ARG ARG B . n 
B 1 69  HIS 69  287 287 HIS HIS B . n 
B 1 70  ASN 70  288 288 ASN ASN B . n 
B 1 71  LEU 71  289 289 LEU LEU B . n 
B 1 72  SER 72  290 290 SER SER B . n 
B 1 73  LEU 73  291 291 LEU LEU B . n 
B 1 74  HIS 74  292 292 HIS HIS B . n 
B 1 75  ASP 75  293 293 ASP ASP B . n 
B 1 76  MET 76  294 294 MET MET B . n 
B 1 77  PHE 77  295 295 PHE PHE B . n 
B 1 78  VAL 78  296 296 VAL VAL B . n 
B 1 79  ARG 79  297 297 ARG ARG B . n 
B 1 80  GLU 80  298 298 GLU GLU B . n 
B 1 81  THR 81  299 299 THR THR B . n 
B 1 82  SER 82  300 300 SER SER B . n 
B 1 83  ALA 83  301 301 ALA ALA B . n 
B 1 84  ASN 84  302 302 ASN ASN B . n 
B 1 85  GLY 85  303 303 GLY GLY B . n 
B 1 86  LYS 86  304 304 LYS LYS B . n 
B 1 87  VAL 87  305 305 VAL VAL B . n 
B 1 88  SER 88  306 306 SER SER B . n 
B 1 89  PHE 89  307 307 PHE PHE B . n 
B 1 90  TRP 90  308 308 TRP TRP B . n 
B 1 91  THR 91  309 309 THR THR B . n 
B 1 92  ILE 92  310 310 ILE ILE B . n 
B 1 93  HIS 93  311 311 HIS HIS B . n 
B 1 94  PRO 94  312 312 PRO PRO B . n 
B 1 95  SER 95  313 313 SER SER B . n 
B 1 96  ALA 96  314 314 ALA ALA B . n 
B 1 97  ASN 97  315 315 ASN ASN B . n 
B 1 98  ARG 98  316 316 ARG ARG B . n 
B 1 99  TYR 99  317 317 TYR TYR B . n 
B 1 100 LEU 100 318 318 LEU LEU B . n 
B 1 101 THR 101 319 319 THR THR B . n 
B 1 102 LEU 102 320 320 LEU LEU B . n 
B 1 103 ASP 103 321 321 ASP ASP B . n 
B 1 104 GLN 104 322 322 GLN GLN B . n 
B 1 105 VAL 105 323 323 VAL VAL B . n 
B 1 106 PHE 106 324 324 PHE PHE B . n 
B 1 107 LYS 107 325 325 LYS LYS B . n 
B 1 108 PRO 108 326 326 PRO PRO B . n 
B 1 109 LEU 109 327 327 LEU LEU B . n 
B 1 110 ASP 110 328 328 ASP ASP B . n 
B 1 111 PRO 111 329 ?   ?   ?   B . n 
B 1 112 GLY 112 330 ?   ?   ?   B . n 
B 1 113 SER 113 331 ?   ?   ?   B . n 
B 1 114 PRO 114 332 ?   ?   ?   B . n 
B 1 115 GLN 115 333 ?   ?   ?   B . n 
B 1 116 LEU 116 334 ?   ?   ?   B . n 
B 1 117 PRO 117 335 ?   ?   ?   B . n 
B 1 118 GLU 118 336 ?   ?   ?   B . n 
B 1 119 HIS 119 337 ?   ?   ?   B . n 
B 1 120 LEU 120 338 ?   ?   ?   B . n 
B 1 121 GLU 121 339 ?   ?   ?   B . n 
B 1 122 SER 122 340 ?   ?   ?   B . n 
B 1 123 GLN 123 341 ?   ?   ?   B . n 
B 1 124 GLN 124 342 ?   ?   ?   B . n 
B 1 125 LYS 125 343 ?   ?   ?   B . n 
B 1 126 ARG 126 344 ?   ?   ?   B . n 
B 1 127 PRO 127 345 ?   ?   ?   B . n 
B 1 128 ASN 128 346 ?   ?   ?   B . n 
B 1 129 PRO 129 347 ?   ?   ?   B . n 
B 1 130 GLU 130 348 ?   ?   ?   B . n 
B 1 131 LEU 131 349 ?   ?   ?   B . n 
B 1 132 ARG 132 350 ?   ?   ?   B . n 
B 1 133 ARG 133 351 ?   ?   ?   B . n 
B 1 134 ASN 134 352 ?   ?   ?   B . n 
B 1 135 MET 135 353 ?   ?   ?   B . n 
B 1 136 THR 136 354 ?   ?   ?   B . n 
B 1 137 ILE 137 355 ?   ?   ?   B . n 
B 1 138 LYS 138 356 ?   ?   ?   B . n 
B 1 139 THR 139 357 ?   ?   ?   B . n 
B 1 140 GLU 140 358 ?   ?   ?   B . n 
B 1 141 LEU 141 359 ?   ?   ?   B . n 
