data_4V5X
# 
_entry.id   4V5X 
# 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.318 
_audit_conform.dict_location   http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic 
# 
loop_
_database_2.database_id 
_database_2.database_code 
PDB   4V5X         
WWPDB D_1000179516 
# 
_pdbx_database_PDB_obs_spr.id               SPRSDE 
_pdbx_database_PDB_obs_spr.date             2014-12-10 
_pdbx_database_PDB_obs_spr.pdb_id           4V5X 
_pdbx_database_PDB_obs_spr.replace_pdb_id   '2YMF 2YMG 2YMH 2YMI 2YMR' 
_pdbx_database_PDB_obs_spr.details          ? 
# 
loop_
_pdbx_database_related.db_name 
_pdbx_database_related.db_id 
_pdbx_database_related.content_type 
_pdbx_database_related.details 
PDB  4V5X     'complete structure'   .                                                  
PDB  2YMF     split                  .                                                  
PDB  2YMG     split                  'THE CRYO-EM STRUCTURE OF A 3D DNA-ORIGAMI OBJECT' 
PDB  2YMH     split                  'THE CRYO-EM STRUCTURE OF A 3D DNA-ORIGAMI OBJECT' 
PDB  2YMI     split                  'THE CRYO-EM STRUCTURE OF A 3D DNA-ORIGAMI OBJECT' 
PDB  2YMR     split                  'THE CRYO-EM STRUCTURE OF A 3D DNA-ORIGAMI OBJECT' 
EMDB EMD-2210 'associated EM volume' 'THE CRYO-EM STRUCTURE OF A 3D DNA-ORIGAMI OBJECT' 
# 
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.entry_id                        4V5X 
_pdbx_database_status.recvd_initial_deposition_date   2012-10-09 
_pdbx_database_status.deposit_site                    PDBE 
_pdbx_database_status.process_site                    PDBE 
_pdbx_database_status.SG_entry                        ? 
_pdbx_database_status.status_code_sf                  ? 
_pdbx_database_status.pdb_format_compatible           N 
_pdbx_database_status.status_code_mr                  ? 
_pdbx_database_status.status_code_cs                  ? 
_pdbx_database_status.methods_development_category    ? 
# 
loop_
_audit_author.name 
_audit_author.pdbx_ordinal 
'Bai, X.C.'       1 
'Martin, T.G.'    2 
'Scheres, S.H.W.' 3 
'Dietz, H.'       4 
# 
_citation.id                        primary 
_citation.title                     'Cryo-Em Structure of a 3D DNA-Origami Object.' 
_citation.journal_abbrev            Proc.Natl.Acad.Sci.USA 
_citation.journal_volume            109 
_citation.page_first                20012 
_citation.page_last                 ? 
_citation.year                      2012 
_citation.journal_id_ASTM           PNASA6 
_citation.country                   US 
_citation.journal_id_ISSN           0027-8424 
_citation.journal_id_CSD            0040 
_citation.book_publisher            ? 
_citation.pdbx_database_id_PubMed   23169645 
_citation.pdbx_database_id_DOI      10.1073/PNAS.1215713109 
# 
loop_
_citation_author.citation_id 
_citation_author.name 
_citation_author.ordinal 
_citation_author.identifier_ORCID 
primary 'Bai, X.'         1 ? 
primary 'Martin, T.G.'    2 ? 
primary 'Scheres, S.H.W.' 3 ? 
primary 'Dietz, H.'       4 ? 
# 
_cell.entry_id           4V5X 
_cell.length_a           1.000 
_cell.length_b           1.000 
_cell.length_c           1.000 
_cell.angle_alpha        90.00 
_cell.angle_beta         90.00 
_cell.angle_gamma        90.00 
_cell.Z_PDB              1 
_cell.pdbx_unique_axis   ? 
# 
_symmetry.entry_id                         4V5X 
_symmetry.space_group_name_H-M             'P 1' 
_symmetry.pdbx_full_space_group_name_H-M   ? 
_symmetry.cell_setting                     ? 
_symmetry.Int_Tables_number                1 
# 
loop_
_entity.id 
_entity.type 
_entity.src_method 
_entity.pdbx_description 
_entity.formula_weight 
_entity.pdbx_number_of_molecules 
_entity.pdbx_ec 
_entity.pdbx_mutation 
_entity.pdbx_fragment 
_entity.details 
1   polymer man 'SCAFFOLD STRAND,SCAFFOLD STRAND' 2236529.500 1 ? ? ? 
'ISOLATED M13 PHAGE GENOME (SINGLE-STRANDED),ISOLATED M13 PHAGE GENOME (SINGLE-STRANDED)' 
2   polymer syn 'STAPLE STRAND'                   17040.047   1 ? ? ? ? 
3   polymer syn 'STAPLE STRAND'                   13578.773   1 ? ? ? ? 
4   polymer syn 'STAPLE STRAND'                   15511.108   1 ? ? ? ? 
5   polymer syn 'STAPLE STRAND'                   12230.890   1 ? ? ? ? 
6   polymer syn 'STAPLE STRAND'                   14807.590   1 ? ? ? ? 
7   polymer syn 'STAPLE STRAND'                   14780.572   1 ? ? ? ? 
8   polymer syn 'STAPLE STRAND'                   15464.999   1 ? ? ? ? 
9   polymer syn 'STAPLE STRAND'                   14646.427   1 ? ? ? ? 
10  polymer syn 'STAPLE STRAND'                   14915.617   1 ? ? ? ? 
11  polymer syn 'STAPLE STRAND'                   12142.799   1 ? ? ? ? 
12  polymer syn 'STAPLE STRAND'                   15050.683   1 ? ? ? ? 
13  polymer syn 'STAPLE STRAND'                   15408.909   1 ? ? ? ? 
14  polymer syn 'STAPLE STRAND'                   14141.102   1 ? ? ? ? 
15  polymer syn 'STAPLE STRAND'                   14669.425   1 ? ? ? ? 
16  polymer syn 'STAPLE STRAND'                   14206.161   1 ? ? ? ? 
17  polymer syn 'STAPLE STRAND'                   14627.406   1 ? ? ? ? 
18  polymer syn 'STAPLE STRAND'                   14811.582   1 ? ? ? ? 
19  polymer syn 'STAPLE STRAND'                   16067.389   1 ? ? ? ? 
20  polymer syn 'STAPLE STRAND'                   18479.871   1 ? ? ? ? 
21  polymer syn 'STAPLE STRAND'                   14739.470   1 ? ? ? ? 
22  polymer syn 'STAPLE STRAND'                   15255.813   1 ? ? ? ? 
23  polymer syn 'STAPLE STRAND'                   14723.457   1 ? ? ? ? 
24  polymer syn 'STAPLE STRAND'                   14647.427   1 ? ? ? ? 
25  polymer syn 'STAPLE STRAND'                   12225.881   1 ? ? ? ? 
26  polymer syn 'STAPLE STRAND'                   17719.348   1 ? ? ? ? 
27  polymer syn 'STAPLE STRAND'                   19372.441   1 ? ? ? ? 
28  polymer syn 'STAPLE STRAND'                   19698.684   1 ? ? ? ? 
29  polymer syn 'STAPLE STRAND'                   14866.562   1 ? ? ? ? 
30  polymer syn 'STAPLE STRAND'                   14811.582   1 ? ? ? ? 
31  polymer syn 'STAPLE STRAND'                   16044.354   1 ? ? ? ? 
32  polymer syn 'STAPLE STRAND'                   15186.788   1 ? ? ? ? 
33  polymer syn 'STAPLE STRAND'                   14668.473   1 ? ? ? ? 
34  polymer syn 'STAPLE STRAND'                   12847.249   1 ? ? ? ? 
35  polymer syn 'STAPLE STRAND'                   16569.660   1 ? ? ? ? 
36  polymer syn 'STAPLE STRAND'                   13844.921   1 ? ? ? ? 
37  polymer syn 'STAPLE STRAND'                   21594.908   1 ? ? ? ? 
38  polymer syn 'STAPLE STRAND'                   14677.449   1 ? ? ? ? 
39  polymer syn 'STAPLE STRAND'                   14724.548   1 ? ? ? ? 
40  polymer syn 'STAPLE STRAND'                   14873.547   1 ? ? ? ? 
41  polymer syn 'STAPLE STRAND'                   13352.602   1 ? ? ? ? 
42  polymer syn 'STAPLE STRAND'                   14051.038   1 ? ? ? ? 
43  polymer syn 'STAPLE STRAND'                   19167.404   1 ? ? ? ? 
44  polymer syn 'STAPLE STRAND'                   14427.287   1 ? ? ? ? 
45  polymer syn 'STAPLE STRAND'                   14603.398   1 ? ? ? ? 
46  polymer syn 'STAPLE STRAND'                   14738.465   1 ? ? ? ? 
47  polymer syn 'STAPLE STRAND'                   14783.497   1 ? ? ? ? 
48  polymer syn 'STAPLE STRAND'                   11088.116   1 ? ? ? ? 
49  polymer syn 'STAPLE STRAND'                   14856.577   1 ? ? ? ? 
50  polymer syn 'STAPLE STRAND'                   14668.435   1 ? ? ? ? 
51  polymer syn 'STAPLE STRAND'                   14776.514   1 ? ? ? ? 
52  polymer syn 'STAPLE STRAND'                   14700.488   1 ? ? ? ? 
53  polymer syn 'STAPLE STRAND'                   16015.279   1 ? ? ? ? 
54  polymer syn 'STAPLE STRAND'                   11672.545   1 ? ? ? ? 
55  polymer syn 'STAPLE STRAND'                   15777.127   1 ? ? ? ? 
56  polymer syn 'STAPLE STRAND'                   14858.482   1 ? ? ? ? 
57  polymer syn 'STAPLE STRAND'                   18217.744   1 ? ? ? ? 
58  polymer syn 'STAPLE STRAND'                   11130.170   1 ? ? ? ? 
59  polymer syn 'STAPLE STRAND'                   14792.514   1 ? ? ? ? 
60  polymer syn 'STAPLE STRAND'                   14648.434   1 ? ? ? ? 
61  polymer syn 'STAPLE STRAND'                   12362.992   1 ? ? ? ? 
62  polymer syn 'STAPLE STRAND'                   15522.011   1 ? ? ? ? 
63  polymer syn 'STAPLE STRAND'                   13550.692   1 ? ? ? ? 
64  polymer syn 'STAPLE STRAND'                   12030.770   1 ? ? ? ? 
65  polymer syn 'STAPLE STRAND'                   16897.852   1 ? ? ? ? 
66  polymer syn 'STAPLE STRAND'                   14819.556   1 ? ? ? ? 
67  polymer syn 'STAPLE STRAND'                   13567.786   1 ? ? ? ? 
68  polymer syn 'STAPLE STRAND'                   10961.058   1 ? ? ? ? 
69  polymer syn 'STAPLE STRAND'                   20973.498   1 ? ? ? ? 
70  polymer syn 'STAPLE STRAND'                   12298.959   1 ? ? ? ? 
71  polymer syn 'STAPLE STRAND'                   15221.823   1 ? ? ? ? 
72  polymer syn 'STAPLE STRAND'                   12828.285   1 ? ? ? ? 
73  polymer syn 'STAPLE STRAND'                   12823.292   1 ? ? ? ? 
74  polymer syn 'STAPLE STRAND'                   17870.438   1 ? ? ? ? 
75  polymer syn 'STAPLE STRAND'                   13573.818   1 ? ? ? ? 
76  polymer syn 'STAPLE STRAND'                   14710.436   1 ? ? ? ? 
77  polymer syn 'STAPLE STRAND'                   16003.303   1 ? ? ? ? 
78  polymer syn 'STAPLE STRAND'                   19274.367   1 ? ? ? ? 
79  polymer syn 'STAPLE STRAND'                   14948.607   1 ? ? ? ? 
80  polymer syn 'STAPLE STRAND'                   20124.887   1 ? ? ? ? 
81  polymer syn 'STAPLE STRAND'                   14687.453   1 ? ? ? ? 
82  polymer syn 'STAPLE STRAND'                   19689.631   1 ? ? ? ? 
83  polymer syn 'STAPLE STRAND'                   14721.426   1 ? ? ? ? 
84  polymer syn 'STAPLE STRAND'                   15960.209   1 ? ? ? ? 
85  polymer syn 'STAPLE STRAND'                   16950.857   1 ? ? ? ? 
86  polymer syn 'STAPLE STRAND'                   13490.700   1 ? ? ? ? 
87  polymer syn 'STAPLE STRAND'                   16259.448   1 ? ? ? ? 
88  polymer syn 'STAPLE STRAND'                   15029.691   1 ? ? ? ? 
89  polymer syn 'STAPLE STRAND'                   14731.495   1 ? ? ? ? 
90  polymer syn 'STAPLE STRAND'                   20185.957   1 ? ? ? ? 
91  polymer syn 'STAPLE STRAND'                   14797.471   1 ? ? ? ? 
92  polymer syn 'STAPLE STRAND'                   20881.359   1 ? ? ? ? 
93  polymer syn 'STAPLE STRAND'                   15441.856   1 ? ? ? ? 
94  polymer syn 'STAPLE STRAND'                   17205.010   1 ? ? ? ? 
95  polymer syn 'STAPLE STRAND'                   14825.497   1 ? ? ? ? 
96  polymer syn 'STAPLE STRAND'                   14900.536   1 ? ? ? ? 
97  polymer syn 'STAPLE STRAND'                   14388.232   1 ? ? ? ? 
98  polymer syn 'STAPLE STRAND'                   14887.535   1 ? ? ? ? 
99  polymer syn 'STAPLE STRAND'                   20567.201   1 ? ? ? ? 
100 polymer syn 'STAPLE STRAND'                   13759.860   1 ? ? ? ? 
101 polymer syn 'STAPLE STRAND'                   20663.260   1 ? ? ? ? 
102 polymer syn 'STAPLE STRAND'                   14911.580   1 ? ? ? ? 
103 polymer syn 'STAPLE STRAND'                   14672.440   1 ? ? ? ? 
104 polymer syn 'STAPLE STRAND'                   20798.240   1 ? ? ? ? 
105 polymer syn 'STAPLE STRAND'                   20573.143   1 ? ? ? ? 
106 polymer syn 'STAPLE STRAND'                   14902.566   1 ? ? ? ? 
107 polymer syn 'STAPLE STRAND'                   18002.525   1 ? ? ? ? 
108 polymer syn 'STAPLE STRAND'                   15694.010   1 ? ? ? ? 
109 polymer syn 'STAPLE STRAND'                   16673.688   1 ? ? ? ? 
