data_3PDR
# 
_entry.id   3PDR 
# 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.287 
_audit_conform.dict_location   http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic 
# 
loop_
_database_2.database_id 
_database_2.database_code 
PDB   3PDR         
NDB   NA0830       
RCSB  RCSB062254   
WWPDB D_1000062254 
# 
_pdbx_database_status.entry_id                        3PDR 
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.deposit_site                    RCSB 
_pdbx_database_status.process_site                    RCSB 
_pdbx_database_status.recvd_initial_deposition_date   2010-10-23 
_pdbx_database_status.status_code_sf                  REL 
_pdbx_database_status.status_code_mr                  ? 
_pdbx_database_status.SG_entry                        ? 
_pdbx_database_status.status_code_cs                  ? 
_pdbx_database_status.pdb_format_compatible           Y 
_pdbx_database_status.methods_development_category    ? 
# 
loop_
_audit_author.name 
_audit_author.pdbx_ordinal 
_audit_author.identifier_ORCID 
'Ramesh, A.'    1 ? 
'Winkler, W.C.' 2 ? 
# 
_citation.id                        primary 
_citation.title                     
'Insights into Metalloregulation by M-box Riboswitch RNAs via Structural Analysis of Manganese-Bound Complexes.' 
_citation.journal_abbrev            J.Mol.Biol. 
_citation.journal_volume            407 
_citation.page_first                556 
_citation.page_last                 570 
_citation.year                      2011 
_citation.journal_id_ASTM           JMOBAK 
_citation.country                   UK 
_citation.journal_id_ISSN           0022-2836 
_citation.journal_id_CSD            0070 
_citation.book_publisher            ? 
_citation.pdbx_database_id_PubMed   21315082 
_citation.pdbx_database_id_DOI      10.1016/j.jmb.2011.01.049 
# 
loop_
_citation_author.citation_id 
_citation_author.name 
_citation_author.ordinal 
primary 'Ramesh, A.'    1 
primary 'Wakeman, C.A.' 2 
primary 'Winkler, W.C.' 3 
# 
_cell.entry_id           3PDR 
_cell.length_a           68.780 
_cell.length_b           102.487 
_cell.length_c           126.375 
_cell.angle_alpha        90.00 
_cell.angle_beta         90.00 
_cell.angle_gamma        90.00 
_cell.Z_PDB              8 
_cell.pdbx_unique_axis   ? 
_cell.length_a_esd       ? 
_cell.length_b_esd       ? 
_cell.length_c_esd       ? 
_cell.angle_alpha_esd    ? 
_cell.angle_beta_esd     ? 
_cell.angle_gamma_esd    ? 
# 
_symmetry.entry_id                         3PDR 
_symmetry.space_group_name_H-M             'P 21 21 21' 
_symmetry.pdbx_full_space_group_name_H-M   ? 
_symmetry.cell_setting                     ? 
_symmetry.Int_Tables_number                19 
_symmetry.space_group_name_Hall            ? 
# 
loop_
_entity.id 
_entity.type 
_entity.src_method 
_entity.pdbx_description 
_entity.formula_weight 
_entity.pdbx_number_of_molecules 
_entity.pdbx_ec 
_entity.pdbx_mutation 
_entity.pdbx_fragment 
_entity.details 
1 polymer     man 'M-box Riboswitch RNA' 51810.707 2   ? ? ? ? 
2 non-polymer syn 'POTASSIUM ION'        39.098    6   ? ? ? ? 
3 non-polymer syn 'MANGANESE (II) ION'   54.938    25  ? ? ? ? 
4 water       nat water                  18.015    548 ? ? ? ? 
# 
_entity_poly.entity_id                      1 
_entity_poly.type                           polyribonucleotide 
_entity_poly.nstd_linkage                   no 
_entity_poly.nstd_monomer                   no 
_entity_poly.pdbx_seq_one_letter_code       
;GGGCUUCGUUAGGUGAGGCUCCUGUAUGGAGAUACGCUGCUGCCCAAAAAUGUCCAAAGACGCCAAUGGGUCAACAGAAA
UCAUCGACAUAAGGUGAUUUUUAAUGCAGCUGGAUGCUUGUCCUAUGCCAUACAGUGCUAAAGCUCUACGAUUGAAGCCC
A
;
_entity_poly.pdbx_seq_one_letter_code_can   
;GGGCUUCGUUAGGUGAGGCUCCUGUAUGGAGAUACGCUGCUGCCCAAAAAUGUCCAAAGACGCCAAUGGGUCAACAGAAA
UCAUCGACAUAAGGUGAUUUUUAAUGCAGCUGGAUGCUUGUCCUAUGCCAUACAGUGCUAAAGCUCUACGAUUGAAGCCC
A
;
_entity_poly.pdbx_strand_id                 X,A 
_entity_poly.pdbx_target_identifier         ? 
# 
loop_
_entity_poly_seq.entity_id 
_entity_poly_seq.num 
_entity_poly_seq.mon_id 
_entity_poly_seq.hetero 
1 1   G n 
1 2   G n 
1 3   G n 
1 4   C n 
1 5   U n 
1 6   U n 
1 7   C n 
1 8   G n 
1 9   U n 
1 10  U n 
1 11  A n 
1 12  G n 
1 13  G n 
1 14  U n 
1 15  G n 
1 16  A n 
1 17  G n 
1 18  G n 
1 19  C n 
1 20  U n 
1 21  C n 
1 22  C n 
1 23  U n 
1 24  G n 
1 25  U n 
1 26  A n 
1 27  U n 
1 28  G n 
1 29  G n 
1 30  A n 
1 31  G n 
1 32  A n 
1 33  U n 
1 34  A n 
1 35  C n 
1 36  G n 
1 37  C n 
1 38  U n 
1 39  G n 
1 40  C n 
1 41  U n 
1 42  G n 
1 43  C n 
1 44  C n 
1 45  C n 
1 46  A n 
1 47  A n 
1 48  A n 
1 49  A n 
1 50  A n 
1 51  U n 
1 52  G n 
1 53  U n 
1 54  C n 
1 55  C n 
1 56  A n 
1 57  A n 
1 58  A n 
1 59  G n 
1 60  A n 
1 61  C n 
1 62  G n 
1 63  C n 
1 64  C n 
1 65  A n 
1 66  A n 
1 67  U n 
1 68  G n 
1 69  G n 
1 70  G n 
1 71  U n 
1 72  C n 
1 73  A n 
1 74  A n 
1 75  C n 
1 76  A n 
1 77  G n 
1 78  A n 
1 79  A n 
1 80  A n 
1 81  U n 
1 82  C n 
1 83  A n 
1 84  U n 
1 85  C n 
1 86  G n 
1 87  A n 
1 88  C n 
1 89  A n 
1 90  U n 
1 91  A n 
1 92  A n 
1 93  G n 
1 94  G n 
1 95  U n 
1 96  G n 
1 97  A n 
1 98  U n 
1 99  U n 
1 100 U n 
1 101 U n 
1 102 U n 
1 103 A n 
1 104 A n 
1 105 U n 
1 106 G n 
1 107 C n 
1 108 A n 
1 109 G n 
1 110 C n 
1 111 U n 
1 112 G n 
1 113 G n 
1 114 A n 
1 115 U n 
1 116 G n 
1 117 C n 
1 118 U n 
1 119 U n 
1 120 G n 
1 121 U n 
1 122 C n 
1 123 C n 
1 124 U n 
1 125 A n 
1 126 U n 
1 127 G n 
1 128 C n 
1 129 C n 
1 130 A n 
1 131 U n 
1 132 A n 
1 133 C n 
1 134 A n 
1 135 G n 
1 136 U n 
1 137 G n 
1 138 C n 
1 139 U n 
1 140 A n 
1 141 A n 
1 142 A n 
1 143 G n 
1 144 C n 
1 145 U n 
1 146 C n 
1 147 U n 
1 148 A n 
1 149 C n 
1 150 G n 
1 151 A n 
1 152 U n 
1 153 U n 
1 154 G n 
1 155 A n 
1 156 A n 
1 157 G n 
1 158 C n 
1 159 C n 
1 160 C n 
1 161 A n 
# 
_entity_src_gen.entity_id                          1 
_entity_src_gen.pdbx_src_id                        1 
_entity_src_gen.pdbx_alt_source_flag               sample 
_entity_src_gen.pdbx_seq_type                      ? 
_entity_src_gen.pdbx_beg_seq_num                   ? 
_entity_src_gen.pdbx_end_seq_num                   ? 
_entity_src_gen.gene_src_common_name               ? 
_entity_src_gen.gene_src_genus                     ? 
_entity_src_gen.pdbx_gene_src_gene                 ? 
_entity_src_gen.gene_src_species                   ? 
_entity_src_gen.gene_src_strain                    ? 
_entity_src_gen.gene_src_tissue                    ? 
_entity_src_gen.gene_src_tissue_fraction           ? 
_entity_src_gen.gene_src_details                   ? 
_entity_src_gen.pdbx_gene_src_fragment             ? 
_entity_src_gen.pdbx_gene_src_scientific_name      'Bacillus subtilis' 
_entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id     1423 
_entity_src_gen.pdbx_gene_src_variant              ? 
_entity_src_gen.pdbx_gene_src_cell_line            ? 
_entity_src_gen.pdbx_gene_src_atcc                 ? 
_entity_src_gen.pdbx_gene_src_organ                ? 
_entity_src_gen.pdbx_gene_src_organelle            ? 
_entity_src_gen.pdbx_gene_src_cell                 ? 
_entity_src_gen.pdbx_gene_src_cellular_location    ? 
_entity_src_gen.host_org_common_name               ? 
_entity_src_gen.pdbx_host_org_scientific_name      'Escherichia coli' 
_entity_src_gen.pdbx_host_org_ncbi_taxonomy_id     562 
_entity_src_gen.host_org_genus                     ? 
_entity_src_gen.pdbx_host_org_gene                 ? 
_entity_src_gen.pdbx_host_org_organ                ? 
_entity_src_gen.host_org_species                   ? 
_entity_src_gen.pdbx_host_org_tissue               ? 
_entity_src_gen.pdbx_host_org_tissue_fraction      ? 
_entity_src_gen.pdbx_host_org_strain               ? 
_entity_src_gen.pdbx_host_org_variant              ? 
_entity_src_gen.pdbx_host_org_cell_line            ? 
_entity_src_gen.pdbx_host_org_atcc                 ? 
_entity_src_gen.pdbx_host_org_culture_collection   ? 
_entity_src_gen.pdbx_host_org_cell                 ? 
_entity_src_gen.pdbx_host_org_organelle            ? 
_entity_src_gen.pdbx_host_org_cellular_location    ? 
_entity_src_gen.pdbx_host_org_vector_type          ? 
_entity_src_gen.pdbx_host_org_vector               ? 
_entity_src_gen.host_org_details                   ? 
_entity_src_gen.expression_system_id               ? 
_entity_src_gen.plasmid_name                       ? 
_entity_src_gen.plasmid_details                    ? 
_entity_src_gen.pdbx_description                   ? 
# 
_struct_ref.id                         1 
_struct_ref.db_name                    GB 
_struct_ref.db_code                    AL009126 
_struct_ref.pdbx_db_accession          AL009126.3 
_struct_ref.entity_id                  1 
_struct_ref.pdbx_seq_one_letter_code   
;CUUCGUUAGGUGAGGCUCCUGUAUGGAGAUACGCUGCUGCCCAAAAAUGUCCAAAGACGCCAAUGGGUCAACAGAAAUCA
UCGACAUAAGGUGAUUUUUAAUGCAGCUGGAUGCUUGUCCUAUGCCAUACAGUGCUAAAGCUCUACGAUUGAAG
;
_struct_ref.pdbx_align_begin           1395622 
_struct_ref.pdbx_db_isoform            ? 
# 
loop_
_struct_ref_seq.align_id 
_struct_ref_seq.ref_id 
_struct_ref_seq.pdbx_PDB_id_code 
_struct_ref_seq.pdbx_strand_id 
_struct_ref_seq.seq_align_beg 
_struct_ref_seq.pdbx_seq_align_beg_ins_code 
_struct_ref_seq.seq_align_end 
_struct_ref_seq.pdbx_seq_align_end_ins_code 
_struct_ref_seq.pdbx_db_accession 
_struct_ref_seq.db_align_beg 
_struct_ref_seq.pdbx_db_align_beg_ins_code 
_struct_ref_seq.db_align_end 
_struct_ref_seq.pdbx_db_align_end_ins_code 
_struct_ref_seq.pdbx_auth_seq_align_beg 
_struct_ref_seq.pdbx_auth_seq_align_end 
1 1 3PDR X 4 ? 157 ? AL009126.3 1395622 ? 1395775 ? 18 171 
2 1 3PDR A 4 ? 157 ? AL009126.3 1395622 ? 1395775 ? 18 171 
# 
loop_
_struct_ref_seq_dif.align_id 
_struct_ref_seq_dif.pdbx_pdb_id_code 
_struct_ref_seq_dif.mon_id 
_struct_ref_seq_dif.pdbx_pdb_strand_id 
_struct_ref_seq_dif.seq_num 
_struct_ref_seq_dif.pdbx_pdb_ins_code 
_struct_ref_seq_dif.pdbx_seq_db_name 
_struct_ref_seq_dif.pdbx_seq_db_accession_code 
_struct_ref_seq_dif.db_mon_id 
_struct_ref_seq_dif.pdbx_seq_db_seq_num 
_struct_ref_seq_dif.details 
_struct_ref_seq_dif.pdbx_auth_seq_num 
_struct_ref_seq_dif.pdbx_ordinal 
1 3PDR G X 1   ? GB AL009126.3 ? ? INSERTION 15  1  
1 3PDR G X 2   ? GB AL009126.3 ? ? INSERTION 16  2  
1 3PDR G X 3   ? GB AL009126.3 ? ? INSERTION 17  3  
1 3PDR C X 158 ? GB AL009126.3 ? ? INSERTION 172 4  
1 3PDR C X 159 ? GB AL009126.3 ? ? INSERTION 173 5  
1 3PDR C X 160 ? GB AL009126.3 ? ? INSERTION 174 6  
1 3PDR A X 161 ? GB AL009126.3 ? ? INSERTION 175 7  
2 3PDR G A 1   ? GB AL009126.3 ? ? INSERTION 15  8  
2 3PDR G A 2   ? GB AL009126.3 ? ? INSERTION 16  9  
2 3PDR G A 3   ? GB AL009126.3 ? ? INSERTION 17  10 
2 3PDR C A 158 ? GB AL009126.3 ? ? INSERTION 172 11 
2 3PDR C A 159 ? GB AL009126.3 ? ? INSERTION 173 12 
2 3PDR C A 160 ? GB AL009126.3 ? ? INSERTION 174 13 
2 3PDR A A 161 ? GB AL009126.3 ? ? INSERTION 175 14 
# 
loop_
_chem_comp.id 
_chem_comp.type 
_chem_comp.mon_nstd_flag 
_chem_comp.name 
_chem_comp.pdbx_synonyms 
_chem_comp.formula 
_chem_comp.formula_weight 
A   'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 
C   'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE"  ? 'C9 H14 N3 O8 P'  323.197 
G   'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 
HOH non-polymer   . WATER                        ? 'H2 O'            18.015  
K   non-polymer   . 'POTASSIUM ION'              ? 'K 1'             39.098  
MN  non-polymer   . 'MANGANESE (II) ION'         ? 'Mn 2'            54.938  
U   'RNA linking' y "URIDINE-5'-MONOPHOSPHATE"   ? 'C9 H13 N2 O9 P'  324.181 
# 
_exptl.entry_id          3PDR 
_exptl.method            'X-RAY DIFFRACTION' 
_exptl.crystals_number   1 
# 
_exptl_crystal.id                    1 
_exptl_crystal.density_meas          ? 
_exptl_crystal.density_Matthews      2.15 
_exptl_crystal.density_percent_sol   42.77 
_exptl_crystal.description           ? 
_exptl_crystal.F_000                 ? 
_exptl_crystal.preparation           ? 
# 
_exptl_crystal_grow.crystal_id      1 
_exptl_crystal_grow.method          'VAPOR DIFFUSION' 
_exptl_crystal_grow.temp            293 
_exptl_crystal_grow.temp_details    ? 
_exptl_crystal_grow.pH              7.2 
_exptl_crystal_grow.pdbx_pH_range   ? 
_exptl_crystal_grow.pdbx_details    
;10%MPD, 40mM sodium cacodylate, 12mM Spermine .4HCl,20mM KCl, 50mM Ammonium sulfate, 5mM MnCl2, pH 7.2, VAPOR DIFFUSION, temperature 293K
;
# 
_diffrn.id                     1 
_diffrn.ambient_temp           100 
_diffrn.ambient_temp_details   ? 
_diffrn.crystal_id             1 
# 
_diffrn_detector.diffrn_id              1 
_diffrn_detector.detector               CCD 
_diffrn_detector.type                   'ADSC QUANTUM 315' 
_diffrn_detector.pdbx_collection_date   2009-08-08 
_diffrn_detector.details                ? 
# 
_diffrn_radiation.diffrn_id                        1 
_diffrn_radiation.wavelength_id                    1 
_diffrn_radiation.pdbx_monochromatic_or_laue_m_l   M 
_diffrn_radiation.monochromator                    'Rosenbaum-Rock high-resolution double-crystal monochromator' 
_diffrn_radiation.pdbx_diffrn_protocol             'SINGLE WAVELENGTH' 
_diffrn_radiation.pdbx_scattering_type             x-ray 
# 
_diffrn_radiation_wavelength.id           1 
_diffrn_radiation_wavelength.wavelength   0.98 
_diffrn_radiation_wavelength.wt           1.0 
# 
_diffrn_source.diffrn_id                   1 
_diffrn_source.source                      SYNCHROTRON 
_diffrn_source.type                        'APS BEAMLINE 19-ID' 
_diffrn_source.pdbx_synchrotron_site       APS 
_diffrn_source.pdbx_synchrotron_beamline   19-ID 
_diffrn_source.pdbx_wavelength             ? 
_diffrn_source.pdbx_wavelength_list        0.98 
# 
_reflns.entry_id                     3PDR 
_reflns.observed_criterion_sigma_I   ? 
_reflns.observed_criterion_sigma_F   ? 
_reflns.d_resolution_low             50.000 
_reflns.d_resolution_high            1.853 
_reflns.number_obs                   73903 
_reflns.number_all                   ? 
_reflns.percent_possible_obs         96.800 
_reflns.pdbx_Rmerge_I_obs            0.087 
_reflns.pdbx_Rsym_value              ? 
_reflns.pdbx_netI_over_sigmaI        9.500 
_reflns.B_iso_Wilson_estimate        ? 
_reflns.pdbx_redundancy              5.700 
_reflns.R_free_details               ? 
_reflns.pdbx_chi_squared             ? 
_reflns.pdbx_scaling_rejects         ? 
_reflns.pdbx_diffrn_id               1 
_reflns.pdbx_ordinal                 1 
# 
loop_
_reflns_shell.d_res_high 
_reflns_shell.d_res_low 
_reflns_shell.percent_possible_all 
_reflns_shell.Rmerge_I_obs 
_reflns_shell.pdbx_Rsym_value 
_reflns_shell.meanI_over_sigI_obs 
_reflns_shell.pdbx_redundancy 
_reflns_shell.percent_possible_obs 
_reflns_shell.number_unique_all 
_reflns_shell.number_measured_all 
_reflns_shell.number_measured_obs 
_reflns_shell.number_unique_obs 
_reflns_shell.pdbx_chi_squared 
_reflns_shell.pdbx_diffrn_id 
_reflns_shell.pdbx_ordinal 
1.853 1.890  97.600 0.916 ? ? 5.600 ? ? ? ? ? ? ? 1  
1.890 1.930  98.100 0.768 ? ? 5.600 ? ? ? ? ? ? ? 2  
1.930 1.960  98.000 0.690 ? ? 5.600 ? ? ? ? ? ? ? 3  
1.960 2.000  97.800 0.540 ? ? 5.600 ? ? ? ? ? ? ? 4  
2.000 2.050  97.900 0.488 ? ? 5.700 ? ? ? ? ? ? ? 5  
2.050 2.090  97.700 0.421 ? ? 5.700 ? ? ? ? ? ? ? 6  
2.090 2.150  97.500 0.345 ? ? 5.700 ? ? ? ? ? ? ? 7  
2.150 2.210  97.500 0.307 ? ? 5.800 ? ? ? ? ? ? ? 8  
2.210 2.270  97.400 0.279 ? ? 5.800 ? ? ? ? ? ? ? 9  
2.270 2.340  97.200 0.236 ? ? 5.700 ? ? ? ? ? ? ? 10 
2.340 2.430  96.800 0.194 ? ? 5.800 ? ? ? ? ? ? ? 11 
2.430 2.520  97.100 0.168 ? ? 5.800 ? ? ? ? ? ? ? 12 
2.520 2.640  96.800 0.136 ? ? 5.800 ? ? ? ? ? ? ? 13 
2.640 2.780  96.900 0.116 ? ? 5.800 ? ? ? ? ? ? ? 14 
2.780 2.950  96.600 0.094 ? ? 5.800 ? ? ? ? ? ? ? 15 
2.950 3.180  96.900 0.076 ? ? 5.700 ? ? ? ? ? ? ? 16 
3.180 3.500  96.600 0.069 ? ? 5.700 ? ? ? ? ? ? ? 17 
3.500 4.010  96.000 0.055 ? ? 5.600 ? ? ? ? ? ? ? 18 
4.010 5.050  95.200 0.043 ? ? 5.600 ? ? ? ? ? ? ? 19 
5.050 50.000 91.600 0.040 ? ? 5.800 ? ? ? ? ? ? ? 20 
# 
_refine.pdbx_refine_id                           'X-RAY DIFFRACTION' 
_refine.entry_id                                 3PDR 
_refine.ls_number_reflns_obs                     69314 
_refine.ls_number_reflns_all                     ? 
_refine.pdbx_ls_sigma_I                          ? 
_refine.pdbx_ls_sigma_F                          0.10 
_refine.pdbx_data_cutoff_high_absF               ? 
_refine.pdbx_data_cutoff_low_absF                ? 
_refine.pdbx_data_cutoff_high_rms_absF           ? 
_refine.ls_d_res_low                             47.488 
_refine.ls_d_res_high                            1.853 
_refine.ls_percent_reflns_obs                    90.57 
_refine.ls_R_factor_obs                          0.1940 
_refine.ls_R_factor_all                          ? 
_refine.ls_R_factor_R_work                       0.1922 
_refine.ls_R_factor_R_free                       0.2278 
_refine.ls_R_factor_R_free_error                 ? 
_refine.ls_R_factor_R_free_error_details         ? 
_refine.ls_percent_reflns_R_free                 5.05 
_refine.ls_number_reflns_R_free                  3497 
_refine.ls_number_parameters                     ? 
_refine.ls_number_restraints                     ? 
_refine.occupancy_min                            0.420 
_refine.occupancy_max                            1.000 
_refine.correlation_coeff_Fo_to_Fc               ? 
_refine.correlation_coeff_Fo_to_Fc_free          ? 
_refine.B_iso_mean                               ? 
_refine.aniso_B[1][1]                            -2.0230 
_refine.aniso_B[2][2]                            -2.2667 
_refine.aniso_B[3][3]                            4.2897 
_refine.aniso_B[1][2]                            -0.0000 
_refine.aniso_B[1][3]                            0.0000 
_refine.aniso_B[2][3]                            0.0000 
_refine.solvent_model_details                    'FLAT BULK SOLVENT MODEL' 
_refine.solvent_model_param_ksol                 0.400 
_refine.solvent_model_param_bsol                 40.720 
_refine.pdbx_solvent_vdw_probe_radii             1.11 
_refine.pdbx_solvent_ion_probe_radii             ? 
_refine.pdbx_solvent_shrinkage_radii             0.90 
_refine.pdbx_ls_cross_valid_method               ? 
_refine.details                                  ? 
_refine.pdbx_starting_model                      ? 
_refine.pdbx_method_to_determine_struct          'MOLECULAR REPLACEMENT' 
_refine.pdbx_isotropic_thermal_model             ? 
_refine.pdbx_stereochemistry_target_values       ML 
_refine.pdbx_stereochem_target_val_spec_case     ? 
_refine.pdbx_R_Free_selection_details            ? 
_refine.pdbx_overall_ESU_R_Free                  ? 
_refine.overall_SU_ML                            0.27 
_refine.pdbx_overall_phase_error                 23.85 
_refine.overall_SU_B                             ? 
_refine.overall_SU_R_Cruickshank_DPI             ? 
_refine.pdbx_overall_SU_R_free_Cruickshank_DPI   ? 
_refine.pdbx_overall_SU_R_Blow_DPI               ? 
_refine.pdbx_overall_SU_R_free_Blow_DPI          ? 
_refine.ls_redundancy_reflns_obs                 ? 
_refine.overall_SU_R_free                        ? 
_refine.ls_wR_factor_R_free                      ? 
_refine.ls_wR_factor_R_work                      ? 
_refine.overall_FOM_free_R_set                   ? 
_refine.overall_FOM_work_R_set                   ? 
_refine.pdbx_overall_ESU_R                       ? 
_refine.pdbx_diffrn_id                           1 
_refine.pdbx_TLS_residual_ADP_flag               ? 
# 
_refine_hist.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_refine_hist.cycle_id                         LAST 
_refine_hist.pdbx_number_atoms_protein        0 
_refine_hist.pdbx_number_atoms_nucleic_acid   6862 
_refine_hist.pdbx_number_atoms_ligand         31 
_refine_hist.number_atoms_solvent             548 
_refine_hist.number_atoms_total               7441 
_refine_hist.d_res_high                       1.853 
_refine_hist.d_res_low                        47.488 
# 
loop_
_refine_ls_restr.type 
_refine_ls_restr.dev_ideal 
_refine_ls_restr.dev_ideal_target 
_refine_ls_restr.weight 
_refine_ls_restr.number 
_refine_ls_restr.pdbx_refine_id 
_refine_ls_restr.pdbx_restraint_function 
f_bond_d           0.005  ? ? 7674  'X-RAY DIFFRACTION' ? 
f_angle_d          1.428  ? ? 11956 'X-RAY DIFFRACTION' ? 
f_dihedral_angle_d 15.465 ? ? 3858  'X-RAY DIFFRACTION' ? 
f_chiral_restr     0.066  ? ? 1610  'X-RAY DIFFRACTION' ? 
f_plane_restr      0.007  ? ? 322   'X-RAY DIFFRACTION' ? 
# 
loop_
_refine_ls_shell.pdbx_refine_id 
_refine_ls_shell.pdbx_total_number_of_bins_used 
_refine_ls_shell.d_res_high 
_refine_ls_shell.d_res_low 
_refine_ls_shell.number_reflns_R_work 
_refine_ls_shell.R_factor_R_work 
_refine_ls_shell.percent_reflns_obs 
_refine_ls_shell.R_factor_R_free 
_refine_ls_shell.R_factor_R_free_error 
_refine_ls_shell.percent_reflns_R_free 
_refine_ls_shell.number_reflns_R_free 
_refine_ls_shell.number_reflns_all 
_refine_ls_shell.R_factor_all 
_refine_ls_shell.redundancy_reflns_obs 
_refine_ls_shell.number_reflns_obs 
'X-RAY DIFFRACTION' . 1.8531 1.8785  2046 0.2754 72.00 0.3397 . . 116 . . . . 
'X-RAY DIFFRACTION' . 1.8785 1.9053  2356 0.2608 82.00 0.3181 . . 119 . . . . 
'X-RAY DIFFRACTION' . 1.9053 1.9338  2426 0.2591 84.00 0.3355 . . 117 . . . . 
'X-RAY DIFFRACTION' . 1.9338 1.9640  2458 0.2546 85.00 0.2724 . . 137 . . . . 
'X-RAY DIFFRACTION' . 1.9640 1.9962  2466 0.2428 87.00 0.2918 . . 140 . . . . 
'X-RAY DIFFRACTION' . 1.9962 2.0306  2526 0.2254 87.00 0.3048 . . 134 . . . . 
'X-RAY DIFFRACTION' . 2.0306 2.0675  2581 0.2285 90.00 0.2988 . . 134 . . . . 
'X-RAY DIFFRACTION' . 2.0675 2.1073  2566 0.2185 90.00 0.2849 . . 151 . . . . 
'X-RAY DIFFRACTION' . 2.1073 2.1503  2621 0.2091 90.00 0.2659 . . 146 . . . . 
'X-RAY DIFFRACTION' . 2.1503 2.1970  2591 0.2040 91.00 0.2385 . . 141 . . . . 
'X-RAY DIFFRACTION' . 2.1970 2.2482  2633 0.2122 91.00 0.2305 . . 136 . . . . 
'X-RAY DIFFRACTION' . 2.2482 2.3044  2585 0.2171 90.00 0.2713 . . 140 . . . . 
'X-RAY DIFFRACTION' . 2.3044 2.3667  2670 0.2197 92.00 0.2822 . . 137 . . . . 
'X-RAY DIFFRACTION' . 2.3667 2.4363  2657 0.2195 92.00 0.3167 . . 139 . . . . 
'X-RAY DIFFRACTION' . 2.4363 2.5150  2706 0.2185 93.00 0.2508 . . 124 . . . . 
'X-RAY DIFFRACTION' . 2.5150 2.6048  2693 0.2209 93.00 0.2614 . . 146 . . . . 
'X-RAY DIFFRACTION' . 2.6048 2.7091  2732 0.2262 94.00 0.2596 . . 153 . . . . 
'X-RAY DIFFRACTION' . 2.7091 2.8324  2729 0.2321 95.00 0.2651 . . 157 . . . . 
'X-RAY DIFFRACTION' . 2.8324 2.9817  2788 0.2029 96.00 0.2558 . . 142 . . . . 
'X-RAY DIFFRACTION' . 2.9817 3.1685  2808 0.1801 95.00 0.2250 . . 141 . . . . 
'X-RAY DIFFRACTION' . 3.1685 3.4131  2823 0.1661 96.00 0.1786 . . 148 . . . . 
'X-RAY DIFFRACTION' . 3.4131 3.7564  2827 0.1571 96.00 0.2083 . . 144 . . . . 
'X-RAY DIFFRACTION' . 3.7564 4.2997  2827 0.1386 95.00 0.1520 . . 156 . . . . 
'X-RAY DIFFRACTION' . 4.2997 5.4159  2839 0.1407 95.00 0.1600 . . 151 . . . . 
'X-RAY DIFFRACTION' . 5.4159 47.5036 2863 0.1676 91.00 0.1870 . . 148 . . . . 
# 
_struct.entry_id                  3PDR 
_struct.title                     'Crystal structure of manganese bound M-box RNA' 
_struct.pdbx_descriptor           'M-box Riboswitch RNA' 
_struct.pdbx_model_details        ? 
_struct.pdbx_CASP_flag            ? 
_struct.pdbx_model_type_details   ? 
# 
_struct_keywords.entry_id        3PDR 
_struct_keywords.text            'manganese-RNA complex, RNA' 
_struct_keywords.pdbx_keywords   RNA 
# 
loop_
_struct_asym.id 
_struct_asym.pdbx_blank_PDB_chainid_flag 
_struct_asym.pdbx_modified 
_struct_asym.entity_id 
_struct_asym.details 
A  N N 1 ? 
B  N N 1 ? 
C  N N 2 ? 
D  N N 2 ? 
E  N N 2 ? 
F  N N 3 ? 
G  N N 3 ? 
H  N N 3 ? 
I  N N 3 ? 
J  N N 3 ? 
K  N N 3 ? 
L  N N 3 ? 
M  N N 3 ? 
N  N N 3 ? 
O  N N 3 ? 
P  N N 3 ? 
Q  N N 3 ? 
R  N N 2 ? 
S  N N 2 ? 
T  N N 2 ? 
U  N N 3 ? 
V  N N 3 ? 
W  N N 3 ? 
X  N N 3 ? 
Y  N N 3 ? 
Z  N N 3 ? 
AA N N 3 ? 
BA N N 3 ? 
CA N N 3 ? 
DA N N 3 ? 
EA N N 3 ? 
FA N N 3 ? 
GA N N 3 ? 
HA N N 4 ? 
IA N N 4 ? 
# 
loop_
_struct_conn.id 
_struct_conn.conn_type_id 
_struct_conn.pdbx_leaving_atom_flag 
_struct_conn.pdbx_PDB_id 
_struct_conn.ptnr1_label_asym_id 
_struct_conn.ptnr1_label_comp_id 
_struct_conn.ptnr1_label_seq_id 
_struct_conn.ptnr1_label_atom_id 
_struct_conn.pdbx_ptnr1_label_alt_id 
_struct_conn.pdbx_ptnr1_PDB_ins_code 
_struct_conn.pdbx_ptnr1_standard_comp_id 
_struct_conn.ptnr1_symmetry 
_struct_conn.ptnr2_label_asym_id 
_struct_conn.ptnr2_label_comp_id 
_struct_conn.ptnr2_label_seq_id 
_struct_conn.ptnr2_label_atom_id 
_struct_conn.pdbx_ptnr2_label_alt_id 
_struct_conn.pdbx_ptnr2_PDB_ins_code 
_struct_conn.ptnr1_auth_asym_id 
_struct_conn.ptnr1_auth_comp_id 
_struct_conn.ptnr1_auth_seq_id 
_struct_conn.ptnr2_auth_asym_id 
_struct_conn.ptnr2_auth_comp_id 
_struct_conn.ptnr2_auth_seq_id 
_struct_conn.ptnr2_symmetry 
_struct_conn.pdbx_ptnr3_label_atom_id 
_struct_conn.pdbx_ptnr3_label_seq_id 
_struct_conn.pdbx_ptnr3_label_comp_id 
_struct_conn.pdbx_ptnr3_label_asym_id 
_struct_conn.pdbx_ptnr3_label_alt_id 
_struct_conn.pdbx_ptnr3_PDB_ins_code 
_struct_conn.details 
_struct_conn.pdbx_dist_value 
_struct_conn.pdbx_value_order 
metalc1   metalc ? ? B  C  22  OP2   ? ? ? 1_555 BA MN  .   MN ? ? A C  36  A MN  9   1_555 ? ? ? ? ? ? ?                    2.001 
? 
metalc2   metalc ? ? A  A  58  OP2   ? ? ? 1_555 I  MN  .   MN ? ? X A  72  X MN  4   1_555 ? ? ? ? ? ? ?                    2.023 
? 
metalc3   metalc ? ? B  A  58  OP2   ? ? ? 1_555 X  MN  .   MN ? ? A A  72  A MN  4   1_555 ? ? ? ? ? ? ?                    2.030 
? 
metalc4   metalc ? ? B  A  49  OP2   ? ? ? 1_555 Y  MN  .   MN ? ? A A  63  A MN  5   1_555 ? ? ? ? ? ? ?                    2.033 
? 
metalc5   metalc ? ? A  U  9   OP1   ? ? ? 1_555 G  MN  .   MN ? ? X U  23  X MN  177 1_555 ? ? ? ? ? ? ?                    2.048 
? 
metalc6   metalc ? ? A  A  11  OP1   ? ? ? 1_555 H  MN  .   MN ? ? X A  25  X MN  178 1_555 ? ? ? ? ? ? ?                    2.074 
? 
metalc7   metalc ? ? B  G  86  OP1   ? ? ? 1_555 V  MN  .   MN ? ? A G  100 A MN  177 1_555 ? ? ? ? ? ? ?                    2.079 
? 
metalc8   metalc ? ? A  U  10  OP2   ? ? ? 1_555 H  MN  .   MN ? ? X U  24  X MN  178 1_555 ? ? ? ? ? ? ?                    2.083 
? 
metalc9   metalc ? ? B  U  115 OP1   ? ? ? 1_555 FA MN  .   MN ? ? A U  129 A MN  13  1_555 ? ? ? ? ? ? ?                    2.091 
? 
metalc10  metalc ? ? N  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 13  X HOH 506 1_555 ? ? ? ? ? ? ?                    2.098 
? 
metalc11  metalc ? ? A  G  86  OP1   ? ? ? 1_555 G  MN  .   MN ? ? X G  100 X MN  177 1_555 ? ? ? ? ? ? ?                    2.102 
? 
metalc12  metalc ? ? B  A  66  OP2   ? ? ? 1_555 Z  MN  .   MN ? ? A A  80  A MN  6   1_555 ? ? ? ? ? ? ?                    2.102 
? 
metalc13  metalc ? ? A  C  22  OP2   ? ? ? 1_555 K  MN  .   MN ? ? X C  36  X MN  9   1_555 ? ? ? ? ? ? ?                    2.102 
? 
metalc14  metalc ? ? A  U  105 OP2   ? ? ? 1_555 J  MN  .   MN ? ? X U  119 X MN  7   1_555 ? ? ? ? ? ? ?                    2.106 
? 
metalc15  metalc ? ? B  A  11  OP1   ? ? ? 1_555 W  MN  .   MN ? ? A A  25  A MN  178 1_555 ? ? ? ? ? ? ?                    2.112 
? 
metalc16  metalc ? ? B  U  10  OP2   ? ? ? 1_555 W  MN  .   MN ? ? A U  24  A MN  178 1_555 ? ? ? ? ? ? ?                    2.119 
? 
metalc17  metalc ? ? B  A  114 OP2   ? ? ? 1_555 FA MN  .   MN ? ? A A  128 A MN  13  1_555 ? ? ? ? ? ? ?                    2.120 
? 
metalc18  metalc ? ? A  G  17  OP2   ? ? ? 1_555 O  MN  .   MN ? ? X G  31  X MN  14  1_555 ? ? ? ? ? ? ?                    2.131 
? 
metalc19  metalc ? ? CA MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 10  A HOH 483 1_555 ? ? ? ? ? ? ?                    2.137 
? 
metalc20  metalc ? ? EA MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 12  A HOH 495 1_555 ? ? ? ? ? ? ?                    2.145 
? 
metalc21  metalc ? ? B  U  9   OP1   ? ? ? 1_555 V  MN  .   MN ? ? A U  23  A MN  177 1_555 ? ? ? ? ? ? ?                    2.150 
? 
metalc22  metalc ? ? L  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 10  X HOH 501 1_555 ? ? ? ? ? ? ?                    2.151 
? 
metalc23  metalc ? ? H  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 178 X HOH 498 1_555 ? ? ? ? ? ? ?                    2.154 
? 
metalc24  metalc ? ? B  G  113 OP1   ? ? ? 1_555 FA MN  .   MN ? ? A G  127 A MN  13  1_555 ? ? ? ? ? ? ?                    2.174 
? 
metalc25  metalc ? ? L  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 10  X HOH 502 1_555 ? ? ? ? ? ? ?                    2.176 
? 
metalc26  metalc ? ? A  A  89  OP2   ? ? ? 1_555 F  MN  .   MN ? ? X A  103 X MN  176 1_555 ? ? ? ? ? ? ?                    2.178 
? 
metalc27  metalc ? ? B  G  86  OP2   ? ? ? 1_555 U  MN  .   MN ? ? A G  100 A MN  176 1_555 ? ? ? ? ? ? ?                    2.183 
? 
metalc28  metalc ? ? Y  MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 5   A HOH 492 1_555 ? ? ? ? ? ? ?                    2.183 
? 
metalc29  metalc ? ? W  MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 178 A HOH 244 1_555 ? ? ? ? ? ? ?                    2.184 
? 
metalc30  metalc ? ? Y  MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 5   A HOH 474 1_555 ? ? ? ? ? ? ?                    2.185 
? 
metalc31  metalc ? ? B  C  88  OP2   ? ? ? 1_555 U  MN  .   MN ? ? A C  102 A MN  176 1_555 ? ? ? ? ? ? ?                    2.185 
? 
metalc32  metalc ? ? B  C  21  OP2   ? ? ? 1_555 BA MN  .   MN ? ? A C  35  A MN  9   1_555 ? ? ? ? ? ? ?                    2.187 
? 
metalc33  metalc ? ? CA MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 10  A HOH 486 1_555 ? ? ? ? ? ? ?                    2.187 
? 
metalc34  metalc ? ? B  U  90  O4    ? ? ? 1_555 U  MN  .   MN ? ? A U  104 A MN  176 1_555 ? ? ? ? ? ? ?                    2.188 
? 
metalc35  metalc ? ? B  A  89  OP2   ? ? ? 1_555 U  MN  .   MN ? ? A A  103 A MN  176 1_555 ? ? ? ? ? ? ?                    2.191 
? 
metalc36  metalc ? ? B  G  31  OP2   ? ? ? 1_555 EA MN  .   MN ? ? A G  45  A MN  12  1_555 ? ? ? ? ? ? ?                    2.191 
? 
metalc37  metalc ? ? A  U  90  O4    ? ? ? 1_555 F  MN  .   MN ? ? X U  104 X MN  176 1_555 ? ? ? ? ? ? ?                    2.193 
? 
metalc38  metalc ? ? K  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 9   X HOH 504 1_555 ? ? ? ? ? ? ?                    2.196 
? 
metalc39  metalc ? ? A  G  86  OP2   ? ? ? 1_555 F  MN  .   MN ? ? X G  100 X MN  176 1_555 ? ? ? ? ? ? ?                    2.199 
? 
metalc40  metalc ? ? Q  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 180 X HOH 542 1_555 ? ? ? ? ? ? ?                    2.205 
? 
metalc41  metalc ? ? DA MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 11  A HOH 187 1_555 ? ? ? ? ? ? ?                    2.209 
? 
metalc42  metalc ? ? A  C  88  OP2   ? ? ? 1_555 F  MN  .   MN ? ? X C  102 X MN  176 1_555 ? ? ? ? ? ? ?                    2.211 
? 
metalc43  metalc ? ? X  MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 4   A HOH 332 1_555 ? ? ? ? ? ? ?                    2.213 
? 
metalc44  metalc ? ? A  C  21  OP2   ? ? ? 1_555 K  MN  .   MN ? ? X C  35  X MN  9   1_555 ? ? ? ? ? ? ?                    2.216 
? 
metalc45  metalc ? ? B  U  67  O4    ? ? ? 1_555 Z  MN  .   MN ? ? A U  81  A MN  6   1_555 ? ? ? ? ? ? ?                    2.223 
? 
metalc46  metalc ? ? A  A  16  OP2   ? ? ? 1_555 O  MN  .   MN ? ? X A  30  X MN  14  1_555 ? ? ? ? ? ? ?                    2.224 
? 
metalc47  metalc ? ? A  U  115 OP1   ? ? ? 1_555 N  MN  .   MN ? ? X U  129 X MN  13  1_555 ? ? ? ? ? ? ?                    2.225 
? 
metalc48  metalc ? ? A  A  92  OP2   ? ? ? 1_555 L  MN  .   MN ? ? X A  106 X MN  10  1_555 ? ? ? ? ? ? ?                    2.227 
? 
metalc49  metalc ? ? O  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 14  X HOH 507 1_555 ? ? ? ? ? ? ?                    2.231 
? 
metalc50  metalc ? ? H  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 178 X HOH 272 1_555 ? ? ? ? ? ? ?                    2.231 
? 
metalc51  metalc ? ? V  MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 177 A HOH 220 1_555 ? ? ? ? ? ? ?                    2.234 
? 
metalc52  metalc ? ? DA MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 11  A HOH 306 1_555 ? ? ? ? ? ? ?                    2.234 
? 
metalc53  metalc ? ? X  MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 4   A HOH 320 1_555 ? ? ? ? ? ? ?                    2.235 
? 
metalc54  metalc ? ? A  A  114 OP2   ? ? ? 1_555 N  MN  .   MN ? ? X A  128 X MN  13  1_555 ? ? ? ? ? ? ?                    2.246 
? 
metalc55  metalc ? ? O  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 14  X HOH 510 1_555 ? ? ? ? ? ? ?                    2.248 
? 
metalc56  metalc ? ? B  A  46  OP2   ? ? ? 1_555 DA MN  .   MN ? ? A A  60  A MN  11  1_555 ? ? ? ? ? ? ?                    2.249 
? 
metalc57  metalc ? ? G  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 177 X HOH 209 1_555 ? ? ? ? ? ? ?                    2.254 
? 
metalc58  metalc ? ? B  A  92  OP2   ? ? ? 1_555 CA MN  .   MN ? ? A A  106 A MN  10  1_555 ? ? ? ? ? ? ?                    2.257 
? 
metalc59  metalc ? ? A  A  32  "O2'" ? ? ? 1_555 Q  MN  .   MN ? ? X A  46  X MN  180 1_555 ? ? ? ? ? ? ?                    2.258 
? 
metalc60  metalc ? ? V  MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 177 A HOH 230 1_555 ? ? ? ? ? ? ?                    2.258 
? 
metalc61  metalc ? ? G  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 177 X HOH 327 1_555 ? ? ? ? ? ? ?                    2.259 
? 
metalc62  metalc ? ? Y  MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 5   A HOH 473 1_555 ? ? ? ? ? ? ?                    2.262 
? 
metalc63  metalc ? ? I  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 4   X HOH 299 1_555 ? ? ? ? ? ? ?                    2.269 
? 
metalc64  metalc ? ? V  MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 177 A HOH 472 1_555 ? ? ? ? ? ? ?                    2.270 
? 
metalc65  metalc ? ? B  U  105 OP2   ? ? ? 1_555 AA MN  .   MN ? ? A U  119 A MN  7   1_555 ? ? ? ? ? ? ?                    2.271 
? 
metalc66  metalc ? ? BA MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 9   A HOH 549 1_555 ? ? ? ? ? ? ?                    2.279 
? 
metalc67  metalc ? ? F  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 176 X HOH 497 1_555 ? ? ? ? ? ? ?                    2.284 
? 
metalc68  metalc ? ? Q  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 180 X HOH 545 1_555 ? ? ? ? ? ? ?                    2.288 
? 
metalc69  metalc ? ? L  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 10  X HOH 500 1_555 ? ? ? ? ? ? ?                    2.289 
? 
metalc70  metalc ? ? DA MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 11  A HOH 231 1_555 ? ? ? ? ? ? ?                    2.291 
? 
metalc71  metalc ? ? CA MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 10  A HOH 485 1_555 ? ? ? ? ? ? ?                    2.293 
? 
metalc72  metalc ? ? Z  MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 6   A HOH 487 1_555 ? ? ? ? ? ? ?                    2.294 
? 
metalc73  metalc ? ? B  A  103 OP1   ? ? ? 1_555 AA MN  .   MN ? ? A A  117 A MN  7   1_555 ? ? ? ? ? ? ?                    2.294 
? 
metalc74  metalc ? ? DA MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 11  A HOH 489 1_555 ? ? ? ? ? ? ?                    2.299 
? 
metalc75  metalc ? ? H  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 178 X HOH 247 1_555 ? ? ? ? ? ? ?                    2.303 
? 
metalc76  metalc ? ? G  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 177 X HOH 203 1_555 ? ? ? ? ? ? ?                    2.308 
? 
metalc77  metalc ? ? FA MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 13  A HOH 496 1_555 ? ? ? ? ? ? ?                    2.309 
? 
metalc78  metalc ? ? K  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 9   X HOH 523 1_555 ? ? ? ? ? ? ?                    2.311 
? 
metalc79  metalc ? ? W  MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 178 A HOH 255 1_555 ? ? ? ? ? ? ?                    2.314 
? 
metalc80  metalc ? ? O  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 14  X HOH 509 1_555 ? ? ? ? ? ? ?                    2.319 
? 
metalc81  metalc ? ? A  A  104 OP1   ? ? ? 1_555 J  MN  .   MN ? ? X A  118 X MN  7   1_555 ? ? ? ? ? ? ?                    2.319 
? 
metalc82  metalc ? ? Q  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 180 X HOH 543 1_555 ? ? ? ? ? ? ?                    2.320 
? 
metalc83  metalc ? ? Z  MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 6   A HOH 247 1_555 ? ? ? ? ? ? ?                    2.321 
? 
metalc84  metalc ? ? W  MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 178 A HOH 258 1_555 ? ? ? ? ? ? ?                    2.323 
? 
metalc85  metalc ? ? Y  MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 5   A HOH 263 1_555 ? ? ? ? ? ? ?                    2.324 
? 
metalc86  metalc ? ? A  G  113 OP1   ? ? ? 1_555 N  MN  .   MN ? ? X G  127 X MN  13  1_555 ? ? ? ? ? ? ?                    2.325 
? 
metalc87  metalc ? ? A  G  93  N7    ? ? ? 1_555 L  MN  .   MN ? ? X G  107 X MN  10  1_555 ? ? ? ? ? ? ?                    2.328 
? 
metalc88  metalc ? ? BA MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 9   A HOH 481 1_555 ? ? ? ? ? ? ?                    2.335 
? 
metalc89  metalc ? ? A  G  1   N7    ? ? ? 1_555 P  MN  .   MN ? ? X G  15  X MN  179 1_555 ? ? ? ? ? ? ?                    2.337 
? 
metalc90  metalc ? ? DA MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 11  A HOH 488 1_555 ? ? ? ? ? ? ?                    2.339 
? 
metalc91  metalc ? ? EA MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 12  A HOH 324 1_555 ? ? ? ? ? ? ?                    2.342 
? 
metalc92  metalc ? ? CA MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 10  A HOH 484 1_555 ? ? ? ? ? ? ?                    2.345 
? 
metalc93  metalc ? ? K  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 9   X HOH 524 1_555 ? ? ? ? ? ? ?                    2.350 
? 
metalc94  metalc ? ? I  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 4   X HOH 471 1_555 ? ? ? ? ? ? ?                    2.353 
? 
metalc95  metalc ? ? B  A  104 OP1   ? ? ? 1_555 AA MN  .   MN ? ? A A  118 A MN  7   1_555 ? ? ? ? ? ? ?                    2.355 
? 
metalc96  metalc ? ? L  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 10  X HOH 503 1_555 ? ? ? ? ? ? ?                    2.358 
? 
metalc97  metalc ? ? B  G  93  N7    ? ? ? 1_555 CA MN  .   MN ? ? A G  107 A MN  10  1_555 ? ? ? ? ? ? ?                    2.358 
? 
metalc98  metalc ? ? G  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 177 X HOH 316 1_555 ? ? ? ? ? ? ?                    2.369 
? 
metalc99  metalc ? ? FA MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 13  A HOH 515 1_555 ? ? ? ? ? ? ?                    2.370 
? 
metalc100 metalc ? ? O  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 14  X HOH 508 1_555 ? ? ? ? ? ? ?                    2.371 
? 
metalc101 metalc ? ? W  MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 178 A HOH 222 1_555 ? ? ? ? ? ? ?                    2.374 
? 
metalc102 metalc ? ? F  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 176 X HOH 187 1_555 ? ? ? ? ? ? ?                    2.375 
? 
metalc103 metalc ? ? H  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 178 X HOH 279 1_555 ? ? ? ? ? ? ?                    2.376 
? 
metalc104 metalc ? ? BA MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 9   A HOH 310 1_555 ? ? ? ? ? ? ?                    2.378 
? 
metalc105 metalc ? ? U  MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 176 A HOH 198 1_555 ? ? ? ? ? ? ?                    2.382 
? 
metalc106 metalc ? ? V  MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 177 A HOH 546 1_555 ? ? ? ? ? ? ?                    2.385 
? 
metalc107 metalc ? ? A  G  112 N7    ? ? ? 1_555 Q  MN  .   MN ? ? X G  126 X MN  180 1_555 ? ? ? ? ? ? ?                    2.386 
? 
metalc108 metalc ? ? B  G  1   N7    ? ? ? 1_555 GA MN  .   MN ? ? A G  15  A MN  179 1_555 ? ? ? ? ? ? ?                    2.401 
? 
metalc109 metalc ? ? U  MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 176 A HOH 195 1_555 ? ? ? ? ? ? ?                    2.403 
? 
metalc110 metalc ? ? Z  MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 6   A HOH 477 1_555 ? ? ? ? ? ? ?                    2.412 
? 
metalc111 metalc ? ? M  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 12  X HOH 526 1_555 ? ? ? ? ? ? ?                    2.433 
? 
metalc112 metalc ? ? Q  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 180 X HOH 544 1_555 ? ? ? ? ? ? ?                    2.441 
? 
metalc113 metalc ? ? K  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 9   X HOH 522 1_555 ? ? ? ? ? ? ?                    2.442 
? 
metalc114 metalc ? ? J  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 7   X HOH 547 1_555 ? ? ? ? ? ? ?                    2.447 
? 
metalc115 metalc ? ? Y  MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 5   A HOH 475 1_555 ? ? ? ? ? ? ?                    2.451 
? 
metalc116 metalc ? ? M  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 12  X HOH 525 1_555 ? ? ? ? ? ? ?                    2.456 
? 
metalc117 metalc ? ? Z  MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 6   A HOH 476 1_555 ? ? ? ? ? ? ?                    2.472 
? 
metalc118 metalc ? ? A  G  31  N7    ? ? ? 1_555 M  MN  .   MN ? ? X G  45  X MN  12  1_555 ? ? ? ? ? ? ?                    2.484 
? 
metalc119 metalc ? ? AA MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 7   A HOH 550 1_555 ? ? ? ? ? ? ?                    2.507 
? 
metalc120 metalc ? ? M  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 12  X HOH 551 1_555 ? ? ? ? ? ? ?                    2.516 
? 
metalc121 metalc ? ? BA MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 9   A HOH 482 1_555 ? ? ? ? ? ? ?                    2.518 
? 
metalc122 metalc ? ? X  MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 4   A HOH 490 1_555 ? ? ? ? ? ? ?                    2.520 
? 
metalc123 metalc ? ? P  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 179 X HOH 527 1_555 ? ? ? ? ? ? ?                    2.539 
? 
metalc124 metalc ? ? V  MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 177 A HOH 217 1_555 ? ? ? ? ? ? ?                    2.550 
? 
metalc125 metalc ? ? EA MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 12  A HOH 519 1_555 ? ? ? ? ? ? ?                    2.565 
? 
metalc126 metalc ? ? I  MN .   MN    ? ? ? 1_555 HA HOH .   O  ? ? X MN 4   X HOH 288 1_555 ? ? ? ? ? ? ?                    2.568 
? 
metalc127 metalc ? ? X  MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 4   A HOH 491 1_555 ? ? ? ? ? ? ?                    2.652 
? 
metalc128 metalc ? ? AA MN .   MN    ? ? ? 1_555 IA HOH .   O  ? ? A MN 7   A HOH 478 1_555 ? ? ? ? ? ? ?                    2.679 
? 
metalc129 metalc ? ? B  G  143 O6    ? ? ? 1_555 R  K   .   K  ? ? A G  157 A K   1   1_555 ? ? ? ? ? ? ?                    2.869 
? 
metalc130 metalc ? ? B  A  141 OP2   ? ? ? 1_555 R  K   .   K  ? ? A A  155 A K   1   1_555 ? ? ? ? ? ? ?                    2.888 
? 
metalc131 metalc ? ? B  U  53  O2    ? ? ? 1_555 S  K   .   K  ? ? A U  67  A K   2   1_555 ? ? ? ? ? ? ?                    2.900 
? 
metalc132 metalc ? ? A  A  141 OP2   ? ? ? 1_555 C  K   .   K  ? ? X A  155 X K   1   1_555 ? ? ? ? ? ? ?                    2.928 
? 
metalc133 metalc ? ? B  U  14  O4    ? ? ? 1_555 R  K   .   K  ? ? A U  28  A K   1   1_555 ? ? ? ? ? ? ?                    2.950 
? 
metalc134 metalc ? ? A  U  53  O2    ? ? ? 1_555 D  K   .   K  ? ? X U  67  X K   2   1_555 ? ? ? ? ? ? ?                    2.950 
? 
metalc135 metalc ? ? R  K  .   K     ? ? ? 1_555 IA HOH .   O  ? ? A K  1   A HOH 181 1_555 ? ? ? ? ? ? ?                    2.971 
? 
metalc136 metalc ? ? A  U  14  O4    ? ? ? 1_555 C  K   .   K  ? ? X U  28  X K   1   1_555 ? ? ? ? ? ? ?                    2.973 
? 
metalc137 metalc ? ? A  G  143 O6    ? ? ? 1_555 C  K   .   K  ? ? X G  157 X K   1   1_555 ? ? ? ? ? ? ?                    3.001 
? 
metalc138 metalc ? ? C  K  .   K     ? ? ? 1_555 HA HOH .   O  ? ? X K  1   X HOH 212 1_555 ? ? ? ? ? ? ?                    3.025 
? 
metalc139 metalc ? ? B  C  61  O2    ? ? ? 1_555 S  K   .   K  ? ? A C  75  A K   2   1_555 ? ? ? ? ? ? ?                    3.070 
? 
metalc140 metalc ? ? C  K  .   K     ? ? ? 1_555 HA HOH .   O  ? ? X K  1   X HOH 342 1_555 ? ? ? ? ? ? ?                    3.075 
? 
metalc141 metalc ? ? R  K  .   K     ? ? ? 1_555 IA HOH .   O  ? ? A K  1   A HOH 225 1_555 ? ? ? ? ? ? ?                    3.083 
? 
metalc142 metalc ? ? B  A  92  "O2'" ? ? ? 1_555 S  K   .   K  ? ? A A  106 A K   2   1_555 ? ? ? ? ? ? ?                    3.140 
? 
metalc143 metalc ? ? B  A  92  "O3'" ? ? ? 1_555 S  K   .   K  ? ? A A  106 A K   2   1_555 ? ? ? ? ? ? ?                    3.162 
? 
metalc144 metalc ? ? A  A  92  "O3'" ? ? ? 1_555 D  K   .   K  ? ? X A  106 X K   2   1_555 ? ? ? ? ? ? ?                    3.179 
? 
metalc145 metalc ? ? S  K  .   K     ? ? ? 1_555 IA HOH .   O  ? ? A K  2   A HOH 270 1_555 ? ? ? ? ? ? ?                    3.211 
? 
metalc146 metalc ? ? A  C  61  O2    ? ? ? 1_555 D  K   .   K  ? ? X C  75  X K   2   1_555 ? ? ? ? ? ? ?                    3.215 
? 
metalc147 metalc ? ? D  K  .   K     ? ? ? 1_555 HA HOH .   O  ? ? X K  2   X HOH 186 1_555 ? ? ? ? ? ? ?                    3.269 
? 
metalc148 metalc ? ? A  A  92  "O2'" ? ? ? 1_555 D  K   .   K  ? ? X A  106 X K   2   1_555 ? ? ? ? ? ? ?                    3.348 
? 
metalc149 metalc ? ? A  G  13  O6    ? ? ? 1_555 C  K   .   K  ? ? X G  27  X K   1   1_555 ? ? ? ? ? ? ?                    3.386 
? 
metalc150 metalc ? ? S  K  .   K     ? ? ? 1_555 IA HOH .   O  ? ? A K  2   A HOH 349 1_555 ? ? ? ? ? ? ?                    3.395 
? 
metalc151 metalc ? ? A  G  59  OP1   ? ? ? 1_555 E  K   .   K  ? ? X G  73  X K   3   1_555 ? ? ? ? ? ? ?                    3.478 
? 
hydrog1   hydrog ? ? A  G  1   N1    ? ? ? 1_555 A  C   160 N3 ? ? X G  15  X C   174 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog2   hydrog ? ? A  G  1   N2    ? ? ? 1_555 A  C   160 O2 ? ? X G  15  X C   174 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog3   hydrog ? ? A  G  1   O6    ? ? ? 1_555 A  C   160 N4 ? ? X G  15  X C   174 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog4   hydrog ? ? A  G  2   N1    ? ? ? 1_555 A  C   159 N3 ? ? X G  16  X C   173 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog5   hydrog ? ? A  G  2   N2    ? ? ? 1_555 A  C   159 O2 ? ? X G  16  X C   173 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog6   hydrog ? ? A  G  2   O6    ? ? ? 1_555 A  C   159 N4 ? ? X G  16  X C   173 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog7   hydrog ? ? A  G  3   N1    ? ? ? 1_555 A  C   158 N3 ? ? X G  17  X C   172 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog8   hydrog ? ? A  G  3   N2    ? ? ? 1_555 A  C   158 O2 ? ? X G  17  X C   172 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog9   hydrog ? ? A  G  3   O6    ? ? ? 1_555 A  C   158 N4 ? ? X G  17  X C   172 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog10  hydrog ? ? A  C  4   N3    ? ? ? 1_555 A  G   157 N1 ? ? X C  18  X G   171 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog11  hydrog ? ? A  C  4   N4    ? ? ? 1_555 A  G   157 O6 ? ? X C  18  X G   171 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog12  hydrog ? ? A  C  4   O2    ? ? ? 1_555 A  G   157 N2 ? ? X C  18  X G   171 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog13  hydrog ? ? A  U  5   N3    ? ? ? 1_555 A  A   156 N1 ? ? X U  19  X A   170 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog14  hydrog ? ? A  U  5   O4    ? ? ? 1_555 A  A   156 N6 ? ? X U  19  X A   170 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog15  hydrog ? ? A  U  6   N3    ? ? ? 1_555 A  A   155 N1 ? ? X U  20  X A   169 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog16  hydrog ? ? A  U  6   O4    ? ? ? 1_555 A  A   155 N6 ? ? X U  20  X A   169 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog17  hydrog ? ? A  C  7   N3    ? ? ? 1_555 A  G   154 N1 ? ? X C  21  X G   168 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog18  hydrog ? ? A  C  7   N4    ? ? ? 1_555 A  G   154 O6 ? ? X C  21  X G   168 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog19  hydrog ? ? A  C  7   O2    ? ? ? 1_555 A  G   154 N2 ? ? X C  21  X G   168 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog20  hydrog ? ? A  G  8   N2    ? ? ? 1_555 A  A   57  N3 ? ? X G  22  X A   71  1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ?     
? 
hydrog21  hydrog ? ? A  G  8   N1    ? ? ? 1_555 A  C   149 N3 ? ? X G  22  X C   163 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog22  hydrog ? ? A  G  8   N2    ? ? ? 1_555 A  C   149 O2 ? ? X G  22  X C   163 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog23  hydrog ? ? A  G  8   O6    ? ? ? 1_555 A  C   149 N4 ? ? X G  22  X C   163 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog24  hydrog ? ? A  U  9   N3    ? ? ? 1_555 A  A   148 N1 ? ? X U  23  X A   162 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog25  hydrog ? ? A  U  9   O4    ? ? ? 1_555 A  A   148 N6 ? ? X U  23  X A   162 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog26  hydrog ? ? A  U  10  N3    ? ? ? 1_555 A  A   92  N1 ? ? X U  24  X A   106 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog27  hydrog ? ? A  U  10  O4    ? ? ? 1_555 A  A   92  N6 ? ? X U  24  X A   106 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog28  hydrog ? ? A  A  11  N6    ? ? ? 1_555 A  C   146 O2 ? ? X A  25  X C   160 1_555 ? ? ? ? ? ? 'A-C MISPAIR'        ?     
? 
hydrog29  hydrog ? ? A  G  12  N1    ? ? ? 1_555 A  U   145 O2 ? ? X G  26  X U   159 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog30  hydrog ? ? A  G  12  O6    ? ? ? 1_555 A  U   145 N3 ? ? X G  26  X U   159 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog31  hydrog ? ? A  G  13  N1    ? ? ? 1_555 A  C   144 N3 ? ? X G  27  X C   158 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog32  hydrog ? ? A  G  13  N2    ? ? ? 1_555 A  C   144 O2 ? ? X G  27  X C   158 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog33  hydrog ? ? A  G  13  O6    ? ? ? 1_555 A  C   144 N4 ? ? X G  27  X C   158 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog34  hydrog ? ? A  U  14  N3    ? ? ? 1_555 A  G   143 O6 ? ? X U  28  X G   157 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog35  hydrog ? ? A  U  14  O2    ? ? ? 1_555 A  G   143 N1 ? ? X U  28  X G   157 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog36  hydrog ? ? A  G  15  N2    ? ? ? 1_555 A  A   142 N7 ? ? X G  29  X A   156 1_555 ? ? ? ? ? ? TYPE_11_PAIR         ?     
? 
hydrog37  hydrog ? ? A  G  15  N3    ? ? ? 1_555 A  A   142 N6 ? ? X G  29  X A   156 1_555 ? ? ? ? ? ? TYPE_11_PAIR         ?     
? 
hydrog38  hydrog ? ? A  A  16  N6    ? ? ? 1_555 A  A   140 N3 ? ? X A  30  X A   154 1_555 ? ? ? ? ? ? 'A-A MISPAIR'        ?     
? 
hydrog39  hydrog ? ? A  G  17  N1    ? ? ? 1_555 A  U   139 O2 ? ? X G  31  X U   153 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog40  hydrog ? ? A  G  17  O6    ? ? ? 1_555 A  U   139 N3 ? ? X G  31  X U   153 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog41  hydrog ? ? A  G  18  N1    ? ? ? 1_555 A  C   138 N3 ? ? X G  32  X C   152 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog42  hydrog ? ? A  G  18  N2    ? ? ? 1_555 A  C   138 O2 ? ? X G  32  X C   152 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog43  hydrog ? ? A  G  18  O6    ? ? ? 1_555 A  C   138 N4 ? ? X G  32  X C   152 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog44  hydrog ? ? A  C  19  N3    ? ? ? 1_555 A  G   137 N1 ? ? X C  33  X G   151 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog45  hydrog ? ? A  C  19  N4    ? ? ? 1_555 A  G   137 O6 ? ? X C  33  X G   151 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog46  hydrog ? ? A  C  19  O2    ? ? ? 1_555 A  G   137 N2 ? ? X C  33  X G   151 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog47  hydrog ? ? A  U  20  O2    ? ? ? 1_555 A  C   21  N4 ? ? X U  34  X C   35  1_555 ? ? ? ? ? ? 'U-C MISPAIR'        ?     
? 
hydrog48  hydrog ? ? A  U  20  N3    ? ? ? 1_555 A  U   136 O4 ? ? X U  34  X U   150 1_555 ? ? ? ? ? ? TYPE_16_PAIR         ?     
? 
hydrog49  hydrog ? ? A  U  20  O2    ? ? ? 1_555 A  U   136 N3 ? ? X U  34  X U   150 1_555 ? ? ? ? ? ? TYPE_16_PAIR         ?     
? 
hydrog50  hydrog ? ? A  C  21  N4    ? ? ? 1_555 A  U   136 O2 ? ? X C  35  X U   150 1_555 ? ? ? ? ? ? 'C-U MISPAIR'        ?     
? 
hydrog51  hydrog ? ? A  C  22  N3    ? ? ? 1_555 A  G   135 N1 ? ? X C  36  X G   149 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog52  hydrog ? ? A  C  22  N4    ? ? ? 1_555 A  G   135 O6 ? ? X C  36  X G   149 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog53  hydrog ? ? A  C  22  O2    ? ? ? 1_555 A  G   135 N2 ? ? X C  36  X G   149 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog54  hydrog ? ? A  U  23  N3    ? ? ? 1_555 A  A   134 N1 ? ? X U  37  X A   148 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog55  hydrog ? ? A  U  23  O4    ? ? ? 1_555 A  A   134 N6 ? ? X U  37  X A   148 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog56  hydrog ? ? A  G  24  N1    ? ? ? 1_555 A  C   133 N3 ? ? X G  38  X C   147 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog57  hydrog ? ? A  G  24  N2    ? ? ? 1_555 A  C   133 O2 ? ? X G  38  X C   147 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog58  hydrog ? ? A  G  24  O6    ? ? ? 1_555 A  C   133 N4 ? ? X G  38  X C   147 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog59  hydrog ? ? A  U  25  N3    ? ? ? 1_555 A  A   132 N1 ? ? X U  39  X A   146 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog60  hydrog ? ? A  U  25  O4    ? ? ? 1_555 A  A   132 N6 ? ? X U  39  X A   146 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog61  hydrog ? ? A  A  26  N1    ? ? ? 1_555 A  U   131 N3 ? ? X A  40  X U   145 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog62  hydrog ? ? A  A  26  N6    ? ? ? 1_555 A  U   131 O4 ? ? X A  40  X U   145 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog63  hydrog ? ? A  U  27  N3    ? ? ? 1_555 A  A   130 N1 ? ? X U  41  X A   144 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog64  hydrog ? ? A  U  27  O4    ? ? ? 1_555 A  A   130 N6 ? ? X U  41  X A   144 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog65  hydrog ? ? A  G  28  N1    ? ? ? 1_555 A  C   129 N3 ? ? X G  42  X C   143 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog66  hydrog ? ? A  G  28  N2    ? ? ? 1_555 A  C   129 O2 ? ? X G  42  X C   143 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog67  hydrog ? ? A  G  28  O6    ? ? ? 1_555 A  C   129 N4 ? ? X G  42  X C   143 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog68  hydrog ? ? A  G  29  N1    ? ? ? 1_555 A  C   128 N3 ? ? X G  43  X C   142 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog69  hydrog ? ? A  G  29  N2    ? ? ? 1_555 A  C   128 O2 ? ? X G  43  X C   142 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog70  hydrog ? ? A  G  29  O6    ? ? ? 1_555 A  C   128 N4 ? ? X G  43  X C   142 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog71  hydrog ? ? A  A  30  N1    ? ? ? 1_555 A  G   127 N1 ? ? X A  44  X G   141 1_555 ? ? ? ? ? ? TYPE_8_PAIR          ?     
? 
hydrog72  hydrog ? ? A  A  30  N6    ? ? ? 1_555 A  G   127 O6 ? ? X A  44  X G   141 1_555 ? ? ? ? ? ? TYPE_8_PAIR          ?     
? 
hydrog73  hydrog ? ? A  G  31  N2    ? ? ? 1_555 A  A   125 N1 ? ? X G  45  X A   139 1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ?     
? 
hydrog74  hydrog ? ? A  G  31  N2    ? ? ? 1_555 A  U   126 O4 ? ? X G  45  X U   140 1_555 ? ? ? ? ? ? 'G-U MISPAIR'        ?     
? 
hydrog75  hydrog ? ? A  C  35  N4    ? ? ? 1_555 A  U   111 O2 ? ? X C  49  X U   125 1_555 ? ? ? ? ? ? 'C-U MISPAIR'        ?     
? 
hydrog76  hydrog ? ? A  G  36  N1    ? ? ? 1_555 A  C   110 N3 ? ? X G  50  X C   124 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog77  hydrog ? ? A  G  36  N2    ? ? ? 1_555 A  C   110 O2 ? ? X G  50  X C   124 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog78  hydrog ? ? A  G  36  O6    ? ? ? 1_555 A  C   110 N4 ? ? X G  50  X C   124 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog79  hydrog ? ? A  C  37  N3    ? ? ? 1_555 A  G   109 N1 ? ? X C  51  X G   123 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog80  hydrog ? ? A  C  37  N4    ? ? ? 1_555 A  G   109 O6 ? ? X C  51  X G   123 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog81  hydrog ? ? A  C  37  O2    ? ? ? 1_555 A  G   109 N2 ? ? X C  51  X G   123 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog82  hydrog ? ? A  U  38  N3    ? ? ? 1_555 A  A   108 N1 ? ? X U  52  X A   122 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog83  hydrog ? ? A  U  38  O4    ? ? ? 1_555 A  A   108 N6 ? ? X U  52  X A   122 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog84  hydrog ? ? A  G  39  N1    ? ? ? 1_555 A  C   107 N3 ? ? X G  53  X C   121 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog85  hydrog ? ? A  G  39  N2    ? ? ? 1_555 A  C   107 O2 ? ? X G  53  X C   121 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog86  hydrog ? ? A  G  39  O6    ? ? ? 1_555 A  C   107 N4 ? ? X G  53  X C   121 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog87  hydrog ? ? A  C  40  N3    ? ? ? 1_555 A  G   106 N1 ? ? X C  54  X G   120 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog88  hydrog ? ? A  C  40  N4    ? ? ? 1_555 A  G   106 O6 ? ? X C  54  X G   120 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog89  hydrog ? ? A  C  40  O2    ? ? ? 1_555 A  G   106 N2 ? ? X C  54  X G   120 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog90  hydrog ? ? A  U  41  N3    ? ? ? 1_555 A  A   104 N1 ? ? X U  55  X A   118 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog91  hydrog ? ? A  U  41  O4    ? ? ? 1_555 A  A   104 N6 ? ? X U  55  X A   118 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog92  hydrog ? ? A  G  42  N1    ? ? ? 1_555 A  U   71  O2 ? ? X G  56  X U   85  1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog93  hydrog ? ? A  G  42  O6    ? ? ? 1_555 A  U   71  N3 ? ? X G  56  X U   85  1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog94  hydrog ? ? A  C  43  N3    ? ? ? 1_555 A  G   70  N1 ? ? X C  57  X G   84  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog95  hydrog ? ? A  C  43  N4    ? ? ? 1_555 A  G   70  O6 ? ? X C  57  X G   84  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog96  hydrog ? ? A  C  43  O2    ? ? ? 1_555 A  G   70  N2 ? ? X C  57  X G   84  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog97  hydrog ? ? A  C  44  N3    ? ? ? 1_555 A  G   69  N1 ? ? X C  58  X G   83  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog98  hydrog ? ? A  C  44  N4    ? ? ? 1_555 A  G   69  O6 ? ? X C  58  X G   83  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog99  hydrog ? ? A  C  44  O2    ? ? ? 1_555 A  G   69  N2 ? ? X C  58  X G   83  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog100 hydrog ? ? A  C  45  N3    ? ? ? 1_555 A  G   68  N1 ? ? X C  59  X G   82  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog101 hydrog ? ? A  C  45  N4    ? ? ? 1_555 A  G   68  O6 ? ? X C  59  X G   82  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog102 hydrog ? ? A  C  45  O2    ? ? ? 1_555 A  G   68  N2 ? ? X C  59  X G   82  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog103 hydrog ? ? A  A  46  N1    ? ? ? 1_555 A  U   67  N3 ? ? X A  60  X U   81  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog104 hydrog ? ? A  A  46  N6    ? ? ? 1_555 A  U   67  O4 ? ? X A  60  X U   81  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog105 hydrog ? ? A  A  48  N6    ? ? ? 1_555 A  C   64  O2 ? ? X A  62  X C   78  1_555 ? ? ? ? ? ? 'A-C MISPAIR'        ?     
? 
hydrog106 hydrog ? ? A  A  50  N6    ? ? ? 1_555 A  C   63  O2 ? ? X A  64  X C   77  1_555 ? ? ? ? ? ? 'A-C MISPAIR'        ?     
? 
hydrog107 hydrog ? ? A  U  51  N3    ? ? ? 1_555 A  G   62  O6 ? ? X U  65  X G   76  1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog108 hydrog ? ? A  U  51  O2    ? ? ? 1_555 A  G   62  N1 ? ? X U  65  X G   76  1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog109 hydrog ? ? A  G  52  N1    ? ? ? 1_555 A  C   61  N3 ? ? X G  66  X C   75  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog110 hydrog ? ? A  G  52  N2    ? ? ? 1_555 A  C   61  O2 ? ? X G  66  X C   75  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog111 hydrog ? ? A  G  52  O6    ? ? ? 1_555 A  C   61  N4 ? ? X G  66  X C   75  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog112 hydrog ? ? A  U  53  N3    ? ? ? 1_555 A  A   60  N1 ? ? X U  67  X A   74  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog113 hydrog ? ? A  U  53  O4    ? ? ? 1_555 A  A   60  N6 ? ? X U  67  X A   74  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog114 hydrog ? ? A  C  54  N3    ? ? ? 1_555 A  G   59  N1 ? ? X C  68  X G   73  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog115 hydrog ? ? A  C  54  N4    ? ? ? 1_555 A  G   59  O6 ? ? X C  68  X G   73  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog116 hydrog ? ? A  C  54  O2    ? ? ? 1_555 A  G   59  N2 ? ? X C  68  X G   73  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog117 hydrog ? ? A  C  55  O2    ? ? ? 1_555 A  A   58  N6 ? ? X C  69  X A   72  1_555 ? ? ? ? ? ? 'C-A MISPAIR'        ?     
? 
hydrog118 hydrog ? ? A  A  58  N1    ? ? ? 1_555 A  A   91  N6 ? ? X A  72  X A   105 1_555 ? ? ? ? ? ? TYPE_1_PAIR          ?     
? 
hydrog119 hydrog ? ? A  A  58  N6    ? ? ? 1_555 A  A   91  N1 ? ? X A  72  X A   105 1_555 ? ? ? ? ? ? TYPE_1_PAIR          ?     
? 
hydrog120 hydrog ? ? A  G  59  N2    ? ? ? 1_555 A  A   92  N3 ? ? X G  73  X A   106 1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ?     
? 
hydrog121 hydrog ? ? A  G  68  N2    ? ? ? 1_555 A  A   76  N1 ? ? X G  82  X A   90  1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ?     
? 
hydrog122 hydrog ? ? A  G  70  N2    ? ? ? 1_555 A  A   103 N3 ? ? X G  84  X A   117 1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ?     
? 
hydrog123 hydrog ? ? A  A  73  N6    ? ? ? 1_555 A  U   102 O2 ? ? X A  87  X U   116 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ?     
? 
hydrog124 hydrog ? ? A  A  73  N7    ? ? ? 1_555 A  U   102 N3 ? ? X A  87  X U   116 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ?     
? 
hydrog125 hydrog ? ? A  A  74  N3    ? ? ? 1_555 A  G   137 N2 ? ? X A  88  X G   151 1_555 ? ? ? ? ? ? 'A-G MISPAIR'        ?     
? 
hydrog126 hydrog ? ? A  G  77  N1    ? ? ? 1_555 A  U   101 O2 ? ? X G  91  X U   115 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog127 hydrog ? ? A  G  77  O6    ? ? ? 1_555 A  U   101 N3 ? ? X G  91  X U   115 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog128 hydrog ? ? A  A  78  N1    ? ? ? 1_555 A  U   100 N3 ? ? X A  92  X U   114 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog129 hydrog ? ? A  A  78  N6    ? ? ? 1_555 A  U   100 O4 ? ? X A  92  X U   114 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog130 hydrog ? ? A  A  79  N1    ? ? ? 1_555 A  U   99  N3 ? ? X A  93  X U   113 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog131 hydrog ? ? A  A  79  N6    ? ? ? 1_555 A  U   99  O4 ? ? X A  93  X U   113 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog132 hydrog ? ? A  A  80  N1    ? ? ? 1_555 A  U   98  N3 ? ? X A  94  X U   112 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog133 hydrog ? ? A  A  80  N6    ? ? ? 1_555 A  U   98  O4 ? ? X A  94  X U   112 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog134 hydrog ? ? A  U  81  N3    ? ? ? 1_555 A  A   97  N1 ? ? X U  95  X A   111 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog135 hydrog ? ? A  U  81  O4    ? ? ? 1_555 A  A   97  N6 ? ? X U  95  X A   111 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog136 hydrog ? ? A  C  82  N3    ? ? ? 1_555 A  G   96  N1 ? ? X C  96  X G   110 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog137 hydrog ? ? A  C  82  N4    ? ? ? 1_555 A  G   96  O6 ? ? X C  96  X G   110 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog138 hydrog ? ? A  C  82  O2    ? ? ? 1_555 A  G   96  N2 ? ? X C  96  X G   110 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog139 hydrog ? ? A  A  83  N1    ? ? ? 1_555 A  U   95  N3 ? ? X A  97  X U   109 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog140 hydrog ? ? A  A  83  N6    ? ? ? 1_555 A  U   95  O4 ? ? X A  97  X U   109 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog141 hydrog ? ? A  U  84  N3    ? ? ? 1_555 A  G   94  O6 ? ? X U  98  X G   108 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog142 hydrog ? ? A  U  84  O2    ? ? ? 1_555 A  G   94  N1 ? ? X U  98  X G   108 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog143 hydrog ? ? A  C  85  N3    ? ? ? 1_555 A  G   93  N1 ? ? X C  99  X G   107 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog144 hydrog ? ? A  C  85  N4    ? ? ? 1_555 A  G   93  O6 ? ? X C  99  X G   107 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog145 hydrog ? ? A  C  85  O2    ? ? ? 1_555 A  G   93  N2 ? ? X C  99  X G   107 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog146 hydrog ? ? A  G  86  N2    ? ? ? 1_555 A  A   92  N7 ? ? X G  100 X A   106 1_555 ? ? ? ? ? ? TYPE_11_PAIR         ?     
? 
hydrog147 hydrog ? ? A  G  86  N3    ? ? ? 1_555 A  A   92  N6 ? ? X G  100 X A   106 1_555 ? ? ? ? ? ? TYPE_11_PAIR         ?     
? 
hydrog148 hydrog ? ? A  A  87  N6    ? ? ? 1_555 A  U   153 O4 ? ? X A  101 X U   167 1_555 ? ? ? ? ? ? HOOGSTEEN            ?     
? 
hydrog149 hydrog ? ? A  A  87  N7    ? ? ? 1_555 A  U   153 N3 ? ? X A  101 X U   167 1_555 ? ? ? ? ? ? HOOGSTEEN            ?     
? 
hydrog150 hydrog ? ? A  A  89  N6    ? ? ? 1_555 A  U   153 O2 ? ? X A  103 X U   167 1_555 ? ? ? ? ? ? 'A-U PAIR'           ?     
? 
hydrog151 hydrog ? ? A  G  93  N2    ? ? ? 1_555 A  A   141 N3 ? ? X G  107 X A   155 1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ?     
? 
hydrog152 hydrog ? ? A  G  112 N1    ? ? ? 1_555 A  C   123 N3 ? ? X G  126 X C   137 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog153 hydrog ? ? A  G  112 N2    ? ? ? 1_555 A  C   123 O2 ? ? X G  126 X C   137 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog154 hydrog ? ? A  G  112 O6    ? ? ? 1_555 A  C   123 N4 ? ? X G  126 X C   137 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog155 hydrog ? ? A  G  113 N1    ? ? ? 1_555 A  C   122 N3 ? ? X G  127 X C   136 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog156 hydrog ? ? A  G  113 N2    ? ? ? 1_555 A  C   122 O2 ? ? X G  127 X C   136 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog157 hydrog ? ? A  G  113 O6    ? ? ? 1_555 A  C   122 N4 ? ? X G  127 X C   136 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog158 hydrog ? ? A  G  150 N2    ? ? ? 1_555 A  A   151 N7 ? ? X G  164 X A   165 1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ?     
? 
hydrog159 hydrog ? ? B  G  1   N1    ? ? ? 1_555 B  C   160 N3 ? ? A G  15  A C   174 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog160 hydrog ? ? B  G  1   N2    ? ? ? 1_555 B  C   160 O2 ? ? A G  15  A C   174 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog161 hydrog ? ? B  G  1   O6    ? ? ? 1_555 B  C   160 N4 ? ? A G  15  A C   174 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog162 hydrog ? ? B  G  2   N1    ? ? ? 1_555 B  C   159 N3 ? ? A G  16  A C   173 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog163 hydrog ? ? B  G  2   N2    ? ? ? 1_555 B  C   159 O2 ? ? A G  16  A C   173 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog164 hydrog ? ? B  G  2   O6    ? ? ? 1_555 B  C   159 N4 ? ? A G  16  A C   173 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog165 hydrog ? ? B  G  3   N1    ? ? ? 1_555 B  C   158 N3 ? ? A G  17  A C   172 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog166 hydrog ? ? B  G  3   N2    ? ? ? 1_555 B  C   158 O2 ? ? A G  17  A C   172 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog167 hydrog ? ? B  G  3   O6    ? ? ? 1_555 B  C   158 N4 ? ? A G  17  A C   172 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog168 hydrog ? ? B  C  4   N3    ? ? ? 1_555 B  G   157 N1 ? ? A C  18  A G   171 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog169 hydrog ? ? B  C  4   N4    ? ? ? 1_555 B  G   157 O6 ? ? A C  18  A G   171 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog170 hydrog ? ? B  C  4   O2    ? ? ? 1_555 B  G   157 N2 ? ? A C  18  A G   171 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog171 hydrog ? ? B  U  5   N3    ? ? ? 1_555 B  A   156 N1 ? ? A U  19  A A   170 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog172 hydrog ? ? B  U  5   O4    ? ? ? 1_555 B  A   156 N6 ? ? A U  19  A A   170 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog173 hydrog ? ? B  U  6   N3    ? ? ? 1_555 B  A   155 N1 ? ? A U  20  A A   169 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog174 hydrog ? ? B  U  6   O4    ? ? ? 1_555 B  A   155 N6 ? ? A U  20  A A   169 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog175 hydrog ? ? B  C  7   N3    ? ? ? 1_555 B  G   154 N1 ? ? A C  21  A G   168 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog176 hydrog ? ? B  C  7   N4    ? ? ? 1_555 B  G   154 O6 ? ? A C  21  A G   168 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog177 hydrog ? ? B  C  7   O2    ? ? ? 1_555 B  G   154 N2 ? ? A C  21  A G   168 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog178 hydrog ? ? B  G  8   N2    ? ? ? 1_555 B  A   57  N3 ? ? A G  22  A A   71  1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ?     
? 
hydrog179 hydrog ? ? B  G  8   N1    ? ? ? 1_555 B  C   149 N3 ? ? A G  22  A C   163 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog180 hydrog ? ? B  G  8   N2    ? ? ? 1_555 B  C   149 O2 ? ? A G  22  A C   163 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog181 hydrog ? ? B  G  8   O6    ? ? ? 1_555 B  C   149 N4 ? ? A G  22  A C   163 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog182 hydrog ? ? B  U  9   N3    ? ? ? 1_555 B  A   148 N1 ? ? A U  23  A A   162 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog183 hydrog ? ? B  U  9   O4    ? ? ? 1_555 B  A   148 N6 ? ? A U  23  A A   162 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog184 hydrog ? ? B  U  10  N3    ? ? ? 1_555 B  A   92  N1 ? ? A U  24  A A   106 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog185 hydrog ? ? B  U  10  O4    ? ? ? 1_555 B  A   92  N6 ? ? A U  24  A A   106 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog186 hydrog ? ? B  A  11  N6    ? ? ? 1_555 B  C   146 O2 ? ? A A  25  A C   160 1_555 ? ? ? ? ? ? 'A-C MISPAIR'        ?     
? 
hydrog187 hydrog ? ? B  G  12  N1    ? ? ? 1_555 B  U   145 O2 ? ? A G  26  A U   159 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog188 hydrog ? ? B  G  12  O6    ? ? ? 1_555 B  U   145 N3 ? ? A G  26  A U   159 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog189 hydrog ? ? B  G  13  N1    ? ? ? 1_555 B  C   144 N3 ? ? A G  27  A C   158 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog190 hydrog ? ? B  G  13  N2    ? ? ? 1_555 B  C   144 O2 ? ? A G  27  A C   158 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog191 hydrog ? ? B  G  13  O6    ? ? ? 1_555 B  C   144 N4 ? ? A G  27  A C   158 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog192 hydrog ? ? B  U  14  N3    ? ? ? 1_555 B  G   143 O6 ? ? A U  28  A G   157 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog193 hydrog ? ? B  U  14  O2    ? ? ? 1_555 B  G   143 N1 ? ? A U  28  A G   157 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog194 hydrog ? ? B  G  15  N2    ? ? ? 1_555 B  A   142 N7 ? ? A G  29  A A   156 1_555 ? ? ? ? ? ? TYPE_11_PAIR         ?     
? 
hydrog195 hydrog ? ? B  G  15  N3    ? ? ? 1_555 B  A   142 N6 ? ? A G  29  A A   156 1_555 ? ? ? ? ? ? TYPE_11_PAIR         ?     
? 
hydrog196 hydrog ? ? B  A  16  N6    ? ? ? 1_555 B  A   140 N3 ? ? A A  30  A A   154 1_555 ? ? ? ? ? ? 'A-A MISPAIR'        ?     
? 
hydrog197 hydrog ? ? B  G  17  N1    ? ? ? 1_555 B  U   139 O2 ? ? A G  31  A U   153 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog198 hydrog ? ? B  G  17  O6    ? ? ? 1_555 B  U   139 N3 ? ? A G  31  A U   153 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog199 hydrog ? ? B  G  18  N1    ? ? ? 1_555 B  C   138 N3 ? ? A G  32  A C   152 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog200 hydrog ? ? B  G  18  N2    ? ? ? 1_555 B  C   138 O2 ? ? A G  32  A C   152 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog201 hydrog ? ? B  G  18  O6    ? ? ? 1_555 B  C   138 N4 ? ? A G  32  A C   152 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog202 hydrog ? ? B  C  19  N3    ? ? ? 1_555 B  G   137 N1 ? ? A C  33  A G   151 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog203 hydrog ? ? B  C  19  N4    ? ? ? 1_555 B  G   137 O6 ? ? A C  33  A G   151 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog204 hydrog ? ? B  C  19  O2    ? ? ? 1_555 B  G   137 N2 ? ? A C  33  A G   151 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog205 hydrog ? ? B  U  20  O2    ? ? ? 1_555 B  C   21  N4 ? ? A U  34  A C   35  1_555 ? ? ? ? ? ? 'U-C MISPAIR'        ?     
? 
hydrog206 hydrog ? ? B  U  20  N3    ? ? ? 1_555 B  U   136 O4 ? ? A U  34  A U   150 1_555 ? ? ? ? ? ? TYPE_16_PAIR         ?     
? 
hydrog207 hydrog ? ? B  U  20  O2    ? ? ? 1_555 B  U   136 N3 ? ? A U  34  A U   150 1_555 ? ? ? ? ? ? TYPE_16_PAIR         ?     
? 
hydrog208 hydrog ? ? B  C  21  N4    ? ? ? 1_555 B  U   136 O2 ? ? A C  35  A U   150 1_555 ? ? ? ? ? ? 'C-U MISPAIR'        ?     
? 
hydrog209 hydrog ? ? B  C  22  N3    ? ? ? 1_555 B  G   135 N1 ? ? A C  36  A G   149 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog210 hydrog ? ? B  C  22  N4    ? ? ? 1_555 B  G   135 O6 ? ? A C  36  A G   149 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog211 hydrog ? ? B  C  22  O2    ? ? ? 1_555 B  G   135 N2 ? ? A C  36  A G   149 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog212 hydrog ? ? B  U  23  N3    ? ? ? 1_555 B  A   134 N1 ? ? A U  37  A A   148 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog213 hydrog ? ? B  U  23  O4    ? ? ? 1_555 B  A   134 N6 ? ? A U  37  A A   148 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog214 hydrog ? ? B  G  24  N1    ? ? ? 1_555 B  C   133 N3 ? ? A G  38  A C   147 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog215 hydrog ? ? B  G  24  N2    ? ? ? 1_555 B  C   133 O2 ? ? A G  38  A C   147 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog216 hydrog ? ? B  G  24  O6    ? ? ? 1_555 B  C   133 N4 ? ? A G  38  A C   147 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog217 hydrog ? ? B  U  25  N3    ? ? ? 1_555 B  A   132 N1 ? ? A U  39  A A   146 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog218 hydrog ? ? B  U  25  O4    ? ? ? 1_555 B  A   132 N6 ? ? A U  39  A A   146 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog219 hydrog ? ? B  A  26  N1    ? ? ? 1_555 B  U   131 N3 ? ? A A  40  A U   145 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog220 hydrog ? ? B  A  26  N6    ? ? ? 1_555 B  U   131 O4 ? ? A A  40  A U   145 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog221 hydrog ? ? B  U  27  N3    ? ? ? 1_555 B  A   130 N1 ? ? A U  41  A A   144 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog222 hydrog ? ? B  U  27  O4    ? ? ? 1_555 B  A   130 N6 ? ? A U  41  A A   144 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog223 hydrog ? ? B  G  28  N1    ? ? ? 1_555 B  C   129 N3 ? ? A G  42  A C   143 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog224 hydrog ? ? B  G  28  N2    ? ? ? 1_555 B  C   129 O2 ? ? A G  42  A C   143 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog225 hydrog ? ? B  G  28  O6    ? ? ? 1_555 B  C   129 N4 ? ? A G  42  A C   143 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog226 hydrog ? ? B  G  29  N1    ? ? ? 1_555 B  C   128 N3 ? ? A G  43  A C   142 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog227 hydrog ? ? B  G  29  N2    ? ? ? 1_555 B  C   128 O2 ? ? A G  43  A C   142 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog228 hydrog ? ? B  G  29  O6    ? ? ? 1_555 B  C   128 N4 ? ? A G  43  A C   142 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog229 hydrog ? ? B  A  30  N1    ? ? ? 1_555 B  G   127 N1 ? ? A A  44  A G   141 1_555 ? ? ? ? ? ? TYPE_8_PAIR          ?     
? 
hydrog230 hydrog ? ? B  A  30  N6    ? ? ? 1_555 B  G   127 O6 ? ? A A  44  A G   141 1_555 ? ? ? ? ? ? TYPE_8_PAIR          ?     
? 
hydrog231 hydrog ? ? B  G  31  N2    ? ? ? 1_555 B  A   34  N1 ? ? A G  45  A A   48  1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ?     
? 
hydrog232 hydrog ? ? B  G  31  N2    ? ? ? 1_555 B  U   126 O4 ? ? A G  45  A U   140 1_555 ? ? ? ? ? ? 'G-U MISPAIR'        ?     
? 
hydrog233 hydrog ? ? B  A  32  N6    ? ? ? 1_555 B  U   124 O2 ? ? A A  46  A U   138 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ?     
? 
hydrog234 hydrog ? ? B  A  32  N7    ? ? ? 1_555 B  U   124 N3 ? ? A A  46  A U   138 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ?     
? 
hydrog235 hydrog ? ? B  A  32  N1    ? ? ? 1_555 B  A   125 N6 ? ? A A  46  A A   139 1_555 ? ? ? ? ? ? TYPE_5_PAIR          ?     
? 
hydrog236 hydrog ? ? B  A  32  N6    ? ? ? 1_555 B  A   125 N7 ? ? A A  46  A A   139 1_555 ? ? ? ? ? ? TYPE_5_PAIR          ?     
? 
hydrog237 hydrog ? ? B  A  34  N6    ? ? ? 1_555 B  U   111 O2 ? ? A A  48  A U   125 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ?     
? 
hydrog238 hydrog ? ? B  A  34  N7    ? ? ? 1_555 B  U   111 N3 ? ? A A  48  A U   125 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ?     
? 
hydrog239 hydrog ? ? B  A  34  N6    ? ? ? 1_555 B  U   126 O4 ? ? A A  48  A U   140 1_555 ? ? ? ? ? ? 'A-U PAIR'           ?     
? 
hydrog240 hydrog ? ? B  G  36  N1    ? ? ? 1_555 B  C   110 N3 ? ? A G  50  A C   124 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog241 hydrog ? ? B  G  36  N2    ? ? ? 1_555 B  C   110 O2 ? ? A G  50  A C   124 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog242 hydrog ? ? B  G  36  O6    ? ? ? 1_555 B  C   110 N4 ? ? A G  50  A C   124 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog243 hydrog ? ? B  C  37  N3    ? ? ? 1_555 B  G   109 N1 ? ? A C  51  A G   123 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog244 hydrog ? ? B  C  37  N4    ? ? ? 1_555 B  G   109 O6 ? ? A C  51  A G   123 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog245 hydrog ? ? B  C  37  O2    ? ? ? 1_555 B  G   109 N2 ? ? A C  51  A G   123 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog246 hydrog ? ? B  U  38  N3    ? ? ? 1_555 B  A   108 N1 ? ? A U  52  A A   122 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog247 hydrog ? ? B  U  38  O4    ? ? ? 1_555 B  A   108 N6 ? ? A U  52  A A   122 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog248 hydrog ? ? B  G  39  N1    ? ? ? 1_555 B  C   107 N3 ? ? A G  53  A C   121 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog249 hydrog ? ? B  G  39  N2    ? ? ? 1_555 B  C   107 O2 ? ? A G  53  A C   121 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog250 hydrog ? ? B  G  39  O6    ? ? ? 1_555 B  C   107 N4 ? ? A G  53  A C   121 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog251 hydrog ? ? B  C  40  N3    ? ? ? 1_555 B  G   106 N1 ? ? A C  54  A G   120 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog252 hydrog ? ? B  C  40  N4    ? ? ? 1_555 B  G   106 O6 ? ? A C  54  A G   120 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog253 hydrog ? ? B  C  40  O2    ? ? ? 1_555 B  G   106 N2 ? ? A C  54  A G   120 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog254 hydrog ? ? B  U  41  N3    ? ? ? 1_555 B  A   104 N1 ? ? A U  55  A A   118 1_555 ? ? ? ? ? ? 'U-A PAIR'           ?     
? 
hydrog255 hydrog ? ? B  G  42  N1    ? ? ? 1_555 B  U   71  O2 ? ? A G  56  A U   85  1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog256 hydrog ? ? B  G  42  O6    ? ? ? 1_555 B  U   71  N3 ? ? A G  56  A U   85  1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog257 hydrog ? ? B  C  43  N3    ? ? ? 1_555 B  G   70  N1 ? ? A C  57  A G   84  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog258 hydrog ? ? B  C  43  N4    ? ? ? 1_555 B  G   70  O6 ? ? A C  57  A G   84  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog259 hydrog ? ? B  C  43  O2    ? ? ? 1_555 B  G   70  N2 ? ? A C  57  A G   84  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog260 hydrog ? ? B  C  44  N3    ? ? ? 1_555 B  G   69  N1 ? ? A C  58  A G   83  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog261 hydrog ? ? B  C  44  N4    ? ? ? 1_555 B  G   69  O6 ? ? A C  58  A G   83  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog262 hydrog ? ? B  C  44  O2    ? ? ? 1_555 B  G   69  N2 ? ? A C  58  A G   83  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog263 hydrog ? ? B  C  45  N3    ? ? ? 1_555 B  G   68  N1 ? ? A C  59  A G   82  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog264 hydrog ? ? B  C  45  N4    ? ? ? 1_555 B  G   68  O6 ? ? A C  59  A G   82  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog265 hydrog ? ? B  C  45  O2    ? ? ? 1_555 B  G   68  N2 ? ? A C  59  A G   82  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog266 hydrog ? ? B  A  46  N1    ? ? ? 1_555 B  U   67  N3 ? ? A A  60  A U   81  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog267 hydrog ? ? B  A  46  N6    ? ? ? 1_555 B  U   67  O4 ? ? A A  60  A U   81  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog268 hydrog ? ? B  A  47  N3    ? ? ? 1_555 B  A   66  N6 ? ? A A  61  A A   80  1_555 ? ? ? ? ? ? 'A-A MISPAIR'        ?     
? 
hydrog269 hydrog ? ? B  A  50  N6    ? ? ? 1_555 B  C   63  O2 ? ? A A  64  A C   77  1_555 ? ? ? ? ? ? 'A-C MISPAIR'        ?     
? 
hydrog270 hydrog ? ? B  U  51  O2    ? ? ? 1_555 B  G   62  N2 ? ? A U  65  A G   76  1_555 ? ? ? ? ? ? 'U-G MISPAIR'        ?     
? 
hydrog271 hydrog ? ? B  G  52  N1    ? ? ? 1_555 B  C   61  N3 ? ? A G  66  A C   75  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog272 hydrog ? ? B  G  52  N2    ? ? ? 1_555 B  C   61  O2 ? ? A G  66  A C   75  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog273 hydrog ? ? B  G  52  O6    ? ? ? 1_555 B  C   61  N4 ? ? A G  66  A C   75  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog274 hydrog ? ? B  U  53  N3    ? ? ? 1_555 B  A   60  N1 ? ? A U  67  A A   74  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog275 hydrog ? ? B  U  53  O4    ? ? ? 1_555 B  A   60  N6 ? ? A U  67  A A   74  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog276 hydrog ? ? B  C  54  N3    ? ? ? 1_555 B  G   59  N1 ? ? A C  68  A G   73  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog277 hydrog ? ? B  C  54  N4    ? ? ? 1_555 B  G   59  O6 ? ? A C  68  A G   73  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog278 hydrog ? ? B  C  54  O2    ? ? ? 1_555 B  G   59  N2 ? ? A C  68  A G   73  1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog279 hydrog ? ? B  C  55  O2    ? ? ? 1_555 B  A   58  N6 ? ? A C  69  A A   72  1_555 ? ? ? ? ? ? 'C-A MISPAIR'        ?     
? 
hydrog280 hydrog ? ? B  A  58  N1    ? ? ? 1_555 B  A   91  N6 ? ? A A  72  A A   105 1_555 ? ? ? ? ? ? TYPE_1_PAIR          ?     
? 
hydrog281 hydrog ? ? B  A  58  N6    ? ? ? 1_555 B  A   91  N1 ? ? A A  72  A A   105 1_555 ? ? ? ? ? ? TYPE_1_PAIR          ?     
? 
hydrog282 hydrog ? ? B  G  59  N2    ? ? ? 1_555 B  A   92  N3 ? ? A G  73  A A   106 1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ?     
? 
hydrog283 hydrog ? ? B  G  68  N2    ? ? ? 1_555 B  A   76  N1 ? ? A G  82  A A   90  1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ?     
? 
hydrog284 hydrog ? ? B  G  70  N2    ? ? ? 1_555 B  A   103 N3 ? ? A G  84  A A   117 1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ?     
? 
hydrog285 hydrog ? ? B  A  73  N6    ? ? ? 1_555 B  U   102 O2 ? ? A A  87  A U   116 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ?     
? 
hydrog286 hydrog ? ? B  A  73  N7    ? ? ? 1_555 B  U   102 N3 ? ? A A  87  A U   116 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ?     
? 
hydrog287 hydrog ? ? B  A  74  N3    ? ? ? 1_555 B  G   137 N2 ? ? A A  88  A G   151 1_555 ? ? ? ? ? ? 'A-G MISPAIR'        ?     
? 
hydrog288 hydrog ? ? B  G  77  N1    ? ? ? 1_555 B  U   101 O2 ? ? A G  91  A U   115 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog289 hydrog ? ? B  G  77  O6    ? ? ? 1_555 B  U   101 N3 ? ? A G  91  A U   115 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog290 hydrog ? ? B  A  78  N1    ? ? ? 1_555 B  U   100 N3 ? ? A A  92  A U   114 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog291 hydrog ? ? B  A  78  N6    ? ? ? 1_555 B  U   100 O4 ? ? A A  92  A U   114 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog292 hydrog ? ? B  A  79  N1    ? ? ? 1_555 B  U   99  N3 ? ? A A  93  A U   113 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog293 hydrog ? ? B  A  79  N6    ? ? ? 1_555 B  U   99  O4 ? ? A A  93  A U   113 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog294 hydrog ? ? B  A  80  N1    ? ? ? 1_555 B  U   98  N3 ? ? A A  94  A U   112 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog295 hydrog ? ? B  A  80  N6    ? ? ? 1_555 B  U   98  O4 ? ? A A  94  A U   112 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog296 hydrog ? ? B  U  81  N3    ? ? ? 1_555 B  A   97  N1 ? ? A U  95  A A   111 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog297 hydrog ? ? B  U  81  O4    ? ? ? 1_555 B  A   97  N6 ? ? A U  95  A A   111 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog298 hydrog ? ? B  C  82  N3    ? ? ? 1_555 B  G   96  N1 ? ? A C  96  A G   110 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog299 hydrog ? ? B  C  82  N4    ? ? ? 1_555 B  G   96  O6 ? ? A C  96  A G   110 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog300 hydrog ? ? B  C  82  O2    ? ? ? 1_555 B  G   96  N2 ? ? A C  96  A G   110 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog301 hydrog ? ? B  A  83  N1    ? ? ? 1_555 B  U   95  N3 ? ? A A  97  A U   109 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog302 hydrog ? ? B  A  83  N6    ? ? ? 1_555 B  U   95  O4 ? ? A A  97  A U   109 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog303 hydrog ? ? B  U  84  N3    ? ? ? 1_555 B  G   94  O6 ? ? A U  98  A G   108 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog304 hydrog ? ? B  U  84  O2    ? ? ? 1_555 B  G   94  N1 ? ? A U  98  A G   108 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     
? 
hydrog305 hydrog ? ? B  C  85  N3    ? ? ? 1_555 B  G   93  N1 ? ? A C  99  A G   107 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog306 hydrog ? ? B  C  85  N4    ? ? ? 1_555 B  G   93  O6 ? ? A C  99  A G   107 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog307 hydrog ? ? B  C  85  O2    ? ? ? 1_555 B  G   93  N2 ? ? A C  99  A G   107 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog308 hydrog ? ? B  G  86  N2    ? ? ? 1_555 B  A   92  N7 ? ? A G  100 A A   106 1_555 ? ? ? ? ? ? TYPE_11_PAIR         ?     
? 
hydrog309 hydrog ? ? B  G  86  N3    ? ? ? 1_555 B  A   92  N6 ? ? A G  100 A A   106 1_555 ? ? ? ? ? ? TYPE_11_PAIR         ?     
? 
hydrog310 hydrog ? ? B  A  87  N6    ? ? ? 1_555 B  U   153 O4 ? ? A A  101 A U   167 1_555 ? ? ? ? ? ? HOOGSTEEN            ?     
? 
hydrog311 hydrog ? ? B  A  87  N7    ? ? ? 1_555 B  U   153 N3 ? ? A A  101 A U   167 1_555 ? ? ? ? ? ? HOOGSTEEN            ?     
? 
hydrog312 hydrog ? ? B  A  89  N6    ? ? ? 1_555 B  U   153 O2 ? ? A A  103 A U   167 1_555 ? ? ? ? ? ? 'A-U PAIR'           ?     
? 
hydrog313 hydrog ? ? B  G  93  N2    ? ? ? 1_555 B  A   141 N3 ? ? A G  107 A A   155 1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ?     
? 
hydrog314 hydrog ? ? B  U  111 O2    ? ? ? 1_555 B  A   125 N6 ? ? A U  125 A A   139 1_555 ? ? ? ? ? ? 'U-A PAIR'           ?     
? 
hydrog315 hydrog ? ? B  G  112 N1    ? ? ? 1_555 B  C   123 N3 ? ? A G  126 A C   137 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog316 hydrog ? ? B  G  112 N2    ? ? ? 1_555 B  C   123 O2 ? ? A G  126 A C   137 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog317 hydrog ? ? B  G  112 O6    ? ? ? 1_555 B  C   123 N4 ? ? A G  126 A C   137 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog318 hydrog ? ? B  G  113 N1    ? ? ? 1_555 B  C   122 N3 ? ? A G  127 A C   136 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog319 hydrog ? ? B  G  113 N2    ? ? ? 1_555 B  C   122 O2 ? ? A G  127 A C   136 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog320 hydrog ? ? B  G  113 O6    ? ? ? 1_555 B  C   122 N4 ? ? A G  127 A C   136 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     
? 
hydrog321 hydrog ? ? B  G  150 N2    ? ? ? 1_555 B  A   151 N7 ? ? A G  164 A A   165 1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ?     
? 
# 
loop_
_struct_conn_type.id 
_struct_conn_type.criteria 
_struct_conn_type.reference 
metalc ? ? 
hydrog ? ? 
# 
loop_
_struct_site.id 
_struct_site.pdbx_evidence_code 
_struct_site.pdbx_auth_asym_id 
_struct_site.pdbx_auth_comp_id 
_struct_site.pdbx_auth_seq_id 
_struct_site.pdbx_auth_ins_code 
_struct_site.pdbx_num_residues 
_struct_site.details 
AC1 Software ? ? ? ? 7 'BINDING SITE FOR RESIDUE K X 1'    
AC2 Software ? ? ? ? 3 'BINDING SITE FOR RESIDUE K X 2'    
AC3 Software ? ? ? ? 1 'BINDING SITE FOR RESIDUE K X 3'    
AC4 Software ? ? ? ? 6 'BINDING SITE FOR RESIDUE MN X 176' 
AC5 Software ? ? ? ? 7 'BINDING SITE FOR RESIDUE MN X 177' 
AC6 Software ? ? ? ? 6 'BINDING SITE FOR RESIDUE MN X 178' 
AC7 Software ? ? ? ? 4 'BINDING SITE FOR RESIDUE MN X 4'   
AC8 Software ? ? ? ? 4 'BINDING SITE FOR RESIDUE MN X 7'   
AC9 Software ? ? ? ? 6 'BINDING SITE FOR RESIDUE MN X 9'   
BC1 Software ? ? ? ? 6 'BINDING SITE FOR RESIDUE MN X 10'  
BC2 Software ? ? ? ? 4 'BINDING SITE FOR RESIDUE MN X 12'  
BC3 Software ? ? ? ? 5 'BINDING SITE FOR RESIDUE MN X 13'  
BC4 Software ? ? ? ? 6 'BINDING SITE FOR RESIDUE MN X 14'  
BC5 Software ? ? ? ? 2 'BINDING SITE FOR RESIDUE MN X 179' 
BC6 Software ? ? ? ? 6 'BINDING SITE FOR RESIDUE MN X 180' 
BC7 Software ? ? ? ? 8 'BINDING SITE FOR RESIDUE K A 1'    
BC8 Software ? ? ? ? 3 'BINDING SITE FOR RESIDUE K A 2'    
BC9 Software ? ? ? ? 6 'BINDING SITE FOR RESIDUE MN A 176' 
CC1 Software ? ? ? ? 8 'BINDING SITE FOR RESIDUE MN A 177' 
CC2 Software ? ? ? ? 6 'BINDING SITE FOR RESIDUE MN A 178' 
CC3 Software ? ? ? ? 5 'BINDING SITE FOR RESIDUE MN A 4'   
CC4 Software ? ? ? ? 6 'BINDING SITE FOR RESIDUE MN A 5'   
CC5 Software ? ? ? ? 6 'BINDING SITE FOR RESIDUE MN A 6'   
CC6 Software ? ? ? ? 6 'BINDING SITE FOR RESIDUE MN A 7'   
CC7 Software ? ? ? ? 6 'BINDING SITE FOR RESIDUE MN A 9'   
CC8 Software ? ? ? ? 6 'BINDING SITE FOR RESIDUE MN A 10'  
CC9 Software ? ? ? ? 6 'BINDING SITE FOR RESIDUE MN A 11'  
DC1 Software ? ? ? ? 5 'BINDING SITE FOR RESIDUE MN A 12'  
DC2 Software ? ? ? ? 6 'BINDING SITE FOR RESIDUE MN A 13'  
DC3 Software ? ? ? ? 1 'BINDING SITE FOR RESIDUE MN A 179' 
# 
loop_
_struct_site_gen.id 
_struct_site_gen.site_id 
_struct_site_gen.pdbx_num_res 
_struct_site_gen.label_comp_id 
_struct_site_gen.label_asym_id 
_struct_site_gen.label_seq_id 
_struct_site_gen.pdbx_auth_ins_code 
_struct_site_gen.auth_comp_id 
_struct_site_gen.auth_asym_id 
_struct_site_gen.auth_seq_id 
_struct_site_gen.label_atom_id 
_struct_site_gen.label_alt_id 
_struct_site_gen.symmetry 
_struct_site_gen.details 
1   AC1 7 G   A  13  ? G   X 27  . ? 1_555 ? 
2   AC1 7 U   A  14  ? U   X 28  . ? 1_555 ? 
3   AC1 7 A   A  141 ? A   X 155 . ? 1_555 ? 
4   AC1 7 G   A  143 ? G   X 157 . ? 1_555 ? 
5   AC1 7 C   A  144 ? C   X 158 . ? 1_555 ? 
6   AC1 7 HOH HA .   ? HOH X 212 . ? 1_555 ? 
7   AC1 7 HOH HA .   ? HOH X 342 . ? 1_555 ? 
8   AC2 3 U   A  53  ? U   X 67  . ? 1_555 ? 
9   AC2 3 C   A  61  ? C   X 75  . ? 1_555 ? 
10  AC2 3 A   A  92  ? A   X 106 . ? 1_555 ? 
11  AC3 1 G   A  59  ? G   X 73  . ? 1_555 ? 
12  AC4 6 G   A  86  ? G   X 100 . ? 1_555 ? 
13  AC4 6 C   A  88  ? C   X 102 . ? 1_555 ? 
14  AC4 6 A   A  89  ? A   X 103 . ? 1_555 ? 
15  AC4 6 U   A  90  ? U   X 104 . ? 1_555 ? 
16  AC4 6 HOH HA .   ? HOH X 187 . ? 1_555 ? 
17  AC4 6 HOH HA .   ? HOH X 497 . ? 1_555 ? 
18  AC5 7 U   A  9   ? U   X 23  . ? 1_555 ? 
19  AC5 7 C   A  85  ? C   X 99  . ? 1_555 ? 
20  AC5 7 G   A  86  ? G   X 100 . ? 1_555 ? 
21  AC5 7 HOH HA .   ? HOH X 203 . ? 1_555 ? 
22  AC5 7 HOH HA .   ? HOH X 209 . ? 1_555 ? 
23  AC5 7 HOH HA .   ? HOH X 316 . ? 1_555 ? 
24  AC5 7 HOH HA .   ? HOH X 327 . ? 1_555 ? 
25  AC6 6 U   A  10  ? U   X 24  . ? 1_555 ? 
26  AC6 6 A   A  11  ? A   X 25  . ? 1_555 ? 
27  AC6 6 HOH HA .   ? HOH X 247 . ? 1_555 ? 
28  AC6 6 HOH HA .   ? HOH X 272 . ? 1_555 ? 
29  AC6 6 HOH HA .   ? HOH X 279 . ? 1_555 ? 
30  AC6 6 HOH HA .   ? HOH X 498 . ? 1_555 ? 
31  AC7 4 A   A  58  ? A   X 72  . ? 1_555 ? 
32  AC7 4 HOH HA .   ? HOH X 288 . ? 1_555 ? 
33  AC7 4 HOH HA .   ? HOH X 299 . ? 1_555 ? 
34  AC7 4 HOH HA .   ? HOH X 471 . ? 1_555 ? 
35  AC8 4 A   A  103 ? A   X 117 . ? 1_555 ? 
36  AC8 4 A   A  104 ? A   X 118 . ? 1_555 ? 
37  AC8 4 U   A  105 ? U   X 119 . ? 1_555 ? 
38  AC8 4 HOH HA .   ? HOH X 547 . ? 1_555 ? 
39  AC9 6 C   A  21  ? C   X 35  . ? 1_555 ? 
40  AC9 6 C   A  22  ? C   X 36  . ? 1_555 ? 
41  AC9 6 HOH HA .   ? HOH X 504 . ? 1_555 ? 
42  AC9 6 HOH HA .   ? HOH X 522 . ? 1_555 ? 
43  AC9 6 HOH HA .   ? HOH X 523 . ? 1_555 ? 
44  AC9 6 HOH HA .   ? HOH X 524 . ? 1_555 ? 
45  BC1 6 A   A  92  ? A   X 106 . ? 1_555 ? 
46  BC1 6 G   A  93  ? G   X 107 . ? 1_555 ? 
47  BC1 6 HOH HA .   ? HOH X 500 . ? 1_555 ? 
48  BC1 6 HOH HA .   ? HOH X 501 . ? 1_555 ? 
49  BC1 6 HOH HA .   ? HOH X 502 . ? 1_555 ? 
50  BC1 6 HOH HA .   ? HOH X 503 . ? 1_555 ? 
51  BC2 4 G   A  31  ? G   X 45  . ? 1_555 ? 
52  BC2 4 HOH HA .   ? HOH X 525 . ? 1_555 ? 
53  BC2 4 HOH HA .   ? HOH X 526 . ? 1_555 ? 
54  BC2 4 HOH HA .   ? HOH X 551 . ? 1_555 ? 
55  BC3 5 G   A  113 ? G   X 127 . ? 1_555 ? 
56  BC3 5 A   A  114 ? A   X 128 . ? 1_555 ? 
57  BC3 5 U   A  115 ? U   X 129 . ? 1_555 ? 
58  BC3 5 HOH HA .   ? HOH X 505 . ? 1_555 ? 
59  BC3 5 HOH HA .   ? HOH X 506 . ? 1_555 ? 
60  BC4 6 A   A  16  ? A   X 30  . ? 1_555 ? 
61  BC4 6 G   A  17  ? G   X 31  . ? 1_555 ? 
62  BC4 6 HOH HA .   ? HOH X 507 . ? 1_555 ? 
63  BC4 6 HOH HA .   ? HOH X 508 . ? 1_555 ? 
64  BC4 6 HOH HA .   ? HOH X 509 . ? 1_555 ? 
65  BC4 6 HOH HA .   ? HOH X 510 . ? 1_555 ? 
66  BC5 2 G   A  1   ? G   X 15  . ? 1_555 ? 
67  BC5 2 HOH HA .   ? HOH X 527 . ? 1_555 ? 
68  BC6 6 A   A  32  ? A   X 46  . ? 1_555 ? 
69  BC6 6 G   A  112 ? G   X 126 . ? 1_555 ? 
70  BC6 6 HOH HA .   ? HOH X 542 . ? 1_555 ? 
71  BC6 6 HOH HA .   ? HOH X 543 . ? 1_555 ? 
72  BC6 6 HOH HA .   ? HOH X 544 . ? 1_555 ? 
73  BC6 6 HOH HA .   ? HOH X 545 . ? 1_555 ? 
74  BC7 8 G   B  13  ? G   A 27  . ? 1_555 ? 
75  BC7 8 U   B  14  ? U   A 28  . ? 1_555 ? 
76  BC7 8 G   B  15  ? G   A 29  . ? 1_555 ? 
77  BC7 8 A   B  141 ? A   A 155 . ? 1_555 ? 
78  BC7 8 G   B  143 ? G   A 157 . ? 1_555 ? 
79  BC7 8 C   B  144 ? C   A 158 . ? 1_555 ? 
80  BC7 8 HOH IA .   ? HOH A 181 . ? 1_555 ? 
81  BC7 8 HOH IA .   ? HOH A 225 . ? 1_555 ? 
82  BC8 3 U   B  53  ? U   A 67  . ? 1_555 ? 
83  BC8 3 C   B  61  ? C   A 75  . ? 1_555 ? 
84  BC8 3 A   B  92  ? A   A 106 . ? 1_555 ? 
85  BC9 6 G   B  86  ? G   A 100 . ? 1_555 ? 
86  BC9 6 C   B  88  ? C   A 102 . ? 1_555 ? 
87  BC9 6 A   B  89  ? A   A 103 . ? 1_555 ? 
88  BC9 6 U   B  90  ? U   A 104 . ? 1_555 ? 
89  BC9 6 HOH IA .   ? HOH A 195 . ? 1_555 ? 
90  BC9 6 HOH IA .   ? HOH A 198 . ? 1_555 ? 
91  CC1 8 U   B  9   ? U   A 23  . ? 1_555 ? 
92  CC1 8 C   B  85  ? C   A 99  . ? 1_555 ? 
93  CC1 8 G   B  86  ? G   A 100 . ? 1_555 ? 
94  CC1 8 HOH IA .   ? HOH A 217 . ? 1_555 ? 
95  CC1 8 HOH IA .   ? HOH A 220 . ? 1_555 ? 
96  CC1 8 HOH IA .   ? HOH A 230 . ? 1_555 ? 
97  CC1 8 HOH IA .   ? HOH A 472 . ? 1_555 ? 
98  CC1 8 HOH IA .   ? HOH A 546 . ? 1_555 ? 
99  CC2 6 U   B  10  ? U   A 24  . ? 1_555 ? 
100 CC2 6 A   B  11  ? A   A 25  . ? 1_555 ? 
101 CC2 6 HOH IA .   ? HOH A 222 . ? 1_555 ? 
102 CC2 6 HOH IA .   ? HOH A 244 . ? 1_555 ? 
103 CC2 6 HOH IA .   ? HOH A 255 . ? 1_555 ? 
104 CC2 6 HOH IA .   ? HOH A 258 . ? 1_555 ? 
105 CC3 5 A   B  58  ? A   A 72  . ? 1_555 ? 
106 CC3 5 HOH IA .   ? HOH A 320 . ? 1_555 ? 
107 CC3 5 HOH IA .   ? HOH A 332 . ? 1_555 ? 
108 CC3 5 HOH IA .   ? HOH A 490 . ? 1_555 ? 
109 CC3 5 HOH IA .   ? HOH A 491 . ? 1_555 ? 
110 CC4 6 A   B  49  ? A   A 63  . ? 1_555 ? 
111 CC4 6 HOH IA .   ? HOH A 263 . ? 1_555 ? 
112 CC4 6 HOH IA .   ? HOH A 473 . ? 1_555 ? 
113 CC4 6 HOH IA .   ? HOH A 474 . ? 1_555 ? 
114 CC4 6 HOH IA .   ? HOH A 475 . ? 1_555 ? 
115 CC4 6 HOH IA .   ? HOH A 492 . ? 1_555 ? 
116 CC5 6 A   B  66  ? A   A 80  . ? 1_555 ? 
117 CC5 6 U   B  67  ? U   A 81  . ? 1_555 ? 
118 CC5 6 HOH IA .   ? HOH A 247 . ? 1_555 ? 
119 CC5 6 HOH IA .   ? HOH A 476 . ? 1_555 ? 
120 CC5 6 HOH IA .   ? HOH A 477 . ? 1_555 ? 
121 CC5 6 HOH IA .   ? HOH A 487 . ? 1_555 ? 
122 CC6 6 A   B  103 ? A   A 117 . ? 1_555 ? 
123 CC6 6 A   B  104 ? A   A 118 . ? 1_555 ? 
124 CC6 6 U   B  105 ? U   A 119 . ? 1_555 ? 
125 CC6 6 HOH IA .   ? HOH A 478 . ? 1_555 ? 
126 CC6 6 HOH IA .   ? HOH A 548 . ? 1_555 ? 
127 CC6 6 HOH IA .   ? HOH A 550 . ? 1_555 ? 
128 CC7 6 C   B  21  ? C   A 35  . ? 1_555 ? 
129 CC7 6 C   B  22  ? C   A 36  . ? 1_555 ? 
130 CC7 6 HOH IA .   ? HOH A 310 . ? 1_555 ? 
131 CC7 6 HOH IA .   ? HOH A 481 . ? 1_555 ? 
132 CC7 6 HOH IA .   ? HOH A 482 . ? 1_555 ? 
133 CC7 6 HOH IA .   ? HOH A 549 . ? 1_555 ? 
134 CC8 6 A   B  92  ? A   A 106 . ? 1_555 ? 
135 CC8 6 G   B  93  ? G   A 107 . ? 1_555 ? 
136 CC8 6 HOH IA .   ? HOH A 483 . ? 1_555 ? 
137 CC8 6 HOH IA .   ? HOH A 484 . ? 1_555 ? 
138 CC8 6 HOH IA .   ? HOH A 485 . ? 1_555 ? 
139 CC8 6 HOH IA .   ? HOH A 486 . ? 1_555 ? 
140 CC9 6 A   B  46  ? A   A 60  . ? 1_555 ? 
141 CC9 6 HOH IA .   ? HOH A 187 . ? 1_555 ? 
142 CC9 6 HOH IA .   ? HOH A 231 . ? 1_555 ? 
143 CC9 6 HOH IA .   ? HOH A 306 . ? 1_555 ? 
144 CC9 6 HOH IA .   ? HOH A 488 . ? 1_555 ? 
145 CC9 6 HOH IA .   ? HOH A 489 . ? 1_555 ? 
146 DC1 5 G   B  31  ? G   A 45  . ? 1_555 ? 
147 DC1 5 HOH IA .   ? HOH A 324 . ? 1_555 ? 
148 DC1 5 HOH IA .   ? HOH A 495 . ? 1_555 ? 
149 DC1 5 HOH IA .   ? HOH A 519 . ? 1_555 ? 
150 DC1 5 HOH IA .   ? HOH A 520 . ? 1_555 ? 
151 DC2 6 G   B  113 ? G   A 127 . ? 1_555 ? 
152 DC2 6 A   B  114 ? A   A 128 . ? 1_555 ? 
153 DC2 6 U   B  115 ? U   A 129 . ? 1_555 ? 
154 DC2 6 HOH IA .   ? HOH A 496 . ? 1_555 ? 
155 DC2 6 HOH IA .   ? HOH A 515 . ? 1_555 ? 
156 DC2 6 HOH HA .   ? HOH X 322 . ? 3_655 ? 
157 DC3 1 G   B  1   ? G   A 15  . ? 1_555 ? 
# 
_atom_sites.entry_id                    3PDR 
_atom_sites.fract_transf_matrix[1][1]   0.014539 
_atom_sites.fract_transf_matrix[1][2]   0.000000 
_atom_sites.fract_transf_matrix[1][3]   0.000000 
_atom_sites.fract_transf_matrix[2][1]   0.000000 
_atom_sites.fract_transf_matrix[2][2]   0.009757 
_atom_sites.fract_transf_matrix[2][3]   0.000000 
_atom_sites.fract_transf_matrix[3][1]   0.000000 
_atom_sites.fract_transf_matrix[3][2]   0.000000 
_atom_sites.fract_transf_matrix[3][3]   0.007913 
_atom_sites.fract_transf_vector[1]      0.00000 
_atom_sites.fract_transf_vector[2]      0.00000 
_atom_sites.fract_transf_vector[3]      0.00000 
# 
loop_
_atom_type.symbol 
C  
K  
MN 
N  
O  
P  
# 
loop_
_atom_site.group_PDB 
_atom_site.id 
_atom_site.type_symbol 
_atom_site.label_atom_id 
_atom_site.label_alt_id 
_atom_site.label_comp_id 
_atom_site.label_asym_id 
_atom_site.label_entity_id 
_atom_site.label_seq_id 
_atom_site.pdbx_PDB_ins_code 
_atom_site.Cartn_x 
_atom_site.Cartn_y 
_atom_site.Cartn_z 
_atom_site.occupancy 
_atom_site.B_iso_or_equiv 
_atom_site.pdbx_formal_charge 
_atom_site.auth_seq_id 
_atom_site.auth_comp_id 
_atom_site.auth_asym_id 
_atom_site.auth_atom_id 
_atom_site.pdbx_PDB_model_num 
ATOM   1    O  OP3   . G   A  1 1   ? 46.132  34.890  -0.456 1.00 38.42  ? 15  G   X OP3   1 
ATOM   2    P  P     . G   A  1 1   ? 46.384  35.876  -1.529 1.00 34.10  ? 15  G   X P     1 
ATOM   3    O  OP1   . G   A  1 1   ? 45.286  36.886  -1.446 1.00 34.01  ? 15  G   X OP1   1 
ATOM   4    O  OP2   . G   A  1 1   ? 46.505  35.095  -2.787 1.00 33.35  ? 15  G   X OP2   1 
ATOM   5    O  "O5'" . G   A  1 1   ? 47.807  36.517  -1.206 1.00 29.87  ? 15  G   X "O5'" 1 
ATOM   6    C  "C5'" . G   A  1 1   ? 48.888  36.370  -2.116 1.00 23.72  ? 15  G   X "C5'" 1 
ATOM   7    C  "C4'" . G   A  1 1   ? 49.939  37.422  -1.887 1.00 24.92  ? 15  G   X "C4'" 1 
ATOM   8    O  "O4'" . G   A  1 1   ? 49.434  38.725  -2.272 1.00 23.28  ? 15  G   X "O4'" 1 
ATOM   9    C  "C3'" . G   A  1 1   ? 50.370  37.604  -0.442 1.00 23.98  ? 15  G   X "C3'" 1 
ATOM   10   O  "O3'" . G   A  1 1   ? 51.305  36.631  -0.032 1.00 24.66  ? 15  G   X "O3'" 1 
ATOM   11   C  "C2'" . G   A  1 1   ? 50.914  39.024  -0.434 1.00 24.08  ? 15  G   X "C2'" 1 
ATOM   12   O  "O2'" . G   A  1 1   ? 52.194  39.086  -1.046 1.00 23.41  ? 15  G   X "O2'" 1 
ATOM   13   C  "C1'" . G   A  1 1   ? 49.938  39.703  -1.389 1.00 23.06  ? 15  G   X "C1'" 1 
ATOM   14   N  N9    . G   A  1 1   ? 48.794  40.329  -0.713 1.00 24.99  ? 15  G   X N9    1 
ATOM   15   C  C8    . G   A  1 1   ? 47.481  39.916  -0.735 1.00 24.55  ? 15  G   X C8    1 
ATOM   16   N  N7    . G   A  1 1   ? 46.691  40.718  -0.069 1.00 27.40  ? 15  G   X N7    1 
ATOM   17   C  C5    . G   A  1 1   ? 47.536  41.714  0.416  1.00 26.57  ? 15  G   X C5    1 
ATOM   18   C  C6    . G   A  1 1   ? 47.272  42.853  1.209  1.00 25.24  ? 15  G   X C6    1 
ATOM   19   O  O6    . G   A  1 1   ? 46.188  43.233  1.656  1.00 25.43  ? 15  G   X O6    1 
ATOM   20   N  N1    . G   A  1 1   ? 48.433  43.582  1.463  1.00 25.24  ? 15  G   X N1    1 
ATOM   21   C  C2    . G   A  1 1   ? 49.687  43.261  1.014  1.00 25.66  ? 15  G   X C2    1 
ATOM   22   N  N2    . G   A  1 1   ? 50.691  44.074  1.360  1.00 24.24  ? 15  G   X N2    1 
ATOM   23   N  N3    . G   A  1 1   ? 49.945  42.197  0.278  1.00 26.88  ? 15  G   X N3    1 
ATOM   24   C  C4    . G   A  1 1   ? 48.838  41.486  0.021  1.00 22.41  ? 15  G   X C4    1 
ATOM   25   P  P     . G   A  1 2   ? 51.300  36.078  1.477  1.00 27.04  ? 16  G   X P     1 
ATOM   26   O  OP1   . G   A  1 2   ? 52.301  34.989  1.434  1.00 27.97  ? 16  G   X OP1   1 
ATOM   27   O  OP2   . G   A  1 2   ? 49.890  35.807  1.826  1.00 27.38  ? 16  G   X OP2   1 
ATOM   28   O  "O5'" . G   A  1 2   ? 51.866  37.275  2.355  1.00 22.89  ? 16  G   X "O5'" 1 
ATOM   29   C  "C5'" . G   A  1 2   ? 53.215  37.665  2.158  1.00 22.52  ? 16  G   X "C5'" 1 
ATOM   30   C  "C4'" . G   A  1 2   ? 53.524  38.919  2.930  1.00 23.66  ? 16  G   X "C4'" 1 
ATOM   31   O  "O4'" . G   A  1 2   ? 52.790  40.047  2.388  1.00 22.12  ? 16  G   X "O4'" 1 
ATOM   32   C  "C3'" . G   A  1 2   ? 53.124  38.877  4.391  1.00 22.18  ? 16  G   X "C3'" 1 
ATOM   33   O  "O3'" . G   A  1 2   ? 54.084  38.200  5.179  1.00 23.57  ? 16  G   X "O3'" 1 
ATOM   34   C  "C2'" . G   A  1 2   ? 53.016  40.352  4.727  1.00 22.99  ? 16  G   X "C2'" 1 
ATOM   35   O  "O2'" . G   A  1 2   ? 54.312  40.906  4.870  1.00 27.97  ? 16  G   X "O2'" 1 
ATOM   36   C  "C1'" . G   A  1 2   ? 52.411  40.908  3.441  1.00 24.03  ? 16  G   X "C1'" 1 
ATOM   37   N  N9    . G   A  1 2   ? 50.943  40.927  3.513  1.00 22.53  ? 16  G   X N9    1 
ATOM   38   C  C8    . G   A  1 2   ? 50.075  40.016  2.978  1.00 23.20  ? 16  G   X C8    1 
ATOM   39   N  N7    . G   A  1 2   ? 48.826  40.318  3.206  1.00 23.59  ? 16  G   X N7    1 
ATOM   40   C  C5    . G   A  1 2   ? 48.888  41.501  3.940  1.00 25.65  ? 16  G   X C5    1 
ATOM   41   C  C6    . G   A  1 2   ? 47.850  42.301  4.478  1.00 25.59  ? 16  G   X C6    1 
ATOM   42   O  O6    . G   A  1 2   ? 46.639  42.087  4.386  1.00 26.29  ? 16  G   X O6    1 
ATOM   43   N  N1    . G   A  1 2   ? 48.338  43.418  5.161  1.00 25.38  ? 16  G   X N1    1 
ATOM   44   C  C2    . G   A  1 2   ? 49.673  43.710  5.303  1.00 24.71  ? 16  G   X C2    1 
ATOM   45   N  N2    . G   A  1 2   ? 49.978  44.820  5.984  1.00 24.71  ? 16  G   X N2    1 
ATOM   46   N  N3    . G   A  1 2   ? 50.655  42.971  4.808  1.00 24.40  ? 16  G   X N3    1 
ATOM   47   C  C4    . G   A  1 2   ? 50.189  41.888  4.142  1.00 25.49  ? 16  G   X C4    1 
ATOM   48   P  P     . G   A  1 3   ? 53.657  37.593  6.593  1.00 24.16  ? 17  G   X P     1 
ATOM   49   O  OP1   . G   A  1 3   ? 54.922  37.043  7.165  1.00 24.69  ? 17  G   X OP1   1 
ATOM   50   O  OP2   . G   A  1 3   ? 52.462  36.729  6.481  1.00 22.49  ? 17  G   X OP2   1 
ATOM   51   O  "O5'" . G   A  1 3   ? 53.269  38.940  7.330  1.00 25.90  ? 17  G   X "O5'" 1 
ATOM   52   C  "C5'" . G   A  1 3   ? 52.533  38.945  8.539  1.00 28.44  ? 17  G   X "C5'" 1 
ATOM   53   C  "C4'" . G   A  1 3   ? 52.213  40.365  8.930  1.00 30.07  ? 17  G   X "C4'" 1 
ATOM   54   O  "O4'" . G   A  1 3   ? 51.545  41.037  7.828  1.00 24.73  ? 17  G   X "O4'" 1 
ATOM   55   C  "C3'" . G   A  1 3   ? 51.265  40.540  10.104 1.00 27.81  ? 17  G   X "C3'" 1 
ATOM   56   O  "O3'" . G   A  1 3   ? 51.936  40.430  11.347 1.00 33.09  ? 17  G   X "O3'" 1 
ATOM   57   C  "C2'" . G   A  1 3   ? 50.714  41.934  9.853  1.00 26.08  ? 17  G   X "C2'" 1 
ATOM   58   O  "O2'" . G   A  1 3   ? 51.717  42.881  10.177 1.00 24.90  ? 17  G   X "O2'" 1 
ATOM   59   C  "C1'" . G   A  1 3   ? 50.576  41.932  8.332  1.00 25.93  ? 17  G   X "C1'" 1 
ATOM   60   N  N9    . G   A  1 3   ? 49.253  41.474  7.872  1.00 25.69  ? 17  G   X N9    1 
ATOM   61   C  C8    . G   A  1 3   ? 49.007  40.324  7.155  1.00 25.86  ? 17  G   X C8    1 
ATOM   62   N  N7    . G   A  1 3   ? 47.743  40.166  6.881  1.00 28.11  ? 17  G   X N7    1 
ATOM   63   C  C5    . G   A  1 3   ? 47.120  41.278  7.429  1.00 26.53  ? 17  G   X C5    1 
ATOM   64   C  C6    . G   A  1 3   ? 45.750  41.648  7.443  1.00 27.54  ? 17  G   X C6    1 
ATOM   65   O  O6    . G   A  1 3   ? 44.785  41.050  6.932  1.00 28.28  ? 17  G   X O6    1 
ATOM   66   N  N1    . G   A  1 3   ? 45.549  42.852  8.128  1.00 26.21  ? 17  G   X N1    1 
ATOM   67   C  C2    . G   A  1 3   ? 46.549  43.598  8.713  1.00 28.14  ? 17  G   X C2    1 
ATOM   68   N  N2    . G   A  1 3   ? 46.170  44.731  9.324  1.00 29.51  ? 17  G   X N2    1 
ATOM   69   N  N3    . G   A  1 3   ? 47.825  43.257  8.712  1.00 25.14  ? 17  G   X N3    1 
ATOM   70   C  C4    . G   A  1 3   ? 48.037  42.092  8.057  1.00 27.07  ? 17  G   X C4    1 
ATOM   71   P  P     . C   A  1 4   ? 51.228  39.688  12.577 1.00 31.79  ? 18  C   X P     1 
ATOM   72   O  OP1   . C   A  1 4   ? 52.312  39.444  13.552 1.00 28.21  ? 18  C   X OP1   1 
ATOM   73   O  OP2   . C   A  1 4   ? 50.388  38.563  12.104 1.00 27.51  ? 18  C   X OP2   1 
ATOM   74   O  "O5'" . C   A  1 4   ? 50.294  40.840  13.107 1.00 29.67  ? 18  C   X "O5'" 1 
ATOM   75   C  "C5'" . C   A  1 4   ? 50.812  41.993  13.746 1.00 27.34  ? 18  C   X "C5'" 1 
ATOM   76   C  "C4'" . C   A  1 4   ? 49.667  42.878  14.137 1.00 26.77  ? 18  C   X "C4'" 1 
ATOM   77   O  "O4'" . C   A  1 4   ? 48.932  43.236  12.940 1.00 28.48  ? 18  C   X "O4'" 1 
ATOM   78   C  "C3'" . C   A  1 4   ? 48.605  42.226  15.003 1.00 26.30  ? 18  C   X "C3'" 1 
ATOM   79   O  "O3'" . C   A  1 4   ? 48.968  42.123  16.370 1.00 30.33  ? 18  C   X "O3'" 1 
ATOM   80   C  "C2'" . C   A  1 4   ? 47.397  43.117  14.742 1.00 29.11  ? 18  C   X "C2'" 1 
ATOM   81   O  "O2'" . C   A  1 4   ? 47.614  44.382  15.344 1.00 25.98  ? 18  C   X "O2'" 1 
ATOM   82   C  "C1'" . C   A  1 4   ? 47.543  43.317  13.234 1.00 27.67  ? 18  C   X "C1'" 1 
ATOM   83   N  N1    . C   A  1 4   ? 46.827  42.357  12.354 1.00 22.97  ? 18  C   X N1    1 
ATOM   84   C  C2    . C   A  1 4   ? 45.452  42.512  12.132 1.00 26.79  ? 18  C   X C2    1 
ATOM   85   O  O2    . C   A  1 4   ? 44.842  43.411  12.721 1.00 29.42  ? 18  C   X O2    1 
ATOM   86   N  N3    . C   A  1 4   ? 44.799  41.664  11.296 1.00 28.36  ? 18  C   X N3    1 
ATOM   87   C  C4    . C   A  1 4   ? 45.473  40.689  10.672 1.00 27.36  ? 18  C   X C4    1 
ATOM   88   N  N4    . C   A  1 4   ? 44.780  39.882  9.859  1.00 24.91  ? 18  C   X N4    1 
ATOM   89   C  C5    . C   A  1 4   ? 46.881  40.515  10.863 1.00 22.43  ? 18  C   X C5    1 
ATOM   90   C  C6    . C   A  1 4   ? 47.511  41.358  11.702 1.00 26.50  ? 18  C   X C6    1 
ATOM   91   P  P     . U   A  1 5   ? 48.373  40.898  17.246 1.00 30.90  ? 19  U   X P     1 
ATOM   92   O  OP1   . U   A  1 5   ? 48.941  41.141  18.596 1.00 35.51  ? 19  U   X OP1   1 
ATOM   93   O  OP2   . U   A  1 5   ? 48.682  39.630  16.537 1.00 32.34  ? 19  U   X OP2   1 
ATOM   94   O  "O5'" . U   A  1 5   ? 46.792  41.163  17.280 1.00 28.13  ? 19  U   X "O5'" 1 
ATOM   95   C  "C5'" . U   A  1 5   ? 46.332  42.272  18.045 1.00 29.12  ? 19  U   X "C5'" 1 
ATOM   96   C  "C4'" . U   A  1 5   ? 44.838  42.470  17.950 1.00 30.47  ? 19  U   X "C4'" 1 
ATOM   97   O  "O4'" . U   A  1 5   ? 44.458  42.815  16.591 1.00 29.08  ? 19  U   X "O4'" 1 
ATOM   98   C  "C3'" . U   A  1 5   ? 43.994  41.246  18.255 1.00 29.61  ? 19  U   X "C3'" 1 
ATOM   99   O  "O3'" . U   A  1 5   ? 43.872  40.991  19.644 1.00 37.50  ? 19  U   X "O3'" 1 
ATOM   100  C  "C2'" . U   A  1 5   ? 42.684  41.570  17.542 1.00 30.86  ? 19  U   X "C2'" 1 
ATOM   101  O  "O2'" . U   A  1 5   ? 41.967  42.600  18.208 1.00 30.36  ? 19  U   X "O2'" 1 
ATOM   102  C  "C1'" . U   A  1 5   ? 43.234  42.184  16.261 1.00 28.63  ? 19  U   X "C1'" 1 
ATOM   103  N  N1    . U   A  1 5   ? 43.494  41.144  15.247 1.00 29.64  ? 19  U   X N1    1 
ATOM   104  C  C2    . U   A  1 5   ? 42.418  40.732  14.480 1.00 27.42  ? 19  U   X C2    1 
ATOM   105  O  O2    . U   A  1 5   ? 41.290  41.184  14.603 1.00 26.85  ? 19  U   X O2    1 
ATOM   106  N  N3    . U   A  1 5   ? 42.721  39.771  13.557 1.00 28.45  ? 19  U   X N3    1 
ATOM   107  C  C4    . U   A  1 5   ? 43.960  39.204  13.336 1.00 27.34  ? 19  U   X C4    1 
ATOM   108  O  O4    . U   A  1 5   ? 44.062  38.352  12.457 1.00 25.34  ? 19  U   X O4    1 
ATOM   109  C  C5    . U   A  1 5   ? 45.018  39.672  14.183 1.00 28.29  ? 19  U   X C5    1 
ATOM   110  C  C6    . U   A  1 5   ? 44.752  40.610  15.090 1.00 29.50  ? 19  U   X C6    1 
ATOM   111  P  P     . U   A  1 6   ? 43.939  39.476  20.181 1.00 37.68  ? 20  U   X P     1 
ATOM   112  O  OP1   . U   A  1 6   ? 43.749  39.613  21.650 1.00 40.46  ? 20  U   X OP1   1 
ATOM   113  O  OP2   . U   A  1 6   ? 45.179  38.842  19.667 1.00 34.06  ? 20  U   X OP2   1 
ATOM   114  O  "O5'" . U   A  1 6   ? 42.681  38.764  19.517 1.00 34.98  ? 20  U   X "O5'" 1 
ATOM   115  C  "C5'" . U   A  1 6   ? 41.370  39.198  19.830 1.00 39.62  ? 20  U   X "C5'" 1 
ATOM   116  C  "C4'" . U   A  1 6   ? 40.334  38.624  18.896 1.00 39.16  ? 20  U   X "C4'" 1 
ATOM   117  O  "O4'" . U   A  1 6   ? 40.616  38.975  17.510 1.00 43.18  ? 20  U   X "O4'" 1 
ATOM   118  C  "C3'" . U   A  1 6   ? 40.201  37.111  18.847 1.00 36.57  ? 20  U   X "C3'" 1 
ATOM   119  O  "O3'" . U   A  1 6   ? 39.582  36.567  20.005 1.00 33.52  ? 20  U   X "O3'" 1 
ATOM   120  C  "C2'" . U   A  1 6   ? 39.369  36.982  17.577 1.00 31.89  ? 20  U   X "C2'" 1 
ATOM   121  O  "O2'" . U   A  1 6   ? 38.061  37.474  17.825 1.00 36.05  ? 20  U   X "O2'" 1 
ATOM   122  C  "C1'" . U   A  1 6   ? 40.068  37.989  16.657 1.00 33.18  ? 20  U   X "C1'" 1 
ATOM   123  N  N1    . U   A  1 6   ? 41.130  37.347  15.838 1.00 30.98  ? 20  U   X N1    1 
ATOM   124  C  C2    . U   A  1 6   ? 40.738  36.732  14.664 1.00 28.92  ? 20  U   X C2    1 
ATOM   125  O  O2    . U   A  1 6   ? 39.585  36.712  14.278 1.00 32.32  ? 20  U   X O2    1 
ATOM   126  N  N3    . U   A  1 6   ? 41.738  36.141  13.948 1.00 28.39  ? 20  U   X N3    1 
ATOM   127  C  C4    . U   A  1 6   ? 43.070  36.086  14.266 1.00 28.14  ? 20  U   X C4    1 
ATOM   128  O  O4    . U   A  1 6   ? 43.836  35.505  13.501 1.00 29.95  ? 20  U   X O4    1 
ATOM   129  C  C5    . U   A  1 6   ? 43.411  36.734  15.501 1.00 29.99  ? 20  U   X C5    1 
ATOM   130  C  C6    . U   A  1 6   ? 42.444  37.327  16.221 1.00 30.44  ? 20  U   X C6    1 
ATOM   131  P  P     . C   A  1 7   ? 39.766  35.017  20.440 1.00 35.25  ? 21  C   X P     1 
ATOM   132  O  OP1   . C   A  1 7   ? 38.953  34.953  21.674 1.00 36.86  ? 21  C   X OP1   1 
ATOM   133  O  OP2   . C   A  1 7   ? 41.191  34.611  20.445 1.00 29.03  ? 21  C   X OP2   1 
ATOM   134  O  "O5'" . C   A  1 7   ? 39.045  34.209  19.272 1.00 29.48  ? 21  C   X "O5'" 1 
ATOM   135  C  "C5'" . C   A  1 7   ? 37.635  34.204  19.136 1.00 28.06  ? 21  C   X "C5'" 1 
ATOM   136  C  "C4'" . C   A  1 7   ? 37.242  33.543  17.841 1.00 29.26  ? 21  C   X "C4'" 1 
ATOM   137  O  "O4'" . C   A  1 7   ? 37.855  34.235  16.715 1.00 30.23  ? 21  C   X "O4'" 1 
ATOM   138  C  "C3'" . C   A  1 7   ? 37.679  32.093  17.675 1.00 24.97  ? 21  C   X "C3'" 1 
ATOM   139  O  "O3'" . C   A  1 7   ? 36.828  31.193  18.378 1.00 25.47  ? 21  C   X "O3'" 1 
ATOM   140  C  "C2'" . C   A  1 7   ? 37.633  31.939  16.157 1.00 25.48  ? 21  C   X "C2'" 1 
ATOM   141  O  "O2'" . C   A  1 7   ? 36.294  31.816  15.708 1.00 25.51  ? 21  C   X "O2'" 1 
ATOM   142  C  "C1'" . C   A  1 7   ? 38.150  33.300  15.692 1.00 26.81  ? 21  C   X "C1'" 1 
ATOM   143  N  N1    . C   A  1 7   ? 39.602  33.189  15.491 1.00 27.11  ? 21  C   X N1    1 
ATOM   144  C  C2    . C   A  1 7   ? 40.060  32.584  14.317 1.00 25.63  ? 21  C   X C2    1 
ATOM   145  O  O2    . C   A  1 7   ? 39.209  32.199  13.503 1.00 23.68  ? 21  C   X O2    1 
ATOM   146  N  N3    . C   A  1 7   ? 41.398  32.452  14.103 1.00 27.72  ? 21  C   X N3    1 
ATOM   147  C  C4    . C   A  1 7   ? 42.258  32.896  15.023 1.00 27.43  ? 21  C   X C4    1 
ATOM   148  N  N4    . C   A  1 7   ? 43.570  32.760  14.801 1.00 26.37  ? 21  C   X N4    1 
ATOM   149  C  C5    . C   A  1 7   ? 41.814  33.508  16.232 1.00 27.02  ? 21  C   X C5    1 
ATOM   150  C  C6    . C   A  1 7   ? 40.495  33.628  16.429 1.00 29.91  ? 21  C   X C6    1 
ATOM   151  P  P     . G   A  1 8   ? 37.397  30.180  19.504 1.00 23.62  ? 22  G   X P     1 
ATOM   152  O  OP1   . G   A  1 8   ? 36.207  29.510  20.100 1.00 23.28  ? 22  G   X OP1   1 
ATOM   153  O  OP2   . G   A  1 8   ? 38.321  30.913  20.410 1.00 26.60  ? 22  G   X OP2   1 
ATOM   154  O  "O5'" . G   A  1 8   ? 38.243  29.156  18.652 1.00 22.21  ? 22  G   X "O5'" 1 
ATOM   155  C  "C5'" . G   A  1 8   ? 37.712  28.398  17.574 1.00 22.67  ? 22  G   X "C5'" 1 
ATOM   156  C  "C4'" . G   A  1 8   ? 38.157  26.956  17.639 1.00 21.87  ? 22  G   X "C4'" 1 
ATOM   157  O  "O4'" . G   A  1 8   ? 39.605  26.852  17.698 1.00 21.91  ? 22  G   X "O4'" 1 
ATOM   158  C  "C3'" . G   A  1 8   ? 37.693  26.172  18.856 1.00 20.81  ? 22  G   X "C3'" 1 
ATOM   159  O  "O3'" . G   A  1 8   ? 36.352  25.728  18.732 1.00 20.99  ? 22  G   X "O3'" 1 
ATOM   160  C  "C2'" . G   A  1 8   ? 38.701  25.037  18.911 1.00 21.28  ? 22  G   X "C2'" 1 
ATOM   161  O  "O2'" . G   A  1 8   ? 38.443  24.082  17.886 1.00 19.70  ? 22  G   X "O2'" 1 
ATOM   162  C  "C1'" . G   A  1 8   ? 39.978  25.781  18.538 1.00 23.25  ? 22  G   X "C1'" 1 
ATOM   163  N  N9    . G   A  1 8   ? 40.617  26.373  19.723 1.00 23.43  ? 22  G   X N9    1 
ATOM   164  C  C8    . G   A  1 8   ? 40.503  27.683  20.106 1.00 22.37  ? 22  G   X C8    1 
ATOM   165  N  N7    . G   A  1 8   ? 41.183  27.947  21.189 1.00 25.05  ? 22  G   X N7    1 
ATOM   166  C  C5    . G   A  1 8   ? 41.787  26.738  21.524 1.00 25.74  ? 22  G   X C5    1 
ATOM   167  C  C6    . G   A  1 8   ? 42.651  26.406  22.607 1.00 26.68  ? 22  G   X C6    1 
ATOM   168  O  O6    . G   A  1 8   ? 43.057  27.146  23.510 1.00 29.42  ? 22  G   X O6    1 
ATOM   169  N  N1    . G   A  1 8   ? 43.036  25.073  22.587 1.00 23.79  ? 22  G   X N1    1 
ATOM   170  C  C2    . G   A  1 8   ? 42.634  24.165  21.638 1.00 23.38  ? 22  G   X C2    1 
ATOM   171  N  N2    . G   A  1 8   ? 43.096  22.918  21.772 1.00 22.94  ? 22  G   X N2    1 