B 1 142 PRO 142 360 ?   ?   ?   B . n 
C 2 1   DA  1   1   1   DA  DA  C . n 
C 2 2   DA  2   2   2   DA  DA  C . n 
C 2 3   DA  3   3   3   DA  DA  C . n 
C 2 4   DT  4   4   4   DT  DT  C . n 
C 2 5   DT  5   5   5   DT  DT  C . n 
C 2 6   DG  6   6   6   DG  DG  C . n 
C 2 7   DT  7   7   7   DT  DT  C . n 
C 2 8   DT  8   8   8   DT  DT  C . n 
C 2 9   DT  9   9   9   DT  DT  C . n 
C 2 10  DA  10  10  10  DA  DA  C . n 
C 2 11  DT  11  11  11  DT  DT  C . n 
C 2 12  DA  12  12  12  DA  DA  C . n 
C 2 13  DA  13  13  13  DA  DA  C . n 
C 2 14  DA  14  14  14  DA  DA  C . n 
C 2 15  DC  15  15  15  DC  DC  C . n 
C 2 16  DA  16  16  16  DA  DA  C . n 
C 2 17  DG  17  17  17  DG  DG  C . n 
C 2 18  DC  18  18  18  DC  DC  C . n 
C 2 19  DC  19  19  19  DC  DC  C . n 
C 2 20  DC  20  20  20  DC  DC  C . n 
C 2 21  DG  21  21  21  DG  DG  C . n 
D 3 1   DT  1   1   1   DT  DT  D . n 
D 3 2   DT  2   2   2   DT  DT  D . n 
D 3 3   DC  3   3   3   DC  DC  D . n 
D 3 4   DG  4   4   4   DG  DG  D . n 
D 3 5   DG  5   5   5   DG  DG  D . n 
D 3 6   DG  6   6   6   DG  DG  D . n 
D 3 7   DC  7   7   7   DC  DC  D . n 
D 3 8   DT  8   8   8   DT  DT  D . n 
D 3 9   DG  9   9   9   DG  DG  D . n 
D 3 10  DT  10  10  10  DT  DT  D . n 
D 3 11  DT  11  11  11  DT  DT  D . n 
D 3 12  DT  12  12  12  DT  DT  D . n 
D 3 13  DA  13  13  13  DA  DA  D . n 
D 3 14  DT  14  14  14  DT  DT  D . n 
D 3 15  DA  15  15  15  DA  DA  D . n 
D 3 16  DA  16  16  16  DA  DA  D . n 
D 3 17  DA  17  17  17  DA  DA  D . n 
D 3 18  DC  18  18  18  DC  DC  D . n 
D 3 19  DA  19  19  19  DA  DA  D . n 
D 3 20  DA  20  20  20  DA  DA  D . n 
D 3 21  DT  21  21  21  DT  DT  D . n 
#                   1 
_pdbx_struct_assembly.details              author_and_software_defined_assembly 
_pdbx_struct_assembly.method_details       PISA 
_pdbx_struct_assembly.oligomeric_details   tetrameric 
_pdbx_struct_assembly.oligomeric_count     4 
_pdbx_struct_assembly_gen.assembly_id       1 
_pdbx_struct_assembly_gen.oper_expression   1 
_pdbx_struct_assembly_gen.asym_id_list      A,B,C,D,E,F,G,H,I,J 
1 'ABSA (A^2)' 5270  ? 
1 MORE         -64   ? 
1 'SSA (A^2)'  16980 ? 
#                   1 
_pdbx_struct_oper_list.type                 'identity operation'                 1_555 
_pdbx_struct_oper_list.symmetry_operation   x,y,z 
_pdbx_struct_oper_list.matrix[1][1]         1.0000000000 
_pdbx_struct_oper_list.matrix[1][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[1][3]         0.0000000000 
_pdbx_struct_oper_list.vector[1]            0.0000000000 
_pdbx_struct_oper_list.matrix[2][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[2][2]         1.0000000000 
_pdbx_struct_oper_list.matrix[2][3]         0.0000000000 
_pdbx_struct_oper_list.vector[2]            0.0000000000 
_pdbx_struct_oper_list.matrix[3][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][3]         1.0000000000 
