#   4N41 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.287 
PDB   4N41         
NDB   NA2802       
RCSB  RCSB082724   
WWPDB D_1000082724 
PDB 3DLH . unspecified 
PDB 3HVR . unspecified 
PDB 3HM9 . unspecified 
PDB 4N47 . unspecified 
PDB 4N76 . unspecified 
PDB 4NCA . unspecified 
PDB 4NCB . unspecified 
_pdbx_database_status.entry_id                        4N41 
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.deposit_site                    RCSB 
_pdbx_database_status.process_site                    RCSB 
_pdbx_database_status.recvd_initial_deposition_date   2013-10-08 
_pdbx_database_status.status_code_sf                  REL 
_pdbx_database_status.status_code_mr                  ? 
_pdbx_database_status.SG_entry                        ? 
_pdbx_database_status.status_code_cs                  ? 
_pdbx_database_status.methods_development_category    ? 
_pdbx_database_status.pdb_format_compatible           Y 
'Sheng, G.' 1 
'Zhao, H.'  2 
'Wang, J.'  3 
'Rao, Y.'   4 
'Wang, Y.'  5 
#                        primary 
'Structure-based cleavage mechanism of Thermus thermophilus Argonaute DNA guide strand-mediated DNA target cleavage.' 
_citation.journal_abbrev            Proc.Natl.Acad.Sci.USA 
_citation.journal_volume            111 
_citation.page_first                652 
_citation.page_last                 657 
_citation.year                      2014 
_citation.journal_id_ASTM           PNASA6                   US 
_citation.journal_id_ISSN           0027-8424 
_citation.journal_id_CSD            0040 
_citation.book_publisher            ? 
_citation.pdbx_database_id_PubMed   24374628 
_citation.pdbx_database_id_DOI      10.1073/pnas.1321032111 
primary 'Sheng, G.'        1 
primary 'Zhao, H.'         2 
primary 'Wang, J.'         3 
primary 'Rao, Y.'          4 
primary 'Tian, W.'         5 
primary 'Swarts, D.C.'     6 
primary 'van der Oost, J.' 7 
primary 'Patel, D.J.'      8 
primary 'Wang, Y.'         9 
_cell.entry_id           4N41 
_cell.length_a           59.513 
_cell.length_b           101.699 
_cell.length_c           153.019 
_cell.angle_alpha        90.00 
_cell.angle_beta         93.52 
_cell.angle_gamma        90.00 
_cell.Z_PDB              4 
_cell.pdbx_unique_axis   ? 
_cell.length_a_esd       ? 
_cell.length_b_esd       ? 
_cell.length_c_esd       ? 
_cell.angle_alpha_esd    ? 
_cell.angle_beta_esd     ? 
_cell.angle_gamma_esd    ? 
_symmetry.entry_id                         4N41 
_symmetry.space_group_name_H-M             'P 1 21 1' 
_symmetry.pdbx_full_space_group_name_H-M   ? 
_symmetry.cell_setting                     ? 
_symmetry.Int_Tables_number                4 
_symmetry.space_group_name_Hall            ? 
1 polymer     man Argonaute                                                                 76728.734 2   ? ? ? ? 
2 polymer     syn "5'-D(P*TP*GP*AP*GP*GP*TP*AP*GP*TP*AP*GP*GP*TP*T*GP*TP*AP*TP*AP*GP*T)-3'" 6588.266  2   ? ? ? ? 
3 polymer     syn "5'-D(P*AP*CP*CP*TP*AP*CP*TP*AP*CP*CP*TP*CP*G)-3'"                        3871.538  1   ? ? ? ? 
4 polymer     syn "5'-D(*AP*AP*CP*CP*TP*AP*CP*TP*GP*CP*CP*TP*CP*G)-3'"                      4184.745  1   ? ? ? ? 
5 non-polymer syn 'MAGNESIUM ION'                                                           24.305    3   ? ? ? ? 
6 water       nat water                                                                     18.015    170 ? ? ? ? 
1 'polypeptide(L)'        no no 
A,B ? 
2 polydeoxyribonucleotide no no 
3 polydeoxyribonucleotide no no '(DA)(DC)(DC)(DT)(DA)(DC)(DT)(DA)(DC)(DC)(DT)(DC)(DG)' ACCTACTACCTCG D   ? 
4 polydeoxyribonucleotide no no '(DA)(DA)(DC)(DC)(DT)(DA)(DC)(DT)(DA)(DC)(DC)(DT)(DC)(DG)' AACCTACTACCTCG F   ? 
1 1   MET n 
1 2   ASN n 
1 3   HIS n 
1 4   LEU n 
1 5   GLY n 
1 6   LYS n 
1 7   THR n 
1 8   GLU n 
1 9   VAL n 
1 10  PHE n 
1 11  LEU n 
1 12  ASN n 
1 13  ARG n 
1 14  PHE n 
1 15  ALA n 
1 16  LEU n 
1 17  ARG n 
1 18  PRO n 
1 19  LEU n 
1 20  ASN n 
1 21  PRO n 
1 22  GLU n 
1 23  GLU n 
1 24  LEU n 
1 25  ARG n 
1 26  PRO n 
1 27  TRP n 
1 28  ARG n 
1 29  LEU n 
1 30  GLU n 
1 31  VAL n 
1 32  VAL n 
1 33  LEU n 
1 34  ASP n 
1 35  PRO n 
1 36  PRO n 
1 37  PRO n 
1 38  GLY n 
1 39  ARG n 
1 40  GLU n 
1 41  GLU n 
1 42  VAL n 
1 43  TYR n 
1 44  PRO n 
1 45  LEU n 
1 46  LEU n 
1 47  ALA n 
1 48  GLN n 
1 49  VAL n 
1 50  ALA n 
1 51  ARG n 
1 52  ARG n 
1 53  ALA n 
1 54  GLY n 
1 55  GLY n 
1 56  VAL n 
1 57  THR n 
1 58  VAL n 
1 59  ARG n 
1 60  MET n 
1 61  GLY n 
1 62  ASP n 
1 63  GLY n 
1 64  LEU n 
1 65  ALA n 
1 66  SER n 
1 67  TRP n 
1 68  SER n 
1 69  PRO n 
1 70  PRO n 
1 71  GLU n 
1 72  VAL n 
1 73  LEU n 
1 74  VAL n 
1 75  LEU n 
1 76  GLU n 
1 77  GLY n 
1 78  THR n 
1 79  LEU n 
1 80  ALA n 
1 81  ARG n 
1 82  MET n 
1 83  GLY n 
1 84  GLN n 
1 85  THR n 
1 86  TYR n 
1 87  ALA n 
1 88  TYR n 
1 89  ARG n 
1 90  LEU n 
1 91  TYR n 
1 92  PRO n 
1 93  LYS n 
1 94  GLY n 
1 95  ARG n 
1 96  ARG n 
1 97  PRO n 
1 98  LEU n 
1 99  ASP n 
1 100 PRO n 
1 101 LYS n 
1 102 ASP n 
1 103 PRO n 
1 104 GLY n 
1 105 GLU n 
1 106 ARG n 
1 107 SER n 
1 108 VAL n 
1 109 LEU n 
1 110 SER n 
1 111 ALA n 
1 112 LEU n 
1 113 ALA n 
1 114 ARG n 
1 115 ARG n 
1 116 LEU n 
1 117 LEU n 
1 118 GLN n 
1 119 GLU n 
1 120 ARG n 
1 121 LEU n 
1 122 ARG n 
1 123 ARG n 
1 124 LEU n 
1 125 GLU n 
1 126 GLY n 
1 127 VAL n 
1 128 TRP n 
1 129 VAL n 
1 130 GLU n 
1 131 GLY n 
1 132 LEU n 
1 133 ALA n 
1 134 VAL n 
1 135 TYR n 
1 136 ARG n 
1 137 ARG n 
1 138 GLU n 
1 139 HIS n 
1 140 ALA n 
1 141 ARG n 
1 142 GLY n 
1 143 PRO n 
1 144 GLY n 
1 145 TRP n 
1 146 ARG n 
1 147 VAL n 
1 148 LEU n 
1 149 GLY n 
1 150 GLY n 
1 151 ALA n 
1 152 VAL n 
1 153 LEU n 
1 154 ASP n 
1 155 LEU n 
1 156 TRP n 
1 157 VAL n 
1 158 SER n 
1 159 ASP n 
1 160 SER n 
1 161 GLY n 
1 162 ALA n 
1 163 PHE n 
1 164 LEU n 
1 165 LEU n 
1 166 GLU n 
1 167 VAL n 
1 168 ASP n 
1 169 PRO n 
1 170 ALA n 
1 171 TYR n 
1 172 ARG n 
1 173 ILE n 
1 174 LEU n 
1 175 CYS n 
1 176 GLU n 
1 177 MET n 
1 178 SER n 
1 179 LEU n 
1 180 GLU n 
1 181 ALA n 
1 182 TRP n 
1 183 LEU n 
1 184 ALA n 
1 185 GLN n 
1 186 GLY n 
1 187 HIS n 
1 188 PRO n 
1 189 LEU n 
1 190 PRO n 
1 191 LYS n 
1 192 ARG n 
1 193 VAL n 
1 194 ARG n 
1 195 ASN n 
1 196 ALA n 
1 197 TYR n 
1 198 ASP n 
1 199 ARG n 
1 200 ARG n 
1 201 THR n 
1 202 TRP n 
1 203 GLU n 
1 204 LEU n 
1 205 LEU n 
1 206 ARG n 
1 207 LEU n 
1 208 GLY n 
1 209 GLU n 
1 210 GLU n 
1 211 ASP n 
1 212 PRO n 
1 213 LYS n 
1 214 GLU n 
1 215 LEU n 
1 216 PRO n 
1 217 LEU n 
1 218 PRO n 
1 219 GLY n 
1 220 GLY n 
1 221 LEU n 
1 222 SER n 
1 223 LEU n 
1 224 LEU n 
1 225 ASP n 
1 226 TYR n 
1 227 HIS n 
1 228 ALA n 
1 229 SER n 
1 230 LYS n 
1 231 GLY n 
1 232 ARG n 
1 233 LEU n 
1 234 GLN n 
1 235 GLY n 
1 236 ARG n 
1 237 GLU n 
1 238 GLY n 
1 239 GLY n 
1 240 ARG n 
1 241 VAL n 
1 242 ALA n 
1 243 TRP n 
1 244 VAL n 
1 245 ALA n 
1 246 ASP n 
1 247 PRO n 
1 248 LYS n 
1 249 ASP n 
1 250 PRO n 
1 251 ARG n 
1 252 LYS n 
1 253 PRO n 
1 254 ILE n 
1 255 PRO n 
1 256 HIS n 
1 257 LEU n 
1 258 THR n 
1 259 GLY n 
1 260 LEU n 
1 261 LEU n 
1 262 VAL n 
1 263 PRO n 
1 264 VAL n 
1 265 LEU n 
1 266 THR n 
1 267 LEU n 
1 268 GLU n 
1 269 ASP n 
1 270 LEU n 
1 271 HIS n 
1 272 GLU n 
1 273 GLU n 
1 274 GLU n 
1 275 GLY n 
1 276 SER n 
1 277 LEU n 
1 278 ALA n 
1 279 LEU n 
1 280 SER n 
1 281 LEU n 
1 282 PRO n 
1 283 TRP n 
1 284 GLU n 
1 285 GLU n 
1 286 ARG n 
1 287 ARG n 
1 288 ARG n 
1 289 ARG n 
1 290 THR n 
1 291 ARG n 
1 292 GLU n 
1 293 ILE n 
1 294 ALA n 
1 295 SER n 
1 296 TRP n 
1 297 ILE n 
1 298 GLY n 
1 299 ARG n 
1 300 ARG n 
1 301 LEU n 
1 302 GLY n 
1 303 LEU n 
1 304 GLY n 
1 305 THR n 
1 306 PRO n 
1 307 GLU n 
1 308 ALA n 
1 309 VAL n 
1 310 ARG n 
1 311 ALA n 
1 312 GLN n 
1 313 ALA n 
1 314 TYR n 
1 315 ARG n 
1 316 LEU n 
1 317 SER n 
1 318 ILE n 
1 319 PRO n 
1 320 LYS n 
1 321 LEU n 
1 322 MET n 
1 323 GLY n 
1 324 ARG n 
1 325 ARG n 
1 326 ALA n 
1 327 VAL n 
1 328 SER n 
1 329 LYS n 
1 330 PRO n 
1 331 ALA n 
1 332 ASP n 
1 333 ALA n 
1 334 LEU n 
1 335 ARG n 
1 336 VAL n 
1 337 GLY n 
1 338 PHE n 
1 339 TYR n 
1 340 ARG n 
1 341 ALA n 
1 342 GLN n 
1 343 GLU n 
1 344 THR n 
1 345 ALA n 
1 346 LEU n 
1 347 ALA n 
1 348 LEU n 
1 349 LEU n 
1 350 ARG n 
1 351 LEU n 
1 352 ASP n 
1 353 GLY n 
1 354 ALA n 
1 355 GLN n 
1 356 GLY n 
1 357 TRP n 
1 358 PRO n 
1 359 GLU n 
1 360 PHE n 
1 361 LEU n 
1 362 ARG n 
1 363 ARG n 
1 364 ALA n 
1 365 LEU n 
1 366 LEU n 
1 367 ARG n 
1 368 ALA n 
1 369 PHE n 
1 370 GLY n 
1 371 ALA n 
1 372 SER n 
1 373 GLY n 
1 374 ALA n 
1 375 SER n 
1 376 LEU n 
1 377 ARG n 
1 378 LEU n 
1 379 HIS n 
1 380 THR n 
1 381 LEU n 
1 382 HIS n 
1 383 ALA n 
1 384 HIS n 
1 385 PRO n 
1 386 SER n 
1 387 GLN n 
1 388 GLY n 
1 389 LEU n 
1 390 ALA n 
1 391 PHE n 
1 392 ARG n 
1 393 GLU n 
1 394 ALA n 
1 395 LEU n 
1 396 ARG n 
1 397 LYS n 
1 398 ALA n 
1 399 LYS n 
1 400 GLU n 
1 401 GLU n 
1 402 GLY n 
1 403 VAL n 
1 404 GLN n 
1 405 ALA n 
1 406 VAL n 
1 407 LEU n 
1 408 VAL n 
1 409 LEU n 
1 410 THR n 
1 411 PRO n 
1 412 PRO n 
1 413 MET n 
1 414 ALA n 
1 415 TRP n 
1 416 GLU n 
1 417 ASP n 
1 418 ARG n 
1 419 ASN n 
1 420 ARG n 
1 421 LEU n 
1 422 LYS n 
1 423 ALA n 
1 424 LEU n 
1 425 LEU n 
1 426 LEU n 
1 427 ARG n 
1 428 GLU n 
1 429 GLY n 
1 430 LEU n 
1 431 PRO n 
1 432 SER n 
1 433 GLN n 
1 434 ILE n 
1 435 LEU n 
1 436 ASN n 
1 437 VAL n 
1 438 PRO n 
1 439 LEU n 
1 440 ARG n 
1 441 GLU n 
1 442 GLU n 
1 443 GLU n 
1 444 ARG n 
1 445 HIS n 
1 446 ARG n 
1 447 TRP n 
1 448 GLU n 
1 449 ASN n 
1 450 ALA n 
1 451 LEU n 
1 452 LEU n 
1 453 GLY n 
1 454 LEU n 
1 455 LEU n 
1 456 ALA n 
1 457 LYS n 
1 458 ALA n 
1 459 GLY n 
1 460 LEU n 
1 461 GLN n 
1 462 VAL n 
1 463 VAL n 
1 464 ALA n 
1 465 LEU n 
1 466 SER n 
1 467 GLY n 
1 468 ALA n 
1 469 TYR n 
1 470 PRO n 
1 471 ALA n 
1 472 GLU n 
1 473 LEU n 
1 474 ALA n 
1 475 VAL n 
1 476 GLY n 
1 477 PHE n 
1 478 ASP n 
1 479 ALA n 
1 480 GLY n 
1 481 GLY n 
1 482 ARG n 
1 483 GLU n 
1 484 SER n 
1 485 PHE n 
1 486 ARG n 
1 487 PHE n 
1 488 GLY n 
1 489 GLY n 
1 490 ALA n 
1 491 ALA n 
1 492 CYS n 
1 493 ALA n 
1 494 VAL n 
1 495 GLY n 
1 496 GLY n 
1 497 ASP n 
1 498 GLY n 
1 499 GLY n 
1 500 HIS n 
1 501 LEU n 
1 502 LEU n 
1 503 TRP n 
1 504 THR n 
1 505 LEU n 
1 506 PRO n 
1 507 GLU n 
1 508 ALA n 
1 509 GLN n 
1 510 ALA n 
1 511 GLY n 
1 512 GLU n 
1 513 ARG n 
1 514 ILE n 
1 515 PRO n 
1 516 GLN n 
1 517 GLU n 
1 518 VAL n 
1 519 VAL n 
1 520 TRP n 
1 521 ASP n 
1 522 LEU n 
1 523 LEU n 
1 524 GLU n 
1 525 GLU n 
1 526 THR n 
1 527 LEU n 
1 528 TRP n 
1 529 ALA n 
1 530 PHE n 
1 531 ARG n 
1 532 ARG n 
1 533 LYS n 
1 534 ALA n 
1 535 GLY n 
1 536 ARG n 
1 537 LEU n 
1 538 PRO n 
1 539 SER n 
1 540 ARG n 
1 541 VAL n 
1 542 LEU n 
1 543 LEU n 
1 544 LEU n 
1 545 ARG n 
1 546 ASP n 
1 547 GLY n 
1 548 ARG n 
1 549 VAL n 
1 550 PRO n 
1 551 GLN n 
1 552 ASP n 
1 553 GLU n 
1 554 PHE n 
1 555 ALA n 
1 556 LEU n 
1 557 ALA n 
1 558 LEU n 
1 559 GLU n 
1 560 ALA n 
1 561 LEU n 
1 562 ALA n 
1 563 ARG n 
1 564 GLU n 
1 565 GLY n 
1 566 ILE n 
1 567 ALA n 
1 568 TYR n 
1 569 ASP n 
1 570 LEU n 
1 571 VAL n 
1 572 SER n 
1 573 VAL n 
1 574 ARG n 
1 575 LYS n 
1 576 SER n 
1 577 GLY n 
1 578 GLY n 
1 579 GLY n 
1 580 ARG n 
1 581 VAL n 
1 582 TYR n 
1 583 PRO n 
1 584 VAL n 
1 585 GLN n 
1 586 GLY n 
1 587 ARG n 
1 588 LEU n 
1 589 ALA n 
1 590 ASP n 
1 591 GLY n 
1 592 LEU n 
1 593 TYR n 
1 594 VAL n 
1 595 PRO n 
1 596 LEU n 
1 597 GLU n 
1 598 ASP n 
1 599 LYS n 
1 600 THR n 
1 601 PHE n 
1 602 LEU n 
1 603 LEU n 
1 604 LEU n 
1 605 THR n 
1 606 VAL n 
1 607 HIS n 
1 608 ARG n 
1 609 ASP n 
1 610 PHE n 
1 611 ARG n 
1 612 GLY n 
1 613 THR n 
1 614 PRO n 
1 615 ARG n 
1 616 PRO n 
1 617 LEU n 
1 618 LYS n 
1 619 LEU n 
1 620 VAL n 
1 621 HIS n 
1 622 GLU n 
1 623 ALA n 
1 624 GLY n 
1 625 ASP n 
1 626 THR n 
1 627 PRO n 
1 628 LEU n 
1 629 GLU n 
1 630 ALA n 
1 631 LEU n 
1 632 ALA n 
1 633 HIS n 
1 634 GLN n 
1 635 ILE n 
1 636 PHE n 
1 637 HIS n 
1 638 LEU n 
1 639 THR n 
1 640 ARG n 
1 641 LEU n 
1 642 TYR n 
1 643 PRO n 
1 644 ALA n 
1 645 SER n 
1 646 GLY n 
1 647 PHE n 
1 648 ALA n 
1 649 PHE n 
1 650 PRO n 
1 651 ARG n 
1 652 LEU n 
1 653 PRO n 
1 654 ALA n 
1 655 PRO n 
1 656 LEU n 
1 657 HIS n 
1 658 LEU n 
1 659 ALA n 
1 660 ASP n 
1 661 ARG n 
1 662 LEU n 
1 663 VAL n 
1 664 LYS n 
1 665 GLU n 
1 666 VAL n 
1 667 GLY n 
1 668 ARG n 
1 669 LEU n 
1 670 GLY n 
1 671 ILE n 
1 672 ARG n 
1 673 HIS n 
1 674 LEU n 
1 675 LYS n 
1 676 GLU n 
1 677 VAL n 
1 678 ASP n 
1 679 ARG n 
1 680 GLU n 
1 681 LYS n 
1 682 LEU n 
1 683 PHE n 
1 684 PHE n 
1 685 VAL n 
2 1   DT  n 
2 2   DG  n 
2 3   DA  n 
2 4   DG  n 
2 5   DG  n 
2 6   DT  n 
2 7   DA  n 
2 8   DG  n 
2 9   DT  n 
2 10  DA  n 
2 11  DG  n 
2 12  DG  n 
2 13  DT  n 
2 14  DT  n 
2 15  DG  n 
2 16  DT  n 
2 17  DA  n 
2 18  DT  n 
2 19  DA  n 
2 20  DG  n 
2 21  DT  n 
3 1   DA  n 
3 2   DC  n 
3 3   DC  n 
3 4   DT  n 
3 5   DA  n 
3 6   DC  n 
3 7   DT  n 
3 8   DA  n 
3 9   DC  n 
3 10  DC  n 
3 11  DT  n 
3 12  DC  n 
3 13  DG  n 
4 1   DA  n 
4 2   DA  n 
4 3   DC  n 
4 4   DC  n 
4 5   DT  n 
4 6   DA  n 
4 7   DC  n 
4 8   DT  n 
4 9   DA  n 
4 10  DC  n 
4 11  DC  n 
4 12  DT  n 
4 13  DC  n 
4 14  DG  n 
_entity_src_gen.entity_id                          1 
_entity_src_gen.pdbx_src_id                        1 
_entity_src_gen.pdbx_alt_source_flag               sample 
_entity_src_gen.pdbx_seq_type                      ? 
_entity_src_gen.pdbx_beg_seq_num                   ? 
_entity_src_gen.pdbx_end_seq_num                   ? 
_entity_src_gen.gene_src_common_name               ? 
_entity_src_gen.gene_src_genus                     ? 
_entity_src_gen.pdbx_gene_src_gene                 'Argonaute, TT_P0026' 
_entity_src_gen.gene_src_species                   ? 
_entity_src_gen.gene_src_strain                    Thermophilus 
_entity_src_gen.gene_src_tissue                    ? 
_entity_src_gen.gene_src_tissue_fraction           ? 
_entity_src_gen.gene_src_details                   ? 
_entity_src_gen.pdbx_gene_src_fragment             ? 
_entity_src_gen.pdbx_gene_src_scientific_name      'Thermus thermophilus' 
_entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id     274 
_entity_src_gen.pdbx_gene_src_variant              ? 
_entity_src_gen.pdbx_gene_src_cell_line            ? 
_entity_src_gen.pdbx_gene_src_atcc                 ? 
_entity_src_gen.pdbx_gene_src_organ                ? 
_entity_src_gen.pdbx_gene_src_organelle            ? 
_entity_src_gen.pdbx_gene_src_cell                 ? 
_entity_src_gen.pdbx_gene_src_cellular_location    ? 
_entity_src_gen.host_org_common_name               ? 
_entity_src_gen.pdbx_host_org_scientific_name      'Escherichia coli' 
_entity_src_gen.pdbx_host_org_ncbi_taxonomy_id     511693 
_entity_src_gen.host_org_genus                     ? 
_entity_src_gen.pdbx_host_org_gene                 ? 
_entity_src_gen.pdbx_host_org_organ                ? 
_entity_src_gen.host_org_species                   ? 
_entity_src_gen.pdbx_host_org_tissue               ? 
_entity_src_gen.pdbx_host_org_tissue_fraction      ? 
_entity_src_gen.pdbx_host_org_strain               Rosetta 
_entity_src_gen.pdbx_host_org_variant              ? 
_entity_src_gen.pdbx_host_org_cell_line            ? 
_entity_src_gen.pdbx_host_org_atcc                 ? 
_entity_src_gen.pdbx_host_org_culture_collection   ? 
_entity_src_gen.pdbx_host_org_cell                 ? 
_entity_src_gen.pdbx_host_org_organelle            ? 
_entity_src_gen.pdbx_host_org_cellular_location    ? 
_entity_src_gen.pdbx_host_org_vector_type          plasmid 
_entity_src_gen.pdbx_host_org_vector               ? 
_entity_src_gen.host_org_details                   ? 
_entity_src_gen.expression_system_id               ? 
_entity_src_gen.plasmid_name                       pET-SUMO 
_entity_src_gen.plasmid_details                    ? 
_entity_src_gen.pdbx_description                   ? 
1 UNP Q746M7_THET2 Q746M7 1 
1 ? 
2 PDB 4N41         4N41   2 TGAGGTAGTAGGTTGTATAGT 1 ? 
3 PDB 4N41         4N41   3 ACCTACTACCTCG 1 ? 
4 PDB 4N41         4N41   4 AACCTACTACCTCG 1 ? 
1 1 4N41 A 1 ? 685 ? Q746M7 1 ? 685 ? 1 685 
2 1 4N41 B 1 ? 685 ? Q746M7 1 ? 685 ? 1 685 
3 2 4N41 C 1 ? 21  ? 4N41   1 ? 26  ? 1 26  
4 2 4N41 E 1 ? 21  ? 4N41   1 ? 21  ? 1 21  
5 3 4N41 D 1 ? 13  ? 4N41   3 ? 15  ? 3 15  
6 4 4N41 F 1 ? 14  ? 4N41   2 ? 15  ? 2 15  
ALA 'L-peptide linking' y ALANINE                              ? 'C3 H7 N O2'      89.093  
ARG 'L-peptide linking' y ARGININE                             ? 'C6 H15 N4 O2 1'  175.209 
ASN 'L-peptide linking' y ASPARAGINE                           ? 'C4 H8 N2 O3'     132.118 
ASP 'L-peptide linking' y 'ASPARTIC ACID'                      ? 'C4 H7 N O4'      133.103 
CYS 'L-peptide linking' y CYSTEINE                             ? 'C3 H7 N O2 S'    121.158 
DA  'DNA linking'       y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 
DC  'DNA linking'       y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE"  ? 'C9 H14 N3 O7 P'  307.197 
DG  'DNA linking'       y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 
DT  'DNA linking'       y "THYMIDINE-5'-MONOPHOSPHATE"         ? 'C10 H15 N2 O8 P' 322.208 
GLN 'L-peptide linking' y GLUTAMINE                            ? 'C5 H10 N2 O3'    146.144 
GLU 'L-peptide linking' y 'GLUTAMIC ACID'                      ? 'C5 H9 N O4'      147.129 
GLY 'peptide linking'   y GLYCINE                              ? 'C2 H5 N O2'      75.067  
HIS 'L-peptide linking' y HISTIDINE                            ? 'C6 H10 N3 O2 1'  156.162 
HOH non-polymer         . WATER                                ? 'H2 O'            18.015  
ILE 'L-peptide linking' y ISOLEUCINE                           ? 'C6 H13 N O2'     131.173 
LEU 'L-peptide linking' y LEUCINE                              ? 'C6 H13 N O2'     131.173 
LYS 'L-peptide linking' y LYSINE                               ? 'C6 H15 N2 O2 1'  147.195 
MET 'L-peptide linking' y METHIONINE                           ? 'C5 H11 N O2 S'   149.211 
MG  non-polymer         . 'MAGNESIUM ION'                      ? 'Mg 2'            24.305  
PHE 'L-peptide linking' y PHENYLALANINE                        ? 'C9 H11 N O2'     165.189 
PRO 'L-peptide linking' y PROLINE                              ? 'C5 H9 N O2'      115.130 
SER 'L-peptide linking' y SERINE                               ? 'C3 H7 N O3'      105.093 
THR 'L-peptide linking' y THREONINE                            ? 'C4 H9 N O3'      119.119 
TRP 'L-peptide linking' y TRYPTOPHAN                           ? 'C11 H12 N2 O2'   204.225 
TYR 'L-peptide linking' y TYROSINE                             ? 'C9 H11 N O3'     181.189 
VAL 'L-peptide linking' y VALINE                               ? 'C5 H11 N O2'     117.146 
_exptl.crystals_number   1 
_exptl.entry_id          4N41 
_exptl.method            'X-RAY DIFFRACTION' 
#                    1 
_exptl_crystal.density_Matthews      2.65 
_exptl_crystal.density_meas          ? 
_exptl_crystal.density_percent_sol   53.51 
_exptl_crystal.description           ? 
_exptl_crystal.F_000                 ? 
_exptl_crystal.preparation           ? 
_exptl_crystal_grow.crystal_id      1 
_exptl_crystal_grow.method          'VAPOR DIFFUSION, HANGING DROP' 
_exptl_crystal_grow.pH              7.0 
_exptl_crystal_grow.temp            306 
'3.2 M sodium chloride, 0.1 M Tris-HCl, pH 8.5, VAPOR DIFFUSION, HANGING DROP, temperature 306K' 
_exptl_crystal_grow.temp_details    ? 
_exptl_crystal_grow.pdbx_pH_range   ? 
#                     1 
_diffrn.ambient_temp           100 
_diffrn.ambient_temp_details   ? 
_diffrn.crystal_id             1 
_diffrn_detector.diffrn_id              1 
_diffrn_detector.detector               CCD 
_diffrn_detector.type                   'ADSC QUANTUM 315r' 
_diffrn_detector.pdbx_collection_date   2012-11-15 
_diffrn_detector.details                ? 
_diffrn_radiation.diffrn_id                        1 
_diffrn_radiation.pdbx_diffrn_protocol             'SINGLE WAVELENGTH' 
_diffrn_radiation.monochromator                    'double crystal Si(111)' 
_diffrn_radiation.wavelength_id                    1 
_diffrn_radiation.pdbx_monochromatic_or_laue_m_l   M 
_diffrn_radiation.pdbx_scattering_type             x-ray 
#           1 
_diffrn_radiation_wavelength.wavelength   0.97 
_diffrn_radiation_wavelength.wt           1.0 
_diffrn_source.diffrn_id                   1 
_diffrn_source.source                      SYNCHROTRON 
_diffrn_source.type                        'SSRF BEAMLINE BL17U' 
_diffrn_source.pdbx_wavelength_list        0.97 
_diffrn_source.pdbx_wavelength             ? 
_diffrn_source.pdbx_synchrotron_site       SSRF 
_diffrn_source.pdbx_synchrotron_beamline   BL17U 
_reflns.entry_id                     4N41 
_reflns.d_resolution_high            2.248 
_reflns.d_resolution_low             50.0 
_reflns.number_obs                   86435 
_reflns.pdbx_Rmerge_I_obs            0.070 
_reflns.pdbx_netI_over_sigmaI        10.5 
_reflns.pdbx_chi_squared             1.442 
_reflns.pdbx_redundancy              7.4 
_reflns.percent_possible_obs         99.8 
_reflns.B_iso_Wilson_estimate        49.720 
_reflns.observed_criterion_sigma_F   ? 
_reflns.observed_criterion_sigma_I   ? 
_reflns.number_all                   ? 
_reflns.pdbx_Rsym_value              ? 
_reflns.R_free_details               ? 
_reflns.limit_h_max                  ? 
_reflns.limit_h_min                  ? 
_reflns.limit_k_max                  ? 
_reflns.limit_k_min                  ? 
_reflns.limit_l_max                  ? 
_reflns.limit_l_min                  ? 
_reflns.observed_criterion_F_max     ? 
_reflns.observed_criterion_F_min     ? 
_reflns.pdbx_scaling_rejects         ? 
_reflns.pdbx_ordinal                 1 
_reflns.pdbx_diffrn_id               1 
2.248 2.300  ? ? ? 0.772 ? ? 0.842 6.9 ? 5727 98.9  1  1 
2.300 2.360  ? ? ? 0.662 ? ? 0.855 7.4 ? 5745 100.0 2  1 
2.360 2.420  ? ? ? 0.576 ? ? 0.895 7.5 ? 5714 100.0 3  1 
2.420 2.500  ? ? ? 0.487 ? ? 0.939 7.5 ? 5749 100.0 4  1 
2.500 2.580  ? ? ? 0.391 ? ? 0.976 7.5 ? 5757 100.0 5  1 
2.580 2.670  ? ? ? 0.309 ? ? 1.072 7.5 ? 5719 100.0 6  1 
2.670 2.770  ? ? ? 0.237 ? ? 1.228 7.5 ? 5753 100.0 7  1 
2.770 2.900  ? ? ? 0.191 ? ? 1.303 7.5 ? 5757 100.0 8  1 
2.900 3.050  ? ? ? 0.142 ? ? 1.454 7.5 ? 5743 100.0 9  1 
3.050 3.240  ? ? ? 0.108 ? ? 1.647 7.5 ? 5777 100.0 10 1 
3.240 3.500  ? ? ? 0.080 ? ? 1.880 7.5 ? 5790 100.0 11 1 
3.500 3.850  ? ? ? 0.063 ? ? 2.086 7.4 ? 5746 100.0 12 1 
3.850 4.400  ? ? ? 0.056 ? ? 2.519 7.2 ? 5792 99.9  13 1 
4.400 5.550  ? ? ? 0.047 ? ? 2.316 7.1 ? 5818 99.9  14 1 
5.550 50.000 ? ? ? 0.032 ? ? 1.655 7.1 ? 5848 98.9  15 1 
_refine.entry_id                                 4N41 
_refine.ls_d_res_high                            2.248 
_refine.ls_d_res_low                             45.524 
_refine.pdbx_ls_sigma_F                          1.33 
_refine.pdbx_data_cutoff_high_absF               ? 
_refine.pdbx_data_cutoff_low_absF                ? 
_refine.ls_percent_reflns_obs                    99.71 
_refine.ls_number_reflns_obs                     86385 
_refine.ls_number_reflns_all                     ? 
_refine.pdbx_ls_cross_valid_method               ? 
_refine.pdbx_R_Free_selection_details            ? 
_refine.details                                  ? 
_refine.ls_R_factor_all                          ? 
_refine.ls_R_factor_obs                          0.2248 
_refine.ls_R_factor_R_work                       0.2229 
_refine.ls_wR_factor_R_work                      ? 
_refine.ls_R_factor_R_free                       0.2591 
_refine.ls_wR_factor_R_free                      ? 
_refine.ls_percent_reflns_R_free                 5.01 
_refine.ls_number_reflns_R_free                  4330 
_refine.ls_R_factor_R_free_error                 ? 
_refine.B_iso_mean                               68.4624 
_refine.solvent_model_param_bsol                 ? 
_refine.solvent_model_param_ksol                 ? 
_refine.pdbx_isotropic_thermal_model             ? 
_refine.aniso_B[1][1]                            ? 
_refine.aniso_B[2][2]                            ? 
_refine.aniso_B[3][3]                            ? 
_refine.aniso_B[1][2]                            ? 
_refine.aniso_B[1][3]                            ? 
_refine.aniso_B[2][3]                            ? 
_refine.correlation_coeff_Fo_to_Fc               ? 
_refine.correlation_coeff_Fo_to_Fc_free          ? 
_refine.overall_SU_R_Cruickshank_DPI             ? 
_refine.overall_SU_R_free                        ? 
_refine.pdbx_overall_ESU_R                       ? 
_refine.pdbx_overall_ESU_R_Free                  ? 
_refine.overall_SU_ML                            0.2900 
_refine.overall_SU_B                             ? 
_refine.solvent_model_details                    'FLAT BULK SOLVENT MODEL' 
_refine.pdbx_solvent_vdw_probe_radii             1.1100 
_refine.pdbx_solvent_ion_probe_radii             ? 
_refine.pdbx_solvent_shrinkage_radii             0.9000 
_refine.ls_number_parameters                     ? 
_refine.ls_number_restraints                     ? 
_refine.pdbx_starting_model                      'PDB ENTRY 3F73' 
_refine.pdbx_method_to_determine_struct          'MOLECULAR REPLACEMENT' 
_refine.pdbx_stereochemistry_target_values       ML 
_refine.pdbx_stereochem_target_val_spec_case     ? 
_refine.overall_FOM_work_R_set                   0.7809 
_refine.B_iso_max                                139.480 
_refine.B_iso_min                                20.000 
_refine.pdbx_overall_phase_error                 28.9200 
_refine.occupancy_max                            1.000 
_refine.occupancy_min                            0.410 
_refine.pdbx_ls_sigma_I                          ? 
_refine.ls_redundancy_reflns_obs                 ? 
_refine.ls_R_factor_R_free_error_details         ? 
_refine.pdbx_data_cutoff_high_rms_absF           ? 
_refine.overall_FOM_free_R_set                   ? 
_refine.pdbx_diffrn_id                           1 
_refine.pdbx_refine_id                           'X-RAY DIFFRACTION' 
_refine.pdbx_TLS_residual_ADP_flag               ? 
_refine.pdbx_overall_SU_R_free_Cruickshank_DPI   ? 
_refine.pdbx_overall_SU_R_Blow_DPI               ? 
_refine.pdbx_overall_SU_R_free_Blow_DPI          ? 
_refine_hist.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_refine_hist.cycle_id                         LAST 
_refine_hist.pdbx_number_atoms_protein        10062 
_refine_hist.pdbx_number_atoms_nucleic_acid   1189 
_refine_hist.pdbx_number_atoms_ligand         3 
_refine_hist.number_atoms_solvent             170 
_refine_hist.number_atoms_total               11424 
_refine_hist.d_res_high                       2.248 
_refine_hist.d_res_low                        45.524 
f_bond_d           11689 0.011  ? ? ? 'X-RAY DIFFRACTION' 
f_angle_d          16151 1.274  ? ? ? 'X-RAY DIFFRACTION' 
f_chiral_restr     1793  0.060  ? ? ? 'X-RAY DIFFRACTION' 
f_plane_restr      1899  0.006  ? ? ? 'X-RAY DIFFRACTION' 
f_dihedral_angle_d 4321  15.564 ? ? ? 'X-RAY DIFFRACTION' 
1 'X-RAY DIFFRACTION' 1 1 TORSIONAL A 5333 10.428 ? ? ? ? ? ? ? 
2 'X-RAY DIFFRACTION' 1 2 TORSIONAL B 5333 10.428 ? ? ? ? ? ? ? 
3 'X-RAY DIFFRACTION' 2 1 TORSIONAL C 504  10.428 ? ? ? ? ? ? ? 
4 'X-RAY DIFFRACTION' 2 2 TORSIONAL D 504  10.428 ? ? ? ? ? ? ? 
5 'X-RAY DIFFRACTION' 2 3 TORSIONAL E 504  10.428 ? ? ? ? ? ? ? 
6 'X-RAY DIFFRACTION' 2 4 TORSIONAL F 504  10.428 ? ? ? ? ? ? ? 
2.248  2.2736  30 95.0  2622 . 0.2803 0.3273 . 141 . 2763 . . 'X-RAY DIFFRACTION' 
2.2736 2.3004  30 100.0 2722 . 0.2661 0.3091 . 152 . 2874 . . 'X-RAY DIFFRACTION' 
2.3004 2.3284  30 100.0 2721 . 0.2572 0.2795 . 128 . 2849 . . 'X-RAY DIFFRACTION' 
2.3284 2.3579  30 100.0 2761 . 0.2527 0.3007 . 149 . 2910 . . 'X-RAY DIFFRACTION' 
2.3579 2.3889  30 100.0 2726 . 0.2580 0.3003 . 136 . 2862 . . 'X-RAY DIFFRACTION' 
2.3889 2.4216  30 100.0 2688 . 0.2641 0.3100 . 147 . 2835 . . 'X-RAY DIFFRACTION' 
2.4216 2.4562  30 100.0 2737 . 0.2659 0.3451 . 154 . 2891 . . 'X-RAY DIFFRACTION' 
2.4562 2.4929  30 100.0 2720 . 0.2597 0.3625 . 150 . 2870 . . 'X-RAY DIFFRACTION' 
2.4929 2.5318  30 100.0 2695 . 0.2495 0.3111 . 148 . 2843 . . 'X-RAY DIFFRACTION' 
2.5318 2.5733  30 100.0 2792 . 0.2467 0.3030 . 137 . 2929 . . 'X-RAY DIFFRACTION' 
2.5733 2.6177  30 100.0 2713 . 0.2506 0.2780 . 153 . 2866 . . 'X-RAY DIFFRACTION' 
2.6177 2.6653  30 100.0 2732 . 0.2539 0.3537 . 125 . 2857 . . 'X-RAY DIFFRACTION' 
2.6653 2.7166  30 100.0 2762 . 0.2481 0.3341 . 133 . 2895 . . 'X-RAY DIFFRACTION' 
2.7166 2.7720  30 100.0 2687 . 0.2403 0.2847 . 155 . 2842 . . 'X-RAY DIFFRACTION' 
2.7720 2.8323  30 100.0 2795 . 0.2394 0.3389 . 136 . 2931 . . 'X-RAY DIFFRACTION' 
2.8323 2.8981  30 100.0 2690 . 0.2366 0.2616 . 154 . 2844 . . 'X-RAY DIFFRACTION' 
2.8981 2.9706  30 100.0 2760 . 0.2421 0.2737 . 144 . 2904 . . 'X-RAY DIFFRACTION' 
2.9706 3.0509  30 100.0 2691 . 0.2449 0.3095 . 152 . 2843 . . 'X-RAY DIFFRACTION' 
3.0509 3.1407  30 100.0 2763 . 0.2590 0.2625 . 139 . 2902 . . 'X-RAY DIFFRACTION' 
3.1407 3.2420  30 100.0 2742 . 0.2557 0.3100 . 134 . 2876 . . 'X-RAY DIFFRACTION' 
3.2420 3.3579  30 100.0 2756 . 0.2388 0.3080 . 128 . 2884 . . 'X-RAY DIFFRACTION' 
3.3579 3.4923  30 100.0 2789 . 0.2448 0.2662 . 126 . 2915 . . 'X-RAY DIFFRACTION' 
3.4923 3.6511  30 100.0 2740 . 0.2253 0.2842 . 130 . 2870 . . 'X-RAY DIFFRACTION' 
3.6511 3.8435  30 100.0 2726 . 0.2184 0.2536 . 153 . 2879 . . 'X-RAY DIFFRACTION' 
3.8435 4.0842  30 100.0 2760 . 0.2175 0.2473 . 150 . 2910 . . 'X-RAY DIFFRACTION' 
4.0842 4.3993  30 100.0 2714 . 0.1891 0.2160 . 170 . 2884 . . 'X-RAY DIFFRACTION' 
4.3993 4.8416  30 100.0 2760 . 0.1930 0.2062 . 135 . 2895 . . 'X-RAY DIFFRACTION' 
4.8416 5.5411  30 100.0 2773 . 0.2033 0.2346 . 147 . 2920 . . 'X-RAY DIFFRACTION' 
5.5411 6.9772  30 100.0 2762 . 0.2200 0.2601 . 168 . 2930 . . 'X-RAY DIFFRACTION' 
6.9772 45.5337 30 98.0  2756 . 0.1930 0.2093 . 156 . 2912 . . 'X-RAY DIFFRACTION' 
1 1 'chain A and segid A' 
1 2 'chain B and segid B' 
2 1 'chain C and segid C' 
2 2 'chain D and segid D' 
2 3 'chain E and segid E' 
2 4 'chain F and segid F' 
1 1 1 ? A 0 A 0 'chain A and segid A' ? ? ? ? ? ? ? ? 
1 2 1 ? B 0 B 0 'chain B and segid B' ? ? ? ? ? ? ? ? 
2 1 1 ? C 0 C 0 'chain C and segid C' ? ? ? ? ? ? ? ? 
2 2 1 ? D 0 D 0 'chain D and segid D' ? ? ? ? ? ? ? ? 
2 3 1 ? E 0 E 0 'chain E and segid E' ? ? ? ? ? ? ? ? 
2 4 1 ? F 0 F 0 'chain F and segid F' ? ? ? ? ? ? ? ? 
1 ? 
2 ? 
_struct.entry_id                  4N41 
_struct.title                     'Structure of Thermus thermophilus Argonaute bound to guide DNA and 15-mer target DNA' 
_struct.pdbx_descriptor           Argonaute 
_struct.pdbx_model_details        ? 
_struct.pdbx_CASP_flag            ? 
_struct.pdbx_model_type_details   ? 
_struct_keywords.entry_id        4N41 
_struct_keywords.text            'Argonaute, RNA interference, DNA interference, NUCLEAR PROTEIN-DNA complex' 
_struct_keywords.pdbx_keywords   'NUCLEAR PROTEIN/DNA' 
A N N 1 ? 
B N N 1 ? 
C N N 2 ? 
D N N 2 ? 
E N N 3 ? 
F N N 4 ? 
G N N 5 ? 
H N N 5 ? 
I N N 5 ? 
J N N 6 ? 
K N N 6 ? 
L N N 6 ? 
M N N 6 ? 
N N N 6 ? 
O N N 6 ? 
#        1 
_struct_biol.details   ? 
HELX_P HELX_P1  1  ASN A 20  ? ARG A 25  ? ASN A 20  ARG A 25  1 ? 6  
HELX_P HELX_P2  2  LEU A 45  ? GLY A 54  ? LEU A 45  GLY A 54  1 ? 10 
HELX_P HELX_P3  3  PRO A 69  ? LEU A 73  ? PRO A 69  LEU A 73  5 ? 5  
HELX_P HELX_P4  4  ASP A 102 ? ARG A 123 ? ASP A 102 ARG A 123 1 ? 22 
HELX_P HELX_P5  5  SER A 178 ? ALA A 184 ? SER A 178 ALA A 184 1 ? 7  
HELX_P HELX_P6  6  LEU A 224 ? SER A 229 ? LEU A 224 SER A 229 1 ? 6  
HELX_P HELX_P7  7  PRO A 282 ? GLY A 302 ? PRO A 282 GLY A 302 1 ? 21 
HELX_P HELX_P8  8  LYS A 329 ? ALA A 331 ? LYS A 329 ALA A 331 5 ? 3  
HELX_P HELX_P9  9  ASP A 332 ? GLY A 337 ? ASP A 332 GLY A 337 1 ? 6  
HELX_P HELX_P10 10 PRO A 358 ? SER A 372 ? PRO A 358 SER A 372 1 ? 15 
HELX_P HELX_P11 11 HIS A 384 ? GLN A 387 ? HIS A 384 GLN A 387 5 ? 4  
HELX_P HELX_P12 12 GLY A 388 ? GLU A 401 ? GLY A 388 GLU A 401 1 ? 14 
HELX_P HELX_P13 13 ALA A 414 ? GLU A 428 ? ALA A 414 GLU A 428 1 ? 15 
HELX_P HELX_P14 14 GLU A 443 ? ALA A 458 ? GLU A 443 ALA A 458 1 ? 16 
HELX_P HELX_P15 15 ILE A 514 ? GLY A 535 ? ILE A 514 GLY A 535 1 ? 22 
HELX_P HELX_P16 16 PRO A 550 ? GLU A 553 ? PRO A 550 GLU A 553 5 ? 4  
HELX_P HELX_P17 17 PHE A 554 ? GLU A 564 ? PHE A 554 GLU A 564 1 ? 11 
HELX_P HELX_P18 18 ARG A 608 ? GLY A 612 ? ARG A 608 GLY A 612 5 ? 5  
HELX_P HELX_P19 19 PRO A 627 ? THR A 639 ? PRO A 627 THR A 639 1 ? 13 
HELX_P HELX_P20 20 PRO A 653 ? GLY A 670 ? PRO A 653 GLY A 670 1 ? 18 
HELX_P HELX_P21 21 GLU B 41  ? GLY B 54  ? GLU B 41  GLY B 54  1 ? 14 
HELX_P HELX_P22 22 PRO B 69  ? LEU B 73  ? PRO B 69  LEU B 73  5 ? 5  
HELX_P HELX_P23 23 ASP B 102 ? ARG B 123 ? ASP B 102 ARG B 123 1 ? 22 
HELX_P HELX_P24 24 SER B 178 ? GLN B 185 ? SER B 178 GLN B 185 1 ? 8  
HELX_P HELX_P25 25 SER B 222 ? SER B 229 ? SER B 222 SER B 229 1 ? 8  
HELX_P HELX_P26 26 PRO B 282 ? GLY B 302 ? PRO B 282 GLY B 302 1 ? 21 
HELX_P HELX_P27 27 LYS B 329 ? ALA B 331 ? LYS B 329 ALA B 331 5 ? 3  
HELX_P HELX_P28 28 ASP B 332 ? GLY B 337 ? ASP B 332 GLY B 337 1 ? 6  
HELX_P HELX_P29 29 PRO B 358 ? GLY B 373 ? PRO B 358 GLY B 373 1 ? 16 
HELX_P HELX_P30 30 HIS B 384 ? GLN B 387 ? HIS B 384 GLN B 387 5 ? 4  
HELX_P HELX_P31 31 GLY B 388 ? GLY B 402 ? GLY B 388 GLY B 402 1 ? 15 
HELX_P HELX_P32 32 ALA B 414 ? GLU B 428 ? ALA B 414 GLU B 428 1 ? 15 
HELX_P HELX_P33 33 GLU B 443 ? ALA B 458 ? GLU B 443 ALA B 458 1 ? 16 
HELX_P HELX_P34 34 SER B 484 ? GLY B 488 ? SER B 484 GLY B 488 5 ? 5  
HELX_P HELX_P35 35 ILE B 514 ? ALA B 534 ? ILE B 514 ALA B 534 1 ? 21 
HELX_P HELX_P36 36 PRO B 550 ? GLU B 553 ? PRO B 550 GLU B 553 5 ? 4  
HELX_P HELX_P37 37 PHE B 554 ? GLU B 564 ? PHE B 554 GLU B 564 1 ? 11 
HELX_P HELX_P38 38 PRO B 627 ? THR B 639 ? PRO B 627 THR B 639 1 ? 13 
HELX_P HELX_P39 39 ARG B 640 ? TYR B 642 ? ARG B 640 TYR B 642 5 ? 3  
HELX_P HELX_P40 40 PRO B 653 ? GLY B 670 ? PRO B 653 GLY B 670 1 ? 18 
#          HELX_P 
_struct_conf_type.criteria    ? 
_struct_conf_type.reference   ? 
metalc1  metalc ? ? C DT  1   OP3 ? ? ? 1_555 H MG  .  MG ? ? C DT  1   C MG  101 1_555 ? ? ? ? ? ? ?            1.924 ? 
metalc2  metalc ? ? D DT  1   OP3 ? ? ? 1_555 I MG  .  MG ? ? E DT  1   E MG  101 1_555 ? ? ? ? ? ? ?            1.973 ? 
metalc3  metalc ? ? C DA  3   OP1 ? ? ? 1_555 H MG  .  MG ? ? C DA  3   C MG  101 1_555 ? ? ? ? ? ? ?            1.976 ? 
metalc4  metalc ? ? B VAL 685 OXT ? ? ? 1_555 I MG  .  MG ? ? B VAL 685 E MG  101 1_555 ? ? ? ? ? ? ?            2.004 ? 
metalc5  metalc ? ? H MG  .   MG  ? ? ? 1_555 J HOH .  O  ? ? C MG  101 A HOH 735 1_555 ? ? ? ? ? ? ?            2.014 ? 
metalc6  metalc ? ? H MG  .   MG  ? ? ? 1_555 L HOH .  O  ? ? C MG  101 C HOH 205 1_555 ? ? ? ? ? ? ?            2.030 ? 
metalc7  metalc ? ? D DA  3   OP1 ? ? ? 1_555 I MG  .  MG ? ? E DA  3   E MG  101 1_555 ? ? ? ? ? ? ?            2.038 ? 
metalc8  metalc ? ? G MG  .   MG  ? ? ? 1_555 K HOH .  O  ? ? B MG  701 B HOH 808 1_555 ? ? ? ? ? ? ?            2.072 ? 
metalc9  metalc ? ? I MG  .   MG  ? ? ? 1_555 M HOH .  O  ? ? E MG  101 E HOH 203 1_555 ? ? ? ? ? ? ?            2.089 ? 
metalc10 metalc ? ? B VAL 685 O   ? ? ? 1_555 I MG  .  MG ? ? B VAL 685 E MG  101 1_555 ? ? ? ? ? ? ?            2.192 ? 
metalc11 metalc ? ? B ASP 660 OD2 ? ? ? 1_555 G MG  .  MG ? ? B ASP 660 B MG  701 1_555 ? ? ? ? ? ? ?            2.198 ? 
metalc12 metalc ? ? A VAL 685 OXT ? ? ? 1_555 H MG  .  MG ? ? A VAL 685 C MG  101 1_555 ? ? ? ? ? ? ?            2.279 ? 
metalc13 metalc ? ? A VAL 685 O   ? ? ? 1_555 H MG  .  MG ? ? A VAL 685 C MG  101 1_555 ? ? ? ? ? ? ?            2.281 ? 
metalc14 metalc ? ? B ASP 478 OD1 ? ? ? 1_555 G MG  .  MG ? ? B ASP 478 B MG  701 1_555 ? ? ? ? ? ? ?            2.333 ? 
metalc15 metalc ? ? B ASP 478 OD2 ? ? ? 1_555 G MG  .  MG ? ? B ASP 478 B MG  701 1_555 ? ? ? ? ? ? ?            2.511 ? 
metalc16 metalc ? ? F DT  5   OP1 ? ? ? 1_555 G MG  .  MG ? ? F DT  6   B MG  701 1_555 ? ? ? ? ? ? ?            2.606 ? 
hydrog1  hydrog ? ? C DG  2   N1  ? ? ? 1_555 E DC  12 N3 ? ? C DG  2   D DC  14  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog2  hydrog ? ? C DG  2   N2  ? ? ? 1_555 E DC  12 O2 ? ? C DG  2   D DC  14  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog3  hydrog ? ? C DG  2   O6  ? ? ? 1_555 E DC  12 N4 ? ? C DG  2   D DC  14  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog4  hydrog ? ? C DA  3   N1  ? ? ? 1_555 E DT  11 N3 ? ? C DA  3   D DT  13  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog5  hydrog ? ? C DA  3   N6  ? ? ? 1_555 E DT  11 O4 ? ? C DA  3   D DT  13  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog6  hydrog ? ? C DG  4   N1  ? ? ? 1_555 E DC  10 N3 ? ? C DG  4   D DC  12  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog7  hydrog ? ? C DG  4   N2  ? ? ? 1_555 E DC  10 O2 ? ? C DG  4   D DC  12  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog8  hydrog ? ? C DG  4   O6  ? ? ? 1_555 E DC  10 N4 ? ? C DG  4   D DC  12  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog9  hydrog ? ? C DG  5   N1  ? ? ? 1_555 E DC  9  N3 ? ? C DG  5   D DC  11  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog10 hydrog ? ? C DG  5   N2  ? ? ? 1_555 E DC  9  O2 ? ? C DG  5   D DC  11  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog11 hydrog ? ? C DG  5   O6  ? ? ? 1_555 E DC  9  N4 ? ? C DG  5   D DC  11  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog12 hydrog ? ? C DT  6   N3  ? ? ? 1_555 E DA  8  N1 ? ? C DT  6   D DA  10  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog13 hydrog ? ? C DT  6   O4  ? ? ? 1_555 E DA  8  N6 ? ? C DT  6   D DA  10  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog14 hydrog ? ? C DA  7   N1  ? ? ? 1_555 E DT  7  N3 ? ? C DA  7   D DT  9   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog15 hydrog ? ? C DA  7   N6  ? ? ? 1_555 E DT  7  O4 ? ? C DA  7   D DT  9   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog16 hydrog ? ? C DG  8   N1  ? ? ? 1_555 E DC  6  N3 ? ? C DG  8   D DC  8   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog17 hydrog ? ? C DG  8   N2  ? ? ? 1_555 E DC  6  O2 ? ? C DG  8   D DC  8   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog18 hydrog ? ? C DG  8   O6  ? ? ? 1_555 E DC  6  N4 ? ? C DG  8   D DC  8   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog19 hydrog ? ? C DT  9   N3  ? ? ? 1_555 E DA  5  N1 ? ? C DT  9   D DA  7   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog20 hydrog ? ? C DT  9   O4  ? ? ? 1_555 E DA  5  N6 ? ? C DT  9   D DA  7   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog21 hydrog ? ? C DA  10  N1  ? ? ? 1_555 E DT  4  N3 ? ? C DA  10  D DT  6   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog22 hydrog ? ? C DA  10  N6  ? ? ? 1_555 E DT  4  O4 ? ? C DA  10  D DT  6   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog23 hydrog ? ? C DG  11  N1  ? ? ? 1_555 E DC  3  N3 ? ? C DG  11  D DC  5   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog24 hydrog ? ? C DG  11  N2  ? ? ? 1_555 E DC  3  O2 ? ? C DG  11  D DC  5   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog25 hydrog ? ? C DG  11  O6  ? ? ? 1_555 E DC  3  N4 ? ? C DG  11  D DC  5   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog26 hydrog ? ? C DG  12  N1  ? ? ? 1_555 E DC  2  N3 ? ? C DG  12  D DC  4   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog27 hydrog ? ? C DG  12  N2  ? ? ? 1_555 E DC  2  O2 ? ? C DG  12  D DC  4   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog28 hydrog ? ? C DG  12  O6  ? ? ? 1_555 E DC  2  N4 ? ? C DG  12  D DC  4   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog29 hydrog ? ? C DT  13  N3  ? ? ? 1_555 E DA  1  N1 ? ? C DT  13  D DA  3   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog30 hydrog ? ? C DT  13  O4  ? ? ? 1_555 E DA  1  N6 ? ? C DT  13  D DA  3   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog31 hydrog ? ? D DG  2   N1  ? ? ? 1_555 F DC  13 N3 ? ? E DG  2   F DC  14  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog32 hydrog ? ? D DG  2   N2  ? ? ? 1_555 F DC  13 O2 ? ? E DG  2   F DC  14  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog33 hydrog ? ? D DG  2   O6  ? ? ? 1_555 F DC  13 N4 ? ? E DG  2   F DC  14  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog34 hydrog ? ? D DA  3   N1  ? ? ? 1_555 F DT  12 N3 ? ? E DA  3   F DT  13  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog35 hydrog ? ? D DA  3   N6  ? ? ? 1_555 F DT  12 O4 ? ? E DA  3   F DT  13  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog36 hydrog ? ? D DG  4   N1  ? ? ? 1_555 F DC  11 N3 ? ? E DG  4   F DC  12  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog37 hydrog ? ? D DG  4   N2  ? ? ? 1_555 F DC  11 O2 ? ? E DG  4   F DC  12  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog38 hydrog ? ? D DG  4   O6  ? ? ? 1_555 F DC  11 N4 ? ? E DG  4   F DC  12  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog39 hydrog ? ? D DG  5   N1  ? ? ? 1_555 F DC  10 N3 ? ? E DG  5   F DC  11  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog40 hydrog ? ? D DG  5   N2  ? ? ? 1_555 F DC  10 O2 ? ? E DG  5   F DC  11  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog41 hydrog ? ? D DG  5   O6  ? ? ? 1_555 F DC  10 N4 ? ? E DG  5   F DC  11  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog42 hydrog ? ? D DT  6   N3  ? ? ? 1_555 F DA  9  N1 ? ? E DT  6   F DA  10  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog43 hydrog ? ? D DT  6   O4  ? ? ? 1_555 F DA  9  N6 ? ? E DT  6   F DA  10  1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog44 hydrog ? ? D DA  7   N1  ? ? ? 1_555 F DT  8  N3 ? ? E DA  7   F DT  9   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog45 hydrog ? ? D DA  7   N6  ? ? ? 1_555 F DT  8  O4 ? ? E DA  7   F DT  9   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog46 hydrog ? ? D DG  8   N1  ? ? ? 1_555 F DC  7  N3 ? ? E DG  8   F DC  8   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog47 hydrog ? ? D DG  8   N2  ? ? ? 1_555 F DC  7  O2 ? ? E DG  8   F DC  8   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog48 hydrog ? ? D DG  8   O6  ? ? ? 1_555 F DC  7  N4 ? ? E DG  8   F DC  8   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog49 hydrog ? ? D DT  9   N3  ? ? ? 1_555 F DA  6  N1 ? ? E DT  9   F DA  7   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog50 hydrog ? ? D DT  9   O4  ? ? ? 1_555 F DA  6  N6 ? ? E DT  9   F DA  7   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog51 hydrog ? ? D DA  10  N1  ? ? ? 1_555 F DT  5  N3 ? ? E DA  10  F DT  6   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog52 hydrog ? ? D DA  10  N6  ? ? ? 1_555 F DT  5  O4 ? ? E DA  10  F DT  6   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog53 hydrog ? ? D DG  11  N1  ? ? ? 1_555 F DC  4  N3 ? ? E DG  11  F DC  5   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog54 hydrog ? ? D DG  11  N2  ? ? ? 1_555 F DC  4  O2 ? ? E DG  11  F DC  5   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog55 hydrog ? ? D DG  11  O6  ? ? ? 1_555 F DC  4  N4 ? ? E DG  11  F DC  5   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog56 hydrog ? ? D DG  12  N1  ? ? ? 1_555 F DC  3  N3 ? ? E DG  12  F DC  4   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog57 hydrog ? ? D DG  12  N2  ? ? ? 1_555 F DC  3  O2 ? ? E DG  12  F DC  4   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog58 hydrog ? ? D DG  12  O6  ? ? ? 1_555 F DC  3  N4 ? ? E DG  12  F DC  4   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog59 hydrog ? ? D DT  13  N3  ? ? ? 1_555 F DA  2  N1 ? ? E DT  13  F DA  3   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog60 hydrog ? ? D DT  13  O4  ? ? ? 1_555 F DA  2  N6 ? ? E DT  13  F DA  3   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog61 hydrog ? ? D DT  14  N3  ? ? ? 1_555 F DA  1  N1 ? ? E DT  14  F DA  2   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
hydrog62 hydrog ? ? D DT  14  O4  ? ? ? 1_555 F DA  1  N6 ? ? E DT  14  F DA  2   1_555 ? ? ? ? ? ? WATSON-CRICK ?     ? 
metalc ? ? 
hydrog ? ? 
1 ASP 34  A . ? ASP 34  A PRO 35  A ? PRO 35  A 1 -4.08 
2 GLY 142 A . ? GLY 142 A PRO 143 A ? PRO 143 A 1 -4.37 
3 VAL 437 A . ? VAL 437 A PRO 438 A ? PRO 438 A 1 2.97  
4 ASP 34  B . ? ASP 34  B PRO 35  B ? PRO 35  B 1 3.47  
5 GLY 142 B . ? GLY 142 B PRO 143 B ? PRO 143 B 1 -6.12 
A ? 14 ? 
B ? 6  ? 
C ? 4  ? 
D ? 5  ? 
E ? 2  ? 
F ? 4  ? 
G ? 14 ? 
H ? 6  ? 
I ? 5  ? 
J ? 5  ? 
K ? 2  ? 
L ? 4  ? 
A 1  2  ? anti-parallel 
A 2  3  ? anti-parallel 
A 3  4  ? anti-parallel 
A 4  5  ? anti-parallel 
A 5  6  ? anti-parallel 
A 6  7  ? anti-parallel 
A 7  8  ? anti-parallel 
A 8  9  ? anti-parallel 
A 9  10 ? anti-parallel 
A 10 11 ? parallel      
A 11 12 ? parallel      
A 12 13 ? anti-parallel 
A 13 14 ? anti-parallel 
B 1  2  ? anti-parallel 
B 2  3  ? anti-parallel 
B 3  4  ? anti-parallel 
B 4  5  ? anti-parallel 
B 5  6  ? anti-parallel 
C 1  2  ? anti-parallel 
C 2  3  ? anti-parallel 
C 3  4  ? anti-parallel 
D 1  2  ? anti-parallel 
D 2  3  ? anti-parallel 
D 3  4  ? anti-parallel 
D 4  5  ? anti-parallel 
E 1  2  ? anti-parallel 
F 1  2  ? parallel      
F 2  3  ? parallel      
F 3  4  ? parallel      
G 1  2  ? anti-parallel 
G 2  3  ? anti-parallel 
G 3  4  ? anti-parallel 
G 4  5  ? anti-parallel 
G 5  6  ? anti-parallel 
G 6  7  ? anti-parallel 
G 7  8  ? anti-parallel 
G 8  9  ? anti-parallel 
G 9  10 ? anti-parallel 
G 10 11 ? parallel      
G 11 12 ? parallel      
G 12 13 ? anti-parallel 
G 13 14 ? anti-parallel 
H 1  2  ? anti-parallel 
H 2  3  ? anti-parallel 
H 3  4  ? anti-parallel 
H 4  5  ? anti-parallel 
H 5  6  ? anti-parallel 
I 1  2  ? anti-parallel 
I 2  3  ? anti-parallel 
I 3  4  ? anti-parallel 
I 4  5  ? anti-parallel 
J 1  2  ? anti-parallel 
J 2  3  ? anti-parallel 
J 3  4  ? anti-parallel 
J 4  5  ? anti-parallel 
K 1  2  ? anti-parallel 
L 1  2  ? parallel      
L 2  3  ? parallel      
L 3  4  ? parallel      
A 1  TRP A 128 ? GLU A 130 ? TRP A 128 GLU A 130 
A 2  ALA A 133 ? ARG A 141 ? ALA A 133 ARG A 141 
A 3  TRP A 145 ? VAL A 157 ? TRP A 145 VAL A 157 
A 4  ALA A 162 ? CYS A 175 ? ALA A 162 CYS A 175 
A 5  LYS A 6   ? PRO A 18  ? LYS A 6   PRO A 18  
A 6  GLU A 307 ? ARG A 315 ? GLU A 307 ARG A 315 
A 7  LEU A 592 ? PRO A 595 ? LEU A 592 PRO A 595 
A 8  THR A 600 ? LEU A 604 ? THR A 600 LEU A 604 
A 9  LEU A 617 ? ALA A 623 ? LEU A 617 ALA A 623 
A 10 ALA A 567 ? ARG A 574 ? ALA A 567 ARG A 574 
A 11 ARG A 540 ? ARG A 545 ? ARG A 540 ARG A 545 
A 12 LEU A 473 ? ASP A 478 ? LEU A 473 ASP A 478 
A 13 ALA A 490 ? GLY A 495 ? ALA A 490 GLY A 495 
A 14 LEU A 501 ? THR A 504 ? LEU A 501 THR A 504 
B 1  TRP A 128 ? GLU A 130 ? TRP A 128 GLU A 130 
B 2  ALA A 133 ? ARG A 141 ? ALA A 133 ARG A 141 
B 3  TRP A 145 ? VAL A 157 ? TRP A 145 VAL A 157 
B 4  ALA A 162 ? CYS A 175 ? ALA A 162 CYS A 175 
B 5  LYS A 6   ? PRO A 18  ? LYS A 6   PRO A 18  
B 6  VAL A 581 ? PRO A 583 ? VAL A 581 PRO A 583 
C 1  THR A 57  ? MET A 60  ? THR A 57  MET A 60  
C 2  GLY A 63  ? SER A 66  ? GLY A 63  SER A 66  
C 3  TRP A 27  ? VAL A 32  ? TRP A 27  VAL A 32  
C 4  ARG A 89  ? ARG A 95  ? ARG A 89  ARG A 95  
D 1  PRO A 253 ? LEU A 257 ? PRO A 253 LEU A 257 
D 2  VAL A 241 ? ALA A 245 ? VAL A 241 ALA A 245 
D 3  THR A 201 ? GLY A 208 ? THR A 201 GLY A 208 
D 4  ARG A 192 ? ASN A 195 ? ARG A 192 ASN A 195 
D 5  LEU A 261 ? PRO A 263 ? LEU A 261 PRO A 263 
E 1  LEU A 321 ? MET A 322 ? LEU A 321 MET A 322 
E 2  ALA A 464 ? LEU A 465 ? ALA A 464 LEU A 465 
F 1  LEU A 376 ? THR A 380 ? LEU A 376 THR A 380 
F 2  THR A 344 ? ARG A 350 ? THR A 344 ARG A 350 
F 3  ALA A 405 ? THR A 410 ? ALA A 405 THR A 410 
F 4  SER A 432 ? ASN A 436 ? SER A 432 ASN A 436 
G 1  TRP B 128 ? GLU B 130 ? TRP B 128 GLU B 130 
G 2  ALA B 133 ? ARG B 141 ? ALA B 133 ARG B 141 
G 3  TRP B 145 ? VAL B 157 ? TRP B 145 VAL B 157 
G 4  ALA B 162 ? CYS B 175 ? ALA B 162 CYS B 175 
G 5  LYS B 6   ? PRO B 18  ? LYS B 6   PRO B 18  
G 6  GLU B 307 ? ARG B 315 ? GLU B 307 ARG B 315 
G 7  LEU B 592 ? PRO B 595 ? LEU B 592 PRO B 595 
G 8  THR B 600 ? LEU B 604 ? THR B 600 LEU B 604 
G 9  LEU B 617 ? ALA B 623 ? LEU B 617 ALA B 623 
G 10 ALA B 567 ? ARG B 574 ? ALA B 567 ARG B 574 
G 11 ARG B 540 ? ARG B 545 ? ARG B 540 ARG B 545 
G 12 LEU B 473 ? ASP B 478 ? LEU B 473 ASP B 478 
G 13 ALA B 490 ? VAL B 494 ? ALA B 490 VAL B 494 
G 14 LEU B 502 ? THR B 504 ? LEU B 502 THR B 504 
H 1  TRP B 128 ? GLU B 130 ? TRP B 128 GLU B 130 
H 2  ALA B 133 ? ARG B 141 ? ALA B 133 ARG B 141 
H 3  TRP B 145 ? VAL B 157 ? TRP B 145 VAL B 157 
H 4  ALA B 162 ? CYS B 175 ? ALA B 162 CYS B 175 
H 5  LYS B 6   ? PRO B 18  ? LYS B 6   PRO B 18  
H 6  VAL B 581 ? PRO B 583 ? VAL B 581 PRO B 583 
I 1  THR B 57  ? MET B 60  ? THR B 57  MET B 60  
I 2  GLY B 63  ? SER B 66  ? GLY B 63  SER B 66  
I 3  TRP B 27  ? ASP B 34  ? TRP B 27  ASP B 34  
I 4  GLN B 84  ? ARG B 95  ? GLN B 84  ARG B 95  
I 5  GLU B 76  ? ARG B 81  ? GLU B 76  ARG B 81  
J 1  ASP B 249 ? LEU B 257 ? ASP B 249 LEU B 257 
J 2  VAL B 241 ? ASP B 246 ? VAL B 241 ASP B 246 
J 3  THR B 201 ? GLY B 208 ? THR B 201 GLY B 208 
J 4  ARG B 192 ? ASN B 195 ? ARG B 192 ASN B 195 
J 5  LEU B 261 ? VAL B 264 ? LEU B 261 VAL B 264 
K 1  LEU B 321 ? MET B 322 ? LEU B 321 MET B 322 
K 2  ALA B 464 ? LEU B 465 ? ALA B 464 LEU B 465 
L 1  LEU B 376 ? THR B 380 ? LEU B 376 THR B 380 
L 2  THR B 344 ? ARG B 350 ? THR B 344 ARG B 350 
L 3  ALA B 405 ? THR B 410 ? ALA B 405 THR B 410 
L 4  SER B 432 ? ASN B 436 ? SER B 432 ASN B 436 
A 1  2  N GLU A 130 ? N GLU A 130 O ALA A 133 ? O ALA A 133 
A 2  3  N HIS A 139 ? N HIS A 139 O VAL A 147 ? O VAL A 147 
A 3  4  N ARG A 146 ? N ARG A 146 O LEU A 174 ? O LEU A 174 
A 4  5  O LEU A 165 ? O LEU A 165 N PHE A 14  ? N PHE A 14  
A 5  6  N ALA A 15  ? N ALA A 15  O GLU A 307 ? O GLU A 307 
A 6  7  N TYR A 314 ? N TYR A 314 O TYR A 593 ? O TYR A 593 
A 7  8  N LEU A 592 ? N LEU A 592 O LEU A 604 ? O LEU A 604 
A 8  9  N PHE A 601 ? N PHE A 601 O LEU A 619 ? O LEU A 619 
A 9  10 O LYS A 618 ? O LYS A 618 N ARG A 574 ? N ARG A 574 
A 10 11 O VAL A 573 ? O VAL A 573 N ARG A 545 ? N ARG A 545 
A 11 12 O LEU A 544 ? O LEU A 544 N VAL A 475 ? N VAL A 475 
A 12 13 N ALA A 474 ? N ALA A 474 O VAL A 494 ? O VAL A 494 
A 13 14 N ALA A 493 ? N ALA A 493 O LEU A 502 ? O LEU A 502 
B 1  2  N GLU A 130 ? N GLU A 130 O ALA A 133 ? O ALA A 133 
B 2  3  N HIS A 139 ? N HIS A 139 O VAL A 147 ? O VAL A 147 
B 3  4  N ARG A 146 ? N ARG A 146 O LEU A 174 ? O LEU A 174 
B 4  5  O LEU A 165 ? O LEU A 165 N PHE A 14  ? N PHE A 14  
B 5  6  N PHE A 10  ? N PHE A 10  O TYR A 582 ? O TYR A 582 
C 1  2  N MET A 60  ? N MET A 60  O GLY A 63  ? O GLY A 63  
C 2  3  O SER A 66  ? O SER A 66  N TRP A 27  ? N TRP A 27  
C 3  4  N GLU A 30  ? N GLU A 30  O TYR A 91  ? O TYR A 91  
D 1  2  O HIS A 256 ? O HIS A 256 N ALA A 242 ? N ALA A 242 
D 2  3  O TRP A 243 ? O TRP A 243 N ARG A 206 ? N ARG A 206 
D 3  4  O TRP A 202 ? O TRP A 202 N VAL A 193 ? N VAL A 193 
D 4  5  N ARG A 194 ? N ARG A 194 O VAL A 262 ? O VAL A 262 
E 1  2  N MET A 322 ? N MET A 322 O ALA A 464 ? O ALA A 464 
F 1  2  O HIS A 379 ? O HIS A 379 N LEU A 346 ? N LEU A 346 
F 2  3  N LEU A 349 ? N LEU A 349 O LEU A 407 ? O LEU A 407 
F 3  4  N VAL A 408 ? N VAL A 408 O GLN A 433 ? O GLN A 433 
G 1  2  N GLU B 130 ? N GLU B 130 O ALA B 133 ? O ALA B 133 
G 2  3  N HIS B 139 ? N HIS B 139 O VAL B 147 ? O VAL B 147 
G 3  4  N ARG B 146 ? N ARG B 146 O LEU B 174 ? O LEU B 174 
G 4  5  O LEU B 165 ? O LEU B 165 N PHE B 14  ? N PHE B 14  
G 5  6  N ALA B 15  ? N ALA B 15  O GLU B 307 ? O GLU B 307 
G 6  7  N TYR B 314 ? N TYR B 314 O TYR B 593 ? O TYR B 593 
G 7  8  N VAL B 594 ? N VAL B 594 O LEU B 602 ? O LEU B 602 
G 8  9  N PHE B 601 ? N PHE B 601 O LEU B 619 ? O LEU B 619 
G 9  10 O LYS B 618 ? O LYS B 618 N ARG B 574 ? N ARG B 574 
G 10 11 O ASP B 569 ? O ASP B 569 N LEU B 543 ? N LEU B 543 
G 11 12 O LEU B 544 ? O LEU B 544 N VAL B 475 ? N VAL B 475 
G 12 13 N GLY B 476 ? N GLY B 476 O CYS B 492 ? O CYS B 492 
G 13 14 N ALA B 491 ? N ALA B 491 O THR B 504 ? O THR B 504 
H 1  2  N GLU B 130 ? N GLU B 130 O ALA B 133 ? O ALA B 133 
H 2  3  N HIS B 139 ? N HIS B 139 O VAL B 147 ? O VAL B 147 
H 3  4  N ARG B 146 ? N ARG B 146 O LEU B 174 ? O LEU B 174 
H 4  5  O LEU B 165 ? O LEU B 165 N PHE B 14  ? N PHE B 14  
H 5  6  N PHE B 10  ? N PHE B 10  O TYR B 582 ? O TYR B 582 
I 1  2  N VAL B 58  ? N VAL B 58  O ALA B 65  ? O ALA B 65  
I 2  3  O LEU B 64  ? O LEU B 64  N LEU B 29  ? N LEU B 29  
I 3  4  N ARG B 28  ? N ARG B 28  O GLY B 94  ? O GLY B 94  
I 4  5  O GLN B 84  ? O GLN B 84  N ARG B 81  ? N ARG B 81  
J 1  2  O ILE B 254 ? O ILE B 254 N VAL B 244 ? N VAL B 244 
J 2  3  O ALA B 245 ? O ALA B 245 N GLU B 203 ? N GLU B 203 
J 3  4  O TRP B 202 ? O TRP B 202 N VAL B 193 ? N VAL B 193 
J 4  5  N ARG B 194 ? N ARG B 194 O VAL B 262 ? O VAL B 262 
K 1  2  N MET B 322 ? N MET B 322 O ALA B 464 ? O ALA B 464 
L 1  2  O HIS B 379 ? O HIS B 379 N LEU B 346 ? N LEU B 346 
L 2  3  N ALA B 347 ? N ALA B 347 O LEU B 407 ? O LEU B 407 
L 3  4  N VAL B 408 ? N VAL B 408 O GLN B 433 ? O GLN B 433 
AC1 Software ? ? ? ? 5 'BINDING SITE FOR RESIDUE MG B 701' 
AC2 Software ? ? ? ? 5 'BINDING SITE FOR RESIDUE MG C 101' 
AC3 Software ? ? ? ? 4 'BINDING SITE FOR RESIDUE MG E 101' 
1  AC1 5 ASP B 478 ? ASP B 478 . ? 1_555 ? 
2  AC1 5 ALA B 479 ? ALA B 479 . ? 1_555 ? 
3  AC1 5 ASP B 660 ? ASP B 660 . ? 1_555 ? 
4  AC1 5 HOH K .   ? HOH B 808 . ? 1_555 ? 
5  AC1 5 DT  F 5   ? DT  F 6   . ? 1_555 ? 
6  AC2 5 VAL A 685 ? VAL A 685 . ? 1_555 ? 
7  AC2 5 HOH J .   ? HOH A 735 . ? 1_555 ? 
8  AC2 5 DT  C 1   ? DT  C 1   . ? 1_555 ? 
9  AC2 5 DA  C 3   ? DA  C 3   . ? 1_555 ? 
10 AC2 5 HOH L .   ? HOH C 205 . ? 1_555 ? 
11 AC3 4 VAL B 685 ? VAL B 685 . ? 1_555 ? 
12 AC3 4 DT  D 1   ? DT  E 1   . ? 1_555 ? 
13 AC3 4 DA  D 3   ? DA  E 3   . ? 1_555 ? 
14 AC3 4 HOH M .   ? HOH E 203 . ? 1_555 ? 
_atom_sites.entry_id                    4N41 
_atom_sites.fract_transf_matrix[1][1]   0.016803 
_atom_sites.fract_transf_matrix[1][2]   0.000000 
_atom_sites.fract_transf_matrix[1][3]   0.001034 
_atom_sites.fract_transf_matrix[2][1]   0.000000 
_atom_sites.fract_transf_matrix[2][2]   0.009833 
_atom_sites.fract_transf_matrix[2][3]   0.000000 
_atom_sites.fract_transf_matrix[3][1]   0.000000 
_atom_sites.fract_transf_matrix[3][2]   0.000000 
_atom_sites.fract_transf_matrix[3][3]   0.006547 
_atom_sites.fract_transf_vector[1]      0.00000 
_atom_sites.fract_transf_vector[2]      0.00000 
_atom_sites.fract_transf_vector[3]      0.00000 
ATOM   1     N  N     . GLY A 1 5   ? 1.786   32.729  0.930   1.00 70.28  ? 5   GLY A N     1 
ATOM   2     C  CA    . GLY A 1 5   ? 1.647   33.834  1.860   1.00 72.62  ? 5   GLY A CA    1 
ATOM   3     C  C     . GLY A 1 5   ? 1.021   33.407  3.174   1.00 67.93  ? 5   GLY A C     1 
ATOM   4     O  O     . GLY A 1 5   ? 1.416   32.394  3.757   1.00 57.76  ? 5   GLY A O     1 
ATOM   5     N  N     . LYS A 1 6   ? 0.043   34.184  3.637   1.00 66.99  ? 6   LYS A N     1 
ATOM   6     C  CA    . LYS A 1 6   ? -0.612  33.924  4.916   1.00 61.56  ? 6   LYS A CA    1 
ATOM   7     C  C     . LYS A 1 6   ? -1.810  32.998  4.851   1.00 56.58  ? 6   LYS A C     1 
ATOM   8     O  O     . LYS A 1 6   ? -2.486  32.875  3.838   1.00 56.94  ? 6   LYS A O     1 
ATOM   9     C  CB    . LYS A 1 6   ? -1.048  35.225  5.600   1.00 61.93  ? 6   LYS A CB    1 
ATOM   10    C  CG    . LYS A 1 6   ? 0.072   36.190  5.905   1.00 64.38  ? 6   LYS A CG    1 
ATOM   11    C  CD    . LYS A 1 6   ? -0.480  37.492  6.462   1.00 75.18  ? 6   LYS A CD    1 
ATOM   12    C  CE    . LYS A 1 6   ? 0.629   38.516  6.668   1.00 80.16  ? 6   LYS A CE    1 
ATOM   13    N  NZ    . LYS A 1 6   ? 0.097   39.809  7.181   1.00 81.17  ? 6   LYS A NZ    1 
ATOM   14    N  N     . THR A 1 7   ? -2.036  32.318  5.962   1.00 53.44  ? 7   THR A N     1 
ATOM   15    C  CA    . THR A 1 7   ? -3.207  31.490  6.128   1.00 51.01  ? 7   THR A CA    1 
ATOM   16    C  C     . THR A 1 7   ? -3.479  31.532  7.607   1.00 54.67  ? 7   THR A C     1 
ATOM   17    O  O     . THR A 1 7   ? -2.634  31.988  8.374   1.00 57.49  ? 7   THR A O     1 
ATOM   18    C  CB    . THR A 1 7   ? -2.987  30.035  5.675   1.00 62.11  ? 7   THR A CB    1 
ATOM   19    O  OG1   . THR A 1 7   ? -2.054  29.994  4.588   1.00 75.48  ? 7   THR A OG1   1 
ATOM   20    C  CG2   . THR A 1 7   ? -4.302  29.389  5.262   1.00 58.22  ? 7   THR A CG2   1 
ATOM   21    N  N     . GLU A 1 8   ? -4.646  31.059  8.013   1.00 52.52  ? 8   GLU A N     1 
ATOM   22    C  CA    . GLU A 1 8   ? -4.954  30.980  9.422   1.00 49.49  ? 8   GLU A CA    1 
ATOM   23    C  C     . GLU A 1 8   ? -5.312  29.533  9.682   1.00 45.52  ? 8   GLU A C     1 
ATOM   24    O  O     . GLU A 1 8   ? -5.888  28.867  8.813   1.00 43.73  ? 8   GLU A O     1 
ATOM   25    C  CB    . GLU A 1 8   ? -6.106  31.918  9.811   1.00 52.59  ? 8   GLU A CB    1 
ATOM   26    C  CG    . GLU A 1 8   ? -6.272  32.061  11.330  1.00 54.38  ? 8   GLU A CG    1 
ATOM   27    C  CD    . GLU A 1 8   ? -7.379  33.031  11.751  1.00 63.46  ? 8   GLU A CD    1 
ATOM   28    O  OE1   . GLU A 1 8   ? -7.064  34.003  12.483  1.00 61.49  ? 8   GLU A OE1   1 
ATOM   29    O  OE2   . GLU A 1 8   ? -8.556  32.834  11.366  1.00 62.60  ? 8   GLU A OE2   1 
ATOM   30    N  N     . VAL A 1 9   ? -4.954  29.045  10.863  1.00 41.12  ? 9   VAL A N     1 
ATOM   31    C  CA    . VAL A 1 9   ? -5.247  27.668  11.227  1.00 43.20  ? 9   VAL A CA    1 
ATOM   32    C  C     . VAL A 1 9   ? -5.880  27.622  12.588  1.00 35.71  ? 9   VAL A C     1 
ATOM   33    O  O     . VAL A 1 9   ? -5.797  28.574  13.347  1.00 39.21  ? 9   VAL A O     1 
ATOM   34    C  CB    . VAL A 1 9   ? -3.976  26.752  11.283  1.00 37.51  ? 9   VAL A CB    1 
ATOM   35    C  CG1   . VAL A 1 9   ? -3.354  26.586  9.903   1.00 36.69  ? 9   VAL A CG1   1 
ATOM   36    C  CG2   . VAL A 1 9   ? -2.991  27.293  12.290  1.00 30.16  ? 9   VAL A CG2   1 
ATOM   37    N  N     . PHE A 1 10  ? -6.529  26.504  12.868  1.00 34.23  ? 10  PHE A N     1 
ATOM   38    C  CA    . PHE A 1 10  ? -6.941  26.127  14.199  1.00 35.76  ? 10  PHE A CA    1 
ATOM   39    C  C     . PHE A 1 10  ? -5.910  25.177  14.752  1.00 33.93  ? 10  PHE A C     1 
ATOM   40    O  O     . PHE A 1 10  ? -5.433  24.312  14.020  1.00 31.12  ? 10  PHE A O     1 
ATOM   41    C  CB    . PHE A 1 10  ? -8.308  25.416  14.196  1.00 39.54  ? 10  PHE A CB    1 
ATOM   42    C  CG    . PHE A 1 10  ? -9.467  26.303  13.847  1.00 43.95  ? 10  PHE A CG    1 
ATOM   43    C  CD1   . PHE A 1 10  ? -9.877  27.305  14.717  1.00 45.79  ? 10  PHE A CD1   1 
ATOM   44    C  CD2   . PHE A 1 10  ? -10.175 26.106  12.669  1.00 50.77  ? 10  PHE A CD2   1 
ATOM   45    C  CE1   . PHE A 1 10  ? -10.973 28.123  14.401  1.00 54.11  ? 10  PHE A CE1   1 
ATOM   46    C  CE2   . PHE A 1 10  ? -11.277 26.917  12.345  1.00 50.66  ? 10  PHE A CE2   1 
ATOM   47    C  CZ    . PHE A 1 10  ? -11.672 27.923  13.214  1.00 49.04  ? 10  PHE A CZ    1 
ATOM   48    N  N     . LEU A 1 11  ? -5.600  25.315  16.037  1.00 33.16  ? 11  LEU A N     1 
ATOM   49    C  CA    . LEU A 1 11  ? -4.898  24.278  16.788  1.00 33.60  ? 11  LEU A CA    1 
ATOM   50    C  C     . LEU A 1 11  ? -5.957  23.384  17.431  1.00 38.27  ? 11  LEU A C     1 
ATOM   51    O  O     . LEU A 1 11  ? -7.105  23.801  17.529  1.00 34.75  ? 11  LEU A O     1 
ATOM   52    C  CB    . LEU A 1 11  ? -4.007  24.896  17.862  1.00 34.96  ? 11  LEU A CB    1 
ATOM   53    C  CG    . LEU A 1 11  ? -3.087  25.999  17.322  1.00 41.86  ? 11  LEU A CG    1 
ATOM   54    C  CD1   . LEU A 1 11  ? -2.167  26.521  18.414  1.00 38.31  ? 11  LEU A CD1   1 
ATOM   55    C  CD2   . LEU A 1 11  ? -2.306  25.516  16.111  1.00 38.66  ? 11  LEU A CD2   1 
ATOM   56    N  N     . ASN A 1 12  ? -5.586  22.213  17.902  1.00 33.95  ? 12  ASN A N     1 
ATOM   57    C  CA    . ASN A 1 12  ? -6.532  21.421  18.644  1.00 30.90  ? 12  ASN A CA    1 
ATOM   58    C  C     . ASN A 1 12  ? -6.726  21.806  20.079  1.00 31.23  ? 12  ASN A C     1 
ATOM   59    O  O     . ASN A 1 12  ? -7.083  21.019  20.904  1.00 36.82  ? 12  ASN A O     1 
ATOM   60    C  CB    . ASN A 1 12  ? -6.330  19.937  18.410  1.00 31.64  ? 12  ASN A CB    1 
ATOM   61    C  CG    . ASN A 1 12  ? -4.991  19.443  18.864  1.00 34.16  ? 12  ASN A CG    1 
ATOM   62    O  OD1   . ASN A 1 12  ? -4.020  20.134  18.808  1.00 32.46  ? 12  ASN A OD1   1 
ATOM   63    N  ND2   . ASN A 1 12  ? -4.953  18.231  19.290  1.00 34.64  ? 12  ASN A ND2   1 
ATOM   64    N  N     . ARG A 1 13  ? -6.401  22.968  20.427  1.00 33.32  ? 13  ARG A N     1 
ATOM   65    C  CA    . ARG A 1 13  ? -6.741  23.532  21.727  1.00 39.05  ? 13  ARG A CA    1 
ATOM   66    C  C     . ARG A 1 13  ? -7.843  24.595  21.791  1.00 42.01  ? 13  ARG A C     1 
ATOM   67    O  O     . ARG A 1 13  ? -8.190  25.220  20.785  1.00 38.10  ? 13  ARG A O     1 
ATOM   68    C  CB    . ARG A 1 13  ? -5.411  24.065  22.296  1.00 47.13  ? 13  ARG A CB    1 
ATOM   69    C  CG    . ARG A 1 13  ? -4.742  25.165  21.501  1.00 48.31  ? 13  ARG A CG    1 
ATOM   70    C  CD    . ARG A 1 13  ? -3.419  25.633  22.150  1.00 49.48  ? 13  ARG A CD    1 
ATOM   71    N  NE    . ARG A 1 13  ? -2.354  24.641  22.003  1.00 53.06  ? 13  ARG A NE    1 
ATOM   72    C  CZ    . ARG A 1 13  ? -1.050  24.907  22.114  1.00 64.18  ? 13  ARG A CZ    1 
ATOM   73    N  NH1   . ARG A 1 13  ? -0.632  26.141  22.365  1.00 53.62  ? 13  ARG A NH1   1 
ATOM   74    N  NH2   . ARG A 1 13  ? -0.158  23.936  21.961  1.00 63.38  ? 13  ARG A NH2   1 
ATOM   75    N  N     . PHE A 1 14  ? -8.379  24.796  22.988  1.00 39.20  ? 14  PHE A N     1 
ATOM   76    C  CA    . PHE A 1 14  ? -9.568  25.601  23.186  1.00 42.80  ? 14  PHE A CA    1 
ATOM   77    C  C     . PHE A 1 14  ? -9.406  26.475  24.420  1.00 42.84  ? 14  PHE A C     1 
ATOM   78    O  O     . PHE A 1 14  ? -9.034  25.988  25.498  1.00 43.65  ? 14  PHE A O     1 
ATOM   79    C  CB    . PHE A 1 14  ? -10.790 24.687  23.314  1.00 37.18  ? 14  PHE A CB    1 
ATOM   80    C  CG    . PHE A 1 14  ? -10.993 23.790  22.120  1.00 37.33  ? 14  PHE A CG    1 
ATOM   81    C  CD1   . PHE A 1 14  ? -10.270 22.609  21.979  1.00 42.57  ? 14  PHE A CD1   1 
ATOM   82    C  CD2   . PHE A 1 14  ? -11.902 24.135  21.132  1.00 37.84  ? 14  PHE A CD2   1 
ATOM   83    C  CE1   . PHE A 1 14  ? -10.437 21.804  20.868  1.00 41.42  ? 14  PHE A CE1   1 
ATOM   84    C  CE2   . PHE A 1 14  ? -12.085 23.336  20.027  1.00 34.78  ? 14  PHE A CE2   1 
ATOM   85    C  CZ    . PHE A 1 14  ? -11.360 22.167  19.890  1.00 36.26  ? 14  PHE A CZ    1 
ATOM   86    N  N     . ALA A 1 15  ? -9.698  27.764  24.262  1.00 39.85  ? 15  ALA A N     1 
ATOM   87    C  CA    . ALA A 1 15  ? -9.628  28.693  25.385  1.00 47.13  ? 15  ALA A CA    1 
ATOM   88    C  C     . ALA A 1 15  ? -10.876 28.539  26.238  1.00 48.26  ? 15  ALA A C     1 
ATOM   89    O  O     . ALA A 1 15  ? -11.988 28.452  25.727  1.00 45.18  ? 15  ALA A O     1 
ATOM   90    C  CB    . ALA A 1 15  ? -9.486  30.127  24.902  1.00 38.17  ? 15  ALA A CB    1 
ATOM   91    N  N     . LEU A 1 16  ? -10.667 28.457  27.541  1.00 49.27  ? 16  LEU A N     1 
ATOM   92    C  CA    . LEU A 1 16  ? -11.745 28.461  28.508  1.00 45.98  ? 16  LEU A CA    1 
ATOM   93    C  C     . LEU A 1 16  ? -11.550 29.693  29.393  1.00 50.84  ? 16  LEU A C     1 
ATOM   94    O  O     . LEU A 1 16  ? -10.686 30.523  29.114  1.00 49.34  ? 16  LEU A O     1 
ATOM   95    C  CB    . LEU A 1 16  ? -11.754 27.158  29.313  1.00 48.92  ? 16  LEU A CB    1 
ATOM   96    C  CG    . LEU A 1 16  ? -12.223 25.928  28.534  1.00 51.10  ? 16  LEU A CG    1 
ATOM   97    C  CD1   . LEU A 1 16  ? -11.948 24.634  29.277  1.00 46.50  ? 16  LEU A CD1   1 
ATOM   98    C  CD2   . LEU A 1 16  ? -13.722 26.059  28.274  1.00 56.74  ? 16  LEU A CD2   1 
ATOM   99    N  N     . ARG A 1 17  ? -12.329 29.808  30.461  1.00 56.18  ? 17  ARG A N     1 
ATOM   100   C  CA    . ARG A 1 17  ? -12.334 31.028  31.264  1.00 60.39  ? 17  ARG A CA    1 
ATOM   101   C  C     . ARG A 1 17  ? -11.011 31.289  31.984  1.00 60.09  ? 17  ARG A C     1 
ATOM   102   O  O     . ARG A 1 17  ? -10.276 30.356  32.308  1.00 59.33  ? 17  ARG A O     1 
ATOM   103   C  CB    . ARG A 1 17  ? -13.480 30.974  32.279  1.00 59.27  ? 17  ARG A CB    1 
ATOM   104   C  CG    . ARG A 1 17  ? -13.256 30.026  33.450  1.00 58.80  ? 17  ARG A CG    1 
ATOM   105   C  CD    . ARG A 1 17  ? -14.124 30.415  34.638  1.00 60.09  ? 17  ARG A CD    1 
ATOM   106   N  NE    . ARG A 1 17  ? -14.087 29.421  35.713  1.00 58.58  ? 17  ARG A NE    1 
ATOM   107   C  CZ    . ARG A 1 17  ? -13.103 29.306  36.598  1.00 63.94  ? 17  ARG A CZ    1 
ATOM   108   N  NH1   . ARG A 1 17  ? -12.058 30.124  36.538  1.00 68.92  ? 17  ARG A NH1   1 
ATOM   109   N  NH2   . ARG A 1 17  ? -13.162 28.375  37.543  1.00 63.70  ? 17  ARG A NH2   1 
ATOM   110   N  N     . PRO A 1 18  ? -10.703 32.574  32.224  1.00 57.76  ? 18  PRO A N     1 
ATOM   111   C  CA    . PRO A 1 18  ? -9.516  32.896  33.018  1.00 65.37  ? 18  PRO A CA    1 
ATOM   112   C  C     . PRO A 1 18  ? -9.647  32.319  34.421  1.00 65.98  ? 18  PRO A C     1 
ATOM   113   O  O     . PRO A 1 18  ? -10.762 32.080  34.888  1.00 67.42  ? 18  PRO A O     1 
ATOM   114   C  CB    . PRO A 1 18  ? -9.507  34.432  33.047  1.00 62.34  ? 18  PRO A CB    1 
ATOM   115   C  CG    . PRO A 1 18  ? -10.330 34.845  31.869  1.00 61.79  ? 18  PRO A CG    1 
ATOM   116   C  CD    . PRO A 1 18  ? -11.388 33.787  31.736  1.00 58.86  ? 18  PRO A CD    1 
ATOM   117   N  N     . LEU A 1 19  ? -8.523  32.105  35.089  1.00 64.18  ? 19  LEU A N     1 
ATOM   118   C  CA    . LEU A 1 19  ? -8.562  31.589  36.446  1.00 71.79  ? 19  LEU A CA    1 
ATOM   119   C  C     . LEU A 1 19  ? -9.104  32.671  37.381  1.00 74.62  ? 19  LEU A C     1 
ATOM   120   O  O     . LEU A 1 19  ? -8.831  33.862  37.197  1.00 73.60  ? 19  LEU A O     1 
ATOM   121   C  CB    . LEU A 1 19  ? -7.165  31.125  36.891  1.00 70.62  ? 19  LEU A CB    1 
ATOM   122   C  CG    . LEU A 1 19  ? -6.721  29.692  36.536  1.00 70.71  ? 19  LEU A CG    1 
ATOM   123   C  CD1   . LEU A 1 19  ? -6.616  29.484  35.028  1.00 66.05  ? 19  LEU A CD1   1 
ATOM   124   C  CD2   . LEU A 1 19  ? -5.401  29.341  37.200  1.00 66.66  ? 19  LEU A CD2   1 
ATOM   125   N  N     . ASN A 1 20  ? -9.919  32.267  38.348  1.00 70.04  ? 20  ASN A N     1 
ATOM   126   C  CA    . ASN A 1 20  ? -10.411 33.212  39.334  1.00 74.38  ? 20  ASN A CA    1 
ATOM   127   C  C     . ASN A 1 20  ? -9.332  33.411  40.408  1.00 79.83  ? 20  ASN A C     1 
ATOM   128   O  O     . ASN A 1 20  ? -8.363  32.645  40.457  1.00 82.10  ? 20  ASN A O     1 
ATOM   129   C  CB    . ASN A 1 20  ? -11.757 32.741  39.914  1.00 73.38  ? 20  ASN A CB    1 
ATOM   130   C  CG    . ASN A 1 20  ? -11.674 31.398  40.607  1.00 80.18  ? 20  ASN A CG    1 
ATOM   131   O  OD1   . ASN A 1 20  ? -10.697 31.087  41.292  1.00 79.31  ? 20  ASN A OD1   1 
ATOM   132   N  ND2   . ASN A 1 20  ? -12.711 30.580  40.420  1.00 72.60  ? 20  ASN A ND2   1 
ATOM   133   N  N     . PRO A 1 21  ? -9.456  34.468  41.231  1.00 80.66  ? 21  PRO A N     1 
ATOM   134   C  CA    . PRO A 1 21  ? -8.468  34.688  42.296  1.00 84.11  ? 21  PRO A CA    1 
ATOM   135   C  C     . PRO A 1 21  ? -8.274  33.485  43.221  1.00 84.89  ? 21  PRO A C     1 
ATOM   136   O  O     . PRO A 1 21  ? -7.147  33.220  43.626  1.00 90.17  ? 21  PRO A O     1 
ATOM   137   C  CB    . PRO A 1 21  ? -9.043  35.881  43.055  1.00 84.18  ? 21  PRO A CB    1 
ATOM   138   C  CG    . PRO A 1 21  ? -9.764  36.650  42.004  1.00 80.63  ? 21  PRO A CG    1 
ATOM   139   C  CD    . PRO A 1 21  ? -10.380 35.613  41.106  1.00 78.53  ? 21  PRO A CD    1 
ATOM   140   N  N     . GLU A 1 22  ? -9.342  32.759  43.527  1.00 85.18  ? 22  GLU A N     1 
ATOM   141   C  CA    . GLU A 1 22  ? -9.227  31.585  44.383  1.00 87.85  ? 22  GLU A CA    1 
ATOM   142   C  C     . GLU A 1 22  ? -8.295  30.543  43.764  1.00 88.07  ? 22  GLU A C     1 
ATOM   143   O  O     . GLU A 1 22  ? -7.541  29.876  44.471  1.00 93.04  ? 22  GLU A O     1 
ATOM   144   C  CB    . GLU A 1 22  ? -10.607 30.963  44.624  1.00 91.05  ? 22  GLU A CB    1 
ATOM   145   C  CG    . GLU A 1 22  ? -11.692 31.939  45.062  1.00 90.90  ? 22  GLU A CG    1 
ATOM   146   C  CD    . GLU A 1 22  ? -11.525 32.413  46.498  1.00 102.68 ? 22  GLU A CD    1 
ATOM   147   O  OE1   . GLU A 1 22  ? -10.665 31.861  47.221  1.00 105.18 ? 22  GLU A OE1   1 
ATOM   148   O  OE2   . GLU A 1 22  ? -12.266 33.333  46.909  1.00 104.08 ? 22  GLU A OE2   1 
ATOM   149   N  N     . GLU A 1 23  ? -8.352  30.416  42.441  1.00 84.20  ? 23  GLU A N     1 
ATOM   150   C  CA    . GLU A 1 23  ? -7.528  29.455  41.711  1.00 81.65  ? 23  GLU A CA    1 
ATOM   151   C  C     . GLU A 1 23  ? -6.094  29.956  41.534  1.00 82.68  ? 23  GLU A C     1 
ATOM   152   O  O     . GLU A 1 23  ? -5.151  29.164  41.489  1.00 81.78  ? 23  GLU A O     1 
ATOM   153   C  CB    . GLU A 1 23  ? -8.154  29.161  40.348  1.00 82.11  ? 23  GLU A CB    1 
ATOM   154   C  CG    . GLU A 1 23  ? -9.458  28.365  40.407  1.00 78.96  ? 23  GLU A CG    1 
ATOM   155   C  CD    . GLU A 1 23  ? -10.279 28.523  39.138  1.00 75.87  ? 23  GLU A CD    1 
ATOM   156   O  OE1   . GLU A 1 23  ? -11.199 27.702  38.898  1.00 73.46  ? 23  GLU A OE1   1 
ATOM   157   O  OE2   . GLU A 1 23  ? -10.007 29.487  38.389  1.00 71.61  ? 23  GLU A OE2   1 
ATOM   158   N  N     . LEU A 1 24  ? -5.936  31.274  41.430  1.00 81.28  ? 24  LEU A N     1 
ATOM   159   C  CA    . LEU A 1 24  ? -4.608  31.879  41.330  1.00 87.94  ? 24  LEU A CA    1 
ATOM   160   C  C     . LEU A 1 24  ? -3.938  31.901  42.702  1.00 89.84  ? 24  LEU A C     1 
ATOM   161   O  O     . LEU A 1 24  ? -2.765  32.248  42.832  1.00 87.95  ? 24  LEU A O     1 
ATOM   162   C  CB    . LEU A 1 24  ? -4.686  33.300  40.756  1.00 85.70  ? 24  LEU A CB    1 
ATOM   163   C  CG    . LEU A 1 24  ? -5.109  33.511  39.295  1.00 85.69  ? 24  LEU A CG    1 
ATOM   164   C  CD1   . LEU A 1 24  ? -5.387  34.984  39.007  1.00 75.96  ? 24  LEU A CD1   1 
ATOM   165   C  CD2   . LEU A 1 24  ? -4.049  32.982  38.343  1.00 77.67  ? 24  LEU A CD2   1 
ATOM   166   N  N     . ARG A 1 25  ? -4.704  31.519  43.719  1.00 93.71  ? 25  ARG A N     1 
ATOM   167   C  CA    . ARG A 1 25  ? -4.244  31.481  45.104  1.00 98.17  ? 25  ARG A CA    1 
ATOM   168   C  C     . ARG A 1 25  ? -4.368  30.087  45.719  1.00 96.37  ? 25  ARG A C     1 
ATOM   169   O  O     . ARG A 1 25  ? -5.268  29.835  46.526  1.00 99.90  ? 25  ARG A O     1 
ATOM   170   C  CB    . ARG A 1 25  ? -5.045  32.489  45.926  1.00 99.52  ? 25  ARG A CB    1 
ATOM   171   C  CG    . ARG A 1 25  ? -4.783  33.950  45.580  1.00 98.70  ? 25  ARG A CG    1 
ATOM   172   C  CD    . ARG A 1 25  ? -5.945  34.829  46.034  1.00 102.50 ? 25  ARG A CD    1 
ATOM   173   N  NE    . ARG A 1 25  ? -5.940  35.093  47.467  1.00 109.79 ? 25  ARG A NE    1 
ATOM   174   C  CZ    . ARG A 1 25  ? -6.707  34.430  48.325  1.00 109.46 ? 25  ARG A CZ    1 
ATOM   175   N  NH1   . ARG A 1 25  ? -6.666  34.706  49.621  1.00 108.34 ? 25  ARG A NH1   1 
ATOM   176   N  NH2   . ARG A 1 25  ? -7.520  33.486  47.871  1.00 108.34 ? 25  ARG A NH2   1 
ATOM   177   N  N     . PRO A 1 26  ? -3.460  29.174  45.341  1.00 90.88  ? 26  PRO A N     1 
ATOM   178   C  CA    . PRO A 1 26  ? -3.523  27.815  45.880  1.00 91.32  ? 26  PRO A CA    1 
ATOM   179   C  C     . PRO A 1 26  ? -3.153  27.736  47.358  1.00 102.18 ? 26  PRO A C     1 
ATOM   180   O  O     . PRO A 1 26  ? -2.334  28.518  47.873  1.00 102.12 ? 26  PRO A O     1 
ATOM   181   C  CB    . PRO A 1 26  ? -2.495  27.044  45.039  1.00 89.43  ? 26  PRO A CB    1 
ATOM   182   C  CG    . PRO A 1 26  ? -2.208  27.900  43.863  1.00 89.77  ? 26  PRO A CG    1 
ATOM   183   C  CD    . PRO A 1 26  ? -2.416  29.308  44.312  1.00 91.72  ? 26  PRO A CD    1 
ATOM   184   N  N     . TRP A 1 27  ? -3.807  26.797  48.030  1.00 101.84 ? 27  TRP A N     1 
ATOM   185   C  CA    . TRP A 1 27  ? -3.492  26.424  49.395  1.00 103.98 ? 27  TRP A CA    1 
ATOM   186   C  C     . TRP A 1 27  ? -2.105  25.786  49.435  1.00 107.71 ? 27  TRP A C     1 
ATOM   187   O  O     . TRP A 1 27  ? -1.869  24.753  48.798  1.00 105.27 ? 27  TRP A O     1 
ATOM   188   C  CB    . TRP A 1 27  ? -4.546  25.455  49.931  1.00 105.00 ? 27  TRP A CB    1 
ATOM   189   C  CG    . TRP A 1 27  ? -5.912  26.065  50.024  1.00 106.78 ? 27  TRP A CG    1 
ATOM   190   C  CD1   . TRP A 1 27  ? -6.961  25.848  49.178  1.00 107.28 ? 27  TRP A CD1   1 
ATOM   191   C  CD2   . TRP A 1 27  ? -6.372  27.006  51.000  1.00 108.73 ? 27  TRP A CD2   1 
ATOM   192   N  NE1   . TRP A 1 27  ? -8.051  26.587  49.574  1.00 108.72 ? 27  TRP A NE1   1 
ATOM   193   C  CE2   . TRP A 1 27  ? -7.714  27.308  50.690  1.00 107.99 ? 27  TRP A CE2   1 
ATOM   194   C  CE3   . TRP A 1 27  ? -5.782  27.620  52.108  1.00 110.06 ? 27  TRP A CE3   1 
ATOM   195   C  CZ2   . TRP A 1 27  ? -8.475  28.192  51.450  1.00 108.01 ? 27  TRP A CZ2   1 
ATOM   196   C  CZ3   . TRP A 1 27  ? -6.538  28.499  52.859  1.00 109.80 ? 27  TRP A CZ3   1 
ATOM   197   C  CH2   . TRP A 1 27  ? -7.870  28.778  52.526  1.00 110.04 ? 27  TRP A CH2   1 
ATOM   198   N  N     . ARG A 1 28  ? -1.188  26.409  50.166  1.00 110.17 ? 28  ARG A N     1 
ATOM   199   C  CA    . ARG A 1 28  ? 0.150   25.866  50.353  1.00 107.46 ? 28  ARG A CA    1 
ATOM   200   C  C     . ARG A 1 28  ? 0.186   24.979  51.593  1.00 110.11 ? 28  ARG A C     1 
ATOM   201   O  O     . ARG A 1 28  ? -0.473  25.263  52.594  1.00 110.81 ? 28  ARG A O     1 
ATOM   202   C  CB    . ARG A 1 28  ? 1.172   26.985  50.461  1.00 106.39 ? 28  ARG A CB    1 
ATOM   203   N  N     . LEU A 1 29  ? 0.949   23.894  51.502  1.00 108.65 ? 29  LEU A N     1 
ATOM   204   C  CA    . LEU A 1 29  ? 1.090   22.912  52.567  1.00 108.22 ? 29  LEU A CA    1 
ATOM   205   C  C     . LEU A 1 29  ? 2.447   22.228  52.458  1.00 112.71 ? 29  LEU A C     1 
ATOM   206   O  O     . LEU A 1 29  ? 2.611   21.308  51.657  1.00 113.09 ? 29  LEU A O     1 
ATOM   207   C  CB    . LEU A 1 29  ? -0.024  21.859  52.510  1.00 109.66 ? 29  LEU A CB    1 
ATOM   208   C  CG    . LEU A 1 29  ? -1.468  22.218  52.884  1.00 114.64 ? 29  LEU A CG    1 
ATOM   209   C  CD1   . LEU A 1 29  ? -2.285  22.677  51.684  1.00 114.31 ? 29  LEU A CD1   1 
ATOM   210   C  CD2   . LEU A 1 29  ? -2.144  21.040  53.564  1.00 114.46 ? 29  LEU A CD2   1 
ATOM   211   N  N     . GLU A 1 30  ? 3.416   22.679  53.253  1.00 117.18 ? 30  GLU A N     1 
ATOM   212   C  CA    . GLU A 1 30  ? 4.743   22.062  53.271  1.00 114.42 ? 30  GLU A CA    1 
ATOM   213   C  C     . GLU A 1 30  ? 4.669   20.659  53.866  1.00 115.63 ? 30  GLU A C     1 
ATOM   214   O  O     . GLU A 1 30  ? 3.773   20.359  54.659  1.00 115.46 ? 30  GLU A O     1 
ATOM   215   C  CB    . GLU A 1 30  ? 5.727   22.921  54.051  1.00 111.40 ? 30  GLU A CB    1 
ATOM   216   N  N     . VAL A 1 31  ? 5.608   19.800  53.482  1.00 115.78 ? 31  VAL A N     1 
ATOM   217   C  CA    . VAL A 1 31  ? 5.590   18.410  53.926  1.00 117.76 ? 31  VAL A CA    1 
ATOM   218   C  C     . VAL A 1 31  ? 6.886   18.014  54.629  1.00 120.71 ? 31  VAL A C     1 
ATOM   219   O  O     . VAL A 1 31  ? 7.968   18.473  54.264  1.00 119.55 ? 31  VAL A O     1 
ATOM   220   C  CB    . VAL A 1 31  ? 5.330   17.486  52.746  1.00 114.32 ? 31  VAL A CB    1 
ATOM   221   N  N     . VAL A 1 32  ? 6.764   17.156  55.639  1.00 122.15 ? 32  VAL A N     1 
ATOM   222   C  CA    . VAL A 1 32  ? 7.921   16.646  56.370  1.00 123.14 ? 32  VAL A CA    1 
ATOM   223   C  C     . VAL A 1 32  ? 8.004   15.127  56.247  1.00 122.18 ? 32  VAL A C     1 
ATOM   224   O  O     . VAL A 1 32  ? 7.045   14.420  56.559  1.00 122.97 ? 32  VAL A O     1 
ATOM   225   C  CB    . VAL A 1 32  ? 7.870   17.033  57.866  1.00 121.58 ? 32  VAL A CB    1 
ATOM   226   C  CG1   . VAL A 1 32  ? 9.085   16.485  58.602  1.00 119.50 ? 32  VAL A CG1   1 
ATOM   227   C  CG2   . VAL A 1 32  ? 7.782   18.544  58.022  1.00 116.92 ? 32  VAL A CG2   1 
ATOM   228   N  N     . LEU A 1 33  ? 9.149   14.631  55.787  1.00 121.37 ? 33  LEU A N     1 
ATOM   229   C  CA    . LEU A 1 33  ? 9.346   13.196  55.603  1.00 128.16 ? 33  LEU A CA    1 
ATOM   230   C  C     . LEU A 1 33  ? 10.698  12.741  56.150  1.00 129.81 ? 33  LEU A C     1 
ATOM   231   O  O     . LEU A 1 33  ? 11.693  13.461  56.050  1.00 128.21 ? 33  LEU A O     1 
ATOM   232   C  CB    . LEU A 1 33  ? 9.222   12.829  54.131  1.00 127.11 ? 33  LEU A CB    1 
ATOM   233   N  N     . ASP A 1 34  ? 10.727  11.540  56.721  1.00 128.41 ? 34  ASP A N     1 
ATOM   234   C  CA    . ASP A 1 34  ? 11.951  11.003  57.303  1.00 129.55 ? 34  ASP A CA    1 
ATOM   235   C  C     . ASP A 1 34  ? 12.509  9.852   56.467  1.00 131.10 ? 34  ASP A C     1 
ATOM   236   O  O     . ASP A 1 34  ? 11.870  8.807   56.343  1.00 131.97 ? 34  ASP A O     1 
ATOM   237   C  CB    . ASP A 1 34  ? 11.698  10.545  58.733  1.00 123.82 ? 34  ASP A CB    1 
ATOM   238   N  N     . PRO A 1 35  ? 13.706  10.042  55.884  1.00 130.49 ? 35  PRO A N     1 
ATOM   239   C  CA    . PRO A 1 35  ? 14.481  11.288  55.913  1.00 129.21 ? 35  PRO A CA    1 
ATOM   240   C  C     . PRO A 1 35  ? 14.148  12.204  54.735  1.00 127.77 ? 35  PRO A C     1 
ATOM   241   O  O     . PRO A 1 35  ? 15.036  12.906  54.246  1.00 123.39 ? 35  PRO A O     1 
ATOM   242   C  CB    . PRO A 1 35  ? 15.929  10.802  55.827  1.00 125.72 ? 35  PRO A CB    1 
ATOM   243   C  CG    . PRO A 1 35  ? 15.847  9.510   55.092  1.00 126.31 ? 35  PRO A CG    1 
ATOM   244   C  CD    . PRO A 1 35  ? 14.481  8.921   55.325  1.00 128.76 ? 35  PRO A CD    1 
ATOM   245   N  N     . PRO A 1 44  ? 11.061  14.352  44.375  1.00 126.19 ? 44  PRO A N     1 
ATOM   246   C  CA    . PRO A 1 44  ? 11.151  12.891  44.520  1.00 125.89 ? 44  PRO A CA    1 
ATOM   247   C  C     . PRO A 1 44  ? 9.785   12.201  44.584  1.00 123.23 ? 44  PRO A C     1 
ATOM   248   O  O     . PRO A 1 44  ? 9.162   11.929  43.557  1.00 119.33 ? 44  PRO A O     1 
ATOM   249   C  CB    . PRO A 1 44  ? 11.908  12.715  45.843  1.00 124.12 ? 44  PRO A CB    1 
ATOM   250   C  CG    . PRO A 1 44  ? 12.696  13.963  46.000  1.00 119.18 ? 44  PRO A CG    1 
ATOM   251   C  CD    . PRO A 1 44  ? 11.832  15.047  45.426  1.00 121.88 ? 44  PRO A CD    1 
ATOM   252   N  N     . LEU A 1 45  ? 9.228   11.351  45.910  1.00 123.32 ? 45  LEU A N     1 
ATOM   253   C  CA    . LEU A 1 45  ? 7.888   10.788  45.910  1.00 121.75 ? 45  LEU A CA    1 
ATOM   254   C  C     . LEU A 1 45  ? 6.874   11.809  46.393  1.00 116.46 ? 45  LEU A C     1 
ATOM   255   O  O     . LEU A 1 45  ? 5.840   11.449  46.953  1.00 117.33 ? 45  LEU A O     1 
ATOM   256   C  CB    . LEU A 1 45  ? 7.837   9.539   46.775  1.00 122.10 ? 45  LEU A CB    1 
ATOM   257   N  N     . LEU A 1 46  ? 7.181   13.084  46.179  1.00 115.45 ? 46  LEU A N     1 
ATOM   258   C  CA    . LEU A 1 46  ? 6.257   14.160  46.525  1.00 119.11 ? 46  LEU A CA    1 
ATOM   259   C  C     . LEU A 1 46  ? 4.933   13.960  45.786  1.00 119.50 ? 46  LEU A C     1 
ATOM   260   O  O     . LEU A 1 46  ? 3.860   14.291  46.299  1.00 116.03 ? 46  LEU A O     1 
ATOM   261   C  CB    . LEU A 1 46  ? 6.857   15.534  46.205  1.00 118.08 ? 46  LEU A CB    1 
ATOM   262   C  CG    . LEU A 1 46  ? 7.555   16.223  47.386  1.00 119.05 ? 46  LEU A CG    1 
ATOM   263   C  CD1   . LEU A 1 46  ? 8.664   15.345  47.945  1.00 118.04 ? 46  LEU A CD1   1 
ATOM   264   C  CD2   . LEU A 1 46  ? 8.077   17.614  47.040  1.00 120.53 ? 46  LEU A CD2   1 
ATOM   265   N  N     . ALA A 1 47  ? 5.026   13.432  44.568  1.00 120.32 ? 47  ALA A N     1 
ATOM   266   C  CA    . ALA A 1 47  ? 3.850   13.076  43.781  1.00 117.60 ? 47  ALA A CA    1 
ATOM   267   C  C     . ALA A 1 47  ? 2.989   12.057  44.526  1.00 114.69 ? 47  ALA A C     1 
ATOM   268   O  O     . ALA A 1 47  ? 1.762   12.198  44.595  1.00 112.67 ? 47  ALA A O     1 
ATOM   269   C  CB    . ALA A 1 47  ? 4.266   12.530  42.421  1.00 115.36 ? 47  ALA A CB    1 
ATOM   270   N  N     . GLN A 1 48  ? 3.638   11.036  45.082  1.00 116.56 ? 48  GLN A N     1 
ATOM   271   C  CA    . GLN A 1 48  ? 2.941   10.001  45.843  1.00 115.99 ? 48  GLN A CA    1 
ATOM   272   C  C     . GLN A 1 48  ? 2.218   10.633  47.029  1.00 113.71 ? 48  GLN A C     1 
ATOM   273   O  O     . GLN A 1 48  ? 1.096   10.245  47.377  1.00 112.28 ? 48  GLN A O     1 
ATOM   274   C  CB    . GLN A 1 48  ? 3.917   8.919   46.325  1.00 116.94 ? 48  GLN A CB    1 
ATOM   275   C  CG    . GLN A 1 48  ? 4.678   8.207   45.211  1.00 117.82 ? 48  GLN A CG    1 
ATOM   276   C  CD    . GLN A 1 48  ? 4.786   6.708   45.443  1.00 118.03 ? 48  GLN A CD    1 
ATOM   277   O  OE1   . GLN A 1 48  ? 4.353   6.195   46.474  1.00 116.53 ? 48  GLN A OE1   1 
ATOM   278   N  NE2   . GLN A 1 48  ? 5.357   5.999   44.475  1.00 119.99 ? 48  GLN A NE2   1 
ATOM   279   N  N     . VAL A 1 49  ? 2.879   11.606  47.646  1.00 112.09 ? 49  VAL A N     1 
ATOM   280   C  CA    . VAL A 1 49  ? 2.296   12.363  48.742  1.00 109.43 ? 49  VAL A CA    1 
ATOM   281   C  C     . VAL A 1 49  ? 1.029   13.067  48.276  1.00 108.68 ? 49  VAL A C     1 
ATOM   282   O  O     . VAL A 1 49  ? -0.017  12.980  48.922  1.00 107.16 ? 49  VAL A O     1 
ATOM   283   C  CB    . VAL A 1 49  ? 3.285   13.402  49.291  1.00 110.44 ? 49  VAL A CB    1 
ATOM   284   C  CG1   . VAL A 1 49  ? 2.662   14.173  50.439  1.00 105.38 ? 49  VAL A CG1   1 
ATOM   285   C  CG2   . VAL A 1 49  ? 4.569   12.722  49.732  1.00 109.67 ? 49  VAL A CG2   1 
ATOM   286   N  N     . ALA A 1 50  ? 1.138   13.766  47.148  1.00 110.14 ? 50  ALA A N     1 
ATOM   287   C  CA    . ALA A 1 50  ? 0.013   14.496  46.563  1.00 107.56 ? 50  ALA A CA    1 
ATOM   288   C  C     . ALA A 1 50  ? -1.170  13.581  46.267  1.00 104.60 ? 50  ALA A C     1 
ATOM   289   O  O     . ALA A 1 50  ? -2.324  13.977  46.436  1.00 101.71 ? 50  ALA A O     1 
ATOM   290   C  CB    . ALA A 1 50  ? 0.448   15.214  45.296  1.00 102.27 ? 50  ALA A CB    1 
ATOM   291   N  N     . ARG A 1 51  ? -0.877  12.358  45.830  1.00 107.42 ? 51  ARG A N     1 
ATOM   292   C  CA    . ARG A 1 51  ? -1.924  11.383  45.529  1.00 107.31 ? 51  ARG A CA    1 
ATOM   293   C  C     . ARG A 1 51  ? -2.596  10.888  46.804  1.00 107.80 ? 51  ARG A C     1 
ATOM   294   O  O     . ARG A 1 51  ? -3.825  10.866  46.901  1.00 101.21 ? 51  ARG A O     1 
ATOM   295   C  CB    . ARG A 1 51  ? -1.360  10.186  44.756  1.00 108.73 ? 51  ARG A CB    1 
ATOM   296   C  CG    . ARG A 1 51  ? -0.932  10.470  43.323  1.00 108.68 ? 51  ARG A CG    1 
ATOM   297   C  CD    . ARG A 1 51  ? -0.802  9.166   42.534  1.00 108.68 ? 51  ARG A CD    1 
ATOM   298   N  NE    . ARG A 1 51  ? -0.663  9.391   41.095  1.00 112.81 ? 51  ARG A NE    1 
ATOM   299   C  CZ    . ARG A 1 51  ? -1.684  9.611   40.270  1.00 107.59 ? 51  ARG A CZ    1 
ATOM   300   N  NH1   . ARG A 1 51  ? -2.925  9.640   40.741  1.00 102.67 ? 51  ARG A NH1   1 
ATOM   301   N  NH2   . ARG A 1 51  ? -1.467  9.805   38.974  1.00 101.31 ? 51  ARG A NH2   1 
ATOM   302   N  N     . ARG A 1 52  ? -1.782  10.476  47.773  1.00 110.42 ? 52  ARG A N     1 
ATOM   303   C  CA    . ARG A 1 52  ? -2.297  9.954   49.035  1.00 110.87 ? 52  ARG A CA    1 
ATOM   304   C  C     . ARG A 1 52  ? -3.116  11.000  49.780  1.00 108.74 ? 52  ARG A C     1 
ATOM   305   O  O     . ARG A 1 52  ? -4.077  10.678  50.481  1.00 109.54 ? 52  ARG A O     1 
ATOM   306   C  CB    . ARG A 1 52  ? -1.147  9.468   49.913  1.00 114.71 ? 52  ARG A CB    1 
ATOM   307   C  CG    . ARG A 1 52  ? -0.501  8.190   49.414  1.00 118.07 ? 52  ARG A CG    1 
ATOM   308   C  CD    . ARG A 1 52  ? -1.411  6.988   49.591  1.00 121.83 ? 52  ARG A CD    1 
ATOM   309   N  NE    . ARG A 1 52  ? -0.890  5.825   48.879  1.00 129.16 ? 52  ARG A NE    1 
ATOM   310   C  CZ    . ARG A 1 52  ? 0.042   5.008   49.359  1.00 132.39 ? 52  ARG A CZ    1 
ATOM   311   N  NH1   . ARG A 1 52  ? 0.560   5.223   50.561  1.00 131.28 ? 52  ARG A NH1   1 
ATOM   312   N  NH2   . ARG A 1 52  ? 0.457   3.975   48.638  1.00 133.59 ? 52  ARG A NH2   1 
ATOM   313   N  N     . ALA A 1 53  ? -2.734  12.260  49.608  1.00 104.99 ? 53  ALA A N     1 
ATOM   314   C  CA    . ALA A 1 53  ? -3.420  13.359  50.266  1.00 107.56 ? 53  ALA A CA    1 
ATOM   315   C  C     . ALA A 1 53  ? -4.846  13.467  49.749  1.00 107.73 ? 53  ALA A C     1 
ATOM   316   O  O     . ALA A 1 53  ? -5.760  13.831  50.489  1.00 111.18 ? 53  ALA A O     1 
ATOM   317   C  CB    . ALA A 1 53  ? -2.673  14.657  50.048  1.00 103.42 ? 53  ALA A CB    1 
ATOM   318   N  N     . GLY A 1 54  ? -5.025  13.154  48.468  1.00 106.00 ? 54  GLY A N     1 
ATOM   319   C  CA    . GLY A 1 54  ? -6.332  13.221  47.841  1.00 103.82 ? 54  GLY A CA    1 
ATOM   320   C  C     . GLY A 1 54  ? -6.601  14.618  47.321  1.00 99.30  ? 54  GLY A C     1 
ATOM   321   O  O     . GLY A 1 54  ? -5.754  15.498  47.451  1.00 96.70  ? 54  GLY A O     1 
ATOM   322   N  N     . GLY A 1 55  ? -7.776  14.828  46.737  1.00 93.55  ? 55  GLY A N     1 
ATOM   323   C  CA    . GLY A 1 55  ? -8.143  16.137  46.226  1.00 90.40  ? 55  GLY A CA    1 
ATOM   324   C  C     . GLY A 1 55  ? -7.285  16.623  45.072  1.00 84.51  ? 55  GLY A C     1 
ATOM   325   O  O     . GLY A 1 55  ? -6.518  15.865  44.484  1.00 85.74  ? 55  GLY A O     1 
ATOM   326   N  N     . VAL A 1 56  ? -7.433  17.899  44.738  1.00 87.77  ? 56  VAL A N     1 
ATOM   327   C  CA    . VAL A 1 56  ? -6.682  18.491  43.640  1.00 84.74  ? 56  VAL A CA    1 
ATOM   328   C  C     . VAL A 1 56  ? -5.381  19.106  44.158  1.00 90.39  ? 56  VAL A C     1 
ATOM   329   O  O     . VAL A 1 56  ? -5.301  20.316  44.388  1.00 89.79  ? 56  VAL A O     1 
ATOM   330   C  CB    . VAL A 1 56  ? -7.521  19.556  42.905  1.00 83.98  ? 56  VAL A CB    1 
ATOM   331   C  CG1   . VAL A 1 56  ? -6.820  20.014  41.631  1.00 77.25  ? 56  VAL A CG1   1 
ATOM   332   C  CG2   . VAL A 1 56  ? -8.890  18.998  42.571  1.00 75.50  ? 56  VAL A CG2   1 
ATOM   333   N  N     . THR A 1 57  ? -4.364  18.262  44.348  1.00 91.02  ? 57  THR A N     1 
ATOM   334   C  CA    . THR A 1 57  ? -3.097  18.691  44.941  1.00 87.86  ? 57  THR A CA    1 
ATOM   335   C  C     . THR A 1 57  ? -1.879  18.218  44.147  1.00 87.15  ? 57  THR A C     1 
ATOM   336   O  O     . THR A 1 57  ? -1.824  17.074  43.695  1.00 84.43  ? 57  THR A O     1 
ATOM   337   C  CB    . THR A 1 57  ? -2.945  18.177  46.397  1.00 95.68  ? 57  THR A CB    1 
ATOM   338   O  OG1   . THR A 1 57  ? -2.332  16.879  46.392  1.00 99.04  ? 57  THR A OG1   1 
ATOM   339   C  CG2   . THR A 1 57  ? -4.292  18.091  47.088  1.00 89.03  ? 57  THR A CG2   1 
ATOM   340   N  N     . VAL A 1 58  ? -0.901  19.107  43.993  1.00 87.69  ? 58  VAL A N     1 
ATOM   341   C  CA    . VAL A 1 58  ? 0.344   18.786  43.301  1.00 92.29  ? 58  VAL A CA    1 
ATOM   342   C  C     . VAL A 1 58  ? 1.577   19.288  44.068  1.00 93.80  ? 58  VAL A C     1 
ATOM   343   O  O     . VAL A 1 58  ? 1.459   20.013  45.060  1.00 88.79  ? 58  VAL A O     1 
ATOM   344   C  CB    . VAL A 1 58  ? 0.370   19.386  41.867  1.00 87.93  ? 58  VAL A CB    1 
ATOM   345   C  CG1   . VAL A 1 58  ? -0.794  18.853  41.021  1.00 76.44  ? 58  VAL A CG1   1 
ATOM   346   C  CG2   . VAL A 1 58  ? 0.344   20.903  41.924  1.00 78.46  ? 58  VAL A CG2   1 
ATOM   347   N  N     . ARG A 1 59  ? 2.757   18.890  43.595  1.00 99.98  ? 59  ARG A N     1 
ATOM   348   C  CA    . ARG A 1 59  ? 4.022   19.358  44.151  1.00 98.55  ? 59  ARG A CA    1 
ATOM   349   C  C     . ARG A 1 59  ? 4.258   20.831  43.835  1.00 101.20 ? 59  ARG A C     1 
ATOM   350   O  O     . ARG A 1 59  ? 4.074   21.264  42.699  1.00 100.95 ? 59  ARG A O     1 
ATOM   351   C  CB    . ARG A 1 59  ? 5.188   18.519  43.612  1.00 101.87 ? 59  ARG A CB    1 
ATOM   352   C  CG    . ARG A 1 59  ? 6.562   19.032  44.032  1.00 108.12 ? 59  ARG A CG    1 
ATOM   353   C  CD    . ARG A 1 59  ? 7.697   18.124  43.568  1.00 111.64 ? 59  ARG A CD    1 
ATOM   354   N  NE    . ARG A 1 59  ? 7.968   18.207  42.135  1.00 111.13 ? 59  ARG A NE    1 
ATOM   355   C  CZ    . ARG A 1 59  ? 8.682   19.173  41.566  1.00 112.66 ? 59  ARG A CZ    1 
ATOM   356   N  NH1   . ARG A 1 59  ? 9.182   20.155  42.306  1.00 112.27 ? 59  ARG A NH1   1 
ATOM   357   N  NH2   . ARG A 1 59  ? 8.889   19.166  40.255  1.00 110.23 ? 59  ARG A NH2   1 
ATOM   358   N  N     . MET A 1 60  ? 4.671   21.597  44.839  1.00 102.25 ? 60  MET A N     1 
ATOM   359   C  CA    . MET A 1 60  ? 5.127   22.965  44.617  1.00 104.79 ? 60  MET A CA    1 
ATOM   360   C  C     . MET A 1 60  ? 6.425   23.214  45.381  1.00 108.16 ? 60  MET A C     1 
ATOM   361   O  O     . MET A 1 60  ? 6.406   23.469  46.586  1.00 105.66 ? 60  MET A O     1 
ATOM   362   C  CB    . MET A 1 60  ? 4.055   23.973  45.040  1.00 99.39  ? 60  MET A CB    1 
ATOM   363   C  CG    . MET A 1 60  ? 4.473   25.424  44.861  1.00 97.66  ? 60  MET A CG    1 
ATOM   364   S  SD    . MET A 1 60  ? 3.128   26.593  45.148  1.00 94.29  ? 60  MET A SD    1 
ATOM   365   C  CE    . MET A 1 60  ? 2.783   26.325  46.885  1.00 102.45 ? 60  MET A CE    1 
ATOM   366   N  N     . GLY A 1 61  ? 7.547   23.156  44.669  1.00 109.25 ? 61  GLY A N     1 
ATOM   367   C  CA    . GLY A 1 61  ? 8.852   23.244  45.300  1.00 113.32 ? 61  GLY A CA    1 
ATOM   368   C  C     . GLY A 1 61  ? 9.071   22.016  46.164  1.00 116.06 ? 61  GLY A C     1 
ATOM   369   O  O     . GLY A 1 61  ? 9.038   20.887  45.667  1.00 115.46 ? 61  GLY A O     1 
ATOM   370   N  N     . ASP A 1 62  ? 9.293   22.234  47.458  1.00 116.32 ? 62  ASP A N     1 
ATOM   371   C  CA    . ASP A 1 62  ? 9.391   21.130  48.407  1.00 118.19 ? 62  ASP A CA    1 
ATOM   372   C  C     . ASP A 1 62  ? 8.120   21.094  49.245  1.00 116.88 ? 62  ASP A C     1 
ATOM   373   O  O     . ASP A 1 62  ? 8.096   20.521  50.337  1.00 117.60 ? 62  ASP A O     1 
ATOM   374   C  CB    . ASP A 1 62  ? 10.616  21.269  49.316  1.00 116.32 ? 62  ASP A CB    1 
ATOM   375   C  CG    . ASP A 1 62  ? 10.541  22.489  50.220  1.00 116.55 ? 62  ASP A CG    1 
ATOM   376   O  OD1   . ASP A 1 62  ? 9.821   23.451  49.871  1.00 117.91 ? 62  ASP A OD1   1 
ATOM   377   O  OD2   . ASP A 1 62  ? 11.194  22.483  51.288  1.00 115.07 ? 62  ASP A OD2   1 
ATOM   378   N  N     . GLY A 1 63  ? 7.068   21.722  48.725  1.00 114.73 ? 63  GLY A N     1 
ATOM   379   C  CA    . GLY A 1 63  ? 5.783   21.743  49.396  1.00 110.76 ? 63  GLY A CA    1 
ATOM   380   C  C     . GLY A 1 63  ? 4.660   21.317  48.471  1.00 106.63 ? 63  GLY A C     1 
ATOM   381   O  O     . GLY A 1 63  ? 4.902   20.789  47.384  1.00 105.10 ? 63  GLY A O     1 
ATOM   382   N  N     . LEU A 1 64  ? 3.429   21.588  48.883  1.00 105.83 ? 64  LEU A N     1 
ATOM   383   C  CA    . LEU A 1 64  ? 2.260   21.127  48.147  1.00 100.95 ? 64  LEU A CA    1 
ATOM   384   C  C     . LEU A 1 64  ? 1.282   22.263  47.890  1.00 104.25 ? 64  LEU A C     1 
ATOM   385   O  O     . LEU A 1 64  ? 0.976   23.043  48.784  1.00 103.49 ? 64  LEU A O     1 
ATOM   386   C  CB    . LEU A 1 64  ? 1.565   20.002  48.916  1.00 97.73  ? 64  LEU A CB    1 
ATOM   387   C  CG    . LEU A 1 64  ? 1.690   18.575  48.379  1.00 98.11  ? 64  LEU A CG    1 
ATOM   388   C  CD1   . LEU A 1 64  ? 3.115   18.256  47.978  1.00 101.61 ? 64  LEU A CD1   1 
ATOM   389   C  CD2   . LEU A 1 64  ? 1.197   17.580  49.416  1.00 96.15  ? 64  LEU A CD2   1 
ATOM   390   N  N     . ALA A 1 65  ? 0.769   22.342  46.671  1.00 101.23 ? 65  ALA A N     1 
ATOM   391   C  CA    . ALA A 1 65  ? -0.281  23.306  46.385  1.00 99.79  ? 65  ALA A CA    1 
ATOM   392   C  C     . ALA A 1 65  ? -1.563  22.557  46.084  1.00 95.42  ? 65  ALA A C     1 
ATOM   393   O  O     . ALA A 1 65  ? -1.539  21.491  45.474  1.00 93.09  ? 65  ALA A O     1 
ATOM   394   C  CB    . ALA A 1 65  ? 0.109   24.206  45.221  1.00 95.77  ? 65  ALA A CB    1 
ATOM   395   N  N     . SER A 1 66  ? -2.684  23.114  46.518  1.00 95.81  ? 66  SER A N     1 
ATOM   396   C  CA    . SER A 1 66  ? -3.960  22.441  46.346  1.00 94.95  ? 66  SER A CA    1 
ATOM   397   C  C     . SER A 1 66  ? -5.055  23.466  46.127  1.00 96.68  ? 66  SER A C     1 
ATOM   398   O  O     . SER A 1 66  ? -4.993  24.566  46.667  1.00 96.10  ? 66  SER A O     1 
ATOM   399   C  CB    . SER A 1 66  ? -4.279  21.570  47.562  1.00 93.96  ? 66  SER A CB    1 
ATOM   400   O  OG    . SER A 1 66  ? -5.546  20.949  47.435  1.00 99.01  ? 66  SER A OG    1 
ATOM   401   N  N     . TRP A 1 67  ? -6.057  23.102  45.334  1.00 90.89  ? 67  TRP A N     1 
ATOM   402   C  CA    . TRP A 1 67  ? -7.199  23.976  45.114  1.00 92.61  ? 67  TRP A CA    1 
ATOM   403   C  C     . TRP A 1 67  ? -8.339  23.503  45.993  1.00 96.19  ? 67  TRP A C     1 
ATOM   404   O  O     . TRP A 1 67  ? -9.402  24.124  46.057  1.00 92.95  ? 67  TRP A O     1 
ATOM   405   C  CB    . TRP A 1 67  ? -7.619  23.983  43.643  1.00 88.48  ? 67  TRP A CB    1 
ATOM   406   C  CG    . TRP A 1 67  ? -6.813  24.905  42.794  1.00 77.37  ? 67  TRP A CG    1 
ATOM   407   C  CD1   . TRP A 1 67  ? -5.990  25.903  43.222  1.00 81.01  ? 67  TRP A CD1   1 
ATOM   408   C  CD2   . TRP A 1 67  ? -6.758  24.924  41.364  1.00 75.98  ? 67  TRP A CD2   1 
ATOM   409   N  NE1   . TRP A 1 67  ? -5.419  26.540  42.147  1.00 80.22  ? 67  TRP A NE1   1 
ATOM   410   C  CE2   . TRP A 1 67  ? -5.875  25.957  40.992  1.00 77.43  ? 67  TRP A CE2   1 
ATOM   411   C  CE3   . TRP A 1 67  ? -7.370  24.166  40.359  1.00 69.87  ? 67  TRP A CE3   1 
ATOM   412   C  CZ2   . TRP A 1 67  ? -5.586  26.254  39.659  1.00 72.66  ? 67  TRP A CZ2   1 
ATOM   413   C  CZ3   . TRP A 1 67  ? -7.086  24.461  39.039  1.00 68.49  ? 67  TRP A CZ3   1 
ATOM   414   C  CH2   . TRP A 1 67  ? -6.202  25.496  38.700  1.00 68.64  ? 67  TRP A CH2   1 
ATOM   415   N  N     . SER A 1 68  ? -8.093  22.396  46.683  1.00 99.85  ? 68  SER A N     1 
ATOM   416   C  CA    . SER A 1 68  ? -9.055  21.859  47.625  1.00 104.28 ? 68  SER A CA    1 
ATOM   417   C  C     . SER A 1 68  ? -8.746  22.387  49.018  1.00 108.09 ? 68  SER A C     1 
ATOM   418   O  O     . SER A 1 68  ? -7.588  22.404  49.442  1.00 106.71 ? 68  SER A O     1 
ATOM   419   C  CB    . SER A 1 68  ? -9.018  20.326  47.620  1.00 104.11 ? 68  SER A CB    1 
ATOM   420   O  OG    . SER A 1 68  ? -9.318  19.799  46.339  1.00 98.43  ? 68  SER A OG    1 
ATOM   421   N  N     . PRO A 1 69  ? -9.790  22.827  49.734  1.00 111.59 ? 69  PRO A N     1 
ATOM   422   C  CA    . PRO A 1 69  ? -9.679  23.289  51.119  1.00 112.44 ? 69  PRO A CA    1 
ATOM   423   C  C     . PRO A 1 69  ? -9.245  22.147  52.031  1.00 117.41 ? 69  PRO A C     1 
ATOM   424   O  O     . PRO A 1 69  ? -9.607  21.001  51.768  1.00 117.85 ? 69  PRO A O     1 
ATOM   425   C  CB    . PRO A 1 69  ? -11.096 23.774  51.449  1.00 111.81 ? 69  PRO A CB    1 
ATOM   426   C  CG    . PRO A 1 69  ? -11.751 23.995  50.125  1.00 110.32 ? 69  PRO A CG    1 
ATOM   427   C  CD    . PRO A 1 69  ? -11.159 22.971  49.215  1.00 110.10 ? 69  PRO A CD    1 
ATOM   428   N  N     . PRO A 1 70  ? -8.467  22.453  53.083  1.00 120.48 ? 70  PRO A N     1 
ATOM   429   C  CA    . PRO A 1 70  ? -7.912  21.463  54.018  1.00 118.00 ? 70  PRO A CA    1 
ATOM   430   C  C     . PRO A 1 70  ? -8.967  20.545  54.641  1.00 118.84 ? 70  PRO A C     1 
ATOM   431   O  O     . PRO A 1 70  ? -8.621  19.487  55.165  1.00 120.79 ? 70  PRO A O     1 
ATOM   432   C  CB    . PRO A 1 70  ? -7.246  22.334  55.090  1.00 114.80 ? 70  PRO A CB    1 
ATOM   433   C  CG    . PRO A 1 70  ? -6.916  23.600  54.385  1.00 114.03 ? 70  PRO A CG    1 
ATOM   434   C  CD    . PRO A 1 70  ? -8.049  23.823  53.428  1.00 115.06 ? 70  PRO A CD    1 
ATOM   435   N  N     . GLU A 1 71  ? -10.232 20.950  54.579  1.00 120.87 ? 71  GLU A N     1 
ATOM   436   C  CA    . GLU A 1 71  ? -11.332 20.181  55.153  1.00 121.79 ? 71  GLU A CA    1 
ATOM   437   C  C     . GLU A 1 71  ? -11.438 18.770  54.564  1.00 120.64 ? 71  GLU A C     1 
ATOM   438   O  O     . GLU A 1 71  ? -11.952 17.857  55.214  1.00 120.66 ? 71  GLU A O     1 
ATOM   439   C  CB    . GLU A 1 71  ? -12.660 20.915  54.920  1.00 118.77 ? 71  GLU A CB    1 
ATOM   440   C  CG    . GLU A 1 71  ? -12.946 22.088  55.850  1.00 121.93 ? 71  GLU A CG    1 
ATOM   441   C  CD    . GLU A 1 71  ? -12.037 23.281  55.601  1.00 121.88 ? 71  GLU A CD    1 
ATOM   442   O  OE1   . GLU A 1 71  ? -12.028 24.209  56.437  1.00 123.90 ? 71  GLU A OE1   1 
ATOM   443   O  OE2   . GLU A 1 71  ? -11.343 23.303  54.563  1.00 119.76 ? 71  GLU A OE2   1 
ATOM   444   N  N     . VAL A 1 72  ? -10.961 18.599  53.333  1.00 119.52 ? 72  VAL A N     1 
ATOM   445   C  CA    . VAL A 1 72  ? -11.063 17.316  52.640  1.00 121.31 ? 72  VAL A CA    1 
ATOM   446   C  C     . VAL A 1 72  ? -9.748  16.539  52.509  1.00 121.02 ? 72  VAL A C     1 
ATOM   447   O  O     . VAL A 1 72  ? -9.740  15.409  52.019  1.00 120.71 ? 72  VAL A O     1 
ATOM   448   C  CB    . VAL A 1 72  ? -11.647 17.506  51.225  1.00 122.20 ? 72  VAL A CB    1 
ATOM   449   C  CG1   . VAL A 1 72  ? -13.042 18.115  51.299  1.00 115.75 ? 72  VAL A CG1   1 
ATOM   450   C  CG2   . VAL A 1 72  ? -10.720 18.371  50.381  1.00 117.73 ? 72  VAL A CG2   1 
ATOM   451   N  N     . LEU A 1 73  ? -8.638  17.132  52.936  1.00 118.98 ? 73  LEU A N     1 
ATOM   452   C  CA    . LEU A 1 73  ? -7.353  16.441  52.846  1.00 120.10 ? 73  LEU A CA    1 
ATOM   453   C  C     . LEU A 1 73  ? -7.142  15.394  53.935  1.00 121.24 ? 73  LEU A C     1 
ATOM   454   O  O     . LEU A 1 73  ? -7.747  15.449  55.007  1.00 122.09 ? 73  LEU A O     1 
ATOM   455   C  CB    . LEU A 1 73  ? -6.199  17.447  52.887  1.00 120.76 ? 73  LEU A CB    1 
ATOM   456   C  CG    . LEU A 1 73  ? -6.037  18.365  51.674  1.00 118.98 ? 73  LEU A CG    1 
ATOM   457   C  CD1   . LEU A 1 73  ? -4.962  19.412  51.924  1.00 115.81 ? 73  LEU A CD1   1 
ATOM   458   C  CD2   . LEU A 1 73  ? -5.699  17.536  50.447  1.00 111.66 ? 73  LEU A CD2   1 
ATOM   459   N  N     . VAL A 1 74  ? -6.281  14.429  53.632  1.00 120.94 ? 74  VAL A N     1 
ATOM   460   C  CA    . VAL A 1 74  ? -5.801  13.478  54.623  1.00 121.92 ? 74  VAL A CA    1 
ATOM   461   C  C     . VAL A 1 74  ? -4.344  13.795  54.939  1.00 122.84 ? 74  VAL A C     1 
ATOM   462   O  O     . VAL A 1 74  ? -3.429  13.217  54.348  1.00 118.63 ? 74  VAL A O     1 
ATOM   463   C  CB    . VAL A 1 74  ? -5.949  12.052  54.122  1.00 119.04 ? 74  VAL A CB    1 
ATOM   464   N  N     . LEU A 1 75  ? -4.138  14.734  55.860  1.00 123.44 ? 75  LEU A N     1 
ATOM   465   C  CA    . LEU A 1 75  ? -2.799  15.176  56.227  1.00 122.52 ? 75  LEU A CA    1 
ATOM   466   C  C     . LEU A 1 75  ? -2.012  14.032  56.843  1.00 125.17 ? 75  LEU A C     1 
ATOM   467   O  O     . LEU A 1 75  ? -0.996  13.593  56.300  1.00 123.77 ? 75  LEU A O     1 
ATOM   468   C  CB    . LEU A 1 75  ? -2.867  16.351  57.203  1.00 122.19 ? 75  LEU A CB    1 
ATOM   469   C  CG    . LEU A 1 75  ? -3.581  17.606  56.699  1.00 122.40 ? 75  LEU A CG    1 
ATOM   470   C  CD1   . LEU A 1 75  ? -3.589  18.698  57.762  1.00 119.83 ? 75  LEU A CD1   1 
ATOM   471   C  CD2   . LEU A 1 75  ? -2.932  18.099  55.422  1.00 120.36 ? 75  LEU A CD2   1 
ATOM   472   N  N     . GLU A 1 76  ? -2.493  13.553  57.984  1.00 126.69 ? 76  GLU A N     1 
ATOM   473   C  CA    . GLU A 1 76  ? -1.898  12.397  58.632  1.00 126.34 ? 76  GLU A CA    1 
ATOM   474   C  C     . GLU A 1 76  ? -2.238  11.136  57.855  1.00 126.43 ? 76  GLU A C     1 
ATOM   475   O  O     . GLU A 1 76  ? -3.356  10.624  57.943  1.00 121.70 ? 76  GLU A O     1 
ATOM   476   C  CB    . GLU A 1 76  ? -2.375  12.283  60.069  1.00 125.38 ? 76  GLU A CB    1 
ATOM   477   N  N     . GLY A 1 77  ? -1.277  10.647  57.080  1.00 125.45 ? 77  GLY A N     1 
ATOM   478   C  CA    . GLY A 1 77  ? -1.451  9.383   56.396  1.00 125.18 ? 77  GLY A CA    1 
ATOM   479   C  C     . GLY A 1 77  ? -0.225  8.508   56.532  1.00 128.38 ? 77  GLY A C     1 
ATOM   480   O  O     . GLY A 1 77  ? 0.713   8.838   57.259  1.00 127.58 ? 77  GLY A O     1 
ATOM   481   N  N     . THR A 1 78  ? -0.229  7.390   55.816  1.00 130.15 ? 78  THR A N     1 
ATOM   482   C  CA    . THR A 1 78  ? 0.883   6.452   55.853  1.00 131.52 ? 78  THR A CA    1 
ATOM   483   C  C     . THR A 1 78  ? 1.352   6.126   54.442  1.00 132.07 ? 78  THR A C     1 
ATOM   484   O  O     . THR A 1 78  ? 0.877   5.171   53.827  1.00 130.66 ? 78  THR A O     1 
ATOM   485   C  CB    . THR A 1 78  ? 0.501   5.149   56.583  1.00 129.53 ? 78  THR A CB    1 
ATOM   486   O  OG1   . THR A 1 78  ? -0.679  4.593   55.990  1.00 130.73 ? 78  THR A OG1   1 
ATOM   487   C  CG2   . THR A 1 78  ? 0.240   5.421   58.058  1.00 125.49 ? 78  THR A CG2   1 
ATOM   488   N  N     . LEU A 1 79  ? 2.281   6.927   53.932  1.00 132.36 ? 79  LEU A N     1 
ATOM   489   C  CA    . LEU A 1 79  ? 2.819   6.710   52.596  1.00 132.60 ? 79  LEU A CA    1 
ATOM   490   C  C     . LEU A 1 79  ? 3.642   5.430   52.550  1.00 134.33 ? 79  LEU A C     1 
ATOM   491   O  O     . LEU A 1 79  ? 4.624   5.285   53.280  1.00 134.29 ? 79  LEU A O     1 
ATOM   492   C  CB    . LEU A 1 79  ? 3.660   7.898   52.159  1.00 131.55 ? 79  LEU A CB    1 
ATOM   493   N  N     . ALA A 1 80  ? 3.232   4.503   51.690  1.00 136.16 ? 80  ALA A N     1 
ATOM   494   C  CA    . ALA A 1 80  ? 3.936   3.237   51.527  1.00 135.30 ? 80  ALA A CA    1 
ATOM   495   C  C     . ALA A 1 80  ? 4.694   3.197   50.200  1.00 137.22 ? 80  ALA A C     1 
ATOM   496   O  O     . ALA A 1 80  ? 4.124   2.860   49.161  1.00 135.91 ? 80  ALA A O     1 
ATOM   497   C  CB    . ALA A 1 80  ? 2.958   2.074   51.618  1.00 130.05 ? 80  ALA A CB    1 
ATOM   498   N  N     . ARG A 1 81  ? 5.979   3.542   50.244  1.00 136.95 ? 81  ARG A N     1 
ATOM   499   C  CA    . ARG A 1 81  ? 6.820   3.541   49.049  1.00 136.45 ? 81  ARG A CA    1 
ATOM   500   C  C     . ARG A 1 81  ? 7.255   2.125   48.672  1.00 138.87 ? 81  ARG A C     1 
ATOM   501   O  O     . ARG A 1 81  ? 6.766   1.146   49.238  1.00 137.20 ? 81  ARG A O     1 
ATOM   502   C  CB    . ARG A 1 81  ? 8.034   4.429   49.257  1.00 132.86 ? 81  ARG A CB    1 
ATOM   503   N  N     . MET A 1 82  ? 8.174   2.020   47.715  1.00 139.48 ? 82  MET A N     1 
ATOM   504   C  CA    . MET A 1 82  ? 8.638   0.717   47.242  1.00 138.92 ? 82  MET A CA    1 
ATOM   505   C  C     . MET A 1 82  ? 10.007  0.374   47.815  1.00 138.01 ? 82  MET A C     1 
ATOM   506   O  O     . MET A 1 82  ? 10.445  -0.775  47.755  1.00 136.31 ? 82  MET A O     1 
ATOM   507   C  CB    . MET A 1 82  ? 8.679   0.686   45.721  1.00 137.89 ? 82  MET A CB    1 
ATOM   508   N  N     . GLY A 1 83  ? 10.678  1.379   48.368  1.00 137.03 ? 83  GLY A N     1 
ATOM   509   C  CA    . GLY A 1 83  ? 11.969  1.178   48.994  1.00 133.72 ? 83  GLY A CA    1 
ATOM   510   C  C     . GLY A 1 83  ? 11.884  1.347   50.498  1.00 133.54 ? 83  GLY A C     1 
ATOM   511   O  O     . GLY A 1 83  ? 12.186  0.424   51.255  1.00 129.29 ? 83  GLY A O     1 
ATOM   512   N  N     . GLN A 1 84  ? 11.458  2.531   50.929  1.00 134.34 ? 84  GLN A N     1 
ATOM   513   C  CA    . GLN A 1 84  ? 11.371  2.841   52.352  1.00 133.96 ? 84  GLN A CA    1 
ATOM   514   C  C     . GLN A 1 84  ? 10.011  3.425   52.734  1.00 134.34 ? 84  GLN A C     1 
ATOM   515   O  O     . GLN A 1 84  ? 9.575   4.428   52.166  1.00 135.06 ? 84  GLN A O     1 
ATOM   516   C  CB    . GLN A 1 84  ? 12.486  3.803   52.747  1.00 126.41 ? 84  GLN A CB    1 
ATOM   517   N  N     . THR A 1 85  ? 9.346   2.790   53.696  1.00 131.63 ? 85  THR A N     1 
ATOM   518   C  CA    . THR A 1 85  ? 8.105   3.320   54.253  1.00 132.89 ? 85  THR A CA    1 
ATOM   519   C  C     . THR A 1 85  ? 8.382   4.660   54.938  1.00 133.31 ? 85  THR A C     1 
ATOM   520   O  O     . THR A 1 85  ? 9.109   4.715   55.931  1.00 132.89 ? 85  THR A O     1 
ATOM   521   C  CB    . THR A 1 85  ? 7.466   2.340   55.266  1.00 131.09 ? 85  THR A CB    1 
ATOM   522   O  OG1   . THR A 1 85  ? 7.129   1.111   54.607  1.00 126.69 ? 85  THR A OG1   1 
ATOM   523   C  CG2   . THR A 1 85  ? 6.210   2.940   55.883  1.00 129.31 ? 85  THR A CG2   1 
ATOM   524   N  N     . TYR A 1 86  ? 7.811   5.736   54.402  1.00 133.34 ? 86  TYR A N     1 
ATOM   525   C  CA    . TYR A 1 86  ? 8.083   7.079   54.913  1.00 130.61 ? 86  TYR A CA    1 
ATOM   526   C  C     . TYR A 1 86  ? 6.914   7.643   55.721  1.00 130.79 ? 86  TYR A C     1 
ATOM   527   O  O     . TYR A 1 86  ? 5.815   7.087   55.716  1.00 129.60 ? 86  TYR A O     1 
ATOM   528   C  CB    . TYR A 1 86  ? 8.428   8.015   53.768  1.00 126.79 ? 86  TYR A CB    1 
ATOM   529   N  N     . ALA A 1 87  ? 7.164   8.756   56.408  1.00 130.66 ? 87  ALA A N     1 
ATOM   530   C  CA    . ALA A 1 87  ? 6.171   9.373   57.287  1.00 131.48 ? 87  ALA A CA    1 
ATOM   531   C  C     . ALA A 1 87  ? 5.475   10.567  56.630  1.00 130.98 ? 87  ALA A C     1 
ATOM   532   O  O     . ALA A 1 87  ? 6.131   11.488  56.140  1.00 129.60 ? 87  ALA A O     1 
ATOM   533   C  CB    . ALA A 1 87  ? 6.826   9.800   58.594  1.00 128.06 ? 87  ALA A CB    1 
ATOM   534   N  N     . TYR A 1 88  ? 4.145   10.557  56.641  1.00 128.88 ? 88  TYR A N     1 
ATOM   535   C  CA    . TYR A 1 88  ? 3.363   11.599  55.982  1.00 127.79 ? 88  TYR A CA    1 
ATOM   536   C  C     . TYR A 1 88  ? 2.916   12.703  56.940  1.00 126.87 ? 88  TYR A C     1 
ATOM   537   O  O     . TYR A 1 88  ? 1.989   12.517  57.733  1.00 125.53 ? 88  TYR A O     1 
ATOM   538   C  CB    . TYR A 1 88  ? 2.151   10.985  55.295  1.00 132.28 ? 88  TYR A CB    1 
ATOM   539   N  N     . ARG A 1 89  ? 3.569   13.858  56.841  1.00 123.94 ? 89  ARG A N     1 
ATOM   540   C  CA    . ARG A 1 89  ? 3.205   15.028  57.632  1.00 122.93 ? 89  ARG A CA    1 
ATOM   541   C  C     . ARG A 1 89  ? 3.140   16.279  56.757  1.00 121.07 ? 89  ARG A C     1 
ATOM   542   O  O     . ARG A 1 89  ? 4.170   16.781  56.308  1.00 119.97 ? 89  ARG A O     1 
ATOM   543   C  CB    . ARG A 1 89  ? 4.194   15.229  58.769  1.00 120.27 ? 89  ARG A CB    1 
ATOM   544   N  N     . LEU A 1 90  ? 1.928   16.776  56.519  1.00 119.94 ? 90  LEU A N     1 
ATOM   545   C  CA    . LEU A 1 90  ? 1.727   17.982  55.716  1.00 119.15 ? 90  LEU A CA    1 
ATOM   546   C  C     . LEU A 1 90  ? 1.176   19.119  56.577  1.00 119.78 ? 90  LEU A C     1 
ATOM   547   O  O     . LEU A 1 90  ? 0.318   18.892  57.432  1.00 119.47 ? 90  LEU A O     1 
ATOM   548   C  CB    . LEU A 1 90  ? 0.791   17.695  54.550  1.00 117.37 ? 90  LEU A CB    1 
ATOM   549   N  N     . TYR A 1 91  ? 1.659   20.339  56.341  1.00 117.60 ? 91  TYR A N     1 
ATOM   550   C  CA    . TYR A 1 91  ? 1.300   21.480  57.186  1.00 116.63 ? 91  TYR A CA    1 
ATOM   551   C  C     . TYR A 1 91  ? 0.956   22.748  56.397  1.00 116.42 ? 91  TYR A C     1 
ATOM   552   O  O     . TYR A 1 91  ? 1.790   23.264  55.651  1.00 114.44 ? 91  TYR A O     1 
ATOM   553   C  CB    . TYR A 1 91  ? 2.428   21.773  58.163  1.00 116.82 ? 91  TYR A CB    1 
ATOM   554   N  N     . PRO A 1 92  ? -0.273  23.262  56.588  1.00 115.87 ? 92  PRO A N     1 
ATOM   555   C  CA    . PRO A 1 92  ? -0.829  24.462  55.937  1.00 115.64 ? 92  PRO A CA    1 
ATOM   556   C  C     . PRO A 1 92  ? 0.022   25.731  56.091  1.00 118.24 ? 92  PRO A C     1 
ATOM   557   O  O     . PRO A 1 92  ? 0.137   26.263  57.195  1.00 120.87 ? 92  PRO A O     1 
ATOM   558   C  CB    . PRO A 1 92  ? -2.185  24.647  56.632  1.00 112.99 ? 92  PRO A CB    1 
ATOM   559   C  CG    . PRO A 1 92  ? -2.536  23.309  57.170  1.00 113.69 ? 92  PRO A CG    1 
ATOM   560   C  CD    . PRO A 1 92  ? -1.246  22.615  57.488  1.00 113.21 ? 92  PRO A CD    1 
ATOM   561   N  N     . LYS A 1 93  ? 0.611   26.198  54.991  1.00 117.38 ? 93  LYS A N     1 
ATOM   562   C  CA    . LYS A 1 93  ? 1.412   27.424  54.989  1.00 115.19 ? 93  LYS A CA    1 
ATOM   563   C  C     . LYS A 1 93  ? 0.614   28.629  54.485  1.00 113.92 ? 93  LYS A C     1 
ATOM   564   O  O     . LYS A 1 93  ? 1.194   29.586  53.968  1.00 110.98 ? 93  LYS A O     1 
ATOM   565   C  CB    . LYS A 1 93  ? 2.658   27.249  54.113  1.00 112.46 ? 93  LYS A CB    1 
ATOM   566   C  CG    . LYS A 1 93  ? 3.691   26.272  54.643  1.00 111.28 ? 93  LYS A CG    1 
ATOM   567   C  CD    . LYS A 1 93  ? 4.220   26.704  55.995  1.00 112.33 ? 93  LYS A CD    1 
ATOM   568   C  CE    . LYS A 1 93  ? 5.213   25.693  56.538  1.00 112.48 ? 93  LYS A CE    1 
ATOM   569   N  NZ    . LYS A 1 93  ? 5.556   25.968  57.961  1.00 114.32 ? 93  LYS A NZ    1 
ATOM   570   N  N     . GLY A 1 94  ? -0.710  28.584  54.629  1.00 114.26 ? 94  GLY A N     1 
ATOM   571   C  CA    . GLY A 1 94  ? -1.562  29.652  54.128  1.00 114.90 ? 94  GLY A CA    1 
ATOM   572   C  C     . GLY A 1 94  ? -1.793  29.547  52.629  1.00 113.80 ? 94  GLY A C     1 
ATOM   573   O  O     . GLY A 1 94  ? -1.774  28.455  52.071  1.00 111.58 ? 94  GLY A O     1 
ATOM   574   N  N     . ARG A 1 95  ? -2.024  30.684  51.977  1.00 114.93 ? 95  ARG A N     1 
ATOM   575   C  CA    . ARG A 1 95  ? -2.254  30.722  50.532  1.00 112.41 ? 95  ARG A CA    1 
ATOM   576   C  C     . ARG A 1 95  ? -1.066  31.381  49.829  1.00 112.06 ? 95  ARG A C     1 
ATOM   577   O  O     . ARG A 1 95  ? -0.432  32.282  50.383  1.00 110.87 ? 95  ARG A O     1 
ATOM   578   C  CB    . ARG A 1 95  ? -3.554  31.468  50.221  1.00 107.49 ? 95  ARG A CB    1 
ATOM   579   C  CG    . ARG A 1 95  ? -4.802  30.602  50.297  1.00 104.71 ? 95  ARG A CG    1 
ATOM   580   C  CD    . ARG A 1 95  ? -6.062  31.440  50.132  1.00 108.28 ? 95  ARG A CD    1 
ATOM   581   N  NE    . ARG A 1 95  ? -7.224  30.646  49.739  1.00 109.22 ? 95  ARG A NE    1 
ATOM   582   C  CZ    . ARG A 1 95  ? -8.475  31.100  49.735  1.00 109.85 ? 95  ARG A CZ    1 
ATOM   583   N  NH1   . ARG A 1 95  ? -9.468  30.309  49.352  1.00 107.34 ? 95  ARG A NH1   1 
ATOM   584   N  NH2   . ARG A 1 95  ? -8.739  32.334  50.143  1.00 107.73 ? 95  ARG A NH2   1 
ATOM   585   N  N     . ARG A 1 96  ? -0.763  30.942  48.609  1.00 110.66 ? 96  ARG A N     1 
ATOM   586   C  CA    . ARG A 1 96  ? 0.386   31.507  47.895  1.00 107.35 ? 96  ARG A CA    1 
ATOM   587   C  C     . ARG A 1 96  ? 0.038   31.992  46.488  1.00 105.94 ? 96  ARG A C     1 
ATOM   588   O  O     . ARG A 1 96  ? -0.505  31.241  45.689  1.00 103.48 ? 96  ARG A O     1 
ATOM   589   C  CB    . ARG A 1 96  ? 1.525   30.486  47.829  1.00 104.31 ? 96  ARG A CB    1 
ATOM   590   C  CG    . ARG A 1 96  ? 2.673   30.907  46.930  1.00 104.44 ? 96  ARG A CG    1 
ATOM   591   C  CD    . ARG A 1 96  ? 3.739   29.830  46.832  1.00 100.90 ? 96  ARG A CD    1 
ATOM   592   N  NE    . ARG A 1 96  ? 4.713   30.135  45.788  1.00 100.16 ? 96  ARG A NE    1 
ATOM   593   C  CZ    . ARG A 1 96  ? 5.787   29.399  45.526  1.00 103.46 ? 96  ARG A CZ    1 
ATOM   594   N  NH1   . ARG A 1 96  ? 6.040   28.313  46.244  1.00 101.31 ? 96  ARG A NH1   1 
ATOM   595   N  NH2   . ARG A 1 96  ? 6.616   29.759  44.553  1.00 100.34 ? 96  ARG A NH2   1 
ATOM   596   N  N     . PRO A 1 97  ? 0.340   33.267  46.194  1.00 104.68 ? 97  PRO A N     1 
ATOM   597   C  CA    . PRO A 1 97  ? 0.089   33.876  44.882  1.00 100.77 ? 97  PRO A CA    1 
ATOM   598   C  C     . PRO A 1 97  ? 1.049   33.409  43.787  1.00 98.02  ? 97  PRO A C     1 
ATOM   599   O  O     . PRO A 1 97  ? 2.266   33.456  43.968  1.00 99.47  ? 97  PRO A O     1 
ATOM   600   C  CB    . PRO A 1 97  ? 0.283   35.376  45.150  1.00 105.17 ? 97  PRO A CB    1 
ATOM   601   C  CG    . PRO A 1 97  ? 0.195   35.528  46.641  1.00 105.41 ? 97  PRO A CG    1 
ATOM   602   C  CD    . PRO A 1 97  ? 0.775   34.265  47.183  1.00 107.48 ? 97  PRO A CD    1 
ATOM   603   N  N     . LEU A 1 98  ? 0.497   32.962  42.662  1.00 96.30  ? 98  LEU A N     1 
ATOM   604   C  CA    . LEU A 1 98  ? 1.303   32.528  41.525  1.00 91.49  ? 98  LEU A CA    1 
ATOM   605   C  C     . LEU A 1 98  ? 1.089   33.433  40.314  1.00 93.55  ? 98  LEU A C     1 
ATOM   606   O  O     . LEU A 1 98  ? -0.042  33.796  39.982  1.00 87.18  ? 98  LEU A O     1 
ATOM   607   C  CB    . LEU A 1 98  ? 0.999   31.071  41.148  1.00 88.25  ? 98  LEU A CB    1 
ATOM   608   C  CG    . LEU A 1 98  ? 1.553   29.891  41.966  1.00 93.62  ? 98  LEU A CG    1 
ATOM   609   C  CD1   . LEU A 1 98  ? 1.329   30.017  43.461  1.00 98.28  ? 98  LEU A CD1   1 
ATOM   610   C  CD2   . LEU A 1 98  ? 0.977   28.570  41.465  1.00 84.27  ? 98  LEU A CD2   1 
ATOM   611   N  N     . ASP A 1 99  ? 2.191   33.794  39.662  1.00 96.76  ? 99  ASP A N     1 
ATOM   612   C  CA    . ASP A 1 99  ? 2.153   34.671  38.497  1.00 93.71  ? 99  ASP A CA    1 
ATOM   613   C  C     . ASP A 1 99  ? 2.267   33.816  37.239  1.00 90.80  ? 99  ASP A C     1 
ATOM   614   O  O     . ASP A 1 99  ? 3.317   33.217  36.981  1.00 87.20  ? 99  ASP A O     1 
ATOM   615   C  CB    . ASP A 1 99  ? 3.275   35.720  38.560  1.00 91.89  ? 99  ASP A CB    1 
ATOM   616   C  CG    . ASP A 1 99  ? 3.153   36.792  37.476  1.00 96.88  ? 99  ASP A CG    1 
ATOM   617   O  OD1   . ASP A 1 99  ? 2.059   36.942  36.881  1.00 95.68  ? 99  ASP A OD1   1 
ATOM   618   O  OD2   . ASP A 1 99  ? 4.154   37.507  37.238  1.00 95.90  ? 99  ASP A OD2   1 
ATOM   619   N  N     . PRO A 1 100 ? 1.172   33.744  36.463  1.00 86.41  ? 100 PRO A N     1 
ATOM   620   C  CA    . PRO A 1 100 ? 1.096   32.975  35.215  1.00 83.12  ? 100 PRO A CA    1 
ATOM   621   C  C     . PRO A 1 100 ? 2.210   33.347  34.239  1.00 87.62  ? 100 PRO A C     1 
ATOM   622   O  O     . PRO A 1 100 ? 2.536   32.567  33.339  1.00 84.23  ? 100 PRO A O     1 
ATOM   623   C  CB    . PRO A 1 100 ? -0.274  33.357  34.655  1.00 81.79  ? 100 PRO A CB    1 
ATOM   624   C  CG    . PRO A 1 100 ? -1.077  33.720  35.856  1.00 83.35  ? 100 PRO A CG    1 
ATOM   625   C  CD    . PRO A 1 100 ? -0.109  34.398  36.784  1.00 85.24  ? 100 PRO A CD    1 
ATOM   626   N  N     . LYS A 1 101 ? 2.790   34.530  34.427  1.00 86.82  ? 101 LYS A N     1 
ATOM   627   C  CA    . LYS A 1 101 ? 3.900   34.977  33.604  1.00 83.31  ? 101 LYS A CA    1 
ATOM   628   C  C     . LYS A 1 101 ? 5.175   34.243  34.015  1.00 86.15  ? 101 LYS A C     1 
ATOM   629   O  O     . LYS A 1 101 ? 6.119   34.125  33.230  1.00 81.18  ? 101 LYS A O     1 
ATOM   630   C  CB    . LYS A 1 101 ? 4.074   36.489  33.734  1.00 86.24  ? 101 LYS A CB    1 
ATOM   631   C  CG    . LYS A 1 101 ? 2.879   37.289  33.225  1.00 88.39  ? 101 LYS A CG    1 
ATOM   632   C  CD    . LYS A 1 101 ? 3.110   38.787  33.332  1.00 92.11  ? 101 LYS A CD    1 
ATOM   633   C  CE    . LYS A 1 101 ? 1.900   39.559  32.831  1.00 88.49  ? 101 LYS A CE    1 
ATOM   634   N  NZ    . LYS A 1 101 ? 0.716   39.320  33.704  1.00 92.94  ? 101 LYS A NZ    1 
ATOM   635   N  N     . ASP A 1 102 ? 5.191   33.735  35.243  1.00 85.94  ? 102 ASP A N     1 
ATOM   636   C  CA    . ASP A 1 102 ? 6.349   33.002  35.737  1.00 86.82  ? 102 ASP A CA    1 
ATOM   637   C  C     . ASP A 1 102 ? 6.192   31.513  35.451  1.00 90.17  ? 102 ASP A C     1 
ATOM   638   O  O     . ASP A 1 102 ? 5.289   30.865  35.988  1.00 88.58  ? 102 ASP A O     1 
ATOM   639   C  CB    . ASP A 1 102 ? 6.547   33.241  37.236  1.00 87.78  ? 102 ASP A CB    1 
ATOM   640   C  CG    . ASP A 1 102 ? 7.755   32.508  37.787  1.00 91.73  ? 102 ASP A CG    1 
ATOM   641   O  OD1   . ASP A 1 102 ? 8.717   32.279  37.023  1.00 92.86  ? 102 ASP A OD1   1 
ATOM   642   O  OD2   . ASP A 1 102 ? 7.746   32.164  38.989  1.00 93.84  ? 102 ASP A OD2   1 
ATOM   643   N  N     . PRO A 1 103 ? 7.092   30.967  34.615  1.00 91.01  ? 103 PRO A N     1 
ATOM   644   C  CA    . PRO A 1 103 ? 7.101   29.577  34.146  1.00 87.15  ? 103 PRO A CA    1 
ATOM   645   C  C     . PRO A 1 103 ? 6.907   28.521  35.234  1.00 87.56  ? 103 PRO A C     1 
ATOM   646   O  O     . PRO A 1 103 ? 6.076   27.643  35.036  1.00 90.36  ? 103 PRO A O     1 
ATOM   647   C  CB    . PRO A 1 103 ? 8.482   29.447  33.503  1.00 84.82  ? 103 PRO A CB    1 
ATOM   648   C  CG    . PRO A 1 103 ? 8.733   30.801  32.950  1.00 82.55  ? 103 PRO A CG    1 
ATOM   649   C  CD    . PRO A 1 103 ? 8.150   31.760  33.960  1.00 89.75  ? 103 PRO A CD    1 
ATOM   650   N  N     . GLY A 1 104 ? 7.669   28.567  36.323  1.00 86.44  ? 104 GLY A N     1 
ATOM   651   C  CA    . GLY A 1 104 ? 7.548   27.548  37.354  1.00 80.60  ? 104 GLY A CA    1 
ATOM   652   C  C     . GLY A 1 104 ? 6.180   27.564  38.004  1.00 81.40  ? 104 GLY A C     1 
ATOM   653   O  O     . GLY A 1 104 ? 5.528   26.520  38.174  1.00 84.38  ? 104 GLY A O     1 
ATOM   654   N  N     . GLU A 1 105 ? 5.739   28.767  38.355  1.00 80.45  ? 105 GLU A N     1 
ATOM   655   C  CA    . GLU A 1 105 ? 4.451   28.954  39.007  1.00 86.33  ? 105 GLU A CA    1 
ATOM   656   C  C     . GLU A 1 105 ? 3.301   28.575  38.069  1.00 84.23  ? 105 GLU A C     1 
ATOM   657   O  O     . GLU A 1 105 ? 2.353   27.892  38.479  1.00 82.16  ? 105 GLU A O     1 
ATOM   658   C  CB    . GLU A 1 105 ? 4.317   30.402  39.491  1.00 89.23  ? 105 GLU A CB    1 
ATOM   659   C  CG    . GLU A 1 105 ? 5.306   30.753  40.606  1.00 92.86  ? 105 GLU A CG    1 
ATOM   660   C  CD    . GLU A 1 105 ? 5.204   32.192  41.079  1.00 96.68  ? 105 GLU A CD    1 
ATOM   661   O  OE1   . GLU A 1 105 ? 4.297   32.918  40.618  1.00 95.97  ? 105 GLU A OE1   1 
ATOM   662   O  OE2   . GLU A 1 105 ? 6.028   32.594  41.930  1.00 99.78  ? 105 GLU A OE2   1 
ATOM   663   N  N     . ARG A 1 106 ? 3.407   28.982  36.803  1.00 82.57  ? 106 ARG A N     1 
ATOM   664   C  CA    . ARG A 1 106 ? 2.405   28.624  35.806  1.00 79.38  ? 106 ARG A CA    1 
ATOM   665   C  C     . ARG A 1 106 ? 2.382   27.119  35.627  1.00 75.61  ? 106 ARG A C     1 
ATOM   666   O  O     . ARG A 1 106 ? 1.339   26.550  35.359  1.00 71.47  ? 106 ARG A O     1 
ATOM   667   C  CB    . ARG A 1 106 ? 2.671   29.298  34.456  1.00 83.45  ? 106 ARG A CB    1 
ATOM   668   C  CG    . ARG A 1 106 ? 1.415   29.413  33.596  1.00 75.08  ? 106 ARG A CG    1 
ATOM   669   C  CD    . ARG A 1 106 ? 1.706   29.461  32.099  1.00 77.45  ? 106 ARG A CD    1 
ATOM   670   N  NE    . ARG A 1 106 ? 2.793   30.374  31.761  1.00 89.73  ? 106 ARG A NE    1 
ATOM   671   C  CZ    . ARG A 1 106 ? 3.968   29.986  31.275  1.00 93.55  ? 106 ARG A CZ    1 
ATOM   672   N  NH1   . ARG A 1 106 ? 4.203   28.698  31.056  1.00 91.88  ? 106 ARG A NH1   1 
ATOM   673   N  NH2   . ARG A 1 106 ? 4.904   30.887  30.998  1.00 93.48  ? 106 ARG A NH2   1 
ATOM   674   N  N     . SER A 1 107 ? 3.542   26.485  35.767  1.00 75.05  ? 107 SER A N     1 
ATOM   675   C  CA    . SER A 1 107 ? 3.647   25.032  35.682  1.00 76.30  ? 107 SER A CA    1 
ATOM   676   C  C     . SER A 1 107 ? 2.908   24.393  36.850  1.00 71.13  ? 107 SER A C     1 
ATOM   677   O  O     . SER A 1 107 ? 2.288   23.332  36.707  1.00 76.01  ? 107 SER A O     1 
ATOM   678   C  CB    . SER A 1 107 ? 5.101   24.594  35.661  1.00 79.45  ? 107 SER A CB    1 
ATOM   679   N  N     . VAL A 1 108 ? 2.979   25.038  38.009  1.00 71.24  ? 108 VAL A N     1 
ATOM   680   C  CA    . VAL A 1 108 ? 2.212   24.568  39.162  1.00 76.41  ? 108 VAL A CA    1 
ATOM   681   C  C     . VAL A 1 108 ? 0.704   24.666  38.877  1.00 71.17  ? 108 VAL A C     1 
ATOM   682   O  O     . VAL A 1 108 ? -0.057  23.695  39.080  1.00 69.44  ? 108 VAL A O     1 
ATOM   683   C  CB    . VAL A 1 108 ? 2.563   25.368  40.443  1.00 80.80  ? 108 VAL A CB    1 
ATOM   684   C  CG1   . VAL A 1 108 ? 1.680   24.941  41.603  1.00 81.08  ? 108 VAL A CG1   1 
ATOM   685   C  CG2   . VAL A 1 108 ? 4.030   25.187  40.795  1.00 80.11  ? 108 VAL A CG2   1 
ATOM   686   N  N     . LEU A 1 109 ? 0.278   25.840  38.405  1.00 68.51  ? 109 LEU A N     1 
ATOM   687   C  CA    . LEU A 1 109 ? -1.133  26.067  38.081  1.00 73.50  ? 109 LEU A CA    1 
ATOM   688   C  C     . LEU A 1 109 ? -1.636  25.052  37.054  1.00 62.95  ? 109 LEU A C     1 
ATOM   689   O  O     . LEU A 1 109 ? -2.726  24.513  37.192  1.00 59.21  ? 109 LEU A O     1 
ATOM   690   C  CB    . LEU A 1 109 ? -1.359  27.492  37.560  1.00 73.14  ? 109 LEU A CB    1 
ATOM   691   C  CG    . LEU A 1 109 ? -1.312  28.637  38.574  1.00 73.59  ? 109 LEU A CG    1 
ATOM   692   C  CD1   . LEU A 1 109 ? -1.372  29.992  37.884  1.00 65.88  ? 109 LEU A CD1   1 
ATOM   693   C  CD2   . LEU A 1 109 ? -2.445  28.497  39.572  1.00 74.08  ? 109 LEU A CD2   1 
ATOM   694   N  N     . SER A 1 110 ? -0.810  24.781  36.050  1.00 64.74  ? 110 SER A N     1 
ATOM   695   C  CA    . SER A 1 110 ? -1.131  23.835  34.996  1.00 64.96  ? 110 SER A CA    1 
ATOM   696   C  C     . SER A 1 110 ? -1.247  22.424  35.540  1.00 67.00  ? 110 SER A C     1 
ATOM   697   O  O     . SER A 1 110 ? -2.166  21.693  35.161  1.00 60.42  ? 110 SER A O     1 
ATOM   698   C  CB    . SER A 1 110 ? -0.079  23.875  33.884  1.00 56.02  ? 110 SER A CB    1 
ATOM   699   O  OG    . SER A 1 110 ? -0.153  25.088  33.153  1.00 57.53  ? 110 SER A OG    1 
ATOM   700   N  N     . ALA A 1 111 ? -0.333  22.038  36.433  1.00 62.29  ? 111 ALA A N     1 
ATOM   701   C  CA    . ALA A 1 111 ? -0.417  20.705  37.036  1.00 61.03  ? 111 ALA A CA    1 
ATOM   702   C  C     . ALA A 1 111 ? -1.723  20.571  37.818  1.00 58.48  ? 111 ALA A C     1 
ATOM   703   O  O     . ALA A 1 111 ? -2.359  19.506  37.835  1.00 60.25  ? 111 ALA A O     1 
ATOM   704   C  CB    . ALA A 1 111 ? 0.783   20.442  37.934  1.00 69.69  ? 111 ALA A CB    1 
ATOM   705   N  N     . LEU A 1 112 ? -2.110  21.662  38.473  1.00 62.89  ? 112 LEU A N     1 
ATOM   706   C  CA    . LEU A 1 112 ? -3.395  21.727  39.170  1.00 63.56  ? 112 LEU A CA    1 
ATOM   707   C  C     . LEU A 1 112 ? -4.594  21.569  38.203  1.00 66.78  ? 112 LEU A C     1 
ATOM   708   O  O     . LEU A 1 112 ? -5.577  20.877  38.504  1.00 59.19  ? 112 LEU A O     1 
ATOM   709   C  CB    . LEU A 1 112 ? -3.499  23.044  39.940  1.00 65.17  ? 112 LEU A CB    1 
ATOM   710   C  CG    . LEU A 1 112 ? -2.624  23.133  41.198  1.00 71.57  ? 112 LEU A CG    1 
ATOM   711   C  CD1   . LEU A 1 112 ? -2.633  24.539  41.779  1.00 71.99  ? 112 LEU A CD1   1 
ATOM   712   C  CD2   . LEU A 1 112 ? -3.090  22.134  42.242  1.00 77.55  ? 112 LEU A CD2   1 
ATOM   713   N  N     . ALA A 1 113 ? -4.509  22.232  37.054  1.00 58.39  ? 113 ALA A N     1 
ATOM   714   C  CA    . ALA A 1 113 ? -5.533  22.133  36.021  1.00 62.41  ? 113 ALA A CA    1 
ATOM   715   C  C     . ALA A 1 113 ? -5.687  20.680  35.569  1.00 58.80  ? 113 ALA A C     1 
ATOM   716   O  O     . ALA A 1 113 ? -6.798  20.145  35.473  1.00 55.53  ? 113 ALA A O     1 
ATOM   717   C  CB    . ALA A 1 113 ? -5.174  23.039  34.847  1.00 57.10  ? 113 ALA A CB    1 
ATOM   718   N  N     . ARG A 1 114 ? -4.549  20.047  35.315  1.00 59.70  ? 114 ARG A N     1 
ATOM   719   C  CA    . ARG A 1 114 ? -4.484  18.644  34.923  1.00 57.60  ? 114 ARG A CA    1 
ATOM   720   C  C     . ARG A 1 114 ? -5.128  17.726  35.953  1.00 60.04  ? 114 ARG A C     1 
ATOM   721   O  O     . ARG A 1 114 ? -5.900  16.818  35.610  1.00 58.08  ? 114 ARG A O     1 
ATOM   722   C  CB    . ARG A 1 114 ? -3.028  18.247  34.706  1.00 52.64  ? 114 ARG A CB    1 
ATOM   723   C  CG    . ARG A 1 114 ? -2.819  16.926  33.993  1.00 53.98  ? 114 ARG A CG    1 
ATOM   724   C  CD    . ARG A 1 114 ? -1.551  17.030  33.168  1.00 65.43  ? 114 ARG A CD    1 
ATOM   725   N  NE    . ARG A 1 114 ? -1.392  18.409  32.697  1.00 62.23  ? 114 ARG A NE    1 
ATOM   726   C  CZ    . ARG A 1 114 ? -0.481  18.815  31.818  1.00 63.04  ? 114 ARG A CZ    1 
ATOM   727   N  NH1   . ARG A 1 114 ? 0.377   17.952  31.290  1.00 69.01  ? 114 ARG A NH1   1 
ATOM   728   N  NH2   . ARG A 1 114 ? -0.439  20.091  31.460  1.00 70.82  ? 114 ARG A NH2   1 
ATOM   729   N  N     . ARG A 1 115 ? -4.779  17.945  37.218  1.00 59.95  ? 115 ARG A N     1 
ATOM   730   C  CA    . ARG A 1 115 ? -5.337  17.143  38.303  1.00 65.31  ? 115 ARG A CA    1 
ATOM   731   C  C     . ARG A 1 115 ? -6.852  17.326  38.382  1.00 62.37  ? 115 ARG A C     1 
ATOM   732   O  O     . ARG A 1 115 ? -7.592  16.366  38.602  1.00 62.29  ? 115 ARG A O     1 
ATOM   733   C  CB    . ARG A 1 115 ? -4.656  17.504  39.632  1.00 73.60  ? 115 ARG A CB    1 
ATOM   734   C  CG    . ARG A 1 115 ? -5.232  16.824  40.867  1.00 77.61  ? 115 ARG A CG    1 
ATOM   735   C  CD    . ARG A 1 115 ? -5.216  15.304  40.775  1.00 82.88  ? 115 ARG A CD    1 
ATOM   736   N  NE    . ARG A 1 115 ? -3.893  14.750  40.494  1.00 90.33  ? 115 ARG A NE    1 
ATOM   737   C  CZ    . ARG A 1 115 ? -3.676  13.459  40.253  1.00 94.76  ? 115 ARG A CZ    1 
ATOM   738   N  NH1   . ARG A 1 115 ? -4.698  12.611  40.265  1.00 90.95  ? 115 ARG A NH1   1 
ATOM   739   N  NH2   . ARG A 1 115 ? -2.449  13.014  40.003  1.00 91.23  ? 115 ARG A NH2   1 
ATOM   740   N  N     . LEU A 1 116 ? -7.300  18.563  38.191  1.00 64.20  ? 116 LEU A N     1 
ATOM   741   C  CA    . LEU A 1 116 ? -8.724  18.884  38.124  1.00 65.72  ? 116 LEU A CA    1 
ATOM   742   C  C     . LEU A 1 116 ? -9.415  18.052  37.032  1.00 65.09  ? 116 LEU A C     1 
ATOM   743   O  O     . LEU A 1 116 ? -10.417 17.363  37.284  1.00 63.13  ? 116 LEU A O     1 
ATOM   744   C  CB    . LEU A 1 116 ? -8.890  20.385  37.858  1.00 64.35  ? 116 LEU A CB    1 
ATOM   745   C  CG    . LEU A 1 116 ? -10.224 21.142  37.925  1.00 73.42  ? 116 LEU A CG    1 
ATOM   746   C  CD1   . LEU A 1 116 ? -11.033 20.935  36.654  1.00 70.69  ? 116 LEU A CD1   1 
ATOM   747   C  CD2   . LEU A 1 116 ? -11.035 20.774  39.156  1.00 79.52  ? 116 LEU A CD2   1 
ATOM   748   N  N     . LEU A 1 117 ? -8.842  18.092  35.831  1.00 61.01  ? 117 LEU A N     1 
ATOM   749   C  CA    . LEU A 1 117 ? -9.383  17.350  34.696  1.00 59.57  ? 117 LEU A CA    1 
ATOM   750   C  C     . LEU A 1 117 ? -9.468  15.861  34.999  1.00 62.43  ? 117 LEU A C     1 
ATOM   751   O  O     . LEU A 1 117 ? -10.476 15.222  34.701  1.00 51.87  ? 117 LEU A O     1 
ATOM   752   C  CB    . LEU A 1 117 ? -8.528  17.575  33.445  1.00 53.77  ? 117 LEU A CB    1 
ATOM   753   C  CG    . LEU A 1 117 ? -8.882  16.700  32.231  1.00 53.00  ? 117 LEU A CG    1 
ATOM   754   C  CD1   . LEU A 1 117 ? -10.334 16.873  31.806  1.00 48.36  ? 117 LEU A CD1   1 
ATOM   755   C  CD2   . LEU A 1 117 ? -7.940  16.981  31.067  1.00 48.85  ? 117 LEU A CD2   1 
ATOM   756   N  N     . GLN A 1 118 ? -8.401  15.309  35.575  1.00 59.98  ? 118 GLN A N     1 
ATOM   757   C  CA    . GLN A 1 118 ? -8.385  13.889  35.899  1.00 57.71  ? 118 GLN A CA    1 
ATOM   758   C  C     . GLN A 1 118 ? -9.461  13.541  36.929  1.00 59.23  ? 118 GLN A C     1 
ATOM   759   O  O     . GLN A 1 118 ? -10.149 12.522  36.807  1.00 62.26  ? 118 GLN A O     1 
ATOM   760   C  CB    . GLN A 1 118 ? -7.003  13.469  36.412  1.00 65.45  ? 118 GLN A CB    1 
ATOM   761   C  CG    . GLN A 1 118 ? -6.950  12.027  36.909  1.00 70.62  ? 118 GLN A CG    1 
ATOM   762   C  CD    . GLN A 1 118 ? -5.530  11.534  37.156  1.00 85.94  ? 118 GLN A CD    1 
ATOM   763   O  OE1   . GLN A 1 118 ? -4.619  12.322  37.425  1.00 85.40  ? 118 GLN A OE1   1 
ATOM   764   N  NE2   . GLN A 1 118 ? -5.339  10.223  37.068  1.00 83.20  ? 118 GLN A NE2   1 
ATOM   765   N  N     . GLU A 1 119 ? -9.630  14.400  37.926  1.00 64.17  ? 119 GLU A N     1 
ATOM   766   C  CA    . GLU A 1 119 ? -10.619 14.135  38.967  1.00 67.40  ? 119 GLU A CA    1 
ATOM   767   C  C     . GLU A 1 119 ? -12.037 14.183  38.426  1.00 63.88  ? 119 GLU A C     1 
ATOM   768   O  O     . GLU A 1 119 ? -12.866 13.331  38.756  1.00 68.13  ? 119 GLU A O     1 
ATOM   769   C  CB    . GLU A 1 119 ? -10.471 15.114  40.129  1.00 66.47  ? 119 GLU A CB    1 
ATOM   770   C  CG    . GLU A 1 119 ? -9.158  14.934  40.879  1.00 76.87  ? 119 GLU A CG    1 
ATOM   771   C  CD    . GLU A 1 119 ? -9.003  13.543  41.471  1.00 80.81  ? 119 GLU A CD    1 
ATOM   772   O  OE1   . GLU A 1 119 ? -10.027 12.905  41.802  1.00 84.70  ? 119 GLU A OE1   1 
ATOM   773   O  OE2   . GLU A 1 119 ? -7.847  13.080  41.585  1.00 86.86  ? 119 GLU A OE2   1 
ATOM   774   N  N     . ARG A 1 120 ? -12.333 15.179  37.604  1.00 62.90  ? 120 ARG A N     1 
ATOM   775   C  CA    . ARG A 1 120 ? -13.681 15.263  37.064  1.00 61.88  ? 120 ARG A CA    1 
ATOM   776   C  C     . ARG A 1 120 ? -13.926 14.192  36.007  1.00 61.73  ? 120 ARG A C     1 
ATOM   777   O  O     . ARG A 1 120 ? -15.061 13.758  35.825  1.00 61.99  ? 120 ARG A O     1 
ATOM   778   C  CB    . ARG A 1 120 ? -13.944 16.660  36.521  1.00 68.17  ? 120 ARG A CB    1 
ATOM   779   C  CG    . ARG A 1 120 ? -14.471 17.578  37.615  1.00 76.58  ? 120 ARG A CG    1 
ATOM   780   C  CD    . ARG A 1 120 ? -14.433 19.037  37.236  1.00 79.99  ? 120 ARG A CD    1 
ATOM   781   N  NE    . ARG A 1 120 ? -14.683 19.872  38.407  1.00 86.40  ? 120 ARG A NE    1 
ATOM   782   C  CZ    . ARG A 1 120 ? -14.661 21.201  38.401  1.00 90.07  ? 120 ARG A CZ    1 
ATOM   783   N  NH1   . ARG A 1 120 ? -14.383 21.856  37.281  1.00 86.77  ? 120 ARG A NH1   1 
ATOM   784   N  NH2   . ARG A 1 120 ? -14.903 21.874  39.518  1.00 90.48  ? 120 ARG A NH2   1 
ATOM   785   N  N     . LEU A 1 121 ? -12.867 13.715  35.358  1.00 58.14  ? 121 LEU A N     1 
ATOM   786   C  CA    . LEU A 1 121 ? -13.018 12.578  34.457  1.00 60.74  ? 121 LEU A CA    1 
ATOM   787   C  C     . LEU A 1 121 ? -13.354 11.335  35.255  1.00 66.49  ? 121 LEU A C     1 
ATOM   788   O  O     . LEU A 1 121 ? -14.163 10.516  34.816  1.00 65.29  ? 121 LEU A O     1 