ATOM   172  N  N3    . G   A  1 8   ? 41.826  24.459  20.622 1.00 25.61  ? 22  G   X N3    1 
ATOM   173  C  C4    . G   A  1 8   ? 41.438  25.754  20.629 1.00 23.11  ? 22  G   X C4    1 
ATOM   174  P  P     . U   A  1 9   ? 35.459  25.516  20.049 1.00 20.20  ? 23  U   X P     1 
ATOM   175  O  OP1   . U   A  1 9   ? 34.052  25.476  19.563 1.00 20.96  ? 23  U   X OP1   1 
ATOM   176  O  OP2   . U   A  1 9   ? 35.810  26.511  21.080 1.00 20.91  ? 23  U   X OP2   1 
ATOM   177  O  "O5'" . U   A  1 9   ? 35.942  24.077  20.538 1.00 19.19  ? 23  U   X "O5'" 1 
ATOM   178  C  "C5'" . U   A  1 9   ? 35.778  22.870  19.803 1.00 18.03  ? 23  U   X "C5'" 1 
ATOM   179  C  "C4'" . U   A  1 9   ? 36.476  21.737  20.512 1.00 20.83  ? 23  U   X "C4'" 1 
ATOM   180  O  "O4'" . U   A  1 9   ? 37.910  22.007  20.577 1.00 18.54  ? 23  U   X "O4'" 1 
ATOM   181  C  "C3'" . U   A  1 9   ? 36.081  21.551  21.975 1.00 20.85  ? 23  U   X "C3'" 1 
ATOM   182  O  "O3'" . U   A  1 9   ? 34.864  20.850  22.147 1.00 18.78  ? 23  U   X "O3'" 1 
ATOM   183  C  "C2'" . U   A  1 9   ? 37.282  20.797  22.517 1.00 19.82  ? 23  U   X "C2'" 1 
ATOM   184  O  "O2'" . U   A  1 9   ? 37.229  19.458  22.032 1.00 18.89  ? 23  U   X "O2'" 1 
ATOM   185  C  "C1'" . U   A  1 9   ? 38.419  21.545  21.818 1.00 19.53  ? 23  U   X "C1'" 1 
ATOM   186  N  N1    . U   A  1 9   ? 38.937  22.702  22.611 1.00 21.44  ? 23  U   X N1    1 
ATOM   187  C  C2    . U   A  1 9   ? 39.944  22.434  23.527 1.00 25.65  ? 23  U   X C2    1 
ATOM   188  O  O2    . U   A  1 9   ? 40.370  21.309  23.697 1.00 21.97  ? 23  U   X O2    1 
ATOM   189  N  N3    . U   A  1 9   ? 40.409  23.509  24.248 1.00 26.21  ? 23  U   X N3    1 
ATOM   190  C  C4    . U   A  1 9   ? 39.985  24.826  24.129 1.00 27.57  ? 23  U   X C4    1 
ATOM   191  O  O4    . U   A  1 9   ? 40.494  25.711  24.836 1.00 27.11  ? 23  U   X O4    1 
ATOM   192  C  C5    . U   A  1 9   ? 38.943  25.021  23.158 1.00 23.89  ? 23  U   X C5    1 
ATOM   193  C  C6    . U   A  1 9   ? 38.472  23.980  22.457 1.00 20.89  ? 23  U   X C6    1 
ATOM   194  P  P     . U   A  1 10  ? 33.879  21.181  23.381 1.00 21.21  ? 24  U   X P     1 
ATOM   195  O  OP1   . U   A  1 10  ? 33.186  22.474  23.161 1.00 21.00  ? 24  U   X OP1   1 
ATOM   196  O  OP2   . U   A  1 10  ? 34.701  21.072  24.604 1.00 21.29  ? 24  U   X OP2   1 
ATOM   197  O  "O5'" . U   A  1 10  ? 32.893  19.942  23.228 1.00 20.53  ? 24  U   X "O5'" 1 
ATOM   198  C  "C5'" . U   A  1 10  ? 32.731  18.958  24.257 1.00 21.64  ? 24  U   X "C5'" 1 
ATOM   199  C  "C4'" . U   A  1 10  ? 33.519  17.687  24.008 1.00 19.99  ? 24  U   X "C4'" 1 
ATOM   200  O  "O4'" . U   A  1 10  ? 33.138  17.103  22.734 1.00 18.63  ? 24  U   X "O4'" 1 
ATOM   201  C  "C3'" . U   A  1 10  ? 35.039  17.828  23.954 1.00 19.96  ? 24  U   X "C3'" 1 
ATOM   202  O  "O3'" . U   A  1 10  ? 35.610  17.725  25.253 1.00 20.66  ? 24  U   X "O3'" 1 
ATOM   203  C  "C2'" . U   A  1 10  ? 35.474  16.709  23.009 1.00 19.71  ? 24  U   X "C2'" 1 
ATOM   204  O  "O2'" . U   A  1 10  ? 35.632  15.477  23.702 1.00 22.02  ? 24  U   X "O2'" 1 
ATOM   205  C  "C1'" . U   A  1 10  ? 34.259  16.557  22.083 1.00 19.98  ? 24  U   X "C1'" 1 
ATOM   206  N  N1    . U   A  1 10  ? 34.385  17.246  20.786 1.00 19.52  ? 24  U   X N1    1 
ATOM   207  C  C2    . U   A  1 10  ? 34.997  16.553  19.760 1.00 20.27  ? 24  U   X C2    1 
ATOM   208  O  O2    . U   A  1 10  ? 35.439  15.426  19.900 1.00 22.64  ? 24  U   X O2    1 
ATOM   209  N  N3    . U   A  1 10  ? 35.089  17.249  18.573 1.00 21.16  ? 24  U   X N3    1 
ATOM   210  C  C4    . U   A  1 10  ? 34.604  18.531  18.349 1.00 17.23  ? 24  U   X C4    1 
ATOM   211  O  O4    . U   A  1 10  ? 34.751  19.029  17.247 1.00 19.54  ? 24  U   X O4    1 
ATOM   212  C  C5    . U   A  1 10  ? 33.972  19.172  19.455 1.00 16.14  ? 24  U   X C5    1 
ATOM   213  C  C6    . U   A  1 10  ? 33.880  18.515  20.607 1.00 18.94  ? 24  U   X C6    1 
ATOM   214  P  P     . A   A  1 11  ? 37.065  18.300  25.677 1.00 20.00  ? 25  A   X P     1 
ATOM   215  O  OP1   . A   A  1 11  ? 36.943  19.717  26.096 1.00 19.66  ? 25  A   X OP1   1 
ATOM   216  O  OP2   . A   A  1 11  ? 37.998  17.934  24.588 1.00 22.14  ? 25  A   X OP2   1 
ATOM   217  O  "O5'" . A   A  1 11  ? 37.319  17.440  26.984 1.00 22.91  ? 25  A   X "O5'" 1 
ATOM   218  C  "C5'" . A   A  1 11  ? 37.652  16.059  26.925 1.00 21.71  ? 25  A   X "C5'" 1 
ATOM   219  C  "C4'" . A   A  1 11  ? 38.114  15.597  28.281 1.00 24.89  ? 25  A   X "C4'" 1 
ATOM   220  O  "O4'" . A   A  1 11  ? 39.186  16.465  28.752 1.00 26.74  ? 25  A   X "O4'" 1 
ATOM   221  C  "C3'" . A   A  1 11  ? 37.076  15.694  29.386 1.00 23.65  ? 25  A   X "C3'" 1 
ATOM   222  O  "O3'" . A   A  1 11  ? 36.142  14.631  29.362 1.00 26.38  ? 25  A   X "O3'" 1 
ATOM   223  C  "C2'" . A   A  1 11  ? 37.962  15.719  30.626 1.00 28.00  ? 25  A   X "C2'" 1 
ATOM   224  O  "O2'" . A   A  1 11  ? 38.544  14.444  30.850 1.00 29.28  ? 25  A   X "O2'" 1 
ATOM   225  C  "C1'" . A   A  1 11  ? 39.067  16.661  30.149 1.00 27.56  ? 25  A   X "C1'" 1 
ATOM   226  N  N9    . A   A  1 11  ? 38.645  18.043  30.417 1.00 26.37  ? 25  A   X N9    1 
ATOM   227  C  C8    . A   A  1 11  ? 38.134  18.962  29.528 1.00 26.81  ? 25  A   X C8    1 
ATOM   228  N  N7    . A   A  1 11  ? 37.817  20.098  30.092 1.00 29.05  ? 25  A   X N7    1 
ATOM   229  C  C5    . A   A  1 11  ? 38.102  19.918  31.438 1.00 27.99  ? 25  A   X C5    1 
ATOM   230  C  C6    . A   A  1 11  ? 37.984  20.765  32.564 1.00 29.92  ? 25  A   X C6    1 
ATOM   231  N  N6    . A   A  1 11  ? 37.525  22.016  32.536 1.00 28.04  ? 25  A   X N6    1 
ATOM   232  N  N1    . A   A  1 11  ? 38.380  20.268  33.757 1.00 31.33  ? 25  A   X N1    1 
ATOM   233  C  C2    . A   A  1 11  ? 38.856  19.020  33.799 1.00 27.81  ? 25  A   X C2    1 
ATOM   234  N  N3    . A   A  1 11  ? 39.018  18.132  32.821 1.00 30.31  ? 25  A   X N3    1 
ATOM   235  C  C4    . A   A  1 11  ? 38.618  18.654  31.646 1.00 28.40  ? 25  A   X C4    1 
ATOM   236  P  P     . G   A  1 12  ? 34.560  14.909  29.437 1.00 27.69  ? 26  G   X P     1 
ATOM   237  O  OP1   . G   A  1 12  ? 33.921  13.584  29.581 1.00 27.61  ? 26  G   X OP1   1 
ATOM   238  O  OP2   . G   A  1 12  ? 34.218  15.758  28.267 1.00 29.76  ? 26  G   X OP2   1 
ATOM   239  O  "O5'" . G   A  1 12  ? 34.413  15.780  30.753 1.00 25.20  ? 26  G   X "O5'" 1 
ATOM   240  C  "C5'" . G   A  1 12  ? 34.654  15.188  32.018 1.00 25.97  ? 26  G   X "C5'" 1 
ATOM   241  C  "C4'" . G   A  1 12  ? 34.510  16.199  33.125 1.00 23.77  ? 26  G   X "C4'" 1 
ATOM   242  O  "O4'" . G   A  1 12  ? 35.477  17.263  32.952 1.00 27.08  ? 26  G   X "O4'" 1 
ATOM   243  C  "C3'" . G   A  1 12  ? 33.179  16.940  33.220 1.00 24.70  ? 26  G   X "C3'" 1 
ATOM   244  O  "O3'" . G   A  1 12  ? 32.143  16.163  33.806 1.00 23.67  ? 26  G   X "O3'" 1 
ATOM   245  C  "C2'" . G   A  1 12  ? 33.594  18.123  34.074 1.00 26.63  ? 26  G   X "C2'" 1 
ATOM   246  O  "O2'" . G   A  1 12  ? 33.850  17.657  35.386 1.00 27.54  ? 26  G   X "O2'" 1 
ATOM   247  C  "C1'" . G   A  1 12  ? 34.933  18.478  33.426 1.00 25.53  ? 26  G   X "C1'" 1 
ATOM   248  N  N9    . G   A  1 12  ? 34.671  19.365  32.279 1.00 25.43  ? 26  G   X N9    1 
ATOM   249  C  C8    . G   A  1 12  ? 34.663  19.036  30.946 1.00 24.14  ? 26  G   X C8    1 
ATOM   250  N  N7    . G   A  1 12  ? 34.345  20.051  30.180 1.00 25.75  ? 26  G   X N7    1 
ATOM   251  C  C5    . G   A  1 12  ? 34.100  21.095  31.060 1.00 22.59  ? 26  G   X C5    1 
ATOM   252  C  C6    . G   A  1 12  ? 33.697  22.429  30.819 1.00 23.31  ? 26  G   X C6    1 
ATOM   253  O  O6    . G   A  1 12  ? 33.487  22.976  29.733 1.00 23.58  ? 26  G   X O6    1 
ATOM   254  N  N1    . G   A  1 12  ? 33.549  23.156  31.997 1.00 23.17  ? 26  G   X N1    1 
ATOM   255  C  C2    . G   A  1 12  ? 33.748  22.670  33.260 1.00 26.36  ? 26  G   X C2    1 
ATOM   256  N  N2    . G   A  1 12  ? 33.547  23.539  34.268 1.00 22.68  ? 26  G   X N2    1 
ATOM   257  N  N3    . G   A  1 12  ? 34.116  21.416  33.496 1.00 25.99  ? 26  G   X N3    1 
ATOM   258  C  C4    . G   A  1 12  ? 34.281  20.689  32.363 1.00 23.93  ? 26  G   X C4    1 
ATOM   259  P  P     . G   A  1 13  ? 30.585  16.459  33.463 1.00 28.73  ? 27  G   X P     1 
ATOM   260  O  OP1   . G   A  1 13  ? 29.752  15.438  34.173 1.00 27.12  ? 27  G   X OP1   1 
ATOM   261  O  OP2   . G   A  1 13  ? 30.523  16.520  31.979 1.00 24.30  ? 27  G   X OP2   1 
ATOM   262  O  "O5'" . G   A  1 13  ? 30.368  17.896  34.053 1.00 25.90  ? 27  G   X "O5'" 1 
ATOM   263  C  "C5'" . G   A  1 13  ? 30.261  18.151  35.442 1.00 26.53  ? 27  G   X "C5'" 1 
ATOM   264  C  "C4'" . G   A  1 13  ? 29.904  19.592  35.646 1.00 24.47  ? 27  G   X "C4'" 1 
ATOM   265  O  "O4'" . G   A  1 13  ? 30.907  20.428  35.016 1.00 23.74  ? 27  G   X "O4'" 1 
ATOM   266  C  "C3'" . G   A  1 13  ? 28.613  20.055  34.987 1.00 24.26  ? 27  G   X "C3'" 1 
ATOM   267  O  "O3'" . G   A  1 13  ? 27.456  19.657  35.694 1.00 24.64  ? 27  G   X "O3'" 1 
ATOM   268  C  "C2'" . G   A  1 13  ? 28.832  21.556  34.943 1.00 24.18  ? 27  G   X "C2'" 1 
ATOM   269  O  "O2'" . G   A  1 13  ? 28.736  22.086  36.261 1.00 29.15  ? 27  G   X "O2'" 1 
ATOM   270  C  "C1'" . G   A  1 13  ? 30.301  21.608  34.523 1.00 22.72  ? 27  G   X "C1'" 1 
ATOM   271  N  N9    . G   A  1 13  ? 30.424  21.615  33.052 1.00 23.20  ? 27  G   X N9    1 
ATOM   272  C  C8    . G   A  1 13  ? 30.786  20.568  32.247 1.00 22.39  ? 27  G   X C8    1 
ATOM   273  N  N7    . G   A  1 13  ? 30.796  20.888  30.976 1.00 25.32  ? 27  G   X N7    1 
ATOM   274  C  C5    . G   A  1 13  ? 30.399  22.216  30.938 1.00 22.43  ? 27  G   X C5    1 
ATOM   275  C  C6    . G   A  1 13  ? 30.218  23.106  29.840 1.00 22.61  ? 27  G   X C6    1 
ATOM   276  O  O6    . G   A  1 13  ? 30.360  22.874  28.636 1.00 22.18  ? 27  G   X O6    1 
ATOM   277  N  N1    . G   A  1 13  ? 29.800  24.367  30.249 1.00 22.38  ? 27  G   X N1    1 
ATOM   278  C  C2    . G   A  1 13  ? 29.599  24.727  31.567 1.00 22.95  ? 27  G   X C2    1 
ATOM   279  N  N2    . G   A  1 13  ? 29.207  25.990  31.799 1.00 19.31  ? 27  G   X N2    1 
ATOM   280  N  N3    . G   A  1 13  ? 29.766  23.897  32.592 1.00 20.93  ? 27  G   X N3    1 
ATOM   281  C  C4    . G   A  1 13  ? 30.169  22.678  32.212 1.00 22.26  ? 27  G   X C4    1 
ATOM   282  P  P     . U   A  1 14  ? 26.085  19.239  34.983 1.00 23.90  ? 28  U   X P     1 
ATOM   283  O  OP1   . U   A  1 14  ? 25.232  18.731  36.084 1.00 26.74  ? 28  U   X OP1   1 
ATOM   284  O  OP2   . U   A  1 14  ? 26.333  18.330  33.827 1.00 21.43  ? 28  U   X OP2   1 
ATOM   285  O  "O5'" . U   A  1 14  ? 25.560  20.644  34.467 1.00 21.63  ? 28  U   X "O5'" 1 
ATOM   286  C  "C5'" . U   A  1 14  ? 25.228  21.696  35.363 1.00 23.48  ? 28  U   X "C5'" 1 
ATOM   287  C  "C4'" . U   A  1 14  ? 25.068  22.999  34.628 1.00 24.36  ? 28  U   X "C4'" 1 
ATOM   288  O  "O4'" . U   A  1 14  ? 26.269  23.274  33.867 1.00 25.10  ? 28  U   X "O4'" 1 
ATOM   289  C  "C3'" . U   A  1 14  ? 23.965  23.041  33.589 1.00 22.21  ? 28  U   X "C3'" 1 
ATOM   290  O  "O3'" . U   A  1 14  ? 22.719  23.359  34.160 1.00 23.25  ? 28  U   X "O3'" 1 
ATOM   291  C  "C2'" . U   A  1 14  ? 24.425  24.133  32.643 1.00 20.90  ? 28  U   X "C2'" 1 
ATOM   292  O  "O2'" . U   A  1 14  ? 24.123  25.419  33.179 1.00 18.98  ? 28  U   X "O2'" 1 
ATOM   293  C  "C1'" . U   A  1 14  ? 25.936  23.928  32.662 1.00 22.47  ? 28  U   X "C1'" 1 
ATOM   294  N  N1    . U   A  1 14  ? 26.426  23.082  31.558 1.00 20.17  ? 28  U   X N1    1 
ATOM   295  C  C2    . U   A  1 14  ? 26.456  23.648  30.304 1.00 19.12  ? 28  U   X C2    1 
ATOM   296  O  O2    . U   A  1 14  ? 26.098  24.782  30.097 1.00 18.22  ? 28  U   X O2    1 
ATOM   297  N  N3    . U   A  1 14  ? 26.937  22.836  29.310 1.00 20.36  ? 28  U   X N3    1 
ATOM   298  C  C4    . U   A  1 14  ? 27.361  21.543  29.465 1.00 20.41  ? 28  U   X C4    1 
ATOM   299  O  O4    . U   A  1 14  ? 27.756  20.937  28.480 1.00 17.33  ? 28  U   X O4    1 
ATOM   300  C  C5    . U   A  1 14  ? 27.289  21.007  30.796 1.00 21.42  ? 28  U   X C5    1 
ATOM   301  C  C6    . U   A  1 14  ? 26.837  21.791  31.777 1.00 21.82  ? 28  U   X C6    1 
ATOM   302  P  P     . G   A  1 15  ? 21.393  22.803  33.477 1.00 25.74  ? 29  G   X P     1 
ATOM   303  O  OP1   . G   A  1 15  ? 20.310  23.488  34.225 1.00 22.10  ? 29  G   X OP1   1 
ATOM   304  O  OP2   . G   A  1 15  ? 21.455  21.338  33.414 1.00 20.45  ? 29  G   X OP2   1 
ATOM   305  O  "O5'" . G   A  1 15  ? 21.494  23.335  31.974 1.00 20.41  ? 29  G   X "O5'" 1 
ATOM   306  C  "C5'" . G   A  1 15  ? 21.181  24.663  31.567 1.00 22.94  ? 29  G   X "C5'" 1 
ATOM   307  C  "C4'" . G   A  1 15  ? 20.985  24.693  30.071 1.00 19.89  ? 29  G   X "C4'" 1 
ATOM   308  O  "O4'" . G   A  1 15  ? 22.143  24.063  29.460 1.00 20.30  ? 29  G   X "O4'" 1 
ATOM   309  C  "C3'" . G   A  1 15  ? 19.784  23.883  29.598 1.00 18.25  ? 29  G   X "C3'" 1 
ATOM   310  O  "O3'" . G   A  1 15  ? 19.385  24.354  28.321 1.00 21.19  ? 29  G   X "O3'" 1 
ATOM   311  C  "C2'" . G   A  1 15  ? 20.375  22.503  29.387 1.00 21.74  ? 29  G   X "C2'" 1 
ATOM   312  O  "O2'" . G   A  1 15  ? 19.598  21.672  28.542 1.00 19.64  ? 29  G   X "O2'" 1 
ATOM   313  C  "C1'" . G   A  1 15  ? 21.747  22.872  28.808 1.00 18.42  ? 29  G   X "C1'" 1 
ATOM   314  N  N9    . G   A  1 15  ? 22.734  21.818  29.034 1.00 17.05  ? 29  G   X N9    1 
ATOM   315  C  C8    . G   A  1 15  ? 22.879  21.082  30.188 1.00 18.79  ? 29  G   X C8    1 
ATOM   316  N  N7    . G   A  1 15  ? 23.803  20.173  30.085 1.00 19.65  ? 29  G   X N7    1 
ATOM   317  C  C5    . G   A  1 15  ? 24.279  20.292  28.779 1.00 17.20  ? 29  G   X C5    1 
ATOM   318  C  C6    . G   A  1 15  ? 25.269  19.566  28.081 1.00 17.64  ? 29  G   X C6    1 
ATOM   319  O  O6    . G   A  1 15  ? 25.966  18.627  28.496 1.00 17.79  ? 29  G   X O6    1 
ATOM   320  N  N1    . G   A  1 15  ? 25.435  20.033  26.774 1.00 16.95  ? 29  G   X N1    1 
ATOM   321  C  C2    . G   A  1 15  ? 24.714  21.053  26.210 1.00 16.97  ? 29  G   X C2    1 
ATOM   322  N  N2    . G   A  1 15  ? 24.994  21.369  24.927 1.00 17.68  ? 29  G   X N2    1 
ATOM   323  N  N3    . G   A  1 15  ? 23.794  21.735  26.854 1.00 14.15  ? 29  G   X N3    1 
ATOM   324  C  C4    . G   A  1 15  ? 23.611  21.300  28.116 1.00 18.65  ? 29  G   X C4    1 
ATOM   325  P  P     . A   A  1 16  ? 18.157  25.349  28.171 1.00 22.81  ? 30  A   X P     1 
ATOM   326  O  OP1   . A   A  1 16  ? 18.488  26.588  28.904 1.00 22.60  ? 30  A   X OP1   1 
ATOM   327  O  OP2   . A   A  1 16  ? 16.924  24.632  28.522 1.00 20.68  ? 30  A   X OP2   1 
ATOM   328  O  "O5'" . A   A  1 16  ? 18.264  25.598  26.609 1.00 20.88  ? 30  A   X "O5'" 1 
ATOM   329  C  "C5'" . A   A  1 16  ? 17.688  26.766  26.061 1.00 18.12  ? 30  A   X "C5'" 1 
ATOM   330  C  "C4'" . A   A  1 16  ? 17.731  26.698  24.562 1.00 18.47  ? 30  A   X "C4'" 1 
ATOM   331  O  "O4'" . A   A  1 16  ? 19.100  26.521  24.123 1.00 17.30  ? 30  A   X "O4'" 1 
ATOM   332  C  "C3'" . A   A  1 16  ? 17.015  25.523  23.928 1.00 16.82  ? 30  A   X "C3'" 1 
ATOM   333  O  "O3'" . A   A  1 16  ? 15.604  25.661  23.943 1.00 19.52  ? 30  A   X "O3'" 1 
ATOM   334  C  "C2'" . A   A  1 16  ? 17.651  25.527  22.547 1.00 18.00  ? 30  A   X "C2'" 1 
ATOM   335  O  "O2'" . A   A  1 16  ? 17.260  26.691  21.839 1.00 18.60  ? 30  A   X "O2'" 1 
ATOM   336  C  "C1'" . A   A  1 16  ? 19.106  25.753  22.937 1.00 18.98  ? 30  A   X "C1'" 1 
ATOM   337  N  N9    . A   A  1 16  ? 19.769  24.472  23.212 1.00 18.40  ? 30  A   X N9    1 
ATOM   338  C  C8    . A   A  1 16  ? 19.942  23.825  24.410 1.00 18.17  ? 30  A   X C8    1 
ATOM   339  N  N7    . A   A  1 16  ? 20.583  22.683  24.265 1.00 17.54  ? 30  A   X N7    1 
ATOM   340  C  C5    . A   A  1 16  ? 20.839  22.572  22.902 1.00 17.02  ? 30  A   X C5    1 
ATOM   341  C  C6    . A   A  1 16  ? 21.486  21.591  22.114 1.00 17.84  ? 30  A   X C6    1 
ATOM   342  N  N6    . A   A  1 16  ? 22.034  20.477  22.606 1.00 15.05  ? 30  A   X N6    1 
ATOM   343  N  N1    . A   A  1 16  ? 21.556  21.799  20.773 1.00 16.93  ? 30  A   X N1    1 
ATOM   344  C  C2    . A   A  1 16  ? 21.010  22.927  20.278 1.00 17.10  ? 30  A   X C2    1 
ATOM   345  N  N3    . A   A  1 16  ? 20.376  23.919  20.924 1.00 16.36  ? 30  A   X N3    1 
ATOM   346  C  C4    . A   A  1 16  ? 20.330  23.672  22.241 1.00 17.03  ? 30  A   X C4    1 
ATOM   347  P  P     . G   A  1 17  ? 14.666  24.430  24.405 1.00 16.69  ? 31  G   X P     1 
ATOM   348  O  OP1   . G   A  1 17  ? 13.262  24.945  24.493 1.00 18.29  ? 31  G   X OP1   1 
ATOM   349  O  OP2   . G   A  1 17  ? 15.287  23.873  25.611 1.00 18.14  ? 31  G   X OP2   1 
ATOM   350  O  "O5'" . G   A  1 17  ? 14.846  23.334  23.270 1.00 17.38  ? 31  G   X "O5'" 1 
ATOM   351  C  "C5'" . G   A  1 17  ? 14.686  23.676  21.906 1.00 18.66  ? 31  G   X "C5'" 1 
ATOM   352  C  "C4'" . G   A  1 17  ? 15.479  22.734  21.031 1.00 18.32  ? 31  G   X "C4'" 1 
ATOM   353  O  "O4'" . G   A  1 17  ? 16.876  22.742  21.419 1.00 17.16  ? 31  G   X "O4'" 1 
ATOM   354  C  "C3'" . G   A  1 17  ? 15.111  21.266  21.074 1.00 16.75  ? 31  G   X "C3'" 1 
ATOM   355  O  "O3'" . G   A  1 17  ? 13.951  20.988  20.300 1.00 19.82  ? 31  G   X "O3'" 1 
ATOM   356  C  "C2'" . G   A  1 17  ? 16.377  20.640  20.504 1.00 18.46  ? 31  G   X "C2'" 1 
ATOM   357  O  "O2'" . G   A  1 17  ? 16.451  20.906  19.107 1.00 16.66  ? 31  G   X "O2'" 1 
ATOM   358  C  "C1'" . G   A  1 17  ? 17.455  21.467  21.214 1.00 15.88  ? 31  G   X "C1'" 1 
ATOM   359  N  N9    . G   A  1 17  ? 17.690  20.828  22.520 1.00 16.84  ? 31  G   X N9    1 
ATOM   360  C  C8    . G   A  1 17  ? 17.210  21.227  23.744 1.00 18.05  ? 31  G   X C8    1 
ATOM   361  N  N7    . G   A  1 17  ? 17.543  20.404  24.710 1.00 17.03  ? 31  G   X N7    1 
ATOM   362  C  C5    . G   A  1 17  ? 18.267  19.402  24.085 1.00 19.26  ? 31  G   X C5    1 
ATOM   363  C  C6    . G   A  1 17  ? 18.867  18.224  24.612 1.00 18.41  ? 31  G   X C6    1 
ATOM   364  O  O6    . G   A  1 17  ? 18.860  17.840  25.789 1.00 15.81  ? 31  G   X O6    1 
ATOM   365  N  N1    . G   A  1 17  ? 19.490  17.460  23.621 1.00 16.25  ? 31  G   X N1    1 
ATOM   366  C  C2    . G   A  1 17  ? 19.540  17.804  22.281 1.00 19.08  ? 31  G   X C2    1 
ATOM   367  N  N2    . G   A  1 17  ? 20.203  16.976  21.430 1.00 15.85  ? 31  G   X N2    1 
ATOM   368  N  N3    . G   A  1 17  ? 18.986  18.897  21.799 1.00 15.38  ? 31  G   X N3    1 
ATOM   369  C  C4    . G   A  1 17  ? 18.359  19.643  22.731 1.00 19.16  ? 31  G   X C4    1 
ATOM   370  P  P     . G   A  1 18  ? 12.794  20.024  20.855 1.00 19.68  ? 32  G   X P     1 
ATOM   371  O  OP1   . G   A  1 18  ? 11.675  20.182  19.883 1.00 21.33  ? 32  G   X OP1   1 
ATOM   372  O  OP2   . G   A  1 18  ? 12.525  20.271  22.302 1.00 17.43  ? 32  G   X OP2   1 
ATOM   373  O  "O5'" . G   A  1 18  ? 13.503  18.605  20.731 1.00 20.47  ? 32  G   X "O5'" 1 
ATOM   374  C  "C5'" . G   A  1 18  ? 13.897  18.116  19.459 1.00 20.82  ? 32  G   X "C5'" 1 
ATOM   375  C  "C4'" . G   A  1 18  ? 14.724  16.867  19.602 1.00 20.17  ? 32  G   X "C4'" 1 
ATOM   376  O  "O4'" . G   A  1 18  ? 15.934  17.179  20.344 1.00 15.95  ? 32  G   X "O4'" 1 
ATOM   377  C  "C3'" . G   A  1 18  ? 14.112  15.715  20.389 1.00 16.92  ? 32  G   X "C3'" 1 
ATOM   378  O  "O3'" . G   A  1 18  ? 13.177  14.963  19.642 1.00 20.14  ? 32  G   X "O3'" 1 
ATOM   379  C  "C2'" . G   A  1 18  ? 15.362  14.929  20.751 1.00 18.78  ? 32  G   X "C2'" 1 
ATOM   380  O  "O2'" . G   A  1 18  ? 15.906  14.295  19.586 1.00 18.74  ? 32  G   X "O2'" 1 
ATOM   381  C  "C1'" . G   A  1 18  ? 16.284  16.081  21.152 1.00 17.29  ? 32  G   X "C1'" 1 
ATOM   382  N  N9    . G   A  1 18  ? 16.061  16.443  22.567 1.00 17.56  ? 32  G   X N9    1 
ATOM   383  C  C8    . G   A  1 18  ? 15.438  17.560  23.091 1.00 18.57  ? 32  G   X C8    1 
ATOM   384  N  N7    . G   A  1 18  ? 15.392  17.539  24.408 1.00 18.10  ? 32  G   X N7    1 
ATOM   385  C  C5    . G   A  1 18  ? 15.989  16.338  24.758 1.00 16.13  ? 32  G   X C5    1 
ATOM   386  C  C6    . G   A  1 18  ? 16.197  15.769  26.037 1.00 18.98  ? 32  G   X C6    1 
ATOM   387  O  O6    . G   A  1 18  ? 15.885  16.252  27.135 1.00 19.13  ? 32  G   X O6    1 
ATOM   388  N  N1    . G   A  1 18  ? 16.829  14.537  25.968 1.00 16.17  ? 32  G   X N1    1 
ATOM   389  C  C2    . G   A  1 18  ? 17.204  13.913  24.795 1.00 18.07  ? 32  G   X C2    1 
ATOM   390  N  N2    . G   A  1 18  ? 17.805  12.722  24.944 1.00 17.53  ? 32  G   X N2    1 
ATOM   391  N  N3    . G   A  1 18  ? 17.017  14.439  23.583 1.00 16.46  ? 32  G   X N3    1 
ATOM   392  C  C4    . G   A  1 18  ? 16.393  15.640  23.641 1.00 17.47  ? 32  G   X C4    1 
ATOM   393  P  P     . C   A  1 19  ? 12.030  14.083  20.349 1.00 21.94  ? 33  C   X P     1 
ATOM   394  O  OP1   . C   A  1 19  ? 11.187  13.649  19.219 1.00 22.55  ? 33  C   X OP1   1 
ATOM   395  O  OP2   . C   A  1 19  ? 11.477  14.894  21.454 1.00 22.73  ? 33  C   X OP2   1 
ATOM   396  O  "O5'" . C   A  1 19  ? 12.788  12.830  20.956 1.00 17.81  ? 33  C   X "O5'" 1 
ATOM   397  C  "C5'" . C   A  1 19  ? 13.588  11.984  20.141 1.00 19.56  ? 33  C   X "C5'" 1 
ATOM   398  C  "C4'" . C   A  1 19  ? 14.272  10.954  20.994 1.00 22.13  ? 33  C   X "C4'" 1 
ATOM   399  O  "O4'" . C   A  1 19  ? 15.117  11.612  21.973 1.00 19.50  ? 33  C   X "O4'" 1 
ATOM   400  C  "C3'" . C   A  1 19  ? 13.348  10.106  21.846 1.00 21.29  ? 33  C   X "C3'" 1 
ATOM   401  O  "O3'" . C   A  1 19  ? 12.716  9.069   21.117 1.00 19.86  ? 33  C   X "O3'" 1 
ATOM   402  C  "C2'" . C   A  1 19  ? 14.274  9.615   22.953 1.00 21.48  ? 33  C   X "C2'" 1 
ATOM   403  O  "O2'" . C   A  1 19  ? 15.120  8.570   22.504 1.00 21.06  ? 33  C   X "O2'" 1 
ATOM   404  C  "C1'" . C   A  1 19  ? 15.147  10.849  23.161 1.00 20.07  ? 33  C   X "C1'" 1 
ATOM   405  N  N1    . C   A  1 19  ? 14.679  11.685  24.288 1.00 19.57  ? 33  C   X N1    1 
ATOM   406  C  C2    . C   A  1 19  ? 14.904  11.191  25.570 1.00 21.93  ? 33  C   X C2    1 
ATOM   407  O  O2    . C   A  1 19  ? 15.463  10.092  25.665 1.00 19.14  ? 33  C   X O2    1 
ATOM   408  N  N3    . C   A  1 19  ? 14.497  11.917  26.645 1.00 20.47  ? 33  C   X N3    1 
ATOM   409  C  C4    . C   A  1 19  ? 13.909  13.098  26.447 1.00 19.91  ? 33  C   X C4    1 
ATOM   410  N  N4    . C   A  1 19  ? 13.537  13.795  27.524 1.00 21.33  ? 33  C   X N4    1 
ATOM   411  C  C5    . C   A  1 19  ? 13.674  13.629  25.141 1.00 19.69  ? 33  C   X C5    1 
ATOM   412  C  C6    . C   A  1 19  ? 14.076  12.886  24.100 1.00 19.53  ? 33  C   X C6    1 
ATOM   413  P  P     . U   A  1 20  ? 11.213  8.646   21.487 1.00 23.78  ? 34  U   X P     1 
ATOM   414  O  OP1   . U   A  1 20  ? 10.941  7.486   20.601 1.00 25.08  ? 34  U   X OP1   1 
ATOM   415  O  OP2   . U   A  1 20  ? 10.307  9.821   21.446 1.00 22.82  ? 34  U   X OP2   1 
ATOM   416  O  "O5'" . U   A  1 20  ? 11.335  8.132   22.984 1.00 21.38  ? 34  U   X "O5'" 1 
ATOM   417  C  "C5'" . U   A  1 20  ? 12.118  6.988   23.290 1.00 23.62  ? 34  U   X "C5'" 1 
ATOM   418  C  "C4'" . U   A  1 20  ? 11.764  6.490   24.665 1.00 25.21  ? 34  U   X "C4'" 1 
ATOM   419  O  "O4'" . U   A  1 20  ? 12.247  7.458   25.642 1.00 26.50  ? 34  U   X "O4'" 1 
ATOM   420  C  "C3'" . U   A  1 20  ? 10.259  6.343   24.895 1.00 27.34  ? 34  U   X "C3'" 1 
ATOM   421  O  "O3'" . U   A  1 20  ? 9.982   5.196   25.693 1.00 31.51  ? 34  U   X "O3'" 1 
ATOM   422  C  "C2'" . U   A  1 20  ? 9.903   7.592   25.695 1.00 30.91  ? 34  U   X "C2'" 1 
ATOM   423  O  "O2'" . U   A  1 20  ? 8.780   7.425   26.537 1.00 32.17  ? 34  U   X "O2'" 1 
ATOM   424  C  "C1'" . U   A  1 20  ? 11.184  7.857   26.494 1.00 25.74  ? 34  U   X "C1'" 1 
ATOM   425  N  N1    . U   A  1 20  ? 11.168  9.289   26.905 1.00 26.30  ? 34  U   X N1    1 
ATOM   426  C  C2    . U   A  1 20  ? 11.282  9.611   28.257 1.00 26.72  ? 34  U   X C2    1 
ATOM   427  O  O2    . U   A  1 20  ? 11.465  8.782   29.127 1.00 27.64  ? 34  U   X O2    1 
ATOM   428  N  N3    . U   A  1 20  ? 11.198  10.950  28.558 1.00 24.77  ? 34  U   X N3    1 
ATOM   429  C  C4    . U   A  1 20  ? 10.983  11.992  27.666 1.00 27.39  ? 34  U   X C4    1 
ATOM   430  O  O4    . U   A  1 20  ? 10.900  13.153  28.082 1.00 26.84  ? 34  U   X O4    1 
ATOM   431  C  C5    . U   A  1 20  ? 10.853  11.586  26.297 1.00 23.01  ? 34  U   X C5    1 
ATOM   432  C  C6    . U   A  1 20  ? 10.930  10.287  25.984 1.00 23.97  ? 34  U   X C6    1 
ATOM   433  P  P     . C   A  1 21  ? 9.764   3.734   25.047 1.00 35.87  ? 35  C   X P     1 
ATOM   434  O  OP1   . C   A  1 21  ? 9.579   3.840   23.582 1.00 32.57  ? 35  C   X OP1   1 
ATOM   435  O  OP2   . C   A  1 21  ? 8.652   3.238   25.885 1.00 34.82  ? 35  C   X OP2   1 
ATOM   436  O  "O5'" . C   A  1 21  ? 11.118  2.977   25.417 1.00 29.16  ? 35  C   X "O5'" 1 
ATOM   437  C  "C5'" . C   A  1 21  ? 11.371  1.643   25.003 1.00 32.78  ? 35  C   X "C5'" 1 
ATOM   438  C  "C4'" . C   A  1 21  ? 12.010  0.864   26.116 1.00 33.93  ? 35  C   X "C4'" 1 
ATOM   439  O  "O4'" . C   A  1 21  ? 13.173  1.597   26.581 1.00 32.14  ? 35  C   X "O4'" 1 
ATOM   440  C  "C3'" . C   A  1 21  ? 11.158  0.666   27.360 1.00 34.33  ? 35  C   X "C3'" 1 
ATOM   441  O  "O3'" . C   A  1 21  ? 10.293  -0.458  27.259 1.00 35.80  ? 35  C   X "O3'" 1 
ATOM   442  C  "C2'" . C   A  1 21  ? 12.213  0.506   28.442 1.00 31.63  ? 35  C   X "C2'" 1 
ATOM   443  O  "O2'" . C   A  1 21  ? 12.724  -0.818  28.397 1.00 35.95  ? 35  C   X "O2'" 1 
ATOM   444  C  "C1'" . C   A  1 21  ? 13.307  1.472   27.978 1.00 31.22  ? 35  C   X "C1'" 1 
ATOM   445  N  N1    . C   A  1 21  ? 13.170  2.831   28.553 1.00 30.61  ? 35  C   X N1    1 
ATOM   446  C  C2    . C   A  1 21  ? 13.344  3.001   29.923 1.00 30.05  ? 35  C   X C2    1 
ATOM   447  O  O2    . C   A  1 21  ? 13.616  2.004   30.604 1.00 35.65  ? 35  C   X O2    1 
ATOM   448  N  N3    . C   A  1 21  ? 13.209  4.227   30.472 1.00 31.71  ? 35  C   X N3    1 
ATOM   449  C  C4    . C   A  1 21  ? 12.925  5.269   29.691 1.00 28.60  ? 35  C   X C4    1 
ATOM   450  N  N4    . C   A  1 21  ? 12.804  6.459   30.267 1.00 29.19  ? 35  C   X N4    1 
ATOM   451  C  C5    . C   A  1 21  ? 12.750  5.134   28.285 1.00 29.17  ? 35  C   X C5    1 
ATOM   452  C  C6    . C   A  1 21  ? 12.872  3.904   27.765 1.00 30.19  ? 35  C   X C6    1 
ATOM   453  P  P     . C   A  1 22  ? 8.771   -0.487  27.802 1.00 37.14  ? 36  C   X P     1 
ATOM   454  O  OP1   . C   A  1 22  ? 8.338   -1.896  27.682 1.00 44.37  ? 36  C   X OP1   1 
ATOM   455  O  OP2   . C   A  1 22  ? 8.021   0.556   27.085 1.00 36.78  ? 36  C   X OP2   1 
ATOM   456  O  "O5'" . C   A  1 22  ? 8.870   -0.061  29.331 1.00 38.51  ? 36  C   X "O5'" 1 
ATOM   457  C  "C5'" . C   A  1 22  ? 9.435   -0.885  30.338 1.00 37.98  ? 36  C   X "C5'" 1 
ATOM   458  C  "C4'" . C   A  1 22  ? 9.514   -0.137  31.647 1.00 38.80  ? 36  C   X "C4'" 1 
ATOM   459  O  "O4'" . C   A  1 22  ? 10.451  0.973   31.533 1.00 36.13  ? 36  C   X "O4'" 1 
ATOM   460  C  "C3'" . C   A  1 22  ? 8.224   0.524   32.106 1.00 39.04  ? 36  C   X "C3'" 1 
ATOM   461  O  "O3'" . C   A  1 22  ? 7.319   -0.385  32.710 1.00 38.35  ? 36  C   X "O3'" 1 
ATOM   462  C  "C2'" . C   A  1 22  ? 8.739   1.617   33.038 1.00 40.85  ? 36  C   X "C2'" 1 
ATOM   463  O  "O2'" . C   A  1 22  ? 9.131   1.074   34.290 1.00 36.56  ? 36  C   X "O2'" 1 
ATOM   464  C  "C1'" . C   A  1 22  ? 10.002  2.071   32.296 1.00 36.61  ? 36  C   X "C1'" 1 
ATOM   465  N  N1    . C   A  1 22  ? 9.699   3.215   31.403 1.00 35.38  ? 36  C   X N1    1 
ATOM   466  C  C2    . C   A  1 22  ? 9.597   4.490   31.966 1.00 36.68  ? 36  C   X C2    1 
ATOM   467  O  O2    . C   A  1 22  ? 9.778   4.614   33.185 1.00 37.98  ? 36  C   X O2    1 
ATOM   468  N  N3    . C   A  1 22  ? 9.301   5.553   31.177 1.00 33.40  ? 36  C   X N3    1 
ATOM   469  C  C4    . C   A  1 22  ? 9.113   5.371   29.868 1.00 32.53  ? 36  C   X C4    1 
ATOM   470  N  N4    . C   A  1 22  ? 8.821   6.438   29.128 1.00 31.70  ? 36  C   X N4    1 
ATOM   471  C  C5    . C   A  1 22  ? 9.201   4.086   29.265 1.00 34.13  ? 36  C   X C5    1 
ATOM   472  C  C6    . C   A  1 22  ? 9.491   3.046   30.064 1.00 34.60  ? 36  C   X C6    1 
ATOM   473  P  P     . U   A  1 23  ? 5.743   -0.103  32.682 1.00 40.17  ? 37  U   X P     1 
ATOM   474  O  OP1   . U   A  1 23  ? 5.233   -1.395  33.189 1.00 40.86  ? 37  U   X OP1   1 
ATOM   475  O  OP2   . U   A  1 23  ? 5.326   0.380   31.337 1.00 39.20  ? 37  U   X OP2   1 
ATOM   476  O  "O5'" . U   A  1 23  ? 5.492   1.073   33.731 1.00 38.67  ? 37  U   X "O5'" 1 
ATOM   477  C  "C5'" . U   A  1 23  ? 5.443   0.873   35.136 1.00 35.12  ? 37  U   X "C5'" 1 
ATOM   478  C  "C4'" . U   A  1 23  ? 4.956   2.119   35.837 1.00 39.15  ? 37  U   X "C4'" 1 
ATOM   479  O  "O4'" . U   A  1 23  ? 5.883   3.213   35.605 1.00 36.65  ? 37  U   X "O4'" 1 
ATOM   480  C  "C3'" . U   A  1 23  ? 3.615   2.669   35.380 1.00 35.48  ? 37  U   X "C3'" 1 
ATOM   481  O  "O3'" . U   A  1 23  ? 2.521   2.015   35.990 1.00 37.27  ? 37  U   X "O3'" 1 
ATOM   482  C  "C2'" . U   A  1 23  ? 3.696   4.136   35.769 1.00 37.68  ? 37  U   X "C2'" 1 
ATOM   483  O  "O2'" . U   A  1 23  ? 3.424   4.311   37.149 1.00 34.63  ? 37  U   X "O2'" 1 
ATOM   484  C  "C1'" . U   A  1 23  ? 5.173   4.432   35.521 1.00 38.06  ? 37  U   X "C1'" 1 
ATOM   485  N  N1    . U   A  1 23  ? 5.315   5.002   34.174 1.00 31.93  ? 37  U   X N1    1 
ATOM   486  C  C2    . U   A  1 23  ? 4.877   6.292   34.015 1.00 33.93  ? 37  U   X C2    1 
ATOM   487  O  O2    . U   A  1 23  ? 4.411   6.934   34.937 1.00 35.55  ? 37  U   X O2    1 
ATOM   488  N  N3    . U   A  1 23  ? 5.023   6.807   32.751 1.00 33.16  ? 37  U   X N3    1 
ATOM   489  C  C4    . U   A  1 23  ? 5.535   6.141   31.657 1.00 31.58  ? 37  U   X C4    1 
ATOM   490  O  O4    . U   A  1 23  ? 5.596   6.728   30.573 1.00 36.06  ? 37  U   X O4    1 
ATOM   491  C  C5    . U   A  1 23  ? 5.961   4.801   31.907 1.00 35.18  ? 37  U   X C5    1 
ATOM   492  C  C6    . U   A  1 23  ? 5.836   4.279   33.129 1.00 34.36  ? 37  U   X C6    1 
ATOM   493  P  P     . G   A  1 24  ? 1.105   1.962   35.245 1.00 39.27  ? 38  G   X P     1 
ATOM   494  O  OP1   . G   A  1 24  ? 0.463   0.816   35.951 1.00 39.60  ? 38  G   X OP1   1 
ATOM   495  O  OP2   . G   A  1 24  ? 1.335   1.874   33.784 1.00 38.99  ? 38  G   X OP2   1 
ATOM   496  O  "O5'" . G   A  1 24  ? 0.387   3.339   35.590 1.00 37.24  ? 38  G   X "O5'" 1 
ATOM   497  C  "C5'" . G   A  1 24  ? 0.176   3.735   36.934 1.00 35.65  ? 38  G   X "C5'" 1 
ATOM   498  C  "C4'" . G   A  1 24  ? -0.322  5.153   37.004 1.00 34.81  ? 38  G   X "C4'" 1 
ATOM   499  O  "O4'" . G   A  1 24  ? 0.738   6.060   36.606 1.00 36.58  ? 38  G   X "O4'" 1 
ATOM   500  C  "C3'" . G   A  1 24  ? -1.462  5.506   36.062 1.00 34.34  ? 38  G   X "C3'" 1 
ATOM   501  O  "O3'" . G   A  1 24  ? -2.725  5.064   36.528 1.00 36.26  ? 38  G   X "O3'" 1 
ATOM   502  C  "C2'" . G   A  1 24  ? -1.327  7.019   35.974 1.00 33.75  ? 38  G   X "C2'" 1 
ATOM   503  O  "O2'" . G   A  1 24  ? -1.778  7.624   37.181 1.00 34.07  ? 38  G   X "O2'" 1 
ATOM   504  C  "C1'" . G   A  1 24  ? 0.194   7.163   35.914 1.00 32.88  ? 38  G   X "C1'" 1 
ATOM   505  N  N9    . G   A  1 24  ? 0.699   7.140   34.523 1.00 33.71  ? 38  G   X N9    1 
ATOM   506  C  C8    . G   A  1 24  ? 1.235   6.067   33.839 1.00 34.73  ? 38  G   X C8    1 
ATOM   507  N  N7    . G   A  1 24  ? 1.583   6.361   32.610 1.00 32.04  ? 38  G   X N7    1 
ATOM   508  C  C5    . G   A  1 24  ? 1.269   7.717   32.476 1.00 33.05  ? 38  G   X C5    1 
ATOM   509  C  C6    . G   A  1 24  ? 1.411   8.600   31.367 1.00 33.70  ? 38  G   X C6    1 
ATOM   510  O  O6    . G   A  1 24  ? 1.877   8.359   30.249 1.00 36.02  ? 38  G   X O6    1 
ATOM   511  N  N1    . G   A  1 24  ? 0.960   9.886   31.651 1.00 34.29  ? 38  G   X N1    1 
ATOM   512  C  C2    . G   A  1 24  ? 0.426   10.274  32.861 1.00 34.62  ? 38  G   X C2    1 
ATOM   513  N  N2    . G   A  1 24  ? 0.046   11.557  32.949 1.00 33.98  ? 38  G   X N2    1 
ATOM   514  N  N3    . G   A  1 24  ? 0.282   9.463   33.906 1.00 32.54  ? 38  G   X N3    1 
ATOM   515  C  C4    . G   A  1 24  ? 0.722   8.210   33.647 1.00 34.02  ? 38  G   X C4    1 
ATOM   516  P  P     . U   A  1 25  ? -3.834  4.512   35.489 1.00 40.42  ? 39  U   X P     1 
ATOM   517  O  OP1   . U   A  1 25  ? -4.956  4.121   36.380 1.00 41.05  ? 39  U   X OP1   1 
ATOM   518  O  OP2   . U   A  1 25  ? -3.224  3.515   34.565 1.00 38.30  ? 39  U   X OP2   1 
ATOM   519  O  "O5'" . U   A  1 25  ? -4.222  5.838   34.705 1.00 37.71  ? 39  U   X "O5'" 1 
ATOM   520  C  "C5'" . U   A  1 25  ? -4.811  6.876   35.469 1.00 35.85  ? 39  U   X "C5'" 1 
ATOM   521  C  "C4'" . U   A  1 25  ? -5.044  8.104   34.634 1.00 37.32  ? 39  U   X "C4'" 1 
ATOM   522  O  "O4'" . U   A  1 25  ? -3.774  8.660   34.200 1.00 35.92  ? 39  U   X "O4'" 1 
ATOM   523  C  "C3'" . U   A  1 25  ? -5.796  7.876   33.335 1.00 38.96  ? 39  U   X "C3'" 1 
ATOM   524  O  "O3'" . U   A  1 25  ? -7.195  7.736   33.516 1.00 38.01  ? 39  U   X "O3'" 1 
ATOM   525  C  "C2'" . U   A  1 25  ? -5.398  9.104   32.533 1.00 38.07  ? 39  U   X "C2'" 1 
ATOM   526  O  "O2'" . U   A  1 25  ? -6.096  10.247  33.008 1.00 37.60  ? 39  U   X "O2'" 1 
ATOM   527  C  "C1'" . U   A  1 25  ? -3.926  9.239   32.923 1.00 35.99  ? 39  U   X "C1'" 1 
ATOM   528  N  N1    . U   A  1 25  ? -3.047  8.526   31.980 1.00 33.77  ? 39  U   X N1    1 
ATOM   529  C  C2    . U   A  1 25  ? -2.673  9.206   30.839 1.00 35.26  ? 39  U   X C2    1 
ATOM   530  O  O2    . U   A  1 25  ? -3.020  10.345  30.582 1.00 36.10  ? 39  U   X O2    1 
ATOM   531  N  N3    . U   A  1 25  ? -1.864  8.501   29.998 1.00 35.50  ? 39  U   X N3    1 
ATOM   532  C  C4    . U   A  1 25  ? -1.402  7.221   30.180 1.00 33.22  ? 39  U   X C4    1 
ATOM   533  O  O4    . U   A  1 25  ? -0.680  6.750   29.312 1.00 35.19  ? 39  U   X O4    1 
ATOM   534  C  C5    . U   A  1 25  ? -1.832  6.571   31.381 1.00 34.65  ? 39  U   X C5    1 
ATOM   535  C  C6    . U   A  1 25  ? -2.629  7.239   32.221 1.00 36.34  ? 39  U   X C6    1 
ATOM   536  P  P     . A   A  1 26  ? -8.039  6.909   32.427 1.00 37.95  ? 40  A   X P     1 
ATOM   537  O  OP1   . A   A  1 26  ? -9.402  6.833   33.006 1.00 39.57  ? 40  A   X OP1   1 
ATOM   538  O  OP2   . A   A  1 26  ? -7.327  5.645   32.097 1.00 35.58  ? 40  A   X OP2   1 
ATOM   539  O  "O5'" . A   A  1 26  ? -7.995  7.891   31.189 1.00 35.58  ? 40  A   X "O5'" 1 
ATOM   540  C  "C5'" . A   A  1 26  ? -8.552  9.187   31.325 1.00 38.84  ? 40  A   X "C5'" 1 
ATOM   541  C  "C4'" . A   A  1 26  ? -8.442  9.939   30.031 1.00 38.29  ? 40  A   X "C4'" 1 
ATOM   542  O  "O4'" . A   A  1 26  ? -7.050  10.259  29.776 1.00 38.04  ? 40  A   X "O4'" 1 
ATOM   543  C  "C3'" . A   A  1 26  ? -8.878  9.168   28.795 1.00 38.44  ? 40  A   X "C3'" 1 
ATOM   544  O  "O3'" . A   A  1 26  ? -10.285 9.161   28.603 1.00 35.72  ? 40  A   X "O3'" 1 
ATOM   545  C  "C2'" . A   A  1 26  ? -8.112  9.877   27.687 1.00 34.38  ? 40  A   X "C2'" 1 
ATOM   546  O  "O2'" . A   A  1 26  ? -8.722  11.117  27.384 1.00 33.08  ? 40  A   X "O2'" 1 
ATOM   547  C  "C1'" . A   A  1 26  ? -6.794  10.189  28.389 1.00 35.80  ? 40  A   X "C1'" 1 
ATOM   548  N  N9    . A   A  1 26  ? -5.785  9.148   28.137 1.00 33.00  ? 40  A   X N9    1 
ATOM   549  C  C8    . A   A  1 26  ? -5.466  8.051   28.902 1.00 32.60  ? 40  A   X C8    1 
ATOM   550  N  N7    . A   A  1 26  ? -4.498  7.330   28.385 1.00 30.12  ? 40  A   X N7    1 
ATOM   551  C  C5    . A   A  1 26  ? -4.169  7.996   27.207 1.00 30.80  ? 40  A   X C5    1 
ATOM   552  C  C6    . A   A  1 26  ? -3.221  7.750   26.197 1.00 33.32  ? 40  A   X C6    1 
ATOM   553  N  N6    . A   A  1 26  ? -2.388  6.710   26.199 1.00 30.08  ? 40  A   X N6    1 
ATOM   554  N  N1    . A   A  1 26  ? -3.155  8.621   25.164 1.00 33.65  ? 40  A   X N1    1 
ATOM   555  C  C2    . A   A  1 26  ? -3.995  9.666   25.147 1.00 32.50  ? 40  A   X C2    1 
ATOM   556  N  N3    . A   A  1 26  ? -4.919  10.007  26.041 1.00 34.50  ? 40  A   X N3    1 
ATOM   557  C  C4    . A   A  1 26  ? -4.952  9.122   27.051 1.00 32.28  ? 40  A   X C4    1 
ATOM   558  P  P     . U   A  1 27  ? -10.977 7.979   27.754 1.00 35.71  ? 41  U   X P     1 
ATOM   559  O  OP1   . U   A  1 27  ? -12.426 8.221   27.964 1.00 39.51  ? 41  U   X OP1   1 
ATOM   560  O  OP2   . U   A  1 27  ? -10.383 6.660   28.086 1.00 35.86  ? 41  U   X OP2   1 
ATOM   561  O  "O5'" . U   A  1 27  ? -10.583 8.350   26.264 1.00 35.12  ? 41  U   X "O5'" 1 
ATOM   562  C  "C5'" . U   A  1 27  ? -11.212 9.442   25.619 1.00 36.95  ? 41  U   X "C5'" 1 
ATOM   563  C  "C4'" . U   A  1 27  ? -10.660 9.630   24.231 1.00 37.19  ? 41  U   X "C4'" 1 
ATOM   564  O  "O4'" . U   A  1 27  ? -9.238  9.910   24.304 1.00 35.16  ? 41  U   X "O4'" 1 
ATOM   565  C  "C3'" . U   A  1 27  ? -10.724 8.421   23.312 1.00 34.36  ? 41  U   X "C3'" 1 
ATOM   566  O  "O3'" . U   A  1 27  ? -12.018 8.195   22.779 1.00 38.95  ? 41  U   X "O3'" 1 
ATOM   567  C  "C2'" . U   A  1 27  ? -9.689  8.803   22.264 1.00 34.49  ? 41  U   X "C2'" 1 
ATOM   568  O  "O2'" . U   A  1 27  ? -10.203 9.867   21.475 1.00 33.79  ? 41  U   X "O2'" 1 
ATOM   569  C  "C1'" . U   A  1 27  ? -8.594  9.372   23.170 1.00 34.57  ? 41  U   X "C1'" 1 
ATOM   570  N  N1    . U   A  1 27  ? -7.653  8.319   23.607 1.00 32.74  ? 41  U   X N1    1 
ATOM   571  C  C2    . U   A  1 27  ? -6.600  8.055   22.753 1.00 31.76  ? 41  U   X C2    1 
ATOM   572  O  O2    . U   A  1 27  ? -6.449  8.653   21.700 1.00 31.05  ? 41  U   X O2    1 
ATOM   573  N  N3    . U   A  1 27  ? -5.741  7.070   23.176 1.00 31.92  ? 41  U   X N3    1 
ATOM   574  C  C4    . U   A  1 27  ? -5.827  6.341   24.341 1.00 29.39  ? 41  U   X C4    1 
ATOM   575  O  O4    . U   A  1 27  ? -4.974  5.485   24.557 1.00 31.58  ? 41  U   X O4    1 
ATOM   576  C  C5    . U   A  1 27  ? -6.946  6.666   25.176 1.00 33.59  ? 41  U   X C5    1 
ATOM   577  C  C6    . U   A  1 27  ? -7.803  7.622   24.787 1.00 32.62  ? 41  U   X C6    1 
ATOM   578  P  P     . G   A  1 28  ? -12.531 6.686   22.539 1.00 43.20  ? 42  G   X P     1 
ATOM   579  O  OP1   . G   A  1 28  ? -13.967 6.912   22.252 1.00 45.14  ? 42  G   X OP1   1 
ATOM   580  O  OP2   . G   A  1 28  ? -12.103 5.836   23.688 1.00 35.78  ? 42  G   X OP2   1 
ATOM   581  O  "O5'" . G   A  1 28  ? -11.761 6.186   21.236 1.00 36.81  ? 42  G   X "O5'" 1 
ATOM   582  C  "C5'" . G   A  1 28  ? -11.858 6.931   20.031 1.00 37.05  ? 42  G   X "C5'" 1 
ATOM   583  C  "C4'" . G   A  1 28  ? -10.732 6.607   19.080 1.00 37.32  ? 42  G   X "C4'" 1 
ATOM   584  O  "O4'" . G   A  1 28  ? -9.456  6.998   19.655 1.00 34.80  ? 42  G   X "O4'" 1 
ATOM   585  C  "C3'" . G   A  1 28  ? -10.509 5.140   18.741 1.00 34.49  ? 42  G   X "C3'" 1 
ATOM   586  O  "O3'" . G   A  1 28  ? -11.441 4.616   17.819 1.00 43.23  ? 42  G   X "O3'" 1 
ATOM   587  C  "C2'" . G   A  1 28  ? -9.099  5.172   18.185 1.00 35.02  ? 42  G   X "C2'" 1 
ATOM   588  O  "O2'" . G   A  1 28  ? -9.087  5.825   16.925 1.00 37.22  ? 42  G   X "O2'" 1 
ATOM   589  C  "C1'" . G   A  1 28  ? -8.455  6.116   19.190 1.00 33.58  ? 42  G   X "C1'" 1 
ATOM   590  N  N9    . G   A  1 28  ? -7.919  5.353   20.323 1.00 31.41  ? 42  G   X N9    1 
ATOM   591  C  C8    . G   A  1 28  ? -8.404  5.271   21.598 1.00 32.08  ? 42  G   X C8    1 
ATOM   592  N  N7    . G   A  1 28  ? -7.665  4.502   22.350 1.00 32.19  ? 42  G   X N7    1 
ATOM   593  C  C5    . G   A  1 28  ? -6.648  4.058   21.516 1.00 28.72  ? 42  G   X C5    1 
ATOM   594  C  C6    . G   A  1 28  ? -5.548  3.210   21.764 1.00 27.41  ? 42  G   X C6    1 
ATOM   595  O  O6    . G   A  1 28  ? -5.243  2.655   22.822 1.00 29.66  ? 42  G   X O6    1 
ATOM   596  N  N1    . G   A  1 28  ? -4.760  3.026   20.625 1.00 28.12  ? 42  G   X N1    1 
ATOM   597  C  C2    . G   A  1 28  ? -4.998  3.593   19.394 1.00 27.93  ? 42  G   X C2    1 
ATOM   598  N  N2    . G   A  1 28  ? -4.133  3.302   18.401 1.00 27.87  ? 42  G   X N2    1 
ATOM   599  N  N3    . G   A  1 28  ? -6.021  4.393   19.163 1.00 30.37  ? 42  G   X N3    1 
ATOM   600  C  C4    . G   A  1 28  ? -6.793  4.576   20.258 1.00 30.74  ? 42  G   X C4    1 
ATOM   601  P  P     . G   A  1 29  ? -11.787 3.049   17.889 1.00 43.31  ? 43  G   X P     1 
ATOM   602  O  OP1   . G   A  1 29  ? -13.005 3.010   17.040 1.00 45.41  ? 43  G   X OP1   1 
ATOM   603  O  OP2   . G   A  1 29  ? -11.838 2.662   19.332 1.00 36.58  ? 43  G   X OP2   1 
ATOM   604  O  "O5'" . G   A  1 29  ? -10.562 2.271   17.236 1.00 38.16  ? 43  G   X "O5'" 1 
ATOM   605  C  "C5'" . G   A  1 29  ? -10.050 2.599   15.956 1.00 36.86  ? 43  G   X "C5'" 1 
ATOM   606  C  "C4'" . G   A  1 29  ? -8.713  1.943   15.735 1.00 38.23  ? 43  G   X "C4'" 1 
ATOM   607  O  "O4'" . G   A  1 29  ? -7.783  2.328   16.784 1.00 38.14  ? 43  G   X "O4'" 1 
ATOM   608  C  "C3'" . G   A  1 29  ? -8.685  0.425   15.780 1.00 33.41  ? 43  G   X "C3'" 1 
ATOM   609  O  "O3'" . G   A  1 29  ? -9.155  -0.163  14.582 1.00 39.08  ? 43  G   X "O3'" 1 
ATOM   610  C  "C2'" . G   A  1 29  ? -7.211  0.150   16.032 1.00 35.86  ? 43  G   X "C2'" 1 
ATOM   611  O  "O2'" . G   A  1 29  ? -6.476  0.348   14.837 1.00 39.92  ? 43  G   X "O2'" 1 
ATOM   612  C  "C1'" . G   A  1 29  ? -6.851  1.286   16.986 1.00 31.65  ? 43  G   X "C1'" 1 
ATOM   613  N  N9    . G   A  1 29  ? -6.881  0.893   18.409 1.00 30.13  ? 43  G   X N9    1 
ATOM   614  C  C8    . G   A  1 29  ? -7.841  1.216   19.343 1.00 31.90  ? 43  G   X C8    1 
ATOM   615  N  N7    . G   A  1 29  ? -7.587  0.739   20.536 1.00 29.65  ? 43  G   X N7    1 
ATOM   616  C  C5    . G   A  1 29  ? -6.375  0.075   20.375 1.00 29.42  ? 43  G   X C5    1 
ATOM   617  C  C6    . G   A  1 29  ? -5.589  -0.641  21.315 1.00 28.78  ? 43  G   X C6    1 
ATOM   618  O  O6    . G   A  1 29  ? -5.805  -0.821  22.521 1.00 24.69  ? 43  G   X O6    1 
ATOM   619  N  N1    . G   A  1 29  ? -4.441  -1.157  20.731 1.00 26.34  ? 43  G   X N1    1 
ATOM   620  C  C2    . G   A  1 29  ? -4.078  -1.016  19.418 1.00 28.82  ? 43  G   X C2    1 
ATOM   621  N  N2    . G   A  1 29  ? -2.929  -1.597  19.052 1.00 23.78  ? 43  G   X N2    1 
ATOM   622  N  N3    . G   A  1 29  ? -4.802  -0.357  18.531 1.00 30.67  ? 43  G   X N3    1 
ATOM   623  C  C4    . G   A  1 29  ? -5.923  0.167   19.073 1.00 28.97  ? 43  G   X C4    1 
ATOM   624  P  P     . A   A  1 30  ? -9.952  -1.559  14.567 1.00 38.99  ? 44  A   X P     1 
ATOM   625  O  OP1   . A   A  1 30  ? -10.679 -1.565  13.271 1.00 41.33  ? 44  A   X OP1   1 
ATOM   626  O  OP2   . A   A  1 30  ? -10.747 -1.720  15.814 1.00 35.99  ? 44  A   X OP2   1 
ATOM   627  O  "O5'" . A   A  1 30  ? -8.752  -2.587  14.503 1.00 35.37  ? 44  A   X "O5'" 1 
ATOM   628  C  "C5'" . A   A  1 30  ? -7.931  -2.715  13.357 1.00 33.35  ? 44  A   X "C5'" 1 
ATOM   629  C  "C4'" . A   A  1 30  ? -6.749  -3.597  13.654 1.00 37.39  ? 44  A   X "C4'" 1 
ATOM   630  O  "O4'" . A   A  1 30  ? -5.924  -2.980  14.673 1.00 36.64  ? 44  A   X "O4'" 1 
ATOM   631  C  "C3'" . A   A  1 30  ? -7.072  -4.959  14.245 1.00 37.39  ? 44  A   X "C3'" 1 
ATOM   632  O  "O3'" . A   A  1 30  ? -7.482  -5.918  13.288 1.00 39.07  ? 44  A   X "O3'" 1 
ATOM   633  C  "C2'" . A   A  1 30  ? -5.763  -5.323  14.924 1.00 36.64  ? 44  A   X "C2'" 1 
ATOM   634  O  "O2'" . A   A  1 30  ? -4.794  -5.676  13.948 1.00 41.52  ? 44  A   X "O2'" 1 
ATOM   635  C  "C1'" . A   A  1 30  ? -5.369  -3.976  15.511 1.00 34.15  ? 44  A   X "C1'" 1 
ATOM   636  N  N9    . A   A  1 30  ? -5.900  -3.796  16.877 1.00 30.75  ? 44  A   X N9    1 
ATOM   637  C  C8    . A   A  1 30  ? -7.087  -3.215  17.262 1.00 32.26  ? 44  A   X C8    1 
ATOM   638  N  N7    . A   A  1 30  ? -7.285  -3.201  18.562 1.00 31.24  ? 44  A   X N7    1 
ATOM   639  C  C5    . A   A  1 30  ? -6.142  -3.820  19.063 1.00 28.50  ? 44  A   X C5    1 
ATOM   640  C  C6    . A   A  1 30  ? -5.729  -4.110  20.373 1.00 26.38  ? 44  A   X C6    1 
ATOM   641  N  N6    . A   A  1 30  ? -6.441  -3.808  21.458 1.00 28.32  ? 44  A   X N6    1 
ATOM   642  N  N1    . A   A  1 30  ? -4.551  -4.734  20.529 1.00 25.13  ? 44  A   X N1    1 
ATOM   643  C  C2    . A   A  1 30  ? -3.830  -5.041  19.443 1.00 29.72  ? 44  A   X C2    1 
ATOM   644  N  N3    . A   A  1 30  ? -4.104  -4.814  18.159 1.00 26.94  ? 44  A   X N3    1 
ATOM   645  C  C4    . A   A  1 30  ? -5.287  -4.189  18.042 1.00 29.27  ? 44  A   X C4    1 
ATOM   646  P  P     . G   A  1 31  ? -8.711  -6.907  13.586 1.00 40.41  ? 45  G   X P     1 
ATOM   647  O  OP1   . G   A  1 31  ? -8.784  -7.732  12.353 1.00 47.70  ? 45  G   X OP1   1 
ATOM   648  O  OP2   . G   A  1 31  ? -9.880  -6.074  13.959 1.00 38.57  ? 45  G   X OP2   1 
ATOM   649  O  "O5'" . G   A  1 31  ? -8.306  -7.759  14.880 1.00 44.77  ? 45  G   X "O5'" 1 
ATOM   650  C  "C5'" . G   A  1 31  ? -7.118  -8.527  15.000 1.00 39.17  ? 45  G   X "C5'" 1 
ATOM   651  C  "C4'" . G   A  1 31  ? -6.632  -8.632  16.432 1.00 36.22  ? 45  G   X "C4'" 1 
ATOM   652  O  "O4'" . G   A  1 31  ? -6.709  -7.344  17.093 1.00 36.76  ? 45  G   X "O4'" 1 
ATOM   653  C  "C3'" . G   A  1 31  ? -7.365  -9.564  17.391 1.00 32.34  ? 45  G   X "C3'" 1 
ATOM   654  O  "O3'" . G   A  1 31  ? -7.007  -10.917 17.188 1.00 31.79  ? 45  G   X "O3'" 1 
ATOM   655  C  "C2'" . G   A  1 31  ? -6.910  -9.032  18.747 1.00 30.47  ? 45  G   X "C2'" 1 
ATOM   656  O  "O2'" . G   A  1 31  ? -5.583  -9.443  19.023 1.00 30.70  ? 45  G   X "O2'" 1 
ATOM   657  C  "C1'" . G   A  1 31  ? -6.852  -7.532  18.481 1.00 31.97  ? 45  G   X "C1'" 1 
ATOM   658  N  N9    . G   A  1 31  ? -8.056  -6.830  18.941 1.00 28.62  ? 45  G   X N9    1 
ATOM   659  C  C8    . G   A  1 31  ? -9.065  -6.330  18.161 1.00 31.09  ? 45  G   X C8    1 
ATOM   660  N  N7    . G   A  1 31  ? -9.987  -5.738  18.869 1.00 34.78  ? 45  G   X N7    1 
ATOM   661  C  C5    . G   A  1 31  ? -9.554  -5.857  20.186 1.00 29.33  ? 45  G   X C5    1 
ATOM   662  C  C6    . G   A  1 31  ? -10.155 -5.408  21.388 1.00 31.88  ? 45  G   X C6    1 
ATOM   663  O  O6    . G   A  1 31  ? -11.221 -4.796  21.532 1.00 29.85  ? 45  G   X O6    1 
ATOM   664  N  N1    . G   A  1 31  ? -9.385  -5.747  22.493 1.00 27.36  ? 45  G   X N1    1 
ATOM   665  C  C2    . G   A  1 31  ? -8.190  -6.418  22.456 1.00 25.59  ? 45  G   X C2    1 
ATOM   666  N  N2    . G   A  1 31  ? -7.613  -6.631  23.655 1.00 24.35  ? 45  G   X N2    1 
ATOM   667  N  N3    . G   A  1 31  ? -7.616  -6.844  21.340 1.00 25.36  ? 45  G   X N3    1 
ATOM   668  C  C4    . G   A  1 31  ? -8.354  -6.524  20.250 1.00 28.72  ? 45  G   X C4    1 
ATOM   669  P  P     . A   A  1 32  ? -7.773  -12.151 17.889 1.00 34.61  ? 46  A   X P     1 
ATOM   670  O  OP1   . A   A  1 32  ? -7.393  -13.295 17.026 1.00 35.46  ? 46  A   X OP1   1 
ATOM   671  O  OP2   . A   A  1 32  ? -9.201  -11.797 18.128 1.00 31.24  ? 46  A   X OP2   1 
ATOM   672  O  "O5'" . A   A  1 32  ? -7.016  -12.260 19.299 1.00 28.00  ? 46  A   X "O5'" 1 
ATOM   673  C  "C5'" . A   A  1 32  ? -5.658  -12.676 19.376 1.00 28.99  ? 46  A   X "C5'" 1 
ATOM   674  C  "C4'" . A   A  1 32  ? -5.534  -13.925 20.210 1.00 29.01  ? 46  A   X "C4'" 1 
ATOM   675  O  "O4'" . A   A  1 32  ? -5.832  -13.630 21.607 1.00 25.29  ? 46  A   X "O4'" 1 
ATOM   676  C  "C3'" . A   A  1 32  ? -6.467  -15.063 19.812 1.00 26.06  ? 46  A   X "C3'" 1 
ATOM   677  O  "O3'" . A   A  1 32  ? -5.783  -16.285 20.057 1.00 25.80  ? 46  A   X "O3'" 1 
ATOM   678  C  "C2'" . A   A  1 32  ? -7.606  -14.925 20.818 1.00 25.91  ? 46  A   X "C2'" 1 
ATOM   679  O  "O2'" . A   A  1 32  ? -8.354  -16.103 21.024 1.00 23.82  ? 46  A   X "O2'" 1 
ATOM   680  C  "C1'" . A   A  1 32  ? -6.821  -14.534 22.066 1.00 23.40  ? 46  A   X "C1'" 1 
ATOM   681  N  N9    . A   A  1 32  ? -7.619  -13.917 23.128 1.00 22.87  ? 46  A   X N9    1 
ATOM   682  C  C8    . A   A  1 32  ? -8.683  -13.050 23.018 1.00 23.66  ? 46  A   X C8    1 
ATOM   683  N  N7    . A   A  1 32  ? -9.189  -12.688 24.178 1.00 23.04  ? 46  A   X N7    1 
ATOM   684  C  C5    . A   A  1 32  ? -8.414  -13.357 25.112 1.00 22.13  ? 46  A   X C5    1 
ATOM   685  C  C6    . A   A  1 32  ? -8.447  -13.388 26.522 1.00 22.83  ? 46  A   X C6    1 
ATOM   686  N  N6    . A   A  1 32  ? -9.328  -12.702 27.273 1.00 20.29  ? 46  A   X N6    1 
ATOM   687  N  N1    . A   A  1 32  ? -7.525  -14.152 27.150 1.00 20.59  ? 46  A   X N1    1 
ATOM   688  C  C2    . A   A  1 32  ? -6.647  -14.839 26.405 1.00 24.71  ? 46  A   X C2    1 
ATOM   689  N  N3    . A   A  1 32  ? -6.526  -14.885 25.072 1.00 23.05  ? 46  A   X N3    1 
ATOM   690  C  C4    . A   A  1 32  ? -7.447  -14.115 24.479 1.00 21.59  ? 46  A   X C4    1 
ATOM   691  P  P     . U   A  1 33  ? -5.725  -17.425 18.937 1.00 32.16  ? 47  U   X P     1 
ATOM   692  O  OP1   . U   A  1 33  ? -7.129  -17.693 18.535 1.00 28.43  ? 47  U   X OP1   1 
ATOM   693  O  OP2   . U   A  1 33  ? -4.919  -18.551 19.481 1.00 33.19  ? 47  U   X OP2   1 
ATOM   694  O  "O5'" . U   A  1 33  ? -4.978  -16.659 17.777 1.00 39.27  ? 47  U   X "O5'" 1 
ATOM   695  C  "C5'" . U   A  1 33  ? -3.589  -16.379 17.888 1.00 44.76  ? 47  U   X "C5'" 1 
ATOM   696  C  "C4'" . U   A  1 33  ? -2.891  -16.753 16.608 1.00 52.90  ? 47  U   X "C4'" 1 
ATOM   697  O  "O4'" . U   A  1 33  ? -2.318  -18.086 16.718 1.00 52.07  ? 47  U   X "O4'" 1 
ATOM   698  C  "C3'" . U   A  1 33  ? -3.801  -16.788 15.380 1.00 54.98  ? 47  U   X "C3'" 1 
ATOM   699  O  "O3'" . U   A  1 33  ? -3.012  -16.476 14.240 1.00 63.15  ? 47  U   X "O3'" 1 
ATOM   700  C  "C2'" . U   A  1 33  ? -4.151  -18.262 15.278 1.00 54.19  ? 47  U   X "C2'" 1 
ATOM   701  O  "O2'" . U   A  1 33  ? -4.611  -18.652 14.002 1.00 56.78  ? 47  U   X "O2'" 1 
ATOM   702  C  "C1'" . U   A  1 33  ? -2.771  -18.832 15.600 1.00 57.52  ? 47  U   X "C1'" 1 
ATOM   703  N  N1    . U   A  1 33  ? -2.599  -20.300 15.733 1.00 59.24  ? 47  U   X N1    1 
ATOM   704  C  C2    . U   A  1 33  ? -3.274  -21.029 16.701 1.00 56.69  ? 47  U   X C2    1 
ATOM   705  O  O2    . U   A  1 33  ? -4.052  -20.544 17.505 1.00 50.85  ? 47  U   X O2    1 
ATOM   706  N  N3    . U   A  1 33  ? -2.994  -22.375 16.685 1.00 59.36  ? 47  U   X N3    1 
ATOM   707  C  C4    . U   A  1 33  ? -2.134  -23.043 15.830 1.00 66.97  ? 47  U   X C4    1 
ATOM   708  O  O4    . U   A  1 33  ? -1.986  -24.262 15.940 1.00 72.85  ? 47  U   X O4    1 
ATOM   709  C  C5    . U   A  1 33  ? -1.476  -22.216 14.867 1.00 65.76  ? 47  U   X C5    1 
ATOM   710  C  C6    . U   A  1 33  ? -1.727  -20.908 14.858 1.00 60.87  ? 47  U   X C6    1 
ATOM   711  P  P     . A   A  1 34  ? -3.348  -15.234 13.294 1.00 72.40  ? 48  A   X P     1 
ATOM   712  O  OP1   . A   A  1 34  ? -4.720  -14.755 13.603 1.00 68.36  ? 48  A   X OP1   1 
ATOM   713  O  OP2   . A   A  1 34  ? -3.035  -15.667 11.908 1.00 76.96  ? 48  A   X OP2   1 
ATOM   714  O  "O5'" . A   A  1 34  ? -2.226  -14.258 13.853 1.00 71.47  ? 48  A   X "O5'" 1 
ATOM   715  C  "C5'" . A   A  1 34  ? -0.927  -14.786 14.099 1.00 72.51  ? 48  A   X "C5'" 1 
ATOM   716  C  "C4'" . A   A  1 34  ? 0.114   -14.010 13.337 1.00 79.95  ? 48  A   X "C4'" 1 
ATOM   717  O  "O4'" . A   A  1 34  ? -0.227  -14.009 11.919 1.00 86.59  ? 48  A   X "O4'" 1 
ATOM   718  C  "C3'" . A   A  1 34  ? 0.214   -12.541 13.736 1.00 79.56  ? 48  A   X "C3'" 1 
ATOM   719  O  "O3'" . A   A  1 34  ? 1.556   -12.107 13.506 1.00 78.09  ? 48  A   X "O3'" 1 
ATOM   720  C  "C2'" . A   A  1 34  ? -0.743  -11.886 12.741 1.00 83.94  ? 48  A   X "C2'" 1 
ATOM   721  O  "O2'" . A   A  1 34  ? -0.629  -10.486 12.575 1.00 82.01  ? 48  A   X "O2'" 1 
ATOM   722  C  "C1'" . A   A  1 34  ? -0.388  -12.667 11.479 1.00 89.85  ? 48  A   X "C1'" 1 
ATOM   723  N  N9    . A   A  1 34  ? -1.386  -12.590 10.402 1.00 95.19  ? 48  A   X N9    1 
ATOM   724  C  C8    . A   A  1 34  ? -2.621  -13.195 10.320 1.00 94.65  ? 48  A   X C8    1 
ATOM   725  N  N7    . A   A  1 34  ? -3.281  -12.918 9.218  1.00 97.79  ? 48  A   X N7    1 
ATOM   726  C  C5    . A   A  1 34  ? -2.426  -12.069 8.522  1.00 102.88 ? 48  A   X C5    1 
ATOM   727  C  C6    . A   A  1 34  ? -2.539  -11.420 7.274  1.00 107.23 ? 48  A   X C6    1 
ATOM   728  N  N6    . A   A  1 34  ? -3.605  -11.531 6.472  1.00 105.58 ? 48  A   X N6    1 
ATOM   729  N  N1    . A   A  1 34  ? -1.502  -10.642 6.875  1.00 107.56 ? 48  A   X N1    1 
ATOM   730  C  C2    . A   A  1 34  ? -0.431  -10.530 7.677  1.00 102.75 ? 48  A   X C2    1 
ATOM   731  N  N3    . A   A  1 34  ? -0.210  -11.089 8.867  1.00 99.37  ? 48  A   X N3    1 
ATOM   732  C  C4    . A   A  1 34  ? -1.256  -11.857 9.239  1.00 99.48  ? 48  A   X C4    1 
ATOM   733  P  P     . C   A  1 35  ? 1.958   -10.555 13.334 1.00 84.38  ? 49  C   X P     1 
ATOM   734  O  OP1   . C   A  1 35  ? 1.636   -10.128 11.946 1.00 83.31  ? 49  C   X OP1   1 
ATOM   735  O  OP2   . C   A  1 35  ? 3.372   -10.475 13.788 1.00 75.51  ? 49  C   X OP2   1 
ATOM   736  O  "O5'" . C   A  1 35  ? 0.977   -9.838  14.371 1.00 72.67  ? 49  C   X "O5'" 1 
ATOM   737  C  "C5'" . C   A  1 35  ? 0.904   -10.283 15.719 1.00 59.81  ? 49  C   X "C5'" 1 
ATOM   738  C  "C4'" . C   A  1 35  ? 0.084   -9.355  16.577 1.00 51.03  ? 49  C   X "C4'" 1 
ATOM   739  O  "O4'" . C   A  1 35  ? -1.198  -9.972  16.879 1.00 44.43  ? 49  C   X "O4'" 1 
ATOM   740  C  "C3'" . C   A  1 35  ? 0.696   -9.034  17.933 1.00 37.98  ? 49  C   X "C3'" 1 
ATOM   741  O  "O3'" . C   A  1 35  ? 1.664   -7.995  17.864 1.00 41.92  ? 49  C   X "O3'" 1 
ATOM   742  C  "C2'" . C   A  1 35  ? -0.525  -8.716  18.791 1.00 37.68  ? 49  C   X "C2'" 1 
ATOM   743  O  "O2'" . C   A  1 35  ? -0.946  -7.365  18.629 1.00 40.32  ? 49  C   X "O2'" 1 
ATOM   744  C  "C1'" . C   A  1 35  ? -1.587  -9.660  18.201 1.00 40.03  ? 49  C   X "C1'" 1 
ATOM   745  N  N1    . C   A  1 35  ? -1.747  -10.918 18.982 1.00 34.98  ? 49  C   X N1    1 
ATOM   746  C  C2    . C   A  1 35  ? -2.253  -10.827 20.283 1.00 33.57  ? 49  C   X C2    1 
ATOM   747  O  O2    . C   A  1 35  ? -2.555  -9.720  20.734 1.00 33.72  ? 49  C   X O2    1 
ATOM   748  N  N3    . C   A  1 35  ? -2.403  -11.942 21.034 1.00 33.59  ? 49  C   X N3    1 
ATOM   749  C  C4    . C   A  1 35  ? -2.067  -13.132 20.541 1.00 32.39  ? 49  C   X C4    1 
ATOM   750  N  N4    . C   A  1 35  ? -2.244  -14.185 21.353 1.00 29.98  ? 49  C   X N4    1 
ATOM   751  C  C5    . C   A  1 35  ? -1.546  -13.269 19.217 1.00 32.08  ? 49  C   X C5    1 
ATOM   752  C  C6    . C   A  1 35  ? -1.402  -12.149 18.483 1.00 34.77  ? 49  C   X C6    1 
ATOM   753  P  P     . G   A  1 36  ? 3.074   -8.114  18.643 1.00 43.52  ? 50  G   X P     1 
ATOM   754  O  OP1   . G   A  1 36  ? 3.717   -6.779  18.608 1.00 41.85  ? 50  G   X OP1   1 
ATOM   755  O  OP2   . G   A  1 36  ? 3.806   -9.287  18.103 1.00 38.66  ? 50  G   X OP2   1 
ATOM   756  O  "O5'" . G   A  1 36  ? 2.588   -8.405  20.132 1.00 33.24  ? 50  G   X "O5'" 1 
ATOM   757  C  "C5'" . G   A  1 36  ? 2.062   -7.385  20.971 1.00 31.10  ? 50  G   X "C5'" 1 
ATOM   758  C  "C4'" . G   A  1 36  ? 1.614   -7.964  22.289 1.00 29.19  ? 50  G   X "C4'" 1 
ATOM   759  O  "O4'" . G   A  1 36  ? 0.567   -8.932  22.033 1.00 30.25  ? 50  G   X "O4'" 1 
ATOM   760  C  "C3'" . G   A  1 36  ? 2.651   -8.763  23.066 1.00 27.61  ? 50  G   X "C3'" 1 
ATOM   761  O  "O3'" . G   A  1 36  ? 3.539   -7.963  23.824 1.00 27.36  ? 50  G   X "O3'" 1 
ATOM   762  C  "C2'" . G   A  1 36  ? 1.783   -9.665  23.931 1.00 27.47  ? 50  G   X "C2'" 1 
ATOM   763  O  "O2'" . G   A  1 36  ? 1.234   -8.931  25.017 1.00 27.52  ? 50  G   X "O2'" 1 
ATOM   764  C  "C1'" . G   A  1 36  ? 0.658   -9.996  22.952 1.00 30.14  ? 50  G   X "C1'" 1 
ATOM   765  N  N9    . G   A  1 36  ? 0.916   -11.229 22.186 1.00 27.62  ? 50  G   X N9    1 
ATOM   766  C  C8    . G   A  1 36  ? 1.237   -11.329 20.856 1.00 29.78  ? 50  G   X C8    1 
ATOM   767  N  N7    . G   A  1 36  ? 1.394   -12.566 20.458 1.00 28.91  ? 50  G   X N7    1 
ATOM   768  C  C5    . G   A  1 36  ? 1.151   -13.335 21.594 1.00 29.64  ? 50  G   X C5    1 
ATOM   769  C  C6    . G   A  1 36  ? 1.161   -14.746 21.791 1.00 26.16  ? 50  G   X C6    1 
ATOM   770  O  O6    . G   A  1 36  ? 1.393   -15.641 20.982 1.00 24.83  ? 50  G   X O6    1 
ATOM   771  N  N1    . G   A  1 36  ? 0.861   -15.105 23.099 1.00 25.31  ? 50  G   X N1    1 
ATOM   772  C  C2    . G   A  1 36  ? 0.571   -14.201 24.092 1.00 29.07  ? 50  G   X C2    1 
ATOM   773  N  N2    . G   A  1 36  ? 0.304   -14.731 25.287 1.00 28.02  ? 50  G   X N2    1 
ATOM   774  N  N3    . G   A  1 36  ? 0.543   -12.881 23.932 1.00 27.55  ? 50  G   X N3    1 
ATOM   775  C  C4    . G   A  1 36  ? 0.842   -12.518 22.667 1.00 28.78  ? 50  G   X C4    1 
ATOM   776  P  P     . C   A  1 37  ? 5.046   -8.457  24.092 1.00 30.61  ? 51  C   X P     1 
ATOM   777  O  OP1   . C   A  1 37  ? 5.736   -7.271  24.656 1.00 32.38  ? 51  C   X OP1   1 
ATOM   778  O  OP2   . C   A  1 37  ? 5.519   -9.095  22.845 1.00 32.27  ? 51  C   X OP2   1 
ATOM   779  O  "O5'" . C   A  1 37  ? 4.907   -9.546  25.223 1.00 29.26  ? 51  C   X "O5'" 1 
ATOM   780  C  "C5'" . C   A  1 37  ? 4.411   -9.203  26.503 1.00 29.48  ? 51  C   X "C5'" 1 
ATOM   781  C  "C4'" . C   A  1 37  ? 4.251   -10.442 27.344 1.00 32.75  ? 51  C   X "C4'" 1 
ATOM   782  O  "O4'" . C   A  1 37  ? 3.223   -11.290 26.762 1.00 29.92  ? 51  C   X "O4'" 1 
ATOM   783  C  "C3'" . C   A  1 37  ? 5.467   -11.355 27.421 1.00 28.48  ? 51  C   X "C3'" 1 
ATOM   784  O  "O3'" . C   A  1 37  ? 6.466   -10.915 28.325 1.00 31.15  ? 51  C   X "O3'" 1 
ATOM   785  C  "C2'" . C   A  1 37  ? 4.840   -12.678 27.817 1.00 27.63  ? 51  C   X "C2'" 1 
ATOM   786  O  "O2'" . C   A  1 37  ? 4.491   -12.671 29.193 1.00 31.48  ? 51  C   X "O2'" 1 
ATOM   787  C  "C1'" . C   A  1 37  ? 3.556   -12.643 26.987 1.00 27.78  ? 51  C   X "C1'" 1 
ATOM   788  N  N1    . C   A  1 37  ? 3.777   -13.258 25.671 1.00 26.48  ? 51  C   X N1    1 
ATOM   789  C  C2    . C   A  1 37  ? 3.754   -14.649 25.572 1.00 25.93  ? 51  C   X C2    1 
ATOM   790  O  O2    . C   A  1 37  ? 3.542   -15.334 26.585 1.00 25.99  ? 51  C   X O2    1 
ATOM   791  N  N3    . C   A  1 37  ? 3.957   -15.220 24.369 1.00 27.92  ? 51  C   X N3    1 
ATOM   792  C  C4    . C   A  1 37  ? 4.188   -14.453 23.302 1.00 25.85  ? 51  C   X C4    1 
ATOM   793  N  N4    . C   A  1 37  ? 4.372   -15.079 22.140 1.00 23.56  ? 51  C   X N4    1 
ATOM   794  C  C5    . C   A  1 37  ? 4.217   -13.031 23.374 1.00 26.62  ? 51  C   X C5    1 
ATOM   795  C  C6    . C   A  1 37  ? 4.016   -12.471 24.573 1.00 27.81  ? 51  C   X C6    1 
ATOM   796  P  P     . U   A  1 38  ? 8.026   -11.175 28.020 1.00 32.24  ? 52  U   X P     1 
ATOM   797  O  OP1   . U   A  1 38  ? 8.718   -10.424 29.090 1.00 34.06  ? 52  U   X OP1   1 
ATOM   798  O  OP2   . U   A  1 38  ? 8.322   -10.839 26.596 1.00 27.36  ? 52  U   X OP2   1 
ATOM   799  O  "O5'" . U   A  1 38  ? 8.113   -12.743 28.260 1.00 30.77  ? 52  U   X "O5'" 1 
ATOM   800  C  "C5'" . U   A  1 38  ? 7.865   -13.303 29.541 1.00 28.28  ? 52  U   X "C5'" 1 
ATOM   801  C  "C4'" . U   A  1 38  ? 7.878   -14.811 29.502 1.00 29.19  ? 52  U   X "C4'" 1 
ATOM   802  O  "O4'" . U   A  1 38  ? 6.844   -15.288 28.609 1.00 28.74  ? 52  U   X "O4'" 1 
ATOM   803  C  "C3'" . U   A  1 38  ? 9.139   -15.451 28.941 1.00 26.47  ? 52  U   X "C3'" 1 
ATOM   804  O  "O3'" . U   A  1 38  ? 10.195  -15.474 29.874 1.00 30.49  ? 52  U   X "O3'" 1 
ATOM   805  C  "C2'" . U   A  1 38  ? 8.639   -16.827 28.523 1.00 26.94  ? 52  U   X "C2'" 1 
ATOM   806  O  "O2'" . U   A  1 38  ? 8.401   -17.660 29.652 1.00 32.05  ? 52  U   X "O2'" 1 
ATOM   807  C  "C1'" . U   A  1 38  ? 7.283   -16.454 27.942 1.00 26.76  ? 52  U   X "C1'" 1 
ATOM   808  N  N1    . U   A  1 38  ? 7.349   -16.181 26.487 1.00 26.95  ? 52  U   X N1    1 
ATOM   809  C  C2    . U   A  1 38  ? 7.327   -17.274 25.656 1.00 25.02  ? 52  U   X C2    1 
ATOM   810  O  O2    . U   A  1 38  ? 7.262   -18.409 26.086 1.00 24.62  ? 52  U   X O2    1 
ATOM   811  N  N3    . U   A  1 38  ? 7.385   -16.994 24.311 1.00 23.82  ? 52  U   X N3    1 
ATOM   812  C  C4    . U   A  1 38  ? 7.446   -15.752 23.722 1.00 26.01  ? 52  U   X C4    1 
ATOM   813  O  O4    . U   A  1 38  ? 7.478   -15.671 22.485 1.00 22.96  ? 52  U   X O4    1 
ATOM   814  C  C5    . U   A  1 38  ? 7.461   -14.665 24.662 1.00 26.81  ? 52  U   X C5    1 
ATOM   815  C  C6    . U   A  1 38  ? 7.412   -14.908 25.981 1.00 23.18  ? 52  U   X C6    1 
ATOM   816  P  P     . G   A  1 39  ? 11.652  -14.938 29.449 1.00 29.13  ? 53  G   X P     1 
ATOM   817  O  OP1   . G   A  1 39  ? 12.301  -14.586 30.733 1.00 33.21  ? 53  G   X OP1   1 
ATOM   818  O  OP2   . G   A  1 39  ? 11.604  -13.946 28.349 1.00 27.12  ? 53  G   X OP2   1 
ATOM   819  O  "O5'" . G   A  1 39  ? 12.223  -16.303 28.871 1.00 25.49  ? 53  G   X "O5'" 1 
ATOM   820  C  "C5'" . G   A  1 39  ? 12.383  -17.411 29.747 1.00 26.95  ? 53  G   X "C5'" 1 
ATOM   821  C  "C4'" . G   A  1 39  ? 12.464  -18.699 28.977 1.00 28.63  ? 53  G   X "C4'" 1 
ATOM   822  O  "O4'" . G   A  1 39  ? 11.294  -18.822 28.126 1.00 26.55  ? 53  G   X "O4'" 1 
ATOM   823  C  "C3'" . G   A  1 39  ? 13.627  -18.831 28.002 1.00 28.02  ? 53  G   X "C3'" 1 
ATOM   824  O  "O3'" . G   A  1 39  ? 14.855  -19.149 28.634 1.00 25.06  ? 53  G   X "O3'" 1 
ATOM   825  C  "C2'" . G   A  1 39  ? 13.126  -19.927 27.077 1.00 24.77  ? 53  G   X "C2'" 1 
ATOM   826  O  "O2'" . G   A  1 39  ? 13.232  -21.190 27.719 1.00 25.44  ? 53  G   X "O2'" 1 
ATOM   827  C  "C1'" . G   A  1 39  ? 11.644  -19.563 26.970 1.00 25.85  ? 53  G   X "C1'" 1 
ATOM   828  N  N9    . G   A  1 39  ? 11.341  -18.746 25.780 1.00 23.86  ? 53  G   X N9    1 
ATOM   829  C  C8    . G   A  1 39  ? 11.039  -17.406 25.749 1.00 25.08  ? 53  G   X C8    1 
ATOM   830  N  N7    . G   A  1 39  ? 10.780  -16.974 24.539 1.00 25.70  ? 53  G   X N7    1 
ATOM   831  C  C5    . G   A  1 39  ? 10.915  -18.093 23.727 1.00 23.60  ? 53  G   X C5    1 
ATOM   832  C  C6    . G   A  1 39  ? 10.774  -18.247 22.318 1.00 24.06  ? 53  G   X C6    1 
ATOM   833  O  O6    . G   A  1 39  ? 10.478  -17.409 21.460 1.00 23.78  ? 53  G   X O6    1 
ATOM   834  N  N1    . G   A  1 39  ? 11.013  -19.554 21.914 1.00 24.69  ? 53  G   X N1    1 
ATOM   835  C  C2    . G   A  1 39  ? 11.345  -20.588 22.753 1.00 24.25  ? 53  G   X C2    1 
ATOM   836  N  N2    . G   A  1 39  ? 11.532  -21.777 22.163 1.00 23.81  ? 53  G   X N2    1 
ATOM   837  N  N3    . G   A  1 39  ? 11.484  -20.461 24.063 1.00 24.36  ? 53  G   X N3    1 
ATOM   838  C  C4    . G   A  1 39  ? 11.259  -19.197 24.483 1.00 25.24  ? 53  G   X C4    1 
ATOM   839  P  P     . C   A  1 40  ? 16.275  -18.750 27.988 1.00 29.68  ? 54  C   X P     1 
ATOM   840  O  OP1   . C   A  1 40  ? 17.239  -19.053 29.076 1.00 33.54  ? 54  C   X OP1   1 
ATOM   841  O  OP2   . C   A  1 40  ? 16.187  -17.406 27.388 1.00 30.45  ? 54  C   X OP2   1 
ATOM   842  O  "O5'" . C   A  1 40  ? 16.483  -19.771 26.800 1.00 29.92  ? 54  C   X "O5'" 1 
ATOM   843  C  "C5'" . C   A  1 40  ? 16.581  -21.164 27.037 1.00 31.21  ? 54  C   X "C5'" 1 
ATOM   844  C  "C4'" . C   A  1 40  ? 16.560  -21.903 25.727 1.00 29.02  ? 54  C   X "C4'" 1 
ATOM   845  O  "O4'" . C   A  1 40  ? 15.283  -21.681 25.071 1.00 30.21  ? 54  C   X "O4'" 1 
ATOM   846  C  "C3'" . C   A  1 40  ? 17.576  -21.420 24.703 1.00 29.75  ? 54  C   X "C3'" 1 
ATOM   847  O  "O3'" . C   A  1 40  ? 18.878  -21.929 24.940 1.00 32.56  ? 54  C   X "O3'" 1 
ATOM   848  C  "C2'" . C   A  1 40  ? 16.952  -21.887 23.397 1.00 30.90  ? 54  C   X "C2'" 1 
ATOM   849  O  "O2'" . C   A  1 40  ? 17.099  -23.292 23.254 1.00 32.28  ? 54  C   X "O2'" 1 
ATOM   850  C  "C1'" . C   A  1 40  ? 15.474  -21.608 23.671 1.00 29.37  ? 54  C   X "C1'" 1 
ATOM   851  N  N1    . C   A  1 40  ? 15.001  -20.293 23.192 1.00 25.71  ? 54  C   X N1    1 
ATOM   852  C  C2    . C   A  1 40  ? 14.689  -20.165 21.844 1.00 26.82  ? 54  C   X C2    1 
ATOM   853  O  O2    . C   A  1 40  ? 14.836  -21.147 21.096 1.00 29.58  ? 54  C   X O2    1 
ATOM   854  N  N3    . C   A  1 40  ? 14.237  -18.982 21.383 1.00 27.27  ? 54  C   X N3    1 
ATOM   855  C  C4    . C   A  1 40  ? 14.100  -17.943 22.204 1.00 24.73  ? 54  C   X C4    1 
ATOM   856  N  N4    . C   A  1 40  ? 13.655  -16.806 21.678 1.00 25.10  ? 54  C   X N4    1 
ATOM   857  C  C5    . C   A  1 40  ? 14.410  -18.044 23.589 1.00 28.83  ? 54  C   X C5    1 
ATOM   858  C  C6    . C   A  1 40  ? 14.856  -19.227 24.038 1.00 27.61  ? 54  C   X C6    1 
ATOM   859  P  P     . U   A  1 41  ? 20.185  -21.039 24.669 1.00 32.58  ? 55  U   X P     1 
ATOM   860  O  OP1   . U   A  1 41  ? 21.276  -21.797 25.332 1.00 42.09  ? 55  U   X OP1   1 
ATOM   861  O  OP2   . U   A  1 41  ? 19.926  -19.661 25.148 1.00 31.71  ? 55  U   X OP2   1 
ATOM   862  O  "O5'" . U   A  1 41  ? 20.302  -21.073 23.082 1.00 31.93  ? 55  U   X "O5'" 1 
ATOM   863  C  "C5'" . U   A  1 41  ? 20.619  -22.293 22.426 1.00 33.02  ? 55  U   X "C5'" 1 
ATOM   864  C  "C4'" . U   A  1 41  ? 20.488  -22.193 20.929 1.00 30.67  ? 55  U   X "C4'" 1 
ATOM   865  O  "O4'" . U   A  1 41  ? 19.097  -22.025 20.552 1.00 33.74  ? 55  U   X "O4'" 1 
ATOM   866  C  "C3'" . U   A  1 41  ? 21.173  -21.008 20.262 1.00 33.34  ? 55  U   X "C3'" 1 
ATOM   867  O  "O3'" . U   A  1 41  ? 22.566  -21.173 20.107 1.00 36.33  ? 55  U   X "O3'" 1 
ATOM   868  C  "C2'" . U   A  1 41  ? 20.437  -20.949 18.937 1.00 33.35  ? 55  U   X "C2'" 1 
ATOM   869  O  "O2'" . U   A  1 41  ? 20.846  -22.045 18.129 1.00 34.31  ? 55  U   X "O2'" 1 
ATOM   870  C  "C1'" . U   A  1 41  ? 19.007  -21.204 19.406 1.00 31.32  ? 55  U   X "C1'" 1 
ATOM   871  N  N1    . U   A  1 41  ? 18.342  -19.918 19.759 1.00 29.50  ? 55  U   X N1    1 
ATOM   872  C  C2    . U   A  1 41  ? 17.718  -19.228 18.740 1.00 30.43  ? 55  U   X C2    1 
ATOM   873  O  O2    . U   A  1 41  ? 17.681  -19.625 17.588 1.00 32.42  ? 55  U   X O2    1 
ATOM   874  N  N3    . U   A  1 41  ? 17.120  -18.046 19.106 1.00 29.35  ? 55  U   X N3    1 
ATOM   875  C  C4    . U   A  1 41  ? 17.090  -17.469 20.357 1.00 29.60  ? 55  U   X C4    1 
ATOM   876  O  O4    . U   A  1 41  ? 16.508  -16.389 20.493 1.00 30.08  ? 55  U   X O4    1 
ATOM   877  C  C5    . U   A  1 41  ? 17.763  -18.229 21.367 1.00 30.14  ? 55  U   X C5    1 
ATOM   878  C  C6    . U   A  1 41  ? 18.354  -19.398 21.037 1.00 30.91  ? 55  U   X C6    1 
ATOM   879  P  P     . G   A  1 42  ? 23.517  -19.877 19.945 1.00 36.17  ? 56  G   X P     1 
ATOM   880  O  OP1   . G   A  1 42  ? 24.832  -20.517 19.692 1.00 35.80  ? 56  G   X OP1   1 
ATOM   881  O  OP2   . G   A  1 42  ? 23.326  -18.998 21.126 1.00 31.36  ? 56  G   X OP2   1 
ATOM   882  O  "O5'" . G   A  1 42  ? 23.000  -19.142 18.633 1.00 30.68  ? 56  G   X "O5'" 1 
ATOM   883  C  "C5'" . G   A  1 42  ? 23.432  -19.596 17.362 1.00 34.20  ? 56  G   X "C5'" 1 
ATOM   884  C  "C4'" . G   A  1 42  ? 22.808  -18.800 16.250 1.00 35.56  ? 56  G   X "C4'" 1 
ATOM   885  O  "O4'" . G   A  1 42  ? 21.373  -18.739 16.453 1.00 35.48  ? 56  G   X "O4'" 1 
ATOM   886  C  "C3'" . G   A  1 42  ? 23.229  -17.340 16.148 1.00 33.37  ? 56  G   X "C3'" 1 
ATOM   887  O  "O3'" . G   A  1 42  ? 24.475  -17.162 15.494 1.00 35.81  ? 56  G   X "O3'" 1 
ATOM   888  C  "C2'" . G   A  1 42  ? 22.058  -16.725 15.402 1.00 33.96  ? 56  G   X "C2'" 1 
ATOM   889  O  "O2'" . G   A  1 42  ? 22.110  -17.029 14.017 1.00 39.96  ? 56  G   X "O2'" 1 
ATOM   890  C  "C1'" . G   A  1 42  ? 20.887  -17.488 16.018 1.00 33.44  ? 56  G   X "C1'" 1 
ATOM   891  N  N9    . G   A  1 42  ? 20.347  -16.758 17.182 1.00 31.14  ? 56  G   X N9    1 
ATOM   892  C  C8    . G   A  1 42  ? 20.542  -17.012 18.520 1.00 29.92  ? 56  G   X C8    1 
ATOM   893  N  N7    . G   A  1 42  ? 19.907  -16.163 19.291 1.00 28.93  ? 56  G   X N7    1 
ATOM   894  C  C5    . G   A  1 42  ? 19.263  -15.305 18.409 1.00 29.54  ? 56  G   X C5    1 
ATOM   895  C  C6    . G   A  1 42  ? 18.422  -14.182 18.638 1.00 28.30  ? 56  G   X C6    1 
ATOM   896  O  O6    . G   A  1 42  ? 18.057  -13.685 19.713 1.00 25.46  ? 56  G   X O6    1 
ATOM   897  N  N1    . G   A  1 42  ? 17.996  -13.621 17.440 1.00 28.44  ? 56  G   X N1    1 
ATOM   898  C  C2    . G   A  1 42  ? 18.326  -14.062 16.183 1.00 30.47  ? 56  G   X C2    1 
ATOM   899  N  N2    . G   A  1 42  ? 17.811  -13.385 15.149 1.00 32.44  ? 56  G   X N2    1 
ATOM   900  N  N3    . G   A  1 42  ? 19.094  -15.103 15.956 1.00 30.37  ? 56  G   X N3    1 
ATOM   901  C  C4    . G   A  1 42  ? 19.528  -15.665 17.104 1.00 30.22  ? 56  G   X C4    1 
ATOM   902  P  P     . C   A  1 43  ? 25.570  -16.098 16.012 1.00 36.31  ? 57  C   X P     1 
ATOM   903  O  OP1   . C   A  1 43  ? 26.751  -16.297 15.133 1.00 38.59  ? 57  C   X OP1   1 
ATOM   904  O  OP2   . C   A  1 43  ? 25.775  -16.184 17.484 1.00 30.68  ? 57  C   X OP2   1 
ATOM   905  O  "O5'" . C   A  1 43  ? 24.820  -14.767 15.616 1.00 33.18  ? 57  C   X "O5'" 1 
ATOM   906  C  "C5'" . C   A  1 43  ? 24.554  -14.462 14.258 1.00 35.42  ? 57  C   X "C5'" 1 
ATOM   907  C  "C4'" . C   A  1 43  ? 23.624  -13.284 14.152 1.00 33.26  ? 57  C   X "C4'" 1 
ATOM   908  O  "O4'" . C   A  1 43  ? 22.372  -13.609 14.813 1.00 32.24  ? 57  C   X "O4'" 1 
ATOM   909  C  "C3'" . C   A  1 43  ? 24.078  -12.008 14.851 1.00 29.15  ? 57  C   X "C3'" 1 
ATOM   910  O  "O3'" . C   A  1 43  ? 25.029  -11.252 14.118 1.00 31.32  ? 57  C   X "O3'" 1 
ATOM   911  C  "C2'" . C   A  1 43  ? 22.760  -11.282 15.056 1.00 26.76  ? 57  C   X "C2'" 1 
ATOM   912  O  "O2'" . C   A  1 43  ? 22.300  -10.728 13.835 1.00 30.37  ? 57  C   X "O2'" 1 
ATOM   913  C  "C1'" . C   A  1 43  ? 21.835  -12.448 15.415 1.00 29.90  ? 57  C   X "C1'" 1 
ATOM   914  N  N1    . C   A  1 43  ? 21.716  -12.653 16.872 1.00 26.24  ? 57  C   X N1    1 
ATOM   915  C  C2    . C   A  1 43  ? 20.766  -11.897 17.571 1.00 28.20  ? 57  C   X C2    1 
ATOM   916  O  O2    . C   A  1 43  ? 20.082  -11.079 16.937 1.00 26.84  ? 57  C   X O2    1 
ATOM   917  N  N3    . C   A  1 43  ? 20.628  -12.066 18.911 1.00 25.73  ? 57  C   X N3    1 
ATOM   918  C  C4    . C   A  1 43  ? 21.386  -12.957 19.556 1.00 27.16  ? 57  C   X C4    1 
ATOM   919  N  N4    . C   A  1 43  ? 21.204  -13.101 20.876 1.00 23.91  ? 57  C   X N4    1 
ATOM   920  C  C5    . C   A  1 43  ? 22.357  -13.751 18.865 1.00 28.56  ? 57  C   X C5    1 
ATOM   921  C  C6    . C   A  1 43  ? 22.482  -13.566 17.538 1.00 28.17  ? 57  C   X C6    1 
ATOM   922  P  P     . C   A  1 44  ? 26.073  -10.247 14.821 1.00 32.84  ? 58  C   X P     1 
ATOM   923  O  OP1   . C   A  1 44  ? 27.006  -9.890  13.721 1.00 29.43  ? 58  C   X OP1   1 
ATOM   924  O  OP2   . C   A  1 44  ? 26.596  -10.842 16.074 1.00 29.37  ? 58  C   X OP2   1 
ATOM   925  O  "O5'" . C   A  1 44  ? 25.197  -8.984  15.212 1.00 31.06  ? 58  C   X "O5'" 1 
ATOM   926  C  "C5'" . C   A  1 44  ? 24.474  -8.219  14.259 1.00 29.43  ? 58  C   X "C5'" 1 
ATOM   927  C  "C4'" . C   A  1 44  ? 23.674  -7.156  14.963 1.00 28.75  ? 58  C   X "C4'" 1 
ATOM   928  O  "O4'" . C   A  1 44  ? 22.568  -7.771  15.688 1.00 27.35  ? 58  C   X "O4'" 1 
ATOM   929  C  "C3'" . C   A  1 44  ? 24.430  -6.385  16.040 1.00 24.53  ? 58  C   X "C3'" 1 
ATOM   930  O  "O3'" . C   A  1 44  ? 25.271  -5.357  15.531 1.00 20.46  ? 58  C   X "O3'" 1 
ATOM   931  C  "C2'" . C   A  1 44  ? 23.288  -5.873  16.907 1.00 23.66  ? 58  C   X "C2'" 1 
ATOM   932  O  "O2'" . C   A  1 44  ? 22.613  -4.834  16.213 1.00 27.06  ? 58  C   X "O2'" 1 
ATOM   933  C  "C1'" . C   A  1 44  ? 22.354  -7.079  16.906 1.00 25.15  ? 58  C   X "C1'" 1 
ATOM   934  N  N1    . C   A  1 44  ? 22.590  -7.978  18.055 1.00 26.67  ? 58  C   X N1    1 
ATOM   935  C  C2    . C   A  1 44  ? 22.047  -7.630  19.298 1.00 24.77  ? 58  C   X C2    1 
ATOM   936  O  O2    . C   A  1 44  ? 21.412  -6.577  19.394 1.00 25.21  ? 58  C   X O2    1 
ATOM   937  N  N3    . C   A  1 44  ? 22.235  -8.432  20.361 1.00 25.06  ? 58  C   X N3    1 
ATOM   938  C  C4    . C   A  1 44  ? 22.928  -9.565  20.235 1.00 27.25  ? 58  C   X C4    1 
ATOM   939  N  N4    . C   A  1 44  ? 23.087  -10.324 21.324 1.00 24.07  ? 58  C   X N4    1 
ATOM   940  C  C5    . C   A  1 44  ? 23.502  -9.952  18.983 1.00 27.00  ? 58  C   X C5    1 
ATOM   941  C  C6    . C   A  1 44  ? 23.301  -9.137  17.929 1.00 27.51  ? 58  C   X C6    1 
ATOM   942  P  P     . C   A  1 45  ? 26.445  -4.734  16.460 1.00 26.35  ? 59  C   X P     1 
ATOM   943  O  OP1   . C   A  1 45  ? 27.117  -3.808  15.536 1.00 26.00  ? 59  C   X OP1   1 
ATOM   944  O  OP2   . C   A  1 45  ? 27.250  -5.780  17.122 1.00 26.89  ? 59  C   X OP2   1 
ATOM   945  O  "O5'" . C   A  1 45  ? 25.691  -3.918  17.607 1.00 23.40  ? 59  C   X "O5'" 1 
ATOM   946  C  "C5'" . C   A  1 45  ? 24.803  -2.841  17.367 1.00 22.91  ? 59  C   X "C5'" 1 
ATOM   947  C  "C4'" . C   A  1 45  ? 24.263  -2.326  18.675 1.00 22.10  ? 59  C   X "C4'" 1 
ATOM   948  O  "O4'" . C   A  1 45  ? 23.486  -3.370  19.322 1.00 20.26  ? 59  C   X "O4'" 1 
ATOM   949  C  "C3'" . C   A  1 45  ? 25.327  -1.968  19.706 1.00 22.91  ? 59  C   X "C3'" 1 
ATOM   950  O  "O3'" . C   A  1 45  ? 25.889  -0.683  19.508 1.00 20.30  ? 59  C   X "O3'" 1 
ATOM   951  C  "C2'" . C   A  1 45  ? 24.569  -2.093  21.017 1.00 21.08  ? 59  C   X "C2'" 1 
ATOM   952  O  "O2'" . C   A  1 45  ? 23.738  -0.956  21.212 1.00 22.36  ? 59  C   X "O2'" 1 
ATOM   953  C  "C1'" . C   A  1 45  ? 23.670  -3.293  20.725 1.00 22.84  ? 59  C   X "C1'" 1 
ATOM   954  N  N1    . C   A  1 45  ? 24.161  -4.595  21.251 1.00 21.38  ? 59  C   X N1    1 
ATOM   955  C  C2    . C   A  1 45  ? 23.941  -4.907  22.594 1.00 22.67  ? 59  C   X C2    1 
ATOM   956  O  O2    . C   A  1 45  ? 23.391  -4.080  23.322 1.00 22.02  ? 59  C   X O2    1 
ATOM   957  N  N3    . C   A  1 45  ? 24.343  -6.107  23.072 1.00 23.43  ? 59  C   X N3    1 
ATOM   958  C  C4    . C   A  1 45  ? 24.945  -6.985  22.267 1.00 23.98  ? 59  C   X C4    1 
ATOM   959  N  N4    . C   A  1 45  ? 25.333  -8.157  22.794 1.00 23.29  ? 59  C   X N4    1 
ATOM   960  C  C5    . C   A  1 45  ? 25.166  -6.699  20.888 1.00 22.74  ? 59  C   X C5    1 
ATOM   961  C  C6    . C   A  1 45  ? 24.761  -5.506  20.435 1.00 23.28  ? 59  C   X C6    1 
ATOM   962  P  P     . A   A  1 46  ? 27.410  -0.370  19.895 1.00 23.90  ? 60  A   X P     1 
ATOM   963  O  OP1   . A   A  1 46  ? 27.656  0.898   19.176 1.00 25.96  ? 60  A   X OP1   1 
ATOM   964  O  OP2   . A   A  1 46  ? 28.206  -1.584  19.558 1.00 25.39  ? 60  A   X OP2   1 
ATOM   965  O  "O5'" . A   A  1 46  ? 27.420  -0.069  21.456 1.00 20.23  ? 60  A   X "O5'" 1 
ATOM   966  C  "C5'" . A   A  1 46  ? 26.702  1.040   21.973 1.00 22.07  ? 60  A   X "C5'" 1 
ATOM   967  C  "C4'" . A   A  1 46  ? 26.698  1.004   23.477 1.00 22.24  ? 60  A   X "C4'" 1 
ATOM   968  O  "O4'" . A   A  1 46  ? 25.772  -0.016  23.927 1.00 24.76  ? 60  A   X "O4'" 1 
ATOM   969  C  "C3'" . A   A  1 46  ? 28.026  0.631   24.125 1.00 24.18  ? 60  A   X "C3'" 1 
ATOM   970  O  "O3'" . A   A  1 46  ? 28.895  1.741   24.227 1.00 25.43  ? 60  A   X "O3'" 1 
ATOM   971  C  "C2'" . A   A  1 46  ? 27.565  0.110   25.477 1.00 22.73  ? 60  A   X "C2'" 1 
ATOM   972  O  "O2'" . A   A  1 46  ? 27.200  1.206   26.302 1.00 24.55  ? 60  A   X "O2'" 1 
ATOM   973  C  "C1'" . A   A  1 46  ? 26.278  -0.629  25.093 1.00 23.97  ? 60  A   X "C1'" 1 
ATOM   974  N  N9    . A   A  1 46  ? 26.528  -2.058  24.808 1.00 23.68  ? 60  A   X N9    1 
ATOM   975  C  C8    . A   A  1 46  ? 26.918  -2.645  23.624 1.00 23.16  ? 60  A   X C8    1 
ATOM   976  N  N7    . A   A  1 46  ? 27.061  -3.954  23.706 1.00 22.31  ? 60  A   X N7    1 
ATOM   977  C  C5    . A   A  1 46  ? 26.764  -4.239  25.036 1.00 23.30  ? 60  A   X C5    1 
ATOM   978  C  C6    . A   A  1 46  ? 26.731  -5.444  25.765 1.00 22.64  ? 60  A   X C6    1 
ATOM   979  N  N6    . A   A  1 46  ? 27.024  -6.639  25.248 1.00 23.48  ? 60  A   X N6    1 
ATOM   980  N  N1    . A   A  1 46  ? 26.394  -5.375  27.069 1.00 23.70  ? 60  A   X N1    1 
ATOM   981  C  C2    . A   A  1 46  ? 26.096  -4.182  27.599 1.00 23.18  ? 60  A   X C2    1 
ATOM   982  N  N3    . A   A  1 46  ? 26.082  -2.983  27.011 1.00 27.33  ? 60  A   X N3    1 
ATOM   983  C  C4    . A   A  1 46  ? 26.436  -3.082  25.718 1.00 22.30  ? 60  A   X C4    1 
ATOM   984  P  P     . A   A  1 47  ? 30.459  1.706   23.848 1.00 28.67  ? 61  A   X P     1 
ATOM   985  O  OP1   . A   A  1 47  ? 30.724  3.112   23.461 1.00 33.30  ? 61  A   X OP1   1 
ATOM   986  O  OP2   . A   A  1 47  ? 30.712  0.647   22.850 1.00 30.80  ? 61  A   X OP2   1 
ATOM   987  O  "O5'" . A   A  1 47  ? 31.160  1.313   25.234 1.00 27.12  ? 61  A   X "O5'" 1 
ATOM   988  C  "C5'" . A   A  1 47  ? 31.086  2.192   26.347 1.00 34.19  ? 61  A   X "C5'" 1 
ATOM   989  C  "C4'" . A   A  1 47  ? 32.307  2.181   27.248 1.00 29.34  ? 61  A   X "C4'" 1 
ATOM   990  O  "O4'" . A   A  1 47  ? 32.436  0.901   27.922 1.00 34.78  ? 61  A   X "O4'" 1 
ATOM   991  C  "C3'" . A   A  1 47  ? 33.690  2.408   26.643 1.00 34.60  ? 61  A   X "C3'" 1 
ATOM   992  O  "O3'" . A   A  1 47  ? 33.971  3.762   26.297 1.00 36.55  ? 61  A   X "O3'" 1 
ATOM   993  C  "C2'" . A   A  1 47  ? 34.587  1.902   27.769 1.00 32.85  ? 61  A   X "C2'" 1 
ATOM   994  O  "O2'" . A   A  1 47  ? 34.640  2.843   28.833 1.00 25.61  ? 61  A   X "O2'" 1 
ATOM   995  C  "C1'" . A   A  1 47  ? 33.789  0.707   28.285 1.00 30.89  ? 61  A   X "C1'" 1 
ATOM   996  N  N9    . A   A  1 47  ? 34.278  -0.558  27.729 1.00 28.16  ? 61  A   X N9    1 
ATOM   997  C  C8    . A   A  1 47  ? 33.937  -1.166  26.551 1.00 29.46  ? 61  A   X C8    1 
ATOM   998  N  N7    . A   A  1 47  ? 34.560  -2.306  26.377 1.00 30.31  ? 61  A   X N7    1 
ATOM   999  C  C5    . A   A  1 47  ? 35.352  -2.465  27.509 1.00 29.17  ? 61  A   X C5    1 
ATOM   1000 C  C6    . A   A  1 47  ? 36.252  -3.470  27.920 1.00 26.12  ? 61  A   X C6    1 
ATOM   1001 N  N6    . A   A  1 47  ? 36.527  -4.578  27.225 1.00 28.17  ? 61  A   X N6    1 
ATOM   1002 N  N1    . A   A  1 47  ? 36.867  -3.300  29.106 1.00 24.33  ? 61  A   X N1    1 
ATOM   1003 C  C2    . A   A  1 47  ? 36.607  -2.191  29.821 1.00 26.67  ? 61  A   X C2    1 
ATOM   1004 N  N3    . A   A  1 47  ? 35.781  -1.179  29.537 1.00 26.86  ? 61  A   X N3    1 
ATOM   1005 C  C4    . A   A  1 47  ? 35.182  -1.385  28.354 1.00 28.78  ? 61  A   X C4    1 
ATOM   1006 P  P     . A   A  1 48  ? 35.230  4.158   25.355 1.00 41.84  ? 62  A   X P     1 
ATOM   1007 O  OP1   . A   A  1 48  ? 35.007  5.585   25.031 1.00 38.24  ? 62  A   X OP1   1 
ATOM   1008 O  OP2   . A   A  1 48  ? 35.348  3.186   24.246 1.00 39.34  ? 62  A   X OP2   1 
ATOM   1009 O  "O5'" . A   A  1 48  ? 36.514  4.002   26.297 1.00 39.15  ? 62  A   X "O5'" 1 
ATOM   1010 C  "C5'" . A   A  1 48  ? 36.810  4.869   27.384 1.00 35.41  ? 62  A   X "C5'" 1 
ATOM   1011 C  "C4'" . A   A  1 48  ? 37.976  4.352   28.191 1.00 36.20  ? 62  A   X "C4'" 1 
ATOM   1012 O  "O4'" . A   A  1 48  ? 37.631  3.064   28.766 1.00 30.53  ? 62  A   X "O4'" 1 
ATOM   1013 C  "C3'" . A   A  1 48  ? 39.271  4.064   27.437 1.00 34.90  ? 62  A   X "C3'" 1 
ATOM   1014 O  "O3'" . A   A  1 48  ? 40.037  5.223   27.160 1.00 43.22  ? 62  A   X "O3'" 1 
ATOM   1015 C  "C2'" . A   A  1 48  ? 39.962  3.117   28.403 1.00 35.16  ? 62  A   X "C2'" 1 
ATOM   1016 O  "O2'" . A   A  1 48  ? 40.405  3.848   29.538 1.00 32.56  ? 62  A   X "O2'" 1 
ATOM   1017 C  "C1'" . A   A  1 48  ? 38.780  2.246   28.825 1.00 32.38  ? 62  A   X "C1'" 1 
ATOM   1018 N  N9    . A   A  1 48  ? 38.626  1.126   27.880 1.00 30.28  ? 62  A   X N9    1 
ATOM   1019 C  C8    . A   A  1 48  ? 37.946  1.107   26.684 1.00 32.78  ? 62  A   X C8    1 
ATOM   1020 N  N7    . A   A  1 48  ? 38.005  -0.047  26.058 1.00 30.08  ? 62  A   X N7    1 
ATOM   1021 C  C5    . A   A  1 48  ? 38.785  -0.837  26.897 1.00 30.99  ? 62  A   X C5    1 
ATOM   1022 C  C6    . A   A  1 48  ? 39.218  -2.173  26.805 1.00 32.17  ? 62  A   X C6    1 
ATOM   1023 N  N6    . A   A  1 48  ? 38.922  -2.977  25.780 1.00 31.96  ? 62  A   X N6    1 
ATOM   1024 N  N1    . A   A  1 48  ? 39.973  -2.663  27.818 1.00 30.54  ? 62  A   X N1    1 
ATOM   1025 C  C2    . A   A  1 48  ? 40.271  -1.854  28.845 1.00 28.35  ? 62  A   X C2    1 
ATOM   1026 N  N3    . A   A  1 48  ? 39.917  -0.584  29.053 1.00 29.69  ? 62  A   X N3    1 
ATOM   1027 C  C4    . A   A  1 48  ? 39.174  -0.129  28.021 1.00 30.15  ? 62  A   X C4    1 
ATOM   1028 P  P     . A   A  1 49  ? 41.094  5.302   25.939 1.00 48.32  ? 63  A   X P     1 
ATOM   1029 O  OP1   . A   A  1 49  ? 41.673  6.658   26.120 1.00 46.11  ? 63  A   X OP1   1 
ATOM   1030 O  OP2   . A   A  1 49  ? 40.374  4.936   24.687 1.00 43.84  ? 63  A   X OP2   1 
ATOM   1031 O  "O5'" . A   A  1 49  ? 42.214  4.205   26.207 1.00 41.35  ? 63  A   X "O5'" 1 
ATOM   1032 C  "C5'" . A   A  1 49  ? 43.132  4.311   27.280 1.00 42.85  ? 63  A   X "C5'" 1 
ATOM   1033 C  "C4'" . A   A  1 49  ? 44.048  3.116   27.326 1.00 45.74  ? 63  A   X "C4'" 1 
ATOM   1034 O  "O4'" . A   A  1 49  ? 43.287  1.913   27.620 1.00 43.29  ? 63  A   X "O4'" 1 
ATOM   1035 C  "C3'" . A   A  1 49  ? 44.780  2.780   26.036 1.00 44.35  ? 63  A   X "C3'" 1 
ATOM   1036 O  "O3'" . A   A  1 49  ? 45.917  3.598   25.815 1.00 50.36  ? 63  A   X "O3'" 1 
ATOM   1037 C  "C2'" . A   A  1 49  ? 45.109  1.302   26.222 1.00 46.65  ? 63  A   X "C2'" 1 
ATOM   1038 O  "O2'" . A   A  1 49  ? 46.239  1.123   27.064 1.00 46.80  ? 63  A   X "O2'" 1 
ATOM   1039 C  "C1'" . A   A  1 49  ? 43.868  0.804   26.964 1.00 41.52  ? 63  A   X "C1'" 1 
ATOM   1040 N  N9    . A   A  1 49  ? 42.879  0.242   26.029 1.00 38.21  ? 63  A   X N9    1 
ATOM   1041 C  C8    . A   A  1 49  ? 41.764  0.863   25.516 1.00 38.76  ? 63  A   X C8    1 
ATOM   1042 N  N7    . A   A  1 49  ? 41.079  0.103   24.701 1.00 39.50  ? 63  A   X N7    1 
ATOM   1043 C  C5    . A   A  1 49  ? 41.787  -1.093  24.687 1.00 38.64  ? 63  A   X C5    1 
ATOM   1044 C  C6    . A   A  1 49  ? 41.575  -2.305  24.006 1.00 39.57  ? 63  A   X C6    1 
ATOM   1045 N  N6    . A   A  1 49  ? 40.536  -2.512  23.186 1.00 43.40  ? 63  A   X N6    1 
ATOM   1046 N  N1    . A   A  1 49  ? 42.468  -3.299  24.202 1.00 40.49  ? 63  A   X N1    1 
ATOM   1047 C  C2    . A   A  1 49  ? 43.501  -3.078  25.025 1.00 38.07  ? 63  A   X C2    1 
ATOM   1048 N  N3    . A   A  1 49  ? 43.807  -1.985  25.720 1.00 38.40  ? 63  A   X N3    1 
ATOM   1049 C  C4    . A   A  1 49  ? 42.898  -1.020  25.500 1.00 39.50  ? 63  A   X C4    1 
ATOM   1050 P  P     . A   A  1 50  ? 46.397  4.008   24.330 1.00 49.59  ? 64  A   X P     1 
ATOM   1051 O  OP1   . A   A  1 50  ? 47.547  4.906   24.598 1.00 59.27  ? 64  A   X OP1   1 
ATOM   1052 O  OP2   . A   A  1 50  ? 45.223  4.517   23.574 1.00 49.47  ? 64  A   X OP2   1 
ATOM   1053 O  "O5'" . A   A  1 50  ? 46.914  2.659   23.665 1.00 48.95  ? 64  A   X "O5'" 1 
ATOM   1054 C  "C5'" . A   A  1 50  ? 48.114  2.029   24.081 1.00 45.65  ? 64  A   X "C5'" 1 
ATOM   1055 C  "C4'" . A   A  1 50  ? 48.176  0.618   23.564 1.00 45.59  ? 64  A   X "C4'" 1 
ATOM   1056 O  "O4'" . A   A  1 50  ? 47.019  -0.111  24.047 1.00 46.32  ? 64  A   X "O4'" 1 
ATOM   1057 C  "C3'" . A   A  1 50  ? 48.106  0.468   22.052 1.00 48.24  ? 64  A   X "C3'" 1 
ATOM   1058 O  "O3'" . A   A  1 50  ? 49.362  0.641   21.419 1.00 51.74  ? 64  A   X "O3'" 1 
ATOM   1059 C  "C2'" . A   A  1 50  ? 47.522  -0.928  21.874 1.00 48.39  ? 64  A   X "C2'" 1 
ATOM   1060 O  "O2'" . A   A  1 50  ? 48.516  -1.930  22.041 1.00 45.09  ? 64  A   X "O2'" 1 
ATOM   1061 C  "C1'" . A   A  1 50  ? 46.545  -0.992  23.048 1.00 46.51  ? 64  A   X "C1'" 1 
ATOM   1062 N  N9    . A   A  1 50  ? 45.213  -0.533  22.627 1.00 43.98  ? 64  A   X N9    1 
ATOM   1063 C  C8    . A   A  1 50  ? 44.608  0.664   22.923 1.00 43.97  ? 64  A   X C8    1 
ATOM   1064 N  N7    . A   A  1 50  ? 43.419  0.792   22.384 1.00 45.68  ? 64  A   X N7    1 
ATOM   1065 C  C5    . A   A  1 50  ? 43.240  -0.396  21.684 1.00 41.97  ? 64  A   X C5    1 
ATOM   1066 C  C6    . A   A  1 50  ? 42.176  -0.878  20.896 1.00 44.75  ? 64  A   X C6    1 
ATOM   1067 N  N6    . A   A  1 50  ? 41.053  -0.187  20.674 1.00 42.60  ? 64  A   X N6    1 
ATOM   1068 N  N1    . A   A  1 50  ? 42.316  -2.104  20.332 1.00 45.36  ? 64  A   X N1    1 
ATOM   1069 C  C2    . A   A  1 50  ? 43.453  -2.786  20.562 1.00 46.61  ? 64  A   X C2    1 
ATOM   1070 N  N3    . A   A  1 50  ? 44.520  -2.439  21.286 1.00 43.69  ? 64  A   X N3    1 
ATOM   1071 C  C4    . A   A  1 50  ? 44.342  -1.219  21.823 1.00 42.67  ? 64  A   X C4    1 
ATOM   1072 P  P     . U   A  1 51  ? 49.542  1.704   20.223 1.00 53.10  ? 65  U   X P     1 
ATOM   1073 O  OP1   . U   A  1 51  ? 50.977  1.630   19.845 1.00 55.71  ? 65  U   X OP1   1 
ATOM   1074 O  OP2   . U   A  1 51  ? 49.006  3.007   20.709 1.00 49.63  ? 65  U   X OP2   1 
ATOM   1075 O  "O5'" . U   A  1 51  ? 48.677  1.053   19.057 1.00 47.39  ? 65  U   X "O5'" 1 
ATOM   1076 C  "C5'" . U   A  1 51  ? 49.033  -0.250  18.619 1.00 46.50  ? 65  U   X "C5'" 1 
ATOM   1077 C  "C4'" . U   A  1 51  ? 47.946  -0.890  17.794 1.00 45.96  ? 65  U   X "C4'" 1 
ATOM   1078 O  "O4'" . U   A  1 51  ? 46.753  -1.071  18.599 1.00 49.68  ? 65  U   X "O4'" 1 
ATOM   1079 C  "C3'" . U   A  1 51  ? 47.461  -0.089  16.598 1.00 46.12  ? 65  U   X "C3'" 1 
ATOM   1080 O  "O3'" . U   A  1 51  ? 48.322  -0.210  15.482 1.00 47.38  ? 65  U   X "O3'" 1 
ATOM   1081 C  "C2'" . U   A  1 51  ? 46.071  -0.666  16.365 1.00 45.15  ? 65  U   X "C2'" 1 
ATOM   1082 O  "O2'" . U   A  1 51  ? 46.166  -1.934  15.727 1.00 47.22  ? 65  U   X "O2'" 1 
ATOM   1083 C  "C1'" . U   A  1 51  ? 45.601  -0.882  17.806 1.00 45.86  ? 65  U   X "C1'" 1 
ATOM   1084 N  N1    . U   A  1 51  ? 44.906  0.296   18.369 1.00 44.68  ? 65  U   X N1    1 
ATOM   1085 C  C2    . U   A  1 51  ? 43.525  0.365   18.246 1.00 45.20  ? 65  U   X C2    1 
ATOM   1086 O  O2    . U   A  1 51  ? 42.875  -0.513  17.689 1.00 45.09  ? 65  U   X O2    1 
ATOM   1087 N  N3    . U   A  1 51  ? 42.946  1.494   18.792 1.00 42.10  ? 65  U   X N3    1 
ATOM   1088 C  C4    . U   A  1 51  ? 43.600  2.533   19.437 1.00 43.27  ? 65  U   X C4    1 
ATOM   1089 O  O4    . U   A  1 51  ? 42.963  3.491   19.889 1.00 41.30  ? 65  U   X O4    1 
ATOM   1090 C  C5    . U   A  1 51  ? 45.021  2.376   19.519 1.00 45.31  ? 65  U   X C5    1 
ATOM   1091 C  C6    . U   A  1 51  ? 45.611  1.292   18.998 1.00 44.28  ? 65  U   X C6    1 
ATOM   1092 P  P     . G   A  1 52  ? 48.482  1.040   14.479 1.00 52.81  ? 66  G   X P     1 
ATOM   1093 O  OP1   . G   A  1 52  ? 49.495  0.638   13.470 1.00 50.88  ? 66  G   X OP1   1 
ATOM   1094 O  OP2   . G   A  1 52  ? 48.715  2.266   15.283 1.00 40.29  ? 66  G   X OP2   1 
ATOM   1095 O  "O5'" . G   A  1 52  ? 47.043  1.050   13.799 1.00 41.43  ? 66  G   X "O5'" 1 
ATOM   1096 C  "C5'" . G   A  1 52  ? 46.733  0.077   12.817 1.00 38.01  ? 66  G   X "C5'" 1 
ATOM   1097 C  "C4'" . G   A  1 52  ? 45.433  0.409   12.135 1.00 40.44  ? 66  G   X "C4'" 1 
ATOM   1098 O  "O4'" . G   A  1 52  ? 44.345  0.179   13.065 1.00 41.75  ? 66  G   X "O4'" 1 
ATOM   1099 C  "C3'" . G   A  1 52  ? 45.243  1.858   11.702 1.00 36.68  ? 66  G   X "C3'" 1 
ATOM   1100 O  "O3'" . G   A  1 52  ? 45.894  2.174   10.480 1.00 34.20  ? 66  G   X "O3'" 1 
ATOM   1101 C  "C2'" . G   A  1 52  ? 43.724  1.960   11.642 1.00 35.46  ? 66  G   X "C2'" 1 
ATOM   1102 O  "O2'" . G   A  1 52  ? 43.225  1.283   10.502 1.00 33.96  ? 66  G   X "O2'" 1 
ATOM   1103 C  "C1'" . G   A  1 52  ? 43.320  1.125   12.855 1.00 33.91  ? 66  G   X "C1'" 1 
ATOM   1104 N  N9    . G   A  1 52  ? 43.182  1.930   14.083 1.00 37.11  ? 66  G   X N9    1 
ATOM   1105 C  C8    . G   A  1 52  ? 44.114  2.058   15.088 1.00 36.96  ? 66  G   X C8    1 
ATOM   1106 N  N7    . G   A  1 52  ? 43.707  2.830   16.059 1.00 38.04  ? 66  G   X N7    1 
ATOM   1107 C  C5    . G   A  1 52  ? 42.429  3.228   15.674 1.00 35.82  ? 66  G   X C5    1 
ATOM   1108 C  C6    . G   A  1 52  ? 41.496  4.076   16.325 1.00 32.83  ? 66  G   X C6    1 
ATOM   1109 O  O6    . G   A  1 52  ? 41.631  4.653   17.409 1.00 32.51  ? 66  G   X O6    1 
ATOM   1110 N  N1    . G   A  1 52  ? 40.331  4.226   15.586 1.00 27.93  ? 66  G   X N1    1 
ATOM   1111 C  C2    . G   A  1 52  ? 40.089  3.635   14.369 1.00 29.82  ? 66  G   X C2    1 
ATOM   1112 N  N2    . G   A  1 52  ? 38.899  3.881   13.799 1.00 29.30  ? 66  G   X N2    1 
ATOM   1113 N  N3    . G   A  1 52  ? 40.951  2.842   13.756 1.00 31.35  ? 66  G   X N3    1 
ATOM   1114 C  C4    . G   A  1 52  ? 42.089  2.683   14.460 1.00 32.84  ? 66  G   X C4    1 
ATOM   1115 P  P     . U   A  1 53  ? 46.566  3.614   10.206 1.00 37.60  ? 67  U   X P     1 
ATOM   1116 O  OP1   . U   A  1 53  ? 47.290  3.474   8.921  1.00 36.24  ? 67  U   X OP1   1 
ATOM   1117 O  OP2   . U   A  1 53  ? 47.330  4.069   11.397 1.00 36.85  ? 67  U   X OP2   1 
ATOM   1118 O  "O5'" . U   A  1 53  ? 45.271  4.519   9.987  1.00 34.30  ? 67  U   X "O5'" 1 
ATOM   1119 C  "C5'" . U   A  1 53  ? 44.378  4.256   8.917  1.00 35.48  ? 67  U   X "C5'" 1 
ATOM   1120 C  "C4'" . U   A  1 53  ? 43.087  5.021   9.085  1.00 35.37  ? 67  U   X "C4'" 1 
ATOM   1121 O  "O4'" . U   A  1 53  ? 42.403  4.551   10.276 1.00 36.32  ? 67  U   X "O4'" 1 
ATOM   1122 C  "C3'" . U   A  1 53  ? 43.225  6.520   9.316  1.00 33.40  ? 67  U   X "C3'" 1 
ATOM   1123 O  "O3'" . U   A  1 53  ? 43.434  7.261   8.123  1.00 28.76  ? 67  U   X "O3'" 1 
ATOM   1124 C  "C2'" . U   A  1 53  ? 41.917  6.848   10.022 1.00 32.48  ? 67  U   X "C2'" 1 
ATOM   1125 O  "O2'" . U   A  1 53  ? 40.841  6.810   9.097  1.00 31.94  ? 67  U   X "O2'" 1 
ATOM   1126 C  "C1'" . U   A  1 53  ? 41.771  5.628   10.927 1.00 30.47  ? 67  U   X "C1'" 1 
ATOM   1127 N  N1    . U   A  1 53  ? 42.389  5.807   12.253 1.00 29.31  ? 67  U   X N1    1 
ATOM   1128 C  C2    . U   A  1 53  ? 41.659  6.508   13.184 1.00 30.87  ? 67  U   X C2    1 
ATOM   1129 O  O2    . U   A  1 53  ? 40.584  6.975   12.927 1.00 27.10  ? 67  U   X O2    1 
ATOM   1130 N  N3    . U   A  1 53  ? 42.218  6.664   14.416 1.00 30.21  ? 67  U   X N3    1 
ATOM   1131 C  C4    . U   A  1 53  ? 43.442  6.188   14.811 1.00 31.62  ? 67  U   X C4    1 
ATOM   1132 O  O4    . U   A  1 53  ? 43.817  6.424   15.957 1.00 34.43  ? 67  U   X O4    1 
ATOM   1133 C  C5    . U   A  1 53  ? 44.158  5.462   13.798 1.00 33.71  ? 67  U   X C5    1 
ATOM   1134 C  C6    . U   A  1 53  ? 43.624  5.300   12.581 1.00 33.79  ? 67  U   X C6    1 
ATOM   1135 P  P     . C   A  1 54  ? 44.277  8.624   8.096  1.00 36.46  ? 68  C   X P     1 
ATOM   1136 O  OP1   . C   A  1 54  ? 44.414  8.898   6.645  1.00 30.97  ? 68  C   X OP1   1 
ATOM   1137 O  OP2   . C   A  1 54  ? 45.485  8.495   8.946  1.00 32.56  ? 68  C   X OP2   1 
ATOM   1138 O  "O5'" . C   A  1 54  ? 43.330  9.706   8.787  1.00 30.61  ? 68  C   X "O5'" 1 
ATOM   1139 C  "C5'" . C   A  1 54  ? 42.087  10.107  8.238  1.00 27.73  ? 68  C   X "C5'" 1 
ATOM   1140 C  "C4'" . C   A  1 54  ? 41.406  11.096  9.153  1.00 28.08  ? 68  C   X "C4'" 1 
ATOM   1141 O  "O4'" . C   A  1 54  ? 40.942  10.410  10.350 1.00 29.01  ? 68  C   X "O4'" 1 
ATOM   1142 C  "C3'" . C   A  1 54  ? 42.259  12.238  9.692  1.00 27.59  ? 68  C   X "C3'" 1 
ATOM   1143 O  "O3'" . C   A  1 54  ? 42.448  13.301  8.757  1.00 26.46  ? 68  C   X "O3'" 1 
ATOM   1144 C  "C2'" . C   A  1 54  ? 41.473  12.661  10.930 1.00 27.11  ? 68  C   X "C2'" 1 
ATOM   1145 O  "O2'" . C   A  1 54  ? 40.365  13.481  10.570 1.00 23.51  ? 68  C   X "O2'" 1 
ATOM   1146 C  "C1'" . C   A  1 54  ? 40.950  11.314  11.437 1.00 26.29  ? 68  C   X "C1'" 1 
ATOM   1147 N  N1    . C   A  1 54  ? 41.816  10.813  12.514 1.00 27.72  ? 68  C   X N1    1 
ATOM   1148 C  C2    . C   A  1 54  ? 41.581  11.288  13.802 1.00 24.81  ? 68  C   X C2    1 
ATOM   1149 O  O2    . C   A  1 54  ? 40.655  12.088  13.966 1.00 25.51  ? 68  C   X O2    1 
ATOM   1150 N  N3    . C   A  1 54  ? 42.361  10.875  14.826 1.00 26.23  ? 68  C   X N3    1 
ATOM   1151 C  C4    . C   A  1 54  ? 43.353  10.007  14.587 1.00 28.56  ? 68  C   X C4    1 
ATOM   1152 N  N4    . C   A  1 54  ? 44.111  9.611   15.619 1.00 27.95  ? 68  C   X N4    1 
ATOM   1153 C  C5    . C   A  1 54  ? 43.614  9.510   13.276 1.00 26.68  ? 68  C   X C5    1 
ATOM   1154 C  C6    . C   A  1 54  ? 42.834  9.935   12.274 1.00 28.41  ? 68  C   X C6    1 
ATOM   1155 P  P     . C   A  1 55  ? 43.788  14.179  8.799  1.00 29.43  ? 69  C   X P     1 
ATOM   1156 O  OP1   . C   A  1 55  ? 43.576  15.098  7.648  1.00 34.79  ? 69  C   X OP1   1 
ATOM   1157 O  OP2   . C   A  1 55  ? 44.947  13.259  8.840  1.00 32.63  ? 69  C   X OP2   1 
ATOM   1158 O  "O5'" . C   A  1 55  ? 43.714  15.009  10.157 1.00 28.86  ? 69  C   X "O5'" 1 
ATOM   1159 C  "C5'" . C   A  1 55  ? 42.680  15.955  10.372 1.00 26.35  ? 69  C   X "C5'" 1 
ATOM   1160 C  "C4'" . C   A  1 55  ? 42.653  16.419  11.808 1.00 27.32  ? 69  C   X "C4'" 1 
ATOM   1161 O  "O4'" . C   A  1 55  ? 42.376  15.293  12.685 1.00 26.00  ? 69  C   X "O4'" 1 
ATOM   1162 C  "C3'" . C   A  1 55  ? 43.951  16.998  12.353 1.00 27.51  ? 69  C   X "C3'" 1 
ATOM   1163 O  "O3'" . C   A  1 55  ? 44.186  18.337  11.936 1.00 33.42  ? 69  C   X "O3'" 1 
ATOM   1164 C  "C2'" . C   A  1 55  ? 43.775  16.829  13.860 1.00 27.57  ? 69  C   X "C2'" 1 
ATOM   1165 O  "O2'" . C   A  1 55  ? 42.990  17.878  14.424 1.00 24.44  ? 69  C   X "O2'" 1 
ATOM   1166 C  "C1'" . C   A  1 55  ? 43.002  15.504  13.932 1.00 25.14  ? 69  C   X "C1'" 1 
ATOM   1167 N  N1    . C   A  1 55  ? 43.948  14.417  14.201 1.00 27.65  ? 69  C   X N1    1 
ATOM   1168 C  C2    . C   A  1 55  ? 44.215  14.139  15.540 1.00 29.72  ? 69  C   X C2    1 
ATOM   1169 O  O2    . C   A  1 55  ? 43.601  14.811  16.383 1.00 28.48  ? 69  C   X O2    1 
ATOM   1170 N  N3    . C   A  1 55  ? 45.101  13.162  15.859 1.00 30.83  ? 69  C   X N3    1 
ATOM   1171 C  C4    . C   A  1 55  ? 45.711  12.494  14.870 1.00 32.54  ? 69  C   X C4    1 
ATOM   1172 N  N4    . C   A  1 55  ? 46.581  11.526  15.192 1.00 36.97  ? 69  C   X N4    1 
ATOM   1173 C  C5    . C   A  1 55  ? 45.455  12.769  13.493 1.00 30.89  ? 69  C   X C5    1 
ATOM   1174 C  C6    . C   A  1 55  ? 44.575  13.739  13.203 1.00 30.42  ? 69  C   X C6    1 
ATOM   1175 P  P     . A   A  1 56  ? 45.640  18.825  11.400 1.00 32.92  ? 70  A   X P     1 
ATOM   1176 O  OP1   . A   A  1 56  ? 45.395  20.190  10.865 1.00 34.35  ? 70  A   X OP1   1 
ATOM   1177 O  OP2   . A   A  1 56  ? 46.205  17.805  10.485 1.00 35.70  ? 70  A   X OP2   1 
ATOM   1178 O  "O5'" . A   A  1 56  ? 46.446  18.863  12.773 1.00 28.01  ? 70  A   X "O5'" 1 
ATOM   1179 C  "C5'" . A   A  1 56  ? 47.752  19.418  12.818 1.00 33.77  ? 70  A   X "C5'" 1 
ATOM   1180 C  "C4'" . A   A  1 56  ? 47.967  20.226  14.073 1.00 30.22  ? 70  A   X "C4'" 1 
ATOM   1181 O  "O4'" . A   A  1 56  ? 47.227  21.466  13.991 1.00 26.39  ? 70  A   X "O4'" 1 
ATOM   1182 C  "C3'" . A   A  1 56  ? 47.505  19.582  15.374 1.00 29.35  ? 70  A   X "C3'" 1 
ATOM   1183 O  "O3'" . A   A  1 56  ? 48.477  18.707  15.913 1.00 34.01  ? 70  A   X "O3'" 1 
ATOM   1184 C  "C2'" . A   A  1 56  ? 47.252  20.782  16.269 1.00 28.32  ? 70  A   X "C2'" 1 
ATOM   1185 O  "O2'" . A   A  1 56  ? 48.475  21.294  16.780 1.00 29.22  ? 70  A   X "O2'" 1 
ATOM   1186 C  "C1'" . A   A  1 56  ? 46.727  21.801  15.261 1.00 27.13  ? 70  A   X "C1'" 1 
ATOM   1187 N  N9    . A   A  1 56  ? 45.261  21.826  15.141 1.00 23.85  ? 70  A   X N9    1 
ATOM   1188 C  C8    . A   A  1 56  ? 44.503  21.255  14.148 1.00 25.79  ? 70  A   X C8    1 
ATOM   1189 N  N7    . A   A  1 56  ? 43.214  21.477  14.280 1.00 24.26  ? 70  A   X N7    1 
ATOM   1190 C  C5    . A   A  1 56  ? 43.138  22.272  15.418 1.00 24.59  ? 70  A   X C5    1 
ATOM   1191 C  C6    . A   A  1 56  ? 42.052  22.843  16.100 1.00 24.54  ? 70  A   X C6    1 
ATOM   1192 N  N6    . A   A  1 56  ? 40.788  22.712  15.703 1.00 22.61  ? 70  A   X N6    1 
ATOM   1193 N  N1    . A   A  1 56  ? 42.311  23.570  17.206 1.00 23.98  ? 70  A   X N1    1 
ATOM   1194 C  C2    . A   A  1 56  ? 43.581  23.700  17.612 1.00 26.41  ? 70  A   X C2    1 
ATOM   1195 N  N3    . A   A  1 56  ? 44.690  23.201  17.067 1.00 25.44  ? 70  A   X N3    1 
ATOM   1196 C  C4    . A   A  1 56  ? 44.395  22.495  15.959 1.00 25.42  ? 70  A   X C4    1 
ATOM   1197 P  P     . A   A  1 57  ? 48.088  17.384  16.729 1.00 30.73  ? 71  A   X P     1 
ATOM   1198 O  OP1   . A   A  1 57  ? 49.415  16.782  17.022 1.00 34.35  ? 71  A   X OP1   1 
ATOM   1199 O  OP2   . A   A  1 57  ? 47.123  16.606  15.917 1.00 29.73  ? 71  A   X OP2   1 
ATOM   1200 O  "O5'" . A   A  1 57  ? 47.452  17.896  18.092 1.00 29.63  ? 71  A   X "O5'" 1 
ATOM   1201 C  "C5'" . A   A  1 57  ? 48.250  18.548  19.063 1.00 27.42  ? 71  A   X "C5'" 1 
ATOM   1202 C  "C4'" . A   A  1 57  ? 47.359  19.195  20.090 1.00 28.51  ? 71  A   X "C4'" 1 
ATOM   1203 O  "O4'" . A   A  1 57  ? 46.515  20.171  19.428 1.00 30.29  ? 71  A   X "O4'" 1 
ATOM   1204 C  "C3'" . A   A  1 57  ? 46.373  18.262  20.772 1.00 27.79  ? 71  A   X "C3'" 1 
ATOM   1205 O  "O3'" . A   A  1 57  ? 46.953  17.601  21.876 1.00 27.62  ? 71  A   X "O3'" 1 
ATOM   1206 C  "C2'" . A   A  1 57  ? 45.247  19.199  21.173 1.00 25.26  ? 71  A   X "C2'" 1 
ATOM   1207 O  "O2'" . A   A  1 57  ? 45.667  19.967  22.294 1.00 27.24  ? 71  A   X "O2'" 1 
ATOM   1208 C  "C1'" . A   A  1 57  ? 45.210  20.137  19.972 1.00 27.27  ? 71  A   X "C1'" 1 
ATOM   1209 N  N9    . A   A  1 57  ? 44.306  19.720  18.885 1.00 24.57  ? 71  A   X N9    1 
ATOM   1210 C  C8    . A   A  1 57  ? 44.605  18.926  17.802 1.00 25.57  ? 71  A   X C8    1 
ATOM   1211 N  N7    . A   A  1 57  ? 43.596  18.766  16.964 1.00 24.28  ? 71  A   X N7    1 
ATOM   1212 C  C5    . A   A  1 57  ? 42.579  19.525  17.522 1.00 22.01  ? 71  A   X C5    1 
ATOM   1213 C  C6    . A   A  1 57  ? 41.258  19.781  17.121 1.00 22.33  ? 71  A   X C6    1 
ATOM   1214 N  N6    . A   A  1 57  ? 40.726  19.264  16.018 1.00 19.64  ? 71  A   X N6    1 
ATOM   1215 N  N1    . A   A  1 57  ? 40.492  20.568  17.917 1.00 22.07  ? 71  A   X N1    1 
ATOM   1216 C  C2    . A   A  1 57  ? 41.039  21.074  19.027 1.00 23.39  ? 71  A   X C2    1 
ATOM   1217 N  N3    . A   A  1 57  ? 42.277  20.906  19.501 1.00 25.72  ? 71  A   X N3    1 
ATOM   1218 C  C4    . A   A  1 57  ? 43.001  20.122  18.698 1.00 22.61  ? 71  A   X C4    1 
ATOM   1219 P  P     . A   A  1 58  ? 46.352  16.220  22.402 1.00 27.88  ? 72  A   X P     1 
ATOM   1220 O  OP1   . A   A  1 58  ? 47.277  15.880  23.514 1.00 32.31  ? 72  A   X OP1   1 
ATOM   1221 O  OP2   . A   A  1 58  ? 46.158  15.285  21.269 1.00 28.88  ? 72  A   X OP2   1 
ATOM   1222 O  "O5'" . A   A  1 58  ? 44.919  16.540  23.023 1.00 24.95  ? 72  A   X "O5'" 1 
ATOM   1223 C  "C5'" . A   A  1 58  ? 44.799  17.396  24.149 1.00 25.69  ? 72  A   X "C5'" 1 
ATOM   1224 C  "C4'" . A   A  1 58  ? 43.357  17.792  24.332 1.00 26.23  ? 72  A   X "C4'" 1 
ATOM   1225 O  "O4'" . A   A  1 58  ? 42.923  18.560  23.176 1.00 26.55  ? 72  A   X "O4'" 1 
ATOM   1226 C  "C3'" . A   A  1 58  ? 42.388  16.625  24.384 1.00 25.98  ? 72  A   X "C3'" 1 
ATOM   1227 O  "O3'" . A   A  1 58  ? 42.318  16.032  25.679 1.00 22.11  ? 72  A   X "O3'" 1 
ATOM   1228 C  "C2'" . A   A  1 58  ? 41.083  17.265  23.911 1.00 23.90  ? 72  A   X "C2'" 1 
ATOM   1229 O  "O2'" . A   A  1 58  ? 40.527  18.062  24.944 1.00 21.72  ? 72  A   X "O2'" 1 
ATOM   1230 C  "C1'" . A   A  1 58  ? 41.594  18.214  22.829 1.00 25.15  ? 72  A   X "C1'" 1 
ATOM   1231 N  N9    . A   A  1 58  ? 41.598  17.590  21.489 1.00 23.35  ? 72  A   X N9    1 
ATOM   1232 C  C8    . A   A  1 58  ? 42.551  16.759  20.961 1.00 24.76  ? 72  A   X C8    1 
ATOM   1233 N  N7    . A   A  1 58  ? 42.282  16.346  19.741 1.00 25.01  ? 72  A   X N7    1 
ATOM   1234 C  C5    . A   A  1 58  ? 41.073  16.965  19.451 1.00 23.22  ? 72  A   X C5    1 
ATOM   1235 C  C6    . A   A  1 58  ? 40.276  16.935  18.304 1.00 20.35  ? 72  A   X C6    1 
ATOM   1236 N  N6    . A   A  1 58  ? 40.623  16.220  17.238 1.00 18.69  ? 72  A   X N6    1 
ATOM   1237 N  N1    . A   A  1 58  ? 39.118  17.642  18.310 1.00 20.53  ? 72  A   X N1    1 
ATOM   1238 C  C2    . A   A  1 58  ? 38.804  18.340  19.409 1.00 19.63  ? 72  A   X C2    1 
ATOM   1239 N  N3    . A   A  1 58  ? 39.500  18.459  20.544 1.00 22.84  ? 72  A   X N3    1 
ATOM   1240 C  C4    . A   A  1 58  ? 40.635  17.732  20.507 1.00 20.83  ? 72  A   X C4    1 
ATOM   1241 P  P     . G   A  1 59  ? 41.980  14.478  25.860 1.00 27.80  ? 73  G   X P     1 
ATOM   1242 O  OP1   . G   A  1 59  ? 42.300  14.226  27.291 1.00 28.17  ? 73  G   X OP1   1 
ATOM   1243 O  OP2   . G   A  1 59  ? 42.637  13.632  24.831 1.00 25.53  ? 73  G   X OP2   1 
ATOM   1244 O  "O5'" . G   A  1 59  ? 40.399  14.488  25.680 1.00 26.07  ? 73  G   X "O5'" 1 
ATOM   1245 C  "C5'" . G   A  1 59  ? 39.739  13.437  24.999 1.00 24.85  ? 73  G   X "C5'" 1 
ATOM   1246 C  "C4'" . G   A  1 59  ? 39.067  13.997  23.773 1.00 22.35  ? 73  G   X "C4'" 1 
ATOM   1247 O  "O4'" . G   A  1 59  ? 40.081  14.561  22.900 1.00 24.34  ? 73  G   X "O4'" 1 
ATOM   1248 C  "C3'" . G   A  1 59  ? 38.317  13.000  22.906 1.00 21.15  ? 73  G   X "C3'" 1 
ATOM   1249 O  "O3'" . G   A  1 59  ? 37.002  12.757  23.376 1.00 24.69  ? 73  G   X "O3'" 1 
ATOM   1250 C  "C2'" . G   A  1 59  ? 38.347  13.673  21.543 1.00 21.85  ? 73  G   X "C2'" 1 
ATOM   1251 O  "O2'" . G   A  1 59  ? 37.436  14.757  21.560 1.00 20.86  ? 73  G   X "O2'" 1 
ATOM   1252 C  "C1'" . G   A  1 59  ? 39.747  14.283  21.559 1.00 24.57  ? 73  G   X "C1'" 1 
ATOM   1253 N  N9    . G   A  1 59  ? 40.783  13.386  21.024 1.00 23.50  ? 73  G   X N9    1 
ATOM   1254 C  C8    . G   A  1 59  ? 41.848  12.859  21.726 1.00 26.53  ? 73  G   X C8    1 
ATOM   1255 N  N7    . G   A  1 59  ? 42.632  12.127  20.977 1.00 26.64  ? 73  G   X N7    1 
ATOM   1256 C  C5    . G   A  1 59  ? 42.050  12.195  19.718 1.00 24.01  ? 73  G   X C5    1 
ATOM   1257 C  C6    . G   A  1 59  ? 42.458  11.597  18.509 1.00 25.84  ? 73  G   X C6    1 
ATOM   1258 O  O6    . G   A  1 59  ? 43.447  10.880  18.337 1.00 25.50  ? 73  G   X O6    1 
ATOM   1259 N  N1    . G   A  1 59  ? 41.598  11.914  17.456 1.00 22.30  ? 73  G   X N1    1 
ATOM   1260 C  C2    . G   A  1 59  ? 40.470  12.697  17.560 1.00 23.09  ? 73  G   X C2    1 
ATOM   1261 N  N2    . G   A  1 59  ? 39.773  12.892  16.426 1.00 19.09  ? 73  G   X N2    1 
ATOM   1262 N  N3    . G   A  1 59  ? 40.080  13.271  18.687 1.00 22.39  ? 73  G   X N3    1 
ATOM   1263 C  C4    . G   A  1 59  ? 40.910  12.968  19.720 1.00 24.66  ? 73  G   X C4    1 
ATOM   1264 P  P     . A   A  1 60  ? 36.278  11.365  23.048 1.00 26.25  ? 74  A   X P     1 
ATOM   1265 O  OP1   . A   A  1 60  ? 34.952  11.400  23.715 1.00 28.55  ? 74  A   X OP1   1 
ATOM   1266 O  OP2   . A   A  1 60  ? 37.252  10.288  23.389 1.00 25.25  ? 74  A   X OP2   1 
ATOM   1267 O  "O5'" . A   A  1 60  ? 36.094  11.450  21.471 1.00 22.53  ? 74  A   X "O5'" 1 
ATOM   1268 C  "C5'" . A   A  1 60  ? 35.095  12.253  20.850 1.00 20.41  ? 74  A   X "C5'" 1 
ATOM   1269 C  "C4'" . A   A  1 60  ? 35.131  12.048  19.354 1.00 17.22  ? 74  A   X "C4'" 1 
ATOM   1270 O  "O4'" . A   A  1 60  ? 36.500  12.238  18.906 1.00 19.24  ? 74  A   X "O4'" 1 
ATOM   1271 C  "C3'" . A   A  1 60  ? 34.800  10.645  18.870 1.00 19.82  ? 74  A   X "C3'" 1 
ATOM   1272 O  "O3'" . A   A  1 60  ? 33.408  10.401  18.792 1.00 20.81  ? 74  A   X "O3'" 1 
ATOM   1273 C  "C2'" . A   A  1 60  ? 35.500  10.594  17.518 1.00 21.99  ? 74  A   X "C2'" 1 
ATOM   1274 O  "O2'" . A   A  1 60  ? 34.765  11.370  16.578 1.00 18.96  ? 74  A   X "O2'" 1 
ATOM   1275 C  "C1'" . A   A  1 60  ? 36.777  11.361  17.835 1.00 19.55  ? 74  A   X "C1'" 1 
ATOM   1276 N  N9    . A   A  1 60  ? 37.928  10.514  18.208 1.00 22.13  ? 74  A   X N9    1 
ATOM   1277 C  C8    . A   A  1 60  ? 38.499  10.316  19.442 1.00 22.15  ? 74  A   X C8    1 
ATOM   1278 N  N7    . A   A  1 60  ? 39.554  9.529   19.403 1.00 25.01  ? 74  A   X N7    1 
ATOM   1279 C  C5    . A   A  1 60  ? 39.692  9.213   18.057 1.00 21.55  ? 74  A   X C5    1 
ATOM   1280 C  C6    . A   A  1 60  ? 40.605  8.416   17.340 1.00 23.82  ? 74  A   X C6    1 
ATOM   1281 N  N6    . A   A  1 60  ? 41.631  7.754   17.897 1.00 26.80  ? 74  A   X N6    1 
ATOM   1282 N  N1    . A   A  1 60  ? 40.438  8.322   16.002 1.00 25.79  ? 74  A   X N1    1 
ATOM   1283 C  C2    . A   A  1 60  ? 39.427  8.962   15.414 1.00 23.43  ? 74  A   X C2    1 
ATOM   1284 N  N3    . A   A  1 60  ? 38.507  9.738   15.982 1.00 21.96  ? 74  A   X N3    1 
ATOM   1285 C  C4    . A   A  1 60  ? 38.698  9.817   17.315 1.00 22.20  ? 74  A   X C4    1 
ATOM   1286 P  P     . C   A  1 61  ? 32.774  9.128   19.555 1.00 23.54  ? 75  C   X P     1 
ATOM   1287 O  OP1   . C   A  1 61  ? 31.359  9.518   19.827 1.00 23.14  ? 75  C   X OP1   1 
ATOM   1288 O  OP2   . C   A  1 61  ? 33.662  8.727   20.668 1.00 20.78  ? 75  C   X OP2   1 
ATOM   1289 O  "O5'" . C   A  1 61  ? 32.844  8.015   18.453 1.00 23.41  ? 75  C   X "O5'" 1 
ATOM   1290 C  "C5'" . C   A  1 61  ? 32.050  8.128   17.290 1.00 21.32  ? 75  C   X "C5'" 1 
ATOM   1291 C  "C4'" . C   A  1 61  ? 32.760  7.470   16.141 1.00 24.96  ? 75  C   X "C4'" 1 
ATOM   1292 O  "O4'" . C   A  1 61  ? 34.090  8.036   15.961 1.00 25.19  ? 75  C   X "O4'" 1 
ATOM   1293 C  "C3'" . C   A  1 61  ? 33.058  5.993   16.305 1.00 24.24  ? 75  C   X "C3'" 1 
ATOM   1294 O  "O3'" . C   A  1 61  ? 31.903  5.189   16.174 1.00 27.84  ? 75  C   X "O3'" 1 
ATOM   1295 C  "C2'" . C   A  1 61  ? 34.109  5.787   15.221 1.00 24.54  ? 75  C   X "C2'" 1 
ATOM   1296 O  "O2'" . C   A  1 61  ? 33.508  5.836   13.939 1.00 25.72  ? 75  C   X "O2'" 1 
ATOM   1297 C  "C1'" . C   A  1 61  ? 34.943  7.056   15.411 1.00 22.05  ? 75  C   X "C1'" 1 
ATOM   1298 N  N1    . C   A  1 61  ? 36.053  6.794   16.334 1.00 24.54  ? 75  C   X N1    1 
ATOM   1299 C  C2    . C   A  1 61  ? 37.161  6.135   15.817 1.00 27.52  ? 75  C   X C2    1 
ATOM   1300 O  O2    . C   A  1 61  ? 37.152  5.820   14.626 1.00 27.30  ? 75  C   X O2    1 
ATOM   1301 N  N3    . C   A  1 61  ? 38.207  5.857   16.618 1.00 26.53  ? 75  C   X N3    1 
ATOM   1302 C  C4    . C   A  1 61  ? 38.164  6.194   17.900 1.00 27.14  ? 75  C   X C4    1 
ATOM   1303 N  N4    . C   A  1 61  ? 39.226  5.879   18.646 1.00 25.62  ? 75  C   X N4    1 
ATOM   1304 C  C5    . C   A  1 61  ? 37.041  6.865   18.463 1.00 23.17  ? 75  C   X C5    1 
ATOM   1305 C  C6    . C   A  1 61  ? 36.012  7.139   17.651 1.00 22.52  ? 75  C   X C6    1 
ATOM   1306 P  P     . G   A  1 62  ? 31.867  3.736   16.879 1.00 31.40  ? 76  G   X P     1 
ATOM   1307 O  OP1   . G   A  1 62  ? 30.467  3.342   16.577 1.00 28.59  ? 76  G   X OP1   1 
ATOM   1308 O  OP2   . G   A  1 62  ? 32.364  3.790   18.283 1.00 29.80  ? 76  G   X OP2   1 
ATOM   1309 O  "O5'" . G   A  1 62  ? 32.907  2.900   16.015 1.00 26.33  ? 76  G   X "O5'" 1 
ATOM   1310 C  "C5'" . G   A  1 62  ? 32.658  2.641   14.639 1.00 27.49  ? 76  G   X "C5'" 1 
ATOM   1311 C  "C4'" . G   A  1 62  ? 33.791  1.851   14.035 1.00 28.73  ? 76  G   X "C4'" 1 
ATOM   1312 O  "O4'" . G   A  1 62  ? 35.029  2.589   14.178 1.00 32.80  ? 76  G   X "O4'" 1 
ATOM   1313 C  "C3'" . G   A  1 62  ? 34.078  0.514   14.709 1.00 32.53  ? 76  G   X "C3'" 1 
ATOM   1314 O  "O3'" . G   A  1 62  ? 33.215  -0.524  14.266 1.00 32.47  ? 76  G   X "O3'" 1 
ATOM   1315 C  "C2'" . G   A  1 62  ? 35.540  0.273   14.373 1.00 32.35  ? 76  G   X "C2'" 1 
ATOM   1316 O  "O2'" . G   A  1 62  ? 35.675  -0.207  13.046 1.00 36.27  ? 76  G   X "O2'" 1 
ATOM   1317 C  "C1'" . G   A  1 62  ? 36.096  1.694   14.418 1.00 32.48  ? 76  G   X "C1'" 1 
ATOM   1318 N  N9    . G   A  1 62  ? 36.714  1.991   15.721 1.00 30.55  ? 76  G   X N9    1 
ATOM   1319 C  C8    . G   A  1 62  ? 36.202  2.706   16.774 1.00 31.94  ? 76  G   X C8    1 
ATOM   1320 N  N7    . G   A  1 62  ? 37.030  2.772   17.789 1.00 31.91  ? 76  G   X N7    1 
ATOM   1321 C  C5    . G   A  1 62  ? 38.140  2.047   17.384 1.00 34.22  ? 76  G   X C5    1 
ATOM   1322 C  C6    . G   A  1 62  ? 39.359  1.771   18.060 1.00 38.41  ? 76  G   X C6    1 
ATOM   1323 O  O6    . G   A  1 62  ? 39.709  2.121   19.201 1.00 38.45  ? 76  G   X O6    1 
ATOM   1324 N  N1    . G   A  1 62  ? 40.205  1.001   17.267 1.00 34.90  ? 76  G   X N1    1 
ATOM   1325 C  C2    . G   A  1 62  ? 39.926  0.556   15.999 1.00 37.34  ? 76  G   X C2    1 
ATOM   1326 N  N2    . G   A  1 62  ? 40.875  -0.181  15.402 1.00 37.70  ? 76  G   X N2    1 
ATOM   1327 N  N3    . G   A  1 62  ? 38.796  0.813   15.358 1.00 36.48  ? 76  G   X N3    1 
ATOM   1328 C  C4    . G   A  1 62  ? 37.960  1.557   16.111 1.00 33.59  ? 76  G   X C4    1 
ATOM   1329 P  P     . C   A  1 63  ? 32.660  -1.623  15.296 1.00 34.35  ? 77  C   X P     1 
ATOM   1330 O  OP1   . C   A  1 63  ? 31.872  -2.555  14.449 1.00 38.44  ? 77  C   X OP1   1 
ATOM   1331 O  OP2   . C   A  1 63  ? 31.977  -0.933  16.422 1.00 29.87  ? 77  C   X OP2   1 
ATOM   1332 O  "O5'" . C   A  1 63  ? 33.992  -2.290  15.862 1.00 31.43  ? 77  C   X "O5'" 1 
ATOM   1333 C  "C5'" . C   A  1 63  ? 34.888  -3.024  15.041 1.00 37.62  ? 77  C   X "C5'" 1 
ATOM   1334 C  "C4'" . C   A  1 63  ? 36.098  -3.483  15.817 1.00 37.42  ? 77  C   X "C4'" 1 
ATOM   1335 O  "O4'" . C   A  1 63  ? 36.917  -2.348  16.210 1.00 41.73  ? 77  C   X "O4'" 1 
ATOM   1336 C  "C3'" . C   A  1 63  ? 35.817  -4.207  17.123 1.00 40.16  ? 77  C   X "C3'" 1 
ATOM   1337 O  "O3'" . C   A  1 63  ? 35.501  -5.572  16.919 1.00 39.43  ? 77  C   X "O3'" 1 
ATOM   1338 C  "C2'" . C   A  1 63  ? 37.115  -4.000  17.890 1.00 43.31  ? 77  C   X "C2'" 1 
ATOM   1339 O  "O2'" . C   A  1 63  ? 38.107  -4.882  17.389 1.00 44.88  ? 77  C   X "O2'" 1 
ATOM   1340 C  "C1'" . C   A  1 63  ? 37.496  -2.577  17.478 1.00 37.76  ? 77  C   X "C1'" 1 
ATOM   1341 N  N1    . C   A  1 63  ? 37.003  -1.535  18.412 1.00 37.88  ? 77  C   X N1    1 
ATOM   1342 C  C2    . C   A  1 63  ? 37.775  -1.184  19.529 1.00 38.14  ? 77  C   X C2    1 
ATOM   1343 O  O2    . C   A  1 63  ? 38.849  -1.762  19.720 1.00 40.93  ? 77  C   X O2    1 
ATOM   1344 N  N3    . C   A  1 63  ? 37.327  -0.237  20.384 1.00 38.57  ? 77  C   X N3    1 
ATOM   1345 C  C4    . C   A  1 63  ? 36.160  0.368   20.151 1.00 38.92  ? 77  C   X C4    1 
ATOM   1346 N  N4    . C   A  1 63  ? 35.751  1.294   21.016 1.00 39.38  ? 77  C   X N4    1 
ATOM   1347 C  C5    . C   A  1 63  ? 35.353  0.041   19.025 1.00 35.96  ? 77  C   X C5    1 
ATOM   1348 C  C6    . C   A  1 63  ? 35.808  -0.902  18.189 1.00 34.51  ? 77  C   X C6    1 
ATOM   1349 P  P     . C   A  1 64  ? 34.211  -6.267  17.582 1.00 43.68  ? 78  C   X P     1 
ATOM   1350 O  OP1   . C   A  1 64  ? 34.212  -7.607  16.941 1.00 50.02  ? 78  C   X OP1   1 
ATOM   1351 O  OP2   . C   A  1 64  ? 33.003  -5.423  17.455 1.00 39.23  ? 78  C   X OP2   1 
ATOM   1352 O  "O5'" . C   A  1 64  ? 34.619  -6.414  19.112 1.00 41.89  ? 78  C   X "O5'" 1 
ATOM   1353 C  "C5'" . C   A  1 64  ? 35.613  -7.354  19.488 1.00 43.34  ? 78  C   X "C5'" 1 
ATOM   1354 C  "C4'" . C   A  1 64  ? 36.135  -7.063  20.870 1.00 44.27  ? 78  C   X "C4'" 1 
ATOM   1355 O  "O4'" . C   A  1 64  ? 36.640  -5.706  20.923 1.00 44.14  ? 78  C   X "O4'" 1 
ATOM   1356 C  "C3'" . C   A  1 64  ? 35.111  -7.126  21.993 1.00 44.35  ? 78  C   X "C3'" 1 
ATOM   1357 O  "O3'" . C   A  1 64  ? 34.882  -8.453  22.433 1.00 45.06  ? 78  C   X "O3'" 1 
ATOM   1358 C  "C2'" . C   A  1 64  ? 35.723  -6.224  23.058 1.00 43.92  ? 78  C   X "C2'" 1 
ATOM   1359 O  "O2'" . C   A  1 64  ? 36.713  -6.918  23.812 1.00 42.76  ? 78  C   X "O2'" 1 
ATOM   1360 C  "C1'" . C   A  1 64  ? 36.397  -5.151  22.195 1.00 43.57  ? 78  C   X "C1'" 1 
ATOM   1361 N  N1    . C   A  1 64  ? 35.524  -3.975  22.031 1.00 41.22  ? 78  C   X N1    1 
ATOM   1362 C  C2    . C   A  1 64  ? 35.798  -2.826  22.774 1.00 43.39  ? 78  C   X C2    1 
ATOM   1363 O  O2    . C   A  1 64  ? 36.785  -2.818  23.538 1.00 45.78  ? 78  C   X O2    1 
ATOM   1364 N  N3    . C   A  1 64  ? 34.979  -1.753  22.633 1.00 43.92  ? 78  C   X N3    1 
ATOM   1365 C  C4    . C   A  1 64  ? 33.932  -1.804  21.804 1.00 42.13  ? 78  C   X C4    1 
ATOM   1366 N  N4    . C   A  1 64  ? 33.156  -0.720  21.695 1.00 39.29  ? 78  C   X N4    1 
ATOM   1367 C  C5    . C   A  1 64  ? 33.636  -2.963  21.041 1.00 39.01  ? 78  C   X C5    1 
ATOM   1368 C  C6    . C   A  1 64  ? 34.449  -4.011  21.190 1.00 45.68  ? 78  C   X C6    1 
ATOM   1369 P  P     . A   A  1 65  ? 33.445  -8.884  22.985 1.00 42.15  ? 79  A   X P     1 
ATOM   1370 O  OP1   . A   A  1 65  ? 33.165  -10.151 22.256 1.00 44.78  ? 79  A   X OP1   1 
ATOM   1371 O  OP2   . A   A  1 65  ? 32.509  -7.745  22.885 1.00 35.21  ? 79  A   X OP2   1 
ATOM   1372 O  "O5'" . A   A  1 65  ? 33.733  -9.149  24.531 1.00 36.59  ? 79  A   X "O5'" 1 
ATOM   1373 C  "C5'" . A   A  1 65  ? 34.818  -9.965  24.942 1.00 34.31  ? 79  A   X "C5'" 1 
ATOM   1374 C  "C4'" . A   A  1 65  ? 34.982  -9.925  26.440 1.00 29.63  ? 79  A   X "C4'" 1 
ATOM   1375 O  "O4'" . A   A  1 65  ? 35.427  -8.607  26.837 1.00 28.11  ? 79  A   X "O4'" 1 
ATOM   1376 C  "C3'" . A   A  1 65  ? 33.726  -10.137 27.271 1.00 29.12  ? 79  A   X "C3'" 1 
ATOM   1377 O  "O3'" . A   A  1 65  ? 33.367  -11.501 27.403 1.00 29.78  ? 79  A   X "O3'" 1 
ATOM   1378 C  "C2'" . A   A  1 65  ? 34.113  -9.494  28.593 1.00 28.80  ? 79  A   X "C2'" 1 
ATOM   1379 O  "O2'" . A   A  1 65  ? 35.040  -10.325 29.282 1.00 26.92  ? 79  A   X "O2'" 1 
ATOM   1380 C  "C1'" . A   A  1 65  ? 34.902  -8.284  28.107 1.00 26.49  ? 79  A   X "C1'" 1 
ATOM   1381 N  N9    . A   A  1 65  ? 34.121  -7.034  27.988 1.00 24.71  ? 79  A   X N9    1 
ATOM   1382 C  C8    . A   A  1 65  ? 33.485  -6.543  26.878 1.00 25.10  ? 79  A   X C8    1 
ATOM   1383 N  N7    . A   A  1 65  ? 32.909  -5.376  27.074 1.00 25.34  ? 79  A   X N7    1 
ATOM   1384 C  C5    . A   A  1 65  ? 33.207  -5.080  28.397 1.00 25.10  ? 79  A   X C5    1 
ATOM   1385 C  C6    . A   A  1 65  ? 32.887  -3.983  29.217 1.00 25.42  ? 79  A   X C6    1 
ATOM   1386 N  N6    . A   A  1 65  ? 32.160  -2.932  28.799 1.00 24.15  ? 79  A   X N6    1 
ATOM   1387 N  N1    . A   A  1 65  ? 33.340  -4.004  30.497 1.00 25.00  ? 79  A   X N1    1 
ATOM   1388 C  C2    . A   A  1 65  ? 34.053  -5.058  30.911 1.00 24.68  ? 79  A   X C2    1 
ATOM   1389 N  N3    . A   A  1 65  ? 34.418  -6.147  30.226 1.00 24.57  ? 79  A   X N3    1 
ATOM   1390 C  C4    . A   A  1 65  ? 33.958  -6.096  28.965 1.00 22.90  ? 79  A   X C4    1 
ATOM   1391 P  P     . A   A  1 66  ? 31.819  -11.920 27.573 1.00 33.36  ? 80  A   X P     1 
ATOM   1392 O  OP1   . A   A  1 66  ? 31.725  -13.367 27.260 1.00 35.26  ? 80  A   X OP1   1 
ATOM   1393 O  OP2   . A   A  1 66  ? 31.052  -10.974 26.721 1.00 32.19  ? 80  A   X OP2   1 
ATOM   1394 O  "O5'" . A   A  1 66  ? 31.519  -11.628 29.113 1.00 27.93  ? 80  A   X "O5'" 1 
ATOM   1395 C  "C5'" . A   A  1 66  ? 32.256  -12.183 30.191 1.00 27.15  ? 80  A   X "C5'" 1 
ATOM   1396 C  "C4'" . A   A  1 66  ? 32.011  -11.436 31.480 1.00 29.06  ? 80  A   X "C4'" 1 
ATOM   1397 O  "O4'" . A   A  1 66  ? 32.508  -10.075 31.358 1.00 26.53  ? 80  A   X "O4'" 1 
ATOM   1398 C  "C3'" . A   A  1 66  ? 30.557  -11.277 31.896 1.00 29.50  ? 80  A   X "C3'" 1 
ATOM   1399 O  "O3'" . A   A  1 66  ? 30.053  -12.406 32.593 1.00 29.16  ? 80  A   X "O3'" 1 
ATOM   1400 C  "C2'" . A   A  1 66  ? 30.591  -10.017 32.750 1.00 27.86  ? 80  A   X "C2'" 1 
ATOM   1401 O  "O2'" . A   A  1 66  ? 31.024  -10.332 34.066 1.00 27.83  ? 80  A   X "O2'" 1 
ATOM   1402 C  "C1'" . A   A  1 66  ? 31.665  -9.180  32.046 1.00 23.59  ? 80  A   X "C1'" 1 
ATOM   1403 N  N9    . A   A  1 66  ? 31.079  -8.262  31.053 1.00 23.88  ? 80  A   X N9    1 
ATOM   1404 C  C8    . A   A  1 66  ? 30.724  -8.532  29.745 1.00 26.63  ? 80  A   X C8    1 
ATOM   1405 N  N7    . A   A  1 66  ? 30.218  -7.497  29.108 1.00 24.01  ? 80  A   X N7    1 
ATOM   1406 C  C5    . A   A  1 66  ? 30.235  -6.485  30.064 1.00 24.50  ? 80  A   X C5    1 
ATOM   1407 C  C6    . A   A  1 66  ? 29.820  -5.140  30.019 1.00 25.64  ? 80  A   X C6    1 
ATOM   1408 N  N6    . A   A  1 66  ? 29.299  -4.548  28.925 1.00 22.43  ? 80  A   X N6    1 
ATOM   1409 N  N1    . A   A  1 66  ? 29.982  -4.410  31.144 1.00 25.48  ? 80  A   X N1    1 
ATOM   1410 C  C2    . A   A  1 66  ? 30.509  -4.990  32.241 1.00 25.49  ? 80  A   X C2    1 
ATOM   1411 N  N3    . A   A  1 66  ? 30.929  -6.248  32.398 1.00 22.65  ? 80  A   X N3    1 
ATOM   1412 C  C4    . A   A  1 66  ? 30.761  -6.943  31.261 1.00 24.09  ? 80  A   X C4    1 
ATOM   1413 P  P     . U   A  1 67  ? 28.525  -12.894 32.445 1.00 29.96  ? 81  U   X P     1 
ATOM   1414 O  OP1   . U   A  1 67  ? 28.320  -13.920 33.499 1.00 36.32  ? 81  U   X OP1   1 