110 polymer syn 'STAPLE STRAND'                   12603.098   1 ? ? ? ? 
111 polymer syn 'STAPLE STRAND'                   15650.125   1 ? ? ? ? 
112 polymer syn 'STAPLE STRAND'                   17173.100   1 ? ? ? ? 
113 polymer syn 'STAPLE STRAND'                   14633.459   1 ? ? ? ? 
114 polymer syn 'STAPLE STRAND'                   21768.979   1 ? ? ? ? 
115 polymer syn 'STAPLE STRAND'                   19270.379   1 ? ? ? ? 
116 polymer syn 'STAPLE STRAND'                   14873.601   1 ? ? ? ? 
117 polymer syn 'STAPLE STRAND'                   16051.352   1 ? ? ? ? 
118 polymer syn 'STAPLE STRAND'                   13617.758   1 ? ? ? ? 
119 polymer syn 'STAPLE STRAND'                   16552.635   1 ? ? ? ? 
120 polymer syn 'STAPLE STRAND'                   14576.394   1 ? ? ? ? 
121 polymer syn 'STAPLE STRAND'                   14929.622   1 ? ? ? ? 
122 polymer syn 'STAPLE STRAND'                   12401.041   1 ? ? ? ? 
123 polymer syn 'STAPLE STRAND'                   12350.960   1 ? ? ? ? 
124 polymer syn 'STAPLE STRAND'                   13706.768   1 ? ? ? ? 
125 polymer syn 'STAPLE STRAND'                   14949.592   1 ? ? ? ? 
126 polymer syn 'STAPLE STRAND'                   13565.741   1 ? ? ? ? 
127 polymer syn 'STAPLE STRAND'                   18067.650   1 ? ? ? ? 
128 polymer syn 'STAPLE STRAND'                   14922.639   1 ? ? ? ? 
129 polymer syn 'STAPLE STRAND'                   14789.549   1 ? ? ? ? 
130 polymer syn 'STAPLE STRAND'                   16638.734   1 ? ? ? ? 
131 polymer syn 'STAPLE STRAND'                   12745.254   1 ? ? ? ? 
132 polymer syn 'STAPLE STRAND'                   14860.582   1 ? ? ? ? 
133 polymer syn 'STAPLE STRAND'                   17217.082   1 ? ? ? ? 
134 polymer syn 'STAPLE STRAND'                   11567.484   1 ? ? ? ? 
135 polymer syn 'STAPLE STRAND'                   14660.464   1 ? ? ? ? 
136 polymer syn 'STAPLE STRAND'                   14767.515   1 ? ? ? ? 
137 polymer syn 'STAPLE STRAND'                   14951.619   1 ? ? ? ? 
138 polymer syn 'STAPLE STRAND'                   9754.358    1 ? ? ? ? 
139 polymer syn 'STAPLE STRAND'                   16271.479   1 ? ? ? ? 
140 polymer syn 'STAPLE STRAND'                   11708.513   1 ? ? ? ? 
141 polymer syn 'STAPLE STRAND'                   14417.234   1 ? ? ? ? 
142 polymer syn 'STAPLE STRAND'                   13206.617   1 ? ? ? ? 
143 polymer syn 'STAPLE STRAND'                   14907.681   1 ? ? ? ? 
144 polymer syn 'STAPLE STRAND'                   13626.824   1 ? ? ? ? 
145 polymer syn 'STAPLE STRAND'                   19047.244   1 ? ? ? ? 
146 polymer syn 'STAPLE STRAND'                   12966.436   1 ? ? ? ? 
147 polymer syn 'STAPLE STRAND'                   16020.326   1 ? ? ? ? 
148 polymer syn 'STAPLE STRAND'                   14770.532   1 ? ? ? ? 
149 polymer syn 'STAPLE STRAND'                   14218.170   1 ? ? ? ? 
150 polymer syn 'STAPLE STRAND'                   14330.200   1 ? ? ? ? 
151 polymer syn 'STAPLE STRAND'                   8874.730    1 ? ? ? ? 
152 polymer syn 'STAPLE STRAND'                   14865.575   1 ? ? ? ? 
153 polymer syn 'STAPLE STRAND'                   12440.024   1 ? ? ? ? 
154 polymer syn 'STAPLE STRAND'                   14115.087   1 ? ? ? ? 
155 polymer syn 'STAPLE STRAND'                   15330.904   1 ? ? ? ? 
156 polymer syn 'STAPLE STRAND'                   13488.727   1 ? ? ? ? 
157 polymer syn 'STAPLE STRAND'                   18509.984   1 ? ? ? ? 
158 polymer syn 'STAPLE STRAND'                   14077.056   1 ? ? ? ? 
159 polymer syn 'STAPLE STRAND'                   16704.740   1 ? ? ? ? 
160 polymer syn 'STAPLE STRAND'                   14153.132   1 ? ? ? ? 
161 polymer syn 'STAPLE STRAND'                   20481.178   1 ? ? ? ? 
162 polymer syn 'STAPLE STRAND'                   14727.513   1 ? ? ? ? 
# 
loop_
_entity_poly.entity_id 
_entity_poly.type 
_entity_poly.nstd_linkage 
_entity_poly.nstd_monomer 
_entity_poly.pdbx_seq_one_letter_code 
_entity_poly.pdbx_seq_one_letter_code_can 
_entity_poly.pdbx_strand_id 
_entity_poly.pdbx_target_identifier 
1   polydeoxyribonucleotide no no 
;(DT)(DG)(DA)(DT)(DA)(DG)(DA)(DC)(DG)(DG)(DT)(DT)(DT)(DT)(DT)(DC)(DG)(DC)(DC)(DC)
(DT)(DT)(DT)(DG)(DA)(DC)(DG)(DT)(DT)(DG)(DG)(DA)(DG)(DT)(DC)(DC)(DA)(DC)(DG)(DT)
(DT)(DC)(DT)(DT)(DT)(DA)(DA)(DT)(DA)(DG)(DT)(DG)(DG)(DA)(DC)(DT)(DC)(DT)(DT)(DG)
(DT)(DT)(DC)(DC)(DA)(DA)(DA)(DC)(DT)(DG)(DG)(DA)(DA)(DC)(DA)(DA)(DC)(DA)(DC)(DT)
(DC)(DA)(DA)(DC)(DC)(DC)(DT)(DA)(DT)(DC)(DT)(DC)(DG)(DG)(DG)(DC)(DT)(DA)(DT)(DT)
(DC)(DT)(DT)(DT)(DT)(DG)(DA)(DT)(DT)(DT)(DA)(DT)(DA)(DA)(DG)(DG)(DG)(DA)(DT)(DT)
(DT)(DT)(DG)(DC)(DC)(DG)(DA)(DT)(DT)(DT)(DC)(DG)(DG)(DA)(DA)(DC)(DC)(DA)(DC)(DC)
(DA)(DT)(DC)(DA)(DA)(DA)(DC)(DA)(DG)(DG)(DA)(DT)(DT)(DT)(DT)(DC)(DG)(DC)(DC)(DT)
(DG)(DC)(DT)(DG)(DG)(DG)(DG)(DC)(DA)(DA)(DA)(DC)(DC)(DA)(DG)(DC)(DG)(DT)(DG)(DG)
(DA)(DC)(DC)(DG)(DC)(DT)(DT)(DG)(DC)(DT)(DG)(DC)(DA)(DA)(DC)(DT)(DC)(DT)(DC)(DT)
(DC)(DA)(DG)(DG)(DG)(DC)(DC)(DA)(DG)(DG)(DC)(DG)(DG)(DT)(DG)(DA)(DA)(DG)(DG)(DG)
(DC)(DA)(DA)(DT)(DC)(DA)(DG)(DC)(DT)(DG)(DT)(DT)(DG)(DC)(DC)(DC)(DG)(DT)(DC)(DT)
(DC)(DA)(DC)(DT)(DG)(DG)(DT)(DG)(DA)(DA)(DA)(DA)(DG)(DA)(DA)(DA)(DA)(DA)(DC)(DC)
(DA)(DC)(DC)(DC)(DT)(DG)(DG)(DC)(DG)(DC)(DC)(DC)(DA)(DA)(DT)(DA)(DC)(DG)(DC)(DA)
(DA)(DA)(DC)(DC)(DG)(DC)(DC)(DT)(DC)(DT)(DC)(DC)(DC)(DC)(DG)(DC)(DG)(DC)(DG)(DT)
(DT)(DG)(DG)(DC)(DC)(DG)(DA)(DT)(DT)(DC)(DA)(DT)(DT)(DA)(DA)(DT)(DG)(DC)(DA)(DG)
(DC)(DT)(DG)(DG)(DC)(DA)(DC)(DG)(DA)(DC)(DA)(DG)(DG)(DT)(DT)(DT)(DC)(DC)(DC)(DG)
(DA)(DC)(DT)(DG)(DG)(DA)(DA)(DA)(DG)(DC)(DG)(DG)(DG)(DC)(DA)(DG)(DT)(DG)(DA)(DG)
(DC)(DG)(DC)(DA)(DA)(DC)(DG)(DC)(DA)(DA)(DT)(DT)(DA)(DA)(DT)(DG)(DT)(DG)(DA)(DG)
(DT)(DT)(DA)(DG)(DC)(DT)(DC)(DA)(DC)(DT)(DC)(DA)(DT)(DT)(DA)(DG)(DG)(DC)(DA)(DC)
(DC)(DC)(DC)(DA)(DG)(DG)(DC)(DT)(DT)(DT)(DA)(DC)(DA)(DC)(DT)(DT)(DT)(DA)(DT)(DG)
(DC)(DT)(DT)(DC)(DC)(DG)(DG)(DC)(DT)(DC)(DG)(DT)(DA)(DT)(DG)(DT)(DT)(DG)(DT)(DG)
(DT)(DG)(DG)(DA)(DA)(DT)(DT)(DG)(DT)(DG)(DA)(DG)(DC)(DG)(DG)(DA)(DT)(DA)(DA)(DC)
(DA)(DA)(DT)(DT)(DT)(DC)(DA)(DC)(DA)(DC)(DA)(DG)(DG)(DA)(DA)(DA)(DC)(DA)(DG)(DC)
(DT)(DA)(DT)(DG)(DA)(DC)(DC)(DA)(DT)(DG)(DA)(DT)(DT)(DA)(DC)(DG)(DA)(DA)(DT)(DT)
(DC)(DG)(DA)(DG)(DC)(DT)(DC)(DG)(DG)(DT)(DA)(DC)(DC)(DC)(DG)(DG)(DG)(DG)(DA)(DT)
(DC)(DC)(DT)(DC)(DT)(DA)(DG)(DA)(DG)(DT)(DC)(DG)(DA)(DC)(DC)(DT)(DG)(DC)(DA)(DG)
(DG)(DC)(DA)(DT)(DG)(DC)(DA)(DA)(DG)(DC)(DT)(DT)(DG)(DG)(DC)(DA)(DC)(DT)(DG)(DG)
(DC)(DC)(DG)(DT)(DC)(DG)(DT)(DT)(DT)(DT)(DA)(DC)(DA)(DA)(DC)(DG)(DT)(DC)(DG)(DT)
(DG)(DA)(DC)(DT)(DG)(DG)(DG)(DA)(DA)(DA)(DA)(DC)(DC)(DC)(DT)(DG)(DG)(DC)(DG)(DT)
(DT)(DA)(DC)(DC)(DC)(DA)(DA)(DC)(DT)(DT)(DA)(DA)(DT)(DC)(DG)(DC)(DC)(DT)(DT)(DG)
(DC)(DA)(DG)(DC)(DA)(DC)(DA)(DT)(DC)(DC)(DC)(DC)(DC)(DT)(DT)(DT)(DC)(DG)(DC)(DC)
(DA)(DG)(DC)(DT)(DG)(DG)(DC)(DG)(DT)(DA)(DA)(DT)(DA)(DG)(DC)(DG)(DA)(DA)(DG)(DA)