_pdbx_struct_oper_list.vector[3]            0.0000000000 
1  O ? A LEU 71 ? A LEU 289 ? 1_555 MG ? E MG . ? A MG 996 ? 1_555 O ? A HIS 74 ? A HIS 292 ? 1_555 93.9  ? 
2  O ? A LEU 71 ? A LEU 289 ? 1_555 MG ? E MG . ? A MG 996 ? 1_555 O ? A PHE 77 ? A PHE 295 ? 1_555 102.4 ? 
3  O ? A HIS 74 ? A HIS 292 ? 1_555 MG ? E MG . ? A MG 996 ? 1_555 O ? A PHE 77 ? A PHE 295 ? 1_555 91.1  ? 
4  O ? A LEU 71 ? A LEU 289 ? 1_555 MG ? E MG . ? A MG 996 ? 1_555 O ? G HOH .  ? A HOH 24  ? 1_555 135.0 ? 
5  O ? A HIS 74 ? A HIS 292 ? 1_555 MG ? E MG . ? A MG 996 ? 1_555 O ? G HOH .  ? A HOH 24  ? 1_555 92.4  ? 
6  O ? A PHE 77 ? A PHE 295 ? 1_555 MG ? E MG . ? A MG 996 ? 1_555 O ? G HOH .  ? A HOH 24  ? 1_555 122.0 ? 
7  O ? A LEU 71 ? A LEU 289 ? 1_555 MG ? E MG . ? A MG 996 ? 1_555 O ? J HOH .  ? D HOH 26  ? 1_555 93.5  ? 
8  O ? A HIS 74 ? A HIS 292 ? 1_555 MG ? E MG . ? A MG 996 ? 1_555 O ? J HOH .  ? D HOH 26  ? 1_555 172.3 ? 
9  O ? A PHE 77 ? A PHE 295 ? 1_555 MG ? E MG . ? A MG 996 ? 1_555 O ? J HOH .  ? D HOH 26  ? 1_555 89.3  ? 
10 O ? G HOH .  ? A HOH 24  ? 1_555 MG ? E MG . ? A MG 996 ? 1_555 O ? J HOH .  ? D HOH 26  ? 1_555 80.9  ? 
11 O ? B LEU 71 ? B LEU 289 ? 1_555 MG ? F MG . ? B MG 996 ? 1_555 O ? H HOH .  ? B HOH 49  ? 1_555 145.9 ? 
12 O ? B LEU 71 ? B LEU 289 ? 1_555 MG ? F MG . ? B MG 996 ? 1_555 O ? I HOH .  ? C HOH 46  ? 1_555 99.4  ? 
13 O ? H HOH .  ? B HOH 49  ? 1_555 MG ? F MG . ? B MG 996 ? 1_555 O ? I HOH .  ? C HOH 46  ? 1_555 88.6  ? 
14 O ? B LEU 71 ? B LEU 289 ? 1_555 MG ? F MG . ? B MG 996 ? 1_555 O ? B PHE 77 ? B PHE 295 ? 1_555 105.5 ? 
15 O ? H HOH .  ? B HOH 49  ? 1_555 MG ? F MG . ? B MG 996 ? 1_555 O ? B PHE 77 ? B PHE 295 ? 1_555 106.1 ? 
16 O ? I HOH .  ? C HOH 46  ? 1_555 MG ? F MG . ? B MG 996 ? 1_555 O ? B PHE 77 ? B PHE 295 ? 1_555 97.8  ? 
17 O ? B LEU 71 ? B LEU 289 ? 1_555 MG ? F MG . ? B MG 996 ? 1_555 O ? B HIS 74 ? B HIS 292 ? 1_555 90.5  ? 
18 O ? H HOH .  ? B HOH 49  ? 1_555 MG ? F MG . ? B MG 996 ? 1_555 O ? B HIS 74 ? B HIS 292 ? 1_555 80.6  ? 
19 O ? I HOH .  ? C HOH 46  ? 1_555 MG ? F MG . ? B MG 996 ? 1_555 O ? B HIS 74 ? B HIS 292 ? 1_555 169.0 ? 
20 O ? B PHE 77 ? B PHE 295 ? 1_555 MG ? F MG . ? B MG 996 ? 1_555 O ? B HIS 74 ? B HIS 292 ? 1_555 83.8  ? 
1 'Structure model' 1 0 2009-03-03 
2 'Structure model' 1 1 2011-07-13 
_pdbx_audit_revision_details.ordinal             1 
_pdbx_audit_revision_details.revision_ordinal    1 
_pdbx_audit_revision_details.data_content_type   'Structure model' 
_pdbx_audit_revision_details.provider            repository 
_pdbx_audit_revision_details.type                'Initial release' 
_pdbx_audit_revision_details.description         ? 
1 2 'Structure model' Advisory                    
2 2 'Structure model' 'Version format compliance' 
1 ? refined 10.2974 29.1822 12.9834 0.0293 0.1433 0.0492 0.0188 -0.0187 0.0410  3.8974 4.9382 4.1264 -1.9459 -0.7514 0.9201  
-0.1242 -0.0764 -0.0977 0.3535  0.1006 -0.3056 0.1759  0.2009  0.0237  'X-RAY DIFFRACTION' 
2 ? refined 10.2625 23.7499 -2.3788 0.0436 0.1841 0.0414 0.0102 0.0226  -0.0188 8.9571 4.3913 7.6112 1.7863  -0.3356 0.5534  
-0.3497 0.8179  -0.3373 -0.2595 0.1424 0.0523  0.1524  -0.0090 0.2073  'X-RAY DIFFRACTION' 
3 ? refined -4.4671 36.2163 25.5536 0.0555 0.2198 0.0253 0.0557 0.0220  0.0197  3.4803 3.8758 9.7247 0.0694  -0.7681 -1.7432 
0.2254  0.0460  0.0979  0.2633  0.0784 0.2770  -0.1218 -0.9885 -0.3038 'X-RAY DIFFRACTION' 
1 1 C 1   ? ? C 21  ? ? ? ? 'X-RAY DIFFRACTION' 
2 1 D 1   ? ? D 21  ? ? ? ? 'X-RAY DIFFRACTION' 
3 2 A 232 ? ? A 321 ? ? ? ? 'X-RAY DIFFRACTION' 
4 3 B 235 ? ? B 327 ? ? ? ? 'X-RAY DIFFRACTION' 
DNA    'data collection' .        ? 1 
AMoRE  phasing           .        ? 2 
REFMAC refinement        5.5.0063 ? 3 
MOSFLM 'data reduction'  .        ? 4 
SCALA  'data scaling'    .        ? 5 
#                1 
_pdbx_validate_symm_contact.PDB_model_num     1 
_pdbx_validate_symm_contact.auth_atom_id_1    OP2 
_pdbx_validate_symm_contact.auth_asym_id_1    D 
_pdbx_validate_symm_contact.auth_comp_id_1    DT 
_pdbx_validate_symm_contact.auth_seq_id_1     1 
_pdbx_validate_symm_contact.PDB_ins_code_1    ? 
_pdbx_validate_symm_contact.label_alt_id_1    ? 
_pdbx_validate_symm_contact.site_symmetry_1   1_555 
_pdbx_validate_symm_contact.auth_atom_id_2    "O3'" 
_pdbx_validate_symm_contact.auth_asym_id_2    D 
_pdbx_validate_symm_contact.auth_comp_id_2    DT 
_pdbx_validate_symm_contact.auth_seq_id_2     21 
_pdbx_validate_symm_contact.PDB_ins_code_2    ? 
_pdbx_validate_symm_contact.label_alt_id_2    ? 
_pdbx_validate_symm_contact.site_symmetry_2   5_545 
_pdbx_validate_symm_contact.dist              1.97 
#                        1 
_pdbx_validate_rmsd_bond.PDB_model_num             1 
_pdbx_validate_rmsd_bond.auth_atom_id_1            "O3'" 
_pdbx_validate_rmsd_bond.auth_asym_id_1            D 
_pdbx_validate_rmsd_bond.auth_comp_id_1            DG 
_pdbx_validate_rmsd_bond.auth_seq_id_1             5 
_pdbx_validate_rmsd_bond.PDB_ins_code_1            ? 