ATOM   1415 O  OP2   . U   A  1 67  ? 28.293  -13.258 31.021 1.00 28.87  ? 81  U   X OP2   1 
ATOM   1416 O  "O5'" . U   A  1 67  ? 27.708  -11.594 32.830 1.00 27.25  ? 81  U   X "O5'" 1 
ATOM   1417 C  "C5'" . U   A  1 67  ? 27.488  -11.175 34.163 1.00 26.57  ? 81  U   X "C5'" 1 
ATOM   1418 C  "C4'" . U   A  1 67  ? 26.800  -9.834  34.168 1.00 30.45  ? 81  U   X "C4'" 1 
ATOM   1419 O  "O4'" . U   A  1 67  ? 27.610  -8.884  33.419 1.00 25.79  ? 81  U   X "O4'" 1 
ATOM   1420 C  "C3'" . U   A  1 67  ? 25.445  -9.761  33.469 1.00 27.76  ? 81  U   X "C3'" 1 
ATOM   1421 O  "O3'" . U   A  1 67  ? 24.369  -10.251 34.245 1.00 29.98  ? 81  U   X "O3'" 1 
ATOM   1422 C  "C2'" . U   A  1 67  ? 25.340  -8.276  33.152 1.00 23.41  ? 81  U   X "C2'" 1 
ATOM   1423 O  "O2'" . U   A  1 67  ? 25.111  -7.526  34.332 1.00 25.66  ? 81  U   X "O2'" 1 
ATOM   1424 C  "C1'" . U   A  1 67  ? 26.775  -7.992  32.713 1.00 23.74  ? 81  U   X "C1'" 1 
ATOM   1425 N  N1    . U   A  1 67  ? 26.934  -8.249  31.267 1.00 26.36  ? 81  U   X N1    1 
ATOM   1426 C  C2    . U   A  1 67  ? 26.666  -7.193  30.411 1.00 25.12  ? 81  U   X C2    1 
ATOM   1427 O  O2    . U   A  1 67  ? 26.319  -6.102  30.824 1.00 22.96  ? 81  U   X O2    1 
ATOM   1428 N  N3    . U   A  1 67  ? 26.819  -7.464  29.071 1.00 23.09  ? 81  U   X N3    1 
ATOM   1429 C  C4    . U   A  1 67  ? 27.203  -8.661  28.518 1.00 23.40  ? 81  U   X C4    1 
ATOM   1430 O  O4    . U   A  1 67  ? 27.298  -8.757  27.296 1.00 25.24  ? 81  U   X O4    1 
ATOM   1431 C  C5    . U   A  1 67  ? 27.467  -9.701  29.466 1.00 26.66  ? 81  U   X C5    1 
ATOM   1432 C  C6    . U   A  1 67  ? 27.328  -9.473  30.776 1.00 26.94  ? 81  U   X C6    1 
ATOM   1433 P  P     . G   A  1 68  ? 23.102  -10.929 33.516 1.00 31.22  ? 82  G   X P     1 
ATOM   1434 O  OP1   . G   A  1 68  ? 22.311  -11.418 34.675 1.00 33.75  ? 82  G   X OP1   1 
ATOM   1435 O  OP2   . G   A  1 68  ? 23.569  -11.871 32.474 1.00 31.08  ? 82  G   X OP2   1 
ATOM   1436 O  "O5'" . G   A  1 68  ? 22.321  -9.735  32.804 1.00 31.76  ? 82  G   X "O5'" 1 
ATOM   1437 C  "C5'" . G   A  1 68  ? 21.755  -8.660  33.541 1.00 31.96  ? 82  G   X "C5'" 1 
ATOM   1438 C  "C4'" . G   A  1 68  ? 21.505  -7.453  32.667 1.00 29.88  ? 82  G   X "C4'" 1 
ATOM   1439 O  "O4'" . G   A  1 68  ? 22.738  -7.049  32.010 1.00 27.58  ? 82  G   X "O4'" 1 
ATOM   1440 C  "C3'" . G   A  1 68  ? 20.523  -7.619  31.511 1.00 27.48  ? 82  G   X "C3'" 1 
ATOM   1441 O  "O3'" . G   A  1 68  ? 19.159  -7.588  31.908 1.00 27.72  ? 82  G   X "O3'" 1 
ATOM   1442 C  "C2'" . G   A  1 68  ? 20.904  -6.434  30.639 1.00 29.11  ? 82  G   X "C2'" 1 
ATOM   1443 O  "O2'" . G   A  1 68  ? 20.444  -5.240  31.250 1.00 32.11  ? 82  G   X "O2'" 1 
ATOM   1444 C  "C1'" . G   A  1 68  ? 22.428  -6.474  30.755 1.00 26.29  ? 82  G   X "C1'" 1 
ATOM   1445 N  N9    . G   A  1 68  ? 22.980  -7.318  29.686 1.00 23.57  ? 82  G   X N9    1 
ATOM   1446 C  C8    . G   A  1 68  ? 23.366  -8.636  29.752 1.00 25.56  ? 82  G   X C8    1 
ATOM   1447 N  N7    . G   A  1 68  ? 23.797  -9.091  28.605 1.00 22.94  ? 82  G   X N7    1 
ATOM   1448 C  C5    . G   A  1 68  ? 23.686  -8.020  27.733 1.00 20.86  ? 82  G   X C5    1 
ATOM   1449 C  C6    . G   A  1 68  ? 23.997  -7.888  26.349 1.00 23.60  ? 82  G   X C6    1 
ATOM   1450 O  O6    . G   A  1 68  ? 24.449  -8.733  25.561 1.00 21.42  ? 82  G   X O6    1 
ATOM   1451 N  N1    . G   A  1 68  ? 23.724  -6.594  25.881 1.00 22.61  ? 82  G   X N1    1 
ATOM   1452 C  C2    . G   A  1 68  ? 23.203  -5.572  26.630 1.00 24.67  ? 82  G   X C2    1 
ATOM   1453 N  N2    . G   A  1 68  ? 22.994  -4.391  26.008 1.00 21.28  ? 82  G   X N2    1 
ATOM   1454 N  N3    . G   A  1 68  ? 22.911  -5.697  27.913 1.00 23.50  ? 82  G   X N3    1 
ATOM   1455 C  C4    . G   A  1 68  ? 23.177  -6.924  28.392 1.00 22.71  ? 82  G   X C4    1 
ATOM   1456 P  P     . G   A  1 69  ? 18.050  -8.341  31.016 1.00 35.13  ? 83  G   X P     1 
ATOM   1457 O  OP1   . G   A  1 69  ? 16.805  -8.290  31.824 1.00 39.73  ? 83  G   X OP1   1 
ATOM   1458 O  OP2   . G   A  1 69  ? 18.610  -9.656  30.634 1.00 32.57  ? 83  G   X OP2   1 
ATOM   1459 O  "O5'" . G   A  1 69  ? 17.928  -7.409  29.738 1.00 30.25  ? 83  G   X "O5'" 1 
ATOM   1460 C  "C5'" . G   A  1 69  ? 17.499  -6.069  29.893 1.00 29.96  ? 83  G   X "C5'" 1 
ATOM   1461 C  "C4'" . G   A  1 69  ? 17.690  -5.249  28.640 1.00 31.30  ? 83  G   X "C4'" 1 
ATOM   1462 O  "O4'" . G   A  1 69  ? 19.086  -5.254  28.248 1.00 30.06  ? 83  G   X "O4'" 1 
ATOM   1463 C  "C3'" . G   A  1 69  ? 16.979  -5.719  27.376 1.00 32.57  ? 83  G   X "C3'" 1 
ATOM   1464 O  "O3'" . G   A  1 69  ? 15.582  -5.450  27.352 1.00 32.25  ? 83  G   X "O3'" 1 
ATOM   1465 C  "C2'" . G   A  1 69  ? 17.769  -4.993  26.294 1.00 24.74  ? 83  G   X "C2'" 1 
ATOM   1466 O  "O2'" . G   A  1 69  ? 17.467  -3.612  26.293 1.00 28.09  ? 83  G   X "O2'" 1 
ATOM   1467 C  "C1'" . G   A  1 69  ? 19.188  -5.157  26.840 1.00 27.00  ? 83  G   X "C1'" 1 
ATOM   1468 N  N9    . G   A  1 69  ? 19.766  -6.416  26.352 1.00 26.65  ? 83  G   X N9    1 
ATOM   1469 C  C8    . G   A  1 69  ? 19.934  -7.579  27.057 1.00 27.14  ? 83  G   X C8    1 
ATOM   1470 N  N7    . G   A  1 69  ? 20.473  -8.535  26.344 1.00 28.08  ? 83  G   X N7    1 
ATOM   1471 C  C5    . G   A  1 69  ? 20.673  -7.952  25.099 1.00 26.36  ? 83  G   X C5    1 
ATOM   1472 C  C6    . G   A  1 69  ? 21.226  -8.508  23.913 1.00 27.04  ? 83  G   X C6    1 
ATOM   1473 O  O6    . G   A  1 69  ? 21.657  -9.658  23.744 1.00 25.33  ? 83  G   X O6    1 
ATOM   1474 N  N1    . G   A  1 69  ? 21.226  -7.576  22.879 1.00 24.73  ? 83  G   X N1    1 
ATOM   1475 C  C2    . G   A  1 69  ? 20.769  -6.284  22.989 1.00 22.99  ? 83  G   X C2    1 
ATOM   1476 N  N2    . G   A  1 69  ? 20.864  -5.531  21.892 1.00 22.24  ? 83  G   X N2    1 
ATOM   1477 N  N3    . G   A  1 69  ? 20.255  -5.754  24.088 1.00 23.08  ? 83  G   X N3    1 
ATOM   1478 C  C4    . G   A  1 69  ? 20.239  -6.646  25.088 1.00 24.21  ? 83  G   X C4    1 
ATOM   1479 P  P     . G   A  1 70  ? 14.632  -6.497  26.575 1.00 31.33  ? 84  G   X P     1 
ATOM   1480 O  OP1   . G   A  1 70  ? 13.270  -5.969  26.827 1.00 35.76  ? 84  G   X OP1   1 
ATOM   1481 O  OP2   . G   A  1 70  ? 14.935  -7.885  26.972 1.00 32.01  ? 84  G   X OP2   1 
ATOM   1482 O  "O5'" . G   A  1 70  ? 15.037  -6.212  25.066 1.00 29.05  ? 84  G   X "O5'" 1 
ATOM   1483 C  "C5'" . G   A  1 70  ? 14.705  -4.941  24.518 1.00 25.20  ? 84  G   X "C5'" 1 
ATOM   1484 C  "C4'" . G   A  1 70  ? 15.376  -4.745  23.184 1.00 26.71  ? 84  G   X "C4'" 1 
ATOM   1485 O  "O4'" . G   A  1 70  ? 16.762  -5.156  23.308 1.00 24.09  ? 84  G   X "O4'" 1 
ATOM   1486 C  "C3'" . G   A  1 70  ? 14.848  -5.592  22.034 1.00 27.01  ? 84  G   X "C3'" 1 
ATOM   1487 O  "O3'" . G   A  1 70  ? 13.731  -5.011  21.392 1.00 26.94  ? 84  G   X "O3'" 1 
ATOM   1488 C  "C2'" . G   A  1 70  ? 16.050  -5.676  21.106 1.00 24.14  ? 84  G   X "C2'" 1 
ATOM   1489 O  "O2'" . G   A  1 70  ? 16.197  -4.452  20.407 1.00 24.79  ? 84  G   X "O2'" 1 
ATOM   1490 C  "C1'" . G   A  1 70  ? 17.188  -5.783  22.116 1.00 23.80  ? 84  G   X "C1'" 1 
ATOM   1491 N  N9    . G   A  1 70  ? 17.534  -7.180  22.413 1.00 22.78  ? 84  G   X N9    1 
ATOM   1492 C  C8    . G   A  1 70  ? 17.374  -7.838  23.610 1.00 24.41  ? 84  G   X C8    1 
ATOM   1493 N  N7    . G   A  1 70  ? 17.779  -9.074  23.581 1.00 26.17  ? 84  G   X N7    1 
ATOM   1494 C  C5    . G   A  1 70  ? 18.238  -9.244  22.278 1.00 25.56  ? 84  G   X C5    1 
ATOM   1495 C  C6    . G   A  1 70  ? 18.797  -10.385 21.641 1.00 26.43  ? 84  G   X C6    1 
ATOM   1496 O  O6    . G   A  1 70  ? 19.001  -11.498 22.128 1.00 25.50  ? 84  G   X O6    1 
ATOM   1497 N  N1    . G   A  1 70  ? 19.130  -10.132 20.308 1.00 26.39  ? 84  G   X N1    1 
ATOM   1498 C  C2    . G   A  1 70  ? 18.923  -8.931  19.668 1.00 26.51  ? 84  G   X C2    1 
ATOM   1499 N  N2    . G   A  1 70  ? 19.291  -8.861  18.383 1.00 25.06  ? 84  G   X N2    1 
ATOM   1500 N  N3    . G   A  1 70  ? 18.400  -7.861  20.257 1.00 25.68  ? 84  G   X N3    1 
ATOM   1501 C  C4    . G   A  1 70  ? 18.086  -8.089  21.548 1.00 25.07  ? 84  G   X C4    1 
ATOM   1502 P  P     . U   A  1 71  ? 12.594  -5.945  20.756 1.00 27.56  ? 85  U   X P     1 
ATOM   1503 O  OP1   . U   A  1 71  ? 11.572  -4.962  20.317 1.00 27.32  ? 85  U   X OP1   1 
ATOM   1504 O  OP2   . U   A  1 71  ? 12.303  -7.019  21.731 1.00 26.92  ? 85  U   X OP2   1 
ATOM   1505 O  "O5'" . U   A  1 71  ? 13.287  -6.606  19.489 1.00 26.84  ? 85  U   X "O5'" 1 
ATOM   1506 C  "C5'" . U   A  1 71  ? 13.684  -5.834  18.367 1.00 27.24  ? 85  U   X "C5'" 1 
ATOM   1507 C  "C4'" . U   A  1 71  ? 14.387  -6.723  17.377 1.00 24.45  ? 85  U   X "C4'" 1 
ATOM   1508 O  "O4'" . U   A  1 71  ? 15.531  -7.336  18.028 1.00 23.14  ? 85  U   X "O4'" 1 
ATOM   1509 C  "C3'" . U   A  1 71  ? 13.565  -7.898  16.877 1.00 24.92  ? 85  U   X "C3'" 1 
ATOM   1510 O  "O3'" . U   A  1 71  ? 12.772  -7.555  15.762 1.00 26.98  ? 85  U   X "O3'" 1 
ATOM   1511 C  "C2'" . U   A  1 71  ? 14.606  -8.955  16.552 1.00 24.82  ? 85  U   X "C2'" 1 
ATOM   1512 O  "O2'" . U   A  1 71  ? 15.185  -8.687  15.286 1.00 29.66  ? 85  U   X "O2'" 1 
ATOM   1513 C  "C1'" . U   A  1 71  ? 15.676  -8.675  17.599 1.00 25.14  ? 85  U   X "C1'" 1 
ATOM   1514 N  N1    . U   A  1 71  ? 15.649  -9.575  18.769 1.00 23.07  ? 85  U   X N1    1 
ATOM   1515 C  C2    . U   A  1 71  ? 16.288  -10.800 18.641 1.00 24.23  ? 85  U   X C2    1 
ATOM   1516 O  O2    . U   A  1 71  ? 16.830  -11.169 17.610 1.00 26.38  ? 85  U   X O2    1 
ATOM   1517 N  N3    . U   A  1 71  ? 16.264  -11.582 19.766 1.00 25.16  ? 85  U   X N3    1 
ATOM   1518 C  C4    . U   A  1 71  ? 15.681  -11.272 20.982 1.00 27.20  ? 85  U   X C4    1 
ATOM   1519 O  O4    . U   A  1 71  ? 15.742  -12.090 21.907 1.00 29.70  ? 85  U   X O4    1 
ATOM   1520 C  C5    . U   A  1 71  ? 15.043  -9.984  21.037 1.00 24.99  ? 85  U   X C5    1 
ATOM   1521 C  C6    . U   A  1 71  ? 15.060  -9.196  19.953 1.00 25.58  ? 85  U   X C6    1 
ATOM   1522 P  P     . C   A  1 72  ? 11.197  -7.310  15.919 1.00 34.01  ? 86  C   X P     1 
ATOM   1523 O  OP1   . C   A  1 72  ? 10.748  -8.052  17.123 1.00 31.52  ? 86  C   X OP1   1 
ATOM   1524 O  OP2   . C   A  1 72  ? 10.690  -7.659  14.577 1.00 34.79  ? 86  C   X OP2   1 
ATOM   1525 O  "O5'" . C   A  1 72  ? 10.968  -5.758  16.209 1.00 32.37  ? 86  C   X "O5'" 1 
ATOM   1526 C  "C5'" . C   A  1 72  ? 11.466  -4.740  15.344 1.00 35.06  ? 86  C   X "C5'" 1 
ATOM   1527 C  "C4'" . C   A  1 72  ? 10.887  -3.382  15.664 1.00 35.43  ? 86  C   X "C4'" 1 
ATOM   1528 O  "O4'" . C   A  1 72  ? 9.460   -3.389  15.381 1.00 37.45  ? 86  C   X "O4'" 1 
ATOM   1529 C  "C3'" . C   A  1 72  ? 11.037  -2.898  17.111 1.00 37.35  ? 86  C   X "C3'" 1 
ATOM   1530 O  "O3'" . C   A  1 72  ? 11.211  -1.482  17.109 1.00 37.46  ? 86  C   X "O3'" 1 
ATOM   1531 C  "C2'" . C   A  1 72  ? 9.661   -3.209  17.701 1.00 37.69  ? 86  C   X "C2'" 1 
ATOM   1532 O  "O2'" . C   A  1 72  ? 9.301   -2.451  18.838 1.00 37.83  ? 86  C   X "O2'" 1 
ATOM   1533 C  "C1'" . C   A  1 72  ? 8.763   -2.887  16.508 1.00 39.35  ? 86  C   X "C1'" 1 
ATOM   1534 N  N1    . C   A  1 72  ? 7.394   -3.455  16.606 1.00 45.04  ? 86  C   X N1    1 
ATOM   1535 C  C2    . C   A  1 72  ? 6.296   -2.661  16.234 1.00 46.85  ? 86  C   X C2    1 
ATOM   1536 O  O2    . C   A  1 72  ? 6.489   -1.506  15.822 1.00 45.80  ? 86  C   X O2    1 
ATOM   1537 N  N3    . C   A  1 72  ? 5.044   -3.173  16.333 1.00 47.47  ? 86  C   X N3    1 
ATOM   1538 C  C4    . C   A  1 72  ? 4.865   -4.419  16.783 1.00 46.22  ? 86  C   X C4    1 
ATOM   1539 N  N4    . C   A  1 72  ? 3.615   -4.883  16.860 1.00 45.44  ? 86  C   X N4    1 
ATOM   1540 C  C5    . C   A  1 72  ? 5.960   -5.242  17.177 1.00 44.47  ? 86  C   X C5    1 
ATOM   1541 C  C6    . C   A  1 72  ? 7.193   -4.727  17.075 1.00 43.01  ? 86  C   X C6    1 
ATOM   1542 P  P     . A   A  1 73  ? 12.628  -0.722  17.216 1.00 38.62  ? 87  A   X P     1 
ATOM   1543 O  OP1   . A   A  1 73  ? 12.261  0.497   17.980 1.00 43.72  ? 87  A   X OP1   1 
ATOM   1544 O  OP2   . A   A  1 73  ? 13.163  -0.595  15.837 1.00 34.56  ? 87  A   X OP2   1 
ATOM   1545 O  "O5'" . A   A  1 73  ? 13.598  -1.616  18.094 1.00 31.08  ? 87  A   X "O5'" 1 
ATOM   1546 C  "C5'" . A   A  1 73  ? 13.616  -1.567  19.512 1.00 29.93  ? 87  A   X "C5'" 1 
ATOM   1547 C  "C4'" . A   A  1 73  ? 14.874  -0.899  20.010 1.00 29.42  ? 87  A   X "C4'" 1 
ATOM   1548 O  "O4'" . A   A  1 73  ? 16.035  -1.439  19.320 1.00 25.75  ? 87  A   X "O4'" 1 
ATOM   1549 C  "C3'" . A   A  1 73  ? 14.941  0.606   19.782 1.00 31.28  ? 87  A   X "C3'" 1 
ATOM   1550 O  "O3'" . A   A  1 73  ? 15.681  1.168   20.862 1.00 32.34  ? 87  A   X "O3'" 1 
ATOM   1551 C  "C2'" . A   A  1 73  ? 15.774  0.720   18.503 1.00 28.38  ? 87  A   X "C2'" 1 
ATOM   1552 O  "O2'" . A   A  1 73  ? 16.388  1.982   18.328 1.00 30.94  ? 87  A   X "O2'" 1 
ATOM   1553 C  "C1'" . A   A  1 73  ? 16.788  -0.395  18.737 1.00 27.44  ? 87  A   X "C1'" 1 
ATOM   1554 N  N9    . A   A  1 73  ? 17.459  -0.941  17.550 1.00 25.34  ? 87  A   X N9    1 
ATOM   1555 C  C8    . A   A  1 73  ? 17.084  -0.876  16.231 1.00 24.42  ? 87  A   X C8    1 
ATOM   1556 N  N7    . A   A  1 73  ? 17.917  -1.498  15.427 1.00 22.57  ? 87  A   X N7    1 
ATOM   1557 C  C5    . A   A  1 73  ? 18.904  -2.016  16.255 1.00 25.58  ? 87  A   X C5    1 
ATOM   1558 C  C6    . A   A  1 73  ? 20.079  -2.772  16.017 1.00 24.22  ? 87  A   X C6    1 
ATOM   1559 N  N6    . A   A  1 73  ? 20.500  -3.173  14.810 1.00 27.01  ? 87  A   X N6    1 
ATOM   1560 N  N1    . A   A  1 73  ? 20.844  -3.095  17.079 1.00 22.99  ? 87  A   X N1    1 
ATOM   1561 C  C2    . A   A  1 73  ? 20.445  -2.708  18.295 1.00 26.87  ? 87  A   X C2    1 
ATOM   1562 N  N3    . A   A  1 73  ? 19.378  -1.992  18.647 1.00 24.23  ? 87  A   X N3    1 
ATOM   1563 C  C4    . A   A  1 73  ? 18.633  -1.670  17.571 1.00 25.90  ? 87  A   X C4    1 
ATOM   1564 P  P     . A   A  1 74  ? 15.044  1.350   22.322 1.00 33.20  ? 88  A   X P     1 
ATOM   1565 O  OP1   . A   A  1 74  ? 15.704  0.347   23.197 1.00 34.83  ? 88  A   X OP1   1 
ATOM   1566 O  OP2   . A   A  1 74  ? 13.567  1.385   22.163 1.00 31.15  ? 88  A   X OP2   1 
ATOM   1567 O  "O5'" . A   A  1 74  ? 15.636  2.785   22.682 1.00 31.04  ? 88  A   X "O5'" 1 
ATOM   1568 C  "C5'" . A   A  1 74  ? 15.092  3.978   22.145 1.00 30.04  ? 88  A   X "C5'" 1 
ATOM   1569 C  "C4'" . A   A  1 74  ? 15.354  5.120   23.091 1.00 22.34  ? 88  A   X "C4'" 1 
ATOM   1570 O  "O4'" . A   A  1 74  ? 14.718  4.835   24.364 1.00 23.15  ? 88  A   X "O4'" 1 
ATOM   1571 C  "C3'" . A   A  1 74  ? 16.811  5.348   23.447 1.00 23.14  ? 88  A   X "C3'" 1 
ATOM   1572 O  "O3'" . A   A  1 74  ? 17.505  6.069   22.441 1.00 23.42  ? 88  A   X "O3'" 1 
ATOM   1573 C  "C2'" . A   A  1 74  ? 16.703  6.072   24.785 1.00 20.75  ? 88  A   X "C2'" 1 
ATOM   1574 O  "O2'" . A   A  1 74  ? 16.306  7.415   24.587 1.00 22.15  ? 88  A   X "O2'" 1 
ATOM   1575 C  "C1'" . A   A  1 74  ? 15.508  5.357   25.411 1.00 24.61  ? 88  A   X "C1'" 1 
ATOM   1576 N  N9    . A   A  1 74  ? 15.935  4.266   26.295 1.00 23.36  ? 88  A   X N9    1 
ATOM   1577 C  C8    . A   A  1 74  ? 16.041  2.926   26.040 1.00 25.18  ? 88  A   X C8    1 
ATOM   1578 N  N7    . A   A  1 74  ? 16.452  2.246   27.078 1.00 22.97  ? 88  A   X N7    1 
ATOM   1579 C  C5    . A   A  1 74  ? 16.621  3.206   28.073 1.00 25.89  ? 88  A   X C5    1 
ATOM   1580 C  C6    . A   A  1 74  ? 17.041  3.151   29.412 1.00 27.77  ? 88  A   X C6    1 
ATOM   1581 N  N6    . A   A  1 74  ? 17.392  2.026   30.031 1.00 31.01  ? 88  A   X N6    1 
ATOM   1582 N  N1    . A   A  1 74  ? 17.100  4.304   30.113 1.00 29.46  ? 88  A   X N1    1 
ATOM   1583 C  C2    . A   A  1 74  ? 16.748  5.443   29.506 1.00 27.42  ? 88  A   X C2    1 
ATOM   1584 N  N3    . A   A  1 74  ? 16.335  5.617   28.253 1.00 23.75  ? 88  A   X N3    1 
ATOM   1585 C  C4    . A   A  1 74  ? 16.302  4.454   27.593 1.00 24.42  ? 88  A   X C4    1 
ATOM   1586 P  P     . C   A  1 75  ? 18.973  5.657   21.936 1.00 23.07  ? 89  C   X P     1 
ATOM   1587 O  OP1   . C   A  1 75  ? 19.282  6.681   20.916 1.00 23.48  ? 89  C   X OP1   1 
ATOM   1588 O  OP2   . C   A  1 75  ? 18.881  4.224   21.574 1.00 21.94  ? 89  C   X OP2   1 
ATOM   1589 O  "O5'" . C   A  1 75  ? 19.928  5.825   23.211 1.00 22.63  ? 89  C   X "O5'" 1 
ATOM   1590 C  "C5'" . C   A  1 75  ? 20.100  7.105   23.798 1.00 22.30  ? 89  C   X "C5'" 1 
ATOM   1591 C  "C4'" . C   A  1 75  ? 20.635  7.002   25.203 1.00 21.32  ? 89  C   X "C4'" 1 
ATOM   1592 O  "O4'" . C   A  1 75  ? 19.717  6.249   26.034 1.00 20.40  ? 89  C   X "O4'" 1 
ATOM   1593 C  "C3'" . C   A  1 75  ? 21.955  6.270   25.351 1.00 21.65  ? 89  C   X "C3'" 1 
ATOM   1594 O  "O3'" . C   A  1 75  ? 23.041  7.129   25.073 1.00 22.38  ? 89  C   X "O3'" 1 
ATOM   1595 C  "C2'" . C   A  1 75  ? 21.919  5.834   26.806 1.00 22.04  ? 89  C   X "C2'" 1 
ATOM   1596 O  "O2'" . C   A  1 75  ? 22.188  6.960   27.632 1.00 22.92  ? 89  C   X "O2'" 1 
ATOM   1597 C  "C1'" . C   A  1 75  ? 20.446  5.479   26.966 1.00 22.25  ? 89  C   X "C1'" 1 
ATOM   1598 N  N1    . C   A  1 75  ? 20.160  4.050   26.742 1.00 21.58  ? 89  C   X N1    1 
ATOM   1599 C  C2    . C   A  1 75  ? 20.259  3.179   27.837 1.00 24.28  ? 89  C   X C2    1 
ATOM   1600 O  O2    . C   A  1 75  ? 20.613  3.629   28.936 1.00 26.72  ? 89  C   X O2    1 
ATOM   1601 N  N3    . C   A  1 75  ? 19.999  1.865   27.672 1.00 24.36  ? 89  C   X N3    1 
ATOM   1602 C  C4    . C   A  1 75  ? 19.627  1.403   26.476 1.00 23.29  ? 89  C   X C4    1 
ATOM   1603 N  N4    . C   A  1 75  ? 19.365  0.095   26.360 1.00 24.57  ? 89  C   X N4    1 
ATOM   1604 C  C5    . C   A  1 75  ? 19.491  2.269   25.351 1.00 24.50  ? 89  C   X C5    1 
ATOM   1605 C  C6    . C   A  1 75  ? 19.765  3.576   25.526 1.00 23.10  ? 89  C   X C6    1 
ATOM   1606 P  P     . A   A  1 76  ? 24.368  6.589   24.374 1.00 26.85  ? 90  A   X P     1 
ATOM   1607 O  OP1   . A   A  1 76  ? 25.018  5.598   25.263 1.00 27.89  ? 90  A   X OP1   1 
ATOM   1608 O  OP2   . A   A  1 76  ? 25.127  7.820   24.015 1.00 27.85  ? 90  A   X OP2   1 
ATOM   1609 O  "O5'" . A   A  1 76  ? 23.815  5.870   23.076 1.00 24.27  ? 90  A   X "O5'" 1 
ATOM   1610 C  "C5'" . A   A  1 76  ? 24.726  5.371   22.100 1.00 26.86  ? 90  A   X "C5'" 1 
ATOM   1611 C  "C4'" . A   A  1 76  ? 24.261  4.063   21.496 1.00 22.55  ? 90  A   X "C4'" 1 
ATOM   1612 O  "O4'" . A   A  1 76  ? 24.454  3.003   22.465 1.00 23.33  ? 90  A   X "O4'" 1 
ATOM   1613 C  "C3'" . A   A  1 76  ? 22.794  4.003   21.083 1.00 24.44  ? 90  A   X "C3'" 1 
ATOM   1614 O  "O3'" . A   A  1 76  ? 22.643  3.170   19.931 1.00 28.14  ? 90  A   X "O3'" 1 
ATOM   1615 C  "C2'" . A   A  1 76  ? 22.141  3.312   22.272 1.00 23.42  ? 90  A   X "C2'" 1 
ATOM   1616 O  "O2'" . A   A  1 76  ? 20.947  2.640   21.953 1.00 22.70  ? 90  A   X "O2'" 1 
ATOM   1617 C  "C1'" . A   A  1 76  ? 23.229  2.326   22.664 1.00 23.72  ? 90  A   X "C1'" 1 
ATOM   1618 N  N9    . A   A  1 76  ? 23.179  1.913   24.060 1.00 20.26  ? 90  A   X N9    1 
ATOM   1619 C  C8    . A   A  1 76  ? 23.502  2.666   25.158 1.00 23.84  ? 90  A   X C8    1 
ATOM   1620 N  N7    . A   A  1 76  ? 23.365  2.015   26.289 1.00 21.83  ? 90  A   X N7    1 
ATOM   1621 C  C5    . A   A  1 76  ? 22.927  0.751   25.906 1.00 24.56  ? 90  A   X C5    1 
ATOM   1622 C  C6    . A   A  1 76  ? 22.597  -0.412  26.643 1.00 26.36  ? 90  A   X C6    1 
ATOM   1623 N  N6    . A   A  1 76  ? 22.664  -0.486  27.979 1.00 24.58  ? 90  A   X N6    1 
ATOM   1624 N  N1    . A   A  1 76  ? 22.185  -1.502  25.948 1.00 23.35  ? 90  A   X N1    1 
ATOM   1625 C  C2    . A   A  1 76  ? 22.128  -1.412  24.606 1.00 27.07  ? 90  A   X C2    1 
ATOM   1626 N  N3    . A   A  1 76  ? 22.413  -0.375  23.805 1.00 21.48  ? 90  A   X N3    1 
ATOM   1627 C  C4    . A   A  1 76  ? 22.804  0.683   24.524 1.00 22.03  ? 90  A   X C4    1 
ATOM   1628 P  P     . G   A  1 77  ? 22.651  3.833   18.453 1.00 33.57  ? 91  G   X P     1 
ATOM   1629 O  OP1   . G   A  1 77  ? 23.854  4.705   18.535 1.00 31.04  ? 91  G   X OP1   1 
ATOM   1630 O  OP2   . G   A  1 77  ? 21.292  4.351   18.137 1.00 30.18  ? 91  G   X OP2   1 
ATOM   1631 O  "O5'" . G   A  1 77  ? 22.959  2.602   17.496 1.00 31.30  ? 91  G   X "O5'" 1 
ATOM   1632 C  "C5'" . G   A  1 77  ? 24.134  1.831   17.673 1.00 27.38  ? 91  G   X "C5'" 1 
ATOM   1633 C  "C4'" . G   A  1 77  ? 24.291  0.879   16.521 1.00 28.28  ? 91  G   X "C4'" 1 
ATOM   1634 O  "O4'" . G   A  1 77  ? 23.161  -0.037  16.477 1.00 29.01  ? 91  G   X "O4'" 1 
ATOM   1635 C  "C3'" . G   A  1 77  ? 24.257  1.530   15.150 1.00 30.20  ? 91  G   X "C3'" 1 
ATOM   1636 O  "O3'" . G   A  1 77  ? 25.474  2.169   14.816 1.00 29.37  ? 91  G   X "O3'" 1 
ATOM   1637 C  "C2'" . G   A  1 77  ? 23.905  0.339   14.272 1.00 28.22  ? 91  G   X "C2'" 1 
ATOM   1638 O  "O2'" . G   A  1 77  ? 25.030  -0.518  14.165 1.00 32.10  ? 91  G   X "O2'" 1 
ATOM   1639 C  "C1'" . G   A  1 77  ? 22.842  -0.343  15.137 1.00 24.37  ? 91  G   X "C1'" 1 
ATOM   1640 N  N9    . G   A  1 77  ? 21.534  0.262   14.878 1.00 27.52  ? 91  G   X N9    1 
ATOM   1641 C  C8    . G   A  1 77  ? 20.729  0.933   15.767 1.00 24.30  ? 91  G   X C8    1 
ATOM   1642 N  N7    . G   A  1 77  ? 19.632  1.378   15.218 1.00 25.35  ? 91  G   X N7    1 
ATOM   1643 C  C5    . G   A  1 77  ? 19.741  0.977   13.897 1.00 24.87  ? 91  G   X C5    1 
ATOM   1644 C  C6    . G   A  1 77  ? 18.855  1.186   12.828 1.00 25.39  ? 91  G   X C6    1 
ATOM   1645 O  O6    . G   A  1 77  ? 17.780  1.787   12.873 1.00 29.12  ? 91  G   X O6    1 
ATOM   1646 N  N1    . G   A  1 77  ? 19.331  0.613   11.654 1.00 26.86  ? 91  G   X N1    1 
ATOM   1647 C  C2    . G   A  1 77  ? 20.525  -0.063  11.529 1.00 27.61  ? 91  G   X C2    1 
ATOM   1648 N  N2    . G   A  1 77  ? 20.830  -0.547  10.318 1.00 28.16  ? 91  G   X N2    1 
ATOM   1649 N  N3    . G   A  1 77  ? 21.372  -0.261  12.526 1.00 29.10  ? 91  G   X N3    1 
ATOM   1650 C  C4    . G   A  1 77  ? 20.903  0.291   13.667 1.00 25.84  ? 91  G   X C4    1 
ATOM   1651 P  P     . A   A  1 78  ? 25.457  3.588   14.044 1.00 32.76  ? 92  A   X P     1 
ATOM   1652 O  OP1   . A   A  1 78  ? 26.886  3.976   14.042 1.00 33.63  ? 92  A   X OP1   1 
ATOM   1653 O  OP2   . A   A  1 78  ? 24.421  4.488   14.614 1.00 29.63  ? 92  A   X OP2   1 
ATOM   1654 O  "O5'" . A   A  1 78  ? 24.998  3.198   12.592 1.00 28.83  ? 92  A   X "O5'" 1 
ATOM   1655 C  "C5'" . A   A  1 78  ? 25.717  2.232   11.849 1.00 30.33  ? 92  A   X "C5'" 1 
ATOM   1656 C  "C4'" . A   A  1 78  ? 25.073  2.081   10.501 1.00 29.15  ? 92  A   X "C4'" 1 
ATOM   1657 O  "O4'" . A   A  1 78  ? 23.757  1.497   10.659 1.00 28.25  ? 92  A   X "O4'" 1 
ATOM   1658 C  "C3'" . A   A  1 78  ? 24.794  3.390   9.779  1.00 28.92  ? 92  A   X "C3'" 1 
ATOM   1659 O  "O3'" . A   A  1 78  ? 25.939  3.887   9.128  1.00 32.99  ? 92  A   X "O3'" 1 
ATOM   1660 C  "C2'" . A   A  1 78  ? 23.674  3.004   8.827  1.00 29.63  ? 92  A   X "C2'" 1 
ATOM   1661 O  "O2'" . A   A  1 78  ? 24.204  2.251   7.745  1.00 29.38  ? 92  A   X "O2'" 1 
ATOM   1662 C  "C1'" . A   A  1 78  ? 22.865  2.069   9.727  1.00 28.65  ? 92  A   X "C1'" 1 
ATOM   1663 N  N9    . A   A  1 78  ? 21.863  2.822   10.492 1.00 26.76  ? 92  A   X N9    1 
ATOM   1664 C  C8    . A   A  1 78  ? 21.889  3.162   11.826 1.00 27.54  ? 92  A   X C8    1 
ATOM   1665 N  N7    . A   A  1 78  ? 20.832  3.842   12.205 1.00 25.06  ? 92  A   X N7    1 
ATOM   1666 C  C5    . A   A  1 78  ? 20.077  3.960   11.046 1.00 24.83  ? 92  A   X C5    1 
ATOM   1667 C  C6    . A   A  1 78  ? 18.844  4.567   10.770 1.00 26.15  ? 92  A   X C6    1 
ATOM   1668 N  N6    . A   A  1 78  ? 18.117  5.215   11.681 1.00 26.21  ? 92  A   X N6    1 
ATOM   1669 N  N1    . A   A  1 78  ? 18.381  4.491   9.501  1.00 26.54  ? 92  A   X N1    1 
ATOM   1670 C  C2    . A   A  1 78  ? 19.100  3.849   8.579  1.00 26.27  ? 92  A   X C2    1 
ATOM   1671 N  N3    . A   A  1 78  ? 20.277  3.243   8.713  1.00 27.88  ? 92  A   X N3    1 
ATOM   1672 C  C4    . A   A  1 78  ? 20.703  3.334   9.985  1.00 26.76  ? 92  A   X C4    1 
ATOM   1673 P  P     . A   A  1 79  ? 26.040  5.434   8.771  1.00 36.42  ? 93  A   X P     1 
ATOM   1674 O  OP1   . A   A  1 79  ? 27.460  5.560   8.376  1.00 34.73  ? 93  A   X OP1   1 
ATOM   1675 O  OP2   . A   A  1 79  ? 25.456  6.268   9.853  1.00 32.90  ? 93  A   X OP2   1 
ATOM   1676 O  "O5'" . A   A  1 79  ? 25.091  5.563   7.503  1.00 30.32  ? 93  A   X "O5'" 1 
ATOM   1677 C  "C5'" . A   A  1 79  ? 25.306  4.761   6.357  1.00 28.78  ? 93  A   X "C5'" 1 
ATOM   1678 C  "C4'" . A   A  1 79  ? 24.226  5.020   5.343  1.00 28.83  ? 93  A   X "C4'" 1 
ATOM   1679 O  "O4'" . A   A  1 79  ? 22.944  4.591   5.861  1.00 29.65  ? 93  A   X "O4'" 1 
ATOM   1680 C  "C3'" . A   A  1 79  ? 23.990  6.477   4.975  1.00 28.20  ? 93  A   X "C3'" 1 
ATOM   1681 O  "O3'" . A   A  1 79  ? 24.914  6.960   4.021  1.00 27.72  ? 93  A   X "O3'" 1 
ATOM   1682 C  "C2'" . A   A  1 79  ? 22.584  6.435   4.418  1.00 26.94  ? 93  A   X "C2'" 1 
ATOM   1683 O  "O2'" . A   A  1 79  ? 22.626  5.838   3.134  1.00 29.04  ? 93  A   X "O2'" 1 
ATOM   1684 C  "C1'" . A   A  1 79  ? 21.927  5.437   5.363  1.00 27.96  ? 93  A   X "C1'" 1 
ATOM   1685 N  N9    . A   A  1 79  ? 21.242  6.092   6.490  1.00 26.70  ? 93  A   X N9    1 
ATOM   1686 C  C8    . A   A  1 79  ? 21.668  6.211   7.790  1.00 28.30  ? 93  A   X C8    1 
ATOM   1687 N  N7    . A   A  1 79  ? 20.815  6.836   8.566  1.00 25.41  ? 93  A   X N7    1 
ATOM   1688 C  C5    . A   A  1 79  ? 19.757  7.141   7.716  1.00 24.55  ? 93  A   X C5    1 
ATOM   1689 C  C6    . A   A  1 79  ? 18.540  7.808   7.929  1.00 22.36  ? 93  A   X C6    1 
ATOM   1690 N  N6    . A   A  1 79  ? 18.172  8.282   9.122  1.00 23.35  ? 93  A   X N6    1 
ATOM   1691 N  N1    . A   A  1 79  ? 17.705  7.961   6.873  1.00 25.88  ? 93  A   X N1    1 
ATOM   1692 C  C2    . A   A  1 79  ? 18.080  7.467   5.679  1.00 24.57  ? 93  A   X C2    1 
ATOM   1693 N  N3    . A   A  1 79  ? 19.201  6.816   5.362  1.00 26.46  ? 93  A   X N3    1 
ATOM   1694 C  C4    . A   A  1 79  ? 20.005  6.689   6.437  1.00 23.63  ? 93  A   X C4    1 
ATOM   1695 P  P     . A   A  1 80  ? 25.110  8.526   3.783  1.00 26.90  ? 94  A   X P     1 
ATOM   1696 O  OP1   . A   A  1 80  ? 26.269  8.554   2.863  1.00 31.62  ? 94  A   X OP1   1 
ATOM   1697 O  OP2   . A   A  1 80  ? 25.174  9.245   5.071  1.00 27.18  ? 94  A   X OP2   1 
ATOM   1698 O  "O5'" . A   A  1 80  ? 23.807  9.046   3.034  1.00 25.97  ? 94  A   X "O5'" 1 
ATOM   1699 C  "C5'" . A   A  1 80  ? 23.494  8.634   1.713  1.00 23.83  ? 94  A   X "C5'" 1 
ATOM   1700 C  "C4'" . A   A  1 80  ? 22.298  9.385   1.188  1.00 23.07  ? 94  A   X "C4'" 1 
ATOM   1701 O  "O4'" . A   A  1 80  ? 21.116  9.009   1.933  1.00 21.32  ? 94  A   X "O4'" 1 
ATOM   1702 C  "C3'" . A   A  1 80  ? 22.346  10.897  1.337  1.00 23.54  ? 94  A   X "C3'" 1 
ATOM   1703 O  "O3'" . A   A  1 80  ? 23.117  11.511  0.320  1.00 23.20  ? 94  A   X "O3'" 1 
ATOM   1704 C  "C2'" . A   A  1 80  ? 20.868  11.285  1.330  1.00 22.22  ? 94  A   X "C2'" 1 
ATOM   1705 O  "O2'" . A   A  1 80  ? 20.328  11.211  0.013  1.00 21.95  ? 94  A   X "O2'" 1 
ATOM   1706 C  "C1'" . A   A  1 80  ? 20.265  10.120  2.105  1.00 20.24  ? 94  A   X "C1'" 1 
ATOM   1707 N  N9    . A   A  1 80  ? 20.116  10.336  3.557  1.00 22.29  ? 94  A   X N9    1 
ATOM   1708 C  C8    . A   A  1 80  ? 20.984  9.917   4.531  1.00 21.90  ? 94  A   X C8    1 
ATOM   1709 N  N7    . A   A  1 80  ? 20.586  10.203  5.748  1.00 21.76  ? 94  A   X N7    1 
ATOM   1710 C  C5    . A   A  1 80  ? 19.374  10.833  5.573  1.00 19.77  ? 94  A   X C5    1 
ATOM   1711 C  C6    . A   A  1 80  ? 18.459  11.368  6.492  1.00 21.34  ? 94  A   X C6    1 
ATOM   1712 N  N6    . A   A  1 80  ? 18.659  11.345  7.814  1.00 19.87  ? 94  A   X N6    1 
ATOM   1713 N  N1    . A   A  1 80  ? 17.335  11.931  6.004  1.00 22.27  ? 94  A   X N1    1 
ATOM   1714 C  C2    . A   A  1 80  ? 17.158  11.946  4.668  1.00 22.99  ? 94  A   X C2    1 
ATOM   1715 N  N3    . A   A  1 80  ? 17.955  11.471  3.709  1.00 20.21  ? 94  A   X N3    1 
ATOM   1716 C  C4    . A   A  1 80  ? 19.059  10.913  4.226  1.00 21.42  ? 94  A   X C4    1 
ATOM   1717 P  P     . U   A  1 81  ? 23.961  12.851  0.597  1.00 25.19  ? 95  U   X P     1 
ATOM   1718 O  OP1   . U   A  1 81  ? 24.828  12.964  -0.612 1.00 23.54  ? 95  U   X OP1   1 
ATOM   1719 O  OP2   . U   A  1 81  ? 24.563  12.741  1.945  1.00 23.27  ? 95  U   X OP2   1 
ATOM   1720 O  "O5'" . U   A  1 81  ? 22.881  14.000  0.599  1.00 22.32  ? 95  U   X "O5'" 1 
ATOM   1721 C  "C5'" . U   A  1 81  ? 22.130  14.420  -0.526 1.00 22.70  ? 95  U   X "C5'" 1 
ATOM   1722 C  "C4'" . U   A  1 81  ? 21.028  15.339  -0.074 1.00 25.27  ? 95  U   X "C4'" 1 
ATOM   1723 O  "O4'" . U   A  1 81  ? 20.095  14.604  0.770  1.00 21.77  ? 95  U   X "O4'" 1 
ATOM   1724 C  "C3'" . U   A  1 81  ? 21.448  16.511  0.812  1.00 19.12  ? 95  U   X "C3'" 1 
ATOM   1725 O  "O3'" . U   A  1 81  ? 22.047  17.589  0.108  1.00 24.42  ? 95  U   X "O3'" 1 
ATOM   1726 C  "C2'" . U   A  1 81  ? 20.125  16.877  1.465  1.00 21.30  ? 95  U   X "C2'" 1 
ATOM   1727 O  "O2'" . U   A  1 81  ? 19.283  17.556  0.537  1.00 22.42  ? 95  U   X "O2'" 1 
ATOM   1728 C  "C1'" . U   A  1 81  ? 19.542  15.488  1.729  1.00 21.68  ? 95  U   X "C1'" 1 
ATOM   1729 N  N1    . U   A  1 81  ? 19.860  14.987  3.091  1.00 21.53  ? 95  U   X N1    1 
ATOM   1730 C  C2    . U   A  1 81  ? 19.005  15.358  4.116  1.00 22.66  ? 95  U   X C2    1 
ATOM   1731 O  O2    . U   A  1 81  ? 18.043  16.082  3.914  1.00 20.16  ? 95  U   X O2    1 
ATOM   1732 N  N3    . U   A  1 81  ? 19.335  14.866  5.365  1.00 20.97  ? 95  U   X N3    1 
ATOM   1733 C  C4    . U   A  1 81  ? 20.413  14.059  5.667  1.00 20.51  ? 95  U   X C4    1 
ATOM   1734 O  O4    . U   A  1 81  ? 20.598  13.685  6.832  1.00 21.22  ? 95  U   X O4    1 
ATOM   1735 C  C5    . U   A  1 81  ? 21.250  13.727  4.551  1.00 22.56  ? 95  U   X C5    1 
ATOM   1736 C  C6    . U   A  1 81  ? 20.950  14.193  3.333  1.00 19.56  ? 95  U   X C6    1 
ATOM   1737 P  P     . C   A  1 82  ? 23.190  18.530  0.778  1.00 24.67  ? 96  C   X P     1 
ATOM   1738 O  OP1   . C   A  1 82  ? 23.786  19.336  -0.323 1.00 23.98  ? 96  C   X OP1   1 
ATOM   1739 O  OP2   . C   A  1 82  ? 24.068  17.658  1.595  1.00 26.18  ? 96  C   X OP2   1 
ATOM   1740 O  "O5'" . C   A  1 82  ? 22.336  19.440  1.757  1.00 22.53  ? 96  C   X "O5'" 1 
ATOM   1741 C  "C5'" . C   A  1 82  ? 21.388  20.372  1.262  1.00 24.99  ? 96  C   X "C5'" 1 
ATOM   1742 C  "C4'" . C   A  1 82  ? 20.452  20.840  2.351  1.00 24.04  ? 96  C   X "C4'" 1 
ATOM   1743 O  "O4'" . C   A  1 82  ? 19.748  19.709  2.939  1.00 21.95  ? 96  C   X "O4'" 1 
ATOM   1744 C  "C3'" . C   A  1 82  ? 21.101  21.520  3.548  1.00 21.64  ? 96  C   X "C3'" 1 
ATOM   1745 O  "O3'" . C   A  1 82  ? 21.488  22.866  3.307  1.00 23.72  ? 96  C   X "O3'" 1 
ATOM   1746 C  "C2'" . C   A  1 82  ? 20.025  21.365  4.615  1.00 23.05  ? 96  C   X "C2'" 1 
ATOM   1747 O  "O2'" . C   A  1 82  ? 18.952  22.257  4.375  1.00 22.97  ? 96  C   X "O2'" 1 
ATOM   1748 C  "C1'" . C   A  1 82  ? 19.529  19.949  4.323  1.00 22.05  ? 96  C   X "C1'" 1 
ATOM   1749 N  N1    . C   A  1 82  ? 20.273  18.964  5.160  1.00 19.04  ? 96  C   X N1    1 
ATOM   1750 C  C2    . C   A  1 82  ? 19.898  18.788  6.499  1.00 21.73  ? 96  C   X C2    1 
ATOM   1751 O  O2    . C   A  1 82  ? 18.939  19.439  6.937  1.00 22.55  ? 96  C   X O2    1 
ATOM   1752 N  N3    . C   A  1 82  ? 20.572  17.890  7.267  1.00 19.87  ? 96  C   X N3    1 
ATOM   1753 C  C4    . C   A  1 82  ? 21.592  17.196  6.773  1.00 19.67  ? 96  C   X C4    1 
ATOM   1754 N  N4    . C   A  1 82  ? 22.228  16.334  7.585  1.00 18.49  ? 96  C   X N4    1 
ATOM   1755 C  C5    . C   A  1 82  ? 22.009  17.368  5.413  1.00 21.19  ? 96  C   X C5    1 
ATOM   1756 C  C6    . C   A  1 82  ? 21.338  18.257  4.668  1.00 19.60  ? 96  C   X C6    1 
ATOM   1757 P  P     . A   A  1 83  ? 22.758  23.493  4.102  1.00 23.93  ? 97  A   X P     1 
ATOM   1758 O  OP1   . A   A  1 83  ? 23.012  24.798  3.445  1.00 27.12  ? 97  A   X OP1   1 
ATOM   1759 O  OP2   . A   A  1 83  ? 23.866  22.504  4.207  1.00 26.32  ? 97  A   X OP2   1 
ATOM   1760 O  "O5'" . A   A  1 83  ? 22.142  23.714  5.560  1.00 25.49  ? 97  A   X "O5'" 1 
ATOM   1761 C  "C5'" . A   A  1 83  ? 21.121  24.665  5.823  1.00 26.14  ? 97  A   X "C5'" 1 
ATOM   1762 C  "C4'" . A   A  1 83  ? 20.684  24.562  7.262  1.00 24.83  ? 97  A   X "C4'" 1 
ATOM   1763 O  "O4'" . A   A  1 83  ? 20.278  23.190  7.512  1.00 23.75  ? 97  A   X "O4'" 1 
ATOM   1764 C  "C3'" . A   A  1 83  ? 21.766  24.789  8.311  1.00 23.59  ? 97  A   X "C3'" 1 
ATOM   1765 O  "O3'" . A   A  1 83  ? 22.084  26.150  8.549  1.00 25.28  ? 97  A   X "O3'" 1 
ATOM   1766 C  "C2'" . A   A  1 83  ? 21.196  24.055  9.518  1.00 23.59  ? 97  A   X "C2'" 1 
ATOM   1767 O  "O2'" . A   A  1 83  ? 20.122  24.785  10.087 1.00 26.80  ? 97  A   X "O2'" 1 
ATOM   1768 C  "C1'" . A   A  1 83  ? 20.592  22.825  8.839  1.00 22.55  ? 97  A   X "C1'" 1 
ATOM   1769 N  N9    . A   A  1 83  ? 21.490  21.656  8.830  1.00 22.21  ? 97  A   X N9    1 
ATOM   1770 C  C8    . A   A  1 83  ? 22.184  21.137  7.769  1.00 19.68  ? 97  A   X C8    1 
ATOM   1771 N  N7    . A   A  1 83  ? 22.891  20.084  8.069  1.00 20.33  ? 97  A   X N7    1 
ATOM   1772 C  C5    . A   A  1 83  ? 22.642  19.873  9.418  1.00 20.25  ? 97  A   X C5    1 
ATOM   1773 C  C6    . A   A  1 83  ? 23.099  18.895  10.321 1.00 18.87  ? 97  A   X C6    1 
ATOM   1774 N  N6    . A   A  1 83  ? 23.935  17.903  10.011 1.00 17.58  ? 97  A   X N6    1 
ATOM   1775 N  N1    . A   A  1 83  ? 22.649  18.973  11.592 1.00 19.67  ? 97  A   X N1    1 
ATOM   1776 C  C2    . A   A  1 83  ? 21.815  19.978  11.925 1.00 17.99  ? 97  A   X C2    1 
ATOM   1777 N  N3    . A   A  1 83  ? 21.307  20.938  11.158 1.00 19.41  ? 97  A   X N3    1 
ATOM   1778 C  C4    . A   A  1 83  ? 21.776  20.834  9.902  1.00 19.79  ? 97  A   X C4    1 
ATOM   1779 P  P     . U   A  1 84  ? 23.596  26.550  8.933  1.00 28.12  ? 98  U   X P     1 
ATOM   1780 O  OP1   . U   A  1 84  ? 23.563  28.034  9.027  1.00 27.40  ? 98  U   X OP1   1 
ATOM   1781 O  OP2   . U   A  1 84  ? 24.542  25.878  8.010  1.00 26.20  ? 98  U   X OP2   1 
ATOM   1782 O  "O5'" . U   A  1 84  ? 23.816  25.919  10.368 1.00 22.40  ? 98  U   X "O5'" 1 
ATOM   1783 C  "C5'" . U   A  1 84  ? 22.988  26.286  11.457 1.00 23.88  ? 98  U   X "C5'" 1 
ATOM   1784 C  "C4'" . U   A  1 84  ? 23.264  25.391  12.638 1.00 24.19  ? 98  U   X "C4'" 1 
ATOM   1785 O  "O4'" . U   A  1 84  ? 22.916  24.021  12.298 1.00 20.45  ? 98  U   X "O4'" 1 
ATOM   1786 C  "C3'" . U   A  1 84  ? 24.724  25.306  13.066 1.00 20.03  ? 98  U   X "C3'" 1 
ATOM   1787 O  "O3'" . U   A  1 84  ? 25.152  26.416  13.845 1.00 22.01  ? 98  U   X "O3'" 1 
ATOM   1788 C  "C2'" . U   A  1 84  ? 24.763  23.977  13.798 1.00 19.34  ? 98  U   X "C2'" 1 
ATOM   1789 O  "O2'" . U   A  1 84  ? 24.155  24.102  15.069 1.00 23.56  ? 98  U   X "O2'" 1 
ATOM   1790 C  "C1'" . U   A  1 84  ? 23.812  23.140  12.943 1.00 19.36  ? 98  U   X "C1'" 1 
ATOM   1791 N  N1    . U   A  1 84  ? 24.528  22.337  11.940 1.00 19.55  ? 98  U   X N1    1 
ATOM   1792 C  C2    . U   A  1 84  ? 25.063  21.157  12.399 1.00 18.63  ? 98  U   X C2    1 
ATOM   1793 O  O2    . U   A  1 84  ? 24.952  20.795  13.570 1.00 18.97  ? 98  U   X O2    1 
ATOM   1794 N  N3    . U   A  1 84  ? 25.703  20.411  11.438 1.00 16.74  ? 98  U   X N3    1 
ATOM   1795 C  C4    . U   A  1 84  ? 25.861  20.735  10.104 1.00 19.36  ? 98  U   X C4    1 
ATOM   1796 O  O4    . U   A  1 84  ? 26.478  19.951  9.368  1.00 19.65  ? 98  U   X O4    1 
ATOM   1797 C  C5    . U   A  1 84  ? 25.272  21.981  9.716  1.00 19.17  ? 98  U   X C5    1 
ATOM   1798 C  C6    . U   A  1 84  ? 24.639  22.725  10.624 1.00 19.40  ? 98  U   X C6    1 
ATOM   1799 P  P     . C   A  1 85  ? 26.639  27.024  13.691 1.00 24.68  ? 99  C   X P     1 
ATOM   1800 O  OP1   . C   A  1 85  ? 26.585  28.276  14.494 1.00 22.43  ? 99  C   X OP1   1 
ATOM   1801 O  OP2   . C   A  1 85  ? 27.074  27.074  12.274 1.00 23.93  ? 99  C   X OP2   1 
ATOM   1802 O  "O5'" . C   A  1 85  ? 27.521  25.887  14.406 1.00 19.38  ? 99  C   X "O5'" 1 
ATOM   1803 C  "C5'" . C   A  1 85  ? 27.580  25.839  15.821 1.00 19.48  ? 99  C   X "C5'" 1 
ATOM   1804 C  "C4'" . C   A  1 85  ? 28.306  24.622  16.321 1.00 15.71  ? 99  C   X "C4'" 1 
ATOM   1805 O  "O4'" . C   A  1 85  ? 27.664  23.395  15.877 1.00 14.10  ? 99  C   X "O4'" 1 
ATOM   1806 C  "C3'" . C   A  1 85  ? 29.753  24.428  15.885 1.00 15.41  ? 99  C   X "C3'" 1 
ATOM   1807 O  "O3'" . C   A  1 85  ? 30.640  25.326  16.530 1.00 16.22  ? 99  C   X "O3'" 1 
ATOM   1808 C  "C2'" . C   A  1 85  ? 29.966  22.980  16.304 1.00 16.55  ? 99  C   X "C2'" 1 
ATOM   1809 O  "O2'" . C   A  1 85  ? 30.103  22.919  17.715 1.00 17.85  ? 99  C   X "O2'" 1 
ATOM   1810 C  "C1'" . C   A  1 85  ? 28.617  22.355  15.909 1.00 15.64  ? 99  C   X "C1'" 1 
ATOM   1811 N  N1    . C   A  1 85  ? 28.735  21.743  14.574 1.00 16.11  ? 99  C   X N1    1 
ATOM   1812 C  C2    . C   A  1 85  ? 29.319  20.494  14.518 1.00 16.48  ? 99  C   X C2    1 
ATOM   1813 O  O2    . C   A  1 85  ? 29.683  19.970  15.598 1.00 17.16  ? 99  C   X O2    1 
ATOM   1814 N  N3    . C   A  1 85  ? 29.466  19.896  13.303 1.00 18.41  ? 99  C   X N3    1 
ATOM   1815 C  C4    . C   A  1 85  ? 29.059  20.501  12.185 1.00 18.55  ? 99  C   X C4    1 
ATOM   1816 N  N4    . C   A  1 85  ? 29.225  19.854  11.018 1.00 18.00  ? 99  C   X N4    1 
ATOM   1817 C  C5    . C   A  1 85  ? 28.446  21.790  12.230 1.00 17.21  ? 99  C   X C5    1 
ATOM   1818 C  C6    . C   A  1 85  ? 28.332  22.391  13.432 1.00 16.97  ? 99  C   X C6    1 
ATOM   1819 P  P     . G   A  1 86  ? 32.054  25.677  15.860 1.00 18.53  ? 100 G   X P     1 
ATOM   1820 O  OP1   . G   A  1 86  ? 32.724  26.546  16.828 1.00 17.09  ? 100 G   X OP1   1 
ATOM   1821 O  OP2   . G   A  1 86  ? 31.786  26.212  14.521 1.00 16.62  ? 100 G   X OP2   1 
ATOM   1822 O  "O5'" . G   A  1 86  ? 32.821  24.325  15.704 1.00 17.57  ? 100 G   X "O5'" 1 
ATOM   1823 C  "C5'" . G   A  1 86  ? 33.361  23.672  16.837 1.00 17.54  ? 100 G   X "C5'" 1 
ATOM   1824 C  "C4'" . G   A  1 86  ? 34.118  22.457  16.391 1.00 18.15  ? 100 G   X "C4'" 1 
ATOM   1825 O  "O4'" . G   A  1 86  ? 33.170  21.456  15.927 1.00 17.72  ? 100 G   X "O4'" 1 
ATOM   1826 C  "C3'" . G   A  1 86  ? 35.056  22.649  15.210 1.00 18.12  ? 100 G   X "C3'" 1 
ATOM   1827 O  "O3'" . G   A  1 86  ? 36.284  23.272  15.553 1.00 19.32  ? 100 G   X "O3'" 1 
ATOM   1828 C  "C2'" . G   A  1 86  ? 35.186  21.219  14.698 1.00 18.14  ? 100 G   X "C2'" 1 
ATOM   1829 O  "O2'" . G   A  1 86  ? 36.078  20.456  15.503 1.00 17.39  ? 100 G   X "O2'" 1 
ATOM   1830 C  "C1'" . G   A  1 86  ? 33.746  20.704  14.880 1.00 16.96  ? 100 G   X "C1'" 1 
ATOM   1831 N  N9    . G   A  1 86  ? 33.038  20.989  13.622 1.00 17.63  ? 100 G   X N9    1 
ATOM   1832 C  C8    . G   A  1 86  ? 32.328  22.110  13.299 1.00 15.92  ? 100 G   X C8    1 
ATOM   1833 N  N7    . G   A  1 86  ? 31.907  22.074  12.057 1.00 17.96  ? 100 G   X N7    1 
ATOM   1834 C  C5    . G   A  1 86  ? 32.395  20.899  11.541 1.00 16.53  ? 100 G   X C5    1 
ATOM   1835 C  C6    . G   A  1 86  ? 32.251  20.344  10.242 1.00 20.49  ? 100 G   X C6    1 
ATOM   1836 O  O6    . G   A  1 86  ? 31.653  20.816  9.261  1.00 22.82  ? 100 G   X O6    1 
ATOM   1837 N  N1    . G   A  1 86  ? 32.910  19.133  10.137 1.00 18.28  ? 100 G   X N1    1 
ATOM   1838 C  C2    . G   A  1 86  ? 33.608  18.509  11.144 1.00 17.03  ? 100 G   X C2    1 
ATOM   1839 N  N2    . G   A  1 86  ? 34.147  17.323  10.812 1.00 17.02  ? 100 G   X N2    1 
ATOM   1840 N  N3    . G   A  1 86  ? 33.743  19.017  12.368 1.00 15.48  ? 100 G   X N3    1 
ATOM   1841 C  C4    . G   A  1 86  ? 33.108  20.207  12.488 1.00 15.40  ? 100 G   X C4    1 
ATOM   1842 P  P     . A   A  1 87  ? 37.220  24.032  14.464 1.00 21.19  ? 101 A   X P     1 
ATOM   1843 O  OP1   . A   A  1 87  ? 37.576  23.041  13.441 1.00 19.63  ? 101 A   X OP1   1 
ATOM   1844 O  OP2   . A   A  1 87  ? 38.302  24.623  15.316 1.00 20.77  ? 101 A   X OP2   1 
ATOM   1845 O  "O5'" . A   A  1 87  ? 36.313  25.137  13.773 1.00 18.71  ? 101 A   X "O5'" 1 
ATOM   1846 C  "C5'" . A   A  1 87  ? 35.746  26.153  14.594 1.00 20.72  ? 101 A   X "C5'" 1 
ATOM   1847 C  "C4'" . A   A  1 87  ? 36.130  27.534  14.130 1.00 21.77  ? 101 A   X "C4'" 1 
ATOM   1848 O  "O4'" . A   A  1 87  ? 37.532  27.796  14.434 1.00 21.95  ? 101 A   X "O4'" 1 
ATOM   1849 C  "C3'" . A   A  1 87  ? 35.949  27.820  12.635 1.00 20.06  ? 101 A   X "C3'" 1 
ATOM   1850 O  "O3'" . A   A  1 87  ? 35.414  29.126  12.468 1.00 24.16  ? 101 A   X "O3'" 1 
ATOM   1851 C  "C2'" . A   A  1 87  ? 37.382  27.875  12.116 1.00 25.22  ? 101 A   X "C2'" 1 
ATOM   1852 O  "O2'" . A   A  1 87  ? 37.542  28.711  10.991 1.00 26.08  ? 101 A   X "O2'" 1 
ATOM   1853 C  "C1'" . A   A  1 87  ? 38.070  28.486  13.329 1.00 22.72  ? 101 A   X "C1'" 1 
ATOM   1854 N  N9    . A   A  1 87  ? 39.534  28.488  13.326 1.00 22.90  ? 101 A   X N9    1 
ATOM   1855 C  C8    . A   A  1 87  ? 40.372  28.024  12.343 1.00 22.58  ? 101 A   X C8    1 
ATOM   1856 N  N7    . A   A  1 87  ? 41.642  28.210  12.616 1.00 23.04  ? 101 A   X N7    1 
ATOM   1857 C  C5    . A   A  1 87  ? 41.638  28.839  13.851 1.00 23.40  ? 101 A   X C5    1 
ATOM   1858 C  C6    . A   A  1 87  ? 42.672  29.295  14.683 1.00 25.05  ? 101 A   X C6    1 
ATOM   1859 N  N6    . A   A  1 87  ? 43.962  29.188  14.380 1.00 22.62  ? 101 A   X N6    1 
ATOM   1860 N  N1    . A   A  1 87  ? 42.337  29.875  15.850 1.00 24.89  ? 101 A   X N1    1 
ATOM   1861 C  C2    . A   A  1 87  ? 41.037  29.986  16.139 1.00 25.90  ? 101 A   X C2    1 
ATOM   1862 N  N3    . A   A  1 87  ? 39.978  29.610  15.440 1.00 23.16  ? 101 A   X N3    1 
ATOM   1863 C  C4    . A   A  1 87  ? 40.349  29.022  14.296 1.00 24.63  ? 101 A   X C4    1 
ATOM   1864 P  P     . C   A  1 88  ? 33.844  29.423  12.557 1.00 22.85  ? 102 C   X P     1 
ATOM   1865 O  OP1   . C   A  1 88  ? 33.646  30.468  13.574 1.00 26.83  ? 102 C   X OP1   1 
ATOM   1866 O  OP2   . C   A  1 88  ? 33.222  28.106  12.772 1.00 21.21  ? 102 C   X OP2   1 
ATOM   1867 O  "O5'" . C   A  1 88  ? 33.520  30.018  11.119 1.00 25.12  ? 102 C   X "O5'" 1 
ATOM   1868 C  "C5'" . C   A  1 88  ? 32.341  30.786  10.942 1.00 24.65  ? 102 C   X "C5'" 1 
ATOM   1869 C  "C4'" . C   A  1 88  ? 32.044  30.917  9.476  1.00 26.68  ? 102 C   X "C4'" 1 
ATOM   1870 O  "O4'" . C   A  1 88  ? 33.068  31.721  8.825  1.00 26.49  ? 102 C   X "O4'" 1 
ATOM   1871 C  "C3'" . C   A  1 88  ? 32.050  29.617  8.689  1.00 21.46  ? 102 C   X "C3'" 1 
ATOM   1872 O  "O3'" . C   A  1 88  ? 30.857  28.867  8.852  1.00 26.00  ? 102 C   X "O3'" 1 
ATOM   1873 C  "C2'" . C   A  1 88  ? 32.205  30.155  7.276  1.00 24.45  ? 102 C   X "C2'" 1 
ATOM   1874 O  "O2'" . C   A  1 88  ? 30.986  30.766  6.882  1.00 25.65  ? 102 C   X "O2'" 1 
ATOM   1875 C  "C1'" . C   A  1 88  ? 33.234  31.259  7.501  1.00 24.49  ? 102 C   X "C1'" 1 
ATOM   1876 N  N1    . C   A  1 88  ? 34.580  30.701  7.307  1.00 27.72  ? 102 C   X N1    1 
ATOM   1877 C  C2    . C   A  1 88  ? 34.981  30.536  5.984  1.00 26.01  ? 102 C   X C2    1 
ATOM   1878 O  O2    . C   A  1 88  ? 34.185  30.864  5.094  1.00 28.67  ? 102 C   X O2    1 
ATOM   1879 N  N3    . C   A  1 88  ? 36.191  30.021  5.719  1.00 24.82  ? 102 C   X N3    1 
ATOM   1880 C  C4    . C   A  1 88  ? 37.001  29.678  6.713  1.00 28.14  ? 102 C   X C4    1 
ATOM   1881 N  N4    . C   A  1 88  ? 38.194  29.180  6.372  1.00 27.58  ? 102 C   X N4    1 
ATOM   1882 C  C5    . C   A  1 88  ? 36.625  29.825  8.085  1.00 24.28  ? 102 C   X C5    1 
ATOM   1883 C  C6    . C   A  1 88  ? 35.412  30.340  8.331  1.00 25.44  ? 102 C   X C6    1 
ATOM   1884 P  P     . A   A  1 89  ? 30.854  27.274  9.064  1.00 24.92  ? 103 A   X P     1 
ATOM   1885 O  OP1   . A   A  1 89  ? 29.423  26.900  9.148  1.00 29.59  ? 103 A   X OP1   1 
ATOM   1886 O  OP2   . A   A  1 89  ? 31.717  27.058  10.243 1.00 19.76  ? 103 A   X OP2   1 
ATOM   1887 O  "O5'" . A   A  1 89  ? 31.552  26.647  7.793  1.00 23.37  ? 103 A   X "O5'" 1 
ATOM   1888 C  "C5'" . A   A  1 89  ? 31.067  26.858  6.475  1.00 22.72  ? 103 A   X "C5'" 1 
ATOM   1889 C  "C4'" . A   A  1 89  ? 32.175  26.689  5.460  1.00 23.72  ? 103 A   X "C4'" 1 
ATOM   1890 O  "O4'" . A   A  1 89  ? 33.339  27.474  5.844  1.00 24.43  ? 103 A   X "O4'" 1 
ATOM   1891 C  "C3'" . A   A  1 89  ? 32.738  25.289  5.280  1.00 24.19  ? 103 A   X "C3'" 1 
ATOM   1892 O  "O3'" . A   A  1 89  ? 31.924  24.445  4.479  1.00 25.39  ? 103 A   X "O3'" 1 
ATOM   1893 C  "C2'" . A   A  1 89  ? 34.079  25.567  4.630  1.00 24.74  ? 103 A   X "C2'" 1 
ATOM   1894 O  "O2'" . A   A  1 89  ? 33.873  25.880  3.258  1.00 29.24  ? 103 A   X "O2'" 1 
ATOM   1895 C  "C1'" . A   A  1 89  ? 34.503  26.836  5.365  1.00 25.39  ? 103 A   X "C1'" 1 
ATOM   1896 N  N9    . A   A  1 89  ? 35.397  26.564  6.507  1.00 23.88  ? 103 A   X N9    1 
ATOM   1897 C  C8    . A   A  1 89  ? 35.085  26.580  7.850  1.00 24.09  ? 103 A   X C8    1 
ATOM   1898 N  N7    . A   A  1 89  ? 36.117  26.309  8.620  1.00 23.79  ? 103 A   X N7    1 
ATOM   1899 C  C5    . A   A  1 89  ? 37.170  26.115  7.728  1.00 24.89  ? 103 A   X C5    1 
ATOM   1900 C  C6    . A   A  1 89  ? 38.536  25.811  7.903  1.00 29.34  ? 103 A   X C6    1 
ATOM   1901 N  N6    . A   A  1 89  ? 39.126  25.628  9.100  1.00 22.64  ? 103 A   X N6    1 
ATOM   1902 N  N1    . A   A  1 89  ? 39.298  25.692  6.783  1.00 29.23  ? 103 A   X N1    1 
ATOM   1903 C  C2    . A   A  1 89  ? 38.740  25.864  5.578  1.00 27.48  ? 103 A   X C2    1 
ATOM   1904 N  N3    . A   A  1 89  ? 37.470  26.159  5.299  1.00 27.81  ? 103 A   X N3    1 
ATOM   1905 C  C4    . A   A  1 89  ? 36.735  26.276  6.422  1.00 24.88  ? 103 A   X C4    1 
ATOM   1906 P  P     . U   A  1 90  ? 31.267  23.114  5.092  1.00 27.32  ? 104 U   X P     1 
ATOM   1907 O  OP1   . U   A  1 90  ? 30.806  22.338  3.918  1.00 25.63  ? 104 U   X OP1   1 
ATOM   1908 O  OP2   . U   A  1 90  ? 30.318  23.576  6.121  1.00 25.24  ? 104 U   X OP2   1 
ATOM   1909 O  "O5'" . U   A  1 90  ? 32.483  22.312  5.738  1.00 24.65  ? 104 U   X "O5'" 1 
ATOM   1910 C  "C5'" . U   A  1 90  ? 33.617  22.049  4.918  1.00 25.27  ? 104 U   X "C5'" 1 
ATOM   1911 C  "C4'" . U   A  1 90  ? 34.824  21.704  5.753  1.00 23.09  ? 104 U   X "C4'" 1 
ATOM   1912 O  "O4'" . U   A  1 90  ? 35.249  22.836  6.551  1.00 22.35  ? 104 U   X "O4'" 1 
ATOM   1913 C  "C3'" . U   A  1 90  ? 34.598  20.586  6.752  1.00 23.88  ? 104 U   X "C3'" 1 
ATOM   1914 O  "O3'" . U   A  1 90  ? 34.715  19.337  6.099  1.00 23.76  ? 104 U   X "O3'" 1 
ATOM   1915 C  "C2'" . U   A  1 90  ? 35.662  20.852  7.812  1.00 20.37  ? 104 U   X "C2'" 1 
ATOM   1916 O  "O2'" . U   A  1 90  ? 36.919  20.307  7.440  1.00 23.08  ? 104 U   X "O2'" 1 
ATOM   1917 C  "C1'" . U   A  1 90  ? 35.786  22.381  7.777  1.00 23.08  ? 104 U   X "C1'" 1 
ATOM   1918 N  N1    . U   A  1 90  ? 35.130  23.108  8.889  1.00 20.82  ? 104 U   X N1    1 
ATOM   1919 C  C2    . U   A  1 90  ? 35.926  23.490  9.957  1.00 21.89  ? 104 U   X C2    1 
ATOM   1920 O  O2    . U   A  1 90  ? 37.122  23.256  9.991  1.00 24.16  ? 104 U   X O2    1 
ATOM   1921 N  N3    . U   A  1 90  ? 35.285  24.176  10.968 1.00 19.36  ? 104 U   X N3    1 
ATOM   1922 C  C4    . U   A  1 90  ? 33.950  24.505  10.999 1.00 18.11  ? 104 U   X C4    1 
ATOM   1923 O  O4    . U   A  1 90  ? 33.512  25.134  11.960 1.00 18.60  ? 104 U   X O4    1 
ATOM   1924 C  C5    . U   A  1 90  ? 33.195  24.082  9.855  1.00 18.22  ? 104 U   X C5    1 
ATOM   1925 C  C6    . U   A  1 90  ? 33.790  23.414  8.862  1.00 19.28  ? 104 U   X C6    1 
ATOM   1926 P  P     . A   A  1 91  ? 34.097  17.968  6.646  1.00 23.85  ? 105 A   X P     1 
ATOM   1927 O  OP1   . A   A  1 91  ? 33.839  17.179  5.418  1.00 22.71  ? 105 A   X OP1   1 
ATOM   1928 O  OP2   . A   A  1 91  ? 32.975  18.242  7.588  1.00 21.62  ? 105 A   X OP2   1 
ATOM   1929 O  "O5'" . A   A  1 91  ? 35.325  17.343  7.436  1.00 21.72  ? 105 A   X "O5'" 1 
ATOM   1930 C  "C5'" . A   A  1 91  ? 36.492  16.959  6.717  1.00 21.52  ? 105 A   X "C5'" 1 
ATOM   1931 C  "C4'" . A   A  1 91  ? 37.409  16.097  7.545  1.00 24.73  ? 105 A   X "C4'" 1 
ATOM   1932 O  "O4'" . A   A  1 91  ? 38.160  16.873  8.511  1.00 23.27  ? 105 A   X "O4'" 1 
ATOM   1933 C  "C3'" . A   A  1 91  ? 36.756  15.032  8.401  1.00 23.55  ? 105 A   X "C3'" 1 
ATOM   1934 O  "O3'" . A   A  1 91  ? 36.307  13.937  7.635  1.00 24.94  ? 105 A   X "O3'" 1 
ATOM   1935 C  "C2'" . A   A  1 91  ? 37.883  14.670  9.356  1.00 23.66  ? 105 A   X "C2'" 1 
ATOM   1936 O  "O2'" . A   A  1 91  ? 38.862  13.890  8.680  1.00 22.20  ? 105 A   X "O2'" 1 
ATOM   1937 C  "C1'" . A   A  1 91  ? 38.499  16.040  9.600  1.00 20.53  ? 105 A   X "C1'" 1 
ATOM   1938 N  N9    . A   A  1 91  ? 38.132  16.719  10.861 1.00 22.42  ? 105 A   X N9    1 
ATOM   1939 C  C8    . A   A  1 91  ? 37.385  17.861  11.023 1.00 20.61  ? 105 A   X C8    1 
ATOM   1940 N  N7    . A   A  1 91  ? 37.297  18.254  12.278 1.00 21.97  ? 105 A   X N7    1 
ATOM   1941 C  C5    . A   A  1 91  ? 38.041  17.320  12.986 1.00 20.65  ? 105 A   X C5    1 
ATOM   1942 C  C6    . A   A  1 91  ? 38.347  17.171  14.349 1.00 19.58  ? 105 A   X C6    1 
ATOM   1943 N  N6    . A   A  1 91  ? 37.914  17.994  15.308 1.00 18.42  ? 105 A   X N6    1 
ATOM   1944 N  N1    . A   A  1 91  ? 39.124  16.117  14.700 1.00 21.13  ? 105 A   X N1    1 
ATOM   1945 C  C2    . A   A  1 91  ? 39.563  15.281  13.752 1.00 21.96  ? 105 A   X C2    1 
ATOM   1946 N  N3    . A   A  1 91  ? 39.343  15.326  12.441 1.00 19.80  ? 105 A   X N3    1 
ATOM   1947 C  C4    . A   A  1 91  ? 38.572  16.374  12.121 1.00 20.38  ? 105 A   X C4    1 
ATOM   1948 P  P     . A   A  1 92  ? 35.049  13.114  8.188  1.00 25.65  ? 106 A   X P     1 
ATOM   1949 O  OP1   . A   A  1 92  ? 34.863  12.072  7.158  1.00 24.30  ? 106 A   X OP1   1 
ATOM   1950 O  OP2   . A   A  1 92  ? 33.951  14.037  8.541  1.00 26.04  ? 106 A   X OP2   1 
ATOM   1951 O  "O5'" . A   A  1 92  ? 35.625  12.484  9.532  1.00 22.01  ? 106 A   X "O5'" 1 
ATOM   1952 C  "C5'" . A   A  1 92  ? 36.695  11.554  9.487  1.00 23.40  ? 106 A   X "C5'" 1 
ATOM   1953 C  "C4'" . A   A  1 92  ? 37.047  11.120  10.884 1.00 21.65  ? 106 A   X "C4'" 1 
ATOM   1954 O  "O4'" . A   A  1 92  ? 37.625  12.240  11.592 1.00 21.32  ? 106 A   X "O4'" 1 
ATOM   1955 C  "C3'" . A   A  1 92  ? 35.865  10.690  11.741 1.00 23.00  ? 106 A   X "C3'" 1 
ATOM   1956 O  "O3'" . A   A  1 92  ? 35.508  9.333   11.528 1.00 22.07  ? 106 A   X "O3'" 1 
ATOM   1957 C  "C2'" . A   A  1 92  ? 36.339  10.973  13.159 1.00 20.59  ? 106 A   X "C2'" 1 
ATOM   1958 O  "O2'" . A   A  1 92  ? 37.226  9.962   13.623 1.00 20.75  ? 106 A   X "O2'" 1 
ATOM   1959 C  "C1'" . A   A  1 92  ? 37.173  12.232  12.929 1.00 21.68  ? 106 A   X "C1'" 1 
ATOM   1960 N  N9    . A   A  1 92  ? 36.411  13.472  13.132 1.00 19.02  ? 106 A   X N9    1 
ATOM   1961 C  C8    . A   A  1 92  ? 35.712  14.196  12.197 1.00 18.96  ? 106 A   X C8    1 
ATOM   1962 N  N7    . A   A  1 92  ? 35.175  15.291  12.700 1.00 18.73  ? 106 A   X N7    1 
ATOM   1963 C  C5    . A   A  1 92  ? 35.566  15.259  14.033 1.00 17.65  ? 106 A   X C5    1 
ATOM   1964 C  C6    . A   A  1 92  ? 35.315  16.129  15.101 1.00 18.97  ? 106 A   X C6    1 
ATOM   1965 N  N6    . A   A  1 92  ? 34.596  17.249  14.969 1.00 16.59  ? 106 A   X N6    1 
ATOM   1966 N  N1    . A   A  1 92  ? 35.848  15.813  16.300 1.00 18.61  ? 106 A   X N1    1 
ATOM   1967 C  C2    . A   A  1 92  ? 36.580  14.700  16.423 1.00 17.51  ? 106 A   X C2    1 
ATOM   1968 N  N3    . A   A  1 92  ? 36.879  13.800  15.502 1.00 17.07  ? 106 A   X N3    1 
ATOM   1969 C  C4    . A   A  1 92  ? 36.333  14.154  14.315 1.00 18.58  ? 106 A   X C4    1 
ATOM   1970 P  P     . G   A  1 93  ? 34.043  8.915   11.055 1.00 26.60  ? 107 G   X P     1 
ATOM   1971 O  OP1   . G   A  1 93  ? 34.130  7.541   10.505 1.00 32.40  ? 107 G   X OP1   1 
ATOM   1972 O  OP2   . G   A  1 93  ? 33.510  9.979   10.170 1.00 25.17  ? 107 G   X OP2   1 
ATOM   1973 O  "O5'" . G   A  1 93  ? 33.297  8.873   12.455 1.00 26.34  ? 107 G   X "O5'" 1 
ATOM   1974 C  "C5'" . G   A  1 93  ? 32.185  9.721   12.650 1.00 21.68  ? 107 G   X "C5'" 1 
ATOM   1975 C  "C4'" . G   A  1 93  ? 32.361  10.491  13.929 1.00 20.45  ? 107 G   X "C4'" 1 
ATOM   1976 O  "O4'" . G   A  1 93  ? 33.281  11.596  13.717 1.00 20.11  ? 107 G   X "O4'" 1 
ATOM   1977 C  "C3'" . G   A  1 93  ? 31.091  11.134  14.444 1.00 20.48  ? 107 G   X "C3'" 1 
ATOM   1978 O  "O3'" . G   A  1 93  ? 30.273  10.205  15.153 1.00 22.30  ? 107 G   X "O3'" 1 
ATOM   1979 C  "C2'" . G   A  1 93  ? 31.652  12.278  15.280 1.00 19.40  ? 107 G   X "C2'" 1 
ATOM   1980 O  "O2'" . G   A  1 93  ? 32.172  11.789  16.503 1.00 18.01  ? 107 G   X "O2'" 1 
ATOM   1981 C  "C1'" . G   A  1 93  ? 32.825  12.735  14.407 1.00 18.65  ? 107 G   X "C1'" 1 
ATOM   1982 N  N9    . G   A  1 93  ? 32.337  13.657  13.366 1.00 18.69  ? 107 G   X N9    1 
ATOM   1983 C  C8    . G   A  1 93  ? 32.281  13.389  12.018 1.00 17.31  ? 107 G   X C8    1 
ATOM   1984 N  N7    . G   A  1 93  ? 31.789  14.389  11.349 1.00 19.45  ? 107 G   X N7    1 
ATOM   1985 C  C5    . G   A  1 93  ? 31.496  15.358  12.299 1.00 18.22  ? 107 G   X C5    1 
ATOM   1986 C  C6    . G   A  1 93  ? 30.939  16.657  12.159 1.00 18.73  ? 107 G   X C6    1 
ATOM   1987 O  O6    . G   A  1 93  ? 30.567  17.212  11.113 1.00 19.65  ? 107 G   X O6    1 
ATOM   1988 N  N1    . G   A  1 93  ? 30.836  17.307  13.388 1.00 17.28  ? 107 G   X N1    1 
ATOM   1989 C  C2    . G   A  1 93  ? 31.202  16.759  14.601 1.00 18.32  ? 107 G   X C2    1 
ATOM   1990 N  N2    . G   A  1 93  ? 31.034  17.512  15.700 1.00 16.93  ? 107 G   X N2    1 
ATOM   1991 N  N3    . G   A  1 93  ? 31.724  15.556  14.733 1.00 18.29  ? 107 G   X N3    1 
ATOM   1992 C  C4    . G   A  1 93  ? 31.835  14.913  13.555 1.00 16.17  ? 107 G   X C4    1 
ATOM   1993 P  P     . G   A  1 94  ? 28.668  10.362  15.187 1.00 23.27  ? 108 G   X P     1 
ATOM   1994 O  OP1   . G   A  1 94  ? 28.091  9.188   15.881 1.00 23.09  ? 108 G   X OP1   1 
ATOM   1995 O  OP2   . G   A  1 94  ? 28.188  10.719  13.827 1.00 21.21  ? 108 G   X OP2   1 
ATOM   1996 O  "O5'" . G   A  1 94  ? 28.515  11.641  16.109 1.00 18.42  ? 108 G   X "O5'" 1 
ATOM   1997 C  "C5'" . G   A  1 94  ? 28.807  11.594  17.491 1.00 20.20  ? 108 G   X "C5'" 1 
ATOM   1998 C  "C4'" . G   A  1 94  ? 28.361  12.872  18.151 1.00 19.44  ? 108 G   X "C4'" 1 
ATOM   1999 O  "O4'" . G   A  1 94  ? 29.104  14.003  17.609 1.00 19.70  ? 108 G   X "O4'" 1 
ATOM   2000 C  "C3'" . G   A  1 94  ? 26.906  13.258  17.924 1.00 19.44  ? 108 G   X "C3'" 1 
ATOM   2001 O  "O3'" . G   A  1 94  ? 25.994  12.530  18.729 1.00 18.87  ? 108 G   X "O3'" 1 
ATOM   2002 C  "C2'" . G   A  1 94  ? 26.931  14.747  18.222 1.00 19.47  ? 108 G   X "C2'" 1 
ATOM   2003 O  "O2'" . G   A  1 94  ? 26.987  14.970  19.623 1.00 18.66  ? 108 G   X "O2'" 1 
ATOM   2004 C  "C1'" . G   A  1 94  ? 28.272  15.148  17.599 1.00 18.48  ? 108 G   X "C1'" 1 
ATOM   2005 N  N9    . G   A  1 94  ? 28.059  15.583  16.204 1.00 15.84  ? 108 G   X N9    1 
ATOM   2006 C  C8    . G   A  1 94  ? 28.330  14.885  15.056 1.00 17.98  ? 108 G   X C8    1 
ATOM   2007 N  N7    . G   A  1 94  ? 28.005  15.536  13.970 1.00 16.08  ? 108 G   X N7    1 
ATOM   2008 C  C5    . G   A  1 94  ? 27.491  16.741  14.420 1.00 16.00  ? 108 G   X C5    1 
ATOM   2009 C  C6    . G   A  1 94  ? 26.952  17.849  13.715 1.00 18.22  ? 108 G   X C6    1 
ATOM   2010 O  O6    . G   A  1 94  ? 26.830  18.034  12.488 1.00 17.46  ? 108 G   X O6    1 
ATOM   2011 N  N1    . G   A  1 94  ? 26.519  18.852  14.584 1.00 15.78  ? 108 G   X N1    1 
ATOM   2012 C  C2    . G   A  1 94  ? 26.599  18.789  15.949 1.00 17.05  ? 108 G   X C2    1 
ATOM   2013 N  N2    . G   A  1 94  ? 26.133  19.858  16.611 1.00 15.46  ? 108 G   X N2    1 
ATOM   2014 N  N3    . G   A  1 94  ? 27.088  17.758  16.612 1.00 16.08  ? 108 G   X N3    1 
ATOM   2015 C  C4    . G   A  1 94  ? 27.512  16.774  15.801 1.00 16.69  ? 108 G   X C4    1 
ATOM   2016 P  P     . U   A  1 95  ? 24.516  12.253  18.187 1.00 21.26  ? 109 U   X P     1 
ATOM   2017 O  OP1   . U   A  1 95  ? 23.911  11.397  19.227 1.00 23.12  ? 109 U   X OP1   1 
ATOM   2018 O  OP2   . U   A  1 95  ? 24.624  11.736  16.797 1.00 19.28  ? 109 U   X OP2   1 
ATOM   2019 O  "O5'" . U   A  1 95  ? 23.839  13.686  18.113 1.00 19.10  ? 109 U   X "O5'" 1 
ATOM   2020 C  "C5'" . U   A  1 95  ? 23.725  14.480  19.287 1.00 18.68  ? 109 U   X "C5'" 1 
ATOM   2021 C  "C4'" . U   A  1 95  ? 23.078  15.800  18.993 1.00 20.20  ? 109 U   X "C4'" 1 
ATOM   2022 O  "O4'" . U   A  1 95  ? 23.970  16.636  18.219 1.00 18.77  ? 109 U   X "O4'" 1 
ATOM   2023 C  "C3'" . U   A  1 95  ? 21.806  15.773  18.163 1.00 18.73  ? 109 U   X "C3'" 1 
ATOM   2024 O  "O3'" . U   A  1 95  ? 20.669  15.361  18.897 1.00 18.48  ? 109 U   X "O3'" 1 
ATOM   2025 C  "C2'" . U   A  1 95  ? 21.752  17.212  17.674 1.00 17.09  ? 109 U   X "C2'" 1 
ATOM   2026 O  "O2'" . U   A  1 95  ? 21.389  18.092  18.738 1.00 18.15  ? 109 U   X "O2'" 1 
ATOM   2027 C  "C1'" . U   A  1 95  ? 23.226  17.438  17.338 1.00 17.13  ? 109 U   X "C1'" 1 
ATOM   2028 N  N1    . U   A  1 95  ? 23.544  16.977  15.961 1.00 17.57  ? 109 U   X N1    1 
ATOM   2029 C  C2    . U   A  1 95  ? 23.211  17.818  14.938 1.00 17.22  ? 109 U   X C2    1 
ATOM   2030 O  O2    . U   A  1 95  ? 22.675  18.880  15.155 1.00 19.80  ? 109 U   X O2    1 
ATOM   2031 N  N3    . U   A  1 95  ? 23.510  17.377  13.680 1.00 16.01  ? 109 U   X N3    1 
ATOM   2032 C  C4    . U   A  1 95  ? 24.097  16.174  13.346 1.00 18.58  ? 109 U   X C4    1 
ATOM   2033 O  O4    . U   A  1 95  ? 24.293  15.892  12.161 1.00 17.58  ? 109 U   X O4    1 
ATOM   2034 C  C5    . U   A  1 95  ? 24.420  15.340  14.470 1.00 18.98  ? 109 U   X C5    1 
ATOM   2035 C  C6    . U   A  1 95  ? 24.131  15.769  15.709 1.00 17.62  ? 109 U   X C6    1 
ATOM   2036 P  P     . G   A  1 96  ? 19.411  14.656  18.168 1.00 19.72  ? 110 G   X P     1 
ATOM   2037 O  OP1   . G   A  1 96  ? 18.534  14.155  19.256 1.00 19.36  ? 110 G   X OP1   1 
ATOM   2038 O  OP2   . G   A  1 96  ? 19.901  13.651  17.200 1.00 19.90  ? 110 G   X OP2   1 
ATOM   2039 O  "O5'" . G   A  1 96  ? 18.762  15.840  17.354 1.00 20.01  ? 110 G   X "O5'" 1 
ATOM   2040 C  "C5'" . G   A  1 96  ? 18.108  16.959  17.934 1.00 19.87  ? 110 G   X "C5'" 1 
ATOM   2041 C  "C4'" . G   A  1 96  ? 17.722  17.951  16.863 1.00 20.29  ? 110 G   X "C4'" 1 
ATOM   2042 O  "O4'" . G   A  1 96  ? 18.892  18.324  16.089 1.00 19.98  ? 110 G   X "O4'" 1 
ATOM   2043 C  "C3'" . G   A  1 96  ? 16.750  17.463  15.802 1.00 18.15  ? 110 G   X "C3'" 1 
ATOM   2044 O  "O3'" . G   A  1 96  ? 15.412  17.513  16.239 1.00 20.16  ? 110 G   X "O3'" 1 
ATOM   2045 C  "C2'" . G   A  1 96  ? 17.004  18.427  14.653 1.00 18.35  ? 110 G   X "C2'" 1 
ATOM   2046 O  "O2'" . G   A  1 96  ? 16.458  19.699  14.951 1.00 19.02  ? 110 G   X "O2'" 1 
ATOM   2047 C  "C1'" . G   A  1 96  ? 18.504  18.592  14.758 1.00 20.28  ? 110 G   X "C1'" 1 
ATOM   2048 N  N9    . G   A  1 96  ? 19.242  17.697  13.857 1.00 21.16  ? 110 G   X N9    1 
ATOM   2049 C  C8    . G   A  1 96  ? 19.993  16.607  14.207 1.00 19.19  ? 110 G   X C8    1 
ATOM   2050 N  N7    . G   A  1 96  ? 20.583  16.058  13.181 1.00 19.68  ? 110 G   X N7    1 
ATOM   2051 C  C5    . G   A  1 96  ? 20.188  16.842  12.111 1.00 20.85  ? 110 G   X C5    1 
ATOM   2052 C  C6    . G   A  1 96  ? 20.520  16.740  10.741 1.00 20.76  ? 110 G   X C6    1 
ATOM   2053 O  O6    . G   A  1 96  ? 21.231  15.887  10.206 1.00 20.17  ? 110 G   X O6    1 
ATOM   2054 N  N1    . G   A  1 96  ? 19.908  17.739  9.999  1.00 18.45  ? 110 G   X N1    1 
ATOM   2055 C  C2    . G   A  1 96  ? 19.115  18.735  10.507 1.00 20.10  ? 110 G   X C2    1 
ATOM   2056 N  N2    . G   A  1 96  ? 18.607  19.603  9.621  1.00 16.71  ? 110 G   X N2    1 
ATOM   2057 N  N3    . G   A  1 96  ? 18.797  18.848  11.791 1.00 20.72  ? 110 G   X N3    1 
ATOM   2058 C  C4    . G   A  1 96  ? 19.368  17.872  12.516 1.00 19.47  ? 110 G   X C4    1 
ATOM   2059 P  P     . A   A  1 97  ? 14.298  16.652  15.482 1.00 22.97  ? 111 A   X P     1 
ATOM   2060 O  OP1   . A   A  1 97  ? 13.070  16.897  16.288 1.00 24.66  ? 111 A   X OP1   1 
ATOM   2061 O  OP2   . A   A  1 97  ? 14.839  15.300  15.285 1.00 18.33  ? 111 A   X OP2   1 
ATOM   2062 O  "O5'" . A   A  1 97  ? 14.170  17.338  14.052 1.00 22.86  ? 111 A   X "O5'" 1 
ATOM   2063 C  "C5'" . A   A  1 97  ? 13.475  18.554  13.884 1.00 21.36  ? 111 A   X "C5'" 1 
ATOM   2064 C  "C4'" . A   A  1 97  ? 13.344  18.867  12.419 1.00 23.05  ? 111 A   X "C4'" 1 
ATOM   2065 O  "O4'" . A   A  1 97  ? 14.656  19.072  11.835 1.00 21.21  ? 111 A   X "O4'" 1 
ATOM   2066 C  "C3'" . A   A  1 97  ? 12.743  17.753  11.586 1.00 26.09  ? 111 A   X "C3'" 1 
ATOM   2067 O  "O3'" . A   A  1 97  ? 11.332  17.732  11.686 1.00 29.32  ? 111 A   X "O3'" 1 
ATOM   2068 C  "C2'" . A   A  1 97  ? 13.265  18.075  10.195 1.00 24.02  ? 111 A   X "C2'" 1 
ATOM   2069 O  "O2'" . A   A  1 97  ? 12.568  19.193  9.675  1.00 26.68  ? 111 A   X "O2'" 1 
ATOM   2070 C  "C1'" . A   A  1 97  ? 14.680  18.544  10.526 1.00 23.33  ? 111 A   X "C1'" 1 
ATOM   2071 N  N9    . A   A  1 97  ? 15.635  17.426  10.475 1.00 22.78  ? 111 A   X N9    1 
ATOM   2072 C  C8    . A   A  1 97  ? 16.063  16.610  11.492 1.00 22.61  ? 111 A   X C8    1 
ATOM   2073 N  N7    . A   A  1 97  ? 16.922  15.698  11.102 1.00 20.51  ? 111 A   X N7    1 
ATOM   2074 C  C5    . A   A  1 97  ? 17.072  15.947  9.738  1.00 21.04  ? 111 A   X C5    1 
ATOM   2075 C  C6    . A   A  1 97  ? 17.847  15.328  8.737  1.00 20.33  ? 111 A   X C6    1 
ATOM   2076 N  N6    . A   A  1 97  ? 18.653  14.303  8.960  1.00 18.20  ? 111 A   X N6    1 
ATOM   2077 N  N1    . A   A  1 97  ? 17.760  15.800  7.480  1.00 18.47  ? 111 A   X N1    1 
ATOM   2078 C  C2    . A   A  1 97  ? 16.953  16.834  7.261  1.00 21.97  ? 111 A   X C2    1 
ATOM   2079 N  N3    . A   A  1 97  ? 16.182  17.517  8.108  1.00 22.83  ? 111 A   X N3    1 
ATOM   2080 C  C4    . A   A  1 97  ? 16.285  16.997  9.344  1.00 21.89  ? 111 A   X C4    1 
ATOM   2081 P  P     . U   A  1 98  ? 10.556  16.339  11.589 1.00 30.32  ? 112 U   X P     1 
ATOM   2082 O  OP1   . U   A  1 98  ? 9.144   16.730  11.830 1.00 36.00  ? 112 U   X OP1   1 
ATOM   2083 O  OP2   . U   A  1 98  ? 11.175  15.255  12.387 1.00 27.26  ? 112 U   X OP2   1 
ATOM   2084 O  "O5'" . U   A  1 98  ? 10.790  15.950  10.064 1.00 32.16  ? 112 U   X "O5'" 1 
ATOM   2085 C  "C5'" . U   A  1 98  ? 10.242  16.761  9.040  1.00 32.78  ? 112 U   X "C5'" 1 
ATOM   2086 C  "C4'" . U   A  1 98  ? 10.719  16.294  7.691  1.00 28.11  ? 112 U   X "C4'" 1 
ATOM   2087 O  "O4'" . U   A  1 98  ? 12.148  16.530  7.583  1.00 26.46  ? 112 U   X "O4'" 1 
ATOM   2088 C  "C3'" . U   A  1 98  ? 10.589  14.806  7.410  1.00 30.37  ? 112 U   X "C3'" 1 
ATOM   2089 O  "O3'" . U   A  1 98  ? 9.272   14.398  7.076  1.00 31.63  ? 112 U   X "O3'" 1 
ATOM   2090 C  "C2'" . U   A  1 98  ? 11.581  14.650  6.272  1.00 29.62  ? 112 U   X "C2'" 1 
ATOM   2091 O  "O2'" . U   A  1 98  ? 11.049  15.274  5.114  1.00 30.10  ? 112 U   X "O2'" 1 
ATOM   2092 C  "C1'" . U   A  1 98  ? 12.729  15.520  6.788  1.00 26.37  ? 112 U   X "C1'" 1 
ATOM   2093 N  N1    . U   A  1 98  ? 13.670  14.697  7.582  1.00 25.35  ? 112 U   X N1    1 
ATOM   2094 C  C2    . U   A  1 98  ? 14.614  14.019  6.835  1.00 24.19  ? 112 U   X C2    1 
ATOM   2095 O  O2    . U   A  1 98  ? 14.659  14.109  5.616  1.00 25.09  ? 112 U   X O2    1 
ATOM   2096 N  N3    . U   A  1 98  ? 15.484  13.245  7.550  1.00 20.30  ? 112 U   X N3    1 
ATOM   2097 C  C4    . U   A  1 98  ? 15.498  13.083  8.922  1.00 21.00  ? 112 U   X C4    1 
ATOM   2098 O  O4    . U   A  1 98  ? 16.356  12.348  9.410  1.00 22.92  ? 112 U   X O4    1 
ATOM   2099 C  C5    . U   A  1 98  ? 14.494  13.818  9.636  1.00 22.92  ? 112 U   X C5    1 
ATOM   2100 C  C6    . U   A  1 98  ? 13.628  14.589  8.952  1.00 24.82  ? 112 U   X C6    1 
ATOM   2101 P  P     . U   A  1 99  ? 8.808   12.880  7.311  1.00 38.49  ? 113 U   X P     1 
ATOM   2102 O  OP1   . U   A  1 99  ? 7.425   12.834  6.768  1.00 38.70  ? 113 U   X OP1   1 
ATOM   2103 O  OP2   . U   A  1 99  ? 9.088   12.446  8.708  1.00 36.39  ? 113 U   X OP2   1 
ATOM   2104 O  "O5'" . U   A  1 99  ? 9.769   12.041  6.357  1.00 30.93  ? 113 U   X "O5'" 1 
ATOM   2105 C  "C5'" . U   A  1 99  ? 9.683   12.209  4.953  1.00 34.35  ? 113 U   X "C5'" 1 
ATOM   2106 C  "C4'" . U   A  1 99  ? 10.657  11.297  4.262  1.00 30.97  ? 113 U   X "C4'" 1 
ATOM   2107 O  "O4'" . U   A  1 99  ? 12.015  11.682  4.599  1.00 25.55  ? 113 U   X "O4'" 1 
ATOM   2108 C  "C3'" . U   A  1 99  ? 10.608  9.839   4.676  1.00 30.39  ? 113 U   X "C3'" 1 
ATOM   2109 O  "O3'" . U   A  1 99  ? 9.499   9.137   4.139  1.00 35.24  ? 113 U   X "O3'" 1 
ATOM   2110 C  "C2'" . U   A  1 99  ? 11.968  9.340   4.201  1.00 29.75  ? 113 U   X "C2'" 1 
ATOM   2111 O  "O2'" . U   A  1 99  ? 11.996  9.178   2.790  1.00 29.17  ? 113 U   X "O2'" 1 
ATOM   2112 C  "C1'" . U   A  1 99  ? 12.845  10.539  4.560  1.00 27.36  ? 113 U   X "C1'" 1 
ATOM   2113 N  N1    . U   A  1 99  ? 13.501  10.293  5.854  1.00 25.60  ? 113 U   X N1    1 
ATOM   2114 C  C2    . U   A  1 99  ? 14.706  9.638   5.822  1.00 25.88  ? 113 U   X C2    1 
ATOM   2115 O  O2    . U   A  1 99  ? 15.232  9.275   4.777  1.00 24.92  ? 113 U   X O2    1 
ATOM   2116 N  N3    . U   A  1 99  ? 15.274  9.424   7.052  1.00 24.67  ? 113 U   X N3    1 
ATOM   2117 C  C4    . U   A  1 99  ? 14.754  9.796   8.281  1.00 26.22  ? 113 U   X C4    1 
ATOM   2118 O  O4    . U   A  1 99  ? 15.376  9.539   9.316  1.00 23.88  ? 113 U   X O4    1 
ATOM   2119 C  C5    . U   A  1 99  ? 13.495  10.470  8.221  1.00 26.98  ? 113 U   X C5    1 
ATOM   2120 C  C6    . U   A  1 99  ? 12.923  10.691  7.030  1.00 29.18  ? 113 U   X C6    1 
ATOM   2121 P  P     . U   A  1 100 ? 9.045   7.721   4.747  1.00 36.65  ? 114 U   X P     1 
ATOM   2122 O  OP1   . U   A  1 100 ? 7.829   7.336   3.987  1.00 43.63  ? 114 U   X OP1   1 
ATOM   2123 O  OP2   . U   A  1 100 ? 9.010   7.762   6.232  1.00 37.29  ? 114 U   X OP2   1 
ATOM   2124 O  "O5'" . U   A  1 100 ? 10.252  6.813   4.312  1.00 34.83  ? 114 U   X "O5'" 1 
ATOM   2125 C  "C5'" . U   A  1 100 ? 10.671  5.735   5.125  1.00 35.02  ? 114 U   X "C5'" 1 
ATOM   2126 C  "C4'" . U   A  1 100 ? 12.033  5.268   4.696  1.00 32.78  ? 114 U   X "C4'" 1 
ATOM   2127 O  "O4'" . U   A  1 100 ? 13.036  6.204   5.174  1.00 32.18  ? 114 U   X "O4'" 1 
ATOM   2128 C  "C3'" . U   A  1 100 ? 12.469  3.932   5.268  1.00 33.94  ? 114 U   X "C3'" 1 
ATOM   2129 O  "O3'" . U   A  1 100 ? 11.914  2.829   4.568  1.00 38.40  ? 114 U   X "O3'" 1 
ATOM   2130 C  "C2'" . U   A  1 100 ? 13.990  4.023   5.194  1.00 33.11  ? 114 U   X "C2'" 1 
ATOM   2131 O  "O2'" . U   A  1 100 ? 14.464  3.773   3.875  1.00 35.60  ? 114 U   X "O2'" 1 
ATOM   2132 C  "C1'" . U   A  1 100 ? 14.211  5.501   5.521  1.00 30.67  ? 114 U   X "C1'" 1 
ATOM   2133 N  N1    . U   A  1 100 ? 14.495  5.734   6.950  1.00 28.98  ? 114 U   X N1    1 
ATOM   2134 C  C2    . U   A  1 100 ? 15.723  5.305   7.421  1.00 29.29  ? 114 U   X C2    1 
ATOM   2135 O  O2    . U   A  1 100 ? 16.541  4.751   6.703  1.00 28.17  ? 114 U   X O2    1 
ATOM   2136 N  N3    . U   A  1 100 ? 15.949  5.547   8.756  1.00 26.19  ? 114 U   X N3    1 
ATOM   2137 C  C4    . U   A  1 100 ? 15.083  6.161   9.637  1.00 28.22  ? 114 U   X C4    1 
ATOM   2138 O  O4    . U   A  1 100 ? 15.432  6.308   10.813 1.00 28.98  ? 114 U   X O4    1 
ATOM   2139 C  C5    . U   A  1 100 ? 13.833  6.579   9.069  1.00 26.97  ? 114 U   X C5    1 
ATOM   2140 C  C6    . U   A  1 100 ? 13.585  6.362   7.774  1.00 29.41  ? 114 U   X C6    1 
ATOM   2141 P  P     . U   A  1 101 ? 11.522  1.491   5.365  1.00 40.42  ? 115 U   X P     1 
ATOM   2142 O  OP1   . U   A  1 101 ? 10.933  0.545   4.379  1.00 43.22  ? 115 U   X OP1   1 
ATOM   2143 O  OP2   . U   A  1 101 ? 10.711  1.916   6.531  1.00 32.49  ? 115 U   X OP2   1 
ATOM   2144 O  "O5'" . U   A  1 101 ? 12.971  0.979   5.771  1.00 36.40  ? 115 U   X "O5'" 1 
ATOM   2145 C  "C5'" . U   A  1 101 ? 13.894  0.688   4.730  1.00 38.23  ? 115 U   X "C5'" 1 
ATOM   2146 C  "C4'" . U   A  1 101 ? 15.269  0.385   5.263  1.00 36.80  ? 115 U   X "C4'" 1 
ATOM   2147 O  "O4'" . U   A  1 101 ? 15.797  1.526   5.990  1.00 36.37  ? 115 U   X "O4'" 1 
ATOM   2148 C  "C3'" . U   A  1 101 ? 15.341  -0.754  6.264  1.00 38.70  ? 115 U   X "C3'" 1 
ATOM   2149 O  "O3'" . U   A  1 101 ? 15.341  -2.014  5.622  1.00 44.78  ? 115 U   X "O3'" 1 
ATOM   2150 C  "C2'" . U   A  1 101 ? 16.621  -0.449  7.030  1.00 35.00  ? 115 U   X "C2'" 1 
ATOM   2151 O  "O2'" . U   A  1 101 ? 17.770  -0.803  6.273  1.00 35.83  ? 115 U   X "O2'" 1 
ATOM   2152 C  "C1'" . U   A  1 101 ? 16.562  1.075   7.091  1.00 33.72  ? 115 U   X "C1'" 1 
ATOM   2153 N  N1    . U   A  1 101 ? 15.978  1.613   8.341  1.00 30.11  ? 115 U   X N1    1 
ATOM   2154 C  C2    . U   A  1 101 ? 16.758  1.558   9.485  1.00 28.31  ? 115 U   X C2    1 
ATOM   2155 O  O2    . U   A  1 101 ? 17.877  1.067   9.500  1.00 30.34  ? 115 U   X O2    1 
ATOM   2156 N  N3    . U   A  1 101 ? 16.173  2.090   10.608 1.00 24.32  ? 115 U   X N3    1 
ATOM   2157 C  C4    . U   A  1 101 ? 14.926  2.654   10.699 1.00 27.76  ? 115 U   X C4    1 
ATOM   2158 O  O4    . U   A  1 101 ? 14.542  3.090   11.785 1.00 32.20  ? 115 U   X O4    1 
ATOM   2159 C  C5    . U   A  1 101 ? 14.185  2.683   9.470  1.00 31.43  ? 115 U   X C5    1 
ATOM   2160 C  C6    . U   A  1 101 ? 14.727  2.173   8.363  1.00 29.50  ? 115 U   X C6    1 
ATOM   2161 P  P     . U   A  1 102 ? 14.700  -3.298  6.332  1.00 43.64  ? 116 U   X P     1 
ATOM   2162 O  OP1   . U   A  1 102 ? 14.565  -4.244  5.189  1.00 49.68  ? 116 U   X OP1   1 
ATOM   2163 O  OP2   . U   A  1 102 ? 13.518  -2.904  7.150  1.00 41.32  ? 116 U   X OP2   1 
ATOM   2164 O  "O5'" . U   A  1 102 ? 15.893  -3.770  7.266  1.00 33.87  ? 116 U   X "O5'" 1 
ATOM   2165 C  "C5'" . U   A  1 102 ? 17.104  -4.207  6.675  1.00 34.80  ? 116 U   X "C5'" 1 
ATOM   2166 C  "C4'" . U   A  1 102 ? 18.115  -4.488  7.750  1.00 38.89  ? 116 U   X "C4'" 1 
ATOM   2167 O  "O4'" . U   A  1 102 ? 18.465  -3.240  8.403  1.00 37.37  ? 116 U   X "O4'" 1 
ATOM   2168 C  "C3'" . U   A  1 102 ? 17.604  -5.335  8.903  1.00 35.35  ? 116 U   X "C3'" 1 
ATOM   2169 O  "O3'" . U   A  1 102 ? 17.528  -6.720  8.619  1.00 40.42  ? 116 U   X "O3'" 1 
ATOM   2170 C  "C2'" . U   A  1 102 ? 18.574  -4.970  10.012 1.00 31.88  ? 116 U   X "C2'" 1 
ATOM   2171 O  "O2'" . U   A  1 102 ? 19.850  -5.534  9.750  1.00 33.47  ? 116 U   X "O2'" 1 
ATOM   2172 C  "C1'" . U   A  1 102 ? 18.687  -3.466  9.783  1.00 33.32  ? 116 U   X "C1'" 1 
ATOM   2173 N  N1    . U   A  1 102 ? 17.758  -2.671  10.629 1.00 29.45  ? 116 U   X N1    1 
ATOM   2174 C  C2    . U   A  1 102 ? 18.177  -2.442  11.921 1.00 27.09  ? 116 U   X C2    1 
ATOM   2175 O  O2    . U   A  1 102 ? 19.235  -2.871  12.339 1.00 27.16  ? 116 U   X O2    1 
ATOM   2176 N  N3    . U   A  1 102 ? 17.319  -1.705  12.694 1.00 26.15  ? 116 U   X N3    1 
ATOM   2177 C  C4    . U   A  1 102 ? 16.107  -1.175  12.310 1.00 28.33  ? 116 U   X C4    1 
ATOM   2178 O  O4    . U   A  1 102 ? 15.449  -0.520  13.126 1.00 31.10  ? 116 U   X O4    1 
ATOM   2179 C  C5    . U   A  1 102 ? 15.739  -1.447  10.952 1.00 28.48  ? 116 U   X C5    1 
ATOM   2180 C  C6    . U   A  1 102 ? 16.559  -2.172  10.181 1.00 30.41  ? 116 U   X C6    1 
ATOM   2181 P  P     . A   A  1 103 ? 16.609  -7.669  9.545  1.00 42.30  ? 117 A   X P     1 
ATOM   2182 O  OP1   . A   A  1 103 ? 16.621  -8.949  8.792  1.00 50.04  ? 117 A   X OP1   1 
ATOM   2183 O  OP2   . A   A  1 103 ? 15.297  -7.054  9.890  1.00 39.75  ? 117 A   X OP2   1 
ATOM   2184 O  "O5'" . A   A  1 103 ? 17.516  -7.773  10.839 1.00 35.11  ? 117 A   X "O5'" 1 
ATOM   2185 C  "C5'" . A   A  1 103 ? 18.826  -8.303  10.771 1.00 33.03  ? 117 A   X "C5'" 1 
ATOM   2186 C  "C4'" . A   A  1 103 ? 19.301  -8.644  12.155 1.00 33.18  ? 117 A   X "C4'" 1 
ATOM   2187 O  "O4'" . A   A  1 103 ? 19.673  -7.430  12.872 1.00 30.32  ? 117 A   X "O4'" 1 
ATOM   2188 C  "C3'" . A   A  1 103 ? 18.245  -9.285  13.042 1.00 34.15  ? 117 A   X "C3'" 1 
ATOM   2189 O  "O3'" . A   A  1 103 ? 18.060  -10.667 12.777 1.00 33.86  ? 117 A   X "O3'" 1 
ATOM   2190 C  "C2'" . A   A  1 103 ? 18.783  -8.978  14.435 1.00 31.18  ? 117 A   X "C2'" 1 
ATOM   2191 O  "O2'" . A   A  1 103 ? 19.889  -9.812  14.725 1.00 31.22  ? 117 A   X "O2'" 1 
ATOM   2192 C  "C1'" . A   A  1 103 ? 19.326  -7.559  14.234 1.00 30.07  ? 117 A   X "C1'" 1 
ATOM   2193 N  N9    . A   A  1 103 ? 18.311  -6.544  14.567 1.00 25.04  ? 117 A   X N9    1 
ATOM   2194 C  C8    . A   A  1 103 ? 17.364  -5.983  13.750 1.00 29.55  ? 117 A   X C8    1 
ATOM   2195 N  N7    . A   A  1 103 ? 16.596  -5.107  14.349 1.00 26.73  ? 117 A   X N7    1 
ATOM   2196 C  C5    . A   A  1 103 ? 17.083  -5.088  15.652 1.00 22.71  ? 117 A   X C5    1 
ATOM   2197 C  C6    . A   A  1 103 ? 16.689  -4.369  16.790 1.00 24.21  ? 117 A   X C6    1 
ATOM   2198 N  N6    . A   A  1 103 ? 15.694  -3.482  16.796 1.00 24.30  ? 117 A   X N6    1 
ATOM   2199 N  N1    . A   A  1 103 ? 17.371  -4.587  17.939 1.00 23.67  ? 117 A   X N1    1 
ATOM   2200 C  C2    . A   A  1 103 ? 18.376  -5.478  17.938 1.00 24.81  ? 117 A   X C2    1 
ATOM   2201 N  N3    . A   A  1 103 ? 18.838  -6.215  16.925 1.00 25.35  ? 117 A   X N3    1 
ATOM   2202 C  C4    . A   A  1 103 ? 18.132  -5.969  15.801 1.00 23.48  ? 117 A   X C4    1 
ATOM   2203 P  P     . A   A  1 104 ? 16.561  -11.250 12.653 1.00 37.82  ? 118 A   X P     1 
ATOM   2204 O  OP1   . A   A  1 104 ? 15.942  -10.725 11.415 1.00 38.97  ? 118 A   X OP1   1 
ATOM   2205 O  OP2   . A   A  1 104 ? 15.885  -10.945 13.938 1.00 35.13  ? 118 A   X OP2   1 
ATOM   2206 O  "O5'" . A   A  1 104 ? 16.843  -12.821 12.524 1.00 35.34  ? 118 A   X "O5'" 1 
ATOM   2207 C  "C5'" . A   A  1 104 ? 17.346  -13.440 11.343 1.00 41.21  ? 118 A   X "C5'" 1 
ATOM   2208 C  "C4'" . A   A  1 104 ? 16.821  -14.851 11.219 1.00 42.81  ? 118 A   X "C4'" 1 
ATOM   2209 O  "O4'" . A   A  1 104 ? 17.055  -15.541 12.475 1.00 39.12  ? 118 A   X "O4'" 1 
ATOM   2210 C  "C3'" . A   A  1 104 ? 15.316  -14.947 11.024 1.00 44.28  ? 118 A   X "C3'" 1 
ATOM   2211 O  "O3'" . A   A  1 104 ? 14.908  -14.860 9.673  1.00 46.05  ? 118 A   X "O3'" 1 
ATOM   2212 C  "C2'" . A   A  1 104 ? 14.937  -16.260 11.689 1.00 44.69  ? 118 A   X "C2'" 1 
ATOM   2213 O  "O2'" . A   A  1 104 ? 15.242  -17.367 10.849 1.00 44.71  ? 118 A   X "O2'" 1 
ATOM   2214 C  "C1'" . A   A  1 104 ? 15.904  -16.260 12.868 1.00 40.39  ? 118 A   X "C1'" 1 
ATOM   2215 N  N9    . A   A  1 104 ? 15.345  -15.540 14.025 1.00 38.33  ? 118 A   X N9    1 
ATOM   2216 C  C8    . A   A  1 104 ? 14.475  -14.468 14.103 1.00 36.58  ? 118 A   X C8    1 
ATOM   2217 N  N7    . A   A  1 104 ? 14.228  -14.062 15.328 1.00 34.27  ? 118 A   X N7    1 
ATOM   2218 C  C5    . A   A  1 104 ? 14.996  -14.940 16.093 1.00 35.63  ? 118 A   X C5    1 
ATOM   2219 C  C6    . A   A  1 104 ? 15.202  -15.078 17.468 1.00 32.40  ? 118 A   X C6    1 
ATOM   2220 N  N6    . A   A  1 104 ? 14.634  -14.319 18.401 1.00 29.34  ? 118 A   X N6    1 
ATOM   2221 N  N1    . A   A  1 104 ? 16.042  -16.055 17.859 1.00 37.39  ? 118 A   X N1    1 
ATOM   2222 C  C2    . A   A  1 104 ? 16.632  -16.833 16.946 1.00 34.31  ? 118 A   X C2    1 
ATOM   2223 N  N3    . A   A  1 104 ? 16.525  -16.810 15.631 1.00 35.68  ? 118 A   X N3    1 
ATOM   2224 C  C4    . A   A  1 104 ? 15.681  -15.836 15.295 1.00 35.01  ? 118 A   X C4    1 
ATOM   2225 P  P     . U   A  1 105 ? 13.734  -13.819 9.360  1.00 59.30  ? 119 U   X P     1 
ATOM   2226 O  OP1   . U   A  1 105 ? 13.383  -14.002 7.926  1.00 63.87  ? 119 U   X OP1   1 
ATOM   2227 O  OP2   . U   A  1 105 ? 14.266  -12.520 9.819  1.00 52.74  ? 119 U   X OP2   1 
ATOM   2228 O  "O5'" . U   A  1 105 ? 12.527  -14.232 10.319 1.00 55.34  ? 119 U   X "O5'" 1 
ATOM   2229 C  "C5'" . U   A  1 105 ? 12.119  -13.345 11.351 1.00 53.71  ? 119 U   X "C5'" 1 
ATOM   2230 C  "C4'" . U   A  1 105 ? 10.642  -13.023 11.303 1.00 62.97  ? 119 U   X "C4'" 1 
ATOM   2231 O  "O4'" . U   A  1 105 ? 10.331  -12.144 10.186 1.00 65.83  ? 119 U   X "O4'" 1 
ATOM   2232 C  "C3'" . U   A  1 105 ? 9.672   -14.184 11.123 1.00 64.25  ? 119 U   X "C3'" 1 
ATOM   2233 O  "O3'" . U   A  1 105 ? 9.465   -14.946 12.298 1.00 57.90  ? 119 U   X "O3'" 1 
ATOM   2234 C  "C2'" . U   A  1 105 ? 8.405   -13.488 10.642 1.00 67.07  ? 119 U   X "C2'" 1 
ATOM   2235 O  "O2'" . U   A  1 105 ? 7.670   -12.939 11.727 1.00 67.40  ? 119 U   X "O2'" 1 
ATOM   2236 C  "C1'" . U   A  1 105 ? 8.978   -12.340 9.807  1.00 70.54  ? 119 U   X "C1'" 1 
ATOM   2237 N  N1    . U   A  1 105 ? 8.739   -12.554 8.356  1.00 74.83  ? 119 U   X N1    1 
ATOM   2238 C  C2    . U   A  1 105 ? 9.789   -12.819 7.491  1.00 74.59  ? 119 U   X C2    1 
ATOM   2239 O  O2    . U   A  1 105 ? 10.956  -12.885 7.841  1.00 71.05  ? 119 U   X O2    1 
ATOM   2240 N  N3    . U   A  1 105 ? 9.414   -12.997 6.178  1.00 79.10  ? 119 U   X N3    1 
ATOM   2241 C  C4    . U   A  1 105 ? 8.134   -12.947 5.652  1.00 81.85  ? 119 U   X C4    1 
ATOM   2242 O  O4    . U   A  1 105 ? 7.962   -13.133 4.445  1.00 83.19  ? 119 U   X O4    1 
ATOM   2243 C  C5    . U   A  1 105 ? 7.108   -12.674 6.611  1.00 80.17  ? 119 U   X C5    1 
ATOM   2244 C  C6    . U   A  1 105 ? 7.441   -12.496 7.893  1.00 78.64  ? 119 U   X C6    1 
ATOM   2245 P  P     . G   A  1 106 ? 9.175   -16.518 12.151 1.00 53.75  ? 120 G   X P     1 
ATOM   2246 O  OP1   . G   A  1 106 ? 8.471   -16.702 10.853 1.00 58.21  ? 120 G   X OP1   1 
ATOM   2247 O  OP2   . G   A  1 106 ? 8.510   -16.924 13.420 1.00 50.20  ? 120 G   X OP2   1 
ATOM   2248 O  "O5'" . G   A  1 106 ? 10.657  -17.110 12.070 1.00 47.27  ? 120 G   X "O5'" 1 
ATOM   2249 C  "C5'" . G   A  1 106 ? 11.112  -17.955 11.026 1.00 43.47  ? 120 G   X "C5'" 1 
ATOM   2250 C  "C4'" . G   A  1 106 ? 12.000  -19.039 11.578 1.00 42.51  ? 120 G   X "C4'" 1 
ATOM   2251 O  "O4'" . G   A  1 106 ? 13.057  -18.435 12.370 1.00 40.76  ? 120 G   X "O4'" 1 
ATOM   2252 C  "C3'" . G   A  1 106 ? 11.325  -20.009 12.538 1.00 38.75  ? 120 G   X "C3'" 1 
ATOM   2253 O  "O3'" . G   A  1 106 ? 10.637  -21.058 11.872 1.00 41.79  ? 120 G   X "O3'" 1 
ATOM   2254 C  "C2'" . G   A  1 106 ? 12.485  -20.494 13.391 1.00 35.51  ? 120 G   X "C2'" 1 
ATOM   2255 O  "O2'" . G   A  1 106 ? 13.243  -21.460 12.683 1.00 38.49  ? 120 G   X "O2'" 1 
ATOM   2256 C  "C1'" . G   A  1 106 ? 13.335  -19.229 13.503 1.00 36.67  ? 120 G   X "C1'" 1 
ATOM   2257 N  N9    . G   A  1 106 ? 13.018  -18.450 14.715 1.00 34.89  ? 120 G   X N9    1 
ATOM   2258 C  C8    . G   A  1 106 ? 12.309  -17.275 14.782 1.00 35.16  ? 120 G   X C8    1 
ATOM   2259 N  N7    . G   A  1 106 ? 12.196  -16.813 15.997 1.00 33.21  ? 120 G   X N7    1 
ATOM   2260 C  C5    . G   A  1 106 ? 12.869  -17.736 16.782 1.00 32.50  ? 120 G   X C5    1 
ATOM   2261 C  C6    . G   A  1 106 ? 13.090  -17.762 18.184 1.00 31.27  ? 120 G   X C6    1 
ATOM   2262 O  O6    . G   A  1 106 ? 12.709  -16.942 19.034 1.00 31.85  ? 120 G   X O6    1 
ATOM   2263 N  N1    . G   A  1 106 ? 13.828  -18.879 18.570 1.00 30.26  ? 120 G   X N1    1 
ATOM   2264 C  C2    . G   A  1 106 ? 14.297  -19.845 17.714 1.00 31.34  ? 120 G   X C2    1 
ATOM   2265 N  N2    . G   A  1 106 ? 14.985  -20.848 18.269 1.00 29.81  ? 120 G   X N2    1 
ATOM   2266 N  N3    . G   A  1 106 ? 14.101  -19.830 16.404 1.00 33.59  ? 120 G   X N3    1 
ATOM   2267 C  C4    . G   A  1 106 ? 13.387  -18.753 16.007 1.00 33.67  ? 120 G   X C4    1 
ATOM   2268 P  P     . C   A  1 107 ? 9.199   -21.594 12.376 1.00 42.35  ? 121 C   X P     1 
ATOM   2269 O  OP1   . C   A  1 107 ? 8.799   -22.554 11.305 1.00 37.66  ? 121 C   X OP1   1 
ATOM   2270 O  OP2   . C   A  1 107 ? 8.317   -20.454 12.723 1.00 37.54  ? 121 C   X OP2   1 
ATOM   2271 O  "O5'" . C   A  1 107 ? 9.556   -22.390 13.702 1.00 31.69  ? 121 C   X "O5'" 1 
ATOM   2272 C  "C5'" . C   A  1 107 ? 10.348  -23.562 13.617 1.00 31.96  ? 121 C   X "C5'" 1 
ATOM   2273 C  "C4'" . C   A  1 107 ? 10.741  -24.036 14.986 1.00 30.04  ? 121 C   X "C4'" 1 
ATOM   2274 O  "O4'" . C   A  1 107 ? 11.650  -23.073 15.584 1.00 27.30  ? 121 C   X "O4'" 1 
ATOM   2275 C  "C3'" . C   A  1 107 ? 9.615   -24.131 16.003 1.00 28.87  ? 121 C   X "C3'" 1 
ATOM   2276 O  "O3'" . C   A  1 107 ? 8.801   -25.281 15.858 1.00 26.84  ? 121 C   X "O3'" 1 
ATOM   2277 C  "C2'" . C   A  1 107 ? 10.382  -24.090 17.312 1.00 27.18  ? 121 C   X "C2'" 1 
ATOM   2278 O  "O2'" . C   A  1 107 ? 11.071  -25.319 17.493 1.00 28.20  ? 121 C   X "O2'" 1 
ATOM   2279 C  "C1'" . C   A  1 107 ? 11.426  -23.023 16.979 1.00 29.97  ? 121 C   X "C1'" 1 
ATOM   2280 N  N1    . C   A  1 107 ? 10.976  -21.677 17.399 1.00 28.16  ? 121 C   X N1    1 
ATOM   2281 C  C2    . C   A  1 107 ? 11.140  -21.328 18.739 1.00 26.20  ? 121 C   X C2    1 
ATOM   2282 O  O2    . C   A  1 107 ? 11.649  -22.148 19.507 1.00 28.60  ? 121 C   X O2    1 
ATOM   2283 N  N3    . C   A  1 107 ? 10.755  -20.109 19.159 1.00 25.84  ? 121 C   X N3    1 
ATOM   2284 C  C4    . C   A  1 107 ? 10.206  -19.252 18.298 1.00 26.66  ? 121 C   X C4    1 
ATOM   2285 N  N4    . C   A  1 107 ? 9.830   -18.056 18.762 1.00 26.01  ? 121 C   X N4    1 
ATOM   2286 C  C5    . C   A  1 107 ? 10.026  -19.578 16.923 1.00 28.86  ? 121 C   X C5    1 
ATOM   2287 C  C6    . C   A  1 107 ? 10.422  -20.793 16.522 1.00 27.57  ? 121 C   X C6    1 
ATOM   2288 P  P     . A   A  1 108 ? 7.256   -25.207 16.331 1.00 31.10  ? 122 A   X P     1 
ATOM   2289 O  OP1   . A   A  1 108 ? 6.669   -26.512 15.932 1.00 31.82  ? 122 A   X OP1   1 
ATOM   2290 O  OP2   . A   A  1 108 ? 6.652   -23.967 15.821 1.00 31.68  ? 122 A   X OP2   1 
ATOM   2291 O  "O5'" . A   A  1 108 ? 7.365   -25.153 17.914 1.00 29.19  ? 122 A   X "O5'" 1 
ATOM   2292 C  "C5'" . A   A  1 108 ? 7.875   -26.284 18.603 1.00 28.37  ? 122 A   X "C5'" 1 
ATOM   2293 C  "C4'" . A   A  1 108 ? 8.031   -26.003 20.074 1.00 30.36  ? 122 A   X "C4'" 1 
ATOM   2294 O  "O4'" . A   A  1 108 ? 8.971   -24.915 20.266 1.00 26.72  ? 122 A   X "O4'" 1 
ATOM   2295 C  "C3'" . A   A  1 108 ? 6.780   -25.514 20.786 1.00 29.56  ? 122 A   X "C3'" 1 
ATOM   2296 O  "O3'" . A   A  1 108 ? 5.853   -26.544 21.083 1.00 28.85  ? 122 A   X "O3'" 1 
ATOM   2297 C  "C2'" . A   A  1 108 ? 7.367   -24.827 22.011 1.00 29.09  ? 122 A   X "C2'" 1 
ATOM   2298 O  "O2'" . A   A  1 108 ? 7.871   -25.787 22.923 1.00 31.44  ? 122 A   X "O2'" 1 
ATOM   2299 C  "C1'" . A   A  1 108 ? 8.570   -24.131 21.379 1.00 30.04  ? 122 A   X "C1'" 1 
ATOM   2300 N  N9    . A   A  1 108 ? 8.212   -22.772 20.924 1.00 28.88  ? 122 A   X N9    1 
ATOM   2301 C  C8    . A   A  1 108 ? 7.925   -22.333 19.642 1.00 29.41  ? 122 A   X C8    1 
ATOM   2302 N  N7    . A   A  1 108 ? 7.642   -21.045 19.569 1.00 26.01  ? 122 A   X N7    1 
ATOM   2303 C  C5    . A   A  1 108 ? 7.741   -20.619 20.893 1.00 25.48  ? 122 A   X C5    1 
ATOM   2304 C  C6    . A   A  1 108 ? 7.566   -19.368 21.500 1.00 24.83  ? 122 A   X C6    1 
ATOM   2305 N  N6    . A   A  1 108 ? 7.230   -18.265 20.837 1.00 23.29  ? 122 A   X N6    1 
ATOM   2306 N  N1    . A   A  1 108 ? 7.738   -19.283 22.831 1.00 23.92  ? 122 A   X N1    1 
ATOM   2307 C  C2    . A   A  1 108 ? 8.074   -20.376 23.515 1.00 24.71  ? 122 A   X C2    1 
ATOM   2308 N  N3    . A   A  1 108 ? 8.270   -21.601 23.063 1.00 26.10  ? 122 A   X N3    1 
ATOM   2309 C  C4    . A   A  1 108 ? 8.090   -21.662 21.731 1.00 26.32  ? 122 A   X C4    1 
ATOM   2310 P  P     . G   A  1 109 ? 4.291   -26.164 21.271 1.00 32.79  ? 123 G   X P     1 
ATOM   2311 O  OP1   . G   A  1 109 ? 3.650   -27.507 21.328 1.00 37.17  ? 123 G   X OP1   1 
ATOM   2312 O  OP2   . G   A  1 109 ? 3.866   -25.202 20.230 1.00 33.03  ? 123 G   X OP2   1 
ATOM   2313 O  "O5'" . G   A  1 109 ? 4.257   -25.471 22.710 1.00 31.66  ? 123 G   X "O5'" 1 
ATOM   2314 C  "C5'" . G   A  1 109 ? 4.558   -26.204 23.884 1.00 29.93  ? 123 G   X "C5'" 1 
ATOM   2315 C  "C4'" . G   A  1 109 ? 4.471   -25.298 25.082 1.00 29.23  ? 123 G   X "C4'" 1 
ATOM   2316 O  "O4'" . G   A  1 109 ? 5.427   -24.223 24.908 1.00 28.14  ? 123 G   X "O4'" 1 
ATOM   2317 C  "C3'" . G   A  1 109 ? 3.147   -24.562 25.243 1.00 30.74  ? 123 G   X "C3'" 1 
ATOM   2318 O  "O3'" . G   A  1 109 ? 2.126   -25.341 25.835 1.00 28.90  ? 123 G   X "O3'" 1 
ATOM   2319 C  "C2'" . G   A  1 109 ? 3.542   -23.351 26.064 1.00 28.39  ? 123 G   X "C2'" 1 
ATOM   2320 O  "O2'" . G   A  1 109 ? 3.763   -23.732 27.414 1.00 27.88  ? 123 G   X "O2'" 1 
ATOM   2321 C  "C1'" . G   A  1 109 ? 4.889   -23.027 25.424 1.00 27.57  ? 123 G   X "C1'" 1 
ATOM   2322 N  N9    . G   A  1 109 ? 4.758   -22.050 24.329 1.00 27.52  ? 123 G   X N9    1 
ATOM   2323 C  C8    . G   A  1 109 ? 4.787   -22.246 22.967 1.00 26.18  ? 123 G   X C8    1 
ATOM   2324 N  N7    . G   A  1 109 ? 4.646   -21.136 22.301 1.00 25.54  ? 123 G   X N7    1 
ATOM   2325 C  C5    . G   A  1 109 ? 4.515   -20.157 23.284 1.00 25.40  ? 123 G   X C5    1 
ATOM   2326 C  C6    . G   A  1 109 ? 4.341   -18.751 23.202 1.00 23.71  ? 123 G   X C6    1 
ATOM   2327 O  O6    . G   A  1 109 ? 4.257   -18.046 22.185 1.00 24.17  ? 123 G   X O6    1 
ATOM   2328 N  N1    . G   A  1 109 ? 4.263   -18.161 24.472 1.00 23.63  ? 123 G   X N1    1 
ATOM   2329 C  C2    . G   A  1 109 ? 4.347   -18.840 25.665 1.00 23.97  ? 123 G   X C2    1 
ATOM   2330 N  N2    . G   A  1 109 ? 4.242   -18.133 26.805 1.00 24.70  ? 123 G   X N2    1 
ATOM   2331 N  N3    . G   A  1 109 ? 4.508   -20.140 25.751 1.00 25.71  ? 123 G   X N3    1 
ATOM   2332 C  C4    . G   A  1 109 ? 4.587   -20.718 24.535 1.00 25.42  ? 123 G   X C4    1 
ATOM   2333 P  P     . C   A  1 110 ? 0.615   -25.138 25.345 1.00 30.17  ? 124 C   X P     1 
ATOM   2334 O  OP1   . C   A  1 110 ? -0.119  -26.227 26.028 1.00 33.42  ? 124 C   X OP1   1 
ATOM   2335 O  OP2   . C   A  1 110 ? 0.641   -25.086 23.854 1.00 27.48  ? 124 C   X OP2   1 
ATOM   2336 O  "O5'" . C   A  1 110 ? 0.231   -23.699 25.913 1.00 23.85  ? 124 C   X "O5'" 1 
ATOM   2337 C  "C5'" . C   A  1 110 ? 0.210   -23.481 27.316 1.00 29.39  ? 124 C   X "C5'" 1 
ATOM   2338 C  "C4'" . C   A  1 110 ? -0.099  -22.047 27.654 1.00 26.44  ? 124 C   X "C4'" 1 
ATOM   2339 O  "O4'" . C   A  1 110 ? 0.995   -21.171 27.254 1.00 24.48  ? 124 C   X "O4'" 1 
ATOM   2340 C  "C3'" . C   A  1 110 ? -1.312  -21.451 26.964 1.00 27.40  ? 124 C   X "C3'" 1 
ATOM   2341 O  "O3'" . C   A  1 110 ? -2.543  -21.837 27.553 1.00 29.93  ? 124 C   X "O3'" 1 
ATOM   2342 C  "C2'" . C   A  1 110 ? -1.033  -19.963 27.082 1.00 25.23  ? 124 C   X "C2'" 1 
ATOM   2343 O  "O2'" . C   A  1 110 ? -1.299  -19.524 28.401 1.00 25.31  ? 124 C   X "O2'" 1 
ATOM   2344 C  "C1'" . C   A  1 110 ? 0.480   -19.926 26.850 1.00 27.02  ? 124 C   X "C1'" 1 
ATOM   2345 N  N1    . C   A  1 110 ? 0.716   -19.667 25.412 1.00 24.68  ? 124 C   X N1    1 
ATOM   2346 C  C2    . C   A  1 110 ? 0.666   -18.338 25.034 1.00 26.08  ? 124 C   X C2    1 
ATOM   2347 O  O2    . C   A  1 110 ? 0.461   -17.507 25.938 1.00 24.59  ? 124 C   X O2    1 
ATOM   2348 N  N3    . C   A  1 110 ? 0.843   -18.016 23.726 1.00 25.01  ? 124 C   X N3    1 
ATOM   2349 C  C4    . C   A  1 110 ? 1.064   -18.972 22.829 1.00 27.18  ? 124 C   X C4    1 
ATOM   2350 N  N4    . C   A  1 110 ? 1.229   -18.605 21.550 1.00 28.78  ? 124 C   X N4    1 
ATOM   2351 C  C5    . C   A  1 110 ? 1.105   -20.347 23.195 1.00 26.54  ? 124 C   X C5    1 
ATOM   2352 C  C6    . C   A  1 110 ? 0.919   -20.653 24.486 1.00 26.90  ? 124 C   X C6    1 
ATOM   2353 P  P     . U   A  1 111 ? -3.788  -22.173 26.607 1.00 31.70  ? 125 U   X P     1 
ATOM   2354 O  OP1   . U   A  1 111 ? -4.942  -22.363 27.521 1.00 29.74  ? 125 U   X OP1   1 
ATOM   2355 O  OP2   . U   A  1 111 ? -3.398  -23.263 25.688 1.00 25.88  ? 125 U   X OP2   1 
ATOM   2356 O  "O5'" . U   A  1 111 ? -3.953  -20.870 25.696 1.00 27.12  ? 125 U   X "O5'" 1 
ATOM   2357 C  "C5'" . U   A  1 111 ? -4.315  -19.611 26.211 1.00 31.24  ? 125 U   X "C5'" 1 
ATOM   2358 C  "C4'" . U   A  1 111 ? -4.110  -18.505 25.200 1.00 29.45  ? 125 U   X "C4'" 1 
ATOM   2359 O  "O4'" . U   A  1 111 ? -2.788  -18.580 24.589 1.00 29.73  ? 125 U   X "O4'" 1 
ATOM   2360 C  "C3'" . U   A  1 111 ? -5.024  -18.430 23.985 1.00 26.92  ? 125 U   X "C3'" 1 
ATOM   2361 O  "O3'" . U   A  1 111 ? -6.344  -18.004 24.280 1.00 26.40  ? 125 U   X "O3'" 1 
ATOM   2362 C  "C2'" . U   A  1 111 ? -4.259  -17.389 23.181 1.00 28.33  ? 125 U   X "C2'" 1 
ATOM   2363 O  "O2'" . U   A  1 111 ? -4.371  -16.136 23.841 1.00 25.57  ? 125 U   X "O2'" 1 
ATOM   2364 C  "C1'" . U   A  1 111 ? -2.820  -17.868 23.369 1.00 26.13  ? 125 U   X "C1'" 1 
ATOM   2365 N  N1    . U   A  1 111 ? -2.359  -18.686 22.235 1.00 27.18  ? 125 U   X N1    1 
ATOM   2366 C  C2    . U   A  1 111 ? -1.946  -18.010 21.102 1.00 29.78  ? 125 U   X C2    1 
ATOM   2367 O  O2    . U   A  1 111 ? -1.948  -16.800 21.029 1.00 28.01  ? 125 U   X O2    1 
ATOM   2368 N  N3    . U   A  1 111 ? -1.524  -18.803 20.060 1.00 34.49  ? 125 U   X N3    1 
ATOM   2369 C  C4    . U   A  1 111 ? -1.476  -20.181 20.043 1.00 38.48  ? 125 U   X C4    1 
ATOM   2370 O  O4    . U   A  1 111 ? -1.074  -20.761 19.032 1.00 44.26  ? 125 U   X O4    1 
ATOM   2371 C  C5    . U   A  1 111 ? -1.924  -20.807 21.249 1.00 33.55  ? 125 U   X C5    1 
ATOM   2372 C  C6    . U   A  1 111 ? -2.341  -20.060 22.277 1.00 29.43  ? 125 U   X C6    1 
ATOM   2373 P  P     . G   A  1 112 ? -7.626  -18.709 23.614 1.00 24.98  ? 126 G   X P     1 
ATOM   2374 O  OP1   . G   A  1 112 ? -7.548  -20.115 24.017 1.00 23.94  ? 126 G   X OP1   1 
ATOM   2375 O  OP2   . G   A  1 112 ? -7.686  -18.371 22.169 1.00 26.16  ? 126 G   X OP2   1 
ATOM   2376 O  "O5'" . G   A  1 112 ? -8.774  -17.945 24.418 1.00 23.94  ? 126 G   X "O5'" 1 
ATOM   2377 C  "C5'" . G   A  1 112 ? -8.799  -18.003 25.834 1.00 22.92  ? 126 G   X "C5'" 1 
ATOM   2378 C  "C4'" . G   A  1 112 ? -10.051 -17.363 26.370 1.00 25.18  ? 126 G   X "C4'" 1 
ATOM   2379 O  "O4'" . G   A  1 112 ? -10.016 -15.943 26.080 1.00 22.13  ? 126 G   X "O4'" 1 
ATOM   2380 C  "C3'" . G   A  1 112 ? -11.358 -17.802 25.724 1.00 21.03  ? 126 G   X "C3'" 1 
ATOM   2381 O  "O3'" . G   A  1 112 ? -11.827 -19.067 26.141 1.00 24.17  ? 126 G   X "O3'" 1 
ATOM   2382 C  "C2'" . G   A  1 112 ? -12.274 -16.648 26.107 1.00 24.16  ? 126 G   X "C2'" 1 
ATOM   2383 O  "O2'" . G   A  1 112 ? -12.559 -16.699 27.499 1.00 23.63  ? 126 G   X "O2'" 1 
ATOM   2384 C  "C1'" . G   A  1 112 ? -11.325 -15.478 25.832 1.00 23.10  ? 126 G   X "C1'" 1 
ATOM   2385 N  N9    . G   A  1 112 ? -11.415 -15.093 24.410 1.00 25.08  ? 126 G   X N9    1 
ATOM   2386 C  C8    . G   A  1 112 ? -10.681 -15.544 23.338 1.00 24.37  ? 126 G   X C8    1 
ATOM   2387 N  N7    . G   A  1 112 ? -11.058 -15.002 22.198 1.00 23.59  ? 126 G   X N7    1 
ATOM   2388 C  C5    . G   A  1 112 ? -12.098 -14.161 22.536 1.00 25.75  ? 126 G   X C5    1 
ATOM   2389 C  C6    . G   A  1 112 ? -12.903 -13.304 21.736 1.00 26.82  ? 126 G   X C6    1 
ATOM   2390 O  O6    . G   A  1 112 ? -12.861 -13.095 20.517 1.00 28.09  ? 126 G   X O6    1 
ATOM   2391 N  N1    . G   A  1 112 ? -13.835 -12.632 22.505 1.00 28.02  ? 126 G   X N1    1 
ATOM   2392 C  C2    . G   A  1 112 ? -13.990 -12.757 23.860 1.00 27.31  ? 126 G   X C2    1 
ATOM   2393 N  N2    . G   A  1 112 ? -14.963 -12.017 24.409 1.00 27.22  ? 126 G   X N2    1 
ATOM   2394 N  N3    . G   A  1 112 ? -13.248 -13.549 24.617 1.00 26.18  ? 126 G   X N3    1 
ATOM   2395 C  C4    . G   A  1 112 ? -12.328 -14.210 23.897 1.00 24.61  ? 126 G   X C4    1 
ATOM   2396 P  P     . G   A  1 113 ? -12.762 -19.916 25.126 1.00 28.26  ? 127 G   X P     1 
ATOM   2397 O  OP1   . G   A  1 113 ? -13.016 -21.169 25.856 1.00 25.81  ? 127 G   X OP1   1 
ATOM   2398 O  OP2   . G   A  1 113 ? -12.089 -19.961 23.799 1.00 27.40  ? 127 G   X OP2   1 
ATOM   2399 O  "O5'" . G   A  1 113 ? -14.064 -19.012 24.975 1.00 24.82  ? 127 G   X "O5'" 1 
ATOM   2400 C  "C5'" . G   A  1 113 ? -14.876 -18.676 26.089 1.00 26.39  ? 127 G   X "C5'" 1 
ATOM   2401 C  "C4'" . G   A  1 113 ? -16.052 -17.824 25.680 1.00 22.97  ? 127 G   X "C4'" 1 
ATOM   2402 O  "O4'" . G   A  1 113 ? -15.611 -16.549 25.157 1.00 26.86  ? 127 G   X "O4'" 1 
ATOM   2403 C  "C3'" . G   A  1 113 ? -16.935 -18.376 24.571 1.00 27.21  ? 127 G   X "C3'" 1 
ATOM   2404 O  "O3'" . G   A  1 113 ? -17.819 -19.373 25.037 1.00 30.80  ? 127 G   X "O3'" 1 
ATOM   2405 C  "C2'" . G   A  1 113 ? -17.652 -17.123 24.084 1.00 29.94  ? 127 G   X "C2'" 1 
ATOM   2406 O  "O2'" . G   A  1 113 ? -18.712 -16.749 24.955 1.00 31.33  ? 127 G   X "O2'" 1 
ATOM   2407 C  "C1'" . G   A  1 113 ? -16.542 -16.078 24.203 1.00 27.30  ? 127 G   X "C1'" 1 
ATOM   2408 N  N9    . G   A  1 113 ? -15.907 -15.893 22.892 1.00 29.07  ? 127 G   X N9    1 
ATOM   2409 C  C8    . G   A  1 113 ? -14.842 -16.557 22.337 1.00 28.23  ? 127 G   X C8    1 
ATOM   2410 N  N7    . G   A  1 113 ? -14.590 -16.132 21.121 1.00 30.46  ? 127 G   X N7    1 
ATOM   2411 C  C5    . G   A  1 113 ? -15.551 -15.157 20.863 1.00 26.23  ? 127 G   X C5    1 
ATOM   2412 C  C6    . G   A  1 113 ? -15.793 -14.346 19.718 1.00 32.08  ? 127 G   X C6    1 
ATOM   2413 O  O6    . G   A  1 113 ? -15.164 -14.333 18.649 1.00 31.32  ? 127 G   X O6    1 
ATOM   2414 N  N1    . G   A  1 113 ? -16.884 -13.489 19.902 1.00 29.34  ? 127 G   X N1    1 
ATOM   2415 C  C2    . G   A  1 113 ? -17.646 -13.429 21.045 1.00 32.73  ? 127 G   X C2    1 
ATOM   2416 N  N2    . G   A  1 113 ? -18.669 -12.555 21.075 1.00 32.95  ? 127 G   X N2    1 
ATOM   2417 N  N3    . G   A  1 113 ? -17.427 -14.184 22.109 1.00 30.17  ? 127 G   X N3    1 
ATOM   2418 C  C4    . G   A  1 113 ? -16.371 -15.010 21.947 1.00 28.20  ? 127 G   X C4    1 
ATOM   2419 P  P     . A   A  1 114 ? -17.674 -20.911 24.658 1.00 32.19  ? 128 A   X P     1 
ATOM   2420 O  OP1   . A   A  1 114 ? -18.973 -21.504 25.083 1.00 34.53  ? 128 A   X OP1   1 
ATOM   2421 O  OP2   . A   A  1 114 ? -16.456 -21.492 25.257 1.00 27.75  ? 128 A   X OP2   1 
ATOM   2422 O  "O5'" . A   A  1 114 ? -17.552 -20.918 23.076 1.00 27.31  ? 128 A   X "O5'" 1 
ATOM   2423 C  "C5'" . A   A  1 114 ? -17.314 -22.161 22.428 1.00 30.29  ? 128 A   X "C5'" 1 
ATOM   2424 C  "C4'" . A   A  1 114 ? -16.061 -22.118 21.586 1.00 30.26  ? 128 A   X "C4'" 1 
ATOM   2425 O  "O4'" . A   A  1 114 ? -16.311 -21.344 20.384 1.00 29.08  ? 128 A   X "O4'" 1 
ATOM   2426 C  "C3'" . A   A  1 114 ? -14.830 -21.502 22.245 1.00 26.94  ? 128 A   X "C3'" 1 
ATOM   2427 O  "O3'" . A   A  1 114 ? -13.676 -22.259 21.880 1.00 27.32  ? 128 A   X "O3'" 1 
ATOM   2428 C  "C2'" . A   A  1 114 ? -14.738 -20.108 21.631 1.00 30.53  ? 128 A   X "C2'" 1 
ATOM   2429 O  "O2'" . A   A  1 114 ? -13.407 -19.653 21.495 1.00 29.79  ? 128 A   X "O2'" 1 
ATOM   2430 C  "C1'" . A   A  1 114 ? -15.400 -20.268 20.264 1.00 30.99  ? 128 A   X "C1'" 1 
ATOM   2431 N  N9    . A   A  1 114 ? -16.226 -19.118 19.896 1.00 33.03  ? 128 A   X N9    1 
ATOM   2432 C  C8    . A   A  1 114 ? -17.225 -18.529 20.650 1.00 30.88  ? 128 A   X C8    1 
ATOM   2433 N  N7    . A   A  1 114 ? -17.836 -17.525 20.076 1.00 34.19  ? 128 A   X N7    1 
ATOM   2434 C  C5    . A   A  1 114 ? -17.184 -17.462 18.849 1.00 34.89  ? 128 A   X C5    1 
ATOM   2435 C  C6    . A   A  1 114 ? -17.355 -16.612 17.763 1.00 36.88  ? 128 A   X C6    1 
ATOM   2436 N  N6    . A   A  1 114 ? -18.254 -15.635 17.738 1.00 36.00  ? 128 A   X N6    1 
ATOM   2437 N  N1    . A   A  1 114 ? -16.555 -16.811 16.694 1.00 42.63  ? 128 A   X N1    1 
ATOM   2438 C  C2    . A   A  1 114 ? -15.650 -17.802 16.731 1.00 38.05  ? 128 A   X C2    1 
ATOM   2439 N  N3    . A   A  1 114 ? -15.389 -18.677 17.695 1.00 34.64  ? 128 A   X N3    1 
ATOM   2440 C  C4    . A   A  1 114 ? -16.203 -18.435 18.725 1.00 33.90  ? 128 A   X C4    1 
ATOM   2441 P  P     . U   A  1 115 ? -13.311 -23.614 22.677 1.00 33.00  ? 129 U   X P     1 
ATOM   2442 O  OP1   . U   A  1 115 ? -13.972 -23.573 24.003 1.00 31.81  ? 129 U   X OP1   1 
ATOM   2443 O  OP2   . U   A  1 115 ? -11.832 -23.814 22.590 1.00 30.87  ? 129 U   X OP2   1 
ATOM   2444 O  "O5'" . U   A  1 115 ? -14.052 -24.695 21.758 1.00 32.23  ? 129 U   X "O5'" 1 
ATOM   2445 C  "C5'" . U   A  1 115 ? -13.348 -25.447 20.772 1.00 32.04  ? 129 U   X "C5'" 1 
ATOM   2446 C  "C4'" . U   A  1 115 ? -14.304 -26.276 19.948 1.00 30.20  ? 129 U   X "C4'" 1 
ATOM   2447 O  "O4'" . U   A  1 115 ? -15.216 -25.393 19.236 1.00 32.15  ? 129 U   X "O4'" 1 
ATOM   2448 C  "C3'" . U   A  1 115 ? -13.664 -27.164 18.886 1.00 36.02  ? 129 U   X "C3'" 1 
ATOM   2449 O  "O3'" . U   A  1 115 ? -14.426 -28.366 18.759 1.00 32.13  ? 129 U   X "O3'" 1 
ATOM   2450 C  "C2'" . U   A  1 115 ? -13.828 -26.338 17.614 1.00 38.06  ? 129 U   X "C2'" 1 
ATOM   2451 O  "O2'" . U   A  1 115 ? -13.821 -27.083 16.415 1.00 40.67  ? 129 U   X "O2'" 1 
ATOM   2452 C  "C1'" . U   A  1 115 ? -15.181 -25.680 17.852 1.00 35.74  ? 129 U   X "C1'" 1 
ATOM   2453 N  N1    . U   A  1 115 ? -15.302 -24.447 17.044 1.00 39.32  ? 129 U   X N1    1 
ATOM   2454 C  C2    . U   A  1 115 ? -16.189 -24.433 15.974 1.00 43.10  ? 129 U   X C2    1 
ATOM   2455 O  O2    . U   A  1 115 ? -16.893 -25.378 15.671 1.00 39.89  ? 129 U   X O2    1 
ATOM   2456 N  N3    . U   A  1 115 ? -16.228 -23.259 15.262 1.00 46.30  ? 129 U   X N3    1 
ATOM   2457 C  C4    . U   A  1 115 ? -15.477 -22.122 15.494 1.00 49.03  ? 129 U   X C4    1 
ATOM   2458 O  O4    . U   A  1 115 ? -15.623 -21.138 14.761 1.00 54.07  ? 129 U   X O4    1 
ATOM   2459 C  C5    . U   A  1 115 ? -14.577 -22.215 16.605 1.00 47.44  ? 129 U   X C5    1 
ATOM   2460 C  C6    . U   A  1 115 ? -14.521 -23.346 17.321 1.00 44.07  ? 129 U   X C6    1 
ATOM   2461 P  P     . G   A  1 116 ? -13.711 -29.782 18.953 1.00 37.96  ? 130 G   X P     1 
ATOM   2462 O  OP1   . G   A  1 116 ? -14.752 -30.798 18.628 1.00 38.55  ? 130 G   X OP1   1 
ATOM   2463 O  OP2   . G   A  1 116 ? -13.037 -29.813 20.283 1.00 29.28  ? 130 G   X OP2   1 
ATOM   2464 O  "O5'" . G   A  1 116 ? -12.612 -29.714 17.809 1.00 41.09  ? 130 G   X "O5'" 1 
ATOM   2465 C  "C5'" . G   A  1 116 ? -11.482 -30.570 17.875 1.00 42.25  ? 130 G   X "C5'" 1 
ATOM   2466 C  "C4'" . G   A  1 116 ? -11.034 -30.948 16.489 1.00 46.98  ? 130 G   X "C4'" 1 
ATOM   2467 O  "O4'" . G   A  1 116 ? -12.025 -31.816 15.872 1.00 43.19  ? 130 G   X "O4'" 1 
ATOM   2468 C  "C3'" . G   A  1 116 ? -10.929 -29.795 15.504 1.00 45.96  ? 130 G   X "C3'" 1 
ATOM   2469 O  "O3'" . G   A  1 116 ? -9.767  -29.002 15.659 1.00 48.16  ? 130 G   X "O3'" 1 
ATOM   2470 C  "C2'" . G   A  1 116 ? -11.012 -30.515 14.167 1.00 49.17  ? 130 G   X "C2'" 1 
ATOM   2471 O  "O2'" . G   A  1 116 ? -9.789  -31.173 13.878 1.00 46.51  ? 130 G   X "O2'" 1 
ATOM   2472 C  "C1'" . G   A  1 116 ? -12.075 -31.568 14.481 1.00 45.11  ? 130 G   X "C1'" 1 
ATOM   2473 N  N9    . G   A  1 116 ? -13.408 -31.058 14.121 1.00 43.78  ? 130 G   X N9    1 
ATOM   2474 C  C8    . G   A  1 116 ? -14.385 -30.572 14.963 1.00 42.22  ? 130 G   X C8    1 
ATOM   2475 N  N7    . G   A  1 116 ? -15.451 -30.177 14.316 1.00 40.99  ? 130 G   X N7    1 
ATOM   2476 C  C5    . G   A  1 116 ? -15.158 -30.417 12.976 1.00 42.65  ? 130 G   X C5    1 
ATOM   2477 C  C6    . G   A  1 116 ? -15.919 -30.199 11.798 1.00 42.78  ? 130 G   X C6    1 
ATOM   2478 O  O6    . G   A  1 116 ? -17.054 -29.726 11.679 1.00 42.60  ? 130 G   X O6    1 
ATOM   2479 N  N1    . G   A  1 116 ? -15.231 -30.585 10.650 1.00 43.92  ? 130 G   X N1    1 
ATOM   2480 C  C2    . G   A  1 116 ? -13.975 -31.117 10.619 1.00 45.25  ? 130 G   X C2    1 
ATOM   2481 N  N2    . G   A  1 116 ? -13.509 -31.420 9.393  1.00 48.03  ? 130 G   X N2    1 
ATOM   2482 N  N3    . G   A  1 116 ? -13.246 -31.329 11.707 1.00 45.92  ? 130 G   X N3    1 
ATOM   2483 C  C4    . G   A  1 116 ? -13.895 -30.958 12.839 1.00 44.97  ? 130 G   X C4    1 
ATOM   2484 P  P     . C   A  1 117 ? -9.875  -27.439 15.302 1.00 50.59  ? 131 C   X P     1 
ATOM   2485 O  OP1   . C   A  1 117 ? -8.483  -26.956 15.490 1.00 58.28  ? 131 C   X OP1   1 
ATOM   2486 O  OP2   . C   A  1 117 ? -10.975 -26.869 16.121 1.00 49.99  ? 131 C   X OP2   1 
ATOM   2487 O  "O5'" . C   A  1 117 ? -10.332 -27.360 13.778 1.00 49.06  ? 131 C   X "O5'" 1 
ATOM   2488 C  "C5'" . C   A  1 117 ? -9.535  -27.852 12.713 1.00 52.53  ? 131 C   X "C5'" 1 
ATOM   2489 C  "C4'" . C   A  1 117 ? -10.233 -27.722 11.381 1.00 53.32  ? 131 C   X "C4'" 1 
ATOM   2490 O  "O4'" . C   A  1 117 ? -11.474 -28.483 11.367 1.00 51.04  ? 131 C   X "O4'" 1 
ATOM   2491 C  "C3'" . C   A  1 117 ? -10.676 -26.324 10.979 1.00 53.42  ? 131 C   X "C3'" 1 
ATOM   2492 O  "O3'" . C   A  1 117 ? -9.613  -25.510 10.516 1.00 59.25  ? 131 C   X "O3'" 1 
ATOM   2493 C  "C2'" . C   A  1 117 ? -11.716 -26.625 9.909  1.00 54.65  ? 131 C   X "C2'" 1 
ATOM   2494 O  "O2'" . C   A  1 117 ? -11.084 -26.988 8.688  1.00 57.95  ? 131 C   X "O2'" 1 
ATOM   2495 C  "C1'" . C   A  1 117 ? -12.399 -27.862 10.498 1.00 48.08  ? 131 C   X "C1'" 1 
ATOM   2496 N  N1    . C   A  1 117 ? -13.619 -27.437 11.213 1.00 49.25  ? 131 C   X N1    1 
ATOM   2497 C  C2    . C   A  1 117 ? -14.775 -27.236 10.458 1.00 49.13  ? 131 C   X C2    1 
ATOM   2498 O  O2    . C   A  1 117 ? -14.728 -27.444 9.238  1.00 49.63  ? 131 C   X O2    1 
ATOM   2499 N  N3    . C   A  1 117 ? -15.908 -26.825 11.068 1.00 48.17  ? 131 C   X N3    1 
ATOM   2500 C  C4    . C   A  1 117 ? -15.907 -26.612 12.381 1.00 44.02  ? 131 C   X C4    1 
ATOM   2501 N  N4    . C   A  1 117 ? -17.047 -26.212 12.938 1.00 42.82  ? 131 C   X N4    1 
ATOM   2502 C  C5    . C   A  1 117 ? -14.744 -26.801 13.179 1.00 45.42  ? 131 C   X C5    1 
ATOM   2503 C  C6    . C   A  1 117 ? -13.627 -27.207 12.561 1.00 50.01  ? 131 C   X C6    1 
ATOM   2504 P  P     . U   A  1 118 ? -9.742  -23.909 10.587 1.00 59.32  ? 132 U   X P     1 
ATOM   2505 O  OP1   . U   A  1 118 ? -8.442  -23.359 10.115 1.00 64.28  ? 132 U   X OP1   1 
ATOM   2506 O  OP2   . U   A  1 118 ? -10.203 -23.611 11.966 1.00 55.95  ? 132 U   X OP2   1 
ATOM   2507 O  "O5'" . U   A  1 118 ? -10.881 -23.561 9.536  1.00 57.44  ? 132 U   X "O5'" 1 
ATOM   2508 C  "C5'" . U   A  1 118 ? -10.641 -23.717 8.147  1.00 59.91  ? 132 U   X "C5'" 1 
ATOM   2509 C  "C4'" . U   A  1 118 ? -11.909 -23.543 7.354  1.00 57.77  ? 132 U   X "C4'" 1 
ATOM   2510 O  "O4'" . U   A  1 118 ? -12.937 -24.423 7.882  1.00 55.78  ? 132 U   X "O4'" 1 
ATOM   2511 C  "C3'" . U   A  1 118 ? -12.563 -22.172 7.410  1.00 58.80  ? 132 U   X "C3'" 1 
ATOM   2512 O  "O3'" . U   A  1 118 ? -11.929 -21.197 6.598  1.00 63.88  ? 132 U   X "O3'" 1 
ATOM   2513 C  "C2'" . U   A  1 118 ? -13.989 -22.497 6.986  1.00 58.39  ? 132 U   X "C2'" 1 
ATOM   2514 O  "O2'" . U   A  1 118 ? -14.070 -22.734 5.587  1.00 57.59  ? 132 U   X "O2'" 1 
ATOM   2515 C  "C1'" . U   A  1 118 ? -14.207 -23.827 7.707  1.00 54.87  ? 132 U   X "C1'" 1 
ATOM   2516 N  N1    . U   A  1 118 ? -14.894 -23.597 9.000  1.00 50.88  ? 132 U   X N1    1 
ATOM   2517 C  C2    . U   A  1 118 ? -16.229 -23.260 8.924  1.00 50.32  ? 132 U   X C2    1 
ATOM   2518 O  O2    . U   A  1 118 ? -16.827 -23.158 7.864  1.00 50.83  ? 132 U   X O2    1 
ATOM   2519 N  N3    . U   A  1 118 ? -16.840 -23.042 10.132 1.00 52.42  ? 132 U   X N3    1 
ATOM   2520 C  C4    . U   A  1 118 ? -16.262 -23.128 11.382 1.00 50.89  ? 132 U   X C4    1 
ATOM   2521 O  O4    . U   A  1 118 ? -16.956 -22.899 12.378 1.00 50.70  ? 132 U   X O4    1 
ATOM   2522 C  C5    . U   A  1 118 ? -14.873 -23.482 11.375 1.00 49.79  ? 132 U   X C5    1 
ATOM   2523 C  C6    . U   A  1 118 ? -14.250 -23.699 10.211 1.00 50.68  ? 132 U   X C6    1 
ATOM   2524 P  P     . U   A  1 119 ? -12.119 -19.628 6.918  1.00 69.00  ? 133 U   X P     1 
ATOM   2525 O  OP1   . U   A  1 119 ? -10.730 -19.109 6.963  1.00 68.91  ? 133 U   X OP1   1 
ATOM   2526 O  OP2   . U   A  1 119 ? -12.971 -19.496 8.126  1.00 65.94  ? 133 U   X OP2   1 
ATOM   2527 O  "O5'" . U   A  1 119 ? -12.896 -19.061 5.645  1.00 61.77  ? 133 U   X "O5'" 1 
ATOM   2528 C  "C5'" . U   A  1 119 ? -14.031 -19.735 5.132  1.00 59.29  ? 133 U   X "C5'" 1 
ATOM   2529 C  "C4'" . U   A  1 119 ? -15.147 -18.791 4.769  1.00 60.59  ? 133 U   X "C4'" 1 
ATOM   2530 O  "O4'" . U   A  1 119 ? -16.404 -19.421 5.127  1.00 60.79  ? 133 U   X "O4'" 1 
ATOM   2531 C  "C3'" . U   A  1 119 ? -15.181 -17.455 5.500  1.00 63.61  ? 133 U   X "C3'" 1 
ATOM   2532 O  "O3'" . U   A  1 119 ? -14.333 -16.466 4.934  1.00 69.35  ? 133 U   X "O3'" 1 
ATOM   2533 C  "C2'" . U   A  1 119 ? -16.658 -17.087 5.437  1.00 61.57  ? 133 U   X "C2'" 1 
ATOM   2534 O  "O2'" . U   A  1 119 ? -16.994 -16.581 4.154  1.00 62.75  ? 133 U   X "O2'" 1 
ATOM   2535 C  "C1'" . U   A  1 119 ? -17.315 -18.457 5.611  1.00 60.93  ? 133 U   X "C1'" 1 
ATOM   2536 N  N1    . U   A  1 119 ? -17.594 -18.745 7.037  1.00 55.66  ? 133 U   X N1    1 
ATOM   2537 C  C2    . U   A  1 119 ? -18.801 -18.322 7.577  1.00 56.71  ? 133 U   X C2    1 
ATOM   2538 O  O2    . U   A  1 119 ? -19.658 -17.728 6.938  1.00 54.78  ? 133 U   X O2    1 
ATOM   2539 N  N3    . U   A  1 119 ? -18.976 -18.619 8.907  1.00 53.36  ? 133 U   X N3    1 
ATOM   2540 C  C4    . U   A  1 119 ? -18.089 -19.280 9.734  1.00 53.67  ? 133 U   X C4    1 
ATOM   2541 O  O4    . U   A  1 119 ? -18.393 -19.478 10.914 1.00 51.47  ? 133 U   X O4    1 
ATOM   2542 C  C5    . U   A  1 119 ? -16.868 -19.684 9.104  1.00 55.06  ? 133 U   X C5    1 
ATOM   2543 C  C6    . U   A  1 119 ? -16.669 -19.408 7.811  1.00 55.90  ? 133 U   X C6    1 
ATOM   2544 P  P     . G   A  1 120 ? -13.662 -15.307 5.840  1.00 75.39  ? 134 G   X P     1 
ATOM   2545 O  OP1   . G   A  1 120 ? -12.919 -14.461 4.874  1.00 74.79  ? 134 G   X OP1   1 
ATOM   2546 O  OP2   . G   A  1 120 ? -12.903 -15.973 6.933  1.00 71.40  ? 134 G   X OP2   1 
ATOM   2547 O  "O5'" . G   A  1 120 ? -14.905 -14.503 6.431  1.00 63.78  ? 134 G   X "O5'" 1 
ATOM   2548 C  "C5'" . G   A  1 120 ? -15.641 -13.647 5.573  1.00 64.28  ? 134 G   X "C5'" 1 
ATOM   2549 C  "C4'" . G   A  1 120 ? -16.950 -13.200 6.179  1.00 62.57  ? 134 G   X "C4'" 1 
ATOM   2550 O  "O4'" . G   A  1 120 ? -17.741 -14.353 6.579  1.00 62.41  ? 134 G   X "O4'" 1 
ATOM   2551 C  "C3'" . G   A  1 120 ? -16.894 -12.368 7.452  1.00 59.58  ? 134 G   X "C3'" 1 
ATOM   2552 O  "O3'" . G   A  1 120 ? -16.511 -11.019 7.256  1.00 60.94  ? 134 G   X "O3'" 1 
ATOM   2553 C  "C2'" . G   A  1 120 ? -18.318 -12.520 7.967  1.00 59.37  ? 134 G   X "C2'" 1 
ATOM   2554 O  "O2'" . G   A  1 120 ? -19.222 -11.742 7.191  1.00 58.14  ? 134 G   X "O2'" 1 
ATOM   2555 C  "C1'" . G   A  1 120 ? -18.563 -14.000 7.674  1.00 58.63  ? 134 G   X "C1'" 1 
ATOM   2556 N  N9    . G   A  1 120 ? -18.223 -14.826 8.852  1.00 55.59  ? 134 G   X N9    1 
ATOM   2557 C  C8    . G   A  1 120 ? -17.115 -15.610 9.089  1.00 55.28  ? 134 G   X C8    1 
ATOM   2558 N  N7    . G   A  1 120 ? -17.145 -16.188 10.264 1.00 52.12  ? 134 G   X N7    1 
ATOM   2559 C  C5    . G   A  1 120 ? -18.339 -15.757 10.832 1.00 50.92  ? 134 G   X C5    1 
ATOM   2560 C  C6    . G   A  1 120 ? -18.931 -16.039 12.090 1.00 47.49  ? 134 G   X C6    1 
ATOM   2561 O  O6    . G   A  1 120 ? -18.500 -16.761 13.000 1.00 47.91  ? 134 G   X O6    1 
ATOM   2562 N  N1    . G   A  1 120 ? -20.147 -15.379 12.244 1.00 46.81  ? 134 G   X N1    1 
ATOM   2563 C  C2    . G   A  1 120 ? -20.729 -14.550 11.312 1.00 49.77  ? 134 G   X C2    1 
ATOM   2564 N  N2    . G   A  1 120 ? -21.908 -13.992 11.629 1.00 45.17  ? 134 G   X N2    1 
ATOM   2565 N  N3    . G   A  1 120 ? -20.186 -14.282 10.141 1.00 50.66  ? 134 G   X N3    1 
ATOM   2566 C  C4    . G   A  1 120 ? -19.007 -14.917 9.973  1.00 50.65  ? 134 G   X C4    1 
ATOM   2567 P  P     . U   A  1 121 ? -15.766 -10.231 8.449  1.00 63.84  ? 135 U   X P     1 
ATOM   2568 O  OP1   . U   A  1 121 ? -15.299 -8.969  7.822  1.00 65.34  ? 135 U   X OP1   1 
ATOM   2569 O  OP2   . U   A  1 121 ? -14.754 -11.145 9.042  1.00 60.74  ? 135 U   X OP2   1 
ATOM   2570 O  "O5'" . U   A  1 121 ? -16.937 -9.959  9.498  1.00 54.60  ? 135 U   X "O5'" 1 
ATOM   2571 C  "C5'" . U   A  1 121 ? -18.105 -9.262  9.092  1.00 55.02  ? 135 U   X "C5'" 1 
ATOM   2572 C  "C4'" . U   A  1 121 ? -19.194 -9.328  10.131 1.00 52.36  ? 135 U   X "C4'" 1 
ATOM   2573 O  "O4'" . U   A  1 121 ? -19.591 -10.709 10.350 1.00 51.07  ? 135 U   X "O4'" 1 
ATOM   2574 C  "C3'" . U   A  1 121 ? -18.833 -8.831  11.521 1.00 50.58  ? 135 U   X "C3'" 1 
ATOM   2575 O  "O3'" . U   A  1 121 ? -18.857 -7.420  11.645 1.00 53.82  ? 135 U   X "O3'" 1 
ATOM   2576 C  "C2'" . U   A  1 121 ? -19.868 -9.527  12.393 1.00 48.33  ? 135 U   X "C2'" 1 
ATOM   2577 O  "O2'" . U   A  1 121 ? -21.136 -8.897  12.286 1.00 50.15  ? 135 U   X "O2'" 1 
ATOM   2578 C  "C1'" . U   A  1 121 ? -19.958 -10.884 11.704 1.00 48.15  ? 135 U   X "C1'" 1 
ATOM   2579 N  N1    . U   A  1 121 ? -19.054 -11.859 12.340 1.00 46.90  ? 135 U   X N1    1 
ATOM   2580 C  C2    . U   A  1 121 ? -19.466 -12.387 13.551 1.00 45.04  ? 135 U   X C2    1 
ATOM   2581 O  O2    . U   A  1 121 ? -20.515 -12.066 14.095 1.00 42.09  ? 135 U   X O2    1 
ATOM   2582 N  N3    . U   A  1 121 ? -18.598 -13.294 14.101 1.00 43.34  ? 135 U   X N3    1 
ATOM   2583 C  C4    . U   A  1 121 ? -17.393 -13.716 13.572 1.00 45.43  ? 135 U   X C4    1 
ATOM   2584 O  O4    . U   A  1 121 ? -16.722 -14.547 14.194 1.00 44.52  ? 135 U   X O4    1 
ATOM   2585 C  C5    . U   A  1 121 ? -17.044 -13.127 12.311 1.00 47.40  ? 135 U   X C5    1 
ATOM   2586 C  C6    . U   A  1 121 ? -17.868 -12.235 11.752 1.00 48.56  ? 135 U   X C6    1 
ATOM   2587 P  P     . C   A  1 122 ? -17.809 -6.705  12.627 1.00 53.11  ? 136 C   X P     1 
ATOM   2588 O  OP1   . C   A  1 122 ? -17.932 -5.255  12.336 1.00 56.27  ? 136 C   X OP1   1 
ATOM   2589 O  OP2   . C   A  1 122 ? -16.518 -7.408  12.404 1.00 48.23  ? 136 C   X OP2   1 
ATOM   2590 O  "O5'" . C   A  1 122 ? -18.374 -6.972  14.092 1.00 47.78  ? 136 C   X "O5'" 1 
ATOM   2591 C  "C5'" . C   A  1 122 ? -19.648 -6.461  14.448 1.00 45.89  ? 136 C   X "C5'" 1 
ATOM   2592 C  "C4'" . C   A  1 122 ? -20.192 -7.105  15.698 1.00 46.76  ? 136 C   X "C4'" 1 
ATOM   2593 O  "O4'" . C   A  1 122 ? -20.282 -8.548  15.536 1.00 45.80  ? 136 C   X "O4'" 1 
ATOM   2594 C  "C3'" . C   A  1 122 ? -19.354 -6.947  16.953 1.00 44.20  ? 136 C   X "C3'" 1 
ATOM   2595 O  "O3'" . C   A  1 122 ? -19.458 -5.662  17.537 1.00 44.34  ? 136 C   X "O3'" 1 
ATOM   2596 C  "C2'" . C   A  1 122 ? -19.893 -8.077  17.823 1.00 43.20  ? 136 C   X "C2'" 1 
ATOM   2597 O  "O2'" . C   A  1 122 ? -21.183 -7.762  18.329 1.00 43.57  ? 136 C   X "O2'" 1 
ATOM   2598 C  "C1'" . C   A  1 122 ? -20.060 -9.180  16.780 1.00 41.84  ? 136 C   X "C1'" 1 
ATOM   2599 N  N1    . C   A  1 122 ? -18.870 -10.055 16.682 1.00 38.23  ? 136 C   X N1    1 
ATOM   2600 C  C2    . C   A  1 122 ? -18.639 -10.987 17.700 1.00 36.80  ? 136 C   X C2    1 
ATOM   2601 O  O2    . C   A  1 122 ? -19.439 -11.049 18.650 1.00 36.50  ? 136 C   X O2    1 
ATOM   2602 N  N3    . C   A  1 122 ? -17.557 -11.800 17.625 1.00 36.10  ? 136 C   X N3    1 
ATOM   2603 C  C4    . C   A  1 122 ? -16.726 -11.715 16.592 1.00 37.26  ? 136 C   X C4    1 
ATOM   2604 N  N4    . C   A  1 122 ? -15.676 -12.540 16.569 1.00 36.67  ? 136 C   X N4    1 
ATOM   2605 C  C5    . C   A  1 122 ? -16.934 -10.773 15.540 1.00 40.75  ? 136 C   X C5    1 
ATOM   2606 C  C6    . C   A  1 122 ? -18.008 -9.972  15.626 1.00 40.60  ? 136 C   X C6    1 
ATOM   2607 P  P     . C   A  1 123 ? -18.145 -4.936  18.117 1.00 46.88  ? 137 C   X P     1 
ATOM   2608 O  OP1   . C   A  1 123 ? -18.465 -3.490  18.217 1.00 48.42  ? 137 C   X OP1   1 
ATOM   2609 O  OP2   . C   A  1 123 ? -16.987 -5.357  17.294 1.00 43.15  ? 137 C   X OP2   1 
ATOM   2610 O  "O5'" . C   A  1 123 ? -18.067 -5.561  19.578 1.00 45.50  ? 137 C   X "O5'" 1 
ATOM   2611 C  "C5'" . C   A  1 123 ? -19.206 -5.569  20.422 1.00 42.78  ? 137 C   X "C5'" 1 
ATOM   2612 C  "C4'" . C   A  1 123 ? -18.980 -6.467  21.610 1.00 42.26  ? 137 C   X "C4'" 1 
ATOM   2613 O  "O4'" . C   A  1 123 ? -18.985 -7.859  21.189 1.00 45.10  ? 137 C   X "O4'" 1 
ATOM   2614 C  "C3'" . C   A  1 123 ? -17.635 -6.317  22.303 1.00 41.08  ? 137 C   X "C3'" 1 
ATOM   2615 O  "O3'" . C   A  1 123 ? -17.549 -5.187  23.156 1.00 37.67  ? 137 C   X "O3'" 1 
ATOM   2616 C  "C2'" . C   A  1 123 ? -17.520 -7.649  23.029 1.00 37.61  ? 137 C   X "C2'" 1 
ATOM   2617 O  "O2'" . C   A  1 123 ? -18.409 -7.680  24.134 1.00 38.45  ? 137 C   X "O2'" 1 
ATOM   2618 C  "C1'" . C   A  1 123 ? -18.075 -8.602  21.974 1.00 37.52  ? 137 C   X "C1'" 1 
ATOM   2619 N  N1    . C   A  1 123 ? -17.005 -9.186  21.132 1.00 36.08  ? 137 C   X N1    1 
ATOM   2620 C  C2    . C   A  1 123 ? -16.297 -10.284 21.638 1.00 32.85  ? 137 C   X C2    1 
ATOM   2621 O  O2    . C   A  1 123 ? -16.591 -10.732 22.756 1.00 33.37  ? 137 C   X O2    1 
ATOM   2622 N  N3    . C   A  1 123 ? -15.315 -10.842 20.903 1.00 29.47  ? 137 C   X N3    1 
ATOM   2623 C  C4    . C   A  1 123 ? -15.032 -10.349 19.705 1.00 33.04  ? 137 C   X C4    1 
ATOM   2624 N  N4    . C   A  1 123 ? -14.052 -10.939 19.023 1.00 32.60  ? 137 C   X N4    1 
ATOM   2625 C  C5    . C   A  1 123 ? -15.734 -9.231  19.156 1.00 35.04  ? 137 C   X C5    1 
ATOM   2626 C  C6    . C   A  1 123 ? -16.699 -8.684  19.901 1.00 34.15  ? 137 C   X C6    1 
ATOM   2627 P  P     . U   A  1 124 ? -16.188 -4.326  23.191 1.00 48.05  ? 138 U   X P     1 
ATOM   2628 O  OP1   . U   A  1 124 ? -16.514 -3.283  24.202 1.00 44.89  ? 138 U   X OP1   1 
ATOM   2629 O  OP2   . U   A  1 124 ? -15.793 -3.963  21.808 1.00 42.38  ? 138 U   X OP2   1 
ATOM   2630 O  "O5'" . U   A  1 124 ? -15.075 -5.331  23.741 1.00 36.19  ? 138 U   X "O5'" 1 
ATOM   2631 C  "C5'" . U   A  1 124 ? -15.219 -5.889  25.035 1.00 36.34  ? 138 U   X "C5'" 1 
ATOM   2632 C  "C4'" . U   A  1 124 ? -14.197 -6.970  25.282 1.00 31.85  ? 138 U   X "C4'" 1 
ATOM   2633 O  "O4'" . U   A  1 124 ? -14.336 -8.036  24.303 1.00 33.82  ? 138 U   X "O4'" 1 
ATOM   2634 C  "C3'" . U   A  1 124 ? -12.736 -6.569  25.161 1.00 32.79  ? 138 U   X "C3'" 1 
ATOM   2635 O  "O3'" . U   A  1 124 ? -12.281 -5.855  26.299 1.00 31.44  ? 138 U   X "O3'" 1 
ATOM   2636 C  "C2'" . U   A  1 124 ? -12.071 -7.924  24.983 1.00 29.74  ? 138 U   X "C2'" 1 
ATOM   2637 O  "O2'" . U   A  1 124 ? -12.061 -8.594  26.231 1.00 30.10  ? 138 U   X "O2'" 1 
ATOM   2638 C  "C1'" . U   A  1 124 ? -13.082 -8.652  24.094 1.00 32.41  ? 138 U   X "C1'" 1 
ATOM   2639 N  N1    . U   A  1 124 ? -12.718 -8.648  22.659 1.00 29.00  ? 138 U   X N1    1 
ATOM   2640 C  C2    . U   A  1 124 ? -11.885 -9.650  22.213 1.00 28.72  ? 138 U   X C2    1 
ATOM   2641 O  O2    . U   A  1 124 ? -11.435 -10.533 22.942 1.00 29.52  ? 138 U   X O2    1 
ATOM   2642 N  N3    . U   A  1 124 ? -11.576 -9.582  20.880 1.00 32.10  ? 138 U   X N3    1 
ATOM   2643 C  C4    . U   A  1 124 ? -12.016 -8.644  19.963 1.00 33.53  ? 138 U   X C4    1 
ATOM   2644 O  O4    . U   A  1 124 ? -11.649 -8.732  18.788 1.00 34.03  ? 138 U   X O4    1 
ATOM   2645 C  C5    . U   A  1 124 ? -12.886 -7.642  20.507 1.00 34.35  ? 138 U   X C5    1 
ATOM   2646 C  C6    . U   A  1 124 ? -13.199 -7.679  21.809 1.00 34.48  ? 138 U   X C6    1 
ATOM   2647 P  P     . A   A  1 125 ? -10.786 -5.262  26.384 1.00 30.48  ? 139 A   X P     1 
ATOM   2648 O  OP1   . A   A  1 125 ? -11.019 -3.941  27.020 1.00 31.54  ? 139 A   X OP1   1 
ATOM   2649 O  OP2   . A   A  1 125 ? -10.105 -5.330  25.064 1.00 27.44  ? 139 A   X OP2   1 
ATOM   2650 O  "O5'" . A   A  1 125 ? -10.064 -6.259  27.391 1.00 26.65  ? 139 A   X "O5'" 1 
ATOM   2651 C  "C5'" . A   A  1 125 ? -10.653 -6.654  28.618 1.00 28.74  ? 139 A   X "C5'" 1 
ATOM   2652 C  "C4'" . A   A  1 125 ? -9.769  -7.617  29.391 1.00 23.74  ? 139 A   X "C4'" 1 
ATOM   2653 O  "O4'" . A   A  1 125 ? -9.672  -8.924  28.748 1.00 25.57  ? 139 A   X "O4'" 1 
ATOM   2654 C  "C3'" . A   A  1 125 ? -8.308  -7.237  29.588 1.00 21.38  ? 139 A   X "C3'" 1 
ATOM   2655 O  "O3'" . A   A  1 125 ? -8.095  -6.173  30.496 1.00 21.92  ? 139 A   X "O3'" 1 
ATOM   2656 C  "C2'" . A   A  1 125 ? -7.734  -8.557  30.093 1.00 23.59  ? 139 A   X "C2'" 1 
ATOM   2657 O  "O2'" . A   A  1 125 ? -8.132  -8.847  31.419 1.00 23.63  ? 139 A   X "O2'" 1 