ATOM   789   C  CB    . LEU A 1 121 ? -11.756 12.325  33.630  1.00 53.79  ? 121 LEU A CB    1 
ATOM   790   C  CG    . LEU A 1 121 ? -11.428 13.320  32.519  1.00 57.67  ? 121 LEU A CG    1 
ATOM   791   C  CD1   . LEU A 1 121 ? -10.193 12.891  31.736  1.00 52.92  ? 121 LEU A CD1   1 
ATOM   792   C  CD2   . LEU A 1 121 ? -12.625 13.464  31.604  1.00 59.00  ? 121 LEU A CD2   1 
ATOM   793   N  N     . ARG A 1 122 ? -12.727 11.195  36.424  1.00 62.39  ? 122 ARG A N     1 
ATOM   794   C  CA    . ARG A 1 122 ? -12.906 9.996   37.235  1.00 65.45  ? 122 ARG A CA    1 
ATOM   795   C  C     . ARG A 1 122 ? -14.334 9.905   37.763  1.00 68.49  ? 122 ARG A C     1 
ATOM   796   O  O     . ARG A 1 122 ? -14.859 8.809   37.971  1.00 68.75  ? 122 ARG A O     1 
ATOM   797   C  CB    . ARG A 1 122 ? -11.907 9.973   38.390  1.00 70.67  ? 122 ARG A CB    1 
ATOM   798   N  N     . ARG A 1 123 ? -14.958 11.062  37.965  1.00 65.71  ? 123 ARG A N     1 
ATOM   799   C  CA    . ARG A 1 123 ? -16.327 11.128  38.466  1.00 70.51  ? 123 ARG A CA    1 
ATOM   800   C  C     . ARG A 1 123 ? -17.376 11.083  37.347  1.00 70.83  ? 123 ARG A C     1 
ATOM   801   O  O     . ARG A 1 123 ? -18.480 11.602  37.513  1.00 76.90  ? 123 ARG A O     1 
ATOM   802   C  CB    . ARG A 1 123 ? -16.515 12.388  39.309  1.00 68.14  ? 123 ARG A CB    1 
ATOM   803   N  N     . LEU A 1 124 ? -17.040 10.464  36.216  1.00 68.92  ? 124 LEU A N     1 
ATOM   804   C  CA    . LEU A 1 124 ? -18.012 10.297  35.134  1.00 74.55  ? 124 LEU A CA    1 
ATOM   805   C  C     . LEU A 1 124 ? -18.545 8.869   35.089  1.00 76.38  ? 124 LEU A C     1 
ATOM   806   O  O     . LEU A 1 124 ? -17.807 7.915   35.342  1.00 73.54  ? 124 LEU A O     1 
ATOM   807   C  CB    . LEU A 1 124 ? -17.396 10.647  33.774  1.00 67.37  ? 124 LEU A CB    1 
ATOM   808   C  CG    . LEU A 1 124 ? -17.022 12.097  33.461  1.00 67.16  ? 124 LEU A CG    1 
ATOM   809   C  CD1   . LEU A 1 124 ? -16.362 12.173  32.099  1.00 63.00  ? 124 LEU A CD1   1 
ATOM   810   C  CD2   . LEU A 1 124 ? -18.223 13.016  33.521  1.00 59.45  ? 124 LEU A CD2   1 
ATOM   811   N  N     . GLU A 1 125 ? -19.819 8.727   34.736  1.00 78.72  ? 125 GLU A N     1 
ATOM   812   C  CA    . GLU A 1 125 ? -20.426 7.409   34.605  1.00 77.32  ? 125 GLU A CA    1 
ATOM   813   C  C     . GLU A 1 125 ? -20.784 7.132   33.149  1.00 77.56  ? 125 GLU A C     1 
ATOM   814   O  O     . GLU A 1 125 ? -21.197 8.034   32.418  1.00 77.34  ? 125 GLU A O     1 
ATOM   815   C  CB    . GLU A 1 125 ? -21.660 7.303   35.485  1.00 77.59  ? 125 GLU A CB    1 
ATOM   816   N  N     . GLY A 1 126 ? -20.615 5.883   32.729  1.00 76.00  ? 126 GLY A N     1 
ATOM   817   C  CA    . GLY A 1 126 ? -21.031 5.474   31.401  1.00 81.19  ? 126 GLY A CA    1 
ATOM   818   C  C     . GLY A 1 126 ? -19.958 5.543   30.330  1.00 80.06  ? 126 GLY A C     1 
ATOM   819   O  O     . GLY A 1 126 ? -20.224 5.207   29.173  1.00 77.41  ? 126 GLY A O     1 
ATOM   820   N  N     . VAL A 1 127 ? -18.754 5.980   30.696  1.00 77.30  ? 127 VAL A N     1 
ATOM   821   C  CA    . VAL A 1 127 ? -17.665 6.078   29.725  1.00 68.94  ? 127 VAL A CA    1 
ATOM   822   C  C     . VAL A 1 127 ? -16.418 5.332   30.177  1.00 73.37  ? 127 VAL A C     1 
ATOM   823   O  O     . VAL A 1 127 ? -16.160 5.203   31.371  1.00 76.37  ? 127 VAL A O     1 
ATOM   824   C  CB    . VAL A 1 127 ? -17.270 7.544   29.447  1.00 71.85  ? 127 VAL A CB    1 
ATOM   825   C  CG1   . VAL A 1 127 ? -18.436 8.310   28.833  1.00 72.81  ? 127 VAL A CG1   1 
ATOM   826   C  CG2   . VAL A 1 127 ? -16.794 8.216   30.717  1.00 66.37  ? 127 VAL A CG2   1 
ATOM   827   N  N     . TRP A 1 128 ? -15.643 4.844   29.214  1.00 68.36  ? 128 TRP A N     1 
ATOM   828   C  CA    . TRP A 1 128 ? -14.372 4.209   29.516  1.00 62.62  ? 128 TRP A CA    1 
ATOM   829   C  C     . TRP A 1 128 ? -13.283 5.262   29.717  1.00 66.04  ? 128 TRP A C     1 
ATOM   830   O  O     . TRP A 1 128 ? -12.957 6.016   28.797  1.00 61.79  ? 128 TRP A O     1 
ATOM   831   C  CB    . TRP A 1 128 ? -13.975 3.251   28.394  1.00 60.28  ? 128 TRP A CB    1 
ATOM   832   C  CG    . TRP A 1 128 ? -12.995 2.242   28.833  1.00 63.92  ? 128 TRP A CG    1 
ATOM   833   C  CD1   . TRP A 1 128 ? -11.639 2.316   28.727  1.00 64.08  ? 128 TRP A CD1   1 
ATOM   834   C  CD2   . TRP A 1 128 ? -13.282 0.998   29.474  1.00 70.06  ? 128 TRP A CD2   1 
ATOM   835   N  NE1   . TRP A 1 128 ? -11.062 1.187   29.257  1.00 74.33  ? 128 TRP A NE1   1 
ATOM   836   C  CE2   . TRP A 1 128 ? -12.053 0.359   29.722  1.00 73.01  ? 128 TRP A CE2   1 
ATOM   837   C  CE3   . TRP A 1 128 ? -14.464 0.354   29.856  1.00 74.60  ? 128 TRP A CE3   1 
ATOM   838   C  CZ2   . TRP A 1 128 ? -11.968 -0.889  30.341  1.00 76.62  ? 128 TRP A CZ2   1 
ATOM   839   C  CZ3   . TRP A 1 128 ? -14.378 -0.889  30.471  1.00 79.35  ? 128 TRP A CZ3   1 
ATOM   840   C  CH2   . TRP A 1 128 ? -13.140 -1.494  30.708  1.00 71.86  ? 128 TRP A CH2   1 
ATOM   841   N  N     . VAL A 1 129 ? -12.724 5.319   30.923  1.00 70.12  ? 129 VAL A N     1 
ATOM   842   C  CA    . VAL A 1 129 ? -11.744 6.348   31.255  1.00 58.41  ? 129 VAL A CA    1 
ATOM   843   C  C     . VAL A 1 129 ? -10.388 5.712   31.521  1.00 64.93  ? 129 VAL A C     1 
ATOM   844   O  O     . VAL A 1 129 ? -10.276 4.721   32.245  1.00 71.67  ? 129 VAL A O     1 
ATOM   845   C  CB    . VAL A 1 129 ? -12.189 7.196   32.470  1.00 59.49  ? 129 VAL A CB    1 
ATOM   846   C  CG1   . VAL A 1 129 ? -11.081 8.125   32.933  1.00 62.80  ? 129 VAL A CG1   1 
ATOM   847   C  CG2   . VAL A 1 129 ? -13.425 7.997   32.128  1.00 67.24  ? 129 VAL A CG2   1 
ATOM   848   N  N     . GLU A 1 130 ? -9.359  6.275   30.903  1.00 62.12  ? 130 GLU A N     1 
ATOM   849   C  CA    . GLU A 1 130 ? -8.003  5.801   31.084  1.00 57.55  ? 130 GLU A CA    1 
ATOM   850   C  C     . GLU A 1 130 ? -7.089  7.013   31.171  1.00 62.09  ? 130 GLU A C     1 
ATOM   851   O  O     . GLU A 1 130 ? -6.670  7.566   30.152  1.00 59.89  ? 130 GLU A O     1 
ATOM   852   C  CB    . GLU A 1 130 ? -7.603  4.876   29.932  1.00 66.20  ? 130 GLU A CB    1 
ATOM   853   C  CG    . GLU A 1 130 ? -6.295  4.127   30.133  1.00 64.45  ? 130 GLU A CG    1 
ATOM   854   C  CD    . GLU A 1 130 ? -6.080  3.049   29.078  1.00 72.32  ? 130 GLU A CD    1 
ATOM   855   O  OE1   . GLU A 1 130 ? -6.848  3.013   28.093  1.00 76.52  ? 130 GLU A OE1   1 
ATOM   856   O  OE2   . GLU A 1 130 ? -5.157  2.221   29.240  1.00 74.77  ? 130 GLU A OE2   1 
ATOM   857   N  N     . GLY A 1 131 ? -6.789  7.422   32.401  1.00 64.23  ? 131 GLY A N     1 
ATOM   858   C  CA    . GLY A 1 131 ? -5.954  8.582   32.635  1.00 61.52  ? 131 GLY A CA    1 
ATOM   859   C  C     . GLY A 1 131 ? -6.639  9.864   32.223  1.00 55.76  ? 131 GLY A C     1 
ATOM   860   O  O     . GLY A 1 131 ? -7.677  10.239  32.768  1.00 57.96  ? 131 GLY A O     1 
ATOM   861   N  N     . LEU A 1 132 ? -6.030  10.559  31.272  1.00 52.03  ? 132 LEU A N     1 
ATOM   862   C  CA    . LEU A 1 132 ? -6.648  11.745  30.708  1.00 52.22  ? 132 LEU A CA    1 
ATOM   863   C  C     . LEU A 1 132 ? -7.323  11.409  29.369  1.00 51.01  ? 132 LEU A C     1 
ATOM   864   O  O     . LEU A 1 132 ? -7.517  12.281  28.527  1.00 53.08  ? 132 LEU A O     1 
ATOM   865   C  CB    . LEU A 1 132 ? -5.612  12.858  30.541  1.00 50.89  ? 132 LEU A CB    1 
ATOM   866   C  CG    . LEU A 1 132 ? -4.990  13.413  31.831  1.00 53.65  ? 132 LEU A CG    1 
ATOM   867   C  CD1   . LEU A 1 132 ? -3.956  14.460  31.504  1.00 48.89  ? 132 LEU A CD1   1 
ATOM   868   C  CD2   . LEU A 1 132 ? -6.055  14.010  32.748  1.00 54.58  ? 132 LEU A CD2   1 
ATOM   869   N  N     . ALA A 1 133 ? -7.682  10.143  29.170  1.00 50.70  ? 133 ALA A N     1 
ATOM   870   C  CA    . ALA A 1 133 ? -8.390  9.763   27.953  1.00 50.03  ? 133 ALA A CA    1 
ATOM   871   C  C     . ALA A 1 133 ? -9.807  9.285   28.259  1.00 57.13  ? 133 ALA A C     1 
ATOM   872   O  O     . ALA A 1 133 ? -10.021 8.525   29.205  1.00 59.60  ? 133 ALA A O     1 
ATOM   873   C  CB    . ALA A 1 133 ? -7.617  8.692   27.205  1.00 45.16  ? 133 ALA A CB    1 
ATOM   874   N  N     . VAL A 1 134 ? -10.782 9.744   27.478  1.00 51.73  ? 134 VAL A N     1 
ATOM   875   C  CA    . VAL A 1 134 ? -12.140 9.219   27.611  1.00 51.44  ? 134 VAL A CA    1 
ATOM   876   C  C     . VAL A 1 134 ? -12.631 8.672   26.280  1.00 50.39  ? 134 VAL A C     1 
ATOM   877   O  O     . VAL A 1 134 ? -12.386 9.270   25.229  1.00 46.88  ? 134 VAL A O     1 
ATOM   878   C  CB    . VAL A 1 134 ? -13.140 10.281  28.115  1.00 55.58  ? 134 VAL A CB    1 
ATOM   879   C  CG1   . VAL A 1 134 ? -12.876 10.586  29.568  1.00 63.12  ? 134 VAL A CG1   1 
ATOM   880   C  CG2   . VAL A 1 134 ? -13.042 11.550  27.293  1.00 49.11  ? 134 VAL A CG2   1 
ATOM   881   N  N     . TYR A 1 135 ? -13.336 7.546   26.329  1.00 48.50  ? 135 TYR A N     1 
ATOM   882   C  CA    . TYR A 1 135 ? -13.875 6.923   25.124  1.00 49.34  ? 135 TYR A CA    1 
ATOM   883   C  C     . TYR A 1 135 ? -15.386 6.756   25.286  1.00 51.86  ? 135 TYR A C     1 
ATOM   884   O  O     . TYR A 1 135 ? -15.841 6.029   26.164  1.00 55.75  ? 135 TYR A O     1 
ATOM   885   C  CB    . TYR A 1 135 ? -13.184 5.585   24.850  1.00 48.23  ? 135 TYR A CB    1 
ATOM   886   C  CG    . TYR A 1 135 ? -11.685 5.730   24.747  1.00 49.41  ? 135 TYR A CG    1 
ATOM   887   C  CD1   . TYR A 1 135 ? -11.090 6.006   23.530  1.00 46.77  ? 135 TYR A CD1   1 
ATOM   888   C  CD2   . TYR A 1 135 ? -10.877 5.665   25.874  1.00 46.35  ? 135 TYR A CD2   1 
ATOM   889   C  CE1   . TYR A 1 135 ? -9.733  6.180   23.423  1.00 49.45  ? 135 TYR A CE1   1 
ATOM   890   C  CE2   . TYR A 1 135 ? -9.511  5.824   25.779  1.00 55.48  ? 135 TYR A CE2   1 
ATOM   891   C  CZ    . TYR A 1 135 ? -8.947  6.088   24.548  1.00 52.81  ? 135 TYR A CZ    1 
ATOM   892   O  OH    . TYR A 1 135 ? -7.601  6.255   24.429  1.00 45.67  ? 135 TYR A OH    1 
ATOM   893   N  N     . ARG A 1 136 ? -16.157 7.487   24.481  1.00 60.60  ? 136 ARG A N     1 
ATOM   894   C  CA    . ARG A 1 136 ? -17.609 7.501   24.629  1.00 57.71  ? 136 ARG A CA    1 
ATOM   895   C  C     . ARG A 1 136 ? -18.313 6.609   23.604  1.00 60.53  ? 136 ARG A C     1 
ATOM   896   O  O     . ARG A 1 136 ? -19.074 5.720   23.976  1.00 72.02  ? 136 ARG A O     1 
ATOM   897   C  CB    . ARG A 1 136 ? -18.151 8.947   24.557  1.00 58.18  ? 136 ARG A CB    1 
ATOM   898   C  CG    . ARG A 1 136 ? -17.886 9.734   23.257  1.00 64.05  ? 136 ARG A CG    1 
ATOM   899   C  CD    . ARG A 1 136 ? -18.948 10.854  23.024  1.00 74.26  ? 136 ARG A CD    1 
ATOM   900   N  NE    . ARG A 1 136 ? -18.921 11.439  21.673  1.00 71.87  ? 136 ARG A NE    1 
ATOM   901   C  CZ    . ARG A 1 136 ? -19.512 12.587  21.329  1.00 77.68  ? 136 ARG A CZ    1 
ATOM   902   N  NH1   . ARG A 1 136 ? -20.175 13.297  22.234  1.00 69.77  ? 136 ARG A NH1   1 
ATOM   903   N  NH2   . ARG A 1 136 ? -19.434 13.037  20.080  1.00 73.22  ? 136 ARG A NH2   1 
ATOM   904   N  N     . ARG A 1 137 ? -18.062 6.822   22.318  1.00 62.76  ? 137 ARG A N     1 
ATOM   905   C  CA    . ARG A 1 137 ? -18.856 6.123   21.307  1.00 57.33  ? 137 ARG A CA    1 
ATOM   906   C  C     . ARG A 1 137 ? -18.379 4.713   21.080  1.00 56.86  ? 137 ARG A C     1 
ATOM   907   O  O     . ARG A 1 137 ? -17.239 4.390   21.345  1.00 53.01  ? 137 ARG A O     1 
ATOM   908   C  CB    . ARG A 1 137 ? -18.843 6.871   19.970  1.00 55.07  ? 137 ARG A CB    1 
ATOM   909   C  CG    . ARG A 1 137 ? -19.669 8.125   19.955  1.00 69.20  ? 137 ARG A CG    1 
ATOM   910   C  CD    . ARG A 1 137 ? -19.766 8.705   18.558  1.00 65.61  ? 137 ARG A CD    1 
ATOM   911   N  NE    . ARG A 1 137 ? -20.622 9.889   18.565  1.00 67.50  ? 137 ARG A NE    1 
ATOM   912   C  CZ    . ARG A 1 137 ? -20.728 10.747  17.559  1.00 63.11  ? 137 ARG A CZ    1 
ATOM   913   N  NH1   . ARG A 1 137 ? -20.012 10.573  16.457  1.00 66.73  ? 137 ARG A NH1   1 
ATOM   914   N  NH2   . ARG A 1 137 ? -21.541 11.788  17.665  1.00 70.41  ? 137 ARG A NH2   1 
ATOM   915   N  N     . GLU A 1 138 ? -19.258 3.889   20.536  1.00 55.15  ? 138 GLU A N     1 
ATOM   916   C  CA    . GLU A 1 138 ? -18.872 2.579   20.065  1.00 53.84  ? 138 GLU A CA    1 
ATOM   917   C  C     . GLU A 1 138 ? -18.693 2.657   18.554  1.00 55.26  ? 138 GLU A C     1 
ATOM   918   O  O     . GLU A 1 138 ? -19.582 3.118   17.838  1.00 56.67  ? 138 GLU A O     1 
ATOM   919   C  CB    . GLU A 1 138 ? -19.932 1.550   20.438  1.00 55.31  ? 138 GLU A CB    1 
ATOM   920   C  CG    . GLU A 1 138 ? -19.687 0.174   19.888  1.00 57.69  ? 138 GLU A CG    1 
ATOM   921   C  CD    . GLU A 1 138 ? -20.873 -0.744  20.138  1.00 67.20  ? 138 GLU A CD    1 
ATOM   922   O  OE1   . GLU A 1 138 ? -21.643 -0.491  21.092  1.00 69.10  ? 138 GLU A OE1   1 
ATOM   923   O  OE2   . GLU A 1 138 ? -21.080 -1.668  19.330  1.00 65.04  ? 138 GLU A OE2   1 
ATOM   924   N  N     . HIS A 1 139 ? -17.550 2.174   18.076  1.00 54.37  ? 139 HIS A N     1 
ATOM   925   C  CA    . HIS A 1 139 ? -17.153 2.349   16.682  1.00 55.96  ? 139 HIS A CA    1 
ATOM   926   C  C     . HIS A 1 139 ? -17.229 1.050   15.910  1.00 48.20  ? 139 HIS A C     1 
ATOM   927   O  O     . HIS A 1 139 ? -17.460 1.053   14.700  1.00 54.47  ? 139 HIS A O     1 
ATOM   928   C  CB    . HIS A 1 139 ? -15.722 2.905   16.596  1.00 50.13  ? 139 HIS A CB    1 
ATOM   929   C  CG    . HIS A 1 139 ? -15.262 3.179   15.197  1.00 49.96  ? 139 HIS A CG    1 
ATOM   930   N  ND1   . HIS A 1 139 ? -14.276 2.438   14.579  1.00 50.55  ? 139 HIS A ND1   1 
ATOM   931   C  CD2   . HIS A 1 139 ? -15.655 4.111   14.291  1.00 45.17  ? 139 HIS A CD2   1 
ATOM   932   C  CE1   . HIS A 1 139 ? -14.081 2.899   13.358  1.00 50.16  ? 139 HIS A CE1   1 
ATOM   933   N  NE2   . HIS A 1 139 ? -14.902 3.914   13.157  1.00 46.12  ? 139 HIS A NE2   1 
ATOM   934   N  N     . ALA A 1 140 ? -17.036 -0.057  16.619  1.00 51.16  ? 140 ALA A N     1 
ATOM   935   C  CA    . ALA A 1 140 ? -17.054 -1.381  16.009  1.00 56.97  ? 140 ALA A CA    1 
ATOM   936   C  C     . ALA A 1 140 ? -17.115 -2.455  17.093  1.00 62.75  ? 140 ALA A C     1 
ATOM   937   O  O     . ALA A 1 140 ? -16.703 -2.208  18.231  1.00 56.72  ? 140 ALA A O     1 
ATOM   938   C  CB    . ALA A 1 140 ? -15.840 -1.573  15.115  1.00 51.53  ? 140 ALA A CB    1 
ATOM   939   N  N     . ARG A 1 141 ? -17.628 -3.638  16.741  1.00 67.15  ? 141 ARG A N     1 
ATOM   940   C  CA    . ARG A 1 141 ? -17.893 -4.683  17.733  1.00 69.40  ? 141 ARG A CA    1 
ATOM   941   C  C     . ARG A 1 141 ? -17.500 -6.112  17.343  1.00 70.80  ? 141 ARG A C     1 
ATOM   942   O  O     . ARG A 1 141 ? -17.408 -6.442  16.160  1.00 72.16  ? 141 ARG A O     1 
ATOM   943   C  CB    . ARG A 1 141 ? -19.380 -4.675  18.093  1.00 72.62  ? 141 ARG A CB    1 
ATOM   944   C  CG    . ARG A 1 141 ? -19.624 -4.298  19.532  1.00 74.40  ? 141 ARG A CG    1 
ATOM   945   C  CD    . ARG A 1 141 ? -20.648 -5.193  20.203  1.00 79.71  ? 141 ARG A CD    1 
ATOM   946   N  NE    . ARG A 1 141 ? -20.503 -5.124  21.657  1.00 78.60  ? 141 ARG A NE    1 
ATOM   947   C  CZ    . ARG A 1 141 ? -19.748 -5.951  22.378  1.00 79.61  ? 141 ARG A CZ    1 
ATOM   948   N  NH1   . ARG A 1 141 ? -19.067 -6.932  21.791  1.00 72.33  ? 141 ARG A NH1   1 
ATOM   949   N  NH2   . ARG A 1 141 ? -19.680 -5.799  23.695  1.00 81.25  ? 141 ARG A NH2   1 
ATOM   950   N  N     . GLY A 1 142 ? -17.260 -6.936  18.372  1.00 77.43  ? 142 GLY A N     1 
ATOM   951   C  CA    . GLY A 1 142 ? -17.004 -8.369  18.252  1.00 71.08  ? 142 GLY A CA    1 
ATOM   952   C  C     . GLY A 1 142 ? -18.289 -9.136  18.552  1.00 81.78  ? 142 GLY A C     1 
ATOM   953   O  O     . GLY A 1 142 ? -19.336 -8.486  18.575  1.00 88.63  ? 142 GLY A O     1 
ATOM   954   N  N     . PRO A 1 143 ? -18.304 -10.462 18.779  1.00 83.90  ? 143 PRO A N     1 
ATOM   955   C  CA    . PRO A 1 143 ? -17.224 -11.467 18.720  1.00 77.26  ? 143 PRO A CA    1 
ATOM   956   C  C     . PRO A 1 143 ? -16.251 -11.410 19.894  1.00 70.11  ? 143 PRO A C     1 
ATOM   957   O  O     . PRO A 1 143 ? -15.145 -11.934 19.807  1.00 75.61  ? 143 PRO A O     1 
ATOM   958   C  CB    . PRO A 1 143 ? -16.453 -11.397 17.387  1.00 80.02  ? 143 PRO A CB    1 
ATOM   959   N  N     . GLY A 1 144 ? -16.648 -10.776 20.990  1.00 69.91  ? 144 GLY A N     1 
ATOM   960   C  CA    . GLY A 1 144 ? -15.818 -10.796 22.182  1.00 70.84  ? 144 GLY A CA    1 
ATOM   961   C  C     . GLY A 1 144 ? -15.024 -9.526  22.417  1.00 70.91  ? 144 GLY A C     1 
ATOM   962   O  O     . GLY A 1 144 ? -14.246 -9.439  23.371  1.00 67.97  ? 144 GLY A O     1 
ATOM   963   N  N     . TRP A 1 145 ? -15.241 -8.529  21.566  1.00 65.79  ? 145 TRP A N     1 
ATOM   964   C  CA    . TRP A 1 145 ? -14.483 -7.286  21.642  1.00 69.62  ? 145 TRP A CA    1 
ATOM   965   C  C     . TRP A 1 145 ? -15.295 -6.084  21.186  1.00 67.28  ? 145 TRP A C     1 
ATOM   966   O  O     . TRP A 1 145 ? -16.368 -6.224  20.596  1.00 59.21  ? 145 TRP A O     1 
ATOM   967   C  CB    . TRP A 1 145 ? -13.218 -7.391  20.781  1.00 64.11  ? 145 TRP A CB    1 
ATOM   968   C  CG    . TRP A 1 145 ? -13.507 -7.674  19.317  1.00 70.97  ? 145 TRP A CG    1 
ATOM   969   C  CD1   . TRP A 1 145 ? -13.551 -8.899  18.715  1.00 72.69  ? 145 TRP A CD1   1 
ATOM   970   C  CD2   . TRP A 1 145 ? -13.748 -6.712  18.277  1.00 69.78  ? 145 TRP A CD2   1 
ATOM   971   N  NE1   . TRP A 1 145 ? -13.826 -8.763  17.374  1.00 71.13  ? 145 TRP A NE1   1 
ATOM   972   C  CE2   . TRP A 1 145 ? -13.947 -7.429  17.077  1.00 72.38  ? 145 TRP A CE2   1 
ATOM   973   C  CE3   . TRP A 1 145 ? -13.823 -5.313  18.243  1.00 66.47  ? 145 TRP A CE3   1 
ATOM   974   C  CZ2   . TRP A 1 145 ? -14.213 -6.799  15.858  1.00 69.44  ? 145 TRP A CZ2   1 
ATOM   975   C  CZ3   . TRP A 1 145 ? -14.089 -4.687  17.030  1.00 66.89  ? 145 TRP A CZ3   1 
ATOM   976   C  CH2   . TRP A 1 145 ? -14.279 -5.431  15.855  1.00 67.44  ? 145 TRP A CH2   1 
ATOM   977   N  N     . ARG A 1 146 ? -14.766 -4.897  21.463  1.00 64.90  ? 146 ARG A N     1 
ATOM   978   C  CA    . ARG A 1 146 ? -15.302 -3.685  20.864  1.00 64.32  ? 146 ARG A CA    1 
ATOM   979   C  C     . ARG A 1 146 ? -14.237 -2.599  20.788  1.00 60.47  ? 146 ARG A C     1 
ATOM   980   O  O     . ARG A 1 146 ? -13.211 -2.654  21.467  1.00 55.91  ? 146 ARG A O     1 
ATOM   981   C  CB    . ARG A 1 146 ? -16.544 -3.198  21.628  1.00 64.67  ? 146 ARG A CB    1 
ATOM   982   C  CG    . ARG A 1 146 ? -16.304 -2.596  23.003  1.00 66.00  ? 146 ARG A CG    1 
ATOM   983   C  CD    . ARG A 1 146 ? -17.633 -2.496  23.753  1.00 69.18  ? 146 ARG A CD    1 
ATOM   984   N  NE    . ARG A 1 146 ? -17.669 -1.425  24.748  1.00 75.81  ? 146 ARG A NE    1 
ATOM   985   C  CZ    . ARG A 1 146 ? -17.119 -1.501  25.958  1.00 73.70  ? 146 ARG A CZ    1 
ATOM   986   N  NH1   . ARG A 1 146 ? -16.458 -2.588  26.323  1.00 76.95  ? 146 ARG A NH1   1 
ATOM   987   N  NH2   . ARG A 1 146 ? -17.210 -0.479  26.798  1.00 73.45  ? 146 ARG A NH2   1 
ATOM   988   N  N     . VAL A 1 147 ? -14.484 -1.634  19.914  1.00 57.03  ? 147 VAL A N     1 
ATOM   989   C  CA    . VAL A 1 147 ? -13.603 -0.501  19.740  1.00 52.55  ? 147 VAL A CA    1 
ATOM   990   C  C     . VAL A 1 147 ? -14.393 0.743   20.092  1.00 49.07  ? 147 VAL A C     1 
ATOM   991   O  O     . VAL A 1 147 ? -15.462 0.992   19.533  1.00 50.73  ? 147 VAL A O     1 
ATOM   992   C  CB    . VAL A 1 147 ? -13.055 -0.410  18.300  1.00 53.16  ? 147 VAL A CB    1 
ATOM   993   C  CG1   . VAL A 1 147 ? -12.171 0.812   18.132  1.00 44.29  ? 147 VAL A CG1   1 
ATOM   994   C  CG2   . VAL A 1 147 ? -12.285 -1.674  17.955  1.00 53.74  ? 147 VAL A CG2   1 
ATOM   995   N  N     . LEU A 1 148 ? -13.894 1.495   21.064  1.00 44.74  ? 148 LEU A N     1 
ATOM   996   C  CA    . LEU A 1 148 ? -14.562 2.712   21.473  1.00 43.92  ? 148 LEU A CA    1 
ATOM   997   C  C     . LEU A 1 148 ? -13.819 3.892   20.894  1.00 48.56  ? 148 LEU A C     1 
ATOM   998   O  O     . LEU A 1 148 ? -12.601 3.852   20.720  1.00 42.54  ? 148 LEU A O     1 
ATOM   999   C  CB    . LEU A 1 148 ? -14.641 2.827   22.997  1.00 44.04  ? 148 LEU A CB    1 
ATOM   1000  C  CG    . LEU A 1 148 ? -15.296 1.672   23.761  1.00 53.25  ? 148 LEU A CG    1 
ATOM   1001  C  CD1   . LEU A 1 148 ? -15.403 2.021   25.235  1.00 55.66  ? 148 LEU A CD1   1 
ATOM   1002  C  CD2   . LEU A 1 148 ? -16.678 1.340   23.181  1.00 57.33  ? 148 LEU A CD2   1 
ATOM   1003  N  N     . GLY A 1 149 ? -14.562 4.954   20.621  1.00 38.14  ? 149 GLY A N     1 
ATOM   1004  C  CA    . GLY A 1 149 ? -14.000 6.191   20.134  1.00 36.31  ? 149 GLY A CA    1 
ATOM   1005  C  C     . GLY A 1 149 ? -14.131 7.256   21.195  1.00 42.70  ? 149 GLY A C     1 
ATOM   1006  O  O     . GLY A 1 149 ? -15.141 7.313   21.925  1.00 46.84  ? 149 GLY A O     1 
ATOM   1007  N  N     . GLY A 1 150 ? -13.100 8.092   21.289  1.00 39.47  ? 150 GLY A N     1 
ATOM   1008  C  CA    . GLY A 1 150 ? -13.101 9.201   22.220  1.00 37.63  ? 150 GLY A CA    1 
ATOM   1009  C  C     . GLY A 1 150 ? -11.934 10.113  21.943  1.00 40.26  ? 150 GLY A C     1 
ATOM   1010  O  O     . GLY A 1 150 ? -11.603 10.376  20.788  1.00 40.12  ? 150 GLY A O     1 
ATOM   1011  N  N     . ALA A 1 151 ? -11.264 10.559  22.997  1.00 39.37  ? 151 ALA A N     1 
ATOM   1012  C  CA    . ALA A 1 151 ? -10.158 11.482  22.821  1.00 36.72  ? 151 ALA A CA    1 
ATOM   1013  C  C     . ALA A 1 151 ? -9.201  11.452  24.003  1.00 43.67  ? 151 ALA A C     1 
ATOM   1014  O  O     . ALA A 1 151 ? -9.589  11.140  25.138  1.00 39.72  ? 151 ALA A O     1 
ATOM   1015  C  CB    . ALA A 1 151 ? -10.691 12.946  22.602  1.00 32.39  ? 151 ALA A CB    1 
ATOM   1016  N  N     . VAL A 1 152 ? -7.939  11.758  23.710  1.00 37.08  ? 152 VAL A N     1 
ATOM   1017  C  CA    . VAL A 1 152 ? -6.968  12.025  24.737  1.00 35.07  ? 152 VAL A CA    1 
ATOM   1018  C  C     . VAL A 1 152 ? -7.091  13.504  25.046  1.00 38.91  ? 152 VAL A C     1 
ATOM   1019  O  O     . VAL A 1 152 ? -7.147  14.335  24.131  1.00 39.30  ? 152 VAL A O     1 
ATOM   1020  C  CB    . VAL A 1 152 ? -5.530  11.659  24.279  1.00 44.47  ? 152 VAL A CB    1 
ATOM   1021  C  CG1   . VAL A 1 152 ? -4.479  12.170  25.282  1.00 45.58  ? 152 VAL A CG1   1 
ATOM   1022  C  CG2   . VAL A 1 152 ? -5.414  10.158  24.070  1.00 33.09  ? 152 VAL A CG2   1 
ATOM   1023  N  N     . LEU A 1 153 ? -7.172  13.833  26.329  1.00 41.08  ? 153 LEU A N     1 
ATOM   1024  C  CA    . LEU A 1 153 ? -7.388  15.209  26.747  1.00 44.23  ? 153 LEU A CA    1 
ATOM   1025  C  C     . LEU A 1 153 ? -6.203  15.761  27.542  1.00 47.89  ? 153 LEU A C     1 
ATOM   1026  O  O     . LEU A 1 153 ? -5.428  15.003  28.123  1.00 51.09  ? 153 LEU A O     1 
ATOM   1027  C  CB    . LEU A 1 153 ? -8.666  15.308  27.597  1.00 42.78  ? 153 LEU A CB    1 
ATOM   1028  C  CG    . LEU A 1 153 ? -9.968  14.754  26.994  1.00 45.78  ? 153 LEU A CG    1 
ATOM   1029  C  CD1   . LEU A 1 153 ? -11.094 14.777  28.026  1.00 43.81  ? 153 LEU A CD1   1 
ATOM   1030  C  CD2   . LEU A 1 153 ? -10.360 15.508  25.730  1.00 33.26  ? 153 LEU A CD2   1 
ATOM   1031  N  N     . ASP A 1 154 ? -6.090  17.083  27.593  1.00 44.46  ? 154 ASP A N     1 
ATOM   1032  C  CA    . ASP A 1 154 ? -5.149  17.741  28.513  1.00 43.75  ? 154 ASP A CA    1 
ATOM   1033  C  C     . ASP A 1 154 ? -5.708  19.105  28.918  1.00 48.51  ? 154 ASP A C     1 
ATOM   1034  O  O     . ASP A 1 154 ? -6.465  19.708  28.167  1.00 48.25  ? 154 ASP A O     1 
ATOM   1035  C  CB    . ASP A 1 154 ? -3.768  17.889  27.859  1.00 45.55  ? 154 ASP A CB    1 
ATOM   1036  C  CG    . ASP A 1 154 ? -2.664  18.251  28.865  1.00 56.94  ? 154 ASP A CG    1 
ATOM   1037  O  OD1   . ASP A 1 154 ? -2.895  18.198  30.097  1.00 49.13  ? 154 ASP A OD1   1 
ATOM   1038  O  OD2   . ASP A 1 154 ? -1.548  18.577  28.412  1.00 58.54  ? 154 ASP A OD2   1 
ATOM   1039  N  N     . LEU A 1 155 ? -5.330  19.609  30.087  1.00 50.00  ? 155 LEU A N     1 
ATOM   1040  C  CA    . LEU A 1 155 ? -5.887  20.872  30.551  1.00 44.45  ? 155 LEU A CA    1 
ATOM   1041  C  C     . LEU A 1 155 ? -4.803  21.621  31.332  1.00 55.30  ? 155 LEU A C     1 
ATOM   1042  O  O     . LEU A 1 155 ? -4.247  21.101  32.309  1.00 49.18  ? 155 LEU A O     1 
ATOM   1043  C  CB    . LEU A 1 155 ? -7.129  20.592  31.397  1.00 47.81  ? 155 LEU A CB    1 
ATOM   1044  C  CG    . LEU A 1 155 ? -8.197  21.614  31.822  1.00 60.11  ? 155 LEU A CG    1 
ATOM   1045  C  CD1   . LEU A 1 155 ? -7.988  22.187  33.189  1.00 55.74  ? 155 LEU A CD1   1 
ATOM   1046  C  CD2   . LEU A 1 155 ? -8.401  22.723  30.771  1.00 52.32  ? 155 LEU A CD2   1 
ATOM   1047  N  N     . TRP A 1 156 ? -4.467  22.826  30.886  1.00 51.27  ? 156 TRP A N     1 
ATOM   1048  C  CA    . TRP A 1 156 ? -3.418  23.579  31.567  1.00 56.17  ? 156 TRP A CA    1 
ATOM   1049  C  C     . TRP A 1 156 ? -3.747  25.067  31.638  1.00 56.37  ? 156 TRP A C     1 
ATOM   1050  O  O     . TRP A 1 156 ? -4.890  25.457  31.431  1.00 51.29  ? 156 TRP A O     1 
ATOM   1051  C  CB    . TRP A 1 156 ? -2.067  23.339  30.889  1.00 49.71  ? 156 TRP A CB    1 
ATOM   1052  C  CG    . TRP A 1 156 ? -1.873  23.964  29.541  1.00 53.53  ? 156 TRP A CG    1 
ATOM   1053  C  CD1   . TRP A 1 156 ? -1.356  25.207  29.279  1.00 57.93  ? 156 TRP A CD1   1 
ATOM   1054  C  CD2   . TRP A 1 156 ? -2.133  23.365  28.265  1.00 54.49  ? 156 TRP A CD2   1 
ATOM   1055  N  NE1   . TRP A 1 156 ? -1.295  25.421  27.923  1.00 57.84  ? 156 TRP A NE1   1 
ATOM   1056  C  CE2   . TRP A 1 156 ? -1.768  24.306  27.275  1.00 52.84  ? 156 TRP A CE2   1 
ATOM   1057  C  CE3   . TRP A 1 156 ? -2.648  22.128  27.859  1.00 55.58  ? 156 TRP A CE3   1 
ATOM   1058  C  CZ2   . TRP A 1 156 ? -1.900  24.050  25.909  1.00 53.49  ? 156 TRP A CZ2   1 
ATOM   1059  C  CZ3   . TRP A 1 156 ? -2.785  21.877  26.501  1.00 55.18  ? 156 TRP A CZ3   1 
ATOM   1060  C  CH2   . TRP A 1 156 ? -2.407  22.831  25.542  1.00 53.17  ? 156 TRP A CH2   1 
ATOM   1061  N  N     . VAL A 1 157 ? -2.760  25.887  31.988  1.00 60.79  ? 157 VAL A N     1 
ATOM   1062  C  CA    . VAL A 1 157 ? -2.996  27.312  32.191  1.00 58.52  ? 157 VAL A CA    1 
ATOM   1063  C  C     . VAL A 1 157 ? -2.060  28.152  31.329  1.00 62.87  ? 157 VAL A C     1 
ATOM   1064  O  O     . VAL A 1 157 ? -0.876  27.833  31.213  1.00 67.25  ? 157 VAL A O     1 
ATOM   1065  C  CB    . VAL A 1 157 ? -2.823  27.694  33.677  1.00 65.28  ? 157 VAL A CB    1 
ATOM   1066  C  CG1   . VAL A 1 157 ? -3.113  29.173  33.898  1.00 69.05  ? 157 VAL A CG1   1 
ATOM   1067  C  CG2   . VAL A 1 157 ? -3.729  26.839  34.553  1.00 56.32  ? 157 VAL A CG2   1 
ATOM   1068  N  N     . SER A 1 158 ? -2.592  29.205  30.705  1.00 62.18  ? 158 SER A N     1 
ATOM   1069  C  CA    . SER A 1 158 ? -1.807  30.032  29.782  1.00 68.02  ? 158 SER A CA    1 
ATOM   1070  C  C     . SER A 1 158 ? -0.968  31.091  30.508  1.00 75.73  ? 158 SER A C     1 
ATOM   1071  O  O     . SER A 1 158 ? -1.039  31.232  31.732  1.00 75.92  ? 158 SER A O     1 
ATOM   1072  C  CB    . SER A 1 158 ? -2.719  30.730  28.769  1.00 71.67  ? 158 SER A CB    1 
ATOM   1073  O  OG    . SER A 1 158 ? -3.631  31.602  29.412  1.00 70.89  ? 158 SER A OG    1 
ATOM   1074  N  N     . ASP A 1 159 ? -0.160  31.821  29.742  1.00 78.02  ? 159 ASP A N     1 
ATOM   1075  C  CA    . ASP A 1 159 ? 0.584   32.964  30.268  1.00 80.60  ? 159 ASP A CA    1 
ATOM   1076  C  C     . ASP A 1 159 ? -0.370  34.052  30.727  1.00 78.61  ? 159 ASP A C     1 
ATOM   1077  O  O     . ASP A 1 159 ? -0.073  34.813  31.645  1.00 84.26  ? 159 ASP A O     1 
ATOM   1078  C  CB    . ASP A 1 159 ? 1.535   33.526  29.218  1.00 81.89  ? 159 ASP A CB    1 
ATOM   1079  C  CG    . ASP A 1 159 ? 2.263   32.445  28.460  1.00 91.10  ? 159 ASP A CG    1 
ATOM   1080  O  OD1   . ASP A 1 159 ? 2.468   31.354  29.036  1.00 92.00  ? 159 ASP A OD1   1 
ATOM   1081  O  OD2   . ASP A 1 159 ? 2.622   32.689  27.287  1.00 93.93  ? 159 ASP A OD2   1 
ATOM   1082  N  N     . SER A 1 160 ? -1.514  34.132  30.059  1.00 74.43  ? 160 SER A N     1 
ATOM   1083  C  CA    . SER A 1 160 ? -2.490  35.171  30.327  1.00 74.77  ? 160 SER A CA    1 
ATOM   1084  C  C     . SER A 1 160 ? -3.438  34.740  31.435  1.00 72.47  ? 160 SER A C     1 
ATOM   1085  O  O     . SER A 1 160 ? -4.421  35.421  31.727  1.00 75.18  ? 160 SER A O     1 
ATOM   1086  C  CB    . SER A 1 160 ? -3.276  35.502  29.057  1.00 76.20  ? 160 SER A CB    1 
ATOM   1087  O  OG    . SER A 1 160 ? -4.001  34.372  28.602  1.00 76.32  ? 160 SER A OG    1 
ATOM   1088  N  N     . GLY A 1 161 ? -3.136  33.602  32.049  1.00 68.66  ? 161 GLY A N     1 
ATOM   1089  C  CA    . GLY A 1 161 ? -3.912  33.124  33.176  1.00 71.13  ? 161 GLY A CA    1 
ATOM   1090  C  C     . GLY A 1 161 ? -5.302  32.625  32.827  1.00 70.17  ? 161 GLY A C     1 
ATOM   1091  O  O     . GLY A 1 161 ? -6.265  32.924  33.535  1.00 70.05  ? 161 GLY A O     1 
ATOM   1092  N  N     . ALA A 1 162 ? -5.411  31.843  31.756  1.00 68.04  ? 162 ALA A N     1 
ATOM   1093  C  CA    . ALA A 1 162 ? -6.684  31.216  31.420  1.00 65.54  ? 162 ALA A CA    1 
ATOM   1094  C  C     . ALA A 1 162 ? -6.511  29.720  31.175  1.00 59.31  ? 162 ALA A C     1 
ATOM   1095  O  O     . ALA A 1 162 ? -5.417  29.259  30.846  1.00 59.60  ? 162 ALA A O     1 
ATOM   1096  C  CB    . ALA A 1 162 ? -7.308  31.896  30.197  1.00 60.33  ? 162 ALA A CB    1 
ATOM   1097  N  N     . PHE A 1 163 ? -7.591  28.959  31.331  1.00 59.69  ? 163 PHE A N     1 
ATOM   1098  C  CA    . PHE A 1 163 ? -7.532  27.529  31.043  1.00 56.69  ? 163 PHE A CA    1 
ATOM   1099  C  C     . PHE A 1 163 ? -7.376  27.251  29.551  1.00 54.04  ? 163 PHE A C     1 
ATOM   1100  O  O     . PHE A 1 163 ? -7.929  27.958  28.705  1.00 53.72  ? 163 PHE A O     1 
ATOM   1101  C  CB    . PHE A 1 163 ? -8.776  26.801  31.552  1.00 56.14  ? 163 PHE A CB    1 
ATOM   1102  C  CG    . PHE A 1 163 ? -8.809  26.602  33.039  1.00 59.02  ? 163 PHE A CG    1 
ATOM   1103  C  CD1   . PHE A 1 163 ? -7.972  25.672  33.643  1.00 62.58  ? 163 PHE A CD1   1 
ATOM   1104  C  CD2   . PHE A 1 163 ? -9.711  27.294  33.829  1.00 63.27  ? 163 PHE A CD2   1 
ATOM   1105  C  CE1   . PHE A 1 163 ? -8.004  25.464  35.012  1.00 57.92  ? 163 PHE A CE1   1 
ATOM   1106  C  CE2   . PHE A 1 163 ? -9.752  27.087  35.201  1.00 62.02  ? 163 PHE A CE2   1 
ATOM   1107  C  CZ    . PHE A 1 163 ? -8.899  26.170  35.788  1.00 63.94  ? 163 PHE A CZ    1 
ATOM   1108  N  N     . LEU A 1 164 ? -6.619  26.208  29.241  1.00 50.46  ? 164 LEU A N     1 
ATOM   1109  C  CA    . LEU A 1 164 ? -6.473  25.744  27.875  1.00 45.78  ? 164 LEU A CA    1 
ATOM   1110  C  C     . LEU A 1 164 ? -6.749  24.255  27.846  1.00 47.95  ? 164 LEU A C     1 
ATOM   1111  O  O     . LEU A 1 164 ? -6.195  23.492  28.631  1.00 48.45  ? 164 LEU A O     1 
ATOM   1112  C  CB    . LEU A 1 164 ? -5.080  26.045  27.318  1.00 45.88  ? 164 LEU A CB    1 
ATOM   1113  C  CG    . LEU A 1 164 ? -4.885  27.429  26.703  1.00 62.99  ? 164 LEU A CG    1 
ATOM   1114  C  CD1   . LEU A 1 164 ? -3.412  27.695  26.408  1.00 66.57  ? 164 LEU A CD1   1 
ATOM   1115  C  CD2   . LEU A 1 164 ? -5.733  27.569  25.434  1.00 48.95  ? 164 LEU A CD2   1 
ATOM   1116  N  N     . LEU A 1 165 ? -7.642  23.863  26.951  1.00 46.84  ? 165 LEU A N     1 
ATOM   1117  C  CA    . LEU A 1 165 ? -8.054  22.477  26.792  1.00 43.73  ? 165 LEU A CA    1 
ATOM   1118  C  C     . LEU A 1 165 ? -7.423  21.937  25.520  1.00 42.22  ? 165 LEU A C     1 
ATOM   1119  O  O     . LEU A 1 165 ? -7.472  22.588  24.497  1.00 40.29  ? 165 LEU A O     1 
ATOM   1120  C  CB    . LEU A 1 165 ? -9.583  22.395  26.721  1.00 44.44  ? 165 LEU A CB    1 
ATOM   1121  C  CG    . LEU A 1 165 ? -10.426 21.160  27.046  1.00 46.04  ? 165 LEU A CG    1 
ATOM   1122  C  CD1   . LEU A 1 165 ? -11.704 21.203  26.204  1.00 46.63  ? 165 LEU A CD1   1 
ATOM   1123  C  CD2   . LEU A 1 165 ? -9.712  19.864  26.843  1.00 42.45  ? 165 LEU A CD2   1 
ATOM   1124  N  N     . GLU A 1 166 ? -6.820  20.758  25.580  1.00 41.74  ? 166 GLU A N     1 
ATOM   1125  C  CA    . GLU A 1 166 ? -6.337  20.100  24.382  1.00 41.11  ? 166 GLU A CA    1 
ATOM   1126  C  C     . GLU A 1 166 ? -7.156  18.830  24.170  1.00 36.34  ? 166 GLU A C     1 
ATOM   1127  O  O     . GLU A 1 166 ? -7.476  18.118  25.127  1.00 36.27  ? 166 GLU A O     1 
ATOM   1128  C  CB    . GLU A 1 166 ? -4.845  19.764  24.484  1.00 38.79  ? 166 GLU A CB    1 
ATOM   1129  C  CG    . GLU A 1 166 ? -4.253  19.243  23.178  1.00 45.13  ? 166 GLU A CG    1 
ATOM   1130  C  CD    . GLU A 1 166 ? -2.784  18.768  23.313  1.00 54.98  ? 166 GLU A CD    1 
ATOM   1131  O  OE1   . GLU A 1 166 ? -2.098  18.650  22.276  1.00 49.05  ? 166 GLU A OE1   1 
ATOM   1132  O  OE2   . GLU A 1 166 ? -2.310  18.533  24.444  1.00 54.35  ? 166 GLU A OE2   1 
ATOM   1133  N  N     . VAL A 1 167 ? -7.507  18.560  22.918  1.00 31.09  ? 167 VAL A N     1 
ATOM   1134  C  CA    . VAL A 1 167 ? -8.324  17.397  22.587  1.00 38.23  ? 167 VAL A CA    1 
ATOM   1135  C  C     . VAL A 1 167 ? -7.780  16.711  21.349  1.00 31.11  ? 167 VAL A C     1 
ATOM   1136  O  O     . VAL A 1 167 ? -7.535  17.382  20.340  1.00 37.78  ? 167 VAL A O     1 
ATOM   1137  C  CB    . VAL A 1 167 ? -9.795  17.809  22.312  1.00 31.58  ? 167 VAL A CB    1 
ATOM   1138  C  CG1   . VAL A 1 167 ? -10.656 16.570  22.047  1.00 32.63  ? 167 VAL A CG1   1 
ATOM   1139  C  CG2   . VAL A 1 167 ? -10.357 18.640  23.466  1.00 30.54  ? 167 VAL A CG2   1 
ATOM   1140  N  N     . ASP A 1 168 ? -7.596  15.394  21.392  1.00 33.67  ? 168 ASP A N     1 
ATOM   1141  C  CA    . ASP A 1 168 ? -7.252  14.690  20.151  1.00 38.18  ? 168 ASP A CA    1 
ATOM   1142  C  C     . ASP A 1 168 ? -7.923  13.338  20.091  1.00 31.93  ? 168 ASP A C     1 
ATOM   1143  O  O     . ASP A 1 168 ? -7.676  12.486  20.938  1.00 34.00  ? 168 ASP A O     1 
ATOM   1144  C  CB    . ASP A 1 168 ? -5.708  14.540  19.990  1.00 31.73  ? 168 ASP A CB    1 
ATOM   1145  C  CG    . ASP A 1 168 ? -5.298  14.341  18.519  1.00 35.68  ? 168 ASP A CG    1 
ATOM   1146  O  OD1   . ASP A 1 168 ? -6.070  14.735  17.602  1.00 36.79  ? 168 ASP A OD1   1 
ATOM   1147  O  OD2   . ASP A 1 168 ? -4.196  13.834  18.259  1.00 45.71  ? 168 ASP A OD2   1 
ATOM   1148  N  N     . PRO A 1 169 ? -8.784  13.141  19.084  1.00 36.84  ? 169 PRO A N     1 
ATOM   1149  C  CA    . PRO A 1 169 ? -9.534  11.890  18.933  1.00 40.17  ? 169 PRO A CA    1 
ATOM   1150  C  C     . PRO A 1 169 ? -8.632  10.676  18.931  1.00 41.90  ? 169 PRO A C     1 
ATOM   1151  O  O     . PRO A 1 169 ? -7.479  10.785  18.502  1.00 35.67  ? 169 PRO A O     1 
ATOM   1152  C  CB    . PRO A 1 169 ? -10.231 12.053  17.578  1.00 35.49  ? 169 PRO A CB    1 
ATOM   1153  C  CG    . PRO A 1 169 ? -10.438 13.513  17.460  1.00 39.28  ? 169 PRO A CG    1 
ATOM   1154  C  CD    . PRO A 1 169 ? -9.192  14.137  18.077  1.00 33.88  ? 169 PRO A CD    1 
ATOM   1155  N  N     . ALA A 1 170 ? -9.139  9.564   19.454  1.00 39.15  ? 170 ALA A N     1 
ATOM   1156  C  CA    . ALA A 1 170 ? -8.387  8.327   19.495  1.00 40.08  ? 170 ALA A CA    1 
ATOM   1157  C  C     . ALA A 1 170 ? -9.350  7.171   19.715  1.00 43.20  ? 170 ALA A C     1 
ATOM   1158  O  O     . ALA A 1 170 ? -10.396 7.332   20.356  1.00 40.59  ? 170 ALA A O     1 
ATOM   1159  C  CB    . ALA A 1 170 ? -7.302  8.370   20.611  1.00 38.02  ? 170 ALA A CB    1 
ATOM   1160  N  N     . TYR A 1 171 ? -8.995  6.011   19.180  1.00 38.22  ? 171 TYR A N     1 
ATOM   1161  C  CA    . TYR A 1 171 ? -9.767  4.800   19.405  1.00 44.16  ? 171 TYR A CA    1 
ATOM   1162  C  C     . TYR A 1 171 ? -9.092  3.911   20.450  1.00 45.76  ? 171 TYR A C     1 
ATOM   1163  O  O     . TYR A 1 171 ? -7.870  3.951   20.629  1.00 43.39  ? 171 TYR A O     1 
ATOM   1164  C  CB    . TYR A 1 171 ? -9.944  4.014   18.100  1.00 38.39  ? 171 TYR A CB    1 
ATOM   1165  C  CG    . TYR A 1 171 ? -10.771 4.700   17.031  1.00 45.59  ? 171 TYR A CG    1 
ATOM   1166  C  CD1   . TYR A 1 171 ? -12.124 4.959   17.229  1.00 35.38  ? 171 TYR A CD1   1 
ATOM   1167  C  CD2   . TYR A 1 171 ? -10.210 5.052   15.812  1.00 41.71  ? 171 TYR A CD2   1 
ATOM   1168  C  CE1   . TYR A 1 171 ? -12.890 5.564   16.240  1.00 43.60  ? 171 TYR A CE1   1 
ATOM   1169  C  CE2   . TYR A 1 171 ? -10.964 5.659   14.821  1.00 45.99  ? 171 TYR A CE2   1 
ATOM   1170  C  CZ    . TYR A 1 171 ? -12.309 5.907   15.042  1.00 46.79  ? 171 TYR A CZ    1 
ATOM   1171  O  OH    . TYR A 1 171 ? -13.072 6.500   14.062  1.00 44.74  ? 171 TYR A OH    1 
ATOM   1172  N  N     . ARG A 1 172 ? -9.893  3.083   21.112  1.00 42.17  ? 172 ARG A N     1 
ATOM   1173  C  CA    . ARG A 1 172 ? -9.382  2.147   22.094  1.00 46.86  ? 172 ARG A CA    1 
ATOM   1174  C  C     . ARG A 1 172 ? -9.985  0.781   21.821  1.00 50.10  ? 172 ARG A C     1 
ATOM   1175  O  O     . ARG A 1 172 ? -11.211 0.635   21.699  1.00 47.91  ? 172 ARG A O     1 
ATOM   1176  C  CB    . ARG A 1 172 ? -9.717  2.627   23.511  1.00 45.57  ? 172 ARG A CB    1 
ATOM   1177  C  CG    . ARG A 1 172 ? -8.986  1.878   24.629  1.00 49.88  ? 172 ARG A CG    1 
ATOM   1178  C  CD    . ARG A 1 172 ? -7.490  2.223   24.622  1.00 49.61  ? 172 ARG A CD    1 
ATOM   1179  N  NE    . ARG A 1 172 ? -6.804  1.764   25.829  1.00 52.31  ? 172 ARG A NE    1 
ATOM   1180  C  CZ    . ARG A 1 172 ? -6.121  0.625   25.916  1.00 50.99  ? 172 ARG A CZ    1 
ATOM   1181  N  NH1   . ARG A 1 172 ? -6.051  -0.192  24.875  1.00 42.77  ? 172 ARG A NH1   1 
ATOM   1182  N  NH2   . ARG A 1 172 ? -5.532  0.291   27.055  1.00 56.96  ? 172 ARG A NH2   1 
ATOM   1183  N  N     . ILE A 1 173 ? -9.114  -0.220  21.754  1.00 48.74  ? 173 ILE A N     1 
ATOM   1184  C  CA    . ILE A 1 173 ? -9.523  -1.592  21.489  1.00 52.73  ? 173 ILE A CA    1 
ATOM   1185  C  C     . ILE A 1 173 ? -9.631  -2.326  22.810  1.00 51.80  ? 173 ILE A C     1 
ATOM   1186  O  O     . ILE A 1 173 ? -8.675  -2.382  23.581  1.00 54.40  ? 173 ILE A O     1 
ATOM   1187  C  CB    . ILE A 1 173 ? -8.527  -2.321  20.569  1.00 56.43  ? 173 ILE A CB    1 
ATOM   1188  C  CG1   . ILE A 1 173 ? -8.290  -1.520  19.287  1.00 51.31  ? 173 ILE A CG1   1 
ATOM   1189  C  CG2   . ILE A 1 173 ? -9.026  -3.716  20.235  1.00 50.48  ? 173 ILE A CG2   1 
ATOM   1190  C  CD1   . ILE A 1 173 ? -7.333  -2.190  18.324  1.00 53.26  ? 173 ILE A CD1   1 
ATOM   1191  N  N     . LEU A 1 174 ? -10.815 -2.857  23.074  1.00 51.08  ? 174 LEU A N     1 
ATOM   1192  C  CA    . LEU A 1 174 ? -11.100 -3.521  24.333  1.00 58.52  ? 174 LEU A CA    1 
ATOM   1193  C  C     . LEU A 1 174 ? -11.633 -4.924  24.122  1.00 58.08  ? 174 LEU A C     1 
ATOM   1194  O  O     . LEU A 1 174 ? -12.475 -5.157  23.254  1.00 51.93  ? 174 LEU A O     1 
ATOM   1195  C  CB    . LEU A 1 174 ? -12.104 -2.713  25.150  1.00 55.50  ? 174 LEU A CB    1 
ATOM   1196  C  CG    . LEU A 1 174 ? -11.702 -1.269  25.443  1.00 61.09  ? 174 LEU A CG    1 
ATOM   1197  C  CD1   . LEU A 1 174 ? -12.830 -0.532  26.157  1.00 64.31  ? 174 LEU A CD1   1 
ATOM   1198  C  CD2   . LEU A 1 174 ? -10.417 -1.241  26.258  1.00 61.82  ? 174 LEU A CD2   1 
ATOM   1199  N  N     . CYS A 1 175 ? -11.099 -5.854  24.905  1.00 61.65  ? 175 CYS A N     1 
ATOM   1200  C  CA    . CYS A 1 175 ? -11.631 -7.206  24.994  1.00 66.54  ? 175 CYS A CA    1 
ATOM   1201  C  C     . CYS A 1 175 ? -12.616 -7.230  26.155  1.00 68.12  ? 175 CYS A C     1 
ATOM   1202  O  O     . CYS A 1 175 ? -12.391 -6.571  27.169  1.00 67.14  ? 175 CYS A O     1 
ATOM   1203  C  CB    . CYS A 1 175 ? -10.506 -8.220  25.212  1.00 66.52  ? 175 CYS A CB    1 
ATOM   1204  S  SG    . CYS A 1 175 ? -11.004 -9.951  25.082  1.00 68.37  ? 175 CYS A SG    1 
ATOM   1205  N  N     . GLU A 1 176 ? -13.703 -7.982  26.028  1.00 74.32  ? 176 GLU A N     1 
ATOM   1206  C  CA    . GLU A 1 176 ? -14.681 -8.002  27.109  1.00 78.27  ? 176 GLU A CA    1 
ATOM   1207  C  C     . GLU A 1 176 ? -14.894 -9.374  27.728  1.00 82.99  ? 176 GLU A C     1 
ATOM   1208  O  O     . GLU A 1 176 ? -15.691 -9.522  28.658  1.00 84.88  ? 176 GLU A O     1 
ATOM   1209  C  CB    . GLU A 1 176 ? -16.008 -7.459  26.614  1.00 75.77  ? 176 GLU A CB    1 
ATOM   1210  C  CG    . GLU A 1 176 ? -15.968 -5.991  26.296  1.00 75.59  ? 176 GLU A CG    1 
ATOM   1211  C  CD    . GLU A 1 176 ? -17.243 -5.535  25.656  1.00 81.85  ? 176 GLU A CD    1 
ATOM   1212  O  OE1   . GLU A 1 176 ? -17.737 -6.245  24.752  1.00 85.18  ? 176 GLU A OE1   1 
ATOM   1213  O  OE2   . GLU A 1 176 ? -17.785 -4.502  26.098  1.00 84.05  ? 176 GLU A OE2   1 
ATOM   1214  N  N     . MET A 1 177 ? -14.176 -10.370 27.223  1.00 70.90  ? 177 MET A N     1 
ATOM   1215  C  CA    . MET A 1 177 ? -14.223 -11.694 27.821  1.00 78.29  ? 177 MET A CA    1 
ATOM   1216  C  C     . MET A 1 177 ? -12.866 -12.036 28.407  1.00 82.93  ? 177 MET A C     1 
ATOM   1217  O  O     . MET A 1 177 ? -11.872 -11.350 28.158  1.00 82.64  ? 177 MET A O     1 
ATOM   1218  C  CB    . MET A 1 177 ? -14.667 -12.756 26.808  1.00 84.94  ? 177 MET A CB    1 
ATOM   1219  C  CG    . MET A 1 177 ? -14.101 -12.607 25.410  1.00 83.07  ? 177 MET A CG    1 
ATOM   1220  S  SD    . MET A 1 177 ? -14.725 -13.908 24.317  1.00 83.29  ? 177 MET A SD    1 
ATOM   1221  C  CE    . MET A 1 177 ? -16.499 -13.710 24.522  1.00 76.14  ? 177 MET A CE    1 
ATOM   1222  N  N     . SER A 1 178 ? -12.823 -13.110 29.182  1.00 85.25  ? 178 SER A N     1 
ATOM   1223  C  CA    . SER A 1 178 ? -11.570 -13.571 29.752  1.00 78.76  ? 178 SER A CA    1 
ATOM   1224  C  C     . SER A 1 178 ? -10.703 -14.242 28.695  1.00 79.72  ? 178 SER A C     1 
ATOM   1225  O  O     . SER A 1 178 ? -11.159 -14.515 27.582  1.00 80.20  ? 178 SER A O     1 
ATOM   1226  C  CB    . SER A 1 178 ? -11.845 -14.538 30.903  1.00 84.19  ? 178 SER A CB    1 
ATOM   1227  O  OG    . SER A 1 178 ? -12.608 -15.645 30.453  1.00 85.90  ? 178 SER A OG    1 
ATOM   1228  N  N     . LEU A 1 179 ? -9.446  -14.489 29.052  1.00 79.38  ? 179 LEU A N     1 
ATOM   1229  C  CA    . LEU A 1 179 ? -8.511  -15.177 28.175  1.00 79.90  ? 179 LEU A CA    1 
ATOM   1230  C  C     . LEU A 1 179 ? -9.058  -16.562 27.862  1.00 83.31  ? 179 LEU A C     1 
ATOM   1231  O  O     . LEU A 1 179 ? -8.917  -17.062 26.745  1.00 82.42  ? 179 LEU A O     1 
ATOM   1232  C  CB    . LEU A 1 179 ? -7.124  -15.251 28.827  1.00 78.48  ? 179 LEU A CB    1 
ATOM   1233  C  CG    . LEU A 1 179 ? -5.937  -15.892 28.099  1.00 78.41  ? 179 LEU A CG    1 
ATOM   1234  C  CD1   . LEU A 1 179 ? -5.864  -17.378 28.335  1.00 87.78  ? 179 LEU A CD1   1 
ATOM   1235  C  CD2   . LEU A 1 179 ? -5.984  -15.605 26.608  1.00 81.46  ? 179 LEU A CD2   1 
ATOM   1236  N  N     . GLU A 1 180 ? -9.694  -17.169 28.860  1.00 88.01  ? 180 GLU A N     1 
ATOM   1237  C  CA    . GLU A 1 180 ? -10.265 -18.498 28.707  1.00 88.39  ? 180 GLU A CA    1 
ATOM   1238  C  C     . GLU A 1 180 ? -11.329 -18.465 27.621  1.00 86.50  ? 180 GLU A C     1 
ATOM   1239  O  O     . GLU A 1 180 ? -11.249 -19.208 26.639  1.00 87.40  ? 180 GLU A O     1 
ATOM   1240  C  CB    . GLU A 1 180 ? -10.864 -18.988 30.031  1.00 91.70  ? 180 GLU A CB    1 
ATOM   1241  C  CG    . GLU A 1 180 ? -11.356 -20.434 30.005  1.00 90.64  ? 180 GLU A CG    1 
ATOM   1242  C  CD    . GLU A 1 180 ? -10.222 -21.433 29.850  1.00 89.26  ? 180 GLU A CD    1 
ATOM   1243  O  OE1   . GLU A 1 180 ? -9.086  -21.108 30.264  1.00 91.41  ? 180 GLU A OE1   1 
ATOM   1244  O  OE2   . GLU A 1 180 ? -10.460 -22.533 29.303  1.00 81.90  ? 180 GLU A OE2   1 
ATOM   1245  N  N     . ALA A 1 181 ? -12.307 -17.577 27.793  1.00 85.66  ? 181 ALA A N     1 
ATOM   1246  C  CA    . ALA A 1 181 ? -13.401 -17.425 26.836  1.00 87.81  ? 181 ALA A CA    1 
ATOM   1247  C  C     . ALA A 1 181 ? -12.885 -17.058 25.446  1.00 85.47  ? 181 ALA A C     1 
ATOM   1248  O  O     . ALA A 1 181 ? -13.446 -17.470 24.430  1.00 89.88  ? 181 ALA A O     1 
ATOM   1249  C  CB    . ALA A 1 181 ? -14.389 -16.381 27.328  1.00 83.29  ? 181 ALA A CB    1 
ATOM   1250  N  N     . TRP A 1 182 ? -11.808 -16.284 25.413  1.00 83.60  ? 182 TRP A N     1 
ATOM   1251  C  CA    . TRP A 1 182 ? -11.203 -15.867 24.157  1.00 84.79  ? 182 TRP A CA    1 
ATOM   1252  C  C     . TRP A 1 182 ? -10.615 -17.067 23.416  1.00 84.51  ? 182 TRP A C     1 
ATOM   1253  O  O     . TRP A 1 182 ? -10.872 -17.256 22.224  1.00 81.78  ? 182 TRP A O     1 
ATOM   1254  C  CB    . TRP A 1 182 ? -10.133 -14.803 24.424  1.00 80.57  ? 182 TRP A CB    1 
ATOM   1255  C  CG    . TRP A 1 182 ? -9.516  -14.216 23.195  1.00 76.82  ? 182 TRP A CG    1 
ATOM   1256  C  CD1   . TRP A 1 182 ? -8.252  -14.433 22.730  1.00 78.32  ? 182 TRP A CD1   1 
ATOM   1257  C  CD2   . TRP A 1 182 ? -10.143 -13.334 22.257  1.00 76.72  ? 182 TRP A CD2   1 
ATOM   1258  N  NE1   . TRP A 1 182 ? -8.048  -13.727 21.570  1.00 79.41  ? 182 TRP A NE1   1 
ATOM   1259  C  CE2   . TRP A 1 182 ? -9.195  -13.044 21.257  1.00 71.33  ? 182 TRP A CE2   1 
ATOM   1260  C  CE3   . TRP A 1 182 ? -11.415 -12.757 22.168  1.00 77.48  ? 182 TRP A CE3   1 
ATOM   1261  C  CZ2   . TRP A 1 182 ? -9.477  -12.205 20.181  1.00 70.51  ? 182 TRP A CZ2   1 
ATOM   1262  C  CZ3   . TRP A 1 182 ? -11.695 -11.923 21.097  1.00 72.08  ? 182 TRP A CZ3   1 
ATOM   1263  C  CH2   . TRP A 1 182 ? -10.731 -11.655 20.119  1.00 72.58  ? 182 TRP A CH2   1 
ATOM   1264  N  N     . LEU A 1 183 ? -9.843  -17.886 24.125  1.00 86.58  ? 183 LEU A N     1 
ATOM   1265  C  CA    . LEU A 1 183 ? -9.236  -19.067 23.516  1.00 88.55  ? 183 LEU A CA    1 
ATOM   1266  C  C     . LEU A 1 183 ? -10.284 -20.149 23.272  1.00 90.29  ? 183 LEU A C     1 
ATOM   1267  O  O     . LEU A 1 183 ? -10.054 -21.086 22.507  1.00 90.97  ? 183 LEU A O     1 
ATOM   1268  C  CB    . LEU A 1 183 ? -8.116  -19.629 24.399  1.00 85.47  ? 183 LEU A CB    1 
ATOM   1269  C  CG    . LEU A 1 183 ? -6.861  -18.794 24.662  1.00 87.83  ? 183 LEU A CG    1 
ATOM   1270  C  CD1   . LEU A 1 183 ? -5.889  -19.566 25.537  1.00 85.92  ? 183 LEU A CD1   1 
ATOM   1271  C  CD2   . LEU A 1 183 ? -6.186  -18.386 23.360  1.00 87.98  ? 183 LEU A CD2   1 
ATOM   1272  N  N     . ALA A 1 184 ? -11.445 -19.993 23.904  1.00 91.08  ? 184 ALA A N     1 
ATOM   1273  C  CA    . ALA A 1 184 ? -12.506 -20.990 23.828  1.00 89.71  ? 184 ALA A CA    1 
ATOM   1274  C  C     . ALA A 1 184 ? -13.373 -20.798 22.592  1.00 93.14  ? 184 ALA A C     1 
ATOM   1275  O  O     . ALA A 1 184 ? -14.203 -21.652 22.268  1.00 91.08  ? 184 ALA A O     1 
ATOM   1276  C  CB    . ALA A 1 184 ? -13.362 -20.943 25.084  1.00 91.13  ? 184 ALA A CB    1 
ATOM   1277  N  N     . GLN A 1 185 ? -13.183 -19.671 21.912  1.00 93.46  ? 185 GLN A N     1 
ATOM   1278  C  CA    . GLN A 1 185 ? -13.869 -19.412 20.654  1.00 89.14  ? 185 GLN A CA    1 
ATOM   1279  C  C     . GLN A 1 185 ? -12.912 -19.606 19.482  1.00 89.08  ? 185 GLN A C     1 
ATOM   1280  O  O     . GLN A 1 185 ? -13.278 -19.386 18.329  1.00 93.68  ? 185 GLN A O     1 
ATOM   1281  C  CB    . GLN A 1 185 ? -14.457 -18.012 20.639  1.00 89.60  ? 185 GLN A CB    1 
ATOM   1282  N  N     . GLY A 1 186 ? -11.680 -20.006 19.781  1.00 87.10  ? 186 GLY A N     1 
ATOM   1283  C  CA    . GLY A 1 186 ? -10.743 -20.386 18.740  1.00 90.65  ? 186 GLY A CA    1 
ATOM   1284  C  C     . GLY A 1 186 ? -9.526  -19.497 18.575  1.00 89.13  ? 186 GLY A C     1 
ATOM   1285  O  O     . GLY A 1 186 ? -8.483  -19.961 18.111  1.00 91.57  ? 186 GLY A O     1 
ATOM   1286  N  N     . HIS A 1 187 ? -9.653  -18.227 18.955  1.00 87.32  ? 187 HIS A N     1 
ATOM   1287  C  CA    . HIS A 1 187 ? -8.575  -17.250 18.780  1.00 88.09  ? 187 HIS A CA    1 
ATOM   1288  C  C     . HIS A 1 187 ? -7.226  -17.716 19.323  1.00 87.66  ? 187 HIS A C     1 
ATOM   1289  O  O     . HIS A 1 187 ? -7.163  -18.443 20.316  1.00 90.89  ? 187 HIS A O     1 
ATOM   1290  C  CB    . HIS A 1 187 ? -8.953  -15.917 19.430  1.00 84.24  ? 187 HIS A CB    1 
ATOM   1291  C  CG    . HIS A 1 187 ? -10.101 -15.221 18.766  1.00 80.49  ? 187 HIS A CG    1 
ATOM   1292  N  ND1   . HIS A 1 187 ? -11.316 -15.029 19.382  1.00 80.57  ? 187 HIS A ND1   1 
ATOM   1293  C  CD2   . HIS A 1 187 ? -10.204 -14.660 17.537  1.00 78.72  ? 187 HIS A CD2   1 
ATOM   1294  C  CE1   . HIS A 1 187 ? -12.126 -14.384 18.558  1.00 82.38  ? 187 HIS A CE1   1 
ATOM   1295  N  NE2   . HIS A 1 187 ? -11.476 -14.148 17.436  1.00 82.50  ? 187 HIS A NE2   1 
ATOM   1296  N  N     . PRO A 1 188 ? -6.137  -17.287 18.667  1.00 85.42  ? 188 PRO A N     1 
ATOM   1297  C  CA    . PRO A 1 188 ? -4.781  -17.625 19.114  1.00 88.14  ? 188 PRO A CA    1 
ATOM   1298  C  C     . PRO A 1 188 ? -4.392  -16.906 20.399  1.00 87.03  ? 188 PRO A C     1 
ATOM   1299  O  O     . PRO A 1 188 ? -5.203  -16.186 20.981  1.00 86.91  ? 188 PRO A O     1 
ATOM   1300  C  CB    . PRO A 1 188 ? -3.891  -17.157 17.950  1.00 89.15  ? 188 PRO A CB    1 
ATOM   1301  C  CG    . PRO A 1 188 ? -4.829  -16.907 16.799  1.00 87.38  ? 188 PRO A CG    1 
ATOM   1302  C  CD    . PRO A 1 188 ? -6.126  -16.509 17.418  1.00 81.33  ? 188 PRO A CD    1 
ATOM   1303  N  N     . LEU A 1 189 ? -3.154  -17.112 20.835  1.00 83.60  ? 189 LEU A N     1 
ATOM   1304  C  CA    . LEU A 1 189 ? -2.654  -16.469 22.038  1.00 81.62  ? 189 LEU A CA    1 
ATOM   1305  C  C     . LEU A 1 189 ? -2.232  -15.039 21.733  1.00 81.57  ? 189 LEU A C     1 
ATOM   1306  O  O     . LEU A 1 189 ? -1.469  -14.792 20.794  1.00 80.61  ? 189 LEU A O     1 
ATOM   1307  C  CB    . LEU A 1 189 ? -1.471  -17.249 22.624  1.00 84.18  ? 189 LEU A CB    1 
ATOM   1308  C  CG    . LEU A 1 189 ? -1.687  -18.708 23.036  1.00 79.87  ? 189 LEU A CG    1 
ATOM   1309  C  CD1   . LEU A 1 189 ? -0.352  -19.388 23.292  1.00 78.14  ? 189 LEU A CD1   1 
ATOM   1310  C  CD2   . LEU A 1 189 ? -2.567  -18.783 24.266  1.00 79.41  ? 189 LEU A CD2   1 
ATOM   1311  N  N     . PRO A 1 190 ? -2.738  -14.084 22.518  1.00 80.19  ? 190 PRO A N     1 
ATOM   1312  C  CA    . PRO A 1 190 ? -2.208  -12.727 22.391  1.00 76.26  ? 190 PRO A CA    1 
ATOM   1313  C  C     . PRO A 1 190 ? -0.809  -12.670 22.994  1.00 74.06  ? 190 PRO A C     1 
ATOM   1314  O  O     . PRO A 1 190 ? -0.541  -13.407 23.937  1.00 78.38  ? 190 PRO A O     1 
ATOM   1315  C  CB    . PRO A 1 190 ? -3.205  -11.884 23.192  1.00 72.61  ? 190 PRO A CB    1 
ATOM   1316  C  CG    . PRO A 1 190 ? -3.770  -12.833 24.204  1.00 73.89  ? 190 PRO A CG    1 
ATOM   1317  C  CD    . PRO A 1 190 ? -3.814  -14.178 23.521  1.00 78.84  ? 190 PRO A CD    1 
ATOM   1318  N  N     . LYS A 1 191 ? 0.063   -11.818 22.469  1.00 73.19  ? 191 LYS A N     1 
ATOM   1319  C  CA    . LYS A 1 191 ? 1.415   -11.713 22.998  1.00 75.62  ? 191 LYS A CA    1 
ATOM   1320  C  C     . LYS A 1 191 ? 1.381   -11.064 24.376  1.00 72.13  ? 191 LYS A C     1 
ATOM   1321  O  O     . LYS A 1 191 ? 2.331   -11.175 25.151  1.00 70.30  ? 191 LYS A O     1 
ATOM   1322  C  CB    . LYS A 1 191 ? 2.305   -10.920 22.052  1.00 70.65  ? 191 LYS A CB    1 
ATOM   1323  N  N     . ARG A 1 192 ? 0.280   -10.385 24.677  1.00 62.22  ? 192 ARG A N     1 
ATOM   1324  C  CA    . ARG A 1 192 ? 0.140   -9.707  25.955  1.00 63.39  ? 192 ARG A CA    1 
ATOM   1325  C  C     . ARG A 1 192 ? -1.253  -9.884  26.550  1.00 65.63  ? 192 ARG A C     1 
ATOM   1326  O  O     . ARG A 1 192 ? -2.236  -10.177 25.849  1.00 55.91  ? 192 ARG A O     1 
ATOM   1327  C  CB    . ARG A 1 192 ? 0.459   -8.217  25.813  1.00 59.70  ? 192 ARG A CB    1 
ATOM   1328  C  CG    . ARG A 1 192 ? 1.869   -7.933  25.354  1.00 59.54  ? 192 ARG A CG    1 
ATOM   1329  C  CD    . ARG A 1 192 ? 2.226   -6.470  25.514  1.00 62.44  ? 192 ARG A CD    1 
ATOM   1330  N  NE    . ARG A 1 192 ? 3.591   -6.212  25.064  1.00 68.05  ? 192 ARG A NE    1 
ATOM   1331  C  CZ    . ARG A 1 192 ? 3.914   -5.806  23.840  1.00 69.90  ? 192 ARG A CZ    1 
ATOM   1332  N  NH1   . ARG A 1 192 ? 2.965   -5.592  22.938  1.00 78.29  ? 192 ARG A NH1   1 
ATOM   1333  N  NH2   . ARG A 1 192 ? 5.186   -5.609  23.519  1.00 78.11  ? 192 ARG A NH2   1 
ATOM   1334  N  N     . VAL A 1 193 ? -1.323  -9.680  27.858  1.00 59.35  ? 193 VAL A N     1 
ATOM   1335  C  CA    . VAL A 1 193 ? -2.514  -9.995  28.616  1.00 62.82  ? 193 VAL A CA    1 
ATOM   1336  C  C     . VAL A 1 193 ? -2.536  -9.114  29.865  1.00 68.99  ? 193 VAL A C     1 
ATOM   1337  O  O     . VAL A 1 193 ? -1.501  -8.832  30.436  1.00 70.04  ? 193 VAL A O     1 
ATOM   1338  C  CB    . VAL A 1 193 ? -2.544  -11.510 28.969  1.00 69.74  ? 193 VAL A CB    1 
ATOM   1339  C  CG1   . VAL A 1 193 ? -1.238  -11.937 29.636  1.00 71.34  ? 193 VAL A CG1   1 
ATOM   1340  C  CG2   . VAL A 1 193 ? -3.718  -11.839 29.834  1.00 72.89  ? 193 VAL A CG2   1 
ATOM   1341  N  N     . ARG A 1 194 ? -3.714  -8.651  30.261  1.00 69.85  ? 194 ARG A N     1 
ATOM   1342  C  CA    A ARG A 1 194 ? -3.866  -7.749  31.398  0.59 73.27  ? 194 ARG A CA    1 
ATOM   1343  C  CA    B ARG A 1 194 ? -3.849  -7.761  31.409  0.41 73.29  ? 194 ARG A CA    1 
ATOM   1344  C  C     . ARG A 1 194 ? -4.724  -8.384  32.492  1.00 76.68  ? 194 ARG A C     1 
ATOM   1345  O  O     . ARG A 1 194 ? -5.681  -9.092  32.195  1.00 78.12  ? 194 ARG A O     1 
ATOM   1346  C  CB    A ARG A 1 194 ? -4.493  -6.433  30.927  0.59 73.52  ? 194 ARG A CB    1 
ATOM   1347  C  CB    B ARG A 1 194 ? -4.430  -6.415  30.964  0.41 73.53  ? 194 ARG A CB    1 
ATOM   1348  C  CG    A ARG A 1 194 ? -4.840  -5.438  32.017  0.59 75.67  ? 194 ARG A CG    1 
ATOM   1349  C  CG    B ARG A 1 194 ? -4.968  -5.544  32.089  0.41 75.66  ? 194 ARG A CG    1 
ATOM   1350  C  CD    A ARG A 1 194 ? -5.750  -4.342  31.473  0.59 75.56  ? 194 ARG A CD    1 
ATOM   1351  C  CD    B ARG A 1 194 ? -5.462  -4.204  31.575  0.41 75.78  ? 194 ARG A CD    1 
ATOM   1352  N  NE    A ARG A 1 194 ? -5.356  -3.904  30.134  0.59 72.21  ? 194 ARG A NE    1 
ATOM   1353  N  NE    B ARG A 1 194 ? -4.406  -3.457  30.897  0.41 74.57  ? 194 ARG A NE    1 
ATOM   1354  C  CZ    A ARG A 1 194 ? -6.151  -3.948  29.068  0.59 68.26  ? 194 ARG A CZ    1 
ATOM   1355  C  CZ    B ARG A 1 194 ? -4.337  -3.292  29.581  0.41 69.24  ? 194 ARG A CZ    1 
ATOM   1356  N  NH1   A ARG A 1 194 ? -7.388  -4.405  29.185  0.59 63.83  ? 194 ARG A NH1   1 
ATOM   1357  N  NH1   B ARG A 1 194 ? -5.269  -3.813  28.795  0.41 69.49  ? 194 ARG A NH1   1 
ATOM   1358  N  NH2   A ARG A 1 194 ? -5.714  -3.533  27.885  0.59 67.18  ? 194 ARG A NH2   1 
ATOM   1359  N  NH2   B ARG A 1 194 ? -3.340  -2.600  29.053  0.41 65.67  ? 194 ARG A NH2   1 
ATOM   1360  N  N     . ASN A 1 195 ? -4.382  -8.134  33.754  1.00 79.68  ? 195 ASN A N     1 
ATOM   1361  C  CA    . ASN A 1 195 ? -5.204  -8.596  34.872  1.00 85.57  ? 195 ASN A CA    1 
ATOM   1362  C  C     . ASN A 1 195 ? -6.654  -8.118  34.742  1.00 86.16  ? 195 ASN A C     1 
ATOM   1363  O  O     . ASN A 1 195 ? -6.925  -7.103  34.097  1.00 85.13  ? 195 ASN A O     1 
ATOM   1364  C  CB    . ASN A 1 195 ? -4.621  -8.125  36.204  1.00 86.46  ? 195 ASN A CB    1 
ATOM   1365  C  CG    . ASN A 1 195 ? -3.318  -8.814  36.551  1.00 86.84  ? 195 ASN A CG    1 
ATOM   1366  O  OD1   . ASN A 1 195 ? -3.032  -9.912  36.071  1.00 83.96  ? 195 ASN A OD1   1 
ATOM   1367  N  ND2   . ASN A 1 195 ? -2.511  -8.163  37.386  1.00 91.02  ? 195 ASN A ND2   1 
ATOM   1368  N  N     . ALA A 1 196 ? -7.586  -8.853  35.340  1.00 86.76  ? 196 ALA A N     1 
ATOM   1369  C  CA    . ALA A 1 196 ? -8.995  -8.469  35.283  1.00 88.69  ? 196 ALA A CA    1 
ATOM   1370  C  C     . ALA A 1 196 ? -9.346  -7.446  36.359  1.00 89.51  ? 196 ALA A C     1 
ATOM   1371  O  O     . ALA A 1 196 ? -10.318 -6.703  36.227  1.00 94.17  ? 196 ALA A O     1 
ATOM   1372  C  CB    . ALA A 1 196 ? -9.882  -9.696  35.415  1.00 89.31  ? 196 ALA A CB    1 
ATOM   1373  N  N     . TYR A 1 197 ? -8.544  -7.411  37.419  1.00 92.37  ? 197 TYR A N     1 
ATOM   1374  C  CA    . TYR A 1 197 ? -8.806  -6.537  38.557  1.00 94.23  ? 197 TYR A CA    1 
ATOM   1375  C  C     . TYR A 1 197 ? -8.098  -5.186  38.446  1.00 96.25  ? 197 TYR A C     1 
ATOM   1376  O  O     . TYR A 1 197 ? -8.629  -4.169  38.893  1.00 97.55  ? 197 TYR A O     1 
ATOM   1377  C  CB    . TYR A 1 197 ? -8.403  -7.232  39.859  1.00 93.46  ? 197 TYR A CB    1 
ATOM   1378  C  CG    . TYR A 1 197 ? -7.222  -8.167  39.724  1.00 92.26  ? 197 TYR A CG    1 
ATOM   1379  C  CD1   . TYR A 1 197 ? -7.410  -9.525  39.504  1.00 86.49  ? 197 TYR A CD1   1 
ATOM   1380  C  CD2   . TYR A 1 197 ? -5.922  -7.696  39.828  1.00 94.02  ? 197 TYR A CD2   1 
ATOM   1381  C  CE1   . TYR A 1 197 ? -6.339  -10.385 39.387  1.00 90.48  ? 197 TYR A CE1   1 
ATOM   1382  C  CE2   . TYR A 1 197 ? -4.842  -8.549  39.710  1.00 91.36  ? 197 TYR A CE2   1 
ATOM   1383  C  CZ    . TYR A 1 197 ? -5.056  -9.892  39.489  1.00 92.61  ? 197 TYR A CZ    1 
ATOM   1384  O  OH    . TYR A 1 197 ? -3.982  -10.746 39.371  1.00 95.07  ? 197 TYR A OH    1 
ATOM   1385  N  N     . ASP A 1 198 ? -6.908  -5.167  37.850  1.00 95.86  ? 198 ASP A N     1 
ATOM   1386  C  CA    . ASP A 1 198 ? -6.189  -3.904  37.680  1.00 95.77  ? 198 ASP A CA    1 
ATOM   1387  C  C     . ASP A 1 198 ? -5.680  -3.688  36.253  1.00 92.51  ? 198 ASP A C     1 
ATOM   1388  O  O     . ASP A 1 198 ? -6.089  -4.384  35.321  1.00 88.55  ? 198 ASP A O     1 
ATOM   1389  C  CB    . ASP A 1 198 ? -5.016  -3.818  38.671  1.00 95.06  ? 198 ASP A CB    1 
ATOM   1390  C  CG    . ASP A 1 198 ? -4.083  -5.018  38.595  1.00 93.84  ? 198 ASP A CG    1 
ATOM   1391  O  OD1   . ASP A 1 198 ? -3.777  -5.477  37.475  1.00 95.55  ? 198 ASP A OD1   1 
ATOM   1392  O  OD2   . ASP A 1 198 ? -3.641  -5.499  39.661  1.00 94.49  ? 198 ASP A OD2   1 
ATOM   1393  N  N     . ARG A 1 199 ? -4.781  -2.720  36.097  1.00 90.01  ? 199 ARG A N     1 
ATOM   1394  C  CA    . ARG A 1 199 ? -4.316  -2.304  34.779  1.00 87.91  ? 199 ARG A CA    1 
ATOM   1395  C  C     . ARG A 1 199 ? -2.978  -2.935  34.409  1.00 86.52  ? 199 ARG A C     1 
ATOM   1396  O  O     . ARG A 1 199 ? -2.461  -2.696  33.318  1.00 87.07  ? 199 ARG A O     1 
ATOM   1397  C  CB    . ARG A 1 199 ? -4.215  -0.782  34.716  1.00 85.09  ? 199 ARG A CB    1 
ATOM   1398  N  N     . ARG A 1 200 ? -2.423  -3.737  35.316  1.00 85.70  ? 200 ARG A N     1 
ATOM   1399  C  CA    . ARG A 1 200 ? -1.108  -4.342  35.112  1.00 84.31  ? 200 ARG A CA    1 
ATOM   1400  C  C     . ARG A 1 200 ? -1.107  -5.260  33.894  1.00 81.02  ? 200 ARG A C     1 
ATOM   1401  O  O     . ARG A 1 200 ? -2.110  -5.904  33.595  1.00 81.75  ? 200 ARG A O     1 
ATOM   1402  C  CB    . ARG A 1 200 ? -0.675  -5.107  36.355  1.00 80.80  ? 200 ARG A CB    1 
ATOM   1403  N  N     . THR A 1 201 ? 0.024   -5.321  33.197  1.00 80.46  ? 201 THR A N     1 
ATOM   1404  C  CA    . THR A 1 201 ? 0.112   -6.091  31.961  1.00 76.30  ? 201 THR A CA    1 
ATOM   1405  C  C     . THR A 1 201 ? 1.255   -7.111  32.030  1.00 73.76  ? 201 THR A C     1 
ATOM   1406  O  O     . THR A 1 201 ? 2.238   -6.919  32.737  1.00 73.64  ? 201 THR A O     1 
ATOM   1407  C  CB    . THR A 1 201 ? 0.297   -5.151  30.730  1.00 75.56  ? 201 THR A CB    1 
ATOM   1408  O  OG1   . THR A 1 201 ? -0.732  -4.152  30.723  1.00 75.05  ? 201 THR A OG1   1 
ATOM   1409  C  CG2   . THR A 1 201 ? 0.234   -5.920  29.417  1.00 72.00  ? 201 THR A CG2   1 
ATOM   1410  N  N     . TRP A 1 202 ? 1.089   -8.209  31.305  1.00 70.36  ? 202 TRP A N     1 
ATOM   1411  C  CA    . TRP A 1 202 ? 2.035   -9.303  31.264  1.00 73.57  ? 202 TRP A CA    1 
ATOM   1412  C  C     . TRP A 1 202 ? 2.246   -9.725  29.826  1.00 73.28  ? 202 TRP A C     1 
ATOM   1413  O  O     . TRP A 1 202 ? 1.387   -9.497  28.969  1.00 66.09  ? 202 TRP A O     1 
ATOM   1414  C  CB    . TRP A 1 202 ? 1.537   -10.511 32.073  1.00 76.72  ? 202 TRP A CB    1 
ATOM   1415  C  CG    . TRP A 1 202 ? 1.163   -10.234 33.497  1.00 79.47  ? 202 TRP A CG    1 
ATOM   1416  C  CD1   . TRP A 1 202 ? -0.093  -10.028 34.001  1.00 77.15  ? 202 TRP A CD1   1 
ATOM   1417  C  CD2   . TRP A 1 202 ? 2.057   -10.150 34.605  1.00 78.58  ? 202 TRP A CD2   1 
ATOM   1418  N  NE1   . TRP A 1 202 ? -0.028  -9.816  35.358  1.00 76.77  ? 202 TRP A NE1   1 
ATOM   1419  C  CE2   . TRP A 1 202 ? 1.285   -9.886  35.752  1.00 81.20  ? 202 TRP A CE2   1 
ATOM   1420  C  CE3   . TRP A 1 202 ? 3.443   -10.270 34.739  1.00 80.72  ? 202 TRP A CE3   1 
ATOM   1421  C  CZ2   . TRP A 1 202 ? 1.851   -9.740  37.015  1.00 89.73  ? 202 TRP A CZ2   1 
ATOM   1422  C  CZ3   . TRP A 1 202 ? 4.003   -10.123 35.988  1.00 84.60  ? 202 TRP A CZ3   1 
ATOM   1423  C  CH2   . TRP A 1 202 ? 3.211   -9.861  37.110  1.00 86.88  ? 202 TRP A CH2   1 
ATOM   1424  N  N     . GLU A 1 203 ? 3.379   -10.372 29.583  1.00 72.97  ? 203 GLU A N     1 
ATOM   1425  C  CA    . GLU A 1 203 ? 3.658   -11.006 28.307  1.00 75.99  ? 203 GLU A CA    1 
ATOM   1426  C  C     . GLU A 1 203 ? 3.297   -12.481 28.406  1.00 78.71  ? 203 GLU A C     1 
ATOM   1427  O  O     . GLU A 1 203 ? 3.915   -13.218 29.168  1.00 86.33  ? 203 GLU A O     1 
ATOM   1428  C  CB    . GLU A 1 203 ? 5.124   -10.829 27.927  1.00 79.46  ? 203 GLU A CB    1 
ATOM   1429  N  N     . LEU A 1 204 ? 2.283   -12.907 27.659  1.00 76.87  ? 204 LEU A N     1 
ATOM   1430  C  CA    . LEU A 1 204 ? 1.852   -14.302 27.692  1.00 82.27  ? 204 LEU A CA    1 
ATOM   1431  C  C     . LEU A 1 204 ? 2.867   -15.190 26.981  1.00 84.75  ? 204 LEU A C     1 
ATOM   1432  O  O     . LEU A 1 204 ? 3.021   -15.125 25.760  1.00 82.74  ? 204 LEU A O     1 
ATOM   1433  C  CB    . LEU A 1 204 ? 0.473   -14.472 27.054  1.00 78.07  ? 204 LEU A CB    1 
ATOM   1434  C  CG    . LEU A 1 204 ? -0.115  -15.882 27.145  1.00 84.62  ? 204 LEU A CG    1 
ATOM   1435  C  CD1   . LEU A 1 204 ? -0.138  -16.356 28.590  1.00 86.71  ? 204 LEU A CD1   1 
ATOM   1436  C  CD2   . LEU A 1 204 ? -1.508  -15.956 26.528  1.00 77.95  ? 204 LEU A CD2   1 
ATOM   1437  N  N     . LEU A 1 205 ? 3.556   -16.022 27.752  1.00 91.52  ? 205 LEU A N     1 
ATOM   1438  C  CA    . LEU A 1 205 ? 4.610   -16.865 27.210  1.00 88.58  ? 205 LEU A CA    1 
ATOM   1439  C  C     . LEU A 1 205 ? 4.011   -18.117 26.587  1.00 87.53  ? 205 LEU A C     1 
ATOM   1440  O  O     . LEU A 1 205 ? 4.285   -18.430 25.429  1.00 92.00  ? 205 LEU A O     1 
ATOM   1441  C  CB    . LEU A 1 205 ? 5.610   -17.229 28.296  1.00 86.69  ? 205 LEU A CB    1 
ATOM   1442  N  N     . ARG A 1 206 ? 3.185   -18.823 27.353  1.00 88.02  ? 206 ARG A N     1 
ATOM   1443  C  CA    . ARG A 1 206 ? 2.553   -20.052 26.878  1.00 90.89  ? 206 ARG A CA    1 
ATOM   1444  C  C     . ARG A 1 206 ? 1.454   -20.506 27.831  1.00 92.35  ? 206 ARG A C     1 
ATOM   1445  O  O     . ARG A 1 206 ? 1.205   -19.869 28.853  1.00 92.87  ? 206 ARG A O     1 
ATOM   1446  C  CB    . ARG A 1 206 ? 3.592   -21.156 26.706  1.00 95.78  ? 206 ARG A CB    1 
ATOM   1447  N  N     . LEU A 1 207 ? 0.815   -21.623 27.501  1.00 98.18  ? 207 LEU A N     1 
ATOM   1448  C  CA    . LEU A 1 207 ? -0.147  -22.249 28.401  1.00 100.33 ? 207 LEU A CA    1 
ATOM   1449  C  C     . LEU A 1 207 ? 0.543   -23.371 29.169  1.00 104.96 ? 207 LEU A C     1 
ATOM   1450  O  O     . LEU A 1 207 ? 1.653   -23.777 28.821  1.00 106.10 ? 207 LEU A O     1 
ATOM   1451  C  CB    . LEU A 1 207 ? -1.350  -22.804 27.632  1.00 97.72  ? 207 LEU A CB    1 
ATOM   1452  C  CG    . LEU A 1 207 ? -2.410  -21.853 27.082  1.00 93.55  ? 207 LEU A CG    1 
ATOM   1453  C  CD1   . LEU A 1 207 ? -3.361  -22.602 26.157  1.00 90.05  ? 207 LEU A CD1   1 
ATOM   1454  C  CD2   . LEU A 1 207 ? -3.181  -21.217 28.225  1.00 93.04  ? 207 LEU A CD2   1 
ATOM   1455  N  N     . GLY A 1 208 ? -0.112  -23.869 30.213  1.00 107.86 ? 208 GLY A N     1 
ATOM   1456  C  CA    . GLY A 1 208 ? 0.463   -24.914 31.039  1.00 113.40 ? 208 GLY A CA    1 
ATOM   1457  C  C     . GLY A 1 208 ? -0.585  -25.905 31.505  1.00 117.17 ? 208 GLY A C     1 
ATOM   1458  O  O     . GLY A 1 208 ? -1.626  -25.520 32.044  1.00 115.08 ? 208 GLY A O     1 
ATOM   1459  N  N     . GLU A 1 209 ? -0.304  -27.190 31.309  1.00 120.13 ? 209 GLU A N     1 
ATOM   1460  C  CA    . GLU A 1 209 ? -1.248  -28.240 31.674  1.00 120.49 ? 209 GLU A CA    1 
ATOM   1461  C  C     . GLU A 1 209 ? -1.067  -28.614 33.136  1.00 119.39 ? 209 GLU A C     1 
ATOM   1462  O  O     . GLU A 1 209 ? -1.532  -29.663 33.583  1.00 120.32 ? 209 GLU A O     1 
ATOM   1463  C  CB    . GLU A 1 209 ? -1.070  -29.459 30.781  1.00 118.28 ? 209 GLU A CB    1 
ATOM   1464  N  N     . GLU A 1 210 ? -0.396  -27.741 33.879  1.00 115.53 ? 210 GLU A N     1 
ATOM   1465  C  CA    . GLU A 1 210 ? -0.184  -27.963 35.296  1.00 113.48 ? 210 GLU A CA    1 
ATOM   1466  C  C     . GLU A 1 210 ? -1.476  -27.667 36.041  1.00 115.12 ? 210 GLU A C     1 
ATOM   1467  O  O     . GLU A 1 210 ? -2.293  -26.869 35.588  1.00 114.70 ? 210 GLU A O     1 
ATOM   1468  C  CB    . GLU A 1 210 ? 0.947   -27.089 35.810  1.00 110.45 ? 210 GLU A CB    1 
ATOM   1469  N  N     . ASP A 1 211 ? -1.658  -28.316 37.184  1.00 116.07 ? 211 ASP A N     1 
ATOM   1470  C  CA    . ASP A 1 211 ? -2.842  -28.099 38.003  1.00 119.36 ? 211 ASP A CA    1 
ATOM   1471  C  C     . ASP A 1 211 ? -2.689  -26.811 38.796  1.00 118.40 ? 211 ASP A C     1 
ATOM   1472  O  O     . ASP A 1 211 ? -1.575  -26.338 39.008  1.00 116.52 ? 211 ASP A O     1 
ATOM   1473  C  CB    . ASP A 1 211 ? -3.077  -29.280 38.931  1.00 118.26 ? 211 ASP A CB    1 
ATOM   1474  N  N     . PRO A 1 212 ? -3.808  -26.246 39.234  1.00 121.58 ? 212 PRO A N     1 
ATOM   1475  C  CA    . PRO A 1 212 ? -3.781  -24.975 39.947  1.00 122.50 ? 212 PRO A CA    1 
ATOM   1476  C  C     . PRO A 1 212 ? -3.268  -25.110 41.384  1.00 124.50 ? 212 PRO A C     1 
ATOM   1477  O  O     . PRO A 1 212 ? -2.370  -24.374 41.799  1.00 122.24 ? 212 PRO A O     1 
ATOM   1478  C  CB    . PRO A 1 212 ? -5.170  -24.353 39.944  1.00 115.97 ? 212 PRO A CB    1 
ATOM   1479  N  N     . LYS A 1 213 ? -3.825  -26.055 42.136  1.00 126.65 ? 213 LYS A N     1 
ATOM   1480  C  CA    . LYS A 1 213 ? -3.489  -26.187 43.551  1.00 125.25 ? 213 LYS A CA    1 
ATOM   1481  C  C     . LYS A 1 213 ? -2.221  -27.011 43.756  1.00 122.25 ? 213 LYS A C     1 
ATOM   1482  O  O     . LYS A 1 213 ? -1.775  -27.204 44.887  1.00 122.63 ? 213 LYS A O     1 
ATOM   1483  C  CB    . LYS A 1 213 ? -4.654  -26.806 44.316  1.00 118.79 ? 213 LYS A CB    1 
ATOM   1484  N  N     . GLU A 1 214 ? -1.639  -27.485 42.658  1.00 120.27 ? 214 GLU A N     1 
ATOM   1485  C  CA    . GLU A 1 214 ? -0.448  -28.325 42.717  1.00 120.89 ? 214 GLU A CA    1 
ATOM   1486  C  C     . GLU A 1 214 ? 0.775   -27.581 42.192  1.00 118.95 ? 214 GLU A C     1 
ATOM   1487  O  O     . GLU A 1 214 ? 1.847   -28.164 42.037  1.00 113.05 ? 214 GLU A O     1 
ATOM   1488  C  CB    . GLU A 1 214 ? -0.666  -29.613 41.933  1.00 122.72 ? 214 GLU A CB    1 
ATOM   1489  N  N     . LEU A 1 223 ? -0.686  -22.112 43.939  1.00 121.39 ? 223 LEU A N     1 
ATOM   1490  C  CA    . LEU A 1 223 ? -0.736  -21.045 42.944  1.00 124.60 ? 223 LEU A CA    1 
ATOM   1491  C  C     . LEU A 1 223 ? -2.121  -20.406 42.902  1.00 127.46 ? 223 LEU A C     1 
ATOM   1492  O  O     . LEU A 1 223 ? -2.259  -19.188 43.024  1.00 126.71 ? 223 LEU A O     1 
ATOM   1493  C  CB    . LEU A 1 223 ? -0.351  -21.579 41.572  1.00 120.31 ? 223 LEU A CB    1 
ATOM   1494  N  N     . LEU A 1 224 ? -3.141  -21.241 42.724  1.00 128.18 ? 224 LEU A N     1 
ATOM   1495  C  CA    . LEU A 1 224 ? -4.531  -20.797 42.735  1.00 128.04 ? 224 LEU A CA    1 
ATOM   1496  C  C     . LEU A 1 224 ? -4.835  -20.098 44.049  1.00 128.07 ? 224 LEU A C     1 
ATOM   1497  O  O     . LEU A 1 224 ? -5.537  -19.090 44.086  1.00 128.56 ? 224 LEU A O     1 
ATOM   1498  C  CB    . LEU A 1 224 ? -5.472  -21.969 42.528  1.00 126.02 ? 224 LEU A CB    1 
ATOM   1499  N  N     . ASP A 1 225 ? -4.305  -20.672 45.124  1.00 126.96 ? 225 ASP A N     1 
ATOM   1500  C  CA    . ASP A 1 225 ? -4.538  -20.209 46.484  1.00 127.55 ? 225 ASP A CA    1 
ATOM   1501  C  C     . ASP A 1 225 ? -4.163  -18.733 46.661  1.00 127.34 ? 225 ASP A C     1 
ATOM   1502  O  O     . ASP A 1 225 ? -4.866  -17.972 47.345  1.00 126.76 ? 225 ASP A O     1 
ATOM   1503  C  CB    . ASP A 1 225 ? -3.735  -21.077 47.452  1.00 125.81 ? 225 ASP A CB    1 
ATOM   1504  C  CG    . ASP A 1 225 ? -4.111  -22.544 47.363  1.00 124.14 ? 225 ASP A CG    1 
ATOM   1505  O  OD1   . ASP A 1 225 ? -5.232  -22.851 46.907  1.00 124.78 ? 225 ASP A OD1   1 
ATOM   1506  O  OD2   . ASP A 1 225 ? -3.278  -23.395 47.736  1.00 125.07 ? 225 ASP A OD2   1 
ATOM   1507  N  N     . TYR A 1 226 ? -3.056  -18.343 46.032  1.00 126.43 ? 226 TYR A N     1 
ATOM   1508  C  CA    . TYR A 1 226 ? -2.564  -16.967 46.076  1.00 128.58 ? 226 TYR A CA    1 
ATOM   1509  C  C     . TYR A 1 226 ? -3.634  -15.969 45.638  1.00 125.82 ? 226 TYR A C     1 
ATOM   1510  O  O     . TYR A 1 226 ? -3.779  -14.894 46.224  1.00 122.96 ? 226 TYR A O     1 
ATOM   1511  C  CB    . TYR A 1 226 ? -1.319  -16.824 45.204  1.00 123.11 ? 226 TYR A CB    1 
ATOM   1512  N  N     . HIS A 1 227 ? -4.381  -16.335 44.602  1.00 127.35 ? 227 HIS A N     1 
ATOM   1513  C  CA    . HIS A 1 227 ? -5.470  -15.504 44.104  1.00 126.23 ? 227 HIS A CA    1 
ATOM   1514  C  C     . HIS A 1 227 ? -6.722  -15.726 44.942  1.00 125.86 ? 227 HIS A C     1 
ATOM   1515  O  O     . HIS A 1 227 ? -7.557  -14.831 45.075  1.00 124.77 ? 227 HIS A O     1 
ATOM   1516  C  CB    . HIS A 1 227 ? -5.747  -15.792 42.625  1.00 125.20 ? 227 HIS A CB    1 
ATOM   1517  C  CG    . HIS A 1 227 ? -4.622  -15.402 41.713  1.00 123.66 ? 227 HIS A CG    1 
ATOM   1518  N  ND1   . HIS A 1 227 ? -4.487  -14.132 41.198  1.00 117.98 ? 227 HIS A ND1   1 
ATOM   1519  C  CD2   . HIS A 1 227 ? -3.581  -16.120 41.225  1.00 120.22 ? 227 HIS A CD2   1 
ATOM   1520  C  CE1   . HIS A 1 227 ? -3.408  -14.080 40.434  1.00 112.63 ? 227 HIS A CE1   1 
ATOM   1521  N  NE2   . HIS A 1 227 ? -2.843  -15.273 40.433  1.00 112.47 ? 227 HIS A NE2   1 
ATOM   1522  N  N     . ALA A 1 228 ? -6.849  -16.932 45.490  1.00 127.44 ? 228 ALA A N     1 
ATOM   1523  C  CA    . ALA A 1 228 ? -7.971  -17.275 46.353  1.00 124.92 ? 228 ALA A CA    1 
ATOM   1524  C  C     . ALA A 1 228 ? -8.018  -16.325 47.542  1.00 124.37 ? 228 ALA A C     1 
ATOM   1525  O  O     . ALA A 1 228 ? -9.098  -15.950 47.998  1.00 122.86 ? 228 ALA A O     1 
ATOM   1526  C  CB    . ALA A 1 228 ? -7.872  -18.718 46.819  1.00 122.03 ? 228 ALA A CB    1 
ATOM   1527  N  N     . SER A 1 229 ? -6.844  -15.920 48.023  1.00 123.64 ? 229 SER A N     1 
ATOM   1528  C  CA    . SER A 1 229 ? -6.755  -14.993 49.153  1.00 123.75 ? 229 SER A CA    1 
ATOM   1529  C  C     . SER A 1 229 ? -7.422  -13.637 48.880  1.00 125.37 ? 229 SER A C     1 
ATOM   1530  O  O     . SER A 1 229 ? -7.780  -12.919 49.816  1.00 120.57 ? 229 SER A O     1 
ATOM   1531  C  CB    . SER A 1 229 ? -5.300  -14.783 49.538  1.00 123.51 ? 229 SER A CB    1 
ATOM   1532  N  N     . LYS A 1 230 ? -7.586  -13.286 47.607  1.00 126.82 ? 230 LYS A N     1 
ATOM   1533  C  CA    . LYS A 1 230 ? -8.256  -12.040 47.240  1.00 125.47 ? 230 LYS A CA    1 
ATOM   1534  C  C     . LYS A 1 230 ? -9.590  -12.303 46.539  1.00 125.91 ? 230 LYS A C     1 
ATOM   1535  O  O     . LYS A 1 230 ? -9.651  -12.994 45.519  1.00 121.09 ? 230 LYS A O     1 
ATOM   1536  C  CB    . LYS A 1 230 ? -7.352  -11.189 46.358  1.00 120.59 ? 230 LYS A CB    1 
ATOM   1537  N  N     . GLN A 1 234 ? -13.315 -13.941 43.162  1.00 113.57 ? 234 GLN A N     1 
ATOM   1538  C  CA    . GLN A 1 234 ? -14.446 -13.026 43.257  1.00 120.60 ? 234 GLN A CA    1 
ATOM   1539  C  C     . GLN A 1 234 ? -15.602 -13.487 42.372  1.00 124.65 ? 234 GLN A C     1 
ATOM   1540  O  O     . GLN A 1 234 ? -15.696 -14.665 42.020  1.00 124.29 ? 234 GLN A O     1 
ATOM   1541  C  CB    . GLN A 1 234 ? -14.020 -11.615 42.883  1.00 117.96 ? 234 GLN A CB    1 
ATOM   1542  N  N     . GLY A 1 235 ? -16.477 -12.549 42.018  1.00 123.31 ? 235 GLY A N     1 
ATOM   1543  C  CA    . GLY A 1 235 ? -17.662 -12.813 41.212  1.00 121.56 ? 235 GLY A CA    1 
ATOM   1544  C  C     . GLY A 1 235 ? -17.435 -13.488 39.867  1.00 121.18 ? 235 GLY A C     1 
ATOM   1545  O  O     . GLY A 1 235 ? -18.073 -13.127 38.878  1.00 120.95 ? 235 GLY A O     1 
ATOM   1546  N  N     . ARG A 1 236 ? -16.534 -14.464 39.822  1.00 118.87 ? 236 ARG A N     1 
ATOM   1547  C  CA    . ARG A 1 236 ? -16.135 -15.093 38.568  1.00 117.00 ? 236 ARG A CA    1 
ATOM   1548  C  C     . ARG A 1 236 ? -15.560 -16.485 38.796  1.00 115.59 ? 236 ARG A C     1 
ATOM   1549  O  O     . ARG A 1 236 ? -15.410 -16.929 39.934  1.00 116.49 ? 236 ARG A O     1 
ATOM   1550  C  CB    . ARG A 1 236 ? -15.121 -14.220 37.842  1.00 115.41 ? 236 ARG A CB    1 
ATOM   1551  N  N     . GLU A 1 237 ? -15.242 -17.166 37.700  1.00 112.19 ? 237 GLU A N     1 
ATOM   1552  C  CA    . GLU A 1 237 ? -14.623 -18.483 37.764  1.00 107.45 ? 237 GLU A CA    1 
ATOM   1553  C  C     . GLU A 1 237 ? -13.282 -18.471 37.046  1.00 105.50 ? 237 GLU A C     1 
ATOM   1554  O  O     . GLU A 1 237 ? -13.063 -17.681 36.128  1.00 103.63 ? 237 GLU A O     1 
ATOM   1555  C  CB    . GLU A 1 237 ? -15.540 -19.534 37.154  1.00 107.28 ? 237 GLU A CB    1 
ATOM   1556  N  N     . GLY A 1 238 ? -12.388 -19.357 37.472  1.00 102.27 ? 238 GLY A N     1 
ATOM   1557  C  CA    . GLY A 1 238 ? -11.053 -19.443 36.909  1.00 99.08  ? 238 GLY A CA    1 
ATOM   1558  C  C     . GLY A 1 238 ? -10.889 -20.594 35.939  1.00 99.04  ? 238 GLY A C     1 
ATOM   1559  O  O     . GLY A 1 238 ? -11.630 -21.576 35.996  1.00 106.19 ? 238 GLY A O     1 
ATOM   1560  N  N     . GLY A 1 239 ? -9.925  -20.468 35.034  1.00 97.18  ? 239 GLY A N     1 
ATOM   1561  C  CA    . GLY A 1 239 ? -9.668  -21.506 34.053  1.00 93.84  ? 239 GLY A CA    1 
ATOM   1562  C  C     . GLY A 1 239 ? -8.308  -22.153 34.226  1.00 95.85  ? 239 GLY A C     1 
ATOM   1563  O  O     . GLY A 1 239 ? -7.812  -22.273 35.343  1.00 100.65 ? 239 GLY A O     1 
ATOM   1564  N  N     . ARG A 1 240 ? -7.693  -22.550 33.115  1.00 97.58  ? 240 ARG A N     1 
ATOM   1565  C  CA    . ARG A 1 240 ? -6.410  -23.251 33.142  1.00 99.06  ? 240 ARG A CA    1 
ATOM   1566  C  C     . ARG A 1 240 ? -5.230  -22.353 33.521  1.00 102.43 ? 240 ARG A C     1 
ATOM   1567  O  O     . ARG A 1 240 ? -5.394  -21.160 33.786  1.00 103.36 ? 240 ARG A O     1 
ATOM   1568  C  CB    . ARG A 1 240 ? -6.115  -23.839 31.764  1.00 96.82  ? 240 ARG A CB    1 
ATOM   1569  N  N     . VAL A 1 241 ? -4.045  -22.956 33.570  1.00 102.42 ? 241 VAL A N     1 
ATOM   1570  C  CA    . VAL A 1 241 ? -2.805  -22.249 33.888  1.00 106.21 ? 241 VAL A CA    1 
ATOM   1571  C  C     . VAL A 1 241 ? -2.175  -21.569 32.671  1.00 107.53 ? 241 VAL A C     1 
ATOM   1572  O  O     . VAL A 1 241 ? -2.139  -22.139 31.577  1.00 106.49 ? 241 VAL A O     1 
ATOM   1573  C  CB    . VAL A 1 241 ? -1.786  -23.225 34.541  1.00 109.90 ? 241 VAL A CB    1 
ATOM   1574  C  CG1   . VAL A 1 241 ? -0.375  -22.634 34.573  1.00 108.72 ? 241 VAL A CG1   1 
ATOM   1575  C  CG2   . VAL A 1 241 ? -2.246  -23.610 35.940  1.00 110.96 ? 241 VAL A CG2   1 
ATOM   1576  N  N     . ALA A 1 242 ? -1.707  -20.338 32.867  1.00 104.26 ? 242 ALA A N     1 
ATOM   1577  C  CA    . ALA A 1 242 ? -0.993  -19.591 31.835  1.00 98.96  ? 242 ALA A CA    1 
ATOM   1578  C  C     . ALA A 1 242 ? 0.435   -19.232 32.248  1.00 98.13  ? 242 ALA A C     1 
ATOM   1579  O  O     . ALA A 1 242 ? 0.644   -18.659 33.319  1.00 100.08 ? 242 ALA A O     1 
ATOM   1580  C  CB    . ALA A 1 242 ? -1.766  -18.326 31.482  1.00 93.79  ? 242 ALA A CB    1 
ATOM   1581  N  N     . TRP A 1 243 ? 1.420   -19.577 31.421  1.00 96.62  ? 243 TRP A N     1 
ATOM   1582  C  CA    . TRP A 1 243 ? 2.778   -19.104 31.682  1.00 99.90  ? 243 TRP A CA    1 
ATOM   1583  C  C     . TRP A 1 243 ? 2.852   -17.633 31.266  1.00 96.96  ? 243 TRP A C     1 
ATOM   1584  O  O     . TRP A 1 243 ? 2.562   -17.285 30.124  1.00 94.25  ? 243 TRP A O     1 
ATOM   1585  C  CB    . TRP A 1 243 ? 3.849   -19.913 30.931  1.00 98.45  ? 243 TRP A CB    1 
ATOM   1586  C  CG    . TRP A 1 243 ? 4.166   -21.278 31.507  1.00 107.23 ? 243 TRP A CG    1 
ATOM   1587  C  CD1   . TRP A 1 243 ? 4.081   -22.486 30.865  1.00 106.04 ? 243 TRP A CD1   1 
ATOM   1588  C  CD2   . TRP A 1 243 ? 4.576   -21.571 32.851  1.00 107.57 ? 243 TRP A CD2   1 
ATOM   1589  N  NE1   . TRP A 1 243 ? 4.442   -23.502 31.717  1.00 104.06 ? 243 TRP A NE1   1 
ATOM   1590  C  CE2   . TRP A 1 243 ? 4.743   -22.968 32.944  1.00 106.11 ? 243 TRP A CE2   1 
ATOM   1591  C  CE3   . TRP A 1 243 ? 4.824   -20.786 33.984  1.00 105.00 ? 243 TRP A CE3   1 
ATOM   1592  C  CZ2   . TRP A 1 243 ? 5.148   -23.595 34.122  1.00 106.80 ? 243 TRP A CZ2   1 
ATOM   1593  C  CZ3   . TRP A 1 243 ? 5.224   -21.410 35.151  1.00 104.91 ? 243 TRP A CZ3   1 
ATOM   1594  C  CH2   . TRP A 1 243 ? 5.384   -22.800 35.211  1.00 105.34 ? 243 TRP A CH2   1 
ATOM   1595  N  N     . VAL A 1 244 ? 3.228   -16.774 32.204  1.00 92.51  ? 244 VAL A N     1 
ATOM   1596  C  CA    . VAL A 1 244 ? 3.150   -15.335 32.008  1.00 89.47  ? 244 VAL A CA    1 
ATOM   1597  C  C     . VAL A 1 244 ? 4.527   -14.725 32.301  1.00 92.33  ? 244 VAL A C     1 
ATOM   1598  O  O     . VAL A 1 244 ? 5.390   -15.407 32.842  1.00 95.44  ? 244 VAL A O     1 
ATOM   1599  C  CB    . VAL A 1 244 ? 2.021   -14.749 32.897  1.00 86.96  ? 244 VAL A CB    1 
ATOM   1600  C  CG1   . VAL A 1 244 ? 2.537   -13.732 33.907  1.00 91.20  ? 244 VAL A CG1   1 
ATOM   1601  C  CG2   . VAL A 1 244 ? 0.915   -14.181 32.035  1.00 85.92  ? 244 VAL A CG2   1 
ATOM   1602  N  N     . ALA A 1 245 ? 4.768   -13.475 31.914  1.00 88.93  ? 245 ALA A N     1 
ATOM   1603  C  CA    . ALA A 1 245 ? 6.057   -12.860 32.206  1.00 85.94  ? 245 ALA A CA    1 
ATOM   1604  C  C     . ALA A 1 245 ? 5.970   -11.356 32.446  1.00 87.10  ? 245 ALA A C     1 
ATOM   1605  O  O     . ALA A 1 245 ? 5.192   -10.658 31.803  1.00 85.14  ? 245 ALA A O     1 
ATOM   1606  C  CB    . ALA A 1 245 ? 7.036   -13.148 31.073  1.00 87.39  ? 245 ALA A CB    1 
ATOM   1607  N  N     . ASP A 1 246 ? 6.766   -10.869 33.392  1.00 81.51  ? 246 ASP A N     1 
ATOM   1608  C  CA    . ASP A 1 246 ? 6.885   -9.438  33.630  1.00 83.01  ? 246 ASP A CA    1 
ATOM   1609  C  C     . ASP A 1 246 ? 7.845   -8.853  32.603  1.00 88.09  ? 246 ASP A C     1 
ATOM   1610  O  O     . ASP A 1 246 ? 8.875   -9.455  32.300  1.00 86.08  ? 246 ASP A O     1 
ATOM   1611  C  CB    . ASP A 1 246 ? 7.370   -9.146  35.050  1.00 83.19  ? 246 ASP A CB    1 
ATOM   1612  C  CG    . ASP A 1 246 ? 7.298   -7.668  35.397  1.00 82.63  ? 246 ASP A CG    1 
ATOM   1613  O  OD1   . ASP A 1 246 ? 8.079   -6.879  34.827  1.00 81.75  ? 246 ASP A OD1   1 
ATOM   1614  O  OD2   . ASP A 1 246 ? 6.462   -7.294  36.246  1.00 89.05  ? 246 ASP A OD2   1 
ATOM   1615  N  N     . PRO A 1 247 ? 7.500   -7.690  32.060  1.00 88.64  ? 247 PRO A N     1 
ATOM   1616  C  CA    . PRO A 1 247 ? 8.317   -7.047  31.036  1.00 89.01  ? 247 PRO A CA    1 
ATOM   1617  C  C     . PRO A 1 247 ? 9.768   -6.848  31.486  1.00 84.39  ? 247 PRO A C     1 
ATOM   1618  O  O     . PRO A 1 247 ? 10.699  -7.067  30.712  1.00 83.23  ? 247 PRO A O     1 
ATOM   1619  C  CB    . PRO A 1 247 ? 7.699   -5.718  30.639  1.00 85.99  ? 247 PRO A CB    1 
ATOM   1620  N  N     . LYS A 1 248 ? 9.951   -6.444  32.740  1.00 87.59  ? 248 LYS A N     1 
ATOM   1621  C  CA    . LYS A 1 248 ? 11.274  -6.161  33.294  1.00 80.37  ? 248 LYS A CA    1 
ATOM   1622  C  C     . LYS A 1 248 ? 12.150  -7.409  33.449  1.00 86.65  ? 248 LYS A C     1 
ATOM   1623  O  O     . LYS A 1 248 ? 13.327  -7.309  33.799  1.00 89.40  ? 248 LYS A O     1 
ATOM   1624  C  CB    . LYS A 1 248 ? 11.127  -5.461  34.635  1.00 71.41  ? 248 LYS A CB    1 
ATOM   1625  N  N     . ASP A 1 249 ? 11.571  -8.578  33.197  1.00 88.51  ? 249 ASP A N     1 
ATOM   1626  C  CA    . ASP A 1 249 ? 12.293  -9.847  33.267  1.00 88.57  ? 249 ASP A CA    1 
ATOM   1627  C  C     . ASP A 1 249 ? 11.434  -10.530 32.207  1.00 89.10  ? 249 ASP A C     1 
ATOM   1628  O  O     . ASP A 1 249 ? 10.281  -10.883 32.461  1.00 89.96  ? 249 ASP A O     1 
ATOM   1629  C  CB    . ASP A 1 249 ? 12.289  -10.396 34.684  1.00 90.34  ? 249 ASP A CB    1 
ATOM   1630  N  N     . PRO A 1 250 ? 11.997  -10.704 31.013  1.00 86.90  ? 250 PRO A N     1 
ATOM   1631  C  CA    . PRO A 1 250 ? 11.330  -11.472 29.969  1.00 89.85  ? 250 PRO A CA    1 
ATOM   1632  C  C     . PRO A 1 250 ? 11.709  -12.953 29.954  1.00 94.96  ? 250 PRO A C     1 
ATOM   1633  O  O     . PRO A 1 250 ? 10.962  -13.784 29.435  1.00 96.73  ? 250 PRO A O     1 
ATOM   1634  C  CB    . PRO A 1 250 ? 11.627  -10.848 28.615  1.00 90.09  ? 250 PRO A CB    1 
ATOM   1635  N  N     . ARG A 1 251 ? 12.862  -13.282 30.531  1.00 97.39  ? 251 ARG A N     1 
ATOM   1636  C  CA    . ARG A 1 251 ? 13.333  -14.664 30.571  1.00 98.35  ? 251 ARG A CA    1 
ATOM   1637  C  C     . ARG A 1 251 ? 12.922  -15.378 31.862  1.00 96.74  ? 251 ARG A C     1 
ATOM   1638  O  O     . ARG A 1 251 ? 13.377  -16.491 32.133  1.00 93.77  ? 251 ARG A O     1 
ATOM   1639  C  CB    . ARG A 1 251 ? 14.856  -14.706 30.406  1.00 88.90  ? 251 ARG A CB    1 
ATOM   1640  N  N     . LYS A 1 252 ? 12.061  -14.738 32.651  1.00 92.20  ? 252 LYS A N     1 
ATOM   1641  C  CA    . LYS A 1 252 ? 11.685  -15.258 33.966  1.00 94.25  ? 252 LYS A CA    1 
ATOM   1642  C  C     . LYS A 1 252 ? 10.198  -15.608 34.031  1.00 91.32  ? 252 LYS A C     1 
ATOM   1643  O  O     . LYS A 1 252 ? 9.375   -14.767 34.390  1.00 94.72  ? 252 LYS A O     1 
ATOM   1644  C  CB    . LYS A 1 252 ? 12.047  -14.238 35.058  1.00 93.92  ? 252 LYS A CB    1 
ATOM   1645  C  CG    . LYS A 1 252 ? 11.721  -14.682 36.481  1.00 95.47  ? 252 LYS A CG    1 
ATOM   1646  C  CD    . LYS A 1 252 ? 12.413  -13.804 37.520  1.00 98.46  ? 252 LYS A CD    1 
ATOM   1647  C  CE    . LYS A 1 252 ? 11.925  -14.139 38.926  1.00 100.55 ? 252 LYS A CE    1 
ATOM   1648  N  NZ    . LYS A 1 252 ? 12.938  -13.853 39.984  1.00 92.28  ? 252 LYS A NZ    1 
ATOM   1649  N  N     . PRO A 1 253 ? 9.849   -16.858 33.674  1.00 94.37  ? 253 PRO A N     1 
ATOM   1650  C  CA    . PRO A 1 253 ? 8.449   -17.310 33.639  1.00 95.25  ? 253 PRO A CA    1 
ATOM   1651  C  C     . PRO A 1 253 ? 7.769   -17.289 35.007  1.00 95.14  ? 253 PRO A C     1 
ATOM   1652  O  O     . PRO A 1 253 ? 8.413   -17.574 36.015  1.00 93.51  ? 253 PRO A O     1 
ATOM   1653  C  CB    . PRO A 1 253 ? 8.562   -18.749 33.121  1.00 92.62  ? 253 PRO A CB    1 
ATOM   1654  C  CG    . PRO A 1 253 ? 9.841   -18.766 32.348  1.00 89.68  ? 253 PRO A CG    1 
ATOM   1655  C  CD    . PRO A 1 253 ? 10.762  -17.875 33.126  1.00 90.74  ? 253 PRO A CD    1 
ATOM   1656  N  N     . ILE A 1 254 ? 6.481   -16.950 35.024  1.00 95.36  ? 254 ILE A N     1 
ATOM   1657  C  CA    . ILE A 1 254 ? 5.694   -16.860 36.254  1.00 96.49  ? 254 ILE A CA    1 
ATOM   1658  C  C     . ILE A 1 254 ? 4.230   -17.232 35.971  1.00 101.41 ? 254 ILE A C     1 
ATOM   1659  O  O     . ILE A 1 254 ? 3.607   -16.668 35.070  1.00 100.31 ? 254 ILE A O     1 
ATOM   1660  C  CB    . ILE A 1 254 ? 5.794   -15.444 36.883  1.00 95.73  ? 254 ILE A CB    1 
ATOM   1661  C  CG1   . ILE A 1 254 ? 4.488   -15.050 37.576  1.00 100.94 ? 254 ILE A CG1   1 
ATOM   1662  C  CG2   . ILE A 1 254 ? 6.170   -14.406 35.834  1.00 94.37  ? 254 ILE A CG2   1 
ATOM   1663  C  CD1   . ILE A 1 254 ? 4.424   -13.582 37.938  1.00 103.12 ? 254 ILE A CD1   1 
ATOM   1664  N  N     . PRO A 1 255 ? 3.677   -18.182 36.748  1.00 105.99 ? 255 PRO A N     1 
ATOM   1665  C  CA    . PRO A 1 255 ? 2.353   -18.793 36.531  1.00 102.93 ? 255 PRO A CA    1 
ATOM   1666  C  C     . PRO A 1 255 ? 1.161   -17.871 36.822  1.00 100.79 ? 255 PRO A C     1 
ATOM   1667  O  O     . PRO A 1 255 ? 1.267   -17.004 37.688  1.00 102.74 ? 255 PRO A O     1 
ATOM   1668  C  CB    . PRO A 1 255 ? 2.362   -19.978 37.500  1.00 105.73 ? 255 PRO A CB    1 
ATOM   1669  C  CG    . PRO A 1 255 ? 3.274   -19.552 38.596  1.00 103.94 ? 255 PRO A CG    1 
ATOM   1670  C  CD    . PRO A 1 255 ? 4.355   -18.750 37.929  1.00 104.09 ? 255 PRO A CD    1 
ATOM   1671  N  N     . HIS A 1 256 ? 0.054   -18.061 36.098  1.00 100.03 ? 256 HIS A N     1 
ATOM   1672  C  CA    . HIS A 1 256 ? -1.153  -17.237 36.249  1.00 98.99  ? 256 HIS A CA    1 
ATOM   1673  C  C     . HIS A 1 256 ? -2.420  -18.034 35.905  1.00 98.28  ? 256 HIS A C     1 
ATOM   1674  O  O     . HIS A 1 256 ? -2.336  -19.168 35.433  1.00 99.64  ? 256 HIS A O     1 
ATOM   1675  C  CB    . HIS A 1 256 ? -1.056  -15.994 35.354  1.00 95.82  ? 256 HIS A CB    1 
ATOM   1676  C  CG    . HIS A 1 256 ? -1.718  -14.772 35.916  1.00 91.78  ? 256 HIS A CG    1 
ATOM   1677  N  ND1   . HIS A 1 256 ? -3.054  -14.725 36.252  1.00 90.54  ? 256 HIS A ND1   1 
ATOM   1678  C  CD2   . HIS A 1 256 ? -1.222  -13.540 36.185  1.00 91.91  ? 256 HIS A CD2   1 
ATOM   1679  C  CE1   . HIS A 1 256 ? -3.350  -13.523 36.711  1.00 91.99  ? 256 HIS A CE1   1 
ATOM   1680  N  NE2   . HIS A 1 256 ? -2.256  -12.784 36.681  1.00 91.06  ? 256 HIS A NE2   1 
ATOM   1681  N  N     . LEU A 1 257 ? -3.589  -17.433 36.128  1.00 96.19  ? 257 LEU A N     1 
ATOM   1682  C  CA    . LEU A 1 257 ? -4.873  -18.086 35.861  1.00 97.22  ? 257 LEU A CA    1 
ATOM   1683  C  C     . LEU A 1 257 ? -5.659  -17.421 34.725  1.00 94.45  ? 257 LEU A C     1 
ATOM   1684  O  O     . LEU A 1 257 ? -6.023  -16.244 34.813  1.00 94.05  ? 257 LEU A O     1 
ATOM   1685  C  CB    . LEU A 1 257 ? -5.716  -18.109 37.127  1.00 96.69  ? 257 LEU A CB    1 
ATOM   1686  N  N     . THR A 1 258 ? -5.946  -18.197 33.679  1.00 94.69  ? 258 THR A N     1 
ATOM   1687  C  CA    . THR A 1 258 ? -6.647  -17.711 32.486  1.00 87.79  ? 258 THR A CA    1 
ATOM   1688  C  C     . THR A 1 258 ? -8.008  -17.100 32.782  1.00 88.97  ? 258 THR A C     1 
ATOM   1689  O  O     . THR A 1 258 ? -8.576  -16.396 31.945  1.00 86.62  ? 258 THR A O     1 
ATOM   1690  C  CB    . THR A 1 258 ? -6.872  -18.834 31.457  1.00 89.99  ? 258 THR A CB    1 
ATOM   1691  O  OG1   . THR A 1 258 ? -7.886  -19.729 31.935  1.00 92.64  ? 258 THR A OG1   1 
ATOM   1692  C  CG2   . THR A 1 258 ? -5.583  -19.596 31.191  1.00 93.57  ? 258 THR A CG2   1 
ATOM   1693  N  N     . GLY A 1 259 ? -8.543  -17.385 33.962  1.00 93.49  ? 259 GLY A N     1 
ATOM   1694  C  CA    . GLY A 1 259 ? -9.839  -16.859 34.336  1.00 89.56  ? 259 GLY A CA    1 
ATOM   1695  C  C     . GLY A 1 259 ? -9.758  -15.399 34.717  1.00 89.52  ? 259 GLY A C     1 
ATOM   1696  O  O     . GLY A 1 259 ? -10.624 -14.609 34.346  1.00 95.03  ? 259 GLY A O     1 
ATOM   1697  N  N     . LEU A 1 260 ? -8.711  -15.036 35.450  1.00 89.07  ? 260 LEU A N     1 
ATOM   1698  C  CA    . LEU A 1 260 ? -8.543  -13.662 35.905  1.00 91.04  ? 260 LEU A CA    1 
ATOM   1699  C  C     . LEU A 1 260 ? -7.728  -12.832 34.909  1.00 91.08  ? 260 LEU A C     1 
ATOM   1700  O  O     . LEU A 1 260 ? -7.299  -11.721 35.219  1.00 88.14  ? 260 LEU A O     1 
ATOM   1701  C  CB    . LEU A 1 260 ? -7.886  -13.640 37.282  1.00 94.52  ? 260 LEU A CB    1 
ATOM   1702  N  N     . LEU A 1 261 ? -7.514  -13.376 33.714  1.00 91.41  ? 261 LEU A N     1 
ATOM   1703  C  CA    . LEU A 1 261 ? -6.783  -12.661 32.675  1.00 85.23  ? 261 LEU A CA    1 
ATOM   1704  C  C     . LEU A 1 261 ? -7.687  -12.214 31.529  1.00 77.76  ? 261 LEU A C     1 
ATOM   1705  O  O     . LEU A 1 261 ? -8.642  -12.904 31.171  1.00 79.82  ? 261 LEU A O     1 
ATOM   1706  C  CB    . LEU A 1 261 ? -5.644  -13.529 32.128  1.00 80.59  ? 261 LEU A CB    1 
ATOM   1707  C  CG    . LEU A 1 261 ? -4.428  -13.748 33.030  1.00 86.10  ? 261 LEU A CG    1 
ATOM   1708  C  CD1   . LEU A 1 261 ? -3.379  -14.604 32.334  1.00 86.37  ? 261 LEU A CD1   1 
ATOM   1709  C  CD2   . LEU A 1 261 ? -3.827  -12.412 33.435  1.00 81.09  ? 261 LEU A CD2   1 
ATOM   1710  N  N     . VAL A 1 262 ? -7.364  -11.050 30.965  1.00 75.17  ? 262 VAL A N     1 
ATOM   1711  C  CA    . VAL A 1 262 ? -8.066  -10.492 29.812  1.00 73.96  ? 262 VAL A CA    1 
ATOM   1712  C  C     . VAL A 1 262 ? -7.052  -10.286 28.692  1.00 70.32  ? 262 VAL A C     1 
ATOM   1713  O  O     . VAL A 1 262 ? -5.982  -9.732  28.921  1.00 68.57  ? 262 VAL A O     1 
ATOM   1714  C  CB    . VAL A 1 262 ? -8.754  -9.144  30.147  1.00 69.05  ? 262 VAL A CB    1 
ATOM   1715  C  CG1   . VAL A 1 262 ? -9.542  -8.632  28.951  1.00 71.35  ? 262 VAL A CG1   1 
ATOM   1716  C  CG2   . VAL A 1 262 ? -9.657  -9.289  31.361  1.00 72.85  ? 262 VAL A CG2   1 
ATOM   1717  N  N     . PRO A 1 263 ? -7.378  -10.724 27.471  1.00 67.35  ? 263 PRO A N     1 
ATOM   1718  C  CA    . PRO A 1 263 ? -6.402  -10.511 26.395  1.00 65.67  ? 263 PRO A CA    1 
ATOM   1719  C  C     . PRO A 1 263 ? -6.169  -9.025  26.103  1.00 68.64  ? 263 PRO A C     1 
ATOM   1720  O  O     . PRO A 1 263 ? -7.126  -8.246  26.136  1.00 64.60  ? 263 PRO A O     1 
ATOM   1721  C  CB    . PRO A 1 263 ? -7.051  -11.211 25.193  1.00 70.58  ? 263 PRO A CB    1 
ATOM   1722  C  CG    . PRO A 1 263 ? -8.004  -12.205 25.794  1.00 67.05  ? 263 PRO A CG    1 
ATOM   1723  C  CD    . PRO A 1 263 ? -8.506  -11.572 27.051  1.00 68.50  ? 263 PRO A CD    1 
ATOM   1724  N  N     . VAL A 1 264 ? -4.923  -8.652  25.810  1.00 64.86  ? 264 VAL A N     1 
ATOM   1725  C  CA    . VAL A 1 264 ? -4.622  -7.328  25.279  1.00 58.37  ? 264 VAL A CA    1 
ATOM   1726  C  C     . VAL A 1 264 ? -4.659  -7.433  23.764  1.00 64.04  ? 264 VAL A C     1 
ATOM   1727  O  O     . VAL A 1 264 ? -3.797  -8.071  23.155  1.00 66.12  ? 264 VAL A O     1 
ATOM   1728  C  CB    . VAL A 1 264 ? -3.244  -6.804  25.720  1.00 58.49  ? 264 VAL A CB    1 
ATOM   1729  C  CG1   . VAL A 1 264 ? -2.892  -5.530  24.952  1.00 54.90  ? 264 VAL A CG1   1 
ATOM   1730  C  CG2   . VAL A 1 264 ? -3.206  -6.557  27.225  1.00 61.75  ? 264 VAL A CG2   1 
ATOM   1731  N  N     . LEU A 1 265 ? -5.676  -6.827  23.160  1.00 52.31  ? 265 LEU A N     1 
ATOM   1732  C  CA    . LEU A 1 265 ? -5.924  -7.008  21.736  1.00 55.98  ? 265 LEU A CA    1 
ATOM   1733  C  C     . LEU A 1 265 ? -5.264  -5.927  20.901  1.00 59.16  ? 265 LEU A C     1 
ATOM   1734  O  O     . LEU A 1 265 ? -5.339  -4.739  21.222  1.00 54.19  ? 265 LEU A O     1 
ATOM   1735  C  CB    . LEU A 1 265 ? -7.427  -7.026  21.451  1.00 58.17  ? 265 LEU A CB    1 
ATOM   1736  C  CG    . LEU A 1 265 ? -8.196  -8.187  22.072  1.00 60.61  ? 265 LEU A CG    1 
ATOM   1737  C  CD1   . LEU A 1 265 ? -9.690  -8.042  21.797  1.00 59.50  ? 265 LEU A CD1   1 
ATOM   1738  C  CD2   . LEU A 1 265 ? -7.661  -9.502  21.533  1.00 59.73  ? 265 LEU A CD2   1 
ATOM   1739  N  N     . THR A 1 266 ? -4.616  -6.351  19.825  1.00 63.15  ? 266 THR A N     1 
ATOM   1740  C  CA    . THR A 1 266 ? -3.994  -5.424  18.897  1.00 64.77  ? 266 THR A CA    1 
ATOM   1741  C  C     . THR A 1 266 ? -4.692  -5.545  17.566  1.00 62.72  ? 266 THR A C     1 
ATOM   1742  O  O     . THR A 1 266 ? -5.702  -6.234  17.451  1.00 65.63  ? 266 THR A O     1 
ATOM   1743  C  CB    . THR A 1 266 ? -2.492  -5.702  18.710  1.00 57.98  ? 266 THR A CB    1 
ATOM   1744  O  OG1   . THR A 1 266 ? -2.322  -6.904  17.950  1.00 69.35  ? 266 THR A OG1   1 
ATOM   1745  C  CG2   . THR A 1 266 ? -1.802  -5.841  20.054  1.00 55.52  ? 266 THR A CG2   1 
ATOM   1746  N  N     . LEU A 1 267 ? -4.138  -4.891  16.557  1.00 63.27  ? 267 LEU A N     1 
ATOM   1747  C  CA    . LEU A 1 267 ? -4.703  -4.957  15.221  1.00 72.43  ? 267 LEU A CA    1 
ATOM   1748  C  C     . LEU A 1 267 ? -4.462  -6.349  14.652  1.00 73.34  ? 267 LEU A C     1 
ATOM   1749  O  O     . LEU A 1 267 ? -5.266  -6.858  13.870  1.00 72.78  ? 267 LEU A O     1 
ATOM   1750  C  CB    . LEU A 1 267 ? -4.084  -3.880  14.330  1.00 70.21  ? 267 LEU A CB    1 
ATOM   1751  C  CG    . LEU A 1 267 ? -4.316  -2.453  14.843  1.00 60.35  ? 267 LEU A CG    1 
ATOM   1752  C  CD1   . LEU A 1 267 ? -3.547  -1.437  14.023  1.00 53.81  ? 267 LEU A CD1   1 
ATOM   1753  C  CD2   . LEU A 1 267 ? -5.794  -2.151  14.807  1.00 66.43  ? 267 LEU A CD2   1 
ATOM   1754  N  N     . GLU A 1 268 ? -3.352  -6.959  15.070  1.00 75.69  ? 268 GLU A N     1 
ATOM   1755  C  CA    . GLU A 1 268 ? -2.979  -8.303  14.633  1.00 74.62  ? 268 GLU A CA    1 
ATOM   1756  C  C     . GLU A 1 268 ? -3.934  -9.366  15.192  1.00 77.62  ? 268 GLU A C     1 
ATOM   1757  O  O     . GLU A 1 268 ? -4.182  -10.388 14.551  1.00 81.00  ? 268 GLU A O     1 
ATOM   1758  C  CB    . GLU A 1 268 ? -1.543  -8.616  15.049  1.00 79.92  ? 268 GLU A CB    1 
ATOM   1759  C  CG    . GLU A 1 268 ? -1.015  -9.924  14.486  1.00 82.15  ? 268 GLU A CG    1 
ATOM   1760  C  CD    . GLU A 1 268 ? 0.374   -10.244 14.973  1.00 78.59  ? 268 GLU A CD    1 
ATOM   1761  O  OE1   . GLU A 1 268 ? 0.767   -9.722  16.037  1.00 82.16  ? 268 GLU A OE1   1 
ATOM   1762  O  OE2   . GLU A 1 268 ? 1.076   -11.017 14.289  1.00 84.89  ? 268 GLU A OE2   1 
ATOM   1763  N  N     . ASP A 1 269 ? -4.459  -9.117  16.392  1.00 77.00  ? 269 ASP A N     1 
ATOM   1764  C  CA    . ASP A 1 269 ? -5.409  -10.028 17.035  1.00 74.68  ? 269 ASP A CA    1 
ATOM   1765  C  C     . ASP A 1 269 ? -6.800  -9.898  16.424  1.00 75.40  ? 269 ASP A C     1 
ATOM   1766  O  O     . ASP A 1 269 ? -7.588  -10.838 16.453  1.00 78.91  ? 269 ASP A O     1 
ATOM   1767  C  CB    . ASP A 1 269 ? -5.481  -9.761  18.544  1.00 64.18  ? 269 ASP A CB    1 
ATOM   1768  C  CG    . ASP A 1 269 ? -4.185  -10.099 19.264  1.00 71.36  ? 269 ASP A CG    1 
ATOM   1769  O  OD1   . ASP A 1 269 ? -3.676  -11.229 19.085  1.00 74.90  ? 269 ASP A OD1   1 
ATOM   1770  O  OD2   . ASP A 1 269 ? -3.672  -9.233  20.008  1.00 69.09  ? 269 ASP A OD2   1 
ATOM   1771  N  N     . LEU A 1 270 ? -7.107  -8.718  15.898  1.00 75.26  ? 270 LEU A N     1 
ATOM   1772  C  CA    . LEU A 1 270 ? -8.373  -8.502  15.206  1.00 79.16  ? 270 LEU A CA    1 
ATOM   1773  C  C     . LEU A 1 270 ? -8.192  -8.462  13.692  1.00 82.23  ? 270 LEU A C     1 
ATOM   1774  O  O     . LEU A 1 270 ? -9.058  -7.956  12.981  1.00 86.83  ? 270 LEU A O     1 
ATOM   1775  C  CB    . LEU A 1 270 ? -9.038  -7.208  15.682  1.00 76.13  ? 270 LEU A CB    1 
ATOM   1776  C  CG    . LEU A 1 270 ? -9.378  -7.102  17.170  1.00 73.52  ? 270 LEU A CG    1 
ATOM   1777  C  CD1   . LEU A 1 270 ? -10.181 -5.838  17.445  1.00 70.85  ? 270 LEU A CD1   1 
ATOM   1778  C  CD2   . LEU A 1 270 ? -10.149 -8.333  17.624  1.00 74.43  ? 270 LEU A CD2   1 
ATOM   1779  N  N     . HIS A 1 271 ? -7.065  -8.981  13.209  1.00 80.76  ? 271 HIS A N     1 
ATOM   1780  C  CA    . HIS A 1 271 ? -6.760  -8.967  11.780  1.00 82.83  ? 271 HIS A CA    1 
ATOM   1781  C  C     . HIS A 1 271 ? -7.873  -9.631  10.970  1.00 90.73  ? 271 HIS A C     1 
ATOM   1782  O  O     . HIS A 1 271 ? -8.426  -9.030  10.047  1.00 94.82  ? 271 HIS A O     1 
ATOM   1783  C  CB    . HIS A 1 271 ? -5.423  -9.665  11.505  1.00 84.95  ? 271 HIS A CB    1 
ATOM   1784  C  CG    . HIS A 1 271 ? -4.924  -9.486  10.104  1.00 87.20  ? 271 HIS A CG    1 
ATOM   1785  N  ND1   . HIS A 1 271 ? -5.605  -9.962  9.001   1.00 85.66  ? 271 HIS A ND1   1 
ATOM   1786  C  CD2   . HIS A 1 271 ? -3.809  -8.884  9.624   1.00 82.87  ? 271 HIS A CD2   1 
ATOM   1787  C  CE1   . HIS A 1 271 ? -4.935  -9.655  7.906   1.00 87.39  ? 271 HIS A CE1   1 
ATOM   1788  N  NE2   . HIS A 1 271 ? -3.840  -9.001  8.255   1.00 82.66  ? 271 HIS A NE2   1 
ATOM   1789  N  N     . GLU A 1 272 ? -8.197  -10.871 11.324  1.00 92.54  ? 272 GLU A N     1 
ATOM   1790  C  CA    . GLU A 1 272 ? -9.252  -11.609 10.644  1.00 89.07  ? 272 GLU A CA    1 
ATOM   1791  C  C     . GLU A 1 272 ? -10.556 -11.584 11.441  1.00 88.61  ? 272 GLU A C     1 
ATOM   1792  O  O     . GLU A 1 272 ? -10.837 -12.494 12.224  1.00 92.07  ? 272 GLU A O     1 
ATOM   1793  C  CB    . GLU A 1 272 ? -8.810  -13.043 10.390  1.00 92.90  ? 272 GLU A CB    1 
ATOM   1794  N  N     . GLU A 1 273 ? -11.350 -10.537 11.239  1.00 91.86  ? 273 GLU A N     1 
ATOM   1795  C  CA    . GLU A 1 273 ? -12.669 -10.442 11.861  1.00 93.97  ? 273 GLU A CA    1 
ATOM   1796  C  C     . GLU A 1 273 ? -13.705 -9.944  10.859  1.00 85.83  ? 273 GLU A C     1 
ATOM   1797  O  O     . GLU A 1 273 ? -14.799 -9.523  11.239  1.00 88.11  ? 273 GLU A O     1 
ATOM   1798  C  CB    . GLU A 1 273 ? -12.629 -9.517  13.083  1.00 90.01  ? 273 GLU A CB    1 
ATOM   1799  C  CG    . GLU A 1 273 ? -11.786 -10.027 14.249  1.00 88.28  ? 273 GLU A CG    1 
ATOM   1800  C  CD    . GLU A 1 273 ? -12.480 -11.107 15.071  1.00 86.28  ? 273 GLU A CD    1 
ATOM   1801  O  OE1   . GLU A 1 273 ? -13.729 -11.121 15.119  1.00 88.29  ? 273 GLU A OE1   1 
ATOM   1802  O  OE2   . GLU A 1 273 ? -11.770 -11.939 15.681  1.00 87.27  ? 273 GLU A OE2   1 
ATOM   1803  N  N     . LEU A 1 277 ? -12.848 -2.754  10.759  1.00 76.39  ? 277 LEU A N     1 
ATOM   1804  C  CA    . LEU A 1 277 ? -12.423 -1.725  11.703  1.00 74.43  ? 277 LEU A CA    1 
ATOM   1805  C  C     . LEU A 1 277 ? -11.460 -0.741  11.048  1.00 75.09  ? 277 LEU A C     1 
ATOM   1806  O  O     . LEU A 1 277 ? -10.258 -1.006  10.950  1.00 82.56  ? 277 LEU A O     1 
ATOM   1807  C  CB    . LEU A 1 277 ? -11.779 -2.360  12.926  1.00 73.60  ? 277 LEU A CB    1 
ATOM   1808  N  N     . ALA A 1 278 ? -11.992 0.392   10.602  1.00 65.16  ? 278 ALA A N     1 
ATOM   1809  C  CA    . ALA A 1 278 ? -11.191 1.434   9.964   1.00 68.01  ? 278 ALA A CA    1 
ATOM   1810  C  C     . ALA A 1 278 ? -10.805 2.517   10.972  1.00 63.55  ? 278 ALA A C     1 
ATOM   1811  O  O     . ALA A 1 278 ? -11.663 3.284   11.412  1.00 56.68  ? 278 ALA A O     1 
ATOM   1812  C  CB    . ALA A 1 278 ? -11.958 2.046   8.798   1.00 74.30  ? 278 ALA A CB    1 
ATOM   1813  N  N     . LEU A 1 279 ? -9.522  2.597   11.324  1.00 59.99  ? 279 LEU A N     1 
ATOM   1814  C  CA    . LEU A 1 279 ? -9.114  3.423   12.461  1.00 56.24  ? 279 LEU A CA    1 
ATOM   1815  C  C     . LEU A 1 279 ? -8.459  4.741   12.098  1.00 49.81  ? 279 LEU A C     1 
ATOM   1816  O  O     . LEU A 1 279 ? -8.015  5.475   12.983  1.00 54.71  ? 279 LEU A O     1 
ATOM   1817  C  CB    . LEU A 1 279 ? -8.173  2.643   13.380  1.00 58.71  ? 279 LEU A CB    1 
ATOM   1818  C  CG    . LEU A 1 279 ? -8.776  1.333   13.899  1.00 58.34  ? 279 LEU A CG    1 
ATOM   1819  C  CD1   . LEU A 1 279 ? -7.899  0.735   14.973  1.00 54.72  ? 279 LEU A CD1   1 
ATOM   1820  C  CD2   . LEU A 1 279 ? -10.208 1.542   14.411  1.00 55.39  ? 279 LEU A CD2   1 
ATOM   1821  N  N     . SER A 1 280 ? -8.365  5.049   10.813  1.00 55.72  ? 280 SER A N     1 
ATOM   1822  C  CA    . SER A 1 280 ? -7.744  6.313   10.441  1.00 58.86  ? 280 SER A CA    1 
ATOM   1823  C  C     . SER A 1 280 ? -8.808  7.330   10.044  1.00 47.21  ? 280 SER A C     1 
ATOM   1824  O  O     . SER A 1 280 ? -9.691  7.039   9.249   1.00 48.47  ? 280 SER A O     1 
ATOM   1825  C  CB    . SER A 1 280 ? -6.735  6.123   9.306   1.00 54.93  ? 280 SER A CB    1 
ATOM   1826  O  OG    . SER A 1 280 ? -5.904  7.266   9.223   1.00 54.95  ? 280 SER A OG    1 
ATOM   1827  N  N     . LEU A 1 281 ? -8.676  8.541   10.563  1.00 54.31  ? 281 LEU A N     1 
ATOM   1828  C  CA    . LEU A 1 281 ? -9.636  9.598   10.285  1.00 48.48  ? 281 LEU A CA    1 
ATOM   1829  C  C     . LEU A 1 281 ? -9.173  10.535  9.190   1.00 41.35  ? 281 LEU A C     1 
ATOM   1830  O  O     . LEU A 1 281 ? -8.044  11.017  9.220   1.00 47.98  ? 281 LEU A O     1 
ATOM   1831  C  CB    . LEU A 1 281 ? -9.903  10.417  11.557  1.00 41.10  ? 281 LEU A CB    1 
ATOM   1832  C  CG    . LEU A 1 281 ? -10.526 9.711   12.758  1.00 45.95  ? 281 LEU A CG    1 
ATOM   1833  C  CD1   . LEU A 1 281 ? -10.559 10.640  13.957  1.00 43.37  ? 281 LEU A CD1   1 
ATOM   1834  C  CD2   . LEU A 1 281 ? -11.942 9.309   12.401  1.00 43.05  ? 281 LEU A CD2   1 
ATOM   1835  N  N     . PRO A 1 282 ? -10.063 10.815  8.221   1.00 49.58  ? 282 PRO A N     1 
ATOM   1836  C  CA    . PRO A 1 282 ? -9.833  11.957  7.331   1.00 41.55  ? 282 PRO A CA    1 
ATOM   1837  C  C     . PRO A 1 282 ? -9.779  13.197  8.199   1.00 42.01  ? 282 PRO A C     1 
ATOM   1838  O  O     . PRO A 1 282 ? -10.493 13.225  9.210   1.00 43.14  ? 282 PRO A O     1 
ATOM   1839  C  CB    . PRO A 1 282 ? -11.061 11.956  6.407   1.00 38.79  ? 282 PRO A CB    1 
ATOM   1840  C  CG    . PRO A 1 282 ? -11.587 10.549  6.473   1.00 47.06  ? 282 PRO A CG    1 
ATOM   1841  C  CD    . PRO A 1 282 ? -11.280 10.060  7.870   1.00 42.44  ? 282 PRO A CD    1 
ATOM   1842  N  N     . TRP A 1 283 ? -8.964  14.187  7.845   1.00 38.87  ? 283 TRP A N     1 
ATOM   1843  C  CA    . TRP A 1 283 ? -8.702  15.271  8.774   1.00 38.15  ? 283 TRP A CA    1 
ATOM   1844  C  C     . TRP A 1 283 ? -9.950  16.117  9.051   1.00 36.53  ? 283 TRP A C     1 
ATOM   1845  O  O     . TRP A 1 283 ? -10.075 16.674  10.138  1.00 38.23  ? 283 TRP A O     1 
ATOM   1846  C  CB    . TRP A 1 283 ? -7.572  16.176  8.273   1.00 36.65  ? 283 TRP A CB    1 
ATOM   1847  C  CG    . TRP A 1 283 ? -7.877  16.854  7.011   1.00 38.72  ? 283 TRP A CG    1 
ATOM   1848  C  CD1   . TRP A 1 283 ? -7.641  16.383  5.755   1.00 40.77  ? 283 TRP A CD1   1 
ATOM   1849  C  CD2   . TRP A 1 283 ? -8.473  18.144  6.856   1.00 34.25  ? 283 TRP A CD2   1 
ATOM   1850  N  NE1   . TRP A 1 283 ? -8.059  17.299  4.827   1.00 39.82  ? 283 TRP A NE1   1 
ATOM   1851  C  CE2   . TRP A 1 283 ? -8.576  18.392  5.477   1.00 36.21  ? 283 TRP A CE2   1 
ATOM   1852  C  CE3   . TRP A 1 283 ? -8.950  19.109  7.751   1.00 32.07  ? 283 TRP A CE3   1 
ATOM   1853  C  CZ2   . TRP A 1 283 ? -9.127  19.560  4.962   1.00 38.67  ? 283 TRP A CZ2   1 
ATOM   1854  C  CZ3   . TRP A 1 283 ? -9.494  20.275  7.240   1.00 35.08  ? 283 TRP A CZ3   1 
ATOM   1855  C  CH2   . TRP A 1 283 ? -9.577  20.490  5.858   1.00 38.16  ? 283 TRP A CH2   1 
ATOM   1856  N  N     . GLU A 1 284 ? -10.871 16.216  8.093   1.00 39.71  ? 284 GLU A N     1 
ATOM   1857  C  CA    . GLU A 1 284 ? -12.107 16.985  8.325   1.00 39.98  ? 284 GLU A CA    1 
ATOM   1858  C  C     . GLU A 1 284 ? -12.888 16.335  9.454   1.00 31.08  ? 284 GLU A C     1 
ATOM   1859  O  O     . GLU A 1 284 ? -13.432 17.003  10.337  1.00 32.95  ? 284 GLU A O     1 
ATOM   1860  C  CB    . GLU A 1 284 ? -12.948 17.044  7.044   1.00 40.81  ? 284 GLU A CB    1 
ATOM   1861  C  CG    . GLU A 1 284 ? -12.266 17.796  5.892   1.00 42.84  ? 284 GLU A CG    1 
ATOM   1862  C  CD    . GLU A 1 284 ? -11.540 16.848  4.915   1.00 54.11  ? 284 GLU A CD    1 
ATOM   1863  O  OE1   . GLU A 1 284 ? -11.062 15.764  5.355   1.00 44.42  ? 284 GLU A OE1   1 
ATOM   1864  O  OE2   . GLU A 1 284 ? -11.456 17.181  3.704   1.00 57.29  ? 284 GLU A OE2   1 
ATOM   1865  N  N     . GLU A 1 285 ? -12.884 15.011  9.435   1.00 32.85  ? 285 GLU A N     1 
ATOM   1866  C  CA    . GLU A 1 285 ? -13.567 14.196  10.429  1.00 29.87  ? 285 GLU A CA    1 
ATOM   1867  C  C     . GLU A 1 285 ? -12.894 14.274  11.796  1.00 39.36  ? 285 GLU A C     1 
ATOM   1868  O  O     . GLU A 1 285 ? -13.583 14.266  12.839  1.00 34.70  ? 285 GLU A O     1 
ATOM   1869  C  CB    . GLU A 1 285 ? -13.639 12.744  9.939   1.00 32.00  ? 285 GLU A CB    1 
ATOM   1870  C  CG    . GLU A 1 285 ? -14.432 11.798  10.812  1.00 39.11  ? 285 GLU A CG    1 
ATOM   1871  C  CD    . GLU A 1 285 ? -15.925 12.192  10.955  1.00 49.11  ? 285 GLU A CD    1 
ATOM   1872  O  OE1   . GLU A 1 285 ? -16.484 11.915  12.040  1.00 45.95  ? 285 GLU A OE1   1 
ATOM   1873  O  OE2   . GLU A 1 285 ? -16.523 12.778  10.011  1.00 35.28  ? 285 GLU A OE2   1 
ATOM   1874  N  N     . ARG A 1 286 ? -11.555 14.342  11.802  1.00 39.58  ? 286 ARG A N     1 
ATOM   1875  C  CA    . ARG A 1 286 ? -10.833 14.455  13.058  1.00 37.54  ? 286 ARG A CA    1 
ATOM   1876  C  C     . ARG A 1 286 ? -11.146 15.805  13.654  1.00 29.33  ? 286 ARG A C     1 
ATOM   1877  O  O     . ARG A 1 286 ? -11.400 15.937  14.842  1.00 31.86  ? 286 ARG A O     1 
ATOM   1878  C  CB    . ARG A 1 286 ? -9.298  14.275  12.875  1.00 31.97  ? 286 ARG A CB    1 
ATOM   1879  C  CG    . ARG A 1 286 ? -8.503  14.434  14.172  1.00 33.54  ? 286 ARG A CG    1 
ATOM   1880  C  CD    . ARG A 1 286 ? -6.978  14.039  14.054  1.00 31.51  ? 286 ARG A CD    1 
ATOM   1881  N  NE    . ARG A 1 286 ? -6.884  12.590  13.904  1.00 28.97  ? 286 ARG A NE    1 
ATOM   1882  C  CZ    . ARG A 1 286 ? -6.861  11.737  14.918  1.00 32.31  ? 286 ARG A CZ    1 
ATOM   1883  N  NH1   . ARG A 1 286 ? -6.844  12.173  16.178  1.00 30.69  ? 286 ARG A NH1   1 
ATOM   1884  N  NH2   . ARG A 1 286 ? -6.835  10.448  14.661  1.00 31.15  ? 286 ARG A NH2   1 
ATOM   1885  N  N     . ARG A 1 287 ? -11.155 16.811  12.805  1.00 27.96  ? 287 ARG A N     1 
ATOM   1886  C  CA    . ARG A 1 287 ? -11.448 18.169  13.237  1.00 32.39  ? 287 ARG A CA    1 
ATOM   1887  C  C     . ARG A 1 287 ? -12.877 18.271  13.830  1.00 32.90  ? 287 ARG A C     1 
ATOM   1888  O  O     . ARG A 1 287 ? -13.086 18.847  14.920  1.00 33.49  ? 287 ARG A O     1 
ATOM   1889  C  CB    . ARG A 1 287 ? -11.241 19.113  12.054  1.00 30.04  ? 287 ARG A CB    1 
ATOM   1890  C  CG    . ARG A 1 287 ? -11.445 20.582  12.374  1.00 36.11  ? 287 ARG A CG    1 
ATOM   1891  C  CD    . ARG A 1 287 ? -12.288 21.190  11.287  1.00 49.56  ? 287 ARG A CD    1 
ATOM   1892  N  NE    . ARG A 1 287 ? -11.573 22.080  10.383  1.00 58.64  ? 287 ARG A NE    1 
ATOM   1893  C  CZ    . ARG A 1 287 ? -11.870 22.227  9.094   1.00 57.07  ? 287 ARG A CZ    1 
ATOM   1894  N  NH1   . ARG A 1 287 ? -12.828 21.494  8.536   1.00 50.15  ? 287 ARG A NH1   1 
ATOM   1895  N  NH2   . ARG A 1 287 ? -11.182 23.089  8.356   1.00 53.38  ? 287 ARG A NH2   1 
ATOM   1896  N  N     . ARG A 1 288 ? -13.844 17.668  13.137  1.00 31.89  ? 288 ARG A N     1 
ATOM   1897  C  CA    . ARG A 1 288 ? -15.238 17.594  13.608  1.00 33.38  ? 288 ARG A CA    1 
ATOM   1898  C  C     . ARG A 1 288 ? -15.331 16.936  14.989  1.00 32.90  ? 288 ARG A C     1 
ATOM   1899  O  O     . ARG A 1 288 ? -15.892 17.512  15.946  1.00 28.35  ? 288 ARG A O     1 
ATOM   1900  C  CB    . ARG A 1 288 ? -16.091 16.820  12.580  1.00 33.12  ? 288 ARG A CB    1 
ATOM   1901  C  CG    . ARG A 1 288 ? -17.541 16.578  12.944  1.00 36.63  ? 288 ARG A CG    1 
ATOM   1902  C  CD    . ARG A 1 288 ? -18.106 15.525  12.002  1.00 34.27  ? 288 ARG A CD    1 
ATOM   1903  N  NE    . ARG A 1 288 ? -19.503 15.178  12.233  1.00 37.10  ? 288 ARG A NE    1 
ATOM   1904  C  CZ    . ARG A 1 288 ? -20.099 14.101  11.715  1.00 43.92  ? 288 ARG A CZ    1 
ATOM   1905  N  NH1   . ARG A 1 288 ? -19.405 13.258  10.962  1.00 36.10  ? 288 ARG A NH1   1 
ATOM   1906  N  NH2   . ARG A 1 288 ? -21.381 13.857  11.963  1.00 34.97  ? 288 ARG A NH2   1 
ATOM   1907  N  N     . ARG A 1 289 ? -14.763 15.731  15.102  1.00 33.25  ? 289 ARG A N     1 
ATOM   1908  C  CA    . ARG A 1 289 ? -14.782 15.013  16.393  1.00 31.81  ? 289 ARG A CA    1 
ATOM   1909  C  C     . ARG A 1 289 ? -14.061 15.789  17.497  1.00 34.01  ? 289 ARG A C     1 
ATOM   1910  O  O     . ARG A 1 289 ? -14.430 15.721  18.665  1.00 35.16  ? 289 ARG A O     1 
ATOM   1911  C  CB    . ARG A 1 289 ? -14.164 13.621  16.235  1.00 33.79  ? 289 ARG A CB    1 
ATOM   1912  C  CG    . ARG A 1 289 ? -14.958 12.737  15.260  1.00 45.80  ? 289 ARG A CG    1 
ATOM   1913  C  CD    . ARG A 1 289 ? -15.679 11.605  15.948  1.00 48.94  ? 289 ARG A CD    1 
ATOM   1914  N  NE    . ARG A 1 289 ? -14.943 10.338  15.865  1.00 60.83  ? 289 ARG A NE    1 
ATOM   1915  C  CZ    . ARG A 1 289 ? -15.012 9.480   14.844  1.00 59.61  ? 289 ARG A CZ    1 
ATOM   1916  N  NH1   . ARG A 1 289 ? -15.768 9.749   13.777  1.00 52.77  ? 289 ARG A NH1   1 
ATOM   1917  N  NH2   . ARG A 1 289 ? -14.312 8.348   14.885  1.00 51.44  ? 289 ARG A NH2   1 
ATOM   1918  N  N     . THR A 1 290 ? -13.033 16.538  17.119  1.00 27.98  ? 290 THR A N     1 
ATOM   1919  C  CA    . THR A 1 290 ? -12.255 17.328  18.072  1.00 35.35  ? 290 THR A CA    1 
ATOM   1920  C  C     . THR A 1 290 ? -13.144 18.420  18.642  1.00 35.34  ? 290 THR A C     1 
ATOM   1921  O  O     . THR A 1 290 ? -13.208 18.628  19.863  1.00 32.46  ? 290 THR A O     1 
ATOM   1922  C  CB    . THR A 1 290 ? -10.987 17.920  17.397  1.00 30.75  ? 290 THR A CB    1 
ATOM   1923  O  OG1   . THR A 1 290 ? -10.187 16.838  16.927  1.00 31.97  ? 290 THR A OG1   1 
ATOM   1924  C  CG2   . THR A 1 290 ? -10.179 18.760  18.353  1.00 25.85  ? 290 THR A CG2   1 
ATOM   1925  N  N     . ARG A 1 291 ? -13.845 19.114  17.749  1.00 32.08  ? 291 ARG A N     1 
ATOM   1926  C  CA    . ARG A 1 291 ? -14.769 20.160  18.190  1.00 31.12  ? 291 ARG A CA    1 
ATOM   1927  C  C     . ARG A 1 291 ? -15.887 19.611  19.086  1.00 35.31  ? 291 ARG A C     1 
ATOM   1928  O  O     . ARG A 1 291 ? -16.203 20.184  20.150  1.00 32.86  ? 291 ARG A O     1 
ATOM   1929  C  CB    . ARG A 1 291 ? -15.368 20.889  16.978  1.00 37.67  ? 291 ARG A CB    1 
ATOM   1930  C  CG    . ARG A 1 291 ? -14.416 21.885  16.334  1.00 40.41  ? 291 ARG A CG    1 
ATOM   1931  C  CD    . ARG A 1 291 ? -14.861 22.251  14.919  1.00 51.56  ? 291 ARG A CD    1 
ATOM   1932  N  NE    . ARG A 1 291 ? -13.917 23.162  14.259  1.00 56.12  ? 291 ARG A NE    1 
ATOM   1933  C  CZ    . ARG A 1 291 ? -13.970 23.490  12.966  1.00 58.31  ? 291 ARG A CZ    1 
ATOM   1934  N  NH1   . ARG A 1 291 ? -14.912 22.974  12.191  1.00 58.52  ? 291 ARG A NH1   1 
ATOM   1935  N  NH2   . ARG A 1 291 ? -13.077 24.322  12.440  1.00 57.42  ? 291 ARG A NH2   1 
ATOM   1936  N  N     . GLU A 1 292 ? -16.501 18.514  18.647  1.00 35.90  ? 292 GLU A N     1 
ATOM   1937  C  CA    . GLU A 1 292 ? -17.633 17.954  19.397  1.00 41.14  ? 292 GLU A CA    1 
ATOM   1938  C  C     . GLU A 1 292 ? -17.212 17.454  20.785  1.00 41.94  ? 292 GLU A C     1 
ATOM   1939  O  O     . GLU A 1 292 ? -17.885 17.703  21.808  1.00 40.81  ? 292 GLU A O     1 
ATOM   1940  C  CB    . GLU A 1 292 ? -18.279 16.812  18.611  1.00 34.06  ? 292 GLU A CB    1 
ATOM   1941  C  CG    . GLU A 1 292 ? -19.164 17.307  17.478  1.00 39.29  ? 292 GLU A CG    1 
ATOM   1942  C  CD    . GLU A 1 292 ? -20.218 18.302  17.960  1.00 45.94  ? 292 GLU A CD    1 
ATOM   1943  O  OE1   . GLU A 1 292 ? -21.023 17.951  18.861  1.00 42.15  ? 292 GLU A OE1   1 
ATOM   1944  O  OE2   . GLU A 1 292 ? -20.241 19.435  17.428  1.00 41.69  ? 292 GLU A OE2   1 
ATOM   1945  N  N     . ILE A 1 293 ? -16.093 16.735  20.823  1.00 37.08  ? 293 ILE A N     1 
ATOM   1946  C  CA    . ILE A 1 293 ? -15.617 16.199  22.094  1.00 34.35  ? 293 ILE A CA    1 
ATOM   1947  C  C     . ILE A 1 293 ? -15.205 17.351  22.992  1.00 33.27  ? 293 ILE A C     1 
ATOM   1948  O  O     . ILE A 1 293 ? -15.480 17.317  24.194  1.00 38.88  ? 293 ILE A O     1 
ATOM   1949  C  CB    . ILE A 1 293 ? -14.457 15.171  21.880  1.00 38.60  ? 293 ILE A CB    1 
ATOM   1950  C  CG1   . ILE A 1 293 ? -15.042 13.889  21.278  1.00 39.24  ? 293 ILE A CG1   1 
ATOM   1951  C  CG2   . ILE A 1 293 ? -13.756 14.872  23.180  1.00 39.63  ? 293 ILE A CG2   1 
ATOM   1952  C  CD1   . ILE A 1 293 ? -14.030 12.838  20.901  1.00 42.91  ? 293 ILE A CD1   1 
ATOM   1953  N  N     . ALA A 1 294 ? -14.628 18.407  22.411  1.00 29.26  ? 294 ALA A N     1 
ATOM   1954  C  CA    . ALA A 1 294 ? -14.301 19.598  23.193  1.00 36.44  ? 294 ALA A CA    1 
ATOM   1955  C  C     . ALA A 1 294 ? -15.547 20.222  23.826  1.00 45.63  ? 294 ALA A C     1 
ATOM   1956  O  O     . ALA A 1 294 ? -15.500 20.653  24.983  1.00 38.00  ? 294 ALA A O     1 
ATOM   1957  C  CB    . ALA A 1 294 ? -13.574 20.640  22.335  1.00 38.41  ? 294 ALA A CB    1 
ATOM   1958  N  N     . SER A 1 295 ? -16.649 20.289  23.069  1.00 37.03  ? 295 SER A N     1 
ATOM   1959  C  CA    . SER A 1 295 ? -17.892 20.879  23.607  1.00 46.13  ? 295 SER A CA    1 
ATOM   1960  C  C     . SER A 1 295 ? -18.443 20.049  24.742  1.00 38.87  ? 295 SER A C     1 
ATOM   1961  O  O     . SER A 1 295 ? -18.886 20.579  25.759  1.00 38.27  ? 295 SER A O     1 
ATOM   1962  C  CB    . SER A 1 295 ? -18.974 20.999  22.526  1.00 39.72  ? 295 SER A CB    1 
ATOM   1963  O  OG    . SER A 1 295 ? -18.652 22.029  21.625  1.00 47.15  ? 295 SER A OG    1 
ATOM   1964  N  N     . TRP A 1 296 ? -18.429 18.739  24.523  1.00 36.99  ? 296 TRP A N     1 
ATOM   1965  C  CA    . TRP A 1 296 ? -18.879 17.736  25.492  1.00 42.17  ? 296 TRP A CA    1 
ATOM   1966  C  C     . TRP A 1 296 ? -18.111 17.780  26.850  1.00 46.90  ? 296 TRP A C     1 
ATOM   1967  O  O     . TRP A 1 296 ? -18.708 17.908  27.957  1.00 42.99  ? 296 TRP A O     1 
ATOM   1968  C  CB    . TRP A 1 296 ? -18.744 16.365  24.819  1.00 38.98  ? 296 TRP A CB    1 
ATOM   1969  C  CG    . TRP A 1 296 ? -19.285 15.213  25.561  1.00 47.14  ? 296 TRP A CG    1 
ATOM   1970  C  CD1   . TRP A 1 296 ? -20.558 14.710  25.485  1.00 48.95  ? 296 TRP A CD1   1 
ATOM   1971  C  CD2   . TRP A 1 296 ? -18.584 14.394  26.499  1.00 42.25  ? 296 TRP A CD2   1 
ATOM   1972  N  NE1   . TRP A 1 296 ? -20.680 13.628  26.316  1.00 53.27  ? 296 TRP A NE1   1 
ATOM   1973  C  CE2   . TRP A 1 296 ? -19.482 13.414  26.954  1.00 47.90  ? 296 TRP A CE2   1 
ATOM   1974  C  CE3   . TRP A 1 296 ? -17.282 14.404  27.013  1.00 50.51  ? 296 TRP A CE3   1 
ATOM   1975  C  CZ2   . TRP A 1 296 ? -19.128 12.448  27.887  1.00 50.35  ? 296 TRP A CZ2   1 
ATOM   1976  C  CZ3   . TRP A 1 296 ? -16.928 13.438  27.941  1.00 46.89  ? 296 TRP A CZ3   1 
ATOM   1977  C  CH2   . TRP A 1 296 ? -17.850 12.479  28.372  1.00 50.70  ? 296 TRP A CH2   1 
ATOM   1978  N  N     . ILE A 1 297 ? -16.783 17.689  26.779  1.00 41.59  ? 297 ILE A N     1 
ATOM   1979  C  CA    . ILE A 1 297 ? -16.002 17.764  28.014  1.00 44.33  ? 297 ILE A CA    1 
ATOM   1980  C  C     . ILE A 1 297 ? -16.171 19.171  28.573  1.00 43.95  ? 297 ILE A C     1 
ATOM   1981  O  O     . ILE A 1 297 ? -16.237 19.363  29.782  1.00 44.10  ? 297 ILE A O     1 
ATOM   1982  C  CB    . ILE A 1 297 ? -14.491 17.406  27.810  1.00 45.24  ? 297 ILE A CB    1 
ATOM   1983  C  CG1   . ILE A 1 297 ? -13.791 17.284  29.165  1.00 50.49  ? 297 ILE A CG1   1 
ATOM   1984  C  CG2   . ILE A 1 297 ? -13.783 18.432  26.977  1.00 42.66  ? 297 ILE A CG2   1 
ATOM   1985  C  CD1   . ILE A 1 297 ? -14.278 16.115  29.991  1.00 43.99  ? 297 ILE A CD1   1 
ATOM   1986  N  N     . GLY A 1 298 ? -16.313 20.144  27.680  1.00 42.79  ? 298 GLY A N     1 
ATOM   1987  C  CA    . GLY A 1 298 ? -16.573 21.514  28.083  1.00 47.93  ? 298 GLY A CA    1 
ATOM   1988  C  C     . GLY A 1 298 ? -17.784 21.621  28.994  1.00 50.61  ? 298 GLY A C     1 
ATOM   1989  O  O     . GLY A 1 298 ? -17.725 22.279  30.039  1.00 54.06  ? 298 GLY A O     1 
ATOM   1990  N  N     . ARG A 1 299 ? -18.874 20.943  28.644  1.00 45.62  ? 299 ARG A N     1 
ATOM   1991  C  CA    . ARG A 1 299 ? -20.068 21.101  29.467  1.00 49.82  ? 299 ARG A CA    1 
ATOM   1992  C  C     . ARG A 1 299 ? -19.973 20.153  30.660  1.00 53.28  ? 299 ARG A C     1 
ATOM   1993  O  O     . ARG A 1 299 ? -20.691 20.339  31.640  1.00 51.57  ? 299 ARG A O     1 
ATOM   1994  C  CB    . ARG A 1 299 ? -21.366 20.857  28.661  1.00 45.03  ? 299 ARG A CB    1 
ATOM   1995  C  CG    . ARG A 1 299 ? -21.667 19.414  28.290  1.00 46.67  ? 299 ARG A CG    1 
ATOM   1996  C  CD    . ARG A 1 299 ? -22.872 19.308  27.306  1.00 48.96  ? 299 ARG A CD    1 
ATOM   1997  N  NE    . ARG A 1 299 ? -22.560 19.965  26.045  1.00 49.18  ? 299 ARG A NE    1 
ATOM   1998  C  CZ    . ARG A 1 299 ? -22.297 19.322  24.911  1.00 43.72  ? 299 ARG A CZ    1 
ATOM   1999  N  NH1   . ARG A 1 299 ? -22.345 17.997  24.864  1.00 52.18  ? 299 ARG A NH1   1 
ATOM   2000  N  NH2   . ARG A 1 299 ? -21.994 20.006  23.814  1.00 43.07  ? 299 ARG A NH2   1 
ATOM   2001  N  N     . ARG A 1 300 ? -19.019 19.215  30.635  1.00 51.29  ? 300 ARG A N     1 
ATOM   2002  C  CA    . ARG A 1 300 ? -18.746 18.438  31.858  1.00 50.01  ? 300 ARG A CA    1 
ATOM   2003  C  C     . ARG A 1 300 ? -17.841 19.174  32.870  1.00 57.62  ? 300 ARG A C     1 
ATOM   2004  O  O     . ARG A 1 300 ? -17.784 18.818  34.049  1.00 59.15  ? 300 ARG A O     1 
ATOM   2005  C  CB    . ARG A 1 300 ? -18.082 17.099  31.531  1.00 54.48  ? 300 ARG A CB    1 
ATOM   2006  C  CG    . ARG A 1 300 ? -18.874 16.145  30.650  1.00 51.82  ? 300 ARG A CG    1 
ATOM   2007  C  CD    . ARG A 1 300 ? -20.293 16.035  31.116  1.00 60.19  ? 300 ARG A CD    1 
ATOM   2008  N  NE    . ARG A 1 300 ? -20.979 14.859  30.584  1.00 66.02  ? 300 ARG A NE    1 
ATOM   2009  C  CZ    . ARG A 1 300 ? -21.446 14.756  29.342  1.00 57.31  ? 300 ARG A CZ    1 
ATOM   2010  N  NH1   . ARG A 1 300 ? -21.243 15.738  28.472  1.00 45.32  ? 300 ARG A NH1   1 
ATOM   2011  N  NH2   . ARG A 1 300 ? -22.090 13.656  28.965  1.00 56.63  ? 300 ARG A NH2   1 
ATOM   2012  N  N     . LEU A 1 301 ? -17.125 20.187  32.398  1.00 60.44  ? 301 LEU A N     1 
ATOM   2013  C  CA    . LEU A 1 301 ? -16.041 20.804  33.152  1.00 56.95  ? 301 LEU A CA    1 
ATOM   2014  C  C     . LEU A 1 301 ? -16.526 22.044  33.901  1.00 60.10  ? 301 LEU A C     1 
ATOM   2015  O  O     . LEU A 1 301 ? -16.043 22.355  34.989  1.00 67.15  ? 301 LEU A O     1 
ATOM   2016  C  CB    . LEU A 1 301 ? -14.900 21.163  32.203  1.00 54.53  ? 301 LEU A CB    1 
ATOM   2017  C  CG    . LEU A 1 301 ? -13.509 20.602  32.462  1.00 64.94  ? 301 LEU A CG    1 
ATOM   2018  C  CD1   . LEU A 1 301 ? -13.580 19.120  32.830  1.00 59.06  ? 301 LEU A CD1   1 
ATOM   2019  C  CD2   . LEU A 1 301 ? -12.666 20.807  31.210  1.00 54.61  ? 301 LEU A CD2   1 
ATOM   2020  N  N     . GLY A 1 302 ? -17.472 22.760  33.304  1.00 62.16  ? 302 GLY A N     1 
ATOM   2021  C  CA    . GLY A 1 302 ? -18.032 23.939  33.936  1.00 63.56  ? 302 GLY A CA    1 
ATOM   2022  C  C     . GLY A 1 302 ? -17.069 25.102  33.993  1.00 60.95  ? 302 GLY A C     1 
ATOM   2023  O  O     . GLY A 1 302 ? -17.173 25.954  34.869  1.00 68.65  ? 302 GLY A O     1 
ATOM   2024  N  N     . LEU A 1 303 ? -16.125 25.126  33.058  1.00 66.12  ? 303 LEU A N     1 
ATOM   2025  C  CA    . LEU A 1 303 ? -15.121 26.182  32.969  1.00 57.35  ? 303 LEU A CA    1 
ATOM   2026  C  C     . LEU A 1 303 ? -15.358 27.136  31.799  1.00 59.15  ? 303 LEU A C     1 
ATOM   2027  O  O     . LEU A 1 303 ? -14.422 27.794  31.346  1.00 60.46  ? 303 LEU A O     1 
ATOM   2028  C  CB    . LEU A 1 303 ? -13.719 25.571  32.846  1.00 61.93  ? 303 LEU A CB    1 
ATOM   2029  C  CG    . LEU A 1 303 ? -13.137 24.796  34.030  1.00 64.74  ? 303 LEU A CG    1 
ATOM   2030  C  CD1   . LEU A 1 303 ? -11.732 24.304  33.707  1.00 61.43  ? 303 LEU A CD1   1 
ATOM   2031  C  CD2   . LEU A 1 303 ? -13.095 25.702  35.259  1.00 62.26  ? 303 LEU A CD2   1 
ATOM   2032  N  N     . GLY A 1 304 ? -16.592 27.209  31.300  1.00 58.27  ? 304 GLY A N     1 
ATOM   2033  C  CA    . GLY A 1 304 ? -16.912 28.096  30.186  1.00 52.22  ? 304 GLY A CA    1 
ATOM   2034  C  C     . GLY A 1 304 ? -17.082 27.365  28.855  1.00 57.03  ? 304 GLY A C     1 
ATOM   2035  O  O     . GLY A 1 304 ? -17.083 26.133  28.809  1.00 53.96  ? 304 GLY A O     1 
ATOM   2036  N  N     . THR A 1 305 ? -17.251 28.128  27.774  1.00 56.39  ? 305 THR A N     1 
ATOM   2037  C  CA    . THR A 1 305 ? -17.425 27.572  26.428  1.00 55.87  ? 305 THR A CA    1 
ATOM   2038  C  C     . THR A 1 305 ? -16.077 27.506  25.720  1.00 54.19  ? 305 THR A C     1 
ATOM   2039  O  O     . THR A 1 305 ? -15.445 28.541  25.510  1.00 52.24  ? 305 THR A O     1 
ATOM   2040  C  CB    . THR A 1 305 ? -18.406 28.427  25.588  1.00 60.67  ? 305 THR A CB    1 
ATOM   2041  O  OG1   . THR A 1 305 ? -19.726 28.330  26.144  1.00 62.19  ? 305 THR A OG1   1 
ATOM   2042  C  CG2   . THR A 1 305 ? -18.441 27.945  24.140  1.00 54.17  ? 305 THR A CG2   1 
ATOM   2043  N  N     . PRO A 1 306 ? -15.625 26.291  25.354  1.00 53.44  ? 306 PRO A N     1 
ATOM   2044  C  CA    . PRO A 1 306 ? -14.315 26.126  24.706  1.00 48.47  ? 306 PRO A CA    1 
ATOM   2045  C  C     . PRO A 1 306 ? -14.235 26.908  23.414  1.00 52.39  ? 306 PRO A C     1 
ATOM   2046  O  O     . PRO A 1 306 ? -15.097 26.737  22.553  1.00 48.31  ? 306 PRO A O     1 
ATOM   2047  C  CB    . PRO A 1 306 ? -14.227 24.623  24.440  1.00 42.70  ? 306 PRO A CB    1 
ATOM   2048  C  CG    . PRO A 1 306 ? -15.172 24.008  25.408  1.00 53.95  ? 306 PRO A CG    1 
ATOM   2049  C  CD    . PRO A 1 306 ? -16.296 24.998  25.567  1.00 51.87  ? 306 PRO A CD    1 
ATOM   2050  N  N     . GLU A 1 307 ? -13.273 27.816  23.313  1.00 45.07  ? 307 GLU A N     1 
ATOM   2051  C  CA    . GLU A 1 307 ? -13.140 28.600  22.097  1.00 47.93  ? 307 GLU A CA    1 
ATOM   2052  C  C     . GLU A 1 307 ? -11.855 28.179  21.393  1.00 48.30  ? 307 GLU A C     1 
ATOM   2053  O  O     . GLU A 1 307 ? -10.756 28.389  21.908  1.00 43.90  ? 307 GLU A O     1 
ATOM   2054  C  CB    . GLU A 1 307 ? -13.154 30.104  22.406  1.00 47.55  ? 307 GLU A CB    1 
ATOM   2055  C  CG    . GLU A 1 307 ? -13.724 30.907  21.273  1.00 52.99  ? 307 GLU A CG    1 
ATOM   2056  C  CD    . GLU A 1 307 ? -15.211 30.607  21.093  1.00 62.47  ? 307 GLU A CD    1 
ATOM   2057  O  OE1   . GLU A 1 307 ? -15.968 30.631  22.101  1.00 53.58  ? 307 GLU A OE1   1 
ATOM   2058  O  OE2   . GLU A 1 307 ? -15.611 30.286  19.952  1.00 66.43  ? 307 GLU A OE2   1 
ATOM   2059  N  N     . ALA A 1 308 ? -12.005 27.587  20.212  1.00 44.22  ? 308 ALA A N     1 
ATOM   2060  C  CA    . ALA A 1 308 ? -10.875 27.030  19.475  1.00 47.02  ? 308 ALA A CA    1 
ATOM   2061  C  C     . ALA A 1 308 ? -9.805  28.078  19.222  1.00 41.68  ? 308 ALA A C     1 
ATOM   2062  O  O     . ALA A 1 308 ? -10.120 29.169  18.765  1.00 46.04  ? 308 ALA A O     1 
ATOM   2063  C  CB    . ALA A 1 308 ? -11.359 26.454  18.155  1.00 46.63  ? 308 ALA A CB    1 
ATOM   2064  N  N     . VAL A 1 309 ? -8.536  27.778  19.495  1.00 43.53  ? 309 VAL A N     1 
ATOM   2065  C  CA    . VAL A 1 309 ? -7.564  28.849  19.308  1.00 36.77  ? 309 VAL A CA    1 
ATOM   2066  C  C     . VAL A 1 309 ? -7.061  28.839  17.868  1.00 39.27  ? 309 VAL A C     1 
ATOM   2067  O  O     . VAL A 1 309 ? -6.850  27.793  17.250  1.00 38.49  ? 309 VAL A O     1 
ATOM   2068  C  CB    . VAL A 1 309 ? -6.394  28.810  20.347  1.00 44.82  ? 309 VAL A CB    1 
ATOM   2069  C  CG1   . VAL A 1 309 ? -6.726  27.987  21.580  1.00 46.17  ? 309 VAL A CG1   1 
ATOM   2070  C  CG2   . VAL A 1 309 ? -5.045  28.476  19.708  1.00 44.08  ? 309 VAL A CG2   1 
ATOM   2071  N  N     . ARG A 1 310 ? -6.936  30.050  17.333  1.00 33.47  ? 310 ARG A N     1 
ATOM   2072  C  CA    . ARG A 1 310 ? -6.546  30.277  15.950  1.00 40.67  ? 310 ARG A CA    1 
ATOM   2073  C  C     . ARG A 1 310 ? -5.120  30.774  15.958  1.00 40.02  ? 310 ARG A C     1 
ATOM   2074  O  O     . ARG A 1 310 ? -4.692  31.390  16.925  1.00 37.09  ? 310 ARG A O     1 
ATOM   2075  C  CB    . ARG A 1 310 ? -7.456  31.308  15.269  1.00 40.55  ? 310 ARG A CB    1 
ATOM   2076  C  CG    . ARG A 1 310 ? -8.933  30.918  15.235  1.00 50.88  ? 310 ARG A CG    1 
ATOM   2077  C  CD    . ARG A 1 310 ? -9.850  32.136  15.122  1.00 54.73  ? 310 ARG A CD    1 
ATOM   2078  N  NE    . ARG A 1 310 ? -11.254 31.745  14.984  1.00 64.66  ? 310 ARG A NE    1 
ATOM   2079  C  CZ    . ARG A 1 310 ? -11.914 31.707  13.830  1.00 58.43  ? 310 ARG A CZ    1 
ATOM   2080  N  NH1   . ARG A 1 310 ? -11.310 32.064  12.702  1.00 60.06  ? 310 ARG A NH1   1 
ATOM   2081  N  NH2   . ARG A 1 310 ? -13.181 31.321  13.807  1.00 68.20  ? 310 ARG A NH2   1 
ATOM   2082  N  N     . ALA A 1 311 ? -4.394  30.524  14.880  1.00 34.39  ? 311 ALA A N     1 
ATOM   2083  C  CA    . ALA A 1 311 ? -3.020  30.976  14.797  1.00 38.74  ? 311 ALA A CA    1 
ATOM   2084  C  C     . ALA A 1 311 ? -2.706  31.385  13.373  1.00 37.01  ? 311 ALA A C     1 
ATOM   2085  O  O     . ALA A 1 311 ? -3.273  30.850  12.423  1.00 42.23  ? 311 ALA A O     1 
ATOM   2086  C  CB    . ALA A 1 311 ? -2.072  29.870  15.272  1.00 33.27  ? 311 ALA A CB    1 
ATOM   2087  N  N     . GLN A 1 312 ? -1.832  32.364  13.224  1.00 40.38  ? 312 GLN A N     1 
ATOM   2088  C  CA    . GLN A 1 312 ? -1.399  32.767  11.899  1.00 41.27  ? 312 GLN A CA    1 
ATOM   2089  C  C     . GLN A 1 312 ? -0.357  31.738  11.413  1.00 49.48  ? 312 GLN A C     1 
ATOM   2090  O  O     . GLN A 1 312 ? 0.591   31.414  12.136  1.00 40.46  ? 312 GLN A O     1 
ATOM   2091  C  CB    . GLN A 1 312 ? -0.817  34.181  11.926  1.00 49.61  ? 312 GLN A CB    1 
ATOM   2092  C  CG    . GLN A 1 312 ? -0.710  34.846  10.556  1.00 58.23  ? 312 GLN A CG    1 
ATOM   2093  C  CD    . GLN A 1 312 ? -2.083  35.281  10.023  1.00 67.26  ? 312 GLN A CD    1 
ATOM   2094  O  OE1   . GLN A 1 312 ? -3.104  35.144  10.707  1.00 64.26  ? 312 GLN A OE1   1 
ATOM   2095  N  NE2   . GLN A 1 312 ? -2.106  35.819  8.808   1.00 66.37  ? 312 GLN A NE2   1 
ATOM   2096  N  N     . ALA A 1 313 ? -0.580  31.178  10.229  1.00 43.85  ? 313 ALA A N     1 
ATOM   2097  C  CA    . ALA A 1 313 ? 0.349   30.249  9.617   1.00 42.24  ? 313 ALA A CA    1 
ATOM   2098  C  C     . ALA A 1 313 ? 0.898   30.826  8.307   1.00 54.86  ? 313 ALA A C     1 
ATOM   2099  O  O     . ALA A 1 313 ? 0.243   31.652  7.661   1.00 48.92  ? 313 ALA A O     1 
ATOM   2100  C  CB    . ALA A 1 313 ? -0.331  28.906  9.353   1.00 44.62  ? 313 ALA A CB    1 
ATOM   2101  N  N     . TYR A 1 314 ? 2.081   30.366  7.896   1.00 46.81  ? 314 TYR A N     1 
ATOM   2102  C  CA    . TYR A 1 314 ? 2.662   30.822  6.635   1.00 39.68  ? 314 TYR A CA    1 
ATOM   2103  C  C     . TYR A 1 314 ? 2.944   29.629  5.736   1.00 41.73  ? 314 TYR A C     1 
ATOM   2104  O  O     . TYR A 1 314 ? 3.403   28.586  6.212   1.00 42.23  ? 314 TYR A O     1 
ATOM   2105  C  CB    . TYR A 1 314 ? 3.940   31.637  6.884   1.00 38.38  ? 314 TYR A CB    1 
ATOM   2106  C  CG    . TYR A 1 314 ? 3.679   32.799  7.790   1.00 41.84  ? 314 TYR A CG    1 
ATOM   2107  C  CD1   . TYR A 1 314 ? 3.775   32.660  9.165   1.00 35.37  ? 314 TYR A CD1   1 
ATOM   2108  C  CD2   . TYR A 1 314 ? 3.264   34.028  7.272   1.00 50.53  ? 314 TYR A CD2   1 
ATOM   2109  C  CE1   . TYR A 1 314 ? 3.499   33.713  10.006  1.00 48.81  ? 314 TYR A CE1   1 
ATOM   2110  C  CE2   . TYR A 1 314 ? 2.981   35.096  8.108   1.00 54.67  ? 314 TYR A CE2   1 
ATOM   2111  C  CZ    . TYR A 1 314 ? 3.102   34.931  9.475   1.00 53.94  ? 314 TYR A CZ    1 
ATOM   2112  O  OH    . TYR A 1 314 ? 2.826   35.976  10.319  1.00 60.15  ? 314 TYR A OH    1 
ATOM   2113  N  N     . ARG A 1 315 ? 2.635   29.784  4.450   1.00 36.64  ? 315 ARG A N     1 
ATOM   2114  C  CA    . ARG A 1 315 ? 2.951   28.782  3.440   1.00 46.62  ? 315 ARG A CA    1 
ATOM   2115  C  C     . ARG A 1 315 ? 4.369   28.974  2.905   1.00 42.48  ? 315 ARG A C     1 
ATOM   2116  O  O     . ARG A 1 315 ? 4.727   30.041  2.427   1.00 45.39  ? 315 ARG A O     1 
ATOM   2117  C  CB    . ARG A 1 315 ? 1.947   28.839  2.286   1.00 46.75  ? 315 ARG A CB    1 
ATOM   2118  C  CG    . ARG A 1 315 ? 0.514   28.555  2.706   1.00 53.22  ? 315 ARG A CG    1 
ATOM   2119  C  CD    . ARG A 1 315 ? -0.432  28.594  1.511   1.00 61.81  ? 315 ARG A CD    1 
ATOM   2120  N  NE    . ARG A 1 315 ? -1.826  28.613  1.940   1.00 66.43  ? 315 ARG A NE    1 
ATOM   2121  C  CZ    . ARG A 1 315 ? -2.520  27.529  2.280   1.00 66.14  ? 315 ARG A CZ    1 
ATOM   2122  N  NH1   . ARG A 1 315 ? -1.948  26.329  2.243   1.00 62.71  ? 315 ARG A NH1   1 
ATOM   2123  N  NH2   . ARG A 1 315 ? -3.786  27.644  2.656   1.00 69.74  ? 315 ARG A NH2   1 
ATOM   2124  N  N     . LEU A 1 316 ? 5.184   27.938  3.015   1.00 38.49  ? 316 LEU A N     1 
ATOM   2125  C  CA    . LEU A 1 316 ? 6.579   28.001  2.573   1.00 36.72  ? 316 LEU A CA    1 
ATOM   2126  C  C     . LEU A 1 316 ? 6.682   27.651  1.094   1.00 36.70  ? 316 LEU A C     1 
ATOM   2127  O  O     . LEU A 1 316 ? 5.892   26.859  0.573   1.00 38.51  ? 316 LEU A O     1 
ATOM   2128  C  CB    . LEU A 1 316 ? 7.428   27.045  3.416   1.00 36.68  ? 316 LEU A CB    1 
ATOM   2129  C  CG    . LEU A 1 316 ? 7.363   27.262  4.929   1.00 42.48  ? 316 LEU A CG    1 
ATOM   2130  C  CD1   . LEU A 1 316 ? 8.101   26.139  5.652   1.00 37.02  ? 316 LEU A CD1   1 
ATOM   2131  C  CD2   . LEU A 1 316 ? 8.018   28.612  5.302   1.00 35.77  ? 316 LEU A CD2   1 
ATOM   2132  N  N     . SER A 1 317 ? 7.658   28.227  0.410   1.00 34.68  ? 317 SER A N     1 
ATOM   2133  C  CA    . SER A 1 317 ? 7.851   27.943  -1.014  1.00 38.30  ? 317 SER A CA    1 
ATOM   2134  C  C     . SER A 1 317 ? 8.162   26.461  -1.241  1.00 44.78  ? 317 SER A C     1 
ATOM   2135  O  O     . SER A 1 317 ? 8.752   25.798  -0.382  1.00 44.30  ? 317 SER A O     1 
ATOM   2136  C  CB    . SER A 1 317 ? 8.979   28.791  -1.565  1.00 42.36  ? 317 SER A CB    1 
ATOM   2137  O  OG    . SER A 1 317 ? 10.163  28.440  -0.893  1.00 44.91  ? 317 SER A OG    1 
ATOM   2138  N  N     . ILE A 1 318 ? 7.708   25.939  -2.375  1.00 46.95  ? 318 ILE A N     1 
ATOM   2139  C  CA    . ILE A 1 318 ? 7.921   24.554  -2.755  1.00 40.80  ? 318 ILE A CA    1 
ATOM   2140  C  C     . ILE A 1 318 ? 9.388   24.272  -3.099  1.00 44.97  ? 318 ILE A C     1 
ATOM   2141  O  O     . ILE A 1 318 ? 10.010  24.991  -3.879  1.00 48.43  ? 318 ILE A O     1 
ATOM   2142  C  CB    . ILE A 1 318 ? 7.048   24.176  -3.953  1.00 46.53  ? 318 ILE A CB    1 
ATOM   2143  C  CG1   . ILE A 1 318 ? 5.588   24.551  -3.681  1.00 58.55  ? 318 ILE A CG1   1 
ATOM   2144  C  CG2   . ILE A 1 318 ? 7.205   22.684  -4.285  1.00 49.11  ? 318 ILE A CG2   1 
ATOM   2145  C  CD1   . ILE A 1 318 ? 5.054   23.965  -2.398  1.00 55.36  ? 318 ILE A CD1   1 
ATOM   2146  N  N     . PRO A 1 319 ? 9.947   23.219  -2.511  1.00 42.33  ? 319 PRO A N     1 
ATOM   2147  C  CA    . PRO A 1 319 ? 11.317  22.825  -2.842  1.00 42.28  ? 319 PRO A CA    1 
ATOM   2148  C  C     . PRO A 1 319 ? 11.438  22.447  -4.312  1.00 44.97  ? 319 PRO A C     1 
ATOM   2149  O  O     . PRO A 1 319 ? 10.541  21.806  -4.848  1.00 46.81  ? 319 PRO A O     1 
ATOM   2150  C  CB    . PRO A 1 319 ? 11.554  21.611  -1.947  1.00 41.17  ? 319 PRO A CB    1 
ATOM   2151  C  CG    . PRO A 1 319 ? 10.595  21.791  -0.806  1.00 42.85  ? 319 PRO A CG    1 
ATOM   2152  C  CD    . PRO A 1 319 ? 9.381   22.423  -1.408  1.00 47.11  ? 319 PRO A CD    1 