_pdbx_validate_rmsd_bond.label_alt_id_1            ? 
_pdbx_validate_rmsd_bond.auth_atom_id_2            "C3'" 
_pdbx_validate_rmsd_bond.auth_asym_id_2            D 
_pdbx_validate_rmsd_bond.auth_comp_id_2            DG 
_pdbx_validate_rmsd_bond.auth_seq_id_2             5 
_pdbx_validate_rmsd_bond.PDB_ins_code_2            ? 
_pdbx_validate_rmsd_bond.label_alt_id_2            ? 
_pdbx_validate_rmsd_bond.bond_value                1.376 
_pdbx_validate_rmsd_bond.bond_target_value         1.419 
_pdbx_validate_rmsd_bond.bond_deviation            -0.043 
_pdbx_validate_rmsd_bond.bond_standard_deviation   0.006 
_pdbx_validate_rmsd_bond.linker_flag               N 
1 1 "O4'" C DC 15 ? ? "C1'" C DC 15 ? ? N1    C DC 15 ? ? 111.77 108.30 3.47  0.30 N 
2 1 "O4'" D DC 7  ? ? "C1'" D DC 7  ? ? N1    D DC 7  ? ? 103.49 108.00 -4.51 0.70 N 
3 1 "O4'" D DC 18 ? ? "C4'" D DC 18 ? ? "C3'" D DC 18 ? ? 100.71 104.50 -3.79 0.40 N 
4 1 "C1'" D DC 18 ? ? "O4'" D DC 18 ? ? "C4'" D DC 18 ? ? 101.15 110.10 -8.95 1.00 N 
5 1 "O4'" D DC 18 ? ? "C1'" D DC 18 ? ? N1    D DC 18 ? ? 111.85 108.30 3.55  0.30 N 
1 1 PRO A 238 ? ? -88.64  42.65  
2 1 LEU A 318 ? ? -59.08  108.82 
3 1 PRO B 238 ? ? -91.40  45.64  
4 1 ALA B 314 ? ? -149.37 49.59  
1  1 Y 1 A GLY 219 ? A GLY 1   
2  1 Y 1 A PRO 220 ? A PRO 2   
3  1 Y 1 A GLY 221 ? A GLY 3   
4  1 Y 1 A PRO 222 ? A PRO 4   
5  1 Y 1 A SER 223 ? A SER 5   
6  1 Y 1 A ARG 224 ? A ARG 6   
7  1 Y 1 A PRO 225 ? A PRO 7   
8  1 Y 1 A SER 226 ? A SER 8   
9  1 Y 1 A ALA 227 ? A ALA 9   
10 1 Y 1 A SER 228 ? A SER 10  
11 1 Y 1 A TRP 229 ? A TRP 11  
12 1 Y 1 A GLN 230 ? A GLN 12  
13 1 Y 1 A ASN 231 ? A ASN 13  
14 1 Y 1 A GLN 322 ? A GLN 104 
15 1 Y 1 A VAL 323 ? A VAL 105 
16 1 Y 1 A PHE 324 ? A PHE 106 
17 1 Y 1 A LYS 325 ? A LYS 107 
18 1 Y 1 A PRO 326 ? A PRO 108 
19 1 Y 1 A LEU 327 ? A LEU 109 
20 1 Y 1 A ASP 328 ? A ASP 110 
21 1 Y 1 A PRO 329 ? A PRO 111 
22 1 Y 1 A GLY 330 ? A GLY 112 
23 1 Y 1 A SER 331 ? A SER 113 
24 1 Y 1 A PRO 332 ? A PRO 114 
25 1 Y 1 A GLN 333 ? A GLN 115 
26 1 Y 1 A LEU 334 ? A LEU 116 
27 1 Y 1 A PRO 335 ? A PRO 117 
28 1 Y 1 A GLU 336 ? A GLU 118 
29 1 Y 1 A HIS 337 ? A HIS 119 
30 1 Y 1 A LEU 338 ? A LEU 120 
31 1 Y 1 A GLU 339 ? A GLU 121 
32 1 Y 1 A SER 340 ? A SER 122 
33 1 Y 1 A GLN 341 ? A GLN 123 
34 1 Y 1 A GLN 342 ? A GLN 124 
35 1 Y 1 A LYS 343 ? A LYS 125 
36 1 Y 1 A ARG 344 ? A ARG 126 
37 1 Y 1 A PRO 345 ? A PRO 127 
38 1 Y 1 A ASN 346 ? A ASN 128 
39 1 Y 1 A PRO 347 ? A PRO 129 
40 1 Y 1 A GLU 348 ? A GLU 130 
41 1 Y 1 A LEU 349 ? A LEU 131 
42 1 Y 1 A ARG 350 ? A ARG 132 
43 1 Y 1 A ARG 351 ? A ARG 133 
44 1 Y 1 A ASN 352 ? A ASN 134 
45 1 Y 1 A MET 353 ? A MET 135 
46 1 Y 1 A THR 354 ? A THR 136 
47 1 Y 1 A ILE 355 ? A ILE 137 
48 1 Y 1 A LYS 356 ? A LYS 138 
49 1 Y 1 A THR 357 ? A THR 139 
50 1 Y 1 A GLU 358 ? A GLU 140 
51 1 Y 1 A LEU 359 ? A LEU 141 
52 1 Y 1 A PRO 360 ? A PRO 142 
53 1 Y 1 B GLY 219 ? B GLY 1   
54 1 Y 1 B PRO 220 ? B PRO 2   
55 1 Y 1 B GLY 221 ? B GLY 3   
56 1 Y 1 B PRO 222 ? B PRO 4   
57 1 Y 1 B SER 223 ? B SER 5   
58 1 Y 1 B ARG 224 ? B ARG 6   
59 1 Y 1 B PRO 225 ? B PRO 7   
60 1 Y 1 B SER 226 ? B SER 8   
61 1 Y 1 B ALA 227 ? B ALA 9   
62 1 Y 1 B SER 228 ? B SER 10  
63 1 Y 1 B TRP 229 ? B TRP 11  
64 1 Y 1 B GLN 230 ? B GLN 12  
65 1 Y 1 B ASN 231 ? B ASN 13  
66 1 Y 1 B SER 232 ? B SER 14  
67 1 Y 1 B VAL 233 ? B VAL 15  
68 1 Y 1 B PRO 329 ? B PRO 111 