(DG)(DG)(DC)(DC)(DC)(DG)(DC)(DA)(DC)(DC)(DG)(DA)(DT)(DC)(DG)(DC)(DC)(DC)(DT)(DT)
(DC)(DC)(DC)(DA)(DA)(DC)(DA)(DG)(DT)(DT)(DG)(DC)(DG)(DC)(DA)(DG)(DC)(DC)(DT)(DG)
(DA)(DA)(DT)(DG)(DG)(DC)(DG)(DA)(DA)(DT)(DG)(DG)(DC)(DG)(DC)(DT)(DT)(DT)(DG)(DC)
(DC)(DT)(DG)(DG)(DT)(DT)(DT)(DC)(DC)(DG)(DG)(DC)(DA)(DC)(DC)(DA)(DG)(DA)(DA)(DG)
(DC)(DG)(DG)(DT)(DG)(DC)(DC)(DG)(DG)(DA)(DA)(DA)(DG)(DC)(DT)(DG)(DG)(DC)(DT)(DG)
(DG)(DA)(DG)(DT)(DG)(DC)(DG)(DA)(DT)(DC)(DT)(DT)(DC)(DC)(DT)(DG)(DA)(DG)(DG)(DC)
(DC)(DG)(DA)(DT)(DA)(DC)(DT)(DG)(DT)(DC)(DG)(DT)(DC)(DG)(DT)(DC)(DC)(DC)(DC)(DT)
(DC)(DA)(DA)(DA)(DC)(DT)(DG)(DG)(DC)(DA)(DG)(DA)(DT)(DG)(DC)(DA)(DC)(DG)(DG)(DT)
(DT)(DA)(DC)(DG)(DA)(DT)(DG)(DC)(DG)(DC)(DC)(DC)(DA)(DT)(DC)(DT)(DA)(DC)(DA)(DC)
(DC)(DA)(DA)(DC)(DG)(DT)(DG)(DA)(DC)(DC)(DT)(DA)(DT)(DC)(DC)(DC)(DA)(DT)(DT)(DA)
(DC)(DG)(DG)(DT)(DC)(DA)(DA)(DT)(DC)(DC)(DG)(DC)(DC)(DG)(DT)(DT)(DT)(DG)(DT)(DT)
(DC)(DC)(DC)(DA)(DC)(DG)(DG)(DA)(DG)(DA)(DA)(DT)(DC)(DC)(DG)(DA)(DC)(DG)(DG)(DG)
(DT)(DT)(DG)(DT)(DT)(DA)(DC)(DT)(DC)(DG)(DC)(DT)(DC)(DA)(DC)(DA)(DT)(DT)(DT)(DA)
(DA)(DT)(DG)(DT)(DT)(DG)(DA)(DT)(DG)(DA)(DA)(DA)(DG)(DC)(DT)(DG)(DG)(DC)(DT)(DA)
(DC)(DA)(DG)(DG)(DA)(DA)(DG)(DG)(DC)(DC)(DA)(DG)(DA)(DC)(DG)(DC)(DG)(DA)(DA)(DT)
(DT)(DA)(DT)(DT)(DT)(DT)(DT)(DG)(DA)(DT)(DG)(DG)(DC)(DG)(DT)(DT)(DC)(DC)(DT)(DA)
(DT)(DT)(DG)(DG)(DT)(DT)(DA)(DA)(DA)(DA)(DA)(DA)(DT)(DG)(DA)(DG)(DC)(DT)(DG)(DA)
(DT)(DT)(DT)(DA)(DA)(DC)(DA)(DA)(DA)(DA)(DA)(DT)(DT)(DT)(DA)(DA)(DT)(DG)(DC)(DG)
(DA)(DA)(DT)(DT)(DT)(DT)(DA)(DA)(DC)(DA)(DA)(DA)(DA)(DT)(DA)(DT)(DT)(DA)(DA)(DC)
(DG)(DT)(DT)(DT)(DA)(DC)(DA)(DA)(DT)(DT)(DT)(DA)(DA)(DA)(DT)(DA)(DT)(DT)(DT)(DG)
(DC)(DT)(DT)(DA)(DT)(DA)(DC)(DA)(DA)(DT)(DC)(DT)(DT)(DC)(DC)(DT)(DG)(DT)(DT)(DT)
(DT)(DT)(DG)(DG)(DG)(DG)(DC)(DT)(DT)(DT)(DT)(DC)(DT)(DG)(DA)(DT)(DT)(DA)(DT)(DC)
(DA)(DA)(DC)(DC)(DG)(DG)(DG)(DG)(DT)(DA)(DC)(DA)(DT)(DA)(DT)(DG)(DA)(DT)(DT)(DG)
(DA)(DC)(DA)(DT)(DG)(DC)(DT)(DA)(DG)(DT)(DT)(DT)(DT)(DA)(DC)(DG)(DA)(DT)(DT)(DA)
(DC)(DC)(DG)(DT)(DT)(DC)(DA)(DT)(DC)(DG)(DA)(DT)(DT)(DC)(DT)(DC)(DT)(DT)(DG)(DT)
(DT)(DT)(DG)(DC)(DT)(DC)(DC)(DA)(DG)(DA)(DC)(DT)(DC)(DT)(DC)(DA)(DG)(DG)(DC)(DA)
(DA)(DT)(DG)(DA)(DC)(DC)(DT)(DG)(DA)(DT)(DA)(DG)(DC)(DC)(DT)(DT)(DT)(DG)(DT)(DA)
(DG)(DA)(DT)(DC)(DT)(DC)(DT)(DC)(DA)(DA)(DA)(DA)(DA)(DT)(DA)(DG)(DC)(DT)(DA)(DC)
(DC)(DC)(DT)(DC)(DT)(DC)(DC)(DG)(DG)(DC)(DA)(DT)(DT)(DA)(DA)(DT)(DT)(DT)(DA)(DT)
(DC)(DA)(DG)(DC)(DT)(DA)(DG)(DA)(DA)(DC)(DG)(DG)(DT)(DT)(DG)(DA)(DA)(DT)(DA)(DT)
(DC)(DA)(DT)(DA)(DT)(DT)(DG)(DA)(DT)(DG)(DG)(DT)(DG)(DA)(DT)(DT)(DT)(DG)(DA)(DC)
(DT)(DG)(DT)(DC)(DT)(DC)(DC)(DG)(DG)(DC)(DC)(DT)(DT)(DT)(DC)(DT)(DC)(DA)(DC)(DC)
(DC)(DT)(DT)(DT)(DT)(DG)(DA)(DA)(DT)(DC)(DT)(DT)(DT)(DA)(DC)(DC)(DT)(DA)(DC)(DA)
(DC)(DA)(DT)(DT)(DA)(DC)(DT)(DC)(DA)(DG)(DG)(DC)(DA)(DT)(DT)(DG)(DC)(DA)(DT)(DT)
(DT)(DA)(DA)(DA)(DA)(DT)(DA)(DT)(DA)(DT)(DG)(DA)(DG)(DG)(DG)(DT)(DT)(DC)(DT)(DA)
(DA)(DA)(DA)(DA)(DT)(DT)(DT)(DT)(DT)(DA)(DT)(DC)(DC)(DT)(DT)(DG)(DC)(DG)(DT)(DT)
(DG)(DA)(DA)(DA)(DT)(DA)(DA)(DA)(DG)(DG)(DC)(DT)(DT)(DC)(DT)(DC)(DC)(DC)(DG)(DC)
(DA)(DA)(DA)(DA)(DG)(DT)(DA)(DT)(DT)(DA)(DC)(DA)(DG)(DG)(DG)(DT)(DC)(DA)(DT)(DA)
(DA)(DT)(DG)(DT)(DT)(DT)(DT)(DT)(DG)(DG)(DT)(DA)(DC)(DA)(DA)(DC)(DC)(DG)(DA)(DT)
(DT)(DT)(DA)(DG)(DC)(DT)(DT)(DT)(DA)(DT)(DG)(DC)(DT)(DC)(DT)(DG)(DA)(DG)(DG)(DC)
(DT)(DT)(DT)(DA)(DT)(DT)(DG)(DC)(DT)(DT)(DA)(DA)(DT)(DT)(DT)(DT)(DG)(DC)(DT)(DA)
(DA)(DT)(DT)(DC)(DT)(DT)(DT)(DG)(DC)(DC)(DT)(DT)(DG)(DC)(DC)(DT)(DG)(DT)(DA)(DT)
(DG)(DA)(DT)(DT)(DT)(DA)(DT)(DT)(DG)(DG)(DA)(DT)(DG)(DT)(DT)(DA)(DA)(DT)(DG)(DC)
(DT)(DA)(DC)(DT)(DA)(DC)(DT)(DA)(DT)(DT)(DA)(DG)(DT)(DA)(DG)(DA)(DA)(DT)(DT)(DG)
(DA)(DT)(DG)(DC)(DC)(DA)(DC)(DC)(DT)(DT)(DT)(DT)(DC)(DA)(DG)(DC)(DT)(DC)(DG)(DC)
(DG)(DC)(DC)(DC)(DC)(DA)(DA)(DA)(DT)(DG)(DA)(DA)(DA)(DA)(DT)(DA)(DT)(DA)(DG)(DC)
(DT)(DA)(DA)(DA)(DC)(DA)(DG)(DG)(DT)(DT)(DA)(DT)(DT)(DG)(DA)(DC)(DC)(DA)(DT)(DT)
(DT)(DG)(DC)(DG)(DA)(DA)(DA)(DT)(DG)(DT)(DA)(DT)(DC)(DT)(DA)(DA)(DT)(DG)(DG)(DT)
(DC)(DA)(DA)(DA)(DC)(DT)(DA)(DA)(DA)(DT)(DC)(DT)(DA)(DC)(DT)(DC)(DG)(DT)(DT)(DC)
(DG)(DC)(DA)(DG)(DA)(DA)(DT)(DT)(DG)(DG)(DG)(DA)(DA)(DT)(DC)(DA)(DA)(DC)(DT)(DG)
(DT)(DT)(DA)(DT)(DA)(DT)(DG)(DG)(DA)(DA)(DT)(DG)(DA)(DA)(DA)(DC)(DT)(DT)(DC)(DC)
(DA)(DG)(DA)(DC)(DA)(DC)(DC)(DG)(DT)(DA)(DC)(DT)(DT)(DT)(DA)(DG)(DT)(DT)(DG)(DC)
(DA)(DT)(DA)(DT)(DT)(DT)(DA)(DA)(DA)(DA)(DC)(DA)(DT)(DG)(DT)(DT)(DG)(DA)(DG)(DC)
(DT)(DA)(DC)(DA)(DG)(DC)(DA)(DT)(DT)(DA)(DT)(DA)(DT)(DT)(DC)(DA)(DG)(DC)(DA)(DA)
(DT)(DT)(DA)(DA)(DG)(DC)(DT)(DC)(DT)(DA)(DA)(DG)(DC)(DC)(DA)(DT)(DC)(DC)(DG)(DC)
(DA)(DA)(DA)(DA)(DA)(DT)(DG)(DA)(DC)(DC)(DT)(DC)(DT)(DT)(DA)(DT)(DC)(DA)(DA)(DA)
(DA)(DG)(DG)(DA)(DG)(DC)(DA)(DA)(DT)(DT)(DA)(DA)(DA)(DG)(DG)(DT)(DA)(DC)(DT)(DC)
(DT)(DC)(DT)(DA)(DA)(DT)(DC)(DC)(DT)(DG)(DA)(DC)(DC)(DT)(DG)(DT)(DT)(DG)(DG)(DA)
(DG)(DT)(DT)(DT)(DG)(DC)(DT)(DT)(DC)(DC)(DG)(DG)(DT)(DC)(DT)(DG)(DG)(DT)(DT)(DC)
(DG)(DC)(DT)(DT)(DT)(DG)(DA)(DA)(DG)(DC)(DT)(DC)(DG)(DA)(DA)(DT)(DT)(DA)(DA)(DA)
(DA)(DC)(DG)(DC)(DG)(DA)(DT)(DA)(DT)(DT)(DT)(DG)(DA)(DA)(DG)(DT)(DC)(DT)(DT)(DT)
(DC)(DG)(DG)(DG)(DC)(DT)(DT)(DC)(DC)(DT)(DC)(DT)(DT)(DA)(DA)(DT)(DC)(DT)(DT)(DT)
(DT)(DT)(DG)(DA)(DT)(DG)(DC)(DA)(DA)(DT)(DC)(DC)(DG)(DC)(DT)(DT)(DT)(DG)(DC)(DT)
(DT)(DC)(DT)(DG)(DA)(DC)(DT)(DA)(DT)(DA)(DA)(DT)(DA)(DG)(DT)(DC)(DA)(DG)(DG)(DG)
(DT)(DA)(DA)(DA)(DG)(DA)(DC)(DC)(DT)(DG)(DA)(DT)(DT)(DT)(DT)(DT)(DG)(DA)(DT)(DT)
(DT)(DA)(DT)(DG)(DG)(DT)(DC)(DA)(DT)(DT)(DC)(DT)(DC)(DG)(DT)(DT)(DT)(DT)(DC)(DT)
(DG)(DA)(DA)(DC)(DT)(DG)(DT)(DT)(DT)(DA)(DA)(DA)(DG)(DC)(DA)(DT)(DT)(DT)(DG)(DA)
(DG)(DG)(DG)(DG)(DG)(DA)(DT)(DT)(DC)(DA)(DA)(DT)(DG)(DA)(DA)(DT)(DA)(DT)(DT)(DT)
(DA)(DT)(DG)(DA)(DC)(DG)(DA)(DT)(DT)(DC)(DC)(DG)(DC)(DA)(DG)(DT)(DA)(DT)(DT)(DG)
(DG)(DA)(DC)(DG)(DC)(DT)(DA)(DT)(DC)(DC)(DA)(DG)(DT)(DC)(DT)(DA)(DA)(DA)(DC)(DA)
(DT)(DT)(DT)(DT)(DA)(DC)(DT)(DA)(DT)(DT)(DA)(DC)(DC)(DC)(DC)(DC)(DT)(DC)(DT)(DG)
(DG)(DC)(DA)(DA)(DA)(DA)(DC)(DT)(DT)(DC)(DT)(DT)(DT)(DT)(DG)(DC)(DA)(DA)(DA)(DA)
(DG)(DC)(DC)(DT)(DC)(DT)(DC)(DG)(DC)(DT)(DA)(DT)(DT)(DT)(DT)(DG)(DG)(DT)(DT)(DT)
(DT)(DT)(DA)(DT)(DC)(DG)(DT)(DC)(DG)(DT)(DC)(DT)(DG)(DG)(DT)(DA)(DA)(DA)(DC)(DG)
(DA)(DG)(DG)(DG)(DT)(DT)(DA)(DT)(DG)(DA)(DT)(DA)(DG)(DT)(DG)(DT)(DT)(DG)(DC)(DT)
(DC)(DT)(DT)(DA)(DC)(DT)(DA)(DT)(DG)(DC)(DC)(DT)(DC)(DG)(DT)(DA)(DA)(DT)(DT)(DC)
(DC)(DT)(DT)(DT)(DT)(DG)(DG)(DC)(DG)(DT)(DT)(DA)(DT)(DG)(DT)(DA)(DT)(DC)(DT)(DG)
(DC)(DA)(DT)(DT)(DA)(DG)(DT)(DT)(DG)(DA)(DA)(DT)(DG)(DT)(DG)(DG)(DT)(DA)(DT)(DT)
(DC)(DC)(DT)(DA)(DA)(DA)(DT)(DC)(DT)(DC)(DA)(DA)(DC)(DT)(DG)(DA)(DT)(DG)(DA)(DA)
(DT)(DC)(DT)(DT)(DT)(DC)(DT)(DA)(DC)(DC)(DT)(DG)(DT)(DA)(DA)(DT)(DA)(DA)(DT)(DG)
(DT)(DT)(DG)(DT)(DT)(DC)(DC)(DG)(DT)(DT)(DA)(DG)(DT)(DT)(DC)(DG)(DT)(DT)(DT)(DT)
(DA)(DT)(DT)(DA)(DA)(DC)(DG)(DT)(DA)(DG)(DA)(DT)(DT)(DT)(DT)(DT)(DC)(DT)(DT)(DC)
(DC)(DC)(DA)(DA)(DC)(DG)(DT)(DC)(DC)(DT)(DG)(DA)(DC)(DT)(DG)(DG)(DT)(DA)(DT)(DA)