ATOM   2153  N  N     . LYS A 1 320 ? 12.521  22.860  -4.957  1.00 44.15  ? 320 LYS A N     1 
ATOM   2154  C  CA    . LYS A 1 320 ? 12.785  22.443  -6.328  1.00 46.90  ? 320 LYS A CA    1 
ATOM   2155  C  C     . LYS A 1 320 ? 13.789  21.290  -6.353  1.00 49.05  ? 320 LYS A C     1 
ATOM   2156  O  O     . LYS A 1 320 ? 15.000  21.514  -6.299  1.00 42.67  ? 320 LYS A O     1 
ATOM   2157  C  CB    . LYS A 1 320 ? 13.302  23.617  -7.154  1.00 49.07  ? 320 LYS A CB    1 
ATOM   2158  N  N     . LEU A 1 321 ? 13.276  20.063  -6.433  1.00 45.12  ? 321 LEU A N     1 
ATOM   2159  C  CA    . LEU A 1 321 ? 14.110  18.860  -6.477  1.00 39.69  ? 321 LEU A CA    1 
ATOM   2160  C  C     . LEU A 1 321 ? 14.761  18.668  -7.844  1.00 41.58  ? 321 LEU A C     1 
ATOM   2161  O  O     . LEU A 1 321 ? 14.092  18.745  -8.876  1.00 45.46  ? 321 LEU A O     1 
ATOM   2162  C  CB    . LEU A 1 321 ? 13.291  17.610  -6.143  1.00 42.45  ? 321 LEU A CB    1 
ATOM   2163  C  CG    . LEU A 1 321 ? 13.542  16.799  -4.869  1.00 47.66  ? 321 LEU A CG    1 
ATOM   2164  C  CD1   . LEU A 1 321 ? 13.007  15.360  -5.034  1.00 36.74  ? 321 LEU A CD1   1 
ATOM   2165  C  CD2   . LEU A 1 321 ? 15.008  16.776  -4.476  1.00 42.45  ? 321 LEU A CD2   1 
ATOM   2166  N  N     . MET A 1 322 ? 16.052  18.352  -7.848  1.00 41.54  ? 322 MET A N     1 
ATOM   2167  C  CA    . MET A 1 322 ? 16.821  18.254  -9.084  1.00 39.03  ? 322 MET A CA    1 
ATOM   2168  C  C     . MET A 1 322 ? 17.523  16.896  -9.246  1.00 49.06  ? 322 MET A C     1 
ATOM   2169  O  O     . MET A 1 322 ? 18.289  16.450  -8.374  1.00 44.42  ? 322 MET A O     1 
ATOM   2170  C  CB    . MET A 1 322 ? 17.866  19.387  -9.128  1.00 45.14  ? 322 MET A CB    1 
ATOM   2171  C  CG    . MET A 1 322 ? 18.244  19.930  -10.529 1.00 53.24  ? 322 MET A CG    1 
ATOM   2172  S  SD    . MET A 1 322 ? 17.030  20.910  -11.488 1.00 66.80  ? 322 MET A SD    1 
ATOM   2173  C  CE    . MET A 1 322 ? 15.868  21.436  -10.243 1.00 43.30  ? 322 MET A CE    1 
ATOM   2174  N  N     . GLY A 1 323 ? 17.239  16.230  -10.361 1.00 43.51  ? 323 GLY A N     1 
ATOM   2175  C  CA    . GLY A 1 323 ? 18.046  15.104  -10.787 1.00 40.85  ? 323 GLY A CA    1 
ATOM   2176  C  C     . GLY A 1 323 ? 19.065  15.691  -11.739 1.00 43.40  ? 323 GLY A C     1 
ATOM   2177  O  O     . GLY A 1 323 ? 19.677  16.714  -11.433 1.00 48.04  ? 323 GLY A O     1 
ATOM   2178  N  N     . ARG A 1 324 ? 19.243  15.070  -12.900 1.00 47.36  ? 324 ARG A N     1 
ATOM   2179  C  CA    . ARG A 1 324 ? 20.021  15.701  -13.966 1.00 51.85  ? 324 ARG A CA    1 
ATOM   2180  C  C     . ARG A 1 324 ? 19.235  16.910  -14.469 1.00 49.43  ? 324 ARG A C     1 
ATOM   2181  O  O     . ARG A 1 324 ? 19.798  17.933  -14.848 1.00 53.72  ? 324 ARG A O     1 
ATOM   2182  C  CB    . ARG A 1 324 ? 20.296  14.722  -15.102 1.00 48.28  ? 324 ARG A CB    1 
ATOM   2183  C  CG    . ARG A 1 324 ? 21.014  15.336  -16.294 1.00 57.61  ? 324 ARG A CG    1 
ATOM   2184  C  CD    . ARG A 1 324 ? 21.111  14.335  -17.423 1.00 56.68  ? 324 ARG A CD    1 
ATOM   2185  N  NE    . ARG A 1 324 ? 22.101  14.701  -18.434 1.00 61.38  ? 324 ARG A NE    1 
ATOM   2186  C  CZ    . ARG A 1 324 ? 23.411  14.504  -18.308 1.00 64.02  ? 324 ARG A CZ    1 
ATOM   2187  N  NH1   . ARG A 1 324 ? 23.908  13.972  -17.200 1.00 60.11  ? 324 ARG A NH1   1 
ATOM   2188  N  NH2   . ARG A 1 324 ? 24.229  14.861  -19.286 1.00 72.27  ? 324 ARG A NH2   1 
ATOM   2189  N  N     . ARG A 1 325 ? 17.917  16.763  -14.451 1.00 46.99  ? 325 ARG A N     1 
ATOM   2190  C  CA    . ARG A 1 325 ? 16.981  17.854  -14.710 1.00 54.68  ? 325 ARG A CA    1 
ATOM   2191  C  C     . ARG A 1 325 ? 15.993  17.856  -13.564 1.00 44.47  ? 325 ARG A C     1 
ATOM   2192  O  O     . ARG A 1 325 ? 16.084  17.005  -12.681 1.00 42.55  ? 325 ARG A O     1 
ATOM   2193  C  CB    . ARG A 1 325 ? 16.266  17.671  -16.057 1.00 53.15  ? 325 ARG A CB    1 
ATOM   2194  C  CG    . ARG A 1 325 ? 17.225  17.448  -17.224 1.00 65.68  ? 325 ARG A CG    1 
ATOM   2195  C  CD    . ARG A 1 325 ? 16.479  17.204  -18.524 1.00 69.90  ? 325 ARG A CD    1 
ATOM   2196  N  NE    . ARG A 1 325 ? 15.375  16.271  -18.335 1.00 67.53  ? 325 ARG A NE    1 
ATOM   2197  C  CZ    . ARG A 1 325 ? 14.325  16.187  -19.144 1.00 79.35  ? 325 ARG A CZ    1 
ATOM   2198  N  NH1   . ARG A 1 325 ? 14.241  16.982  -20.207 1.00 84.35  ? 325 ARG A NH1   1 
ATOM   2199  N  NH2   . ARG A 1 325 ? 13.354  15.314  -18.890 1.00 70.48  ? 325 ARG A NH2   1 
ATOM   2200  N  N     . ALA A 1 326 ? 15.040  18.780  -13.590 1.00 45.15  ? 326 ALA A N     1 
ATOM   2201  C  CA    . ALA A 1 326 ? 14.049  18.912  -12.526 1.00 42.01  ? 326 ALA A CA    1 
ATOM   2202  C  C     . ALA A 1 326 ? 13.197  17.659  -12.347 1.00 42.67  ? 326 ALA A C     1 
ATOM   2203  O  O     . ALA A 1 326 ? 12.831  16.998  -13.319 1.00 45.22  ? 326 ALA A O     1 
ATOM   2204  C  CB    . ALA A 1 326 ? 13.142  20.126  -12.801 1.00 40.73  ? 326 ALA A CB    1 
ATOM   2205  N  N     . VAL A 1 327 ? 12.875  17.331  -11.099 1.00 43.88  ? 327 VAL A N     1 
ATOM   2206  C  CA    . VAL A 1 327 ? 12.063  16.143  -10.805 1.00 38.80  ? 327 VAL A CA    1 
ATOM   2207  C  C     . VAL A 1 327 ? 11.012  16.481  -9.755  1.00 39.00  ? 327 VAL A C     1 
ATOM   2208  O  O     . VAL A 1 327 ? 11.170  17.449  -9.011  1.00 43.47  ? 327 VAL A O     1 
ATOM   2209  C  CB    . VAL A 1 327 ? 12.934  14.962  -10.284 1.00 37.65  ? 327 VAL A CB    1 
ATOM   2210  C  CG1   . VAL A 1 327 ? 13.929  14.538  -11.331 1.00 36.56  ? 327 VAL A CG1   1 
ATOM   2211  C  CG2   . VAL A 1 327 ? 13.678  15.347  -9.003  1.00 34.98  ? 327 VAL A CG2   1 
ATOM   2212  N  N     . SER A 1 328 ? 9.943   15.699  -9.672  1.00 36.92  ? 328 SER A N     1 
ATOM   2213  C  CA    . SER A 1 328 ? 8.958   15.918  -8.613  1.00 39.73  ? 328 SER A CA    1 
ATOM   2214  C  C     . SER A 1 328 ? 9.178   14.940  -7.454  1.00 42.00  ? 328 SER A C     1 
ATOM   2215  O  O     . SER A 1 328 ? 8.660   15.132  -6.344  1.00 43.06  ? 328 SER A O     1 
ATOM   2216  C  CB    . SER A 1 328 ? 7.535   15.774  -9.155  1.00 42.53  ? 328 SER A CB    1 
ATOM   2217  O  OG    . SER A 1 328 ? 7.355   14.463  -9.651  1.00 52.91  ? 328 SER A OG    1 
ATOM   2218  N  N     . LYS A 1 329 ? 9.935   13.880  -7.726  1.00 37.66  ? 329 LYS A N     1 
ATOM   2219  C  CA    . LYS A 1 329 ? 10.208  12.838  -6.742  1.00 35.90  ? 329 LYS A CA    1 
ATOM   2220  C  C     . LYS A 1 329 ? 11.506  12.104  -7.106  1.00 37.34  ? 329 LYS A C     1 
ATOM   2221  O  O     . LYS A 1 329 ? 11.888  12.073  -8.276  1.00 38.72  ? 329 LYS A O     1 
ATOM   2222  C  CB    . LYS A 1 329 ? 9.033   11.859  -6.659  1.00 36.36  ? 329 LYS A CB    1 
ATOM   2223  C  CG    . LYS A 1 329 ? 8.753   11.132  -7.963  1.00 36.46  ? 329 LYS A CG    1 
ATOM   2224  C  CD    . LYS A 1 329 ? 7.544   10.218  -7.828  1.00 38.10  ? 329 LYS A CD    1 
ATOM   2225  C  CE    . LYS A 1 329 ? 7.325   9.419   -9.108  1.00 34.55  ? 329 LYS A CE    1 
ATOM   2226  N  NZ    . LYS A 1 329 ? 7.036   10.330  -10.256 1.00 49.29  ? 329 LYS A NZ    1 
ATOM   2227  N  N     . PRO A 1 330 ? 12.198  11.529  -6.104  1.00 31.76  ? 330 PRO A N     1 
ATOM   2228  C  CA    . PRO A 1 330 ? 13.508  10.899  -6.370  1.00 39.15  ? 330 PRO A CA    1 
ATOM   2229  C  C     . PRO A 1 330 ? 13.451  9.765   -7.393  1.00 40.22  ? 330 PRO A C     1 
ATOM   2230  O  O     . PRO A 1 330 ? 14.431  9.561   -8.113  1.00 35.73  ? 330 PRO A O     1 
ATOM   2231  C  CB    . PRO A 1 330 ? 13.926  10.360  -4.995  1.00 34.32  ? 330 PRO A CB    1 
ATOM   2232  C  CG    . PRO A 1 330 ? 13.237  11.263  -4.020  1.00 40.67  ? 330 PRO A CG    1 
ATOM   2233  C  CD    . PRO A 1 330 ? 11.899  11.594  -4.660  1.00 29.79  ? 330 PRO A CD    1 
ATOM   2234  N  N     . ALA A 1 331 ? 12.324  9.064   -7.480  1.00 31.28  ? 331 ALA A N     1 
ATOM   2235  C  CA    . ALA A 1 331 ? 12.197  7.976   -8.454  1.00 33.56  ? 331 ALA A CA    1 
ATOM   2236  C  C     . ALA A 1 331 ? 12.286  8.488   -9.888  1.00 41.20  ? 331 ALA A C     1 
ATOM   2237  O  O     . ALA A 1 331 ? 12.659  7.736   -10.781 1.00 43.67  ? 331 ALA A O     1 
ATOM   2238  C  CB    . ALA A 1 331 ? 10.884  7.216   -8.250  1.00 40.01  ? 331 ALA A CB    1 
ATOM   2239  N  N     . ASP A 1 332 ? 11.910  9.747   -10.116 1.00 35.32  ? 332 ASP A N     1 
ATOM   2240  C  CA    . ASP A 1 332 ? 12.025  10.352  -11.446 1.00 36.65  ? 332 ASP A CA    1 
ATOM   2241  C  C     . ASP A 1 332 ? 13.481  10.389  -11.954 1.00 41.69  ? 332 ASP A C     1 
ATOM   2242  O  O     . ASP A 1 332 ? 13.736  10.498  -13.158 1.00 42.67  ? 332 ASP A O     1 
ATOM   2243  C  CB    . ASP A 1 332 ? 11.462  11.773  -11.441 1.00 37.63  ? 332 ASP A CB    1 
ATOM   2244  C  CG    . ASP A 1 332 ? 9.935   11.805  -11.300 1.00 40.93  ? 332 ASP A CG    1 
ATOM   2245  O  OD1   . ASP A 1 332 ? 9.251   10.822  -11.673 1.00 37.26  ? 332 ASP A OD1   1 
ATOM   2246  O  OD2   . ASP A 1 332 ? 9.422   12.827  -10.802 1.00 49.21  ? 332 ASP A OD2   1 
ATOM   2247  N  N     . ALA A 1 333 ? 14.438  10.344  -11.039 1.00 38.81  ? 333 ALA A N     1 
ATOM   2248  C  CA    . ALA A 1 333 ? 15.846  10.377  -11.438 1.00 44.48  ? 333 ALA A CA    1 
ATOM   2249  C  C     . ALA A 1 333 ? 16.244  9.112   -12.216 1.00 44.84  ? 333 ALA A C     1 
ATOM   2250  O  O     . ALA A 1 333 ? 17.212  9.120   -12.977 1.00 44.96  ? 333 ALA A O     1 
ATOM   2251  C  CB    . ALA A 1 333 ? 16.720  10.545  -10.233 1.00 41.17  ? 333 ALA A CB    1 
ATOM   2252  N  N     . LEU A 1 334 ? 15.476  8.039   -12.030 1.00 40.85  ? 334 LEU A N     1 
ATOM   2253  C  CA    . LEU A 1 334 ? 15.705  6.770   -12.725 1.00 43.99  ? 334 LEU A CA    1 
ATOM   2254  C  C     . LEU A 1 334 ? 15.474  6.902   -14.237 1.00 50.37  ? 334 LEU A C     1 
ATOM   2255  O  O     . LEU A 1 334 ? 15.945  6.071   -15.017 1.00 49.01  ? 334 LEU A O     1 
ATOM   2256  C  CB    . LEU A 1 334 ? 14.782  5.682   -12.161 1.00 41.81  ? 334 LEU A CB    1 
ATOM   2257  C  CG    . LEU A 1 334 ? 15.072  5.213   -10.737 1.00 43.02  ? 334 LEU A CG    1 
ATOM   2258  C  CD1   . LEU A 1 334 ? 14.067  4.158   -10.291 1.00 43.62  ? 334 LEU A CD1   1 
ATOM   2259  C  CD2   . LEU A 1 334 ? 16.498  4.687   -10.613 1.00 38.78  ? 334 LEU A CD2   1 
ATOM   2260  N  N     . ARG A 1 335 ? 14.746  7.943   -14.643 1.00 44.07  ? 335 ARG A N     1 
ATOM   2261  C  CA    . ARG A 1 335 ? 14.457  8.181   -16.055 1.00 46.99  ? 335 ARG A CA    1 
ATOM   2262  C  C     . ARG A 1 335 ? 15.102  9.453   -16.562 1.00 50.92  ? 335 ARG A C     1 
ATOM   2263  O  O     . ARG A 1 335 ? 15.645  9.487   -17.665 1.00 57.42  ? 335 ARG A O     1 
ATOM   2264  C  CB    . ARG A 1 335 ? 12.942  8.215   -16.276 1.00 54.62  ? 335 ARG A CB    1 
ATOM   2265  C  CG    . ARG A 1 335 ? 12.342  6.841   -16.065 1.00 59.47  ? 335 ARG A CG    1 
ATOM   2266  C  CD    . ARG A 1 335 ? 10.844  6.772   -16.216 1.00 67.26  ? 335 ARG A CD    1 
ATOM   2267  N  NE    . ARG A 1 335 ? 10.461  5.369   -16.357 1.00 76.30  ? 335 ARG A NE    1 
ATOM   2268  C  CZ    . ARG A 1 335 ? 10.364  4.509   -15.344 1.00 74.92  ? 335 ARG A CZ    1 
ATOM   2269  N  NH1   . ARG A 1 335 ? 10.616  4.900   -14.095 1.00 59.52  ? 335 ARG A NH1   1 
ATOM   2270  N  NH2   . ARG A 1 335 ? 10.021  3.250   -15.585 1.00 74.51  ? 335 ARG A NH2   1 
ATOM   2271  N  N     . VAL A 1 336 ? 15.068  10.491  -15.736 1.00 52.78  ? 336 VAL A N     1 
ATOM   2272  C  CA    . VAL A 1 336 ? 15.638  11.780  -16.096 1.00 46.48  ? 336 VAL A CA    1 
ATOM   2273  C  C     . VAL A 1 336 ? 17.160  11.767  -15.991 1.00 50.26  ? 336 VAL A C     1 
ATOM   2274  O  O     . VAL A 1 336 ? 17.850  12.461  -16.739 1.00 47.51  ? 336 VAL A O     1 
ATOM   2275  C  CB    . VAL A 1 336 ? 15.039  12.897  -15.203 1.00 48.32  ? 336 VAL A CB    1 
ATOM   2276  C  CG1   . VAL A 1 336 ? 15.889  14.150  -15.203 1.00 50.52  ? 336 VAL A CG1   1 
ATOM   2277  C  CG2   . VAL A 1 336 ? 13.601  13.201  -15.639 1.00 52.95  ? 336 VAL A CG2   1 
ATOM   2278  N  N     . GLY A 1 337 ? 17.678  10.978  -15.055 1.00 49.76  ? 337 GLY A N     1 
ATOM   2279  C  CA    . GLY A 1 337 ? 19.108  10.928  -14.809 1.00 45.62  ? 337 GLY A CA    1 
ATOM   2280  C  C     . GLY A 1 337 ? 19.408  11.515  -13.438 1.00 49.36  ? 337 GLY A C     1 
ATOM   2281  O  O     . GLY A 1 337 ? 18.641  12.340  -12.925 1.00 46.65  ? 337 GLY A O     1 
ATOM   2282  N  N     . PHE A 1 338 ? 20.534  11.116  -12.857 1.00 45.56  ? 338 PHE A N     1 
ATOM   2283  C  CA    . PHE A 1 338 ? 20.900  11.526  -11.509 1.00 46.21  ? 338 PHE A CA    1 
ATOM   2284  C  C     . PHE A 1 338 ? 21.543  12.910  -11.476 1.00 44.25  ? 338 PHE A C     1 
ATOM   2285  O  O     . PHE A 1 338 ? 22.097  13.372  -12.462 1.00 40.78  ? 338 PHE A O     1 
ATOM   2286  C  CB    . PHE A 1 338 ? 21.851  10.501  -10.876 1.00 51.58  ? 338 PHE A CB    1 
ATOM   2287  C  CG    . PHE A 1 338 ? 21.437  9.066   -11.093 1.00 49.06  ? 338 PHE A CG    1 
ATOM   2288  C  CD1   . PHE A 1 338 ? 20.220  8.605   -10.621 1.00 48.13  ? 338 PHE A CD1   1 
ATOM   2289  C  CD2   . PHE A 1 338 ? 22.279  8.181   -11.740 1.00 51.44  ? 338 PHE A CD2   1 
ATOM   2290  C  CE1   . PHE A 1 338 ? 19.830  7.291   -10.814 1.00 49.44  ? 338 PHE A CE1   1 
ATOM   2291  C  CE2   . PHE A 1 338 ? 21.909  6.872   -11.930 1.00 50.85  ? 338 PHE A CE2   1 
ATOM   2292  C  CZ    . PHE A 1 338 ? 20.677  6.423   -11.471 1.00 52.40  ? 338 PHE A CZ    1 
ATOM   2293  N  N     . TYR A 1 339 ? 21.452  13.561  -10.325 1.00 44.29  ? 339 TYR A N     1 
ATOM   2294  C  CA    . TYR A 1 339 ? 22.057  14.860  -10.125 1.00 41.43  ? 339 TYR A CA    1 
ATOM   2295  C  C     . TYR A 1 339 ? 23.555  14.795  -10.380 1.00 49.75  ? 339 TYR A C     1 
ATOM   2296  O  O     . TYR A 1 339 ? 24.113  15.601  -11.124 1.00 50.11  ? 339 TYR A O     1 
ATOM   2297  C  CB    . TYR A 1 339 ? 21.784  15.360  -8.711  1.00 41.35  ? 339 TYR A CB    1 
ATOM   2298  C  CG    . TYR A 1 339 ? 22.365  16.736  -8.442  1.00 53.04  ? 339 TYR A CG    1 
ATOM   2299  C  CD1   . TYR A 1 339 ? 21.767  17.870  -8.974  1.00 49.90  ? 339 TYR A CD1   1 
ATOM   2300  C  CD2   . TYR A 1 339 ? 23.495  16.903  -7.660  1.00 45.35  ? 339 TYR A CD2   1 
ATOM   2301  C  CE1   . TYR A 1 339 ? 22.278  19.127  -8.741  1.00 48.58  ? 339 TYR A CE1   1 
ATOM   2302  C  CE2   . TYR A 1 339 ? 24.013  18.167  -7.419  1.00 54.18  ? 339 TYR A CE2   1 
ATOM   2303  C  CZ    . TYR A 1 339 ? 23.397  19.273  -7.967  1.00 54.38  ? 339 TYR A CZ    1 
ATOM   2304  O  OH    . TYR A 1 339 ? 23.891  20.535  -7.742  1.00 54.32  ? 339 TYR A OH    1 
ATOM   2305  N  N     . ARG A 1 340 ? 24.204  13.830  -9.745  1.00 47.96  ? 340 ARG A N     1 
ATOM   2306  C  CA    . ARG A 1 340 ? 25.622  13.600  -9.974  1.00 51.85  ? 340 ARG A CA    1 
ATOM   2307  C  C     . ARG A 1 340 ? 25.904  12.102  -9.987  1.00 54.11  ? 340 ARG A C     1 
ATOM   2308  O  O     . ARG A 1 340 ? 25.748  11.388  -8.987  1.00 49.26  ? 340 ARG A O     1 
ATOM   2309  C  CB    . ARG A 1 340 ? 26.478  14.320  -8.924  1.00 51.94  ? 340 ARG A CB    1 
ATOM   2310  C  CG    . ARG A 1 340 ? 26.481  15.851  -9.088  1.00 63.64  ? 340 ARG A CG    1 
ATOM   2311  C  CD    . ARG A 1 340 ? 27.785  16.507  -8.641  1.00 67.91  ? 340 ARG A CD    1 
ATOM   2312  N  NE    . ARG A 1 340 ? 27.597  17.925  -8.320  1.00 73.13  ? 340 ARG A NE    1 
ATOM   2313  C  CZ    . ARG A 1 340 ? 27.424  18.394  -7.083  1.00 77.11  ? 340 ARG A CZ    1 
ATOM   2314  N  NH1   . ARG A 1 340 ? 27.421  17.561  -6.046  1.00 72.51  ? 340 ARG A NH1   1 
ATOM   2315  N  NH2   . ARG A 1 340 ? 27.256  19.697  -6.875  1.00 78.16  ? 340 ARG A NH2   1 
ATOM   2316  N  N     . ALA A 1 341 ? 26.292  11.614  -11.148 1.00 52.57  ? 341 ALA A N     1 
ATOM   2317  C  CA    . ALA A 1 341 ? 26.641  10.221  -11.247 1.00 57.16  ? 341 ALA A CA    1 
ATOM   2318  C  C     . ALA A 1 341 ? 28.115  10.089  -11.579 1.00 52.82  ? 341 ALA A C     1 
ATOM   2319  O  O     . ALA A 1 341 ? 28.716  11.001  -12.148 1.00 59.42  ? 341 ALA A O     1 
ATOM   2320  C  CB    . ALA A 1 341 ? 25.784  9.540   -12.301 1.00 52.35  ? 341 ALA A CB    1 
ATOM   2321  N  N     . GLN A 1 342 ? 28.695  8.956   -11.208 1.00 52.06  ? 342 GLN A N     1 
ATOM   2322  C  CA    . GLN A 1 342 ? 30.053  8.621   -11.605 1.00 52.34  ? 342 GLN A CA    1 
ATOM   2323  C  C     . GLN A 1 342 ? 30.065  7.177   -12.086 1.00 52.10  ? 342 GLN A C     1 
ATOM   2324  O  O     . GLN A 1 342 ? 29.069  6.461   -11.961 1.00 54.03  ? 342 GLN A O     1 
ATOM   2325  C  CB    . GLN A 1 342 ? 31.053  8.806   -10.450 1.00 58.62  ? 342 GLN A CB    1 
ATOM   2326  C  CG    . GLN A 1 342 ? 30.450  9.228   -9.103  1.00 58.74  ? 342 GLN A CG    1 
ATOM   2327  C  CD    . GLN A 1 342 ? 29.661  8.120   -8.399  1.00 61.46  ? 342 GLN A CD    1 
ATOM   2328  O  OE1   . GLN A 1 342 ? 30.104  6.970   -8.314  1.00 72.94  ? 342 GLN A OE1   1 
ATOM   2329  N  NE2   . GLN A 1 342 ? 28.485  8.470   -7.891  1.00 58.63  ? 342 GLN A NE2   1 
ATOM   2330  N  N     . GLU A 1 343 ? 31.206  6.757   -12.610 1.00 47.62  ? 343 GLU A N     1 
ATOM   2331  C  CA    . GLU A 1 343 ? 31.451  5.371   -12.969 1.00 52.72  ? 343 GLU A CA    1 
ATOM   2332  C  C     . GLU A 1 343 ? 31.081  4.447   -11.810 1.00 52.35  ? 343 GLU A C     1 
ATOM   2333  O  O     . GLU A 1 343 ? 31.527  4.638   -10.678 1.00 52.81  ? 343 GLU A O     1 
ATOM   2334  C  CB    . GLU A 1 343 ? 32.919  5.191   -13.345 1.00 62.06  ? 343 GLU A CB    1 
ATOM   2335  C  CG    . GLU A 1 343 ? 33.303  3.795   -13.759 1.00 65.78  ? 343 GLU A CG    1 
ATOM   2336  C  CD    . GLU A 1 343 ? 34.780  3.698   -14.079 1.00 76.35  ? 343 GLU A CD    1 
ATOM   2337  O  OE1   . GLU A 1 343 ? 35.481  4.728   -13.939 1.00 74.57  ? 343 GLU A OE1   1 
ATOM   2338  O  OE2   . GLU A 1 343 ? 35.234  2.597   -14.461 1.00 82.59  ? 343 GLU A OE2   1 
ATOM   2339  N  N     . THR A 1 344 ? 30.235  3.462   -12.081 1.00 46.95  ? 344 THR A N     1 
ATOM   2340  C  CA    . THR A 1 344 ? 29.715  2.640   -11.003 1.00 45.89  ? 344 THR A CA    1 
ATOM   2341  C  C     . THR A 1 344 ? 29.751  1.167   -11.344 1.00 46.53  ? 344 THR A C     1 
ATOM   2342  O  O     . THR A 1 344 ? 29.458  0.774   -12.470 1.00 43.89  ? 344 THR A O     1 
ATOM   2343  C  CB    . THR A 1 344 ? 28.260  3.029   -10.662 1.00 46.12  ? 344 THR A CB    1 
ATOM   2344  O  OG1   . THR A 1 344 ? 28.202  4.411   -10.289 1.00 55.07  ? 344 THR A OG1   1 
ATOM   2345  C  CG2   . THR A 1 344 ? 27.707  2.167   -9.525  1.00 49.57  ? 344 THR A CG2   1 
ATOM   2346  N  N     . ALA A 1 345 ? 30.109  0.357   -10.359 1.00 41.67  ? 345 ALA A N     1 
ATOM   2347  C  CA    . ALA A 1 345 ? 30.046  -1.082  -10.496 1.00 45.30  ? 345 ALA A CA    1 
ATOM   2348  C  C     . ALA A 1 345 ? 29.186  -1.627  -9.373  1.00 37.01  ? 345 ALA A C     1 
ATOM   2349  O  O     . ALA A 1 345 ? 29.390  -1.298  -8.201  1.00 39.55  ? 345 ALA A O     1 
ATOM   2350  C  CB    . ALA A 1 345 ? 31.442  -1.686  -10.466 1.00 42.91  ? 345 ALA A CB    1 
ATOM   2351  N  N     . LEU A 1 346 ? 28.189  -2.416  -9.742  1.00 38.38  ? 346 LEU A N     1 
ATOM   2352  C  CA    . LEU A 1 346 ? 27.283  -3.018  -8.775  1.00 40.59  ? 346 LEU A CA    1 
ATOM   2353  C  C     . LEU A 1 346 ? 27.412  -4.520  -8.879  1.00 44.62  ? 346 LEU A C     1 
ATOM   2354  O  O     . LEU A 1 346 ? 27.697  -5.011  -9.958  1.00 43.40  ? 346 LEU A O     1 
ATOM   2355  C  CB    . LEU A 1 346 ? 25.839  -2.603  -9.051  1.00 43.50  ? 346 LEU A CB    1 
ATOM   2356  C  CG    . LEU A 1 346 ? 25.185  -1.301  -8.564  1.00 51.13  ? 346 LEU A CG    1 
ATOM   2357  C  CD1   . LEU A 1 346 ? 26.045  -0.519  -7.594  1.00 32.79  ? 346 LEU A CD1   1 
ATOM   2358  C  CD2   . LEU A 1 346 ? 24.695  -0.432  -9.718  1.00 47.96  ? 346 LEU A CD2   1 
ATOM   2359  N  N     . ALA A 1 347 ? 27.182  -5.259  -7.795  1.00 38.47  ? 347 ALA A N     1 
ATOM   2360  C  CA    . ALA A 1 347 ? 27.260  -6.709  -7.896  1.00 37.98  ? 347 ALA A CA    1 
ATOM   2361  C  C     . ALA A 1 347 ? 25.962  -7.369  -7.458  1.00 38.39  ? 347 ALA A C     1 
ATOM   2362  O  O     . ALA A 1 347 ? 25.320  -6.937  -6.502  1.00 33.56  ? 347 ALA A O     1 
ATOM   2363  C  CB    . ALA A 1 347 ? 28.425  -7.257  -7.056  1.00 34.86  ? 347 ALA A CB    1 
ATOM   2364  N  N     . LEU A 1 348 ? 25.641  -8.482  -8.095  1.00 37.74  ? 348 LEU A N     1 
ATOM   2365  C  CA    . LEU A 1 348 ? 24.438  -9.226  -7.750  1.00 37.22  ? 348 LEU A CA    1 
ATOM   2366  C  C     . LEU A 1 348 ? 24.804  -10.460 -6.931  1.00 39.72  ? 348 LEU A C     1 
ATOM   2367  O  O     . LEU A 1 348 ? 25.726  -11.202 -7.280  1.00 40.25  ? 348 LEU A O     1 
ATOM   2368  C  CB    . LEU A 1 348 ? 23.690  -9.630  -9.020  1.00 36.57  ? 348 LEU A CB    1 
ATOM   2369  C  CG    . LEU A 1 348 ? 22.396  -10.443 -8.861  1.00 42.70  ? 348 LEU A CG    1 
ATOM   2370  C  CD1   . LEU A 1 348 ? 21.333  -9.650  -8.109  1.00 35.40  ? 348 LEU A CD1   1 
ATOM   2371  C  CD2   . LEU A 1 348 ? 21.871  -10.858 -10.227 1.00 47.91  ? 348 LEU A CD2   1 
ATOM   2372  N  N     . LEU A 1 349 ? 24.082  -10.656 -5.831  1.00 34.76  ? 349 LEU A N     1 
ATOM   2373  C  CA    . LEU A 1 349 ? 24.163  -11.860 -5.012  1.00 31.74  ? 349 LEU A CA    1 
ATOM   2374  C  C     . LEU A 1 349 ? 22.776  -12.516 -5.008  1.00 37.82  ? 349 LEU A C     1 
ATOM   2375  O  O     . LEU A 1 349 ? 21.809  -11.945 -4.496  1.00 38.98  ? 349 LEU A O     1 
ATOM   2376  C  CB    . LEU A 1 349 ? 24.603  -11.542 -3.575  1.00 31.32  ? 349 LEU A CB    1 
ATOM   2377  C  CG    . LEU A 1 349 ? 24.558  -12.678 -2.538  1.00 40.83  ? 349 LEU A CG    1 
ATOM   2378  C  CD1   . LEU A 1 349 ? 25.343  -13.900 -2.998  1.00 42.10  ? 349 LEU A CD1   1 
ATOM   2379  C  CD2   . LEU A 1 349 ? 25.054  -12.245 -1.165  1.00 34.62  ? 349 LEU A CD2   1 
ATOM   2380  N  N     . ARG A 1 350 ? 22.665  -13.701 -5.599  1.00 40.12  ? 350 ARG A N     1 
ATOM   2381  C  CA    . ARG A 1 350 ? 21.369  -14.384 -5.648  1.00 39.80  ? 350 ARG A CA    1 
ATOM   2382  C  C     . ARG A 1 350 ? 21.327  -15.545 -4.685  1.00 37.01  ? 350 ARG A C     1 
ATOM   2383  O  O     . ARG A 1 350 ? 22.253  -16.356 -4.639  1.00 40.51  ? 350 ARG A O     1 
ATOM   2384  C  CB    . ARG A 1 350 ? 21.055  -14.882 -7.055  1.00 38.81  ? 350 ARG A CB    1 
ATOM   2385  C  CG    . ARG A 1 350 ? 21.015  -13.785 -8.099  1.00 47.27  ? 350 ARG A CG    1 
ATOM   2386  C  CD    . ARG A 1 350 ? 20.624  -14.358 -9.454  1.00 51.54  ? 350 ARG A CD    1 
ATOM   2387  N  NE    . ARG A 1 350 ? 19.263  -13.996 -9.836  1.00 50.57  ? 350 ARG A NE    1 
ATOM   2388  C  CZ    . ARG A 1 350 ? 18.168  -14.572 -9.352  1.00 46.83  ? 350 ARG A CZ    1 
ATOM   2389  N  NH1   . ARG A 1 350 ? 16.952  -14.193 -9.778  1.00 40.30  ? 350 ARG A NH1   1 
ATOM   2390  N  NH2   . ARG A 1 350 ? 18.290  -15.531 -8.465  1.00 50.19  ? 350 ARG A NH2   1 
ATOM   2391  N  N     . LEU A 1 351 ? 20.250  -15.630 -3.911  1.00 37.15  ? 351 LEU A N     1 
ATOM   2392  C  CA    . LEU A 1 351 ? 20.117  -16.687 -2.915  1.00 38.93  ? 351 LEU A CA    1 
ATOM   2393  C  C     . LEU A 1 351 ? 18.829  -17.501 -3.102  1.00 37.39  ? 351 LEU A C     1 
ATOM   2394  O  O     . LEU A 1 351 ? 18.427  -18.250 -2.197  1.00 40.52  ? 351 LEU A O     1 
ATOM   2395  C  CB    . LEU A 1 351 ? 20.158  -16.079 -1.510  1.00 28.28  ? 351 LEU A CB    1 
ATOM   2396  C  CG    . LEU A 1 351 ? 21.365  -15.147 -1.229  1.00 43.61  ? 351 LEU A CG    1 
ATOM   2397  C  CD1   . LEU A 1 351 ? 21.299  -14.590 0.182   1.00 38.26  ? 351 LEU A CD1   1 
ATOM   2398  C  CD2   . LEU A 1 351 ? 22.706  -15.898 -1.422  1.00 37.48  ? 351 LEU A CD2   1 
ATOM   2399  N  N     . ASP A 1 352 ? 18.208  -17.376 -4.275  1.00 35.41  ? 352 ASP A N     1 
ATOM   2400  C  CA    . ASP A 1 352 ? 16.924  -18.039 -4.553  1.00 46.42  ? 352 ASP A CA    1 
ATOM   2401  C  C     . ASP A 1 352 ? 17.087  -19.273 -5.430  1.00 51.93  ? 352 ASP A C     1 
ATOM   2402  O  O     . ASP A 1 352 ? 16.132  -20.026 -5.633  1.00 50.12  ? 352 ASP A O     1 
ATOM   2403  C  CB    . ASP A 1 352 ? 15.934  -17.078 -5.215  1.00 42.14  ? 352 ASP A CB    1 
ATOM   2404  C  CG    . ASP A 1 352 ? 16.467  -16.498 -6.503  1.00 45.39  ? 352 ASP A CG    1 
ATOM   2405  O  OD1   . ASP A 1 352 ? 17.607  -16.848 -6.895  1.00 47.61  ? 352 ASP A OD1   1 
ATOM   2406  O  OD2   . ASP A 1 352 ? 15.776  -15.678 -7.129  1.00 48.81  ? 352 ASP A OD2   1 
ATOM   2407  N  N     . GLY A 1 353 ? 18.256  -19.406 -6.045  1.00 50.09  ? 353 GLY A N     1 
ATOM   2408  C  CA    . GLY A 1 353 ? 18.592  -20.603 -6.793  1.00 43.82  ? 353 GLY A CA    1 
ATOM   2409  C  C     . GLY A 1 353 ? 18.695  -20.298 -8.268  1.00 43.57  ? 353 GLY A C     1 
ATOM   2410  O  O     . GLY A 1 353 ? 18.994  -21.174 -9.071  1.00 53.07  ? 353 GLY A O     1 
ATOM   2411  N  N     . ALA A 1 354 ? 18.408  -19.059 -8.642  1.00 47.02  ? 354 ALA A N     1 
ATOM   2412  C  CA    . ALA A 1 354 ? 18.408  -18.702 -10.055 1.00 51.44  ? 354 ALA A CA    1 
ATOM   2413  C  C     . ALA A 1 354 ? 19.647  -17.894 -10.412 1.00 53.16  ? 354 ALA A C     1 
ATOM   2414  O  O     . ALA A 1 354 ? 20.478  -17.606 -9.542  1.00 51.38  ? 354 ALA A O     1 
ATOM   2415  C  CB    . ALA A 1 354 ? 17.137  -17.928 -10.404 1.00 47.91  ? 354 ALA A CB    1 
ATOM   2416  N  N     . GLN A 1 355 ? 19.754  -17.481 -11.674 1.00 52.17  ? 355 GLN A N     1 
ATOM   2417  C  CA    . GLN A 1 355 ? 20.967  -16.805 -12.120 1.00 54.41  ? 355 GLN A CA    1 
ATOM   2418  C  C     . GLN A 1 355 ? 20.694  -15.558 -12.927 1.00 52.57  ? 355 GLN A C     1 
ATOM   2419  O  O     . GLN A 1 355 ? 19.692  -15.454 -13.633 1.00 51.98  ? 355 GLN A O     1 
ATOM   2420  C  CB    . GLN A 1 355 ? 21.861  -17.740 -12.955 1.00 55.67  ? 355 GLN A CB    1 
ATOM   2421  C  CG    . GLN A 1 355 ? 21.310  -18.129 -14.326 1.00 42.76  ? 355 GLN A CG    1 
ATOM   2422  C  CD    . GLN A 1 355 ? 21.682  -17.139 -15.438 1.00 61.94  ? 355 GLN A CD    1 
ATOM   2423  O  OE1   . GLN A 1 355 ? 22.819  -16.630 -15.510 1.00 53.76  ? 355 GLN A OE1   1 
ATOM   2424  N  NE2   . GLN A 1 355 ? 20.704  -16.841 -16.300 1.00 53.77  ? 355 GLN A NE2   1 
ATOM   2425  N  N     . GLY A 1 356 ? 21.649  -14.642 -12.854 1.00 48.94  ? 356 GLY A N     1 
ATOM   2426  C  CA    . GLY A 1 356 ? 21.674  -13.487 -13.717 1.00 49.66  ? 356 GLY A CA    1 
ATOM   2427  C  C     . GLY A 1 356 ? 20.770  -12.398 -13.205 1.00 50.12  ? 356 GLY A C     1 
ATOM   2428  O  O     . GLY A 1 356 ? 19.897  -12.625 -12.359 1.00 43.79  ? 356 GLY A O     1 
ATOM   2429  N  N     . TRP A 1 357 ? 21.046  -11.189 -13.672 1.00 48.79  ? 357 TRP A N     1 
ATOM   2430  C  CA    . TRP A 1 357 ? 20.194  -10.048 -13.414 1.00 49.50  ? 357 TRP A CA    1 
ATOM   2431  C  C     . TRP A 1 357 ? 18.839  -10.241 -14.086 1.00 47.87  ? 357 TRP A C     1 
ATOM   2432  O  O     . TRP A 1 357 ? 18.795  -10.524 -15.281 1.00 48.03  ? 357 TRP A O     1 
ATOM   2433  C  CB    . TRP A 1 357 ? 20.864  -8.774  -13.918 1.00 46.22  ? 357 TRP A CB    1 
ATOM   2434  C  CG    . TRP A 1 357 ? 22.075  -8.380  -13.148 1.00 46.16  ? 357 TRP A CG    1 
ATOM   2435  C  CD1   . TRP A 1 357 ? 23.330  -8.912  -13.244 1.00 47.87  ? 357 TRP A CD1   1 
ATOM   2436  C  CD2   . TRP A 1 357 ? 22.151  -7.342  -12.162 1.00 47.32  ? 357 TRP A CD2   1 
ATOM   2437  N  NE1   . TRP A 1 357 ? 24.183  -8.270  -12.371 1.00 47.38  ? 357 TRP A NE1   1 
ATOM   2438  C  CE2   . TRP A 1 357 ? 23.482  -7.296  -11.697 1.00 43.65  ? 357 TRP A CE2   1 
ATOM   2439  C  CE3   . TRP A 1 357 ? 21.218  -6.437  -11.631 1.00 44.66  ? 357 TRP A CE3   1 
ATOM   2440  C  CZ2   . TRP A 1 357 ? 23.909  -6.388  -10.720 1.00 40.68  ? 357 TRP A CZ2   1 
ATOM   2441  C  CZ3   . TRP A 1 357 ? 21.639  -5.536  -10.659 1.00 44.19  ? 357 TRP A CZ3   1 
ATOM   2442  C  CH2   . TRP A 1 357 ? 22.969  -5.517  -10.215 1.00 44.30  ? 357 TRP A CH2   1 
ATOM   2443  N  N     . PRO A 1 358 ? 17.739  -10.082 -13.323 1.00 43.80  ? 358 PRO A N     1 
ATOM   2444  C  CA    . PRO A 1 358 ? 16.421  -9.967  -13.958 1.00 51.49  ? 358 PRO A CA    1 
ATOM   2445  C  C     . PRO A 1 358 ? 16.478  -8.869  -14.997 1.00 50.11  ? 358 PRO A C     1 
ATOM   2446  O  O     . PRO A 1 358 ? 17.057  -7.814  -14.708 1.00 41.78  ? 358 PRO A O     1 
ATOM   2447  C  CB    . PRO A 1 358 ? 15.494  -9.593  -12.799 1.00 48.98  ? 358 PRO A CB    1 
ATOM   2448  C  CG    . PRO A 1 358 ? 16.169  -10.180 -11.582 1.00 45.81  ? 358 PRO A CG    1 
ATOM   2449  C  CD    . PRO A 1 358 ? 17.649  -10.023 -11.853 1.00 40.80  ? 358 PRO A CD    1 
ATOM   2450  N  N     . GLU A 1 359 ? 15.926  -9.116  -16.181 1.00 43.81  ? 359 GLU A N     1 
ATOM   2451  C  CA    . GLU A 1 359 ? 16.163  -8.237  -17.316 1.00 50.26  ? 359 GLU A CA    1 
ATOM   2452  C  C     . GLU A 1 359 ? 15.661  -6.811  -17.101 1.00 48.08  ? 359 GLU A C     1 
ATOM   2453  O  O     . GLU A 1 359 ? 16.347  -5.863  -17.486 1.00 49.63  ? 359 GLU A O     1 
ATOM   2454  C  CB    . GLU A 1 359 ? 15.520  -8.827  -18.580 1.00 52.55  ? 359 GLU A CB    1 
ATOM   2455  C  CG    . GLU A 1 359 ? 15.676  -7.980  -19.844 1.00 61.40  ? 359 GLU A CG    1 
ATOM   2456  C  CD    . GLU A 1 359 ? 17.110  -7.943  -20.381 1.00 76.10  ? 359 GLU A CD    1 
ATOM   2457  O  OE1   . GLU A 1 359 ? 17.975  -8.696  -19.878 1.00 70.22  ? 359 GLU A OE1   1 
ATOM   2458  O  OE2   . GLU A 1 359 ? 17.371  -7.155  -21.320 1.00 80.36  ? 359 GLU A OE2   1 
ATOM   2459  N  N     . PHE A 1 360 ? 14.505  -6.638  -16.462 1.00 43.32  ? 360 PHE A N     1 
ATOM   2460  C  CA    . PHE A 1 360 ? 13.977  -5.275  -16.297 1.00 49.17  ? 360 PHE A CA    1 
ATOM   2461  C  C     . PHE A 1 360 ? 14.803  -4.470  -15.291 1.00 42.37  ? 360 PHE A C     1 
ATOM   2462  O  O     . PHE A 1 360 ? 14.905  -3.246  -15.410 1.00 40.79  ? 360 PHE A O     1 
ATOM   2463  C  CB    . PHE A 1 360 ? 12.496  -5.276  -15.884 1.00 41.81  ? 360 PHE A CB    1 
ATOM   2464  C  CG    . PHE A 1 360 ? 12.204  -6.061  -14.641 1.00 41.11  ? 360 PHE A CG    1 
ATOM   2465  C  CD1   . PHE A 1 360 ? 12.223  -5.444  -13.394 1.00 42.26  ? 360 PHE A CD1   1 
ATOM   2466  C  CD2   . PHE A 1 360 ? 11.904  -7.409  -14.712 1.00 44.98  ? 360 PHE A CD2   1 
ATOM   2467  C  CE1   . PHE A 1 360 ? 11.945  -6.165  -12.248 1.00 42.83  ? 360 PHE A CE1   1 
ATOM   2468  C  CE2   . PHE A 1 360 ? 11.622  -8.139  -13.568 1.00 40.04  ? 360 PHE A CE2   1 
ATOM   2469  C  CZ    . PHE A 1 360 ? 11.640  -7.517  -12.335 1.00 42.83  ? 360 PHE A CZ    1 
ATOM   2470  N  N     . LEU A 1 361 ? 15.412  -5.144  -14.313 1.00 42.80  ? 361 LEU A N     1 
ATOM   2471  C  CA    . LEU A 1 361 ? 16.335  -4.433  -13.419 1.00 45.63  ? 361 LEU A CA    1 
ATOM   2472  C  C     . LEU A 1 361 ? 17.535  -3.915  -14.200 1.00 42.55  ? 361 LEU A C     1 
ATOM   2473  O  O     . LEU A 1 361 ? 17.887  -2.733  -14.095 1.00 40.74  ? 361 LEU A O     1 
ATOM   2474  C  CB    . LEU A 1 361 ? 16.796  -5.322  -12.265 1.00 44.95  ? 361 LEU A CB    1 
ATOM   2475  C  CG    . LEU A 1 361 ? 15.689  -5.738  -11.294 1.00 46.48  ? 361 LEU A CG    1 
ATOM   2476  C  CD1   . LEU A 1 361 ? 16.286  -6.503  -10.111 1.00 44.86  ? 361 LEU A CD1   1 
ATOM   2477  C  CD2   . LEU A 1 361 ? 14.928  -4.495  -10.801 1.00 39.95  ? 361 LEU A CD2   1 
ATOM   2478  N  N     . ARG A 1 362 ? 18.135  -4.781  -15.014 1.00 46.20  ? 362 ARG A N     1 
ATOM   2479  C  CA    . ARG A 1 362 ? 19.281  -4.378  -15.831 1.00 45.70  ? 362 ARG A CA    1 
ATOM   2480  C  C     . ARG A 1 362 ? 18.907  -3.214  -16.732 1.00 49.28  ? 362 ARG A C     1 
ATOM   2481  O  O     . ARG A 1 362 ? 19.636  -2.224  -16.823 1.00 47.38  ? 362 ARG A O     1 
ATOM   2482  C  CB    . ARG A 1 362 ? 19.794  -5.552  -16.680 1.00 49.97  ? 362 ARG A CB    1 
ATOM   2483  C  CG    . ARG A 1 362 ? 20.825  -5.132  -17.732 1.00 48.21  ? 362 ARG A CG    1 
ATOM   2484  C  CD    . ARG A 1 362 ? 21.176  -6.255  -18.702 1.00 60.73  ? 362 ARG A CD    1 
ATOM   2485  N  NE    . ARG A 1 362 ? 22.423  -6.922  -18.320 1.00 73.61  ? 362 ARG A NE    1 
ATOM   2486  C  CZ    . ARG A 1 362 ? 22.489  -8.107  -17.721 1.00 70.10  ? 362 ARG A CZ    1 
ATOM   2487  N  NH1   . ARG A 1 362 ? 21.375  -8.774  -17.442 1.00 70.72  ? 362 ARG A NH1   1 
ATOM   2488  N  NH2   . ARG A 1 362 ? 23.671  -8.627  -17.414 1.00 62.55  ? 362 ARG A NH2   1 
ATOM   2489  N  N     . ARG A 1 363 ? 17.760  -3.344  -17.392 1.00 49.60  ? 363 ARG A N     1 
ATOM   2490  C  CA    . ARG A 1 363 ? 17.268  -2.319  -18.312 1.00 53.90  ? 363 ARG A CA    1 
ATOM   2491  C  C     . ARG A 1 363 ? 17.068  -0.985  -17.595 1.00 40.93  ? 363 ARG A C     1 
ATOM   2492  O  O     . ARG A 1 363 ? 17.482  0.060   -18.088 1.00 46.61  ? 363 ARG A O     1 
ATOM   2493  C  CB    . ARG A 1 363 ? 15.970  -2.800  -18.980 1.00 52.71  ? 363 ARG A CB    1 
ATOM   2494  C  CG    . ARG A 1 363 ? 15.448  -1.908  -20.094 1.00 55.90  ? 363 ARG A CG    1 
ATOM   2495  C  CD    . ARG A 1 363 ? 14.341  -2.614  -20.875 1.00 59.66  ? 363 ARG A CD    1 
ATOM   2496  N  NE    . ARG A 1 363 ? 13.034  -2.513  -20.216 1.00 62.48  ? 363 ARG A NE    1 
ATOM   2497  C  CZ    . ARG A 1 363 ? 12.387  -3.547  -19.677 1.00 57.07  ? 363 ARG A CZ    1 
ATOM   2498  N  NH1   . ARG A 1 363 ? 12.910  -4.767  -19.729 1.00 57.72  ? 363 ARG A NH1   1 
ATOM   2499  N  NH2   . ARG A 1 363 ? 11.215  -3.366  -19.088 1.00 55.79  ? 363 ARG A NH2   1 
ATOM   2500  N  N     . ALA A 1 364 ? 16.426  -1.013  -16.432 1.00 44.13  ? 364 ALA A N     1 
ATOM   2501  C  CA    . ALA A 1 364 ? 16.176  0.230   -15.689 1.00 45.76  ? 364 ALA A CA    1 
ATOM   2502  C  C     . ALA A 1 364 ? 17.498  0.879   -15.242 1.00 42.06  ? 364 ALA A C     1 
ATOM   2503  O  O     . ALA A 1 364 ? 17.678  2.108   -15.354 1.00 42.80  ? 364 ALA A O     1 
ATOM   2504  C  CB    . ALA A 1 364 ? 15.263  -0.026  -14.490 1.00 35.55  ? 364 ALA A CB    1 
ATOM   2505  N  N     . LEU A 1 365 ? 18.418  0.063   -14.727 1.00 40.02  ? 365 LEU A N     1 
ATOM   2506  C  CA    . LEU A 1 365 ? 19.718  0.596   -14.299 1.00 43.72  ? 365 LEU A CA    1 
ATOM   2507  C  C     . LEU A 1 365 ? 20.446  1.230   -15.481 1.00 44.91  ? 365 LEU A C     1 
ATOM   2508  O  O     . LEU A 1 365 ? 21.005  2.327   -15.361 1.00 44.51  ? 365 LEU A O     1 
ATOM   2509  C  CB    . LEU A 1 365 ? 20.581  -0.492  -13.644 1.00 37.72  ? 365 LEU A CB    1 
ATOM   2510  C  CG    . LEU A 1 365 ? 20.181  -0.872  -12.212 1.00 41.96  ? 365 LEU A CG    1 
ATOM   2511  C  CD1   . LEU A 1 365 ? 20.944  -2.103  -11.713 1.00 41.74  ? 365 LEU A CD1   1 
ATOM   2512  C  CD2   . LEU A 1 365 ? 20.444  0.320   -11.277 1.00 37.75  ? 365 LEU A CD2   1 
ATOM   2513  N  N     . LEU A 1 366 ? 20.421  0.544   -16.625 1.00 48.39  ? 366 LEU A N     1 
ATOM   2514  C  CA    . LEU A 1 366 ? 21.112  1.018   -17.828 1.00 49.45  ? 366 LEU A CA    1 
ATOM   2515  C  C     . LEU A 1 366 ? 20.477  2.296   -18.386 1.00 49.66  ? 366 LEU A C     1 
ATOM   2516  O  O     . LEU A 1 366 ? 21.180  3.172   -18.879 1.00 50.99  ? 366 LEU A O     1 
ATOM   2517  C  CB    . LEU A 1 366 ? 21.131  -0.071  -18.900 1.00 52.25  ? 366 LEU A CB    1 
ATOM   2518  C  CG    . LEU A 1 366 ? 22.319  -1.041  -18.858 1.00 60.50  ? 366 LEU A CG    1 
ATOM   2519  C  CD1   . LEU A 1 366 ? 22.128  -2.195  -19.837 1.00 60.60  ? 366 LEU A CD1   1 
ATOM   2520  C  CD2   . LEU A 1 366 ? 23.613  -0.312  -19.159 1.00 59.58  ? 366 LEU A CD2   1 
ATOM   2521  N  N     . ARG A 1 367 ? 19.153  2.399   -18.322 1.00 42.39  ? 367 ARG A N     1 
ATOM   2522  C  CA    . ARG A 1 367 ? 18.484  3.621   -18.771 1.00 47.44  ? 367 ARG A CA    1 
ATOM   2523  C  C     . ARG A 1 367 ? 18.871  4.766   -17.851 1.00 47.64  ? 367 ARG A C     1 
ATOM   2524  O  O     . ARG A 1 367 ? 19.214  5.849   -18.306 1.00 50.77  ? 367 ARG A O     1 
ATOM   2525  C  CB    . ARG A 1 367 ? 16.971  3.439   -18.802 1.00 46.29  ? 367 ARG A CB    1 
ATOM   2526  N  N     . ALA A 1 368 ? 18.857  4.504   -16.550 1.00 46.12  ? 368 ALA A N     1 
ATOM   2527  C  CA    . ALA A 1 368 ? 19.182  5.537   -15.580 1.00 42.45  ? 368 ALA A CA    1 
ATOM   2528  C  C     . ALA A 1 368 ? 20.612  6.051   -15.771 1.00 49.78  ? 368 ALA A C     1 
ATOM   2529  O  O     . ALA A 1 368 ? 20.854  7.265   -15.754 1.00 46.42  ? 368 ALA A O     1 
ATOM   2530  C  CB    . ALA A 1 368 ? 18.980  5.017   -14.181 1.00 47.06  ? 368 ALA A CB    1 
ATOM   2531  N  N     . PHE A 1 369 ? 21.570  5.138   -15.917 1.00 44.99  ? 369 PHE A N     1 
ATOM   2532  C  CA    . PHE A 1 369 ? 22.962  5.573   -16.087 1.00 47.89  ? 369 PHE A CA    1 
ATOM   2533  C  C     . PHE A 1 369 ? 23.209  6.174   -17.468 1.00 42.31  ? 369 PHE A C     1 
ATOM   2534  O  O     . PHE A 1 369 ? 24.055  7.046   -17.629 1.00 51.48  ? 369 PHE A O     1 
ATOM   2535  C  CB    . PHE A 1 369 ? 23.912  4.404   -15.814 1.00 42.76  ? 369 PHE A CB    1 
ATOM   2536  C  CG    . PHE A 1 369 ? 24.232  4.235   -14.354 1.00 44.68  ? 369 PHE A CG    1 
ATOM   2537  C  CD1   . PHE A 1 369 ? 23.313  3.662   -13.498 1.00 42.13  ? 369 PHE A CD1   1 
ATOM   2538  C  CD2   . PHE A 1 369 ? 25.439  4.663   -13.837 1.00 41.00  ? 369 PHE A CD2   1 
ATOM   2539  C  CE1   . PHE A 1 369 ? 23.594  3.517   -12.149 1.00 41.40  ? 369 PHE A CE1   1 
ATOM   2540  C  CE2   . PHE A 1 369 ? 25.718  4.527   -12.497 1.00 45.05  ? 369 PHE A CE2   1 
ATOM   2541  C  CZ    . PHE A 1 369 ? 24.797  3.945   -11.652 1.00 43.32  ? 369 PHE A CZ    1 
ATOM   2542  N  N     . GLY A 1 370 ? 22.448  5.714   -18.453 1.00 49.28  ? 370 GLY A N     1 
ATOM   2543  C  CA    . GLY A 1 370 ? 22.478  6.262   -19.801 1.00 55.05  ? 370 GLY A CA    1 
ATOM   2544  C  C     . GLY A 1 370 ? 22.052  7.719   -19.800 1.00 50.41  ? 370 GLY A C     1 
ATOM   2545  O  O     . GLY A 1 370 ? 22.719  8.583   -20.363 1.00 49.24  ? 370 GLY A O     1 
ATOM   2546  N  N     . ALA A 1 371 ? 20.921  7.990   -19.158 1.00 50.71  ? 371 ALA A N     1 
ATOM   2547  C  CA    . ALA A 1 371 ? 20.410  9.352   -19.068 1.00 50.26  ? 371 ALA A CA    1 
ATOM   2548  C  C     . ALA A 1 371 ? 21.374  10.245  -18.295 1.00 53.49  ? 371 ALA A C     1 
ATOM   2549  O  O     . ALA A 1 371 ? 21.359  11.454  -18.480 1.00 60.24  ? 371 ALA A O     1 
ATOM   2550  C  CB    . ALA A 1 371 ? 19.040  9.358   -18.412 1.00 46.05  ? 371 ALA A CB    1 
ATOM   2551  N  N     . SER A 1 372 ? 22.216  9.651   -17.442 1.00 52.11  ? 372 SER A N     1 
ATOM   2552  C  CA    . SER A 1 372 ? 23.146  10.416  -16.596 1.00 53.30  ? 372 SER A CA    1 
ATOM   2553  C  C     . SER A 1 372 ? 24.508  10.605  -17.242 1.00 47.96  ? 372 SER A C     1 
ATOM   2554  O  O     . SER A 1 372 ? 25.367  11.308  -16.708 1.00 51.65  ? 372 SER A O     1 
ATOM   2555  C  CB    . SER A 1 372 ? 23.335  9.745   -15.231 1.00 48.22  ? 372 SER A CB    1 
ATOM   2556  O  OG    . SER A 1 372 ? 22.090  9.442   -14.631 1.00 44.00  ? 372 SER A OG    1 
ATOM   2557  N  N     . GLY A 1 373 ? 24.722  9.947   -18.373 1.00 54.36  ? 373 GLY A N     1 
ATOM   2558  C  CA    . GLY A 1 373 ? 26.012  10.004  -19.040 1.00 53.31  ? 373 GLY A CA    1 
ATOM   2559  C  C     . GLY A 1 373 ? 27.105  9.401   -18.176 1.00 56.88  ? 373 GLY A C     1 
ATOM   2560  O  O     . GLY A 1 373 ? 28.208  9.938   -18.085 1.00 63.04  ? 373 GLY A O     1 
ATOM   2561  N  N     . ALA A 1 374 ? 26.816  8.272   -17.541 1.00 53.26  ? 374 ALA A N     1 
ATOM   2562  C  CA    . ALA A 1 374 ? 27.816  7.656   -16.677 1.00 55.06  ? 374 ALA A CA    1 
ATOM   2563  C  C     . ALA A 1 374 ? 27.980  6.184   -16.995 1.00 49.09  ? 374 ALA A C     1 
ATOM   2564  O  O     . ALA A 1 374 ? 27.035  5.502   -17.416 1.00 50.08  ? 374 ALA A O     1 
ATOM   2565  C  CB    . ALA A 1 374 ? 27.450  7.841   -15.210 1.00 51.85  ? 374 ALA A CB    1 
ATOM   2566  N  N     . SER A 1 375 ? 29.177  5.695   -16.725 1.00 49.89  ? 375 SER A N     1 
ATOM   2567  C  CA    . SER A 1 375 ? 29.520  4.312   -16.975 1.00 50.29  ? 375 SER A CA    1 
ATOM   2568  C  C     . SER A 1 375 ? 28.916  3.388   -15.922 1.00 47.63  ? 375 SER A C     1 
ATOM   2569  O  O     . SER A 1 375 ? 28.998  3.655   -14.721 1.00 47.96  ? 375 SER A O     1 
ATOM   2570  C  CB    . SER A 1 375 ? 31.051  4.176   -17.002 1.00 50.49  ? 375 SER A CB    1 
ATOM   2571  O  OG    . SER A 1 375 ? 31.455  2.825   -17.106 1.00 62.68  ? 375 SER A OG    1 
ATOM   2572  N  N     . LEU A 1 376 ? 28.315  2.296   -16.384 1.00 43.36  ? 376 LEU A N     1 
ATOM   2573  C  CA    . LEU A 1 376 ? 27.756  1.294   -15.486 1.00 48.30  ? 376 LEU A CA    1 
ATOM   2574  C  C     . LEU A 1 376 ? 28.326  -0.087  -15.796 1.00 47.91  ? 376 LEU A C     1 
ATOM   2575  O  O     . LEU A 1 376 ? 28.358  -0.516  -16.949 1.00 48.40  ? 376 LEU A O     1 
ATOM   2576  C  CB    . LEU A 1 376 ? 26.216  1.243   -15.578 1.00 39.99  ? 376 LEU A CB    1 
ATOM   2577  C  CG    . LEU A 1 376 ? 25.558  0.135   -14.744 1.00 44.18  ? 376 LEU A CG    1 
ATOM   2578  C  CD1   . LEU A 1 376 ? 25.786  0.340   -13.259 1.00 45.49  ? 376 LEU A CD1   1 
ATOM   2579  C  CD2   . LEU A 1 376 ? 24.068  -0.038  -15.023 1.00 46.53  ? 376 LEU A CD2   1 
ATOM   2580  N  N     . ARG A 1 377 ? 28.797  -0.758  -14.753 1.00 43.61  ? 377 ARG A N     1 
ATOM   2581  C  CA    . ARG A 1 377 ? 29.239  -2.148  -14.825 1.00 50.12  ? 377 ARG A CA    1 
ATOM   2582  C  C     . ARG A 1 377 ? 28.448  -3.005  -13.850 1.00 39.95  ? 377 ARG A C     1 
ATOM   2583  O  O     . ARG A 1 377 ? 28.411  -2.726  -12.646 1.00 42.26  ? 377 ARG A O     1 
ATOM   2584  C  CB    . ARG A 1 377 ? 30.751  -2.273  -14.535 1.00 47.56  ? 377 ARG A CB    1 
ATOM   2585  C  CG    . ARG A 1 377 ? 31.636  -1.730  -15.653 1.00 55.99  ? 377 ARG A CG    1 
ATOM   2586  C  CD    . ARG A 1 377 ? 33.137  -1.919  -15.377 1.00 79.19  ? 377 ARG A CD    1 
ATOM   2587  N  NE    . ARG A 1 377 ? 33.645  -0.988  -14.365 1.00 78.15  ? 377 ARG A NE    1 
ATOM   2588  C  CZ    . ARG A 1 377 ? 34.133  -1.342  -13.177 1.00 79.27  ? 377 ARG A CZ    1 
ATOM   2589  N  NH1   . ARG A 1 377 ? 34.561  -0.404  -12.335 1.00 74.47  ? 377 ARG A NH1   1 
ATOM   2590  N  NH2   . ARG A 1 377 ? 34.198  -2.625  -12.826 1.00 68.12  ? 377 ARG A NH2   1 
ATOM   2591  N  N     . LEU A 1 378 ? 27.828  -4.053  -14.377 1.00 42.77  ? 378 LEU A N     1 
ATOM   2592  C  CA    . LEU A 1 378 ? 27.081  -5.009  -13.569 1.00 43.56  ? 378 LEU A CA    1 
ATOM   2593  C  C     . LEU A 1 378 ? 27.863  -6.312  -13.443 1.00 47.38  ? 378 LEU A C     1 
ATOM   2594  O  O     . LEU A 1 378 ? 28.141  -6.982  -14.437 1.00 55.57  ? 378 LEU A O     1 
ATOM   2595  C  CB    . LEU A 1 378 ? 25.701  -5.294  -14.173 1.00 43.19  ? 378 LEU A CB    1 
ATOM   2596  C  CG    . LEU A 1 378 ? 24.772  -4.098  -14.408 1.00 48.62  ? 378 LEU A CG    1 
ATOM   2597  C  CD1   . LEU A 1 378 ? 23.432  -4.578  -14.949 1.00 51.71  ? 378 LEU A CD1   1 
ATOM   2598  C  CD2   . LEU A 1 378 ? 24.572  -3.317  -13.114 1.00 44.72  ? 378 LEU A CD2   1 
ATOM   2599  N  N     . HIS A 1 379 ? 28.243  -6.637  -12.215 1.00 46.51  ? 379 HIS A N     1 
ATOM   2600  C  CA    . HIS A 1 379 ? 28.944  -7.869  -11.887 1.00 43.77  ? 379 HIS A CA    1 
ATOM   2601  C  C     . HIS A 1 379 ? 27.987  -8.847  -11.207 1.00 45.26  ? 379 HIS A C     1 
ATOM   2602  O  O     . HIS A 1 379 ? 26.914  -8.465  -10.719 1.00 41.78  ? 379 HIS A O     1 
ATOM   2603  C  CB    . HIS A 1 379 ? 30.135  -7.586  -10.967 1.00 38.96  ? 379 HIS A CB    1 
ATOM   2604  C  CG    . HIS A 1 379 ? 31.107  -6.581  -11.510 1.00 49.57  ? 379 HIS A CG    1 
ATOM   2605  N  ND1   . HIS A 1 379 ? 32.440  -6.868  -11.719 1.00 61.88  ? 379 HIS A ND1   1 
ATOM   2606  C  CD2   . HIS A 1 379 ? 30.945  -5.280  -11.861 1.00 50.97  ? 379 HIS A CD2   1 
ATOM   2607  C  CE1   . HIS A 1 379 ? 33.056  -5.794  -12.181 1.00 50.14  ? 379 HIS A CE1   1 
ATOM   2608  N  NE2   . HIS A 1 379 ? 32.173  -4.818  -12.279 1.00 61.35  ? 379 HIS A NE2   1 
ATOM   2609  N  N     . THR A 1 380 ? 28.423  -10.097 -11.134 1.00 44.69  ? 380 THR A N     1 
ATOM   2610  C  CA    . THR A 1 380 ? 27.710  -11.178 -10.472 1.00 42.71  ? 380 THR A CA    1 
ATOM   2611  C  C     . THR A 1 380 ? 28.660  -11.882 -9.514  1.00 38.14  ? 380 THR A C     1 
ATOM   2612  O  O     . THR A 1 380 ? 29.694  -12.358 -9.940  1.00 41.79  ? 380 THR A O     1 
ATOM   2613  C  CB    . THR A 1 380 ? 27.162  -12.194 -11.497 1.00 46.72  ? 380 THR A CB    1 
ATOM   2614  O  OG1   . THR A 1 380 ? 26.110  -11.578 -12.253 1.00 53.47  ? 380 THR A OG1   1 
ATOM   2615  C  CG2   . THR A 1 380 ? 26.607  -13.436 -10.794 1.00 39.60  ? 380 THR A CG2   1 
ATOM   2616  N  N     . LEU A 1 381 ? 28.329  -11.902 -8.223  1.00 37.79  ? 381 LEU A N     1 
ATOM   2617  C  CA    . LEU A 1 381 ? 29.120  -12.617 -7.226  1.00 41.81  ? 381 LEU A CA    1 
ATOM   2618  C  C     . LEU A 1 381 ? 28.898  -14.131 -7.332  1.00 45.28  ? 381 LEU A C     1 
ATOM   2619  O  O     . LEU A 1 381 ? 27.771  -14.607 -7.196  1.00 39.00  ? 381 LEU A O     1 
ATOM   2620  C  CB    . LEU A 1 381 ? 28.761  -12.147 -5.813  1.00 40.59  ? 381 LEU A CB    1 
ATOM   2621  C  CG    . LEU A 1 381 ? 29.255  -10.791 -5.307  1.00 53.41  ? 381 LEU A CG    1 
ATOM   2622  C  CD1   . LEU A 1 381 ? 28.646  -10.471 -3.946  1.00 47.85  ? 381 LEU A CD1   1 
ATOM   2623  C  CD2   . LEU A 1 381 ? 30.770  -10.813 -5.209  1.00 48.38  ? 381 LEU A CD2   1 
ATOM   2624  N  N     . HIS A 1 382 ? 29.960  -14.889 -7.570  1.00 40.45  ? 382 HIS A N     1 
ATOM   2625  C  CA    . HIS A 1 382 ? 29.832  -16.349 -7.665  1.00 33.97  ? 382 HIS A CA    1 
ATOM   2626  C  C     . HIS A 1 382 ? 30.342  -16.984 -6.390  1.00 31.33  ? 382 HIS A C     1 
ATOM   2627  O  O     . HIS A 1 382 ? 31.382  -17.630 -6.370  1.00 39.67  ? 382 HIS A O     1 
ATOM   2628  C  CB    . HIS A 1 382 ? 30.582  -16.869 -8.885  1.00 37.45  ? 382 HIS A CB    1 
ATOM   2629  C  CG    . HIS A 1 382 ? 30.022  -16.367 -10.179 1.00 37.90  ? 382 HIS A CG    1 
ATOM   2630  N  ND1   . HIS A 1 382 ? 28.915  -16.931 -10.773 1.00 38.31  ? 382 HIS A ND1   1 
ATOM   2631  C  CD2   . HIS A 1 382 ? 30.395  -15.341 -10.981 1.00 40.39  ? 382 HIS A CD2   1 
ATOM   2632  C  CE1   . HIS A 1 382 ? 28.648  -16.291 -11.899 1.00 38.76  ? 382 HIS A CE1   1 
ATOM   2633  N  NE2   . HIS A 1 382 ? 29.528  -15.321 -12.046 1.00 34.73  ? 382 HIS A NE2   1 
ATOM   2634  N  N     . ALA A 1 383 ? 29.651  -16.686 -5.304  1.00 39.88  ? 383 ALA A N     1 
ATOM   2635  C  CA    . ALA A 1 383 ? 29.967  -17.231 -4.009  1.00 38.91  ? 383 ALA A CA    1 
ATOM   2636  C  C     . ALA A 1 383 ? 28.693  -17.315 -3.183  1.00 35.43  ? 383 ALA A C     1 
ATOM   2637  O  O     . ALA A 1 383 ? 27.726  -16.608 -3.446  1.00 40.31  ? 383 ALA A O     1 
ATOM   2638  C  CB    . ALA A 1 383 ? 31.008  -16.396 -3.306  1.00 39.29  ? 383 ALA A CB    1 
ATOM   2639  N  N     . HIS A 1 384 ? 28.714  -18.156 -2.160  1.00 37.94  ? 384 HIS A N     1 
ATOM   2640  C  CA    . HIS A 1 384 ? 27.574  -18.329 -1.272  1.00 38.96  ? 384 HIS A CA    1 
ATOM   2641  C  C     . HIS A 1 384 ? 28.040  -18.210 0.176   1.00 39.62  ? 384 HIS A C     1 
ATOM   2642  O  O     . HIS A 1 384 ? 29.092  -18.721 0.519   1.00 40.76  ? 384 HIS A O     1 
ATOM   2643  C  CB    . HIS A 1 384 ? 26.903  -19.679 -1.511  1.00 37.32  ? 384 HIS A CB    1 
ATOM   2644  C  CG    . HIS A 1 384 ? 25.558  -19.811 -0.868  1.00 36.23  ? 384 HIS A CG    1 
ATOM   2645  N  ND1   . HIS A 1 384 ? 25.398  -20.231 0.435   1.00 35.11  ? 384 HIS A ND1   1 
ATOM   2646  C  CD2   . HIS A 1 384 ? 24.310  -19.571 -1.347  1.00 32.31  ? 384 HIS A CD2   1 
ATOM   2647  C  CE1   . HIS A 1 384 ? 24.110  -20.253 0.732   1.00 34.49  ? 384 HIS A CE1   1 
ATOM   2648  N  NE2   . HIS A 1 384 ? 23.428  -19.856 -0.329  1.00 38.24  ? 384 HIS A NE2   1 
ATOM   2649  N  N     . PRO A 1 385 ? 27.268  -17.502 1.018   1.00 43.86  ? 385 PRO A N     1 
ATOM   2650  C  CA    . PRO A 1 385 ? 27.620  -17.298 2.430   1.00 41.96  ? 385 PRO A CA    1 
ATOM   2651  C  C     . PRO A 1 385 ? 27.953  -18.603 3.176   1.00 45.68  ? 385 PRO A C     1 
ATOM   2652  O  O     . PRO A 1 385 ? 28.668  -18.564 4.180   1.00 44.02  ? 385 PRO A O     1 
ATOM   2653  C  CB    . PRO A 1 385 ? 26.350  -16.672 3.017   1.00 42.48  ? 385 PRO A CB    1 
ATOM   2654  C  CG    . PRO A 1 385 ? 25.683  -16.012 1.865   1.00 42.22  ? 385 PRO A CG    1 
ATOM   2655  C  CD    . PRO A 1 385 ? 25.981  -16.863 0.666   1.00 36.29  ? 385 PRO A CD    1 
ATOM   2656  N  N     . SER A 1 386 ? 27.487  -19.741 2.671   1.00 41.41  ? 386 SER A N     1 
ATOM   2657  C  CA    . SER A 1 386 ? 27.790  -21.028 3.317   1.00 48.60  ? 386 SER A CA    1 
ATOM   2658  C  C     . SER A 1 386 ? 29.271  -21.395 3.167   1.00 51.45  ? 386 SER A C     1 
ATOM   2659  O  O     . SER A 1 386 ? 29.750  -22.324 3.816   1.00 54.43  ? 386 SER A O     1 
ATOM   2660  C  CB    . SER A 1 386 ? 26.902  -22.163 2.732   1.00 35.19  ? 386 SER A CB    1 
ATOM   2661  N  N     . GLN A 1 387 ? 30.010  -20.620 2.378   1.00 50.43  ? 387 GLN A N     1 
ATOM   2662  C  CA    . GLN A 1 387 ? 31.388  -20.973 2.058   1.00 45.73  ? 387 GLN A CA    1 
ATOM   2663  C  C     . GLN A 1 387 ? 32.395  -20.350 3.004   1.00 49.80  ? 387 GLN A C     1 
ATOM   2664  O  O     . GLN A 1 387 ? 33.598  -20.389 2.737   1.00 56.88  ? 387 GLN A O     1 
ATOM   2665  C  CB    . GLN A 1 387 ? 31.732  -20.542 0.628   1.00 42.25  ? 387 GLN A CB    1 
ATOM   2666  C  CG    . GLN A 1 387 ? 30.922  -21.229 -0.461  1.00 38.05  ? 387 GLN A CG    1 
ATOM   2667  C  CD    . GLN A 1 387 ? 31.402  -20.854 -1.842  1.00 43.17  ? 387 GLN A CD    1 
ATOM   2668  O  OE1   . GLN A 1 387 ? 30.657  -20.285 -2.643  1.00 38.03  ? 387 GLN A OE1   1 
ATOM   2669  N  NE2   . GLN A 1 387 ? 32.663  -21.175 -2.136  1.00 42.75  ? 387 GLN A NE2   1 
ATOM   2670  N  N     . GLY A 1 388 ? 31.922  -19.768 4.105   1.00 54.33  ? 388 GLY A N     1 
ATOM   2671  C  CA    . GLY A 1 388 ? 32.829  -19.213 5.101   1.00 46.81  ? 388 GLY A CA    1 
ATOM   2672  C  C     . GLY A 1 388 ? 33.888  -18.273 4.554   1.00 48.69  ? 388 GLY A C     1 
ATOM   2673  O  O     . GLY A 1 388 ? 33.576  -17.221 3.979   1.00 52.28  ? 388 GLY A O     1 
ATOM   2674  N  N     . LEU A 1 389 ? 35.154  -18.641 4.722   1.00 49.64  ? 389 LEU A N     1 
ATOM   2675  C  CA    . LEU A 1 389 ? 36.229  -17.742 4.324   1.00 46.59  ? 389 LEU A CA    1 
ATOM   2676  C  C     . LEU A 1 389 ? 36.328  -17.580 2.810   1.00 45.98  ? 389 LEU A C     1 
ATOM   2677  O  O     . LEU A 1 389 ? 36.805  -16.544 2.325   1.00 44.85  ? 389 LEU A O     1 
ATOM   2678  C  CB    . LEU A 1 389 ? 37.571  -18.221 4.880   1.00 54.92  ? 389 LEU A CB    1 
ATOM   2679  C  CG    . LEU A 1 389 ? 38.095  -17.452 6.096   1.00 61.45  ? 389 LEU A CG    1 
ATOM   2680  C  CD1   . LEU A 1 389 ? 39.440  -18.011 6.545   1.00 56.58  ? 389 LEU A CD1   1 
ATOM   2681  C  CD2   . LEU A 1 389 ? 38.207  -15.966 5.781   1.00 55.43  ? 389 LEU A CD2   1 
ATOM   2682  N  N     . ALA A 1 390 ? 35.856  -18.573 2.058   1.00 42.01  ? 390 ALA A N     1 
ATOM   2683  C  CA    . ALA A 1 390 ? 35.846  -18.439 0.602   1.00 42.70  ? 390 ALA A CA    1 
ATOM   2684  C  C     . ALA A 1 390 ? 34.900  -17.307 0.196   1.00 34.00  ? 390 ALA A C     1 
ATOM   2685  O  O     . ALA A 1 390 ? 35.181  -16.562 -0.738  1.00 39.79  ? 390 ALA A O     1 
ATOM   2686  C  CB    . ALA A 1 390 ? 35.447  -19.759 -0.077  1.00 39.88  ? 390 ALA A CB    1 
ATOM   2687  N  N     . PHE A 1 391 ? 33.785  -17.184 0.908   1.00 34.90  ? 391 PHE A N     1 
ATOM   2688  C  CA    . PHE A 1 391 ? 32.800  -16.125 0.623   1.00 41.45  ? 391 PHE A CA    1 
ATOM   2689  C  C     . PHE A 1 391 ? 33.418  -14.754 0.885   1.00 38.54  ? 391 PHE A C     1 
ATOM   2690  O  O     . PHE A 1 391 ? 33.415  -13.891 0.003   1.00 38.83  ? 391 PHE A O     1 
ATOM   2691  C  CB    . PHE A 1 391 ? 31.523  -16.330 1.459   1.00 40.63  ? 391 PHE A CB    1 
ATOM   2692  C  CG    . PHE A 1 391 ? 30.427  -15.319 1.185   1.00 44.83  ? 391 PHE A CG    1 
ATOM   2693  C  CD1   . PHE A 1 391 ? 29.775  -15.284 -0.048  1.00 35.38  ? 391 PHE A CD1   1 
ATOM   2694  C  CD2   . PHE A 1 391 ? 30.026  -14.425 2.180   1.00 40.22  ? 391 PHE A CD2   1 
ATOM   2695  C  CE1   . PHE A 1 391 ? 28.766  -14.359 -0.298  1.00 36.48  ? 391 PHE A CE1   1 
ATOM   2696  C  CE2   . PHE A 1 391 ? 29.009  -13.495 1.948   1.00 38.83  ? 391 PHE A CE2   1 
ATOM   2697  C  CZ    . PHE A 1 391 ? 28.374  -13.460 0.704   1.00 38.72  ? 391 PHE A CZ    1 
ATOM   2698  N  N     . ARG A 1 392 ? 33.999  -14.574 2.071   1.00 38.92  ? 392 ARG A N     1 
ATOM   2699  C  CA    . ARG A 1 392 ? 34.664  -13.306 2.405   1.00 44.22  ? 392 ARG A CA    1 
ATOM   2700  C  C     . ARG A 1 392 ? 35.724  -12.983 1.373   1.00 41.30  ? 392 ARG A C     1 
ATOM   2701  O  O     . ARG A 1 392 ? 35.838  -11.841 0.935   1.00 40.00  ? 392 ARG A O     1 
ATOM   2702  C  CB    . ARG A 1 392 ? 35.300  -13.351 3.795   1.00 47.09  ? 392 ARG A CB    1 
ATOM   2703  C  CG    . ARG A 1 392 ? 34.288  -13.264 4.941   1.00 53.10  ? 392 ARG A CG    1 
ATOM   2704  C  CD    . ARG A 1 392 ? 34.987  -13.216 6.295   1.00 64.02  ? 392 ARG A CD    1 
ATOM   2705  N  NE    . ARG A 1 392 ? 35.910  -12.083 6.407   1.00 64.31  ? 392 ARG A NE    1 
ATOM   2706  C  CZ    . ARG A 1 392 ? 36.888  -11.998 7.306   1.00 75.42  ? 392 ARG A CZ    1 
ATOM   2707  N  NH1   . ARG A 1 392 ? 37.674  -10.926 7.334   1.00 76.84  ? 392 ARG A NH1   1 
ATOM   2708  N  NH2   . ARG A 1 392 ? 37.095  -12.990 8.165   1.00 71.61  ? 392 ARG A NH2   1 
ATOM   2709  N  N     . GLU A 1 393 ? 36.461  -13.997 0.934   1.00 40.64  ? 393 GLU A N     1 
ATOM   2710  C  CA    . GLU A 1 393 ? 37.518  -13.753 -0.045  1.00 45.36  ? 393 GLU A CA    1 
ATOM   2711  C  C     . GLU A 1 393 ? 36.929  -13.302 -1.382  1.00 46.36  ? 393 GLU A C     1 
ATOM   2712  O  O     . GLU A 1 393 ? 37.471  -12.403 -2.042  1.00 47.86  ? 393 GLU A O     1 
ATOM   2713  C  CB    . GLU A 1 393 ? 38.381  -15.015 -0.236  1.00 42.45  ? 393 GLU A CB    1 
ATOM   2714  C  CG    . GLU A 1 393 ? 39.468  -14.883 -1.294  1.00 49.61  ? 393 GLU A CG    1 
ATOM   2715  C  CD    . GLU A 1 393 ? 40.405  -13.684 -1.058  1.00 68.23  ? 393 GLU A CD    1 
ATOM   2716  O  OE1   . GLU A 1 393 ? 40.840  -13.454 0.103   1.00 64.09  ? 393 GLU A OE1   1 
ATOM   2717  O  OE2   . GLU A 1 393 ? 40.703  -12.966 -2.043  1.00 63.81  ? 393 GLU A OE2   1 
ATOM   2718  N  N     . ALA A 1 394 ? 35.804  -13.891 -1.778  1.00 36.90  ? 394 ALA A N     1 
ATOM   2719  C  CA    . ALA A 1 394 ? 35.208  -13.478 -3.035  1.00 36.22  ? 394 ALA A CA    1 
ATOM   2720  C  C     . ALA A 1 394 ? 34.663  -12.039 -2.915  1.00 32.62  ? 394 ALA A C     1 
ATOM   2721  O  O     . ALA A 1 394 ? 34.709  -11.246 -3.873  1.00 33.16  ? 394 ALA A O     1 
ATOM   2722  C  CB    . ALA A 1 394 ? 34.118  -14.462 -3.452  1.00 33.26  ? 394 ALA A CB    1 
ATOM   2723  N  N     . LEU A 1 395 ? 34.176  -11.692 -1.729  1.00 31.54  ? 395 LEU A N     1 
ATOM   2724  C  CA    . LEU A 1 395 ? 33.732  -10.311 -1.476  1.00 40.20  ? 395 LEU A CA    1 
ATOM   2725  C  C     . LEU A 1 395 ? 34.898  -9.330  -1.600  1.00 39.84  ? 395 LEU A C     1 
ATOM   2726  O  O     . LEU A 1 395 ? 34.804  -8.312  -2.284  1.00 38.91  ? 395 LEU A O     1 
ATOM   2727  C  CB    . LEU A 1 395 ? 33.083  -10.175 -0.091  1.00 34.41  ? 395 LEU A CB    1 
ATOM   2728  C  CG    . LEU A 1 395 ? 31.758  -10.906 0.155   1.00 40.80  ? 395 LEU A CG    1 
ATOM   2729  C  CD1   . LEU A 1 395 ? 31.302  -10.680 1.601   1.00 36.54  ? 395 LEU A CD1   1 
ATOM   2730  C  CD2   . LEU A 1 395 ? 30.675  -10.466 -0.859  1.00 32.41  ? 395 LEU A CD2   1 
ATOM   2731  N  N     . ARG A 1 396 ? 35.995  -9.644  -0.927  1.00 43.57  ? 396 ARG A N     1 
ATOM   2732  C  CA    . ARG A 1 396 ? 37.203  -8.829  -0.993  1.00 39.85  ? 396 ARG A CA    1 
ATOM   2733  C  C     . ARG A 1 396 ? 37.643  -8.653  -2.435  1.00 37.35  ? 396 ARG A C     1 
ATOM   2734  O  O     . ARG A 1 396 ? 37.980  -7.560  -2.869  1.00 39.31  ? 396 ARG A O     1 
ATOM   2735  C  CB    . ARG A 1 396 ? 38.315  -9.477  -0.164  1.00 41.89  ? 396 ARG A CB    1 
ATOM   2736  C  CG    . ARG A 1 396 ? 38.757  -8.654  1.030   1.00 60.35  ? 396 ARG A CG    1 
ATOM   2737  C  CD    . ARG A 1 396 ? 39.554  -9.493  2.019   1.00 63.43  ? 396 ARG A CD    1 
ATOM   2738  N  NE    . ARG A 1 396 ? 38.697  -10.380 2.804   1.00 62.86  ? 396 ARG A NE    1 
ATOM   2739  C  CZ    . ARG A 1 396 ? 39.109  -11.076 3.862   1.00 70.49  ? 396 ARG A CZ    1 
ATOM   2740  N  NH1   . ARG A 1 396 ? 40.370  -10.990 4.269   1.00 76.58  ? 396 ARG A NH1   1 
ATOM   2741  N  NH2   . ARG A 1 396 ? 38.260  -11.860 4.514   1.00 66.18  ? 396 ARG A NH2   1 
ATOM   2742  N  N     . LYS A 1 397 ? 37.598  -9.735  -3.198  1.00 41.07  ? 397 LYS A N     1 
ATOM   2743  C  CA    . LYS A 1 397 ? 37.987  -9.666  -4.601  1.00 40.28  ? 397 LYS A CA    1 
ATOM   2744  C  C     . LYS A 1 397 ? 37.059  -8.763  -5.411  1.00 42.20  ? 397 LYS A C     1 
ATOM   2745  O  O     . LYS A 1 397 ? 37.524  -8.016  -6.275  1.00 39.69  ? 397 LYS A O     1 
ATOM   2746  C  CB    . LYS A 1 397 ? 38.037  -11.069 -5.204  1.00 48.00  ? 397 LYS A CB    1 
ATOM   2747  C  CG    . LYS A 1 397 ? 38.554  -11.112 -6.638  1.00 57.25  ? 397 LYS A CG    1 
ATOM   2748  C  CD    . LYS A 1 397 ? 38.703  -12.552 -7.123  1.00 63.00  ? 397 LYS A CD    1 
ATOM   2749  C  CE    . LYS A 1 397 ? 39.103  -12.626 -8.592  1.00 71.70  ? 397 LYS A CE    1 
ATOM   2750  N  NZ    . LYS A 1 397 ? 39.204  -14.046 -9.077  1.00 71.37  ? 397 LYS A NZ    1 
ATOM   2751  N  N     . ALA A 1 398 ? 35.750  -8.835  -5.143  1.00 41.91  ? 398 ALA A N     1 
ATOM   2752  C  CA    . ALA A 1 398 ? 34.798  -7.958  -5.829  1.00 36.08  ? 398 ALA A CA    1 
ATOM   2753  C  C     . ALA A 1 398 ? 35.077  -6.494  -5.486  1.00 36.76  ? 398 ALA A C     1 
ATOM   2754  O  O     . ALA A 1 398 ? 35.066  -5.617  -6.356  1.00 33.48  ? 398 ALA A O     1 
ATOM   2755  C  CB    . ALA A 1 398 ? 33.369  -8.319  -5.470  1.00 35.49  ? 398 ALA A CB    1 
ATOM   2756  N  N     . LYS A 1 399 ? 35.346  -6.249  -4.213  1.00 35.97  ? 399 LYS A N     1 
ATOM   2757  C  CA    . LYS A 1 399 ? 35.722  -4.921  -3.738  1.00 47.10  ? 399 LYS A CA    1 
ATOM   2758  C  C     . LYS A 1 399 ? 37.004  -4.403  -4.398  1.00 47.90  ? 399 LYS A C     1 
ATOM   2759  O  O     . LYS A 1 399 ? 37.106  -3.212  -4.704  1.00 46.67  ? 399 LYS A O     1 
ATOM   2760  C  CB    . LYS A 1 399 ? 35.911  -4.950  -2.212  1.00 47.72  ? 399 LYS A CB    1 
ATOM   2761  C  CG    . LYS A 1 399 ? 36.345  -3.604  -1.582  1.00 53.58  ? 399 LYS A CG    1 
ATOM   2762  C  CD    . LYS A 1 399 ? 35.325  -2.521  -1.821  1.00 41.49  ? 399 LYS A CD    1 
ATOM   2763  C  CE    . LYS A 1 399 ? 35.703  -1.207  -1.126  1.00 48.33  ? 399 LYS A CE    1 
ATOM   2764  N  NZ    . LYS A 1 399 ? 35.218  -1.179  0.277   1.00 46.46  ? 399 LYS A NZ    1 
ATOM   2765  N  N     . GLU A 1 400 ? 37.948  -5.303  -4.667  1.00 40.60  ? 400 GLU A N     1 
ATOM   2766  C  CA    . GLU A 1 400 ? 39.195  -4.910  -5.334  1.00 50.12  ? 400 GLU A CA    1 
ATOM   2767  C  C     . GLU A 1 400 ? 38.878  -4.513  -6.769  1.00 47.99  ? 400 GLU A C     1 
ATOM   2768  O  O     . GLU A 1 400 ? 39.447  -3.559  -7.293  1.00 54.42  ? 400 GLU A O     1 
ATOM   2769  C  CB    . GLU A 1 400 ? 40.241  -6.038  -5.314  1.00 46.20  ? 400 GLU A CB    1 
ATOM   2770  C  CG    . GLU A 1 400 ? 40.681  -6.475  -3.919  1.00 47.10  ? 400 GLU A CG    1 
ATOM   2771  C  CD    . GLU A 1 400 ? 41.661  -7.660  -3.925  1.00 67.23  ? 400 GLU A CD    1 
ATOM   2772  O  OE1   . GLU A 1 400 ? 42.112  -8.059  -2.826  1.00 66.46  ? 400 GLU A OE1   1 
ATOM   2773  O  OE2   . GLU A 1 400 ? 41.976  -8.198  -5.016  1.00 70.18  ? 400 GLU A OE2   1 
ATOM   2774  N  N     . GLU A 1 401 ? 37.979  -5.256  -7.410  1.00 46.07  ? 401 GLU A N     1 
ATOM   2775  C  CA    . GLU A 1 401 ? 37.668  -5.003  -8.814  1.00 46.35  ? 401 GLU A CA    1 
ATOM   2776  C  C     . GLU A 1 401 ? 36.772  -3.789  -9.008  1.00 43.85  ? 401 GLU A C     1 
ATOM   2777  O  O     . GLU A 1 401 ? 36.413  -3.458  -10.138 1.00 48.60  ? 401 GLU A O     1 
ATOM   2778  C  CB    . GLU A 1 401 ? 37.036  -6.239  -9.447  1.00 53.49  ? 401 GLU A CB    1 
ATOM   2779  C  CG    . GLU A 1 401 ? 38.016  -7.401  -9.594  1.00 59.22  ? 401 GLU A CG    1 
ATOM   2780  C  CD    . GLU A 1 401 ? 37.423  -8.590  -10.334 1.00 74.34  ? 401 GLU A CD    1 
ATOM   2781  O  OE1   . GLU A 1 401 ? 36.495  -8.391  -11.156 1.00 76.91  ? 401 GLU A OE1   1 
ATOM   2782  O  OE2   . GLU A 1 401 ? 37.902  -9.724  -10.099 1.00 73.12  ? 401 GLU A OE2   1 
ATOM   2783  N  N     . GLY A 1 402 ? 36.413  -3.130  -7.909  1.00 42.56  ? 402 GLY A N     1 
ATOM   2784  C  CA    . GLY A 1 402 ? 35.711  -1.861  -7.986  1.00 43.07  ? 402 GLY A CA    1 
ATOM   2785  C  C     . GLY A 1 402 ? 34.218  -1.897  -7.697  1.00 44.47  ? 402 GLY A C     1 
ATOM   2786  O  O     . GLY A 1 402 ? 33.525  -0.921  -7.930  1.00 41.46  ? 402 GLY A O     1 
ATOM   2787  N  N     . VAL A 1 403 ? 33.729  -3.003  -7.155  1.00 37.77  ? 403 VAL A N     1 
ATOM   2788  C  CA    . VAL A 1 403 ? 32.317  -3.103  -6.823  1.00 44.14  ? 403 VAL A CA    1 
ATOM   2789  C  C     . VAL A 1 403 ? 32.002  -2.220  -5.627  1.00 41.33  ? 403 VAL A C     1 
ATOM   2790  O  O     . VAL A 1 403 ? 32.675  -2.300  -4.614  1.00 37.46  ? 403 VAL A O     1 
ATOM   2791  C  CB    . VAL A 1 403 ? 31.897  -4.560  -6.530  1.00 39.80  ? 403 VAL A CB    1 
ATOM   2792  C  CG1   . VAL A 1 403 ? 30.510  -4.603  -5.873  1.00 38.97  ? 403 VAL A CG1   1 
ATOM   2793  C  CG2   . VAL A 1 403 ? 31.944  -5.390  -7.818  1.00 33.41  ? 403 VAL A CG2   1 
ATOM   2794  N  N     . GLN A 1 404 ? 30.979  -1.376  -5.757  1.00 42.27  ? 404 GLN A N     1 
ATOM   2795  C  CA    . GLN A 1 404 ? 30.643  -0.406  -4.717  1.00 37.00  ? 404 GLN A CA    1 
ATOM   2796  C  C     . GLN A 1 404 ? 29.485  -0.834  -3.816  1.00 39.06  ? 404 GLN A C     1 
ATOM   2797  O  O     . GLN A 1 404 ? 29.387  -0.371  -2.685  1.00 35.66  ? 404 GLN A O     1 
ATOM   2798  C  CB    . GLN A 1 404 ? 30.304  0.947   -5.356  1.00 37.05  ? 404 GLN A CB    1 
ATOM   2799  C  CG    . GLN A 1 404 ? 31.532  1.698   -5.882  1.00 45.94  ? 404 GLN A CG    1 
ATOM   2800  C  CD    . GLN A 1 404 ? 31.195  2.643   -7.018  1.00 52.32  ? 404 GLN A CD    1 
ATOM   2801  O  OE1   . GLN A 1 404 ? 30.410  2.309   -7.903  1.00 52.68  ? 404 GLN A OE1   1 
ATOM   2802  N  NE2   . GLN A 1 404 ? 31.804  3.826   -7.008  1.00 56.02  ? 404 GLN A NE2   1 
ATOM   2803  N  N     . ALA A 1 405 ? 28.596  -1.696  -4.314  1.00 34.25  ? 405 ALA A N     1 
ATOM   2804  C  CA    . ALA A 1 405 ? 27.437  -2.106  -3.525  1.00 29.44  ? 405 ALA A CA    1 
ATOM   2805  C  C     . ALA A 1 405 ? 26.872  -3.381  -4.097  1.00 33.74  ? 405 ALA A C     1 
ATOM   2806  O  O     . ALA A 1 405 ? 27.076  -3.679  -5.296  1.00 30.60  ? 405 ALA A O     1 
ATOM   2807  C  CB    . ALA A 1 405 ? 26.355  -0.983  -3.512  1.00 30.12  ? 405 ALA A CB    1 
ATOM   2808  N  N     . VAL A 1 406 ? 26.173  -4.155  -3.270  1.00 33.30  ? 406 VAL A N     1 
ATOM   2809  C  CA    . VAL A 1 406 ? 25.603  -5.369  -3.815  1.00 33.60  ? 406 VAL A CA    1 
ATOM   2810  C  C     . VAL A 1 406 ? 24.095  -5.468  -3.592  1.00 34.28  ? 406 VAL A C     1 
ATOM   2811  O  O     . VAL A 1 406 ? 23.550  -5.170  -2.529  1.00 30.52  ? 406 VAL A O     1 
ATOM   2812  C  CB    . VAL A 1 406 ? 26.319  -6.670  -3.287  1.00 36.31  ? 406 VAL A CB    1 
ATOM   2813  C  CG1   . VAL A 1 406 ? 27.744  -6.390  -2.795  1.00 39.74  ? 406 VAL A CG1   1 
ATOM   2814  C  CG2   . VAL A 1 406 ? 25.506  -7.426  -2.274  1.00 36.66  ? 406 VAL A CG2   1 
ATOM   2815  N  N     . LEU A 1 407 ? 23.435  -5.915  -4.641  1.00 29.96  ? 407 LEU A N     1 
ATOM   2816  C  CA    . LEU A 1 407 ? 22.023  -6.175  -4.620  1.00 33.46  ? 407 LEU A CA    1 
ATOM   2817  C  C     . LEU A 1 407 ? 21.865  -7.641  -4.289  1.00 34.39  ? 407 LEU A C     1 
ATOM   2818  O  O     . LEU A 1 407 ? 22.438  -8.491  -4.960  1.00 34.62  ? 407 LEU A O     1 
ATOM   2819  C  CB    . LEU A 1 407 ? 21.403  -5.843  -5.979  1.00 30.04  ? 407 LEU A CB    1 
ATOM   2820  C  CG    . LEU A 1 407 ? 19.897  -6.129  -6.071  1.00 36.08  ? 407 LEU A CG    1 
ATOM   2821  C  CD1   . LEU A 1 407 ? 19.150  -5.250  -5.064  1.00 28.88  ? 407 LEU A CD1   1 
ATOM   2822  C  CD2   . LEU A 1 407 ? 19.413  -5.904  -7.492  1.00 30.88  ? 407 LEU A CD2   1 
ATOM   2823  N  N     . VAL A 1 408 ? 21.116  -7.918  -3.227  1.00 31.71  ? 408 VAL A N     1 
ATOM   2824  C  CA    . VAL A 1 408 ? 20.890  -9.262  -2.739  1.00 32.44  ? 408 VAL A CA    1 
ATOM   2825  C  C     . VAL A 1 408 ? 19.447  -9.673  -3.123  1.00 40.46  ? 408 VAL A C     1 
ATOM   2826  O  O     . VAL A 1 408 ? 18.470  -9.178  -2.556  1.00 35.20  ? 408 VAL A O     1 
ATOM   2827  C  CB    . VAL A 1 408 ? 21.086  -9.341  -1.201  1.00 34.25  ? 408 VAL A CB    1 
ATOM   2828  C  CG1   . VAL A 1 408 ? 20.932  -10.777 -0.702  1.00 32.94  ? 408 VAL A CG1   1 
ATOM   2829  C  CG2   . VAL A 1 408 ? 22.459  -8.788  -0.774  1.00 35.36  ? 408 VAL A CG2   1 
ATOM   2830  N  N     . LEU A 1 409 ? 19.313  -10.525 -4.131  1.00 39.09  ? 409 LEU A N     1 
ATOM   2831  C  CA    . LEU A 1 409 ? 18.001  -11.078 -4.492  1.00 40.17  ? 409 LEU A CA    1 
ATOM   2832  C  C     . LEU A 1 409 ? 17.750  -12.312 -3.656  1.00 39.55  ? 409 LEU A C     1 
ATOM   2833  O  O     . LEU A 1 409 ? 18.454  -13.329 -3.817  1.00 40.84  ? 409 LEU A O     1 
ATOM   2834  C  CB    . LEU A 1 409 ? 17.929  -11.417 -5.978  1.00 43.39  ? 409 LEU A CB    1 
ATOM   2835  C  CG    . LEU A 1 409 ? 17.742  -10.305 -7.000  1.00 44.87  ? 409 LEU A CG    1 
ATOM   2836  C  CD1   . LEU A 1 409 ? 17.582  -10.920 -8.376  1.00 44.58  ? 409 LEU A CD1   1 
ATOM   2837  C  CD2   . LEU A 1 409 ? 16.499  -9.481  -6.650  1.00 44.84  ? 409 LEU A CD2   1 
ATOM   2838  N  N     . THR A 1 410 ? 16.793  -12.236 -2.735  1.00 31.69  ? 410 THR A N     1 
ATOM   2839  C  CA    . THR A 1 410 ? 16.615  -13.376 -1.802  1.00 36.33  ? 410 THR A CA    1 
ATOM   2840  C  C     . THR A 1 410 ? 15.159  -13.621 -1.388  1.00 40.94  ? 410 THR A C     1 
ATOM   2841  O  O     . THR A 1 410 ? 14.362  -12.698 -1.374  1.00 41.41  ? 410 THR A O     1 
ATOM   2842  C  CB    . THR A 1 410 ? 17.458  -13.173 -0.531  1.00 36.93  ? 410 THR A CB    1 
ATOM   2843  O  OG1   . THR A 1 410 ? 17.169  -14.197 0.430   1.00 35.33  ? 410 THR A OG1   1 
ATOM   2844  C  CG2   . THR A 1 410 ? 17.167  -11.807 0.113   1.00 30.81  ? 410 THR A CG2   1 
ATOM   2845  N  N     . PRO A 1 411 ? 14.800  -14.869 -1.050  1.00 44.48  ? 411 PRO A N     1 
ATOM   2846  C  CA    . PRO A 1 411 ? 13.496  -14.953 -0.385  1.00 43.89  ? 411 PRO A CA    1 
ATOM   2847  C  C     . PRO A 1 411 ? 13.577  -14.191 0.941   1.00 47.93  ? 411 PRO A C     1 
ATOM   2848  O  O     . PRO A 1 411 ? 14.694  -14.029 1.468   1.00 43.17  ? 411 PRO A O     1 
ATOM   2849  C  CB    . PRO A 1 411 ? 13.292  -16.468 -0.163  1.00 44.41  ? 411 PRO A CB    1 
ATOM   2850  C  CG    . PRO A 1 411 ? 14.242  -17.139 -1.126  1.00 50.28  ? 411 PRO A CG    1 
ATOM   2851  C  CD    . PRO A 1 411 ? 15.424  -16.197 -1.233  1.00 41.17  ? 411 PRO A CD    1 
ATOM   2852  N  N     . PRO A 1 412 ? 12.427  -13.750 1.478   1.00 45.55  ? 412 PRO A N     1 
ATOM   2853  C  CA    . PRO A 1 412 ? 12.389  -13.061 2.777   1.00 45.85  ? 412 PRO A CA    1 
ATOM   2854  C  C     . PRO A 1 412 ? 13.305  -13.713 3.812   1.00 48.78  ? 412 PRO A C     1 
ATOM   2855  O  O     . PRO A 1 412 ? 13.165  -14.901 4.065   1.00 47.41  ? 412 PRO A O     1 
ATOM   2856  C  CB    . PRO A 1 412 ? 10.920  -13.189 3.198   1.00 41.66  ? 412 PRO A CB    1 
ATOM   2857  C  CG    . PRO A 1 412 ? 10.173  -13.230 1.901   1.00 42.21  ? 412 PRO A CG    1 
ATOM   2858  C  CD    . PRO A 1 412 ? 11.077  -13.951 0.915   1.00 44.48  ? 412 PRO A CD    1 
ATOM   2859  N  N     . MET A 1 413 ? 14.247  -12.957 4.371   1.00 43.58  ? 413 MET A N     1 
ATOM   2860  C  CA    . MET A 1 413 ? 15.191  -13.505 5.326   1.00 46.75  ? 413 MET A CA    1 
ATOM   2861  C  C     . MET A 1 413 ? 14.666  -13.369 6.739   1.00 53.48  ? 413 MET A C     1 
ATOM   2862  O  O     . MET A 1 413 ? 13.939  -12.429 7.045   1.00 49.86  ? 413 MET A O     1 
ATOM   2863  C  CB    . MET A 1 413 ? 16.545  -12.802 5.219   1.00 45.27  ? 413 MET A CB    1 
ATOM   2864  C  CG    . MET A 1 413 ? 17.159  -12.859 3.834   1.00 47.46  ? 413 MET A CG    1 
ATOM   2865  S  SD    . MET A 1 413 ? 18.776  -12.084 3.744   1.00 43.67  ? 413 MET A SD    1 
ATOM   2866  C  CE    . MET A 1 413 ? 19.808  -13.323 4.556   1.00 44.72  ? 413 MET A CE    1 
ATOM   2867  N  N     . ALA A 1 414 ? 15.036  -14.313 7.597   1.00 48.28  ? 414 ALA A N     1 
ATOM   2868  C  CA    . ALA A 1 414 ? 14.808  -14.163 9.019   1.00 50.69  ? 414 ALA A CA    1 
ATOM   2869  C  C     . ALA A 1 414 ? 15.710  -13.042 9.535   1.00 54.66  ? 414 ALA A C     1 
ATOM   2870  O  O     . ALA A 1 414 ? 16.852  -12.864 9.067   1.00 49.82  ? 414 ALA A O     1 
ATOM   2871  C  CB    . ALA A 1 414 ? 15.085  -15.483 9.767   1.00 44.39  ? 414 ALA A CB    1 
ATOM   2872  N  N     . TRP A 1 415 ? 15.203  -12.306 10.518  1.00 55.58  ? 415 TRP A N     1 
ATOM   2873  C  CA    . TRP A 1 415 ? 15.847  -11.093 11.003  1.00 56.78  ? 415 TRP A CA    1 
ATOM   2874  C  C     . TRP A 1 415 ? 17.336  -11.319 11.309  1.00 54.24  ? 415 TRP A C     1 
ATOM   2875  O  O     . TRP A 1 415 ? 18.211  -10.520 10.950  1.00 54.98  ? 415 TRP A O     1 
ATOM   2876  C  CB    . TRP A 1 415 ? 15.149  -10.610 12.266  1.00 56.08  ? 415 TRP A CB    1 
ATOM   2877  C  CG    . TRP A 1 415 ? 15.256  -9.154  12.442  1.00 66.48  ? 415 TRP A CG    1 
ATOM   2878  C  CD1   . TRP A 1 415 ? 15.149  -8.200  11.469  1.00 63.99  ? 415 TRP A CD1   1 
ATOM   2879  C  CD2   . TRP A 1 415 ? 15.645  -8.470  13.633  1.00 70.81  ? 415 TRP A CD2   1 
ATOM   2880  N  NE1   . TRP A 1 415 ? 15.357  -6.953  12.006  1.00 70.54  ? 415 TRP A NE1   1 
ATOM   2881  C  CE2   . TRP A 1 415 ? 15.677  -7.093  13.334  1.00 71.29  ? 415 TRP A CE2   1 
ATOM   2882  C  CE3   . TRP A 1 415 ? 15.939  -8.885  14.936  1.00 75.40  ? 415 TRP A CE3   1 
ATOM   2883  C  CZ2   . TRP A 1 415 ? 15.988  -6.127  14.291  1.00 72.86  ? 415 TRP A CZ2   1 
ATOM   2884  C  CZ3   . TRP A 1 415 ? 16.246  -7.928  15.885  1.00 76.65  ? 415 TRP A CZ3   1 
ATOM   2885  C  CH2   . TRP A 1 415 ? 16.271  -6.565  15.557  1.00 76.80  ? 415 TRP A CH2   1 
ATOM   2886  N  N     . GLU A 1 416 ? 17.601  -12.424 11.990  1.00 54.26  ? 416 GLU A N     1 
ATOM   2887  C  CA    . GLU A 1 416 ? 18.938  -12.809 12.414  1.00 53.97  ? 416 GLU A CA    1 
ATOM   2888  C  C     . GLU A 1 416 ? 19.873  -13.021 11.217  1.00 50.04  ? 416 GLU A C     1 
ATOM   2889  O  O     . GLU A 1 416 ? 21.034  -12.595 11.226  1.00 51.75  ? 416 GLU A O     1 
ATOM   2890  C  CB    . GLU A 1 416 ? 18.839  -14.085 13.249  1.00 65.20  ? 416 GLU A CB    1 
ATOM   2891  C  CG    . GLU A 1 416 ? 20.118  -14.534 13.929  1.00 70.08  ? 416 GLU A CG    1 
ATOM   2892  C  CD    . GLU A 1 416 ? 19.958  -15.902 14.591  1.00 78.59  ? 416 GLU A CD    1 
ATOM   2893  O  OE1   . GLU A 1 416 ? 19.006  -16.636 14.232  1.00 75.48  ? 416 GLU A OE1   1 
ATOM   2894  O  OE2   . GLU A 1 416 ? 20.776  -16.239 15.475  1.00 83.21  ? 416 GLU A OE2   1 
ATOM   2895  N  N     . ASP A 1 417 ? 19.356  -13.707 10.201  1.00 51.53  ? 417 ASP A N     1 
ATOM   2896  C  CA    . ASP A 1 417 ? 20.103  -13.977 8.977   1.00 50.31  ? 417 ASP A CA    1 
ATOM   2897  C  C     . ASP A 1 417 ? 20.347  -12.706 8.169   1.00 47.37  ? 417 ASP A C     1 
ATOM   2898  O  O     . ASP A 1 417 ? 21.432  -12.502 7.621   1.00 45.38  ? 417 ASP A O     1 
ATOM   2899  C  CB    . ASP A 1 417 ? 19.355  -15.012 8.126   1.00 45.20  ? 417 ASP A CB    1 
ATOM   2900  C  CG    . ASP A 1 417 ? 19.234  -16.361 8.829   1.00 55.04  ? 417 ASP A CG    1 
ATOM   2901  O  OD1   . ASP A 1 417 ? 20.128  -16.675 9.641   1.00 56.45  ? 417 ASP A OD1   1 
ATOM   2902  O  OD2   . ASP A 1 417 ? 18.254  -17.102 8.579   1.00 54.16  ? 417 ASP A OD2   1 
ATOM   2903  N  N     . ARG A 1 418 ? 19.317  -11.867 8.093   1.00 46.66  ? 418 ARG A N     1 
ATOM   2904  C  CA    . ARG A 1 418 ? 19.417  -10.567 7.458   1.00 44.93  ? 418 ARG A CA    1 
ATOM   2905  C  C     . ARG A 1 418 ? 20.566  -9.788  8.085   1.00 39.60  ? 418 ARG A C     1 
ATOM   2906  O  O     . ARG A 1 418 ? 21.460  -9.307  7.388   1.00 39.76  ? 418 ARG A O     1 
ATOM   2907  C  CB    . ARG A 1 418 ? 18.088  -9.808  7.583   1.00 44.11  ? 418 ARG A CB    1 
ATOM   2908  C  CG    . ARG A 1 418 ? 18.071  -8.423  6.934   1.00 40.70  ? 418 ARG A CG    1 
ATOM   2909  C  CD    . ARG A 1 418 ? 18.403  -7.315  7.918   1.00 42.74  ? 418 ARG A CD    1 
ATOM   2910  N  NE    . ARG A 1 418 ? 18.238  -5.993  7.318   1.00 44.25  ? 418 ARG A NE    1 
ATOM   2911  C  CZ    . ARG A 1 418 ? 18.636  -4.853  7.882   1.00 44.25  ? 418 ARG A CZ    1 
ATOM   2912  N  NH1   . ARG A 1 418 ? 19.222  -4.869  9.069   1.00 40.47  ? 418 ARG A NH1   1 
ATOM   2913  N  NH2   . ARG A 1 418 ? 18.431  -3.692  7.264   1.00 39.40  ? 418 ARG A NH2   1 
ATOM   2914  N  N     . ASN A 1 419 ? 20.541  -9.674  9.409   1.00 39.32  ? 419 ASN A N     1 
ATOM   2915  C  CA    . ASN A 1 419 ? 21.568  -8.905  10.089  1.00 41.34  ? 419 ASN A CA    1 
ATOM   2916  C  C     . ASN A 1 419 ? 22.954  -9.525  9.940   1.00 44.36  ? 419 ASN A C     1 
ATOM   2917  O  O     . ASN A 1 419 ? 23.942  -8.797  9.734   1.00 40.93  ? 419 ASN A O     1 
ATOM   2918  C  CB    . ASN A 1 419 ? 21.213  -8.713  11.567  1.00 43.32  ? 419 ASN A CB    1 
ATOM   2919  C  CG    . ASN A 1 419 ? 19.956  -7.855  11.751  1.00 49.57  ? 419 ASN A CG    1 
ATOM   2920  O  OD1   . ASN A 1 419 ? 19.654  -7.006  10.915  1.00 44.91  ? 419 ASN A OD1   1 
ATOM   2921  N  ND2   . ASN A 1 419 ? 19.223  -8.081  12.839  1.00 46.50  ? 419 ASN A ND2   1 
ATOM   2922  N  N     . ARG A 1 420 ? 23.034  -10.858 9.983   1.00 43.98  ? 420 ARG A N     1 
ATOM   2923  C  CA    . ARG A 1 420 ? 24.336  -11.528 9.804   1.00 44.25  ? 420 ARG A CA    1 
ATOM   2924  C  C     . ARG A 1 420 ? 24.922  -11.249 8.421   1.00 38.35  ? 420 ARG A C     1 
ATOM   2925  O  O     . ARG A 1 420 ? 26.086  -10.859 8.293   1.00 44.70  ? 420 ARG A O     1 
ATOM   2926  C  CB    . ARG A 1 420 ? 24.221  -13.040 9.989   1.00 44.13  ? 420 ARG A CB    1 
ATOM   2927  C  CG    . ARG A 1 420 ? 25.580  -13.747 9.949   1.00 55.55  ? 420 ARG A CG    1 
ATOM   2928  C  CD    . ARG A 1 420 ? 25.441  -15.230 10.295  1.00 67.92  ? 420 ARG A CD    1 
ATOM   2929  N  NE    . ARG A 1 420 ? 24.757  -15.427 11.568  1.00 69.66  ? 420 ARG A NE    1 
ATOM   2930  C  CZ    . ARG A 1 420 ? 23.520  -15.902 11.678  1.00 66.25  ? 420 ARG A CZ    1 
ATOM   2931  N  NH1   . ARG A 1 420 ? 22.830  -16.232 10.589  1.00 60.96  ? 420 ARG A NH1   1 
ATOM   2932  N  NH2   . ARG A 1 420 ? 22.971  -16.042 12.876  1.00 73.96  ? 420 ARG A NH2   1 
ATOM   2933  N  N     . LEU A 1 421 ? 24.115  -11.472 7.380   1.00 41.12  ? 421 LEU A N     1 
ATOM   2934  C  CA    . LEU A 1 421 ? 24.579  -11.265 6.011   1.00 38.59  ? 421 LEU A CA    1 
ATOM   2935  C  C     . LEU A 1 421 ? 24.948  -9.806  5.756   1.00 39.40  ? 421 LEU A C     1 
ATOM   2936  O  O     . LEU A 1 421 ? 26.002  -9.521  5.167   1.00 40.14  ? 421 LEU A O     1 
ATOM   2937  C  CB    . LEU A 1 421 ? 23.523  -11.718 5.004   1.00 36.13  ? 421 LEU A CB    1 
ATOM   2938  C  CG    . LEU A 1 421 ? 23.980  -11.547 3.547   1.00 36.15  ? 421 LEU A CG    1 
ATOM   2939  C  CD1   . LEU A 1 421 ? 25.179  -12.438 3.208   1.00 32.76  ? 421 LEU A CD1   1 
ATOM   2940  C  CD2   . LEU A 1 421 ? 22.859  -11.761 2.571   1.00 28.55  ? 421 LEU A CD2   1 
ATOM   2941  N  N     . LYS A 1 422 ? 24.109  -8.877  6.217   1.00 35.78  ? 422 LYS A N     1 
ATOM   2942  C  CA    . LYS A 1 422 ? 24.435  -7.462  6.032   1.00 37.51  ? 422 LYS A CA    1 
ATOM   2943  C  C     . LYS A 1 422 ? 25.747  -7.088  6.735   1.00 40.59  ? 422 LYS A C     1 
ATOM   2944  O  O     . LYS A 1 422 ? 26.610  -6.435  6.136   1.00 34.89  ? 422 LYS A O     1 
ATOM   2945  C  CB    . LYS A 1 422 ? 23.286  -6.558  6.499   1.00 34.01  ? 422 LYS A CB    1 
ATOM   2946  C  CG    . LYS A 1 422 ? 22.141  -6.460  5.492   1.00 40.91  ? 422 LYS A CG    1 
ATOM   2947  C  CD    . LYS A 1 422 ? 21.300  -5.240  5.764   1.00 45.23  ? 422 LYS A CD    1 
ATOM   2948  C  CE    . LYS A 1 422 ? 20.433  -4.885  4.582   1.00 38.24  ? 422 LYS A CE    1 
ATOM   2949  N  NZ    . LYS A 1 422 ? 21.131  -4.017  3.597   1.00 34.96  ? 422 LYS A NZ    1 
ATOM   2950  N  N     . ALA A 1 423 ? 25.907  -7.505  7.991   1.00 39.27  ? 423 ALA A N     1 
ATOM   2951  C  CA    . ALA A 1 423 ? 27.132  -7.172  8.719   1.00 41.96  ? 423 ALA A CA    1 
ATOM   2952  C  C     . ALA A 1 423 ? 28.350  -7.781  8.008   1.00 42.44  ? 423 ALA A C     1 
ATOM   2953  O  O     . ALA A 1 423 ? 29.403  -7.149  7.879   1.00 46.49  ? 423 ALA A O     1 
ATOM   2954  C  CB    . ALA A 1 423 ? 27.045  -7.644  10.157  1.00 45.70  ? 423 ALA A CB    1 
ATOM   2955  N  N     . LEU A 1 424 ? 28.184  -9.005  7.519   1.00 46.06  ? 424 LEU A N     1 
ATOM   2956  C  CA    . LEU A 1 424 ? 29.258  -9.700  6.804   1.00 43.63  ? 424 LEU A CA    1 
ATOM   2957  C  C     . LEU A 1 424 ? 29.671  -8.941  5.543   1.00 40.47  ? 424 LEU A C     1 
ATOM   2958  O  O     . LEU A 1 424 ? 30.866  -8.824  5.253   1.00 37.65  ? 424 LEU A O     1 
ATOM   2959  C  CB    . LEU A 1 424 ? 28.824  -11.122 6.442   1.00 39.91  ? 424 LEU A CB    1 
ATOM   2960  C  CG    . LEU A 1 424 ? 29.793  -12.109 5.799   1.00 50.26  ? 424 LEU A CG    1 
ATOM   2961  C  CD1   . LEU A 1 424 ? 30.984  -12.337 6.712   1.00 58.34  ? 424 LEU A CD1   1 
ATOM   2962  C  CD2   . LEU A 1 424 ? 29.087  -13.437 5.518   1.00 51.40  ? 424 LEU A CD2   1 
ATOM   2963  N  N     . LEU A 1 425 ? 28.695  -8.449  4.773   1.00 35.10  ? 425 LEU A N     1 
ATOM   2964  C  CA    . LEU A 1 425 ? 29.047  -7.689  3.580   1.00 35.26  ? 425 LEU A CA    1 
ATOM   2965  C  C     . LEU A 1 425 ? 29.731  -6.370  3.963   1.00 37.75  ? 425 LEU A C     1 
ATOM   2966  O  O     . LEU A 1 425 ? 30.728  -5.956  3.342   1.00 33.65  ? 425 LEU A O     1 
ATOM   2967  C  CB    . LEU A 1 425 ? 27.809  -7.420  2.718   1.00 35.24  ? 425 LEU A CB    1 
ATOM   2968  C  CG    . LEU A 1 425 ? 27.100  -8.683  2.220   1.00 47.84  ? 425 LEU A CG    1 
ATOM   2969  C  CD1   . LEU A 1 425 ? 25.928  -8.351  1.302   1.00 38.37  ? 425 LEU A CD1   1 
ATOM   2970  C  CD2   . LEU A 1 425 ? 28.052  -9.599  1.542   1.00 39.36  ? 425 LEU A CD2   1 
ATOM   2971  N  N     . LEU A 1 426 ? 29.212  -5.737  5.014   1.00 38.30  ? 426 LEU A N     1 
ATOM   2972  C  CA    . LEU A 1 426 ? 29.709  -4.431  5.453   1.00 45.96  ? 426 LEU A CA    1 
ATOM   2973  C  C     . LEU A 1 426 ? 31.166  -4.474  5.937   1.00 40.70  ? 426 LEU A C     1 
ATOM   2974  O  O     . LEU A 1 426 ? 31.977  -3.617  5.573   1.00 39.76  ? 426 LEU A O     1 
ATOM   2975  C  CB    . LEU A 1 426 ? 28.811  -3.886  6.555   1.00 38.13  ? 426 LEU A CB    1 
ATOM   2976  C  CG    . LEU A 1 426 ? 28.685  -2.370  6.580   1.00 52.58  ? 426 LEU A CG    1 
ATOM   2977  C  CD1   . LEU A 1 426 ? 28.130  -1.886  5.241   1.00 42.58  ? 426 LEU A CD1   1 
ATOM   2978  C  CD2   . LEU A 1 426 ? 27.762  -1.936  7.718   1.00 52.37  ? 426 LEU A CD2   1 
ATOM   2979  N  N     . ARG A 1 427 ? 31.503  -5.491  6.722   1.00 43.74  ? 427 ARG A N     1 
ATOM   2980  C  CA    . ARG A 1 427 ? 32.867  -5.619  7.249   1.00 49.54  ? 427 ARG A CA    1 
ATOM   2981  C  C     . ARG A 1 427 ? 33.882  -5.817  6.126   1.00 44.52  ? 427 ARG A C     1 
ATOM   2982  O  O     . ARG A 1 427 ? 35.061  -5.568  6.311   1.00 49.84  ? 427 ARG A O     1 
ATOM   2983  C  CB    . ARG A 1 427 ? 32.943  -6.757  8.268   1.00 52.83  ? 427 ARG A CB    1 
ATOM   2984  C  CG    . ARG A 1 427 ? 32.197  -6.424  9.564   1.00 63.09  ? 427 ARG A CG    1 
ATOM   2985  C  CD    . ARG A 1 427 ? 32.484  -7.428  10.672  1.00 72.82  ? 427 ARG A CD    1 
ATOM   2986  N  NE    . ARG A 1 427 ? 31.992  -8.758  10.322  1.00 68.83  ? 427 ARG A NE    1 
ATOM   2987  C  CZ    . ARG A 1 427 ? 30.854  -9.281  10.767  1.00 67.70  ? 427 ARG A CZ    1 
ATOM   2988  N  NH1   . ARG A 1 427 ? 30.076  -8.588  11.597  1.00 69.12  ? 427 ARG A NH1   1 
ATOM   2989  N  NH2   . ARG A 1 427 ? 30.494  -10.500 10.384  1.00 62.05  ? 427 ARG A NH2   1 
ATOM   2990  N  N     . GLU A 1 428 ? 33.427  -6.275  4.964   1.00 45.04  ? 428 GLU A N     1 
ATOM   2991  C  CA    . GLU A 1 428 ? 34.307  -6.328  3.801   1.00 37.99  ? 428 GLU A CA    1 
ATOM   2992  C  C     . GLU A 1 428 ? 34.128  -5.094  2.921   1.00 39.17  ? 428 GLU A C     1 
ATOM   2993  O  O     . GLU A 1 428 ? 34.485  -5.115  1.748   1.00 43.08  ? 428 GLU A O     1 
ATOM   2994  C  CB    . GLU A 1 428 ? 34.072  -7.601  2.984   1.00 44.93  ? 428 GLU A CB    1 
ATOM   2995  C  CG    . GLU A 1 428 ? 34.239  -8.891  3.787   1.00 45.06  ? 428 GLU A CG    1 
ATOM   2996  C  CD    . GLU A 1 428 ? 35.623  -9.026  4.415   1.00 53.69  ? 428 GLU A CD    1 
ATOM   2997  O  OE1   . GLU A 1 428 ? 36.617  -8.553  3.817   1.00 47.45  ? 428 GLU A OE1   1 
ATOM   2998  O  OE2   . GLU A 1 428 ? 35.710  -9.615  5.518   1.00 54.88  ? 428 GLU A OE2   1 
ATOM   2999  N  N     . GLY A 1 429 ? 33.525  -4.037  3.459   1.00 38.79  ? 429 GLY A N     1 
ATOM   3000  C  CA    . GLY A 1 429 ? 33.377  -2.801  2.708   1.00 37.75  ? 429 GLY A CA    1 
ATOM   3001  C  C     . GLY A 1 429 ? 32.302  -2.744  1.639   1.00 42.42  ? 429 GLY A C     1 
ATOM   3002  O  O     . GLY A 1 429 ? 32.368  -1.910  0.733   1.00 37.54  ? 429 GLY A O     1 
ATOM   3003  N  N     . LEU A 1 430 ? 31.295  -3.610  1.744   1.00 35.30  ? 430 LEU A N     1 
ATOM   3004  C  CA    . LEU A 1 430 ? 30.256  -3.637  0.731   1.00 32.43  ? 430 LEU A CA    1 
ATOM   3005  C  C     . LEU A 1 430 ? 28.862  -3.444  1.329   1.00 38.47  ? 430 LEU A C     1 
ATOM   3006  O  O     . LEU A 1 430 ? 28.318  -4.338  1.998   1.00 33.05  ? 430 LEU A O     1 
ATOM   3007  C  CB    . LEU A 1 430 ? 30.324  -4.943  -0.063  1.00 42.24  ? 430 LEU A CB    1 
ATOM   3008  C  CG    . LEU A 1 430 ? 31.539  -5.077  -0.998  1.00 44.47  ? 430 LEU A CG    1 
ATOM   3009  C  CD1   . LEU A 1 430 ? 31.695  -6.502  -1.542  1.00 38.64  ? 430 LEU A CD1   1 
ATOM   3010  C  CD2   . LEU A 1 430 ? 31.399  -4.089  -2.146  1.00 41.79  ? 430 LEU A CD2   1 
ATOM   3011  N  N     . PRO A 1 431 ? 28.295  -2.251  1.114   1.00 36.70  ? 431 PRO A N     1 
ATOM   3012  C  CA    . PRO A 1 431 ? 26.900  -2.010  1.469   1.00 37.25  ? 431 PRO A CA    1 
ATOM   3013  C  C     . PRO A 1 431 ? 26.010  -2.916  0.643   1.00 32.52  ? 431 PRO A C     1 
ATOM   3014  O  O     . PRO A 1 431 ? 26.380  -3.289  -0.475  1.00 36.44  ? 431 PRO A O     1 
ATOM   3015  C  CB    . PRO A 1 431 ? 26.687  -0.539  1.107   1.00 31.31  ? 431 PRO A CB    1 
ATOM   3016  C  CG    . PRO A 1 431 ? 28.023  0.058   1.133   1.00 39.99  ? 431 PRO A CG    1 
ATOM   3017  C  CD    . PRO A 1 431 ? 28.953  -1.030  0.623   1.00 35.86  ? 431 PRO A CD    1 
ATOM   3018  N  N     . SER A 1 432 ? 24.847  -3.245  1.183   1.00 34.99  ? 432 SER A N     1 
ATOM   3019  C  CA    . SER A 1 432 ? 23.953  -4.191  0.545   1.00 38.62  ? 432 SER A CA    1 
ATOM   3020  C  C     . SER A 1 432 ? 22.512  -3.668  0.506   1.00 36.35  ? 432 SER A C     1 
ATOM   3021  O  O     . SER A 1 432 ? 22.045  -3.014  1.437   1.00 36.05  ? 432 SER A O     1 
ATOM   3022  C  CB    . SER A 1 432 ? 23.980  -5.530  1.278   1.00 31.28  ? 432 SER A CB    1 
ATOM   3023  O  OG    . SER A 1 432 ? 23.734  -5.349  2.667   1.00 34.89  ? 432 SER A OG    1 
ATOM   3024  N  N     . GLN A 1 433 ? 21.828  -3.959  -0.594  1.00 31.42  ? 433 GLN A N     1 
ATOM   3025  C  CA    . GLN A 1 433 ? 20.412  -3.705  -0.721  1.00 33.66  ? 433 GLN A CA    1 
ATOM   3026  C  C     . GLN A 1 433 ? 19.684  -5.020  -0.920  1.00 34.69  ? 433 GLN A C     1 
ATOM   3027  O  O     . GLN A 1 433 ? 19.915  -5.714  -1.907  1.00 35.93  ? 433 GLN A O     1 
ATOM   3028  C  CB    . GLN A 1 433 ? 20.111  -2.801  -1.902  1.00 30.06  ? 433 GLN A CB    1 
ATOM   3029  C  CG    . GLN A 1 433 ? 18.592  -2.647  -2.156  1.00 29.40  ? 433 GLN A CG    1 
ATOM   3030  C  CD    . GLN A 1 433 ? 17.886  -1.947  -1.010  1.00 35.45  ? 433 GLN A CD    1 
ATOM   3031  O  OE1   . GLN A 1 433 ? 18.233  -0.810  -0.667  1.00 35.44  ? 433 GLN A OE1   1 
ATOM   3032  N  NE2   . GLN A 1 433 ? 16.882  -2.612  -0.418  1.00 38.28  ? 433 GLN A NE2   1 
ATOM   3033  N  N     . ILE A 1 434 ? 18.801  -5.359  0.003   1.00 31.30  ? 434 ILE A N     1 
ATOM   3034  C  CA    . ILE A 1 434 ? 18.023  -6.573  -0.134  1.00 30.61  ? 434 ILE A CA    1 
ATOM   3035  C  C     . ILE A 1 434 ? 16.749  -6.281  -0.949  1.00 42.64  ? 434 ILE A C     1 
ATOM   3036  O  O     . ILE A 1 434 ? 16.150  -5.186  -0.855  1.00 37.98  ? 434 ILE A O     1 
ATOM   3037  C  CB    . ILE A 1 434 ? 17.694  -7.181  1.245   1.00 33.56  ? 434 ILE A CB    1 
ATOM   3038  C  CG1   . ILE A 1 434 ? 18.997  -7.704  1.873   1.00 40.56  ? 434 ILE A CG1   1 
ATOM   3039  C  CG2   . ILE A 1 434 ? 16.724  -8.374  1.110   1.00 34.37  ? 434 ILE A CG2   1 
ATOM   3040  C  CD1   . ILE A 1 434 ? 18.833  -8.447  3.178   1.00 37.90  ? 434 ILE A CD1   1 
ATOM   3041  N  N     . LEU A 1 435 ? 16.415  -7.236  -1.817  1.00 36.57  ? 435 LEU A N     1 
ATOM   3042  C  CA    . LEU A 1 435 ? 15.222  -7.200  -2.674  1.00 38.14  ? 435 LEU A CA    1 
ATOM   3043  C  C     . LEU A 1 435 ? 14.676  -8.624  -2.691  1.00 41.24  ? 435 LEU A C     1 
ATOM   3044  O  O     . LEU A 1 435 ? 15.385  -9.585  -3.096  1.00 34.32  ? 435 LEU A O     1 
ATOM   3045  C  CB    . LEU A 1 435 ? 15.551  -6.711  -4.092  1.00 35.39  ? 435 LEU A CB    1 
ATOM   3046  C  CG    . LEU A 1 435 ? 14.395  -6.623  -5.117  1.00 38.46  ? 435 LEU A CG    1 
ATOM   3047  C  CD1   . LEU A 1 435 ? 13.232  -5.753  -4.639  1.00 34.73  ? 435 LEU A CD1   1 
ATOM   3048  C  CD2   . LEU A 1 435 ? 14.926  -6.111  -6.452  1.00 35.16  ? 435 LEU A CD2   1 
ATOM   3049  N  N     . ASN A 1 436 ? 13.452  -8.764  -2.184  1.00 34.01  ? 436 ASN A N     1 
ATOM   3050  C  CA    . ASN A 1 436 ? 12.845  -10.085 -1.970  1.00 40.74  ? 436 ASN A CA    1 
ATOM   3051  C  C     . ASN A 1 436 ? 12.241  -10.703 -3.218  1.00 34.46  ? 436 ASN A C     1 
ATOM   3052  O  O     . ASN A 1 436 ? 11.688  -9.996  -4.070  1.00 39.02  ? 436 ASN A O     1 
ATOM   3053  C  CB    . ASN A 1 436 ? 11.756  -10.027 -0.889  1.00 35.76  ? 436 ASN A CB    1 
ATOM   3054  C  CG    . ASN A 1 436 ? 12.313  -10.016 0.516   1.00 42.32  ? 436 ASN A CG    1 
ATOM   3055  O  OD1   . ASN A 1 436 ? 13.460  -10.425 0.770   1.00 43.23  ? 436 ASN A OD1   1 
ATOM   3056  N  ND2   . ASN A 1 436 ? 11.485  -9.580  1.458   1.00 33.53  ? 436 ASN A ND2   1 
ATOM   3057  N  N     . VAL A 1 437 ? 12.429  -12.008 -3.380  1.00 40.16  ? 437 VAL A N     1 
ATOM   3058  C  CA    . VAL A 1 437 ? 11.760  -12.746 -4.464  1.00 43.05  ? 437 VAL A CA    1 
ATOM   3059  C  C     . VAL A 1 437 ? 10.611  -13.548 -3.836  1.00 41.53  ? 437 VAL A C     1 
ATOM   3060  O  O     . VAL A 1 437 ? 10.681  -13.880 -2.643  1.00 46.01  ? 437 VAL A O     1 
ATOM   3061  C  CB    . VAL A 1 437 ? 12.716  -13.665 -5.237  1.00 44.17  ? 437 VAL A CB    1 
ATOM   3062  C  CG1   . VAL A 1 437 ? 13.743  -12.817 -5.976  1.00 40.76  ? 437 VAL A CG1   1 
ATOM   3063  C  CG2   . VAL A 1 437 ? 13.375  -14.684 -4.292  1.00 39.51  ? 437 VAL A CG2   1 
ATOM   3064  N  N     . PRO A 1 438 ? 9.544   -13.842 -4.601  1.00 40.17  ? 438 PRO A N     1 
ATOM   3065  C  CA    . PRO A 1 438 ? 9.302   -13.559 -6.027  1.00 44.20  ? 438 PRO A CA    1 
ATOM   3066  C  C     . PRO A 1 438 ? 9.144   -12.079 -6.301  1.00 39.52  ? 438 PRO A C     1 
ATOM   3067  O  O     . PRO A 1 438 ? 8.718   -11.312 -5.428  1.00 41.33  ? 438 PRO A O     1 
ATOM   3068  C  CB    . PRO A 1 438 ? 7.969   -14.291 -6.332  1.00 37.66  ? 438 PRO A CB    1 
ATOM   3069  C  CG    . PRO A 1 438 ? 7.311   -14.446 -4.998  1.00 37.18  ? 438 PRO A CG    1 
ATOM   3070  C  CD    . PRO A 1 438 ? 8.447   -14.632 -4.005  1.00 42.90  ? 438 PRO A CD    1 
ATOM   3071  N  N     . LEU A 1 439 ? 9.511   -11.688 -7.511  1.00 36.67  ? 439 LEU A N     1 
ATOM   3072  C  CA    . LEU A 1 439 ? 9.578   -10.296 -7.877  1.00 42.87  ? 439 LEU A CA    1 
ATOM   3073  C  C     . LEU A 1 439 ? 9.102   -10.224 -9.293  1.00 46.47  ? 439 LEU A C     1 
ATOM   3074  O  O     . LEU A 1 439 ? 9.626   -10.946 -10.140 1.00 43.13  ? 439 LEU A O     1 
ATOM   3075  C  CB    . LEU A 1 439 ? 11.013  -9.750  -7.749  1.00 38.37  ? 439 LEU A CB    1 
ATOM   3076  C  CG    . LEU A 1 439 ? 11.214  -8.376  -8.383  1.00 45.73  ? 439 LEU A CG    1 
ATOM   3077  C  CD1   . LEU A 1 439 ? 10.436  -7.313  -7.592  1.00 43.97  ? 439 LEU A CD1   1 
ATOM   3078  C  CD2   . LEU A 1 439 ? 12.704  -8.019  -8.489  1.00 44.71  ? 439 LEU A CD2   1 
ATOM   3079  N  N     . ARG A 1 440 ? 8.132   -9.343  -9.548  1.00 48.85  ? 440 ARG A N     1 
ATOM   3080  C  CA    . ARG A 1 440 ? 7.514   -9.195  -10.862 1.00 50.04  ? 440 ARG A CA    1 
ATOM   3081  C  C     . ARG A 1 440 ? 7.761   -7.780  -11.373 1.00 47.23  ? 440 ARG A C     1 
ATOM   3082  O  O     . ARG A 1 440 ? 7.807   -6.841  -10.578 1.00 46.87  ? 440 ARG A O     1 
ATOM   3083  C  CB    . ARG A 1 440 ? 6.006   -9.488  -10.754 1.00 53.34  ? 440 ARG A CB    1 
ATOM   3084  C  CG    . ARG A 1 440 ? 5.678   -10.962 -10.545 1.00 57.59  ? 440 ARG A CG    1 
ATOM   3085  C  CD    . ARG A 1 440 ? 4.177   -11.211 -10.313 1.00 71.40  ? 440 ARG A CD    1 
ATOM   3086  N  NE    . ARG A 1 440 ? 3.341   -11.075 -11.506 1.00 72.00  ? 440 ARG A NE    1 
ATOM   3087  C  CZ    . ARG A 1 440 ? 3.305   -11.954 -12.504 1.00 74.91  ? 440 ARG A CZ    1 
ATOM   3088  N  NH1   . ARG A 1 440 ? 4.070   -13.040 -12.466 1.00 75.31  ? 440 ARG A NH1   1 
ATOM   3089  N  NH2   . ARG A 1 440 ? 2.504   -11.747 -13.543 1.00 77.64  ? 440 ARG A NH2   1 
ATOM   3090  N  N     . GLU A 1 441 ? 7.911   -7.620  -12.687 1.00 36.73  ? 441 GLU A N     1 
ATOM   3091  C  CA    . GLU A 1 441 ? 8.228   -6.319  -13.259 1.00 45.52  ? 441 GLU A CA    1 
ATOM   3092  C  C     . GLU A 1 441 ? 7.177   -5.266  -12.900 1.00 52.70  ? 441 GLU A C     1 
ATOM   3093  O  O     . GLU A 1 441 ? 7.484   -4.078  -12.758 1.00 47.13  ? 441 GLU A O     1 
ATOM   3094  C  CB    . GLU A 1 441 ? 8.355   -6.434  -14.771 1.00 47.66  ? 441 GLU A CB    1 
ATOM   3095  C  CG    . GLU A 1 441 ? 8.562   -5.115  -15.484 1.00 45.66  ? 441 GLU A CG    1 
ATOM   3096  C  CD    . GLU A 1 441 ? 8.970   -5.330  -16.921 1.00 50.28  ? 441 GLU A CD    1 
ATOM   3097  O  OE1   . GLU A 1 441 ? 9.037   -6.510  -17.325 1.00 51.03  ? 441 GLU A OE1   1 
ATOM   3098  O  OE2   . GLU A 1 441 ? 9.231   -4.339  -17.635 1.00 49.45  ? 441 GLU A OE2   1 
ATOM   3099  N  N     . GLU A 1 442 ? 5.938   -5.713  -12.737 1.00 47.79  ? 442 GLU A N     1 
ATOM   3100  C  CA    . GLU A 1 442 ? 4.857   -4.805  -12.400 1.00 53.93  ? 442 GLU A CA    1 
ATOM   3101  C  C     . GLU A 1 442 ? 4.937   -4.257  -10.962 1.00 52.18  ? 442 GLU A C     1 
ATOM   3102  O  O     . GLU A 1 442 ? 4.325   -3.239  -10.669 1.00 45.94  ? 442 GLU A O     1 
ATOM   3103  C  CB    . GLU A 1 442 ? 3.510   -5.499  -12.650 1.00 57.58  ? 442 GLU A CB    1 
ATOM   3104  C  CG    . GLU A 1 442 ? 3.490   -6.978  -12.280 1.00 65.41  ? 442 GLU A CG    1 
ATOM   3105  C  CD    . GLU A 1 442 ? 4.068   -7.890  -13.382 1.00 68.86  ? 442 GLU A CD    1 
ATOM   3106  O  OE1   . GLU A 1 442 ? 4.665   -7.380  -14.359 1.00 70.40  ? 442 GLU A OE1   1 
ATOM   3107  O  OE2   . GLU A 1 442 ? 3.951   -9.125  -13.255 1.00 71.59  ? 442 GLU A OE2   1 
ATOM   3108  N  N     . GLU A 1 443 ? 5.710   -4.887  -10.073 1.00 47.63  ? 443 GLU A N     1 
ATOM   3109  C  CA    . GLU A 1 443 ? 5.856   -4.349  -8.714  1.00 48.19  ? 443 GLU A CA    1 
ATOM   3110  C  C     . GLU A 1 443 ? 6.868   -3.188  -8.703  1.00 44.61  ? 443 GLU A C     1 
ATOM   3111  O  O     . GLU A 1 443 ? 7.802   -3.162  -7.915  1.00 44.13  ? 443 GLU A O     1 
ATOM   3112  C  CB    . GLU A 1 443 ? 6.274   -5.447  -7.736  1.00 46.25  ? 443 GLU A CB    1 
ATOM   3113  C  CG    . GLU A 1 443 ? 5.192   -6.501  -7.534  1.00 49.21  ? 443 GLU A CG    1 
ATOM   3114  C  CD    . GLU A 1 443 ? 5.596   -7.569  -6.548  1.00 50.26  ? 443 GLU A CD    1 
ATOM   3115  O  OE1   . GLU A 1 443 ? 5.386   -7.386  -5.329  1.00 59.42  ? 443 GLU A OE1   1 
ATOM   3116  O  OE2   . GLU A 1 443 ? 6.175   -8.577  -6.993  1.00 53.41  ? 443 GLU A OE2   1 
ATOM   3117  N  N     . ARG A 1 444 ? 6.640   -2.242  -9.602  1.00 43.10  ? 444 ARG A N     1 
ATOM   3118  C  CA    . ARG A 1 444 ? 7.527   -1.142  -9.891  1.00 42.22  ? 444 ARG A CA    1 
ATOM   3119  C  C     . ARG A 1 444 ? 7.954   -0.337  -8.651  1.00 49.12  ? 444 ARG A C     1 
ATOM   3120  O  O     . ARG A 1 444 ? 9.113   0.057   -8.539  1.00 41.95  ? 444 ARG A O     1 
ATOM   3121  C  CB    . ARG A 1 444 ? 6.860   -0.252  -10.939 1.00 45.92  ? 444 ARG A CB    1 
ATOM   3122  C  CG    . ARG A 1 444 ? 7.616   0.984   -11.304 1.00 59.13  ? 444 ARG A CG    1 
ATOM   3123  C  CD    . ARG A 1 444 ? 6.861   1.791   -12.340 1.00 60.85  ? 444 ARG A CD    1 
ATOM   3124  N  NE    . ARG A 1 444 ? 7.339   3.171   -12.389 1.00 64.06  ? 444 ARG A NE    1 
ATOM   3125  C  CZ    . ARG A 1 444 ? 7.298   3.929   -13.481 1.00 73.41  ? 444 ARG A CZ    1 
ATOM   3126  N  NH1   . ARG A 1 444 ? 6.813   3.434   -14.614 1.00 74.36  ? 444 ARG A NH1   1 
ATOM   3127  N  NH2   . ARG A 1 444 ? 7.755   5.173   -13.446 1.00 72.81  ? 444 ARG A NH2   1 
ATOM   3128  N  N     . HIS A 1 445 ? 7.037   -0.083  -7.725  1.00 42.76  ? 445 HIS A N     1 
ATOM   3129  C  CA    . HIS A 1 445 ? 7.377   0.751   -6.570  1.00 44.57  ? 445 HIS A CA    1 
ATOM   3130  C  C     . HIS A 1 445 ? 8.411   0.074   -5.680  1.00 39.25  ? 445 HIS A C     1 
ATOM   3131  O  O     . HIS A 1 445 ? 9.366   0.721   -5.211  1.00 36.75  ? 445 HIS A O     1 
ATOM   3132  C  CB    . HIS A 1 445 ? 6.120   1.118   -5.793  1.00 32.31  ? 445 HIS A CB    1 
ATOM   3133  C  CG    . HIS A 1 445 ? 5.163   1.936   -6.603  1.00 43.00  ? 445 HIS A CG    1 
ATOM   3134  N  ND1   . HIS A 1 445 ? 3.964   1.441   -7.073  1.00 40.23  ? 445 HIS A ND1   1 
ATOM   3135  C  CD2   . HIS A 1 445 ? 5.260   3.200   -7.087  1.00 37.24  ? 445 HIS A CD2   1 
ATOM   3136  C  CE1   . HIS A 1 445 ? 3.348   2.373   -7.779  1.00 42.00  ? 445 HIS A CE1   1 
ATOM   3137  N  NE2   . HIS A 1 445 ? 4.113   3.447   -7.808  1.00 47.68  ? 445 HIS A NE2   1 
ATOM   3138  N  N     . ARG A 1 446 ? 8.208   -1.218  -5.445  1.00 33.75  ? 446 ARG A N     1 
ATOM   3139  C  CA    . ARG A 1 446 ? 9.124   -2.013  -4.645  1.00 39.72  ? 446 ARG A CA    1 
ATOM   3140  C  C     . ARG A 1 446 ? 10.537  -2.059  -5.259  1.00 41.23  ? 446 ARG A C     1 
ATOM   3141  O  O     . ARG A 1 446 ? 11.530  -1.714  -4.590  1.00 41.02  ? 446 ARG A O     1 
ATOM   3142  C  CB    . ARG A 1 446 ? 8.577   -3.431  -4.456  1.00 42.20  ? 446 ARG A CB    1 
ATOM   3143  C  CG    . ARG A 1 446 ? 9.378   -4.235  -3.432  1.00 38.44  ? 446 ARG A CG    1 
ATOM   3144  C  CD    . ARG A 1 446 ? 8.597   -5.397  -2.820  1.00 36.53  ? 446 ARG A CD    1 
ATOM   3145  N  NE    . ARG A 1 446 ? 8.134   -6.356  -3.825  1.00 41.29  ? 446 ARG A NE    1 
ATOM   3146  C  CZ    . ARG A 1 446 ? 8.757   -7.498  -4.120  1.00 49.57  ? 446 ARG A CZ    1 
ATOM   3147  N  NH1   . ARG A 1 446 ? 9.907   -7.812  -3.519  1.00 46.35  ? 446 ARG A NH1   1 
ATOM   3148  N  NH2   . ARG A 1 446 ? 8.249   -8.313  -5.044  1.00 46.64  ? 446 ARG A NH2   1 
ATOM   3149  N  N     . TRP A 1 447 ? 10.645  -2.448  -6.528  1.00 37.15  ? 447 TRP A N     1 
ATOM   3150  C  CA    . TRP A 1 447 ? 11.980  -2.650  -7.050  1.00 37.09  ? 447 TRP A CA    1 
ATOM   3151  C  C     . TRP A 1 447 ? 12.646  -1.332  -7.401  1.00 37.47  ? 447 TRP A C     1 
ATOM   3152  O  O     . TRP A 1 447 ? 13.869  -1.207  -7.300  1.00 34.41  ? 447 TRP A O     1 
ATOM   3153  C  CB    . TRP A 1 447 ? 12.006  -3.638  -8.237  1.00 34.50  ? 447 TRP A CB    1 
ATOM   3154  C  CG    . TRP A 1 447 ? 11.228  -3.379  -9.527  1.00 38.48  ? 447 TRP A CG    1 
ATOM   3155  C  CD1   . TRP A 1 447 ? 10.056  -4.000  -9.915  1.00 41.48  ? 447 TRP A CD1   1 
ATOM   3156  C  CD2   . TRP A 1 447 ? 11.613  -2.541  -10.633 1.00 34.18  ? 447 TRP A CD2   1 
ATOM   3157  N  NE1   . TRP A 1 447 ? 9.688   -3.571  -11.167 1.00 38.38  ? 447 TRP A NE1   1 
ATOM   3158  C  CE2   . TRP A 1 447 ? 10.617  -2.674  -11.628 1.00 38.30  ? 447 TRP A CE2   1 
ATOM   3159  C  CE3   . TRP A 1 447 ? 12.695  -1.690  -10.878 1.00 36.38  ? 447 TRP A CE3   1 
ATOM   3160  C  CZ2   . TRP A 1 447 ? 10.669  -1.986  -12.837 1.00 36.02  ? 447 TRP A CZ2   1 
ATOM   3161  C  CZ3   . TRP A 1 447 ? 12.745  -1.004  -12.074 1.00 37.46  ? 447 TRP A CZ3   1 
ATOM   3162  C  CH2   . TRP A 1 447 ? 11.732  -1.150  -13.040 1.00 37.77  ? 447 TRP A CH2   1 
ATOM   3163  N  N     . GLU A 1 448 ? 11.855  -0.317  -7.725  1.00 38.63  ? 448 GLU A N     1 
ATOM   3164  C  CA    . GLU A 1 448 ? 12.435  0.998   -7.942  1.00 34.67  ? 448 GLU A CA    1 
ATOM   3165  C  C     . GLU A 1 448 ? 12.955  1.576   -6.615  1.00 34.51  ? 448 GLU A C     1 
ATOM   3166  O  O     . GLU A 1 448 ? 14.027  2.198   -6.593  1.00 34.11  ? 448 GLU A O     1 
ATOM   3167  C  CB    . GLU A 1 448 ? 11.431  1.938   -8.596  1.00 34.56  ? 448 GLU A CB    1 
ATOM   3168  C  CG    . GLU A 1 448 ? 11.271  1.701   -10.115 1.00 44.15  ? 448 GLU A CG    1 
ATOM   3169  C  CD    . GLU A 1 448 ? 10.539  2.844   -10.833 1.00 49.10  ? 448 GLU A CD    1 
ATOM   3170  O  OE1   . GLU A 1 448 ? 10.105  3.808   -10.162 1.00 48.61  ? 448 GLU A OE1   1 
ATOM   3171  O  OE2   . GLU A 1 448 ? 10.418  2.791   -12.074 1.00 49.59  ? 448 GLU A OE2   1 
ATOM   3172  N  N     . ASN A 1 449 ? 12.233  1.356   -5.508  1.00 29.53  ? 449 ASN A N     1 
ATOM   3173  C  CA    . ASN A 1 449 ? 12.777  1.803   -4.231  1.00 34.25  ? 449 ASN A CA    1 
ATOM   3174  C  C     . ASN A 1 449 ? 14.043  1.018   -3.871  1.00 37.59  ? 449 ASN A C     1 
ATOM   3175  O  O     . ASN A 1 449 ? 15.013  1.615   -3.381  1.00 34.21  ? 449 ASN A O     1 
ATOM   3176  C  CB    . ASN A 1 449 ? 11.744  1.706   -3.107  1.00 32.27  ? 449 ASN A CB    1 
ATOM   3177  C  CG    . ASN A 1 449 ? 11.076  3.052   -2.819  1.00 34.31  ? 449 ASN A CG    1 
ATOM   3178  O  OD1   . ASN A 1 449 ? 11.332  4.031   -3.510  1.00 35.23  ? 449 ASN A OD1   1 
ATOM   3179  N  ND2   . ASN A 1 449 ? 10.236  3.104   -1.787  1.00 32.74  ? 449 ASN A ND2   1 
ATOM   3180  N  N     . ALA A 1 450 ? 14.043  -0.298  -4.134  1.00 33.69  ? 450 ALA A N     1 
ATOM   3181  C  CA    . ALA A 1 450 ? 15.249  -1.108  -3.923  1.00 36.51  ? 450 ALA A CA    1 
ATOM   3182  C  C     . ALA A 1 450 ? 16.429  -0.511  -4.679  1.00 31.43  ? 450 ALA A C     1 
ATOM   3183  O  O     . ALA A 1 450 ? 17.498  -0.354  -4.140  1.00 33.93  ? 450 ALA A O     1 
ATOM   3184  C  CB    . ALA A 1 450 ? 15.028  -2.552  -4.356  1.00 32.38  ? 450 ALA A CB    1 
ATOM   3185  N  N     . LEU A 1 451 ? 16.205  -0.172  -5.938  1.00 33.13  ? 451 LEU A N     1 
ATOM   3186  C  CA    . LEU A 1 451 ? 17.236  0.394   -6.780  1.00 31.79  ? 451 LEU A CA    1 
ATOM   3187  C  C     . LEU A 1 451 ? 17.748  1.744   -6.257  1.00 36.65  ? 451 LEU A C     1 
ATOM   3188  O  O     . LEU A 1 451 ? 18.964  1.985   -6.230  1.00 32.95  ? 451 LEU A O     1 
ATOM   3189  C  CB    . LEU A 1 451 ? 16.700  0.556   -8.199  1.00 31.30  ? 451 LEU A CB    1 
ATOM   3190  C  CG    . LEU A 1 451 ? 17.153  -0.397  -9.307  1.00 44.12  ? 451 LEU A CG    1 
ATOM   3191  C  CD1   . LEU A 1 451 ? 17.470  -1.811  -8.819  1.00 35.84  ? 451 LEU A CD1   1 
ATOM   3192  C  CD2   . LEU A 1 451 ? 16.122  -0.415  -10.415 1.00 25.34  ? 451 LEU A CD2   1 
ATOM   3193  N  N     . LEU A 1 452 ? 16.837  2.621   -5.840  1.00 33.41  ? 452 LEU A N     1 
ATOM   3194  C  CA    . LEU A 1 452 ? 17.254  3.915   -5.272  1.00 32.23  ? 452 LEU A CA    1 
ATOM   3195  C  C     . LEU A 1 452 ? 18.113  3.699   -4.029  1.00 33.88  ? 452 LEU A C     1 
ATOM   3196  O  O     . LEU A 1 452 ? 19.114  4.390   -3.815  1.00 34.97  ? 452 LEU A O     1 
ATOM   3197  C  CB    . LEU A 1 452 ? 16.038  4.779   -4.923  1.00 33.08  ? 452 LEU A CB    1 
ATOM   3198  C  CG    . LEU A 1 452 ? 15.260  5.311   -6.130  1.00 34.89  ? 452 LEU A CG    1 
ATOM   3199  C  CD1   . LEU A 1 452 ? 13.975  5.938   -5.629  1.00 32.80  ? 452 LEU A CD1   1 
ATOM   3200  C  CD2   . LEU A 1 452 ? 16.081  6.345   -6.897  1.00 29.73  ? 452 LEU A CD2   1 
ATOM   3201  N  N     . GLY A 1 453 ? 17.715  2.725   -3.210  1.00 31.87  ? 453 GLY A N     1 
ATOM   3202  C  CA    . GLY A 1 453 ? 18.508  2.357   -2.052  1.00 37.26  ? 453 GLY A CA    1 
ATOM   3203  C  C     . GLY A 1 453 ? 19.898  1.867   -2.463  1.00 33.60  ? 453 GLY A C     1 
ATOM   3204  O  O     . GLY A 1 453 ? 20.891  2.260   -1.870  1.00 33.34  ? 453 GLY A O     1 
ATOM   3205  N  N     . LEU A 1 454 ? 19.956  1.001   -3.473  1.00 35.07  ? 454 LEU A N     1 
ATOM   3206  C  CA    . LEU A 1 454 ? 21.204  0.440   -4.005  1.00 38.37  ? 454 LEU A CA    1 
ATOM   3207  C  C     . LEU A 1 454 ? 22.165  1.534   -4.453  1.00 38.62  ? 454 LEU A C     1 
ATOM   3208  O  O     . LEU A 1 454 ? 23.365  1.507   -4.163  1.00 32.16  ? 454 LEU A O     1 
ATOM   3209  C  CB    . LEU A 1 454 ? 20.900  -0.471  -5.201  1.00 33.38  ? 454 LEU A CB    1 
ATOM   3210  C  CG    . LEU A 1 454 ? 21.620  -1.782  -5.580  1.00 44.92  ? 454 LEU A CG    1 
ATOM   3211  C  CD1   . LEU A 1 454 ? 21.745  -1.937  -7.104  1.00 39.93  ? 454 LEU A CD1   1 
ATOM   3212  C  CD2   . LEU A 1 454 ? 22.942  -2.059  -4.884  1.00 30.62  ? 454 LEU A CD2   1 
ATOM   3213  N  N     . LEU A 1 455 ? 21.618  2.484   -5.198  1.00 35.48  ? 455 LEU A N     1 
ATOM   3214  C  CA    . LEU A 1 455 ? 22.424  3.540   -5.766  1.00 36.76  ? 455 LEU A CA    1 
ATOM   3215  C  C     . LEU A 1 455 ? 22.894  4.512   -4.683  1.00 38.76  ? 455 LEU A C     1 
ATOM   3216  O  O     . LEU A 1 455 ? 24.057  4.935   -4.707  1.00 36.17  ? 455 LEU A O     1 
ATOM   3217  C  CB    . LEU A 1 455 ? 21.647  4.272   -6.863  1.00 34.40  ? 455 LEU A CB    1 
ATOM   3218  C  CG    . LEU A 1 455 ? 21.290  3.381   -8.067  1.00 42.07  ? 455 LEU A CG    1 
ATOM   3219  C  CD1   . LEU A 1 455 ? 20.300  4.057   -8.997  1.00 40.85  ? 455 LEU A CD1   1 
ATOM   3220  C  CD2   . LEU A 1 455 ? 22.504  2.898   -8.858  1.00 41.47  ? 455 LEU A CD2   1 
ATOM   3221  N  N     . ALA A 1 456 ? 22.032  4.830   -3.711  1.00 33.86  ? 456 ALA A N     1 
ATOM   3222  C  CA    . ALA A 1 456 ? 22.515  5.659   -2.604  1.00 38.96  ? 456 ALA A CA    1 
ATOM   3223  C  C     . ALA A 1 456 ? 23.624  4.902   -1.868  1.00 37.24  ? 456 ALA A C     1 
ATOM   3224  O  O     . ALA A 1 456 ? 24.610  5.497   -1.425  1.00 36.74  ? 456 ALA A O     1 
ATOM   3225  C  CB    . ALA A 1 456 ? 21.418  6.018   -1.662  1.00 25.58  ? 456 ALA A CB    1 
ATOM   3226  N  N     . LYS A 1 457 ? 23.480  3.584   -1.781  1.00 35.13  ? 457 LYS A N     1 
ATOM   3227  C  CA    . LYS A 1 457 ? 24.467  2.766   -1.076  1.00 31.82  ? 457 LYS A CA    1 
ATOM   3228  C  C     . LYS A 1 457 ? 25.757  2.687   -1.859  1.00 34.23  ? 457 LYS A C     1 
ATOM   3229  O  O     . LYS A 1 457 ? 26.826  2.447   -1.286  1.00 32.81  ? 457 LYS A O     1 
ATOM   3230  C  CB    . LYS A 1 457 ? 23.912  1.367   -0.799  1.00 30.44  ? 457 LYS A CB    1 
ATOM   3231  C  CG    . LYS A 1 457 ? 22.829  1.373   0.282   1.00 34.93  ? 457 LYS A CG    1 
ATOM   3232  C  CD    . LYS A 1 457 ? 21.987  0.090   0.326   1.00 30.30  ? 457 LYS A CD    1 
ATOM   3233  C  CE    . LYS A 1 457 ? 21.061  0.155   1.524   1.00 36.88  ? 457 LYS A CE    1 
ATOM   3234  N  NZ    . LYS A 1 457 ? 20.196  -1.040  1.682   1.00 36.35  ? 457 LYS A NZ    1 
ATOM   3235  N  N     . ALA A 1 458 ? 25.673  2.915   -3.164  1.00 32.05  ? 458 ALA A N     1 
ATOM   3236  C  CA    . ALA A 1 458 ? 26.873  2.942   -3.973  1.00 31.70  ? 458 ALA A CA    1 
ATOM   3237  C  C     . ALA A 1 458 ? 27.521  4.338   -3.930  1.00 37.44  ? 458 ALA A C     1 
ATOM   3238  O  O     . ALA A 1 458 ? 28.549  4.565   -4.557  1.00 40.51  ? 458 ALA A O     1 
ATOM   3239  C  CB    . ALA A 1 458 ? 26.567  2.547   -5.397  1.00 29.89  ? 458 ALA A CB    1 
ATOM   3240  N  N     . GLY A 1 459 ? 26.895  5.287   -3.244  1.00 37.63  ? 459 GLY A N     1 
ATOM   3241  C  CA    . GLY A 1 459 ? 27.469  6.618   -3.166  1.00 43.41  ? 459 GLY A CA    1 
ATOM   3242  C  C     . GLY A 1 459 ? 26.970  7.584   -4.235  1.00 40.33  ? 459 GLY A C     1 
ATOM   3243  O  O     . GLY A 1 459 ? 27.443  8.706   -4.329  1.00 44.03  ? 459 GLY A O     1 
ATOM   3244  N  N     . LEU A 1 460 ? 26.016  7.170   -5.056  1.00 41.69  ? 460 LEU A N     1 
ATOM   3245  C  CA    . LEU A 1 460 ? 25.530  8.079   -6.089  1.00 42.61  ? 460 LEU A CA    1 
ATOM   3246  C  C     . LEU A 1 460 ? 24.709  9.175   -5.457  1.00 44.84  ? 460 LEU A C     1 
ATOM   3247  O  O     . LEU A 1 460 ? 24.097  8.974   -4.414  1.00 45.28  ? 460 LEU A O     1 
ATOM   3248  C  CB    . LEU A 1 460 ? 24.682  7.355   -7.125  1.00 52.66  ? 460 LEU A CB    1 
ATOM   3249  C  CG    . LEU A 1 460 ? 25.403  6.688   -8.286  1.00 51.21  ? 460 LEU A CG    1 
ATOM   3250  C  CD1   . LEU A 1 460 ? 26.133  5.443   -7.837  1.00 47.25  ? 460 LEU A CD1   1 
ATOM   3251  C  CD2   . LEU A 1 460 ? 24.367  6.364   -9.324  1.00 54.31  ? 460 LEU A CD2   1 
ATOM   3252  N  N     . GLN A 1 461 ? 24.721  10.346  -6.075  1.00 43.74  ? 461 GLN A N     1 
ATOM   3253  C  CA    . GLN A 1 461 ? 23.860  11.422  -5.624  1.00 45.57  ? 461 GLN A CA    1 
ATOM   3254  C  C     . GLN A 1 461 ? 22.668  11.470  -6.562  1.00 43.11  ? 461 GLN A C     1 
ATOM   3255  O  O     . GLN A 1 461 ? 22.767  11.972  -7.681  1.00 44.16  ? 461 GLN A O     1 
ATOM   3256  C  CB    . GLN A 1 461 ? 24.606  12.754  -5.620  1.00 45.84  ? 461 GLN A CB    1 
ATOM   3257  C  CG    . GLN A 1 461 ? 23.891  13.831  -4.823  1.00 60.40  ? 461 GLN A CG    1 
ATOM   3258  C  CD    . GLN A 1 461 ? 24.666  15.132  -4.767  1.00 61.34  ? 461 GLN A CD    1 
ATOM   3259  O  OE1   . GLN A 1 461 ? 24.079  16.206  -4.635  1.00 66.70  ? 461 GLN A OE1   1 
ATOM   3260  N  NE2   . GLN A 1 461 ? 25.988  15.040  -4.846  1.00 56.65  ? 461 GLN A NE2   1 
ATOM   3261  N  N     . VAL A 1 462 ? 21.532  10.952  -6.116  1.00 46.23  ? 462 VAL A N     1 
ATOM   3262  C  CA    . VAL A 1 462 ? 20.445  10.787  -7.059  1.00 46.89  ? 462 VAL A CA    1 
ATOM   3263  C  C     . VAL A 1 462 ? 19.714  12.116  -7.260  1.00 40.42  ? 462 VAL A C     1 
ATOM   3264  O  O     . VAL A 1 462 ? 19.469  12.507  -8.400  1.00 40.61  ? 462 VAL A O     1 
ATOM   3265  C  CB    . VAL A 1 462 ? 19.487  9.629   -6.624  1.00 48.62  ? 462 VAL A CB    1 
ATOM   3266  C  CG1   . VAL A 1 462 ? 20.323  8.463   -6.081  1.00 45.70  ? 462 VAL A CG1   1 
ATOM   3267  C  CG2   . VAL A 1 462 ? 18.479  10.045  -5.576  1.00 43.98  ? 462 VAL A CG2   1 
ATOM   3268  N  N     . VAL A 1 463 ? 19.470  12.859  -6.183  1.00 38.80  ? 463 VAL A N     1 
ATOM   3269  C  CA    . VAL A 1 463 ? 18.841  14.175  -6.287  1.00 42.47  ? 463 VAL A CA    1 
ATOM   3270  C  C     . VAL A 1 463 ? 19.513  15.179  -5.360  1.00 44.45  ? 463 VAL A C     1 
ATOM   3271  O  O     . VAL A 1 463 ? 20.258  14.804  -4.459  1.00 43.78  ? 463 VAL A O     1 
ATOM   3272  C  CB    . VAL A 1 463 ? 17.331  14.148  -5.941  1.00 46.76  ? 463 VAL A CB    1 
ATOM   3273  C  CG1   . VAL A 1 463 ? 16.510  13.471  -7.052  1.00 39.27  ? 463 VAL A CG1   1 
ATOM   3274  C  CG2   . VAL A 1 463 ? 17.111  13.500  -4.582  1.00 38.02  ? 463 VAL A CG2   1 
ATOM   3275  N  N     . ALA A 1 464 ? 19.222  16.454  -5.587  1.00 39.01  ? 464 ALA A N     1 
ATOM   3276  C  CA    . ALA A 1 464 ? 19.693  17.532  -4.739  1.00 40.02  ? 464 ALA A CA    1 
ATOM   3277  C  C     . ALA A 1 464 ? 18.683  18.669  -4.823  1.00 45.96  ? 464 ALA A C     1 
ATOM   3278  O  O     . ALA A 1 464 ? 17.825  18.682  -5.715  1.00 42.04  ? 464 ALA A O     1 
ATOM   3279  C  CB    . ALA A 1 464 ? 21.079  17.999  -5.175  1.00 41.87  ? 464 ALA A CB    1 
ATOM   3280  N  N     . LEU A 1 465 ? 18.782  19.621  -3.903  1.00 39.82  ? 465 LEU A N     1 
ATOM   3281  C  CA    . LEU A 1 465 ? 17.960  20.817  -3.963  1.00 42.71  ? 465 LEU A CA    1 
ATOM   3282  C  C     . LEU A 1 465 ? 18.668  21.855  -4.823  1.00 45.40  ? 465 LEU A C     1 
ATOM   3283  O  O     . LEU A 1 465 ? 19.878  21.987  -4.758  1.00 48.10  ? 465 LEU A O     1 
ATOM   3284  C  CB    . LEU A 1 465 ? 17.719  21.366  -2.562  1.00 46.08  ? 465 LEU A CB    1 
ATOM   3285  C  CG    . LEU A 1 465 ? 16.889  20.516  -1.611  1.00 42.12  ? 465 LEU A CG    1 
ATOM   3286  C  CD1   . LEU A 1 465 ? 17.008  21.058  -0.185  1.00 41.24  ? 465 LEU A CD1   1 
ATOM   3287  C  CD2   . LEU A 1 465 ? 15.432  20.492  -2.066  1.00 41.45  ? 465 LEU A CD2   1 
ATOM   3288  N  N     . SER A 1 466 ? 17.917  22.572  -5.647  1.00 46.78  ? 466 SER A N     1 
ATOM   3289  C  CA    . SER A 1 466 ? 18.479  23.693  -6.375  1.00 54.49  ? 466 SER A CA    1 
ATOM   3290  C  C     . SER A 1 466 ? 18.129  24.954  -5.614  1.00 56.64  ? 466 SER A C     1 
ATOM   3291  O  O     . SER A 1 466 ? 16.979  25.147  -5.235  1.00 55.71  ? 466 SER A O     1 
ATOM   3292  C  CB    . SER A 1 466 ? 17.940  23.768  -7.800  1.00 52.52  ? 466 SER A CB    1 
ATOM   3293  O  OG    . SER A 1 466 ? 16.562  24.080  -7.803  1.00 55.70  ? 466 SER A OG    1 
ATOM   3294  N  N     . GLY A 1 467 ? 19.110  25.800  -5.347  1.00 53.83  ? 467 GLY A N     1 
ATOM   3295  C  CA    . GLY A 1 467 ? 18.779  27.038  -4.673  1.00 60.54  ? 467 GLY A CA    1 
ATOM   3296  C  C     . GLY A 1 467 ? 19.740  27.441  -3.581  1.00 56.12  ? 467 GLY A C     1 
ATOM   3297  O  O     . GLY A 1 467 ? 20.658  26.703  -3.228  1.00 45.75  ? 467 GLY A O     1 
ATOM   3298  N  N     . ALA A 1 468 ? 19.483  28.614  -3.019  1.00 60.24  ? 468 ALA A N     1 
ATOM   3299  C  CA    . ALA A 1 468 ? 20.361  29.201  -2.025  1.00 53.05  ? 468 ALA A CA    1 
ATOM   3300  C  C     . ALA A 1 468 ? 19.872  28.930  -0.620  1.00 47.16  ? 468 ALA A C     1 
ATOM   3301  O  O     . ALA A 1 468 ? 18.713  29.204  -0.283  1.00 51.68  ? 468 ALA A O     1 
ATOM   3302  C  CB    . ALA A 1 468 ? 20.470  30.720  -2.254  1.00 50.95  ? 468 ALA A CB    1 
ATOM   3303  N  N     . TYR A 1 469 ? 20.759  28.391  0.206   1.00 49.63  ? 469 TYR A N     1 
ATOM   3304  C  CA    . TYR A 1 469 ? 20.435  28.226  1.610   1.00 43.10  ? 469 TYR A CA    1 
ATOM   3305  C  C     . TYR A 1 469 ? 21.547  28.857  2.455   1.00 41.31  ? 469 TYR A C     1 
ATOM   3306  O  O     . TYR A 1 469 ? 22.737  28.742  2.141   1.00 42.24  ? 469 TYR A O     1 
ATOM   3307  C  CB    . TYR A 1 469 ? 20.230  26.740  1.946   1.00 37.31  ? 469 TYR A CB    1 
ATOM   3308  C  CG    . TYR A 1 469 ? 19.093  26.137  1.158   1.00 38.49  ? 469 TYR A CG    1 
ATOM   3309  C  CD1   . TYR A 1 469 ? 17.775  26.333  1.549   1.00 32.71  ? 469 TYR A CD1   1 
ATOM   3310  C  CD2   . TYR A 1 469 ? 19.333  25.415  -0.004  1.00 40.27  ? 469 TYR A CD2   1 
ATOM   3311  C  CE1   . TYR A 1 469 ? 16.718  25.800  0.815   1.00 37.47  ? 469 TYR A CE1   1 
ATOM   3312  C  CE2   . TYR A 1 469 ? 18.290  24.879  -0.747  1.00 41.22  ? 469 TYR A CE2   1 
ATOM   3313  C  CZ    . TYR A 1 469 ? 16.984  25.080  -0.333  1.00 41.80  ? 469 TYR A CZ    1 
ATOM   3314  O  OH    . TYR A 1 469 ? 15.941  24.558  -1.066  1.00 40.09  ? 469 TYR A OH    1 
ATOM   3315  N  N     . PRO A 1 470 ? 21.140  29.546  3.521   1.00 37.39  ? 470 PRO A N     1 
ATOM   3316  C  CA    . PRO A 1 470 ? 22.031  30.200  4.484   1.00 44.42  ? 470 PRO A CA    1 
ATOM   3317  C  C     . PRO A 1 470 ? 23.079  29.210  5.016   1.00 46.06  ? 470 PRO A C     1 
ATOM   3318  O  O     . PRO A 1 470 ? 24.264  29.536  4.991   1.00 46.74  ? 470 PRO A O     1 
ATOM   3319  C  CB    . PRO A 1 470 ? 21.068  30.707  5.580   1.00 42.87  ? 470 PRO A CB    1 
ATOM   3320  C  CG    . PRO A 1 470 ? 19.772  29.963  5.369   1.00 42.19  ? 470 PRO A CG    1 
ATOM   3321  C  CD    . PRO A 1 470 ? 19.717  29.675  3.890   1.00 37.03  ? 470 PRO A CD    1 
ATOM   3322  N  N     . ALA A 1 471 ? 22.670  28.025  5.473   1.00 38.91  ? 471 ALA A N     1 
ATOM   3323  C  CA    . ALA A 1 471 ? 23.649  27.075  6.006   1.00 37.79  ? 471 ALA A CA    1 
ATOM   3324  C  C     . ALA A 1 471 ? 24.105  26.149  4.903   1.00 41.39  ? 471 ALA A C     1 
ATOM   3325  O  O     . ALA A 1 471 ? 23.283  25.445  4.312   1.00 45.90  ? 471 ALA A O     1 
ATOM   3326  C  CB    . ALA A 1 471 ? 23.054  26.255  7.180   1.00 27.69  ? 471 ALA A CB    1 
ATOM   3327  N  N     . GLU A 1 472 ? 25.413  26.077  4.665   1.00 30.61  ? 472 GLU A N     1 
ATOM   3328  C  CA    . GLU A 1 472 ? 25.884  25.233  3.572   1.00 43.97  ? 472 GLU A CA    1 
ATOM   3329  C  C     . GLU A 1 472 ? 26.194  23.818  4.094   1.00 44.34  ? 472 GLU A C     1 
ATOM   3330  O  O     . GLU A 1 472 ? 26.525  22.903  3.341   1.00 43.23  ? 472 GLU A O     1 
ATOM   3331  C  CB    . GLU A 1 472 ? 27.104  25.858  2.882   1.00 45.38  ? 472 GLU A CB    1 
ATOM   3332  C  CG    . GLU A 1 472 ? 28.346  26.008  3.723   1.00 36.77  ? 472 GLU A CG    1 
ATOM   3333  C  CD    . GLU A 1 472 ? 29.485  26.735  2.971   1.00 42.79  ? 472 GLU A CD    1 
ATOM   3334  O  OE1   . GLU A 1 472 ? 29.614  26.548  1.740   1.00 46.99  ? 472 GLU A OE1   1 
ATOM   3335  O  OE2   . GLU A 1 472 ? 30.311  27.426  3.622   1.00 43.21  ? 472 GLU A OE2   1 
ATOM   3336  N  N     . LEU A 1 473 ? 26.071  23.643  5.399   1.00 34.21  ? 473 LEU A N     1 
ATOM   3337  C  CA    . LEU A 1 473 ? 26.147  22.320  5.979   1.00 36.19  ? 473 LEU A CA    1 
ATOM   3338  C  C     . LEU A 1 473 ? 25.049  22.143  7.013   1.00 32.24  ? 473 LEU A C     1 
ATOM   3339  O  O     . LEU A 1 473 ? 24.929  22.948  7.921   1.00 31.84  ? 473 LEU A O     1 
ATOM   3340  C  CB    . LEU A 1 473 ? 27.516  22.094  6.610   1.00 32.35  ? 473 LEU A CB    1 
ATOM   3341  C  CG    . LEU A 1 473 ? 27.686  20.689  7.169   1.00 30.40  ? 473 LEU A CG    1 
ATOM   3342  C  CD1   . LEU A 1 473 ? 27.640  19.677  6.023   1.00 32.06  ? 473 LEU A CD1   1 
ATOM   3343  C  CD2   . LEU A 1 473 ? 28.996  20.617  7.938   1.00 33.76  ? 473 LEU A CD2   1 
ATOM   3344  N  N     . ALA A 1 474 ? 24.241  21.105  6.863   1.00 30.22  ? 474 ALA A N     1 
ATOM   3345  C  CA    . ALA A 1 474 ? 23.188  20.800  7.832   1.00 30.56  ? 474 ALA A CA    1 
ATOM   3346  C  C     . ALA A 1 474 ? 23.420  19.415  8.402   1.00 28.40  ? 474 ALA A C     1 
ATOM   3347  O  O     . ALA A 1 474 ? 23.494  18.426  7.660   1.00 29.53  ? 474 ALA A O     1 
ATOM   3348  C  CB    . ALA A 1 474 ? 21.784  20.888  7.179   1.00 29.45  ? 474 ALA A CB    1 
ATOM   3349  N  N     . VAL A 1 475 ? 23.571  19.326  9.716   1.00 26.45  ? 475 VAL A N     1 
ATOM   3350  C  CA    . VAL A 1 475 ? 23.828  18.020  10.302  1.00 28.75  ? 475 VAL A CA    1 
ATOM   3351  C  C     . VAL A 1 475 ? 22.839  17.678  11.438  1.00 30.46  ? 475 VAL A C     1 
ATOM   3352  O  O     . VAL A 1 475 ? 22.484  18.499  12.288  1.00 31.23  ? 475 VAL A O     1 
ATOM   3353  C  CB    . VAL A 1 475 ? 25.332  17.889  10.728  1.00 34.32  ? 475 VAL A CB    1 
ATOM   3354  C  CG1   . VAL A 1 475 ? 26.080  19.224  10.632  1.00 27.72  ? 475 VAL A CG1   1 
ATOM   3355  C  CG2   . VAL A 1 475 ? 25.521  17.161  12.040  1.00 25.26  ? 475 VAL A CG2   1 
ATOM   3356  N  N     . GLY A 1 476 ? 22.342  16.450  11.373  1.00 28.83  ? 476 GLY A N     1 
ATOM   3357  C  CA    . GLY A 1 476 ? 21.380  15.928  12.327  1.00 27.58  ? 476 GLY A CA    1 
ATOM   3358  C  C     . GLY A 1 476 ? 22.032  14.923  13.253  1.00 29.53  ? 476 GLY A C     1 
ATOM   3359  O  O     . GLY A 1 476 ? 22.797  14.067  12.815  1.00 36.01  ? 476 GLY A O     1 
ATOM   3360  N  N     . PHE A 1 477 ? 21.739  15.055  14.542  1.00 31.42  ? 477 PHE A N     1 
ATOM   3361  C  CA    . PHE A 1 477 ? 22.307  14.202  15.572  1.00 32.64  ? 477 PHE A CA    1 
ATOM   3362  C  C     . PHE A 1 477 ? 21.245  13.294  16.168  1.00 38.05  ? 477 PHE A C     1 
ATOM   3363  O  O     . PHE A 1 477 ? 20.114  13.730  16.398  1.00 32.06  ? 477 PHE A O     1 
ATOM   3364  C  CB    . PHE A 1 477 ? 22.942  15.034  16.677  1.00 28.06  ? 477 PHE A CB    1 
ATOM   3365  C  CG    . PHE A 1 477 ? 23.985  16.005  16.198  1.00 27.81  ? 477 PHE A CG    1 
ATOM   3366  C  CD1   . PHE A 1 477 ? 23.628  17.213  15.611  1.00 27.80  ? 477 PHE A CD1   1 
ATOM   3367  C  CD2   . PHE A 1 477 ? 25.338  15.731  16.392  1.00 29.00  ? 477 PHE A CD2   1 
ATOM   3368  C  CE1   . PHE A 1 477 ? 24.605  18.125  15.203  1.00 32.63  ? 477 PHE A CE1   1 
ATOM   3369  C  CE2   . PHE A 1 477 ? 26.301  16.630  15.988  1.00 29.79  ? 477 PHE A CE2   1 
ATOM   3370  C  CZ    . PHE A 1 477 ? 25.938  17.832  15.388  1.00 27.47  ? 477 PHE A CZ    1 
ATOM   3371  N  N     . ASP A 1 478 ? 21.606  12.032  16.393  1.00 31.00  ? 478 ASP A N     1 
ATOM   3372  C  CA    . ASP A 1 478 ? 20.675  11.065  16.955  1.00 31.02  ? 478 ASP A CA    1 
ATOM   3373  C  C     . ASP A 1 478 ? 21.316  10.225  18.059  1.00 36.92  ? 478 ASP A C     1 
ATOM   3374  O  O     . ASP A 1 478 ? 22.402  9.640   17.856  1.00 30.39  ? 478 ASP A O     1 
ATOM   3375  C  CB    . ASP A 1 478 ? 20.139  10.157  15.836  1.00 36.30  ? 478 ASP A CB    1 
ATOM   3376  C  CG    . ASP A 1 478 ? 18.929  9.349   16.271  1.00 44.60  ? 478 ASP A CG    1 
ATOM   3377  O  OD1   . ASP A 1 478 ? 19.121  8.227   16.783  1.00 43.16  ? 478 ASP A OD1   1 
ATOM   3378  O  OD2   . ASP A 1 478 ? 17.791  9.856   16.145  1.00 46.12  ? 478 ASP A OD2   1 
ATOM   3379  N  N     . ALA A 1 479 ? 20.683  10.202  19.232  1.00 33.21  ? 479 ALA A N     1 
ATOM   3380  C  CA    . ALA A 1 479 ? 21.110  9.319   20.318  1.00 37.35  ? 479 ALA A CA    1 
ATOM   3381  C  C     . ALA A 1 479 ? 20.234  8.066   20.512  1.00 43.59  ? 479 ALA A C     1 
ATOM   3382  O  O     . ALA A 1 479 ? 20.102  7.569   21.635  1.00 40.92  ? 479 ALA A O     1 
ATOM   3383  C  CB    . ALA A 1 479 ? 21.176  10.104  21.630  1.00 39.51  ? 479 ALA A CB    1 
ATOM   3384  N  N     . GLY A 1 480 ? 19.634  7.550   19.446  1.00 42.55  ? 480 GLY A N     1 
ATOM   3385  C  CA    . GLY A 1 480 ? 18.774  6.381   19.582  1.00 44.63  ? 480 GLY A CA    1 
ATOM   3386  C  C     . GLY A 1 480 ? 17.518  6.611   20.409  1.00 46.22  ? 480 GLY A C     1 
ATOM   3387  O  O     . GLY A 1 480 ? 16.961  5.673   20.968  1.00 57.96  ? 480 GLY A O     1 
ATOM   3388  N  N     . GLY A 1 481 ? 17.088  7.864   20.513  1.00 49.01  ? 481 GLY A N     1 
ATOM   3389  C  CA    . GLY A 1 481 ? 15.950  8.218   21.340  1.00 53.25  ? 481 GLY A CA    1 
ATOM   3390  C  C     . GLY A 1 481 ? 16.251  8.313   22.825  1.00 57.63  ? 481 GLY A C     1 
ATOM   3391  O  O     . GLY A 1 481 ? 15.379  8.701   23.622  1.00 52.09  ? 481 GLY A O     1 
ATOM   3392  N  N     . ARG A 1 482 ? 17.484  7.973   23.198  1.00 49.92  ? 482 ARG A N     1 
ATOM   3393  C  CA    . ARG A 1 482 ? 17.898  7.936   24.601  1.00 46.33  ? 482 ARG A CA    1 
ATOM   3394  C  C     . ARG A 1 482 ? 17.949  9.318   25.235  1.00 44.17  ? 482 ARG A C     1 
ATOM   3395  O  O     . ARG A 1 482 ? 17.874  10.340  24.550  1.00 46.84  ? 482 ARG A O     1 
ATOM   3396  C  CB    . ARG A 1 482 ? 19.258  7.259   24.734  1.00 48.15  ? 482 ARG A CB    1 
ATOM   3397  C  CG    . ARG A 1 482 ? 19.212  5.748   24.623  1.00 57.41  ? 482 ARG A CG    1 
ATOM   3398  C  CD    . ARG A 1 482 ? 20.616  5.143   24.625  1.00 51.62  ? 482 ARG A CD    1 
ATOM   3399  N  NE    . ARG A 1 482 ? 21.112  4.919   23.264  1.00 56.40  ? 482 ARG A NE    1 
ATOM   3400  C  CZ    . ARG A 1 482 ? 22.036  5.659   22.660  1.00 51.10  ? 482 ARG A CZ    1 
ATOM   3401  N  NH1   . ARG A 1 482 ? 22.591  6.685   23.297  1.00 59.39  ? 482 ARG A NH1   1 
ATOM   3402  N  NH2   . ARG A 1 482 ? 22.410  5.369   21.419  1.00 50.24  ? 482 ARG A NH2   1 
ATOM   3403  N  N     . GLU A 1 483 ? 18.064  9.335   26.557  1.00 46.56  ? 483 GLU A N     1 
ATOM   3404  C  CA    . GLU A 1 483 ? 18.031  10.571  27.332  1.00 56.19  ? 483 GLU A CA    1 
ATOM   3405  C  C     . GLU A 1 483 ? 19.363  11.351  27.286  1.00 48.75  ? 483 GLU A C     1 
ATOM   3406  O  O     . GLU A 1 483 ? 19.427  12.486  27.739  1.00 44.59  ? 483 GLU A O     1 
ATOM   3407  C  CB    . GLU A 1 483 ? 17.656  10.260  28.785  1.00 56.13  ? 483 GLU A CB    1 
ATOM   3408  C  CG    . GLU A 1 483 ? 18.665  9.360   29.526  1.00 62.38  ? 483 GLU A CG    1 
ATOM   3409  C  CD    . GLU A 1 483 ? 18.549  7.873   29.182  1.00 69.04  ? 483 GLU A CD    1 
ATOM   3410  O  OE1   . GLU A 1 483 ? 17.809  7.513   28.233  1.00 67.81  ? 483 GLU A OE1   1 
ATOM   3411  O  OE2   . GLU A 1 483 ? 19.208  7.055   29.861  1.00 74.45  ? 483 GLU A OE2   1 
ATOM   3412  N  N     . SER A 1 484 ? 20.406  10.743  26.724  1.00 44.47  ? 484 SER A N     1 
ATOM   3413  C  CA    . SER A 1 484 ? 21.734  11.350  26.684  1.00 40.96  ? 484 SER A CA    1 
ATOM   3414  C  C     . SER A 1 484 ? 22.566  10.797  25.537  1.00 40.87  ? 484 SER A C     1 
ATOM   3415  O  O     . SER A 1 484 ? 22.286  9.700   25.046  1.00 40.84  ? 484 SER A O     1 
ATOM   3416  C  CB    . SER A 1 484 ? 22.459  11.075  28.015  1.00 45.85  ? 484 SER A CB    1 
ATOM   3417  O  OG    . SER A 1 484 ? 23.720  11.723  28.095  1.00 39.79  ? 484 SER A OG    1 
ATOM   3418  N  N     . PHE A 1 485 ? 23.598  11.535  25.122  1.00 38.20  ? 485 PHE A N     1 
ATOM   3419  C  CA    . PHE A 1 485 ? 24.571  10.998  24.164  1.00 37.67  ? 485 PHE A CA    1 
ATOM   3420  C  C     . PHE A 1 485 ? 25.695  10.234  24.856  1.00 36.42  ? 485 PHE A C     1 
ATOM   3421  O  O     . PHE A 1 485 ? 26.631  9.803   24.197  1.00 37.13  ? 485 PHE A O     1 
ATOM   3422  C  CB    . PHE A 1 485 ? 25.188  12.101  23.293  1.00 35.86  ? 485 PHE A CB    1 
ATOM   3423  C  CG    . PHE A 1 485 ? 24.338  12.488  22.112  1.00 34.10  ? 485 PHE A CG    1 
ATOM   3424  C  CD1   . PHE A 1 485 ? 23.308  13.409  22.254  1.00 32.59  ? 485 PHE A CD1   1 
ATOM   3425  C  CD2   . PHE A 1 485 ? 24.564  11.919  20.863  1.00 27.36  ? 485 PHE A CD2   1 
ATOM   3426  C  CE1   . PHE A 1 485 ? 22.512  13.761  21.165  1.00 35.78  ? 485 PHE A CE1   1 
ATOM   3427  C  CE2   . PHE A 1 485 ? 23.768  12.263  19.758  1.00 34.80  ? 485 PHE A CE2   1 
ATOM   3428  C  CZ    . PHE A 1 485 ? 22.738  13.186  19.912  1.00 32.91  ? 485 PHE A CZ    1 
ATOM   3429  N  N     . ARG A 1 486 ? 25.610  10.076  26.172  1.00 34.34  ? 486 ARG A N     1 
ATOM   3430  C  CA    . ARG A 1 486 ? 26.671  9.411   26.925  1.00 44.49  ? 486 ARG A CA    1 
ATOM   3431  C  C     . ARG A 1 486 ? 26.881  7.959   26.476  1.00 48.29  ? 486 ARG A C     1 
ATOM   3432  O  O     . ARG A 1 486 ? 27.966  7.410   26.624  1.00 53.32  ? 486 ARG A O     1 
ATOM   3433  C  CB    . ARG A 1 486 ? 26.389  9.478   28.431  1.00 46.76  ? 486 ARG A CB    1 
ATOM   3434  C  CG    . ARG A 1 486 ? 25.487  8.385   28.968  1.00 59.78  ? 486 ARG A CG    1 
ATOM   3435  C  CD    . ARG A 1 486 ? 25.246  8.556   30.469  1.00 66.12  ? 486 ARG A CD    1 
ATOM   3436  N  NE    . ARG A 1 486 ? 24.392  9.703   30.772  1.00 61.78  ? 486 ARG A NE    1 
ATOM   3437  C  CZ    . ARG A 1 486 ? 24.851  10.871  31.208  1.00 70.51  ? 486 ARG A CZ    1 
ATOM   3438  N  NH1   . ARG A 1 486 ? 26.158  11.038  31.400  1.00 69.69  ? 486 ARG A NH1   1 
ATOM   3439  N  NH2   . ARG A 1 486 ? 24.009  11.867  31.455  1.00 61.64  ? 486 ARG A NH2   1 
ATOM   3440  N  N     . PHE A 1 487 ? 25.857  7.336   25.908  1.00 45.50  ? 487 PHE A N     1 
ATOM   3441  C  CA    . PHE A 1 487 ? 26.022  5.964   25.433  1.00 52.61  ? 487 PHE A CA    1 
ATOM   3442  C  C     . PHE A 1 487 ? 26.257  5.945   23.928  1.00 55.95  ? 487 PHE A C     1 
ATOM   3443  O  O     . PHE A 1 487 ? 25.990  4.939   23.259  1.00 59.20  ? 487 PHE A O     1 
ATOM   3444  C  CB    . PHE A 1 487 ? 24.808  5.106   25.778  1.00 49.93  ? 487 PHE A CB    1 
ATOM   3445  C  CG    . PHE A 1 487 ? 24.400  5.187   27.218  1.00 57.30  ? 487 PHE A CG    1 
ATOM   3446  C  CD1   . PHE A 1 487 ? 25.162  4.578   28.203  1.00 58.49  ? 487 PHE A CD1   1 
ATOM   3447  C  CD2   . PHE A 1 487 ? 23.238  5.858   27.585  1.00 59.22  ? 487 PHE A CD2   1 
ATOM   3448  C  CE1   . PHE A 1 487 ? 24.784  4.649   29.530  1.00 63.74  ? 487 PHE A CE1   1 
ATOM   3449  C  CE2   . PHE A 1 487 ? 22.856  5.932   28.913  1.00 61.62  ? 487 PHE A CE2   1 
ATOM   3450  C  CZ    . PHE A 1 487 ? 23.628  5.327   29.883  1.00 53.85  ? 487 PHE A CZ    1 
ATOM   3451  N  N     . GLY A 1 488 ? 26.706  7.077   23.392  1.00 42.13  ? 488 GLY A N     1 
ATOM   3452  C  CA    . GLY A 1 488 ? 26.999  7.173   21.973  1.00 42.41  ? 488 GLY A CA    1 
ATOM   3453  C  C     . GLY A 1 488 ? 25.829  7.665   21.145  1.00 43.69  ? 488 GLY A C     1 
ATOM   3454  O  O     . GLY A 1 488 ? 24.779  8.014   21.673  1.00 41.39  ? 488 GLY A O     1 
ATOM   3455  N  N     . GLY A 1 489 ? 26.014  7.690   19.833  1.00 40.44  ? 489 GLY A N     1 
ATOM   3456  C  CA    . GLY A 1 489 ? 24.995  8.186   18.939  1.00 37.05  ? 489 GLY A CA    1 
ATOM   3457  C  C     . GLY A 1 489 ? 25.607  8.347   17.570  1.00 35.99  ? 489 GLY A C     1 
ATOM   3458  O  O     . GLY A 1 489 ? 26.682  7.836   17.324  1.00 39.38  ? 489 GLY A O     1 
ATOM   3459  N  N     . ALA A 1 490 ? 24.951  9.086   16.687  1.00 28.40  ? 490 ALA A N     1 
ATOM   3460  C  CA    . ALA A 1 490 ? 25.458  9.235   15.333  1.00 33.84  ? 490 ALA A CA    1 
ATOM   3461  C  C     . ALA A 1 490 ? 24.973  10.521  14.686  1.00 30.52  ? 490 ALA A C     1 
ATOM   3462  O  O     . ALA A 1 490 ? 24.039  11.168  15.177  1.00 31.83  ? 490 ALA A O     1 
ATOM   3463  C  CB    . ALA A 1 490 ? 25.044  8.025   14.486  1.00 38.15  ? 490 ALA A CB    1 
ATOM   3464  N  N     . ALA A 1 491 ? 25.589  10.890  13.564  1.00 30.48  ? 491 ALA A N     1 
ATOM   3465  C  CA    . ALA A 1 491 ? 25.125  12.085  12.870  1.00 28.01  ? 491 ALA A CA    1 
ATOM   3466  C  C     . ALA A 1 491 ? 25.140  11.869  11.377  1.00 30.16  ? 491 ALA A C     1 
ATOM   3467  O  O     . ALA A 1 491 ? 25.883  11.037  10.875  1.00 31.78  ? 491 ALA A O     1 
ATOM   3468  C  CB    . ALA A 1 491 ? 25.992  13.306  13.236  1.00 28.53  ? 491 ALA A CB    1 
ATOM   3469  N  N     . CYS A 1 492 ? 24.330  12.631  10.667  1.00 26.00  ? 492 CYS A N     1 
ATOM   3470  C  CA    . CYS A 1 492 ? 24.368  12.616  9.210   1.00 30.75  ? 492 CYS A CA    1 
ATOM   3471  C  C     . CYS A 1 492 ? 24.276  14.043  8.741   1.00 28.18  ? 492 CYS A C     1 
ATOM   3472  O  O     . CYS A 1 492 ? 23.807  14.888  9.474   1.00 33.87  ? 492 CYS A O     1 
ATOM   3473  C  CB    . CYS A 1 492 ? 23.219  11.792  8.604   1.00 30.19  ? 492 CYS A CB    1 
ATOM   3474  S  SG    . CYS A 1 492 ? 23.310  10.018  8.901   1.00 35.48  ? 492 CYS A SG    1 
ATOM   3475  N  N     . ALA A 1 493 ? 24.705  14.314  7.518   1.00 34.39  ? 493 ALA A N     1 
ATOM   3476  C  CA    . ALA A 1 493 ? 24.794  15.684  7.051   1.00 35.19  ? 493 ALA A CA    1 
ATOM   3477  C  C     . ALA A 1 493 ? 24.554  15.843  5.547   1.00 32.17  ? 493 ALA A C     1 
ATOM   3478  O  O     . ALA A 1 493 ? 24.769  14.916  4.761   1.00 35.64  ? 493 ALA A O     1 
ATOM   3479  C  CB    . ALA A 1 493 ? 26.165  16.259  7.430   1.00 28.72  ? 493 ALA A CB    1 
ATOM   3480  N  N     . VAL A 1 494 ? 24.111  17.046  5.187   1.00 33.37  ? 494 VAL A N     1 
ATOM   3481  C  CA    . VAL A 1 494 ? 23.911  17.515  3.816   1.00 38.92  ? 494 VAL A CA    1 
ATOM   3482  C  C     . VAL A 1 494 ? 24.823  18.716  3.650   1.00 34.66  ? 494 VAL A C     1 
ATOM   3483  O  O     . VAL A 1 494 ? 24.779  19.612  4.484   1.00 33.97  ? 494 VAL A O     1 
ATOM   3484  C  CB    . VAL A 1 494 ? 22.466  17.980  3.540   1.00 41.59  ? 494 VAL A CB    1 
ATOM   3485  C  CG1   . VAL A 1 494 ? 22.304  18.290  2.060   1.00 37.32  ? 494 VAL A CG1   1 
ATOM   3486  C  CG2   . VAL A 1 494 ? 21.460  16.944  4.013   1.00 42.04  ? 494 VAL A CG2   1 
ATOM   3487  N  N     . GLY A 1 495 ? 25.581  18.809  2.566   1.00 42.67  ? 495 GLY A N     1 
ATOM   3488  C  CA    . GLY A 1 495 ? 26.668  19.787  2.544   1.00 50.99  ? 495 GLY A CA    1 
ATOM   3489  C  C     . GLY A 1 495 ? 26.990  20.624  1.316   1.00 66.96  ? 495 GLY A C     1 
ATOM   3490  O  O     . GLY A 1 495 ? 27.713  20.190  0.408   1.00 68.03  ? 495 GLY A O     1 
ATOM   3491  N  N     . GLY A 1 496 ? 26.513  21.871  1.348   1.00 67.66  ? 496 GLY A N     1 
ATOM   3492  C  CA    . GLY A 1 496 ? 26.674  22.826  0.265   1.00 56.42  ? 496 GLY A CA    1 
ATOM   3493  C  C     . GLY A 1 496 ? 25.610  22.621  -0.791  1.00 67.59  ? 496 GLY A C     1 
ATOM   3494  O  O     . GLY A 1 496 ? 24.415  22.744  -0.491  1.00 74.32  ? 496 GLY A O     1 
ATOM   3495  N  N     . GLY A 1 498 ? 25.617  21.219  -4.411  1.00 70.42  ? 498 GLY A N     1 
ATOM   3496  C  CA    . GLY A 1 498 ? 24.438  20.369  -4.404  1.00 71.24  ? 498 GLY A CA    1 
ATOM   3497  C  C     . GLY A 1 498 ? 24.194  19.693  -3.065  1.00 68.36  ? 498 GLY A C     1 
ATOM   3498  O  O     . GLY A 1 498 ? 24.646  20.179  -2.028  1.00 69.56  ? 498 GLY A O     1 
ATOM   3499  N  N     . GLY A 1 499 ? 23.482  18.566  -3.095  1.00 66.99  ? 499 GLY A N     1 
ATOM   3500  C  CA    . GLY A 1 499 ? 23.121  17.834  -1.892  1.00 61.74  ? 499 GLY A CA    1 
ATOM   3501  C  C     . GLY A 1 499 ? 23.988  16.605  -1.676  1.00 69.24  ? 499 GLY A C     1 
ATOM   3502  O  O     . GLY A 1 499 ? 23.589  15.474  -1.959  1.00 73.46  ? 499 GLY A O     1 
ATOM   3503  N  N     . HIS A 1 500 ? 25.193  16.837  -1.176  1.00 63.68  ? 500 HIS A N     1 
ATOM   3504  C  CA    . HIS A 1 500 ? 26.126  15.776  -0.832  1.00 62.78  ? 500 HIS A CA    1 
ATOM   3505  C  C     . HIS A 1 500 ? 25.729  15.190  0.538   1.00 55.13  ? 500 HIS A C     1 
ATOM   3506  O  O     . HIS A 1 500 ? 25.736  15.902  1.537   1.00 54.06  ? 500 HIS A O     1 
ATOM   3507  C  CB    . HIS A 1 500 ? 27.541  16.372  -0.853  1.00 65.10  ? 500 HIS A CB    1 
ATOM   3508  C  CG    . HIS A 1 500 ? 28.611  15.490  -0.301  1.00 69.38  ? 500 HIS A CG    1 
ATOM   3509  N  ND1   . HIS A 1 500 ? 29.792  15.999  0.198   1.00 73.27  ? 500 HIS A ND1   1 
ATOM   3510  C  CD2   . HIS A 1 500 ? 28.705  14.142  -0.192  1.00 66.67  ? 500 HIS A CD2   1 
ATOM   3511  C  CE1   . HIS A 1 500 ? 30.559  15.006  0.607   1.00 67.91  ? 500 HIS A CE1   1 
ATOM   3512  N  NE2   . HIS A 1 500 ? 29.926  13.871  0.382   1.00 66.45  ? 500 HIS A NE2   1 
ATOM   3513  N  N     . LEU A 1 501 ? 25.330  13.918  0.577   1.00 52.25  ? 501 LEU A N     1 
ATOM   3514  C  CA    . LEU A 1 501 ? 24.894  13.279  1.828   1.00 43.55  ? 501 LEU A CA    1 
ATOM   3515  C  C     . LEU A 1 501 ? 25.984  12.418  2.447   1.00 42.21  ? 501 LEU A C     1 