69 1 Y 1 B GLY 330 ? B GLY 112 
70 1 Y 1 B SER 331 ? B SER 113 
71 1 Y 1 B PRO 332 ? B PRO 114 
72 1 Y 1 B GLN 333 ? B GLN 115 
73 1 Y 1 B LEU 334 ? B LEU 116 
74 1 Y 1 B PRO 335 ? B PRO 117 
75 1 Y 1 B GLU 336 ? B GLU 118 
76 1 Y 1 B HIS 337 ? B HIS 119 
77 1 Y 1 B LEU 338 ? B LEU 120 
78 1 Y 1 B GLU 339 ? B GLU 121 
79 1 Y 1 B SER 340 ? B SER 122 
80 1 Y 1 B GLN 341 ? B GLN 123 
81 1 Y 1 B GLN 342 ? B GLN 124 
82 1 Y 1 B LYS 343 ? B LYS 125 
83 1 Y 1 B ARG 344 ? B ARG 126 
84 1 Y 1 B PRO 345 ? B PRO 127 
85 1 Y 1 B ASN 346 ? B ASN 128 
86 1 Y 1 B PRO 347 ? B PRO 129 
87 1 Y 1 B GLU 348 ? B GLU 130 
88 1 Y 1 B LEU 349 ? B LEU 131 
89 1 Y 1 B ARG 350 ? B ARG 132 
90 1 Y 1 B ARG 351 ? B ARG 133 
91 1 Y 1 B ASN 352 ? B ASN 134 
92 1 Y 1 B MET 353 ? B MET 135 
93 1 Y 1 B THR 354 ? B THR 136 
94 1 Y 1 B ILE 355 ? B ILE 137 
95 1 Y 1 B LYS 356 ? B LYS 138 
96 1 Y 1 B THR 357 ? B THR 139 
97 1 Y 1 B GLU 358 ? B GLU 140 
98 1 Y 1 B LEU 359 ? B LEU 141 
99 1 Y 1 B PRO 360 ? B PRO 142 
_ndb_struct_conf_na.entry_id   3G73 
_ndb_struct_conf_na.feature    'b-form double helix' 
1 C DA 3  1_555 D DT 21 1_555 0.032  -0.219 0.128  3.652   -14.829 -3.365 1  C_DA3:DT21_D  C 3  ? D 21 ? 20 1 
1 C DT 4  1_555 D DA 20 1_555 0.026  -0.146 0.198  -0.952  -15.891 4.401  2  C_DT4:DA20_D  C 4  ? D 20 ? 20 1 
1 C DT 5  1_555 D DA 19 1_555 -0.146 -0.108 0.286  -7.739  -15.042 4.874  3  C_DT5:DA19_D  C 5  ? D 19 ? 20 1 
1 C DG 6  1_555 D DC 18 1_555 -0.694 -0.150 -0.329 -17.725 -15.420 3.173  4  C_DG6:DC18_D  C 6  ? D 18 ? 19 1 
1 C DT 7  1_555 D DA 17 1_555 -0.281 -0.165 0.159  -15.289 -8.574  -2.276 5  C_DT7:DA17_D  C 7  ? D 17 ? 20 1 
1 C DT 8  1_555 D DA 16 1_555 -0.012 -0.173 0.064  -8.329  -15.467 3.310  6  C_DT8:DA16_D  C 8  ? D 16 ? 20 1 
1 C DT 9  1_555 D DA 15 1_555 -0.124 -0.056 -0.240 -0.341  -8.268  -0.379 7  C_DT9:DA15_D  C 9  ? D 15 ? 20 1 
1 C DA 10 1_555 D DT 14 1_555 -0.064 -0.189 -0.080 -2.255  -9.452  -0.415 8  C_DA10:DT14_D C 10 ? D 14 ? 20 1 
1 C DT 11 1_555 D DA 13 1_555 -0.031 -0.138 0.007  2.125   -10.605 1.180  9  C_DT11:DA13_D C 11 ? D 13 ? 20 1 
1 C DA 12 1_555 D DT 12 1_555 0.170  -0.024 -0.050 -1.592  -5.036  2.342  10 C_DA12:DT12_D C 12 ? D 12 ? 20 1 
1 C DA 13 1_555 D DT 11 1_555 0.025  -0.113 0.368  8.661   -13.502 2.710  11 C_DA13:DT11_D C 13 ? D 11 ? 20 1 
1 C DA 14 1_555 D DT 10 1_555 0.104  -0.109 0.230  10.217  -8.477  -1.511 12 C_DA14:DT10_D C 14 ? D 10 ? 20 1 
1 C DC 15 1_555 D DG 9  1_555 0.336  -0.186 -0.313 17.028  -10.388 -1.377 13 C_DC15:DG9_D  C 15 ? D 9  ? 19 1 
1 C DA 16 1_555 D DT 8  1_555 -0.095 -0.129 0.232  13.135  -14.230 2.000  14 C_DA16:DT8_D  C 16 ? D 8  ? 20 1 
1 C DG 17 1_555 D DC 7  1_555 -0.119 -0.094 0.142  11.168  -10.304 3.207  15 C_DG17:DC7_D  C 17 ? D 7  ? 19 1 
1 C DC 18 1_555 D DG 6  1_555 0.231  -0.319 -0.168 3.953   -14.263 0.422  16 C_DC18:DG6_D  C 18 ? D 6  ? 19 1 
1 C DC 19 1_555 D DG 5  1_555 0.120  -0.347 0.135  -8.070  -6.393  2.331  17 C_DC19:DG5_D  C 19 ? D 5  ? 19 1 
1 C DC 20 1_555 D DG 4  1_555 0.649  -0.191 -0.196 1.469   -4.229  8.282  18 C_DC20:DG4_D  C 20 ? D 4  ? 19 1 
1 C DG 21 1_555 D DC 3  1_555 -0.807 -0.155 -0.179 6.348   -8.955  5.109  19 C_DG21:DC3_D  C 21 ? D 3  ? 19 1 
1 C DA 3  1_555 D DT 21 1_555 C DT 4  1_555 D DA 20 1_555 0.272  -0.484 3.291 0.041  -1.939 36.647 -0.502 -0.426 3.312 -3.082 
-0.065 36.697 1  CC_DA3DT4:DA20DT21_DD   C 3  ? D 21 ? C 4  ? D 20 ? 