(DA)(DT)(DG)(DA)(DG)(DC)(DC)(DA)(DG)(DT)(DT)(DC)(DT)(DT)(DA)(DA)(DA)(DA)(DT)(DC)
(DG)(DC)(DA)(DT)(DA)(DA)(DG)(DG)(DT)(DA)(DA)(DT)(DT)(DC)(DA)(DC)(DA)(DA)(DT)(DG)
(DA)(DT)(DT)(DA)(DA)(DA)(DG)(DT)(DT)(DG)(DA)(DA)(DA)(DT)(DT)(DA)(DA)(DA)(DC)(DC)
(DA)(DT)(DC)(DT)(DC)(DA)(DA)(DG)(DC)(DC)(DC)(DA)(DA)(DT)(DT)(DT)(DA)(DC)(DT)(DA)
(DC)(DT)(DC)(DG)(DT)(DT)(DC)(DT)(DG)(DG)(DT)(DG)(DT)(DT)(DT)(DC)(DT)(DC)(DG)(DT)
(DC)(DA)(DG)(DG)(DG)(DC)(DA)(DA)(DG)(DC)(DC)(DT)(DT)(DA)(DT)(DT)(DC)(DA)(DC)(DT)
(DG)(DA)(DA)(DT)(DG)(DA)(DG)(DC)(DA)(DG)(DC)(DT)(DT)(DT)(DG)(DT)(DT)(DA)(DC)(DG)
(DT)(DT)(DG)(DA)(DT)(DT)(DT)(DG)(DG)(DG)(DT)(DA)(DA)(DT)(DG)(DA)(DA)(DT)(DA)(DT)
(DC)(DC)(DG)(DG)(DT)(DT)(DC)(DT)(DT)(DG)(DT)(DC)(DA)(DA)(DG)(DA)(DT)(DT)(DA)(DC)
(DT)(DC)(DT)(DT)(DG)(DA)(DT)(DG)(DA)(DA)(DG)(DG)(DT)(DC)(DA)(DG)(DC)(DC)(DA)(DG)
(DC)(DC)(DT)(DA)(DT)(DG)(DC)(DG)(DC)(DC)(DT)(DG)(DG)(DT)(DC)(DT)(DG)(DT)(DA)(DC)
(DA)(DC)(DC)(DG)(DT)(DT)(DC)(DA)(DT)(DC)(DT)(DG)(DT)(DC)(DC)(DT)(DC)(DT)(DT)(DT)
(DC)(DA)(DA)(DA)(DG)(DT)(DT)(DG)(DG)(DT)(DC)(DA)(DG)(DT)(DT)(DC)(DG)(DG)(DT)(DT)
(DC)(DC)(DC)(DT)(DT)(DA)(DT)(DG)(DA)(DT)(DT)(DG)(DA)(DC)(DC)(DG)(DT)(DC)(DT)(DG)
(DC)(DG)(DC)(DC)(DT)(DC)(DG)(DT)(DT)(DC)(DC)(DG)(DG)(DC)(DT)(DA)(DA)(DG)(DT)(DA)
(DA)(DC)(DA)(DT)(DG)(DG)(DA)(DG)(DC)(DA)(DG)(DG)(DT)(DC)(DG)(DC)(DG)(DG)(DA)(DT)
(DT)(DT)(DC)(DG)(DA)(DC)(DA)(DC)(DA)(DA)(DT)(DT)(DT)(DA)(DT)(DC)(DA)(DG)(DG)(DC)
(DG)(DA)(DT)(DG)(DA)(DT)(DA)(DC)(DA)(DA)(DA)(DT)(DC)(DT)(DC)(DC)(DG)(DT)(DT)(DG)
(DT)(DA)(DC)(DT)(DT)(DT)(DG)(DT)(DT)(DT)(DC)(DG)(DC)(DG)(DC)(DT)(DT)(DG)(DG)(DT)
(DA)(DT)(DA)(DA)(DT)(DC)(DG)(DC)(DT)(DG)(DG)(DG)(DG)(DG)(DT)(DC)(DA)(DA)(DA)(DG)
(DA)(DT)(DG)(DA)(DG)(DT)(DG)(DT)(DT)(DT)(DT)(DA)(DG)(DT)(DG)(DT)(DA)(DT)(DT)(DC)
(DT)(DT)(DT)(DT)(DG)(DC)(DC)(DT)(DC)(DT)(DT)(DT)(DC)(DG)(DT)(DT)(DT)(DT)(DA)(DG)
(DG)(DT)(DT)(DG)(DG)(DT)(DG)(DC)(DC)(DT)(DT)(DC)(DG)(DT)(DA)(DG)(DT)(DG)(DG)(DC)
(DA)(DT)(DT)(DA)(DC)(DG)(DT)(DA)(DT)(DT)(DT)(DT)(DA)(DC)(DC)(DC)(DG)(DT)(DT)(DT)
(DA)(DA)(DT)(DG)(DG)(DA)(DA)(DA)(DC)(DT)(DT)(DC)(DC)(DT)(DC)(DA)(DT)(DG)(DA)(DA)
(DA)(DA)(DA)(DG)(DT)(DC)(DT)(DT)(DT)(DA)(DG)(DT)(DC)(DC)(DT)(DC)(DA)(DA)(DA)(DG)
(DC)(DC)(DT)(DC)(DT)(DG)(DT)(DA)(DG)(DC)(DC)(DG)(DT)(DT)(DG)(DC)(DT)(DA)(DC)(DC)
(DC)(DT)(DC)(DG)(DT)(DT)(DC)(DC)(DG)(DA)(DT)(DG)(DC)(DT)(DG)(DT)(DC)(DT)(DT)(DT)
(DC)(DG)(DC)(DT)(DG)(DC)(DT)(DG)(DA)(DG)(DG)(DG)(DT)(DG)(DA)(DC)(DG)(DA)(DT)(DC)
(DC)(DC)(DG)(DC)(DA)(DA)(DA)(DA)(DG)(DC)(DG)(DG)(DC)(DC)(DT)(DT)(DT)(DA)(DA)(DC)
(DT)(DC)(DC)(DC)(DT)(DG)(DC)(DA)(DA)(DG)(DC)(DC)(DT)(DC)(DA)(DG)(DC)(DG)(DA)(DC)
(DC)(DG)(DA)(DA)(DT)(DA)(DT)(DA)(DT)(DC)(DG)(DG)(DT)(DT)(DA)(DT)(DG)(DC)(DG)(DT)
(DG)(DG)(DG)(DC)(DG)(DA)(DT)(DG)(DG)(DT)(DT)(DG)(DT)(DT)(DG)(DT)(DC)(DA)(DT)(DT)
(DG)(DT)(DC)(DG)(DG)(DC)(DG)(DC)(DA)(DA)(DC)(DT)(DA)(DT)(DC)(DG)(DG)(DT)(DA)(DT)
(DC)(DA)(DA)(DG)(DC)(DT)(DG)(DT)(DT)(DT)(DA)(DA)(DG)(DA)(DA)(DA)(DT)(DT)(DC)(DA)
(DC)(DC)(DT)(DC)(DG)(DA)(DA)(DA)(DG)(DC)(DA)(DA)(DG)(DC)(DT)(DG)(DA)(DT)(DA)(DA)
(DA)(DC)(DC)(DG)(DA)(DT)(DA)(DC)(DA)(DA)(DT)(DT)(DA)(DA)(DA)(DG)(DG)(DC)(DT)(DC)
(DC)(DT)(DT)(DT)(DT)(DG)(DG)(DA)(DG)(DC)(DC)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DG)
(DG)(DA)(DG)(DA)(DT)(DT)(DT)(DT)(DC)(DA)(DA)(DC)(DG)(DT)(DG)(DA)(DA)(DA)(DA)(DA)
(DA)(DT)(DT)(DA)(DT)(DT)(DA)(DT)(DT)(DC)(DG)(DC)(DA)(DA)(DT)(DT)(DC)(DC)(DT)(DT)
(DT)(DA)(DG)(DT)(DT)(DG)(DT)(DT)(DC)(DC)(DT)(DT)(DT)(DC)(DT)(DA)(DT)(DT)(DC)(DT)
(DC)(DA)(DC)(DT)(DC)(DC)(DG)(DC)(DT)(DG)(DA)(DA)(DA)(DC)(DT)(DG)(DT)(DT)(DG)(DA)
(DA)(DA)(DG)(DT)(DT)(DG)(DT)(DT)(DT)(DA)(DG)(DC)(DA)(DA)(DA)(DA)(DT)(DC)(DC)(DC)
(DA)(DT)(DA)(DC)(DA)(DG)(DA)(DA)(DA)(DA)(DT)(DT)(DC)(DA)(DT)(DT)(DT)(DA)(DC)(DT)
(DA)(DA)(DC)(DG)(DT)(DC)(DT)(DG)(DG)(DA)(DA)(DA)(DG)(DA)(DC)(DG)(DA)(DC)(DA)(DA)
(DA)(DA)(DC)(DT)(DT)(DT)(DA)(DG)(DA)(DT)(DC)(DG)(DT)(DT)(DA)(DC)(DG)(DC)(DT)(DA)
(DA)(DC)(DT)(DA)(DT)(DG)(DA)(DG)(DG)(DG)(DC)(DT)(DG)(DT)(DC)(DT)(DG)(DT)(DG)(DG)
(DA)(DA)(DT)(DG)(DC)(DT)(DA)(DC)(DA)(DG)(DG)(DC)(DG)(DT)(DT)(DG)(DT)(DA)(DG)(DT)
(DT)(DT)(DG)(DT)(DA)(DC)(DT)(DG)(DG)(DT)(DG)(DA)(DC)(DG)(DA)(DA)(DA)(DC)(DT)(DC)
(DA)(DG)(DT)(DG)(DT)(DT)(DA)(DC)(DG)(DG)(DT)(DA)(DC)(DA)(DT)(DG)(DG)(DG)(DT)(DT)
(DC)(DC)(DT)(DA)(DT)(DT)(DG)(DG)(DG)(DC)(DT)(DT)(DG)(DC)(DT)(DA)(DT)(DC)(DC)(DC)
(DT)(DG)(DA)(DA)(DA)(DA)(DT)(DG)(DA)(DG)(DG)(DG)(DT)(DG)(DG)(DT)(DG)(DG)(DC)(DT)
(DC)(DT)(DG)(DA)(DG)(DG)(DG)(DT)(DG)(DG)(DC)(DG)(DG)(DT)(DT)(DC)(DT)(DG)(DA)(DG)
(DG)(DG)(DT)(DG)(DG)(DC)(DG)(DG)(DT)(DT)(DC)(DT)(DG)(DA)(DG)(DG)(DG)(DT)(DG)(DG)
(DC)(DG)(DG)(DT)(DA)(DC)(DT)(DA)(DA)(DA)(DC)(DC)(DT)(DC)(DC)(DT)(DG)(DA)(DG)(DT)
(DA)(DC)(DG)(DG)(DT)(DG)(DA)(DT)(DA)(DC)(DA)(DC)(DC)(DT)(DA)(DT)(DT)(DC)(DC)(DG)
(DG)(DG)(DC)(DT)(DA)(DT)(DA)(DC)(DT)(DT)(DA)(DT)(DA)(DT)(DC)(DA)(DA)(DC)(DC)(DC)
(DT)(DC)(DT)(DC)(DG)(DA)(DC)(DG)(DG)(DC)(DA)(DC)(DT)(DT)(DA)(DT)(DC)(DC)(DG)(DC)
(DC)(DT)(DG)(DG)(DT)(DA)(DC)(DT)(DG)(DA)(DG)(DC)(DA)(DA)(DA)(DA)(DC)(DC)(DC)(DC)
(DG)(DC)(DT)(DA)(DA)(DT)(DC)(DC)(DT)(DA)(DA)(DT)(DC)(DC)(DT)(DT)(DC)(DT)(DC)(DT)
(DT)(DG)(DA)(DG)(DG)(DA)(DG)(DT)(DC)(DT)(DC)(DA)(DG)(DC)(DC)(DT)(DC)(DT)(DT)(DA)
(DA)(DT)(DA)(DC)(DT)(DT)(DT)(DC)(DA)(DT)(DG)(DT)(DT)(DT)(DC)(DA)(DG)(DA)(DA)(DT)
(DA)(DA)(DT)(DA)(DG)(DG)(DT)(DT)(DC)(DC)(DG)(DA)(DA)(DA)(DT)(DA)(DG)(DG)(DC)(DA)
(DG)(DG)(DG)(DG)(DG)(DC)(DA)(DT)(DT)(DA)(DA)(DC)(DT)(DG)(DT)(DT)(DT)(DA)(DT)(DA)
(DC)(DG)(DG)(DG)(DC)(DA)(DC)(DT)(DG)(DT)(DT)(DA)(DC)(DT)(DC)(DA)(DA)(DG)(DG)(DC)
(DA)(DC)(DT)(DG)(DA)(DC)(DC)(DC)(DC)(DG)(DT)(DT)(DA)(DA)(DA)(DA)(DC)(DT)(DT)(DA)
(DT)(DT)(DA)(DC)(DC)(DA)(DG)(DT)(DA)(DC)(DA)(DC)(DT)(DC)(DC)(DT)(DG)(DT)(DA)(DT)
(DC)(DA)(DT)(DC)(DA)(DA)(DA)(DA)(DG)(DC)(DC)(DA)(DT)(DG)(DT)(DA)(DT)(DG)(DA)(DC)
(DG)(DC)(DT)(DT)(DA)(DC)(DT)(DG)(DG)(DA)(DA)(DC)(DG)(DG)(DT)(DA)(DA)(DA)(DT)(DT)
(DC)(DA)(DG)(DA)(DG)(DA)(DC)(DT)(DG)(DC)(DG)(DC)(DT)(DT)(DT)(DC)(DC)(DA)(DT)(DT)
(DC)(DT)(DG)(DG)(DC)(DT)(DT)(DT)(DA)(DA)(DT)(DG)(DA)(DG)(DG)(DA)(DT)(DT)(DT)(DA)
(DT)(DT)(DT)(DG)(DT)(DT)(DT)(DG)(DT)(DG)(DA)(DA)(DT)(DA)(DT)(DC)(DA)(DA)(DG)(DG)
(DC)(DC)(DA)(DA)(DT)(DC)(DG)(DT)(DC)(DT)(DG)(DA)(DC)(DC)(DT)(DG)(DC)(DC)(DT)(DC)
(DA)(DA)(DC)(DC)(DT)(DC)(DC)(DT)(DG)(DT)(DC)(DA)(DA)(DT)(DG)(DC)(DT)(DG)(DG)(DC)
(DG)(DG)(DC)(DG)(DG)(DC)(DT)(DC)(DT)(DG)(DG)(DT)(DG)(DG)(DT)(DG)(DG)(DT)(DT)(DC)
(DT)(DG)(DG)(DT)(DG)(DG)(DC)(DG)(DG)(DC)(DT)(DC)(DT)(DG)(DA)(DG)(DG)(DG)(DT)(DG)
(DG)(DT)(DG)(DG)(DC)(DT)(DC)(DT)(DG)(DA)(DG)(DG)(DG)(DT)(DG)(DG)(DC)(DG)(DG)(DT)
(DT)(DC)(DT)(DG)(DA)(DG)(DG)(DG)(DT)(DG)(DG)(DC)(DG)(DG)(DC)(DT)(DC)(DT)(DG)(DA)
(DG)(DG)(DG)(DA)(DG)(DG)(DC)(DG)(DG)(DT)(DT)(DC)(DC)(DG)(DG)(DT)(DG)(DG)(DT)(DG)
(DG)(DC)(DT)(DC)(DT)(DG)(DG)(DT)(DT)(DC)(DC)(DG)(DG)(DT)(DG)(DA)(DT)(DT)(DT)(DT)
(DG)(DA)(DT)(DT)(DA)(DT)(DG)(DA)(DA)(DA)(DA)(DG)(DA)(DT)(DG)(DG)(DC)(DA)(DA)(DA)
(DC)(DG)(DC)(DT)(DA)(DA)(DT)(DA)(DA)(DG)(DG)(DG)(DG)(DG)(DC)(DT)(DA)(DT)(DG)(DA)
(DC)(DC)(DG)(DA)(DA)(DA)(DA)(DT)(DG)(DC)(DC)(DG)(DA)(DT)(DG)(DA)(DA)(DA)(DA)(DC)
(DG)(DC)(DG)(DC)(DT)(DA)(DC)(DA)(DG)(DT)(DC)(DT)(DG)(DA)(DC)(DG)(DC)(DT)(DA)(DA)