ATOM   3516  O  O     . LEU A 1 501 ? 26.580  11.610  1.749   1.00 44.31  ? 501 LEU A O     1 
ATOM   3517  C  CB    . LEU A 1 501 ? 23.655  12.409  1.588   1.00 42.54  ? 501 LEU A CB    1 
ATOM   3518  C  CG    . LEU A 1 501 ? 22.355  13.091  1.177   1.00 42.12  ? 501 LEU A CG    1 
ATOM   3519  C  CD1   . LEU A 1 501 ? 21.190  12.106  1.106   1.00 44.74  ? 501 LEU A CD1   1 
ATOM   3520  C  CD2   . LEU A 1 501 ? 22.054  14.109  2.222   1.00 42.51  ? 501 LEU A CD2   1 
ATOM   3521  N  N     . LEU A 1 502 ? 26.225  12.558  3.753   1.00 36.01  ? 502 LEU A N     1 
ATOM   3522  C  CA    . LEU A 1 502 ? 27.241  11.728  4.402   1.00 43.81  ? 502 LEU A CA    1 
ATOM   3523  C  C     . LEU A 1 502 ? 26.892  11.368  5.839   1.00 42.25  ? 502 LEU A C     1 
ATOM   3524  O  O     . LEU A 1 502 ? 26.116  12.062  6.482   1.00 37.83  ? 502 LEU A O     1 
ATOM   3525  C  CB    . LEU A 1 502 ? 28.622  12.409  4.363   1.00 43.07  ? 502 LEU A CB    1 
ATOM   3526  C  CG    . LEU A 1 502 ? 28.790  13.702  5.135   1.00 44.54  ? 502 LEU A CG    1 
ATOM   3527  C  CD1   . LEU A 1 502 ? 29.927  13.573  6.165   1.00 49.96  ? 502 LEU A CD1   1 
ATOM   3528  C  CD2   . LEU A 1 502 ? 29.059  14.852  4.162   1.00 53.99  ? 502 LEU A CD2   1 
ATOM   3529  N  N     . TRP A 1 503 ? 27.467  10.267  6.324   1.00 34.13  ? 503 TRP A N     1 
ATOM   3530  C  CA    . TRP A 1 503 ? 27.213  9.766   7.670   1.00 35.43  ? 503 TRP A CA    1 
ATOM   3531  C  C     . TRP A 1 503 ? 28.476  9.812   8.523   1.00 35.93  ? 503 TRP A C     1 
ATOM   3532  O  O     . TRP A 1 503 ? 29.580  9.819   7.996   1.00 34.66  ? 503 TRP A O     1 
ATOM   3533  C  CB    . TRP A 1 503 ? 26.658  8.330   7.620   1.00 32.23  ? 503 TRP A CB    1 
ATOM   3534  C  CG    . TRP A 1 503 ? 27.571  7.387   6.916   1.00 39.54  ? 503 TRP A CG    1 
ATOM   3535  C  CD1   . TRP A 1 503 ? 27.563  7.087   5.586   1.00 43.71  ? 503 TRP A CD1   1 
ATOM   3536  C  CD2   . TRP A 1 503 ? 28.650  6.642   7.491   1.00 36.89  ? 503 TRP A CD2   1 
ATOM   3537  N  NE1   . TRP A 1 503 ? 28.557  6.192   5.299   1.00 39.31  ? 503 TRP A NE1   1 
ATOM   3538  C  CE2   . TRP A 1 503 ? 29.238  5.893   6.454   1.00 42.23  ? 503 TRP A CE2   1 
ATOM   3539  C  CE3   . TRP A 1 503 ? 29.167  6.518   8.788   1.00 40.56  ? 503 TRP A CE3   1 
ATOM   3540  C  CZ2   . TRP A 1 503 ? 30.335  5.044   6.660   1.00 47.62  ? 503 TRP A CZ2   1 
ATOM   3541  C  CZ3   . TRP A 1 503 ? 30.263  5.668   8.999   1.00 51.29  ? 503 TRP A CZ3   1 
ATOM   3542  C  CH2   . TRP A 1 503 ? 30.830  4.946   7.940   1.00 51.71  ? 503 TRP A CH2   1 
ATOM   3543  N  N     . THR A 1 504 ? 28.283  9.899   9.836   1.00 31.61  ? 504 THR A N     1 
ATOM   3544  C  CA    . THR A 1 504 ? 29.355  9.924   10.812  1.00 36.32  ? 504 THR A CA    1 
ATOM   3545  C  C     . THR A 1 504 ? 29.031  9.039   12.013  1.00 34.86  ? 504 THR A C     1 
ATOM   3546  O  O     . THR A 1 504 ? 27.959  9.177   12.641  1.00 35.15  ? 504 THR A O     1 
ATOM   3547  C  CB    . THR A 1 504 ? 29.628  11.371  11.359  1.00 39.93  ? 504 THR A CB    1 
ATOM   3548  O  OG1   . THR A 1 504 ? 30.016  12.251  10.291  1.00 43.50  ? 504 THR A OG1   1 
ATOM   3549  C  CG2   . THR A 1 504 ? 30.733  11.324  12.413  1.00 43.67  ? 504 THR A CG2   1 
ATOM   3550  N  N     . LEU A 1 505 ? 29.951  8.133   12.334  1.00 34.99  ? 505 LEU A N     1 
ATOM   3551  C  CA    . LEU A 1 505 ? 29.838  7.360   13.562  1.00 37.26  ? 505 LEU A CA    1 
ATOM   3552  C  C     . LEU A 1 505 ? 30.845  7.892   14.573  1.00 45.35  ? 505 LEU A C     1 
ATOM   3553  O  O     . LEU A 1 505 ? 31.867  8.477   14.207  1.00 43.04  ? 505 LEU A O     1 
ATOM   3554  C  CB    . LEU A 1 505 ? 30.056  5.866   13.296  1.00 43.44  ? 505 LEU A CB    1 
ATOM   3555  C  CG    . LEU A 1 505 ? 28.788  5.232   12.717  1.00 48.54  ? 505 LEU A CG    1 
ATOM   3556  C  CD1   . LEU A 1 505 ? 28.943  3.745   12.405  1.00 45.86  ? 505 LEU A CD1   1 
ATOM   3557  C  CD2   . LEU A 1 505 ? 27.632  5.461   13.686  1.00 44.40  ? 505 LEU A CD2   1 
ATOM   3558  N  N     . PRO A 1 506 ? 30.575  7.673   15.858  1.00 44.25  ? 506 PRO A N     1 
ATOM   3559  C  CA    . PRO A 1 506 ? 31.625  7.993   16.816  1.00 46.73  ? 506 PRO A CA    1 
ATOM   3560  C  C     . PRO A 1 506 ? 32.708  6.904   16.799  1.00 54.09  ? 506 PRO A C     1 
ATOM   3561  O  O     . PRO A 1 506 ? 32.378  5.714   16.699  1.00 46.46  ? 506 PRO A O     1 
ATOM   3562  C  CB    . PRO A 1 506 ? 30.867  8.039   18.143  1.00 51.55  ? 506 PRO A CB    1 
ATOM   3563  C  CG    . PRO A 1 506 ? 29.750  7.027   17.969  1.00 46.31  ? 506 PRO A CG    1 
ATOM   3564  C  CD    . PRO A 1 506 ? 29.472  6.912   16.473  1.00 42.16  ? 506 PRO A CD    1 
ATOM   3565  N  N     . GLU A 1 507 ? 33.979  7.308   16.859  1.00 54.32  ? 507 GLU A N     1 
ATOM   3566  C  CA    . GLU A 1 507 ? 35.072  6.346   16.963  1.00 57.96  ? 507 GLU A CA    1 
ATOM   3567  C  C     . GLU A 1 507 ? 34.952  5.538   18.253  1.00 55.18  ? 507 GLU A C     1 
ATOM   3568  O  O     . GLU A 1 507 ? 34.356  5.989   19.233  1.00 58.88  ? 507 GLU A O     1 
ATOM   3569  C  CB    . GLU A 1 507 ? 36.429  7.050   16.890  1.00 63.83  ? 507 GLU A CB    1 
ATOM   3570  N  N     . ALA A 1 508 ? 35.527  4.343   18.251  1.00 65.18  ? 508 ALA A N     1 
ATOM   3571  C  CA    . ALA A 1 508 ? 35.348  3.417   19.363  1.00 65.13  ? 508 ALA A CA    1 
ATOM   3572  C  C     . ALA A 1 508 ? 35.951  3.859   20.702  1.00 70.40  ? 508 ALA A C     1 
ATOM   3573  O  O     . ALA A 1 508 ? 37.175  3.935   20.877  1.00 69.46  ? 508 ALA A O     1 
ATOM   3574  C  CB    . ALA A 1 508 ? 35.901  2.048   18.985  1.00 66.04  ? 508 ALA A CB    1 
ATOM   3575  N  N     . GLN A 1 509 ? 35.055  4.236   21.605  1.00 80.91  ? 509 GLN A N     1 
ATOM   3576  C  CA    . GLN A 1 509 ? 35.098  3.758   22.976  1.00 90.34  ? 509 GLN A CA    1 
ATOM   3577  C  C     . GLN A 1 509 ? 33.704  3.157   23.150  1.00 92.80  ? 509 GLN A C     1 
ATOM   3578  O  O     . GLN A 1 509 ? 32.721  3.734   22.673  1.00 90.80  ? 509 GLN A O     1 
ATOM   3579  C  CB    . GLN A 1 509 ? 35.378  4.876   23.971  1.00 83.65  ? 509 GLN A CB    1 
ATOM   3580  N  N     . ALA A 1 510 ? 33.594  2.038   23.857  1.00 93.37  ? 510 ALA A N     1 
ATOM   3581  C  CA    . ALA A 1 510 ? 32.289  1.398   24.022  1.00 97.67  ? 510 ALA A CA    1 
ATOM   3582  C  C     . ALA A 1 510 ? 31.746  1.672   25.412  1.00 100.42 ? 510 ALA A C     1 
ATOM   3583  O  O     . ALA A 1 510 ? 30.724  1.112   25.826  1.00 96.25  ? 510 ALA A O     1 
ATOM   3584  C  CB    . ALA A 1 510 ? 32.386  -0.101  23.764  1.00 96.94  ? 510 ALA A CB    1 
ATOM   3585  N  N     . GLY A 1 511 ? 32.449  2.549   26.121  1.00 98.31  ? 511 GLY A N     1 
ATOM   3586  C  CA    . GLY A 1 511 ? 32.109  2.887   27.492  1.00 95.15  ? 511 GLY A CA    1 
ATOM   3587  C  C     . GLY A 1 511 ? 31.270  4.154   27.547  1.00 85.79  ? 511 GLY A C     1 
ATOM   3588  O  O     . GLY A 1 511 ? 31.004  4.789   26.523  1.00 83.46  ? 511 GLY A O     1 
ATOM   3589  N  N     . GLU A 1 512 ? 30.849  4.511   28.754  1.00 80.67  ? 512 GLU A N     1 
ATOM   3590  C  CA    . GLU A 1 512 ? 30.157  5.766   28.975  1.00 76.55  ? 512 GLU A CA    1 
ATOM   3591  C  C     . GLU A 1 512 ? 31.149  6.916   28.745  1.00 74.04  ? 512 GLU A C     1 
ATOM   3592  O  O     . GLU A 1 512 ? 32.269  6.908   29.269  1.00 66.11  ? 512 GLU A O     1 
ATOM   3593  C  CB    . GLU A 1 512 ? 29.562  5.811   30.387  1.00 72.75  ? 512 GLU A CB    1 
ATOM   3594  C  CG    . GLU A 1 512 ? 28.354  6.714   30.520  1.00 74.61  ? 512 GLU A CG    1 
ATOM   3595  C  CD    . GLU A 1 512 ? 28.272  7.395   31.876  1.00 83.05  ? 512 GLU A CD    1 
ATOM   3596  O  OE1   . GLU A 1 512 ? 28.424  6.702   32.907  1.00 88.53  ? 512 GLU A OE1   1 
ATOM   3597  O  OE2   . GLU A 1 512 ? 28.058  8.629   31.906  1.00 85.87  ? 512 GLU A OE2   1 
ATOM   3598  N  N     . ARG A 1 513 ? 30.745  7.901   27.953  1.00 65.43  ? 513 ARG A N     1 
ATOM   3599  C  CA    . ARG A 1 513 ? 31.610  9.045   27.696  1.00 56.05  ? 513 ARG A CA    1 
ATOM   3600  C  C     . ARG A 1 513 ? 31.000  10.331  28.236  1.00 46.19  ? 513 ARG A C     1 
ATOM   3601  O  O     . ARG A 1 513 ? 29.850  10.345  28.679  1.00 56.12  ? 513 ARG A O     1 
ATOM   3602  C  CB    . ARG A 1 513 ? 31.879  9.176   26.191  1.00 58.90  ? 513 ARG A CB    1 
ATOM   3603  C  CG    . ARG A 1 513 ? 32.732  8.063   25.595  1.00 61.05  ? 513 ARG A CG    1 
ATOM   3604  C  CD    . ARG A 1 513 ? 33.796  8.671   24.691  1.00 62.36  ? 513 ARG A CD    1 
ATOM   3605  N  NE    . ARG A 1 513 ? 33.330  8.924   23.333  1.00 57.15  ? 513 ARG A NE    1 
ATOM   3606  C  CZ    . ARG A 1 513 ? 33.665  9.994   22.616  1.00 58.23  ? 513 ARG A CZ    1 
ATOM   3607  N  NH1   . ARG A 1 513 ? 34.430  10.938  23.149  1.00 52.80  ? 513 ARG A NH1   1 
ATOM   3608  N  NH2   . ARG A 1 513 ? 33.211  10.134  21.375  1.00 51.27  ? 513 ARG A NH2   1 
ATOM   3609  N  N     . ILE A 1 514 ? 31.763  11.416  28.207  1.00 45.52  ? 514 ILE A N     1 
ATOM   3610  C  CA    . ILE A 1 514 ? 31.177  12.719  28.474  1.00 41.84  ? 514 ILE A CA    1 
ATOM   3611  C  C     . ILE A 1 514 ? 30.361  13.098  27.229  1.00 40.18  ? 514 ILE A C     1 
ATOM   3612  O  O     . ILE A 1 514 ? 30.916  13.237  26.141  1.00 39.35  ? 514 ILE A O     1 
ATOM   3613  C  CB    . ILE A 1 514 ? 32.257  13.757  28.793  1.00 44.02  ? 514 ILE A CB    1 
ATOM   3614  C  CG1   . ILE A 1 514 ? 33.082  13.281  29.994  1.00 51.01  ? 514 ILE A CG1   1 
ATOM   3615  C  CG2   . ILE A 1 514 ? 31.648  15.133  29.090  1.00 33.57  ? 514 ILE A CG2   1 
ATOM   3616  C  CD1   . ILE A 1 514 ? 34.285  14.139  30.292  1.00 54.28  ? 514 ILE A CD1   1 
ATOM   3617  N  N     . PRO A 1 515 ? 29.034  13.245  27.389  1.00 40.08  ? 515 PRO A N     1 
ATOM   3618  C  CA    . PRO A 1 515 ? 28.110  13.480  26.259  1.00 36.03  ? 515 PRO A CA    1 
ATOM   3619  C  C     . PRO A 1 515 ? 28.522  14.664  25.363  1.00 32.18  ? 515 PRO A C     1 
ATOM   3620  O  O     . PRO A 1 515 ? 28.463  14.550  24.124  1.00 35.54  ? 515 PRO A O     1 
ATOM   3621  C  CB    . PRO A 1 515 ? 26.753  13.720  26.955  1.00 39.25  ? 515 PRO A CB    1 
ATOM   3622  C  CG    . PRO A 1 515 ? 27.073  13.986  28.398  1.00 44.71  ? 515 PRO A CG    1 
ATOM   3623  C  CD    . PRO A 1 515 ? 28.319  13.180  28.678  1.00 40.01  ? 515 PRO A CD    1 
ATOM   3624  N  N     . GLN A 1 516 ? 28.941  15.773  25.966  1.00 31.14  ? 516 GLN A N     1 
ATOM   3625  C  CA    . GLN A 1 516 ? 29.426  16.918  25.190  1.00 34.01  ? 516 GLN A CA    1 
ATOM   3626  C  C     . GLN A 1 516 ? 30.547  16.528  24.256  1.00 32.42  ? 516 GLN A C     1 
ATOM   3627  O  O     . GLN A 1 516 ? 30.623  17.052  23.133  1.00 30.75  ? 516 GLN A O     1 
ATOM   3628  C  CB    . GLN A 1 516 ? 29.903  18.057  26.096  1.00 35.22  ? 516 GLN A CB    1 
ATOM   3629  C  CG    . GLN A 1 516 ? 28.775  18.716  26.882  1.00 45.54  ? 516 GLN A CG    1 
ATOM   3630  C  CD    . GLN A 1 516 ? 29.196  20.028  27.520  1.00 47.73  ? 516 GLN A CD    1 
ATOM   3631  O  OE1   . GLN A 1 516 ? 30.326  20.477  27.354  1.00 54.38  ? 516 GLN A OE1   1 
ATOM   3632  N  NE2   . GLN A 1 516 ? 28.279  20.653  28.236  1.00 49.56  ? 516 GLN A NE2   1 
ATOM   3633  N  N     . GLU A 1 517 ? 31.395  15.592  24.692  1.00 30.66  ? 517 GLU A N     1 
ATOM   3634  C  CA    . GLU A 1 517 ? 32.528  15.185  23.861  1.00 31.87  ? 517 GLU A CA    1 
ATOM   3635  C  C     . GLU A 1 517 ? 32.071  14.246  22.744  1.00 32.97  ? 517 GLU A C     1 
ATOM   3636  O  O     . GLU A 1 517 ? 32.616  14.279  21.644  1.00 31.83  ? 517 GLU A O     1 
ATOM   3637  C  CB    . GLU A 1 517 ? 33.635  14.524  24.716  1.00 32.79  ? 517 GLU A CB    1 
ATOM   3638  C  CG    . GLU A 1 517 ? 34.509  15.563  25.424  1.00 37.93  ? 517 GLU A CG    1 
ATOM   3639  C  CD    . GLU A 1 517 ? 35.503  14.979  26.405  1.00 46.90  ? 517 GLU A CD    1 
ATOM   3640  O  OE1   . GLU A 1 517 ? 36.036  15.780  27.193  1.00 45.41  ? 517 GLU A OE1   1 
ATOM   3641  O  OE2   . GLU A 1 517 ? 35.756  13.744  26.403  1.00 46.81  ? 517 GLU A OE2   1 
ATOM   3642  N  N     . VAL A 1 518 ? 31.063  13.422  23.004  1.00 27.17  ? 518 VAL A N     1 
ATOM   3643  C  CA    . VAL A 1 518 ? 30.512  12.592  21.926  1.00 33.41  ? 518 VAL A CA    1 
ATOM   3644  C  C     . VAL A 1 518 ? 29.901  13.488  20.833  1.00 27.55  ? 518 VAL A C     1 
ATOM   3645  O  O     . VAL A 1 518 ? 30.191  13.341  19.620  1.00 25.17  ? 518 VAL A O     1 
ATOM   3646  C  CB    . VAL A 1 518 ? 29.456  11.595  22.459  1.00 35.96  ? 518 VAL A CB    1 
ATOM   3647  C  CG1   . VAL A 1 518 ? 28.743  10.890  21.302  1.00 35.36  ? 518 VAL A CG1   1 
ATOM   3648  C  CG2   . VAL A 1 518 ? 30.108  10.569  23.349  1.00 37.16  ? 518 VAL A CG2   1 
ATOM   3649  N  N     . VAL A 1 519 ? 29.101  14.458  21.266  1.00 28.77  ? 519 VAL A N     1 
ATOM   3650  C  CA    . VAL A 1 519 ? 28.441  15.374  20.307  1.00 29.27  ? 519 VAL A CA    1 
ATOM   3651  C  C     . VAL A 1 519 ? 29.477  16.141  19.503  1.00 27.47  ? 519 VAL A C     1 
ATOM   3652  O  O     . VAL A 1 519 ? 29.457  16.154  18.251  1.00 31.29  ? 519 VAL A O     1 
ATOM   3653  C  CB    . VAL A 1 519 ? 27.486  16.357  21.032  1.00 25.20  ? 519 VAL A CB    1 
ATOM   3654  C  CG1   . VAL A 1 519 ? 26.917  17.397  20.061  1.00 27.45  ? 519 VAL A CG1   1 
ATOM   3655  C  CG2   . VAL A 1 519 ? 26.375  15.576  21.685  1.00 31.54  ? 519 VAL A CG2   1 
ATOM   3656  N  N     . TRP A 1 520 ? 30.419  16.749  20.216  1.00 27.99  ? 520 TRP A N     1 
ATOM   3657  C  CA    . TRP A 1 520 ? 31.455  17.484  19.502  1.00 30.60  ? 520 TRP A CA    1 
ATOM   3658  C  C     . TRP A 1 520 ? 32.253  16.570  18.570  1.00 32.78  ? 520 TRP A C     1 
ATOM   3659  O  O     . TRP A 1 520 ? 32.515  16.964  17.463  1.00 27.37  ? 520 TRP A O     1 
ATOM   3660  C  CB    . TRP A 1 520 ? 32.407  18.213  20.458  1.00 31.88  ? 520 TRP A CB    1 
ATOM   3661  C  CG    . TRP A 1 520 ? 33.687  18.659  19.776  1.00 34.00  ? 520 TRP A CG    1 
ATOM   3662  C  CD1   . TRP A 1 520 ? 34.978  18.292  20.119  1.00 34.32  ? 520 TRP A CD1   1 
ATOM   3663  C  CD2   . TRP A 1 520 ? 33.815  19.518  18.614  1.00 28.70  ? 520 TRP A CD2   1 
ATOM   3664  N  NE1   . TRP A 1 520 ? 35.876  18.876  19.255  1.00 29.08  ? 520 TRP A NE1   1 
ATOM   3665  C  CE2   . TRP A 1 520 ? 35.197  19.634  18.333  1.00 30.40  ? 520 TRP A CE2   1 
ATOM   3666  C  CE3   . TRP A 1 520 ? 32.901  20.175  17.789  1.00 30.38  ? 520 TRP A CE3   1 
ATOM   3667  C  CZ2   . TRP A 1 520 ? 35.678  20.395  17.259  1.00 27.27  ? 520 TRP A CZ2   1 
ATOM   3668  C  CZ3   . TRP A 1 520 ? 33.374  20.928  16.716  1.00 25.21  ? 520 TRP A CZ3   1 
ATOM   3669  C  CH2   . TRP A 1 520 ? 34.759  21.029  16.459  1.00 28.25  ? 520 TRP A CH2   1 
ATOM   3670  N  N     . ASP A 1 521 ? 32.588  15.345  18.977  1.00 33.20  ? 521 ASP A N     1 
ATOM   3671  C  CA    . ASP A 1 521 ? 33.352  14.432  18.102  1.00 31.52  ? 521 ASP A CA    1 
ATOM   3672  C  C     . ASP A 1 521 ? 32.603  14.111  16.795  1.00 32.77  ? 521 ASP A C     1 
ATOM   3673  O  O     . ASP A 1 521 ? 33.196  14.173  15.685  1.00 27.13  ? 521 ASP A O     1 
ATOM   3674  C  CB    . ASP A 1 521 ? 33.678  13.126  18.853  1.00 38.41  ? 521 ASP A CB    1 
ATOM   3675  C  CG    . ASP A 1 521 ? 34.841  13.291  19.867  1.00 48.42  ? 521 ASP A CG    1 
ATOM   3676  O  OD1   . ASP A 1 521 ? 35.227  14.442  20.190  1.00 44.00  ? 521 ASP A OD1   1 
ATOM   3677  O  OD2   . ASP A 1 521 ? 35.346  12.258  20.369  1.00 56.27  ? 521 ASP A OD2   1 
ATOM   3678  N  N     . LEU A 1 522 ? 31.303  13.805  16.912  1.00 25.63  ? 522 LEU A N     1 
ATOM   3679  C  CA    . LEU A 1 522 ? 30.462  13.641  15.706  1.00 35.04  ? 522 LEU A CA    1 
ATOM   3680  C  C     . LEU A 1 522 ? 30.526  14.894  14.789  1.00 31.10  ? 522 LEU A C     1 
ATOM   3681  O  O     . LEU A 1 522 ? 30.734  14.806  13.538  1.00 33.51  ? 522 LEU A O     1 
ATOM   3682  C  CB    . LEU A 1 522 ? 28.995  13.354  16.086  1.00 34.74  ? 522 LEU A CB    1 
ATOM   3683  C  CG    . LEU A 1 522 ? 28.659  12.014  16.769  1.00 37.00  ? 522 LEU A CG    1 
ATOM   3684  C  CD1   . LEU A 1 522 ? 27.179  12.032  17.240  1.00 28.68  ? 522 LEU A CD1   1 
ATOM   3685  C  CD2   . LEU A 1 522 ? 28.915  10.811  15.837  1.00 32.09  ? 522 LEU A CD2   1 
ATOM   3686  N  N     . LEU A 1 523 ? 30.318  16.064  15.394  1.00 29.62  ? 523 LEU A N     1 
ATOM   3687  C  CA    . LEU A 1 523 ? 30.372  17.311  14.587  1.00 30.90  ? 523 LEU A CA    1 
ATOM   3688  C  C     . LEU A 1 523 ? 31.750  17.567  13.959  1.00 28.22  ? 523 LEU A C     1 
ATOM   3689  O  O     . LEU A 1 523 ? 31.861  17.871  12.786  1.00 27.72  ? 523 LEU A O     1 
ATOM   3690  C  CB    . LEU A 1 523 ? 29.995  18.526  15.435  1.00 28.67  ? 523 LEU A CB    1 
ATOM   3691  C  CG    . LEU A 1 523 ? 30.069  19.859  14.682  1.00 30.72  ? 523 LEU A CG    1 
ATOM   3692  C  CD1   . LEU A 1 523 ? 29.168  19.793  13.446  1.00 28.32  ? 523 LEU A CD1   1 
ATOM   3693  C  CD2   . LEU A 1 523 ? 29.681  21.027  15.588  1.00 25.22  ? 523 LEU A CD2   1 
ATOM   3694  N  N     . GLU A 1 524 ? 32.799  17.378  14.738  1.00 25.48  ? 524 GLU A N     1 
ATOM   3695  C  CA    . GLU A 1 524 ? 34.190  17.605  14.314  1.00 34.46  ? 524 GLU A CA    1 
ATOM   3696  C  C     . GLU A 1 524 ? 34.489  16.726  13.115  1.00 28.67  ? 524 GLU A C     1 
ATOM   3697  O  O     . GLU A 1 524 ? 35.059  17.183  12.122  1.00 30.74  ? 524 GLU A O     1 
ATOM   3698  C  CB    . GLU A 1 524 ? 35.175  17.308  15.466  1.00 27.26  ? 524 GLU A CB    1 
ATOM   3699  C  CG    . GLU A 1 524 ? 36.669  17.657  15.173  1.00 38.23  ? 524 GLU A CG    1 
ATOM   3700  C  CD    . GLU A 1 524 ? 37.359  16.593  14.307  1.00 39.34  ? 524 GLU A CD    1 
ATOM   3701  O  OE1   . GLU A 1 524 ? 37.012  15.385  14.409  1.00 37.05  ? 524 GLU A OE1   1 
ATOM   3702  O  OE2   . GLU A 1 524 ? 38.244  16.969  13.521  1.00 42.52  ? 524 GLU A OE2   1 
ATOM   3703  N  N     . GLU A 1 525 ? 34.080  15.468  13.194  1.00 26.92  ? 525 GLU A N     1 
ATOM   3704  C  CA    . GLU A 1 525 ? 34.295  14.550  12.063  1.00 30.94  ? 525 GLU A CA    1 
ATOM   3705  C  C     . GLU A 1 525 ? 33.533  15.033  10.818  1.00 32.14  ? 525 GLU A C     1 
ATOM   3706  O  O     . GLU A 1 525 ? 34.050  15.021  9.677   1.00 31.10  ? 525 GLU A O     1 
ATOM   3707  C  CB    . GLU A 1 525 ? 33.859  13.135  12.463  1.00 37.26  ? 525 GLU A CB    1 
ATOM   3708  C  CG    . GLU A 1 525 ? 34.247  12.042  11.483  1.00 48.66  ? 525 GLU A CG    1 
ATOM   3709  C  CD    . GLU A 1 525 ? 35.732  11.688  11.568  1.00 55.93  ? 525 GLU A CD    1 
ATOM   3710  O  OE1   . GLU A 1 525 ? 36.235  11.439  12.693  1.00 46.56  ? 525 GLU A OE1   1 
ATOM   3711  O  OE2   . GLU A 1 525 ? 36.398  11.683  10.509  1.00 54.37  ? 525 GLU A OE2   1 
ATOM   3712  N  N     . THR A 1 526 ? 32.296  15.485  11.034  1.00 30.54  ? 526 THR A N     1 
ATOM   3713  C  CA    . THR A 1 526 ? 31.544  16.065  9.917   1.00 31.11  ? 526 THR A CA    1 
ATOM   3714  C  C     . THR A 1 526 ? 32.234  17.294  9.277   1.00 27.30  ? 526 THR A C     1 
ATOM   3715  O  O     . THR A 1 526 ? 32.294  17.444  8.042   1.00 32.67  ? 526 THR A O     1 
ATOM   3716  C  CB    . THR A 1 526 ? 30.121  16.439  10.371  1.00 31.59  ? 526 THR A CB    1 
ATOM   3717  O  OG1   . THR A 1 526 ? 29.498  15.276  10.934  1.00 32.88  ? 526 THR A OG1   1 
ATOM   3718  C  CG2   . THR A 1 526 ? 29.325  16.901  9.214   1.00 28.90  ? 526 THR A CG2   1 
ATOM   3719  N  N     . LEU A 1 527 ? 32.721  18.195  10.121  1.00 25.59  ? 527 LEU A N     1 
ATOM   3720  C  CA    . LEU A 1 527 ? 33.470  19.363  9.661   1.00 30.87  ? 527 LEU A CA    1 
ATOM   3721  C  C     . LEU A 1 527 ? 34.702  18.934  8.878   1.00 35.43  ? 527 LEU A C     1 
ATOM   3722  O  O     . LEU A 1 527 ? 35.061  19.569  7.893   1.00 29.70  ? 527 LEU A O     1 
ATOM   3723  C  CB    . LEU A 1 527 ? 33.924  20.215  10.842  1.00 30.14  ? 527 LEU A CB    1 
ATOM   3724  C  CG    . LEU A 1 527 ? 32.825  20.904  11.645  1.00 38.75  ? 527 LEU A CG    1 
ATOM   3725  C  CD1   . LEU A 1 527 ? 33.496  21.679  12.763  1.00 31.43  ? 527 LEU A CD1   1 
ATOM   3726  C  CD2   . LEU A 1 527 ? 32.011  21.837  10.760  1.00 30.02  ? 527 LEU A CD2   1 
ATOM   3727  N  N     . TRP A 1 528 ? 35.367  17.874  9.349   1.00 31.05  ? 528 TRP A N     1 
ATOM   3728  C  CA    . TRP A 1 528 ? 36.605  17.388  8.709   1.00 31.12  ? 528 TRP A CA    1 
ATOM   3729  C  C     . TRP A 1 528 ? 36.294  16.899  7.305   1.00 36.26  ? 528 TRP A C     1 
ATOM   3730  O  O     . TRP A 1 528 ? 37.019  17.220  6.366   1.00 32.54  ? 528 TRP A O     1 
ATOM   3731  C  CB    . TRP A 1 528 ? 37.255  16.277  9.527   1.00 30.88  ? 528 TRP A CB    1 
ATOM   3732  C  CG    . TRP A 1 528 ? 38.574  15.813  8.979   1.00 40.74  ? 528 TRP A CG    1 
ATOM   3733  C  CD1   . TRP A 1 528 ? 38.834  14.617  8.368   1.00 41.39  ? 528 TRP A CD1   1 
ATOM   3734  C  CD2   . TRP A 1 528 ? 39.818  16.526  9.009   1.00 36.58  ? 528 TRP A CD2   1 
ATOM   3735  N  NE1   . TRP A 1 528 ? 40.157  14.544  8.018   1.00 35.96  ? 528 TRP A NE1   1 
ATOM   3736  C  CE2   . TRP A 1 528 ? 40.786  15.705  8.397   1.00 41.59  ? 528 TRP A CE2   1 
ATOM   3737  C  CE3   . TRP A 1 528 ? 40.210  17.781  9.495   1.00 45.00  ? 528 TRP A CE3   1 
ATOM   3738  C  CZ2   . TRP A 1 528 ? 42.120  16.087  8.262   1.00 39.39  ? 528 TRP A CZ2   1 
ATOM   3739  C  CZ3   . TRP A 1 528 ? 41.545  18.171  9.352   1.00 43.39  ? 528 TRP A CZ3   1 
ATOM   3740  C  CH2   . TRP A 1 528 ? 42.476  17.325  8.735   1.00 37.65  ? 528 TRP A CH2   1 
ATOM   3741  N  N     . ALA A 1 529 ? 35.224  16.109  7.161   1.00 30.31  ? 529 ALA A N     1 
ATOM   3742  C  CA    . ALA A 1 529 ? 34.814  15.707  5.807   1.00 42.46  ? 529 ALA A CA    1 
ATOM   3743  C  C     . ALA A 1 529 ? 34.478  16.933  4.918   1.00 36.91  ? 529 ALA A C     1 
ATOM   3744  O  O     . ALA A 1 529 ? 34.899  17.025  3.742   1.00 39.96  ? 529 ALA A O     1 
ATOM   3745  C  CB    . ALA A 1 529 ? 33.612  14.748  5.870   1.00 33.57  ? 529 ALA A CB    1 
ATOM   3746  N  N     . PHE A 1 530 ? 33.719  17.880  5.468   1.00 37.94  ? 530 PHE A N     1 
ATOM   3747  C  CA    . PHE A 1 530 ? 33.393  19.078  4.677   1.00 33.76  ? 530 PHE A CA    1 
ATOM   3748  C  C     . PHE A 1 530 ? 34.697  19.731  4.190   1.00 38.82  ? 530 PHE A C     1 
ATOM   3749  O  O     . PHE A 1 530 ? 34.856  20.046  3.016   1.00 36.97  ? 530 PHE A O     1 
ATOM   3750  C  CB    . PHE A 1 530 ? 32.564  20.093  5.478   1.00 31.49  ? 530 PHE A CB    1 
ATOM   3751  C  CG    . PHE A 1 530 ? 32.157  21.310  4.670   1.00 35.25  ? 530 PHE A CG    1 
ATOM   3752  C  CD1   . PHE A 1 530 ? 33.048  22.361  4.467   1.00 37.79  ? 530 PHE A CD1   1 
ATOM   3753  C  CD2   . PHE A 1 530 ? 30.904  21.394  4.102   1.00 33.93  ? 530 PHE A CD2   1 
ATOM   3754  C  CE1   . PHE A 1 530 ? 32.692  23.480  3.718   1.00 35.53  ? 530 PHE A CE1   1 
ATOM   3755  C  CE2   . PHE A 1 530 ? 30.535  22.520  3.342   1.00 42.76  ? 530 PHE A CE2   1 
ATOM   3756  C  CZ    . PHE A 1 530 ? 31.429  23.560  3.157   1.00 41.92  ? 530 PHE A CZ    1 
ATOM   3757  N  N     . ARG A 1 531 ? 35.637  19.913  5.106   1.00 36.76  ? 531 ARG A N     1 
ATOM   3758  C  CA    . ARG A 1 531 ? 36.893  20.573  4.788   1.00 41.50  ? 531 ARG A CA    1 
ATOM   3759  C  C     . ARG A 1 531 ? 37.688  19.808  3.743   1.00 47.40  ? 531 ARG A C     1 
ATOM   3760  O  O     . ARG A 1 531 ? 38.331  20.409  2.878   1.00 47.99  ? 531 ARG A O     1 
ATOM   3761  C  CB    . ARG A 1 531 ? 37.768  20.679  6.028   1.00 38.89  ? 531 ARG A CB    1 
ATOM   3762  C  CG    . ARG A 1 531 ? 38.902  21.664  5.882   1.00 52.51  ? 531 ARG A CG    1 
ATOM   3763  C  CD    . ARG A 1 531 ? 40.109  21.212  6.668   1.00 55.61  ? 531 ARG A CD    1 
ATOM   3764  N  NE    . ARG A 1 531 ? 39.954  21.319  8.110   1.00 58.12  ? 531 ARG A NE    1 
ATOM   3765  C  CZ    . ARG A 1 531 ? 40.219  22.403  8.819   1.00 62.13  ? 531 ARG A CZ    1 
ATOM   3766  N  NH1   . ARG A 1 531 ? 40.594  23.523  8.209   1.00 67.20  ? 531 ARG A NH1   1 
ATOM   3767  N  NH2   . ARG A 1 531 ? 40.071  22.369  10.138  1.00 61.91  ? 531 ARG A NH2   1 
ATOM   3768  N  N     . ARG A 1 532 ? 37.632  18.479  3.814   1.00 45.74  ? 532 ARG A N     1 
ATOM   3769  C  CA    . ARG A 1 532 ? 38.312  17.656  2.817   1.00 51.40  ? 532 ARG A CA    1 
ATOM   3770  C  C     . ARG A 1 532 ? 37.739  17.889  1.440   1.00 47.28  ? 532 ARG A C     1 
ATOM   3771  O  O     . ARG A 1 532 ? 38.483  17.977  0.458   1.00 43.61  ? 532 ARG A O     1 
ATOM   3772  C  CB    . ARG A 1 532 ? 38.219  16.166  3.168   1.00 55.33  ? 532 ARG A CB    1 
ATOM   3773  C  CG    . ARG A 1 532 ? 39.341  15.649  4.064   1.00 55.21  ? 532 ARG A CG    1 
ATOM   3774  C  CD    . ARG A 1 532 ? 39.163  14.146  4.329   1.00 65.55  ? 532 ARG A CD    1 
ATOM   3775  N  NE    . ARG A 1 532 ? 38.918  13.405  3.091   1.00 73.89  ? 532 ARG A NE    1 
ATOM   3776  C  CZ    . ARG A 1 532 ? 37.754  12.831  2.788   1.00 77.83  ? 532 ARG A CZ    1 
ATOM   3777  N  NH1   . ARG A 1 532 ? 37.599  12.188  1.636   1.00 78.76  ? 532 ARG A NH1   1 
ATOM   3778  N  NH2   . ARG A 1 532 ? 36.742  12.893  3.645   1.00 74.41  ? 532 ARG A NH2   1 
ATOM   3779  N  N     . LYS A 1 533 ? 36.423  18.048  1.374   1.00 50.57  ? 533 LYS A N     1 
ATOM   3780  C  CA    . LYS A 1 533 ? 35.785  18.243  0.075   1.00 50.94  ? 533 LYS A CA    1 
ATOM   3781  C  C     . LYS A 1 533 ? 35.896  19.664  -0.482  1.00 54.54  ? 533 LYS A C     1 
ATOM   3782  O  O     . LYS A 1 533 ? 35.943  19.855  -1.700  1.00 59.62  ? 533 LYS A O     1 
ATOM   3783  C  CB    . LYS A 1 533 ? 34.306  17.857  0.150   1.00 52.18  ? 533 LYS A CB    1 
ATOM   3784  C  CG    . LYS A 1 533 ? 33.657  17.680  -1.199  1.00 58.26  ? 533 LYS A CG    1 
ATOM   3785  C  CD    . LYS A 1 533 ? 34.234  16.495  -1.954  1.00 72.49  ? 533 LYS A CD    1 
ATOM   3786  C  CE    . LYS A 1 533 ? 33.444  16.236  -3.232  1.00 77.62  ? 533 LYS A CE    1 
ATOM   3787  N  NZ    . LYS A 1 533 ? 33.513  17.406  -4.158  1.00 77.04  ? 533 LYS A NZ    1 
ATOM   3788  N  N     . ALA A 1 534 ? 35.967  20.661  0.392   1.00 49.25  ? 534 ALA A N     1 
ATOM   3789  C  CA    . ALA A 1 534 ? 35.852  22.041  -0.063  1.00 44.49  ? 534 ALA A CA    1 
ATOM   3790  C  C     . ALA A 1 534 ? 37.121  22.868  0.120   1.00 46.98  ? 534 ALA A C     1 
ATOM   3791  O  O     . ALA A 1 534 ? 37.172  24.020  -0.308  1.00 47.15  ? 534 ALA A O     1 
ATOM   3792  C  CB    . ALA A 1 534 ? 34.697  22.713  0.653   1.00 44.81  ? 534 ALA A CB    1 
ATOM   3793  N  N     . GLY A 1 535 ? 38.140  22.292  0.752   1.00 45.19  ? 535 GLY A N     1 
ATOM   3794  C  CA    . GLY A 1 535 ? 39.373  23.018  0.998   1.00 42.25  ? 535 GLY A CA    1 
ATOM   3795  C  C     . GLY A 1 535 ? 39.236  24.099  2.054   1.00 48.18  ? 535 GLY A C     1 
ATOM   3796  O  O     . GLY A 1 535 ? 40.126  24.942  2.216   1.00 44.34  ? 535 GLY A O     1 
ATOM   3797  N  N     . ARG A 1 536 ? 38.113  24.086  2.766   1.00 41.78  ? 536 ARG A N     1 
ATOM   3798  C  CA    . ARG A 1 536 ? 37.877  25.044  3.846   1.00 45.45  ? 536 ARG A CA    1 
ATOM   3799  C  C     . ARG A 1 536 ? 36.732  24.590  4.743   1.00 42.28  ? 536 ARG A C     1 
ATOM   3800  O  O     . ARG A 1 536 ? 35.995  23.658  4.399   1.00 39.11  ? 536 ARG A O     1 
ATOM   3801  C  CB    . ARG A 1 536 ? 37.546  26.423  3.257   1.00 40.70  ? 536 ARG A CB    1 
ATOM   3802  C  CG    . ARG A 1 536 ? 36.334  26.336  2.341   1.00 36.37  ? 536 ARG A CG    1 
ATOM   3803  C  CD    . ARG A 1 536 ? 35.801  27.678  1.869   1.00 40.67  ? 536 ARG A CD    1 
ATOM   3804  N  NE    . ARG A 1 536 ? 34.618  27.440  1.048   1.00 43.09  ? 536 ARG A NE    1 
ATOM   3805  C  CZ    . ARG A 1 536 ? 33.360  27.478  1.479   1.00 40.14  ? 536 ARG A CZ    1 
ATOM   3806  N  NH1   . ARG A 1 536 ? 33.070  27.824  2.730   1.00 36.36  ? 536 ARG A NH1   1 
ATOM   3807  N  NH2   . ARG A 1 536 ? 32.386  27.220  0.627   1.00 36.77  ? 536 ARG A NH2   1 
ATOM   3808  N  N     . LEU A 1 537 ? 36.540  25.319  5.840   1.00 41.00  ? 537 LEU A N     1 
ATOM   3809  C  CA    . LEU A 1 537 ? 35.418  25.109  6.745   1.00 37.72  ? 537 LEU A CA    1 
ATOM   3810  C  C     . LEU A 1 537 ? 34.152  25.777  6.207   1.00 40.91  ? 537 LEU A C     1 
ATOM   3811  O  O     . LEU A 1 537 ? 34.233  26.706  5.400   1.00 39.13  ? 537 LEU A O     1 
ATOM   3812  C  CB    . LEU A 1 537 ? 35.774  25.638  8.144   1.00 35.31  ? 537 LEU A CB    1 
ATOM   3813  C  CG    . LEU A 1 537 ? 36.852  24.798  8.859   1.00 40.50  ? 537 LEU A CG    1 
ATOM   3814  C  CD1   . LEU A 1 537 ? 37.380  25.508  10.076  1.00 47.29  ? 537 LEU A CD1   1 
ATOM   3815  C  CD2   . LEU A 1 537 ? 36.320  23.422  9.255   1.00 35.43  ? 537 LEU A CD2   1 
ATOM   3816  N  N     . PRO A 1 538 ? 32.974  25.283  6.623   1.00 36.42  ? 538 PRO A N     1 
ATOM   3817  C  CA    . PRO A 1 538 ? 31.740  25.954  6.185   1.00 34.78  ? 538 PRO A CA    1 
ATOM   3818  C  C     . PRO A 1 538 ? 31.606  27.293  6.880   1.00 36.35  ? 538 PRO A C     1 
ATOM   3819  O  O     . PRO A 1 538 ? 32.058  27.433  8.013   1.00 35.55  ? 538 PRO A O     1 
ATOM   3820  C  CB    . PRO A 1 538 ? 30.620  24.998  6.619   1.00 35.23  ? 538 PRO A CB    1 
ATOM   3821  C  CG    . PRO A 1 538 ? 31.217  24.224  7.794   1.00 35.08  ? 538 PRO A CG    1 
ATOM   3822  C  CD    . PRO A 1 538 ? 32.713  24.119  7.492   1.00 35.22  ? 538 PRO A CD    1 
ATOM   3823  N  N     . SER A 1 539 ? 30.990  28.253  6.208   1.00 36.47  ? 539 SER A N     1 
ATOM   3824  C  CA    . SER A 1 539 ? 30.742  29.550  6.799   1.00 34.67  ? 539 SER A CA    1 
ATOM   3825  C  C     . SER A 1 539 ? 29.677  29.445  7.881   1.00 28.22  ? 539 SER A C     1 
ATOM   3826  O  O     . SER A 1 539 ? 29.690  30.206  8.844   1.00 29.32  ? 539 SER A O     1 
ATOM   3827  C  CB    . SER A 1 539 ? 30.303  30.537  5.725   1.00 29.89  ? 539 SER A CB    1 
ATOM   3828  O  OG    . SER A 1 539 ? 29.133  30.053  5.058   1.00 37.02  ? 539 SER A OG    1 
ATOM   3829  N  N     . ARG A 1 540 ? 28.753  28.496  7.716   1.00 31.09  ? 540 ARG A N     1 
ATOM   3830  C  CA    . ARG A 1 540 ? 27.555  28.418  8.573   1.00 30.10  ? 540 ARG A CA    1 
ATOM   3831  C  C     . ARG A 1 540 ? 27.008  27.008  8.602   1.00 29.82  ? 540 ARG A C     1 
ATOM   3832  O  O     . ARG A 1 540 ? 26.875  26.381  7.565   1.00 29.98  ? 540 ARG A O     1 
ATOM   3833  C  CB    . ARG A 1 540 ? 26.436  29.375  8.082   1.00 28.47  ? 540 ARG A CB    1 
ATOM   3834  C  CG    . ARG A 1 540 ? 25.157  29.339  8.975   1.00 32.77  ? 540 ARG A CG    1 
ATOM   3835  C  CD    . ARG A 1 540 ? 24.022  30.331  8.504   1.00 34.70  ? 540 ARG A CD    1 
ATOM   3836  N  NE    . ARG A 1 540 ? 24.308  31.721  8.854   1.00 28.89  ? 540 ARG A NE    1 
ATOM   3837  C  CZ    . ARG A 1 540 ? 24.118  32.252  10.060  1.00 29.21  ? 540 ARG A CZ    1 
ATOM   3838  N  NH1   . ARG A 1 540 ? 23.632  31.525  11.061  1.00 29.56  ? 540 ARG A NH1   1 
ATOM   3839  N  NH2   . ARG A 1 540 ? 24.421  33.518  10.265  1.00 31.14  ? 540 ARG A NH2   1 
ATOM   3840  N  N     . VAL A 1 541 ? 26.655  26.520  9.786   1.00 24.65  ? 541 VAL A N     1 
ATOM   3841  C  CA    . VAL A 1 541 ? 26.049  25.205  9.870   1.00 31.07  ? 541 VAL A CA    1 
ATOM   3842  C  C     . VAL A 1 541 ? 24.682  25.257  10.531  1.00 27.57  ? 541 VAL A C     1 
ATOM   3843  O  O     . VAL A 1 541 ? 24.425  26.115  11.365  1.00 29.22  ? 541 VAL A O     1 
ATOM   3844  C  CB    . VAL A 1 541 ? 26.937  24.228  10.666  1.00 28.76  ? 541 VAL A CB    1 
ATOM   3845  C  CG1   . VAL A 1 541 ? 28.283  24.087  9.979   1.00 29.01  ? 541 VAL A CG1   1 
ATOM   3846  C  CG2   . VAL A 1 541 ? 27.158  24.780  12.037  1.00 29.31  ? 541 VAL A CG2   1 
ATOM   3847  N  N     . LEU A 1 542 ? 23.807  24.336  10.141  1.00 28.76  ? 542 LEU A N     1 
ATOM   3848  C  CA    . LEU A 1 542 ? 22.516  24.162  10.791  1.00 24.88  ? 542 LEU A CA    1 
ATOM   3849  C  C     . LEU A 1 542 ? 22.567  22.847  11.553  1.00 29.48  ? 542 LEU A C     1 
ATOM   3850  O  O     . LEU A 1 542 ? 22.722  21.791  10.956  1.00 28.02  ? 542 LEU A O     1 
ATOM   3851  C  CB    . LEU A 1 542 ? 21.377  24.158  9.759   1.00 26.42  ? 542 LEU A CB    1 
ATOM   3852  C  CG    . LEU A 1 542 ? 19.965  23.846  10.289  1.00 30.09  ? 542 LEU A CG    1 
ATOM   3853  C  CD1   . LEU A 1 542 ? 19.495  24.872  11.334  1.00 29.52  ? 542 LEU A CD1   1 
ATOM   3854  C  CD2   . LEU A 1 542 ? 19.005  23.770  9.140   1.00 29.00  ? 542 LEU A CD2   1 
ATOM   3855  N  N     . LEU A 1 543 ? 22.450  22.923  12.873  1.00 26.80  ? 543 LEU A N     1 
ATOM   3856  C  CA    . LEU A 1 543 ? 22.504  21.752  13.727  1.00 28.88  ? 543 LEU A CA    1 
ATOM   3857  C  C     . LEU A 1 543 ? 21.065  21.373  14.148  1.00 30.65  ? 543 LEU A C     1 
ATOM   3858  O  O     . LEU A 1 543 ? 20.337  22.193  14.718  1.00 25.51  ? 543 LEU A O     1 
ATOM   3859  C  CB    . LEU A 1 543 ? 23.360  22.036  14.949  1.00 22.35  ? 543 LEU A CB    1 
ATOM   3860  C  CG    . LEU A 1 543 ? 24.777  22.576  14.634  1.00 34.62  ? 543 LEU A CG    1 
ATOM   3861  C  CD1   . LEU A 1 543 ? 25.428  22.982  15.927  1.00 28.99  ? 543 LEU A CD1   1 
ATOM   3862  C  CD2   . LEU A 1 543 ? 25.665  21.538  13.900  1.00 25.53  ? 543 LEU A CD2   1 
ATOM   3863  N  N     . LEU A 1 544 ? 20.671  20.147  13.835  1.00 32.41  ? 544 LEU A N     1 
ATOM   3864  C  CA    . LEU A 1 544 ? 19.329  19.627  14.122  1.00 28.18  ? 544 LEU A CA    1 
ATOM   3865  C  C     . LEU A 1 544 ? 19.459  18.474  15.104  1.00 30.53  ? 544 LEU A C     1 
ATOM   3866  O  O     . LEU A 1 544 ? 20.289  17.572  14.925  1.00 34.10  ? 544 LEU A O     1 
ATOM   3867  C  CB    . LEU A 1 544 ? 18.642  19.144  12.836  1.00 23.70  ? 544 LEU A CB    1 
ATOM   3868  C  CG    . LEU A 1 544 ? 18.588  20.166  11.681  1.00 30.11  ? 544 LEU A CG    1 
ATOM   3869  C  CD1   . LEU A 1 544 ? 18.059  19.531  10.331  1.00 23.30  ? 544 LEU A CD1   1 
ATOM   3870  C  CD2   . LEU A 1 544 ? 17.711  21.392  12.101  1.00 28.88  ? 544 LEU A CD2   1 
ATOM   3871  N  N     . ARG A 1 545 ? 18.681  18.518  16.171  1.00 29.86  ? 545 ARG A N     1 
ATOM   3872  C  CA    . ARG A 1 545 ? 18.723  17.460  17.172  1.00 34.93  ? 545 ARG A CA    1 
ATOM   3873  C  C     . ARG A 1 545 ? 17.312  17.042  17.515  1.00 39.45  ? 545 ARG A C     1 
ATOM   3874  O  O     . ARG A 1 545 ? 16.329  17.685  17.109  1.00 30.29  ? 545 ARG A O     1 
ATOM   3875  C  CB    . ARG A 1 545 ? 19.473  17.916  18.439  1.00 29.57  ? 545 ARG A CB    1 
ATOM   3876  C  CG    . ARG A 1 545 ? 18.933  19.200  19.032  1.00 36.24  ? 545 ARG A CG    1 
ATOM   3877  C  CD    . ARG A 1 545 ? 19.668  19.591  20.279  1.00 36.34  ? 545 ARG A CD    1 
ATOM   3878  N  NE    . ARG A 1 545 ? 19.284  18.704  21.355  1.00 48.30  ? 545 ARG A NE    1 
ATOM   3879  C  CZ    . ARG A 1 545 ? 18.528  19.047  22.390  1.00 44.99  ? 545 ARG A CZ    1 
ATOM   3880  N  NH1   . ARG A 1 545 ? 18.087  20.278  22.528  1.00 41.21  ? 545 ARG A NH1   1 
ATOM   3881  N  NH2   . ARG A 1 545 ? 18.233  18.142  23.302  1.00 46.97  ? 545 ARG A NH2   1 
ATOM   3882  N  N     . ASP A 1 546 ? 17.232  15.959  18.272  1.00 45.50  ? 546 ASP A N     1 
ATOM   3883  C  CA    . ASP A 1 546 ? 15.987  15.410  18.775  1.00 43.93  ? 546 ASP A CA    1 
ATOM   3884  C  C     . ASP A 1 546 ? 15.454  16.221  19.935  1.00 43.46  ? 546 ASP A C     1 
ATOM   3885  O  O     . ASP A 1 546 ? 16.002  17.269  20.258  1.00 44.08  ? 546 ASP A O     1 
ATOM   3886  C  CB    . ASP A 1 546 ? 16.258  13.996  19.249  1.00 56.02  ? 546 ASP A CB    1 
ATOM   3887  C  CG    . ASP A 1 546 ? 17.344  13.976  20.308  1.00 62.29  ? 546 ASP A CG    1 
ATOM   3888  O  OD1   . ASP A 1 546 ? 18.542  13.876  19.930  1.00 63.63  ? 546 ASP A OD1   1 
ATOM   3889  O  OD2   . ASP A 1 546 ? 17.014  14.136  21.506  1.00 63.60  ? 546 ASP A OD2   1 
ATOM   3890  N  N     . GLY A 1 547 ? 14.429  15.707  20.613  1.00 53.75  ? 547 GLY A N     1 
ATOM   3891  C  CA    . GLY A 1 547 ? 13.799  16.475  21.672  1.00 49.51  ? 547 GLY A CA    1 
ATOM   3892  C  C     . GLY A 1 547 ? 14.079  15.991  23.084  1.00 50.34  ? 547 GLY A C     1 
ATOM   3893  O  O     . GLY A 1 547 ? 13.604  16.590  24.045  1.00 56.06  ? 547 GLY A O     1 
ATOM   3894  N  N     . ARG A 1 548 ? 14.885  14.942  23.223  1.00 55.85  ? 548 ARG A N     1 
ATOM   3895  C  CA    . ARG A 1 548 ? 15.063  14.306  24.529  1.00 50.84  ? 548 ARG A CA    1 
ATOM   3896  C  C     . ARG A 1 548 ? 16.303  14.754  25.312  1.00 52.19  ? 548 ARG A C     1 
ATOM   3897  O  O     . ARG A 1 548 ? 16.185  15.109  26.488  1.00 52.31  ? 548 ARG A O     1 
ATOM   3898  C  CB    . ARG A 1 548 ? 15.063  12.782  24.379  1.00 53.44  ? 548 ARG A CB    1 
ATOM   3899  C  CG    . ARG A 1 548 ? 15.149  12.040  25.724  1.00 63.98  ? 548 ARG A CG    1 
ATOM   3900  C  CD    . ARG A 1 548 ? 13.967  12.340  26.653  1.00 70.29  ? 548 ARG A CD    1 
ATOM   3901  N  NE    . ARG A 1 548 ? 14.182  11.851  28.022  1.00 81.64  ? 548 ARG A NE    1 
ATOM   3902  C  CZ    . ARG A 1 548 ? 14.788  12.549  28.988  1.00 80.59  ? 548 ARG A CZ    1 
ATOM   3903  N  NH1   . ARG A 1 548 ? 15.246  13.773  28.751  1.00 72.87  ? 548 ARG A NH1   1 
ATOM   3904  N  NH2   . ARG A 1 548 ? 14.939  12.023  30.199  1.00 84.91  ? 548 ARG A NH2   1 
ATOM   3905  N  N     . VAL A 1 549 ? 17.489  14.727  24.704  1.00 47.60  ? 549 VAL A N     1 
ATOM   3906  C  CA    . VAL A 1 549 ? 18.691  15.017  25.494  1.00 48.67  ? 549 VAL A CA    1 
ATOM   3907  C  C     . VAL A 1 549 ? 18.713  16.481  25.934  1.00 48.45  ? 549 VAL A C     1 
ATOM   3908  O  O     . VAL A 1 549 ? 18.180  17.345  25.251  1.00 43.43  ? 549 VAL A O     1 
ATOM   3909  C  CB    . VAL A 1 549 ? 20.003  14.690  24.726  1.00 42.77  ? 549 VAL A CB    1 
ATOM   3910  C  CG1   . VAL A 1 549 ? 19.939  13.307  24.105  1.00 41.15  ? 549 VAL A CG1   1 
ATOM   3911  C  CG2   . VAL A 1 549 ? 20.304  15.743  23.672  1.00 33.70  ? 549 VAL A CG2   1 
ATOM   3912  N  N     . PRO A 1 550 ? 19.330  16.762  27.088  1.00 45.76  ? 550 PRO A N     1 
ATOM   3913  C  CA    . PRO A 1 550 ? 19.418  18.157  27.533  1.00 43.17  ? 550 PRO A CA    1 
ATOM   3914  C  C     . PRO A 1 550 ? 20.267  19.018  26.592  1.00 47.91  ? 550 PRO A C     1 
ATOM   3915  O  O     . PRO A 1 550 ? 21.329  18.572  26.137  1.00 41.52  ? 550 PRO A O     1 
ATOM   3916  C  CB    . PRO A 1 550 ? 20.093  18.048  28.911  1.00 43.75  ? 550 PRO A CB    1 
ATOM   3917  C  CG    . PRO A 1 550 ? 19.825  16.633  29.361  1.00 41.65  ? 550 PRO A CG    1 
ATOM   3918  C  CD    . PRO A 1 550 ? 19.847  15.817  28.098  1.00 44.74  ? 550 PRO A CD    1 
ATOM   3919  N  N     . GLN A 1 551 ? 19.810  20.243  26.343  1.00 40.99  ? 551 GLN A N     1 
ATOM   3920  C  CA    . GLN A 1 551 ? 20.493  21.180  25.456  1.00 38.72  ? 551 GLN A CA    1 
ATOM   3921  C  C     . GLN A 1 551 ? 21.993  21.381  25.778  1.00 39.66  ? 551 GLN A C     1 
ATOM   3922  O  O     . GLN A 1 551 ? 22.789  21.653  24.881  1.00 35.55  ? 551 GLN A O     1 
ATOM   3923  C  CB    . GLN A 1 551 ? 19.749  22.527  25.491  1.00 41.28  ? 551 GLN A CB    1 
ATOM   3924  C  CG    . GLN A 1 551 ? 20.425  23.677  24.769  1.00 42.89  ? 551 GLN A CG    1 
ATOM   3925  C  CD    . GLN A 1 551 ? 19.574  24.932  24.763  1.00 47.85  ? 551 GLN A CD    1 
ATOM   3926  O  OE1   . GLN A 1 551 ? 18.369  24.889  25.069  1.00 41.60  ? 551 GLN A OE1   1 
ATOM   3927  N  NE2   . GLN A 1 551 ? 20.194  26.063  24.423  1.00 45.90  ? 551 GLN A NE2   1 
ATOM   3928  N  N     . ASP A 1 552 ? 22.381  21.261  27.042  1.00 39.41  ? 552 ASP A N     1 
ATOM   3929  C  CA    . ASP A 1 552 ? 23.784  21.481  27.405  1.00 44.71  ? 552 ASP A CA    1 
ATOM   3930  C  C     . ASP A 1 552 ? 24.728  20.418  26.809  1.00 40.49  ? 552 ASP A C     1 
ATOM   3931  O  O     . ASP A 1 552 ? 25.929  20.664  26.688  1.00 31.89  ? 552 ASP A O     1 
ATOM   3932  C  CB    . ASP A 1 552 ? 23.957  21.522  28.923  1.00 47.56  ? 552 ASP A CB    1 
ATOM   3933  C  CG    . ASP A 1 552 ? 25.169  22.346  29.347  1.00 62.72  ? 552 ASP A CG    1 
ATOM   3934  O  OD1   . ASP A 1 552 ? 25.101  23.600  29.224  1.00 69.89  ? 552 ASP A OD1   1 
ATOM   3935  O  OD2   . ASP A 1 552 ? 26.185  21.750  29.799  1.00 54.71  ? 552 ASP A OD2   1 
ATOM   3936  N  N     . GLU A 1 553 ? 24.197  19.263  26.396  1.00 36.57  ? 553 GLU A N     1 
ATOM   3937  C  CA    . GLU A 1 553 ? 25.055  18.255  25.760  1.00 39.85  ? 553 GLU A CA    1 
ATOM   3938  C  C     . GLU A 1 553 ? 25.661  18.782  24.451  1.00 38.98  ? 553 GLU A C     1 
ATOM   3939  O  O     . GLU A 1 553 ? 26.647  18.211  23.950  1.00 34.44  ? 553 GLU A O     1 
ATOM   3940  C  CB    . GLU A 1 553 ? 24.283  16.950  25.503  1.00 35.30  ? 553 GLU A CB    1 
ATOM   3941  C  CG    . GLU A 1 553 ? 23.816  16.229  26.792  1.00 31.41  ? 553 GLU A CG    1 
ATOM   3942  C  CD    . GLU A 1 553 ? 23.600  14.731  26.627  1.00 41.91  ? 553 GLU A CD    1 
ATOM   3943  O  OE1   . GLU A 1 553 ? 23.375  14.060  27.662  1.00 45.66  ? 553 GLU A OE1   1 
ATOM   3944  O  OE2   . GLU A 1 553 ? 23.672  14.214  25.485  1.00 37.51  ? 553 GLU A OE2   1 
ATOM   3945  N  N     . PHE A 1 554 ? 25.155  19.924  23.972  1.00 35.05  ? 554 PHE A N     1 
ATOM   3946  C  CA    . PHE A 1 554 ? 25.660  20.543  22.741  1.00 35.46  ? 554 PHE A CA    1 
ATOM   3947  C  C     . PHE A 1 554 ? 26.566  21.769  22.997  1.00 33.94  ? 554 PHE A C     1 
ATOM   3948  O  O     . PHE A 1 554 ? 27.084  22.356  22.054  1.00 36.26  ? 554 PHE A O     1 
ATOM   3949  C  CB    . PHE A 1 554 ? 24.473  20.934  21.830  1.00 29.14  ? 554 PHE A CB    1 
ATOM   3950  C  CG    . PHE A 1 554 ? 23.887  19.755  21.078  1.00 32.65  ? 554 PHE A CG    1 
ATOM   3951  C  CD1   . PHE A 1 554 ? 23.130  18.804  21.741  1.00 31.33  ? 554 PHE A CD1   1 
ATOM   3952  C  CD2   . PHE A 1 554 ? 24.119  19.577  19.724  1.00 27.56  ? 554 PHE A CD2   1 
ATOM   3953  C  CE1   . PHE A 1 554 ? 22.613  17.693  21.067  1.00 35.75  ? 554 PHE A CE1   1 
ATOM   3954  C  CE2   . PHE A 1 554 ? 23.604  18.450  19.056  1.00 25.31  ? 554 PHE A CE2   1 
ATOM   3955  C  CZ    . PHE A 1 554 ? 22.861  17.524  19.730  1.00 31.25  ? 554 PHE A CZ    1 
ATOM   3956  N  N     . ALA A 1 555 ? 26.780  22.141  24.257  1.00 31.27  ? 555 ALA A N     1 
ATOM   3957  C  CA    . ALA A 1 555 ? 27.526  23.374  24.572  1.00 40.04  ? 555 ALA A CA    1 
ATOM   3958  C  C     . ALA A 1 555 ? 28.955  23.380  24.010  1.00 38.37  ? 555 ALA A C     1 
ATOM   3959  O  O     . ALA A 1 555 ? 29.377  24.359  23.365  1.00 34.21  ? 555 ALA A O     1 
ATOM   3960  C  CB    . ALA A 1 555 ? 27.572  23.589  26.089  1.00 40.21  ? 555 ALA A CB    1 
ATOM   3961  N  N     . LEU A 1 556 ? 29.670  22.272  24.208  1.00 32.96  ? 556 LEU A N     1 
ATOM   3962  C  CA    . LEU A 1 556 ? 31.038  22.156  23.709  1.00 37.87  ? 556 LEU A CA    1 
ATOM   3963  C  C     . LEU A 1 556 ? 31.056  22.348  22.199  1.00 32.35  ? 556 LEU A C     1 
ATOM   3964  O  O     . LEU A 1 556 ? 31.848  23.128  21.696  1.00 34.52  ? 556 LEU A O     1 
ATOM   3965  C  CB    . LEU A 1 556 ? 31.661  20.790  24.076  1.00 33.91  ? 556 LEU A CB    1 
ATOM   3966  C  CG    . LEU A 1 556 ? 33.134  20.648  24.453  1.00 48.33  ? 556 LEU A CG    1 
ATOM   3967  C  CD1   . LEU A 1 556 ? 33.715  19.261  24.063  1.00 35.84  ? 556 LEU A CD1   1 
ATOM   3968  C  CD2   . LEU A 1 556 ? 34.011  21.816  23.954  1.00 47.10  ? 556 LEU A CD2   1 
ATOM   3969  N  N     . ALA A 1 557 ? 30.147  21.683  21.484  1.00 32.48  ? 557 ALA A N     1 
ATOM   3970  C  CA    . ALA A 1 557 ? 30.120  21.784  20.021  1.00 34.16  ? 557 ALA A CA    1 
ATOM   3971  C  C     . ALA A 1 557 ? 29.865  23.217  19.521  1.00 37.51  ? 557 ALA A C     1 
ATOM   3972  O  O     . ALA A 1 557 ? 30.544  23.697  18.599  1.00 32.99  ? 557 ALA A O     1 
ATOM   3973  C  CB    . ALA A 1 557 ? 29.064  20.827  19.455  1.00 30.77  ? 557 ALA A CB    1 
ATOM   3974  N  N     . LEU A 1 558 ? 28.912  23.901  20.156  1.00 29.03  ? 558 LEU A N     1 
ATOM   3975  C  CA    . LEU A 1 558 ? 28.608  25.303  19.863  1.00 34.51  ? 558 LEU A CA    1 
ATOM   3976  C  C     . LEU A 1 558 ? 29.799  26.231  20.089  1.00 37.36  ? 558 LEU A C     1 
ATOM   3977  O  O     . LEU A 1 558 ? 30.152  27.050  19.212  1.00 34.14  ? 558 LEU A O     1 
ATOM   3978  C  CB    . LEU A 1 558 ? 27.433  25.761  20.729  1.00 36.11  ? 558 LEU A CB    1 
ATOM   3979  C  CG    . LEU A 1 558 ? 26.022  25.845  20.145  1.00 42.50  ? 558 LEU A CG    1 
ATOM   3980  C  CD1   . LEU A 1 558 ? 25.746  24.742  19.189  1.00 30.68  ? 558 LEU A CD1   1 
ATOM   3981  C  CD2   . LEU A 1 558 ? 25.035  25.785  21.298  1.00 34.29  ? 558 LEU A CD2   1 
ATOM   3982  N  N     . GLU A 1 559 ? 30.434  26.095  21.251  1.00 35.02  ? 559 GLU A N     1 
ATOM   3983  C  CA    . GLU A 1 559 ? 31.590  26.947  21.544  1.00 40.38  ? 559 GLU A CA    1 
ATOM   3984  C  C     . GLU A 1 559 ? 32.720  26.668  20.586  1.00 39.07  ? 559 GLU A C     1 
ATOM   3985  O  O     . GLU A 1 559 ? 33.415  27.582  20.186  1.00 40.11  ? 559 GLU A O     1 
ATOM   3986  C  CB    . GLU A 1 559 ? 32.088  26.773  22.980  1.00 38.72  ? 559 GLU A CB    1 
ATOM   3987  C  CG    . GLU A 1 559 ? 31.368  27.704  23.924  1.00 55.70  ? 559 GLU A CG    1 
ATOM   3988  C  CD    . GLU A 1 559 ? 31.329  29.142  23.408  1.00 54.44  ? 559 GLU A CD    1 
ATOM   3989  O  OE1   . GLU A 1 559 ? 32.370  29.655  22.944  1.00 54.61  ? 559 GLU A OE1   1 
ATOM   3990  O  OE2   . GLU A 1 559 ? 30.248  29.759  23.457  1.00 56.38  ? 559 GLU A OE2   1 
ATOM   3991  N  N     . ALA A 1 560 ? 32.907  25.400  20.234  1.00 33.22  ? 560 ALA A N     1 
ATOM   3992  C  CA    . ALA A 1 560 ? 33.940  25.030  19.288  1.00 30.43  ? 560 ALA A CA    1 
ATOM   3993  C  C     . ALA A 1 560 ? 33.647  25.629  17.924  1.00 34.38  ? 560 ALA A C     1 
ATOM   3994  O  O     . ALA A 1 560 ? 34.567  26.008  17.211  1.00 32.92  ? 560 ALA A O     1 
ATOM   3995  C  CB    . ALA A 1 560 ? 34.068  23.490  19.186  1.00 26.48  ? 560 ALA A CB    1 
ATOM   3996  N  N     . LEU A 1 561 ? 32.373  25.710  17.539  1.00 31.56  ? 561 LEU A N     1 
ATOM   3997  C  CA    . LEU A 1 561 ? 32.052  26.373  16.269  1.00 30.53  ? 561 LEU A CA    1 
ATOM   3998  C  C     . LEU A 1 561 ? 32.389  27.864  16.359  1.00 33.24  ? 561 LEU A C     1 
ATOM   3999  O  O     . LEU A 1 561 ? 32.944  28.455  15.419  1.00 29.43  ? 561 LEU A O     1 
ATOM   4000  C  CB    . LEU A 1 561 ? 30.586  26.193  15.902  1.00 38.11  ? 561 LEU A CB    1 
ATOM   4001  C  CG    . LEU A 1 561 ? 30.157  24.790  15.438  1.00 35.71  ? 561 LEU A CG    1 
ATOM   4002  C  CD1   . LEU A 1 561 ? 28.635  24.719  15.345  1.00 26.02  ? 561 LEU A CD1   1 
ATOM   4003  C  CD2   . LEU A 1 561 ? 30.803  24.427  14.120  1.00 30.10  ? 561 LEU A CD2   1 
ATOM   4004  N  N     . ALA A 1 562 ? 32.082  28.463  17.508  1.00 38.51  ? 562 ALA A N     1 
ATOM   4005  C  CA    . ALA A 1 562 ? 32.342  29.887  17.721  1.00 39.06  ? 562 ALA A CA    1 
ATOM   4006  C  C     . ALA A 1 562 ? 33.846  30.212  17.653  1.00 41.97  ? 562 ALA A C     1 
ATOM   4007  O  O     . ALA A 1 562 ? 34.247  31.149  16.960  1.00 41.97  ? 562 ALA A O     1 
ATOM   4008  C  CB    . ALA A 1 562 ? 31.772  30.329  19.066  1.00 34.92  ? 562 ALA A CB    1 
ATOM   4009  N  N     . ARG A 1 563 ? 34.668  29.405  18.329  1.00 39.61  ? 563 ARG A N     1 
ATOM   4010  C  CA    . ARG A 1 563 ? 36.133  29.576  18.334  1.00 42.48  ? 563 ARG A CA    1 
ATOM   4011  C  C     . ARG A 1 563 ? 36.620  29.556  16.906  1.00 40.55  ? 563 ARG A C     1 
ATOM   4012  O  O     . ARG A 1 563 ? 37.591  30.193  16.554  1.00 40.17  ? 563 ARG A O     1 
ATOM   4013  C  CB    . ARG A 1 563 ? 36.852  28.455  19.085  1.00 44.66  ? 563 ARG A CB    1 
ATOM   4014  C  CG    . ARG A 1 563 ? 36.572  28.232  20.570  1.00 47.43  ? 563 ARG A CG    1 
ATOM   4015  C  CD    . ARG A 1 563 ? 37.484  27.049  20.979  1.00 60.62  ? 563 ARG A CD    1 
ATOM   4016  N  NE    . ARG A 1 563 ? 36.955  26.122  21.984  1.00 64.78  ? 563 ARG A NE    1 
ATOM   4017  C  CZ    . ARG A 1 563 ? 37.069  24.791  21.887  1.00 64.65  ? 563 ARG A CZ    1 
ATOM   4018  N  NH1   . ARG A 1 563 ? 37.660  24.247  20.824  1.00 55.77  ? 563 ARG A NH1   1 
ATOM   4019  N  NH2   . ARG A 1 563 ? 36.586  23.995  22.836  1.00 57.74  ? 563 ARG A NH2   1 
ATOM   4020  N  N     . GLU A 1 564 ? 35.948  28.772  16.081  1.00 39.98  ? 564 GLU A N     1 
ATOM   4021  C  CA    . GLU A 1 564 ? 36.318  28.663  14.679  1.00 36.21  ? 564 GLU A CA    1 
ATOM   4022  C  C     . GLU A 1 564 ? 35.747  29.793  13.803  1.00 36.99  ? 564 GLU A C     1 
ATOM   4023  O  O     . GLU A 1 564 ? 36.048  29.889  12.609  1.00 36.65  ? 564 GLU A O     1 
ATOM   4024  C  CB    . GLU A 1 564 ? 35.863  27.316  14.165  1.00 39.26  ? 564 GLU A CB    1 
ATOM   4025  C  CG    . GLU A 1 564 ? 36.776  26.768  13.174  1.00 53.05  ? 564 GLU A CG    1 
ATOM   4026  C  CD    . GLU A 1 564 ? 38.082  26.371  13.805  1.00 58.85  ? 564 GLU A CD    1 
ATOM   4027  O  OE1   . GLU A 1 564 ? 38.047  25.756  14.886  1.00 63.57  ? 564 GLU A OE1   1 
ATOM   4028  O  OE2   . GLU A 1 564 ? 39.135  26.713  13.238  1.00 51.98  ? 564 GLU A OE2   1 
ATOM   4029  N  N     . GLY A 1 565 ? 34.936  30.667  14.386  1.00 34.26  ? 565 GLY A N     1 
ATOM   4030  C  CA    . GLY A 1 565 ? 34.319  31.704  13.570  1.00 40.77  ? 565 GLY A CA    1 
ATOM   4031  C  C     . GLY A 1 565 ? 33.208  31.174  12.655  1.00 36.46  ? 565 GLY A C     1 
ATOM   4032  O  O     . GLY A 1 565 ? 32.728  31.878  11.767  1.00 43.84  ? 565 GLY A O     1 
ATOM   4033  N  N     . ILE A 1 566 ? 32.805  29.925  12.857  1.00 32.81  ? 566 ILE A N     1 
ATOM   4034  C  CA    . ILE A 1 566 ? 31.678  29.354  12.121  1.00 30.88  ? 566 ILE A CA    1 
ATOM   4035  C  C     . ILE A 1 566 ? 30.352  29.750  12.750  1.00 33.79  ? 566 ILE A C     1 
ATOM   4036  O  O     . ILE A 1 566 ? 30.165  29.565  13.960  1.00 33.01  ? 566 ILE A O     1 
ATOM   4037  C  CB    . ILE A 1 566 ? 31.765  27.822  12.069  1.00 34.75  ? 566 ILE A CB    1 
ATOM   4038  C  CG1   . ILE A 1 566 ? 33.113  27.403  11.474  1.00 29.96  ? 566 ILE A CG1   1 
ATOM   4039  C  CG2   . ILE A 1 566 ? 30.580  27.203  11.252  1.00 28.12  ? 566 ILE A CG2   1 
ATOM   4040  C  CD1   . ILE A 1 566 ? 33.328  25.876  11.493  1.00 31.74  ? 566 ILE A CD1   1 
ATOM   4041  N  N     . ALA A 1 567 ? 29.429  30.314  11.974  1.00 36.34  ? 567 ALA A N     1 
ATOM   4042  C  CA    . ALA A 1 567 ? 28.121  30.589  12.581  1.00 37.45  ? 567 ALA A CA    1 
ATOM   4043  C  C     . ALA A 1 567 ? 27.204  29.369  12.523  1.00 34.00  ? 567 ALA A C     1 
ATOM   4044  O  O     . ALA A 1 567 ? 27.414  28.441  11.733  1.00 30.91  ? 567 ALA A O     1 
ATOM   4045  C  CB    . ALA A 1 567 ? 27.463  31.778  11.898  1.00 20.00  ? 567 ALA A CB    1 
ATOM   4046  N  N     . TYR A 1 568 ? 26.179  29.386  13.366  1.00 30.62  ? 568 TYR A N     1 
ATOM   4047  C  CA    . TYR A 1 568 ? 25.349  28.230  13.536  1.00 36.11  ? 568 TYR A CA    1 
ATOM   4048  C  C     . TYR A 1 568 ? 23.972  28.572  14.054  1.00 36.64  ? 568 TYR A C     1 
ATOM   4049  O  O     . TYR A 1 568 ? 23.772  29.634  14.631  1.00 29.64  ? 568 TYR A O     1 
ATOM   4050  C  CB    . TYR A 1 568 ? 26.039  27.259  14.502  1.00 31.44  ? 568 TYR A CB    1 
ATOM   4051  C  CG    . TYR A 1 568 ? 26.376  27.907  15.806  1.00 32.09  ? 568 TYR A CG    1 
ATOM   4052  C  CD1   . TYR A 1 568 ? 25.442  28.009  16.824  1.00 33.96  ? 568 TYR A CD1   1 
ATOM   4053  C  CD2   . TYR A 1 568 ? 27.622  28.482  15.996  1.00 32.72  ? 568 TYR A CD2   1 
ATOM   4054  C  CE1   . TYR A 1 568 ? 25.767  28.629  18.022  1.00 39.95  ? 568 TYR A CE1   1 
ATOM   4055  C  CE2   . TYR A 1 568 ? 27.947  29.099  17.164  1.00 34.66  ? 568 TYR A CE2   1 
ATOM   4056  C  CZ    . TYR A 1 568 ? 27.029  29.165  18.177  1.00 38.38  ? 568 TYR A CZ    1 
ATOM   4057  O  OH    . TYR A 1 568 ? 27.388  29.785  19.346  1.00 46.42  ? 568 TYR A OH    1 
ATOM   4058  N  N     . ASP A 1 569 ? 23.047  27.626  13.874  1.00 29.23  ? 569 ASP A N     1 
ATOM   4059  C  CA    . ASP A 1 569 ? 21.784  27.601  14.597  1.00 34.95  ? 569 ASP A CA    1 
ATOM   4060  C  C     . ASP A 1 569 ? 21.583  26.191  15.113  1.00 34.02  ? 569 ASP A C     1 
ATOM   4061  O  O     . ASP A 1 569 ? 21.963  25.226  14.454  1.00 29.87  ? 569 ASP A O     1 
ATOM   4062  C  CB    . ASP A 1 569 ? 20.612  28.042  13.711  1.00 25.21  ? 569 ASP A CB    1 
ATOM   4063  C  CG    . ASP A 1 569 ? 20.693  29.509  13.362  1.00 33.78  ? 569 ASP A CG    1 
ATOM   4064  O  OD1   . ASP A 1 569 ? 20.323  30.325  14.232  1.00 33.72  ? 569 ASP A OD1   1 
ATOM   4065  O  OD2   . ASP A 1 569 ? 21.148  29.854  12.244  1.00 32.01  ? 569 ASP A OD2   1 
ATOM   4066  N  N     . LEU A 1 570 ? 21.045  26.087  16.321  1.00 32.05  ? 570 LEU A N     1 
ATOM   4067  C  CA    . LEU A 1 570 ? 20.710  24.807  16.909  1.00 29.22  ? 570 LEU A CA    1 
ATOM   4068  C  C     . LEU A 1 570 ? 19.207  24.760  16.969  1.00 35.37  ? 570 LEU A C     1 
ATOM   4069  O  O     . LEU A 1 570 ? 18.596  25.635  17.576  1.00 27.42  ? 570 LEU A O     1 
ATOM   4070  C  CB    . LEU A 1 570 ? 21.306  24.645  18.310  1.00 28.82  ? 570 LEU A CB    1 
ATOM   4071  C  CG    . LEU A 1 570 ? 20.956  23.334  19.030  1.00 33.05  ? 570 LEU A CG    1 
ATOM   4072  C  CD1   . LEU A 1 570 ? 21.432  22.116  18.251  1.00 27.65  ? 570 LEU A CD1   1 
ATOM   4073  C  CD2   . LEU A 1 570 ? 21.506  23.279  20.457  1.00 31.29  ? 570 LEU A CD2   1 
ATOM   4074  N  N     . VAL A 1 571 ? 18.614  23.763  16.319  1.00 29.16  ? 571 VAL A N     1 
ATOM   4075  C  CA    . VAL A 1 571 ? 17.191  23.602  16.368  1.00 31.06  ? 571 VAL A CA    1 
ATOM   4076  C  C     . VAL A 1 571 ? 16.845  22.206  16.846  1.00 35.40  ? 571 VAL A C     1 
ATOM   4077  O  O     . VAL A 1 571 ? 17.324  21.204  16.298  1.00 31.97  ? 571 VAL A O     1 
ATOM   4078  C  CB    . VAL A 1 571 ? 16.545  23.870  14.991  1.00 32.89  ? 571 VAL A CB    1 
ATOM   4079  C  CG1   . VAL A 1 571 ? 15.064  23.696  15.076  1.00 29.55  ? 571 VAL A CG1   1 
ATOM   4080  C  CG2   . VAL A 1 571 ? 16.910  25.275  14.503  1.00 29.04  ? 571 VAL A CG2   1 
ATOM   4081  N  N     . SER A 1 572 ? 16.018  22.160  17.886  1.00 30.85  ? 572 SER A N     1 
ATOM   4082  C  CA    . SER A 1 572 ? 15.502  20.922  18.413  1.00 33.96  ? 572 SER A CA    1 
ATOM   4083  C  C     . SER A 1 572 ? 14.214  20.548  17.677  1.00 38.96  ? 572 SER A C     1 
ATOM   4084  O  O     . SER A 1 572 ? 13.297  21.372  17.521  1.00 34.17  ? 572 SER A O     1 
ATOM   4085  C  CB    . SER A 1 572 ? 15.256  21.046  19.920  1.00 38.60  ? 572 SER A CB    1 
ATOM   4086  O  OG    . SER A 1 572 ? 14.857  19.793  20.447  1.00 46.62  ? 572 SER A OG    1 
ATOM   4087  N  N     . VAL A 1 573 ? 14.145  19.300  17.227  1.00 31.98  ? 573 VAL A N     1 
ATOM   4088  C  CA    . VAL A 1 573 ? 13.002  18.839  16.452  1.00 33.68  ? 573 VAL A CA    1 
ATOM   4089  C  C     . VAL A 1 573 ? 12.289  17.712  17.170  1.00 41.43  ? 573 VAL A C     1 
ATOM   4090  O  O     . VAL A 1 573 ? 12.851  16.635  17.330  1.00 38.11  ? 573 VAL A O     1 
ATOM   4091  C  CB    . VAL A 1 573 ? 13.421  18.363  15.047  1.00 30.34  ? 573 VAL A CB    1 
ATOM   4092  C  CG1   . VAL A 1 573 ? 12.219  17.841  14.274  1.00 29.65  ? 573 VAL A CG1   1 
ATOM   4093  C  CG2   . VAL A 1 573 ? 14.114  19.504  14.291  1.00 32.82  ? 573 VAL A CG2   1 
ATOM   4094  N  N     . ARG A 1 574 ? 11.084  17.990  17.665  1.00 39.46  ? 574 ARG A N     1 
ATOM   4095  C  CA    . ARG A 1 574 ? 10.284  16.998  18.397  1.00 42.86  ? 574 ARG A CA    1 
ATOM   4096  C  C     . ARG A 1 574 ? 9.195   16.402  17.515  1.00 40.34  ? 574 ARG A C     1 
ATOM   4097  O  O     . ARG A 1 574 ? 8.346   17.136  16.936  1.00 38.64  ? 574 ARG A O     1 
ATOM   4098  C  CB    . ARG A 1 574 ? 9.633   17.597  19.659  1.00 45.61  ? 574 ARG A CB    1 
ATOM   4099  C  CG    . ARG A 1 574 ? 10.586  18.070  20.745  1.00 43.07  ? 574 ARG A CG    1 
ATOM   4100  C  CD    . ARG A 1 574 ? 11.052  19.496  20.508  1.00 51.55  ? 574 ARG A CD    1 
ATOM   4101  N  NE    . ARG A 1 574 ? 12.010  19.959  21.521  1.00 54.98  ? 574 ARG A NE    1 
ATOM   4102  C  CZ    . ARG A 1 574 ? 11.665  20.424  22.721  1.00 58.69  ? 574 ARG A CZ    1 
ATOM   4103  N  NH1   . ARG A 1 574 ? 10.385  20.478  23.078  1.00 68.12  ? 574 ARG A NH1   1 
ATOM   4104  N  NH2   . ARG A 1 574 ? 12.598  20.833  23.566  1.00 60.05  ? 574 ARG A NH2   1 
ATOM   4105  N  N     . LYS A 1 575 ? 9.211   15.071  17.454  1.00 39.44  ? 575 LYS A N     1 
ATOM   4106  C  CA    . LYS A 1 575 ? 8.267   14.266  16.670  1.00 44.24  ? 575 LYS A CA    1 
ATOM   4107  C  C     . LYS A 1 575 ? 6.870   14.173  17.269  1.00 40.63  ? 575 LYS A C     1 
ATOM   4108  O  O     . LYS A 1 575 ? 5.912   13.860  16.568  1.00 45.77  ? 575 LYS A O     1 
ATOM   4109  C  CB    . LYS A 1 575 ? 8.769   12.841  16.513  1.00 47.58  ? 575 LYS A CB    1 
ATOM   4110  C  CG    . LYS A 1 575 ? 10.106  12.643  15.866  1.00 55.67  ? 575 LYS A CG    1 
ATOM   4111  C  CD    . LYS A 1 575 ? 10.398  11.144  15.945  1.00 55.15  ? 575 LYS A CD    1 
ATOM   4112  C  CE    . LYS A 1 575 ? 11.735  10.751  15.376  1.00 64.24  ? 575 LYS A CE    1 
ATOM   4113  N  NZ    . LYS A 1 575 ? 11.890  9.256   15.441  1.00 63.89  ? 575 LYS A NZ    1 
ATOM   4114  N  N     . SER A 1 576 ? 6.770   14.395  18.575  1.00 40.67  ? 576 SER A N     1 
ATOM   4115  C  CA    . SER A 1 576 ? 5.495   14.305  19.278  1.00 47.49  ? 576 SER A CA    1 
ATOM   4116  C  C     . SER A 1 576 ? 5.302   15.579  20.084  1.00 47.68  ? 576 SER A C     1 
ATOM   4117  O  O     . SER A 1 576 ? 6.273   16.271  20.388  1.00 40.93  ? 576 SER A O     1 
ATOM   4118  C  CB    . SER A 1 576 ? 5.465   13.076  20.197  1.00 43.95  ? 576 SER A CB    1 
ATOM   4119  O  OG    . SER A 1 576 ? 6.305   13.287  21.327  1.00 52.51  ? 576 SER A OG    1 
ATOM   4120  N  N     . GLY A 1 577 ? 4.059   15.902  20.430  1.00 44.10  ? 577 GLY A N     1 
ATOM   4121  C  CA    . GLY A 1 577 ? 3.802   17.097  21.219  1.00 39.84  ? 577 GLY A CA    1 
ATOM   4122  C  C     . GLY A 1 577 ? 3.451   18.313  20.373  1.00 45.60  ? 577 GLY A C     1 
ATOM   4123  O  O     . GLY A 1 577 ? 3.209   19.400  20.900  1.00 40.93  ? 577 GLY A O     1 
ATOM   4124  N  N     . GLY A 1 578 ? 3.412   18.137  19.056  1.00 42.59  ? 578 GLY A N     1 
ATOM   4125  C  CA    . GLY A 1 578 ? 3.093   19.240  18.168  1.00 35.66  ? 578 GLY A CA    1 
ATOM   4126  C  C     . GLY A 1 578 ? 1.599   19.490  18.048  1.00 37.08  ? 578 GLY A C     1 
ATOM   4127  O  O     . GLY A 1 578 ? 1.182   20.461  17.441  1.00 34.52  ? 578 GLY A O     1 
ATOM   4128  N  N     . GLY A 1 579 ? 0.792   18.603  18.618  1.00 38.63  ? 579 GLY A N     1 
ATOM   4129  C  CA    . GLY A 1 579 ? -0.647  18.716  18.511  1.00 39.00  ? 579 GLY A CA    1 
ATOM   4130  C  C     . GLY A 1 579 ? -1.127  18.585  17.082  1.00 37.94  ? 579 GLY A C     1 
ATOM   4131  O  O     . GLY A 1 579 ? -0.601  17.781  16.307  1.00 36.93  ? 579 GLY A O     1 
ATOM   4132  N  N     . ARG A 1 580 ? -2.161  19.346  16.736  1.00 34.04  ? 580 ARG A N     1 
ATOM   4133  C  CA    . ARG A 1 580 ? -2.728  19.259  15.400  1.00 33.52  ? 580 ARG A CA    1 
ATOM   4134  C  C     . ARG A 1 580 ? -2.996  20.633  14.836  1.00 34.91  ? 580 ARG A C     1 
ATOM   4135  O  O     . ARG A 1 580 ? -3.245  21.594  15.563  1.00 36.11  ? 580 ARG A O     1 
ATOM   4136  C  CB    . ARG A 1 580 ? -4.038  18.442  15.402  1.00 33.86  ? 580 ARG A CB    1 
ATOM   4137  C  CG    . ARG A 1 580 ? -3.938  17.057  16.033  1.00 32.44  ? 580 ARG A CG    1 
ATOM   4138  C  CD    . ARG A 1 580 ? -3.350  16.022  15.078  1.00 35.23  ? 580 ARG A CD    1 
ATOM   4139  N  NE    . ARG A 1 580 ? -3.512  14.672  15.614  1.00 32.75  ? 580 ARG A NE    1 
ATOM   4140  C  CZ    . ARG A 1 580 ? -3.332  13.551  14.921  1.00 35.36  ? 580 ARG A CZ    1 
ATOM   4141  N  NH1   . ARG A 1 580 ? -2.981  13.599  13.642  1.00 31.88  ? 580 ARG A NH1   1 
ATOM   4142  N  NH2   . ARG A 1 580 ? -3.525  12.377  15.513  1.00 33.65  ? 580 ARG A NH2   1 
ATOM   4143  N  N     . VAL A 1 581 ? -3.016  20.699  13.519  1.00 31.62  ? 581 VAL A N     1 
ATOM   4144  C  CA    . VAL A 1 581 ? -3.207  21.941  12.819  1.00 35.01  ? 581 VAL A CA    1 
ATOM   4145  C  C     . VAL A 1 581 ? -4.232  21.747  11.702  1.00 32.85  ? 581 VAL A C     1 
ATOM   4146  O  O     . VAL A 1 581 ? -4.082  20.819  10.906  1.00 34.77  ? 581 VAL A O     1 
ATOM   4147  C  CB    . VAL A 1 581 ? -1.821  22.425  12.285  1.00 34.72  ? 581 VAL A CB    1 
ATOM   4148  C  CG1   . VAL A 1 581 ? -1.930  23.191  11.014  1.00 34.22  ? 581 VAL A CG1   1 
ATOM   4149  C  CG2   . VAL A 1 581 ? -1.066  23.158  13.388  1.00 37.26  ? 581 VAL A CG2   1 
ATOM   4150  N  N     . TYR A 1 582 ? -5.275  22.591  11.675  1.00 31.84  ? 582 TYR A N     1 
ATOM   4151  C  CA    . TYR A 1 582 ? -6.341  22.517  10.658  1.00 32.59  ? 582 TYR A CA    1 
ATOM   4152  C  C     . TYR A 1 582 ? -6.495  23.854  9.917   1.00 33.68  ? 582 TYR A C     1 
ATOM   4153  O  O     . TYR A 1 582 ? -6.416  24.915  10.525  1.00 32.83  ? 582 TYR A O     1 
ATOM   4154  C  CB    . TYR A 1 582 ? -7.692  22.140  11.314  1.00 29.63  ? 582 TYR A CB    1 
ATOM   4155  C  CG    . TYR A 1 582 ? -7.640  20.837  12.095  1.00 30.58  ? 582 TYR A CG    1 
ATOM   4156  C  CD1   . TYR A 1 582 ? -7.578  19.623  11.441  1.00 31.89  ? 582 TYR A CD1   1 
ATOM   4157  C  CD2   . TYR A 1 582 ? -7.644  20.831  13.482  1.00 31.45  ? 582 TYR A CD2   1 
ATOM   4158  C  CE1   . TYR A 1 582 ? -7.513  18.424  12.147  1.00 34.32  ? 582 TYR A CE1   1 
ATOM   4159  C  CE2   . TYR A 1 582 ? -7.573  19.642  14.191  1.00 28.18  ? 582 TYR A CE2   1 
ATOM   4160  C  CZ    . TYR A 1 582 ? -7.509  18.456  13.515  1.00 27.38  ? 582 TYR A CZ    1 
ATOM   4161  O  OH    . TYR A 1 582 ? -7.424  17.298  14.220  1.00 29.54  ? 582 TYR A OH    1 
ATOM   4162  N  N     . PRO A 1 583 ? -6.760  23.816  8.611   1.00 33.94  ? 583 PRO A N     1 
ATOM   4163  C  CA    . PRO A 1 583 ? -7.025  25.122  7.997   1.00 39.28  ? 583 PRO A CA    1 
ATOM   4164  C  C     . PRO A 1 583 ? -8.355  25.677  8.503   1.00 48.09  ? 583 PRO A C     1 
ATOM   4165  O  O     . PRO A 1 583 ? -9.248  24.909  8.867   1.00 41.15  ? 583 PRO A O     1 
ATOM   4166  C  CB    . PRO A 1 583 ? -7.089  24.814  6.497   1.00 40.27  ? 583 PRO A CB    1 
ATOM   4167  C  CG    . PRO A 1 583 ? -7.421  23.350  6.414   1.00 39.19  ? 583 PRO A CG    1 
ATOM   4168  C  CD    . PRO A 1 583 ? -6.858  22.698  7.656   1.00 38.53  ? 583 PRO A CD    1 
ATOM   4169  N  N     . VAL A 1 584 ? -8.468  26.995  8.583   1.00 51.91  ? 584 VAL A N     1 
ATOM   4170  C  CA    . VAL A 1 584 ? -9.750  27.600  8.913   1.00 48.06  ? 584 VAL A CA    1 
ATOM   4171  C  C     . VAL A 1 584 ? -10.715 27.362  7.748   1.00 55.02  ? 584 VAL A C     1 
ATOM   4172  O  O     . VAL A 1 584 ? -11.827 26.843  7.932   1.00 53.08  ? 584 VAL A O     1 
ATOM   4173  C  CB    . VAL A 1 584 ? -9.596  29.092  9.228   1.00 51.06  ? 584 VAL A CB    1 
ATOM   4174  C  CG1   . VAL A 1 584 ? -10.972 29.787  9.266   1.00 60.17  ? 584 VAL A CG1   1 
ATOM   4175  C  CG2   . VAL A 1 584 ? -8.857  29.255  10.551  1.00 43.00  ? 584 VAL A CG2   1 
ATOM   4176  N  N     . GLN A 1 585 ? -10.263 27.686  6.542   1.00 51.00  ? 585 GLN A N     1 
ATOM   4177  C  CA    . GLN A 1 585 ? -11.031 27.377  5.344   1.00 57.22  ? 585 GLN A CA    1 
ATOM   4178  C  C     . GLN A 1 585 ? -10.120 26.790  4.272   1.00 54.21  ? 585 GLN A C     1 
ATOM   4179  O  O     . GLN A 1 585 ? -8.912  27.013  4.287   1.00 49.94  ? 585 GLN A O     1 
ATOM   4180  C  CB    . GLN A 1 585 ? -11.727 28.631  4.819   1.00 61.00  ? 585 GLN A CB    1 
ATOM   4181  N  N     . GLY A 1 586 ? -10.692 26.010  3.361   1.00 46.71  ? 586 GLY A N     1 
ATOM   4182  C  CA    . GLY A 1 586 ? -9.926  25.477  2.249   1.00 50.47  ? 586 GLY A CA    1 
ATOM   4183  C  C     . GLY A 1 586 ? -9.214  24.166  2.553   1.00 47.23  ? 586 GLY A C     1 
ATOM   4184  O  O     . GLY A 1 586 ? -9.464  23.523  3.567   1.00 44.10  ? 586 GLY A O     1 
ATOM   4185  N  N     . ARG A 1 587 ? -8.261  23.801  1.707   1.00 46.72  ? 587 ARG A N     1 
ATOM   4186  C  CA    . ARG A 1 587 ? -7.642  22.491  1.820   1.00 45.64  ? 587 ARG A CA    1 
ATOM   4187  C  C     . ARG A 1 587 ? -6.447  22.519  2.763   1.00 46.62  ? 587 ARG A C     1 
ATOM   4188  O  O     . ARG A 1 587 ? -5.862  23.571  3.022   1.00 41.03  ? 587 ARG A O     1 
ATOM   4189  C  CB    . ARG A 1 587 ? -7.205  21.990  0.435   1.00 54.02  ? 587 ARG A CB    1 
ATOM   4190  C  CG    . ARG A 1 587 ? -8.363  21.805  -0.567  1.00 59.98  ? 587 ARG A CG    1 
ATOM   4191  C  CD    . ARG A 1 587 ? -7.857  21.549  -1.997  1.00 72.09  ? 587 ARG A CD    1 
ATOM   4192  N  NE    . ARG A 1 587 ? -7.197  22.711  -2.596  1.00 73.89  ? 587 ARG A NE    1 
ATOM   4193  C  CZ    . ARG A 1 587 ? -7.743  23.489  -3.530  1.00 76.82  ? 587 ARG A CZ    1 
ATOM   4194  N  NH1   . ARG A 1 587 ? -8.960  23.222  -3.994  1.00 77.75  ? 587 ARG A NH1   1 
ATOM   4195  N  NH2   . ARG A 1 587 ? -7.065  24.527  -4.013  1.00 70.12  ? 587 ARG A NH2   1 
ATOM   4196  N  N     . LEU A 1 588 ? -6.121  21.356  3.311   1.00 43.57  ? 588 LEU A N     1 
ATOM   4197  C  CA    . LEU A 1 588 ? -4.952  21.222  4.151   1.00 48.05  ? 588 LEU A CA    1 
ATOM   4198  C  C     . LEU A 1 588 ? -3.801  20.918  3.216   1.00 43.60  ? 588 LEU A C     1 
ATOM   4199  O  O     . LEU A 1 588 ? -3.888  19.986  2.411   1.00 50.00  ? 588 LEU A O     1 
ATOM   4200  C  CB    . LEU A 1 588 ? -5.142  20.125  5.199   1.00 40.97  ? 588 LEU A CB    1 
ATOM   4201  C  CG    . LEU A 1 588 ? -3.961  19.789  6.118   1.00 45.64  ? 588 LEU A CG    1 
ATOM   4202  C  CD1   . LEU A 1 588 ? -3.449  21.014  6.876   1.00 36.89  ? 588 LEU A CD1   1 
ATOM   4203  C  CD2   . LEU A 1 588 ? -4.359  18.687  7.082   1.00 39.18  ? 588 LEU A CD2   1 
ATOM   4204  N  N     . ALA A 1 589 ? -2.754  21.734  3.285   1.00 51.49  ? 589 ALA A N     1 
ATOM   4205  C  CA    . ALA A 1 589 ? -1.584  21.576  2.413   1.00 48.89  ? 589 ALA A CA    1 
ATOM   4206  C  C     . ALA A 1 589 ? -0.306  21.478  3.220   1.00 49.96  ? 589 ALA A C     1 
ATOM   4207  O  O     . ALA A 1 589 ? -0.272  21.889  4.388   1.00 45.59  ? 589 ALA A O     1 
ATOM   4208  C  CB    . ALA A 1 589 ? -1.466  22.730  1.437   1.00 38.67  ? 589 ALA A CB    1 
ATOM   4209  N  N     . ASP A 1 590 ? 0.731   20.934  2.569   1.00 46.67  ? 590 ASP A N     1 
ATOM   4210  C  CA    . ASP A 1 590 ? 2.086   20.810  3.110   1.00 48.51  ? 590 ASP A CA    1 
ATOM   4211  C  C     . ASP A 1 590 ? 2.796   22.115  3.274   1.00 41.54  ? 590 ASP A C     1 
ATOM   4212  O  O     . ASP A 1 590 ? 2.383   23.109  2.713   1.00 40.97  ? 590 ASP A O     1 
ATOM   4213  C  CB    . ASP A 1 590 ? 2.956   19.937  2.177   1.00 39.01  ? 590 ASP A CB    1 
ATOM   4214  C  CG    . ASP A 1 590 ? 2.909   18.537  2.555   1.00 37.69  ? 590 ASP A CG    1 
ATOM   4215  O  OD1   . ASP A 1 590 ? 2.544   18.308  3.719   1.00 51.74  ? 590 ASP A OD1   1 
ATOM   4216  O  OD2   . ASP A 1 590 ? 3.129   17.660  1.710   1.00 43.04  ? 590 ASP A OD2   1 
ATOM   4217  N  N     . GLY A 1 591 ? 3.942   22.062  3.952   1.00 42.75  ? 591 GLY A N     1 
ATOM   4218  C  CA    . GLY A 1 591 ? 4.802   23.216  4.081   1.00 41.48  ? 591 GLY A CA    1 
ATOM   4219  C  C     . GLY A 1 591 ? 4.132   24.338  4.837   1.00 40.24  ? 591 GLY A C     1 
ATOM   4220  O  O     . GLY A 1 591 ? 4.036   25.448  4.343   1.00 36.41  ? 591 GLY A O     1 
ATOM   4221  N  N     . LEU A 1 592 ? 3.635   24.029  6.026   1.00 36.75  ? 592 LEU A N     1 
ATOM   4222  C  CA    . LEU A 1 592 ? 3.020   25.053  6.843   1.00 42.09  ? 592 LEU A CA    1 
ATOM   4223  C  C     . LEU A 1 592 ? 3.944   25.368  7.992   1.00 37.25  ? 592 LEU A C     1 
ATOM   4224  O  O     . LEU A 1 592 ? 4.376   24.470  8.699   1.00 34.61  ? 592 LEU A O     1 
ATOM   4225  C  CB    . LEU A 1 592 ? 1.630   24.613  7.364   1.00 35.11  ? 592 LEU A CB    1 
ATOM   4226  C  CG    . LEU A 1 592 ? 0.449   25.293  6.684   1.00 44.73  ? 592 LEU A CG    1 
ATOM   4227  C  CD1   . LEU A 1 592 ? 0.600   25.223  5.175   1.00 46.17  ? 592 LEU A CD1   1 
ATOM   4228  C  CD2   . LEU A 1 592 ? -0.894  24.712  7.129   1.00 43.78  ? 592 LEU A CD2   1 
ATOM   4229  N  N     . TYR A 1 593 ? 4.224   26.650  8.174   1.00 34.65  ? 593 TYR A N     1 
ATOM   4230  C  CA    . TYR A 1 593 ? 5.034   27.127  9.264   1.00 32.63  ? 593 TYR A CA    1 
ATOM   4231  C  C     . TYR A 1 593 ? 4.148   27.930  10.239  1.00 36.28  ? 593 TYR A C     1 
ATOM   4232  O  O     . TYR A 1 593 ? 3.473   28.878  9.846   1.00 34.67  ? 593 TYR A O     1 
ATOM   4233  C  CB    . TYR A 1 593 ? 6.216   27.959  8.702   1.00 36.37  ? 593 TYR A CB    1 
ATOM   4234  C  CG    . TYR A 1 593 ? 6.754   29.012  9.632   1.00 29.95  ? 593 TYR A CG    1 
ATOM   4235  C  CD1   . TYR A 1 593 ? 7.263   28.662  10.855  1.00 34.17  ? 593 TYR A CD1   1 
ATOM   4236  C  CD2   . TYR A 1 593 ? 6.762   30.364  9.270   1.00 40.63  ? 593 TYR A CD2   1 
ATOM   4237  C  CE1   . TYR A 1 593 ? 7.749   29.601  11.717  1.00 39.82  ? 593 TYR A CE1   1 
ATOM   4238  C  CE2   . TYR A 1 593 ? 7.262   31.342  10.138  1.00 34.21  ? 593 TYR A CE2   1 
ATOM   4239  C  CZ    . TYR A 1 593 ? 7.761   30.936  11.361  1.00 39.99  ? 593 TYR A CZ    1 
ATOM   4240  O  OH    . TYR A 1 593 ? 8.283   31.829  12.267  1.00 44.00  ? 593 TYR A OH    1 
ATOM   4241  N  N     . VAL A 1 594 ? 4.124   27.511  11.505  1.00 30.32  ? 594 VAL A N     1 
ATOM   4242  C  CA    . VAL A 1 594 ? 3.226   28.097  12.472  1.00 35.26  ? 594 VAL A CA    1 
ATOM   4243  C  C     . VAL A 1 594 ? 3.941   28.562  13.733  1.00 34.49  ? 594 VAL A C     1 
ATOM   4244  O  O     . VAL A 1 594 ? 4.115   27.792  14.680  1.00 36.09  ? 594 VAL A O     1 
ATOM   4245  C  CB    . VAL A 1 594 ? 2.094   27.108  12.870  1.00 39.69  ? 594 VAL A CB    1 
ATOM   4246  C  CG1   . VAL A 1 594 ? 1.088   27.814  13.757  1.00 34.75  ? 594 VAL A CG1   1 
ATOM   4247  C  CG2   . VAL A 1 594 ? 1.413   26.536  11.614  1.00 25.81  ? 594 VAL A CG2   1 
ATOM   4248  N  N     . PRO A 1 595 ? 4.329   29.850  13.761  1.00 37.94  ? 595 PRO A N     1 
ATOM   4249  C  CA    . PRO A 1 595 ? 5.031   30.398  14.930  1.00 39.27  ? 595 PRO A CA    1 
ATOM   4250  C  C     . PRO A 1 595 ? 4.131   30.406  16.153  1.00 40.72  ? 595 PRO A C     1 
ATOM   4251  O  O     . PRO A 1 595 ? 2.970   30.812  16.054  1.00 47.98  ? 595 PRO A O     1 
ATOM   4252  C  CB    . PRO A 1 595 ? 5.427   31.825  14.492  1.00 42.84  ? 595 PRO A CB    1 
ATOM   4253  C  CG    . PRO A 1 595 ? 4.517   32.162  13.358  1.00 46.56  ? 595 PRO A CG    1 
ATOM   4254  C  CD    . PRO A 1 595 ? 4.067   30.859  12.719  1.00 30.85  ? 595 PRO A CD    1 
ATOM   4255  N  N     . LEU A 1 596 ? 4.667   29.951  17.280  1.00 36.69  ? 596 LEU A N     1 
ATOM   4256  C  CA    . LEU A 1 596 ? 3.974   29.918  18.559  1.00 37.87  ? 596 LEU A CA    1 
ATOM   4257  C  C     . LEU A 1 596 ? 4.783   30.778  19.550  1.00 45.55  ? 596 LEU A C     1 
ATOM   4258  O  O     . LEU A 1 596 ? 5.440   31.733  19.149  1.00 53.48  ? 596 LEU A O     1 
ATOM   4259  C  CB    . LEU A 1 596 ? 3.905   28.484  19.082  1.00 44.61  ? 596 LEU A CB    1 
ATOM   4260  C  CG    . LEU A 1 596 ? 3.243   27.391  18.235  1.00 43.00  ? 596 LEU A CG    1 
ATOM   4261  C  CD1   . LEU A 1 596 ? 3.404   26.032  18.904  1.00 46.13  ? 596 LEU A CD1   1 
ATOM   4262  C  CD2   . LEU A 1 596 ? 1.776   27.702  18.047  1.00 44.89  ? 596 LEU A CD2   1 
ATOM   4263  N  N     . GLU A 1 597 ? 4.854   30.354  20.784  1.00 40.96  ? 597 GLU A N     1 
ATOM   4264  C  CA    . GLU A 1 597 ? 5.499   31.131  21.800  1.00 52.32  ? 597 GLU A CA    1 
ATOM   4265  C  C     . GLU A 1 597 ? 6.940   31.203  21.396  1.00 54.15  ? 597 GLU A C     1 
ATOM   4266  O  O     . GLU A 1 597 ? 7.318   30.624  20.435  1.00 54.69  ? 597 GLU A O     1 
ATOM   4267  C  CB    . GLU A 1 597 ? 5.350   30.480  23.158  1.00 52.00  ? 597 GLU A CB    1 
ATOM   4268  C  CG    . GLU A 1 597 ? 6.199   29.255  23.362  1.00 58.97  ? 597 GLU A CG    1 
ATOM   4269  C  CD    . GLU A 1 597 ? 5.462   27.981  23.023  1.00 65.73  ? 597 GLU A CD    1 
ATOM   4270  O  OE1   . GLU A 1 597 ? 5.854   26.912  23.496  1.00 67.42  ? 597 GLU A OE1   1 
ATOM   4271  O  OE2   . GLU A 1 597 ? 4.485   28.044  22.278  1.00 65.58  ? 597 GLU A OE2   1 
ATOM   4272  N  N     . ASP A 1 598 ? 7.737   31.976  22.092  1.00 55.75  ? 598 ASP A N     1 
ATOM   4273  C  CA    . ASP A 1 598 ? 8.744   32.855  21.566  1.00 53.56  ? 598 ASP A CA    1 
ATOM   4274  C  C     . ASP A 1 598 ? 9.852   32.305  20.674  1.00 49.92  ? 598 ASP A C     1 
ATOM   4275  O  O     . ASP A 1 598 ? 10.183  32.961  19.695  1.00 48.94  ? 598 ASP A O     1 
ATOM   4276  C  CB    . ASP A 1 598 ? 9.382   33.600  22.720  1.00 58.56  ? 598 ASP A CB    1 
ATOM   4277  N  N     . LYS A 1 599 ? 10.442  31.160  20.980  1.00 44.74  ? 599 LYS A N     1 
ATOM   4278  C  CA    . LYS A 1 599 ? 11.418  30.587  20.058  1.00 44.93  ? 599 LYS A CA    1 
ATOM   4279  C  C     . LYS A 1 599 ? 10.945  29.267  19.461  1.00 49.49  ? 599 LYS A C     1 
ATOM   4280  O  O     . LYS A 1 599 ? 11.710  28.437  19.045  1.00 38.61  ? 599 LYS A O     1 
ATOM   4281  C  CB    . LYS A 1 599 ? 12.788  30.495  20.695  1.00 51.56  ? 599 LYS A CB    1 
ATOM   4282  C  CG    . LYS A 1 599 ? 13.466  31.845  20.778  1.00 56.88  ? 599 LYS A CG    1 
ATOM   4283  C  CD    . LYS A 1 599 ? 14.897  31.773  21.269  1.00 65.52  ? 599 LYS A CD    1 
ATOM   4284  C  CE    . LYS A 1 599 ? 14.972  31.291  22.708  1.00 74.43  ? 599 LYS A CE    1 
ATOM   4285  N  NZ    . LYS A 1 599 ? 14.897  32.404  23.690  1.00 74.00  ? 599 LYS A NZ    1 
ATOM   4286  N  N     . THR A 1 600 ? 9.648   29.081  19.474  1.00 41.09  ? 600 THR A N     1 
ATOM   4287  C  CA    . THR A 1 600 ? 9.045   27.789  19.142  1.00 38.46  ? 600 THR A CA    1 
ATOM   4288  C  C     . THR A 1 600 ? 8.063   27.897  17.999  1.00 40.16  ? 600 THR A C     1 
ATOM   4289  O  O     . THR A 1 600 ? 7.300   28.858  17.902  1.00 37.32  ? 600 THR A O     1 
ATOM   4290  C  CB    . THR A 1 600 ? 8.317   27.190  20.333  1.00 42.48  ? 600 THR A CB    1 
ATOM   4291  O  OG1   . THR A 1 600 ? 7.128   27.958  20.568  1.00 54.93  ? 600 THR A OG1   1 
ATOM   4292  C  CG2   . THR A 1 600 ? 9.191   27.250  21.550  1.00 37.29  ? 600 THR A CG2   1 
ATOM   4293  N  N     . PHE A 1 601 ? 8.054   26.893  17.137  1.00 40.49  ? 601 PHE A N     1 
ATOM   4294  C  CA    . PHE A 1 601 ? 7.076   26.878  16.059  1.00 30.32  ? 601 PHE A CA    1 
ATOM   4295  C  C     . PHE A 1 601 ? 6.727   25.475  15.645  1.00 41.03  ? 601 PHE A C     1 
ATOM   4296  O  O     . PHE A 1 601 ? 7.440   24.527  15.967  1.00 36.93  ? 601 PHE A O     1 
ATOM   4297  C  CB    . PHE A 1 601 ? 7.572   27.663  14.845  1.00 30.61  ? 601 PHE A CB    1 
ATOM   4298  C  CG    . PHE A 1 601 ? 8.869   27.144  14.243  1.00 39.45  ? 601 PHE A CG    1 
ATOM   4299  C  CD1   . PHE A 1 601 ? 10.092  27.526  14.785  1.00 36.01  ? 601 PHE A CD1   1 
ATOM   4300  C  CD2   . PHE A 1 601 ? 8.867   26.329  13.113  1.00 37.16  ? 601 PHE A CD2   1 
ATOM   4301  C  CE1   . PHE A 1 601 ? 11.300  27.091  14.233  1.00 42.99  ? 601 PHE A CE1   1 
ATOM   4302  C  CE2   . PHE A 1 601 ? 10.068  25.888  12.553  1.00 42.71  ? 601 PHE A CE2   1 
ATOM   4303  C  CZ    . PHE A 1 601 ? 11.291  26.276  13.112  1.00 39.87  ? 601 PHE A CZ    1 
ATOM   4304  N  N     . LEU A 1 602 ? 5.632   25.374  14.903  1.00 34.08  ? 602 LEU A N     1 
ATOM   4305  C  CA    . LEU A 1 602 ? 5.163   24.118  14.358  1.00 37.52  ? 602 LEU A CA    1 
ATOM   4306  C  C     . LEU A 1 602 ? 5.533   24.079  12.903  1.00 32.30  ? 602 LEU A C     1 
ATOM   4307  O  O     . LEU A 1 602 ? 5.500   25.091  12.209  1.00 33.74  ? 602 LEU A O     1 
ATOM   4308  C  CB    . LEU A 1 602 ? 3.634   23.985  14.496  1.00 30.73  ? 602 LEU A CB    1 
ATOM   4309  C  CG    . LEU A 1 602 ? 3.091   24.072  15.924  1.00 37.86  ? 602 LEU A CG    1 
ATOM   4310  C  CD1   . LEU A 1 602 ? 1.573   23.885  15.939  1.00 35.28  ? 602 LEU A CD1   1 
ATOM   4311  C  CD2   . LEU A 1 602 ? 3.770   23.075  16.853  1.00 36.42  ? 602 LEU A CD2   1 
ATOM   4312  N  N     . LEU A 1 603 ? 5.812   22.897  12.410  1.00 26.77  ? 603 LEU A N     1 
ATOM   4313  C  CA    . LEU A 1 603 ? 6.148   22.764  11.010  1.00 30.78  ? 603 LEU A CA    1 
ATOM   4314  C  C     . LEU A 1 603 ? 5.406   21.554  10.504  1.00 28.89  ? 603 LEU A C     1 
ATOM   4315  O  O     . LEU A 1 603 ? 5.628   20.441  10.980  1.00 30.00  ? 603 LEU A O     1 
ATOM   4316  C  CB    . LEU A 1 603 ? 7.685   22.611  10.828  1.00 35.07  ? 603 LEU A CB    1 
ATOM   4317  C  CG    . LEU A 1 603 ? 8.281   22.719  9.420   1.00 38.33  ? 603 LEU A CG    1 
ATOM   4318  C  CD1   . LEU A 1 603 ? 8.042   24.113  8.844   1.00 37.79  ? 603 LEU A CD1   1 
ATOM   4319  C  CD2   . LEU A 1 603 ? 9.795   22.357  9.421   1.00 26.21  ? 603 LEU A CD2   1 
ATOM   4320  N  N     . LEU A 1 604 ? 4.487   21.792  9.579   1.00 31.96  ? 604 LEU A N     1 
ATOM   4321  C  CA    . LEU A 1 604 ? 3.775   20.736  8.902   1.00 35.02  ? 604 LEU A CA    1 
ATOM   4322  C  C     . LEU A 1 604 ? 4.498   20.442  7.602   1.00 32.85  ? 604 LEU A C     1 
ATOM   4323  O  O     . LEU A 1 604 ? 4.365   21.190  6.615   1.00 31.86  ? 604 LEU A O     1 
ATOM   4324  C  CB    . LEU A 1 604 ? 2.306   21.133  8.641   1.00 31.51  ? 604 LEU A CB    1 
ATOM   4325  C  CG    . LEU A 1 604 ? 1.283   19.990  8.661   1.00 35.37  ? 604 LEU A CG    1 
ATOM   4326  C  CD1   . LEU A 1 604 ? -0.148  20.500  8.443   1.00 38.93  ? 604 LEU A CD1   1 
ATOM   4327  C  CD2   . LEU A 1 604 ? 1.614   18.949  7.617   1.00 31.64  ? 604 LEU A CD2   1 
ATOM   4328  N  N     . THR A 1 605 ? 5.225   19.324  7.589   1.00 35.27  ? 605 THR A N     1 
ATOM   4329  C  CA    . THR A 1 605 ? 6.141   19.039  6.490   1.00 33.91  ? 605 THR A CA    1 
ATOM   4330  C  C     . THR A 1 605 ? 5.521   18.111  5.466   1.00 37.30  ? 605 THR A C     1 
ATOM   4331  O  O     . THR A 1 605 ? 5.741   18.268  4.263   1.00 34.19  ? 605 THR A O     1 
ATOM   4332  C  CB    . THR A 1 605 ? 7.479   18.452  6.991   1.00 35.46  ? 605 THR A CB    1 
ATOM   4333  O  OG1   . THR A 1 605 ? 7.226   17.286  7.775   1.00 32.28  ? 605 THR A OG1   1 
ATOM   4334  C  CG2   . THR A 1 605 ? 8.195   19.470  7.890   1.00 29.90  ? 605 THR A CG2   1 
ATOM   4335  N  N     . VAL A 1 606 ? 4.751   17.135  5.927   1.00 29.55  ? 606 VAL A N     1 
ATOM   4336  C  CA    . VAL A 1 606 ? 4.179   16.194  4.986   1.00 32.12  ? 606 VAL A CA    1 
ATOM   4337  C  C     . VAL A 1 606 ? 2.687   15.964  5.274   1.00 32.83  ? 606 VAL A C     1 
ATOM   4338  O  O     . VAL A 1 606 ? 2.225   15.948  6.424   1.00 32.04  ? 606 VAL A O     1 
ATOM   4339  C  CB    . VAL A 1 606 ? 4.920   14.831  4.996   1.00 35.57  ? 606 VAL A CB    1 
ATOM   4340  C  CG1   . VAL A 1 606 ? 6.382   15.017  4.565   1.00 34.11  ? 606 VAL A CG1   1 
ATOM   4341  C  CG2   . VAL A 1 606 ? 4.825   14.181  6.385   1.00 27.77  ? 606 VAL A CG2   1 
ATOM   4342  N  N     . HIS A 1 607 ? 1.935   15.818  4.205   1.00 30.88  ? 607 HIS A N     1 
ATOM   4343  C  CA    . HIS A 1 607 ? 0.542   15.441  4.340   1.00 42.25  ? 607 HIS A CA    1 
ATOM   4344  C  C     . HIS A 1 607 ? 0.067   14.780  3.075   1.00 40.10  ? 607 HIS A C     1 
ATOM   4345  O  O     . HIS A 1 607 ? 0.492   15.146  1.967   1.00 40.86  ? 607 HIS A O     1 
ATOM   4346  C  CB    . HIS A 1 607 ? -0.361  16.647  4.636   1.00 38.09  ? 607 HIS A CB    1 
ATOM   4347  C  CG    . HIS A 1 607 ? -1.816  16.345  4.445   1.00 44.04  ? 607 HIS A CG    1 
ATOM   4348  N  ND1   . HIS A 1 607 ? -2.498  15.449  5.237   1.00 40.86  ? 607 HIS A ND1   1 
ATOM   4349  C  CD2   . HIS A 1 607 ? -2.692  16.756  3.498   1.00 41.07  ? 607 HIS A CD2   1 
ATOM   4350  C  CE1   . HIS A 1 607 ? -3.744  15.350  4.813   1.00 41.99  ? 607 HIS A CE1   1 
ATOM   4351  N  NE2   . HIS A 1 607 ? -3.887  16.132  3.757   1.00 39.47  ? 607 HIS A NE2   1 
ATOM   4352  N  N     . ARG A 1 608 ? -0.813  13.800  3.266   1.00 43.26  ? 608 ARG A N     1 
ATOM   4353  C  CA    . ARG A 1 608 ? -1.514  13.135  2.182   1.00 45.57  ? 608 ARG A CA    1 
ATOM   4354  C  C     . ARG A 1 608 ? -2.944  12.787  2.639   1.00 41.96  ? 608 ARG A C     1 
ATOM   4355  O  O     . ARG A 1 608 ? -3.139  12.238  3.723   1.00 43.77  ? 608 ARG A O     1 
ATOM   4356  C  CB    . ARG A 1 608 ? -0.751  11.883  1.758   1.00 47.92  ? 608 ARG A CB    1 
ATOM   4357  C  CG    . ARG A 1 608 ? -0.332  11.894  0.311   1.00 52.58  ? 608 ARG A CG    1 
ATOM   4358  C  CD    . ARG A 1 608 ? 0.974   12.605  0.073   1.00 42.88  ? 608 ARG A CD    1 
ATOM   4359  N  NE    . ARG A 1 608 ? 1.075   12.922  -1.342  1.00 45.48  ? 608 ARG A NE    1 
ATOM   4360  C  CZ    . ARG A 1 608 ? 0.900   14.132  -1.860  1.00 43.49  ? 608 ARG A CZ    1 
ATOM   4361  N  NH1   . ARG A 1 608 ? 0.646   15.174  -1.072  1.00 37.52  ? 608 ARG A NH1   1 
ATOM   4362  N  NH2   . ARG A 1 608 ? 1.001   14.299  -3.174  1.00 45.32  ? 608 ARG A NH2   1 
ATOM   4363  N  N     . ASP A 1 609 ? -3.936  13.089  1.816   1.00 43.87  ? 609 ASP A N     1 
ATOM   4364  C  CA    . ASP A 1 609 ? -5.333  12.863  2.222   1.00 46.86  ? 609 ASP A CA    1 
ATOM   4365  C  C     . ASP A 1 609 ? -5.610  11.408  2.629   1.00 44.81  ? 609 ASP A C     1 
ATOM   4366  O  O     . ASP A 1 609 ? -6.264  11.164  3.643   1.00 46.07  ? 609 ASP A O     1 
ATOM   4367  C  CB    . ASP A 1 609 ? -6.256  13.300  1.097   1.00 41.27  ? 609 ASP A CB    1 
ATOM   4368  C  CG    . ASP A 1 609 ? -6.311  14.829  0.972   1.00 56.80  ? 609 ASP A CG    1 
ATOM   4369  O  OD1   . ASP A 1 609 ? -6.304  15.519  2.036   1.00 45.52  ? 609 ASP A OD1   1 
ATOM   4370  O  OD2   . ASP A 1 609 ? -6.281  15.335  -0.182  1.00 54.49  ? 609 ASP A OD2   1 
ATOM   4371  N  N     . PHE A 1 610 ? -5.062  10.444  1.888   1.00 37.21  ? 610 PHE A N     1 
ATOM   4372  C  CA    . PHE A 1 610 ? -5.285  9.036   2.214   1.00 42.04  ? 610 PHE A CA    1 
ATOM   4373  C  C     . PHE A 1 610 ? -4.550  8.606   3.492   1.00 50.88  ? 610 PHE A C     1 
ATOM   4374  O  O     . PHE A 1 610 ? -4.728  7.491   3.987   1.00 50.92  ? 610 PHE A O     1 
ATOM   4375  C  CB    . PHE A 1 610 ? -4.847  8.146   1.043   1.00 47.69  ? 610 PHE A CB    1 
ATOM   4376  C  CG    . PHE A 1 610 ? -3.347  8.161   0.766   1.00 41.15  ? 610 PHE A CG    1 
ATOM   4377  C  CD1   . PHE A 1 610 ? -2.467  7.381   1.512   1.00 43.95  ? 610 PHE A CD1   1 
ATOM   4378  C  CD2   . PHE A 1 610 ? -2.833  8.930   -0.268  1.00 40.25  ? 610 PHE A CD2   1 
ATOM   4379  C  CE1   . PHE A 1 610 ? -1.099  7.382   1.242   1.00 41.99  ? 610 PHE A CE1   1 
ATOM   4380  C  CE2   . PHE A 1 610 ? -1.470  8.939   -0.550  1.00 48.02  ? 610 PHE A CE2   1 
ATOM   4381  C  CZ    . PHE A 1 610 ? -0.595  8.167   0.208   1.00 37.06  ? 610 PHE A CZ    1 
ATOM   4382  N  N     . ARG A 1 611 ? -3.716  9.499   4.009   1.00 45.95  ? 611 ARG A N     1 
ATOM   4383  C  CA    . ARG A 1 611 ? -2.835  9.183   5.115   1.00 48.21  ? 611 ARG A CA    1 
ATOM   4384  C  C     . ARG A 1 611 ? -3.257  9.743   6.484   1.00 50.05  ? 611 ARG A C     1 
ATOM   4385  O  O     . ARG A 1 611 ? -2.396  10.153  7.281   1.00 48.93  ? 611 ARG A O     1 
ATOM   4386  C  CB    . ARG A 1 611 ? -1.407  9.623   4.756   1.00 49.29  ? 611 ARG A CB    1 
ATOM   4387  C  CG    . ARG A 1 611 ? -0.311  8.810   5.408   1.00 48.51  ? 611 ARG A CG    1 
ATOM   4388  C  CD    . ARG A 1 611 ? 1.025   9.568   5.344   1.00 52.56  ? 611 ARG A CD    1 
ATOM   4389  N  NE    . ARG A 1 611 ? 1.791   9.398   4.113   1.00 56.97  ? 611 ARG A NE    1 
ATOM   4390  C  CZ    . ARG A 1 611 ? 2.616   10.314  3.616   1.00 51.13  ? 611 ARG A CZ    1 
ATOM   4391  N  NH1   . ARG A 1 611 ? 2.743   11.493  4.220   1.00 48.42  ? 611 ARG A NH1   1 
ATOM   4392  N  NH2   . ARG A 1 611 ? 3.275   10.069  2.489   1.00 49.32  ? 611 ARG A NH2   1 
ATOM   4393  N  N     . GLY A 1 612 ? -4.563  9.796   6.745   1.00 42.93  ? 612 GLY A N     1 
ATOM   4394  C  CA    . GLY A 1 612 ? -5.094  10.347  7.987   1.00 37.86  ? 612 GLY A CA    1 
ATOM   4395  C  C     . GLY A 1 612 ? -4.832  11.845  8.188   1.00 36.32  ? 612 GLY A C     1 
ATOM   4396  O  O     . GLY A 1 612 ? -4.828  12.622  7.241   1.00 39.39  ? 612 GLY A O     1 
ATOM   4397  N  N     . THR A 1 613 ? -4.628  12.248  9.440   1.00 32.84  ? 613 THR A N     1 
ATOM   4398  C  CA    . THR A 1 613 ? -4.333  13.636  9.796   1.00 34.48  ? 613 THR A CA    1 
ATOM   4399  C  C     . THR A 1 613 ? -2.848  13.820  10.114  1.00 36.58  ? 613 THR A C     1 
ATOM   4400  O  O     . THR A 1 613 ? -2.279  12.990  10.812  1.00 36.11  ? 613 THR A O     1 
ATOM   4401  C  CB    . THR A 1 613 ? -5.162  14.092  11.019  1.00 38.12  ? 613 THR A CB    1 
ATOM   4402  O  OG1   . THR A 1 613 ? -6.559  13.920  10.750  1.00 39.66  ? 613 THR A OG1   1 
ATOM   4403  C  CG2   . THR A 1 613 ? -4.891  15.567  11.367  1.00 33.90  ? 613 THR A CG2   1 
ATOM   4404  N  N     . PRO A 1 614 ? -2.210  14.881  9.585   1.00 34.68  ? 614 PRO A N     1 
ATOM   4405  C  CA    . PRO A 1 614 ? -0.774  15.036  9.873   1.00 36.41  ? 614 PRO A CA    1 
ATOM   4406  C  C     . PRO A 1 614 ? -0.502  15.352  11.335  1.00 38.88  ? 614 PRO A C     1 
ATOM   4407  O  O     . PRO A 1 614 ? -1.368  15.875  12.057  1.00 37.26  ? 614 PRO A O     1 
ATOM   4408  C  CB    . PRO A 1 614 ? -0.322  16.204  8.984   1.00 33.09  ? 614 PRO A CB    1 
ATOM   4409  C  CG    . PRO A 1 614 ? -1.526  16.588  8.126   1.00 38.09  ? 614 PRO A CG    1 
ATOM   4410  C  CD    . PRO A 1 614 ? -2.749  15.978  8.756   1.00 37.70  ? 614 PRO A CD    1 
ATOM   4411  N  N     . ARG A 1 615 ? 0.701   14.994  11.761  1.00 35.72  ? 615 ARG A N     1 
ATOM   4412  C  CA    . ARG A 1 615 ? 1.228   15.352  13.061  1.00 37.72  ? 615 ARG A CA    1 
ATOM   4413  C  C     . ARG A 1 615 ? 2.358   16.373  12.844  1.00 44.40  ? 615 ARG A C     1 
ATOM   4414  O  O     . ARG A 1 615 ? 3.486   15.991  12.502  1.00 38.88  ? 615 ARG A O     1 
ATOM   4415  C  CB    . ARG A 1 615 ? 1.759   14.111  13.794  1.00 36.38  ? 615 ARG A CB    1 
ATOM   4416  C  CG    . ARG A 1 615 ? 0.716   13.015  14.063  1.00 50.44  ? 615 ARG A CG    1 
ATOM   4417  C  CD    . ARG A 1 615 ? 1.366   11.858  14.833  1.00 53.79  ? 615 ARG A CD    1 
ATOM   4418  N  NE    . ARG A 1 615 ? 2.176   12.405  15.922  1.00 67.71  ? 615 ARG A NE    1 
ATOM   4419  C  CZ    . ARG A 1 615 ? 1.692   12.840  17.085  1.00 70.73  ? 615 ARG A CZ    1 
ATOM   4420  N  NH1   . ARG A 1 615 ? 0.384   12.772  17.346  1.00 65.83  ? 615 ARG A NH1   1 
ATOM   4421  N  NH2   . ARG A 1 615 ? 2.520   13.345  17.995  1.00 64.85  ? 615 ARG A NH2   1 
ATOM   4422  N  N     . PRO A 1 616 ? 2.067   17.670  13.044  1.00 42.57  ? 616 PRO A N     1 
ATOM   4423  C  CA    . PRO A 1 616 ? 3.109   18.678  12.802  1.00 33.40  ? 616 PRO A CA    1 
ATOM   4424  C  C     . PRO A 1 616 ? 4.314   18.471  13.705  1.00 33.35  ? 616 PRO A C     1 
ATOM   4425  O  O     . PRO A 1 616 ? 4.154   18.065  14.850  1.00 34.39  ? 616 PRO A O     1 
ATOM   4426  C  CB    . PRO A 1 616 ? 2.424   20.011  13.139  1.00 31.02  ? 616 PRO A CB    1 
ATOM   4427  C  CG    . PRO A 1 616 ? 0.903   19.703  13.188  1.00 35.76  ? 616 PRO A CG    1 
ATOM   4428  C  CD    . PRO A 1 616 ? 0.814   18.253  13.573  1.00 38.50  ? 616 PRO A CD    1 
ATOM   4429  N  N     . LEU A 1 617 ? 5.512   18.736  13.199  1.00 33.31  ? 617 LEU A N     1 
ATOM   4430  C  CA    . LEU A 1 617 ? 6.683   18.737  14.072  1.00 33.39  ? 617 LEU A CA    1 
ATOM   4431  C  C     . LEU A 1 617 ? 6.645   19.960  14.984  1.00 33.20  ? 617 LEU A C     1 
ATOM   4432  O  O     . LEU A 1 617 ? 6.157   21.025  14.589  1.00 30.90  ? 617 LEU A O     1 
ATOM   4433  C  CB    . LEU A 1 617 ? 7.979   18.739  13.259  1.00 31.64  ? 617 LEU A CB    1 
ATOM   4434  C  CG    . LEU A 1 617 ? 8.182   17.602  12.249  1.00 33.52  ? 617 LEU A CG    1 
ATOM   4435  C  CD1   . LEU A 1 617 ? 9.424   17.892  11.352  1.00 21.83  ? 617 LEU A CD1   1 
ATOM   4436  C  CD2   . LEU A 1 617 ? 8.294   16.243  12.963  1.00 36.98  ? 617 LEU A CD2   1 
ATOM   4437  N  N     . LYS A 1 618 ? 7.161   19.810  16.200  1.00 31.79  ? 618 LYS A N     1 
ATOM   4438  C  CA    . LYS A 1 618 ? 7.358   20.969  17.065  1.00 36.30  ? 618 LYS A CA    1 
ATOM   4439  C  C     . LYS A 1 618 ? 8.864   21.285  17.171  1.00 35.70  ? 618 LYS A C     1 
ATOM   4440  O  O     . LYS A 1 618 ? 9.623   20.435  17.539  1.00 32.15  ? 618 LYS A O     1 
ATOM   4441  C  CB    . LYS A 1 618 ? 6.786   20.712  18.451  1.00 32.98  ? 618 LYS A CB    1 
ATOM   4442  C  CG    . LYS A 1 618 ? 7.008   21.885  19.400  1.00 40.89  ? 618 LYS A CG    1 
ATOM   4443  C  CD    . LYS A 1 618 ? 6.363   21.591  20.757  1.00 57.74  ? 618 LYS A CD    1 
ATOM   4444  C  CE    . LYS A 1 618 ? 6.654   22.693  21.770  1.00 61.77  ? 618 LYS A CE    1 
ATOM   4445  N  NZ    . LYS A 1 618 ? 6.042   22.412  23.106  1.00 64.61  ? 618 LYS A NZ    1 
ATOM   4446  N  N     . LEU A 1 619 ? 9.263   22.508  16.848  1.00 33.25  ? 619 LEU A N     1 
ATOM   4447  C  CA    . LEU A 1 619 ? 10.661  22.888  16.748  1.00 31.81  ? 619 LEU A CA    1 
ATOM   4448  C  C     . LEU A 1 619 ? 10.952  24.014  17.711  1.00 40.76  ? 619 LEU A C     1 
ATOM   4449  O  O     . LEU A 1 619 ? 10.116  24.909  17.912  1.00 39.22  ? 619 LEU A O     1 
ATOM   4450  C  CB    . LEU A 1 619 ? 10.999  23.318  15.317  1.00 30.19  ? 619 LEU A CB    1 
ATOM   4451  C  CG    . LEU A 1 619 ? 10.960  22.174  14.293  1.00 37.76  ? 619 LEU A CG    1 
ATOM   4452  C  CD1   . LEU A 1 619 ? 9.508   21.886  13.864  1.00 38.78  ? 619 LEU A CD1   1 
ATOM   4453  C  CD2   . LEU A 1 619 ? 11.777  22.574  13.089  1.00 34.98  ? 619 LEU A CD2   1 
ATOM   4454  N  N     . VAL A 1 620 ? 12.141  23.974  18.301  1.00 30.89  ? 620 VAL A N     1 
ATOM   4455  C  CA    . VAL A 1 620 ? 12.571  25.022  19.205  1.00 38.56  ? 620 VAL A CA    1 
ATOM   4456  C  C     . VAL A 1 620 ? 13.940  25.533  18.781  1.00 36.54  ? 620 VAL A C     1 
ATOM   4457  O  O     . VAL A 1 620 ? 14.902  24.752  18.660  1.00 31.28  ? 620 VAL A O     1 
ATOM   4458  C  CB    . VAL A 1 620 ? 12.639  24.539  20.675  1.00 35.00  ? 620 VAL A CB    1 
ATOM   4459  C  CG1   . VAL A 1 620 ? 13.170  25.672  21.583  1.00 37.52  ? 620 VAL A CG1   1 
ATOM   4460  C  CG2   . VAL A 1 620 ? 11.273  24.067  21.145  1.00 36.49  ? 620 VAL A CG2   1 
ATOM   4461  N  N     . HIS A 1 621 ? 14.005  26.840  18.533  1.00 34.08  ? 621 HIS A N     1 
ATOM   4462  C  CA    . HIS A 1 621 ? 15.258  27.519  18.207  1.00 37.91  ? 621 HIS A CA    1 
ATOM   4463  C  C     . HIS A 1 621 ? 16.058  27.735  19.488  1.00 36.55  ? 621 HIS A C     1 
ATOM   4464  O  O     . HIS A 1 621 ? 15.729  28.590  20.308  1.00 44.52  ? 621 HIS A O     1 
ATOM   4465  C  CB    . HIS A 1 621 ? 15.004  28.852  17.507  1.00 33.32  ? 621 HIS A CB    1 
ATOM   4466  C  CG    . HIS A 1 621 ? 16.225  29.472  16.892  1.00 35.05  ? 621 HIS A CG    1 
ATOM   4467  N  ND1   . HIS A 1 621 ? 16.247  30.768  16.458  1.00 28.67  ? 621 HIS A ND1   1 
ATOM   4468  C  CD2   . HIS A 1 621 ? 17.467  28.954  16.648  1.00 30.04  ? 621 HIS A CD2   1 
ATOM   4469  C  CE1   . HIS A 1 621 ? 17.447  31.042  15.956  1.00 37.75  ? 621 HIS A CE1   1 
ATOM   4470  N  NE2   . HIS A 1 621 ? 18.196  29.970  16.055  1.00 33.86  ? 621 HIS A NE2   1 
ATOM   4471  N  N     . GLU A 1 622 ? 17.103  26.943  19.670  1.00 35.44  ? 622 GLU A N     1 
ATOM   4472  C  CA    . GLU A 1 622 ? 17.831  26.943  20.928  1.00 34.86  ? 622 GLU A CA    1 
ATOM   4473  C  C     . GLU A 1 622 ? 19.069  27.832  20.936  1.00 37.58  ? 622 GLU A C     1 
ATOM   4474  O  O     . GLU A 1 622 ? 19.495  28.259  22.001  1.00 40.22  ? 622 GLU A O     1 
ATOM   4475  C  CB    . GLU A 1 622 ? 18.215  25.513  21.291  1.00 37.98  ? 622 GLU A CB    1 
ATOM   4476  C  CG    . GLU A 1 622 ? 17.009  24.639  21.549  1.00 39.31  ? 622 GLU A CG    1 
ATOM   4477  C  CD    . GLU A 1 622 ? 17.407  23.237  21.917  1.00 42.66  ? 622 GLU A CD    1 
ATOM   4478  O  OE1   . GLU A 1 622 ? 16.710  22.619  22.752  1.00 46.33  ? 622 GLU A OE1   1 
ATOM   4479  O  OE2   . GLU A 1 622 ? 18.408  22.744  21.348  1.00 38.75  ? 622 GLU A OE2   1 
ATOM   4480  N  N     . ALA A 1 623 ? 19.680  28.058  19.776  1.00 34.49  ? 623 ALA A N     1 
ATOM   4481  C  CA    . ALA A 1 623 ? 20.863  28.923  19.694  1.00 30.97  ? 623 ALA A CA    1 
ATOM   4482  C  C     . ALA A 1 623 ? 21.032  29.467  18.282  1.00 33.55  ? 623 ALA A C     1 
ATOM   4483  O  O     . ALA A 1 623 ? 20.683  28.801  17.297  1.00 28.13  ? 623 ALA A O     1 
ATOM   4484  C  CB    . ALA A 1 623 ? 22.117  28.164  20.127  1.00 31.14  ? 623 ALA A CB    1 
ATOM   4485  N  N     . GLY A 1 624 ? 21.588  30.668  18.178  1.00 34.11  ? 624 GLY A N     1 
ATOM   4486  C  CA    . GLY A 1 624 ? 21.755  31.307  16.883  1.00 37.65  ? 624 GLY A CA    1 
ATOM   4487  C  C     . GLY A 1 624 ? 20.803  32.474  16.688  1.00 39.51  ? 624 GLY A C     1 
ATOM   4488  O  O     . GLY A 1 624 ? 19.922  32.695  17.513  1.00 35.23  ? 624 GLY A O     1 
ATOM   4489  N  N     . ASP A 1 625 ? 20.974  33.229  15.606  1.00 38.75  ? 625 ASP A N     1 
ATOM   4490  C  CA    . ASP A 1 625 ? 20.117  34.393  15.393  1.00 43.30  ? 625 ASP A CA    1 
ATOM   4491  C  C     . ASP A 1 625 ? 19.471  34.412  14.012  1.00 38.25  ? 625 ASP A C     1 
ATOM   4492  O  O     . ASP A 1 625 ? 19.071  35.463  13.532  1.00 38.71  ? 625 ASP A O     1 
ATOM   4493  C  CB    . ASP A 1 625 ? 20.888  35.702  15.635  1.00 39.56  ? 625 ASP A CB    1 
ATOM   4494  C  CG    . ASP A 1 625 ? 22.069  35.891  14.697  1.00 39.74  ? 625 ASP A CG    1 
ATOM   4495  O  OD1   . ASP A 1 625 ? 22.249  35.090  13.759  1.00 42.54  ? 625 ASP A OD1   1 
ATOM   4496  O  OD2   . ASP A 1 625 ? 22.810  36.880  14.886  1.00 62.05  ? 625 ASP A OD2   1 
ATOM   4497  N  N     . THR A 1 626 ? 19.411  33.263  13.347  1.00 36.74  ? 626 THR A N     1 
ATOM   4498  C  CA    . THR A 1 626 ? 18.629  33.190  12.123  1.00 35.11  ? 626 THR A CA    1 
ATOM   4499  C  C     . THR A 1 626 ? 17.140  33.301  12.490  1.00 36.43  ? 626 THR A C     1 
ATOM   4500  O  O     . THR A 1 626 ? 16.694  32.679  13.456  1.00 35.57  ? 626 THR A O     1 
ATOM   4501  C  CB    . THR A 1 626 ? 18.889  31.885  11.360  1.00 33.32  ? 626 THR A CB    1 
ATOM   4502  O  OG1   . THR A 1 626 ? 20.265  31.829  10.957  1.00 35.59  ? 626 THR A OG1   1 
ATOM   4503  C  CG2   . THR A 1 626 ? 18.011  31.782  10.125  1.00 25.99  ? 626 THR A CG2   1 
ATOM   4504  N  N     . PRO A 1 627 ? 16.384  34.134  11.751  1.00 29.72  ? 627 PRO A N     1 
ATOM   4505  C  CA    . PRO A 1 627 ? 14.933  34.238  11.948  1.00 38.98  ? 627 PRO A CA    1 
ATOM   4506  C  C     . PRO A 1 627 ? 14.259  32.887  11.791  1.00 35.96  ? 627 PRO A C     1 
ATOM   4507  O  O     . PRO A 1 627 ? 14.684  32.073  10.955  1.00 35.87  ? 627 PRO A O     1 
ATOM   4508  C  CB    . PRO A 1 627 ? 14.482  35.186  10.829  1.00 34.25  ? 627 PRO A CB    1 
ATOM   4509  C  CG    . PRO A 1 627 ? 15.722  36.051  10.550  1.00 34.29  ? 627 PRO A CG    1 
ATOM   4510  C  CD    . PRO A 1 627 ? 16.888  35.103  10.758  1.00 36.53  ? 627 PRO A CD    1 
ATOM   4511  N  N     . LEU A 1 628 ? 13.207  32.677  12.571  1.00 33.69  ? 628 LEU A N     1 
ATOM   4512  C  CA    . LEU A 1 628 ? 12.485  31.422  12.583  1.00 40.54  ? 628 LEU A CA    1 
ATOM   4513  C  C     . LEU A 1 628 ? 12.031  31.050  11.187  1.00 43.77  ? 628 LEU A C     1 
ATOM   4514  O  O     . LEU A 1 628 ? 12.095  29.886  10.816  1.00 38.15  ? 628 LEU A O     1 
ATOM   4515  C  CB    . LEU A 1 628 ? 11.285  31.513  13.515  1.00 46.11  ? 628 LEU A CB    1 
ATOM   4516  C  CG    . LEU A 1 628 ? 11.590  31.461  15.014  1.00 47.16  ? 628 LEU A CG    1 
ATOM   4517  C  CD1   . LEU A 1 628 ? 10.287  31.339  15.800  1.00 40.61  ? 628 LEU A CD1   1 
ATOM   4518  C  CD2   . LEU A 1 628 ? 12.575  30.332  15.384  1.00 36.26  ? 628 LEU A CD2   1 
ATOM   4519  N  N     . GLU A 1 629 ? 11.596  32.043  10.411  1.00 40.85  ? 629 GLU A N     1 
ATOM   4520  C  CA    . GLU A 1 629 ? 11.059  31.792  9.075   1.00 43.02  ? 629 GLU A CA    1 
ATOM   4521  C  C     . GLU A 1 629 ? 12.050  31.106  8.149   1.00 33.88  ? 629 GLU A C     1 
ATOM   4522  O  O     . GLU A 1 629 ? 11.691  30.175  7.421   1.00 34.68  ? 629 GLU A O     1 
ATOM   4523  C  CB    . GLU A 1 629 ? 10.638  33.105  8.404   1.00 39.20  ? 629 GLU A CB    1 
ATOM   4524  C  CG    . GLU A 1 629 ? 9.843   34.054  9.289   1.00 56.00  ? 629 GLU A CG    1 
ATOM   4525  C  CD    . GLU A 1 629 ? 10.736  35.004  10.097  1.00 52.48  ? 629 GLU A CD    1 
ATOM   4526  O  OE1   . GLU A 1 629 ? 11.124  34.671  11.244  1.00 47.25  ? 629 GLU A OE1   1 
ATOM   4527  O  OE2   . GLU A 1 629 ? 11.028  36.110  9.580   1.00 57.00  ? 629 GLU A OE2   1 
ATOM   4528  N  N     . ALA A 1 630 ? 13.280  31.619  8.131   1.00 36.28  ? 630 ALA A N     1 
ATOM   4529  C  CA    . ALA A 1 630 ? 14.348  31.085  7.287   1.00 34.58  ? 630 ALA A CA    1 
ATOM   4530  C  C     . ALA A 1 630 ? 14.772  29.684  7.763   1.00 29.38  ? 630 ALA A C     1 
ATOM   4531  O  O     . ALA A 1 630 ? 15.034  28.786  6.946   1.00 34.54  ? 630 ALA A O     1 
ATOM   4532  C  CB    . ALA A 1 630 ? 15.546  32.044  7.273   1.00 33.29  ? 630 ALA A CB    1 
ATOM   4533  N  N     . LEU A 1 631 ? 14.830  29.496  9.080   1.00 25.49  ? 631 LEU A N     1 
ATOM   4534  C  CA    . LEU A 1 631 ? 15.040  28.152  9.638   1.00 32.20  ? 631 LEU A CA    1 
ATOM   4535  C  C     . LEU A 1 631 ? 13.956  27.171  9.149   1.00 34.63  ? 631 LEU A C     1 
ATOM   4536  O  O     . LEU A 1 631 ? 14.269  26.047  8.711   1.00 30.40  ? 631 LEU A O     1 
ATOM   4537  C  CB    . LEU A 1 631 ? 15.042  28.181  11.167  1.00 32.71  ? 631 LEU A CB    1 
ATOM   4538  C  CG    . LEU A 1 631 ? 16.216  28.864  11.860  1.00 34.14  ? 631 LEU A CG    1 
ATOM   4539  C  CD1   . LEU A 1 631 ? 16.028  28.867  13.361  1.00 29.00  ? 631 LEU A CD1   1 
ATOM   4540  C  CD2   . LEU A 1 631 ? 17.501  28.149  11.487  1.00 36.05  ? 631 LEU A CD2   1 
ATOM   4541  N  N     . ALA A 1 632 ? 12.682  27.578  9.257   1.00 30.73  ? 632 ALA A N     1 
ATOM   4542  C  CA    . ALA A 1 632 ? 11.548  26.718  8.866   1.00 34.67  ? 632 ALA A CA    1 
ATOM   4543  C  C     . ALA A 1 632 ? 11.647  26.398  7.396   1.00 33.83  ? 632 ALA A C     1 
ATOM   4544  O  O     . ALA A 1 632 ? 11.385  25.263  6.971   1.00 30.42  ? 632 ALA A O     1 
ATOM   4545  C  CB    . ALA A 1 632 ? 10.193  27.388  9.171   1.00 33.60  ? 632 ALA A CB    1 
ATOM   4546  N  N     . HIS A 1 633 ? 12.041  27.407  6.622   1.00 29.43  ? 633 HIS A N     1 
ATOM   4547  C  CA    . HIS A 1 633 ? 12.232  27.216  5.182   1.00 32.77  ? 633 HIS A CA    1 
ATOM   4548  C  C     . HIS A 1 633 ? 13.286  26.148  4.898   1.00 33.47  ? 633 HIS A C     1 
ATOM   4549  O  O     . HIS A 1 633 ? 13.005  25.166  4.202   1.00 32.19  ? 633 HIS A O     1 
ATOM   4550  C  CB    . HIS A 1 633 ? 12.622  28.537  4.522   1.00 29.97  ? 633 HIS A CB    1 
ATOM   4551  C  CG    . HIS A 1 633 ? 12.851  28.443  3.047   1.00 37.66  ? 633 HIS A CG    1 
ATOM   4552  N  ND1   . HIS A 1 633 ? 14.116  28.367  2.494   1.00 38.04  ? 633 HIS A ND1   1 
ATOM   4553  C  CD2   . HIS A 1 633 ? 11.984  28.425  2.003   1.00 39.63  ? 633 HIS A CD2   1 
ATOM   4554  C  CE1   . HIS A 1 633 ? 14.019  28.313  1.179   1.00 36.64  ? 633 HIS A CE1   1 
ATOM   4555  N  NE2   . HIS A 1 633 ? 12.739  28.344  0.854   1.00 44.81  ? 633 HIS A NE2   1 
ATOM   4556  N  N     . GLN A 1 634 ? 14.479  26.299  5.471   1.00 30.65  ? 634 GLN A N     1 
ATOM   4557  C  CA    . GLN A 1 634 ? 15.526  25.306  5.193   1.00 29.90  ? 634 GLN A CA    1 
ATOM   4558  C  C     . GLN A 1 634 ? 15.162  23.894  5.688   1.00 28.83  ? 634 GLN A C     1 
ATOM   4559  O  O     . GLN A 1 634 ? 15.354  22.908  4.981   1.00 28.86  ? 634 GLN A O     1 
ATOM   4560  C  CB    . GLN A 1 634 ? 16.879  25.713  5.808   1.00 29.51  ? 634 GLN A CB    1 
ATOM   4561  C  CG    . GLN A 1 634 ? 18.000  24.679  5.408   1.00 37.94  ? 634 GLN A CG    1 
ATOM   4562  C  CD    . GLN A 1 634 ? 19.433  25.221  5.479   1.00 36.52  ? 634 GLN A CD    1 
ATOM   4563  O  OE1   . GLN A 1 634 ? 19.674  26.356  5.927   1.00 37.85  ? 634 GLN A OE1   1 
ATOM   4564  N  NE2   . GLN A 1 634 ? 20.400  24.393  5.051   1.00 27.36  ? 634 GLN A NE2   1 
ATOM   4565  N  N     . ILE A 1 635 ? 14.601  23.802  6.886   1.00 25.55  ? 635 ILE A N     1 
ATOM   4566  C  CA    . ILE A 1 635 ? 14.286  22.500  7.461   1.00 29.43  ? 635 ILE A CA    1 
ATOM   4567  C  C     . ILE A 1 635 ? 13.238  21.783  6.587   1.00 32.28  ? 635 ILE A C     1 
ATOM   4568  O  O     . ILE A 1 635 ? 13.408  20.573  6.203   1.00 28.49  ? 635 ILE A O     1 
ATOM   4569  C  CB    . ILE A 1 635 ? 13.823  22.673  8.936   1.00 30.51  ? 635 ILE A CB    1 
ATOM   4570  C  CG1   . ILE A 1 635 ? 15.046  23.092  9.780   1.00 31.02  ? 635 ILE A CG1   1 
ATOM   4571  C  CG2   . ILE A 1 635 ? 13.253  21.393  9.508   1.00 29.23  ? 635 ILE A CG2   1 
ATOM   4572  C  CD1   . ILE A 1 635 ? 14.735  23.522  11.207  1.00 27.91  ? 635 ILE A CD1   1 
ATOM   4573  N  N     . PHE A 1 636 ? 12.194  22.549  6.225   1.00 26.20  ? 636 PHE A N     1 
ATOM   4574  C  CA    . PHE A 1 636 ? 11.136  22.030  5.362   1.00 32.14  ? 636 PHE A CA    1 
ATOM   4575  C  C     . PHE A 1 636 ? 11.720  21.558  4.051   1.00 30.85  ? 636 PHE A C     1 
ATOM   4576  O  O     . PHE A 1 636 ? 11.384  20.477  3.566   1.00 30.28  ? 636 PHE A O     1 
ATOM   4577  C  CB    . PHE A 1 636 ? 10.036  23.080  5.101   1.00 32.98  ? 636 PHE A CB    1 
ATOM   4578  C  CG    . PHE A 1 636 ? 9.053   22.669  4.035   1.00 34.65  ? 636 PHE A CG    1 
ATOM   4579  C  CD1   . PHE A 1 636 ? 8.381   21.454  4.127   1.00 32.84  ? 636 PHE A CD1   1 
ATOM   4580  C  CD2   . PHE A 1 636 ? 8.775   23.506  2.954   1.00 36.31  ? 636 PHE A CD2   1 
ATOM   4581  C  CE1   . PHE A 1 636 ? 7.452   21.067  3.157   1.00 36.95  ? 636 PHE A CE1   1 
ATOM   4582  C  CE2   . PHE A 1 636 ? 7.846   23.136  1.976   1.00 42.38  ? 636 PHE A CE2   1 
ATOM   4583  C  CZ    . PHE A 1 636 ? 7.186   21.902  2.069   1.00 41.28  ? 636 PHE A CZ    1 
ATOM   4584  N  N     . HIS A 1 637 ? 12.598  22.360  3.466   1.00 26.55  ? 637 HIS A N     1 
ATOM   4585  C  CA    . HIS A 1 637 ? 13.223  21.932  2.213   1.00 31.21  ? 637 HIS A CA    1 
ATOM   4586  C  C     . HIS A 1 637 ? 14.096  20.659  2.370   1.00 30.95  ? 637 HIS A C     1 
ATOM   4587  O  O     . HIS A 1 637 ? 14.074  19.791  1.493   1.00 32.68  ? 637 HIS A O     1 
ATOM   4588  C  CB    . HIS A 1 637 ? 14.038  23.084  1.602   1.00 31.25  ? 637 HIS A CB    1 
ATOM   4589  C  CG    . HIS A 1 637 ? 13.200  24.068  0.828   1.00 39.29  ? 637 HIS A CG    1 
ATOM   4590  N  ND1   . HIS A 1 637 ? 13.665  24.756  -0.275  1.00 37.12  ? 637 HIS A ND1   1 
ATOM   4591  C  CD2   . HIS A 1 637 ? 11.909  24.473  0.999   1.00 36.42  ? 637 HIS A CD2   1 
ATOM   4592  C  CE1   . HIS A 1 637 ? 12.712  25.542  -0.741  1.00 38.96  ? 637 HIS A CE1   1 
ATOM   4593  N  NE2   . HIS A 1 637 ? 11.634  25.385  0.004   1.00 33.84  ? 637 HIS A NE2   1 
ATOM   4594  N  N     . LEU A 1 638 ? 14.819  20.517  3.484   1.00 27.70  ? 638 LEU A N     1 
ATOM   4595  C  CA    . LEU A 1 638 ? 15.671  19.316  3.721   1.00 29.62  ? 638 LEU A CA    1 
ATOM   4596  C  C     . LEU A 1 638 ? 14.807  18.074  3.805   1.00 37.47  ? 638 LEU A C     1 
ATOM   4597  O  O     . LEU A 1 638 ? 15.267  16.940  3.636   1.00 30.60  ? 638 LEU A O     1 
ATOM   4598  C  CB    . LEU A 1 638 ? 16.463  19.448  5.000   1.00 27.16  ? 638 LEU A CB    1 
ATOM   4599  C  CG    . LEU A 1 638 ? 17.654  20.399  4.815   1.00 32.96  ? 638 LEU A CG    1 
ATOM   4600  C  CD1   . LEU A 1 638 ? 18.234  20.691  6.166   1.00 22.85  ? 638 LEU A CD1   1 
ATOM   4601  C  CD2   . LEU A 1 638 ? 18.682  19.812  3.870   1.00 31.82  ? 638 LEU A CD2   1 
ATOM   4602  N  N     . THR A 1 639 ? 13.544  18.294  4.142   1.00 26.23  ? 639 THR A N     1 
ATOM   4603  C  CA    . THR A 1 639 ? 12.619  17.173  4.131   1.00 28.32  ? 639 THR A CA    1 
ATOM   4604  C  C     . THR A 1 639 ? 12.455  16.478  2.721   1.00 31.78  ? 639 THR A C     1 
ATOM   4605  O  O     . THR A 1 639 ? 12.094  15.304  2.642   1.00 34.46  ? 639 THR A O     1 
ATOM   4606  C  CB    . THR A 1 639 ? 11.268  17.700  4.685   1.00 33.72  ? 639 THR A CB    1 
ATOM   4607  O  OG1   . THR A 1 639 ? 10.838  16.951  5.825   1.00 41.08  ? 639 THR A OG1   1 
ATOM   4608  C  CG2   . THR A 1 639 ? 10.284  17.680  3.673   1.00 21.85  ? 639 THR A CG2   1 
ATOM   4609  N  N     . ARG A 1 640 ? 12.732  17.169  1.610   1.00 34.15  ? 640 ARG A N     1 
ATOM   4610  C  CA    . ARG A 1 640 ? 12.537  16.563  0.278   1.00 29.91  ? 640 ARG A CA    1 
ATOM   4611  C  C     . ARG A 1 640 ? 13.784  15.876  -0.286  1.00 42.59  ? 640 ARG A C     1 
ATOM   4612  O  O     . ARG A 1 640 ? 13.780  15.413  -1.437  1.00 36.44  ? 640 ARG A O     1 
ATOM   4613  C  CB    . ARG A 1 640 ? 12.080  17.597  -0.767  1.00 38.33  ? 640 ARG A CB    1 
ATOM   4614  C  CG    . ARG A 1 640 ? 10.963  18.565  -0.360  1.00 44.99  ? 640 ARG A CG    1 
ATOM   4615  C  CD    . ARG A 1 640 ? 9.511   18.106  -0.463  1.00 38.58  ? 640 ARG A CD    1 
ATOM   4616  N  NE    . ARG A 1 640 ? 9.027   17.817  0.875   1.00 44.98  ? 640 ARG A NE    1 
ATOM   4617  C  CZ    . ARG A 1 640 ? 7.795   17.973  1.350   1.00 32.24  ? 640 ARG A CZ    1 
ATOM   4618  N  NH1   . ARG A 1 640 ? 6.785   18.445  0.616   1.00 38.93  ? 640 ARG A NH1   1 
ATOM   4619  N  NH2   . ARG A 1 640 ? 7.586   17.631  2.620   1.00 31.31  ? 640 ARG A NH2   1 
ATOM   4620  N  N     . LEU A 1 641 ? 14.842  15.806  0.516   1.00 31.93  ? 641 LEU A N     1 
ATOM   4621  C  CA    . LEU A 1 641 ? 16.140  15.346  0.029   1.00 42.22  ? 641 LEU A CA    1 
ATOM   4622  C  C     . LEU A 1 641 ? 16.409  13.846  0.134   1.00 38.35  ? 641 LEU A C     1 
ATOM   4623  O  O     . LEU A 1 641 ? 17.371  13.361  -0.443  1.00 53.43  ? 641 LEU A O     1 
ATOM   4624  C  CB    . LEU A 1 641 ? 17.256  16.084  0.788   1.00 45.83  ? 641 LEU A CB    1 
ATOM   4625  C  CG    . LEU A 1 641 ? 18.103  17.014  -0.055  1.00 52.63  ? 641 LEU A CG    1 
ATOM   4626  C  CD1   . LEU A 1 641 ? 19.119  17.713  0.809   1.00 52.13  ? 641 LEU A CD1   1 
ATOM   4627  C  CD2   . LEU A 1 641 ? 18.795  16.190  -1.130  1.00 54.98  ? 641 LEU A CD2   1 
ATOM   4628  N  N     . TYR A 1 642 ? 15.566  13.110  0.840   1.00 38.74  ? 642 TYR A N     1 
ATOM   4629  C  CA    . TYR A 1 642 ? 15.857  11.707  1.113   1.00 37.01  ? 642 TYR A CA    1 
ATOM   4630  C  C     . TYR A 1 642 ? 15.904  10.849  -0.149  1.00 38.43  ? 642 TYR A C     1 
ATOM   4631  O  O     . TYR A 1 642 ? 14.905  10.656  -0.805  1.00 36.07  ? 642 TYR A O     1 
ATOM   4632  C  CB    . TYR A 1 642 ? 14.840  11.157  2.099   1.00 31.58  ? 642 TYR A CB    1 
ATOM   4633  C  CG    . TYR A 1 642 ? 15.264  9.838   2.696   1.00 37.59  ? 642 TYR A CG    1 
ATOM   4634  C  CD1   . TYR A 1 642 ? 16.381  9.753   3.521   1.00 40.68  ? 642 TYR A CD1   1 
ATOM   4635  C  CD2   . TYR A 1 642 ? 14.555  8.678   2.435   1.00 36.82  ? 642 TYR A CD2   1 
ATOM   4636  C  CE1   . TYR A 1 642 ? 16.777  8.535   4.066   1.00 36.17  ? 642 TYR A CE1   1 
ATOM   4637  C  CE2   . TYR A 1 642 ? 14.934  7.468   2.977   1.00 32.57  ? 642 TYR A CE2   1 
ATOM   4638  C  CZ    . TYR A 1 642 ? 16.041  7.398   3.788   1.00 38.62  ? 642 TYR A CZ    1 
ATOM   4639  O  OH    . TYR A 1 642 ? 16.405  6.185   4.318   1.00 40.78  ? 642 TYR A OH    1 
ATOM   4640  N  N     . PRO A 1 643 ? 17.085  10.290  -0.469  1.00 38.82  ? 643 PRO A N     1 
ATOM   4641  C  CA    . PRO A 1 643 ? 17.257  9.620   -1.762  1.00 34.47  ? 643 PRO A CA    1 
ATOM   4642  C  C     . PRO A 1 643 ? 16.696  8.203   -1.825  1.00 32.68  ? 643 PRO A C     1 
ATOM   4643  O  O     . PRO A 1 643 ? 16.556  7.702   -2.941  1.00 36.18  ? 643 PRO A O     1 
ATOM   4644  C  CB    . PRO A 1 643 ? 18.781  9.570   -1.942  1.00 36.58  ? 643 PRO A CB    1 
ATOM   4645  C  CG    . PRO A 1 643 ? 19.340  9.580   -0.549  1.00 32.30  ? 643 PRO A CG    1 
ATOM   4646  C  CD    . PRO A 1 643 ? 18.265  10.154  0.393   1.00 32.84  ? 643 PRO A CD    1 
ATOM   4647  N  N     . ALA A 1 644 ? 16.372  7.581   -0.690  1.00 33.57  ? 644 ALA A N     1 
ATOM   4648  C  CA    . ALA A 1 644 ? 15.953  6.176   -0.689  1.00 27.83  ? 644 ALA A CA    1 
ATOM   4649  C  C     . ALA A 1 644 ? 14.422  5.958   -0.617  1.00 31.20  ? 644 ALA A C     1 
ATOM   4650  O  O     . ALA A 1 644 ? 13.973  4.806   -0.523  1.00 28.24  ? 644 ALA A O     1 
ATOM   4651  C  CB    . ALA A 1 644 ? 16.633  5.426   0.480   1.00 28.11  ? 644 ALA A CB    1 
ATOM   4652  N  N     . SER A 1 645 ? 13.639  7.040   -0.605  1.00 35.37  ? 645 SER A N     1 
ATOM   4653  C  CA    . SER A 1 645 ? 12.172  6.955   -0.719  1.00 36.01  ? 645 SER A CA    1 
ATOM   4654  C  C     . SER A 1 645 ? 11.763  7.565   -2.054  1.00 37.08  ? 645 SER A C     1 
ATOM   4655  O  O     . SER A 1 645 ? 11.790  8.783   -2.196  1.00 32.27  ? 645 SER A O     1 
ATOM   4656  C  CB    . SER A 1 645 ? 11.459  7.678   0.421   1.00 32.59  ? 645 SER A CB    1 
ATOM   4657  O  OG    . SER A 1 645 ? 10.053  7.435   0.343   1.00 40.42  ? 645 SER A OG    1 
ATOM   4658  N  N     . GLY A 1 646 ? 11.376  6.744   -3.025  1.00 31.84  ? 646 GLY A N     1 
ATOM   4659  C  CA    . GLY A 1 646 ? 11.044  7.266   -4.337  1.00 30.77  ? 646 GLY A CA    1 
ATOM   4660  C  C     . GLY A 1 646 ? 9.733   8.022   -4.531  1.00 36.00  ? 646 GLY A C     1 
ATOM   4661  O  O     . GLY A 1 646 ? 9.592   8.775   -5.498  1.00 31.26  ? 646 GLY A O     1 
ATOM   4662  N  N     . PHE A 1 647 ? 8.770   7.832   -3.634  1.00 30.88  ? 647 PHE A N     1 
ATOM   4663  C  CA    . PHE A 1 647 ? 7.414   8.295   -3.932  1.00 40.14  ? 647 PHE A CA    1 
ATOM   4664  C  C     . PHE A 1 647 ? 6.722   9.050   -2.792  1.00 36.13  ? 647 PHE A C     1 
ATOM   4665  O  O     . PHE A 1 647 ? 5.652   9.599   -2.980  1.00 42.82  ? 647 PHE A O     1 
ATOM   4666  C  CB    . PHE A 1 647 ? 6.578   7.069   -4.340  1.00 32.05  ? 647 PHE A CB    1 
ATOM   4667  C  CG    . PHE A 1 647 ? 7.232   6.232   -5.427  1.00 35.16  ? 647 PHE A CG    1 
ATOM   4668  C  CD1   . PHE A 1 647 ? 8.075   5.163   -5.084  1.00 32.81  ? 647 PHE A CD1   1 
ATOM   4669  C  CD2   . PHE A 1 647 ? 7.072   6.547   -6.768  1.00 36.29  ? 647 PHE A CD2   1 
ATOM   4670  C  CE1   . PHE A 1 647 ? 8.693   4.393   -6.057  1.00 32.70  ? 647 PHE A CE1   1 
ATOM   4671  C  CE2   . PHE A 1 647 ? 7.685   5.772   -7.760  1.00 42.91  ? 647 PHE A CE2   1 
ATOM   4672  C  CZ    . PHE A 1 647 ? 8.516   4.699   -7.398  1.00 39.44  ? 647 PHE A CZ    1 
ATOM   4673  N  N     . ALA A 1 648 ? 7.337   9.074   -1.617  1.00 35.61  ? 648 ALA A N     1 
ATOM   4674  C  CA    . ALA A 1 648 ? 6.754   9.741   -0.462  1.00 41.37  ? 648 ALA A CA    1 
ATOM   4675  C  C     . ALA A 1 648 ? 7.869   10.407  0.347   1.00 38.29  ? 648 ALA A C     1 
ATOM   4676  O  O     . ALA A 1 648 ? 8.903   9.792   0.616   1.00 38.31  ? 648 ALA A O     1 
ATOM   4677  C  CB    . ALA A 1 648 ? 5.964   8.744   0.404   1.00 29.90  ? 648 ALA A CB    1 
ATOM   4678  N  N     . PHE A 1 649 ? 7.688   11.674  0.701   1.00 34.52  ? 649 PHE A N     1 
ATOM   4679  C  CA    . PHE A 1 649 ? 8.714   12.383  1.473   1.00 33.95  ? 649 PHE A CA    1 
ATOM   4680  C  C     . PHE A 1 649 ? 8.649   12.107  2.968   1.00 30.52  ? 649 PHE A C     1 
ATOM   4681  O  O     . PHE A 1 649 ? 7.583   12.029  3.543   1.00 36.69  ? 649 PHE A O     1 
ATOM   4682  C  CB    . PHE A 1 649 ? 8.630   13.882  1.244   1.00 34.59  ? 649 PHE A CB    1 
ATOM   4683  C  CG    . PHE A 1 649 ? 8.840   14.292  -0.182  1.00 36.33  ? 649 PHE A CG    1 
ATOM   4684  C  CD1   . PHE A 1 649 ? 10.033  13.987  -0.841  1.00 31.38  ? 649 PHE A CD1   1 
ATOM   4685  C  CD2   . PHE A 1 649 ? 7.860   14.999  -0.862  1.00 30.37  ? 649 PHE A CD2   1 
ATOM   4686  C  CE1   . PHE A 1 649 ? 10.231  14.365  -2.165  1.00 31.44  ? 649 PHE A CE1   1 
ATOM   4687  C  CE2   . PHE A 1 649 ? 8.054   15.393  -2.179  1.00 29.91  ? 649 PHE A CE2   1 
ATOM   4688  C  CZ    . PHE A 1 649 ? 9.242   15.075  -2.834  1.00 36.72  ? 649 PHE A CZ    1 
ATOM   4689  N  N     . PRO A 1 650 ? 9.817   11.988  3.610   1.00 35.41  ? 650 PRO A N     1 
ATOM   4690  C  CA    . PRO A 1 650 ? 9.834   11.843  5.065   1.00 34.43  ? 650 PRO A CA    1 
ATOM   4691  C  C     . PRO A 1 650 ? 9.341   13.113  5.761   1.00 31.97  ? 650 PRO A C     1 
ATOM   4692  O  O     . PRO A 1 650 ? 9.499   14.234  5.251   1.00 29.04  ? 650 PRO A O     1 
ATOM   4693  C  CB    . PRO A 1 650 ? 11.329  11.595  5.390   1.00 31.92  ? 650 PRO A CB    1 
ATOM   4694  C  CG    . PRO A 1 650 ? 11.928  11.145  4.105   1.00 39.31  ? 650 PRO A CG    1 
ATOM   4695  C  CD    . PRO A 1 650 ? 11.167  11.899  3.033   1.00 32.48  ? 650 PRO A CD    1 
ATOM   4696  N  N     . ARG A 1 651 ? 8.718   12.909  6.914   1.00 34.13  ? 651 ARG A N     1 
ATOM   4697  C  CA    . ARG A 1 651 ? 8.311   13.987  7.795   1.00 33.65  ? 651 ARG A CA    1 
ATOM   4698  C  C     . ARG A 1 651 ? 9.539   14.741  8.327   1.00 28.85  ? 651 ARG A C     1 
ATOM   4699  O  O     . ARG A 1 651 ? 9.554   15.974  8.358   1.00 26.62  ? 651 ARG A O     1 
ATOM   4700  C  CB    . ARG A 1 651 ? 7.494   13.407  8.947   1.00 28.93  ? 651 ARG A CB    1 
ATOM   4701  C  CG    . ARG A 1 651 ? 6.994   14.371  10.010  1.00 31.71  ? 651 ARG A CG    1 
ATOM   4702  C  CD    . ARG A 1 651 ? 5.907   13.654  10.841  1.00 32.87  ? 651 ARG A CD    1 
ATOM   4703  N  NE    . ARG A 1 651 ? 5.586   14.317  12.102  1.00 32.62  ? 651 ARG A NE    1 
ATOM   4704  C  CZ    . ARG A 1 651 ? 5.910   13.846  13.300  1.00 39.04  ? 651 ARG A CZ    1 
ATOM   4705  N  NH1   . ARG A 1 651 ? 6.590   12.710  13.416  1.00 32.50  ? 651 ARG A NH1   1 
ATOM   4706  N  NH2   . ARG A 1 651 ? 5.562   14.520  14.385  1.00 37.81  ? 651 ARG A NH2   1 
ATOM   4707  N  N     . LEU A 1 652 ? 10.565  14.005  8.744   1.00 27.27  ? 652 LEU A N     1 
ATOM   4708  C  CA    . LEU A 1 652 ? 11.787  14.654  9.289   1.00 27.26  ? 652 LEU A CA    1 
ATOM   4709  C  C     . LEU A 1 652 ? 12.673  15.195  8.171   1.00 23.37  ? 652 LEU A C     1 
ATOM   4710  O  O     . LEU A 1 652 ? 12.725  14.623  7.086   1.00 30.47  ? 652 LEU A O     1 
ATOM   4711  C  CB    . LEU A 1 652 ? 12.597  13.659  10.134  1.00 29.50  ? 652 LEU A CB    1 
ATOM   4712  C  CG    . LEU A 1 652 ? 11.995  13.196  11.462  1.00 38.15  ? 652 LEU A CG    1 
ATOM   4713  C  CD1   . LEU A 1 652 ? 12.858  12.054  12.053  1.00 31.86  ? 652 LEU A CD1   1 
ATOM   4714  C  CD2   . LEU A 1 652 ? 11.881  14.357  12.436  1.00 34.06  ? 652 LEU A CD2   1 
ATOM   4715  N  N     . PRO A 1 653 ? 13.398  16.292  8.430   1.00 28.43  ? 653 PRO A N     1 
ATOM   4716  C  CA    . PRO A 1 653 ? 14.394  16.732  7.458   1.00 27.78  ? 653 PRO A CA    1 
ATOM   4717  C  C     . PRO A 1 653 ? 15.450  15.637  7.297   1.00 28.84  ? 653 PRO A C     1 
ATOM   4718  O  O     . PRO A 1 653 ? 15.792  14.965  8.282   1.00 26.83  ? 653 PRO A O     1 
ATOM   4719  C  CB    . PRO A 1 653 ? 15.006  17.981  8.106   1.00 29.65  ? 653 PRO A CB    1 
ATOM   4720  C  CG    . PRO A 1 653 ? 14.797  17.785  9.567   1.00 30.73  ? 653 PRO A CG    1 
ATOM   4721  C  CD    . PRO A 1 653 ? 13.465  17.075  9.674   1.00 27.76  ? 653 PRO A CD    1 
ATOM   4722  N  N     . ALA A 1 654 ? 15.950  15.455  6.083   1.00 24.03  ? 654 ALA A N     1 
ATOM   4723  C  CA    . ALA A 1 654 ? 16.827  14.313  5.769   1.00 27.88  ? 654 ALA A CA    1 
ATOM   4724  C  C     . ALA A 1 654 ? 17.988  14.040  6.756   1.00 34.90  ? 654 ALA A C     1 
ATOM   4725  O  O     . ALA A 1 654 ? 18.259  12.878  7.053   1.00 34.57  ? 654 ALA A O     1 
ATOM   4726  C  CB    . ALA A 1 654 ? 17.386  14.463  4.335   1.00 24.94  ? 654 ALA A CB    1 
ATOM   4727  N  N     . PRO A 1 655 ? 18.682  15.075  7.272   1.00 34.54  ? 655 PRO A N     1 
ATOM   4728  C  CA    . PRO A 1 655 ? 19.791  14.681  8.177   1.00 34.32  ? 655 PRO A CA    1 
ATOM   4729  C  C     . PRO A 1 655 ? 19.370  13.873  9.418   1.00 32.36  ? 655 PRO A C     1 
ATOM   4730  O  O     . PRO A 1 655 ? 20.085  12.925  9.798   1.00 32.58  ? 655 PRO A O     1 
ATOM   4731  C  CB    . PRO A 1 655 ? 20.394  16.026  8.600   1.00 37.24  ? 655 PRO A CB    1 
ATOM   4732  C  CG    . PRO A 1 655 ? 20.055  16.954  7.473   1.00 36.46  ? 655 PRO A CG    1 
ATOM   4733  C  CD    . PRO A 1 655 ? 18.690  16.522  6.983   1.00 27.20  ? 655 PRO A CD    1 
ATOM   4734  N  N     . LEU A 1 656 ? 18.233  14.235  10.009  1.00 33.65  ? 656 LEU A N     1 
ATOM   4735  C  CA    . LEU A 1 656 ? 17.644  13.525  11.153  1.00 35.78  ? 656 LEU A CA    1 
ATOM   4736  C  C     . LEU A 1 656 ? 17.014  12.185  10.775  1.00 31.76  ? 656 LEU A C     1 
ATOM   4737  O  O     . LEU A 1 656 ? 17.063  11.230  11.547  1.00 38.11  ? 656 LEU A O     1 
ATOM   4738  C  CB    . LEU A 1 656 ? 16.572  14.386  11.841  1.00 30.59  ? 656 LEU A CB    1 
ATOM   4739  C  CG    . LEU A 1 656 ? 17.038  15.642  12.595  1.00 37.08  ? 656 LEU A CG    1 
ATOM   4740  C  CD1   . LEU A 1 656 ? 15.850  16.422  13.209  1.00 29.85  ? 656 LEU A CD1   1 
ATOM   4741  C  CD2   . LEU A 1 656 ? 18.056  15.294  13.667  1.00 29.46  ? 656 LEU A CD2   1 
ATOM   4742  N  N     . HIS A 1 657 ? 16.360  12.135  9.623   1.00 32.63  ? 657 HIS A N     1 
ATOM   4743  C  CA    . HIS A 1 657 ? 15.773  10.887  9.142   1.00 29.85  ? 657 HIS A CA    1 
ATOM   4744  C  C     . HIS A 1 657 ? 16.879  9.840   8.930   1.00 32.79  ? 657 HIS A C     1 
ATOM   4745  O  O     . HIS A 1 657 ? 16.792  8.677   9.368   1.00 35.27  ? 657 HIS A O     1 
ATOM   4746  C  CB    . HIS A 1 657 ? 15.016  11.134  7.836   1.00 30.98  ? 657 HIS A CB    1 
ATOM   4747  C  CG    . HIS A 1 657 ? 14.112  10.007  7.439   1.00 34.00  ? 657 HIS A CG    1 
ATOM   4748  N  ND1   . HIS A 1 657 ? 13.007  9.651   8.172   1.00 32.53  ? 657 HIS A ND1   1 
ATOM   4749  C  CD2   . HIS A 1 657 ? 14.163  9.155   6.379   1.00 30.07  ? 657 HIS A CD2   1 
ATOM   4750  C  CE1   . HIS A 1 657 ? 12.400  8.629   7.580   1.00 36.39  ? 657 HIS A CE1   1 
ATOM   4751  N  NE2   . HIS A 1 657 ? 13.082  8.309   6.498   1.00 32.78  ? 657 HIS A NE2   1 
ATOM   4752  N  N     . LEU A 1 658 ? 17.931  10.305  8.259   1.00 36.45  ? 658 LEU A N     1 
ATOM   4753  C  CA    . LEU A 1 658 ? 19.135  9.530   7.998   1.00 36.24  ? 658 LEU A CA    1 
ATOM   4754  C  C     . LEU A 1 658 ? 19.743  9.085   9.288   1.00 36.72  ? 658 LEU A C     1 
ATOM   4755  O  O     . LEU A 1 658 ? 19.930  7.895   9.473   1.00 31.84  ? 658 LEU A O     1 
ATOM   4756  C  CB    . LEU A 1 658 ? 20.171  10.348  7.210   1.00 29.35  ? 658 LEU A CB    1 
ATOM   4757  C  CG    . LEU A 1 658 ? 19.851  10.606  5.731   1.00 35.85  ? 658 LEU A CG    1 
ATOM   4758  C  CD1   . LEU A 1 658 ? 20.723  11.727  5.178   1.00 32.46  ? 658 LEU A CD1   1 
ATOM   4759  C  CD2   . LEU A 1 658 ? 20.004  9.336   4.896   1.00 40.18  ? 658 LEU A CD2   1 
ATOM   4760  N  N     . ALA A 1 659 ? 19.999  10.031  10.199  1.00 34.75  ? 659 ALA A N     1 
ATOM   4761  C  CA    . ALA A 1 659 ? 20.659  9.701   11.467  1.00 34.91  ? 659 ALA A CA    1 
ATOM   4762  C  C     . ALA A 1 659 ? 19.873  8.658   12.250  1.00 35.36  ? 659 ALA A C     1 
ATOM   4763  O  O     . ALA A 1 659 ? 20.438  7.753   12.898  1.00 32.76  ? 659 ALA A O     1 
ATOM   4764  C  CB    . ALA A 1 659 ? 20.862  10.956  12.317  1.00 31.01  ? 659 ALA A CB    1 
ATOM   4765  N  N     . ASP A 1 660 ? 18.561  8.820   12.204  1.00 35.75  ? 660 ASP A N     1 
ATOM   4766  C  CA    . ASP A 1 660 ? 17.634  7.883   12.813  1.00 39.66  ? 660 ASP A CA    1 
ATOM   4767  C  C     . ASP A 1 660 ? 17.899  6.465   12.273  1.00 39.37  ? 660 ASP A C     1 
ATOM   4768  O  O     . ASP A 1 660 ? 18.221  5.512   13.038  1.00 38.77  ? 660 ASP A O     1 
ATOM   4769  C  CB    . ASP A 1 660 ? 16.205  8.332   12.498  1.00 42.08  ? 660 ASP A CB    1 
ATOM   4770  C  CG    . ASP A 1 660 ? 15.264  8.131   13.652  1.00 54.02  ? 660 ASP A CG    1 
ATOM   4771  O  OD1   . ASP A 1 660 ? 15.326  7.051   14.277  1.00 53.92  ? 660 ASP A OD1   1 
ATOM   4772  O  OD2   . ASP A 1 660 ? 14.464  9.056   13.935  1.00 61.88  ? 660 ASP A OD2   1 
ATOM   4773  N  N     . ARG A 1 661 ? 17.815  6.340   10.946  1.00 34.81  ? 661 ARG A N     1 
ATOM   4774  C  CA    . ARG A 1 661 ? 18.042  5.031   10.322  1.00 40.68  ? 661 ARG A CA    1 
ATOM   4775  C  C     . ARG A 1 661 ? 19.466  4.474   10.606  1.00 43.37  ? 661 ARG A C     1 
ATOM   4776  O  O     . ARG A 1 661 ? 19.639  3.262   10.830  1.00 43.28  ? 661 ARG A O     1 
ATOM   4777  C  CB    . ARG A 1 661 ? 17.769  5.136   8.811   1.00 44.80  ? 661 ARG A CB    1 
ATOM   4778  C  CG    . ARG A 1 661 ? 16.715  4.165   8.269   1.00 49.92  ? 661 ARG A CG    1 
ATOM   4779  C  CD    . ARG A 1 661 ? 15.381  4.825   7.828   1.00 56.78  ? 661 ARG A CD    1 
ATOM   4780  N  NE    . ARG A 1 661 ? 14.456  5.052   8.944   1.00 64.26  ? 661 ARG A NE    1 
ATOM   4781  C  CZ    . ARG A 1 661 ? 13.170  5.388   8.819   1.00 47.95  ? 661 ARG A CZ    1 
ATOM   4782  N  NH1   . ARG A 1 661 ? 12.422  5.570   9.894   1.00 51.84  ? 661 ARG A NH1   1 
ATOM   4783  N  NH2   . ARG A 1 661 ? 12.618  5.507   7.629   1.00 52.38  ? 661 ARG A NH2   1 
ATOM   4784  N  N     . LEU A 1 662 ? 20.471  5.358   10.654  1.00 35.75  ? 662 LEU A N     1 
ATOM   4785  C  CA    . LEU A 1 662 ? 21.855  4.966   10.931  1.00 35.28  ? 662 LEU A CA    1 
ATOM   4786  C  C     . LEU A 1 662 ? 22.027  4.386   12.335  1.00 48.20  ? 662 LEU A C     1 
ATOM   4787  O  O     . LEU A 1 662 ? 22.632  3.325   12.501  1.00 40.19  ? 662 LEU A O     1 
ATOM   4788  C  CB    . LEU A 1 662 ? 22.812  6.149   10.751  1.00 33.57  ? 662 LEU A CB    1 
ATOM   4789  C  CG    . LEU A 1 662 ? 24.258  5.958   11.234  1.00 35.26  ? 662 LEU A CG    1 
ATOM   4790  C  CD1   . LEU A 1 662 ? 24.953  4.746   10.580  1.00 35.63  ? 662 LEU A CD1   1 
ATOM   4791  C  CD2   . LEU A 1 662 ? 25.047  7.192   10.958  1.00 33.95  ? 662 LEU A CD2   1 
ATOM   4792  N  N     . VAL A 1 663 ? 21.524  5.088   13.348  1.00 43.72  ? 663 VAL A N     1 
ATOM   4793  C  CA    . VAL A 1 663 ? 21.616  4.560   14.703  1.00 48.05  ? 663 VAL A CA    1 
ATOM   4794  C  C     . VAL A 1 663 ? 20.890  3.219   14.773  1.00 46.38  ? 663 VAL A C     1 
ATOM   4795  O  O     . VAL A 1 663 ? 21.408  2.250   15.362  1.00 50.28  ? 663 VAL A O     1 
ATOM   4796  C  CB    . VAL A 1 663 ? 21.072  5.555   15.754  1.00 43.10  ? 663 VAL A CB    1 
ATOM   4797  C  CG1   . VAL A 1 663 ? 20.728  4.843   17.065  1.00 43.44  ? 663 VAL A CG1   1 
ATOM   4798  C  CG2   . VAL A 1 663 ? 22.098  6.661   15.987  1.00 39.01  ? 663 VAL A CG2   1 
ATOM   4799  N  N     . LYS A 1 664 ? 19.727  3.140   14.131  1.00 45.49  ? 664 LYS A N     1 
ATOM   4800  C  CA    . LYS A 1 664 ? 19.028  1.850   14.094  1.00 51.29  ? 664 LYS A CA    1 
ATOM   4801  C  C     . LYS A 1 664 ? 19.912  0.712   13.538  1.00 55.71  ? 664 LYS A C     1 
ATOM   4802  O  O     . LYS A 1 664 ? 20.020  -0.364  14.151  1.00 57.74  ? 664 LYS A O     1 
ATOM   4803  C  CB    . LYS A 1 664 ? 17.747  1.957   13.278  1.00 50.38  ? 664 LYS A CB    1 
ATOM   4804  C  CG    . LYS A 1 664 ? 16.602  1.132   13.834  1.00 60.25  ? 664 LYS A CG    1 
ATOM   4805  C  CD    . LYS A 1 664 ? 15.279  1.504   13.165  1.00 62.33  ? 664 LYS A CD    1 
ATOM   4806  C  CE    . LYS A 1 664 ? 14.958  2.975   13.350  1.00 63.03  ? 664 LYS A CE    1 
ATOM   4807  N  NZ    . LYS A 1 664 ? 13.800  3.420   12.510  1.00 68.09  ? 664 LYS A NZ    1 
ATOM   4808  N  N     . GLU A 1 665 ? 20.568  0.951   12.405  1.00 49.81  ? 665 GLU A N     1 
ATOM   4809  C  CA    . GLU A 1 665 ? 21.345  -0.111  11.770  1.00 49.73  ? 665 GLU A CA    1 
ATOM   4810  C  C     . GLU A 1 665 ? 22.623  -0.442  12.529  1.00 56.31  ? 665 GLU A C     1 
ATOM   4811  O  O     . GLU A 1 665 ? 23.080  -1.591  12.532  1.00 56.18  ? 665 GLU A O     1 
ATOM   4812  C  CB    . GLU A 1 665 ? 21.666  0.266   10.326  1.00 45.24  ? 665 GLU A CB    1 
ATOM   4813  C  CG    . GLU A 1 665 ? 20.424  0.195   9.425   1.00 41.74  ? 665 GLU A CG    1 
ATOM   4814  C  CD    . GLU A 1 665 ? 19.892  -1.218  9.238   1.00 47.56  ? 665 GLU A CD    1 
ATOM   4815  O  OE1   . GLU A 1 665 ? 18.647  -1.401  9.106   1.00 53.62  ? 665 GLU A OE1   1 
ATOM   4816  O  OE2   . GLU A 1 665 ? 20.727  -2.148  9.171   1.00 45.45  ? 665 GLU A OE2   1 
ATOM   4817  N  N     . VAL A 1 666 ? 23.200  0.568   13.168  1.00 58.58  ? 666 VAL A N     1 
ATOM   4818  C  CA    . VAL A 1 666 ? 24.368  0.378   14.007  1.00 52.93  ? 666 VAL A CA    1 
ATOM   4819  C  C     . VAL A 1 666 ? 23.990  -0.570  15.132  1.00 57.28  ? 666 VAL A C     1 
ATOM   4820  O  O     . VAL A 1 666 ? 24.745  -1.489  15.470  1.00 56.93  ? 666 VAL A O     1 
ATOM   4821  C  CB    . VAL A 1 666 ? 24.886  1.712   14.579  1.00 50.71  ? 666 VAL A CB    1 
ATOM   4822  C  CG1   . VAL A 1 666 ? 25.835  1.477   15.756  1.00 59.57  ? 666 VAL A CG1   1 
ATOM   4823  C  CG2   . VAL A 1 666 ? 25.575  2.509   13.491  1.00 56.77  ? 666 VAL A CG2   1 
ATOM   4824  N  N     . GLY A 1 667 ? 22.804  -0.353  15.694  1.00 54.95  ? 667 GLY A N     1 
ATOM   4825  C  CA    . GLY A 1 667 ? 22.315  -1.244  16.727  1.00 58.27  ? 667 GLY A CA    1 
ATOM   4826  C  C     . GLY A 1 667 ? 22.028  -2.648  16.213  1.00 67.80  ? 667 GLY A C     1 
ATOM   4827  O  O     . GLY A 1 667 ? 22.351  -3.639  16.872  1.00 67.61  ? 667 GLY A O     1 
ATOM   4828  N  N     . ARG A 1 668 ? 21.474  -2.752  15.012  1.00 58.28  ? 668 ARG A N     1 
ATOM   4829  C  CA    . ARG A 1 668 ? 21.085  -4.066  14.520  1.00 57.75  ? 668 ARG A CA    1 
ATOM   4830  C  C     . ARG A 1 668 ? 22.252  -4.902  13.978  1.00 57.72  ? 668 ARG A C     1 
ATOM   4831  O  O     . ARG A 1 668 ? 22.149  -6.128  13.905  1.00 56.05  ? 668 ARG A O     1 
ATOM   4832  C  CB    . ARG A 1 668 ? 20.005  -3.917  13.454  1.00 46.74  ? 668 ARG A CB    1 
ATOM   4833  C  CG    . ARG A 1 668 ? 18.612  -3.974  14.045  1.00 60.60  ? 668 ARG A CG    1 
ATOM   4834  C  CD    . ARG A 1 668 ? 17.679  -2.876  13.561  1.00 59.99  ? 668 ARG A CD    1 
ATOM   4835  N  NE    . ARG A 1 668 ? 17.436  -2.914  12.122  1.00 62.01  ? 668 ARG A NE    1 
ATOM   4836  C  CZ    . ARG A 1 668 ? 16.433  -2.278  11.519  1.00 67.89  ? 668 ARG A CZ    1 
ATOM   4837  N  NH1   . ARG A 1 668 ? 15.560  -1.577  12.233  1.00 65.76  ? 668 ARG A NH1   1 
ATOM   4838  N  NH2   . ARG A 1 668 ? 16.290  -2.360  10.202  1.00 69.29  ? 668 ARG A NH2   1 
ATOM   4839  N  N     . LEU A 1 669 ? 23.376  -4.269  13.662  1.00 51.39  ? 669 LEU A N     1 
ATOM   4840  C  CA    . LEU A 1 669 ? 24.461  -5.002  13.028  1.00 53.45  ? 669 LEU A CA    1 
ATOM   4841  C  C     . LEU A 1 669 ? 25.668  -5.153  13.954  1.00 59.88  ? 669 LEU A C     1 
ATOM   4842  O  O     . LEU A 1 669 ? 26.548  -5.973  13.693  1.00 65.36  ? 669 LEU A O     1 
ATOM   4843  C  CB    . LEU A 1 669 ? 24.880  -4.328  11.715  1.00 49.49  ? 669 LEU A CB    1 
ATOM   4844  C  CG    . LEU A 1 669 ? 23.848  -4.253  10.574  1.00 51.49  ? 669 LEU A CG    1 
ATOM   4845  C  CD1   . LEU A 1 669 ? 24.517  -3.798  9.291   1.00 48.96  ? 669 LEU A CD1   1 
ATOM   4846  C  CD2   . LEU A 1 669 ? 23.118  -5.586  10.348  1.00 48.34  ? 669 LEU A CD2   1 
ATOM   4847  N  N     . GLY A 1 670 ? 25.744  -4.340  15.002  1.00 65.10  ? 670 GLY A N     1 
ATOM   4848  C  CA    . GLY A 1 670 ? 26.813  -4.493  15.973  1.00 59.31  ? 670 GLY A CA    1 
ATOM   4849  C  C     . GLY A 1 670 ? 28.105  -3.854  15.519  1.00 69.63  ? 670 GLY A C     1 
ATOM   4850  O  O     . GLY A 1 670 ? 29.195  -4.371  15.776  1.00 69.39  ? 670 GLY A O     1 
ATOM   4851  N  N     . ILE A 1 671 ? 27.989  -2.720  14.845  1.00 67.71  ? 671 ILE A N     1 
ATOM   4852  C  CA    . ILE A 1 671 ? 29.131  -2.134  14.166  1.00 66.91  ? 671 ILE A CA    1 
ATOM   4853  C  C     . ILE A 1 671 ? 29.937  -1.251  15.120  1.00 75.10  ? 671 ILE A C     1 
ATOM   4854  O  O     . ILE A 1 671 ? 29.377  -0.526  15.948  1.00 71.84  ? 671 ILE A O     1 
ATOM   4855  C  CB    . ILE A 1 671 ? 28.669  -1.338  12.942  1.00 67.58  ? 671 ILE A CB    1 
ATOM   4856  C  CG1   . ILE A 1 671 ? 29.807  -0.564  12.298  1.00 71.63  ? 671 ILE A CG1   1 
ATOM   4857  C  CG2   . ILE A 1 671 ? 27.617  -0.356  13.327  1.00 72.75  ? 671 ILE A CG2   1 
ATOM   4858  C  CD1   . ILE A 1 671 ? 29.297  0.290   11.190  1.00 72.44  ? 671 ILE A CD1   1 
ATOM   4859  N  N     . ARG A 1 672 ? 31.249  -1.364  15.019  1.00 74.22  ? 672 ARG A N     1 
ATOM   4860  C  CA    . ARG A 1 672 ? 32.164  -0.678  15.900  1.00 79.79  ? 672 ARG A CA    1 
ATOM   4861  C  C     . ARG A 1 672 ? 33.294  0.125   15.278  1.00 79.84  ? 672 ARG A C     1 
ATOM   4862  O  O     . ARG A 1 672 ? 33.572  1.233   15.682  1.00 73.98  ? 672 ARG A O     1 
ATOM   4863  C  CB    . ARG A 1 672 ? 32.868  -1.707  16.752  1.00 79.49  ? 672 ARG A CB    1 
ATOM   4864  N  N     . HIS A 1 673 ? 33.943  -0.462  14.285  1.00 77.44  ? 673 HIS A N     1 
ATOM   4865  C  CA    . HIS A 1 673 ? 35.073  0.196   13.646  1.00 78.03  ? 673 HIS A CA    1 
ATOM   4866  C  C     . HIS A 1 673 ? 34.983  0.062   12.125  1.00 80.78  ? 673 HIS A C     1 
ATOM   4867  O  O     . HIS A 1 673 ? 35.886  -0.499  11.499  1.00 84.12  ? 673 HIS A O     1 
ATOM   4868  C  CB    . HIS A 1 673 ? 36.430  -0.328  14.136  1.00 78.77  ? 673 HIS A CB    1 
ATOM   4869  C  CG    . HIS A 1 673 ? 37.508  0.710   14.149  1.00 79.60  ? 673 HIS A CG    1 
ATOM   4870  N  ND1   . HIS A 1 673 ? 37.933  1.358   13.007  1.00 87.45  ? 673 HIS A ND1   1 
ATOM   4871  C  CD2   . HIS A 1 673 ? 38.246  1.219   15.165  1.00 75.95  ? 673 HIS A CD2   1 
ATOM   4872  C  CE1   . HIS A 1 673 ? 38.887  2.218   13.318  1.00 73.06  ? 673 HIS A CE1   1 
ATOM   4873  N  NE2   . HIS A 1 673 ? 39.096  2.154   14.621  1.00 78.31  ? 673 HIS A NE2   1 
ATOM   4874  N  N     . LEU A 1 674 ? 33.906  0.585   11.535  1.00 80.28  ? 674 LEU A N     1 
ATOM   4875  C  CA    . LEU A 1 674 ? 33.756  0.585   10.078  1.00 73.37  ? 674 LEU A CA    1 
ATOM   4876  C  C     . LEU A 1 674 ? 34.863  1.387   9.425   1.00 71.92  ? 674 LEU A C     1 
ATOM   4877  O  O     . LEU A 1 674 ? 35.063  2.560   9.748   1.00 77.78  ? 674 LEU A O     1 
ATOM   4878  C  CB    . LEU A 1 674 ? 32.402  1.158   9.648   1.00 67.57  ? 674 LEU A CB    1 
ATOM   4879  C  CG    . LEU A 1 674 ? 31.596  0.201   8.754   1.00 70.53  ? 674 LEU A CG    1 