ATOM   2658 C  "C1'" . A   A  1 125 ? -8.491  -9.556  29.236 1.00 22.56  ? 139 A   X "C1'" 1 
ATOM   2659 N  N9    . A   A  1 125 ? -7.611  -10.123 28.203 1.00 29.19  ? 139 A   X N9    1 
ATOM   2660 C  C8    . A   A  1 125 ? -6.517  -10.967 28.378 1.00 22.85  ? 139 A   X C8    1 
ATOM   2661 N  N7    . A   A  1 125 ? -5.903  -11.344 27.293 1.00 25.58  ? 139 A   X N7    1 
ATOM   2662 C  C5    . A   A  1 125 ? -6.678  -10.675 26.353 1.00 25.41  ? 139 A   X C5    1 
ATOM   2663 C  C6    . A   A  1 125 ? -6.596  -10.638 24.980 1.00 28.13  ? 139 A   X C6    1 
ATOM   2664 N  N6    . A   A  1 125 ? -5.683  -11.274 24.242 1.00 23.71  ? 139 A   X N6    1 
ATOM   2665 N  N1    . A   A  1 125 ? -7.524  -9.876  24.389 1.00 31.87  ? 139 A   X N1    1 
ATOM   2666 C  C2    . A   A  1 125 ? -8.459  -9.223  25.069 1.00 27.35  ? 139 A   X C2    1 
ATOM   2667 N  N3    . A   A  1 125 ? -8.656  -9.175  26.360 1.00 26.94  ? 139 A   X N3    1 
ATOM   2668 C  C4    . A   A  1 125 ? -7.708  -9.928  26.901 1.00 24.48  ? 139 A   X C4    1 
ATOM   2669 P  P     . U   A  1 126 ? -6.951  -5.066  30.278 1.00 23.53  ? 140 U   X P     1 
ATOM   2670 O  OP1   . U   A  1 126 ? -7.064  -4.294  31.550 1.00 24.38  ? 140 U   X OP1   1 
ATOM   2671 O  OP2   . U   A  1 126 ? -7.161  -4.418  28.963 1.00 26.40  ? 140 U   X OP2   1 
ATOM   2672 O  "O5'" . U   A  1 126 ? -5.579  -5.858  30.288 1.00 21.95  ? 140 U   X "O5'" 1 
ATOM   2673 C  "C5'" . U   A  1 126 ? -5.138  -6.541  31.451 1.00 25.63  ? 140 U   X "C5'" 1 
ATOM   2674 C  "C4'" . U   A  1 126 ? -4.032  -7.504  31.103 1.00 24.85  ? 140 U   X "C4'" 1 
ATOM   2675 O  "O4'" . U   A  1 126 ? -4.530  -8.490  30.170 1.00 24.85  ? 140 U   X "O4'" 1 
ATOM   2676 C  "C3'" . U   A  1 126 ? -2.829  -6.899  30.400 1.00 23.98  ? 140 U   X "C3'" 1 
ATOM   2677 O  "O3'" . U   A  1 126 ? -1.923  -6.317  31.314 1.00 27.26  ? 140 U   X "O3'" 1 
ATOM   2678 C  "C2'" . U   A  1 126 ? -2.249  -8.081  29.644 1.00 27.28  ? 140 U   X "C2'" 1 
ATOM   2679 O  "O2'" . U   A  1 126 ? -1.473  -8.905  30.500 1.00 29.81  ? 140 U   X "O2'" 1 
ATOM   2680 C  "C1'" . U   A  1 126 ? -3.509  -8.856  29.273 1.00 24.56  ? 140 U   X "C1'" 1 
ATOM   2681 N  N1    . U   A  1 126 ? -3.937  -8.543  27.907 1.00 25.27  ? 140 U   X N1    1 
ATOM   2682 C  C2    . U   A  1 126 ? -3.256  -9.215  26.920 1.00 24.50  ? 140 U   X C2    1 
ATOM   2683 O  O2    . U   A  1 126 ? -2.366  -10.005 27.175 1.00 25.30  ? 140 U   X O2    1 
ATOM   2684 N  N3    . U   A  1 126 ? -3.653  -8.923  25.648 1.00 23.28  ? 140 U   X N3    1 
ATOM   2685 C  C4    . U   A  1 126 ? -4.650  -8.035  25.290 1.00 24.22  ? 140 U   X C4    1 
ATOM   2686 O  O4    . U   A  1 126 ? -4.902  -7.878  24.101 1.00 25.39  ? 140 U   X O4    1 
ATOM   2687 C  C5    . U   A  1 126 ? -5.317  -7.377  26.379 1.00 25.18  ? 140 U   X C5    1 
ATOM   2688 C  C6    . U   A  1 126 ? -4.937  -7.641  27.638 1.00 22.80  ? 140 U   X C6    1 
ATOM   2689 P  P     . G   A  1 127 ? -1.620  -4.745  31.240 1.00 32.46  ? 141 G   X P     1 
ATOM   2690 O  OP1   . G   A  1 127 ? -1.069  -4.502  32.593 1.00 36.68  ? 141 G   X OP1   1 
ATOM   2691 O  OP2   . G   A  1 127 ? -2.826  -4.003  30.786 1.00 30.17  ? 141 G   X OP2   1 
ATOM   2692 O  "O5'" . G   A  1 127 ? -0.530  -4.591  30.084 1.00 33.50  ? 141 G   X "O5'" 1 
ATOM   2693 C  "C5'" . G   A  1 127 ? 0.661   -5.349  30.056 1.00 30.00  ? 141 G   X "C5'" 1 
ATOM   2694 C  "C4'" . G   A  1 127 ? 0.956   -5.847  28.667 1.00 29.19  ? 141 G   X "C4'" 1 
ATOM   2695 O  "O4'" . G   A  1 127 ? -0.192  -6.567  28.159 1.00 28.96  ? 141 G   X "O4'" 1 
ATOM   2696 C  "C3'" . G   A  1 127 ? 1.232   -4.818  27.580 1.00 28.02  ? 141 G   X "C3'" 1 
ATOM   2697 O  "O3'" . G   A  1 127 ? 2.547   -4.298  27.621 1.00 30.14  ? 141 G   X "O3'" 1 
ATOM   2698 C  "C2'" . G   A  1 127 ? 0.992   -5.657  26.339 1.00 27.55  ? 141 G   X "C2'" 1 
ATOM   2699 O  "O2'" . G   A  1 127 ? 2.066   -6.573  26.175 1.00 27.65  ? 141 G   X "O2'" 1 
ATOM   2700 C  "C1'" . G   A  1 127 ? -0.234  -6.458  26.760 1.00 24.73  ? 141 G   X "C1'" 1 
ATOM   2701 N  N9    . G   A  1 127 ? -1.468  -5.762  26.369 1.00 24.08  ? 141 G   X N9    1 
ATOM   2702 C  C8    . G   A  1 127 ? -2.290  -4.968  27.135 1.00 25.61  ? 141 G   X C8    1 
ATOM   2703 N  N7    . G   A  1 127 ? -3.318  -4.504  26.457 1.00 26.32  ? 141 G   X N7    1 
ATOM   2704 C  C5    . G   A  1 127 ? -3.157  -5.028  25.182 1.00 23.82  ? 141 G   X C5    1 
ATOM   2705 C  C6    . G   A  1 127 ? -3.935  -4.859  24.009 1.00 23.84  ? 141 G   X C6    1 
ATOM   2706 O  O6    . G   A  1 127 ? -4.973  -4.204  23.872 1.00 23.30  ? 141 G   X O6    1 
ATOM   2707 N  N1    . G   A  1 127 ? -3.401  -5.562  22.929 1.00 24.80  ? 141 G   X N1    1 
ATOM   2708 C  C2    . G   A  1 127 ? -2.256  -6.313  22.967 1.00 24.02  ? 141 G   X C2    1 
ATOM   2709 N  N2    . G   A  1 127 ? -1.904  -6.910  21.818 1.00 28.44  ? 141 G   X N2    1 
ATOM   2710 N  N3    . G   A  1 127 ? -1.517  -6.470  24.053 1.00 23.29  ? 141 G   X N3    1 
ATOM   2711 C  C4    . G   A  1 127 ? -2.016  -5.798  25.109 1.00 24.88  ? 141 G   X C4    1 
ATOM   2712 P  P     . C   A  1 128 ? 2.931   -2.935  26.860 1.00 34.07  ? 142 C   X P     1 
ATOM   2713 O  OP1   . C   A  1 128 ? 4.397   -2.798  27.078 1.00 37.84  ? 142 C   X OP1   1 
ATOM   2714 O  OP2   . C   A  1 128 ? 1.996   -1.921  27.378 1.00 30.42  ? 142 C   X OP2   1 
ATOM   2715 O  "O5'" . C   A  1 128 ? 2.627   -3.164  25.318 1.00 28.54  ? 142 C   X "O5'" 1 
ATOM   2716 C  "C5'" . C   A  1 128 ? 3.321   -4.145  24.566 1.00 30.31  ? 142 C   X "C5'" 1 
ATOM   2717 C  "C4'" . C   A  1 128 ? 2.783   -4.198  23.162 1.00 29.65  ? 142 C   X "C4'" 1 
ATOM   2718 O  "O4'" . C   A  1 128 ? 1.396   -4.613  23.197 1.00 27.75  ? 142 C   X "O4'" 1 
ATOM   2719 C  "C3'" . C   A  1 128 ? 2.724   -2.865  22.436 1.00 30.28  ? 142 C   X "C3'" 1 
ATOM   2720 O  "O3'" . C   A  1 128 ? 3.984   -2.486  21.924 1.00 33.97  ? 142 C   X "O3'" 1 
ATOM   2721 C  "C2'" . C   A  1 128 ? 1.663   -3.117  21.374 1.00 27.90  ? 142 C   X "C2'" 1 
ATOM   2722 O  "O2'" . C   A  1 128 ? 2.192   -3.937  20.342 1.00 29.60  ? 142 C   X "O2'" 1 
ATOM   2723 C  "C1'" . C   A  1 128 ? 0.676   -3.978  22.168 1.00 25.49  ? 142 C   X "C1'" 1 
ATOM   2724 N  N1    . C   A  1 128 ? -0.395  -3.226  22.828 1.00 27.95  ? 142 C   X N1    1 
ATOM   2725 C  C2    . C   A  1 128 ? -1.484  -2.896  22.043 1.00 25.99  ? 142 C   X C2    1 
ATOM   2726 O  O2    . C   A  1 128 ? -1.452  -3.257  20.854 1.00 28.07  ? 142 C   X O2    1 
ATOM   2727 N  N3    . C   A  1 128 ? -2.509  -2.214  22.593 1.00 25.76  ? 142 C   X N3    1 
ATOM   2728 C  C4    . C   A  1 128 ? -2.459  -1.870  23.881 1.00 24.47  ? 142 C   X C4    1 
ATOM   2729 N  N4    . C   A  1 128 ? -3.491  -1.188  24.366 1.00 23.65  ? 142 C   X N4    1 
ATOM   2730 C  C5    . C   A  1 128 ? -1.340  -2.190  24.718 1.00 27.38  ? 142 C   X C5    1 
ATOM   2731 C  C6    . C   A  1 128 ? -0.331  -2.876  24.152 1.00 25.87  ? 142 C   X C6    1 
ATOM   2732 P  P     . C   A  1 129 ? 4.394   -0.943  21.821 1.00 32.04  ? 143 C   X P     1 
ATOM   2733 O  OP1   . C   A  1 129 ? 5.844   -1.056  21.468 1.00 35.42  ? 143 C   X OP1   1 
ATOM   2734 O  OP2   . C   A  1 129 ? 4.008   -0.166  23.025 1.00 30.93  ? 143 C   X OP2   1 
ATOM   2735 O  "O5'" . C   A  1 129 ? 3.503   -0.429  20.613 1.00 31.77  ? 143 C   X "O5'" 1 
ATOM   2736 C  "C5'" . C   A  1 129 ? 3.632   -0.972  19.312 1.00 34.49  ? 143 C   X "C5'" 1 
ATOM   2737 C  "C4'" . C   A  1 129 ? 2.643   -0.301  18.402 1.00 34.19  ? 143 C   X "C4'" 1 
ATOM   2738 O  "O4'" . C   A  1 129 ? 1.302   -0.723  18.759 1.00 32.57  ? 143 C   X "O4'" 1 
ATOM   2739 C  "C3'" . C   A  1 129 ? 2.571   1.214   18.524 1.00 34.05  ? 143 C   X "C3'" 1 
ATOM   2740 O  "O3'" . C   A  1 129 ? 3.624   1.897   17.862 1.00 36.92  ? 143 C   X "O3'" 1 
ATOM   2741 C  "C2'" . C   A  1 129 ? 1.188   1.513   17.972 1.00 33.63  ? 143 C   X "C2'" 1 
ATOM   2742 O  "O2'" . C   A  1 129 ? 1.174   1.393   16.556 1.00 37.90  ? 143 C   X "O2'" 1 
ATOM   2743 C  "C1'" . C   A  1 129 ? 0.399   0.336   18.544 1.00 29.82  ? 143 C   X "C1'" 1 
ATOM   2744 N  N1    . C   A  1 129 ? -0.284  0.660   19.809 1.00 29.89  ? 143 C   X N1    1 
ATOM   2745 C  C2    . C   A  1 129 ? -1.506  1.307   19.705 1.00 29.51  ? 143 C   X C2    1 
ATOM   2746 O  O2    . C   A  1 129 ? -1.930  1.576   18.559 1.00 32.84  ? 143 C   X O2    1 
ATOM   2747 N  N3    . C   A  1 129 ? -2.182  1.618   20.840 1.00 29.97  ? 143 C   X N3    1 
ATOM   2748 C  C4    . C   A  1 129 ? -1.670  1.300   22.038 1.00 28.04  ? 143 C   X C4    1 
ATOM   2749 N  N4    . C   A  1 129 ? -2.373  1.635   23.127 1.00 28.71  ? 143 C   X N4    1 
ATOM   2750 C  C5    . C   A  1 129 ? -0.413  0.637   22.165 1.00 28.60  ? 143 C   X C5    1 
ATOM   2751 C  C6    . C   A  1 129 ? 0.245   0.334   21.032 1.00 31.25  ? 143 C   X C6    1 
ATOM   2752 P  P     . A   A  1 130 ? 4.157   3.286   18.461 1.00 35.30  ? 144 A   X P     1 
ATOM   2753 O  OP1   . A   A  1 130 ? 5.393   3.565   17.688 1.00 43.02  ? 144 A   X OP1   1 
ATOM   2754 O  OP2   . A   A  1 130 ? 4.274   3.162   19.935 1.00 38.85  ? 144 A   X OP2   1 
ATOM   2755 O  "O5'" . A   A  1 130 ? 3.021   4.323   18.081 1.00 32.71  ? 144 A   X "O5'" 1 
ATOM   2756 C  "C5'" . A   A  1 130 ? 2.705   4.533   16.712 1.00 35.14  ? 144 A   X "C5'" 1 
ATOM   2757 C  "C4'" . A   A  1 130 ? 1.584   5.524   16.529 1.00 35.33  ? 144 A   X "C4'" 1 
ATOM   2758 O  "O4'" . A   A  1 130 ? 0.311   4.911   16.868 1.00 33.49  ? 144 A   X "O4'" 1 
ATOM   2759 C  "C3'" . A   A  1 130 ? 1.628   6.775   17.393 1.00 34.54  ? 144 A   X "C3'" 1 
ATOM   2760 O  "O3'" . A   A  1 130 ? 2.514   7.761   16.896 1.00 37.51  ? 144 A   X "O3'" 1 
ATOM   2761 C  "C2'" . A   A  1 130 ? 0.173   7.220   17.377 1.00 33.91  ? 144 A   X "C2'" 1 
ATOM   2762 O  "O2'" . A   A  1 130 ? -0.143  7.854   16.143 1.00 33.42  ? 144 A   X "O2'" 1 
ATOM   2763 C  "C1'" . A   A  1 130 ? -0.550  5.874   17.431 1.00 33.13  ? 144 A   X "C1'" 1 
ATOM   2764 N  N9    . A   A  1 130 ? -0.802  5.475   18.822 1.00 31.42  ? 144 A   X N9    1 
ATOM   2765 C  C8    . A   A  1 130 ? 0.018   4.700   19.597 1.00 31.54  ? 144 A   X C8    1 
ATOM   2766 N  N7    . A   A  1 130 ? -0.454  4.512   20.807 1.00 31.70  ? 144 A   X N7    1 
ATOM   2767 C  C5    . A   A  1 130 ? -1.650  5.204   20.820 1.00 29.00  ? 144 A   X C5    1 
ATOM   2768 C  C6    . A   A  1 130 ? -2.618  5.386   21.826 1.00 30.50  ? 144 A   X C6    1 
ATOM   2769 N  N6    . A   A  1 130 ? -2.519  4.847   23.048 1.00 28.86  ? 144 A   X N6    1 
ATOM   2770 N  N1    . A   A  1 130 ? -3.699  6.131   21.526 1.00 29.69  ? 144 A   X N1    1 
ATOM   2771 C  C2    . A   A  1 130 ? -3.784  6.658   20.296 1.00 30.71  ? 144 A   X C2    1 
ATOM   2772 N  N3    . A   A  1 130 ? -2.944  6.555   19.271 1.00 30.24  ? 144 A   X N3    1 
ATOM   2773 C  C4    . A   A  1 130 ? -1.881  5.803   19.601 1.00 29.45  ? 144 A   X C4    1 
ATOM   2774 P  P     . U   A  1 131 ? 3.426   8.669   17.860 1.00 37.09  ? 145 U   X P     1 
ATOM   2775 O  OP1   . U   A  1 131 ? 4.354   9.216   16.837 1.00 36.18  ? 145 U   X OP1   1 
ATOM   2776 O  OP2   . U   A  1 131 ? 3.994   7.929   19.017 1.00 34.06  ? 145 U   X OP2   1 
ATOM   2777 O  "O5'" . U   A  1 131 ? 2.401   9.751   18.409 1.00 35.64  ? 145 U   X "O5'" 1 
ATOM   2778 C  "C5'" . U   A  1 131 ? 1.571   10.509  17.543 1.00 33.37  ? 145 U   X "C5'" 1 
ATOM   2779 C  "C4'" . U   A  1 131 ? 0.470   11.190  18.313 1.00 35.39  ? 145 U   X "C4'" 1 
ATOM   2780 O  "O4'" . U   A  1 131 ? -0.524  10.208  18.707 1.00 37.26  ? 145 U   X "O4'" 1 
ATOM   2781 C  "C3'" . U   A  1 131 ? 0.879   11.832  19.633 1.00 38.45  ? 145 U   X "C3'" 1 
ATOM   2782 O  "O3'" . U   A  1 131 ? 1.535   13.086  19.493 1.00 40.89  ? 145 U   X "O3'" 1 
ATOM   2783 C  "C2'" . U   A  1 131 ? -0.443  11.886  20.392 1.00 36.88  ? 145 U   X "C2'" 1 
ATOM   2784 O  "O2'" . U   A  1 131 ? -1.266  12.960  19.960 1.00 37.51  ? 145 U   X "O2'" 1 
ATOM   2785 C  "C1'" . U   A  1 131 ? -1.083  10.567  19.953 1.00 36.75  ? 145 U   X "C1'" 1 
ATOM   2786 N  N1    . U   A  1 131 ? -0.777  9.545   20.969 1.00 33.43  ? 145 U   X N1    1 
ATOM   2787 C  C2    . U   A  1 131 ? -1.655  9.478   22.029 1.00 33.79  ? 145 U   X C2    1 
ATOM   2788 O  O2    . U   A  1 131 ? -2.626  10.204  22.106 1.00 35.76  ? 145 U   X O2    1 
ATOM   2789 N  N3    . U   A  1 131 ? -1.352  8.540   22.978 1.00 31.46  ? 145 U   X N3    1 
ATOM   2790 C  C4    . U   A  1 131 ? -0.268  7.687   22.968 1.00 31.96  ? 145 U   X C4    1 
ATOM   2791 O  O4    . U   A  1 131 ? -0.126  6.890   23.896 1.00 32.90  ? 145 U   X O4    1 
ATOM   2792 C  C5    . U   A  1 131 ? 0.605   7.823   21.836 1.00 33.26  ? 145 U   X C5    1 
ATOM   2793 C  C6    . U   A  1 131 ? 0.332   8.730   20.894 1.00 33.53  ? 145 U   X C6    1 
ATOM   2794 P  P     . A   A  1 132 ? 2.574   13.603  20.619 1.00 48.02  ? 146 A   X P     1 
ATOM   2795 O  OP1   . A   A  1 132 ? 3.294   14.764  20.037 1.00 52.50  ? 146 A   X OP1   1 
ATOM   2796 O  OP2   . A   A  1 132 ? 3.360   12.443  21.091 1.00 41.12  ? 146 A   X OP2   1 
ATOM   2797 O  "O5'" . A   A  1 132 ? 1.630   14.111  21.782 1.00 39.30  ? 146 A   X "O5'" 1 
ATOM   2798 C  "C5'" . A   A  1 132 ? 0.692   15.144  21.552 1.00 41.34  ? 146 A   X "C5'" 1 
ATOM   2799 C  "C4'" . A   A  1 132 ? -0.205  15.288  22.751 1.00 40.87  ? 146 A   X "C4'" 1 
ATOM   2800 O  "O4'" . A   A  1 132 ? -0.940  14.057  22.959 1.00 40.37  ? 146 A   X "O4'" 1 
ATOM   2801 C  "C3'" . A   A  1 132 ? 0.527   15.493  24.065 1.00 44.78  ? 146 A   X "C3'" 1 
ATOM   2802 O  "O3'" . A   A  1 132 ? 0.961   16.830  24.247 1.00 46.93  ? 146 A   X "O3'" 1 
ATOM   2803 C  "C2'" . A   A  1 132 ? -0.485  15.004  25.093 1.00 41.35  ? 146 A   X "C2'" 1 
ATOM   2804 O  "O2'" . A   A  1 132 ? -1.476  15.991  25.329 1.00 45.12  ? 146 A   X "O2'" 1 
ATOM   2805 C  "C1'" . A   A  1 132 ? -1.137  13.843  24.340 1.00 40.16  ? 146 A   X "C1'" 1 
ATOM   2806 N  N9    . A   A  1 132 ? -0.578  12.530  24.722 1.00 34.54  ? 146 A   X N9    1 
ATOM   2807 C  C8    . A   A  1 132 ? 0.401   11.777  24.118 1.00 36.41  ? 146 A   X C8    1 
ATOM   2808 N  N7    . A   A  1 132 ? 0.656   10.651  24.740 1.00 34.66  ? 146 A   X N7    1 
ATOM   2809 C  C5    . A   A  1 132 ? -0.222  10.668  25.822 1.00 35.02  ? 146 A   X C5    1 
ATOM   2810 C  C6    . A   A  1 132 ? -0.471  9.763   26.873 1.00 35.75  ? 146 A   X C6    1 
ATOM   2811 N  N6    . A   A  1 132 ? 0.178   8.595   27.025 1.00 33.83  ? 146 A   X N6    1 
ATOM   2812 N  N1    . A   A  1 132 ? -1.423  10.110  27.783 1.00 33.99  ? 146 A   X N1    1 
ATOM   2813 C  C2    . A   A  1 132 ? -2.071  11.268  27.643 1.00 33.43  ? 146 A   X C2    1 
ATOM   2814 N  N3    . A   A  1 132 ? -1.928  12.192  26.695 1.00 37.58  ? 146 A   X N3    1 
ATOM   2815 C  C4    . A   A  1 132 ? -0.982  11.820  25.814 1.00 33.03  ? 146 A   X C4    1 
ATOM   2816 P  P     . C   A  1 133 ? 2.386   17.116  24.949 1.00 51.03  ? 147 C   X P     1 
ATOM   2817 O  OP1   . C   A  1 133 ? 2.638   18.553  24.681 1.00 49.15  ? 147 C   X OP1   1 
ATOM   2818 O  OP2   . C   A  1 133 ? 3.404   16.102  24.558 1.00 45.94  ? 147 C   X OP2   1 
ATOM   2819 O  "O5'" . C   A  1 133 ? 1.969   16.918  26.463 1.00 42.29  ? 147 C   X "O5'" 1 
ATOM   2820 C  "C5'" . C   A  1 133 ? 0.934   17.765  26.930 1.00 45.32  ? 147 C   X "C5'" 1 
ATOM   2821 C  "C4'" . C   A  1 133 ? 0.598   17.456  28.360 1.00 46.05  ? 147 C   X "C4'" 1 
ATOM   2822 O  "O4'" . C   A  1 133 ? -0.194  16.244  28.414 1.00 42.53  ? 147 C   X "O4'" 1 
ATOM   2823 C  "C3'" . C   A  1 133 ? 1.786   17.145  29.255 1.00 48.18  ? 147 C   X "C3'" 1 
ATOM   2824 O  "O3'" . C   A  1 133 ? 2.513   18.292  29.668 1.00 49.07  ? 147 C   X "O3'" 1 
ATOM   2825 C  "C2'" . C   A  1 133 ? 1.120   16.364  30.380 1.00 42.75  ? 147 C   X "C2'" 1 
ATOM   2826 O  "O2'" . C   A  1 133 ? 0.354   17.229  31.203 1.00 46.29  ? 147 C   X "O2'" 1 
ATOM   2827 C  "C1'" . C   A  1 133 ? 0.139   15.516  29.573 1.00 42.65  ? 147 C   X "C1'" 1 
ATOM   2828 N  N1    . C   A  1 133 ? 0.773   14.247  29.174 1.00 41.66  ? 147 C   X N1    1 
ATOM   2829 C  C2    . C   A  1 133 ? 0.621   13.187  30.058 1.00 37.53  ? 147 C   X C2    1 
ATOM   2830 O  O2    . C   A  1 133 ? -0.023  13.396  31.097 1.00 38.85  ? 147 C   X O2    1 
ATOM   2831 N  N3    . C   A  1 133 ? 1.182   11.996  29.759 1.00 35.49  ? 147 C   X N3    1 
ATOM   2832 C  C4    . C   A  1 133 ? 1.865   11.850  28.625 1.00 34.02  ? 147 C   X C4    1 
ATOM   2833 N  N4    . C   A  1 133 ? 2.399   10.654  28.393 1.00 32.24  ? 147 C   X N4    1 
ATOM   2834 C  C5    . C   A  1 133 ? 2.039   12.916  27.693 1.00 37.35  ? 147 C   X C5    1 
ATOM   2835 C  C6    . C   A  1 133 ? 1.478   14.095  28.004 1.00 39.94  ? 147 C   X C6    1 
ATOM   2836 P  P     . A   A  1 134 ? 4.105   18.158  29.910 1.00 56.36  ? 148 A   X P     1 
ATOM   2837 O  OP1   . A   A  1 134 ? 4.589   19.552  30.092 1.00 56.12  ? 148 A   X OP1   1 
ATOM   2838 O  OP2   . A   A  1 134 ? 4.736   17.326  28.854 1.00 49.45  ? 148 A   X OP2   1 
ATOM   2839 O  "O5'" . A   A  1 134 ? 4.131   17.334  31.272 1.00 47.38  ? 148 A   X "O5'" 1 
ATOM   2840 C  "C5'" . A   A  1 134 ? 3.531   17.830  32.454 1.00 43.08  ? 148 A   X "C5'" 1 
ATOM   2841 C  "C4'" . A   A  1 134 ? 3.465   16.746  33.497 1.00 44.14  ? 148 A   X "C4'" 1 
ATOM   2842 O  "O4'" . A   A  1 134 ? 2.679   15.640  32.989 1.00 42.43  ? 148 A   X "O4'" 1 
ATOM   2843 C  "C3'" . A   A  1 134 ? 4.778   16.075  33.877 1.00 43.68  ? 148 A   X "C3'" 1 
ATOM   2844 O  "O3'" . A   A  1 134 ? 5.596   16.857  34.734 1.00 44.61  ? 148 A   X "O3'" 1 
ATOM   2845 C  "C2'" . A   A  1 134 ? 4.274   14.790  34.516 1.00 39.41  ? 148 A   X "C2'" 1 
ATOM   2846 O  "O2'" . A   A  1 134 ? 3.727   15.068  35.794 1.00 37.08  ? 148 A   X "O2'" 1 
ATOM   2847 C  "C1'" . A   A  1 134 ? 3.129   14.432  33.567 1.00 41.61  ? 148 A   X "C1'" 1 
ATOM   2848 N  N9    . A   A  1 134 ? 3.610   13.515  32.514 1.00 40.72  ? 148 A   X N9    1 
ATOM   2849 C  C8    . A   A  1 134 ? 3.990   13.783  31.221 1.00 36.96  ? 148 A   X C8    1 
ATOM   2850 N  N7    . A   A  1 134 ? 4.396   12.717  30.563 1.00 37.07  ? 148 A   X N7    1 
ATOM   2851 C  C5    . A   A  1 134 ? 4.285   11.681  31.482 1.00 34.79  ? 148 A   X C5    1 
ATOM   2852 C  C6    . A   A  1 134 ? 4.560   10.299  31.418 1.00 34.06  ? 148 A   X C6    1 
ATOM   2853 N  N6    . A   A  1 134 ? 5.022   9.669   30.338 1.00 32.54  ? 148 A   X N6    1 
ATOM   2854 N  N1    . A   A  1 134 ? 4.337   9.562   32.523 1.00 33.86  ? 148 A   X N1    1 
ATOM   2855 C  C2    . A   A  1 134 ? 3.861   10.173  33.619 1.00 33.23  ? 148 A   X C2    1 
ATOM   2856 N  N3    . A   A  1 134 ? 3.568   11.458  33.804 1.00 32.79  ? 148 A   X N3    1 
ATOM   2857 C  C4    . A   A  1 134 ? 3.803   12.164  32.687 1.00 36.19  ? 148 A   X C4    1 
ATOM   2858 P  P     . G   A  1 135 ? 7.190   16.609  34.812 1.00 46.01  ? 149 G   X P     1 
ATOM   2859 O  OP1   . G   A  1 135 ? 7.706   17.631  35.765 1.00 47.68  ? 149 G   X OP1   1 
ATOM   2860 O  OP2   . G   A  1 135 ? 7.718   16.595  33.422 1.00 42.12  ? 149 G   X OP2   1 
ATOM   2861 O  "O5'" . G   A  1 135 ? 7.316   15.151  35.443 1.00 41.99  ? 149 G   X "O5'" 1 
ATOM   2862 C  "C5'" . G   A  1 135 ? 6.881   14.895  36.767 1.00 41.72  ? 149 G   X "C5'" 1 
ATOM   2863 C  "C4'" . G   A  1 135 ? 6.938   13.425  37.093 1.00 36.07  ? 149 G   X "C4'" 1 
ATOM   2864 O  "O4'" . G   A  1 135 ? 6.170   12.679  36.118 1.00 38.97  ? 149 G   X "O4'" 1 
ATOM   2865 C  "C3'" . G   A  1 135 ? 8.302   12.746  37.051 1.00 41.07  ? 149 G   X "C3'" 1 
ATOM   2866 O  "O3'" . G   A  1 135 ? 9.102   13.002  38.193 1.00 41.49  ? 149 G   X "O3'" 1 
ATOM   2867 C  "C2'" . G   A  1 135 ? 7.907   11.281  36.931 1.00 36.35  ? 149 G   X "C2'" 1 
ATOM   2868 O  "O2'" . G   A  1 135 ? 7.434   10.804  38.180 1.00 42.92  ? 149 G   X "O2'" 1 
ATOM   2869 C  "C1'" . G   A  1 135 ? 6.712   11.378  35.987 1.00 36.52  ? 149 G   X "C1'" 1 
ATOM   2870 N  N9    . G   A  1 135 ? 7.114   11.140  34.588 1.00 33.22  ? 149 G   X N9    1 
ATOM   2871 C  C8    . G   A  1 135 ? 7.176   12.039  33.543 1.00 34.59  ? 149 G   X C8    1 
ATOM   2872 N  N7    . G   A  1 135 ? 7.573   11.479  32.425 1.00 33.71  ? 149 G   X N7    1 
ATOM   2873 C  C5    . G   A  1 135 ? 7.783   10.139  32.750 1.00 30.99  ? 149 G   X C5    1 
ATOM   2874 C  C6    . G   A  1 135 ? 8.219   9.036   31.969 1.00 32.48  ? 149 G   X C6    1 
ATOM   2875 O  O6    . G   A  1 135 ? 8.529   8.997   30.770 1.00 31.57  ? 149 G   X O6    1 
ATOM   2876 N  N1    . G   A  1 135 ? 8.290   7.869   32.724 1.00 32.06  ? 149 G   X N1    1 
ATOM   2877 C  C2    . G   A  1 135 ? 7.973   7.760   34.060 1.00 31.25  ? 149 G   X C2    1 
ATOM   2878 N  N2    . G   A  1 135 ? 8.102   6.545   34.622 1.00 30.81  ? 149 G   X N2    1 
ATOM   2879 N  N3    . G   A  1 135 ? 7.570   8.776   34.792 1.00 31.47  ? 149 G   X N3    1 
ATOM   2880 C  C4    . G   A  1 135 ? 7.498   9.921   34.084 1.00 32.05  ? 149 G   X C4    1 
ATOM   2881 P  P     . U   A  1 136 ? 10.709  13.055  38.111 1.00 42.15  ? 150 U   X P     1 
ATOM   2882 O  OP1   . U   A  1 136 ? 11.126  13.244  39.525 1.00 46.44  ? 150 U   X OP1   1 
ATOM   2883 O  OP2   . U   A  1 136 ? 11.093  14.089  37.114 1.00 41.69  ? 150 U   X OP2   1 
ATOM   2884 O  "O5'" . U   A  1 136 ? 11.137  11.611  37.601 1.00 38.68  ? 150 U   X "O5'" 1 
ATOM   2885 C  "C5'" . U   A  1 136 ? 11.032  10.480  38.448 1.00 34.92  ? 150 U   X "C5'" 1 
ATOM   2886 C  "C4'" . U   A  1 136 ? 11.409  9.208   37.737 1.00 35.44  ? 150 U   X "C4'" 1 
ATOM   2887 O  "O4'" . U   A  1 136 ? 10.504  8.968   36.627 1.00 35.41  ? 150 U   X "O4'" 1 
ATOM   2888 C  "C3'" . U   A  1 136 ? 12.790  9.170   37.095 1.00 36.08  ? 150 U   X "C3'" 1 
ATOM   2889 O  "O3'" . U   A  1 136 ? 13.841  8.945   38.020 1.00 34.82  ? 150 U   X "O3'" 1 
ATOM   2890 C  "C2'" . U   A  1 136 ? 12.638  8.072   36.045 1.00 31.12  ? 150 U   X "C2'" 1 
ATOM   2891 O  "O2'" . U   A  1 136 ? 12.747  6.770   36.603 1.00 33.63  ? 150 U   X "O2'" 1 
ATOM   2892 C  "C1'" . U   A  1 136 ? 11.195  8.294   35.593 1.00 33.25  ? 150 U   X "C1'" 1 
ATOM   2893 N  N1    . U   A  1 136 ? 11.179  9.176   34.424 1.00 30.52  ? 150 U   X N1    1 
ATOM   2894 C  C2    . U   A  1 136 ? 11.538  8.649   33.198 1.00 29.16  ? 150 U   X C2    1 
ATOM   2895 O  O2    . U   A  1 136 ? 11.874  7.489   33.032 1.00 30.26  ? 150 U   X O2    1 
ATOM   2896 N  N3    . U   A  1 136 ? 11.496  9.546   32.166 1.00 28.52  ? 150 U   X N3    1 
ATOM   2897 C  C4    . U   A  1 136 ? 11.145  10.875  32.240 1.00 29.12  ? 150 U   X C4    1 
ATOM   2898 O  O4    . U   A  1 136 ? 11.160  11.562  31.221 1.00 31.41  ? 150 U   X O4    1 
ATOM   2899 C  C5    . U   A  1 136 ? 10.792  11.340  33.545 1.00 31.14  ? 150 U   X C5    1 
ATOM   2900 C  C6    . U   A  1 136 ? 10.822  10.488  34.570 1.00 31.64  ? 150 U   X C6    1 
ATOM   2901 P  P     . G   A  1 137 ? 15.234  9.706   37.849 1.00 35.86  ? 151 G   X P     1 
ATOM   2902 O  OP1   . G   A  1 137 ? 15.989  9.307   39.057 1.00 37.82  ? 151 G   X OP1   1 
ATOM   2903 O  OP2   . G   A  1 137 ? 14.971  11.142  37.583 1.00 33.79  ? 151 G   X OP2   1 
ATOM   2904 O  "O5'" . G   A  1 137 ? 15.881  9.015   36.577 1.00 33.09  ? 151 G   X "O5'" 1 
ATOM   2905 C  "C5'" . G   A  1 137 ? 16.150  7.626   36.614 1.00 30.13  ? 151 G   X "C5'" 1 
ATOM   2906 C  "C4'" . G   A  1 137 ? 16.433  7.087   35.238 1.00 29.57  ? 151 G   X "C4'" 1 
ATOM   2907 O  "O4'" . G   A  1 137 ? 15.273  7.279   34.383 1.00 30.80  ? 151 G   X "O4'" 1 
ATOM   2908 C  "C3'" . G   A  1 137 ? 17.563  7.770   34.488 1.00 29.93  ? 151 G   X "C3'" 1 
ATOM   2909 O  "O3'" . G   A  1 137 ? 18.837  7.309   34.911 1.00 31.29  ? 151 G   X "O3'" 1 
ATOM   2910 C  "C2'" . G   A  1 137 ? 17.218  7.449   33.036 1.00 27.28  ? 151 G   X "C2'" 1 
ATOM   2911 O  "O2'" . G   A  1 137 ? 17.604  6.130   32.694 1.00 28.94  ? 151 G   X "O2'" 1 
ATOM   2912 C  "C1'" . G   A  1 137 ? 15.688  7.508   33.052 1.00 29.59  ? 151 G   X "C1'" 1 
ATOM   2913 N  N9    . G   A  1 137 ? 15.222  8.836   32.618 1.00 26.37  ? 151 G   X N9    1 
ATOM   2914 C  C8    . G   A  1 137 ? 14.865  9.909   33.406 1.00 28.22  ? 151 G   X C8    1 
ATOM   2915 N  N7    . G   A  1 137 ? 14.511  10.955  32.710 1.00 23.40  ? 151 G   X N7    1 
ATOM   2916 C  C5    . G   A  1 137 ? 14.661  10.545  31.390 1.00 25.16  ? 151 G   X C5    1 
ATOM   2917 C  C6    . G   A  1 137 ? 14.436  11.256  30.193 1.00 24.27  ? 151 G   X C6    1 
ATOM   2918 O  O6    . G   A  1 137 ? 14.056  12.420  30.085 1.00 24.65  ? 151 G   X O6    1 
ATOM   2919 N  N1    . G   A  1 137 ? 14.709  10.485  29.056 1.00 22.47  ? 151 G   X N1    1 
ATOM   2920 C  C2    . G   A  1 137 ? 15.141  9.183   29.076 1.00 22.20  ? 151 G   X C2    1 
ATOM   2921 N  N2    . G   A  1 137 ? 15.349  8.610   27.870 1.00 19.71  ? 151 G   X N2    1 
ATOM   2922 N  N3    . G   A  1 137 ? 15.362  8.507   30.198 1.00 22.94  ? 151 G   X N3    1 
ATOM   2923 C  C4    . G   A  1 137 ? 15.101  9.248   31.305 1.00 23.25  ? 151 G   X C4    1 
ATOM   2924 P  P     . C   A  1 138 ? 20.148  8.201   34.682 1.00 32.58  ? 152 C   X P     1 
ATOM   2925 O  OP1   . C   A  1 138 ? 21.344  7.445   35.157 1.00 29.76  ? 152 C   X OP1   1 
ATOM   2926 O  OP2   . C   A  1 138 ? 19.873  9.559   35.215 1.00 24.76  ? 152 C   X OP2   1 
ATOM   2927 O  "O5'" . C   A  1 138 ? 20.154  8.156   33.092 1.00 26.70  ? 152 C   X "O5'" 1 
ATOM   2928 C  "C5'" . C   A  1 138 ? 20.699  9.180   32.287 1.00 26.85  ? 152 C   X "C5'" 1 
ATOM   2929 C  "C4'" . C   A  1 138 ? 20.331  8.930   30.846 1.00 23.54  ? 152 C   X "C4'" 1 
ATOM   2930 O  "O4'" . C   A  1 138 ? 18.919  9.201   30.649 1.00 21.96  ? 152 C   X "O4'" 1 
ATOM   2931 C  "C3'" . C   A  1 138 ? 21.042  9.814   29.838 1.00 23.60  ? 152 C   X "C3'" 1 
ATOM   2932 O  "O3'" . C   A  1 138 ? 22.327  9.291   29.532 1.00 22.88  ? 152 C   X "O3'" 1 
ATOM   2933 C  "C2'" . C   A  1 138 ? 20.056  9.809   28.673 1.00 22.02  ? 152 C   X "C2'" 1 
ATOM   2934 O  "O2'" . C   A  1 138 ? 20.138  8.576   27.977 1.00 20.94  ? 152 C   X "O2'" 1 
ATOM   2935 C  "C1'" . C   A  1 138 ? 18.710  9.815   29.395 1.00 22.25  ? 152 C   X "C1'" 1 
ATOM   2936 N  N1    . C   A  1 138 ? 18.127  11.170  29.570 1.00 22.79  ? 152 C   X N1    1 
ATOM   2937 C  C2    . C   A  1 138 ? 17.721  11.855  28.418 1.00 22.24  ? 152 C   X C2    1 
ATOM   2938 O  O2    . C   A  1 138 ? 17.857  11.297  27.310 1.00 19.29  ? 152 C   X O2    1 
ATOM   2939 N  N3    . C   A  1 138 ? 17.193  13.099  28.539 1.00 19.97  ? 152 C   X N3    1 
ATOM   2940 C  C4    . C   A  1 138 ? 17.048  13.670  29.738 1.00 22.78  ? 152 C   X C4    1 
ATOM   2941 N  N4    . C   A  1 138 ? 16.513  14.896  29.769 1.00 20.96  ? 152 C   X N4    1 
ATOM   2942 C  C5    . C   A  1 138 ? 17.460  12.993  30.933 1.00 25.21  ? 152 C   X C5    1 
ATOM   2943 C  C6    . C   A  1 138 ? 17.988  11.761  30.801 1.00 21.65  ? 152 C   X C6    1 
ATOM   2944 P  P     . U   A  1 139 ? 23.644  10.195  29.491 1.00 24.44  ? 153 U   X P     1 
ATOM   2945 O  OP1   . U   A  1 139 ? 24.800  9.271   29.526 1.00 24.66  ? 153 U   X OP1   1 
ATOM   2946 O  OP2   . U   A  1 139 ? 23.508  11.244  30.519 1.00 25.31  ? 153 U   X OP2   1 
ATOM   2947 O  "O5'" . U   A  1 139 ? 23.485  10.860  28.053 1.00 21.07  ? 153 U   X "O5'" 1 
ATOM   2948 C  "C5'" . U   A  1 139 ? 23.497  10.065  26.876 1.00 19.75  ? 153 U   X "C5'" 1 
ATOM   2949 C  "C4'" . U   A  1 139 ? 23.150  10.904  25.666 1.00 20.59  ? 153 U   X "C4'" 1 
ATOM   2950 O  "O4'" . U   A  1 139 ? 21.746  11.283  25.691 1.00 17.05  ? 153 U   X "O4'" 1 
ATOM   2951 C  "C3'" . U   A  1 139 ? 23.886  12.236  25.541 1.00 18.15  ? 153 U   X "C3'" 1 
ATOM   2952 O  "O3'" . U   A  1 139 ? 25.198  12.102  25.019 1.00 20.10  ? 153 U   X "O3'" 1 
ATOM   2953 C  "C2'" . U   A  1 139 ? 22.964  13.014  24.616 1.00 18.06  ? 153 U   X "C2'" 1 
ATOM   2954 O  "O2'" . U   A  1 139 ? 23.046  12.494  23.294 1.00 19.87  ? 153 U   X "O2'" 1 
ATOM   2955 C  "C1'" . U   A  1 139 ? 21.604  12.583  25.150 1.00 19.40  ? 153 U   X "C1'" 1 
ATOM   2956 N  N1    . U   A  1 139 ? 21.041  13.463  26.191 1.00 18.32  ? 153 U   X N1    1 
ATOM   2957 C  C2    . U   A  1 139 ? 20.434  14.634  25.766 1.00 17.72  ? 153 U   X C2    1 
ATOM   2958 O  O2    . U   A  1 139 ? 20.394  14.984  24.599 1.00 16.06  ? 153 U   X O2    1 
ATOM   2959 N  N3    . U   A  1 139 ? 19.882  15.384  26.758 1.00 19.12  ? 153 U   X N3    1 
ATOM   2960 C  C4    . U   A  1 139 ? 19.875  15.093  28.105 1.00 19.58  ? 153 U   X C4    1 
ATOM   2961 O  O4    . U   A  1 139 ? 19.339  15.892  28.859 1.00 15.69  ? 153 U   X O4    1 
ATOM   2962 C  C5    . U   A  1 139 ? 20.521  13.867  28.481 1.00 20.64  ? 153 U   X C5    1 
ATOM   2963 C  C6    . U   A  1 139 ? 21.057  13.095  27.523 1.00 19.83  ? 153 U   X C6    1 
ATOM   2964 P  P     . A   A  1 140 ? 26.361  13.134  25.379 1.00 23.08  ? 154 A   X P     1 
ATOM   2965 O  OP1   . A   A  1 140 ? 27.517  12.597  24.607 1.00 26.14  ? 154 A   X OP1   1 
ATOM   2966 O  OP2   . A   A  1 140 ? 26.453  13.279  26.848 1.00 22.73  ? 154 A   X OP2   1 
ATOM   2967 O  "O5'" . A   A  1 140 ? 25.910  14.507  24.717 1.00 19.90  ? 154 A   X "O5'" 1 
ATOM   2968 C  "C5'" . A   A  1 140 ? 25.963  14.720  23.321 1.00 17.12  ? 154 A   X "C5'" 1 
ATOM   2969 C  "C4'" . A   A  1 140 ? 25.314  16.037  22.965 1.00 18.61  ? 154 A   X "C4'" 1 
ATOM   2970 O  "O4'" . A   A  1 140 ? 23.918  15.989  23.370 1.00 17.96  ? 154 A   X "O4'" 1 
ATOM   2971 C  "C3'" . A   A  1 140 ? 25.837  17.279  23.683 1.00 19.04  ? 154 A   X "C3'" 1 
ATOM   2972 O  "O3'" . A   A  1 140 ? 27.046  17.806  23.156 1.00 18.42  ? 154 A   X "O3'" 1 
ATOM   2973 C  "C2'" . A   A  1 140 ? 24.658  18.234  23.568 1.00 18.48  ? 154 A   X "C2'" 1 
ATOM   2974 O  "O2'" . A   A  1 140 ? 24.543  18.740  22.244 1.00 16.54  ? 154 A   X "O2'" 1 
ATOM   2975 C  "C1'" . A   A  1 140 ? 23.498  17.269  23.800 1.00 16.63  ? 154 A   X "C1'" 1 
ATOM   2976 N  N9    . A   A  1 140 ? 23.151  17.228  25.232 1.00 16.32  ? 154 A   X N9    1 
ATOM   2977 C  C8    . A   A  1 140 ? 23.555  16.324  26.188 1.00 19.34  ? 154 A   X C8    1 
ATOM   2978 N  N7    . A   A  1 140 ? 23.065  16.584  27.384 1.00 19.43  ? 154 A   X N7    1 
ATOM   2979 C  C5    . A   A  1 140 ? 22.312  17.742  27.193 1.00 17.88  ? 154 A   X C5    1 
ATOM   2980 C  C6    . A   A  1 140 ? 21.546  18.532  28.069 1.00 18.08  ? 154 A   X C6    1 
ATOM   2981 N  N6    . A   A  1 140 ? 21.401  18.264  29.382 1.00 17.38  ? 154 A   X N6    1 
ATOM   2982 N  N1    . A   A  1 140 ? 20.917  19.611  27.543 1.00 17.83  ? 154 A   X N1    1 
ATOM   2983 C  C2    . A   A  1 140 ? 21.059  19.889  26.233 1.00 19.79  ? 154 A   X C2    1 
ATOM   2984 N  N3    . A   A  1 140 ? 21.762  19.220  25.307 1.00 16.33  ? 154 A   X N3    1 
ATOM   2985 C  C4    . A   A  1 140 ? 22.365  18.147  25.866 1.00 16.05  ? 154 A   X C4    1 
ATOM   2986 P  P     . A   A  1 141 ? 28.130  18.454  24.171 1.00 18.21  ? 155 A   X P     1 
ATOM   2987 O  OP1   . A   A  1 141 ? 28.632  17.423  25.115 1.00 19.83  ? 155 A   X OP1   1 
ATOM   2988 O  OP2   . A   A  1 141 ? 27.424  19.587  24.750 1.00 17.16  ? 155 A   X OP2   1 
ATOM   2989 O  "O5'" . A   A  1 141 ? 29.273  18.891  23.143 1.00 20.33  ? 155 A   X "O5'" 1 
ATOM   2990 C  "C5'" . A   A  1 141 ? 29.524  20.230  22.740 1.00 17.34  ? 155 A   X "C5'" 1 
ATOM   2991 C  "C4'" . A   A  1 141 ? 29.876  20.262  21.277 1.00 15.30  ? 155 A   X "C4'" 1 
ATOM   2992 O  "O4'" . A   A  1 141 ? 30.895  19.269  21.029 1.00 16.94  ? 155 A   X "O4'" 1 
ATOM   2993 C  "C3'" . A   A  1 141 ? 28.721  19.864  20.374 1.00 17.13  ? 155 A   X "C3'" 1 
ATOM   2994 O  "O3'" . A   A  1 141 ? 27.929  21.000  20.069 1.00 16.58  ? 155 A   X "O3'" 1 
ATOM   2995 C  "C2'" . A   A  1 141 ? 29.404  19.215  19.177 1.00 14.12  ? 155 A   X "C2'" 1 
ATOM   2996 O  "O2'" . A   A  1 141 ? 29.875  20.209  18.275 1.00 17.82  ? 155 A   X "O2'" 1 
ATOM   2997 C  "C1'" . A   A  1 141 ? 30.645  18.583  19.822 1.00 17.42  ? 155 A   X "C1'" 1 
ATOM   2998 N  N9    . A   A  1 141 ? 30.577  17.142  20.151 1.00 18.04  ? 155 A   X N9    1 
ATOM   2999 C  C8    . A   A  1 141 ? 30.002  16.536  21.241 1.00 19.03  ? 155 A   X C8    1 
ATOM   3000 N  N7    . A   A  1 141 ? 30.149  15.232  21.263 1.00 19.65  ? 155 A   X N7    1 
ATOM   3001 C  C5    . A   A  1 141 ? 30.909  14.953  20.134 1.00 17.84  ? 155 A   X C5    1 
ATOM   3002 C  C6    . A   A  1 141 ? 31.418  13.760  19.598 1.00 19.78  ? 155 A   X C6    1 
ATOM   3003 N  N6    . A   A  1 141 ? 31.257  12.548  20.139 1.00 18.74  ? 155 A   X N6    1 
ATOM   3004 N  N1    . A   A  1 141 ? 32.129  13.843  18.461 1.00 20.51  ? 155 A   X N1    1 
ATOM   3005 C  C2    . A   A  1 141 ? 32.317  15.047  17.911 1.00 19.63  ? 155 A   X C2    1 
ATOM   3006 N  N3    . A   A  1 141 ? 31.892  16.239  18.326 1.00 19.40  ? 155 A   X N3    1 
ATOM   3007 C  C4    . A   A  1 141 ? 31.190  16.120  19.457 1.00 17.77  ? 155 A   X C4    1 
ATOM   3008 P  P     . A   A  1 142 ? 26.393  21.086  20.472 1.00 14.94  ? 156 A   X P     1 
ATOM   3009 O  OP1   . A   A  1 142 ? 26.254  20.899  21.940 1.00 16.72  ? 156 A   X OP1   1 
ATOM   3010 O  OP2   . A   A  1 142 ? 25.666  20.184  19.554 1.00 15.36  ? 156 A   X OP2   1 
ATOM   3011 O  "O5'" . A   A  1 142 ? 26.070  22.596  20.142 1.00 15.51  ? 156 A   X "O5'" 1 
ATOM   3012 C  "C5'" . A   A  1 142 ? 25.883  23.075  18.813 1.00 17.82  ? 156 A   X "C5'" 1 
ATOM   3013 C  "C4'" . A   A  1 142 ? 25.100  24.362  18.830 1.00 15.41  ? 156 A   X "C4'" 1 
ATOM   3014 O  "O4'" . A   A  1 142 ? 23.838  24.136  19.511 1.00 16.97  ? 156 A   X "O4'" 1 
ATOM   3015 C  "C3'" . A   A  1 142 ? 25.739  25.505  19.613 1.00 17.15  ? 156 A   X "C3'" 1 
ATOM   3016 O  "O3'" . A   A  1 142 ? 26.680  26.243  18.858 1.00 19.92  ? 156 A   X "O3'" 1 
ATOM   3017 C  "C2'" . A   A  1 142 ? 24.537  26.343  20.024 1.00 16.86  ? 156 A   X "C2'" 1 
ATOM   3018 O  "O2'" . A   A  1 142 ? 24.067  27.096  18.918 1.00 16.27  ? 156 A   X "O2'" 1 
ATOM   3019 C  "C1'" . A   A  1 142 ? 23.516  25.253  20.314 1.00 17.96  ? 156 A   X "C1'" 1 
ATOM   3020 N  N9    . A   A  1 142 ? 23.549  24.830  21.730 1.00 17.78  ? 156 A   X N9    1 
ATOM   3021 C  C8    . A   A  1 142 ? 24.036  23.658  22.274 1.00 18.33  ? 156 A   X C8    1 
ATOM   3022 N  N7    . A   A  1 142 ? 23.906  23.599  23.589 1.00 17.16  ? 156 A   X N7    1 
ATOM   3023 C  C5    . A   A  1 142 ? 23.280  24.793  23.922 1.00 18.27  ? 156 A   X C5    1 
ATOM   3024 C  C6    . A   A  1 142 ? 22.848  25.329  25.152 1.00 19.19  ? 156 A   X C6    1 
ATOM   3025 N  N6    . A   A  1 142 ? 23.001  24.713  26.343 1.00 16.58  ? 156 A   X N6    1 
ATOM   3026 N  N1    . A   A  1 142 ? 22.264  26.546  25.101 1.00 17.22  ? 156 A   X N1    1 
ATOM   3027 C  C2    . A   A  1 142 ? 22.128  27.180  23.930 1.00 17.61  ? 156 A   X C2    1 
ATOM   3028 N  N3    . A   A  1 142 ? 22.481  26.767  22.718 1.00 16.20  ? 156 A   X N3    1 
ATOM   3029 C  C4    . A   A  1 142 ? 23.053  25.558  22.789 1.00 16.92  ? 156 A   X C4    1 
ATOM   3030 P  P     . G   A  1 143 ? 27.893  27.020  19.568 1.00 19.44  ? 157 G   X P     1 
ATOM   3031 O  OP1   . G   A  1 143 ? 28.497  27.818  18.473 1.00 17.41  ? 157 G   X OP1   1 
ATOM   3032 O  OP2   . G   A  1 143 ? 28.712  25.980  20.230 1.00 18.07  ? 157 G   X OP2   1 
ATOM   3033 O  "O5'" . G   A  1 143 ? 27.240  27.931  20.696 1.00 19.36  ? 157 G   X "O5'" 1 
ATOM   3034 C  "C5'" . G   A  1 143 ? 26.640  29.184  20.416 1.00 18.53  ? 157 G   X "C5'" 1 
ATOM   3035 C  "C4'" . G   A  1 143 ? 26.065  29.777  21.678 1.00 18.52  ? 157 G   X "C4'" 1 
ATOM   3036 O  "O4'" . G   A  1 143 ? 25.103  28.853  22.251 1.00 18.23  ? 157 G   X "O4'" 1 
ATOM   3037 C  "C3'" . G   A  1 143 ? 27.067  29.990  22.802 1.00 18.84  ? 157 G   X "C3'" 1 
ATOM   3038 O  "O3'" . G   A  1 143 ? 27.800  31.186  22.649 1.00 17.55  ? 157 G   X "O3'" 1 
ATOM   3039 C  "C2'" . G   A  1 143 ? 26.185  29.966  24.041 1.00 18.69  ? 157 G   X "C2'" 1 
ATOM   3040 O  "O2'" . G   A  1 143 ? 25.421  31.156  24.137 1.00 18.82  ? 157 G   X "O2'" 1 
ATOM   3041 C  "C1'" . G   A  1 143 ? 25.211  28.855  23.661 1.00 17.11  ? 157 G   X "C1'" 1 
ATOM   3042 N  N9    . G   A  1 143 ? 25.703  27.542  24.108 1.00 18.43  ? 157 G   X N9    1 
ATOM   3043 C  C8    . G   A  1 143 ? 26.250  26.511  23.357 1.00 17.09  ? 157 G   X C8    1 
ATOM   3044 N  N7    . G   A  1 143 ? 26.581  25.477  24.096 1.00 17.61  ? 157 G   X N7    1 
ATOM   3045 C  C5    . G   A  1 143 ? 26.205  25.856  25.393 1.00 18.33  ? 157 G   X C5    1 
ATOM   3046 C  C6    . G   A  1 143 ? 26.293  25.191  26.646 1.00 17.87  ? 157 G   X C6    1 
ATOM   3047 O  O6    . G   A  1 143 ? 26.718  24.077  26.893 1.00 18.54  ? 157 G   X O6    1 
ATOM   3048 N  N1    . G   A  1 143 ? 25.812  25.944  27.709 1.00 15.88  ? 157 G   X N1    1 
ATOM   3049 C  C2    . G   A  1 143 ? 25.282  27.203  27.605 1.00 19.57  ? 157 G   X C2    1 
ATOM   3050 N  N2    . G   A  1 143 ? 24.869  27.774  28.762 1.00 16.42  ? 157 G   X N2    1 
ATOM   3051 N  N3    . G   A  1 143 ? 25.191  27.850  26.452 1.00 18.24  ? 157 G   X N3    1 
ATOM   3052 C  C4    . G   A  1 143 ? 25.667  27.125  25.408 1.00 18.12  ? 157 G   X C4    1 
ATOM   3053 P  P     . C   A  1 144 ? 29.294  31.281  23.177 1.00 20.44  ? 158 C   X P     1 
ATOM   3054 O  OP1   . C   A  1 144 ? 29.732  32.629  22.730 1.00 20.74  ? 158 C   X OP1   1 
ATOM   3055 O  OP2   . C   A  1 144 ? 30.077  30.106  22.697 1.00 20.55  ? 158 C   X OP2   1 
ATOM   3056 O  "O5'" . C   A  1 144 ? 29.077  31.168  24.752 1.00 23.02  ? 158 C   X "O5'" 1 
ATOM   3057 C  "C5'" . C   A  1 144 ? 28.473  32.203  25.514 1.00 21.62  ? 158 C   X "C5'" 1 
ATOM   3058 C  "C4'" . C   A  1 144 ? 28.340  31.788  26.961 1.00 21.60  ? 158 C   X "C4'" 1 
ATOM   3059 O  "O4'" . C   A  1 144 ? 27.546  30.574  27.072 1.00 22.21  ? 158 C   X "O4'" 1 
ATOM   3060 C  "C3'" . C   A  1 144 ? 29.632  31.423  27.667 1.00 24.22  ? 158 C   X "C3'" 1 
ATOM   3061 O  "O3'" . C   A  1 144 ? 30.421  32.549  28.031 1.00 28.62  ? 158 C   X "O3'" 1 
ATOM   3062 C  "C2'" . C   A  1 144 ? 29.121  30.602  28.843 1.00 25.05  ? 158 C   X "C2'" 1 
ATOM   3063 O  "O2'" . C   A  1 144 ? 28.497  31.449  29.797 1.00 23.99  ? 158 C   X "O2'" 1 
ATOM   3064 C  "C1'" . C   A  1 144 ? 28.018  29.799  28.159 1.00 21.60  ? 158 C   X "C1'" 1 
ATOM   3065 N  N1    . C   A  1 144 ? 28.563  28.522  27.664 1.00 19.46  ? 158 C   X N1    1 
ATOM   3066 C  C2    . C   A  1 144 ? 28.681  27.466  28.572 1.00 20.03  ? 158 C   X C2    1 
ATOM   3067 O  O2    . C   A  1 144 ? 28.331  27.648  29.756 1.00 21.09  ? 158 C   X O2    1 
ATOM   3068 N  N3    . C   A  1 144 ? 29.185  26.286  28.141 1.00 18.76  ? 158 C   X N3    1 
ATOM   3069 C  C4    . C   A  1 144 ? 29.542  26.134  26.865 1.00 21.59  ? 158 C   X C4    1 
ATOM   3070 N  N4    . C   A  1 144 ? 30.026  24.949  26.497 1.00 18.07  ? 158 C   X N4    1 
ATOM   3071 C  C5    . C   A  1 144 ? 29.425  27.191  25.907 1.00 18.93  ? 158 C   X C5    1 
ATOM   3072 C  C6    . C   A  1 144 ? 28.941  28.366  26.353 1.00 20.43  ? 158 C   X C6    1 
ATOM   3073 P  P     . U   A  1 145 ? 32.018  32.368  28.088 1.00 30.45  ? 159 U   X P     1 
ATOM   3074 O  OP1   . U   A  1 145 ? 32.560  33.725  28.334 1.00 33.97  ? 159 U   X OP1   1 
ATOM   3075 O  OP2   . U   A  1 145 ? 32.472  31.616  26.893 1.00 29.47  ? 159 U   X OP2   1 
ATOM   3076 O  "O5'" . U   A  1 145 ? 32.212  31.392  29.339 1.00 25.46  ? 159 U   X "O5'" 1 
ATOM   3077 C  "C5'" . U   A  1 145 ? 31.823  31.743  30.660 1.00 27.61  ? 159 U   X "C5'" 1 
ATOM   3078 C  "C4'" . U   A  1 145 ? 32.100  30.614  31.626 1.00 27.98  ? 159 U   X "C4'" 1 
ATOM   3079 O  "O4'" . U   A  1 145 ? 31.290  29.466  31.273 1.00 25.70  ? 159 U   X "O4'" 1 
ATOM   3080 C  "C3'" . U   A  1 145 ? 33.518  30.064  31.641 1.00 29.29  ? 159 U   X "C3'" 1 
ATOM   3081 O  "O3'" . U   A  1 145 ? 34.415  30.835  32.426 1.00 31.15  ? 159 U   X "O3'" 1 
ATOM   3082 C  "C2'" . U   A  1 145 ? 33.311  28.661  32.191 1.00 25.12  ? 159 U   X "C2'" 1 
ATOM   3083 O  "O2'" . U   A  1 145 ? 33.081  28.724  33.582 1.00 24.44  ? 159 U   X "O2'" 1 
ATOM   3084 C  "C1'" . U   A  1 145 ? 31.994  28.273  31.530 1.00 25.72  ? 159 U   X "C1'" 1 
ATOM   3085 N  N1    . U   A  1 145 ? 32.251  27.573  30.259 1.00 23.96  ? 159 U   X N1    1 
ATOM   3086 C  C2    . U   A  1 145 ? 32.530  26.233  30.368 1.00 26.24  ? 159 U   X C2    1 
ATOM   3087 O  O2    . U   A  1 145 ? 32.565  25.660  31.453 1.00 24.96  ? 159 U   X O2    1 
ATOM   3088 N  N3    . U   A  1 145 ? 32.773  25.601  29.171 1.00 24.59  ? 159 U   X N3    1 
ATOM   3089 C  C4    . U   A  1 145 ? 32.751  26.169  27.909 1.00 23.94  ? 159 U   X C4    1 
ATOM   3090 O  O4    . U   A  1 145 ? 32.986  25.453  26.934 1.00 23.36  ? 159 U   X O4    1 
ATOM   3091 C  C5    . U   A  1 145 ? 32.444  27.564  27.885 1.00 23.49  ? 159 U   X C5    1 
ATOM   3092 C  C6    . U   A  1 145 ? 32.210  28.211  29.039 1.00 24.06  ? 159 U   X C6    1 
ATOM   3093 P  P     . C   A  1 146 ? 35.983  30.950  32.070 1.00 36.30  ? 160 C   X P     1 
ATOM   3094 O  OP1   . C   A  1 146 ? 36.438  32.013  33.009 1.00 38.25  ? 160 C   X OP1   1 
ATOM   3095 O  OP2   . C   A  1 146 ? 36.139  31.172  30.607 1.00 27.97  ? 160 C   X OP2   1 
ATOM   3096 O  "O5'" . C   A  1 146 ? 36.599  29.540  32.477 1.00 33.57  ? 160 C   X "O5'" 1 
ATOM   3097 C  "C5'" . C   A  1 146 ? 36.501  29.021  33.793 1.00 30.31  ? 160 C   X "C5'" 1 
ATOM   3098 C  "C4'" . C   A  1 146 ? 36.803  27.545  33.796 1.00 33.38  ? 160 C   X "C4'" 1 
ATOM   3099 O  "O4'" . C   A  1 146 ? 35.796  26.852  33.015 1.00 32.12  ? 160 C   X "O4'" 1 
ATOM   3100 C  "C3'" . C   A  1 146 ? 38.124  27.140  33.156 1.00 32.55  ? 160 C   X "C3'" 1 
ATOM   3101 O  "O3'" . C   A  1 146 ? 39.231  27.258  34.038 1.00 37.98  ? 160 C   X "O3'" 1 
ATOM   3102 C  "C2'" . C   A  1 146 ? 37.862  25.708  32.724 1.00 32.77  ? 160 C   X "C2'" 1 
ATOM   3103 O  "O2'" . C   A  1 146 ? 38.003  24.827  33.831 1.00 33.61  ? 160 C   X "O2'" 1 
ATOM   3104 C  "C1'" . C   A  1 146 ? 36.386  25.773  32.320 1.00 29.78  ? 160 C   X "C1'" 1 
ATOM   3105 N  N1    . C   A  1 146 ? 36.253  25.967  30.856 1.00 27.43  ? 160 C   X N1    1 
ATOM   3106 C  C2    . C   A  1 146 ? 36.307  24.824  30.072 1.00 26.44  ? 160 C   X C2    1 
ATOM   3107 O  O2    . C   A  1 146 ? 36.452  23.759  30.667 1.00 29.56  ? 160 C   X O2    1 
ATOM   3108 N  N3    . C   A  1 146 ? 36.198  24.915  28.726 1.00 28.61  ? 160 C   X N3    1 
ATOM   3109 C  C4    . C   A  1 146 ? 36.036  26.112  28.158 1.00 27.17  ? 160 C   X C4    1 
ATOM   3110 N  N4    . C   A  1 146 ? 35.939  26.180  26.827 1.00 26.37  ? 160 C   X N4    1 
ATOM   3111 C  C5    . C   A  1 146 ? 35.974  27.300  28.941 1.00 28.85  ? 160 C   X C5    1 
ATOM   3112 C  C6    . C   A  1 146 ? 36.088  27.182  30.274 1.00 26.98  ? 160 C   X C6    1 
ATOM   3113 P  P     . U   A  1 147 ? 40.760  27.250  33.518 1.00 38.38  ? 161 U   X P     1 
ATOM   3114 O  OP1   . U   A  1 147 ? 41.558  27.737  34.678 1.00 41.67  ? 161 U   X OP1   1 
ATOM   3115 O  OP2   . U   A  1 147 ? 40.808  27.952  32.220 1.00 34.03  ? 161 U   X OP2   1 
ATOM   3116 O  "O5'" . U   A  1 147 ? 41.085  25.711  33.281 1.00 31.41  ? 161 U   X "O5'" 1 
ATOM   3117 C  "C5'" . U   A  1 147 ? 41.038  24.768  34.337 1.00 33.91  ? 161 U   X "C5'" 1 
ATOM   3118 C  "C4'" . U   A  1 147 ? 41.403  23.402  33.824 1.00 38.17  ? 161 U   X "C4'" 1 
ATOM   3119 O  "O4'" . U   A  1 147 ? 40.387  22.936  32.893 1.00 33.97  ? 161 U   X "O4'" 1 
ATOM   3120 C  "C3'" . U   A  1 147 ? 42.710  23.340  33.047 1.00 34.36  ? 161 U   X "C3'" 1 
ATOM   3121 O  "O3'" . U   A  1 147 ? 43.818  23.175  33.917 1.00 40.58  ? 161 U   X "O3'" 1 
ATOM   3122 C  "C2'" . U   A  1 147 ? 42.499  22.150  32.124 1.00 35.97  ? 161 U   X "C2'" 1 
ATOM   3123 O  "O2'" . U   A  1 147 ? 42.742  20.938  32.828 1.00 38.23  ? 161 U   X "O2'" 1 
ATOM   3124 C  "C1'" . U   A  1 147 ? 40.996  22.223  31.837 1.00 31.35  ? 161 U   X "C1'" 1 
ATOM   3125 N  N1    . U   A  1 147 ? 40.517  22.819  30.563 1.00 31.67  ? 161 U   X N1    1 
ATOM   3126 C  C2    . U   A  1 147 ? 40.447  21.997  29.462 1.00 30.87  ? 161 U   X C2    1 
ATOM   3127 O  O2    . U   A  1 147 ? 40.817  20.841  29.493 1.00 29.03  ? 161 U   X O2    1 
ATOM   3128 N  N3    . U   A  1 147 ? 39.950  22.577  28.318 1.00 28.75  ? 161 U   X N3    1 
ATOM   3129 C  C4    . U   A  1 147 ? 39.518  23.869  28.164 1.00 27.23  ? 161 U   X C4    1 
ATOM   3130 O  O4    . U   A  1 147 ? 39.092  24.234  27.073 1.00 27.60  ? 161 U   X O4    1 
ATOM   3131 C  C5    . U   A  1 147 ? 39.603  24.659  29.354 1.00 30.22  ? 161 U   X C5    1 
ATOM   3132 C  C6    . U   A  1 147 ? 40.077  24.114  30.482 1.00 30.94  ? 161 U   X C6    1 
ATOM   3133 P  P     . A   A  1 148 ? 45.268  23.855  33.713 1.00 39.28  ? 162 A   X P     1 
ATOM   3134 O  OP1   . A   A  1 148 ? 45.948  23.567  35.007 1.00 39.25  ? 162 A   X OP1   1 
ATOM   3135 O  OP2   . A   A  1 148 ? 45.105  25.264  33.297 1.00 35.39  ? 162 A   X OP2   1 
ATOM   3136 O  "O5'" . A   A  1 148 ? 45.977  22.975  32.591 1.00 37.79  ? 162 A   X "O5'" 1 
ATOM   3137 C  "C5'" . A   A  1 148 ? 46.539  21.717  32.938 1.00 40.36  ? 162 A   X "C5'" 1 
ATOM   3138 C  "C4'" . A   A  1 148 ? 46.536  20.766  31.767 1.00 39.93  ? 162 A   X "C4'" 1 
ATOM   3139 O  "O4'" . A   A  1 148 ? 45.212  20.728  31.178 1.00 43.15  ? 162 A   X "O4'" 1 
ATOM   3140 C  "C3'" . A   A  1 148 ? 47.447  21.146  30.614 1.00 42.23  ? 162 A   X "C3'" 1 
ATOM   3141 O  "O3'" . A   A  1 148 ? 48.760  20.664  30.809 1.00 45.91  ? 162 A   X "O3'" 1 
ATOM   3142 C  "C2'" . A   A  1 148 ? 46.760  20.525  29.408 1.00 41.57  ? 162 A   X "C2'" 1 
ATOM   3143 O  "O2'" . A   A  1 148 ? 46.996  19.122  29.373 1.00 44.81  ? 162 A   X "O2'" 1 
ATOM   3144 C  "C1'" . A   A  1 148 ? 45.292  20.716  29.772 1.00 37.83  ? 162 A   X "C1'" 1 
ATOM   3145 N  N9    . A   A  1 148 ? 44.701  21.981  29.290 1.00 35.99  ? 162 A   X N9    1 
ATOM   3146 C  C8    . A   A  1 148 ? 44.719  23.205  29.914 1.00 35.80  ? 162 A   X C8    1 
ATOM   3147 N  N7    . A   A  1 148 ? 44.073  24.144  29.265 1.00 35.06  ? 162 A   X N7    1 
ATOM   3148 C  C5    . A   A  1 148 ? 43.579  23.484  28.143 1.00 32.28  ? 162 A   X C5    1 
ATOM   3149 C  C6    . A   A  1 148 ? 42.803  23.929  27.056 1.00 30.15  ? 162 A   X C6    1 
ATOM   3150 N  N6    . A   A  1 148 ? 42.373  25.188  26.921 1.00 27.53  ? 162 A   X N6    1 
ATOM   3151 N  N1    . A   A  1 148 ? 42.488  23.016  26.107 1.00 29.46  ? 162 A   X N1    1 
ATOM   3152 C  C2    . A   A  1 148 ? 42.918  21.757  26.238 1.00 28.40  ? 162 A   X C2    1 
ATOM   3153 N  N3    . A   A  1 148 ? 43.648  21.222  27.218 1.00 33.75  ? 162 A   X N3    1 
ATOM   3154 C  C4    . A   A  1 148 ? 43.948  22.153  28.149 1.00 32.15  ? 162 A   X C4    1 
ATOM   3155 P  P     . C   A  1 149 ? 49.953  21.176  29.875 1.00 50.37  ? 163 C   X P     1 
ATOM   3156 O  OP1   . C   A  1 149 ? 51.161  20.532  30.451 1.00 52.77  ? 163 C   X OP1   1 
ATOM   3157 O  OP2   . C   A  1 149 ? 49.836  22.657  29.826 1.00 44.21  ? 163 C   X OP2   1 
ATOM   3158 O  "O5'" . C   A  1 149 ? 49.636  20.554  28.443 1.00 41.46  ? 163 C   X "O5'" 1 
ATOM   3159 C  "C5'" . C   A  1 149 ? 49.939  21.320  27.286 1.00 39.35  ? 163 C   X "C5'" 1 
ATOM   3160 C  "C4'" . C   A  1 149 ? 49.181  20.834  26.076 1.00 36.66  ? 163 C   X "C4'" 1 
ATOM   3161 O  "O4'" . C   A  1 149 ? 47.753  20.882  26.345 1.00 35.08  ? 163 C   X "O4'" 1 
ATOM   3162 C  "C3'" . C   A  1 149 ? 49.320  21.684  24.823 1.00 34.40  ? 163 C   X "C3'" 1 
ATOM   3163 O  "O3'" . C   A  1 149 ? 50.524  21.483  24.112 1.00 39.03  ? 163 C   X "O3'" 1 
ATOM   3164 C  "C2'" . C   A  1 149 ? 48.089  21.267  24.036 1.00 32.65  ? 163 C   X "C2'" 1 
ATOM   3165 O  "O2'" . C   A  1 149 ? 48.265  19.956  23.540 1.00 29.06  ? 163 C   X "O2'" 1 
ATOM   3166 C  "C1'" . C   A  1 149 ? 47.057  21.209  25.157 1.00 33.16  ? 163 C   X "C1'" 1 
ATOM   3167 N  N1    . C   A  1 149 ? 46.481  22.553  25.303 1.00 30.97  ? 163 C   X N1    1 
ATOM   3168 C  C2    . C   A  1 149 ? 45.463  22.962  24.427 1.00 29.69  ? 163 C   X C2    1 
ATOM   3169 O  O2    . C   A  1 149 ? 45.073  22.166  23.560 1.00 27.61  ? 163 C   X O2    1 
ATOM   3170 N  N3    . C   A  1 149 ? 44.941  24.203  24.557 1.00 26.81  ? 163 C   X N3    1 
ATOM   3171 C  C4    . C   A  1 149 ? 45.400  25.014  25.513 1.00 28.75  ? 163 C   X C4    1 
ATOM   3172 N  N4    . C   A  1 149 ? 44.874  26.233  25.630 1.00 28.86  ? 163 C   X N4    1 
ATOM   3173 C  C5    . C   A  1 149 ? 46.432  24.618  26.410 1.00 30.76  ? 163 C   X C5    1 
ATOM   3174 C  C6    . C   A  1 149 ? 46.940  23.391  26.273 1.00 33.44  ? 163 C   X C6    1 
ATOM   3175 P  P     . G   A  1 150 ? 51.133  22.702  23.269 1.00 39.27  ? 164 G   X P     1 
ATOM   3176 O  OP1   . G   A  1 150 ? 52.372  22.140  22.666 1.00 39.16  ? 164 G   X OP1   1 
ATOM   3177 O  OP2   . G   A  1 150 ? 51.177  23.887  24.155 1.00 38.33  ? 164 G   X OP2   1 
ATOM   3178 O  "O5'" . G   A  1 150 ? 50.060  22.988  22.134 1.00 34.97  ? 164 G   X "O5'" 1 
ATOM   3179 C  "C5'" . G   A  1 150 ? 49.898  22.065  21.077 1.00 29.94  ? 164 G   X "C5'" 1 
ATOM   3180 C  "C4'" . G   A  1 150 ? 48.780  22.511  20.173 1.00 30.68  ? 164 G   X "C4'" 1 
ATOM   3181 O  "O4'" . G   A  1 150 ? 47.612  22.851  20.968 1.00 30.91  ? 164 G   X "O4'" 1 
ATOM   3182 C  "C3'" . G   A  1 150 ? 49.017  23.785  19.381 1.00 30.03  ? 164 G   X "C3'" 1 
ATOM   3183 O  "O3'" . G   A  1 150 ? 49.885  23.623  18.270 1.00 31.39  ? 164 G   X "O3'" 1 
ATOM   3184 C  "C2'" . G   A  1 150 ? 47.591  24.157  18.999 1.00 28.09  ? 164 G   X "C2'" 1 
ATOM   3185 O  "O2'" . G   A  1 150 ? 47.135  23.292  17.975 1.00 24.34  ? 164 G   X "O2'" 1 
ATOM   3186 C  "C1'" . G   A  1 150 ? 46.850  23.823  20.295 1.00 25.56  ? 164 G   X "C1'" 1 
ATOM   3187 N  N9    . G   A  1 150 ? 46.748  25.022  21.136 1.00 26.20  ? 164 G   X N9    1 
ATOM   3188 C  C8    . G   A  1 150 ? 47.426  25.330  22.294 1.00 30.78  ? 164 G   X C8    1 
ATOM   3189 N  N7    . G   A  1 150 ? 47.108  26.512  22.765 1.00 28.23  ? 164 G   X N7    1 
ATOM   3190 C  C5    . G   A  1 150 ? 46.169  27.007  21.861 1.00 27.46  ? 164 G   X C5    1 
ATOM   3191 C  C6    . G   A  1 150 ? 45.467  28.242  21.831 1.00 26.93  ? 164 G   X C6    1 
ATOM   3192 O  O6    . G   A  1 150 ? 45.506  29.200  22.623 1.00 29.32  ? 164 G   X O6    1 
ATOM   3193 N  N1    . G   A  1 150 ? 44.629  28.315  20.729 1.00 25.82  ? 164 G   X N1    1 
ATOM   3194 C  C2    . G   A  1 150 ? 44.478  27.333  19.774 1.00 25.61  ? 164 G   X C2    1 
ATOM   3195 N  N2    . G   A  1 150 ? 43.621  27.606  18.785 1.00 24.03  ? 164 G   X N2    1 
ATOM   3196 N  N3    . G   A  1 150 ? 45.119  26.180  19.779 1.00 26.03  ? 164 G   X N3    1 
ATOM   3197 C  C4    . G   A  1 150 ? 45.944  26.093  20.850 1.00 26.01  ? 164 G   X C4    1 
ATOM   3198 P  P     . A   A  1 151 ? 50.464  24.947  17.556 1.00 32.99  ? 165 A   X P     1 
ATOM   3199 O  OP1   . A   A  1 151 ? 51.765  24.478  17.023 1.00 37.85  ? 165 A   X OP1   1 
ATOM   3200 O  OP2   . A   A  1 151 ? 50.328  26.132  18.434 1.00 31.70  ? 165 A   X OP2   1 
ATOM   3201 O  "O5'" . A   A  1 151 ? 49.490  25.163  16.336 1.00 30.11  ? 165 A   X "O5'" 1 
ATOM   3202 C  "C5'" . A   A  1 151 ? 49.547  24.251  15.252 1.00 28.53  ? 165 A   X "C5'" 1 
ATOM   3203 C  "C4'" . A   A  1 151 ? 48.738  24.776  14.094 1.00 28.85  ? 165 A   X "C4'" 1 
ATOM   3204 O  "O4'" . A   A  1 151 ? 47.313  24.611  14.361 1.00 28.94  ? 165 A   X "O4'" 1 
ATOM   3205 C  "C3'" . A   A  1 151 ? 48.939  26.258  13.770 1.00 30.47  ? 165 A   X "C3'" 1 
ATOM   3206 O  "O3'" . A   A  1 151 ? 48.841  26.436  12.360 1.00 33.89  ? 165 A   X "O3'" 1 
ATOM   3207 C  "C2'" . A   A  1 151 ? 47.710  26.901  14.394 1.00 31.38  ? 165 A   X "C2'" 1 
ATOM   3208 O  "O2'" . A   A  1 151 ? 47.365  28.151  13.842 1.00 28.79  ? 165 A   X "O2'" 1 
ATOM   3209 C  "C1'" . A   A  1 151 ? 46.678  25.830  14.048 1.00 26.09  ? 165 A   X "C1'" 1 
ATOM   3210 N  N9    . A   A  1 151 ? 45.342  25.973  14.648 1.00 25.59  ? 165 A   X N9    1 
ATOM   3211 C  C8    . A   A  1 151 ? 44.939  26.592  15.807 1.00 25.86  ? 165 A   X C8    1 
ATOM   3212 N  N7    . A   A  1 151 ? 43.637  26.562  16.004 1.00 23.49  ? 165 A   X N7    1 
ATOM   3213 C  C5    . A   A  1 151 ? 43.153  25.883  14.886 1.00 24.15  ? 165 A   X C5    1 
ATOM   3214 C  C6    . A   A  1 151 ? 41.859  25.522  14.474 1.00 21.73  ? 165 A   X C6    1 
ATOM   3215 N  N6    . A   A  1 151 ? 40.762  25.814  15.177 1.00 23.77  ? 165 A   X N6    1 
ATOM   3216 N  N1    . A   A  1 151 ? 41.718  24.854  13.307 1.00 21.51  ? 165 A   X N1    1 
ATOM   3217 C  C2    . A   A  1 151 ? 42.818  24.572  12.599 1.00 26.21  ? 165 A   X C2    1 
ATOM   3218 N  N3    . A   A  1 151 ? 44.097  24.861  12.881 1.00 23.00  ? 165 A   X N3    1 
ATOM   3219 C  C4    . A   A  1 151 ? 44.191  25.527  14.047 1.00 25.07  ? 165 A   X C4    1 
ATOM   3220 P  P     . U   A  1 152 ? 49.981  27.189  11.514 1.00 32.26  ? 166 U   X P     1 
ATOM   3221 O  OP1   . U   A  1 152 ? 50.904  27.820  12.495 1.00 34.27  ? 166 U   X OP1   1 
ATOM   3222 O  OP2   . U   A  1 152 ? 49.254  28.045  10.543 1.00 30.80  ? 166 U   X OP2   1 
ATOM   3223 O  "O5'" . U   A  1 152 ? 50.688  25.945  10.822 1.00 32.70  ? 166 U   X "O5'" 1 
ATOM   3224 C  "C5'" . U   A  1 152 ? 51.230  26.030  9.510  1.00 34.71  ? 166 U   X "C5'" 1 
ATOM   3225 C  "C4'" . U   A  1 152 ? 50.804  24.857  8.660  1.00 32.98  ? 166 U   X "C4'" 1 
ATOM   3226 O  "O4'" . U   A  1 152 ? 51.352  23.639  9.228  1.00 33.09  ? 166 U   X "O4'" 1 
ATOM   3227 C  "C3'" . U   A  1 152 ? 49.294  24.638  8.563  1.00 35.74  ? 166 U   X "C3'" 1 
ATOM   3228 O  "O3'" . U   A  1 152 ? 48.957  24.128  7.270  1.00 31.74  ? 166 U   X "O3'" 1 
ATOM   3229 C  "C2'" . U   A  1 152 ? 49.047  23.571  9.624  1.00 35.30  ? 166 U   X "C2'" 1 
ATOM   3230 O  "O2'" . U   A  1 152 ? 47.869  22.821  9.438  1.00 36.76  ? 166 U   X "O2'" 1 
ATOM   3231 C  "C1'" . U   A  1 152 ? 50.306  22.719  9.482  1.00 34.13  ? 166 U   X "C1'" 1 
ATOM   3232 N  N1    . U   A  1 152 ? 50.679  21.977  10.700 1.00 34.85  ? 166 U   X N1    1 
ATOM   3233 C  C2    . U   A  1 152 ? 50.617  20.602  10.649 1.00 34.04  ? 166 U   X C2    1 
ATOM   3234 O  O2    . U   A  1 152 ? 50.254  20.010  9.649  1.00 33.80  ? 166 U   X O2    1 
ATOM   3235 N  N3    . U   A  1 152 ? 50.984  19.965  11.803 1.00 32.74  ? 166 U   X N3    1 
ATOM   3236 C  C4    . U   A  1 152 ? 51.411  20.575  12.973 1.00 38.24  ? 166 U   X C4    1 
ATOM   3237 O  O4    . U   A  1 152 ? 51.722  19.892  13.951 1.00 39.60  ? 166 U   X O4    1 
ATOM   3238 C  C5    . U   A  1 152 ? 51.456  22.003  12.933 1.00 36.29  ? 166 U   X C5    1 
ATOM   3239 C  C6    . U   A  1 152 ? 51.094  22.641  11.820 1.00 34.14  ? 166 U   X C6    1 
ATOM   3240 P  P     . U   A  1 153 ? 48.491  25.147  6.103  1.00 40.23  ? 167 U   X P     1 
ATOM   3241 O  OP1   . U   A  1 153 ? 48.917  24.528  4.822  1.00 38.42  ? 167 U   X OP1   1 
ATOM   3242 O  OP2   . U   A  1 153 ? 48.942  26.511  6.469  1.00 35.40  ? 167 U   X OP2   1 
ATOM   3243 O  "O5'" . U   A  1 153 ? 46.896  25.094  6.213  1.00 36.38  ? 167 U   X "O5'" 1 
ATOM   3244 C  "C5'" . U   A  1 153 ? 46.143  23.935  5.876  1.00 37.04  ? 167 U   X "C5'" 1 
ATOM   3245 C  "C4'" . U   A  1 153 ? 44.673  24.163  6.135  1.00 31.42  ? 167 U   X "C4'" 1 
ATOM   3246 O  "O4'" . U   A  1 153 ? 44.406  24.105  7.557  1.00 30.05  ? 167 U   X "O4'" 1 
ATOM   3247 C  "C3'" . U   A  1 153 ? 44.140  25.524  5.718  1.00 33.26  ? 167 U   X "C3'" 1 
ATOM   3248 O  "O3'" . U   A  1 153 ? 43.813  25.557  4.345  1.00 35.64  ? 167 U   X "O3'" 1 
ATOM   3249 C  "C2'" . U   A  1 153 ? 42.927  25.705  6.621  1.00 34.63  ? 167 U   X "C2'" 1 
ATOM   3250 O  "O2'" . U   A  1 153 ? 41.839  24.932  6.129  1.00 33.37  ? 167 U   X "O2'" 1 
ATOM   3251 C  "C1'" . U   A  1 153 ? 43.408  25.037  7.907  1.00 29.60  ? 167 U   X "C1'" 1 
ATOM   3252 N  N1    . U   A  1 153 ? 43.970  25.911  8.960  1.00 30.32  ? 167 U   X N1    1 
ATOM   3253 C  C2    . U   A  1 153 ? 43.086  26.569  9.791  1.00 27.37  ? 167 U   X C2    1 
ATOM   3254 O  O2    . U   A  1 153 ? 41.873  26.495  9.687  1.00 25.04  ? 167 U   X O2    1 
ATOM   3255 N  N3    . U   A  1 153 ? 43.672  27.338  10.761 1.00 26.71  ? 167 U   X N3    1 
ATOM   3256 C  C4    . U   A  1 153 ? 45.020  27.509  10.999 1.00 28.61  ? 167 U   X C4    1 
ATOM   3257 O  O4    . U   A  1 153 ? 45.362  28.242  11.931 1.00 27.03  ? 167 U   X O4    1 
ATOM   3258 C  C5    . U   A  1 153 ? 45.883  26.782  10.105 1.00 30.57  ? 167 U   X C5    1 
ATOM   3259 C  C6    . U   A  1 153 ? 45.340  26.024  9.137  1.00 32.16  ? 167 U   X C6    1 
ATOM   3260 P  P     . G   A  1 154 ? 44.211  26.815  3.444  1.00 39.08  ? 168 G   X P     1 
ATOM   3261 O  OP1   . G   A  1 154 ? 43.730  26.433  2.093  1.00 44.76  ? 168 G   X OP1   1 
ATOM   3262 O  OP2   . G   A  1 154 ? 45.643  27.111  3.692  1.00 45.18  ? 168 G   X OP2   1 
ATOM   3263 O  "O5'" . G   A  1 154 ? 43.335  28.006  4.011  1.00 38.72  ? 168 G   X "O5'" 1 
ATOM   3264 C  "C5'" . G   A  1 154 ? 41.929  27.838  4.104  1.00 33.89  ? 168 G   X "C5'" 1 
ATOM   3265 C  "C4'" . G   A  1 154 ? 41.343  28.956  4.915  1.00 37.08  ? 168 G   X "C4'" 1 
ATOM   3266 O  "O4'" . G   A  1 154 ? 41.808  28.838  6.296  1.00 38.34  ? 168 G   X "O4'" 1 
ATOM   3267 C  "C3'" . G   A  1 154 ? 41.737  30.359  4.430  1.00 35.99  ? 168 G   X "C3'" 1 
ATOM   3268 O  "O3'" . G   A  1 154 ? 40.629  31.255  4.501  1.00 41.30  ? 168 G   X "O3'" 1 
ATOM   3269 C  "C2'" . G   A  1 154 ? 42.773  30.788  5.457  1.00 37.89  ? 168 G   X "C2'" 1 
ATOM   3270 O  "O2'" . G   A  1 154 ? 42.930  32.184  5.633  1.00 44.53  ? 168 G   X "O2'" 1 
ATOM   3271 C  "C1'" . G   A  1 154 ? 42.163  30.140  6.694  1.00 33.49  ? 168 G   X "C1'" 1 
ATOM   3272 N  N9    . G   A  1 154 ? 42.985  30.274  7.894  1.00 32.33  ? 168 G   X N9    1 
ATOM   3273 C  C8    . G   A  1 154 ? 44.354  30.286  8.009  1.00 34.50  ? 168 G   X C8    1 
ATOM   3274 N  N7    . G   A  1 154 ? 44.768  30.564  9.219  1.00 33.35  ? 168 G   X N7    1 
ATOM   3275 C  C5    . G   A  1 154 ? 43.599  30.792  9.931  1.00 30.99  ? 168 G   X C5    1 
ATOM   3276 C  C6    . G   A  1 154 ? 43.408  31.137  11.291 1.00 29.96  ? 168 G   X C6    1 
ATOM   3277 O  O6    . G   A  1 154 ? 44.289  31.318  12.147 1.00 31.63  ? 168 G   X O6    1 
ATOM   3278 N  N1    . G   A  1 154 ? 42.048  31.271  11.591 1.00 28.03  ? 168 G   X N1    1 
ATOM   3279 C  C2    . G   A  1 154 ? 41.016  31.085  10.687 1.00 28.78  ? 168 G   X C2    1 
ATOM   3280 N  N2    . G   A  1 154 ? 39.758  31.254  11.120 1.00 24.48  ? 168 G   X N2    1 
ATOM   3281 N  N3    . G   A  1 154 ? 41.192  30.765  9.416  1.00 29.12  ? 168 G   X N3    1 
ATOM   3282 C  C4    . G   A  1 154 ? 42.495  30.641  9.119  1.00 30.07  ? 168 G   X C4    1 
ATOM   3283 P  P     . A   A  1 155 ? 40.443  32.422  3.403  1.00 44.96  ? 169 A   X P     1 
ATOM   3284 O  OP1   . A   A  1 155 ? 39.941  31.701  2.195  1.00 38.95  ? 169 A   X OP1   1 
ATOM   3285 O  OP2   . A   A  1 155 ? 41.661  33.268  3.341  1.00 42.63  ? 169 A   X OP2   1 
ATOM   3286 O  "O5'" . A   A  1 155 ? 39.273  33.266  4.059  1.00 35.75  ? 169 A   X "O5'" 1 
ATOM   3287 C  "C5'" . A   A  1 155 ? 37.982  32.695  4.113  1.00 32.80  ? 169 A   X "C5'" 1 
ATOM   3288 C  "C4'" . A   A  1 155 ? 37.320  33.040  5.414  1.00 32.05  ? 169 A   X "C4'" 1 
ATOM   3289 O  "O4'" . A   A  1 155 ? 38.039  32.425  6.514  1.00 30.36  ? 169 A   X "O4'" 1 
ATOM   3290 C  "C3'" . A   A  1 155 ? 37.312  34.515  5.770  1.00 30.10  ? 169 A   X "C3'" 1 
ATOM   3291 O  "O3'" . A   A  1 155 ? 36.325  35.236  5.058  1.00 31.70  ? 169 A   X "O3'" 1 
ATOM   3292 C  "C2'" . A   A  1 155 ? 37.069  34.456  7.270  1.00 28.91  ? 169 A   X "C2'" 1 
ATOM   3293 O  "O2'" . A   A  1 155 ? 35.707  34.130  7.521  1.00 28.08  ? 169 A   X "O2'" 1 
ATOM   3294 C  "C1'" . A   A  1 155 ? 37.910  33.242  7.655  1.00 29.89  ? 169 A   X "C1'" 1 
ATOM   3295 N  N9    . A   A  1 155 ? 39.263  33.543  8.169  1.00 29.10  ? 169 A   X N9    1 
ATOM   3296 C  C8    . A   A  1 155 ? 40.465  33.337  7.542  1.00 29.71  ? 169 A   X C8    1 
ATOM   3297 N  N7    . A   A  1 155 ? 41.509  33.664  8.269  1.00 29.43  ? 169 A   X N7    1 
ATOM   3298 C  C5    . A   A  1 155 ? 40.955  34.103  9.463  1.00 28.12  ? 169 A   X C5    1 
ATOM   3299 C  C6    . A   A  1 155 ? 41.524  34.582  10.659 1.00 27.19  ? 169 A   X C6    1 
ATOM   3300 N  N6    . A   A  1 155 ? 42.833  34.722  10.867 1.00 26.35  ? 169 A   X N6    1 
ATOM   3301 N  N1    . A   A  1 155 ? 40.678  34.939  11.657 1.00 28.42  ? 169 A   X N1    1 
ATOM   3302 C  C2    . A   A  1 155 ? 39.360  34.802  11.464 1.00 27.16  ? 169 A   X C2    1 
ATOM   3303 N  N3    . A   A  1 155 ? 38.712  34.359  10.389 1.00 29.75  ? 169 A   X N3    1 
ATOM   3304 C  C4    . A   A  1 155 ? 39.573  34.026  9.415  1.00 26.18  ? 169 A   X C4    1 
ATOM   3305 P  P     . A   A  1 156 ? 36.475  36.820  4.785  1.00 35.91  ? 170 A   X P     1 
ATOM   3306 O  OP1   . A   A  1 156 ? 35.418  37.169  3.801  1.00 34.63  ? 170 A   X OP1   1 
ATOM   3307 O  OP2   . A   A  1 156 ? 37.907  37.087  4.480  1.00 35.60  ? 170 A   X OP2   1 
ATOM   3308 O  "O5'" . A   A  1 156 ? 36.083  37.440  6.202  1.00 35.07  ? 170 A   X "O5'" 1 
ATOM   3309 C  "C5'" . A   A  1 156 ? 34.725  37.418  6.615  1.00 36.48  ? 170 A   X "C5'" 1 
ATOM   3310 C  "C4'" . A   A  1 156 ? 34.542  38.202  7.890  1.00 35.74  ? 170 A   X "C4'" 1 
ATOM   3311 O  "O4'" . A   A  1 156 ? 35.269  37.544  8.955  1.00 35.79  ? 170 A   X "O4'" 1 
ATOM   3312 C  "C3'" . A   A  1 156 ? 35.096  39.622  7.875  1.00 32.26  ? 170 A   X "C3'" 1 
ATOM   3313 O  "O3'" . A   A  1 156 ? 34.210  40.557  7.276  1.00 33.54  ? 170 A   X "O3'" 1 
ATOM   3314 C  "C2'" . A   A  1 156 ? 35.377  39.884  9.343  1.00 31.86  ? 170 A   X "C2'" 1 
ATOM   3315 O  "O2'" . A   A  1 156 ? 34.158  40.150  10.030 1.00 35.34  ? 170 A   X "O2'" 1 
ATOM   3316 C  "C1'" . A   A  1 156 ? 35.865  38.509  9.797  1.00 34.16  ? 170 A   X "C1'" 1 
ATOM   3317 N  N9    . A   A  1 156 ? 37.324  38.310  9.706  1.00 29.87  ? 170 A   X N9    1 
ATOM   3318 C  C8    . A   A  1 156 ? 37.999  37.685  8.692  1.00 29.94  ? 170 A   X C8    1 
ATOM   3319 N  N7    . A   A  1 156 ? 39.288  37.602  8.873  1.00 27.37  ? 170 A   X N7    1 
ATOM   3320 C  C5    . A   A  1 156 ? 39.485  38.201  10.107 1.00 26.79  ? 170 A   X C5    1 
ATOM   3321 C  C6    . A   A  1 156 ? 40.651  38.424  10.856 1.00 28.21  ? 170 A   X C6    1 
ATOM   3322 N  N6    . A   A  1 156 ? 41.865  38.050  10.447 1.00 24.32  ? 170 A   X N6    1 
ATOM   3323 N  N1    . A   A  1 156 ? 40.516  39.043  12.055 1.00 28.30  ? 170 A   X N1    1 
ATOM   3324 C  C2    . A   A  1 156 ? 39.291  39.415  12.451 1.00 29.06  ? 170 A   X C2    1 
ATOM   3325 N  N3    . A   A  1 156 ? 38.117  39.269  11.826 1.00 30.99  ? 170 A   X N3    1 
ATOM   3326 C  C4    . A   A  1 156 ? 38.288  38.636  10.644 1.00 31.45  ? 170 A   X C4    1 
ATOM   3327 P  P     . G   A  1 157 ? 34.825  41.757  6.383  1.00 38.46  ? 171 G   X P     1 
ATOM   3328 O  OP1   . G   A  1 157 ? 33.668  42.405  5.704  1.00 38.64  ? 171 G   X OP1   1 
ATOM   3329 O  OP2   . G   A  1 157 ? 35.979  41.253  5.605  1.00 37.29  ? 171 G   X OP2   1 
ATOM   3330 O  "O5'" . G   A  1 157 ? 35.398  42.708  7.507  1.00 30.91  ? 171 G   X "O5'" 1 
ATOM   3331 C  "C5'" . G   A  1 157 ? 34.492  43.376  8.366  1.00 35.07  ? 171 G   X "C5'" 1 
ATOM   3332 C  "C4'" . G   A  1 157 ? 35.259  44.071  9.457  1.00 32.35  ? 171 G   X "C4'" 1 
ATOM   3333 O  "O4'" . G   A  1 157 ? 35.934  43.075  10.265 1.00 32.78  ? 171 G   X "O4'" 1 
ATOM   3334 C  "C3'" . G   A  1 157 ? 36.388  44.972  8.989  1.00 31.85  ? 171 G   X "C3'" 1 
ATOM   3335 O  "O3'" . G   A  1 157 ? 35.938  46.240  8.543  1.00 32.61  ? 171 G   X "O3'" 1 
ATOM   3336 C  "C2'" . G   A  1 157 ? 37.269  45.018  10.228 1.00 33.59  ? 171 G   X "C2'" 1 
ATOM   3337 O  "O2'" . G   A  1 157 ? 36.653  45.826  11.220 1.00 32.64  ? 171 G   X "O2'" 1 
ATOM   3338 C  "C1'" . G   A  1 157 ? 37.187  43.563  10.689 1.00 29.83  ? 171 G   X "C1'" 1 
ATOM   3339 N  N9    . G   A  1 157 ? 38.232  42.743  10.056 1.00 28.60  ? 171 G   X N9    1 
ATOM   3340 C  C8    . G   A  1 157 ? 38.114  41.957  8.930  1.00 31.15  ? 171 G   X C8    1 
ATOM   3341 N  N7    . G   A  1 157 ? 39.237  41.360  8.609  1.00 27.22  ? 171 G   X N7    1 
ATOM   3342 C  C5    . G   A  1 157 ? 40.152  41.772  9.576  1.00 25.47  ? 171 G   X C5    1 
ATOM   3343 C  C6    . G   A  1 157 ? 41.534  41.470  9.759  1.00 26.30  ? 171 G   X C6    1 
ATOM   3344 O  O6    . G   A  1 157 ? 42.290  40.748  9.089  1.00 26.80  ? 171 G   X O6    1 
ATOM   3345 N  N1    . G   A  1 157 ? 42.068  42.128  10.861 1.00 25.88  ? 171 G   X N1    1 
ATOM   3346 C  C2    . G   A  1 157 ? 41.371  42.962  11.697 1.00 29.03  ? 171 G   X C2    1 
ATOM   3347 N  N2    . G   A  1 157 ? 42.068  43.495  12.720 1.00 26.63  ? 171 G   X N2    1 
ATOM   3348 N  N3    . G   A  1 157 ? 40.086  43.248  11.536 1.00 27.26  ? 171 G   X N3    1 
ATOM   3349 C  C4    . G   A  1 157 ? 39.543  42.631  10.468 1.00 25.69  ? 171 G   X C4    1 
ATOM   3350 P  P     . C   A  1 158 ? 36.500  46.909  7.184  1.00 36.20  ? 172 C   X P     1 
ATOM   3351 O  OP1   . C   A  1 158 ? 35.555  48.047  6.973  1.00 36.15  ? 172 C   X OP1   1 
ATOM   3352 O  OP2   . C   A  1 158 ? 36.665  45.914  6.099  1.00 35.62  ? 172 C   X OP2   1 
ATOM   3353 O  "O5'" . C   A  1 158 ? 37.927  47.440  7.622  1.00 32.47  ? 172 C   X "O5'" 1 
ATOM   3354 C  "C5'" . C   A  1 158 ? 38.023  48.335  8.721  1.00 32.80  ? 172 C   X "C5'" 1 
ATOM   3355 C  "C4'" . C   A  1 158 ? 39.404  48.323  9.326  1.00 32.43  ? 172 C   X "C4'" 1 
ATOM   3356 O  "O4'" . C   A  1 158 ? 39.705  46.990  9.813  1.00 33.07  ? 172 C   X "O4'" 1 
ATOM   3357 C  "C3'" . C   A  1 158 ? 40.568  48.643  8.394  1.00 30.53  ? 172 C   X "C3'" 1 
ATOM   3358 O  "O3'" . C   A  1 158 ? 40.754  50.033  8.191  1.00 32.09  ? 172 C   X "O3'" 1 
ATOM   3359 C  "C2'" . C   A  1 158 ? 41.746  47.996  9.113  1.00 28.44  ? 172 C   X "C2'" 1 
ATOM   3360 O  "O2'" . C   A  1 158 ? 42.188  48.812  10.189 1.00 30.06  ? 172 C   X "O2'" 1 
ATOM   3361 C  "C1'" . C   A  1 158 ? 41.091  46.736  9.678  1.00 30.54  ? 172 C   X "C1'" 1 
ATOM   3362 N  N1    . C   A  1 158 ? 41.319  45.594  8.752  1.00 29.48  ? 172 C   X N1    1 
ATOM   3363 C  C2    . C   A  1 158 ? 42.561  44.950  8.835  1.00 27.68  ? 172 C   X C2    1 
ATOM   3364 O  O2    . C   A  1 158 ? 43.385  45.370  9.678  1.00 26.55  ? 172 C   X O2    1 
ATOM   3365 N  N3    . C   A  1 158 ? 42.824  43.908  7.999  1.00 25.53  ? 172 C   X N3    1 
ATOM   3366 C  C4    . C   A  1 158 ? 41.906  43.498  7.116  1.00 26.87  ? 172 C   X C4    1 
ATOM   3367 N  N4    . C   A  1 158 ? 42.213  42.457  6.328  1.00 23.88  ? 172 C   X N4    1 
ATOM   3368 C  C5    . C   A  1 158 ? 40.624  44.140  7.002  1.00 28.21  ? 172 C   X C5    1 
ATOM   3369 C  C6    . C   A  1 158 ? 40.377  45.177  7.835  1.00 29.54  ? 172 C   X C6    1 
ATOM   3370 P  P     . C   A  1 159 ? 41.551  50.618  6.920  1.00 34.44  ? 173 C   X P     1 
ATOM   3371 O  OP1   . C   A  1 159 ? 41.296  52.080  7.019  1.00 33.21  ? 173 C   X OP1   1 
ATOM   3372 O  OP2   . C   A  1 159 ? 41.132  49.905  5.679  1.00 27.70  ? 173 C   X OP2   1 
ATOM   3373 O  "O5'" . C   A  1 159 ? 43.064  50.285  7.248  1.00 29.67  ? 173 C   X "O5'" 1 
ATOM   3374 C  "C5'" . C   A  1 159 ? 43.741  50.887  8.339  1.00 31.18  ? 173 C   X "C5'" 1 
ATOM   3375 C  "C4'" . C   A  1 159 ? 45.154  50.371  8.439  1.00 29.84  ? 173 C   X "C4'" 1 
ATOM   3376 O  "O4'" . C   A  1 159 ? 45.131  48.943  8.689  1.00 29.81  ? 173 C   X "O4'" 1 
ATOM   3377 C  "C3'" . C   A  1 159 ? 46.028  50.508  7.196  1.00 29.05  ? 173 C   X "C3'" 1 
ATOM   3378 O  "O3'" . C   A  1 159 ? 46.588  51.799  7.036  1.00 33.36  ? 173 C   X "O3'" 1 
ATOM   3379 C  "C2'" . C   A  1 159 ? 47.086  49.431  7.399  1.00 30.76  ? 173 C   X "C2'" 1 
ATOM   3380 O  "O2'" . C   A  1 159 ? 48.090  49.867  8.309  1.00 32.37  ? 173 C   X "O2'" 1 
ATOM   3381 C  "C1'" . C   A  1 159 ? 46.257  48.338  8.075  1.00 30.74  ? 173 C   X "C1'" 1 
ATOM   3382 N  N1    . C   A  1 159 ? 45.775  47.299  7.147  1.00 25.81  ? 173 C   X N1    1 
ATOM   3383 C  C2    . C   A  1 159 ? 46.677  46.314  6.753  1.00 27.29  ? 173 C   X C2    1 
ATOM   3384 O  O2    . C   A  1 159 ? 47.839  46.387  7.176  1.00 26.32  ? 173 C   X O2    1 
ATOM   3385 N  N3    . C   A  1 159 ? 46.254  45.330  5.927  1.00 24.22  ? 173 C   X N3    1 
ATOM   3386 C  C4    . C   A  1 159 ? 44.988  45.297  5.496  1.00 26.41  ? 173 C   X C4    1 
ATOM   3387 N  N4    . C   A  1 159 ? 44.622  44.302  4.677  1.00 22.15  ? 173 C   X N4    1 
ATOM   3388 C  C5    . C   A  1 159 ? 44.039  46.290  5.898  1.00 27.44  ? 173 C   X C5    1 
ATOM   3389 C  C6    . C   A  1 159 ? 44.478  47.261  6.717  1.00 26.57  ? 173 C   X C6    1 
ATOM   3390 P  P     . C   A  1 160 ? 46.903  52.362  5.562  1.00 35.78  ? 174 C   X P     1 
ATOM   3391 O  OP1   . C   A  1 160 ? 47.271  53.791  5.751  1.00 39.17  ? 174 C   X OP1   1 
ATOM   3392 O  OP2   . C   A  1 160 ? 45.781  52.008  4.668  1.00 31.61  ? 174 C   X OP2   1 
ATOM   3393 O  "O5'" . C   A  1 160 ? 48.181  51.515  5.152  1.00 32.80  ? 174 C   X "O5'" 1 
ATOM   3394 C  "C5'" . C   A  1 160 ? 49.414  51.631  5.839  1.00 34.13  ? 174 C   X "C5'" 1 
ATOM   3395 C  "C4'" . C   A  1 160 ? 50.378  50.590  5.335  1.00 36.27  ? 174 C   X "C4'" 1 
ATOM   3396 O  "O4'" . C   A  1 160 ? 49.857  49.262  5.611  1.00 32.58  ? 174 C   X "O4'" 1 
ATOM   3397 C  "C3'" . C   A  1 160 ? 50.606  50.593  3.830  1.00 36.71  ? 174 C   X "C3'" 1 
ATOM   3398 O  "O3'" . C   A  1 160 ? 51.559  51.565  3.435  1.00 37.66  ? 174 C   X "O3'" 1 
ATOM   3399 C  "C2'" . C   A  1 160 ? 51.059  49.163  3.558  1.00 33.46  ? 174 C   X "C2'" 1 
ATOM   3400 O  "O2'" . C   A  1 160 ? 52.422  49.008  3.922  1.00 37.18  ? 174 C   X "O2'" 1 
ATOM   3401 C  "C1'" . C   A  1 160 ? 50.204  48.385  4.556  1.00 31.44  ? 174 C   X "C1'" 1 
ATOM   3402 N  N1    . C   A  1 160 ? 48.969  47.829  3.952  1.00 29.04  ? 174 C   X N1    1 
ATOM   3403 C  C2    . C   A  1 160 ? 49.090  46.643  3.227  1.00 27.54  ? 174 C   X C2    1 
ATOM   3404 O  O2    . C   A  1 160 ? 50.216  46.124  3.110  1.00 28.07  ? 174 C   X O2    1 
ATOM   3405 N  N3    . C   A  1 160 ? 47.995  46.098  2.667  1.00 24.18  ? 174 C   X N3    1 
ATOM   3406 C  C4    . C   A  1 160 ? 46.807  46.682  2.806  1.00 26.41  ? 174 C   X C4    1 
ATOM   3407 N  N4    . C   A  1 160 ? 45.759  46.091  2.236  1.00 24.71  ? 174 C   X N4    1 
ATOM   3408 C  C5    . C   A  1 160 ? 46.653  47.893  3.545  1.00 29.13  ? 174 C   X C5    1 
ATOM   3409 C  C6    . C   A  1 160 ? 47.757  48.432  4.096  1.00 27.28  ? 174 C   X C6    1 
ATOM   3410 P  P     . A   A  1 161 ? 51.476  52.262  1.991  1.00 41.26  ? 175 A   X P     1 
ATOM   3411 O  OP1   . A   A  1 161 ? 52.625  53.206  2.005  1.00 41.94  ? 175 A   X OP1   1 
ATOM   3412 O  OP2   . A   A  1 161 ? 50.112  52.779  1.747  1.00 38.65  ? 175 A   X OP2   1 
ATOM   3413 O  "O5'" . A   A  1 161 ? 51.699  51.030  1.007  1.00 37.73  ? 175 A   X "O5'" 1 
ATOM   3414 C  "C5'" . A   A  1 161 ? 52.944  50.355  0.887  1.00 39.81  ? 175 A   X "C5'" 1 
ATOM   3415 C  "C4'" . A   A  1 161 ? 52.928  49.406  -0.289 1.00 41.20  ? 175 A   X "C4'" 1 
ATOM   3416 O  "O4'" . A   A  1 161 ? 52.156  48.218  0.033  1.00 37.92  ? 175 A   X "O4'" 1 
ATOM   3417 C  "C3'" . A   A  1 161 ? 52.288  49.944  -1.565 1.00 43.46  ? 175 A   X "C3'" 1 
ATOM   3418 O  "O3'" . A   A  1 161 ? 53.188  50.720  -2.338 1.00 53.10  ? 175 A   X "O3'" 1 
ATOM   3419 C  "C2'" . A   A  1 161 ? 51.825  48.693  -2.296 1.00 42.38  ? 175 A   X "C2'" 1 
ATOM   3420 O  "O2'" . A   A  1 161 ? 52.886  48.171  -3.087 1.00 47.26  ? 175 A   X "O2'" 1 
ATOM   3421 C  "C1'" . A   A  1 161 ? 51.532  47.729  -1.137 1.00 38.38  ? 175 A   X "C1'" 1 
ATOM   3422 N  N9    . A   A  1 161 ? 50.091  47.496  -0.888 1.00 31.58  ? 175 A   X N9    1 
ATOM   3423 C  C8    . A   A  1 161 ? 49.148  48.291  -0.283 1.00 32.78  ? 175 A   X C8    1 
ATOM   3424 N  N7    . A   A  1 161 ? 47.949  47.737  -0.235 1.00 28.39  ? 175 A   X N7    1 
ATOM   3425 C  C5    . A   A  1 161 ? 48.124  46.494  -0.843 1.00 28.58  ? 175 A   X C5    1 
ATOM   3426 C  C6    . A   A  1 161 ? 47.258  45.414  -1.120 1.00 28.67  ? 175 A   X C6    1 
ATOM   3427 N  N6    . A   A  1 161 ? 45.958  45.370  -0.808 1.00 30.36  ? 175 A   X N6    1 
ATOM   3428 N  N1    . A   A  1 161 ? 47.781  44.332  -1.744 1.00 31.03  ? 175 A   X N1    1 
ATOM   3429 C  C2    . A   A  1 161 ? 49.081  44.330  -2.077 1.00 27.04  ? 175 A   X C2    1 
ATOM   3430 N  N3    . A   A  1 161 ? 49.990  45.273  -1.868 1.00 28.26  ? 175 A   X N3    1 
ATOM   3431 C  C4    . A   A  1 161 ? 49.443  46.340  -1.242 1.00 30.79  ? 175 A   X C4    1 
ATOM   3432 O  OP3   . G   B  1 1   ? -9.108  14.712  1.947  1.00 43.78  ? 15  G   A OP3   1 
ATOM   3433 P  P     . G   B  1 1   ? -9.184  13.707  0.860  1.00 39.90  ? 15  G   A P     1 
ATOM   3434 O  OP1   . G   B  1 1   ? -7.919  12.918  0.887  1.00 40.13  ? 15  G   A OP1   1 
ATOM   3435 O  OP2   . G   B  1 1   ? -9.497  14.462  -0.375 1.00 42.73  ? 15  G   A OP2   1 
ATOM   3436 O  "O5'" . G   B  1 1   ? -10.459 12.823  1.182  1.00 34.42  ? 15  G   A "O5'" 1 
ATOM   3437 C  "C5'" . G   B  1 1   ? -11.620 12.876  0.364  1.00 30.03  ? 15  G   A "C5'" 1 
ATOM   3438 C  "C4'" . G   B  1 1   ? -12.585 11.783  0.745  1.00 26.70  ? 15  G   A "C4'" 1 
ATOM   3439 O  "O4'" . G   B  1 1   ? -11.979 10.500  0.462  1.00 27.83  ? 15  G   A "O4'" 1 
ATOM   3440 C  "C3'" . G   B  1 1   ? -12.913 11.706  2.228  1.00 28.37  ? 15  G   A "C3'" 1 
ATOM   3441 O  "O3'" . G   B  1 1   ? -13.922 12.618  2.618  1.00 28.84  ? 15  G   A "O3'" 1 
ATOM   3442 C  "C2'" . G   B  1 1   ? -13.270 10.235  2.441  1.00 28.16  ? 15  G   A "C2'" 1 
ATOM   3443 O  "O2'" . G   B  1 1   ? -14.584 9.918   1.996  1.00 25.52  ? 15  G   A "O2'" 1 
ATOM   3444 C  "C1'" . G   B  1 1   ? -12.290 9.575   1.483  1.00 26.61  ? 15  G   A "C1'" 1 
ATOM   3445 N  N9    . G   B  1 1   ? -11.029 9.182   2.132  1.00 27.59  ? 15  G   A N9    1 
ATOM   3446 C  C8    . G   B  1 1   ? -9.801  9.733   1.884  1.00 26.89  ? 15  G   A C8    1 
ATOM   3447 N  N7    . G   B  1 1   ? -8.856  9.165   2.572  1.00 28.17  ? 15  G   A N7    1 
ATOM   3448 C  C5    . G   B  1 1   ? -9.491  8.184   3.319  1.00 27.97  ? 15  G   A C5    1 
ATOM   3449 C  C6    . G   B  1 1   ? -8.950  7.263   4.250  1.00 27.40  ? 15  G   A C6    1 
ATOM   3450 O  O6    . G   B  1 1   ? -7.754  7.175   4.563  1.00 26.28  ? 15  G   A O6    1 
ATOM   3451 N  N1    . G   B  1 1   ? -9.945  6.440   4.794  1.00 24.66  ? 15  G   A N1    1 
ATOM   3452 C  C2    . G   B  1 1   ? -11.281 6.510   4.464  1.00 27.10  ? 15  G   A C2    1 
ATOM   3453 N  N2    . G   B  1 1   ? -12.130 5.658   5.060  1.00 26.72  ? 15  G   A N2    1 
ATOM   3454 N  N3    . G   B  1 1   ? -11.781 7.369   3.590  1.00 24.84  ? 15  G   A N3    1 
ATOM   3455 C  C4    . G   B  1 1   ? -10.837 8.171   3.061  1.00 25.94  ? 15  G   A C4    1 
ATOM   3456 P  P     . G   B  1 2   ? -13.871 13.308  4.068  1.00 29.46  ? 16  G   A P     1 
ATOM   3457 O  OP1   . G   B  1 2   ? -14.968 14.311  4.061  1.00 28.29  ? 16  G   A OP1   1 
ATOM   3458 O  OP2   . G   B  1 2   ? -12.459 13.692  4.250  1.00 25.37  ? 16  G   A OP2   1 
ATOM   3459 O  "O5'" . G   B  1 2   ? -14.233 12.094  5.039  1.00 28.16  ? 16  G   A "O5'" 1 
ATOM   3460 C  "C5'" . G   B  1 2   ? -15.537 11.542  5.126  1.00 27.16  ? 16  G   A "C5'" 1 
ATOM   3461 C  "C4'" . G   B  1 2   ? -15.543 10.375  6.078  1.00 27.71  ? 16  G   A "C4'" 1 
ATOM   3462 O  "O4'" . G   B  1 2   ? -14.601 9.379   5.608  1.00 28.64  ? 16  G   A "O4'" 1 
ATOM   3463 C  "C3'" . G   B  1 2   ? -15.063 10.668  7.493  1.00 28.88  ? 16  G   A "C3'" 1 
ATOM   3464 O  "O3'" . G   B  1 2   ? -16.051 11.269  8.304  1.00 33.61  ? 16  G   A "O3'" 1 
ATOM   3465 C  "C2'" . G   B  1 2   ? -14.631 9.292   7.976  1.00 32.13  ? 16  G   A "C2'" 1 
ATOM   3466 O  "O2'" . G   B  1 2   ? -15.756 8.474   8.228  1.00 30.84  ? 16  G   A "O2'" 1 
ATOM   3467 C  "C1'" . G   B  1 2   ? -13.985 8.748   6.715  1.00 30.55  ? 16  G   A "C1'" 1 
ATOM   3468 N  N9    . G   B  1 2   ? -12.535 8.996   6.687  1.00 26.56  ? 16  G   A N9    1 
ATOM   3469 C  C8    . G   B  1 2   ? -11.842 9.941   5.977  1.00 28.04  ? 16  G   A C8    1 
ATOM   3470 N  N7    . G   B  1 2   ? -10.551 9.867   6.176  1.00 28.34  ? 16  G   A N7    1 
ATOM   3471 C  C5    . G   B  1 2   ? -10.388 8.812   7.062  1.00 30.14  ? 16  G   A C5    1 
ATOM   3472 C  C6    . G   B  1 2   ? -9.217  8.255   7.643  1.00 28.04  ? 16  G   A C6    1 
ATOM   3473 O  O6    . G   B  1 2   ? -8.041  8.590   7.476  1.00 28.37  ? 16  G   A O6    1 
ATOM   3474 N  N1    . G   B  1 2   ? -9.521  7.194   8.489  1.00 29.15  ? 16  G   A N1    1 
ATOM   3475 C  C2    . G   B  1 2   ? -10.782 6.725   8.745  1.00 28.85  ? 16  G   A C2    1 
ATOM   3476 N  N2    . G   B  1 2   ? -10.882 5.686   9.592  1.00 30.69  ? 16  G   A N2    1 
ATOM   3477 N  N3    . G   B  1 2   ? -11.877 7.230   8.212  1.00 30.73  ? 16  G   A N3    1 
ATOM   3478 C  C4    . G   B  1 2   ? -11.605 8.263   7.383  1.00 29.45  ? 16  G   A C4    1 
ATOM   3479 P  P     . G   B  1 3   ? -15.643 12.202  9.560  1.00 34.37  ? 17  G   A P     1 
ATOM   3480 O  OP1   . G   B  1 3   ? -16.950 12.792  9.951  1.00 31.20  ? 17  G   A OP1   1 
ATOM   3481 O  OP2   . G   B  1 3   ? -14.500 13.092  9.201  1.00 29.16  ? 17  G   A OP2   1 
ATOM   3482 O  "O5'" . G   B  1 3   ? -15.137 11.117  10.592 1.00 31.17  ? 17  G   A "O5'" 1 
ATOM   3483 C  "C5'" . G   B  1 3   ? -16.021 10.156  11.145 1.00 35.14  ? 17  G   A "C5'" 1 
ATOM   3484 C  "C4'" . G   B  1 3   ? -15.306 9.277   12.137 1.00 31.54  ? 17  G   A "C4'" 1 
ATOM   3485 O  "O4'" . G   B  1 3   ? -14.343 8.438   11.454 1.00 30.15  ? 17  G   A "O4'" 1 
ATOM   3486 C  "C3'" . G   B  1 3   ? -14.480 10.004  13.185 1.00 32.52  ? 17  G   A "C3'" 1 
ATOM   3487 O  "O3'" . G   B  1 3   ? -15.278 10.513  14.242 1.00 32.21  ? 17  G   A "O3'" 1 
ATOM   3488 C  "C2'" . G   B  1 3   ? -13.493 8.928   13.606 1.00 29.84  ? 17  G   A "C2'" 1 
ATOM   3489 O  "O2'" . G   B  1 3   ? -14.141 7.948   14.399 1.00 34.93  ? 17  G   A "O2'" 1 
ATOM   3490 C  "C1'" . G   B  1 3   ? -13.194 8.277   12.256 1.00 32.24  ? 17  G   A "C1'" 1 
ATOM   3491 N  N9    . G   B  1 3   ? -12.069 8.931   11.565 1.00 29.48  ? 17  G   A N9    1 
ATOM   3492 C  C8    . G   B  1 3   ? -12.163 9.947   10.639 1.00 26.96  ? 17  G   A C8    1 
ATOM   3493 N  N7    . G   B  1 3   ? -10.995 10.323  10.191 1.00 27.57  ? 17  G   A N7    1 
ATOM   3494 C  C5    . G   B  1 3   ? -10.083 9.507   10.852 1.00 28.53  ? 17  G   A C5    1 
ATOM   3495 C  C6    . G   B  1 3   ? -8.664  9.457   10.783 1.00 28.14  ? 17  G   A C6    1 
ATOM   3496 O  O6    . G   B  1 3   ? -7.890  10.129  10.092 1.00 29.47  ? 17  G   A O6    1 
ATOM   3497 N  N1    . G   B  1 3   ? -8.143  8.483   11.627 1.00 27.17  ? 17  G   A N1    1 
ATOM   3498 C  C2    . G   B  1 3   ? -8.880  7.669   12.450 1.00 27.75  ? 17  G   A C2    1 
ATOM   3499 N  N2    . G   B  1 3   ? -8.165  6.800   13.190 1.00 29.72  ? 17  G   A N2    1 
ATOM   3500 N  N3    . G   B  1 3   ? -10.199 7.708   12.529 1.00 28.02  ? 17  G   A N3    1 
ATOM   3501 C  C4    . G   B  1 3   ? -10.733 8.642   11.714 1.00 28.15  ? 17  G   A C4    1 
ATOM   3502 P  P     . C   B  1 4   ? -14.874 11.870  15.012 1.00 35.77  ? 18  C   A P     1 
ATOM   3503 O  OP1   . C   B  1 4   ? -16.031 12.087  15.924 1.00 37.02  ? 18  C   A OP1   1 
ATOM   3504 O  OP2   . C   B  1 4   ? -14.484 12.955  14.088 1.00 32.02  ? 18  C   A OP2   1 
ATOM   3505 O  "O5'" . C   B  1 4   ? -13.549 11.418  15.785 1.00 34.84  ? 18  C   A "O5'" 1 
ATOM   3506 C  "C5'" . C   B  1 4   ? -13.573 10.482  16.849 1.00 35.46  ? 18  C   A "C5'" 1 
ATOM   3507 C  "C4'" . C   B  1 4   ? -12.173 10.186  17.321 1.00 33.86  ? 18  C   A "C4'" 1 
ATOM   3508 O  "O4'" . C   B  1 4   ? -11.470 9.480   16.269 1.00 31.41  ? 18  C   A "O4'" 1 
ATOM   3509 C  "C3'" . C   B  1 4   ? -11.281 11.391  17.601 1.00 32.38  ? 18  C   A "C3'" 1 
ATOM   3510 O  "O3'" . C   B  1 4   ? -11.508 12.016  18.856 1.00 32.10  ? 18  C   A "O3'" 1 
ATOM   3511 C  "C2'" . C   B  1 4   ? -9.887  10.803  17.441 1.00 31.27  ? 18  C   A "C2'" 1 
ATOM   3512 O  "O2'" . C   B  1 4   ? -9.507  10.030  18.569 1.00 29.76  ? 18  C   A "O2'" 1 
ATOM   3513 C  "C1'" . C   B  1 4   ? -10.110 9.857   16.261 1.00 30.09  ? 18  C   A "C1'" 1 
ATOM   3514 N  N1    . C   B  1 4   ? -9.779  10.605  15.034 1.00 26.77  ? 18  C   A N1    1 
ATOM   3515 C  C2    . C   B  1 4   ? -8.449  10.589  14.608 1.00 27.43  ? 18  C   A C2    1 
ATOM   3516 O  O2    . C   B  1 4   ? -7.607  9.922   15.235 1.00 31.47  ? 18  C   A O2    1 
ATOM   3517 N  N3    . C   B  1 4   ? -8.114  11.275  13.499 1.00 28.80  ? 18  C   A N3    1 
ATOM   3518 C  C4    . C   B  1 4   ? -9.029  11.981  12.839 1.00 26.94  ? 18  C   A C4    1 
ATOM   3519 N  N4    . C   B  1 4   ? -8.616  12.634  11.752 1.00 27.54  ? 18  C   A N4    1 
ATOM   3520 C  C5    . C   B  1 4   ? -10.395 12.031  13.258 1.00 28.39  ? 18  C   A C5    1 
ATOM   3521 C  C6    . C   B  1 4   ? -10.718 11.340  14.361 1.00 26.78  ? 18  C   A C6    1 
ATOM   3522 P  P     . U   B  1 5   ? -11.152 13.569  19.100 1.00 36.65  ? 19  U   A P     1 
ATOM   3523 O  OP1   . U   B  1 5   ? -11.639 13.781  20.481 1.00 40.48  ? 19  U   A OP1   1 
ATOM   3524 O  OP2   . U   B  1 5   ? -11.676 14.401  17.987 1.00 35.53  ? 19  U   A OP2   1 
ATOM   3525 O  "O5'" . U   B  1 5   ? -9.564  13.639  19.088 1.00 35.10  ? 19  U   A "O5'" 1 
ATOM   3526 C  "C5'" . U   B  1 5   ? -8.820  12.914  20.058 1.00 33.99  ? 19  U   A "C5'" 1 
ATOM   3527 C  "C4'" . U   B  1 5   ? -7.365  12.863  19.684 1.00 36.39  ? 19  U   A "C4'" 1 
ATOM   3528 O  "O4'" . U   B  1 5   ? -7.223  12.261  18.374 1.00 34.08  ? 19  U   A "O4'" 1 
ATOM   3529 C  "C3'" . U   B  1 5   ? -6.677  14.211  19.517 1.00 36.34  ? 19  U   A "C3'" 1 
ATOM   3530 O  "O3'" . U   B  1 5   ? -6.314  14.815  20.745 1.00 41.00  ? 19  U   A "O3'" 1 
ATOM   3531 C  "C2'" . U   B  1 5   ? -5.494  13.855  18.631 1.00 35.62  ? 19  U   A "C2'" 1 
ATOM   3532 O  "O2'" . U   B  1 5   ? -4.528  13.111  19.360 1.00 35.89  ? 19  U   A "O2'" 1 
ATOM   3533 C  "C1'" . U   B  1 5   ? -6.161  12.879  17.669 1.00 33.72  ? 19  U   A "C1'" 1 
ATOM   3534 N  N1    . U   B  1 5   ? -6.680  13.553  16.459 1.00 31.55  ? 19  U   A N1    1 
ATOM   3535 C  C2    . U   B  1 5   ? -5.763  13.856  15.471 1.00 32.45  ? 19  U   A C2    1 
ATOM   3536 O  O2    . U   B  1 5   ? -4.566  13.604  15.556 1.00 30.84  ? 19  U   A O2    1 
ATOM   3537 N  N3    . U   B  1 5   ? -6.300  14.469  14.368 1.00 28.95  ? 19  U   A N3    1 
ATOM   3538 C  C4    . U   B  1 5   ? -7.612  14.806  14.149 1.00 29.61  ? 19  U   A C4    1 
ATOM   3539 O  O4    . U   B  1 5   ? -7.901  15.349  13.080 1.00 29.65  ? 19  U   A O4    1 
ATOM   3540 C  C5    . U   B  1 5   ? -8.507  14.463  15.217 1.00 31.35  ? 19  U   A C5    1 
ATOM   3541 C  C6    . U   B  1 5   ? -8.017  13.861  16.311 1.00 29.35  ? 19  U   A C6    1 
ATOM   3542 P  P     . U   B  1 6   ? -6.287  16.417  20.868 1.00 44.25  ? 20  U   A P     1 
ATOM   3543 O  OP1   . U   B  1 6   ? -5.984  16.626  22.306 1.00 48.71  ? 20  U   A OP1   1 
ATOM   3544 O  OP2   . U   B  1 6   ? -7.540  16.982  20.300 1.00 47.23  ? 20  U   A OP2   1 
ATOM   3545 O  "O5'" . U   B  1 6   ? -5.043  16.829  19.966 1.00 36.46  ? 20  U   A "O5'" 1 
ATOM   3546 C  "C5'" . U   B  1 6   ? -3.755  16.414  20.391 1.00 37.66  ? 20  U   A "C5'" 1 
ATOM   3547 C  "C4'" . U   B  1 6   ? -2.685  16.772  19.393 1.00 38.30  ? 20  U   A "C4'" 1 
ATOM   3548 O  "O4'" . U   B  1 6   ? -2.955  16.109  18.131 1.00 36.59  ? 20  U   A "O4'" 1 
ATOM   3549 C  "C3'" . U   B  1 6   ? -2.568  18.235  18.997 1.00 37.52  ? 20  U   A "C3'" 1 
ATOM   3550 O  "O3'" . U   B  1 6   ? -1.924  19.049  19.965 1.00 37.06  ? 20  U   A "O3'" 1 
ATOM   3551 C  "C2'" . U   B  1 6   ? -1.794  18.119  17.696 1.00 30.92  ? 20  U   A "C2'" 1 
ATOM   3552 O  "O2'" . U   B  1 6   ? -0.446  17.767  17.966 1.00 37.53  ? 20  U   A "O2'" 1 
ATOM   3553 C  "C1'" . U   B  1 6   ? -2.469  16.905  17.072 1.00 33.53  ? 20  U   A "C1'" 1 
ATOM   3554 N  N1    . U   B  1 6   ? -3.601  17.269  16.200 1.00 29.58  ? 20  U   A N1    1 
ATOM   3555 C  C2    . U   B  1 6   ? -3.301  17.643  14.910 1.00 32.05  ? 20  U   A C2    1 
ATOM   3556 O  O2    . U   B  1 6   ? -2.142  17.680  14.513 1.00 32.82  ? 20  U   A O2    1 
ATOM   3557 N  N3    . U   B  1 6   ? -4.395  17.961  14.133 1.00 30.30  ? 20  U   A N3    1 
ATOM   3558 C  C4    . U   B  1 6   ? -5.721  17.923  14.530 1.00 32.81  ? 20  U   A C4    1 
ATOM   3559 O  O4    . U   B  1 6   ? -6.619  18.231  13.745 1.00 37.79  ? 20  U   A O4    1 
ATOM   3560 C  C5    . U   B  1 6   ? -5.941  17.523  15.885 1.00 33.21  ? 20  U   A C5    1 
ATOM   3561 C  C6    . U   B  1 6   ? -4.894  17.214  16.652 1.00 35.45  ? 20  U   A C6    1 
ATOM   3562 P  P     . C   B  1 7   ? -2.242  20.623  20.024 1.00 36.06  ? 21  C   A P     1 
ATOM   3563 O  OP1   . C   B  1 7   ? -1.485  21.035  21.228 1.00 36.34  ? 21  C   A OP1   1 
ATOM   3564 O  OP2   . C   B  1 7   ? -3.698  20.914  19.969 1.00 30.38  ? 21  C   A OP2   1 
ATOM   3565 O  "O5'" . C   B  1 7   ? -1.601  21.197  18.678 1.00 31.29  ? 21  C   A "O5'" 1 
ATOM   3566 C  "C5'" . C   B  1 7   ? -0.229  21.137  18.346 1.00 26.77  ? 21  C   A "C5'" 1 
ATOM   3567 C  "C4'" . C   B  1 7   ? 0.005   21.631  16.940 1.00 25.76  ? 21  C   A "C4'" 1 
ATOM   3568 O  "O4'" . C   B  1 7   ? -0.628  20.738  15.984 1.00 27.23  ? 21  C   A "O4'" 1 
ATOM   3569 C  "C3'" . C   B  1 7   ? -0.551  23.009  16.588 1.00 26.59  ? 21  C   A "C3'" 1 
ATOM   3570 O  "O3'" . C   B  1 7   ? 0.272   24.074  17.042 1.00 20.94  ? 21  C   A "O3'" 1 
ATOM   3571 C  "C2'" . C   B  1 7   ? -0.651  22.944  15.068 1.00 27.11  ? 21  C   A "C2'" 1 
ATOM   3572 O  "O2'" . C   B  1 7   ? 0.599   23.212  14.459 1.00 23.94  ? 21  C   A "O2'" 1 
ATOM   3573 C  "C1'" . C   B  1 7   ? -1.016  21.473  14.838 1.00 27.97  ? 21  C   A "C1'" 1 
ATOM   3574 N  N1    . C   B  1 7   ? -2.465  21.444  14.645 1.00 24.49  ? 21  C   A N1    1 
ATOM   3575 C  C2    . C   B  1 7   ? -2.932  21.748  13.371 1.00 27.66  ? 21  C   A C2    1 
ATOM   3576 O  O2    . C   B  1 7   ? -2.086  21.988  12.501 1.00 27.69  ? 21  C   A O2    1 
ATOM   3577 N  N3    . C   B  1 7   ? -4.270  21.751  13.132 1.00 26.26  ? 21  C   A N3    1 
ATOM   3578 C  C4    . C   B  1 7   ? -5.118  21.487  14.129 1.00 30.18  ? 21  C   A C4    1 
ATOM   3579 N  N4    . C   B  1 7   ? -6.434  21.510  13.872 1.00 30.07  ? 21  C   A N4    1 
ATOM   3580 C  C5    . C   B  1 7   ? -4.660  21.182  15.447 1.00 26.48  ? 21  C   A C5    1 
ATOM   3581 C  C6    . C   B  1 7   ? -3.337  21.177  15.663 1.00 25.10  ? 21  C   A C6    1 
ATOM   3582 P  P     . G   B  1 8   ? -0.340  25.223  17.955 1.00 23.03  ? 22  G   A P     1 
ATOM   3583 O  OP1   . G   B  1 8   ? 0.880   25.979  18.368 1.00 21.35  ? 22  G   A OP1   1 
ATOM   3584 O  OP2   . G   B  1 8   ? -1.223  24.615  18.992 1.00 22.70  ? 22  G   A OP2   1 
ATOM   3585 O  "O5'" . G   B  1 8   ? -1.251  26.066  16.953 1.00 23.14  ? 22  G   A "O5'" 1 
ATOM   3586 C  "C5'" . G   B  1 8   ? -0.711  26.657  15.781 1.00 21.41  ? 22  G   A "C5'" 1 
ATOM   3587 C  "C4'" . G   B  1 8   ? -1.146  28.091  15.660 1.00 18.23  ? 22  G   A "C4'" 1 
ATOM   3588 O  "O4'" . G   B  1 8   ? -2.605  28.177  15.685 1.00 20.19  ? 22  G   A "O4'" 1 
ATOM   3589 C  "C3'" . G   B  1 8   ? -0.704  29.015  16.788 1.00 18.25  ? 22  G   A "C3'" 1 
ATOM   3590 O  "O3'" . G   B  1 8   ? 0.633   29.455  16.623 1.00 19.30  ? 22  G   A "O3'" 1 
ATOM   3591 C  "C2'" . G   B  1 8   ? -1.736  30.130  16.692 1.00 18.73  ? 22  G   A "C2'" 1 
ATOM   3592 O  "O2'" . G   B  1 8   ? -1.478  30.930  15.542 1.00 18.53  ? 22  G   A "O2'" 1 
ATOM   3593 C  "C1'" . G   B  1 8   ? -3.008  29.322  16.400 1.00 18.54  ? 22  G   A "C1'" 1 
ATOM   3594 N  N9    . G   B  1 8   ? -3.702  28.881  17.632 1.00 18.56  ? 22  G   A N9    1 
ATOM   3595 C  C8    . G   B  1 8   ? -3.600  27.659  18.256 1.00 19.03  ? 22  G   A C8    1 
ATOM   3596 N  N7    . G   B  1 8   ? -4.334  27.562  19.338 1.00 19.30  ? 22  G   A N7    1 
ATOM   3597 C  C5    . G   B  1 8   ? -4.961  28.803  19.439 1.00 19.03  ? 22  G   A C5    1 
ATOM   3598 C  C6    . G   B  1 8   ? -5.874  29.310  20.401 1.00 21.69  ? 22  G   A C6    1 
ATOM   3599 O  O6    . G   B  1 8   ? -6.335  28.714  21.385 1.00 23.01  ? 22  G   A O6    1 
ATOM   3600 N  N1    . G   B  1 8   ? -6.268  30.627  20.136 1.00 18.05  ? 22  G   A N1    1 
ATOM   3601 C  C2    . G   B  1 8   ? -5.819  31.361  19.062 1.00 20.62  ? 22  G   A C2    1 
ATOM   3602 N  N2    . G   B  1 8   ? -6.281  32.618  18.939 1.00 19.93  ? 22  G   A N2    1 
ATOM   3603 N  N3    . G   B  1 8   ? -4.969  30.895  18.154 1.00 20.21  ? 22  G   A N3    1 
ATOM   3604 C  C4    . G   B  1 8   ? -4.576  29.627  18.400 1.00 19.35  ? 22  G   A C4    1 
ATOM   3605 P  P     . U   B  1 9   ? 1.542   29.843  17.890 1.00 19.41  ? 23  U   A P     1 
ATOM   3606 O  OP1   . U   B  1 9   ? 2.919   29.873  17.394 1.00 20.32  ? 23  U   A OP1   1 
ATOM   3607 O  OP2   . U   B  1 9   ? 1.181   28.962  19.005 1.00 17.93  ? 23  U   A OP2   1 
ATOM   3608 O  "O5'" . U   B  1 9   ? 1.028   31.300  18.215 1.00 17.90  ? 23  U   A "O5'" 1 
ATOM   3609 C  "C5'" . U   B  1 9   ? 1.166   32.363  17.285 1.00 16.95  ? 23  U   A "C5'" 1 
ATOM   3610 C  "C4'" . U   B  1 9   ? 0.475   33.590  17.817 1.00 17.94  ? 23  U   A "C4'" 1 
ATOM   3611 O  "O4'" . U   B  1 9   ? -0.955  33.353  17.860 1.00 19.45  ? 23  U   A "O4'" 1 
ATOM   3612 C  "C3'" . U   B  1 9   ? 0.808   33.951  19.258 1.00 17.22  ? 23  U   A "C3'" 1 
ATOM   3613 O  "O3'" . U   B  1 9   ? 2.047   34.623  19.383 1.00 17.83  ? 23  U   A "O3'" 1 
ATOM   3614 C  "C2'" . U   B  1 9   ? -0.408  34.769  19.682 1.00 15.20  ? 23  U   A "C2'" 1 
ATOM   3615 O  "O2'" . U   B  1 9   ? -0.406  36.058  19.094 1.00 16.52  ? 23  U   A "O2'" 1 
ATOM   3616 C  "C1'" . U   B  1 9   ? -1.516  33.971  19.005 1.00 17.31  ? 23  U   A "C1'" 1 
ATOM   3617 N  N1    . U   B  1 9   ? -2.070  32.923  19.883 1.00 16.54  ? 23  U   A N1    1 
ATOM   3618 C  C2    . U   B  1 9   ? -3.140  33.278  20.699 1.00 19.82  ? 23  U   A C2    1 
ATOM   3619 O  O2    . U   B  1 9   ? -3.605  34.408  20.725 1.00 18.20  ? 23  U   A O2    1 
ATOM   3620 N  N3    . U   B  1 9   ? -3.623  32.260  21.492 1.00 20.64  ? 23  U   A N3    1 
ATOM   3621 C  C4    . U   B  1 9   ? -3.161  30.957  21.551 1.00 21.09  ? 23  U   A C4    1 
ATOM   3622 O  O4    . U   B  1 9   ? -3.715  30.148  22.308 1.00 20.68  ? 23  U   A O4    1 
ATOM   3623 C  C5    . U   B  1 9   ? -2.053  30.672  20.684 1.00 17.78  ? 23  U   A C5    1 
ATOM   3624 C  C6    . U   B  1 9   ? -1.565  31.643  19.894 1.00 16.90  ? 23  U   A C6    1 
ATOM   3625 P  P     . U   B  1 10  ? 2.893   34.562  20.751 1.00 18.31  ? 24  U   A P     1 
ATOM   3626 O  OP1   . U   B  1 10  ? 3.650   33.296  20.809 1.00 15.97  ? 24  U   A OP1   1 
ATOM   3627 O  OP2   . U   B  1 10  ? 1.903   34.832  21.801 1.00 18.33  ? 24  U   A OP2   1 
ATOM   3628 O  "O5'" . U   B  1 10  ? 3.826   35.844  20.502 1.00 18.59  ? 24  U   A "O5'" 1 
ATOM   3629 C  "C5'" . U   B  1 10  ? 3.978   36.938  21.396 1.00 17.11  ? 24  U   A "C5'" 1 
ATOM   3630 C  "C4'" . U   B  1 10  ? 3.192   38.138  20.916 1.00 17.76  ? 24  U   A "C4'" 1 
ATOM   3631 O  "O4'" . U   B  1 10  ? 3.622   38.528  19.587 1.00 17.02  ? 24  U   A "O4'" 1 
ATOM   3632 C  "C3'" . U   B  1 10  ? 1.692   37.905  20.793 1.00 15.90  ? 24  U   A "C3'" 1 
ATOM   3633 O  "O3'" . U   B  1 10  ? 1.061   38.113  22.043 1.00 18.13  ? 24  U   A "O3'" 1 
ATOM   3634 C  "C2'" . U   B  1 10  ? 1.264   38.879  19.697 1.00 16.55  ? 24  U   A "C2'" 1 
ATOM   3635 O  "O2'" . U   B  1 10  ? 1.070   40.181  20.221 1.00 17.87  ? 24  U   A "O2'" 1 
ATOM   3636 C  "C1'" . U   B  1 10  ? 2.509   38.930  18.811 1.00 17.82  ? 24  U   A "C1'" 1 
ATOM   3637 N  N1    . U   B  1 10  ? 2.440   38.057  17.610 1.00 15.55  ? 24  U   A N1    1 
ATOM   3638 C  C2    . U   B  1 10  ? 1.852   38.589  16.472 1.00 19.10  ? 24  U   A C2    1 
ATOM   3639 O  O2    . U   B  1 10  ? 1.394   39.717  16.458 1.00 20.56  ? 24  U   A O2    1 
ATOM   3640 N  N3    . U   B  1 10  ? 1.827   37.762  15.369 1.00 16.73  ? 24  U   A N3    1 
ATOM   3641 C  C4    . U   B  1 10  ? 2.344   36.481  15.321 1.00 16.77  ? 24  U   A C4    1 
ATOM   3642 O  O4    . U   B  1 10  ? 2.268   35.822  14.282 1.00 18.76  ? 24  U   A O4    1 
ATOM   3643 C  C5    . U   B  1 10  ? 2.941   36.021  16.528 1.00 16.10  ? 24  U   A C5    1 
ATOM   3644 C  C6    . U   B  1 10  ? 2.976   36.805  17.605 1.00 15.64  ? 24  U   A C6    1 
ATOM   3645 P  P     . A   B  1 11  ? -0.430  37.647  22.458 1.00 17.04  ? 25  A   A P     1 
ATOM   3646 O  OP1   . A   B  1 11  ? -0.433  36.343  23.137 1.00 15.86  ? 25  A   A OP1   1 
ATOM   3647 O  OP2   . A   B  1 11  ? -1.293  37.865  21.251 1.00 17.25  ? 25  A   A OP2   1 
ATOM   3648 O  "O5'" . A   B  1 11  ? -0.706  38.751  23.550 1.00 19.59  ? 25  A   A "O5'" 1 
ATOM   3649 C  "C5'" . A   B  1 11  ? -1.174  40.052  23.246 1.00 20.44  ? 25  A   A "C5'" 1 
ATOM   3650 C  "C4'" . A   B  1 11  ? -1.761  40.701  24.476 1.00 24.01  ? 25  A   A "C4'" 1 
ATOM   3651 O  "O4'" . A   B  1 11  ? -2.844  39.883  24.986 1.00 24.58  ? 25  A   A "O4'" 1 
ATOM   3652 C  "C3'" . A   B  1 11  ? -0.829  40.820  25.668 1.00 21.82  ? 25  A   A "C3'" 1 
ATOM   3653 O  "O3'" . A   B  1 11  ? 0.076   41.896  25.563 1.00 21.36  ? 25  A   A "O3'" 1 
ATOM   3654 C  "C2'" . A   B  1 11  ? -1.810  40.946  26.827 1.00 24.26  ? 25  A   A "C2'" 1 
ATOM   3655 O  "O2'" . A   B  1 11  ? -2.392  42.241  26.877 1.00 22.85  ? 25  A   A "O2'" 1 
ATOM   3656 C  "C1'" . A   B  1 11  ? -2.869  39.932  26.396 1.00 27.24  ? 25  A   A "C1'" 1 
ATOM   3657 N  N9    . A   B  1 11  ? -2.485  38.621  26.936 1.00 24.43  ? 25  A   A N9    1 
ATOM   3658 C  C8    . A   B  1 11  ? -1.880  37.563  26.311 1.00 23.61  ? 25  A   A C8    1 
ATOM   3659 N  N7    . A   B  1 11  ? -1.621  36.555  27.110 1.00 23.36  ? 25  A   A N7    1 
ATOM   3660 C  C5    . A   B  1 11  ? -2.076  36.990  28.345 1.00 24.95  ? 25  A   A C5    1 
ATOM   3661 C  C6    . A   B  1 11  ? -2.087  36.380  29.613 1.00 26.03  ? 25  A   A C6    1 
ATOM   3662 N  N6    . A   B  1 11  ? -1.616  35.154  29.849 1.00 25.24  ? 25  A   A N6    1 
ATOM   3663 N  N1    . A   B  1 11  ? -2.596  37.093  30.640 1.00 26.33  ? 25  A   A N1    1 
ATOM   3664 C  C2    . A   B  1 11  ? -3.066  38.326  30.398 1.00 30.01  ? 25  A   A C2    1 
ATOM   3665 N  N3    . A   B  1 11  ? -3.120  39.007  29.251 1.00 26.92  ? 25  A   A N3    1 
ATOM   3666 C  C4    . A   B  1 11  ? -2.597  38.265  28.256 1.00 25.03  ? 25  A   A C4    1 
ATOM   3667 P  P     . G   B  1 12  ? 1.648   41.629  25.770 1.00 21.94  ? 26  G   A P     1 
ATOM   3668 O  OP1   . G   B  1 12  ? 2.212   42.994  25.792 1.00 22.12  ? 26  G   A OP1   1 
ATOM   3669 O  OP2   . G   B  1 12  ? 2.074   40.612  24.764 1.00 21.44  ? 26  G   A OP2   1 
ATOM   3670 O  "O5'" . G   B  1 12  ? 1.766   40.905  27.178 1.00 20.10  ? 26  G   A "O5'" 1 
ATOM   3671 C  "C5'" . G   B  1 12  ? 1.430   41.630  28.355 1.00 23.52  ? 26  G   A "C5'" 1 
ATOM   3672 C  "C4'" . G   B  1 12  ? 1.581   40.774  29.589 1.00 20.70  ? 26  G   A "C4'" 1 
ATOM   3673 O  "O4'" . G   B  1 12  ? 0.634   39.664  29.543 1.00 22.39  ? 26  G   A "O4'" 1 
ATOM   3674 C  "C3'" . G   B  1 12  ? 2.921   40.071  29.775 1.00 20.18  ? 26  G   A "C3'" 1 
ATOM   3675 O  "O3'" . G   B  1 12  ? 3.973   40.925  30.194 1.00 20.76  ? 26  G   A "O3'" 1 
ATOM   3676 C  "C2'" . G   B  1 12  ? 2.530   38.981  30.768 1.00 22.52  ? 26  G   A "C2'" 1 
ATOM   3677 O  "O2'" . G   B  1 12  ? 2.306   39.520  32.065 1.00 23.59  ? 26  G   A "O2'" 1 
ATOM   3678 C  "C1'" . G   B  1 12  ? 1.189   38.530  30.176 1.00 20.60  ? 26  G   A "C1'" 1 
ATOM   3679 N  N9    . G   B  1 12  ? 1.494   37.507  29.157 1.00 20.29  ? 26  G   A N9    1 
ATOM   3680 C  C8    . G   B  1 12  ? 1.590   37.685  27.793 1.00 20.04  ? 26  G   A C8    1 
ATOM   3681 N  N7    . G   B  1 12  ? 1.956   36.592  27.175 1.00 19.56  ? 26  G   A N7    1 
ATOM   3682 C  C5    . G   B  1 12  ? 2.126   35.644  28.185 1.00 18.84  ? 26  G   A C5    1 
ATOM   3683 C  C6    . G   B  1 12  ? 2.527   34.286  28.130 1.00 20.38  ? 26  G   A C6    1 
ATOM   3684 O  O6    . G   B  1 12  ? 2.812   33.585  27.143 1.00 20.38  ? 26  G   A O6    1 
ATOM   3685 N  N1    . G   B  1 12  ? 2.582   33.709  29.393 1.00 19.03  ? 26  G   A N1    1 
ATOM   3686 C  C2    . G   B  1 12  ? 2.290   34.357  30.562 1.00 19.13  ? 26  G   A C2    1 
ATOM   3687 N  N2    . G   B  1 12  ? 2.406   33.619  31.681 1.00 21.86  ? 26  G   A N2    1 
ATOM   3688 N  N3    . G   B  1 12  ? 1.918   35.622  30.630 1.00 20.38  ? 26  G   A N3    1 
ATOM   3689 C  C4    . G   B  1 12  ? 1.864   36.210  29.415 1.00 20.95  ? 26  G   A C4    1 
ATOM   3690 P  P     . G   B  1 13  ? 5.497   40.631  29.741 1.00 25.26  ? 27  G   A P     1 
ATOM   3691 O  OP1   . G   B  1 13  ? 6.281   41.800  30.188 1.00 22.40  ? 27  G   A OP1   1 
ATOM   3692 O  OP2   . G   B  1 13  ? 5.518   40.277  28.295 1.00 22.03  ? 27  G   A OP2   1 
ATOM   3693 O  "O5'" . G   B  1 13  ? 5.862   39.346  30.595 1.00 20.38  ? 27  G   A "O5'" 1 
ATOM   3694 C  "C5'" . G   B  1 13  ? 5.702   39.323  32.007 1.00 21.16  ? 27  G   A "C5'" 1 
ATOM   3695 C  "C4'" . G   B  1 13  ? 6.055   37.973  32.573 1.00 22.11  ? 27  G   A "C4'" 1 
ATOM   3696 O  "O4'" . G   B  1 13  ? 5.099   36.987  32.101 1.00 20.23  ? 27  G   A "O4'" 1 
ATOM   3697 C  "C3'" . G   B  1 13  ? 7.399   37.395  32.143 1.00 19.66  ? 27  G   A "C3'" 1 
ATOM   3698 O  "O3'" . G   B  1 13  ? 8.500   37.976  32.832 1.00 17.61  ? 27  G   A "O3'" 1 
ATOM   3699 C  "C2'" . G   B  1 13  ? 7.191   35.908  32.388 1.00 20.66  ? 27  G   A "C2'" 1 
ATOM   3700 O  "O2'" . G   B  1 13  ? 7.215   35.608  33.783 1.00 21.41  ? 27  G   A "O2'" 1 
ATOM   3701 C  "C1'" . G   B  1 13  ? 5.751   35.746  31.893 1.00 18.67  ? 27  G   A "C1'" 1 
ATOM   3702 N  N9    . G   B  1 13  ? 5.718   35.466  30.442 1.00 17.42  ? 27  G   A N9    1 
ATOM   3703 C  C8    . G   B  1 13  ? 5.390   36.365  29.436 1.00 19.74  ? 27  G   A C8    1 
ATOM   3704 N  N7    . G   B  1 13  ? 5.448   35.856  28.229 1.00 17.48  ? 27  G   A N7    1 
ATOM   3705 C  C5    . G   B  1 13  ? 5.847   34.547  28.456 1.00 17.14  ? 27  G   A C5    1 
ATOM   3706 C  C6    . G   B  1 13  ? 6.115   33.516  27.522 1.00 18.84  ? 27  G   A C6    1 
ATOM   3707 O  O6    . G   B  1 13  ? 6.004   33.569  26.288 1.00 16.95  ? 27  G   A O6    1 
ATOM   3708 N  N1    . G   B  1 13  ? 6.524   32.348  28.146 1.00 17.24  ? 27  G   A N1    1 
ATOM   3709 C  C2    . G   B  1 13  ? 6.665   32.202  29.510 1.00 17.98  ? 27  G   A C2    1 
ATOM   3710 N  N2    . G   B  1 13  ? 7.065   31.003  29.944 1.00 16.67  ? 27  G   A N2    1 
ATOM   3711 N  N3    . G   B  1 13  ? 6.425   33.160  30.399 1.00 19.05  ? 27  G   A N3    1 
ATOM   3712 C  C4    . G   B  1 13  ? 6.020   34.295  29.805 1.00 20.27  ? 27  G   A C4    1 
ATOM   3713 P  P     . U   B  1 14  ? 9.959   38.153  32.181 1.00 21.35  ? 28  U   A P     1 
ATOM   3714 O  OP1   . U   B  1 14  ? 10.770  38.802  33.248 1.00 19.12  ? 28  U   A OP1   1 
ATOM   3715 O  OP2   . U   B  1 14  ? 9.858   38.827  30.862 1.00 19.91  ? 28  U   A OP2   1 
ATOM   3716 O  "O5'" . U   B  1 14  ? 10.485  36.674  31.984 1.00 20.26  ? 28  U   A "O5'" 1 
ATOM   3717 C  "C5'" . U   B  1 14  ? 10.796  35.784  33.049 1.00 18.82  ? 28  U   A "C5'" 1 
ATOM   3718 C  "C4'" . U   B  1 14  ? 11.031  34.402  32.494 1.00 20.38  ? 28  U   A "C4'" 1 
ATOM   3719 O  "O4'" . U   B  1 14  ? 9.887   33.987  31.695 1.00 20.34  ? 28  U   A "O4'" 1 
ATOM   3720 C  "C3'" . U   B  1 14  ? 12.203  34.290  31.537 1.00 17.51  ? 28  U   A "C3'" 1 
ATOM   3721 O  "O3'" . U   B  1 14  ? 13.431  34.142  32.217 1.00 20.46  ? 28  U   A "O3'" 1 
ATOM   3722 C  "C2'" . U   B  1 14  ? 11.840  33.090  30.675 1.00 17.91  ? 28  U   A "C2'" 1 
ATOM   3723 O  "O2'" . U   B  1 14  ? 12.098  31.873  31.359 1.00 17.64  ? 28  U   A "O2'" 1 
ATOM   3724 C  "C1'" . U   B  1 14  ? 10.326  33.242  30.578 1.00 18.12  ? 28  U   A "C1'" 1 
ATOM   3725 N  N1    . U   B  1 14  ? 9.852   33.911  29.345 1.00 16.41  ? 28  U   A N1    1 
ATOM   3726 C  C2    . U   B  1 14  ? 9.837   33.126  28.210 1.00 18.68  ? 28  U   A C2    1 
ATOM   3727 O  O2    . U   B  1 14  ? 10.225  31.965  28.215 1.00 16.96  ? 28  U   A O2    1 
ATOM   3728 N  N3    . U   B  1 14  ? 9.369   33.763  27.090 1.00 15.89  ? 28  U   A N3    1 
ATOM   3729 C  C4    . U   B  1 14  ? 8.922   35.069  27.036 1.00 19.02  ? 28  U   A C4    1 
ATOM   3730 O  O4    . U   B  1 14  ? 8.513   35.503  25.976 1.00 17.39  ? 28  U   A O4    1 
ATOM   3731 C  C5    . U   B  1 14  ? 8.962   35.823  28.255 1.00 19.02  ? 28  U   A C5    1 
ATOM   3732 C  C6    . U   B  1 14  ? 9.422   35.216  29.353 1.00 16.25  ? 28  U   A C6    1 
ATOM   3733 P  P     . G   B  1 15  ? 14.792  34.659  31.564 1.00 21.12  ? 29  G   A P     1 
ATOM   3734 O  OP1   . G   B  1 15  ? 15.805  34.200  32.548 1.00 23.27  ? 29  G   A OP1   1 
ATOM   3735 O  OP2   . G   B  1 15  ? 14.681  36.103  31.262 1.00 17.31  ? 29  G   A OP2   1 
ATOM   3736 O  "O5'" . G   B  1 15  ? 14.922  33.902  30.158 1.00 19.39  ? 29  G   A "O5'" 1 
ATOM   3737 C  "C5'" . G   B  1 15  ? 15.069  32.492  29.994 1.00 20.68  ? 29  G   A "C5'" 1 
ATOM   3738 C  "C4'" . G   B  1 15  ? 15.356  32.186  28.542 1.00 21.78  ? 29  G   A "C4'" 1 
ATOM   3739 O  "O4'" . G   B  1 15  ? 14.212  32.642  27.767 1.00 20.38  ? 29  G   A "O4'" 1 
ATOM   3740 C  "C3'" . G   B  1 15  ? 16.564  32.941  27.992 1.00 20.45  ? 29  G   A "C3'" 1 
ATOM   3741 O  "O3'" . G   B  1 15  ? 17.137  32.213  26.912 1.00 21.12  ? 29  G   A "O3'" 1 
ATOM   3742 C  "C2'" . G   B  1 15  ? 15.919  34.212  27.455 1.00 22.42  ? 29  G   A "C2'" 1 
ATOM   3743 O  "O2'" . G   B  1 15  ? 16.661  34.910  26.472 1.00 21.97  ? 29  G   A "O2'" 1 
ATOM   3744 C  "C1'" . G   B  1 15  ? 14.588  33.694  26.916 1.00 16.82  ? 29  G   A "C1'" 1 
ATOM   3745 N  N9    . G   B  1 15  ? 13.583  34.758  26.914 1.00 18.71  ? 29  G   A N9    1 
ATOM   3746 C  C8    . G   B  1 15  ? 13.362  35.678  27.918 1.00 17.83  ? 29  G   A C8    1 
ATOM   3747 N  N7    . G   B  1 15  ? 12.438  36.548  27.613 1.00 19.14  ? 29  G   A N7    1 
ATOM   3748 C  C5    . G   B  1 15  ? 12.064  36.214  26.323 1.00 17.31  ? 29  G   A C5    1 
ATOM   3749 C  C6    . G   B  1 15  ? 11.112  36.816  25.469 1.00 18.00  ? 29  G   A C6    1 
ATOM   3750 O  O6    . G   B  1 15  ? 10.402  37.804  25.698 1.00 16.62  ? 29  G   A O6    1 
ATOM   3751 N  N1    . G   B  1 15  ? 11.031  36.141  24.249 1.00 16.08  ? 29  G   A N1    1 
ATOM   3752 C  C2    . G   B  1 15  ? 11.785  35.044  23.898 1.00 17.22  ? 29  G   A C2    1 
ATOM   3753 N  N2    . G   B  1 15  ? 11.588  34.531  22.673 1.00 15.77  ? 29  G   A N2    1 
ATOM   3754 N  N3    . G   B  1 15  ? 12.669  34.482  24.697 1.00 15.63  ? 29  G   A N3    1 
ATOM   3755 C  C4    . G   B  1 15  ? 12.763  35.116  25.873 1.00 16.34  ? 29  G   A C4    1 
ATOM   3756 P  P     . A   B  1 16  ? 18.494  31.396  27.109 1.00 36.46  ? 30  A   A P     1 
ATOM   3757 O  OP1   . A   B  1 16  ? 18.040  30.060  27.581 1.00 29.51  ? 30  A   A OP1   1 
ATOM   3758 O  OP2   . A   B  1 16  ? 19.444  32.175  27.933 1.00 29.06  ? 30  A   A OP2   1 
ATOM   3759 O  "O5'" . A   B  1 16  ? 19.003  31.359  25.584 1.00 24.23  ? 30  A   A "O5'" 1 
ATOM   3760 C  "C5'" . A   B  1 16  ? 19.467  30.114  25.113 1.00 21.65  ? 30  A   A "C5'" 1 
ATOM   3761 C  "C4'" . A   B  1 16  ? 19.257  29.959  23.634 1.00 21.12  ? 30  A   A "C4'" 1 
ATOM   3762 O  "O4'" . A   B  1 16  ? 17.847  30.018  23.300 1.00 18.98  ? 30  A   A "O4'" 1 
ATOM   3763 C  "C3'" . A   B  1 16  ? 19.887  31.018  22.752 1.00 17.16  ? 30  A   A "C3'" 1 
ATOM   3764 O  "O3'" . A   B  1 16  ? 21.294  30.852  22.630 1.00 17.68  ? 30  A   A "O3'" 1 
ATOM   3765 C  "C2'" . A   B  1 16  ? 19.135  30.759  21.456 1.00 17.21  ? 30  A   A "C2'" 1 
ATOM   3766 O  "O2'" . A   B  1 16  ? 19.629  29.555  20.894 1.00 19.61  ? 30  A   A "O2'" 1 
ATOM   3767 C  "C1'" . A   B  1 16  ? 17.714  30.514  21.984 1.00 18.66  ? 30  A   A "C1'" 1 
ATOM   3768 N  N9    . A   B  1 16  ? 16.961  31.782  21.994 1.00 16.27  ? 30  A   A N9    1 
ATOM   3769 C  C8    . A   B  1 16  ? 16.684  32.655  23.026 1.00 18.93  ? 30  A   A C8    1 
ATOM   3770 N  N7    . A   B  1 16  ? 16.027  33.731  22.641 1.00 17.13  ? 30  A   A N7    1 
ATOM   3771 C  C5    . A   B  1 16  ? 15.870  33.548  21.265 1.00 16.51  ? 30  A   A C5    1 
ATOM   3772 C  C6    . A   B  1 16  ? 15.262  34.315  20.256 1.00 17.29  ? 30  A   A C6    1 
ATOM   3773 N  N6    . A   B  1 16  ? 14.663  35.473  20.510 1.00 15.21  ? 30  A   A N6    1 
ATOM   3774 N  N1    . A   B  1 16  ? 15.290  33.838  18.982 1.00 16.94  ? 30  A   A N1    1 
ATOM   3775 C  C2    . A   B  1 16  ? 15.903  32.675  18.746 1.00 17.41  ? 30  A   A C2    1 
ATOM   3776 N  N3    . A   B  1 16  ? 16.517  31.874  19.610 1.00 16.41  ? 30  A   A N3    1 
ATOM   3777 C  C4    . A   B  1 16  ? 16.457  32.369  20.858 1.00 16.99  ? 30  A   A C4    1 
ATOM   3778 P  P     . G   B  1 17  ? 22.241  32.131  22.559 1.00 19.33  ? 31  G   A P     1 
ATOM   3779 O  OP1   . G   B  1 17  ? 23.612  31.591  22.385 1.00 19.20  ? 31  G   A OP1   1 
ATOM   3780 O  OP2   . G   B  1 17  ? 21.919  32.985  23.733 1.00 17.99  ? 31  G   A OP2   1 
ATOM   3781 O  "O5'" . G   B  1 17  ? 21.718  32.899  21.274 1.00 16.57  ? 31  G   A "O5'" 1 
ATOM   3782 C  "C5'" . G   B  1 17  ? 21.808  32.310  19.990 1.00 18.33  ? 31  G   A "C5'" 1 
ATOM   3783 C  "C4'" . G   B  1 17  ? 21.059  33.136  18.979 1.00 19.90  ? 31  G   A "C4'" 1 
ATOM   3784 O  "O4'" . G   B  1 17  ? 19.659  33.217  19.341 1.00 17.28  ? 31  G   A "O4'" 1 
ATOM   3785 C  "C3'" . G   B  1 17  ? 21.482  34.587  18.847 1.00 15.46  ? 31  G   A "C3'" 1 
ATOM   3786 O  "O3'" . G   B  1 17  ? 22.643  34.730  18.054 1.00 18.29  ? 31  G   A "O3'" 1 
ATOM   3787 C  "C2'" . G   B  1 17  ? 20.233  35.207  18.232 1.00 17.52  ? 31  G   A "C2'" 1 
ATOM   3788 O  "O2'" . G   B  1 17  ? 20.111  34.846  16.870 1.00 17.51  ? 31  G   A "O2'" 1 
ATOM   3789 C  "C1'" . G   B  1 17  ? 19.138  34.478  19.012 1.00 14.34  ? 31  G   A "C1'" 1 
ATOM   3790 N  N9    . G   B  1 17  ? 18.885  35.228  20.251 1.00 15.78  ? 31  G   A N9    1 
ATOM   3791 C  C8    . G   B  1 17  ? 19.339  34.940  21.526 1.00 18.29  ? 31  G   A C8    1 
ATOM   3792 N  N7    . G   B  1 17  ? 18.956  35.838  22.414 1.00 17.52  ? 31  G   A N7    1 
ATOM   3793 C  C5    . G   B  1 17  ? 18.251  36.773  21.672 1.00 15.54  ? 31  G   A C5    1 
ATOM   3794 C  C6    . G   B  1 17  ? 17.627  37.972  22.075 1.00 16.65  ? 31  G   A C6    1 
ATOM   3795 O  O6    . G   B  1 17  ? 17.566  38.443  23.217 1.00 16.05  ? 31  G   A O6    1 
ATOM   3796 N  N1    . G   B  1 17  ? 17.003  38.620  21.012 1.00 16.76  ? 31  G   A N1    1 
ATOM   3797 C  C2    . G   B  1 17  ? 16.996  38.183  19.714 1.00 15.89  ? 31  G   A C2    1 
ATOM   3798 N  N2    . G   B  1 17  ? 16.340  38.959  18.818 1.00 15.61  ? 31  G   A N2    1 
ATOM   3799 N  N3    . G   B  1 17  ? 17.594  37.077  19.322 1.00 15.83  ? 31  G   A N3    1 
ATOM   3800 C  C4    . G   B  1 17  ? 18.197  36.417  20.337 1.00 15.62  ? 31  G   A C4    1 
ATOM   3801 P  P     . G   B  1 18  ? 23.838  35.739  18.489 1.00 19.56  ? 32  G   A P     1 
ATOM   3802 O  OP1   . G   B  1 18  ? 24.868  35.458  17.452 1.00 16.32  ? 32  G   A OP1   1 
ATOM   3803 O  OP2   . G   B  1 18  ? 24.111  35.612  19.924 1.00 19.54  ? 32  G   A OP2   1 
ATOM   3804 O  "O5'" . G   B  1 18  ? 23.234  37.186  18.253 1.00 17.77  ? 32  G   A "O5'" 1 
ATOM   3805 C  "C5'" . G   B  1 18  ? 22.914  37.564  16.929 1.00 17.24  ? 32  G   A "C5'" 1 
ATOM   3806 C  "C4'" . G   B  1 18  ? 22.000  38.758  16.937 1.00 19.12  ? 32  G   A "C4'" 1 
ATOM   3807 O  "O4'" . G   B  1 18  ? 20.797  38.465  17.692 1.00 15.68  ? 32  G   A "O4'" 1 
ATOM   3808 C  "C3'" . G   B  1 18  ? 22.544  40.015  17.602 1.00 16.54  ? 32  G   A "C3'" 1 
ATOM   3809 O  "O3'" . G   B  1 18  ? 23.479  40.700  16.776 1.00 15.87  ? 32  G   A "O3'" 1 
ATOM   3810 C  "C2'" . G   B  1 18  ? 21.250  40.780  17.833 1.00 15.80  ? 32  G   A "C2'" 1 
ATOM   3811 O  "O2'" . G   B  1 18  ? 20.766  41.282  16.596 1.00 16.92  ? 32  G   A "O2'" 1 
ATOM   3812 C  "C1'" . G   B  1 18  ? 20.336  39.646  18.315 1.00 18.06  ? 32  G   A "C1'" 1 
ATOM   3813 N  N9    . G   B  1 18  ? 20.501  39.461  19.769 1.00 15.82  ? 32  G   A N9    1 
ATOM   3814 C  C8    . G   B  1 18  ? 21.146  38.423  20.396 1.00 17.88  ? 32  G   A C8    1 
ATOM   3815 N  N7    . G   B  1 18  ? 21.156  38.541  21.699 1.00 16.17  ? 32  G   A N7    1 
ATOM   3816 C  C5    . G   B  1 18  ? 20.492  39.733  21.953 1.00 16.34  ? 32  G   A C5    1 
ATOM   3817 C  C6    . G   B  1 18  ? 20.205  40.395  23.184 1.00 17.11  ? 32  G   A C6    1 
ATOM   3818 O  O6    . G   B  1 18  ? 20.480  40.053  24.351 1.00 18.28  ? 32  G   A O6    1 
ATOM   3819 N  N1    . G   B  1 18  ? 19.535  41.588  22.969 1.00 16.36  ? 32  G   A N1    1 
ATOM   3820 C  C2    . G   B  1 18  ? 19.166  42.094  21.750 1.00 18.93  ? 32  G   A C2    1 
ATOM   3821 N  N2    . G   B  1 18  ? 18.527  43.276  21.771 1.00 15.77  ? 32  G   A N2    1 
ATOM   3822 N  N3    . G   B  1 18  ? 19.424  41.490  20.595 1.00 17.31  ? 32  G   A N3    1 
ATOM   3823 C  C4    . G   B  1 18  ? 20.092  40.324  20.769 1.00 16.93  ? 32  G   A C4    1 
ATOM   3824 P  P     . C   B  1 19  ? 24.575  41.705  17.378 1.00 21.10  ? 33  C   A P     1 
ATOM   3825 O  OP1   . C   B  1 19  ? 25.336  42.102  16.167 1.00 19.65  ? 33  C   A OP1   1 
ATOM   3826 O  OP2   . C   B  1 19  ? 25.194  41.039  18.551 1.00 21.03  ? 33  C   A OP2   1 
ATOM   3827 O  "O5'" . C   B  1 19  ? 23.731  42.933  17.887 1.00 18.96  ? 33  C   A "O5'" 1 
ATOM   3828 C  "C5'" . C   B  1 19  ? 22.958  43.708  16.980 1.00 20.59  ? 33  C   A "C5'" 1 
ATOM   3829 C  "C4'" . C   B  1 19  ? 22.259  44.816  17.717 1.00 21.27  ? 33  C   A "C4'" 1 
ATOM   3830 O  "O4'" . C   B  1 19  ? 21.358  44.241  18.705 1.00 19.17  ? 33  C   A "O4'" 1 
ATOM   3831 C  "C3'" . C   B  1 19  ? 23.161  45.741  18.526 1.00 18.92  ? 33  C   A "C3'" 1 
ATOM   3832 O  "O3'" . C   B  1 19  ? 23.754  46.757  17.741 1.00 22.16  ? 33  C   A "O3'" 1 
ATOM   3833 C  "C2'" . C   B  1 19  ? 22.203  46.297  19.558 1.00 20.42  ? 33  C   A "C2'" 1 
ATOM   3834 O  "O2'" . C   B  1 19  ? 21.404  47.305  18.956 1.00 20.18  ? 33  C   A "O2'" 1 
ATOM   3835 C  "C1'" . C   B  1 19  ? 21.330  45.075  19.844 1.00 19.25  ? 33  C   A "C1'" 1 
ATOM   3836 N  N1    . C   B  1 19  ? 21.765  44.277  21.016 1.00 18.93  ? 33  C   A N1    1 
ATOM   3837 C  C2    . C   B  1 19  ? 21.493  44.801  22.275 1.00 19.85  ? 33  C   A C2    1 
ATOM   3838 O  O2    . C   B  1 19  ? 20.931  45.893  22.328 1.00 17.37  ? 33  C   A O2    1 
ATOM   3839 N  N3    . C   B  1 19  ? 21.860  44.122  23.382 1.00 19.69  ? 33  C   A N3    1 
ATOM   3840 C  C4    . C   B  1 19  ? 22.455  42.942  23.261 1.00 18.58  ? 33  C   A C4    1 
ATOM   3841 N  N4    . C   B  1 19  ? 22.781  42.291  24.384 1.00 17.04  ? 33  C   A N4    1 
ATOM   3842 C  C5    . C   B  1 19  ? 22.742  42.374  21.988 1.00 17.73  ? 33  C   A C5    1 
ATOM   3843 C  C6    . C   B  1 19  ? 22.387  43.079  20.904 1.00 16.58  ? 33  C   A C6    1 
ATOM   3844 P  P     . U   B  1 20  ? 25.237  47.300  18.072 1.00 24.28  ? 34  U   A P     1 
ATOM   3845 O  OP1   . U   B  1 20  ? 25.412  48.406  17.113 1.00 22.87  ? 34  U   A OP1   1 
ATOM   3846 O  OP2   . U   B  1 20  ? 26.188  46.180  18.098 1.00 22.67  ? 34  U   A OP2   1 
ATOM   3847 O  "O5'" . U   B  1 20  ? 25.079  47.900  19.545 1.00 21.09  ? 34  U   A "O5'" 1 
ATOM   3848 C  "C5'" . U   B  1 20  ? 24.137  48.923  19.827 1.00 22.66  ? 34  U   A "C5'" 1 
ATOM   3849 C  "C4'" . U   B  1 20  ? 24.409  49.545  21.172 1.00 22.04  ? 34  U   A "C4'" 1 
ATOM   3850 O  "O4'" . U   B  1 20  ? 23.965  48.636  22.217 1.00 23.50  ? 34  U   A "O4'" 1 
ATOM   3851 C  "C3'" . U   B  1 20  ? 25.884  49.847  21.439 1.00 25.22  ? 34  U   A "C3'" 1 
ATOM   3852 O  "O3'" . U   B  1 20  ? 26.007  51.099  22.124 1.00 28.38  ? 34  U   A "O3'" 1 
ATOM   3853 C  "C2'" . U   B  1 20  ? 26.310  48.693  22.340 1.00 26.31  ? 34  U   A "C2'" 1 
ATOM   3854 O  "O2'" . U   B  1 20  ? 27.382  49.009  23.209 1.00 27.42  ? 34  U   A "O2'" 1 
ATOM   3855 C  "C1'" . U   B  1 20  ? 25.025  48.365  23.105 1.00 22.81  ? 34  U   A "C1'" 1 
ATOM   3856 N  N1    . U   B  1 20  ? 25.104  46.949  23.515 1.00 22.90  ? 34  U   A N1    1 
ATOM   3857 C  C2    . U   B  1 20  ? 24.962  46.659  24.859 1.00 21.48  ? 34  U   A C2    1 
ATOM   3858 O  O2    . U   B  1 20  ? 24.710  47.508  25.703 1.00 21.91  ? 34  U   A O2    1 
ATOM   3859 N  N3    . U   B  1 20  ? 25.104  45.333  25.179 1.00 20.94  ? 34  U   A N3    1 
ATOM   3860 C  C4    . U   B  1 20  ? 25.388  44.297  24.310 1.00 19.91  ? 34  U   A C4    1 
ATOM   3861 O  O4    . U   B  1 20  ? 25.503  43.162  24.749 1.00 20.87  ? 34  U   A O4    1 
ATOM   3862 C  C5    . U   B  1 20  ? 25.525  44.676  22.937 1.00 21.40  ? 34  U   A C5    1 
ATOM   3863 C  C6    . U   B  1 20  ? 25.389  45.963  22.598 1.00 22.07  ? 34  U   A C6    1 
ATOM   3864 P  P     . C   B  1 21  ? 26.328  52.427  21.259 1.00 31.29  ? 35  C   A P     1 
ATOM   3865 O  OP1   . C   B  1 21  ? 26.677  51.956  19.901 1.00 37.52  ? 35  C   A OP1   1 
ATOM   3866 O  OP2   . C   B  1 21  ? 27.309  53.118  22.115 1.00 31.19  ? 35  C   A OP2   1 
ATOM   3867 O  "O5'" . C   B  1 21  ? 25.031  53.284  21.115 1.00 32.65  ? 35  C   A "O5'" 1 
ATOM   3868 C  "C5'" . C   B  1 21  ? 24.206  53.333  22.247 1.00 30.33  ? 35  C   A "C5'" 1 
ATOM   3869 C  "C4'" . C   B  1 21  ? 23.804  54.730  22.601 1.00 28.58  ? 35  C   A "C4'" 1 
ATOM   3870 O  "O4'" . C   B  1 21  ? 22.486  54.525  23.160 1.00 30.86  ? 35  C   A "O4'" 1 
ATOM   3871 C  "C3'" . C   B  1 21  ? 24.667  55.357  23.700 1.00 30.15  ? 35  C   A "C3'" 1 
ATOM   3872 O  "O3'" . C   B  1 21  ? 25.305  56.594  23.356 1.00 31.04  ? 35  C   A "O3'" 1 
ATOM   3873 C  "C2'" . C   B  1 21  ? 23.732  55.536  24.893 1.00 29.23  ? 35  C   A "C2'" 1 
ATOM   3874 O  "O2'" . C   B  1 21  ? 23.356  56.890  25.048 1.00 29.01  ? 35  C   A "O2'" 1 
ATOM   3875 C  "C1'" . C   B  1 21  ? 22.484  54.731  24.550 1.00 28.65  ? 35  C   A "C1'" 1 
ATOM   3876 N  N1    . C   B  1 21  ? 22.778  53.398  25.160 1.00 27.96  ? 35  C   A N1    1 
ATOM   3877 C  C2    . C   B  1 21  ? 22.776  53.294  26.551 1.00 27.10  ? 35  C   A C2    1 
ATOM   3878 O  O2    . C   B  1 21  ? 22.502  54.307  27.205 1.00 27.94  ? 35  C   A O2    1 
ATOM   3879 N  N3    . C   B  1 21  ? 23.068  52.114  27.155 1.00 24.89  ? 35  C   A N3    1 
ATOM   3880 C  C4    . C   B  1 21  ? 23.364  51.038  26.434 1.00 26.63  ? 35  C   A C4    1 
ATOM   3881 N  N4    . C   B  1 21  ? 23.653  49.903  27.092 1.00 26.30  ? 35  C   A N4    1 
ATOM   3882 C  C5    . C   B  1 21  ? 23.384  51.099  25.009 1.00 24.80  ? 35  C   A C5    1 
ATOM   3883 C  C6    . C   B  1 21  ? 23.093  52.279  24.434 1.00 26.22  ? 35  C   A C6    1 
ATOM   3884 P  P     . C   B  1 22  ? 26.838  56.831  23.859 1.00 31.14  ? 36  C   A P     1 
ATOM   3885 O  OP1   . C   B  1 22  ? 27.109  58.278  23.635 1.00 35.01  ? 36  C   A OP1   1 
ATOM   3886 O  OP2   . C   B  1 22  ? 27.723  55.838  23.223 1.00 33.34  ? 36  C   A OP2   1 
ATOM   3887 O  "O5'" . C   B  1 22  ? 26.878  56.484  25.407 1.00 28.21  ? 36  C   A "O5'" 1 
ATOM   3888 C  "C5'" . C   B  1 22  ? 26.394  57.389  26.391 1.00 31.26  ? 36  C   A "C5'" 1 
ATOM   3889 C  "C4'" . C   B  1 22  ? 26.441  56.752  27.759 1.00 28.57  ? 36  C   A "C4'" 1 
ATOM   3890 O  "O4'" . C   B  1 22  ? 25.590  55.580  27.775 1.00 27.21  ? 36  C   A "O4'" 1 
ATOM   3891 C  "C3'" . C   B  1 22  ? 27.793  56.222  28.208 1.00 28.84  ? 36  C   A "C3'" 1 
ATOM   3892 O  "O3'" . C   B  1 22  ? 28.608  57.229  28.764 1.00 30.31  ? 36  C   A "O3'" 1 
ATOM   3893 C  "C2'" . C   B  1 22  ? 27.418  55.149  29.222 1.00 28.82  ? 36  C   A "C2'" 1 
ATOM   3894 O  "O2'" . C   B  1 22  ? 27.022  55.729  30.454 1.00 30.38  ? 36  C   A "O2'" 1 
ATOM   3895 C  "C1'" . C   B  1 22  ? 26.163  54.573  28.582 1.00 28.02  ? 36  C   A "C1'" 1 
ATOM   3896 N  N1    . C   B  1 22  ? 26.453  53.377  27.784 1.00 21.82  ? 36  C   A N1    1 
ATOM   3897 C  C2    . C   B  1 22  ? 26.689  52.182  28.473 1.00 26.85  ? 36  C   A C2    1 
ATOM   3898 O  O2    . C   B  1 22  ? 26.667  52.193  29.717 1.00 23.82  ? 36  C   A O2    1 
ATOM   3899 N  N3    . C   B  1 22  ? 26.947  51.051  27.772 1.00 26.26  ? 36  C   A N3    1 
ATOM   3900 C  C4    . C   B  1 22  ? 26.973  51.088  26.432 1.00 27.54  ? 36  C   A C4    1 
ATOM   3901 N  N4    . C   B  1 22  ? 27.232  49.946  25.778 1.00 23.96  ? 36  C   A N4    1 