1 C DT 4  1_555 D DA 20 1_555 C DT 5  1_555 D DA 19 1_555 0.077  -0.418 3.373 -0.336 -0.839 34.721 -0.568 -0.182 3.381 -1.405 
0.562  34.733 2  CC_DT4DT5:DA19DA20_DD   C 4  ? D 20 ? C 5  ? D 19 ? 
1 C DT 5  1_555 D DA 19 1_555 C DG 6  1_555 D DC 18 1_555 0.185  -0.411 3.473 1.431  8.712  35.109 -1.951 -0.086 3.286 14.167 
-2.326 36.168 3  CC_DT5DG6:DC18DA19_DD   C 5  ? D 19 ? C 6  ? D 18 ? 
1 C DG 6  1_555 D DC 18 1_555 C DT 7  1_555 D DA 17 1_555 -1.072 -0.885 3.293 -2.989 0.815  29.044 -1.936 1.465  3.359 1.620  
5.939  29.206 4  CC_DG6DT7:DA17DC18_DD   C 6  ? D 18 ? C 7  ? D 17 ? 
1 C DT 7  1_555 D DA 17 1_555 C DT 8  1_555 D DA 16 1_555 0.444  -0.060 3.146 1.420  1.748  33.678 -0.376 -0.542 3.155 3.013  
-2.448 33.751 5  CC_DT7DT8:DA16DA17_DD   C 7  ? D 17 ? C 8  ? D 16 ? 
1 C DT 8  1_555 D DA 16 1_555 C DT 9  1_555 D DA 15 1_555 -0.346 -0.439 3.018 1.424  1.392  30.119 -1.102 0.930  2.977 2.674  
-2.737 30.184 6  CC_DT8DT9:DA15DA16_DD   C 8  ? D 16 ? C 9  ? D 15 ? 
1 C DT 9  1_555 D DA 15 1_555 C DA 10 1_555 D DT 14 1_555 0.011  -0.594 3.356 -0.744 8.517  32.882 -2.389 -0.138 3.109 14.737 
1.288  33.945 7  CC_DT9DA10:DT14DA15_DD  C 9  ? D 15 ? C 10 ? D 14 ? 
1 C DA 10 1_555 D DT 14 1_555 C DT 11 1_555 D DA 13 1_555 0.154  -0.489 3.130 -0.507 1.758  31.286 -1.221 -0.376 3.096 3.256  
0.939  31.338 8  CC_DA10DT11:DA13DT14_DD C 10 ? D 14 ? C 11 ? D 13 ? 
1 C DT 11 1_555 D DA 13 1_555 C DA 12 1_555 D DT 12 1_555 -0.021 -0.720 3.294 -0.154 8.714  33.976 -2.480 0.012  3.023 14.615 
0.259  35.044 9  CC_DT11DA12:DT12DA13_DD C 11 ? D 13 ? C 12 ? D 12 ? 
1 C DA 12 1_555 D DT 12 1_555 C DA 13 1_555 D DT 11 1_555 0.243  -0.503 3.003 -2.974 2.878  29.463 -1.527 -1.038 2.904 5.624  
5.812  29.746 10 CC_DA12DA13:DT11DT12_DD C 12 ? D 12 ? C 13 ? D 11 ? 
1 C DA 13 1_555 D DT 11 1_555 C DA 14 1_555 D DT 10 1_555 -0.704 -0.306 3.266 -0.456 0.557  33.552 -0.622 1.144  3.270 0.964  
0.789  33.560 11 CC_DA13DA14:DT10DT11_DD C 13 ? D 11 ? C 14 ? D 10 ? 
1 C DA 14 1_555 D DT 10 1_555 C DC 15 1_555 D DG 9  1_555 0.701  -0.732 3.158 3.656  2.847  27.281 -2.200 -0.608 3.132 5.980  
-7.681 27.664 12 CC_DA14DC15:DG9DT10_DD  C 14 ? D 10 ? C 15 ? D 9  ? 
1 C DC 15 1_555 D DG 9  1_555 C DA 16 1_555 D DT 8  1_555 -0.197 -0.128 3.393 -1.530 8.828  35.146 -1.488 0.094  3.272 14.334 
2.484  36.236 13 CC_DC15DA16:DT8DG9_DD   C 15 ? D 9  ? C 16 ? D 8  ? 
1 C DA 16 1_555 D DT 8  1_555 C DG 17 1_555 D DC 7  1_555 0.296  -0.195 3.373 0.427  2.842  33.049 -0.832 -0.445 3.348 4.985  
-0.750 33.170 14 CC_DA16DG17:DC7DT8_DD   C 16 ? D 8  ? C 17 ? D 7  ? 