ATOM   4880  C  CD1   . LEU A 1 674 ? 30.535  0.931   7.924   1.00 61.81  ? 674 LEU A CD1   1 
ATOM   4881  C  CD2   . LEU A 1 674 ? 32.507  -0.630  7.880   1.00 70.06  ? 674 LEU A CD2   1 
ATOM   4882  N  N     . LYS A 1 675 ? 35.577  0.763   8.497   1.00 62.86  ? 675 LYS A N     1 
ATOM   4883  C  CA    . LYS A 1 675 ? 36.727  1.422   7.906   1.00 71.60  ? 675 LYS A CA    1 
ATOM   4884  C  C     . LYS A 1 675 ? 36.793  1.221   6.399   1.00 68.56  ? 675 LYS A C     1 
ATOM   4885  O  O     . LYS A 1 675 ? 37.482  1.964   5.693   1.00 68.99  ? 675 LYS A O     1 
ATOM   4886  C  CB    . LYS A 1 675 ? 38.021  0.921   8.569   1.00 71.75  ? 675 LYS A CB    1 
ATOM   4887  N  N     . GLU A 1 676 ? 36.079  0.221   5.897   1.00 62.27  ? 676 GLU A N     1 
ATOM   4888  C  CA    . GLU A 1 676 ? 36.142  -0.051  4.469   1.00 64.75  ? 676 GLU A CA    1 
ATOM   4889  C  C     . GLU A 1 676 ? 35.082  0.723   3.668   1.00 57.32  ? 676 GLU A C     1 
ATOM   4890  O  O     . GLU A 1 676 ? 35.078  0.669   2.436   1.00 57.89  ? 676 GLU A O     1 
ATOM   4891  C  CB    . GLU A 1 676 ? 36.001  -1.555  4.208   1.00 56.76  ? 676 GLU A CB    1 
ATOM   4892  C  CG    . GLU A 1 676 ? 37.015  -2.456  4.921   1.00 69.07  ? 676 GLU A CG    1 
ATOM   4893  C  CD    . GLU A 1 676 ? 37.583  -3.536  4.005   1.00 70.79  ? 676 GLU A CD    1 
ATOM   4894  O  OE1   . GLU A 1 676 ? 37.227  -3.541  2.806   1.00 68.00  ? 676 GLU A OE1   1 
ATOM   4895  O  OE2   . GLU A 1 676 ? 38.393  -4.372  4.477   1.00 79.41  ? 676 GLU A OE2   1 
ATOM   4896  N  N     . VAL A 1 677 ? 34.210  1.457   4.361   1.00 62.98  ? 677 VAL A N     1 
ATOM   4897  C  CA    . VAL A 1 677 ? 33.032  2.072   3.727   1.00 56.33  ? 677 VAL A CA    1 
ATOM   4898  C  C     . VAL A 1 677 ? 33.086  3.603   3.664   1.00 43.64  ? 677 VAL A C     1 
ATOM   4899  O  O     . VAL A 1 677 ? 33.088  4.266   4.693   1.00 44.70  ? 677 VAL A O     1 
ATOM   4900  C  CB    . VAL A 1 677 ? 31.748  1.640   4.473   1.00 53.75  ? 677 VAL A CB    1 
ATOM   4901  C  CG1   . VAL A 1 677 ? 30.495  2.137   3.755   1.00 43.99  ? 677 VAL A CG1   1 
ATOM   4902  C  CG2   . VAL A 1 677 ? 31.716  0.119   4.615   1.00 49.68  ? 677 VAL A CG2   1 
ATOM   4903  N  N     . ASP A 1 678 ? 33.130  4.158   2.454   1.00 46.94  ? 678 ASP A N     1 
ATOM   4904  C  CA    . ASP A 1 678 ? 33.092  5.612   2.252   1.00 47.51  ? 678 ASP A CA    1 
ATOM   4905  C  C     . ASP A 1 678 ? 31.883  6.253   2.945   1.00 51.54  ? 678 ASP A C     1 
ATOM   4906  O  O     . ASP A 1 678 ? 30.814  5.633   3.067   1.00 39.97  ? 678 ASP A O     1 
ATOM   4907  C  CB    . ASP A 1 678 ? 33.055  5.962   0.756   1.00 47.22  ? 678 ASP A CB    1 
ATOM   4908  C  CG    . ASP A 1 678 ? 34.296  5.498   0.006   1.00 63.23  ? 678 ASP A CG    1 
ATOM   4909  O  OD1   . ASP A 1 678 ? 35.144  4.805   0.611   1.00 67.83  ? 678 ASP A OD1   1 
ATOM   4910  O  OD2   . ASP A 1 678 ? 34.411  5.803   -1.204  1.00 66.67  ? 678 ASP A OD2   1 
ATOM   4911  N  N     . ARG A 1 679 ? 32.054  7.489   3.400   1.00 40.80  ? 679 ARG A N     1 
ATOM   4912  C  CA    . ARG A 1 679 ? 31.020  8.147   4.185   1.00 46.45  ? 679 ARG A CA    1 
ATOM   4913  C  C     . ARG A 1 679 ? 29.900  8.685   3.300   1.00 44.45  ? 679 ARG A C     1 
ATOM   4914  O  O     . ARG A 1 679 ? 28.866  9.112   3.812   1.00 49.05  ? 679 ARG A O     1 
ATOM   4915  C  CB    . ARG A 1 679 ? 31.628  9.282   5.000   1.00 47.77  ? 679 ARG A CB    1 
ATOM   4916  C  CG    . ARG A 1 679 ? 32.799  8.853   5.875   1.00 53.30  ? 679 ARG A CG    1 
ATOM   4917  C  CD    . ARG A 1 679 ? 32.432  8.648   7.339   1.00 50.58  ? 679 ARG A CD    1 
ATOM   4918  N  NE    . ARG A 1 679 ? 31.946  9.910   7.899   1.00 58.66  ? 679 ARG A NE    1 
ATOM   4919  C  CZ    . ARG A 1 679 ? 32.721  10.953  8.205   1.00 53.89  ? 679 ARG A CZ    1 
ATOM   4920  N  NH1   . ARG A 1 679 ? 34.033  10.905  7.994   1.00 54.88  ? 679 ARG A NH1   1 
ATOM   4921  N  NH2   . ARG A 1 679 ? 32.178  12.058  8.703   1.00 48.67  ? 679 ARG A NH2   1 
ATOM   4922  N  N     . GLU A 1 680 ? 30.076  8.629   1.980   1.00 42.28  ? 680 GLU A N     1 
ATOM   4923  C  CA    . GLU A 1 680 ? 28.994  9.022   1.076   1.00 43.57  ? 680 GLU A CA    1 
ATOM   4924  C  C     . GLU A 1 680 ? 28.143  7.805   0.716   1.00 43.33  ? 680 GLU A C     1 
ATOM   4925  O  O     . GLU A 1 680 ? 27.146  7.940   0.015   1.00 41.65  ? 680 GLU A O     1 
ATOM   4926  C  CB    . GLU A 1 680 ? 29.517  9.643   -0.220  1.00 43.38  ? 680 GLU A CB    1 
ATOM   4927  C  CG    . GLU A 1 680 ? 30.333  10.900  -0.068  1.00 55.50  ? 680 GLU A CG    1 
ATOM   4928  C  CD    . GLU A 1 680 ? 31.817  10.603  0.076   1.00 64.39  ? 680 GLU A CD    1 
ATOM   4929  O  OE1   . GLU A 1 680 ? 32.529  11.420  0.693   1.00 69.55  ? 680 GLU A OE1   1 
ATOM   4930  O  OE2   . GLU A 1 680 ? 32.269  9.545   -0.424  1.00 64.35  ? 680 GLU A OE2   1 
ATOM   4931  N  N     . LYS A 1 681 ? 28.569  6.621   1.156   1.00 39.64  ? 681 LYS A N     1 
ATOM   4932  C  CA    . LYS A 1 681 ? 27.812  5.396   0.927   1.00 37.71  ? 681 LYS A CA    1 
ATOM   4933  C  C     . LYS A 1 681 ? 26.848  5.203   2.068   1.00 42.26  ? 681 LYS A C     1 
ATOM   4934  O  O     . LYS A 1 681 ? 27.263  4.805   3.164   1.00 38.78  ? 681 LYS A O     1 
ATOM   4935  C  CB    . LYS A 1 681 ? 28.718  4.163   0.812   1.00 42.91  ? 681 LYS A CB    1 
ATOM   4936  C  CG    . LYS A 1 681 ? 29.568  4.080   -0.463  1.00 43.52  ? 681 LYS A CG    1 
ATOM   4937  C  CD    . LYS A 1 681 ? 30.207  2.679   -0.585  1.00 38.72  ? 681 LYS A CD    1 
ATOM   4938  C  CE    . LYS A 1 681 ? 30.927  2.495   -1.918  1.00 43.92  ? 681 LYS A CE    1 
ATOM   4939  N  NZ    . LYS A 1 681 ? 31.945  3.581   -2.138  1.00 56.04  ? 681 LYS A NZ    1 
ATOM   4940  N  N     . LEU A 1 682 ? 25.570  5.468   1.800   1.00 35.06  ? 682 LEU A N     1 
ATOM   4941  C  CA    . LEU A 1 682 ? 24.538  5.442   2.822   1.00 37.69  ? 682 LEU A CA    1 
ATOM   4942  C  C     . LEU A 1 682 ? 24.115  4.022   3.073   1.00 35.27  ? 682 LEU A C     1 
ATOM   4943  O  O     . LEU A 1 682 ? 22.999  3.655   2.728   1.00 34.41  ? 682 LEU A O     1 
ATOM   4944  C  CB    . LEU A 1 682 ? 23.321  6.288   2.404   1.00 31.01  ? 682 LEU A CB    1 
ATOM   4945  C  CG    . LEU A 1 682 ? 23.700  7.706   1.966   1.00 38.45  ? 682 LEU A CG    1 
ATOM   4946  C  CD1   . LEU A 1 682 ? 22.466  8.597   1.732   1.00 31.33  ? 682 LEU A CD1   1 
ATOM   4947  C  CD2   . LEU A 1 682 ? 24.656  8.355   2.977   1.00 40.46  ? 682 LEU A CD2   1 
ATOM   4948  N  N     . PHE A 1 683 ? 24.993  3.233   3.685   1.00 34.59  ? 683 PHE A N     1 
ATOM   4949  C  CA    . PHE A 1 683 ? 24.799  1.795   3.754   1.00 33.84  ? 683 PHE A CA    1 
ATOM   4950  C  C     . PHE A 1 683 ? 23.542  1.407   4.503   1.00 36.54  ? 683 PHE A C     1 
ATOM   4951  O  O     . PHE A 1 683 ? 23.018  0.310   4.333   1.00 37.49  ? 683 PHE A O     1 
ATOM   4952  C  CB    . PHE A 1 683 ? 25.998  1.116   4.432   1.00 31.80  ? 683 PHE A CB    1 
ATOM   4953  C  CG    . PHE A 1 683 ? 26.184  1.506   5.866   1.00 29.22  ? 683 PHE A CG    1 
ATOM   4954  C  CD1   . PHE A 1 683 ? 25.548  0.801   6.886   1.00 34.37  ? 683 PHE A CD1   1 
ATOM   4955  C  CD2   . PHE A 1 683 ? 26.970  2.600   6.198   1.00 31.68  ? 683 PHE A CD2   1 
ATOM   4956  C  CE1   . PHE A 1 683 ? 25.696  1.187   8.215   1.00 32.34  ? 683 PHE A CE1   1 
ATOM   4957  C  CE2   . PHE A 1 683 ? 27.141  2.971   7.509   1.00 33.65  ? 683 PHE A CE2   1 
ATOM   4958  C  CZ    . PHE A 1 683 ? 26.513  2.266   8.522   1.00 32.79  ? 683 PHE A CZ    1 
ATOM   4959  N  N     . PHE A 1 684 ? 23.044  2.331   5.309   1.00 36.46  ? 684 PHE A N     1 
ATOM   4960  C  CA    . PHE A 1 684 ? 22.003  2.021   6.274   1.00 38.76  ? 684 PHE A CA    1 
ATOM   4961  C  C     . PHE A 1 684 ? 20.571  2.318   5.812   1.00 37.58  ? 684 PHE A C     1 
ATOM   4962  O  O     . PHE A 1 684 ? 19.649  2.199   6.604   1.00 37.60  ? 684 PHE A O     1 
ATOM   4963  C  CB    . PHE A 1 684 ? 22.274  2.813   7.546   1.00 35.10  ? 684 PHE A CB    1 
ATOM   4964  C  CG    . PHE A 1 684 ? 22.520  4.265   7.286   1.00 33.26  ? 684 PHE A CG    1 
ATOM   4965  C  CD1   . PHE A 1 684 ? 21.453  5.149   7.209   1.00 32.40  ? 684 PHE A CD1   1 
ATOM   4966  C  CD2   . PHE A 1 684 ? 23.806  4.749   7.080   1.00 35.33  ? 684 PHE A CD2   1 
ATOM   4967  C  CE1   . PHE A 1 684 ? 21.670  6.500   6.965   1.00 32.95  ? 684 PHE A CE1   1 
ATOM   4968  C  CE2   . PHE A 1 684 ? 24.022  6.103   6.824   1.00 28.06  ? 684 PHE A CE2   1 
ATOM   4969  C  CZ    . PHE A 1 684 ? 22.945  6.971   6.771   1.00 32.96  ? 684 PHE A CZ    1 
ATOM   4970  N  N     . VAL A 1 685 ? 20.370  2.760   4.576   1.00 31.43  ? 685 VAL A N     1 
ATOM   4971  C  CA    . VAL A 1 685 ? 19.021  3.198   4.218   1.00 36.68  ? 685 VAL A CA    1 
ATOM   4972  C  C     . VAL A 1 685 ? 18.125  2.010   3.829   1.00 45.75  ? 685 VAL A C     1 
ATOM   4973  O  O     . VAL A 1 685 ? 18.597  0.871   3.672   1.00 36.43  ? 685 VAL A O     1 
ATOM   4974  C  CB    . VAL A 1 685 ? 19.045  4.274   3.092   1.00 33.96  ? 685 VAL A CB    1 
ATOM   4975  C  CG1   . VAL A 1 685 ? 19.703  5.547   3.589   1.00 29.53  ? 685 VAL A CG1   1 
ATOM   4976  C  CG2   . VAL A 1 685 ? 19.736  3.759   1.823   1.00 33.00  ? 685 VAL A CG2   1 
ATOM   4977  O  OXT   . VAL A 1 685 ? 16.890  2.153   3.755   1.00 37.28  ? 685 VAL A OXT   1 
ATOM   4978  N  N     . GLY B 1 5   ? 27.963  47.958  82.889  1.00 91.65  ? 5   GLY B N     1 
ATOM   4979  C  CA    . GLY B 1 5   ? 26.506  47.865  82.958  1.00 95.41  ? 5   GLY B CA    1 
ATOM   4980  C  C     . GLY B 1 5   ? 25.945  47.197  81.710  1.00 92.55  ? 5   GLY B C     1 
ATOM   4981  O  O     . GLY B 1 5   ? 26.343  47.510  80.586  1.00 87.47  ? 5   GLY B O     1 
ATOM   4982  N  N     . LYS B 1 6   ? 25.013  46.275  81.912  1.00 94.68  ? 6   LYS B N     1 
ATOM   4983  C  CA    . LYS B 1 6   ? 24.432  45.546  80.803  1.00 87.79  ? 6   LYS B CA    1 
ATOM   4984  C  C     . LYS B 1 6   ? 23.261  46.357  80.263  1.00 90.22  ? 6   LYS B C     1 
ATOM   4985  O  O     . LYS B 1 6   ? 22.530  46.984  81.030  1.00 92.32  ? 6   LYS B O     1 
ATOM   4986  C  CB    . LYS B 1 6   ? 23.966  44.176  81.286  1.00 90.71  ? 6   LYS B CB    1 
ATOM   4987  C  CG    . LYS B 1 6   ? 25.054  43.407  82.005  1.00 94.19  ? 6   LYS B CG    1 
ATOM   4988  C  CD    . LYS B 1 6   ? 24.501  42.182  82.711  1.00 92.80  ? 6   LYS B CD    1 
ATOM   4989  C  CE    . LYS B 1 6   ? 25.574  41.549  83.588  1.00 91.71  ? 6   LYS B CE    1 
ATOM   4990  N  NZ    . LYS B 1 6   ? 25.058  40.393  84.369  1.00 96.35  ? 6   LYS B NZ    1 
ATOM   4991  N  N     . THR B 1 7   ? 23.067  46.327  78.950  1.00 90.13  ? 7   THR B N     1 
ATOM   4992  C  CA    . THR B 1 7   ? 21.910  46.965  78.328  1.00 86.86  ? 7   THR B CA    1 
ATOM   4993  C  C     . THR B 1 7   ? 21.637  46.219  77.040  1.00 85.92  ? 7   THR B C     1 
ATOM   4994  O  O     . THR B 1 7   ? 22.438  45.386  76.631  1.00 84.77  ? 7   THR B O     1 
ATOM   4995  C  CB    . THR B 1 7   ? 22.131  48.467  78.035  1.00 85.23  ? 7   THR B CB    1 
ATOM   4996  O  OG1   . THR B 1 7   ? 22.948  49.050  79.055  1.00 89.68  ? 7   THR B OG1   1 
ATOM   4997  C  CG2   . THR B 1 7   ? 20.803  49.206  77.985  1.00 81.86  ? 7   THR B CG2   1 
ATOM   4998  N  N     . GLU B 1 8   ? 20.505  46.491  76.409  1.00 81.28  ? 8   GLU B N     1 
ATOM   4999  C  CA    . GLU B 1 8   ? 20.210  45.867  75.133  1.00 80.37  ? 8   GLU B CA    1 
ATOM   5000  C  C     . GLU B 1 8   ? 19.881  46.940  74.113  1.00 80.08  ? 8   GLU B C     1 
ATOM   5001  O  O     . GLU B 1 8   ? 19.339  47.992  74.460  1.00 76.36  ? 8   GLU B O     1 
ATOM   5002  C  CB    . GLU B 1 8   ? 19.058  44.867  75.264  1.00 86.44  ? 8   GLU B CB    1 
ATOM   5003  C  CG    . GLU B 1 8   ? 18.863  43.987  74.036  1.00 84.90  ? 8   GLU B CG    1 
ATOM   5004  C  CD    . GLU B 1 8   ? 17.753  42.971  74.211  1.00 98.45  ? 8   GLU B CD    1 
ATOM   5005  O  OE1   . GLU B 1 8   ? 16.605  43.377  74.511  1.00 97.33  ? 8   GLU B OE1   1 
ATOM   5006  O  OE2   . GLU B 1 8   ? 18.032  41.762  74.048  1.00 101.65 ? 8   GLU B OE2   1 
ATOM   5007  N  N     . VAL B 1 9   ? 20.228  46.689  72.856  1.00 78.79  ? 9   VAL B N     1 
ATOM   5008  C  CA    . VAL B 1 9   ? 19.935  47.666  71.819  1.00 74.54  ? 9   VAL B CA    1 
ATOM   5009  C  C     . VAL B 1 9   ? 19.261  47.056  70.598  1.00 68.62  ? 9   VAL B C     1 
ATOM   5010  O  O     . VAL B 1 9   ? 19.363  45.854  70.341  1.00 73.73  ? 9   VAL B O     1 
ATOM   5011  C  CB    . VAL B 1 9   ? 21.215  48.386  71.357  1.00 70.64  ? 9   VAL B CB    1 
ATOM   5012  C  CG1   . VAL B 1 9   ? 21.800  49.204  72.485  1.00 67.33  ? 9   VAL B CG1   1 
ATOM   5013  C  CG2   . VAL B 1 9   ? 22.228  47.368  70.837  1.00 72.44  ? 9   VAL B CG2   1 
ATOM   5014  N  N     . PHE B 1 10  ? 18.571  47.912  69.857  1.00 67.52  ? 10  PHE B N     1 
ATOM   5015  C  CA    . PHE B 1 10  ? 18.090  47.599  68.523  1.00 70.31  ? 10  PHE B CA    1 
ATOM   5016  C  C     . PHE B 1 10  ? 19.078  48.131  67.505  1.00 66.53  ? 10  PHE B C     1 
ATOM   5017  O  O     . PHE B 1 10  ? 19.590  49.242  67.643  1.00 64.63  ? 10  PHE B O     1 
ATOM   5018  C  CB    . PHE B 1 10  ? 16.720  48.229  68.253  1.00 70.92  ? 10  PHE B CB    1 
ATOM   5019  C  CG    . PHE B 1 10  ? 15.595  47.617  69.030  1.00 77.72  ? 10  PHE B CG    1 
ATOM   5020  C  CD1   . PHE B 1 10  ? 15.596  46.264  69.338  1.00 82.63  ? 10  PHE B CD1   1 
ATOM   5021  C  CD2   . PHE B 1 10  ? 14.522  48.397  69.440  1.00 77.76  ? 10  PHE B CD2   1 
ATOM   5022  C  CE1   . PHE B 1 10  ? 14.544  45.701  70.052  1.00 87.15  ? 10  PHE B CE1   1 
ATOM   5023  C  CE2   . PHE B 1 10  ? 13.472  47.841  70.151  1.00 83.45  ? 10  PHE B CE2   1 
ATOM   5024  C  CZ    . PHE B 1 10  ? 13.483  46.491  70.458  1.00 84.31  ? 10  PHE B CZ    1 
ATOM   5025  N  N     . LEU B 1 11  ? 19.289  47.352  66.470  1.00 66.48  ? 11  LEU B N     1 
ATOM   5026  C  CA    . LEU B 1 11  ? 19.975  47.801  65.298  1.00 56.06  ? 11  LEU B CA    1 
ATOM   5027  C  C     . LEU B 1 11  ? 18.913  48.243  64.324  1.00 64.70  ? 11  LEU B C     1 
ATOM   5028  O  O     . LEU B 1 11  ? 17.762  47.961  64.519  1.00 66.56  ? 11  LEU B O     1 
ATOM   5029  C  CB    . LEU B 1 11  ? 20.822  46.675  64.747  1.00 60.16  ? 11  LEU B CB    1 
ATOM   5030  C  CG    . LEU B 1 11  ? 21.854  46.098  65.702  1.00 58.44  ? 11  LEU B CG    1 
ATOM   5031  C  CD1   . LEU B 1 11  ? 22.726  45.069  65.035  1.00 61.59  ? 11  LEU B CD1   1 
ATOM   5032  C  CD2   . LEU B 1 11  ? 22.715  47.202  66.238  1.00 53.93  ? 11  LEU B CD2   1 
ATOM   5033  N  N     . ASN B 1 12  ? 19.295  48.939  63.278  1.00 58.42  ? 12  ASN B N     1 
ATOM   5034  C  CA    . ASN B 1 12  ? 18.348  49.379  62.294  1.00 54.17  ? 12  ASN B CA    1 
ATOM   5035  C  C     . ASN B 1 12  ? 18.323  48.358  61.200  1.00 56.43  ? 12  ASN B C     1 
ATOM   5036  O  O     . ASN B 1 12  ? 18.162  48.664  60.050  1.00 54.85  ? 12  ASN B O     1 
ATOM   5037  C  CB    . ASN B 1 12  ? 18.684  50.747  61.756  1.00 54.80  ? 12  ASN B CB    1 
ATOM   5038  C  CG    . ASN B 1 12  ? 20.086  50.833  61.252  1.00 54.09  ? 12  ASN B CG    1 
ATOM   5039  O  OD1   . ASN B 1 12  ? 20.950  50.148  61.720  1.00 49.85  ? 12  ASN B OD1   1 
ATOM   5040  N  ND2   . ASN B 1 12  ? 20.305  51.672  60.292  1.00 49.98  ? 12  ASN B ND2   1 
ATOM   5041  N  N     . ARG B 1 13  ? 18.550  47.128  61.596  1.00 56.66  ? 13  ARG B N     1 
ATOM   5042  C  CA    . ARG B 1 13  ? 18.365  45.992  60.716  1.00 65.92  ? 13  ARG B CA    1 
ATOM   5043  C  C     . ARG B 1 13  ? 17.270  45.074  61.247  1.00 69.26  ? 13  ARG B C     1 
ATOM   5044  O  O     . ARG B 1 13  ? 16.915  45.126  62.424  1.00 70.80  ? 13  ARG B O     1 
ATOM   5045  C  CB    . ARG B 1 13  ? 19.679  45.225  60.566  1.00 63.08  ? 13  ARG B CB    1 
ATOM   5046  C  CG    . ARG B 1 13  ? 20.227  44.667  61.861  1.00 70.51  ? 13  ARG B CG    1 
ATOM   5047  C  CD    . ARG B 1 13  ? 21.499  43.859  61.634  1.00 66.98  ? 13  ARG B CD    1 
ATOM   5048  N  NE    . ARG B 1 13  ? 22.649  44.700  61.309  1.00 69.15  ? 13  ARG B NE    1 
ATOM   5049  C  CZ    . ARG B 1 13  ? 23.911  44.294  61.407  1.00 68.99  ? 13  ARG B CZ    1 
ATOM   5050  N  NH1   . ARG B 1 13  ? 24.172  43.057  61.811  1.00 68.61  ? 13  ARG B NH1   1 
ATOM   5051  N  NH2   . ARG B 1 13  ? 24.906  45.118  61.099  1.00 67.12  ? 13  ARG B NH2   1 
ATOM   5052  N  N     . PHE B 1 14  ? 16.731  44.247  60.360  1.00 66.09  ? 14  PHE B N     1 
ATOM   5053  C  CA    . PHE B 1 14  ? 15.540  43.464  60.648  1.00 72.32  ? 14  PHE B CA    1 
ATOM   5054  C  C     . PHE B 1 14  ? 15.668  42.065  60.044  1.00 71.85  ? 14  PHE B C     1 
ATOM   5055  O  O     . PHE B 1 14  ? 16.035  41.915  58.876  1.00 71.52  ? 14  PHE B O     1 
ATOM   5056  C  CB    . PHE B 1 14  ? 14.293  44.167  60.094  1.00 69.56  ? 14  PHE B CB    1 
ATOM   5057  C  CG    . PHE B 1 14  ? 14.108  45.581  60.592  1.00 71.38  ? 14  PHE B CG    1 
ATOM   5058  C  CD1   . PHE B 1 14  ? 14.778  46.641  59.989  1.00 65.92  ? 14  PHE B CD1   1 
ATOM   5059  C  CD2   . PHE B 1 14  ? 13.245  45.855  61.646  1.00 75.99  ? 14  PHE B CD2   1 
ATOM   5060  C  CE1   . PHE B 1 14  ? 14.602  47.943  60.440  1.00 67.80  ? 14  PHE B CE1   1 
ATOM   5061  C  CE2   . PHE B 1 14  ? 13.062  47.158  62.103  1.00 66.49  ? 14  PHE B CE2   1 
ATOM   5062  C  CZ    . PHE B 1 14  ? 13.740  48.200  61.499  1.00 64.41  ? 14  PHE B CZ    1 
ATOM   5063  N  N     . ALA B 1 15  ? 15.346  41.046  60.830  1.00 75.02  ? 15  ALA B N     1 
ATOM   5064  C  CA    . ALA B 1 15  ? 15.388  39.673  60.345  1.00 74.15  ? 15  ALA B CA    1 
ATOM   5065  C  C     . ALA B 1 15  ? 14.160  39.350  59.494  1.00 75.02  ? 15  ALA B C     1 
ATOM   5066  O  O     . ALA B 1 15  ? 13.037  39.723  59.840  1.00 79.20  ? 15  ALA B O     1 
ATOM   5067  C  CB    . ALA B 1 15  ? 15.489  38.705  61.508  1.00 75.92  ? 15  ALA B CB    1 
ATOM   5068  N  N     . LEU B 1 16  ? 14.386  38.685  58.364  1.00 73.87  ? 16  LEU B N     1 
ATOM   5069  C  CA    . LEU B 1 16  ? 13.306  38.166  57.527  1.00 70.68  ? 16  LEU B CA    1 
ATOM   5070  C  C     . LEU B 1 16  ? 13.427  36.642  57.485  1.00 74.11  ? 16  LEU B C     1 
ATOM   5071  O  O     . LEU B 1 16  ? 14.243  36.069  58.214  1.00 70.08  ? 16  LEU B O     1 
ATOM   5072  C  CB    . LEU B 1 16  ? 13.367  38.752  56.115  1.00 67.91  ? 16  LEU B CB    1 
ATOM   5073  C  CG    . LEU B 1 16  ? 13.025  40.232  55.953  1.00 74.00  ? 16  LEU B CG    1 
ATOM   5074  C  CD1   . LEU B 1 16  ? 13.365  40.727  54.557  1.00 72.65  ? 16  LEU B CD1   1 
ATOM   5075  C  CD2   . LEU B 1 16  ? 11.561  40.477  56.259  1.00 75.31  ? 16  LEU B CD2   1 
ATOM   5076  N  N     . ARG B 1 17  ? 12.630  35.989  56.636  1.00 74.30  ? 17  ARG B N     1 
ATOM   5077  C  CA    . ARG B 1 17  ? 12.592  34.524  56.596  1.00 73.47  ? 17  ARG B CA    1 
ATOM   5078  C  C     . ARG B 1 17  ? 13.906  33.948  56.078  1.00 76.49  ? 17  ARG B C     1 
ATOM   5079  O  O     . ARG B 1 17  ? 14.610  34.596  55.304  1.00 76.74  ? 17  ARG B O     1 
ATOM   5080  C  CB    . ARG B 1 17  ? 11.450  34.012  55.713  1.00 77.12  ? 17  ARG B CB    1 
ATOM   5081  C  CG    . ARG B 1 17  ? 11.732  34.127  54.229  1.00 75.65  ? 17  ARG B CG    1 
ATOM   5082  C  CD    . ARG B 1 17  ? 10.931  33.120  53.419  1.00 74.06  ? 17  ARG B CD    1 
ATOM   5083  N  NE    . ARG B 1 17  ? 11.095  33.338  51.983  1.00 74.24  ? 17  ARG B NE    1 
ATOM   5084  C  CZ    . ARG B 1 17  ? 12.163  32.956  51.286  1.00 71.97  ? 17  ARG B CZ    1 
ATOM   5085  N  NH1   . ARG B 1 17  ? 13.174  32.346  51.890  1.00 71.53  ? 17  ARG B NH1   1 
ATOM   5086  N  NH2   . ARG B 1 17  ? 12.226  33.196  49.985  1.00 75.53  ? 17  ARG B NH2   1 
ATOM   5087  N  N     . PRO B 1 18  ? 14.241  32.719  56.502  1.00 77.58  ? 18  PRO B N     1 
ATOM   5088  C  CA    . PRO B 1 18  ? 15.423  32.032  55.971  1.00 77.13  ? 18  PRO B CA    1 
ATOM   5089  C  C     . PRO B 1 18  ? 15.306  31.794  54.464  1.00 78.40  ? 18  PRO B C     1 
ATOM   5090  O  O     . PRO B 1 18  ? 14.193  31.842  53.929  1.00 78.57  ? 18  PRO B O     1 
ATOM   5091  C  CB    . PRO B 1 18  ? 15.433  30.698  56.732  1.00 79.60  ? 18  PRO B CB    1 
ATOM   5092  C  CG    . PRO B 1 18  ? 14.612  30.938  57.952  1.00 76.65  ? 18  PRO B CG    1 
ATOM   5093  C  CD    . PRO B 1 18  ? 13.555  31.916  57.530  1.00 76.99  ? 18  PRO B CD    1 
ATOM   5094  N  N     . LEU B 1 19  ? 16.432  31.578  53.787  1.00 78.97  ? 19  LEU B N     1 
ATOM   5095  C  CA    . LEU B 1 19  ? 16.406  31.256  52.361  1.00 78.98  ? 19  LEU B CA    1 
ATOM   5096  C  C     . LEU B 1 19  ? 15.862  29.844  52.152  1.00 75.97  ? 19  LEU B C     1 
ATOM   5097  O  O     . LEU B 1 19  ? 16.149  28.939  52.939  1.00 74.36  ? 19  LEU B O     1 
ATOM   5098  C  CB    . LEU B 1 19  ? 17.800  31.390  51.738  1.00 79.84  ? 19  LEU B CB    1 
ATOM   5099  C  CG    . LEU B 1 19  ? 18.211  32.774  51.219  1.00 74.84  ? 19  LEU B CG    1 
ATOM   5100  C  CD1   . LEU B 1 19  ? 18.284  33.798  52.345  1.00 74.88  ? 19  LEU B CD1   1 
ATOM   5101  C  CD2   . LEU B 1 19  ? 19.539  32.693  50.474  1.00 70.84  ? 19  LEU B CD2   1 
ATOM   5102  N  N     . ASN B 1 20  ? 15.071  29.658  51.098  1.00 80.01  ? 20  ASN B N     1 
ATOM   5103  C  CA    . ASN B 1 20  ? 14.522  28.338  50.800  1.00 81.00  ? 20  ASN B CA    1 
ATOM   5104  C  C     . ASN B 1 20  ? 15.592  27.502  50.100  1.00 85.64  ? 20  ASN B C     1 
ATOM   5105  O  O     . ASN B 1 20  ? 16.603  28.055  49.655  1.00 82.40  ? 20  ASN B O     1 
ATOM   5106  C  CB    . ASN B 1 20  ? 13.230  28.450  49.961  1.00 80.69  ? 20  ASN B CB    1 
ATOM   5107  C  CG    . ASN B 1 20  ? 13.442  29.094  48.596  1.00 80.92  ? 20  ASN B CG    1 
ATOM   5108  O  OD1   . ASN B 1 20  ? 14.450  28.867  47.927  1.00 83.32  ? 20  ASN B OD1   1 
ATOM   5109  N  ND2   . ASN B 1 20  ? 12.464  29.886  48.166  1.00 76.09  ? 20  ASN B ND2   1 
ATOM   5110  N  N     . PRO B 1 21  ? 15.395  26.170  50.027  1.00 90.61  ? 21  PRO B N     1 
ATOM   5111  C  CA    . PRO B 1 21  ? 16.379  25.304  49.363  1.00 85.95  ? 21  PRO B CA    1 
ATOM   5112  C  C     . PRO B 1 21  ? 16.711  25.738  47.935  1.00 83.16  ? 21  PRO B C     1 
ATOM   5113  O  O     . PRO B 1 21  ? 17.866  25.634  47.515  1.00 82.27  ? 21  PRO B O     1 
ATOM   5114  C  CB    . PRO B 1 21  ? 15.688  23.941  49.363  1.00 89.38  ? 21  PRO B CB    1 
ATOM   5115  C  CG    . PRO B 1 21  ? 14.840  23.969  50.580  1.00 85.29  ? 21  PRO B CG    1 
ATOM   5116  C  CD    . PRO B 1 21  ? 14.327  25.377  50.669  1.00 85.09  ? 21  PRO B CD    1 
ATOM   5117  N  N     . GLU B 1 22  ? 15.702  26.199  47.203  1.00 86.53  ? 22  GLU B N     1 
ATOM   5118  C  CA    . GLU B 1 22  ? 15.884  26.684  45.837  1.00 88.96  ? 22  GLU B CA    1 
ATOM   5119  C  C     . GLU B 1 22  ? 16.778  27.933  45.781  1.00 87.31  ? 22  GLU B C     1 
ATOM   5120  O  O     . GLU B 1 22  ? 17.569  28.101  44.849  1.00 83.39  ? 22  GLU B O     1 
ATOM   5121  C  CB    . GLU B 1 22  ? 14.524  26.974  45.196  1.00 92.19  ? 22  GLU B CB    1 
ATOM   5122  C  CG    . GLU B 1 22  ? 13.489  25.855  45.373  1.00 96.71  ? 22  GLU B CG    1 
ATOM   5123  C  CD    . GLU B 1 22  ? 13.794  24.603  44.555  1.00 104.84 ? 22  GLU B CD    1 
ATOM   5124  O  OE1   . GLU B 1 22  ? 14.719  24.635  43.715  1.00 101.66 ? 22  GLU B OE1   1 
ATOM   5125  O  OE2   . GLU B 1 22  ? 13.096  23.582  44.750  1.00 108.07 ? 22  GLU B OE2   1 
ATOM   5126  N  N     . GLU B 1 23  ? 16.651  28.802  46.785  1.00 84.87  ? 23  GLU B N     1 
ATOM   5127  C  CA    . GLU B 1 23  ? 17.449  30.026  46.842  1.00 81.28  ? 23  GLU B CA    1 
ATOM   5128  C  C     . GLU B 1 23  ? 18.874  29.716  47.262  1.00 77.02  ? 23  GLU B C     1 
ATOM   5129  O  O     . GLU B 1 23  ? 19.806  30.389  46.834  1.00 77.34  ? 23  GLU B O     1 
ATOM   5130  C  CB    . GLU B 1 23  ? 16.836  31.047  47.809  1.00 79.36  ? 23  GLU B CB    1 
ATOM   5131  C  CG    . GLU B 1 23  ? 15.558  31.718  47.323  1.00 75.36  ? 23  GLU B CG    1 
ATOM   5132  C  CD    . GLU B 1 23  ? 14.752  32.317  48.463  1.00 77.33  ? 23  GLU B CD    1 
ATOM   5133  O  OE1   . GLU B 1 23  ? 13.897  33.193  48.202  1.00 77.16  ? 23  GLU B OE1   1 
ATOM   5134  O  OE2   . GLU B 1 23  ? 14.975  31.915  49.624  1.00 77.62  ? 23  GLU B OE2   1 
ATOM   5135  N  N     . LEU B 1 24  ? 19.045  28.683  48.081  1.00 79.89  ? 24  LEU B N     1 
ATOM   5136  C  CA    . LEU B 1 24  ? 20.382  28.271  48.490  1.00 81.91  ? 24  LEU B CA    1 
ATOM   5137  C  C     . LEU B 1 24  ? 21.076  27.503  47.367  1.00 81.29  ? 24  LEU B C     1 
ATOM   5138  O  O     . LEU B 1 24  ? 22.279  27.232  47.439  1.00 81.36  ? 24  LEU B O     1 
ATOM   5139  C  CB    . LEU B 1 24  ? 20.322  27.415  49.761  1.00 83.58  ? 24  LEU B CB    1 
ATOM   5140  C  CG    . LEU B 1 24  ? 19.880  28.108  51.052  1.00 79.76  ? 24  LEU B CG    1 
ATOM   5141  C  CD1   . LEU B 1 24  ? 19.603  27.104  52.162  1.00 73.16  ? 24  LEU B CD1   1 
ATOM   5142  C  CD2   . LEU B 1 24  ? 20.938  29.093  51.490  1.00 73.42  ? 24  LEU B CD2   1 
ATOM   5143  N  N     . ARG B 1 25  ? 20.319  27.169  46.323  1.00 85.17  ? 25  ARG B N     1 
ATOM   5144  C  CA    . ARG B 1 25  ? 20.883  26.473  45.170  1.00 87.12  ? 25  ARG B CA    1 
ATOM   5145  C  C     . ARG B 1 25  ? 20.604  27.280  43.903  1.00 81.72  ? 25  ARG B C     1 
ATOM   5146  O  O     . ARG B 1 25  ? 19.720  26.930  43.121  1.00 82.24  ? 25  ARG B O     1 
ATOM   5147  C  CB    . ARG B 1 25  ? 20.320  25.048  45.049  1.00 88.10  ? 25  ARG B CB    1 
ATOM   5148  C  CG    . ARG B 1 25  ? 20.671  24.164  46.254  1.00 94.32  ? 25  ARG B CG    1 
ATOM   5149  C  CD    . ARG B 1 25  ? 19.867  22.859  46.325  1.00 90.34  ? 25  ARG B CD    1 
ATOM   5150  N  NE    . ARG B 1 25  ? 20.481  21.802  45.520  1.00 94.66  ? 25  ARG B NE    1 
ATOM   5151  C  CZ    . ARG B 1 25  ? 20.089  21.447  44.301  1.00 98.09  ? 25  ARG B CZ    1 
ATOM   5152  N  NH1   . ARG B 1 25  ? 20.725  20.474  43.659  1.00 95.32  ? 25  ARG B NH1   1 
ATOM   5153  N  NH2   . ARG B 1 25  ? 19.063  22.058  43.724  1.00 94.34  ? 25  ARG B NH2   1 
ATOM   5154  N  N     . PRO B 1 26  ? 21.348  28.384  43.712  1.00 86.15  ? 26  PRO B N     1 
ATOM   5155  C  CA    . PRO B 1 26  ? 21.153  29.225  42.526  1.00 83.51  ? 26  PRO B CA    1 
ATOM   5156  C  C     . PRO B 1 26  ? 21.660  28.557  41.249  1.00 79.25  ? 26  PRO B C     1 
ATOM   5157  O  O     . PRO B 1 26  ? 22.646  27.797  41.282  1.00 74.85  ? 26  PRO B O     1 
ATOM   5158  C  CB    . PRO B 1 26  ? 21.968  30.481  42.850  1.00 76.80  ? 26  PRO B CB    1 
ATOM   5159  C  CG    . PRO B 1 26  ? 23.049  29.994  43.761  1.00 78.04  ? 26  PRO B CG    1 
ATOM   5160  C  CD    . PRO B 1 26  ? 22.417  28.905  44.586  1.00 80.55  ? 26  PRO B CD    1 
ATOM   5161  N  N     . TRP B 1 27  ? 20.984  28.843  40.139  1.00 77.85  ? 27  TRP B N     1 
ATOM   5162  C  CA    . TRP B 1 27  ? 21.456  28.396  38.837  1.00 79.55  ? 27  TRP B CA    1 
ATOM   5163  C  C     . TRP B 1 27  ? 22.800  29.027  38.532  1.00 74.51  ? 27  TRP B C     1 
ATOM   5164  O  O     . TRP B 1 27  ? 23.006  30.218  38.737  1.00 74.99  ? 27  TRP B O     1 
ATOM   5165  C  CB    . TRP B 1 27  ? 20.449  28.721  37.726  1.00 74.69  ? 27  TRP B CB    1 
ATOM   5166  C  CG    . TRP B 1 27  ? 19.192  27.889  37.760  1.00 84.89  ? 27  TRP B CG    1 
ATOM   5167  C  CD1   . TRP B 1 27  ? 19.066  26.585  37.360  1.00 83.79  ? 27  TRP B CD1   1 
ATOM   5168  C  CD2   . TRP B 1 27  ? 17.886  28.305  38.181  1.00 82.82  ? 27  TRP B CD2   1 
ATOM   5169  N  NE1   . TRP B 1 27  ? 17.768  26.164  37.520  1.00 84.77  ? 27  TRP B NE1   1 
ATOM   5170  C  CE2   . TRP B 1 27  ? 17.022  27.200  38.023  1.00 87.79  ? 27  TRP B CE2   1 
ATOM   5171  C  CE3   . TRP B 1 27  ? 17.363  29.501  38.686  1.00 81.15  ? 27  TRP B CE3   1 
ATOM   5172  C  CZ2   . TRP B 1 27  ? 15.665  27.255  38.350  1.00 87.43  ? 27  TRP B CZ2   1 
ATOM   5173  C  CZ3   . TRP B 1 27  ? 16.016  29.554  39.013  1.00 82.31  ? 27  TRP B CZ3   1 
ATOM   5174  C  CH2   . TRP B 1 27  ? 15.183  28.438  38.844  1.00 85.67  ? 27  TRP B CH2   1 
ATOM   5175  N  N     . ARG B 1 28  ? 23.724  28.200  38.071  1.00 75.90  ? 28  ARG B N     1 
ATOM   5176  C  CA    . ARG B 1 28  ? 25.058  28.650  37.730  1.00 68.91  ? 28  ARG B CA    1 
ATOM   5177  C  C     . ARG B 1 28  ? 25.152  28.744  36.212  1.00 71.82  ? 28  ARG B C     1 
ATOM   5178  O  O     . ARG B 1 28  ? 24.555  27.937  35.496  1.00 71.70  ? 28  ARG B O     1 
ATOM   5179  C  CB    . ARG B 1 28  ? 26.100  27.691  38.308  1.00 73.23  ? 28  ARG B CB    1 
ATOM   5180  C  CG    . ARG B 1 28  ? 27.538  28.122  38.144  1.00 74.64  ? 28  ARG B CG    1 
ATOM   5181  C  CD    . ARG B 1 28  ? 28.474  27.124  38.815  1.00 88.33  ? 28  ARG B CD    1 
ATOM   5182  N  NE    . ARG B 1 28  ? 28.412  25.793  38.206  1.00 91.92  ? 28  ARG B NE    1 
ATOM   5183  C  CZ    . ARG B 1 28  ? 29.270  25.344  37.291  1.00 87.86  ? 28  ARG B CZ    1 
ATOM   5184  N  NH1   . ARG B 1 28  ? 30.266  26.116  36.870  1.00 86.46  ? 28  ARG B NH1   1 
ATOM   5185  N  NH2   . ARG B 1 28  ? 29.132  24.120  36.796  1.00 88.46  ? 28  ARG B NH2   1 
ATOM   5186  N  N     . LEU B 1 29  ? 25.873  29.744  35.719  1.00 69.30  ? 29  LEU B N     1 
ATOM   5187  C  CA    . LEU B 1 29  ? 26.001  29.946  34.284  1.00 69.51  ? 29  LEU B CA    1 
ATOM   5188  C  C     . LEU B 1 29  ? 27.440  30.309  33.927  1.00 68.30  ? 29  LEU B C     1 
ATOM   5189  O  O     . LEU B 1 29  ? 28.057  31.153  34.571  1.00 69.64  ? 29  LEU B O     1 
ATOM   5190  C  CB    . LEU B 1 29  ? 25.034  31.034  33.799  1.00 69.15  ? 29  LEU B CB    1 
ATOM   5191  C  CG    . LEU B 1 29  ? 23.535  30.692  33.835  1.00 69.87  ? 29  LEU B CG    1 
ATOM   5192  C  CD1   . LEU B 1 29  ? 22.884  31.135  35.142  1.00 67.51  ? 29  LEU B CD1   1 
ATOM   5193  C  CD2   . LEU B 1 29  ? 22.775  31.244  32.635  1.00 68.23  ? 29  LEU B CD2   1 
ATOM   5194  N  N     . GLU B 1 30  ? 27.977  29.651  32.907  1.00 64.54  ? 30  GLU B N     1 
ATOM   5195  C  CA    . GLU B 1 30  ? 29.326  29.941  32.438  1.00 64.54  ? 30  GLU B CA    1 
ATOM   5196  C  C     . GLU B 1 30  ? 29.243  31.042  31.379  1.00 62.07  ? 30  GLU B C     1 
ATOM   5197  O  O     . GLU B 1 30  ? 28.246  31.143  30.669  1.00 58.85  ? 30  GLU B O     1 
ATOM   5198  C  CB    . GLU B 1 30  ? 29.970  28.669  31.883  1.00 69.01  ? 30  GLU B CB    1 
ATOM   5199  C  CG    . GLU B 1 30  ? 31.420  28.782  31.467  1.00 74.96  ? 30  GLU B CG    1 
ATOM   5200  C  CD    . GLU B 1 30  ? 31.919  27.490  30.841  1.00 83.49  ? 30  GLU B CD    1 
ATOM   5201  O  OE1   . GLU B 1 30  ? 32.941  27.520  30.118  1.00 80.25  ? 30  GLU B OE1   1 
ATOM   5202  O  OE2   . GLU B 1 30  ? 31.276  26.440  31.072  1.00 84.37  ? 30  GLU B OE2   1 
ATOM   5203  N  N     . VAL B 1 31  ? 30.279  31.869  31.271  1.00 68.78  ? 31  VAL B N     1 
ATOM   5204  C  CA    . VAL B 1 31  ? 30.212  33.029  30.382  1.00 66.63  ? 31  VAL B CA    1 
ATOM   5205  C  C     . VAL B 1 31  ? 31.318  33.047  29.327  1.00 58.71  ? 31  VAL B C     1 
ATOM   5206  O  O     . VAL B 1 31  ? 32.496  32.908  29.639  1.00 55.75  ? 31  VAL B O     1 
ATOM   5207  C  CB    . VAL B 1 31  ? 30.281  34.354  31.185  1.00 67.37  ? 31  VAL B CB    1 
ATOM   5208  C  CG1   . VAL B 1 31  ? 30.031  35.545  30.273  1.00 65.76  ? 31  VAL B CG1   1 
ATOM   5209  C  CG2   . VAL B 1 31  ? 29.272  34.347  32.311  1.00 62.76  ? 31  VAL B CG2   1 
ATOM   5210  N  N     . VAL B 1 32  ? 30.934  33.229  28.070  1.00 57.63  ? 32  VAL B N     1 
ATOM   5211  C  CA    . VAL B 1 32  ? 31.927  33.396  27.019  1.00 65.26  ? 32  VAL B CA    1 
ATOM   5212  C  C     . VAL B 1 32  ? 31.788  34.784  26.389  1.00 58.04  ? 32  VAL B C     1 
ATOM   5213  O  O     . VAL B 1 32  ? 30.685  35.205  26.023  1.00 61.76  ? 32  VAL B O     1 
ATOM   5214  C  CB    . VAL B 1 32  ? 31.805  32.291  25.932  1.00 61.95  ? 32  VAL B CB    1 
ATOM   5215  C  CG1   . VAL B 1 32  ? 32.895  32.458  24.883  1.00 62.78  ? 32  VAL B CG1   1 
ATOM   5216  C  CG2   . VAL B 1 32  ? 31.918  30.921  26.572  1.00 61.48  ? 32  VAL B CG2   1 
ATOM   5217  N  N     . LEU B 1 33  ? 32.908  35.497  26.289  1.00 63.46  ? 33  LEU B N     1 
ATOM   5218  C  CA    . LEU B 1 33  ? 32.922  36.841  25.711  1.00 64.78  ? 33  LEU B CA    1 
ATOM   5219  C  C     . LEU B 1 33  ? 33.741  36.898  24.419  1.00 64.56  ? 33  LEU B C     1 
ATOM   5220  O  O     . LEU B 1 33  ? 34.847  36.363  24.346  1.00 68.46  ? 33  LEU B O     1 
ATOM   5221  C  CB    . LEU B 1 33  ? 33.466  37.849  26.730  1.00 65.42  ? 33  LEU B CB    1 
ATOM   5222  C  CG    . LEU B 1 33  ? 32.512  38.164  27.888  1.00 62.72  ? 33  LEU B CG    1 
ATOM   5223  C  CD1   . LEU B 1 33  ? 33.215  38.921  29.010  1.00 69.18  ? 33  LEU B CD1   1 
ATOM   5224  C  CD2   . LEU B 1 33  ? 31.314  38.954  27.374  1.00 61.87  ? 33  LEU B CD2   1 
ATOM   5225  N  N     . ASP B 1 34  ? 33.186  37.553  23.405  1.00 61.19  ? 34  ASP B N     1 
ATOM   5226  C  CA    . ASP B 1 34  ? 33.835  37.653  22.101  1.00 67.05  ? 34  ASP B CA    1 
ATOM   5227  C  C     . ASP B 1 34  ? 33.827  39.100  21.610  1.00 66.92  ? 34  ASP B C     1 
ATOM   5228  O  O     . ASP B 1 34  ? 32.764  39.676  21.391  1.00 66.41  ? 34  ASP B O     1 
ATOM   5229  C  CB    . ASP B 1 34  ? 33.140  36.739  21.082  1.00 72.23  ? 34  ASP B CB    1 
ATOM   5230  C  CG    . ASP B 1 34  ? 33.919  36.605  19.782  1.00 75.55  ? 34  ASP B CG    1 
ATOM   5231  O  OD1   . ASP B 1 34  ? 33.664  37.401  18.850  1.00 79.98  ? 34  ASP B OD1   1 
ATOM   5232  O  OD2   . ASP B 1 34  ? 34.779  35.698  19.688  1.00 75.17  ? 34  ASP B OD2   1 
ATOM   5233  N  N     . PRO B 1 35  ? 35.016  39.696  21.430  1.00 67.87  ? 35  PRO B N     1 
ATOM   5234  C  CA    . PRO B 1 35  ? 36.338  39.078  21.589  1.00 68.39  ? 35  PRO B CA    1 
ATOM   5235  C  C     . PRO B 1 35  ? 36.752  38.908  23.050  1.00 71.29  ? 35  PRO B C     1 
ATOM   5236  O  O     . PRO B 1 35  ? 36.110  39.474  23.937  1.00 72.91  ? 35  PRO B O     1 
ATOM   5237  C  CB    . PRO B 1 35  ? 37.268  40.063  20.876  1.00 72.58  ? 35  PRO B CB    1 
ATOM   5238  C  CG    . PRO B 1 35  ? 36.577  41.384  20.970  1.00 72.46  ? 35  PRO B CG    1 
ATOM   5239  C  CD    . PRO B 1 35  ? 35.102  41.126  21.081  1.00 69.15  ? 35  PRO B CD    1 
ATOM   5240  N  N     . PRO B 1 36  ? 37.796  38.104  23.299  1.00 74.10  ? 36  PRO B N     1 
ATOM   5241  C  CA    . PRO B 1 36  ? 38.349  37.973  24.648  1.00 75.65  ? 36  PRO B CA    1 
ATOM   5242  C  C     . PRO B 1 36  ? 38.854  39.304  25.181  1.00 75.03  ? 36  PRO B C     1 
ATOM   5243  O  O     . PRO B 1 36  ? 39.725  39.915  24.567  1.00 75.27  ? 36  PRO B O     1 
ATOM   5244  C  CB    . PRO B 1 36  ? 39.506  36.990  24.459  1.00 76.97  ? 36  PRO B CB    1 
ATOM   5245  C  CG    . PRO B 1 36  ? 39.106  36.174  23.279  1.00 76.30  ? 36  PRO B CG    1 
ATOM   5246  C  CD    . PRO B 1 36  ? 38.394  37.132  22.365  1.00 80.07  ? 36  PRO B CD    1 
ATOM   5247  N  N     . PRO B 1 37  ? 38.301  39.755  26.313  1.00 75.06  ? 37  PRO B N     1 
ATOM   5248  C  CA    . PRO B 1 37  ? 38.717  41.014  26.929  1.00 77.15  ? 37  PRO B CA    1 
ATOM   5249  C  C     . PRO B 1 37  ? 39.874  40.811  27.894  1.00 78.58  ? 37  PRO B C     1 
ATOM   5250  O  O     . PRO B 1 37  ? 40.153  39.667  28.263  1.00 73.42  ? 37  PRO B O     1 
ATOM   5251  C  CB    . PRO B 1 37  ? 37.465  41.453  27.678  1.00 72.26  ? 37  PRO B CB    1 
ATOM   5252  C  CG    . PRO B 1 37  ? 36.857  40.155  28.118  1.00 72.06  ? 37  PRO B CG    1 
ATOM   5253  C  CD    . PRO B 1 37  ? 37.166  39.146  27.030  1.00 68.85  ? 37  PRO B CD    1 
ATOM   5254  N  N     . GLY B 1 38  ? 40.522  41.904  28.296  1.00 83.67  ? 38  GLY B N     1 
ATOM   5255  C  CA    . GLY B 1 38  ? 41.583  41.849  29.286  1.00 86.98  ? 38  GLY B CA    1 
ATOM   5256  C  C     . GLY B 1 38  ? 41.065  41.619  30.696  1.00 86.29  ? 38  GLY B C     1 
ATOM   5257  O  O     . GLY B 1 38  ? 39.901  41.901  30.992  1.00 81.02  ? 38  GLY B O     1 
ATOM   5258  N  N     . ARG B 1 39  ? 41.935  41.115  31.570  1.00 90.12  ? 39  ARG B N     1 
ATOM   5259  C  CA    . ARG B 1 39  ? 41.565  40.805  32.951  1.00 87.27  ? 39  ARG B CA    1 
ATOM   5260  C  C     . ARG B 1 39  ? 41.254  42.063  33.760  1.00 83.29  ? 39  ARG B C     1 
ATOM   5261  O  O     . ARG B 1 39  ? 40.734  41.980  34.872  1.00 85.27  ? 39  ARG B O     1 
ATOM   5262  C  CB    . ARG B 1 39  ? 42.679  40.004  33.637  1.00 88.11  ? 39  ARG B CB    1 
ATOM   5263  C  CG    . ARG B 1 39  ? 43.061  38.718  32.916  1.00 89.75  ? 39  ARG B CG    1 
ATOM   5264  C  CD    . ARG B 1 39  ? 44.467  38.793  32.331  1.00 97.70  ? 39  ARG B CD    1 
ATOM   5265  N  NE    . ARG B 1 39  ? 44.626  39.879  31.361  1.00 99.81  ? 39  ARG B NE    1 
ATOM   5266  C  CZ    . ARG B 1 39  ? 44.421  39.756  30.051  1.00 98.47  ? 39  ARG B CZ    1 
ATOM   5267  N  NH1   . ARG B 1 39  ? 44.037  38.593  29.541  1.00 95.02  ? 39  ARG B NH1   1 
ATOM   5268  N  NH2   . ARG B 1 39  ? 44.597  40.798  29.248  1.00 97.93  ? 39  ARG B NH2   1 
ATOM   5269  N  N     . GLU B 1 40  ? 41.582  43.225  33.204  1.00 84.50  ? 40  GLU B N     1 
ATOM   5270  C  CA    . GLU B 1 40  ? 41.228  44.493  33.824  1.00 82.76  ? 40  GLU B CA    1 
ATOM   5271  C  C     . GLU B 1 40  ? 39.781  44.838  33.495  1.00 86.80  ? 40  GLU B C     1 
ATOM   5272  O  O     . GLU B 1 40  ? 39.158  45.664  34.167  1.00 87.08  ? 40  GLU B O     1 
ATOM   5273  C  CB    . GLU B 1 40  ? 42.161  45.601  33.360  1.00 81.95  ? 40  GLU B CB    1 
ATOM   5274  N  N     . GLU B 1 41  ? 39.250  44.193  32.460  1.00 83.58  ? 41  GLU B N     1 
ATOM   5275  C  CA    . GLU B 1 41  ? 37.902  44.492  31.991  1.00 81.17  ? 41  GLU B CA    1 
ATOM   5276  C  C     . GLU B 1 41  ? 36.941  43.307  32.142  1.00 76.01  ? 41  GLU B C     1 
ATOM   5277  O  O     . GLU B 1 41  ? 35.772  43.412  31.777  1.00 72.27  ? 41  GLU B O     1 
ATOM   5278  C  CB    . GLU B 1 41  ? 37.947  44.948  30.538  1.00 80.31  ? 41  GLU B CB    1 
ATOM   5279  N  N     . VAL B 1 42  ? 37.419  42.190  32.683  1.00 74.75  ? 42  VAL B N     1 
ATOM   5280  C  CA    . VAL B 1 42  ? 36.580  40.998  32.805  1.00 71.91  ? 42  VAL B CA    1 
ATOM   5281  C  C     . VAL B 1 42  ? 35.388  41.215  33.744  1.00 71.57  ? 42  VAL B C     1 
ATOM   5282  O  O     . VAL B 1 42  ? 34.232  41.009  33.353  1.00 65.15  ? 42  VAL B O     1 
ATOM   5283  C  CB    . VAL B 1 42  ? 37.403  39.786  33.288  1.00 75.88  ? 42  VAL B CB    1 
ATOM   5284  C  CG1   . VAL B 1 42  ? 36.497  38.696  33.841  1.00 73.62  ? 42  VAL B CG1   1 
ATOM   5285  C  CG2   . VAL B 1 42  ? 38.256  39.249  32.149  1.00 76.21  ? 42  VAL B CG2   1 
ATOM   5286  N  N     . TYR B 1 43  ? 35.668  41.655  34.966  1.00 67.98  ? 43  TYR B N     1 
ATOM   5287  C  CA    . TYR B 1 43  ? 34.625  41.807  35.983  1.00 71.01  ? 43  TYR B CA    1 
ATOM   5288  C  C     . TYR B 1 43  ? 33.565  42.885  35.667  1.00 63.41  ? 43  TYR B C     1 
ATOM   5289  O  O     . TYR B 1 43  ? 32.369  42.641  35.871  1.00 67.08  ? 43  TYR B O     1 
ATOM   5290  C  CB    . TYR B 1 43  ? 35.281  42.078  37.342  1.00 69.83  ? 43  TYR B CB    1 
ATOM   5291  C  CG    . TYR B 1 43  ? 36.166  40.935  37.780  1.00 73.60  ? 43  TYR B CG    1 
ATOM   5292  C  CD1   . TYR B 1 43  ? 35.633  39.830  38.430  1.00 73.47  ? 43  TYR B CD1   1 
ATOM   5293  C  CD2   . TYR B 1 43  ? 37.532  40.945  37.515  1.00 80.19  ? 43  TYR B CD2   1 
ATOM   5294  C  CE1   . TYR B 1 43  ? 36.433  38.774  38.821  1.00 76.12  ? 43  TYR B CE1   1 
ATOM   5295  C  CE2   . TYR B 1 43  ? 38.342  39.889  37.901  1.00 81.84  ? 43  TYR B CE2   1 
ATOM   5296  C  CZ    . TYR B 1 43  ? 37.784  38.808  38.553  1.00 80.17  ? 43  TYR B CZ    1 
ATOM   5297  O  OH    . TYR B 1 43  ? 38.582  37.760  38.941  1.00 91.54  ? 43  TYR B OH    1 
ATOM   5298  N  N     . PRO B 1 44  ? 33.981  44.072  35.169  1.00 65.18  ? 44  PRO B N     1 
ATOM   5299  C  CA    . PRO B 1 44  ? 32.951  45.039  34.742  1.00 63.28  ? 44  PRO B CA    1 
ATOM   5300  C  C     . PRO B 1 44  ? 32.033  44.494  33.638  1.00 63.85  ? 44  PRO B C     1 
ATOM   5301  O  O     . PRO B 1 44  ? 30.801  44.690  33.656  1.00 61.25  ? 44  PRO B O     1 
ATOM   5302  C  CB    . PRO B 1 44  ? 33.776  46.221  34.218  1.00 64.28  ? 44  PRO B CB    1 
ATOM   5303  C  CG    . PRO B 1 44  ? 35.071  46.124  34.931  1.00 70.12  ? 44  PRO B CG    1 
ATOM   5304  C  CD    . PRO B 1 44  ? 35.336  44.655  35.093  1.00 69.50  ? 44  PRO B CD    1 
ATOM   5305  N  N     . LEU B 1 45  ? 32.649  43.814  32.675  1.00 64.89  ? 45  LEU B N     1 
ATOM   5306  C  CA    . LEU B 1 45  ? 31.910  43.225  31.570  1.00 62.30  ? 45  LEU B CA    1 
ATOM   5307  C  C     . LEU B 1 45  ? 30.943  42.162  32.080  1.00 60.06  ? 45  LEU B C     1 
ATOM   5308  O  O     . LEU B 1 45  ? 29.801  42.130  31.656  1.00 60.64  ? 45  LEU B O     1 
ATOM   5309  C  CB    . LEU B 1 45  ? 32.872  42.648  30.526  1.00 62.94  ? 45  LEU B CB    1 
ATOM   5310  C  CG    . LEU B 1 45  ? 33.429  43.686  29.539  1.00 63.57  ? 45  LEU B CG    1 
ATOM   5311  C  CD1   . LEU B 1 45  ? 34.570  43.131  28.711  1.00 60.97  ? 45  LEU B CD1   1 
ATOM   5312  C  CD2   . LEU B 1 45  ? 32.319  44.184  28.630  1.00 60.94  ? 45  LEU B CD2   1 
ATOM   5313  N  N     . LEU B 1 46  ? 31.397  41.321  33.006  1.00 61.74  ? 46  LEU B N     1 
ATOM   5314  C  CA    . LEU B 1 46  ? 30.559  40.292  33.621  1.00 61.09  ? 46  LEU B CA    1 
ATOM   5315  C  C     . LEU B 1 46  ? 29.386  40.879  34.399  1.00 64.44  ? 46  LEU B C     1 
ATOM   5316  O  O     . LEU B 1 46  ? 28.280  40.314  34.390  1.00 56.59  ? 46  LEU B O     1 
ATOM   5317  C  CB    . LEU B 1 46  ? 31.408  39.410  34.539  1.00 61.84  ? 46  LEU B CB    1 
ATOM   5318  C  CG    . LEU B 1 46  ? 31.919  38.075  33.986  1.00 69.65  ? 46  LEU B CG    1 
ATOM   5319  C  CD1   . LEU B 1 46  ? 32.661  38.254  32.675  1.00 71.43  ? 46  LEU B CD1   1 
ATOM   5320  C  CD2   . LEU B 1 46  ? 32.846  37.452  35.015  1.00 65.00  ? 46  LEU B CD2   1 
ATOM   5321  N  N     . ALA B 1 47  ? 29.620  42.004  35.077  1.00 62.67  ? 47  ALA B N     1 
ATOM   5322  C  CA    . ALA B 1 47  ? 28.525  42.713  35.744  1.00 56.18  ? 47  ALA B CA    1 
ATOM   5323  C  C     . ALA B 1 47  ? 27.484  43.144  34.710  1.00 59.48  ? 47  ALA B C     1 
ATOM   5324  O  O     . ALA B 1 47  ? 26.256  42.984  34.900  1.00 59.46  ? 47  ALA B O     1 
ATOM   5325  C  CB    . ALA B 1 47  ? 29.049  43.913  36.506  1.00 59.09  ? 47  ALA B CB    1 
ATOM   5326  N  N     . GLN B 1 48  ? 27.988  43.709  33.614  1.00 58.65  ? 48  GLN B N     1 
ATOM   5327  C  CA    . GLN B 1 48  ? 27.115  44.148  32.535  1.00 62.92  ? 48  GLN B CA    1 
ATOM   5328  C  C     . GLN B 1 48  ? 26.341  42.952  31.946  1.00 61.78  ? 48  GLN B C     1 
ATOM   5329  O  O     . GLN B 1 48  ? 25.146  43.057  31.662  1.00 57.69  ? 48  GLN B O     1 
ATOM   5330  C  CB    . GLN B 1 48  ? 27.926  44.878  31.457  1.00 63.47  ? 48  GLN B CB    1 
ATOM   5331  C  CG    . GLN B 1 48  ? 27.073  45.535  30.382  1.00 68.88  ? 48  GLN B CG    1 
ATOM   5332  C  CD    . GLN B 1 48  ? 27.888  46.344  29.379  1.00 72.96  ? 48  GLN B CD    1 
ATOM   5333  O  OE1   . GLN B 1 48  ? 29.060  46.674  29.613  1.00 69.91  ? 48  GLN B OE1   1 
ATOM   5334  N  NE2   . GLN B 1 48  ? 27.263  46.667  28.252  1.00 66.52  ? 48  GLN B NE2   1 
ATOM   5335  N  N     . VAL B 1 49  ? 27.021  41.814  31.806  1.00 62.03  ? 49  VAL B N     1 
ATOM   5336  C  CA    . VAL B 1 49  ? 26.404  40.574  31.331  1.00 65.16  ? 49  VAL B CA    1 
ATOM   5337  C  C     . VAL B 1 49  ? 25.263  40.199  32.246  1.00 57.95  ? 49  VAL B C     1 
ATOM   5338  O  O     . VAL B 1 49  ? 24.174  39.879  31.786  1.00 59.10  ? 49  VAL B O     1 
ATOM   5339  C  CB    . VAL B 1 49  ? 27.394  39.390  31.271  1.00 59.32  ? 49  VAL B CB    1 
ATOM   5340  C  CG1   . VAL B 1 49  ? 26.672  38.112  30.836  1.00 58.62  ? 49  VAL B CG1   1 
ATOM   5341  C  CG2   . VAL B 1 49  ? 28.553  39.696  30.352  1.00 61.98  ? 49  VAL B CG2   1 
ATOM   5342  N  N     . ALA B 1 50  ? 25.532  40.250  33.545  1.00 59.74  ? 50  ALA B N     1 
ATOM   5343  C  CA    . ALA B 1 50  ? 24.542  39.926  34.553  1.00 59.85  ? 50  ALA B CA    1 
ATOM   5344  C  C     . ALA B 1 50  ? 23.308  40.790  34.354  1.00 66.37  ? 50  ALA B C     1 
ATOM   5345  O  O     . ALA B 1 50  ? 22.182  40.311  34.507  1.00 60.86  ? 50  ALA B O     1 
ATOM   5346  C  CB    . ALA B 1 50  ? 25.118  40.119  35.949  1.00 58.24  ? 50  ALA B CB    1 
ATOM   5347  N  N     . ARG B 1 51  ? 23.512  42.054  33.981  1.00 66.97  ? 51  ARG B N     1 
ATOM   5348  C  CA    . ARG B 1 51  ? 22.356  42.931  33.739  1.00 65.83  ? 51  ARG B CA    1 
ATOM   5349  C  C     . ARG B 1 51  ? 21.601  42.607  32.436  1.00 63.89  ? 51  ARG B C     1 
ATOM   5350  O  O     . ARG B 1 51  ? 20.376  42.470  32.439  1.00 63.31  ? 51  ARG B O     1 
ATOM   5351  C  CB    . ARG B 1 51  ? 22.795  44.395  33.744  1.00 72.42  ? 51  ARG B CB    1 
ATOM   5352  C  CG    . ARG B 1 51  ? 23.219  44.869  35.130  1.00 73.82  ? 51  ARG B CG    1 
ATOM   5353  C  CD    . ARG B 1 51  ? 23.237  46.379  35.235  1.00 88.93  ? 51  ARG B CD    1 
ATOM   5354  N  NE    . ARG B 1 51  ? 23.361  46.802  36.627  1.00 97.85  ? 51  ARG B NE    1 
ATOM   5355  C  CZ    . ARG B 1 51  ? 22.336  46.881  37.469  1.00 96.08  ? 51  ARG B CZ    1 
ATOM   5356  N  NH1   . ARG B 1 51  ? 21.114  46.573  37.050  1.00 94.42  ? 51  ARG B NH1   1 
ATOM   5357  N  NH2   . ARG B 1 51  ? 22.529  47.276  38.721  1.00 96.03  ? 51  ARG B NH2   1 
ATOM   5358  N  N     . ARG B 1 52  ? 22.332  42.494  31.330  1.00 64.01  ? 52  ARG B N     1 
ATOM   5359  C  CA    . ARG B 1 52  ? 21.740  42.198  30.025  1.00 63.09  ? 52  ARG B CA    1 
ATOM   5360  C  C     . ARG B 1 52  ? 21.008  40.859  30.030  1.00 64.79  ? 52  ARG B C     1 
ATOM   5361  O  O     . ARG B 1 52  ? 20.063  40.647  29.264  1.00 66.08  ? 52  ARG B O     1 
ATOM   5362  C  CB    . ARG B 1 52  ? 22.814  42.201  28.932  1.00 67.50  ? 52  ARG B CB    1 
ATOM   5363  C  CG    . ARG B 1 52  ? 23.323  43.587  28.539  1.00 70.08  ? 52  ARG B CG    1 
ATOM   5364  C  CD    . ARG B 1 52  ? 22.272  44.363  27.752  1.00 78.38  ? 52  ARG B CD    1 
ATOM   5365  N  NE    . ARG B 1 52  ? 22.649  45.766  27.582  1.00 88.17  ? 52  ARG B NE    1 
ATOM   5366  C  CZ    . ARG B 1 52  ? 23.467  46.213  26.631  1.00 89.98  ? 52  ARG B CZ    1 
ATOM   5367  N  NH1   . ARG B 1 52  ? 23.990  45.367  25.753  1.00 90.64  ? 52  ARG B NH1   1 
ATOM   5368  N  NH2   . ARG B 1 52  ? 23.762  47.506  26.554  1.00 86.88  ? 52  ARG B NH2   1 
ATOM   5369  N  N     . ALA B 1 53  ? 21.471  39.948  30.880  1.00 61.92  ? 53  ALA B N     1 
ATOM   5370  C  CA    . ALA B 1 53  ? 20.879  38.626  30.980  1.00 64.32  ? 53  ALA B CA    1 
ATOM   5371  C  C     . ALA B 1 53  ? 19.444  38.722  31.493  1.00 69.12  ? 53  ALA B C     1 
ATOM   5372  O  O     . ALA B 1 53  ? 18.584  37.932  31.103  1.00 66.17  ? 53  ALA B O     1 
ATOM   5373  C  CB    . ALA B 1 53  ? 21.714  37.737  31.884  1.00 60.07  ? 53  ALA B CB    1 
ATOM   5374  N  N     . GLY B 1 54  ? 19.193  39.692  32.369  1.00 67.02  ? 54  GLY B N     1 
ATOM   5375  C  CA    . GLY B 1 54  ? 17.872  39.879  32.947  1.00 67.28  ? 54  GLY B CA    1 
ATOM   5376  C  C     . GLY B 1 54  ? 17.716  39.010  34.181  1.00 65.47  ? 54  GLY B C     1 
ATOM   5377  O  O     . GLY B 1 54  ? 18.632  38.276  34.539  1.00 61.18  ? 54  GLY B O     1 
ATOM   5378  N  N     . GLY B 1 55  ? 16.555  39.077  34.823  1.00 66.81  ? 55  GLY B N     1 
ATOM   5379  C  CA    . GLY B 1 55  ? 16.290  38.288  36.014  1.00 70.77  ? 55  GLY B CA    1 
ATOM   5380  C  C     . GLY B 1 55  ? 17.168  38.643  37.202  1.00 69.06  ? 55  GLY B C     1 
ATOM   5381  O  O     . GLY B 1 55  ? 17.881  39.644  37.179  1.00 70.92  ? 55  GLY B O     1 
ATOM   5382  N  N     . VAL B 1 56  ? 17.112  37.823  38.249  1.00 68.64  ? 56  VAL B N     1 
ATOM   5383  C  CA    . VAL B 1 56  ? 17.915  38.060  39.450  1.00 68.68  ? 56  VAL B CA    1 
ATOM   5384  C  C     . VAL B 1 56  ? 19.244  37.332  39.329  1.00 65.60  ? 56  VAL B C     1 
ATOM   5385  O  O     . VAL B 1 56  ? 19.412  36.237  39.863  1.00 65.68  ? 56  VAL B O     1 
ATOM   5386  C  CB    . VAL B 1 56  ? 17.186  37.594  40.729  1.00 65.87  ? 56  VAL B CB    1 
ATOM   5387  C  CG1   . VAL B 1 56  ? 17.976  37.969  41.984  1.00 59.91  ? 56  VAL B CG1   1 
ATOM   5388  C  CG2   . VAL B 1 56  ? 15.778  38.170  40.775  1.00 65.87  ? 56  VAL B CG2   1 
ATOM   5389  N  N     . THR B 1 57  ? 20.183  37.933  38.606  1.00 66.31  ? 57  THR B N     1 
ATOM   5390  C  CA    . THR B 1 57  ? 21.459  37.281  38.336  1.00 63.15  ? 57  THR B CA    1 
ATOM   5391  C  C     . THR B 1 57  ? 22.582  38.252  38.617  1.00 57.29  ? 57  THR B C     1 
ATOM   5392  O  O     . THR B 1 57  ? 22.469  39.439  38.306  1.00 60.90  ? 57  THR B O     1 
ATOM   5393  C  CB    . THR B 1 57  ? 21.579  36.794  36.868  1.00 60.40  ? 57  THR B CB    1 
ATOM   5394  O  OG1   . THR B 1 57  ? 22.205  37.794  36.059  1.00 74.76  ? 57  THR B OG1   1 
ATOM   5395  C  CG2   . THR B 1 57  ? 20.228  36.475  36.309  1.00 63.39  ? 57  THR B CG2   1 
ATOM   5396  N  N     . VAL B 1 58  ? 23.657  37.749  39.215  1.00 61.87  ? 58  VAL B N     1 
ATOM   5397  C  CA    . VAL B 1 58  ? 24.841  38.550  39.506  1.00 56.68  ? 58  VAL B CA    1 
ATOM   5398  C  C     . VAL B 1 58  ? 26.094  37.799  39.093  1.00 63.55  ? 58  VAL B C     1 
ATOM   5399  O  O     . VAL B 1 58  ? 26.040  36.620  38.736  1.00 59.47  ? 58  VAL B O     1 
ATOM   5400  C  CB    . VAL B 1 58  ? 24.962  38.896  41.008  1.00 60.03  ? 58  VAL B CB    1 
ATOM   5401  C  CG1   . VAL B 1 58  ? 23.735  39.642  41.496  1.00 55.12  ? 58  VAL B CG1   1 
ATOM   5402  C  CG2   . VAL B 1 58  ? 25.177  37.635  41.824  1.00 62.26  ? 58  VAL B CG2   1 
ATOM   5403  N  N     . ARG B 1 59  ? 27.230  38.479  39.157  1.00 61.57  ? 59  ARG B N     1 
ATOM   5404  C  CA    . ARG B 1 59  ? 28.502  37.832  38.893  1.00 63.28  ? 59  ARG B CA    1 
ATOM   5405  C  C     . ARG B 1 59  ? 28.807  36.831  40.006  1.00 65.60  ? 59  ARG B C     1 
ATOM   5406  O  O     . ARG B 1 59  ? 28.524  37.090  41.173  1.00 67.41  ? 59  ARG B O     1 
ATOM   5407  C  CB    . ARG B 1 59  ? 29.628  38.863  38.777  1.00 66.48  ? 59  ARG B CB    1 
ATOM   5408  C  CG    . ARG B 1 59  ? 31.016  38.240  38.655  1.00 69.38  ? 59  ARG B CG    1 
ATOM   5409  C  CD    . ARG B 1 59  ? 32.094  39.296  38.477  1.00 69.83  ? 59  ARG B CD    1 
ATOM   5410  N  NE    . ARG B 1 59  ? 32.308  40.039  39.716  1.00 73.98  ? 59  ARG B NE    1 
ATOM   5411  C  CZ    . ARG B 1 59  ? 33.021  39.592  40.747  1.00 76.01  ? 59  ARG B CZ    1 
ATOM   5412  N  NH1   . ARG B 1 59  ? 33.581  38.389  40.699  1.00 69.87  ? 59  ARG B NH1   1 
ATOM   5413  N  NH2   . ARG B 1 59  ? 33.164  40.342  41.835  1.00 79.70  ? 59  ARG B NH2   1 
ATOM   5414  N  N     . MET B 1 60  ? 29.302  35.657  39.631  1.00 67.31  ? 60  MET B N     1 
ATOM   5415  C  CA    . MET B 1 60  ? 29.878  34.720  40.590  1.00 65.12  ? 60  MET B CA    1 
ATOM   5416  C  C     . MET B 1 60  ? 31.199  34.190  40.044  1.00 73.46  ? 60  MET B C     1 
ATOM   5417  O  O     . MET B 1 60  ? 31.218  33.313  39.177  1.00 74.90  ? 60  MET B O     1 
ATOM   5418  C  CB    . MET B 1 60  ? 28.930  33.562  40.898  1.00 71.74  ? 60  MET B CB    1 
ATOM   5419  C  CG    . MET B 1 60  ? 29.541  32.547  41.861  1.00 73.09  ? 60  MET B CG    1 
ATOM   5420  S  SD    . MET B 1 60  ? 28.401  31.287  42.447  1.00 85.33  ? 60  MET B SD    1 
ATOM   5421  C  CE    . MET B 1 60  ? 28.008  30.417  40.926  1.00 81.37  ? 60  MET B CE    1 
ATOM   5422  N  N     . GLY B 1 61  ? 32.298  34.731  40.560  1.00 71.56  ? 61  GLY B N     1 
ATOM   5423  C  CA    . GLY B 1 61  ? 33.620  34.420  40.054  1.00 71.46  ? 61  GLY B CA    1 
ATOM   5424  C  C     . GLY B 1 61  ? 33.766  34.974  38.653  1.00 76.33  ? 61  GLY B C     1 
ATOM   5425  O  O     . GLY B 1 61  ? 33.596  36.175  38.430  1.00 73.80  ? 61  GLY B O     1 
ATOM   5426  N  N     . ASP B 1 62  ? 34.060  34.095  37.701  1.00 78.75  ? 62  ASP B N     1 
ATOM   5427  C  CA    . ASP B 1 62  ? 34.133  34.486  36.299  1.00 75.66  ? 62  ASP B CA    1 
ATOM   5428  C  C     . ASP B 1 62  ? 32.898  33.958  35.588  1.00 78.07  ? 62  ASP B C     1 
ATOM   5429  O  O     . ASP B 1 62  ? 32.881  33.787  34.369  1.00 78.88  ? 62  ASP B O     1 
ATOM   5430  C  CB    . ASP B 1 62  ? 35.420  33.972  35.646  1.00 83.62  ? 62  ASP B CB    1 
ATOM   5431  C  CG    . ASP B 1 62  ? 35.503  32.459  35.622  1.00 86.25  ? 62  ASP B CG    1 
ATOM   5432  O  OD1   . ASP B 1 62  ? 34.833  31.803  36.451  1.00 88.50  ? 62  ASP B OD1   1 
ATOM   5433  O  OD2   . ASP B 1 62  ? 36.259  31.924  34.783  1.00 92.27  ? 62  ASP B OD2   1 
ATOM   5434  N  N     . GLY B 1 63  ? 31.863  33.703  36.385  1.00 75.57  ? 63  GLY B N     1 
ATOM   5435  C  CA    . GLY B 1 63  ? 30.592  33.205  35.901  1.00 70.19  ? 63  GLY B CA    1 
ATOM   5436  C  C     . GLY B 1 63  ? 29.415  34.029  36.389  1.00 71.64  ? 63  GLY B C     1 
ATOM   5437  O  O     . GLY B 1 63  ? 29.553  35.186  36.785  1.00 68.71  ? 63  GLY B O     1 
ATOM   5438  N  N     . LEU B 1 64  ? 28.243  33.416  36.334  1.00 66.55  ? 64  LEU B N     1 
ATOM   5439  C  CA    . LEU B 1 64  ? 26.984  34.051  36.681  1.00 66.67  ? 64  LEU B CA    1 
ATOM   5440  C  C     . LEU B 1 64  ? 26.220  33.162  37.669  1.00 68.62  ? 64  LEU B C     1 
ATOM   5441  O  O     . LEU B 1 64  ? 26.208  31.945  37.518  1.00 71.87  ? 64  LEU B O     1 
ATOM   5442  C  CB    . LEU B 1 64  ? 26.159  34.285  35.415  1.00 61.57  ? 64  LEU B CB    1 
ATOM   5443  C  CG    . LEU B 1 64  ? 25.951  35.682  34.826  1.00 66.60  ? 64  LEU B CG    1 
ATOM   5444  C  CD1   . LEU B 1 64  ? 27.233  36.487  34.782  1.00 64.63  ? 64  LEU B CD1   1 
ATOM   5445  C  CD2   . LEU B 1 64  ? 25.389  35.532  33.422  1.00 55.65  ? 64  LEU B CD2   1 
ATOM   5446  N  N     . ALA B 1 65  ? 25.641  33.756  38.708  1.00 67.14  ? 65  ALA B N     1 
ATOM   5447  C  CA    . ALA B 1 65  ? 24.722  33.039  39.591  1.00 63.37  ? 65  ALA B CA    1 
ATOM   5448  C  C     . ALA B 1 65  ? 23.347  33.684  39.460  1.00 65.19  ? 65  ALA B C     1 
ATOM   5449  O  O     . ALA B 1 65  ? 23.249  34.893  39.293  1.00 65.57  ? 65  ALA B O     1 
ATOM   5450  C  CB    . ALA B 1 65  ? 25.208  33.059  41.037  1.00 65.32  ? 65  ALA B CB    1 
ATOM   5451  N  N     . SER B 1 66  ? 22.285  32.889  39.513  1.00 66.61  ? 66  SER B N     1 
ATOM   5452  C  CA    . SER B 1 66  ? 20.950  33.427  39.287  1.00 68.17  ? 66  SER B CA    1 
ATOM   5453  C  C     . SER B 1 66  ? 19.827  32.718  40.043  1.00 73.31  ? 66  SER B C     1 
ATOM   5454  O  O     . SER B 1 66  ? 19.873  31.509  40.261  1.00 75.25  ? 66  SER B O     1 
ATOM   5455  C  CB    . SER B 1 66  ? 20.636  33.387  37.794  1.00 64.96  ? 66  SER B CB    1 
ATOM   5456  O  OG    . SER B 1 66  ? 19.321  33.850  37.538  1.00 64.24  ? 66  SER B OG    1 
ATOM   5457  N  N     . TRP B 1 67  ? 18.810  33.488  40.418  1.00 68.89  ? 67  TRP B N     1 
ATOM   5458  C  CA    . TRP B 1 67  ? 17.617  32.945  41.054  1.00 69.96  ? 67  TRP B CA    1 
ATOM   5459  C  C     . TRP B 1 67  ? 16.479  32.858  40.047  1.00 71.54  ? 67  TRP B C     1 
ATOM   5460  O  O     . TRP B 1 67  ? 15.390  32.368  40.355  1.00 71.91  ? 67  TRP B O     1 
ATOM   5461  C  CB    . TRP B 1 67  ? 17.206  33.803  42.249  1.00 66.05  ? 67  TRP B CB    1 
ATOM   5462  C  CG    . TRP B 1 67  ? 17.943  33.479  43.496  1.00 65.90  ? 67  TRP B CG    1 
ATOM   5463  C  CD1   . TRP B 1 67  ? 18.668  32.353  43.751  1.00 67.79  ? 67  TRP B CD1   1 
ATOM   5464  C  CD2   . TRP B 1 67  ? 18.047  34.298  44.663  1.00 65.10  ? 67  TRP B CD2   1 
ATOM   5465  N  NE1   . TRP B 1 67  ? 19.208  32.414  45.013  1.00 70.52  ? 67  TRP B NE1   1 
ATOM   5466  C  CE2   . TRP B 1 67  ? 18.841  33.603  45.595  1.00 66.86  ? 67  TRP B CE2   1 
ATOM   5467  C  CE3   . TRP B 1 67  ? 17.543  35.556  45.011  1.00 65.01  ? 67  TRP B CE3   1 
ATOM   5468  C  CZ2   . TRP B 1 67  ? 19.147  34.117  46.852  1.00 67.17  ? 67  TRP B CZ2   1 
ATOM   5469  C  CZ3   . TRP B 1 67  ? 17.846  36.068  46.259  1.00 68.88  ? 67  TRP B CZ3   1 
ATOM   5470  C  CH2   . TRP B 1 67  ? 18.642  35.349  47.166  1.00 67.31  ? 67  TRP B CH2   1 
ATOM   5471  N  N     . SER B 1 68  ? 16.741  33.359  38.845  1.00 71.49  ? 68  SER B N     1 
ATOM   5472  C  CA    . SER B 1 68  ? 15.799  33.272  37.738  1.00 77.36  ? 68  SER B CA    1 
ATOM   5473  C  C     . SER B 1 68  ? 16.123  32.057  36.869  1.00 78.27  ? 68  SER B C     1 
ATOM   5474  O  O     . SER B 1 68  ? 17.296  31.777  36.605  1.00 73.17  ? 68  SER B O     1 
ATOM   5475  C  CB    . SER B 1 68  ? 15.824  34.557  36.905  1.00 75.26  ? 68  SER B CB    1 
ATOM   5476  O  OG    . SER B 1 68  ? 15.463  35.680  37.691  1.00 71.34  ? 68  SER B OG    1 
ATOM   5477  N  N     . PRO B 1 69  ? 15.082  31.323  36.430  1.00 85.14  ? 69  PRO B N     1 
ATOM   5478  C  CA    . PRO B 1 69  ? 15.277  30.163  35.549  1.00 85.44  ? 69  PRO B CA    1 
ATOM   5479  C  C     . PRO B 1 69  ? 15.883  30.586  34.217  1.00 84.04  ? 69  PRO B C     1 
ATOM   5480  O  O     . PRO B 1 69  ? 15.539  31.660  33.721  1.00 81.55  ? 69  PRO B O     1 
ATOM   5481  C  CB    . PRO B 1 69  ? 13.854  29.620  35.351  1.00 80.39  ? 69  PRO B CB    1 
ATOM   5482  C  CG    . PRO B 1 69  ? 13.043  30.217  36.469  1.00 83.61  ? 69  PRO B CG    1 
ATOM   5483  C  CD    . PRO B 1 69  ? 13.658  31.559  36.726  1.00 80.76  ? 69  PRO B CD    1 
ATOM   5484  N  N     . PRO B 1 70  ? 16.772  29.757  33.640  1.00 85.75  ? 70  PRO B N     1 
ATOM   5485  C  CA    . PRO B 1 70  ? 17.453  30.116  32.387  1.00 86.54  ? 70  PRO B CA    1 
ATOM   5486  C  C     . PRO B 1 70  ? 16.484  30.429  31.246  1.00 86.02  ? 70  PRO B C     1 
ATOM   5487  O  O     . PRO B 1 70  ? 16.845  31.129  30.298  1.00 85.34  ? 70  PRO B O     1 
ATOM   5488  C  CB    . PRO B 1 70  ? 18.288  28.869  32.073  1.00 82.21  ? 70  PRO B CB    1 
ATOM   5489  C  CG    . PRO B 1 70  ? 18.514  28.228  33.407  1.00 82.77  ? 70  PRO B CG    1 
ATOM   5490  C  CD    . PRO B 1 70  ? 17.237  28.464  34.170  1.00 84.06  ? 70  PRO B CD    1 
ATOM   5491  N  N     . GLU B 1 71  ? 15.266  29.911  31.357  1.00 81.49  ? 71  GLU B N     1 
ATOM   5492  C  CA    . GLU B 1 71  ? 14.221  30.124  30.364  1.00 87.70  ? 71  GLU B CA    1 
ATOM   5493  C  C     . GLU B 1 71  ? 13.812  31.590  30.215  1.00 87.82  ? 71  GLU B C     1 
ATOM   5494  O  O     . GLU B 1 71  ? 13.294  31.986  29.168  1.00 87.43  ? 71  GLU B O     1 
ATOM   5495  C  CB    . GLU B 1 71  ? 13.001  29.261  30.699  1.00 90.95  ? 71  GLU B CB    1 
ATOM   5496  C  CG    . GLU B 1 71  ? 13.134  27.804  30.241  1.00 96.84  ? 71  GLU B CG    1 
ATOM   5497  C  CD    . GLU B 1 71  ? 14.186  27.013  31.008  1.00 96.48  ? 71  GLU B CD    1 
ATOM   5498  O  OE1   . GLU B 1 71  ? 14.553  25.909  30.543  1.00 101.28 ? 71  GLU B OE1   1 
ATOM   5499  O  OE2   . GLU B 1 71  ? 14.654  27.492  32.066  1.00 97.28  ? 71  GLU B OE2   1 
ATOM   5500  N  N     . VAL B 1 72  ? 14.027  32.395  31.253  1.00 85.82  ? 72  VAL B N     1 
ATOM   5501  C  CA    . VAL B 1 72  ? 13.642  33.804  31.181  1.00 87.03  ? 72  VAL B CA    1 
ATOM   5502  C  C     . VAL B 1 72  ? 14.887  34.650  30.957  1.00 80.49  ? 72  VAL B C     1 
ATOM   5503  O  O     . VAL B 1 72  ? 14.805  35.861  30.757  1.00 79.22  ? 72  VAL B O     1 
ATOM   5504  C  CB    . VAL B 1 72  ? 12.909  34.290  32.457  1.00 89.69  ? 72  VAL B CB    1 
ATOM   5505  C  CG1   . VAL B 1 72  ? 11.634  33.484  32.685  1.00 90.30  ? 72  VAL B CG1   1 
ATOM   5506  C  CG2   . VAL B 1 72  ? 13.823  34.211  33.670  1.00 81.76  ? 72  VAL B CG2   1 
ATOM   5507  N  N     . LEU B 1 73  ? 16.044  33.999  30.987  1.00 81.15  ? 73  LEU B N     1 
ATOM   5508  C  CA    . LEU B 1 73  ? 17.303  34.680  30.727  1.00 81.34  ? 73  LEU B CA    1 
ATOM   5509  C  C     . LEU B 1 73  ? 17.508  34.878  29.224  1.00 80.02  ? 73  LEU B C     1 
ATOM   5510  O  O     . LEU B 1 73  ? 17.038  34.080  28.406  1.00 77.29  ? 73  LEU B O     1 
ATOM   5511  C  CB    . LEU B 1 73  ? 18.480  33.899  31.327  1.00 75.10  ? 73  LEU B CB    1 
ATOM   5512  C  CG    . LEU B 1 73  ? 18.542  33.829  32.858  1.00 77.84  ? 73  LEU B CG    1 
ATOM   5513  C  CD1   . LEU B 1 73  ? 19.647  32.909  33.349  1.00 72.86  ? 73  LEU B CD1   1 
ATOM   5514  C  CD2   . LEU B 1 73  ? 18.723  35.208  33.429  1.00 75.39  ? 73  LEU B CD2   1 
ATOM   5515  N  N     . VAL B 1 74  ? 18.197  35.960  28.878  1.00 75.85  ? 74  VAL B N     1 
ATOM   5516  C  CA    . VAL B 1 74  ? 18.669  36.205  27.521  1.00 70.39  ? 74  VAL B CA    1 
ATOM   5517  C  C     . VAL B 1 74  ? 20.078  35.631  27.408  1.00 70.11  ? 74  VAL B C     1 
ATOM   5518  O  O     . VAL B 1 74  ? 21.037  36.242  27.888  1.00 68.77  ? 74  VAL B O     1 
ATOM   5519  C  CB    . VAL B 1 74  ? 18.670  37.717  27.196  1.00 71.32  ? 74  VAL B CB    1 
ATOM   5520  C  CG1   . VAL B 1 74  ? 19.090  37.971  25.751  1.00 67.24  ? 74  VAL B CG1   1 
ATOM   5521  C  CG2   . VAL B 1 74  ? 17.297  38.316  27.492  1.00 61.84  ? 74  VAL B CG2   1 
ATOM   5522  N  N     . LEU B 1 75  ? 20.200  34.462  26.780  1.00 69.07  ? 75  LEU B N     1 
ATOM   5523  C  CA    . LEU B 1 75  ? 21.419  33.647  26.870  1.00 61.40  ? 75  LEU B CA    1 
ATOM   5524  C  C     . LEU B 1 75  ? 22.543  34.039  25.908  1.00 62.41  ? 75  LEU B C     1 
ATOM   5525  O  O     . LEU B 1 75  ? 23.721  33.800  26.192  1.00 64.89  ? 75  LEU B O     1 
ATOM   5526  C  CB    . LEU B 1 75  ? 21.063  32.176  26.660  1.00 67.61  ? 75  LEU B CB    1 
ATOM   5527  C  CG    . LEU B 1 75  ? 20.075  31.648  27.699  1.00 69.52  ? 75  LEU B CG    1 
ATOM   5528  C  CD1   . LEU B 1 75  ? 19.736  30.183  27.460  1.00 66.65  ? 75  LEU B CD1   1 
ATOM   5529  C  CD2   . LEU B 1 75  ? 20.644  31.857  29.094  1.00 71.03  ? 75  LEU B CD2   1 
ATOM   5530  N  N     . GLU B 1 76  ? 22.186  34.626  24.769  1.00 67.65  ? 76  GLU B N     1 
ATOM   5531  C  CA    . GLU B 1 76  ? 23.189  35.175  23.860  1.00 67.62  ? 76  GLU B CA    1 
ATOM   5532  C  C     . GLU B 1 76  ? 22.821  36.615  23.524  1.00 69.59  ? 76  GLU B C     1 
ATOM   5533  O  O     . GLU B 1 76  ? 21.640  36.936  23.355  1.00 72.61  ? 76  GLU B O     1 
ATOM   5534  C  CB    . GLU B 1 76  ? 23.314  34.325  22.586  1.00 62.47  ? 76  GLU B CB    1 
ATOM   5535  C  CG    . GLU B 1 76  ? 22.028  34.164  21.780  1.00 61.07  ? 76  GLU B CG    1 
ATOM   5536  C  CD    . GLU B 1 76  ? 22.201  33.242  20.567  1.00 59.49  ? 76  GLU B CD    1 
ATOM   5537  O  OE1   . GLU B 1 76  ? 22.151  33.743  19.416  1.00 57.95  ? 76  GLU B OE1   1 
ATOM   5538  O  OE2   . GLU B 1 76  ? 22.385  32.019  20.763  1.00 45.10  ? 76  GLU B OE2   1 
ATOM   5539  N  N     . GLY B 1 77  ? 23.821  37.488  23.438  1.00 66.37  ? 77  GLY B N     1 
ATOM   5540  C  CA    . GLY B 1 77  ? 23.526  38.891  23.195  1.00 69.71  ? 77  GLY B CA    1 
ATOM   5541  C  C     . GLY B 1 77  ? 24.757  39.759  23.031  1.00 69.39  ? 77  GLY B C     1 
ATOM   5542  O  O     . GLY B 1 77  ? 25.864  39.247  22.876  1.00 67.36  ? 77  GLY B O     1 
ATOM   5543  N  N     . THR B 1 78  ? 24.566  41.076  23.058  1.00 68.03  ? 78  THR B N     1 
ATOM   5544  C  CA    . THR B 1 78  ? 25.692  41.996  22.926  1.00 70.32  ? 78  THR B CA    1 
ATOM   5545  C  C     . THR B 1 78  ? 25.791  42.990  24.080  1.00 73.61  ? 78  THR B C     1 
ATOM   5546  O  O     . THR B 1 78  ? 24.890  43.117  24.912  1.00 75.25  ? 78  THR B O     1 
ATOM   5547  C  CB    . THR B 1 78  ? 25.639  42.793  21.607  1.00 65.22  ? 78  THR B CB    1 
ATOM   5548  O  OG1   . THR B 1 78  ? 24.359  43.424  21.484  1.00 70.20  ? 78  THR B OG1   1 
ATOM   5549  C  CG2   . THR B 1 78  ? 25.864  41.875  20.417  1.00 64.62  ? 78  THR B CG2   1 
ATOM   5550  N  N     . LEU B 1 79  ? 26.911  43.697  24.087  1.00 73.23  ? 79  LEU B N     1 
ATOM   5551  C  CA    . LEU B 1 79  ? 27.400  44.484  25.205  1.00 77.56  ? 79  LEU B CA    1 
ATOM   5552  C  C     . LEU B 1 79  ? 28.154  45.664  24.623  1.00 77.87  ? 79  LEU B C     1 
ATOM   5553  O  O     . LEU B 1 79  ? 28.883  45.505  23.642  1.00 68.08  ? 79  LEU B O     1 
ATOM   5554  C  CB    . LEU B 1 79  ? 28.341  43.652  26.090  1.00 71.26  ? 79  LEU B CB    1 
ATOM   5555  C  CG    . LEU B 1 79  ? 27.958  43.228  27.508  1.00 73.59  ? 79  LEU B CG    1 
ATOM   5556  C  CD1   . LEU B 1 79  ? 26.674  42.413  27.524  1.00 74.16  ? 79  LEU B CD1   1 
ATOM   5557  C  CD2   . LEU B 1 79  ? 29.101  42.438  28.119  1.00 68.39  ? 79  LEU B CD2   1 
ATOM   5558  N  N     . ALA B 1 80  ? 27.985  46.841  25.213  1.00 76.32  ? 80  ALA B N     1 
ATOM   5559  C  CA    . ALA B 1 80  ? 28.754  47.999  24.787  1.00 71.49  ? 80  ALA B CA    1 
ATOM   5560  C  C     . ALA B 1 80  ? 29.517  48.583  25.972  1.00 69.47  ? 80  ALA B C     1 
ATOM   5561  O  O     . ALA B 1 80  ? 28.912  49.055  26.934  1.00 68.95  ? 80  ALA B O     1 
ATOM   5562  C  CB    . ALA B 1 80  ? 27.841  49.046  24.155  1.00 71.31  ? 80  ALA B CB    1 
ATOM   5563  N  N     . ARG B 1 81  ? 30.844  48.530  25.907  1.00 62.03  ? 81  ARG B N     1 
ATOM   5564  C  CA    . ARG B 1 81  ? 31.682  49.158  26.921  1.00 68.20  ? 81  ARG B CA    1 
ATOM   5565  C  C     . ARG B 1 81  ? 32.786  50.010  26.295  1.00 68.19  ? 81  ARG B C     1 
ATOM   5566  O  O     . ARG B 1 81  ? 33.642  49.502  25.557  1.00 64.50  ? 81  ARG B O     1 
ATOM   5567  C  CB    . ARG B 1 81  ? 32.298  48.104  27.854  1.00 69.45  ? 81  ARG B CB    1 
ATOM   5568  C  CG    . ARG B 1 81  ? 33.153  48.717  28.952  1.00 70.66  ? 81  ARG B CG    1 
ATOM   5569  C  CD    . ARG B 1 81  ? 33.251  47.835  30.182  1.00 78.63  ? 81  ARG B CD    1 
ATOM   5570  N  NE    . ARG B 1 81  ? 33.873  48.552  31.294  1.00 79.27  ? 81  ARG B NE    1 
ATOM   5571  C  CZ    . ARG B 1 81  ? 35.184  48.612  31.502  1.00 82.23  ? 81  ARG B CZ    1 
ATOM   5572  N  NH1   . ARG B 1 81  ? 36.018  47.988  30.678  1.00 82.17  ? 81  ARG B NH1   1 
ATOM   5573  N  NH2   . ARG B 1 81  ? 35.660  49.292  32.537  1.00 77.72  ? 81  ARG B NH2   1 
ATOM   5574  N  N     . MET B 1 82  ? 32.747  51.308  26.600  1.00 72.91  ? 82  MET B N     1 
ATOM   5575  C  CA    . MET B 1 82  ? 33.742  52.270  26.134  1.00 68.14  ? 82  MET B CA    1 
ATOM   5576  C  C     . MET B 1 82  ? 33.976  52.167  24.626  1.00 63.98  ? 82  MET B C     1 
ATOM   5577  O  O     . MET B 1 82  ? 35.113  52.041  24.166  1.00 64.95  ? 82  MET B O     1 
ATOM   5578  C  CB    . MET B 1 82  ? 35.049  52.078  26.891  1.00 64.34  ? 82  MET B CB    1 
ATOM   5579  N  N     . GLY B 1 83  ? 32.892  52.207  23.862  1.00 65.38  ? 83  GLY B N     1 
ATOM   5580  C  CA    . GLY B 1 83  ? 32.989  52.154  22.415  1.00 65.96  ? 83  GLY B CA    1 
ATOM   5581  C  C     . GLY B 1 83  ? 33.076  50.752  21.823  1.00 66.78  ? 83  GLY B C     1 
ATOM   5582  O  O     . GLY B 1 83  ? 32.809  50.565  20.636  1.00 62.69  ? 83  GLY B O     1 
ATOM   5583  N  N     . GLN B 1 84  ? 33.440  49.763  22.637  1.00 62.70  ? 84  GLN B N     1 
ATOM   5584  C  CA    . GLN B 1 84  ? 33.641  48.410  22.117  1.00 68.91  ? 84  GLN B CA    1 
ATOM   5585  C  C     . GLN B 1 84  ? 32.387  47.536  22.289  1.00 70.52  ? 84  GLN B C     1 
ATOM   5586  O  O     . GLN B 1 84  ? 31.723  47.566  23.330  1.00 67.47  ? 84  GLN B O     1 
ATOM   5587  C  CB    . GLN B 1 84  ? 34.858  47.754  22.794  1.00 65.63  ? 84  GLN B CB    1 
ATOM   5588  C  CG    . GLN B 1 84  ? 35.352  46.477  22.106  1.00 70.26  ? 84  GLN B CG    1 
ATOM   5589  C  CD    . GLN B 1 84  ? 36.777  46.084  22.503  1.00 73.92  ? 84  GLN B CD    1 
ATOM   5590  O  OE1   . GLN B 1 84  ? 37.494  46.848  23.159  1.00 71.40  ? 84  GLN B OE1   1 
ATOM   5591  N  NE2   . GLN B 1 84  ? 37.193  44.885  22.100  1.00 70.80  ? 84  GLN B NE2   1 
ATOM   5592  N  N     . THR B 1 85  ? 32.054  46.776  21.250  1.00 72.97  ? 85  THR B N     1 
ATOM   5593  C  CA    . THR B 1 85  ? 30.943  45.833  21.323  1.00 66.34  ? 85  THR B CA    1 
ATOM   5594  C  C     . THR B 1 85  ? 31.462  44.420  21.597  1.00 67.84  ? 85  THR B C     1 
ATOM   5595  O  O     . THR B 1 85  ? 32.420  43.974  20.975  1.00 68.57  ? 85  THR B O     1 
ATOM   5596  C  CB    . THR B 1 85  ? 30.109  45.842  20.030  1.00 75.27  ? 85  THR B CB    1 
ATOM   5597  O  OG1   . THR B 1 85  ? 29.531  47.141  19.839  1.00 74.55  ? 85  THR B OG1   1 
ATOM   5598  C  CG2   . THR B 1 85  ? 28.990  44.799  20.100  1.00 70.73  ? 85  THR B CG2   1 
ATOM   5599  N  N     . TYR B 1 86  ? 30.845  43.739  22.557  1.00 66.46  ? 86  TYR B N     1 
ATOM   5600  C  CA    . TYR B 1 86  ? 31.148  42.347  22.853  1.00 64.88  ? 86  TYR B CA    1 
ATOM   5601  C  C     . TYR B 1 86  ? 29.900  41.505  22.635  1.00 66.43  ? 86  TYR B C     1 
ATOM   5602  O  O     . TYR B 1 86  ? 28.807  41.921  22.994  1.00 63.57  ? 86  TYR B O     1 
ATOM   5603  C  CB    . TYR B 1 86  ? 31.638  42.179  24.298  1.00 63.72  ? 86  TYR B CB    1 
ATOM   5604  C  CG    . TYR B 1 86  ? 32.988  42.794  24.587  1.00 65.62  ? 86  TYR B CG    1 
ATOM   5605  C  CD1   . TYR B 1 86  ? 33.103  44.129  24.960  1.00 62.12  ? 86  TYR B CD1   1 
ATOM   5606  C  CD2   . TYR B 1 86  ? 34.147  42.037  24.497  1.00 64.64  ? 86  TYR B CD2   1 
ATOM   5607  C  CE1   . TYR B 1 86  ? 34.339  44.693  25.235  1.00 63.12  ? 86  TYR B CE1   1 
ATOM   5608  C  CE2   . TYR B 1 86  ? 35.391  42.594  24.764  1.00 68.51  ? 86  TYR B CE2   1 
ATOM   5609  C  CZ    . TYR B 1 86  ? 35.480  43.922  25.134  1.00 67.23  ? 86  TYR B CZ    1 
ATOM   5610  O  OH    . TYR B 1 86  ? 36.714  44.476  25.400  1.00 68.79  ? 86  TYR B OH    1 
ATOM   5611  N  N     . ALA B 1 87  ? 30.052  40.332  22.032  1.00 62.78  ? 87  ALA B N     1 
ATOM   5612  C  CA    . ALA B 1 87  ? 29.006  39.320  22.107  1.00 63.00  ? 87  ALA B CA    1 
ATOM   5613  C  C     . ALA B 1 87  ? 29.260  38.519  23.377  1.00 59.36  ? 87  ALA B C     1 
ATOM   5614  O  O     . ALA B 1 87  ? 30.407  38.341  23.782  1.00 52.17  ? 87  ALA B O     1 
ATOM   5615  C  CB    . ALA B 1 87  ? 29.002  38.412  20.864  1.00 51.05  ? 87  ALA B CB    1 
ATOM   5616  N  N     . TYR B 1 88  ? 28.190  38.079  24.028  1.00 64.12  ? 88  TYR B N     1 
ATOM   5617  C  CA    . TYR B 1 88  ? 28.294  37.150  25.144  1.00 59.06  ? 88  TYR B CA    1 
ATOM   5618  C  C     . TYR B 1 88  ? 27.403  35.938  24.872  1.00 61.70  ? 88  TYR B C     1 
ATOM   5619  O  O     . TYR B 1 88  ? 26.319  36.053  24.256  1.00 56.52  ? 88  TYR B O     1 
ATOM   5620  C  CB    . TYR B 1 88  ? 27.900  37.813  26.473  1.00 57.04  ? 88  TYR B CB    1 
ATOM   5621  C  CG    . TYR B 1 88  ? 26.405  37.989  26.658  1.00 63.98  ? 88  TYR B CG    1 
ATOM   5622  C  CD1   . TYR B 1 88  ? 25.628  36.993  27.251  1.00 65.34  ? 88  TYR B CD1   1 
ATOM   5623  C  CD2   . TYR B 1 88  ? 25.769  39.146  26.241  1.00 64.18  ? 88  TYR B CD2   1 
ATOM   5624  C  CE1   . TYR B 1 88  ? 24.258  37.151  27.413  1.00 64.13  ? 88  TYR B CE1   1 
ATOM   5625  C  CE2   . TYR B 1 88  ? 24.408  39.313  26.409  1.00 66.81  ? 88  TYR B CE2   1 
ATOM   5626  C  CZ    . TYR B 1 88  ? 23.656  38.314  26.991  1.00 65.64  ? 88  TYR B CZ    1 
ATOM   5627  O  OH    . TYR B 1 88  ? 22.299  38.490  27.149  1.00 68.23  ? 88  TYR B OH    1 
ATOM   5628  N  N     . ARG B 1 89  ? 27.874  34.787  25.349  1.00 60.01  ? 89  ARG B N     1 
ATOM   5629  C  CA    . ARG B 1 89  ? 27.131  33.535  25.285  1.00 60.88  ? 89  ARG B CA    1 
ATOM   5630  C  C     . ARG B 1 89  ? 27.143  32.880  26.664  1.00 62.18  ? 89  ARG B C     1 
ATOM   5631  O  O     . ARG B 1 89  ? 28.194  32.755  27.300  1.00 55.19  ? 89  ARG B O     1 
ATOM   5632  C  CB    . ARG B 1 89  ? 27.725  32.600  24.219  1.00 59.50  ? 89  ARG B CB    1 
ATOM   5633  C  CG    . ARG B 1 89  ? 27.542  33.110  22.781  1.00 60.38  ? 89  ARG B CG    1 
ATOM   5634  C  CD    . ARG B 1 89  ? 28.205  32.197  21.749  1.00 57.70  ? 89  ARG B CD    1 
ATOM   5635  N  NE    . ARG B 1 89  ? 29.653  32.080  21.932  1.00 57.69  ? 89  ARG B NE    1 
ATOM   5636  C  CZ    . ARG B 1 89  ? 30.556  32.842  21.321  1.00 55.49  ? 89  ARG B CZ    1 
ATOM   5637  N  NH1   . ARG B 1 89  ? 30.173  33.806  20.483  1.00 50.22  ? 89  ARG B NH1   1 
ATOM   5638  N  NH2   . ARG B 1 89  ? 31.845  32.644  21.555  1.00 57.11  ? 89  ARG B NH2   1 
ATOM   5639  N  N     . LEU B 1 90  ? 25.968  32.480  27.135  1.00 62.68  ? 90  LEU B N     1 
ATOM   5640  C  CA    . LEU B 1 90  ? 25.858  31.913  28.474  1.00 63.93  ? 90  LEU B CA    1 
ATOM   5641  C  C     . LEU B 1 90  ? 25.539  30.423  28.418  1.00 64.69  ? 90  LEU B C     1 
ATOM   5642  O  O     . LEU B 1 90  ? 24.744  29.983  27.590  1.00 61.00  ? 90  LEU B O     1 
ATOM   5643  C  CB    . LEU B 1 90  ? 24.786  32.658  29.272  1.00 63.24  ? 90  LEU B CB    1 
ATOM   5644  C  CG    . LEU B 1 90  ? 24.947  34.184  29.272  1.00 64.70  ? 90  LEU B CG    1 
ATOM   5645  C  CD1   . LEU B 1 90  ? 23.796  34.841  30.006  1.00 54.60  ? 90  LEU B CD1   1 
ATOM   5646  C  CD2   . LEU B 1 90  ? 26.294  34.593  29.873  1.00 54.14  ? 90  LEU B CD2   1 
ATOM   5647  N  N     . TYR B 1 91  ? 26.160  29.643  29.295  1.00 65.47  ? 91  TYR B N     1 
ATOM   5648  C  CA    . TYR B 1 91  ? 25.842  28.222  29.357  1.00 67.43  ? 91  TYR B CA    1 
ATOM   5649  C  C     . TYR B 1 91  ? 25.376  27.814  30.747  1.00 63.45  ? 91  TYR B C     1 
ATOM   5650  O  O     . TYR B 1 91  ? 26.182  27.711  31.676  1.00 65.28  ? 91  TYR B O     1 
ATOM   5651  C  CB    . TYR B 1 91  ? 27.046  27.383  28.907  1.00 62.00  ? 91  TYR B CB    1 
ATOM   5652  C  CG    . TYR B 1 91  ? 27.387  27.657  27.465  1.00 60.41  ? 91  TYR B CG    1 
ATOM   5653  C  CD1   . TYR B 1 91  ? 26.591  27.164  26.437  1.00 58.39  ? 91  TYR B CD1   1 
ATOM   5654  C  CD2   . TYR B 1 91  ? 28.479  28.447  27.130  1.00 62.55  ? 91  TYR B CD2   1 
ATOM   5655  C  CE1   . TYR B 1 91  ? 26.883  27.437  25.110  1.00 57.88  ? 91  TYR B CE1   1 
ATOM   5656  C  CE2   . TYR B 1 91  ? 28.780  28.727  25.818  1.00 58.22  ? 91  TYR B CE2   1 
ATOM   5657  C  CZ    . TYR B 1 91  ? 27.980  28.219  24.806  1.00 61.32  ? 91  TYR B CZ    1 
ATOM   5658  O  OH    . TYR B 1 91  ? 28.279  28.498  23.489  1.00 61.56  ? 91  TYR B OH    1 
ATOM   5659  N  N     . PRO B 1 92  ? 24.056  27.610  30.887  1.00 65.14  ? 92  PRO B N     1 
ATOM   5660  C  CA    . PRO B 1 92  ? 23.456  27.072  32.111  1.00 68.17  ? 92  PRO B CA    1 
ATOM   5661  C  C     . PRO B 1 92  ? 24.111  25.750  32.493  1.00 69.91  ? 92  PRO B C     1 
ATOM   5662  O  O     . PRO B 1 92  ? 23.926  24.754  31.792  1.00 72.81  ? 92  PRO B O     1 
ATOM   5663  C  CB    . PRO B 1 92  ? 21.981  26.878  31.734  1.00 71.23  ? 92  PRO B CB    1 
ATOM   5664  C  CG    . PRO B 1 92  ? 21.744  27.808  30.587  1.00 62.05  ? 92  PRO B CG    1 
ATOM   5665  C  CD    . PRO B 1 92  ? 23.049  27.917  29.854  1.00 63.89  ? 92  PRO B CD    1 
ATOM   5666  N  N     . LYS B 1 93  ? 24.891  25.756  33.571  1.00 72.39  ? 93  LYS B N     1 
ATOM   5667  C  CA    . LYS B 1 93  ? 25.567  24.554  34.049  1.00 75.45  ? 93  LYS B CA    1 
ATOM   5668  C  C     . LYS B 1 93  ? 24.838  23.884  35.215  1.00 78.37  ? 93  LYS B C     1 
ATOM   5669  O  O     . LYS B 1 93  ? 25.468  23.237  36.056  1.00 81.16  ? 93  LYS B O     1 
ATOM   5670  C  CB    . LYS B 1 93  ? 27.009  24.878  34.448  1.00 69.99  ? 93  LYS B CB    1 
ATOM   5671  C  CG    . LYS B 1 93  ? 27.890  25.235  33.259  1.00 74.87  ? 93  LYS B CG    1 
ATOM   5672  C  CD    . LYS B 1 93  ? 27.898  24.077  32.272  1.00 71.99  ? 93  LYS B CD    1 
ATOM   5673  C  CE    . LYS B 1 93  ? 28.694  24.371  31.012  1.00 74.48  ? 93  LYS B CE    1 
ATOM   5674  N  NZ    . LYS B 1 93  ? 28.418  23.317  29.976  1.00 62.45  ? 93  LYS B NZ    1 
ATOM   5675  N  N     . GLY B 1 94  ? 23.518  24.049  35.271  1.00 72.36  ? 94  GLY B N     1 
ATOM   5676  C  CA    . GLY B 1 94  ? 22.733  23.509  36.368  1.00 73.75  ? 94  GLY B CA    1 
ATOM   5677  C  C     . GLY B 1 94  ? 22.796  24.380  37.614  1.00 89.03  ? 94  GLY B C     1 
ATOM   5678  O  O     . GLY B 1 94  ? 23.001  25.593  37.524  1.00 87.24  ? 94  GLY B O     1 
ATOM   5679  N  N     . ARG B 1 95  ? 22.640  23.760  38.781  1.00 91.36  ? 95  ARG B N     1 
ATOM   5680  C  CA    . ARG B 1 95  ? 22.624  24.492  40.048  1.00 87.35  ? 95  ARG B CA    1 
ATOM   5681  C  C     . ARG B 1 95  ? 23.840  24.264  40.935  1.00 90.14  ? 95  ARG B C     1 
ATOM   5682  O  O     . ARG B 1 95  ? 24.449  23.196  40.909  1.00 93.57  ? 95  ARG B O     1 
ATOM   5683  C  CB    . ARG B 1 95  ? 21.366  24.143  40.840  1.00 82.18  ? 95  ARG B CB    1 
ATOM   5684  C  CG    . ARG B 1 95  ? 20.176  24.964  40.424  1.00 83.54  ? 95  ARG B CG    1 
ATOM   5685  C  CD    . ARG B 1 95  ? 18.931  24.574  41.172  1.00 85.27  ? 95  ARG B CD    1 
ATOM   5686  N  NE    . ARG B 1 95  ? 17.955  25.654  41.100  1.00 88.22  ? 95  ARG B NE    1 
ATOM   5687  C  CZ    . ARG B 1 95  ? 16.702  25.565  41.526  1.00 91.33  ? 95  ARG B CZ    1 
ATOM   5688  N  NH1   . ARG B 1 95  ? 15.893  26.609  41.419  1.00 88.36  ? 95  ARG B NH1   1 
ATOM   5689  N  NH2   . ARG B 1 95  ? 16.262  24.436  42.067  1.00 100.04 ? 95  ARG B NH2   1 
ATOM   5690  N  N     . ARG B 1 96  ? 24.194  25.277  41.722  1.00 88.50  ? 96  ARG B N     1 
ATOM   5691  C  CA    . ARG B 1 96  ? 25.336  25.141  42.622  1.00 95.36  ? 96  ARG B CA    1 
ATOM   5692  C  C     . ARG B 1 96  ? 24.936  25.490  44.052  1.00 95.97  ? 96  ARG B C     1 
ATOM   5693  O  O     . ARG B 1 96  ? 24.441  26.588  44.308  1.00 94.01  ? 96  ARG B O     1 
ATOM   5694  C  CB    . ARG B 1 96  ? 26.502  26.032  42.177  1.00 94.76  ? 96  ARG B CB    1 
ATOM   5695  C  CG    . ARG B 1 96  ? 27.639  26.094  43.196  1.00 92.93  ? 96  ARG B CG    1 
ATOM   5696  C  CD    . ARG B 1 96  ? 28.729  27.080  42.799  1.00 91.52  ? 96  ARG B CD    1 
ATOM   5697  N  NE    . ARG B 1 96  ? 29.668  27.304  43.899  1.00 91.06  ? 96  ARG B NE    1 
ATOM   5698  C  CZ    . ARG B 1 96  ? 30.740  28.090  43.833  1.00 94.47  ? 96  ARG B CZ    1 
ATOM   5699  N  NH1   . ARG B 1 96  ? 31.024  28.745  42.715  1.00 99.06  ? 96  ARG B NH1   1 
ATOM   5700  N  NH2   . ARG B 1 96  ? 31.529  28.227  44.892  1.00 94.57  ? 96  ARG B NH2   1 
ATOM   5701  N  N     . PRO B 1 97  ? 25.142  24.549  44.988  1.00 97.44  ? 97  PRO B N     1 
ATOM   5702  C  CA    . PRO B 1 97  ? 24.839  24.792  46.403  1.00 91.14  ? 97  PRO B CA    1 
ATOM   5703  C  C     . PRO B 1 97  ? 25.865  25.724  47.034  1.00 93.12  ? 97  PRO B C     1 
ATOM   5704  O  O     . PRO B 1 97  ? 27.070  25.484  46.921  1.00 90.35  ? 97  PRO B O     1 
ATOM   5705  C  CB    . PRO B 1 97  ? 24.909  23.393  47.030  1.00 92.56  ? 97  PRO B CB    1 
ATOM   5706  C  CG    . PRO B 1 97  ? 24.804  22.440  45.873  1.00 95.68  ? 97  PRO B CG    1 
ATOM   5707  C  CD    . PRO B 1 97  ? 25.485  23.140  44.738  1.00 96.16  ? 97  PRO B CD    1 
ATOM   5708  N  N     . LEU B 1 98  ? 25.393  26.778  47.691  1.00 91.50  ? 98  LEU B N     1 
ATOM   5709  C  CA    . LEU B 1 98  ? 26.290  27.732  48.330  1.00 89.26  ? 98  LEU B CA    1 
ATOM   5710  C  C     . LEU B 1 98  ? 26.100  27.696  49.846  1.00 86.45  ? 98  LEU B C     1 
ATOM   5711  O  O     . LEU B 1 98  ? 24.970  27.632  50.335  1.00 84.52  ? 98  LEU B O     1 
ATOM   5712  C  CB    . LEU B 1 98  ? 26.053  29.137  47.770  1.00 85.25  ? 98  LEU B CB    1 
ATOM   5713  C  CG    . LEU B 1 98  ? 26.573  29.314  46.338  1.00 86.54  ? 98  LEU B CG    1 
ATOM   5714  C  CD1   . LEU B 1 98  ? 26.398  30.737  45.854  1.00 79.11  ? 98  LEU B CD1   1 
ATOM   5715  C  CD2   . LEU B 1 98  ? 28.025  28.889  46.226  1.00 85.61  ? 98  LEU B CD2   1 
ATOM   5716  N  N     . ASP B 1 99  ? 27.211  27.722  50.580  1.00 85.62  ? 99  ASP B N     1 
ATOM   5717  C  CA    . ASP B 1 99  ? 27.191  27.618  52.037  1.00 87.83  ? 99  ASP B CA    1 
ATOM   5718  C  C     . ASP B 1 99  ? 27.307  28.977  52.722  1.00 85.80  ? 99  ASP B C     1 
ATOM   5719  O  O     . ASP B 1 99  ? 28.358  29.617  52.671  1.00 88.02  ? 99  ASP B O     1 
ATOM   5720  C  CB    . ASP B 1 99  ? 28.327  26.706  52.510  1.00 89.79  ? 99  ASP B CB    1 
ATOM   5721  C  CG    . ASP B 1 99  ? 28.252  26.398  53.992  1.00 92.34  ? 99  ASP B CG    1 
ATOM   5722  O  OD1   . ASP B 1 99  ? 27.168  26.583  54.592  1.00 90.96  ? 99  ASP B OD1   1 
ATOM   5723  O  OD2   . ASP B 1 99  ? 29.285  25.971  54.555  1.00 93.66  ? 99  ASP B OD2   1 
ATOM   5724  N  N     . PRO B 1 100 ? 26.215  29.417  53.367  1.00 83.89  ? 100 PRO B N     1 
ATOM   5725  C  CA    . PRO B 1 100 ? 26.128  30.692  54.090  1.00 83.76  ? 100 PRO B CA    1 
ATOM   5726  C  C     . PRO B 1 100 ? 27.203  30.896  55.163  1.00 83.83  ? 100 PRO B C     1 
ATOM   5727  O  O     . PRO B 1 100 ? 27.469  32.045  55.515  1.00 83.46  ? 100 PRO B O     1 
ATOM   5728  C  CB    . PRO B 1 100 ? 24.736  30.632  54.728  1.00 82.98  ? 100 PRO B CB    1 
ATOM   5729  C  CG    . PRO B 1 100 ? 23.950  29.753  53.817  1.00 80.34  ? 100 PRO B CG    1 
ATOM   5730  C  CD    . PRO B 1 100 ? 24.922  28.709  53.348  1.00 84.77  ? 100 PRO B CD    1 
ATOM   5731  N  N     . LYS B 1 101 ? 27.812  29.825  55.669  1.00 84.72  ? 101 LYS B N     1 
ATOM   5732  C  CA    . LYS B 1 101 ? 28.886  29.974  56.652  1.00 84.14  ? 101 LYS B CA    1 
ATOM   5733  C  C     . LYS B 1 101 ? 30.179  30.427  55.982  1.00 84.37  ? 101 LYS B C     1 
ATOM   5734  O  O     . LYS B 1 101 ? 31.083  30.952  56.635  1.00 86.04  ? 101 LYS B O     1 
ATOM   5735  C  CB    . LYS B 1 101 ? 29.131  28.672  57.419  1.00 88.16  ? 101 LYS B CB    1 
ATOM   5736  C  CG    . LYS B 1 101 ? 27.982  28.204  58.298  1.00 89.62  ? 101 LYS B CG    1 
ATOM   5737  C  CD    . LYS B 1 101 ? 28.379  26.948  59.072  1.00 94.79  ? 101 LYS B CD    1 
ATOM   5738  C  CE    . LYS B 1 101 ? 27.251  26.444  59.957  1.00 99.97  ? 101 LYS B CE    1 
ATOM   5739  N  NZ    . LYS B 1 101 ? 26.090  25.970  59.150  1.00 100.17 ? 101 LYS B NZ    1 
ATOM   5740  N  N     . ASP B 1 102 ? 30.256  30.214  54.674  1.00 82.60  ? 102 ASP B N     1 
ATOM   5741  C  CA    . ASP B 1 102 ? 31.434  30.568  53.895  1.00 81.77  ? 102 ASP B CA    1 
ATOM   5742  C  C     . ASP B 1 102 ? 31.305  31.998  53.374  1.00 84.79  ? 102 ASP B C     1 
ATOM   5743  O  O     . ASP B 1 102 ? 30.358  32.314  52.649  1.00 83.65  ? 102 ASP B O     1 
ATOM   5744  C  CB    . ASP B 1 102 ? 31.614  29.584  52.736  1.00 85.44  ? 102 ASP B CB    1 
ATOM   5745  C  CG    . ASP B 1 102 ? 32.858  29.862  51.914  1.00 84.25  ? 102 ASP B CG    1 
ATOM   5746  O  OD1   . ASP B 1 102 ? 33.851  30.378  52.472  1.00 84.14  ? 102 ASP B OD1   1 
ATOM   5747  O  OD2   . ASP B 1 102 ? 32.838  29.564  50.702  1.00 88.64  ? 102 ASP B OD2   1 
ATOM   5748  N  N     . PRO B 1 103 ? 32.242  32.874  53.772  1.00 81.30  ? 103 PRO B N     1 
ATOM   5749  C  CA    . PRO B 1 103 ? 32.234  34.301  53.418  1.00 83.74  ? 103 PRO B CA    1 
ATOM   5750  C  C     . PRO B 1 103 ? 31.985  34.604  51.931  1.00 82.29  ? 103 PRO B C     1 
ATOM   5751  O  O     . PRO B 1 103 ? 31.099  35.406  51.628  1.00 78.20  ? 103 PRO B O     1 
ATOM   5752  C  CB    . PRO B 1 103 ? 33.631  34.758  53.841  1.00 80.27  ? 103 PRO B CB    1 
ATOM   5753  C  CG    . PRO B 1 103 ? 33.938  33.894  55.024  1.00 78.44  ? 103 PRO B CG    1 
ATOM   5754  C  CD    . PRO B 1 103 ? 33.344  32.547  54.696  1.00 80.91  ? 103 PRO B CD    1 
ATOM   5755  N  N     . GLY B 1 104 ? 32.746  33.991  51.027  1.00 82.15  ? 104 GLY B N     1 
ATOM   5756  C  CA    . GLY B 1 104 ? 32.599  34.262  49.604  1.00 74.89  ? 104 GLY B CA    1 
ATOM   5757  C  C     . GLY B 1 104 ? 31.240  33.860  49.057  1.00 75.60  ? 104 GLY B C     1 
ATOM   5758  O  O     . GLY B 1 104 ? 30.584  34.616  48.316  1.00 79.99  ? 104 GLY B O     1 
ATOM   5759  N  N     . GLU B 1 105 ? 30.809  32.660  49.425  1.00 73.03  ? 105 GLU B N     1 
ATOM   5760  C  CA    . GLU B 1 105 ? 29.532  32.145  48.948  1.00 83.09  ? 105 GLU B CA    1 
ATOM   5761  C  C     . GLU B 1 105 ? 28.398  33.007  49.503  1.00 75.34  ? 105 GLU B C     1 
ATOM   5762  O  O     . GLU B 1 105 ? 27.421  33.303  48.796  1.00 74.97  ? 105 GLU B O     1 
ATOM   5763  C  CB    . GLU B 1 105 ? 29.367  30.672  49.334  1.00 84.21  ? 105 GLU B CB    1 
ATOM   5764  C  CG    . GLU B 1 105 ? 30.399  29.777  48.650  1.00 85.92  ? 105 GLU B CG    1 
ATOM   5765  C  CD    . GLU B 1 105 ? 30.264  28.310  49.006  1.00 89.92  ? 105 GLU B CD    1 
ATOM   5766  O  OE1   . GLU B 1 105 ? 29.286  27.942  49.688  1.00 91.47  ? 105 GLU B OE1   1 
ATOM   5767  O  OE2   . GLU B 1 105 ? 31.150  27.523  48.610  1.00 95.29  ? 105 GLU B OE2   1 
ATOM   5768  N  N     . ARG B 1 106 ? 28.539  33.413  50.766  1.00 77.34  ? 106 ARG B N     1 
ATOM   5769  C  CA    . ARG B 1 106 ? 27.565  34.297  51.397  1.00 75.07  ? 106 ARG B CA    1 
ATOM   5770  C  C     . ARG B 1 106 ? 27.539  35.628  50.661  1.00 72.67  ? 106 ARG B C     1 
ATOM   5771  O  O     . ARG B 1 106 ? 26.494  36.262  50.562  1.00 73.97  ? 106 ARG B O     1 
ATOM   5772  C  CB    . ARG B 1 106 ? 27.879  34.529  52.877  1.00 76.02  ? 106 ARG B CB    1 
ATOM   5773  C  CG    . ARG B 1 106 ? 26.654  34.934  53.699  1.00 75.12  ? 106 ARG B CG    1 
ATOM   5774  C  CD    . ARG B 1 106 ? 26.997  35.771  54.922  1.00 74.01  ? 106 ARG B CD    1 
ATOM   5775  N  NE    . ARG B 1 106 ? 28.129  35.248  55.681  1.00 80.99  ? 106 ARG B NE    1 
ATOM   5776  C  CZ    . ARG B 1 106 ? 29.303  35.865  55.775  1.00 84.67  ? 106 ARG B CZ    1 
ATOM   5777  N  NH1   . ARG B 1 106 ? 29.492  37.022  55.154  1.00 85.41  ? 106 ARG B NH1   1 
ATOM   5778  N  NH2   . ARG B 1 106 ? 30.288  35.328  56.484  1.00 80.88  ? 106 ARG B NH2   1 
ATOM   5779  N  N     . SER B 1 107 ? 28.694  36.042  50.145  1.00 69.23  ? 107 SER B N     1 
ATOM   5780  C  CA    . SER B 1 107 ? 28.787  37.278  49.373  1.00 69.93  ? 107 SER B CA    1 
ATOM   5781  C  C     . SER B 1 107 ? 27.988  37.146  48.083  1.00 69.30  ? 107 SER B C     1 
ATOM   5782  O  O     . SER B 1 107 ? 27.344  38.109  47.629  1.00 66.69  ? 107 SER B O     1 
ATOM   5783  C  CB    . SER B 1 107 ? 30.245  37.620  49.072  1.00 61.15  ? 107 SER B CB    1 
ATOM   5784  N  N     . VAL B 1 108 ? 28.021  35.953  47.493  1.00 64.89  ? 108 VAL B N     1 
ATOM   5785  C  CA    . VAL B 1 108 ? 27.199  35.704  46.311  1.00 62.80  ? 108 VAL B CA    1 
ATOM   5786  C  C     . VAL B 1 108 ? 25.721  35.800  46.668  1.00 64.60  ? 108 VAL B C     1 
ATOM   5787  O  O     . VAL B 1 108 ? 24.959  36.512  46.007  1.00 60.49  ? 108 VAL B O     1 
ATOM   5788  C  CB    . VAL B 1 108 ? 27.480  34.318  45.677  1.00 65.43  ? 108 VAL B CB    1 
ATOM   5789  C  CG1   . VAL B 1 108 ? 26.526  34.050  44.522  1.00 54.66  ? 108 VAL B CG1   1 
ATOM   5790  C  CG2   . VAL B 1 108 ? 28.921  34.234  45.206  1.00 67.25  ? 108 VAL B CG2   1 
ATOM   5791  N  N     . LEU B 1 109 ? 25.322  35.091  47.720  1.00 67.39  ? 109 LEU B N     1 
ATOM   5792  C  CA    . LEU B 1 109 ? 23.920  35.092  48.145  1.00 66.19  ? 109 LEU B CA    1 
ATOM   5793  C  C     . LEU B 1 109 ? 23.415  36.506  48.450  1.00 64.41  ? 109 LEU B C     1 
ATOM   5794  O  O     . LEU B 1 109 ? 22.297  36.871  48.086  1.00 60.58  ? 109 LEU B O     1 
ATOM   5795  C  CB    . LEU B 1 109 ? 23.742  34.186  49.366  1.00 71.62  ? 109 LEU B CB    1 
ATOM   5796  C  CG    . LEU B 1 109 ? 23.834  32.684  49.081  1.00 72.16  ? 109 LEU B CG    1 
ATOM   5797  C  CD1   . LEU B 1 109 ? 23.853  31.877  50.371  1.00 70.18  ? 109 LEU B CD1   1 
ATOM   5798  C  CD2   . LEU B 1 109 ? 22.679  32.250  48.183  1.00 68.99  ? 109 LEU B CD2   1 
ATOM   5799  N  N     . SER B 1 110 ? 24.254  37.294  49.119  1.00 62.24  ? 110 SER B N     1 
ATOM   5800  C  CA    . SER B 1 110 ? 23.922  38.664  49.474  1.00 62.70  ? 110 SER B CA    1 
ATOM   5801  C  C     . SER B 1 110 ? 23.794  39.535  48.235  1.00 60.79  ? 110 SER B C     1 
ATOM   5802  O  O     . SER B 1 110 ? 22.920  40.402  48.168  1.00 59.57  ? 110 SER B O     1 
ATOM   5803  C  CB    . SER B 1 110 ? 24.965  39.242  50.426  1.00 60.88  ? 110 SER B CB    1 
ATOM   5804  O  OG    . SER B 1 110 ? 24.884  38.612  51.691  1.00 64.91  ? 110 SER B OG    1 
ATOM   5805  N  N     . ALA B 1 111 ? 24.684  39.334  47.267  1.00 63.83  ? 111 ALA B N     1 
ATOM   5806  C  CA    . ALA B 1 111 ? 24.584  40.085  46.018  1.00 62.55  ? 111 ALA B CA    1 
ATOM   5807  C  C     . ALA B 1 111 ? 23.263  39.752  45.333  1.00 55.42  ? 111 ALA B C     1 
ATOM   5808  O  O     . ALA B 1 111 ? 22.595  40.630  44.768  1.00 60.42  ? 111 ALA B O     1 
ATOM   5809  C  CB    . ALA B 1 111 ? 25.765  39.782  45.102  1.00 54.69  ? 111 ALA B CB    1 
ATOM   5810  N  N     . LEU B 1 112 ? 22.884  38.479  45.405  1.00 57.80  ? 112 LEU B N     1 
ATOM   5811  C  CA    . LEU B 1 112 ? 21.595  38.032  44.878  1.00 62.53  ? 112 LEU B CA    1 
ATOM   5812  C  C     . LEU B 1 112 ? 20.425  38.714  45.591  1.00 58.20  ? 112 LEU B C     1 
ATOM   5813  O  O     . LEU B 1 112 ? 19.470  39.163  44.947  1.00 60.94  ? 112 LEU B O     1 
ATOM   5814  C  CB    . LEU B 1 112 ? 21.463  36.510  44.997  1.00 63.79  ? 112 LEU B CB    1 
ATOM   5815  C  CG    . LEU B 1 112 ? 22.256  35.637  44.022  1.00 64.92  ? 112 LEU B CG    1 
ATOM   5816  C  CD1   . LEU B 1 112 ? 22.163  34.176  44.417  1.00 63.53  ? 112 LEU B CD1   1 
ATOM   5817  C  CD2   . LEU B 1 112 ? 21.727  35.827  42.609  1.00 64.98  ? 112 LEU B CD2   1 
ATOM   5818  N  N     . ALA B 1 113 ? 20.507  38.794  46.916  1.00 54.12  ? 113 ALA B N     1 
ATOM   5819  C  CA    . ALA B 1 113 ? 19.481  39.466  47.709  1.00 61.95  ? 113 ALA B CA    1 
ATOM   5820  C  C     . ALA B 1 113 ? 19.345  40.931  47.293  1.00 60.32  ? 113 ALA B C     1 
ATOM   5821  O  O     . ALA B 1 113 ? 18.233  41.423  47.084  1.00 62.94  ? 113 ALA B O     1 
ATOM   5822  C  CB    . ALA B 1 113 ? 19.797  39.355  49.191  1.00 57.93  ? 113 ALA B CB    1 
ATOM   5823  N  N     . ARG B 1 114 ? 20.481  41.609  47.162  1.00 55.92  ? 114 ARG B N     1 
ATOM   5824  C  CA    . ARG B 1 114 ? 20.523  43.002  46.721  1.00 61.54  ? 114 ARG B CA    1 
ATOM   5825  C  C     . ARG B 1 114 ? 19.844  43.181  45.377  1.00 62.74  ? 114 ARG B C     1 
ATOM   5826  O  O     . ARG B 1 114 ? 19.061  44.118  45.183  1.00 61.03  ? 114 ARG B O     1 
ATOM   5827  C  CB    . ARG B 1 114 ? 21.970  43.493  46.633  1.00 58.91  ? 114 ARG B CB    1 
ATOM   5828  C  CG    . ARG B 1 114 ? 22.350  44.491  47.693  1.00 67.64  ? 114 ARG B CG    1 
ATOM   5829  C  CD    . ARG B 1 114 ? 23.769  44.252  48.135  1.00 73.46  ? 114 ARG B CD    1 
ATOM   5830  N  NE    . ARG B 1 114 ? 24.076  44.904  49.403  1.00 75.18  ? 114 ARG B NE    1 
ATOM   5831  C  CZ    . ARG B 1 114 ? 24.997  44.466  50.255  1.00 82.85  ? 114 ARG B CZ    1 
ATOM   5832  N  NH1   . ARG B 1 114 ? 25.695  43.373  49.971  1.00 84.61  ? 114 ARG B NH1   1 
ATOM   5833  N  NH2   . ARG B 1 114 ? 25.219  45.115  51.392  1.00 79.61  ? 114 ARG B NH2   1 
ATOM   5834  N  N     . ARG B 1 115 ? 20.171  42.295  44.440  1.00 62.98  ? 115 ARG B N     1 
ATOM   5835  C  CA    . ARG B 1 115 ? 19.574  42.347  43.106  1.00 68.27  ? 115 ARG B CA    1 
ATOM   5836  C  C     . ARG B 1 115 ? 18.057  42.140  43.177  1.00 66.18  ? 115 ARG B C     1 
ATOM   5837  O  O     . ARG B 1 115 ? 17.285  42.801  42.479  1.00 70.38  ? 115 ARG B O     1 
ATOM   5838  C  CB    . ARG B 1 115 ? 20.211  41.294  42.196  1.00 72.18  ? 115 ARG B CB    1 
ATOM   5839  C  CG    . ARG B 1 115 ? 19.596  41.230  40.813  1.00 73.22  ? 115 ARG B CG    1 
ATOM   5840  C  CD    . ARG B 1 115 ? 19.731  42.578  40.147  1.00 78.47  ? 115 ARG B CD    1 
ATOM   5841  N  NE    . ARG B 1 115 ? 21.129  43.000  40.122  1.00 86.78  ? 115 ARG B NE    1 
ATOM   5842  C  CZ    . ARG B 1 115 ? 21.531  44.208  39.746  1.00 94.13  ? 115 ARG B CZ    1 
ATOM   5843  N  NH1   . ARG B 1 115 ? 20.632  45.119  39.401  1.00 90.94  ? 115 ARG B NH1   1 
ATOM   5844  N  NH2   . ARG B 1 115 ? 22.823  44.513  39.745  1.00 96.96  ? 115 ARG B NH2   1 
ATOM   5845  N  N     . LEU B 1 116 ? 17.643  41.214  44.032  1.00 65.57  ? 116 LEU B N     1 
ATOM   5846  C  CA    . LEU B 1 116 ? 16.232  40.962  44.286  1.00 65.06  ? 116 LEU B CA    1 
ATOM   5847  C  C     . LEU B 1 116 ? 15.539  42.249  44.753  1.00 69.48  ? 116 LEU B C     1 
ATOM   5848  O  O     . LEU B 1 116 ? 14.503  42.653  44.202  1.00 64.99  ? 116 LEU B O     1 
ATOM   5849  C  CB    . LEU B 1 116 ? 16.087  39.838  45.320  1.00 60.52  ? 116 LEU B CB    1 
ATOM   5850  C  CG    . LEU B 1 116 ? 14.727  39.185  45.612  1.00 76.35  ? 116 LEU B CG    1 
ATOM   5851  C  CD1   . LEU B 1 116 ? 13.885  40.031  46.558  1.00 75.52  ? 116 LEU B CD1   1 
ATOM   5852  C  CD2   . LEU B 1 116 ? 13.958  38.894  44.329  1.00 69.57  ? 116 LEU B CD2   1 
ATOM   5853  N  N     . LEU B 1 117 ? 16.130  42.896  45.756  1.00 69.44  ? 117 LEU B N     1 
ATOM   5854  C  CA    . LEU B 1 117 ? 15.584  44.133  46.304  1.00 65.33  ? 117 LEU B CA    1 
ATOM   5855  C  C     . LEU B 1 117 ? 15.476  45.199  45.223  1.00 66.09  ? 117 LEU B C     1 
ATOM   5856  O  O     . LEU B 1 117 ? 14.450  45.863  45.099  1.00 68.21  ? 117 LEU B O     1 
ATOM   5857  C  CB    . LEU B 1 117 ? 16.444  44.644  47.467  1.00 65.64  ? 117 LEU B CB    1 
ATOM   5858  C  CG    . LEU B 1 117 ? 16.049  46.016  48.027  1.00 61.44  ? 117 LEU B CG    1 
ATOM   5859  C  CD1   . LEU B 1 117 ? 14.603  46.004  48.487  1.00 61.79  ? 117 LEU B CD1   1 
ATOM   5860  C  CD2   . LEU B 1 117 ? 16.953  46.432  49.171  1.00 58.88  ? 117 LEU B CD2   1 
ATOM   5861  N  N     . GLN B 1 118 ? 16.529  45.348  44.429  1.00 66.67  ? 118 GLN B N     1 
ATOM   5862  C  CA    . GLN B 1 118 ? 16.532  46.364  43.381  1.00 73.41  ? 118 GLN B CA    1 
ATOM   5863  C  C     . GLN B 1 118 ? 15.417  46.100  42.375  1.00 72.77  ? 118 GLN B C     1 
ATOM   5864  O  O     . GLN B 1 118 ? 14.751  47.033  41.908  1.00 67.07  ? 118 GLN B O     1 
ATOM   5865  C  CB    . GLN B 1 118 ? 17.887  46.413  42.673  1.00 72.81  ? 118 GLN B CB    1 
ATOM   5866  C  CG    . GLN B 1 118 ? 17.918  47.353  41.476  1.00 78.68  ? 118 GLN B CG    1 
ATOM   5867  C  CD    . GLN B 1 118 ? 19.321  47.608  40.960  1.00 88.00  ? 118 GLN B CD    1 
ATOM   5868  O  OE1   . GLN B 1 118 ? 20.222  46.780  41.128  1.00 87.04  ? 118 GLN B OE1   1 
ATOM   5869  N  NE2   . GLN B 1 118 ? 19.518  48.764  40.333  1.00 90.33  ? 118 GLN B NE2   1 
ATOM   5870  N  N     . GLU B 1 119 ? 15.211  44.823  42.060  1.00 71.63  ? 119 GLU B N     1 
ATOM   5871  C  CA    . GLU B 1 119 ? 14.183  44.440  41.102  1.00 75.65  ? 119 GLU B CA    1 
ATOM   5872  C  C     . GLU B 1 119 ? 12.793  44.751  41.631  1.00 75.99  ? 119 GLU B C     1 
ATOM   5873  O  O     . GLU B 1 119 ? 11.959  45.309  40.912  1.00 76.74  ? 119 GLU B O     1 
ATOM   5874  C  CB    . GLU B 1 119 ? 14.285  42.951  40.763  1.00 77.51  ? 119 GLU B CB    1 
ATOM   5875  C  CG    . GLU B 1 119 ? 15.540  42.570  39.985  1.00 81.15  ? 119 GLU B CG    1 
ATOM   5876  C  CD    . GLU B 1 119 ? 15.626  43.248  38.629  1.00 84.95  ? 119 GLU B CD    1 
ATOM   5877  O  OE1   . GLU B 1 119 ? 14.561  43.555  38.041  1.00 80.54  ? 119 GLU B OE1   1 
ATOM   5878  O  OE2   . GLU B 1 119 ? 16.762  43.465  38.151  1.00 80.32  ? 119 GLU B OE2   1 
ATOM   5879  N  N     . ARG B 1 120 ? 12.552  44.418  42.894  1.00 73.62  ? 120 ARG B N     1 
ATOM   5880  C  CA    . ARG B 1 120 ? 11.234  44.639  43.460  1.00 72.24  ? 120 ARG B CA    1 
ATOM   5881  C  C     . ARG B 1 120 ? 10.975  46.124  43.676  1.00 76.21  ? 120 ARG B C     1 
ATOM   5882  O  O     . ARG B 1 120 ? 9.823   46.569  43.649  1.00 72.42  ? 120 ARG B O     1 
ATOM   5883  C  CB    . ARG B 1 120 ? 11.075  43.848  44.758  1.00 73.75  ? 120 ARG B CB    1 
ATOM   5884  C  CG    . ARG B 1 120 ? 10.581  42.431  44.479  1.00 77.24  ? 120 ARG B CG    1 
ATOM   5885  C  CD    . ARG B 1 120 ? 10.657  41.487  45.666  1.00 80.24  ? 120 ARG B CD    1 
ATOM   5886  N  NE    . ARG B 1 120 ? 10.434  40.107  45.229  1.00 82.89  ? 120 ARG B NE    1 
ATOM   5887  C  CZ    . ARG B 1 120 ? 10.455  39.042  46.026  1.00 87.68  ? 120 ARG B CZ    1 
ATOM   5888  N  NH1   . ARG B 1 120 ? 10.672  39.184  47.328  1.00 82.87  ? 120 ARG B NH1   1 
ATOM   5889  N  NH2   . ARG B 1 120 ? 10.245  37.830  45.522  1.00 89.62  ? 120 ARG B NH2   1 
ATOM   5890  N  N     . LEU B 1 121 ? 12.048  46.894  43.843  1.00 67.56  ? 121 LEU B N     1 
ATOM   5891  C  CA    . LEU B 1 121 ? 11.936  48.350  43.888  1.00 70.12  ? 121 LEU B CA    1 
ATOM   5892  C  C     . LEU B 1 121 ? 11.578  48.916  42.514  1.00 72.42  ? 121 LEU B C     1 
ATOM   5893  O  O     . LEU B 1 121 ? 10.804  49.871  42.410  1.00 72.00  ? 121 LEU B O     1 
ATOM   5894  C  CB    . LEU B 1 121 ? 13.234  48.983  44.387  1.00 64.27  ? 121 LEU B CB    1 
ATOM   5895  C  CG    . LEU B 1 121 ? 13.555  48.772  45.867  1.00 64.57  ? 121 LEU B CG    1 
ATOM   5896  C  CD1   . LEU B 1 121 ? 14.830  49.494  46.265  1.00 63.76  ? 121 LEU B CD1   1 
ATOM   5897  C  CD2   . LEU B 1 121 ? 12.398  49.219  46.727  1.00 65.23  ? 121 LEU B CD2   1 
ATOM   5898  N  N     . ARG B 1 122 ? 12.145  48.328  41.462  1.00 74.09  ? 122 ARG B N     1 
ATOM   5899  C  CA    . ARG B 1 122 ? 11.977  48.860  40.108  1.00 77.05  ? 122 ARG B CA    1 
ATOM   5900  C  C     . ARG B 1 122 ? 10.539  48.766  39.594  1.00 78.95  ? 122 ARG B C     1 
ATOM   5901  O  O     . ARG B 1 122 ? 10.133  49.552  38.736  1.00 80.62  ? 122 ARG B O     1 
ATOM   5902  C  CB    . ARG B 1 122 ? 12.918  48.149  39.148  1.00 76.68  ? 122 ARG B CB    1 
ATOM   5903  N  N     . ARG B 1 123 ? 9.743   47.880  40.165  1.00 76.73  ? 123 ARG B N     1 
ATOM   5904  C  CA    . ARG B 1 123 ? 8.392   47.638  39.675  1.00 84.55  ? 123 ARG B CA    1 
ATOM   5905  C  C     . ARG B 1 123 ? 7.312   48.451  40.372  1.00 83.89  ? 123 ARG B C     1 
ATOM   5906  O  O     . ARG B 1 123 ? 6.133   48.206  40.222  1.00 85.38  ? 123 ARG B O     1 
ATOM   5907  C  CB    . ARG B 1 123 ? 8.064   46.150  39.752  1.00 85.29  ? 123 ARG B CB    1 
ATOM   5908  C  CG    . ARG B 1 123 ? 7.433   45.688  41.054  1.00 87.17  ? 123 ARG B CG    1 
ATOM   5909  C  CD    . ARG B 1 123 ? 7.113   44.213  40.981  1.00 89.64  ? 123 ARG B CD    1 
ATOM   5910  N  NE    . ARG B 1 123 ? 8.182   43.486  40.318  1.00 98.38  ? 123 ARG B NE    1 
ATOM   5911  C  CZ    . ARG B 1 123 ? 8.613   42.305  40.710  1.00 99.94  ? 123 ARG B CZ    1 
ATOM   5912  N  NH1   . ARG B 1 123 ? 8.043   41.722  41.751  1.00 94.16  ? 123 ARG B NH1   1 
ATOM   5913  N  NH2   . ARG B 1 123 ? 9.600   41.710  40.060  1.00 104.43 ? 123 ARG B NH2   1 
ATOM   5914  N  N     . LEU B 1 124 ? 7.736   49.367  41.195  1.00 76.04  ? 124 LEU B N     1 
ATOM   5915  C  CA    . LEU B 1 124 ? 6.831   50.089  42.079  1.00 76.37  ? 124 LEU B CA    1 
ATOM   5916  C  C     . LEU B 1 124 ? 6.352   51.379  41.420  1.00 80.64  ? 124 LEU B C     1 
ATOM   5917  O  O     . LEU B 1 124 ? 7.076   51.998  40.639  1.00 79.75  ? 124 LEU B O     1 
ATOM   5918  C  CB    . LEU B 1 124 ? 7.509   50.395  43.418  1.00 77.70  ? 124 LEU B CB    1 
ATOM   5919  C  CG    . LEU B 1 124 ? 7.814   49.205  44.338  1.00 78.74  ? 124 LEU B CG    1 
ATOM   5920  C  CD1   . LEU B 1 124 ? 8.580   49.651  45.580  1.00 75.83  ? 124 LEU B CD1   1 
ATOM   5921  C  CD2   . LEU B 1 124 ? 6.538   48.472  44.730  1.00 72.48  ? 124 LEU B CD2   1 
ATOM   5922  N  N     . GLU B 1 125 ? 5.116   51.762  41.722  1.00 82.88  ? 125 GLU B N     1 
ATOM   5923  C  CA    . GLU B 1 125 ? 4.538   53.001  41.216  1.00 83.74  ? 125 GLU B CA    1 
ATOM   5924  C  C     . GLU B 1 125 ? 4.284   53.975  42.366  1.00 84.98  ? 125 GLU B C     1 
ATOM   5925  O  O     . GLU B 1 125 ? 3.977   53.559  43.484  1.00 83.77  ? 125 GLU B O     1 
ATOM   5926  C  CB    . GLU B 1 125 ? 3.246   52.716  40.458  1.00 85.91  ? 125 GLU B CB    1 
ATOM   5927  N  N     . GLY B 1 126 ? 4.440   55.268  42.104  1.00 84.77  ? 126 GLY B N     1 
ATOM   5928  C  CA    . GLY B 1 126 ? 4.110   56.275  43.096  1.00 86.68  ? 126 GLY B CA    1 
ATOM   5929  C  C     . GLY B 1 126 ? 5.308   56.681  43.925  1.00 87.01  ? 126 GLY B C     1 
ATOM   5930  O  O     . GLY B 1 126 ? 5.389   57.811  44.405  1.00 90.34  ? 126 GLY B O     1 
ATOM   5931  N  N     . VAL B 1 127 ? 6.239   55.750  44.097  1.00 83.62  ? 127 VAL B N     1 
ATOM   5932  C  CA    . VAL B 1 127 ? 7.475   56.023  44.813  1.00 75.75  ? 127 VAL B CA    1 
ATOM   5933  C  C     . VAL B 1 127 ? 8.512   56.606  43.859  1.00 76.18  ? 127 VAL B C     1 
ATOM   5934  O  O     . VAL B 1 127 ? 8.433   56.402  42.648  1.00 80.27  ? 127 VAL B O     1 
ATOM   5935  C  CB    . VAL B 1 127 ? 7.997   54.758  45.457  1.00 70.95  ? 127 VAL B CB    1 
ATOM   5936  N  N     . TRP B 1 128 ? 9.475   57.342  44.401  1.00 70.91  ? 128 TRP B N     1 
ATOM   5937  C  CA    . TRP B 1 128 ? 10.619  57.790  43.615  1.00 72.49  ? 128 TRP B CA    1 
ATOM   5938  C  C     . TRP B 1 128 ? 11.817  56.909  43.981  1.00 71.79  ? 128 TRP B C     1 
ATOM   5939  O  O     . TRP B 1 128 ? 12.220  56.867  45.142  1.00 70.03  ? 128 TRP B O     1 
ATOM   5940  C  CB    . TRP B 1 128 ? 10.920  59.263  43.877  1.00 72.29  ? 128 TRP B CB    1 
ATOM   5941  C  CG    . TRP B 1 128 ? 11.664  59.912  42.764  1.00 75.08  ? 128 TRP B CG    1 
ATOM   5942  C  CD1   . TRP B 1 128 ? 11.138  60.355  41.583  1.00 82.80  ? 128 TRP B CD1   1 
ATOM   5943  C  CD2   . TRP B 1 128 ? 13.065  60.204  42.715  1.00 75.34  ? 128 TRP B CD2   1 
ATOM   5944  N  NE1   . TRP B 1 128 ? 12.127  60.901  40.800  1.00 86.90  ? 128 TRP B NE1   1 
ATOM   5945  C  CE2   . TRP B 1 128 ? 13.320  60.823  41.472  1.00 79.37  ? 128 TRP B CE2   1 
ATOM   5946  C  CE3   . TRP B 1 128 ? 14.129  60.004  43.598  1.00 75.31  ? 128 TRP B CE3   1 
ATOM   5947  C  CZ2   . TRP B 1 128 ? 14.592  61.244  41.092  1.00 75.62  ? 128 TRP B CZ2   1 
ATOM   5948  C  CZ3   . TRP B 1 128 ? 15.394  60.421  43.220  1.00 80.86  ? 128 TRP B CZ3   1 
ATOM   5949  C  CH2   . TRP B 1 128 ? 15.615  61.032  41.976  1.00 85.90  ? 128 TRP B CH2   1 
ATOM   5950  N  N     . VAL B 1 129 ? 12.377  56.199  43.003  1.00 72.17  ? 129 VAL B N     1 
ATOM   5951  C  CA    . VAL B 1 129 ? 13.415  55.204  43.290  1.00 65.72  ? 129 VAL B CA    1 
ATOM   5952  C  C     . VAL B 1 129 ? 14.790  55.602  42.747  1.00 69.00  ? 129 VAL B C     1 
ATOM   5953  O  O     . VAL B 1 129 ? 14.935  55.993  41.591  1.00 67.86  ? 129 VAL B O     1 
ATOM   5954  C  CB    . VAL B 1 129 ? 13.027  53.820  42.720  1.00 61.44  ? 129 VAL B CB    1 
ATOM   5955  C  CG1   . VAL B 1 129 ? 14.152  52.835  42.887  1.00 69.43  ? 129 VAL B CG1   1 
ATOM   5956  C  CG2   . VAL B 1 129 ? 11.783  53.295  43.413  1.00 69.36  ? 129 VAL B CG2   1 
ATOM   5957  N  N     . GLU B 1 130 ? 15.797  55.500  43.608  1.00 69.48  ? 130 GLU B N     1 
ATOM   5958  C  CA    . GLU B 1 130 ? 17.169  55.827  43.258  1.00 69.80  ? 130 GLU B CA    1 
ATOM   5959  C  C     . GLU B 1 130 ? 18.088  54.790  43.897  1.00 69.82  ? 130 GLU B C     1 
ATOM   5960  O  O     . GLU B 1 130 ? 18.368  54.843  45.097  1.00 66.87  ? 130 GLU B O     1 
ATOM   5961  C  CB    . GLU B 1 130 ? 17.521  57.247  43.711  1.00 73.28  ? 130 GLU B CB    1 
ATOM   5962  C  CG    . GLU B 1 130 ? 18.842  57.786  43.170  1.00 73.83  ? 130 GLU B CG    1 
ATOM   5963  C  CD    . GLU B 1 130 ? 19.035  59.275  43.456  1.00 80.85  ? 130 GLU B CD    1 
ATOM   5964  O  OE1   . GLU B 1 130 ? 18.235  59.851  44.226  1.00 77.11  ? 130 GLU B OE1   1 
ATOM   5965  O  OE2   . GLU B 1 130 ? 19.995  59.871  42.915  1.00 82.07  ? 130 GLU B OE2   1 
ATOM   5966  N  N     . GLY B 1 131 ? 18.506  53.814  43.097  1.00 75.36  ? 131 GLY B N     1 
ATOM   5967  C  CA    . GLY B 1 131 ? 19.352  52.728  43.566  1.00 69.06  ? 131 GLY B CA    1 
ATOM   5968  C  C     . GLY B 1 131 ? 18.594  51.835  44.526  1.00 65.26  ? 131 GLY B C     1 
ATOM   5969  O  O     . GLY B 1 131 ? 17.538  51.306  44.189  1.00 67.90  ? 131 GLY B O     1 
ATOM   5970  N  N     . LEU B 1 132 ? 19.118  51.681  45.735  1.00 63.91  ? 132 LEU B N     1 
ATOM   5971  C  CA    . LEU B 1 132 ? 18.408  50.935  46.762  1.00 63.92  ? 132 LEU B CA    1 
ATOM   5972  C  C     . LEU B 1 132 ? 17.708  51.893  47.729  1.00 61.02  ? 132 LEU B C     1 
ATOM   5973  O  O     . LEU B 1 132 ? 17.404  51.530  48.866  1.00 62.12  ? 132 LEU B O     1 
ATOM   5974  C  CB    . LEU B 1 132 ? 19.367  50.016  47.513  1.00 58.14  ? 132 LEU B CB    1 
ATOM   5975  C  CG    . LEU B 1 132 ? 20.002  48.913  46.659  1.00 67.84  ? 132 LEU B CG    1 
ATOM   5976  C  CD1   . LEU B 1 132 ? 20.974  48.072  47.476  1.00 66.45  ? 132 LEU B CD1   1 
ATOM   5977  C  CD2   . LEU B 1 132 ? 18.940  48.027  46.022  1.00 64.71  ? 132 LEU B CD2   1 
ATOM   5978  N  N     . ALA B 1 133 ? 17.447  53.113  47.270  1.00 58.10  ? 133 ALA B N     1 
ATOM   5979  C  CA    . ALA B 1 133 ? 16.737  54.085  48.096  1.00 66.15  ? 133 ALA B CA    1 
ATOM   5980  C  C     . ALA B 1 133 ? 15.363  54.400  47.508  1.00 65.87  ? 133 ALA B C     1 
ATOM   5981  O  O     . ALA B 1 133 ? 15.220  54.588  46.298  1.00 66.01  ? 133 ALA B O     1 
ATOM   5982  C  CB    . ALA B 1 133 ? 17.559  55.364  48.251  1.00 56.45  ? 133 ALA B CB    1 
ATOM   5983  N  N     . VAL B 1 134 ? 14.359  54.452  48.379  1.00 64.09  ? 134 VAL B N     1 
ATOM   5984  C  CA    . VAL B 1 134 ? 13.008  54.844  47.993  1.00 67.30  ? 134 VAL B CA    1 
ATOM   5985  C  C     . VAL B 1 134 ? 12.557  56.052  48.780  1.00 66.60  ? 134 VAL B C     1 
ATOM   5986  O  O     . VAL B 1 134 ? 12.825  56.163  49.975  1.00 69.71  ? 134 VAL B O     1 
ATOM   5987  C  CB    . VAL B 1 134 ? 11.987  53.710  48.218  1.00 66.30  ? 134 VAL B CB    1 
ATOM   5988  C  CG1   . VAL B 1 134 ? 12.122  52.659  47.142  1.00 70.17  ? 134 VAL B CG1   1 
ATOM   5989  C  CG2   . VAL B 1 134 ? 12.152  53.109  49.615  1.00 60.61  ? 134 VAL B CG2   1 
ATOM   5990  N  N     . TYR B 1 135 ? 11.873  56.959  48.096  1.00 64.96  ? 135 TYR B N     1 
ATOM   5991  C  CA    . TYR B 1 135 ? 11.369  58.171  48.719  1.00 67.22  ? 135 TYR B CA    1 
ATOM   5992  C  C     . TYR B 1 135 ? 9.867   58.273  48.456  1.00 75.83  ? 135 TYR B C     1 
ATOM   5993  O  O     . TYR B 1 135 ? 9.435   58.452  47.314  1.00 71.15  ? 135 TYR B O     1 
ATOM   5994  C  CB    . TYR B 1 135 ? 12.135  59.382  48.182  1.00 66.55  ? 135 TYR B CB    1 
ATOM   5995  C  CG    . TYR B 1 135 ? 13.636  59.239  48.382  1.00 73.67  ? 135 TYR B CG    1 
ATOM   5996  C  CD1   . TYR B 1 135 ? 14.419  58.535  47.469  1.00 66.91  ? 135 TYR B CD1   1 
ATOM   5997  C  CD2   . TYR B 1 135 ? 14.265  59.790  49.490  1.00 67.97  ? 135 TYR B CD2   1 
ATOM   5998  C  CE1   . TYR B 1 135 ? 15.778  58.391  47.655  1.00 68.23  ? 135 TYR B CE1   1 
ATOM   5999  C  CE2   . TYR B 1 135 ? 15.629  59.651  49.682  1.00 66.73  ? 135 TYR B CE2   1 
ATOM   6000  C  CZ    . TYR B 1 135 ? 16.379  58.954  48.763  1.00 65.89  ? 135 TYR B CZ    1 
ATOM   6001  O  OH    . TYR B 1 135 ? 17.733  58.820  48.953  1.00 62.96  ? 135 TYR B OH    1 
ATOM   6002  N  N     . ARG B 1 136 ? 9.075   58.132  49.515  1.00 77.58  ? 136 ARG B N     1 
ATOM   6003  C  CA    . ARG B 1 136 ? 7.623   58.098  49.375  1.00 80.04  ? 136 ARG B CA    1 
ATOM   6004  C  C     . ARG B 1 136 ? 6.975   59.437  49.714  1.00 84.93  ? 136 ARG B C     1 
ATOM   6005  O  O     . ARG B 1 136 ? 6.242   59.999  48.900  1.00 89.67  ? 136 ARG B O     1 
ATOM   6006  C  CB    . ARG B 1 136 ? 7.017   56.995  50.252  1.00 82.15  ? 136 ARG B CB    1 
ATOM   6007  C  CG    . ARG B 1 136 ? 8.028   56.067  50.900  1.00 76.07  ? 136 ARG B CG    1 
ATOM   6008  C  CD    . ARG B 1 136 ? 8.311   56.485  52.341  1.00 86.58  ? 136 ARG B CD    1 
ATOM   6009  N  NE    . ARG B 1 136 ? 7.172   56.248  53.235  1.00 91.43  ? 136 ARG B NE    1 
ATOM   6010  C  CZ    . ARG B 1 136 ? 7.054   56.759  54.460  1.00 90.33  ? 136 ARG B CZ    1 
ATOM   6011  N  NH1   . ARG B 1 136 ? 8.004   57.550  54.952  1.00 86.51  ? 136 ARG B NH1   1 
ATOM   6012  N  NH2   . ARG B 1 136 ? 5.983   56.482  55.196  1.00 86.47  ? 136 ARG B NH2   1 
ATOM   6013  N  N     . ARG B 1 137 ? 7.249   59.955  50.907  1.00 84.58  ? 137 ARG B N     1 
ATOM   6014  C  CA    . ARG B 1 137 ? 6.534   61.134  51.382  1.00 81.25  ? 137 ARG B CA    1 
ATOM   6015  C  C     . ARG B 1 137 ? 7.084   62.386  50.737  1.00 82.59  ? 137 ARG B C     1 
ATOM   6016  O  O     . ARG B 1 137 ? 8.193   62.391  50.216  1.00 80.09  ? 137 ARG B O     1 
ATOM   6017  C  CB    . ARG B 1 137 ? 6.626   61.263  52.903  1.00 82.41  ? 137 ARG B CB    1 
ATOM   6018  C  CG    . ARG B 1 137 ? 5.826   60.236  53.668  1.00 88.36  ? 137 ARG B CG    1 
ATOM   6019  C  CD    . ARG B 1 137 ? 5.833   60.551  55.148  1.00 89.08  ? 137 ARG B CD    1 
ATOM   6020  N  NE    . ARG B 1 137 ? 5.056   59.578  55.909  1.00 93.02  ? 137 ARG B NE    1 
ATOM   6021  C  CZ    . ARG B 1 137 ? 5.065   59.494  57.235  1.00 95.00  ? 137 ARG B CZ    1 
ATOM   6022  N  NH1   . ARG B 1 137 ? 5.806   60.332  57.948  1.00 95.89  ? 137 ARG B NH1   1 
ATOM   6023  N  NH2   . ARG B 1 137 ? 4.331   58.574  57.847  1.00 94.18  ? 137 ARG B NH2   1 
ATOM   6024  N  N     . GLU B 1 138 ? 6.288   63.444  50.743  1.00 83.81  ? 138 GLU B N     1 
ATOM   6025  C  CA    . GLU B 1 138 ? 6.792   64.745  50.351  1.00 80.96  ? 138 GLU B CA    1 
ATOM   6026  C  C     . GLU B 1 138 ? 6.999   65.576  51.614  1.00 81.73  ? 138 GLU B C     1 
ATOM   6027  O  O     . GLU B 1 138 ? 6.144   65.584  52.498  1.00 85.97  ? 138 GLU B O     1 
ATOM   6028  C  CB    . GLU B 1 138 ? 5.849   65.436  49.379  1.00 84.92  ? 138 GLU B CB    1 
ATOM   6029  C  CG    . GLU B 1 138 ? 6.344   66.791  48.961  1.00 85.31  ? 138 GLU B CG    1 
ATOM   6030  C  CD    . GLU B 1 138 ? 5.363   67.517  48.088  1.00 92.94  ? 138 GLU B CD    1 
ATOM   6031  O  OE1   . GLU B 1 138 ? 4.492   66.861  47.476  1.00 104.07 ? 138 GLU B OE1   1 
ATOM   6032  O  OE2   . GLU B 1 138 ? 5.480   68.749  48.003  1.00 92.61  ? 138 GLU B OE2   1 
ATOM   6033  N  N     . HIS B 1 139 ? 8.140   66.251  51.711  1.00 80.01  ? 139 HIS B N     1 
ATOM   6034  C  CA    . HIS B 1 139 ? 8.517   66.926  52.950  1.00 77.42  ? 139 HIS B CA    1 
ATOM   6035  C  C     . HIS B 1 139 ? 8.426   68.442  52.809  1.00 71.34  ? 139 HIS B C     1 
ATOM   6036  O  O     . HIS B 1 139 ? 8.210   69.148  53.792  1.00 67.19  ? 139 HIS B O     1 
ATOM   6037  C  CB    . HIS B 1 139 ? 9.940   66.517  53.357  1.00 67.42  ? 139 HIS B CB    1 
ATOM   6038  C  CG    . HIS B 1 139 ? 10.366  67.031  54.696  1.00 64.18  ? 139 HIS B CG    1 
ATOM   6039  N  ND1   . HIS B 1 139 ? 10.104  66.353  55.871  1.00 67.25  ? 139 HIS B ND1   1 
ATOM   6040  C  CD2   . HIS B 1 139 ? 11.054  68.142  55.052  1.00 66.94  ? 139 HIS B CD2   1 
ATOM   6041  C  CE1   . HIS B 1 139 ? 10.601  67.031  56.888  1.00 66.56  ? 139 HIS B CE1   1 
ATOM   6042  N  NE2   . HIS B 1 139 ? 11.184  68.122  56.419  1.00 64.20  ? 139 HIS B NE2   1 
ATOM   6043  N  N     . ALA B 1 140 ? 8.607   68.930  51.583  1.00 69.45  ? 140 ALA B N     1 
ATOM   6044  C  CA    . ALA B 1 140 ? 8.555   70.359  51.285  1.00 76.38  ? 140 ALA B CA    1 
ATOM   6045  C  C     . ALA B 1 140 ? 8.500   70.554  49.774  1.00 80.94  ? 140 ALA B C     1 
ATOM   6046  O  O     . ALA B 1 140 ? 8.987   69.702  49.030  1.00 82.09  ? 140 ALA B O     1 
ATOM   6047  C  CB    . ALA B 1 140 ? 9.763   71.083  51.879  1.00 73.73  ? 140 ALA B CB    1 
ATOM   6048  N  N     . ARG B 1 141 ? 7.928   71.671  49.321  1.00 77.50  ? 141 ARG B N     1 
ATOM   6049  C  CA    . ARG B 1 141 ? 7.701   71.881  47.888  1.00 83.30  ? 141 ARG B CA    1 
ATOM   6050  C  C     . ARG B 1 141 ? 8.017   73.297  47.400  1.00 86.43  ? 141 ARG B C     1 
ATOM   6051  O  O     . ARG B 1 141 ? 7.942   74.255  48.166  1.00 82.49  ? 141 ARG B O     1 
ATOM   6052  C  CB    . ARG B 1 141 ? 6.253   71.543  47.531  1.00 89.72  ? 141 ARG B CB    1 
ATOM   6053  C  CG    . ARG B 1 141 ? 5.237   71.956  48.589  1.00 94.81  ? 141 ARG B CG    1 
ATOM   6054  C  CD    . ARG B 1 141 ? 3.794   71.683  48.151  1.00 102.06 ? 141 ARG B CD    1 
ATOM   6055  N  NE    . ARG B 1 141 ? 3.298   70.379  48.592  1.00 102.99 ? 141 ARG B NE    1 
ATOM   6056  C  CZ    . ARG B 1 141 ? 2.026   69.997  48.507  1.00 104.64 ? 141 ARG B CZ    1 
ATOM   6057  N  NH1   . ARG B 1 141 ? 1.119   70.822  48.001  1.00 102.85 ? 141 ARG B NH1   1 
ATOM   6058  N  NH2   . ARG B 1 141 ? 1.659   68.794  48.931  1.00 102.33 ? 141 ARG B NH2   1 
ATOM   6059  N  N     . GLY B 1 142 ? 8.342   73.385  46.107  1.00 89.72  ? 142 GLY B N     1 
ATOM   6060  C  CA    . GLY B 1 142 ? 8.621   74.605  45.349  1.00 83.41  ? 142 GLY B CA    1 
ATOM   6061  C  C     . GLY B 1 142 ? 9.207   75.835  46.017  1.00 88.05  ? 142 GLY B C     1 
ATOM   6062  O  O     . GLY B 1 142 ? 9.612   75.797  47.171  1.00 87.83  ? 142 GLY B O     1 
ATOM   6063  N  N     . PRO B 1 143 ? 9.266   76.942  45.281  1.00 92.07  ? 143 PRO B N     1 
ATOM   6064  C  CA    . PRO B 1 143 ? 8.921   76.970  43.864  1.00 88.31  ? 143 PRO B CA    1 
ATOM   6065  C  C     . PRO B 1 143 ? 10.124  76.566  43.005  1.00 86.49  ? 143 PRO B C     1 
ATOM   6066  O  O     . PRO B 1 143 ? 11.138  77.272  42.959  1.00 77.82  ? 143 PRO B O     1 
ATOM   6067  C  CB    . PRO B 1 143 ? 8.429   78.354  43.470  1.00 87.29  ? 143 PRO B CB    1 
ATOM   6068  N  N     . GLY B 1 144 ? 10.008  75.433  42.321  1.00 81.40  ? 144 GLY B N     1 
ATOM   6069  C  CA    . GLY B 1 144 ? 11.059  74.980  41.427  1.00 82.74  ? 144 GLY B CA    1 
ATOM   6070  C  C     . GLY B 1 144 ? 11.870  73.830  42.002  1.00 84.42  ? 144 GLY B C     1 
ATOM   6071  O  O     . GLY B 1 144 ? 12.843  73.376  41.392  1.00 79.68  ? 144 GLY B O     1 
ATOM   6072  N  N     . TRP B 1 145 ? 11.466  73.368  43.184  1.00 86.05  ? 145 TRP B N     1 
ATOM   6073  C  CA    . TRP B 1 145 ? 12.128  72.263  43.872  1.00 80.85  ? 145 TRP B CA    1 
ATOM   6074  C  C     . TRP B 1 145 ? 11.149  71.497  44.757  1.00 80.45  ? 145 TRP B C     1 
ATOM   6075  O  O     . TRP B 1 145 ? 10.035  71.953  44.990  1.00 81.65  ? 145 TRP B O     1 
ATOM   6076  C  CB    . TRP B 1 145 ? 13.305  72.770  44.713  1.00 79.07  ? 145 TRP B CB    1 
ATOM   6077  C  CG    . TRP B 1 145 ? 12.965  73.819  45.751  1.00 80.71  ? 145 TRP B CG    1 
ATOM   6078  C  CD1   . TRP B 1 145 ? 13.104  75.171  45.620  1.00 78.38  ? 145 TRP B CD1   1 
ATOM   6079  C  CD2   . TRP B 1 145 ? 12.430  73.598  47.069  1.00 81.59  ? 145 TRP B CD2   1 
ATOM   6080  N  NE1   . TRP B 1 145 ? 12.700  75.805  46.775  1.00 76.65  ? 145 TRP B NE1   1 
ATOM   6081  C  CE2   . TRP B 1 145 ? 12.284  74.861  47.680  1.00 80.73  ? 145 TRP B CE2   1 
ATOM   6082  C  CE3   . TRP B 1 145 ? 12.067  72.456  47.794  1.00 77.58  ? 145 TRP B CE3   1 
ATOM   6083  C  CZ2   . TRP B 1 145 ? 11.786  75.014  48.977  1.00 75.66  ? 145 TRP B CZ2   1 
ATOM   6084  C  CZ3   . TRP B 1 145 ? 11.571  72.609  49.079  1.00 75.83  ? 145 TRP B CZ3   1 
ATOM   6085  C  CH2   . TRP B 1 145 ? 11.435  73.879  49.656  1.00 74.02  ? 145 TRP B CH2   1 
ATOM   6086  N  N     . ARG B 1 146 ? 11.554  70.326  45.236  1.00 74.96  ? 146 ARG B N     1 
ATOM   6087  C  CA    . ARG B 1 146 ? 10.814  69.661  46.307  1.00 78.83  ? 146 ARG B CA    1 
ATOM   6088  C  C     . ARG B 1 146 ? 11.739  68.718  47.086  1.00 75.64  ? 146 ARG B C     1 
ATOM   6089  O  O     . ARG B 1 146 ? 12.803  68.336  46.602  1.00 68.43  ? 146 ARG B O     1 
ATOM   6090  C  CB    . ARG B 1 146 ? 9.570   68.928  45.761  1.00 78.36  ? 146 ARG B CB    1 
ATOM   6091  C  CG    . ARG B 1 146 ? 9.781   67.647  44.959  1.00 82.35  ? 146 ARG B CG    1 
ATOM   6092  C  CD    . ARG B 1 146 ? 8.467   67.278  44.238  1.00 84.85  ? 146 ARG B CD    1 
ATOM   6093  N  NE    . ARG B 1 146 ? 8.288   65.842  43.999  1.00 90.22  ? 146 ARG B NE    1 
ATOM   6094  C  CZ    . ARG B 1 146 ? 8.859   65.154  43.010  1.00 88.93  ? 146 ARG B CZ    1 
ATOM   6095  N  NH1   . ARG B 1 146 ? 9.678   65.756  42.152  1.00 83.44  ? 146 ARG B NH1   1 
ATOM   6096  N  NH2   . ARG B 1 146 ? 8.618   63.853  42.886  1.00 80.14  ? 146 ARG B NH2   1 
ATOM   6097  N  N     . VAL B 1 147 ? 11.348  68.391  48.313  1.00 76.00  ? 147 VAL B N     1 
ATOM   6098  C  CA    . VAL B 1 147 ? 12.119  67.492  49.161  1.00 70.95  ? 147 VAL B CA    1 
ATOM   6099  C  C     . VAL B 1 147 ? 11.276  66.278  49.534  1.00 69.72  ? 147 VAL B C     1 
ATOM   6100  O  O     . VAL B 1 147 ? 10.203  66.423  50.109  1.00 72.08  ? 147 VAL B O     1 
ATOM   6101  C  CB    . VAL B 1 147 ? 12.607  68.202  50.443  1.00 67.07  ? 147 VAL B CB    1 
ATOM   6102  C  CG1   . VAL B 1 147 ? 13.400  67.241  51.314  1.00 64.39  ? 147 VAL B CG1   1 
ATOM   6103  C  CG2   . VAL B 1 147 ? 13.445  69.413  50.088  1.00 65.97  ? 147 VAL B CG2   1 
ATOM   6104  N  N     . LEU B 1 148 ? 11.758  65.083  49.204  1.00 71.60  ? 148 LEU B N     1 
ATOM   6105  C  CA    . LEU B 1 148 ? 11.028  63.857  49.506  1.00 64.13  ? 148 LEU B CA    1 
ATOM   6106  C  C     . LEU B 1 148 ? 11.620  63.149  50.713  1.00 65.91  ? 148 LEU B C     1 
ATOM   6107  O  O     . LEU B 1 148 ? 12.808  63.273  50.994  1.00 65.08  ? 148 LEU B O     1 
ATOM   6108  C  CB    . LEU B 1 148 ? 11.031  62.912  48.302  1.00 73.34  ? 148 LEU B CB    1 
ATOM   6109  C  CG    . LEU B 1 148 ? 10.487  63.437  46.969  1.00 81.38  ? 148 LEU B CG    1 
ATOM   6110  C  CD1   . LEU B 1 148 ? 10.469  62.332  45.914  1.00 77.26  ? 148 LEU B CD1   1 
ATOM   6111  C  CD2   . LEU B 1 148 ? 9.092   64.032  47.149  1.00 74.05  ? 148 LEU B CD2   1 
ATOM   6112  N  N     . GLY B 1 149 ? 10.781  62.417  51.431  1.00 63.35  ? 149 GLY B N     1 
ATOM   6113  C  CA    . GLY B 1 149 ? 11.227  61.617  52.552  1.00 60.24  ? 149 GLY B CA    1 
ATOM   6114  C  C     . GLY B 1 149 ? 11.074  60.141  52.251  1.00 70.18  ? 149 GLY B C     1 
ATOM   6115  O  O     . GLY B 1 149 ? 10.085  59.720  51.639  1.00 69.89  ? 149 GLY B O     1 
ATOM   6116  N  N     . GLY B 1 150 ? 12.066  59.361  52.672  1.00 69.02  ? 150 GLY B N     1 
ATOM   6117  C  CA    . GLY B 1 150 ? 12.063  57.919  52.502  1.00 62.52  ? 150 GLY B CA    1 
ATOM   6118  C  C     . GLY B 1 150 ? 13.202  57.287  53.282  1.00 64.76  ? 150 GLY B C     1 
ATOM   6119  O  O     . GLY B 1 150 ? 13.457  57.659  54.430  1.00 60.65  ? 150 GLY B O     1 
ATOM   6120  N  N     . ALA B 1 151 ? 13.890  56.328  52.666  1.00 63.78  ? 151 ALA B N     1 
ATOM   6121  C  CA    . ALA B 1 151 ? 14.997  55.647  53.327  1.00 58.57  ? 151 ALA B CA    1 
ATOM   6122  C  C     . ALA B 1 151 ? 15.951  54.979  52.337  1.00 63.54  ? 151 ALA B C     1 
ATOM   6123  O  O     . ALA B 1 151 ? 15.550  54.559  51.251  1.00 58.59  ? 151 ALA B O     1 
ATOM   6124  C  CB    . ALA B 1 151 ? 14.470  54.612  54.314  1.00 56.06  ? 151 ALA B CB    1 
ATOM   6125  N  N     . VAL B 1 152 ? 17.217  54.882  52.734  1.00 56.98  ? 152 VAL B N     1 
ATOM   6126  C  CA    . VAL B 1 152 ? 18.190  54.069  52.029  1.00 54.47  ? 152 VAL B CA    1 
ATOM   6127  C  C     . VAL B 1 152 ? 18.059  52.647  52.555  1.00 49.24  ? 152 VAL B C     1 
ATOM   6128  O  O     . VAL B 1 152 ? 17.980  52.429  53.770  1.00 51.77  ? 152 VAL B O     1 
ATOM   6129  C  CB    . VAL B 1 152 ? 19.630  54.601  52.227  1.00 58.56  ? 152 VAL B CB    1 
ATOM   6130  C  CG1   . VAL B 1 152 ? 20.666  53.601  51.712  1.00 58.87  ? 152 VAL B CG1   1 
ATOM   6131  C  CG2   . VAL B 1 152 ? 19.784  55.956  51.560  1.00 52.52  ? 152 VAL B CG2   1 
ATOM   6132  N  N     . LEU B 1 153 ? 17.979  51.685  51.640  1.00 55.63  ? 153 LEU B N     1 
ATOM   6133  C  CA    . LEU B 1 153 ? 17.739  50.291  52.008  1.00 54.42  ? 153 LEU B CA    1 
ATOM   6134  C  C     . LEU B 1 153 ? 18.903  49.388  51.641  1.00 56.52  ? 153 LEU B C     1 
ATOM   6135  O  O     . LEU B 1 153 ? 19.683  49.700  50.756  1.00 59.20  ? 153 LEU B O     1 
ATOM   6136  C  CB    . LEU B 1 153 ? 16.479  49.757  51.320  1.00 51.69  ? 153 LEU B CB    1 
ATOM   6137  C  CG    . LEU B 1 153 ? 15.136  50.467  51.487  1.00 56.13  ? 153 LEU B CG    1 
ATOM   6138  C  CD1   . LEU B 1 153 ? 14.124  49.854  50.525  1.00 55.18  ? 153 LEU B CD1   1 
ATOM   6139  C  CD2   . LEU B 1 153 ? 14.659  50.302  52.920  1.00 56.63  ? 153 LEU B CD2   1 
ATOM   6140  N  N     . ASP B 1 154 ? 18.973  48.236  52.290  1.00 55.65  ? 154 ASP B N     1 
ATOM   6141  C  CA    . ASP B 1 154 ? 19.886  47.190  51.867  1.00 55.14  ? 154 ASP B CA    1 
ATOM   6142  C  C     . ASP B 1 154 ? 19.264  45.846  52.218  1.00 60.32  ? 154 ASP B C     1 
ATOM   6143  O  O     . ASP B 1 154 ? 18.384  45.763  53.076  1.00 59.41  ? 154 ASP B O     1 
ATOM   6144  C  CB    . ASP B 1 154 ? 21.258  47.357  52.531  1.00 64.47  ? 154 ASP B CB    1 
ATOM   6145  C  CG    . ASP B 1 154 ? 22.358  46.541  51.845  1.00 67.64  ? 154 ASP B CG    1 
ATOM   6146  O  OD1   . ASP B 1 154 ? 22.134  46.022  50.727  1.00 60.14  ? 154 ASP B OD1   1 
ATOM   6147  O  OD2   . ASP B 1 154 ? 23.457  46.428  52.429  1.00 68.51  ? 154 ASP B OD2   1 
ATOM   6148  N  N     . LEU B 1 155 ? 19.682  44.804  51.515  1.00 61.67  ? 155 LEU B N     1 
ATOM   6149  C  CA    . LEU B 1 155 ? 19.172  43.458  51.753  1.00 57.72  ? 155 LEU B CA    1 
ATOM   6150  C  C     . LEU B 1 155 ? 20.293  42.457  51.513  1.00 61.48  ? 155 LEU B C     1 
ATOM   6151  O  O     . LEU B 1 155 ? 20.870  42.401  50.426  1.00 61.16  ? 155 LEU B O     1 
ATOM   6152  C  CB    . LEU B 1 155 ? 17.975  43.145  50.850  1.00 55.08  ? 155 LEU B CB    1 
ATOM   6153  C  CG    . LEU B 1 155 ? 17.259  41.823  51.139  1.00 64.88  ? 155 LEU B CG    1 
ATOM   6154  C  CD1   . LEU B 1 155 ? 16.634  41.835  52.525  1.00 61.27  ? 155 LEU B CD1   1 
ATOM   6155  C  CD2   . LEU B 1 155 ? 16.210  41.518  50.081  1.00 61.73  ? 155 LEU B CD2   1 
ATOM   6156  N  N     . TRP B 1 156 ? 20.627  41.680  52.532  1.00 58.89  ? 156 TRP B N     1 
ATOM   6157  C  CA    . TRP B 1 156 ? 21.684  40.710  52.345  1.00 59.04  ? 156 TRP B CA    1 
ATOM   6158  C  C     . TRP B 1 156 ? 21.362  39.417  53.072  1.00 61.34  ? 156 TRP B C     1 
ATOM   6159  O  O     . TRP B 1 156 ? 20.249  39.235  53.543  1.00 63.30  ? 156 TRP B O     1 
ATOM   6160  C  CB    . TRP B 1 156 ? 23.034  41.283  52.798  1.00 67.30  ? 156 TRP B CB    1 
ATOM   6161  C  CG    . TRP B 1 156 ? 23.210  41.473  54.277  1.00 63.32  ? 156 TRP B CG    1 
ATOM   6162  C  CD1   . TRP B 1 156 ? 23.701  40.565  55.166  1.00 68.10  ? 156 TRP B CD1   1 
ATOM   6163  C  CD2   . TRP B 1 156 ? 22.952  42.666  55.025  1.00 63.20  ? 156 TRP B CD2   1 
ATOM   6164  N  NE1   . TRP B 1 156 ? 23.747  41.110  56.427  1.00 69.60  ? 156 TRP B NE1   1 
ATOM   6165  C  CE2   . TRP B 1 156 ? 23.291  42.402  56.368  1.00 62.37  ? 156 TRP B CE2   1 
ATOM   6166  C  CE3   . TRP B 1 156 ? 22.460  43.930  54.693  1.00 62.73  ? 156 TRP B CE3   1 
ATOM   6167  C  CZ2   . TRP B 1 156 ? 23.152  43.352  57.379  1.00 63.74  ? 156 TRP B CZ2   1 
ATOM   6168  C  CZ3   . TRP B 1 156 ? 22.327  44.875  55.695  1.00 71.20  ? 156 TRP B CZ3   1 
ATOM   6169  C  CH2   . TRP B 1 156 ? 22.673  44.581  57.024  1.00 66.96  ? 156 TRP B CH2   1 
ATOM   6170  N  N     . VAL B 1 157 ? 22.335  38.521  53.167  1.00 59.84  ? 157 VAL B N     1 
ATOM   6171  C  CA    . VAL B 1 157 ? 22.076  37.208  53.736  1.00 67.26  ? 157 VAL B CA    1 
ATOM   6172  C  C     . VAL B 1 157 ? 23.020  36.963  54.902  1.00 68.91  ? 157 VAL B C     1 
ATOM   6173  O  O     . VAL B 1 157 ? 24.219  37.231  54.813  1.00 63.25  ? 157 VAL B O     1 
ATOM   6174  C  CB    . VAL B 1 157 ? 22.228  36.091  52.674  1.00 73.04  ? 157 VAL B CB    1 
ATOM   6175  C  CG1   . VAL B 1 157 ? 21.901  34.737  53.271  1.00 71.83  ? 157 VAL B CG1   1 
ATOM   6176  C  CG2   . VAL B 1 157 ? 21.324  36.371  51.474  1.00 64.40  ? 157 VAL B CG2   1 
ATOM   6177  N  N     . SER B 1 158 ? 22.466  36.437  55.990  1.00 72.15  ? 158 SER B N     1 
ATOM   6178  C  CA    . SER B 1 158 ? 23.195  36.294  57.247  1.00 75.23  ? 158 SER B CA    1 
ATOM   6179  C  C     . SER B 1 158 ? 24.091  35.066  57.280  1.00 77.48  ? 158 SER B C     1 
ATOM   6180  O  O     . SER B 1 158 ? 24.110  34.277  56.336  1.00 80.81  ? 158 SER B O     1 
ATOM   6181  C  CB    . SER B 1 158 ? 22.206  36.242  58.412  1.00 76.15  ? 158 SER B CB    1 
ATOM   6182  O  OG    . SER B 1 158 ? 21.319  35.143  58.277  1.00 78.37  ? 158 SER B OG    1 
ATOM   6183  N  N     . ASP B 1 159 ? 24.833  34.917  58.374  1.00 82.47  ? 159 ASP B N     1 
ATOM   6184  C  CA    . ASP B 1 159 ? 25.658  33.733  58.597  1.00 80.45  ? 159 ASP B CA    1 
ATOM   6185  C  C     . ASP B 1 159 ? 24.768  32.501  58.661  1.00 82.11  ? 159 ASP B C     1 
ATOM   6186  O  O     . ASP B 1 159 ? 25.176  31.405  58.277  1.00 87.00  ? 159 ASP B O     1 
ATOM   6187  C  CB    . ASP B 1 159 ? 26.456  33.855  59.898  1.00 82.87  ? 159 ASP B CB    1 
ATOM   6188  C  CG    . ASP B 1 159 ? 27.078  35.231  60.084  1.00 90.92  ? 159 ASP B CG    1 
ATOM   6189  O  OD1   . ASP B 1 159 ? 28.169  35.309  60.695  1.00 89.37  ? 159 ASP B OD1   1 
ATOM   6190  O  OD2   . ASP B 1 159 ? 26.466  36.234  59.641  1.00 89.43  ? 159 ASP B OD2   1 
ATOM   6191  N  N     . SER B 1 160 ? 23.551  32.697  59.164  1.00 80.99  ? 160 SER B N     1 
ATOM   6192  C  CA    . SER B 1 160 ? 22.594  31.612  59.373  1.00 80.54  ? 160 SER B CA    1 
ATOM   6193  C  C     . SER B 1 160 ? 21.697  31.354  58.160  1.00 82.20  ? 160 SER B C     1 
ATOM   6194  O  O     . SER B 1 160 ? 20.738  30.584  58.241  1.00 84.33  ? 160 SER B O     1 
ATOM   6195  C  CB    . SER B 1 160 ? 21.720  31.913  60.594  1.00 78.17  ? 160 SER B CB    1 
ATOM   6196  O  OG    . SER B 1 160 ? 20.948  33.084  60.390  1.00 82.55  ? 160 SER B OG    1 
ATOM   6197  N  N     . GLY B 1 161 ? 21.986  32.014  57.044  1.00 84.50  ? 161 GLY B N     1 
ATOM   6198  C  CA    . GLY B 1 161 ? 21.236  31.779  55.822  1.00 77.13  ? 161 GLY B CA    1 
ATOM   6199  C  C     . GLY B 1 161 ? 19.821  32.322  55.845  1.00 75.66  ? 161 GLY B C     1 
ATOM   6200  O  O     . GLY B 1 161 ? 18.881  31.656  55.409  1.00 78.42  ? 161 GLY B O     1 
ATOM   6201  N  N     . ALA B 1 162 ? 19.666  33.545  56.342  1.00 76.80  ? 162 ALA B N     1 
ATOM   6202  C  CA    . ALA B 1 162 ? 18.376  34.224  56.291  1.00 71.59  ? 162 ALA B CA    1 
ATOM   6203  C  C     . ALA B 1 162 ? 18.529  35.637  55.743  1.00 70.90  ? 162 ALA B C     1 
ATOM   6204  O  O     . ALA B 1 162 ? 19.615  36.220  55.786  1.00 68.65  ? 162 ALA B O     1 
ATOM   6205  C  CB    . ALA B 1 162 ? 17.730  34.255  57.670  1.00 71.32  ? 162 ALA B CB    1 
ATOM   6206  N  N     . PHE B 1 163 ? 17.437  36.186  55.226  1.00 69.63  ? 163 PHE B N     1 
ATOM   6207  C  CA    . PHE B 1 163 ? 17.461  37.548  54.726  1.00 68.38  ? 163 PHE B CA    1 
ATOM   6208  C  C     . PHE B 1 163 ? 17.597  38.539  55.878  1.00 69.33  ? 163 PHE B C     1 
ATOM   6209  O  O     . PHE B 1 163 ? 17.072  38.321  56.969  1.00 67.80  ? 163 PHE B O     1 
ATOM   6210  C  CB    . PHE B 1 163 ? 16.204  37.837  53.912  1.00 68.22  ? 163 PHE B CB    1 
ATOM   6211  C  CG    . PHE B 1 163 ? 16.182  37.160  52.564  1.00 71.31  ? 163 PHE B CG    1 
ATOM   6212  C  CD1   . PHE B 1 163 ? 16.943  37.646  51.508  1.00 66.98  ? 163 PHE B CD1   1 
ATOM   6213  C  CD2   . PHE B 1 163 ? 15.412  36.021  52.359  1.00 71.87  ? 163 PHE B CD2   1 
ATOM   6214  C  CE1   . PHE B 1 163 ? 16.923  37.020  50.268  1.00 61.96  ? 163 PHE B CE1   1 
ATOM   6215  C  CE2   . PHE B 1 163 ? 15.388  35.393  51.127  1.00 73.44  ? 163 PHE B CE2   1 
ATOM   6216  C  CZ    . PHE B 1 163 ? 16.145  35.893  50.078  1.00 66.73  ? 163 PHE B CZ    1 
ATOM   6217  N  N     . LEU B 1 164 ? 18.335  39.613  55.630  1.00 66.02  ? 164 LEU B N     1 
ATOM   6218  C  CA    . LEU B 1 164 ? 18.466  40.709  56.572  1.00 59.57  ? 164 LEU B CA    1 
ATOM   6219  C  C     . LEU B 1 164 ? 18.185  42.000  55.824  1.00 60.88  ? 164 LEU B C     1 
ATOM   6220  O  O     . LEU B 1 164 ? 18.785  42.270  54.777  1.00 59.08  ? 164 LEU B O     1 
ATOM   6221  C  CB    . LEU B 1 164 ? 19.858  40.737  57.200  1.00 62.62  ? 164 LEU B CB    1 
ATOM   6222  C  CG    . LEU B 1 164 ? 20.077  39.840  58.420  1.00 66.09  ? 164 LEU B CG    1 
ATOM   6223  C  CD1   . LEU B 1 164 ? 21.548  39.794  58.787  1.00 70.82  ? 164 LEU B CD1   1 
ATOM   6224  C  CD2   . LEU B 1 164 ? 19.246  40.333  59.598  1.00 66.31  ? 164 LEU B CD2   1 
ATOM   6225  N  N     . LEU B 1 165 ? 17.264  42.787  56.371  1.00 61.93  ? 165 LEU B N     1 
ATOM   6226  C  CA    . LEU B 1 165 ? 16.851  44.050  55.779  1.00 57.45  ? 165 LEU B CA    1 
ATOM   6227  C  C     . LEU B 1 165 ? 17.486  45.170  56.579  1.00 59.06  ? 165 LEU B C     1 
ATOM   6228  O  O     . LEU B 1 165 ? 17.417  45.168  57.800  1.00 56.01  ? 165 LEU B O     1 
ATOM   6229  C  CB    . LEU B 1 165 ? 15.321  44.189  55.799  1.00 57.76  ? 165 LEU B CB    1 
ATOM   6230  C  CG    . LEU B 1 165 ? 14.555  44.967  54.723  1.00 61.04  ? 165 LEU B CG    1 
ATOM   6231  C  CD1   . LEU B 1 165 ? 13.234  45.503  55.291  1.00 69.20  ? 165 LEU B CD1   1 
ATOM   6232  C  CD2   . LEU B 1 165 ? 15.357  46.087  54.101  1.00 53.86  ? 165 LEU B CD2   1 
ATOM   6233  N  N     . GLU B 1 166 ? 18.114  46.119  55.901  1.00 55.50  ? 166 GLU B N     1 
ATOM   6234  C  CA    . GLU B 1 166 ? 18.604  47.314  56.567  1.00 56.50  ? 166 GLU B CA    1 
ATOM   6235  C  C     . GLU B 1 166 ? 17.824  48.507  56.054  1.00 51.98  ? 166 GLU B C     1 
ATOM   6236  O  O     . GLU B 1 166 ? 17.540  48.610  54.853  1.00 54.68  ? 166 GLU B O     1 
ATOM   6237  C  CB    . GLU B 1 166 ? 20.111  47.516  56.343  1.00 57.03  ? 166 GLU B CB    1 
ATOM   6238  C  CG    . GLU B 1 166 ? 20.695  48.685  57.138  1.00 57.72  ? 166 GLU B CG    1 
ATOM   6239  C  CD    . GLU B 1 166 ? 22.170  48.945  56.839  1.00 72.76  ? 166 GLU B CD    1 
ATOM   6240  O  OE1   . GLU B 1 166 ? 22.692  48.417  55.831  1.00 76.12  ? 166 GLU B OE1   1 
ATOM   6241  O  OE2   . GLU B 1 166 ? 22.808  49.686  57.617  1.00 73.11  ? 166 GLU B OE2   1 
ATOM   6242  N  N     . VAL B 1 167 ? 17.468  49.395  56.977  1.00 49.88  ? 167 VAL B N     1 