ATOM   3902 C  C5    . C   B  1 22  ? 26.730  52.295  25.708 1.00 25.00  ? 36  C   A C5    1 
ATOM   3903 C  C6    . C   B  1 22  ? 26.481  53.405  26.418 1.00 27.05  ? 36  C   A C6    1 
ATOM   3904 P  P     . U   B  1 23  ? 30.188  57.222  28.519 1.00 32.35  ? 37  U   A P     1 
ATOM   3905 O  OP1   . U   B  1 23  ? 30.585  58.537  29.098 1.00 35.51  ? 37  U   A OP1   1 
ATOM   3906 O  OP2   . U   B  1 23  ? 30.464  56.922  27.094 1.00 30.72  ? 37  U   A OP2   1 
ATOM   3907 O  "O5'" . U   B  1 23  ? 30.746  56.043  29.422 1.00 29.63  ? 37  U   A "O5'" 1 
ATOM   3908 C  "C5'" . U   B  1 23  ? 30.672  56.059  30.838 1.00 29.37  ? 37  U   A "C5'" 1 
ATOM   3909 C  "C4'" . U   B  1 23  ? 31.226  54.773  31.384 1.00 26.93  ? 37  U   A "C4'" 1 
ATOM   3910 O  "O4'" . U   B  1 23  ? 30.332  53.679  31.048 1.00 27.46  ? 37  U   A "O4'" 1 
ATOM   3911 C  "C3'" . U   B  1 23  ? 32.551  54.311  30.793 1.00 27.30  ? 37  U   A "C3'" 1 
ATOM   3912 O  "O3'" . U   B  1 23  ? 33.684  54.992  31.296 1.00 28.98  ? 37  U   A "O3'" 1 
ATOM   3913 C  "C2'" . U   B  1 23  ? 32.544  52.830  31.126 1.00 25.25  ? 37  U   A "C2'" 1 
ATOM   3914 O  "O2'" . U   B  1 23  ? 32.748  52.641  32.518 1.00 24.54  ? 37  U   A "O2'" 1 
ATOM   3915 C  "C1'" . U   B  1 23  ? 31.086  52.502  30.838 1.00 25.92  ? 37  U   A "C1'" 1 
ATOM   3916 N  N1    . U   B  1 23  ? 30.893  51.974  29.473 1.00 24.48  ? 37  U   A N1    1 
ATOM   3917 C  C2    . U   B  1 23  ? 31.263  50.654  29.280 1.00 24.25  ? 37  U   A C2    1 
ATOM   3918 O  O2    . U   B  1 23  ? 31.746  49.939  30.157 1.00 22.43  ? 37  U   A O2    1 
ATOM   3919 N  N3    . U   B  1 23  ? 31.052  50.199  28.005 1.00 23.81  ? 37  U   A N3    1 
ATOM   3920 C  C4    . U   B  1 23  ? 30.523  50.904  26.942 1.00 23.02  ? 37  U   A C4    1 
ATOM   3921 O  O4    . U   B  1 23  ? 30.409  50.325  25.863 1.00 24.59  ? 37  U   A O4    1 
ATOM   3922 C  C5    . U   B  1 23  ? 30.165  52.267  27.216 1.00 24.69  ? 37  U   A C5    1 
ATOM   3923 C  C6    . U   B  1 23  ? 30.362  52.746  28.458 1.00 26.43  ? 37  U   A C6    1 
ATOM   3924 P  P     . G   B  1 24  ? 34.968  55.152  30.346 1.00 29.16  ? 38  G   A P     1 
ATOM   3925 O  OP1   . G   B  1 24  ? 35.667  56.292  30.995 1.00 34.40  ? 38  G   A OP1   1 
ATOM   3926 O  OP2   . G   B  1 24  ? 34.533  55.284  28.929 1.00 30.97  ? 38  G   A OP2   1 
ATOM   3927 O  "O5'" . G   B  1 24  ? 35.795  53.795  30.524 1.00 26.02  ? 38  G   A "O5'" 1 
ATOM   3928 C  "C5'" . G   B  1 24  ? 36.450  53.483  31.748 1.00 25.14  ? 38  G   A "C5'" 1 
ATOM   3929 C  "C4'" . G   B  1 24  ? 36.870  52.036  31.815 1.00 25.41  ? 38  G   A "C4'" 1 
ATOM   3930 O  "O4'" . G   B  1 24  ? 35.725  51.179  31.550 1.00 26.27  ? 38  G   A "O4'" 1 
ATOM   3931 C  "C3'" . G   B  1 24  ? 37.897  51.581  30.790 1.00 24.00  ? 38  G   A "C3'" 1 
ATOM   3932 O  "O3'" . G   B  1 24  ? 39.224  51.965  31.101 1.00 24.99  ? 38  G   A "O3'" 1 
ATOM   3933 C  "C2'" . G   B  1 24  ? 37.684  50.074  30.786 1.00 25.38  ? 38  G   A "C2'" 1 
ATOM   3934 O  "O2'" . G   B  1 24  ? 38.232  49.490  31.961 1.00 24.07  ? 38  G   A "O2'" 1 
ATOM   3935 C  "C1'" . G   B  1 24  ? 36.157  50.010  30.888 1.00 25.50  ? 38  G   A "C1'" 1 
ATOM   3936 N  N9    . G   B  1 24  ? 35.552  49.961  29.548 1.00 25.99  ? 38  G   A N9    1 
ATOM   3937 C  C8    . G   B  1 24  ? 34.960  50.980  28.841 1.00 27.95  ? 38  G   A C8    1 
ATOM   3938 N  N7    . G   B  1 24  ? 34.531  50.597  27.664 1.00 23.38  ? 38  G   A N7    1 
ATOM   3939 C  C5    . G   B  1 24  ? 34.862  49.246  27.588 1.00 22.97  ? 38  G   A C5    1 
ATOM   3940 C  C6    . G   B  1 24  ? 34.648  48.292  26.546 1.00 26.00  ? 38  G   A C6    1 
ATOM   3941 O  O6    . G   B  1 24  ? 34.102  48.461  25.444 1.00 25.33  ? 38  G   A O6    1 
ATOM   3942 N  N1    . G   B  1 24  ? 35.135  47.027  26.885 1.00 24.35  ? 38  G   A N1    1 
ATOM   3943 C  C2    . G   B  1 24  ? 35.754  46.720  28.075 1.00 24.05  ? 38  G   A C2    1 
ATOM   3944 N  N2    . G   B  1 24  ? 36.165  45.450  28.209 1.00 23.33  ? 38  G   A N2    1 
ATOM   3945 N  N3    . G   B  1 24  ? 35.963  47.604  29.054 1.00 24.13  ? 38  G   A N3    1 
ATOM   3946 C  C4    . G   B  1 24  ? 35.490  48.835  28.743 1.00 25.79  ? 38  G   A C4    1 
ATOM   3947 P  P     . U   B  1 25  ? 40.267  52.273  29.921 1.00 31.43  ? 39  U   A P     1 
ATOM   3948 O  OP1   . U   B  1 25  ? 41.474  52.795  30.616 1.00 33.78  ? 39  U   A OP1   1 
ATOM   3949 O  OP2   . U   B  1 25  ? 39.627  53.080  28.854 1.00 29.14  ? 39  U   A OP2   1 
ATOM   3950 O  "O5'" . U   B  1 25  ? 40.579  50.839  29.335 1.00 27.15  ? 39  U   A "O5'" 1 
ATOM   3951 C  "C5'" . U   B  1 25  ? 41.187  49.854  30.150 1.00 29.26  ? 39  U   A "C5'" 1 
ATOM   3952 C  "C4'" . U   B  1 25  ? 41.308  48.564  29.393 1.00 28.09  ? 39  U   A "C4'" 1 
ATOM   3953 O  "O4'" . U   B  1 25  ? 39.982  48.079  29.070 1.00 26.88  ? 39  U   A "O4'" 1 
ATOM   3954 C  "C3'" . U   B  1 25  ? 41.984  48.654  28.036 1.00 28.39  ? 39  U   A "C3'" 1 
ATOM   3955 O  "O3'" . U   B  1 25  ? 43.393  48.739  28.112 1.00 29.12  ? 39  U   A "O3'" 1 
ATOM   3956 C  "C2'" . U   B  1 25  ? 41.473  47.390  27.362 1.00 29.10  ? 39  U   A "C2'" 1 
ATOM   3957 O  "O2'" . U   B  1 25  ? 42.114  46.247  27.910 1.00 30.17  ? 39  U   A "O2'" 1 
ATOM   3958 C  "C1'" . U   B  1 25  ? 40.021  47.385  27.842 1.00 27.28  ? 39  U   A "C1'" 1 
ATOM   3959 N  N1    . U   B  1 25  ? 39.098  48.039  26.891 1.00 25.11  ? 39  U   A N1    1 
ATOM   3960 C  C2    . U   B  1 25  ? 38.745  47.290  25.797 1.00 28.42  ? 39  U   A C2    1 
ATOM   3961 O  O2    . U   B  1 25  ? 39.180  46.165  25.640 1.00 26.77  ? 39  U   A O2    1 
ATOM   3962 N  N3    . U   B  1 25  ? 37.877  47.898  24.920 1.00 27.70  ? 39  U   A N3    1 
ATOM   3963 C  C4    . U   B  1 25  ? 37.353  49.166  25.046 1.00 26.83  ? 39  U   A C4    1 
ATOM   3964 O  O4    . U   B  1 25  ? 36.596  49.593  24.172 1.00 28.76  ? 39  U   A O4    1 
ATOM   3965 C  C5    . U   B  1 25  ? 37.770  49.880  26.213 1.00 26.82  ? 39  U   A C5    1 
ATOM   3966 C  C6    . U   B  1 25  ? 38.612  49.307  27.082 1.00 27.01  ? 39  U   A C6    1 
ATOM   3967 P  P     . A   B  1 26  ? 44.247  49.439  26.937 1.00 33.79  ? 40  A   A P     1 
ATOM   3968 O  OP1   . A   B  1 26  ? 45.611  49.526  27.505 1.00 37.42  ? 40  A   A OP1   1 
ATOM   3969 O  OP2   . A   B  1 26  ? 43.579  50.683  26.487 1.00 32.58  ? 40  A   A OP2   1 
ATOM   3970 O  "O5'" . A   B  1 26  ? 44.230  48.391  25.744 1.00 31.85  ? 40  A   A "O5'" 1 
ATOM   3971 C  "C5'" . A   B  1 26  ? 44.800  47.099  25.873 1.00 30.99  ? 40  A   A "C5'" 1 
ATOM   3972 C  "C4'" . A   B  1 26  ? 44.512  46.276  24.650 1.00 33.35  ? 40  A   A "C4'" 1 
ATOM   3973 O  "O4'" . A   B  1 26  ? 43.091  45.999  24.552 1.00 33.46  ? 40  A   A "O4'" 1 
ATOM   3974 C  "C3'" . A   B  1 26  ? 44.854  46.944  23.327 1.00 33.87  ? 40  A   A "C3'" 1 
ATOM   3975 O  "O3'" . A   B  1 26  ? 46.229  46.812  23.015 1.00 33.99  ? 40  A   A "O3'" 1 
ATOM   3976 C  "C2'" . A   B  1 26  ? 43.952  46.221  22.338 1.00 30.39  ? 40  A   A "C2'" 1 
ATOM   3977 O  "O2'" . A   B  1 26  ? 44.501  44.962  21.985 1.00 34.02  ? 40  A   A "O2'" 1 
ATOM   3978 C  "C1'" . A   B  1 26  ? 42.711  45.977  23.189 1.00 31.40  ? 40  A   A "C1'" 1 
ATOM   3979 N  N9    . A   B  1 26  ? 41.695  47.018  22.942 1.00 31.29  ? 40  A   A N9    1 
ATOM   3980 C  C8    . A   B  1 26  ? 41.453  48.187  23.616 1.00 29.37  ? 40  A   A C8    1 
ATOM   3981 N  N7    . A   B  1 26  ? 40.463  48.884  23.108 1.00 26.22  ? 40  A   A N7    1 
ATOM   3982 C  C5    . A   B  1 26  ? 40.039  48.119  22.031 1.00 28.47  ? 40  A   A C5    1 
ATOM   3983 C  C6    . A   B  1 26  ? 39.014  48.294  21.087 1.00 25.68  ? 40  A   A C6    1 
ATOM   3984 N  N6    . A   B  1 26  ? 38.219  49.352  21.083 1.00 25.49  ? 40  A   A N6    1 
ATOM   3985 N  N1    . A   B  1 26  ? 38.852  47.356  20.133 1.00 27.10  ? 40  A   A N1    1 
ATOM   3986 C  C2    . A   B  1 26  ? 39.654  46.287  20.147 1.00 28.40  ? 40  A   A C2    1 
ATOM   3987 N  N3    . A   B  1 26  ? 40.652  46.005  20.988 1.00 30.82  ? 40  A   A N3    1 
ATOM   3988 C  C4    . A   B  1 26  ? 40.785  46.973  21.914 1.00 28.08  ? 40  A   A C4    1 
ATOM   3989 P  P     . U   B  1 27  ? 46.963  47.937  22.140 1.00 34.18  ? 41  U   A P     1 
ATOM   3990 O  OP1   . U   B  1 27  ? 48.409  47.614  22.335 1.00 38.71  ? 41  U   A OP1   1 
ATOM   3991 O  OP2   . U   B  1 27  ? 46.439  49.273  22.523 1.00 28.50  ? 41  U   A OP2   1 
ATOM   3992 O  "O5'" . U   B  1 27  ? 46.530  47.567  20.650 1.00 29.48  ? 41  U   A "O5'" 1 
ATOM   3993 C  "C5'" . U   B  1 27  ? 46.959  46.360  20.040 1.00 32.54  ? 41  U   A "C5'" 1 
ATOM   3994 C  "C4'" . U   B  1 27  ? 46.318  46.222  18.686 1.00 34.53  ? 41  U   A "C4'" 1 
ATOM   3995 O  "O4'" . U   B  1 27  ? 44.902  45.950  18.849 1.00 30.89  ? 41  U   A "O4'" 1 
ATOM   3996 C  "C3'" . U   B  1 27  ? 46.321  47.485  17.838 1.00 33.36  ? 41  U   A "C3'" 1 
ATOM   3997 O  "O3'" . U   B  1 27  ? 47.556  47.775  17.209 1.00 34.73  ? 41  U   A "O3'" 1 
ATOM   3998 C  "C2'" . U   B  1 27  ? 45.197  47.195  16.859 1.00 31.43  ? 41  U   A "C2'" 1 
ATOM   3999 O  "O2'" . U   B  1 27  ? 45.605  46.172  15.958 1.00 30.39  ? 41  U   A "O2'" 1 
ATOM   4000 C  "C1'" . U   B  1 27  ? 44.174  46.607  17.828 1.00 31.36  ? 41  U   A "C1'" 1 
ATOM   4001 N  N1    . U   B  1 27  ? 43.299  47.677  18.386 1.00 29.76  ? 41  U   A N1    1 
ATOM   4002 C  C2    . U   B  1 27  ? 42.185  48.007  17.628 1.00 29.24  ? 41  U   A C2    1 
ATOM   4003 O  O2    . U   B  1 27  ? 41.929  47.476  16.563 1.00 27.38  ? 41  U   A O2    1 
ATOM   4004 N  N3    . U   B  1 27  ? 41.393  48.991  18.137 1.00 25.76  ? 41  U   A N3    1 
ATOM   4005 C  C4    . U   B  1 27  ? 41.569  49.671  19.320 1.00 28.10  ? 41  U   A C4    1 
ATOM   4006 O  O4    . U   B  1 27  ? 40.737  50.533  19.621 1.00 26.77  ? 41  U   A O4    1 
ATOM   4007 C  C5    . U   B  1 27  ? 42.742  49.294  20.061 1.00 27.76  ? 41  U   A C5    1 
ATOM   4008 C  C6    . U   B  1 27  ? 43.546  48.324  19.578 1.00 30.31  ? 41  U   A C6    1 
ATOM   4009 P  P     . G   B  1 28  ? 47.921  49.323  16.944 1.00 37.17  ? 42  G   A P     1 
ATOM   4010 O  OP1   . G   B  1 28  ? 49.319  49.199  16.479 1.00 39.78  ? 42  G   A OP1   1 
ATOM   4011 O  OP2   . G   B  1 28  ? 47.565  50.127  18.145 1.00 34.60  ? 42  G   A OP2   1 
ATOM   4012 O  "O5'" . G   B  1 28  ? 46.967  49.803  15.752 1.00 35.72  ? 42  G   A "O5'" 1 
ATOM   4013 C  "C5'" . G   B  1 28  ? 47.092  49.208  14.469 1.00 32.18  ? 42  G   A "C5'" 1 
ATOM   4014 C  "C4'" . G   B  1 28  ? 45.928  49.546  13.574 1.00 33.38  ? 42  G   A "C4'" 1 
ATOM   4015 O  "O4'" . G   B  1 28  ? 44.687  49.098  14.182 1.00 31.48  ? 42  G   A "O4'" 1 
ATOM   4016 C  "C3'" . G   B  1 28  ? 45.673  51.021  13.318 1.00 31.43  ? 42  G   A "C3'" 1 
ATOM   4017 O  "O3'" . G   B  1 28  ? 46.561  51.606  12.382 1.00 38.70  ? 42  G   A "O3'" 1 
ATOM   4018 C  "C2'" . G   B  1 28  ? 44.222  50.997  12.852 1.00 33.87  ? 42  G   A "C2'" 1 
ATOM   4019 O  "O2'" . G   B  1 28  ? 44.106  50.448  11.547 1.00 33.01  ? 42  G   A "O2'" 1 
ATOM   4020 C  "C1'" . G   B  1 28  ? 43.649  49.990  13.839 1.00 29.68  ? 42  G   A "C1'" 1 
ATOM   4021 N  N9    . G   B  1 28  ? 43.221  50.730  15.033 1.00 29.01  ? 42  G   A N9    1 
ATOM   4022 C  C8    . G   B  1 28  ? 43.867  50.883  16.235 1.00 29.66  ? 42  G   A C8    1 
ATOM   4023 N  N7    . G   B  1 28  ? 43.196  51.643  17.066 1.00 28.21  ? 42  G   A N7    1 
ATOM   4024 C  C5    . G   B  1 28  ? 42.064  52.024  16.356 1.00 25.46  ? 42  G   A C5    1 
ATOM   4025 C  C6    . G   B  1 28  ? 40.971  52.832  16.729 1.00 27.51  ? 42  G   A C6    1 
ATOM   4026 O  O6    . G   B  1 28  ? 40.778  53.419  17.804 1.00 28.57  ? 42  G   A O6    1 
ATOM   4027 N  N1    . G   B  1 28  ? 40.038  52.929  15.696 1.00 27.56  ? 42  G   A N1    1 
ATOM   4028 C  C2    . G   B  1 28  ? 40.144  52.332  14.466 1.00 28.44  ? 42  G   A C2    1 
ATOM   4029 N  N2    . G   B  1 28  ? 39.139  52.552  13.607 1.00 28.34  ? 42  G   A N2    1 
ATOM   4030 N  N3    . G   B  1 28  ? 41.166  51.576  14.107 1.00 29.36  ? 42  G   A N3    1 
ATOM   4031 C  C4    . G   B  1 28  ? 42.071  51.466  15.099 1.00 27.59  ? 42  G   A C4    1 
ATOM   4032 P  P     . G   B  1 29  ? 46.888  53.181  12.454 1.00 44.05  ? 43  G   A P     1 
ATOM   4033 O  OP1   . G   B  1 29  ? 47.972  53.319  11.444 1.00 41.04  ? 43  G   A OP1   1 
ATOM   4034 O  OP2   . G   B  1 29  ? 47.117  53.532  13.880 1.00 37.13  ? 43  G   A OP2   1 
ATOM   4035 O  "O5'" . G   B  1 29  ? 45.548  53.916  11.986 1.00 30.65  ? 43  G   A "O5'" 1 
ATOM   4036 C  "C5'" . G   B  1 29  ? 44.961  53.569  10.748 1.00 34.14  ? 43  G   A "C5'" 1 
ATOM   4037 C  "C4'" . G   B  1 29  ? 43.573  54.136  10.593 1.00 32.45  ? 43  G   A "C4'" 1 
ATOM   4038 O  "O4'" . G   B  1 29  ? 42.707  53.677  11.660 1.00 32.34  ? 43  G   A "O4'" 1 
ATOM   4039 C  "C3'" . G   B  1 29  ? 43.443  55.648  10.637 1.00 35.75  ? 43  G   A "C3'" 1 
ATOM   4040 O  "O3'" . G   B  1 29  ? 43.818  56.240  9.407  1.00 38.39  ? 43  G   A "O3'" 1 
ATOM   4041 C  "C2'" . G   B  1 29  ? 41.967  55.820  10.957 1.00 33.52  ? 43  G   A "C2'" 1 
ATOM   4042 O  "O2'" . G   B  1 29  ? 41.192  55.540  9.805  1.00 38.76  ? 43  G   A "O2'" 1 
ATOM   4043 C  "C1'" . G   B  1 29  ? 41.744  54.671  11.942 1.00 32.83  ? 43  G   A "C1'" 1 
ATOM   4044 N  N9    . G   B  1 29  ? 41.911  55.095  13.346 1.00 29.17  ? 43  G   A N9    1 
ATOM   4045 C  C8    . G   B  1 29  ? 42.952  54.784  14.188 1.00 32.12  ? 43  G   A C8    1 
ATOM   4046 N  N7    . G   B  1 29  ? 42.811  55.301  15.384 1.00 29.90  ? 43  G   A N7    1 
ATOM   4047 C  C5    . G   B  1 29  ? 41.609  55.986  15.323 1.00 27.15  ? 43  G   A C5    1 
ATOM   4048 C  C6    . G   B  1 29  ? 40.948  56.738  16.326 1.00 29.31  ? 43  G   A C6    1 
ATOM   4049 O  O6    . G   B  1 29  ? 41.330  56.928  17.493 1.00 25.14  ? 43  G   A O6    1 
ATOM   4050 N  N1    . G   B  1 29  ? 39.753  57.274  15.855 1.00 26.21  ? 43  G   A N1    1 
ATOM   4051 C  C2    . G   B  1 29  ? 39.270  57.082  14.569 1.00 30.24  ? 43  G   A C2    1 
ATOM   4052 N  N2    . G   B  1 29  ? 38.104  57.662  14.264 1.00 27.15  ? 43  G   A N2    1 
ATOM   4053 N  N3    . G   B  1 29  ? 39.888  56.380  13.629 1.00 28.07  ? 43  G   A N3    1 
ATOM   4054 C  C4    . G   B  1 29  ? 41.041  55.865  14.076 1.00 26.89  ? 43  G   A C4    1 
ATOM   4055 P  P     . A   B  1 30  ? 44.377  57.738  9.350  1.00 38.09  ? 44  A   A P     1 
ATOM   4056 O  OP1   . A   B  1 30  ? 45.149  57.793  8.076  1.00 45.07  ? 44  A   A OP1   1 
ATOM   4057 O  OP2   . A   B  1 30  ? 45.097  58.034  10.622 1.00 36.55  ? 44  A   A OP2   1 
ATOM   4058 O  "O5'" . A   B  1 30  ? 43.052  58.598  9.270  1.00 32.97  ? 44  A   A "O5'" 1 
ATOM   4059 C  "C5'" . A   B  1 30  ? 42.033  58.449  8.293  1.00 36.52  ? 44  A   A "C5'" 1 
ATOM   4060 C  "C4'" . A   B  1 30  ? 40.777  59.174  8.727  1.00 34.22  ? 44  A   A "C4'" 1 
ATOM   4061 O  "O4'" . A   B  1 30  ? 40.317  58.612  9.983  1.00 33.97  ? 44  A   A "O4'" 1 
ATOM   4062 C  "C3'" . A   B  1 30  ? 40.900  60.665  9.034  1.00 37.16  ? 44  A   A "C3'" 1 
ATOM   4063 O  "O3'" . A   B  1 30  ? 40.805  61.495  7.893  1.00 38.73  ? 44  A   A "O3'" 1 
ATOM   4064 C  "C2'" . A   B  1 30  ? 39.764  60.924  10.015 1.00 35.12  ? 44  A   A "C2'" 1 
ATOM   4065 O  "O2'" . A   B  1 30  ? 38.532  61.069  9.325  1.00 37.00  ? 44  A   A "O2'" 1 
ATOM   4066 C  "C1'" . A   B  1 30  ? 39.727  59.614  10.791 1.00 33.97  ? 44  A   A "C1'" 1 
ATOM   4067 N  N9    . A   B  1 30  ? 40.449  59.665  12.080 1.00 33.42  ? 44  A   A N9    1 
ATOM   4068 C  C8    . A   B  1 30  ? 41.677  59.115  12.396 1.00 30.82  ? 44  A   A C8    1 
ATOM   4069 N  N7    . A   B  1 30  ? 42.041  59.298  13.647 1.00 28.64  ? 44  A   A N7    1 
ATOM   4070 C  C5    . A   B  1 30  ? 40.969  60.001  14.195 1.00 28.56  ? 44  A   A C5    1 
ATOM   4071 C  C6    . A   B  1 30  ? 40.725  60.497  15.485 1.00 25.88  ? 44  A   A C6    1 
ATOM   4072 N  N6    . A   B  1 30  ? 41.581  60.357  16.497 1.00 27.94  ? 44  A   A N6    1 
ATOM   4073 N  N1    . A   B  1 30  ? 39.567  61.157  15.695 1.00 27.68  ? 44  A   A N1    1 
ATOM   4074 C  C2    . A   B  1 30  ? 38.707  61.300  14.676 1.00 27.84  ? 44  A   A C2    1 
ATOM   4075 N  N3    . A   B  1 30  ? 38.829  60.872  13.420 1.00 26.95  ? 44  A   A N3    1 
ATOM   4076 C  C4    . A   B  1 30  ? 39.984  60.227  13.245 1.00 27.49  ? 44  A   A C4    1 
ATOM   4077 P  P     . G   B  1 31  ? 41.557  62.919  7.883  1.00 37.63  ? 45  G   A P     1 
ATOM   4078 O  OP1   . G   B  1 31  ? 41.290  63.496  6.542  1.00 38.43  ? 45  G   A OP1   1 
ATOM   4079 O  OP2   . G   B  1 31  ? 42.945  62.662  8.318  1.00 33.36  ? 45  G   A OP2   1 
ATOM   4080 O  "O5'" . G   B  1 31  ? 40.808  63.772  8.986  1.00 33.75  ? 45  G   A "O5'" 1 
ATOM   4081 C  "C5'" . G   B  1 31  ? 39.435  64.078  8.827  1.00 35.69  ? 45  G   A "C5'" 1 
ATOM   4082 C  "C4'" . G   B  1 31  ? 38.925  64.816  10.033 1.00 37.59  ? 45  G   A "C4'" 1 
ATOM   4083 O  "O4'" . G   B  1 31  ? 38.932  63.954  11.199 1.00 33.27  ? 45  G   A "O4'" 1 
ATOM   4084 C  "C3'" . G   B  1 31  ? 39.774  66.000  10.451 1.00 35.87  ? 45  G   A "C3'" 1 
ATOM   4085 O  "O3'" . G   B  1 31  ? 39.492  67.134  9.659  1.00 40.73  ? 45  G   A "O3'" 1 
ATOM   4086 C  "C2'" . G   B  1 31  ? 39.402  66.157  11.916 1.00 34.89  ? 45  G   A "C2'" 1 
ATOM   4087 O  "O2'" . G   B  1 31  ? 38.117  66.751  12.034 1.00 32.98  ? 45  G   A "O2'" 1 
ATOM   4088 C  "C1'" . G   B  1 31  ? 39.274  64.696  12.346 1.00 30.91  ? 45  G   A "C1'" 1 
ATOM   4089 N  N9    . G   B  1 31  ? 40.520  64.120  12.887 1.00 30.43  ? 45  G   A N9    1 
ATOM   4090 C  C8    . G   B  1 31  ? 41.522  63.490  12.186 1.00 30.61  ? 45  G   A C8    1 
ATOM   4091 N  N7    . G   B  1 31  ? 42.489  63.060  12.952 1.00 29.54  ? 45  G   A N7    1 
ATOM   4092 C  C5    . G   B  1 31  ? 42.092  63.414  14.240 1.00 28.78  ? 45  G   A C5    1 
ATOM   4093 C  C6    . G   B  1 31  ? 42.728  63.217  15.495 1.00 27.60  ? 45  G   A C6    1 
ATOM   4094 O  O6    . G   B  1 31  ? 43.803  62.657  15.723 1.00 28.56  ? 45  G   A O6    1 
ATOM   4095 N  N1    . G   B  1 31  ? 41.978  63.732  16.552 1.00 26.40  ? 45  G   A N1    1 
ATOM   4096 C  C2    . G   B  1 31  ? 40.768  64.361  16.413 1.00 24.08  ? 45  G   A C2    1 
ATOM   4097 N  N2    . G   B  1 31  ? 40.174  64.796  17.538 1.00 24.47  ? 45  G   A N2    1 
ATOM   4098 N  N3    . G   B  1 31  ? 40.170  64.553  15.245 1.00 26.76  ? 45  G   A N3    1 
ATOM   4099 C  C4    . G   B  1 31  ? 40.878  64.055  14.214 1.00 27.96  ? 45  G   A C4    1 
ATOM   4100 P  P     . A   B  1 32  ? 40.668  68.080  9.118  1.00 45.03  ? 46  A   A P     1 
ATOM   4101 O  OP1   . A   B  1 32  ? 40.041  68.641  7.896  1.00 44.59  ? 46  A   A OP1   1 
ATOM   4102 O  OP2   . A   B  1 32  ? 42.003  67.407  9.079  1.00 34.35  ? 46  A   A OP2   1 
ATOM   4103 O  "O5'" . A   B  1 32  ? 40.712  69.197  10.249 1.00 37.36  ? 46  A   A "O5'" 1 
ATOM   4104 C  "C5'" . A   B  1 32  ? 39.631  70.084  10.500 1.00 36.92  ? 46  A   A "C5'" 1 
ATOM   4105 C  "C4'" . A   B  1 32  ? 40.014  71.007  11.624 1.00 40.81  ? 46  A   A "C4'" 1 
ATOM   4106 O  "O4'" . A   B  1 32  ? 40.062  70.235  12.860 1.00 36.12  ? 46  A   A "O4'" 1 
ATOM   4107 C  "C3'" . A   B  1 32  ? 41.394  71.656  11.461 1.00 39.59  ? 46  A   A "C3'" 1 
ATOM   4108 O  "O3'" . A   B  1 32  ? 41.379  72.978  12.000 1.00 49.58  ? 46  A   A "O3'" 1 
ATOM   4109 C  "C2'" . A   B  1 32  ? 42.279  70.767  12.331 1.00 37.10  ? 46  A   A "C2'" 1 
ATOM   4110 O  "O2'" . A   B  1 32  ? 43.466  71.364  12.816 1.00 31.73  ? 46  A   A "O2'" 1 
ATOM   4111 C  "C1'" . A   B  1 32  ? 41.315  70.472  13.472 1.00 36.00  ? 46  A   A "C1'" 1 
ATOM   4112 N  N9    . A   B  1 32  ? 41.731  69.383  14.361 1.00 28.69  ? 46  A   A N9    1 
ATOM   4113 C  C8    . A   B  1 32  ? 42.505  68.281  14.098 1.00 28.66  ? 46  A   A C8    1 
ATOM   4114 N  N7    . A   B  1 32  ? 42.703  67.531  15.156 1.00 27.20  ? 46  A   A N7    1 
ATOM   4115 C  C5    . A   B  1 32  ? 42.030  68.202  16.171 1.00 27.26  ? 46  A   A C5    1 
ATOM   4116 C  C6    . A   B  1 32  ? 41.861  67.947  17.540 1.00 24.90  ? 46  A   A C6    1 
ATOM   4117 N  N6    . A   B  1 32  ? 42.372  66.887  18.156 1.00 24.22  ? 46  A   A N6    1 
ATOM   4118 N  N1    . A   B  1 32  ? 41.130  68.820  18.264 1.00 23.60  ? 46  A   A N1    1 
ATOM   4119 C  C2    . A   B  1 32  ? 40.621  69.894  17.660 1.00 25.76  ? 46  A   A C2    1 
ATOM   4120 N  N3    . A   B  1 32  ? 40.719  70.247  16.388 1.00 28.80  ? 46  A   A N3    1 
ATOM   4121 C  C4    . A   B  1 32  ? 41.446  69.352  15.699 1.00 28.76  ? 46  A   A C4    1 
ATOM   4122 P  P     . U   B  1 33  ? 41.087  74.281  11.089 1.00 57.43  ? 47  U   A P     1 
ATOM   4123 O  OP1   . U   B  1 33  ? 41.119  73.870  9.665  1.00 52.06  ? 47  U   A OP1   1 
ATOM   4124 O  OP2   . U   B  1 33  ? 42.031  75.309  11.585 1.00 59.94  ? 47  U   A OP2   1 
ATOM   4125 O  "O5'" . U   B  1 33  ? 39.599  74.669  11.491 1.00 56.37  ? 47  U   A "O5'" 1 
ATOM   4126 C  "C5'" . U   B  1 33  ? 39.288  75.371  12.689 1.00 60.95  ? 47  U   A "C5'" 1 
ATOM   4127 C  "C4'" . U   B  1 33  ? 37.953  76.061  12.552 1.00 65.37  ? 47  U   A "C4'" 1 
ATOM   4128 O  "O4'" . U   B  1 33  ? 38.120  77.498  12.734 1.00 72.91  ? 47  U   A "O4'" 1 
ATOM   4129 C  "C3'" . U   B  1 33  ? 37.273  75.878  11.192 1.00 64.13  ? 47  U   A "C3'" 1 
ATOM   4130 O  "O3'" . U   B  1 33  ? 35.852  75.836  11.344 1.00 60.28  ? 47  U   A "O3'" 1 
ATOM   4131 C  "C2'" . U   B  1 33  ? 37.658  77.161  10.461 1.00 70.38  ? 47  U   A "C2'" 1 
ATOM   4132 O  "O2'" . U   B  1 33  ? 36.821  77.519  9.379  1.00 71.98  ? 47  U   A "O2'" 1 
ATOM   4133 C  "C1'" . U   B  1 33  ? 37.584  78.171  11.605 1.00 73.10  ? 47  U   A "C1'" 1 
ATOM   4134 N  N1    . U   B  1 33  ? 38.295  79.434  11.287 1.00 76.84  ? 47  U   A N1    1 
ATOM   4135 C  C2    . U   B  1 33  ? 39.685  79.443  11.268 1.00 77.06  ? 47  U   A C2    1 
ATOM   4136 O  O2    . U   B  1 33  ? 40.370  78.461  11.520 1.00 75.37  ? 47  U   A O2    1 
ATOM   4137 N  N3    . U   B  1 33  ? 40.247  80.658  10.947 1.00 72.11  ? 47  U   A N3    1 
ATOM   4138 C  C4    . U   B  1 33  ? 39.583  81.834  10.647 1.00 72.85  ? 47  U   A C4    1 
ATOM   4139 O  O4    . U   B  1 33  ? 40.237  82.845  10.378 1.00 73.63  ? 47  U   A O4    1 
ATOM   4140 C  C5    . U   B  1 33  ? 38.152  81.742  10.683 1.00 75.37  ? 47  U   A C5    1 
ATOM   4141 C  C6    . U   B  1 33  ? 37.574  80.573  10.990 1.00 77.88  ? 47  U   A C6    1 
ATOM   4142 P  P     . A   B  1 34  ? 35.153  75.578  12.766 1.00 59.94  ? 48  A   A P     1 
ATOM   4143 O  OP1   . A   B  1 34  ? 33.698  75.491  12.480 1.00 63.51  ? 48  A   A OP1   1 
ATOM   4144 O  OP2   . A   B  1 34  ? 35.600  76.549  13.794 1.00 59.81  ? 48  A   A OP2   1 
ATOM   4145 O  "O5'" . A   B  1 34  ? 35.747  74.142  13.091 1.00 53.42  ? 48  A   A "O5'" 1 
ATOM   4146 C  "C5'" . A   B  1 34  ? 34.910  73.014  12.926 1.00 49.91  ? 48  A   A "C5'" 1 
ATOM   4147 C  "C4'" . A   B  1 34  ? 35.638  71.862  12.289 1.00 47.33  ? 48  A   A "C4'" 1 
ATOM   4148 O  "O4'" . A   B  1 34  ? 36.873  71.603  13.000 1.00 44.41  ? 48  A   A "O4'" 1 
ATOM   4149 C  "C3'" . A   B  1 34  ? 34.856  70.563  12.328 1.00 44.68  ? 48  A   A "C3'" 1 
ATOM   4150 O  "O3'" . A   B  1 34  ? 34.079  70.439  11.153 1.00 50.47  ? 48  A   A "O3'" 1 
ATOM   4151 C  "C2'" . A   B  1 34  ? 35.919  69.481  12.467 1.00 43.75  ? 48  A   A "C2'" 1 
ATOM   4152 O  "O2'" . A   B  1 34  ? 36.390  69.070  11.191 1.00 45.36  ? 48  A   A "O2'" 1 
ATOM   4153 C  "C1'" . A   B  1 34  ? 37.058  70.218  13.176 1.00 39.22  ? 48  A   A "C1'" 1 
ATOM   4154 N  N9    . A   B  1 34  ? 37.172  69.953  14.624 1.00 36.91  ? 48  A   A N9    1 
ATOM   4155 C  C8    . A   B  1 34  ? 37.088  70.877  15.634 1.00 33.51  ? 48  A   A C8    1 
ATOM   4156 N  N7    . A   B  1 34  ? 37.255  70.368  16.826 1.00 32.55  ? 48  A   A N7    1 
ATOM   4157 C  C5    . A   B  1 34  ? 37.469  69.025  16.595 1.00 31.47  ? 48  A   A C5    1 
ATOM   4158 C  C6    . A   B  1 34  ? 37.710  67.946  17.467 1.00 31.17  ? 48  A   A C6    1 
ATOM   4159 N  N6    . A   B  1 34  ? 37.786  68.055  18.803 1.00 25.07  ? 48  A   A N6    1 
ATOM   4160 N  N1    . A   B  1 34  ? 37.877  66.732  16.895 1.00 31.28  ? 48  A   A N1    1 
ATOM   4161 C  C2    . A   B  1 34  ? 37.815  66.615  15.558 1.00 32.76  ? 48  A   A C2    1 
ATOM   4162 N  N3    . A   B  1 34  ? 37.590  67.558  14.646 1.00 34.68  ? 48  A   A N3    1 
ATOM   4163 C  C4    . A   B  1 34  ? 37.426  68.752  15.237 1.00 34.26  ? 48  A   A C4    1 
ATOM   4164 P  P     . C   B  1 35  ? 32.582  69.882  11.171 1.00 58.52  ? 49  C   A P     1 
ATOM   4165 O  OP1   . C   B  1 35  ? 32.147  69.981  9.754  1.00 57.88  ? 49  C   A OP1   1 
ATOM   4166 O  OP2   . C   B  1 35  ? 31.820  70.604  12.227 1.00 46.19  ? 49  C   A OP2   1 
ATOM   4167 O  "O5'" . C   B  1 35  ? 32.837  68.355  11.551 1.00 52.51  ? 49  C   A "O5'" 1 
ATOM   4168 C  "C5'" . C   B  1 35  ? 31.757  67.436  11.655 1.00 51.75  ? 49  C   A "C5'" 1 
ATOM   4169 C  "C4'" . C   B  1 35  ? 32.239  66.009  11.726 1.00 49.88  ? 49  C   A "C4'" 1 
ATOM   4170 O  "O4'" . C   B  1 35  ? 32.802  65.618  10.442 1.00 47.99  ? 49  C   A "O4'" 1 
ATOM   4171 C  "C3'" . C   B  1 35  ? 33.315  65.727  12.774 1.00 48.16  ? 49  C   A "C3'" 1 
ATOM   4172 O  "O3'" . C   B  1 35  ? 33.082  64.445  13.362 1.00 43.13  ? 49  C   A "O3'" 1 
ATOM   4173 C  "C2'" . C   B  1 35  ? 34.594  65.694  11.942 1.00 46.18  ? 49  C   A "C2'" 1 
ATOM   4174 O  "O2'" . C   B  1 35  ? 35.652  64.945  12.505 1.00 48.02  ? 49  C   A "O2'" 1 
ATOM   4175 C  "C1'" . C   B  1 35  ? 34.095  65.084  10.632 1.00 47.73  ? 49  C   A "C1'" 1 
ATOM   4176 N  N1    . C   B  1 35  ? 34.941  65.451  9.476  1.00 49.43  ? 49  C   A N1    1 
ATOM   4177 C  C2    . C   B  1 35  ? 35.472  64.448  8.649  1.00 51.01  ? 49  C   A C2    1 
ATOM   4178 O  O2    . C   B  1 35  ? 35.211  63.256  8.904  1.00 49.94  ? 49  C   A O2    1 
ATOM   4179 N  N3    . C   B  1 35  ? 36.255  64.809  7.597  1.00 47.79  ? 49  C   A N3    1 
ATOM   4180 C  C4    . C   B  1 35  ? 36.506  66.105  7.365  1.00 49.06  ? 49  C   A C4    1 
ATOM   4181 N  N4    . C   B  1 35  ? 37.278  66.446  6.328  1.00 47.79  ? 49  C   A N4    1 
ATOM   4182 C  C5    . C   B  1 35  ? 35.978  67.134  8.194  1.00 49.80  ? 49  C   A C5    1 
ATOM   4183 C  C6    . C   B  1 35  ? 35.209  66.766  9.226  1.00 49.51  ? 49  C   A C6    1 
ATOM   4184 P  P     . G   B  1 36  ? 31.922  64.279  14.461 1.00 44.44  ? 50  G   A P     1 
ATOM   4185 O  OP1   . G   B  1 36  ? 31.564  62.840  14.405 1.00 47.75  ? 50  G   A OP1   1 
ATOM   4186 O  OP2   . G   B  1 36  ? 30.895  65.317  14.169 1.00 44.14  ? 50  G   A OP2   1 
ATOM   4187 O  "O5'" . G   B  1 36  ? 32.608  64.603  15.858 1.00 38.45  ? 50  G   A "O5'" 1 
ATOM   4188 C  "C5'" . G   B  1 36  ? 33.315  63.611  16.585 1.00 38.20  ? 50  G   A "C5'" 1 
ATOM   4189 C  "C4'" . G   B  1 36  ? 33.843  64.192  17.869 1.00 33.23  ? 50  G   A "C4'" 1 
ATOM   4190 O  "O4'" . G   B  1 36  ? 34.893  65.146  17.567 1.00 34.50  ? 50  G   A "O4'" 1 
ATOM   4191 C  "C3'" . G   B  1 36  ? 32.827  64.991  18.665 1.00 32.97  ? 50  G   A "C3'" 1 
ATOM   4192 O  "O3'" . G   B  1 36  ? 32.049  64.173  19.512 1.00 37.92  ? 50  G   A "O3'" 1 
ATOM   4193 C  "C2'" . G   B  1 36  ? 33.682  65.975  19.443 1.00 30.17  ? 50  G   A "C2'" 1 
ATOM   4194 O  "O2'" . G   B  1 36  ? 34.256  65.330  20.567 1.00 33.78  ? 50  G   A "O2'" 1 
ATOM   4195 C  "C1'" . G   B  1 36  ? 34.797  66.253  18.441 1.00 31.80  ? 50  G   A "C1'" 1 
ATOM   4196 N  N9    . G   B  1 36  ? 34.542  67.461  17.636 1.00 31.12  ? 50  G   A N9    1 
ATOM   4197 C  C8    . G   B  1 36  ? 34.368  67.533  16.279 1.00 32.98  ? 50  G   A C8    1 
ATOM   4198 N  N7    . G   B  1 36  ? 34.172  68.751  15.849 1.00 33.86  ? 50  G   A N7    1 
ATOM   4199 C  C5    . G   B  1 36  ? 34.216  69.522  16.995 1.00 31.99  ? 50  G   A C5    1 
ATOM   4200 C  C6    . G   B  1 36  ? 34.075  70.917  17.143 1.00 32.81  ? 50  G   A C6    1 
ATOM   4201 O  O6    . G   B  1 36  ? 33.866  71.758  16.254 1.00 33.34  ? 50  G   A O6    1 
ATOM   4202 N  N1    . G   B  1 36  ? 34.183  71.288  18.482 1.00 29.42  ? 50  G   A N1    1 
ATOM   4203 C  C2    . G   B  1 36  ? 34.422  70.440  19.532 1.00 32.19  ? 50  G   A C2    1 
ATOM   4204 N  N2    . G   B  1 36  ? 34.495  71.004  20.742 1.00 30.46  ? 50  G   A N2    1 
ATOM   4205 N  N3    . G   B  1 36  ? 34.560  69.125  19.403 1.00 33.14  ? 50  G   A N3    1 
ATOM   4206 C  C4    . G   B  1 36  ? 34.448  68.745  18.111 1.00 32.06  ? 50  G   A C4    1 
ATOM   4207 P  P     . C   B  1 37  ? 30.468  64.450  19.668 1.00 39.03  ? 51  C   A P     1 
ATOM   4208 O  OP1   . C   B  1 37  ? 29.885  63.200  20.240 1.00 39.35  ? 51  C   A OP1   1 
ATOM   4209 O  OP2   . C   B  1 37  ? 30.030  64.978  18.349 1.00 38.69  ? 51  C   A OP2   1 
ATOM   4210 O  "O5'" . C   B  1 37  ? 30.374  65.640  20.709 1.00 34.19  ? 51  C   A "O5'" 1 
ATOM   4211 C  "C5'" . C   B  1 37  ? 30.860  65.571  22.035 1.00 35.67  ? 51  C   A "C5'" 1 
ATOM   4212 C  "C4'" . C   B  1 37  ? 30.788  66.935  22.667 1.00 37.66  ? 51  C   A "C4'" 1 
ATOM   4213 O  "O4'" . C   B  1 37  ? 31.725  67.846  22.019 1.00 35.86  ? 51  C   A "O4'" 1 
ATOM   4214 C  "C3'" . C   B  1 37  ? 29.454  67.657  22.542 1.00 36.59  ? 51  C   A "C3'" 1 
ATOM   4215 O  "O3'" . C   B  1 37  ? 28.480  67.184  23.457 1.00 38.79  ? 51  C   A "O3'" 1 
ATOM   4216 C  "C2'" . C   B  1 37  ? 29.864  69.100  22.799 1.00 36.91  ? 51  C   A "C2'" 1 
ATOM   4217 O  "O2'" . C   B  1 37  ? 30.101  69.288  24.185 1.00 40.21  ? 51  C   A "O2'" 1 
ATOM   4218 C  "C1'" . C   B  1 37  ? 31.212  69.166  22.077 1.00 36.98  ? 51  C   A "C1'" 1 
ATOM   4219 N  N1    . C   B  1 37  ? 31.107  69.726  20.712 1.00 34.42  ? 51  C   A N1    1 
ATOM   4220 C  C2    . C   B  1 37  ? 30.897  71.102  20.556 1.00 33.50  ? 51  C   A C2    1 
ATOM   4221 O  O2    . C   B  1 37  ? 30.800  71.815  21.571 1.00 32.95  ? 51  C   A O2    1 
ATOM   4222 N  N3    . C   B  1 37  ? 30.795  71.614  19.309 1.00 33.00  ? 51  C   A N3    1 
ATOM   4223 C  C4    . C   B  1 37  ? 30.911  70.822  18.241 1.00 34.10  ? 51  C   A C4    1 
ATOM   4224 N  N4    . C   B  1 37  ? 30.814  71.373  17.025 1.00 36.38  ? 51  C   A N4    1 
ATOM   4225 C  C5    . C   B  1 37  ? 31.126  69.419  18.370 1.00 36.46  ? 51  C   A C5    1 
ATOM   4226 C  C6    . C   B  1 37  ? 31.217  68.917  19.612 1.00 36.33  ? 51  C   A C6    1 
ATOM   4227 P  P     . U   B  1 38  ? 26.902  67.286  23.153 1.00 37.36  ? 52  U   A P     1 
ATOM   4228 O  OP1   . U   B  1 38  ? 26.283  66.480  24.231 1.00 41.03  ? 52  U   A OP1   1 
ATOM   4229 O  OP2   . U   B  1 38  ? 26.673  66.990  21.722 1.00 34.21  ? 52  U   A OP2   1 
ATOM   4230 O  "O5'" . U   B  1 38  ? 26.573  68.813  23.397 1.00 37.80  ? 52  U   A "O5'" 1 
ATOM   4231 C  "C5'" . U   B  1 38  ? 26.609  69.366  24.702 1.00 37.74  ? 52  U   A "C5'" 1 
ATOM   4232 C  "C4'" . U   B  1 38  ? 26.308  70.840  24.640 1.00 37.61  ? 52  U   A "C4'" 1 
ATOM   4233 O  "O4'" . U   B  1 38  ? 27.344  71.502  23.875 1.00 35.65  ? 52  U   A "O4'" 1 
ATOM   4234 C  "C3'" . U   B  1 38  ? 25.035  71.242  23.908 1.00 36.62  ? 52  U   A "C3'" 1 
ATOM   4235 O  "O3'" . U   B  1 38  ? 23.856  71.064  24.672 1.00 37.81  ? 52  U   A "O3'" 1 
ATOM   4236 C  "C2'" . U   B  1 38  ? 25.326  72.696  23.564 1.00 36.64  ? 52  U   A "C2'" 1 
ATOM   4237 O  "O2'" . U   B  1 38  ? 25.254  73.500  24.730 1.00 33.25  ? 52  U   A "O2'" 1 
ATOM   4238 C  "C1'" . U   B  1 38  ? 26.801  72.605  23.189 1.00 34.62  ? 52  U   A "C1'" 1 
ATOM   4239 N  N1    . U   B  1 38  ? 27.064  72.446  21.747 1.00 35.81  ? 52  U   A N1    1 
ATOM   4240 C  C2    . U   B  1 38  ? 26.969  73.585  20.980 1.00 33.41  ? 52  U   A C2    1 
ATOM   4241 O  O2    . U   B  1 38  ? 26.657  74.660  21.450 1.00 34.77  ? 52  U   A O2    1 
ATOM   4242 N  N3    . U   B  1 38  ? 27.230  73.418  19.652 1.00 32.59  ? 52  U   A N3    1 
ATOM   4243 C  C4    . U   B  1 38  ? 27.586  72.250  19.022 1.00 33.43  ? 52  U   A C4    1 
ATOM   4244 O  O4    . U   B  1 38  ? 27.797  72.272  17.813 1.00 32.45  ? 52  U   A O4    1 
ATOM   4245 C  C5    . U   B  1 38  ? 27.683  71.109  19.882 1.00 33.59  ? 52  U   A C5    1 
ATOM   4246 C  C6    . U   B  1 38  ? 27.429  71.242  21.192 1.00 36.77  ? 52  U   A C6    1 
ATOM   4247 P  P     . G   B  1 39  ? 22.466  70.835  23.906 1.00 40.35  ? 53  G   A P     1 
ATOM   4248 O  OP1   . G   B  1 39  ? 21.519  70.502  24.999 1.00 40.29  ? 53  G   A OP1   1 
ATOM   4249 O  OP2   . G   B  1 39  ? 22.685  69.920  22.760 1.00 39.85  ? 53  G   A OP2   1 
ATOM   4250 O  "O5'" . G   B  1 39  ? 22.083  72.259  23.337 1.00 39.44  ? 53  G   A "O5'" 1 
ATOM   4251 C  "C5'" . G   B  1 39  ? 21.709  73.269  24.259 1.00 38.38  ? 53  G   A "C5'" 1 
ATOM   4252 C  "C4'" . G   B  1 39  ? 21.576  74.598  23.569 1.00 36.89  ? 53  G   A "C4'" 1 
ATOM   4253 O  "O4'" . G   B  1 39  ? 22.832  74.949  22.930 1.00 36.30  ? 53  G   A "O4'" 1 
ATOM   4254 C  "C3'" . G   B  1 39  ? 20.553  74.653  22.443 1.00 35.95  ? 53  G   A "C3'" 1 
ATOM   4255 O  "O3'" . G   B  1 39  ? 19.231  74.826  22.916 1.00 34.56  ? 53  G   A "O3'" 1 
ATOM   4256 C  "C2'" . G   B  1 39  ? 21.040  75.832  21.619 1.00 36.39  ? 53  G   A "C2'" 1 
ATOM   4257 O  "O2'" . G   B  1 39  ? 20.628  77.050  22.222 1.00 35.35  ? 53  G   A "O2'" 1 
ATOM   4258 C  "C1'" . G   B  1 39  ? 22.557  75.689  21.760 1.00 37.50  ? 53  G   A "C1'" 1 
ATOM   4259 N  N9    . G   B  1 39  ? 23.102  74.994  20.588 1.00 32.08  ? 53  G   A N9    1 
ATOM   4260 C  C8    . G   B  1 39  ? 23.496  73.684  20.445 1.00 36.68  ? 53  G   A C8    1 
ATOM   4261 N  N7    . G   B  1 39  ? 23.917  73.423  19.231 1.00 36.30  ? 53  G   A N7    1 
ATOM   4262 C  C5    . G   B  1 39  ? 23.776  74.638  18.555 1.00 35.34  ? 53  G   A C5    1 
ATOM   4263 C  C6    . G   B  1 39  ? 24.061  74.995  17.214 1.00 37.25  ? 53  G   A C6    1 
ATOM   4264 O  O6    . G   B  1 39  ? 24.516  74.249  16.344 1.00 34.87  ? 53  G   A O6    1 
ATOM   4265 N  N1    . G   B  1 39  ? 23.766  76.342  16.939 1.00 34.55  ? 53  G   A N1    1 
ATOM   4266 C  C2    . G   B  1 39  ? 23.258  77.240  17.862 1.00 38.51  ? 53  G   A C2    1 
ATOM   4267 N  N2    . G   B  1 39  ? 23.024  78.510  17.461 1.00 36.64  ? 53  G   A N2    1 
ATOM   4268 N  N3    . G   B  1 39  ? 22.989  76.910  19.116 1.00 36.98  ? 53  G   A N3    1 
ATOM   4269 C  C4    . G   B  1 39  ? 23.275  75.610  19.382 1.00 36.38  ? 53  G   A C4    1 
ATOM   4270 P  P     . C   B  1 40  ? 17.979  74.430  21.986 1.00 32.84  ? 54  C   A P     1 
ATOM   4271 O  OP1   . C   B  1 40  ? 16.796  74.807  22.809 1.00 36.74  ? 54  C   A OP1   1 
ATOM   4272 O  OP2   . C   B  1 40  ? 18.166  73.019  21.562 1.00 32.82  ? 54  C   A OP2   1 
ATOM   4273 O  "O5'" . C   B  1 40  ? 18.113  75.398  20.733 1.00 32.94  ? 54  C   A "O5'" 1 
ATOM   4274 C  "C5'" . C   B  1 40  ? 17.738  76.762  20.865 1.00 33.15  ? 54  C   A "C5'" 1 
ATOM   4275 C  "C4'" . C   B  1 40  ? 17.900  77.495  19.561 1.00 36.33  ? 54  C   A "C4'" 1 
ATOM   4276 O  "O4'" . C   B  1 40  ? 19.271  77.372  19.110 1.00 34.14  ? 54  C   A "O4'" 1 
ATOM   4277 C  "C3'" . C   B  1 40  ? 17.094  76.950  18.394 1.00 35.58  ? 54  C   A "C3'" 1 
ATOM   4278 O  "O3'" . C   B  1 40  ? 15.746  77.372  18.408 1.00 29.94  ? 54  C   A "O3'" 1 
ATOM   4279 C  "C2'" . C   B  1 40  ? 17.872  77.454  17.188 1.00 36.14  ? 54  C   A "C2'" 1 
ATOM   4280 O  "O2'" . C   B  1 40  ? 17.617  78.838  16.976 1.00 35.25  ? 54  C   A "O2'" 1 
ATOM   4281 C  "C1'" . C   B  1 40  ? 19.302  77.294  17.697 1.00 35.22  ? 54  C   A "C1'" 1 
ATOM   4282 N  N1    . C   B  1 40  ? 19.927  76.013  17.307 1.00 36.19  ? 54  C   A N1    1 
ATOM   4283 C  C2    . C   B  1 40  ? 20.454  75.886  16.018 1.00 36.67  ? 54  C   A C2    1 
ATOM   4284 O  O2    . C   B  1 40  ? 20.357  76.844  15.233 1.00 40.51  ? 54  C   A O2    1 
ATOM   4285 N  N3    . C   B  1 40  ? 21.040  74.728  15.649 1.00 36.05  ? 54  C   A N3    1 
ATOM   4286 C  C4    . C   B  1 40  ? 21.124  73.719  16.514 1.00 37.01  ? 54  C   A C4    1 
ATOM   4287 N  N4    . C   B  1 40  ? 21.721  72.596  16.103 1.00 37.02  ? 54  C   A N4    1 
ATOM   4288 C  C5    . C   B  1 40  ? 20.596  73.818  17.836 1.00 36.06  ? 54  C   A C5    1 
ATOM   4289 C  C6    . C   B  1 40  ? 20.010  74.972  18.189 1.00 34.37  ? 54  C   A C6    1 
ATOM   4290 P  P     . U   B  1 41  ? 14.610  76.348  17.966 1.00 33.28  ? 55  U   A P     1 
ATOM   4291 O  OP1   . U   B  1 41  ? 13.367  77.072  18.347 1.00 34.28  ? 55  U   A OP1   1 
ATOM   4292 O  OP2   . U   B  1 41  ? 14.848  75.000  18.549 1.00 31.55  ? 55  U   A OP2   1 
ATOM   4293 O  "O5'" . U   B  1 41  ? 14.834  76.331  16.390 1.00 31.88  ? 55  U   A "O5'" 1 
ATOM   4294 C  "C5'" . U   B  1 41  ? 14.551  77.510  15.662 1.00 28.67  ? 55  U   A "C5'" 1 
ATOM   4295 C  "C4'" . U   B  1 41  ? 14.946  77.365  14.222 1.00 30.84  ? 55  U   A "C4'" 1 
ATOM   4296 O  "O4'" . U   B  1 41  ? 16.380  77.185  14.144 1.00 30.69  ? 55  U   A "O4'" 1 
ATOM   4297 C  "C3'" . U   B  1 41  ? 14.393  76.153  13.490 1.00 28.02  ? 55  U   A "C3'" 1 
ATOM   4298 O  "O3'" . U   B  1 41  ? 13.070  76.322  13.036 1.00 29.98  ? 55  U   A "O3'" 1 
ATOM   4299 C  "C2'" . U   B  1 41  ? 15.378  76.008  12.349 1.00 32.19  ? 55  U   A "C2'" 1 
ATOM   4300 O  "O2'" . U   B  1 41  ? 15.131  77.004  11.368 1.00 29.99  ? 55  U   A "O2'" 1 
ATOM   4301 C  "C1'" . U   B  1 41  ? 16.686  76.340  13.061 1.00 33.87  ? 55  U   A "C1'" 1 
ATOM   4302 N  N1    . U   B  1 41  ? 17.324  75.126  13.599 1.00 32.29  ? 55  U   A N1    1 
ATOM   4303 C  C2    . U   B  1 41  ? 18.076  74.398  12.717 1.00 34.06  ? 55  U   A C2    1 
ATOM   4304 O  O2    . U   B  1 41  ? 18.208  74.726  11.550 1.00 32.55  ? 55  U   A O2    1 
ATOM   4305 N  N3    . U   B  1 41  ? 18.649  73.277  13.258 1.00 32.63  ? 55  U   A N3    1 
ATOM   4306 C  C4    . U   B  1 41  ? 18.546  72.819  14.552 1.00 33.31  ? 55  U   A C4    1 
ATOM   4307 O  O4    . U   B  1 41  ? 19.127  71.783  14.885 1.00 31.83  ? 55  U   A O4    1 
ATOM   4308 C  C5    . U   B  1 41  ? 17.741  73.638  15.403 1.00 33.90  ? 55  U   A C5    1 
ATOM   4309 C  C6    . U   B  1 41  ? 17.175  74.743  14.905 1.00 33.00  ? 55  U   A C6    1 
ATOM   4310 P  P     . G   B  1 42  ? 12.076  75.060  12.933 1.00 32.33  ? 56  G   A P     1 
ATOM   4311 O  OP1   . G   B  1 42  ? 10.808  75.667  12.464 1.00 30.87  ? 56  G   A OP1   1 
ATOM   4312 O  OP2   . G   B  1 42  ? 12.144  74.306  14.209 1.00 25.47  ? 56  G   A OP2   1 
ATOM   4313 O  "O5'" . G   B  1 42  ? 12.714  74.159  11.784 1.00 29.36  ? 56  G   A "O5'" 1 
ATOM   4314 C  "C5'" . G   B  1 42  ? 12.711  74.612  10.440 1.00 30.58  ? 56  G   A "C5'" 1 
ATOM   4315 C  "C4'" . G   B  1 42  ? 13.465  73.647  9.564  1.00 28.72  ? 56  G   A "C4'" 1 
ATOM   4316 O  "O4'" . G   B  1 42  ? 14.856  73.624  9.974  1.00 30.66  ? 56  G   A "O4'" 1 
ATOM   4317 C  "C3'" . G   B  1 42  ? 13.040  72.184  9.637  1.00 28.39  ? 56  G   A "C3'" 1 
ATOM   4318 O  "O3'" . G   B  1 42  ? 11.888  71.892  8.872  1.00 28.72  ? 56  G   A "O3'" 1 
ATOM   4319 C  "C2'" . G   B  1 42  ? 14.276  71.488  9.105  1.00 30.63  ? 56  G   A "C2'" 1 
ATOM   4320 O  "O2'" . G   B  1 42  ? 14.339  71.662  7.698  1.00 34.36  ? 56  G   A "O2'" 1 
ATOM   4321 C  "C1'" . G   B  1 42  ? 15.377  72.328  9.749  1.00 32.42  ? 56  G   A "C1'" 1 
ATOM   4322 N  N9    . G   B  1 42  ? 15.811  71.745  11.031 1.00 31.60  ? 56  G   A N9    1 
ATOM   4323 C  C8    . G   B  1 42  ? 15.513  72.151  12.308 1.00 32.84  ? 56  G   A C8    1 
ATOM   4324 N  N7    . G   B  1 42  ? 16.070  71.401  13.224 1.00 28.91  ? 56  G   A N7    1 
ATOM   4325 C  C5    . G   B  1 42  ? 16.770  70.439  12.507 1.00 31.13  ? 56  G   A C5    1 
ATOM   4326 C  C6    . G   B  1 42  ? 17.566  69.350  12.954 1.00 29.17  ? 56  G   A C6    1 
ATOM   4327 O  O6    . G   B  1 42  ? 17.819  69.016  14.121 1.00 24.35  ? 56  G   A O6    1 
ATOM   4328 N  N1    . G   B  1 42  ? 18.099  68.639  11.882 1.00 29.22  ? 56  G   A N1    1 
ATOM   4329 C  C2    . G   B  1 42  ? 17.878  68.920  10.548 1.00 33.31  ? 56  G   A C2    1 
ATOM   4330 N  N2    . G   B  1 42  ? 18.466  68.116  9.647  1.00 29.14  ? 56  G   A N2    1 
ATOM   4331 N  N3    . G   B  1 42  ? 17.132  69.926  10.125 1.00 31.58  ? 56  G   A N3    1 
ATOM   4332 C  C4    . G   B  1 42  ? 16.619  70.639  11.152 1.00 31.56  ? 56  G   A C4    1 
ATOM   4333 P  P     . C   B  1 43  ? 10.794  70.806  9.321  1.00 34.05  ? 57  C   A P     1 
ATOM   4334 O  OP1   . C   B  1 43  ? 9.672   71.023  8.371  1.00 29.66  ? 57  C   A OP1   1 
ATOM   4335 O  OP2   . C   B  1 43  ? 10.569  70.917  10.788 1.00 30.06  ? 57  C   A OP2   1 
ATOM   4336 O  "O5'" . C   B  1 43  ? 11.526  69.416  9.036  1.00 34.12  ? 57  C   A "O5'" 1 
ATOM   4337 C  "C5'" . C   B  1 43  ? 11.986  69.003  7.759  1.00 29.46  ? 57  C   A "C5'" 1 
ATOM   4338 C  "C4'" . C   B  1 43  ? 12.946  67.849  7.874  1.00 29.25  ? 57  C   A "C4'" 1 
ATOM   4339 O  "O4'" . C   B  1 43  ? 14.139  68.288  8.576  1.00 32.48  ? 57  C   A "O4'" 1 
ATOM   4340 C  "C3'" . C   B  1 43  ? 12.478  66.643  8.682  1.00 29.89  ? 57  C   A "C3'" 1 
ATOM   4341 O  "O3'" . C   B  1 43  ? 11.623  65.762  7.969  1.00 32.51  ? 57  C   A "O3'" 1 
ATOM   4342 C  "C2'" . C   B  1 43  ? 13.798  65.998  9.064  1.00 31.48  ? 57  C   A "C2'" 1 
ATOM   4343 O  "O2'" . C   B  1 43  ? 14.366  65.352  7.936  1.00 33.36  ? 57  C   A "O2'" 1 
ATOM   4344 C  "C1'" . C   B  1 43  ? 14.641  67.236  9.369  1.00 31.57  ? 57  C   A "C1'" 1 
ATOM   4345 N  N1    . C   B  1 43  ? 14.549  67.584  10.808 1.00 29.10  ? 57  C   A N1    1 
ATOM   4346 C  C2    . C   B  1 43  ? 15.383  66.874  11.667 1.00 30.63  ? 57  C   A C2    1 
ATOM   4347 O  O2    . C   B  1 43  ? 16.150  66.020  11.173 1.00 27.41  ? 57  C   A O2    1 
ATOM   4348 N  N3    . C   B  1 43  ? 15.341  67.139  12.994 1.00 25.45  ? 57  C   A N3    1 
ATOM   4349 C  C4    . C   B  1 43  ? 14.513  68.069  13.468 1.00 31.58  ? 57  C   A C4    1 
ATOM   4350 N  N4    . C   B  1 43  ? 14.540  68.285  14.787 1.00 29.14  ? 57  C   A N4    1 
ATOM   4351 C  C5    . C   B  1 43  ? 13.635  68.813  12.616 1.00 29.03  ? 57  C   A C5    1 
ATOM   4352 C  C6    . C   B  1 43  ? 13.688  68.533  11.299 1.00 30.26  ? 57  C   A C6    1 
ATOM   4353 P  P     . C   B  1 44  ? 10.570  64.776  8.692  1.00 32.53  ? 58  C   A P     1 
ATOM   4354 O  OP1   . C   B  1 44  ? 9.690   64.349  7.573  1.00 38.22  ? 58  C   A OP1   1 
ATOM   4355 O  OP2   . C   B  1 44  ? 9.964   65.499  9.836  1.00 34.01  ? 58  C   A OP2   1 
ATOM   4356 O  "O5'" . C   B  1 44  ? 11.384  63.537  9.250  1.00 32.03  ? 58  C   A "O5'" 1 
ATOM   4357 C  "C5'" . C   B  1 44  ? 12.123  62.661  8.416  1.00 29.27  ? 58  C   A "C5'" 1 
ATOM   4358 C  "C4'" . C   B  1 44  ? 12.991  61.772  9.264  1.00 31.18  ? 58  C   A "C4'" 1 
ATOM   4359 O  "O4'" . C   B  1 44  ? 13.934  62.567  10.028 1.00 29.82  ? 58  C   A "O4'" 1 
ATOM   4360 C  "C3'" . C   B  1 44  ? 12.257  60.989  10.338 1.00 26.13  ? 58  C   A "C3'" 1 
ATOM   4361 O  "O3'" . C   B  1 44  ? 11.598  59.857  9.816  1.00 26.77  ? 58  C   A "O3'" 1 
ATOM   4362 C  "C2'" . C   B  1 44  ? 13.370  60.651  11.310 1.00 25.73  ? 58  C   A "C2'" 1 
ATOM   4363 O  "O2'" . C   B  1 44  ? 14.196  59.632  10.765 1.00 28.37  ? 58  C   A "O2'" 1 
ATOM   4364 C  "C1'" . C   B  1 44  ? 14.153  61.959  11.289 1.00 27.78  ? 58  C   A "C1'" 1 
ATOM   4365 N  N1    . C   B  1 44  ? 13.738  62.902  12.358 1.00 26.86  ? 58  C   A N1    1 
ATOM   4366 C  C2    . C   B  1 44  ? 14.172  62.664  13.659 1.00 24.81  ? 58  C   A C2    1 
ATOM   4367 O  O2    . C   B  1 44  ? 14.872  61.663  13.864 1.00 26.68  ? 58  C   A O2    1 
ATOM   4368 N  N3    . C   B  1 44  ? 13.825  63.531  14.651 1.00 25.83  ? 58  C   A N3    1 
ATOM   4369 C  C4    . C   B  1 44  ? 13.077  64.599  14.365 1.00 25.97  ? 58  C   A C4    1 
ATOM   4370 N  N4    . C   B  1 44  ? 12.747  65.427  15.359 1.00 26.23  ? 58  C   A N4    1 
ATOM   4371 C  C5    . C   B  1 44  ? 12.622  64.869  13.043 1.00 24.59  ? 58  C   A C5    1 
ATOM   4372 C  C6    . C   B  1 44  ? 12.976  64.003  12.076 1.00 25.69  ? 58  C   A C6    1 
ATOM   4373 P  P     . C   B  1 45  ? 10.355  59.234  10.592 1.00 28.36  ? 59  C   A P     1 
ATOM   4374 O  OP1   . C   B  1 45  ? 9.860   58.118  9.740  1.00 29.27  ? 59  C   A OP1   1 
ATOM   4375 O  OP2   . C   B  1 45  ? 9.482   60.393  10.887 1.00 28.89  ? 59  C   A OP2   1 
ATOM   4376 O  "O5'" . C   B  1 45  ? 10.978  58.663  11.940 1.00 25.67  ? 59  C   A "O5'" 1 
ATOM   4377 C  "C5'" . C   B  1 45  ? 11.942  57.626  11.958 1.00 26.99  ? 59  C   A "C5'" 1 
ATOM   4378 C  "C4'" . C   B  1 45  ? 12.343  57.305  13.378 1.00 25.92  ? 59  C   A "C4'" 1 
ATOM   4379 O  "O4'" . C   B  1 45  ? 13.014  58.453  13.959 1.00 23.67  ? 59  C   A "O4'" 1 
ATOM   4380 C  "C3'" . C   B  1 45  ? 11.213  57.023  14.353 1.00 25.19  ? 59  C   A "C3'" 1 
ATOM   4381 O  "O3'" . C   B  1 45  ? 10.699  55.708  14.267 1.00 24.20  ? 59  C   A "O3'" 1 
ATOM   4382 C  "C2'" . C   B  1 45  ? 11.855  57.322  15.699 1.00 23.49  ? 59  C   A "C2'" 1 
ATOM   4383 O  "O2'" . C   B  1 45  ? 12.723  56.261  16.072 1.00 22.82  ? 59  C   A "O2'" 1 
ATOM   4384 C  "C1'" . C   B  1 45  ? 12.720  58.530  15.339 1.00 23.15  ? 59  C   A "C1'" 1 
ATOM   4385 N  N1    . C   B  1 45  ? 12.078  59.831  15.656 1.00 22.46  ? 59  C   A N1    1 
ATOM   4386 C  C2    . C   B  1 45  ? 12.021  60.197  17.000 1.00 22.53  ? 59  C   A C2    1 
ATOM   4387 O  O2    . C   B  1 45  ? 12.490  59.411  17.841 1.00 22.03  ? 59  C   A O2    1 
ATOM   4388 N  N3    . C   B  1 45  ? 11.456  61.378  17.333 1.00 23.98  ? 59  C   A N3    1 
ATOM   4389 C  C4    . C   B  1 45  ? 10.958  62.188  16.395 1.00 24.39  ? 59  C   A C4    1 
ATOM   4390 N  N4    . C   B  1 45  ? 10.414  63.346  16.781 1.00 24.37  ? 59  C   A N4    1 
ATOM   4391 C  C5    . C   B  1 45  ? 10.997  61.841  15.013 1.00 22.81  ? 59  C   A C5    1 
ATOM   4392 C  C6    . C   B  1 45  ? 11.562  60.666  14.701 1.00 22.16  ? 59  C   A C6    1 
ATOM   4393 P  P     . A   B  1 46  ? 9.161   55.427  14.613 1.00 24.12  ? 60  A   A P     1 
ATOM   4394 O  OP1   . A   B  1 46  ? 8.902   54.061  14.109 1.00 26.20  ? 60  A   A OP1   1 
ATOM   4395 O  OP2   . A   B  1 46  ? 8.397   56.558  14.030 1.00 26.52  ? 60  A   A OP2   1 
ATOM   4396 O  "O5'" . A   B  1 46  ? 9.090   55.464  16.216 1.00 22.93  ? 60  A   A "O5'" 1 
ATOM   4397 C  "C5'" . A   B  1 46  ? 9.828   54.508  16.966 1.00 23.84  ? 60  A   A "C5'" 1 
ATOM   4398 C  "C4'" . A   B  1 46  ? 9.813   54.815  18.437 1.00 24.68  ? 60  A   A "C4'" 1 
ATOM   4399 O  "O4'" . A   B  1 46  ? 10.574  56.025  18.688 1.00 22.17  ? 60  A   A "O4'" 1 
ATOM   4400 C  "C3'" . A   B  1 46  ? 8.451   55.137  19.030 1.00 23.89  ? 60  A   A "C3'" 1 
ATOM   4401 O  "O3'" . A   B  1 46  ? 7.667   53.988  19.292 1.00 25.75  ? 60  A   A "O3'" 1 
ATOM   4402 C  "C2'" . A   B  1 46  ? 8.838   55.907  20.281 1.00 23.84  ? 60  A   A "C2'" 1 
ATOM   4403 O  "O2'" . A   B  1 46  ? 9.423   55.037  21.238 1.00 25.33  ? 60  A   A "O2'" 1 
ATOM   4404 C  "C1'" . A   B  1 46  ? 9.964   56.761  19.725 1.00 24.80  ? 60  A   A "C1'" 1 
ATOM   4405 N  N9    . A   B  1 46  ? 9.450   58.030  19.183 1.00 22.72  ? 60  A   A N9    1 
ATOM   4406 C  C8    . A   B  1 46  ? 9.230   58.361  17.877 1.00 23.57  ? 60  A   A C8    1 
ATOM   4407 N  N7    . A   B  1 46  ? 8.769   59.571  17.727 1.00 24.80  ? 60  A   A N7    1 
ATOM   4408 C  C5    . A   B  1 46  ? 8.703   60.073  19.022 1.00 22.73  ? 60  A   A C5    1 
ATOM   4409 C  C6    . A   B  1 46  ? 8.292   61.316  19.541 1.00 25.92  ? 60  A   A C6    1 
ATOM   4410 N  N6    . A   B  1 46  ? 7.864   62.328  18.778 1.00 26.55  ? 60  A   A N6    1 
ATOM   4411 N  N1    . A   B  1 46  ? 8.338   61.493  20.883 1.00 21.90  ? 60  A   A N1    1 
ATOM   4412 C  C2    . A   B  1 46  ? 8.763   60.475  21.638 1.00 23.79  ? 60  A   A C2    1 
ATOM   4413 N  N3    . A   B  1 46  ? 9.173   59.258  21.260 1.00 25.76  ? 60  A   A N3    1 
ATOM   4414 C  C4    . A   B  1 46  ? 9.111   59.125  19.925 1.00 24.94  ? 60  A   A C4    1 
ATOM   4415 P  P     . A   B  1 47  ? 6.080   54.078  19.107 1.00 26.29  ? 61  A   A P     1 
ATOM   4416 O  OP1   . A   B  1 47  ? 5.582   52.702  19.320 1.00 28.02  ? 61  A   A OP1   1 
ATOM   4417 O  OP2   . A   B  1 47  ? 5.820   54.772  17.841 1.00 26.61  ? 61  A   A OP2   1 
ATOM   4418 O  "O5'" . A   B  1 47  ? 5.577   54.982  20.313 1.00 25.13  ? 61  A   A "O5'" 1 
ATOM   4419 C  "C5'" . A   B  1 47  ? 5.834   54.665  21.676 1.00 25.08  ? 61  A   A "C5'" 1 
ATOM   4420 C  "C4'" . A   B  1 47  ? 5.504   55.853  22.552 1.00 25.54  ? 61  A   A "C4'" 1 
ATOM   4421 O  "O4'" . A   B  1 47  ? 6.353   56.974  22.195 1.00 26.30  ? 61  A   A "O4'" 1 
ATOM   4422 C  "C3'" . A   B  1 47  ? 4.099   56.404  22.367 1.00 23.27  ? 61  A   A "C3'" 1 
ATOM   4423 O  "O3'" . A   B  1 47  ? 3.152   55.675  23.111 1.00 30.33  ? 61  A   A "O3'" 1 
ATOM   4424 C  "C2'" . A   B  1 47  ? 4.241   57.850  22.818 1.00 26.07  ? 61  A   A "C2'" 1 
ATOM   4425 O  "O2'" . A   B  1 47  ? 4.320   57.914  24.236 1.00 27.77  ? 61  A   A "O2'" 1 
ATOM   4426 C  "C1'" . A   B  1 47  ? 5.614   58.182  22.235 1.00 25.93  ? 61  A   A "C1'" 1 
ATOM   4427 N  N9    . A   B  1 47  ? 5.473   58.694  20.858 1.00 26.51  ? 61  A   A N9    1 
ATOM   4428 C  C8    . A   B  1 47  ? 5.611   57.997  19.683 1.00 26.23  ? 61  A   A C8    1 
ATOM   4429 N  N7    . A   B  1 47  ? 5.395   58.729  18.608 1.00 24.72  ? 61  A   A N7    1 
ATOM   4430 C  C5    . A   B  1 47  ? 5.104   59.988  19.103 1.00 26.62  ? 61  A   A C5    1 
ATOM   4431 C  C6    . A   B  1 47  ? 4.796   61.207  18.465 1.00 27.31  ? 61  A   A C6    1 
ATOM   4432 N  N6    . A   B  1 47  ? 4.726   61.354  17.133 1.00 27.72  ? 61  A   A N6    1 
ATOM   4433 N  N1    . A   B  1 47  ? 4.554   62.271  19.252 1.00 26.54  ? 61  A   A N1    1 
ATOM   4434 C  C2    . A   B  1 47  ? 4.624   62.123  20.579 1.00 26.89  ? 61  A   A C2    1 
ATOM   4435 N  N3    . A   B  1 47  ? 4.910   61.037  21.289 1.00 28.31  ? 61  A   A N3    1 
ATOM   4436 C  C4    . A   B  1 47  ? 5.146   59.984  20.487 1.00 26.59  ? 61  A   A C4    1 
ATOM   4437 P  P     . A   B  1 48  ? 1.796   55.182  22.427 1.00 28.67  ? 62  A   A P     1 
ATOM   4438 O  OP1   . A   B  1 48  ? 1.234   54.264  23.435 1.00 30.79  ? 62  A   A OP1   1 
ATOM   4439 O  OP2   . A   B  1 48  ? 2.027   54.682  21.048 1.00 28.19  ? 62  A   A OP2   1 
ATOM   4440 O  "O5'" . A   B  1 48  ? 0.985   56.542  22.344 1.00 28.52  ? 62  A   A "O5'" 1 
ATOM   4441 C  "C5'" . A   B  1 48  ? -0.350  56.488  21.867 1.00 31.10  ? 62  A   A "C5'" 1 
ATOM   4442 C  "C4'" . A   B  1 48  ? -1.288  57.101  22.870 1.00 30.34  ? 62  A   A "C4'" 1 
ATOM   4443 O  "O4'" . A   B  1 48  ? -0.936  58.485  23.112 1.00 34.42  ? 62  A   A "O4'" 1 
ATOM   4444 C  "C3'" . A   B  1 48  ? -2.744  57.154  22.454 1.00 32.44  ? 62  A   A "C3'" 1 
ATOM   4445 O  "O3'" . A   B  1 48  ? -3.376  55.909  22.672 1.00 34.11  ? 62  A   A "O3'" 1 
ATOM   4446 C  "C2'" . A   B  1 48  ? -3.294  58.287  23.312 1.00 35.72  ? 62  A   A "C2'" 1 
ATOM   4447 O  "O2'" . A   B  1 48  ? -3.547  57.835  24.636 1.00 33.75  ? 62  A   A "O2'" 1 
ATOM   4448 C  "C1'" . A   B  1 48  ? -2.102  59.245  23.348 1.00 35.57  ? 62  A   A "C1'" 1 
ATOM   4449 N  N9    . A   B  1 48  ? -2.186  60.273  22.296 1.00 34.38  ? 62  A   A N9    1 
ATOM   4450 C  C8    . A   B  1 48  ? -1.600  60.262  21.055 1.00 33.33  ? 62  A   A C8    1 
ATOM   4451 N  N7    . A   B  1 48  ? -1.863  61.331  20.342 1.00 34.93  ? 62  A   A N7    1 
ATOM   4452 C  C5    . A   B  1 48  ? -2.671  62.091  21.173 1.00 33.17  ? 62  A   A C5    1 
ATOM   4453 C  C6    . A   B  1 48  ? -3.290  63.338  21.006 1.00 38.23  ? 62  A   A C6    1 
ATOM   4454 N  N6    . A   B  1 48  ? -3.185  64.082  19.899 1.00 40.16  ? 62  A   A N6    1 
ATOM   4455 N  N1    . A   B  1 48  ? -4.040  63.804  22.036 1.00 44.24  ? 62  A   A N1    1 
ATOM   4456 C  C2    . A   B  1 48  ? -4.150  63.064  23.150 1.00 39.83  ? 62  A   A C2    1 
ATOM   4457 N  N3    . A   B  1 48  ? -3.607  61.877  23.419 1.00 37.31  ? 62  A   A N3    1 
ATOM   4458 C  C4    . A   B  1 48  ? -2.874  61.451  22.380 1.00 34.81  ? 62  A   A C4    1 
ATOM   4459 P  P     . A   B  1 49  ? -4.305  55.258  21.540 1.00 37.35  ? 63  A   A P     1 
ATOM   4460 O  OP1   . A   B  1 49  ? -4.638  53.910  22.054 1.00 36.03  ? 63  A   A OP1   1 
ATOM   4461 O  OP2   . A   B  1 49  ? -3.592  55.389  20.248 1.00 36.43  ? 63  A   A OP2   1 
ATOM   4462 O  "O5'" . A   B  1 49  ? -5.582  56.189  21.544 1.00 41.18  ? 63  A   A "O5'" 1 
ATOM   4463 C  "C5'" . A   B  1 49  ? -6.397  56.288  22.698 1.00 40.65  ? 63  A   A "C5'" 1 
ATOM   4464 C  "C4'" . A   B  1 49  ? -7.464  57.329  22.501 1.00 40.94  ? 63  A   A "C4'" 1 
ATOM   4465 O  "O4'" . A   B  1 49  ? -6.881  58.658  22.566 1.00 40.50  ? 63  A   A "O4'" 1 
ATOM   4466 C  "C3'" . A   B  1 49  ? -8.152  57.307  21.146 1.00 43.09  ? 63  A   A "C3'" 1 
ATOM   4467 O  "O3'" . A   B  1 49  ? -9.126  56.287  21.029 1.00 46.86  ? 63  A   A "O3'" 1 
ATOM   4468 C  "C2'" . A   B  1 49  ? -8.715  58.716  21.080 1.00 44.44  ? 63  A   A "C2'" 1 
ATOM   4469 O  "O2'" . A   B  1 49  ? -9.807  58.839  21.985 1.00 44.99  ? 63  A   A "O2'" 1 
ATOM   4470 C  "C1'" . A   B  1 49  ? -7.534  59.505  21.644 1.00 43.78  ? 63  A   A "C1'" 1 
ATOM   4471 N  N9    . A   B  1 49  ? -6.565  59.843  20.584 1.00 43.35  ? 63  A   A N9    1 
ATOM   4472 C  C8    . A   B  1 49  ? -5.495  59.080  20.193 1.00 42.25  ? 63  A   A C8    1 
ATOM   4473 N  N7    . A   B  1 49  ? -4.794  59.606  19.222 1.00 40.98  ? 63  A   A N7    1 
ATOM   4474 C  C5    . A   B  1 49  ? -5.435  60.802  18.950 1.00 43.94  ? 63  A   A C5    1 
ATOM   4475 C  C6    . A   B  1 49  ? -5.170  61.821  18.017 1.00 45.14  ? 63  A   A C6    1 
ATOM   4476 N  N6    . A   B  1 49  ? -4.154  61.802  17.150 1.00 42.52  ? 63  A   A N6    1 
ATOM   4477 N  N1    . A   B  1 49  ? -6.001  62.881  18.001 1.00 47.19  ? 63  A   A N1    1 
ATOM   4478 C  C2    . A   B  1 49  ? -7.020  62.897  18.867 1.00 47.88  ? 63  A   A C2    1 
ATOM   4479 N  N3    . A   B  1 49  ? -7.370  62.003  19.786 1.00 45.45  ? 63  A   A N3    1 
ATOM   4480 C  C4    . A   B  1 49  ? -6.528  60.961  19.783 1.00 44.85  ? 63  A   A C4    1 
ATOM   4481 P  P     . A   B  1 50  ? -9.372  55.554  19.616 1.00 51.70  ? 64  A   A P     1 
ATOM   4482 O  OP1   . A   B  1 50  ? -10.519 54.637  19.836 1.00 51.81  ? 64  A   A OP1   1 
ATOM   4483 O  OP2   . A   B  1 50  ? -8.064  54.996  19.165 1.00 46.62  ? 64  A   A OP2   1 
ATOM   4484 O  "O5'" . A   B  1 50  ? -9.787  56.761  18.665 1.00 47.12  ? 64  A   A "O5'" 1 
ATOM   4485 C  "C5'" . A   B  1 50  ? -11.046 57.410  18.767 1.00 48.07  ? 64  A   A "C5'" 1 
ATOM   4486 C  "C4'" . A   B  1 50  ? -11.216 58.422  17.666 1.00 47.69  ? 64  A   A "C4'" 1 
ATOM   4487 O  "O4'" . A   B  1 50  ? -10.148 59.399  17.758 1.00 49.22  ? 64  A   A "O4'" 1 
ATOM   4488 C  "C3'" . A   B  1 50  ? -11.102 57.883  16.247 1.00 51.59  ? 64  A   A "C3'" 1 
ATOM   4489 O  "O3'" . A   B  1 50  ? -12.305 57.315  15.761 1.00 47.85  ? 64  A   A "O3'" 1 
ATOM   4490 C  "C2'" . A   B  1 50  ? -10.648 59.103  15.459 1.00 53.22  ? 64  A   A "C2'" 1 
ATOM   4491 O  "O2'" . A   B  1 50  ? -11.752 59.962  15.203 1.00 54.21  ? 64  A   A "O2'" 1 
ATOM   4492 C  "C1'" . A   B  1 50  ? -9.722  59.778  16.470 1.00 50.88  ? 64  A   A "C1'" 1 
ATOM   4493 N  N9    . A   B  1 50  ? -8.327  59.333  16.314 1.00 47.12  ? 64  A   A N9    1 
ATOM   4494 C  C8    . A   B  1 50  ? -7.661  58.356  17.007 1.00 47.81  ? 64  A   A C8    1 
ATOM   4495 N  N7    . A   B  1 50  ? -6.413  58.205  16.623 1.00 47.05  ? 64  A   A N7    1 
ATOM   4496 C  C5    . A   B  1 50  ? -6.254  59.143  15.613 1.00 47.98  ? 64  A   A C5    1 
ATOM   4497 C  C6    . A   B  1 50  ? -5.163  59.496  14.794 1.00 50.66  ? 64  A   A C6    1 
ATOM   4498 N  N6    . A   B  1 50  ? -3.957  58.923  14.854 1.00 43.31  ? 64  A   A N6    1 
ATOM   4499 N  N1    . A   B  1 50  ? -5.352  60.484  13.891 1.00 51.73  ? 64  A   A N1    1 
ATOM   4500 C  C2    . A   B  1 50  ? -6.557  61.068  13.820 1.00 52.80  ? 64  A   A C2    1 
ATOM   4501 N  N3    . A   B  1 50  ? -7.655  60.825  14.531 1.00 51.29  ? 64  A   A N3    1 
ATOM   4502 C  C4    . A   B  1 50  ? -7.430  59.843  15.419 1.00 48.90  ? 64  A   A C4    1 
ATOM   4503 P  P     . U   B  1 51  ? -12.257 55.914  14.974 1.00 56.22  ? 65  U   A P     1 
ATOM   4504 O  OP1   . U   B  1 51  ? -13.633 55.682  14.472 1.00 57.50  ? 65  U   A OP1   1 
ATOM   4505 O  OP2   . U   B  1 51  ? -11.636 54.900  15.868 1.00 55.83  ? 65  U   A OP2   1 
ATOM   4506 O  "O5'" . U   B  1 51  ? -11.306 56.230  13.751 1.00 51.29  ? 65  U   A "O5'" 1 
ATOM   4507 C  "C5'" . U   B  1 51  ? -11.752 57.087  12.714 1.00 53.25  ? 65  U   A "C5'" 1 
ATOM   4508 C  "C4'" . U   B  1 51  ? -10.631 57.377  11.756 1.00 55.64  ? 65  U   A "C4'" 1 
ATOM   4509 O  "O4'" . U   B  1 51  ? -9.508  57.927  12.499 1.00 55.34  ? 65  U   A "O4'" 1 
ATOM   4510 C  "C3'" . U   B  1 51  ? -10.032 56.165  11.055 1.00 52.93  ? 65  U   A "C3'" 1 
ATOM   4511 O  "O3'" . U   B  1 51  ? -10.796 55.681  9.962  1.00 48.80  ? 65  U   A "O3'" 1 
ATOM   4512 C  "C2'" . U   B  1 51  ? -8.651  56.685  10.681 1.00 50.25  ? 65  U   A "C2'" 1 
ATOM   4513 O  "O2'" . U   B  1 51  ? -8.758  57.624  9.618  1.00 51.85  ? 65  U   A "O2'" 1 
ATOM   4514 C  "C1'" . U   B  1 51  ? -8.296  57.441  11.964 1.00 53.77  ? 65  U   A "C1'" 1 
ATOM   4515 N  N1    . U   B  1 51  ? -7.714  56.501  12.948 1.00 50.72  ? 65  U   A N1    1 
ATOM   4516 C  C2    . U   B  1 51  ? -6.342  56.351  12.966 1.00 49.69  ? 65  U   A C2    1 
ATOM   4517 O  O2    . U   B  1 51  ? -5.611  56.982  12.219 1.00 51.24  ? 65  U   A O2    1 
ATOM   4518 N  N3    . U   B  1 51  ? -5.872  55.442  13.893 1.00 47.56  ? 65  U   A N3    1 
ATOM   4519 C  C4    . U   B  1 51  ? -6.623  54.684  14.785 1.00 50.55  ? 65  U   A C4    1 
ATOM   4520 O  O4    . U   B  1 51  ? -6.065  53.906  15.571 1.00 47.71  ? 65  U   A O4    1 
ATOM   4521 C  C5    . U   B  1 51  ? -8.036  54.895  14.698 1.00 50.61  ? 65  U   A C5    1 
ATOM   4522 C  C6    . U   B  1 51  ? -8.511  55.772  13.806 1.00 51.57  ? 65  U   A C6    1 
ATOM   4523 P  P     . G   B  1 52  ? -10.803 54.098  9.651  1.00 55.33  ? 66  G   A P     1 
ATOM   4524 O  OP1   . G   B  1 52  ? -12.037 53.833  8.867  1.00 56.99  ? 66  G   A OP1   1 
ATOM   4525 O  OP2   . G   B  1 52  ? -10.607 53.410  10.952 1.00 51.68  ? 66  G   A OP2   1 
ATOM   4526 O  "O5'" . G   B  1 52  ? -9.506  53.869  8.756  1.00 43.12  ? 66  G   A "O5'" 1 
ATOM   4527 C  "C5'" . G   B  1 52  ? -9.315  54.551  7.530  1.00 41.23  ? 66  G   A "C5'" 1 
ATOM   4528 C  "C4'" . G   B  1 52  ? -7.995  54.166  6.924  1.00 37.40  ? 66  G   A "C4'" 1 
ATOM   4529 O  "O4'" . G   B  1 52  ? -6.935  54.507  7.854  1.00 38.04  ? 66  G   A "O4'" 1 
ATOM   4530 C  "C3'" . G   B  1 52  ? -7.796  52.680  6.671  1.00 36.01  ? 66  G   A "C3'" 1 
ATOM   4531 O  "O3'" . G   B  1 52  ? -8.387  52.248  5.458  1.00 35.78  ? 66  G   A "O3'" 1 
ATOM   4532 C  "C2'" . G   B  1 52  ? -6.279  52.539  6.697  1.00 34.96  ? 66  G   A "C2'" 1 
ATOM   4533 O  "O2'" . G   B  1 52  ? -5.706  53.045  5.498  1.00 35.14  ? 66  G   A "O2'" 1 
ATOM   4534 C  "C1'" . G   B  1 52  ? -5.922  53.525  7.805  1.00 34.43  ? 66  G   A "C1'" 1 
ATOM   4535 N  N9    . G   B  1 52  ? -5.804  52.903  9.138  1.00 32.62  ? 66  G   A N9    1 
ATOM   4536 C  C8    . G   B  1 52  ? -6.654  53.047  10.203 1.00 33.63  ? 66  G   A C8    1 
ATOM   4537 N  N7    . G   B  1 52  ? -6.250  52.392  11.257 1.00 35.21  ? 66  G   A N7    1 
ATOM   4538 C  C5    . G   B  1 52  ? -5.056  51.789  10.869 1.00 28.13  ? 66  G   A C5    1 
ATOM   4539 C  C6    . G   B  1 52  ? -4.153  50.949  11.583 1.00 29.39  ? 66  G   A C6    1 
ATOM   4540 O  O6    . G   B  1 52  ? -4.225  50.555  12.752 1.00 28.11  ? 66  G   A O6    1 
ATOM   4541 N  N1    . G   B  1 52  ? -3.069  50.567  10.805 1.00 27.93  ? 66  G   A N1    1 
ATOM   4542 C  C2    . G   B  1 52  ? -2.875  50.940  9.500  1.00 29.89  ? 66  G   A C2    1 
ATOM   4543 N  N2    . G   B  1 52  ? -1.765  50.472  8.898  1.00 26.82  ? 66  G   A N2    1 
ATOM   4544 N  N3    . G   B  1 52  ? -3.712  51.716  8.824  1.00 30.19  ? 66  G   A N3    1 
ATOM   4545 C  C4    . G   B  1 52  ? -4.767  52.105  9.566  1.00 30.52  ? 66  G   A C4    1 
ATOM   4546 P  P     . U   B  1 53  ? -9.124  50.829  5.305  1.00 37.51  ? 67  U   A P     1 
ATOM   4547 O  OP1   . U   B  1 53  ? -9.769  50.894  3.972  1.00 42.16  ? 67  U   A OP1   1 
ATOM   4548 O  OP2   . U   B  1 53  ? -9.928  50.540  6.515  1.00 42.25  ? 67  U   A OP2   1 
ATOM   4549 O  "O5'" . U   B  1 53  ? -7.925  49.799  5.217  1.00 31.82  ? 67  U   A "O5'" 1 
ATOM   4550 C  "C5'" . U   B  1 53  ? -7.108  49.771  4.063  1.00 29.94  ? 67  U   A "C5'" 1 
ATOM   4551 C  "C4'" . U   B  1 53  ? -5.848  49.003  4.346  1.00 27.92  ? 67  U   A "C4'" 1 
ATOM   4552 O  "O4'" . U   B  1 53  ? -5.191  49.605  5.483  1.00 28.05  ? 67  U   A "O4'" 1 
ATOM   4553 C  "C3'" . U   B  1 53  ? -6.043  47.557  4.770  1.00 26.53  ? 67  U   A "C3'" 1 
ATOM   4554 O  "O3'" . U   B  1 53  ? -6.261  46.679  3.677  1.00 25.98  ? 67  U   A "O3'" 1 
ATOM   4555 C  "C2'" . U   B  1 53  ? -4.752  47.280  5.522  1.00 26.72  ? 67  U   A "C2'" 1 
ATOM   4556 O  "O2'" . U   B  1 53  ? -3.685  47.186  4.590  1.00 22.97  ? 67  U   A "O2'" 1 
ATOM   4557 C  "C1'" . U   B  1 53  ? -4.580  48.600  6.269  1.00 25.63  ? 67  U   A "C1'" 1 
ATOM   4558 N  N1    . U   B  1 53  ? -5.156  48.624  7.631  1.00 25.46  ? 67  U   A N1    1 
ATOM   4559 C  C2    . U   B  1 53  ? -4.447  47.983  8.627  1.00 26.98  ? 67  U   A C2    1 
ATOM   4560 O  O2    . U   B  1 53  ? -3.431  47.389  8.408  1.00 27.03  ? 67  U   A O2    1 
ATOM   4561 N  N3    . U   B  1 53  ? -4.957  48.012  9.891  1.00 23.18  ? 67  U   A N3    1 
ATOM   4562 C  C4    . U   B  1 53  ? -6.118  48.632  10.271 1.00 26.92  ? 67  U   A C4    1 
ATOM   4563 O  O4    . U   B  1 53  ? -6.456  48.568  11.456 1.00 26.97  ? 67  U   A O4    1 
ATOM   4564 C  C5    . U   B  1 53  ? -6.816  49.283  9.193  1.00 29.14  ? 67  U   A C5    1 
ATOM   4565 C  C6    . U   B  1 53  ? -6.328  49.264  7.943  1.00 27.18  ? 67  U   A C6    1 
ATOM   4566 P  P     . C   B  1 54  ? -7.138  45.355  3.906  1.00 24.71  ? 68  C   A P     1 
ATOM   4567 O  OP1   . C   B  1 54  ? -7.344  44.748  2.564  1.00 28.92  ? 68  C   A OP1   1 
ATOM   4568 O  OP2   . C   B  1 54  ? -8.272  45.679  4.793  1.00 23.07  ? 68  C   A OP2   1 
ATOM   4569 O  "O5'" . C   B  1 54  ? -6.167  44.408  4.713  1.00 23.60  ? 68  C   A "O5'" 1 
ATOM   4570 C  "C5'" . C   B  1 54  ? -4.991  43.875  4.134  1.00 23.66  ? 68  C   A "C5'" 1 
ATOM   4571 C  "C4'" . C   B  1 54  ? -4.279  43.009  5.138  1.00 24.06  ? 68  C   A "C4'" 1 
ATOM   4572 O  "O4'" . C   B  1 54  ? -3.817  43.827  6.243  1.00 20.67  ? 68  C   A "O4'" 1 
ATOM   4573 C  "C3'" . C   B  1 54  ? -5.142  41.960  5.822  1.00 22.11  ? 68  C   A "C3'" 1 
ATOM   4574 O  "O3'" . C   B  1 54  ? -5.392  40.814  5.019  1.00 25.85  ? 68  C   A "O3'" 1 
ATOM   4575 C  "C2'" . C   B  1 54  ? -4.364  41.671  7.105  1.00 23.51  ? 68  C   A "C2'" 1 
ATOM   4576 O  "O2'" . C   B  1 54  ? -3.251  40.824  6.854  1.00 24.55  ? 68  C   A "O2'" 1 
ATOM   4577 C  "C1'" . C   B  1 54  ? -3.841  43.068  7.437  1.00 24.33  ? 68  C   A "C1'" 1 
ATOM   4578 N  N1    . C   B  1 54  ? -4.704  43.726  8.431  1.00 21.99  ? 68  C   A N1    1 
ATOM   4579 C  C2    . C   B  1 54  ? -4.494  43.381  9.763  1.00 23.39  ? 68  C   A C2    1 
ATOM   4580 O  O2    . C   B  1 54  ? -3.609  42.552  10.025 1.00 21.37  ? 68  C   A O2    1 
ATOM   4581 N  N3    . C   B  1 54  ? -5.263  43.952  10.717 1.00 26.15  ? 68  C   A N3    1 
ATOM   4582 C  C4    . C   B  1 54  ? -6.209  44.832  10.381 1.00 25.87  ? 68  C   A C4    1 
ATOM   4583 N  N4    . C   B  1 54  ? -6.928  45.374  11.373 1.00 21.97  ? 68  C   A N4    1 
ATOM   4584 C  C5    . C   B  1 54  ? -6.445  45.196  9.018  1.00 25.54  ? 68  C   A C5    1 
ATOM   4585 C  C6    . C   B  1 54  ? -5.676  44.623  8.084  1.00 22.47  ? 68  C   A C6    1 
ATOM   4586 P  P     . C   B  1 55  ? -6.779  40.008  5.202  1.00 26.71  ? 69  C   A P     1 
ATOM   4587 O  OP1   . C   B  1 55  ? -6.760  38.961  4.167  1.00 24.99  ? 69  C   A OP1   1 
ATOM   4588 O  OP2   . C   B  1 55  ? -7.934  40.933  5.288  1.00 24.07  ? 69  C   A OP2   1 
ATOM   4589 O  "O5'" . C   B  1 55  ? -6.565  39.374  6.651  1.00 23.54  ? 69  C   A "O5'" 1 
ATOM   4590 C  "C5'" . C   B  1 55  ? -5.518  38.450  6.909  1.00 22.17  ? 69  C   A "C5'" 1 
ATOM   4591 C  "C4'" . C   B  1 55  ? -5.561  38.015  8.352  1.00 24.34  ? 69  C   A "C4'" 1 
ATOM   4592 O  "O4'" . C   B  1 55  ? -5.254  39.148  9.219  1.00 22.74  ? 69  C   A "O4'" 1 
ATOM   4593 C  "C3'" . C   B  1 55  ? -6.931  37.548  8.821  1.00 21.12  ? 69  C   A "C3'" 1 
ATOM   4594 O  "O3'" . C   B  1 55  ? -7.180  36.204  8.461  1.00 22.76  ? 69  C   A "O3'" 1 
ATOM   4595 C  "C2'" . C   B  1 55  ? -6.857  37.788  10.322 1.00 24.10  ? 69  C   A "C2'" 1 
ATOM   4596 O  "O2'" . C   B  1 55  ? -6.124  36.750  10.943 1.00 23.08  ? 69  C   A "O2'" 1 
ATOM   4597 C  "C1'" . C   B  1 55  ? -6.024  39.072  10.392 1.00 22.23  ? 69  C   A "C1'" 1 
ATOM   4598 N  N1    . C   B  1 55  ? -6.883  40.263  10.518 1.00 23.54  ? 69  C   A N1    1 
ATOM   4599 C  C2    . C   B  1 55  ? -7.077  40.753  11.807 1.00 24.98  ? 69  C   A C2    1 
ATOM   4600 O  O2    . C   B  1 55  ? -6.488  40.151  12.713 1.00 26.34  ? 69  C   A O2    1 
ATOM   4601 N  N3    . C   B  1 55  ? -7.887  41.822  12.007 1.00 26.34  ? 69  C   A N3    1 
ATOM   4602 C  C4    . C   B  1 55  ? -8.487  42.397  10.951 1.00 27.74  ? 69  C   A C4    1 
ATOM   4603 N  N4    . C   B  1 55  ? -9.271  43.458  11.149 1.00 32.59  ? 69  C   A N4    1 
ATOM   4604 C  C5    . C   B  1 55  ? -8.304  41.917  9.624  1.00 25.31  ? 69  C   A C5    1 
ATOM   4605 C  C6    . C   B  1 55  ? -7.510  40.851  9.452  1.00 24.04  ? 69  C   A C6    1 
ATOM   4606 P  P     . A   B  1 56  ? -8.636  35.660  8.014  1.00 25.36  ? 70  A   A P     1 
ATOM   4607 O  OP1   . A   B  1 56  ? -8.366  34.394  7.306  1.00 25.50  ? 70  A   A OP1   1 
ATOM   4608 O  OP2   . A   B  1 56  ? -9.384  36.739  7.335  1.00 25.57  ? 70  A   A OP2   1 
ATOM   4609 O  "O5'" . A   B  1 56  ? -9.319  35.372  9.421  1.00 24.76  ? 70  A   A "O5'" 1 
ATOM   4610 C  "C5'" . A   B  1 56  ? -10.616 34.800  9.446  1.00 26.24  ? 70  A   A "C5'" 1 
ATOM   4611 C  "C4'" . A   B  1 56  ? -10.868 34.129  10.766 1.00 23.77  ? 70  A   A "C4'" 1 
ATOM   4612 O  "O4'" . A   B  1 56  ? -10.131 32.882  10.827 1.00 20.86  ? 70  A   A "O4'" 1 
ATOM   4613 C  "C3'" . A   B  1 56  ? -10.411 34.927  11.978 1.00 23.46  ? 70  A   A "C3'" 1 
ATOM   4614 O  "O3'" . A   B  1 56  ? -11.386 35.876  12.379 1.00 24.95  ? 70  A   A "O3'" 1 
ATOM   4615 C  "C2'" . A   B  1 56  ? -10.217 33.826  13.003 1.00 22.75  ? 70  A   A "C2'" 1 
ATOM   4616 O  "O2'" . A   B  1 56  ? -11.498 33.423  13.465 1.00 24.32  ? 70  A   A "O2'" 1 
ATOM   4617 C  "C1'" . A   B  1 56  ? -9.648  32.696  12.143 1.00 22.83  ? 70  A   A "C1'" 1 
ATOM   4618 N  N9    . A   B  1 56  ? -8.168  32.683  12.092 1.00 24.26  ? 70  A   A N9    1 
ATOM   4619 C  C8    . A   B  1 56  ? -7.347  33.112  11.072 1.00 22.41  ? 70  A   A C8    1 
ATOM   4620 N  N7    . A   B  1 56  ? -6.056  32.926  11.300 1.00 19.91  ? 70  A   A N7    1 
ATOM   4621 C  C5    . A   B  1 56  ? -6.040  32.324  12.560 1.00 22.15  ? 70  A   A C5    1 
ATOM   4622 C  C6    . A   B  1 56  ? -4.988  31.883  13.395 1.00 19.59  ? 70  A   A C6    1 
ATOM   4623 N  N6    . A   B  1 56  ? -3.688  31.949  13.080 1.00 19.48  ? 70  A   A N6    1 
ATOM   4624 N  N1    . A   B  1 56  ? -5.316  31.319  14.571 1.00 17.67  ? 70  A   A N1    1 
ATOM   4625 C  C2    . A   B  1 56  ? -6.610  31.227  14.912 1.00 21.73  ? 70  A   A C2    1 
ATOM   4626 N  N3    . A   B  1 56  ? -7.690  31.625  14.229 1.00 22.21  ? 70  A   A N3    1 
ATOM   4627 C  C4    . A   B  1 56  ? -7.329  32.171  13.051 1.00 19.99  ? 70  A   A C4    1 
ATOM   4628 P  P     . A   B  1 57  ? -11.114 37.361  12.932 1.00 26.63  ? 71  A   A P     1 
ATOM   4629 O  OP1   . A   B  1 57  ? -12.438 38.022  12.992 1.00 28.97  ? 71  A   A OP1   1 
ATOM   4630 O  OP2   . A   B  1 57  ? -10.077 38.018  12.104 1.00 23.26  ? 71  A   A OP2   1 
ATOM   4631 O  "O5'" . A   B  1 57  ? -10.574 37.103  14.402 1.00 26.30  ? 71  A   A "O5'" 1 
ATOM   4632 C  "C5'" . A   B  1 57  ? -11.375 36.445  15.370 1.00 25.35  ? 71  A   A "C5'" 1 
ATOM   4633 C  "C4'" . A   B  1 57  ? -10.532 35.952  16.518 1.00 21.59  ? 71  A   A "C4'" 1 
ATOM   4634 O  "O4'" . A   B  1 57  ? -9.679  34.868  16.061 1.00 21.13  ? 71  A   A "O4'" 1 
ATOM   4635 C  "C3'" . A   B  1 57  ? -9.578  36.971  17.128 1.00 24.77  ? 71  A   A "C3'" 1 
ATOM   4636 O  "O3'" . A   B  1 57  ? -10.208 37.786  18.110 1.00 25.35  ? 71  A   A "O3'" 1 
ATOM   4637 C  "C2'" . A   B  1 57  ? -8.506  36.067  17.713 1.00 22.08  ? 71  A   A "C2'" 1 
ATOM   4638 O  "O2'" . A   B  1 57  ? -9.050  35.446  18.865 1.00 22.16  ? 71  A   A "O2'" 1 
ATOM   4639 C  "C1'" . A   B  1 57  ? -8.402  34.975  16.649 1.00 20.72  ? 71  A   A "C1'" 1 
ATOM   4640 N  N9    . A   B  1 57  ? -7.434  35.266  15.569 1.00 18.11  ? 71  A   A N9    1 
ATOM   4641 C  C8    . A   B  1 57  ? -7.647  35.930  14.388 1.00 22.19  ? 71  A   A C8    1 
ATOM   4642 N  N7    . A   B  1 57  ? -6.589  36.002  13.600 1.00 20.75  ? 71  A   A N7    1 
ATOM   4643 C  C5    . A   B  1 57  ? -5.617  35.308  14.308 1.00 21.11  ? 71  A   A C5    1 
ATOM   4644 C  C6    . A   B  1 57  ? -4.266  35.015  14.030 1.00 19.54  ? 71  A   A C6    1 
ATOM   4645 N  N6    . A   B  1 57  ? -3.639  35.389  12.915 1.00 19.58  ? 71  A   A N6    1 
ATOM   4646 N  N1    . A   B  1 57  ? -3.572  34.320  14.957 1.00 19.35  ? 71  A   A N1    1 
ATOM   4647 C  C2    . A   B  1 57  ? -4.205  33.942  16.076 1.00 19.84  ? 71  A   A C2    1 
ATOM   4648 N  N3    . A   B  1 57  ? -5.473  34.153  16.448 1.00 20.03  ? 71  A   A N3    1 
ATOM   4649 C  C4    . A   B  1 57  ? -6.127  34.854  15.514 1.00 19.39  ? 71  A   A C4    1 
ATOM   4650 P  P     . A   B  1 58  ? -9.662  39.227  18.562 1.00 26.21  ? 72  A   A P     1 
ATOM   4651 O  OP1   . A   B  1 58  ? -10.584 39.712  19.624 1.00 24.07  ? 72  A   A OP1   1 
ATOM   4652 O  OP2   . A   B  1 58  ? -9.453  40.032  17.335 1.00 23.16  ? 72  A   A OP2   1 
ATOM   4653 O  "O5'" . A   B  1 58  ? -8.241  38.918  19.235 1.00 21.69  ? 72  A   A "O5'" 1 
ATOM   4654 C  "C5'" . A   B  1 58  ? -8.148  38.200  20.456 1.00 23.92  ? 72  A   A "C5'" 1 
ATOM   4655 C  "C4'" . A   B  1 58  ? -6.713  37.844  20.770 1.00 22.69  ? 72  A   A "C4'" 1 
ATOM   4656 O  "O4'" . A   B  1 58  ? -6.210  36.927  19.762 1.00 22.96  ? 72  A   A "O4'" 1 
ATOM   4657 C  "C3'" . A   B  1 58  ? -5.737  39.008  20.757 1.00 20.92  ? 72  A   A "C3'" 1 
ATOM   4658 O  "O3'" . A   B  1 58  ? -5.731  39.747  21.974 1.00 23.11  ? 72  A   A "O3'" 1 
ATOM   4659 C  "C2'" . A   B  1 58  ? -4.421  38.319  20.442 1.00 17.95  ? 72  A   A "C2'" 1 
ATOM   4660 O  "O2'" . A   B  1 58  ? -3.917  37.688  21.605 1.00 19.37  ? 72  A   A "O2'" 1 
ATOM   4661 C  "C1'" . A   B  1 58  ? -4.861  37.231  19.454 1.00 19.57  ? 72  A   A "C1'" 1 
ATOM   4662 N  N9    . A   B  1 58  ? -4.805  37.705  18.054 1.00 19.06  ? 72  A   A N9    1 
ATOM   4663 C  C8    . A   B  1 58  ? -5.786  38.442  17.426 1.00 19.75  ? 72  A   A C8    1 
ATOM   4664 N  N7    . A   B  1 58  ? -5.500  38.740  16.180 1.00 20.49  ? 72  A   A N7    1 
ATOM   4665 C  C5    . A   B  1 58  ? -4.258  38.163  15.964 1.00 19.77  ? 72  A   A C5    1 
ATOM   4666 C  C6    . A   B  1 58  ? -3.418  38.139  14.830 1.00 17.93  ? 72  A   A C6    1 
ATOM   4667 N  N6    . A   B  1 58  ? -3.724  38.725  13.660 1.00 18.06  ? 72  A   A N6    1 
ATOM   4668 N  N1    . A   B  1 58  ? -2.238  37.504  14.947 1.00 18.84  ? 72  A   A N1    1 
ATOM   4669 C  C2    . A   B  1 58  ? -1.932  36.906  16.111 1.00 20.29  ? 72  A   A C2    1 
ATOM   4670 N  N3    . A   B  1 58  ? -2.639  36.866  17.242 1.00 20.51  ? 72  A   A N3    1 
ATOM   4671 C  C4    . A   B  1 58  ? -3.808  37.528  17.112 1.00 17.32  ? 72  A   A C4    1 
ATOM   4672 P  P     . G   B  1 59  ? -5.439  41.324  22.019 1.00 25.23  ? 73  G   A P     1 
ATOM   4673 O  OP1   . G   B  1 59  ? -5.840  41.811  23.363 1.00 26.17  ? 73  G   A OP1   1 
ATOM   4674 O  OP2   . G   B  1 59  ? -6.066  41.935  20.819 1.00 24.31  ? 73  G   A OP2   1 
ATOM   4675 O  "O5'" . G   B  1 59  ? -3.847  41.386  21.878 1.00 24.46  ? 73  G   A "O5'" 1 
ATOM   4676 C  "C5'" . G   B  1 59  ? -3.182  42.346  21.071 1.00 22.94  ? 73  G   A "C5'" 1 
ATOM   4677 C  "C4'" . G   B  1 59  ? -2.471  41.643  19.937 1.00 22.61  ? 73  G   A "C4'" 1 
ATOM   4678 O  "O4'" . G   B  1 59  ? -3.440  40.969  19.087 1.00 21.15  ? 73  G   A "O4'" 1 
ATOM   4679 C  "C3'" . G   B  1 59  ? -1.664  42.518  18.992 1.00 20.02  ? 73  G   A "C3'" 1 
ATOM   4680 O  "O3'" . G   B  1 59  ? -0.370  42.763  19.505 1.00 22.72  ? 73  G   A "O3'" 1 
ATOM   4681 C  "C2'" . G   B  1 59  ? -1.623  41.668  17.737 1.00 20.46  ? 73  G   A "C2'" 1 
ATOM   4682 O  "O2'" . G   B  1 59  ? -0.682  40.619  17.955 1.00 19.04  ? 73  G   A "O2'" 1 
ATOM   4683 C  "C1'" . G   B  1 59  ? -3.035  41.071  17.737 1.00 20.01  ? 73  G   A "C1'" 1 
ATOM   4684 N  N9    . G   B  1 59  ? -4.019  41.938  17.052 1.00 21.71  ? 73  G   A N9    1 
ATOM   4685 C  C8    . G   B  1 59  ? -5.066  42.621  17.639 1.00 24.13  ? 73  G   A C8    1 
ATOM   4686 N  N7    . G   B  1 59  ? -5.766  43.327  16.790 1.00 22.03  ? 73  G   A N7    1 
ATOM   4687 C  C5    . G   B  1 59  ? -5.171  43.066  15.568 1.00 22.45  ? 73  G   A C5    1 
ATOM   4688 C  C6    . G   B  1 59  ? -5.507  43.543  14.283 1.00 22.84  ? 73  G   A C6    1 
ATOM   4689 O  O6    . G   B  1 59  ? -6.435  44.300  13.985 1.00 23.07  ? 73  G   A O6    1 
ATOM   4690 N  N1    . G   B  1 59  ? -4.630  43.061  13.302 1.00 20.43  ? 73  G   A N1    1 
ATOM   4691 C  C2    . G   B  1 59  ? -3.565  42.224  13.550 1.00 22.39  ? 73  G   A C2    1 
ATOM   4692 N  N2    . G   B  1 59  ? -2.823  41.858  12.494 1.00 21.17  ? 73  G   A N2    1 
ATOM   4693 N  N3    . G   B  1 59  ? -3.251  41.772  14.750 1.00 19.22  ? 73  G   A N3    1 
ATOM   4694 C  C4    . G   B  1 59  ? -4.084  42.232  15.704 1.00 18.55  ? 73  G   A C4    1 
ATOM   4695 P  P     . A   B  1 60  ? 0.449   44.094  19.160 1.00 24.04  ? 74  A   A P     1 
ATOM   4696 O  OP1   . A   B  1 60  ? 1.735   43.898  19.881 1.00 25.38  ? 74  A   A OP1   1 
ATOM   4697 O  OP2   . A   B  1 60  ? -0.407  45.284  19.401 1.00 26.00  ? 74  A   A OP2   1 
ATOM   4698 O  "O5'" . A   B  1 60  ? 0.721   43.978  17.591 1.00 20.36  ? 74  A   A "O5'" 1 
ATOM   4699 C  "C5'" . A   B  1 60  ? 1.659   43.047  17.083 1.00 21.13  ? 74  A   A "C5'" 1 
ATOM   4700 C  "C4'" . A   B  1 60  ? 1.659   43.082  15.575 1.00 20.93  ? 74  A   A "C4'" 1 
ATOM   4701 O  "O4'" . A   B  1 60  ? 0.318   42.823  15.093 1.00 21.74  ? 74  A   A "O4'" 1 
ATOM   4702 C  "C3'" . A   B  1 60  ? 2.011   44.413  14.945 1.00 19.98  ? 74  A   A "C3'" 1 
ATOM   4703 O  "O3'" . A   B  1 60  ? 3.408   44.629  14.909 1.00 18.34  ? 74  A   A "O3'" 1 
ATOM   4704 C  "C2'" . A   B  1 60  ? 1.376   44.290  13.564 1.00 18.74  ? 74  A   A "C2'" 1 
ATOM   4705 O  "O2'" . A   B  1 60  ? 2.161   43.453  12.732 1.00 19.84  ? 74  A   A "O2'" 1 
ATOM   4706 C  "C1'" . A   B  1 60  ? 0.087   43.545  13.901 1.00 20.86  ? 74  A   A "C1'" 1 
ATOM   4707 N  N9    . A   B  1 60  ? -1.039  44.464  14.133 1.00 20.52  ? 74  A   A N9    1 
ATOM   4708 C  C8    . A   B  1 60  ? -1.574  44.807  15.351 1.00 22.01  ? 74  A   A C8    1 
ATOM   4709 N  N7    . A   B  1 60  ? -2.584  45.635  15.246 1.00 22.94  ? 74  A   A N7    1 
ATOM   4710 C  C5    . A   B  1 60  ? -2.723  45.845  13.882 1.00 22.53  ? 74  A   A C5    1 
ATOM   4711 C  C6    . A   B  1 60  ? -3.635  46.620  13.141 1.00 22.67  ? 74  A   A C6    1 
ATOM   4712 N  N6    . A   B  1 60  ? -4.588  47.375  13.711 1.00 22.60  ? 74  A   A N6    1 
ATOM   4713 N  N1    . A   B  1 60  ? -3.517  46.610  11.795 1.00 22.68  ? 74  A   A N1    1 
ATOM   4714 C  C2    . A   B  1 60  ? -2.540  45.864  11.246 1.00 23.63  ? 74  A   A C2    1 
ATOM   4715 N  N3    . A   B  1 60  ? -1.627  45.086  11.840 1.00 21.60  ? 74  A   A N3    1 
ATOM   4716 C  C4    . A   B  1 60  ? -1.783  45.118  13.180 1.00 20.38  ? 74  A   A C4    1 
ATOM   4717 P  P     . C   B  1 61  ? 4.044   45.955  15.593 1.00 20.88  ? 75  C   A P     1 
ATOM   4718 O  OP1   . C   B  1 61  ? 5.430   45.557  15.950 1.00 22.12  ? 75  C   A OP1   1 
ATOM   4719 O  OP2   . C   B  1 61  ? 3.098   46.451  16.607 1.00 23.79  ? 75  C   A OP2   1 
ATOM   4720 O  "O5'" . C   B  1 61  ? 4.080   46.938  14.359 1.00 22.34  ? 75  C   A "O5'" 1 
ATOM   4721 C  "C5'" . C   B  1 61  ? 4.911   46.658  13.246 1.00 22.37  ? 75  C   A "C5'" 1 
ATOM   4722 C  "C4'" . C   B  1 61  ? 4.264   47.160  11.985 1.00 24.58  ? 75  C   A "C4'" 1 
ATOM   4723 O  "O4'" . C   B  1 61  ? 2.930   46.598  11.885 1.00 21.40  ? 75  C   A "O4'" 1 
ATOM   4724 C  "C3'" . C   B  1 61  ? 4.017   48.657  11.920 1.00 22.86  ? 75  C   A "C3'" 1 
ATOM   4725 O  "O3'" . C   B  1 61  ? 5.180   49.397  11.582 1.00 29.53  ? 75  C   A "O3'" 1 
ATOM   4726 C  "C2'" . C   B  1 61  ? 2.930   48.738  10.867 1.00 25.78  ? 75  C   A "C2'" 1 
ATOM   4727 O  "O2'" . C   B  1 61  ? 3.501   48.538  9.584  1.00 24.27  ? 75  C   A "O2'" 1 
ATOM   4728 C  "C1'" . C   B  1 61  ? 2.083   47.520  11.231 1.00 24.16  ? 75  C   A "C1'" 1 
ATOM   4729 N  N1    . C   B  1 61  ? 0.985   47.914  12.130 1.00 22.50  ? 75  C   A N1    1 
ATOM   4730 C  C2    . C   B  1 61  ? -0.131  48.509  11.548 1.00 25.45  ? 75  C   A C2    1 
ATOM   4731 O  O2    . C   B  1 61  ? -0.149  48.674  10.326 1.00 26.20  ? 75  C   A O2    1 
ATOM   4732 N  N3    . C   B  1 61  ? -1.162  48.909  12.314 1.00 24.69  ? 75  C   A N3    1 
ATOM   4733 C  C4    . C   B  1 61  ? -1.124  48.735  13.628 1.00 25.77  ? 75  C   A C4    1 
ATOM   4734 N  N4    . C   B  1 61  ? -2.190  49.161  14.328 1.00 23.99  ? 75  C   A N4    1 
ATOM   4735 C  C5    . C   B  1 61  ? 0.009   48.131  14.266 1.00 23.43  ? 75  C   A C5    1 
ATOM   4736 C  C6    . C   B  1 61  ? 1.036   47.744  13.488 1.00 21.83  ? 75  C   A C6    1 
ATOM   4737 P  P     . G   B  1 62  ? 5.324   50.927  12.077 1.00 27.31  ? 76  G   A P     1 
ATOM   4738 O  OP1   . G   B  1 62  ? 6.678   51.284  11.587 1.00 27.95  ? 76  G   A OP1   1 
ATOM   4739 O  OP2   . G   B  1 62  ? 5.008   50.975  13.519 1.00 27.79  ? 76  G   A OP2   1 
ATOM   4740 O  "O5'" . G   B  1 62  ? 4.178   51.707  11.278 1.00 25.05  ? 76  G   A "O5'" 1 
ATOM   4741 C  "C5'" . G   B  1 62  ? 4.154   51.757  9.859  1.00 25.74  ? 76  G   A "C5'" 1 
ATOM   4742 C  "C4'" . G   B  1 62  ? 2.939   52.491  9.339  1.00 27.50  ? 76  G   A "C4'" 1 
ATOM   4743 O  "O4'" . G   B  1 62  ? 1.723   51.773  9.677  1.00 25.87  ? 76  G   A "O4'" 1 
ATOM   4744 C  "C3'" . G   B  1 62  ? 2.704   53.887  9.892  1.00 25.59  ? 76  G   A "C3'" 1 
ATOM   4745 O  "O3'" . G   B  1 62  ? 3.516   54.858  9.252  1.00 27.59  ? 76  G   A "O3'" 1 
ATOM   4746 C  "C2'" . G   B  1 62  ? 1.218   54.077  9.626  1.00 30.35  ? 76  G   A "C2'" 1 
ATOM   4747 O  "O2'" . G   B  1 62  ? 1.027   54.346  8.244  1.00 32.71  ? 76  G   A "O2'" 1 
ATOM   4748 C  "C1'" . G   B  1 62  ? 0.665   52.677  9.908  1.00 27.10  ? 76  G   A "C1'" 1 
ATOM   4749 N  N9    . G   B  1 62  ? 0.201   52.508  11.301 1.00 28.16  ? 76  G   A N9    1 
ATOM   4750 C  C8    . G   B  1 62  ? 0.855   51.814  12.293 1.00 27.97  ? 76  G   A C8    1 
ATOM   4751 N  N7    . G   B  1 62  ? 0.214   51.827  13.429 1.00 31.38  ? 76  G   A N7    1 
ATOM   4752 C  C5    . G   B  1 62  ? -0.927  52.580  13.180 1.00 29.96  ? 76  G   A C5    1 
ATOM   4753 C  C6    . G   B  1 62  ? -2.000  52.941  14.044 1.00 31.49  ? 76  G   A C6    1 
ATOM   4754 O  O6    . G   B  1 62  ? -2.139  52.657  15.242 1.00 34.70  ? 76  G   A O6    1 
ATOM   4755 N  N1    . G   B  1 62  ? -2.958  53.711  13.392 1.00 29.73  ? 76  G   A N1    1 
ATOM   4756 C  C2    . G   B  1 62  ? -2.884  54.089  12.074 1.00 34.36  ? 76  G   A C2    1 
ATOM   4757 N  N2    . G   B  1 62  ? -3.898  54.834  11.595 1.00 32.89  ? 76  G   A N2    1 
ATOM   4758 N  N3    . G   B  1 62  ? -1.887  53.753  11.267 1.00 32.40  ? 76  G   A N3    1 
ATOM   4759 C  C4    . G   B  1 62  ? -0.951  53.000  11.875 1.00 28.75  ? 76  G   A C4    1 
ATOM   4760 P  P     . C   B  1 63  ? 4.166   56.101  10.048 1.00 28.79  ? 77  C   A P     1 
ATOM   4761 O  OP1   . C   B  1 63  ? 4.996   56.836  9.060  1.00 32.83  ? 77  C   A OP1   1 
ATOM   4762 O  OP2   . C   B  1 63  ? 4.782   55.582  11.290 1.00 25.51  ? 77  C   A OP2   1 
ATOM   4763 O  "O5'" . C   B  1 63  ? 2.903   56.977  10.454 1.00 31.56  ? 77  C   A "O5'" 1 
ATOM   4764 C  "C5'" . C   B  1 63  ? 2.023   57.571  9.511  1.00 29.33  ? 77  C   A "C5'" 1 
ATOM   4765 C  "C4'" . C   B  1 63  ? 0.772   58.039  10.207 1.00 30.83  ? 77  C   A "C4'" 1 
ATOM   4766 O  "O4'" . C   B  1 63  ? 0.031   56.890  10.710 1.00 30.67  ? 77  C   A "O4'" 1 
ATOM   4767 C  "C3'" . C   B  1 63  ? 0.990   58.890  11.452 1.00 28.78  ? 77  C   A "C3'" 1 
ATOM   4768 O  "O3'" . C   B  1 63  ? 1.309   60.242  11.170 1.00 28.36  ? 77  C   A "O3'" 1 
ATOM   4769 C  "C2'" . C   B  1 63  ? -0.342  58.720  12.161 1.00 30.85  ? 77  C   A "C2'" 1 
ATOM   4770 O  "O2'" . C   B  1 63  ? -1.330  59.468  11.472 1.00 36.06  ? 77  C   A "O2'" 1 
ATOM   4771 C  "C1'" . C   B  1 63  ? -0.611  57.236  11.918 1.00 29.82  ? 77  C   A "C1'" 1 
ATOM   4772 N  N1    . C   B  1 63  ? -0.081  56.422  13.035 1.00 32.21  ? 77  C   A N1    1 
ATOM   4773 C  C2    . C   B  1 63  ? -0.857  56.336  14.195 1.00 30.22  ? 77  C   A C2    1 
ATOM   4774 O  O2    . C   B  1 63  ? -1.935  56.941  14.226 1.00 34.79  ? 77  C   A O2    1 
ATOM   4775 N  N3    . C   B  1 63  ? -0.413  55.617  15.251 1.00 30.09  ? 77  C   A N3    1 
ATOM   4776 C  C4    . C   B  1 63  ? 0.746   54.979  15.190 1.00 30.10  ? 77  C   A C4    1 
ATOM   4777 N  N4    . C   B  1 63  ? 1.121   54.273  16.270 1.00 32.14  ? 77  C   A N4    1 
ATOM   4778 C  C5    . C   B  1 63  ? 1.563   55.045  14.021 1.00 29.04  ? 77  C   A C5    1 
ATOM   4779 C  C6    . C   B  1 63  ? 1.118   55.770  12.978 1.00 26.27  ? 77  C   A C6    1 
ATOM   4780 P  P     . C   B  1 64  ? 2.492   60.993  11.981 1.00 32.71  ? 78  C   A P     1 
ATOM   4781 O  OP1   . C   B  1 64  ? 2.708   62.242  11.220 1.00 32.76  ? 78  C   A OP1   1 
ATOM   4782 O  OP2   . C   B  1 64  ? 3.647   60.080  12.154 1.00 33.99  ? 78  C   A OP2   1 
ATOM   4783 O  "O5'" . C   B  1 64  ? 1.842   61.243  13.421 1.00 29.34  ? 78  C   A "O5'" 1 
ATOM   4784 C  "C5'" . C   B  1 64  ? 0.707   62.074  13.601 1.00 33.34  ? 78  C   A "C5'" 1 
ATOM   4785 C  "C4'" . C   B  1 64  ? 0.050   61.825  14.934 1.00 31.02  ? 78  C   A "C4'" 1 
ATOM   4786 O  "O4'" . C   B  1 64  ? -0.224  60.403  15.074 1.00 33.15  ? 78  C   A "O4'" 1 
ATOM   4787 C  "C3'" . C   B  1 64  ? 0.849   62.152  16.190 1.00 31.74  ? 78  C   A "C3'" 1 
ATOM   4788 O  "O3'" . C   B  1 64  ? 0.887   63.532  16.524 1.00 29.06  ? 78  C   A "O3'" 1 
ATOM   4789 C  "C2'" . C   B  1 64  ? 0.144   61.306  17.246 1.00 31.78  ? 78  C   A "C2'" 1 
ATOM   4790 O  "O2'" . C   B  1 64  ? -1.054  61.930  17.685 1.00 36.51  ? 78  C   A "O2'" 1 
ATOM   4791 C  "C1'" . C   B  1 64  ? -0.229  60.057  16.447 1.00 29.62  ? 78  C   A "C1'" 1 
ATOM   4792 N  N1    . C   B  1 64  ? 0.689   58.960  16.818 1.00 30.43  ? 78  C   A N1    1 
ATOM   4793 C  C2    . C   B  1 64  ? 0.418   58.328  18.032 1.00 31.74  ? 78  C   A C2    1 
ATOM   4794 O  O2    . C   B  1 64  ? -0.570  58.708  18.685 1.00 31.98  ? 78  C   A O2    1 
ATOM   4795 N  N3    . C   B  1 64  ? 1.226   57.332  18.461 1.00 30.50  ? 78  C   A N3    1 
ATOM   4796 C  C4    . C   B  1 64  ? 2.267   56.957  17.715 1.00 27.89  ? 78  C   A C4    1 
ATOM   4797 N  N4    . C   B  1 64  ? 3.029   55.963  18.184 1.00 28.84  ? 78  C   A N4    1 
ATOM   4798 C  C5    . C   B  1 64  ? 2.578   57.589  16.472 1.00 29.12  ? 78  C   A C5    1 
ATOM   4799 C  C6    . C   B  1 64  ? 1.770   58.585  16.065 1.00 31.22  ? 78  C   A C6    1 
ATOM   4800 P  P     . A   B  1 65  ? 2.159   64.434  16.103 1.00 37.30  ? 79  A   A P     1 
ATOM   4801 O  OP1   . A   B  1 65  ? 1.709   65.115  14.877 1.00 35.95  ? 79  A   A OP1   1 
ATOM   4802 O  OP2   . A   B  1 65  ? 3.379   63.600  16.035 1.00 30.77  ? 79  A   A OP2   1 
ATOM   4803 O  "O5'" . A   B  1 65  ? 2.305   65.443  17.331 1.00 30.41  ? 79  A   A "O5'" 1 
ATOM   4804 C  "C5'" . A   B  1 65  ? 1.480   66.594  17.400 1.00 35.46  ? 79  A   A "C5'" 1 
ATOM   4805 C  "C4'" . A   B  1 65  ? 0.922   66.821  18.782 1.00 32.16  ? 79  A   A "C4'" 1 
ATOM   4806 O  "O4'" . A   B  1 65  ? 0.034   65.733  19.154 1.00 32.33  ? 79  A   A "O4'" 1 
ATOM   4807 C  "C3'" . A   B  1 65  ? 1.920   66.888  19.929 1.00 28.86  ? 79  A   A "C3'" 1 
ATOM   4808 O  "O3'" . A   B  1 65  ? 2.612   68.124  19.998 1.00 30.69  ? 79  A   A "O3'" 1 
ATOM   4809 C  "C2'" . A   B  1 65  ? 1.017   66.623  21.124 1.00 32.82  ? 79  A   A "C2'" 1 
ATOM   4810 O  "O2'" . A   B  1 65  ? 0.230   67.765  21.432 1.00 33.54  ? 79  A   A "O2'" 1 
ATOM   4811 C  "C1'" . A   B  1 65  ? 0.072   65.565  20.556 1.00 30.19  ? 79  A   A "C1'" 1 
ATOM   4812 N  N9    . A   B  1 65  ? 0.516   64.200  20.905 1.00 33.72  ? 79  A   A N9    1 
ATOM   4813 C  C8    . A   B  1 65  ? 1.179   63.255  20.153 1.00 29.51  ? 79  A   A C8    1 
ATOM   4814 N  N7    . A   B  1 65  ? 1.413   62.135  20.809 1.00 27.92  ? 79  A   A N7    1 
ATOM   4815 C  C5    . A   B  1 65  ? 0.871   62.361  22.069 1.00 29.99  ? 79  A   A C5    1 
ATOM   4816 C  C6    . A   B  1 65  ? 0.793   61.575  23.237 1.00 30.99  ? 79  A   A C6    1 
ATOM   4817 N  N6    . A   B  1 65  ? 1.267   60.329  23.341 1.00 27.77  ? 79  A   A N6    1 
ATOM   4818 N  N1    . A   B  1 65  ? 0.178   62.117  24.317 1.00 32.63  ? 79  A   A N1    1 
ATOM   4819 C  C2    . A   B  1 65  ? -0.310  63.360  24.225 1.00 33.61  ? 79  A   A C2    1 
ATOM   4820 N  N3    . A   B  1 65  ? -0.284  64.200  23.192 1.00 31.66  ? 79  A   A N3    1 
ATOM   4821 C  C4    . A   B  1 65  ? 0.319   63.626  22.134 1.00 32.31  ? 79  A   A C4    1 
ATOM   4822 P  P     . A   B  1 66  ? 4.087   68.221  20.636 1.00 35.95  ? 80  A   A P     1 
ATOM   4823 O  OP1   . A   B  1 66  ? 4.609   69.581  20.346 1.00 34.69  ? 80  A   A OP1   1 
ATOM   4824 O  OP2   . A   B  1 66  ? 4.820   67.040  20.123 1.00 37.80  ? 80  A   A OP2   1 
ATOM   4825 O  "O5'" . A   B  1 66  ? 3.848   68.034  22.193 1.00 31.20  ? 80  A   A "O5'" 1 
ATOM   4826 C  "C5'" . A   B  1 66  ? 3.121   69.006  22.926 1.00 32.86  ? 80  A   A "C5'" 1 
ATOM   4827 C  "C4'" . A   B  1 66  ? 2.819   68.521  24.321 1.00 33.81  ? 80  A   A "C4'" 1 
ATOM   4828 O  "O4'" . A   B  1 66  ? 2.024   67.306  24.261 1.00 31.78  ? 80  A   A "O4'" 1 
ATOM   4829 C  "C3'" . A   B  1 66  ? 4.021   68.136  25.166 1.00 33.75  ? 80  A   A "C3'" 1 
ATOM   4830 O  "O3'" . A   B  1 66  ? 4.642   69.253  25.770 1.00 35.41  ? 80  A   A "O3'" 1 
ATOM   4831 C  "C2'" . A   B  1 66  ? 3.413   67.173  26.176 1.00 34.13  ? 80  A   A "C2'" 1 
ATOM   4832 O  "O2'" . A   B  1 66  ? 2.711   67.881  27.185 1.00 38.60  ? 80  A   A "O2'" 1 
ATOM   4833 C  "C1'" . A   B  1 66  ? 2.387   66.442  25.314 1.00 34.57  ? 80  A   A "C1'" 1 
ATOM   4834 N  N9    . A   B  1 66  ? 2.965   65.219  24.731 1.00 32.63  ? 80  A   A N9    1 
ATOM   4835 C  C8    . A   B  1 66  ? 3.603   65.066  23.521 1.00 33.07  ? 80  A   A C8    1 
ATOM   4836 N  N7    . A   B  1 66  ? 4.018   63.839  23.303 1.00 32.19  ? 80  A   A N7    1 
ATOM   4837 C  C5    . A   B  1 66  ? 3.623   63.144  24.443 1.00 29.39  ? 80  A   A C5    1 
ATOM   4838 C  C6    . A   B  1 66  ? 3.752   61.791  24.835 1.00 33.50  ? 80  A   A C6    1 
ATOM   4839 N  N6    . A   B  1 66  ? 4.348   60.849  24.086 1.00 27.80  ? 80  A   A N6    1 
ATOM   4840 N  N1    . A   B  1 66  ? 3.241   61.436  26.043 1.00 31.72  ? 80  A   A N1    1 
ATOM   4841 C  C2    . A   B  1 66  ? 2.638   62.371  26.790 1.00 32.36  ? 80  A   A C2    1 
ATOM   4842 N  N3    . A   B  1 66  ? 2.457   63.666  26.529 1.00 32.32  ? 80  A   A N3    1 
ATOM   4843 C  C4    . A   B  1 66  ? 2.973   63.986  25.327 1.00 32.35  ? 80  A   A C4    1 
ATOM   4844 P  P     . U   B  1 67  ? 6.214   69.536  25.633 1.00 38.64  ? 81  U   A P     1 
ATOM   4845 O  OP1   . U   B  1 67  ? 6.478   70.636  26.589 1.00 33.29  ? 81  U   A OP1   1 
ATOM   4846 O  OP2   . U   B  1 67  ? 6.553   69.683  24.189 1.00 33.50  ? 81  U   A OP2   1 
ATOM   4847 O  "O5'" . U   B  1 67  ? 6.910   68.231  26.179 1.00 36.02  ? 81  U   A "O5'" 1 
ATOM   4848 C  "C5'" . U   B  1 67  ? 6.676   67.735  27.482 1.00 31.21  ? 81  U   A "C5'" 1 
ATOM   4849 C  "C4'" . U   B  1 67  ? 7.191   66.328  27.557 1.00 32.30  ? 81  U   A "C4'" 1 
ATOM   4850 O  "O4'" . U   B  1 67  ? 6.378   65.458  26.725 1.00 33.00  ? 81  U   A "O4'" 1 
ATOM   4851 C  "C3'" . U   B  1 67  ? 8.593   66.126  27.005 1.00 30.27  ? 81  U   A "C3'" 1 
ATOM   4852 O  "O3'" . U   B  1 67  ? 9.606   66.540  27.895 1.00 30.87  ? 81  U   A "O3'" 1 
ATOM   4853 C  "C2'" . U   B  1 67  ? 8.602   64.634  26.744 1.00 30.89  ? 81  U   A "C2'" 1 
ATOM   4854 O  "O2'" . U   B  1 67  ? 8.684   63.947  27.983 1.00 33.33  ? 81  U   A "O2'" 1 
ATOM   4855 C  "C1'" . U   B  1 67  ? 7.197   64.440  26.177 1.00 30.20  ? 81  U   A "C1'" 1 
ATOM   4856 N  N1    . U   B  1 67  ? 7.162   64.561  24.700 1.00 32.16  ? 81  U   A N1    1 
ATOM   4857 C  C2    . U   B  1 67  ? 7.506   63.452  23.944 1.00 28.34  ? 81  U   A C2    1 
ATOM   4858 O  O2    . U   B  1 67  ? 7.842   62.388  24.426 1.00 26.31  ? 81  U   A O2    1 
ATOM   4859 N  N3    . U   B  1 67  ? 7.442   63.639  22.594 1.00 24.88  ? 81  U   A N3    1 
ATOM   4860 C  C4    . U   B  1 67  ? 7.074   64.794  21.938 1.00 27.64  ? 81  U   A C4    1 
ATOM   4861 O  O4    . U   B  1 67  ? 7.063   64.797  20.723 1.00 26.34  ? 81  U   A O4    1 
ATOM   4862 C  C5    . U   B  1 67  ? 6.725   65.902  22.773 1.00 28.90  ? 81  U   A C5    1 
ATOM   4863 C  C6    . U   B  1 67  ? 6.785   65.746  24.100 1.00 31.06  ? 81  U   A C6    1 
ATOM   4864 P  P     . G   B  1 68  ? 11.033  67.017  27.347 1.00 34.62  ? 82  G   A P     1 
ATOM   4865 O  OP1   . G   B  1 68  ? 11.659  67.616  28.554 1.00 36.28  ? 82  G   A OP1   1 
ATOM   4866 O  OP2   . G   B  1 68  ? 10.841  67.854  26.140 1.00 27.49  ? 82  G   A OP2   1 
ATOM   4867 O  "O5'" . G   B  1 68  ? 11.787  65.675  26.935 1.00 35.86  ? 82  G   A "O5'" 1 
ATOM   4868 C  "C5'" . G   B  1 68  ? 12.105  64.649  27.865 1.00 32.72  ? 82  G   A "C5'" 1 
ATOM   4869 C  "C4'" . G   B  1 68  ? 12.477  63.359  27.168 1.00 32.16  ? 82  G   A "C4'" 1 
ATOM   4870 O  "O4'" . G   B  1 68  ? 11.368  62.903  26.343 1.00 33.93  ? 82  G   A "O4'" 1 
ATOM   4871 C  "C3'" . G   B  1 68  ? 13.639  63.407  26.186 1.00 30.70  ? 82  G   A "C3'" 1 
ATOM   4872 O  "O3'" . G   B  1 68  ? 14.910  63.386  26.807 1.00 32.13  ? 82  G   A "O3'" 1 
ATOM   4873 C  "C2'" . G   B  1 68  ? 13.386  62.163  25.349 1.00 30.27  ? 82  G   A "C2'" 1 
ATOM   4874 O  "O2'" . G   B  1 68  ? 13.730  61.013  26.109 1.00 29.89  ? 82  G   A "O2'" 1 
ATOM   4875 C  "C1'" . G   B  1 68  ? 11.864  62.226  25.206 1.00 30.67  ? 82  G   A "C1'" 1 
ATOM   4876 N  N9    . G   B  1 68  ? 11.472  62.971  23.992 1.00 25.40  ? 82  G   A N9    1 
ATOM   4877 C  C8    . G   B  1 68  ? 10.990  64.252  23.895 1.00 27.32  ? 82  G   A C8    1 
ATOM   4878 N  N7    . G   B  1 68  ? 10.751  64.615  22.660 1.00 27.05  ? 82  G   A N7    1 
ATOM   4879 C  C5    . G   B  1 68  ? 11.101  63.516  21.892 1.00 24.16  ? 82  G   A C5    1 
ATOM   4880 C  C6    . G   B  1 68  ? 11.069  63.306  20.485 1.00 25.40  ? 82  G   A C6    1 
ATOM   4881 O  O6    . G   B  1 68  ? 10.707  64.075  19.591 1.00 23.74  ? 82  G   A O6    1 
ATOM   4882 N  N1    . G   B  1 68  ? 11.522  62.034  20.141 1.00 23.43  ? 82  G   A N1    1 
ATOM   4883 C  C2    . G   B  1 68  ? 11.952  61.089  21.033 1.00 25.47  ? 82  G   A C2    1 
ATOM   4884 N  N2    . G   B  1 68  ? 12.357  59.922  20.507 1.00 23.16  ? 82  G   A N2    1 
ATOM   4885 N  N3    . G   B  1 68  ? 11.990  61.270  22.340 1.00 24.71  ? 82  G   A N3    1 
ATOM   4886 C  C4    . G   B  1 68  ? 11.552  62.496  22.701 1.00 26.62  ? 82  G   A C4    1 
ATOM   4887 P  P     . G   B  1 69  ? 16.196  63.950  26.021 1.00 38.85  ? 83  G   A P     1 
ATOM   4888 O  OP1   . G   B  1 69  ? 17.252  63.895  27.065 1.00 37.19  ? 83  G   A OP1   1 
ATOM   4889 O  OP2   . G   B  1 69  ? 15.823  65.243  25.414 1.00 37.32  ? 83  G   A OP2   1 
ATOM   4890 O  "O5'" . G   B  1 69  ? 16.483  62.926  24.819 1.00 32.75  ? 83  G   A "O5'" 1 
ATOM   4891 C  "C5'" . G   B  1 69  ? 17.131  61.676  25.003 1.00 31.74  ? 83  G   A "C5'" 1 
ATOM   4892 C  "C4'" . G   B  1 69  ? 17.155  60.850  23.735 1.00 32.37  ? 83  G   A "C4'" 1 
ATOM   4893 O  "O4'" . G   B  1 69  ? 15.811  60.750  23.177 1.00 29.51  ? 83  G   A "O4'" 1 
ATOM   4894 C  "C3'" . G   B  1 69  ? 17.972  61.373  22.552 1.00 32.57  ? 83  G   A "C3'" 1 
ATOM   4895 O  "O3'" . G   B  1 69  ? 19.377  61.221  22.677 1.00 32.51  ? 83  G   A "O3'" 1 
ATOM   4896 C  "C2'" . G   B  1 69  ? 17.378  60.557  21.413 1.00 29.50  ? 83  G   A "C2'" 1 
ATOM   4897 O  "O2'" . G   B  1 69  ? 17.760  59.194  21.530 1.00 29.46  ? 83  G   A "O2'" 1 
ATOM   4898 C  "C1'" . G   B  1 69  ? 15.897  60.662  21.766 1.00 28.08  ? 83  G   A "C1'" 1 
ATOM   4899 N  N9    . G   B  1 69  ? 15.318  61.874  21.154 1.00 24.98  ? 83  G   A N9    1 
ATOM   4900 C  C8    . G   B  1 69  ? 14.901  63.053  21.722 1.00 28.48  ? 83  G   A C8    1 
ATOM   4901 N  N7    . G   B  1 69  ? 14.442  63.910  20.843 1.00 27.75  ? 83  G   A N7    1 
ATOM   4902 C  C5    . G   B  1 69  ? 14.566  63.268  19.616 1.00 26.96  ? 83  G   A C5    1 
ATOM   4903 C  C6    . G   B  1 69  ? 14.237  63.676  18.294 1.00 26.61  ? 83  G   A C6    1 
ATOM   4904 O  O6    . G   B  1 69  ? 13.745  64.745  17.906 1.00 26.66  ? 83  G   A O6    1 
ATOM   4905 N  N1    . G   B  1 69  ? 14.544  62.690  17.352 1.00 27.03  ? 83  G   A N1    1 
ATOM   4906 C  C2    . G   B  1 69  ? 15.084  61.461  17.653 1.00 26.93  ? 83  G   A C2    1 
ATOM   4907 N  N2    . G   B  1 69  ? 15.319  60.622  16.634 1.00 25.97  ? 83  G   A N2    1 
ATOM   4908 N  N3    . G   B  1 69  ? 15.391  61.076  18.884 1.00 28.49  ? 83  G   A N3    1 
ATOM   4909 C  C4    . G   B  1 69  ? 15.109  62.019  19.802 1.00 28.68  ? 83  G   A C4    1 
ATOM   4910 P  P     . G   B  1 70  ? 20.395  62.279  22.005 1.00 35.31  ? 84  G   A P     1 
ATOM   4911 O  OP1   . G   B  1 70  ? 21.668  61.820  22.624 1.00 42.94  ? 84  G   A OP1   1 
ATOM   4912 O  OP2   . G   B  1 70  ? 19.914  63.670  22.145 1.00 34.24  ? 84  G   A OP2   1 
ATOM   4913 O  "O5'" . G   B  1 70  ? 20.449  61.925  20.451 1.00 28.59  ? 84  G   A "O5'" 1 
ATOM   4914 C  "C5'" . G   B  1 70  ? 20.785  60.624  20.010 1.00 30.05  ? 84  G   A "C5'" 1 
ATOM   4915 C  "C4'" . G   B  1 70  ? 20.300  60.421  18.598 1.00 30.93  ? 84  G   A "C4'" 1 
ATOM   4916 O  "O4'" . G   B  1 70  ? 18.896  60.789  18.516 1.00 27.65  ? 84  G   A "O4'" 1 
ATOM   4917 C  "C3'" . G   B  1 70  ? 20.967  61.279  17.535 1.00 27.58  ? 84  G   A "C3'" 1 
ATOM   4918 O  "O3'" . G   B  1 70  ? 22.213  60.744  17.127 1.00 28.43  ? 84  G   A "O3'" 1 
ATOM   4919 C  "C2'" . G   B  1 70  ? 19.922  61.247  16.431 1.00 27.34  ? 84  G   A "C2'" 1 
ATOM   4920 O  "O2'" . G   B  1 70  ? 19.948  59.973  15.806 1.00 25.12  ? 84  G   A "O2'" 1 
ATOM   4921 C  "C1'" . G   B  1 70  ? 18.630  61.334  17.246 1.00 26.86  ? 84  G   A "C1'" 1 
ATOM   4922 N  N9    . G   B  1 70  ? 18.159  62.716  17.432 1.00 27.16  ? 84  G   A N9    1 
ATOM   4923 C  C8    . G   B  1 70  ? 18.083  63.449  18.600 1.00 28.29  ? 84  G   A C8    1 
ATOM   4924 N  N7    . G   B  1 70  ? 17.607  64.658  18.417 1.00 25.78  ? 84  G   A N7    1 
ATOM   4925 C  C5    . G   B  1 70  ? 17.352  64.719  17.051 1.00 27.28  ? 84  G   A C5    1 
ATOM   4926 C  C6    . G   B  1 70  ? 16.827  65.767  16.242 1.00 26.95  ? 84  G   A C6    1 
ATOM   4927 O  O6    . G   B  1 70  ? 16.464  66.886  16.595 1.00 26.73  ? 84  G   A O6    1 
ATOM   4928 N  N1    . G   B  1 70  ? 16.740  65.404  14.894 1.00 25.54  ? 84  G   A N1    1 
ATOM   4929 C  C2    . G   B  1 70  ? 17.101  64.170  14.394 1.00 26.09  ? 84  G   A C2    1 
ATOM   4930 N  N2    . G   B  1 70  ? 16.959  63.979  13.072 1.00 24.79  ? 84  G   A N2    1 
ATOM   4931 N  N3    . G   B  1 70  ? 17.592  63.187  15.133 1.00 27.33  ? 84  G   A N3    1 
ATOM   4932 C  C4    . G   B  1 70  ? 17.685  63.527  16.437 1.00 27.90  ? 84  G   A C4    1 
ATOM   4933 P  P     . U   B  1 71  ? 23.421  61.658  16.614 1.00 29.24  ? 85  U   A P     1 
ATOM   4934 O  OP1   . U   B  1 71  ? 24.584  60.738  16.471 1.00 30.63  ? 85  U   A OP1   1 
ATOM   4935 O  OP2   . U   B  1 71  ? 23.531  62.812  17.558 1.00 28.95  ? 85  U   A OP2   1 
ATOM   4936 O  "O5'" . U   B  1 71  ? 22.869  62.130  15.203 1.00 24.81  ? 85  U   A "O5'" 1 
ATOM   4937 C  "C5'" . U   B  1 71  ? 22.689  61.280  14.079 1.00 27.43  ? 85  U   A "C5'" 1 
ATOM   4938 C  "C4'" . U   B  1 71  ? 22.047  62.024  12.932 1.00 28.76  ? 85  U   A "C4'" 1 
ATOM   4939 O  "O4'" . U   B  1 71  ? 20.819  62.639  13.400 1.00 29.69  ? 85  U   A "O4'" 1 
ATOM   4940 C  "C3'" . U   B  1 71  ? 22.854  63.176  12.334 1.00 31.98  ? 85  U   A "C3'" 1 
ATOM   4941 O  "O3'" . U   B  1 71  ? 23.719  62.758  11.295 1.00 31.07  ? 85  U   A "O3'" 1 
ATOM   4942 C  "C2'" . U   B  1 71  ? 21.786  64.123  11.807 1.00 29.62  ? 85  U   A "C2'" 1 
ATOM   4943 O  "O2'" . U   B  1 71  ? 21.322  63.665  10.543 1.00 31.38  ? 85  U   A "O2'" 1 
ATOM   4944 C  "C1'" . U   B  1 71  ? 20.659  63.919  12.817 1.00 27.62  ? 85  U   A "C1'" 1 
ATOM   4945 N  N1    . U   B  1 71  ? 20.515  64.912  13.915 1.00 26.14  ? 85  U   A N1    1 
ATOM   4946 C  C2    . U   B  1 71  ? 19.859  66.089  13.624 1.00 26.13  ? 85  U   A C2    1 
ATOM   4947 O  O2    . U   B  1 71  ? 19.458  66.341  12.502 1.00 25.77  ? 85  U   A O2    1 
ATOM   4948 N  N3    . U   B  1 71  ? 19.712  66.958  14.684 1.00 30.40  ? 85  U   A N3    1 
ATOM   4949 C  C4    . U   B  1 71  ? 20.127  66.762  15.989 1.00 31.72  ? 85  U   A C4    1 
ATOM   4950 O  O4    . U   B  1 71  ? 19.916  67.625  16.854 1.00 32.40  ? 85  U   A O4    1 
ATOM   4951 C  C5    . U   B  1 71  ? 20.784  65.505  16.206 1.00 30.46  ? 85  U   A C5    1 
ATOM   4952 C  C6    . U   B  1 71  ? 20.944  64.647  15.194 1.00 26.82  ? 85  U   A C6    1 
ATOM   4953 P  P     . C   B  1 72  ? 25.259  62.396  11.539 1.00 36.83  ? 86  C   A P     1 
ATOM   4954 O  OP1   . C   B  1 72  ? 25.795  63.139  12.696 1.00 29.84  ? 86  C   A OP1   1 
ATOM   4955 O  OP2   . C   B  1 72  ? 25.877  62.523  10.197 1.00 32.39  ? 86  C   A OP2   1 
ATOM   4956 O  "O5'" . C   B  1 72  ? 25.144  60.869  11.963 1.00 35.37  ? 86  C   A "O5'" 1 
ATOM   4957 C  "C5'" . C   B  1 72  ? 24.835  59.820  11.057 1.00 33.56  ? 86  C   A "C5'" 1 
ATOM   4958 C  "C4'" . C   B  1 72  ? 25.502  58.550  11.516 1.00 35.99  ? 86  C   A "C4'" 1 
ATOM   4959 O  "O4'" . C   B  1 72  ? 26.926  58.615  11.215 1.00 37.36  ? 86  C   A "O4'" 1 
ATOM   4960 C  "C3'" . C   B  1 72  ? 25.392  58.279  13.016 1.00 38.18  ? 86  C   A "C3'" 1 
ATOM   4961 O  "O3'" . C   B  1 72  ? 25.345  56.877  13.235 1.00 42.36  ? 86  C   A "O3'" 1 
ATOM   4962 C  "C2'" . C   B  1 72  ? 26.733  58.769  13.544 1.00 41.18  ? 86  C   A "C2'" 1 
ATOM   4963 O  "O2'" . C   B  1 72  ? 27.128  58.187  14.771 1.00 45.53  ? 86  C   A "O2'" 1 
ATOM   4964 C  "C1'" . C   B  1 72  ? 27.658  58.359  12.401 1.00 40.31  ? 86  C   A "C1'" 1 
ATOM   4965 N  N1    . C   B  1 72  ? 28.943  59.101  12.448 1.00 41.98  ? 86  C   A N1    1 
ATOM   4966 C  C2    . C   B  1 72  ? 30.139  58.406  12.232 1.00 41.40  ? 86  C   A C2    1 
ATOM   4967 O  O2    . C   B  1 72  ? 30.080  57.187  11.982 1.00 39.91  ? 86  C   A O2    1 
ATOM   4968 N  N3    . C   B  1 72  ? 31.319  59.072  12.291 1.00 43.26  ? 86  C   A N3    1 
ATOM   4969 C  C4    . C   B  1 72  ? 31.326  60.379  12.565 1.00 41.40  ? 86  C   A C4    1 
ATOM   4970 N  N4    . C   B  1 72  ? 32.503  61.015  12.618 1.00 40.86  ? 86  C   A N4    1 
ATOM   4971 C  C5    . C   B  1 72  ? 30.123  61.100  12.792 1.00 41.84  ? 86  C   A C5    1 
ATOM   4972 C  C6    . C   B  1 72  ? 28.965  60.435  12.732 1.00 41.48  ? 86  C   A C6    1 
ATOM   4973 P  P     . A   B  1 73  ? 24.022  56.094  13.673 1.00 48.39  ? 87  A   A P     1 
ATOM   4974 O  OP1   . A   B  1 73  ? 24.459  55.245  14.815 1.00 49.29  ? 87  A   A OP1   1 
ATOM   4975 O  OP2   . A   B  1 73  ? 23.603  55.468  12.385 1.00 40.33  ? 87  A   A OP2   1 
ATOM   4976 O  "O5'" . A   B  1 73  ? 22.922  57.136  14.171 1.00 38.02  ? 87  A   A "O5'" 1 
ATOM   4977 C  "C5'" . A   B  1 73  ? 22.625  57.312  15.556 1.00 32.55  ? 87  A   A "C5'" 1 
ATOM   4978 C  "C4'" . A   B  1 73  ? 21.319  56.664  15.961 1.00 31.66  ? 87  A   A "C4'" 1 
ATOM   4979 O  "O4'" . A   B  1 73  ? 20.250  57.017  15.034 1.00 28.30  ? 87  A   A "O4'" 1 
ATOM   4980 C  "C3'" . A   B  1 73  ? 21.315  55.138  16.026 1.00 32.57  ? 87  A   A "C3'" 1 
ATOM   4981 O  "O3'" . A   B  1 73  ? 20.447  54.739  17.086 1.00 30.04  ? 87  A   A "O3'" 1 
ATOM   4982 C  "C2'" . A   B  1 73  ? 20.679  54.766  14.686 1.00 33.30  ? 87  A   A "C2'" 1 
ATOM   4983 O  "O2'" . A   B  1 73  ? 20.149  53.458  14.599 1.00 35.04  ? 87  A   A "O2'" 1 
ATOM   4984 C  "C1'" . A   B  1 73  ? 19.601  55.840  14.588 1.00 28.38  ? 87  A   A "C1'" 1 
ATOM   4985 N  N9    . A   B  1 73  ? 19.101  56.120  13.243 1.00 27.16  ? 87  A   A N9    1 
ATOM   4986 C  C8    . A   B  1 73  ? 19.662  55.823  12.026 1.00 27.36  ? 87  A   A C8    1 
ATOM   4987 N  N7    . A   B  1 73  ? 18.948  56.252  11.010 1.00 24.85  ? 87  A   A N7    1 
ATOM   4988 C  C5    . A   B  1 73  ? 17.855  56.879  11.606 1.00 27.26  ? 87  A   A C5    1 
ATOM   4989 C  C6    . A   B  1 73  ? 16.738  57.562  11.089 1.00 26.33  ? 87  A   A C6    1 
ATOM   4990 N  N6    . A   B  1 73  ? 16.521  57.729  9.787  1.00 26.92  ? 87  A   A N6    1 
ATOM   4991 N  N1    . A   B  1 73  ? 15.837  58.078  11.961 1.00 24.73  ? 87  A   A N1    1 
ATOM   4992 C  C2    . A   B  1 73  ? 16.067  57.930  13.272 1.00 27.63  ? 87  A   A C2    1 
ATOM   4993 N  N3    . A   B  1 73  ? 17.084  57.312  13.879 1.00 27.16  ? 87  A   A N3    1 
ATOM   4994 C  C4    . A   B  1 73  ? 17.943  56.805  12.981 1.00 27.22  ? 87  A   A C4    1 
ATOM   4995 P  P     . A   B  1 74  ? 20.934  54.679  18.627 1.00 38.17  ? 88  A   A P     1 
ATOM   4996 O  OP1   . A   B  1 74  ? 20.123  55.633  19.427 1.00 34.43  ? 88  A   A OP1   1 
ATOM   4997 O  OP2   . A   B  1 74  ? 22.415  54.821  18.606 1.00 37.20  ? 88  A   A OP2   1 
ATOM   4998 O  "O5'" . A   B  1 74  ? 20.498  53.190  19.039 1.00 30.81  ? 88  A   A "O5'" 1 
ATOM   4999 C  "C5'" . A   B  1 74  ? 21.182  52.036  18.571 1.00 30.98  ? 88  A   A "C5'" 1 
ATOM   5000 C  "C4'" . A   B  1 74  ? 21.028  50.881  19.532 1.00 24.83  ? 88  A   A "C4'" 1 
ATOM   5001 O  "O4'" . A   B  1 74  ? 21.563  51.229  20.839 1.00 23.00  ? 88  A   A "O4'" 1 
ATOM   5002 C  "C3'" . A   B  1 74  ? 19.600  50.448  19.824 1.00 22.59  ? 88  A   A "C3'" 1 
ATOM   5003 O  "O3'" . A   B  1 74  ? 19.075  49.620  18.800 1.00 24.80  ? 88  A   A "O3'" 1 
ATOM   5004 C  "C2'" . A   B  1 74  ? 19.748  49.732  21.159 1.00 21.43  ? 88  A   A "C2'" 1 
ATOM   5005 O  "O2'" . A   B  1 74  ? 20.292  48.440  20.953 1.00 21.77  ? 88  A   A "O2'" 1 
ATOM   5006 C  "C1'" . A   B  1 74  ? 20.822  50.571  21.846 1.00 23.72  ? 88  A   A "C1'" 1 
ATOM   5007 N  N9    . A   B  1 74  ? 20.247  51.570  22.764 1.00 24.11  ? 88  A   A N9    1 
ATOM   5008 C  C8    . A   B  1 74  ? 20.045  52.894  22.528 1.00 24.98  ? 88  A   A C8    1 
ATOM   5009 N  N7    . A   B  1 74  ? 19.507  53.521  23.549 1.00 27.62  ? 88  A   A N7    1 
ATOM   5010 C  C5    . A   B  1 74  ? 19.354  52.547  24.518 1.00 25.25  ? 88  A   A C5    1 
ATOM   5011 C  C6    . A   B  1 74  ? 18.839  52.573  25.827 1.00 28.57  ? 88  A   A C6    1 
ATOM   5012 N  N6    . A   B  1 74  ? 18.368  53.686  26.408 1.00 29.74  ? 88  A   A N6    1 
ATOM   5013 N  N1    . A   B  1 74  ? 18.824  51.410  26.526 1.00 26.49  ? 88  A   A N1    1 
ATOM   5014 C  C2    . A   B  1 74  ? 19.296  50.304  25.939 1.00 24.94  ? 88  A   A C2    1 
ATOM   5015 N  N3    . A   B  1 74  ? 19.800  50.166  24.710 1.00 22.47  ? 88  A   A N3    1 
ATOM   5016 C  C4    . A   B  1 74  ? 19.806  51.334  24.046 1.00 22.67  ? 88  A   A C4    1 
ATOM   5017 P  P     . C   B  1 75  ? 17.684  49.961  18.057 1.00 25.58  ? 89  C   A P     1 
ATOM   5018 O  OP1   . C   B  1 75  ? 17.435  48.854  17.124 1.00 23.14  ? 89  C   A OP1   1 
ATOM   5019 O  OP2   . C   B  1 75  ? 17.719  51.352  17.534 1.00 24.96  ? 89  C   A OP2   1 
ATOM   5020 O  "O5'" . C   B  1 75  ? 16.671  49.891  19.264 1.00 23.48  ? 89  C   A "O5'" 1 
ATOM   5021 C  "C5'" . C   B  1 75  ? 16.470  48.670  19.951 1.00 23.10  ? 89  C   A "C5'" 1 
ATOM   5022 C  "C4'" . C   B  1 75  ? 15.822  48.935  21.281 1.00 22.68  ? 89  C   A "C4'" 1 
ATOM   5023 O  "O4'" . C   B  1 75  ? 16.655  49.826  22.061 1.00 24.52  ? 89  C   A "O4'" 1 
ATOM   5024 C  "C3'" . C   B  1 75  ? 14.480  49.640  21.233 1.00 23.39  ? 89  C   A "C3'" 1 
ATOM   5025 O  "O3'" . C   B  1 75  ? 13.438  48.725  20.971 1.00 24.47  ? 89  C   A "O3'" 1 
ATOM   5026 C  "C2'" . C   B  1 75  ? 14.392  50.266  22.624 1.00 24.40  ? 89  C   A "C2'" 1 
ATOM   5027 O  "O2'" . C   B  1 75  ? 14.083  49.269  23.584 1.00 24.38  ? 89  C   A "O2'" 1 
ATOM   5028 C  "C1'" . C   B  1 75  ? 15.850  50.667  22.862 1.00 23.84  ? 89  C   A "C1'" 1 
ATOM   5029 N  N1    . C   B  1 75  ? 16.092  52.080  22.507 1.00 23.73  ? 89  C   A N1    1 
ATOM   5030 C  C2    . C   B  1 75  ? 15.805  53.071  23.454 1.00 26.54  ? 89  C   A C2    1 
ATOM   5031 O  O2    . C   B  1 75  ? 15.374  52.721  24.573 1.00 26.84  ? 89  C   A O2    1 
ATOM   5032 N  N3    . C   B  1 75  ? 15.999  54.369  23.121 1.00 23.93  ? 89  C   A N3    1 
ATOM   5033 C  C4    . C   B  1 75  ? 16.457  54.684  21.906 1.00 24.59  ? 89  C   A C4    1 
ATOM   5034 N  N4    . C   B  1 75  ? 16.654  55.970  21.603 1.00 25.16  ? 89  C   A N4    1 
ATOM   5035 C  C5    . C   B  1 75  ? 16.745  53.691  20.935 1.00 24.60  ? 89  C   A C5    1 
ATOM   5036 C  C6    . C   B  1 75  ? 16.543  52.412  21.267 1.00 24.97  ? 89  C   A C6    1 
ATOM   5037 P  P     . A   B  1 76  ? 12.145  49.107  20.107 1.00 31.23  ? 90  A   A P     1 
ATOM   5038 O  OP1   . A   B  1 76  ? 11.438  50.101  20.953 1.00 30.83  ? 90  A   A OP1   1 
ATOM   5039 O  OP2   . A   B  1 76  ? 11.442  47.859  19.759 1.00 25.96  ? 90  A   A OP2   1 
ATOM   5040 O  "O5'" . A   B  1 76  ? 12.785  49.746  18.786 1.00 27.30  ? 90  A   A "O5'" 1 
ATOM   5041 C  "C5'" . A   B  1 76  ? 11.990  50.000  17.633 1.00 27.20  ? 90  A   A "C5'" 1 
ATOM   5042 C  "C4'" . A   B  1 76  ? 12.468  51.222  16.878 1.00 28.02  ? 90  A   A "C4'" 1 
ATOM   5043 O  "O4'" . A   B  1 76  ? 12.114  52.426  17.623 1.00 24.54  ? 90  A   A "O4'" 1 
ATOM   5044 C  "C3'" . A   B  1 76  ? 13.978  51.287  16.647 1.00 25.42  ? 90  A   A "C3'" 1 
ATOM   5045 O  "O3'" . A   B  1 76  ? 14.238  51.973  15.425 1.00 27.63  ? 90  A   A "O3'" 1 
ATOM   5046 C  "C2'" . A   B  1 76  ? 14.442  52.160  17.808 1.00 22.31  ? 90  A   A "C2'" 1 
ATOM   5047 O  "O2'" . A   B  1 76  ? 15.659  52.834  17.600 1.00 21.68  ? 90  A   A "O2'" 1 
ATOM   5048 C  "C1'" . A   B  1 76  ? 13.292  53.150  17.919 1.00 24.94  ? 90  A   A "C1'" 1 
ATOM   5049 N  N9    . A   B  1 76  ? 13.163  53.711  19.260 1.00 25.65  ? 90  A   A N9    1 
ATOM   5050 C  C8    . A   B  1 76  ? 12.794  53.048  20.405 1.00 23.49  ? 90  A   A C8    1 
ATOM   5051 N  N7    . A   B  1 76  ? 12.781  53.826  21.452 1.00 24.44  ? 90  A   A N7    1 
ATOM   5052 C  C5    . A   B  1 76  ? 13.171  55.071  20.964 1.00 21.93  ? 90  A   A C5    1 
ATOM   5053 C  C6    . A   B  1 76  ? 13.344  56.316  21.582 1.00 24.55  ? 90  A   A C6    1 
ATOM   5054 N  N6    . A   B  1 76  ? 13.129  56.504  22.885 1.00 22.48  ? 90  A   A N6    1 
ATOM   5055 N  N1    . A   B  1 76  ? 13.739  57.364  20.811 1.00 23.84  ? 90  A   A N1    1 
ATOM   5056 C  C2    . A   B  1 76  ? 13.936  57.169  19.501 1.00 22.70  ? 90  A   A C2    1 
ATOM   5057 N  N3    . A   B  1 76  ? 13.803  56.034  18.806 1.00 25.57  ? 90  A   A N3    1 
ATOM   5058 C  C4    . A   B  1 76  ? 13.411  55.017  19.605 1.00 23.76  ? 90  A   A C4    1 
ATOM   5059 P  P     . G   B  1 77  ? 14.229  51.163  14.027 1.00 31.46  ? 91  G   A P     1 
ATOM   5060 O  OP1   . G   B  1 77  ? 13.006  50.329  13.941 1.00 30.42  ? 91  G   A OP1   1 
ATOM   5061 O  OP2   . G   B  1 77  ? 15.561  50.526  13.905 1.00 30.16  ? 91  G   A OP2   1 
ATOM   5062 O  "O5'" . G   B  1 77  ? 14.105  52.390  13.027 1.00 27.68  ? 91  G   A "O5'" 1 
ATOM   5063 C  "C5'" . G   B  1 77  ? 12.919  53.168  12.977 1.00 28.96  ? 91  G   A "C5'" 1 
ATOM   5064 C  "C4'" . G   B  1 77  ? 12.872  53.980  11.711 1.00 25.56  ? 91  G   A "C4'" 1 
ATOM   5065 O  "O4'" . G   B  1 77  ? 14.025  54.860  11.636 1.00 28.21  ? 91  G   A "O4'" 1 
ATOM   5066 C  "C3'" . G   B  1 77  ? 12.968  53.178  10.425 1.00 28.76  ? 91  G   A "C3'" 1 
ATOM   5067 O  "O3'" . G   B  1 77  ? 11.746  52.547  10.086 1.00 30.26  ? 91  G   A "O3'" 1 
ATOM   5068 C  "C2'" . G   B  1 77  ? 13.413  54.260  9.450  1.00 26.17  ? 91  G   A "C2'" 1 
ATOM   5069 O  "O2'" . G   B  1 77  ? 12.351  55.166  9.235  1.00 25.03  ? 91  G   A "O2'" 1 
ATOM   5070 C  "C1'" . G   B  1 77  ? 14.454  54.986  10.297 1.00 27.39  ? 91  G   A "C1'" 1 
ATOM   5071 N  N9    . G   B  1 77  ? 15.771  54.335  10.155 1.00 25.45  ? 91  G   A N9    1 
ATOM   5072 C  C8    . G   B  1 77  ? 16.533  53.702  11.102 1.00 24.86  ? 91  G   A C8    1 
ATOM   5073 N  N7    . G   B  1 77  ? 17.648  53.217  10.615 1.00 27.52  ? 91  G   A N7    1 
ATOM   5074 C  C5    . G   B  1 77  ? 17.609  53.542  9.268  1.00 27.97  ? 91  G   A C5    1 
ATOM   5075 C  C6    . G   B  1 77  ? 18.527  53.271  8.220  1.00 26.77  ? 91  G   A C6    1 
ATOM   5076 O  O6    . G   B  1 77  ? 19.604  52.683  8.278  1.00 27.08  ? 91  G   A O6    1 
ATOM   5077 N  N1    . G   B  1 77  ? 18.094  53.786  7.010  1.00 26.33  ? 91  G   A N1    1 
ATOM   5078 C  C2    . G   B  1 77  ? 16.924  54.464  6.813  1.00 28.12  ? 91  G   A C2    1 
ATOM   5079 N  N2    . G   B  1 77  ? 16.685  54.878  5.561  1.00 25.71  ? 91  G   A N2    1 
ATOM   5080 N  N3    . G   B  1 77  ? 16.053  54.721  7.775  1.00 27.37  ? 91  G   A N3    1 
ATOM   5081 C  C4    . G   B  1 77  ? 16.459  54.229  8.968  1.00 27.33  ? 91  G   A C4    1 
ATOM   5082 P  P     . A   B  1 78  ? 11.717  51.124  9.333  1.00 32.79  ? 92  A   A P     1 
ATOM   5083 O  OP1   . A   B  1 78  ? 10.263  50.877  9.160  1.00 36.12  ? 92  A   A OP1   1 
ATOM   5084 O  OP2   . A   B  1 78  ? 12.560  50.137  10.055 1.00 30.04  ? 92  A   A OP2   1 
ATOM   5085 O  "O5'" . A   B  1 78  ? 12.373  51.465  7.935  1.00 29.34  ? 92  A   A "O5'" 1 
ATOM   5086 C  "C5'" . A   B  1 78  ? 11.689  52.353  7.067  1.00 30.99  ? 92  A   A "C5'" 1 
ATOM   5087 C  "C4'" . A   B  1 78  ? 12.370  52.418  5.729  1.00 32.41  ? 92  A   A "C4'" 1 
ATOM   5088 O  "O4'" . A   B  1 78  ? 13.683  53.013  5.881  1.00 31.20  ? 92  A   A "O4'" 1 
ATOM   5089 C  "C3'" . A   B  1 78  ? 12.653  51.068  5.089  1.00 30.47  ? 92  A   A "C3'" 1 
ATOM   5090 O  "O3'" . A   B  1 78  ? 11.513  50.504  4.460  1.00 33.35  ? 92  A   A "O3'" 1 
ATOM   5091 C  "C2'" . A   B  1 78  ? 13.791  51.411  4.143  1.00 30.28  ? 92  A   A "C2'" 1 
ATOM   5092 O  "O2'" . A   B  1 78  ? 13.294  52.135  3.032  1.00 30.74  ? 92  A   A "O2'" 1 
ATOM   5093 C  "C1'" . A   B  1 78  ? 14.594  52.375  5.012  1.00 29.86  ? 92  A   A "C1'" 1 
ATOM   5094 N  N9    . A   B  1 78  ? 15.539  51.631  5.848  1.00 28.52  ? 92  A   A N9    1 
ATOM   5095 C  C8    . A   B  1 78  ? 15.423  51.353  7.184  1.00 27.57  ? 92  A   A C8    1 
ATOM   5096 N  N7    . A   B  1 78  ? 16.433  50.661  7.652  1.00 28.28  ? 92  A   A N7    1 
ATOM   5097 C  C5    . A   B  1 78  ? 17.255  50.485  6.545  1.00 26.02  ? 92  A   A C5    1 
ATOM   5098 C  C6    . A   B  1 78  ? 18.477  49.829  6.381  1.00 27.48  ? 92  A   A C6    1 
ATOM   5099 N  N6    . A   B  1 78  ? 19.123  49.205  7.372  1.00 24.21  ? 92  A   A N6    1 
ATOM   5100 N  N1    . A   B  1 78  ? 19.013  49.839  5.145  1.00 24.17  ? 92  A   A N1    1 
ATOM   5101 C  C2    . A   B  1 78  ? 18.374  50.464  4.148  1.00 26.94  ? 92  A   A C2    1 
ATOM   5102 N  N3    . A   B  1 78  ? 17.213  51.107  4.180  1.00 26.23  ? 92  A   A N3    1 
ATOM   5103 C  C4    . A   B  1 78  ? 16.717  51.079  5.427  1.00 24.17  ? 92  A   A C4    1 
ATOM   5104 P  P     . A   B  1 79  ? 11.373  48.918  4.231  1.00 34.58  ? 93  A   A P     1 
ATOM   5105 O  OP1   . A   B  1 79  ? 9.985   48.734  3.722  1.00 38.65  ? 93  A   A OP1   1 
ATOM   5106 O  OP2   . A   B  1 79  ? 11.782  48.220  5.477  1.00 33.08  ? 93  A   A OP2   1 
ATOM   5107 O  "O5'" . A   B  1 79  ? 12.445  48.655  3.081  1.00 31.40  ? 93  A   A "O5'" 1 
ATOM   5108 C  "C5'" . A   B  1 79  ? 12.307  49.284  1.818  1.00 32.56  ? 93  A   A "C5'" 1 
ATOM   5109 C  "C4'" . A   B  1 79  ? 13.437  48.913  0.892  1.00 32.89  ? 93  A   A "C4'" 1 
ATOM   5110 O  "O4'" . A   B  1 79  ? 14.699  49.386  1.433  1.00 31.21  ? 93  A   A "O4'" 1 
ATOM   5111 C  "C3'" . A   B  1 79  ? 13.673  47.426  0.691  1.00 30.61  ? 93  A   A "C3'" 1 
ATOM   5112 O  "O3'" . A   B  1 79  ? 12.768  46.833  -0.224 1.00 31.25  ? 93  A   A "O3'" 1 
ATOM   5113 C  "C2'" . A   B  1 79  ? 15.118  47.399  0.227  1.00 30.16  ? 93  A   A "C2'" 1 
ATOM   5114 O  "O2'" . A   B  1 79  ? 15.202  47.879  -1.106 1.00 32.61  ? 93  A   A "O2'" 1 
ATOM   5115 C  "C1'" . A   B  1 79  ? 15.724  48.476  1.117  1.00 29.34  ? 93  A   A "C1'" 1 
ATOM   5116 N  N9    . A   B  1 79  ? 16.275  47.937  2.374  1.00 28.56  ? 93  A   A N9    1 
ATOM   5117 C  C8    . A   B  1 79  ? 15.733  47.945  3.637  1.00 26.29  ? 93  A   A C8    1 
ATOM   5118 N  N7    . A   B  1 79  ? 16.516  47.392  4.546  1.00 27.39  ? 93  A   A N7    1 
ATOM   5119 C  C5    . A   B  1 79  ? 17.639  47.007  3.823  1.00 26.58  ? 93  A   A C5    1 
ATOM   5120 C  C6    . A   B  1 79  ? 18.837  46.359  4.189  1.00 26.04  ? 93  A   A C6    1 
ATOM   5121 N  N6    . A   B  1 79  ? 19.129  45.975  5.438  1.00 26.40  ? 93  A   A N6    1 
ATOM   5122 N  N1    . A   B  1 79  ? 19.733  46.115  3.212  1.00 25.06  ? 93  A   A N1    1 
ATOM   5123 C  C2    . A   B  1 79  ? 19.453  46.505  1.966  1.00 25.10  ? 93  A   A C2    1 
ATOM   5124 N  N3    . A   B  1 79  ? 18.374  47.116  1.494  1.00 27.72  ? 93  A   A N3    1 
ATOM   5125 C  C4    . A   B  1 79  ? 17.498  47.341  2.488  1.00 25.54  ? 93  A   A C4    1 
ATOM   5126 P  P     . A   B  1 80  ? 12.477  45.255  -0.121 1.00 34.35  ? 94  A   A P     1 
ATOM   5127 O  OP1   . A   B  1 80  ? 11.350  44.975  -1.048 1.00 38.01  ? 94  A   A OP1   1 
ATOM   5128 O  OP2   . A   B  1 80  ? 12.365  44.802  1.287  1.00 31.45  ? 94  A   A OP2   1 
ATOM   5129 O  "O5'" . A   B  1 80  ? 13.828  44.690  -0.686 1.00 27.36  ? 94  A   A "O5'" 1 
ATOM   5130 C  "C5'" . A   B  1 80  ? 14.230  44.923  -2.021 1.00 31.99  ? 94  A   A "C5'" 1 
ATOM   5131 C  "C4'" . A   B  1 80  ? 15.425  44.067  -2.339 1.00 28.96  ? 94  A   A "C4'" 1 
ATOM   5132 O  "O4'" . A   B  1 80  ? 16.566  44.519  -1.573 1.00 27.11  ? 94  A   A "O4'" 1 
ATOM   5133 C  "C3'" . A   B  1 80  ? 15.298  42.597  -1.961 1.00 30.56  ? 94  A   A "C3'" 1 
ATOM   5134 O  "O3'" . A   B  1 80  ? 14.532  41.862  -2.899 1.00 30.08  ? 94  A   A "O3'" 1 
ATOM   5135 C  "C2'" . A   B  1 80  ? 16.758  42.170  -1.854 1.00 25.19  ? 94  A   A "C2'" 1 
ATOM   5136 O  "O2'" . A   B  1 80  ? 17.351  42.067  -3.147 1.00 28.98  ? 94  A   A "O2'" 1 
ATOM   5137 C  "C1'" . A   B  1 80  ? 17.362  43.412  -1.198 1.00 25.55  ? 94  A   A "C1'" 1 
ATOM   5138 N  N9    . A   B  1 80  ? 17.392  43.366  0.280  1.00 23.29  ? 94  A   A N9    1 
ATOM   5139 C  C8    . A   B  1 80  ? 16.483  43.924  1.140  1.00 24.59  ? 94  A   A C8    1 
ATOM   5140 N  N7    . A   B  1 80  ? 16.784  43.750  2.408  1.00 22.80  ? 94  A   A N7    1 
ATOM   5141 C  C5    . A   B  1 80  ? 17.979  43.048  2.370  1.00 21.91  ? 94  A   A C5    1 
ATOM   5142 C  C6    . A   B  1 80  ? 18.815  42.561  3.384  1.00 23.79  ? 94  A   A C6    1 
ATOM   5143 N  N6    . A   B  1 80  ? 18.564  42.731  4.691  1.00 22.60  ? 94  A   A N6    1 
ATOM   5144 N  N1    . A   B  1 80  ? 19.928  41.891  3.010  1.00 23.53  ? 94  A   A N1    1 