(DA)(DG)(DG)(DC)(DA)(DA)(DA)(DC)(DT)(DT)(DG)(DA)(DT)(DT)(DC)(DT)(DG)(DT)(DC)(DG)
(DC)(DT)(DA)(DC)(DT)(DG)(DA)(DT)(DT)(DA)(DC)(DG)(DG)(DT)(DG)(DC)(DT)(DG)(DC)(DT)
(DA)(DT)(DC)(DG)(DA)(DT)(DG)(DG)(DT)(DT)(DT)(DC)(DA)(DT)(DT)(DG)(DG)(DT)(DG)(DA)
(DC)(DG)(DT)(DT)(DT)(DC)(DC)(DG)(DG)(DC)(DC)(DT)(DT)(DG)(DC)(DT)(DA)(DA)(DT)(DG)
(DG)(DT)(DA)(DA)(DT)(DG)(DG)(DT)(DG)(DC)(DT)(DA)(DC)(DT)(DG)(DG)(DT)(DG)(DA)(DT)
(DT)(DT)(DT)(DG)(DC)(DT)(DG)(DG)(DC)(DT)(DC)(DT)(DA)(DA)(DT)(DT)(DC)(DC)(DC)(DA)
(DA)(DA)(DT)(DG)(DG)(DC)(DT)(DC)(DA)(DA)(DG)(DT)(DC)(DG)(DG)(DT)(DG)(DA)(DC)(DG)
(DG)(DT)(DG)(DA)(DT)(DA)(DA)(DT)(DT)(DC)(DA)(DC)(DC)(DT)(DT)(DT)(DA)(DA)(DT)(DG)
(DA)(DA)(DT)(DA)(DA)(DT)(DT)(DT)(DC)(DC)(DG)(DT)(DC)(DA)(DA)(DT)(DA)(DT)(DT)(DT)
(DA)(DC)(DC)(DT)(DT)(DC)(DC)(DC)(DT)(DC)(DC)(DC)(DT)(DC)(DA)(DA)(DT)(DC)(DG)(DG)
(DT)(DT)(DG)(DA)(DA)(DT)(DG)(DT)(DC)(DG)(DC)(DC)(DC)(DT)(DT)(DT)(DT)(DG)(DT)(DC)
(DT)(DT)(DT)(DG)(DG)(DC)(DG)(DC)(DT)(DG)(DG)(DT)(DA)(DA)(DA)(DC)(DC)(DA)(DT)(DA)
(DT)(DG)(DA)(DA)(DT)(DT)(DT)(DT)(DC)(DT)(DA)(DT)(DT)(DG)(DA)(DT)(DT)(DG)(DT)(DG)
(DA)(DC)(DA)(DA)(DA)(DA)(DT)(DA)(DA)(DA)(DC)(DT)(DT)(DA)(DT)(DT)(DC)(DC)(DG)(DT)
(DG)(DG)(DT)(DG)(DT)(DC)(DT)(DT)(DT)(DG)(DC)(DG)(DT)(DT)(DT)(DC)(DT)(DT)(DT)(DT)
(DA)(DT)(DA)(DT)(DG)(DT)(DT)(DG)(DC)(DC)(DA)(DC)(DC)(DT)(DT)(DT)(DA)(DT)(DG)(DT)
(DA)(DT)(DG)(DT)(DA)(DT)(DT)(DT)(DT)(DC)(DT)(DA)(DC)(DG)(DT)(DT)(DT)(DG)(DC)(DT)
(DA)(DA)(DC)(DA)(DT)(DA)(DC)(DT)(DG)(DC)(DG)(DT)(DA)(DA)(DT)(DA)(DA)(DG)(DG)(DA)
(DG)(DT)(DC)(DT)(DT)(DA)(DA)(DT)(DC)(DA)(DT)(DG)(DC)(DC)(DA)(DG)(DT)(DT)(DC)(DT)
(DT)(DT)(DT)(DG)(DG)(DG)(DT)(DA)(DT)(DT)(DC)(DC)(DG)(DT)(DT)(DA)(DT)(DT)(DA)(DT)
(DT)(DG)(DC)(DG)(DT)(DT)(DT)(DC)(DC)(DT)(DC)(DG)(DG)(DT)(DT)(DT)(DC)(DC)(DT)(DT)
(DC)(DT)(DG)(DG)(DT)(DA)(DA)(DC)(DT)(DT)(DT)(DG)(DT)(DT)(DC)(DG)(DG)(DC)(DT)(DA)
(DT)(DC)(DT)(DG)(DC)(DT)(DT)(DA)(DC)(DT)(DT)(DT)(DT)(DC)(DT)(DT)(DA)(DA)(DA)(DA)
(DA)(DG)(DG)(DG)(DC)(DT)(DT)(DC)(DG)(DG)(DT)(DA)(DA)(DG)(DA)(DT)(DA)(DG)(DC)(DT)
(DA)(DT)(DT)(DG)(DC)(DT)(DA)(DT)(DT)(DT)(DC)(DA)(DT)(DT)(DG)(DT)(DT)(DT)(DC)(DT)
(DT)(DG)(DC)(DT)(DC)(DT)(DT)(DA)(DT)(DT)(DA)(DT)(DT)(DG)(DG)(DG)(DC)(DT)(DT)(DA)
(DA)(DC)(DT)(DC)(DA)(DA)(DT)(DT)(DC)(DT)(DT)(DG)(DT)(DG)(DG)(DG)(DT)(DT)(DA)(DT)
(DC)(DT)(DC)(DT)(DC)(DT)(DG)(DA)(DT)(DA)(DT)(DT)(DA)(DG)(DC)(DG)(DC)(DT)(DC)(DA)
(DA)(DT)(DT)(DA)(DC)(DC)(DC)(DT)(DC)(DT)(DG)(DA)(DC)(DT)(DT)(DT)(DG)(DT)(DT)(DC)
(DA)(DG)(DG)(DG)(DT)(DG)(DT)(DT)(DC)(DA)(DG)(DT)(DT)(DA)(DA)(DT)(DT)(DC)(DT)(DC)
(DC)(DC)(DG)(DT)(DC)(DT)(DA)(DA)(DT)(DG)(DC)(DG)(DC)(DT)(DT)(DC)(DC)(DC)(DT)(DG)
(DT)(DT)(DT)(DT)(DT)(DA)(DT)(DG)(DT)(DT)(DA)(DT)(DT)(DC)(DT)(DC)(DT)(DC)(DT)(DG)
(DT)(DA)(DA)(DA)(DG)(DG)(DC)(DT)(DG)(DC)(DT)(DA)(DT)(DT)(DT)(DT)(DC)(DA)(DT)(DT)
(DT)(DT)(DT)(DG)(DA)(DC)(DG)(DT)(DT)(DA)(DA)(DA)(DC)(DA)(DA)(DA)(DA)(DA)(DA)(DT)
(DC)(DG)(DT)(DT)(DT)(DC)(DT)(DT)(DA)(DT)(DT)(DT)(DG)(DG)(DA)(DT)(DT)(DG)(DG)(DG)
(DA)(DT)(DA)(DA)(DA)(DT)(DA)(DA)(DT)(DA)(DT)(DG)(DG)(DC)(DT)(DG)(DT)(DT)(DT)(DA)
(DT)(DT)(DT)(DT)(DG)(DT)(DA)(DA)(DC)(DT)(DG)(DG)(DC)(DA)(DA)(DA)(DT)(DT)(DA)(DG)
(DG)(DC)(DT)(DC)(DT)(DG)(DG)(DA)(DA)(DA)(DG)(DA)(DC)(DG)(DC)(DT)(DC)(DG)(DT)(DT)
(DA)(DG)(DC)(DG)(DT)(DT)(DG)(DG)(DT)(DA)(DA)(DG)(DA)(DT)(DT)(DC)(DA)(DG)(DG)(DA)
(DT)(DA)(DA)(DA)(DA)(DT)(DT)(DG)(DT)(DA)(DG)(DC)(DT)(DG)(DG)(DG)(DT)(DG)(DC)(DA)
(DA)(DA)(DA)(DT)(DA)(DG)(DC)(DA)(DA)(DC)(DT)(DA)(DA)(DT)(DC)(DT)(DT)(DG)(DA)(DT)
(DT)(DT)(DA)(DA)(DG)(DG)(DC)(DT)(DT)(DC)(DA)(DA)(DA)(DA)(DC)(DC)(DT)(DC)(DC)(DC)
(DG)(DC)(DA)(DA)(DG)(DT)(DC)(DG)(DG)(DG)(DA)(DG)(DG)(DT)(DT)(DC)(DG)(DC)(DT)(DA)
(DA)(DA)(DA)(DC)(DG)(DC)(DC)(DT)(DC)(DG)(DC)(DG)(DT)(DT)(DC)(DT)(DT)(DA)(DG)(DA)
(DA)(DT)(DA)(DC)(DC)(DG)(DG)(DA)(DT)(DA)(DA)(DG)(DC)(DC)(DT)(DT)(DC)(DT)(DA)(DT)
(DA)(DT)(DC)(DT)(DG)(DA)(DT)(DT)(DT)(DG)(DC)(DT)(DT)(DG)(DC)(DT)(DA)(DT)(DT)(DG)
(DG)(DG)(DC)(DG)(DC)(DG)(DG)(DT)(DA)(DA)(DT)(DG)(DA)(DT)(DT)(DC)(DC)(DT)(DA)(DC)
(DG)(DA)(DT)(DG)(DA)(DA)(DA)(DA)(DT)(DA)(DA)(DA)(DA)(DA)(DC)(DG)(DG)(DC)(DT)(DT)
(DG)(DC)(DT)(DT)(DG)(DT)(DT)(DC)(DT)(DC)(DG)(DA)(DT)(DG)(DA)(DG)(DT)(DG)(DC)(DG)
(DG)(DT)(DA)(DC)(DT)(DT)(DG)(DG)(DT)(DT)(DT)(DA)(DA)(DT)(DA)(DC)(DC)(DC)(DG)(DT)
(DT)(DC)(DT)(DT)(DG)(DG)(DA)(DA)(DT)(DG)(DA)(DT)(DA)(DA)(DG)(DG)(DA)(DA)(DA)(DG)
(DA)(DC)(DA)(DG)(DC)(DC)(DG)(DA)(DT)(DT)(DA)(DT)(DT)(DG)(DA)(DT)(DT)(DG)(DG)(DT)
(DT)(DT)(DC)(DT)(DA)(DC)(DA)(DT)(DG)(DC)(DT)(DC)(DG)(DT)(DA)(DA)(DA)(DT)(DT)(DA)
(DG)(DG)(DA)(DT)(DG)(DG)(DG)(DA)(DT)(DA)(DT)(DT)(DA)(DT)(DT)(DT)(DT)(DT)(DC)(DT)
(DT)(DG)(DT)(DT)(DC)(DA)(DG)(DG)(DA)(DC)(DT)(DT)(DA)(DT)(DC)(DT)(DA)(DT)(DT)(DG)
(DT)(DT)(DG)(DA)(DT)(DA)(DA)(DA)(DC)(DA)(DG)(DG)(DC)(DG)(DC)(DG)(DT)(DT)(DC)(DT)
(DG)(DC)(DA)(DT)(DT)(DA)(DG)(DC)(DT)(DG)(DA)(DA)(DC)(DA)(DT)(DG)(DT)(DT)(DG)(DT)
(DT)(DT)(DA)(DT)(DT)(DG)(DT)(DC)(DG)(DT)(DC)(DG)(DT)(DC)(DT)(DG)(DG)(DA)(DC)(DA)
(DG)(DA)(DA)(DT)(DT)(DA)(DC)(DT)(DT)(DT)(DA)(DC)(DC)(DT)(DT)(DT)(DT)(DG)(DT)(DC)
(DG)(DG)(DT)(DA)(DC)(DT)(DT)(DT)(DA)(DT)(DA)(DT)(DT)(DC)(DT)(DC)(DT)(DT)(DA)(DT)
(DT)(DA)(DC)(DT)(DG)(DG)(DC)(DT)(DC)(DG)(DA)(DA)(DA)(DA)(DT)(DG)(DC)(DC)(DT)(DC)
(DT)(DG)(DC)(DC)(DT)(DA)(DA)(DA)(DT)(DT)(DA)(DC)(DA)(DT)(DG)(DT)(DT)(DG)(DG)(DC)
(DG)(DT)(DT)(DG)(DT)(DT)(DA)(DA)(DA)(DT)(DA)(DT)(DG)(DG)(DC)(DG)(DA)(DT)(DT)(DC)
(DT)(DC)(DA)(DA)(DT)(DT)(DA)(DA)(DG)(DC)(DC)(DC)(DT)(DA)(DC)(DT)(DG)(DT)(DT)(DG)
(DA)(DG)(DC)(DG)(DT)(DT)(DG)(DG)(DC)(DT)(DT)(DT)(DA)(DT)(DA)(DC)(DT)(DG)(DG)(DT)
(DA)(DA)(DG)(DA)(DA)(DT)(DT)(DT)(DG)(DT)(DA)(DT)(DA)(DA)(DC)(DG)(DC)(DA)(DT)(DA)
(DT)(DG)(DA)(DT)(DA)(DC)(DT)(DA)(DA)(DA)(DC)(DA)(DG)(DG)(DC)(DT)(DT)(DT)(DT)(DT)
(DC)(DT)(DA)(DG)(DT)(DA)(DA)(DT)(DT)(DA)(DT)(DG)(DA)(DT)(DT)(DC)(DC)(DG)(DG)(DT)
(DG)(DT)(DT)(DT)(DA)(DT)(DT)(DC)(DT)(DT)(DA)(DT)(DT)(DT)(DA)(DA)(DC)(DG)(DC)(DC)
(DT)(DT)(DA)(DT)(DT)(DT)(DA)(DT)(DC)(DA)(DC)(DA)(DC)(DG)(DG)(DT)(DC)(DG)(DG)(DT)
(DA)(DT)(DT)(DT)(DC)(DA)(DA)(DA)(DC)(DC)(DA)(DT)(DT)(DA)(DA)(DA)(DT)(DT)(DT)(DA)
(DG)(DG)(DT)(DC)(DA)(DG)(DA)(DA)(DG)(DA)(DT)(DG)(DA)(DA)(DA)(DT)(DT)(DA)(DA)(DC)
(DT)(DA)(DA)(DA)(DA)(DT)(DA)(DT)(DA)(DT)(DT)(DT)(DG)(DA)(DA)(DA)(DA)(DA)(DG)(DT)
(DT)(DT)(DT)(DC)(DT)(DC)(DG)(DC)(DG)(DT)(DT)(DC)(DT)(DT)(DT)(DG)(DT)(DC)(DT)(DT)
(DG)(DC)(DG)(DA)(DT)(DT)(DG)(DG)(DA)(DT)(DT)(DT)(DG)(DC)(DA)(DT)(DC)(DA)(DG)(DC)
(DA)(DT)(DT)(DT)(DA)(DC)(DA)(DT)(DA)(DT)(DA)(DG)(DT)(DT)(DA)(DT)(DA)(DT)(DA)(DA)
(DC)(DC)(DC)(DA)(DA)(DC)(DC)(DT)(DA)(DA)(DG)(DC)(DC)(DG)(DG)(DA)(DG)(DG)(DT)(DT)
(DA)(DA)(DA)(DA)(DA)(DG)(DG)(DT)(DA)(DG)(DT)(DC)(DT)(DC)(DT)(DC)(DA)(DG)(DA)(DC)
(DC)(DT)(DA)(DT)(DG)(DA)(DT)(DT)(DT)(DT)(DG)(DA)(DT)(DA)(DA)(DA)(DT)(DT)(DC)(DA)
(DC)(DT)(DA)(DT)(DT)(DG)(DA)(DC)(DT)(DC)(DT)(DT)(DC)(DT)(DC)(DA)(DG)(DC)(DG)(DT)
(DC)(DT)(DT)(DA)(DA)(DT)(DC)(DT)(DA)(DA)(DG)(DC)(DT)(DA)(DT)(DC)(DG)(DC)(DT)(DA)
(DT)(DG)(DT)(DT)(DT)(DT)(DC)(DA)(DA)(DG)(DG)(DA)(DT)(DT)(DC)(DT)(DA)(DA)(DG)(DG)
(DG)(DA)(DA)(DA)(DA)(DT)(DT)(DA)(DA)(DT)(DT)(DA)(DA)(DT)(DA)(DG)(DC)(DG)(DA)(DC)
(DG)(DA)(DT)(DT)(DT)(DA)(DC)(DA)(DG)(DA)(DA)(DG)(DC)(DA)(DA)(DG)(DG)(DT)(DT)(DA)