ATOM   6243  C  CA    . VAL B 1 167 ? 16.695  50.584  56.660  1.00 49.21  ? 167 VAL B CA    1 
ATOM   6244  C  C     . VAL B 1 167 ? 17.255  51.798  57.378  1.00 45.64  ? 167 VAL B C     1 
ATOM   6245  O  O     . VAL B 1 167 ? 17.479  51.754  58.588  1.00 45.49  ? 167 VAL B O     1 
ATOM   6246  C  CB    . VAL B 1 167 ? 15.204  50.425  57.070  1.00 53.49  ? 167 VAL B CB    1 
ATOM   6247  C  CG1   . VAL B 1 167 ? 14.420  51.672  56.704  1.00 51.24  ? 167 VAL B CG1   1 
ATOM   6248  C  CG2   . VAL B 1 167 ? 14.594  49.176  56.444  1.00 54.29  ? 167 VAL B CG2   1 
ATOM   6249  N  N     . ASP B 1 168 ? 17.472  52.889  56.656  1.00 47.02  ? 168 ASP B N     1 
ATOM   6250  C  CA    . ASP B 1 168 ? 17.777  54.135  57.346  1.00 46.37  ? 168 ASP B CA    1 
ATOM   6251  C  C     . ASP B 1 168 ? 17.129  55.320  56.659  1.00 50.12  ? 168 ASP B C     1 
ATOM   6252  O  O     . ASP B 1 168 ? 17.433  55.614  55.504  1.00 52.77  ? 168 ASP B O     1 
ATOM   6253  C  CB    . ASP B 1 168 ? 19.288  54.375  57.444  1.00 49.58  ? 168 ASP B CB    1 
ATOM   6254  C  CG    . ASP B 1 168 ? 19.648  55.312  58.597  1.00 57.60  ? 168 ASP B CG    1 
ATOM   6255  O  OD1   . ASP B 1 168 ? 18.872  55.371  59.587  1.00 55.20  ? 168 ASP B OD1   1 
ATOM   6256  O  OD2   . ASP B 1 168 ? 20.683  56.011  58.508  1.00 61.70  ? 168 ASP B OD2   1 
ATOM   6257  N  N     . PRO B 1 169 ? 16.234  56.010  57.380  1.00 51.53  ? 169 PRO B N     1 
ATOM   6258  C  CA    . PRO B 1 169 ? 15.525  57.176  56.841  1.00 48.51  ? 169 PRO B CA    1 
ATOM   6259  C  C     . PRO B 1 169 ? 16.456  58.225  56.245  1.00 52.26  ? 169 PRO B C     1 
ATOM   6260  O  O     . PRO B 1 169 ? 17.547  58.480  56.766  1.00 51.52  ? 169 PRO B O     1 
ATOM   6261  C  CB    . PRO B 1 169 ? 14.789  57.724  58.066  1.00 51.32  ? 169 PRO B CB    1 
ATOM   6262  C  CG    . PRO B 1 169 ? 14.492  56.496  58.876  1.00 54.17  ? 169 PRO B CG    1 
ATOM   6263  C  CD    . PRO B 1 169 ? 15.709  55.600  58.698  1.00 49.96  ? 169 PRO B CD    1 
ATOM   6264  N  N     . ALA B 1 170 ? 15.993  58.846  55.170  1.00 54.65  ? 170 ALA B N     1 
ATOM   6265  C  CA    . ALA B 1 170 ? 16.766  59.836  54.438  1.00 47.23  ? 170 ALA B CA    1 
ATOM   6266  C  C     . ALA B 1 170 ? 15.846  60.712  53.593  1.00 54.98  ? 170 ALA B C     1 
ATOM   6267  O  O     . ALA B 1 170 ? 14.791  60.262  53.128  1.00 58.93  ? 170 ALA B O     1 
ATOM   6268  C  CB    . ALA B 1 170 ? 17.807  59.140  53.546  1.00 47.66  ? 170 ALA B CB    1 
ATOM   6269  N  N     . TYR B 1 171 ? 16.260  61.958  53.406  1.00 50.17  ? 171 TYR B N     1 
ATOM   6270  C  CA    . TYR B 1 171 ? 15.572  62.921  52.555  1.00 57.48  ? 171 TYR B CA    1 
ATOM   6271  C  C     . TYR B 1 171 ? 16.290  63.096  51.220  1.00 60.39  ? 171 TYR B C     1 
ATOM   6272  O  O     . TYR B 1 171 ? 17.490  62.839  51.117  1.00 62.85  ? 171 TYR B O     1 
ATOM   6273  C  CB    . TYR B 1 171 ? 15.461  64.279  53.259  1.00 59.56  ? 171 TYR B CB    1 
ATOM   6274  C  CG    . TYR B 1 171 ? 14.595  64.272  54.500  1.00 69.00  ? 171 TYR B CG    1 
ATOM   6275  C  CD1   . TYR B 1 171 ? 13.226  64.024  54.416  1.00 63.33  ? 171 TYR B CD1   1 
ATOM   6276  C  CD2   . TYR B 1 171 ? 15.139  64.539  55.751  1.00 59.85  ? 171 TYR B CD2   1 
ATOM   6277  C  CE1   . TYR B 1 171 ? 12.427  64.024  55.549  1.00 65.54  ? 171 TYR B CE1   1 
ATOM   6278  C  CE2   . TYR B 1 171 ? 14.347  64.546  56.890  1.00 63.74  ? 171 TYR B CE2   1 
ATOM   6279  C  CZ    . TYR B 1 171 ? 12.992  64.291  56.782  1.00 67.53  ? 171 TYR B CZ    1 
ATOM   6280  O  OH    . TYR B 1 171 ? 12.205  64.294  57.909  1.00 63.98  ? 171 TYR B OH    1 
ATOM   6281  N  N     . ARG B 1 172 ? 15.557  63.526  50.195  1.00 63.68  ? 172 ARG B N     1 
ATOM   6282  C  CA    . ARG B 1 172 ? 16.156  63.787  48.889  1.00 61.90  ? 172 ARG B CA    1 
ATOM   6283  C  C     . ARG B 1 172 ? 15.678  65.119  48.320  1.00 66.01  ? 172 ARG B C     1 
ATOM   6284  O  O     . ARG B 1 172 ? 14.491  65.432  48.353  1.00 68.51  ? 172 ARG B O     1 
ATOM   6285  C  CB    . ARG B 1 172 ? 15.843  62.648  47.916  1.00 61.63  ? 172 ARG B CB    1 
ATOM   6286  C  CG    . ARG B 1 172 ? 16.662  62.692  46.631  1.00 67.07  ? 172 ARG B CG    1 
ATOM   6287  C  CD    . ARG B 1 172 ? 18.135  62.335  46.864  1.00 63.38  ? 172 ARG B CD    1 
ATOM   6288  N  NE    . ARG B 1 172 ? 18.837  62.117  45.602  1.00 59.23  ? 172 ARG B NE    1 
ATOM   6289  C  CZ    . ARG B 1 172 ? 19.600  63.021  44.993  1.00 63.37  ? 172 ARG B CZ    1 
ATOM   6290  N  NH1   . ARG B 1 172 ? 19.784  64.222  45.528  1.00 67.07  ? 172 ARG B NH1   1 
ATOM   6291  N  NH2   . ARG B 1 172 ? 20.192  62.721  43.847  1.00 60.42  ? 172 ARG B NH2   1 
ATOM   6292  N  N     . ILE B 1 173 ? 16.616  65.910  47.821  1.00 64.00  ? 173 ILE B N     1 
ATOM   6293  C  CA    . ILE B 1 173 ? 16.304  67.200  47.224  1.00 67.09  ? 173 ILE B CA    1 
ATOM   6294  C  C     . ILE B 1 173 ? 16.243  67.092  45.706  1.00 70.18  ? 173 ILE B C     1 
ATOM   6295  O  O     . ILE B 1 173 ? 17.204  66.658  45.074  1.00 69.95  ? 173 ILE B O     1 
ATOM   6296  C  CB    . ILE B 1 173 ? 17.341  68.264  47.613  1.00 65.99  ? 173 ILE B CB    1 
ATOM   6297  C  CG1   . ILE B 1 173 ? 17.457  68.350  49.137  1.00 66.70  ? 173 ILE B CG1   1 
ATOM   6298  C  CG2   . ILE B 1 173 ? 16.964  69.607  47.029  1.00 72.04  ? 173 ILE B CG2   1 
ATOM   6299  C  CD1   . ILE B 1 173 ? 18.442  69.390  49.616  1.00 67.16  ? 173 ILE B CD1   1 
ATOM   6300  N  N     . LEU B 1 174 ? 15.117  67.493  45.128  1.00 73.01  ? 174 LEU B N     1 
ATOM   6301  C  CA    . LEU B 1 174 ? 14.906  67.384  43.689  1.00 74.23  ? 174 LEU B CA    1 
ATOM   6302  C  C     . LEU B 1 174 ? 14.589  68.734  43.062  1.00 73.31  ? 174 LEU B C     1 
ATOM   6303  O  O     . LEU B 1 174 ? 13.753  69.482  43.561  1.00 72.65  ? 174 LEU B O     1 
ATOM   6304  C  CB    . LEU B 1 174 ? 13.771  66.405  43.393  1.00 72.97  ? 174 LEU B CB    1 
ATOM   6305  C  CG    . LEU B 1 174 ? 13.937  64.996  43.968  1.00 76.20  ? 174 LEU B CG    1 
ATOM   6306  C  CD1   . LEU B 1 174 ? 12.688  64.158  43.707  1.00 75.18  ? 174 LEU B CD1   1 
ATOM   6307  C  CD2   . LEU B 1 174 ? 15.179  64.331  43.387  1.00 70.05  ? 174 LEU B CD2   1 
ATOM   6308  N  N     . CYS B 1 175 ? 15.265  69.030  41.958  1.00 75.16  ? 175 CYS B N     1 
ATOM   6309  C  CA    . CYS B 1 175 ? 14.968  70.207  41.155  1.00 74.54  ? 175 CYS B CA    1 
ATOM   6310  C  C     . CYS B 1 175 ? 13.972  69.821  40.067  1.00 73.71  ? 175 CYS B C     1 
ATOM   6311  O  O     . CYS B 1 175 ? 14.009  68.706  39.550  1.00 70.16  ? 175 CYS B O     1 
ATOM   6312  C  CB    . CYS B 1 175 ? 16.249  70.787  40.546  1.00 72.67  ? 175 CYS B CB    1 
ATOM   6313  S  SG    . CYS B 1 175 ? 16.055  72.406  39.758  1.00 82.46  ? 175 CYS B SG    1 
ATOM   6314  N  N     . GLU B 1 176 ? 13.068  70.733  39.738  1.00 79.91  ? 176 GLU B N     1 
ATOM   6315  C  CA    . GLU B 1 176 ? 12.039  70.450  38.744  1.00 79.82  ? 176 GLU B CA    1 
ATOM   6316  C  C     . GLU B 1 176 ? 12.108  71.404  37.551  1.00 75.26  ? 176 GLU B C     1 
ATOM   6317  O  O     . GLU B 1 176 ? 11.292  71.324  36.639  1.00 81.23  ? 176 GLU B O     1 
ATOM   6318  C  CB    . GLU B 1 176 ? 10.661  70.504  39.397  1.00 79.22  ? 176 GLU B CB    1 
ATOM   6319  C  CG    . GLU B 1 176 ? 10.446  69.401  40.422  1.00 81.74  ? 176 GLU B CG    1 
ATOM   6320  C  CD    . GLU B 1 176 ? 9.148   69.552  41.190  1.00 86.29  ? 176 GLU B CD    1 
ATOM   6321  O  OE1   . GLU B 1 176 ? 8.817   70.686  41.596  1.00 94.02  ? 176 GLU B OE1   1 
ATOM   6322  O  OE2   . GLU B 1 176 ? 8.452   68.535  41.380  1.00 87.40  ? 176 GLU B OE2   1 
ATOM   6323  N  N     . MET B 1 177 ? 13.089  72.299  37.560  1.00 74.32  ? 177 MET B N     1 
ATOM   6324  C  CA    . MET B 1 177 ? 13.307  73.196  36.432  1.00 78.92  ? 177 MET B CA    1 
ATOM   6325  C  C     . MET B 1 177 ? 14.614  72.913  35.706  1.00 77.78  ? 177 MET B C     1 
ATOM   6326  O  O     . MET B 1 177 ? 15.495  72.219  36.218  1.00 76.76  ? 177 MET B O     1 
ATOM   6327  C  CB    . MET B 1 177 ? 13.325  74.656  36.900  1.00 77.49  ? 177 MET B CB    1 
ATOM   6328  C  CG    . MET B 1 177 ? 12.063  75.141  37.582  1.00 82.90  ? 177 MET B CG    1 
ATOM   6329  S  SD    . MET B 1 177 ? 12.263  76.846  38.154  1.00 86.61  ? 177 MET B SD    1 
ATOM   6330  C  CE    . MET B 1 177 ? 10.594  77.219  38.712  1.00 84.26  ? 177 MET B CE    1 
ATOM   6331  N  N     . SER B 1 178 ? 14.732  73.479  34.513  1.00 75.05  ? 178 SER B N     1 
ATOM   6332  C  CA    . SER B 1 178 ? 15.974  73.463  33.762  1.00 78.24  ? 178 SER B CA    1 
ATOM   6333  C  C     . SER B 1 178 ? 16.889  74.519  34.369  1.00 82.20  ? 178 SER B C     1 
ATOM   6334  O  O     . SER B 1 178 ? 16.430  75.335  35.171  1.00 84.37  ? 178 SER B O     1 
ATOM   6335  C  CB    . SER B 1 178 ? 15.716  73.758  32.285  1.00 83.63  ? 178 SER B CB    1 
ATOM   6336  O  OG    . SER B 1 178 ? 15.089  75.022  32.130  1.00 83.07  ? 178 SER B OG    1 
ATOM   6337  N  N     . LEU B 1 179 ? 18.165  74.525  33.992  1.00 78.88  ? 179 LEU B N     1 
ATOM   6338  C  CA    . LEU B 1 179 ? 19.076  75.565  34.469  1.00 81.91  ? 179 LEU B CA    1 
ATOM   6339  C  C     . LEU B 1 179 ? 18.598  76.954  34.047  1.00 86.22  ? 179 LEU B C     1 
ATOM   6340  O  O     . LEU B 1 179 ? 18.716  77.927  34.807  1.00 85.62  ? 179 LEU B O     1 
ATOM   6341  C  CB    . LEU B 1 179 ? 20.494  75.334  33.948  1.00 78.55  ? 179 LEU B CB    1 
ATOM   6342  C  CG    . LEU B 1 179 ? 21.499  76.401  34.392  1.00 79.77  ? 179 LEU B CG    1 
ATOM   6343  C  CD1   . LEU B 1 179 ? 21.599  76.463  35.911  1.00 80.34  ? 179 LEU B CD1   1 
ATOM   6344  C  CD2   . LEU B 1 179 ? 22.871  76.183  33.767  1.00 80.08  ? 179 LEU B CD2   1 
ATOM   6345  N  N     . GLU B 1 180 ? 18.062  77.035  32.830  1.00 86.80  ? 180 GLU B N     1 
ATOM   6346  C  CA    . GLU B 1 180 ? 17.572  78.292  32.276  1.00 87.06  ? 180 GLU B CA    1 
ATOM   6347  C  C     . GLU B 1 180 ? 16.418  78.852  33.098  1.00 84.84  ? 180 GLU B C     1 
ATOM   6348  O  O     . GLU B 1 180 ? 16.471  79.998  33.537  1.00 89.86  ? 180 GLU B O     1 
ATOM   6349  C  CB    . GLU B 1 180 ? 17.143  78.104  30.819  1.00 86.53  ? 180 GLU B CB    1 
ATOM   6350  C  CG    . GLU B 1 180 ? 16.729  79.393  30.111  1.00 84.63  ? 180 GLU B CG    1 
ATOM   6351  C  CD    . GLU B 1 180 ? 17.877  80.377  29.910  1.00 87.36  ? 180 GLU B CD    1 
ATOM   6352  O  OE1   . GLU B 1 180 ? 19.046  79.948  29.843  1.00 88.12  ? 180 GLU B OE1   1 
ATOM   6353  O  OE2   . GLU B 1 180 ? 17.608  81.591  29.805  1.00 94.50  ? 180 GLU B OE2   1 
ATOM   6354  N  N     . ALA B 1 181 ? 15.379  78.046  33.296  1.00 80.12  ? 181 ALA B N     1 
ATOM   6355  C  CA    . ALA B 1 181 ? 14.207  78.463  34.064  1.00 79.51  ? 181 ALA B CA    1 
ATOM   6356  C  C     . ALA B 1 181 ? 14.579  78.857  35.489  1.00 84.26  ? 181 ALA B C     1 
ATOM   6357  O  O     . ALA B 1 181 ? 13.960  79.742  36.085  1.00 86.46  ? 181 ALA B O     1 
ATOM   6358  C  CB    . ALA B 1 181 ? 13.166  77.357  34.079  1.00 75.47  ? 181 ALA B CB    1 
ATOM   6359  N  N     . TRP B 1 182 ? 15.580  78.171  36.035  1.00 84.40  ? 182 TRP B N     1 
ATOM   6360  C  CA    . TRP B 1 182 ? 16.070  78.431  37.384  1.00 81.71  ? 182 TRP B CA    1 
ATOM   6361  C  C     . TRP B 1 182 ? 16.765  79.793  37.463  1.00 82.84  ? 182 TRP B C     1 
ATOM   6362  O  O     . TRP B 1 182 ? 16.492  80.587  38.362  1.00 83.18  ? 182 TRP B O     1 
ATOM   6363  C  CB    . TRP B 1 182 ? 17.027  77.313  37.814  1.00 80.54  ? 182 TRP B CB    1 
ATOM   6364  C  CG    . TRP B 1 182 ? 17.474  77.366  39.248  1.00 75.48  ? 182 TRP B CG    1 
ATOM   6365  C  CD1   . TRP B 1 182 ? 18.703  77.745  39.714  1.00 76.49  ? 182 TRP B CD1   1 
ATOM   6366  C  CD2   . TRP B 1 182 ? 16.707  76.990  40.398  1.00 72.47  ? 182 TRP B CD2   1 
ATOM   6367  N  NE1   . TRP B 1 182 ? 18.741  77.642  41.085  1.00 74.15  ? 182 TRP B NE1   1 
ATOM   6368  C  CE2   . TRP B 1 182 ? 17.529  77.180  41.531  1.00 74.77  ? 182 TRP B CE2   1 
ATOM   6369  C  CE3   . TRP B 1 182 ? 15.403  76.516  40.583  1.00 71.98  ? 182 TRP B CE3   1 
ATOM   6370  C  CZ2   . TRP B 1 182 ? 17.087  76.920  42.830  1.00 69.89  ? 182 TRP B CZ2   1 
ATOM   6371  C  CZ3   . TRP B 1 182 ? 14.965  76.253  41.873  1.00 71.72  ? 182 TRP B CZ3   1 
ATOM   6372  C  CH2   . TRP B 1 182 ? 15.805  76.457  42.979  1.00 74.71  ? 182 TRP B CH2   1 
ATOM   6373  N  N     . LEU B 1 183 ? 17.674  80.049  36.525  1.00 82.93  ? 183 LEU B N     1 
ATOM   6374  C  CA    . LEU B 1 183 ? 18.418  81.311  36.494  1.00 85.47  ? 183 LEU B CA    1 
ATOM   6375  C  C     . LEU B 1 183 ? 17.560  82.481  36.002  1.00 87.28  ? 183 LEU B C     1 
ATOM   6376  O  O     . LEU B 1 183 ? 17.955  83.642  36.114  1.00 89.98  ? 183 LEU B O     1 
ATOM   6377  C  CB    . LEU B 1 183 ? 19.670  81.173  35.625  1.00 81.72  ? 183 LEU B CB    1 
ATOM   6378  C  CG    . LEU B 1 183 ? 20.695  80.161  36.154  1.00 84.86  ? 183 LEU B CG    1 
ATOM   6379  C  CD1   . LEU B 1 183 ? 21.936  80.103  35.271  1.00 82.84  ? 183 LEU B CD1   1 
ATOM   6380  C  CD2   . LEU B 1 183 ? 21.070  80.463  37.598  1.00 83.83  ? 183 LEU B CD2   1 
ATOM   6381  N  N     . ALA B 1 184 ? 16.398  82.167  35.440  1.00 88.46  ? 184 ALA B N     1 
ATOM   6382  C  CA    . ALA B 1 184 ? 15.505  83.185  34.899  1.00 90.72  ? 184 ALA B CA    1 
ATOM   6383  C  C     . ALA B 1 184 ? 14.623  83.744  36.006  1.00 92.72  ? 184 ALA B C     1 
ATOM   6384  O  O     . ALA B 1 184 ? 14.041  84.821  35.867  1.00 94.33  ? 184 ALA B O     1 
ATOM   6385  C  CB    . ALA B 1 184 ? 14.651  82.614  33.774  1.00 83.84  ? 184 ALA B CB    1 
ATOM   6386  N  N     . GLN B 1 185 ? 14.527  83.002  37.106  1.00 90.63  ? 185 GLN B N     1 
ATOM   6387  C  CA    . GLN B 1 185 ? 13.724  83.430  38.244  1.00 88.68  ? 185 GLN B CA    1 
ATOM   6388  C  C     . GLN B 1 185 ? 14.577  84.136  39.291  1.00 86.78  ? 185 GLN B C     1 
ATOM   6389  O  O     . GLN B 1 185 ? 14.145  84.319  40.427  1.00 89.24  ? 185 GLN B O     1 
ATOM   6390  C  CB    . GLN B 1 185 ? 12.995  82.237  38.868  1.00 87.03  ? 185 GLN B CB    1 
ATOM   6391  C  CG    . GLN B 1 185 ? 11.962  81.601  37.946  1.00 87.77  ? 185 GLN B CG    1 
ATOM   6392  C  CD    . GLN B 1 185 ? 10.622  81.375  38.628  1.00 88.64  ? 185 GLN B CD    1 
ATOM   6393  O  OE1   . GLN B 1 185 ? 10.433  81.746  39.789  1.00 87.79  ? 185 GLN B OE1   1 
ATOM   6394  N  NE2   . GLN B 1 185 ? 9.682   80.764  37.907  1.00 80.10  ? 185 GLN B NE2   1 
ATOM   6395  N  N     . GLY B 1 186 ? 15.788  84.531  38.909  1.00 85.36  ? 186 GLY B N     1 
ATOM   6396  C  CA    . GLY B 1 186 ? 16.637  85.293  39.807  1.00 91.62  ? 186 GLY B CA    1 
ATOM   6397  C  C     . GLY B 1 186 ? 17.717  84.510  40.533  1.00 89.64  ? 186 GLY B C     1 
ATOM   6398  O  O     . GLY B 1 186 ? 18.719  85.094  40.951  1.00 88.53  ? 186 GLY B O     1 
ATOM   6399  N  N     . HIS B 1 187 ? 17.503  83.205  40.705  1.00 89.72  ? 187 HIS B N     1 
ATOM   6400  C  CA    . HIS B 1 187 ? 18.422  82.343  41.459  1.00 84.86  ? 187 HIS B CA    1 
ATOM   6401  C  C     . HIS B 1 187 ? 19.868  82.491  40.996  1.00 84.00  ? 187 HIS B C     1 
ATOM   6402  O  O     . HIS B 1 187 ? 20.123  82.674  39.806  1.00 87.08  ? 187 HIS B O     1 
ATOM   6403  C  CB    . HIS B 1 187 ? 18.010  80.872  41.322  1.00 82.75  ? 187 HIS B CB    1 
ATOM   6404  C  CG    . HIS B 1 187 ? 16.665  80.555  41.896  1.00 77.14  ? 187 HIS B CG    1 
ATOM   6405  N  ND1   . HIS B 1 187 ? 16.386  80.651  43.242  1.00 75.17  ? 187 HIS B ND1   1 
ATOM   6406  C  CD2   . HIS B 1 187 ? 15.524  80.121  41.306  1.00 80.92  ? 187 HIS B CD2   1 
ATOM   6407  C  CE1   . HIS B 1 187 ? 15.129  80.300  43.455  1.00 79.49  ? 187 HIS B CE1   1 
ATOM   6408  N  NE2   . HIS B 1 187 ? 14.584  79.972  42.299  1.00 75.47  ? 187 HIS B NE2   1 
ATOM   6409  N  N     . PRO B 1 188 ? 20.823  82.397  41.936  1.00 85.19  ? 188 PRO B N     1 
ATOM   6410  C  CA    . PRO B 1 188 ? 22.252  82.424  41.594  1.00 82.01  ? 188 PRO B CA    1 
ATOM   6411  C  C     . PRO B 1 188 ? 22.690  81.122  40.917  1.00 83.55  ? 188 PRO B C     1 
ATOM   6412  O  O     . PRO B 1 188 ? 21.981  80.122  41.020  1.00 81.88  ? 188 PRO B O     1 
ATOM   6413  C  CB    . PRO B 1 188 ? 22.945  82.601  42.955  1.00 80.26  ? 188 PRO B CB    1 
ATOM   6414  C  CG    . PRO B 1 188 ? 21.858  83.009  43.911  1.00 84.34  ? 188 PRO B CG    1 
ATOM   6415  C  CD    . PRO B 1 188 ? 20.604  82.389  43.391  1.00 82.56  ? 188 PRO B CD    1 
ATOM   6416  N  N     . LEU B 1 189 ? 23.838  81.130  40.244  1.00 81.41  ? 189 LEU B N     1 
ATOM   6417  C  CA    . LEU B 1 189 ? 24.303  79.941  39.533  1.00 81.00  ? 189 LEU B CA    1 
ATOM   6418  C  C     . LEU B 1 189 ? 24.601  78.789  40.492  1.00 81.24  ? 189 LEU B C     1 
ATOM   6419  O  O     . LEU B 1 189 ? 25.431  78.924  41.396  1.00 77.97  ? 189 LEU B O     1 
ATOM   6420  C  CB    . LEU B 1 189 ? 25.534  80.266  38.700  1.00 79.50  ? 189 LEU B CB    1 
ATOM   6421  N  N     . PRO B 1 190 ? 23.915  77.651  40.299  1.00 79.86  ? 190 PRO B N     1 
ATOM   6422  C  CA    . PRO B 1 190 ? 24.155  76.439  41.095  1.00 79.12  ? 190 PRO B CA    1 
ATOM   6423  C  C     . PRO B 1 190 ? 25.607  75.979  40.978  1.00 77.47  ? 190 PRO B C     1 
ATOM   6424  O  O     . PRO B 1 190 ? 26.228  76.218  39.940  1.00 81.21  ? 190 PRO B O     1 
ATOM   6425  C  CB    . PRO B 1 190 ? 23.198  75.416  40.477  1.00 77.69  ? 190 PRO B CB    1 
ATOM   6426  C  CG    . PRO B 1 190 ? 22.135  76.239  39.815  1.00 75.88  ? 190 PRO B CG    1 
ATOM   6427  C  CD    . PRO B 1 190 ? 22.839  77.458  39.312  1.00 77.59  ? 190 PRO B CD    1 
ATOM   6428  N  N     . LYS B 1 191 ? 26.148  75.342  42.013  1.00 69.81  ? 191 LYS B N     1 
ATOM   6429  C  CA    . LYS B 1 191 ? 27.542  74.906  41.963  1.00 76.52  ? 191 LYS B CA    1 
ATOM   6430  C  C     . LYS B 1 191 ? 27.728  73.754  40.980  1.00 76.08  ? 191 LYS B C     1 
ATOM   6431  O  O     . LYS B 1 191 ? 28.759  73.656  40.307  1.00 78.18  ? 191 LYS B O     1 
ATOM   6432  C  CB    . LYS B 1 191 ? 28.029  74.505  43.349  1.00 77.17  ? 191 LYS B CB    1 
ATOM   6433  N  N     . ARG B 1 192 ? 26.725  72.888  40.899  1.00 70.94  ? 192 ARG B N     1 
ATOM   6434  C  CA    . ARG B 1 192 ? 26.784  71.741  40.005  1.00 75.01  ? 192 ARG B CA    1 
ATOM   6435  C  C     . ARG B 1 192 ? 25.534  71.659  39.142  1.00 73.24  ? 192 ARG B C     1 
ATOM   6436  O  O     . ARG B 1 192 ? 24.448  72.070  39.566  1.00 73.42  ? 192 ARG B O     1 
ATOM   6437  C  CB    . ARG B 1 192 ? 26.964  70.452  40.801  1.00 72.95  ? 192 ARG B CB    1 
ATOM   6438  N  N     . VAL B 1 193 ? 25.697  71.121  37.934  1.00 74.14  ? 193 VAL B N     1 
ATOM   6439  C  CA    . VAL B 1 193 ? 24.581  70.909  37.011  1.00 78.41  ? 193 VAL B CA    1 
ATOM   6440  C  C     . VAL B 1 193 ? 24.529  69.453  36.538  1.00 74.41  ? 193 VAL B C     1 
ATOM   6441  O  O     . VAL B 1 193 ? 25.551  68.860  36.260  1.00 71.25  ? 193 VAL B O     1 
ATOM   6442  C  CB    . VAL B 1 193 ? 24.697  71.855  35.816  1.00 71.95  ? 193 VAL B CB    1 
ATOM   6443  N  N     . ARG B 1 194 ? 23.336  68.881  36.448  1.00 72.04  ? 194 ARG B N     1 
ATOM   6444  C  CA    . ARG B 1 194 ? 23.154  67.509  35.983  1.00 71.49  ? 194 ARG B CA    1 
ATOM   6445  C  C     . ARG B 1 194 ? 22.447  67.504  34.629  1.00 73.83  ? 194 ARG B C     1 
ATOM   6446  O  O     . ARG B 1 194 ? 21.535  68.296  34.411  1.00 70.71  ? 194 ARG B O     1 
ATOM   6447  C  CB    . ARG B 1 194 ? 22.352  66.713  37.018  1.00 69.99  ? 194 ARG B CB    1 
ATOM   6448  C  CG    . ARG B 1 194 ? 22.050  65.269  36.659  1.00 72.49  ? 194 ARG B CG    1 
ATOM   6449  C  CD    . ARG B 1 194 ? 21.156  64.636  37.726  1.00 78.12  ? 194 ARG B CD    1 
ATOM   6450  N  NE    . ARG B 1 194 ? 20.073  65.538  38.129  1.00 88.76  ? 194 ARG B NE    1 
ATOM   6451  C  CZ    . ARG B 1 194 ? 18.989  65.169  38.811  1.00 91.76  ? 194 ARG B CZ    1 
ATOM   6452  N  NH1   . ARG B 1 194 ? 18.819  63.902  39.173  1.00 88.26  ? 194 ARG B NH1   1 
ATOM   6453  N  NH2   . ARG B 1 194 ? 18.066  66.071  39.128  1.00 85.40  ? 194 ARG B NH2   1 
ATOM   6454  N  N     . ASN B 1 195 ? 22.861  66.630  33.714  1.00 72.52  ? 195 ASN B N     1 
ATOM   6455  C  CA    . ASN B 1 195 ? 22.171  66.531  32.429  1.00 72.20  ? 195 ASN B CA    1 
ATOM   6456  C  C     . ASN B 1 195 ? 20.699  66.209  32.626  1.00 74.01  ? 195 ASN B C     1 
ATOM   6457  O  O     . ASN B 1 195 ? 20.321  65.611  33.633  1.00 74.51  ? 195 ASN B O     1 
ATOM   6458  C  CB    . ASN B 1 195 ? 22.806  65.467  31.531  1.00 71.37  ? 195 ASN B CB    1 
ATOM   6459  C  CG    . ASN B 1 195 ? 24.178  65.863  31.035  1.00 72.66  ? 195 ASN B CG    1 
ATOM   6460  O  OD1   . ASN B 1 195 ? 24.520  67.044  30.998  1.00 70.60  ? 195 ASN B OD1   1 
ATOM   6461  N  ND2   . ASN B 1 195 ? 24.969  64.873  30.633  1.00 72.58  ? 195 ASN B ND2   1 
ATOM   6462  N  N     . ALA B 1 196 ? 19.865  66.625  31.679  1.00 78.22  ? 196 ALA B N     1 
ATOM   6463  C  CA    . ALA B 1 196 ? 18.441  66.323  31.748  1.00 74.35  ? 196 ALA B CA    1 
ATOM   6464  C  C     . ALA B 1 196 ? 18.154  64.955  31.141  1.00 75.68  ? 196 ALA B C     1 
ATOM   6465  O  O     . ALA B 1 196 ? 17.125  64.334  31.435  1.00 75.48  ? 196 ALA B O     1 
ATOM   6466  C  CB    . ALA B 1 196 ? 17.629  67.400  31.047  1.00 74.44  ? 196 ALA B CB    1 
ATOM   6467  N  N     . TYR B 1 197 ? 19.063  64.496  30.281  1.00 74.83  ? 197 TYR B N     1 
ATOM   6468  C  CA    . TYR B 1 197 ? 18.861  63.245  29.556  1.00 77.62  ? 197 TYR B CA    1 
ATOM   6469  C  C     . TYR B 1 197 ? 19.477  62.034  30.253  1.00 79.79  ? 197 TYR B C     1 
ATOM   6470  O  O     . TYR B 1 197 ? 18.924  60.940  30.171  1.00 86.39  ? 197 TYR B O     1 
ATOM   6471  C  CB    . TYR B 1 197 ? 19.413  63.354  28.132  1.00 78.84  ? 197 TYR B CB    1 
ATOM   6472  C  CG    . TYR B 1 197 ? 20.641  64.227  27.985  1.00 81.90  ? 197 TYR B CG    1 
ATOM   6473  C  CD1   . TYR B 1 197 ? 21.916  63.712  28.186  1.00 76.46  ? 197 TYR B CD1   1 
ATOM   6474  C  CD2   . TYR B 1 197 ? 20.527  65.565  27.627  1.00 82.52  ? 197 TYR B CD2   1 
ATOM   6475  C  CE1   . TYR B 1 197 ? 23.038  64.508  28.040  1.00 77.30  ? 197 TYR B CE1   1 
ATOM   6476  C  CE2   . TYR B 1 197 ? 21.646  66.365  27.481  1.00 78.88  ? 197 TYR B CE2   1 
ATOM   6477  C  CZ    . TYR B 1 197 ? 22.893  65.832  27.688  1.00 74.31  ? 197 TYR B CZ    1 
ATOM   6478  O  OH    . TYR B 1 197 ? 23.999  66.630  27.542  1.00 77.56  ? 197 TYR B OH    1 
ATOM   6479  N  N     . ASP B 1 198 ? 20.614  62.216  30.923  1.00 75.67  ? 198 ASP B N     1 
ATOM   6480  C  CA    . ASP B 1 198 ? 21.230  61.114  31.669  1.00 76.87  ? 198 ASP B CA    1 
ATOM   6481  C  C     . ASP B 1 198 ? 21.629  61.555  33.082  1.00 77.30  ? 198 ASP B C     1 
ATOM   6482  O  O     . ASP B 1 198 ? 21.184  62.602  33.554  1.00 79.93  ? 198 ASP B O     1 
ATOM   6483  C  CB    . ASP B 1 198 ? 22.437  60.546  30.910  1.00 75.81  ? 198 ASP B CB    1 
ATOM   6484  C  CG    . ASP B 1 198 ? 23.464  61.603  30.550  1.00 71.89  ? 198 ASP B CG    1 
ATOM   6485  O  OD1   . ASP B 1 198 ? 23.781  62.462  31.400  1.00 71.86  ? 198 ASP B OD1   1 
ATOM   6486  O  OD2   . ASP B 1 198 ? 23.945  61.580  29.397  1.00 76.49  ? 198 ASP B OD2   1 
ATOM   6487  N  N     . ARG B 1 199 ? 22.471  60.771  33.750  1.00 72.06  ? 199 ARG B N     1 
ATOM   6488  C  CA    . ARG B 1 199 ? 22.778  61.028  35.155  1.00 74.14  ? 199 ARG B CA    1 
ATOM   6489  C  C     . ARG B 1 199 ? 24.076  61.803  35.332  1.00 71.62  ? 199 ARG B C     1 
ATOM   6490  O  O     . ARG B 1 199 ? 24.449  62.138  36.455  1.00 74.40  ? 199 ARG B O     1 
ATOM   6491  C  CB    . ARG B 1 199 ? 22.844  59.718  35.930  1.00 70.90  ? 199 ARG B CB    1 
ATOM   6492  N  N     . ARG B 1 200 ? 24.745  62.103  34.224  1.00 67.00  ? 200 ARG B N     1 
ATOM   6493  C  CA    . ARG B 1 200 ? 26.036  62.778  34.269  1.00 69.63  ? 200 ARG B CA    1 
ATOM   6494  C  C     . ARG B 1 200 ? 25.942  64.173  34.895  1.00 72.08  ? 200 ARG B C     1 
ATOM   6495  O  O     . ARG B 1 200 ? 24.953  64.886  34.723  1.00 72.30  ? 200 ARG B O     1 
ATOM   6496  C  CB    . ARG B 1 200 ? 26.627  62.865  32.869  1.00 69.87  ? 200 ARG B CB    1 
ATOM   6497  N  N     . THR B 1 201 ? 26.992  64.557  35.614  1.00 73.33  ? 201 THR B N     1 
ATOM   6498  C  CA    . THR B 1 201 ? 27.030  65.819  36.342  1.00 72.58  ? 201 THR B CA    1 
ATOM   6499  C  C     . THR B 1 201 ? 28.267  66.638  35.940  1.00 73.78  ? 201 THR B C     1 
ATOM   6500  O  O     . THR B 1 201 ? 29.294  66.085  35.544  1.00 78.19  ? 201 THR B O     1 
ATOM   6501  C  CB    . THR B 1 201 ? 27.004  65.566  37.875  1.00 75.48  ? 201 THR B CB    1 
ATOM   6502  O  OG1   . THR B 1 201 ? 25.867  64.757  38.199  1.00 76.87  ? 201 THR B OG1   1 
ATOM   6503  C  CG2   . THR B 1 201 ? 26.901  66.864  38.662  1.00 77.76  ? 201 THR B CG2   1 
ATOM   6504  N  N     . TRP B 1 202 ? 28.147  67.959  36.034  1.00 73.41  ? 202 TRP B N     1 
ATOM   6505  C  CA    . TRP B 1 202 ? 29.173  68.907  35.636  1.00 75.45  ? 202 TRP B CA    1 
ATOM   6506  C  C     . TRP B 1 202 ? 29.348  69.995  36.694  1.00 79.03  ? 202 TRP B C     1 
ATOM   6507  O  O     . TRP B 1 202 ? 28.445  70.249  37.498  1.00 74.49  ? 202 TRP B O     1 
ATOM   6508  C  CB    . TRP B 1 202 ? 28.800  69.569  34.309  1.00 80.00  ? 202 TRP B CB    1 
ATOM   6509  C  CG    . TRP B 1 202 ? 28.434  68.626  33.212  1.00 77.97  ? 202 TRP B CG    1 
ATOM   6510  C  CD1   . TRP B 1 202 ? 27.174  68.266  32.824  1.00 74.24  ? 202 TRP B CD1   1 
ATOM   6511  C  CD2   . TRP B 1 202 ? 29.333  67.935  32.346  1.00 75.76  ? 202 TRP B CD2   1 
ATOM   6512  N  NE1   . TRP B 1 202 ? 27.239  67.387  31.772  1.00 72.49  ? 202 TRP B NE1   1 
ATOM   6513  C  CE2   . TRP B 1 202 ? 28.555  67.167  31.460  1.00 74.41  ? 202 TRP B CE2   1 
ATOM   6514  C  CE3   . TRP B 1 202 ? 30.726  67.885  32.236  1.00 82.41  ? 202 TRP B CE3   1 
ATOM   6515  C  CZ2   . TRP B 1 202 ? 29.122  66.358  30.478  1.00 83.12  ? 202 TRP B CZ2   1 
ATOM   6516  C  CZ3   . TRP B 1 202 ? 31.287  67.084  31.264  1.00 82.92  ? 202 TRP B CZ3   1 
ATOM   6517  C  CH2   . TRP B 1 202 ? 30.489  66.333  30.397  1.00 79.40  ? 202 TRP B CH2   1 
ATOM   6518  N  N     . GLU B 1 203 ? 30.503  70.653  36.672  1.00 83.29  ? 203 GLU B N     1 
ATOM   6519  C  CA    . GLU B 1 203 ? 30.730  71.834  37.496  1.00 86.02  ? 203 GLU B CA    1 
ATOM   6520  C  C     . GLU B 1 203 ? 30.455  73.084  36.667  1.00 85.96  ? 203 GLU B C     1 
ATOM   6521  O  O     . GLU B 1 203 ? 31.188  73.375  35.720  1.00 89.84  ? 203 GLU B O     1 
ATOM   6522  C  CB    . GLU B 1 203 ? 32.158  71.851  38.036  1.00 81.14  ? 203 GLU B CB    1 
ATOM   6523  N  N     . LEU B 1 204 ? 29.409  73.826  37.023  1.00 83.54  ? 204 LEU B N     1 
ATOM   6524  C  CA    . LEU B 1 204 ? 29.037  75.028  36.270  1.00 87.26  ? 204 LEU B CA    1 
ATOM   6525  C  C     . LEU B 1 204 ? 30.016  76.179  36.509  1.00 86.00  ? 204 LEU B C     1 
ATOM   6526  O  O     . LEU B 1 204 ? 30.058  76.755  37.596  1.00 88.65  ? 204 LEU B O     1 
ATOM   6527  C  CB    . LEU B 1 204 ? 27.612  75.460  36.633  1.00 84.61  ? 204 LEU B CB    1 
ATOM   6528  C  CG    . LEU B 1 204 ? 26.998  76.638  35.874  1.00 79.65  ? 204 LEU B CG    1 
ATOM   6529  C  CD1   . LEU B 1 204 ? 27.085  76.433  34.373  1.00 80.73  ? 204 LEU B CD1   1 
ATOM   6530  C  CD2   . LEU B 1 204 ? 25.552  76.804  36.287  1.00 77.12  ? 204 LEU B CD2   1 
ATOM   6531  N  N     . LEU B 1 205 ? 30.798  76.506  35.481  1.00 86.22  ? 205 LEU B N     1 
ATOM   6532  C  CA    . LEU B 1 205 ? 31.838  77.531  35.582  1.00 91.07  ? 205 LEU B CA    1 
ATOM   6533  C  C     . LEU B 1 205 ? 31.311  78.954  35.350  1.00 94.12  ? 205 LEU B C     1 
ATOM   6534  O  O     . LEU B 1 205 ? 31.554  79.849  36.164  1.00 92.81  ? 205 LEU B O     1 
ATOM   6535  C  CB    . LEU B 1 205 ? 32.975  77.227  34.607  1.00 86.08  ? 205 LEU B CB    1 
ATOM   6536  N  N     . ARG B 1 206 ? 30.587  79.162  34.252  1.00 89.90  ? 206 ARG B N     1 
ATOM   6537  C  CA    . ARG B 1 206 ? 30.090  80.496  33.919  1.00 88.10  ? 206 ARG B CA    1 
ATOM   6538  C  C     . ARG B 1 206 ? 29.007  80.472  32.854  1.00 91.81  ? 206 ARG B C     1 
ATOM   6539  O  O     . ARG B 1 206 ? 28.619  79.413  32.360  1.00 92.84  ? 206 ARG B O     1 
ATOM   6540  C  CB    . ARG B 1 206 ? 31.240  81.385  33.455  1.00 89.02  ? 206 ARG B CB    1 
ATOM   6541  N  N     . LEU B 1 207 ? 28.509  81.657  32.521  1.00 94.41  ? 207 LEU B N     1 
ATOM   6542  C  CA    . LEU B 1 207 ? 27.573  81.816  31.419  1.00 94.21  ? 207 LEU B CA    1 
ATOM   6543  C  C     . LEU B 1 207 ? 28.286  82.347  30.177  1.00 97.73  ? 207 LEU B C     1 
ATOM   6544  O  O     . LEU B 1 207 ? 29.438  82.790  30.247  1.00 95.51  ? 207 LEU B O     1 
ATOM   6545  C  CB    . LEU B 1 207 ? 26.427  82.730  31.835  1.00 88.91  ? 207 LEU B CB    1 
ATOM   6546  C  CG    . LEU B 1 207 ? 25.500  81.995  32.803  1.00 88.14  ? 207 LEU B CG    1 
ATOM   6547  C  CD1   . LEU B 1 207 ? 24.484  82.928  33.437  1.00 89.95  ? 207 LEU B CD1   1 
ATOM   6548  C  CD2   . LEU B 1 207 ? 24.806  80.853  32.079  1.00 89.39  ? 207 LEU B CD2   1 
ATOM   6549  N  N     . GLY B 1 208 ? 27.598  82.298  29.041  1.00 95.46  ? 208 GLY B N     1 
ATOM   6550  C  CA    . GLY B 1 208 ? 28.185  82.708  27.778  1.00 96.35  ? 208 GLY B CA    1 
ATOM   6551  C  C     . GLY B 1 208 ? 27.199  83.410  26.866  1.00 97.65  ? 208 GLY B C     1 
ATOM   6552  O  O     . GLY B 1 208 ? 26.076  82.940  26.660  1.00 97.42  ? 208 GLY B O     1 
ATOM   6553  N  N     . GLU B 1 209 ? 27.615  84.554  26.334  1.00 100.80 ? 209 GLU B N     1 
ATOM   6554  C  CA    . GLU B 1 209 ? 26.756  85.345  25.462  1.00 102.68 ? 209 GLU B CA    1 
ATOM   6555  C  C     . GLU B 1 209 ? 26.864  84.902  24.002  1.00 102.07 ? 209 GLU B C     1 
ATOM   6556  O  O     . GLU B 1 209 ? 26.451  85.625  23.097  1.00 105.36 ? 209 GLU B O     1 
ATOM   6557  C  CB    . GLU B 1 209 ? 27.095  86.822  25.594  1.00 105.55 ? 209 GLU B CB    1 
ATOM   6558  N  N     . GLU B 1 210 ? 27.426  83.717  23.781  1.00 102.80 ? 210 GLU B N     1 
ATOM   6559  C  CA    . GLU B 1 210 ? 27.546  83.152  22.439  1.00 98.80  ? 210 GLU B CA    1 
ATOM   6560  C  C     . GLU B 1 210 ? 26.211  82.563  21.988  1.00 98.12  ? 210 GLU B C     1 
ATOM   6561  O  O     . GLU B 1 210 ? 25.381  82.187  22.818  1.00 100.15 ? 210 GLU B O     1 
ATOM   6562  C  CB    . GLU B 1 210 ? 28.641  82.094  22.402  1.00 92.07  ? 210 GLU B CB    1 
ATOM   6563  N  N     . ASP B 1 211 ? 25.995  82.490  20.677  1.00 97.82  ? 211 ASP B N     1 
ATOM   6564  C  CA    . ASP B 1 211 ? 24.762  81.909  20.157  1.00 95.86  ? 211 ASP B CA    1 
ATOM   6565  C  C     . ASP B 1 211 ? 24.821  80.384  20.208  1.00 95.99  ? 211 ASP B C     1 
ATOM   6566  O  O     . ASP B 1 211 ? 25.900  79.795  20.178  1.00 97.16  ? 211 ASP B O     1 
ATOM   6567  C  CB    . ASP B 1 211 ? 24.510  82.383  18.732  1.00 95.49  ? 211 ASP B CB    1 
ATOM   6568  N  N     . PRO B 1 212 ? 23.656  79.749  20.259  1.00 96.53  ? 212 PRO B N     1 
ATOM   6569  C  CA    . PRO B 1 212 ? 23.579  78.296  20.369  1.00 94.49  ? 212 PRO B CA    1 
ATOM   6570  C  C     . PRO B 1 212 ? 23.899  77.605  19.044  1.00 97.87  ? 212 PRO B C     1 
ATOM   6571  O  O     . PRO B 1 212 ? 24.682  76.656  19.000  1.00 98.37  ? 212 PRO B O     1 
ATOM   6572  C  CB    . PRO B 1 212 ? 22.208  77.879  20.865  1.00 87.84  ? 212 PRO B CB    1 
ATOM   6573  N  N     . LYS B 1 213 ? 23.287  78.088  17.968  1.00 99.76  ? 213 LYS B N     1 
ATOM   6574  C  CA    . LYS B 1 213 ? 23.390  77.440  16.664  1.00 97.05  ? 213 LYS B CA    1 
ATOM   6575  C  C     . LYS B 1 213 ? 24.663  77.823  15.906  1.00 97.16  ? 213 LYS B C     1 
ATOM   6576  O  O     . LYS B 1 213 ? 24.880  77.355  14.786  1.00 93.30  ? 213 LYS B O     1 
ATOM   6577  C  CB    . LYS B 1 213 ? 22.159  77.769  15.825  1.00 95.74  ? 213 LYS B CB    1 
ATOM   6578  N  N     . GLU B 1 214 ? 25.498  78.666  16.514  1.00 99.23  ? 214 GLU B N     1 
ATOM   6579  C  CA    . GLU B 1 214 ? 26.718  79.147  15.862  1.00 96.97  ? 214 GLU B CA    1 
ATOM   6580  C  C     . GLU B 1 214 ? 28.006  78.586  16.474  1.00 100.20 ? 214 GLU B C     1 
ATOM   6581  O  O     . GLU B 1 214 ? 29.078  78.705  15.878  1.00 103.18 ? 214 GLU B O     1 
ATOM   6582  C  CB    . GLU B 1 214 ? 26.756  80.670  15.887  1.00 93.92  ? 214 GLU B CB    1 
ATOM   6583  N  N     . LEU B 1 215 ? 27.904  77.979  17.654  1.00 99.74  ? 215 LEU B N     1 
ATOM   6584  C  CA    . LEU B 1 215 ? 29.080  77.448  18.351  1.00 100.38 ? 215 LEU B CA    1 
ATOM   6585  C  C     . LEU B 1 215 ? 29.660  76.205  17.667  1.00 96.01  ? 215 LEU B C     1 
ATOM   6586  O  O     . LEU B 1 215 ? 28.989  75.175  17.560  1.00 94.91  ? 215 LEU B O     1 
ATOM   6587  C  CB    . LEU B 1 215 ? 28.736  77.134  19.803  1.00 101.41 ? 215 LEU B CB    1 
ATOM   6588  N  N     . PRO B 1 216 ? 30.922  76.300  17.218  1.00 94.24  ? 216 PRO B N     1 
ATOM   6589  C  CA    . PRO B 1 216 ? 31.617  75.237  16.482  1.00 92.03  ? 216 PRO B CA    1 
ATOM   6590  C  C     . PRO B 1 216 ? 32.128  74.099  17.369  1.00 93.28  ? 216 PRO B C     1 
ATOM   6591  O  O     . PRO B 1 216 ? 33.167  74.229  18.022  1.00 90.87  ? 216 PRO B O     1 
ATOM   6592  C  CB    . PRO B 1 216 ? 32.789  75.978  15.836  1.00 91.36  ? 216 PRO B CB    1 
ATOM   6593  C  CG    . PRO B 1 216 ? 33.085  77.087  16.786  1.00 94.03  ? 216 PRO B CG    1 
ATOM   6594  C  CD    . PRO B 1 216 ? 31.756  77.508  17.360  1.00 93.30  ? 216 PRO B CD    1 
ATOM   6595  N  N     . LEU B 1 217 ? 31.408  72.985  17.378  1.00 92.43  ? 217 LEU B N     1 
ATOM   6596  C  CA    . LEU B 1 217 ? 31.843  71.811  18.126  1.00 92.41  ? 217 LEU B CA    1 
ATOM   6597  C  C     . LEU B 1 217 ? 33.012  71.130  17.422  1.00 89.47  ? 217 LEU B C     1 
ATOM   6598  O  O     . LEU B 1 217 ? 33.166  71.242  16.206  1.00 92.74  ? 217 LEU B O     1 
ATOM   6599  C  CB    . LEU B 1 217 ? 30.688  70.821  18.299  1.00 89.30  ? 217 LEU B CB    1 
ATOM   6600  C  CG    . LEU B 1 217 ? 29.723  70.959  19.479  1.00 90.32  ? 217 LEU B CG    1 
ATOM   6601  C  CD1   . LEU B 1 217 ? 30.122  69.982  20.560  1.00 90.15  ? 217 LEU B CD1   1 
ATOM   6602  C  CD2   . LEU B 1 217 ? 29.692  72.375  20.031  1.00 89.74  ? 217 LEU B CD2   1 
ATOM   6603  N  N     . PRO B 1 218 ? 33.843  70.432  18.186  1.00 83.40  ? 218 PRO B N     1 
ATOM   6604  C  CA    . PRO B 1 218 ? 34.886  69.614  17.588  1.00 83.11  ? 218 PRO B CA    1 
ATOM   6605  C  C     . PRO B 1 218 ? 34.251  68.357  16.990  1.00 85.36  ? 218 PRO B C     1 
ATOM   6606  O  O     . PRO B 1 218 ? 33.962  67.400  17.712  1.00 87.94  ? 218 PRO B O     1 
ATOM   6607  C  CB    . PRO B 1 218 ? 35.944  69.251  18.617  1.00 77.30  ? 218 PRO B CB    1 
ATOM   6608  N  N     . GLY B 1 219 ? 34.019  68.367  15.679  1.00 83.96  ? 219 GLY B N     1 
ATOM   6609  C  CA    . GLY B 1 219 ? 33.382  67.243  15.012  1.00 80.22  ? 219 GLY B CA    1 
ATOM   6610  C  C     . GLY B 1 219 ? 32.644  67.619  13.741  1.00 79.53  ? 219 GLY B C     1 
ATOM   6611  O  O     . GLY B 1 219 ? 32.214  66.745  12.979  1.00 71.35  ? 219 GLY B O     1 
ATOM   6612  N  N     . GLY B 1 220 ? 32.487  68.921  13.516  1.00 81.04  ? 220 GLY B N     1 
ATOM   6613  C  CA    . GLY B 1 220 ? 31.856  69.417  12.307  1.00 82.92  ? 220 GLY B CA    1 
ATOM   6614  C  C     . GLY B 1 220 ? 30.366  69.702  12.412  1.00 88.83  ? 220 GLY B C     1 
ATOM   6615  O  O     . GLY B 1 220 ? 29.637  69.543  11.430  1.00 96.20  ? 220 GLY B O     1 
ATOM   6616  N  N     . LEU B 1 221 ? 29.907  70.130  13.586  1.00 91.13  ? 221 LEU B N     1 
ATOM   6617  C  CA    . LEU B 1 221 ? 28.486  70.442  13.775  1.00 93.41  ? 221 LEU B CA    1 
ATOM   6618  C  C     . LEU B 1 221 ? 28.267  71.462  14.896  1.00 93.30  ? 221 LEU B C     1 
ATOM   6619  O  O     . LEU B 1 221 ? 29.114  71.621  15.776  1.00 90.33  ? 221 LEU B O     1 
ATOM   6620  C  CB    . LEU B 1 221 ? 27.682  69.161  14.050  1.00 93.89  ? 221 LEU B CB    1 
ATOM   6621  C  CG    . LEU B 1 221 ? 27.804  68.370  15.358  1.00 94.80  ? 221 LEU B CG    1 
ATOM   6622  C  CD1   . LEU B 1 221 ? 26.773  67.243  15.369  1.00 94.43  ? 221 LEU B CD1   1 
ATOM   6623  C  CD2   . LEU B 1 221 ? 29.208  67.807  15.584  1.00 93.57  ? 221 LEU B CD2   1 
ATOM   6624  N  N     . SER B 1 222 ? 27.133  72.159  14.855  1.00 93.48  ? 222 SER B N     1 
ATOM   6625  C  CA    . SER B 1 222 ? 26.857  73.225  15.821  1.00 98.29  ? 222 SER B CA    1 
ATOM   6626  C  C     . SER B 1 222 ? 26.323  72.675  17.142  1.00 96.59  ? 222 SER B C     1 
ATOM   6627  O  O     . SER B 1 222 ? 25.691  71.613  17.170  1.00 94.41  ? 222 SER B O     1 
ATOM   6628  C  CB    . SER B 1 222 ? 25.874  74.237  15.234  1.00 94.08  ? 222 SER B CB    1 
ATOM   6629  N  N     . LEU B 1 223 ? 26.574  73.418  18.222  1.00 93.05  ? 223 LEU B N     1 
ATOM   6630  C  CA    . LEU B 1 223 ? 26.187  73.023  19.577  1.00 91.11  ? 223 LEU B CA    1 
ATOM   6631  C  C     . LEU B 1 223 ? 24.745  72.540  19.667  1.00 92.03  ? 223 LEU B C     1 
ATOM   6632  O  O     . LEU B 1 223 ? 24.488  71.443  20.170  1.00 92.08  ? 223 LEU B O     1 
ATOM   6633  C  CB    . LEU B 1 223 ? 26.411  74.181  20.547  1.00 90.97  ? 223 LEU B CB    1 
ATOM   6634  N  N     . LEU B 1 224 ? 23.810  73.361  19.194  1.00 93.96  ? 224 LEU B N     1 
ATOM   6635  C  CA    . LEU B 1 224 ? 22.404  72.974  19.176  1.00 93.45  ? 224 LEU B CA    1 
ATOM   6636  C  C     . LEU B 1 224 ? 22.197  71.700  18.361  1.00 92.30  ? 224 LEU B C     1 
ATOM   6637  O  O     . LEU B 1 224 ? 21.507  70.779  18.806  1.00 91.87  ? 224 LEU B O     1 
ATOM   6638  C  CB    . LEU B 1 224 ? 21.549  74.107  18.624  1.00 91.15  ? 224 LEU B CB    1 
ATOM   6639  N  N     . ASP B 1 225 ? 22.805  71.653  17.176  1.00 92.55  ? 225 ASP B N     1 
ATOM   6640  C  CA    . ASP B 1 225 ? 22.656  70.514  16.267  1.00 96.37  ? 225 ASP B CA    1 
ATOM   6641  C  C     . ASP B 1 225 ? 23.116  69.206  16.902  1.00 94.44  ? 225 ASP B C     1 
ATOM   6642  O  O     . ASP B 1 225 ? 22.562  68.144  16.619  1.00 90.35  ? 225 ASP B O     1 
ATOM   6643  C  CB    . ASP B 1 225 ? 23.417  70.750  14.957  1.00 95.91  ? 225 ASP B CB    1 
ATOM   6644  C  CG    . ASP B 1 225 ? 22.877  71.932  14.164  1.00 97.86  ? 225 ASP B CG    1 
ATOM   6645  O  OD1   . ASP B 1 225 ? 21.697  72.303  14.355  1.00 97.64  ? 225 ASP B OD1   1 
ATOM   6646  O  OD2   . ASP B 1 225 ? 23.634  72.486  13.340  1.00 98.62  ? 225 ASP B OD2   1 
ATOM   6647  N  N     . TYR B 1 226 ? 24.136  69.290  17.751  1.00 93.39  ? 226 TYR B N     1 
ATOM   6648  C  CA    . TYR B 1 226 ? 24.678  68.109  18.411  1.00 91.02  ? 226 TYR B CA    1 
ATOM   6649  C  C     . TYR B 1 226 ? 23.643  67.433  19.304  1.00 91.89  ? 226 TYR B C     1 
ATOM   6650  O  O     . TYR B 1 226 ? 23.498  66.208  19.281  1.00 91.13  ? 226 TYR B O     1 
ATOM   6651  C  CB    . TYR B 1 226 ? 25.915  68.472  19.233  1.00 90.17  ? 226 TYR B CB    1 
ATOM   6652  C  CG    . TYR B 1 226 ? 26.392  67.349  20.125  1.00 91.72  ? 226 TYR B CG    1 
ATOM   6653  C  CD1   . TYR B 1 226 ? 27.180  66.322  19.620  1.00 88.36  ? 226 TYR B CD1   1 
ATOM   6654  C  CD2   . TYR B 1 226 ? 26.051  67.312  21.473  1.00 90.35  ? 226 TYR B CD2   1 
ATOM   6655  C  CE1   . TYR B 1 226 ? 27.618  65.294  20.433  1.00 89.45  ? 226 TYR B CE1   1 
ATOM   6656  C  CE2   . TYR B 1 226 ? 26.479  66.283  22.292  1.00 90.11  ? 226 TYR B CE2   1 
ATOM   6657  C  CZ    . TYR B 1 226 ? 27.264  65.279  21.768  1.00 91.09  ? 226 TYR B CZ    1 
ATOM   6658  O  OH    . TYR B 1 226 ? 27.695  64.258  22.585  1.00 88.09  ? 226 TYR B OH    1 
ATOM   6659  N  N     . HIS B 1 227 ? 22.930  68.226  20.097  1.00 91.15  ? 227 HIS B N     1 
ATOM   6660  C  CA    . HIS B 1 227 ? 21.931  67.666  20.998  1.00 90.53  ? 227 HIS B CA    1 
ATOM   6661  C  C     . HIS B 1 227 ? 20.661  67.333  20.221  1.00 93.57  ? 227 HIS B C     1 
ATOM   6662  O  O     . HIS B 1 227 ? 19.957  66.372  20.539  1.00 94.69  ? 227 HIS B O     1 
ATOM   6663  C  CB    . HIS B 1 227 ? 21.613  68.643  22.135  1.00 91.81  ? 227 HIS B CB    1 
ATOM   6664  C  CG    . HIS B 1 227 ? 22.770  68.915  23.048  1.00 91.44  ? 227 HIS B CG    1 
ATOM   6665  N  ND1   . HIS B 1 227 ? 23.063  68.127  24.142  1.00 90.53  ? 227 HIS B ND1   1 
ATOM   6666  C  CD2   . HIS B 1 227 ? 23.704  69.897  23.035  1.00 87.92  ? 227 HIS B CD2   1 
ATOM   6667  C  CE1   . HIS B 1 227 ? 24.128  68.608  24.757  1.00 84.51  ? 227 HIS B CE1   1 
ATOM   6668  N  NE2   . HIS B 1 227 ? 24.538  69.682  24.105  1.00 84.23  ? 227 HIS B NE2   1 
ATOM   6669  N  N     . ALA B 1 228 ? 20.371  68.137  19.200  1.00 93.65  ? 228 ALA B N     1 
ATOM   6670  C  CA    . ALA B 1 228 ? 19.211  67.901  18.344  1.00 94.80  ? 228 ALA B CA    1 
ATOM   6671  C  C     . ALA B 1 228 ? 19.320  66.551  17.649  1.00 93.22  ? 228 ALA B C     1 
ATOM   6672  O  O     . ALA B 1 228 ? 18.328  65.845  17.469  1.00 98.74  ? 228 ALA B O     1 
ATOM   6673  C  CB    . ALA B 1 228 ? 19.070  69.013  17.323  1.00 96.50  ? 228 ALA B CB    1 
ATOM   6674  N  N     . SER B 1 229 ? 20.544  66.204  17.268  1.00 92.77  ? 229 SER B N     1 
ATOM   6675  C  CA    . SER B 1 229 ? 20.834  64.947  16.595  1.00 91.26  ? 229 SER B CA    1 
ATOM   6676  C  C     . SER B 1 229 ? 20.488  63.748  17.469  1.00 95.49  ? 229 SER B C     1 
ATOM   6677  O  O     . SER B 1 229 ? 20.252  62.648  16.965  1.00 93.35  ? 229 SER B O     1 
ATOM   6678  C  CB    . SER B 1 229 ? 22.295  64.899  16.193  1.00 88.13  ? 229 SER B CB    1 
ATOM   6679  N  N     . LYS B 1 230 ? 20.461  63.966  18.781  1.00 95.29  ? 230 LYS B N     1 
ATOM   6680  C  CA    . LYS B 1 230 ? 20.216  62.886  19.727  1.00 93.79  ? 230 LYS B CA    1 
ATOM   6681  C  C     . LYS B 1 230 ? 18.831  62.994  20.357  1.00 98.47  ? 230 LYS B C     1 
ATOM   6682  O  O     . LYS B 1 230 ? 18.592  62.462  21.442  1.00 100.10 ? 230 LYS B O     1 
ATOM   6683  C  CB    . LYS B 1 230 ? 21.302  62.881  20.803  1.00 88.39  ? 230 LYS B CB    1 
ATOM   6684  C  CG    . LYS B 1 230 ? 22.706  62.892  20.209  1.00 87.86  ? 230 LYS B CG    1 
ATOM   6685  C  CD    . LYS B 1 230 ? 23.791  62.738  21.256  1.00 87.37  ? 230 LYS B CD    1 
ATOM   6686  C  CE    . LYS B 1 230 ? 25.159  62.861  20.615  1.00 87.59  ? 230 LYS B CE    1 
ATOM   6687  N  NZ    . LYS B 1 230 ? 25.278  61.997  19.415  1.00 92.23  ? 230 LYS B NZ    1 
ATOM   6688  N  N     . GLY B 1 231 ? 17.925  63.684  19.665  1.00 98.88  ? 231 GLY B N     1 
ATOM   6689  C  CA    . GLY B 1 231 ? 16.544  63.817  20.101  1.00 100.83 ? 231 GLY B CA    1 
ATOM   6690  C  C     . GLY B 1 231 ? 16.403  64.469  21.462  1.00 101.87 ? 231 GLY B C     1 
ATOM   6691  O  O     . GLY B 1 231 ? 15.425  64.237  22.175  1.00 102.33 ? 231 GLY B O     1 
ATOM   6692  N  N     . ARG B 1 232 ? 17.386  65.291  21.817  1.00 100.85 ? 232 ARG B N     1 
ATOM   6693  C  CA    . ARG B 1 232 ? 17.451  65.892  23.141  1.00 101.28 ? 232 ARG B CA    1 
ATOM   6694  C  C     . ARG B 1 232 ? 16.622  67.165  23.228  1.00 101.03 ? 232 ARG B C     1 
ATOM   6695  O  O     . ARG B 1 232 ? 16.262  67.607  24.320  1.00 102.20 ? 232 ARG B O     1 
ATOM   6696  C  CB    . ARG B 1 232 ? 18.906  66.184  23.519  1.00 95.20  ? 232 ARG B CB    1 
ATOM   6697  C  CG    . ARG B 1 232 ? 19.758  64.933  23.697  1.00 92.62  ? 232 ARG B CG    1 
ATOM   6698  C  CD    . ARG B 1 232 ? 21.206  65.281  23.968  1.00 87.93  ? 232 ARG B CD    1 
ATOM   6699  N  NE    . ARG B 1 232 ? 21.965  64.131  24.451  1.00 82.07  ? 232 ARG B NE    1 
ATOM   6700  C  CZ    . ARG B 1 232 ? 23.283  64.125  24.608  1.00 83.19  ? 232 ARG B CZ    1 
ATOM   6701  N  NH1   . ARG B 1 232 ? 23.990  65.206  24.315  1.00 85.87  ? 232 ARG B NH1   1 
ATOM   6702  N  NH2   . ARG B 1 232 ? 23.899  63.038  25.055  1.00 85.55  ? 232 ARG B NH2   1 
ATOM   6703  N  N     . LEU B 1 233 ? 16.316  67.749  22.075  1.00 100.03 ? 233 LEU B N     1 
ATOM   6704  C  CA    . LEU B 1 233 ? 15.560  68.993  22.039  1.00 99.93  ? 233 LEU B CA    1 
ATOM   6705  C  C     . LEU B 1 233 ? 14.065  68.753  21.857  1.00 103.83 ? 233 LEU B C     1 
ATOM   6706  O  O     . LEU B 1 233 ? 13.256  69.652  22.094  1.00 105.91 ? 233 LEU B O     1 
ATOM   6707  C  CB    . LEU B 1 233 ? 16.096  69.900  20.934  1.00 96.40  ? 233 LEU B CB    1 
ATOM   6708  C  CG    . LEU B 1 233 ? 17.329  70.687  21.369  1.00 95.04  ? 233 LEU B CG    1 
ATOM   6709  C  CD1   . LEU B 1 233 ? 18.010  71.361  20.189  1.00 92.47  ? 233 LEU B CD1   1 
ATOM   6710  C  CD2   . LEU B 1 233 ? 16.927  71.712  22.420  1.00 96.03  ? 233 LEU B CD2   1 
ATOM   6711  N  N     . GLN B 1 234 ? 13.700  67.545  21.436  1.00 104.03 ? 234 GLN B N     1 
ATOM   6712  C  CA    . GLN B 1 234 ? 12.292  67.171  21.349  1.00 105.20 ? 234 GLN B CA    1 
ATOM   6713  C  C     . GLN B 1 234 ? 11.684  67.226  22.743  1.00 106.45 ? 234 GLN B C     1 
ATOM   6714  O  O     . GLN B 1 234 ? 12.306  66.787  23.711  1.00 109.09 ? 234 GLN B O     1 
ATOM   6715  C  CB    . GLN B 1 234 ? 12.132  65.785  20.743  1.00 103.72 ? 234 GLN B CB    1 
ATOM   6716  N  N     . GLY B 1 235 ? 10.469  67.755  22.837  1.00 107.83 ? 235 GLY B N     1 
ATOM   6717  C  CA    . GLY B 1 235 ? 9.808   67.951  24.116  1.00 105.12 ? 235 GLY B CA    1 
ATOM   6718  C  C     . GLY B 1 235 ? 10.639  68.770  25.091  1.00 107.53 ? 235 GLY B C     1 
ATOM   6719  O  O     . GLY B 1 235 ? 10.610  68.536  26.301  1.00 108.61 ? 235 GLY B O     1 
ATOM   6720  N  N     . ARG B 1 236 ? 11.382  69.735  24.554  1.00 105.66 ? 236 ARG B N     1 
ATOM   6721  C  CA    . ARG B 1 236 ? 12.257  70.579  25.357  1.00 102.00 ? 236 ARG B CA    1 
ATOM   6722  C  C     . ARG B 1 236 ? 12.606  71.855  24.602  1.00 99.54  ? 236 ARG B C     1 
ATOM   6723  O  O     . ARG B 1 236 ? 12.329  71.981  23.410  1.00 104.19 ? 236 ARG B O     1 
ATOM   6724  C  CB    . ARG B 1 236 ? 13.528  69.823  25.739  1.00 102.95 ? 236 ARG B CB    1 
ATOM   6725  N  N     . GLU B 1 237 ? 13.217  72.800  25.305  1.00 96.42  ? 237 GLU B N     1 
ATOM   6726  C  CA    . GLU B 1 237 ? 13.714  74.018  24.681  1.00 96.39  ? 237 GLU B CA    1 
ATOM   6727  C  C     . GLU B 1 237 ? 15.166  74.224  25.062  1.00 94.07  ? 237 GLU B C     1 
ATOM   6728  O  O     . GLU B 1 237 ? 15.600  73.776  26.123  1.00 94.71  ? 237 GLU B O     1 
ATOM   6729  C  CB    . GLU B 1 237 ? 12.878  75.220  25.094  1.00 92.44  ? 237 GLU B CB    1 
ATOM   6730  N  N     . GLY B 1 238 ? 15.922  74.894  24.201  1.00 90.88  ? 238 GLY B N     1 
ATOM   6731  C  CA    . GLY B 1 238 ? 17.306  75.188  24.513  1.00 90.16  ? 238 GLY B CA    1 
ATOM   6732  C  C     . GLY B 1 238 ? 17.365  76.650  24.905  1.00 96.59  ? 238 GLY B C     1 
ATOM   6733  O  O     . GLY B 1 238 ? 16.552  77.453  24.445  1.00 106.04 ? 238 GLY B O     1 
ATOM   6734  N  N     . GLY B 1 239 ? 18.315  77.005  25.757  1.00 92.25  ? 239 GLY B N     1 
ATOM   6735  C  CA    . GLY B 1 239 ? 18.456  78.383  26.185  1.00 87.85  ? 239 GLY B CA    1 
ATOM   6736  C  C     . GLY B 1 239 ? 19.800  78.935  25.771  1.00 92.15  ? 239 GLY B C     1 
ATOM   6737  O  O     . GLY B 1 239 ? 20.324  78.585  24.715  1.00 95.02  ? 239 GLY B O     1 
ATOM   6738  N  N     . ARG B 1 240 ? 20.353  79.812  26.603  1.00 92.78  ? 240 ARG B N     1 
ATOM   6739  C  CA    . ARG B 1 240 ? 21.655  80.409  26.336  1.00 93.62  ? 240 ARG B CA    1 
ATOM   6740  C  C     . ARG B 1 240 ? 22.761  79.369  26.509  1.00 92.01  ? 240 ARG B C     1 
ATOM   6741  O  O     . ARG B 1 240 ? 22.497  78.189  26.750  1.00 88.08  ? 240 ARG B O     1 
ATOM   6742  C  CB    . ARG B 1 240 ? 21.895  81.603  27.250  1.00 91.39  ? 240 ARG B CB    1 
ATOM   6743  N  N     . VAL B 1 241 ? 24.004  79.813  26.400  1.00 92.25  ? 241 VAL B N     1 
ATOM   6744  C  CA    . VAL B 1 241 ? 25.129  78.914  26.571  1.00 91.07  ? 241 VAL B CA    1 
ATOM   6745  C  C     . VAL B 1 241 ? 25.538  78.906  28.038  1.00 95.61  ? 241 VAL B C     1 
ATOM   6746  O  O     . VAL B 1 241 ? 25.587  79.959  28.677  1.00 95.31  ? 241 VAL B O     1 
ATOM   6747  C  CB    . VAL B 1 241 ? 26.324  79.336  25.685  1.00 93.74  ? 241 VAL B CB    1 
ATOM   6748  C  CG1   . VAL B 1 241 ? 27.614  78.629  26.113  1.00 91.17  ? 241 VAL B CG1   1 
ATOM   6749  C  CG2   . VAL B 1 241 ? 26.015  79.063  24.225  1.00 95.32  ? 241 VAL B CG2   1 
ATOM   6750  N  N     . ALA B 1 242 ? 25.800  77.718  28.576  1.00 93.55  ? 242 ALA B N     1 
ATOM   6751  C  CA    . ALA B 1 242 ? 26.339  77.599  29.923  1.00 90.37  ? 242 ALA B CA    1 
ATOM   6752  C  C     . ALA B 1 242 ? 27.704  76.955  29.821  1.00 91.51  ? 242 ALA B C     1 
ATOM   6753  O  O     . ALA B 1 242 ? 27.840  75.840  29.311  1.00 92.23  ? 242 ALA B O     1 
ATOM   6754  C  CB    . ALA B 1 242 ? 25.424  76.777  30.815  1.00 83.54  ? 242 ALA B CB    1 
ATOM   6755  N  N     . TRP B 1 243 ? 28.714  77.662  30.313  1.00 95.33  ? 243 TRP B N     1 
ATOM   6756  C  CA    . TRP B 1 243 ? 30.060  77.122  30.377  1.00 89.02  ? 243 TRP B CA    1 
ATOM   6757  C  C     . TRP B 1 243 ? 30.190  76.179  31.560  1.00 92.19  ? 243 TRP B C     1 
ATOM   6758  O  O     . TRP B 1 243 ? 29.957  76.550  32.710  1.00 92.85  ? 243 TRP B O     1 
ATOM   6759  C  CB    . TRP B 1 243 ? 31.075  78.261  30.425  1.00 94.78  ? 243 TRP B CB    1 
ATOM   6760  C  CG    . TRP B 1 243 ? 31.265  78.855  29.064  1.00 99.00  ? 243 TRP B CG    1 
ATOM   6761  C  CD1   . TRP B 1 243 ? 30.966  80.125  28.670  1.00 100.19 ? 243 TRP B CD1   1 
ATOM   6762  C  CD2   . TRP B 1 243 ? 31.815  78.197  27.916  1.00 100.36 ? 243 TRP B CD2   1 
ATOM   6763  N  NE1   . TRP B 1 243 ? 31.279  80.294  27.342  1.00 104.82 ? 243 TRP B NE1   1 
ATOM   6764  C  CE2   . TRP B 1 243 ? 31.807  79.125  26.857  1.00 103.28 ? 243 TRP B CE2   1 
ATOM   6765  C  CE3   . TRP B 1 243 ? 32.311  76.910  27.680  1.00 96.70  ? 243 TRP B CE3   1 
ATOM   6766  C  CZ2   . TRP B 1 243 ? 32.276  78.809  25.583  1.00 103.86 ? 243 TRP B CZ2   1 
ATOM   6767  C  CZ3   . TRP B 1 243 ? 32.776  76.600  26.419  1.00 96.61  ? 243 TRP B CZ3   1 
ATOM   6768  C  CH2   . TRP B 1 243 ? 32.754  77.543  25.386  1.00 100.95 ? 243 TRP B CH2   1 
ATOM   6769  N  N     . VAL B 1 244 ? 30.571  74.950  31.246  1.00 91.30  ? 244 VAL B N     1 
ATOM   6770  C  CA    . VAL B 1 244 ? 30.527  73.842  32.181  1.00 90.60  ? 244 VAL B CA    1 
ATOM   6771  C  C     . VAL B 1 244 ? 31.934  73.239  32.230  1.00 91.31  ? 244 VAL B C     1 
ATOM   6772  O  O     . VAL B 1 244 ? 32.773  73.605  31.418  1.00 93.82  ? 244 VAL B O     1 
ATOM   6773  C  CB    . VAL B 1 244 ? 29.424  72.825  31.737  1.00 87.53  ? 244 VAL B CB    1 
ATOM   6774  C  CG1   . VAL B 1 244 ? 29.978  71.431  31.451  1.00 86.14  ? 244 VAL B CG1   1 
ATOM   6775  C  CG2   . VAL B 1 244 ? 28.279  72.794  32.737  1.00 82.42  ? 244 VAL B CG2   1 
ATOM   6776  N  N     . ALA B 1 245 ? 32.222  72.385  33.207  1.00 93.20  ? 245 ALA B N     1 
ATOM   6777  C  CA    . ALA B 1 245 ? 33.531  71.737  33.284  1.00 94.83  ? 245 ALA B CA    1 
ATOM   6778  C  C     . ALA B 1 245 ? 33.405  70.335  33.866  1.00 93.27  ? 245 ALA B C     1 
ATOM   6779  O  O     . ALA B 1 245 ? 32.610  70.103  34.773  1.00 90.73  ? 245 ALA B O     1 
ATOM   6780  C  CB    . ALA B 1 245 ? 34.494  72.574  34.116  1.00 96.64  ? 245 ALA B CB    1 
ATOM   6781  N  N     . ASP B 1 246 ? 34.205  69.403  33.361  1.00 100.95 ? 246 ASP B N     1 
ATOM   6782  C  CA    . ASP B 1 246 ? 34.206  68.055  33.910  1.00 103.53 ? 246 ASP B CA    1 
ATOM   6783  C  C     . ASP B 1 246 ? 34.979  68.095  35.217  1.00 108.87 ? 246 ASP B C     1 
ATOM   6784  O  O     . ASP B 1 246 ? 36.017  68.742  35.296  1.00 109.88 ? 246 ASP B O     1 
ATOM   6785  C  CB    . ASP B 1 246 ? 34.839  67.066  32.925  1.00 104.61 ? 246 ASP B CB    1 
ATOM   6786  C  CG    . ASP B 1 246 ? 34.675  65.611  33.351  1.00 107.49 ? 246 ASP B CG    1 
ATOM   6787  O  OD1   . ASP B 1 246 ? 34.290  65.354  34.511  1.00 109.41 ? 246 ASP B OD1   1 
ATOM   6788  O  OD2   . ASP B 1 246 ? 34.945  64.717  32.521  1.00 108.58 ? 246 ASP B OD2   1 
ATOM   6789  N  N     . PRO B 1 247 ? 34.454  67.448  36.254  1.00 106.66 ? 247 PRO B N     1 
ATOM   6790  C  CA    . PRO B 1 247 ? 35.121  67.447  37.553  1.00 107.87 ? 247 PRO B CA    1 
ATOM   6791  C  C     . PRO B 1 247 ? 36.542  66.900  37.421  1.00 111.30 ? 247 PRO B C     1 
ATOM   6792  O  O     . PRO B 1 247 ? 37.494  67.455  37.975  1.00 110.27 ? 247 PRO B O     1 
ATOM   6793  C  CB    . PRO B 1 247 ? 34.325  66.637  38.560  1.00 102.60 ? 247 PRO B CB    1 
ATOM   6794  N  N     . LYS B 1 248 ? 36.672  65.808  36.673  1.00 111.12 ? 248 LYS B N     1 
ATOM   6795  C  CA    . LYS B 1 248 ? 37.959  65.163  36.452  1.00 110.91 ? 248 LYS B CA    1 
ATOM   6796  C  C     . LYS B 1 248 ? 38.852  66.007  35.545  1.00 112.21 ? 248 LYS B C     1 
ATOM   6797  O  O     . LYS B 1 248 ? 40.025  65.689  35.344  1.00 112.47 ? 248 LYS B O     1 
ATOM   6798  C  CB    . LYS B 1 248 ? 37.760  63.777  35.861  1.00 107.78 ? 248 LYS B CB    1 
ATOM   6799  N  N     . ASP B 1 249 ? 38.290  67.082  34.999  1.00 112.60 ? 249 ASP B N     1 
ATOM   6800  C  CA    . ASP B 1 249 ? 39.047  67.983  34.139  1.00 114.60 ? 249 ASP B CA    1 
ATOM   6801  C  C     . ASP B 1 249 ? 38.524  69.414  34.239  1.00 113.19 ? 249 ASP B C     1 
ATOM   6802  O  O     . ASP B 1 249 ? 37.860  69.910  33.324  1.00 113.82 ? 249 ASP B O     1 
ATOM   6803  C  CB    . ASP B 1 249 ? 38.978  67.501  32.702  1.00 115.39 ? 249 ASP B CB    1 
ATOM   6804  N  N     . PRO B 1 250 ? 38.825  70.064  35.362  1.00 111.31 ? 250 PRO B N     1 
ATOM   6805  C  CA    . PRO B 1 250 ? 38.300  71.393  35.667  1.00 110.81 ? 250 PRO B CA    1 
ATOM   6806  C  C     . PRO B 1 250 ? 39.059  72.474  34.907  1.00 112.57 ? 250 PRO B C     1 
ATOM   6807  O  O     . PRO B 1 250 ? 38.662  73.642  34.892  1.00 108.92 ? 250 PRO B O     1 
ATOM   6808  C  CB    . PRO B 1 250 ? 38.360  71.653  37.161  1.00 107.32 ? 250 PRO B CB    1 
ATOM   6809  N  N     . ARG B 1 251 ? 40.160  72.066  34.284  1.00 115.42 ? 251 ARG B N     1 
ATOM   6810  C  CA    . ARG B 1 251 ? 41.078  72.980  33.615  1.00 115.83 ? 251 ARG B CA    1 
ATOM   6811  C  C     . ARG B 1 251 ? 40.585  73.425  32.236  1.00 115.22 ? 251 ARG B C     1 
ATOM   6812  O  O     . ARG B 1 251 ? 40.885  74.535  31.789  1.00 111.75 ? 251 ARG B O     1 
ATOM   6813  C  CB    . ARG B 1 251 ? 42.460  72.325  33.500  1.00 114.63 ? 251 ARG B CB    1 
ATOM   6814  C  CG    . ARG B 1 251 ? 42.432  70.793  33.475  1.00 112.69 ? 251 ARG B CG    1 
ATOM   6815  C  CD    . ARG B 1 251 ? 42.045  70.253  32.106  1.00 113.02 ? 251 ARG B CD    1 
ATOM   6816  N  NE    . ARG B 1 251 ? 41.981  68.794  32.084  1.00 112.31 ? 251 ARG B NE    1 
ATOM   6817  C  CZ    . ARG B 1 251 ? 41.753  68.074  30.989  1.00 116.62 ? 251 ARG B CZ    1 
ATOM   6818  N  NH1   . ARG B 1 251 ? 41.565  68.678  29.823  1.00 117.03 ? 251 ARG B NH1   1 
ATOM   6819  N  NH2   . ARG B 1 251 ? 41.707  66.749  31.061  1.00 116.95 ? 251 ARG B NH2   1 
ATOM   6820  N  N     . LYS B 1 252 ? 39.827  72.561  31.568  1.00 115.46 ? 252 LYS B N     1 
ATOM   6821  C  CA    . LYS B 1 252 ? 39.312  72.865  30.237  1.00 110.60 ? 252 LYS B CA    1 
ATOM   6822  C  C     . LYS B 1 252 ? 37.795  73.051  30.250  1.00 108.71 ? 252 LYS B C     1 
ATOM   6823  O  O     . LYS B 1 252 ? 37.050  72.112  30.536  1.00 107.08 ? 252 LYS B O     1 
ATOM   6824  C  CB    . LYS B 1 252 ? 39.704  71.768  29.256  1.00 109.32 ? 252 LYS B CB    1 
ATOM   6825  N  N     . PRO B 1 253 ? 37.336  74.278  29.954  1.00 105.46 ? 253 PRO B N     1 
ATOM   6826  C  CA    . PRO B 1 253 ? 35.914  74.608  29.803  1.00 100.67 ? 253 PRO B CA    1 
ATOM   6827  C  C     . PRO B 1 253 ? 35.248  73.837  28.666  1.00 97.84  ? 253 PRO B C     1 
ATOM   6828  O  O     . PRO B 1 253 ? 35.890  73.548  27.659  1.00 99.48  ? 253 PRO B O     1 
ATOM   6829  C  CB    . PRO B 1 253 ? 35.935  76.110  29.507  1.00 98.40  ? 253 PRO B CB    1 
ATOM   6830  C  CG    . PRO B 1 253 ? 37.198  76.589  30.126  1.00 94.51  ? 253 PRO B CG    1 
ATOM   6831  C  CD    . PRO B 1 253 ? 38.179  75.483  29.892  1.00 103.88 ? 253 PRO B CD    1 
ATOM   6832  N  N     . ILE B 1 254 ? 33.969  73.523  28.834  1.00 96.64  ? 254 ILE B N     1 
ATOM   6833  C  CA    . ILE B 1 254 ? 33.204  72.758  27.856  1.00 94.34  ? 254 ILE B CA    1 
ATOM   6834  C  C     . ILE B 1 254 ? 31.766  73.282  27.821  1.00 92.79  ? 254 ILE B C     1 
ATOM   6835  O  O     . ILE B 1 254 ? 31.109  73.384  28.859  1.00 89.57  ? 254 ILE B O     1 
ATOM   6836  C  CB    . ILE B 1 254 ? 33.226  71.238  28.177  1.00 88.47  ? 254 ILE B CB    1 
ATOM   6837  C  CG1   . ILE B 1 254 ? 31.992  70.535  27.612  1.00 89.01  ? 254 ILE B CG1   1 
ATOM   6838  C  CG2   . ILE B 1 254 ? 33.297  71.002  29.669  1.00 93.01  ? 254 ILE B CG2   1 
ATOM   6839  C  CD1   . ILE B 1 254 ? 31.900  69.071  28.010  1.00 93.19  ? 254 ILE B CD1   1 
ATOM   6840  N  N     . PRO B 1 255 ? 31.289  73.647  26.617  1.00 93.35  ? 255 PRO B N     1 
ATOM   6841  C  CA    . PRO B 1 255 ? 29.997  74.320  26.416  1.00 92.24  ? 255 PRO B CA    1 
ATOM   6842  C  C     . PRO B 1 255 ? 28.787  73.407  26.584  1.00 87.92  ? 255 PRO B C     1 
ATOM   6843  O  O     . PRO B 1 255 ? 28.853  72.227  26.244  1.00 88.43  ? 255 PRO B O     1 
ATOM   6844  C  CB    . PRO B 1 255 ? 30.089  74.816  24.971  1.00 93.81  ? 255 PRO B CB    1 
ATOM   6845  C  CG    . PRO B 1 255 ? 30.986  73.821  24.307  1.00 92.97  ? 255 PRO B CG    1 
ATOM   6846  C  CD    . PRO B 1 255 ? 32.006  73.441  25.344  1.00 89.01  ? 255 PRO B CD    1 
ATOM   6847  N  N     . HIS B 1 256 ? 27.689  73.964  27.085  1.00 83.94  ? 256 HIS B N     1 
ATOM   6848  C  CA    . HIS B 1 256 ? 26.460  73.206  27.269  1.00 85.32  ? 256 HIS B CA    1 
ATOM   6849  C  C     . HIS B 1 256 ? 25.282  74.163  27.135  1.00 86.39  ? 256 HIS B C     1 
ATOM   6850  O  O     . HIS B 1 256 ? 25.467  75.362  26.942  1.00 87.82  ? 256 HIS B O     1 
ATOM   6851  C  CB    . HIS B 1 256 ? 26.436  72.495  28.627  1.00 84.13  ? 256 HIS B CB    1 
ATOM   6852  C  CG    . HIS B 1 256 ? 25.709  71.181  28.619  1.00 83.25  ? 256 HIS B CG    1 
ATOM   6853  N  ND1   . HIS B 1 256 ? 24.390  71.053  28.236  1.00 81.62  ? 256 HIS B ND1   1 
ATOM   6854  C  CD2   . HIS B 1 256 ? 26.120  69.936  28.963  1.00 80.89  ? 256 HIS B CD2   1 
ATOM   6855  C  CE1   . HIS B 1 256 ? 24.022  69.788  28.336  1.00 78.97  ? 256 HIS B CE1   1 
ATOM   6856  N  NE2   . HIS B 1 256 ? 25.053  69.090  28.775  1.00 81.30  ? 256 HIS B NE2   1 
ATOM   6857  N  N     . LEU B 1 257 ? 24.072  73.632  27.231  1.00 84.07  ? 257 LEU B N     1 
ATOM   6858  C  CA    . LEU B 1 257 ? 22.879  74.433  27.042  1.00 81.93  ? 257 LEU B CA    1 
ATOM   6859  C  C     . LEU B 1 257 ? 22.032  74.472  28.299  1.00 83.92  ? 257 LEU B C     1 
ATOM   6860  O  O     . LEU B 1 257 ? 21.647  73.428  28.835  1.00 83.18  ? 257 LEU B O     1 
ATOM   6861  C  CB    . LEU B 1 257 ? 22.055  73.892  25.872  1.00 86.53  ? 257 LEU B CB    1 
ATOM   6862  C  CG    . LEU B 1 257 ? 22.697  74.015  24.488  1.00 87.26  ? 257 LEU B CG    1 
ATOM   6863  C  CD1   . LEU B 1 257 ? 21.687  73.689  23.396  1.00 85.18  ? 257 LEU B CD1   1 
ATOM   6864  C  CD2   . LEU B 1 257 ? 23.281  75.408  24.293  1.00 90.73  ? 257 LEU B CD2   1 
ATOM   6865  N  N     . THR B 1 258 ? 21.725  75.685  28.750  1.00 83.35  ? 258 THR B N     1 
ATOM   6866  C  CA    . THR B 1 258 ? 20.951  75.882  29.968  1.00 85.05  ? 258 THR B CA    1 
ATOM   6867  C  C     . THR B 1 258 ? 19.553  75.275  29.878  1.00 81.32  ? 258 THR B C     1 
ATOM   6868  O  O     . THR B 1 258 ? 18.920  75.008  30.899  1.00 83.18  ? 258 THR B O     1 
ATOM   6869  C  CB    . THR B 1 258 ? 20.818  77.381  30.299  1.00 87.19  ? 258 THR B CB    1 
ATOM   6870  O  OG1   . THR B 1 258 ? 19.982  78.011  29.319  1.00 89.94  ? 258 THR B OG1   1 
ATOM   6871  C  CG2   . THR B 1 258 ? 22.178  78.056  30.283  1.00 86.24  ? 258 THR B CG2   1 
ATOM   6872  N  N     . GLY B 1 259 ? 19.084  75.041  28.656  1.00 84.31  ? 259 GLY B N     1 
ATOM   6873  C  CA    . GLY B 1 259 ? 17.776  74.448  28.450  1.00 79.46  ? 259 GLY B CA    1 
ATOM   6874  C  C     . GLY B 1 259 ? 17.804  72.952  28.694  1.00 81.33  ? 259 GLY B C     1 
ATOM   6875  O  O     . GLY B 1 259 ? 16.761  72.321  28.882  1.00 76.52  ? 259 GLY B O     1 
ATOM   6876  N  N     . LEU B 1 260 ? 19.011  72.390  28.694  1.00 78.58  ? 260 LEU B N     1 
ATOM   6877  C  CA    . LEU B 1 260 ? 19.198  70.951  28.835  1.00 83.66  ? 260 LEU B CA    1 
ATOM   6878  C  C     . LEU B 1 260 ? 19.920  70.588  30.137  1.00 83.19  ? 260 LEU B C     1 
ATOM   6879  O  O     . LEU B 1 260 ? 20.106  69.408  30.450  1.00 78.97  ? 260 LEU B O     1 
ATOM   6880  C  CB    . LEU B 1 260 ? 19.974  70.407  27.633  1.00 83.45  ? 260 LEU B CB    1 
ATOM   6881  C  CG    . LEU B 1 260 ? 19.328  70.647  26.268  1.00 83.74  ? 260 LEU B CG    1 
ATOM   6882  C  CD1   . LEU B 1 260 ? 20.251  70.207  25.145  1.00 84.80  ? 260 LEU B CD1   1 
ATOM   6883  C  CD2   . LEU B 1 260 ? 18.002  69.921  26.191  1.00 86.43  ? 260 LEU B CD2   1 
ATOM   6884  N  N     . LEU B 1 261 ? 20.326  71.606  30.888  1.00 78.02  ? 261 LEU B N     1 
ATOM   6885  C  CA    . LEU B 1 261 ? 20.982  71.402  32.173  1.00 73.46  ? 261 LEU B CA    1 
ATOM   6886  C  C     . LEU B 1 261 ? 19.974  71.562  33.303  1.00 77.63  ? 261 LEU B C     1 
ATOM   6887  O  O     . LEU B 1 261 ? 19.025  72.340  33.195  1.00 84.01  ? 261 LEU B O     1 
ATOM   6888  C  CB    . LEU B 1 261 ? 22.141  72.381  32.351  1.00 75.80  ? 261 LEU B CB    1 
ATOM   6889  C  CG    . LEU B 1 261 ? 23.345  72.119  31.450  1.00 77.48  ? 261 LEU B CG    1 
ATOM   6890  C  CD1   . LEU B 1 261 ? 24.460  73.125  31.722  1.00 77.13  ? 261 LEU B CD1   1 
ATOM   6891  C  CD2   . LEU B 1 261 ? 23.836  70.691  31.638  1.00 79.74  ? 261 LEU B CD2   1 
ATOM   6892  N  N     . VAL B 1 262 ? 20.178  70.810  34.376  1.00 77.01  ? 262 VAL B N     1 
ATOM   6893  C  CA    . VAL B 1 262 ? 19.325  70.874  35.559  1.00 79.39  ? 262 VAL B CA    1 
ATOM   6894  C  C     . VAL B 1 262 ? 20.176  71.244  36.766  1.00 75.70  ? 262 VAL B C     1 
ATOM   6895  O  O     . VAL B 1 262 ? 21.272  70.732  36.922  1.00 73.80  ? 262 VAL B O     1 
ATOM   6896  C  CB    . VAL B 1 262 ? 18.597  69.527  35.822  1.00 74.90  ? 262 VAL B CB    1 
ATOM   6897  C  CG1   . VAL B 1 262 ? 17.685  69.632  37.038  1.00 70.38  ? 262 VAL B CG1   1 
ATOM   6898  C  CG2   . VAL B 1 262 ? 17.818  69.077  34.588  1.00 70.88  ? 262 VAL B CG2   1 
ATOM   6899  N  N     . PRO B 1 263 ? 19.699  72.174  37.600  1.00 76.22  ? 263 PRO B N     1 
ATOM   6900  C  CA    . PRO B 1 263 ? 20.487  72.508  38.790  1.00 74.15  ? 263 PRO B CA    1 
ATOM   6901  C  C     . PRO B 1 263 ? 20.613  71.336  39.759  1.00 72.76  ? 263 PRO B C     1 
ATOM   6902  O  O     . PRO B 1 263 ? 19.672  70.553  39.913  1.00 73.70  ? 263 PRO B O     1 
ATOM   6903  C  CB    . PRO B 1 263 ? 19.691  73.651  39.433  1.00 74.81  ? 263 PRO B CB    1 
ATOM   6904  C  CG    . PRO B 1 263 ? 18.883  74.223  38.324  1.00 78.99  ? 263 PRO B CG    1 
ATOM   6905  C  CD    . PRO B 1 263 ? 18.548  73.075  37.423  1.00 77.51  ? 263 PRO B CD    1 
ATOM   6906  N  N     . VAL B 1 264 ? 21.783  71.204  40.373  1.00 70.01  ? 264 VAL B N     1 
ATOM   6907  C  CA    . VAL B 1 264 ? 21.945  70.318  41.514  1.00 69.68  ? 264 VAL B CA    1 
ATOM   6908  C  C     . VAL B 1 264 ? 21.770  71.166  42.767  1.00 65.13  ? 264 VAL B C     1 
ATOM   6909  O  O     . VAL B 1 264 ? 22.616  72.004  43.086  1.00 72.79  ? 264 VAL B O     1 
ATOM   6910  C  CB    . VAL B 1 264 ? 23.316  69.610  41.514  1.00 72.61  ? 264 VAL B CB    1 
ATOM   6911  C  CG1   . VAL B 1 264 ? 23.536  68.875  42.826  1.00 70.00  ? 264 VAL B CG1   1 
ATOM   6912  C  CG2   . VAL B 1 264 ? 23.419  68.651  40.324  1.00 73.03  ? 264 VAL B CG2   1 
ATOM   6913  N  N     . LEU B 1 265 ? 20.657  70.963  43.462  1.00 61.73  ? 265 LEU B N     1 
ATOM   6914  C  CA    . LEU B 1 265 ? 20.289  71.821  44.583  1.00 67.52  ? 265 LEU B CA    1 
ATOM   6915  C  C     . LEU B 1 265 ? 20.949  71.409  45.900  1.00 66.39  ? 265 LEU B C     1 
ATOM   6916  O  O     . LEU B 1 265 ? 20.679  70.333  46.431  1.00 58.74  ? 265 LEU B O     1 
ATOM   6917  C  CB    . LEU B 1 265 ? 18.778  71.839  44.749  1.00 64.40  ? 265 LEU B CB    1 
ATOM   6918  N  N     . THR B 1 266 ? 21.805  72.283  46.421  1.00 67.72  ? 266 THR B N     1 
ATOM   6919  C  CA    . THR B 1 266 ? 22.363  72.132  47.759  1.00 67.45  ? 266 THR B CA    1 
ATOM   6920  C  C     . THR B 1 266 ? 21.433  72.771  48.772  1.00 71.37  ? 266 THR B C     1 
ATOM   6921  O  O     . THR B 1 266 ? 20.378  73.297  48.418  1.00 79.88  ? 266 THR B O     1 
ATOM   6922  C  CB    . THR B 1 266 ? 23.767  72.758  47.845  1.00 20.00  ? 266 THR B CB    1 
ATOM   6923  O  OG1   . THR B 1 266 ? 23.696  74.146  47.497  1.00 20.00  ? 266 THR B OG1   1 
ATOM   6924  C  CG2   . THR B 1 266 ? 24.678  72.175  46.775  1.00 20.00  ? 266 THR B CG2   1 
ATOM   6925  N  N     . LEU B 1 267 ? 21.842  72.739  50.032  1.00 72.21  ? 267 LEU B N     1 
ATOM   6926  C  CA    . LEU B 1 267 ? 21.210  73.534  51.072  1.00 73.60  ? 267 LEU B CA    1 
ATOM   6927  C  C     . LEU B 1 267 ? 21.507  75.009  50.830  1.00 75.57  ? 267 LEU B C     1 
ATOM   6928  O  O     . LEU B 1 267 ? 20.726  75.883  51.204  1.00 76.91  ? 267 LEU B O     1 
ATOM   6929  C  CB    . LEU B 1 267 ? 21.705  73.102  52.451  1.00 69.14  ? 267 LEU B CB    1 
ATOM   6930  C  CG    . LEU B 1 267 ? 21.384  71.645  52.779  1.00 68.97  ? 267 LEU B CG    1 
ATOM   6931  C  CD1   . LEU B 1 267 ? 22.041  71.211  54.078  1.00 65.25  ? 267 LEU B CD1   1 
ATOM   6932  C  CD2   . LEU B 1 267 ? 19.873  71.453  52.840  1.00 67.43  ? 267 LEU B CD2   1 
ATOM   6933  N  N     . GLU B 1 268 ? 22.653  75.265  50.203  1.00 72.95  ? 268 GLU B N     1 
ATOM   6934  C  CA    . GLU B 1 268 ? 23.109  76.616  49.899  1.00 77.48  ? 268 GLU B CA    1 
ATOM   6935  C  C     . GLU B 1 268 ? 22.212  77.306  48.876  1.00 82.11  ? 268 GLU B C     1 
ATOM   6936  O  O     . GLU B 1 268 ? 22.020  78.523  48.922  1.00 87.10  ? 268 GLU B O     1 
ATOM   6937  C  CB    . GLU B 1 268 ? 24.542  76.567  49.373  1.00 78.02  ? 268 GLU B CB    1 
ATOM   6938  C  CG    . GLU B 1 268 ? 25.203  77.914  49.172  1.00 77.15  ? 268 GLU B CG    1 
ATOM   6939  C  CD    . GLU B 1 268 ? 26.587  77.777  48.573  1.00 82.97  ? 268 GLU B CD    1 
ATOM   6940  O  OE1   . GLU B 1 268 ? 26.850  76.739  47.927  1.00 87.26  ? 268 GLU B OE1   1 
ATOM   6941  O  OE2   . GLU B 1 268 ? 27.415  78.693  48.759  1.00 83.39  ? 268 GLU B OE2   1 
ATOM   6942  N  N     . ASP B 1 269 ? 21.665  76.517  47.956  1.00 80.42  ? 269 ASP B N     1 
ATOM   6943  C  CA    . ASP B 1 269 ? 20.781  77.033  46.917  1.00 81.19  ? 269 ASP B CA    1 
ATOM   6944  C  C     . ASP B 1 269 ? 19.393  77.308  47.487  1.00 78.68  ? 269 ASP B C     1 
ATOM   6945  O  O     . ASP B 1 269 ? 18.659  78.155  46.982  1.00 81.51  ? 269 ASP B O     1 
ATOM   6946  C  CB    . ASP B 1 269 ? 20.702  76.049  45.748  1.00 73.52  ? 269 ASP B CB    1 
ATOM   6947  C  CG    . ASP B 1 269 ? 22.036  75.885  45.035  1.00 77.36  ? 269 ASP B CG    1 
ATOM   6948  O  OD1   . ASP B 1 269 ? 22.653  76.907  44.664  1.00 77.99  ? 269 ASP B OD1   1 
ATOM   6949  O  OD2   . ASP B 1 269 ? 22.478  74.729  44.858  1.00 75.45  ? 269 ASP B OD2   1 
ATOM   6950  N  N     . LEU B 1 270 ? 18.999  76.530  48.485  1.00 79.68  ? 270 LEU B N     1 
ATOM   6951  C  CA    . LEU B 1 270 ? 17.785  76.795  49.247  1.00 81.47  ? 270 LEU B CA    1 
ATOM   6952  C  C     . LEU B 1 270 ? 18.124  77.559  50.524  1.00 82.19  ? 270 LEU B C     1 
ATOM   6953  O  O     . LEU B 1 270 ? 18.004  77.051  51.611  1.00 85.62  ? 270 LEU B O     1 
ATOM   6954  C  CB    . LEU B 1 270 ? 17.050  75.495  49.554  1.00 79.47  ? 270 LEU B CB    1 
ATOM   6955  C  CG    . LEU B 1 270 ? 16.879  74.528  48.382  1.00 79.69  ? 270 LEU B CG    1 
ATOM   6956  C  CD1   . LEU B 1 270 ? 16.110  73.284  48.782  1.00 70.58  ? 270 LEU B CD1   1 
ATOM   6957  C  CD2   . LEU B 1 270 ? 16.244  75.199  47.184  1.00 76.53  ? 270 LEU B CD2   1 
ATOM   6958  N  N     . HIS B 1 271 ? 18.517  78.801  50.374  1.00 84.34  ? 271 HIS B N     1 
ATOM   6959  C  CA    . HIS B 1 271 ? 18.854  79.682  51.498  1.00 90.79  ? 271 HIS B CA    1 
ATOM   6960  C  C     . HIS B 1 271 ? 19.688  79.023  52.598  1.00 89.85  ? 271 HIS B C     1 
ATOM   6961  O  O     . HIS B 1 271 ? 20.456  79.692  53.298  1.00 86.44  ? 271 HIS B O     1 
ATOM   6962  C  CB    . HIS B 1 271 ? 17.546  80.224  52.081  1.00 84.08  ? 271 HIS B CB    1 
ATOM   6963  N  N     . SER B 1 276 ? 15.582  76.512  55.073  1.00 99.14  ? 276 SER B N     1 
ATOM   6964  C  CA    . SER B 1 276 ? 14.921  76.410  56.366  1.00 95.91  ? 276 SER B CA    1 
ATOM   6965  C  C     . SER B 1 276 ? 14.024  75.202  56.382  1.00 95.57  ? 276 SER B C     1 
ATOM   6966  O  O     . SER B 1 276 ? 12.813  75.313  56.488  1.00 95.17  ? 276 SER B O     1 
ATOM   6967  C  CB    . SER B 1 276 ? 14.138  77.674  56.695  1.00 88.85  ? 276 SER B CB    1 
ATOM   6968  N  N     . LEU B 1 277 ? 14.649  74.044  56.259  1.00 96.32  ? 277 LEU B N     1 
ATOM   6969  C  CA    . LEU B 1 277 ? 13.974  72.783  56.445  1.00 93.97  ? 277 LEU B CA    1 
ATOM   6970  C  C     . LEU B 1 277 ? 14.797  72.007  57.452  1.00 88.29  ? 277 LEU B C     1 
ATOM   6971  O  O     . LEU B 1 277 ? 16.035  72.141  57.517  1.00 82.75  ? 277 LEU B O     1 
ATOM   6972  C  CB    . LEU B 1 277 ? 13.865  72.025  55.139  1.00 88.16  ? 277 LEU B CB    1 
ATOM   6973  N  N     . ALA B 1 278 ? 14.115  71.224  58.269  1.00 87.85  ? 278 ALA B N     1 
ATOM   6974  C  CA    . ALA B 1 278 ? 14.828  70.459  59.251  1.00 82.45  ? 278 ALA B CA    1 
ATOM   6975  C  C     . ALA B 1 278 ? 14.918  69.145  58.629  1.00 75.86  ? 278 ALA B C     1 
ATOM   6976  O  O     . ALA B 1 278 ? 13.935  68.471  58.517  1.00 75.12  ? 278 ALA B O     1 
ATOM   6977  C  CB    . ALA B 1 278 ? 14.041  70.361  60.535  1.00 81.51  ? 278 ALA B CB    1 
ATOM   6978  N  N     . LEU B 1 279 ? 16.114  68.766  58.247  1.00 74.83  ? 279 LEU B N     1 
ATOM   6979  C  CA    . LEU B 1 279 ? 16.301  67.477  57.669  1.00 74.04  ? 279 LEU B CA    1 
ATOM   6980  C  C     . LEU B 1 279 ? 16.833  66.585  58.744  1.00 73.50  ? 279 LEU B C     1 
ATOM   6981  O  O     . LEU B 1 279 ? 17.173  65.455  58.504  1.00 73.45  ? 279 LEU B O     1 
ATOM   6982  C  CB    . LEU B 1 279 ? 17.258  67.575  56.507  1.00 71.81  ? 279 LEU B CB    1 
ATOM   6983  C  CG    . LEU B 1 279 ? 16.900  68.670  55.522  1.00 72.22  ? 279 LEU B CG    1 
ATOM   6984  C  CD1   . LEU B 1 279 ? 17.763  68.547  54.296  1.00 70.48  ? 279 LEU B CD1   1 
ATOM   6985  C  CD2   . LEU B 1 279 ? 15.444  68.538  55.162  1.00 72.74  ? 279 LEU B CD2   1 
ATOM   6986  N  N     . SER B 1 280 ? 16.903  67.091  59.961  1.00 74.48  ? 280 SER B N     1 
ATOM   6987  C  CA    . SER B 1 280 ? 17.437  66.236  61.013  1.00 77.46  ? 280 SER B CA    1 
ATOM   6988  C  C     . SER B 1 280 ? 16.328  65.660  61.875  1.00 68.42  ? 280 SER B C     1 
ATOM   6989  O  O     . SER B 1 280 ? 15.409  66.367  62.280  1.00 76.28  ? 280 SER B O     1 
ATOM   6990  C  CB    . SER B 1 280 ? 18.433  67.002  61.889  1.00 74.17  ? 280 SER B CB    1 
ATOM   6991  O  OG    . SER B 1 280 ? 19.178  66.099  62.687  1.00 71.05  ? 280 SER B OG    1 
ATOM   6992  N  N     . LEU B 1 281 ? 16.417  64.363  62.131  1.00 67.02  ? 281 LEU B N     1 
ATOM   6993  C  CA    . LEU B 1 281 ? 15.437  63.677  62.946  1.00 72.57  ? 281 LEU B CA    1 
ATOM   6994  C  C     . LEU B 1 281 ? 15.973  63.410  64.349  1.00 67.35  ? 281 LEU B C     1 
ATOM   6995  O  O     . LEU B 1 281 ? 17.091  62.910  64.501  1.00 66.96  ? 281 LEU B O     1 
ATOM   6996  C  CB    . LEU B 1 281 ? 15.028  62.356  62.284  1.00 65.41  ? 281 LEU B CB    1 
ATOM   6997  C  CG    . LEU B 1 281 ? 14.431  62.489  60.884  1.00 65.94  ? 281 LEU B CG    1 
ATOM   6998  C  CD1   . LEU B 1 281 ? 14.114  61.114  60.298  1.00 65.92  ? 281 LEU B CD1   1 
ATOM   6999  C  CD2   . LEU B 1 281 ? 13.189  63.361  60.927  1.00 69.70  ? 281 LEU B CD2   1 
ATOM   7000  N  N     . PRO B 1 282 ? 15.173  63.739  65.378  1.00 67.95  ? 282 PRO B N     1 
ATOM   7001  C  CA    . PRO B 1 282 ? 15.439  63.228  66.727  1.00 63.67  ? 282 PRO B CA    1 
ATOM   7002  C  C     . PRO B 1 282 ? 15.391  61.710  66.680  1.00 68.67  ? 282 PRO B C     1 
ATOM   7003  O  O     . PRO B 1 282 ? 14.601  61.158  65.909  1.00 67.91  ? 282 PRO B O     1 
ATOM   7004  C  CB    . PRO B 1 282 ? 14.290  63.802  67.566  1.00 66.09  ? 282 PRO B CB    1 
ATOM   7005  C  CG    . PRO B 1 282 ? 13.798  64.977  66.793  1.00 66.93  ? 282 PRO B CG    1 
ATOM   7006  C  CD    . PRO B 1 282 ? 14.007  64.639  65.344  1.00 67.50  ? 282 PRO B CD    1 
ATOM   7007  N  N     . TRP B 1 283 ? 16.200  61.040  67.486  1.00 66.41  ? 283 TRP B N     1 
ATOM   7008  C  CA    . TRP B 1 283 ? 16.396  59.608  67.306  1.00 68.26  ? 283 TRP B CA    1 
ATOM   7009  C  C     . TRP B 1 283 ? 15.152  58.747  67.532  1.00 65.47  ? 283 TRP B C     1 
ATOM   7010  O  O     . TRP B 1 283 ? 15.036  57.670  66.945  1.00 64.04  ? 283 TRP B O     1 
ATOM   7011  C  CB    . TRP B 1 283 ? 17.534  59.140  68.204  1.00 64.32  ? 283 TRP B CB    1 
ATOM   7012  C  CG    . TRP B 1 283 ? 17.320  59.424  69.639  1.00 73.99  ? 283 TRP B CG    1 
ATOM   7013  C  CD1   . TRP B 1 283 ? 17.689  60.556  70.315  1.00 72.77  ? 283 TRP B CD1   1 
ATOM   7014  C  CD2   . TRP B 1 283 ? 16.709  58.563  70.599  1.00 69.76  ? 283 TRP B CD2   1 
ATOM   7015  N  NE1   . TRP B 1 283 ? 17.338  60.449  71.637  1.00 71.09  ? 283 TRP B NE1   1 
ATOM   7016  C  CE2   . TRP B 1 283 ? 16.736  59.233  71.839  1.00 70.66  ? 283 TRP B CE2   1 
ATOM   7017  C  CE3   . TRP B 1 283 ? 16.138  57.289  70.532  1.00 70.87  ? 283 TRP B CE3   1 
ATOM   7018  C  CZ2   . TRP B 1 283 ? 16.211  58.675  73.001  1.00 75.74  ? 283 TRP B CZ2   1 
ATOM   7019  C  CZ3   . TRP B 1 283 ? 15.620  56.732  71.688  1.00 73.61  ? 283 TRP B CZ3   1 
ATOM   7020  C  CH2   . TRP B 1 283 ? 15.659  57.425  72.905  1.00 76.09  ? 283 TRP B CH2   1 
ATOM   7021  N  N     . GLU B 1 284 ? 14.238  59.191  68.389  1.00 69.33  ? 284 GLU B N     1 
ATOM   7022  C  CA    . GLU B 1 284 ? 12.991  58.451  68.578  1.00 70.96  ? 284 GLU B CA    1 
ATOM   7023  C  C     . GLU B 1 284 ? 12.181  58.491  67.279  1.00 62.32  ? 284 GLU B C     1 
ATOM   7024  O  O     . GLU B 1 284 ? 11.568  57.499  66.873  1.00 61.78  ? 284 GLU B O     1 
ATOM   7025  C  CB    . GLU B 1 284 ? 12.171  59.013  69.741  1.00 75.85  ? 284 GLU B CB    1 
ATOM   7026  C  CG    . GLU B 1 284 ? 12.848  58.924  71.111  1.00 74.83  ? 284 GLU B CG    1 
ATOM   7027  C  CD    . GLU B 1 284 ? 13.442  60.250  71.565  1.00 83.53  ? 284 GLU B CD    1 
ATOM   7028  O  OE1   . GLU B 1 284 ? 13.831  61.071  70.701  1.00 79.64  ? 284 GLU B OE1   1 
ATOM   7029  O  OE2   . GLU B 1 284 ? 13.504  60.477  72.796  1.00 86.82  ? 284 GLU B OE2   1 
ATOM   7030  N  N     . GLU B 1 285 ? 12.207  59.645  66.622  1.00 60.71  ? 285 GLU B N     1 
ATOM   7031  C  CA    . GLU B 1 285 ? 11.494  59.817  65.367  1.00 61.21  ? 285 GLU B CA    1 
ATOM   7032  C  C     . GLU B 1 285 ? 12.136  59.019  64.229  1.00 66.98  ? 285 GLU B C     1 
ATOM   7033  O  O     . GLU B 1 285 ? 11.426  58.416  63.409  1.00 59.03  ? 285 GLU B O     1 
ATOM   7034  C  CB    . GLU B 1 285 ? 11.417  61.302  65.005  1.00 62.09  ? 285 GLU B CB    1 
ATOM   7035  C  CG    . GLU B 1 285 ? 10.530  61.587  63.808  1.00 69.36  ? 285 GLU B CG    1 
ATOM   7036  C  CD    . GLU B 1 285 ? 9.091   61.133  64.038  1.00 75.31  ? 285 GLU B CD    1 
ATOM   7037  O  OE1   . GLU B 1 285 ? 8.415   60.760  63.050  1.00 68.44  ? 285 GLU B OE1   1 
ATOM   7038  O  OE2   . GLU B 1 285 ? 8.640   61.144  65.208  1.00 74.58  ? 285 GLU B OE2   1 
ATOM   7039  N  N     . ARG B 1 286 ? 13.471  58.982  64.199  1.00 64.04  ? 286 ARG B N     1 
ATOM   7040  C  CA    . ARG B 1 286 ? 14.172  58.213  63.177  1.00 59.28  ? 286 ARG B CA    1 
ATOM   7041  C  C     . ARG B 1 286 ? 13.897  56.736  63.382  1.00 56.43  ? 286 ARG B C     1 
ATOM   7042  O  O     . ARG B 1 286 ? 13.673  56.006  62.427  1.00 55.43  ? 286 ARG B O     1 
ATOM   7043  C  CB    . ARG B 1 286 ? 15.690  58.462  63.207  1.00 58.43  ? 286 ARG B CB    1 
ATOM   7044  C  CG    . ARG B 1 286 ? 16.450  57.642  62.151  1.00 50.92  ? 286 ARG B CG    1 
ATOM   7045  C  CD    . ARG B 1 286 ? 17.953  57.972  62.080  1.00 51.26  ? 286 ARG B CD    1 
ATOM   7046  N  NE    . ARG B 1 286 ? 18.204  59.298  61.530  1.00 52.66  ? 286 ARG B NE    1 
ATOM   7047  C  CZ    . ARG B 1 286 ? 18.279  59.565  60.231  1.00 52.05  ? 286 ARG B CZ    1 
ATOM   7048  N  NH1   . ARG B 1 286 ? 18.108  58.590  59.342  1.00 53.06  ? 286 ARG B NH1   1 
ATOM   7049  N  NH2   . ARG B 1 286 ? 18.517  60.807  59.823  1.00 47.36  ? 286 ARG B NH2   1 
ATOM   7050  N  N     . ARG B 1 287 ? 13.909  56.307  64.640  1.00 54.16  ? 287 ARG B N     1 
ATOM   7051  C  CA    . ARG B 1 287 ? 13.629  54.924  64.987  1.00 58.67  ? 287 ARG B CA    1 
ATOM   7052  C  C     . ARG B 1 287 ? 12.214  54.537  64.514  1.00 63.32  ? 287 ARG B C     1 
ATOM   7053  O  O     . ARG B 1 287 ? 12.002  53.472  63.901  1.00 56.11  ? 287 ARG B O     1 
ATOM   7054  C  CB    . ARG B 1 287 ? 13.773  54.747  66.498  1.00 60.89  ? 287 ARG B CB    1 
ATOM   7055  C  CG    . ARG B 1 287 ? 13.563  53.341  67.016  1.00 67.31  ? 287 ARG B CG    1 
ATOM   7056  C  CD    . ARG B 1 287 ? 12.643  53.387  68.223  1.00 75.42  ? 287 ARG B CD    1 
ATOM   7057  N  NE    . ARG B 1 287 ? 13.334  53.231  69.498  1.00 76.25  ? 287 ARG B NE    1 
ATOM   7058  C  CZ    . ARG B 1 287 ? 12.939  53.813  70.628  1.00 76.60  ? 287 ARG B CZ    1 
ATOM   7059  N  NH1   . ARG B 1 287 ? 11.867  54.595  70.633  1.00 75.16  ? 287 ARG B NH1   1 
ATOM   7060  N  NH2   . ARG B 1 287 ? 13.616  53.620  71.751  1.00 78.60  ? 287 ARG B NH2   1 
ATOM   7061  N  N     . ARG B 1 288 ? 11.264  55.436  64.783  1.00 60.50  ? 288 ARG B N     1 
ATOM   7062  C  CA    . ARG B 1 288 ? 9.882   55.281  64.348  1.00 62.12  ? 288 ARG B CA    1 
ATOM   7063  C  C     . ARG B 1 288 ? 9.769   55.097  62.829  1.00 60.36  ? 288 ARG B C     1 
ATOM   7064  O  O     . ARG B 1 288 ? 9.207   54.098  62.344  1.00 61.02  ? 288 ARG B O     1 
ATOM   7065  C  CB    . ARG B 1 288 ? 9.070   56.504  64.792  1.00 64.67  ? 288 ARG B CB    1 
ATOM   7066  C  CG    . ARG B 1 288 ? 7.618   56.524  64.339  1.00 70.28  ? 288 ARG B CG    1 
ATOM   7067  C  CD    . ARG B 1 288 ? 7.028   57.917  64.532  1.00 73.80  ? 288 ARG B CD    1 
ATOM   7068  N  NE    . ARG B 1 288 ? 5.636   58.030  64.097  1.00 66.81  ? 288 ARG B NE    1 
ATOM   7069  C  CZ    . ARG B 1 288 ? 5.010   59.192  63.925  1.00 77.34  ? 288 ARG B CZ    1 
ATOM   7070  N  NH1   . ARG B 1 288 ? 5.658   60.330  64.142  1.00 73.94  ? 288 ARG B NH1   1 
ATOM   7071  N  NH2   . ARG B 1 288 ? 3.741   59.223  63.529  1.00 74.73  ? 288 ARG B NH2   1 
ATOM   7072  N  N     . ARG B 1 289 ? 10.315  56.051  62.077  1.00 53.80  ? 289 ARG B N     1 
ATOM   7073  C  CA    . ARG B 1 289 ? 10.267  55.966  60.622  1.00 54.55  ? 289 ARG B CA    1 
ATOM   7074  C  C     . ARG B 1 289 ? 10.988  54.715  60.117  1.00 63.78  ? 289 ARG B C     1 
ATOM   7075  O  O     . ARG B 1 289 ? 10.624  54.154  59.078  1.00 60.79  ? 289 ARG B O     1 
ATOM   7076  C  CB    . ARG B 1 289 ? 10.859  57.218  59.988  1.00 55.96  ? 289 ARG B CB    1 
ATOM   7077  C  CG    . ARG B 1 289 ? 10.048  58.484  60.256  1.00 62.36  ? 289 ARG B CG    1 
ATOM   7078  C  CD    . ARG B 1 289 ? 10.554  59.652  59.425  1.00 59.38  ? 289 ARG B CD    1 
ATOM   7079  N  NE    . ARG B 1 289 ? 9.887   60.908  59.766  1.00 63.75  ? 289 ARG B NE    1 
ATOM   7080  C  CZ    . ARG B 1 289 ? 9.981   62.025  59.048  1.00 69.13  ? 289 ARG B CZ    1 
ATOM   7081  N  NH1   . ARG B 1 289 ? 10.714  62.044  57.942  1.00 71.86  ? 289 ARG B NH1   1 
ATOM   7082  N  NH2   . ARG B 1 289 ? 9.341   63.121  59.432  1.00 65.38  ? 289 ARG B NH2   1 
ATOM   7083  N  N     . THR B 1 290 ? 12.000  54.276  60.863  1.00 56.07  ? 290 THR B N     1 
ATOM   7084  C  CA    . THR B 1 290 ? 12.758  53.104  60.474  1.00 59.57  ? 290 THR B CA    1 
ATOM   7085  C  C     . THR B 1 290 ? 11.821  51.913  60.526  1.00 59.55  ? 290 THR B C     1 
ATOM   7086  O  O     . THR B 1 290 ? 11.732  51.156  59.558  1.00 59.32  ? 290 THR B O     1 
ATOM   7087  C  CB    . THR B 1 290 ? 14.004  52.861  61.383  1.00 61.23  ? 290 THR B CB    1 
ATOM   7088  O  OG1   . THR B 1 290 ? 14.881  53.995  61.324  1.00 56.79  ? 290 THR B OG1   1 
ATOM   7089  C  CG2   . THR B 1 290 ? 14.763  51.622  60.939  1.00 45.58  ? 290 THR B CG2   1 
ATOM   7090  N  N     . ARG B 1 291 ? 11.099  51.766  61.636  1.00 65.77  ? 291 ARG B N     1 
ATOM   7091  C  CA    . ARG B 1 291 ? 10.136  50.657  61.765  1.00 66.56  ? 291 ARG B CA    1 
ATOM   7092  C  C     . ARG B 1 291 ? 9.049   50.699  60.685  1.00 63.53  ? 291 ARG B C     1 
ATOM   7093  O  O     . ARG B 1 291 ? 8.797   49.701  59.988  1.00 62.75  ? 291 ARG B O     1 
ATOM   7094  C  CB    . ARG B 1 291 ? 9.467   50.677  63.143  1.00 66.60  ? 291 ARG B CB    1 
ATOM   7095  C  CG    . ARG B 1 291 ? 10.341  50.186  64.290  1.00 72.30  ? 291 ARG B CG    1 
ATOM   7096  C  CD    . ARG B 1 291 ? 9.783   50.673  65.629  1.00 82.54  ? 291 ARG B CD    1 
ATOM   7097  N  NE    . ARG B 1 291 ? 10.618  50.290  66.770  1.00 88.89  ? 291 ARG B NE    1 
ATOM   7098  C  CZ    . ARG B 1 291 ? 10.455  50.746  68.011  1.00 89.50  ? 291 ARG B CZ    1 
ATOM   7099  N  NH1   . ARG B 1 291 ? 9.493   51.621  68.289  1.00 84.54  ? 291 ARG B NH1   1 
ATOM   7100  N  NH2   . ARG B 1 291 ? 11.267  50.335  68.978  1.00 88.55  ? 291 ARG B NH2   1 
ATOM   7101  N  N     . GLU B 1 292 ? 8.427   51.862  60.524  1.00 62.08  ? 292 GLU B N     1 
ATOM   7102  C  CA    . GLU B 1 292 ? 7.322   51.968  59.574  1.00 62.31  ? 292 GLU B CA    1 
ATOM   7103  C  C     . GLU B 1 292 ? 7.746   51.696  58.135  1.00 65.58  ? 292 GLU B C     1 
ATOM   7104  O  O     . GLU B 1 292 ? 7.059   50.961  57.406  1.00 62.10  ? 292 GLU B O     1 
ATOM   7105  C  CB    . GLU B 1 292 ? 6.656   53.338  59.687  1.00 61.46  ? 292 GLU B CB    1 
ATOM   7106  C  CG    . GLU B 1 292 ? 5.649   53.376  60.814  1.00 68.00  ? 292 GLU B CG    1 
ATOM   7107  C  CD    . GLU B 1 292 ? 4.603   52.282  60.657  1.00 69.05  ? 292 GLU B CD    1 
ATOM   7108  O  OE1   . GLU B 1 292 ? 3.928   52.264  59.603  1.00 73.76  ? 292 GLU B OE1   1 
ATOM   7109  O  OE2   . GLU B 1 292 ? 4.464   51.431  61.566  1.00 66.01  ? 292 GLU B OE2   1 
ATOM   7110  N  N     . ILE B 1 293 ? 8.870   52.277  57.723  1.00 64.63  ? 293 ILE B N     1 
ATOM   7111  C  CA    . ILE B 1 293 ? 9.358   52.046  56.371  1.00 65.45  ? 293 ILE B CA    1 
ATOM   7112  C  C     . ILE B 1 293 ? 9.763   50.582  56.228  1.00 62.39  ? 293 ILE B C     1 
ATOM   7113  O  O     . ILE B 1 293 ? 9.579   49.983  55.164  1.00 63.11  ? 293 ILE B O     1 
ATOM   7114  C  CB    . ILE B 1 293 ? 10.516  52.987  56.007  1.00 64.64  ? 293 ILE B CB    1 
ATOM   7115  C  CG1   . ILE B 1 293 ? 9.964   54.394  55.766  1.00 64.73  ? 293 ILE B CG1   1 
ATOM   7116  C  CG2   . ILE B 1 293 ? 11.220  52.525  54.745  1.00 63.69  ? 293 ILE B CG2   1 
ATOM   7117  C  CD1   . ILE B 1 293 ? 11.025  55.446  55.493  1.00 67.54  ? 293 ILE B CD1   1 
ATOM   7118  N  N     . ALA B 1 294 ? 10.270  49.995  57.309  1.00 59.72  ? 294 ALA B N     1 
ATOM   7119  C  CA    . ALA B 1 294 ? 10.598  48.578  57.288  1.00 61.18  ? 294 ALA B CA    1 
ATOM   7120  C  C     . ALA B 1 294 ? 9.361   47.728  56.991  1.00 64.19  ? 294 ALA B C     1 
ATOM   7121  O  O     . ALA B 1 294 ? 9.433   46.775  56.216  1.00 65.53  ? 294 ALA B O     1 
ATOM   7122  C  CB    . ALA B 1 294 ? 11.236  48.153  58.605  1.00 60.20  ? 294 ALA B CB    1 
ATOM   7123  N  N     . SER B 1 295 ? 8.235   48.056  57.618  1.00 62.56  ? 295 SER B N     1 
ATOM   7124  C  CA    . SER B 1 295 ? 6.997   47.307  57.372  1.00 63.87  ? 295 SER B CA    1 
ATOM   7125  C  C     . SER B 1 295 ? 6.470   47.523  55.951  1.00 62.00  ? 295 SER B C     1 
ATOM   7126  O  O     . SER B 1 295 ? 6.057   46.578  55.278  1.00 64.58  ? 295 SER B O     1 
ATOM   7127  C  CB    . SER B 1 295 ? 5.929   47.690  58.389  1.00 58.89  ? 295 SER B CB    1 
ATOM   7128  O  OG    . SER B 1 295 ? 6.231   47.131  59.654  1.00 70.16  ? 295 SER B OG    1 
ATOM   7129  N  N     . TRP B 1 296 ? 6.501   48.772  55.503  1.00 60.14  ? 296 TRP B N     1 
ATOM   7130  C  CA    . TRP B 1 296 ? 6.078   49.122  54.151  1.00 62.49  ? 296 TRP B CA    1 
ATOM   7131  C  C     . TRP B 1 296 ? 6.851   48.354  53.080  1.00 68.59  ? 296 TRP B C     1 
ATOM   7132  O  O     . TRP B 1 296 ? 6.244   47.710  52.216  1.00 62.34  ? 296 TRP B O     1 
ATOM   7133  C  CB    . TRP B 1 296 ? 6.243   50.619  53.941  1.00 64.64  ? 296 TRP B CB    1 
ATOM   7134  C  CG    . TRP B 1 296 ? 5.728   51.158  52.643  1.00 70.43  ? 296 TRP B CG    1 
ATOM   7135  C  CD1   . TRP B 1 296 ? 4.466   51.614  52.384  1.00 68.49  ? 296 TRP B CD1   1 
ATOM   7136  C  CD2   . TRP B 1 296 ? 6.478   51.350  51.439  1.00 72.81  ? 296 TRP B CD2   1 
ATOM   7137  N  NE1   . TRP B 1 296 ? 4.385   52.068  51.092  1.00 70.04  ? 296 TRP B NE1   1 
ATOM   7138  C  CE2   . TRP B 1 296 ? 5.606   51.914  50.486  1.00 69.08  ? 296 TRP B CE2   1 
ATOM   7139  C  CE3   . TRP B 1 296 ? 7.806   51.096  51.072  1.00 69.52  ? 296 TRP B CE3   1 
ATOM   7140  C  CZ2   . TRP B 1 296 ? 6.012   52.225  49.189  1.00 74.05  ? 296 TRP B CZ2   1 
ATOM   7141  C  CZ3   . TRP B 1 296 ? 8.209   51.405  49.784  1.00 70.55  ? 296 TRP B CZ3   1 
ATOM   7142  C  CH2   . TRP B 1 296 ? 7.316   51.963  48.858  1.00 76.62  ? 296 TRP B CH2   1 
ATOM   7143  N  N     . ILE B 1 297 ? 8.182   48.426  53.139  1.00 64.24  ? 297 ILE B N     1 
ATOM   7144  C  CA    . ILE B 1 297 ? 9.042   47.664  52.233  1.00 65.98  ? 297 ILE B CA    1 
ATOM   7145  C  C     . ILE B 1 297 ? 8.829   46.161  52.399  1.00 62.98  ? 297 ILE B C     1 
ATOM   7146  O  O     . ILE B 1 297 ? 8.819   45.415  51.419  1.00 63.58  ? 297 ILE B O     1 
ATOM   7147  C  CB    . ILE B 1 297 ? 10.517  48.017  52.464  1.00 66.62  ? 297 ILE B CB    1 
ATOM   7148  N  N     . GLY B 1 298 ? 8.666   45.725  53.644  1.00 62.47  ? 298 GLY B N     1 
ATOM   7149  C  CA    . GLY B 1 298 ? 8.450   44.321  53.954  1.00 61.41  ? 298 GLY B CA    1 
ATOM   7150  C  C     . GLY B 1 298 ? 7.273   43.709  53.210  1.00 73.95  ? 298 GLY B C     1 
ATOM   7151  O  O     . GLY B 1 298 ? 7.368   42.588  52.707  1.00 78.62  ? 298 GLY B O     1 
ATOM   7152  N  N     . ARG B 1 299 ? 6.152   44.427  53.142  1.00 69.03  ? 299 ARG B N     1 
ATOM   7153  C  CA    . ARG B 1 299 ? 4.963   43.877  52.487  1.00 73.92  ? 299 ARG B CA    1 
ATOM   7154  C  C     . ARG B 1 299 ? 5.040   44.073  50.972  1.00 75.31  ? 299 ARG B C     1 
ATOM   7155  O  O     . ARG B 1 299 ? 4.160   43.629  50.229  1.00 73.57  ? 299 ARG B O     1 
ATOM   7156  C  CB    . ARG B 1 299 ? 3.673   44.474  53.070  1.00 70.17  ? 299 ARG B CB    1 
ATOM   7157  C  CG    . ARG B 1 299 ? 3.411   45.949  52.782  1.00 75.06  ? 299 ARG B CG    1 
ATOM   7158  C  CD    . ARG B 1 299 ? 2.199   46.433  53.589  1.00 73.18  ? 299 ARG B CD    1 
ATOM   7159  N  NE    . ARG B 1 299 ? 2.432   46.266  55.023  1.00 73.42  ? 299 ARG B NE    1 
ATOM   7160  C  CZ    . ARG B 1 299 ? 2.672   47.257  55.881  1.00 74.73  ? 299 ARG B CZ    1 
ATOM   7161  N  NH1   . ARG B 1 299 ? 2.698   48.519  55.466  1.00 67.75  ? 299 ARG B NH1   1 
ATOM   7162  N  NH2   . ARG B 1 299 ? 2.880   46.980  57.165  1.00 73.40  ? 299 ARG B NH2   1 
ATOM   7163  N  N     . ARG B 1 300 ? 6.077   44.774  50.523  1.00 68.05  ? 300 ARG B N     1 
ATOM   7164  C  CA    . ARG B 1 300 ? 6.415   44.815  49.105  1.00 68.89  ? 300 ARG B CA    1 
ATOM   7165  C  C     . ARG B 1 300 ? 7.278   43.611  48.731  1.00 72.61  ? 300 ARG B C     1 
ATOM   7166  O  O     . ARG B 1 300 ? 7.397   43.254  47.557  1.00 71.69  ? 300 ARG B O     1 
ATOM   7167  C  CB    . ARG B 1 300 ? 7.156   46.108  48.758  1.00 71.17  ? 300 ARG B CB    1 
ATOM   7168  C  CG    . ARG B 1 300 ? 6.371   47.384  49.039  1.00 72.26  ? 300 ARG B CG    1 
ATOM   7169  C  CD    . ARG B 1 300 ? 4.981   47.268  48.479  1.00 70.97  ? 300 ARG B CD    1 
ATOM   7170  N  NE    . ARG B 1 300 ? 4.290   48.550  48.366  1.00 77.72  ? 300 ARG B NE    1 
ATOM   7171  C  CZ    . ARG B 1 300 ? 3.694   49.177  49.375  1.00 71.91  ? 300 ARG B CZ    1 
ATOM   7172  N  NH1   . ARG B 1 300 ? 3.705   48.650  50.592  1.00 65.11  ? 300 ARG B NH1   1 
ATOM   7173  N  NH2   . ARG B 1 300 ? 3.074   50.331  49.160  1.00 71.37  ? 300 ARG B NH2   1 
ATOM   7174  N  N     . LEU B 1 301 ? 7.891   42.999  49.741  1.00 74.69  ? 301 LEU B N     1 
ATOM   7175  C  CA    . LEU B 1 301 ? 8.952   42.016  49.520  1.00 78.51  ? 301 LEU B CA    1 
ATOM   7176  C  C     . LEU B 1 301 ? 8.479   40.571  49.546  1.00 72.79  ? 301 LEU B C     1 
ATOM   7177  O  O     . LEU B 1 301 ? 8.979   39.738  48.794  1.00 74.95  ? 301 LEU B O     1 
ATOM   7178  C  CB    . LEU B 1 301 ? 10.058  42.202  50.574  1.00 76.38  ? 301 LEU B CB    1 
ATOM   7179  C  CG    . LEU B 1 301 ? 11.504  42.411  50.118  1.00 73.28  ? 301 LEU B CG    1 
ATOM   7180  C  CD1   . LEU B 1 301 ? 11.559  43.393  48.963  1.00 72.63  ? 301 LEU B CD1   1 
ATOM   7181  C  CD2   . LEU B 1 301 ? 12.356  42.912  51.276  1.00 66.69  ? 301 LEU B CD2   1 
ATOM   7182  N  N     . GLY B 1 302 ? 7.524   40.273  50.418  1.00 77.27  ? 302 GLY B N     1 
ATOM   7183  C  CA    . GLY B 1 302 ? 7.016   38.920  50.536  1.00 77.58  ? 302 GLY B CA    1 
ATOM   7184  C  C     . GLY B 1 302 ? 8.066   38.002  51.135  1.00 79.12  ? 302 GLY B C     1 
ATOM   7185  O  O     . GLY B 1 302 ? 8.048   36.788  50.912  1.00 80.71  ? 302 GLY B O     1 
ATOM   7186  N  N     . LEU B 1 303 ? 8.984   38.577  51.906  1.00 75.82  ? 303 LEU B N     1 
ATOM   7187  C  CA    . LEU B 1 303 ? 10.054  37.789  52.509  1.00 79.37  ? 303 LEU B CA    1 
ATOM   7188  C  C     . LEU B 1 303 ? 9.813   37.586  53.998  1.00 74.31  ? 303 LEU B C     1 
ATOM   7189  O  O     . LEU B 1 303 ? 10.737  37.288  54.756  1.00 75.89  ? 303 LEU B O     1 
ATOM   7190  C  CB    . LEU B 1 303 ? 11.415  38.455  52.278  1.00 76.71  ? 303 LEU B CB    1 
ATOM   7191  C  CG    . LEU B 1 303 ? 11.838  38.545  50.810  1.00 77.20  ? 303 LEU B CG    1 
ATOM   7192  C  CD1   . LEU B 1 303 ? 13.251  39.112  50.665  1.00 69.59  ? 303 LEU B CD1   1 
ATOM   7193  C  CD2   . LEU B 1 303 ? 11.711  37.187  50.136  1.00 78.23  ? 303 LEU B CD2   1 
ATOM   7194  N  N     . GLY B 1 304 ? 8.561   37.742  54.409  1.00 75.81  ? 304 GLY B N     1 
ATOM   7195  C  CA    . GLY B 1 304 ? 8.187   37.527  55.792  1.00 77.18  ? 304 GLY B CA    1 
ATOM   7196  C  C     . GLY B 1 304 ? 7.997   38.830  56.539  1.00 78.86  ? 304 GLY B C     1 
ATOM   7197  O  O     . GLY B 1 304 ? 8.070   39.919  55.963  1.00 75.08  ? 304 GLY B O     1 
ATOM   7198  N  N     . THR B 1 305 ? 7.769   38.716  57.839  1.00 77.95  ? 305 THR B N     1 
ATOM   7199  C  CA    . THR B 1 305 ? 7.566   39.887  58.670  1.00 82.82  ? 305 THR B CA    1 
ATOM   7200  C  C     . THR B 1 305 ? 8.895   40.321  59.275  1.00 75.59  ? 305 THR B C     1 
ATOM   7201  O  O     . THR B 1 305 ? 9.539   39.549  59.987  1.00 76.58  ? 305 THR B O     1 
ATOM   7202  C  CB    . THR B 1 305 ? 6.548   39.616  59.786  1.00 80.42  ? 305 THR B CB    1 
ATOM   7203  O  OG1   . THR B 1 305 ? 5.259   39.388  59.204  1.00 79.65  ? 305 THR B OG1   1 
ATOM   7204  C  CG2   . THR B 1 305 ? 6.470   40.806  60.733  1.00 82.54  ? 305 THR B CG2   1 
ATOM   7205  N  N     . PRO B 1 306 ? 9.320   41.554  58.964  1.00 77.86  ? 306 PRO B N     1 
ATOM   7206  C  CA    . PRO B 1 306 ? 10.587  42.113  59.450  1.00 76.58  ? 306 PRO B CA    1 
ATOM   7207  C  C     . PRO B 1 306 ? 10.647  42.162  60.971  1.00 78.18  ? 306 PRO B C     1 
ATOM   7208  O  O     . PRO B 1 306 ? 9.843   42.852  61.597  1.00 82.63  ? 306 PRO B O     1 
ATOM   7209  C  CB    . PRO B 1 306 ? 10.599  43.528  58.862  1.00 72.95  ? 306 PRO B CB    1 
ATOM   7210  C  CG    . PRO B 1 306 ? 9.679   43.470  57.692  1.00 77.27  ? 306 PRO B CG    1 
ATOM   7211  C  CD    . PRO B 1 306 ? 8.614   42.484  58.064  1.00 75.88  ? 306 PRO B CD    1 
ATOM   7212  N  N     . GLU B 1 307 ? 11.602  41.446  61.551  1.00 74.56  ? 307 GLU B N     1 
ATOM   7213  C  CA    . GLU B 1 307 ? 11.775  41.407  62.998  1.00 77.65  ? 307 GLU B CA    1 
ATOM   7214  C  C     . GLU B 1 307 ? 13.042  42.150  63.414  1.00 78.66  ? 307 GLU B C     1 
ATOM   7215  O  O     . GLU B 1 307 ? 14.154  41.726  63.089  1.00 77.87  ? 307 GLU B O     1 
ATOM   7216  C  CB    . GLU B 1 307 ? 11.836  39.957  63.483  1.00 79.05  ? 307 GLU B CB    1 
ATOM   7217  C  CG    . GLU B 1 307 ? 11.411  39.737  64.931  1.00 88.53  ? 307 GLU B CG    1 
ATOM   7218  C  CD    . GLU B 1 307 ? 9.931   39.987  65.166  1.00 94.52  ? 307 GLU B CD    1 
ATOM   7219  O  OE1   . GLU B 1 307 ? 9.101   39.491  64.370  1.00 93.32  ? 307 GLU B OE1   1 
ATOM   7220  O  OE2   . GLU B 1 307 ? 9.598   40.666  66.162  1.00 97.48  ? 307 GLU B OE2   1 
ATOM   7221  N  N     . ALA B 1 308 ? 12.872  43.264  64.123  1.00 73.05  ? 308 ALA B N     1 
ATOM   7222  C  CA    . ALA B 1 308 ? 14.012  44.074  64.545  1.00 76.53  ? 308 ALA B CA    1 
ATOM   7223  C  C     . ALA B 1 308 ? 14.961  43.246  65.410  1.00 75.09  ? 308 ALA B C     1 
ATOM   7224  O  O     . ALA B 1 308 ? 14.522  42.557  66.334  1.00 78.57  ? 308 ALA B O     1 
ATOM   7225  C  CB    . ALA B 1 308 ? 13.538  45.305  65.294  1.00 75.91  ? 308 ALA B CB    1 
ATOM   7226  N  N     . VAL B 1 309 ? 16.255  43.299  65.097  1.00 69.12  ? 309 VAL B N     1 
ATOM   7227  C  CA    . VAL B 1 309 ? 17.233  42.465  65.791  1.00 72.41  ? 309 VAL B CA    1 
ATOM   7228  C  C     . VAL B 1 309 ? 17.852  43.168  67.001  1.00 78.65  ? 309 VAL B C     1 
ATOM   7229  O  O     . VAL B 1 309 ? 18.100  44.378  66.996  1.00 75.48  ? 309 VAL B O     1 
ATOM   7230  C  CB    . VAL B 1 309 ? 18.350  41.971  64.823  1.00 76.24  ? 309 VAL B CB    1 
ATOM   7231  C  CG1   . VAL B 1 309 ? 18.014  42.341  63.381  1.00 73.96  ? 309 VAL B CG1   1 
ATOM   7232  C  CG2   . VAL B 1 309 ? 19.738  42.482  65.229  1.00 68.44  ? 309 VAL B CG2   1 
ATOM   7233  N  N     . ARG B 1 310 ? 18.061  42.387  68.052  1.00 77.97  ? 310 ARG B N     1 
ATOM   7234  C  CA    . ARG B 1 310 ? 18.578  42.887  69.310  1.00 78.31  ? 310 ARG B CA    1 
ATOM   7235  C  C     . ARG B 1 310 ? 20.016  42.469  69.520  1.00 77.11  ? 310 ARG B C     1 
ATOM   7236  O  O     . ARG B 1 310 ? 20.461  41.455  68.993  1.00 73.14  ? 310 ARG B O     1 
ATOM   7237  C  CB    . ARG B 1 310 ? 17.737  42.370  70.468  1.00 89.91  ? 310 ARG B CB    1 
ATOM   7238  C  CG    . ARG B 1 310 ? 16.289  42.766  70.401  1.00 91.46  ? 310 ARG B CG    1 
ATOM   7239  C  CD    . ARG B 1 310 ? 15.443  41.786  71.174  1.00 95.32  ? 310 ARG B CD    1 
ATOM   7240  N  NE    . ARG B 1 310 ? 14.065  42.240  71.250  1.00 100.71 ? 310 ARG B NE    1 
ATOM   7241  C  CZ    . ARG B 1 310 ? 13.567  42.880  72.300  1.00 102.79 ? 310 ARG B CZ    1 
ATOM   7242  N  NH1   . ARG B 1 310 ? 14.338  43.134  73.353  1.00 100.17 ? 310 ARG B NH1   1 
ATOM   7243  N  NH2   . ARG B 1 310 ? 12.307  43.275  72.294  1.00 100.44 ? 310 ARG B NH2   1 
ATOM   7244  N  N     . ALA B 1 311 ? 20.742  43.255  70.300  1.00 77.96  ? 311 ALA B N     1 
ATOM   7245  C  CA    . ALA B 1 311 ? 22.115  42.909  70.610  1.00 79.24  ? 311 ALA B CA    1 
ATOM   7246  C  C     . ALA B 1 311 ? 22.437  43.297  72.036  1.00 78.27  ? 311 ALA B C     1 
ATOM   7247  O  O     . ALA B 1 311 ? 21.901  44.280  72.564  1.00 81.91  ? 311 ALA B O     1 
ATOM   7248  C  CB    . ALA B 1 311 ? 23.076  43.588  69.639  1.00 72.15  ? 311 ALA B CB    1 
ATOM   7249  N  N     . GLN B 1 312 ? 23.320  42.522  72.653  1.00 79.04  ? 312 GLN B N     1 
ATOM   7250  C  CA    . GLN B 1 312 ? 23.789  42.843  73.987  1.00 84.51  ? 312 GLN B CA    1 
ATOM   7251  C  C     . GLN B 1 312 ? 24.762  43.997  73.891  1.00 82.10  ? 312 GLN B C     1 
ATOM   7252  O  O     . GLN B 1 312 ? 25.755  43.933  73.167  1.00 83.73  ? 312 GLN B O     1 
ATOM   7253  C  CB    . GLN B 1 312 ? 24.441  41.623  74.655  1.00 83.97  ? 312 GLN B CB    1 
ATOM   7254  C  CG    . GLN B 1 312 ? 24.821  41.829  76.122  1.00 88.21  ? 312 GLN B CG    1 
ATOM   7255  C  CD    . GLN B 1 312 ? 23.626  41.926  77.050  1.00 93.06  ? 312 GLN B CD    1 
ATOM   7256  O  OE1   . GLN B 1 312 ? 22.480  41.784  76.624  1.00 94.42  ? 312 GLN B OE1   1 
ATOM   7257  N  NE2   . GLN B 1 312 ? 23.890  42.178  78.328  1.00 89.64  ? 312 GLN B NE2   1 
ATOM   7258  N  N     . ALA B 1 313 ? 24.454  45.060  74.622  1.00 82.26  ? 313 ALA B N     1 
ATOM   7259  C  CA    . ALA B 1 313 ? 25.293  46.245  74.667  1.00 80.12  ? 313 ALA B CA    1 
ATOM   7260  C  C     . ALA B 1 313 ? 25.843  46.466  76.070  1.00 80.63  ? 313 ALA B C     1 
ATOM   7261  O  O     . ALA B 1 313 ? 25.262  46.005  77.054  1.00 82.90  ? 313 ALA B O     1 
ATOM   7262  C  CB    . ALA B 1 313 ? 24.507  47.462  74.205  1.00 76.09  ? 313 ALA B CB    1 
ATOM   7263  N  N     . TYR B 1 314 ? 26.968  47.170  76.155  1.00 81.92  ? 314 TYR B N     1 
ATOM   7264  C  CA    . TYR B 1 314 ? 27.592  47.467  77.438  1.00 79.24  ? 314 TYR B CA    1 
ATOM   7265  C  C     . TYR B 1 314 ? 27.834  48.960  77.616  1.00 79.99  ? 314 TYR B C     1 
ATOM   7266  O  O     . TYR B 1 314 ? 28.305  49.635  76.695  1.00 76.28  ? 314 TYR B O     1 
ATOM   7267  C  CB    . TYR B 1 314 ? 28.920  46.720  77.573  1.00 77.06  ? 314 TYR B CB    1 
ATOM   7268  C  CG    . TYR B 1 314 ? 28.814  45.227  77.390  1.00 81.20  ? 314 TYR B CG    1 
ATOM   7269  C  CD1   . TYR B 1 314 ? 28.555  44.390  78.467  1.00 84.72  ? 314 TYR B CD1   1 
ATOM   7270  C  CD2   . TYR B 1 314 ? 28.967  44.653  76.138  1.00 78.45  ? 314 TYR B CD2   1 
ATOM   7271  C  CE1   . TYR B 1 314 ? 28.462  43.022  78.302  1.00 82.29  ? 314 TYR B CE1   1 
ATOM   7272  C  CE2   . TYR B 1 314 ? 28.873  43.290  75.963  1.00 81.50  ? 314 TYR B CE2   1 
ATOM   7273  C  CZ    . TYR B 1 314 ? 28.620  42.479  77.048  1.00 84.71  ? 314 TYR B CZ    1 
ATOM   7274  O  OH    . TYR B 1 314 ? 28.523  41.119  76.873  1.00 94.78  ? 314 TYR B OH    1 
ATOM   7275  N  N     . ARG B 1 315 ? 27.528  49.470  78.804  1.00 81.47  ? 315 ARG B N     1 
ATOM   7276  C  CA    . ARG B 1 315 ? 27.842  50.854  79.121  1.00 78.19  ? 315 ARG B CA    1 
ATOM   7277  C  C     . ARG B 1 315 ? 29.268  50.919  79.651  1.00 77.44  ? 315 ARG B C     1 
ATOM   7278  O  O     . ARG B 1 315 ? 29.610  50.267  80.639  1.00 77.50  ? 315 ARG B O     1 
ATOM   7279  C  CB    . ARG B 1 315 ? 26.854  51.431  80.138  1.00 79.84  ? 315 ARG B CB    1 
ATOM   7280  C  CG    . ARG B 1 315 ? 25.417  51.449  79.648  1.00 83.26  ? 315 ARG B CG    1 
ATOM   7281  C  CD    . ARG B 1 315 ? 24.478  52.055  80.676  1.00 87.64  ? 315 ARG B CD    1 
ATOM   7282  N  NE    . ARG B 1 315 ? 23.074  51.823  80.333  1.00 93.56  ? 315 ARG B NE    1 
ATOM   7283  C  CZ    . ARG B 1 315 ? 22.375  52.570  79.482  1.00 89.63  ? 315 ARG B CZ    1 
ATOM   7284  N  NH1   . ARG B 1 315 ? 22.945  53.601  78.876  1.00 89.29  ? 315 ARG B NH1   1 
ATOM   7285  N  NH2   . ARG B 1 315 ? 21.104  52.285  79.232  1.00 87.66  ? 315 ARG B NH2   1 
ATOM   7286  N  N     . LEU B 1 316 ? 30.103  51.704  78.983  1.00 74.23  ? 316 LEU B N     1 
ATOM   7287  C  CA    . LEU B 1 316 ? 31.486  51.838  79.394  1.00 68.68  ? 316 LEU B CA    1 
ATOM   7288  C  C     . LEU B 1 316 ? 31.560  52.910  80.471  1.00 72.79  ? 316 LEU B C     1 
ATOM   7289  O  O     . LEU B 1 316 ? 30.756  53.845  80.483  1.00 75.65  ? 316 LEU B O     1 
ATOM   7290  C  CB    . LEU B 1 316 ? 32.382  52.184  78.203  1.00 68.04  ? 316 LEU B CB    1 
ATOM   7291  C  CG    . LEU B 1 316 ? 32.304  51.213  77.023  1.00 71.15  ? 316 LEU B CG    1 
ATOM   7292  C  CD1   . LEU B 1 316 ? 33.163  51.691  75.859  1.00 63.22  ? 316 LEU B CD1   1 
ATOM   7293  C  CD2   . LEU B 1 316 ? 32.716  49.812  77.460  1.00 68.70  ? 316 LEU B CD2   1 
ATOM   7294  N  N     . SER B 1 317 ? 32.519  52.771  81.378  1.00 74.13  ? 317 SER B N     1 
ATOM   7295  C  CA    . SER B 1 317 ? 32.661  53.728  82.464  1.00 76.03  ? 317 SER B CA    1 
ATOM   7296  C  C     . SER B 1 317 ? 32.958  55.125  81.927  1.00 72.56  ? 317 SER B C     1 
ATOM   7297  O  O     . SER B 1 317 ? 33.650  55.286  80.920  1.00 72.44  ? 317 SER B O     1 
ATOM   7298  C  CB    . SER B 1 317 ? 33.760  53.278  83.434  1.00 71.31  ? 317 SER B CB    1 
ATOM   7299  O  OG    . SER B 1 317 ? 35.025  53.216  82.799  1.00 73.18  ? 317 SER B OG    1 
ATOM   7300  N  N     . ILE B 1 318 ? 32.424  56.132  82.608  1.00 75.60  ? 318 ILE B N     1 
ATOM   7301  C  CA    . ILE B 1 318 ? 32.667  57.518  82.239  1.00 74.81  ? 318 ILE B CA    1 
ATOM   7302  C  C     . ILE B 1 318 ? 34.135  57.861  82.462  1.00 75.93  ? 318 ILE B C     1 
ATOM   7303  O  O     . ILE B 1 318 ? 34.702  57.554  83.512  1.00 81.22  ? 318 ILE B O     1 
ATOM   7304  C  CB    . ILE B 1 318 ? 31.760  58.482  83.037  1.00 77.48  ? 318 ILE B CB    1 
ATOM   7305  C  CG1   . ILE B 1 318 ? 30.291  58.117  82.808  1.00 74.10  ? 318 ILE B CG1   1 
ATOM   7306  C  CG2   . ILE B 1 318 ? 32.014  59.934  82.643  1.00 72.72  ? 318 ILE B CG2   1 
ATOM   7307  C  CD1   . ILE B 1 318 ? 29.312  59.223  83.161  1.00 75.41  ? 318 ILE B CD1   1 
ATOM   7308  N  N     . PRO B 1 319 ? 34.768  58.464  81.447  1.00 76.96  ? 319 PRO B N     1 
ATOM   7309  C  CA    . PRO B 1 319 ? 36.166  58.904  81.534  1.00 73.99  ? 319 PRO B CA    1 
ATOM   7310  C  C     . PRO B 1 319 ? 36.401  59.965  82.606  1.00 75.55  ? 319 PRO B C     1 
ATOM   7311  O  O     . PRO B 1 319 ? 35.571  60.849  82.819  1.00 79.23  ? 319 PRO B O     1 
ATOM   7312  C  CB    . PRO B 1 319 ? 36.441  59.479  80.142  1.00 72.85  ? 319 PRO B CB    1 
ATOM   7313  C  CG    . PRO B 1 319 ? 35.450  58.789  79.247  1.00 74.51  ? 319 PRO B CG    1 
ATOM   7314  C  CD    . PRO B 1 319 ? 34.223  58.607  80.084  1.00 74.39  ? 319 PRO B CD    1 
ATOM   7315  N  N     . LYS B 1 320 ? 37.536  59.861  83.281  1.00 73.48  ? 320 LYS B N     1 
ATOM   7316  C  CA    . LYS B 1 320 ? 37.926  60.851  84.273  1.00 80.92  ? 320 LYS B CA    1 
ATOM   7317  C  C     . LYS B 1 320 ? 38.838  61.892  83.632  1.00 74.54  ? 320 LYS B C     1 
ATOM   7318  O  O     . LYS B 1 320 ? 40.059  61.764  83.672  1.00 75.43  ? 320 LYS B O     1 
ATOM   7319  C  CB    . LYS B 1 320 ? 38.625  60.177  85.460  1.00 81.75  ? 320 LYS B CB    1 
ATOM   7320  C  CG    . LYS B 1 320 ? 37.835  60.174  86.767  1.00 85.01  ? 320 LYS B CG    1 
ATOM   7321  C  CD    . LYS B 1 320 ? 37.251  58.800  87.094  1.00 83.63  ? 320 LYS B CD    1 
ATOM   7322  C  CE    . LYS B 1 320 ? 35.919  58.565  86.387  1.00 86.67  ? 320 LYS B CE    1 
ATOM   7323  N  NZ    . LYS B 1 320 ? 35.206  57.362  86.912  1.00 86.25  ? 320 LYS B NZ    1 
ATOM   7324  N  N     . LEU B 1 321 ? 38.242  62.909  83.018  1.00 75.23  ? 321 LEU B N     1 
ATOM   7325  C  CA    . LEU B 1 321 ? 39.020  63.973  82.399  1.00 72.70  ? 321 LEU B CA    1 
ATOM   7326  C  C     . LEU B 1 321 ? 39.698  64.797  83.479  1.00 74.03  ? 321 LEU B C     1 
ATOM   7327  O  O     . LEU B 1 321 ? 39.055  65.233  84.435  1.00 73.23  ? 321 LEU B O     1 
ATOM   7328  C  CB    . LEU B 1 321 ? 38.133  64.872  81.538  1.00 71.38  ? 321 LEU B CB    1 
ATOM   7329  C  CG    . LEU B 1 321 ? 38.334  64.862  80.027  1.00 71.64  ? 321 LEU B CG    1 
ATOM   7330  C  CD1   . LEU B 1 321 ? 37.773  66.146  79.413  1.00 67.36  ? 321 LEU B CD1   1 
ATOM   7331  C  CD2   . LEU B 1 321 ? 39.793  64.679  79.677  1.00 71.14  ? 321 LEU B CD2   1 
ATOM   7332  N  N     . MET B 1 322 ? 40.992  65.030  83.329  1.00 75.27  ? 322 MET B N     1 
ATOM   7333  C  CA    . MET B 1 322 ? 41.723  65.713  84.379  1.00 77.60  ? 322 MET B CA    1 
ATOM   7334  C  C     . MET B 1 322 ? 42.508  66.885  83.795  1.00 77.44  ? 322 MET B C     1 
ATOM   7335  O  O     . MET B 1 322 ? 43.312  66.701  82.881  1.00 75.97  ? 322 MET B O     1 
ATOM   7336  C  CB    . MET B 1 322 ? 42.664  64.729  85.089  1.00 82.71  ? 322 MET B CB    1 
ATOM   7337  C  CG    . MET B 1 322 ? 42.814  64.964  86.584  1.00 83.72  ? 322 MET B CG    1 
ATOM   7338  S  SD    . MET B 1 322 ? 41.282  64.506  87.426  1.00 88.76  ? 322 MET B SD    1 
ATOM   7339  C  CE    . MET B 1 322 ? 41.587  65.073  89.103  1.00 85.48  ? 322 MET B CE    1 
ATOM   7340  N  N     . GLY B 1 323 ? 42.271  68.086  84.313  1.00 79.65  ? 323 GLY B N     1 
ATOM   7341  C  CA    . GLY B 1 323 ? 43.139  69.215  84.025  1.00 80.51  ? 323 GLY B CA    1 
ATOM   7342  C  C     . GLY B 1 323 ? 44.183  69.299  85.129  1.00 84.79  ? 323 GLY B C     1 
ATOM   7343  O  O     . GLY B 1 323 ? 44.894  68.324  85.378  1.00 80.43  ? 323 GLY B O     1 
ATOM   7344  N  N     . ARG B 1 324 ? 44.279  70.449  85.793  1.00 85.93  ? 324 ARG B N     1 
ATOM   7345  C  CA    . ARG B 1 324 ? 45.048  70.538  87.034  1.00 87.25  ? 324 ARG B CA    1 
ATOM   7346  C  C     . ARG B 1 324 ? 44.294  69.794  88.134  1.00 87.34  ? 324 ARG B C     1 
ATOM   7347  O  O     . ARG B 1 324 ? 44.901  69.150  88.992  1.00 91.23  ? 324 ARG B O     1 
ATOM   7348  C  CB    . ARG B 1 324 ? 45.291  71.982  87.427  1.00 89.09  ? 324 ARG B CB    1 
ATOM   7349  N  N     . ARG B 1 325 ? 42.966  69.901  88.100  1.00 83.41  ? 325 ARG B N     1 
ATOM   7350  C  CA    . ARG B 1 325 ? 42.085  69.054  88.900  1.00 85.03  ? 325 ARG B CA    1 
ATOM   7351  C  C     . ARG B 1 325 ? 41.016  68.504  87.957  1.00 87.07  ? 325 ARG B C     1 
ATOM   7352  O  O     . ARG B 1 325 ? 41.102  68.687  86.741  1.00 86.50  ? 325 ARG B O     1 
ATOM   7353  C  CB    . ARG B 1 325 ? 41.340  69.869  89.946  1.00 84.64  ? 325 ARG B CB    1 
ATOM   7354  N  N     . ALA B 1 326 ? 40.010  67.835  88.509  1.00 85.73  ? 326 ALA B N     1 
ATOM   7355  C  CA    . ALA B 1 326 ? 38.957  67.252  87.684  1.00 81.22  ? 326 ALA B CA    1 
ATOM   7356  C  C     . ALA B 1 326 ? 38.139  68.219  86.839  1.00 80.86  ? 326 ALA B C     1 
ATOM   7357  O  O     . ALA B 1 326 ? 37.795  69.314  87.289  1.00 81.61  ? 326 ALA B O     1 
ATOM   7358  C  CB    . ALA B 1 326 ? 38.038  66.420  88.572  1.00 77.18  ? 326 ALA B CB    1 
ATOM   7359  N  N     . VAL B 1 327 ? 37.833  67.811  85.612  1.00 79.50  ? 327 VAL B N     1 
ATOM   7360  C  CA    . VAL B 1 327 ? 37.041  68.639  84.709  1.00 74.20  ? 327 VAL B CA    1 
ATOM   7361  C  C     . VAL B 1 327 ? 35.989  67.794  84.011  1.00 74.84  ? 327 VAL B C     1 
ATOM   7362  O  O     . VAL B 1 327 ? 36.159  66.584  83.841  1.00 73.35  ? 327 VAL B O     1 
ATOM   7363  C  CB    . VAL B 1 327 ? 37.918  69.332  83.649  1.00 75.91  ? 327 VAL B CB    1 
ATOM   7364  C  CG1   . VAL B 1 327 ? 38.857  70.343  84.297  1.00 74.80  ? 327 VAL B CG1   1 
ATOM   7365  C  CG2   . VAL B 1 327 ? 38.698  68.293  82.845  1.00 72.22  ? 327 VAL B CG2   1 
ATOM   7366  N  N     . SER B 1 328 ? 34.913  68.439  83.575  1.00 75.12  ? 328 SER B N     1 
ATOM   7367  C  CA    . SER B 1 328 ? 33.877  67.744  82.828  1.00 74.24  ? 328 SER B CA    1 
ATOM   7368  C  C     . SER B 1 328 ? 34.085  68.004  81.346  1.00 73.41  ? 328 SER B C     1 
ATOM   7369  O  O     . SER B 1 328 ? 33.608  67.255  80.494  1.00 69.96  ? 328 SER B O     1 
ATOM   7370  C  CB    . SER B 1 328 ? 32.488  68.214  83.262  1.00 70.35  ? 328 SER B CB    1 
ATOM   7371  O  OG    . SER B 1 328 ? 32.338  69.601  83.018  1.00 73.24  ? 328 SER B OG    1 
ATOM   7372  N  N     . LYS B 1 329 ? 34.839  69.060  81.060  1.00 71.72  ? 329 LYS B N     1 
ATOM   7373  C  CA    . LYS B 1 329 ? 35.103  69.497  79.699  1.00 70.26  ? 329 LYS B CA    1 
ATOM   7374  C  C     . LYS B 1 329 ? 36.411  70.283  79.663  1.00 70.24  ? 329 LYS B C     1 
ATOM   7375  O  O     . LYS B 1 329 ? 36.775  70.923  80.647  1.00 71.29  ? 329 LYS B O     1 
ATOM   7376  C  CB    . LYS B 1 329 ? 33.941  70.348  79.177  1.00 68.38  ? 329 LYS B CB    1 
ATOM   7377  C  CG    . LYS B 1 329 ? 33.656  71.617  79.982  1.00 66.80  ? 329 LYS B CG    1 
ATOM   7378  C  CD    . LYS B 1 329 ? 32.477  72.387  79.379  1.00 72.41  ? 329 LYS B CD    1 
ATOM   7379  C  CE    . LYS B 1 329 ? 32.192  73.692  80.115  1.00 69.31  ? 329 LYS B CE    1 
ATOM   7380  N  NZ    . LYS B 1 329 ? 31.783  73.461  81.529  1.00 75.96  ? 329 LYS B NZ    1 
ATOM   7381  N  N     . PRO B 1 330 ? 37.121  70.239  78.525  1.00 71.02  ? 330 PRO B N     1 
ATOM   7382  C  CA    . PRO B 1 330 ? 38.441  70.874  78.406  1.00 70.54  ? 330 PRO B CA    1 
ATOM   7383  C  C     . PRO B 1 330 ? 38.438  72.372  78.705  1.00 69.28  ? 330 PRO B C     1 
ATOM   7384  O  O     . PRO B 1 330 ? 39.462  72.893  79.136  1.00 66.66  ? 330 PRO B O     1 
ATOM   7385  C  CB    . PRO B 1 330 ? 38.825  70.607  76.949  1.00 67.40  ? 330 PRO B CB    1 
ATOM   7386  C  CG    . PRO B 1 330 ? 38.112  69.329  76.614  1.00 64.62  ? 330 PRO B CG    1 
ATOM   7387  C  CD    . PRO B 1 330 ? 36.800  69.410  77.348  1.00 65.62  ? 330 PRO B CD    1 
ATOM   7388  N  N     . ALA B 1 331 ? 37.319  73.048  78.468  1.00 67.17  ? 331 ALA B N     1 
ATOM   7389  C  CA    . ALA B 1 331 ? 37.226  74.478  78.747  1.00 71.81  ? 331 ALA B CA    1 
ATOM   7390  C  C     . ALA B 1 331 ? 37.336  74.786  80.239  1.00 72.44  ? 331 ALA B C     1 
ATOM   7391  O  O     . ALA B 1 331 ? 37.785  75.868  80.617  1.00 75.32  ? 331 ALA B O     1 
ATOM   7392  C  CB    . ALA B 1 331 ? 35.925  75.043  78.193  1.00 68.24  ? 331 ALA B CB    1 
ATOM   7393  N  N     . ASP B 1 332 ? 36.925  73.839  81.080  1.00 71.72  ? 332 ASP B N     1 
ATOM   7394  C  CA    . ASP B 1 332 ? 36.994  74.022  82.528  1.00 73.50  ? 332 ASP B CA    1 
ATOM   7395  C  C     . ASP B 1 332 ? 38.424  74.245  83.002  1.00 78.83  ? 332 ASP B C     1 
ATOM   7396  O  O     . ASP B 1 332 ? 38.650  74.864  84.041  1.00 80.83  ? 332 ASP B O     1 
ATOM   7397  C  CB    . ASP B 1 332 ? 36.404  72.816  83.260  1.00 73.85  ? 332 ASP B CB    1 
ATOM   7398  C  CG    . ASP B 1 332 ? 34.900  72.726  83.125  1.00 75.55  ? 332 ASP B CG    1 
ATOM   7399  O  OD1   . ASP B 1 332 ? 34.258  73.775  82.898  1.00 77.91  ? 332 ASP B OD1   1 
ATOM   7400  O  OD2   . ASP B 1 332 ? 34.360  71.606  83.271  1.00 74.66  ? 332 ASP B OD2   1 
ATOM   7401  N  N     . ALA B 1 333 ? 39.384  73.753  82.227  1.00 77.88  ? 333 ALA B N     1 
ATOM   7402  C  CA    . ALA B 1 333 ? 40.794  73.883  82.569  1.00 81.11  ? 333 ALA B CA    1 
ATOM   7403  C  C     . ALA B 1 333 ? 41.265  75.339  82.536  1.00 81.97  ? 333 ALA B C     1 
ATOM   7404  O  O     . ALA B 1 333 ? 42.286  75.674  83.130  1.00 84.73  ? 333 ALA B O     1 
ATOM   7405  C  CB    . ALA B 1 333 ? 41.645  73.028  81.635  1.00 73.84  ? 333 ALA B CB    1 
ATOM   7406  N  N     . LEU B 1 334 ? 40.536  76.199  81.833  1.00 80.19  ? 334 LEU B N     1 
ATOM   7407  C  CA    . LEU B 1 334 ? 40.888  77.618  81.784  1.00 81.68  ? 334 LEU B CA    1 
ATOM   7408  C  C     . LEU B 1 334 ? 40.734  78.272  83.151  1.00 84.17  ? 334 LEU B C     1 
ATOM   7409  O  O     . LEU B 1 334 ? 41.287  79.342  83.402  1.00 86.57  ? 334 LEU B O     1 
ATOM   7410  C  CB    . LEU B 1 334 ? 40.039  78.366  80.748  1.00 79.39  ? 334 LEU B CB    1 
ATOM   7411  C  CG    . LEU B 1 334 ? 40.339  78.076  79.274  1.00 78.60  ? 334 LEU B CG    1 
ATOM   7412  C  CD1   . LEU B 1 334 ? 39.416  78.864  78.348  1.00 74.90  ? 334 LEU B CD1   1 
ATOM   7413  C  CD2   . LEU B 1 334 ? 41.798  78.386  78.968  1.00 75.08  ? 334 LEU B CD2   1 
ATOM   7414  N  N     . ARG B 1 335 ? 39.976  77.631  84.032  1.00 85.84  ? 335 ARG B N     1 
ATOM   7415  C  CA    . ARG B 1 335 ? 39.764  78.160  85.371  1.00 89.61  ? 335 ARG B CA    1 
ATOM   7416  C  C     . ARG B 1 335 ? 40.372  77.240  86.426  1.00 87.77  ? 335 ARG B C     1 
ATOM   7417  O  O     . ARG B 1 335 ? 40.997  77.701  87.381  1.00 88.99  ? 335 ARG B O     1 
ATOM   7418  C  CB    . ARG B 1 335 ? 38.268  78.363  85.619  1.00 87.65  ? 335 ARG B CB    1 
ATOM   7419  C  CG    . ARG B 1 335 ? 37.679  79.446  84.729  1.00 91.54  ? 335 ARG B CG    1 
ATOM   7420  C  CD    . ARG B 1 335 ? 36.194  79.657  84.950  1.00 97.85  ? 335 ARG B CD    1 
ATOM   7421  N  NE    . ARG B 1 335 ? 35.752  80.901  84.324  1.00 102.59 ? 335 ARG B NE    1 
ATOM   7422  C  CZ    . ARG B 1 335 ? 35.488  81.032  83.026  1.00 105.92 ? 335 ARG B CZ    1 
ATOM   7423  N  NH1   . ARG B 1 335 ? 35.610  79.990  82.206  1.00 95.98  ? 335 ARG B NH1   1 
ATOM   7424  N  NH2   . ARG B 1 335 ? 35.094  82.207  82.546  1.00 103.49 ? 335 ARG B NH2   1 
ATOM   7425  N  N     . VAL B 1 336 ? 40.208  75.937  86.229  1.00 85.03  ? 336 VAL B N     1 
ATOM   7426  C  CA    . VAL B 1 336 ? 40.716  74.939  87.164  1.00 82.45  ? 336 VAL B CA    1 
ATOM   7427  C  C     . VAL B 1 336 ? 42.228  74.769  86.991  1.00 85.96  ? 336 VAL B C     1 
ATOM   7428  O  O     . VAL B 1 336 ? 42.949  74.498  87.953  1.00 88.96  ? 336 VAL B O     1 
ATOM   7429  C  CB    . VAL B 1 336 ? 39.982  73.586  86.974  1.00 83.64  ? 336 VAL B CB    1 
ATOM   7430  C  CG1   . VAL B 1 336 ? 40.734  72.451  87.633  1.00 80.60  ? 336 VAL B CG1   1 
ATOM   7431  C  CG2   . VAL B 1 336 ? 38.557  73.673  87.518  1.00 78.05  ? 336 VAL B CG2   1 
ATOM   7432  N  N     . GLY B 1 337 ? 42.709  74.952  85.766  1.00 86.34  ? 337 GLY B N     1 
ATOM   7433  C  CA    . GLY B 1 337 ? 44.121  74.779  85.472  1.00 86.72  ? 337 GLY B CA    1 
ATOM   7434  C  C     . GLY B 1 337 ? 44.400  73.609  84.545  1.00 84.94  ? 337 GLY B C     1 
ATOM   7435  O  O     . GLY B 1 337 ? 43.601  72.677  84.453  1.00 80.84  ? 337 GLY B O     1 
ATOM   7436  N  N     . PHE B 1 338 ? 45.537  73.662  83.856  1.00 83.12  ? 338 PHE B N     1 
ATOM   7437  C  CA    . PHE B 1 338 ? 45.903  72.635  82.885  1.00 82.46  ? 338 PHE B CA    1 
ATOM   7438  C  C     . PHE B 1 338 ? 46.529  71.427  83.555  1.00 82.43  ? 338 PHE B C     1 
ATOM   7439  O  O     . PHE B 1 338 ? 47.058  71.530  84.660  1.00 87.58  ? 338 PHE B O     1 
ATOM   7440  C  CB    . PHE B 1 338 ? 46.881  73.191  81.853  1.00 83.53  ? 338 PHE B CB    1 
ATOM   7441  C  CG    . PHE B 1 338 ? 46.522  74.552  81.360  1.00 86.63  ? 338 PHE B CG    1 
ATOM   7442  C  CD1   . PHE B 1 338 ? 45.323  74.772  80.698  1.00 84.16  ? 338 PHE B CD1   1 
ATOM   7443  C  CD2   . PHE B 1 338 ? 47.383  75.619  81.559  1.00 88.81  ? 338 PHE B CD2   1 
ATOM   7444  C  CE1   . PHE B 1 338 ? 44.990  76.037  80.248  1.00 88.11  ? 338 PHE B CE1   1 
ATOM   7445  C  CE2   . PHE B 1 338 ? 47.059  76.884  81.111  1.00 86.74  ? 338 PHE B CE2   1 
ATOM   7446  C  CZ    . PHE B 1 338 ? 45.863  77.095  80.458  1.00 86.06  ? 338 PHE B CZ    1 
ATOM   7447  N  N     . TYR B 1 339 ? 46.466  70.285  82.881  1.00 81.07  ? 339 TYR B N     1 
ATOM   7448  C  CA    . TYR B 1 339 ? 47.125  69.076  83.357  1.00 82.68  ? 339 TYR B CA    1 
ATOM   7449  C  C     . TYR B 1 339 ? 48.611  69.325  83.558  1.00 82.23  ? 339 TYR B C     1 
ATOM   7450  O  O     . TYR B 1 339 ? 49.152  69.093  84.637  1.00 78.78  ? 339 TYR B O     1 
ATOM   7451  C  CB    . TYR B 1 339 ? 46.917  67.931  82.370  1.00 79.62  ? 339 TYR B CB    1 
ATOM   7452  C  CG    . TYR B 1 339 ? 47.640  66.659  82.742  1.00 80.54  ? 339 TYR B CG    1 
ATOM   7453  C  CD1   . TYR B 1 339 ? 47.183  65.849  83.771  1.00 80.22  ? 339 TYR B CD1   1 
ATOM   7454  C  CD2   . TYR B 1 339 ? 48.788  66.267  82.059  1.00 82.96  ? 339 TYR B CD2   1 
ATOM   7455  C  CE1   . TYR B 1 339 ? 47.846  64.681  84.112  1.00 78.14  ? 339 TYR B CE1   1 
ATOM   7456  C  CE2   . TYR B 1 339 ? 49.456  65.105  82.390  1.00 83.23  ? 339 TYR B CE2   1 
ATOM   7457  C  CZ    . TYR B 1 339 ? 48.979  64.314  83.417  1.00 82.82  ? 339 TYR B CZ    1 
ATOM   7458  O  OH    . TYR B 1 339 ? 49.637  63.152  83.755  1.00 85.51  ? 339 TYR B OH    1 
ATOM   7459  N  N     . ARG B 1 340 ? 49.257  69.803  82.504  1.00 82.66  ? 340 ARG B N     1 
ATOM   7460  C  CA    . ARG B 1 340 ? 50.663  70.152  82.557  1.00 83.11  ? 340 ARG B CA    1 
ATOM   7461  C  C     . ARG B 1 340 ? 50.898  71.472  81.837  1.00 85.49  ? 340 ARG B C     1 
ATOM   7462  O  O     . ARG B 1 340 ? 50.476  71.654  80.693  1.00 86.99  ? 340 ARG B O     1 
ATOM   7463  C  CB    . ARG B 1 340 ? 51.510  69.048  81.946  1.00 80.83  ? 340 ARG B CB    1 
ATOM   7464  N  N     . ALA B 1 341 ? 51.557  72.398  82.521  1.00 87.82  ? 341 ALA B N     1 
ATOM   7465  C  CA    . ALA B 1 341 ? 51.957  73.658  81.912  1.00 92.43  ? 341 ALA B CA    1 
ATOM   7466  C  C     . ALA B 1 341 ? 53.408  73.954  82.267  1.00 93.68  ? 341 ALA B C     1 
ATOM   7467  O  O     . ALA B 1 341 ? 53.931  73.447  83.261  1.00 87.44  ? 341 ALA B O     1 
ATOM   7468  C  CB    . ALA B 1 341 ? 51.050  74.794  82.359  1.00 87.57  ? 341 ALA B CB    1 
ATOM   7469  N  N     . GLN B 1 342 ? 54.051  74.769  81.440  1.00 94.12  ? 342 GLN B N     1 
ATOM   7470  C  CA    . GLN B 1 342 ? 55.413  75.216  81.689  1.00 98.15  ? 342 GLN B CA    1 
ATOM   7471  C  C     . GLN B 1 342 ? 55.484  76.719  81.469  1.00 98.57  ? 342 GLN B C     1 
ATOM   7472  O  O     . GLN B 1 342 ? 54.483  77.339  81.105  1.00 99.26  ? 342 GLN B O     1 
ATOM   7473  C  CB    . GLN B 1 342 ? 56.399  74.483  80.773  1.00 98.09  ? 342 GLN B CB    1 
ATOM   7474  C  CG    . GLN B 1 342 ? 55.720  73.703  79.649  1.00 100.59 ? 342 GLN B CG    1 
ATOM   7475  C  CD    . GLN B 1 342 ? 56.699  73.125  78.640  1.00 106.85 ? 342 GLN B CD    1 
ATOM   7476  O  OE1   . GLN B 1 342 ? 57.894  73.432  78.664  1.00 107.79 ? 342 GLN B OE1   1 
ATOM   7477  N  NE2   . GLN B 1 342 ? 56.191  72.283  77.741  1.00 96.98  ? 342 GLN B NE2   1 
ATOM   7478  N  N     . GLU B 1 343 ? 56.645  77.308  81.731  1.00 99.68  ? 343 GLU B N     1 
ATOM   7479  C  CA    . GLU B 1 343 ? 56.878  78.703  81.384  1.00 99.45  ? 343 GLU B CA    1 
ATOM   7480  C  C     . GLU B 1 343 ? 56.519  78.918  79.914  1.00 97.40  ? 343 GLU B C     1 
ATOM   7481  O  O     . GLU B 1 343 ? 57.055  78.244  79.032  1.00 98.32  ? 343 GLU B O     1 
ATOM   7482  C  CB    . GLU B 1 343 ? 58.335  79.078  81.654  1.00 101.77 ? 343 GLU B CB    1 
ATOM   7483  C  CG    . GLU B 1 343 ? 58.700  80.515  81.332  1.00 105.59 ? 343 GLU B CG    1 
ATOM   7484  C  CD    . GLU B 1 343 ? 60.166  80.802  81.611  1.00 108.38 ? 343 GLU B CD    1 
ATOM   7485  O  OE1   . GLU B 1 343 ? 60.879  79.867  82.036  1.00 108.26 ? 343 GLU B OE1   1 
ATOM   7486  O  OE2   . GLU B 1 343 ? 60.606  81.954  81.395  1.00 106.60 ? 343 GLU B OE2   1 
ATOM   7487  N  N     . THR B 1 344 ? 55.603  79.841  79.651  1.00 93.64  ? 344 THR B N     1 
ATOM   7488  C  CA    . THR B 1 344 ? 55.087  80.008  78.298  1.00 93.45  ? 344 THR B CA    1 
ATOM   7489  C  C     . THR B 1 344 ? 54.975  81.473  77.906  1.00 90.00  ? 344 THR B C     1 
ATOM   7490  O  O     . THR B 1 344 ? 54.587  82.314  78.715  1.00 90.82  ? 344 THR B O     1 
ATOM   7491  C  CB    . THR B 1 344 ? 53.709  79.326  78.150  1.00 94.08  ? 344 THR B CB    1 
ATOM   7492  O  OG1   . THR B 1 344 ? 53.836  77.929  78.442  1.00 94.07  ? 344 THR B OG1   1 
ATOM   7493  C  CG2   . THR B 1 344 ? 53.161  79.491  76.740  1.00 86.25  ? 344 THR B CG2   1 
ATOM   7494  N  N     . ALA B 1 345 ? 55.324  81.773  76.660  1.00 89.69  ? 345 ALA B N     1 
ATOM   7495  C  CA    . ALA B 1 345 ? 55.140  83.109  76.117  1.00 89.70  ? 345 ALA B CA    1 
ATOM   7496  C  C     . ALA B 1 345 ? 54.304  83.061  74.844  1.00 90.88  ? 345 ALA B C     1 
ATOM   7497  O  O     . ALA B 1 345 ? 54.601  82.298  73.923  1.00 90.62  ? 345 ALA B O     1 
ATOM   7498  C  CB    . ALA B 1 345 ? 56.485  83.764  75.846  1.00 96.19  ? 345 ALA B CB    1 
ATOM   7499  N  N     . LEU B 1 346 ? 53.258  83.877  74.804  1.00 88.85  ? 346 LEU B N     1 
ATOM   7500  C  CA    . LEU B 1 346 ? 52.377  83.956  73.643  1.00 90.76  ? 346 LEU B CA    1 
ATOM   7501  C  C     . LEU B 1 346 ? 52.500  85.341  73.028  1.00 92.84  ? 346 LEU B C     1 
ATOM   7502  O  O     . LEU B 1 346 ? 52.806  86.298  73.728  1.00 96.67  ? 346 LEU B O     1 
ATOM   7503  C  CB    . LEU B 1 346 ? 50.918  83.680  74.031  1.00 85.99  ? 346 LEU B CB    1 
ATOM   7504  C  CG    . LEU B 1 346 ? 50.431  82.253  74.325  1.00 85.36  ? 346 LEU B CG    1 
ATOM   7505  C  CD1   . LEU B 1 346 ? 51.501  81.208  74.033  1.00 83.10  ? 346 LEU B CD1   1 
ATOM   7506  C  CD2   . LEU B 1 346 ? 49.902  82.115  75.750  1.00 78.42  ? 346 LEU B CD2   1 
ATOM   7507  N  N     . ALA B 1 347 ? 52.240  85.464  71.732  1.00 92.13  ? 347 ALA B N     1 
ATOM   7508  C  CA    . ALA B 1 347 ? 52.332  86.775  71.095  1.00 89.55  ? 347 ALA B CA    1 
ATOM   7509  C  C     . ALA B 1 347 ? 51.005  87.190  70.479  1.00 93.43  ? 347 ALA B C     1 
ATOM   7510  O  O     . ALA B 1 347 ? 50.226  86.350  70.043  1.00 93.59  ? 347 ALA B O     1 
ATOM   7511  C  CB    . ALA B 1 347 ? 53.420  86.777  70.041  1.00 90.81  ? 347 ALA B CB    1 
ATOM   7512  N  N     . LEU B 1 348 ? 50.742  88.492  70.461  1.00 95.69  ? 348 LEU B N     1 
ATOM   7513  C  CA    . LEU B 1 348 ? 49.517  89.009  69.866  1.00 93.54  ? 348 LEU B CA    1 
ATOM   7514  C  C     . LEU B 1 348 ? 49.781  89.697  68.529  1.00 94.59  ? 348 LEU B C     1 
ATOM   7515  O  O     . LEU B 1 348 ? 50.672  90.537  68.415  1.00 98.17  ? 348 LEU B O     1 
ATOM   7516  C  CB    . LEU B 1 348 ? 48.830  89.982  70.822  1.00 94.79  ? 348 LEU B CB    1 
ATOM   7517  C  CG    . LEU B 1 348 ? 47.564  90.615  70.250  1.00 98.43  ? 348 LEU B CG    1 
ATOM   7518  C  CD1   . LEU B 1 348 ? 46.525  89.544  69.969  1.00 96.69  ? 348 LEU B CD1   1 
ATOM   7519  C  CD2   . LEU B 1 348 ? 47.016  91.676  71.186  1.00 99.17  ? 348 LEU B CD2   1 
ATOM   7520  N  N     . LEU B 1 349 ? 48.998  89.330  67.521  1.00 95.39  ? 349 LEU B N     1 
ATOM   7521  C  CA    . LEU B 1 349 ? 49.042  89.981  66.217  1.00 95.42  ? 349 LEU B CA    1 
ATOM   7522  C  C     . LEU B 1 349 ? 47.656  90.493  65.816  1.00 97.74  ? 349 LEU B C     1 
ATOM   7523  O  O     . LEU B 1 349 ? 46.739  89.703  65.583  1.00 97.01  ? 349 LEU B O     1 
ATOM   7524  C  CB    . LEU B 1 349 ? 49.588  89.013  65.167  1.00 96.35  ? 349 LEU B CB    1 
ATOM   7525  C  CG    . LEU B 1 349 ? 49.569  89.467  63.711  1.00 96.69  ? 349 LEU B CG    1 
ATOM   7526  C  CD1   . LEU B 1 349 ? 50.283  90.800  63.568  1.00 98.91  ? 349 LEU B CD1   1 
ATOM   7527  C  CD2   . LEU B 1 349 ? 50.218  88.408  62.833  1.00 93.52  ? 349 LEU B CD2   1 
ATOM   7528  N  N     . ARG B 1 350 ? 47.511  91.812  65.730  1.00 97.53  ? 350 ARG B N     1 
ATOM   7529  C  CA    . ARG B 1 350 ? 46.229  92.430  65.402  1.00 95.88  ? 350 ARG B CA    1 
ATOM   7530  C  C     . ARG B 1 350 ? 46.206  92.978  63.977  1.00 97.86  ? 350 ARG B C     1 
ATOM   7531  O  O     . ARG B 1 350 ? 47.127  93.676  63.556  1.00 99.92  ? 350 ARG B O     1 
ATOM   7532  C  CB    . ARG B 1 350 ? 45.920  93.543  66.403  1.00 94.75  ? 350 ARG B CB    1 
ATOM   7533  C  CG    . ARG B 1 350 ? 45.836  93.060  67.845  1.00 97.44  ? 350 ARG B CG    1 
ATOM   7534  C  CD    . ARG B 1 350 ? 45.524  94.200  68.804  1.00 101.96 ? 350 ARG B CD    1 
ATOM   7535  N  NE    . ARG B 1 350 ? 44.148  94.172  69.293  1.00 103.67 ? 350 ARG B NE    1 
ATOM   7536  C  CZ    . ARG B 1 350 ? 43.103  94.612  68.599  1.00 104.92 ? 350 ARG B CZ    1 
ATOM   7537  N  NH1   . ARG B 1 350 ? 41.882  94.557  69.115  1.00 99.81  ? 350 ARG B NH1   1 
ATOM   7538  N  NH2   . ARG B 1 350 ? 43.283  95.111  67.386  1.00 104.32 ? 350 ARG B NH2   1 
ATOM   7539  N  N     . LEU B 1 351 ? 45.143  92.658  63.242  1.00 98.73  ? 351 LEU B N     1 
ATOM   7540  C  CA    . LEU B 1 351 ? 45.001  93.074  61.850  1.00 96.02  ? 351 LEU B CA    1 
ATOM   7541  C  C     . LEU B 1 351 ? 43.694  93.832  61.615  1.00 98.79  ? 351 LEU B C     1 
ATOM   7542  O  O     . LEU B 1 351 ? 43.245  93.968  60.475  1.00 96.07  ? 351 LEU B O     1 
ATOM   7543  C  CB    . LEU B 1 351 ? 45.071  91.856  60.924  1.00 92.88  ? 351 LEU B CB    1 
ATOM   7544  C  CG    . LEU B 1 351 ? 46.266  90.915  61.114  1.00 95.25  ? 351 LEU B CG    1 
ATOM   7545  C  CD1   . LEU B 1 351 ? 46.210  89.762  60.123  1.00 92.52  ? 351 LEU B CD1   1 
ATOM   7546  C  CD2   . LEU B 1 351 ? 47.576  91.672  60.978  1.00 97.32  ? 351 LEU B CD2   1 
ATOM   7547  N  N     . ASP B 1 352 ? 43.081  94.313  62.695  1.00 99.24  ? 352 ASP B N     1 
ATOM   7548  C  CA    . ASP B 1 352 ? 41.800  95.009  62.603  1.00 98.38  ? 352 ASP B CA    1 
ATOM   7549  C  C     . ASP B 1 352 ? 41.951  96.525  62.699  1.00 99.09  ? 352 ASP B C     1 
ATOM   7550  O  O     . ASP B 1 352 ? 41.043  97.269  62.325  1.00 102.85 ? 352 ASP B O     1 
ATOM   7551  C  CB    . ASP B 1 352 ? 40.844  94.510  63.690  1.00 101.40 ? 352 ASP B CB    1 
ATOM   7552  C  CG    . ASP B 1 352 ? 41.412  94.669  65.086  1.00 101.58 ? 352 ASP B CG    1 
ATOM   7553  O  OD1   . ASP B 1 352 ? 42.655  94.714  65.222  1.00 101.83 ? 352 ASP B OD1   1 
ATOM   7554  O  OD2   . ASP B 1 352 ? 40.619  94.739  66.050  1.00 101.72 ? 352 ASP B OD2   1 
ATOM   7555  N  N     . GLY B 1 353 ? 43.092  96.980  63.208  1.00 102.94 ? 353 GLY B N     1 
ATOM   7556  C  CA    . GLY B 1 353 ? 43.402  98.398  63.229  1.00 97.29  ? 353 GLY B CA    1 
ATOM   7557  C  C     . GLY B 1 353 ? 43.489  98.951  64.635  1.00 98.82  ? 353 GLY B C     1 
ATOM   7558  O  O     . GLY B 1 353 ? 43.826  100.116 64.836  1.00 101.35 ? 353 GLY B O     1 
ATOM   7559  N  N     . ALA B 1 354 ? 43.197  98.102  65.612  1.00 101.97 ? 354 ALA B N     1 
ATOM   7560  C  CA    . ALA B 1 354 ? 43.187  98.509  67.012  1.00 103.77 ? 354 ALA B CA    1 
ATOM   7561  C  C     . ALA B 1 354 ? 44.450  98.005  67.702  1.00 105.24 ? 354 ALA B C     1 
ATOM   7562  O  O     . ALA B 1 354 ? 45.351  97.475  67.049  1.00 103.78 ? 354 ALA B O     1 
ATOM   7563  C  CB    . ALA B 1 354 ? 41.939  97.996  67.713  1.00 103.06 ? 354 ALA B CB    1 
ATOM   7564  N  N     . GLN B 1 355 ? 44.525  98.172  69.017  1.00 105.02 ? 355 GLN B N     1 
ATOM   7565  C  CA    . GLN B 1 355 ? 45.745  97.827  69.737  1.00 109.59 ? 355 GLN B CA    1 
ATOM   7566  C  C     . GLN B 1 355 ? 45.512  96.984  70.988  1.00 110.49 ? 355 GLN B C     1 
ATOM   7567  O  O     . GLN B 1 355 ? 44.455  97.060  71.619  1.00 109.03 ? 355 GLN B O     1 
ATOM   7568  C  CB    . GLN B 1 355 ? 46.496  99.104  70.131  1.00 113.58 ? 355 GLN B CB    1 
ATOM   7569  C  CG    . GLN B 1 355 ? 45.781  99.949  71.190  1.00 115.17 ? 355 GLN B CG    1 
ATOM   7570  C  CD    . GLN B 1 355 ? 46.128  99.545  72.621  1.00 116.79 ? 355 GLN B CD    1 
ATOM   7571  O  OE1   . GLN B 1 355 ? 47.282  99.237  72.933  1.00 114.64 ? 355 GLN B OE1   1 
ATOM   7572  N  NE2   . GLN B 1 355 ? 45.124  99.535  73.493  1.00 115.32 ? 355 GLN B NE2   1 
ATOM   7573  N  N     . GLY B 1 356 ? 46.510  96.171  71.328  1.00 109.67 ? 356 GLY B N     1 
ATOM   7574  C  CA    . GLY B 1 356 ? 46.561  95.523  72.627  1.00 110.54 ? 356 GLY B CA    1 
ATOM   7575  C  C     . GLY B 1 356 ? 45.674  94.312  72.839  1.00 105.86 ? 356 GLY B C     1 
ATOM   7576  O  O     . GLY B 1 356 ? 44.701  94.094  72.115  1.00 104.54 ? 356 GLY B O     1 
ATOM   7577  N  N     . TRP B 1 357 ? 46.021  93.523  73.851  1.00 103.00 ? 357 TRP B N     1 
ATOM   7578  C  CA    . TRP B 1 357 ? 45.198  92.400  74.269  1.00 101.65 ? 357 TRP B CA    1 
ATOM   7579  C  C     . TRP B 1 357 ? 43.849  92.900  74.766  1.00 102.57 ? 357 TRP B C     1 
ATOM   7580  O  O     . TRP B 1 357 ? 43.793  93.796  75.611  1.00 102.38 ? 357 TRP B O     1 
ATOM   7581  C  CB    . TRP B 1 357 ? 45.893  91.603  75.376  1.00 99.52  ? 357 TRP B CB    1 
ATOM   7582  C  CG    . TRP B 1 357 ? 47.155  90.918  74.952  1.00 99.07  ? 357 TRP B CG    1 
ATOM   7583  C  CD1   . TRP B 1 357 ? 48.387  91.485  74.802  1.00 97.74  ? 357 TRP B CD1   1 
ATOM   7584  C  CD2   . TRP B 1 357 ? 47.310  89.531  74.631  1.00 102.74 ? 357 TRP B CD2   1 
ATOM   7585  N  NE1   . TRP B 1 357 ? 49.301  90.535  74.406  1.00 97.03  ? 357 TRP B NE1   1 
ATOM   7586  C  CE2   . TRP B 1 357 ? 48.664  89.327  74.294  1.00 96.51  ? 357 TRP B CE2   1 
ATOM   7587  C  CE3   . TRP B 1 357 ? 46.434  88.440  74.594  1.00 99.11  ? 357 TRP B CE3   1 
ATOM   7588  C  CZ2   . TRP B 1 357 ? 49.162  88.080  73.922  1.00 94.71  ? 357 TRP B CZ2   1 
ATOM   7589  C  CZ3   . TRP B 1 357 ? 46.931  87.202  74.227  1.00 95.31  ? 357 TRP B CZ3   1 
ATOM   7590  C  CH2   . TRP B 1 357 ? 48.281  87.032  73.897  1.00 95.87  ? 357 TRP B CH2   1 
ATOM   7591  N  N     . PRO B 1 358 ? 42.754  92.339  74.229  1.00 98.55  ? 358 PRO B N     1 
ATOM   7592  C  CA    . PRO B 1 358 ? 41.448  92.556  74.856  1.00 100.31 ? 358 PRO B CA    1 
ATOM   7593  C  C     . PRO B 1 358 ? 41.526  92.138  76.318  1.00 99.14  ? 358 PRO B C     1 
ATOM   7594  O  O     . PRO B 1 358 ? 42.097  91.089  76.612  1.00 97.49  ? 358 PRO B O     1 
ATOM   7595  C  CB    . PRO B 1 358 ? 40.512  91.653  74.049  1.00 101.02 ? 358 PRO B CB    1 
ATOM   7596  C  CG    . PRO B 1 358 ? 41.171  91.558  72.707  1.00 102.44 ? 358 PRO B CG    1 
ATOM   7597  C  CD    . PRO B 1 358 ? 42.651  91.553  72.987  1.00 95.99  ? 358 PRO B CD    1 
ATOM   7598  N  N     . GLU B 1 359 ? 40.990  92.956  77.217  1.00 102.19 ? 359 GLU B N     1 
ATOM   7599  C  CA    . GLU B 1 359 ? 41.253  92.777  78.641  1.00 104.06 ? 359 GLU B CA    1 
ATOM   7600  C  C     . GLU B 1 359 ? 40.720  91.452  79.179  1.00 99.78  ? 359 GLU B C     1 
ATOM   7601  O  O     . GLU B 1 359 ? 41.335  90.849  80.061  1.00 96.77  ? 359 GLU B O     1 
ATOM   7602  C  CB    . GLU B 1 359 ? 40.684  93.949  79.445  1.00 104.97 ? 359 GLU B CB    1 
ATOM   7603  C  CG    . GLU B 1 359 ? 40.915  93.849  80.956  1.00 103.44 ? 359 GLU B CG    1 
ATOM   7604  C  CD    . GLU B 1 359 ? 42.369  94.042  81.363  1.00 108.21 ? 359 GLU B CD    1 
ATOM   7605  O  OE1   . GLU B 1 359 ? 43.198  94.425  80.507  1.00 106.23 ? 359 GLU B OE1   1 
ATOM   7606  O  OE2   . GLU B 1 359 ? 42.683  93.798  82.549  1.00 109.56 ? 359 GLU B OE2   1 