ATOM   5145 C  C2    . A   B  1 80  ? 20.181  41.735  1.701  1.00 25.88  ? 94  A   A C2    1 
ATOM   5146 N  N3    . A   B  1 80  ? 19.462  42.152  0.658  1.00 26.45  ? 94  A   A N3    1 
ATOM   5147 C  C4    . A   B  1 80  ? 18.369  42.818  1.065  1.00 23.11  ? 94  A   A C4    1 
ATOM   5148 P  P     . U   B  1 81  ? 13.563  40.672  -2.442 1.00 31.75  ? 95  U   A P     1 
ATOM   5149 O  OP1   . U   B  1 81  ? 12.692  40.530  -3.633 1.00 36.83  ? 95  U   A OP1   1 
ATOM   5150 O  OP2   . U   B  1 81  ? 12.956  40.998  -1.119 1.00 30.34  ? 95  U   A OP2   1 
ATOM   5151 O  "O5'" . U   B  1 81  ? 14.512  39.401  -2.274 1.00 28.63  ? 95  U   A "O5'" 1 
ATOM   5152 C  "C5'" . U   B  1 81  ? 15.243  38.856  -3.369 1.00 27.64  ? 95  U   A "C5'" 1 
ATOM   5153 C  "C4'" . U   B  1 81  ? 16.372  37.975  -2.891 1.00 29.36  ? 95  U   A "C4'" 1 
ATOM   5154 O  "O4'" . U   B  1 81  ? 17.328  38.761  -2.133 1.00 25.86  ? 95  U   A "O4'" 1 
ATOM   5155 C  "C3'" . U   B  1 81  ? 15.981  36.861  -1.930 1.00 28.42  ? 95  U   A "C3'" 1 
ATOM   5156 O  "O3'" . U   B  1 81  ? 15.436  35.724  -2.576 1.00 26.31  ? 95  U   A "O3'" 1 
ATOM   5157 C  "C2'" . U   B  1 81  ? 17.282  36.586  -1.189 1.00 27.58  ? 95  U   A "C2'" 1 
ATOM   5158 O  "O2'" . U   B  1 81  ? 18.183  35.824  -1.978 1.00 25.21  ? 95  U   A "O2'" 1 
ATOM   5159 C  "C1'" . U   B  1 81  ? 17.836  38.001  -1.055 1.00 26.94  ? 95  U   A "C1'" 1 
ATOM   5160 N  N1    . U   B  1 81  ? 17.425  38.642  0.226  1.00 24.45  ? 95  U   A N1    1 
ATOM   5161 C  C2    . U   B  1 81  ? 18.243  38.408  1.323  1.00 26.97  ? 95  U   A C2    1 
ATOM   5162 O  O2    . U   B  1 81  ? 19.228  37.696  1.247  1.00 25.85  ? 95  U   A O2    1 
ATOM   5163 N  N3    . U   B  1 81  ? 17.854  39.003  2.499  1.00 20.80  ? 95  U   A N3    1 
ATOM   5164 C  C4    . U   B  1 81  ? 16.745  39.811  2.682  1.00 25.19  ? 95  U   A C4    1 
ATOM   5165 O  O4    . U   B  1 81  ? 16.521  40.288  3.805  1.00 23.03  ? 95  U   A O4    1 
ATOM   5166 C  C5    . U   B  1 81  ? 15.949  40.017  1.500  1.00 27.06  ? 95  U   A C5    1 
ATOM   5167 C  C6    . U   B  1 81  ? 16.306  39.433  0.338  1.00 25.67  ? 95  U   A C6    1 
ATOM   5168 P  P     . C   B  1 82  ? 14.239  34.898  -1.898 1.00 32.29  ? 96  C   A P     1 
ATOM   5169 O  OP1   . C   B  1 82  ? 13.769  34.017  -3.001 1.00 31.63  ? 96  C   A OP1   1 
ATOM   5170 O  OP2   . C   B  1 82  ? 13.260  35.770  -1.204 1.00 28.79  ? 96  C   A OP2   1 
ATOM   5171 O  "O5'" . C   B  1 82  ? 15.037  34.053  -0.818 1.00 28.59  ? 96  C   A "O5'" 1 
ATOM   5172 C  "C5'" . C   B  1 82  ? 16.064  33.164  -1.214 1.00 27.69  ? 96  C   A "C5'" 1 
ATOM   5173 C  "C4'" . C   B  1 82  ? 16.908  32.754  -0.036 1.00 26.87  ? 96  C   A "C4'" 1 
ATOM   5174 O  "O4'" . C   B  1 82  ? 17.606  33.915  0.484  1.00 25.96  ? 96  C   A "O4'" 1 
ATOM   5175 C  "C3'" . C   B  1 82  ? 16.170  32.196  1.176  1.00 27.51  ? 96  C   A "C3'" 1 
ATOM   5176 O  "O3'" . C   B  1 82  ? 15.807  30.826  1.044  1.00 28.90  ? 96  C   A "O3'" 1 
ATOM   5177 C  "C2'" . C   B  1 82  ? 17.199  32.424  2.276  1.00 25.80  ? 96  C   A "C2'" 1 
ATOM   5178 O  "O2'" . C   B  1 82  ? 18.232  31.452  2.172  1.00 27.99  ? 96  C   A "O2'" 1 
ATOM   5179 C  "C1'" . C   B  1 82  ? 17.765  33.788  1.884  1.00 26.52  ? 96  C   A "C1'" 1 
ATOM   5180 N  N1    . C   B  1 82  ? 17.022  34.861  2.585  1.00 24.17  ? 96  C   A N1    1 
ATOM   5181 C  C2    . C   B  1 82  ? 17.387  35.185  3.902  1.00 24.51  ? 96  C   A C2    1 
ATOM   5182 O  O2    . C   B  1 82  ? 18.335  34.600  4.445  1.00 21.56  ? 96  C   A O2    1 
ATOM   5183 N  N3    . C   B  1 82  ? 16.703  36.144  4.547  1.00 21.81  ? 96  C   A N3    1 
ATOM   5184 C  C4    . C   B  1 82  ? 15.684  36.771  3.976  1.00 22.87  ? 96  C   A C4    1 
ATOM   5185 N  N4    . C   B  1 82  ? 15.061  37.720  4.693  1.00 21.33  ? 96  C   A N4    1 
ATOM   5186 C  C5    . C   B  1 82  ? 15.273  36.461  2.645  1.00 23.08  ? 96  C   A C5    1 
ATOM   5187 C  C6    . C   B  1 82  ? 15.965  35.505  2.003  1.00 26.36  ? 96  C   A C6    1 
ATOM   5188 P  P     . A   B  1 83  ? 14.529  30.242  1.836  1.00 32.40  ? 97  A   A P     1 
ATOM   5189 O  OP1   . A   B  1 83  ? 14.307  28.915  1.223  1.00 32.45  ? 97  A   A OP1   1 
ATOM   5190 O  OP2   . A   B  1 83  ? 13.472  31.280  1.795  1.00 30.97  ? 97  A   A OP2   1 
ATOM   5191 O  "O5'" . A   B  1 83  ? 14.974  30.101  3.363  1.00 30.09  ? 97  A   A "O5'" 1 
ATOM   5192 C  "C5'" . A   B  1 83  ? 16.093  29.330  3.776  1.00 26.87  ? 97  A   A "C5'" 1 
ATOM   5193 C  "C4'" . A   B  1 83  ? 16.444  29.590  5.222  1.00 26.35  ? 97  A   A "C4'" 1 
ATOM   5194 O  "O4'" . A   B  1 83  ? 16.883  30.962  5.390  1.00 26.28  ? 97  A   A "O4'" 1 
ATOM   5195 C  "C3'" . A   B  1 83  ? 15.316  29.458  6.237  1.00 23.58  ? 97  A   A "C3'" 1 
ATOM   5196 O  "O3'" . A   B  1 83  ? 15.023  28.115  6.572  1.00 24.80  ? 97  A   A "O3'" 1 
ATOM   5197 C  "C2'" . A   B  1 83  ? 15.852  30.273  7.409  1.00 25.70  ? 97  A   A "C2'" 1 
ATOM   5198 O  "O2'" . A   B  1 83  ? 16.876  29.551  8.074  1.00 26.67  ? 97  A   A "O2'" 1 
ATOM   5199 C  "C1'" . A   B  1 83  ? 16.522  31.430  6.673  1.00 23.76  ? 97  A   A "C1'" 1 
ATOM   5200 N  N9    . A   B  1 83  ? 15.625  32.585  6.508  1.00 24.06  ? 97  A   A N9    1 
ATOM   5201 C  C8    . A   B  1 83  ? 14.966  32.963  5.362  1.00 23.33  ? 97  A   A C8    1 
ATOM   5202 N  N7    . A   B  1 83  ? 14.227  34.033  5.525  1.00 23.77  ? 97  A   A N7    1 
ATOM   5203 C  C5    . A   B  1 83  ? 14.434  34.383  6.864  1.00 21.49  ? 97  A   A C5    1 
ATOM   5204 C  C6    . A   B  1 83  ? 13.932  35.423  7.664  1.00 20.36  ? 97  A   A C6    1 
ATOM   5205 N  N6    . A   B  1 83  ? 13.111  36.369  7.211  1.00 21.02  ? 97  A   A N6    1 
ATOM   5206 N  N1    . A   B  1 83  ? 14.309  35.474  8.965  1.00 19.55  ? 97  A   A N1    1 
ATOM   5207 C  C2    . A   B  1 83  ? 15.144  34.536  9.419  1.00 20.37  ? 97  A   A C2    1 
ATOM   5208 N  N3    . A   B  1 83  ? 15.686  33.518  8.756  1.00 20.99  ? 97  A   A N3    1 
ATOM   5209 C  C4    . A   B  1 83  ? 15.280  33.494  7.478  1.00 21.87  ? 97  A   A C4    1 
ATOM   5210 P  P     . U   B  1 84  ? 13.534  27.642  6.953  1.00 27.87  ? 98  U   A P     1 
ATOM   5211 O  OP1   . U   B  1 84  ? 13.600  26.177  7.141  1.00 33.74  ? 98  U   A OP1   1 
ATOM   5212 O  OP2   . U   B  1 84  ? 12.618  28.201  5.933  1.00 27.82  ? 98  U   A OP2   1 
ATOM   5213 O  "O5'" . U   B  1 84  ? 13.267  28.364  8.351  1.00 24.74  ? 98  U   A "O5'" 1 
ATOM   5214 C  "C5'" . U   B  1 84  ? 14.000  28.007  9.512  1.00 21.18  ? 98  U   A "C5'" 1 
ATOM   5215 C  "C4'" . U   B  1 84  ? 13.755  28.993  10.624 1.00 21.93  ? 98  U   A "C4'" 1 
ATOM   5216 O  "O4'" . U   B  1 84  ? 14.143  30.329  10.207 1.00 22.35  ? 98  U   A "O4'" 1 
ATOM   5217 C  "C3'" . U   B  1 84  ? 12.296  29.156  11.024 1.00 21.18  ? 98  U   A "C3'" 1 
ATOM   5218 O  "O3'" . U   B  1 84  ? 11.871  28.121  11.891 1.00 23.51  ? 98  U   A "O3'" 1 
ATOM   5219 C  "C2'" . U   B  1 84  ? 12.285  30.541  11.658 1.00 20.53  ? 98  U   A "C2'" 1 
ATOM   5220 O  "O2'" . U   B  1 84  ? 12.918  30.516  12.929 1.00 20.99  ? 98  U   A "O2'" 1 
ATOM   5221 C  "C1'" . U   B  1 84  ? 13.253  31.281  10.733 1.00 21.75  ? 98  U   A "C1'" 1 
ATOM   5222 N  N1    . U   B  1 84  ? 12.583  31.988  9.628  1.00 21.96  ? 98  U   A N1    1 
ATOM   5223 C  C2    . U   B  1 84  ? 12.040  33.214  9.934  1.00 20.15  ? 98  U   A C2    1 
ATOM   5224 O  O2    . U   B  1 84  ? 12.114  33.677  11.063 1.00 20.44  ? 98  U   A O2    1 
ATOM   5225 N  N3    . U   B  1 84  ? 11.429  33.876  8.883  1.00 18.22  ? 98  U   A N3    1 
ATOM   5226 C  C4    . U   B  1 84  ? 11.317  33.416  7.589  1.00 24.39  ? 98  U   A C4    1 
ATOM   5227 O  O4    . U   B  1 84  ? 10.735  34.117  6.750  1.00 23.93  ? 98  U   A O4    1 
ATOM   5228 C  C5    . U   B  1 84  ? 11.910  32.122  7.354  1.00 24.49  ? 98  U   A C5    1 
ATOM   5229 C  C6    . U   B  1 84  ? 12.512  31.469  8.355  1.00 23.53  ? 98  U   A C6    1 
ATOM   5230 P  P     . C   B  1 85  ? 10.358  27.592  11.830 1.00 23.95  ? 99  C   A P     1 
ATOM   5231 O  OP1   . C   B  1 85  ? 10.392  26.422  12.738 1.00 22.43  ? 99  C   A OP1   1 
ATOM   5232 O  OP2   . C   B  1 85  ? 9.913   27.403  10.433 1.00 22.21  ? 99  C   A OP2   1 
ATOM   5233 O  "O5'" . C   B  1 85  ? 9.497   28.789  12.425 1.00 20.33  ? 99  C   A "O5'" 1 
ATOM   5234 C  "C5'" . C   B  1 85  ? 9.485   28.967  13.834 1.00 22.30  ? 99  C   A "C5'" 1 
ATOM   5235 C  "C4'" . C   B  1 85  ? 8.782   30.238  14.233 1.00 16.39  ? 99  C   A "C4'" 1 
ATOM   5236 O  "O4'" . C   B  1 85  ? 9.447   31.417  13.694 1.00 18.27  ? 99  C   A "O4'" 1 
ATOM   5237 C  "C3'" . C   B  1 85  ? 7.353   30.408  13.753 1.00 17.14  ? 99  C   A "C3'" 1 
ATOM   5238 O  "O3'" . C   B  1 85  ? 6.436   29.616  14.484 1.00 16.96  ? 99  C   A "O3'" 1 
ATOM   5239 C  "C2'" . C   B  1 85  ? 7.147   31.900  13.968 1.00 16.65  ? 99  C   A "C2'" 1 
ATOM   5240 O  "O2'" . C   B  1 85  ? 6.948   32.158  15.356 1.00 18.57  ? 99  C   A "O2'" 1 
ATOM   5241 C  "C1'" . C   B  1 85  ? 8.508   32.462  13.536 1.00 16.24  ? 99  C   A "C1'" 1 
ATOM   5242 N  N1    . C   B  1 85  ? 8.392   32.920  12.125 1.00 16.92  ? 99  C   A N1    1 
ATOM   5243 C  C2    . C   B  1 85  ? 7.836   34.177  11.905 1.00 17.42  ? 99  C   A C2    1 
ATOM   5244 O  O2    . C   B  1 85  ? 7.501   34.861  12.891 1.00 17.76  ? 99  C   A O2    1 
ATOM   5245 N  N3    . C   B  1 85  ? 7.660   34.623  10.633 1.00 17.52  ? 99  C   A N3    1 
ATOM   5246 C  C4    . C   B  1 85  ? 8.042   33.858  9.611  1.00 16.45  ? 99  C   A C4    1 
ATOM   5247 N  N4    . C   B  1 85  ? 7.858   34.343  8.381  1.00 18.35  ? 99  C   A N4    1 
ATOM   5248 C  C5    . C   B  1 85  ? 8.601   32.551  9.803  1.00 19.64  ? 99  C   A C5    1 
ATOM   5249 C  C6    . C   B  1 85  ? 8.743   32.118  11.070 1.00 16.82  ? 99  C   A C6    1 
ATOM   5250 P  P     . G   B  1 86  ? 5.045   29.162  13.815 1.00 19.21  ? 100 G   A P     1 
ATOM   5251 O  OP1   . G   B  1 86  ? 4.333   28.379  14.842 1.00 15.79  ? 100 G   A OP1   1 
ATOM   5252 O  OP2   . G   B  1 86  ? 5.406   28.486  12.559 1.00 15.07  ? 100 G   A OP2   1 
ATOM   5253 O  "O5'" . G   B  1 86  ? 4.272   30.489  13.498 1.00 16.89  ? 100 G   A "O5'" 1 
ATOM   5254 C  "C5'" . G   B  1 86  ? 3.636   31.242  14.522 1.00 17.29  ? 100 G   A "C5'" 1 
ATOM   5255 C  "C4'" . G   B  1 86  ? 2.913   32.402  13.899 1.00 17.24  ? 100 G   A "C4'" 1 
ATOM   5256 O  "O4'" . G   B  1 86  ? 3.877   33.314  13.318 1.00 18.35  ? 100 G   A "O4'" 1 
ATOM   5257 C  "C3'" . G   B  1 86  ? 2.002   32.046  12.735 1.00 19.02  ? 100 G   A "C3'" 1 
ATOM   5258 O  "O3'" . G   B  1 86  ? 0.734   31.518  13.134 1.00 16.48  ? 100 G   A "O3'" 1 
ATOM   5259 C  "C2'" . G   B  1 86  ? 1.930   33.377  11.994 1.00 15.97  ? 100 G   A "C2'" 1 
ATOM   5260 O  "O2'" . G   B  1 86  ? 0.972   34.239  12.586 1.00 19.73  ? 100 G   A "O2'" 1 
ATOM   5261 C  "C1'" . G   B  1 86  ? 3.353   33.928  12.159 1.00 18.97  ? 100 G   A "C1'" 1 
ATOM   5262 N  N9    . G   B  1 86  ? 4.068   33.486  10.951 1.00 17.01  ? 100 G   A N9    1 
ATOM   5263 C  C8    . G   B  1 86  ? 4.755   32.316  10.753 1.00 16.56  ? 100 G   A C8    1 
ATOM   5264 N  N7    . G   B  1 86  ? 5.161   32.171  9.517  1.00 18.37  ? 100 G   A N7    1 
ATOM   5265 C  C5    . G   B  1 86  ? 4.693   33.296  8.865  1.00 18.89  ? 100 G   A C5    1 
ATOM   5266 C  C6    . G   B  1 86  ? 4.825   33.686  7.510  1.00 21.29  ? 100 G   A C6    1 
ATOM   5267 O  O6    . G   B  1 86  ? 5.404   33.079  6.602  1.00 20.73  ? 100 G   A O6    1 
ATOM   5268 N  N1    . G   B  1 86  ? 4.211   34.908  7.276  1.00 17.68  ? 100 G   A N1    1 
ATOM   5269 C  C2    . G   B  1 86  ? 3.534   35.659  8.206  1.00 18.96  ? 100 G   A C2    1 
ATOM   5270 N  N2    . G   B  1 86  ? 3.010   36.811  7.757  1.00 17.99  ? 100 G   A N2    1 
ATOM   5271 N  N3    . G   B  1 86  ? 3.395   35.306  9.480  1.00 16.89  ? 100 G   A N3    1 
ATOM   5272 C  C4    . G   B  1 86  ? 4.005   34.123  9.731  1.00 19.54  ? 100 G   A C4    1 
ATOM   5273 P  P     . A   B  1 87  ? -0.178  30.609  12.133 1.00 18.54  ? 101 A   A P     1 
ATOM   5274 O  OP1   . A   B  1 87  ? -0.560  31.436  10.956 1.00 22.70  ? 101 A   A OP1   1 
ATOM   5275 O  OP2   . A   B  1 87  ? -1.260  30.078  13.006 1.00 18.16  ? 101 A   A OP2   1 
ATOM   5276 O  "O5'" . A   B  1 87  ? 0.763   29.440  11.631 1.00 20.36  ? 101 A   A "O5'" 1 
ATOM   5277 C  "C5'" . A   B  1 87  ? 1.330   28.527  12.560 1.00 19.74  ? 101 A   A "C5'" 1 
ATOM   5278 C  "C4'" . A   B  1 87  ? 0.911   27.089  12.323 1.00 20.00  ? 101 A   A "C4'" 1 
ATOM   5279 O  "O4'" . A   B  1 87  ? -0.508  26.908  12.609 1.00 23.62  ? 101 A   A "O4'" 1 
ATOM   5280 C  "C3'" . A   B  1 87  ? 1.129   26.488  10.931 1.00 20.75  ? 101 A   A "C3'" 1 
ATOM   5281 O  "O3'" . A   B  1 87  ? 1.720   25.210  11.099 1.00 23.00  ? 101 A   A "O3'" 1 
ATOM   5282 C  "C2'" . A   B  1 87  ? -0.288  26.253  10.406 1.00 26.01  ? 101 A   A "C2'" 1 
ATOM   5283 O  "O2'" . A   B  1 87  ? -0.417  25.150  9.535  1.00 31.96  ? 101 A   A "O2'" 1 
ATOM   5284 C  "C1'" . A   B  1 87  ? -1.006  25.940  11.704 1.00 25.36  ? 101 A   A "C1'" 1 
ATOM   5285 N  N9    . A   B  1 87  ? -2.480  25.892  11.647 1.00 21.07  ? 101 A   A N9    1 
ATOM   5286 C  C8    . A   B  1 87  ? -3.318  26.179  10.588 1.00 24.62  ? 101 A   A C8    1 
ATOM   5287 N  N7    . A   B  1 87  ? -4.596  26.010  10.862 1.00 24.45  ? 101 A   A N7    1 
ATOM   5288 C  C5    . A   B  1 87  ? -4.591  25.552  12.176 1.00 24.23  ? 101 A   A C5    1 
ATOM   5289 C  C6    . A   B  1 87  ? -5.626  25.189  13.047 1.00 26.00  ? 101 A   A C6    1 
ATOM   5290 N  N6    . A   B  1 87  ? -6.920  25.219  12.696 1.00 25.81  ? 101 A   A N6    1 
ATOM   5291 N  N1    . A   B  1 87  ? -5.285  24.788  14.292 1.00 24.12  ? 101 A   A N1    1 
ATOM   5292 C  C2    . A   B  1 87  ? -3.986  24.758  14.624 1.00 24.11  ? 101 A   A C2    1 
ATOM   5293 N  N3    . A   B  1 87  ? -2.916  25.077  13.888 1.00 24.51  ? 101 A   A N3    1 
ATOM   5294 C  C4    . A   B  1 87  ? -3.293  25.469  12.662 1.00 23.58  ? 101 A   A C4    1 
ATOM   5295 P  P     . C   B  1 88  ? 3.317   25.079  11.180 1.00 24.07  ? 102 C   A P     1 
ATOM   5296 O  OP1   . C   B  1 88  ? 3.629   24.340  12.423 1.00 24.20  ? 102 C   A OP1   1 
ATOM   5297 O  OP2   . C   B  1 88  ? 3.806   26.446  10.991 1.00 21.18  ? 102 C   A OP2   1 
ATOM   5298 O  "O5'" . C   B  1 88  ? 3.654   24.236  9.876  1.00 24.26  ? 102 C   A "O5'" 1 
ATOM   5299 C  "C5'" . C   B  1 88  ? 4.923   23.616  9.743  1.00 26.55  ? 102 C   A "C5'" 1 
ATOM   5300 C  "C4'" . C   B  1 88  ? 5.223   23.232  8.312  1.00 25.16  ? 102 C   A "C4'" 1 
ATOM   5301 O  "O4'" . C   B  1 88  ? 4.222   22.303  7.807  1.00 26.61  ? 102 C   A "O4'" 1 
ATOM   5302 C  "C3'" . C   B  1 88  ? 5.224   24.351  7.285  1.00 25.38  ? 102 C   A "C3'" 1 
ATOM   5303 O  "O3'" . C   B  1 88  ? 6.412   25.115  7.313  1.00 24.60  ? 102 C   A "O3'" 1 
ATOM   5304 C  "C2'" . C   B  1 88  ? 5.079   23.567  5.987  1.00 28.38  ? 102 C   A "C2'" 1 
ATOM   5305 O  "O2'" . C   B  1 88  ? 6.340   22.996  5.672  1.00 27.41  ? 102 C   A "O2'" 1 
ATOM   5306 C  "C1'" . C   B  1 88  ? 4.100   22.464  6.406  1.00 28.95  ? 102 C   A "C1'" 1 
ATOM   5307 N  N1    . C   B  1 88  ? 2.729   22.890  6.059  1.00 32.25  ? 102 C   A N1    1 
ATOM   5308 C  C2    . C   B  1 88  ? 2.351   22.882  4.712  1.00 30.92  ? 102 C   A C2    1 
ATOM   5309 O  O2    . C   B  1 88  ? 3.172   22.486  3.870  1.00 33.72  ? 102 C   A O2    1 
ATOM   5310 N  N3    . C   B  1 88  ? 1.116   23.300  4.368  1.00 30.33  ? 102 C   A N3    1 
ATOM   5311 C  C4    . C   B  1 88  ? 0.267   23.707  5.305  1.00 31.70  ? 102 C   A C4    1 
ATOM   5312 N  N4    . C   B  1 88  ? -0.943  24.107  4.920  1.00 33.51  ? 102 C   A N4    1 
ATOM   5313 C  C5    . C   B  1 88  ? 0.624   23.741  6.683  1.00 31.08  ? 102 C   A C5    1 
ATOM   5314 C  C6    . C   B  1 88  ? 1.855   23.331  7.015  1.00 31.86  ? 102 C   A C6    1 
ATOM   5315 P  P     . A   B  1 89  ? 6.342   26.713  7.288  1.00 26.26  ? 103 A   A P     1 
ATOM   5316 O  OP1   . A   B  1 89  ? 7.771   27.133  7.155  1.00 26.56  ? 103 A   A OP1   1 
ATOM   5317 O  OP2   . A   B  1 89  ? 5.506   27.193  8.409  1.00 19.52  ? 103 A   A OP2   1 
ATOM   5318 O  "O5'" . A   B  1 89  ? 5.531   27.008  5.963  1.00 27.75  ? 103 A   A "O5'" 1 
ATOM   5319 C  "C5'" . A   B  1 89  ? 6.114   26.765  4.696  1.00 28.65  ? 103 A   A "C5'" 1 
ATOM   5320 C  "C4'" . A   B  1 89  ? 5.028   26.742  3.662  1.00 26.63  ? 103 A   A "C4'" 1 
ATOM   5321 O  "O4'" . A   B  1 89  ? 3.913   25.965  4.174  1.00 28.53  ? 103 A   A "O4'" 1 
ATOM   5322 C  "C3'" . A   B  1 89  ? 4.403   28.087  3.343  1.00 24.84  ? 103 A   A "C3'" 1 
ATOM   5323 O  "O3'" . A   B  1 89  ? 5.171   28.859  2.437  1.00 23.93  ? 103 A   A "O3'" 1 
ATOM   5324 C  "C2'" . A   B  1 89  ? 3.058   27.679  2.771  1.00 29.00  ? 103 A   A "C2'" 1 
ATOM   5325 O  "O2'" . A   B  1 89  ? 3.213   27.235  1.434  1.00 30.46  ? 103 A   A "O2'" 1 
ATOM   5326 C  "C1'" . A   B  1 89  ? 2.711   26.478  3.649  1.00 27.28  ? 103 A   A "C1'" 1 
ATOM   5327 N  N9    . A   B  1 89  ? 1.826   26.892  4.745  1.00 27.52  ? 103 A   A N9    1 
ATOM   5328 C  C8    . A   B  1 89  ? 2.105   27.151  6.061  1.00 27.10  ? 103 A   A C8    1 
ATOM   5329 N  N7    . A   B  1 89  ? 1.047   27.530  6.744  1.00 24.95  ? 103 A   A N7    1 
ATOM   5330 C  C5    . A   B  1 89  ? 0.015   27.522  5.818  1.00 27.92  ? 103 A   A C5    1 
ATOM   5331 C  C6    . A   B  1 89  ? -1.364  27.815  5.900  1.00 29.17  ? 103 A   A C6    1 
ATOM   5332 N  N6    . A   B  1 89  ? -1.996  28.200  7.017  1.00 29.99  ? 103 A   A N6    1 
ATOM   5333 N  N1    . A   B  1 89  ? -2.099  27.700  4.771  1.00 28.52  ? 103 A   A N1    1 
ATOM   5334 C  C2    . A   B  1 89  ? -1.490  27.307  3.643  1.00 31.05  ? 103 A   A C2    1 
ATOM   5335 N  N3    . A   B  1 89  ? -0.211  27.003  3.448  1.00 29.69  ? 103 A   A N3    1 
ATOM   5336 C  C4    . A   B  1 89  ? 0.490   27.133  4.582  1.00 28.32  ? 103 A   A C4    1 
ATOM   5337 P  P     . U   B  1 90  ? 5.886   30.213  2.916  1.00 29.90  ? 104 U   A P     1 
ATOM   5338 O  OP1   . U   B  1 90  ? 6.444   30.890  1.712  1.00 31.85  ? 104 U   A OP1   1 
ATOM   5339 O  OP2   . U   B  1 90  ? 6.789   29.929  4.052  1.00 26.66  ? 104 U   A OP2   1 
ATOM   5340 O  "O5'" . U   B  1 90  ? 4.623   31.019  3.407  1.00 26.03  ? 104 U   A "O5'" 1 
ATOM   5341 C  "C5'" . U   B  1 90  ? 3.550   31.271  2.515  1.00 26.44  ? 104 U   A "C5'" 1 
ATOM   5342 C  "C4'" . U   B  1 90  ? 2.348   31.758  3.275  1.00 23.51  ? 104 U   A "C4'" 1 
ATOM   5343 O  "O4'" . U   B  1 90  ? 1.910   30.750  4.222  1.00 24.29  ? 104 U   A "O4'" 1 
ATOM   5344 C  "C3'" . U   B  1 90  ? 2.563   33.005  4.119  1.00 24.78  ? 104 U   A "C3'" 1 
ATOM   5345 O  "O3'" . U   B  1 90  ? 2.448   34.171  3.321  1.00 23.26  ? 104 U   A "O3'" 1 
ATOM   5346 C  "C2'" . U   B  1 90  ? 1.473   32.891  5.184  1.00 22.67  ? 104 U   A "C2'" 1 
ATOM   5347 O  "O2'" . U   B  1 90  ? 0.245   33.386  4.671  1.00 25.65  ? 104 U   A "O2'" 1 
ATOM   5348 C  "C1'" . U   B  1 90  ? 1.348   31.373  5.362  1.00 23.86  ? 104 U   A "C1'" 1 
ATOM   5349 N  N1    . U   B  1 90  ? 1.974   30.791  6.577  1.00 22.87  ? 104 U   A N1    1 
ATOM   5350 C  C2    . U   B  1 90  ? 1.156   30.565  7.662  1.00 22.42  ? 104 U   A C2    1 
ATOM   5351 O  O2    . U   B  1 90  ? -0.043  30.824  7.639  1.00 21.84  ? 104 U   A O2    1 
ATOM   5352 N  N3    . U   B  1 90  ? 1.781   30.024  8.763  1.00 19.51  ? 104 U   A N3    1 
ATOM   5353 C  C4    . U   B  1 90  ? 3.103   29.676  8.866  1.00 20.39  ? 104 U   A C4    1 
ATOM   5354 O  O4    . U   B  1 90  ? 3.525   29.190  9.910  1.00 20.04  ? 104 U   A O4    1 
ATOM   5355 C  C5    . U   B  1 90  ? 3.883   29.936  7.691  1.00 20.55  ? 104 U   A C5    1 
ATOM   5356 C  C6    . U   B  1 90  ? 3.306   30.472  6.615  1.00 21.30  ? 104 U   A C6    1 
ATOM   5357 P  P     . A   B  1 91  ? 3.105   35.594  3.697  1.00 24.29  ? 105 A   A P     1 
ATOM   5358 O  OP1   . A   B  1 91  ? 3.441   36.203  2.395  1.00 26.11  ? 105 A   A OP1   1 
ATOM   5359 O  OP2   . A   B  1 91  ? 4.200   35.424  4.707  1.00 22.65  ? 105 A   A OP2   1 
ATOM   5360 O  "O5'" . A   B  1 91  ? 1.904   36.393  4.325  1.00 22.51  ? 105 A   A "O5'" 1 
ATOM   5361 C  "C5'" . A   B  1 91  ? 0.766   36.648  3.526  1.00 23.02  ? 105 A   A "C5'" 1 
ATOM   5362 C  "C4'" . A   B  1 91  ? -0.159  37.629  4.189  1.00 26.24  ? 105 A   A "C4'" 1 
ATOM   5363 O  "O4'" . A   B  1 91  ? -0.938  36.961  5.210  1.00 22.26  ? 105 A   A "O4'" 1 
ATOM   5364 C  "C3'" . A   B  1 91  ? 0.479   38.787  4.941  1.00 22.10  ? 105 A   A "C3'" 1 
ATOM   5365 O  "O3'" . A   B  1 91  ? 0.983   39.808  4.098  1.00 23.45  ? 105 A   A "O3'" 1 
ATOM   5366 C  "C2'" . A   B  1 91  ? -0.672  39.252  5.820  1.00 22.26  ? 105 A   A "C2'" 1 
ATOM   5367 O  "O2'" . A   B  1 91  ? -1.597  40.007  5.043  1.00 23.78  ? 105 A   A "O2'" 1 
ATOM   5368 C  "C1'" . A   B  1 91  ? -1.324  37.917  6.174  1.00 21.09  ? 105 A   A "C1'" 1 
ATOM   5369 N  N9    . A   B  1 91  ? -1.005  37.398  7.521  1.00 20.50  ? 105 A   A N9    1 
ATOM   5370 C  C8    . A   B  1 91  ? -0.265  36.279  7.833  1.00 19.73  ? 105 A   A C8    1 
ATOM   5371 N  N7    . A   B  1 91  ? -0.200  36.034  9.126  1.00 19.19  ? 105 A   A N7    1 
ATOM   5372 C  C5    . A   B  1 91  ? -0.953  37.057  9.688  1.00 18.45  ? 105 A   A C5    1 
ATOM   5373 C  C6    . A   B  1 91  ? -1.279  37.355  11.020 1.00 18.63  ? 105 A   A C6    1 
ATOM   5374 N  N6    . A   B  1 91  ? -0.846  36.622  12.061 1.00 15.14  ? 105 A   A N6    1 
ATOM   5375 N  N1    . A   B  1 91  ? -2.076  38.440  11.245 1.00 20.34  ? 105 A   A N1    1 
ATOM   5376 C  C2    . A   B  1 91  ? -2.502  39.179  10.198 1.00 20.26  ? 105 A   A C2    1 
ATOM   5377 N  N3    . A   B  1 91  ? -2.255  38.988  8.892  1.00 20.05  ? 105 A   A N3    1 
ATOM   5378 C  C4    . A   B  1 91  ? -1.466  37.903  8.707  1.00 18.97  ? 105 A   A C4    1 
ATOM   5379 P  P     . A   B  1 92  ? 2.233   40.656  4.628  1.00 24.27  ? 106 A   A P     1 
ATOM   5380 O  OP1   . A   B  1 92  ? 2.630   41.543  3.504  1.00 28.84  ? 106 A   A OP1   1 
ATOM   5381 O  OP2   . A   B  1 92  ? 3.210   39.697  5.212  1.00 25.82  ? 106 A   A OP2   1 
ATOM   5382 O  "O5'" . A   B  1 92  ? 1.616   41.502  5.825  1.00 21.23  ? 106 A   A "O5'" 1 
ATOM   5383 C  "C5'" . A   B  1 92  ? 0.573   42.450  5.637  1.00 22.98  ? 106 A   A "C5'" 1 
ATOM   5384 C  "C4'" . A   B  1 92  ? 0.146   42.994  6.974  1.00 23.01  ? 106 A   A "C4'" 1 
ATOM   5385 O  "O4'" . A   B  1 92  ? -0.470  41.938  7.760  1.00 21.79  ? 106 A   A "O4'" 1 
ATOM   5386 C  "C3'" . A   B  1 92  ? 1.295   43.493  7.837  1.00 19.99  ? 106 A   A "C3'" 1 
ATOM   5387 O  "O3'" . A   B  1 92  ? 1.651   44.823  7.502  1.00 24.56  ? 106 A   A "O3'" 1 
ATOM   5388 C  "C2'" . A   B  1 92  ? 0.732   43.351  9.242  1.00 22.47  ? 106 A   A "C2'" 1 
ATOM   5389 O  "O2'" . A   B  1 92  ? -0.164  44.408  9.507  1.00 22.42  ? 106 A   A "O2'" 1 
ATOM   5390 C  "C1'" . A   B  1 92  ? -0.104  42.078  9.115  1.00 21.36  ? 106 A   A "C1'" 1 
ATOM   5391 N  N9    . A   B  1 92  ? 0.644   40.870  9.490  1.00 23.19  ? 106 A   A N9    1 
ATOM   5392 C  C8    . A   B  1 92  ? 1.369   40.050  8.671  1.00 18.16  ? 106 A   A C8    1 
ATOM   5393 N  N7    . A   B  1 92  ? 1.915   39.044  9.321  1.00 20.17  ? 106 A   A N7    1 
ATOM   5394 C  C5    . A   B  1 92  ? 1.496   39.219  10.635 1.00 17.84  ? 106 A   A C5    1 
ATOM   5395 C  C6    . A   B  1 92  ? 1.708   38.486  11.814 1.00 17.91  ? 106 A   A C6    1 
ATOM   5396 N  N6    . A   B  1 92  ? 2.433   37.375  11.873 1.00 17.08  ? 106 A   A N6    1 
ATOM   5397 N  N1    . A   B  1 92  ? 1.140   38.945  12.944 1.00 17.33  ? 106 A   A N1    1 
ATOM   5398 C  C2    . A   B  1 92  ? 0.410   40.052  12.907 1.00 17.93  ? 106 A   A C2    1 
ATOM   5399 N  N3    . A   B  1 92  ? 0.139   40.825  11.860 1.00 19.35  ? 106 A   A N3    1 
ATOM   5400 C  C4    . A   B  1 92  ? 0.709   40.335  10.750 1.00 17.75  ? 106 A   A C4    1 
ATOM   5401 P  P     . G   B  1 93  ? 3.097   45.236  6.958  1.00 25.82  ? 107 G   A P     1 
ATOM   5402 O  OP1   . G   B  1 93  ? 2.986   46.558  6.302  1.00 28.02  ? 107 G   A OP1   1 
ATOM   5403 O  OP2   . G   B  1 93  ? 3.709   44.111  6.216  1.00 25.32  ? 107 G   A OP2   1 
ATOM   5404 O  "O5'" . G   B  1 93  ? 3.794   45.440  8.372  1.00 27.22  ? 107 G   A "O5'" 1 
ATOM   5405 C  "C5'" . G   B  1 93  ? 4.886   44.627  8.741  1.00 23.94  ? 107 G   A "C5'" 1 
ATOM   5406 C  "C4'" . G   B  1 93  ? 4.661   43.997  10.092 1.00 20.89  ? 107 G   A "C4'" 1 
ATOM   5407 O  "O4'" . G   B  1 93  ? 3.756   42.863  9.986  1.00 23.24  ? 107 G   A "O4'" 1 
ATOM   5408 C  "C3'" . G   B  1 93  ? 5.918   43.409  10.701 1.00 18.83  ? 107 G   A "C3'" 1 
ATOM   5409 O  "O3'" . G   B  1 93  ? 6.694   44.412  11.329 1.00 22.15  ? 107 G   A "O3'" 1 
ATOM   5410 C  "C2'" . G   B  1 93  ? 5.353   42.355  11.647 1.00 16.43  ? 107 G   A "C2'" 1 
ATOM   5411 O  "O2'" . G   B  1 93  ? 4.782   42.968  12.793 1.00 18.32  ? 107 G   A "O2'" 1 
ATOM   5412 C  "C1'" . G   B  1 93  ? 4.219   41.791  10.783 1.00 19.66  ? 107 G   A "C1'" 1 
ATOM   5413 N  N9    . G   B  1 93  ? 4.748   40.754  9.871  1.00 19.37  ? 107 G   A N9    1 
ATOM   5414 C  C8    . G   B  1 93  ? 4.864   40.830  8.495  1.00 18.86  ? 107 G   A C8    1 
ATOM   5415 N  N7    . G   B  1 93  ? 5.374   39.749  7.965  1.00 17.88  ? 107 G   A N7    1 
ATOM   5416 C  C5    . G   B  1 93  ? 5.631   38.909  9.038  1.00 20.40  ? 107 G   A C5    1 
ATOM   5417 C  C6    . G   B  1 93  ? 6.206   37.613  9.083  1.00 20.67  ? 107 G   A C6    1 
ATOM   5418 O  O6    . G   B  1 93  ? 6.616   36.914  8.154  1.00 19.12  ? 107 G   A O6    1 
ATOM   5419 N  N1    . G   B  1 93  ? 6.268   37.119  10.378 1.00 18.22  ? 107 G   A N1    1 
ATOM   5420 C  C2    . G   B  1 93  ? 5.868   37.798  11.495 1.00 18.17  ? 107 G   A C2    1 
ATOM   5421 N  N2    . G   B  1 93  ? 6.031   37.151  12.648 1.00 14.66  ? 107 G   A N2    1 
ATOM   5422 N  N3    . G   B  1 93  ? 5.333   39.009  11.476 1.00 18.54  ? 107 G   A N3    1 
ATOM   5423 C  C4    . G   B  1 93  ? 5.248   39.511  10.224 1.00 19.91  ? 107 G   A C4    1 
ATOM   5424 P  P     . G   B  1 94  ? 8.278   44.293  11.475 1.00 23.14  ? 108 G   A P     1 
ATOM   5425 O  OP1   . G   B  1 94  ? 8.679   45.598  12.039 1.00 21.33  ? 108 G   A OP1   1 
ATOM   5426 O  OP2   . G   B  1 94  ? 8.850   43.851  10.173 1.00 21.97  ? 108 G   A OP2   1 
ATOM   5427 O  "O5'" . G   B  1 94  ? 8.479   43.139  12.528 1.00 19.83  ? 108 G   A "O5'" 1 
ATOM   5428 C  "C5'" . G   B  1 94  ? 8.015   43.273  13.860 1.00 20.33  ? 108 G   A "C5'" 1 
ATOM   5429 C  "C4'" . G   B  1 94  ? 8.432   42.080  14.678 1.00 17.64  ? 108 G   A "C4'" 1 
ATOM   5430 O  "O4'" . G   B  1 94  ? 7.728   40.891  14.228 1.00 18.33  ? 108 G   A "O4'" 1 
ATOM   5431 C  "C3'" . G   B  1 94  ? 9.891   41.677  14.581 1.00 17.76  ? 108 G   A "C3'" 1 
ATOM   5432 O  "O3'" . G   B  1 94  ? 10.725  42.492  15.377 1.00 20.17  ? 108 G   A "O3'" 1 
ATOM   5433 C  "C2'" . G   B  1 94  ? 9.840   40.228  15.041 1.00 18.48  ? 108 G   A "C2'" 1 
ATOM   5434 O  "O2'" . G   B  1 94  ? 9.683   40.179  16.451 1.00 18.98  ? 108 G   A "O2'" 1 
ATOM   5435 C  "C1'" . G   B  1 94  ? 8.541   39.755  14.392 1.00 16.58  ? 108 G   A "C1'" 1 
ATOM   5436 N  N9    . G   B  1 94  ? 8.824   39.188  13.067 1.00 16.98  ? 108 G   A N9    1 
ATOM   5437 C  C8    . G   B  1 94  ? 8.570   39.713  11.829 1.00 18.36  ? 108 G   A C8    1 
ATOM   5438 N  N7    . G   B  1 94  ? 8.965   38.937  10.848 1.00 18.93  ? 108 G   A N7    1 
ATOM   5439 C  C5    . G   B  1 94  ? 9.531   37.847  11.490 1.00 18.39  ? 108 G   A C5    1 
ATOM   5440 C  C6    . G   B  1 94  ? 10.141  36.688  10.964 1.00 19.54  ? 108 G   A C6    1 
ATOM   5441 O  O6    . G   B  1 94  ? 10.319  36.395  9.762  1.00 18.78  ? 108 G   A O6    1 
ATOM   5442 N  N1    . G   B  1 94  ? 10.563  35.830  11.986 1.00 17.75  ? 108 G   A N1    1 
ATOM   5443 C  C2    . G   B  1 94  ? 10.423  36.063  13.334 1.00 18.09  ? 108 G   A C2    1 
ATOM   5444 N  N2    . G   B  1 94  ? 10.909  35.133  14.155 1.00 16.11  ? 108 G   A N2    1 
ATOM   5445 N  N3    . G   B  1 94  ? 9.855   37.137  13.834 1.00 16.21  ? 108 G   A N3    1 
ATOM   5446 C  C4    . G   B  1 94  ? 9.441   37.983  12.865 1.00 19.84  ? 108 G   A C4    1 
ATOM   5447 P  P     . U   B  1 95  ? 12.245  42.753  14.922 1.00 23.53  ? 109 U   A P     1 
ATOM   5448 O  OP1   . U   B  1 95  ? 12.688  43.770  15.913 1.00 21.39  ? 109 U   A OP1   1 
ATOM   5449 O  OP2   . U   B  1 95  ? 12.222  43.123  13.474 1.00 19.14  ? 109 U   A OP2   1 
ATOM   5450 O  "O5'" . U   B  1 95  ? 12.941  41.342  15.062 1.00 19.57  ? 109 U   A "O5'" 1 
ATOM   5451 C  "C5'" . U   B  1 95  ? 13.042  40.628  16.283 1.00 19.70  ? 109 U   A "C5'" 1 
ATOM   5452 C  "C4'" . U   B  1 95  ? 13.742  39.313  16.088 1.00 19.87  ? 109 U   A "C4'" 1 
ATOM   5453 O  "O4'" . U   B  1 95  ? 12.875  38.388  15.365 1.00 20.13  ? 109 U   A "O4'" 1 
ATOM   5454 C  "C3'" . U   B  1 95  ? 15.019  39.342  15.256 1.00 21.83  ? 109 U   A "C3'" 1 
ATOM   5455 O  "O3'" . U   B  1 95  ? 16.177  39.829  15.929 1.00 18.24  ? 109 U   A "O3'" 1 
ATOM   5456 C  "C2'" . U   B  1 95  ? 15.120  37.884  14.866 1.00 17.63  ? 109 U   A "C2'" 1 
ATOM   5457 O  "O2'" . U   B  1 95  ? 15.466  37.112  16.002 1.00 20.77  ? 109 U   A "O2'" 1 
ATOM   5458 C  "C1'" . U   B  1 95  ? 13.658  37.557  14.537 1.00 19.34  ? 109 U   A "C1'" 1 
ATOM   5459 N  N1    . U   B  1 95  ? 13.374  37.857  13.112 1.00 18.33  ? 109 U   A N1    1 
ATOM   5460 C  C2    . U   B  1 95  ? 13.755  36.914  12.175 1.00 18.86  ? 109 U   A C2    1 
ATOM   5461 O  O2    . U   B  1 95  ? 14.305  35.892  12.497 1.00 17.88  ? 109 U   A O2    1 
ATOM   5462 N  N3    . U   B  1 95  ? 13.485  37.225  10.866 1.00 19.55  ? 109 U   A N3    1 
ATOM   5463 C  C4    . U   B  1 95  ? 12.879  38.376  10.411 1.00 21.25  ? 109 U   A C4    1 
ATOM   5464 O  O4    . U   B  1 95  ? 12.691  38.536  9.201  1.00 21.22  ? 109 U   A O4    1 
ATOM   5465 C  C5    . U   B  1 95  ? 12.511  39.311  11.438 1.00 21.56  ? 109 U   A C5    1 
ATOM   5466 C  C6    . U   B  1 95  ? 12.769  39.025  12.724 1.00 19.66  ? 109 U   A C6    1 
ATOM   5467 P  P     . G   B  1 96  ? 17.392  40.524  15.120 1.00 18.84  ? 110 G   A P     1 
ATOM   5468 O  OP1   . G   B  1 96  ? 18.210  41.161  16.191 1.00 18.98  ? 110 G   A OP1   1 
ATOM   5469 O  OP2   . G   B  1 96  ? 16.863  41.433  14.094 1.00 19.41  ? 110 G   A OP2   1 
ATOM   5470 O  "O5'" . G   B  1 96  ? 18.150  39.319  14.457 1.00 19.87  ? 110 G   A "O5'" 1 
ATOM   5471 C  "C5'" . G   B  1 96  ? 18.631  38.218  15.219 1.00 18.62  ? 110 G   A "C5'" 1 
ATOM   5472 C  "C4'" . G   B  1 96  ? 19.088  37.107  14.307 1.00 19.34  ? 110 G   A "C4'" 1 
ATOM   5473 O  "O4'" . G   B  1 96  ? 17.948  36.597  13.560 1.00 20.55  ? 110 G   A "O4'" 1 
ATOM   5474 C  "C3'" . G   B  1 96  ? 20.087  37.492  13.223 1.00 20.76  ? 110 G   A "C3'" 1 
ATOM   5475 O  "O3'" . G   B  1 96  ? 21.416  37.546  13.699 1.00 18.40  ? 110 G   A "O3'" 1 
ATOM   5476 C  "C2'" . G   B  1 96  ? 19.886  36.386  12.200 1.00 20.86  ? 110 G   A "C2'" 1 
ATOM   5477 O  "O2'" . G   B  1 96  ? 20.465  35.185  12.681 1.00 19.88  ? 110 G   A "O2'" 1 
ATOM   5478 C  "C1'" . G   B  1 96  ? 18.370  36.213  12.264 1.00 19.81  ? 110 G   A "C1'" 1 
ATOM   5479 N  N9    . G   B  1 96  ? 17.667  37.028  11.253 1.00 20.05  ? 110 G   A N9    1 
ATOM   5480 C  C8    . G   B  1 96  ? 16.945  38.185  11.439 1.00 18.12  ? 110 G   A C8    1 
ATOM   5481 N  N7    . G   B  1 96  ? 16.428  38.641  10.323 1.00 20.45  ? 110 G   A N7    1 
ATOM   5482 C  C5    . G   B  1 96  ? 16.812  37.743  9.350  1.00 20.93  ? 110 G   A C5    1 
ATOM   5483 C  C6    . G   B  1 96  ? 16.549  37.713  7.949  1.00 21.55  ? 110 G   A C6    1 
ATOM   5484 O  O6    . G   B  1 96  ? 15.877  38.501  7.278  1.00 18.27  ? 110 G   A O6    1 
ATOM   5485 N  N1    . G   B  1 96  ? 17.146  36.626  7.330  1.00 19.35  ? 110 G   A N1    1 
ATOM   5486 C  C2    . G   B  1 96  ? 17.891  35.675  7.990  1.00 22.70  ? 110 G   A C2    1 
ATOM   5487 N  N2    . G   B  1 96  ? 18.394  34.675  7.253  1.00 22.04  ? 110 G   A N2    1 
ATOM   5488 N  N3    . G   B  1 96  ? 18.136  35.687  9.289  1.00 21.24  ? 110 G   A N3    1 
ATOM   5489 C  C4    . G   B  1 96  ? 17.581  36.743  9.906  1.00 18.88  ? 110 G   A C4    1 
ATOM   5490 P  P     . A   B  1 97  ? 22.528  38.395  12.941 1.00 20.03  ? 111 A   A P     1 
ATOM   5491 O  OP1   . A   B  1 97  ? 23.684  38.244  13.830 1.00 18.32  ? 111 A   A OP1   1 
ATOM   5492 O  OP2   . A   B  1 97  ? 21.996  39.727  12.589 1.00 20.46  ? 111 A   A OP2   1 
ATOM   5493 O  "O5'" . A   B  1 97  ? 22.761  37.572  11.585 1.00 20.00  ? 111 A   A "O5'" 1 
ATOM   5494 C  "C5'" . A   B  1 97  ? 23.390  36.305  11.580 1.00 20.49  ? 111 A   A "C5'" 1 
ATOM   5495 C  "C4'" . A   B  1 97  ? 23.585  35.817  10.165 1.00 21.85  ? 111 A   A "C4'" 1 
ATOM   5496 O  "O4'" . A   B  1 97  ? 22.300  35.567  9.558  1.00 20.96  ? 111 A   A "O4'" 1 
ATOM   5497 C  "C3'" . A   B  1 97  ? 24.240  36.824  9.235  1.00 21.74  ? 111 A   A "C3'" 1 
ATOM   5498 O  "O3'" . A   B  1 97  ? 25.645  36.808  9.377  1.00 22.97  ? 111 A   A "O3'" 1 
ATOM   5499 C  "C2'" . A   B  1 97  ? 23.759  36.373  7.862  1.00 23.40  ? 111 A   A "C2'" 1 
ATOM   5500 O  "O2'" . A   B  1 97  ? 24.421  35.186  7.466  1.00 21.42  ? 111 A   A "O2'" 1 
ATOM   5501 C  "C1'" . A   B  1 97  ? 22.335  35.956  8.201  1.00 21.98  ? 111 A   A "C1'" 1 
ATOM   5502 N  N9    . A   B  1 97  ? 21.373  37.040  7.990  1.00 20.66  ? 111 A   A N9    1 
ATOM   5503 C  C8    . A   B  1 97  ? 20.900  37.954  8.898  1.00 19.43  ? 111 A   A C8    1 
ATOM   5504 N  N7    . A   B  1 97  ? 20.038  38.792  8.386  1.00 18.30  ? 111 A   A N7    1 
ATOM   5505 C  C5    . A   B  1 97  ? 19.938  38.401  7.056  1.00 20.52  ? 111 A   A C5    1 
ATOM   5506 C  C6    . A   B  1 97  ? 19.173  38.895  5.984  1.00 20.49  ? 111 A   A C6    1 
ATOM   5507 N  N6    . A   B  1 97  ? 18.329  39.914  6.105  1.00 18.48  ? 111 A   A N6    1 
ATOM   5508 N  N1    . A   B  1 97  ? 19.306  38.278  4.789  1.00 22.19  ? 111 A   A N1    1 
ATOM   5509 C  C2    . A   B  1 97  ? 20.158  37.244  4.687  1.00 22.32  ? 111 A   A C2    1 
ATOM   5510 N  N3    . A   B  1 97  ? 20.937  36.687  5.627  1.00 23.10  ? 111 A   A N3    1 
ATOM   5511 C  C4    . A   B  1 97  ? 20.766  37.325  6.797  1.00 21.42  ? 111 A   A C4    1 
ATOM   5512 P  P     . U   B  1 98  ? 26.451  38.179  9.272  1.00 24.94  ? 112 U   A P     1 
ATOM   5513 O  OP1   . U   B  1 98  ? 27.825  37.709  9.599  1.00 27.78  ? 112 U   A OP1   1 
ATOM   5514 O  OP2   . U   B  1 98  ? 25.817  39.331  9.965  1.00 23.45  ? 112 U   A OP2   1 
ATOM   5515 O  "O5'" . U   B  1 98  ? 26.377  38.481  7.714  1.00 24.09  ? 112 U   A "O5'" 1 
ATOM   5516 C  "C5'" . U   B  1 98  ? 27.025  37.577  6.831  1.00 26.13  ? 112 U   A "C5'" 1 
ATOM   5517 C  "C4'" . U   B  1 98  ? 26.602  37.807  5.401  1.00 25.81  ? 112 U   A "C4'" 1 
ATOM   5518 O  "O4'" . U   B  1 98  ? 25.191  37.503  5.227  1.00 25.96  ? 112 U   A "O4'" 1 
ATOM   5519 C  "C3'" . U   B  1 98  ? 26.730  39.230  4.899  1.00 25.79  ? 112 U   A "C3'" 1 
ATOM   5520 O  "O3'" . U   B  1 98  ? 28.065  39.580  4.558  1.00 29.14  ? 112 U   A "O3'" 1 
ATOM   5521 C  "C2'" . U   B  1 98  ? 25.779  39.217  3.715  1.00 28.35  ? 112 U   A "C2'" 1 
ATOM   5522 O  "O2'" . U   B  1 98  ? 26.374  38.491  2.649  1.00 26.41  ? 112 U   A "O2'" 1 
ATOM   5523 C  "C1'" . U   B  1 98  ? 24.624  38.388  4.283  1.00 23.79  ? 112 U   A "C1'" 1 
ATOM   5524 N  N1    . U   B  1 98  ? 23.624  39.274  4.928  1.00 23.83  ? 112 U   A N1    1 
ATOM   5525 C  C2    . U   B  1 98  ? 22.661  39.833  4.108  1.00 24.08  ? 112 U   A C2    1 
ATOM   5526 O  O2    . U   B  1 98  ? 22.581  39.618  2.905  1.00 25.10  ? 112 U   A O2    1 
ATOM   5527 N  N3    . U   B  1 98  ? 21.775  40.661  4.748  1.00 21.05  ? 112 U   A N3    1 
ATOM   5528 C  C4    . U   B  1 98  ? 21.736  40.979  6.091  1.00 22.33  ? 112 U   A C4    1 
ATOM   5529 O  O4    . U   B  1 98  ? 20.851  41.746  6.479  1.00 19.61  ? 112 U   A O4    1 
ATOM   5530 C  C5    . U   B  1 98  ? 22.764  40.366  6.884  1.00 20.73  ? 112 U   A C5    1 
ATOM   5531 C  C6    . U   B  1 98  ? 23.651  39.558  6.286  1.00 21.27  ? 112 U   A C6    1 
ATOM   5532 P  P     . U   B  1 99  ? 28.507  41.115  4.704  1.00 30.89  ? 113 U   A P     1 
ATOM   5533 O  OP1   . U   B  1 99  ? 29.945  41.175  4.353  1.00 36.99  ? 113 U   A OP1   1 
ATOM   5534 O  OP2   . U   B  1 99  ? 28.048  41.632  6.020  1.00 34.36  ? 113 U   A OP2   1 
ATOM   5535 O  "O5'" . U   B  1 99  ? 27.655  41.862  3.595  1.00 30.36  ? 113 U   A "O5'" 1 
ATOM   5536 C  "C5'" . U   B  1 99  ? 27.838  41.531  2.231  1.00 33.34  ? 113 U   A "C5'" 1 
ATOM   5537 C  "C4'" . U   B  1 99  ? 26.917  42.341  1.358  1.00 30.80  ? 113 U   A "C4'" 1 
ATOM   5538 O  "O4'" . U   B  1 99  ? 25.529  41.984  1.594  1.00 25.45  ? 113 U   A "O4'" 1 
ATOM   5539 C  "C3'" . U   B  1 99  ? 26.943  43.843  1.573  1.00 30.01  ? 113 U   A "C3'" 1 
ATOM   5540 O  "O3'" . U   B  1 99  ? 28.094  44.445  1.005  1.00 33.18  ? 113 U   A "O3'" 1 
ATOM   5541 C  "C2'" . U   B  1 99  ? 25.628  44.261  0.928  1.00 26.36  ? 113 U   A "C2'" 1 
ATOM   5542 O  "O2'" . U   B  1 99  ? 25.748  44.244  -0.486 1.00 27.36  ? 113 U   A "O2'" 1 
ATOM   5543 C  "C1'" . U   B  1 99  ? 24.710  43.107  1.342  1.00 27.92  ? 113 U   A "C1'" 1 
ATOM   5544 N  N1    . U   B  1 99  ? 23.952  43.488  2.555  1.00 26.44  ? 113 U   A N1    1 
ATOM   5545 C  C2    . U   B  1 99  ? 22.767  44.163  2.361  1.00 27.46  ? 113 U   A C2    1 
ATOM   5546 O  O2    . U   B  1 99  ? 22.339  44.429  1.249  1.00 25.06  ? 113 U   A O2    1 
ATOM   5547 N  N3    . U   B  1 99  ? 22.096  44.513  3.505  1.00 25.57  ? 113 U   A N3    1 
ATOM   5548 C  C4    . U   B  1 99  ? 22.506  44.262  4.794  1.00 24.23  ? 113 U   A C4    1 
ATOM   5549 O  O4    . U   B  1 99  ? 21.810  44.647  5.725  1.00 25.55  ? 113 U   A O4    1 
ATOM   5550 C  C5    . U   B  1 99  ? 23.741  43.558  4.911  1.00 25.68  ? 113 U   A C5    1 
ATOM   5551 C  C6    . U   B  1 99  ? 24.417  43.201  3.811  1.00 27.50  ? 113 U   A C6    1 
ATOM   5552 P  P     . U   B  1 100 ? 28.592  45.891  1.491  1.00 36.80  ? 114 U   A P     1 
ATOM   5553 O  OP1   . U   B  1 100 ? 29.838  46.159  0.735  1.00 40.62  ? 114 U   A OP1   1 
ATOM   5554 O  OP2   . U   B  1 100 ? 28.609  45.977  2.971  1.00 35.91  ? 114 U   A OP2   1 
ATOM   5555 O  "O5'" . U   B  1 100 ? 27.398  46.759  0.918  1.00 34.81  ? 114 U   A "O5'" 1 
ATOM   5556 C  "C5'" . U   B  1 100 ? 26.963  47.937  1.567  1.00 29.96  ? 114 U   A "C5'" 1 
ATOM   5557 C  "C4'" . U   B  1 100 ? 25.706  48.439  0.912  1.00 32.07  ? 114 U   A "C4'" 1 
ATOM   5558 O  "O4'" . U   B  1 100 ? 24.598  47.558  1.228  1.00 29.22  ? 114 U   A "O4'" 1 
ATOM   5559 C  "C3'" . U   B  1 100 ? 25.236  49.809  1.362  1.00 30.29  ? 114 U   A "C3'" 1 
ATOM   5560 O  "O3'" . U   B  1 100 ? 25.911  50.833  0.667  1.00 31.81  ? 114 U   A "O3'" 1 
ATOM   5561 C  "C2'" . U   B  1 100 ? 23.751  49.762  1.051  1.00 29.99  ? 114 U   A "C2'" 1 
ATOM   5562 O  "O2'" . U   B  1 100 ? 23.541  49.959  -0.338 1.00 32.36  ? 114 U   A "O2'" 1 
ATOM   5563 C  "C1'" . U   B  1 100 ? 23.414  48.310  1.382  1.00 28.58  ? 114 U   A "C1'" 1 
ATOM   5564 N  N1    . U   B  1 100 ? 23.009  48.199  2.790  1.00 29.61  ? 114 U   A N1    1 
ATOM   5565 C  C2    . U   B  1 100 ? 21.747  48.645  3.123  1.00 29.41  ? 114 U   A C2    1 
ATOM   5566 O  O2    . U   B  1 100 ? 20.976  49.109  2.293  1.00 29.03  ? 114 U   A O2    1 
ATOM   5567 N  N3    . U   B  1 100 ? 21.439  48.526  4.458  1.00 25.82  ? 114 U   A N3    1 
ATOM   5568 C  C4    . U   B  1 100 ? 22.255  48.020  5.460  1.00 29.23  ? 114 U   A C4    1 
ATOM   5569 O  O4    . U   B  1 100 ? 21.843  47.980  6.628  1.00 26.04  ? 114 U   A O4    1 
ATOM   5570 C  C5    . U   B  1 100 ? 23.547  47.579  5.023  1.00 28.32  ? 114 U   A C5    1 
ATOM   5571 C  C6    . U   B  1 100 ? 23.873  47.687  3.731  1.00 29.16  ? 114 U   A C6    1 
ATOM   5572 P  P     . U   B  1 101 ? 26.404  52.152  1.427  1.00 32.33  ? 115 U   A P     1 
ATOM   5573 O  OP1   . U   B  1 101 ? 27.214  52.871  0.422  1.00 34.09  ? 115 U   A OP1   1 
ATOM   5574 O  OP2   . U   B  1 101 ? 27.002  51.739  2.716  1.00 30.41  ? 115 U   A OP2   1 
ATOM   5575 O  "O5'" . U   B  1 101 ? 25.069  52.964  1.678  1.00 28.65  ? 115 U   A "O5'" 1 
ATOM   5576 C  "C5'" . U   B  1 101 ? 24.219  53.228  0.579  1.00 33.33  ? 115 U   A "C5'" 1 
ATOM   5577 C  "C4'" . U   B  1 101 ? 22.839  53.581  1.052  1.00 32.73  ? 115 U   A "C4'" 1 
ATOM   5578 O  "O4'" . U   B  1 101 ? 22.241  52.451  1.743  1.00 31.64  ? 115 U   A "O4'" 1 
ATOM   5579 C  "C3'" . U   B  1 101 ? 22.775  54.704  2.079  1.00 35.16  ? 115 U   A "C3'" 1 
ATOM   5580 O  "O3'" . U   B  1 101 ? 22.918  55.995  1.502  1.00 38.75  ? 115 U   A "O3'" 1 
ATOM   5581 C  "C2'" . U   B  1 101 ? 21.412  54.450  2.707  1.00 30.73  ? 115 U   A "C2'" 1 
ATOM   5582 O  "O2'" . U   B  1 101 ? 20.391  54.833  1.802  1.00 30.98  ? 115 U   A "O2'" 1 
ATOM   5583 C  "C1'" . U   B  1 101 ? 21.398  52.920  2.778  1.00 29.27  ? 115 U   A "C1'" 1 
ATOM   5584 N  N1    . U   B  1 101 ? 21.843  52.373  4.088  1.00 26.36  ? 115 U   A N1    1 
ATOM   5585 C  C2    . U   B  1 101 ? 20.996  52.495  5.170  1.00 26.63  ? 115 U   A C2    1 
ATOM   5586 O  O2    . U   B  1 101 ? 19.908  53.044  5.105  1.00 25.35  ? 115 U   A O2    1 
ATOM   5587 N  N3    . U   B  1 101 ? 21.472  51.965  6.347  1.00 23.61  ? 115 U   A N3    1 
ATOM   5588 C  C4    . U   B  1 101 ? 22.663  51.321  6.548  1.00 25.32  ? 115 U   A C4    1 
ATOM   5589 O  O4    . U   B  1 101 ? 22.938  50.898  7.671  1.00 29.12  ? 115 U   A O4    1 
ATOM   5590 C  C5    . U   B  1 101 ? 23.489  51.226  5.386  1.00 28.60  ? 115 U   A C5    1 
ATOM   5591 C  C6    . U   B  1 101 ? 23.054  51.744  4.230  1.00 28.58  ? 115 U   A C6    1 
ATOM   5592 P  P     . U   B  1 102 ? 23.555  57.222  2.335  1.00 41.04  ? 116 U   A P     1 
ATOM   5593 O  OP1   . U   B  1 102 ? 24.141  58.093  1.286  1.00 43.63  ? 116 U   A OP1   1 
ATOM   5594 O  OP2   . U   B  1 102 ? 24.428  56.753  3.431  1.00 32.15  ? 116 U   A OP2   1 
ATOM   5595 O  "O5'" . U   B  1 102 ? 22.243  57.864  2.977  1.00 36.21  ? 116 U   A "O5'" 1 
ATOM   5596 C  "C5'" . U   B  1 102 ? 21.045  58.081  2.247  1.00 34.40  ? 116 U   A "C5'" 1 
ATOM   5597 C  "C4'" . U   B  1 102 ? 19.902  58.424  3.167  1.00 33.56  ? 116 U   A "C4'" 1 
ATOM   5598 O  "O4'" . U   B  1 102 ? 19.451  57.237  3.873  1.00 34.67  ? 116 U   A "O4'" 1 
ATOM   5599 C  "C3'" . U   B  1 102 ? 20.234  59.385  4.295  1.00 32.98  ? 116 U   A "C3'" 1 
ATOM   5600 O  "O3'" . U   B  1 102 ? 20.287  60.737  3.894  1.00 36.36  ? 116 U   A "O3'" 1 
ATOM   5601 C  "C2'" . U   B  1 102 ? 19.136  59.105  5.307  1.00 30.90  ? 116 U   A "C2'" 1 
ATOM   5602 O  "O2'" . U   B  1 102 ? 17.914  59.686  4.892  1.00 33.92  ? 116 U   A "O2'" 1 
ATOM   5603 C  "C1'" . U   B  1 102 ? 19.005  57.594  5.168  1.00 31.66  ? 116 U   A "C1'" 1 
ATOM   5604 N  N1    . U   B  1 102 ? 19.781  56.905  6.213  1.00 31.66  ? 116 U   A N1    1 
ATOM   5605 C  C2    . U   B  1 102 ? 19.201  56.853  7.462  1.00 28.32  ? 116 U   A C2    1 
ATOM   5606 O  O2    . U   B  1 102 ? 18.118  57.353  7.681  1.00 29.58  ? 116 U   A O2    1 
ATOM   5607 N  N3    . U   B  1 102 ? 19.926  56.199  8.425  1.00 27.91  ? 116 U   A N3    1 
ATOM   5608 C  C4    . U   B  1 102 ? 21.157  55.606  8.243  1.00 28.48  ? 116 U   A C4    1 
ATOM   5609 O  O4    . U   B  1 102 ? 21.705  55.045  9.197  1.00 28.21  ? 116 U   A O4    1 
ATOM   5610 C  C5    . U   B  1 102 ? 21.694  55.713  6.917  1.00 27.27  ? 116 U   A C5    1 
ATOM   5611 C  C6    . U   B  1 102 ? 21.003  56.343  5.966  1.00 29.12  ? 116 U   A C6    1 
ATOM   5612 P  P     . A   B  1 103 ? 20.934  61.778  4.924  1.00 33.61  ? 117 A   A P     1 
ATOM   5613 O  OP1   . A   B  1 103 ? 21.174  62.945  4.046  1.00 35.70  ? 117 A   A OP1   1 
ATOM   5614 O  OP2   . A   B  1 103 ? 22.048  61.203  5.710  1.00 31.70  ? 117 A   A OP2   1 
ATOM   5615 O  "O5'" . A   B  1 103 ? 19.727  62.021  5.940  1.00 36.03  ? 117 A   A "O5'" 1 
ATOM   5616 C  "C5'" . A   B  1 103 ? 18.600  62.824  5.635  1.00 30.52  ? 117 A   A "C5'" 1 
ATOM   5617 C  "C4'" . A   B  1 103 ? 17.901  63.243  6.904  1.00 28.85  ? 117 A   A "C4'" 1 
ATOM   5618 O  "O4'" . A   B  1 103 ? 17.403  62.067  7.605  1.00 30.03  ? 117 A   A "O4'" 1 
ATOM   5619 C  "C3'" . A   B  1 103 ? 18.760  63.945  7.947  1.00 28.50  ? 117 A   A "C3'" 1 
ATOM   5620 O  "O3'" . A   B  1 103 ? 19.011  65.308  7.636  1.00 30.38  ? 117 A   A "O3'" 1 
ATOM   5621 C  "C2'" . A   B  1 103 ? 17.929  63.730  9.208  1.00 29.20  ? 117 A   A "C2'" 1 
ATOM   5622 O  "O2'" . A   B  1 103 ? 16.771  64.548  9.181  1.00 29.01  ? 117 A   A "O2'" 1 
ATOM   5623 C  "C1'" . A   B  1 103 ? 17.464  62.288  8.998  1.00 29.33  ? 117 A   A "C1'" 1 
ATOM   5624 N  N9    . A   B  1 103 ? 18.435  61.355  9.590  1.00 27.35  ? 117 A   A N9    1 
ATOM   5625 C  C8    . A   B  1 103 ? 19.472  60.699  8.980  1.00 29.00  ? 117 A   A C8    1 
ATOM   5626 N  N7    . A   B  1 103 ? 20.163  59.941  9.802  1.00 28.92  ? 117 A   A N7    1 
ATOM   5627 C  C5    . A   B  1 103 ? 19.552  60.119  11.033 1.00 26.99  ? 117 A   A C5    1 
ATOM   5628 C  C6    . A   B  1 103 ? 19.808  59.597  12.310 1.00 25.80  ? 117 A   A C6    1 
ATOM   5629 N  N6    . A   B  1 103 ? 20.803  58.747  12.585 1.00 25.01  ? 117 A   A N6    1 
ATOM   5630 N  N1    . A   B  1 103 ? 19.003  59.996  13.314 1.00 24.65  ? 117 A   A N1    1 
ATOM   5631 C  C2    . A   B  1 103 ? 18.003  60.837  13.051 1.00 25.20  ? 117 A   A C2    1 
ATOM   5632 N  N3    . A   B  1 103 ? 17.663  61.392  11.894 1.00 28.13  ? 117 A   A N3    1 
ATOM   5633 C  C4    . A   B  1 103 ? 18.484  60.989  10.915 1.00 27.79  ? 117 A   A C4    1 
ATOM   5634 P  P     . A   B  1 104 ? 20.496  65.926  7.669  1.00 36.19  ? 118 A   A P     1 
ATOM   5635 O  OP1   . A   B  1 104 ? 21.236  65.279  6.567  1.00 40.61  ? 118 A   A OP1   1 
ATOM   5636 O  OP2   . A   B  1 104 ? 21.035  65.815  9.047  1.00 30.76  ? 118 A   A OP2   1 
ATOM   5637 O  "O5'" . A   B  1 104 ? 20.194  67.466  7.342  1.00 40.24  ? 118 A   A "O5'" 1 
ATOM   5638 C  "C5'" . A   B  1 104 ? 19.573  67.935  6.148  1.00 43.85  ? 118 A   A "C5'" 1 
ATOM   5639 C  "C4'" . A   B  1 104 ? 19.978  69.364  5.861  1.00 44.44  ? 118 A   A "C4'" 1 
ATOM   5640 O  "O4'" . A   B  1 104 ? 19.542  70.213  6.957  1.00 44.13  ? 118 A   A "O4'" 1 
ATOM   5641 C  "C3'" . A   B  1 104 ? 21.483  69.575  5.807  1.00 45.59  ? 118 A   A "C3'" 1 
ATOM   5642 O  "O3'" . A   B  1 104 ? 22.052  69.323  4.537  1.00 53.13  ? 118 A   A "O3'" 1 
ATOM   5643 C  "C2'" . A   B  1 104 ? 21.667  71.004  6.296  1.00 51.63  ? 118 A   A "C2'" 1 
ATOM   5644 O  "O2'" . A   B  1 104 ? 21.300  71.931  5.284  1.00 49.67  ? 118 A   A "O2'" 1 
ATOM   5645 C  "C1'" . A   B  1 104 ? 20.605  71.039  7.387  1.00 43.64  ? 118 A   A "C1'" 1 
ATOM   5646 N  N9    . A   B  1 104 ? 21.106  70.417  8.623  1.00 45.03  ? 118 A   A N9    1 
ATOM   5647 C  C8    . A   B  1 104 ? 21.983  69.366  8.819  1.00 42.94  ? 118 A   A C8    1 
ATOM   5648 N  N7    . A   B  1 104 ? 22.177  69.061  10.084 1.00 39.77  ? 118 A   A N7    1 
ATOM   5649 C  C5    . A   B  1 104 ? 21.361  69.970  10.754 1.00 40.21  ? 118 A   A C5    1 
ATOM   5650 C  C6    . A   B  1 104 ? 21.091  70.203  12.111 1.00 36.65  ? 118 A   A C6    1 
ATOM   5651 N  N6    . A   B  1 104 ? 21.612  69.531  13.137 1.00 35.79  ? 118 A   A N6    1 
ATOM   5652 N  N1    . A   B  1 104 ? 20.231  71.197  12.391 1.00 39.63  ? 118 A   A N1    1 
ATOM   5653 C  C2    . A   B  1 104 ? 19.681  71.901  11.396 1.00 38.34  ? 118 A   A C2    1 
ATOM   5654 N  N3    . A   B  1 104 ? 19.843  71.791  10.091 1.00 37.91  ? 118 A   A N3    1 
ATOM   5655 C  C4    . A   B  1 104 ? 20.705  70.798  9.857  1.00 40.50  ? 118 A   A C4    1 
ATOM   5656 P  P     . U   B  1 105 ? 23.422  68.489  4.510  1.00 59.96  ? 119 U   A P     1 
ATOM   5657 O  OP1   . U   B  1 105 ? 24.262  69.057  3.419  1.00 64.20  ? 119 U   A OP1   1 
ATOM   5658 O  OP2   . U   B  1 105 ? 22.981  67.079  4.447  1.00 56.21  ? 119 U   A OP2   1 
ATOM   5659 O  "O5'" . U   B  1 105 ? 24.067  68.792  5.940  1.00 56.30  ? 119 U   A "O5'" 1 
ATOM   5660 C  "C5'" . U   B  1 105 ? 25.052  67.928  6.498  1.00 62.06  ? 119 U   A "C5'" 1 
ATOM   5661 C  "C4'" . U   B  1 105 ? 26.371  68.637  6.695  1.00 69.00  ? 119 U   A "C4'" 1 
ATOM   5662 O  "O4'" . U   B  1 105 ? 27.425  67.840  6.086  1.00 73.03  ? 119 U   A "O4'" 1 
ATOM   5663 C  "C3'" . U   B  1 105 ? 26.472  70.028  6.064  1.00 73.86  ? 119 U   A "C3'" 1 
ATOM   5664 O  "O3'" . U   B  1 105 ? 27.329  70.852  6.858  1.00 70.88  ? 119 U   A "O3'" 1 
ATOM   5665 C  "C2'" . U   B  1 105 ? 27.143  69.736  4.725  1.00 75.33  ? 119 U   A "C2'" 1 
ATOM   5666 O  "O2'" . U   B  1 105 ? 27.828  70.827  4.149  1.00 75.64  ? 119 U   A "O2'" 1 
ATOM   5667 C  "C1'" . U   B  1 105 ? 28.101  68.613  5.110  1.00 77.26  ? 119 U   A "C1'" 1 
ATOM   5668 N  N1    . U   B  1 105 ? 28.470  67.782  3.939  1.00 84.34  ? 119 U   A N1    1 
ATOM   5669 C  C2    . U   B  1 105 ? 27.539  66.884  3.432  1.00 80.84  ? 119 U   A C2    1 
ATOM   5670 O  O2    . U   B  1 105 ? 26.421  66.731  3.906  1.00 73.21  ? 119 U   A O2    1 
ATOM   5671 N  N3    . U   B  1 105 ? 27.975  66.160  2.342  1.00 86.75  ? 119 U   A N3    1 
ATOM   5672 C  C4    . U   B  1 105 ? 29.211  66.242  1.721  1.00 91.95  ? 119 U   A C4    1 
ATOM   5673 O  O4    . U   B  1 105 ? 29.454  65.522  0.747  1.00 93.61  ? 119 U   A O4    1 
ATOM   5674 C  C5    . U   B  1 105 ? 30.110  67.195  2.303  1.00 89.46  ? 119 U   A C5    1 
ATOM   5675 C  C6    . U   B  1 105 ? 29.717  67.913  3.363  1.00 86.24  ? 119 U   A C6    1 
ATOM   5676 P  P     . G   B  1 106 ? 27.175  72.457  6.916  1.00 74.47  ? 120 G   A P     1 
ATOM   5677 O  OP1   . G   B  1 106 ? 28.012  72.967  5.801  1.00 78.82  ? 120 G   A OP1   1 
ATOM   5678 O  OP2   . G   B  1 106 ? 27.559  72.791  8.312  1.00 69.71  ? 120 G   A OP2   1 
ATOM   5679 O  "O5'" . G   B  1 106 ? 25.640  72.814  6.634  1.00 65.65  ? 120 G   A "O5'" 1 
ATOM   5680 C  "C5'" . G   B  1 106 ? 25.239  73.746  5.626  1.00 63.68  ? 120 G   A "C5'" 1 
ATOM   5681 C  "C4'" . G   B  1 106 ? 24.550  74.964  6.203  1.00 58.78  ? 120 G   A "C4'" 1 
ATOM   5682 O  "O4'" . G   B  1 106 ? 23.493  74.499  7.100  1.00 57.67  ? 120 G   A "O4'" 1 
ATOM   5683 C  "C3'" . G   B  1 106 ? 25.475  75.877  7.024  1.00 63.27  ? 120 G   A "C3'" 1 
ATOM   5684 O  "O3'" . G   B  1 106 ? 25.155  77.276  6.960  1.00 63.56  ? 120 G   A "O3'" 1 
ATOM   5685 C  "C2'" . G   B  1 106 ? 25.201  75.396  8.434  1.00 61.15  ? 120 G   A "C2'" 1 
ATOM   5686 O  "O2'" . G   B  1 106 ? 25.499  76.323  9.458  1.00 58.28  ? 120 G   A "O2'" 1 
ATOM   5687 C  "C1'" . G   B  1 106 ? 23.715  75.036  8.389  1.00 57.14  ? 120 G   A "C1'" 1 
ATOM   5688 N  N9    . G   B  1 106 ? 23.499  74.071  9.463  1.00 51.77  ? 120 G   A N9    1 
ATOM   5689 C  C8    . G   B  1 106 ? 24.055  72.819  9.591  1.00 49.34  ? 120 G   A C8    1 
ATOM   5690 N  N7    . G   B  1 106 ? 23.763  72.252  10.728 1.00 45.97  ? 120 G   A N7    1 
ATOM   5691 C  C5    . G   B  1 106 ? 23.013  73.217  11.392 1.00 43.13  ? 120 G   A C5    1 
ATOM   5692 C  C6    . G   B  1 106 ? 22.421  73.189  12.665 1.00 38.57  ? 120 G   A C6    1 
ATOM   5693 O  O6    . G   B  1 106 ? 22.449  72.267  13.486 1.00 43.60  ? 120 G   A O6    1 
ATOM   5694 N  N1    . G   B  1 106 ? 21.749  74.371  12.950 1.00 41.94  ? 120 G   A N1    1 
ATOM   5695 C  C2    . G   B  1 106 ? 21.659  75.459  12.127 1.00 42.13  ? 120 G   A C2    1 
ATOM   5696 N  N2    . G   B  1 106 ? 20.966  76.509  12.596 1.00 40.85  ? 120 G   A N2    1 
ATOM   5697 N  N3    . G   B  1 106 ? 22.212  75.499  10.931 1.00 45.88  ? 120 G   A N3    1 
ATOM   5698 C  C4    . G   B  1 106 ? 22.860  74.352  10.640 1.00 44.69  ? 120 G   A C4    1 
ATOM   5699 P  P     . C   B  1 107 ? 26.138  78.332  7.724  1.00 61.17  ? 121 C   A P     1 
ATOM   5700 O  OP1   . C   B  1 107 ? 26.400  79.440  6.771  1.00 57.81  ? 121 C   A OP1   1 
ATOM   5701 O  OP2   . C   B  1 107 ? 27.296  77.542  8.206  1.00 51.50  ? 121 C   A OP2   1 
ATOM   5702 O  "O5'" . C   B  1 107 ? 25.299  78.883  8.972  1.00 54.03  ? 121 C   A "O5'" 1 
ATOM   5703 C  "C5'" . C   B  1 107 ? 24.609  80.123  8.883  1.00 54.49  ? 121 C   A "C5'" 1 
ATOM   5704 C  "C4'" . C   B  1 107 ? 24.170  80.651  10.229 1.00 50.83  ? 121 C   A "C4'" 1 
ATOM   5705 O  "O4'" . C   B  1 107 ? 23.246  79.720  10.851 1.00 49.42  ? 121 C   A "O4'" 1 
ATOM   5706 C  "C3'" . C   B  1 107 ? 25.261  80.825  11.274 1.00 50.61  ? 121 C   A "C3'" 1 
ATOM   5707 O  "O3'" . C   B  1 107 ? 26.022  82.008  11.105 1.00 53.41  ? 121 C   A "O3'" 1 
ATOM   5708 C  "C2'" . C   B  1 107 ? 24.475  80.768  12.581 1.00 47.62  ? 121 C   A "C2'" 1 
ATOM   5709 O  "O2'" . C   B  1 107 ? 23.751  81.969  12.817 1.00 45.05  ? 121 C   A "O2'" 1 
ATOM   5710 C  "C1'" . C   B  1 107 ? 23.461  79.683  12.246 1.00 45.06  ? 121 C   A "C1'" 1 
ATOM   5711 N  N1    . C   B  1 107 ? 23.987  78.357  12.636 1.00 47.78  ? 121 C   A N1    1 
ATOM   5712 C  C2    . C   B  1 107 ? 23.781  77.953  13.956 1.00 41.14  ? 121 C   A C2    1 
ATOM   5713 O  O2    . C   B  1 107 ? 23.183  78.732  14.714 1.00 41.92  ? 121 C   A O2    1 
ATOM   5714 N  N3    . C   B  1 107 ? 24.246  76.751  14.363 1.00 40.10  ? 121 C   A N3    1 
ATOM   5715 C  C4    . C   B  1 107 ? 24.888  75.960  13.495 1.00 40.53  ? 121 C   A C4    1 
ATOM   5716 N  N4    . C   B  1 107 ? 25.323  74.782  13.933 1.00 37.24  ? 121 C   A N4    1 
ATOM   5717 C  C5    . C   B  1 107 ? 25.111  76.342  12.141 1.00 40.75  ? 121 C   A C5    1 
ATOM   5718 C  C6    . C   B  1 107 ? 24.648  77.540  11.756 1.00 44.87  ? 121 C   A C6    1 
ATOM   5719 P  P     . A   B  1 108 ? 27.594  82.008  11.453 1.00 54.65  ? 122 A   A P     1 
ATOM   5720 O  OP1   . A   B  1 108 ? 28.047  83.374  11.064 1.00 45.79  ? 122 A   A OP1   1 
ATOM   5721 O  OP2   . A   B  1 108 ? 28.208  80.804  10.832 1.00 49.90  ? 122 A   A OP2   1 
ATOM   5722 O  "O5'" . A   B  1 108 ? 27.566  81.873  13.040 1.00 46.60  ? 122 A   A "O5'" 1 
ATOM   5723 C  "C5'" . A   B  1 108 ? 26.752  82.799  13.741 1.00 44.41  ? 122 A   A "C5'" 1 
ATOM   5724 C  "C4'" . A   B  1 108 ? 26.678  82.483  15.210 1.00 41.53  ? 122 A   A "C4'" 1 
ATOM   5725 O  "O4'" . A   B  1 108 ? 25.760  81.385  15.461 1.00 41.34  ? 122 A   A "O4'" 1 
ATOM   5726 C  "C3'" . A   B  1 108 ? 27.969  82.020  15.856 1.00 39.31  ? 122 A   A "C3'" 1 
ATOM   5727 O  "O3'" . A   B  1 108 ? 28.886  83.069  16.079 1.00 42.40  ? 122 A   A "O3'" 1 
ATOM   5728 C  "C2'" . A   B  1 108 ? 27.440  81.382  17.132 1.00 40.53  ? 122 A   A "C2'" 1 
ATOM   5729 O  "O2'" . A   B  1 108 ? 27.027  82.374  18.057 1.00 34.70  ? 122 A   A "O2'" 1 
ATOM   5730 C  "C1'" . A   B  1 108 ? 26.202  80.665  16.594 1.00 38.40  ? 122 A   A "C1'" 1 
ATOM   5731 N  N9    . A   B  1 108 ? 26.561  79.292  16.191 1.00 38.56  ? 122 A   A N9    1 
ATOM   5732 C  C8    . A   B  1 108 ? 26.886  78.823  14.939 1.00 39.08  ? 122 A   A C8    1 
ATOM   5733 N  N7    . A   B  1 108 ? 27.183  77.545  14.918 1.00 35.68  ? 122 A   A N7    1 
ATOM   5734 C  C5    . A   B  1 108 ? 27.053  77.156  16.247 1.00 34.41  ? 122 A   A C5    1 
ATOM   5735 C  C6    . A   B  1 108 ? 27.226  75.923  16.889 1.00 34.25  ? 122 A   A C6    1 
ATOM   5736 N  N6    . A   B  1 108 ? 27.586  74.819  16.236 1.00 35.67  ? 122 A   A N6    1 
ATOM   5737 N  N1    . A   B  1 108 ? 27.021  75.857  18.227 1.00 35.08  ? 122 A   A N1    1 
ATOM   5738 C  C2    . A   B  1 108 ? 26.654  76.974  18.872 1.00 36.62  ? 122 A   A C2    1 
ATOM   5739 N  N3    . A   B  1 108 ? 26.456  78.195  18.372 1.00 38.30  ? 122 A   A N3    1 
ATOM   5740 C  C4    . A   B  1 108 ? 26.671  78.217  17.041 1.00 37.33  ? 122 A   A C4    1 
ATOM   5741 P  P     . G   B  1 109 ? 30.474  82.825  15.962 1.00 45.64  ? 123 G   A P     1 
ATOM   5742 O  OP1   . G   B  1 109 ? 31.057  84.192  16.028 1.00 44.36  ? 123 G   A OP1   1 
ATOM   5743 O  OP2   . G   B  1 109 ? 30.723  81.964  14.773 1.00 47.37  ? 123 G   A OP2   1 
ATOM   5744 O  "O5'" . G   B  1 109 ? 30.814  82.021  17.286 1.00 40.53  ? 123 G   A "O5'" 1 
ATOM   5745 C  "C5'" . G   B  1 109 ? 30.558  82.633  18.535 1.00 41.86  ? 123 G   A "C5'" 1 
ATOM   5746 C  "C4'" . G   B  1 109 ? 30.429  81.604  19.624 1.00 41.51  ? 123 G   A "C4'" 1 
ATOM   5747 O  "O4'" . G   B  1 109 ? 29.432  80.611  19.253 1.00 46.06  ? 123 G   A "O4'" 1 
ATOM   5748 C  "C3'" . G   B  1 109 ? 31.664  80.761  19.900 1.00 39.01  ? 123 G   A "C3'" 1 
ATOM   5749 O  "O3'" . G   B  1 109 ? 32.682  81.447  20.612 1.00 39.22  ? 123 G   A "O3'" 1 
ATOM   5750 C  "C2'" . G   B  1 109 ? 31.050  79.581  20.645 1.00 40.07  ? 123 G   A "C2'" 1 
ATOM   5751 O  "O2'" . G   B  1 109 ? 30.671  79.944  21.967 1.00 39.24  ? 123 G   A "O2'" 1 
ATOM   5752 C  "C1'" . G   B  1 109 ? 29.782  79.363  19.818 1.00 40.76  ? 123 G   A "C1'" 1 
ATOM   5753 N  N9    . G   B  1 109 ? 30.039  78.374  18.752 1.00 38.21  ? 123 G   A N9    1 
ATOM   5754 C  C8    . G   B  1 109 ? 30.196  78.512  17.390 1.00 37.17  ? 123 G   A C8    1 
ATOM   5755 N  N7    . G   B  1 109 ? 30.425  77.369  16.781 1.00 36.25  ? 123 G   A N7    1 
ATOM   5756 C  C5    . G   B  1 109 ? 30.418  76.429  17.811 1.00 37.35  ? 123 G   A C5    1 
ATOM   5757 C  C6    . G   B  1 109 ? 30.617  75.024  17.807 1.00 34.11  ? 123 G   A C6    1 
ATOM   5758 O  O6    . G   B  1 109 ? 30.841  74.274  16.841 1.00 34.49  ? 123 G   A O6    1 
ATOM   5759 N  N1    . G   B  1 109 ? 30.528  74.506  19.096 1.00 33.96  ? 123 G   A N1    1 
ATOM   5760 C  C2    . G   B  1 109 ? 30.279  75.223  20.238 1.00 34.72  ? 123 G   A C2    1 
ATOM   5761 N  N2    . G   B  1 109 ? 30.222  74.552  21.391 1.00 33.38  ? 123 G   A N2    1 
ATOM   5762 N  N3    . G   B  1 109 ? 30.091  76.525  20.260 1.00 36.20  ? 123 G   A N3    1 
ATOM   5763 C  C4    . G   B  1 109 ? 30.182  77.044  19.023 1.00 36.64  ? 123 G   A C4    1 
ATOM   5764 P  P     . C   B  1 110 ? 34.228  81.054  20.381 1.00 45.43  ? 124 C   A P     1 
ATOM   5765 O  OP1   . C   B  1 110 ? 34.940  82.085  21.177 1.00 39.77  ? 124 C   A OP1   1 
ATOM   5766 O  OP2   . C   B  1 110 ? 34.534  80.835  18.936 1.00 37.99  ? 124 C   A OP2   1 
ATOM   5767 O  "O5'" . C   B  1 110 ? 34.329  79.653  21.112 1.00 38.65  ? 124 C   A "O5'" 1 
ATOM   5768 C  "C5'" . C   B  1 110 ? 33.885  79.568  22.456 1.00 35.72  ? 124 C   A "C5'" 1 
ATOM   5769 C  "C4'" . C   B  1 110 ? 33.862  78.135  22.904 1.00 36.24  ? 124 C   A "C4'" 1 
ATOM   5770 O  "O4'" . C   B  1 110 ? 32.923  77.374  22.095 1.00 35.21  ? 124 C   A "O4'" 1 
ATOM   5771 C  "C3'" . C   B  1 110 ? 35.165  77.376  22.725 1.00 34.49  ? 124 C   A "C3'" 1 
ATOM   5772 O  "O3'" . C   B  1 110 ? 36.129  77.708  23.708 1.00 33.91  ? 124 C   A "O3'" 1 
ATOM   5773 C  "C2'" . C   B  1 110 ? 34.674  75.937  22.782 1.00 32.88  ? 124 C   A "C2'" 1 
ATOM   5774 O  "O2'" . C   B  1 110 ? 34.285  75.615  24.113 1.00 30.98  ? 124 C   A "O2'" 1 
ATOM   5775 C  "C1'" . C   B  1 110 ? 33.397  76.053  21.951 1.00 32.91  ? 124 C   A "C1'" 1 
ATOM   5776 N  N1    . C   B  1 110 ? 33.595  75.752  20.518 1.00 32.79  ? 124 C   A N1    1 
ATOM   5777 C  C2    . C   B  1 110 ? 33.726  74.416  20.174 1.00 30.61  ? 124 C   A C2    1 
ATOM   5778 O  O2    . C   B  1 110 ? 33.677  73.579  21.089 1.00 30.44  ? 124 C   A O2    1 
ATOM   5779 N  N3    . C   B  1 110 ? 33.909  74.073  18.879 1.00 31.73  ? 124 C   A N3    1 
ATOM   5780 C  C4    . C   B  1 110 ? 33.950  75.015  17.947 1.00 31.26  ? 124 C   A C4    1 
ATOM   5781 N  N4    . C   B  1 110 ? 34.133  74.615  16.687 1.00 34.62  ? 124 C   A N4    1 
ATOM   5782 C  C5    . C   B  1 110 ? 33.819  76.397  18.269 1.00 35.68  ? 124 C   A C5    1 
ATOM   5783 C  C6    . C   B  1 110 ? 33.641  76.724  19.558 1.00 34.90  ? 124 C   A C6    1 
ATOM   5784 P  P     . U   B  1 111 ? 37.683  77.648  23.328 1.00 34.16  ? 125 U   A P     1 
ATOM   5785 O  OP1   . U   B  1 111 ? 38.415  78.270  24.468 1.00 35.21  ? 125 U   A OP1   1 
ATOM   5786 O  OP2   . U   B  1 111 ? 37.902  78.200  21.977 1.00 32.30  ? 125 U   A OP2   1 
ATOM   5787 O  "O5'" . U   B  1 111 ? 37.924  76.078  23.263 1.00 30.80  ? 125 U   A "O5'" 1 
ATOM   5788 C  "C5'" . U   B  1 111 ? 37.863  75.277  24.431 1.00 31.46  ? 125 U   A "C5'" 1 
ATOM   5789 C  "C4'" . U   B  1 111 ? 38.104  73.825  24.114 1.00 27.52  ? 125 U   A "C4'" 1 
ATOM   5790 O  "O4'" . U   B  1 111 ? 37.025  73.285  23.300 1.00 26.96  ? 125 U   A "O4'" 1 
ATOM   5791 C  "C3'" . U   B  1 111 ? 39.345  73.536  23.288 1.00 28.14  ? 125 U   A "C3'" 1 
ATOM   5792 O  "O3'" . U   B  1 111 ? 40.544  73.629  24.042 1.00 26.82  ? 125 U   A "O3'" 1 
ATOM   5793 C  "C2'" . U   B  1 111 ? 39.019  72.143  22.752 1.00 25.66  ? 125 U   A "C2'" 1 
ATOM   5794 O  "O2'" . U   B  1 111 ? 39.091  71.163  23.782 1.00 24.37  ? 125 U   A "O2'" 1 
ATOM   5795 C  "C1'" . U   B  1 111 ? 37.540  72.325  22.406 1.00 27.67  ? 125 U   A "C1'" 1 
ATOM   5796 N  N1    . U   B  1 111 ? 37.428  72.793  21.007 1.00 27.84  ? 125 U   A N1    1 
ATOM   5797 C  C2    . U   B  1 111 ? 37.570  71.819  20.039 1.00 28.90  ? 125 U   A C2    1 
ATOM   5798 O  O2    . U   B  1 111 ? 37.767  70.647  20.311 1.00 26.72  ? 125 U   A O2    1 
ATOM   5799 N  N3    . U   B  1 111 ? 37.491  72.264  18.744 1.00 27.77  ? 125 U   A N3    1 
ATOM   5800 C  C4    . U   B  1 111 ? 37.277  73.556  18.336 1.00 30.41  ? 125 U   A C4    1 
ATOM   5801 O  O4    . U   B  1 111 ? 37.227  73.781  17.130 1.00 32.11  ? 125 U   A O4    1 
ATOM   5802 C  C5    . U   B  1 111 ? 37.144  74.515  19.397 1.00 29.97  ? 125 U   A C5    1 
ATOM   5803 C  C6    . U   B  1 111 ? 37.222  74.104  20.669 1.00 27.94  ? 125 U   A C6    1 
ATOM   5804 P  P     . G   B  1 112 ? 41.918  74.107  23.349 1.00 28.02  ? 126 G   A P     1 
ATOM   5805 O  OP1   . G   B  1 112 ? 42.723  74.708  24.446 1.00 28.65  ? 126 G   A OP1   1 
ATOM   5806 O  OP2   . G   B  1 112 ? 41.593  74.871  22.128 1.00 29.06  ? 126 G   A OP2   1 
ATOM   5807 O  "O5'" . G   B  1 112 ? 42.560  72.722  22.948 1.00 27.62  ? 126 G   A "O5'" 1 
ATOM   5808 C  "C5'" . G   B  1 112 ? 42.804  71.768  23.969 1.00 26.72  ? 126 G   A "C5'" 1 
ATOM   5809 C  "C4'" . G   B  1 112 ? 43.901  70.810  23.587 1.00 26.54  ? 126 G   A "C4'" 1 
ATOM   5810 O  "O4'" . G   B  1 112 ? 43.431  69.863  22.592 1.00 25.41  ? 126 G   A "O4'" 1 
ATOM   5811 C  "C3'" . G   B  1 112 ? 45.121  71.416  22.911 1.00 27.97  ? 126 G   A "C3'" 1 
ATOM   5812 O  "O3'" . G   B  1 112 ? 45.970  72.119  23.794 1.00 29.18  ? 126 G   A "O3'" 1 
ATOM   5813 C  "C2'" . G   B  1 112 ? 45.762  70.186  22.289 1.00 25.23  ? 126 G   A "C2'" 1 
ATOM   5814 O  "O2'" . G   B  1 112 ? 46.375  69.396  23.293 1.00 26.15  ? 126 G   A "O2'" 1 
ATOM   5815 C  "C1'" . G   B  1 112 ? 44.516  69.453  21.783 1.00 26.46  ? 126 G   A "C1'" 1 
ATOM   5816 N  N9    . G   B  1 112 ? 44.262  69.844  20.386 1.00 27.13  ? 126 G   A N9    1 
ATOM   5817 C  C8    . G   B  1 112 ? 43.338  70.736  19.884 1.00 26.00  ? 126 G   A C8    1 
ATOM   5818 N  N7    . G   B  1 112 ? 43.435  70.863  18.585 1.00 25.55  ? 126 G   A N7    1 
ATOM   5819 C  C5    . G   B  1 112 ? 44.474  70.015  18.213 1.00 24.53  ? 126 G   A C5    1 
ATOM   5820 C  C6    . G   B  1 112 ? 45.052  69.723  16.942 1.00 26.13  ? 126 G   A C6    1 
ATOM   5821 O  O6    . G   B  1 112 ? 44.744  70.160  15.830 1.00 26.37  ? 126 G   A O6    1 
ATOM   5822 N  N1    . G   B  1 112 ? 46.103  68.817  17.052 1.00 26.61  ? 126 G   A N1    1 
ATOM   5823 C  C2    . G   B  1 112 ? 46.530  68.246  18.228 1.00 28.05  ? 126 G   A C2    1 
ATOM   5824 N  N2    . G   B  1 112 ? 47.550  67.378  18.157 1.00 28.77  ? 126 G   A N2    1 
ATOM   5825 N  N3    . G   B  1 112 ? 45.999  68.505  19.405 1.00 26.20  ? 126 G   A N3    1 
ATOM   5826 C  C4    . G   B  1 112 ? 44.993  69.391  19.318 1.00 23.43  ? 126 G   A C4    1 
ATOM   5827 P  P     . G   B  1 113 ? 46.870  73.302  23.182 1.00 29.97  ? 127 G   A P     1 
ATOM   5828 O  OP1   . G   B  1 113 ? 47.360  73.990  24.401 1.00 30.82  ? 127 G   A OP1   1 
ATOM   5829 O  OP2   . G   B  1 113 ? 46.053  74.102  22.231 1.00 29.71  ? 127 G   A OP2   1 
ATOM   5830 O  "O5'" . G   B  1 113 ? 47.997  72.500  22.411 1.00 29.85  ? 127 G   A "O5'" 1 
ATOM   5831 C  "C5'" . G   B  1 113 ? 48.939  71.684  23.082 1.00 30.40  ? 127 G   A "C5'" 1 
ATOM   5832 C  "C4'" . G   B  1 113 ? 49.993  71.225  22.112 1.00 29.91  ? 127 G   A "C4'" 1 
ATOM   5833 O  "O4'" . G   B  1 113 ? 49.366  70.443  21.060 1.00 29.46  ? 127 G   A "O4'" 1 
ATOM   5834 C  "C3'" . G   B  1 113 ? 50.706  72.330  21.352 1.00 31.54  ? 127 G   A "C3'" 1 
ATOM   5835 O  "O3'" . G   B  1 113 ? 51.724  72.955  22.117 1.00 31.11  ? 127 G   A "O3'" 1 
ATOM   5836 C  "C2'" . G   B  1 113 ? 51.225  71.581  20.133 1.00 28.74  ? 127 G   A "C2'" 1 
ATOM   5837 O  "O2'" . G   B  1 113 ? 52.353  70.804  20.492 1.00 31.39  ? 127 G   A "O2'" 1 
ATOM   5838 C  "C1'" . G   B  1 113 ? 50.078  70.609  19.852 1.00 28.90  ? 127 G   A "C1'" 1 
ATOM   5839 N  N9    . G   B  1 113 ? 49.193  71.082  18.764 1.00 28.04  ? 127 G   A N9    1 
ATOM   5840 C  C8    . G   B  1 113 ? 48.023  71.799  18.824 1.00 30.36  ? 127 G   A C8    1 
ATOM   5841 N  N7    . G   B  1 113 ? 47.509  72.054  17.644 1.00 30.93  ? 127 G   A N7    1 
ATOM   5842 C  C5    . G   B  1 113 ? 48.402  71.477  16.746 1.00 31.92  ? 127 G   A C5    1 
ATOM   5843 C  C6    . G   B  1 113 ? 48.411  71.420  15.318 1.00 32.30  ? 127 G   A C6    1 
ATOM   5844 O  O6    . G   B  1 113 ? 47.601  71.881  14.505 1.00 30.70  ? 127 G   A O6    1 
ATOM   5845 N  N1    . G   B  1 113 ? 49.514  70.736  14.832 1.00 31.92  ? 127 G   A N1    1 
ATOM   5846 C  C2    . G   B  1 113 ? 50.498  70.180  15.604 1.00 35.95  ? 127 G   A C2    1 
ATOM   5847 N  N2    . G   B  1 113 ? 51.494  69.557  14.949 1.00 36.33  ? 127 G   A N2    1 
ATOM   5848 N  N3    . G   B  1 113 ? 50.505  70.221  16.928 1.00 33.34  ? 127 G   A N3    1 
ATOM   5849 C  C4    . G   B  1 113 ? 49.437  70.877  17.428 1.00 32.04  ? 127 G   A C4    1 
ATOM   5850 P  P     . A   B  1 114 ? 51.594  74.481  22.598 1.00 28.57  ? 128 A   A P     1 
ATOM   5851 O  OP1   . A   B  1 114 ? 52.923  74.811  23.169 1.00 34.05  ? 128 A   A OP1   1 
ATOM   5852 O  OP2   . A   B  1 114 ? 50.412  74.570  23.484 1.00 29.34  ? 128 A   A OP2   1 
ATOM   5853 O  "O5'" . A   B  1 114 ? 51.342  75.289  21.239 1.00 31.51  ? 128 A   A "O5'" 1 
ATOM   5854 C  "C5'" . A   B  1 114 ? 51.072  76.685  21.256 1.00 28.38  ? 128 A   A "C5'" 1 
ATOM   5855 C  "C4'" . A   B  1 114 ? 49.692  77.040  20.743 1.00 32.11  ? 128 A   A "C4'" 1 
ATOM   5856 O  "O4'" . A   B  1 114 ? 49.685  77.016  19.289 1.00 29.75  ? 128 A   A "O4'" 1 
ATOM   5857 C  "C3'" . A   B  1 114 ? 48.543  76.143  21.203 1.00 27.99  ? 128 A   A "C3'" 1 
ATOM   5858 O  "O3'" . A   B  1 114 ? 47.422  76.956  21.545 1.00 26.63  ? 128 A   A "O3'" 1 
ATOM   5859 C  "C2'" . A   B  1 114 ? 48.230  75.270  19.982 1.00 30.69  ? 128 A   A "C2'" 1 
ATOM   5860 O  "O2'" . A   B  1 114 ? 46.854  74.968  19.844 1.00 28.65  ? 128 A   A "O2'" 1 
ATOM   5861 C  "C1'" . A   B  1 114 ? 48.730  76.094  18.791 1.00 33.49  ? 128 A   A "C1'" 1 
ATOM   5862 N  N9    . A   B  1 114 ? 49.469  75.283  17.812 1.00 34.76  ? 128 A   A N9    1 
ATOM   5863 C  C8    . A   B  1 114 ? 50.601  74.521  18.040 1.00 33.09  ? 128 A   A C8    1 
ATOM   5864 N  N7    . A   B  1 114 ? 51.092  73.905  16.995 1.00 36.73  ? 128 A   A N7    1 
ATOM   5865 C  C5    . A   B  1 114 ? 50.212  74.316  16.004 1.00 35.31  ? 128 A   A C5    1 
ATOM   5866 C  C6    . A   B  1 114 ? 50.172  74.015  14.654 1.00 37.93  ? 128 A   A C6    1 
ATOM   5867 N  N6    . A   B  1 114 ? 51.057  73.216  14.073 1.00 41.77  ? 128 A   A N6    1 
ATOM   5868 N  N1    . A   B  1 114 ? 49.179  74.562  13.927 1.00 42.97  ? 128 A   A N1    1 
ATOM   5869 C  C2    . A   B  1 114 ? 48.292  75.370  14.534 1.00 40.21  ? 128 A   A C2    1 
ATOM   5870 N  N3    . A   B  1 114 ? 48.216  75.738  15.808 1.00 33.40  ? 128 A   A N3    1 
ATOM   5871 C  C4    . A   B  1 114 ? 49.220  75.158  16.484 1.00 33.41  ? 128 A   A C4    1 
ATOM   5872 P  P     . U   B  1 115 ? 47.395  77.637  23.013 1.00 28.35  ? 129 U   A P     1 
ATOM   5873 O  OP1   . U   B  1 115 ? 48.347  76.917  23.890 1.00 24.97  ? 129 U   A OP1   1 
ATOM   5874 O  OP2   . U   B  1 115 ? 45.967  77.720  23.387 1.00 28.48  ? 129 U   A OP2   1 
ATOM   5875 O  "O5'" . U   B  1 115 ? 47.981  79.085  22.748 1.00 27.60  ? 129 U   A "O5'" 1 
ATOM   5876 C  "C5'" . U   B  1 115 ? 47.132  80.150  22.334 1.00 31.06  ? 129 U   A "C5'" 1 
ATOM   5877 C  "C4'" . U   B  1 115 ? 47.905  81.413  22.046 1.00 34.05  ? 129 U   A "C4'" 1 
ATOM   5878 O  "O4'" . U   B  1 115 ? 48.740  81.217  20.871 1.00 32.29  ? 129 U   A "O4'" 1 
ATOM   5879 C  "C3'" . U   B  1 115 ? 47.029  82.615  21.718 1.00 33.86  ? 129 U   A "C3'" 1 
ATOM   5880 O  "O3'" . U   B  1 115 ? 47.745  83.801  22.055 1.00 31.02  ? 129 U   A "O3'" 1 
ATOM   5881 C  "C2'" . U   B  1 115 ? 46.914  82.488  20.205 1.00 36.59  ? 129 U   A "C2'" 1 
ATOM   5882 O  "O2'" . U   B  1 115 ? 46.467  83.625  19.497 1.00 36.87  ? 129 U   A "O2'" 1 
ATOM   5883 C  "C1'" . U   B  1 115 ? 48.353  82.143  19.871 1.00 35.64  ? 129 U   A "C1'" 1 
ATOM   5884 N  N1    . U   B  1 115 ? 48.355  81.525  18.545 1.00 39.72  ? 129 U   A N1    1 
ATOM   5885 C  C2    . U   B  1 115 ? 48.980  82.197  17.519 1.00 39.21  ? 129 U   A C2    1 
ATOM   5886 O  O2    . U   B  1 115 ? 49.541  83.259  17.686 1.00 38.00  ? 129 U   A O2    1 
ATOM   5887 N  N3    . U   B  1 115 ? 48.940  81.561  16.304 1.00 46.29  ? 129 U   A N3    1 
ATOM   5888 C  C4    . U   B  1 115 ? 48.317  80.355  16.023 1.00 50.39  ? 129 U   A C4    1 
ATOM   5889 O  O4    . U   B  1 115 ? 48.343  79.891  14.878 1.00 53.23  ? 129 U   A O4    1 
ATOM   5890 C  C5    . U   B  1 115 ? 47.673  79.738  17.143 1.00 47.48  ? 129 U   A C5    1 
ATOM   5891 C  C6    . U   B  1 115 ? 47.710  80.333  18.340 1.00 44.72  ? 129 U   A C6    1 
ATOM   5892 P  P     . G   B  1 116 ? 47.135  84.729  23.203 1.00 32.07  ? 130 G   A P     1 
ATOM   5893 O  OP1   . G   B  1 116 ? 48.064  85.865  23.414 1.00 34.17  ? 130 G   A OP1   1 
ATOM   5894 O  OP2   . G   B  1 116 ? 46.741  83.867  24.346 1.00 34.65  ? 130 G   A OP2   1 
ATOM   5895 O  "O5'" . G   B  1 116 ? 45.811  85.222  22.469 1.00 37.11  ? 130 G   A "O5'" 1 
ATOM   5896 C  "C5'" . G   B  1 116 ? 44.773  85.887  23.170 1.00 34.72  ? 130 G   A "C5'" 1 
ATOM   5897 C  "C4'" . G   B  1 116 ? 44.109  86.914  22.289 1.00 37.03  ? 130 G   A "C4'" 1 
ATOM   5898 O  "O4'" . G   B  1 116 ? 44.997  88.045  22.090 1.00 39.04  ? 130 G   A "O4'" 1 
ATOM   5899 C  "C3'" . G   B  1 116 ? 43.795  86.462  20.870 1.00 39.29  ? 130 G   A "C3'" 1 
ATOM   5900 O  "O3'" . G   B  1 116 ? 42.632  85.657  20.769 1.00 40.35  ? 130 G   A "O3'" 1 
ATOM   5901 C  "C2'" . G   B  1 116 ? 43.681  87.792  20.142 1.00 39.66  ? 130 G   A "C2'" 1 
ATOM   5902 O  "O2'" . G   B  1 116 ? 42.466  88.439  20.493 1.00 41.09  ? 130 G   A "O2'" 1 
ATOM   5903 C  "C1'" . G   B  1 116 ? 44.839  88.554  20.781 1.00 39.11  ? 130 G   A "C1'" 1 
ATOM   5904 N  N9    . G   B  1 116 ? 46.069  88.330  19.994 1.00 37.33  ? 130 G   A N9    1 
ATOM   5905 C  C8    . G   B  1 116 ? 47.121  87.476  20.230 1.00 37.80  ? 130 G   A C8    1 
ATOM   5906 N  N7    . G   B  1 116 ? 48.034  87.518  19.286 1.00 37.38  ? 130 G   A N7    1 
ATOM   5907 C  C5    . G   B  1 116 ? 47.548  88.447  18.368 1.00 37.40  ? 130 G   A C5    1 
ATOM   5908 C  C6    . G   B  1 116 ? 48.078  88.931  17.138 1.00 38.17  ? 130 G   A C6    1 
ATOM   5909 O  O6    . G   B  1 116 ? 49.133  88.639  16.565 1.00 36.57  ? 130 G   A O6    1 
ATOM   5910 N  N1    . G   B  1 116 ? 47.240  89.872  16.549 1.00 39.98  ? 130 G   A N1    1 
ATOM   5911 C  C2    . G   B  1 116 ? 46.043  90.297  17.061 1.00 40.41  ? 130 G   A C2    1 
ATOM   5912 N  N2    . G   B  1 116 ? 45.376  91.214  16.339 1.00 42.31  ? 130 G   A N2    1 
ATOM   5913 N  N3    . G   B  1 116 ? 45.537  89.857  18.201 1.00 40.06  ? 130 G   A N3    1 
ATOM   5914 C  C4    . G   B  1 116 ? 46.337  88.946  18.796 1.00 38.58  ? 130 G   A C4    1 
ATOM   5915 P  P     . C   B  1 117 ? 42.530  84.531  19.625 1.00 43.43  ? 131 C   A P     1 
ATOM   5916 O  OP1   . C   B  1 117 ? 41.244  83.843  19.898 1.00 46.13  ? 131 C   A OP1   1 
ATOM   5917 O  OP2   . C   B  1 117 ? 43.794  83.755  19.582 1.00 45.92  ? 131 C   A OP2   1 
ATOM   5918 O  "O5'" . C   B  1 117 ? 42.478  85.333  18.266 1.00 45.09  ? 131 C   A "O5'" 1 
ATOM   5919 C  "C5'" . C   B  1 117 ? 41.484  86.290  17.942 1.00 46.35  ? 131 C   A "C5'" 1 
ATOM   5920 C  "C4'" . C   B  1 117 ? 41.867  86.987  16.663 1.00 44.83  ? 131 C   A "C4'" 1 
ATOM   5921 O  "O4'" . C   B  1 117 ? 43.132  87.673  16.852 1.00 44.24  ? 131 C   A "O4'" 1 
ATOM   5922 C  "C3'" . C   B  1 117 ? 42.143  86.080  15.473 1.00 48.57  ? 131 C   A "C3'" 1 
ATOM   5923 O  "O3'" . C   B  1 117 ? 40.978  85.634  14.806 1.00 53.17  ? 131 C   A "O3'" 1 
ATOM   5924 C  "C2'" . C   B  1 117 ? 43.026  86.948  14.594 1.00 47.32  ? 131 C   A "C2'" 1 
ATOM   5925 O  "O2'" . C   B  1 117 ? 42.239  87.919  13.921 1.00 48.15  ? 131 C   A "O2'" 1 
ATOM   5926 C  "C1'" . C   B  1 117 ? 43.874  87.653  15.650 1.00 43.73  ? 131 C   A "C1'" 1 
ATOM   5927 N  N1    . C   B  1 117 ? 45.154  86.931  15.760 1.00 43.32  ? 131 C   A N1    1 
ATOM   5928 C  C2    . C   B  1 117 ? 46.041  87.166  14.712 1.00 44.71  ? 131 C   A C2    1 
ATOM   5929 O  O2    . C   B  1 117 ? 45.692  87.951  13.820 1.00 48.67  ? 131 C   A O2    1 
ATOM   5930 N  N3    . C   B  1 117 ? 47.240  86.554  14.685 1.00 45.32  ? 131 C   A N3    1 
ATOM   5931 C  C4    . C   B  1 117 ? 47.574  85.722  15.665 1.00 43.51  ? 131 C   A C4    1 
ATOM   5932 N  N4    . C   B  1 117 ? 48.778  85.159  15.561 1.00 37.24  ? 131 C   A N4    1 
ATOM   5933 C  C5    . C   B  1 117 ? 46.685  85.450  16.759 1.00 40.12  ? 131 C   A C5    1 
ATOM   5934 C  C6    . C   B  1 117 ? 45.484  86.066  16.770 1.00 43.55  ? 131 C   A C6    1 
ATOM   5935 P  P     . U   B  1 118 ? 41.040  84.251  13.991 1.00 54.78  ? 132 U   A P     1 
ATOM   5936 O  OP1   . U   B  1 118 ? 39.646  84.079  13.504 1.00 62.72  ? 132 U   A OP1   1 
ATOM   5937 O  OP2   . U   B  1 118 ? 41.633  83.263  14.930 1.00 55.01  ? 132 U   A OP2   1 
ATOM   5938 O  "O5'" . U   B  1 118 ? 42.029  84.474  12.760 1.00 51.37  ? 132 U   A "O5'" 1 
ATOM   5939 C  "C5'" . U   B  1 118 ? 41.570  85.166  11.611 1.00 55.93  ? 132 U   A "C5'" 1 
ATOM   5940 C  "C4'" . U   B  1 118 ? 42.687  85.438  10.638 1.00 54.31  ? 132 U   A "C4'" 1 
ATOM   5941 O  "O4'" . U   B  1 118 ? 43.843  85.943  11.355 1.00 49.92  ? 132 U   A "O4'" 1 
ATOM   5942 C  "C3'" . U   B  1 118 ? 43.241  84.252  9.863  1.00 57.83  ? 132 U   A "C3'" 1 
ATOM   5943 O  "O3'" . U   B  1 118 ? 42.428  83.839  8.776  1.00 62.06  ? 132 U   A "O3'" 1 
ATOM   5944 C  "C2'" . U   B  1 118 ? 44.605  84.778  9.437  1.00 56.24  ? 132 U   A "C2'" 1 
ATOM   5945 O  "O2'" . U   B  1 118 ? 44.481  85.727  8.388  1.00 50.29  ? 132 U   A "O2'" 1 
ATOM   5946 C  "C1'" . U   B  1 118 ? 45.022  85.533  10.695 1.00 50.07  ? 132 U   A "C1'" 1 
ATOM   5947 N  N1    . U   B  1 118 ? 45.822  84.659  11.569 1.00 47.83  ? 132 U   A N1    1 
ATOM   5948 C  C2    . U   B  1 118 ? 47.121  84.452  11.172 1.00 50.13  ? 132 U   A C2    1 
ATOM   5949 O  O2    . U   B  1 118 ? 47.582  84.959  10.164 1.00 52.98  ? 132 U   A O2    1 
ATOM   5950 N  N3    . U   B  1 118 ? 47.856  83.635  11.992 1.00 49.67  ? 132 U   A N3    1 
ATOM   5951 C  C4    . U   B  1 118 ? 47.422  83.018  13.146 1.00 47.06  ? 132 U   A C4    1 
ATOM   5952 O  O4    . U   B  1 118 ? 48.212  82.313  13.774 1.00 45.59  ? 132 U   A O4    1 
ATOM   5953 C  C5    . U   B  1 118 ? 46.059  83.283  13.490 1.00 47.95  ? 132 U   A C5    1 
ATOM   5954 C  C6    . U   B  1 118 ? 45.318  84.078  12.708 1.00 49.04  ? 132 U   A C6    1 
ATOM   5955 P  P     . U   B  1 119 ? 42.627  82.375  8.129  1.00 62.50  ? 133 U   A P     1 
ATOM   5956 O  OP1   . U   B  1 119 ? 41.300  81.725  8.237  1.00 68.22  ? 133 U   A OP1   1 
ATOM   5957 O  OP2   . U   B  1 119 ? 43.804  81.736  8.772  1.00 62.86  ? 133 U   A OP2   1 
ATOM   5958 O  "O5'" . U   B  1 119 ? 42.973  82.692  6.609  1.00 66.33  ? 133 U   A "O5'" 1 
ATOM   5959 C  "C5'" . U   B  1 119 ? 44.023  83.592  6.298  1.00 62.36  ? 133 U   A "C5'" 1 
ATOM   5960 C  "C4'" . U   B  1 119 ? 45.022  82.990  5.344  1.00 64.31  ? 133 U   A "C4'" 1 
ATOM   5961 O  "O4'" . U   B  1 119 ? 46.363  83.269  5.819  1.00 62.36  ? 133 U   A "O4'" 1 
ATOM   5962 C  "C3'" . U   B  1 119 ? 44.982  81.477  5.191  1.00 66.05  ? 133 U   A "C3'" 1 
ATOM   5963 O  "O3'" . U   B  1 119 ? 43.994  81.057  4.265  1.00 68.96  ? 133 U   A "O3'" 1 
ATOM   5964 C  "C2'" . U   B  1 119 ? 46.403  81.148  4.750  1.00 64.59  ? 133 U   A "C2'" 1 
ATOM   5965 O  "O2'" . U   B  1 119 ? 46.578  81.410  3.366  1.00 69.71  ? 133 U   A "O2'" 1 
ATOM   5966 C  "C1'" . U   B  1 119 ? 47.213  82.181  5.531  1.00 61.93  ? 133 U   A "C1'" 1 
ATOM   5967 N  N1    . U   B  1 119 ? 47.735  81.632  6.796  1.00 57.50  ? 133 U   A N1    1 
ATOM   5968 C  C2    . U   B  1 119 ? 49.022  81.150  6.759  1.00 56.94  ? 133 U   A C2    1 
ATOM   5969 O  O2    . U   B  1 119 ? 49.691  81.170  5.743  1.00 59.17  ? 133 U   A O2    1 
ATOM   5970 N  N3    . U   B  1 119 ? 49.489  80.647  7.947  1.00 53.71  ? 133 U   A N3    1 
ATOM   5971 C  C4    . U   B  1 119 ? 48.796  80.587  9.140  1.00 53.59  ? 133 U   A C4    1 
ATOM   5972 O  O4    . U   B  1 119 ? 49.355  80.102  10.123 1.00 53.05  ? 133 U   A O4    1 
ATOM   5973 C  C5    . U   B  1 119 ? 47.462  81.112  9.099  1.00 55.56  ? 133 U   A C5    1 
ATOM   5974 C  C6    . U   B  1 119 ? 46.986  81.608  7.951  1.00 57.31  ? 133 U   A C6    1 
ATOM   5975 P  P     . G   B  1 120 ? 43.401  79.563  4.261  1.00 75.10  ? 134 G   A P     1 
ATOM   5976 O  OP1   . G   B  1 120 ? 42.826  79.402  2.901  1.00 77.40  ? 134 G   A OP1   1 
ATOM   5977 O  OP2   . G   B  1 120 ? 42.502  79.405  5.431  1.00 71.27  ? 134 G   A OP2   1 
ATOM   5978 O  "O5'" . G   B  1 120 ? 44.699  78.658  4.417  1.00 68.72  ? 134 G   A "O5'" 1 
ATOM   5979 C  "C5'" . G   B  1 120 ? 44.871  77.534  3.572  1.00 66.82  ? 134 G   A "C5'" 1 
ATOM   5980 C  "C4'" . G   B  1 120 ? 46.318  77.135  3.464  1.00 65.00  ? 134 G   A "C4'" 1 
ATOM   5981 O  "O4'" . G   B  1 120 ? 47.154  78.041  4.228  1.00 65.89  ? 134 G   A "O4'" 1 
ATOM   5982 C  "C3'" . G   B  1 120 ? 46.666  75.770  4.029  1.00 64.68  ? 134 G   A "C3'" 1 
ATOM   5983 O  "O3'" . G   B  1 120 ? 46.308  74.706  3.169  1.00 67.85  ? 134 G   A "O3'" 1 
ATOM   5984 C  "C2'" . G   B  1 120 ? 48.166  75.887  4.269  1.00 61.59  ? 134 G   A "C2'" 1 
ATOM   5985 O  "O2'" . G   B  1 120 ? 48.888  75.739  3.055  1.00 62.76  ? 134 G   A "O2'" 1 
ATOM   5986 C  "C1'" . G   B  1 120 ? 48.277  77.340  4.727  1.00 60.79  ? 134 G   A "C1'" 1 
ATOM   5987 N  N9    . G   B  1 120 ? 48.322  77.451  6.198  1.00 56.71  ? 134 G   A N9    1 
ATOM   5988 C  C8    . G   B  1 120 ? 47.382  77.988  7.046  1.00 56.84  ? 134 G   A C8    1 
ATOM   5989 N  N7    . G   B  1 120 ? 47.744  77.934  8.303  1.00 54.99  ? 134 G   A N7    1 
ATOM   5990 C  C5    . G   B  1 120 ? 48.997  77.331  8.283  1.00 50.04  ? 134 G   A C5    1 
ATOM   5991 C  C6    . G   B  1 120 ? 49.889  77.001  9.337  1.00 48.28  ? 134 G   A C6    1 
ATOM   5992 O  O6    . G   B  1 120 ? 49.757  77.181  10.554 1.00 48.22  ? 134 G   A O6    1 
ATOM   5993 N  N1    . G   B  1 120 ? 51.047  76.393  8.859  1.00 49.25  ? 134 G   A N1    1 
ATOM   5994 C  C2    . G   B  1 120 ? 51.315  76.136  7.537  1.00 49.06  ? 134 G   A C2    1 
ATOM   5995 N  N2    . G   B  1 120 ? 52.489  75.545  7.266  1.00 46.18  ? 134 G   A N2    1 
ATOM   5996 N  N3    . G   B  1 120 ? 50.491  76.440  6.550  1.00 51.17  ? 134 G   A N3    1 
ATOM   5997 C  C4    . G   B  1 120 ? 49.363  77.030  6.991  1.00 51.72  ? 134 G   A C4    1 
ATOM   5998 P  P     . U   B  1 121 ? 45.934  73.280  3.808  1.00 73.74  ? 135 U   A P     1 
ATOM   5999 O  OP1   . U   B  1 121 ? 45.395  72.466  2.689  1.00 73.58  ? 135 U   A OP1   1 
ATOM   6000 O  OP2   . U   B  1 121 ? 45.071  73.574  4.984  1.00 66.95  ? 135 U   A OP2   1 
ATOM   6001 O  "O5'" . U   B  1 121 ? 47.346  72.708  4.268  1.00 59.46  ? 135 U   A "O5'" 1 
ATOM   6002 C  "C5'" . U   B  1 121 ? 48.434  72.675  3.360  1.00 58.77  ? 135 U   A "C5'" 1 
ATOM   6003 C  "C4'" . U   B  1 121 ? 49.642  72.056  4.010  1.00 57.66  ? 135 U   A "C4'" 1 
ATOM   6004 O  "O4'" . U   B  1 121 ? 50.323  73.031  4.842  1.00 55.18  ? 135 U   A "O4'" 1 
ATOM   6005 C  "C3'" . U   B  1 121 ? 49.341  70.929  4.979  1.00 54.53  ? 135 U   A "C3'" 1 
ATOM   6006 O  "O3'" . U   B  1 121 ? 49.019  69.707  4.341  1.00 59.19  ? 135 U   A "O3'" 1 
ATOM   6007 C  "C2'" . U   B  1 121 ? 50.608  70.896  5.821  1.00 52.80  ? 135 U   A "C2'" 1 
ATOM   6008 O  "O2'" . U   B  1 121 ? 51.688  70.343  5.088  1.00 55.01  ? 135 U   A "O2'" 1 
ATOM   6009 C  "C1'" . U   B  1 121 ? 50.873  72.390  5.976  1.00 51.91  ? 135 U   A "C1'" 1 
ATOM   6010 N  N1    . U   B  1 121 ? 50.235  72.900  7.211  1.00 48.78  ? 135 U   A N1    1 
ATOM   6011 C  C2    . U   B  1 121 ? 50.965  72.820  8.380  1.00 46.65  ? 135 U   A C2    1 
ATOM   6012 O  O2    . U   B  1 121 ? 52.093  72.355  8.425  1.00 44.98  ? 135 U   A O2    1 
ATOM   6013 N  N3    . U   B  1 121 ? 50.324  73.303  9.496  1.00 44.91  ? 135 U   A N3    1 
ATOM   6014 C  C4    . U   B  1 121 ? 49.055  73.838  9.567  1.00 45.88  ? 135 U   A C4    1 
ATOM   6015 O  O4    . U   B  1 121 ? 48.620  74.234  10.653 1.00 44.52  ? 135 U   A O4    1 
ATOM   6016 C  C5    . U   B  1 121 ? 48.365  73.882  8.312  1.00 50.01  ? 135 U   A C5    1 
ATOM   6017 C  C6    . U   B  1 121 ? 48.961  73.422  7.208  1.00 50.42  ? 135 U   A C6    1 
ATOM   6018 P  P     . C   B  1 122 ? 48.600  68.436  5.233  1.00 60.53  ? 136 C   A P     1 
ATOM   6019 O  OP1   . C   B  1 122 ? 47.998  67.437  4.311  1.00 59.41  ? 136 C   A OP1   1 
ATOM   6020 O  OP2   . C   B  1 122 ? 47.798  68.904  6.393  1.00 57.28  ? 136 C   A OP2   1 
ATOM   6021 O  "O5'" . C   B  1 122 ? 50.046  67.988  5.725  1.00 51.88  ? 136 C   A "O5'" 1 
ATOM   6022 C  "C5'" . C   B  1 122 ? 50.148  66.999  6.729  1.00 49.28  ? 136 C   A "C5'" 1 
ATOM   6023 C  "C4'" . C   B  1 122 ? 51.330  67.224  7.635  1.00 49.51  ? 136 C   A "C4'" 1 
ATOM   6024 O  "O4'" . C   B  1 122 ? 51.433  68.622  8.013  1.00 50.09  ? 136 C   A "O4'" 1 
ATOM   6025 C  "C3'" . C   B  1 122 ? 51.218  66.485  8.954  1.00 49.33  ? 136 C   A "C3'" 1 
ATOM   6026 O  "O3'" . C   B  1 122 ? 51.607  65.130  8.835  1.00 50.99  ? 136 C   A "O3'" 1 
ATOM   6027 C  "C2'" . C   B  1 122 ? 52.062  67.323  9.907  1.00 48.93  ? 136 C   A "C2'" 1 
ATOM   6028 O  "O2'" . C   B  1 122 ? 53.449  67.035  9.767  1.00 51.66  ? 136 C   A "O2'" 1 
ATOM   6029 C  "C1'" . C   B  1 122 ? 51.782  68.732  9.378  1.00 44.64  ? 136 C   A "C1'" 1 
ATOM   6030 N  N1    . C   B  1 122 ? 50.622  69.382  10.030 1.00 43.11  ? 136 C   A N1    1 
ATOM   6031 C  C2    . C   B  1 122 ? 50.632  69.639  11.405 1.00 40.49  ? 136 C   A C2    1 
ATOM   6032 O  O2    . C   B  1 122 ? 51.622  69.305  12.067 1.00 39.59  ? 136 C   A O2    1 
ATOM   6033 N  N3    . C   B  1 122 ? 49.561  70.243  11.977 1.00 38.22  ? 136 C   A N3    1 
ATOM   6034 C  C4    . C   B  1 122 ? 48.516  70.589  11.223 1.00 38.69  ? 136 C   A C4    1 
ATOM   6035 N  N4    . C   B  1 122 ? 47.482  71.181  11.811 1.00 36.90  ? 136 C   A N4    1 
ATOM   6036 C  C5    . C   B  1 122 ? 48.478  70.343  9.820  1.00 41.80  ? 136 C   A C5    1 
ATOM   6037 C  C6    . C   B  1 122 ? 49.542  69.743  9.275  1.00 43.81  ? 136 C   A C6    1 
ATOM   6038 P  P     . C   B  1 123 ? 50.472  64.000  8.950  1.00 55.99  ? 137 C   A P     1 
ATOM   6039 O  OP1   . C   B  1 123 ? 50.695  63.011  7.863  1.00 57.90  ? 137 C   A OP1   1 
ATOM   6040 O  OP2   . C   B  1 123 ? 49.145  64.663  9.084  1.00 40.21  ? 137 C   A OP2   1 
ATOM   6041 O  "O5'" . C   B  1 123 ? 50.946  63.370  10.320 1.00 51.35  ? 137 C   A "O5'" 1 
ATOM   6042 C  "C5'" . C   B  1 123 ? 50.178  63.640  11.471 1.00 44.54  ? 137 C   A "C5'" 1 
ATOM   6043 C  "C4'" . C   B  1 123 ? 51.009  64.220  12.583 1.00 44.07  ? 137 C   A "C4'" 1 
ATOM   6044 O  "O4'" . C   B  1 123 ? 50.908  65.665  12.546 1.00 42.89  ? 137 C   A "O4'" 1 
ATOM   6045 C  "C3'" . C   B  1 123 ? 50.476  63.819  13.941 1.00 40.84  ? 137 C   A "C3'" 1 
ATOM   6046 O  "O3'" . C   B  1 123 ? 51.071  62.615  14.386 1.00 38.83  ? 137 C   A "O3'" 1 
ATOM   6047 C  "C2'" . C   B  1 123 ? 50.705  65.032  14.835 1.00 39.98  ? 137 C   A "C2'" 1 
ATOM   6048 O  "O2'" . C   B  1 123 ? 52.001  65.021  15.404 1.00 37.82  ? 137 C   A "O2'" 1 
ATOM   6049 C  "C1'" . C   B  1 123 ? 50.630  66.181  13.830 1.00 40.89  ? 137 C   A "C1'" 1 
ATOM   6050 N  N1    . C   B  1 123 ? 49.315  66.838  13.702 1.00 36.53  ? 137 C   A N1    1 
ATOM   6051 C  C2    . C   B  1 123 ? 48.678  67.413  14.808 1.00 33.82  ? 137 C   A C2    1 
ATOM   6052 O  O2    . C   B  1 123 ? 49.223  67.343  15.919 1.00 31.95  ? 137 C   A O2    1 
ATOM   6053 N  N3    . C   B  1 123 ? 47.480  68.021  14.634 1.00 29.60  ? 137 C   A N3    1 
ATOM   6054 C  C4    . C   B  1 123 ? 46.927  68.074  13.422 1.00 32.74  ? 137 C   A C4    1 
ATOM   6055 N  N4    . C   B  1 123 ? 45.745  68.682  13.284 1.00 30.78  ? 137 C   A N4    1 
ATOM   6056 C  C5    . C   B  1 123 ? 47.558  67.501  12.284 1.00 34.40  ? 137 C   A C5    1 
ATOM   6057 C  C6    . C   B  1 123 ? 48.738  66.906  12.467 1.00 35.81  ? 137 C   A C6    1 
ATOM   6058 P  P     . U   B  1 124 ? 50.124  61.333  14.548 1.00 44.25  ? 138 U   A P     1 
ATOM   6059 O  OP1   . U   B  1 124 ? 51.026  60.212  14.909 1.00 45.65  ? 138 U   A OP1   1 
ATOM   6060 O  OP2   . U   B  1 124 ? 49.267  61.264  13.332 1.00 42.52  ? 138 U   A OP2   1 
ATOM   6061 O  "O5'" . U   B  1 124 ? 49.225  61.719  15.821 1.00 36.95  ? 138 U   A "O5'" 1 
ATOM   6062 C  "C5'" . U   B  1 124 ? 49.842  62.116  17.042 1.00 34.60  ? 138 U   A "C5'" 1 
ATOM   6063 C  "C4'" . U   B  1 124 ? 48.881  62.867  17.928 1.00 33.76  ? 138 U   A "C4'" 1 
ATOM   6064 O  "O4'" . U   B  1 124 ? 48.309  63.973  17.172 1.00 32.08  ? 138 U   A "O4'" 1 
ATOM   6065 C  "C3'" . U   B  1 124 ? 47.695  62.048  18.433 1.00 33.30  ? 138 U   A "C3'" 1 
ATOM   6066 O  "O3'" . U   B  1 124 ? 47.289  62.565  19.699 1.00 33.02  ? 138 U   A "O3'" 1 
ATOM   6067 C  "C2'" . U   B  1 124 ? 46.613  62.374  17.409 1.00 29.90  ? 138 U   A "C2'" 1 
ATOM   6068 O  "O2'" . U   B  1 124 ? 45.290  62.133  17.850 1.00 32.16  ? 138 U   A "O2'" 1 
ATOM   6069 C  "C1'" . U   B  1 124 ? 46.898  63.855  17.182 1.00 29.67  ? 138 U   A "C1'" 1 
ATOM   6070 N  N1    . U   B  1 124 ? 46.316  64.356  15.927 1.00 30.46  ? 138 U   A N1    1 
ATOM   6071 C  C2    . U   B  1 124 ? 45.252  65.217  16.069 1.00 26.78  ? 138 U   A C2    1 
ATOM   6072 O  O2    . U   B  1 124 ? 44.814  65.549  17.156 1.00 27.90  ? 138 U   A O2    1 
ATOM   6073 N  N3    . U   B  1 124 ? 44.712  65.668  14.901 1.00 25.98  ? 138 U   A N3    1 
ATOM   6074 C  C4    . U   B  1 124 ? 45.106  65.328  13.626 1.00 28.73  ? 138 U   A C4    1 
ATOM   6075 O  O4    . U   B  1 124 ? 44.499  65.823  12.675 1.00 30.88  ? 138 U   A O4    1 
ATOM   6076 C  C5    . U   B  1 124 ? 46.213  64.425  13.557 1.00 31.39  ? 138 U   A C5    1 
ATOM   6077 C  C6    . U   B  1 124 ? 46.769  63.971  14.688 1.00 32.28  ? 138 U   A C6    1 
ATOM   6078 P  P     . A   B  1 125 ? 47.912  61.966  21.046 1.00 38.32  ? 139 A   A P     1 
ATOM   6079 O  OP1   . A   B  1 125 ? 49.344  62.352  21.047 1.00 40.78  ? 139 A   A OP1   1 
ATOM   6080 O  OP2   . A   B  1 125 ? 47.535  60.541  21.163 1.00 32.24  ? 139 A   A OP2   1 
ATOM   6081 O  "O5'" . A   B  1 125 ? 47.132  62.831  22.132 1.00 31.60  ? 139 A   A "O5'" 1 
ATOM   6082 C  "C5'" . A   B  1 125 ? 45.735  62.728  22.336 1.00 30.27  ? 139 A   A "C5'" 1 
ATOM   6083 C  "C4'" . A   B  1 125 ? 45.360  63.558  23.536 1.00 27.74  ? 139 A   A "C4'" 1 
ATOM   6084 O  "O4'" . A   B  1 125 ? 45.361  64.974  23.208 1.00 27.26  ? 139 A   A "O4'" 1 
ATOM   6085 C  "C3'" . A   B  1 125 ? 43.986  63.294  24.111 1.00 27.29  ? 139 A   A "C3'" 1 
ATOM   6086 O  "O3'" . A   B  1 125 ? 44.005  62.164  24.964 1.00 29.27  ? 139 A   A "O3'" 1 
ATOM   6087 C  "C2'" . A   B  1 125 ? 43.657  64.597  24.831 1.00 26.55  ? 139 A   A "C2'" 1 
ATOM   6088 O  "O2'" . A   B  1 125 ? 44.278  64.620  26.102 1.00 29.96  ? 139 A   A "O2'" 1 
ATOM   6089 C  "C1'" . A   B  1 125 ? 44.354  65.629  23.944 1.00 26.03  ? 139 A   A "C1'" 1 
ATOM   6090 N  N9    . A   B  1 125 ? 43.427  66.245  22.983 1.00 24.66  ? 139 A   A N9    1 
ATOM   6091 C  C8    . A   B  1 125 ? 43.366  66.055  21.624 1.00 26.33  ? 139 A   A C8    1 
ATOM   6092 N  N7    . A   B  1 125 ? 42.431  66.766  21.046 1.00 23.79  ? 139 A   A N7    1 
ATOM   6093 C  C5    . A   B  1 125 ? 41.846  67.465  22.091 1.00 21.88  ? 139 A   A C5    1 
ATOM   6094 C  C6    . A   B  1 125 ? 40.796  68.386  22.145 1.00 23.38  ? 139 A   A C6    1 
ATOM   6095 N  N6    . A   B  1 125 ? 40.105  68.804  21.081 1.00 23.63  ? 139 A   A N6    1 
ATOM   6096 N  N1    . A   B  1 125 ? 40.482  68.890  23.359 1.00 23.17  ? 139 A   A N1    1 
ATOM   6097 C  C2    . A   B  1 125 ? 41.165  68.478  24.431 1.00 24.82  ? 139 A   A C2    1 
ATOM   6098 N  N3    . A   B  1 125 ? 42.174  67.620  24.514 1.00 23.90  ? 139 A   A N3    1 
ATOM   6099 C  C4    . A   B  1 125 ? 42.457  67.148  23.291 1.00 25.86  ? 139 A   A C4    1 
ATOM   6100 P  P     . U   B  1 126 ? 42.765  61.147  24.863 1.00 34.08  ? 140 U   A P     1 
ATOM   6101 O  OP1   . U   B  1 126 ? 43.044  60.125  25.901 1.00 34.59  ? 140 U   A OP1   1 
ATOM   6102 O  OP2   . U   B  1 126 ? 42.605  60.749  23.438 1.00 30.99  ? 140 U   A OP2   1 
ATOM   6103 O  "O5'" . U   B  1 126 ? 41.543  62.050  25.288 1.00 29.11  ? 140 U   A "O5'" 1 
ATOM   6104 C  "C5'" . U   B  1 126 ? 41.469  62.482  26.637 1.00 31.85  ? 140 U   A "C5'" 1 
ATOM   6105 C  "C4'" . U   B  1 126 ? 40.327  63.434  26.835 1.00 27.35  ? 140 U   A "C4'" 1 
ATOM   6106 O  "O4'" . U   B  1 126 ? 40.558  64.628  26.051 1.00 27.42  ? 140 U   A "O4'" 1 
ATOM   6107 C  "C3'" . U   B  1 126 ? 38.974  62.939  26.353 1.00 29.73  ? 140 U   A "C3'" 1 
ATOM   6108 O  "O3'" . U   B  1 126 ? 38.332  62.088  27.287 1.00 30.85  ? 140 U   A "O3'" 1 
ATOM   6109 C  "C2'" . U   B  1 126 ? 38.219  64.234  26.110 1.00 25.82  ? 140 U   A "C2'" 1 
ATOM   6110 O  "O2'" . U   B  1 126 ? 37.728  64.779  27.323 1.00 32.51  ? 140 U   A "O2'" 1 
ATOM   6111 C  "C1'" . U   B  1 126 ? 39.329  65.151  25.602 1.00 27.36  ? 140 U   A "C1'" 1 
ATOM   6112 N  N1    . U   B  1 126 ? 39.310  65.250  24.132 1.00 26.05  ? 140 U   A N1    1 
ATOM   6113 C  C2    . U   B  1 126 ? 38.383  66.121  23.585 1.00 25.64  ? 140 U   A C2    1 
ATOM   6114 O  O2    . U   B  1 126 ? 37.607  66.776  24.260 1.00 26.61  ? 140 U   A O2    1 
ATOM   6115 N  N3    . U   B  1 126 ? 38.379  66.186  22.214 1.00 24.95  ? 140 U   A N3    1 
ATOM   6116 C  C4    . U   B  1 126 ? 39.197  65.476  21.361 1.00 25.50  ? 140 U   A C4    1 
ATOM   6117 O  O4    . U   B  1 126 ? 39.076  65.657  20.148 1.00 24.17  ? 140 U   A O4    1 
ATOM   6118 C  C5    . U   B  1 126 ? 40.132  64.596  22.006 1.00 27.80  ? 140 U   A C5    1 
ATOM   6119 C  C6    . U   B  1 126 ? 40.163  64.510  23.346 1.00 27.54  ? 140 U   A C6    1 
ATOM   6120 P  P     . G   B  1 127 ? 37.706  60.698  26.801 1.00 35.64  ? 141 G   A P     1 
ATOM   6121 O  OP1   . G   B  1 127 ? 36.827  60.225  27.906 1.00 40.15  ? 141 G   A OP1   1 
ATOM   6122 O  OP2   . G   B  1 127 ? 38.819  59.860  26.307 1.00 31.58  ? 141 G   A OP2   1 
ATOM   6123 O  "O5'" . G   B  1 127 ? 36.819  61.110  25.554 1.00 35.16  ? 141 G   A "O5'" 1 
ATOM   6124 C  "C5'" . G   B  1 127 ? 35.531  61.664  25.714 1.00 31.66  ? 141 G   A "C5'" 1 
ATOM   6125 C  "C4'" . G   B  1 127 ? 35.073  62.317  24.437 1.00 32.07  ? 141 G   A "C4'" 1 
ATOM   6126 O  "O4'" . G   B  1 127 ? 36.147  63.116  23.881 1.00 29.40  ? 141 G   A "O4'" 1 
ATOM   6127 C  "C3'" . G   B  1 127 ? 34.699  61.385  23.293 1.00 32.81  ? 141 G   A "C3'" 1 
ATOM   6128 O  "O3'" . G   B  1 127 ? 33.420  60.790  23.443 1.00 32.84  ? 141 G   A "O3'" 1 
ATOM   6129 C  "C2'" . G   B  1 127 ? 34.805  62.322  22.098 1.00 29.22  ? 141 G   A "C2'" 1 
ATOM   6130 O  "O2'" . G   B  1 127 ? 33.717  63.234  22.074 1.00 30.44  ? 141 G   A "O2'" 1 
ATOM   6131 C  "C1'" . G   B  1 127 ? 36.066  63.097  22.471 1.00 28.66  ? 141 G   A "C1'" 1 
ATOM   6132 N  N9    . G   B  1 127 ? 37.256  62.410  21.945 1.00 24.15  ? 141 G   A N9    1 
ATOM   6133 C  C8    . G   B  1 127 ? 38.156  61.669  22.665 1.00 28.76  ? 141 G   A C8    1 
ATOM   6134 N  N7    . G   B  1 127 ? 39.108  61.166  21.919 1.00 28.10  ? 141 G   A N7    1 
ATOM   6135 C  C5    . G   B  1 127 ? 38.804  61.593  20.634 1.00 27.41  ? 141 G   A C5    1 
ATOM   6136 C  C6    . G   B  1 127 ? 39.480  61.355  19.408 1.00 25.31  ? 141 G   A C6    1 
ATOM   6137 O  O6    . G   B  1 127 ? 40.511  60.703  19.216 1.00 24.29  ? 141 G   A O6    1 
ATOM   6138 N  N1    . G   B  1 127 ? 38.830  61.962  18.343 1.00 25.89  ? 141 G   A N1    1 
ATOM   6139 C  C2    . G   B  1 127 ? 37.688  62.706  18.438 1.00 25.11  ? 141 G   A C2    1 
ATOM   6140 N  N2    . G   B  1 127 ? 37.222  63.213  17.284 1.00 28.95  ? 141 G   A N2    1 
ATOM   6141 N  N3    . G   B  1 127 ? 37.055  62.945  19.573 1.00 27.41  ? 141 G   A N3    1 
ATOM   6142 C  C4    . G   B  1 127 ? 37.663  62.357  20.629 1.00 27.23  ? 141 G   A C4    1 
ATOM   6143 P  P     . C   B  1 128 ? 33.080  59.363  22.790 1.00 35.18  ? 142 C   A P     1 
ATOM   6144 O  OP1   . C   B  1 128 ? 31.658  59.141  23.160 1.00 39.06  ? 142 C   A OP1   1 
ATOM   6145 O  OP2   . C   B  1 128 ? 34.085  58.342  23.159 1.00 29.15  ? 142 C   A OP2   1 
ATOM   6146 O  "O5'" . C   B  1 128 ? 33.220  59.655  21.238 1.00 30.93  ? 142 C   A "O5'" 1 
ATOM   6147 C  "C5'" . C   B  1 128 ? 32.322  60.488  20.521 1.00 33.57  ? 142 C   A "C5'" 1 
ATOM   6148 C  "C4'" . C   B  1 128 ? 32.720  60.525  19.068 1.00 34.31  ? 142 C   A "C4'" 1 
ATOM   6149 O  "O4'" . C   B  1 128 ? 34.099  60.966  18.949 1.00 31.30  ? 142 C   A "O4'" 1 
ATOM   6150 C  "C3'" . C   B  1 128 ? 32.730  59.181  18.359 1.00 32.10  ? 142 C   A "C3'" 1 
ATOM   6151 O  "O3'" . C   B  1 128 ? 31.434  58.734  17.994 1.00 33.72  ? 142 C   A "O3'" 1 
ATOM   6152 C  "C2'" . C   B  1 128 ? 33.671  59.439  17.188 1.00 33.91  ? 142 C   A "C2'" 1 
ATOM   6153 O  "O2'" . C   B  1 128 ? 33.022  60.210  16.190 1.00 34.06  ? 142 C   A "O2'" 1 
ATOM   6154 C  "C1'" . C   B  1 128 ? 34.722  60.331  17.851 1.00 31.33  ? 142 C   A "C1'" 1 
ATOM   6155 N  N1    . C   B  1 128 ? 35.935  59.614  18.327 1.00 29.89  ? 142 C   A N1    1 
ATOM   6156 C  C2    . C   B  1 128 ? 36.889  59.172  17.410 1.00 28.70  ? 142 C   A C2    1 
ATOM   6157 O  O2    . C   B  1 128 ? 36.714  59.369  16.195 1.00 31.35  ? 142 C   A O2    1 
ATOM   6158 N  N3    . C   B  1 128 ? 37.992  58.530  17.861 1.00 29.18  ? 142 C   A N3    1 
ATOM   6159 C  C4    . C   B  1 128 ? 38.161  58.330  19.166 1.00 27.38  ? 142 C   A C4    1 
ATOM   6160 N  N4    . C   B  1 128 ? 39.265  57.688  19.556 1.00 27.31  ? 142 C   A N4    1 
ATOM   6161 C  C5    . C   B  1 128 ? 37.204  58.763  20.121 1.00 27.89  ? 142 C   A C5    1 
ATOM   6162 C  C6    . C   B  1 128 ? 36.122  59.395  19.663 1.00 29.46  ? 142 C   A C6    1 
ATOM   6163 P  P     . C   B  1 129 ? 31.099  57.163  17.954 1.00 34.62  ? 143 C   A P     1 
ATOM   6164 O  OP1   . C   B  1 129 ? 29.642  57.166  17.677 1.00 39.84  ? 143 C   A OP1   1 
ATOM   6165 O  OP2   . C   B  1 129 ? 31.606  56.531  19.200 1.00 30.99  ? 143 C   A OP2   1 
ATOM   6166 O  "O5'" . C   B  1 129 ? 31.957  56.603  16.725 1.00 29.77  ? 143 C   A "O5'" 1 
ATOM   6167 C  "C5'" . C   B  1 129 ? 31.686  56.994  15.388 1.00 31.09  ? 143 C   A "C5'" 1 
ATOM   6168 C  "C4'" . C   B  1 129 ? 32.602  56.305  14.407 1.00 29.52  ? 143 C   A "C4'" 1 
ATOM   6169 O  "O4'" . C   B  1 129 ? 33.968  56.759  14.597 1.00 29.16  ? 143 C   A "O4'" 1 
ATOM   6170 C  "C3'" . C   B  1 129 ? 32.716  54.789  14.518 1.00 30.06  ? 143 C   A "C3'" 1 
ATOM   6171 O  "O3'" . C   B  1 129 ? 31.614  54.094  13.955 1.00 31.43  ? 143 C   A "O3'" 1 
ATOM   6172 C  "C2'" . C   B  1 129 ? 34.030  54.527  13.795 1.00 30.93  ? 143 C   A "C2'" 1 
ATOM   6173 O  "O2'" . C   B  1 129 ? 33.850  54.648  12.387 1.00 29.93  ? 143 C   A "O2'" 1 
ATOM   6174 C  "C1'" . C   B  1 129 ? 34.864  55.720  14.271 1.00 30.65  ? 143 C   A "C1'" 1 
ATOM   6175 N  N1    . C   B  1 129 ? 35.701  55.454  15.461 1.00 27.20  ? 143 C   A N1    1 
ATOM   6176 C  C2    . C   B  1 129 ? 36.914  54.805  15.266 1.00 30.76  ? 143 C   A C2    1 
ATOM   6177 O  O2    . C   B  1 129 ? 37.223  54.463  14.107 1.00 31.42  ? 143 C   A O2    1 
ATOM   6178 N  N3    . C   B  1 129 ? 37.714  54.555  16.333 1.00 30.47  ? 143 C   A N3    1 
ATOM   6179 C  C4    . C   B  1 129 ? 37.335  54.948  17.549 1.00 30.26  ? 143 C   A C4    1 
ATOM   6180 N  N4    . C   B  1 129 ? 38.169  54.685  18.564 1.00 25.87  ? 143 C   A N4    1 
ATOM   6181 C  C5    . C   B  1 129 ? 36.099  55.623  17.774 1.00 27.21  ? 143 C   A C5    1 
ATOM   6182 C  C6    . C   B  1 129 ? 35.317  55.854  16.711 1.00 30.54  ? 143 C   A C6    1 
ATOM   6183 P  P     . A   B  1 130 ? 31.192  52.632  14.485 1.00 31.23  ? 144 A   A P     1 
ATOM   6184 O  OP1   . A   B  1 130 ? 29.912  52.357  13.780 1.00 27.95  ? 144 A   A OP1   1 
ATOM   6185 O  OP2   . A   B  1 130 ? 31.192  52.634  15.965 1.00 29.55  ? 144 A   A OP2   1 
ATOM   6186 O  "O5'" . A   B  1 130 ? 32.342  51.715  13.875 1.00 31.62  ? 144 A   A "O5'" 1 
ATOM   6187 C  "C5'" . A   B  1 130 ? 32.365  51.505  12.471 1.00 29.34  ? 144 A   A "C5'" 1 
ATOM   6188 C  "C4'" . A   B  1 130 ? 33.458  50.547  12.088 1.00 30.02  ? 144 A   A "C4'" 1 
ATOM   6189 O  "O4'" . A   B  1 130 ? 34.746  51.152  12.368 1.00 28.66  ? 144 A   A "O4'" 1 
ATOM   6190 C  "C3'" . A   B  1 130 ? 33.482  49.242  12.867 1.00 30.20  ? 144 A   A "C3'" 1 
ATOM   6191 O  "O3'" . A   B  1 130 ? 32.558  48.275  12.383 1.00 30.75  ? 144 A   A "O3'" 1 
ATOM   6192 C  "C2'" . A   B  1 130 ? 34.944  48.822  12.762 1.00 30.29  ? 144 A   A "C2'" 1 
ATOM   6193 O  "O2'" . A   B  1 130 ? 35.227  48.262  11.487 1.00 30.72  ? 144 A   A "O2'" 1 
ATOM   6194 C  "C1'" . A   B  1 130 ? 35.647  50.179  12.850 1.00 28.42  ? 144 A   A "C1'" 1 
ATOM   6195 N  N9    . A   B  1 130 ? 36.013  50.538  14.235 1.00 29.61  ? 144 A   A N9    1 
ATOM   6196 C  C8    . A   B  1 130 ? 35.283  51.304  15.107 1.00 28.14  ? 144 A   A C8    1 
ATOM   6197 N  N7    . A   B  1 130 ? 35.859  51.467  16.273 1.00 27.57  ? 144 A   A N7    1 
ATOM   6198 C  C5    . A   B  1 130 ? 37.049  50.775  16.156 1.00 26.29  ? 144 A   A C5    1 
ATOM   6199 C  C6    . A   B  1 130 ? 38.107  50.580  17.058 1.00 24.95  ? 144 A   A C6    1 
ATOM   6200 N  N6    . A   B  1 130 ? 38.108  51.082  18.292 1.00 28.49  ? 144 A   A N6    1 
ATOM   6201 N  N1    . A   B  1 130 ? 39.145  49.828  16.655 1.00 27.85  ? 144 A   A N1    1 
ATOM   6202 C  C2    . A   B  1 130 ? 39.139  49.317  15.412 1.00 27.02  ? 144 A   A C2    1 
ATOM   6203 N  N3    . A   B  1 130 ? 38.204  49.446  14.469 1.00 28.94  ? 144 A   A N3    1 
ATOM   6204 C  C4    . A   B  1 130 ? 37.167  50.196  14.912 1.00 26.08  ? 144 A   A C4    1 
ATOM   6205 P  P     . U   B  1 131 ? 31.783  47.324  13.419 1.00 31.13  ? 145 U   A P     1 
ATOM   6206 O  OP1   . U   B  1 131 ? 30.820  46.549  12.586 1.00 36.72  ? 145 U   A OP1   1 
ATOM   6207 O  OP2   . U   B  1 131 ? 31.303  48.121  14.570 1.00 28.62  ? 145 U   A OP2   1 
ATOM   6208 O  "O5'" . U   B  1 131 ? 32.937  46.343  13.889 1.00 28.41  ? 145 U   A "O5'" 1 
ATOM   6209 C  "C5'" . U   B  1 131 ? 33.488  45.461  12.927 1.00 30.55  ? 145 U   A "C5'" 1 
ATOM   6210 C  "C4'" . U   B  1 131 ? 34.669  44.724  13.490 1.00 27.77  ? 145 U   A "C4'" 1 
ATOM   6211 O  "O4'" . U   B  1 131 ? 35.728  45.678  13.751 1.00 28.80  ? 145 U   A "O4'" 1 
ATOM   6212 C  "C3'" . U   B  1 131 ? 34.455  44.058  14.842 1.00 27.65  ? 145 U   A "C3'" 1 
ATOM   6213 O  "O3'" . U   B  1 131 ? 33.782  42.810  14.773 1.00 27.82  ? 145 U   A "O3'" 1 
ATOM   6214 C  "C2'" . U   B  1 131 ? 35.882  43.942  15.351 1.00 26.57  ? 145 U   A "C2'" 1 
ATOM   6215 O  "O2'" . U   B  1 131 ? 36.567  42.932  14.627 1.00 27.78  ? 145 U   A "O2'" 1 
ATOM   6216 C  "C1'" . U   B  1 131 ? 36.436  45.288  14.909 1.00 29.16  ? 145 U   A "C1'" 1 
ATOM   6217 N  N1    . U   B  1 131 ? 36.266  46.276  15.990 1.00 27.68  ? 145 U   A N1    1 
ATOM   6218 C  C2    . U   B  1 131 ? 37.271  46.311  16.946 1.00 26.46  ? 145 U   A C2    1 
ATOM   6219 O  O2    . U   B  1 131 ? 38.241  45.570  16.909 1.00 25.67  ? 145 U   A O2    1 
ATOM   6220 N  N3    . U   B  1 131 ? 37.090  47.224  17.945 1.00 23.36  ? 145 U   A N3    1 
ATOM   6221 C  C4    . U   B  1 131 ? 36.017  48.081  18.073 1.00 27.95  ? 145 U   A C4    1 
ATOM   6222 O  O4    . U   B  1 131 ? 35.987  48.853  19.023 1.00 26.13  ? 145 U   A O4    1 
ATOM   6223 C  C5    . U   B  1 131 ? 35.020  47.983  17.048 1.00 26.61  ? 145 U   A C5    1 
ATOM   6224 C  C6    . U   B  1 131 ? 35.174  47.099  16.062 1.00 27.68  ? 145 U   A C6    1 
ATOM   6225 P  P     . A   B  1 132 ? 32.782  42.394  15.964 1.00 32.51  ? 146 A   A P     1 
ATOM   6226 O  OP1   . A   B  1 132 ? 32.090  41.215  15.396 1.00 31.43  ? 146 A   A OP1   1 
ATOM   6227 O  OP2   . A   B  1 132 ? 31.969  43.565  16.409 1.00 29.54  ? 146 A   A OP2   1 
ATOM   6228 O  "O5'" . A   B  1 132 ? 33.777  41.979  17.131 1.00 30.81  ? 146 A   A "O5'" 1 
ATOM   6229 C  "C5'" . A   B  1 132 ? 34.708  40.914  16.982 1.00 29.07  ? 146 A   A "C5'" 1 
ATOM   6230 C  "C4'" . A   B  1 132 ? 35.623  40.817  18.178 1.00 28.83  ? 146 A   A "C4'" 1 
ATOM   6231 O  "O4'" . A   B  1 132 ? 36.469  41.998  18.246 1.00 32.95  ? 146 A   A "O4'" 1 
ATOM   6232 C  "C3'" . A   B  1 132 ? 34.954  40.778  19.542 1.00 28.95  ? 146 A   A "C3'" 1 
ATOM   6233 O  "O3'" . A   B  1 132 ? 34.444  39.500  19.888 1.00 30.27  ? 146 A   A "O3'" 1 
ATOM   6234 C  "C2'" . A   B  1 132 ? 36.080  41.231  20.457 1.00 29.01  ? 146 A   A "C2'" 1 
ATOM   6235 O  "O2'" . A   B  1 132 ? 37.006  40.173  20.657 1.00 32.95  ? 146 A   A "O2'" 1 
ATOM   6236 C  "C1'" . A   B  1 132 ? 36.744  42.303  19.594 1.00 26.41  ? 146 A   A "C1'" 1 
ATOM   6237 N  N9    . A   B  1 132 ? 36.202  43.632  19.895 1.00 25.47  ? 146 A   A N9    1 
ATOM   6238 C  C8    . A   B  1 132 ? 35.210  44.313  19.242 1.00 28.57  ? 146 A   A C8    1 
ATOM   6239 N  N7    . A   B  1 132 ? 34.937  45.482  19.765 1.00 25.98  ? 146 A   A N7    1 
ATOM   6240 C  C5    . A   B  1 132 ? 35.803  45.575  20.839 1.00 25.48  ? 146 A   A C5    1 
ATOM   6241 C  C6    . A   B  1 132 ? 36.014  46.589  21.787 1.00 26.77  ? 146 A   A C6    1 
ATOM   6242 N  N6    . A   B  1 132 ? 35.335  47.742  21.808 1.00 23.47  ? 146 A   A N6    1 
ATOM   6243 N  N1    . A   B  1 132 ? 36.962  46.372  22.724 1.00 27.80  ? 146 A   A N1    1 
ATOM   6244 C  C2    . A   B  1 132 ? 37.640  45.219  22.695 1.00 27.98  ? 146 A   A C2    1 
ATOM   6245 N  N3    . A   B  1 132 ? 37.536  44.193  21.853 1.00 30.08  ? 146 A   A N3    1 
ATOM   6246 C  C4    . A   B  1 132 ? 36.588  44.445  20.932 1.00 28.85  ? 146 A   A C4    1 
ATOM   6247 P  P     . C   B  1 133 ? 33.138  39.341  20.827 1.00 32.90  ? 147 C   A P     1 
ATOM   6248 O  OP1   . C   B  1 133 ? 32.839  37.904  20.617 1.00 30.27  ? 147 C   A OP1   1 
ATOM   6249 O  OP2   . C   B  1 133 ? 32.095  40.360  20.530 1.00 32.10  ? 147 C   A OP2   1 
ATOM   6250 O  "O5'" . C   B  1 133 ? 33.696  39.598  22.283 1.00 26.88  ? 147 C   A "O5'" 1 
ATOM   6251 C  "C5'" . C   B  1 133 ? 34.687  38.736  22.809 1.00 29.82  ? 147 C   A "C5'" 1 
ATOM   6252 C  "C4'" . C   B  1 133 ? 35.336  39.338  24.026 1.00 27.84  ? 147 C   A "C4'" 1 
ATOM   6253 O  "O4'" . C   B  1 133 ? 36.034  40.558  23.669 1.00 31.11  ? 147 C   A "O4'" 1 
ATOM   6254 C  "C3'" . C   B  1 133 ? 34.404  39.792  25.138 1.00 26.42  ? 147 C   A "C3'" 1 
ATOM   6255 O  "O3'" . C   B  1 133 ? 33.924  38.727  25.923 1.00 25.83  ? 147 C   A "O3'" 1 
ATOM   6256 C  "C2'" . C   B  1 133 ? 35.312  40.726  25.920 1.00 26.44  ? 147 C   A "C2'" 1 
ATOM   6257 O  "O2'" . C   B  1 133 ? 36.297  39.973  26.604 1.00 28.33  ? 147 C   A "O2'" 1 
ATOM   6258 C  "C1'" . C   B  1 133 ? 36.002  41.445  24.768 1.00 25.46  ? 147 C   A "C1'" 1 
ATOM   6259 N  N1    . C   B  1 133 ? 35.236  42.654  24.429 1.00 26.03  ? 147 C   A N1    1 
ATOM   6260 C  C2    . C   B  1 133 ? 35.467  43.769  25.245 1.00 24.48  ? 147 C   A C2    1 
ATOM   6261 O  O2    . C   B  1 133 ? 36.271  43.675  26.193 1.00 23.58  ? 147 C   A O2    1 
ATOM   6262 N  N3    . C   B  1 133 ? 34.812  44.901  24.986 1.00 22.11  ? 147 C   A N3    1 
ATOM   6263 C  C4    . C   B  1 133 ? 33.947  44.963  23.979 1.00 25.41  ? 147 C   A C4    1 
ATOM   6264 N  N4    . C   B  1 133 ? 33.339  46.131  23.794 1.00 23.09  ? 147 C   A N4    1 
ATOM   6265 C  C5    . C   B  1 133 ? 33.690  43.848  23.128 1.00 25.38  ? 147 C   A C5    1 
ATOM   6266 C  C6    . C   B  1 133 ? 34.351  42.712  23.385 1.00 25.42  ? 147 C   A C6    1 
ATOM   6267 P  P     . A   B  1 134 ? 32.472  38.844  26.577 1.00 27.65  ? 148 A   A P     1 
ATOM   6268 O  OP1   . A   B  1 134 ? 32.322  37.496  27.180 1.00 29.32  ? 148 A   A OP1   1 
ATOM   6269 O  OP2   . A   B  1 134 ? 31.505  39.421  25.616 1.00 25.34  ? 148 A   A OP2   1 
ATOM   6270 O  "O5'" . A   B  1 134 ? 32.755  39.906  27.724 1.00 25.94  ? 148 A   A "O5'" 1 
ATOM   6271 C  "C5'" . A   B  1 134 ? 33.588  39.605  28.825 1.00 23.50  ? 148 A   A "C5'" 1 
ATOM   6272 C  "C4'" . A   B  1 134 ? 33.646  40.799  29.743 1.00 25.57  ? 148 A   A "C4'" 1 
ATOM   6273 O  "O4'" . A   B  1 134 ? 34.231  41.920  29.037 1.00 24.88  ? 148 A   A "O4'" 1 
ATOM   6274 C  "C3'" . A   B  1 134 ? 32.306  41.356  30.189 1.00 25.72  ? 148 A   A "C3'" 1 
ATOM   6275 O  "O3'" . A   B  1 134 ? 31.722  40.601  31.228 1.00 30.02  ? 148 A   A "O3'" 1 
ATOM   6276 C  "C2'" . A   B  1 134 ? 32.692  42.761  30.622 1.00 26.38  ? 148 A   A "C2'" 1 
ATOM   6277 O  "O2'" . A   B  1 134 ? 33.433  42.676  31.830 1.00 26.28  ? 148 A   A "O2'" 1 
ATOM   6278 C  "C1'" . A   B  1 134 ? 33.660  43.123  29.499 1.00 25.48  ? 148 A   A "C1'" 1 
ATOM   6279 N  N9    . A   B  1 134 ? 32.962  43.779  28.380 1.00 23.36  ? 148 A   A N9    1 
ATOM   6280 C  C8    . A   B  1 134 ? 32.527  43.245  27.190 1.00 24.16  ? 148 A   A C8    1 
ATOM   6281 N  N7    . A   B  1 134 ? 31.933  44.121  26.416 1.00 22.01  ? 148 A   A N7    1 
ATOM   6282 C  C5    . A   B  1 134 ? 31.971  45.310  27.142 1.00 23.77  ? 148 A   A C5    1 
ATOM   6283 C  C6    . A   B  1 134 ? 31.510  46.622  26.897 1.00 24.45  ? 148 A   A C6    1 
ATOM   6284 N  N6    . A   B  1 134 ? 30.880  47.037  25.786 1.00 18.83  ? 148 A   A N6    1 
ATOM   6285 N  N1    . A   B  1 134 ? 31.739  47.546  27.864 1.00 23.41  ? 148 A   A N1    1 
ATOM   6286 C  C2    . A   B  1 134 ? 32.380  47.179  28.975 1.00 24.71  ? 148 A   A C2    1 
ATOM   6287 N  N3    . A   B  1 134 ? 32.854  45.988  29.324 1.00 23.87  ? 148 A   A N3    1 
ATOM   6288 C  C4    . A   B  1 134 ? 32.609  45.096  28.355 1.00 23.26  ? 148 A   A C4    1 
ATOM   6289 P  P     . G   B  1 135 ? 30.128  40.522  31.333 1.00 29.44  ? 149 G   A P     1 
ATOM   6290 O  OP1   . G   B  1 135 ? 30.041  39.310  32.193 1.00 27.22  ? 149 G   A OP1   1 
ATOM   6291 O  OP2   . G   B  1 135 ? 29.497  40.586  29.986 1.00 27.86  ? 149 G   A OP2   1 
ATOM   6292 O  "O5'" . G   B  1 135 ? 29.672  41.831  32.106 1.00 28.65  ? 149 G   A "O5'" 1 
ATOM   6293 C  "C5'" . G   B  1 135 ? 30.202  42.124  33.384 1.00 29.37  ? 149 G   A "C5'" 1 
ATOM   6294 C  "C4'" . G   B  1 135 ? 29.981  43.577  33.711 1.00 30.16  ? 149 G   A "C4'" 1 
ATOM   6295 O  "O4'" . G   B  1 135 ? 30.670  44.418  32.744 1.00 25.94  ? 149 G   A "O4'" 1 
ATOM   6296 C  "C3'" . G   B  1 135 ? 28.546  44.085  33.663 1.00 27.88  ? 149 G   A "C3'" 1 
ATOM   6297 O  "O3'" . G   B  1 135 ? 27.775  43.724  34.795 1.00 30.04  ? 149 G   A "O3'" 1 
ATOM   6298 C  "C2'" . G   B  1 135 ? 28.775  45.582  33.577 1.00 27.27  ? 149 G   A "C2'" 1 
ATOM   6299 O  "O2'" . G   B  1 135 ? 29.232  46.064  34.833 1.00 32.40  ? 149 G   A "O2'" 1 
ATOM   6300 C  "C1'" . G   B  1 135 ? 29.955  45.626  32.609 1.00 28.14  ? 149 G   A "C1'" 1 
ATOM   6301 N  N9    . G   B  1 135 ? 29.477  45.755  31.227 1.00 24.17  ? 149 G   A N9    1 
ATOM   6302 C  C8    . G   B  1 135 ? 29.363  44.784  30.259 1.00 24.94  ? 149 G   A C8    1 
ATOM   6303 N  N7    . G   B  1 135 ? 28.895  45.265  29.134 1.00 24.64  ? 149 G   A N7    1 
ATOM   6304 C  C5    . G   B  1 135 ? 28.685  46.614  29.396 1.00 23.35  ? 149 G   A C5    1 
ATOM   6305 C  C6    . G   B  1 135 ? 28.188  47.657  28.579 1.00 24.47  ? 149 G   A C6    1 
ATOM   6306 O  O6    . G   B  1 135 ? 27.825  47.583  27.402 1.00 24.84  ? 149 G   A O6    1 
ATOM   6307 N  N1    . G   B  1 135 ? 28.132  48.877  29.254 1.00 22.79  ? 149 G   A N1    1 
ATOM   6308 C  C2    . G   B  1 135 ? 28.533  49.084  30.552 1.00 24.84  ? 149 G   A C2    1 
ATOM   6309 N  N2    . G   B  1 135 ? 28.409  50.334  31.037 1.00 20.80  ? 149 G   A N2    1 
ATOM   6310 N  N3    . G   B  1 135 ? 28.996  48.121  31.324 1.00 23.18  ? 149 G   A N3    1 
ATOM   6311 C  C4    . G   B  1 135 ? 29.037  46.930  30.686 1.00 26.10  ? 149 G   A C4    1 
ATOM   6312 P  P     . U   B  1 136 ? 26.179  43.540  34.673 1.00 32.69  ? 150 U   A P     1 
ATOM   6313 O  OP1   . U   B  1 136 ? 25.778  43.182  36.063 1.00 33.44  ? 150 U   A OP1   1 
ATOM   6314 O  OP2   . U   B  1 136 ? 25.897  42.574  33.582 1.00 33.13  ? 150 U   A OP2   1 
ATOM   6315 O  "O5'" . U   B  1 136 ? 25.623  44.962  34.250 1.00 29.23  ? 150 U   A "O5'" 1 
ATOM   6316 C  "C5'" . U   B  1 136 ? 25.607  46.095  35.104 1.00 31.58  ? 150 U   A "C5'" 1 
ATOM   6317 C  "C4'" . U   B  1 136 ? 25.176  47.330  34.355 1.00 28.89  ? 150 U   A "C4'" 1 
ATOM   6318 O  "O4'" . U   B  1 136 ? 26.090  47.569  33.257 1.00 25.23  ? 150 U   A "O4'" 1 
ATOM   6319 C  "C3'" . U   B  1 136 ? 23.815  47.285  33.672 1.00 29.71  ? 150 U   A "C3'" 1 
ATOM   6320 O  "O3'" . U   B  1 136 ? 22.723  47.502  34.547 1.00 31.15  ? 150 U   A "O3'" 1 
ATOM   6321 C  "C2'" . U   B  1 136 ? 23.960  48.366  32.609 1.00 28.40  ? 150 U   A "C2'" 1 
ATOM   6322 O  "O2'" . U   B  1 136 ? 23.908  49.658  33.187 1.00 29.17  ? 150 U   A "O2'" 1 
ATOM   6323 C  "C1'" . U   B  1 136 ? 25.395  48.126  32.156 1.00 27.17  ? 150 U   A "C1'" 1 
ATOM   6324 N  N1    . U   B  1 136 ? 25.394  47.179  31.013 1.00 25.78  ? 150 U   A N1    1 
ATOM   6325 C  C2    . U   B  1 136 ? 25.053  47.663  29.763 1.00 25.56  ? 150 U   A C2    1 
ATOM   6326 O  O2    . U   B  1 136 ? 24.765  48.826  29.553 1.00 27.13  ? 150 U   A O2    1 
ATOM   6327 N  N3    . U   B  1 136 ? 25.062  46.730  28.748 1.00 27.39  ? 150 U   A N3    1 
ATOM   6328 C  C4    . U   B  1 136 ? 25.367  45.390  28.855 1.00 24.80  ? 150 U   A C4    1 
ATOM   6329 O  O4    . U   B  1 136 ? 25.332  44.675  27.847 1.00 24.75  ? 150 U   A O4    1 
ATOM   6330 C  C5    . U   B  1 136 ? 25.699  44.965  30.182 1.00 26.54  ? 150 U   A C5    1 
ATOM   6331 C  C6    . U   B  1 136 ? 25.696  45.850  31.194 1.00 25.19  ? 150 U   A C6    1 
ATOM   6332 P  P     . G   B  1 137 ? 21.334  46.727  34.310 1.00 32.39  ? 151 G   A P     1 
ATOM   6333 O  OP1   . G   B  1 137 ? 20.467  47.049  35.472 1.00 32.82  ? 151 G   A OP1   1 
ATOM   6334 O  OP2   . G   B  1 137 ? 21.602  45.304  33.990 1.00 29.68  ? 151 G   A OP2   1 
ATOM   6335 O  "O5'" . G   B  1 137 ? 20.782  47.499  33.041 1.00 30.93  ? 151 G   A "O5'" 1 
ATOM   6336 C  "C5'" . G   B  1 137 ? 20.517  48.886  33.091 1.00 29.53  ? 151 G   A "C5'" 1 
ATOM   6337 C  "C4'" . G   B  1 137 ? 20.268  49.428  31.711 1.00 30.69  ? 151 G   A "C4'" 1 
ATOM   6338 O  "O4'" . G   B  1 137 ? 21.411  49.153  30.859 1.00 28.70  ? 151 G   A "O4'" 1 
ATOM   6339 C  "C3'" . G   B  1 137 ? 19.093  48.813  30.964 1.00 31.98  ? 151 G   A "C3'" 1 
ATOM   6340 O  "O3'" . G   B  1 137 ? 17.846  49.368  31.350 1.00 32.49  ? 151 G   A "O3'" 1 
ATOM   6341 C  "C2'" . G   B  1 137 ? 19.449  49.086  29.508 1.00 28.98  ? 151 G   A "C2'" 1 
ATOM   6342 O  "O2'" . G   B  1 137 ? 19.170  50.438  29.161 1.00 28.65  ? 151 G   A "O2'" 1 
ATOM   6343 C  "C1'" . G   B  1 137 ? 20.969  48.907  29.537 1.00 27.53  ? 151 G   A "C1'" 1 
ATOM   6344 N  N9    . G   B  1 137 ? 21.363  47.541  29.146 1.00 22.75  ? 151 G   A N9    1 
ATOM   6345 C  C8    . G   B  1 137 ? 21.719  46.511  29.977 1.00 25.45  ? 151 G   A C8    1 
ATOM   6346 N  N7    . G   B  1 137 ? 22.009  45.423  29.323 1.00 25.26  ? 151 G   A N7    1 
ATOM   6347 C  C5    . G   B  1 137 ? 21.820  45.759  27.988 1.00 25.35  ? 151 G   A C5    1 
ATOM   6348 C  C6    . G   B  1 137 ? 21.981  44.987  26.811 1.00 19.48  ? 151 G   A C6    1 
ATOM   6349 O  O6    . G   B  1 137 ? 22.336  43.817  26.732 1.00 22.27  ? 151 G   A O6    1 
ATOM   6350 N  N1    . G   B  1 137 ? 21.676  45.690  25.655 1.00 20.78  ? 151 G   A N1    1 
ATOM   6351 C  C2    . G   B  1 137 ? 21.285  46.999  25.618 1.00 22.67  ? 151 G   A C2    1 
ATOM   6352 N  N2    . G   B  1 137 ? 21.053  47.501  24.396 1.00 19.66  ? 151 G   A N2    1 
ATOM   6353 N  N3    . G   B  1 137 ? 21.128  47.743  26.711 1.00 24.23  ? 151 G   A N3    1 
ATOM   6354 C  C4    . G   B  1 137 ? 21.421  47.063  27.854 1.00 23.62  ? 151 G   A C4    1 
ATOM   6355 P  P     . C   B  1 138 ? 16.498  48.521  31.110 1.00 33.72  ? 152 C   A P     1 
ATOM   6356 O  OP1   . C   B  1 138 ? 15.424  49.375  31.682 1.00 38.15  ? 152 C   A OP1   1 
ATOM   6357 O  OP2   . C   B  1 138 ? 16.662  47.128  31.590 1.00 27.87  ? 152 C   A OP2   1 
ATOM   6358 O  "O5'" . C   B  1 138 ? 16.432  48.557  29.526 1.00 31.73  ? 152 C   A "O5'" 1 
ATOM   6359 C  "C5'" . C   B  1 138 ? 15.832  47.511  28.785 1.00 30.47  ? 152 C   A "C5'" 1 
ATOM   6360 C  "C4'" . C   B  1 138 ? 16.178  47.644  27.325 1.00 28.13  ? 152 C   A "C4'" 1 
ATOM   6361 O  "O4'" . C   B  1 138 ? 17.561  47.264  27.126 1.00 23.96  ? 152 C   A "O4'" 1 
ATOM   6362 C  "C3'" . C   B  1 138 ? 15.414  46.709  26.408 1.00 22.90  ? 152 C   A "C3'" 1 
ATOM   6363 O  "O3'" . C   B  1 138 ? 14.144  47.230  26.084 1.00 22.02  ? 152 C   A "O3'" 1 
ATOM   6364 C  "C2'" . C   B  1 138 ? 16.349  46.568  25.214 1.00 20.25  ? 152 C   A "C2'" 1 
ATOM   6365 O  "O2'" . C   B  1 138 ? 16.312  47.727  24.395 1.00 22.32  ? 152 C   A "O2'" 1 
ATOM   6366 C  "C1'" . C   B  1 138 ? 17.702  46.569  25.908 1.00 22.29  ? 152 C   A "C1'" 1 
ATOM   6367 N  N1    . C   B  1 138 ? 18.247  45.238  26.182 1.00 22.58  ? 152 C   A N1    1 
ATOM   6368 C  C2    . C   B  1 138 ? 18.557  44.428  25.090 1.00 20.07  ? 152 C   A C2    1 
ATOM   6369 O  O2    . C   B  1 138 ? 18.340  44.860  23.932 1.00 19.45  ? 152 C   A O2    1 
ATOM   6370 N  N3    . C   B  1 138 ? 19.091  43.217  25.327 1.00 17.91  ? 152 C   A N3    1 
ATOM   6371 C  C4    . C   B  1 138 ? 19.323  42.787  26.575 1.00 21.06  ? 152 C   A C4    1 
ATOM   6372 N  N4    . C   B  1 138 ? 19.841  41.560  26.730 1.00 18.12  ? 152 C   A N4    1 
ATOM   6373 C  C5    . C   B  1 138 ? 19.006  43.597  27.708 1.00 21.30  ? 152 C   A C5    1 
ATOM   6374 C  C6    . C   B  1 138 ? 18.482  44.812  27.462 1.00 23.00  ? 152 C   A C6    1 
ATOM   6375 P  P     . U   B  1 139 ? 12.845  46.292  26.040 1.00 25.37  ? 153 U   A P     1 
ATOM   6376 O  OP1   . U   B  1 139 ? 11.778  47.301  25.866 1.00 23.82  ? 153 U   A OP1   1 
ATOM   6377 O  OP2   . U   B  1 139 ? 12.857  45.397  27.216 1.00 23.54  ? 153 U   A OP2   1 
ATOM   6378 O  "O5'" . U   B  1 139 ? 12.966  45.445  24.703 1.00 21.86  ? 153 U   A "O5'" 1 
ATOM   6379 C  "C5'" . U   B  1 139 ? 12.643  46.063  23.468 1.00 20.17  ? 153 U   A "C5'" 1 
ATOM   6380 C  "C4'" . U   B  1 139 ? 13.075  45.190  22.326 1.00 17.50  ? 153 U   A "C4'" 1 
ATOM   6381 O  "O4'" . U   B  1 139 ? 14.489  44.886  22.452 1.00 18.48  ? 153 U   A "O4'" 1 
ATOM   6382 C  "C3'" . U   B  1 139 ? 12.423  43.817  22.301 1.00 15.90  ? 153 U   A "C3'" 1 
ATOM   6383 O  "O3'" . U   B  1 139 ? 11.127  43.838  21.738 1.00 17.72  ? 153 U   A "O3'" 1 
ATOM   6384 C  "C2'" . U   B  1 139 ? 13.414  42.984  21.513 1.00 18.34  ? 153 U   A "C2'" 1 
ATOM   6385 O  "O2'" . U   B  1 139 ? 13.330  43.332  20.141 1.00 19.45  ? 153 U   A "O2'" 1 
ATOM   6386 C  "C1'" . U   B  1 139 ? 14.725  43.551  22.049 1.00 17.93  ? 153 U   A "C1'" 1 
ATOM   6387 N  N1    . U   B  1 139 ? 15.270  42.794  23.191 1.00 16.55  ? 153 U   A N1    1 