(DT)(DT)(DC)(DA)(DC)(DT)(DC)(DA)(DC)(DA)(DT)(DA)(DT)(DA)(DT)(DT)(DG)(DA)(DT)(DT)
(DT)(DA)(DT)(DG)(DT)(DA)(DC)(DT)(DG)(DT)(DT)(DT)(DC)(DC)(DA)(DT)(DT)(DA)(DA)(DA)
(DA)(DA)(DA)(DG)(DG)(DT)(DA)(DA)(DT)(DT)(DC)(DA)(DA)(DA)(DT)(DG)(DA)(DA)(DA)(DT)
(DT)(DG)(DT)(DT)(DA)(DA)(DA)(DT)(DG)(DT)(DA)(DA)(DT)(DT)(DA)(DA)(DT)(DT)(DT)(DT)
(DG)(DT)(DT)(DT)(DT)(DC)(DT)(DT)(DG)(DA)(DT)(DG)(DT)(DT)(DT)(DG)(DT)(DT)(DT)(DC)
(DA)(DT)(DC)(DA)(DT)(DC)(DT)(DT)(DC)(DT)(DT)(DT)(DT)(DG)(DC)(DT)(DC)(DA)(DG)(DG)
(DT)(DA)(DA)(DT)(DT)(DG)(DA)(DA)(DA)(DT)(DG)(DA)(DA)(DT)(DA)(DA)(DT)(DT)(DC)(DG)
(DC)(DC)(DT)(DC)(DT)(DG)(DC)(DG)(DC)(DG)(DA)(DT)(DT)(DT)(DT)(DG)(DT)(DA)(DA)(DC)
(DT)(DT)(DG)(DG)(DT)(DA)(DT)(DT)(DC)(DA)(DA)(DA)(DG)(DC)(DA)(DA)(DT)(DC)(DA)(DG)
(DG)(DC)(DG)(DA)(DA)(DT)(DC)(DC)(DG)(DT)(DT)(DA)(DT)(DT)(DG)(DT)(DT)(DT)(DC)(DT)
(DC)(DC)(DC)(DG)(DA)(DT)(DG)(DT)(DA)(DA)(DA)(DA)(DG)(DG)(DT)(DA)(DC)(DT)(DG)(DT)
(DT)(DA)(DC)(DT)(DG)(DT)(DA)(DT)(DA)(DT)(DT)(DC)(DA)(DT)(DC)(DT)(DG)(DA)(DC)(DG)
(DT)(DT)(DA)(DA)(DA)(DC)(DC)(DT)(DG)(DA)(DA)(DA)(DA)(DT)(DC)(DT)(DA)(DC)(DG)(DC)
(DA)(DA)(DT)(DT)(DT)(DC)(DT)(DT)(DT)(DA)(DT)(DT)(DT)(DC)(DT)(DG)(DT)(DT)(DT)(DT)
(DA)(DC)(DG)(DT)(DG)(DC)(DA)(DA)(DA)(DT)(DA)(DA)(DT)(DT)(DT)(DT)(DG)(DA)(DT)(DA)
(DT)(DG)(DG)(DT)(DA)(DG)(DG)(DT)(DT)(DC)(DT)(DA)(DA)(DC)(DC)(DC)(DT)(DT)(DC)(DC)
(DA)(DT)(DT)(DA)(DT)(DT)(DC)(DA)(DG)(DA)(DA)(DG)(DT)(DA)(DT)(DA)(DA)(DT)(DC)(DC)
(DA)(DA)(DA)(DC)(DA)(DA)(DT)(DC)(DA)(DG)(DG)(DA)(DT)(DT)(DA)(DT)(DA)(DT)(DT)(DG)
(DA)(DT)(DG)(DA)(DA)(DT)(DT)(DG)(DC)(DC)(DA)(DT)(DC)(DA)(DT)(DC)(DT)(DG)(DA)(DT)
(DA)(DA)(DT)(DC)(DA)(DG)(DG)(DA)(DA)(DT)(DA)(DT)(DG)(DA)(DT)(DG)(DA)(DT)(DA)(DA)
(DT)(DT)(DC)(DC)(DG)(DC)(DT)(DC)(DC)(DT)(DT)(DC)(DT)(DG)(DG)(DT)(DG)(DG)(DT)(DT)
(DT)(DC)(DT)(DT)(DT)(DG)(DT)(DT)(DC)(DC)(DG)(DC)(DA)(DA)(DA)(DA)(DT)(DG)(DA)(DT)
(DA)(DA)(DT)(DG)(DT)(DT)(DA)(DC)(DT)(DC)(DA)(DA)(DA)(DC)(DT)(DT)(DT)(DT)(DA)(DA)
(DA)(DA)(DT)(DT)(DA)(DA)(DT)(DA)(DA)(DC)(DG)(DT)(DT)(DC)(DG)(DG)(DG)(DC)(DA)(DA)
(DA)(DG)(DG)(DA)(DT)(DT)(DT)(DA)(DA)(DT)(DA)(DC)(DG)(DA)(DG)(DT)(DT)(DG)(DT)(DC)
(DG)(DA)(DA)(DT)(DT)(DG)(DT)(DT)(DT)(DG)(DT)(DA)(DA)(DA)(DG)(DT)(DC)(DT)(DA)(DA)
(DT)(DA)(DC)(DT)(DT)(DC)(DT)(DA)(DA)(DA)(DT)(DC)(DC)(DT)(DC)(DA)(DA)(DA)(DT)(DG)
(DT)(DA)(DT)(DT)(DA)(DT)(DC)(DT)(DA)(DT)(DT)(DG)(DA)(DC)(DG)(DG)(DC)(DT)(DC)(DT)
(DA)(DA)(DT)(DC)(DT)(DA)(DT)(DT)(DA)(DG)(DT)(DT)(DG)(DT)(DT)(DA)(DG)(DT)(DG)(DC)
(DT)(DC)(DC)(DT)(DA)(DA)(DA)(DG)(DA)(DT)(DA)(DT)(DT)(DT)(DT)(DA)(DG)(DA)(DT)(DA)
(DA)(DC)(DC)(DT)(DT)(DC)(DC)(DT)(DC)(DA)(DA)(DT)(DT)(DC)(DC)(DT)(DT)(DT)(DC)(DA)
(DA)(DC)(DT)(DG)(DT)(DT)(DG)(DA)(DT)(DT)(DT)(DG)(DC)(DC)(DA)(DA)(DC)(DT)(DG)(DA)
(DC)(DC)(DA)(DG)(DA)(DT)(DA)(DT)(DT)(DG)(DA)(DT)(DT)(DG)(DA)(DG)(DG)(DG)(DT)(DT)
(DT)(DG)(DA)(DT)(DA)(DT)(DT)(DT)(DG)(DA)(DG)(DG)(DT)(DT)(DC)(DA)(DG)(DC)(DA)(DA)
(DG)(DG)(DT)(DG)(DA)(DT)(DG)(DC)(DT)(DT)(DT)(DA)(DG)(DA)(DT)(DT)(DT)(DT)(DT)(DC)
(DA)(DT)(DT)(DT)(DG)(DC)(DT)(DG)(DC)(DT)(DG)(DG)(DC)(DT)(DC)(DT)(DC)(DA)(DG)(DC)
(DG)(DT)(DG)(DG)(DC)(DA)(DC)(DT)(DG)(DT)(DT)(DG)(DC)(DA)(DG)(DG)(DC)(DG)(DG)(DT)
(DG)(DT)(DT)(DA)(DA)(DT)(DA)(DC)(DT)(DG)(DA)(DC)(DC)(DG)(DC)(DC)(DT)(DC)(DA)(DC)
(DC)(DT)(DC)(DT)(DG)(DT)(DT)(DT)(DT)(DA)(DT)(DC)(DT)(DT)(DC)(DT)(DG)(DC)(DT)(DG)
(DG)(DT)(DG)(DG)(DT)(DT)(DC)(DG)(DT)(DT)(DC)(DG)(DG)(DT)(DA)(DT)(DT)(DT)(DT)(DT)
(DA)(DA)(DT)(DG)(DG)(DC)(DG)(DA)(DT)(DG)(DT)(DT)(DT)(DT)(DA)(DG)(DG)(DG)(DC)(DT)
(DA)(DT)(DC)(DA)(DG)(DT)(DT)(DC)(DG)(DC)(DG)(DC)(DA)(DT)(DT)(DA)(DA)(DA)(DG)(DA)
(DC)(DT)(DA)(DA)(DT)(DA)(DG)(DC)(DC)(DA)(DT)(DT)(DC)(DA)(DA)(DA)(DA)(DA)(DT)(DA)
(DT)(DT)(DG)(DT)(DC)(DT)(DG)(DT)(DG)(DC)(DC)(DA)(DC)(DG)(DT)(DA)(DT)(DT)(DC)(DT)
(DT)(DA)(DC)(DG)(DC)(DT)(DT)(DT)(DC)(DA)(DG)(DG)(DT)(DC)(DA)(DG)(DA)(DA)(DG)(DG)
(DG)(DT)(DT)(DC)(DT)(DA)(DT)(DC)(DT)(DC)(DT)(DG)(DT)(DT)(DG)(DG)(DC)(DC)(DA)(DG)
(DA)(DA)(DT)(DG)(DT)(DC)(DC)(DC)(DT)(DT)(DT)(DT)(DA)(DT)(DT)(DA)(DC)(DT)(DG)(DG)
(DT)(DC)(DG)(DT)(DG)(DT)(DG)(DA)(DC)(DT)(DG)(DG)(DT)(DG)(DA)(DA)(DT)(DC)(DT)(DG)
(DC)(DC)(DA)(DA)(DT)(DG)(DT)(DA)(DA)(DA)(DT)(DA)(DA)(DT)(DC)(DC)(DA)(DT)(DT)(DT)
(DC)(DA)(DG)(DA)(DC)(DG)(DA)(DT)(DT)(DG)(DA)(DG)(DC)(DG)(DT)(DC)(DA)(DA)(DA)(DA)
(DT)(DG)(DT)(DA)(DG)(DG)(DT)(DA)(DT)(DT)(DT)(DC)(DC)(DA)(DT)(DG)(DA)(DG)(DC)(DG)
(DT)(DT)(DT)(DT)(DT)(DC)(DC)(DT)(DG)(DT)(DT)(DG)(DC)(DA)(DA)(DT)(DG)(DG)(DC)(DT)
(DG)(DG)(DC)(DG)(DG)(DT)(DA)(DA)(DT)(DA)(DT)(DT)(DG)(DT)(DT)(DC)(DT)(DG)(DG)(DA)
(DT)(DA)(DT)(DT)(DA)(DC)(DC)(DA)(DG)(DC)(DA)(DA)(DG)(DG)(DC)(DC)(DG)(DA)(DT)(DA)
(DG)(DT)(DT)(DT)(DG)(DA)(DG)(DT)(DT)(DC)(DT)(DT)(DC)(DT)(DA)(DC)(DT)(DC)(DA)(DG)
(DG)(DC)(DA)(DA)(DG)(DT)(DG)(DA)(DT)(DG)(DT)(DT)(DA)(DT)(DT)(DA)(DC)(DT)(DA)(DA)
(DT)(DC)(DA)(DA)(DA)(DG)(DA)(DA)(DG)(DT)(DA)(DT)(DT)(DG)(DC)(DT)(DA)(DC)(DA)(DA)
(DC)(DG)(DG)(DT)(DT)(DA)(DA)(DT)(DT)(DT)(DG)(DC)(DG)(DT)(DG)(DA)(DT)(DG)(DG)(DA)
(DC)(DA)(DG)(DA)(DC)(DT)(DC)(DT)(DT)(DT)(DT)(DA)(DC)(DT)(DC)(DG)(DG)(DT)(DG)(DG)
(DC)(DC)(DT)(DC)(DA)(DC)(DT)(DG)(DA)(DT)(DT)(DA)(DT)(DA)(DA)(DA)(DA)(DA)(DC)(DA)
(DC)(DT)(DT)(DC)(DT)(DC)(DA)(DG)(DG)(DA)(DT)(DT)(DC)(DT)(DG)(DG)(DC)(DG)(DT)(DA)
(DC)(DC)(DG)(DT)(DT)(DC)(DC)(DT)(DG)(DT)(DC)(DT)(DA)(DA)(DA)(DA)(DT)(DC)(DC)(DC)
(DT)(DT)(DT)(DA)(DA)(DT)(DC)(DG)(DG)(DC)(DC)(DT)(DC)(DC)(DT)(DG)(DT)(DT)(DT)(DA)
(DG)(DC)(DT)(DC)(DC)(DC)(DG)(DC)(DT)(DC)(DT)(DG)(DA)(DT)(DT)(DC)(DT)(DA)(DA)(DC)
(DG)(DA)(DG)(DG)(DA)(DA)(DA)(DG)(DC)(DA)(DC)(DG)(DT)(DT)(DA)(DT)(DA)(DC)(DG)(DT)
(DG)(DC)(DT)(DC)(DG)(DT)(DC)(DA)(DA)(DA)(DG)(DC)(DA)(DA)(DC)(DC)(DA)(DT)(DA)(DG)
(DT)(DA)(DC)(DG)(DC)(DG)(DC)(DC)(DC)(DT)(DG)(DT)(DA)(DG)(DC)(DG)(DG)(DC)(DG)(DC)
(DA)(DT)(DT)(DA)(DA)(DG)(DC)(DG)(DC)(DG)(DG)(DC)(DG)(DG)(DG)(DT)(DG)(DT)(DG)(DG)
(DT)(DG)(DG)(DT)(DT)(DA)(DC)(DG)(DC)(DG)(DC)(DA)(DG)(DC)(DG)(DT)(DG)(DA)(DC)(DC)
(DG)(DC)(DT)(DA)(DC)(DA)(DC)(DT)(DT)(DG)(DC)(DC)(DA)(DG)(DC)(DG)(DC)(DC)(DC)(DT)
(DA)(DG)(DC)(DG)(DC)(DC)(DC)(DG)(DC)(DT)(DC)(DC)(DT)(DT)(DT)(DC)(DG)(DC)(DT)(DT)
(DT)(DC)(DT)(DT)(DC)(DC)(DC)(DT)(DT)(DC)(DC)(DT)(DT)(DT)(DC)(DT)(DC)(DG)(DC)(DC)
(DA)(DC)(DG)(DT)(DT)(DC)(DG)(DC)(DC)(DG)(DG)(DC)(DT)(DT)(DT)(DC)(DC)(DC)(DC)(DG)
(DT)(DC)(DA)(DA)(DG)(DC)(DT)(DC)(DT)(DA)(DA)(DA)(DT)(DC)(DG)(DG)(DG)(DG)(DG)(DC)
(DT)(DC)(DC)(DC)(DT)(DT)(DT)(DA)(DG)(DG)(DG)(DT)(DT)(DC)(DC)(DG)(DA)(DT)(DT)(DT)
(DA)(DG)(DT)(DG)(DC)(DT)(DT)(DT)(DA)(DC)(DG)(DG)(DC)(DA)(DC)(DC)(DT)(DC)(DG)(DA)
(DC)(DC)(DC)(DC)(DA)(DA)(DA)(DA)(DA)(DA)(DC)(DT)(DT)(DG)(DA)(DT)(DT)(DT)(DG)(DG)
(DG)(DT)(DG)(DA)(DT)(DG)(DG)(DT)(DT)(DC)(DA)(DC)(DG)(DT)(DA)(DG)(DT)(DG)(DG)(DG)
(DC)(DC)(DA)(DT)(DC)(DG)(DC)(DC)(DC)
;
;TGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACT
CAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGAACCACCATCAAACAGGATTTTCGCCT
GCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCT
CACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAG
CTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCAC
CCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGC
TATGACCATGATTACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCACTGG
CCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCC
AGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCTTTGC
CTGGTTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGGCTGGAGTGCGATCTTCCTGAGGCCGATACTGTCGTCGTCCCCT
CAAACTGGCAGATGCACGGTTACGATGCGCCCATCTACACCAACGTGACCTATCCCATTACGGTCAATCCGCCGTTTGTT
CCCACGGAGAATCCGACGGGTTGTTACTCGCTCACATTTAATGTTGATGAAAGCTGGCTACAGGAAGGCCAGACGCGAAT
TATTTTTGATGGCGTTCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAATGCGAATTTTAACAAAATATTAAC
GTTTACAATTTAAATATTTGCTTATACAATCTTCCTGTTTTTGGGGCTTTTCTGATTATCAACCGGGGTACATATGATTG
ACATGCTAGTTTTACGATTACCGTTCATCGATTCTCTTGTTTGCTCCAGACTCTCAGGCAATGACCTGATAGCCTTTGTA
GATCTCTCAAAAATAGCTACCCTCTCCGGCATTAATTTATCAGCTAGAACGGTTGAATATCATATTGATGGTGATTTGAC
TGTCTCCGGCCTTTCTCACCCTTTTGAATCTTTACCTACACATTACTCAGGCATTGCATTTAAAATATATGAGGGTTCTA
AAAATTTTTATCCTTGCGTTGAAATAAAGGCTTCTCCCGCAAAAGTATTACAGGGTCATAATGTTTTTGGTACAACCGAT
TTAGCTTTATGCTCTGAGGCTTTATTGCTTAATTTTGCTAATTCTTTGCCTTGCCTGTATGATTTATTGGATGTTAATGC
TACTACTATTAGTAGAATTGATGCCACCTTTTCAGCTCGCGCCCCAAATGAAAATATAGCTAAACAGGTTATTGACCATT
TGCGAAATGTATCTAATGGTCAAACTAAATCTACTCGTTCGCAGAATTGGGAATCAACTGTTATATGGAATGAAACTTCC
AGACACCGTACTTTAGTTGCATATTTAAAACATGTTGAGCTACAGCATTATATTCAGCAATTAAGCTCTAAGCCATCCGC
AAAAATGACCTCTTATCAAAAGGAGCAATTAAAGGTACTCTCTAATCCTGACCTGTTGGAGTTTGCTTCCGGTCTGGTTC
GCTTTGAAGCTCGAATTAAAACGCGATATTTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATGCAATCCGCTTTGCT
TCTGACTATAATAGTCAGGGTAAAGACCTGATTTTTGATTTATGGTCATTCTCGTTTTCTGAACTGTTTAAAGCATTTGA
GGGGGATTCAATGAATATTTATGACGATTCCGCAGTATTGGACGCTATCCAGTCTAAACATTTTACTATTACCCCCTCTG
GCAAAACTTCTTTTGCAAAAGCCTCTCGCTATTTTGGTTTTTATCGTCGTCTGGTAAACGAGGGTTATGATAGTGTTGCT
CTTACTATGCCTCGTAATTCCTTTTGGCGTTATGTATCTGCATTAGTTGAATGTGGTATTCCTAAATCTCAACTGATGAA
TCTTTCTACCTGTAATAATGTTGTTCCGTTAGTTCGTTTTATTAACGTAGATTTTTCTTCCCAACGTCCTGACTGGTATA
ATGAGCCAGTTCTTAAAATCGCATAAGGTAATTCACAATGATTAAAGTTGAAATTAAACCATCTCAAGCCCAATTTACTA
CTCGTTCTGGTGTTTCTCGTCAGGGCAAGCCTTATTCACTGAATGAGCAGCTTTGTTACGTTGATTTGGGTAATGAATAT
CCGGTTCTTGTCAAGATTACTCTTGATGAAGGTCAGCCAGCCTATGCGCCTGGTCTGTACACCGTTCATCTGTCCTCTTT
CAAAGTTGGTCAGTTCGGTTCCCTTATGATTGACCGTCTGCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGAT
TTCGACACAATTTATCAGGCGATGATACAAATCTCCGTTGTACTTTGTTTCGCGCTTGGTATAATCGCTGGGGGTCAAAG
ATGAGTGTTTTAGTGTATTCTTTTGCCTCTTTCGTTTTAGGTTGGTGCCTTCGTAGTGGCATTACGTATTTTACCCGTTT
AATGGAAACTTCCTCATGAAAAAGTCTTTAGTCCTCAAAGCCTCTGTAGCCGTTGCTACCCTCGTTCCGATGCTGTCTTT
CGCTGCTGAGGGTGACGATCCCGCAAAAGCGGCCTTTAACTCCCTGCAAGCCTCAGCGACCGAATATATCGGTTATGCGT
GGGCGATGGTTGTTGTCATTGTCGGCGCAACTATCGGTATCAAGCTGTTTAAGAAATTCACCTCGAAAGCAAGCTGATAA
ACCGATACAATTAAAGGCTCCTTTTGGAGCCTTTTTTTTGGAGATTTTCAACGTGAAAAAATTATTATTCGCAATTCCTT
TAGTTGTTCCTTTCTATTCTCACTCCGCTGAAACTGTTGAAAGTTGTTTAGCAAAATCCCATACAGAAAATTCATTTACT
AACGTCTGGAAAGACGACAAAACTTTAGATCGTTACGCTAACTATGAGGGCTGTCTGTGGAATGCTACAGGCGTTGTAGT
TTGTACTGGTGACGAAACTCAGTGTTACGGTACATGGGTTCCTATTGGGCTTGCTATCCCTGAAAATGAGGGTGGTGGCT
CTGAGGGTGGCGGTTCTGAGGGTGGCGGTTCTGAGGGTGGCGGTACTAAACCTCCTGAGTACGGTGATACACCTATTCCG
GGCTATACTTATATCAACCCTCTCGACGGCACTTATCCGCCTGGTACTGAGCAAAACCCCGCTAATCCTAATCCTTCTCT
TGAGGAGTCTCAGCCTCTTAATACTTTCATGTTTCAGAATAATAGGTTCCGAAATAGGCAGGGGGCATTAACTGTTTATA
CGGGCACTGTTACTCAAGGCACTGACCCCGTTAAAACTTATTACCAGTACACTCCTGTATCATCAAAAGCCATGTATGAC
GCTTACTGGAACGGTAAATTCAGAGACTGCGCTTTCCATTCTGGCTTTAATGAGGATTTATTTGTTTGTGAATATCAAGG
CCAATCGTCTGACCTGCCTCAACCTCCTGTCAATGCTGGCGGCGGCTCTGGTGGTGGTTCTGGTGGCGGCTCTGAGGGTG
GTGGCTCTGAGGGTGGCGGTTCTGAGGGTGGCGGCTCTGAGGGAGGCGGTTCCGGTGGTGGCTCTGGTTCCGGTGATTTT
GATTATGAAAAGATGGCAAACGCTAATAAGGGGGCTATGACCGAAAATGCCGATGAAAACGCGCTACAGTCTGACGCTAA
AGGCAAACTTGATTCTGTCGCTACTGATTACGGTGCTGCTATCGATGGTTTCATTGGTGACGTTTCCGGCCTTGCTAATG
GTAATGGTGCTACTGGTGATTTTGCTGGCTCTAATTCCCAAATGGCTCAAGTCGGTGACGGTGATAATTCACCTTTAATG
AATAATTTCCGTCAATATTTACCTTCCCTCCCTCAATCGGTTGAATGTCGCCCTTTTGTCTTTGGCGCTGGTAAACCATA
TGAATTTTCTATTGATTGTGACAAAATAAACTTATTCCGTGGTGTCTTTGCGTTTCTTTTATATGTTGCCACCTTTATGT
ATGTATTTTCTACGTTTGCTAACATACTGCGTAATAAGGAGTCTTAATCATGCCAGTTCTTTTGGGTATTCCGTTATTAT
TGCGTTTCCTCGGTTTCCTTCTGGTAACTTTGTTCGGCTATCTGCTTACTTTTCTTAAAAAGGGCTTCGGTAAGATAGCT
ATTGCTATTTCATTGTTTCTTGCTCTTATTATTGGGCTTAACTCAATTCTTGTGGGTTATCTCTCTGATATTAGCGCTCA
ATTACCCTCTGACTTTGTTCAGGGTGTTCAGTTAATTCTCCCGTCTAATGCGCTTCCCTGTTTTTATGTTATTCTCTCTG
TAAAGGCTGCTATTTTCATTTTTGACGTTAAACAAAAAATCGTTTCTTATTTGGATTGGGATAAATAATATGGCTGTTTA
TTTTGTAACTGGCAAATTAGGCTCTGGAAAGACGCTCGTTAGCGTTGGTAAGATTCAGGATAAAATTGTAGCTGGGTGCA
AAATAGCAACTAATCTTGATTTAAGGCTTCAAAACCTCCCGCAAGTCGGGAGGTTCGCTAAAACGCCTCGCGTTCTTAGA
ATACCGGATAAGCCTTCTATATCTGATTTGCTTGCTATTGGGCGCGGTAATGATTCCTACGATGAAAATAAAAACGGCTT
GCTTGTTCTCGATGAGTGCGGTACTTGGTTTAATACCCGTTCTTGGAATGATAAGGAAAGACAGCCGATTATTGATTGGT
TTCTACATGCTCGTAAATTAGGATGGGATATTATTTTTCTTGTTCAGGACTTATCTATTGTTGATAAACAGGCGCGTTCT
GCATTAGCTGAACATGTTGTTTATTGTCGTCGTCTGGACAGAATTACTTTACCTTTTGTCGGTACTTTATATTCTCTTAT
TACTGGCTCGAAAATGCCTCTGCCTAAATTACATGTTGGCGTTGTTAAATATGGCGATTCTCAATTAAGCCCTACTGTTG
AGCGTTGGCTTTATACTGGTAAGAATTTGTATAACGCATATGATACTAAACAGGCTTTTTCTAGTAATTATGATTCCGGT
GTTTATTCTTATTTAACGCCTTATTTATCACACGGTCGGTATTTCAAACCATTAAATTTAGGTCAGAAGATGAAATTAAC
TAAAATATATTTGAAAAAGTTTTCTCGCGTTCTTTGTCTTGCGATTGGATTTGCATCAGCATTTACATATAGTTATATAA
CCCAACCTAAGCCGGAGGTTAAAAAGGTAGTCTCTCAGACCTATGATTTTGATAAATTCACTATTGACTCTTCTCAGCGT
CTTAATCTAAGCTATCGCTATGTTTTCAAGGATTCTAAGGGAAAATTAATTAATAGCGACGATTTACAGAAGCAAGGTTA
TTCACTCACATATATTGATTTATGTACTGTTTCCATTAAAAAAGGTAATTCAAATGAAATTGTTAAATGTAATTAATTTT
GTTTTCTTGATGTTTGTTTCATCATCTTCTTTTGCTCAGGTAATTGAAATGAATAATTCGCCTCTGCGCGATTTTGTAAC
TTGGTATTCAAAGCAATCAGGCGAATCCGTTATTGTTTCTCCCGATGTAAAAGGTACTGTTACTGTATATTCATCTGACG
TTAAACCTGAAAATCTACGCAATTTCTTTATTTCTGTTTTACGTGCAAATAATTTTGATATGGTAGGTTCTAACCCTTCC
ATTATTCAGAAGTATAATCCAAACAATCAGGATTATATTGATGAATTGCCATCATCTGATAATCAGGAATATGATGATAA
TTCCGCTCCTTCTGGTGGTTTCTTTGTTCCGCAAAATGATAATGTTACTCAAACTTTTAAAATTAATAACGTTCGGGCAA
AGGATTTAATACGAGTTGTCGAATTGTTTGTAAAGTCTAATACTTCTAAATCCTCAAATGTATTATCTATTGACGGCTCT
AATCTATTAGTTGTTAGTGCTCCTAAAGATATTTTAGATAACCTTCCTCAATTCCTTTCAACTGTTGATTTGCCAACTGA
CCAGATATTGATTGAGGGTTTGATATTTGAGGTTCAGCAAGGTGATGCTTTAGATTTTTCATTTGCTGCTGGCTCTCAGC
GTGGCACTGTTGCAGGCGGTGTTAATACTGACCGCCTCACCTCTGTTTTATCTTCTGCTGGTGGTTCGTTCGGTATTTTT
AATGGCGATGTTTTAGGGCTATCAGTTCGCGCATTAAAGACTAATAGCCATTCAAAAATATTGTCTGTGCCACGTATTCT
TACGCTTTCAGGTCAGAAGGGTTCTATCTCTGTTGGCCAGAATGTCCCTTTTATTACTGGTCGTGTGACTGGTGAATCTG
CCAATGTAAATAATCCATTTCAGACGATTGAGCGTCAAAATGTAGGTATTTCCATGAGCGTTTTTCCTGTTGCAATGGCT
GGCGGTAATATTGTTCTGGATATTACCAGCAAGGCCGATAGTTTGAGTTCTTCTACTCAGGCAAGTGATGTTATTACTAA
TCAAAGAAGTATTGCTACAACGGTTAATTTGCGTGATGGACAGACTCTTTTACTCGGTGGCCTCACTGATTATAAAAACA
CTTCTCAGGATTCTGGCGTACCGTTCCTGTCTAAAATCCCTTTAATCGGCCTCCTGTTTAGCTCCCGCTCTGATTCTAAC
GAGGAAAGCACGTTATACGTGCTCGTCAAAGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGG
TGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCC
ACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGA
CCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCC
;
AA ? 