ATOM   7607  N  N     . PHE B 1 360 ? 39.579  91.002  78.668  1.00 98.36  ? 360 PHE B N     1 
ATOM   7608  C  CA    . PHE B 1 360 ? 39.017  89.750  79.156  1.00 98.20  ? 360 PHE B CA    1 
ATOM   7609  C  C     . PHE B 1 360 ? 39.847  88.541  78.701  1.00 94.61  ? 360 PHE B C     1 
ATOM   7610  O  O     . PHE B 1 360 ? 39.929  87.537  79.414  1.00 93.87  ? 360 PHE B O     1 
ATOM   7611  C  CB    . PHE B 1 360 ? 37.549  89.608  78.730  1.00 96.48  ? 360 PHE B CB    1 
ATOM   7612  C  CG    . PHE B 1 360 ? 37.309  89.749  77.248  1.00 98.97  ? 360 PHE B CG    1 
ATOM   7613  C  CD1   . PHE B 1 360 ? 37.093  90.998  76.681  1.00 99.60  ? 360 PHE B CD1   1 
ATOM   7614  C  CD2   . PHE B 1 360 ? 37.242  88.629  76.430  1.00 94.11  ? 360 PHE B CD2   1 
ATOM   7615  C  CE1   . PHE B 1 360 ? 36.851  91.131  75.322  1.00 96.99  ? 360 PHE B CE1   1 
ATOM   7616  C  CE2   . PHE B 1 360 ? 36.997  88.755  75.070  1.00 93.57  ? 360 PHE B CE2   1 
ATOM   7617  C  CZ    . PHE B 1 360 ? 36.802  90.008  74.516  1.00 95.08  ? 360 PHE B CZ    1 
ATOM   7618  N  N     . LEU B 1 361 ? 40.486  88.649  77.537  1.00 93.23  ? 361 LEU B N     1 
ATOM   7619  C  CA    . LEU B 1 361 ? 41.408  87.611  77.070  1.00 91.31  ? 361 LEU B CA    1 
ATOM   7620  C  C     . LEU B 1 361 ? 42.627  87.527  77.987  1.00 90.65  ? 361 LEU B C     1 
ATOM   7621  O  O     . LEU B 1 361 ? 43.042  86.437  78.403  1.00 86.62  ? 361 LEU B O     1 
ATOM   7622  C  CB    . LEU B 1 361 ? 41.853  87.879  75.629  1.00 90.02  ? 361 LEU B CB    1 
ATOM   7623  C  CG    . LEU B 1 361 ? 40.772  87.878  74.543  1.00 93.22  ? 361 LEU B CG    1 
ATOM   7624  C  CD1   . LEU B 1 361 ? 41.386  87.982  73.153  1.00 90.36  ? 361 LEU B CD1   1 
ATOM   7625  C  CD2   . LEU B 1 361 ? 39.881  86.650  74.646  1.00 88.79  ? 361 LEU B CD2   1 
ATOM   7626  N  N     . ARG B 1 362 ? 43.199  88.691  78.283  1.00 92.99  ? 362 ARG B N     1 
ATOM   7627  C  CA    . ARG B 1 362 ? 44.351  88.794  79.170  1.00 91.39  ? 362 ARG B CA    1 
ATOM   7628  C  C     . ARG B 1 362 ? 44.000  88.203  80.529  1.00 89.42  ? 362 ARG B C     1 
ATOM   7629  O  O     . ARG B 1 362 ? 44.764  87.411  81.099  1.00 89.69  ? 362 ARG B O     1 
ATOM   7630  C  CB    . ARG B 1 362 ? 44.785  90.258  79.312  1.00 94.73  ? 362 ARG B CB    1 
ATOM   7631  C  CG    . ARG B 1 362 ? 45.859  90.516  80.370  1.00 95.23  ? 362 ARG B CG    1 
ATOM   7632  C  CD    . ARG B 1 362 ? 46.056  92.013  80.614  1.00 94.40  ? 362 ARG B CD    1 
ATOM   7633  N  NE    . ARG B 1 362 ? 47.172  92.566  79.851  1.00 92.89  ? 362 ARG B NE    1 
ATOM   7634  C  CZ    . ARG B 1 362 ? 47.030  93.283  78.739  1.00 97.49  ? 362 ARG B CZ    1 
ATOM   7635  N  NH1   . ARG B 1 362 ? 45.817  93.528  78.259  1.00 101.98 ? 362 ARG B NH1   1 
ATOM   7636  N  NH2   . ARG B 1 362 ? 48.096  93.753  78.102  1.00 93.32  ? 362 ARG B NH2   1 
ATOM   7637  N  N     . ARG B 1 363 ? 42.828  88.587  81.028  1.00 88.61  ? 363 ARG B N     1 
ATOM   7638  C  CA    . ARG B 1 363 ? 42.351  88.132  82.324  1.00 90.51  ? 363 ARG B CA    1 
ATOM   7639  C  C     . ARG B 1 363 ? 42.239  86.618  82.338  1.00 90.04  ? 363 ARG B C     1 
ATOM   7640  O  O     . ARG B 1 363 ? 42.712  85.966  83.265  1.00 88.09  ? 363 ARG B O     1 
ATOM   7641  C  CB    . ARG B 1 363 ? 40.985  88.743  82.663  1.00 92.93  ? 363 ARG B CB    1 
ATOM   7642  C  CG    . ARG B 1 363 ? 40.556  88.481  84.105  1.00 93.21  ? 363 ARG B CG    1 
ATOM   7643  C  CD    . ARG B 1 363 ? 39.293  89.233  84.511  1.00 98.47  ? 363 ARG B CD    1 
ATOM   7644  N  NE    . ARG B 1 363 ? 38.077  88.491  84.174  1.00 105.15 ? 363 ARG B NE    1 
ATOM   7645  C  CZ    . ARG B 1 363 ? 37.202  88.851  83.240  1.00 104.90 ? 363 ARG B CZ    1 
ATOM   7646  N  NH1   . ARG B 1 363 ? 37.402  89.957  82.534  1.00 106.32 ? 363 ARG B NH1   1 
ATOM   7647  N  NH2   . ARG B 1 363 ? 36.126  88.106  83.013  1.00 99.99  ? 363 ARG B NH2   1 
ATOM   7648  N  N     . ALA B 1 364 ? 41.610  86.069  81.300  1.00 92.06  ? 364 ALA B N     1 
ATOM   7649  C  CA    . ALA B 1 364 ? 41.375  84.631  81.217  1.00 86.62  ? 364 ALA B CA    1 
ATOM   7650  C  C     . ALA B 1 364 ? 42.684  83.850  81.153  1.00 82.78  ? 364 ALA B C     1 
ATOM   7651  O  O     . ALA B 1 364 ? 42.853  82.842  81.841  1.00 78.54  ? 364 ALA B O     1 
ATOM   7652  C  CB    . ALA B 1 364 ? 40.511  84.310  80.020  1.00 83.31  ? 364 ALA B CB    1 
ATOM   7653  N  N     . LEU B 1 365 ? 43.606  84.316  80.320  1.00 82.64  ? 365 LEU B N     1 
ATOM   7654  C  CA    . LEU B 1 365 ? 44.902  83.667  80.206  1.00 83.72  ? 365 LEU B CA    1 
ATOM   7655  C  C     . LEU B 1 365 ? 45.617  83.686  81.551  1.00 85.65  ? 365 LEU B C     1 
ATOM   7656  O  O     . LEU B 1 365 ? 46.179  82.676  81.979  1.00 84.41  ? 365 LEU B O     1 
ATOM   7657  C  CB    . LEU B 1 365 ? 45.757  84.345  79.140  1.00 81.16  ? 365 LEU B CB    1 
ATOM   7658  C  CG    . LEU B 1 365 ? 45.359  84.039  77.698  1.00 84.31  ? 365 LEU B CG    1 
ATOM   7659  C  CD1   . LEU B 1 365 ? 46.136  84.907  76.721  1.00 86.24  ? 365 LEU B CD1   1 
ATOM   7660  C  CD2   . LEU B 1 365 ? 45.587  82.572  77.403  1.00 81.38  ? 365 LEU B CD2   1 
ATOM   7661  N  N     . LEU B 1 366 ? 45.571  84.837  82.219  1.00 85.12  ? 366 LEU B N     1 
ATOM   7662  C  CA    . LEU B 1 366 ? 46.243  85.008  83.504  1.00 85.91  ? 366 LEU B CA    1 
ATOM   7663  C  C     . LEU B 1 366 ? 45.631  84.141  84.601  1.00 86.73  ? 366 LEU B C     1 
ATOM   7664  O  O     . LEU B 1 366 ? 46.348  83.624  85.457  1.00 85.62  ? 366 LEU B O     1 
ATOM   7665  C  CB    . LEU B 1 366 ? 46.219  86.479  83.919  1.00 81.35  ? 366 LEU B CB    1 
ATOM   7666  C  CG    . LEU B 1 366 ? 47.418  87.277  83.410  1.00 81.91  ? 366 LEU B CG    1 
ATOM   7667  C  CD1   . LEU B 1 366 ? 47.242  88.763  83.679  1.00 82.20  ? 366 LEU B CD1   1 
ATOM   7668  C  CD2   . LEU B 1 366 ? 48.682  86.759  84.072  1.00 74.87  ? 366 LEU B CD2   1 
ATOM   7669  N  N     . ARG B 1 367 ? 44.310  83.995  84.581  1.00 83.31  ? 367 ARG B N     1 
ATOM   7670  C  CA    . ARG B 1 367 ? 43.622  83.137  85.535  1.00 85.82  ? 367 ARG B CA    1 
ATOM   7671  C  C     . ARG B 1 367 ? 44.022  81.690  85.281  1.00 85.47  ? 367 ARG B C     1 
ATOM   7672  O  O     . ARG B 1 367 ? 44.262  80.915  86.215  1.00 84.60  ? 367 ARG B O     1 
ATOM   7673  C  CB    . ARG B 1 367 ? 42.115  83.310  85.428  1.00 82.79  ? 367 ARG B CB    1 
ATOM   7674  N  N     . ALA B 1 368 ? 44.077  81.335  84.002  1.00 87.04  ? 368 ALA B N     1 
ATOM   7675  C  CA    . ALA B 1 368 ? 44.415  79.980  83.589  1.00 89.94  ? 368 ALA B CA    1 
ATOM   7676  C  C     . ALA B 1 368 ? 45.823  79.596  84.032  1.00 86.57  ? 368 ALA B C     1 
ATOM   7677  O  O     . ALA B 1 368 ? 46.032  78.538  84.630  1.00 86.84  ? 368 ALA B O     1 
ATOM   7678  C  CB    . ALA B 1 368 ? 44.274  79.841  82.079  1.00 85.63  ? 368 ALA B CB    1 
ATOM   7679  N  N     . PHE B 1 369 ? 46.788  80.457  83.736  1.00 83.35  ? 369 PHE B N     1 
ATOM   7680  C  CA    . PHE B 1 369 ? 48.170  80.182  84.101  1.00 90.57  ? 369 PHE B CA    1 
ATOM   7681  C  C     . PHE B 1 369 ? 48.361  80.310  85.611  1.00 91.57  ? 369 PHE B C     1 
ATOM   7682  O  O     . PHE B 1 369 ? 49.260  79.689  86.189  1.00 90.03  ? 369 PHE B O     1 
ATOM   7683  C  CB    . PHE B 1 369 ? 49.126  81.114  83.354  1.00 86.59  ? 369 PHE B CB    1 
ATOM   7684  C  CG    . PHE B 1 369 ? 49.502  80.622  81.982  1.00 90.59  ? 369 PHE B CG    1 
ATOM   7685  C  CD1   . PHE B 1 369 ? 48.627  80.765  80.914  1.00 90.76  ? 369 PHE B CD1   1 
ATOM   7686  C  CD2   . PHE B 1 369 ? 50.725  80.002  81.764  1.00 89.92  ? 369 PHE B CD2   1 
ATOM   7687  C  CE1   . PHE B 1 369 ? 48.972  80.312  79.650  1.00 88.93  ? 369 PHE B CE1   1 
ATOM   7688  C  CE2   . PHE B 1 369 ? 51.074  79.544  80.503  1.00 91.44  ? 369 PHE B CE2   1 
ATOM   7689  C  CZ    . PHE B 1 369 ? 50.196  79.700  79.444  1.00 91.04  ? 369 PHE B CZ    1 
ATOM   7690  N  N     . GLY B 1 370 ? 47.519  81.125  86.242  1.00 86.08  ? 370 GLY B N     1 
ATOM   7691  C  CA    . GLY B 1 370 ? 47.527  81.257  87.686  1.00 88.20  ? 370 GLY B CA    1 
ATOM   7692  C  C     . GLY B 1 370 ? 47.172  79.948  88.366  1.00 92.87  ? 370 GLY B C     1 
ATOM   7693  O  O     . GLY B 1 370 ? 47.914  79.455  89.220  1.00 94.15  ? 370 GLY B O     1 
ATOM   7694  N  N     . ALA B 1 371 ? 46.037  79.376  87.975  1.00 85.08  ? 371 ALA B N     1 
ATOM   7695  C  CA    . ALA B 1 371 ? 45.590  78.109  88.546  1.00 87.08  ? 371 ALA B CA    1 
ATOM   7696  C  C     . ALA B 1 371 ? 46.530  76.954  88.197  1.00 90.57  ? 371 ALA B C     1 
ATOM   7697  O  O     . ALA B 1 371 ? 46.545  75.923  88.873  1.00 89.65  ? 371 ALA B O     1 
ATOM   7698  C  CB    . ALA B 1 371 ? 44.182  77.794  88.082  1.00 80.87  ? 371 ALA B CB    1 
ATOM   7699  N  N     . SER B 1 372 ? 47.296  77.125  87.126  1.00 86.37  ? 372 SER B N     1 
ATOM   7700  C  CA    . SER B 1 372 ? 48.155  76.063  86.625  1.00 89.98  ? 372 SER B CA    1 
ATOM   7701  C  C     . SER B 1 372 ? 49.552  76.144  87.229  1.00 94.49  ? 372 SER B C     1 
ATOM   7702  O  O     . SER B 1 372 ? 50.369  75.240  87.040  1.00 88.88  ? 372 SER B O     1 
ATOM   7703  C  CB    . SER B 1 372 ? 48.236  76.124  85.099  1.00 89.21  ? 372 SER B CB    1 
ATOM   7704  O  OG    . SER B 1 372 ? 46.942  76.232  84.530  1.00 87.21  ? 372 SER B OG    1 
ATOM   7705  N  N     . GLY B 1 373 ? 49.821  77.230  87.951  1.00 94.04  ? 373 GLY B N     1 
ATOM   7706  C  CA    . GLY B 1 373 ? 51.122  77.433  88.561  1.00 93.75  ? 373 GLY B CA    1 
ATOM   7707  C  C     . GLY B 1 373 ? 52.238  77.580  87.545  1.00 96.52  ? 373 GLY B C     1 
ATOM   7708  O  O     . GLY B 1 373 ? 53.303  76.978  87.689  1.00 93.96  ? 373 GLY B O     1 
ATOM   7709  N  N     . ALA B 1 374 ? 51.992  78.375  86.509  1.00 96.88  ? 374 ALA B N     1 
ATOM   7710  C  CA    . ALA B 1 374 ? 52.975  78.565  85.451  1.00 95.91  ? 374 ALA B CA    1 
ATOM   7711  C  C     . ALA B 1 374 ? 53.204  80.038  85.129  1.00 91.62  ? 374 ALA B C     1 
ATOM   7712  O  O     . ALA B 1 374 ? 52.331  80.878  85.340  1.00 88.34  ? 374 ALA B O     1 
ATOM   7713  C  CB    . ALA B 1 374 ? 52.542  77.814  84.196  1.00 93.80  ? 374 ALA B CB    1 
ATOM   7714  N  N     . SER B 1 375 ? 54.399  80.340  84.632  1.00 94.38  ? 375 SER B N     1 
ATOM   7715  C  CA    . SER B 1 375 ? 54.756  81.694  84.223  1.00 96.28  ? 375 SER B CA    1 
ATOM   7716  C  C     . SER B 1 375 ? 54.182  82.016  82.843  1.00 95.16  ? 375 SER B C     1 
ATOM   7717  O  O     . SER B 1 375 ? 54.256  81.195  81.928  1.00 95.09  ? 375 SER B O     1 
ATOM   7718  C  CB    . SER B 1 375 ? 56.276  81.867  84.214  1.00 89.47  ? 375 SER B CB    1 
ATOM   7719  O  OG    . SER B 1 375 ? 56.636  83.136  83.704  1.00 90.91  ? 375 SER B OG    1 
ATOM   7720  N  N     . LEU B 1 376 ? 53.622  83.212  82.687  1.00 91.81  ? 376 LEU B N     1 
ATOM   7721  C  CA    . LEU B 1 376 ? 53.084  83.625  81.395  1.00 91.95  ? 376 LEU B CA    1 
ATOM   7722  C  C     . LEU B 1 376 ? 53.667  84.962  80.931  1.00 89.83  ? 376 LEU B C     1 
ATOM   7723  O  O     . LEU B 1 376 ? 53.659  85.938  81.677  1.00 94.24  ? 376 LEU B O     1 
ATOM   7724  C  CB    . LEU B 1 376 ? 51.555  83.705  81.469  1.00 89.46  ? 376 LEU B CB    1 
ATOM   7725  C  CG    . LEU B 1 376 ? 50.815  84.225  80.236  1.00 88.52  ? 376 LEU B CG    1 
ATOM   7726  C  CD1   . LEU B 1 376 ? 51.041  83.298  79.057  1.00 89.84  ? 376 LEU B CD1   1 
ATOM   7727  C  CD2   . LEU B 1 376 ? 49.330  84.352  80.530  1.00 88.45  ? 376 LEU B CD2   1 
ATOM   7728  N  N     . ARG B 1 377 ? 54.159  85.002  79.694  1.00 89.88  ? 377 ARG B N     1 
ATOM   7729  C  CA    . ARG B 1 377 ? 54.670  86.242  79.103  1.00 95.46  ? 377 ARG B CA    1 
ATOM   7730  C  C     . ARG B 1 377 ? 53.898  86.606  77.836  1.00 92.64  ? 377 ARG B C     1 
ATOM   7731  O  O     . ARG B 1 377 ? 53.786  85.802  76.915  1.00 93.90  ? 377 ARG B O     1 
ATOM   7732  C  CB    . ARG B 1 377 ? 56.166  86.125  78.779  1.00 98.55  ? 377 ARG B CB    1 
ATOM   7733  C  CG    . ARG B 1 377 ? 57.081  86.044  79.996  1.00 99.16  ? 377 ARG B CG    1 
ATOM   7734  C  CD    . ARG B 1 377 ? 58.563  86.060  79.606  1.00 102.49 ? 377 ARG B CD    1 
ATOM   7735  N  NE    . ARG B 1 377 ? 59.028  84.818  78.989  1.00 105.05 ? 377 ARG B NE    1 
ATOM   7736  C  CZ    . ARG B 1 377 ? 59.465  84.725  77.735  1.00 103.61 ? 377 ARG B CZ    1 
ATOM   7737  N  NH1   . ARG B 1 377 ? 59.873  83.558  77.253  1.00 101.71 ? 377 ARG B NH1   1 
ATOM   7738  N  NH2   . ARG B 1 377 ? 59.496  85.801  76.960  1.00 103.95 ? 377 ARG B NH2   1 
ATOM   7739  N  N     . LEU B 1 378 ? 53.366  87.822  77.792  1.00 94.36  ? 378 LEU B N     1 
ATOM   7740  C  CA    . LEU B 1 378 ? 52.604  88.271  76.632  1.00 92.63  ? 378 LEU B CA    1 
ATOM   7741  C  C     . LEU B 1 378 ? 53.351  89.292  75.785  1.00 93.02  ? 378 LEU B C     1 
ATOM   7742  O  O     . LEU B 1 378 ? 53.650  90.390  76.247  1.00 96.35  ? 378 LEU B O     1 
ATOM   7743  C  CB    . LEU B 1 378 ? 51.264  88.863  77.076  1.00 95.89  ? 378 LEU B CB    1 
ATOM   7744  C  CG    . LEU B 1 378 ? 50.378  87.962  77.939  1.00 93.62  ? 378 LEU B CG    1 
ATOM   7745  C  CD1   . LEU B 1 378 ? 49.044  88.641  78.241  1.00 94.99  ? 378 LEU B CD1   1 
ATOM   7746  C  CD2   . LEU B 1 378 ? 50.168  86.608  77.276  1.00 92.35  ? 378 LEU B CD2   1 
ATOM   7747  N  N     . HIS B 1 379 ? 53.636  88.928  74.540  1.00 94.31  ? 379 HIS B N     1 
ATOM   7748  C  CA    . HIS B 1 379 ? 54.284  89.837  73.602  1.00 95.70  ? 379 HIS B CA    1 
ATOM   7749  C  C     . HIS B 1 379 ? 53.239  90.427  72.668  1.00 95.58  ? 379 HIS B C     1 
ATOM   7750  O  O     . HIS B 1 379 ? 52.122  89.920  72.573  1.00 95.55  ? 379 HIS B O     1 
ATOM   7751  C  CB    . HIS B 1 379 ? 55.359  89.122  72.771  1.00 96.16  ? 379 HIS B CB    1 
ATOM   7752  C  CG    . HIS B 1 379 ? 56.439  88.476  73.582  1.00 100.28 ? 379 HIS B CG    1 
ATOM   7753  N  ND1   . HIS B 1 379 ? 57.771  88.805  73.437  1.00 101.97 ? 379 HIS B ND1   1 
ATOM   7754  C  CD2   . HIS B 1 379 ? 56.392  87.512  74.532  1.00 100.57 ? 379 HIS B CD2   1 
ATOM   7755  C  CE1   . HIS B 1 379 ? 58.496  88.077  74.267  1.00 102.69 ? 379 HIS B CE1   1 
ATOM   7756  N  NE2   . HIS B 1 379 ? 57.684  87.284  74.944  1.00 104.17 ? 379 HIS B NE2   1 
ATOM   7757  N  N     . THR B 1 380 ? 53.599  91.507  71.988  1.00 93.54  ? 380 THR B N     1 
ATOM   7758  C  CA    . THR B 1 380 ? 52.725  92.101  70.988  1.00 94.76  ? 380 THR B CA    1 
ATOM   7759  C  C     . THR B 1 380 ? 53.530  92.396  69.734  1.00 100.25 ? 380 THR B C     1 
ATOM   7760  O  O     . THR B 1 380 ? 54.503  93.149  69.780  1.00 100.62 ? 380 THR B O     1 
ATOM   7761  C  CB    . THR B 1 380 ? 52.058  93.390  71.499  1.00 94.12  ? 380 THR B CB    1 
ATOM   7762  O  OG1   . THR B 1 380 ? 51.158  93.070  72.566  1.00 90.42  ? 380 THR B OG1   1 
ATOM   7763  C  CG2   . THR B 1 380 ? 51.286  94.077  70.379  1.00 95.34  ? 380 THR B CG2   1 
ATOM   7764  N  N     . LEU B 1 381 ? 53.139  91.790  68.619  1.00 98.67  ? 381 LEU B N     1 
ATOM   7765  C  CA    . LEU B 1 381 ? 53.797  92.071  67.352  1.00 101.10 ? 381 LEU B CA    1 
ATOM   7766  C  C     . LEU B 1 381 ? 53.358  93.439  66.853  1.00 103.03 ? 381 LEU B C     1 
ATOM   7767  O  O     . LEU B 1 381 ? 52.170  93.670  66.618  1.00 103.64 ? 381 LEU B O     1 
ATOM   7768  C  CB    . LEU B 1 381 ? 53.474  90.989  66.319  1.00 102.18 ? 381 LEU B CB    1 
ATOM   7769  C  CG    . LEU B 1 381 ? 54.156  89.629  66.482  1.00 101.35 ? 381 LEU B CG    1 
ATOM   7770  C  CD1   . LEU B 1 381 ? 53.591  88.644  65.481  1.00 100.86 ? 381 LEU B CD1   1 
ATOM   7771  C  CD2   . LEU B 1 381 ? 55.665  89.750  66.313  1.00 104.66 ? 381 LEU B CD2   1 
ATOM   7772  N  N     . HIS B 1 382 ? 54.286  94.374  66.842  1.00 106.09 ? 382 HIS B N     1 
ATOM   7773  C  CA    . HIS B 1 382 ? 54.043  95.645  66.204  1.00 109.28 ? 382 HIS B CA    1 
ATOM   7774  C  C     . HIS B 1 382 ? 54.517  95.661  64.768  1.00 113.26 ? 382 HIS B C     1 
ATOM   7775  O  O     . HIS B 1 382 ? 55.461  96.357  64.430  1.00 119.48 ? 382 HIS B O     1 
ATOM   7776  C  CB    . HIS B 1 382 ? 54.663  96.790  66.989  1.00 108.20 ? 382 HIS B CB    1 
ATOM   7777  C  CG    . HIS B 1 382 ? 54.372  96.744  68.452  1.00 104.70 ? 382 HIS B CG    1 
ATOM   7778  N  ND1   . HIS B 1 382 ? 53.428  97.546  69.047  1.00 102.87 ? 382 HIS B ND1   1 
ATOM   7779  C  CD2   . HIS B 1 382 ? 54.907  95.996  69.441  1.00 100.89 ? 382 HIS B CD2   1 
ATOM   7780  C  CE1   . HIS B 1 382 ? 53.395  97.295  70.340  1.00 101.03 ? 382 HIS B CE1   1 
ATOM   7781  N  NE2   . HIS B 1 382 ? 54.281  96.357  70.604  1.00 97.40  ? 382 HIS B NE2   1 
ATOM   7782  N  N     . ALA B 1 383 ? 53.859  94.888  63.930  1.00 112.59 ? 383 ALA B N     1 
ATOM   7783  C  CA    . ALA B 1 383 ? 54.123  94.871  62.499  1.00 117.55 ? 383 ALA B CA    1 
ATOM   7784  C  C     . ALA B 1 383 ? 52.882  94.443  61.730  1.00 118.79 ? 383 ALA B C     1 
ATOM   7785  O  O     . ALA B 1 383 ? 51.944  93.882  62.298  1.00 113.52 ? 383 ALA B O     1 
ATOM   7786  C  CB    . ALA B 1 383 ? 55.296  93.945  62.182  1.00 116.48 ? 383 ALA B CB    1 
ATOM   7787  N  N     . HIS B 1 384 ? 52.888  94.712  60.431  1.00 118.12 ? 384 HIS B N     1 
ATOM   7788  C  CA    . HIS B 1 384 ? 51.772  94.359  59.573  1.00 120.66 ? 384 HIS B CA    1 
ATOM   7789  C  C     . HIS B 1 384 ? 52.312  93.600  58.369  1.00 122.20 ? 384 HIS B C     1 
ATOM   7790  O  O     . HIS B 1 384 ? 53.342  93.977  57.817  1.00 123.00 ? 384 HIS B O     1 
ATOM   7791  C  CB    . HIS B 1 384 ? 51.009  95.614  59.137  1.00 122.23 ? 384 HIS B CB    1 
ATOM   7792  C  CG    . HIS B 1 384 ? 49.663  95.332  58.545  1.00 120.85 ? 384 HIS B CG    1 
ATOM   7793  N  ND1   . HIS B 1 384 ? 49.481  95.033  57.213  1.00 124.52 ? 384 HIS B ND1   1 
ATOM   7794  C  CD2   . HIS B 1 384 ? 48.432  95.303  59.109  1.00 118.91 ? 384 HIS B CD2   1 
ATOM   7795  C  CE1   . HIS B 1 384 ? 48.196  94.831  56.980  1.00 124.02 ? 384 HIS B CE1   1 
ATOM   7796  N  NE2   . HIS B 1 384 ? 47.538  94.988  58.115  1.00 122.41 ? 384 HIS B NE2   1 
ATOM   7797  N  N     . PRO B 1 385 ? 51.627  92.516  57.967  1.00 122.85 ? 385 PRO B N     1 
ATOM   7798  C  CA    . PRO B 1 385 ? 52.046  91.676  56.835  1.00 123.63 ? 385 PRO B CA    1 
ATOM   7799  C  C     . PRO B 1 385 ? 52.358  92.473  55.564  1.00 122.18 ? 385 PRO B C     1 
ATOM   7800  O  O     . PRO B 1 385 ? 53.044  91.970  54.674  1.00 120.45 ? 385 PRO B O     1 
ATOM   7801  C  CB    . PRO B 1 385 ? 50.842  90.753  56.625  1.00 120.99 ? 385 PRO B CB    1 
ATOM   7802  C  CG    . PRO B 1 385 ? 50.219  90.649  57.975  1.00 118.96 ? 385 PRO B CG    1 
ATOM   7803  C  CD    . PRO B 1 385 ? 50.418  91.990  58.627  1.00 122.10 ? 385 PRO B CD    1 
ATOM   7804  N  N     . SER B 1 386 ? 51.850  93.697  55.481  1.00 122.33 ? 386 SER B N     1 
ATOM   7805  C  CA    . SER B 1 386 ? 52.148  94.573  54.358  1.00 124.28 ? 386 SER B CA    1 
ATOM   7806  C  C     . SER B 1 386 ? 53.577  95.123  54.427  1.00 126.71 ? 386 SER B C     1 
ATOM   7807  O  O     . SER B 1 386 ? 54.042  95.768  53.488  1.00 127.29 ? 386 SER B O     1 
ATOM   7808  C  CB    . SER B 1 386 ? 51.146  95.716  54.308  1.00 123.10 ? 386 SER B CB    1 
ATOM   7809  N  N     . GLN B 1 387 ? 54.266  94.871  55.539  1.00 126.88 ? 387 GLN B N     1 
ATOM   7810  C  CA    . GLN B 1 387 ? 55.592  95.449  55.777  1.00 125.02 ? 387 GLN B CA    1 
ATOM   7811  C  C     . GLN B 1 387 ? 56.748  94.513  55.415  1.00 123.26 ? 387 GLN B C     1 
ATOM   7812  O  O     . GLN B 1 387 ? 57.898  94.782  55.763  1.00 124.58 ? 387 GLN B O     1 
ATOM   7813  C  CB    . GLN B 1 387 ? 55.726  95.887  57.239  1.00 125.52 ? 387 GLN B CB    1 
ATOM   7814  C  CG    . GLN B 1 387 ? 54.755  96.991  57.646  1.00 125.73 ? 387 GLN B CG    1 
ATOM   7815  C  CD    . GLN B 1 387 ? 54.978  97.479  59.068  1.00 124.06 ? 387 GLN B CD    1 
ATOM   7816  O  OE1   . GLN B 1 387 ? 55.306  96.698  59.962  1.00 121.02 ? 387 GLN B OE1   1 
ATOM   7817  N  NE2   . GLN B 1 387 ? 54.802  98.781  59.282  1.00 122.92 ? 387 GLN B NE2   1 
ATOM   7818  N  N     . GLY B 1 388 ? 56.440  93.420  54.726  1.00 123.41 ? 388 GLY B N     1 
ATOM   7819  C  CA    . GLY B 1 388 ? 57.456  92.495  54.251  1.00 125.14 ? 388 GLY B CA    1 
ATOM   7820  C  C     . GLY B 1 388 ? 58.472  91.976  55.257  1.00 125.73 ? 388 GLY B C     1 
ATOM   7821  O  O     . GLY B 1 388 ? 58.121  91.301  56.226  1.00 125.47 ? 388 GLY B O     1 
ATOM   7822  N  N     . LEU B 1 389 ? 59.743  92.282  55.010  1.00 126.12 ? 389 LEU B N     1 
ATOM   7823  C  CA    . LEU B 1 389 ? 60.841  91.739  55.808  1.00 127.12 ? 389 LEU B CA    1 
ATOM   7824  C  C     . LEU B 1 389 ? 60.890  92.281  57.235  1.00 125.24 ? 389 LEU B C     1 
ATOM   7825  O  O     . LEU B 1 389 ? 61.481  91.653  58.113  1.00 125.01 ? 389 LEU B O     1 
ATOM   7826  C  CB    . LEU B 1 389 ? 62.183  91.993  55.113  1.00 128.49 ? 389 LEU B CB    1 
ATOM   7827  C  CG    . LEU B 1 389 ? 62.778  90.781  54.387  1.00 127.03 ? 389 LEU B CG    1 
ATOM   7828  C  CD1   . LEU B 1 389 ? 64.101  91.131  53.719  1.00 122.50 ? 389 LEU B CD1   1 
ATOM   7829  C  CD2   . LEU B 1 389 ? 62.949  89.610  55.346  1.00 124.36 ? 389 LEU B CD2   1 
ATOM   7830  N  N     . ALA B 1 390 ? 60.300  93.450  57.466  1.00 124.11 ? 390 ALA B N     1 
ATOM   7831  C  CA    . ALA B 1 390 ? 60.219  93.975  58.822  1.00 122.15 ? 390 ALA B CA    1 
ATOM   7832  C  C     . ALA B 1 390 ? 59.352  93.029  59.646  1.00 123.30 ? 390 ALA B C     1 
ATOM   7833  O  O     . ALA B 1 390 ? 59.643  92.730  60.810  1.00 122.17 ? 390 ALA B O     1 
ATOM   7834  C  CB    . ALA B 1 390 ? 59.649  95.383  58.826  1.00 120.08 ? 390 ALA B CB    1 
ATOM   7835  N  N     . PHE B 1 391 ? 58.299  92.537  59.002  1.00 125.40 ? 391 PHE B N     1 
ATOM   7836  C  CA    . PHE B 1 391 ? 57.367  91.601  59.612  1.00 124.06 ? 391 PHE B CA    1 
ATOM   7837  C  C     . PHE B 1 391 ? 58.054  90.274  59.926  1.00 123.55 ? 391 PHE B C     1 
ATOM   7838  O  O     . PHE B 1 391 ? 57.996  89.789  61.058  1.00 122.20 ? 391 PHE B O     1 
ATOM   7839  C  CB    . PHE B 1 391 ? 56.174  91.380  58.681  1.00 125.10 ? 391 PHE B CB    1 
ATOM   7840  C  CG    . PHE B 1 391 ? 55.108  90.494  59.249  1.00 124.22 ? 391 PHE B CG    1 
ATOM   7841  C  CD1   . PHE B 1 391 ? 54.339  90.915  60.322  1.00 121.70 ? 391 PHE B CD1   1 
ATOM   7842  C  CD2   . PHE B 1 391 ? 54.866  89.244  58.703  1.00 121.85 ? 391 PHE B CD2   1 
ATOM   7843  C  CE1   . PHE B 1 391 ? 53.351  90.104  60.844  1.00 118.84 ? 391 PHE B CE1   1 
ATOM   7844  C  CE2   . PHE B 1 391 ? 53.880  88.429  59.220  1.00 121.00 ? 391 PHE B CE2   1 
ATOM   7845  C  CZ    . PHE B 1 391 ? 53.123  88.858  60.294  1.00 118.59 ? 391 PHE B CZ    1 
ATOM   7846  N  N     . ARG B 1 392 ? 58.712  89.700  58.919  1.00 124.70 ? 392 ARG B N     1 
ATOM   7847  C  CA    . ARG B 1 392 ? 59.454  88.450  59.081  1.00 123.25 ? 392 ARG B CA    1 
ATOM   7848  C  C     . ARG B 1 392 ? 60.516  88.548  60.170  1.00 121.33 ? 392 ARG B C     1 
ATOM   7849  O  O     . ARG B 1 392 ? 60.722  87.604  60.936  1.00 118.83 ? 392 ARG B O     1 
ATOM   7850  C  CB    . ARG B 1 392 ? 60.114  88.039  57.764  1.00 122.58 ? 392 ARG B CB    1 
ATOM   7851  C  CG    . ARG B 1 392 ? 59.169  87.447  56.732  1.00 121.19 ? 392 ARG B CG    1 
ATOM   7852  C  CD    . ARG B 1 392 ? 59.950  86.999  55.511  1.00 123.81 ? 392 ARG B CD    1 
ATOM   7853  N  NE    . ARG B 1 392 ? 60.997  86.045  55.870  1.00 125.95 ? 392 ARG B NE    1 
ATOM   7854  C  CZ    . ARG B 1 392 ? 62.042  85.751  55.101  1.00 128.30 ? 392 ARG B CZ    1 
ATOM   7855  N  NH1   . ARG B 1 392 ? 62.944  84.872  55.515  1.00 127.49 ? 392 ARG B NH1   1 
ATOM   7856  N  NH2   . ARG B 1 392 ? 62.190  86.342  53.923  1.00 129.22 ? 392 ARG B NH2   1 
ATOM   7857  N  N     . GLU B 1 393 ? 61.205  89.683  60.215  1.00 121.88 ? 393 GLU B N     1 
ATOM   7858  C  CA    . GLU B 1 393 ? 62.253  89.886  61.206  1.00 124.64 ? 393 GLU B CA    1 
ATOM   7859  C  C     . GLU B 1 393 ? 61.657  90.006  62.603  1.00 121.13 ? 393 GLU B C     1 
ATOM   7860  O  O     . GLU B 1 393 ? 62.251  89.542  63.573  1.00 117.84 ? 393 GLU B O     1 
ATOM   7861  C  CB    . GLU B 1 393 ? 63.096  91.122  60.882  1.00 126.60 ? 393 GLU B CB    1 
ATOM   7862  C  CG    . GLU B 1 393 ? 64.191  91.387  61.908  1.00 125.12 ? 393 GLU B CG    1 
ATOM   7863  C  CD    . GLU B 1 393 ? 65.102  90.183  62.107  1.00 126.46 ? 393 GLU B CD    1 
ATOM   7864  O  OE1   . GLU B 1 393 ? 65.503  89.560  61.100  1.00 128.16 ? 393 GLU B OE1   1 
ATOM   7865  O  OE2   . GLU B 1 393 ? 65.405  89.847  63.272  1.00 125.40 ? 393 GLU B OE2   1 
ATOM   7866  N  N     . ALA B 1 394 ? 60.493  90.644  62.707  1.00 121.50 ? 394 ALA B N     1 
ATOM   7867  C  CA    . ALA B 1 394 ? 59.827  90.773  64.001  1.00 118.08 ? 394 ALA B CA    1 
ATOM   7868  C  C     . ALA B 1 394 ? 59.344  89.405  64.483  1.00 118.32 ? 394 ALA B C     1 
ATOM   7869  O  O     . ALA B 1 394 ? 59.344  89.118  65.685  1.00 114.98 ? 394 ALA B O     1 
ATOM   7870  C  CB    . ALA B 1 394 ? 58.669  91.749  63.912  1.00 112.71 ? 394 ALA B CB    1 
ATOM   7871  N  N     . LEU B 1 395 ? 58.934  88.568  63.533  1.00 118.96 ? 395 LEU B N     1 
ATOM   7872  C  CA    . LEU B 1 395 ? 58.555  87.185  63.819  1.00 118.05 ? 395 LEU B CA    1 
ATOM   7873  C  C     . LEU B 1 395 ? 59.740  86.372  64.333  1.00 116.04 ? 395 LEU B C     1 
ATOM   7874  O  O     . LEU B 1 395 ? 59.652  85.709  65.368  1.00 114.12 ? 395 LEU B O     1 
ATOM   7875  C  CB    . LEU B 1 395 ? 57.979  86.523  62.567  1.00 118.43 ? 395 LEU B CB    1 
ATOM   7876  C  CG    . LEU B 1 395 ? 56.658  87.089  62.048  1.00 115.97 ? 395 LEU B CG    1 
ATOM   7877  C  CD1   . LEU B 1 395 ? 56.240  86.395  60.764  1.00 112.00 ? 395 LEU B CD1   1 
ATOM   7878  C  CD2   . LEU B 1 395 ? 55.596  86.941  63.111  1.00 111.62 ? 395 LEU B CD2   1 
ATOM   7879  N  N     . ARG B 1 396 ? 60.840  86.418  63.586  1.00 116.60 ? 396 ARG B N     1 
ATOM   7880  C  CA    . ARG B 1 396 ? 62.077  85.743  63.964  1.00 117.59 ? 396 ARG B CA    1 
ATOM   7881  C  C     . ARG B 1 396 ? 62.511  86.210  65.354  1.00 117.11 ? 396 ARG B C     1 
ATOM   7882  O  O     . ARG B 1 396 ? 62.961  85.418  66.180  1.00 113.93 ? 396 ARG B O     1 
ATOM   7883  C  CB    . ARG B 1 396 ? 63.168  86.016  62.926  1.00 119.19 ? 396 ARG B CB    1 
ATOM   7884  C  CG    . ARG B 1 396 ? 64.298  85.000  62.892  1.00 117.49 ? 396 ARG B CG    1 
ATOM   7885  C  CD    . ARG B 1 396 ? 64.383  84.329  61.527  1.00 121.00 ? 396 ARG B CD    1 
ATOM   7886  N  NE    . ARG B 1 396 ? 64.055  85.255  60.444  1.00 123.83 ? 396 ARG B NE    1 
ATOM   7887  C  CZ    . ARG B 1 396 ? 63.897  84.901  59.172  1.00 122.26 ? 396 ARG B CZ    1 
ATOM   7888  N  NH1   . ARG B 1 396 ? 64.055  83.635  58.807  1.00 122.92 ? 396 ARG B NH1   1 
ATOM   7889  N  NH2   . ARG B 1 396 ? 63.596  85.816  58.260  1.00 118.59 ? 396 ARG B NH2   1 
ATOM   7890  N  N     . LYS B 1 397 ? 62.360  87.510  65.591  1.00 118.11 ? 397 LYS B N     1 
ATOM   7891  C  CA    . LYS B 1 397 ? 62.692  88.149  66.861  1.00 117.75 ? 397 LYS B CA    1 
ATOM   7892  C  C     . LYS B 1 397 ? 61.839  87.603  67.996  1.00 113.17 ? 397 LYS B C     1 
ATOM   7893  O  O     . LYS B 1 397 ? 62.325  87.377  69.104  1.00 113.37 ? 397 LYS B O     1 
ATOM   7894  C  CB    . LYS B 1 397 ? 62.493  89.663  66.749  1.00 116.15 ? 397 LYS B CB    1 
ATOM   7895  C  CG    . LYS B 1 397 ? 62.861  90.458  67.986  1.00 116.87 ? 397 LYS B CG    1 
ATOM   7896  C  CD    . LYS B 1 397 ? 62.716  91.945  67.714  1.00 115.60 ? 397 LYS B CD    1 
ATOM   7897  C  CE    . LYS B 1 397 ? 62.943  92.771  68.966  1.00 117.76 ? 397 LYS B CE    1 
ATOM   7898  N  NZ    . LYS B 1 397 ? 62.769  94.227  68.697  1.00 121.33 ? 397 LYS B NZ    1 
ATOM   7899  N  N     . ALA B 1 398 ? 60.557  87.410  67.712  1.00 116.18 ? 398 ALA B N     1 
ATOM   7900  C  CA    . ALA B 1 398 ? 59.646  86.821  68.680  1.00 112.68 ? 398 ALA B CA    1 
ATOM   7901  C  C     . ALA B 1 398 ? 60.079  85.395  68.991  1.00 108.91 ? 398 ALA B C     1 
ATOM   7902  O  O     . ALA B 1 398 ? 60.070  84.971  70.146  1.00 106.68 ? 398 ALA B O     1 
ATOM   7903  C  CB    . ALA B 1 398 ? 58.222  86.849  68.157  1.00 110.31 ? 398 ALA B CB    1 
ATOM   7904  N  N     . LYS B 1 399 ? 60.466  84.664  67.949  1.00 111.22 ? 399 LYS B N     1 
ATOM   7905  C  CA    . LYS B 1 399 ? 60.954  83.297  68.095  1.00 110.00 ? 399 LYS B CA    1 
ATOM   7906  C  C     . LYS B 1 399 ? 62.209  83.282  68.963  1.00 107.55 ? 399 LYS B C     1 
ATOM   7907  O  O     . LYS B 1 399 ? 62.467  82.321  69.688  1.00 106.84 ? 399 LYS B O     1 
ATOM   7908  C  CB    . LYS B 1 399 ? 61.231  82.676  66.721  1.00 111.38 ? 399 LYS B CB    1 
ATOM   7909  C  CG    . LYS B 1 399 ? 61.723  81.231  66.755  1.00 109.23 ? 399 LYS B CG    1 
ATOM   7910  C  CD    . LYS B 1 399 ? 60.692  80.303  67.390  1.00 101.07 ? 399 LYS B CD    1 
ATOM   7911  C  CE    . LYS B 1 399 ? 61.143  78.852  67.335  1.00 100.20 ? 399 LYS B CE    1 
ATOM   7912  N  NZ    . LYS B 1 399 ? 60.228  77.969  68.101  1.00 98.30  ? 399 LYS B NZ    1 
ATOM   7913  N  N     . GLU B 1 400 ? 62.992  84.353  68.869  1.00 111.56 ? 400 GLU B N     1 
ATOM   7914  C  CA    . GLU B 1 400 ? 64.182  84.513  69.697  1.00 112.52 ? 400 GLU B CA    1 
ATOM   7915  C  C     . GLU B 1 400 ? 63.838  84.773  71.165  1.00 107.21 ? 400 GLU B C     1 
ATOM   7916  O  O     . GLU B 1 400 ? 64.430  84.167  72.059  1.00 104.50 ? 400 GLU B O     1 
ATOM   7917  C  CB    . GLU B 1 400 ? 65.047  85.654  69.159  1.00 114.21 ? 400 GLU B CB    1 
ATOM   7918  C  CG    . GLU B 1 400 ? 65.597  85.419  67.761  1.00 118.58 ? 400 GLU B CG    1 
ATOM   7919  C  CD    . GLU B 1 400 ? 66.342  86.625  67.210  1.00 123.80 ? 400 GLU B CD    1 
ATOM   7920  O  OE1   . GLU B 1 400 ? 66.367  87.676  67.887  1.00 123.35 ? 400 GLU B OE1   1 
ATOM   7921  O  OE2   . GLU B 1 400 ? 66.897  86.522  66.094  1.00 124.45 ? 400 GLU B OE2   1 
ATOM   7922  N  N     . GLU B 1 401 ? 62.863  85.646  71.411  1.00 107.26 ? 401 GLU B N     1 
ATOM   7923  C  CA    . GLU B 1 401 ? 62.512  86.019  72.782  1.00 108.80 ? 401 GLU B CA    1 
ATOM   7924  C  C     . GLU B 1 401 ? 61.700  84.932  73.481  1.00 108.02 ? 401 GLU B C     1 
ATOM   7925  O  O     . GLU B 1 401 ? 61.314  85.092  74.640  1.00 108.46 ? 401 GLU B O     1 
ATOM   7926  C  CB    . GLU B 1 401 ? 61.723  87.334  72.819  1.00 107.58 ? 401 GLU B CB    1 
ATOM   7927  C  CG    . GLU B 1 401 ? 62.507  88.577  72.421  1.00 109.58 ? 401 GLU B CG    1 
ATOM   7928  C  CD    . GLU B 1 401 ? 61.720  89.862  72.650  1.00 111.10 ? 401 GLU B CD    1 
ATOM   7929  O  OE1   . GLU B 1 401 ? 60.853  89.884  73.552  1.00 104.21 ? 401 GLU B OE1   1 
ATOM   7930  O  OE2   . GLU B 1 401 ? 61.963  90.851  71.926  1.00 113.04 ? 401 GLU B OE2   1 
ATOM   7931  N  N     . GLY B 1 402 ? 61.428  83.839  72.774  1.00 106.30 ? 402 GLY B N     1 
ATOM   7932  C  CA    . GLY B 1 402 ? 60.793  82.686  73.385  1.00 104.38 ? 402 GLY B CA    1 
ATOM   7933  C  C     . GLY B 1 402 ? 59.316  82.534  73.066  1.00 99.82  ? 402 GLY B C     1 
ATOM   7934  O  O     . GLY B 1 402 ? 58.614  81.766  73.726  1.00 93.99  ? 402 GLY B O     1 
ATOM   7935  N  N     . VAL B 1 403 ? 58.838  83.259  72.059  1.00 101.71 ? 403 VAL B N     1 
ATOM   7936  C  CA    . VAL B 1 403 ? 57.433  83.167  71.676  1.00 99.93  ? 403 VAL B CA    1 
ATOM   7937  C  C     . VAL B 1 403 ? 57.156  81.812  71.034  1.00 95.02  ? 403 VAL B C     1 
ATOM   7938  O  O     . VAL B 1 403 ? 57.812  81.418  70.072  1.00 99.31  ? 403 VAL B O     1 
ATOM   7939  C  CB    . VAL B 1 403 ? 57.026  84.291  70.701  1.00 99.89  ? 403 VAL B CB    1 
ATOM   7940  C  CG1   . VAL B 1 403 ? 55.650  84.019  70.118  1.00 95.74  ? 403 VAL B CG1   1 
ATOM   7941  C  CG2   . VAL B 1 403 ? 57.057  85.639  71.406  1.00 99.82  ? 403 VAL B CG2   1 
ATOM   7942  N  N     . GLN B 1 404 ? 56.176  81.105  71.579  1.00 91.64  ? 404 GLN B N     1 
ATOM   7943  C  CA    . GLN B 1 404 ? 55.884  79.745  71.151  1.00 94.17  ? 404 GLN B CA    1 
ATOM   7944  C  C     . GLN B 1 404 ? 54.684  79.663  70.214  1.00 89.95  ? 404 GLN B C     1 
ATOM   7945  O  O     . GLN B 1 404 ? 54.573  78.731  69.416  1.00 89.11  ? 404 GLN B O     1 
ATOM   7946  C  CB    . GLN B 1 404 ? 55.659  78.866  72.378  1.00 91.41  ? 404 GLN B CB    1 
ATOM   7947  C  CG    . GLN B 1 404 ? 56.935  78.552  73.135  1.00 90.64  ? 404 GLN B CG    1 
ATOM   7948  C  CD    . GLN B 1 404 ? 56.677  78.329  74.602  1.00 92.30  ? 404 GLN B CD    1 
ATOM   7949  O  OE1   . GLN B 1 404 ? 55.901  79.059  75.218  1.00 92.51  ? 404 GLN B OE1   1 
ATOM   7950  N  NE2   . GLN B 1 404 ? 57.323  77.320  75.176  1.00 95.49  ? 404 GLN B NE2   1 
ATOM   7951  N  N     . ALA B 1 405 ? 53.797  80.648  70.306  1.00 88.39  ? 405 ALA B N     1 
ATOM   7952  C  CA    . ALA B 1 405 ? 52.578  80.658  69.507  1.00 87.41  ? 405 ALA B CA    1 
ATOM   7953  C  C     . ALA B 1 405 ? 52.007  82.063  69.398  1.00 87.26  ? 405 ALA B C     1 
ATOM   7954  O  O     . ALA B 1 405 ? 52.233  82.912  70.270  1.00 90.39  ? 405 ALA B O     1 
ATOM   7955  C  CB    . ALA B 1 405 ? 51.540  79.709  70.108  1.00 84.74  ? 405 ALA B CB    1 
ATOM   7956  N  N     . VAL B 1 406 ? 51.244  82.302  68.335  1.00 86.73  ? 406 VAL B N     1 
ATOM   7957  C  CA    . VAL B 1 406 ? 50.671  83.622  68.113  1.00 83.16  ? 406 VAL B CA    1 
ATOM   7958  C  C     . VAL B 1 406 ? 49.151  83.584  67.985  1.00 87.98  ? 406 VAL B C     1 
ATOM   7959  O  O     . VAL B 1 406 ? 48.591  82.703  67.337  1.00 90.25  ? 406 VAL B O     1 
ATOM   7960  C  CB    . VAL B 1 406 ? 51.256  84.269  66.837  1.00 84.23  ? 406 VAL B CB    1 
ATOM   7961  C  CG1   . VAL B 1 406 ? 50.750  85.699  66.669  1.00 87.82  ? 406 VAL B CG1   1 
ATOM   7962  C  CG2   . VAL B 1 406 ? 52.772  84.240  66.876  1.00 86.13  ? 406 VAL B CG2   1 
ATOM   7963  N  N     . LEU B 1 407 ? 48.489  84.539  68.628  1.00 86.85  ? 407 LEU B N     1 
ATOM   7964  C  CA    . LEU B 1 407 ? 47.059  84.748  68.456  1.00 86.16  ? 407 LEU B CA    1 
ATOM   7965  C  C     . LEU B 1 407 ? 46.816  85.878  67.459  1.00 90.32  ? 407 LEU B C     1 
ATOM   7966  O  O     . LEU B 1 407 ? 47.316  86.987  67.630  1.00 89.54  ? 407 LEU B O     1 
ATOM   7967  C  CB    . LEU B 1 407 ? 46.386  85.067  69.791  1.00 85.98  ? 407 LEU B CB    1 
ATOM   7968  C  CG    . LEU B 1 407 ? 44.897  85.415  69.686  1.00 91.58  ? 407 LEU B CG    1 
ATOM   7969  C  CD1   . LEU B 1 407 ? 44.096  84.251  69.123  1.00 87.83  ? 407 LEU B CD1   1 
ATOM   7970  C  CD2   . LEU B 1 407 ? 44.337  85.858  71.034  1.00 91.07  ? 407 LEU B CD2   1 
ATOM   7971  N  N     . VAL B 1 408 ? 46.045  85.593  66.419  1.00 90.61  ? 408 VAL B N     1 
ATOM   7972  C  CA    . VAL B 1 408 ? 45.773  86.573  65.378  1.00 89.69  ? 408 VAL B CA    1 
ATOM   7973  C  C     . VAL B 1 408 ? 44.345  87.101  65.455  1.00 93.21  ? 408 VAL B C     1 
ATOM   7974  O  O     . VAL B 1 408 ? 43.393  86.391  65.127  1.00 89.80  ? 408 VAL B O     1 
ATOM   7975  C  CB    . VAL B 1 408 ? 46.005  85.981  63.976  1.00 89.16  ? 408 VAL B CB    1 
ATOM   7976  C  CG1   . VAL B 1 408 ? 45.774  87.037  62.908  1.00 91.26  ? 408 VAL B CG1   1 
ATOM   7977  C  CG2   . VAL B 1 408 ? 47.405  85.389  63.872  1.00 86.47  ? 408 VAL B CG2   1 
ATOM   7978  N  N     . LEU B 1 409 ? 44.195  88.343  65.901  1.00 94.97  ? 409 LEU B N     1 
ATOM   7979  C  CA    . LEU B 1 409 ? 42.892  88.993  65.881  1.00 91.93  ? 409 LEU B CA    1 
ATOM   7980  C  C     . LEU B 1 409 ? 42.675  89.612  64.508  1.00 96.09  ? 409 LEU B C     1 
ATOM   7981  O  O     . LEU B 1 409 ? 43.370  90.556  64.135  1.00 99.47  ? 409 LEU B O     1 
ATOM   7982  C  CB    . LEU B 1 409 ? 42.783  90.062  66.969  1.00 95.17  ? 409 LEU B CB    1 
ATOM   7983  C  CG    . LEU B 1 409 ? 42.581  89.577  68.404  1.00 96.58  ? 409 LEU B CG    1 
ATOM   7984  C  CD1   . LEU B 1 409 ? 42.323  90.759  69.328  1.00 96.24  ? 409 LEU B CD1   1 
ATOM   7985  C  CD2   . LEU B 1 409 ? 41.437  88.586  68.464  1.00 93.59  ? 409 LEU B CD2   1 
ATOM   7986  N  N     . THR B 1 410 ? 41.718  89.083  63.750  1.00 96.59  ? 410 THR B N     1 
ATOM   7987  C  CA    . THR B 1 410 ? 41.522  89.558  62.383  1.00 96.30  ? 410 THR B CA    1 
ATOM   7988  C  C     . THR B 1 410 ? 40.050  89.573  62.001  1.00 100.41 ? 410 THR B C     1 
ATOM   7989  O  O     . THR B 1 410 ? 39.262  88.803  62.544  1.00 99.09  ? 410 THR B O     1 
ATOM   7990  C  CB    . THR B 1 410 ? 42.288  88.677  61.365  1.00 95.18  ? 410 THR B CB    1 
ATOM   7991  O  OG1   . THR B 1 410 ? 41.987  89.095  60.027  1.00 93.97  ? 410 THR B OG1   1 
ATOM   7992  C  CG2   . THR B 1 410 ? 41.897  87.217  61.529  1.00 93.13  ? 410 THR B CG2   1 
ATOM   7993  N  N     . PRO B 1 411 ? 39.667  90.465  61.072  1.00 97.56  ? 411 PRO B N     1 
ATOM   7994  C  CA    . PRO B 1 411 ? 38.354  90.294  60.453  1.00 97.86  ? 411 PRO B CA    1 
ATOM   7995  C  C     . PRO B 1 411 ? 38.344  88.965  59.719  1.00 97.71  ? 411 PRO B C     1 
ATOM   7996  O  O     . PRO B 1 411 ? 39.430  88.468  59.406  1.00 98.61  ? 411 PRO B O     1 
ATOM   7997  C  CB    . PRO B 1 411 ? 38.250  91.483  59.490  1.00 98.43  ? 411 PRO B CB    1 
ATOM   7998  C  CG    . PRO B 1 411 ? 39.226  92.481  60.005  1.00 96.68  ? 411 PRO B CG    1 
ATOM   7999  C  CD    . PRO B 1 411 ? 40.342  91.691  60.612  1.00 99.40  ? 411 PRO B CD    1 
ATOM   8000  N  N     . PRO B 1 412 ? 37.157  88.380  59.489  1.00 95.29  ? 412 PRO B N     1 
ATOM   8001  C  CA    . PRO B 1 412 ? 37.068  87.133  58.724  1.00 95.07  ? 412 PRO B CA    1 
ATOM   8002  C  C     . PRO B 1 412 ? 37.959  87.181  57.490  1.00 97.64  ? 412 PRO B C     1 
ATOM   8003  O  O     . PRO B 1 412 ? 37.781  88.064  56.652  1.00 101.44 ? 412 PRO B O     1 
ATOM   8004  C  CB    . PRO B 1 412 ? 35.589  87.067  58.340  1.00 97.00  ? 412 PRO B CB    1 
ATOM   8005  C  CG    . PRO B 1 412 ? 34.893  87.772  59.458  1.00 97.10  ? 412 PRO B CG    1 
ATOM   8006  C  CD    . PRO B 1 412 ? 35.832  88.863  59.921  1.00 96.92  ? 412 PRO B CD    1 
ATOM   8007  N  N     . MET B 1 413 ? 38.913  86.260  57.393  1.00 98.06  ? 413 MET B N     1 
ATOM   8008  C  CA    . MET B 1 413 ? 39.843  86.253  56.271  1.00 98.03  ? 413 MET B CA    1 
ATOM   8009  C  C     . MET B 1 413 ? 39.300  85.408  55.134  1.00 100.30 ? 413 MET B C     1 
ATOM   8010  O  O     . MET B 1 413 ? 38.576  84.437  55.359  1.00 101.44 ? 413 MET B O     1 
ATOM   8011  C  CB    . MET B 1 413 ? 41.218  85.723  56.690  1.00 93.60  ? 413 MET B CB    1 
ATOM   8012  C  CG    . MET B 1 413 ? 41.881  86.494  57.818  1.00 99.58  ? 413 MET B CG    1 
ATOM   8013  S  SD    . MET B 1 413 ? 43.537  85.876  58.210  1.00 109.08 ? 413 MET B SD    1 
ATOM   8014  C  CE    . MET B 1 413 ? 44.480  86.513  56.824  1.00 100.97 ? 413 MET B CE    1 
ATOM   8015  N  N     . ALA B 1 414 ? 39.644  85.785  53.908  1.00 102.54 ? 414 ALA B N     1 
ATOM   8016  C  CA    . ALA B 1 414 ? 39.389  84.914  52.777  1.00 103.24 ? 414 ALA B CA    1 
ATOM   8017  C  C     . ALA B 1 414 ? 40.307  83.720  52.950  1.00 101.10 ? 414 ALA B C     1 
ATOM   8018  O  O     . ALA B 1 414 ? 41.418  83.869  53.459  1.00 101.31 ? 414 ALA B O     1 
ATOM   8019  C  CB    . ALA B 1 414 ? 39.644  85.627  51.458  1.00 101.91 ? 414 ALA B CB    1 
ATOM   8020  N  N     . TRP B 1 415 ? 39.832  82.543  52.558  1.00 102.71 ? 415 TRP B N     1 
ATOM   8021  C  CA    . TRP B 1 415 ? 40.539  81.294  52.826  1.00 104.48 ? 415 TRP B CA    1 
ATOM   8022  C  C     . TRP B 1 415 ? 42.000  81.309  52.372  1.00 101.11 ? 415 TRP B C     1 
ATOM   8023  O  O     . TRP B 1 415 ? 42.887  80.882  53.112  1.00 101.88 ? 415 TRP B O     1 
ATOM   8024  C  CB    . TRP B 1 415 ? 39.806  80.126  52.168  1.00 105.53 ? 415 TRP B CB    1 
ATOM   8025  C  CG    . TRP B 1 415 ? 40.110  78.802  52.806  1.00 104.40 ? 415 TRP B CG    1 
ATOM   8026  C  CD1   . TRP B 1 415 ? 40.371  78.565  54.130  1.00 103.84 ? 415 TRP B CD1   1 
ATOM   8027  C  CD2   . TRP B 1 415 ? 40.200  77.535  52.148  1.00 103.19 ? 415 TRP B CD2   1 
ATOM   8028  N  NE1   . TRP B 1 415 ? 40.610  77.226  54.333  1.00 100.10 ? 415 TRP B NE1   1 
ATOM   8029  C  CE2   . TRP B 1 415 ? 40.512  76.573  53.130  1.00 101.80 ? 415 TRP B CE2   1 
ATOM   8030  C  CE3   . TRP B 1 415 ? 40.045  77.119  50.822  1.00 106.77 ? 415 TRP B CE3   1 
ATOM   8031  C  CZ2   . TRP B 1 415 ? 40.665  75.223  52.829  1.00 102.18 ? 415 TRP B CZ2   1 
ATOM   8032  C  CZ3   . TRP B 1 415 ? 40.205  75.777  50.525  1.00 106.92 ? 415 TRP B CZ3   1 
ATOM   8033  C  CH2   . TRP B 1 415 ? 40.512  74.846  51.523  1.00 101.61 ? 415 TRP B CH2   1 
ATOM   8034  N  N     . GLU B 1 416 ? 42.245  81.789  51.157  1.00 103.00 ? 416 GLU B N     1 
ATOM   8035  C  CA    . GLU B 1 416 ? 43.596  81.810  50.599  1.00 107.52 ? 416 GLU B CA    1 
ATOM   8036  C  C     . GLU B 1 416 ? 44.547  82.697  51.411  1.00 107.08 ? 416 GLU B C     1 
ATOM   8037  O  O     . GLU B 1 416 ? 45.693  82.317  51.681  1.00 104.89 ? 416 GLU B O     1 
ATOM   8038  C  CB    . GLU B 1 416 ? 43.563  82.268  49.141  1.00 111.81 ? 416 GLU B CB    1 
ATOM   8039  C  CG    . GLU B 1 416 ? 44.903  82.134  48.442  1.00 117.54 ? 416 GLU B CG    1 
ATOM   8040  C  CD    . GLU B 1 416 ? 44.902  82.709  47.040  1.00 122.08 ? 416 GLU B CD    1 
ATOM   8041  O  OE1   . GLU B 1 416 ? 43.984  83.493  46.715  1.00 123.69 ? 416 GLU B OE1   1 
ATOM   8042  O  OE2   . GLU B 1 416 ? 45.831  82.385  46.267  1.00 122.56 ? 416 GLU B OE2   1 
ATOM   8043  N  N     . ASP B 1 417 ? 44.068  83.878  51.795  1.00 105.38 ? 417 ASP B N     1 
ATOM   8044  C  CA    . ASP B 1 417 ? 44.860  84.807  52.596  1.00 105.24 ? 417 ASP B CA    1 
ATOM   8045  C  C     . ASP B 1 417 ? 45.127  84.204  53.972  1.00 105.68 ? 417 ASP B C     1 
ATOM   8046  O  O     . ASP B 1 417 ? 46.224  84.342  54.528  1.00 106.19 ? 417 ASP B O     1 
ATOM   8047  C  CB    . ASP B 1 417 ? 44.147  86.155  52.734  1.00 106.29 ? 417 ASP B CB    1 
ATOM   8048  C  CG    . ASP B 1 417 ? 43.953  86.857  51.400  1.00 106.57 ? 417 ASP B CG    1 
ATOM   8049  O  OD1   . ASP B 1 417 ? 44.778  86.650  50.485  1.00 111.72 ? 417 ASP B OD1   1 
ATOM   8050  O  OD2   . ASP B 1 417 ? 42.972  87.620  51.270  1.00 105.20 ? 417 ASP B OD2   1 
ATOM   8051  N  N     . ARG B 1 418 ? 44.104  83.541  54.511  1.00 104.88 ? 418 ARG B N     1 
ATOM   8052  C  CA    . ARG B 1 418 ? 44.205  82.793  55.763  1.00 102.05 ? 418 ARG B CA    1 
ATOM   8053  C  C     . ARG B 1 418 ? 45.365  81.804  55.702  1.00 98.72  ? 418 ARG B C     1 
ATOM   8054  O  O     . ARG B 1 418 ? 46.253  81.806  56.559  1.00 95.66  ? 418 ARG B O     1 
ATOM   8055  C  CB    . ARG B 1 418 ? 42.887  82.053  56.047  1.00 96.19  ? 418 ARG B CB    1 
ATOM   8056  C  CG    . ARG B 1 418 ? 42.867  81.210  57.320  1.00 92.98  ? 418 ARG B CG    1 
ATOM   8057  C  CD    . ARG B 1 418 ? 43.249  79.753  57.051  1.00 93.59  ? 418 ARG B CD    1 
ATOM   8058  N  NE    . ARG B 1 418 ? 43.124  78.897  58.231  1.00 91.62  ? 418 ARG B NE    1 
ATOM   8059  C  CZ    . ARG B 1 418 ? 43.591  77.654  58.303  1.00 90.93  ? 418 ARG B CZ    1 
ATOM   8060  N  NH1   . ARG B 1 418 ? 44.230  77.124  57.270  1.00 92.30  ? 418 ARG B NH1   1 
ATOM   8061  N  NH2   . ARG B 1 418 ? 43.437  76.947  59.413  1.00 92.36  ? 418 ARG B NH2   1 
ATOM   8062  N  N     . ASN B 1 419 ? 45.346  80.968  54.669  1.00 100.56 ? 419 ASN B N     1 
ATOM   8063  C  CA    . ASN B 1 419 ? 46.346  79.926  54.491  1.00 97.72  ? 419 ASN B CA    1 
ATOM   8064  C  C     . ASN B 1 419 ? 47.730  80.531  54.306  1.00 100.54 ? 419 ASN B C     1 
ATOM   8065  O  O     . ASN B 1 419 ? 48.731  79.982  54.767  1.00 97.32  ? 419 ASN B O     1 
ATOM   8066  C  CB    . ASN B 1 419 ? 45.988  79.048  53.294  1.00 97.40  ? 419 ASN B CB    1 
ATOM   8067  C  CG    . ASN B 1 419 ? 44.695  78.288  53.498  1.00 97.28  ? 419 ASN B CG    1 
ATOM   8068  O  OD1   . ASN B 1 419 ? 44.325  77.964  54.626  1.00 96.66  ? 419 ASN B OD1   1 
ATOM   8069  N  ND2   . ASN B 1 419 ? 43.996  78.004  52.406  1.00 97.84  ? 419 ASN B ND2   1 
ATOM   8070  N  N     . ARG B 1 420 ? 47.773  81.663  53.616  1.00 103.37 ? 420 ARG B N     1 
ATOM   8071  C  CA    . ARG B 1 420 ? 49.020  82.382  53.402  1.00 104.37 ? 420 ARG B CA    1 
ATOM   8072  C  C     . ARG B 1 420 ? 49.643  82.856  54.714  1.00 101.21 ? 420 ARG B C     1 
ATOM   8073  O  O     . ARG B 1 420 ? 50.815  82.581  54.981  1.00 98.64  ? 420 ARG B O     1 
ATOM   8074  C  CB    . ARG B 1 420 ? 48.774  83.557  52.461  1.00 105.71 ? 420 ARG B CB    1 
ATOM   8075  C  CG    . ARG B 1 420 ? 50.003  84.356  52.105  1.00 109.52 ? 420 ARG B CG    1 
ATOM   8076  C  CD    . ARG B 1 420 ? 49.692  85.286  50.955  1.00 114.05 ? 420 ARG B CD    1 
ATOM   8077  N  NE    . ARG B 1 420 ? 49.217  84.525  49.799  1.00 117.10 ? 420 ARG B NE    1 
ATOM   8078  C  CZ    . ARG B 1 420 ? 47.967  84.523  49.346  1.00 113.45 ? 420 ARG B CZ    1 
ATOM   8079  N  NH1   . ARG B 1 420 ? 47.038  85.259  49.940  1.00 112.31 ? 420 ARG B NH1   1 
ATOM   8080  N  NH2   . ARG B 1 420 ? 47.653  83.787  48.290  1.00 110.79 ? 420 ARG B NH2   1 
ATOM   8081  N  N     . LEU B 1 421 ? 48.860  83.555  55.532  1.00 100.06 ? 421 LEU B N     1 
ATOM   8082  C  CA    . LEU B 1 421 ? 49.363  84.063  56.808  1.00 99.02  ? 421 LEU B CA    1 
ATOM   8083  C  C     . LEU B 1 421 ? 49.756  82.912  57.737  1.00 100.31 ? 421 LEU B C     1 
ATOM   8084  O  O     . LEU B 1 421 ? 50.798  82.968  58.412  1.00 98.20  ? 421 LEU B O     1 
ATOM   8085  C  CB    . LEU B 1 421 ? 48.326  84.962  57.486  1.00 99.10  ? 421 LEU B CB    1 
ATOM   8086  C  CG    . LEU B 1 421 ? 48.779  85.642  58.786  1.00 98.22  ? 421 LEU B CG    1 
ATOM   8087  C  CD1   . LEU B 1 421 ? 49.910  86.621  58.517  1.00 98.84  ? 421 LEU B CD1   1 
ATOM   8088  C  CD2   . LEU B 1 421 ? 47.625  86.348  59.475  1.00 94.20  ? 421 LEU B CD2   1 
ATOM   8089  N  N     . LYS B 1 422 ? 48.919  81.873  57.757  1.00 98.22  ? 422 LYS B N     1 
ATOM   8090  C  CA    . LYS B 1 422 ? 49.153  80.690  58.587  1.00 97.53  ? 422 LYS B CA    1 
ATOM   8091  C  C     . LYS B 1 422 ? 50.483  80.043  58.203  1.00 95.53  ? 422 LYS B C     1 
ATOM   8092  O  O     . LYS B 1 422 ? 51.318  79.728  59.060  1.00 92.15  ? 422 LYS B O     1 
ATOM   8093  C  CB    . LYS B 1 422 ? 48.014  79.672  58.419  1.00 96.71  ? 422 LYS B CB    1 
ATOM   8094  C  CG    . LYS B 1 422 ? 46.684  80.043  59.085  1.00 92.80  ? 422 LYS B CG    1 
ATOM   8095  C  CD    . LYS B 1 422 ? 46.675  79.828  60.588  1.00 91.81  ? 422 LYS B CD    1 
ATOM   8096  C  CE    . LYS B 1 422 ? 46.055  78.493  60.978  1.00 89.11  ? 422 LYS B CE    1 
ATOM   8097  N  NZ    . LYS B 1 422 ? 45.855  78.396  62.456  1.00 78.43  ? 422 LYS B NZ    1 
ATOM   8098  N  N     . ALA B 1 423 ? 50.667  79.856  56.899  1.00 95.04  ? 423 ALA B N     1 
ATOM   8099  C  CA    . ALA B 1 423 ? 51.872  79.242  56.369  1.00 96.24  ? 423 ALA B CA    1 
ATOM   8100  C  C     . ALA B 1 423 ? 53.101  80.084  56.688  1.00 98.15  ? 423 ALA B C     1 
ATOM   8101  O  O     . ALA B 1 423 ? 54.143  79.549  57.062  1.00 96.71  ? 423 ALA B O     1 
ATOM   8102  C  CB    . ALA B 1 423 ? 51.743  79.038  54.869  1.00 92.90  ? 423 ALA B CB    1 
ATOM   8103  N  N     . LEU B 1 424 ? 52.969  81.401  56.538  1.00 98.92  ? 424 LEU B N     1 
ATOM   8104  C  CA    . LEU B 1 424 ? 54.070  82.329  56.803  1.00 99.60  ? 424 LEU B CA    1 
ATOM   8105  C  C     . LEU B 1 424 ? 54.529  82.305  58.257  1.00 99.77  ? 424 LEU B C     1 
ATOM   8106  O  O     . LEU B 1 424 ? 55.729  82.266  58.530  1.00 102.40 ? 424 LEU B O     1 
ATOM   8107  C  CB    . LEU B 1 424 ? 53.682  83.755  56.410  1.00 100.90 ? 424 LEU B CB    1 
ATOM   8108  C  CG    . LEU B 1 424 ? 54.797  84.789  56.588  1.00 103.03 ? 424 LEU B CG    1 
ATOM   8109  C  CD1   . LEU B 1 424 ? 56.013  84.413  55.764  1.00 103.12 ? 424 LEU B CD1   1 
ATOM   8110  C  CD2   . LEU B 1 424 ? 54.312  86.182  56.215  1.00 104.02 ? 424 LEU B CD2   1 
ATOM   8111  N  N     . LEU B 1 425 ? 53.579  82.337  59.189  1.00 99.29  ? 425 LEU B N     1 
ATOM   8112  C  CA    . LEU B 1 425 ? 53.924  82.249  60.606  1.00 96.72  ? 425 LEU B CA    1 
ATOM   8113  C  C     . LEU B 1 425 ? 54.533  80.880  60.901  1.00 96.46  ? 425 LEU B C     1 
ATOM   8114  O  O     . LEU B 1 425 ? 55.465  80.758  61.703  1.00 93.83  ? 425 LEU B O     1 
ATOM   8115  C  CB    . LEU B 1 425 ? 52.699  82.489  61.491  1.00 97.63  ? 425 LEU B CB    1 
ATOM   8116  C  CG    . LEU B 1 425 ? 52.033  83.863  61.409  1.00 98.62  ? 425 LEU B CG    1 
ATOM   8117  C  CD1   . LEU B 1 425 ? 50.873  83.975  62.387  1.00 97.06  ? 425 LEU B CD1   1 
ATOM   8118  C  CD2   . LEU B 1 425 ? 53.048  84.937  61.688  1.00 101.52 ? 425 LEU B CD2   1 
ATOM   8119  N  N     . LEU B 1 426 ? 53.993  79.854  60.246  1.00 95.69  ? 426 LEU B N     1 
ATOM   8120  C  CA    . LEU B 1 426 ? 54.445  78.481  60.446  1.00 95.96  ? 426 LEU B CA    1 
ATOM   8121  C  C     . LEU B 1 426 ? 55.903  78.296  60.036  1.00 98.98  ? 426 LEU B C     1 
ATOM   8122  O  O     . LEU B 1 426 ? 56.669  77.611  60.719  1.00 100.59 ? 426 LEU B O     1 
ATOM   8123  C  CB    . LEU B 1 426 ? 53.561  77.509  59.663  1.00 95.88  ? 426 LEU B CB    1 
ATOM   8124  C  CG    . LEU B 1 426 ? 53.448  76.112  60.277  1.00 94.23  ? 426 LEU B CG    1 
ATOM   8125  C  CD1   . LEU B 1 426 ? 52.867  76.201  61.679  1.00 88.70  ? 426 LEU B CD1   1 
ATOM   8126  C  CD2   . LEU B 1 426 ? 52.611  75.193  59.398  1.00 89.77  ? 426 LEU B CD2   1 
ATOM   8127  N  N     . ARG B 1 427 ? 56.274  78.893  58.907  1.00 98.64  ? 427 ARG B N     1 
ATOM   8128  C  CA    . ARG B 1 427 ? 57.635  78.792  58.397  1.00 102.75 ? 427 ARG B CA    1 
ATOM   8129  C  C     . ARG B 1 427 ? 58.635  79.463  59.332  1.00 103.67 ? 427 ARG B C     1 
ATOM   8130  O  O     . ARG B 1 427 ? 59.822  79.140  59.317  1.00 103.87 ? 427 ARG B O     1 
ATOM   8131  C  CB    . ARG B 1 427 ? 57.732  79.414  57.003  1.00 104.41 ? 427 ARG B CB    1 
ATOM   8132  C  CG    . ARG B 1 427 ? 57.007  78.632  55.920  1.00 103.87 ? 427 ARG B CG    1 
ATOM   8133  C  CD    . ARG B 1 427 ? 57.387  79.131  54.534  1.00 106.49 ? 427 ARG B CD    1 
ATOM   8134  N  NE    . ARG B 1 427 ? 56.980  80.518  54.315  1.00 107.32 ? 427 ARG B NE    1 
ATOM   8135  C  CZ    . ARG B 1 427 ? 55.895  80.882  53.638  1.00 106.30 ? 427 ARG B CZ    1 
ATOM   8136  N  NH1   . ARG B 1 427 ? 55.096  79.961  53.111  1.00 106.65 ? 427 ARG B NH1   1 
ATOM   8137  N  NH2   . ARG B 1 427 ? 55.607  82.168  53.488  1.00 103.53 ? 427 ARG B NH2   1 
ATOM   8138  N  N     . GLU B 1 428 ? 58.143  80.383  60.157  1.00 102.92 ? 428 GLU B N     1 
ATOM   8139  C  CA    . GLU B 1 428 ? 58.984  81.064  61.134  1.00 101.62 ? 428 GLU B CA    1 
ATOM   8140  C  C     . GLU B 1 428 ? 58.961  80.355  62.479  1.00 101.52 ? 428 GLU B C     1 
ATOM   8141  O  O     . GLU B 1 428 ? 59.383  80.917  63.493  1.00 97.55  ? 428 GLU B O     1 
ATOM   8142  C  CB    . GLU B 1 428 ? 58.526  82.513  61.311  1.00 104.01 ? 428 GLU B CB    1 
ATOM   8143  C  CG    . GLU B 1 428 ? 58.505  83.325  60.027  1.00 108.02 ? 428 GLU B CG    1 
ATOM   8144  C  CD    . GLU B 1 428 ? 59.872  83.428  59.382  1.00 116.12 ? 428 GLU B CD    1 
ATOM   8145  O  OE1   . GLU B 1 428 ? 60.881  83.469  60.122  1.00 117.24 ? 428 GLU B OE1   1 
ATOM   8146  O  OE2   . GLU B 1 428 ? 59.936  83.464  58.134  1.00 117.94 ? 428 GLU B OE2   1 
ATOM   8147  N  N     . GLY B 1 429 ? 58.454  79.124  62.485  1.00 100.06 ? 429 GLY B N     1 
ATOM   8148  C  CA    . GLY B 1 429 ? 58.454  78.308  63.684  1.00 95.70  ? 429 GLY B CA    1 
ATOM   8149  C  C     . GLY B 1 429 ? 57.399  78.754  64.673  1.00 92.80  ? 429 GLY B C     1 
ATOM   8150  O  O     . GLY B 1 429 ? 57.499  78.470  65.867  1.00 93.28  ? 429 GLY B O     1 
ATOM   8151  N  N     . LEU B 1 430 ? 56.385  79.456  64.177  1.00 89.77  ? 430 LEU B N     1 
ATOM   8152  C  CA    . LEU B 1 430 ? 55.335  79.980  65.040  1.00 92.62  ? 430 LEU B CA    1 
ATOM   8153  C  C     . LEU B 1 430 ? 53.939  79.508  64.628  1.00 88.88  ? 430 LEU B C     1 
ATOM   8154  O  O     . LEU B 1 430 ? 53.365  80.006  63.655  1.00 85.74  ? 430 LEU B O     1 
ATOM   8155  C  CB    . LEU B 1 430 ? 55.381  81.512  65.053  1.00 95.12  ? 430 LEU B CB    1 
ATOM   8156  C  CG    . LEU B 1 430 ? 56.577  82.145  65.770  1.00 94.38  ? 430 LEU B CG    1 
ATOM   8157  C  CD1   . LEU B 1 430 ? 56.665  83.638  65.492  1.00 97.31  ? 430 LEU B CD1   1 
ATOM   8158  C  CD2   . LEU B 1 430 ? 56.471  81.891  67.257  1.00 94.74  ? 430 LEU B CD2   1 
ATOM   8159  N  N     . PRO B 1 431 ? 53.386  78.547  65.384  1.00 86.39  ? 431 PRO B N     1 
ATOM   8160  C  CA    . PRO B 1 431 ? 51.990  78.129  65.211  1.00 85.11  ? 431 PRO B CA    1 
ATOM   8161  C  C     . PRO B 1 431 ? 51.024  79.280  65.494  1.00 83.48  ? 431 PRO B C     1 
ATOM   8162  O  O     . PRO B 1 431 ? 51.333  80.176  66.293  1.00 84.02  ? 431 PRO B O     1 
ATOM   8163  C  CB    . PRO B 1 431 ? 51.833  77.001  66.236  1.00 77.63  ? 431 PRO B CB    1 
ATOM   8164  C  CG    . PRO B 1 431 ? 53.221  76.485  66.438  1.00 83.03  ? 431 PRO B CG    1 
ATOM   8165  C  CD    . PRO B 1 431 ? 54.107  77.686  66.338  1.00 82.97  ? 431 PRO B CD    1 
ATOM   8166  N  N     . SER B 1 432 ? 49.863  79.255  64.850  1.00 77.82  ? 432 SER B N     1 
ATOM   8167  C  CA    . SER B 1 432 ? 48.941  80.383  64.940  1.00 83.81  ? 432 SER B CA    1 
ATOM   8168  C  C     . SER B 1 432 ? 47.483  80.003  65.205  1.00 85.26  ? 432 SER B C     1 
ATOM   8169  O  O     . SER B 1 432 ? 46.961  79.023  64.671  1.00 81.44  ? 432 SER B O     1 
ATOM   8170  C  CB    . SER B 1 432 ? 49.035  81.217  63.662  1.00 83.68  ? 432 SER B CB    1 
ATOM   8171  O  OG    . SER B 1 432 ? 48.952  80.397  62.515  1.00 85.99  ? 432 SER B OG    1 
ATOM   8172  N  N     . GLN B 1 433 ? 46.831  80.813  66.030  1.00 81.32  ? 433 GLN B N     1 
ATOM   8173  C  CA    . GLN B 1 433 ? 45.415  80.658  66.307  1.00 81.07  ? 433 GLN B CA    1 
ATOM   8174  C  C     . GLN B 1 433 ? 44.647  81.877  65.827  1.00 84.59  ? 433 GLN B C     1 
ATOM   8175  O  O     . GLN B 1 433 ? 44.867  82.981  66.313  1.00 87.37  ? 433 GLN B O     1 
ATOM   8176  C  CB    . GLN B 1 433 ? 45.182  80.448  67.803  1.00 76.31  ? 433 GLN B CB    1 
ATOM   8177  C  CG    . GLN B 1 433 ? 43.718  80.442  68.162  1.00 76.63  ? 433 GLN B CG    1 
ATOM   8178  C  CD    . GLN B 1 433 ? 42.989  79.305  67.495  1.00 75.50  ? 433 GLN B CD    1 
ATOM   8179  O  OE1   . GLN B 1 433 ? 43.322  78.136  67.702  1.00 70.67  ? 433 GLN B OE1   1 
ATOM   8180  N  NE2   . GLN B 1 433 ? 42.009  79.640  66.662  1.00 73.88  ? 433 GLN B NE2   1 
ATOM   8181  N  N     . ILE B 1 434 ? 43.740  81.682  64.879  1.00 75.80  ? 434 ILE B N     1 
ATOM   8182  C  CA    . ILE B 1 434 ? 42.973  82.803  64.358  1.00 80.45  ? 434 ILE B CA    1 
ATOM   8183  C  C     . ILE B 1 434 ? 41.703  83.040  65.182  1.00 82.13  ? 434 ILE B C     1 
ATOM   8184  O  O     . ILE B 1 434 ? 41.050  82.094  65.630  1.00 80.38  ? 434 ILE B O     1 
ATOM   8185  C  CB    . ILE B 1 434 ? 42.618  82.583  62.875  1.00 81.92  ? 434 ILE B CB    1 
ATOM   8186  C  CG1   . ILE B 1 434 ? 43.895  82.470  62.044  1.00 82.35  ? 434 ILE B CG1   1 
ATOM   8187  C  CG2   . ILE B 1 434 ? 41.725  83.699  62.348  1.00 82.77  ? 434 ILE B CG2   1 
ATOM   8188  C  CD1   . ILE B 1 434 ? 43.644  82.379  60.565  1.00 83.77  ? 434 ILE B CD1   1 
ATOM   8189  N  N     . LEU B 1 435 ? 41.388  84.314  65.399  1.00 82.48  ? 435 LEU B N     1 
ATOM   8190  C  CA    . LEU B 1 435 ? 40.205  84.732  66.139  1.00 83.59  ? 435 LEU B CA    1 
ATOM   8191  C  C     . LEU B 1 435 ? 39.598  85.971  65.473  1.00 85.80  ? 435 LEU B C     1 
ATOM   8192  O  O     . LEU B 1 435 ? 40.280  86.987  65.282  1.00 84.80  ? 435 LEU B O     1 
ATOM   8193  C  CB    . LEU B 1 435 ? 40.555  85.002  67.606  1.00 81.99  ? 435 LEU B CB    1 
ATOM   8194  C  CG    . LEU B 1 435 ? 39.418  85.412  68.541  1.00 84.76  ? 435 LEU B CG    1 
ATOM   8195  C  CD1   . LEU B 1 435 ? 38.301  84.377  68.504  1.00 83.33  ? 435 LEU B CD1   1 
ATOM   8196  C  CD2   . LEU B 1 435 ? 39.936  85.587  69.965  1.00 81.17  ? 435 LEU B CD2   1 
ATOM   8197  N  N     . ASN B 1 436 ? 38.327  85.873  65.092  1.00 87.89  ? 436 ASN B N     1 
ATOM   8198  C  CA    . ASN B 1 436 ? 37.685  86.922  64.300  1.00 90.09  ? 436 ASN B CA    1 
ATOM   8199  C  C     . ASN B 1 436 ? 37.340  88.121  65.185  1.00 92.01  ? 436 ASN B C     1 
ATOM   8200  O  O     . ASN B 1 436 ? 36.879  87.944  66.313  1.00 90.60  ? 436 ASN B O     1 
ATOM   8201  C  CB    . ASN B 1 436 ? 36.448  86.374  63.586  1.00 89.71  ? 436 ASN B CB    1 
ATOM   8202  C  CG    . ASN B 1 436 ? 36.809  85.528  62.369  1.00 92.05  ? 436 ASN B CG    1 
ATOM   8203  O  OD1   . ASN B 1 436 ? 37.916  85.637  61.833  1.00 90.32  ? 436 ASN B OD1   1 
ATOM   8204  N  ND2   . ASN B 1 436 ? 35.875  84.691  61.922  1.00 89.11  ? 436 ASN B ND2   1 
ATOM   8205  N  N     . VAL B 1 437 ? 37.521  89.337  64.662  1.00 96.17  ? 437 VAL B N     1 
ATOM   8206  C  CA    . VAL B 1 437 ? 37.421  90.539  65.502  1.00 98.50  ? 437 VAL B CA    1 
ATOM   8207  C  C     . VAL B 1 437 ? 36.091  91.272  65.602  1.00 96.72  ? 437 VAL B C     1 
ATOM   8208  O  O     . VAL B 1 437 ? 35.951  92.149  66.456  1.00 101.18 ? 437 VAL B O     1 
ATOM   8209  C  CB    . VAL B 1 437 ? 38.440  91.615  65.060  1.00 95.53  ? 437 VAL B CB    1 
ATOM   8210  C  CG1   . VAL B 1 437 ? 39.840  91.146  65.304  1.00 95.86  ? 437 VAL B CG1   1 
ATOM   8211  C  CG2   . VAL B 1 437 ? 38.232  91.990  63.607  1.00 99.19  ? 437 VAL B CG2   1 
ATOM   8212  N  N     . PRO B 1 438 ? 35.064  90.870  64.926  1.00 96.81  ? 438 PRO B N     1 
ATOM   8213  C  CA    . PRO B 1 438 ? 33.808  91.436  65.377  1.00 96.22  ? 438 PRO B CA    1 
ATOM   8214  C  C     . PRO B 1 438 ? 33.415  90.531  66.546  1.00 96.07  ? 438 PRO B C     1 
ATOM   8215  O  O     . PRO B 1 438 ? 32.598  89.642  66.418  1.00 96.98  ? 438 PRO B O     1 
ATOM   8216  C  CB    . PRO B 1 438 ? 32.915  91.274  64.170  1.00 98.16  ? 438 PRO B CB    1 
ATOM   8217  C  CG    . PRO B 1 438 ? 33.855  91.377  63.027  1.00 99.74  ? 438 PRO B CG    1 
ATOM   8218  C  CD    . PRO B 1 438 ? 35.134  90.746  63.471  1.00 96.73  ? 438 PRO B CD    1 
ATOM   8219  N  N     . LEU B 1 439 ? 34.045  90.763  67.687  1.00 92.29  ? 439 LEU B N     1 
ATOM   8220  C  CA    . LEU B 1 439 ? 34.065  89.844  68.824  1.00 94.43  ? 439 LEU B CA    1 
ATOM   8221  C  C     . LEU B 1 439 ? 33.730  90.481  70.162  1.00 95.26  ? 439 LEU B C     1 
ATOM   8222  O  O     . LEU B 1 439 ? 34.303  91.500  70.544  1.00 97.18  ? 439 LEU B O     1 
ATOM   8223  C  CB    . LEU B 1 439 ? 35.441  89.179  68.939  1.00 92.71  ? 439 LEU B CB    1 
ATOM   8224  C  CG    . LEU B 1 439 ? 35.727  88.437  70.254  1.00 93.79  ? 439 LEU B CG    1 
ATOM   8225  C  CD1   . LEU B 1 439 ? 34.852  87.196  70.412  1.00 88.57  ? 439 LEU B CD1   1 
ATOM   8226  C  CD2   . LEU B 1 439 ? 37.198  88.067  70.365  1.00 89.52  ? 439 LEU B CD2   1 
ATOM   8227  N  N     . ARG B 1 440 ? 32.797  89.856  70.872  1.00 90.05  ? 440 ARG B N     1 
ATOM   8228  C  CA    . ARG B 1 440 ? 32.371  90.335  72.176  1.00 92.01  ? 440 ARG B CA    1 
ATOM   8229  C  C     . ARG B 1 440 ? 32.616  89.292  73.267  1.00 92.57  ? 440 ARG B C     1 
ATOM   8230  O  O     . ARG B 1 440 ? 32.605  88.091  73.004  1.00 92.65  ? 440 ARG B O     1 
ATOM   8231  C  CB    . ARG B 1 440 ? 30.902  90.743  72.145  1.00 94.37  ? 440 ARG B CB    1 
ATOM   8232  C  CG    . ARG B 1 440 ? 30.674  92.042  71.403  1.00 97.70  ? 440 ARG B CG    1 
ATOM   8233  C  CD    . ARG B 1 440 ? 29.223  92.440  71.443  1.00 96.07  ? 440 ARG B CD    1 
ATOM   8234  N  NE    . ARG B 1 440 ? 28.911  92.852  72.810  1.00 100.26 ? 440 ARG B NE    1 
ATOM   8235  C  CZ    . ARG B 1 440 ? 29.340  93.976  73.380  1.00 98.47  ? 440 ARG B CZ    1 
ATOM   8236  N  NH1   . ARG B 1 440 ? 30.094  94.832  72.703  1.00 96.23  ? 440 ARG B NH1   1 
ATOM   8237  N  NH2   . ARG B 1 440 ? 29.013  94.244  74.637  1.00 98.15  ? 440 ARG B NH2   1 
ATOM   8238  N  N     . GLU B 1 441 ? 32.862  89.763  74.486  1.00 92.27  ? 441 GLU B N     1 
ATOM   8239  C  CA    . GLU B 1 441 ? 33.187  88.895  75.616  1.00 94.41  ? 441 GLU B CA    1 
ATOM   8240  C  C     . GLU B 1 441 ? 32.118  87.842  75.944  1.00 91.62  ? 441 GLU B C     1 
ATOM   8241  O  O     . GLU B 1 441 ? 32.438  86.751  76.419  1.00 88.68  ? 441 GLU B O     1 
ATOM   8242  C  CB    . GLU B 1 441 ? 33.455  89.754  76.850  1.00 95.24  ? 441 GLU B CB    1 
ATOM   8243  C  CG    . GLU B 1 441 ? 33.696  88.970  78.122  1.00 95.06  ? 441 GLU B CG    1 
ATOM   8244  C  CD    . GLU B 1 441 ? 34.245  89.842  79.218  1.00 102.56 ? 441 GLU B CD    1 
ATOM   8245  O  OE1   . GLU B 1 441 ? 34.385  91.058  78.969  1.00 102.42 ? 441 GLU B OE1   1 
ATOM   8246  O  OE2   . GLU B 1 441 ? 34.548  89.319  80.313  1.00 103.80 ? 441 GLU B OE2   1 
ATOM   8247  N  N     . GLU B 1 442 ? 30.853  88.156  75.681  1.00 92.10  ? 442 GLU B N     1 
ATOM   8248  C  CA    . GLU B 1 442 ? 29.779  87.215  75.989  1.00 94.60  ? 442 GLU B CA    1 
ATOM   8249  C  C     . GLU B 1 442 ? 29.842  86.029  75.032  1.00 90.95  ? 442 GLU B C     1 
ATOM   8250  O  O     . GLU B 1 442 ? 29.219  84.993  75.276  1.00 86.95  ? 442 GLU B O     1 
ATOM   8251  C  CB    . GLU B 1 442 ? 28.404  87.883  75.918  1.00 88.62  ? 442 GLU B CB    1 
ATOM   8252  C  CG    . GLU B 1 442 ? 28.196  88.795  74.725  1.00 96.18  ? 442 GLU B CG    1 
ATOM   8253  C  CD    . GLU B 1 442 ? 28.792  90.180  74.909  1.00 102.19 ? 442 GLU B CD    1 
ATOM   8254  O  OE1   . GLU B 1 442 ? 29.575  90.394  75.865  1.00 96.38  ? 442 GLU B OE1   1 
ATOM   8255  O  OE2   . GLU B 1 442 ? 28.465  91.060  74.088  1.00 102.57 ? 442 GLU B OE2   1 
ATOM   8256  N  N     . GLU B 1 443 ? 30.587  86.185  73.937  1.00 87.15  ? 443 GLU B N     1 
ATOM   8257  C  CA    . GLU B 1 443 ? 30.815  85.083  73.007  1.00 85.94  ? 443 GLU B CA    1 
ATOM   8258  C  C     . GLU B 1 443 ? 31.868  84.138  73.587  1.00 80.35  ? 443 GLU B C     1 
ATOM   8259  O  O     . GLU B 1 443 ? 32.857  83.793  72.938  1.00 75.48  ? 443 GLU B O     1 
ATOM   8260  C  CB    . GLU B 1 443 ? 31.239  85.594  71.626  1.00 83.00  ? 443 GLU B CB    1 
ATOM   8261  C  CG    . GLU B 1 443 ? 30.131  86.327  70.879  1.00 85.36  ? 443 GLU B CG    1 
ATOM   8262  C  CD    . GLU B 1 443 ? 30.556  86.796  69.501  1.00 84.38  ? 443 GLU B CD    1 
ATOM   8263  O  OE1   . GLU B 1 443 ? 30.470  85.998  68.540  1.00 84.33  ? 443 GLU B OE1   1 
ATOM   8264  O  OE2   . GLU B 1 443 ? 30.963  87.968  69.376  1.00 83.50  ? 443 GLU B OE2   1 
ATOM   8265  N  N     . ARG B 1 444 ? 31.620  83.732  74.827  1.00 80.59  ? 444 ARG B N     1 
ATOM   8266  C  CA    . ARG B 1 444 ? 32.528  82.916  75.615  1.00 79.33  ? 444 ARG B CA    1 
ATOM   8267  C  C     . ARG B 1 444 ? 33.017  81.674  74.881  1.00 78.63  ? 444 ARG B C     1 
ATOM   8268  O  O     . ARG B 1 444 ? 34.200  81.350  74.920  1.00 76.07  ? 444 ARG B O     1 
ATOM   8269  C  CB    . ARG B 1 444 ? 31.821  82.493  76.907  1.00 84.29  ? 444 ARG B CB    1 
ATOM   8270  C  CG    . ARG B 1 444 ? 32.571  81.473  77.732  1.00 81.18  ? 444 ARG B CG    1 
ATOM   8271  C  CD    . ARG B 1 444 ? 31.748  81.015  78.925  1.00 82.42  ? 444 ARG B CD    1 
ATOM   8272  N  NE    . ARG B 1 444 ? 32.208  79.711  79.399  1.00 92.69  ? 444 ARG B NE    1 
ATOM   8273  C  CZ    . ARG B 1 444 ? 32.082  79.266  80.646  1.00 96.56  ? 444 ARG B CZ    1 
ATOM   8274  N  NH1   . ARG B 1 444 ? 31.498  80.017  81.571  1.00 95.60  ? 444 ARG B NH1   1 
ATOM   8275  N  NH2   . ARG B 1 444 ? 32.539  78.060  80.962  1.00 92.37  ? 444 ARG B NH2   1 
ATOM   8276  N  N     . HIS B 1 445 ? 32.106  80.998  74.186  1.00 73.03  ? 445 HIS B N     1 
ATOM   8277  C  CA    . HIS B 1 445 ? 32.422  79.708  73.581  1.00 69.85  ? 445 HIS B CA    1 
ATOM   8278  C  C     . HIS B 1 445 ? 33.464  79.820  72.467  1.00 67.85  ? 445 HIS B C     1 
ATOM   8279  O  O     . HIS B 1 445 ? 34.445  79.050  72.418  1.00 66.36  ? 445 HIS B O     1 
ATOM   8280  C  CB    . HIS B 1 445 ? 31.141  79.069  73.050  1.00 63.81  ? 445 HIS B CB    1 
ATOM   8281  C  CG    . HIS B 1 445 ? 30.106  78.846  74.107  1.00 66.72  ? 445 HIS B CG    1 
ATOM   8282  N  ND1   . HIS B 1 445 ? 30.300  77.992  75.174  1.00 66.11  ? 445 HIS B ND1   1 
ATOM   8283  C  CD2   . HIS B 1 445 ? 28.869  79.375  74.270  1.00 59.11  ? 445 HIS B CD2   1 
ATOM   8284  C  CE1   . HIS B 1 445 ? 29.228  78.005  75.946  1.00 62.84  ? 445 HIS B CE1   1 
ATOM   8285  N  NE2   . HIS B 1 445 ? 28.344  78.832  75.418  1.00 64.61  ? 445 HIS B NE2   1 
ATOM   8286  N  N     . ARG B 1 446 ? 33.255  80.797  71.591  1.00 65.70  ? 446 ARG B N     1 
ATOM   8287  C  CA    . ARG B 1 446 ? 34.161  81.035  70.479  1.00 69.50  ? 446 ARG B CA    1 
ATOM   8288  C  C     . ARG B 1 446 ? 35.586  81.379  70.949  1.00 70.65  ? 446 ARG B C     1 
ATOM   8289  O  O     . ARG B 1 446 ? 36.550  80.728  70.529  1.00 69.31  ? 446 ARG B O     1 
ATOM   8290  C  CB    . ARG B 1 446 ? 33.604  82.145  69.582  1.00 68.66  ? 446 ARG B CB    1 
ATOM   8291  C  CG    . ARG B 1 446 ? 34.321  82.290  68.249  1.00 70.67  ? 446 ARG B CG    1 
ATOM   8292  C  CD    . ARG B 1 446 ? 33.448  82.984  67.209  1.00 69.84  ? 446 ARG B CD    1 
ATOM   8293  N  NE    . ARG B 1 446 ? 33.024  84.318  67.629  1.00 74.81  ? 446 ARG B NE    1 
ATOM   8294  C  CZ    . ARG B 1 446 ? 33.611  85.449  67.242  1.00 85.46  ? 446 ARG B CZ    1 
ATOM   8295  N  NH1   . ARG B 1 446 ? 34.660  85.413  66.429  1.00 83.12  ? 446 ARG B NH1   1 
ATOM   8296  N  NH2   . ARG B 1 446 ? 33.151  86.620  67.670  1.00 84.56  ? 446 ARG B NH2   1 
ATOM   8297  N  N     . TRP B 1 447 ? 35.735  82.380  71.820  1.00 72.44  ? 447 TRP B N     1 
ATOM   8298  C  CA    . TRP B 1 447 ? 37.090  82.808  72.163  1.00 73.70  ? 447 TRP B CA    1 
ATOM   8299  C  C     . TRP B 1 447 ? 37.732  81.869  73.180  1.00 70.98  ? 447 TRP B C     1 
ATOM   8300  O  O     . TRP B 1 447 ? 38.955  81.765  73.218  1.00 75.30  ? 447 TRP B O     1 
ATOM   8301  C  CB    . TRP B 1 447 ? 37.146  84.272  72.654  1.00 74.11  ? 447 TRP B CB    1 
ATOM   8302  C  CG    . TRP B 1 447 ? 36.405  84.648  73.911  1.00 76.59  ? 447 TRP B CG    1 
ATOM   8303  C  CD1   . TRP B 1 447 ? 35.218  85.322  73.990  1.00 81.95  ? 447 TRP B CD1   1 
ATOM   8304  C  CD2   . TRP B 1 447 ? 36.838  84.444  75.264  1.00 78.66  ? 447 TRP B CD2   1 
ATOM   8305  N  NE1   . TRP B 1 447 ? 34.870  85.519  75.304  1.00 80.09  ? 447 TRP B NE1   1 
ATOM   8306  C  CE2   . TRP B 1 447 ? 35.848  84.989  76.107  1.00 81.35  ? 447 TRP B CE2   1 
ATOM   8307  C  CE3   . TRP B 1 447 ? 37.957  83.837  75.847  1.00 75.70  ? 447 TRP B CE3   1 
ATOM   8308  C  CZ2   . TRP B 1 447 ? 35.943  84.945  77.499  1.00 79.83  ? 447 TRP B CZ2   1 
ATOM   8309  C  CZ3   . TRP B 1 447 ? 38.048  83.793  77.227  1.00 75.29  ? 447 TRP B CZ3   1 
ATOM   8310  C  CH2   . TRP B 1 447 ? 37.049  84.342  78.037  1.00 80.93  ? 447 TRP B CH2   1 
ATOM   8311  N  N     . GLU B 1 448 ? 36.934  81.174  73.988  1.00 69.48  ? 448 GLU B N     1 
ATOM   8312  C  CA    . GLU B 1 448 ? 37.517  80.164  74.873  1.00 74.66  ? 448 GLU B CA    1 
ATOM   8313  C  C     . GLU B 1 448 ? 38.075  79.013  74.039  1.00 74.44  ? 448 GLU B C     1 
ATOM   8314  O  O     . GLU B 1 448 ? 39.126  78.451  74.377  1.00 71.38  ? 448 GLU B O     1 
ATOM   8315  C  CB    . GLU B 1 448 ? 36.509  79.631  75.899  1.00 73.00  ? 448 GLU B CB    1 
ATOM   8316  C  CG    . GLU B 1 448 ? 36.283  80.533  77.112  1.00 77.69  ? 448 GLU B CG    1 
ATOM   8317  C  CD    . GLU B 1 448 ? 35.588  79.812  78.256  1.00 80.80  ? 448 GLU B CD    1 
ATOM   8318  O  OE1   . GLU B 1 448 ? 35.259  78.620  78.097  1.00 81.51  ? 448 GLU B OE1   1 
ATOM   8319  O  OE2   . GLU B 1 448 ? 35.371  80.432  79.319  1.00 88.27  ? 448 GLU B OE2   1 
ATOM   8320  N  N     . ASN B 1 449 ? 37.380  78.658  72.956  1.00 70.21  ? 449 ASN B N     1 
ATOM   8321  C  CA    . ASN B 1 449 ? 37.924  77.649  72.050  1.00 69.25  ? 449 ASN B CA    1 
ATOM   8322  C  C     . ASN B 1 449 ? 39.177  78.165  71.345  1.00 68.62  ? 449 ASN B C     1 
ATOM   8323  O  O     . ASN B 1 449 ? 40.157  77.423  71.165  1.00 63.11  ? 449 ASN B O     1 
ATOM   8324  C  CB    . ASN B 1 449 ? 36.877  77.210  71.027  1.00 64.02  ? 449 ASN B CB    1 
ATOM   8325  C  CG    . ASN B 1 449 ? 36.184  75.944  71.444  1.00 66.21  ? 449 ASN B CG    1 
ATOM   8326  O  OD1   . ASN B 1 449 ? 36.425  75.444  72.542  1.00 62.48  ? 449 ASN B OD1   1 
ATOM   8327  N  ND2   . ASN B 1 449 ? 35.311  75.420  70.587  1.00 64.22  ? 449 ASN B ND2   1 
ATOM   8328  N  N     . ALA B 1 450 ? 39.143  79.438  70.958  1.00 69.22  ? 450 ALA B N     1 
ATOM   8329  C  CA    . ALA B 1 450 ? 40.325  80.080  70.388  1.00 73.89  ? 450 ALA B CA    1 
ATOM   8330  C  C     . ALA B 1 450 ? 41.512  79.906  71.333  1.00 72.49  ? 450 ALA B C     1 
ATOM   8331  O  O     . ALA B 1 450 ? 42.599  79.504  70.915  1.00 72.03  ? 450 ALA B O     1 
ATOM   8332  C  CB    . ALA B 1 450 ? 40.066  81.559  70.121  1.00 69.07  ? 450 ALA B CB    1 
ATOM   8333  N  N     . LEU B 1 451 ? 41.283  80.185  72.613  1.00 69.17  ? 451 LEU B N     1 
ATOM   8334  C  CA    . LEU B 1 451 ? 42.333  80.087  73.629  1.00 76.53  ? 451 LEU B CA    1 
ATOM   8335  C  C     . LEU B 1 451 ? 42.834  78.660  73.833  1.00 71.58  ? 451 LEU B C     1 
ATOM   8336  O  O     . LEU B 1 451 ? 44.037  78.435  73.974  1.00 69.68  ? 451 LEU B O     1 
ATOM   8337  C  CB    . LEU B 1 451 ? 41.840  80.665  74.958  1.00 78.15  ? 451 LEU B CB    1 
ATOM   8338  C  CG    . LEU B 1 451 ? 42.253  82.107  75.278  1.00 76.12  ? 451 LEU B CG    1 
ATOM   8339  C  CD1   . LEU B 1 451 ? 42.371  82.955  74.018  1.00 74.54  ? 451 LEU B CD1   1 
ATOM   8340  C  CD2   . LEU B 1 451 ? 41.258  82.729  76.242  1.00 75.85  ? 451 LEU B CD2   1 
ATOM   8341  N  N     . LEU B 1 452 ? 41.915  77.699  73.872  1.00 73.02  ? 452 LEU B N     1 
ATOM   8342  C  CA    . LEU B 1 452 ? 42.315  76.299  74.014  1.00 70.31  ? 452 LEU B CA    1 
ATOM   8343  C  C     . LEU B 1 452 ? 43.214  75.864  72.857  1.00 68.23  ? 452 LEU B C     1 
ATOM   8344  O  O     . LEU B 1 452 ? 44.205  75.138  73.053  1.00 65.48  ? 452 LEU B O     1 
ATOM   8345  C  CB    . LEU B 1 452 ? 41.087  75.393  74.088  1.00 69.42  ? 452 LEU B CB    1 
ATOM   8346  C  CG    . LEU B 1 452 ? 40.239  75.464  75.355  1.00 66.16  ? 452 LEU B CG    1 
ATOM   8347  C  CD1   . LEU B 1 452 ? 38.986  74.652  75.154  1.00 61.80  ? 452 LEU B CD1   1 
ATOM   8348  C  CD2   . LEU B 1 452 ? 41.011  74.948  76.556  1.00 67.53  ? 452 LEU B CD2   1 
ATOM   8349  N  N     . GLY B 1 453 ? 42.851  76.304  71.651  1.00 67.03  ? 453 GLY B N     1 
ATOM   8350  C  CA    . GLY B 1 453 ? 43.651  76.028  70.473  1.00 62.64  ? 453 GLY B CA    1 
ATOM   8351  C  C     . GLY B 1 453 ? 45.022  76.662  70.589  1.00 70.26  ? 453 GLY B C     1 
ATOM   8352  O  O     . GLY B 1 453 ? 46.040  76.006  70.360  1.00 66.64  ? 453 GLY B O     1 
ATOM   8353  N  N     . LEU B 1 454 ? 45.039  77.934  70.977  1.00 68.37  ? 454 LEU B N     1 
ATOM   8354  C  CA    . LEU B 1 454 ? 46.275  78.692  71.143  1.00 70.41  ? 454 LEU B CA    1 
ATOM   8355  C  C     . LEU B 1 454 ? 47.237  77.988  72.102  1.00 69.40  ? 454 LEU B C     1 
ATOM   8356  O  O     . LEU B 1 454 ? 48.424  77.857  71.818  1.00 66.77  ? 454 LEU B O     1 
ATOM   8357  C  CB    . LEU B 1 454 ? 45.966  80.104  71.647  1.00 69.78  ? 454 LEU B CB    1 
ATOM   8358  C  CG    . LEU B 1 454 ? 47.143  81.077  71.793  1.00 77.06  ? 454 LEU B CG    1 
ATOM   8359  C  CD1   . LEU B 1 454 ? 47.696  81.485  70.432  1.00 75.12  ? 454 LEU B CD1   1 
ATOM   8360  C  CD2   . LEU B 1 454 ? 46.737  82.303  72.592  1.00 73.57  ? 454 LEU B CD2   1 
ATOM   8361  N  N     . LEU B 1 455 ? 46.711  77.527  73.232  1.00 68.34  ? 455 LEU B N     1 
ATOM   8362  C  CA    . LEU B 1 455 ? 47.523  76.876  74.255  1.00 72.47  ? 455 LEU B CA    1 
ATOM   8363  C  C     . LEU B 1 455 ? 47.995  75.490  73.811  1.00 76.15  ? 455 LEU B C     1 
ATOM   8364  O  O     . LEU B 1 455 ? 49.124  75.090  74.110  1.00 76.66  ? 455 LEU B O     1 
ATOM   8365  C  CB    . LEU B 1 455 ? 46.733  76.785  75.563  1.00 74.09  ? 455 LEU B CB    1 
ATOM   8366  C  CG    . LEU B 1 455 ? 46.409  78.153  76.176  1.00 76.79  ? 455 LEU B CG    1 
ATOM   8367  C  CD1   . LEU B 1 455 ? 45.347  78.050  77.254  1.00 77.00  ? 455 LEU B CD1   1 
ATOM   8368  C  CD2   . LEU B 1 455 ? 47.675  78.783  76.738  1.00 79.32  ? 455 LEU B CD2   1 
ATOM   8369  N  N     . ALA B 1 456 ? 47.134  74.761  73.100  1.00 72.11  ? 456 ALA B N     1 
ATOM   8370  C  CA    . ALA B 1 456 ? 47.529  73.471  72.535  1.00 72.92  ? 456 ALA B CA    1 
ATOM   8371  C  C     . ALA B 1 456 ? 48.642  73.636  71.495  1.00 71.97  ? 456 ALA B C     1 
ATOM   8372  O  O     . ALA B 1 456 ? 49.532  72.789  71.373  1.00 71.86  ? 456 ALA B O     1 
ATOM   8373  C  CB    . ALA B 1 456 ? 46.322  72.762  71.914  1.00 66.43  ? 456 ALA B CB    1 
ATOM   8374  N  N     . LYS B 1 457 ? 48.577  74.730  70.744  1.00 69.40  ? 457 LYS B N     1 
ATOM   8375  C  CA    . LYS B 1 457 ? 49.546  75.004  69.695  1.00 72.83  ? 457 LYS B CA    1 
ATOM   8376  C  C     . LYS B 1 457 ? 50.875  75.435  70.301  1.00 79.92  ? 457 LYS B C     1 
ATOM   8377  O  O     . LYS B 1 457 ? 51.924  75.309  69.672  1.00 82.14  ? 457 LYS B O     1 
ATOM   8378  C  CB    . LYS B 1 457 ? 49.010  76.077  68.745  1.00 69.18  ? 457 LYS B CB    1 
ATOM   8379  C  CG    . LYS B 1 457 ? 47.852  75.594  67.869  1.00 73.83  ? 457 LYS B CG    1 
ATOM   8380  C  CD    . LYS B 1 457 ? 47.097  76.742  67.205  1.00 70.36  ? 457 LYS B CD    1 
ATOM   8381  C  CE    . LYS B 1 457 ? 46.045  76.209  66.241  1.00 71.09  ? 457 LYS B CE    1 
ATOM   8382  N  NZ    . LYS B 1 457 ? 45.276  77.287  65.553  1.00 77.36  ? 457 LYS B NZ    1 
ATOM   8383  N  N     . ALA B 1 458 ? 50.823  75.928  71.534  1.00 76.39  ? 458 ALA B N     1 
ATOM   8384  C  CA    . ALA B 1 458 ? 52.024  76.346  72.241  1.00 79.31  ? 458 ALA B CA    1 
ATOM   8385  C  C     . ALA B 1 458 ? 52.708  75.159  72.913  1.00 81.91  ? 458 ALA B C     1 
ATOM   8386  O  O     . ALA B 1 458 ? 53.765  75.306  73.533  1.00 81.04  ? 458 ALA B O     1 
ATOM   8387  C  CB    . ALA B 1 458 ? 51.688  77.415  73.262  1.00 79.36  ? 458 ALA B CB    1 
ATOM   8388  N  N     . GLY B 1 459 ? 52.096  73.986  72.790  1.00 78.59  ? 459 GLY B N     1 
ATOM   8389  C  CA    . GLY B 1 459 ? 52.664  72.762  73.325  1.00 74.86  ? 459 GLY B CA    1 
ATOM   8390  C  C     . GLY B 1 459 ? 52.171  72.362  74.701  1.00 74.16  ? 459 GLY B C     1 
ATOM   8391  O  O     . GLY B 1 459 ? 52.608  71.351  75.245  1.00 76.43  ? 459 GLY B O     1 
ATOM   8392  N  N     . LEU B 1 460 ? 51.248  73.136  75.260  1.00 80.49  ? 460 LEU B N     1 
ATOM   8393  C  CA    . LEU B 1 460 ? 50.693  72.809  76.569  1.00 79.93  ? 460 LEU B CA    1 
ATOM   8394  C  C     . LEU B 1 460 ? 49.699  71.661  76.461  1.00 77.36  ? 460 LEU B C     1 
ATOM   8395  O  O     . LEU B 1 460 ? 49.000  71.528  75.460  1.00 78.38  ? 460 LEU B O     1 
ATOM   8396  C  CB    . LEU B 1 460 ? 50.023  74.036  77.195  1.00 80.13  ? 460 LEU B CB    1 
ATOM   8397  C  CG    . LEU B 1 460 ? 50.952  74.984  77.958  1.00 84.70  ? 460 LEU B CG    1 
ATOM   8398  C  CD1   . LEU B 1 460 ? 51.850  75.760  77.006  1.00 82.21  ? 460 LEU B CD1   1 
ATOM   8399  C  CD2   . LEU B 1 460 ? 50.151  75.932  78.836  1.00 86.34  ? 460 LEU B CD2   1 
ATOM   8400  N  N     . GLN B 1 461 ? 49.644  70.827  77.491  1.00 78.34  ? 461 GLN B N     1 
ATOM   8401  C  CA    . GLN B 1 461 ? 48.651  69.761  77.543  1.00 81.97  ? 461 GLN B CA    1 
ATOM   8402  C  C     . GLN B 1 461 ? 47.561  70.122  78.552  1.00 79.64  ? 461 GLN B C     1 
ATOM   8403  O  O     . GLN B 1 461 ? 47.781  70.080  79.764  1.00 82.16  ? 461 GLN B O     1 
ATOM   8404  C  CB    . GLN B 1 461 ? 49.300  68.420  77.890  1.00 86.06  ? 461 GLN B CB    1 
ATOM   8405  C  CG    . GLN B 1 461 ? 48.440  67.210  77.528  1.00 85.40  ? 461 GLN B CG    1 
ATOM   8406  C  CD    . GLN B 1 461 ? 49.140  65.904  77.829  1.00 91.62  ? 461 GLN B CD    1 
ATOM   8407  O  OE1   . GLN B 1 461 ? 49.990  65.841  78.717  1.00 96.07  ? 461 GLN B OE1   1 
ATOM   8408  N  NE2   . GLN B 1 461 ? 48.796  64.857  77.087  1.00 86.73  ? 461 GLN B NE2   1 
ATOM   8409  N  N     . VAL B 1 462 ? 46.386  70.476  78.047  1.00 81.52  ? 462 VAL B N     1 
ATOM   8410  C  CA    . VAL B 1 462 ? 45.338  71.035  78.889  1.00 76.84  ? 462 VAL B CA    1 
ATOM   8411  C  C     . VAL B 1 462 ? 44.612  69.951  79.689  1.00 72.68  ? 462 VAL B C     1 
ATOM   8412  O  O     . VAL B 1 462 ? 44.241  70.185  80.842  1.00 73.41  ? 462 VAL B O     1 
ATOM   8413  C  CB    . VAL B 1 462 ? 44.343  71.877  78.052  1.00 76.95  ? 462 VAL B CB    1 
ATOM   8414  C  CG1   . VAL B 1 462 ? 45.108  72.756  77.067  1.00 77.05  ? 462 VAL B CG1   1 
ATOM   8415  C  CG2   . VAL B 1 462 ? 43.336  71.005  77.315  1.00 72.25  ? 462 VAL B CG2   1 
ATOM   8416  N  N     . VAL B 1 463 ? 44.418  68.771  79.103  1.00 65.01  ? 463 VAL B N     1 
ATOM   8417  C  CA    . VAL B 1 463 ? 43.792  67.677  79.840  1.00 72.73  ? 463 VAL B CA    1 
ATOM   8418  C  C     . VAL B 1 463 ? 44.476  66.342  79.589  1.00 67.22  ? 463 VAL B C     1 
ATOM   8419  O  O     . VAL B 1 463 ? 45.257  66.193  78.655  1.00 68.69  ? 463 VAL B O     1 
ATOM   8420  C  CB    . VAL B 1 463 ? 42.282  67.509  79.489  1.00 68.70  ? 463 VAL B CB    1 
ATOM   8421  C  CG1   . VAL B 1 463 ? 41.467  68.670  80.025  1.00 67.76  ? 463 VAL B CG1   1 
ATOM   8422  C  CG2   . VAL B 1 463 ? 42.093  67.354  77.993  1.00 67.75  ? 463 VAL B CG2   1 
ATOM   8423  N  N     . ALA B 1 464 ? 44.155  65.378  80.446  1.00 70.72  ? 464 ALA B N     1 
ATOM   8424  C  CA    . ALA B 1 464 ? 44.610  64.003  80.310  1.00 70.55  ? 464 ALA B CA    1 
ATOM   8425  C  C     . ALA B 1 464 ? 43.601  63.079  80.988  1.00 68.76  ? 464 ALA B C     1 
ATOM   8426  O  O     . ALA B 1 464 ? 42.735  63.536  81.741  1.00 69.56  ? 464 ALA B O     1 
ATOM   8427  C  CB    . ALA B 1 464 ? 45.995  63.829  80.916  1.00 75.63  ? 464 ALA B CB    1 
ATOM   8428  N  N     . LEU B 1 465 ? 43.698  61.787  80.706  1.00 64.74  ? 465 LEU B N     1 
ATOM   8429  C  CA    . LEU B 1 465 ? 42.879  60.808  81.402  1.00 69.76  ? 465 LEU B CA    1 
ATOM   8430  C  C     . LEU B 1 465 ? 43.592  60.300  82.647  1.00 72.54  ? 465 LEU B C     1 
ATOM   8431  O  O     . LEU B 1 465 ? 44.796  60.050  82.623  1.00 71.27  ? 465 LEU B O     1 
ATOM   8432  C  CB    . LEU B 1 465 ? 42.535  59.631  80.483  1.00 68.89  ? 465 LEU B CB    1 
ATOM   8433  C  CG    . LEU B 1 465 ? 41.611  59.890  79.291  1.00 70.24  ? 465 LEU B CG    1 
ATOM   8434  C  CD1   . LEU B 1 465 ? 41.625  58.688  78.357  1.00 65.91  ? 465 LEU B CD1   1 
ATOM   8435  C  CD2   . LEU B 1 465 ? 40.190  60.182  79.770  1.00 70.74  ? 465 LEU B CD2   1 
ATOM   8436  N  N     . SER B 1 466 ? 42.847  60.141  83.732  1.00 76.16  ? 466 SER B N     1 
ATOM   8437  C  CA    . SER B 1 466 ? 43.386  59.479  84.908  1.00 82.51  ? 466 SER B CA    1 
ATOM   8438  C  C     . SER B 1 466 ? 42.917  58.032  84.883  1.00 75.75  ? 466 SER B C     1 
ATOM   8439  O  O     . SER B 1 466 ? 41.733  57.759  84.695  1.00 77.26  ? 466 SER B O     1 
ATOM   8440  C  CB    . SER B 1 466 ? 42.952  60.185  86.197  1.00 83.97  ? 466 SER B CB    1 
ATOM   8441  O  OG    . SER B 1 466 ? 41.555  60.083  86.398  1.00 87.18  ? 466 SER B OG    1 
ATOM   8442  N  N     . GLY B 1 467 ? 43.854  57.106  85.041  1.00 83.73  ? 467 GLY B N     1 
ATOM   8443  C  CA    . GLY B 1 467 ? 43.513  55.699  85.080  1.00 82.03  ? 467 GLY B CA    1 
ATOM   8444  C  C     . GLY B 1 467 ? 44.484  54.821  84.321  1.00 79.94  ? 467 GLY B C     1 
ATOM   8445  O  O     . GLY B 1 467 ? 45.416  55.304  83.674  1.00 80.56  ? 467 GLY B O     1 
ATOM   8446  N  N     . ALA B 1 468 ? 44.259  53.515  84.410  1.00 79.98  ? 468 ALA B N     1 
ATOM   8447  C  CA    . ALA B 1 468 ? 45.135  52.530  83.790  1.00 80.27  ? 468 ALA B CA    1 
ATOM   8448  C  C     . ALA B 1 468 ? 44.560  52.047  82.462  1.00 79.96  ? 468 ALA B C     1 
ATOM   8449  O  O     . ALA B 1 468 ? 43.388  51.665  82.377  1.00 77.62  ? 468 ALA B O     1 
ATOM   8450  C  CB    . ALA B 1 468 ? 45.362  51.356  84.725  1.00 80.19  ? 468 ALA B CB    1 
ATOM   8451  N  N     . TYR B 1 469 ? 45.384  52.085  81.424  1.00 79.17  ? 469 TYR B N     1 
ATOM   8452  C  CA    . TYR B 1 469 ? 44.996  51.569  80.120  1.00 78.32  ? 469 TYR B CA    1 
ATOM   8453  C  C     . TYR B 1 469 ? 46.059  50.595  79.639  1.00 79.74  ? 469 TYR B C     1 
ATOM   8454  O  O     . TYR B 1 469 ? 47.246  50.804  79.892  1.00 78.92  ? 469 TYR B O     1 
ATOM   8455  C  CB    . TYR B 1 469 ? 44.790  52.710  79.123  1.00 74.79  ? 469 TYR B CB    1 
ATOM   8456  C  CG    . TYR B 1 469 ? 43.689  53.662  79.536  1.00 73.54  ? 469 TYR B CG    1 
ATOM   8457  C  CD1   . TYR B 1 469 ? 42.353  53.349  79.311  1.00 71.88  ? 469 TYR B CD1   1 
ATOM   8458  C  CD2   . TYR B 1 469 ? 43.984  54.866  80.164  1.00 75.13  ? 469 TYR B CD2   1 
ATOM   8459  C  CE1   . TYR B 1 469 ? 41.341  54.214  79.693  1.00 69.54  ? 469 TYR B CE1   1 
ATOM   8460  C  CE2   . TYR B 1 469 ? 42.980  55.738  80.551  1.00 74.72  ? 469 TYR B CE2   1 
ATOM   8461  C  CZ    . TYR B 1 469 ? 41.662  55.406  80.312  1.00 75.01  ? 469 TYR B CZ    1 
ATOM   8462  O  OH    . TYR B 1 469 ? 40.664  56.268  80.695  1.00 74.19  ? 469 TYR B OH    1 
ATOM   8463  N  N     . PRO B 1 470 ? 45.630  49.512  78.970  1.00 81.44  ? 470 PRO B N     1 
ATOM   8464  C  CA    . PRO B 1 470 ? 46.546  48.487  78.458  1.00 77.88  ? 470 PRO B CA    1 
ATOM   8465  C  C     . PRO B 1 470 ? 47.710  49.082  77.662  1.00 81.63  ? 470 PRO B C     1 
ATOM   8466  O  O     . PRO B 1 470 ? 48.869  48.807  77.981  1.00 82.82  ? 470 PRO B O     1 
ATOM   8467  C  CB    . PRO B 1 470 ? 45.646  47.635  77.555  1.00 80.23  ? 470 PRO B CB    1 
ATOM   8468  C  CG    . PRO B 1 470 ? 44.277  47.795  78.131  1.00 78.92  ? 470 PRO B CG    1 
ATOM   8469  C  CD    . PRO B 1 470 ? 44.221  49.206  78.659  1.00 77.43  ? 470 PRO B CD    1 
ATOM   8470  N  N     . ALA B 1 471 ? 47.405  49.898  76.657  1.00 82.12  ? 471 ALA B N     1 
ATOM   8471  C  CA    . ALA B 1 471 ? 48.440  50.524  75.836  1.00 78.36  ? 471 ALA B CA    1 
ATOM   8472  C  C     . ALA B 1 471 ? 48.765  51.930  76.334  1.00 75.22  ? 471 ALA B C     1 
ATOM   8473  O  O     . ALA B 1 471 ? 47.861  52.748  76.524  1.00 74.07  ? 471 ALA B O     1 
ATOM   8474  C  CB    . ALA B 1 471 ? 48.013  50.560  74.369  1.00 74.30  ? 471 ALA B CB    1 
ATOM   8475  N  N     . GLU B 1 472 ? 50.051  52.201  76.557  1.00 70.63  ? 472 GLU B N     1 
ATOM   8476  C  CA    . GLU B 1 472 ? 50.492  53.513  77.032  1.00 76.91  ? 472 GLU B CA    1 
ATOM   8477  C  C     . GLU B 1 472 ? 50.864  54.447  75.884  1.00 73.07  ? 472 GLU B C     1 
ATOM   8478  O  O     . GLU B 1 472 ? 51.190  55.611  76.101  1.00 76.45  ? 472 GLU B O     1 
ATOM   8479  C  CB    . GLU B 1 472 ? 51.683  53.379  77.990  1.00 79.97  ? 472 GLU B CB    1 
ATOM   8480  C  CG    . GLU B 1 472 ? 52.910  52.721  77.372  1.00 83.11  ? 472 GLU B CG    1 
ATOM   8481  C  CD    . GLU B 1 472 ? 54.077  52.613  78.345  1.00 92.01  ? 472 GLU B CD    1 
ATOM   8482  O  OE1   . GLU B 1 472 ? 54.322  53.588  79.091  1.00 90.38  ? 472 GLU B OE1   1 
ATOM   8483  O  OE2   . GLU B 1 472 ? 54.728  51.542  78.380  1.00 88.25  ? 472 GLU B OE2   1 
ATOM   8484  N  N     . LEU B 1 473 ? 50.822  53.934  74.663  1.00 72.04  ? 473 LEU B N     1 
ATOM   8485  C  CA    . LEU B 1 473 ? 50.995  54.783  73.490  1.00 73.51  ? 473 LEU B CA    1 
ATOM   8486  C  C     . LEU B 1 473 ? 49.921  54.451  72.463  1.00 66.83  ? 473 LEU B C     1 
ATOM   8487  O  O     . LEU B 1 473 ? 49.776  53.306  72.054  1.00 66.71  ? 473 LEU B O     1 
ATOM   8488  C  CB    . LEU B 1 473 ? 52.384  54.606  72.875  1.00 68.74  ? 473 LEU B CB    1 
ATOM   8489  C  CG    . LEU B 1 473 ? 52.646  55.544  71.694  1.00 64.94  ? 473 LEU B CG    1 
ATOM   8490  C  CD1   . LEU B 1 473 ? 52.700  56.989  72.158  1.00 68.40  ? 473 LEU B CD1   1 
ATOM   8491  C  CD2   . LEU B 1 473 ? 53.907  55.172  70.934  1.00 72.40  ? 473 LEU B CD2   1 
ATOM   8492  N  N     . ALA B 1 474 ? 49.164  55.458  72.052  1.00 64.89  ? 474 ALA B N     1 
ATOM   8493  C  CA    . ALA B 1 474 ? 48.115  55.250  71.061  1.00 64.18  ? 474 ALA B CA    1 
ATOM   8494  C  C     . ALA B 1 474 ? 48.381  56.118  69.856  1.00 56.95  ? 474 ALA B C     1 
ATOM   8495  O  O     . ALA B 1 474 ? 48.429  57.342  69.961  1.00 56.25  ? 474 ALA B O     1 
ATOM   8496  C  CB    . ALA B 1 474 ? 46.744  55.555  71.649  1.00 53.99  ? 474 ALA B CB    1 
ATOM   8497  N  N     . VAL B 1 475 ? 48.521  55.489  68.700  1.00 58.47  ? 475 VAL B N     1 
ATOM   8498  C  CA    . VAL B 1 475 ? 48.858  56.251  67.508  1.00 60.78  ? 475 VAL B CA    1 
ATOM   8499  C  C     . VAL B 1 475 ? 47.815  56.026  66.422  1.00 55.56  ? 475 VAL B C     1 
ATOM   8500  O  O     . VAL B 1 475 ? 47.371  54.908  66.186  1.00 53.98  ? 475 VAL B O     1 
ATOM   8501  C  CB    . VAL B 1 475 ? 50.264  55.873  66.988  1.00 56.69  ? 475 VAL B CB    1 
ATOM   8502  C  CG1   . VAL B 1 475 ? 50.398  54.389  66.931  1.00 57.16  ? 475 VAL B CG1   1 
ATOM   8503  C  CG2   . VAL B 1 475 ? 50.542  56.498  65.621  1.00 55.67  ? 475 VAL B CG2   1 
ATOM   8504  N  N     . GLY B 1 476 ? 47.380  57.122  65.820  1.00 55.07  ? 476 GLY B N     1 
ATOM   8505  C  CA    . GLY B 1 476 ? 46.423  57.075  64.740  1.00 59.90  ? 476 GLY B CA    1 
ATOM   8506  C  C     . GLY B 1 476 ? 47.096  57.493  63.455  1.00 60.64  ? 476 GLY B C     1 
ATOM   8507  O  O     . GLY B 1 476 ? 47.775  58.535  63.413  1.00 57.53  ? 476 GLY B O     1 
ATOM   8508  N  N     . PHE B 1 477 ? 46.861  56.704  62.407  1.00 59.87  ? 477 PHE B N     1 
ATOM   8509  C  CA    . PHE B 1 477 ? 47.459  56.926  61.096  1.00 58.54  ? 477 PHE B CA    1 
ATOM   8510  C  C     . PHE B 1 477 ? 46.385  57.402  60.147  1.00 59.10  ? 477 PHE B C     1 
ATOM   8511  O  O     . PHE B 1 477 ? 45.298  56.829  60.104  1.00 60.48  ? 477 PHE B O     1 
ATOM   8512  C  CB    . PHE B 1 477 ? 48.075  55.642  60.537  1.00 57.96  ? 477 PHE B CB    1 
ATOM   8513  C  CG    . PHE B 1 477 ? 49.047  54.980  61.456  1.00 61.66  ? 477 PHE B CG    1 
ATOM   8514  C  CD1   . PHE B 1 477 ? 48.603  54.209  62.518  1.00 57.26  ? 477 PHE B CD1   1 
ATOM   8515  C  CD2   . PHE B 1 477 ? 50.411  55.110  61.246  1.00 61.92  ? 477 PHE B CD2   1 
ATOM   8516  C  CE1   . PHE B 1 477 ? 49.501  53.596  63.370  1.00 61.75  ? 477 PHE B CE1   1 
ATOM   8517  C  CE2   . PHE B 1 477 ? 51.315  54.495  62.086  1.00 62.41  ? 477 PHE B CE2   1 
ATOM   8518  C  CZ    . PHE B 1 477 ? 50.862  53.736  63.150  1.00 65.45  ? 477 PHE B CZ    1 
ATOM   8519  N  N     . ASP B 1 478 ? 46.700  58.421  59.360  1.00 60.08  ? 478 ASP B N     1 
ATOM   8520  C  CA    . ASP B 1 478 ? 45.745  58.944  58.409  1.00 64.69  ? 478 ASP B CA    1 
ATOM   8521  C  C     . ASP B 1 478 ? 46.400  59.099  57.047  1.00 71.33  ? 478 ASP B C     1 
ATOM   8522  O  O     . ASP B 1 478 ? 47.391  59.819  56.889  1.00 66.04  ? 478 ASP B O     1 
ATOM   8523  C  CB    . ASP B 1 478 ? 45.187  60.294  58.884  1.00 67.94  ? 478 ASP B CB    1 
ATOM   8524  C  CG    . ASP B 1 478 ? 43.924  60.720  58.130  1.00 65.36  ? 478 ASP B CG    1 
ATOM   8525  O  OD1   . ASP B 1 478 ? 42.816  60.323  58.538  1.00 72.86  ? 478 ASP B OD1   1 
ATOM   8526  O  OD2   . ASP B 1 478 ? 44.015  61.463  57.140  1.00 60.33  ? 478 ASP B OD2   1 
ATOM   8527  N  N     . ALA B 1 479 ? 45.818  58.427  56.062  1.00 71.37  ? 479 ALA B N     1 
ATOM   8528  C  CA    . ALA B 1 479 ? 46.187  58.641  54.681  1.00 68.99  ? 479 ALA B CA    1 
ATOM   8529  C  C     . ALA B 1 479 ? 45.098  59.589  54.220  1.00 72.40  ? 479 ALA B C     1 
ATOM   8530  O  O     . ALA B 1 479 ? 44.146  59.812  54.966  1.00 78.34  ? 479 ALA B O     1 
ATOM   8531  C  CB    . ALA B 1 479 ? 46.209  57.353  53.893  1.00 68.74  ? 479 ALA B CB    1 
ATOM   8532  N  N     . GLY B 1 480 ? 45.208  60.159  53.027  1.00 69.73  ? 480 GLY B N     1 
ATOM   8533  C  CA    . GLY B 1 480 ? 44.252  61.168  52.595  1.00 78.75  ? 480 GLY B CA    1 
ATOM   8534  C  C     . GLY B 1 480 ? 42.818  60.687  52.464  1.00 72.97  ? 480 GLY B C     1 
ATOM   8535  O  O     . GLY B 1 480 ? 42.039  61.271  51.720  1.00 79.46  ? 480 GLY B O     1 
ATOM   8536  N  N     . GLY B 1 481 ? 42.472  59.627  53.193  1.00 72.61  ? 481 GLY B N     1 
ATOM   8537  C  CA    . GLY B 1 481 ? 41.227  58.914  52.990  1.00 76.70  ? 481 GLY B CA    1 
ATOM   8538  C  C     . GLY B 1 481 ? 41.481  57.979  51.818  1.00 82.17  ? 481 GLY B C     1 
ATOM   8539  O  O     . GLY B 1 481 ? 40.618  57.175  51.436  1.00 79.80  ? 481 GLY B O     1 
ATOM   8540  N  N     . ARG B 1 482 ? 42.701  58.072  51.280  1.00 79.77  ? 482 ARG B N     1 
ATOM   8541  C  CA    . ARG B 1 482 ? 43.120  57.373  50.071  1.00 71.54  ? 482 ARG B CA    1 
ATOM   8542  C  C     . ARG B 1 482 ? 43.163  55.868  50.270  1.00 73.74  ? 482 ARG B C     1 
ATOM   8543  O  O     . ARG B 1 482 ? 43.144  55.373  51.400  1.00 73.63  ? 482 ARG B O     1 
ATOM   8544  C  CB    . ARG B 1 482 ? 44.498  57.869  49.628  1.00 78.84  ? 482 ARG B CB    1 
ATOM   8545  C  CG    . ARG B 1 482 ? 44.502  59.249  49.006  1.00 80.64  ? 482 ARG B CG    1 
ATOM   8546  C  CD    . ARG B 1 482 ? 45.920  59.717  48.683  1.00 81.67  ? 482 ARG B CD    1 
ATOM   8547  N  NE    . ARG B 1 482 ? 46.527  60.510  49.758  1.00 91.93  ? 482 ARG B NE    1 
ATOM   8548  C  CZ    . ARG B 1 482 ? 47.497  60.089  50.571  1.00 88.22  ? 482 ARG B CZ    1 
ATOM   8549  N  NH1   . ARG B 1 482 ? 48.017  58.871  50.439  1.00 84.52  ? 482 ARG B NH1   1 
ATOM   8550  N  NH2   . ARG B 1 482 ? 47.967  60.902  51.510  1.00 82.12  ? 482 ARG B NH2   1 
ATOM   8551  N  N     . GLU B 1 483 ? 43.265  55.148  49.160  1.00 74.63  ? 483 GLU B N     1 
ATOM   8552  C  CA    . GLU B 1 483 ? 43.184  53.696  49.170  1.00 77.55  ? 483 GLU B CA    1 
ATOM   8553  C  C     . GLU B 1 483 ? 44.473  53.066  49.674  1.00 75.94  ? 483 GLU B C     1 
ATOM   8554  O  O     . GLU B 1 483 ? 44.523  51.863  49.942  1.00 73.86  ? 483 GLU B O     1 
ATOM   8555  C  CB    . GLU B 1 483 ? 42.857  53.181  47.764  1.00 84.62  ? 483 GLU B CB    1 
ATOM   8556  C  CG    . GLU B 1 483 ? 43.899  53.529  46.693  1.00 85.84  ? 483 GLU B CG    1 
ATOM   8557  C  CD    . GLU B 1 483 ? 43.793  54.965  46.181  1.00 84.02  ? 483 GLU B CD    1 
ATOM   8558  O  OE1   . GLU B 1 483 ? 44.477  55.297  45.189  1.00 81.47  ? 483 GLU B OE1   1 
ATOM   8559  O  OE2   . GLU B 1 483 ? 43.033  55.763  46.768  1.00 81.54  ? 483 GLU B OE2   1 
ATOM   8560  N  N     . SER B 1 484 ? 45.511  53.886  49.806  1.00 76.04  ? 484 SER B N     1 
ATOM   8561  C  CA    . SER B 1 484 ? 46.810  53.406  50.262  1.00 73.75  ? 484 SER B CA    1 
ATOM   8562  C  C     . SER B 1 484 ? 47.657  54.544  50.827  1.00 70.63  ? 484 SER B C     1 
ATOM   8563  O  O     . SER B 1 484 ? 47.394  55.718  50.563  1.00 74.87  ? 484 SER B O     1 
ATOM   8564  C  CB    . SER B 1 484 ? 47.550  52.713  49.119  1.00 72.99  ? 484 SER B CB    1 
ATOM   8565  O  OG    . SER B 1 484 ? 48.744  52.112  49.583  1.00 72.74  ? 484 SER B OG    1 
ATOM   8566  N  N     . PHE B 1 485 ? 48.686  54.181  51.583  1.00 68.74  ? 485 PHE B N     1 
ATOM   8567  C  CA    . PHE B 1 485 ? 49.654  55.140  52.114  1.00 76.10  ? 485 PHE B CA    1 
ATOM   8568  C  C     . PHE B 1 485 ? 50.758  55.462  51.099  1.00 77.80  ? 485 PHE B C     1 
ATOM   8569  O  O     . PHE B 1 485 ? 51.735  56.148  51.423  1.00 76.81  ? 485 PHE B O     1 
ATOM   8570  C  CB    . PHE B 1 485 ? 50.277  54.595  53.406  1.00 70.30  ? 485 PHE B CB    1 
ATOM   8571  C  CG    . PHE B 1 485 ? 49.405  54.766  54.610  1.00 69.35  ? 485 PHE B CG    1 
ATOM   8572  C  CD1   . PHE B 1 485 ? 48.543  53.750  55.008  1.00 69.38  ? 485 PHE B CD1   1 
ATOM   8573  C  CD2   . PHE B 1 485 ? 49.429  55.944  55.336  1.00 66.53  ? 485 PHE B CD2   1 
ATOM   8574  C  CE1   . PHE B 1 485 ? 47.727  53.907  56.116  1.00 65.62  ? 485 PHE B CE1   1 
ATOM   8575  C  CE2   . PHE B 1 485 ? 48.613  56.109  56.446  1.00 68.05  ? 485 PHE B CE2   1 
ATOM   8576  C  CZ    . PHE B 1 485 ? 47.762  55.089  56.837  1.00 67.83  ? 485 PHE B CZ    1 
ATOM   8577  N  N     . ARG B 1 486 ? 50.598  54.961  49.876  1.00 73.95  ? 486 ARG B N     1 
ATOM   8578  C  CA    . ARG B 1 486 ? 51.608  55.122  48.832  1.00 79.77  ? 486 ARG B CA    1 
ATOM   8579  C  C     . ARG B 1 486 ? 51.915  56.576  48.513  1.00 81.77  ? 486 ARG B C     1 
ATOM   8580  O  O     . ARG B 1 486 ? 53.002  56.896  48.041  1.00 84.14  ? 486 ARG B O     1 
ATOM   8581  C  CB    . ARG B 1 486 ? 51.160  54.427  47.545  1.00 80.05  ? 486 ARG B CB    1 
ATOM   8582  C  CG    . ARG B 1 486 ? 51.394  52.944  47.529  1.00 80.31  ? 486 ARG B CG    1 
ATOM   8583  C  CD    . ARG B 1 486 ? 51.177  52.378  46.141  1.00 84.35  ? 486 ARG B CD    1 
ATOM   8584  N  NE    . ARG B 1 486 ? 51.218  50.921  46.157  1.00 86.17  ? 486 ARG B NE    1 
ATOM   8585  C  CZ    . ARG B 1 486 ? 50.146  50.152  46.311  1.00 89.80  ? 486 ARG B CZ    1 
ATOM   8586  N  NH1   . ARG B 1 486 ? 48.948  50.708  46.455  1.00 81.79  ? 486 ARG B NH1   1 
ATOM   8587  N  NH2   . ARG B 1 486 ? 50.272  48.830  46.318  1.00 92.64  ? 486 ARG B NH2   1 
ATOM   8588  N  N     . PHE B 1 487 ? 50.957  57.456  48.760  1.00 76.05  ? 487 PHE B N     1 
ATOM   8589  C  CA    . PHE B 1 487 ? 51.173  58.866  48.505  1.00 80.82  ? 487 PHE B CA    1 
ATOM   8590  C  C     . PHE B 1 487 ? 51.496  59.590  49.800  1.00 81.27  ? 487 PHE B C     1 
ATOM   8591  O  O     . PHE B 1 487 ? 51.366  60.812  49.891  1.00 78.54  ? 487 PHE B O     1 
ATOM   8592  C  CB    . PHE B 1 487 ? 49.946  59.484  47.836  1.00 89.47  ? 487 PHE B CB    1 
ATOM   8593  C  CG    . PHE B 1 487 ? 49.478  58.735  46.621  1.00 91.42  ? 487 PHE B CG    1 
ATOM   8594  C  CD1   . PHE B 1 487 ? 50.191  58.803  45.434  1.00 89.73  ? 487 PHE B CD1   1 
ATOM   8595  C  CD2   . PHE B 1 487 ? 48.323  57.965  46.664  1.00 90.47  ? 487 PHE B CD2   1 
ATOM   8596  C  CE1   . PHE B 1 487 ? 49.763  58.115  44.312  1.00 98.56  ? 487 PHE B CE1   1 
ATOM   8597  C  CE2   . PHE B 1 487 ? 47.889  57.274  45.548  1.00 92.70  ? 487 PHE B CE2   1 
ATOM   8598  C  CZ    . PHE B 1 487 ? 48.610  57.349  44.371  1.00 95.74  ? 487 PHE B CZ    1 
ATOM   8599  N  N     . GLY B 1 488 ? 51.932  58.834  50.802  1.00 73.50  ? 488 GLY B N     1 
ATOM   8600  C  CA    . GLY B 1 488 ? 52.262  59.438  52.075  1.00 78.27  ? 488 GLY B CA    1 
ATOM   8601  C  C     . GLY B 1 488 ? 51.072  59.411  53.013  1.00 81.94  ? 488 GLY B C     1 
ATOM   8602  O  O     . GLY B 1 488 ? 50.032  58.811  52.711  1.00 74.46  ? 488 GLY B O     1 
ATOM   8603  N  N     . GLY B 1 489 ? 51.226  60.080  54.151  1.00 79.16  ? 489 GLY B N     1 
ATOM   8604  C  CA    . GLY B 1 489 ? 50.212  60.092  55.187  1.00 74.14  ? 489 GLY B CA    1 
ATOM   8605  C  C     . GLY B 1 489 ? 50.772  60.798  56.402  1.00 75.15  ? 489 GLY B C     1 
ATOM   8606  O  O     . GLY B 1 489 ? 51.780  61.491  56.299  1.00 77.10  ? 489 GLY B O     1 
ATOM   8607  N  N     . ALA B 1 490 ? 50.125  60.638  57.549  1.00 65.75  ? 490 ALA B N     1 
ATOM   8608  C  CA    . ALA B 1 490 ? 50.560  61.332  58.751  1.00 67.89  ? 490 ALA B CA    1 
ATOM   8609  C  C     . ALA B 1 490 ? 50.149  60.546  59.973  1.00 66.43  ? 490 ALA B C     1 
ATOM   8610  O  O     . ALA B 1 490 ? 49.371  59.599  59.865  1.00 65.29  ? 490 ALA B O     1 
ATOM   8611  C  CB    . ALA B 1 490 ? 49.980  62.735  58.796  1.00 67.11  ? 490 ALA B CB    1 
ATOM   8612  N  N     . ALA B 1 491 ? 50.687  60.907  61.133  1.00 64.22  ? 491 ALA B N     1 
ATOM   8613  C  CA    . ALA B 1 491 ? 50.261  60.229  62.353  1.00 66.01  ? 491 ALA B CA    1 
ATOM   8614  C  C     . ALA B 1 491 ? 50.171  61.180  63.537  1.00 70.61  ? 491 ALA B C     1 
ATOM   8615  O  O     . ALA B 1 491 ? 50.771  62.258  63.529  1.00 65.62  ? 491 ALA B O     1 
ATOM   8616  C  CB    . ALA B 1 491 ? 51.186  59.077  62.677  1.00 65.85  ? 491 ALA B CB    1 
ATOM   8617  N  N     . CYS B 1 492 ? 49.374  60.796  64.530  1.00 62.82  ? 492 CYS B N     1 
ATOM   8618  C  CA    . CYS B 1 492 ? 49.336  61.529  65.789  1.00 57.49  ? 492 CYS B CA    1 
ATOM   8619  C  C     . CYS B 1 492 ? 49.251  60.537  66.932  1.00 55.38  ? 492 CYS B C     1 
ATOM   8620  O  O     . CYS B 1 492 ? 48.805  59.414  66.737  1.00 59.49  ? 492 CYS B O     1 
ATOM   8621  C  CB    . CYS B 1 492 ? 48.159  62.502  65.828  1.00 62.27  ? 492 CYS B CB    1 
ATOM   8622  S  SG    . CYS B 1 492 ? 48.288  63.893  64.691  1.00 64.89  ? 492 CYS B SG    1 
ATOM   8623  N  N     . ALA B 1 493 ? 49.673  60.933  68.127  1.00 62.51  ? 493 ALA B N     1 
ATOM   8624  C  CA    . ALA B 1 493 ? 49.739  59.973  69.221  1.00 63.60  ? 493 ALA B CA    1 
ATOM   8625  C  C     . ALA B 1 493 ? 49.523  60.576  70.609  1.00 64.29  ? 493 ALA B C     1 
ATOM   8626  O  O     . ALA B 1 493 ? 49.788  61.765  70.849  1.00 62.58  ? 493 ALA B O     1 
ATOM   8627  C  CB    . ALA B 1 493 ? 51.076  59.237  69.178  1.00 64.42  ? 493 ALA B CB    1 
ATOM   8628  N  N     . VAL B 1 494 ? 49.024  59.724  71.504  1.00 61.99  ? 494 VAL B N     1 
ATOM   8629  C  CA    . VAL B 1 494 ? 48.831  60.049  72.913  1.00 68.82  ? 494 VAL B CA    1 
ATOM   8630  C  C     . VAL B 1 494 ? 49.559  59.059  73.819  1.00 70.86  ? 494 VAL B C     1 
ATOM   8631  O  O     . VAL B 1 494 ? 49.390  57.848  73.665  1.00 66.78  ? 494 VAL B O     1 
ATOM   8632  C  CB    . VAL B 1 494 ? 47.337  60.017  73.293  1.00 72.32  ? 494 VAL B CB    1 
ATOM   8633  C  CG1   . VAL B 1 494 ? 47.141  60.522  74.709  1.00 72.38  ? 494 VAL B CG1   1 
ATOM   8634  C  CG2   . VAL B 1 494 ? 46.506  60.814  72.296  1.00 68.85  ? 494 VAL B CG2   1 
ATOM   8635  N  N     . HIS B 1 500 ? 51.405  63.219  77.044  1.00 93.61  ? 500 HIS B N     1 
ATOM   8636  C  CA    . HIS B 1 500 ? 51.944  63.916  75.875  1.00 91.31  ? 500 HIS B CA    1 
ATOM   8637  C  C     . HIS B 1 500 ? 51.093  63.688  74.618  1.00 85.72  ? 500 HIS B C     1 
ATOM   8638  O  O     . HIS B 1 500 ? 50.626  62.574  74.362  1.00 75.62  ? 500 HIS B O     1 
ATOM   8639  C  CB    . HIS B 1 500 ? 53.393  63.480  75.618  1.00 87.99  ? 500 HIS B CB    1 
ATOM   8640  N  N     . LEU B 1 501 ? 50.893  64.754  73.844  1.00 82.05  ? 501 LEU B N     1 
ATOM   8641  C  CA    . LEU B 1 501 ? 50.274  64.647  72.525  1.00 78.93  ? 501 LEU B CA    1 
ATOM   8642  C  C     . LEU B 1 501 ? 51.316  64.999  71.478  1.00 80.16  ? 501 LEU B C     1 
ATOM   8643  O  O     . LEU B 1 501 ? 51.994  66.020  71.609  1.00 78.32  ? 501 LEU B O     1 
ATOM   8644  C  CB    . LEU B 1 501 ? 49.073  65.586  72.382  1.00 75.57  ? 501 LEU B CB    1 
ATOM   8645  C  CG    . LEU B 1 501 ? 47.864  65.395  73.294  1.00 78.76  ? 501 LEU B CG    1 
ATOM   8646  C  CD1   . LEU B 1 501 ? 46.711  66.281  72.845  1.00 75.39  ? 501 LEU B CD1   1 
ATOM   8647  C  CD2   . LEU B 1 501 ? 47.447  63.952  73.345  1.00 74.22  ? 501 LEU B CD2   1 
ATOM   8648  N  N     . LEU B 1 502 ? 51.434  64.194  70.424  1.00 76.70  ? 502 LEU B N     1 
ATOM   8649  C  CA    . LEU B 1 502 ? 52.429  64.520  69.401  1.00 78.10  ? 502 LEU B CA    1 
ATOM   8650  C  C     . LEU B 1 502 ? 51.988  64.217  67.977  1.00 74.89  ? 502 LEU B C     1 
ATOM   8651  O  O     . LEU B 1 502 ? 51.199  63.318  67.732  1.00 73.33  ? 502 LEU B O     1 
ATOM   8652  C  CB    . LEU B 1 502 ? 53.741  63.774  69.684  1.00 80.06  ? 502 LEU B CB    1 
ATOM   8653  C  CG    . LEU B 1 502 ? 53.690  62.553  70.607  1.00 81.21  ? 502 LEU B CG    1 
ATOM   8654  C  CD1   . LEU B 1 502 ? 54.612  61.445  70.109  1.00 84.14  ? 502 LEU B CD1   1 
ATOM   8655  C  CD2   . LEU B 1 502 ? 54.071  62.949  72.027  1.00 81.40  ? 502 LEU B CD2   1 
ATOM   8656  N  N     . TRP B 1 503 ? 52.535  64.975  67.037  1.00 78.83  ? 503 TRP B N     1 
ATOM   8657  C  CA    . TRP B 1 503 ? 52.246  64.788  65.626  1.00 75.20  ? 503 TRP B CA    1 
ATOM   8658  C  C     . TRP B 1 503 ? 53.515  64.348  64.916  1.00 83.03  ? 503 TRP B C     1 
ATOM   8659  O  O     . TRP B 1 503 ? 54.616  64.748  65.301  1.00 79.99  ? 503 TRP B O     1 
ATOM   8660  C  CB    . TRP B 1 503 ? 51.728  66.085  65.009  1.00 79.38  ? 503 TRP B CB    1 
ATOM   8661  C  CG    . TRP B 1 503 ? 52.689  67.224  65.206  1.00 86.39  ? 503 TRP B CG    1 
ATOM   8662  C  CD1   . TRP B 1 503 ? 52.691  68.127  66.233  1.00 87.41  ? 503 TRP B CD1   1 
ATOM   8663  C  CD2   . TRP B 1 503 ? 53.816  67.556  64.382  1.00 87.11  ? 503 TRP B CD2   1 
ATOM   8664  N  NE1   . TRP B 1 503 ? 53.733  69.011  66.086  1.00 83.93  ? 503 TRP B NE1   1 
ATOM   8665  C  CE2   . TRP B 1 503 ? 54.441  68.680  64.958  1.00 87.64  ? 503 TRP B CE2   1 
ATOM   8666  C  CE3   . TRP B 1 503 ? 54.353  67.017  63.207  1.00 84.79  ? 503 TRP B CE3   1 
ATOM   8667  C  CZ2   . TRP B 1 503 ? 55.573  69.273  64.402  1.00 89.48  ? 503 TRP B CZ2   1 
ATOM   8668  C  CZ3   . TRP B 1 503 ? 55.472  67.606  62.657  1.00 85.74  ? 503 TRP B CZ3   1 
ATOM   8669  C  CH2   . TRP B 1 503 ? 56.070  68.723  63.252  1.00 89.52  ? 503 TRP B CH2   1 
ATOM   8670  N  N     . THR B 1 504 ? 53.370  63.539  63.871  1.00 79.93  ? 504 THR B N     1 
ATOM   8671  C  CA    . THR B 1 504 ? 54.526  63.117  63.088  1.00 77.19  ? 504 THR B CA    1 
ATOM   8672  C  C     . THR B 1 504 ? 54.182  63.196  61.610  1.00 82.67  ? 504 THR B C     1 
ATOM   8673  O  O     . THR B 1 504 ? 53.165  62.635  61.143  1.00 80.59  ? 504 THR B O     1 
ATOM   8674  C  CB    . THR B 1 504 ? 55.003  61.688  63.435  1.00 75.71  ? 504 THR B CB    1 
ATOM   8675  O  OG1   . THR B 1 504 ? 54.330  60.736  62.607  1.00 85.61  ? 504 THR B OG1   1 
ATOM   8676  C  CG2   . THR B 1 504 ? 54.754  61.365  64.897  1.00 73.14  ? 504 THR B CG2   1 
ATOM   8677  N  N     . LEU B 1 505 ? 55.026  63.937  60.897  1.00 82.96  ? 505 LEU B N     1 
ATOM   8678  C  CA    . LEU B 1 505 ? 54.959  64.057  59.451  1.00 88.14  ? 505 LEU B CA    1 
ATOM   8679  C  C     . LEU B 1 505 ? 56.097  63.325  58.762  1.00 95.17  ? 505 LEU B C     1 
ATOM   8680  O  O     . LEU B 1 505 ? 57.154  63.101  59.356  1.00 97.21  ? 505 LEU B O     1 
ATOM   8681  C  CB    . LEU B 1 505 ? 55.007  65.529  59.038  1.00 85.23  ? 505 LEU B CB    1 
ATOM   8682  C  CG    . LEU B 1 505 ? 53.740  66.371  59.151  1.00 87.93  ? 505 LEU B CG    1 
ATOM   8683  C  CD1   . LEU B 1 505 ? 54.015  67.800  58.710  1.00 84.54  ? 505 LEU B CD1   1 
ATOM   8684  C  CD2   . LEU B 1 505 ? 52.633  65.750  58.315  1.00 84.88  ? 505 LEU B CD2   1 
ATOM   8685  N  N     . PRO B 1 506 ? 55.876  62.924  57.505  1.00 95.01  ? 506 PRO B N     1 
ATOM   8686  C  CA    . PRO B 1 506 ? 57.038  62.567  56.698  1.00 100.33 ? 506 PRO B CA    1 
ATOM   8687  C  C     . PRO B 1 506 ? 57.217  63.610  55.594  1.00 101.86 ? 506 PRO B C     1 
ATOM   8688  O  O     . PRO B 1 506 ? 56.252  63.963  54.916  1.00 102.91 ? 506 PRO B O     1 
ATOM   8689  C  CB    . PRO B 1 506 ? 56.657  61.201  56.129  1.00 95.60  ? 506 PRO B CB    1 
ATOM   8690  C  CG    . PRO B 1 506 ? 55.148  61.285  55.977  1.00 92.38  ? 506 PRO B CG    1 
ATOM   8691  C  CD    . PRO B 1 506 ? 54.641  62.310  56.989  1.00 89.01  ? 506 PRO B CD    1 
ATOM   8692  N  N     . GLU B 1 507 ? 58.441  64.083  55.409  1.00 100.58 ? 507 GLU B N     1 
ATOM   8693  C  CA    . GLU B 1 507 ? 58.766  64.954  54.291  1.00 98.99  ? 507 GLU B CA    1 
ATOM   8694  C  C     . GLU B 1 507 ? 59.928  64.289  53.583  1.00 109.09 ? 507 GLU B C     1 
ATOM   8695  O  O     . GLU B 1 507 ? 60.699  64.923  52.861  1.00 108.88 ? 507 GLU B O     1 
ATOM   8696  C  CB    . GLU B 1 507 ? 59.119  66.357  54.757  1.00 100.59 ? 507 GLU B CB    1 
ATOM   8697  N  N     . ALA B 1 508 ? 60.036  62.986  53.829  1.00 106.66 ? 508 ALA B N     1 
ATOM   8698  C  CA    . ALA B 1 508 ? 61.140  62.166  53.356  1.00 102.45 ? 508 ALA B CA    1 
ATOM   8699  C  C     . ALA B 1 508 ? 61.158  62.050  51.832  1.00 103.94 ? 508 ALA B C     1 
ATOM   8700  O  O     . ALA B 1 508 ? 62.206  62.186  51.198  1.00 98.85  ? 508 ALA B O     1 
ATOM   8701  C  CB    . ALA B 1 508 ? 61.059  60.783  53.992  1.00 100.01 ? 508 ALA B CB    1 
ATOM   8702  N  N     . GLN B 1 509 ? 59.986  61.808  51.255  1.00 103.64 ? 509 GLN B N     1 
ATOM   8703  C  CA    . GLN B 1 509 ? 59.860  61.517  49.831  1.00 102.57 ? 509 GLN B CA    1 
ATOM   8704  C  C     . GLN B 1 509 ? 58.904  62.474  49.121  1.00 103.74 ? 509 GLN B C     1 
ATOM   8705  O  O     . GLN B 1 509 ? 58.038  63.090  49.747  1.00 102.57 ? 509 GLN B O     1 
ATOM   8706  C  CB    . GLN B 1 509 ? 59.410  60.081  49.626  1.00 97.60  ? 509 GLN B CB    1 
ATOM   8707  N  N     . ALA B 1 510 ? 59.104  62.627  47.817  1.00 102.69 ? 510 ALA B N     1 
ATOM   8708  C  CA    . ALA B 1 510 ? 58.238  63.468  47.004  1.00 101.65 ? 510 ALA B CA    1 
ATOM   8709  C  C     . ALA B 1 510 ? 57.248  62.608  46.216  1.00 103.64 ? 510 ALA B C     1 
ATOM   8710  O  O     . ALA B 1 510 ? 56.145  63.056  45.889  1.00 103.63 ? 510 ALA B O     1 
ATOM   8711  C  CB    . ALA B 1 510 ? 59.067  64.328  46.058  1.00 102.69 ? 510 ALA B CB    1 
ATOM   8712  N  N     . GLY B 1 511 ? 57.640  61.369  45.926  1.00 101.54 ? 511 GLY B N     1 
ATOM   8713  C  CA    . GLY B 1 511 ? 56.849  60.502  45.069  1.00 99.37  ? 511 GLY B CA    1 
ATOM   8714  C  C     . GLY B 1 511 ? 56.289  59.241  45.705  1.00 100.18 ? 511 GLY B C     1 
ATOM   8715  O  O     . GLY B 1 511 ? 56.204  59.122  46.931  1.00 100.42 ? 511 GLY B O     1 
ATOM   8716  N  N     . GLU B 1 512 ? 55.898  58.296  44.854  1.00 99.70  ? 512 GLU B N     1 
ATOM   8717  C  CA    . GLU B 1 512 ? 55.296  57.045  45.297  1.00 95.39  ? 512 GLU B CA    1 
ATOM   8718  C  C     . GLU B 1 512 ? 56.307  56.168  46.035  1.00 91.98  ? 512 GLU B C     1 
ATOM   8719  O  O     . GLU B 1 512 ? 57.423  55.941  45.562  1.00 93.77  ? 512 GLU B O     1 
ATOM   8720  C  CB    . GLU B 1 512 ? 54.706  56.288  44.102  1.00 93.90  ? 512 GLU B CB    1 
ATOM   8721  C  CG    . GLU B 1 512 ? 55.705  56.017  42.980  1.00 101.77 ? 512 GLU B CG    1 
ATOM   8722  C  CD    . GLU B 1 512 ? 55.056  55.439  41.738  1.00 107.42 ? 512 GLU B CD    1 
ATOM   8723  O  OE1   . GLU B 1 512 ? 55.539  54.398  41.241  1.00 105.94 ? 512 GLU B OE1   1 
ATOM   8724  O  OE2   . GLU B 1 512 ? 54.071  56.036  41.252  1.00 110.66 ? 512 GLU B OE2   1 
ATOM   8725  N  N     . ARG B 1 513 ? 55.908  55.698  47.212  1.00 88.81  ? 513 ARG B N     1 
ATOM   8726  C  CA    . ARG B 1 513 ? 56.734  54.805  48.014  1.00 82.59  ? 513 ARG B CA    1 
ATOM   8727  C  C     . ARG B 1 513 ? 56.038  53.470  48.234  1.00 80.04  ? 513 ARG B C     1 
ATOM   8728  O  O     . ARG B 1 513 ? 54.874  53.288  47.864  1.00 78.73  ? 513 ARG B O     1 
ATOM   8729  C  CB    . ARG B 1 513 ? 57.067  55.443  49.363  1.00 81.23  ? 513 ARG B CB    1 
ATOM   8730  C  CG    . ARG B 1 513 ? 57.979  56.653  49.270  1.00 88.13  ? 513 ARG B CG    1 
ATOM   8731  C  CD    . ARG B 1 513 ? 59.059  56.607  50.329  1.00 83.39  ? 513 ARG B CD    1 
ATOM   8732  N  NE    . ARG B 1 513 ? 58.600  57.116  51.621  1.00 87.00  ? 513 ARG B NE    1 
ATOM   8733  C  CZ    . ARG B 1 513 ? 58.991  56.630  52.795  1.00 83.51  ? 513 ARG B CZ    1 
ATOM   8734  N  NH1   . ARG B 1 513 ? 59.853  55.623  52.842  1.00 80.42  ? 513 ARG B NH1   1 
ATOM   8735  N  NH2   . ARG B 1 513 ? 58.528  57.151  53.923  1.00 81.87  ? 513 ARG B NH2   1 
ATOM   8736  N  N     . ILE B 1 514 ? 56.762  52.539  48.843  1.00 77.24  ? 514 ILE B N     1 
ATOM   8737  C  CA    . ILE B 1 514 ? 56.165  51.307  49.331  1.00 73.04  ? 514 ILE B CA    1 
ATOM   8738  C  C     . ILE B 1 514 ? 55.352  51.651  50.572  1.00 73.46  ? 514 ILE B C     1 
ATOM   8739  O  O     . ILE B 1 514 ? 55.892  52.207  51.527  1.00 69.72  ? 514 ILE B O     1 
ATOM   8740  C  CB    . ILE B 1 514 ? 57.230  50.240  49.658  1.00 74.39  ? 514 ILE B CB    1 
ATOM   8741  C  CG1   . ILE B 1 514 ? 58.088  49.956  48.420  1.00 76.76  ? 514 ILE B CG1   1 
ATOM   8742  C  CG2   . ILE B 1 514 ? 56.575  48.961  50.161  1.00 71.08  ? 514 ILE B CG2   1 
ATOM   8743  C  CD1   . ILE B 1 514 ? 59.276  49.051  48.687  1.00 78.06  ? 514 ILE B CD1   1 
ATOM   8744  N  N     . PRO B 1 515 ? 54.039  51.362  50.538  1.00 72.63  ? 515 PRO B N     1 
ATOM   8745  C  CA    . PRO B 1 515 ? 53.090  51.727  51.600  1.00 70.80  ? 515 PRO B CA    1 
ATOM   8746  C  C     . PRO B 1 515 ? 53.505  51.262  53.000  1.00 68.52  ? 515 PRO B C     1 
ATOM   8747  O  O     . PRO B 1 515 ? 53.449  52.049  53.957  1.00 72.03  ? 515 PRO B O     1 
ATOM   8748  C  CB    . PRO B 1 515 ? 51.791  51.025  51.166  1.00 73.82  ? 515 PRO B CB    1 
ATOM   8749  C  CG    . PRO B 1 515 ? 52.210  49.998  50.143  1.00 75.22  ? 515 PRO B CG    1 
ATOM   8750  C  CD    . PRO B 1 515 ? 53.388  50.602  49.457  1.00 71.54  ? 515 PRO B CD    1 
ATOM   8751  N  N     . GLN B 1 516 ? 53.927  50.005  53.108  1.00 61.13  ? 516 GLN B N     1 
ATOM   8752  C  CA    . GLN B 1 516 ? 54.344  49.431  54.379  1.00 66.33  ? 516 GLN B CA    1 
ATOM   8753  C  C     . GLN B 1 516 ? 55.477  50.257  55.006  1.00 72.32  ? 516 GLN B C     1 
ATOM   8754  O  O     . GLN B 1 516 ? 55.587  50.373  56.240  1.00 67.30  ? 516 GLN B O     1 
ATOM   8755  C  CB    . GLN B 1 516 ? 54.789  47.984  54.175  1.00 68.00  ? 516 GLN B CB    1 
ATOM   8756  C  CG    . GLN B 1 516 ? 53.689  47.062  53.656  1.00 70.74  ? 516 GLN B CG    1 
ATOM   8757  C  CD    . GLN B 1 516 ? 54.059  45.591  53.761  1.00 77.19  ? 516 GLN B CD    1 
ATOM   8758  O  OE1   . GLN B 1 516 ? 55.116  45.240  54.292  1.00 79.94  ? 516 GLN B OE1   1 
ATOM   8759  N  NE2   . GLN B 1 516 ? 53.196  44.722  53.239  1.00 80.96  ? 516 GLN B NE2   1 
ATOM   8760  N  N     . GLU B 1 517 ? 56.320  50.819  54.144  1.00 63.66  ? 517 GLU B N     1 
ATOM   8761  C  CA    . GLU B 1 517 ? 57.448  51.625  54.593  1.00 68.99  ? 517 GLU B CA    1 
ATOM   8762  C  C     . GLU B 1 517 ? 57.002  53.031  55.014  1.00 69.64  ? 517 GLU B C     1 
ATOM   8763  O  O     . GLU B 1 517 ? 57.581  53.617  55.925  1.00 69.60  ? 517 GLU B O     1 
ATOM   8764  C  CB    . GLU B 1 517 ? 58.525  51.674  53.500  1.00 68.18  ? 517 GLU B CB    1 
ATOM   8765  C  CG    . GLU B 1 517 ? 59.428  50.428  53.506  1.00 68.96  ? 517 GLU B CG    1 
ATOM   8766  C  CD    . GLU B 1 517 ? 60.360  50.345  52.309  1.00 68.90  ? 517 GLU B CD    1 
ATOM   8767  O  OE1   . GLU B 1 517 ? 60.987  49.277  52.123  1.00 69.52  ? 517 GLU B OE1   1 
ATOM   8768  O  OE2   . GLU B 1 517 ? 60.483  51.344  51.570  1.00 66.51  ? 517 GLU B OE2   1 
ATOM   8769  N  N     . VAL B 1 518 ? 55.971  53.566  54.362  1.00 71.65  ? 518 VAL B N     1 
ATOM   8770  C  CA    . VAL B 1 518 ? 55.383  54.843  54.776  1.00 67.21  ? 518 VAL B CA    1 
ATOM   8771  C  C     . VAL B 1 518 ? 54.795  54.714  56.180  1.00 64.57  ? 518 VAL B C     1 
ATOM   8772  O  O     . VAL B 1 518 ? 55.058  55.546  57.072  1.00 67.17  ? 518 VAL B O     1 
ATOM   8773  C  CB    . VAL B 1 518 ? 54.300  55.309  53.788  1.00 72.82  ? 518 VAL B CB    1 
ATOM   8774  C  CG1   . VAL B 1 518 ? 53.500  56.471  54.360  1.00 71.11  ? 518 VAL B CG1   1 
ATOM   8775  C  CG2   . VAL B 1 518 ? 54.935  55.695  52.461  1.00 77.04  ? 518 VAL B CG2   1 
ATOM   8776  N  N     . VAL B 1 519 ? 54.025  53.646  56.377  1.00 71.19  ? 519 VAL B N     1 
ATOM   8777  C  CA    . VAL B 1 519 ? 53.428  53.362  57.681  1.00 71.94  ? 519 VAL B CA    1 
ATOM   8778  C  C     . VAL B 1 519 ? 54.526  53.188  58.740  1.00 67.68  ? 519 VAL B C     1 
ATOM   8779  O  O     . VAL B 1 519 ? 54.497  53.844  59.797  1.00 63.21  ? 519 VAL B O     1 
ATOM   8780  C  CB    . VAL B 1 519 ? 52.525  52.092  57.637  1.00 67.28  ? 519 VAL B CB    1 
ATOM   8781  C  CG1   . VAL B 1 519 ? 52.024  51.720  59.027  1.00 59.60  ? 519 VAL B CG1   1 
ATOM   8782  C  CG2   . VAL B 1 519 ? 51.347  52.306  56.699  1.00 65.85  ? 519 VAL B CG2   1 
ATOM   8783  N  N     . TRP B 1 520 ? 55.506  52.331  58.452  1.00 67.26  ? 520 TRP B N     1 
ATOM   8784  C  CA    . TRP B 1 520 ? 56.582  52.116  59.421  1.00 69.06  ? 520 TRP B CA    1 
ATOM   8785  C  C     . TRP B 1 520 ? 57.369  53.393  59.733  1.00 69.24  ? 520 TRP B C     1 
ATOM   8786  O  O     . TRP B 1 520 ? 57.731  53.615  60.876  1.00 64.51  ? 520 TRP B O     1 
ATOM   8787  C  CB    . TRP B 1 520 ? 57.570  51.051  58.958  1.00 67.28  ? 520 TRP B CB    1 
ATOM   8788  C  CG    . TRP B 1 520 ? 58.820  51.092  59.791  1.00 70.13  ? 520 TRP B CG    1 
ATOM   8789  C  CD1   . TRP B 1 520 ? 60.098  51.335  59.359  1.00 71.02  ? 520 TRP B CD1   1 
ATOM   8790  C  CD2   . TRP B 1 520 ? 58.905  50.926  61.216  1.00 71.42  ? 520 TRP B CD2   1 
ATOM   8791  N  NE1   . TRP B 1 520 ? 60.970  51.319  60.426  1.00 66.98  ? 520 TRP B NE1   1 
ATOM   8792  C  CE2   . TRP B 1 520 ? 60.264  51.071  61.576  1.00 69.76  ? 520 TRP B CE2   1 
ATOM   8793  C  CE3   . TRP B 1 520 ? 57.962  50.675  62.223  1.00 67.04  ? 520 TRP B CE3   1 
ATOM   8794  C  CZ2   . TRP B 1 520 ? 60.702  50.961  62.897  1.00 64.28  ? 520 TRP B CZ2   1 
ATOM   8795  C  CZ3   . TRP B 1 520 ? 58.398  50.570  63.534  1.00 66.69  ? 520 TRP B CZ3   1 
ATOM   8796  C  CH2   . TRP B 1 520 ? 59.758  50.709  63.859  1.00 68.25  ? 520 TRP B CH2   1 
ATOM   8797  N  N     . ASP B 1 521 ? 57.648  54.220  58.729  1.00 67.20  ? 521 ASP B N     1 
ATOM   8798  C  CA    . ASP B 1 521 ? 58.381  55.465  58.964  1.00 69.21  ? 521 ASP B CA    1 
ATOM   8799  C  C     . ASP B 1 521 ? 57.606  56.389  59.900  1.00 71.76  ? 521 ASP B C     1 
ATOM   8800  O  O     . ASP B 1 521 ? 58.192  56.990  60.820  1.00 68.32  ? 521 ASP B O     1 
ATOM   8801  C  CB    . ASP B 1 521 ? 58.697  56.186  57.649  1.00 72.84  ? 521 ASP B CB    1 
ATOM   8802  C  CG    . ASP B 1 521 ? 59.887  55.573  56.915  1.00 85.05  ? 521 ASP B CG    1 
ATOM   8803  O  OD1   . ASP B 1 521 ? 60.295  54.436  57.258  1.00 79.11  ? 521 ASP B OD1   1 
ATOM   8804  O  OD2   . ASP B 1 521 ? 60.427  56.242  56.003  1.00 89.14  ? 521 ASP B OD2   1 
ATOM   8805  N  N     . LEU B 1 522 ? 56.297  56.506  59.659  1.00 67.61  ? 522 LEU B N     1 
ATOM   8806  C  CA    . LEU B 1 522 ? 55.433  57.256  60.574  1.00 67.63  ? 522 LEU B CA    1 
ATOM   8807  C  C     . LEU B 1 522 ? 55.532  56.736  62.015  1.00 63.23  ? 522 LEU B C     1 
ATOM   8808  O  O     . LEU B 1 522 ? 55.809  57.500  62.960  1.00 65.59  ? 522 LEU B O     1 
ATOM   8809  C  CB    . LEU B 1 522 ? 53.975  57.197  60.100  1.00 68.49  ? 522 LEU B CB    1 
ATOM   8810  C  CG    . LEU B 1 522 ? 53.631  57.941  58.808  1.00 71.43  ? 522 LEU B CG    1 
ATOM   8811  C  CD1   . LEU B 1 522 ? 52.226  57.609  58.355  1.00 70.97  ? 522 LEU B CD1   1 
ATOM   8812  C  CD2   . LEU B 1 522 ? 53.774  59.440  59.010  1.00 75.70  ? 522 LEU B CD2   1 
ATOM   8813  N  N     . LEU B 1 523 ? 55.333  55.431  62.180  1.00 58.07  ? 523 LEU B N     1 
ATOM   8814  C  CA    . LEU B 1 523 ? 55.345  54.851  63.516  1.00 61.14  ? 523 LEU B CA    1 
ATOM   8815  C  C     . LEU B 1 523 ? 56.716  55.024  64.186  1.00 71.69  ? 523 LEU B C     1 
ATOM   8816  O  O     . LEU B 1 523 ? 56.804  55.316  65.381  1.00 71.29  ? 523 LEU B O     1 
ATOM   8817  C  CB    . LEU B 1 523 ? 54.953  53.377  63.462  1.00 55.20  ? 523 LEU B CB    1 
ATOM   8818  C  CG    . LEU B 1 523 ? 54.941  52.651  64.811  1.00 58.12  ? 523 LEU B CG    1 
ATOM   8819  C  CD1   . LEU B 1 523 ? 54.001  53.349  65.784  1.00 58.82  ? 523 LEU B CD1   1 
ATOM   8820  C  CD2   . LEU B 1 523 ? 54.567  51.181  64.654  1.00 55.15  ? 523 LEU B CD2   1 
ATOM   8821  N  N     . GLU B 1 524 ? 57.775  54.832  63.403  1.00 67.50  ? 524 GLU B N     1 
ATOM   8822  C  CA    . GLU B 1 524 ? 59.154  54.929  63.873  1.00 71.09  ? 524 GLU B CA    1 
ATOM   8823  C  C     . GLU B 1 524 ? 59.451  56.320  64.397  1.00 66.78  ? 524 GLU B C     1 
ATOM   8824  O  O     . GLU B 1 524 ? 59.992  56.467  65.490  1.00 70.13  ? 524 GLU B O     1 
ATOM   8825  C  CB    . GLU B 1 524 ? 60.130  54.559  62.744  1.00 70.23  ? 524 GLU B CB    1 
ATOM   8826  C  CG    . GLU B 1 524 ? 61.596  54.508  63.143  1.00 69.85  ? 524 GLU B CG    1 
ATOM   8827  C  CD    . GLU B 1 524 ? 62.254  55.875  63.157  1.00 66.28  ? 524 GLU B CD    1 
ATOM   8828  O  OE1   . GLU B 1 524 ? 61.918  56.721  62.297  1.00 73.81  ? 524 GLU B OE1   1 
ATOM   8829  O  OE2   . GLU B 1 524 ? 63.083  56.116  64.052  1.00 68.44  ? 524 GLU B OE2   1 
ATOM   8830  N  N     . GLU B 1 525 ? 59.079  57.339  63.630  1.00 68.96  ? 525 GLU B N     1 
ATOM   8831  C  CA    . GLU B 1 525 ? 59.283  58.712  64.079  1.00 72.09  ? 525 GLU B CA    1 
ATOM   8832  C  C     . GLU B 1 525 ? 58.482  58.979  65.363  1.00 75.97  ? 525 GLU B C     1 
ATOM   8833  O  O     . GLU B 1 525 ? 58.982  59.646  66.292  1.00 77.86  ? 525 GLU B O     1 
ATOM   8834  C  CB    . GLU B 1 525 ? 58.914  59.707  62.977  1.00 68.04  ? 525 GLU B CB    1 
ATOM   8835  C  CG    . GLU B 1 525 ? 59.295  61.152  63.279  1.00 79.52  ? 525 GLU B CG    1 
ATOM   8836  C  CD    . GLU B 1 525 ? 60.791  61.440  63.168  1.00 85.96  ? 525 GLU B CD    1 
ATOM   8837  O  OE1   . GLU B 1 525 ? 61.401  61.066  62.141  1.00 85.50  ? 525 GLU B OE1   1 
ATOM   8838  O  OE2   . GLU B 1 525 ? 61.356  62.046  64.109  1.00 84.35  ? 525 GLU B OE2   1 
ATOM   8839  N  N     . THR B 1 526 ? 57.255  58.452  65.428  1.00 72.84  ? 526 THR B N     1 
ATOM   8840  C  CA    . THR B 1 526 ? 56.466  58.585  66.659  1.00 78.92  ? 526 THR B CA    1 
ATOM   8841  C  C     . THR B 1 526 ? 57.188  57.978  67.869  1.00 73.86  ? 526 THR B C     1 
ATOM   8842  O  O     . THR B 1 526 ? 57.302  58.612  68.919  1.00 74.04  ? 526 THR B O     1 
ATOM   8843  C  CB    . THR B 1 526 ? 55.076  57.911  66.547  1.00 73.02  ? 526 THR B CB    1 
ATOM   8844  O  OG1   . THR B 1 526 ? 54.354  58.454  65.439  1.00 74.88  ? 526 THR B OG1   1 
ATOM   8845  C  CG2   . THR B 1 526 ? 54.278  58.154  67.806  1.00 71.92  ? 526 THR B CG2   1 
ATOM   8846  N  N     . LEU B 1 527 ? 57.679  56.755  67.709  1.00 71.59  ? 527 LEU B N     1 
ATOM   8847  C  CA    . LEU B 1 527 ? 58.438  56.088  68.760  1.00 81.51  ? 527 LEU B CA    1 
ATOM   8848  C  C     . LEU B 1 527 ? 59.677  56.888  69.156  1.00 79.89  ? 527 LEU B C     1 
ATOM   8849  O  O     . LEU B 1 527 ? 60.051  56.926  70.328  1.00 80.52  ? 527 LEU B O     1 
ATOM   8850  C  CB    . LEU B 1 527 ? 58.841  54.680  68.324  1.00 76.81  ? 527 LEU B CB    1 
ATOM   8851  C  CG    . LEU B 1 527 ? 57.664  53.719  68.192  1.00 75.06  ? 527 LEU B CG    1 
ATOM   8852  C  CD1   . LEU B 1 527 ? 58.133  52.319  67.804  1.00 73.48  ? 527 LEU B CD1   1 
ATOM   8853  C  CD2   . LEU B 1 527 ? 56.913  53.690  69.498  1.00 74.22  ? 527 LEU B CD2   1 
ATOM   8854  N  N     . TRP B 1 528 ? 60.314  57.505  68.166  1.00 76.02  ? 528 TRP B N     1 
ATOM   8855  C  CA    . TRP B 1 528 ? 61.522  58.287  68.387  1.00 80.04  ? 528 TRP B CA    1 
ATOM   8856  C  C     . TRP B 1 528 ? 61.234  59.474  69.301  1.00 84.49  ? 528 TRP B C     1 
ATOM   8857  O  O     . TRP B 1 528 ? 61.936  59.700  70.302  1.00 83.77  ? 528 TRP B O     1 
ATOM   8858  C  CB    . TRP B 1 528 ? 62.079  58.766  67.045  1.00 76.55  ? 528 TRP B CB    1 
ATOM   8859  C  CG    . TRP B 1 528 ? 63.378  59.502  67.140  1.00 83.56  ? 528 TRP B CG    1 
ATOM   8860  C  CD1   . TRP B 1 528 ? 63.587  60.840  66.934  1.00 82.16  ? 528 TRP B CD1   1 
ATOM   8861  C  CD2   . TRP B 1 528 ? 64.656  58.940  67.464  1.00 82.37  ? 528 TRP B CD2   1 
ATOM   8862  N  NE1   . TRP B 1 528 ? 64.919  61.140  67.107  1.00 84.84  ? 528 TRP B NE1   1 
ATOM   8863  C  CE2   . TRP B 1 528 ? 65.596  59.991  67.432  1.00 79.33  ? 528 TRP B CE2   1 
ATOM   8864  C  CE3   . TRP B 1 528 ? 65.097  57.648  67.777  1.00 81.55  ? 528 TRP B CE3   1 
ATOM   8865  C  CZ2   . TRP B 1 528 ? 66.949  59.791  67.703  1.00 83.32  ? 528 TRP B CZ2   1 
ATOM   8866  C  CZ3   . TRP B 1 528 ? 66.438  57.449  68.045  1.00 80.76  ? 528 TRP B CZ3   1 
ATOM   8867  C  CH2   . TRP B 1 528 ? 67.350  58.516  68.007  1.00 83.57  ? 528 TRP B CH2   1 
ATOM   8868  N  N     . ALA B 1 529 ? 60.175  60.211  68.969  1.00 85.97  ? 529 ALA B N     1 
ATOM   8869  C  CA    . ALA B 1 529 ? 59.749  61.326  69.807  1.00 88.30  ? 529 ALA B CA    1 
ATOM   8870  C  C     . ALA B 1 529 ? 59.410  60.824  71.214  1.00 91.48  ? 529 ALA B C     1 
ATOM   8871  O  O     . ALA B 1 529 ? 59.809  61.426  72.233  1.00 92.42  ? 529 ALA B O     1 
ATOM   8872  C  CB    . ALA B 1 529 ? 58.558  62.039  69.186  1.00 85.76  ? 529 ALA B CB    1 
ATOM   8873  N  N     . PHE B 1 530 ? 58.680  59.711  71.262  1.00 80.44  ? 530 PHE B N     1 
ATOM   8874  C  CA    . PHE B 1 530 ? 58.263  59.139  72.533  1.00 87.01  ? 530 PHE B CA    1 
ATOM   8875  C  C     . PHE B 1 530 ? 59.420  58.793  73.469  1.00 92.53  ? 530 PHE B C     1 
ATOM   8876  O  O     . PHE B 1 530 ? 59.436  59.252  74.611  1.00 94.84  ? 530 PHE B O     1 
ATOM   8877  C  CB    . PHE B 1 530 ? 57.427  57.885  72.304  1.00 85.20  ? 530 PHE B CB    1 
ATOM   8878  C  CG    . PHE B 1 530 ? 56.853  57.314  73.563  1.00 84.16  ? 530 PHE B CG    1 
ATOM   8879  C  CD1   . PHE B 1 530 ? 55.658  57.806  74.072  1.00 82.21  ? 530 PHE B CD1   1 
ATOM   8880  C  CD2   . PHE B 1 530 ? 57.506  56.298  74.247  1.00 86.07  ? 530 PHE B CD2   1 
ATOM   8881  C  CE1   . PHE B 1 530 ? 55.117  57.289  75.233  1.00 84.00  ? 530 PHE B CE1   1 
ATOM   8882  C  CE2   . PHE B 1 530 ? 56.975  55.780  75.412  1.00 91.73  ? 530 PHE B CE2   1 
ATOM   8883  C  CZ    . PHE B 1 530 ? 55.774  56.272  75.905  1.00 87.83  ? 530 PHE B CZ    1 
ATOM   8884  N  N     . ARG B 1 531 ? 60.364  57.972  73.006  1.00 90.06  ? 531 ARG B N     1 
ATOM   8885  C  CA    . ARG B 1 531 ? 61.503  57.591  73.847  1.00 97.57  ? 531 ARG B CA    1 
ATOM   8886  C  C     . ARG B 1 531 ? 62.423  58.777  74.133  1.00 97.24  ? 531 ARG B C     1 
ATOM   8887  O  O     . ARG B 1 531 ? 63.081  58.814  75.173  1.00 96.65  ? 531 ARG B O     1 
ATOM   8888  C  CB    . ARG B 1 531 ? 62.297  56.414  73.261  1.00 98.43  ? 531 ARG B CB    1 
ATOM   8889  C  CG    . ARG B 1 531 ? 63.326  55.885  74.275  1.00 100.10 ? 531 ARG B CG    1 
ATOM   8890  C  CD    . ARG B 1 531 ? 64.471  55.076  73.678  1.00 105.43 ? 531 ARG B CD    1 
ATOM   8891  N  NE    . ARG B 1 531 ? 64.092  53.678  73.476  1.00 105.86 ? 531 ARG B NE    1 
ATOM   8892  C  CZ    . ARG B 1 531 ? 64.252  52.727  74.397  1.00 106.22 ? 531 ARG B CZ    1 
ATOM   8893  N  NH1   . ARG B 1 531 ? 64.803  53.024  75.567  1.00 111.23 ? 531 ARG B NH1   1 
ATOM   8894  N  NH2   . ARG B 1 531 ? 63.880  51.478  74.147  1.00 104.92 ? 531 ARG B NH2   1 
ATOM   8895  N  N     . ARG B 1 532 ? 62.509  59.732  73.211  1.00 95.20  ? 532 ARG B N     1 
ATOM   8896  C  CA    . ARG B 1 532 ? 63.288  60.921  73.531  1.00 93.93  ? 532 ARG B CA    1 
ATOM   8897  C  C     . ARG B 1 532 ? 62.652  61.639  74.726  1.00 97.80  ? 532 ARG B C     1 
ATOM   8898  O  O     . ARG B 1 532 ? 63.367  62.206  75.554  1.00 97.76  ? 532 ARG B O     1 
ATOM   8899  C  CB    . ARG B 1 532 ? 63.427  61.863  72.334  1.00 94.73  ? 532 ARG B CB    1 
ATOM   8900  C  CG    . ARG B 1 532 ? 64.598  61.485  71.421  1.00 95.84  ? 532 ARG B CG    1 
ATOM   8901  C  CD    . ARG B 1 532 ? 64.813  62.475  70.284  1.00 95.66  ? 532 ARG B CD    1 
ATOM   8902  N  NE    . ARG B 1 532 ? 64.936  63.847  70.774  1.00 106.71 ? 532 ARG B NE    1 
ATOM   8903  C  CZ    . ARG B 1 532 ? 66.066  64.370  71.246  1.00 105.93 ? 532 ARG B CZ    1 
ATOM   8904  N  NH1   . ARG B 1 532 ? 66.094  65.626  71.672  1.00 104.32 ? 532 ARG B NH1   1 
ATOM   8905  N  NH2   . ARG B 1 532 ? 67.171  63.633  71.295  1.00 99.82  ? 532 ARG B NH2   1 
ATOM   8906  N  N     . LYS B 1 533 ? 61.321  61.624  74.823  1.00 99.91  ? 533 LYS B N     1 
ATOM   8907  C  CA    . LYS B 1 533 ? 60.676  62.295  75.960  1.00 100.43 ? 533 LYS B CA    1 
ATOM   8908  C  C     . LYS B 1 533 ? 60.675  61.435  77.241  1.00 103.65 ? 533 LYS B C     1 
ATOM   8909  O  O     . LYS B 1 533 ? 60.755  61.966  78.351  1.00 107.64 ? 533 LYS B O     1 
ATOM   8910  C  CB    . LYS B 1 533 ? 59.243  62.695  75.606  1.00 98.04  ? 533 LYS B CB    1 
ATOM   8911  C  CG    . LYS B 1 533 ? 58.657  63.747  76.536  1.00 102.53 ? 533 LYS B CG    1 
ATOM   8912  C  CD    . LYS B 1 533 ? 59.409  65.068  76.382  1.00 100.42 ? 533 LYS B CD    1 
ATOM   8913  C  CE    . LYS B 1 533 ? 58.743  66.204  77.149  1.00 102.90 ? 533 LYS B CE    1 
ATOM   8914  N  NZ    . LYS B 1 533 ? 58.704  65.952  78.616  1.00 105.15 ? 533 LYS B NZ    1 
ATOM   8915  N  N     . ALA B 1 534 ? 60.569  60.117  77.085  1.00 99.65  ? 534 ALA B N     1 
ATOM   8916  C  CA    . ALA B 1 534 ? 60.485  59.198  78.222  1.00 97.32  ? 534 ALA B CA    1 
ATOM   8917  C  C     . ALA B 1 534 ? 61.625  58.201  78.146  1.00 101.92 ? 534 ALA B C     1 
ATOM   8918  O  O     . ALA B 1 534 ? 61.847  57.603  77.097  1.00 101.17 ? 534 ALA B O     1 
ATOM   8919  C  CB    . ALA B 1 534 ? 59.150  58.480  78.243  1.00 100.96 ? 534 ALA B CB    1 
ATOM   8920  N  N     . GLY B 1 535 ? 62.313  57.973  79.260  1.00 105.79 ? 535 GLY B N     1 
ATOM   8921  C  CA    . GLY B 1 535 ? 63.501  57.132  79.263  1.00 102.94 ? 535 GLY B CA    1 
ATOM   8922  C  C     . GLY B 1 535 ? 63.451  55.746  78.631  1.00 107.23 ? 535 GLY B C     1 
ATOM   8923  O  O     . GLY B 1 535 ? 64.410  54.981  78.760  1.00 108.85 ? 535 GLY B O     1 
ATOM   8924  N  N     . ARG B 1 536 ? 62.366  55.425  77.928  1.00 106.00 ? 536 ARG B N     1 
ATOM   8925  C  CA    . ARG B 1 536 ? 62.269  54.145  77.235  1.00 103.17 ? 536 ARG B CA    1 
ATOM   8926  C  C     . ARG B 1 536 ? 61.148  54.121  76.198  1.00 100.28 ? 536 ARG B C     1 
ATOM   8927  O  O     . ARG B 1 536 ? 60.447  55.109  75.970  1.00 96.21  ? 536 ARG B O     1 
ATOM   8928  C  CB    . ARG B 1 536 ? 62.064  52.974  78.203  1.00 100.72 ? 536 ARG B CB    1 
ATOM   8929  C  CG    . ARG B 1 536 ? 60.792  53.007  79.023  1.00 100.88 ? 536 ARG B CG    1 
ATOM   8930  C  CD    . ARG B 1 536 ? 60.601  51.660  79.712  1.00 104.07 ? 536 ARG B CD    1 
ATOM   8931  N  NE    . ARG B 1 536 ? 59.341  51.563  80.446  1.00 105.21 ? 536 ARG B NE    1 
ATOM   8932  C  CZ    . ARG B 1 536 ? 58.216  51.057  79.945  1.00 103.47 ? 536 ARG B CZ    1 
ATOM   8933  N  NH1   . ARG B 1 536 ? 58.181  50.605  78.696  1.00 97.96  ? 536 ARG B NH1   1 
ATOM   8934  N  NH2   . ARG B 1 536 ? 57.120  51.006  80.692  1.00 101.14 ? 536 ARG B NH2   1 
ATOM   8935  N  N     . LEU B 1 537 ? 61.030  52.962  75.564  1.00 101.12 ? 537 LEU B N     1 
ATOM   8936  C  CA    . LEU B 1 537 ? 59.964  52.633  74.633  1.00 96.30  ? 537 LEU B CA    1 
ATOM   8937  C  C     . LEU B 1 537 ? 58.696  52.255  75.394  1.00 97.78  ? 537 LEU B C     1 
ATOM   8938  O  O     . LEU B 1 537 ? 58.770  51.872  76.567  1.00 97.68  ? 537 LEU B O     1 
ATOM   8939  C  CB    . LEU B 1 537 ? 60.430  51.484  73.740  1.00 93.88  ? 537 LEU B CB    1 
ATOM   8940  C  CG    . LEU B 1 537 ? 60.635  51.762  72.253  1.00 98.45  ? 537 LEU B CG    1 
ATOM   8941  C  CD1   . LEU B 1 537 ? 61.286  53.109  72.006  1.00 95.75  ? 537 LEU B CD1   1 
ATOM   8942  C  CD2   . LEU B 1 537 ? 61.450  50.637  71.651  1.00 97.02  ? 537 LEU B CD2   1 
ATOM   8943  N  N     . PRO B 1 538 ? 57.527  52.366  74.738  1.00 91.33  ? 538 PRO B N     1 
ATOM   8944  C  CA    . PRO B 1 538 ? 56.292  51.952  75.412  1.00 88.01  ? 538 PRO B CA    1 
ATOM   8945  C  C     . PRO B 1 538 ? 56.247  50.444  75.584  1.00 80.77  ? 538 PRO B C     1 
ATOM   8946  O  O     . PRO B 1 538 ? 56.789  49.722  74.749  1.00 80.24  ? 538 PRO B O     1 
ATOM   8947  C  CB    . PRO B 1 538 ? 55.177  52.414  74.456  1.00 86.60  ? 538 PRO B CB    1 
ATOM   8948  C  CG    . PRO B 1 538 ? 55.839  53.272  73.423  1.00 87.22  ? 538 PRO B CG    1 
ATOM   8949  C  CD    . PRO B 1 538 ? 57.276  52.862  73.373  1.00 90.70  ? 538 PRO B CD    1 
ATOM   8950  N  N     . SER B 1 539 ? 55.605  49.972  76.646  1.00 82.32  ? 539 SER B N     1 
ATOM   8951  C  CA    . SER B 1 539 ? 55.464  48.538  76.845  1.00 84.23  ? 539 SER B CA    1 
ATOM   8952  C  C     . SER B 1 539 ? 54.513  47.994  75.794  1.00 81.42  ? 539 SER B C     1 
ATOM   8953  O  O     . SER B 1 539 ? 54.635  46.845  75.361  1.00 78.89  ? 539 SER B O     1 
ATOM   8954  C  CB    . SER B 1 539 ? 54.953  48.218  78.252  1.00 81.68  ? 539 SER B CB    1 
ATOM   8955  O  OG    . SER B 1 539 ? 53.715  48.852  78.514  1.00 86.51  ? 539 SER B OG    1 
ATOM   8956  N  N     . ARG B 1 540 ? 53.574  48.841  75.378  1.00 78.96  ? 540 ARG B N     1 
ATOM   8957  C  CA    . ARG B 1 540 ? 52.482  48.415  74.512  1.00 79.39  ? 540 ARG B CA    1 
ATOM   8958  C  C     . ARG B 1 540 ? 51.897  49.581  73.713  1.00 78.47  ? 540 ARG B C     1 
ATOM   8959  O  O     . ARG B 1 540 ? 51.682  50.671  74.248  1.00 77.74  ? 540 ARG B O     1 
ATOM   8960  C  CB    . ARG B 1 540 ? 51.387  47.751  75.348  1.00 77.20  ? 540 ARG B CB    1 
ATOM   8961  C  CG    . ARG B 1 540 ? 50.244  47.176  74.535  1.00 79.16  ? 540 ARG B CG    1 
ATOM   8962  C  CD    . ARG B 1 540 ? 49.217  46.497  75.433  1.00 78.45  ? 540 ARG B CD    1 
ATOM   8963  N  NE    . ARG B 1 540 ? 48.505  45.444  74.718  1.00 77.32  ? 540 ARG B NE    1 
ATOM   8964  C  CZ    . ARG B 1 540 ? 48.866  44.166  74.731  1.00 77.21  ? 540 ARG B CZ    1 
ATOM   8965  N  NH1   . ARG B 1 540 ? 49.920  43.788  75.434  1.00 70.17  ? 540 ARG B NH1   1 
ATOM   8966  N  NH2   . ARG B 1 540 ? 48.168  43.265  74.052  1.00 81.09  ? 540 ARG B NH2   1 
ATOM   8967  N  N     . VAL B 1 541 ? 51.629  49.351  72.432  1.00 72.10  ? 541 VAL B N     1 
ATOM   8968  C  CA    . VAL B 1 541 ? 50.998  50.382  71.624  1.00 74.81  ? 541 VAL B CA    1 
ATOM   8969  C  C     . VAL B 1 541 ? 49.656  49.925  71.076  1.00 71.24  ? 541 VAL B C     1 