ATOM   6388 C  C2    . U   B  1 139 ? 15.885  41.606  22.882 1.00 16.37  ? 153 U   A C2    1 
ATOM   6389 O  O2    . U   B  1 139 ? 15.921  41.193  21.742 1.00 18.98  ? 153 U   A O2    1 
ATOM   6390 N  N3    . U   B  1 139 ? 16.432  40.928  23.932 1.00 17.14  ? 153 U   A N3    1 
ATOM   6391 C  C4    . U   B  1 139 ? 16.422  41.327  25.248 1.00 18.51  ? 153 U   A C4    1 
ATOM   6392 O  O4    . U   B  1 139 ? 16.953  40.607  26.090 1.00 17.22  ? 153 U   A O4    1 
ATOM   6393 C  C5    . U   B  1 139 ? 15.771  42.577  25.494 1.00 18.60  ? 153 U   A C5    1 
ATOM   6394 C  C6    . U   B  1 139 ? 15.245  43.267  24.477 1.00 19.94  ? 153 U   A C6    1 
ATOM   6395 P  P     . A   B  1 140 ? 10.023  42.840  22.325 1.00 22.21  ? 154 A   A P     1 
ATOM   6396 O  OP1   . A   B  1 140 ? 8.801   43.306  21.612 1.00 20.18  ? 154 A   A OP1   1 
ATOM   6397 O  OP2   . A   B  1 140 ? 10.123  42.830  23.810 1.00 21.10  ? 154 A   A OP2   1 
ATOM   6398 O  "O5'" . A   B  1 140 ? 10.438  41.404  21.813 1.00 20.81  ? 154 A   A "O5'" 1 
ATOM   6399 C  "C5'" . A   B  1 140 ? 10.473  41.102  20.431 1.00 18.78  ? 154 A   A "C5'" 1 
ATOM   6400 C  "C4'" . A   B  1 140 ? 11.189  39.797  20.207 1.00 17.96  ? 154 A   A "C4'" 1 
ATOM   6401 O  "O4'" . A   B  1 140 ? 12.579  39.923  20.614 1.00 17.24  ? 154 A   A "O4'" 1 
ATOM   6402 C  "C3'" . A   B  1 140 ? 10.668  38.619  21.018 1.00 17.76  ? 154 A   A "C3'" 1 
ATOM   6403 O  "O3'" . A   B  1 140 ? 9.497   38.041  20.461 1.00 17.09  ? 154 A   A "O3'" 1 
ATOM   6404 C  "C2'" . A   B  1 140 ? 11.878  37.701  21.051 1.00 15.93  ? 154 A   A "C2'" 1 
ATOM   6405 O  "O2'" . A   B  1 140 ? 12.047  37.049  19.806 1.00 17.32  ? 154 A   A "O2'" 1 
ATOM   6406 C  "C1'" . A   B  1 140 ? 13.014  38.710  21.196 1.00 15.64  ? 154 A   A "C1'" 1 
ATOM   6407 N  N9    . A   B  1 140 ? 13.296  38.955  22.620 1.00 18.76  ? 154 A   A N9    1 
ATOM   6408 C  C8    . A   B  1 140 ? 12.869  39.995  23.409 1.00 19.35  ? 154 A   A C8    1 
ATOM   6409 N  N7    . A   B  1 140 ? 13.309  39.908  24.650 1.00 17.87  ? 154 A   A N7    1 
ATOM   6410 C  C5    . A   B  1 140 ? 14.054  38.743  24.667 1.00 16.87  ? 154 A   A C5    1 
ATOM   6411 C  C6    . A   B  1 140 ? 14.792  38.086  25.671 1.00 19.31  ? 154 A   A C6    1 
ATOM   6412 N  N6    . A   B  1 140 ? 14.902  38.524  26.942 1.00 17.31  ? 154 A   A N6    1 
ATOM   6413 N  N1    . A   B  1 140 ? 15.424  36.943  25.321 1.00 16.92  ? 154 A   A N1    1 
ATOM   6414 C  C2    . A   B  1 140 ? 15.331  36.476  24.068 1.00 18.82  ? 154 A   A C2    1 
ATOM   6415 N  N3    . A   B  1 140 ? 14.669  37.013  23.039 1.00 17.70  ? 154 A   A N3    1 
ATOM   6416 C  C4    . A   B  1 140 ? 14.054  38.146  23.416 1.00 16.35  ? 154 A   A C4    1 
ATOM   6417 P  P     . A   B  1 141 ? 8.381   37.321  21.397 1.00 16.93  ? 155 A   A P     1 
ATOM   6418 O  OP1   . A   B  1 141 ? 7.684   38.328  22.220 1.00 17.14  ? 155 A   A OP1   1 
ATOM   6419 O  OP2   . A   B  1 141 ? 9.143   36.281  22.077 1.00 17.22  ? 155 A   A OP2   1 
ATOM   6420 O  "O5'" . A   B  1 141 ? 7.386   36.772  20.283 1.00 17.60  ? 155 A   A "O5'" 1 
ATOM   6421 C  "C5'" . A   B  1 141 ? 7.176   35.393  20.014 1.00 15.78  ? 155 A   A "C5'" 1 
ATOM   6422 C  "C4'" . A   B  1 141 ? 6.974   35.210  18.531 1.00 13.36  ? 155 A   A "C4'" 1 
ATOM   6423 O  "O4'" . A   B  1 141 ? 5.953   36.140  18.101 1.00 15.68  ? 155 A   A "O4'" 1 
ATOM   6424 C  "C3'" . A   B  1 141 ? 8.192   35.550  17.689 1.00 14.63  ? 155 A   A "C3'" 1 
ATOM   6425 O  "O3'" . A   B  1 141 ? 9.006   34.404  17.532 1.00 17.12  ? 155 A   A "O3'" 1 
ATOM   6426 C  "C2'" . A   B  1 141 ? 7.577   36.009  16.371 1.00 15.50  ? 155 A   A "C2'" 1 
ATOM   6427 O  "O2'" . A   B  1 141 ? 7.171   34.855  15.652 1.00 19.15  ? 155 A   A "O2'" 1 
ATOM   6428 C  "C1'" . A   B  1 141 ? 6.283   36.680  16.845 1.00 15.51  ? 155 A   A "C1'" 1 
ATOM   6429 N  N9    . A   B  1 141 ? 6.302   38.141  17.011 1.00 17.17  ? 155 A   A N9    1 
ATOM   6430 C  C8    . A   B  1 141 ? 6.809   38.888  18.040 1.00 16.68  ? 155 A   A C8    1 
ATOM   6431 N  N7    . A   B  1 141 ? 6.597   40.178  17.899 1.00 17.52  ? 155 A   A N7    1 
ATOM   6432 C  C5    . A   B  1 141 ? 5.895   40.268  16.697 1.00 18.25  ? 155 A   A C5    1 
ATOM   6433 C  C6    . A   B  1 141 ? 5.372   41.366  15.988 1.00 20.39  ? 155 A   A C6    1 
ATOM   6434 N  N6    . A   B  1 141 ? 5.498   42.619  16.410 1.00 18.92  ? 155 A   A N6    1 
ATOM   6435 N  N1    . A   B  1 141 ? 4.731   41.143  14.823 1.00 18.63  ? 155 A   A N1    1 
ATOM   6436 C  C2    . A   B  1 141 ? 4.621   39.860  14.422 1.00 20.67  ? 155 A   A C2    1 
ATOM   6437 N  N3    . A   B  1 141 ? 5.060   38.738  15.007 1.00 17.78  ? 155 A   A N3    1 
ATOM   6438 C  C4    . A   B  1 141 ? 5.702   39.026  16.151 1.00 16.85  ? 155 A   A C4    1 
ATOM   6439 P  P     . A   B  1 142 ? 10.539  34.300  17.997 1.00 15.75  ? 156 A   A P     1 
ATOM   6440 O  OP1   . A   B  1 142 ? 10.697  34.773  19.407 1.00 16.63  ? 156 A   A OP1   1 
ATOM   6441 O  OP2   . A   B  1 142 ? 11.299  35.062  16.966 1.00 15.76  ? 156 A   A OP2   1 
ATOM   6442 O  "O5'" . A   B  1 142 ? 10.807  32.757  17.914 1.00 17.94  ? 156 A   A "O5'" 1 
ATOM   6443 C  "C5'" . A   B  1 142 ? 11.171  32.122  16.698 1.00 18.05  ? 156 A   A "C5'" 1 
ATOM   6444 C  "C4'" . A   B  1 142 ? 11.998  30.900  16.990 1.00 17.72  ? 156 A   A "C4'" 1 
ATOM   6445 O  "O4'" . A   B  1 142 ? 13.184  31.275  17.743 1.00 17.06  ? 156 A   A "O4'" 1 
ATOM   6446 C  "C3'" . A   B  1 142 ? 11.327  29.848  17.861 1.00 17.16  ? 156 A   A "C3'" 1 
ATOM   6447 O  "O3'" . A   B  1 142 ? 10.447  29.013  17.123 1.00 17.85  ? 156 A   A "O3'" 1 
ATOM   6448 C  "C2'" . A   B  1 142 ? 12.517  29.096  18.436 1.00 15.68  ? 156 A   A "C2'" 1 
ATOM   6449 O  "O2'" . A   B  1 142 ? 13.084  28.260  17.437 1.00 16.11  ? 156 A   A "O2'" 1 
ATOM   6450 C  "C1'" . A   B  1 142 ? 13.483  30.249  18.678 1.00 17.16  ? 156 A   A "C1'" 1 
ATOM   6451 N  N9    . A   B  1 142 ? 13.356  30.811  20.042 1.00 14.37  ? 156 A   A N9    1 
ATOM   6452 C  C8    . A   B  1 142 ? 12.822  32.018  20.404 1.00 15.14  ? 156 A   A C8    1 
ATOM   6453 N  N7    . A   B  1 142 ? 12.879  32.252  21.699 1.00 15.87  ? 156 A   A N7    1 
ATOM   6454 C  C5    . A   B  1 142 ? 13.503  31.122  22.210 1.00 15.46  ? 156 A   A C5    1 
ATOM   6455 C  C6    . A   B  1 142 ? 13.849  30.769  23.514 1.00 16.09  ? 156 A   A C6    1 
ATOM   6456 N  N6    . A   B  1 142 ? 13.590  31.588  24.537 1.00 14.18  ? 156 A   A N6    1 
ATOM   6457 N  N1    . A   B  1 142 ? 14.484  29.579  23.706 1.00 14.58  ? 156 A   A N1    1 
ATOM   6458 C  C2    . A   B  1 142 ? 14.726  28.798  22.633 1.00 18.10  ? 156 A   A C2    1 
ATOM   6459 N  N3    . A   B  1 142 ? 14.431  29.030  21.344 1.00 13.97  ? 156 A   A N3    1 
ATOM   6460 C  C4    . A   B  1 142 ? 13.817  30.225  21.205 1.00 17.12  ? 156 A   A C4    1 
ATOM   6461 P  P     . G   B  1 143 ? 9.164   28.371  17.854 1.00 16.99  ? 157 G   A P     1 
ATOM   6462 O  OP1   . G   B  1 143 ? 8.623   27.387  16.891 1.00 16.69  ? 157 G   A OP1   1 
ATOM   6463 O  OP2   . G   B  1 143 ? 8.304   29.481  18.319 1.00 17.80  ? 157 G   A OP2   1 
ATOM   6464 O  "O5'" . G   B  1 143 ? 9.750   27.630  19.129 1.00 15.98  ? 157 G   A "O5'" 1 
ATOM   6465 C  "C5'" . G   B  1 143 ? 10.370  26.362  19.065 1.00 17.31  ? 157 G   A "C5'" 1 
ATOM   6466 C  "C4'" . G   B  1 143 ? 10.834  25.936  20.433 1.00 18.73  ? 157 G   A "C4'" 1 
ATOM   6467 O  "O4'" . G   B  1 143 ? 11.748  26.943  20.947 1.00 15.92  ? 157 G   A "O4'" 1 
ATOM   6468 C  "C3'" . G   B  1 143 ? 9.750   25.850  21.499 1.00 16.50  ? 157 G   A "C3'" 1 
ATOM   6469 O  "O3'" . G   B  1 143 ? 9.000   24.649  21.471 1.00 17.77  ? 157 G   A "O3'" 1 
ATOM   6470 C  "C2'" . G   B  1 143 ? 10.551  26.039  22.778 1.00 17.30  ? 157 G   A "C2'" 1 
ATOM   6471 O  "O2'" . G   B  1 143 ? 11.284  24.865  23.080 1.00 16.80  ? 157 G   A "O2'" 1 
ATOM   6472 C  "C1'" . G   B  1 143 ? 11.573  27.092  22.335 1.00 17.19  ? 157 G   A "C1'" 1 
ATOM   6473 N  N9    . G   B  1 143 ? 11.074  28.443  22.606 1.00 17.42  ? 157 G   A N9    1 
ATOM   6474 C  C8    . G   B  1 143 ? 10.571  29.356  21.706 1.00 15.73  ? 157 G   A C8    1 
ATOM   6475 N  N7    . G   B  1 143 ? 10.192  30.458  22.292 1.00 16.58  ? 157 G   A N7    1 
ATOM   6476 C  C5    . G   B  1 143 ? 10.475  30.249  23.639 1.00 16.68  ? 157 G   A C5    1 
ATOM   6477 C  C6    . G   B  1 143 ? 10.284  31.069  24.785 1.00 16.87  ? 157 G   A C6    1 
ATOM   6478 O  O6    . G   B  1 143 ? 9.838   32.192  24.874 1.00 17.61  ? 157 G   A O6    1 
ATOM   6479 N  N1    . G   B  1 143 ? 10.683  30.480  25.962 1.00 14.45  ? 157 G   A N1    1 
ATOM   6480 C  C2    . G   B  1 143 ? 11.214  29.222  26.067 1.00 16.68  ? 157 G   A C2    1 
ATOM   6481 N  N2    . G   B  1 143 ? 11.526  28.838  27.320 1.00 14.46  ? 157 G   A N2    1 
ATOM   6482 N  N3    . G   B  1 143 ? 11.413  28.430  25.019 1.00 16.22  ? 157 G   A N3    1 
ATOM   6483 C  C4    . G   B  1 143 ? 11.013  29.008  23.851 1.00 15.73  ? 157 G   A C4    1 
ATOM   6484 P  P     . C   B  1 144 ? 7.477   24.664  21.989 1.00 20.61  ? 158 C   A P     1 
ATOM   6485 O  OP1   . C   B  1 144 ? 7.023   23.282  21.805 1.00 18.89  ? 158 C   A OP1   1 
ATOM   6486 O  OP2   . C   B  1 144 ? 6.753   25.780  21.320 1.00 21.00  ? 158 C   A OP2   1 
ATOM   6487 O  "O5'" . C   B  1 144 ? 7.597   24.980  23.545 1.00 21.27  ? 158 C   A "O5'" 1 
ATOM   6488 C  "C5'" . C   B  1 144 ? 8.258   24.105  24.442 1.00 19.08  ? 158 C   A "C5'" 1 
ATOM   6489 C  "C4'" . C   B  1 144 ? 8.245   24.661  25.845 1.00 20.03  ? 158 C   A "C4'" 1 
ATOM   6490 O  "O4'" . C   B  1 144 ? 9.045   25.874  25.909 1.00 19.43  ? 158 C   A "O4'" 1 
ATOM   6491 C  "C3'" . C   B  1 144 ? 6.890   25.089  26.402 1.00 19.27  ? 158 C   A "C3'" 1 
ATOM   6492 O  "O3'" . C   B  1 144 ? 6.088   24.004  26.851 1.00 24.17  ? 158 C   A "O3'" 1 
ATOM   6493 C  "C2'" . C   B  1 144 ? 7.314   26.031  27.518 1.00 20.70  ? 158 C   A "C2'" 1 
ATOM   6494 O  "O2'" . C   B  1 144 ? 7.851   25.278  28.603 1.00 18.58  ? 158 C   A "O2'" 1 
ATOM   6495 C  "C1'" . C   B  1 144 ? 8.480   26.764  26.847 1.00 17.87  ? 158 C   A "C1'" 1 
ATOM   6496 N  N1    . C   B  1 144 ? 7.999   27.971  26.152 1.00 17.71  ? 158 C   A N1    1 
ATOM   6497 C  C2    . C   B  1 144 ? 7.758   29.087  26.942 1.00 19.24  ? 158 C   A C2    1 
ATOM   6498 O  O2    . C   B  1 144 ? 7.980   29.001  28.173 1.00 19.49  ? 158 C   A O2    1 
ATOM   6499 N  N3    . C   B  1 144 ? 7.279   30.202  26.345 1.00 17.01  ? 158 C   A N3    1 
ATOM   6500 C  C4    . C   B  1 144 ? 7.081   30.231  25.029 1.00 17.43  ? 158 C   A C4    1 
ATOM   6501 N  N4    . C   B  1 144 ? 6.634   31.362  24.525 1.00 16.07  ? 158 C   A N4    1 
ATOM   6502 C  C5    . C   B  1 144 ? 7.319   29.092  24.187 1.00 18.92  ? 158 C   A C5    1 
ATOM   6503 C  C6    . C   B  1 144 ? 7.770   27.990  24.797 1.00 16.79  ? 158 C   A C6    1 
ATOM   6504 P  P     . U   B  1 145 ? 4.483   24.092  26.820 1.00 25.65  ? 159 U   A P     1 
ATOM   6505 O  OP1   . U   B  1 145 ? 4.074   22.757  27.303 1.00 28.81  ? 159 U   A OP1   1 
ATOM   6506 O  OP2   . U   B  1 145 ? 4.001   24.587  25.523 1.00 22.64  ? 159 U   A OP2   1 
ATOM   6507 O  "O5'" . U   B  1 145 ? 4.101   25.178  27.936 1.00 21.83  ? 159 U   A "O5'" 1 
ATOM   6508 C  "C5'" . U   B  1 145 ? 4.403   24.980  29.310 1.00 25.30  ? 159 U   A "C5'" 1 
ATOM   6509 C  "C4'" . U   B  1 145 ? 4.061   26.205  30.126 1.00 20.82  ? 159 U   A "C4'" 1 
ATOM   6510 O  "O4'" . U   B  1 145 ? 4.932   27.312  29.747 1.00 22.17  ? 159 U   A "O4'" 1 
ATOM   6511 C  "C3'" . U   B  1 145 ? 2.648   26.750  29.932 1.00 22.55  ? 159 U   A "C3'" 1 
ATOM   6512 O  "O3'" . U   B  1 145 ? 1.655   26.072  30.694 1.00 25.72  ? 159 U   A "O3'" 1 
ATOM   6513 C  "C2'" . U   B  1 145 ? 2.815   28.214  30.316 1.00 21.84  ? 159 U   A "C2'" 1 
ATOM   6514 O  "O2'" . U   B  1 145 ? 2.906   28.344  31.726 1.00 25.97  ? 159 U   A "O2'" 1 
ATOM   6515 C  "C1'" . U   B  1 145 ? 4.201   28.519  29.743 1.00 20.52  ? 159 U   A "C1'" 1 
ATOM   6516 N  N1    . U   B  1 145 ? 4.068   29.078  28.370 1.00 19.00  ? 159 U   A N1    1 
ATOM   6517 C  C2    . U   B  1 145 ? 3.763   30.418  28.304 1.00 19.48  ? 159 U   A C2    1 
ATOM   6518 O  O2    . U   B  1 145 ? 3.618   31.082  29.317 1.00 20.41  ? 159 U   A O2    1 
ATOM   6519 N  N3    . U   B  1 145 ? 3.631   30.943  27.038 1.00 19.93  ? 159 U   A N3    1 
ATOM   6520 C  C4    . U   B  1 145 ? 3.767   30.238  25.854 1.00 18.82  ? 159 U   A C4    1 
ATOM   6521 O  O4    . U   B  1 145 ? 3.628   30.833  24.784 1.00 19.35  ? 159 U   A O4    1 
ATOM   6522 C  C5    . U   B  1 145 ? 4.089   28.851  26.009 1.00 19.81  ? 159 U   A C5    1 
ATOM   6523 C  C6    . U   B  1 145 ? 4.223   28.321  27.233 1.00 19.22  ? 159 U   A C6    1 
ATOM   6524 P  P     . C   B  1 146 ? 0.186   25.808  30.075 1.00 27.57  ? 160 C   A P     1 
ATOM   6525 O  OP1   . C   B  1 146 ? -0.374  24.752  30.952 1.00 32.78  ? 160 C   A OP1   1 
ATOM   6526 O  OP2   . C   B  1 146 ? 0.274   25.573  28.614 1.00 28.29  ? 160 C   A OP2   1 
ATOM   6527 O  "O5'" . C   B  1 146 ? -0.573  27.165  30.308 1.00 23.86  ? 160 C   A "O5'" 1 
ATOM   6528 C  "C5'" . C   B  1 146 ? -0.676  27.650  31.634 1.00 26.79  ? 160 C   A "C5'" 1 
ATOM   6529 C  "C4'" . C   B  1 146 ? -0.989  29.119  31.652 1.00 25.23  ? 160 C   A "C4'" 1 
ATOM   6530 O  "O4'" . C   B  1 146 ? 0.102   29.858  31.042 1.00 23.80  ? 160 C   A "O4'" 1 
ATOM   6531 C  "C3'" . C   B  1 146 ? -2.224  29.565  30.882 1.00 25.19  ? 160 C   A "C3'" 1 
ATOM   6532 O  "O3'" . C   B  1 146 ? -3.429  29.348  31.596 1.00 29.93  ? 160 C   A "O3'" 1 
ATOM   6533 C  "C2'" . C   B  1 146 ? -1.930  31.035  30.659 1.00 25.55  ? 160 C   A "C2'" 1 
ATOM   6534 O  "O2'" . C   B  1 146 ? -2.128  31.735  31.875 1.00 27.05  ? 160 C   A "O2'" 1 
ATOM   6535 C  "C1'" . C   B  1 146 ? -0.423  30.993  30.386 1.00 24.45  ? 160 C   A "C1'" 1 
ATOM   6536 N  N1    . C   B  1 146 ? -0.176  30.861  28.945 1.00 22.39  ? 160 C   A N1    1 
ATOM   6537 C  C2    . C   B  1 146 ? -0.143  32.047  28.205 1.00 24.53  ? 160 C   A C2    1 
ATOM   6538 O  O2    . C   B  1 146 ? -0.308  33.140  28.787 1.00 24.66  ? 160 C   A O2    1 
ATOM   6539 N  N3    . C   B  1 146 ? 0.082   31.967  26.885 1.00 22.13  ? 160 C   A N3    1 
ATOM   6540 C  C4    . C   B  1 146 ? 0.266   30.767  26.326 1.00 20.27  ? 160 C   A C4    1 
ATOM   6541 N  N4    . C   B  1 146 ? 0.470   30.738  25.026 1.00 21.24  ? 160 C   A N4    1 
ATOM   6542 C  C5    . C   B  1 146 ? 0.231   29.543  27.052 1.00 23.34  ? 160 C   A C5    1 
ATOM   6543 C  C6    . C   B  1 146 ? 0.007   29.641  28.366 1.00 21.67  ? 160 C   A C6    1 
ATOM   6544 P  P     . U   B  1 147 ? -4.832  29.239  30.832 1.00 30.51  ? 161 U   A P     1 
ATOM   6545 O  OP1   . U   B  1 147 ? -5.809  28.655  31.785 1.00 33.95  ? 161 U   A OP1   1 
ATOM   6546 O  OP2   . U   B  1 147 ? -4.554  28.501  29.566 1.00 33.38  ? 161 U   A OP2   1 
ATOM   6547 O  "O5'" . U   B  1 147 ? -5.194  30.752  30.526 1.00 26.88  ? 161 U   A "O5'" 1 
ATOM   6548 C  "C5'" . U   B  1 147 ? -5.460  31.703  31.541 1.00 29.03  ? 161 U   A "C5'" 1 
ATOM   6549 C  "C4'" . U   B  1 147 ? -5.738  33.054  30.932 1.00 30.16  ? 161 U   A "C4'" 1 
ATOM   6550 O  "O4'" . U   B  1 147 ? -4.582  33.483  30.162 1.00 27.27  ? 161 U   A "O4'" 1 
ATOM   6551 C  "C3'" . U   B  1 147 ? -6.888  33.093  29.937 1.00 29.90  ? 161 U   A "C3'" 1 
ATOM   6552 O  "O3'" . U   B  1 147 ? -8.145  33.240  30.577 1.00 30.68  ? 161 U   A "O3'" 1 
ATOM   6553 C  "C2'" . U   B  1 147 ? -6.520  34.281  29.055 1.00 27.86  ? 161 U   A "C2'" 1 
ATOM   6554 O  "O2'" . U   B  1 147 ? -6.799  35.488  29.749 1.00 30.24  ? 161 U   A "O2'" 1 
ATOM   6555 C  "C1'" . U   B  1 147 ? -4.997  34.173  28.998 1.00 26.99  ? 161 U   A "C1'" 1 
ATOM   6556 N  N1    . U   B  1 147 ? -4.365  33.557  27.795 1.00 22.27  ? 161 U   A N1    1 
ATOM   6557 C  C2    . U   B  1 147 ? -4.193  34.337  26.661 1.00 24.59  ? 161 U   A C2    1 
ATOM   6558 O  O2    . U   B  1 147 ? -4.566  35.490  26.606 1.00 23.09  ? 161 U   A O2    1 
ATOM   6559 N  N3    . U   B  1 147 ? -3.568  33.715  25.592 1.00 23.72  ? 161 U   A N3    1 
ATOM   6560 C  C4    . U   B  1 147 ? -3.110  32.410  25.567 1.00 22.41  ? 161 U   A C4    1 
ATOM   6561 O  O4    . U   B  1 147 ? -2.561  31.954  24.564 1.00 21.95  ? 161 U   A O4    1 
ATOM   6562 C  C5    . U   B  1 147 ? -3.321  31.674  26.772 1.00 24.57  ? 161 U   A C5    1 
ATOM   6563 C  C6    . U   B  1 147 ? -3.916  32.264  27.811 1.00 24.72  ? 161 U   A C6    1 
ATOM   6564 P  P     . A   B  1 148 ? -9.359  32.216  30.336 1.00 29.93  ? 162 A   A P     1 
ATOM   6565 O  OP1   . A   B  1 148 ? -10.045 32.198  31.662 1.00 32.82  ? 162 A   A OP1   1 
ATOM   6566 O  OP2   . A   B  1 148 ? -8.889  30.930  29.768 1.00 30.89  ? 162 A   A OP2   1 
ATOM   6567 O  "O5'" . A   B  1 148 ? -10.256 32.985  29.261 1.00 34.34  ? 162 A   A "O5'" 1 
ATOM   6568 C  "C5'" . A   B  1 148 ? -10.745 34.292  29.519 1.00 32.42  ? 162 A   A "C5'" 1 
ATOM   6569 C  "C4'" . A   B  1 148 ? -10.611 35.174  28.306 1.00 35.64  ? 162 A   A "C4'" 1 
ATOM   6570 O  "O4'" . A   B  1 148 ? -9.220  35.271  27.905 1.00 32.15  ? 162 A   A "O4'" 1 
ATOM   6571 C  "C3'" . A   B  1 148 ? -11.318 34.661  27.067 1.00 32.26  ? 162 A   A "C3'" 1 
ATOM   6572 O  "O3'" . A   B  1 148 ? -12.688 34.996  27.092 1.00 35.82  ? 162 A   A "O3'" 1 
ATOM   6573 C  "C2'" . A   B  1 148 ? -10.540 35.314  25.936 1.00 31.98  ? 162 A   A "C2'" 1 
ATOM   6574 O  "O2'" . A   B  1 148 ? -10.867 36.693  25.839 1.00 33.30  ? 162 A   A "O2'" 1 
ATOM   6575 C  "C1'" . A   B  1 148 ? -9.123  35.236  26.493 1.00 31.08  ? 162 A   A "C1'" 1 
ATOM   6576 N  N9    . A   B  1 148 ? -8.413  33.993  26.141 1.00 29.29  ? 162 A   A N9    1 
ATOM   6577 C  C8    . A   B  1 148 ? -8.442  32.803  26.825 1.00 28.54  ? 162 A   A C8    1 
ATOM   6578 N  N7    . A   B  1 148 ? -7.663  31.878  26.303 1.00 27.62  ? 162 A   A N7    1 
ATOM   6579 C  C5    . A   B  1 148 ? -7.082  32.505  25.211 1.00 26.01  ? 162 A   A C5    1 
ATOM   6580 C  C6    . A   B  1 148 ? -6.158  32.051  24.251 1.00 22.30  ? 162 A   A C6    1 
ATOM   6581 N  N6    . A   B  1 148 ? -5.650  30.818  24.250 1.00 20.42  ? 162 A   A N6    1 
ATOM   6582 N  N1    . A   B  1 148 ? -5.781  32.928  23.299 1.00 22.60  ? 162 A   A N1    1 
ATOM   6583 C  C2    . A   B  1 148 ? -6.287  34.170  23.318 1.00 22.62  ? 162 A   A C2    1 
ATOM   6584 N  N3    . A   B  1 148 ? -7.164  34.713  24.172 1.00 23.61  ? 162 A   A N3    1 
ATOM   6585 C  C4    . A   B  1 148 ? -7.520  33.814  25.105 1.00 25.70  ? 162 A   A C4    1 
ATOM   6586 P  P     . C   B  1 149 ? -13.727 34.092  26.299 1.00 42.27  ? 163 C   A P     1 
ATOM   6587 O  OP1   . C   B  1 149 ? -15.070 34.473  26.825 1.00 48.94  ? 163 C   A OP1   1 
ATOM   6588 O  OP2   . C   B  1 149 ? -13.327 32.656  26.242 1.00 33.83  ? 163 C   A OP2   1 
ATOM   6589 O  "O5'" . C   B  1 149 ? -13.487 34.796  24.901 1.00 36.64  ? 163 C   A "O5'" 1 
ATOM   6590 C  "C5'" . C   B  1 149 ? -13.361 33.988  23.756 1.00 31.39  ? 163 C   A "C5'" 1 
ATOM   6591 C  "C4'" . C   B  1 149 ? -12.701 34.740  22.634 1.00 30.97  ? 163 C   A "C4'" 1 
ATOM   6592 O  "O4'" . C   B  1 149 ? -11.312 34.973  22.987 1.00 31.61  ? 163 C   A "O4'" 1 
ATOM   6593 C  "C3'" . C   B  1 149 ? -12.647 33.915  21.363 1.00 27.63  ? 163 C   A "C3'" 1 
ATOM   6594 O  "O3'" . C   B  1 149 ? -13.837 34.004  20.589 1.00 30.49  ? 163 C   A "O3'" 1 
ATOM   6595 C  "C2'" . C   B  1 149 ? -11.370 34.391  20.684 1.00 25.92  ? 163 C   A "C2'" 1 
ATOM   6596 O  "O2'" . C   B  1 149 ? -11.560 35.645  20.049 1.00 22.74  ? 163 C   A "O2'" 1 
ATOM   6597 C  "C1'" . C   B  1 149 ? -10.479 34.596  21.910 1.00 28.22  ? 163 C   A "C1'" 1 
ATOM   6598 N  N1    . C   B  1 149 ? -9.910  33.287  22.258 1.00 25.99  ? 163 C   A N1    1 
ATOM   6599 C  C2    . C   B  1 149 ? -8.831  32.803  21.503 1.00 23.56  ? 163 C   A C2    1 
ATOM   6600 O  O2    . C   B  1 149 ? -8.380  33.513  20.579 1.00 23.14  ? 163 C   A O2    1 
ATOM   6601 N  N3    . C   B  1 149 ? -8.327  31.592  21.812 1.00 24.78  ? 163 C   A N3    1 
ATOM   6602 C  C4    . C   B  1 149 ? -8.847  30.875  22.814 1.00 24.08  ? 163 C   A C4    1 
ATOM   6603 N  N4    . C   B  1 149 ? -8.334  29.675  23.085 1.00 18.81  ? 163 C   A N4    1 
ATOM   6604 C  C5    . C   B  1 149 ? -9.947  31.350  23.583 1.00 22.22  ? 163 C   A C5    1 
ATOM   6605 C  C6    . C   B  1 149 ? -10.439 32.547  23.271 1.00 27.92  ? 163 C   A C6    1 
ATOM   6606 P  P     . G   B  1 150 ? -14.521 32.642  20.064 1.00 30.78  ? 164 G   A P     1 
ATOM   6607 O  OP1   . G   B  1 150 ? -15.802 33.049  19.446 1.00 28.96  ? 164 G   A OP1   1 
ATOM   6608 O  OP2   . G   B  1 150 ? -14.504 31.593  21.115 1.00 32.45  ? 164 G   A OP2   1 
ATOM   6609 O  "O5'" . G   B  1 150 ? -13.467 32.184  18.952 1.00 26.79  ? 164 G   A "O5'" 1 
ATOM   6610 C  "C5'" . G   B  1 150 ? -13.114 33.117  17.943 1.00 25.81  ? 164 G   A "C5'" 1 
ATOM   6611 C  "C4'" . G   B  1 150 ? -11.958 32.623  17.117 1.00 22.84  ? 164 G   A "C4'" 1 
ATOM   6612 O  "O4'" . G   B  1 150 ? -10.759 32.502  17.924 1.00 23.98  ? 164 G   A "O4'" 1 
ATOM   6613 C  "C3'" . G   B  1 150 ? -12.112 31.243  16.514 1.00 23.80  ? 164 G   A "C3'" 1 
ATOM   6614 O  "O3'" . G   B  1 150 ? -12.928 31.284  15.368 1.00 24.86  ? 164 G   A "O3'" 1 
ATOM   6615 C  "C2'" . G   B  1 150 ? -10.670 30.883  16.201 1.00 22.67  ? 164 G   A "C2'" 1 
ATOM   6616 O  "O2'" . G   B  1 150 ? -10.226 31.632  15.076 1.00 22.68  ? 164 G   A "O2'" 1 
ATOM   6617 C  "C1'" . G   B  1 150 ? -9.969  31.437  17.445 1.00 22.73  ? 164 G   A "C1'" 1 
ATOM   6618 N  N9    . G   B  1 150 ? -9.893  30.392  18.476 1.00 20.82  ? 164 G   A N9    1 
ATOM   6619 C  C8    . G   B  1 150 ? -10.647 30.287  19.624 1.00 24.26  ? 164 G   A C8    1 
ATOM   6620 N  N7    . G   B  1 150 ? -10.364 29.212  20.305 1.00 22.23  ? 164 G   A N7    1 
ATOM   6621 C  C5    . G   B  1 150 ? -9.388  28.566  19.558 1.00 22.02  ? 164 G   A C5    1 
ATOM   6622 C  C6    . G   B  1 150 ? -8.681  27.354  19.786 1.00 24.58  ? 164 G   A C6    1 
ATOM   6623 O  O6    . G   B  1 150 ? -8.786  26.542  20.721 1.00 24.63  ? 164 G   A O6    1 
ATOM   6624 N  N1    . G   B  1 150 ? -7.778  27.079  18.755 1.00 23.31  ? 164 G   A N1    1 
ATOM   6625 C  C2    . G   B  1 150 ? -7.573  27.863  17.652 1.00 23.56  ? 164 G   A C2    1 
ATOM   6626 N  N2    . G   B  1 150 ? -6.655  27.414  16.778 1.00 22.43  ? 164 G   A N2    1 
ATOM   6627 N  N3    . G   B  1 150 ? -8.215  28.997  17.434 1.00 18.73  ? 164 G   A N3    1 
ATOM   6628 C  C4    . G   B  1 150 ? -9.098  29.285  18.417 1.00 23.05  ? 164 G   A C4    1 
ATOM   6629 P  P     . A   B  1 151 ? -13.577 29.940  14.776 1.00 27.70  ? 165 A   A P     1 
ATOM   6630 O  OP1   . A   B  1 151 ? -14.791 30.519  14.117 1.00 23.09  ? 165 A   A OP1   1 
ATOM   6631 O  OP2   . A   B  1 151 ? -13.650 28.877  15.809 1.00 27.27  ? 165 A   A OP2   1 
ATOM   6632 O  "O5'" . A   B  1 151 ? -12.526 29.506  13.679 1.00 25.82  ? 165 A   A "O5'" 1 
ATOM   6633 C  "C5'" . A   B  1 151 ? -12.566 30.085  12.381 1.00 25.33  ? 165 A   A "C5'" 1 
ATOM   6634 C  "C4'" . A   B  1 151 ? -11.682 29.313  11.429 1.00 28.07  ? 165 A   A "C4'" 1 
ATOM   6635 O  "O4'" . A   B  1 151 ? -10.275 29.617  11.690 1.00 24.30  ? 165 A   A "O4'" 1 
ATOM   6636 C  "C3'" . A   B  1 151 ? -11.801 27.787  11.507 1.00 24.63  ? 165 A   A "C3'" 1 
ATOM   6637 O  "O3'" . A   B  1 151 ? -11.602 27.234  10.210 1.00 25.81  ? 165 A   A "O3'" 1 
ATOM   6638 C  "C2'" . A   B  1 151 ? -10.587 27.405  12.345 1.00 23.83  ? 165 A   A "C2'" 1 
ATOM   6639 O  "O2'" . A   B  1 151 ? -10.136 26.080  12.190 1.00 26.64  ? 165 A   A "O2'" 1 
ATOM   6640 C  "C1'" . A   B  1 151 ? -9.586  28.388  11.756 1.00 22.03  ? 165 A   A "C1'" 1 
ATOM   6641 N  N9    . A   B  1 151 ? -8.279  28.419  12.420 1.00 25.14  ? 165 A   A N9    1 
ATOM   6642 C  C8    . A   B  1 151 ? -7.951  27.964  13.672 1.00 23.82  ? 165 A   A C8    1 
ATOM   6643 N  N7    . A   B  1 151 ? -6.668  28.052  13.930 1.00 23.01  ? 165 A   A N7    1 
ATOM   6644 C  C5    . A   B  1 151 ? -6.120  28.580  12.765 1.00 20.77  ? 165 A   A C5    1 
ATOM   6645 C  C6    . A   B  1 151 ? -4.801  28.908  12.392 1.00 20.47  ? 165 A   A C6    1 
ATOM   6646 N  N6    . A   B  1 151 ? -3.739  28.753  13.179 1.00 18.62  ? 165 A   A N6    1 
ATOM   6647 N  N1    . A   B  1 151 ? -4.610  29.412  11.150 1.00 20.71  ? 165 A   A N1    1 
ATOM   6648 C  C2    . A   B  1 151 ? -5.660  29.566  10.336 1.00 22.41  ? 165 A   A C2    1 
ATOM   6649 N  N3    . A   B  1 151 ? -6.939  29.294  10.576 1.00 20.52  ? 165 A   A N3    1 
ATOM   6650 C  C4    . A   B  1 151 ? -7.096  28.782  11.815 1.00 22.90  ? 165 A   A C4    1 
ATOM   6651 P  P     . U   B  1 152 ? -12.854 26.725  9.339  1.00 30.25  ? 166 U   A P     1 
ATOM   6652 O  OP1   . U   B  1 152 ? -13.959 26.584  10.318 1.00 30.01  ? 166 U   A OP1   1 
ATOM   6653 O  OP2   . U   B  1 152 ? -12.322 25.552  8.601  1.00 28.97  ? 166 U   A OP2   1 
ATOM   6654 O  "O5'" . U   B  1 152 ? -13.140 27.943  8.355  1.00 31.57  ? 166 U   A "O5'" 1 
ATOM   6655 C  "C5'" . U   B  1 152 ? -13.945 27.741  7.196  1.00 32.16  ? 166 U   A "C5'" 1 
ATOM   6656 C  "C4'" . U   B  1 152 ? -13.598 28.733  6.117  1.00 31.20  ? 166 U   A "C4'" 1 
ATOM   6657 O  "O4'" . U   B  1 152 ? -14.224 30.018  6.408  1.00 32.76  ? 166 U   A "O4'" 1 
ATOM   6658 C  "C3'" . U   B  1 152 ? -12.105 29.007  5.945  1.00 27.41  ? 166 U   A "C3'" 1 
ATOM   6659 O  "O3'" . U   B  1 152 ? -11.841 29.251  4.564  1.00 29.72  ? 166 U   A "O3'" 1 
ATOM   6660 C  "C2'" . U   B  1 152 ? -11.911 30.298  6.733  1.00 30.15  ? 166 U   A "C2'" 1 
ATOM   6661 O  "O2'" . U   B  1 152 ? -10.802 31.067  6.317  1.00 31.69  ? 166 U   A "O2'" 1 
ATOM   6662 C  "C1'" . U   B  1 152 ? -13.229 31.025  6.458  1.00 29.38  ? 166 U   A "C1'" 1 
ATOM   6663 N  N1    . U   B  1 152 ? -13.585 32.016  7.499  1.00 29.17  ? 166 U   A N1    1 
ATOM   6664 C  C2    . U   B  1 152 ? -13.490 33.353  7.145  1.00 31.55  ? 166 U   A C2    1 
ATOM   6665 O  O2    . U   B  1 152 ? -13.124 33.734  6.047  1.00 30.54  ? 166 U   A O2    1 
ATOM   6666 N  N3    . U   B  1 152 ? -13.830 34.239  8.127  1.00 23.29  ? 166 U   A N3    1 
ATOM   6667 C  C4    . U   B  1 152 ? -14.241 33.950  9.409  1.00 26.74  ? 166 U   A C4    1 
ATOM   6668 O  O4    . U   B  1 152 ? -14.506 34.896  10.165 1.00 26.76  ? 166 U   A O4    1 
ATOM   6669 C  C5    . U   B  1 152 ? -14.326 32.549  9.705  1.00 25.95  ? 166 U   A C5    1 
ATOM   6670 C  C6    . U   B  1 152 ? -13.992 31.652  8.766  1.00 27.39  ? 166 U   A C6    1 
ATOM   6671 P  P     . U   B  1 153 ? -11.135 28.110  3.686  1.00 31.25  ? 167 U   A P     1 
ATOM   6672 O  OP1   . U   B  1 153 ? -11.400 28.500  2.272  1.00 31.10  ? 167 U   A OP1   1 
ATOM   6673 O  OP2   . U   B  1 153 ? -11.601 26.824  4.239  1.00 28.04  ? 167 U   A OP2   1 
ATOM   6674 O  "O5'" . U   B  1 153 ? -9.603  28.271  4.008  1.00 32.68  ? 167 U   A "O5'" 1 
ATOM   6675 C  "C5'" . U   B  1 153 ? -8.873  29.337  3.431  1.00 31.66  ? 167 U   A "C5'" 1 
ATOM   6676 C  "C4'" . U   B  1 153 ? -7.431  29.214  3.816  1.00 33.10  ? 167 U   A "C4'" 1 
ATOM   6677 O  "O4'" . U   B  1 153 ? -7.259  29.548  5.217  1.00 30.64  ? 167 U   A "O4'" 1 
ATOM   6678 C  "C3'" . U   B  1 153 ? -6.872  27.810  3.702  1.00 32.85  ? 167 U   A "C3'" 1 
ATOM   6679 O  "O3'" . U   B  1 153 ? -6.491  27.501  2.376  1.00 37.44  ? 167 U   A "O3'" 1 
ATOM   6680 C  "C2'" . U   B  1 153 ? -5.696  27.849  4.665  1.00 33.27  ? 167 U   A "C2'" 1 
ATOM   6681 O  "O2'" . U   B  1 153 ? -4.605  28.527  4.063  1.00 34.66  ? 167 U   A "O2'" 1 
ATOM   6682 C  "C1'" . U   B  1 153 ? -6.255  28.732  5.779  1.00 30.68  ? 167 U   A "C1'" 1 
ATOM   6683 N  N1    . U   B  1 153 ? -6.834  27.945  6.885  1.00 29.64  ? 167 U   A N1    1 
ATOM   6684 C  C2    . U   B  1 153 ? -5.947  27.415  7.812  1.00 29.93  ? 167 U   A C2    1 
ATOM   6685 O  O2    . U   B  1 153 ? -4.743  27.568  7.732  1.00 29.13  ? 167 U   A O2    1 
ATOM   6686 N  N3    . U   B  1 153 ? -6.518  26.695  8.827  1.00 25.91  ? 167 U   A N3    1 
ATOM   6687 C  C4    . U   B  1 153 ? -7.862  26.462  9.019  1.00 28.36  ? 167 U   A C4    1 
ATOM   6688 O  O4    . U   B  1 153 ? -8.225  25.791  9.997  1.00 28.50  ? 167 U   A O4    1 
ATOM   6689 C  C5    . U   B  1 153 ? -8.713  27.038  8.022  1.00 27.90  ? 167 U   A C5    1 
ATOM   6690 C  C6    . U   B  1 153 ? -8.196  27.748  7.011  1.00 27.94  ? 167 U   A C6    1 
ATOM   6691 P  P     . G   B  1 154 ? -7.119  26.220  1.649  1.00 36.59  ? 168 G   A P     1 
ATOM   6692 O  OP1   . G   B  1 154 ? -6.580  26.290  0.268  1.00 42.99  ? 168 G   A OP1   1 
ATOM   6693 O  OP2   . G   B  1 154 ? -8.568  26.172  1.943  1.00 38.87  ? 168 G   A OP2   1 
ATOM   6694 O  "O5'" . G   B  1 154 ? -6.338  25.085  2.430  1.00 42.65  ? 168 G   A "O5'" 1 
ATOM   6695 C  "C5'" . G   B  1 154 ? -5.009  25.445  2.789  1.00 43.37  ? 168 G   A "C5'" 1 
ATOM   6696 C  "C4'" . G   B  1 154 ? -4.425  24.464  3.761  1.00 43.01  ? 168 G   A "C4'" 1 
ATOM   6697 O  "O4'" . G   B  1 154 ? -4.930  24.710  5.112  1.00 40.71  ? 168 G   A "O4'" 1 
ATOM   6698 C  "C3'" . G   B  1 154 ? -4.767  23.022  3.397  1.00 42.72  ? 168 G   A "C3'" 1 
ATOM   6699 O  "O3'" . G   B  1 154 ? -3.623  22.193  3.543  1.00 48.31  ? 168 G   A "O3'" 1 
ATOM   6700 C  "C2'" . G   B  1 154 ? -5.794  22.646  4.449  1.00 40.81  ? 168 G   A "C2'" 1 
ATOM   6701 O  "O2'" . G   B  1 154 ? -5.854  21.266  4.738  1.00 48.09  ? 168 G   A "O2'" 1 
ATOM   6702 C  "C1'" . G   B  1 154 ? -5.265  23.449  5.635  1.00 40.00  ? 168 G   A "C1'" 1 
ATOM   6703 N  N9    . G   B  1 154 ? -6.127  23.392  6.822  1.00 37.09  ? 168 G   A N9    1 
ATOM   6704 C  C8    . G   B  1 154 ? -7.496  23.367  6.928  1.00 35.03  ? 168 G   A C8    1 
ATOM   6705 N  N7    . G   B  1 154 ? -7.899  23.156  8.158  1.00 37.99  ? 168 G   A N7    1 
ATOM   6706 C  C5    . G   B  1 154 ? -6.726  22.983  8.892  1.00 31.31  ? 168 G   A C5    1 
ATOM   6707 C  C6    . G   B  1 154 ? -6.499  22.713  10.269 1.00 32.44  ? 168 G   A C6    1 
ATOM   6708 O  O6    . G   B  1 154 ? -7.337  22.561  11.167 1.00 34.49  ? 168 G   A O6    1 
ATOM   6709 N  N1    . G   B  1 154 ? -5.138  22.625  10.568 1.00 28.23  ? 168 G   A N1    1 
ATOM   6710 C  C2    . G   B  1 154 ? -4.131  22.764  9.646  1.00 30.76  ? 168 G   A C2    1 
ATOM   6711 N  N2    . G   B  1 154 ? -2.871  22.653  10.073 1.00 29.46  ? 168 G   A N2    1 
ATOM   6712 N  N3    . G   B  1 154 ? -4.335  23.007  8.371  1.00 32.63  ? 168 G   A N3    1 
ATOM   6713 C  C4    . G   B  1 154 ? -5.640  23.101  8.071  1.00 32.57  ? 168 G   A C4    1 
ATOM   6714 P  P     . A   B  1 155 ? -3.600  20.832  2.702  1.00 54.23  ? 169 A   A P     1 
ATOM   6715 O  OP1   . A   B  1 155 ? -3.065  21.179  1.356  1.00 50.47  ? 169 A   A OP1   1 
ATOM   6716 O  OP2   . A   B  1 155 ? -4.924  20.172  2.814  1.00 50.56  ? 169 A   A OP2   1 
ATOM   6717 O  "O5'" . A   B  1 155 ? -2.522  20.055  3.548  1.00 47.31  ? 169 A   A "O5'" 1 
ATOM   6718 C  "C5'" . A   B  1 155 ? -1.202  20.566  3.526  1.00 41.73  ? 169 A   A "C5'" 1 
ATOM   6719 C  "C4'" . A   B  1 155 ? -0.545  20.393  4.866  1.00 39.06  ? 169 A   A "C4'" 1 
ATOM   6720 O  "O4'" . A   B  1 155 ? -1.244  21.166  5.878  1.00 39.35  ? 169 A   A "O4'" 1 
ATOM   6721 C  "C3'" . A   B  1 155 ? -0.587  18.998  5.457  1.00 36.05  ? 169 A   A "C3'" 1 
ATOM   6722 O  "O3'" . A   B  1 155 ? 0.280   18.084  4.824  1.00 43.02  ? 169 A   A "O3'" 1 
ATOM   6723 C  "C2'" . A   B  1 155 ? -0.204  19.301  6.893  1.00 33.44  ? 169 A   A "C2'" 1 
ATOM   6724 O  "O2'" . A   B  1 155 ? 1.149   19.718  6.931  1.00 34.32  ? 169 A   A "O2'" 1 
ATOM   6725 C  "C1'" . A   B  1 155 ? -1.053  20.540  7.134  1.00 36.08  ? 169 A   A "C1'" 1 
ATOM   6726 N  N9    . A   B  1 155 ? -2.354  20.215  7.739  1.00 33.69  ? 169 A   A N9    1 
ATOM   6727 C  C8    . A   B  1 155 ? -3.596  20.307  7.176  1.00 33.82  ? 169 A   A C8    1 
ATOM   6728 N  N7    . A   B  1 155 ? -4.556  19.948  7.990  1.00 32.80  ? 169 A   A N7    1 
ATOM   6729 C  C5    . A   B  1 155 ? -3.909  19.587  9.161  1.00 30.93  ? 169 A   A C5    1 
ATOM   6730 C  C6    . A   B  1 155 ? -4.382  19.120  10.400 1.00 32.24  ? 169 A   A C6    1 
ATOM   6731 N  N6    . A   B  1 155 ? -5.668  18.929  10.666 1.00 29.78  ? 169 A   A N6    1 
ATOM   6732 N  N1    . A   B  1 155 ? -3.479  18.852  11.365 1.00 27.95  ? 169 A   A N1    1 
ATOM   6733 C  C2    . A   B  1 155 ? -2.191  19.055  11.080 1.00 31.64  ? 169 A   A C2    1 
ATOM   6734 N  N3    . A   B  1 155 ? -1.620  19.495  9.955  1.00 35.23  ? 169 A   A N3    1 
ATOM   6735 C  C4    . A   B  1 155 ? -2.550  19.749  9.022  1.00 32.67  ? 169 A   A C4    1 
ATOM   6736 P  P     . A   B  1 156 ? -0.080  16.513  4.847  1.00 45.91  ? 170 A   A P     1 
ATOM   6737 O  OP1   . A   B  1 156 ? 0.923   15.939  3.924  1.00 41.19  ? 170 A   A OP1   1 
ATOM   6738 O  OP2   . A   B  1 156 ? -1.546  16.372  4.607  1.00 35.63  ? 170 A   A OP2   1 
ATOM   6739 O  "O5'" . A   B  1 156 ? 0.252   16.042  6.326  1.00 35.40  ? 170 A   A "O5'" 1 
ATOM   6740 C  "C5'" . A   B  1 156 ? 1.566   16.236  6.813  1.00 38.60  ? 170 A   A "C5'" 1 
ATOM   6741 C  "C4'" . A   B  1 156 ? 1.611   15.886  8.271  1.00 38.38  ? 170 A   A "C4'" 1 
ATOM   6742 O  "O4'" . A   B  1 156 ? 0.679   16.728  9.005  1.00 35.70  ? 170 A   A "O4'" 1 
ATOM   6743 C  "C3'" . A   B  1 156 ? 1.154   14.475  8.596  1.00 35.99  ? 170 A   A "C3'" 1 
ATOM   6744 O  "O3'" . A   B  1 156 ? 2.150   13.506  8.342  1.00 36.99  ? 170 A   A "O3'" 1 
ATOM   6745 C  "C2'" . A   B  1 156 ? 0.769   14.598  10.059 1.00 36.00  ? 170 A   A "C2'" 1 
ATOM   6746 O  "O2'" . A   B  1 156 ? 1.944   14.657  10.853 1.00 37.48  ? 170 A   A "O2'" 1 
ATOM   6747 C  "C1'" . A   B  1 156 ? 0.118   15.982  10.066 1.00 34.10  ? 170 A   A "C1'" 1 
ATOM   6748 N  N9    . A   B  1 156 ? -1.354  15.945  9.921  1.00 29.73  ? 170 A   A N9    1 
ATOM   6749 C  C8    . A   B  1 156 ? -2.133  16.260  8.841  1.00 31.82  ? 170 A   A C8    1 
ATOM   6750 N  N7    . A   B  1 156 ? -3.424  16.145  9.068  1.00 34.30  ? 170 A   A N7    1 
ATOM   6751 C  C5    . A   B  1 156 ? -3.501  15.735  10.390 1.00 32.15  ? 170 A   A C5    1 
ATOM   6752 C  C6    . A   B  1 156 ? -4.582  15.431  11.236 1.00 31.13  ? 170 A   A C6    1 
ATOM   6753 N  N6    . A   B  1 156 ? -5.867  15.503  10.875 1.00 30.93  ? 170 A   A N6    1 
ATOM   6754 N  N1    . A   B  1 156 ? -4.293  15.047  12.502 1.00 32.33  ? 170 A   A N1    1 
ATOM   6755 C  C2    . A   B  1 156 ? -3.008  14.976  12.875 1.00 32.23  ? 170 A   A C2    1 
ATOM   6756 N  N3    . A   B  1 156 ? -1.912  15.232  12.165 1.00 30.23  ? 170 A   A N3    1 
ATOM   6757 C  C4    . A   B  1 156 ? -2.231  15.609  10.920 1.00 29.83  ? 170 A   A C4    1 
ATOM   6758 P  P     . G   B  1 157 ? 1.740   11.982  8.056  1.00 37.17  ? 171 G   A P     1 
ATOM   6759 O  OP1   . G   B  1 157 ? 2.999   11.334  7.606  1.00 34.93  ? 171 G   A OP1   1 
ATOM   6760 O  OP2   . G   B  1 157 ? 0.531   11.929  7.193  1.00 33.22  ? 171 G   A OP2   1 
ATOM   6761 O  "O5'" . G   B  1 157 ? 1.375   11.483  9.521  1.00 36.47  ? 171 G   A "O5'" 1 
ATOM   6762 C  "C5'" . G   B  1 157 ? 2.360   11.463  10.541 1.00 33.27  ? 171 G   A "C5'" 1 
ATOM   6763 C  "C4'" . G   B  1 157 ? 1.839   10.768  11.768 1.00 36.75  ? 171 G   A "C4'" 1 
ATOM   6764 O  "O4'" . G   B  1 157 ? 0.882   11.625  12.436 1.00 36.97  ? 171 G   A "O4'" 1 
ATOM   6765 C  "C3'" . G   B  1 157 ? 1.070   9.480   11.514 1.00 33.85  ? 171 G   A "C3'" 1 
ATOM   6766 O  "O3'" . G   B  1 157 ? 1.920   8.360   11.353 1.00 36.62  ? 171 G   A "O3'" 1 
ATOM   6767 C  "C2'" . G   B  1 157 ? 0.182   9.389   12.743 1.00 33.51  ? 171 G   A "C2'" 1 
ATOM   6768 O  "O2'" . G   B  1 157 ? 0.969   9.020   13.868 1.00 32.33  ? 171 G   A "O2'" 1 
ATOM   6769 C  "C1'" . G   B  1 157 ? -0.192  10.852  12.928 1.00 33.38  ? 171 G   A "C1'" 1 
ATOM   6770 N  N9    . G   B  1 157 ? -1.405  11.281  12.204 1.00 31.37  ? 171 G   A N9    1 
ATOM   6771 C  C8    . G   B  1 157 ? -1.452  11.914  10.985 1.00 33.66  ? 171 G   A C8    1 
ATOM   6772 N  N7    . G   B  1 157 ? -2.666  12.218  10.611 1.00 31.93  ? 171 G   A N7    1 
ATOM   6773 C  C5    . G   B  1 157 ? -3.474  11.780  11.647 1.00 30.08  ? 171 G   A C5    1 
ATOM   6774 C  C6    . G   B  1 157 ? -4.884  11.844  11.813 1.00 26.53  ? 171 G   A C6    1 
ATOM   6775 O  O6    . G   B  1 157 ? -5.749  12.304  11.058 1.00 26.77  ? 171 G   A O6    1 
ATOM   6776 N  N1    . G   B  1 157 ? -5.281  11.290  13.020 1.00 28.17  ? 171 G   A N1    1 
ATOM   6777 C  C2    . G   B  1 157 ? -4.432  10.729  13.943 1.00 29.63  ? 171 G   A C2    1 
ATOM   6778 N  N2    . G   B  1 157 ? -5.010  10.232  15.047 1.00 29.57  ? 171 G   A N2    1 
ATOM   6779 N  N3    . G   B  1 157 ? -3.115  10.667  13.807 1.00 31.50  ? 171 G   A N3    1 
ATOM   6780 C  C4    . G   B  1 157 ? -2.706  11.210  12.642 1.00 31.83  ? 171 G   A C4    1 
ATOM   6781 P  P     . C   B  1 158 ? 1.477   7.082   10.486 1.00 39.94  ? 172 C   A P     1 
ATOM   6782 O  OP1   . C   B  1 158 ? 2.707   6.258   10.443 1.00 41.31  ? 172 C   A OP1   1 
ATOM   6783 O  OP2   . C   B  1 158 ? 0.876   7.573   9.218  1.00 36.67  ? 172 C   A OP2   1 
ATOM   6784 O  "O5'" . C   B  1 158 ? 0.365   6.351   11.346 1.00 34.90  ? 172 C   A "O5'" 1 
ATOM   6785 C  "C5'" . C   B  1 158 ? 0.637   5.713   12.585 1.00 35.32  ? 172 C   A "C5'" 1 
ATOM   6786 C  "C4'" . C   B  1 158 ? -0.654  5.376   13.287 1.00 35.25  ? 172 C   A "C4'" 1 
ATOM   6787 O  "O4'" . C   B  1 158 ? -1.394  6.595   13.550 1.00 32.30  ? 172 C   A "O4'" 1 
ATOM   6788 C  "C3'" . C   B  1 158 ? -1.647  4.539   12.493 1.00 35.14  ? 172 C   A "C3'" 1 
ATOM   6789 O  "O3'" . C   B  1 158 ? -1.327  3.162   12.474 1.00 36.14  ? 172 C   A "O3'" 1 
ATOM   6790 C  "C2'" . C   B  1 158 ? -2.959  4.855   13.196 1.00 35.39  ? 172 C   A "C2'" 1 
ATOM   6791 O  "O2'" . C   B  1 158 ? -3.008  4.233   14.472 1.00 38.03  ? 172 C   A "O2'" 1 
ATOM   6792 C  "C1'" . C   B  1 158 ? -2.780  6.351   13.433 1.00 33.51  ? 172 C   A "C1'" 1 
ATOM   6793 N  N1    . C   B  1 158 ? -3.345  7.186   12.348 1.00 31.00  ? 172 C   A N1    1 
ATOM   6794 C  C2    . C   B  1 158 ? -4.702  7.487   12.407 1.00 30.55  ? 172 C   A C2    1 
ATOM   6795 O  O2    . C   B  1 158 ? -5.360  7.036   13.357 1.00 33.47  ? 172 C   A O2    1 
ATOM   6796 N  N3    . C   B  1 158 ? -5.260  8.253   11.440 1.00 28.52  ? 172 C   A N3    1 
ATOM   6797 C  C4    . C   B  1 158 ? -4.494  8.715   10.440 1.00 30.76  ? 172 C   A C4    1 
ATOM   6798 N  N4    . C   B  1 158 ? -5.080  9.476   9.510  1.00 27.55  ? 172 C   A N4    1 
ATOM   6799 C  C5    . C   B  1 158 ? -3.100  8.423   10.350 1.00 29.68  ? 172 C   A C5    1 
ATOM   6800 C  C6    . C   B  1 158 ? -2.571  7.661   11.318 1.00 31.18  ? 172 C   A C6    1 
ATOM   6801 P  P     . C   B  1 159 ? -1.449  2.272   11.132 1.00 40.84  ? 173 C   A P     1 
ATOM   6802 O  OP1   . C   B  1 159 ? -0.562  1.118   11.440 1.00 36.55  ? 173 C   A OP1   1 
ATOM   6803 O  OP2   . C   B  1 159 ? -1.195  3.114   9.938  1.00 37.39  ? 173 C   A OP2   1 
ATOM   6804 O  "O5'" . C   B  1 159 ? -2.985  1.865   11.154 1.00 35.20  ? 173 C   A "O5'" 1 
ATOM   6805 C  "C5'" . C   B  1 159 ? -3.532  1.110   12.220 1.00 35.26  ? 173 C   A "C5'" 1 
ATOM   6806 C  "C4'" . C   B  1 159 ? -5.008  1.372   12.344 1.00 35.35  ? 173 C   A "C4'" 1 
ATOM   6807 O  "O4'" . C   B  1 159 ? -5.230  2.798   12.476 1.00 37.10  ? 173 C   A "O4'" 1 
ATOM   6808 C  "C3'" . C   B  1 159 ? -5.871  0.973   11.156 1.00 33.28  ? 173 C   A "C3'" 1 
ATOM   6809 O  "O3'" . C   B  1 159 ? -6.204  -0.404  11.139 1.00 35.37  ? 173 C   A "O3'" 1 
ATOM   6810 C  "C2'" . C   B  1 159 ? -7.091  1.857   11.341 1.00 33.38  ? 173 C   A "C2'" 1 
ATOM   6811 O  "O2'" . C   B  1 159 ? -7.925  1.319   12.358 1.00 36.26  ? 173 C   A "O2'" 1 
ATOM   6812 C  "C1'" . C   B  1 159 ? -6.453  3.144   11.863 1.00 31.43  ? 173 C   A "C1'" 1 
ATOM   6813 N  N1    . C   B  1 159 ? -6.194  4.127   10.791 1.00 31.02  ? 173 C   A N1    1 
ATOM   6814 C  C2    . C   B  1 159 ? -7.235  4.977   10.429 1.00 30.29  ? 173 C   A C2    1 
ATOM   6815 O  O2    . C   B  1 159 ? -8.309  4.847   11.020 1.00 31.89  ? 173 C   A O2    1 
ATOM   6816 N  N3    . C   B  1 159 ? -7.050  5.902   9.459  1.00 30.95  ? 173 C   A N3    1 
ATOM   6817 C  C4    . C   B  1 159 ? -5.867  5.995   8.859  1.00 30.00  ? 173 C   A C4    1 
ATOM   6818 N  N4    . C   B  1 159 ? -5.715  6.923   7.905  1.00 29.31  ? 173 C   A N4    1 
ATOM   6819 C  C5    . C   B  1 159 ? -4.780  5.137   9.210  1.00 34.12  ? 173 C   A C5    1 
ATOM   6820 C  C6    . C   B  1 159 ? -4.983  4.223   10.173 1.00 30.60  ? 173 C   A C6    1 
ATOM   6821 P  P     . C   B  1 160 ? -6.519  -1.196  9.767  1.00 35.70  ? 174 C   A P     1 
ATOM   6822 O  OP1   . C   B  1 160 ? -6.633  -2.615  10.187 1.00 38.15  ? 174 C   A OP1   1 
ATOM   6823 O  OP2   . C   B  1 160 ? -5.489  -0.814  8.775  1.00 32.58  ? 174 C   A OP2   1 
ATOM   6824 O  "O5'" . C   B  1 160 ? -7.941  -0.680  9.324  1.00 30.55  ? 174 C   A "O5'" 1 
ATOM   6825 C  "C5'" . C   B  1 160 ? -9.053  -0.862  10.183 1.00 33.05  ? 174 C   A "C5'" 1 
ATOM   6826 C  "C4'" . C   B  1 160 ? -10.246 -0.085  9.698  1.00 31.69  ? 174 C   A "C4'" 1 
ATOM   6827 O  "O4'" . C   B  1 160 ? -9.971  1.338   9.786  1.00 35.67  ? 174 C   A "O4'" 1 
ATOM   6828 C  "C3'" . C   B  1 160 ? -10.643 -0.304  8.245  1.00 31.83  ? 174 C   A "C3'" 1 
ATOM   6829 O  "O3'" . C   B  1 160 ? -11.431 -1.466  8.059  1.00 40.03  ? 174 C   A "O3'" 1 
ATOM   6830 C  "C2'" . C   B  1 160 ? -11.400 0.975   7.921  1.00 33.26  ? 174 C   A "C2'" 1 
ATOM   6831 O  "O2'" . C   B  1 160 ? -12.695 0.935   8.498  1.00 37.64  ? 174 C   A "O2'" 1 
ATOM   6832 C  "C1'" . C   B  1 160 ? -10.592 2.005   8.707  1.00 33.36  ? 174 C   A "C1'" 1 
ATOM   6833 N  N1    . C   B  1 160 ? -9.541  2.663   7.919  1.00 31.66  ? 174 C   A N1    1 
ATOM   6834 C  C2    . C   B  1 160 ? -9.933  3.701   7.068  1.00 29.49  ? 174 C   A C2    1 
ATOM   6835 O  O2    . C   B  1 160 ? -11.144 3.994   7.016  1.00 28.88  ? 174 C   A O2    1 
ATOM   6836 N  N3    . C   B  1 160 ? -8.989  4.340   6.343  1.00 27.86  ? 174 C   A N3    1 
ATOM   6837 C  C4    . C   B  1 160 ? -7.716  3.974   6.452  1.00 28.52  ? 174 C   A C4    1 
ATOM   6838 N  N4    . C   B  1 160 ? -6.825  4.628   5.721  1.00 26.18  ? 174 C   A N4    1 
ATOM   6839 C  C5    . C   B  1 160 ? -7.296  2.915   7.312  1.00 28.72  ? 174 C   A C5    1 
ATOM   6840 C  C6    . C   B  1 160 ? -8.237  2.286   8.023  1.00 29.36  ? 174 C   A C6    1 
ATOM   6841 P  P     . A   B  1 161 ? -11.404 -2.279  6.672  1.00 39.78  ? 175 A   A P     1 
ATOM   6842 O  OP1   . A   B  1 161 ? -12.156 -3.516  6.994  1.00 48.12  ? 175 A   A OP1   1 
ATOM   6843 O  OP2   . A   B  1 161 ? -9.996  -2.362  6.205  1.00 32.66  ? 175 A   A OP2   1 
ATOM   6844 O  "O5'" . A   B  1 161 ? -12.258 -1.381  5.678  1.00 36.71  ? 175 A   A "O5'" 1 
ATOM   6845 C  "C5'" . A   B  1 161 ? -13.640 -1.124  5.906  1.00 35.48  ? 175 A   A "C5'" 1 
ATOM   6846 C  "C4'" . A   B  1 161 ? -14.242 -0.326  4.776  1.00 38.45  ? 175 A   A "C4'" 1 
ATOM   6847 O  "O4'" . A   B  1 161 ? -13.491 0.915   4.634  1.00 36.54  ? 175 A   A "O4'" 1 
ATOM   6848 C  "C3'" . A   B  1 161 ? -14.206 -1.019  3.414  1.00 36.89  ? 175 A   A "C3'" 1 
ATOM   6849 O  "O3'" . A   B  1 161 ? -15.374 -0.706  2.652  1.00 44.24  ? 175 A   A "O3'" 1 
ATOM   6850 C  "C2'" . A   B  1 161 ? -12.988 -0.396  2.747  1.00 39.55  ? 175 A   A "C2'" 1 
ATOM   6851 O  "O2'" . A   B  1 161 ? -13.052 -0.426  1.333  1.00 39.93  ? 175 A   A "O2'" 1 
ATOM   6852 C  "C1'" . A   B  1 161 ? -12.986 1.028   3.320  1.00 35.27  ? 175 A   A "C1'" 1 
ATOM   6853 N  N9    . A   B  1 161 ? -11.644 1.626   3.384  1.00 37.75  ? 175 A   A N9    1 
ATOM   6854 C  C8    . A   B  1 161 ? -10.536 1.126   4.024  1.00 32.38  ? 175 A   A C8    1 
ATOM   6855 N  N7    . A   B  1 161 ? -9.464  1.860   3.884  1.00 29.10  ? 175 A   A N7    1 
ATOM   6856 C  C5    . A   B  1 161 ? -9.881  2.916   3.098  1.00 29.54  ? 175 A   A C5    1 
ATOM   6857 C  C6    . A   B  1 161 ? -9.206  4.036   2.591  1.00 28.78  ? 175 A   A C6    1 
ATOM   6858 N  N6    . A   B  1 161 ? -7.913  4.306   2.806  1.00 28.63  ? 175 A   A N6    1 
ATOM   6859 N  N1    . A   B  1 161 ? -9.918  4.897   1.833  1.00 28.61  ? 175 A   A N1    1 
ATOM   6860 C  C2    . A   B  1 161 ? -11.208 4.637   1.612  1.00 29.11  ? 175 A   A C2    1 
ATOM   6861 N  N3    . A   B  1 161 ? -11.947 3.616   2.029  1.00 30.62  ? 175 A   A N3    1 
ATOM   6862 C  C4    . A   B  1 161 ? -11.216 2.785   2.782  1.00 29.92  ? 175 A   A C4    1 
HETATM 6863 K  K     . K   C  2 .   ? 28.634  22.015  25.852 1.00 26.00  ? 1   K   X K     1 
HETATM 6864 K  K     . K   D  2 .   ? 37.861  7.215   11.818 1.00 41.42  ? 2   K   X K     1 
HETATM 6865 K  K     . K   E  2 .   ? 43.122  16.365  29.908 1.00 78.37  ? 3   K   X K     1 
HETATM 6866 MN MN    . MN  F  3 .   ? 31.808  26.463  12.336 1.00 20.70  ? 176 MN  X MN    1 
HETATM 6867 MN MN    . MN  G  3 .   ? 32.699  26.866  18.905 1.00 19.22  ? 177 MN  X MN    1 
HETATM 6868 MN MN    . MN  H  3 .   ? 35.640  21.291  26.450 1.00 22.38  ? 178 MN  X MN    1 
HETATM 6869 MN MN    . MN  I  3 .   ? 46.164  13.925  19.772 0.85 37.38  ? 4   MN  X MN    1 
HETATM 6870 MN MN    . MN  J  3 .   ? 14.275  -10.414 9.833  1.00 68.86  ? 7   MN  X MN    1 
HETATM 6871 MN MN    . MN  K  3 .   ? 7.076   1.706   25.601 0.79 36.09  ? 9   MN  X MN    1 
HETATM 6872 MN MN    . MN  L  3 .   ? 31.781  14.084  9.041  0.88 23.35  ? 10  MN  X MN    1 
HETATM 6873 MN MN    . MN  M  3 .   ? -11.943 -4.486  17.988 1.00 51.36  ? 12  MN  X MN    1 
HETATM 6874 MN MN    . MN  N  3 .   ? -14.720 -22.749 25.930 1.00 40.95  ? 13  MN  X MN    1 
HETATM 6875 MN MN    . MN  O  3 .   ? 15.655  23.082  27.555 1.00 23.52  ? 14  MN  X MN    1 
HETATM 6876 MN MN    . MN  P  3 .   ? 44.462  40.210  0.414  1.00 36.10  ? 179 MN  X MN    1 
HETATM 6877 MN MN    . MN  Q  3 .   ? -10.445 -16.105 20.173 1.00 32.24  ? 180 MN  X MN    1 
HETATM 6878 K  K     . K   R  2 .   ? 8.088   33.988  23.481 1.00 23.50  ? 1   K   A K     1 
HETATM 6879 K  K     . K   S  2 .   ? -0.623  47.001  7.796  1.00 34.18  ? 2   K   A K     1 
HETATM 6880 K  K     . K   T  2 .   ? -7.504  39.757  26.355 1.00 78.10  ? 3   K   A K     1 
HETATM 6881 MN MN    . MN  U  3 .   ? 5.266   27.976  10.441 1.00 21.00  ? 176 MN  A MN    1 
HETATM 6882 MN MN    . MN  V  3 .   ? 4.356   28.346  16.921 1.00 18.81  ? 177 MN  A MN    1 
HETATM 6883 MN MN    . MN  W  3 .   ? 0.932   34.827  23.684 1.00 19.49  ? 178 MN  A MN    1 
HETATM 6884 MN MN    . MN  X  3 .   ? -9.227  41.571  16.030 0.40 31.27  ? 4   MN  A MN    1 
HETATM 6885 MN MN    . MN  Y  3 .   ? -3.548  55.818  18.261 1.00 40.80  ? 5   MN  A MN    1 
HETATM 6886 MN MN    . MN  Z  3 .   ? 6.543   66.302  19.172 1.00 34.43  ? 6   MN  A MN    1 
HETATM 6887 MN MN    . MN  AA 3 .   ? 21.823  65.132  4.291  0.82 45.49  ? 7   MN  A MN    1 
HETATM 6888 MN MN    . MN  BA 3 .   ? 28.733  54.760  21.873 1.00 39.68  ? 9   MN  A MN    1 
HETATM 6889 MN MN    . MN  CA 3 .   ? 5.429   39.804  5.608  0.94 24.77  ? 10  MN  A MN    1 
HETATM 6890 MN MN    . MN  DA 3 .   ? 6.713   57.986  14.460 1.00 29.12  ? 11  MN  A MN    1 
HETATM 6891 MN MN    . MN  EA 3 .   ? 44.860  63.077  9.298  1.00 46.20  ? 12  MN  A MN    1 
HETATM 6892 MN MN    . MN  FA 3 .   ? 49.042  75.254  24.950 1.00 27.91  ? 13  MN  A MN    1 
HETATM 6893 MN MN    . MN  GA 3 .   ? -6.860  10.450  2.933  1.00 50.16  ? 179 MN  A MN    1 
HETATM 6894 O  O     . HOH HA 4 .   ? 23.108  13.940  10.608 1.00 21.54  ? 8   HOH X O     1 
HETATM 6895 O  O     . HOH HA 4 .   ? 43.268  30.805  18.257 1.00 34.90  ? 181 HOH X O     1 
HETATM 6896 O  O     . HOH HA 4 .   ? 36.195  8.054   21.627 1.00 29.40  ? 182 HOH X O     1 
HETATM 6897 O  O     . HOH HA 4 .   ? 18.076  8.890   26.010 1.00 20.20  ? 183 HOH X O     1 
HETATM 6898 O  O     . HOH HA 4 .   ? 54.240  38.674  13.068 1.00 23.46  ? 184 HOH X O     1 
HETATM 6899 O  O     . HOH HA 4 .   ? 26.410  25.050  6.997  1.00 26.91  ? 185 HOH X O     1 
HETATM 6900 O  O     . HOH HA 4 .   ? 35.004  5.647   12.073 1.00 32.12  ? 186 HOH X O     1 
HETATM 6901 O  O     . HOH HA 4 .   ? 30.440  24.547  12.025 1.00 18.57  ? 187 HOH X O     1 
HETATM 6902 O  O     . HOH HA 4 .   ? 25.039  11.320  -2.779 1.00 25.22  ? 188 HOH X O     1 
HETATM 6903 O  O     . HOH HA 4 .   ? 36.730  21.001  11.458 1.00 21.27  ? 189 HOH X O     1 
HETATM 6904 O  O     . HOH HA 4 .   ? 40.672  22.776  10.156 1.00 26.46  ? 190 HOH X O     1 
HETATM 6905 O  O     . HOH HA 4 .   ? 14.726  20.694  17.099 1.00 20.20  ? 191 HOH X O     1 
HETATM 6906 O  O     . HOH HA 4 .   ? 8.015   10.709  28.798 1.00 35.08  ? 192 HOH X O     1 
HETATM 6907 O  O     . HOH HA 4 .   ? 43.431  47.519  2.565  1.00 30.91  ? 193 HOH X O     1 
HETATM 6908 O  O     . HOH HA 4 .   ? 17.132  -14.563 22.688 1.00 30.93  ? 194 HOH X O     1 
HETATM 6909 O  O     . HOH HA 4 .   ? 41.075  31.621  19.862 1.00 32.40  ? 195 HOH X O     1 
HETATM 6910 O  O     . HOH HA 4 .   ? 38.522  20.548  9.536  1.00 20.96  ? 196 HOH X O     1 
HETATM 6911 O  O     . HOH HA 4 .   ? 20.156  19.757  31.491 1.00 23.60  ? 197 HOH X O     1 
HETATM 6912 O  O     . HOH HA 4 .   ? 23.619  -7.917  36.552 1.00 37.29  ? 198 HOH X O     1 
HETATM 6913 O  O     . HOH HA 4 .   ? 22.015  15.899  35.131 1.00 34.92  ? 199 HOH X O     1 
HETATM 6914 O  O     . HOH HA 4 .   ? 13.606  13.982  12.879 1.00 26.09  ? 200 HOH X O     1 
HETATM 6915 O  O     . HOH HA 4 .   ? 30.884  5.985   13.071 1.00 29.89  ? 201 HOH X O     1 
HETATM 6916 O  O     . HOH HA 4 .   ? 19.792  13.462  33.172 1.00 35.12  ? 202 HOH X O     1 
HETATM 6917 O  O     . HOH HA 4 .   ? 34.163  28.632  18.648 1.00 20.44  ? 203 HOH X O     1 
HETATM 6918 O  O     . HOH HA 4 .   ? 22.981  20.496  18.830 1.00 21.34  ? 204 HOH X O     1 
HETATM 6919 O  O     . HOH HA 4 .   ? 47.771  15.550  13.852 1.00 31.52  ? 205 HOH X O     1 
HETATM 6920 O  O     . HOH HA 4 .   ? 17.620  8.993   20.950 1.00 26.41  ? 206 HOH X O     1 
HETATM 6921 O  O     . HOH HA 4 .   ? 22.475  28.798  20.530 1.00 22.73  ? 207 HOH X O     1 
HETATM 6922 O  O     . HOH HA 4 .   ? 24.028  -17.786 12.026 1.00 38.93  ? 208 HOH X O     1 
HETATM 6923 O  O     . HOH HA 4 .   ? 31.126  28.429  18.500 1.00 17.90  ? 209 HOH X O     1 
HETATM 6924 O  O     . HOH HA 4 .   ? -1.034  1.237   25.747 1.00 34.37  ? 210 HOH X O     1 
HETATM 6925 O  O     . HOH HA 4 .   ? 35.605  24.484  24.142 1.00 25.17  ? 211 HOH X O     1 
HETATM 6926 O  O     . HOH HA 4 .   ? 27.548  22.947  23.187 1.00 16.45  ? 212 HOH X O     1 
HETATM 6927 O  O     . HOH HA 4 .   ? 29.543  23.791  21.626 1.00 19.33  ? 213 HOH X O     1 
HETATM 6928 O  O     . HOH HA 4 .   ? 17.592  11.231  19.290 1.00 32.77  ? 214 HOH X O     1 
HETATM 6929 O  O     . HOH HA 4 .   ? 39.519  24.308  11.805 1.00 23.05  ? 215 HOH X O     1 
HETATM 6930 O  O     . HOH HA 4 .   ? 17.578  28.606  29.641 1.00 29.37  ? 216 HOH X O     1 
HETATM 6931 O  O     . HOH HA 4 .   ? 45.806  49.451  -0.411 1.00 39.18  ? 217 HOH X O     1 
HETATM 6932 O  O     . HOH HA 4 .   ? 26.412  17.346  20.091 1.00 19.43  ? 218 HOH X O     1 
HETATM 6933 O  O     . HOH HA 4 .   ? -2.175  -23.247 23.410 1.00 34.84  ? 219 HOH X O     1 
HETATM 6934 O  O     . HOH HA 4 .   ? 14.897  -17.246 32.370 1.00 37.70  ? 220 HOH X O     1 
HETATM 6935 O  O     . HOH HA 4 .   ? 15.833  15.987  32.462 1.00 27.20  ? 221 HOH X O     1 
HETATM 6936 O  O     . HOH HA 4 .   ? 28.024  24.888  10.895 1.00 27.50  ? 222 HOH X O     1 
HETATM 6937 O  O     . HOH HA 4 .   ? 24.561  6.789   17.142 1.00 32.77  ? 223 HOH X O     1 
HETATM 6938 O  O     . HOH HA 4 .   ? 21.673  13.495  12.978 1.00 22.84  ? 224 HOH X O     1 
HETATM 6939 O  O     . HOH HA 4 .   ? 22.035  12.477  15.610 1.00 21.10  ? 225 HOH X O     1 
HETATM 6940 O  O     . HOH HA 4 .   ? 12.087  19.735  16.905 1.00 28.67  ? 226 HOH X O     1 
HETATM 6941 O  O     . HOH HA 4 .   ? 36.932  31.235  10.938 1.00 30.54  ? 227 HOH X O     1 
HETATM 6942 O  O     . HOH HA 4 .   ? 46.589  36.869  3.669  1.00 25.76  ? 228 HOH X O     1 
HETATM 6943 O  O     . HOH HA 4 .   ? 10.766  -14.342 23.819 1.00 27.53  ? 229 HOH X O     1 
HETATM 6944 O  O     . HOH HA 4 .   ? 7.696   -11.173 23.971 1.00 30.06  ? 230 HOH X O     1 
HETATM 6945 O  O     . HOH HA 4 .   ? 32.069  29.448  24.859 1.00 27.32  ? 231 HOH X O     1 
HETATM 6946 O  O     . HOH HA 4 .   ? 14.646  -10.907 24.429 1.00 32.12  ? 232 HOH X O     1 
HETATM 6947 O  O     . HOH HA 4 .   ? 25.654  11.985  14.058 1.00 24.50  ? 233 HOH X O     1 
HETATM 6948 O  O     . HOH HA 4 .   ? 37.910  21.310  17.453 1.00 19.07  ? 234 HOH X O     1 
HETATM 6949 O  O     . HOH HA 4 .   ? 11.494  22.915  18.820 1.00 28.75  ? 235 HOH X O     1 
HETATM 6950 O  O     . HOH HA 4 .   ? 28.712  18.251  28.127 1.00 26.88  ? 236 HOH X O     1 
HETATM 6951 O  O     . HOH HA 4 .   ? -11.264 6.154   14.962 1.00 35.49  ? 237 HOH X O     1 
HETATM 6952 O  O     . HOH HA 4 .   ? 23.200  26.422  16.416 1.00 26.07  ? 238 HOH X O     1 
HETATM 6953 O  O     . HOH HA 4 .   ? 24.426  18.039  31.625 1.00 25.74  ? 239 HOH X O     1 
HETATM 6954 O  O     . HOH HA 4 .   ? 14.203  -23.677 20.636 1.00 27.91  ? 240 HOH X O     1 
HETATM 6955 O  O     . HOH HA 4 .   ? 27.306  16.929  10.140 1.00 23.33  ? 241 HOH X O     1 
HETATM 6956 O  O     . HOH HA 4 .   ? 17.313  18.806  28.002 1.00 28.20  ? 242 HOH X O     1 
HETATM 6957 O  O     . HOH HA 4 .   ? 19.944  -15.834 22.392 1.00 27.76  ? 243 HOH X O     1 
HETATM 6958 O  O     . HOH HA 4 .   ? 17.133  -9.812  26.360 1.00 32.01  ? 244 HOH X O     1 
HETATM 6959 O  O     . HOH HA 4 .   ? 15.887  -15.107 28.587 1.00 38.51  ? 245 HOH X O     1 
HETATM 6960 O  O     . HOH HA 4 .   ? 34.212  30.120  16.520 1.00 32.35  ? 246 HOH X O     1 
HETATM 6961 O  O     . HOH HA 4 .   ? 36.724  21.836  28.407 1.00 24.83  ? 247 HOH X O     1 
HETATM 6962 O  O     . HOH HA 4 .   ? -10.027 -21.539 23.412 1.00 31.92  ? 248 HOH X O     1 
HETATM 6963 O  O     . HOH HA 4 .   ? 18.374  12.810  15.180 1.00 30.10  ? 249 HOH X O     1 
HETATM 6964 O  O     . HOH HA 4 .   ? 17.879  21.872  31.294 1.00 29.41  ? 250 HOH X O     1 
HETATM 6965 O  O     . HOH HA 4 .   ? 14.863  13.497  17.070 1.00 29.85  ? 251 HOH X O     1 
HETATM 6966 O  O     . HOH HA 4 .   ? 27.591  6.138   2.121  1.00 38.16  ? 252 HOH X O     1 
HETATM 6967 O  O     . HOH HA 4 .   ? -8.058  -9.697  22.208 1.00 27.51  ? 253 HOH X O     1 
HETATM 6968 O  O     . HOH HA 4 .   ? -5.225  -3.107  27.738 1.00 31.11  ? 254 HOH X O     1 
HETATM 6969 O  O     . HOH HA 4 .   ? 20.908  -11.013 27.427 1.00 35.56  ? 255 HOH X O     1 
HETATM 6970 O  O     . HOH HA 4 .   ? 49.930  37.334  6.207  1.00 29.42  ? 256 HOH X O     1 
HETATM 6971 O  O     . HOH HA 4 .   ? 8.988   -22.979 25.682 1.00 33.94  ? 257 HOH X O     1 
HETATM 6972 O  O     . HOH HA 4 .   ? 9.809   -14.797 21.061 1.00 27.18  ? 258 HOH X O     1 
HETATM 6973 O  O     . HOH HA 4 .   ? -4.866  -8.369  21.272 1.00 28.45  ? 259 HOH X O     1 
HETATM 6974 O  O     . HOH HA 4 .   ? 24.897  7.850   31.731 1.00 35.81  ? 260 HOH X O     1 
HETATM 6975 O  O     . HOH HA 4 .   ? 10.699  15.586  16.894 1.00 34.73  ? 261 HOH X O     1 
HETATM 6976 O  O     . HOH HA 4 .   ? 13.394  -14.090 22.901 1.00 28.56  ? 262 HOH X O     1 
HETATM 6977 O  O     . HOH HA 4 .   ? 22.938  15.838  30.231 1.00 27.88  ? 263 HOH X O     1 
HETATM 6978 O  O     . HOH HA 4 .   ? 46.350  38.030  5.653  1.00 25.89  ? 264 HOH X O     1 
HETATM 6979 O  O     . HOH HA 4 .   ? 18.197  11.481  33.927 1.00 33.81  ? 265 HOH X O     1 
HETATM 6980 O  O     . HOH HA 4 .   ? 31.524  20.788  27.617 1.00 27.78  ? 266 HOH X O     1 
HETATM 6981 O  O     . HOH HA 4 .   ? 9.249   -6.123  19.652 1.00 35.26  ? 267 HOH X O     1 
HETATM 6982 O  O     . HOH HA 4 .   ? 7.692   6.283   37.515 1.00 37.51  ? 268 HOH X O     1 
HETATM 6983 O  O     . HOH HA 4 .   ? 22.375  -3.186  29.343 1.00 23.33  ? 269 HOH X O     1 
HETATM 6984 O  O     . HOH HA 4 .   ? 26.698  -16.515 12.302 1.00 45.34  ? 270 HOH X O     1 
HETATM 6985 O  O     . HOH HA 4 .   ? 40.222  36.926  6.155  1.00 34.00  ? 271 HOH X O     1 
HETATM 6986 O  O     . HOH HA 4 .   ? 34.159  19.970  27.469 1.00 19.78  ? 272 HOH X O     1 
HETATM 6987 O  O     . HOH HA 4 .   ? 21.312  10.930  19.425 1.00 34.41  ? 273 HOH X O     1 
HETATM 6988 O  O     . HOH HA 4 .   ? 45.722  28.776  27.229 1.00 42.56  ? 274 HOH X O     1 
HETATM 6989 O  O     . HOH HA 4 .   ? 27.941  29.411  16.649 1.00 27.01  ? 275 HOH X O     1 
HETATM 6990 O  O     . HOH HA 4 .   ? 48.851  26.628  25.710 1.00 41.54  ? 276 HOH X O     1 
HETATM 6991 O  O     . HOH HA 4 .   ? 10.319  14.385  30.357 1.00 33.43  ? 277 HOH X O     1 
HETATM 6992 O  O     . HOH HA 4 .   ? 45.842  30.116  16.331 1.00 29.17  ? 278 HOH X O     1 
HETATM 6993 O  O     . HOH HA 4 .   ? 37.147  22.884  25.535 1.00 21.95  ? 279 HOH X O     1 
HETATM 6994 O  O     . HOH HA 4 .   ? 27.856  14.368  11.472 1.00 26.58  ? 280 HOH X O     1 
HETATM 6995 O  O     . HOH HA 4 .   ? 19.574  15.939  31.548 1.00 31.16  ? 281 HOH X O     1 
HETATM 6996 O  O     . HOH HA 4 .   ? 2.933   -25.904 29.538 1.00 38.98  ? 282 HOH X O     1 
HETATM 6997 O  O     . HOH HA 4 .   ? 22.518  12.584  8.077  1.00 24.80  ? 283 HOH X O     1 
HETATM 6998 O  O     . HOH HA 4 .   ? -10.008 -22.625 21.264 1.00 28.92  ? 284 HOH X O     1 
HETATM 6999 O  O     . HOH HA 4 .   ? 24.396  -5.111  33.482 1.00 29.11  ? 285 HOH X O     1 
HETATM 7000 O  O     . HOH HA 4 .   ? 22.933  17.405  33.289 1.00 34.65  ? 286 HOH X O     1 
HETATM 7001 O  O     . HOH HA 4 .   ? 35.587  40.708  12.682 1.00 30.08  ? 287 HOH X O     1 
HETATM 7002 O  O     . HOH HA 4 .   ? 45.222  12.319  21.540 1.00 32.04  ? 288 HOH X O     1 
HETATM 7003 O  O     . HOH HA 4 .   ? 39.156  20.901  14.016 1.00 23.49  ? 289 HOH X O     1 
HETATM 7004 O  O     . HOH HA 4 .   ? 24.285  27.488  31.638 1.00 24.73  ? 290 HOH X O     1 
HETATM 7005 O  O     . HOH HA 4 .   ? -8.324  3.688   24.877 1.00 36.76  ? 291 HOH X O     1 
HETATM 7006 O  O     . HOH HA 4 .   ? 20.728  10.433  9.771  1.00 26.71  ? 292 HOH X O     1 
HETATM 7007 O  O     . HOH HA 4 .   ? 24.743  26.565  5.442  1.00 33.88  ? 293 HOH X O     1 
HETATM 7008 O  O     . HOH HA 4 .   ? 3.516   5.942   20.713 1.00 40.57  ? 294 HOH X O     1 
HETATM 7009 O  O     . HOH HA 4 .   ? 25.087  23.064  6.478  1.00 31.58  ? 295 HOH X O     1 
HETATM 7010 O  O     . HOH HA 4 .   ? 34.212  14.388  25.773 1.00 28.12  ? 296 HOH X O     1 
HETATM 7011 O  O     . HOH HA 4 .   ? 31.759  29.134  15.536 1.00 27.00  ? 297 HOH X O     1 
HETATM 7012 O  O     . HOH HA 4 .   ? 48.111  10.291  17.336 1.00 36.93  ? 298 HOH X O     1 
HETATM 7013 O  O     . HOH HA 4 .   ? 44.160  14.581  18.933 1.00 23.64  ? 299 HOH X O     1 
HETATM 7014 O  O     . HOH HA 4 .   ? -2.488  -10.477 23.440 1.00 32.03  ? 300 HOH X O     1 
HETATM 7015 O  O     . HOH HA 4 .   ? 19.771  -15.546 13.134 1.00 39.07  ? 301 HOH X O     1 
HETATM 7016 O  O     . HOH HA 4 .   ? 25.568  -12.954 30.124 1.00 34.48  ? 302 HOH X O     1 
HETATM 7017 O  O     . HOH HA 4 .   ? 22.534  6.365   10.883 1.00 34.12  ? 303 HOH X O     1 
HETATM 7018 O  O     . HOH HA 4 .   ? 30.170  27.348  22.457 1.00 15.48  ? 304 HOH X O     1 
HETATM 7019 O  O     . HOH HA 4 .   ? 36.088  31.933  13.181 1.00 30.51  ? 305 HOH X O     1 
HETATM 7020 O  O     . HOH HA 4 .   ? 1.133   -9.333  30.231 1.00 35.22  ? 306 HOH X O     1 
HETATM 7021 O  O     . HOH HA 4 .   ? 24.771  28.412  16.466 1.00 34.74  ? 307 HOH X O     1 
HETATM 7022 O  O     . HOH HA 4 .   ? 12.634  14.403  31.207 1.00 33.50  ? 308 HOH X O     1 
HETATM 7023 O  O     . HOH HA 4 .   ? 55.617  41.591  6.948  1.00 32.99  ? 309 HOH X O     1 
HETATM 7024 O  O     . HOH HA 4 .   ? 54.991  49.349  -3.394 1.00 43.57  ? 310 HOH X O     1 
HETATM 7025 O  O     . HOH HA 4 .   ? 10.554  22.019  22.852 1.00 25.36  ? 311 HOH X O     1 
HETATM 7026 O  O     . HOH HA 4 .   ? 9.312   -12.480 21.878 1.00 33.91  ? 312 HOH X O     1 
HETATM 7027 O  O     . HOH HA 4 .   ? 13.913  20.161  24.715 1.00 26.14  ? 313 HOH X O     1 
HETATM 7028 O  O     . HOH HA 4 .   ? -9.124  0.814   22.731 1.00 34.24  ? 314 HOH X O     1 
HETATM 7029 O  O     . HOH HA 4 .   ? 21.238  1.809   6.442  1.00 34.20  ? 315 HOH X O     1 
HETATM 7030 O  O     . HOH HA 4 .   ? 32.444  27.474  21.180 1.00 23.58  ? 316 HOH X O     1 
HETATM 7031 O  O     . HOH HA 4 .   ? 22.901  -12.594 27.208 1.00 32.54  ? 317 HOH X O     1 
HETATM 7032 O  O     . HOH HA 4 .   ? 45.955  37.030  11.847 1.00 28.96  ? 318 HOH X O     1 
HETATM 7033 O  O     . HOH HA 4 .   ? 13.697  13.760  33.630 1.00 35.35  ? 319 HOH X O     1 
HETATM 7034 O  O     . HOH HA 4 .   ? 24.532  15.410  3.252  1.00 27.90  ? 320 HOH X O     1 
HETATM 7035 O  O     . HOH HA 4 .   ? 32.946  26.096  24.211 1.00 28.97  ? 321 HOH X O     1 
HETATM 7036 O  O     . HOH HA 4 .   ? 21.116  24.836  36.482 1.00 25.99  ? 322 HOH X O     1 
HETATM 7037 O  O     . HOH HA 4 .   ? 37.416  28.507  22.555 1.00 34.82  ? 323 HOH X O     1 
HETATM 7038 O  O     . HOH HA 4 .   ? -1.773  -2.097  16.481 1.00 37.59  ? 324 HOH X O     1 
HETATM 7039 O  O     . HOH HA 4 .   ? 44.688  40.045  4.163  1.00 27.67  ? 325 HOH X O     1 
HETATM 7040 O  O     . HOH HA 4 .   ? 23.718  21.612  16.267 1.00 18.45  ? 326 HOH X O     1 
HETATM 7041 O  O     . HOH HA 4 .   ? 31.104  25.348  19.408 1.00 16.91  ? 327 HOH X O     1 
HETATM 7042 O  O     . HOH HA 4 .   ? 32.542  17.645  27.453 1.00 26.33  ? 328 HOH X O     1 
HETATM 7043 O  O     . HOH HA 4 .   ? 47.474  30.347  10.928 1.00 37.00  ? 329 HOH X O     1 
HETATM 7044 O  O     . HOH HA 4 .   ? 31.035  18.410  29.629 1.00 31.34  ? 330 HOH X O     1 
HETATM 7045 O  O     . HOH HA 4 .   ? 14.896  -15.241 31.068 1.00 40.78  ? 331 HOH X O     1 
HETATM 7046 O  O     . HOH HA 4 .   ? 39.742  20.678  26.434 1.00 23.74  ? 332 HOH X O     1 
HETATM 7047 O  O     . HOH HA 4 .   ? 45.990  38.012  17.132 1.00 31.81  ? 333 HOH X O     1 
HETATM 7048 O  O     . HOH HA 4 .   ? 10.062  11.527  23.174 1.00 36.05  ? 334 HOH X O     1 
HETATM 7049 O  O     . HOH HA 4 .   ? 30.028  19.547  7.323  1.00 30.76  ? 335 HOH X O     1 
HETATM 7050 O  O     . HOH HA 4 .   ? 49.952  26.688  23.505 1.00 42.10  ? 336 HOH X O     1 
HETATM 7051 O  O     . HOH HA 4 .   ? 10.554  -12.955 25.952 1.00 29.50  ? 337 HOH X O     1 
HETATM 7052 O  O     . HOH HA 4 .   ? 23.987  2.759   28.839 1.00 33.75  ? 338 HOH X O     1 
HETATM 7053 O  O     . HOH HA 4 .   ? 19.928  -0.563  7.663  1.00 32.88  ? 339 HOH X O     1 
HETATM 7054 O  O     . HOH HA 4 .   ? 31.564  22.592  25.119 1.00 27.10  ? 342 HOH X O     1 
HETATM 7055 O  O     . HOH HA 4 .   ? 1.800   5.259   25.020 1.00 37.27  ? 347 HOH X O     1 
HETATM 7056 O  O     . HOH HA 4 .   ? 3.329   -20.262 28.802 1.00 30.47  ? 348 HOH X O     1 
HETATM 7057 O  O     . HOH HA 4 .   ? 22.823  13.472  31.138 1.00 32.11  ? 356 HOH X O     1 
HETATM 7058 O  O     . HOH HA 4 .   ? 17.166  14.112  13.494 1.00 27.63  ? 358 HOH X O     1 
HETATM 7059 O  O     . HOH HA 4 .   ? 31.472  13.881  25.412 1.00 33.46  ? 360 HOH X O     1 
HETATM 7060 O  O     . HOH HA 4 .   ? 41.193  20.373  12.387 1.00 32.94  ? 361 HOH X O     1 
HETATM 7061 O  O     . HOH HA 4 .   ? -21.159 -20.491 25.800 1.00 36.33  ? 362 HOH X O     1 
HETATM 7062 O  O     . HOH HA 4 .   ? 35.319  33.880  10.502 1.00 36.67  ? 365 HOH X O     1 
HETATM 7063 O  O     . HOH HA 4 .   ? -7.580  1.919   26.918 1.00 36.84  ? 366 HOH X O     1 
HETATM 7064 O  O     . HOH HA 4 .   ? 13.053  -13.126 20.456 1.00 28.70  ? 367 HOH X O     1 
HETATM 7065 O  O     . HOH HA 4 .   ? -13.481 -28.854 22.644 1.00 36.93  ? 369 HOH X O     1 
HETATM 7066 O  O     . HOH HA 4 .   ? 1.285   3.805   22.865 1.00 33.88  ? 371 HOH X O     1 
HETATM 7067 O  O     . HOH HA 4 .   ? 4.771   -4.884  20.208 1.00 40.02  ? 374 HOH X O     1 
HETATM 7068 O  O     . HOH HA 4 .   ? 10.071  14.975  32.849 1.00 39.98  ? 377 HOH X O     1 
HETATM 7069 O  O     . HOH HA 4 .   ? 27.278  28.533  9.910  1.00 39.07  ? 378 HOH X O     1 
HETATM 7070 O  O     . HOH HA 4 .   ? -1.284  2.005   15.697 1.00 37.44  ? 381 HOH X O     1 
HETATM 7071 O  O     . HOH HA 4 .   ? 5.258   -22.049 29.017 1.00 30.52  ? 382 HOH X O     1 
HETATM 7072 O  O     . HOH HA 4 .   ? 30.597  -2.021  26.437 1.00 29.79  ? 385 HOH X O     1 
HETATM 7073 O  O     . HOH HA 4 .   ? 19.490  12.716  11.380 1.00 24.92  ? 391 HOH X O     1 
HETATM 7074 O  O     . HOH HA 4 .   ? -2.521  0.590   35.944 1.00 43.51  ? 393 HOH X O     1 
HETATM 7075 O  O     . HOH HA 4 .   ? 21.936  -12.105 30.235 1.00 38.08  ? 397 HOH X O     1 
HETATM 7076 O  O     . HOH HA 4 .   ? 21.007  14.683  36.913 1.00 41.89  ? 400 HOH X O     1 
HETATM 7077 O  O     . HOH HA 4 .   ? 18.897  10.595  23.143 1.00 23.07  ? 401 HOH X O     1 
HETATM 7078 O  O     . HOH HA 4 .   ? -7.296  3.883   34.309 1.00 41.64  ? 403 HOH X O     1 
HETATM 7079 O  O     . HOH HA 4 .   ? 27.477  15.929  27.642 1.00 35.26  ? 404 HOH X O     1 
HETATM 7080 O  O     . HOH HA 4 .   ? 45.587  33.499  16.940 1.00 32.93  ? 408 HOH X O     1 
HETATM 7081 O  O     . HOH HA 4 .   ? 21.071  27.451  27.328 1.00 25.54  ? 411 HOH X O     1 
HETATM 7082 O  O     . HOH HA 4 .   ? -8.604  -2.715  24.533 1.00 37.40  ? 412 HOH X O     1 
HETATM 7083 O  O     . HOH HA 4 .   ? 42.483  54.470  6.755  1.00 35.27  ? 414 HOH X O     1 
HETATM 7084 O  O     . HOH HA 4 .   ? 15.634  -13.098 24.859 1.00 41.03  ? 417 HOH X O     1 
HETATM 7085 O  O     . HOH HA 4 .   ? 13.911  -13.594 27.303 1.00 36.70  ? 419 HOH X O     1 
HETATM 7086 O  O     . HOH HA 4 .   ? 1.400   -23.433 21.361 1.00 33.05  ? 420 HOH X O     1 
HETATM 7087 O  O     . HOH HA 4 .   ? 24.337  12.063  4.512  1.00 29.20  ? 421 HOH X O     1 
HETATM 7088 O  O     . HOH HA 4 .   ? 16.521  11.446  11.790 1.00 33.19  ? 422 HOH X O     1 
HETATM 7089 O  O     . HOH HA 4 .   ? -15.522 -7.131  16.227 1.00 43.33  ? 423 HOH X O     1 
HETATM 7090 O  O     . HOH HA 4 .   ? 6.971   9.167   26.877 1.00 31.26  ? 426 HOH X O     1 
HETATM 7091 O  O     . HOH HA 4 .   ? 26.287  15.151  -1.348 1.00 34.65  ? 427 HOH X O     1 
HETATM 7092 O  O     . HOH HA 4 .   ? 26.269  -0.796  28.951 1.00 33.20  ? 429 HOH X O     1 
HETATM 7093 O  O     . HOH HA 4 .   ? 44.488  33.976  8.477  1.00 36.92  ? 431 HOH X O     1 
HETATM 7094 O  O     . HOH HA 4 .   ? 42.280  1.763   30.530 1.00 36.24  ? 435 HOH X O     1 
HETATM 7095 O  O     . HOH HA 4 .   ? 7.891   -20.788 27.646 1.00 33.38  ? 436 HOH X O     1 
HETATM 7096 O  O     . HOH HA 4 .   ? 30.908  16.170  25.634 1.00 29.17  ? 439 HOH X O     1 
HETATM 7097 O  O     . HOH HA 4 .   ? 40.569  18.588  10.316 1.00 27.02  ? 442 HOH X O     1 
HETATM 7098 O  O     . HOH HA 4 .   ? 38.311  19.950  5.070  1.00 32.38  ? 446 HOH X O     1 
HETATM 7099 O  O     . HOH HA 4 .   ? 14.096  -7.775  31.431 1.00 38.23  ? 451 HOH X O     1 
HETATM 7100 O  O     . HOH HA 4 .   ? 52.758  25.698  13.092 1.00 38.12  ? 454 HOH X O     1 
HETATM 7101 O  O     . HOH HA 4 .   ? 26.563  -8.757  37.742 1.00 36.84  ? 459 HOH X O     1 
HETATM 7102 O  O     . HOH HA 4 .   ? 25.496  11.300  21.564 1.00 34.24  ? 460 HOH X O     1 
HETATM 7103 O  O     . HOH HA 4 .   ? 44.216  35.201  19.176 1.00 37.80  ? 462 HOH X O     1 
HETATM 7104 O  O     . HOH HA 4 .   ? 45.924  4.531   17.361 1.00 41.71  ? 466 HOH X O     1 
HETATM 7105 O  O     . HOH HA 4 .   ? 50.024  45.088  9.942  1.00 35.34  ? 467 HOH X O     1 
HETATM 7106 O  O     . HOH HA 4 .   ? 3.109   2.009   39.239 1.00 39.21  ? 470 HOH X O     1 
HETATM 7107 O  O     . HOH HA 4 .   ? 45.946  12.065  18.348 1.00 36.62  ? 471 HOH X O     1 
HETATM 7108 O  O     . HOH HA 4 .   ? 29.912  27.677  12.722 1.00 20.98  ? 497 HOH X O     1 
HETATM 7109 O  O     . HOH HA 4 .   ? 34.379  22.888  27.158 1.00 22.99  ? 498 HOH X O     1 
HETATM 7110 O  O     . HOH HA 4 .   ? 17.363  -11.438 8.448  1.00 42.41  ? 499 HOH X O     1 
HETATM 7111 O  O     . HOH HA 4 .   ? 31.853  11.808  9.273  1.00 22.68  ? 500 HOH X O     1 
HETATM 7112 O  O     . HOH HA 4 .   ? 31.373  13.857  6.941  1.00 20.62  ? 501 HOH X O     1 
HETATM 7113 O  O     . HOH HA 4 .   ? 29.619  14.094  9.285  1.00 22.92  ? 502 HOH X O     1 
HETATM 7114 O  O     . HOH HA 4 .   ? 31.583  16.380  8.543  1.00 24.59  ? 503 HOH X O     1 
HETATM 7115 O  O     . HOH HA 4 .   ? 5.722   3.009   24.464 1.00 38.80  ? 504 HOH X O     1 
HETATM 7116 O  O     . HOH HA 4 .   ? -15.675 -25.369 24.746 1.00 37.69  ? 505 HOH X O     1 
HETATM 7117 O  O     . HOH HA 4 .   ? -13.018 -23.814 26.538 1.00 30.48  ? 506 HOH X O     1 
HETATM 7118 O  O     . HOH HA 4 .   ? 15.649  22.355  29.664 1.00 28.35  ? 507 HOH X O     1 
HETATM 7119 O  O     . HOH HA 4 .   ? 13.644  24.069  28.331 1.00 26.30  ? 508 HOH X O     1 
HETATM 7120 O  O     . HOH HA 4 .   ? 17.536  21.870  26.946 1.00 22.31  ? 509 HOH X O     1 
HETATM 7121 O  O     . HOH HA 4 .   ? 14.540  21.241  26.906 1.00 28.50  ? 510 HOH X O     1 
HETATM 7122 O  O     . HOH HA 4 .   ? 32.293  24.593  21.852 1.00 21.46  ? 518 HOH X O     1 
HETATM 7123 O  O     . HOH HA 4 .   ? 7.689   0.604   23.510 1.00 42.50  ? 522 HOH X O     1 
HETATM 7124 O  O     . HOH HA 4 .   ? 5.442   0.097   25.889 1.00 39.97  ? 523 HOH X O     1 
HETATM 7125 O  O     . HOH HA 4 .   ? 6.050   2.354   27.613 1.00 43.44  ? 524 HOH X O     1 
HETATM 7126 O  O     . HOH HA 4 .   ? -13.939 -3.071  17.772 1.00 42.83  ? 525 HOH X O     1 
HETATM 7127 O  O     . HOH HA 4 .   ? -10.540 -4.519  16.001 1.00 43.20  ? 526 HOH X O     1 
HETATM 7128 O  O     . HOH HA 4 .   ? 44.294  37.909  1.473  1.00 36.57  ? 527 HOH X O     1 
HETATM 7129 O  O     . HOH HA 4 .   ? 47.107  35.693  1.707  1.00 35.87  ? 528 HOH X O     1 
HETATM 7130 O  O     . HOH HA 4 .   ? 24.504  32.197  26.687 1.00 28.17  ? 534 HOH X O     1 
HETATM 7131 O  O     . HOH HA 4 .   ? 41.255  18.579  27.741 1.00 29.08  ? 538 HOH X O     1 
HETATM 7132 O  O     . HOH HA 4 .   ? 2.954   6.551   28.633 1.00 35.19  ? 539 HOH X O     1 
HETATM 7133 O  O     . HOH HA 4 .   ? 31.691  -0.964  19.719 1.00 36.99  ? 540 HOH X O     1 
HETATM 7134 O  O     . HOH HA 4 .   ? -11.268 -11.184 25.719 1.00 24.72  ? 541 HOH X O     1 
HETATM 7135 O  O     . HOH HA 4 .   ? -10.676 -14.063 19.375 1.00 28.33  ? 542 HOH X O     1 
HETATM 7136 O  O     . HOH HA 4 .   ? -12.545 -16.681 19.373 1.00 26.76  ? 543 HOH X O     1 
HETATM 7137 O  O     . HOH HA 4 .   ? -10.379 -18.224 21.383 1.00 27.75  ? 544 HOH X O     1 
HETATM 7138 O  O     . HOH HA 4 .   ? -9.419  -17.157 18.419 1.00 31.75  ? 545 HOH X O     1 
HETATM 7139 O  O     . HOH HA 4 .   ? 13.528  -9.712  12.055 1.00 41.72  ? 547 HOH X O     1 
HETATM 7140 O  O     . HOH HA 4 .   ? -13.362 -4.290  20.056 1.00 44.27  ? 551 HOH X O     1 
HETATM 7141 O  O     . HOH HA 4 .   ? -9.625  -2.177  19.061 1.00 38.14  ? 552 HOH X O     1 
HETATM 7142 O  O     . HOH IA 4 .   ? -0.932  33.703  14.691 1.00 17.49  ? 180 HOH A O     1 
HETATM 7143 O  O     . HOH IA 4 .   ? 9.367   32.779  21.088 1.00 17.19  ? 181 HOH A O     1 
HETATM 7144 O  O     . HOH IA 4 .   ? 21.701  41.629  14.101 1.00 22.77  ? 182 HOH A O     1 
HETATM 7145 O  O     . HOH IA 4 .   ? 17.000  58.103  16.775 1.00 29.56  ? 183 HOH A O     1 
HETATM 7146 O  O     . HOH IA 4 .   ? 33.626  48.353  9.130  1.00 36.32  ? 184 HOH A O     1 
HETATM 7147 O  O     . HOH IA 4 .   ? 31.801  49.816  16.403 1.00 35.24  ? 185 HOH A O     1 
HETATM 7148 O  O     . HOH IA 4 .   ? -8.781  11.927  6.069  1.00 22.94  ? 186 HOH A O     1 
HETATM 7149 O  O     . HOH IA 4 .   ? 5.226   59.619  14.515 1.00 27.49  ? 187 HOH A O     1 
HETATM 7150 O  O     . HOH IA 4 .   ? 7.886   22.589  29.216 1.00 32.58  ? 188 HOH A O     1 
HETATM 7151 O  O     . HOH IA 4 .   ? 17.754  54.667  2.862  1.00 32.56  ? 189 HOH A O     1 
HETATM 7152 O  O     . HOH IA 4 .   ? 23.308  40.475  10.149 1.00 22.87  ? 190 HOH A O     1 
HETATM 7153 O  O     . HOH IA 4 .   ? 12.286  34.916  3.811  1.00 32.36  ? 191 HOH A O     1 
HETATM 7154 O  O     . HOH IA 4 .   ? -2.308  29.784  9.533  1.00 23.73  ? 192 HOH A O     1 
HETATM 7155 O  O     . HOH IA 4 .   ? 10.710  67.122  21.966 1.00 27.07  ? 193 HOH A O     1 
HETATM 7156 O  O     . HOH IA 4 .   ? -3.511  35.504  7.091  1.00 24.67  ? 194 HOH A O     1 
HETATM 7157 O  O     . HOH IA 4 .   ? 6.729   29.765  9.782  1.00 19.38  ? 195 HOH A O     1 
HETATM 7158 O  O     . HOH IA 4 .   ? 12.964  59.258  24.077 1.00 28.66  ? 196 HOH A O     1 
HETATM 7159 O  O     . HOH IA 4 .   ? -11.816 12.406  8.692  1.00 34.28  ? 197 HOH A O     1 
HETATM 7160 O  O     . HOH IA 4 .   ? 7.227   26.714  10.926 1.00 19.36  ? 198 HOH A O     1 
HETATM 7161 O  O     . HOH IA 4 .   ? 40.873  44.227  26.694 1.00 30.30  ? 199 HOH A O     1 
HETATM 7162 O  O     . HOH IA 4 .   ? 30.063  66.609  16.090 1.00 41.34  ? 200 HOH A O     1 
HETATM 7163 O  O     . HOH IA 4 .   ? 10.592  37.991  17.369 1.00 17.62  ? 201 HOH A O     1 
HETATM 7164 O  O     . HOH IA 4 .   ? 43.055  63.700  19.215 1.00 25.75  ? 202 HOH A O     1 
HETATM 7165 O  O     . HOH IA 4 .   ? 20.493  34.151  -0.981 1.00 34.05  ? 203 HOH A O     1 
HETATM 7166 O  O     . HOH IA 4 .   ? 6.847   30.640  6.486  1.00 31.59  ? 204 HOH A O     1 
HETATM 7167 O  O     . HOH IA 4 .   ? -3.052  35.350  23.520 1.00 18.66  ? 205 HOH A O     1 
HETATM 7168 O  O     . HOH IA 4 .   ? 22.642  57.228  10.981 1.00 32.50  ? 206 HOH A O     1 
HETATM 7169 O  O     . HOH IA 4 .   ? 18.264  47.162  22.385 1.00 18.62  ? 207 HOH A O     1 
HETATM 7170 O  O     . HOH IA 4 .   ? 32.830  55.339  26.774 1.00 34.76  ? 208 HOH A O     1 
HETATM 7171 O  O     . HOH IA 4 .   ? 33.599  52.267  25.622 1.00 33.78  ? 209 HOH A O     1 
HETATM 7172 O  O     . HOH IA 4 .   ? 21.981  34.551  14.963 1.00 21.69  ? 210 HOH A O     1 
HETATM 7173 O  O     . HOH IA 4 .   ? 20.333  40.919  29.699 1.00 31.11  ? 211 HOH A O     1 
HETATM 7174 O  O     . HOH IA 4 .   ? 9.421   28.281  30.215 1.00 31.03  ? 212 HOH A O     1 
HETATM 7175 O  O     . HOH IA 4 .   ? 9.620   25.579  15.269 1.00 25.40  ? 213 HOH A O     1 
HETATM 7176 O  O     . HOH IA 4 .   ? 2.015   59.276  20.783 1.00 29.74  ? 214 HOH A O     1 
HETATM 7177 O  O     . HOH IA 4 .   ? 25.358  33.467  21.078 1.00 24.14  ? 215 HOH A O     1 
HETATM 7178 O  O     . HOH IA 4 .   ? 12.779  38.130  0.281  1.00 33.78  ? 216 HOH A O     1 
HETATM 7179 O  O     . HOH IA 4 .   ? 5.424   30.101  18.431 1.00 29.72  ? 217 HOH A O     1 
HETATM 7180 O  O     . HOH IA 4 .   ? 17.561  45.338  19.978 1.00 25.79  ? 218 HOH A O     1 
HETATM 7181 O  O     . HOH IA 4 .   ? 14.091  35.264  17.161 1.00 24.84  ? 219 HOH A O     1 
HETATM 7182 O  O     . HOH IA 4 .   ? 5.912   26.773  16.611 1.00 18.21  ? 220 HOH A O     1 
HETATM 7183 O  O     . HOH IA 4 .   ? 12.186  29.628  29.918 1.00 19.95  ? 221 HOH A O     1 
HETATM 7184 O  O     . HOH IA 4 .   ? -0.447  33.064  22.894 1.00 21.41  ? 222 HOH A O     1 
HETATM 7185 O  O     . HOH IA 4 .   ? 10.645  77.490  10.304 1.00 32.48  ? 223 HOH A O     1 
HETATM 7186 O  O     . HOH IA 4 .   ? 6.884   28.369  20.603 1.00 19.77  ? 224 HOH A O     1 
HETATM 7187 O  O     . HOH IA 4 .   ? 5.126   33.423  22.841 1.00 23.26  ? 225 HOH A O     1 
HETATM 7188 O  O     . HOH IA 4 .   ? 10.797  28.928  4.960  1.00 30.40  ? 226 HOH A O     1 
HETATM 7189 O  O     . HOH IA 4 .   ? 0.488   27.313  20.546 1.00 29.54  ? 227 HOH A O     1 
HETATM 7190 O  O     . HOH IA 4 .   ? -1.348  50.895  5.988  1.00 37.45  ? 228 HOH A O     1 
HETATM 7191 O  O     . HOH IA 4 .   ? 18.073  45.113  30.612 1.00 31.08  ? 229 HOH A O     1 
HETATM 7192 O  O     . HOH IA 4 .   ? 2.883   26.637  16.827 1.00 20.22  ? 230 HOH A O     1 
HETATM 7193 O  O     . HOH IA 4 .   ? 5.116   56.502  13.756 1.00 26.24  ? 231 HOH A O     1 
HETATM 7194 O  O     . HOH IA 4 .   ? -2.450  25.019  7.041  1.00 31.94  ? 232 HOH A O     1 
HETATM 7195 O  O     . HOH IA 4 .   ? -7.034  36.350  3.931  1.00 29.46  ? 233 HOH A O     1 
HETATM 7196 O  O     . HOH IA 4 .   ? 30.885  62.135  23.317 1.00 41.76  ? 234 HOH A O     1 
HETATM 7197 O  O     . HOH IA 4 .   ? 7.426   31.748  19.448 1.00 21.08  ? 235 HOH A O     1 
HETATM 7198 O  O     . HOH IA 4 .   ? 5.609   39.954  22.712 1.00 26.50  ? 236 HOH A O     1 
HETATM 7199 O  O     . HOH IA 4 .   ? 30.265  60.801  16.059 1.00 41.24  ? 237 HOH A O     1 
HETATM 7200 O  O     . HOH IA 4 .   ? -1.433  33.421  6.740  1.00 23.10  ? 238 HOH A O     1 
HETATM 7201 O  O     . HOH IA 4 .   ? 46.058  69.552  26.104 1.00 38.03  ? 239 HOH A O     1 
HETATM 7202 O  O     . HOH IA 4 .   ? 9.062   29.372  8.885  1.00 23.91  ? 240 HOH A O     1 
HETATM 7203 O  O     . HOH IA 4 .   ? -9.730  44.334  1.084  1.00 28.63  ? 241 HOH A O     1 
HETATM 7204 O  O     . HOH IA 4 .   ? 28.325  43.615  26.705 1.00 23.90  ? 242 HOH A O     1 
HETATM 7205 O  O     . HOH IA 4 .   ? -9.198  30.594  8.975  1.00 28.13  ? 243 HOH A O     1 
HETATM 7206 O  O     . HOH IA 4 .   ? 2.219   33.339  24.632 1.00 19.31  ? 244 HOH A O     1 
HETATM 7207 O  O     . HOH IA 4 .   ? 16.841  40.950  28.836 1.00 26.30  ? 245 HOH A O     1 
HETATM 7208 O  O     . HOH IA 4 .   ? 26.325  43.496  20.018 1.00 29.09  ? 246 HOH A O     1 
HETATM 7209 O  O     . HOH IA 4 .   ? 5.194   64.616  18.322 1.00 29.90  ? 247 HOH A O     1 
HETATM 7210 O  O     . HOH IA 4 .   ? 11.456  42.584  10.920 1.00 25.50  ? 248 HOH A O     1 
HETATM 7211 O  O     . HOH IA 4 .   ? 1.244   31.446  21.890 1.00 20.01  ? 249 HOH A O     1 
HETATM 7212 O  O     . HOH IA 4 .   ? 2.818   24.675  15.004 1.00 26.87  ? 250 HOH A O     1 
HETATM 7213 O  O     . HOH IA 4 .   ? 9.041   41.937  27.049 1.00 36.40  ? 251 HOH A O     1 
HETATM 7214 O  O     . HOH IA 4 .   ? -3.937  23.840  18.353 1.00 27.55  ? 252 HOH A O     1 
HETATM 7215 O  O     . HOH IA 4 .   ? -10.535 38.824  9.830  1.00 29.24  ? 253 HOH A O     1 
HETATM 7216 O  O     . HOH IA 4 .   ? 20.544  66.948  19.616 1.00 36.57  ? 254 HOH A O     1 
HETATM 7217 O  O     . HOH IA 4 .   ? 2.349   36.397  24.624 1.00 20.17  ? 255 HOH A O     1 
HETATM 7218 O  O     . HOH IA 4 .   ? 19.912  33.364  10.747 1.00 29.43  ? 256 HOH A O     1 
HETATM 7219 O  O     . HOH IA 4 .   ? 44.103  46.204  13.592 1.00 33.70  ? 257 HOH A O     1 
HETATM 7220 O  O     . HOH IA 4 .   ? -0.174  34.527  25.705 1.00 20.48  ? 258 HOH A O     1 
HETATM 7221 O  O     . HOH IA 4 .   ? -5.948  12.995  8.572  1.00 33.03  ? 259 HOH A O     1 
HETATM 7222 O  O     . HOH IA 4 .   ? 5.207   35.559  24.742 1.00 22.34  ? 260 HOH A O     1 
HETATM 7223 O  O     . HOH IA 4 .   ? 4.824   41.932  22.060 1.00 28.01  ? 261 HOH A O     1 
HETATM 7224 O  O     . HOH IA 4 .   ? 3.246   43.588  21.827 1.00 34.31  ? 262 HOH A O     1 
HETATM 7225 O  O     . HOH IA 4 .   ? -2.905  58.033  18.550 1.00 31.19  ? 263 HOH A O     1 
HETATM 7226 O  O     . HOH IA 4 .   ? 5.419   59.348  10.705 1.00 32.93  ? 264 HOH A O     1 
HETATM 7227 O  O     . HOH IA 4 .   ? 9.233   52.033  21.150 1.00 31.42  ? 265 HOH A O     1 
HETATM 7228 O  O     . HOH IA 4 .   ? 4.013   29.587  22.483 1.00 23.56  ? 266 HOH A O     1 
HETATM 7229 O  O     . HOH IA 4 .   ? -2.032  33.450  11.087 1.00 20.81  ? 267 HOH A O     1 
HETATM 7230 O  O     . HOH IA 4 .   ? 16.224  37.389  29.370 1.00 21.16  ? 268 HOH A O     1 
HETATM 7231 O  O     . HOH IA 4 .   ? 23.237  43.096  32.992 1.00 36.54  ? 269 HOH A O     1 
HETATM 7232 O  O     . HOH IA 4 .   ? 2.219   48.487  7.631  1.00 30.72  ? 270 HOH A O     1 
HETATM 7233 O  O     . HOH IA 4 .   ? 26.246  42.313  27.044 1.00 20.69  ? 271 HOH A O     1 
HETATM 7234 O  O     . HOH IA 4 .   ? -12.368 35.535  3.467  1.00 32.19  ? 272 HOH A O     1 
HETATM 7235 O  O     . HOH IA 4 .   ? -5.357  44.953  0.184  1.00 38.24  ? 273 HOH A O     1 
HETATM 7236 O  O     . HOH IA 4 .   ? 3.704   38.697  24.456 1.00 21.85  ? 274 HOH A O     1 
HETATM 7237 O  O     . HOH IA 4 .   ? -5.107  15.506  7.278  1.00 31.23  ? 275 HOH A O     1 
HETATM 7238 O  O     . HOH IA 4 .   ? 7.775   38.159  24.936 1.00 22.56  ? 276 HOH A O     1 
HETATM 7239 O  O     . HOH IA 4 .   ? 15.211  41.082  9.912  1.00 25.80  ? 277 HOH A O     1 
HETATM 7240 O  O     . HOH IA 4 .   ? 13.174  78.985  10.954 1.00 35.58  ? 278 HOH A O     1 
HETATM 7241 O  O     . HOH IA 4 .   ? 17.996  57.269  19.398 1.00 35.20  ? 279 HOH A O     1 
HETATM 7242 O  O     . HOH IA 4 .   ? 15.058  29.114  26.322 1.00 19.83  ? 280 HOH A O     1 
HETATM 7243 O  O     . HOH IA 4 .   ? 0.432   15.154  13.555 1.00 37.21  ? 281 HOH A O     1 
HETATM 7244 O  O     . HOH IA 4 .   ? -15.372 29.014  10.161 1.00 32.96  ? 282 HOH A O     1 
HETATM 7245 O  O     . HOH IA 4 .   ? -10.418 14.137  10.529 1.00 34.71  ? 283 HOH A O     1 
HETATM 7246 O  O     . HOH IA 4 .   ? -2.196  34.382  32.553 1.00 29.74  ? 284 HOH A O     1 
HETATM 7247 O  O     . HOH IA 4 .   ? 5.337   38.162  26.584 1.00 21.49  ? 285 HOH A O     1 
HETATM 7248 O  O     . HOH IA 4 .   ? 0.497   33.322  8.732  1.00 20.90  ? 286 HOH A O     1 
HETATM 7249 O  O     . HOH IA 4 .   ? 5.920   24.917  18.582 1.00 30.51  ? 287 HOH A O     1 
HETATM 7250 O  O     . HOH IA 4 .   ? -3.353  24.567  31.025 1.00 37.44  ? 288 HOH A O     1 
HETATM 7251 O  O     . HOH IA 4 .   ? 30.138  35.805  26.280 1.00 37.59  ? 289 HOH A O     1 
HETATM 7252 O  O     . HOH IA 4 .   ? 11.856  38.809  29.036 1.00 22.95  ? 290 HOH A O     1 
HETATM 7253 O  O     . HOH IA 4 .   ? 24.932  39.914  20.780 1.00 29.52  ? 291 HOH A O     1 
HETATM 7254 O  O     . HOH IA 4 .   ? 19.870  40.692  10.606 1.00 29.26  ? 292 HOH A O     1 
HETATM 7255 O  O     . HOH IA 4 .   ? 22.548  36.272  22.911 1.00 31.25  ? 293 HOH A O     1 
HETATM 7256 O  O     . HOH IA 4 .   ? -12.447 14.329  15.097 1.00 37.37  ? 294 HOH A O     1 
HETATM 7257 O  O     . HOH IA 4 .   ? 27.970  45.857  25.264 1.00 23.46  ? 295 HOH A O     1 
HETATM 7258 O  O     . HOH IA 4 .   ? 1.208   22.123  27.717 1.00 44.90  ? 296 HOH A O     1 
HETATM 7259 O  O     . HOH IA 4 .   ? 0.592   47.437  17.481 1.00 31.19  ? 297 HOH A O     1 
HETATM 7260 O  O     . HOH IA 4 .   ? 13.048  33.188  13.987 1.00 24.03  ? 298 HOH A O     1 
HETATM 7261 O  O     . HOH IA 4 .   ? -4.166  43.219  24.954 1.00 35.42  ? 299 HOH A O     1 
HETATM 7262 O  O     . HOH IA 4 .   ? -11.650 27.714  17.291 1.00 33.14  ? 300 HOH A O     1 
HETATM 7263 O  O     . HOH IA 4 .   ? 49.102  79.296  12.636 1.00 38.09  ? 301 HOH A O     1 
HETATM 7264 O  O     . HOH IA 4 .   ? 20.907  35.361  1.618  1.00 28.84  ? 302 HOH A O     1 
HETATM 7265 O  O     . HOH IA 4 .   ? 31.494  64.082  25.547 1.00 43.62  ? 303 HOH A O     1 
HETATM 7266 O  O     . HOH IA 4 .   ? 18.971  46.533  17.661 1.00 29.37  ? 304 HOH A O     1 
HETATM 7267 O  O     . HOH IA 4 .   ? 45.081  75.665  25.409 1.00 28.37  ? 305 HOH A O     1 
HETATM 7268 O  O     . HOH IA 4 .   ? 6.205   57.406  16.557 1.00 23.54  ? 306 HOH A O     1 
HETATM 7269 O  O     . HOH IA 4 .   ? -14.594 36.759  11.775 1.00 30.37  ? 307 HOH A O     1 
HETATM 7270 O  O     . HOH IA 4 .   ? -2.450  12.787  8.050  1.00 36.84  ? 308 HOH A O     1 
HETATM 7271 O  O     . HOH IA 4 .   ? -4.518  38.908  2.643  1.00 35.26  ? 309 HOH A O     1 
HETATM 7272 O  O     . HOH IA 4 .   ? 30.576  56.263  21.858 1.00 35.64  ? 310 HOH A O     1 
HETATM 7273 O  O     . HOH IA 4 .   ? 13.967  40.436  7.355  1.00 24.79  ? 311 HOH A O     1 
HETATM 7274 O  O     . HOH IA 4 .   ? 17.565  29.546  18.433 1.00 28.27  ? 312 HOH A O     1 
HETATM 7275 O  O     . HOH IA 4 .   ? 9.245   39.967  8.379  1.00 28.65  ? 313 HOH A O     1 
HETATM 7276 O  O     . HOH IA 4 .   ? 17.937  69.796  17.051 1.00 33.57  ? 314 HOH A O     1 
HETATM 7277 O  O     . HOH IA 4 .   ? -2.038  49.221  17.121 1.00 35.01  ? 315 HOH A O     1 
HETATM 7278 O  O     . HOH IA 4 .   ? 13.517  26.836  26.823 1.00 22.95  ? 316 HOH A O     1 
HETATM 7279 O  O     . HOH IA 4 .   ? 10.193  32.975  4.087  1.00 35.86  ? 317 HOH A O     1 
HETATM 7280 O  O     . HOH IA 4 .   ? 11.426  44.640  18.388 1.00 32.76  ? 318 HOH A O     1 
HETATM 7281 O  O     . HOH IA 4 .   ? 8.364   61.329  27.919 1.00 32.69  ? 319 HOH A O     1 
HETATM 7282 O  O     . HOH IA 4 .   ? -7.506  40.352  15.290 1.00 26.41  ? 320 HOH A O     1 
HETATM 7283 O  O     . HOH IA 4 .   ? 2.969   26.334  20.584 1.00 31.54  ? 321 HOH A O     1 
HETATM 7284 O  O     . HOH IA 4 .   ? 8.514   40.411  25.049 1.00 33.33  ? 322 HOH A O     1 
HETATM 7285 O  O     . HOH IA 4 .   ? 17.191  65.775  20.850 1.00 35.75  ? 323 HOH A O     1 
HETATM 7286 O  O     . HOH IA 4 .   ? 44.082  61.957  11.202 1.00 34.21  ? 324 HOH A O     1 
HETATM 7287 O  O     . HOH IA 4 .   ? 14.909  42.344  12.175 1.00 23.88  ? 325 HOH A O     1 
HETATM 7288 O  O     . HOH IA 4 .   ? 2.299   41.526  22.461 1.00 26.26  ? 326 HOH A O     1 
HETATM 7289 O  O     . HOH IA 4 .   ? -3.260  14.336  5.781  1.00 34.78  ? 327 HOH A O     1 
HETATM 7290 O  O     . HOH IA 4 .   ? 6.837   34.141  4.681  1.00 30.27  ? 328 HOH A O     1 
HETATM 7291 O  O     . HOH IA 4 .   ? 20.625  32.784  8.316  1.00 31.06  ? 329 HOH A O     1 
HETATM 7292 O  O     . HOH IA 4 .   ? 16.777  72.924  18.940 1.00 31.77  ? 330 HOH A O     1 
HETATM 7293 O  O     . HOH IA 4 .   ? 8.409   32.432  6.222  1.00 31.59  ? 331 HOH A O     1 
HETATM 7294 O  O     . HOH IA 4 .   ? -8.911  42.849  14.251 1.00 30.45  ? 332 HOH A O     1 
HETATM 7295 O  O     . HOH IA 4 .   ? -17.106 29.888  7.762  1.00 37.79  ? 333 HOH A O     1 
HETATM 7296 O  O     . HOH IA 4 .   ? 40.681  59.099  22.837 1.00 31.17  ? 334 HOH A O     1 
HETATM 7297 O  O     . HOH IA 4 .   ? 5.553   31.801  32.962 1.00 28.90  ? 335 HOH A O     1 
HETATM 7298 O  O     . HOH IA 4 .   ? 22.913  68.599  15.549 1.00 39.51  ? 336 HOH A O     1 
HETATM 7299 O  O     . HOH IA 4 .   ? 21.899  69.832  17.623 1.00 36.33  ? 337 HOH A O     1 
HETATM 7300 O  O     . HOH IA 4 .   ? 43.406  66.941  26.865 1.00 31.49  ? 338 HOH A O     1 
HETATM 7301 O  O     . HOH IA 4 .   ? 9.677   37.120  7.043  1.00 26.93  ? 339 HOH A O     1 
HETATM 7302 O  O     . HOH IA 4 .   ? 29.075  45.530  37.455 1.00 32.28  ? 340 HOH A O     1 
HETATM 7303 O  O     . HOH IA 4 .   ? 26.947  41.635  29.309 1.00 30.91  ? 341 HOH A O     1 
HETATM 7304 O  O     . HOH IA 4 .   ? 12.549  49.962  25.588 1.00 35.54  ? 342 HOH A O     1 
HETATM 7305 O  O     . HOH IA 4 .   ? 38.734  41.618  15.931 1.00 33.63  ? 343 HOH A O     1 
HETATM 7306 O  O     . HOH IA 4 .   ? -10.847 13.519  6.129  1.00 30.63  ? 344 HOH A O     1 
HETATM 7307 O  O     . HOH IA 4 .   ? 18.196  42.250  11.923 1.00 32.32  ? 345 HOH A O     1 
HETATM 7308 O  O     . HOH IA 4 .   ? 20.239  42.587  8.856  1.00 32.09  ? 346 HOH A O     1 
HETATM 7309 O  O     . HOH IA 4 .   ? 10.553  74.622  16.346 1.00 32.89  ? 347 HOH A O     1 
HETATM 7310 O  O     . HOH IA 4 .   ? 6.387   48.230  8.523  1.00 29.61  ? 348 HOH A O     1 
HETATM 7311 O  O     . HOH IA 4 .   ? -1.312  45.937  4.646  1.00 34.66  ? 349 HOH A O     1 
HETATM 7312 O  O     . HOH IA 4 .   ? 8.241   45.031  17.115 1.00 33.17  ? 350 HOH A O     1 
HETATM 7313 O  O     . HOH IA 4 .   ? -13.062 4.799   10.765 1.00 35.99  ? 351 HOH A O     1 
HETATM 7314 O  O     . HOH IA 4 .   ? 27.423  67.609  19.565 1.00 37.28  ? 352 HOH A O     1 
HETATM 7315 O  O     . HOH IA 4 .   ? -8.547  37.187  23.823 1.00 34.56  ? 353 HOH A O     1 
HETATM 7316 O  O     . HOH IA 4 .   ? 44.207  76.076  21.675 1.00 34.92  ? 354 HOH A O     1 
HETATM 7317 O  O     . HOH IA 4 .   ? 8.227   39.167  28.373 1.00 28.67  ? 355 HOH A O     1 
HETATM 7318 O  O     . HOH IA 4 .   ? 12.914  31.796  33.946 1.00 26.90  ? 356 HOH A O     1 
HETATM 7319 O  O     . HOH IA 4 .   ? 39.308  41.660  22.182 1.00 31.93  ? 357 HOH A O     1 
HETATM 7320 O  O     . HOH IA 4 .   ? 14.485  41.668  5.004  1.00 25.88  ? 358 HOH A O     1 
HETATM 7321 O  O     . HOH IA 4 .   ? -14.884 33.991  3.304  1.00 36.32  ? 359 HOH A O     1 
HETATM 7322 O  O     . HOH IA 4 .   ? 23.902  41.886  28.159 1.00 25.10  ? 360 HOH A O     1 
HETATM 7323 O  O     . HOH IA 4 .   ? -1.679  24.104  2.211  1.00 40.41  ? 361 HOH A O     1 
HETATM 7324 O  O     . HOH IA 4 .   ? 2.940   30.851  32.602 1.00 25.76  ? 362 HOH A O     1 
HETATM 7325 O  O     . HOH IA 4 .   ? -6.932  0.982   4.055  1.00 36.97  ? 363 HOH A O     1 
HETATM 7326 O  O     . HOH IA 4 .   ? 13.857  47.999  7.610  1.00 36.79  ? 364 HOH A O     1 
HETATM 7327 O  O     . HOH IA 4 .   ? 6.483   25.727  13.600 1.00 29.43  ? 365 HOH A O     1 
HETATM 7328 O  O     . HOH IA 4 .   ? 25.741  39.978  14.251 1.00 32.69  ? 366 HOH A O     1 
HETATM 7329 O  O     . HOH IA 4 .   ? 7.447   63.235  16.291 1.00 29.14  ? 367 HOH A O     1 
HETATM 7330 O  O     . HOH IA 4 .   ? 33.120  66.248  25.491 1.00 39.48  ? 368 HOH A O     1 
HETATM 7331 O  O     . HOH IA 4 .   ? 17.436  41.814  8.257  1.00 23.10  ? 369 HOH A O     1 
HETATM 7332 O  O     . HOH IA 4 .   ? -4.081  33.877  9.323  1.00 30.28  ? 370 HOH A O     1 
HETATM 7333 O  O     . HOH IA 4 .   ? 41.541  76.149  26.330 1.00 32.27  ? 371 HOH A O     1 
HETATM 7334 O  O     . HOH IA 4 .   ? -14.112 34.572  13.546 1.00 28.05  ? 372 HOH A O     1 
HETATM 7335 O  O     . HOH IA 4 .   ? 24.838  35.617  14.762 1.00 28.96  ? 373 HOH A O     1 
HETATM 7336 O  O     . HOH IA 4 .   ? -1.918  64.517  17.339 1.00 34.95  ? 374 HOH A O     1 
HETATM 7337 O  O     . HOH IA 4 .   ? -11.911 28.211  22.288 1.00 32.11  ? 375 HOH A O     1 
HETATM 7338 O  O     . HOH IA 4 .   ? 31.653  43.118  20.161 1.00 35.63  ? 376 HOH A O     1 
HETATM 7339 O  O     . HOH IA 4 .   ? 34.966  60.489  14.324 1.00 36.39  ? 377 HOH A O     1 
HETATM 7340 O  O     . HOH IA 4 .   ? 16.573  43.983  6.518  1.00 26.81  ? 378 HOH A O     1 
HETATM 7341 O  O     . HOH IA 4 .   ? -7.357  14.141  5.695  1.00 39.64  ? 379 HOH A O     1 
HETATM 7342 O  O     . HOH IA 4 .   ? -4.263  3.837   5.792  1.00 31.76  ? 380 HOH A O     1 
HETATM 7343 O  O     . HOH IA 4 .   ? 43.934  52.683  19.626 1.00 29.33  ? 381 HOH A O     1 
HETATM 7344 O  O     . HOH IA 4 .   ? 11.575  38.910  5.950  1.00 30.63  ? 383 HOH A O     1 
HETATM 7345 O  O     . HOH IA 4 .   ? -1.585  54.459  8.112  1.00 38.16  ? 384 HOH A O     1 
HETATM 7346 O  O     . HOH IA 4 .   ? -0.653  33.612  2.058  1.00 32.59  ? 386 HOH A O     1 
HETATM 7347 O  O     . HOH IA 4 .   ? 3.983   8.248   13.746 1.00 40.03  ? 387 HOH A O     1 
HETATM 7348 O  O     . HOH IA 4 .   ? 0.205   53.883  19.103 1.00 33.46  ? 388 HOH A O     1 
HETATM 7349 O  O     . HOH IA 4 .   ? 29.344  46.702  23.021 1.00 30.09  ? 389 HOH A O     1 
HETATM 7350 O  O     . HOH IA 4 .   ? 45.213  60.879  14.377 1.00 35.53  ? 390 HOH A O     1 
HETATM 7351 O  O     . HOH IA 4 .   ? -3.674  13.103  21.827 1.00 41.80  ? 392 HOH A O     1 
HETATM 7352 O  O     . HOH IA 4 .   ? 44.015  50.198  23.498 1.00 33.60  ? 394 HOH A O     1 
HETATM 7353 O  O     . HOH IA 4 .   ? 11.782  53.434  23.826 1.00 32.55  ? 395 HOH A O     1 
HETATM 7354 O  O     . HOH IA 4 .   ? 18.940  44.084  15.939 1.00 34.10  ? 396 HOH A O     1 
HETATM 7355 O  O     . HOH IA 4 .   ? -0.728  52.395  22.868 1.00 35.00  ? 398 HOH A O     1 
HETATM 7356 O  O     . HOH IA 4 .   ? -12.853 31.206  31.040 1.00 38.08  ? 399 HOH A O     1 
HETATM 7357 O  O     . HOH IA 4 .   ? -10.479 27.315  0.559  1.00 21.48  ? 402 HOH A O     1 
HETATM 7358 O  O     . HOH IA 4 .   ? 2.516   37.578  33.986 1.00 31.31  ? 405 HOH A O     1 
HETATM 7359 O  O     . HOH IA 4 .   ? 5.785   21.263  28.091 1.00 42.30  ? 406 HOH A O     1 
HETATM 7360 O  O     . HOH IA 4 .   ? 11.717  30.930  3.944  1.00 38.09  ? 407 HOH A O     1 
HETATM 7361 O  O     . HOH IA 4 .   ? 35.159  64.796  27.492 1.00 35.48  ? 409 HOH A O     1 
HETATM 7362 O  O     . HOH IA 4 .   ? -8.962  45.398  -1.045 1.00 37.74  ? 410 HOH A O     1 
HETATM 7363 O  O     . HOH IA 4 .   ? -13.819 25.380  4.025  1.00 38.47  ? 413 HOH A O     1 
HETATM 7364 O  O     . HOH IA 4 .   ? -11.006 24.749  6.094  1.00 34.40  ? 415 HOH A O     1 
HETATM 7365 O  O     . HOH IA 4 .   ? -7.026  8.884   17.986 1.00 29.66  ? 416 HOH A O     1 
HETATM 7366 O  O     . HOH IA 4 .   ? 5.676   33.495  35.042 1.00 32.86  ? 418 HOH A O     1 
HETATM 7367 O  O     . HOH IA 4 .   ? -10.171 26.483  15.759 1.00 30.98  ? 424 HOH A O     1 
HETATM 7368 O  O     . HOH IA 4 .   ? 7.377   61.199  9.218  1.00 38.97  ? 425 HOH A O     1 
HETATM 7369 O  O     . HOH IA 4 .   ? -9.342  30.157  33.199 1.00 32.09  ? 428 HOH A O     1 
HETATM 7370 O  O     . HOH IA 4 .   ? -10.255 44.426  8.653  1.00 34.75  ? 430 HOH A O     1 
HETATM 7371 O  O     . HOH IA 4 .   ? 34.489  69.418  23.228 1.00 30.32  ? 432 HOH A O     1 
HETATM 7372 O  O     . HOH IA 4 .   ? -13.729 3.229   7.686  1.00 38.88  ? 433 HOH A O     1 
HETATM 7373 O  O     . HOH IA 4 .   ? 36.212  54.008  11.394 1.00 35.83  ? 434 HOH A O     1 
HETATM 7374 O  O     . HOH IA 4 .   ? 42.536  61.741  20.971 1.00 30.90  ? 437 HOH A O     1 
HETATM 7375 O  O     . HOH IA 4 .   ? 25.999  41.964  8.179  1.00 32.08  ? 438 HOH A O     1 
HETATM 7376 O  O     . HOH IA 4 .   ? 12.892  38.804  3.165  1.00 31.09  ? 440 HOH A O     1 
HETATM 7377 O  O     . HOH IA 4 .   ? 37.064  69.644  24.609 1.00 32.36  ? 441 HOH A O     1 
HETATM 7378 O  O     . HOH IA 4 .   ? 27.270  44.894  6.191  1.00 37.21  ? 443 HOH A O     1 
HETATM 7379 O  O     . HOH IA 4 .   ? 13.807  28.259  14.514 1.00 29.62  ? 444 HOH A O     1 
HETATM 7380 O  O     . HOH IA 4 .   ? 29.845  41.010  27.043 1.00 30.54  ? 445 HOH A O     1 
HETATM 7381 O  O     . HOH IA 4 .   ? 17.365  31.791  10.331 1.00 32.97  ? 447 HOH A O     1 
HETATM 7382 O  O     . HOH IA 4 .   ? 16.118  70.023  6.732  1.00 39.03  ? 448 HOH A O     1 
HETATM 7383 O  O     . HOH IA 4 .   ? 0.860   23.299  1.636  1.00 37.26  ? 449 HOH A O     1 
HETATM 7384 O  O     . HOH IA 4 .   ? 9.972   26.166  5.653  1.00 36.30  ? 450 HOH A O     1 
HETATM 7385 O  O     . HOH IA 4 .   ? 26.534  46.329  4.396  1.00 36.39  ? 452 HOH A O     1 
HETATM 7386 O  O     . HOH IA 4 .   ? 4.717   26.721  23.038 1.00 26.03  ? 453 HOH A O     1 
HETATM 7387 O  O     . HOH IA 4 .   ? -3.078  27.920  27.301 1.00 34.32  ? 455 HOH A O     1 
HETATM 7388 O  O     . HOH IA 4 .   ? -1.464  37.722  33.215 1.00 32.46  ? 456 HOH A O     1 
HETATM 7389 O  O     . HOH IA 4 .   ? 44.644  68.658  10.461 1.00 35.56  ? 457 HOH A O     1 
HETATM 7390 O  O     . HOH IA 4 .   ? 22.172  42.929  30.755 1.00 32.12  ? 458 HOH A O     1 
HETATM 7391 O  O     . HOH IA 4 .   ? 34.620  36.436  19.278 1.00 36.86  ? 461 HOH A O     1 
HETATM 7392 O  O     . HOH IA 4 .   ? 47.880  71.721  27.007 1.00 34.85  ? 463 HOH A O     1 
HETATM 7393 O  O     . HOH IA 4 .   ? -9.442  28.337  25.161 1.00 35.00  ? 464 HOH A O     1 
HETATM 7394 O  O     . HOH IA 4 .   ? 1.413   20.699  9.113  1.00 35.83  ? 465 HOH A O     1 
HETATM 7395 O  O     . HOH IA 4 .   ? 12.001  39.997  -6.600 1.00 40.70  ? 468 HOH A O     1 
HETATM 7396 O  O     . HOH IA 4 .   ? -12.154 25.192  14.205 1.00 37.57  ? 469 HOH A O     1 
HETATM 7397 O  O     . HOH IA 4 .   ? 4.483   28.085  19.172 1.00 23.77  ? 472 HOH A O     1 
HETATM 7398 O  O     . HOH IA 4 .   ? -1.332  55.691  17.826 1.00 32.72  ? 473 HOH A O     1 
HETATM 7399 O  O     . HOH IA 4 .   ? -5.672  56.315  18.140 1.00 41.82  ? 474 HOH A O     1 
HETATM 7400 O  O     . HOH IA 4 .   ? -3.927  56.392  15.908 1.00 42.28  ? 475 HOH A O     1 
HETATM 7401 O  O     . HOH IA 4 .   ? 8.683   65.428  18.296 1.00 32.24  ? 476 HOH A O     1 
HETATM 7402 O  O     . HOH IA 4 .   ? 5.533   67.177  17.164 1.00 40.15  ? 477 HOH A O     1 
HETATM 7403 O  O     . HOH IA 4 .   ? 19.335  65.593  3.410  1.00 41.75  ? 478 HOH A O     1 
HETATM 7404 O  O     . HOH IA 4 .   ? 26.098  52.879  18.016 1.00 30.51  ? 480 HOH A O     1 
HETATM 7405 O  O     . HOH IA 4 .   ? 27.447  55.881  20.279 1.00 36.47  ? 481 HOH A O     1 
HETATM 7406 O  O     . HOH IA 4 .   ? 29.937  54.039  23.964 1.00 34.04  ? 482 HOH A O     1 
HETATM 7407 O  O     . HOH IA 4 .   ? 5.538   37.670  5.588  1.00 27.14  ? 483 HOH A O     1 
HETATM 7408 O  O     . HOH IA 4 .   ? 5.375   42.148  5.608  1.00 26.18  ? 484 HOH A O     1 
HETATM 7409 O  O     . HOH IA 4 .   ? 5.987   39.662  3.388  1.00 27.55  ? 485 HOH A O     1 
HETATM 7410 O  O     . HOH IA 4 .   ? 7.589   39.751  5.947  1.00 25.06  ? 486 HOH A O     1 
HETATM 7411 O  O     . HOH IA 4 .   ? 7.882   67.929  20.079 1.00 33.62  ? 487 HOH A O     1 
HETATM 7412 O  O     . HOH IA 4 .   ? 8.153   59.731  15.054 1.00 23.57  ? 488 HOH A O     1 
HETATM 7413 O  O     . HOH IA 4 .   ? 7.193   58.424  12.255 1.00 29.04  ? 489 HOH A O     1 
HETATM 7414 O  O     . HOH IA 4 .   ? -10.831 40.326  14.537 1.00 36.27  ? 490 HOH A O     1 
HETATM 7415 O  O     . HOH IA 4 .   ? -8.274  43.471  17.616 1.00 35.57  ? 491 HOH A O     1 
HETATM 7416 O  O     . HOH IA 4 .   ? -4.003  53.934  17.256 1.00 42.59  ? 492 HOH A O     1 
HETATM 7417 O  O     . HOH IA 4 .   ? 23.185  62.483  7.890  1.00 37.73  ? 493 HOH A O     1 
HETATM 7418 O  O     . HOH IA 4 .   ? 23.635  65.641  8.738  1.00 37.14  ? 494 HOH A O     1 
HETATM 7419 O  O     . HOH IA 4 .   ? 44.214  65.003  9.988  1.00 35.91  ? 495 HOH A O     1 
HETATM 7420 O  O     . HOH IA 4 .   ? 50.737  76.560  25.818 1.00 31.19  ? 496 HOH A O     1 
HETATM 7421 O  O     . HOH IA 4 .   ? 4.370   38.804  1.471  1.00 35.99  ? 511 HOH A O     1 
HETATM 7422 O  O     . HOH IA 4 .   ? 17.639  42.202  18.555 1.00 26.34  ? 512 HOH A O     1 
HETATM 7423 O  O     . HOH IA 4 .   ? 42.456  43.646  20.891 1.00 32.07  ? 513 HOH A O     1 
HETATM 7424 O  O     . HOH IA 4 .   ? 0.271   22.688  10.189 1.00 33.39  ? 514 HOH A O     1 
HETATM 7425 O  O     . HOH IA 4 .   ? 49.906  73.494  26.281 1.00 29.78  ? 515 HOH A O     1 
HETATM 7426 O  O     . HOH IA 4 .   ? 10.824  40.329  26.731 1.00 31.90  ? 516 HOH A O     1 
HETATM 7427 O  O     . HOH IA 4 .   ? 4.658   31.100  20.113 1.00 23.28  ? 517 HOH A O     1 
HETATM 7428 O  O     . HOH IA 4 .   ? 45.934  64.592  7.529  1.00 43.05  ? 519 HOH A O     1 
HETATM 7429 O  O     . HOH IA 4 .   ? 47.142  63.002  10.931 1.00 43.30  ? 520 HOH A O     1 
HETATM 7430 O  O     . HOH IA 4 .   ? -8.483  24.390  15.033 1.00 35.76  ? 529 HOH A O     1 
HETATM 7431 O  O     . HOH IA 4 .   ? -5.059  37.881  24.427 1.00 26.57  ? 530 HOH A O     1 
HETATM 7432 O  O     . HOH IA 4 .   ? 18.460  38.057  25.949 1.00 24.27  ? 531 HOH A O     1 
HETATM 7433 O  O     . HOH IA 4 .   ? 19.155  35.408  25.715 1.00 32.35  ? 532 HOH A O     1 
HETATM 7434 O  O     . HOH IA 4 .   ? 21.893  32.881  26.433 1.00 30.52  ? 533 HOH A O     1 
HETATM 7435 O  O     . HOH IA 4 .   ? 34.867  58.207  27.621 1.00 38.75  ? 535 HOH A O     1 
HETATM 7436 O  O     . HOH IA 4 .   ? 15.790  43.568  29.763 1.00 32.28  ? 536 HOH A O     1 
HETATM 7437 O  O     . HOH IA 4 .   ? -10.444 23.792  9.546  1.00 37.93  ? 537 HOH A O     1 
HETATM 7438 O  O     . HOH IA 4 .   ? 6.067   30.007  16.884 1.00 15.69  ? 546 HOH A O     1 
HETATM 7439 O  O     . HOH IA 4 .   ? 23.728  64.608  6.640  1.00 40.78  ? 548 HOH A O     1 
HETATM 7440 O  O     . HOH IA 4 .   ? 29.736  54.107  19.933 1.00 42.13  ? 549 HOH A O     1 
HETATM 7441 O  O     . HOH IA 4 .   ? 24.280  64.717  4.015  1.00 56.26  ? 550 HOH A O     1 
# 
loop_
_pdbx_poly_seq_scheme.asym_id 
_pdbx_poly_seq_scheme.entity_id 
_pdbx_poly_seq_scheme.seq_id 
_pdbx_poly_seq_scheme.mon_id 
_pdbx_poly_seq_scheme.ndb_seq_num 
_pdbx_poly_seq_scheme.pdb_seq_num 
_pdbx_poly_seq_scheme.auth_seq_num 
_pdbx_poly_seq_scheme.pdb_mon_id 
_pdbx_poly_seq_scheme.auth_mon_id 
_pdbx_poly_seq_scheme.pdb_strand_id 
_pdbx_poly_seq_scheme.pdb_ins_code 
_pdbx_poly_seq_scheme.hetero 
A 1 1   G 1   15  15  G G X . n 
A 1 2   G 2   16  16  G G X . n 
A 1 3   G 3   17  17  G G X . n 
A 1 4   C 4   18  18  C C X . n 
A 1 5   U 5   19  19  U U X . n 
A 1 6   U 6   20  20  U U X . n 
A 1 7   C 7   21  21  C C X . n 
A 1 8   G 8   22  22  G G X . n 
A 1 9   U 9   23  23  U U X . n 
A 1 10  U 10  24  24  U U X . n 
A 1 11  A 11  25  25  A A X . n 
A 1 12  G 12  26  26  G G X . n 
A 1 13  G 13  27  27  G G X . n 
A 1 14  U 14  28  28  U U X . n 
A 1 15  G 15  29  29  G G X . n 
A 1 16  A 16  30  30  A A X . n 
A 1 17  G 17  31  31  G G X . n 
A 1 18  G 18  32  32  G G X . n 
A 1 19  C 19  33  33  C C X . n 
A 1 20  U 20  34  34  U U X . n 
A 1 21  C 21  35  35  C C X . n 
A 1 22  C 22  36  36  C C X . n 
A 1 23  U 23  37  37  U U X . n 
A 1 24  G 24  38  38  G G X . n 
A 1 25  U 25  39  39  U U X . n 
A 1 26  A 26  40  40  A A X . n 
A 1 27  U 27  41  41  U U X . n 
A 1 28  G 28  42  42  G G X . n 
A 1 29  G 29  43  43  G G X . n 
A 1 30  A 30  44  44  A A X . n 
A 1 31  G 31  45  45  G G X . n 
A 1 32  A 32  46  46  A A X . n 
A 1 33  U 33  47  47  U U X . n 
A 1 34  A 34  48  48  A A X . n 
A 1 35  C 35  49  49  C C X . n 
A 1 36  G 36  50  50  G G X . n 
A 1 37  C 37  51  51  C C X . n 
A 1 38  U 38  52  52  U U X . n 
A 1 39  G 39  53  53  G G X . n 
A 1 40  C 40  54  54  C C X . n 
A 1 41  U 41  55  55  U U X . n 
A 1 42  G 42  56  56  G G X . n 
A 1 43  C 43  57  57  C C X . n 
A 1 44  C 44  58  58  C C X . n 
A 1 45  C 45  59  59  C C X . n 
A 1 46  A 46  60  60  A A X . n 
A 1 47  A 47  61  61  A A X . n 
A 1 48  A 48  62  62  A A X . n 
A 1 49  A 49  63  63  A A X . n 
A 1 50  A 50  64  64  A A X . n 
A 1 51  U 51  65  65  U U X . n 
A 1 52  G 52  66  66  G G X . n 
A 1 53  U 53  67  67  U U X . n 
A 1 54  C 54  68  68  C C X . n 
A 1 55  C 55  69  69  C C X . n 
A 1 56  A 56  70  70  A A X . n 
A 1 57  A 57  71  71  A A X . n 
A 1 58  A 58  72  72  A A X . n 
A 1 59  G 59  73  73  G G X . n 
A 1 60  A 60  74  74  A A X . n 
A 1 61  C 61  75  75  C C X . n 
A 1 62  G 62  76  76  G G X . n 
A 1 63  C 63  77  77  C C X . n 
A 1 64  C 64  78  78  C C X . n 
A 1 65  A 65  79  79  A A X . n 
A 1 66  A 66  80  80  A A X . n 
A 1 67  U 67  81  81  U U X . n 
A 1 68  G 68  82  82  G G X . n 
A 1 69  G 69  83  83  G G X . n 
A 1 70  G 70  84  84  G G X . n 
A 1 71  U 71  85  85  U U X . n 
A 1 72  C 72  86  86  C C X . n 
A 1 73  A 73  87  87  A A X . n 
A 1 74  A 74  88  88  A A X . n 
A 1 75  C 75  89  89  C C X . n 
A 1 76  A 76  90  90  A A X . n 
A 1 77  G 77  91  91  G G X . n 
A 1 78  A 78  92  92  A A X . n 
A 1 79  A 79  93  93  A A X . n 
A 1 80  A 80  94  94  A A X . n 
A 1 81  U 81  95  95  U U X . n 
A 1 82  C 82  96  96  C C X . n 
A 1 83  A 83  97  97  A A X . n 
A 1 84  U 84  98  98  U U X . n 
A 1 85  C 85  99  99  C C X . n 
A 1 86  G 86  100 100 G G X . n 
A 1 87  A 87  101 101 A A X . n 
A 1 88  C 88  102 102 C C X . n 
A 1 89  A 89  103 103 A A X . n 
A 1 90  U 90  104 104 U U X . n 
A 1 91  A 91  105 105 A A X . n 
A 1 92  A 92  106 106 A A X . n 
A 1 93  G 93  107 107 G G X . n 
A 1 94  G 94  108 108 G G X . n 
A 1 95  U 95  109 109 U U X . n 
A 1 96  G 96  110 110 G G X . n 
A 1 97  A 97  111 111 A A X . n 
A 1 98  U 98  112 112 U U X . n 
A 1 99  U 99  113 113 U U X . n 
A 1 100 U 100 114 114 U U X . n 
A 1 101 U 101 115 115 U U X . n 
A 1 102 U 102 116 116 U U X . n 
A 1 103 A 103 117 117 A A X . n 
A 1 104 A 104 118 118 A A X . n 
A 1 105 U 105 119 119 U U X . n 
A 1 106 G 106 120 120 G G X . n 
A 1 107 C 107 121 121 C C X . n 
A 1 108 A 108 122 122 A A X . n 
A 1 109 G 109 123 123 G G X . n 
A 1 110 C 110 124 124 C C X . n 
A 1 111 U 111 125 125 U U X . n 
A 1 112 G 112 126 126 G G X . n 
A 1 113 G 113 127 127 G G X . n 
A 1 114 A 114 128 128 A A X . n 
A 1 115 U 115 129 129 U U X . n 
A 1 116 G 116 130 130 G G X . n 
A 1 117 C 117 131 131 C C X . n 
A 1 118 U 118 132 132 U U X . n 
A 1 119 U 119 133 133 U U X . n 
A 1 120 G 120 134 134 G G X . n 
A 1 121 U 121 135 135 U U X . n 
A 1 122 C 122 136 136 C C X . n 
A 1 123 C 123 137 137 C C X . n 
A 1 124 U 124 138 138 U U X . n 
A 1 125 A 125 139 139 A A X . n 
A 1 126 U 126 140 140 U U X . n 
A 1 127 G 127 141 141 G G X . n 
A 1 128 C 128 142 142 C C X . n 
A 1 129 C 129 143 143 C C X . n 
A 1 130 A 130 144 144 A A X . n 
A 1 131 U 131 145 145 U U X . n 
A 1 132 A 132 146 146 A A X . n 
A 1 133 C 133 147 147 C C X . n 
A 1 134 A 134 148 148 A A X . n 
A 1 135 G 135 149 149 G G X . n 
A 1 136 U 136 150 150 U U X . n 
A 1 137 G 137 151 151 G G X . n 
A 1 138 C 138 152 152 C C X . n 
A 1 139 U 139 153 153 U U X . n 
A 1 140 A 140 154 154 A A X . n 
A 1 141 A 141 155 155 A A X . n 
A 1 142 A 142 156 156 A A X . n 
A 1 143 G 143 157 157 G G X . n 
A 1 144 C 144 158 158 C C X . n 
A 1 145 U 145 159 159 U U X . n 
A 1 146 C 146 160 160 C C X . n 
A 1 147 U 147 161 161 U U X . n 
A 1 148 A 148 162 162 A A X . n 
A 1 149 C 149 163 163 C C X . n 
A 1 150 G 150 164 164 G G X . n 
A 1 151 A 151 165 165 A A X . n 
A 1 152 U 152 166 166 U U X . n 
A 1 153 U 153 167 167 U U X . n 
A 1 154 G 154 168 168 G G X . n 
A 1 155 A 155 169 169 A A X . n 
A 1 156 A 156 170 170 A A X . n 
A 1 157 G 157 171 171 G G X . n 
A 1 158 C 158 172 172 C C X . n 
A 1 159 C 159 173 173 C C X . n 
A 1 160 C 160 174 174 C C X . n 
A 1 161 A 161 175 175 A A X . n 
B 1 1   G 1   15  15  G G A . n 
B 1 2   G 2   16  16  G G A . n 
B 1 3   G 3   17  17  G G A . n 
B 1 4   C 4   18  18  C C A . n 
B 1 5   U 5   19  19  U U A . n 
B 1 6   U 6   20  20  U U A . n 
B 1 7   C 7   21  21  C C A . n 
B 1 8   G 8   22  22  G G A . n 
B 1 9   U 9   23  23  U U A . n 
B 1 10  U 10  24  24  U U A . n 
B 1 11  A 11  25  25  A A A . n 
B 1 12  G 12  26  26  G G A . n 
B 1 13  G 13  27  27  G G A . n 
B 1 14  U 14  28  28  U U A . n 
B 1 15  G 15  29  29  G G A . n 
B 1 16  A 16  30  30  A A A . n 
B 1 17  G 17  31  31  G G A . n 
B 1 18  G 18  32  32  G G A . n 
B 1 19  C 19  33  33  C C A . n 
B 1 20  U 20  34  34  U U A . n 
B 1 21  C 21  35  35  C C A . n 
B 1 22  C 22  36  36  C C A . n 
B 1 23  U 23  37  37  U U A . n 
B 1 24  G 24  38  38  G G A . n 
B 1 25  U 25  39  39  U U A . n 
B 1 26  A 26  40  40  A A A . n 
B 1 27  U 27  41  41  U U A . n 
B 1 28  G 28  42  42  G G A . n 
B 1 29  G 29  43  43  G G A . n 
B 1 30  A 30  44  44  A A A . n 
B 1 31  G 31  45  45  G G A . n 
B 1 32  A 32  46  46  A A A . n 
B 1 33  U 33  47  47  U U A . n 
B 1 34  A 34  48  48  A A A . n 
B 1 35  C 35  49  49  C C A . n 
B 1 36  G 36  50  50  G G A . n 
B 1 37  C 37  51  51  C C A . n 
B 1 38  U 38  52  52  U U A . n 
B 1 39  G 39  53  53  G G A . n 
B 1 40  C 40  54  54  C C A . n 
B 1 41  U 41  55  55  U U A . n 
B 1 42  G 42  56  56  G G A . n 
B 1 43  C 43  57  57  C C A . n 
B 1 44  C 44  58  58  C C A . n 
B 1 45  C 45  59  59  C C A . n 
B 1 46  A 46  60  60  A A A . n 
B 1 47  A 47  61  61  A A A . n 
B 1 48  A 48  62  62  A A A . n 
B 1 49  A 49  63  63  A A A . n 
B 1 50  A 50  64  64  A A A . n 
B 1 51  U 51  65  65  U U A . n 
B 1 52  G 52  66  66  G G A . n 
B 1 53  U 53  67  67  U U A . n 
B 1 54  C 54  68  68  C C A . n 
B 1 55  C 55  69  69  C C A . n 
B 1 56  A 56  70  70  A A A . n 
B 1 57  A 57  71  71  A A A . n 
B 1 58  A 58  72  72  A A A . n 
B 1 59  G 59  73  73  G G A . n 
B 1 60  A 60  74  74  A A A . n 
B 1 61  C 61  75  75  C C A . n 
B 1 62  G 62  76  76  G G A . n 
B 1 63  C 63  77  77  C C A . n 
B 1 64  C 64  78  78  C C A . n 
B 1 65  A 65  79  79  A A A . n 
B 1 66  A 66  80  80  A A A . n 
B 1 67  U 67  81  81  U U A . n 
B 1 68  G 68  82  82  G G A . n 
B 1 69  G 69  83  83  G G A . n 
B 1 70  G 70  84  84  G G A . n 
B 1 71  U 71  85  85  U U A . n 
B 1 72  C 72  86  86  C C A . n 
B 1 73  A 73  87  87  A A A . n 
B 1 74  A 74  88  88  A A A . n 
B 1 75  C 75  89  89  C C A . n 
B 1 76  A 76  90  90  A A A . n 
B 1 77  G 77  91  91  G G A . n 
B 1 78  A 78  92  92  A A A . n 
B 1 79  A 79  93  93  A A A . n 
B 1 80  A 80  94  94  A A A . n 
B 1 81  U 81  95  95  U U A . n 
B 1 82  C 82  96  96  C C A . n 
B 1 83  A 83  97  97  A A A . n 
B 1 84  U 84  98  98  U U A . n 
B 1 85  C 85  99  99  C C A . n 
B 1 86  G 86  100 100 G G A . n 
B 1 87  A 87  101 101 A A A . n 
B 1 88  C 88  102 102 C C A . n 
B 1 89  A 89  103 103 A A A . n 
B 1 90  U 90  104 104 U U A . n 
B 1 91  A 91  105 105 A A A . n 
B 1 92  A 92  106 106 A A A . n 
B 1 93  G 93  107 107 G G A . n 
B 1 94  G 94  108 108 G G A . n 
B 1 95  U 95  109 109 U U A . n 
B 1 96  G 96  110 110 G G A . n 
B 1 97  A 97  111 111 A A A . n 
B 1 98  U 98  112 112 U U A . n 
B 1 99  U 99  113 113 U U A . n 
B 1 100 U 100 114 114 U U A . n 
B 1 101 U 101 115 115 U U A . n 
B 1 102 U 102 116 116 U U A . n 
B 1 103 A 103 117 117 A A A . n 
B 1 104 A 104 118 118 A A A . n 
B 1 105 U 105 119 119 U U A . n 
B 1 106 G 106 120 120 G G A . n 
B 1 107 C 107 121 121 C C A . n 
B 1 108 A 108 122 122 A A A . n 
B 1 109 G 109 123 123 G G A . n 
B 1 110 C 110 124 124 C C A . n 
B 1 111 U 111 125 125 U U A . n 
B 1 112 G 112 126 126 G G A . n 
B 1 113 G 113 127 127 G G A . n 
B 1 114 A 114 128 128 A A A . n 
B 1 115 U 115 129 129 U U A . n 
B 1 116 G 116 130 130 G G A . n 
B 1 117 C 117 131 131 C C A . n 
B 1 118 U 118 132 132 U U A . n 
B 1 119 U 119 133 133 U U A . n 
B 1 120 G 120 134 134 G G A . n 
B 1 121 U 121 135 135 U U A . n 
B 1 122 C 122 136 136 C C A . n 
B 1 123 C 123 137 137 C C A . n 
B 1 124 U 124 138 138 U U A . n 
B 1 125 A 125 139 139 A A A . n 
B 1 126 U 126 140 140 U U A . n 
B 1 127 G 127 141 141 G G A . n 
B 1 128 C 128 142 142 C C A . n 
B 1 129 C 129 143 143 C C A . n 
B 1 130 A 130 144 144 A A A . n 
B 1 131 U 131 145 145 U U A . n 
B 1 132 A 132 146 146 A A A . n 
B 1 133 C 133 147 147 C C A . n 
B 1 134 A 134 148 148 A A A . n 
B 1 135 G 135 149 149 G G A . n 
B 1 136 U 136 150 150 U U A . n 
B 1 137 G 137 151 151 G G A . n 
B 1 138 C 138 152 152 C C A . n 
B 1 139 U 139 153 153 U U A . n 
B 1 140 A 140 154 154 A A A . n 
B 1 141 A 141 155 155 A A A . n 
B 1 142 A 142 156 156 A A A . n 
B 1 143 G 143 157 157 G G A . n 
B 1 144 C 144 158 158 C C A . n 
B 1 145 U 145 159 159 U U A . n 
B 1 146 C 146 160 160 C C A . n 
B 1 147 U 147 161 161 U U A . n 
B 1 148 A 148 162 162 A A A . n 
B 1 149 C 149 163 163 C C A . n 
B 1 150 G 150 164 164 G G A . n 
B 1 151 A 151 165 165 A A A . n 
B 1 152 U 152 166 166 U U A . n 
B 1 153 U 153 167 167 U U A . n 
B 1 154 G 154 168 168 G G A . n 
B 1 155 A 155 169 169 A A A . n 
B 1 156 A 156 170 170 A A A . n 
B 1 157 G 157 171 171 G G A . n 
B 1 158 C 158 172 172 C C A . n 
B 1 159 C 159 173 173 C C A . n 
B 1 160 C 160 174 174 C C A . n 
B 1 161 A 161 175 175 A A A . n 
# 
loop_
_pdbx_nonpoly_scheme.asym_id 
_pdbx_nonpoly_scheme.entity_id 
_pdbx_nonpoly_scheme.mon_id 
_pdbx_nonpoly_scheme.ndb_seq_num 
_pdbx_nonpoly_scheme.pdb_seq_num 
_pdbx_nonpoly_scheme.auth_seq_num 
_pdbx_nonpoly_scheme.pdb_mon_id 
_pdbx_nonpoly_scheme.auth_mon_id 
_pdbx_nonpoly_scheme.pdb_strand_id 
_pdbx_nonpoly_scheme.pdb_ins_code 
C  2 K   1   1   1   K   K   X . 
D  2 K   1   2   2   K   K   X . 
E  2 K   1   3   3   K   K   X . 
F  3 MN  1   176 1   MN  MN  X . 
G  3 MN  1   177 2   MN  MN  X . 
H  3 MN  1   178 3   MN  MN  X . 
I  3 MN  1   4   4   MN  MN  X . 
J  3 MN  1   7   7   MN  MN  X . 
K  3 MN  1   9   9   MN  MN  X . 
L  3 MN  1   10  10  MN  MN  X . 
M  3 MN  1   12  12  MN  MN  X . 
N  3 MN  1   13  13  MN  MN  X . 
O  3 MN  1   14  14  MN  MN  X . 
P  3 MN  1   179 15  MN  MN  X . 
Q  3 MN  1   180 16  MN  MN  X . 
R  2 K   1   1   1   K   K   A . 
S  2 K   1   2   2   K   K   A . 
T  2 K   1   3   3   K   K   A . 
U  3 MN  1   176 1   MN  MN  A . 
V  3 MN  1   177 2   MN  MN  A . 
W  3 MN  1   178 3   MN  MN  A . 
X  3 MN  1   4   4   MN  MN  A . 
Y  3 MN  1   5   5   MN  MN  A . 
Z  3 MN  1   6   6   MN  MN  A . 
AA 3 MN  1   7   7   MN  MN  A . 
BA 3 MN  1   9   9   MN  MN  A . 
CA 3 MN  1   10  10  MN  MN  A . 
DA 3 MN  1   11  11  MN  MN  A . 
EA 3 MN  1   12  12  MN  MN  A . 
FA 3 MN  1   13  13  MN  MN  A . 
GA 3 MN  1   179 15  MN  MN  A . 
HA 4 HOH 1   8   8   HOH HOH X . 
HA 4 HOH 2   181 181 HOH HOH X . 
HA 4 HOH 3   182 182 HOH HOH X . 
HA 4 HOH 4   183 1   HOH HOH X . 
HA 4 HOH 5   184 4   HOH HOH X . 
HA 4 HOH 6   185 9   HOH HOH X . 
HA 4 HOH 7   186 186 HOH HOH X . 
HA 4 HOH 8   187 10  HOH HOH X . 
HA 4 HOH 9   188 13  HOH HOH X . 
HA 4 HOH 10  189 14  HOH HOH X . 
HA 4 HOH 11  190 190 HOH HOH X . 
HA 4 HOH 12  191 17  HOH HOH X . 
HA 4 HOH 13  192 192 HOH HOH X . 
HA 4 HOH 14  193 193 HOH HOH X . 
HA 4 HOH 15  194 20  HOH HOH X . 
HA 4 HOH 16  195 195 HOH HOH X . 
HA 4 HOH 17  196 22  HOH HOH X . 
HA 4 HOH 18  197 26  HOH HOH X . 
HA 4 HOH 19  198 198 HOH HOH X . 
HA 4 HOH 20  199 199 HOH HOH X . 
HA 4 HOH 21  200 28  HOH HOH X . 
HA 4 HOH 22  201 201 HOH HOH X . 
HA 4 HOH 23  202 202 HOH HOH X . 
HA 4 HOH 24  203 29  HOH HOH X . 
HA 4 HOH 25  204 31  HOH HOH X . 
HA 4 HOH 26  205 205 HOH HOH X . 
HA 4 HOH 27  206 206 HOH HOH X . 
HA 4 HOH 28  207 207 HOH HOH X . 
HA 4 HOH 29  208 33  HOH HOH X . 
HA 4 HOH 30  209 35  HOH HOH X . 
HA 4 HOH 31  210 210 HOH HOH X . 
HA 4 HOH 32  211 36  HOH HOH X . 
HA 4 HOH 33  212 37  HOH HOH X . 
HA 4 HOH 34  213 41  HOH HOH X . 
HA 4 HOH 35  214 214 HOH HOH X . 
HA 4 HOH 36  215 46  HOH HOH X . 
HA 4 HOH 37  216 50  HOH HOH X . 
HA 4 HOH 38  217 217 HOH HOH X . 
HA 4 HOH 39  218 55  HOH HOH X . 
HA 4 HOH 40  219 56  HOH HOH X . 
HA 4 HOH 41  220 220 HOH HOH X . 
HA 4 HOH 42  221 221 HOH HOH X . 
HA 4 HOH 43  222 222 HOH HOH X . 
HA 4 HOH 44  223 223 HOH HOH X . 
HA 4 HOH 45  224 224 HOH HOH X . 
HA 4 HOH 46  225 57  HOH HOH X . 
HA 4 HOH 47  226 226 HOH HOH X . 
HA 4 HOH 48  227 227 HOH HOH X . 
HA 4 HOH 49  228 59  HOH HOH X . 
HA 4 HOH 50  229 229 HOH HOH X . 
HA 4 HOH 51  230 230 HOH HOH X . 
HA 4 HOH 52  231 61  HOH HOH X . 
HA 4 HOH 53  232 232 HOH HOH X . 
HA 4 HOH 54  233 64  HOH HOH X . 
HA 4 HOH 55  234 65  HOH HOH X . 
HA 4 HOH 56  235 235 HOH HOH X . 
HA 4 HOH 57  236 67  HOH HOH X . 
HA 4 HOH 58  237 69  HOH HOH X . 
HA 4 HOH 59  238 238 HOH HOH X . 
HA 4 HOH 60  239 70  HOH HOH X . 
HA 4 HOH 61  240 240 HOH HOH X . 
HA 4 HOH 62  241 71  HOH HOH X . 
HA 4 HOH 63  242 242 HOH HOH X . 
HA 4 HOH 64  243 73  HOH HOH X . 
HA 4 HOH 65  244 244 HOH HOH X . 
HA 4 HOH 66  245 245 HOH HOH X . 
HA 4 HOH 67  246 246 HOH HOH X . 
HA 4 HOH 68  247 74  HOH HOH X . 
HA 4 HOH 69  248 75  HOH HOH X . 
HA 4 HOH 70  249 249 HOH HOH X . 
HA 4 HOH 71  250 250 HOH HOH X . 
HA 4 HOH 72  251 76  HOH HOH X . 
HA 4 HOH 73  252 252 HOH HOH X . 
HA 4 HOH 74  253 77  HOH HOH X . 
HA 4 HOH 75  254 254 HOH HOH X . 
HA 4 HOH 76  255 255 HOH HOH X . 
HA 4 HOH 77  256 78  HOH HOH X . 
HA 4 HOH 78  257 257 HOH HOH X . 
HA 4 HOH 79  258 258 HOH HOH X . 
HA 4 HOH 80  259 80  HOH HOH X . 
HA 4 HOH 81  260 260 HOH HOH X . 
HA 4 HOH 82  261 261 HOH HOH X . 
HA 4 HOH 83  262 82  HOH HOH X . 
HA 4 HOH 84  263 263 HOH HOH X . 
HA 4 HOH 85  264 83  HOH HOH X . 
HA 4 HOH 86  265 265 HOH HOH X . 
HA 4 HOH 87  266 85  HOH HOH X . 
HA 4 HOH 88  267 267 HOH HOH X . 
HA 4 HOH 89  268 268 HOH HOH X . 
HA 4 HOH 90  269 89  HOH HOH X . 
HA 4 HOH 91  270 270 HOH HOH X . 
HA 4 HOH 92  271 271 HOH HOH X . 
HA 4 HOH 93  272 91  HOH HOH X . 
HA 4 HOH 94  273 94  HOH HOH X . 
HA 4 HOH 95  274 274 HOH HOH X . 
HA 4 HOH 96  275 96  HOH HOH X . 
HA 4 HOH 97  276 276 HOH HOH X . 
HA 4 HOH 98  277 277 HOH HOH X . 
HA 4 HOH 99  278 99  HOH HOH X . 
HA 4 HOH 100 279 102 HOH HOH X . 
HA 4 HOH 101 280 280 HOH HOH X . 
HA 4 HOH 102 281 103 HOH HOH X . 
HA 4 HOH 103 282 105 HOH HOH X . 
HA 4 HOH 104 283 107 HOH HOH X . 
HA 4 HOH 105 284 110 HOH HOH X . 
HA 4 HOH 106 285 285 HOH HOH X . 
HA 4 HOH 107 286 286 HOH HOH X . 
HA 4 HOH 108 287 111 HOH HOH X . 
HA 4 HOH 109 288 112 HOH HOH X . 
HA 4 HOH 110 289 113 HOH HOH X . 
HA 4 HOH 111 290 290 HOH HOH X . 
HA 4 HOH 112 291 291 HOH HOH X . 
HA 4 HOH 113 292 292 HOH HOH X . 
HA 4 HOH 114 293 293 HOH HOH X . 
HA 4 HOH 115 294 114 HOH HOH X . 
HA 4 HOH 116 295 295 HOH HOH X . 
HA 4 HOH 117 296 116 HOH HOH X . 
HA 4 HOH 118 297 117 HOH HOH X . 
HA 4 HOH 119 298 298 HOH HOH X . 
HA 4 HOH 120 299 118 HOH HOH X . 
HA 4 HOH 121 300 119 HOH HOH X . 
HA 4 HOH 122 301 301 HOH HOH X . 
HA 4 HOH 123 302 302 HOH HOH X . 
HA 4 HOH 124 303 124 HOH HOH X . 
HA 4 HOH 125 304 126 HOH HOH X . 
HA 4 HOH 126 305 128 HOH HOH X . 
HA 4 HOH 127 306 306 HOH HOH X . 
HA 4 HOH 128 307 133 HOH HOH X . 
HA 4 HOH 129 308 308 HOH HOH X . 
HA 4 HOH 130 309 138 HOH HOH X . 
HA 4 HOH 131 310 140 HOH HOH X . 
HA 4 HOH 132 311 141 HOH HOH X . 
HA 4 HOH 133 312 149 HOH HOH X . 
HA 4 HOH 134 313 150 HOH HOH X . 
HA 4 HOH 135 314 314 HOH HOH X . 
HA 4 HOH 136 315 315 HOH HOH X . 
HA 4 HOH 137 316 316 HOH HOH X . 
HA 4 HOH 138 317 317 HOH HOH X . 
HA 4 HOH 139 318 318 HOH HOH X . 
HA 4 HOH 140 319 319 HOH HOH X . 
HA 4 HOH 141 320 320 HOH HOH X . 
HA 4 HOH 142 321 152 HOH HOH X . 
HA 4 HOH 143 322 155 HOH HOH X . 
HA 4 HOH 144 323 156 HOH HOH X . 
HA 4 HOH 145 324 324 HOH HOH X . 
HA 4 HOH 146 325 325 HOH HOH X . 
HA 4 HOH 147 326 157 HOH HOH X . 
HA 4 HOH 148 327 160 HOH HOH X . 
HA 4 HOH 149 328 328 HOH HOH X . 
HA 4 HOH 150 329 166 HOH HOH X . 
HA 4 HOH 151 330 168 HOH HOH X . 
HA 4 HOH 152 331 169 HOH HOH X . 
HA 4 HOH 153 332 173 HOH HOH X . 
HA 4 HOH 154 333 333 HOH HOH X . 
HA 4 HOH 155 334 334 HOH HOH X . 
HA 4 HOH 156 335 335 HOH HOH X . 
HA 4 HOH 157 336 174 HOH HOH X . 