1 C DG 17 1_555 D DC 7  1_555 C DC 18 1_555 D DG 6  1_555 -0.061 -0.355 3.356 2.195  -0.375 39.600 -0.478 0.352  3.351 -0.554 
-3.237 39.660 15 CC_DG17DC18:DG6DC7_DD   C 17 ? D 7  ? C 18 ? D 6  ? 
1 C DC 18 1_555 D DG 6  1_555 C DC 19 1_555 D DG 5  1_555 0.320  -0.105 3.587 -1.794 1.883  36.718 -0.447 -0.773 3.558 2.985  
2.844  36.807 16 CC_DC18DC19:DG5DG6_DD   C 18 ? D 6  ? C 19 ? D 5  ? 
1 C DC 19 1_555 D DG 5  1_555 C DC 20 1_555 D DG 4  1_555 0.476  0.699  3.174 3.449  0.086  35.036 1.144  -0.286 3.207 0.143  
-5.711 35.200 17 CC_DC19DC20:DG4DG5_DD   C 19 ? D 5  ? C 20 ? D 4  ? 
1 C DC 20 1_555 D DG 4  1_555 C DG 21 1_555 D DC 3  1_555 -0.882 1.254  3.111 -0.772 6.788  28.275 1.008  1.588  3.338 13.644 
1.551  29.072 18 CC_DC20DG21:DC3DG4_DD   C 20 ? D 4  ? C 21 ? D 3  ? 
5 water           HOH 
E 4 MG  1  996 996 MG  MG  A . 
F 4 MG  1  996 996 MG  MG  B . 
G 5 HOH 1  4   4   HOH HOH A . 
G 5 HOH 2  8   8   HOH HOH A . 
G 5 HOH 3  9   9   HOH HOH A . 
G 5 HOH 4  10  10  HOH HOH A . 
G 5 HOH 5  11  11  HOH HOH A . 
G 5 HOH 6  13  13  HOH HOH A . 
G 5 HOH 7  14  14  HOH HOH A . 
G 5 HOH 8  15  15  HOH HOH A . 
G 5 HOH 9  16  16  HOH HOH A . 
G 5 HOH 10 17  17  HOH HOH A . 
G 5 HOH 11 18  18  HOH HOH A . 
G 5 HOH 12 24  24  HOH HOH A . 
G 5 HOH 13 25  25  HOH HOH A . 
G 5 HOH 14 27  27  HOH HOH A . 
G 5 HOH 15 28  28  HOH HOH A . 
G 5 HOH 16 29  29  HOH HOH A . 
G 5 HOH 17 30  30  HOH HOH A . 
G 5 HOH 18 31  31  HOH HOH A . 
G 5 HOH 19 54  54  HOH HOH A . 
G 5 HOH 20 55  55  HOH HOH A . 
G 5 HOH 21 56  56  HOH HOH A . 
G 5 HOH 22 57  57  HOH HOH A . 
G 5 HOH 23 58  58  HOH HOH A . 
G 5 HOH 24 59  59  HOH HOH A . 
G 5 HOH 25 60  60  HOH HOH A . 
G 5 HOH 26 61  61  HOH HOH A . 
G 5 HOH 27 62  62  HOH HOH A . 
G 5 HOH 28 63  63  HOH HOH A . 
G 5 HOH 29 64  64  HOH HOH A . 
G 5 HOH 30 65  65  HOH HOH A . 
G 5 HOH 31 66  66  HOH HOH A . 
G 5 HOH 32 69  69  HOH HOH A . 
G 5 HOH 33 79  79  HOH HOH A . 
G 5 HOH 34 82  82  HOH HOH A . 
G 5 HOH 35 86  86  HOH HOH A . 
G 5 HOH 36 96  96  HOH HOH A . 
G 5 HOH 37 97  97  HOH HOH A . 
G 5 HOH 38 129 129 HOH HOH A . 
G 5 HOH 39 131 131 HOH HOH A . 
G 5 HOH 40 133 133 HOH HOH A . 
G 5 HOH 41 135 135 HOH HOH A . 
G 5 HOH 42 136 136 HOH HOH A . 
G 5 HOH 43 139 139 HOH HOH A . 
G 5 HOH 44 140 140 HOH HOH A . 
G 5 HOH 45 157 157 HOH HOH A . 
G 5 HOH 46 164 164 HOH HOH A . 
G 5 HOH 47 169 169 HOH HOH A . 
G 5 HOH 48 170 170 HOH HOH A . 
H 5 HOH 1  33  33  HOH HOH B . 
H 5 HOH 2  35  35  HOH HOH B . 
H 5 HOH 3  36  36  HOH HOH B . 
H 5 HOH 4  41  41  HOH HOH B . 
H 5 HOH 5  43  43  HOH HOH B . 
H 5 HOH 6  45  45  HOH HOH B . 
H 5 HOH 7  47  47  HOH HOH B . 
H 5 HOH 8  48  48  HOH HOH B . 
H 5 HOH 9  49  49  HOH HOH B . 
H 5 HOH 10 50  50  HOH HOH B . 
H 5 HOH 11 51  51  HOH HOH B . 
H 5 HOH 12 52  52  HOH HOH B . 
H 5 HOH 13 53  53  HOH HOH B . 
H 5 HOH 14 70  70  HOH HOH B . 
H 5 HOH 15 71  71  HOH HOH B . 
H 5 HOH 16 72  72  HOH HOH B . 
H 5 HOH 17 74  74  HOH HOH B . 
H 5 HOH 18 76  76  HOH HOH B . 
H 5 HOH 19 80  80  HOH HOH B . 