ATOM   8970  O  O     . VAL B 1 541 ? 49.425  48.742  70.828  1.00 71.61  ? 541 VAL B O     1 
ATOM   8971  C  CB    . VAL B 1 541 ? 51.893  50.826  70.443  1.00 71.63  ? 541 VAL B CB    1 
ATOM   8972  C  CG1   . VAL B 1 541 ? 53.107  51.579  70.946  1.00 76.24  ? 541 VAL B CG1   1 
ATOM   8973  C  CG2   . VAL B 1 541 ? 52.292  49.627  69.594  1.00 72.63  ? 541 VAL B CG2   1 
ATOM   8974  N  N     . LEU B 1 542 ? 48.766  50.894  70.921  1.00 73.44  ? 542 LEU B N     1 
ATOM   8975  C  CA    . LEU B 1 542 ? 47.474  50.699  70.289  1.00 63.98  ? 542 LEU B CA    1 
ATOM   8976  C  C     . LEU B 1 542 ? 47.543  51.414  68.952  1.00 59.77  ? 542 LEU B C     1 
ATOM   8977  O  O     . LEU B 1 542 ? 47.838  52.620  68.891  1.00 60.48  ? 542 LEU B O     1 
ATOM   8978  C  CB    . LEU B 1 542 ? 46.342  51.231  71.171  1.00 62.00  ? 542 LEU B CB    1 
ATOM   8979  C  CG    . LEU B 1 542 ? 44.919  51.222  70.608  1.00 66.97  ? 542 LEU B CG    1 
ATOM   8980  C  CD1   . LEU B 1 542 ? 44.483  49.805  70.255  1.00 66.09  ? 542 LEU B CD1   1 
ATOM   8981  C  CD2   . LEU B 1 542 ? 43.962  51.840  71.621  1.00 62.17  ? 542 LEU B CD2   1 
ATOM   8982  N  N     . LEU B 1 543 ? 47.347  50.647  67.882  1.00 57.36  ? 543 LEU B N     1 
ATOM   8983  C  CA    . LEU B 1 543 ? 47.439  51.175  66.524  1.00 56.72  ? 543 LEU B CA    1 
ATOM   8984  C  C     . LEU B 1 543 ? 46.039  51.382  65.927  1.00 57.26  ? 543 LEU B C     1 
ATOM   8985  O  O     . LEU B 1 543 ? 45.270  50.431  65.772  1.00 52.80  ? 543 LEU B O     1 
ATOM   8986  C  CB    . LEU B 1 543 ? 48.269  50.226  65.643  1.00 54.31  ? 543 LEU B CB    1 
ATOM   8987  C  CG    . LEU B 1 543 ? 49.815  50.209  65.677  1.00 63.66  ? 543 LEU B CG    1 
ATOM   8988  C  CD1   . LEU B 1 543 ? 50.385  50.945  66.868  1.00 59.01  ? 543 LEU B CD1   1 
ATOM   8989  C  CD2   . LEU B 1 543 ? 50.365  48.783  65.644  1.00 53.30  ? 543 LEU B CD2   1 
ATOM   8990  N  N     . LEU B 1 544 ? 45.729  52.627  65.575  1.00 55.25  ? 544 LEU B N     1 
ATOM   8991  C  CA    . LEU B 1 544 ? 44.421  52.979  65.030  1.00 56.02  ? 544 LEU B CA    1 
ATOM   8992  C  C     . LEU B 1 544 ? 44.523  53.520  63.596  1.00 56.67  ? 544 LEU B C     1 
ATOM   8993  O  O     . LEU B 1 544 ? 45.371  54.372  63.300  1.00 51.10  ? 544 LEU B O     1 
ATOM   8994  C  CB    . LEU B 1 544 ? 43.729  54.002  65.943  1.00 58.26  ? 544 LEU B CB    1 
ATOM   8995  C  CG    . LEU B 1 544 ? 43.602  53.589  67.418  1.00 56.22  ? 544 LEU B CG    1 
ATOM   8996  C  CD1   . LEU B 1 544 ? 43.104  54.739  68.280  1.00 54.23  ? 544 LEU B CD1   1 
ATOM   8997  C  CD2   . LEU B 1 544 ? 42.688  52.373  67.563  1.00 51.74  ? 544 LEU B CD2   1 
ATOM   8998  N  N     . ARG B 1 545 ? 43.683  52.971  62.715  1.00 55.11  ? 545 ARG B N     1 
ATOM   8999  C  CA    . ARG B 1 545 ? 43.604  53.350  61.298  1.00 57.77  ? 545 ARG B CA    1 
ATOM   9000  C  C     . ARG B 1 545 ? 42.143  53.518  60.862  1.00 62.58  ? 545 ARG B C     1 
ATOM   9001  O  O     . ARG B 1 545 ? 41.240  53.092  61.588  1.00 59.25  ? 545 ARG B O     1 
ATOM   9002  C  CB    . ARG B 1 545 ? 44.282  52.279  60.436  1.00 59.99  ? 545 ARG B CB    1 
ATOM   9003  C  CG    . ARG B 1 545 ? 43.744  50.869  60.707  1.00 60.79  ? 545 ARG B CG    1 
ATOM   9004  C  CD    . ARG B 1 545 ? 44.418  49.815  59.839  1.00 63.44  ? 545 ARG B CD    1 
ATOM   9005  N  NE    . ARG B 1 545 ? 43.949  49.890  58.462  1.00 72.94  ? 545 ARG B NE    1 
ATOM   9006  C  CZ    . ARG B 1 545 ? 43.163  48.987  57.887  1.00 73.66  ? 545 ARG B CZ    1 
ATOM   9007  N  NH1   . ARG B 1 545 ? 42.767  47.909  58.555  1.00 73.11  ? 545 ARG B NH1   1 
ATOM   9008  N  NH2   . ARG B 1 545 ? 42.783  49.155  56.632  1.00 73.31  ? 545 ARG B NH2   1 
ATOM   9009  N  N     . ASP B 1 546 ? 41.899  54.111  59.689  1.00 65.56  ? 546 ASP B N     1 
ATOM   9010  C  CA    . ASP B 1 546 ? 40.531  54.171  59.153  1.00 66.51  ? 546 ASP B CA    1 
ATOM   9011  C  C     . ASP B 1 546 ? 40.180  52.844  58.484  1.00 59.36  ? 546 ASP B C     1 
ATOM   9012  O  O     . ASP B 1 546 ? 40.877  51.851  58.664  1.00 61.23  ? 546 ASP B O     1 
ATOM   9013  C  CB    . ASP B 1 546 ? 40.321  55.339  58.171  1.00 67.80  ? 546 ASP B CB    1 
ATOM   9014  C  CG    . ASP B 1 546 ? 41.211  55.266  56.940  1.00 67.80  ? 546 ASP B CG    1 
ATOM   9015  O  OD1   . ASP B 1 546 ? 41.834  54.211  56.675  1.00 75.44  ? 546 ASP B OD1   1 
ATOM   9016  O  OD2   . ASP B 1 546 ? 41.272  56.287  56.220  1.00 72.64  ? 546 ASP B OD2   1 
ATOM   9017  N  N     . GLY B 1 547 ? 39.120  52.836  57.682  1.00 71.23  ? 547 GLY B N     1 
ATOM   9018  C  CA    . GLY B 1 547 ? 38.616  51.596  57.114  1.00 68.74  ? 547 GLY B CA    1 
ATOM   9019  C  C     . GLY B 1 547 ? 38.919  51.364  55.644  1.00 66.24  ? 547 GLY B C     1 
ATOM   9020  O  O     . GLY B 1 547 ? 38.431  50.397  55.060  1.00 67.94  ? 547 GLY B O     1 
ATOM   9021  N  N     . ARG B 1 548 ? 39.725  52.237  55.044  1.00 67.14  ? 548 ARG B N     1 
ATOM   9022  C  CA    . ARG B 1 548 ? 39.910  52.210  53.594  1.00 74.31  ? 548 ARG B CA    1 
ATOM   9023  C  C     . ARG B 1 548 ? 41.134  51.399  53.125  1.00 72.67  ? 548 ARG B C     1 
ATOM   9024  O  O     . ARG B 1 548 ? 40.984  50.478  52.315  1.00 74.13  ? 548 ARG B O     1 
ATOM   9025  C  CB    . ARG B 1 548 ? 40.013  53.647  53.062  1.00 75.45  ? 548 ARG B CB    1 
ATOM   9026  C  CG    . ARG B 1 548 ? 40.038  53.756  51.543  1.00 78.66  ? 548 ARG B CG    1 
ATOM   9027  C  CD    . ARG B 1 548 ? 38.734  53.234  50.956  1.00 78.32  ? 548 ARG B CD    1 
ATOM   9028  N  NE    . ARG B 1 548 ? 38.766  53.102  49.500  1.00 81.64  ? 548 ARG B NE    1 
ATOM   9029  C  CZ    . ARG B 1 548 ? 39.166  52.011  48.854  1.00 85.23  ? 548 ARG B CZ    1 
ATOM   9030  N  NH1   . ARG B 1 548 ? 39.563  50.940  49.530  1.00 81.24  ? 548 ARG B NH1   1 
ATOM   9031  N  NH2   . ARG B 1 548 ? 39.155  51.988  47.527  1.00 95.22  ? 548 ARG B NH2   1 
ATOM   9032  N  N     . VAL B 1 549 ? 42.326  51.712  53.638  1.00 66.64  ? 549 VAL B N     1 
ATOM   9033  C  CA    . VAL B 1 549 ? 43.558  51.064  53.155  1.00 67.04  ? 549 VAL B CA    1 
ATOM   9034  C  C     . VAL B 1 549 ? 43.584  49.585  53.541  1.00 62.33  ? 549 VAL B C     1 
ATOM   9035  O  O     . VAL B 1 549 ? 42.972  49.195  54.526  1.00 67.86  ? 549 VAL B O     1 
ATOM   9036  C  CB    . VAL B 1 549 ? 44.849  51.761  53.699  1.00 64.98  ? 549 VAL B CB    1 
ATOM   9037  C  CG1   . VAL B 1 549 ? 44.752  53.276  53.556  1.00 62.79  ? 549 VAL B CG1   1 
ATOM   9038  C  CG2   . VAL B 1 549 ? 45.113  51.380  55.143  1.00 65.54  ? 549 VAL B CG2   1 
ATOM   9039  N  N     . PRO B 1 550 ? 44.272  48.748  52.752  1.00 63.36  ? 550 PRO B N     1 
ATOM   9040  C  CA    . PRO B 1 550 ? 44.374  47.320  53.091  1.00 61.40  ? 550 PRO B CA    1 
ATOM   9041  C  C     . PRO B 1 550 ? 45.150  47.035  54.381  1.00 69.72  ? 550 PRO B C     1 
ATOM   9042  O  O     . PRO B 1 550 ? 46.177  47.667  54.634  1.00 67.07  ? 550 PRO B O     1 
ATOM   9043  C  CB    . PRO B 1 550 ? 45.115  46.724  51.887  1.00 68.13  ? 550 PRO B CB    1 
ATOM   9044  C  CG    . PRO B 1 550 ? 44.878  47.685  50.772  1.00 66.52  ? 550 PRO B CG    1 
ATOM   9045  C  CD    . PRO B 1 550 ? 44.841  49.040  51.424  1.00 67.55  ? 550 PRO B CD    1 
ATOM   9046  N  N     . GLN B 1 551 ? 44.658  46.083  55.171  1.00 69.24  ? 551 GLN B N     1 
ATOM   9047  C  CA    . GLN B 1 551 ? 45.279  45.689  56.434  1.00 71.45  ? 551 GLN B CA    1 
ATOM   9048  C  C     . GLN B 1 551 ? 46.765  45.329  56.304  1.00 70.69  ? 551 GLN B C     1 
ATOM   9049  O  O     . GLN B 1 551 ? 47.556  45.587  57.213  1.00 70.55  ? 551 GLN B O     1 
ATOM   9050  C  CB    . GLN B 1 551 ? 44.522  44.493  57.026  1.00 68.67  ? 551 GLN B CB    1 
ATOM   9051  C  CG    . GLN B 1 551 ? 45.179  43.859  58.256  1.00 75.64  ? 551 GLN B CG    1 
ATOM   9052  C  CD    . GLN B 1 551 ? 44.368  42.700  58.828  1.00 80.25  ? 551 GLN B CD    1 
ATOM   9053  O  OE1   . GLN B 1 551 ? 43.205  42.510  58.478  1.00 84.97  ? 551 GLN B OE1   1 
ATOM   9054  N  NE2   . GLN B 1 551 ? 44.992  41.911  59.699  1.00 82.23  ? 551 GLN B NE2   1 
ATOM   9055  N  N     . ASP B 1 552 ? 47.145  44.763  55.164  1.00 71.22  ? 552 ASP B N     1 
ATOM   9056  C  CA    . ASP B 1 552 ? 48.507  44.278  54.970  1.00 70.36  ? 552 ASP B CA    1 
ATOM   9057  C  C     . ASP B 1 552 ? 49.550  45.401  54.943  1.00 68.29  ? 552 ASP B C     1 
ATOM   9058  O  O     . ASP B 1 552 ? 50.740  45.156  55.140  1.00 68.22  ? 552 ASP B O     1 
ATOM   9059  C  CB    . ASP B 1 552 ? 48.587  43.452  53.682  1.00 68.89  ? 552 ASP B CB    1 
ATOM   9060  C  CG    . ASP B 1 552 ? 49.697  42.413  53.728  1.00 85.25  ? 552 ASP B CG    1 
ATOM   9061  O  OD1   . ASP B 1 552 ? 49.549  41.414  54.468  1.00 90.95  ? 552 ASP B OD1   1 
ATOM   9062  O  OD2   . ASP B 1 552 ? 50.718  42.594  53.032  1.00 86.92  ? 552 ASP B OD2   1 
ATOM   9063  N  N     . GLU B 1 553 ? 49.104  46.628  54.699  1.00 62.97  ? 553 GLU B N     1 
ATOM   9064  C  CA    . GLU B 1 553 ? 49.988  47.790  54.719  1.00 67.12  ? 553 GLU B CA    1 
ATOM   9065  C  C     . GLU B 1 553 ? 50.593  48.050  56.103  1.00 67.51  ? 553 GLU B C     1 
ATOM   9066  O  O     . GLU B 1 553 ? 51.462  48.910  56.259  1.00 65.63  ? 553 GLU B O     1 
ATOM   9067  C  CB    . GLU B 1 553 ? 49.238  49.032  54.232  1.00 61.37  ? 553 GLU B CB    1 
ATOM   9068  C  CG    . GLU B 1 553 ? 48.810  48.938  52.775  1.00 61.68  ? 553 GLU B CG    1 
ATOM   9069  C  CD    . GLU B 1 553 ? 48.609  50.289  52.108  1.00 65.45  ? 553 GLU B CD    1 
ATOM   9070  O  OE1   . GLU B 1 553 ? 48.396  50.304  50.878  1.00 65.71  ? 553 GLU B OE1   1 
ATOM   9071  O  OE2   . GLU B 1 553 ? 48.669  51.332  52.797  1.00 70.04  ? 553 GLU B OE2   1 
ATOM   9072  N  N     . PHE B 1 554 ? 50.117  47.317  57.105  1.00 69.75  ? 554 PHE B N     1 
ATOM   9073  C  CA    . PHE B 1 554 ? 50.606  47.467  58.470  1.00 66.64  ? 554 PHE B CA    1 
ATOM   9074  C  C     . PHE B 1 554 ? 51.500  46.314  58.933  1.00 69.40  ? 554 PHE B C     1 
ATOM   9075  O  O     . PHE B 1 554 ? 51.989  46.323  60.065  1.00 66.99  ? 554 PHE B O     1 
ATOM   9076  C  CB    . PHE B 1 554 ? 49.412  47.638  59.415  1.00 62.33  ? 554 PHE B CB    1 
ATOM   9077  C  CG    . PHE B 1 554 ? 48.845  49.024  59.399  1.00 62.47  ? 554 PHE B CG    1 
ATOM   9078  C  CD1   . PHE B 1 554 ? 48.105  49.470  58.314  1.00 56.78  ? 554 PHE B CD1   1 
ATOM   9079  C  CD2   . PHE B 1 554 ? 49.066  49.891  60.458  1.00 64.66  ? 554 PHE B CD2   1 
ATOM   9080  C  CE1   . PHE B 1 554 ? 47.601  50.745  58.284  1.00 63.77  ? 554 PHE B CE1   1 
ATOM   9081  C  CE2   . PHE B 1 554 ? 48.558  51.180  60.437  1.00 60.04  ? 554 PHE B CE2   1 
ATOM   9082  C  CZ    . PHE B 1 554 ? 47.826  51.608  59.348  1.00 64.68  ? 554 PHE B CZ    1 
ATOM   9083  N  N     . ALA B 1 555 ? 51.708  45.328  58.062  1.00 65.16  ? 555 ALA B N     1 
ATOM   9084  C  CA    . ALA B 1 555 ? 52.463  44.125  58.414  1.00 71.26  ? 555 ALA B CA    1 
ATOM   9085  C  C     . ALA B 1 555 ? 53.915  44.426  58.813  1.00 67.84  ? 555 ALA B C     1 
ATOM   9086  O  O     . ALA B 1 555 ? 54.424  43.876  59.790  1.00 67.40  ? 555 ALA B O     1 
ATOM   9087  C  CB    . ALA B 1 555 ? 52.428  43.129  57.257  1.00 68.91  ? 555 ALA B CB    1 
ATOM   9088  N  N     . LEU B 1 556 ? 54.579  45.273  58.032  1.00 68.86  ? 556 LEU B N     1 
ATOM   9089  C  CA    . LEU B 1 556 ? 55.965  45.661  58.301  1.00 76.11  ? 556 LEU B CA    1 
ATOM   9090  C  C     . LEU B 1 556 ? 56.117  46.354  59.663  1.00 75.99  ? 556 LEU B C     1 
ATOM   9091  O  O     . LEU B 1 556 ? 57.050  46.062  60.413  1.00 75.62  ? 556 LEU B O     1 
ATOM   9092  C  CB    . LEU B 1 556 ? 56.492  46.566  57.179  1.00 73.30  ? 556 LEU B CB    1 
ATOM   9093  C  CG    . LEU B 1 556 ? 58.012  46.676  56.977  1.00 76.58  ? 556 LEU B CG    1 
ATOM   9094  C  CD1   . LEU B 1 556 ? 58.528  48.052  57.355  1.00 71.64  ? 556 LEU B CD1   1 
ATOM   9095  C  CD2   . LEU B 1 556 ? 58.767  45.595  57.742  1.00 70.84  ? 556 LEU B CD2   1 
ATOM   9096  N  N     . ALA B 1 557 ? 55.213  47.288  59.957  1.00 73.76  ? 557 ALA B N     1 
ATOM   9097  C  CA    . ALA B 1 557 ? 55.235  48.022  61.223  1.00 71.69  ? 557 ALA B CA    1 
ATOM   9098  C  C     . ALA B 1 557 ? 55.034  47.065  62.387  1.00 71.43  ? 557 ALA B C     1 
ATOM   9099  O  O     . ALA B 1 557 ? 55.677  47.188  63.437  1.00 71.13  ? 557 ALA B O     1 
ATOM   9100  C  CB    . ALA B 1 557 ? 54.171  49.107  61.236  1.00 69.49  ? 557 ALA B CB    1 
ATOM   9101  N  N     . LEU B 1 558 ? 54.123  46.120  62.190  1.00 64.97  ? 558 LEU B N     1 
ATOM   9102  C  CA    . LEU B 1 558 ? 53.873  45.080  63.173  1.00 71.87  ? 558 LEU B CA    1 
ATOM   9103  C  C     . LEU B 1 558 ? 55.143  44.275  63.421  1.00 76.86  ? 558 LEU B C     1 
ATOM   9104  O  O     . LEU B 1 558 ? 55.488  43.996  64.570  1.00 72.20  ? 558 LEU B O     1 
ATOM   9105  C  CB    . LEU B 1 558 ? 52.742  44.158  62.719  1.00 64.58  ? 558 LEU B CB    1 
ATOM   9106  C  CG    . LEU B 1 558 ? 51.336  44.444  63.260  1.00 76.19  ? 558 LEU B CG    1 
ATOM   9107  C  CD1   . LEU B 1 558 ? 51.021  45.928  63.247  1.00 68.57  ? 558 LEU B CD1   1 
ATOM   9108  C  CD2   . LEU B 1 558 ? 50.260  43.648  62.506  1.00 61.57  ? 558 LEU B CD2   1 
ATOM   9109  N  N     . GLU B 1 559 ? 55.829  43.890  62.345  1.00 76.92  ? 559 GLU B N     1 
ATOM   9110  C  CA    . GLU B 1 559 ? 57.051  43.100  62.483  1.00 79.55  ? 559 GLU B CA    1 
ATOM   9111  C  C     . GLU B 1 559 ? 58.149  43.866  63.203  1.00 73.04  ? 559 GLU B C     1 
ATOM   9112  O  O     . GLU B 1 559 ? 58.857  43.305  64.041  1.00 77.24  ? 559 GLU B O     1 
ATOM   9113  C  CB    . GLU B 1 559 ? 57.553  42.634  61.114  1.00 77.63  ? 559 GLU B CB    1 
ATOM   9114  C  CG    . GLU B 1 559 ? 56.982  41.292  60.672  1.00 81.00  ? 559 GLU B CG    1 
ATOM   9115  C  CD    . GLU B 1 559 ? 57.104  40.220  61.750  1.00 86.91  ? 559 GLU B CD    1 
ATOM   9116  O  OE1   . GLU B 1 559 ? 58.183  40.108  62.373  1.00 83.12  ? 559 GLU B OE1   1 
ATOM   9117  O  OE2   . GLU B 1 559 ? 56.119  39.483  61.974  1.00 89.37  ? 559 GLU B OE2   1 
ATOM   9118  N  N     . ALA B 1 560 ? 58.273  45.149  62.886  1.00 74.01  ? 560 ALA B N     1 
ATOM   9119  C  CA    . ALA B 1 560 ? 59.268  45.991  63.530  1.00 69.81  ? 560 ALA B CA    1 
ATOM   9120  C  C     . ALA B 1 560 ? 58.958  46.137  65.015  1.00 74.00  ? 560 ALA B C     1 
ATOM   9121  O  O     . ALA B 1 560 ? 59.870  46.190  65.839  1.00 79.15  ? 560 ALA B O     1 
ATOM   9122  C  CB    . ALA B 1 560 ? 59.336  47.344  62.859  1.00 66.23  ? 560 ALA B CB    1 
ATOM   9123  N  N     . LEU B 1 561 ? 57.673  46.204  65.355  1.00 74.07  ? 561 LEU B N     1 
ATOM   9124  C  CA    . LEU B 1 561 ? 57.267  46.232  66.760  1.00 76.42  ? 561 LEU B CA    1 
ATOM   9125  C  C     . LEU B 1 561 ? 57.584  44.913  67.455  1.00 72.65  ? 561 LEU B C     1 
ATOM   9126  O  O     . LEU B 1 561 ? 57.997  44.900  68.612  1.00 76.40  ? 561 LEU B O     1 
ATOM   9127  C  CB    . LEU B 1 561 ? 55.777  46.550  66.894  1.00 75.86  ? 561 LEU B CB    1 
ATOM   9128  C  CG    . LEU B 1 561 ? 55.393  48.011  66.653  1.00 73.78  ? 561 LEU B CG    1 
ATOM   9129  C  CD1   . LEU B 1 561 ? 53.877  48.162  66.538  1.00 73.00  ? 561 LEU B CD1   1 
ATOM   9130  C  CD2   . LEU B 1 561 ? 55.936  48.889  67.769  1.00 63.66  ? 561 LEU B CD2   1 
ATOM   9131  N  N     . ALA B 1 562 ? 57.375  43.809  66.747  1.00 72.95  ? 562 ALA B N     1 
ATOM   9132  C  CA    . ALA B 1 562 ? 57.643  42.482  67.288  1.00 73.56  ? 562 ALA B CA    1 
ATOM   9133  C  C     . ALA B 1 562 ? 59.129  42.295  67.598  1.00 81.06  ? 562 ALA B C     1 
ATOM   9134  O  O     . ALA B 1 562 ? 59.481  41.763  68.654  1.00 82.39  ? 562 ALA B O     1 
ATOM   9135  C  CB    . ALA B 1 562 ? 57.167  41.415  66.326  1.00 70.00  ? 562 ALA B CB    1 
ATOM   9136  N  N     . ARG B 1 563 ? 59.990  42.722  66.671  1.00 78.96  ? 563 ARG B N     1 
ATOM   9137  C  CA    . ARG B 1 563 ? 61.441  42.639  66.862  1.00 79.46  ? 563 ARG B CA    1 
ATOM   9138  C  C     . ARG B 1 563 ? 61.875  43.360  68.126  1.00 85.03  ? 563 ARG B C     1 
ATOM   9139  O  O     . ARG B 1 563 ? 62.806  42.932  68.810  1.00 84.38  ? 563 ARG B O     1 
ATOM   9140  C  CB    . ARG B 1 563 ? 62.196  43.227  65.664  1.00 78.24  ? 563 ARG B CB    1 
ATOM   9141  C  CG    . ARG B 1 563 ? 62.024  42.480  64.352  1.00 80.15  ? 563 ARG B CG    1 
ATOM   9142  C  CD    . ARG B 1 563 ? 62.830  43.145  63.242  1.00 80.42  ? 563 ARG B CD    1 
ATOM   9143  N  NE    . ARG B 1 563 ? 62.194  42.986  61.936  1.00 88.57  ? 563 ARG B NE    1 
ATOM   9144  C  CZ    . ARG B 1 563 ? 62.093  43.949  61.025  1.00 83.01  ? 563 ARG B CZ    1 
ATOM   9145  N  NH1   . ARG B 1 563 ? 62.576  45.159  61.274  1.00 85.13  ? 563 ARG B NH1   1 
ATOM   9146  N  NH2   . ARG B 1 563 ? 61.500  43.700  59.865  1.00 84.29  ? 563 ARG B NH2   1 
ATOM   9147  N  N     . GLU B 1 564 ? 61.191  44.457  68.433  1.00 80.51  ? 564 GLU B N     1 
ATOM   9148  C  CA    . GLU B 1 564 ? 61.525  45.257  69.598  1.00 79.11  ? 564 GLU B CA    1 
ATOM   9149  C  C     . GLU B 1 564 ? 60.889  44.696  70.865  1.00 78.03  ? 564 GLU B C     1 
ATOM   9150  O  O     . GLU B 1 564 ? 61.113  45.215  71.959  1.00 83.36  ? 564 GLU B O     1 
ATOM   9151  C  CB    . GLU B 1 564 ? 61.076  46.699  69.398  1.00 79.17  ? 564 GLU B CB    1 
ATOM   9152  C  CG    . GLU B 1 564 ? 62.013  47.706  70.001  1.00 87.23  ? 564 GLU B CG    1 
ATOM   9153  C  CD    . GLU B 1 564 ? 63.297  47.841  69.216  1.00 87.25  ? 564 GLU B CD    1 
ATOM   9154  O  OE1   . GLU B 1 564 ? 63.225  47.888  67.968  1.00 86.59  ? 564 GLU B OE1   1 
ATOM   9155  O  OE2   . GLU B 1 564 ? 64.373  47.896  69.847  1.00 87.24  ? 564 GLU B OE2   1 
ATOM   9156  N  N     . GLY B 1 565 ? 60.082  43.651  70.711  1.00 73.98  ? 565 GLY B N     1 
ATOM   9157  C  CA    . GLY B 1 565 ? 59.384  43.049  71.833  1.00 76.50  ? 565 GLY B CA    1 
ATOM   9158  C  C     . GLY B 1 565 ? 58.228  43.886  72.357  1.00 84.33  ? 565 GLY B C     1 
ATOM   9159  O  O     . GLY B 1 565 ? 57.655  43.566  73.399  1.00 88.29  ? 565 GLY B O     1 
ATOM   9160  N  N     . ILE B 1 566 ? 57.872  44.940  71.625  1.00 79.13  ? 566 ILE B N     1 
ATOM   9161  C  CA    . ILE B 1 566 ? 56.735  45.796  71.979  1.00 82.42  ? 566 ILE B CA    1 
ATOM   9162  C  C     . ILE B 1 566 ? 55.418  45.172  71.536  1.00 73.78  ? 566 ILE B C     1 
ATOM   9163  O  O     . ILE B 1 566 ? 55.243  44.864  70.356  1.00 75.61  ? 566 ILE B O     1 
ATOM   9164  C  CB    . ILE B 1 566 ? 56.841  47.181  71.322  1.00 77.90  ? 566 ILE B CB    1 
ATOM   9165  C  CG1   . ILE B 1 566 ? 58.227  47.787  71.539  1.00 77.57  ? 566 ILE B CG1   1 
ATOM   9166  C  CG2   . ILE B 1 566 ? 55.728  48.094  71.816  1.00 77.78  ? 566 ILE B CG2   1 
ATOM   9167  C  CD1   . ILE B 1 566 ? 58.428  49.081  70.785  1.00 79.98  ? 566 ILE B CD1   1 
ATOM   9168  N  N     . ALA B 1 567 ? 54.473  45.019  72.457  1.00 74.34  ? 567 ALA B N     1 
ATOM   9169  C  CA    . ALA B 1 567 ? 53.190  44.430  72.081  1.00 77.67  ? 567 ALA B CA    1 
ATOM   9170  C  C     . ALA B 1 567 ? 52.267  45.476  71.467  1.00 71.60  ? 567 ALA B C     1 
ATOM   9171  O  O     . ALA B 1 567 ? 52.470  46.680  71.633  1.00 72.49  ? 567 ALA B O     1 
ATOM   9172  C  CB    . ALA B 1 567 ? 52.530  43.779  73.287  1.00 20.00  ? 567 ALA B CB    1 
ATOM   9173  N  N     . TYR B 1 568 ? 51.250  45.007  70.755  1.00 75.86  ? 568 TYR B N     1 
ATOM   9174  C  CA    . TYR B 1 568 ? 50.410  45.907  69.980  1.00 75.13  ? 568 TYR B CA    1 
ATOM   9175  C  C     . TYR B 1 568 ? 48.992  45.391  69.741  1.00 70.09  ? 568 TYR B C     1 
ATOM   9176  O  O     . TYR B 1 568 ? 48.709  44.200  69.887  1.00 66.64  ? 568 TYR B O     1 
ATOM   9177  C  CB    . TYR B 1 568 ? 51.065  46.195  68.625  1.00 70.63  ? 568 TYR B CB    1 
ATOM   9178  C  CG    . TYR B 1 568 ? 51.392  44.958  67.815  1.00 71.30  ? 568 TYR B CG    1 
ATOM   9179  C  CD1   . TYR B 1 568 ? 50.412  44.310  67.073  1.00 71.19  ? 568 TYR B CD1   1 
ATOM   9180  C  CD2   . TYR B 1 568 ? 52.685  44.464  67.761  1.00 76.78  ? 568 TYR B CD2   1 
ATOM   9181  C  CE1   . TYR B 1 568 ? 50.704  43.191  66.326  1.00 77.98  ? 568 TYR B CE1   1 
ATOM   9182  C  CE2   . TYR B 1 568 ? 52.991  43.343  67.009  1.00 76.27  ? 568 TYR B CE2   1 
ATOM   9183  C  CZ    . TYR B 1 568 ? 51.998  42.714  66.291  1.00 77.97  ? 568 TYR B CZ    1 
ATOM   9184  O  OH    . TYR B 1 568 ? 52.294  41.602  65.540  1.00 81.52  ? 568 TYR B OH    1 
ATOM   9185  N  N     . ASP B 1 569 ? 48.109  46.321  69.384  1.00 72.04  ? 569 ASP B N     1 
ATOM   9186  C  CA    . ASP B 1 569 ? 46.812  45.997  68.812  1.00 67.65  ? 569 ASP B CA    1 
ATOM   9187  C  C     . ASP B 1 569 ? 46.535  46.869  67.588  1.00 67.72  ? 569 ASP B C     1 
ATOM   9188  O  O     . ASP B 1 569 ? 46.862  48.062  67.572  1.00 66.32  ? 569 ASP B O     1 
ATOM   9189  C  CB    . ASP B 1 569 ? 45.699  46.173  69.843  1.00 63.56  ? 569 ASP B CB    1 
ATOM   9190  C  CG    . ASP B 1 569 ? 45.757  45.142  70.937  1.00 67.80  ? 569 ASP B CG    1 
ATOM   9191  O  OD1   . ASP B 1 569 ? 45.297  44.003  70.710  1.00 69.45  ? 569 ASP B OD1   1 
ATOM   9192  O  OD2   . ASP B 1 569 ? 46.256  45.476  72.031  1.00 70.22  ? 569 ASP B OD2   1 
ATOM   9193  N  N     . LEU B 1 570 ? 45.933  46.263  66.570  1.00 66.15  ? 570 LEU B N     1 
ATOM   9194  C  CA    . LEU B 1 570 ? 45.513  46.981  65.372  1.00 64.85  ? 570 LEU B CA    1 
ATOM   9195  C  C     . LEU B 1 570 ? 44.009  47.034  65.362  1.00 59.67  ? 570 LEU B C     1 
ATOM   9196  O  O     . LEU B 1 570 ? 43.367  45.993  65.315  1.00 61.23  ? 570 LEU B O     1 
ATOM   9197  C  CB    . LEU B 1 570 ? 45.958  46.286  64.084  1.00 65.11  ? 570 LEU B CB    1 
ATOM   9198  C  CG    . LEU B 1 570 ? 46.696  47.087  63.018  1.00 62.11  ? 570 LEU B CG    1 
ATOM   9199  C  CD1   . LEU B 1 570 ? 46.943  46.208  61.802  1.00 67.85  ? 570 LEU B CD1   1 
ATOM   9200  C  CD2   . LEU B 1 570 ? 45.993  48.352  62.660  1.00 59.55  ? 570 LEU B CD2   1 
ATOM   9201  N  N     . VAL B 1 571 ? 43.441  48.232  65.388  1.00 62.35  ? 571 VAL B N     1 
ATOM   9202  C  CA    . VAL B 1 571 ? 41.994  48.356  65.303  1.00 62.99  ? 571 VAL B CA    1 
ATOM   9203  C  C     . VAL B 1 571 ? 41.634  49.246  64.128  1.00 57.25  ? 571 VAL B C     1 
ATOM   9204  O  O     . VAL B 1 571 ? 42.151  50.356  63.991  1.00 59.03  ? 571 VAL B O     1 
ATOM   9205  C  CB    . VAL B 1 571 ? 41.370  48.933  66.590  1.00 57.92  ? 571 VAL B CB    1 
ATOM   9206  C  CG1   . VAL B 1 571 ? 39.856  49.040  66.435  1.00 56.09  ? 571 VAL B CG1   1 
ATOM   9207  C  CG2   . VAL B 1 571 ? 41.722  48.075  67.790  1.00 60.44  ? 571 VAL B CG2   1 
ATOM   9208  N  N     . SER B 1 572 ? 40.774  48.734  63.258  1.00 60.05  ? 572 SER B N     1 
ATOM   9209  C  CA    . SER B 1 572 ? 40.264  49.532  62.156  1.00 62.40  ? 572 SER B CA    1 
ATOM   9210  C  C     . SER B 1 572 ? 39.008  50.265  62.637  1.00 58.35  ? 572 SER B C     1 
ATOM   9211  O  O     . SER B 1 572 ? 38.103  49.650  63.211  1.00 56.88  ? 572 SER B O     1 
ATOM   9212  C  CB    . SER B 1 572 ? 39.966  48.645  60.946  1.00 58.73  ? 572 SER B CB    1 
ATOM   9213  O  OG    . SER B 1 572 ? 39.620  49.429  59.820  1.00 71.06  ? 572 SER B OG    1 
ATOM   9214  N  N     . VAL B 1 573 ? 38.962  51.576  62.416  1.00 52.88  ? 573 VAL B N     1 
ATOM   9215  C  CA    . VAL B 1 573 ? 37.848  52.385  62.889  1.00 57.22  ? 573 VAL B CA    1 
ATOM   9216  C  C     . VAL B 1 573 ? 37.155  53.063  61.710  1.00 62.46  ? 573 VAL B C     1 
ATOM   9217  O  O     . VAL B 1 573 ? 37.691  53.997  61.107  1.00 61.02  ? 573 VAL B O     1 
ATOM   9218  C  CB    . VAL B 1 573 ? 38.315  53.448  63.906  1.00 51.92  ? 573 VAL B CB    1 
ATOM   9219  C  CG1   . VAL B 1 573 ? 37.139  54.258  64.408  1.00 49.34  ? 573 VAL B CG1   1 
ATOM   9220  C  CG2   . VAL B 1 573 ? 39.037  52.782  65.078  1.00 56.38  ? 573 VAL B CG2   1 
ATOM   9221  N  N     . ARG B 1 574 ? 35.957  52.584  61.395  1.00 56.08  ? 574 ARG B N     1 
ATOM   9222  C  CA    . ARG B 1 574 ? 35.187  53.065  60.248  1.00 60.19  ? 574 ARG B CA    1 
ATOM   9223  C  C     . ARG B 1 574 ? 34.100  54.058  60.660  1.00 52.94  ? 574 ARG B C     1 
ATOM   9224  O  O     . ARG B 1 574 ? 33.228  53.742  61.492  1.00 54.94  ? 574 ARG B O     1 
ATOM   9225  C  CB    . ARG B 1 574 ? 34.542  51.883  59.514  1.00 60.46  ? 574 ARG B CB    1 
ATOM   9226  C  CG    . ARG B 1 574 ? 35.518  50.890  58.929  1.00 63.20  ? 574 ARG B CG    1 
ATOM   9227  C  CD    . ARG B 1 574 ? 35.016  49.463  59.126  1.00 72.98  ? 574 ARG B CD    1 
ATOM   9228  N  NE    . ARG B 1 574 ? 36.114  48.494  59.129  1.00 77.02  ? 574 ARG B NE    1 
ATOM   9229  C  CZ    . ARG B 1 574 ? 36.556  47.855  58.048  1.00 79.78  ? 574 ARG B CZ    1 
ATOM   9230  N  NH1   . ARG B 1 574 ? 35.995  48.072  56.864  1.00 83.93  ? 574 ARG B NH1   1 
ATOM   9231  N  NH2   . ARG B 1 574 ? 37.559  46.996  58.151  1.00 76.74  ? 574 ARG B NH2   1 
ATOM   9232  N  N     . LYS B 1 575 ? 34.139  55.235  60.044  1.00 52.24  ? 575 LYS B N     1 
ATOM   9233  C  CA    . LYS B 1 575 ? 33.188  56.301  60.319  1.00 64.19  ? 575 LYS B CA    1 
ATOM   9234  C  C     . LYS B 1 575 ? 31.813  55.979  59.751  1.00 59.46  ? 575 LYS B C     1 
ATOM   9235  O  O     . LYS B 1 575 ? 30.804  56.512  60.202  1.00 67.34  ? 575 LYS B O     1 
ATOM   9236  C  CB    . LYS B 1 575 ? 33.661  57.620  59.713  1.00 67.05  ? 575 LYS B CB    1 
ATOM   9237  C  CG    . LYS B 1 575 ? 35.019  58.109  60.153  1.00 68.00  ? 575 LYS B CG    1 
ATOM   9238  C  CD    . LYS B 1 575 ? 35.345  59.365  59.356  1.00 71.53  ? 575 LYS B CD    1 
ATOM   9239  C  CE    . LYS B 1 575 ? 36.712  59.917  59.675  1.00 67.81  ? 575 LYS B CE    1 
ATOM   9240  N  NZ    . LYS B 1 575 ? 36.940  61.184  58.921  1.00 69.98  ? 575 LYS B NZ    1 
ATOM   9241  N  N     . SER B 1 576 ? 31.778  55.116  58.748  1.00 57.31  ? 576 SER B N     1 
ATOM   9242  C  CA    . SER B 1 576 ? 30.523  54.778  58.098  1.00 60.47  ? 576 SER B CA    1 
ATOM   9243  C  C     . SER B 1 576 ? 30.385  53.271  58.041  1.00 62.76  ? 576 SER B C     1 
ATOM   9244  O  O     . SER B 1 576 ? 31.383  52.550  58.145  1.00 61.36  ? 576 SER B O     1 
ATOM   9245  C  CB    . SER B 1 576 ? 30.456  55.385  56.696  1.00 60.75  ? 576 SER B CB    1 
ATOM   9246  O  OG    . SER B 1 576 ? 31.317  54.696  55.807  1.00 66.70  ? 576 SER B OG    1 
ATOM   9247  N  N     . GLY B 1 577 ? 29.150  52.800  57.890  1.00 58.66  ? 577 GLY B N     1 
ATOM   9248  C  CA    . GLY B 1 577 ? 28.870  51.377  57.815  1.00 53.93  ? 577 GLY B CA    1 
ATOM   9249  C  C     . GLY B 1 577 ? 28.477  50.785  59.156  1.00 59.07  ? 577 GLY B C     1 
ATOM   9250  O  O     . GLY B 1 577 ? 28.225  49.580  59.259  1.00 53.07  ? 577 GLY B O     1 
ATOM   9251  N  N     . GLY B 1 578 ? 28.434  51.630  60.186  1.00 56.04  ? 578 GLY B N     1 
ATOM   9252  C  CA    . GLY B 1 578 ? 28.059  51.192  61.521  1.00 53.35  ? 578 GLY B CA    1 
ATOM   9253  C  C     . GLY B 1 578 ? 26.553  51.097  61.739  1.00 56.01  ? 578 GLY B C     1 
ATOM   9254  O  O     . GLY B 1 578 ? 26.098  50.573  62.759  1.00 51.26  ? 578 GLY B O     1 
ATOM   9255  N  N     . GLY B 1 579 ? 25.771  51.578  60.774  1.00 52.55  ? 579 GLY B N     1 
ATOM   9256  C  CA    . GLY B 1 579 ? 24.324  51.574  60.914  1.00 55.79  ? 579 GLY B CA    1 
ATOM   9257  C  C     . GLY B 1 579 ? 23.865  52.462  62.056  1.00 58.12  ? 579 GLY B C     1 
ATOM   9258  O  O     . GLY B 1 579 ? 24.454  53.518  62.310  1.00 56.50  ? 579 GLY B O     1 
ATOM   9259  N  N     . ARG B 1 580 ? 22.811  52.042  62.747  1.00 57.48  ? 580 ARG B N     1 
ATOM   9260  C  CA    . ARG B 1 580 ? 22.269  52.830  63.849  1.00 52.32  ? 580 ARG B CA    1 
ATOM   9261  C  C     . ARG B 1 580 ? 22.017  51.953  65.057  1.00 51.29  ? 580 ARG B C     1 
ATOM   9262  O  O     . ARG B 1 580 ? 21.834  50.747  64.933  1.00 55.76  ? 580 ARG B O     1 
ATOM   9263  C  CB    . ARG B 1 580 ? 20.973  53.525  63.445  1.00 53.24  ? 580 ARG B CB    1 
ATOM   9264  C  CG    . ARG B 1 580 ? 21.071  54.346  62.195  1.00 49.16  ? 580 ARG B CG    1 
ATOM   9265  C  CD    . ARG B 1 580 ? 21.720  55.686  62.444  1.00 52.20  ? 580 ARG B CD    1 
ATOM   9266  N  NE    . ARG B 1 580 ? 21.551  56.549  61.280  1.00 50.26  ? 580 ARG B NE    1 
ATOM   9267  C  CZ    . ARG B 1 580 ? 21.830  57.841  61.254  1.00 50.60  ? 580 ARG B CZ    1 
ATOM   9268  N  NH1   . ARG B 1 580 ? 22.310  58.440  62.335  1.00 53.84  ? 580 ARG B NH1   1 
ATOM   9269  N  NH2   . ARG B 1 580 ? 21.621  58.530  60.140  1.00 52.83  ? 580 ARG B NH2   1 
ATOM   9270  N  N     . VAL B 1 581 ? 22.010  52.573  66.228  1.00 57.19  ? 581 VAL B N     1 
ATOM   9271  C  CA    . VAL B 1 581 ? 21.818  51.857  67.475  1.00 57.06  ? 581 VAL B CA    1 
ATOM   9272  C  C     . VAL B 1 581 ? 20.778  52.621  68.293  1.00 57.58  ? 581 VAL B C     1 
ATOM   9273  O  O     . VAL B 1 581 ? 20.911  53.824  68.498  1.00 62.80  ? 581 VAL B O     1 
ATOM   9274  C  CB    . VAL B 1 581 ? 23.140  51.724  68.262  1.00 56.80  ? 581 VAL B CB    1 
ATOM   9275  C  CG1   . VAL B 1 581 ? 22.871  51.466  69.727  1.00 58.31  ? 581 VAL B CG1   1 
ATOM   9276  C  CG2   . VAL B 1 581 ? 23.995  50.602  67.684  1.00 62.34  ? 581 VAL B CG2   1 
ATOM   9277  N  N     . TYR B 1 582 ? 19.734  51.921  68.728  1.00 59.39  ? 582 TYR B N     1 
ATOM   9278  C  CA    . TYR B 1 582 ? 18.650  52.511  69.512  1.00 62.88  ? 582 TYR B CA    1 
ATOM   9279  C  C     . TYR B 1 582 ? 18.473  51.776  70.825  1.00 60.98  ? 582 TYR B C     1 
ATOM   9280  O  O     . TYR B 1 582 ? 18.712  50.579  70.893  1.00 65.42  ? 582 TYR B O     1 
ATOM   9281  C  CB    . TYR B 1 582 ? 17.330  52.497  68.734  1.00 60.45  ? 582 TYR B CB    1 
ATOM   9282  C  CG    . TYR B 1 582 ? 17.379  53.245  67.433  1.00 57.72  ? 582 TYR B CG    1 
ATOM   9283  C  CD1   . TYR B 1 582 ? 17.397  54.630  67.416  1.00 53.31  ? 582 TYR B CD1   1 
ATOM   9284  C  CD2   . TYR B 1 582 ? 17.401  52.572  66.223  1.00 54.88  ? 582 TYR B CD2   1 
ATOM   9285  C  CE1   . TYR B 1 582 ? 17.437  55.326  66.231  1.00 51.95  ? 582 TYR B CE1   1 
ATOM   9286  C  CE2   . TYR B 1 582 ? 17.445  53.263  65.031  1.00 51.79  ? 582 TYR B CE2   1 
ATOM   9287  C  CZ    . TYR B 1 582 ? 17.464  54.634  65.042  1.00 52.42  ? 582 TYR B CZ    1 
ATOM   9288  O  OH    . TYR B 1 582 ? 17.510  55.324  63.853  1.00 58.21  ? 582 TYR B OH    1 
ATOM   9289  N  N     . PRO B 1 583 ? 18.068  52.496  71.883  1.00 66.01  ? 583 PRO B N     1 
ATOM   9290  C  CA    . PRO B 1 583 ? 17.790  51.796  73.141  1.00 72.99  ? 583 PRO B CA    1 
ATOM   9291  C  C     . PRO B 1 583 ? 16.531  50.939  73.006  1.00 73.28  ? 583 PRO B C     1 
ATOM   9292  O  O     . PRO B 1 583 ? 15.643  51.294  72.227  1.00 65.67  ? 583 PRO B O     1 
ATOM   9293  C  CB    . PRO B 1 583 ? 17.573  52.934  74.152  1.00 70.41  ? 583 PRO B CB    1 
ATOM   9294  C  CG    . PRO B 1 583 ? 17.902  54.211  73.424  1.00 69.81  ? 583 PRO B CG    1 
ATOM   9295  C  CD    . PRO B 1 583 ? 17.747  53.929  71.967  1.00 65.13  ? 583 PRO B CD    1 
ATOM   9296  N  N     . VAL B 1 584 ? 16.468  49.825  73.727  1.00 73.57  ? 584 VAL B N     1 
ATOM   9297  C  CA    . VAL B 1 584 ? 15.248  49.031  73.764  1.00 80.40  ? 584 VAL B CA    1 
ATOM   9298  C  C     . VAL B 1 584 ? 14.178  49.846  74.488  1.00 81.98  ? 584 VAL B C     1 
ATOM   9299  O  O     . VAL B 1 584 ? 13.070  50.043  73.981  1.00 82.01  ? 584 VAL B O     1 
ATOM   9300  C  CB    . VAL B 1 584 ? 15.465  47.670  74.478  1.00 86.02  ? 584 VAL B CB    1 
ATOM   9301  C  CG1   . VAL B 1 584 ? 14.135  46.993  74.774  1.00 93.26  ? 584 VAL B CG1   1 
ATOM   9302  C  CG2   . VAL B 1 584 ? 16.355  46.756  73.645  1.00 81.45  ? 584 VAL B CG2   1 
ATOM   9303  N  N     . GLN B 1 585 ? 14.533  50.321  75.677  1.00 81.23  ? 585 GLN B N     1 
ATOM   9304  C  CA    . GLN B 1 585 ? 13.697  51.227  76.448  1.00 78.39  ? 585 GLN B CA    1 
ATOM   9305  C  C     . GLN B 1 585 ? 14.564  52.303  77.091  1.00 75.33  ? 585 GLN B C     1 
ATOM   9306  O  O     . GLN B 1 585 ? 15.763  52.110  77.286  1.00 74.75  ? 585 GLN B O     1 
ATOM   9307  C  CB    . GLN B 1 585 ? 12.917  50.466  77.507  1.00 80.51  ? 585 GLN B CB    1 
ATOM   9308  N  N     . GLY B 1 586 ? 13.966  53.442  77.412  1.00 76.24  ? 586 GLY B N     1 
ATOM   9309  C  CA    . GLY B 1 586 ? 14.699  54.480  78.107  1.00 78.30  ? 586 GLY B CA    1 
ATOM   9310  C  C     . GLY B 1 586 ? 15.422  55.432  77.177  1.00 79.69  ? 586 GLY B C     1 
ATOM   9311  O  O     . GLY B 1 586 ? 15.092  55.541  75.997  1.00 77.49  ? 586 GLY B O     1 
ATOM   9312  N  N     . ARG B 1 587 ? 16.398  56.143  77.727  1.00 80.38  ? 587 ARG B N     1 
ATOM   9313  C  CA    . ARG B 1 587 ? 17.118  57.173  76.991  1.00 82.38  ? 587 ARG B CA    1 
ATOM   9314  C  C     . ARG B 1 587 ? 18.367  56.624  76.308  1.00 77.96  ? 587 ARG B C     1 
ATOM   9315  O  O     . ARG B 1 587 ? 18.915  55.598  76.718  1.00 71.48  ? 587 ARG B O     1 
ATOM   9316  C  CB    . ARG B 1 587 ? 17.483  58.314  77.935  1.00 89.07  ? 587 ARG B CB    1 
ATOM   9317  C  CG    . ARG B 1 587 ? 16.263  59.003  78.524  1.00 96.32  ? 587 ARG B CG    1 
ATOM   9318  C  CD    . ARG B 1 587 ? 16.642  59.888  79.692  1.00 106.88 ? 587 ARG B CD    1 
ATOM   9319  N  NE    . ARG B 1 587 ? 17.121  59.067  80.801  1.00 109.58 ? 587 ARG B NE    1 
ATOM   9320  C  CZ    . ARG B 1 587 ? 16.405  58.768  81.881  1.00 109.43 ? 587 ARG B CZ    1 
ATOM   9321  N  NH1   . ARG B 1 587 ? 15.164  59.220  82.007  1.00 108.55 ? 587 ARG B NH1   1 
ATOM   9322  N  NH2   . ARG B 1 587 ? 16.930  58.009  82.833  1.00 113.49 ? 587 ARG B NH2   1 
ATOM   9323  N  N     . LEU B 1 588 ? 18.804  57.319  75.263  1.00 78.59  ? 588 LEU B N     1 
ATOM   9324  C  CA    . LEU B 1 588 ? 20.017  56.961  74.532  1.00 72.41  ? 588 LEU B CA    1 
ATOM   9325  C  C     . LEU B 1 588 ? 21.237  57.599  75.174  1.00 68.13  ? 588 LEU B C     1 
ATOM   9326  O  O     . LEU B 1 588 ? 21.282  58.813  75.364  1.00 69.44  ? 588 LEU B O     1 
ATOM   9327  C  CB    . LEU B 1 588 ? 19.903  57.393  73.069  1.00 70.84  ? 588 LEU B CB    1 
ATOM   9328  C  CG    . LEU B 1 588 ? 21.117  57.188  72.165  1.00 64.43  ? 588 LEU B CG    1 
ATOM   9329  C  CD1   . LEU B 1 588 ? 21.568  55.747  72.201  1.00 66.66  ? 588 LEU B CD1   1 
ATOM   9330  C  CD2   . LEU B 1 588 ? 20.767  57.592  70.752  1.00 61.42  ? 588 LEU B CD2   1 
ATOM   9331  N  N     . ALA B 1 589 ? 22.228  56.784  75.508  1.00 70.66  ? 589 ALA B N     1 
ATOM   9332  C  CA    . ALA B 1 589 ? 23.403  57.305  76.187  1.00 71.74  ? 589 ALA B CA    1 
ATOM   9333  C  C     . ALA B 1 589 ? 24.709  56.961  75.470  1.00 69.01  ? 589 ALA B C     1 
ATOM   9334  O  O     . ALA B 1 589 ? 24.780  56.024  74.668  1.00 69.27  ? 589 ALA B O     1 
ATOM   9335  C  CB    . ALA B 1 589 ? 23.446  56.791  77.622  1.00 70.93  ? 589 ALA B CB    1 
ATOM   9336  N  N     . ASP B 1 590 ? 25.735  57.746  75.782  1.00 67.13  ? 590 ASP B N     1 
ATOM   9337  C  CA    . ASP B 1 590 ? 27.082  57.576  75.254  1.00 63.65  ? 590 ASP B CA    1 
ATOM   9338  C  C     . ASP B 1 590 ? 27.799  56.357  75.788  1.00 65.97  ? 590 ASP B C     1 
ATOM   9339  O  O     . ASP B 1 590 ? 27.306  55.683  76.696  1.00 67.87  ? 590 ASP B O     1 
ATOM   9340  C  CB    . ASP B 1 590 ? 27.911  58.821  75.558  1.00 59.11  ? 590 ASP B CB    1 
ATOM   9341  C  CG    . ASP B 1 590 ? 27.769  59.837  74.490  1.00 58.37  ? 590 ASP B CG    1 
ATOM   9342  O  OD1   . ASP B 1 590 ? 27.311  59.418  73.410  1.00 66.10  ? 590 ASP B OD1   1 
ATOM   9343  O  OD2   . ASP B 1 590 ? 28.066  61.025  74.711  1.00 54.75  ? 590 ASP B OD2   1 
ATOM   9344  N  N     . GLY B 1 591 ? 28.961  56.078  75.201  1.00 61.66  ? 591 GLY B N     1 
ATOM   9345  C  CA    . GLY B 1 591 ? 29.821  55.015  75.668  1.00 61.40  ? 591 GLY B CA    1 
ATOM   9346  C  C     . GLY B 1 591 ? 29.133  53.679  75.573  1.00 62.55  ? 591 GLY B C     1 
ATOM   9347  O  O     . GLY B 1 591 ? 29.118  52.912  76.538  1.00 66.65  ? 591 GLY B O     1 
ATOM   9348  N  N     . LEU B 1 592 ? 28.575  53.387  74.404  1.00 66.79  ? 592 LEU B N     1 
ATOM   9349  C  CA    . LEU B 1 592 ? 27.914  52.102  74.207  1.00 66.95  ? 592 LEU B CA    1 
ATOM   9350  C  C     . LEU B 1 592 ? 28.807  51.199  73.384  1.00 66.19  ? 592 LEU B C     1 
ATOM   9351  O  O     . LEU B 1 592 ? 29.247  51.564  72.299  1.00 63.93  ? 592 LEU B O     1 
ATOM   9352  C  CB    . LEU B 1 592 ? 26.558  52.282  73.524  1.00 67.02  ? 592 LEU B CB    1 
ATOM   9353  C  CG    . LEU B 1 592 ? 25.306  52.076  74.379  1.00 72.14  ? 592 LEU B CG    1 
ATOM   9354  C  CD1   . LEU B 1 592 ? 25.423  52.827  75.696  1.00 74.54  ? 592 LEU B CD1   1 
ATOM   9355  C  CD2   . LEU B 1 592 ? 24.067  52.529  73.616  1.00 67.23  ? 592 LEU B CD2   1 
ATOM   9356  N  N     . TYR B 1 593 ? 29.066  50.010  73.908  1.00 68.07  ? 593 TYR B N     1 
ATOM   9357  C  CA    . TYR B 1 593 ? 29.906  49.039  73.227  1.00 69.06  ? 593 TYR B CA    1 
ATOM   9358  C  C     . TYR B 1 593 ? 29.039  47.857  72.807  1.00 72.95  ? 593 TYR B C     1 
ATOM   9359  O  O     . TYR B 1 593 ? 28.412  47.213  73.649  1.00 73.54  ? 593 TYR B O     1 
ATOM   9360  C  CB    . TYR B 1 593 ? 31.057  48.630  74.152  1.00 65.62  ? 593 TYR B CB    1 
ATOM   9361  C  CG    . TYR B 1 593 ? 31.670  47.271  73.922  1.00 74.20  ? 593 TYR B CG    1 
ATOM   9362  C  CD1   . TYR B 1 593 ? 32.317  46.960  72.736  1.00 73.45  ? 593 TYR B CD1   1 
ATOM   9363  C  CD2   . TYR B 1 593 ? 31.628  46.305  74.917  1.00 77.87  ? 593 TYR B CD2   1 
ATOM   9364  C  CE1   . TYR B 1 593 ? 32.893  45.715  72.542  1.00 70.49  ? 593 TYR B CE1   1 
ATOM   9365  C  CE2   . TYR B 1 593 ? 32.188  45.063  74.729  1.00 77.84  ? 593 TYR B CE2   1 
ATOM   9366  C  CZ    . TYR B 1 593 ? 32.823  44.771  73.544  1.00 77.31  ? 593 TYR B CZ    1 
ATOM   9367  O  OH    . TYR B 1 593 ? 33.384  43.526  73.363  1.00 77.41  ? 593 TYR B OH    1 
ATOM   9368  N  N     . VAL B 1 594 ? 29.004  47.579  71.503  1.00 67.43  ? 594 VAL B N     1 
ATOM   9369  C  CA    . VAL B 1 594 ? 28.068  46.601  70.958  1.00 69.02  ? 594 VAL B CA    1 
ATOM   9370  C  C     . VAL B 1 594 ? 28.768  45.511  70.143  1.00 67.44  ? 594 VAL B C     1 
ATOM   9371  O  O     . VAL B 1 594 ? 29.008  45.673  68.950  1.00 62.31  ? 594 VAL B O     1 
ATOM   9372  C  CB    . VAL B 1 594 ? 27.005  47.288  70.056  1.00 67.42  ? 594 VAL B CB    1 
ATOM   9373  C  CG1   . VAL B 1 594 ? 25.945  46.283  69.619  1.00 66.85  ? 594 VAL B CG1   1 
ATOM   9374  C  CG2   . VAL B 1 594 ? 26.362  48.472  70.771  1.00 59.13  ? 594 VAL B CG2   1 
ATOM   9375  N  N     . PRO B 1 595 ? 29.080  44.377  70.783  1.00 72.44  ? 595 PRO B N     1 
ATOM   9376  C  CA    . PRO B 1 595 ? 29.746  43.281  70.069  1.00 72.67  ? 595 PRO B CA    1 
ATOM   9377  C  C     . PRO B 1 595 ? 28.901  42.723  68.925  1.00 76.12  ? 595 PRO B C     1 
ATOM   9378  O  O     . PRO B 1 595 ? 27.698  42.514  69.095  1.00 77.47  ? 595 PRO B O     1 
ATOM   9379  C  CB    . PRO B 1 595 ? 29.937  42.219  71.156  1.00 72.70  ? 595 PRO B CB    1 
ATOM   9380  C  CG    . PRO B 1 595 ? 29.895  42.971  72.439  1.00 74.36  ? 595 PRO B CG    1 
ATOM   9381  C  CD    . PRO B 1 595 ? 28.924  44.089  72.219  1.00 74.77  ? 595 PRO B CD    1 
ATOM   9382  N  N     . LEU B 1 596 ? 29.519  42.513  67.766  1.00 77.43  ? 596 LEU B N     1 
ATOM   9383  C  CA    . LEU B 1 596 ? 28.826  41.899  66.637  1.00 79.06  ? 596 LEU B CA    1 
ATOM   9384  C  C     . LEU B 1 596 ? 29.518  40.585  66.297  1.00 80.76  ? 596 LEU B C     1 
ATOM   9385  O  O     . LEU B 1 596 ? 29.943  39.861  67.199  1.00 82.39  ? 596 LEU B O     1 
ATOM   9386  C  CB    . LEU B 1 596 ? 28.798  42.833  65.424  1.00 76.29  ? 596 LEU B CB    1 
ATOM   9387  C  CG    . LEU B 1 596 ? 28.165  44.213  65.625  1.00 74.39  ? 596 LEU B CG    1 
ATOM   9388  C  CD1   . LEU B 1 596 ? 28.272  45.049  64.355  1.00 71.71  ? 596 LEU B CD1   1 
ATOM   9389  C  CD2   . LEU B 1 596 ? 26.715  44.088  66.065  1.00 74.86  ? 596 LEU B CD2   1 
ATOM   9390  N  N     . GLU B 1 597 ? 29.649  40.273  65.010  1.00 82.30  ? 597 GLU B N     1 
ATOM   9391  C  CA    . GLU B 1 597 ? 30.352  39.052  64.621  1.00 82.60  ? 597 GLU B CA    1 
ATOM   9392  C  C     . GLU B 1 597 ? 31.808  39.110  65.087  1.00 81.30  ? 597 GLU B C     1 
ATOM   9393  O  O     . GLU B 1 597 ? 32.292  40.166  65.496  1.00 79.73  ? 597 GLU B O     1 
ATOM   9394  C  CB    . GLU B 1 597 ? 30.279  38.813  63.106  1.00 83.00  ? 597 GLU B CB    1 
ATOM   9395  C  CG    . GLU B 1 597 ? 31.043  39.811  62.238  1.00 84.45  ? 597 GLU B CG    1 
ATOM   9396  C  CD    . GLU B 1 597 ? 30.191  40.985  61.784  1.00 88.12  ? 597 GLU B CD    1 
ATOM   9397  O  OE1   . GLU B 1 597 ? 29.096  41.201  62.353  1.00 87.90  ? 597 GLU B OE1   1 
ATOM   9398  O  OE2   . GLU B 1 597 ? 30.616  41.692  60.845  1.00 85.86  ? 597 GLU B OE2   1 
ATOM   9399  N  N     . ASP B 1 598 ? 32.525  38.023  64.931  1.00 83.18  ? 598 ASP B N     1 
ATOM   9400  C  CA    . ASP B 1 598 ? 33.799  37.831  65.574  1.00 81.67  ? 598 ASP B CA    1 
ATOM   9401  C  C     . ASP B 1 598 ? 34.779  38.968  65.279  1.00 86.40  ? 598 ASP B C     1 
ATOM   9402  O  O     . ASP B 1 598 ? 34.929  39.415  64.150  1.00 85.67  ? 598 ASP B O     1 
ATOM   9403  C  CB    . ASP B 1 598 ? 34.348  36.507  65.051  1.00 85.17  ? 598 ASP B CB    1 
ATOM   9404  C  CG    . ASP B 1 598 ? 35.626  36.094  65.707  1.00 93.83  ? 598 ASP B CG    1 
ATOM   9405  O  OD1   . ASP B 1 598 ? 35.796  36.327  66.915  1.00 93.82  ? 598 ASP B OD1   1 
ATOM   9406  O  OD2   . ASP B 1 598 ? 36.464  35.505  65.008  1.00 95.98  ? 598 ASP B OD2   1 
ATOM   9407  N  N     . LYS B 1 599 ? 35.435  39.432  66.332  1.00 81.74  ? 599 LYS B N     1 
ATOM   9408  C  CA    . LYS B 1 599 ? 36.441  40.497  66.273  1.00 80.08  ? 599 LYS B CA    1 
ATOM   9409  C  C     . LYS B 1 599 ? 35.914  41.863  65.821  1.00 77.13  ? 599 LYS B C     1 
ATOM   9410  O  O     . LYS B 1 599 ? 36.688  42.815  65.692  1.00 72.24  ? 599 LYS B O     1 
ATOM   9411  C  CB    . LYS B 1 599 ? 37.597  40.083  65.354  1.00 79.39  ? 599 LYS B CB    1 
ATOM   9412  C  CG    . LYS B 1 599 ? 38.402  38.883  65.842  1.00 87.52  ? 599 LYS B CG    1 
ATOM   9413  C  CD    . LYS B 1 599 ? 39.279  39.258  67.037  1.00 87.63  ? 599 LYS B CD    1 
ATOM   9414  C  CE    . LYS B 1 599 ? 40.480  38.324  67.164  1.00 89.94  ? 599 LYS B CE    1 
ATOM   9415  N  NZ    . LYS B 1 599 ? 41.339  38.645  68.343  1.00 87.51  ? 599 LYS B NZ    1 
ATOM   9416  N  N     . THR B 1 600 ? 34.610  41.976  65.601  1.00 74.90  ? 600 THR B N     1 
ATOM   9417  C  CA    . THR B 1 600 ? 34.042  43.252  65.187  1.00 72.25  ? 600 THR B CA    1 
ATOM   9418  C  C     . THR B 1 600 ? 33.020  43.742  66.200  1.00 70.87  ? 600 THR B C     1 
ATOM   9419  O  O     . THR B 1 600 ? 32.282  42.949  66.779  1.00 74.87  ? 600 THR B O     1 
ATOM   9420  C  CB    . THR B 1 600 ? 33.380  43.155  63.804  1.00 74.37  ? 600 THR B CB    1 
ATOM   9421  O  OG1   . THR B 1 600 ? 32.174  42.391  63.903  1.00 82.75  ? 600 THR B OG1   1 
ATOM   9422  C  CG2   . THR B 1 600 ? 34.318  42.479  62.823  1.00 76.02  ? 600 THR B CG2   1 
ATOM   9423  N  N     . PHE B 1 601 ? 32.981  45.052  66.417  1.00 67.75  ? 601 PHE B N     1 
ATOM   9424  C  CA    . PHE B 1 601 ? 31.984  45.622  67.315  1.00 65.36  ? 601 PHE B CA    1 
ATOM   9425  C  C     . PHE B 1 601 ? 31.620  47.043  66.918  1.00 62.96  ? 601 PHE B C     1 
ATOM   9426  O  O     . PHE B 1 601 ? 32.304  47.662  66.116  1.00 60.01  ? 601 PHE B O     1 
ATOM   9427  C  CB    . PHE B 1 601 ? 32.477  45.608  68.765  1.00 65.46  ? 601 PHE B CB    1 
ATOM   9428  C  CG    . PHE B 1 601 ? 33.703  46.458  69.010  1.00 67.12  ? 601 PHE B CG    1 
ATOM   9429  C  CD1   . PHE B 1 601 ? 34.976  45.959  68.762  1.00 64.59  ? 601 PHE B CD1   1 
ATOM   9430  C  CD2   . PHE B 1 601 ? 33.578  47.749  69.506  1.00 61.99  ? 601 PHE B CD2   1 
ATOM   9431  C  CE1   . PHE B 1 601 ? 36.100  46.731  68.998  1.00 62.91  ? 601 PHE B CE1   1 
ATOM   9432  C  CE2   . PHE B 1 601 ? 34.695  48.527  69.745  1.00 63.75  ? 601 PHE B CE2   1 
ATOM   9433  C  CZ    . PHE B 1 601 ? 35.962  48.016  69.493  1.00 65.51  ? 601 PHE B CZ    1 
ATOM   9434  N  N     . LEU B 1 602 ? 30.531  47.547  67.483  1.00 61.63  ? 602 LEU B N     1 
ATOM   9435  C  CA    . LEU B 1 602 ? 30.111  48.925  67.289  1.00 59.55  ? 602 LEU B CA    1 
ATOM   9436  C  C     . LEU B 1 602 ? 30.478  49.725  68.528  1.00 56.47  ? 602 LEU B C     1 
ATOM   9437  O  O     . LEU B 1 602 ? 30.587  49.165  69.622  1.00 62.73  ? 602 LEU B O     1 
ATOM   9438  C  CB    . LEU B 1 602 ? 28.605  49.016  67.016  1.00 58.32  ? 602 LEU B CB    1 
ATOM   9439  C  CG    . LEU B 1 602 ? 28.084  48.280  65.781  1.00 63.48  ? 602 LEU B CG    1 
ATOM   9440  C  CD1   . LEU B 1 602 ? 26.573  48.472  65.616  1.00 53.22  ? 602 LEU B CD1   1 
ATOM   9441  C  CD2   . LEU B 1 602 ? 28.830  48.750  64.533  1.00 58.18  ? 602 LEU B CD2   1 
ATOM   9442  N  N     . LEU B 1 603 ? 30.734  51.017  68.349  1.00 55.63  ? 603 LEU B N     1 
ATOM   9443  C  CA    . LEU B 1 603 ? 31.000  51.884  69.487  1.00 53.92  ? 603 LEU B CA    1 
ATOM   9444  C  C     . LEU B 1 603 ? 30.315  53.231  69.325  1.00 56.45  ? 603 LEU B C     1 
ATOM   9445  O  O     . LEU B 1 603 ? 30.679  54.019  68.451  1.00 53.80  ? 603 LEU B O     1 
ATOM   9446  C  CB    . LEU B 1 603 ? 32.504  52.084  69.680  1.00 57.01  ? 603 LEU B CB    1 
ATOM   9447  C  CG    . LEU B 1 603 ? 32.919  52.757  70.989  1.00 58.25  ? 603 LEU B CG    1 
ATOM   9448  C  CD1   . LEU B 1 603 ? 32.525  51.888  72.177  1.00 62.44  ? 603 LEU B CD1   1 
ATOM   9449  C  CD2   . LEU B 1 603 ? 34.415  53.028  70.999  1.00 60.68  ? 603 LEU B CD2   1 
ATOM   9450  N  N     . LEU B 1 604 ? 29.348  53.500  70.195  1.00 56.25  ? 604 LEU B N     1 
ATOM   9451  C  CA    . LEU B 1 604 ? 28.673  54.785  70.238  1.00 54.13  ? 604 LEU B CA    1 
ATOM   9452  C  C     . LEU B 1 604 ? 29.413  55.667  71.222  1.00 58.09  ? 604 LEU B C     1 
ATOM   9453  O  O     . LEU B 1 604 ? 29.302  55.487  72.441  1.00 60.98  ? 604 LEU B O     1 
ATOM   9454  C  CB    . LEU B 1 604 ? 27.213  54.627  70.661  1.00 59.16  ? 604 LEU B CB    1 
ATOM   9455  C  CG    . LEU B 1 604 ? 26.184  55.598  70.088  1.00 59.36  ? 604 LEU B CG    1 
ATOM   9456  C  CD1   . LEU B 1 604 ? 24.792  55.245  70.599  1.00 67.08  ? 604 LEU B CD1   1 
ATOM   9457  C  CD2   . LEU B 1 604 ? 26.525  57.031  70.438  1.00 57.07  ? 604 LEU B CD2   1 
ATOM   9458  N  N     . THR B 1 605 ? 30.153  56.628  70.674  1.00 54.61  ? 605 THR B N     1 
ATOM   9459  C  CA    . THR B 1 605 ? 31.102  57.413  71.436  1.00 48.76  ? 605 THR B CA    1 
ATOM   9460  C  C     . THR B 1 605 ? 30.506  58.754  71.845  1.00 56.45  ? 605 THR B C     1 
ATOM   9461  O  O     . THR B 1 605 ? 30.725  59.217  72.963  1.00 55.50  ? 605 THR B O     1 
ATOM   9462  C  CB    . THR B 1 605 ? 32.402  57.659  70.631  1.00 51.31  ? 605 THR B CB    1 
ATOM   9463  O  OG1   . THR B 1 605 ? 32.118  58.418  69.449  1.00 49.33  ? 605 THR B OG1   1 
ATOM   9464  C  CG2   . THR B 1 605 ? 33.060  56.337  70.239  1.00 51.31  ? 605 THR B CG2   1 
ATOM   9465  N  N     . VAL B 1 606 ? 29.747  59.380  70.947  1.00 51.09  ? 606 VAL B N     1 
ATOM   9466  C  CA    . VAL B 1 606 ? 29.163  60.685  71.244  1.00 50.09  ? 606 VAL B CA    1 
ATOM   9467  C  C     . VAL B 1 606 ? 27.681  60.753  70.884  1.00 54.40  ? 606 VAL B C     1 
ATOM   9468  O  O     . VAL B 1 606 ? 27.227  60.168  69.900  1.00 56.72  ? 606 VAL B O     1 
ATOM   9469  C  CB    . VAL B 1 606 ? 29.904  61.827  70.516  1.00 52.14  ? 606 VAL B CB    1 
ATOM   9470  C  CG1   . VAL B 1 606 ? 31.358  61.952  71.032  1.00 52.71  ? 606 VAL B CG1   1 
ATOM   9471  C  CG2   . VAL B 1 606 ? 29.861  61.627  69.009  1.00 48.81  ? 606 VAL B CG2   1 
ATOM   9472  N  N     . HIS B 1 607 ? 26.924  61.440  71.728  1.00 54.12  ? 607 HIS B N     1 
ATOM   9473  C  CA    . HIS B 1 607 ? 25.522  61.724  71.439  1.00 59.45  ? 607 HIS B CA    1 
ATOM   9474  C  C     . HIS B 1 607 ? 25.028  62.938  72.209  1.00 58.05  ? 607 HIS B C     1 
ATOM   9475  O  O     . HIS B 1 607 ? 25.396  63.160  73.368  1.00 62.56  ? 607 HIS B O     1 
ATOM   9476  C  CB    . HIS B 1 607 ? 24.628  60.522  71.764  1.00 56.64  ? 607 HIS B CB    1 
ATOM   9477  C  CG    . HIS B 1 607 ? 23.173  60.863  71.814  1.00 63.10  ? 607 HIS B CG    1 
ATOM   9478  N  ND1   . HIS B 1 607 ? 22.478  61.319  70.715  1.00 63.23  ? 607 HIS B ND1   1 
ATOM   9479  C  CD2   . HIS B 1 607 ? 22.286  60.845  72.838  1.00 64.22  ? 607 HIS B CD2   1 
ATOM   9480  C  CE1   . HIS B 1 607 ? 21.224  61.554  71.054  1.00 64.15  ? 607 HIS B CE1   1 
ATOM   9481  N  NE2   . HIS B 1 607 ? 21.079  61.272  72.336  1.00 65.42  ? 607 HIS B NE2   1 
ATOM   9482  N  N     . ARG B 1 608 ? 24.166  63.707  71.564  1.00 58.55  ? 608 ARG B N     1 
ATOM   9483  C  CA    . ARG B 1 608 ? 23.525  64.837  72.208  1.00 67.51  ? 608 ARG B CA    1 
ATOM   9484  C  C     . ARG B 1 608 ? 22.085  64.951  71.719  1.00 66.74  ? 608 ARG B C     1 
ATOM   9485  O  O     . ARG B 1 608 ? 21.821  64.826  70.519  1.00 67.20  ? 608 ARG B O     1 
ATOM   9486  C  CB    . ARG B 1 608 ? 24.305  66.121  71.926  1.00 69.41  ? 608 ARG B CB    1 
ATOM   9487  C  CG    . ARG B 1 608 ? 24.769  66.840  73.173  1.00 67.33  ? 608 ARG B CG    1 
ATOM   9488  C  CD    . ARG B 1 608 ? 26.021  66.244  73.757  1.00 65.11  ? 608 ARG B CD    1 
ATOM   9489  N  NE    . ARG B 1 608 ? 26.242  66.745  75.109  1.00 67.51  ? 608 ARG B NE    1 
ATOM   9490  C  CZ    . ARG B 1 608 ? 26.004  66.041  76.210  1.00 64.65  ? 608 ARG B CZ    1 
ATOM   9491  N  NH1   . ARG B 1 608 ? 25.561  64.796  76.113  1.00 57.27  ? 608 ARG B NH1   1 
ATOM   9492  N  NH2   . ARG B 1 608 ? 26.224  66.577  77.406  1.00 67.53  ? 608 ARG B NH2   1 
ATOM   9493  N  N     . ASP B 1 609 ? 21.157  65.154  72.650  1.00 68.90  ? 609 ASP B N     1 
ATOM   9494  C  CA    . ASP B 1 609 ? 19.736  65.204  72.303  1.00 79.08  ? 609 ASP B CA    1 
ATOM   9495  C  C     . ASP B 1 609 ? 19.423  66.282  71.262  1.00 72.25  ? 609 ASP B C     1 
ATOM   9496  O  O     . ASP B 1 609 ? 18.671  66.034  70.320  1.00 76.16  ? 609 ASP B O     1 
ATOM   9497  C  CB    . ASP B 1 609 ? 18.883  65.404  73.559  1.00 76.68  ? 609 ASP B CB    1 
ATOM   9498  C  CG    . ASP B 1 609 ? 18.776  64.134  74.394  1.00 79.55  ? 609 ASP B CG    1 
ATOM   9499  O  OD1   . ASP B 1 609 ? 18.687  63.038  73.796  1.00 75.72  ? 609 ASP B OD1   1 
ATOM   9500  O  OD2   . ASP B 1 609 ? 18.792  64.227  75.642  1.00 85.67  ? 609 ASP B OD2   1 
ATOM   9501  N  N     . PHE B 1 610 ? 20.042  67.453  71.389  1.00 74.06  ? 610 PHE B N     1 
ATOM   9502  C  CA    . PHE B 1 610 ? 19.755  68.549  70.464  1.00 72.51  ? 610 PHE B CA    1 
ATOM   9503  C  C     . PHE B 1 610 ? 20.282  68.251  69.070  1.00 75.10  ? 610 PHE B C     1 
ATOM   9504  O  O     . PHE B 1 610 ? 20.044  69.000  68.125  1.00 78.67  ? 610 PHE B O     1 
ATOM   9505  C  CB    . PHE B 1 610 ? 20.345  69.873  70.967  1.00 79.55  ? 610 PHE B CB    1 
ATOM   9506  C  CG    . PHE B 1 610 ? 21.860  69.923  70.979  1.00 75.05  ? 610 PHE B CG    1 
ATOM   9507  C  CD1   . PHE B 1 610 ? 22.577  70.185  69.811  1.00 74.52  ? 610 PHE B CD1   1 
ATOM   9508  C  CD2   . PHE B 1 610 ? 22.560  69.777  72.165  1.00 72.47  ? 610 PHE B CD2   1 
ATOM   9509  C  CE1   . PHE B 1 610 ? 23.961  70.254  69.822  1.00 71.21  ? 610 PHE B CE1   1 
ATOM   9510  C  CE2   . PHE B 1 610 ? 23.944  69.856  72.182  1.00 72.98  ? 610 PHE B CE2   1 
ATOM   9511  C  CZ    . PHE B 1 610 ? 24.645  70.088  71.009  1.00 71.36  ? 610 PHE B CZ    1 
ATOM   9512  N  N     . ARG B 1 611 ? 21.007  67.149  68.954  1.00 74.45  ? 611 ARG B N     1 
ATOM   9513  C  CA    . ARG B 1 611 ? 21.667  66.798  67.718  1.00 74.01  ? 611 ARG B CA    1 
ATOM   9514  C  C     . ARG B 1 611 ? 20.810  65.689  67.116  1.00 77.29  ? 611 ARG B C     1 
ATOM   9515  O  O     . ARG B 1 611 ? 19.792  65.313  67.703  1.00 79.54  ? 611 ARG B O     1 
ATOM   9516  C  CB    . ARG B 1 611 ? 23.109  66.369  67.997  1.00 73.86  ? 611 ARG B CB    1 
ATOM   9517  C  CG    . ARG B 1 611 ? 24.113  66.631  66.889  1.00 73.23  ? 611 ARG B CG    1 
ATOM   9518  C  CD    . ARG B 1 611 ? 25.443  65.925  67.193  1.00 69.77  ? 611 ARG B CD    1 
ATOM   9519  N  NE    . ARG B 1 611 ? 26.301  66.713  68.088  1.00 68.47  ? 611 ARG B NE    1 
ATOM   9520  C  CZ    . ARG B 1 611 ? 27.211  66.207  68.926  1.00 74.39  ? 611 ARG B CZ    1 
ATOM   9521  N  NH1   . ARG B 1 611 ? 27.401  64.896  69.012  1.00 70.07  ? 611 ARG B NH1   1 
ATOM   9522  N  NH2   . ARG B 1 611 ? 27.938  67.018  69.684  1.00 67.28  ? 611 ARG B NH2   1 
ATOM   9523  N  N     . GLY B 1 612 ? 21.176  65.193  65.943  1.00 74.53  ? 612 GLY B N     1 
ATOM   9524  C  CA    . GLY B 1 612 ? 20.362  64.187  65.281  1.00 64.02  ? 612 GLY B CA    1 
ATOM   9525  C  C     . GLY B 1 612 ? 20.444  62.823  65.940  1.00 59.77  ? 612 GLY B C     1 
ATOM   9526  O  O     . GLY B 1 612 ? 20.477  62.685  67.164  1.00 61.40  ? 612 GLY B O     1 
ATOM   9527  N  N     . THR B 1 613 ? 20.473  61.798  65.108  1.00 55.31  ? 613 THR B N     1 
ATOM   9528  C  CA    . THR B 1 613 ? 20.633  60.445  65.589  1.00 54.02  ? 613 THR B CA    1 
ATOM   9529  C  C     . THR B 1 613 ? 22.102  60.138  65.407  1.00 54.62  ? 613 THR B C     1 
ATOM   9530  O  O     . THR B 1 613 ? 22.663  60.429  64.349  1.00 55.89  ? 613 THR B O     1 
ATOM   9531  C  CB    . THR B 1 613 ? 19.763  59.443  64.809  1.00 54.13  ? 613 THR B CB    1 
ATOM   9532  O  OG1   . THR B 1 613 ? 18.390  59.849  64.878  1.00 58.69  ? 613 THR B OG1   1 
ATOM   9533  C  CG2   . THR B 1 613 ? 19.919  58.028  65.371  1.00 55.61  ? 613 THR B CG2   1 
ATOM   9534  N  N     . PRO B 1 614 ? 22.739  59.578  66.443  1.00 52.43  ? 614 PRO B N     1 
ATOM   9535  C  CA    . PRO B 1 614 ? 24.178  59.323  66.361  1.00 58.94  ? 614 PRO B CA    1 
ATOM   9536  C  C     . PRO B 1 614 ? 24.514  58.294  65.300  1.00 56.72  ? 614 PRO B C     1 
ATOM   9537  O  O     . PRO B 1 614 ? 23.662  57.468  64.952  1.00 52.40  ? 614 PRO B O     1 
ATOM   9538  C  CB    . PRO B 1 614 ? 24.531  58.798  67.762  1.00 56.68  ? 614 PRO B CB    1 
ATOM   9539  C  CG    . PRO B 1 614 ? 23.243  58.343  68.341  1.00 53.77  ? 614 PRO B CG    1 
ATOM   9540  C  CD    . PRO B 1 614 ? 22.198  59.256  67.772  1.00 53.74  ? 614 PRO B CD    1 
ATOM   9541  N  N     . ARG B 1 615 ? 25.733  58.391  64.773  1.00 52.83  ? 615 ARG B N     1 
ATOM   9542  C  CA    . ARG B 1 615 ? 26.283  57.413  63.851  1.00 51.95  ? 615 ARG B CA    1 
ATOM   9543  C  C     . ARG B 1 615 ? 27.416  56.663  64.542  1.00 55.20  ? 615 ARG B C     1 
ATOM   9544  O  O     . ARG B 1 615 ? 28.529  57.174  64.635  1.00 52.62  ? 615 ARG B O     1 
ATOM   9545  C  CB    . ARG B 1 615 ? 26.801  58.090  62.580  1.00 61.48  ? 615 ARG B CB    1 
ATOM   9546  C  CG    . ARG B 1 615 ? 25.755  58.868  61.773  1.00 65.79  ? 615 ARG B CG    1 
ATOM   9547  C  CD    . ARG B 1 615 ? 26.384  59.434  60.500  1.00 69.65  ? 615 ARG B CD    1 
ATOM   9548  N  NE    . ARG B 1 615 ? 27.168  58.404  59.820  1.00 79.94  ? 615 ARG B NE    1 
ATOM   9549  C  CZ    . ARG B 1 615 ? 26.656  57.441  59.052  1.00 85.72  ? 615 ARG B CZ    1 
ATOM   9550  N  NH1   . ARG B 1 615 ? 25.342  57.369  58.841  1.00 75.34  ? 615 ARG B NH1   1 
ATOM   9551  N  NH2   . ARG B 1 615 ? 27.463  56.544  58.492  1.00 81.84  ? 615 ARG B NH2   1 
ATOM   9552  N  N     . PRO B 1 616 ? 27.136  55.447  65.028  1.00 54.75  ? 616 PRO B N     1 
ATOM   9553  C  CA    . PRO B 1 616 ? 28.142  54.647  65.740  1.00 50.31  ? 616 PRO B CA    1 
ATOM   9554  C  C     . PRO B 1 616 ? 29.326  54.304  64.848  1.00 55.91  ? 616 PRO B C     1 
ATOM   9555  O  O     . PRO B 1 616 ? 29.158  53.975  63.672  1.00 51.75  ? 616 PRO B O     1 
ATOM   9556  C  CB    . PRO B 1 616 ? 27.386  53.368  66.126  1.00 54.68  ? 616 PRO B CB    1 
ATOM   9557  C  CG    . PRO B 1 616 ? 25.910  53.693  65.940  1.00 55.72  ? 616 PRO B CG    1 
ATOM   9558  C  CD    . PRO B 1 616 ? 25.847  54.746  64.885  1.00 52.23  ? 616 PRO B CD    1 
ATOM   9559  N  N     . LEU B 1 617 ? 30.521  54.355  65.417  1.00 51.74  ? 617 LEU B N     1 
ATOM   9560  C  CA    . LEU B 1 617 ? 31.694  53.892  64.704  1.00 50.84  ? 617 LEU B CA    1 
ATOM   9561  C  C     . LEU B 1 617 ? 31.629  52.375  64.613  1.00 54.01  ? 617 LEU B C     1 
ATOM   9562  O  O     . LEU B 1 617 ? 31.115  51.714  65.521  1.00 52.78  ? 617 LEU B O     1 
ATOM   9563  C  CB    . LEU B 1 617 ? 32.976  54.336  65.415  1.00 51.73  ? 617 LEU B CB    1 
ATOM   9564  C  CG    . LEU B 1 617 ? 33.184  55.839  65.618  1.00 49.32  ? 617 LEU B CG    1 
ATOM   9565  C  CD1   . LEU B 1 617 ? 34.330  56.091  66.577  1.00 47.88  ? 617 LEU B CD1   1 
ATOM   9566  C  CD2   . LEU B 1 617 ? 33.465  56.508  64.283  1.00 51.67  ? 617 LEU B CD2   1 
ATOM   9567  N  N     . LYS B 1 618 ? 32.143  51.823  63.520  1.00 52.11  ? 618 LYS B N     1 
ATOM   9568  C  CA    . LYS B 1 618 ? 32.289  50.375  63.427  1.00 54.67  ? 618 LYS B CA    1 
ATOM   9569  C  C     . LYS B 1 618 ? 33.775  49.979  63.519  1.00 55.14  ? 618 LYS B C     1 
ATOM   9570  O  O     . LYS B 1 618 ? 34.608  50.482  62.776  1.00 49.22  ? 618 LYS B O     1 
ATOM   9571  C  CB    . LYS B 1 618 ? 31.674  49.855  62.134  1.00 49.79  ? 618 LYS B CB    1 
ATOM   9572  C  CG    . LYS B 1 618 ? 31.837  48.357  61.963  1.00 59.34  ? 618 LYS B CG    1 
ATOM   9573  C  CD    . LYS B 1 618 ? 31.186  47.880  60.677  1.00 61.29  ? 618 LYS B CD    1 
ATOM   9574  C  CE    . LYS B 1 618 ? 31.436  46.400  60.457  1.00 72.04  ? 618 LYS B CE    1 
ATOM   9575  N  NZ    . LYS B 1 618 ? 30.802  45.920  59.194  1.00 73.94  ? 618 LYS B NZ    1 
ATOM   9576  N  N     . LEU B 1 619 ? 34.100  49.087  64.445  1.00 57.24  ? 619 LEU B N     1 
ATOM   9577  C  CA    . LEU B 1 619 ? 35.492  48.752  64.729  1.00 58.90  ? 619 LEU B CA    1 
ATOM   9578  C  C     . LEU B 1 619 ? 35.800  47.283  64.486  1.00 62.26  ? 619 LEU B C     1 
ATOM   9579  O  O     . LEU B 1 619 ? 34.949  46.411  64.707  1.00 63.96  ? 619 LEU B O     1 
ATOM   9580  C  CB    . LEU B 1 619 ? 35.851  49.113  66.174  1.00 53.06  ? 619 LEU B CB    1 
ATOM   9581  C  CG    . LEU B 1 619 ? 35.926  50.607  66.502  1.00 57.69  ? 619 LEU B CG    1 
ATOM   9582  C  CD1   . LEU B 1 619 ? 34.544  51.186  66.796  1.00 61.69  ? 619 LEU B CD1   1 
ATOM   9583  C  CD2   . LEU B 1 619 ? 36.871  50.859  67.666  1.00 57.92  ? 619 LEU B CD2   1 
ATOM   9584  N  N     . VAL B 1 620 ? 37.018  47.022  64.006  1.00 63.92  ? 620 VAL B N     1 
ATOM   9585  C  CA    . VAL B 1 620 ? 37.495  45.652  63.822  1.00 62.38  ? 620 VAL B CA    1 
ATOM   9586  C  C     . VAL B 1 620 ? 38.867  45.430  64.460  1.00 64.18  ? 620 VAL B C     1 
ATOM   9587  O  O     . VAL B 1 620 ? 39.850  46.093  64.105  1.00 61.02  ? 620 VAL B O     1 
ATOM   9588  C  CB    . VAL B 1 620 ? 37.588  45.269  62.327  1.00 64.25  ? 620 VAL B CB    1 
ATOM   9589  C  CG1   . VAL B 1 620 ? 38.145  43.852  62.175  1.00 59.68  ? 620 VAL B CG1   1 
ATOM   9590  C  CG2   . VAL B 1 620 ? 36.225  45.385  61.665  1.00 66.18  ? 620 VAL B CG2   1 
ATOM   9591  N  N     . HIS B 1 621 ? 38.923  44.478  65.388  1.00 65.62  ? 621 HIS B N     1 
ATOM   9592  C  CA    . HIS B 1 621 ? 40.174  44.075  66.018  1.00 66.64  ? 621 HIS B CA    1 
ATOM   9593  C  C     . HIS B 1 621 ? 40.917  43.154  65.067  1.00 66.31  ? 621 HIS B C     1 
ATOM   9594  O  O     . HIS B 1 621 ? 40.553  41.992  64.906  1.00 66.84  ? 621 HIS B O     1 
ATOM   9595  C  CB    . HIS B 1 621 ? 39.920  43.377  67.354  1.00 69.81  ? 621 HIS B CB    1 
ATOM   9596  C  CG    . HIS B 1 621 ? 41.142  43.229  68.206  1.00 72.46  ? 621 HIS B CG    1 
ATOM   9597  N  ND1   . HIS B 1 621 ? 41.174  42.433  69.331  1.00 72.41  ? 621 HIS B ND1   1 
ATOM   9598  C  CD2   . HIS B 1 621 ? 42.375  43.786  68.104  1.00 70.01  ? 621 HIS B CD2   1 
ATOM   9599  C  CE1   . HIS B 1 621 ? 42.373  42.497  69.878  1.00 74.01  ? 621 HIS B CE1   1 
ATOM   9600  N  NE2   . HIS B 1 621 ? 43.121  43.312  69.158  1.00 69.84  ? 621 HIS B NE2   1 
ATOM   9601  N  N     . GLU B 1 622 ? 41.954  43.685  64.434  1.00 61.77  ? 622 GLU B N     1 
ATOM   9602  C  CA    . GLU B 1 622 ? 42.644  42.981  63.366  1.00 68.19  ? 622 GLU B CA    1 
ATOM   9603  C  C     . GLU B 1 622 ? 43.861  42.214  63.860  1.00 72.73  ? 622 GLU B C     1 
ATOM   9604  O  O     . GLU B 1 622 ? 44.202  41.164  63.319  1.00 78.07  ? 622 GLU B O     1 
ATOM   9605  C  CB    . GLU B 1 622 ? 43.073  43.976  62.286  1.00 67.04  ? 622 GLU B CB    1 
ATOM   9606  C  CG    . GLU B 1 622 ? 41.915  44.650  61.555  1.00 70.91  ? 622 GLU B CG    1 
ATOM   9607  C  CD    . GLU B 1 622 ? 42.394  45.617  60.495  1.00 69.83  ? 622 GLU B CD    1 
ATOM   9608  O  OE1   . GLU B 1 622 ? 43.404  46.305  60.740  1.00 70.43  ? 622 GLU B OE1   1 
ATOM   9609  O  OE2   . GLU B 1 622 ? 41.784  45.681  59.407  1.00 73.39  ? 622 GLU B OE2   1 
ATOM   9610  N  N     . ALA B 1 623 ? 44.498  42.727  64.905  1.00 69.10  ? 623 ALA B N     1 
ATOM   9611  C  CA    . ALA B 1 623 ? 45.686  42.094  65.448  1.00 70.07  ? 623 ALA B CA    1 
ATOM   9612  C  C     . ALA B 1 623 ? 45.870  42.465  66.905  1.00 72.56  ? 623 ALA B C     1 
ATOM   9613  O  O     . ALA B 1 623 ? 45.468  43.547  67.340  1.00 69.62  ? 623 ALA B O     1 
ATOM   9614  C  CB    . ALA B 1 623 ? 46.917  42.491  64.643  1.00 73.22  ? 623 ALA B CB    1 
ATOM   9615  N  N     . GLY B 1 624 ? 46.487  41.556  67.651  1.00 75.01  ? 624 GLY B N     1 
ATOM   9616  C  CA    . GLY B 1 624 ? 46.704  41.747  69.069  1.00 72.89  ? 624 GLY B CA    1 
ATOM   9617  C  C     . GLY B 1 624 ? 45.821  40.820  69.872  1.00 76.51  ? 624 GLY B C     1 
ATOM   9618  O  O     . GLY B 1 624 ? 44.931  40.167  69.322  1.00 80.21  ? 624 GLY B O     1 
ATOM   9619  N  N     . ASP B 1 625 ? 46.052  40.785  71.180  1.00 81.72  ? 625 ASP B N     1 
ATOM   9620  C  CA    . ASP B 1 625 ? 45.333  39.875  72.065  1.00 80.53  ? 625 ASP B CA    1 
ATOM   9621  C  C     . ASP B 1 625 ? 44.672  40.586  73.244  1.00 79.95  ? 625 ASP B C     1 
ATOM   9622  O  O     . ASP B 1 625 ? 44.303  39.946  74.228  1.00 85.69  ? 625 ASP B O     1 
ATOM   9623  C  CB    . ASP B 1 625 ? 46.293  38.804  72.585  1.00 84.67  ? 625 ASP B CB    1 
ATOM   9624  C  CG    . ASP B 1 625 ? 47.462  39.400  73.348  1.00 88.65  ? 625 ASP B CG    1 
ATOM   9625  O  OD1   . ASP B 1 625 ? 47.338  39.602  74.575  1.00 92.62  ? 625 ASP B OD1   1 
ATOM   9626  O  OD2   . ASP B 1 625 ? 48.503  39.679  72.716  1.00 90.19  ? 625 ASP B OD2   1 
ATOM   9627  N  N     . THR B 1 626 ? 44.528  41.905  73.152  1.00 75.06  ? 626 THR B N     1 
ATOM   9628  C  CA    . THR B 1 626 ? 43.739  42.644  74.134  1.00 74.27  ? 626 THR B CA    1 
ATOM   9629  C  C     . THR B 1 626 ? 42.260  42.321  73.907  1.00 75.12  ? 626 THR B C     1 
ATOM   9630  O  O     . THR B 1 626 ? 41.801  42.286  72.766  1.00 74.29  ? 626 THR B O     1 
ATOM   9631  C  CB    . THR B 1 626 ? 43.988  44.169  74.040  1.00 75.45  ? 626 THR B CB    1 
ATOM   9632  O  OG1   . THR B 1 626 ? 45.371  44.449  74.298  1.00 76.20  ? 626 THR B OG1   1 
ATOM   9633  C  CG2   . THR B 1 626 ? 43.130  44.928  75.040  1.00 70.67  ? 626 THR B CG2   1 
ATOM   9634  N  N     . PRO B 1 627 ? 41.516  42.036  74.988  1.00 76.66  ? 627 PRO B N     1 
ATOM   9635  C  CA    . PRO B 1 627 ? 40.068  41.792  74.901  1.00 78.57  ? 627 PRO B CA    1 
ATOM   9636  C  C     . PRO B 1 627 ? 39.309  42.962  74.275  1.00 75.84  ? 627 PRO B C     1 
ATOM   9637  O  O     . PRO B 1 627 ? 39.722  44.107  74.485  1.00 75.11  ? 627 PRO B O     1 
ATOM   9638  C  CB    . PRO B 1 627 ? 39.659  41.599  76.366  1.00 75.14  ? 627 PRO B CB    1 
ATOM   9639  C  CG    . PRO B 1 627 ? 40.890  41.092  77.025  1.00 73.61  ? 627 PRO B CG    1 
ATOM   9640  C  CD    . PRO B 1 627 ? 42.036  41.782  76.343  1.00 76.13  ? 627 PRO B CD    1 
ATOM   9641  N  N     . LEU B 1 628 ? 38.234  42.685  73.532  1.00 74.18  ? 628 LEU B N     1 
ATOM   9642  C  CA    . LEU B 1 628 ? 37.483  43.746  72.850  1.00 77.44  ? 628 LEU B CA    1 
ATOM   9643  C  C     . LEU B 1 628 ? 37.004  44.838  73.791  1.00 75.50  ? 628 LEU B C     1 
ATOM   9644  O  O     . LEU B 1 628 ? 37.077  46.017  73.457  1.00 77.98  ? 628 LEU B O     1 
ATOM   9645  C  CB    . LEU B 1 628 ? 36.280  43.177  72.095  1.00 75.73  ? 628 LEU B CB    1 
ATOM   9646  C  CG    . LEU B 1 628 ? 36.528  42.527  70.733  1.00 77.21  ? 628 LEU B CG    1 
ATOM   9647  C  CD1   . LEU B 1 628 ? 35.209  42.200  70.049  1.00 68.31  ? 628 LEU B CD1   1 
ATOM   9648  C  CD2   . LEU B 1 628 ? 37.353  43.465  69.857  1.00 67.16  ? 628 LEU B CD2   1 
ATOM   9649  N  N     . GLU B 1 629 ? 36.522  44.444  74.961  1.00 74.68  ? 629 GLU B N     1 
ATOM   9650  C  CA    . GLU B 1 629 ? 36.005  45.394  75.937  1.00 74.60  ? 629 GLU B CA    1 
ATOM   9651  C  C     . GLU B 1 629 ? 37.073  46.392  76.362  1.00 75.41  ? 629 GLU B C     1 
ATOM   9652  O  O     . GLU B 1 629 ? 36.800  47.583  76.478  1.00 75.76  ? 629 GLU B O     1 
ATOM   9653  C  CB    . GLU B 1 629 ? 35.429  44.653  77.146  1.00 83.25  ? 629 GLU B CB    1 
ATOM   9654  C  CG    . GLU B 1 629 ? 34.382  43.596  76.771  1.00 82.37  ? 629 GLU B CG    1 
ATOM   9655  C  CD    . GLU B 1 629 ? 34.988  42.264  76.336  1.00 92.06  ? 629 GLU B CD    1 
ATOM   9656  O  OE1   . GLU B 1 629 ? 36.199  42.044  76.575  1.00 89.45  ? 629 GLU B OE1   1 
ATOM   9657  O  OE2   . GLU B 1 629 ? 34.253  41.447  75.735  1.00 91.93  ? 629 GLU B OE2   1 
ATOM   9658  N  N     . ALA B 1 630 ? 38.290  45.909  76.595  1.00 79.16  ? 630 ALA B N     1 
ATOM   9659  C  CA    . ALA B 1 630 ? 39.375  46.791  77.013  1.00 73.70  ? 630 ALA B CA    1 
ATOM   9660  C  C     . ALA B 1 630 ? 39.758  47.765  75.899  1.00 66.13  ? 630 ALA B C     1 
ATOM   9661  O  O     . ALA B 1 630 ? 40.028  48.946  76.154  1.00 63.66  ? 630 ALA B O     1 
ATOM   9662  C  CB    . ALA B 1 630 ? 40.579  45.974  77.442  1.00 70.94  ? 630 ALA B CB    1 
ATOM   9663  N  N     . LEU B 1 631 ? 39.786  47.260  74.666  1.00 67.11  ? 631 LEU B N     1 
ATOM   9664  C  CA    . LEU B 1 631 ? 40.001  48.099  73.488  1.00 68.55  ? 631 LEU B CA    1 
ATOM   9665  C  C     . LEU B 1 631 ? 38.955  49.200  73.353  1.00 64.29  ? 631 LEU B C     1 
ATOM   9666  O  O     . LEU B 1 631 ? 39.294  50.373  73.210  1.00 59.74  ? 631 LEU B O     1 
ATOM   9667  C  CB    . LEU B 1 631 ? 39.994  47.253  72.217  1.00 72.39  ? 631 LEU B CB    1 
ATOM   9668  C  CG    . LEU B 1 631 ? 41.146  46.275  71.997  1.00 70.70  ? 631 LEU B CG    1 
ATOM   9669  C  CD1   . LEU B 1 631 ? 40.905  45.509  70.707  1.00 67.95  ? 631 LEU B CD1   1 
ATOM   9670  C  CD2   . LEU B 1 631 ? 42.476  46.999  71.956  1.00 64.37  ? 631 LEU B CD2   1 
ATOM   9671  N  N     . ALA B 1 632 ? 37.685  48.807  73.397  1.00 66.65  ? 632 ALA B N     1 
ATOM   9672  C  CA    . ALA B 1 632 ? 36.576  49.740  73.246  1.00 63.75  ? 632 ALA B CA    1 
ATOM   9673  C  C     . ALA B 1 632 ? 36.607  50.776  74.354  1.00 64.48  ? 632 ALA B C     1 
ATOM   9674  O  O     . ALA B 1 632 ? 36.360  51.959  74.125  1.00 64.95  ? 632 ALA B O     1 
ATOM   9675  C  CB    . ALA B 1 632 ? 35.252  48.999  73.254  1.00 68.72  ? 632 ALA B CB    1 
ATOM   9676  N  N     . HIS B 1 633 ? 36.924  50.316  75.557  1.00 68.86  ? 633 HIS B N     1 
ATOM   9677  C  CA    . HIS B 1 633 ? 37.042  51.192  76.708  1.00 67.19  ? 633 HIS B CA    1 
ATOM   9678  C  C     . HIS B 1 633 ? 38.126  52.242  76.454  1.00 64.50  ? 633 HIS B C     1 
ATOM   9679  O  O     . HIS B 1 633 ? 37.888  53.452  76.607  1.00 66.51  ? 633 HIS B O     1 
ATOM   9680  C  CB    . HIS B 1 633 ? 37.341  50.376  77.966  1.00 68.41  ? 633 HIS B CB    1 
ATOM   9681  C  CG    . HIS B 1 633 ? 37.398  51.196  79.214  1.00 70.04  ? 633 HIS B CG    1 
ATOM   9682  N  ND1   . HIS B 1 633 ? 38.584  51.607  79.780  1.00 75.44  ? 633 HIS B ND1   1 
ATOM   9683  C  CD2   . HIS B 1 633 ? 36.411  51.685  80.001  1.00 72.29  ? 633 HIS B CD2   1 
ATOM   9684  C  CE1   . HIS B 1 633 ? 38.326  52.316  80.866  1.00 78.75  ? 633 HIS B CE1   1 
ATOM   9685  N  NE2   . HIS B 1 633 ? 37.018  52.378  81.022  1.00 74.58  ? 633 HIS B NE2   1 
ATOM   9686  N  N     . GLN B 1 634 ? 39.310  51.790  76.051  1.00 61.18  ? 634 GLN B N     1 
ATOM   9687  C  CA    . GLN B 1 634 ? 40.394  52.736  75.812  1.00 62.93  ? 634 GLN B CA    1 
ATOM   9688  C  C     . GLN B 1 634 ? 40.095  53.717  74.674  1.00 54.94  ? 634 GLN B C     1 
ATOM   9689  O  O     . GLN B 1 634 ? 40.383  54.905  74.778  1.00 58.66  ? 634 GLN B O     1 
ATOM   9690  C  CB    . GLN B 1 634 ? 41.703  52.009  75.516  1.00 63.48  ? 634 GLN B CB    1 
ATOM   9691  C  CG    . GLN B 1 634 ? 42.863  52.987  75.375  1.00 60.85  ? 634 GLN B CG    1 
ATOM   9692  C  CD    . GLN B 1 634 ? 44.213  52.357  75.604  1.00 67.85  ? 634 GLN B CD    1 
ATOM   9693  O  OE1   . GLN B 1 634 ? 44.332  51.141  75.758  1.00 74.16  ? 634 GLN B OE1   1 
ATOM   9694  N  NE2   . GLN B 1 634 ? 45.246  53.184  75.626  1.00 62.87  ? 634 GLN B NE2   1 
ATOM   9695  N  N     . ILE B 1 635 ? 39.528  53.220  73.587  1.00 56.94  ? 635 ILE B N     1 
ATOM   9696  C  CA    . ILE B 1 635 ? 39.229  54.063  72.428  1.00 58.91  ? 635 ILE B CA    1 
ATOM   9697  C  C     . ILE B 1 635 ? 38.174  55.120  72.775  1.00 56.12  ? 635 ILE B C     1 
ATOM   9698  O  O     . ILE B 1 635 ? 38.339  56.330  72.489  1.00 53.20  ? 635 ILE B O     1 
ATOM   9699  C  CB    . ILE B 1 635 ? 38.774  53.185  71.248  1.00 59.28  ? 635 ILE B CB    1 
ATOM   9700  C  CG1   . ILE B 1 635 ? 39.950  52.300  70.810  1.00 57.87  ? 635 ILE B CG1   1 
ATOM   9701  C  CG2   . ILE B 1 635 ? 38.241  54.036  70.101  1.00 59.84  ? 635 ILE B CG2   1 
ATOM   9702  C  CD1   . ILE B 1 635 ? 39.582  51.180  69.871  1.00 57.76  ? 635 ILE B CD1   1 
ATOM   9703  N  N     . PHE B 1 636 ? 37.105  54.662  73.422  1.00 54.60  ? 636 PHE B N     1 
ATOM   9704  C  CA    . PHE B 1 636 ? 36.052  55.570  73.862  1.00 61.40  ? 636 PHE B CA    1 
ATOM   9705  C  C     . PHE B 1 636 ? 36.615  56.645  74.767  1.00 60.07  ? 636 PHE B C     1 
ATOM   9706  O  O     . PHE B 1 636 ? 36.352  57.836  74.565  1.00 55.91  ? 636 PHE B O     1 
ATOM   9707  C  CB    . PHE B 1 636 ? 34.942  54.819  74.598  1.00 58.98  ? 636 PHE B CB    1 
ATOM   9708  C  CG    . PHE B 1 636 ? 33.956  55.728  75.294  1.00 67.23  ? 636 PHE B CG    1 
ATOM   9709  C  CD1   . PHE B 1 636 ? 33.273  56.713  74.589  1.00 62.90  ? 636 PHE B CD1   1 
ATOM   9710  C  CD2   . PHE B 1 636 ? 33.715  55.597  76.656  1.00 65.79  ? 636 PHE B CD2   1 
ATOM   9711  C  CE1   . PHE B 1 636 ? 32.366  57.549  75.231  1.00 65.00  ? 636 PHE B CE1   1 
ATOM   9712  C  CE2   . PHE B 1 636 ? 32.811  56.426  77.301  1.00 63.59  ? 636 PHE B CE2   1 
ATOM   9713  C  CZ    . PHE B 1 636 ? 32.136  57.405  76.589  1.00 61.53  ? 636 PHE B CZ    1 
ATOM   9714  N  N     . HIS B 1 637 ? 37.434  56.231  75.734  1.00 61.66  ? 637 HIS B N     1 
ATOM   9715  C  CA    . HIS B 1 637 ? 38.039  57.196  76.642  1.00 63.67  ? 637 HIS B CA    1 
ATOM   9716  C  C     . HIS B 1 637 ? 38.927  58.156  75.864  1.00 54.60  ? 637 HIS B C     1 
ATOM   9717  O  O     . HIS B 1 637 ? 38.988  59.346  76.178  1.00 57.05  ? 637 HIS B O     1 
ATOM   9718  C  CB    . HIS B 1 637 ? 38.826  56.491  77.748  1.00 65.43  ? 637 HIS B CB    1 
ATOM   9719  C  CG    . HIS B 1 637 ? 37.970  56.020  78.884  1.00 70.92  ? 637 HIS B CG    1 
ATOM   9720  N  ND1   . HIS B 1 637 ? 38.425  55.947  80.182  1.00 71.69  ? 637 HIS B ND1   1 
ATOM   9721  C  CD2   . HIS B 1 637 ? 36.678  55.611  78.917  1.00 69.63  ? 637 HIS B CD2   1 
ATOM   9722  C  CE1   . HIS B 1 637 ? 37.457  55.504  80.964  1.00 73.04  ? 637 HIS B CE1   1 
ATOM   9723  N  NE2   . HIS B 1 637 ? 36.385  55.294  80.222  1.00 73.70  ? 637 HIS B NE2   1 
ATOM   9724  N  N     . LEU B 1 638 ? 39.590  57.642  74.835  1.00 51.44  ? 638 LEU B N     1 
ATOM   9725  C  CA    . LEU B 1 638 ? 40.439  58.473  73.987  1.00 55.71  ? 638 LEU B CA    1 
ATOM   9726  C  C     . LEU B 1 638 ? 39.657  59.558  73.250  1.00 56.66  ? 638 LEU B C     1 
ATOM   9727  O  O     . LEU B 1 638 ? 40.238  60.587  72.906  1.00 53.24  ? 638 LEU B O     1 
ATOM   9728  C  CB    . LEU B 1 638 ? 41.209  57.607  72.984  1.00 51.12  ? 638 LEU B CB    1 
ATOM   9729  C  CG    . LEU B 1 638 ? 42.486  56.937  73.518  1.00 60.40  ? 638 LEU B CG    1 
ATOM   9730  C  CD1   . LEU B 1 638 ? 43.026  55.881  72.567  1.00 51.78  ? 638 LEU B CD1   1 
ATOM   9731  C  CD2   . LEU B 1 638 ? 43.552  58.008  73.762  1.00 48.11  ? 638 LEU B CD2   1 
ATOM   9732  N  N     . THR B 1 639 ? 38.358  59.353  73.000  1.00 53.08  ? 639 THR B N     1 
ATOM   9733  C  CA    . THR B 1 639 ? 37.582  60.436  72.374  1.00 52.92  ? 639 THR B CA    1 
ATOM   9734  C  C     . THR B 1 639 ? 37.497  61.733  73.204  1.00 58.78  ? 639 THR B C     1 
ATOM   9735  O  O     . THR B 1 639 ? 37.303  62.816  72.642  1.00 56.37  ? 639 THR B O     1 
ATOM   9736  C  CB    . THR B 1 639 ? 36.122  60.012  72.034  1.00 59.65  ? 639 THR B CB    1 
ATOM   9737  O  OG1   . THR B 1 639 ? 35.307  60.037  73.215  1.00 52.80  ? 639 THR B OG1   1 
ATOM   9738  C  CG2   . THR B 1 639 ? 36.080  58.625  71.377  1.00 52.51  ? 639 THR B CG2   1 
ATOM   9739  N  N     . ARG B 1 640 ? 37.667  61.654  74.522  1.00 59.08  ? 640 ARG B N     1 
ATOM   9740  C  CA    . ARG B 1 640 ? 37.486  62.859  75.343  1.00 62.05  ? 640 ARG B CA    1 
ATOM   9741  C  C     . ARG B 1 640 ? 38.768  63.682  75.516  1.00 61.45  ? 640 ARG B C     1 
ATOM   9742  O  O     . ARG B 1 640 ? 38.761  64.705  76.201  1.00 65.78  ? 640 ARG B O     1 
ATOM   9743  C  CB    . ARG B 1 640 ? 36.945  62.492  76.730  1.00 63.07  ? 640 ARG B CB    1 
ATOM   9744  C  CG    . ARG B 1 640 ? 35.954  61.340  76.753  1.00 66.26  ? 640 ARG B CG    1 
ATOM   9745  C  CD    . ARG B 1 640 ? 34.511  61.785  76.570  1.00 63.12  ? 640 ARG B CD    1 
ATOM   9746  N  NE    . ARG B 1 640 ? 33.981  61.302  75.303  1.00 68.72  ? 640 ARG B NE    1 
ATOM   9747  C  CZ    . ARG B 1 640 ? 32.731  60.896  75.097  1.00 66.83  ? 640 ARG B CZ    1 
ATOM   9748  N  NH1   . ARG B 1 640 ? 31.838  60.899  76.081  1.00 68.14  ? 640 ARG B NH1   1 
ATOM   9749  N  NH2   . ARG B 1 640 ? 32.380  60.477  73.892  1.00 60.86  ? 640 ARG B NH2   1 
ATOM   9750  N  N     . LEU B 1 641 ? 39.843  63.274  74.847  1.00 58.02  ? 641 LEU B N     1 
ATOM   9751  C  CA    . LEU B 1 641 ? 41.157  63.881  75.057  1.00 62.04  ? 641 LEU B CA    1 
ATOM   9752  C  C     . LEU B 1 641 ? 41.468  65.073  74.152  1.00 60.69  ? 641 LEU B C     1 
ATOM   9753  O  O     . LEU B 1 641 ? 42.488  65.739  74.328  1.00 65.34  ? 641 LEU B O     1 
ATOM   9754  C  CB    . LEU B 1 641 ? 42.252  62.821  74.892  1.00 64.60  ? 641 LEU B CB    1 
ATOM   9755  C  CG    . LEU B 1 641 ? 42.961  62.493  76.202  1.00 67.20  ? 641 LEU B CG    1 
ATOM   9756  C  CD1   . LEU B 1 641 ? 44.010  61.406  76.020  1.00 72.18  ? 641 LEU B CD1   1 
ATOM   9757  C  CD2   . LEU B 1 641 ? 43.583  63.755  76.763  1.00 71.58  ? 641 LEU B CD2   1 
ATOM   9758  N  N     . TYR B 1 642 ? 40.623  65.329  73.163  1.00 59.86  ? 642 TYR B N     1 
ATOM   9759  C  CA    . TYR B 1 642 ? 40.902  66.407  72.216  1.00 57.90  ? 642 TYR B CA    1 
ATOM   9760  C  C     . TYR B 1 642 ? 40.902  67.772  72.910  1.00 58.23  ? 642 TYR B C     1 
ATOM   9761  O  O     . TYR B 1 642 ? 39.886  68.200  73.447  1.00 60.17  ? 642 TYR B O     1 
ATOM   9762  C  CB    . TYR B 1 642 ? 39.894  66.382  71.073  1.00 52.79  ? 642 TYR B CB    1 
ATOM   9763  C  CG    . TYR B 1 642 ? 40.285  67.244  69.902  1.00 53.74  ? 642 TYR B CG    1 
ATOM   9764  C  CD1   . TYR B 1 642 ? 41.420  66.955  69.152  1.00 51.92  ? 642 TYR B CD1   1 
ATOM   9765  C  CD2   . TYR B 1 642 ? 39.508  68.334  69.528  1.00 50.03  ? 642 TYR B CD2   1 
ATOM   9766  C  CE1   . TYR B 1 642 ? 41.780  67.741  68.070  1.00 50.37  ? 642 TYR B CE1   1 
ATOM   9767  C  CE2   . TYR B 1 642 ? 39.856  69.123  68.448  1.00 48.89  ? 642 TYR B CE2   1 
ATOM   9768  C  CZ    . TYR B 1 642 ? 40.993  68.819  67.723  1.00 52.82  ? 642 TYR B CZ    1 
ATOM   9769  O  OH    . TYR B 1 642 ? 41.344  69.601  66.649  1.00 58.30  ? 642 TYR B OH    1 
ATOM   9770  N  N     . PRO B 1 643 ? 42.062  68.450  72.914  1.00 61.90  ? 643 PRO B N     1 
ATOM   9771  C  CA    . PRO B 1 643 ? 42.247  69.693  73.674  1.00 60.85  ? 643 PRO B CA    1 
ATOM   9772  C  C     . PRO B 1 643 ? 41.682  70.946  73.001  1.00 62.36  ? 643 PRO B C     1 
ATOM   9773  O  O     . PRO B 1 643 ? 41.552  71.980  73.655  1.00 60.75  ? 643 PRO B O     1 
ATOM   9774  C  CB    . PRO B 1 643 ? 43.773  69.802  73.803  1.00 66.58  ? 643 PRO B CB    1 
ATOM   9775  C  CG    . PRO B 1 643 ? 44.331  69.028  72.648  1.00 62.05  ? 643 PRO B CG    1 
ATOM   9776  C  CD    . PRO B 1 643 ? 43.267  68.073  72.151  1.00 62.25  ? 643 PRO B CD    1 
ATOM   9777  N  N     . ALA B 1 644 ? 41.342  70.853  71.721  1.00 62.76  ? 644 ALA B N     1 
ATOM   9778  C  CA    . ALA B 1 644 ? 40.924  72.026  70.963  1.00 57.40  ? 644 ALA B CA    1 
ATOM   9779  C  C     . ALA B 1 644 ? 39.407  72.153  70.829  1.00 52.90  ? 644 ALA B C     1 
ATOM   9780  O  O     . ALA B 1 644 ? 38.927  73.030  70.123  1.00 53.24  ? 644 ALA B O     1 
ATOM   9781  C  CB    . ALA B 1 644 ? 41.561  72.012  69.589  1.00 58.66  ? 644 ALA B CB    1 
ATOM   9782  N  N     . SER B 1 645 ? 38.637  71.309  71.501  1.00 55.95  ? 645 SER B N     1 
ATOM   9783  C  CA    . SER B 1 645 ? 37.197  71.471  71.375  1.00 60.49  ? 645 SER B CA    1 
ATOM   9784  C  C     . SER B 1 645 ? 36.577  72.110  72.612  1.00 57.81  ? 645 SER B C     1 
ATOM   9785  O  O     . SER B 1 645 ? 35.788  73.026  72.480  1.00 74.89  ? 645 SER B O     1 
ATOM   9786  C  CB    . SER B 1 645 ? 36.529  70.134  71.067  1.00 56.48  ? 645 SER B CB    1 
ATOM   9787  O  OG    . SER B 1 645 ? 35.173  70.354  70.739  1.00 48.78  ? 645 SER B OG    1 
ATOM   9788  N  N     . GLY B 1 646 ? 36.886  71.632  73.805  1.00 61.05  ? 646 GLY B N     1 
ATOM   9789  C  CA    . GLY B 1 646 ? 36.405  72.317  74.999  1.00 64.74  ? 646 GLY B CA    1 
ATOM   9790  C  C     . GLY B 1 646 ? 34.948  72.282  75.428  1.00 65.36  ? 646 GLY B C     1 
ATOM   9791  O  O     . GLY B 1 646 ? 34.674  72.514  76.607  1.00 65.81  ? 646 GLY B O     1 
ATOM   9792  N  N     . PHE B 1 647 ? 34.012  72.032  74.509  1.00 60.19  ? 647 PHE B N     1 
ATOM   9793  C  CA    . PHE B 1 647 ? 32.588  71.971  74.881  1.00 62.43  ? 647 PHE B CA    1 
ATOM   9794  C  C     . PHE B 1 647 ? 31.886  70.781  74.255  1.00 58.44  ? 647 PHE B C     1 
ATOM   9795  O  O     . PHE B 1 647 ? 30.773  70.441  74.648  1.00 62.40  ? 647 PHE B O     1 
ATOM   9796  C  CB    . PHE B 1 647 ? 31.818  73.239  74.490  1.00 58.97  ? 647 PHE B CB    1 
ATOM   9797  C  CG    . PHE B 1 647 ? 32.372  74.499  75.076  1.00 66.48  ? 647 PHE B CG    1 
ATOM   9798  C  CD1   . PHE B 1 647 ? 32.054  74.864  76.377  1.00 67.94  ? 647 PHE B CD1   1 
ATOM   9799  C  CD2   . PHE B 1 647 ? 33.168  75.340  74.321  1.00 58.99  ? 647 PHE B CD2   1 
ATOM   9800  C  CE1   . PHE B 1 647 ? 32.550  76.027  76.924  1.00 70.27  ? 647 PHE B CE1   1 
ATOM   9801  C  CE2   . PHE B 1 647 ? 33.666  76.507  74.862  1.00 68.37  ? 647 PHE B CE2   1 
ATOM   9802  C  CZ    . PHE B 1 647 ? 33.358  76.852  76.164  1.00 71.46  ? 647 PHE B CZ    1 
ATOM   9803  N  N     . ALA B 1 648 ? 32.542  70.135  73.298  1.00 55.42  ? 648 ALA B N     1 
ATOM   9804  C  CA    . ALA B 1 648 ? 31.954  68.984  72.635  1.00 51.78  ? 648 ALA B CA    1 
ATOM   9805  C  C     . ALA B 1 648 ? 33.046  68.001  72.261  1.00 52.28  ? 648 ALA B C     1 
ATOM   9806  O  O     . ALA B 1 648 ? 34.013  68.373  71.616  1.00 53.86  ? 648 ALA B O     1 
ATOM   9807  C  CB    . ALA B 1 648 ? 31.159  69.422  71.390  1.00 54.20  ? 648 ALA B CB    1 
ATOM   9808  N  N     . PHE B 1 649 ? 32.865  66.739  72.638  1.00 49.90  ? 649 PHE B N     1 
ATOM   9809  C  CA    . PHE B 1 649 ? 33.851  65.707  72.358  1.00 53.83  ? 649 PHE B CA    1 
ATOM   9810  C  C     . PHE B 1 649 ? 33.724  65.206  70.931  1.00 57.10  ? 649 PHE B C     1 
ATOM   9811  O  O     . PHE B 1 649 ? 32.615  65.091  70.405  1.00 57.25  ? 649 PHE B O     1 
ATOM   9812  C  CB    . PHE B 1 649 ? 33.690  64.534  73.320  1.00 58.87  ? 649 PHE B CB    1 
ATOM   9813  C  CG    . PHE B 1 649 ? 33.845  64.908  74.760  1.00 58.93  ? 649 PHE B CG    1 
ATOM   9814  C  CD1   . PHE B 1 649 ? 35.035  65.445  75.227  1.00 54.83  ? 649 PHE B CD1   1 
ATOM   9815  C  CD2   . PHE B 1 649 ? 32.797  64.723  75.647  1.00 57.72  ? 649 PHE B CD2   1 
ATOM   9816  C  CE1   . PHE B 1 649 ? 35.177  65.792  76.559  1.00 56.07  ? 649 PHE B CE1   1 
ATOM   9817  C  CE2   . PHE B 1 649 ? 32.930  65.064  76.975  1.00 60.71  ? 649 PHE B CE2   1 
ATOM   9818  C  CZ    . PHE B 1 649 ? 34.121  65.598  77.435  1.00 58.94  ? 649 PHE B CZ    1 
ATOM   9819  N  N     . PRO B 1 650 ? 34.867  64.927  70.292  1.00 60.51  ? 650 PRO B N     1 
ATOM   9820  C  CA    . PRO B 1 650 ? 34.864  64.322  68.960  1.00 50.09  ? 650 PRO B CA    1 
ATOM   9821  C  C     . PRO B 1 650 ? 34.366  62.891  68.985  1.00 55.20  ? 650 PRO B C     1 
ATOM   9822  O  O     . PRO B 1 650 ? 34.521  62.182  69.982  1.00 56.83  ? 650 PRO B O     1 
ATOM   9823  C  CB    . PRO B 1 650 ? 36.339  64.371  68.537  1.00 49.07  ? 650 PRO B CB    1 
ATOM   9824  C  CG    . PRO B 1 650 ? 36.952  65.427  69.411  1.00 50.21  ? 650 PRO B CG    1 
ATOM   9825  C  CD    . PRO B 1 650 ? 36.223  65.315  70.717  1.00 48.64  ? 650 PRO B CD    1 
ATOM   9826  N  N     . ARG B 1 651 ? 33.752  62.491  67.881  1.00 53.07  ? 651 ARG B N     1 
ATOM   9827  C  CA    . ARG B 1 651 ? 33.337  61.120  67.650  1.00 49.33  ? 651 ARG B CA    1 
ATOM   9828  C  C     . ARG B 1 651 ? 34.517  60.145  67.594  1.00 48.61  ? 651 ARG B C     1 
ATOM   9829  O  O     . ARG B 1 651 ? 34.460  59.036  68.131  1.00 48.48  ? 651 ARG B O     1 
ATOM   9830  C  CB    . ARG B 1 651 ? 32.546  61.075  66.353  1.00 44.38  ? 651 ARG B CB    1 
ATOM   9831  C  CG    . ARG B 1 651 ? 32.041  59.720  65.919  1.00 54.21  ? 651 ARG B CG    1 
ATOM   9832  C  CD    . ARG B 1 651 ? 30.944  59.949  64.885  1.00 46.42  ? 651 ARG B CD    1 
ATOM   9833  N  NE    . ARG B 1 651 ? 30.623  58.751  64.132  1.00 56.77  ? 651 ARG B NE    1 
ATOM   9834  C  CZ    . ARG B 1 651 ? 30.930  58.586  62.853  1.00 56.72  ? 651 ARG B CZ    1 
ATOM   9835  N  NH1   . ARG B 1 651 ? 31.561  59.547  62.192  1.00 54.81  ? 651 ARG B NH1   1 
ATOM   9836  N  NH2   . ARG B 1 651 ? 30.598  57.465  62.239  1.00 59.26  ? 651 ARG B NH2   1 
ATOM   9837  N  N     . LEU B 1 652 ? 35.578  60.553  66.915  1.00 49.12  ? 652 LEU B N     1 
ATOM   9838  C  CA    . LEU B 1 652 ? 36.763  59.713  66.763  1.00 51.58  ? 652 LEU B CA    1 
ATOM   9839  C  C     . LEU B 1 652 ? 37.671  59.755  67.990  1.00 49.92  ? 652 LEU B C     1 
ATOM   9840  O  O     . LEU B 1 652 ? 37.730  60.768  68.694  1.00 48.40  ? 652 LEU B O     1 
ATOM   9841  C  CB    . LEU B 1 652 ? 37.556  60.140  65.522  1.00 53.02  ? 652 LEU B CB    1 
ATOM   9842  C  CG    . LEU B 1 652 ? 36.949  59.833  64.151  1.00 54.03  ? 652 LEU B CG    1 
ATOM   9843  C  CD1   . LEU B 1 652 ? 37.766  60.505  63.073  1.00 54.18  ? 652 LEU B CD1   1 
ATOM   9844  C  CD2   . LEU B 1 652 ? 36.920  58.328  63.933  1.00 47.36  ? 652 LEU B CD2   1 
ATOM   9845  N  N     . PRO B 1 653 ? 38.389  58.655  68.249  1.00 48.41  ? 653 PRO B N     1 
ATOM   9846  C  CA    . PRO B 1 653 ? 39.425  58.740  69.282  1.00 52.71  ? 653 PRO B CA    1 
ATOM   9847  C  C     . PRO B 1 653 ? 40.456  59.797  68.907  1.00 51.07  ? 653 PRO B C     1 
ATOM   9848  O  O     . PRO B 1 653 ? 40.786  59.946  67.729  1.00 52.17  ? 653 PRO B O     1 
ATOM   9849  C  CB    . PRO B 1 653 ? 40.030  57.330  69.297  1.00 52.76  ? 653 PRO B CB    1 
ATOM   9850  C  CG    . PRO B 1 653 ? 39.689  56.743  67.962  1.00 57.84  ? 653 PRO B CG    1 
ATOM   9851  C  CD    . PRO B 1 653 ? 38.333  57.322  67.625  1.00 50.75  ? 653 PRO B CD    1 
ATOM   9852  N  N     . ALA B 1 654 ? 40.932  60.539  69.902  1.00 44.43  ? 654 ALA B N     1 
ATOM   9853  C  CA    . ALA B 1 654 ? 41.771  61.722  69.664  1.00 49.28  ? 654 ALA B CA    1 
ATOM   9854  C  C     . ALA B 1 654 ? 42.953  61.546  68.676  1.00 51.42  ? 654 ALA B C     1 
ATOM   9855  O  O     . ALA B 1 654 ? 43.222  62.457  67.894  1.00 47.95  ? 654 ALA B O     1 
ATOM   9856  C  CB    . ALA B 1 654 ? 42.287  62.259  70.998  1.00 57.67  ? 654 ALA B CB    1 
ATOM   9857  N  N     . PRO B 1 655 ? 43.683  60.412  68.724  1.00 48.73  ? 655 PRO B N     1 
ATOM   9858  C  CA    . PRO B 1 655 ? 44.784  60.322  67.746  1.00 54.91  ? 655 PRO B CA    1 
ATOM   9859  C  C     . PRO B 1 655 ? 44.316  60.373  66.284  1.00 55.47  ? 655 PRO B C     1 
ATOM   9860  O  O     . PRO B 1 655 ? 44.982  61.011  65.459  1.00 55.69  ? 655 PRO B O     1 
ATOM   9861  C  CB    . PRO B 1 655 ? 45.431  58.963  68.062  1.00 53.53  ? 655 PRO B CB    1 
ATOM   9862  C  CG    . PRO B 1 655 ? 45.109  58.719  69.502  1.00 52.75  ? 655 PRO B CG    1 
ATOM   9863  C  CD    . PRO B 1 655 ? 43.725  59.304  69.699  1.00 53.04  ? 655 PRO B CD    1 
ATOM   9864  N  N     . LEU B 1 656 ? 43.184  59.736  65.973  1.00 55.57  ? 656 LEU B N     1 
ATOM   9865  C  CA    . LEU B 1 656 ? 42.647  59.788  64.610  1.00 52.02  ? 656 LEU B CA    1 
ATOM   9866  C  C     . LEU B 1 656 ? 42.063  61.167  64.275  1.00 54.21  ? 656 LEU B C     1 
ATOM   9867  O  O     . LEU B 1 656 ? 42.225  61.655  63.152  1.00 60.81  ? 656 LEU B O     1 
ATOM   9868  C  CB    . LEU B 1 656 ? 41.591  58.702  64.398  1.00 53.76  ? 656 LEU B CB    1 
ATOM   9869  C  CG    . LEU B 1 656 ? 42.022  57.228  64.354  1.00 50.54  ? 656 LEU B CG    1 
ATOM   9870  C  CD1   . LEU B 1 656 ? 40.809  56.338  64.171  1.00 48.99  ? 656 LEU B CD1   1 
ATOM   9871  C  CD2   . LEU B 1 656 ? 43.049  56.958  63.256  1.00 48.98  ? 656 LEU B CD2   1 
ATOM   9872  N  N     . HIS B 1 657 ? 41.390  61.799  65.236  1.00 50.89  ? 657 HIS B N     1 
ATOM   9873  C  CA    . HIS B 1 657 ? 40.856  63.144  65.018  1.00 52.52  ? 657 HIS B CA    1 
ATOM   9874  C  C     . HIS B 1 657 ? 41.990  64.134  64.705  1.00 50.10  ? 657 HIS B C     1 
ATOM   9875  O  O     . HIS B 1 657 ? 41.911  64.938  63.755  1.00 54.00  ? 657 HIS B O     1 
ATOM   9876  C  CB    . HIS B 1 657 ? 40.062  63.607  66.242  1.00 52.08  ? 657 HIS B CB    1 
ATOM   9877  C  CG    . HIS B 1 657 ? 39.206  64.810  65.988  1.00 50.83  ? 657 HIS B CG    1 
ATOM   9878  N  ND1   . HIS B 1 657 ? 38.123  64.789  65.135  1.00 50.05  ? 657 HIS B ND1   1 
ATOM   9879  C  CD2   . HIS B 1 657 ? 39.284  66.076  66.466  1.00 53.38  ? 657 HIS B CD2   1 
ATOM   9880  C  CE1   . HIS B 1 657 ? 37.565  65.987  65.106  1.00 51.90  ? 657 HIS B CE1   1 
ATOM   9881  N  NE2   . HIS B 1 657 ? 38.256  66.790  65.897  1.00 53.29  ? 657 HIS B NE2   1 
ATOM   9882  N  N     . LEU B 1 658 ? 43.039  64.067  65.524  1.00 57.66  ? 658 LEU B N     1 
ATOM   9883  C  CA    . LEU B 1 658 ? 44.260  64.853  65.334  1.00 56.63  ? 658 LEU B CA    1 
ATOM   9884  C  C     . LEU B 1 658 ? 44.895  64.561  63.976  1.00 55.73  ? 658 LEU B C     1 
ATOM   9885  O  O     . LEU B 1 658 ? 45.219  65.489  63.240  1.00 59.35  ? 658 LEU B O     1 
ATOM   9886  C  CB    . LEU B 1 658 ? 45.264  64.580  66.464  1.00 54.43  ? 658 LEU B CB    1 
ATOM   9887  C  CG    . LEU B 1 658 ? 44.937  65.186  67.833  1.00 52.47  ? 658 LEU B CG    1 
ATOM   9888  C  CD1   . LEU B 1 658 ? 45.729  64.520  68.937  1.00 52.84  ? 658 LEU B CD1   1 
ATOM   9889  C  CD2   . LEU B 1 658 ? 45.200  66.682  67.823  1.00 49.07  ? 658 LEU B CD2   1 
ATOM   9890  N  N     . ALA B 1 659 ? 45.073  63.281  63.650  1.00 50.63  ? 659 ALA B N     1 
ATOM   9891  C  CA    . ALA B 1 659 ? 45.690  62.895  62.378  1.00 54.58  ? 659 ALA B CA    1 
ATOM   9892  C  C     . ALA B 1 659 ? 44.925  63.464  61.181  1.00 67.48  ? 659 ALA B C     1 
ATOM   9893  O  O     . ALA B 1 659 ? 45.519  63.958  60.213  1.00 72.85  ? 659 ALA B O     1 
ATOM   9894  C  CB    . ALA B 1 659 ? 45.773  61.389  62.275  1.00 60.48  ? 659 ALA B CB    1 
ATOM   9895  N  N     . ASP B 1 660 ? 43.601  63.406  61.267  1.00 65.31  ? 660 ASP B N     1 
ATOM   9896  C  CA    . ASP B 1 660 ? 42.736  63.984  60.250  1.00 69.69  ? 660 ASP B CA    1 
ATOM   9897  C  C     . ASP B 1 660 ? 42.970  65.481  60.063  1.00 67.29  ? 660 ASP B C     1 
ATOM   9898  O  O     . ASP B 1 660 ? 43.231  65.945  58.937  1.00 67.48  ? 660 ASP B O     1 
ATOM   9899  C  CB    . ASP B 1 660 ? 41.270  63.725  60.598  1.00 67.87  ? 660 ASP B CB    1 
ATOM   9900  C  CG    . ASP B 1 660 ? 40.440  63.393  59.385  1.00 73.24  ? 660 ASP B CG    1 
ATOM   9901  O  OD1   . ASP B 1 660 ? 39.583  64.227  59.020  1.00 83.76  ? 660 ASP B OD1   1 
ATOM   9902  O  OD2   . ASP B 1 660 ? 40.651  62.306  58.791  1.00 71.12  ? 660 ASP B OD2   1 
ATOM   9903  N  N     . ARG B 1 661 ? 42.841  66.239  61.155  1.00 62.28  ? 661 ARG B N     1 
ATOM   9904  C  CA    . ARG B 1 661 ? 43.004  67.694  61.063  1.00 65.71  ? 661 ARG B CA    1 
ATOM   9905  C  C     . ARG B 1 661 ? 44.417  68.068  60.588  1.00 70.04  ? 661 ARG B C     1 
ATOM   9906  O  O     . ARG B 1 661 ? 44.603  69.045  59.845  1.00 73.26  ? 661 ARG B O     1 
ATOM   9907  C  CB    . ARG B 1 661 ? 42.677  68.355  62.403  1.00 67.04  ? 661 ARG B CB    1 
ATOM   9908  C  CG    . ARG B 1 661 ? 41.282  67.988  62.930  1.00 71.78  ? 661 ARG B CG    1 
ATOM   9909  C  CD    . ARG B 1 661 ? 40.481  69.211  63.340  1.00 65.80  ? 661 ARG B CD    1 
ATOM   9910  N  NE    . ARG B 1 661 ? 39.419  69.526  62.388  1.00 78.58  ? 661 ARG B NE    1 
ATOM   9911  C  CZ    . ARG B 1 661 ? 38.686  70.639  62.427  1.00 85.71  ? 661 ARG B CZ    1 
ATOM   9912  N  NH1   . ARG B 1 661 ? 37.736  70.848  61.520  1.00 77.78  ? 661 ARG B NH1   1 
ATOM   9913  N  NH2   . ARG B 1 661 ? 38.909  71.549  63.372  1.00 76.81  ? 661 ARG B NH2   1 
ATOM   9914  N  N     . LEU B 1 662 ? 45.400  67.272  61.002  1.00 64.30  ? 662 LEU B N     1 
ATOM   9915  C  CA    . LEU B 1 662 ? 46.784  67.471  60.589  1.00 71.30  ? 662 LEU B CA    1 
ATOM   9916  C  C     . LEU B 1 662 ? 46.924  67.308  59.086  1.00 71.47  ? 662 LEU B C     1 
ATOM   9917  O  O     . LEU B 1 662 ? 47.506  68.164  58.428  1.00 72.00  ? 662 LEU B O     1 
ATOM   9918  C  CB    . LEU B 1 662 ? 47.726  66.491  61.306  1.00 63.10  ? 662 LEU B CB    1 
ATOM   9919  C  CG    . LEU B 1 662 ? 49.181  66.405  60.801  1.00 71.70  ? 662 LEU B CG    1 
ATOM   9920  C  CD1   . LEU B 1 662 ? 49.896  67.754  60.829  1.00 69.85  ? 662 LEU B CD1   1 
ATOM   9921  C  CD2   . LEU B 1 662 ? 50.006  65.357  61.573  1.00 65.49  ? 662 LEU B CD2   1 
ATOM   9922  N  N     . VAL B 1 663 ? 46.388  66.214  58.544  1.00 70.66  ? 663 VAL B N     1 
ATOM   9923  C  CA    . VAL B 1 663 ? 46.463  65.979  57.103  1.00 66.93  ? 663 VAL B CA    1 
ATOM   9924  C  C     . VAL B 1 663 ? 45.759  67.105  56.337  1.00 70.58  ? 663 VAL B C     1 
ATOM   9925  O  O     . VAL B 1 663 ? 46.287  67.604  55.335  1.00 73.83  ? 663 VAL B O     1 
ATOM   9926  C  CB    . VAL B 1 663 ? 45.854  64.613  56.714  1.00 69.80  ? 663 VAL B CB    1 
ATOM   9927  C  CG1   . VAL B 1 663 ? 45.662  64.525  55.209  1.00 67.96  ? 663 VAL B CG1   1 
ATOM   9928  C  CG2   . VAL B 1 663 ? 46.754  63.479  57.177  1.00 65.96  ? 663 VAL B CG2   1 
ATOM   9929  N  N     . LYS B 1 664 ? 44.586  67.521  56.820  1.00 66.47  ? 664 LYS B N     1 
ATOM   9930  C  CA    . LYS B 1 664 ? 43.879  68.647  56.203  1.00 77.02  ? 664 LYS B CA    1 
ATOM   9931  C  C     . LYS B 1 664 ? 44.764  69.893  56.127  1.00 81.08  ? 664 LYS B C     1 
ATOM   9932  O  O     . LYS B 1 664 ? 44.868  70.543  55.074  1.00 79.98  ? 664 LYS B O     1 
ATOM   9933  C  CB    . LYS B 1 664 ? 42.599  68.993  56.971  1.00 75.17  ? 664 LYS B CB    1 
ATOM   9934  C  CG    . LYS B 1 664 ? 41.463  67.995  56.846  1.00 76.40  ? 664 LYS B CG    1 
ATOM   9935  C  CD    . LYS B 1 664 ? 40.348  68.362  57.820  1.00 81.90  ? 664 LYS B CD    1 
ATOM   9936  C  CE    . LYS B 1 664 ? 39.356  67.224  58.025  1.00 81.07  ? 664 LYS B CE    1 
ATOM   9937  N  NZ    . LYS B 1 664 ? 38.425  67.061  56.879  1.00 81.98  ? 664 LYS B NZ    1 
ATOM   9938  N  N     . GLU B 1 665 ? 45.400  70.230  57.246  1.00 80.10  ? 665 GLU B N     1 
ATOM   9939  C  CA    . GLU B 1 665 ? 46.188  71.455  57.281  1.00 81.78  ? 665 GLU B CA    1 
ATOM   9940  C  C     . GLU B 1 665 ? 47.463  71.316  56.454  1.00 81.51  ? 665 GLU B C     1 
ATOM   9941  O  O     . GLU B 1 665 ? 47.948  72.297  55.900  1.00 86.64  ? 665 GLU B O     1 
ATOM   9942  C  CB    . GLU B 1 665 ? 46.510  71.856  58.719  1.00 78.30  ? 665 GLU B CB    1 
ATOM   9943  C  CG    . GLU B 1 665 ? 45.299  72.398  59.468  1.00 78.40  ? 665 GLU B CG    1 
ATOM   9944  C  CD    . GLU B 1 665 ? 44.762  73.692  58.865  1.00 84.84  ? 665 GLU B CD    1 
ATOM   9945  O  OE1   . GLU B 1 665 ? 43.533  73.902  58.914  1.00 84.75  ? 665 GLU B OE1   1 
ATOM   9946  O  OE2   . GLU B 1 665 ? 45.561  74.515  58.365  1.00 91.09  ? 665 GLU B OE2   1 
ATOM   9947  N  N     . VAL B 1 666 ? 48.006  70.106  56.379  1.00 76.45  ? 666 VAL B N     1 
ATOM   9948  C  CA    . VAL B 1 666 ? 49.156  69.843  55.520  1.00 83.09  ? 666 VAL B CA    1 
ATOM   9949  C  C     . VAL B 1 666 ? 48.787  70.107  54.064  1.00 90.66  ? 666 VAL B C     1 
ATOM   9950  O  O     . VAL B 1 666 ? 49.556  70.723  53.315  1.00 92.72  ? 666 VAL B O     1 
ATOM   9951  C  CB    . VAL B 1 666 ? 49.663  68.397  55.675  1.00 79.58  ? 666 VAL B CB    1 
ATOM   9952  C  CG1   . VAL B 1 666 ? 50.553  68.011  54.506  1.00 85.26  ? 666 VAL B CG1   1 
ATOM   9953  C  CG2   . VAL B 1 666 ? 50.408  68.244  56.987  1.00 81.83  ? 666 VAL B CG2   1 
ATOM   9954  N  N     . GLY B 1 667 ? 47.595  69.658  53.676  1.00 82.78  ? 667 GLY B N     1 
ATOM   9955  C  CA    . GLY B 1 667 ? 47.101  69.889  52.332  1.00 82.99  ? 667 GLY B CA    1 
ATOM   9956  C  C     . GLY B 1 667 ? 46.868  71.358  52.050  1.00 87.54  ? 667 GLY B C     1 
ATOM   9957  O  O     . GLY B 1 667 ? 47.085  71.833  50.934  1.00 88.52  ? 667 GLY B O     1 
ATOM   9958  N  N     . ARG B 1 668 ? 46.400  72.079  53.063  1.00 87.41  ? 668 ARG B N     1 
ATOM   9959  C  CA    . ARG B 1 668 ? 46.071  73.490  52.895  1.00 89.80  ? 668 ARG B CA    1 
ATOM   9960  C  C     . ARG B 1 668 ? 47.280  74.435  52.994  1.00 92.36  ? 668 ARG B C     1 
ATOM   9961  O  O     . ARG B 1 668 ? 47.209  75.584  52.555  1.00 92.86  ? 668 ARG B O     1 
ATOM   9962  C  CB    . ARG B 1 668 ? 45.010  73.890  53.924  1.00 91.39  ? 668 ARG B CB    1 
ATOM   9963  C  CG    . ARG B 1 668 ? 43.589  73.693  53.424  1.00 93.30  ? 668 ARG B CG    1 
ATOM   9964  C  CD    . ARG B 1 668 ? 42.703  72.978  54.441  1.00 94.88  ? 668 ARG B CD    1 
ATOM   9965  N  NE    . ARG B 1 668 ? 42.523  73.724  55.685  1.00 92.41  ? 668 ARG B NE    1 
ATOM   9966  C  CZ    . ARG B 1 668 ? 41.579  73.451  56.584  1.00 94.83  ? 668 ARG B CZ    1 
ATOM   9967  N  NH1   . ARG B 1 668 ? 40.734  72.448  56.379  1.00 88.40  ? 668 ARG B NH1   1 
ATOM   9968  N  NH2   . ARG B 1 668 ? 41.478  74.177  57.691  1.00 95.11  ? 668 ARG B NH2   1 
ATOM   9969  N  N     . LEU B 1 669 ? 48.378  73.957  53.576  1.00 90.84  ? 669 LEU B N     1 
ATOM   9970  C  CA    . LEU B 1 669 ? 49.537  74.809  53.852  1.00 92.52  ? 669 LEU B CA    1 
ATOM   9971  C  C     . LEU B 1 669 ? 50.820  74.433  53.102  1.00 96.56  ? 669 LEU B C     1 
ATOM   9972  O  O     . LEU B 1 669 ? 51.741  75.247  52.994  1.00 94.28  ? 669 LEU B O     1 
ATOM   9973  C  CB    . LEU B 1 669 ? 49.828  74.815  55.355  1.00 87.38  ? 669 LEU B CB    1 
ATOM   9974  C  CG    . LEU B 1 669 ? 48.727  75.379  56.252  1.00 88.61  ? 669 LEU B CG    1 
ATOM   9975  C  CD1   . LEU B 1 669 ? 49.230  75.568  57.674  1.00 91.71  ? 669 LEU B CD1   1 
ATOM   9976  C  CD2   . LEU B 1 669 ? 48.193  76.682  55.689  1.00 90.63  ? 669 LEU B CD2   1 
ATOM   9977  N  N     . GLY B 1 670 ? 50.882  73.213  52.580  1.00 92.90  ? 670 GLY B N     1 
ATOM   9978  C  CA    . GLY B 1 670 ? 52.071  72.752  51.887  1.00 87.89  ? 670 GLY B CA    1 
ATOM   9979  C  C     . GLY B 1 670 ? 53.042  72.163  52.894  1.00 92.03  ? 670 GLY B C     1 
ATOM   9980  O  O     . GLY B 1 670 ? 53.380  72.788  53.899  1.00 89.81  ? 670 GLY B O     1 
ATOM   9981  N  N     . ILE B 1 671 ? 53.503  70.953  52.607  1.00 92.59  ? 671 ILE B N     1 
ATOM   9982  C  CA    . ILE B 1 671 ? 54.225  70.143  53.582  1.00 92.76  ? 671 ILE B CA    1 
ATOM   9983  C  C     . ILE B 1 671 ? 55.734  70.431  53.646  1.00 91.43  ? 671 ILE B C     1 
ATOM   9984  O  O     . ILE B 1 671 ? 56.516  70.041  52.778  1.00 95.46  ? 671 ILE B O     1 
ATOM   9985  C  CB    . ILE B 1 671 ? 53.963  68.637  53.290  1.00 92.80  ? 671 ILE B CB    1 
ATOM   9986  C  CG1   . ILE B 1 671 ? 54.784  67.737  54.208  1.00 95.58  ? 671 ILE B CG1   1 
ATOM   9987  C  CG2   . ILE B 1 671 ? 54.237  68.291  51.823  1.00 90.87  ? 671 ILE B CG2   1 
ATOM   9988  C  CD1   . ILE B 1 671 ? 54.608  66.281  53.881  1.00 92.42  ? 671 ILE B CD1   1 
ATOM   9989  N  N     . VAL B 1 677 ? 59.124  73.605  64.268  1.00 94.22  ? 677 VAL B N     1 
ATOM   9990  C  CA    . VAL B 1 677 ? 57.950  73.366  65.102  1.00 90.54  ? 677 VAL B CA    1 
ATOM   9991  C  C     . VAL B 1 677 ? 58.127  72.147  65.998  1.00 88.25  ? 677 VAL B C     1 
ATOM   9992  O  O     . VAL B 1 677 ? 58.282  71.027  65.507  1.00 84.77  ? 677 VAL B O     1 
ATOM   9993  C  CB    . VAL B 1 677 ? 56.681  73.172  64.256  1.00 91.63  ? 677 VAL B CB    1 
ATOM   9994  C  CG1   . VAL B 1 677 ? 55.463  73.042  65.160  1.00 87.75  ? 677 VAL B CG1   1 
ATOM   9995  C  CG2   . VAL B 1 677 ? 56.517  74.321  63.272  1.00 94.34  ? 677 VAL B CG2   1 
ATOM   9996  N  N     . ASP B 1 678 ? 58.120  72.375  67.310  1.00 88.12  ? 678 ASP B N     1 
ATOM   9997  C  CA    . ASP B 1 678 ? 58.190  71.283  68.278  1.00 87.77  ? 678 ASP B CA    1 
ATOM   9998  C  C     . ASP B 1 678 ? 57.071  70.284  68.003  1.00 89.53  ? 678 ASP B C     1 
ATOM   9999  O  O     . ASP B 1 678 ? 55.969  70.669  67.602  1.00 88.73  ? 678 ASP B O     1 
ATOM   10000 C  CB    . ASP B 1 678 ? 58.094  71.816  69.711  1.00 91.93  ? 678 ASP B CB    1 
ATOM   10001 C  CG    . ASP B 1 678 ? 59.221  72.780  70.055  1.00 101.22 ? 678 ASP B CG    1 
ATOM   10002 O  OD1   . ASP B 1 678 ? 59.987  73.160  69.140  1.00 99.42  ? 678 ASP B OD1   1 
ATOM   10003 O  OD2   . ASP B 1 678 ? 59.342  73.155  71.243  1.00 102.73 ? 678 ASP B OD2   1 
ATOM   10004 N  N     . ARG B 1 679 ? 57.348  69.007  68.230  1.00 85.34  ? 679 ARG B N     1 
ATOM   10005 C  CA    . ARG B 1 679 ? 56.403  67.959  67.871  1.00 87.09  ? 679 ARG B CA    1 
ATOM   10006 C  C     . ARG B 1 679 ? 55.274  67.797  68.880  1.00 88.27  ? 679 ARG B C     1 
ATOM   10007 O  O     . ARG B 1 679 ? 54.360  67.000  68.667  1.00 88.55  ? 679 ARG B O     1 
ATOM   10008 C  CB    . ARG B 1 679 ? 57.137  66.638  67.676  1.00 86.37  ? 679 ARG B CB    1 
ATOM   10009 C  CG    . ARG B 1 679 ? 58.263  66.739  66.654  1.00 92.52  ? 679 ARG B CG    1 
ATOM   10010 C  CD    . ARG B 1 679 ? 57.768  66.303  65.289  1.00 82.34  ? 679 ARG B CD    1 
ATOM   10011 N  NE    . ARG B 1 679 ? 57.319  64.921  65.350  1.00 89.36  ? 679 ARG B NE    1 
ATOM   10012 C  CZ    . ARG B 1 679 ? 58.128  63.869  65.357  1.00 87.31  ? 679 ARG B CZ    1 
ATOM   10013 N  NH1   . ARG B 1 679 ? 59.441  64.029  65.260  1.00 86.43  ? 679 ARG B NH1   1 
ATOM   10014 N  NH2   . ARG B 1 679 ? 57.615  62.651  65.439  1.00 87.65  ? 679 ARG B NH2   1 
ATOM   10015 N  N     . GLU B 1 680 ? 55.351  68.530  69.985  1.00 88.98  ? 680 GLU B N     1 
ATOM   10016 C  CA    . GLU B 1 680 ? 54.250  68.574  70.942  1.00 86.49  ? 680 GLU B CA    1 
ATOM   10017 C  C     . GLU B 1 680 ? 53.349  69.775  70.677  1.00 81.28  ? 680 GLU B C     1 
ATOM   10018 O  O     . GLU B 1 680 ? 52.311  69.942  71.321  1.00 84.66  ? 680 GLU B O     1 
ATOM   10019 C  CB    . GLU B 1 680 ? 54.773  68.605  72.375  1.00 87.27  ? 680 GLU B CB    1 
ATOM   10020 C  CG    . GLU B 1 680 ? 55.545  67.360  72.766  1.00 87.89  ? 680 GLU B CG    1 
ATOM   10021 C  CD    . GLU B 1 680 ? 55.608  67.175  74.266  1.00 96.33  ? 680 GLU B CD    1 
ATOM   10022 O  OE1   . GLU B 1 680 ? 55.622  66.011  74.725  1.00 95.09  ? 680 GLU B OE1   1 
ATOM   10023 O  OE2   . GLU B 1 680 ? 55.638  68.198  74.985  1.00 101.83 ? 680 GLU B OE2   1 
ATOM   10024 N  N     . LYS B 1 681 ? 53.746  70.608  69.723  1.00 80.18  ? 681 LYS B N     1 
ATOM   10025 C  CA    . LYS B 1 681 ? 52.951  71.772  69.354  1.00 81.64  ? 681 LYS B CA    1 
ATOM   10026 C  C     . LYS B 1 681 ? 51.911  71.423  68.287  1.00 82.65  ? 681 LYS B C     1 
ATOM   10027 O  O     . LYS B 1 681 ? 52.244  71.252  67.111  1.00 82.01  ? 681 LYS B O     1 
ATOM   10028 C  CB    . LYS B 1 681 ? 53.858  72.892  68.851  1.00 83.38  ? 681 LYS B CB    1 
ATOM   10029 C  CG    . LYS B 1 681 ? 54.720  73.535  69.928  1.00 85.43  ? 681 LYS B CG    1 
ATOM   10030 C  CD    . LYS B 1 681 ? 55.395  74.788  69.386  1.00 87.52  ? 681 LYS B CD    1 
ATOM   10031 C  CE    . LYS B 1 681 ? 56.118  75.563  70.476  1.00 92.22  ? 681 LYS B CE    1 
ATOM   10032 N  NZ    . LYS B 1 681 ? 56.705  76.817  69.931  1.00 89.26  ? 681 LYS B NZ    1 
ATOM   10033 N  N     . LEU B 1 682 ? 50.650  71.332  68.706  1.00 81.99  ? 682 LEU B N     1 
ATOM   10034 C  CA    . LEU B 1 682 ? 49.553  70.922  67.827  1.00 72.33  ? 682 LEU B CA    1 
ATOM   10035 C  C     . LEU B 1 682 ? 49.090  72.074  66.943  1.00 70.16  ? 682 LEU B C     1 
ATOM   10036 O  O     . LEU B 1 682 ? 47.990  72.594  67.120  1.00 67.41  ? 682 LEU B O     1 
ATOM   10037 C  CB    . LEU B 1 682 ? 48.382  70.407  68.662  1.00 66.36  ? 682 LEU B CB    1 
ATOM   10038 C  CG    . LEU B 1 682 ? 48.749  69.361  69.716  1.00 72.50  ? 682 LEU B CG    1 
ATOM   10039 C  CD1   . LEU B 1 682 ? 47.506  68.821  70.394  1.00 70.38  ? 682 LEU B CD1   1 
ATOM   10040 C  CD2   . LEU B 1 682 ? 49.558  68.230  69.102  1.00 74.99  ? 682 LEU B CD2   1 
ATOM   10041 N  N     . PHE B 1 683 ? 49.942  72.469  65.999  1.00 73.96  ? 683 PHE B N     1 
ATOM   10042 C  CA    . PHE B 1 683 ? 49.746  73.678  65.188  1.00 71.86  ? 683 PHE B CA    1 
ATOM   10043 C  C     . PHE B 1 683 ? 48.517  73.655  64.267  1.00 70.04  ? 683 PHE B C     1 
ATOM   10044 O  O     . PHE B 1 683 ? 48.051  74.700  63.806  1.00 69.13  ? 683 PHE B O     1 
ATOM   10045 C  CB    . PHE B 1 683 ? 51.006  73.931  64.355  1.00 72.49  ? 683 PHE B CB    1 
ATOM   10046 C  CG    . PHE B 1 683 ? 51.307  72.839  63.369  1.00 73.64  ? 683 PHE B CG    1 
ATOM   10047 C  CD1   . PHE B 1 683 ? 52.036  71.723  63.754  1.00 71.05  ? 683 PHE B CD1   1 
ATOM   10048 C  CD2   . PHE B 1 683 ? 50.869  72.929  62.057  1.00 75.84  ? 683 PHE B CD2   1 
ATOM   10049 C  CE1   . PHE B 1 683 ? 52.316  70.713  62.852  1.00 73.13  ? 683 PHE B CE1   1 
ATOM   10050 C  CE2   . PHE B 1 683 ? 51.146  71.918  61.150  1.00 74.05  ? 683 PHE B CE2   1 
ATOM   10051 C  CZ    . PHE B 1 683 ? 51.875  70.811  61.549  1.00 67.00  ? 683 PHE B CZ    1 
ATOM   10052 N  N     . PHE B 1 684 ? 47.998  72.459  64.012  1.00 74.19  ? 684 PHE B N     1 
ATOM   10053 C  CA    . PHE B 1 684 ? 46.981  72.238  62.989  1.00 68.32  ? 684 PHE B CA    1 
ATOM   10054 C  C     . PHE B 1 684 ? 45.533  72.216  63.500  1.00 73.71  ? 684 PHE B C     1 
ATOM   10055 O  O     . PHE B 1 684 ? 44.597  72.015  62.720  1.00 71.00  ? 684 PHE B O     1 
ATOM   10056 C  CB    . PHE B 1 684 ? 47.280  70.921  62.288  1.00 65.85  ? 684 PHE B CB    1 
ATOM   10057 C  CG    . PHE B 1 684 ? 47.570  69.801  63.239  1.00 69.82  ? 684 PHE B CG    1 
ATOM   10058 C  CD1   . PHE B 1 684 ? 46.540  69.046  63.780  1.00 65.76  ? 684 PHE B CD1   1 
ATOM   10059 C  CD2   . PHE B 1 684 ? 48.873  69.517  63.614  1.00 69.00  ? 684 PHE B CD2   1 
ATOM   10060 C  CE1   . PHE B 1 684 ? 46.808  68.016  64.667  1.00 63.65  ? 684 PHE B CE1   1 
ATOM   10061 C  CE2   . PHE B 1 684 ? 49.146  68.490  64.494  1.00 71.31  ? 684 PHE B CE2   1 
ATOM   10062 C  CZ    . PHE B 1 684 ? 48.109  67.737  65.022  1.00 67.57  ? 684 PHE B CZ    1 
ATOM   10063 N  N     . VAL B 1 685 ? 45.334  72.422  64.795  1.00 71.36  ? 685 VAL B N     1 
ATOM   10064 C  CA    . VAL B 1 685 ? 44.001  72.260  65.354  1.00 66.25  ? 685 VAL B CA    1 
ATOM   10065 C  C     . VAL B 1 685 ? 43.184  73.523  65.137  1.00 68.24  ? 685 VAL B C     1 
ATOM   10066 O  O     . VAL B 1 685 ? 43.721  74.570  64.779  1.00 69.24  ? 685 VAL B O     1 
ATOM   10067 C  CB    . VAL B 1 685 ? 44.050  71.925  66.856  1.00 68.92  ? 685 VAL B CB    1 
ATOM   10068 C  CG1   . VAL B 1 685 ? 44.785  70.610  67.077  1.00 61.14  ? 685 VAL B CG1   1 
ATOM   10069 C  CG2   . VAL B 1 685 ? 44.724  73.050  67.625  1.00 66.06  ? 685 VAL B CG2   1 
ATOM   10070 O  OXT   . VAL B 1 685 ? 41.965  73.520  65.295  1.00 68.92  ? 685 VAL B OXT   1 
ATOM   10071 O  OP3   . DT  C 2 1   ? 17.056  -1.736  2.460   1.00 36.76  ? 1   DT  C OP3   1 
ATOM   10072 P  P     . DT  C 2 1   ? 17.559  -3.077  2.859   1.00 33.69  ? 1   DT  C P     1 
ATOM   10073 O  OP1   . DT  C 2 1   ? 18.874  -3.494  2.361   1.00 37.45  ? 1   DT  C OP1   1 
ATOM   10074 O  OP2   . DT  C 2 1   ? 17.568  -3.083  4.351   1.00 30.11  ? 1   DT  C OP2   1 
ATOM   10075 O  "O5'" . DT  C 2 1   ? 16.518  -4.190  2.325   1.00 39.04  ? 1   DT  C "O5'" 1 
ATOM   10076 C  "C5'" . DT  C 2 1   ? 15.114  -4.135  2.533   1.00 38.65  ? 1   DT  C "C5'" 1 
ATOM   10077 C  "C4'" . DT  C 2 1   ? 14.524  -5.509  2.212   1.00 40.16  ? 1   DT  C "C4'" 1 
ATOM   10078 O  "O4'" . DT  C 2 1   ? 14.798  -6.420  3.301   1.00 38.91  ? 1   DT  C "O4'" 1 
ATOM   10079 C  "C3'" . DT  C 2 1   ? 13.001  -5.621  1.953   1.00 37.45  ? 1   DT  C "C3'" 1 
ATOM   10080 O  "O3'" . DT  C 2 1   ? 12.846  -6.154  0.649   1.00 41.54  ? 1   DT  C "O3'" 1 
ATOM   10081 C  "C2'" . DT  C 2 1   ? 12.499  -6.630  2.989   1.00 36.69  ? 1   DT  C "C2'" 1 
ATOM   10082 C  "C1'" . DT  C 2 1   ? 13.772  -7.414  3.303   1.00 35.62  ? 1   DT  C "C1'" 1 
ATOM   10083 N  N1    . DT  C 2 1   ? 13.858  -7.981  4.658   1.00 41.82  ? 1   DT  C N1    1 
ATOM   10084 C  C2    . DT  C 2 1   ? 14.032  -9.344  4.845   1.00 38.33  ? 1   DT  C C2    1 
ATOM   10085 O  O2    . DT  C 2 1   ? 14.122  -10.141 3.943   1.00 38.82  ? 1   DT  C O2    1 
ATOM   10086 N  N3    . DT  C 2 1   ? 14.119  -9.749  6.144   1.00 38.40  ? 1   DT  C N3    1 
ATOM   10087 C  C4    . DT  C 2 1   ? 14.050  -8.940  7.266   1.00 51.09  ? 1   DT  C C4    1 
ATOM   10088 O  O4    . DT  C 2 1   ? 14.141  -9.403  8.410   1.00 57.73  ? 1   DT  C O4    1 
ATOM   10089 C  C5    . DT  C 2 1   ? 13.878  -7.525  6.999   1.00 43.33  ? 1   DT  C C5    1 
ATOM   10090 C  C7    . DT  C 2 1   ? 13.791  -6.538  8.128   1.00 46.33  ? 1   DT  C C7    1 
ATOM   10091 C  C6    . DT  C 2 1   ? 13.780  -7.121  5.729   1.00 41.17  ? 1   DT  C C6    1 
ATOM   10092 P  P     . DG  C 2 2   ? 11.548  -5.818  -0.239  1.00 38.68  ? 2   DG  C P     1 
ATOM   10093 O  OP1   . DG  C 2 2   ? 10.384  -6.102  0.613   1.00 47.51  ? 2   DG  C OP1   1 
ATOM   10094 O  OP2   . DG  C 2 2   ? 11.716  -6.440  -1.583  1.00 34.19  ? 2   DG  C OP2   1 
ATOM   10095 O  "O5'" . DG  C 2 2   ? 11.618  -4.229  -0.426  1.00 33.43  ? 2   DG  C "O5'" 1 
ATOM   10096 C  "C5'" . DG  C 2 2   ? 12.800  -3.580  -0.949  1.00 39.38  ? 2   DG  C "C5'" 1 
ATOM   10097 C  "C4'" . DG  C 2 2   ? 12.492  -2.121  -0.685  1.00 33.61  ? 2   DG  C "C4'" 1 
ATOM   10098 O  "O4'" . DG  C 2 2   ? 11.326  -1.677  -1.396  1.00 43.02  ? 2   DG  C "O4'" 1 
ATOM   10099 C  "C3'" . DG  C 2 2   ? 12.301  -1.748  0.770   1.00 38.77  ? 2   DG  C "C3'" 1 
ATOM   10100 O  "O3'" . DG  C 2 2   ? 13.331  -0.808  1.089   1.00 34.91  ? 2   DG  C "O3'" 1 
ATOM   10101 C  "C2'" . DG  C 2 2   ? 10.881  -1.185  0.884   1.00 38.12  ? 2   DG  C "C2'" 1 
ATOM   10102 C  "C1'" . DG  C 2 2   ? 10.466  -0.931  -0.554  1.00 35.87  ? 2   DG  C "C1'" 1 
ATOM   10103 N  N9    . DG  C 2 2   ? 9.095   -1.357  -0.759  1.00 39.60  ? 2   DG  C N9    1 
ATOM   10104 C  C8    . DG  C 2 2   ? 8.555   -2.608  -0.572  1.00 35.80  ? 2   DG  C C8    1 
ATOM   10105 N  N7    . DG  C 2 2   ? 7.282   -2.645  -0.870  1.00 38.71  ? 2   DG  C N7    1 
ATOM   10106 C  C5    . DG  C 2 2   ? 6.983   -1.359  -1.307  1.00 42.29  ? 2   DG  C C5    1 
ATOM   10107 C  C6    . DG  C 2 2   ? 5.767   -0.795  -1.769  1.00 37.17  ? 2   DG  C C6    1 
ATOM   10108 O  O6    . DG  C 2 2   ? 4.675   -1.344  -1.887  1.00 39.28  ? 2   DG  C O6    1 
ATOM   10109 N  N1    . DG  C 2 2   ? 5.910   0.550   -2.107  1.00 37.67  ? 2   DG  C N1    1 
ATOM   10110 C  C2    . DG  C 2 2   ? 7.095   1.267   -1.991  1.00 38.91  ? 2   DG  C C2    1 
ATOM   10111 N  N2    . DG  C 2 2   ? 7.081   2.562   -2.343  1.00 31.74  ? 2   DG  C N2    1 
ATOM   10112 N  N3    . DG  C 2 2   ? 8.238   0.743   -1.575  1.00 35.20  ? 2   DG  C N3    1 
ATOM   10113 C  C4    . DG  C 2 2   ? 8.097   -0.554  -1.236  1.00 34.25  ? 2   DG  C C4    1 
ATOM   10114 P  P     . DA  C 2 3   ? 13.412  -0.146  2.553   1.00 37.32  ? 3   DA  C P     1 
ATOM   10115 O  OP1   . DA  C 2 3   ? 14.722  0.541   2.671   1.00 39.86  ? 3   DA  C OP1   1 
ATOM   10116 O  OP2   . DA  C 2 3   ? 13.073  -1.102  3.621   1.00 36.89  ? 3   DA  C OP2   1 
ATOM   10117 O  "O5'" . DA  C 2 3   ? 12.304  0.990   2.454   1.00 36.83  ? 3   DA  C "O5'" 1 
ATOM   10118 C  "C5'" . DA  C 2 3   ? 12.517  2.002   1.496   1.00 34.58  ? 3   DA  C "C5'" 1 
ATOM   10119 C  "C4'" . DA  C 2 3   ? 11.333  2.955   1.513   1.00 38.13  ? 3   DA  C "C4'" 1 
ATOM   10120 O  "O4'" . DA  C 2 3   ? 10.189  2.335   0.874   1.00 43.46  ? 3   DA  C "O4'" 1 
ATOM   10121 C  "C3'" . DA  C 2 3   ? 10.838  3.430   2.873   1.00 36.66  ? 3   DA  C "C3'" 1 
ATOM   10122 O  "O3'" . DA  C 2 3   ? 11.512  4.640   3.220   1.00 30.44  ? 3   DA  C "O3'" 1 
ATOM   10123 C  "C2'" . DA  C 2 3   ? 9.352   3.689   2.667   1.00 43.28  ? 3   DA  C "C2'" 1 
ATOM   10124 C  "C1'" . DA  C 2 3   ? 9.007   2.846   1.442   1.00 41.14  ? 3   DA  C "C1'" 1 
ATOM   10125 N  N9    . DA  C 2 3   ? 8.071   1.766   1.657   1.00 42.49  ? 3   DA  C N9    1 
ATOM   10126 C  C8    . DA  C 2 3   ? 8.264   0.511   2.143   1.00 42.25  ? 3   DA  C C8    1 
ATOM   10127 N  N7    . DA  C 2 3   ? 7.162   -0.210  2.156   1.00 38.82  ? 3   DA  C N7    1 
ATOM   10128 C  C5    . DA  C 2 3   ? 6.214   0.629   1.618   1.00 36.54  ? 3   DA  C C5    1 
ATOM   10129 C  C6    . DA  C 2 3   ? 4.850   0.456   1.354   1.00 39.88  ? 3   DA  C C6    1 
ATOM   10130 N  N6    . DA  C 2 3   ? 4.225   -0.703  1.626   1.00 41.27  ? 3   DA  C N6    1 
ATOM   10131 N  N1    . DA  C 2 3   ? 4.181   1.514   0.818   1.00 37.60  ? 3   DA  C N1    1 
ATOM   10132 C  C2    . DA  C 2 3   ? 4.839   2.657   0.545   1.00 42.77  ? 3   DA  C C2    1 
ATOM   10133 N  N3    . DA  C 2 3   ? 6.137   2.925   0.752   1.00 39.74  ? 3   DA  C N3    1 
ATOM   10134 C  C4    . DA  C 2 3   ? 6.754   1.855   1.298   1.00 42.52  ? 3   DA  C C4    1 
ATOM   10135 P  P     . DG  C 2 4   ? 11.364  5.218   4.706   1.00 35.44  ? 4   DG  C P     1 
ATOM   10136 O  OP1   . DG  C 2 4   ? 12.443  6.209   4.877   1.00 36.35  ? 4   DG  C OP1   1 
ATOM   10137 O  OP2   . DG  C 2 4   ? 11.171  4.138   5.687   1.00 36.95  ? 4   DG  C OP2   1 
ATOM   10138 O  "O5'" . DG  C 2 4   ? 9.957   5.986   4.656   1.00 33.77  ? 4   DG  C "O5'" 1 
ATOM   10139 C  "C5'" . DG  C 2 4   ? 9.817   7.122   3.824   1.00 34.45  ? 4   DG  C "C5'" 1 
ATOM   10140 C  "C4'" . DG  C 2 4   ? 8.366   7.592   3.740   1.00 33.01  ? 4   DG  C "C4'" 1 
ATOM   10141 O  "O4'" . DG  C 2 4   ? 7.534   6.634   3.047   1.00 41.68  ? 4   DG  C "O4'" 1 
ATOM   10142 C  "C3'" . DG  C 2 4   ? 7.778   7.669   5.133   1.00 33.64  ? 4   DG  C "C3'" 1 
ATOM   10143 O  "O3'" . DG  C 2 4   ? 8.028   8.922   5.752   1.00 31.61  ? 4   DG  C "O3'" 1 
ATOM   10144 C  "C2'" . DG  C 2 4   ? 6.282   7.410   4.909   1.00 38.45  ? 4   DG  C "C2'" 1 
ATOM   10145 C  "C1'" . DG  C 2 4   ? 6.232   6.602   3.612   1.00 37.06  ? 4   DG  C "C1'" 1 
ATOM   10146 N  N9    . DG  C 2 4   ? 5.851   5.212   3.898   1.00 41.97  ? 4   DG  C N9    1 
ATOM   10147 C  C8    . DG  C 2 4   ? 6.636   4.242   4.475   1.00 40.51  ? 4   DG  C C8    1 
ATOM   10148 N  N7    . DG  C 2 4   ? 6.036   3.093   4.637   1.00 41.35  ? 4   DG  C N7    1 
ATOM   10149 C  C5    . DG  C 2 4   ? 4.754   3.317   4.166   1.00 44.65  ? 4   DG  C C5    1 
ATOM   10150 C  C6    . DG  C 2 4   ? 3.647   2.430   4.095   1.00 47.60  ? 4   DG  C C6    1 
ATOM   10151 O  O6    . DG  C 2 4   ? 3.604   1.246   4.455   1.00 38.67  ? 4   DG  C O6    1 
ATOM   10152 N  N1    . DG  C 2 4   ? 2.518   3.050   3.553   1.00 39.86  ? 4   DG  C N1    1 
ATOM   10153 C  C2    . DG  C 2 4   ? 2.484   4.361   3.131   1.00 47.41  ? 4   DG  C C2    1 
ATOM   10154 N  N2    . DG  C 2 4   ? 1.312   4.809   2.628   1.00 37.35  ? 4   DG  C N2    1 
ATOM   10155 N  N3    . DG  C 2 4   ? 3.526   5.195   3.191   1.00 40.15  ? 4   DG  C N3    1 
ATOM   10156 C  C4    . DG  C 2 4   ? 4.618   4.613   3.723   1.00 40.44  ? 4   DG  C C4    1 
ATOM   10157 P  P     . DG  C 2 5   ? 7.871   9.045   7.345   1.00 34.32  ? 5   DG  C P     1 
ATOM   10158 O  OP1   . DG  C 2 5   ? 8.668   10.202  7.852   1.00 36.28  ? 5   DG  C OP1   1 
ATOM   10159 O  OP2   . DG  C 2 5   ? 8.090   7.717   7.921   1.00 33.37  ? 5   DG  C OP2   1 
ATOM   10160 O  "O5'" . DG  C 2 5   ? 6.305   9.313   7.525   1.00 35.14  ? 5   DG  C "O5'" 1 
ATOM   10161 C  "C5'" . DG  C 2 5   ? 5.667   10.299  6.733   1.00 35.82  ? 5   DG  C "C5'" 1 
ATOM   10162 C  "C4'" . DG  C 2 5   ? 4.217   10.214  7.146   1.00 39.37  ? 5   DG  C "C4'" 1 
ATOM   10163 O  "O4'" . DG  C 2 5   ? 3.727   8.926   6.727   1.00 45.97  ? 5   DG  C "O4'" 1 
ATOM   10164 C  "C3'" . DG  C 2 5   ? 3.882   10.285  8.629   1.00 42.16  ? 5   DG  C "C3'" 1 
ATOM   10165 O  "O3'" . DG  C 2 5   ? 2.916   11.343  8.738   1.00 36.84  ? 5   DG  C "O3'" 1 
ATOM   10166 C  "C2'" . DG  C 2 5   ? 3.420   8.912   9.058   1.00 42.57  ? 5   DG  C "C2'" 1 
ATOM   10167 C  "C1'" . DG  C 2 5   ? 3.030   8.239   7.752   1.00 44.52  ? 5   DG  C "C1'" 1 
ATOM   10168 N  N9    . DG  C 2 5   ? 3.434   6.833   7.750   1.00 44.12  ? 5   DG  C N9    1 
ATOM   10169 C  C8    . DG  C 2 5   ? 4.701   6.306   7.841   1.00 41.89  ? 5   DG  C C8    1 
ATOM   10170 N  N7    . DG  C 2 5   ? 4.719   5.009   7.753   1.00 41.18  ? 5   DG  C N7    1 
ATOM   10171 C  C5    . DG  C 2 5   ? 3.405   4.649   7.516   1.00 45.00  ? 5   DG  C C5    1 
ATOM   10172 C  C6    . DG  C 2 5   ? 2.828   3.373   7.319   1.00 44.45  ? 5   DG  C C6    1 
ATOM   10173 O  O6    . DG  C 2 5   ? 3.394   2.272   7.312   1.00 44.63  ? 5   DG  C O6    1 
ATOM   10174 N  N1    . DG  C 2 5   ? 1.451   3.460   7.110   1.00 38.21  ? 5   DG  C N1    1 
ATOM   10175 C  C2    . DG  C 2 5   ? 0.731   4.641   7.100   1.00 49.47  ? 5   DG  C C2    1 
ATOM   10176 N  N2    . DG  C 2 5   ? -0.595  4.537   6.885   1.00 37.87  ? 5   DG  C N2    1 
ATOM   10177 N  N3    . DG  C 2 5   ? 1.264   5.851   7.284   1.00 41.20  ? 5   DG  C N3    1 
ATOM   10178 C  C4    . DG  C 2 5   ? 2.600   5.770   7.489   1.00 45.72  ? 5   DG  C C4    1 
ATOM   10179 P  P     . DT  C 2 6   ? 2.351   11.808  10.168  1.00 39.72  ? 6   DT  C P     1 
ATOM   10180 O  OP1   . DT  C 2 6   ? 1.808   13.168  9.921   1.00 40.50  ? 6   DT  C OP1   1 
ATOM   10181 O  OP2   . DT  C 2 6   ? 3.275   11.557  11.274  1.00 38.80  ? 6   DT  C OP2   1 
ATOM   10182 O  "O5'" . DT  C 2 6   ? 1.183   10.744  10.469  1.00 40.49  ? 6   DT  C "O5'" 1 
ATOM   10183 C  "C5'" . DT  C 2 6   ? -0.134  10.959  9.946   1.00 44.23  ? 6   DT  C "C5'" 1 
ATOM   10184 C  "C4'" . DT  C 2 6   ? -0.862  9.640   10.108  1.00 50.81  ? 6   DT  C "C4'" 1 
ATOM   10185 O  "O4'" . DT  C 2 6   ? 0.059   8.590   9.781   1.00 53.15  ? 6   DT  C "O4'" 1 
ATOM   10186 C  "C3'" . DT  C 2 6   ? -1.403  9.282   11.483  1.00 41.73  ? 6   DT  C "C3'" 1 
ATOM   10187 O  "O3'" . DT  C 2 6   ? -2.763  9.519   11.321  1.00 53.86  ? 6   DT  C "O3'" 1 
ATOM   10188 C  "C2'" . DT  C 2 6   ? -1.286  7.778   11.531  1.00 52.16  ? 6   DT  C "C2'" 1 
ATOM   10189 C  "C1'" . DT  C 2 6   ? -0.429  7.400   10.327  1.00 48.83  ? 6   DT  C "C1'" 1 
ATOM   10190 N  N1    . DT  C 2 6   ? 0.633   6.376   10.536  1.00 50.23  ? 6   DT  C N1    1 
ATOM   10191 C  C2    . DT  C 2 6   ? 0.215   5.075   10.378  1.00 48.05  ? 6   DT  C C2    1 
ATOM   10192 O  O2    . DT  C 2 6   ? -0.922  4.792   10.059  1.00 47.61  ? 6   DT  C O2    1 
ATOM   10193 N  N3    . DT  C 2 6   ? 1.180   4.126   10.544  1.00 43.37  ? 6   DT  C N3    1 
ATOM   10194 C  C4    . DT  C 2 6   ? 2.495   4.335   10.883  1.00 48.76  ? 6   DT  C C4    1 
ATOM   10195 O  O4    . DT  C 2 6   ? 3.271   3.388   11.022  1.00 47.16  ? 6   DT  C O4    1 
ATOM   10196 C  C5    . DT  C 2 6   ? 2.868   5.726   11.073  1.00 50.92  ? 6   DT  C C5    1 
ATOM   10197 C  C7    . DT  C 2 6   ? 4.282   6.070   11.453  1.00 43.80  ? 6   DT  C C7    1 
ATOM   10198 C  C6    . DT  C 2 6   ? 1.927   6.676   10.898  1.00 47.01  ? 6   DT  C C6    1 
ATOM   10199 P  P     . DA  C 2 7   ? -3.710  9.924   12.545  1.00 42.13  ? 7   DA  C P     1 
ATOM   10200 O  OP1   . DA  C 2 7   ? -4.797  10.424  11.686  1.00 38.17  ? 7   DA  C OP1   1 
ATOM   10201 O  OP2   . DA  C 2 7   ? -3.075  10.801  13.558  1.00 42.69  ? 7   DA  C OP2   1 
ATOM   10202 O  "O5'" . DA  C 2 7   ? -4.062  8.546   13.295  1.00 45.80  ? 7   DA  C "O5'" 1 
ATOM   10203 C  "C5'" . DA  C 2 7   ? -4.958  7.604   12.864  1.00 48.16  ? 7   DA  C "C5'" 1 
ATOM   10204 C  "C4'" . DA  C 2 7   ? -4.725  6.155   13.297  1.00 45.22  ? 7   DA  C "C4'" 1 
ATOM   10205 O  "O4'" . DA  C 2 7   ? -3.553  5.652   12.608  1.00 45.79  ? 7   DA  C "O4'" 1 
ATOM   10206 C  "C3'" . DA  C 2 7   ? -4.447  5.823   14.766  1.00 40.45  ? 7   DA  C "C3'" 1 
ATOM   10207 O  "O3'" . DA  C 2 7   ? -5.582  5.632   15.556  1.00 40.20  ? 7   DA  C "O3'" 1 
ATOM   10208 C  "C2'" . DA  C 2 7   ? -3.811  4.438   14.621  1.00 48.71  ? 7   DA  C "C2'" 1 
ATOM   10209 C  "C1'" . DA  C 2 7   ? -3.221  4.416   13.216  1.00 49.06  ? 7   DA  C "C1'" 1 
ATOM   10210 N  N9    . DA  C 2 7   ? -1.781  4.249   13.367  1.00 49.30  ? 7   DA  C N9    1 
ATOM   10211 C  C8    . DA  C 2 7   ? -0.833  5.209   13.479  1.00 47.70  ? 7   DA  C C8    1 
ATOM   10212 N  N7    . DA  C 2 7   ? 0.384   4.737   13.597  1.00 49.33  ? 7   DA  C N7    1 
ATOM   10213 C  C5    . DA  C 2 7   ? 0.219   3.367   13.548  1.00 47.87  ? 7   DA  C C5    1 
ATOM   10214 C  C6    . DA  C 2 7   ? 1.134   2.295   13.617  1.00 45.09  ? 7   DA  C C6    1 
ATOM   10215 N  N6    . DA  C 2 7   ? 2.443   2.477   13.761  1.00 43.18  ? 7   DA  C N6    1 
ATOM   10216 N  N1    . DA  C 2 7   ? 0.640   1.043   13.531  1.00 44.95  ? 7   DA  C N1    1 
ATOM   10217 C  C2    . DA  C 2 7   ? -0.680  0.871   13.395  1.00 48.05  ? 7   DA  C C2    1 
ATOM   10218 N  N3    . DA  C 2 7   ? -1.634  1.807   13.315  1.00 46.69  ? 7   DA  C N3    1 
ATOM   10219 C  C4    . DA  C 2 7   ? -1.111  3.045   13.399  1.00 45.68  ? 7   DA  C C4    1 
ATOM   10220 P  P     . DG  C 2 8   ? -5.476  5.633   17.165  1.00 42.71  ? 8   DG  C P     1 
ATOM   10221 O  OP1   . DG  C 2 8   ? -6.831  6.008   17.653  1.00 45.48  ? 8   DG  C OP1   1 
ATOM   10222 O  OP2   . DG  C 2 8   ? -4.309  6.449   17.564  1.00 43.18  ? 8   DG  C OP2   1 
ATOM   10223 O  "O5'" . DG  C 2 8   ? -5.101  4.111   17.521  1.00 45.60  ? 8   DG  C "O5'" 1 
ATOM   10224 C  "C5'" . DG  C 2 8   ? -6.114  3.120   17.469  1.00 40.31  ? 8   DG  C "C5'" 1 
ATOM   10225 C  "C4'" . DG  C 2 8   ? -5.544  1.727   17.666  1.00 40.82  ? 8   DG  C "C4'" 1 
ATOM   10226 O  "O4'" . DG  C 2 8   ? -4.552  1.556   16.619  1.00 45.97  ? 8   DG  C "O4'" 1 
ATOM   10227 C  "C3'" . DG  C 2 8   ? -4.795  1.467   18.968  1.00 39.14  ? 8   DG  C "C3'" 1 
ATOM   10228 O  "O3'" . DG  C 2 8   ? -5.596  0.831   19.883  1.00 42.62  ? 8   DG  C "O3'" 1 
ATOM   10229 C  "C2'" . DG  C 2 8   ? -3.684  0.504   18.585  1.00 43.70  ? 8   DG  C "C2'" 1 
ATOM   10230 C  "C1'" . DG  C 2 8   ? -3.505  0.733   17.092  1.00 44.16  ? 8   DG  C "C1'" 1 
ATOM   10231 N  N9    . DG  C 2 8   ? -2.236  1.452   16.994  1.00 49.38  ? 8   DG  C N9    1 
ATOM   10232 C  C8    . DG  C 2 8   ? -2.002  2.809   17.053  1.00 47.14  ? 8   DG  C C8    1 
ATOM   10233 N  N7    . DG  C 2 8   ? -0.724  3.116   17.023  1.00 47.51  ? 8   DG  C N7    1 
ATOM   10234 C  C5    . DG  C 2 8   ? -0.076  1.889   17.014  1.00 47.43  ? 8   DG  C C5    1 
ATOM   10235 C  C6    . DG  C 2 8   ? 1.311   1.578   16.998  1.00 46.62  ? 8   DG  C C6    1 
ATOM   10236 O  O6    . DG  C 2 8   ? 2.268   2.349   16.981  1.00 42.53  ? 8   DG  C O6    1 
ATOM   10237 N  N1    . DG  C 2 8   ? 1.542   0.207   16.990  1.00 45.01  ? 8   DG  C N1    1 
ATOM   10238 C  C2    . DG  C 2 8   ? 0.548   -0.745  17.008  1.00 47.42  ? 8   DG  C C2    1 
ATOM   10239 N  N2    . DG  C 2 8   ? 0.950   -2.020  17.002  1.00 42.28  ? 8   DG  C N2    1 
ATOM   10240 N  N3    . DG  C 2 8   ? -0.756  -0.468  17.015  1.00 45.84  ? 8   DG  C N3    1 
ATOM   10241 C  C4    . DG  C 2 8   ? -0.992  0.863   17.025  1.00 42.46  ? 8   DG  C C4    1 
ATOM   10242 P  P     . DT  C 2 9   ? -5.239  0.884   21.445  1.00 41.93  ? 9   DT  C P     1 
ATOM   10243 O  OP1   . DT  C 2 9   ? -6.473  0.434   22.139  1.00 44.55  ? 9   DT  C OP1   1 
ATOM   10244 O  OP2   . DT  C 2 9   ? -4.689  2.207   21.796  1.00 39.34  ? 9   DT  C OP2   1 
ATOM   10245 O  "O5'" . DT  C 2 9   ? -4.096  -0.218  21.683  1.00 49.61  ? 9   DT  C "O5'" 1 
ATOM   10246 C  "C5'" . DT  C 2 9   ? -4.385  -1.622  21.629  1.00 44.86  ? 9   DT  C "C5'" 1 
ATOM   10247 C  "C4'" . DT  C 2 9   ? -3.096  -2.388  21.847  1.00 49.53  ? 9   DT  C "C4'" 1 
ATOM   10248 O  "O4'" . DT  C 2 9   ? -2.199  -2.057  20.761  1.00 52.57  ? 9   DT  C "O4'" 1 
ATOM   10249 C  "C3'" . DT  C 2 9   ? -2.362  -1.864  23.076  1.00 47.75  ? 9   DT  C "C3'" 1 
ATOM   10250 O  "O3'" . DT  C 2 9   ? -2.747  -2.398  24.315  1.00 50.16  ? 9   DT  C "O3'" 1 
ATOM   10251 C  "C2'" . DT  C 2 9   ? -0.980  -2.419  22.766  1.00 49.70  ? 9   DT  C "C2'" 1 
ATOM   10252 C  "C1'" . DT  C 2 9   ? -0.897  -2.229  21.262  1.00 46.26  ? 9   DT  C "C1'" 1 
ATOM   10253 N  N1    . DT  C 2 9   ? -0.188  -0.928  21.005  1.00 53.22  ? 9   DT  C N1    1 
ATOM   10254 C  C2    . DT  C 2 9   ? 1.191   -0.933  20.832  1.00 50.96  ? 9   DT  C C2    1 
ATOM   10255 O  O2    . DT  C 2 9   ? 1.881   -1.933  20.925  1.00 50.88  ? 9   DT  C O2    1 
ATOM   10256 N  N3    . DT  C 2 9   ? 1.750   0.297   20.609  1.00 44.80  ? 9   DT  C N3    1 
ATOM   10257 C  C4    . DT  C 2 9   ? 1.102   1.509   20.501  1.00 48.16  ? 9   DT  C C4    1 
ATOM   10258 O  O4    . DT  C 2 9   ? 1.706   2.556   20.282  1.00 47.88  ? 9   DT  C O4    1 
ATOM   10259 C  C5    . DT  C 2 9   ? -0.335  1.458   20.662  1.00 51.14  ? 9   DT  C C5    1 
ATOM   10260 C  C7    . DT  C 2 9   ? -1.117  2.736   20.562  1.00 43.15  ? 9   DT  C C7    1 
ATOM   10261 C  C6    . DT  C 2 9   ? -0.913  0.260   20.893  1.00 44.62  ? 9   DT  C C6    1 
ATOM   10262 P  P     . DA  C 2 10  ? -2.445  -1.581  25.670  1.00 52.44  ? 10  DA  C P     1 
ATOM   10263 O  OP1   . DA  C 2 10  ? -3.370  -2.093  26.700  1.00 64.93  ? 10  DA  C OP1   1 
ATOM   10264 O  OP2   . DA  C 2 10  ? -2.395  -0.126  25.405  1.00 56.53  ? 10  DA  C OP2   1 
ATOM   10265 O  "O5'" . DA  C 2 10  ? -0.908  -1.894  26.005  1.00 67.03  ? 10  DA  C "O5'" 1 
ATOM   10266 C  "C5'" . DA  C 2 10  ? -0.356  -3.173  26.199  1.00 66.24  ? 10  DA  C "C5'" 1 
ATOM   10267 C  "C4'" . DA  C 2 10  ? 1.163   -3.105  26.094  1.00 61.91  ? 10  DA  C "C4'" 1 
ATOM   10268 O  "O4'" . DA  C 2 10  ? 1.451   -2.431  24.846  1.00 60.17  ? 10  DA  C "O4'" 1 
ATOM   10269 C  "C3'" . DA  C 2 10  ? 1.810   -2.187  27.116  1.00 65.74  ? 10  DA  C "C3'" 1 
ATOM   10270 O  "O3'" . DA  C 2 10  ? 2.342   -2.904  28.198  1.00 68.01  ? 10  DA  C "O3'" 1 
ATOM   10271 C  "C2'" . DA  C 2 10  ? 3.045   -1.681  26.375  1.00 63.26  ? 10  DA  C "C2'" 1 
ATOM   10272 C  "C1'" . DA  C 2 10  ? 2.721   -1.817  24.900  1.00 58.74  ? 10  DA  C "C1'" 1 
ATOM   10273 N  N9    . DA  C 2 10  ? 2.681   -0.455  24.373  1.00 60.91  ? 10  DA  C N9    1 
ATOM   10274 C  C8    . DA  C 2 10  ? 1.590   0.344   24.176  1.00 56.22  ? 10  DA  C C8    1 
ATOM   10275 N  N7    . DA  C 2 10  ? 1.884   1.536   23.710  1.00 54.33  ? 10  DA  C N7    1 
ATOM   10276 C  C5    . DA  C 2 10  ? 3.264   1.529   23.593  1.00 53.23  ? 10  DA  C C5    1 
ATOM   10277 C  C6    . DA  C 2 10  ? 4.197   2.496   23.153  1.00 51.20  ? 10  DA  C C6    1 
ATOM   10278 N  N6    . DA  C 2 10  ? 3.862   3.719   22.724  1.00 51.01  ? 10  DA  C N6    1 
ATOM   10279 N  N1    . DA  C 2 10  ? 5.507   2.150   23.177  1.00 54.59  ? 10  DA  C N1    1 
ATOM   10280 C  C2    . DA  C 2 10  ? 5.860   0.927   23.606  1.00 57.59  ? 10  DA  C C2    1 
ATOM   10281 N  N3    . DA  C 2 10  ? 5.073   -0.062  24.037  1.00 54.16  ? 10  DA  C N3    1 
ATOM   10282 C  C4    . DA  C 2 10  ? 3.775   0.305   24.008  1.00 61.35  ? 10  DA  C C4    1 
ATOM   10283 P  P     . DG  C 2 11  ? 2.744   -2.132  29.550  1.00 75.63  ? 11  DG  C P     1 
ATOM   10284 O  OP1   . DG  C 2 11  ? 2.808   -3.145  30.623  1.00 82.01  ? 11  DG  C OP1   1 
ATOM   10285 O  OP2   . DG  C 2 11  ? 1.832   -0.967  29.691  1.00 72.66  ? 11  DG  C OP2   1 
ATOM   10286 O  "O5'" . DG  C 2 11  ? 4.229   -1.584  29.279  1.00 71.81  ? 11  DG  C "O5'" 1 
ATOM   10287 C  "C5'" . DG  C 2 11  ? 5.317   -2.473  28.998  1.00 75.50  ? 11  DG  C "C5'" 1 
ATOM   10288 C  "C4'" . DG  C 2 11  ? 6.531   -1.729  28.459  1.00 78.17  ? 11  DG  C "C4'" 1 
ATOM   10289 O  "O4'" . DG  C 2 11  ? 6.061   -0.908  27.361  1.00 78.28  ? 11  DG  C "O4'" 1 
ATOM   10290 C  "C3'" . DG  C 2 11  ? 7.105   -0.684  29.413  1.00 82.42  ? 11  DG  C "C3'" 1 
ATOM   10291 O  "O3'" . DG  C 2 11  ? 8.140   -1.194  30.253  1.00 92.19  ? 11  DG  C "O3'" 1 
ATOM   10292 C  "C2'" . DG  C 2 11  ? 7.729   0.340   28.472  1.00 79.53  ? 11  DG  C "C2'" 1 
ATOM   10293 C  "C1'" . DG  C 2 11  ? 6.976   0.149   27.165  1.00 76.48  ? 11  DG  C "C1'" 1 
ATOM   10294 N  N9    . DG  C 2 11  ? 6.273   1.391   26.860  1.00 66.49  ? 11  DG  C N9    1 
ATOM   10295 C  C8    . DG  C 2 11  ? 4.943   1.700   27.001  1.00 64.91  ? 11  DG  C C8    1 
ATOM   10296 N  N7    . DG  C 2 11  ? 4.653   2.926   26.650  1.00 64.13  ? 11  DG  C N7    1 
ATOM   10297 C  C5    . DG  C 2 11  ? 5.874   3.466   26.267  1.00 66.55  ? 11  DG  C C5    1 
ATOM   10298 C  C6    . DG  C 2 11  ? 6.198   4.758   25.797  1.00 69.28  ? 11  DG  C C6    1 
ATOM   10299 O  O6    . DG  C 2 11  ? 5.430   5.714   25.609  1.00 66.15  ? 11  DG  C O6    1 
ATOM   10300 N  N1    . DG  C 2 11  ? 7.567   4.880   25.535  1.00 68.93  ? 11  DG  C N1    1 
ATOM   10301 C  C2    . DG  C 2 11  ? 8.503   3.877   25.704  1.00 68.61  ? 11  DG  C C2    1 
ATOM   10302 N  N2    . DG  C 2 11  ? 9.783   4.157   25.402  1.00 65.52  ? 11  DG  C N2    1 
ATOM   10303 N  N3    . DG  C 2 11  ? 8.207   2.665   26.143  1.00 70.23  ? 11  DG  C N3    1 
ATOM   10304 C  C4    . DG  C 2 11  ? 6.880   2.536   26.403  1.00 71.30  ? 11  DG  C C4    1 
ATOM   10305 P  P     . DG  C 2 12  ? 8.607   -0.362  31.555  1.00 99.09  ? 12  DG  C P     1 
ATOM   10306 O  OP1   . DG  C 2 12  ? 9.322   -1.315  32.435  1.00 97.66  ? 12  DG  C OP1   1 
ATOM   10307 O  OP2   . DG  C 2 12  ? 7.434   0.387   32.071  1.00 86.42  ? 12  DG  C OP2   1 
ATOM   10308 O  "O5'" . DG  C 2 12  ? 9.659   0.724   31.013  1.00 91.02  ? 12  DG  C "O5'" 1 
ATOM   10309 C  "C5'" . DG  C 2 12  ? 10.891  0.316   30.422  1.00 88.77  ? 12  DG  C "C5'" 1 
ATOM   10310 C  "C4'" . DG  C 2 12  ? 11.665  1.496   29.861  1.00 86.67  ? 12  DG  C "C4'" 1 
ATOM   10311 O  "O4'" . DG  C 2 12  ? 10.822  2.187   28.905  1.00 87.42  ? 12  DG  C "O4'" 1 
ATOM   10312 C  "C3'" . DG  C 2 12  ? 11.952  2.533   30.940  1.00 89.20  ? 12  DG  C "C3'" 1 
ATOM   10313 O  "O3'" . DG  C 2 12  ? 13.308  2.608   31.298  1.00 97.95  ? 12  DG  C "O3'" 1 
ATOM   10314 C  "C2'" . DG  C 2 12  ? 11.601  3.885   30.330  1.00 85.99  ? 12  DG  C "C2'" 1 
ATOM   10315 C  "C1'" . DG  C 2 12  ? 11.101  3.570   28.933  1.00 84.77  ? 12  DG  C "C1'" 1 
ATOM   10316 N  N9    . DG  C 2 12  ? 9.860   4.315   28.816  1.00 76.20  ? 12  DG  C N9    1 
ATOM   10317 C  C8    . DG  C 2 12  ? 8.605   3.872   29.150  1.00 77.00  ? 12  DG  C C8    1 
ATOM   10318 N  N7    . DG  C 2 12  ? 7.682   4.772   28.975  1.00 79.93  ? 12  DG  C N7    1 
ATOM   10319 C  C5    . DG  C 2 12  ? 8.367   5.891   28.514  1.00 80.21  ? 12  DG  C C5    1 
ATOM   10320 C  C6    . DG  C 2 12  ? 7.888   7.176   28.153  1.00 78.11  ? 12  DG  C C6    1 
ATOM   10321 O  O6    . DG  C 2 12  ? 6.719   7.593   28.170  1.00 76.82  ? 12  DG  C O6    1 
ATOM   10322 N  N1    . DG  C 2 12  ? 8.928   8.014   27.741  1.00 77.13  ? 12  DG  C N1    1 
ATOM   10323 C  C2    . DG  C 2 12  ? 10.254  7.653   27.680  1.00 75.33  ? 12  DG  C C2    1 
ATOM   10324 N  N2    . DG  C 2 12  ? 11.113  8.593   27.256  1.00 74.66  ? 12  DG  C N2    1 
ATOM   10325 N  N3    . DG  C 2 12  ? 10.711  6.451   28.014  1.00 74.38  ? 12  DG  C N3    1 
ATOM   10326 C  C4    . DG  C 2 12  ? 9.717   5.626   28.422  1.00 76.60  ? 12  DG  C C4    1 
ATOM   10327 P  P     . DT  C 2 13  ? 13.693  2.988   32.813  1.00 100.05 ? 13  DT  C P     1 
ATOM   10328 O  OP1   . DT  C 2 13  ? 14.637  1.956   33.309  1.00 96.62  ? 13  DT  C OP1   1 
ATOM   10329 O  OP2   . DT  C 2 13  ? 12.421  3.250   33.536  1.00 83.35  ? 13  DT  C OP2   1 
ATOM   10330 O  "O5'" . DT  C 2 13  ? 14.445  4.400   32.676  1.00 93.27  ? 13  DT  C "O5'" 1 
ATOM   10331 C  "C5'" . DT  C 2 13  ? 15.262  4.692   31.545  1.00 87.21  ? 13  DT  C "C5'" 1 
ATOM   10332 C  "C4'" . DT  C 2 13  ? 15.553  6.182   31.442  1.00 87.04  ? 13  DT  C "C4'" 1 
ATOM   10333 O  "O4'" . DT  C 2 13  ? 14.426  6.861   30.813  1.00 86.97  ? 13  DT