HA 4 HOH 158 337 337 HOH HOH X . 
HA 4 HOH 159 338 177 HOH HOH X . 
HA 4 HOH 160 339 180 HOH HOH X . 
HA 4 HOH 161 342 342 HOH HOH X . 
HA 4 HOH 162 347 347 HOH HOH X . 
HA 4 HOH 163 348 348 HOH HOH X . 
HA 4 HOH 164 356 356 HOH HOH X . 
HA 4 HOH 165 358 358 HOH HOH X . 
HA 4 HOH 166 360 360 HOH HOH X . 
HA 4 HOH 167 361 361 HOH HOH X . 
HA 4 HOH 168 362 362 HOH HOH X . 
HA 4 HOH 169 365 365 HOH HOH X . 
HA 4 HOH 170 366 366 HOH HOH X . 
HA 4 HOH 171 367 367 HOH HOH X . 
HA 4 HOH 172 369 369 HOH HOH X . 
HA 4 HOH 173 371 371 HOH HOH X . 
HA 4 HOH 174 374 374 HOH HOH X . 
HA 4 HOH 175 377 377 HOH HOH X . 
HA 4 HOH 176 378 378 HOH HOH X . 
HA 4 HOH 177 381 381 HOH HOH X . 
HA 4 HOH 178 382 382 HOH HOH X . 
HA 4 HOH 179 385 385 HOH HOH X . 
HA 4 HOH 180 391 391 HOH HOH X . 
HA 4 HOH 181 393 393 HOH HOH X . 
HA 4 HOH 182 397 397 HOH HOH X . 
HA 4 HOH 183 400 400 HOH HOH X . 
HA 4 HOH 184 401 401 HOH HOH X . 
HA 4 HOH 185 403 403 HOH HOH X . 
HA 4 HOH 186 404 404 HOH HOH X . 
HA 4 HOH 187 408 408 HOH HOH X . 
HA 4 HOH 188 411 411 HOH HOH X . 
HA 4 HOH 189 412 412 HOH HOH X . 
HA 4 HOH 190 414 414 HOH HOH X . 
HA 4 HOH 191 417 417 HOH HOH X . 
HA 4 HOH 192 419 419 HOH HOH X . 
HA 4 HOH 193 420 420 HOH HOH X . 
HA 4 HOH 194 421 421 HOH HOH X . 
HA 4 HOH 195 422 422 HOH HOH X . 
HA 4 HOH 196 423 423 HOH HOH X . 
HA 4 HOH 197 426 426 HOH HOH X . 
HA 4 HOH 198 427 427 HOH HOH X . 
HA 4 HOH 199 429 429 HOH HOH X . 
HA 4 HOH 200 431 431 HOH HOH X . 
HA 4 HOH 201 435 435 HOH HOH X . 
HA 4 HOH 202 436 436 HOH HOH X . 
HA 4 HOH 203 439 439 HOH HOH X . 
HA 4 HOH 204 442 442 HOH HOH X . 
HA 4 HOH 205 446 446 HOH HOH X . 
HA 4 HOH 206 451 451 HOH HOH X . 
HA 4 HOH 207 454 454 HOH HOH X . 
HA 4 HOH 208 459 459 HOH HOH X . 
HA 4 HOH 209 460 460 HOH HOH X . 
HA 4 HOH 210 462 462 HOH HOH X . 
HA 4 HOH 211 466 466 HOH HOH X . 
HA 4 HOH 212 467 467 HOH HOH X . 
HA 4 HOH 213 470 470 HOH HOH X . 
HA 4 HOH 214 471 471 HOH HOH X . 
HA 4 HOH 215 497 497 HOH HOH X . 
HA 4 HOH 216 498 498 HOH HOH X . 
HA 4 HOH 217 499 499 HOH HOH X . 
HA 4 HOH 218 500 500 HOH HOH X . 
HA 4 HOH 219 501 501 HOH HOH X . 
HA 4 HOH 220 502 502 HOH HOH X . 
HA 4 HOH 221 503 503 HOH HOH X . 
HA 4 HOH 222 504 504 HOH HOH X . 
HA 4 HOH 223 505 505 HOH HOH X . 
HA 4 HOH 224 506 506 HOH HOH X . 
HA 4 HOH 225 507 507 HOH HOH X . 
HA 4 HOH 226 508 508 HOH HOH X . 
HA 4 HOH 227 509 509 HOH HOH X . 
HA 4 HOH 228 510 510 HOH HOH X . 
HA 4 HOH 229 518 518 HOH HOH X . 
HA 4 HOH 230 522 522 HOH HOH X . 
HA 4 HOH 231 523 523 HOH HOH X . 
HA 4 HOH 232 524 524 HOH HOH X . 
HA 4 HOH 233 525 525 HOH HOH X . 
HA 4 HOH 234 526 526 HOH HOH X . 
HA 4 HOH 235 527 527 HOH HOH X . 
HA 4 HOH 236 528 528 HOH HOH X . 
HA 4 HOH 237 534 534 HOH HOH X . 
HA 4 HOH 238 538 538 HOH HOH X . 
HA 4 HOH 239 539 539 HOH HOH X . 
HA 4 HOH 240 540 540 HOH HOH X . 
HA 4 HOH 241 541 541 HOH HOH X . 
HA 4 HOH 242 542 542 HOH HOH X . 
HA 4 HOH 243 543 543 HOH HOH X . 
HA 4 HOH 244 544 544 HOH HOH X . 
HA 4 HOH 245 545 545 HOH HOH X . 
HA 4 HOH 246 547 547 HOH HOH X . 
HA 4 HOH 247 551 551 HOH HOH X . 
HA 4 HOH 248 552 552 HOH HOH X . 
IA 4 HOH 1   180 2   HOH HOH A . 
IA 4 HOH 2   181 3   HOH HOH A . 
IA 4 HOH 3   182 5   HOH HOH A . 
IA 4 HOH 4   183 183 HOH HOH A . 
IA 4 HOH 5   184 184 HOH HOH A . 
IA 4 HOH 6   185 185 HOH HOH A . 
IA 4 HOH 7   186 6   HOH HOH A . 
IA 4 HOH 8   187 187 HOH HOH A . 
IA 4 HOH 9   188 188 HOH HOH A . 
IA 4 HOH 10  189 189 HOH HOH A . 
IA 4 HOH 11  190 7   HOH HOH A . 
IA 4 HOH 12  191 191 HOH HOH A . 
IA 4 HOH 13  192 11  HOH HOH A . 
IA 4 HOH 14  193 12  HOH HOH A . 
IA 4 HOH 15  194 194 HOH HOH A . 
IA 4 HOH 16  195 15  HOH HOH A . 
IA 4 HOH 17  196 196 HOH HOH A . 
IA 4 HOH 18  197 197 HOH HOH A . 
IA 4 HOH 19  198 16  HOH HOH A . 
IA 4 HOH 20  199 18  HOH HOH A . 
IA 4 HOH 21  200 200 HOH HOH A . 
IA 4 HOH 22  201 19  HOH HOH A . 
IA 4 HOH 23  202 21  HOH HOH A . 
IA 4 HOH 24  203 203 HOH HOH A . 
IA 4 HOH 25  204 204 HOH HOH A . 
IA 4 HOH 26  205 23  HOH HOH A . 
IA 4 HOH 27  206 24  HOH HOH A . 
IA 4 HOH 28  207 25  HOH HOH A . 
IA 4 HOH 29  208 208 HOH HOH A . 
IA 4 HOH 30  209 209 HOH HOH A . 
IA 4 HOH 31  210 27  HOH HOH A . 
IA 4 HOH 32  211 211 HOH HOH A . 
IA 4 HOH 33  212 212 HOH HOH A . 
IA 4 HOH 34  213 213 HOH HOH A . 
IA 4 HOH 35  214 30  HOH HOH A . 
IA 4 HOH 36  215 215 HOH HOH A . 
IA 4 HOH 37  216 216 HOH HOH A . 
IA 4 HOH 38  217 32  HOH HOH A . 
IA 4 HOH 39  218 218 HOH HOH A . 
IA 4 HOH 40  219 219 HOH HOH A . 
IA 4 HOH 41  220 34  HOH HOH A . 
IA 4 HOH 42  221 38  HOH HOH A . 
IA 4 HOH 43  222 39  HOH HOH A . 
IA 4 HOH 44  223 40  HOH HOH A . 
IA 4 HOH 45  224 42  HOH HOH A . 
IA 4 HOH 46  225 225 HOH HOH A . 
IA 4 HOH 47  226 43  HOH HOH A . 
IA 4 HOH 48  227 44  HOH HOH A . 
IA 4 HOH 49  228 228 HOH HOH A . 
IA 4 HOH 50  229 45  HOH HOH A . 
IA 4 HOH 51  230 47  HOH HOH A . 
IA 4 HOH 52  231 231 HOH HOH A . 
IA 4 HOH 53  232 48  HOH HOH A . 
IA 4 HOH 54  233 233 HOH HOH A . 
IA 4 HOH 55  234 234 HOH HOH A . 
IA 4 HOH 56  235 49  HOH HOH A . 
IA 4 HOH 57  236 236 HOH HOH A . 
IA 4 HOH 58  237 237 HOH HOH A . 
IA 4 HOH 59  238 51  HOH HOH A . 
IA 4 HOH 60  239 239 HOH HOH A . 
IA 4 HOH 61  240 52  HOH HOH A . 
IA 4 HOH 62  241 241 HOH HOH A . 
IA 4 HOH 63  242 53  HOH HOH A . 
IA 4 HOH 64  243 243 HOH HOH A . 
IA 4 HOH 65  244 54  HOH HOH A . 
IA 4 HOH 66  245 58  HOH HOH A . 
IA 4 HOH 67  246 60  HOH HOH A . 
IA 4 HOH 68  247 247 HOH HOH A . 
IA 4 HOH 69  248 248 HOH HOH A . 
IA 4 HOH 70  249 62  HOH HOH A . 
IA 4 HOH 71  250 63  HOH HOH A . 
IA 4 HOH 72  251 251 HOH HOH A . 
IA 4 HOH 73  252 66  HOH HOH A . 
IA 4 HOH 74  253 253 HOH HOH A . 
IA 4 HOH 75  254 68  HOH HOH A . 
IA 4 HOH 76  255 72  HOH HOH A . 
IA 4 HOH 77  256 256 HOH HOH A . 
IA 4 HOH 78  257 79  HOH HOH A . 
IA 4 HOH 79  258 81  HOH HOH A . 
IA 4 HOH 80  259 259 HOH HOH A . 
IA 4 HOH 81  260 84  HOH HOH A . 
IA 4 HOH 82  261 86  HOH HOH A . 
IA 4 HOH 83  262 262 HOH HOH A . 
IA 4 HOH 84  263 87  HOH HOH A . 
IA 4 HOH 85  264 264 HOH HOH A . 
IA 4 HOH 86  265 90  HOH HOH A . 
IA 4 HOH 87  266 266 HOH HOH A . 
IA 4 HOH 88  267 92  HOH HOH A . 
IA 4 HOH 89  268 93  HOH HOH A . 
IA 4 HOH 90  269 269 HOH HOH A . 
IA 4 HOH 91  270 95  HOH HOH A . 
IA 4 HOH 92  271 97  HOH HOH A . 
IA 4 HOH 93  272 272 HOH HOH A . 
IA 4 HOH 94  273 273 HOH HOH A . 
IA 4 HOH 95  274 98  HOH HOH A . 
IA 4 HOH 96  275 275 HOH HOH A . 
IA 4 HOH 97  276 100 HOH HOH A . 
IA 4 HOH 98  277 101 HOH HOH A . 
IA 4 HOH 99  278 278 HOH HOH A . 
IA 4 HOH 100 279 279 HOH HOH A . 
IA 4 HOH 101 280 104 HOH HOH A . 
IA 4 HOH 102 281 281 HOH HOH A . 
IA 4 HOH 103 282 282 HOH HOH A . 
IA 4 HOH 104 283 283 HOH HOH A . 
IA 4 HOH 105 284 284 HOH HOH A . 
IA 4 HOH 106 285 106 HOH HOH A . 
IA 4 HOH 107 286 108 HOH HOH A . 
IA 4 HOH 108 287 287 HOH HOH A . 
IA 4 HOH 109 288 288 HOH HOH A . 
IA 4 HOH 110 289 289 HOH HOH A . 
IA 4 HOH 111 290 109 HOH HOH A . 
IA 4 HOH 112 291 115 HOH HOH A . 
IA 4 HOH 113 292 120 HOH HOH A . 
IA 4 HOH 114 293 121 HOH HOH A . 
IA 4 HOH 115 294 294 HOH HOH A . 
IA 4 HOH 116 295 122 HOH HOH A . 
IA 4 HOH 117 296 296 HOH HOH A . 
IA 4 HOH 118 297 297 HOH HOH A . 
IA 4 HOH 119 298 123 HOH HOH A . 
IA 4 HOH 120 299 299 HOH HOH A . 
IA 4 HOH 121 300 300 HOH HOH A . 
IA 4 HOH 122 301 125 HOH HOH A . 
IA 4 HOH 123 302 127 HOH HOH A . 
IA 4 HOH 124 303 303 HOH HOH A . 
IA 4 HOH 125 304 304 HOH HOH A . 
IA 4 HOH 126 305 305 HOH HOH A . 
IA 4 HOH 127 306 129 HOH HOH A . 
IA 4 HOH 128 307 307 HOH HOH A . 
IA 4 HOH 129 308 130 HOH HOH A . 
IA 4 HOH 130 309 309 HOH HOH A . 
IA 4 HOH 131 310 310 HOH HOH A . 
IA 4 HOH 132 311 311 HOH HOH A . 
IA 4 HOH 133 312 312 HOH HOH A . 
IA 4 HOH 134 313 131 HOH HOH A . 
IA 4 HOH 135 314 132 HOH HOH A . 
IA 4 HOH 136 315 134 HOH HOH A . 
IA 4 HOH 137 316 135 HOH HOH A . 
IA 4 HOH 138 317 136 HOH HOH A . 
IA 4 HOH 139 318 137 HOH HOH A . 
IA 4 HOH 140 319 139 HOH HOH A . 
IA 4 HOH 141 320 142 HOH HOH A . 
IA 4 HOH 142 321 321 HOH HOH A . 
IA 4 HOH 143 322 322 HOH HOH A . 
IA 4 HOH 144 323 323 HOH HOH A . 
IA 4 HOH 145 324 143 HOH HOH A . 
IA 4 HOH 146 325 144 HOH HOH A . 
IA 4 HOH 147 326 326 HOH HOH A . 
IA 4 HOH 148 327 327 HOH HOH A . 
IA 4 HOH 149 328 145 HOH HOH A . 
IA 4 HOH 150 329 329 HOH HOH A . 
IA 4 HOH 151 330 330 HOH HOH A . 
IA 4 HOH 152 331 331 HOH HOH A . 
IA 4 HOH 153 332 332 HOH HOH A . 
IA 4 HOH 154 333 146 HOH HOH A . 
IA 4 HOH 155 334 147 HOH HOH A . 
IA 4 HOH 156 335 148 HOH HOH A . 
IA 4 HOH 157 336 336 HOH HOH A . 
IA 4 HOH 158 337 151 HOH HOH A . 
IA 4 HOH 159 338 338 HOH HOH A . 
IA 4 HOH 160 339 339 HOH HOH A . 
IA 4 HOH 161 340 340 HOH HOH A . 
IA 4 HOH 162 341 341 HOH HOH A . 
IA 4 HOH 163 342 153 HOH HOH A . 
IA 4 HOH 164 343 343 HOH HOH A . 
IA 4 HOH 165 344 344 HOH HOH A . 
IA 4 HOH 166 345 345 HOH HOH A . 
IA 4 HOH 167 346 346 HOH HOH A . 
IA 4 HOH 168 347 154 HOH HOH A . 
IA 4 HOH 169 348 158 HOH HOH A . 
IA 4 HOH 170 349 349 HOH HOH A . 
IA 4 HOH 171 350 350 HOH HOH A . 
IA 4 HOH 172 351 351 HOH HOH A . 
IA 4 HOH 173 352 352 HOH HOH A . 
IA 4 HOH 174 353 353 HOH HOH A . 
IA 4 HOH 175 354 354 HOH HOH A . 
IA 4 HOH 176 355 355 HOH HOH A . 
IA 4 HOH 177 356 159 HOH HOH A . 
IA 4 HOH 178 357 357 HOH HOH A . 
IA 4 HOH 179 358 161 HOH HOH A . 
IA 4 HOH 180 359 359 HOH HOH A . 
IA 4 HOH 181 360 162 HOH HOH A . 
IA 4 HOH 182 361 163 HOH HOH A . 
IA 4 HOH 183 362 164 HOH HOH A . 
IA 4 HOH 184 363 363 HOH HOH A . 
IA 4 HOH 185 364 364 HOH HOH A . 
IA 4 HOH 186 365 165 HOH HOH A . 
IA 4 HOH 187 366 167 HOH HOH A . 
IA 4 HOH 188 367 170 HOH HOH A . 
IA 4 HOH 189 368 368 HOH HOH A . 
IA 4 HOH 190 369 171 HOH HOH A . 
IA 4 HOH 191 370 370 HOH HOH A . 
IA 4 HOH 192 371 172 HOH HOH A . 
IA 4 HOH 193 372 372 HOH HOH A . 
IA 4 HOH 194 373 373 HOH HOH A . 
IA 4 HOH 195 374 175 HOH HOH A . 
IA 4 HOH 196 375 375 HOH HOH A . 
IA 4 HOH 197 376 376 HOH HOH A . 
IA 4 HOH 198 377 176 HOH HOH A . 
IA 4 HOH 199 378 178 HOH HOH A . 
IA 4 HOH 200 379 379 HOH HOH A . 
IA 4 HOH 201 380 380 HOH HOH A . 
IA 4 HOH 202 381 179 HOH HOH A . 
IA 4 HOH 203 383 383 HOH HOH A . 
IA 4 HOH 204 384 384 HOH HOH A . 
IA 4 HOH 205 386 386 HOH HOH A . 
IA 4 HOH 206 387 387 HOH HOH A . 
IA 4 HOH 207 388 388 HOH HOH A . 
IA 4 HOH 208 389 389 HOH HOH A . 
IA 4 HOH 209 390 390 HOH HOH A . 
IA 4 HOH 210 392 392 HOH HOH A . 
IA 4 HOH 211 394 394 HOH HOH A . 
IA 4 HOH 212 395 395 HOH HOH A . 
IA 4 HOH 213 396 396 HOH HOH A . 
IA 4 HOH 214 398 398 HOH HOH A . 
IA 4 HOH 215 399 399 HOH HOH A . 
IA 4 HOH 216 402 402 HOH HOH A . 
IA 4 HOH 217 405 405 HOH HOH A . 
IA 4 HOH 218 406 406 HOH HOH A . 
IA 4 HOH 219 407 407 HOH HOH A . 
IA 4 HOH 220 409 409 HOH HOH A . 
IA 4 HOH 221 410 410 HOH HOH A . 
IA 4 HOH 222 413 413 HOH HOH A . 
IA 4 HOH 223 415 415 HOH HOH A . 
IA 4 HOH 224 416 416 HOH HOH A . 
IA 4 HOH 225 418 418 HOH HOH A . 
IA 4 HOH 226 424 424 HOH HOH A . 
IA 4 HOH 227 425 425 HOH HOH A . 
IA 4 HOH 228 428 428 HOH HOH A . 
IA 4 HOH 229 430 430 HOH HOH A . 
IA 4 HOH 230 432 432 HOH HOH A . 
IA 4 HOH 231 433 433 HOH HOH A . 
IA 4 HOH 232 434 434 HOH HOH A . 
IA 4 HOH 233 437 437 HOH HOH A . 
IA 4 HOH 234 438 438 HOH HOH A . 
IA 4 HOH 235 440 440 HOH HOH A . 
IA 4 HOH 236 441 441 HOH HOH A . 
IA 4 HOH 237 443 443 HOH HOH A . 
IA 4 HOH 238 444 444 HOH HOH A . 
IA 4 HOH 239 445 445 HOH HOH A . 
IA 4 HOH 240 447 447 HOH HOH A . 
IA 4 HOH 241 448 448 HOH HOH A . 
IA 4 HOH 242 449 449 HOH HOH A . 
IA 4 HOH 243 450 450 HOH HOH A . 
IA 4 HOH 244 452 452 HOH HOH A . 
IA 4 HOH 245 453 453 HOH HOH A . 
IA 4 HOH 246 455 455 HOH HOH A . 
IA 4 HOH 247 456 456 HOH HOH A . 
IA 4 HOH 248 457 457 HOH HOH A . 
IA 4 HOH 249 458 458 HOH HOH A . 
IA 4 HOH 250 461 461 HOH HOH A . 
IA 4 HOH 251 463 463 HOH HOH A . 
IA 4 HOH 252 464 464 HOH HOH A . 
IA 4 HOH 253 465 465 HOH HOH A . 
IA 4 HOH 254 468 468 HOH HOH A . 
IA 4 HOH 255 469 469 HOH HOH A . 
IA 4 HOH 256 472 472 HOH HOH A . 
IA 4 HOH 257 473 473 HOH HOH A . 
IA 4 HOH 258 474 474 HOH HOH A . 
IA 4 HOH 259 475 475 HOH HOH A . 
IA 4 HOH 260 476 476 HOH HOH A . 
IA 4 HOH 261 477 477 HOH HOH A . 
IA 4 HOH 262 478 478 HOH HOH A . 
IA 4 HOH 263 480 480 HOH HOH A . 
IA 4 HOH 264 481 481 HOH HOH A . 
IA 4 HOH 265 482 482 HOH HOH A . 
IA 4 HOH 266 483 483 HOH HOH A . 
IA 4 HOH 267 484 484 HOH HOH A . 
IA 4 HOH 268 485 485 HOH HOH A . 
IA 4 HOH 269 486 486 HOH HOH A . 
IA 4 HOH 270 487 487 HOH HOH A . 
IA 4 HOH 271 488 488 HOH HOH A . 
IA 4 HOH 272 489 489 HOH HOH A . 
IA 4 HOH 273 490 490 HOH HOH A . 
IA 4 HOH 274 491 491 HOH HOH A . 
IA 4 HOH 275 492 492 HOH HOH A . 
IA 4 HOH 276 493 493 HOH HOH A . 
IA 4 HOH 277 494 494 HOH HOH A . 
IA 4 HOH 278 495 495 HOH HOH A . 
IA 4 HOH 279 496 496 HOH HOH A . 
IA 4 HOH 280 511 511 HOH HOH A . 
IA 4 HOH 281 512 512 HOH HOH A . 
IA 4 HOH 282 513 513 HOH HOH A . 
IA 4 HOH 283 514 514 HOH HOH A . 
IA 4 HOH 284 515 515 HOH HOH A . 
IA 4 HOH 285 516 516 HOH HOH A . 
IA 4 HOH 286 517 517 HOH HOH A . 
IA 4 HOH 287 519 519 HOH HOH A . 
IA 4 HOH 288 520 520 HOH HOH A . 
IA 4 HOH 289 529 529 HOH HOH A . 
IA 4 HOH 290 530 530 HOH HOH A . 
IA 4 HOH 291 531 531 HOH HOH A . 
IA 4 HOH 292 532 532 HOH HOH A . 
IA 4 HOH 293 533 533 HOH HOH A . 
IA 4 HOH 294 535 535 HOH HOH A . 
IA 4 HOH 295 536 536 HOH HOH A . 
IA 4 HOH 296 537 537 HOH HOH A . 
IA 4 HOH 297 546 546 HOH HOH A . 
IA 4 HOH 298 548 548 HOH HOH A . 
IA 4 HOH 299 549 549 HOH HOH A . 
IA 4 HOH 300 550 550 HOH HOH A . 
# 
loop_
_pdbx_struct_assembly.id 
_pdbx_struct_assembly.details 
_pdbx_struct_assembly.method_details 
_pdbx_struct_assembly.oligomeric_details 
_pdbx_struct_assembly.oligomeric_count 
1 author_defined_assembly   ?    monomeric 1 
2 author_defined_assembly   ?    monomeric 1 
3 software_defined_assembly PISA dimeric   2 
# 
loop_
_pdbx_struct_assembly_gen.assembly_id 
_pdbx_struct_assembly_gen.oper_expression 
_pdbx_struct_assembly_gen.asym_id_list 
1 1 A,C,D,E,F,G,H,I,J,K,L,M,N,O,P,Q,HA                                             
2 1 B,R,S,T,U,V,W,X,Y,Z,AA,BA,CA,DA,EA,FA,GA,IA                                    
3 1 A,B,C,D,E,F,G,H,I,J,K,L,M,N,O,P,Q,R,S,T,U,V,W,X,Y,Z,AA,BA,CA,DA,EA,FA,GA,HA,IA 
# 
loop_
_pdbx_struct_assembly_prop.biol_id 
_pdbx_struct_assembly_prop.type 
_pdbx_struct_assembly_prop.value 
_pdbx_struct_assembly_prop.details 
3 'ABSA (A^2)' 6590  ? 
3 MORE         -186  ? 
3 'SSA (A^2)'  44810 ? 
# 
_pdbx_struct_oper_list.id                   1 
_pdbx_struct_oper_list.type                 'identity operation' 
_pdbx_struct_oper_list.name                 1_555 
_pdbx_struct_oper_list.symmetry_operation   x,y,z 
_pdbx_struct_oper_list.matrix[1][1]         1.0000000000 
_pdbx_struct_oper_list.matrix[1][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[1][3]         0.0000000000 
_pdbx_struct_oper_list.vector[1]            0.0000000000 
_pdbx_struct_oper_list.matrix[2][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[2][2]         1.0000000000 
_pdbx_struct_oper_list.matrix[2][3]         0.0000000000 
_pdbx_struct_oper_list.vector[2]            0.0000000000 
_pdbx_struct_oper_list.matrix[3][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][3]         1.0000000000 
_pdbx_struct_oper_list.vector[3]            0.0000000000 
# 
loop_
_pdbx_struct_conn_angle.id 
_pdbx_struct_conn_angle.ptnr1_label_atom_id 
_pdbx_struct_conn_angle.ptnr1_label_alt_id 
_pdbx_struct_conn_angle.ptnr1_label_asym_id 
_pdbx_struct_conn_angle.ptnr1_label_comp_id 
_pdbx_struct_conn_angle.ptnr1_label_seq_id 
_pdbx_struct_conn_angle.ptnr1_auth_atom_id 
_pdbx_struct_conn_angle.ptnr1_auth_asym_id 
_pdbx_struct_conn_angle.ptnr1_auth_comp_id 
_pdbx_struct_conn_angle.ptnr1_auth_seq_id 
_pdbx_struct_conn_angle.ptnr1_PDB_ins_code 
_pdbx_struct_conn_angle.ptnr1_symmetry 
_pdbx_struct_conn_angle.ptnr2_label_atom_id 
_pdbx_struct_conn_angle.ptnr2_label_alt_id 
_pdbx_struct_conn_angle.ptnr2_label_asym_id 
_pdbx_struct_conn_angle.ptnr2_label_comp_id 
_pdbx_struct_conn_angle.ptnr2_label_seq_id 
_pdbx_struct_conn_angle.ptnr2_auth_atom_id 
_pdbx_struct_conn_angle.ptnr2_auth_asym_id 
_pdbx_struct_conn_angle.ptnr2_auth_comp_id 
_pdbx_struct_conn_angle.ptnr2_auth_seq_id 
_pdbx_struct_conn_angle.ptnr2_PDB_ins_code 
_pdbx_struct_conn_angle.ptnr2_symmetry 
_pdbx_struct_conn_angle.ptnr3_label_atom_id 
_pdbx_struct_conn_angle.ptnr3_label_alt_id 
_pdbx_struct_conn_angle.ptnr3_label_asym_id 
_pdbx_struct_conn_angle.ptnr3_label_comp_id 
_pdbx_struct_conn_angle.ptnr3_label_seq_id 
_pdbx_struct_conn_angle.ptnr3_auth_atom_id 
_pdbx_struct_conn_angle.ptnr3_auth_asym_id 
_pdbx_struct_conn_angle.ptnr3_auth_comp_id 
_pdbx_struct_conn_angle.ptnr3_auth_seq_id 
_pdbx_struct_conn_angle.ptnr3_PDB_ins_code 
_pdbx_struct_conn_angle.ptnr3_symmetry 
_pdbx_struct_conn_angle.value 
_pdbx_struct_conn_angle.value_esd 
1   OP2   ? B  C   22  ? A C   36  ? 1_555 MN ? BA MN . ? A MN 9   ? 1_555 OP2   ? B  C   21  ? A C   35  ? 1_555 90.1  ? 
2   OP2   ? B  C   22  ? A C   36  ? 1_555 MN ? BA MN . ? A MN 9   ? 1_555 O     ? IA HOH .   ? A HOH 549 ? 1_555 161.9 ? 
3   OP2   ? B  C   21  ? A C   35  ? 1_555 MN ? BA MN . ? A MN 9   ? 1_555 O     ? IA HOH .   ? A HOH 549 ? 1_555 99.5  ? 
4   OP2   ? B  C   22  ? A C   36  ? 1_555 MN ? BA MN . ? A MN 9   ? 1_555 O     ? IA HOH .   ? A HOH 481 ? 1_555 85.6  ? 
5   OP2   ? B  C   21  ? A C   35  ? 1_555 MN ? BA MN . ? A MN 9   ? 1_555 O     ? IA HOH .   ? A HOH 481 ? 1_555 94.4  ? 
6   O     ? IA HOH .   ? A HOH 549 ? 1_555 MN ? BA MN . ? A MN 9   ? 1_555 O     ? IA HOH .   ? A HOH 481 ? 1_555 78.4  ? 
7   OP2   ? B  C   22  ? A C   36  ? 1_555 MN ? BA MN . ? A MN 9   ? 1_555 O     ? IA HOH .   ? A HOH 310 ? 1_555 93.1  ? 
8   OP2   ? B  C   21  ? A C   35  ? 1_555 MN ? BA MN . ? A MN 9   ? 1_555 O     ? IA HOH .   ? A HOH 310 ? 1_555 168.5 ? 
9   O     ? IA HOH .   ? A HOH 549 ? 1_555 MN ? BA MN . ? A MN 9   ? 1_555 O     ? IA HOH .   ? A HOH 310 ? 1_555 80.5  ? 
10  O     ? IA HOH .   ? A HOH 481 ? 1_555 MN ? BA MN . ? A MN 9   ? 1_555 O     ? IA HOH .   ? A HOH 310 ? 1_555 96.8  ? 
11  OP2   ? B  C   22  ? A C   36  ? 1_555 MN ? BA MN . ? A MN 9   ? 1_555 O     ? IA HOH .   ? A HOH 482 ? 1_555 80.5  ? 
12  OP2   ? B  C   21  ? A C   35  ? 1_555 MN ? BA MN . ? A MN 9   ? 1_555 O     ? IA HOH .   ? A HOH 482 ? 1_555 90.3  ? 
13  O     ? IA HOH .   ? A HOH 549 ? 1_555 MN ? BA MN . ? A MN 9   ? 1_555 O     ? IA HOH .   ? A HOH 482 ? 1_555 114.5 ? 
14  O     ? IA HOH .   ? A HOH 481 ? 1_555 MN ? BA MN . ? A MN 9   ? 1_555 O     ? IA HOH .   ? A HOH 482 ? 1_555 165.4 ? 
15  O     ? IA HOH .   ? A HOH 310 ? 1_555 MN ? BA MN . ? A MN 9   ? 1_555 O     ? IA HOH .   ? A HOH 482 ? 1_555 79.4  ? 
16  OP2   ? A  A   58  ? X A   72  ? 1_555 MN ? I  MN . ? X MN 4   ? 1_555 O     ? HA HOH .   ? X HOH 299 ? 1_555 94.4  ? 
17  OP2   ? A  A   58  ? X A   72  ? 1_555 MN ? I  MN . ? X MN 4   ? 1_555 O     ? HA HOH .   ? X HOH 471 ? 1_555 168.3 ? 
18  O     ? HA HOH .   ? X HOH 299 ? 1_555 MN ? I  MN . ? X MN 4   ? 1_555 O     ? HA HOH .   ? X HOH 471 ? 1_555 85.6  ? 
19  OP2   ? A  A   58  ? X A   72  ? 1_555 MN ? I  MN . ? X MN 4   ? 1_555 O     ? HA HOH .   ? X HOH 288 ? 1_555 84.8  ? 
20  O     ? HA HOH .   ? X HOH 299 ? 1_555 MN ? I  MN . ? X MN 4   ? 1_555 O     ? HA HOH .   ? X HOH 288 ? 1_555 96.4  ? 
21  O     ? HA HOH .   ? X HOH 471 ? 1_555 MN ? I  MN . ? X MN 4   ? 1_555 O     ? HA HOH .   ? X HOH 288 ? 1_555 83.6  ? 
22  OP2   ? B  A   58  ? A A   72  ? 1_555 MN ? X  MN . ? A MN 4   ? 1_555 O     ? IA HOH .   ? A HOH 332 ? 1_555 166.0 ? 
23  OP2   ? B  A   58  ? A A   72  ? 1_555 MN ? X  MN . ? A MN 4   ? 1_555 O     ? IA HOH .   ? A HOH 320 ? 1_555 83.4  ? 
24  O     ? IA HOH .   ? A HOH 332 ? 1_555 MN ? X  MN . ? A MN 4   ? 1_555 O     ? IA HOH .   ? A HOH 320 ? 1_555 86.5  ? 
25  OP2   ? B  A   58  ? A A   72  ? 1_555 MN ? X  MN . ? A MN 4   ? 1_555 O     ? IA HOH .   ? A HOH 490 ? 1_555 86.3  ? 
26  O     ? IA HOH .   ? A HOH 332 ? 1_555 MN ? X  MN . ? A MN 4   ? 1_555 O     ? IA HOH .   ? A HOH 490 ? 1_555 84.3  ? 
27  O     ? IA HOH .   ? A HOH 320 ? 1_555 MN ? X  MN . ? A MN 4   ? 1_555 O     ? IA HOH .   ? A HOH 490 ? 1_555 91.4  ? 
28  OP2   ? B  A   58  ? A A   72  ? 1_555 MN ? X  MN . ? A MN 4   ? 1_555 O     ? IA HOH .   ? A HOH 491 ? 1_555 101.5 ? 
29  O     ? IA HOH .   ? A HOH 332 ? 1_555 MN ? X  MN . ? A MN 4   ? 1_555 O     ? IA HOH .   ? A HOH 491 ? 1_555 90.9  ? 
30  O     ? IA HOH .   ? A HOH 320 ? 1_555 MN ? X  MN . ? A MN 4   ? 1_555 O     ? IA HOH .   ? A HOH 491 ? 1_555 108.2 ? 
31  O     ? IA HOH .   ? A HOH 490 ? 1_555 MN ? X  MN . ? A MN 4   ? 1_555 O     ? IA HOH .   ? A HOH 491 ? 1_555 159.5 ? 
32  OP2   ? B  A   49  ? A A   63  ? 1_555 MN ? Y  MN . ? A MN 5   ? 1_555 O     ? IA HOH .   ? A HOH 492 ? 1_555 105.3 ? 
33  OP2   ? B  A   49  ? A A   63  ? 1_555 MN ? Y  MN . ? A MN 5   ? 1_555 O     ? IA HOH .   ? A HOH 474 ? 1_555 94.7  ? 
34  O     ? IA HOH .   ? A HOH 492 ? 1_555 MN ? Y  MN . ? A MN 5   ? 1_555 O     ? IA HOH .   ? A HOH 474 ? 1_555 88.2  ? 
35  OP2   ? B  A   49  ? A A   63  ? 1_555 MN ? Y  MN . ? A MN 5   ? 1_555 O     ? IA HOH .   ? A HOH 473 ? 1_555 101.4 ? 
36  O     ? IA HOH .   ? A HOH 492 ? 1_555 MN ? Y  MN . ? A MN 5   ? 1_555 O     ? IA HOH .   ? A HOH 473 ? 1_555 93.9  ? 
37  O     ? IA HOH .   ? A HOH 474 ? 1_555 MN ? Y  MN . ? A MN 5   ? 1_555 O     ? IA HOH .   ? A HOH 473 ? 1_555 162.7 ? 
38  OP2   ? B  A   49  ? A A   63  ? 1_555 MN ? Y  MN . ? A MN 5   ? 1_555 O     ? IA HOH .   ? A HOH 263 ? 1_555 94.9  ? 
39  O     ? IA HOH .   ? A HOH 492 ? 1_555 MN ? Y  MN . ? A MN 5   ? 1_555 O     ? IA HOH .   ? A HOH 263 ? 1_555 159.6 ? 
40  O     ? IA HOH .   ? A HOH 474 ? 1_555 MN ? Y  MN . ? A MN 5   ? 1_555 O     ? IA HOH .   ? A HOH 263 ? 1_555 93.4  ? 
41  O     ? IA HOH .   ? A HOH 473 ? 1_555 MN ? Y  MN . ? A MN 5   ? 1_555 O     ? IA HOH .   ? A HOH 263 ? 1_555 78.8  ? 
42  OP2   ? B  A   49  ? A A   63  ? 1_555 MN ? Y  MN . ? A MN 5   ? 1_555 O     ? IA HOH .   ? A HOH 475 ? 1_555 169.8 ? 
43  O     ? IA HOH .   ? A HOH 492 ? 1_555 MN ? Y  MN . ? A MN 5   ? 1_555 O     ? IA HOH .   ? A HOH 475 ? 1_555 74.2  ? 
44  O     ? IA HOH .   ? A HOH 474 ? 1_555 MN ? Y  MN . ? A MN 5   ? 1_555 O     ? IA HOH .   ? A HOH 475 ? 1_555 75.1  ? 
45  O     ? IA HOH .   ? A HOH 473 ? 1_555 MN ? Y  MN . ? A MN 5   ? 1_555 O     ? IA HOH .   ? A HOH 475 ? 1_555 88.9  ? 
46  O     ? IA HOH .   ? A HOH 263 ? 1_555 MN ? Y  MN . ? A MN 5   ? 1_555 O     ? IA HOH .   ? A HOH 475 ? 1_555 86.5  ? 
47  OP1   ? A  U   9   ? X U   23  ? 1_555 MN ? G  MN . ? X MN 177 ? 1_555 OP1   ? A  G   86  ? X G   100 ? 1_555 101.9 ? 
48  OP1   ? A  U   9   ? X U   23  ? 1_555 MN ? G  MN . ? X MN 177 ? 1_555 O     ? HA HOH .   ? X HOH 209 ? 1_555 171.6 ? 
49  OP1   ? A  G   86  ? X G   100 ? 1_555 MN ? G  MN . ? X MN 177 ? 1_555 O     ? HA HOH .   ? X HOH 209 ? 1_555 86.3  ? 
50  OP1   ? A  U   9   ? X U   23  ? 1_555 MN ? G  MN . ? X MN 177 ? 1_555 O     ? HA HOH .   ? X HOH 327 ? 1_555 86.5  ? 
51  OP1   ? A  G   86  ? X G   100 ? 1_555 MN ? G  MN . ? X MN 177 ? 1_555 O     ? HA HOH .   ? X HOH 327 ? 1_555 97.2  ? 
52  O     ? HA HOH .   ? X HOH 209 ? 1_555 MN ? G  MN . ? X MN 177 ? 1_555 O     ? HA HOH .   ? X HOH 327 ? 1_555 90.8  ? 
53  OP1   ? A  U   9   ? X U   23  ? 1_555 MN ? G  MN . ? X MN 177 ? 1_555 O     ? HA HOH .   ? X HOH 203 ? 1_555 97.8  ? 
54  OP1   ? A  G   86  ? X G   100 ? 1_555 MN ? G  MN . ? X MN 177 ? 1_555 O     ? HA HOH .   ? X HOH 203 ? 1_555 89.9  ? 
55  O     ? HA HOH .   ? X HOH 209 ? 1_555 MN ? G  MN . ? X MN 177 ? 1_555 O     ? HA HOH .   ? X HOH 203 ? 1_555 83.8  ? 
56  O     ? HA HOH .   ? X HOH 327 ? 1_555 MN ? G  MN . ? X MN 177 ? 1_555 O     ? HA HOH .   ? X HOH 203 ? 1_555 170.7 ? 
57  OP1   ? A  U   9   ? X U   23  ? 1_555 MN ? G  MN . ? X MN 177 ? 1_555 O     ? HA HOH .   ? X HOH 316 ? 1_555 86.4  ? 
58  OP1   ? A  G   86  ? X G   100 ? 1_555 MN ? G  MN . ? X MN 177 ? 1_555 O     ? HA HOH .   ? X HOH 316 ? 1_555 171.7 ? 
59  O     ? HA HOH .   ? X HOH 209 ? 1_555 MN ? G  MN . ? X MN 177 ? 1_555 O     ? HA HOH .   ? X HOH 316 ? 1_555 85.4  ? 
60  O     ? HA HOH .   ? X HOH 327 ? 1_555 MN ? G  MN . ? X MN 177 ? 1_555 O     ? HA HOH .   ? X HOH 316 ? 1_555 83.3  ? 
61  O     ? HA HOH .   ? X HOH 203 ? 1_555 MN ? G  MN . ? X MN 177 ? 1_555 O     ? HA HOH .   ? X HOH 316 ? 1_555 88.8  ? 
62  OP1   ? A  A   11  ? X A   25  ? 1_555 MN ? H  MN . ? X MN 178 ? 1_555 OP2   ? A  U   10  ? X U   24  ? 1_555 93.0  ? 
63  OP1   ? A  A   11  ? X A   25  ? 1_555 MN ? H  MN . ? X MN 178 ? 1_555 O     ? HA HOH .   ? X HOH 498 ? 1_555 170.6 ? 
64  OP2   ? A  U   10  ? X U   24  ? 1_555 MN ? H  MN . ? X MN 178 ? 1_555 O     ? HA HOH .   ? X HOH 498 ? 1_555 96.0  ? 
65  OP1   ? A  A   11  ? X A   25  ? 1_555 MN ? H  MN . ? X MN 178 ? 1_555 O     ? HA HOH .   ? X HOH 272 ? 1_555 92.6  ? 
66  OP2   ? A  U   10  ? X U   24  ? 1_555 MN ? H  MN . ? X MN 178 ? 1_555 O     ? HA HOH .   ? X HOH 272 ? 1_555 92.5  ? 
67  O     ? HA HOH .   ? X HOH 498 ? 1_555 MN ? H  MN . ? X MN 178 ? 1_555 O     ? HA HOH .   ? X HOH 272 ? 1_555 84.3  ? 
68  OP1   ? A  A   11  ? X A   25  ? 1_555 MN ? H  MN . ? X MN 178 ? 1_555 O     ? HA HOH .   ? X HOH 247 ? 1_555 91.7  ? 
69  OP2   ? A  U   10  ? X U   24  ? 1_555 MN ? H  MN . ? X MN 178 ? 1_555 O     ? HA HOH .   ? X HOH 247 ? 1_555 172.1 ? 
70  O     ? HA HOH .   ? X HOH 498 ? 1_555 MN ? H  MN . ? X MN 178 ? 1_555 O     ? HA HOH .   ? X HOH 247 ? 1_555 79.7  ? 
71  O     ? HA HOH .   ? X HOH 272 ? 1_555 MN ? H  MN . ? X MN 178 ? 1_555 O     ? HA HOH .   ? X HOH 247 ? 1_555 93.7  ? 
72  OP1   ? A  A   11  ? X A   25  ? 1_555 MN ? H  MN . ? X MN 178 ? 1_555 O     ? HA HOH .   ? X HOH 279 ? 1_555 92.6  ? 
73  OP2   ? A  U   10  ? X U   24  ? 1_555 MN ? H  MN . ? X MN 178 ? 1_555 O     ? HA HOH .   ? X HOH 279 ? 1_555 90.9  ? 
74  O     ? HA HOH .   ? X HOH 498 ? 1_555 MN ? H  MN . ? X MN 178 ? 1_555 O     ? HA HOH .   ? X HOH 279 ? 1_555 90.0  ? 
75  O     ? HA HOH .   ? X HOH 272 ? 1_555 MN ? H  MN . ? X MN 178 ? 1_555 O     ? HA HOH .   ? X HOH 279 ? 1_555 173.7 ? 
76  O     ? HA HOH .   ? X HOH 247 ? 1_555 MN ? H  MN . ? X MN 178 ? 1_555 O     ? HA HOH .   ? X HOH 279 ? 1_555 82.5  ? 
77  OP1   ? B  G   86  ? A G   100 ? 1_555 MN ? V  MN . ? A MN 177 ? 1_555 OP1   ? B  U   9   ? A U   23  ? 1_555 101.6 ? 
78  OP1   ? B  G   86  ? A G   100 ? 1_555 MN ? V  MN . ? A MN 177 ? 1_555 O     ? IA HOH .   ? A HOH 220 ? 1_555 83.1  ? 
79  OP1   ? B  U   9   ? A U   23  ? 1_555 MN ? V  MN . ? A MN 177 ? 1_555 O     ? IA HOH .   ? A HOH 220 ? 1_555 175.1 ? 
80  OP1   ? B  G   86  ? A G   100 ? 1_555 MN ? V  MN . ? A MN 177 ? 1_555 O     ? IA HOH .   ? A HOH 230 ? 1_555 87.9  ? 
81  OP1   ? B  U   9   ? A U   23  ? 1_555 MN ? V  MN . ? A MN 177 ? 1_555 O     ? IA HOH .   ? A HOH 230 ? 1_555 96.4  ? 
82  O     ? IA HOH .   ? A HOH 220 ? 1_555 MN ? V  MN . ? A MN 177 ? 1_555 O     ? IA HOH .   ? A HOH 230 ? 1_555 85.2  ? 
83  OP1   ? B  G   86  ? A G   100 ? 1_555 MN ? V  MN . ? A MN 177 ? 1_555 O     ? IA HOH .   ? A HOH 472 ? 1_555 173.7 ? 
84  OP1   ? B  U   9   ? A U   23  ? 1_555 MN ? V  MN . ? A MN 177 ? 1_555 O     ? IA HOH .   ? A HOH 472 ? 1_555 84.3  ? 
85  O     ? IA HOH .   ? A HOH 220 ? 1_555 MN ? V  MN . ? A MN 177 ? 1_555 O     ? IA HOH .   ? A HOH 472 ? 1_555 91.0  ? 
86  O     ? IA HOH .   ? A HOH 230 ? 1_555 MN ? V  MN . ? A MN 177 ? 1_555 O     ? IA HOH .   ? A HOH 472 ? 1_555 89.5  ? 
87  OP1   ? B  G   86  ? A G   100 ? 1_555 MN ? V  MN . ? A MN 177 ? 1_555 O     ? IA HOH .   ? A HOH 546 ? 1_555 88.9  ? 
88  OP1   ? B  U   9   ? A U   23  ? 1_555 MN ? V  MN . ? A MN 177 ? 1_555 O     ? IA HOH .   ? A HOH 546 ? 1_555 89.3  ? 
89  O     ? IA HOH .   ? A HOH 220 ? 1_555 MN ? V  MN . ? A MN 177 ? 1_555 O     ? IA HOH .   ? A HOH 546 ? 1_555 89.3  ? 
90  O     ? IA HOH .   ? A HOH 230 ? 1_555 MN ? V  MN . ? A MN 177 ? 1_555 O     ? IA HOH .   ? A HOH 546 ? 1_555 173.9 ? 
91  O     ? IA HOH .   ? A HOH 472 ? 1_555 MN ? V  MN . ? A MN 177 ? 1_555 O     ? IA HOH .   ? A HOH 546 ? 1_555 93.2  ? 
92  OP1   ? B  G   86  ? A G   100 ? 1_555 MN ? V  MN . ? A MN 177 ? 1_555 O     ? IA HOH .   ? A HOH 217 ? 1_555 125.9 ? 
93  OP1   ? B  U   9   ? A U   23  ? 1_555 MN ? V  MN . ? A MN 177 ? 1_555 O     ? IA HOH .   ? A HOH 217 ? 1_555 70.2  ? 
94  O     ? IA HOH .   ? A HOH 220 ? 1_555 MN ? V  MN . ? A MN 177 ? 1_555 O     ? IA HOH .   ? A HOH 217 ? 1_555 106.0 ? 
95  O     ? IA HOH .   ? A HOH 230 ? 1_555 MN ? V  MN . ? A MN 177 ? 1_555 O     ? IA HOH .   ? A HOH 217 ? 1_555 145.0 ? 
96  O     ? IA HOH .   ? A HOH 472 ? 1_555 MN ? V  MN . ? A MN 177 ? 1_555 O     ? IA HOH .   ? A HOH 217 ? 1_555 57.9  ? 
97  O     ? IA HOH .   ? A HOH 546 ? 1_555 MN ? V  MN . ? A MN 177 ? 1_555 O     ? IA HOH .   ? A HOH 217 ? 1_555 39.6  ? 
98  OP1   ? B  U   115 ? A U   129 ? 1_555 MN ? FA MN . ? A MN 13  ? 1_555 OP2   ? B  A   114 ? A A   128 ? 1_555 96.9  ? 
99  OP1   ? B  U   115 ? A U   129 ? 1_555 MN ? FA MN . ? A MN 13  ? 1_555 OP1   ? B  G   113 ? A G   127 ? 1_555 94.4  ? 
100 OP2   ? B  A   114 ? A A   128 ? 1_555 MN ? FA MN . ? A MN 13  ? 1_555 OP1   ? B  G   113 ? A G   127 ? 1_555 97.9  ? 
101 OP1   ? B  U   115 ? A U   129 ? 1_555 MN ? FA MN . ? A MN 13  ? 1_555 O     ? IA HOH .   ? A HOH 496 ? 1_555 89.1  ? 
102 OP2   ? B  A   114 ? A A   128 ? 1_555 MN ? FA MN . ? A MN 13  ? 1_555 O     ? IA HOH .   ? A HOH 496 ? 1_555 88.2  ? 
103 OP1   ? B  G   113 ? A G   127 ? 1_555 MN ? FA MN . ? A MN 13  ? 1_555 O     ? IA HOH .   ? A HOH 496 ? 1_555 172.5 ? 
104 OP1   ? B  U   115 ? A U   129 ? 1_555 MN ? FA MN . ? A MN 13  ? 1_555 O     ? IA HOH .   ? A HOH 515 ? 1_555 175.3 ? 
105 OP2   ? B  A   114 ? A A   128 ? 1_555 MN ? FA MN . ? A MN 13  ? 1_555 O     ? IA HOH .   ? A HOH 515 ? 1_555 85.0  ? 
106 OP1   ? B  G   113 ? A G   127 ? 1_555 MN ? FA MN . ? A MN 13  ? 1_555 O     ? IA HOH .   ? A HOH 515 ? 1_555 89.5  ? 
107 O     ? IA HOH .   ? A HOH 496 ? 1_555 MN ? FA MN . ? A MN 13  ? 1_555 O     ? IA HOH .   ? A HOH 515 ? 1_555 86.6  ? 
108 O     ? HA HOH .   ? X HOH 506 ? 1_555 MN ? N  MN . ? X MN 13  ? 1_555 OP1   ? A  U   115 ? X U   129 ? 1_555 77.9  ? 
109 O     ? HA HOH .   ? X HOH 506 ? 1_555 MN ? N  MN . ? X MN 13  ? 1_555 OP2   ? A  A   114 ? X A   128 ? 1_555 176.3 ? 
110 OP1   ? A  U   115 ? X U   129 ? 1_555 MN ? N  MN . ? X MN 13  ? 1_555 OP2   ? A  A   114 ? X A   128 ? 1_555 102.0 ? 
111 O     ? HA HOH .   ? X HOH 506 ? 1_555 MN ? N  MN . ? X MN 13  ? 1_555 OP1   ? A  G   113 ? X G   127 ? 1_555 76.1  ? 
112 OP1   ? A  U   115 ? X U   129 ? 1_555 MN ? N  MN . ? X MN 13  ? 1_555 OP1   ? A  G   113 ? X G   127 ? 1_555 88.7  ? 
113 OP2   ? A  A   114 ? X A   128 ? 1_555 MN ? N  MN . ? X MN 13  ? 1_555 OP1   ? A  G   113 ? X G   127 ? 1_555 100.2 ? 
114 OP2   ? B  A   66  ? A A   80  ? 1_555 MN ? Z  MN . ? A MN 6   ? 1_555 O4    ? B  U   67  ? A U   81  ? 1_555 96.5  ? 
115 OP2   ? B  A   66  ? A A   80  ? 1_555 MN ? Z  MN . ? A MN 6   ? 1_555 O     ? IA HOH .   ? A HOH 487 ? 1_555 92.9  ? 
116 O4    ? B  U   67  ? A U   81  ? 1_555 MN ? Z  MN . ? A MN 6   ? 1_555 O     ? IA HOH .   ? A HOH 487 ? 1_555 93.9  ? 
117 OP2   ? B  A   66  ? A A   80  ? 1_555 MN ? Z  MN . ? A MN 6   ? 1_555 O     ? IA HOH .   ? A HOH 247 ? 1_555 86.8  ? 
118 O4    ? B  U   67  ? A U   81  ? 1_555 MN ? Z  MN . ? A MN 6   ? 1_555 O     ? IA HOH .   ? A HOH 247 ? 1_555 84.2  ? 
119 O     ? IA HOH .   ? A HOH 487 ? 1_555 MN ? Z  MN . ? A MN 6   ? 1_555 O     ? IA HOH .   ? A HOH 247 ? 1_555 178.1 ? 
120 OP2   ? B  A   66  ? A A   80  ? 1_555 MN ? Z  MN . ? A MN 6   ? 1_555 O     ? IA HOH .   ? A HOH 477 ? 1_555 84.6  ? 
121 O4    ? B  U   67  ? A U   81  ? 1_555 MN ? Z  MN . ? A MN 6   ? 1_555 O     ? IA HOH .   ? A HOH 477 ? 1_555 157.6 ? 
122 O     ? IA HOH .   ? A HOH 487 ? 1_555 MN ? Z  MN . ? A MN 6   ? 1_555 O     ? IA HOH .   ? A HOH 477 ? 1_555 108.4 ? 
123 O     ? IA HOH .   ? A HOH 247 ? 1_555 MN ? Z  MN . ? A MN 6   ? 1_555 O     ? IA HOH .   ? A HOH 477 ? 1_555 73.5  ? 
124 OP2   ? B  A   66  ? A A   80  ? 1_555 MN ? Z  MN . ? A MN 6   ? 1_555 O     ? IA HOH .   ? A HOH 476 ? 1_555 173.8 ? 
125 O4    ? B  U   67  ? A U   81  ? 1_555 MN ? Z  MN . ? A MN 6   ? 1_555 O     ? IA HOH .   ? A HOH 476 ? 1_555 78.8  ? 
126 O     ? IA HOH .   ? A HOH 487 ? 1_555 MN ? Z  MN . ? A MN 6   ? 1_555 O     ? IA HOH .   ? A HOH 476 ? 1_555 83.4  ? 
127 O     ? IA HOH .   ? A HOH 247 ? 1_555 MN ? Z  MN . ? A MN 6   ? 1_555 O     ? IA HOH .   ? A HOH 476 ? 1_555 96.7  ? 
128 O     ? IA HOH .   ? A HOH 477 ? 1_555 MN ? Z  MN . ? A MN 6   ? 1_555 O     ? IA HOH .   ? A HOH 476 ? 1_555 101.3 ? 
129 OP2   ? A  C   22  ? X C   36  ? 1_555 MN ? K  MN . ? X MN 9   ? 1_555 O     ? HA HOH .   ? X HOH 504 ? 1_555 165.3 ? 
130 OP2   ? A  C   22  ? X C   36  ? 1_555 MN ? K  MN . ? X MN 9   ? 1_555 OP2   ? A  C   21  ? X C   35  ? 1_555 88.2  ? 
131 O     ? HA HOH .   ? X HOH 504 ? 1_555 MN ? K  MN . ? X MN 9   ? 1_555 OP2   ? A  C   21  ? X C   35  ? 1_555 95.4  ? 
132 OP2   ? A  C   22  ? X C   36  ? 1_555 MN ? K  MN . ? X MN 9   ? 1_555 O     ? HA HOH .   ? X HOH 523 ? 1_555 81.3  ? 
133 O     ? HA HOH .   ? X HOH 504 ? 1_555 MN ? K  MN . ? X MN 9   ? 1_555 O     ? HA HOH .   ? X HOH 523 ? 1_555 92.4  ? 
134 OP2   ? A  C   21  ? X C   35  ? 1_555 MN ? K  MN . ? X MN 9   ? 1_555 O     ? HA HOH .   ? X HOH 523 ? 1_555 165.5 ? 
135 OP2   ? A  C   22  ? X C   36  ? 1_555 MN ? K  MN . ? X MN 9   ? 1_555 O     ? HA HOH .   ? X HOH 524 ? 1_555 75.1  ? 
136 O     ? HA HOH .   ? X HOH 504 ? 1_555 MN ? K  MN . ? X MN 9   ? 1_555 O     ? HA HOH .   ? X HOH 524 ? 1_555 90.6  ? 
137 OP2   ? A  C   21  ? X C   35  ? 1_555 MN ? K  MN . ? X MN 9   ? 1_555 O     ? HA HOH .   ? X HOH 524 ? 1_555 90.6  ? 
138 O     ? HA HOH .   ? X HOH 523 ? 1_555 MN ? K  MN . ? X MN 9   ? 1_555 O     ? HA HOH .   ? X HOH 524 ? 1_555 77.1  ? 
139 OP2   ? A  C   22  ? X C   36  ? 1_555 MN ? K  MN . ? X MN 9   ? 1_555 O     ? HA HOH .   ? X HOH 522 ? 1_555 104.2 ? 
140 O     ? HA HOH .   ? X HOH 504 ? 1_555 MN ? K  MN . ? X MN 9   ? 1_555 O     ? HA HOH .   ? X HOH 522 ? 1_555 88.8  ? 
141 OP2   ? A  C   21  ? X C   35  ? 1_555 MN ? K  MN . ? X MN 9   ? 1_555 O     ? HA HOH .   ? X HOH 522 ? 1_555 104.1 ? 
142 O     ? HA HOH .   ? X HOH 523 ? 1_555 MN ? K  MN . ? X MN 9   ? 1_555 O     ? HA HOH .   ? X HOH 522 ? 1_555 88.3  ? 
143 O     ? HA HOH .   ? X HOH 524 ? 1_555 MN ? K  MN . ? X MN 9   ? 1_555 O     ? HA HOH .   ? X HOH 522 ? 1_555 165.3 ? 
144 OP2   ? A  U   105 ? X U   119 ? 1_555 MN ? J  MN . ? X MN 7   ? 1_555 OP1   ? A  A   104 ? X A   118 ? 1_555 82.7  ? 
145 OP2   ? A  U   105 ? X U   119 ? 1_555 MN ? J  MN . ? X MN 7   ? 1_555 O     ? HA HOH .   ? X HOH 547 ? 1_555 107.0 ? 
146 OP1   ? A  A   104 ? X A   118 ? 1_555 MN ? J  MN . ? X MN 7   ? 1_555 O     ? HA HOH .   ? X HOH 547 ? 1_555 68.8  ? 
147 OP1   ? B  A   11  ? A A   25  ? 1_555 MN ? W  MN . ? A MN 178 ? 1_555 OP2   ? B  U   10  ? A U   24  ? 1_555 93.7  ? 
148 OP1   ? B  A   11  ? A A   25  ? 1_555 MN ? W  MN . ? A MN 178 ? 1_555 O     ? IA HOH .   ? A HOH 244 ? 1_555 169.2 ? 
149 OP2   ? B  U   10  ? A U   24  ? 1_555 MN ? W  MN . ? A MN 178 ? 1_555 O     ? IA HOH .   ? A HOH 244 ? 1_555 96.7  ? 
150 OP1   ? B  A   11  ? A A   25  ? 1_555 MN ? W  MN . ? A MN 178 ? 1_555 O     ? IA HOH .   ? A HOH 255 ? 1_555 90.8  ? 
151 OP2   ? B  U   10  ? A U   24  ? 1_555 MN ? W  MN . ? A MN 178 ? 1_555 O     ? IA HOH .   ? A HOH 255 ? 1_555 94.5  ? 
152 O     ? IA HOH .   ? A HOH 244 ? 1_555 MN ? W  MN . ? A MN 178 ? 1_555 O     ? IA HOH .   ? A HOH 255 ? 1_555 85.7  ? 
153 OP1   ? B  A   11  ? A A   25  ? 1_555 MN ? W  MN . ? A MN 178 ? 1_555 O     ? IA HOH .   ? A HOH 258 ? 1_555 90.6  ? 
154 OP2   ? B  U   10  ? A U   24  ? 1_555 MN ? W  MN . ? A MN 178 ? 1_555 O     ? IA HOH .   ? A HOH 258 ? 1_555 172.6 ? 
155 O     ? IA HOH .   ? A HOH 244 ? 1_555 MN ? W  MN . ? A MN 178 ? 1_555 O     ? IA HOH .   ? A HOH 258 ? 1_555 79.3  ? 
156 O     ? IA HOH .   ? A HOH 255 ? 1_555 MN ? W  MN . ? A MN 178 ? 1_555 O     ? IA HOH .   ? A HOH 258 ? 1_555 91.5  ? 
157 OP1   ? B  A   11  ? A A   25  ? 1_555 MN ? W  MN . ? A MN 178 ? 1_555 O     ? IA HOH .   ? A HOH 222 ? 1_555 94.1  ? 
158 OP2   ? B  U   10  ? A U   24  ? 1_555 MN ? W  MN . ? A MN 178 ? 1_555 O     ? IA HOH .   ? A HOH 222 ? 1_555 88.4  ? 
159 O     ? IA HOH .   ? A HOH 244 ? 1_555 MN ? W  MN . ? A MN 178 ? 1_555 O     ? IA HOH .   ? A HOH 222 ? 1_555 88.9  ? 
160 O     ? IA HOH .   ? A HOH 255 ? 1_555 MN ? W  MN . ? A MN 178 ? 1_555 O     ? IA HOH .   ? A HOH 222 ? 1_555 174.1 ? 
161 O     ? IA HOH .   ? A HOH 258 ? 1_555 MN ? W  MN . ? A MN 178 ? 1_555 O     ? IA HOH .   ? A HOH 222 ? 1_555 85.2  ? 
162 OP2   ? A  G   17  ? X G   31  ? 1_555 MN ? O  MN . ? X MN 14  ? 1_555 OP2   ? A  A   16  ? X A   30  ? 1_555 103.7 ? 
163 OP2   ? A  G   17  ? X G   31  ? 1_555 MN ? O  MN . ? X MN 14  ? 1_555 O     ? HA HOH .   ? X HOH 507 ? 1_555 169.4 ? 
164 OP2   ? A  A   16  ? X A   30  ? 1_555 MN ? O  MN . ? X MN 14  ? 1_555 O     ? HA HOH .   ? X HOH 507 ? 1_555 79.5  ? 
165 OP2   ? A  G   17  ? X G   31  ? 1_555 MN ? O  MN . ? X MN 14  ? 1_555 O     ? HA HOH .   ? X HOH 510 ? 1_555 87.4  ? 
166 OP2   ? A  A   16  ? X A   30  ? 1_555 MN ? O  MN . ? X MN 14  ? 1_555 O     ? HA HOH .   ? X HOH 510 ? 1_555 168.3 ? 
167 O     ? HA HOH .   ? X HOH 507 ? 1_555 MN ? O  MN . ? X MN 14  ? 1_555 O     ? HA HOH .   ? X HOH 510 ? 1_555 90.3  ? 
168 OP2   ? A  G   17  ? X G   31  ? 1_555 MN ? O  MN . ? X MN 14  ? 1_555 O     ? HA HOH .   ? X HOH 509 ? 1_555 95.4  ? 
169 OP2   ? A  A   16  ? X A   30  ? 1_555 MN ? O  MN . ? X MN 14  ? 1_555 O     ? HA HOH .   ? X HOH 509 ? 1_555 90.9  ? 
170 O     ? HA HOH .   ? X HOH 507 ? 1_555 MN ? O  MN . ? X MN 14  ? 1_555 O     ? HA HOH .   ? X HOH 509 ? 1_555 94.6  ? 
171 O     ? HA HOH .   ? X HOH 510 ? 1_555 MN ? O  MN . ? X MN 14  ? 1_555 O     ? HA HOH .   ? X HOH 509 ? 1_555 84.2  ? 
172 OP2   ? A  G   17  ? X G   31  ? 1_555 MN ? O  MN . ? X MN 14  ? 1_555 O     ? HA HOH .   ? X HOH 508 ? 1_555 89.9  ? 
173 OP2   ? A  A   16  ? X A   30  ? 1_555 MN ? O  MN . ? X MN 14  ? 1_555 O     ? HA HOH .   ? X HOH 508 ? 1_555 93.0  ? 
174 O     ? HA HOH .   ? X HOH 507 ? 1_555 MN ? O  MN . ? X MN 14  ? 1_555 O     ? HA HOH .   ? X HOH 508 ? 1_555 79.9  ? 
175 O     ? HA HOH .   ? X HOH 510 ? 1_555 MN ? O  MN . ? X MN 14  ? 1_555 O     ? HA HOH .   ? X HOH 508 ? 1_555 90.8  ? 
176 O     ? HA HOH .   ? X HOH 509 ? 1_555 MN ? O  MN . ? X MN 14  ? 1_555 O     ? HA HOH .   ? X HOH 508 ? 1_555 172.6 ? 
177 O     ? IA HOH .   ? A HOH 483 ? 1_555 MN ? CA MN . ? A MN 10  ? 1_555 O     ? IA HOH .   ? A HOH 486 ? 1_555 85.8  ? 
178 O     ? IA HOH .   ? A HOH 483 ? 1_555 MN ? CA MN . ? A MN 10  ? 1_555 OP2   ? B  A   92  ? A A   106 ? 1_555 90.1  ? 
179 O     ? IA HOH .   ? A HOH 486 ? 1_555 MN ? CA MN . ? A MN 10  ? 1_555 OP2   ? B  A   92  ? A A   106 ? 1_555 175.7 ? 
180 O     ? IA HOH .   ? A HOH 483 ? 1_555 MN ? CA MN . ? A MN 10  ? 1_555 O     ? IA HOH .   ? A HOH 485 ? 1_555 85.2  ? 
181 O     ? IA HOH .   ? A HOH 486 ? 1_555 MN ? CA MN . ? A MN 10  ? 1_555 O     ? IA HOH .   ? A HOH 485 ? 1_555 84.7  ? 
182 OP2   ? B  A   92  ? A A   106 ? 1_555 MN ? CA MN . ? A MN 10  ? 1_555 O     ? IA HOH .   ? A HOH 485 ? 1_555 93.8  ? 
183 O     ? IA HOH .   ? A HOH 483 ? 1_555 MN ? CA MN . ? A MN 10  ? 1_555 O     ? IA HOH .   ? A HOH 484 ? 1_555 178.3 ? 
184 O     ? IA HOH .   ? A HOH 486 ? 1_555 MN ? CA MN . ? A MN 10  ? 1_555 O     ? IA HOH .   ? A HOH 484 ? 1_555 92.7  ? 
185 OP2   ? B  A   92  ? A A   106 ? 1_555 MN ? CA MN . ? A MN 10  ? 1_555 O     ? IA HOH .   ? A HOH 484 ? 1_555 91.4  ? 
186 O     ? IA HOH .   ? A HOH 485 ? 1_555 MN ? CA MN . ? A MN 10  ? 1_555 O     ? IA HOH .   ? A HOH 484 ? 1_555 93.9  ? 
187 O     ? IA HOH .   ? A HOH 483 ? 1_555 MN ? CA MN . ? A MN 10  ? 1_555 N7    ? B  G   93  ? A G   107 ? 1_555 89.3  ? 
188 O     ? IA HOH .   ? A HOH 486 ? 1_555 MN ? CA MN . ? A MN 10  ? 1_555 N7    ? B  G   93  ? A G   107 ? 1_555 82.4  ? 
189 OP2   ? B  A   92  ? A A   106 ? 1_555 MN ? CA MN . ? A MN 10  ? 1_555 N7    ? B  G   93  ? A G   107 ? 1_555 98.7  ? 
190 O     ? IA HOH .   ? A HOH 485 ? 1_555 MN ? CA MN . ? A MN 10  ? 1_555 N7    ? B  G   93  ? A G   107 ? 1_555 166.3 ? 
191 O     ? IA HOH .   ? A HOH 484 ? 1_555 MN ? CA MN . ? A MN 10  ? 1_555 N7    ? B  G   93  ? A G   107 ? 1_555 91.3  ? 
192 O     ? IA HOH .   ? A HOH 495 ? 1_555 MN ? EA MN . ? A MN 12  ? 1_555 OP2   ? B  G   31  ? A G   45  ? 1_555 92.9  ? 
193 O     ? IA HOH .   ? A HOH 495 ? 1_555 MN ? EA MN . ? A MN 12  ? 1_555 O     ? IA HOH .   ? A HOH 324 ? 1_555 93.9  ? 
194 OP2   ? B  G   31  ? A G   45  ? 1_555 MN ? EA MN . ? A MN 12  ? 1_555 O     ? IA HOH .   ? A HOH 324 ? 1_555 89.0  ? 
195 O     ? IA HOH .   ? A HOH 495 ? 1_555 MN ? EA MN . ? A MN 12  ? 1_555 O     ? IA HOH .   ? A HOH 519 ? 1_555 79.5  ? 
196 OP2   ? B  G   31  ? A G   45  ? 1_555 MN ? EA MN . ? A MN 12  ? 1_555 O     ? IA HOH .   ? A HOH 519 ? 1_555 99.8  ? 
197 O     ? IA HOH .   ? A HOH 324 ? 1_555 MN ? EA MN . ? A MN 12  ? 1_555 O     ? IA HOH .   ? A HOH 519 ? 1_555 169.2 ? 
198 O     ? HA HOH .   ? X HOH 501 ? 1_555 MN ? L  MN . ? X MN 10  ? 1_555 O     ? HA HOH .   ? X HOH 502 ? 1_555 85.5  ? 
199 O     ? HA HOH .   ? X HOH 501 ? 1_555 MN ? L  MN . ? X MN 10  ? 1_555 OP2   ? A  A   92  ? X A   106 ? 1_555 87.9  ? 
200 O     ? HA HOH .   ? X HOH 502 ? 1_555 MN ? L  MN . ? X MN 10  ? 1_555 OP2   ? A  A   92  ? X A   106 ? 1_555 173.4 ? 
201 O     ? HA HOH .   ? X HOH 501 ? 1_555 MN ? L  MN . ? X MN 10  ? 1_555 O     ? HA HOH .   ? X HOH 500 ? 1_555 90.0  ? 
202 O     ? HA HOH .   ? X HOH 502 ? 1_555 MN ? L  MN . ? X MN 10  ? 1_555 O     ? HA HOH .   ? X HOH 500 ? 1_555 91.4  ? 
203 OP2   ? A  A   92  ? X A   106 ? 1_555 MN ? L  MN . ? X MN 10  ? 1_555 O     ? HA HOH .   ? X HOH 500 ? 1_555 88.3  ? 
204 O     ? HA HOH .   ? X HOH 501 ? 1_555 MN ? L  MN . ? X MN 10  ? 1_555 N7    ? A  G   93  ? X G   107 ? 1_555 169.2 ? 
205 O     ? HA HOH .   ? X HOH 502 ? 1_555 MN ? L  MN . ? X MN 10  ? 1_555 N7    ? A  G   93  ? X G   107 ? 1_555 83.8  ? 
206 OP2   ? A  A   92  ? X A   106 ? 1_555 MN ? L  MN . ? X MN 10  ? 1_555 N7    ? A  G   93  ? X G   107 ? 1_555 102.8 ? 
207 O     ? HA HOH .   ? X HOH 500 ? 1_555 MN ? L  MN . ? X MN 10  ? 1_555 N7    ? A  G   93  ? X G   107 ? 1_555 91.7  ? 
208 O     ? HA HOH .   ? X HOH 501 ? 1_555 MN ? L  MN . ? X MN 10  ? 1_555 O     ? HA HOH .   ? X HOH 503 ? 1_555 83.1  ? 
209 O     ? HA HOH .   ? X HOH 502 ? 1_555 MN ? L  MN . ? X MN 10  ? 1_555 O     ? HA HOH .   ? X HOH 503 ? 1_555 86.3  ? 
210 OP2   ? A  A   92  ? X A   106 ? 1_555 MN ? L  MN . ? X MN 10  ? 1_555 O     ? HA HOH .   ? X HOH 503 ? 1_555 93.2  ? 
211 O     ? HA HOH .   ? X HOH 500 ? 1_555 MN ? L  MN . ? X MN 10  ? 1_555 O     ? HA HOH .   ? X HOH 503 ? 1_555 172.9 ? 
212 N7    ? A  G   93  ? X G   107 ? 1_555 MN ? L  MN . ? X MN 10  ? 1_555 O     ? HA HOH .   ? X HOH 503 ? 1_555 94.7  ? 
213 OP2   ? A  A   89  ? X A   103 ? 1_555 MN ? F  MN . ? X MN 176 ? 1_555 O4    ? A  U   90  ? X U   104 ? 1_555 91.9  ? 
214 OP2   ? A  A   89  ? X A   103 ? 1_555 MN ? F  MN . ? X MN 176 ? 1_555 OP2   ? A  G   86  ? X G   100 ? 1_555 170.2 ? 
215 O4    ? A  U   90  ? X U   104 ? 1_555 MN ? F  MN . ? X MN 176 ? 1_555 OP2   ? A  G   86  ? X G   100 ? 1_555 96.3  ? 
216 OP2   ? A  A   89  ? X A   103 ? 1_555 MN ? F  MN . ? X MN 176 ? 1_555 OP2   ? A  C   88  ? X C   102 ? 1_555 90.8  ? 
217 O4    ? A  U   90  ? X U   104 ? 1_555 MN ? F  MN . ? X MN 176 ? 1_555 OP2   ? A  C   88  ? X C   102 ? 1_555 89.3  ? 
218 OP2   ? A  G   86  ? X G   100 ? 1_555 MN ? F  MN . ? X MN 176 ? 1_555 OP2   ? A  C   88  ? X C   102 ? 1_555 84.0  ? 
219 OP2   ? A  A   89  ? X A   103 ? 1_555 MN ? F  MN . ? X MN 176 ? 1_555 O     ? HA HOH .   ? X HOH 497 ? 1_555 89.0  ? 
220 O4    ? A  U   90  ? X U   104 ? 1_555 MN ? F  MN . ? X MN 176 ? 1_555 O     ? HA HOH .   ? X HOH 497 ? 1_555 174.8 ? 
221 OP2   ? A  G   86  ? X G   100 ? 1_555 MN ? F  MN . ? X MN 176 ? 1_555 O     ? HA HOH .   ? X HOH 497 ? 1_555 83.4  ? 
222 OP2   ? A  C   88  ? X C   102 ? 1_555 MN ? F  MN . ? X MN 176 ? 1_555 O     ? HA HOH .   ? X HOH 497 ? 1_555 95.9  ? 
223 OP2   ? A  A   89  ? X A   103 ? 1_555 MN ? F  MN . ? X MN 176 ? 1_555 O     ? HA HOH .   ? X HOH 187 ? 1_555 94.0  ? 
224 O4    ? A  U   90  ? X U   104 ? 1_555 MN ? F  MN . ? X MN 176 ? 1_555 O     ? HA HOH .   ? X HOH 187 ? 1_555 86.3  ? 
225 OP2   ? A  G   86  ? X G   100 ? 1_555 MN ? F  MN . ? X MN 176 ? 1_555 O     ? HA HOH .   ? X HOH 187 ? 1_555 91.8  ? 
226 OP2   ? A  C   88  ? X C   102 ? 1_555 MN ? F  MN . ? X MN 176 ? 1_555 O     ? HA HOH .   ? X HOH 187 ? 1_555 173.6 ? 
227 O     ? HA HOH .   ? X HOH 497 ? 1_555 MN ? F  MN . ? X MN 176 ? 1_555 O     ? HA HOH .   ? X HOH 187 ? 1_555 88.4  ? 
228 OP2   ? B  G   86  ? A G   100 ? 1_555 MN ? U  MN . ? A MN 176 ? 1_555 OP2   ? B  C   88  ? A C   102 ? 1_555 87.8  ? 
229 OP2   ? B  G   86  ? A G   100 ? 1_555 MN ? U  MN . ? A MN 176 ? 1_555 O4    ? B  U   90  ? A U   104 ? 1_555 99.0  ? 
230 OP2   ? B  C   88  ? A C   102 ? 1_555 MN ? U  MN . ? A MN 176 ? 1_555 O4    ? B  U   90  ? A U   104 ? 1_555 85.3  ? 
231 OP2   ? B  G   86  ? A G   100 ? 1_555 MN ? U  MN . ? A MN 176 ? 1_555 OP2   ? B  A   89  ? A A   103 ? 1_555 167.5 ? 
232 OP2   ? B  C   88  ? A C   102 ? 1_555 MN ? U  MN . ? A MN 176 ? 1_555 OP2   ? B  A   89  ? A A   103 ? 1_555 93.2  ? 
233 O4    ? B  U   90  ? A U   104 ? 1_555 MN ? U  MN . ? A MN 176 ? 1_555 OP2   ? B  A   89  ? A A   103 ? 1_555 93.5  ? 
234 OP2   ? B  G   86  ? A G   100 ? 1_555 MN ? U  MN . ? A MN 176 ? 1_555 O     ? IA HOH .   ? A HOH 198 ? 1_555 82.7  ? 
235 OP2   ? B  C   88  ? A C   102 ? 1_555 MN ? U  MN . ? A MN 176 ? 1_555 O     ? IA HOH .   ? A HOH 198 ? 1_555 97.3  ? 
236 O4    ? B  U   90  ? A U   104 ? 1_555 MN ? U  MN . ? A MN 176 ? 1_555 O     ? IA HOH .   ? A HOH 198 ? 1_555 176.9 ? 
237 OP2   ? B  A   89  ? A A   103 ? 1_555 MN ? U  MN . ? A MN 176 ? 1_555 O     ? IA HOH .   ? A HOH 198 ? 1_555 84.8  ? 
238 OP2   ? B  G   86  ? A G   100 ? 1_555 MN ? U  MN . ? A MN 176 ? 1_555 O     ? IA HOH .   ? A HOH 195 ? 1_555 93.0  ? 
239 OP2   ? B  C   88  ? A C   102 ? 1_555 MN ? U  MN . ? A MN 176 ? 1_555 O     ? IA HOH .   ? A HOH 195 ? 1_555 175.6 ? 
240 O4    ? B  U   90  ? A U   104 ? 1_555 MN ? U  MN . ? A MN 176 ? 1_555 O     ? IA HOH .   ? A HOH 195 ? 1_555 90.3  ? 
241 OP2   ? B  A   89  ? A A   103 ? 1_555 MN ? U  MN . ? A MN 176 ? 1_555 O     ? IA HOH .   ? A HOH 195 ? 1_555 86.8  ? 
242 O     ? IA HOH .   ? A HOH 198 ? 1_555 MN ? U  MN . ? A MN 176 ? 1_555 O     ? IA HOH .   ? A HOH 195 ? 1_555 87.1  ? 
243 O     ? HA HOH .   ? X HOH 542 ? 1_555 MN ? Q  MN . ? X MN 180 ? 1_555 "O2'" ? A  A   32  ? X A   46  ? 1_555 103.5 ? 
244 O     ? HA HOH .   ? X HOH 542 ? 1_555 MN ? Q  MN . ? X MN 180 ? 1_555 O     ? HA HOH .   ? X HOH 545 ? 1_555 101.3 ? 
245 "O2'" ? A  A   32  ? X A   46  ? 1_555 MN ? Q  MN . ? X MN 180 ? 1_555 O     ? HA HOH .   ? X HOH 545 ? 1_555 82.8  ? 
246 O     ? HA HOH .   ? X HOH 542 ? 1_555 MN ? Q  MN . ? X MN 180 ? 1_555 O     ? HA HOH .   ? X HOH 543 ? 1_555 90.6  ? 
247 "O2'" ? A  A   32  ? X A   46  ? 1_555 MN ? Q  MN . ? X MN 180 ? 1_555 O     ? HA HOH .   ? X HOH 543 ? 1_555 165.6 ? 
248 O     ? HA HOH .   ? X HOH 545 ? 1_555 MN ? Q  MN . ? X MN 180 ? 1_555 O     ? HA HOH .   ? X HOH 543 ? 1_555 91.6  ? 
249 O     ? HA HOH .   ? X HOH 542 ? 1_555 MN ? Q  MN . ? X MN 180 ? 1_555 N7    ? A  G   112 ? X G   126 ? 1_555 81.5  ? 
250 "O2'" ? A  A   32  ? X A   46  ? 1_555 MN ? Q  MN . ? X MN 180 ? 1_555 N7    ? A  G   112 ? X G   126 ? 1_555 85.3  ? 
251 O     ? HA HOH .   ? X HOH 545 ? 1_555 MN ? Q  MN . ? X MN 180 ? 1_555 N7    ? A  G   112 ? X G   126 ? 1_555 168.0 ? 
252 O     ? HA HOH .   ? X HOH 543 ? 1_555 MN ? Q  MN . ? X MN 180 ? 1_555 N7    ? A  G   112 ? X G   126 ? 1_555 100.1 ? 
253 O     ? HA HOH .   ? X HOH 542 ? 1_555 MN ? Q  MN . ? X MN 180 ? 1_555 O     ? HA HOH .   ? X HOH 544 ? 1_555 170.5 ? 
254 "O2'" ? A  A   32  ? X A   46  ? 1_555 MN ? Q  MN . ? X MN 180 ? 1_555 O     ? HA HOH .   ? X HOH 544 ? 1_555 77.8  ? 
255 O     ? HA HOH .   ? X HOH 545 ? 1_555 MN ? Q  MN . ? X MN 180 ? 1_555 O     ? HA HOH .   ? X HOH 544 ? 1_555 88.2  ? 
256 O     ? HA HOH .   ? X HOH 543 ? 1_555 MN ? Q  MN . ? X MN 180 ? 1_555 O     ? HA HOH .   ? X HOH 544 ? 1_555 88.8  ? 
257 N7    ? A  G   112 ? X G   126 ? 1_555 MN ? Q  MN . ? X MN 180 ? 1_555 O     ? HA HOH .   ? X HOH 544 ? 1_555 89.3  ? 
258 O     ? IA HOH .   ? A HOH 187 ? 1_555 MN ? DA MN . ? A MN 11  ? 1_555 O     ? IA HOH .   ? A HOH 306 ? 1_555 90.9  ? 
259 O     ? IA HOH .   ? A HOH 187 ? 1_555 MN ? DA MN . ? A MN 11  ? 1_555 OP2   ? B  A   46  ? A A   60  ? 1_555 167.9 ? 
260 O     ? IA HOH .   ? A HOH 306 ? 1_555 MN ? DA MN . ? A MN 11  ? 1_555 OP2   ? B  A   46  ? A A   60  ? 1_555 100.7 ? 
261 O     ? IA HOH .   ? A HOH 187 ? 1_555 MN ? DA MN . ? A MN 11  ? 1_555 O     ? IA HOH .   ? A HOH 231 ? 1_555 91.0  ? 
262 O     ? IA HOH .   ? A HOH 306 ? 1_555 MN ? DA MN . ? A MN 11  ? 1_555 O     ? IA HOH .   ? A HOH 231 ? 1_555 87.8  ? 
263 OP2   ? B  A   46  ? A A   60  ? 1_555 MN ? DA MN . ? A MN 11  ? 1_555 O     ? IA HOH .   ? A HOH 231 ? 1_555 93.0  ? 
264 O     ? IA HOH .   ? A HOH 187 ? 1_555 MN ? DA MN . ? A MN 11  ? 1_555 O     ? IA HOH .   ? A HOH 489 ? 1_555 91.4  ? 
265 O     ? IA HOH .   ? A HOH 306 ? 1_555 MN ? DA MN . ? A MN 11  ? 1_555 O     ? IA HOH .   ? A HOH 489 ? 1_555 175.7 ? 
266 OP2   ? B  A   46  ? A A   60  ? 1_555 MN ? DA MN . ? A MN 11  ? 1_555 O     ? IA HOH .   ? A HOH 489 ? 1_555 77.4  ? 
267 O     ? IA HOH .   ? A HOH 231 ? 1_555 MN ? DA MN . ? A MN 11  ? 1_555 O     ? IA HOH .   ? A HOH 489 ? 1_555 88.5  ? 
268 O     ? IA HOH .   ? A HOH 187 ? 1_555 MN ? DA MN . ? A MN 11  ? 1_555 O     ? IA HOH .   ? A HOH 488 ? 1_555 81.8  ? 
269 O     ? IA HOH .   ? A HOH 306 ? 1_555 MN ? DA MN . ? A MN 11  ? 1_555 O     ? IA HOH .   ? A HOH 488 ? 1_555 95.5  ? 
270 OP2   ? B  A   46  ? A A   60  ? 1_555 MN ? DA MN . ? A MN 11  ? 1_555 O     ? IA HOH .   ? A HOH 488 ? 1_555 93.5  ? 
271 O     ? IA HOH .   ? A HOH 231 ? 1_555 MN ? DA MN . ? A MN 11  ? 1_555 O     ? IA HOH .   ? A HOH 488 ? 1_555 172.1 ? 
272 O     ? IA HOH .   ? A HOH 489 ? 1_555 MN ? DA MN . ? A MN 11  ? 1_555 O     ? IA HOH .   ? A HOH 488 ? 1_555 88.4  ? 
273 OP2   ? B  U   105 ? A U   119 ? 1_555 MN ? AA MN . ? A MN 7   ? 1_555 OP1   ? B  A   103 ? A A   117 ? 1_555 165.7 ? 
274 OP2   ? B  U   105 ? A U   119 ? 1_555 MN ? AA MN . ? A MN 7   ? 1_555 OP1   ? B  A   104 ? A A   118 ? 1_555 90.4  ? 
275 OP1   ? B  A   103 ? A A   117 ? 1_555 MN ? AA MN . ? A MN 7   ? 1_555 OP1   ? B  A   104 ? A A   118 ? 1_555 95.3  ? 
276 OP2   ? B  U   105 ? A U   119 ? 1_555 MN ? AA MN . ? A MN 7   ? 1_555 O     ? IA HOH .   ? A HOH 550 ? 1_555 69.5  ? 
277 OP1   ? B  A   103 ? A A   117 ? 1_555 MN ? AA MN . ? A MN 7   ? 1_555 O     ? IA HOH .   ? A HOH 550 ? 1_555 96.2  ? 
278 OP1   ? B  A   104 ? A A   118 ? 1_555 MN ? AA MN . ? A MN 7   ? 1_555 O     ? IA HOH .   ? A HOH 550 ? 1_555 111.2 ? 
279 OP2   ? B  U   105 ? A U   119 ? 1_555 MN ? AA MN . ? A MN 7   ? 1_555 O     ? IA HOH .   ? A HOH 478 ? 1_555 110.4 ? 
280 OP1   ? B  A   103 ? A A   117 ? 1_555 MN ? AA MN . ? A MN 7   ? 1_555 O     ? IA HOH .   ? A HOH 478 ? 1_555 82.3  ? 
281 OP1   ? B  A   104 ? A A   118 ? 1_555 MN ? AA MN . ? A MN 7   ? 1_555 O     ? IA HOH .   ? A HOH 478 ? 1_555 94.3  ? 
282 O     ? IA HOH .   ? A HOH 550 ? 1_555 MN ? AA MN . ? A MN 7   ? 1_555 O     ? IA HOH .   ? A HOH 478 ? 1_555 154.5 ? 
283 N7    ? A  G   1   ? X G   15  ? 1_555 MN ? P  MN . ? X MN 179 ? 1_555 O     ? HA HOH .   ? X HOH 527 ? 1_555 110.3 ? 
284 O     ? HA HOH .   ? X HOH 526 ? 1_555 MN ? M  MN . ? X MN 12  ? 1_555 O     ? HA HOH .   ? X HOH 525 ? 1_555 113.9 ? 
285 O     ? HA HOH .   ? X HOH 526 ? 1_555 MN ? M  MN . ? X MN 12  ? 1_555 N7    ? A  G   31  ? X G   45  ? 1_555 80.1  ? 
286 O     ? HA HOH .   ? X HOH 525 ? 1_555 MN ? M  MN . ? X MN 12  ? 1_555 N7    ? A  G   31  ? X G   45  ? 1_555 164.1 ? 
287 O     ? HA HOH .   ? X HOH 526 ? 1_555 MN ? M  MN . ? X MN 12  ? 1_555 O     ? HA HOH .   ? X HOH 551 ? 1_555 176.2 ? 
288 O     ? HA HOH .   ? X HOH 525 ? 1_555 MN ? M  MN . ? X MN 12  ? 1_555 O     ? HA HOH .   ? X HOH 551 ? 1_555 64.5  ? 
289 N7    ? A  G   31  ? X G   45  ? 1_555 MN ? M  MN . ? X MN 12  ? 1_555 O     ? HA HOH .   ? X HOH 551 ? 1_555 101.1 ? 
290 O6    ? B  G   143 ? A G   157 ? 1_555 K  ? R  K  . ? A K  1   ? 1_555 OP2   ? B  A   141 ? A A   155 ? 1_555 120.7 ? 
291 O6    ? B  G   143 ? A G   157 ? 1_555 K  ? R  K  . ? A K  1   ? 1_555 O4    ? B  U   14  ? A U   28  ? 1_555 79.8  ? 
292 OP2   ? B  A   141 ? A A   155 ? 1_555 K  ? R  K  . ? A K  1   ? 1_555 O4    ? B  U   14  ? A U   28  ? 1_555 87.2  ? 
293 O6    ? B  G   143 ? A G   157 ? 1_555 K  ? R  K  . ? A K  1   ? 1_555 O     ? IA HOH .   ? A HOH 181 ? 1_555 82.7  ? 
294 OP2   ? B  A   141 ? A A   155 ? 1_555 K  ? R  K  . ? A K  1   ? 1_555 O     ? IA HOH .   ? A HOH 181 ? 1_555 77.0  ? 
295 O4    ? B  U   14  ? A U   28  ? 1_555 K  ? R  K  . ? A K  1   ? 1_555 O     ? IA HOH .   ? A HOH 181 ? 1_555 145.9 ? 
296 O6    ? B  G   143 ? A G   157 ? 1_555 K  ? R  K  . ? A K  1   ? 1_555 O     ? IA HOH .   ? A HOH 225 ? 1_555 124.9 ? 
297 OP2   ? B  A   141 ? A A   155 ? 1_555 K  ? R  K  . ? A K  1   ? 1_555 O     ? IA HOH .   ? A HOH 225 ? 1_555 113.3 ? 
298 O4    ? B  U   14  ? A U   28  ? 1_555 K  ? R  K  . ? A K  1   ? 1_555 O     ? IA HOH .   ? A HOH 225 ? 1_555 114.1 ? 
299 O     ? IA HOH .   ? A HOH 181 ? 1_555 K  ? R  K  . ? A K  1   ? 1_555 O     ? IA HOH .   ? A HOH 225 ? 1_555 99.9  ? 
300 O2    ? B  U   53  ? A U   67  ? 1_555 K  ? S  K  . ? A K  2   ? 1_555 O2    ? B  C   61  ? A C   75  ? 1_555 84.4  ? 
301 O2    ? B  U   53  ? A U   67  ? 1_555 K  ? S  K  . ? A K  2   ? 1_555 "O2'" ? B  A   92  ? A A   106 ? 1_555 97.9  ? 
302 O2    ? B  C   61  ? A C   75  ? 1_555 K  ? S  K  . ? A K  2   ? 1_555 "O2'" ? B  A   92  ? A A   106 ? 1_555 88.8  ? 
303 O2    ? B  U   53  ? A U   67  ? 1_555 K  ? S  K  . ? A K  2   ? 1_555 "O3'" ? B  A   92  ? A A   106 ? 1_555 143.9 ? 
304 O2    ? B  C   61  ? A C   75  ? 1_555 K  ? S  K  . ? A K  2   ? 1_555 "O3'" ? B  A   92  ? A A   106 ? 1_555 109.9 ? 
305 "O2'" ? B  A   92  ? A A   106 ? 1_555 K  ? S  K  . ? A K  2   ? 1_555 "O3'" ? B  A   92  ? A A   106 ? 1_555 51.5  ? 
306 O2    ? B  U   53  ? A U   67  ? 1_555 K  ? S  K  . ? A K  2   ? 1_555 O     ? IA HOH .   ? A HOH 270 ? 1_555 143.7 ? 
307 O2    ? B  C   61  ? A C   75  ? 1_555 K  ? S  K  . ? A K  2   ? 1_555 O     ? IA HOH .   ? A HOH 270 ? 1_555 69.7  ? 
308 "O2'" ? B  A   92  ? A A   106 ? 1_555 K  ? S  K  . ? A K  2   ? 1_555 O     ? IA HOH .   ? A HOH 270 ? 1_555 106.3 ? 
309 "O3'" ? B  A   92  ? A A   106 ? 1_555 K  ? S  K  . ? A K  2   ? 1_555 O     ? IA HOH .   ? A HOH 270 ? 1_555 71.2  ? 
310 O2    ? B  U   53  ? A U   67  ? 1_555 K  ? S  K  . ? A K  2   ? 1_555 O     ? IA HOH .   ? A HOH 349 ? 1_555 92.4  ? 
311 O2    ? B  C   61  ? A C   75  ? 1_555 K  ? S  K  . ? A K  2   ? 1_555 O     ? IA HOH .   ? A HOH 349 ? 1_555 165.2 ? 
312 "O2'" ? B  A   92  ? A A   106 ? 1_555 K  ? S  K  . ? A K  2   ? 1_555 O     ? IA HOH .   ? A HOH 349 ? 1_555 106.0 ? 
313 "O3'" ? B  A   92  ? A A   106 ? 1_555 K  ? S  K  . ? A K  2   ? 1_555 O     ? IA HOH .   ? A HOH 349 ? 1_555 81.0  ? 
314 O     ? IA HOH .   ? A HOH 270 ? 1_555 K  ? S  K  . ? A K  2   ? 1_555 O     ? IA HOH .   ? A HOH 349 ? 1_555 106.1 ? 
315 OP2   ? A  A   141 ? X A   155 ? 1_555 K  ? C  K  . ? X K  1   ? 1_555 O4    ? A  U   14  ? X U   28  ? 1_555 84.8  ? 
316 OP2   ? A  A   141 ? X A   155 ? 1_555 K  ? C  K  . ? X K  1   ? 1_555 O6    ? A  G   143 ? X G   157 ? 1_555 115.9 ? 
317 O4    ? A  U   14  ? X U   28  ? 1_555 K  ? C  K  . ? X K  1   ? 1_555 O6    ? A  G   143 ? X G   157 ? 1_555 75.8  ? 
318 OP2   ? A  A   141 ? X A   155 ? 1_555 K  ? C  K  . ? X K  1   ? 1_555 O     ? HA HOH .   ? X HOH 212 ? 1_555 77.0  ? 
319 O4    ? A  U   14  ? X U   28  ? 1_555 K  ? C  K  . ? X K  1   ? 1_555 O     ? HA HOH .   ? X HOH 212 ? 1_555 141.7 ? 
320 O6    ? A  G   143 ? X G   157 ? 1_555 K  ? C  K  . ? X K  1   ? 1_555 O     ? HA HOH .   ? X HOH 212 ? 1_555 82.2  ? 
321 OP2   ? A  A   141 ? X A   155 ? 1_555 K  ? C  K  . ? X K  1   ? 1_555 O     ? HA HOH .   ? X HOH 342 ? 1_555 117.4 ? 
322 O4    ? A  U   14  ? X U   28  ? 1_555 K  ? C  K  . ? X K  1   ? 1_555 O     ? HA HOH .   ? X HOH 342 ? 1_555 124.1 ? 
323 O6    ? A  G   143 ? X G   157 ? 1_555 K  ? C  K  . ? X K  1   ? 1_555 O     ? HA HOH .   ? X HOH 342 ? 1_555 124.2 ? 
324 O     ? HA HOH .   ? X HOH 212 ? 1_555 K  ? C  K  . ? X K  1   ? 1_555 O     ? HA HOH .   ? X HOH 342 ? 1_555 94.3  ? 
325 OP2   ? A  A   141 ? X A   155 ? 1_555 K  ? C  K  . ? X K  1   ? 1_555 O6    ? A  G   13  ? X G   27  ? 1_555 136.9 ? 
326 O4    ? A  U   14  ? X U   28  ? 1_555 K  ? C  K  . ? X K  1   ? 1_555 O6    ? A  G   13  ? X G   27  ? 1_555 61.0  ? 
327 O6    ? A  G   143 ? X G   157 ? 1_555 K  ? C  K  . ? X K  1   ? 1_555 O6    ? A  G   13  ? X G   27  ? 1_555 82.3  ? 
328 O     ? HA HOH .   ? X HOH 212 ? 1_555 K  ? C  K  . ? X K  1   ? 1_555 O6    ? A  G   13  ? X G   27  ? 1_555 146.0 ? 
329 O     ? HA HOH .   ? X HOH 342 ? 1_555 K  ? C  K  . ? X K  1   ? 1_555 O6    ? A  G   13  ? X G   27  ? 1_555 70.3  ? 
330 O2    ? A  U   53  ? X U   67  ? 1_555 K  ? D  K  . ? X K  2   ? 1_555 "O3'" ? A  A   92  ? X A   106 ? 1_555 140.5 ? 
331 O2    ? A  U   53  ? X U   67  ? 1_555 K  ? D  K  . ? X K  2   ? 1_555 O2    ? A  C   61  ? X C   75  ? 1_555 80.8  ? 
332 "O3'" ? A  A   92  ? X A   106 ? 1_555 K  ? D  K  . ? X K  2   ? 1_555 O2    ? A  C   61  ? X C   75  ? 1_555 101.9 ? 
333 O2    ? A  U   53  ? X U   67  ? 1_555 K  ? D  K  . ? X K  2   ? 1_555 O     ? HA HOH .   ? X HOH 186 ? 1_555 137.6 ? 
334 "O3'" ? A  A   92  ? X A   106 ? 1_555 K  ? D  K  . ? X K  2   ? 1_555 O     ? HA HOH .   ? X HOH 186 ? 1_555 71.3  ? 
335 O2    ? A  C   61  ? X C   75  ? 1_555 K  ? D  K  . ? X K  2   ? 1_555 O     ? HA HOH .   ? X HOH 186 ? 1_555 62.0  ? 
336 O2    ? A  U   53  ? X U   67  ? 1_555 K  ? D  K  . ? X K  2   ? 1_555 "O2'" ? A  A   92  ? X A   106 ? 1_555 92.2  ? 
337 "O3'" ? A  A   92  ? X A   106 ? 1_555 K  ? D  K  . ? X K  2   ? 1_555 "O2'" ? A  A   92  ? X A   106 ? 1_555 50.4  ? 
338 O2    ? A  C   61  ? X C   75  ? 1_555 K  ? D  K  . ? X K  2   ? 1_555 "O2'" ? A  A   92  ? X A   106 ? 1_555 81.0  ? 
339 O     ? HA HOH .   ? X HOH 186 ? 1_555 K  ? D  K  . ? X K  2   ? 1_555 "O2'" ? A  A   92  ? X A   106 ? 1_555 100.7 ? 
# 
loop_
_pdbx_audit_revision_history.ordinal 
_pdbx_audit_revision_history.data_content_type 
_pdbx_audit_revision_history.major_revision 
_pdbx_audit_revision_history.minor_revision 
_pdbx_audit_revision_history.revision_date 
1 'Structure model' 1 0 2011-02-23 
2 'Structure model' 1 1 2011-07-13 
3 'Structure model' 1 2 2017-11-08 
# 
_pdbx_audit_revision_details.ordinal             1 
_pdbx_audit_revision_details.revision_ordinal    1 
_pdbx_audit_revision_details.data_content_type   'Structure model' 
_pdbx_audit_revision_details.provider            repository 
_pdbx_audit_revision_details.type                'Initial release' 
_pdbx_audit_revision_details.description         ? 
# 
loop_
_pdbx_audit_revision_group.ordinal 
_pdbx_audit_revision_group.revision_ordinal 
_pdbx_audit_revision_group.data_content_type 
_pdbx_audit_revision_group.group 
1 2 'Structure model' 'Version format compliance' 
2 3 'Structure model' 'Refinement description'    
3 3 'Structure model' 'Structure summary'         
# 
loop_
_pdbx_audit_revision_category.ordinal 
_pdbx_audit_revision_category.revision_ordinal 
_pdbx_audit_revision_category.data_content_type 
_pdbx_audit_revision_category.category 
1 3 'Structure model' audit_author 
2 3 'Structure model' software     
# 
_pdbx_audit_revision_item.ordinal             1 
_pdbx_audit_revision_item.revision_ordinal    3 
_pdbx_audit_revision_item.data_content_type   'Structure model' 
_pdbx_audit_revision_item.item                '_audit_author.name' 
# 
_pdbx_phasing_MR.entry_id                     3PDR 
_pdbx_phasing_MR.method_rotation              ? 
_pdbx_phasing_MR.method_translation           ? 
_pdbx_phasing_MR.model_details                'Phaser MODE: MR_AUTO' 
_pdbx_phasing_MR.R_factor                     47.330 
_pdbx_phasing_MR.R_rigid_body                 ? 
_pdbx_phasing_MR.correlation_coeff_Fo_to_Fc   ? 
_pdbx_phasing_MR.correlation_coeff_Io_to_Ic   ? 
_pdbx_phasing_MR.d_res_high_rotation          2.500 
_pdbx_phasing_MR.d_res_low_rotation           47.490 
_pdbx_phasing_MR.d_res_high_translation       2.500 
_pdbx_phasing_MR.d_res_low_translation        47.490 
_pdbx_phasing_MR.packing                      ? 
_pdbx_phasing_MR.reflns_percent_rotation      ? 
_pdbx_phasing_MR.reflns_percent_translation   ? 
_pdbx_phasing_MR.sigma_F_rotation             ? 
_pdbx_phasing_MR.sigma_F_translation          ? 
_pdbx_phasing_MR.sigma_I_rotation             ? 
_pdbx_phasing_MR.sigma_I_translation          ? 
# 
_phasing.method   MR 
# 
loop_
_software.pdbx_ordinal 
_software.name 
_software.version 
_software.date 
_software.type 
_software.contact_author 
_software.contact_author_email 
_software.classification 
_software.location 
_software.language 
_software.citation_id 
1 DENZO       .       ?                          program 'Zbyszek Otwinowski' hkl@hkl-xray.com            'data reduction'  
http://www.hkl-xray.com/                    ?   ? 
2 SCALEPACK   .       ?                          package 'Zbyszek Otwinowski' hkl@hkl-xray.com            'data scaling'    
http://www.hkl-xray.com/                    ?   ? 
3 PHASER      2.1.4   'Wed Jun 24 14:00:05 2009' program 'Randy J. Read'      cimr-phaser@lists.cam.ac.uk phasing           
http://www-structmed.cimr.cam.ac.uk/phaser/ ?   ? 
4 PHENIX      1.6_289 ?                          package 'Paul D. Adams'      PDAdams@lbl.gov             refinement        
http://www.phenix-online.org/               C++ ? 
5 PDB_EXTRACT 3.10    'June 10, 2010'            package PDB                  deposit@deposit.rcsb.org    'data extraction' 
http://sw-tools.pdb.org/apps/PDB_EXTRACT/   C++ ? 
# 
loop_
_pdbx_validate_close_contact.id 
_pdbx_validate_close_contact.PDB_model_num 
_pdbx_validate_close_contact.auth_atom_id_1 
_pdbx_validate_close_contact.auth_asym_id_1 
_pdbx_validate_close_contact.auth_comp_id_1 
_pdbx_validate_close_contact.auth_seq_id_1 
_pdbx_validate_close_contact.PDB_ins_code_1 
_pdbx_validate_close_contact.label_alt_id_1 
_pdbx_validate_close_contact.auth_atom_id_2 
_pdbx_validate_close_contact.auth_asym_id_2 
_pdbx_validate_close_contact.auth_comp_id_2 
_pdbx_validate_close_contact.auth_seq_id_2 
_pdbx_validate_close_contact.PDB_ins_code_2 
_pdbx_validate_close_contact.label_alt_id_2 
_pdbx_validate_close_contact.dist 
1 1 O   A HOH 217 ? ? O A HOH 546 ? ? 1.68 
2 1 O   A HOH 217 ? ? O A HOH 517 ? ? 2.10 
3 1 OP1 X C   18  ? ? O X HOH 184 ? ? 2.13 
4 1 OP1 A C   35  ? ? O A HOH 480 ? ? 2.18 
5 1 OP2 A U   98  ? ? O A HOH 226 ? ? 2.19 
# 
loop_
_pdbx_validate_rmsd_bond.id 
_pdbx_validate_rmsd_bond.PDB_model_num 
_pdbx_validate_rmsd_bond.auth_atom_id_1 
_pdbx_validate_rmsd_bond.auth_asym_id_1 
_pdbx_validate_rmsd_bond.auth_comp_id_1 
_pdbx_validate_rmsd_bond.auth_seq_id_1 
_pdbx_validate_rmsd_bond.PDB_ins_code_1 
_pdbx_validate_rmsd_bond.label_alt_id_1 
_pdbx_validate_rmsd_bond.auth_atom_id_2 
_pdbx_validate_rmsd_bond.auth_asym_id_2 
_pdbx_validate_rmsd_bond.auth_comp_id_2 
_pdbx_validate_rmsd_bond.auth_seq_id_2 
_pdbx_validate_rmsd_bond.PDB_ins_code_2 
_pdbx_validate_rmsd_bond.label_alt_id_2 
_pdbx_validate_rmsd_bond.bond_value 
_pdbx_validate_rmsd_bond.bond_target_value 
_pdbx_validate_rmsd_bond.bond_deviation 
_pdbx_validate_rmsd_bond.bond_standard_deviation 
_pdbx_validate_rmsd_bond.linker_flag 
1 1 P  X G 15  ? ? OP3 X G 15  ? ? 1.479 1.607 -0.128 0.012 N 
2 1 N9 X A 139 ? ? C4  X A 139 ? ? 1.320 1.374 -0.054 0.006 N 
3 1 P  A G 15  ? ? OP3 A G 15  ? ? 1.482 1.607 -0.125 0.012 N 
# 
loop_
_pdbx_validate_rmsd_angle.id 
_pdbx_validate_rmsd_angle.PDB_model_num 
_pdbx_validate_rmsd_angle.auth_atom_id_1 
_pdbx_validate_rmsd_angle.auth_asym_id_1 
_pdbx_validate_rmsd_angle.auth_comp_id_1 
_pdbx_validate_rmsd_angle.auth_seq_id_1 
_pdbx_validate_rmsd_angle.PDB_ins_code_1 
_pdbx_validate_rmsd_angle.label_alt_id_1 
_pdbx_validate_rmsd_angle.auth_atom_id_2 
_pdbx_validate_rmsd_angle.auth_asym_id_2 
_pdbx_validate_rmsd_angle.auth_comp_id_2 
_pdbx_validate_rmsd_angle.auth_seq_id_2 
_pdbx_validate_rmsd_angle.PDB_ins_code_2 
_pdbx_validate_rmsd_angle.label_alt_id_2 
_pdbx_validate_rmsd_angle.auth_atom_id_3 
_pdbx_validate_rmsd_angle.auth_asym_id_3 
_pdbx_validate_rmsd_angle.auth_comp_id_3 
_pdbx_validate_rmsd_angle.auth_seq_id_3 
_pdbx_validate_rmsd_angle.PDB_ins_code_3 
_pdbx_validate_rmsd_angle.label_alt_id_3 
_pdbx_validate_rmsd_angle.angle_value 
_pdbx_validate_rmsd_angle.angle_target_value 
_pdbx_validate_rmsd_angle.angle_deviation 
_pdbx_validate_rmsd_angle.angle_standard_deviation 
_pdbx_validate_rmsd_angle.linker_flag 
1  1 "O4'" X U 34  ? ? "C1'" X U 34  ? ? N1    X U 34  ? ? 116.34 108.50 7.84  0.70 N 
2  1 "O4'" X U 47  ? ? "C1'" X U 47  ? ? N1    X U 47  ? ? 114.37 108.50 5.87  0.70 N 
3  1 "O4'" X U 119 ? ? "C1'" X U 119 ? ? N1    X U 119 ? ? 115.73 108.50 7.23  0.70 N 
4  1 "O4'" X A 139 ? ? "C1'" X A 139 ? ? N9    X A 139 ? ? 115.22 108.50 6.72  0.70 N 
5  1 C6    X A 139 ? ? N1    X A 139 ? ? C2    X A 139 ? ? 122.83 118.60 4.23  0.60 N 
6  1 C2    X A 139 ? ? N3    X A 139 ? ? C4    X A 139 ? ? 105.93 110.60 -4.67 0.50 N 
7  1 N3    X A 139 ? ? C4    X A 139 ? ? C5    X A 139 ? ? 132.56 126.80 5.76  0.70 N 
8  1 C5    X A 139 ? ? C6    X A 139 ? ? N1    X A 139 ? ? 114.50 117.70 -3.20 0.50 N 
9  1 C4    X A 139 ? ? C5    X A 139 ? ? N7    X A 139 ? ? 113.99 110.70 3.29  0.50 N 
10 1 C5    X A 139 ? ? N7    X A 139 ? ? C8    X A 139 ? ? 99.28  103.90 -4.62 0.50 N 
11 1 "O4'" X A 165 ? ? "C1'" X A 165 ? ? N9    X A 165 ? ? 113.73 108.50 5.23  0.70 N 
12 1 "O4'" X G 168 ? ? "C1'" X G 168 ? ? N9    X G 168 ? ? 117.34 108.50 8.84  0.70 N 
13 1 "O4'" A U 34  ? ? "C1'" A U 34  ? ? N1    A U 34  ? ? 113.56 108.50 5.06  0.70 N 
14 1 "C5'" A C 35  ? ? "C4'" A C 35  ? ? "O4'" A C 35  ? ? 101.77 109.10 -7.33 1.20 N 
15 1 N1    A C 35  ? ? "C1'" A C 35  ? ? "C2'" A C 35  ? ? 102.59 112.00 -9.41 1.10 N 
16 1 C6    A C 35  ? ? N1    A C 35  ? ? C2    A C 35  ? ? 117.88 120.30 -2.42 0.40 N 
17 1 "O4'" A A 46  ? ? "C1'" A A 46  ? ? N9    A A 46  ? ? 112.91 108.50 4.41  0.70 N 
18 1 "O4'" A U 47  ? ? "C1'" A U 47  ? ? N1    A U 47  ? ? 113.15 108.50 4.65  0.70 N 
19 1 "O4'" A C 78  ? ? "C1'" A C 78  ? ? N1    A C 78  ? ? 115.00 108.50 6.50  0.70 N 
20 1 N9    A G 100 ? ? "C1'" A G 100 ? ? "C2'" A G 100 ? ? 104.74 112.00 -7.26 1.10 N 
21 1 "O4'" A A 101 ? ? "C1'" A A 101 ? ? N9    A A 101 ? ? 113.47 108.50 4.97  0.70 N 
22 1 "O4'" A G 120 ? ? "C1'" A G 120 ? ? N9    A G 120 ? ? 113.35 108.50 4.85  0.70 N 
23 1 "O4'" A C 131 ? ? "C1'" A C 131 ? ? N1    A C 131 ? ? 113.55 108.50 5.05  0.70 N 
24 1 N1    A G 157 ? ? C6    A G 157 ? ? O6    A G 157 ? ? 116.16 119.90 -3.74 0.60 N 
25 1 "O4'" A A 165 ? ? "C1'" A A 165 ? ? N9    A A 165 ? ? 115.99 108.50 7.49  0.70 N 
26 1 "O4'" A G 168 ? ? "C1'" A G 168 ? ? N9    A G 168 ? ? 118.40 108.50 9.90  0.70 N 
# 
loop_
_ndb_struct_conf_na.entry_id 
_ndb_struct_conf_na.feature 
3PDR 'double helix'         
3PDR 'a-form double helix'  
3PDR 'hairpin loop'         
3PDR 'bulge loop'           
3PDR 'mismatched base pair' 
3PDR 'internal loop'        
3PDR 'quadruple helix'      
# 
loop_
_ndb_struct_na_base_pair.model_number 
_ndb_struct_na_base_pair.i_label_asym_id 
_ndb_struct_na_base_pair.i_label_comp_id 
_ndb_struct_na_base_pair.i_label_seq_id 
_ndb_struct_na_base_pair.i_symmetry 
_ndb_struct_na_base_pair.j_label_asym_id 
_ndb_struct_na_base_pair.j_label_comp_id 
_ndb_struct_na_base_pair.j_label_seq_id 
_ndb_struct_na_base_pair.j_symmetry 
_ndb_struct_na_base_pair.shear 
_ndb_struct_na_base_pair.stretch 
_ndb_struct_na_base_pair.stagger 
_ndb_struct_na_base_pair.buckle 
_ndb_struct_na_base_pair.propeller 
_ndb_struct_na_base_pair.opening 
_ndb_struct_na_base_pair.pair_number 
_ndb_struct_na_base_pair.pair_name 
_ndb_struct_na_base_pair.i_auth_asym_id 
_ndb_struct_na_base_pair.i_auth_seq_id 
_ndb_struct_na_base_pair.i_PDB_ins_code 
_ndb_struct_na_base_pair.j_auth_asym_id 
_ndb_struct_na_base_pair.j_auth_seq_id 
_ndb_struct_na_base_pair.j_PDB_ins_code 
_ndb_struct_na_base_pair.hbond_type_28 
_ndb_struct_na_base_pair.hbond_type_12 
1 A G 1   1_555 A C 160 1_555 -0.253 -0.259 0.503  -0.097  -18.690 -0.739  1   X_G15:C174_X  X 15  ? X 174 ? 19 1  
1 A G 2   1_555 A C 159 1_555 -0.352 -0.139 0.230  -5.660  -14.615 -1.586  2   X_G16:C173_X  X 16  ? X 173 ? 19 1  
1 A G 3   1_555 A C 158 1_555 -0.292 -0.108 0.055  -8.084  -16.943 0.294   3   X_G17:C172_X  X 17  ? X 172 ? 19 1  
1 A C 4   1_555 A G 157 1_555 0.171  -0.218 0.201  -5.848  -13.024 -1.516  4   X_C18:G171_X  X 18  ? X 171 ? 19 1  
1 A U 5   1_555 A A 156 1_555 0.160  -0.165 0.143  -8.240  -14.479 2.076   5   X_U19:A170_X  X 19  ? X 170 ? 20 1  
1 A U 6   1_555 A A 155 1_555 0.192  -0.184 0.060  -7.498  -13.077 2.923   6   X_U20:A169_X  X 20  ? X 169 ? 20 1  
1 A C 7   1_555 A G 154 1_555 0.154  -0.145 0.082  -8.193  2.518   4.954   7   X_C21:G168_X  X 21  ? X 168 ? 19 1  
1 A A 87  1_555 A U 153 1_555 0.463  -3.545 -0.894 11.849  -2.328  67.384  8   X_A101:U167_X X 101 ? X 167 ? 23 3  
1 A A 151 1_555 A G 150 1_555 -8.073 -4.753 0.081  50.539  24.606  -53.229 9   X_A165:G164_X X 165 ? X 164 ? ?  ?  
1 A G 8   1_555 A C 149 1_555 -0.182 -0.082 -0.165 -9.039  3.803   0.350   10  X_G22:C163_X  X 22  ? X 163 ? 19 1  
1 A U 9   1_555 A A 148 1_555 -0.102 -0.126 0.116  13.324  5.715   -0.587  11  X_U23:A162_X  X 23  ? X 162 ? 20 1  
1 A A 11  1_555 A C 146 1_555 -6.426 -4.160 -0.482 -4.573  -14.896 -23.246 12  X_A25:C160_X  X 25  ? X 160 ? ?  6  
1 A G 12  1_555 A U 145 1_555 -2.559 -0.667 -0.264 -3.489  -7.462  -1.015  13  X_G26:U159_X  X 26  ? X 159 ? 28 1  
1 A G 13  1_555 A C 144 1_555 -0.280 -0.091 -0.299 -3.678  -7.679  2.542   14  X_G27:C158_X  X 27  ? X 158 ? 19 1  
1 A U 14  1_555 A G 143 1_555 2.393  -0.657 -0.237 3.648   -3.061  0.114   15  X_U28:G157_X  X 28  ? X 157 ? 28 1  
1 A G 15  1_555 A A 142 1_555 6.601  -4.596 0.623  19.902  4.929   -0.144  16  X_G29:A156_X  X 29  ? X 156 ? 11 9  
1 A A 16  1_555 A A 140 1_555 -6.487 -4.168 -0.535 -7.413  -0.182  -17.948 17  X_A30:A154_X  X 30  ? X 154 ? ?  10 
1 A G 17  1_555 A U 139 1_555 -2.416 -0.585 -0.227 1.649   -2.955  -2.800  18  X_G31:U153_X  X 31  ? X 153 ? 28 1  
1 A G 18  1_555 A C 138 1_555 -0.312 -0.070 -0.320 -3.461  -7.409  2.184   19  X_G32:C152_X  X 32  ? X 152 ? 19 1  
1 A C 19  1_555 A G 137 1_555 0.395  -0.233 -0.296 1.652   -8.086  2.346   20  X_C33:G151_X  X 33  ? X 151 ? 19 1  
1 A U 20  1_555 A U 136 1_555 2.472  -1.746 0.145  18.108  2.621   2.056   21  X_U34:U150_X  X 34  ? X 150 ? 16 1  
1 A C 22  1_555 A G 135 1_555 0.417  -0.090 -0.476 11.192  -21.048 3.063   22  X_C36:G149_X  X 36  ? X 149 ? 19 1  
1 A U 23  1_555 A A 134 1_555 0.022  -0.057 0.136  -9.702  -2.798  2.371   23  X_U37:A148_X  X 37  ? X 148 ? 20 1  
1 A G 24  1_555 A C 133 1_555 -0.065 -0.103 0.046  -3.927  -8.369  3.132   24  X_G38:C147_X  X 38  ? X 147 ? 19 1  
1 A U 25  1_555 A A 132 1_555 0.289  -0.168 -0.052 -2.250  -9.027  6.610   25  X_U39:A146_X  X 39  ? X 146 ? 20 1  
1 A A 26  1_555 A U 131 1_555 -0.119 -0.038 0.018  -4.327  -9.515  7.298   26  X_A40:U145_X  X 40  ? X 145 ? 20 1  
1 A U 27  1_555 A A 130 1_555 -0.264 -0.132 -0.187 -0.560  -13.397 2.255   27  X_U41:A144_X  X 41  ? X 144 ? 20 1  
1 A G 28  1_555 A C 129 1_555 -0.066 -0.070 0.187  -6.355  -13.433 0.690   28  X_G42:C143_X  X 42  ? X 143 ? 19 1  
1 A G 29  1_555 A C 128 1_555 -0.274 -0.120 -0.023 -16.264 -22.821 0.816   29  X_G43:C142_X  X 43  ? X 142 ? 19 1  
1 A A 30  1_555 A G 127 1_555 0.223  1.397  -0.237 -13.402 -13.454 -14.612 30  X_A44:G141_X  X 44  ? X 141 ? 8  1  
1 A G 31  1_555 A U 126 1_555 7.865  -3.243 0.613  -3.521  -12.262 -18.100 31  X_G45:U140_X  X 45  ? X 140 ? ?  ?  
1 A C 35  1_555 A U 111 1_555 -6.889 -4.511 0.042  -1.196  -5.545  -19.895 32  X_C49:U125_X  X 49  ? X 125 ? ?  ?  
1 A G 36  1_555 A C 110 1_555 -0.212 -0.043 0.203  4.382   -4.283  0.849   33  X_G50:C124_X  X 50  ? X 124 ? 19 1  
1 A C 37  1_555 A G 109 1_555 0.373  -0.070 -0.175 7.330   -11.958 1.106   34  X_C51:G123_X  X 51  ? X 123 ? 19 1  
1 A U 38  1_555 A A 108 1_555 0.176  -0.150 -0.146 3.983   -16.486 7.735   35  X_U52:A122_X  X 52  ? X 122 ? 20 1  
1 A G 39  1_555 A C 107 1_555 -0.167 -0.201 0.041  -1.570  -10.070 1.007   36  X_G53:C121_X  X 53  ? X 121 ? 19 1  
1 A C 40  1_555 A G 106 1_555 0.340  -0.233 0.034  0.441   -16.436 -0.839  37  X_C54:G120_X  X 54  ? X 120 ? 19 1  
1 A U 41  1_555 A A 104 1_555 -1.135 -0.363 -0.259 1.617   -12.277 28.414  38  X_U55:A118_X  X 55  ? X 118 ? ?  1  
1 A G 42  1_555 A U 71  1_555 -2.117 -0.564 0.439  12.765  -16.971 -0.877  39  X_G56:U85_X   X 56  ? X 85  ? 28 1  
1 A C 43  1_555 A G 70  1_555 0.199  -0.140 -0.128 15.876  -22.519 2.128   40  X_C57:G84_X   X 57  ? X 84  ? 19 1  
1 A C 44  1_555 A G 69  1_555 0.158  -0.191 0.012  -0.406  -11.390 0.558   41  X_C58:G83_X   X 58  ? X 83  ? 19 1  
1 A C 45  1_555 A G 68  1_555 0.246  -0.076 0.187  -2.003  -5.795  2.205   42  X_C59:G82_X   X 59  ? X 82  ? 19 1  
1 A A 46  1_555 A U 67  1_555 0.235  -0.005 -0.081 14.790  -2.734  -0.626  43  X_A60:U81_X   X 60  ? X 81  ? 20 1  
1 A U 10  1_555 A A 92  1_555 -0.204 -0.169 0.515  -21.512 -21.894 -5.224  44  X_U24:A106_X  X 24  ? X 106 ? 20 1  
1 A A 58  1_555 A A 91  1_555 -1.619 -1.553 -0.105 -11.454 -24.595 169.497 45  X_A72:A105_X  X 72  ? X 105 ? 1  2  
1 A G 59  1_555 A C 54  1_555 -0.285 -0.083 -0.003 -2.046  5.111   1.902   46  X_G73:C68_X   X 73  ? X 68  ? 19 1  
1 A A 60  1_555 A U 53  1_555 -0.382 -0.029 0.045  1.478   -14.011 6.588   47  X_A74:U67_X   X 74  ? X 67  ? 20 1  
1 A C 61  1_555 A G 52  1_555 0.100  -0.109 -0.071 4.371   -14.082 2.195   48  X_C75:G66_X   X 75  ? X 66  ? 19 1  
1 A G 62  1_555 A U 51  1_555 -1.306 -0.191 0.134  -16.956 -35.962 4.088   49  X_G76:U65_X   X 76  ? X 65  ? 28 1  
1 A C 63  1_555 A A 50  1_555 4.567  -0.967 1.508  -19.084 -10.544 1.549   50  X_C77:A64_X   X 77  ? X 64  ? ?  ?  
1 A C 64  1_555 A A 48  1_555 6.344  -3.920 0.130  -2.351  -20.077 -44.958 51  X_C78:A62_X   X 78  ? X 62  ? ?  ?  
1 A A 73  1_555 A U 102 1_555 -4.137 -2.183 -0.562 -5.315  -10.341 -95.000 52  X_A87:U116_X  X 87  ? X 116 ? 24 4  
1 A G 77  1_555 A U 101 1_555 -2.313 -0.696 -0.155 -1.704  -4.327  -0.117  53  X_G91:U115_X  X 91  ? X 115 ? 28 1  
1 A A 78  1_555 A U 100 1_555 -0.210 -0.147 -0.086 -5.142  -2.642  6.380   54  X_A92:U114_X  X 92  ? X 114 ? 20 1  
1 A A 79  1_555 A U 99  1_555 -0.104 -0.097 -0.052 1.984   -9.317  2.563   55  X_A93:U113_X  X 93  ? X 113 ? 20 1  
1 A A 80  1_555 A U 98  1_555 -0.019 -0.169 0.138  7.285   -11.529 2.797   56  X_A94:U112_X  X 94  ? X 112 ? 20 1  
1 A U 81  1_555 A A 97  1_555 -0.024 -0.133 -0.037 6.979   -13.236 0.913   57  X_U95:A111_X  X 95  ? X 111 ? 20 1  
1 A C 82  1_555 A G 96  1_555 0.142  -0.211 0.009  7.520   -13.131 0.000   58  X_C96:G110_X  X 96  ? X 110 ? 19 1  
1 A A 83  1_555 A U 95  1_555 0.026  -0.170 -0.036 1.946   -14.688 3.166   59  X_A97:U109_X  X 97  ? X 109 ? 20 1  
1 A U 84  1_555 A G 94  1_555 2.279  -0.554 -0.147 -0.790  -14.516 3.860   60  X_U98:G108_X  X 98  ? X 108 ? 28 1  
1 A C 85  1_555 A G 93  1_555 0.293  -0.120 -0.130 -2.348  -0.690  1.345   61  X_C99:G107_X  X 99  ? X 107 ? 19 1  
1 A G 112 1_555 A C 123 1_555 -0.494 -0.198 -0.197 -10.364 -13.480 3.054   62  X_G126:C137_X X 126 ? X 137 ? 19 1  
1 A G 113 1_555 A C 122 1_555 -0.050 -0.147 -0.263 -5.135  -7.542  -2.705  63  X_G127:C136_X X 127 ? X 136 ? 19 1  
1 B G 1   1_555 B C 160 1_555 -0.283 -0.244 0.282  -3.806  -15.741 -0.360  64  A_G15:C174_A  A 15  ? A 174 ? 19 1  
1 B G 2   1_555 B C 159 1_555 -0.468 -0.136 -0.128 -12.029 -18.508 -2.353  65  A_G16:C173_A  A 16  ? A 173 ? 19 1  
1 B G 3   1_555 B C 158 1_555 -0.368 -0.158 -0.077 -5.298  -15.630 0.306   66  A_G17:C172_A  A 17  ? A 172 ? 19 1  
1 B C 4   1_555 B G 157 1_555 0.411  -0.128 -0.104 2.777   -10.430 4.460   67  A_C18:G171_A  A 18  ? A 171 ? 19 1  
1 B U 5   1_555 B A 156 1_555 0.106  -0.136 0.158  0.239   -13.248 4.787   68  A_U19:A170_A  A 19  ? A 170 ? 20 1  
1 B U 6   1_555 B A 155 1_555 0.117  0.059  0.039  2.669   -7.548  1.131   69  A_U20:A169_A  A 20  ? A 169 ? 20 1  
1 B C 7   1_555 B G 154 1_555 0.089  -0.146 -0.348 -0.366  3.889   3.491   70  A_C21:G168_A  A 21  ? A 168 ? 19 1  
1 B A 87  1_555 B U 153 1_555 0.517  -3.656 -0.918 14.485  0.093   67.148  71  A_A101:U167_A A 101 ? A 167 ? 23 3  
1 B A 151 1_555 B G 150 1_555 -8.103 -4.567 0.018  52.071  23.371  -54.224 72  A_A165:G164_A A 165 ? A 164 ? ?  ?  
1 B G 8   1_555 B C 149 1_555 -0.224 -0.184 -0.111 -10.657 -0.521  -1.837  73  A_G22:C163_A  A 22  ? A 163 ? 19 1  
1 B U 9   1_555 B A 148 1_555 -0.027 -0.076 -0.057 10.493  3.673   -4.223  74  A_U23:A162_A  A 23  ? A 162 ? 20 1  
1 B A 11  1_555 B C 146 1_555 -6.061 -3.673 -0.806 -7.577  -16.743 -34.847 75  A_A25:C160_A  A 25  ? A 160 ? ?  ?  
1 B G 12  1_555 B U 145 1_555 -2.454 -0.606 -0.236 -2.508  -6.908  -1.614  76  A_G26:U159_A  A 26  ? A 159 ? 28 1  
1 B G 13  1_555 B C 144 1_555 -0.252 -0.161 -0.258 -1.465  -4.879  0.000   77  A_G27:C158_A  A 27  ? A 158 ? 19 1  
1 B U 14  1_555 B G 143 1_555 2.415  -0.614 -0.346 6.497   -2.389  -0.699  78  A_U28:G157_A  A 28  ? A 157 ? 28 1  
1 B G 15  1_555 B A 142 1_555 6.606  -4.629 0.516  19.642  3.065   -0.878  79  A_G29:A156_A  A 29  ? A 156 ? 11 9  
1 B A 16  1_555 B A 140 1_555 -6.366 -4.318 -0.385 -6.133  1.235   -21.977 80  A_A30:A154_A  A 30  ? A 154 ? ?  10 
1 B G 17  1_555 B U 139 1_555 -2.357 -0.557 -0.089 2.569   -2.099  -3.606  81  A_G31:U153_A  A 31  ? A 153 ? 28 1  
1 B G 18  1_555 B C 138 1_555 -0.214 -0.137 -0.111 3.694   -5.075  1.494   82  A_G32:C152_A  A 32  ? A 152 ? 19 1  
1 B C 19  1_555 B G 137 1_555 0.421  -0.295 -0.363 6.484   -8.451  1.292   83  A_C33:G151_A  A 33  ? A 151 ? 19 1  
1 B U 20  1_555 B U 136 1_555 2.368  -1.665 -0.121 18.383  -2.157  3.014   84  A_U34:U150_A  A 34  ? A 150 ? 16 1  
1 B C 22  1_555 B G 135 1_555 0.257  -0.154 -0.394 7.284   -17.701 1.956   85  A_C36:G149_A  A 36  ? A 149 ? 19 1  
1 B U 23  1_555 B A 134 1_555 0.108  -0.035 0.253  -4.792  -9.468  14.660  86  A_U37:A148_A  A 37  ? A 148 ? 20 1  
1 B G 24  1_555 B C 133 1_555 -0.189 -0.108 -0.063 -4.083  -14.699 2.730   87  A_G38:C147_A  A 38  ? A 147 ? 19 1  
1 B U 25  1_555 B A 132 1_555 -0.112 -0.026 0.251  -4.118  -5.614  7.866   88  A_U39:A146_A  A 39  ? A 146 ? 20 1  
1 B A 26  1_555 B U 131 1_555 0.265  -0.090 -0.105 -2.906  -15.147 2.669   89  A_A40:U145_A  A 40  ? A 145 ? 20 1  
1 B U 27  1_555 B A 130 1_555 -0.114 -0.119 -0.041 -1.769  -12.556 1.943   90  A_U41:A144_A  A 41  ? A 144 ? 20 1  
1 B G 28  1_555 B C 129 1_555 -0.317 -0.135 -0.066 -3.982  -12.801 2.401   91  A_G42:C143_A  A 42  ? A 143 ? 19 1  
1 B G 29  1_555 B C 128 1_555 -0.199 -0.027 0.000  -12.735 -16.983 -0.338  92  A_G43:C142_A  A 43  ? A 142 ? 19 1  
1 B A 30  1_555 B G 127 1_555 -0.062 1.518  -0.017 -18.147 -14.300 -15.818 93  A_A44:G141_A  A 44  ? A 141 ? 8  1  
1 B A 34  1_555 B U 126 1_555 -0.235 -3.282 -0.494 -22.537 -30.274 174.434 94  A_A48:U140_A  A 48  ? A 140 ? ?  ?  
1 B G 36  1_555 B C 110 1_555 -0.322 -0.278 0.131  1.847   -12.573 0.976   95  A_G50:C124_A  A 50  ? A 124 ? 19 1  
1 B C 37  1_555 B G 109 1_555 0.067  -0.137 0.262  -2.487  -7.220  0.421   96  A_C51:G123_A  A 51  ? A 123 ? 19 1  
1 B U 38  1_555 B A 108 1_555 0.145  -0.144 0.049  1.528   -1.044  1.241   97  A_U52:A122_A  A 52  ? A 122 ? 20 1  
1 B G 39  1_555 B C 107 1_555 -0.290 -0.544 -0.651 -9.515  -6.053  -8.586  98  A_G53:C121_A  A 53  ? A 121 ? 19 1  
1 B C 40  1_555 B G 106 1_555 0.038  -0.276 -0.384 -3.425  -1.378  -1.096  99  A_C54:G120_A  A 54  ? A 120 ? 19 1  
1 B U 41  1_555 B A 104 1_555 -1.246 -0.266 -0.072 5.575   -13.615 30.007  100 A_U55:A118_A  A 55  ? A 118 ? ?  1  
1 B G 42  1_555 B U 71  1_555 -2.197 -0.558 0.459  9.336   -13.906 -0.620  101 A_G56:U85_A   A 56  ? A 85  ? 28 1  
1 B C 43  1_555 B G 70  1_555 0.095  -0.034 -0.039 14.549  -19.728 0.779   102 A_C57:G84_A   A 57  ? A 84  ? 19 1  
1 B C 44  1_555 B G 69  1_555 0.318  -0.168 -0.112 5.799   -8.858  -2.629  103 A_C58:G83_A   A 58  ? A 83  ? 19 1  
1 B C 45  1_555 B G 68  1_555 0.200  -0.154 0.169  -1.548  -5.875  1.368   104 A_C59:G82_A   A 59  ? A 82  ? 19 1  
1 B A 46  1_555 B U 67  1_555 0.198  0.007  -0.191 0.582   -4.839  6.789   105 A_A60:U81_A   A 60  ? A 81  ? 20 1  
1 B A 47  1_555 B A 66  1_555 6.181  -4.322 0.195  -9.937  -24.794 -15.636 106 A_A61:A80_A   A 61  ? A 80  ? ?  10 
1 B U 10  1_555 B A 92  1_555 -0.179 -0.155 0.578  -21.308 -20.900 -4.996  107 A_U24:A106_A  A 24  ? A 106 ? 20 1  
1 B A 58  1_555 B A 91  1_555 -1.656 -1.341 -0.055 -13.157 -26.743 170.223 108 A_A72:A105_A  A 72  ? A 105 ? 1  2  
1 B G 59  1_555 B C 54  1_555 -0.347 -0.255 -0.107 -2.438  5.228   0.811   109 A_G73:C68_A   A 73  ? A 68  ? 19 1  
1 B A 60  1_555 B U 53  1_555 0.031  -0.066 0.067  1.689   -9.929  8.036   110 A_A74:U67_A   A 74  ? A 67  ? 20 1  
1 B C 61  1_555 B G 52  1_555 0.458  -0.135 -0.254 9.885   -8.613  1.914   111 A_C75:G66_A   A 75  ? A 66  ? 19 1  
1 B G 62  1_555 B U 51  1_555 0.551  0.637  -0.893 -25.857 -23.607 20.922  112 A_G76:U65_A   A 76  ? A 65  ? ?  ?  
1 B C 63  1_555 B A 50  1_555 6.768  -2.435 -0.736 -19.460 -1.504  3.139   113 A_C77:A64_A   A 77  ? A 64  ? ?  ?  
1 B A 73  1_555 B U 102 1_555 -4.120 -2.183 -0.292 -9.782  -10.078 -93.402 114 A_A87:U116_A  A 87  ? A 116 ? 24 4  
1 B G 77  1_555 B U 101 1_555 -2.678 -0.707 -0.235 -3.348  -1.319  -1.767  115 A_G91:U115_A  A 91  ? A 115 ? 28 1  
1 B A 78  1_555 B U 100 1_555 -0.052 -0.089 -0.255 -5.109  -4.445  4.481   116 A_A92:U114_A  A 92  ? A 114 ? 20 1  
1 B A 79  1_555 B U 99  1_555 0.147  -0.075 -0.213 3.445   -9.384  2.354   117 A_A93:U113_A  A 93  ? A 113 ? 20 1  
1 B A 80  1_555 B U 98  1_555 -0.033 -0.105 -0.067 0.176   -10.899 4.959   118 A_A94:U112_A  A 94  ? A 112 ? 20 1  
1 B U 81  1_555 B A 97  1_555 0.014  -0.121 -0.098 5.918   -13.228 0.998   119 A_U95:A111_A  A 95  ? A 111 ? 20 1  
1 B C 82  1_555 B G 96  1_555 0.031  -0.138 -0.096 9.058   -14.973 -0.335  120 A_C96:G110_A  A 96  ? A 110 ? 19 1  
1 B A 83  1_555 B U 95  1_555 0.107  -0.188 0.018  1.299   -14.133 3.429   121 A_A97:U109_A  A 97  ? A 109 ? 20 1  
1 B U 84  1_555 B G 94  1_555 2.457  -0.550 -0.101 1.753   -13.644 1.611   122 A_U98:G108_A  A 98  ? A 108 ? 28 1  
1 B C 85  1_555 B G 93  1_555 0.245  -0.175 -0.254 -0.991  -4.481  0.513   123 A_C99:G107_A  A 99  ? A 107 ? 19 1  
1 B U 111 1_555 B A 125 1_555 6.691  -1.176 -0.627 29.615  -27.027 40.550  124 A_U125:A139_A A 125 ? A 139 ? ?  5  
1 B A 32  1_555 B U 124 1_555 -4.196 -2.133 0.031  21.477  6.438   -96.910 125 A_A46:U138_A  A 46  ? A 138 ? 24 4  
1 B G 112 1_555 B C 123 1_555 -0.298 -0.104 -0.044 -4.419  -19.854 4.710   126 A_G126:C137_A A 126 ? A 137 ? 19 1  
1 B G 113 1_555 B C 122 1_555 -0.084 -0.128 0.084  -6.385  -7.128  -2.602  127 A_G127:C136_A A 127 ? A 136 ? 19 1  
# 
loop_
_ndb_struct_na_base_pair_step.model_number 
_ndb_struct_na_base_pair_step.i_label_asym_id_1 
_ndb_struct_na_base_pair_step.i_label_comp_id_1 
_ndb_struct_na_base_pair_step.i_label_seq_id_1 
_ndb_struct_na_base_pair_step.i_symmetry_1 
_ndb_struct_na_base_pair_step.j_label_asym_id_1 
_ndb_struct_na_base_pair_step.j_label_comp_id_1 
_ndb_struct_na_base_pair_step.j_label_seq_id_1 
_ndb_struct_na_base_pair_step.j_symmetry_1 
_ndb_struct_na_base_pair_step.i_label_asym_id_2 
_ndb_struct_na_base_pair_step.i_label_comp_id_2 
_ndb_struct_na_base_pair_step.i_label_seq_id_2 
_ndb_struct_na_base_pair_step.i_symmetry_2 
_ndb_struct_na_base_pair_step.j_label_asym_id_2 
_ndb_struct_na_base_pair_step.j_label_comp_id_2 
_ndb_struct_na_base_pair_step.j_label_seq_id_2 
_ndb_struct_na_base_pair_step.j_symmetry_2 
_ndb_struct_na_base_pair_step.shift 
_ndb_struct_na_base_pair_step.slide 
_ndb_struct_na_base_pair_step.rise 
_ndb_struct_na_base_pair_step.tilt 
_ndb_struct_na_base_pair_step.roll 
_ndb_struct_na_base_pair_step.twist 
_ndb_struct_na_base_pair_step.x_displacement 
_ndb_struct_na_base_pair_step.y_displacement 
_ndb_struct_na_base_pair_step.helical_rise 
_ndb_struct_na_base_pair_step.inclination 
_ndb_struct_na_base_pair_step.tip 
_ndb_struct_na_base_pair_step.helical_twist 
_ndb_struct_na_base_pair_step.step_number 
_ndb_struct_na_base_pair_step.step_name 
_ndb_struct_na_base_pair_step.i_auth_asym_id_1 
_ndb_struct_na_base_pair_step.i_auth_seq_id_1 
_ndb_struct_na_base_pair_step.i_PDB_ins_code_1 
_ndb_struct_na_base_pair_step.j_auth_asym_id_1 
_ndb_struct_na_base_pair_step.j_auth_seq_id_1 
_ndb_struct_na_base_pair_step.j_PDB_ins_code_1 
_ndb_struct_na_base_pair_step.i_auth_asym_id_2 
_ndb_struct_na_base_pair_step.i_auth_seq_id_2 
_ndb_struct_na_base_pair_step.i_PDB_ins_code_2 
_ndb_struct_na_base_pair_step.j_auth_asym_id_2 
_ndb_struct_na_base_pair_step.j_auth_seq_id_2 
_ndb_struct_na_base_pair_step.j_PDB_ins_code_2 
1 A G 1   1_555 A C 160 1_555 A G 2   1_555 A C 159 1_555 -0.229 -1.318 3.227  0.792   5.965   35.944   -2.899 0.472  2.972  9.582 
-1.273  36.428   1   XX_G15G16:C173C174_XX   X 15  ? X 174 ? X 16  ? X 173 ? 
1 A G 2   1_555 A C 159 1_555 A G 3   1_555 A C 158 1_555 0.874  -2.093 3.191  4.280   8.438   29.406   -5.424 -0.887 2.603  
16.106 -8.170  30.858   2   XX_G16G17:C172C173_XX   X 16  ? X 173 ? X 17  ? X 172 ? 
1 A G 3   1_555 A C 158 1_555 A C 4   1_555 A G 157 1_555 -0.881 -1.380 3.140  -3.423  8.572   34.731   -3.373 0.976  2.802  
14.055 5.613   35.900   3   XX_G17C18:G171C172_XX   X 17  ? X 172 ? X 18  ? X 171 ? 
1 A C 4   1_555 A G 157 1_555 A U 5   1_555 A A 156 1_555 0.151  -0.959 3.241  1.387   9.077   34.056   -2.874 -0.052 2.902  
15.160 -2.317  35.237   4   XX_C18U19:A170G171_XX   X 18  ? X 171 ? X 19  ? X 170 ? 
1 A U 5   1_555 A A 156 1_555 A U 6   1_555 A A 155 1_555 1.403  -1.448 3.200  5.559   10.557  32.452   -3.991 -1.548 2.803  
18.143 -9.553  34.521   5   XX_U19U20:A169A170_XX   X 19  ? X 170 ? X 20  ? X 169 ? 
1 A U 6   1_555 A A 155 1_555 A C 7   1_555 A G 154 1_555 1.107  -1.102 3.297  2.447   1.985   34.337   -2.170 -1.484 3.299  3.353 
-4.134  34.477   6   XX_U20C21:G168A169_XX   X 20  ? X 169 ? X 21  ? X 168 ? 
1 A C 7   1_555 A G 154 1_555 A A 87  1_555 A U 153 1_555 0.817  2.699  -0.501 165.942 -37.033 -33.817  -1.423 0.103  -0.346 
19.286 86.420  -170.456 7   XX_C21A101:U167G168_XX  X 21  ? X 168 ? X 101 ? X 167 ? 
1 A A 87  1_555 A U 153 1_555 A A 151 1_555 A G 150 1_555 1.229  -0.484 -3.703 -20.405 10.500  -98.510  0.496  1.151  -3.427 
-6.862 -13.336 -100.469 8   XX_A101A165:G164U167_XX X 101 ? X 167 ? X 165 ? X 164 ? 
1 A A 151 1_555 A G 150 1_555 A G 8   1_555 A C 149 1_555 4.402  -4.210 -1.582 147.119 -1.913  73.348   -2.158 -2.017 2.550  
-1.040 -80.002 153.769  9   XX_A165G22:C163G164_XX  X 165 ? X 164 ? X 22  ? X 163 ? 
1 A G 8   1_555 A C 149 1_555 A U 9   1_555 A A 148 1_555 -0.697 -1.390 2.916  -1.750  5.276   22.190   -5.104 1.228  2.567  
13.439 4.457   22.867   10  XX_G22U23:A162C163_XX   X 22  ? X 163 ? X 23  ? X 162 ? 
1 A U 9   1_555 A A 148 1_555 A A 11  1_555 A C 146 1_555 -0.692 -2.222 6.455  -29.970 7.527   50.058   -3.085 -2.492 5.671  8.077 
32.157  58.299   11  XX_U23A25:C160A162_XX   X 23  ? X 162 ? X 25  ? X 160 ? 
1 A A 11  1_555 A C 146 1_555 A G 12  1_555 A U 145 1_555 1.552  -1.646 3.424  -4.066  6.108   50.076   -2.360 -2.104 3.090  7.171 
4.774   50.576   12  XX_A25G26:U159C160_XX   X 25  ? X 160 ? X 26  ? X 159 ? 
1 A G 12  1_555 A U 145 1_555 A G 13  1_555 A C 144 1_555 0.072  -1.805 3.270  -1.702  8.244   38.548   -3.596 -0.296 2.834  
12.308 2.541   39.422   13  XX_G26G27:C158U159_XX   X 26  ? X 159 ? X 27  ? X 158 ? 
1 A G 13  1_555 A C 144 1_555 A U 14  1_555 A G 143 1_555 -0.077 -1.477 3.162  -1.086  3.118   39.841   -2.502 -0.005 3.044  4.567 
1.590   39.972   14  XX_G27U28:G157C158_XX   X 27  ? X 158 ? X 28  ? X 157 ? 
1 A U 14  1_555 A G 143 1_555 A G 15  1_555 A A 142 1_555 -0.113 -0.616 3.029  6.368   12.239  54.281   -1.297 0.453  2.813  
13.177 -6.856  55.878   15  XX_U28G29:A156G157_XX   X 28  ? X 157 ? X 29  ? X 156 ? 
1 A G 15  1_555 A A 142 1_555 A A 16  1_555 A A 140 1_555 -0.374 -1.078 4.003  -4.157  0.268   11.428   -5.507 -4.758 3.867  1.291 
20.023  12.161   16  XX_G29A30:A154A156_XX   X 29  ? X 156 ? X 30  ? X 154 ? 
1 A A 16  1_555 A A 140 1_555 A G 17  1_555 A U 139 1_555 1.748  -1.232 3.252  -1.853  1.370   45.993   -1.691 -2.391 3.147  1.752 
2.370   46.047   17  XX_A30G31:U153A154_XX   X 30  ? X 154 ? X 31  ? X 153 ? 
1 A G 17  1_555 A U 139 1_555 A G 18  1_555 A C 138 1_555 0.966  -1.695 3.454  0.226   9.718   40.518   -3.414 -1.336 2.992  
13.794 -0.320  41.620   18  XX_G31G32:C152U153_XX   X 31  ? X 153 ? X 32  ? X 152 ? 
1 A G 18  1_555 A C 138 1_555 A C 19  1_555 A G 137 1_555 -0.917 -2.617 3.167  -2.563  1.373   24.646   -6.489 1.391  3.097  3.201 
5.978   24.815   19  XX_G32C33:G151C152_XX   X 32  ? X 152 ? X 33  ? X 151 ? 
1 A C 19  1_555 A G 137 1_555 A U 20  1_555 A U 136 1_555 -0.063 -1.493 2.941  -0.455  13.500  34.889   -3.793 0.050  2.232  
21.543 0.726   37.336   20  XX_C33U34:U150G151_XX   X 33  ? X 151 ? X 34  ? X 150 ? 
1 A U 20  1_555 A U 136 1_555 A C 22  1_555 A G 135 1_555 -2.771 0.568  3.284  -0.937  -0.379  52.549   0.667  3.067  3.325  
-0.428 1.058   52.558   21  XX_U34C36:G149U150_XX   X 34  ? X 150 ? X 36  ? X 149 ? 
1 A C 22  1_555 A G 135 1_555 A U 23  1_555 A A 134 1_555 -0.675 -2.217 3.778  -5.140  13.714  29.723   -6.290 0.289  2.609  
24.920 9.340   33.062   22  XX_C36U37:A148G149_XX   X 36  ? X 149 ? X 37  ? X 148 ? 
1 A U 23  1_555 A A 134 1_555 A G 24  1_555 A C 133 1_555 -0.655 -1.675 3.125  1.369   7.336   27.457   -4.901 1.611  2.565  
15.104 -2.820  28.434   23  XX_U37G38:C147A148_XX   X 37  ? X 148 ? X 38  ? X 147 ? 
1 A G 24  1_555 A C 133 1_555 A U 25  1_555 A A 132 1_555 0.544  -1.318 3.362  1.480   13.061  31.473   -4.243 -0.704 2.645  
22.869 -2.592  34.044   24  XX_G38U39:A146C147_XX   X 38  ? X 147 ? X 39  ? X 146 ? 
1 A U 25  1_555 A A 132 1_555 A A 26  1_555 A U 131 1_555 -0.046 -1.562 3.246  -0.702  14.881  26.344   -5.639 -0.036 2.085  
29.812 1.407   30.200   25  XX_U39A40:U145A146_XX   X 39  ? X 146 ? X 40  ? X 145 ? 
1 A A 26  1_555 A U 131 1_555 A U 27  1_555 A A 130 1_555 -0.680 -1.284 3.309  0.651   11.253  27.764   -4.668 1.443  2.587  
22.320 -1.291  29.923   26  XX_A40U41:A144U145_XX   X 40  ? X 145 ? X 41  ? X 144 ? 
1 A U 27  1_555 A A 130 1_555 A G 28  1_555 A C 129 1_555 0.510  -1.401 3.305  -2.451  14.716  31.817   -4.354 -1.184 2.400  
25.186 4.195   35.059   27  XX_U41G42:C143A144_XX   X 41  ? X 144 ? X 42  ? X 143 ? 
1 A G 28  1_555 A C 129 1_555 A G 29  1_555 A C 128 1_555 0.259  -1.913 3.513  4.511   8.436   32.169   -4.715 0.299  2.940  
14.819 -7.925  33.525   28  XX_G42G43:C142C143_XX   X 42  ? X 143 ? X 43  ? X 142 ? 
1 A G 29  1_555 A C 128 1_555 A A 30  1_555 A G 127 1_555 -1.204 -1.181 3.071  2.590   4.489   35.761   -2.479 2.272  2.816  7.264 
-4.191  36.122   29  XX_G43A44:G141C142_XX   X 43  ? X 142 ? X 44  ? X 141 ? 
1 A A 30  1_555 A G 127 1_555 A G 31  1_555 A U 126 1_555 0.201  -1.008 3.356  -2.350  5.545   51.772   -1.521 -0.387 3.228  6.326 
2.681   52.098   30  XX_A44G45:U140G141_XX   X 44  ? X 141 ? X 45  ? X 140 ? 
1 A C 35  1_555 A U 111 1_555 A G 36  1_555 A C 110 1_555 -0.038 -1.425 3.256  -6.825  6.998   55.708   -1.888 -0.333 3.056  7.425 
7.241   56.492   31  XX_C49G50:C124U125_XX   X 49  ? X 125 ? X 50  ? X 124 ? 
1 A G 36  1_555 A C 110 1_555 A C 37  1_555 A G 109 1_555 -0.481 -1.677 3.214  0.545   6.076   33.976   -3.711 0.890  2.872  
10.295 -0.924  34.504   32  XX_G50C51:G123C124_XX   X 50  ? X 124 ? X 51  ? X 123 ? 
1 A C 37  1_555 A G 109 1_555 A U 38  1_555 A A 108 1_555 0.557  -1.698 3.276  1.534   8.855   29.861   -4.738 -0.765 2.698  
16.715 -2.895  31.154   33  XX_C51U52:A122G123_XX   X 51  ? X 123 ? X 52  ? X 122 ? 
1 A U 38  1_555 A A 108 1_555 A G 39  1_555 A C 107 1_555 -0.408 -1.488 3.263  -1.560  13.806  28.866   -4.960 0.485  2.343  
25.888 2.924   31.972   34  XX_U52G53:C121A122_XX   X 52  ? X 122 ? X 53  ? X 121 ? 
1 A G 39  1_555 A C 107 1_555 A C 40  1_555 A G 106 1_555 -0.288 -1.305 3.163  -0.178  6.017   35.999   -2.864 0.436  2.916  9.653 
0.286   36.482   35  XX_G53C54:G120C121_XX   X 53  ? X 121 ? X 54  ? X 120 ? 
1 A C 40  1_555 A G 106 1_555 A U 41  1_555 A A 104 1_555 0.484  -0.983 3.157  3.313   10.726  15.023   -8.079 0.076  2.062  
35.290 -10.902 18.735   36  XX_C54U55:A118G120_XX   X 54  ? X 120 ? X 55  ? X 118 ? 
1 A U 41  1_555 A A 104 1_555 A G 42  1_555 A U 71  1_555 1.449  -0.737 2.725  -11.142 12.121  51.346   -1.398 -2.137 2.177  
13.595 12.496  53.750   37  XX_U55G56:U85A118_XX    X 55  ? X 118 ? X 56  ? X 85  ? 
1 A G 42  1_555 A U 71  1_555 A C 43  1_555 A G 70  1_555 0.482  -1.144 3.126  2.514   4.040   43.419   -1.904 -0.421 3.035  5.441 
-3.386  43.667   38  XX_G56C57:G84U85_XX     X 56  ? X 85  ? X 57  ? X 84  ? 
1 A C 43  1_555 A G 70  1_555 A C 44  1_555 A G 69  1_555 -0.451 -1.722 3.681  -2.949  7.329   32.782   -4.253 0.261  3.258  
12.757 5.133   33.695   39  XX_C57C58:G83G84_XX     X 57  ? X 84  ? X 58  ? X 83  ? 
1 A C 44  1_555 A G 69  1_555 A C 45  1_555 A G 68  1_555 -0.155 -1.808 3.370  -1.194  3.669   30.305   -4.160 0.058  3.138  6.983 
2.273   30.544   40  XX_C58C59:G82G83_XX     X 58  ? X 83  ? X 59  ? X 82  ? 
1 A C 45  1_555 A G 68  1_555 A A 46  1_555 A U 67  1_555 -0.998 -1.038 2.862  0.541   9.045   27.732   -3.689 2.079  2.392  
18.263 -1.092  29.147   41  XX_C59A60:U81G82_XX     X 59  ? X 82  ? X 60  ? X 81  ? 
1 A U 10  1_555 A A 92  1_555 A A 58  1_555 A A 91  1_555 1.589  2.480  1.528  150.179 -41.786 -173.834 -1.229 0.833  1.481  
20.898 75.106  -178.712 42  XX_U24A72:A105A106_XX   X 24  ? X 106 ? X 72  ? X 105 ? 
1 A A 58  1_555 A A 91  1_555 A G 59  1_555 A C 54  1_555 3.497  5.052  2.198  -3.471  7.654   136.422  2.687  -1.897 2.289  4.121 
1.869   136.545  43  XX_A72G73:C68A105_XX    X 72  ? X 105 ? X 73  ? X 68  ? 
1 A G 59  1_555 A C 54  1_555 A A 60  1_555 A U 53  1_555 0.212  -1.837 3.241  0.519   5.163   30.784   -4.344 -0.301 2.905  9.640 
-0.970  31.208   44  XX_G73A74:U67C68_XX     X 73  ? X 68  ? X 74  ? X 67  ? 
1 A A 60  1_555 A U 53  1_555 A C 61  1_555 A G 52  1_555 -0.374 -0.877 3.083  0.605   10.378  32.425   -2.995 0.727  2.676  
18.017 -1.050  34.008   45  XX_A74C75:G66U67_XX     X 74  ? X 67  ? X 75  ? X 66  ? 
1 A C 61  1_555 A G 52  1_555 A G 62  1_555 A U 51  1_555 0.440  -1.651 3.396  2.888   20.808  30.909   -5.084 -0.343 1.969  
34.499 -4.787  37.228   46  XX_C75G76:U65G66_XX     X 75  ? X 66  ? X 76  ? X 65  ? 
1 A G 62  1_555 A U 51  1_555 A C 63  1_555 A A 50  1_555 0.076  -0.507 3.558  -6.721  9.692   56.885   -1.078 -0.463 3.410  
10.055 6.973   57.994   47  XX_G76C77:A64U65_XX     X 76  ? X 65  ? X 77  ? X 64  ? 
1 A C 63  1_555 A A 50  1_555 A C 64  1_555 A A 48  1_555 -0.067 -1.686 4.663  6.337   20.962  64.137   -2.626 0.395  3.988  
19.164 -5.794  67.393   48  XX_C77C78:A62A64_XX     X 77  ? X 64  ? X 78  ? X 62  ? 
1 A A 73  1_555 A U 102 1_555 A G 77  1_555 A U 101 1_555 3.702  -2.380 3.342  0.004   4.056   67.837   -2.284 -3.312 3.212  3.631 
-0.004  67.944   49  XX_A87G91:U115U116_XX   X 87  ? X 116 ? X 91  ? X 115 ? 
1 A G 77  1_555 A U 101 1_555 A A 78  1_555 A U 100 1_555 0.141  -1.982 3.459  -0.178  -0.654  39.850   -2.828 -0.229 3.489  
-0.960 0.262   39.856   50  XX_G91A92:U114U115_XX   X 91  ? X 115 ? X 92  ? X 114 ? 
1 A A 78  1_555 A U 100 1_555 A A 79  1_555 A U 99  1_555 -1.331 -2.386 3.154  -1.905  4.596   21.331   -7.899 2.835  2.693  
12.204 5.059   21.897   51  XX_A92A93:U113U114_XX   X 92  ? X 114 ? X 93  ? X 113 ? 
1 A A 79  1_555 A U 99  1_555 A A 80  1_555 A U 98  1_555 -0.893 -1.730 3.092  -4.452  9.957   32.204   -4.378 0.895  2.558  
17.340 7.754   33.955   52  XX_A93A94:U112U113_XX   X 93  ? X 113 ? X 94  ? X 112 ? 
1 A A 80  1_555 A U 98  1_555 A U 81  1_555 A A 97  1_555 -0.544 -1.090 3.244  0.154   13.412  29.132   -4.213 1.013  2.509  
25.057 -0.288  32.011   53  XX_A94U95:A111U112_XX   X 94  ? X 112 ? X 95  ? X 111 ? 
1 A U 81  1_555 A A 97  1_555 A C 82  1_555 A G 96  1_555 0.422  -1.275 3.286  0.038   5.480   34.079   -2.978 -0.705 3.051  9.276 
-0.065  34.504   54  XX_U95C96:G110A111_XX   X 95  ? X 111 ? X 96  ? X 110 ? 
1 A C 82  1_555 A G 96  1_555 A A 83  1_555 A U 95  1_555 0.146  -1.744 3.219  0.001   11.449  31.162   -4.778 -0.256 2.444  
20.466 -0.001  33.150   55  XX_C96A97:U109G110_XX   X 96  ? X 110 ? X 97  ? X 109 ? 
1 A A 83  1_555 A U 95  1_555 A U 84  1_555 A G 94  1_555 0.149  -1.481 3.299  1.850   5.423   40.315   -2.718 -0.013 3.086  7.821 
-2.668  40.703   56  XX_A97U98:G108U109_XX   X 97  ? X 109 ? X 98  ? X 108 ? 
1 A U 84  1_555 A G 94  1_555 A C 85  1_555 A G 93  1_555 0.093  -2.413 3.096  2.340   11.310  23.395   -7.780 0.295  1.760  
25.962 -5.370  26.055   57  XX_U98C99:G107G108_XX   X 98  ? X 108 ? X 99  ? X 107 ? 
1 A G 112 1_555 A C 123 1_555 A G 113 1_555 A C 122 1_555 0.381  -1.884 3.237  2.768   9.854   27.692   -5.592 -0.218 2.462  
19.753 -5.549  29.489   58  XX_G126G127:C136C137_XX X 126 ? X 137 ? X 127 ? X 136 ? 
1 B G 1   1_555 B C 160 1_555 B G 2   1_555 B C 159 1_555 -0.182 -1.371 3.459  2.068   6.563   34.497   -3.267 0.615  3.138  
10.931 -3.445  35.156   59  AA_G15G16:C173C174_AA   A 15  ? A 174 ? A 16  ? A 173 ? 
1 B G 2   1_555 B C 159 1_555 B G 3   1_555 B C 158 1_555 -0.321 -0.995 3.093  -2.180  7.615   33.184   -2.805 0.230  2.817  
13.103 3.751   34.090   60  AA_G16G17:C172C173_AA   A 16  ? A 173 ? A 17  ? A 172 ? 
1 B G 3   1_555 B C 158 1_555 B C 4   1_555 B G 157 1_555 0.399  -0.835 3.058  0.823   9.318   32.880   -2.755 -0.562 2.735  
16.062 -1.418  34.150   61  AA_G17C18:G171C172_AA   A 17  ? A 172 ? A 18  ? A 171 ? 
1 B C 4   1_555 B G 157 1_555 B U 5   1_555 B A 156 1_555 0.902  -1.430 3.213  1.628   10.979  31.355   -4.192 -1.327 2.620  
19.562 -2.901  33.215   62  AA_C18U19:A170G171_AA   A 18  ? A 171 ? A 19  ? A 170 ? 
1 B U 5   1_555 B A 156 1_555 B U 6   1_555 B A 155 1_555 -0.082 -1.955 3.149  1.123   4.508   29.530   -4.649 0.372  2.821  8.776 
-2.186  29.885   63  AA_U19U20:A169A170_AA   A 19  ? A 170 ? A 20  ? A 169 ? 
1 B U 6   1_555 B A 155 1_555 B C 7   1_555 B G 154 1_555 1.059  -1.544 3.385  6.378   -1.851  32.654   -2.361 -0.701 3.602  
-3.251 -11.199 33.304   64  AA_U20C21:G168A169_AA   A 20  ? A 169 ? A 21  ? A 168 ? 
1 B C 7   1_555 B G 154 1_555 B A 87  1_555 B U 153 1_555 0.765  2.963  -0.194 160.363 -38.924 -54.739  -1.515 0.289  -0.130 
20.413 84.099  -166.705 65  AA_C21A101:U167G168_AA  A 21  ? A 168 ? A 101 ? A 167 ? 
1 B A 87  1_555 B U 153 1_555 B A 151 1_555 B G 150 1_555 1.206  -0.548 -3.752 -19.574 12.823  -95.289  0.606  1.170  -3.452 
-8.579 -13.095 -97.442  66  AA_A101A165:G164U167_AA A 101 ? A 167 ? A 165 ? A 164 ? 
1 B A 151 1_555 B G 150 1_555 B G 8   1_555 B C 149 1_555 4.260  -4.276 -1.278 146.550 -2.706  78.986   -2.187 -1.907 2.455  
-1.462 -79.176 154.356  67  AA_A165G22:C163G164_AA  A 165 ? A 164 ? A 22  ? A 163 ? 
1 B G 8   1_555 B C 149 1_555 B U 9   1_555 B A 148 1_555 -0.722 -1.039 2.848  0.115   6.773   25.412   -3.796 1.613  2.489  
15.058 -0.256  26.285   68  AA_G22U23:A162C163_AA   A 22  ? A 163 ? A 23  ? A 162 ? 
1 B U 9   1_555 B A 148 1_555 B A 11  1_555 B C 146 1_555 -1.431 -2.250 6.608  -29.926 9.702   48.087   -3.501 -2.019 5.994  
10.688 32.966  56.947   69  AA_U23A25:C160A162_AA   A 23  ? A 162 ? A 25  ? A 160 ? 
1 B A 11  1_555 B C 146 1_555 B G 12  1_555 B U 145 1_555 2.313  -1.751 3.412  -5.072  6.190   49.365   -2.513 -3.099 2.950  7.355 
6.027   49.969   70  AA_A25G26:U159C160_AA   A 25  ? A 160 ? A 26  ? A 159 ? 
1 B G 12  1_555 B U 145 1_555 B G 13  1_555 B C 144 1_555 0.072  -1.829 3.262  -2.301  9.158   37.641   -3.801 -0.372 2.750  
13.927 3.499   38.765   71  AA_G26G27:C158U159_AA   A 26  ? A 159 ? A 27  ? A 158 ? 
1 B G 13  1_555 B C 144 1_555 B U 14  1_555 B G 143 1_555 -0.013 -1.597 3.121  0.678   4.437   39.380   -2.837 0.093  2.931  6.558 
-1.002  39.625   72  AA_G27U28:G157C158_AA   A 27  ? A 158 ? A 28  ? A 157 ? 
1 B U 14  1_555 B G 143 1_555 B G 15  1_555 B A 142 1_555 -0.188 -0.574 3.125  5.409   12.016  53.989   -1.275 0.499  2.916  
13.019 -5.860  55.456   73  AA_U28G29:A156G157_AA   A 28  ? A 157 ? A 29  ? A 156 ? 
1 B G 15  1_555 B A 142 1_555 B A 16  1_555 B A 140 1_555 -0.119 -1.072 3.997  -3.417  -0.267  10.353   -5.124 -6.000 3.859  
-1.427 18.291  10.905   74  AA_G29A30:A154A156_AA   A 29  ? A 156 ? A 30  ? A 154 ? 
1 B A 16  1_555 B A 140 1_555 B G 17  1_555 B U 139 1_555 1.518  -1.350 3.187  -2.167  1.927   51.453   -1.679 -1.888 3.076  2.218 
2.494   51.529   75  AA_A30G31:U153A154_AA   A 30  ? A 154 ? A 31  ? A 153 ? 
1 B G 17  1_555 B U 139 1_555 B G 18  1_555 B C 138 1_555 0.904  -1.499 3.242  -0.301  7.096   40.715   -2.851 -1.312 2.945  
10.106 0.428   41.304   76  AA_G31G32:C152U153_AA   A 31  ? A 153 ? A 32  ? A 152 ? 
1 B G 18  1_555 B C 138 1_555 B C 19  1_555 B G 137 1_555 -0.827 -2.511 3.145  -1.626  4.098   26.877   -6.270 1.385  2.782  8.742 
3.468   27.229   77  AA_G32C33:G151C152_AA   A 32  ? A 152 ? A 33  ? A 151 ? 
1 B C 19  1_555 B G 137 1_555 B U 20  1_555 B U 136 1_555 -0.123 -1.437 3.078  0.796   12.037  36.101   -3.547 0.278  2.487  
18.788 -1.242  37.999   78  AA_C33U34:U150G151_AA   A 33  ? A 151 ? A 34  ? A 150 ? 
1 B U 20  1_555 B U 136 1_555 B C 22  1_555 B G 135 1_555 -3.176 0.526  3.315  -7.102  2.918   50.068   0.392  3.172  3.727  3.424 
8.334   50.616   79  AA_U34C36:G149U150_AA   A 34  ? A 150 ? A 36  ? A 149 ? 
1 B C 22  1_555 B G 135 1_555 B U 23  1_555 B A 134 1_555 0.517  -1.824 3.613  -5.302  11.266  30.108   -5.219 -1.846 2.652  
20.613 9.702   32.526   80  AA_C36U37:A148G149_AA   A 36  ? A 149 ? A 37  ? A 148 ? 
1 B U 23  1_555 B A 134 1_555 B G 24  1_555 B C 133 1_555 -0.939 -1.728 3.103  3.058   10.181  29.514   -4.832 2.228  2.289  
19.217 -5.772  31.330   81  AA_U37G38:C147A148_AA   A 37  ? A 148 ? A 38  ? A 147 ? 
1 B G 24  1_555 B C 133 1_555 B U 25  1_555 B A 132 1_555 0.308  -1.688 3.295  -3.140  8.621   28.586   -4.912 -1.197 2.637  
16.918 6.162   29.993   82  AA_G38U39:A146C147_AA   A 38  ? A 147 ? A 39  ? A 146 ? 
1 B U 25  1_555 B A 132 1_555 B A 26  1_555 B U 131 1_555 -0.466 -1.538 3.081  2.936   14.576  31.727   -4.409 1.147  2.142  
25.016 -5.039  34.957   83  AA_U39A40:U145A146_AA   A 39  ? A 146 ? A 40  ? A 145 ? 
1 B A 26  1_555 B U 131 1_555 B U 27  1_555 B A 130 1_555 -0.305 -1.126 3.264  -1.246  13.869  29.122   -4.323 0.344  2.495  
25.804 2.319   32.215   84  AA_A40U41:A144U145_AA   A 40  ? A 145 ? A 41  ? A 144 ? 
1 B U 27  1_555 B A 130 1_555 B G 28  1_555 B C 129 1_555 0.705  -1.372 3.313  1.001   10.969  31.008   -4.206 -1.084 2.705  
19.752 -1.802  32.860   85  AA_U41G42:C143A144_AA   A 41  ? A 144 ? A 42  ? A 143 ? 
1 B G 28  1_555 B C 129 1_555 B G 29  1_555 B C 128 1_555 0.317  -2.068 3.455  1.456   7.808   32.049   -4.948 -0.314 2.895  
13.878 -2.587  32.994   86  AA_G42G43:C142C143_AA   A 42  ? A 143 ? A 43  ? A 142 ? 
1 B G 29  1_555 B C 128 1_555 B A 30  1_555 B G 127 1_555 -1.129 -1.785 3.211  1.935   2.754   34.228   -3.428 2.196  2.996  4.665 
-3.279  34.389   87  AA_G43A44:G141C142_AA   A 43  ? A 142 ? A 44  ? A 141 ? 
1 B A 30  1_555 B G 127 1_555 B A 34  1_555 B U 126 1_555 2.593  2.163  5.466  149.642 -5.087  -137.610 -1.057 2.184  4.236  2.577 
75.802  -169.166 88  AA_A44A48:U140G141_AA   A 44  ? A 141 ? A 48  ? A 140 ? 
1 B G 36  1_555 B C 110 1_555 B C 37  1_555 B G 109 1_555 -0.531 -2.146 3.271  -3.141  2.772   34.657   -3.990 0.418  3.130  4.632 
5.249   34.902   89  AA_G50C51:G123C124_AA   A 50  ? A 124 ? A 51  ? A 123 ? 
1 B C 37  1_555 B G 109 1_555 B U 38  1_555 B A 108 1_555 -0.756 -1.718 3.101  -0.359  7.773   26.764   -5.201 1.496  2.521  
16.358 0.756   27.852   90  AA_C51U52:A122G123_AA   A 51  ? A 123 ? A 52  ? A 122 ? 
1 B U 38  1_555 B A 108 1_555 B G 39  1_555 B C 107 1_555 -0.713 -1.583 3.540  7.237   9.113   27.883   -4.867 2.820  2.641  
17.953 -14.257 30.170   91  AA_U52G53:C121A122_AA   A 52  ? A 122 ? A 53  ? A 121 ? 
1 B G 39  1_555 B C 107 1_555 B C 40  1_555 B G 106 1_555 1.133  -1.436 3.127  -0.329  6.451   39.080   -2.816 -1.709 2.854  9.564 
0.488   39.590   92  AA_G53C54:G120C121_AA   A 53  ? A 121 ? A 54  ? A 120 ? 
1 B C 40  1_555 B G 106 1_555 B U 41  1_555 B A 104 1_555 1.035  -1.023 2.881  -2.501  18.041  16.703   -6.436 -2.983 1.112  
47.368 6.566   24.665   93  AA_C54U55:A118G120_AA   A 54  ? A 120 ? A 55  ? A 118 ? 
1 B U 41  1_555 B A 104 1_555 B G 42  1_555 B U 71  1_555 1.432  -0.737 2.867  -11.462 12.025  53.300   -1.358 -2.076 2.335  
13.051 12.439  55.648   94  AA_U55G56:U85A118_AA    A 55  ? A 118 ? A 56  ? A 85  ? 
1 B G 42  1_555 B U 71  1_555 B C 43  1_555 B G 70  1_555 0.390  -1.143 3.175  1.858   0.602   43.126   -1.611 -0.353 3.172  0.819 
-2.527  43.168   95  AA_G56C57:G84U85_AA     A 56  ? A 85  ? A 57  ? A 84  ? 
1 B C 43  1_555 B G 70  1_555 B C 44  1_555 B G 69  1_555 -0.499 -1.917 3.546  -1.850  4.408   33.178   -4.087 0.546  3.293  7.670 
3.219   33.511   96  AA_C57C58:G83G84_AA     A 57  ? A 84  ? A 58  ? A 83  ? 
1 B C 44  1_555 B G 69  1_555 B C 45  1_555 B G 68  1_555 0.118  -2.095 3.419  -3.026  4.350   29.659   -4.919 -0.843 3.060  8.413 
5.851   30.119   97  AA_C58C59:G82G83_AA     A 58  ? A 83  ? A 59  ? A 82  ? 
1 B C 45  1_555 B G 68  1_555 B A 46  1_555 B U 67  1_555 -0.055 -1.451 3.185  1.295   5.562   30.989   -3.644 0.327  2.882  
10.300 -2.398  31.498   98  AA_C59A60:U81G82_AA     A 59  ? A 82  ? A 60  ? A 81  ? 
1 B A 46  1_555 B U 67  1_555 B A 47  1_555 B A 66  1_555 -1.645 -0.824 3.818  2.911   14.426  59.987   -1.571 1.760  3.482  
14.198 -2.865  61.602   99  AA_A60A61:A80U81_AA     A 60  ? A 81  ? A 61  ? A 80  ? 
1 B U 10  1_555 B A 92  1_555 B A 58  1_555 B A 91  1_555 1.734  2.380  1.582  149.208 -43.019 -173.984 -1.179 0.905  1.528  
21.514 74.620  -178.713 100 AA_U24A72:A105A106_AA   A 24  ? A 106 ? A 72  ? A 105 ? 
1 B A 58  1_555 B A 91  1_555 B G 59  1_555 B C 54  1_555 3.620  5.073  2.238  0.746   5.258   135.559  2.716  -1.952 2.343  2.840 
-0.403  135.609  101 AA_A72G73:C68A105_AA    A 72  ? A 105 ? A 73  ? A 68  ? 
1 B G 59  1_555 B C 54  1_555 B A 60  1_555 B U 53  1_555 0.446  -1.739 3.227  1.019   3.643   33.330   -3.588 -0.613 3.038  6.325 
-1.770  33.538   102 AA_G73A74:U67C68_AA     A 73  ? A 68  ? A 74  ? A 67  ? 
1 B A 60  1_555 B U 53  1_555 B C 61  1_555 B G 52  1_555 -0.163 -0.907 3.019  2.783   8.240   31.746   -2.852 0.711  2.682  
14.721 -4.972  32.887   103 AA_A74C75:G66U67_AA     A 74  ? A 67  ? A 75  ? A 66  ? 
1 B C 61  1_555 B G 52  1_555 B G 62  1_555 B U 51  1_555 1.166  -1.999 4.308  7.337   17.726  31.594   -6.078 -0.640 3.001  
29.412 -12.174 36.835   104 AA_C75G76:U65G66_AA     A 75  ? A 66  ? A 76  ? A 65  ? 
1 B G 62  1_555 B U 51  1_555 B C 63  1_555 B A 50  1_555 -0.980 -0.225 3.529  -3.838  4.628   54.148   -0.551 0.818  3.557  5.067 
4.202   54.456   105 AA_G76C77:A64U65_AA     A 76  ? A 65  ? A 77  ? A 64  ? 
1 B A 73  1_555 B U 102 1_555 B G 77  1_555 B U 101 1_555 4.187  -2.633 3.362  4.909   2.287   61.210   -2.692 -3.854 3.565  2.241 
-4.811  61.426   106 AA_A87G91:U115U116_AA   A 87  ? A 116 ? A 91  ? A 115 ? 
1 B G 77  1_555 B U 101 1_555 B A 78  1_555 B U 100 1_555 -0.104 -1.937 3.402  0.210   1.713   40.996   -2.956 0.172  3.322  2.445 
-0.300  41.030   107 AA_G91A92:U114U115_AA   A 91  ? A 115 ? A 92  ? A 114 ? 
1 B A 78  1_555 B U 100 1_555 B A 79  1_555 B U 99  1_555 -0.965 -2.239 3.144  -1.767  5.118   23.088   -6.974 1.824  2.658  
12.565 4.339   23.705   108 AA_A92A93:U113U114_AA   A 92  ? A 114 ? A 93  ? A 113 ? 
1 B A 79  1_555 B U 99  1_555 B A 80  1_555 B U 98  1_555 -0.530 -1.802 3.385  -3.527  12.921  29.465   -5.381 0.368  2.446  
23.910 6.525   32.305   109 AA_A93A94:U112U113_AA   A 93  ? A 113 ? A 94  ? A 112 ? 
1 B A 80  1_555 B U 98  1_555 B U 81  1_555 B A 97  1_555 -0.508 -0.826 3.128  0.418   11.205  29.948   -3.357 0.993  2.649  
20.789 -0.776  31.933   110 AA_A94U95:A111U112_AA   A 94  ? A 112 ? A 95  ? A 111 ? 
1 B U 81  1_555 B A 97  1_555 B C 82  1_555 B G 96  1_555 0.337  -1.250 3.140  0.409   7.415   32.918   -3.263 -0.520 2.803  
12.881 -0.711  33.723   111 AA_U95C96:G110A111_AA   A 95  ? A 111 ? A 96  ? A 110 ? 
1 B C 82  1_555 B G 96  1_555 B A 83  1_555 B U 95  1_555 0.147  -1.736 3.367  -1.144  10.170  31.510   -4.677 -0.441 2.685  
18.139 2.040   33.090   112 AA_C96A97:U109G110_AA   A 96  ? A 110 ? A 97  ? A 109 ? 
1 B A 83  1_555 B U 95  1_555 B U 84  1_555 B G 94  1_555 -0.033 -1.428 3.186  1.809   5.101   41.592   -2.500 0.224  2.995  7.147 
-2.535  41.927   113 AA_A97U98:G108U109_AA   A 97  ? A 109 ? A 98  ? A 108 ? 
1 B U 84  1_555 B G 94  1_555 B C 85  1_555 B G 93  1_555 0.147  -2.419 3.097  4.550   9.205   22.783   -7.829 0.762  1.976  
21.927 -10.839 24.962   114 AA_U98C99:G107G108_AA   A 98  ? A 108 ? A 99  ? A 107 ? 
1 B U 111 1_555 B A 125 1_555 B A 32  1_555 B U 124 1_555 3.594  -3.473 1.268  -10.759 -12.041 -82.127  2.722  2.601  1.221  9.087 
-8.119  -83.422  115 AA_U125A46:U138A139_AA  A 125 ? A 139 ? A 46  ? A 138 ? 
1 B A 32  1_555 B U 124 1_555 B G 112 1_555 B C 123 1_555 0.836  -1.971 3.587  -13.988 6.860   96.844   -1.430 -0.803 3.368  4.563 
9.305   97.778   116 AA_A46G126:C137U138_AA  A 46  ? A 138 ? A 126 ? A 137 ? 
1 B G 112 1_555 B C 123 1_555 B G 113 1_555 B C 122 1_555 -0.512 -2.274 3.298  0.784   7.688   29.170   -5.811 1.130  2.612  
14.937 -1.523  30.154   117 AA_G126G127:C136C137_AA A 126 ? A 137 ? A 127 ? A 136 ? 
# 
loop_
_pdbx_entity_nonpoly.entity_id 
_pdbx_entity_nonpoly.name 
_pdbx_entity_nonpoly.comp_id 
2 'POTASSIUM ION'      K   
3 'MANGANESE (II) ION' MN  
4 water                HOH 
#