H 5 HOH 20 81  81  HOH HOH B . 
H 5 HOH 21 88  88  HOH HOH B . 
H 5 HOH 22 89  89  HOH HOH B . 
H 5 HOH 23 95  95  HOH HOH B . 
H 5 HOH 24 106 106 HOH HOH B . 
H 5 HOH 25 121 121 HOH HOH B . 
H 5 HOH 26 128 128 HOH HOH B . 
H 5 HOH 27 143 143 HOH HOH B . 
H 5 HOH 28 147 147 HOH HOH B . 
H 5 HOH 29 149 149 HOH HOH B . 
H 5 HOH 30 150 150 HOH HOH B . 
H 5 HOH 31 161 161 HOH HOH B . 
I 5 HOH 1  22  22  HOH HOH C . 
I 5 HOH 2  23  23  HOH HOH C . 
I 5 HOH 3  24  2   HOH HOH C . 
I 5 HOH 4  25  3   HOH HOH C . 
I 5 HOH 5  26  5   HOH HOH C . 
I 5 HOH 6  27  20  HOH HOH C . 
I 5 HOH 7  28  21  HOH HOH C . 
I 5 HOH 8  46  46  HOH HOH C . 
I 5 HOH 9  68  68  HOH HOH C . 
I 5 HOH 10 77  77  HOH HOH C . 
I 5 HOH 11 83  83  HOH HOH C . 
I 5 HOH 12 84  84  HOH HOH C . 
I 5 HOH 13 85  85  HOH HOH C . 
I 5 HOH 14 87  87  HOH HOH C . 
I 5 HOH 15 92  92  HOH HOH C . 
I 5 HOH 16 93  93  HOH HOH C . 
I 5 HOH 17 94  94  HOH HOH C . 
I 5 HOH 18 98  98  HOH HOH C . 
I 5 HOH 19 99  99  HOH HOH C . 
I 5 HOH 20 100 100 HOH HOH C . 
I 5 HOH 21 101 101 HOH HOH C . 
I 5 HOH 22 102 102 HOH HOH C . 
I 5 HOH 23 110 110 HOH HOH C . 
I 5 HOH 24 111 111 HOH HOH C . 
I 5 HOH 25 124 124 HOH HOH C . 
I 5 HOH 26 127 127 HOH HOH C . 
I 5 HOH 27 137 137 HOH HOH C . 
I 5 HOH 28 138 138 HOH HOH C . 
I 5 HOH 29 142 142 HOH HOH C . 
I 5 HOH 30 151 151 HOH HOH C . 
I 5 HOH 31 152 152 HOH HOH C . 
I 5 HOH 32 153 153 HOH HOH C . 
I 5 HOH 33 156 156 HOH HOH C . 
I 5 HOH 34 158 158 HOH HOH C . 
I 5 HOH 35 159 159 HOH HOH C . 
I 5 HOH 36 160 160 HOH HOH C . 
I 5 HOH 37 162 162 HOH HOH C . 
I 5 HOH 38 165 165 HOH HOH C . 
I 5 HOH 39 166 166 HOH HOH C . 
I 5 HOH 40 167 167 HOH HOH C . 
I 5 HOH 41 168 168 HOH HOH C . 
J 5 HOH 1  22  1   HOH HOH D . 
J 5 HOH 2  23  12  HOH HOH D . 
J 5 HOH 3  24  19  HOH HOH D . 
J 5 HOH 4  26  26  HOH HOH D . 
J 5 HOH 5  32  32  HOH HOH D . 
J 5 HOH 6  34  34  HOH HOH D . 
J 5 HOH 7  37  37  HOH HOH D . 
J 5 HOH 8  38  38  HOH HOH D . 
J 5 HOH 9  39  39  HOH HOH D . 
J 5 HOH 10 40  40  HOH HOH D . 
J 5 HOH 11 44  44  HOH HOH D . 
J 5 HOH 12 73  73  HOH HOH D . 
J 5 HOH 13 75  75  HOH HOH D . 
J 5 HOH 14 78  78  HOH HOH D . 
J 5 HOH 15 90  90  HOH HOH D . 
J 5 HOH 16 103 103 HOH HOH D . 
J 5 HOH 17 104 104 HOH HOH D . 
J 5 HOH 18 105 105 HOH HOH D . 
J 5 HOH 19 107 107 HOH HOH D . 
J 5 HOH 20 108 108 HOH HOH D . 
J 5 HOH 21 109 109 HOH HOH D . 
J 5 HOH 22 112 112 HOH HOH D . 
J 5 HOH 23 113 113 HOH HOH D . 
J 5 HOH 24 114 114 HOH HOH D . 
J 5 HOH 25 115 115 HOH HOH D . 
J 5 HOH 26 116 116 HOH HOH D . 
J 5 HOH 27 117 117 HOH HOH D . 
J 5 HOH 28 118 118 HOH HOH D . 
J 5 HOH 29 119 119 HOH HOH D . 
J 5 HOH 30 122 122 HOH HOH D . 
J 5 HOH 31 123 123 HOH HOH D . 
J 5 HOH 32 125 125 HOH HOH D . 
J 5 HOH 33 126 126 HOH HOH D . 
J 5 HOH 34 130 130 HOH HOH D . 
J 5 HOH 35 132 132 HOH HOH D . 
J 5 HOH 36 134 134 HOH HOH D . 
J 5 HOH 37 144 144 HOH HOH D . 
J 5 HOH 38 145 145 HOH HOH D . 
J 5 HOH 39 146 146 HOH HOH D . 
J 5 HOH 40 148 148 HOH HOH D . 
J 5 HOH 41 154 154 HOH HOH D . 
J 5 HOH 42 155 155 HOH HOH D . 
J 5 HOH 43 163 163 HOH HOH D . 