2   polydeoxyribonucleotide no no 
;(DT)(DC)(DA)(DA)(DT)(DA)(DG)(DA)(DT)(DA)(DA)(DT)(DA)(DA)(DA)(DG)(DG)(DC)(DT)(DT)
(DA)(DC)(DA)(DA)(DT)(DA)(DG)(DC)(DA)(DG)(DC)(DG)(DA)(DA)(DT)(DA)(DA)(DA)(DC)(DA)
(DG)(DC)(DT)(DT)(DG)(DA)(DT)(DA)(DA)(DT)(DA)(DA)(DG)(DT)(DA)
;
TCAATAGATAATAAAGGCTTACAATAGCAGCGAATAAACAGCTTGATAATAAGTA A0 ? 
3   polydeoxyribonucleotide no no 
;(DA)(DG)(DA)(DT)(DC)(DA)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DC)(DC)(DA)(DT)(DT)(DA)(DC)
(DG)(DC)(DA)(DT)(DA)(DA)(DC)(DG)(DA)(DC)(DA)(DA)(DT)(DG)(DT)(DA)(DG)(DA)(DA)(DA)
(DG)(DG)(DA)(DG)
;
AGATCATTTTTTTCCATTACGCATAACGACAATGTAGAAAGGAG A1 ? 
4   polydeoxyribonucleotide no no 
;(DA)(DA)(DA)(DA)(DC)(DA)(DG)(DG)(DA)(DA)(DG)(DA)(DA)(DA)(DA)(DG)(DC)(DT)(DG)(DT)
(DC)(DT)(DT)(DT)(DA)(DT)(DA)(DA)(DA)(DC)(DA)(DA)(DC)(DA)(DA)(DG)(DA)(DA)(DA)(DA)
(DT)(DA)(DA)(DT)(DA)(DA)(DG)(DA)(DA)(DC)
;
AAAACAGGAAGAAAAGCTGTCTTTATAAACAACAAGAAAATAATAAGAAC A2 ? 
5   polydeoxyribonucleotide no no 
;(DT)(DG)(DA)(DA)(DC)(DA)(DA)(DT)(DA)(DG)(DC)(DA)(DA)(DT)(DT)(DT)(DG)(DC)(DT)(DT)
(DT)(DC)(DA)(DC)(DT)(DC)(DA)(DT)(DC)(DT)(DG)(DC)(DA)(DA)(DC)(DG)(DG)(DC)(DA)(DT)
;
TGAACAATAGCAATTTGCTTTCACTCATCTGCAACGGCAT A3 ? 
6   polydeoxyribonucleotide no no 
;(DA)(DG)(DA)(DT)(DA)(DA)(DG)(DT)(DA)(DA)(DC)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)
(DT)(DG)(DA)(DT)(DC)(DT)(DA)(DA)(DA)(DG)(DT)(DT)(DT)(DT)(DA)(DG)(DT)(DT)(DA)(DC)
(DA)(DA)(DA)(DA)(DT)(DA)(DA)(DA)
;
AGATAAGTAACTTTTTTTTTTGATCTAAAGTTTTAGTTACAAAATAAA A4 ? 
7   polydeoxyribonucleotide no no 
;(DG)(DA)(DA)(DT)(DA)(DC)(DG)(DT)(DA)(DC)(DA)(DA)(DA)(DC)(DA)(DG)(DC)(DA)(DA)(DG)
(DA)(DA)(DA)(DC)(DA)(DA)(DT)(DG)(DA)(DA)(DC)(DC)(DC)(DT)(DG)(DA)(DA)(DC)(DT)(DC)
(DA)(DC)(DG)(DT)(DT)(DG)(DT)(DA)
;
GAATACGTACAAACAGCAAGAAACAATGAACCCTGAACTCACGTTGTA A5 ? 
8   polydeoxyribonucleotide no no 
;(DA)(DA)(DT)(DT)(DG)(DA)(DG)(DT)(DA)(DA)(DT)(DA)(DT)(DC)(DA)(DG)(DA)(DA)(DC)(DA)
(DA)(DC)(DT)(DA)(DA)(DA)(DT)(DT)(DT)(DG)(DC)(DC)(DC)(DT)(DG)(DT)(DA)(DT)(DG)(DG)
(DA)(DG)(DA)(DT)(DA)(DT)(DA)(DG)(DC)(DA)
;
AATTGAGTAATATCAGAACAACTAAATTTGCCCTGTATGGAGATATAGCA A6 ? 
9   polydeoxyribonucleotide no no 
;(DT)(DT)(DT)(DT)(DT)(DG)(DA)(DA)(DC)(DA)(DC)(DA)(DG)(DG)(DG)(DA)(DT)(DA)(DG)(DC)
(DA)(DA)(DG)(DC)(DC)(DC)(DC)(DC)(DA)(DC)(DC)(DA)(DC)(DC)(DC)(DG)(DA)(DC)(DG)(DA)
(DC)(DA)(DA)(DC)(DC)(DG)(DA)(DC)
;
TTTTTGAACACAGGGATAGCAAGCCCCCACCACCCGACGACAACCGAC A7 ? 
10  polydeoxyribonucleotide no no 
;(DT)(DT)(DA)(DT)(DT)(DC)(DG)(DG)(DA)(DA)(DA)(DC)(DA)(DG)(DT)(DT)(DA)(DG)(DA)(DT)
(DT)(DA)(DA)(DG)(DA)(DC)(DG)(DC)(DT)(DG)(DT)(DT)(DA)(DT)(DA)(DT)(DA)(DA)(DT)(DT)
(DT)(DA)(DA)(DT)(DG)(DG)(DG)(DG)
;
TTATTCGGAAACAGTTAGATTAAGACGCTGTTATATAATTTAATGGGG A8 ? 
11  polydeoxyribonucleotide no no 
;(DG)(DC)(DC)(DT)(DT)(DG)(DT)(DC)(DA)(DG)(DA)(DG)(DC)(DC)(DG)(DC)(DC)(DA)(DC)(DC)
(DC)(DT)(DC)(DA)(DG)(DA)(DA)(DC)(DC)(DG)(DA)(DC)(DC)(DA)(DG)(DA)(DA)(DC)(DC)(DC)
;
GCCTTGTCAGAGCCGCCACCCTCAGAACCGACCAGAACCC AB ? 
12  polydeoxyribonucleotide no no 
;(DA)(DA)(DA)(DC)(DG)(DA)(DT)(DT)(DG)(DG)(DA)(DA)(DA)(DA)(DT)(DC)(DA)(DC)(DG)(DG)
(DT)(DT)(DG)(DA)(DG)(DG)(DA)(DA)(DC)(DC)(DG)(DA)(DT)(DT)(DG)(DA)(DG)(DG)(DG)(DA)
(DG)(DG)(DT)(DA)(DT)(DG)(DG)(DT)
;
AAACGATTGGAAAATCACGGTTGAGGAACCGATTGAGGGAGGTATGGT AC ? 
13  polydeoxyribonucleotide no no 
;(DG)(DA)(DA)(DA)(DG)(DC)(DG)(DC)(DA)(DG)(DT)(DC)(DC)(DG)(DG)(DG)(DG)(DT)(DC)(DA)
(DT)(DA)(DA)(DT)(DG)(DC)(DC)(DC)(DC)(DA)(DC)(DC)(DA)(DC)(DC)(DA)(DA)(DC)(DA)(DT)
(DA)(DA)(DA)(DG)(DG)(DT)(DG)(DG)(DC)(DA)
;
GAAAGCGCAGTCCGGGGTCATAATGCCCCACCACCAACATAAAGGTGGCA AD ? 
14  polydeoxyribonucleotide no no 
;(DC)(DA)(DT)(DA)(DC)(DA)(DT)(DG)(DG)(DC)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)
(DT)(DT)(DT)(DT)(DG)(DA)(DT)(DG)(DA)(DT)(DA)(DC)(DA)(DG)(DT)(DC)(DT)(DG)(DA)(DA)
(DA)(DC)(DA)(DT)(DG)(DA)
;
CATACATGGCTTTTTTTTTTTTTTGATGATACAGTCTGAAACATGA AE ? 
15  polydeoxyribonucleotide no no 
;(DC)(DC)(DC)(DC)(DA)(DC)(DC)(DC)(DT)(DC)(DT)(DG)(DG)(DT)(DA)(DA)(DT)(DA)(DA)(DG)
(DT)(DT)(DT)(DT)(DA)(DA)(DT)(DC)(DT)(DG)(DA)(DA)(DT)(DT)(DT)(DC)(DA)(DG)(DA)(DC)
(DT)(DG)(DT)(DA)(DG)(DC)(DG)(DC)
;
CCCCACCCTCTGGTAATAAGTTTTAATCTGAATTTCAGACTGTAGCGC AF ? 
16  polydeoxyribonucleotide no no 
;(DC)(DA)(DG)(DG)(DT)(DC)(DA)(DG)(DA)(DC)(DC)(DG)(DG)(DA)(DA)(DC)(DT)(DG)(DA)(DC)
(DA)(DG)(DG)(DA)(DC)(DG)(DG)(DA)(DA)(DC)(DC)(DA)(DC)(DA)(DT)(DT)(DA)(DA)(DA)(DG)
(DC)(DA)(DC)(DC)(DA)(DG)
;
CAGGTCAGACCGGAACTGACAGGACGGAACCACATTAAAGCACCAG AG ? 
17  polydeoxyribonucleotide no no 
;(DC)(DC)(DA)(DG)(DT)(DA)(DA)(DC)(DA)(DG)(DG)(DA)(DG)(DC)(DC)(DA)(DC)(DC)(DT)(DC)
(DC)(DT)(DC)(DA)(DT)(DT)(DG)(DG)(DT)(DC)(DA)(DT)(DA)(DG)(DC)(DC)(DC)(DC)(DC)(DT)
(DT)(DA)(DA)(DG)(DC)(DA)(DA)(DA)
;
CCAGTAACAGGAGCCACCTCCTCATTGGTCATAGCCCCCTTAAGCAAA AH ? 
18  polydeoxyribonucleotide no no 
;(DT)(DT)(DA)(DA)(DA)(DG)(DA)(DA)(DC)(DT)(DT)(DT)(DT)(DG)(DA)(DA)(DA)(DT)(DC)(DG)
(DC)(DG)(DA)(DA)(DA)(DC)(DC)(DG)(DA)(DG)(DC)(DC)(DA)(DG)(DA)(DA)(DA)(DG)(DA)(DC)
(DA)(DG)(DC)(DA)(DA)(DT)(DT)(DC)
;
TTAAAGAACTTTTGAAATCGCGAAACCGAGCCAGAAAGACAGCAATTC AI ? 
19  polydeoxyribonucleotide no no 
;(DA)(DA)(DA)(DA)(DT)(DT)(DC)(DA)(DG)(DA)(DA)(DG)(DG)(DT)(DA)(DA)(DA)(DA)(DA)(DT)
(DT)(DA)(DT)(DT)(DT)(DG)(DC)(DC)(DC)(DG)(DT)(DA)(DG)(DC)(DA)(DT)(DT)(DT)(DT)(DC)
(DA)(DA)(DA)(DG)(DC)(DC)(DA)(DG)(DA)(DA)(DT)(DG)
;
AAAATTCAGAAGGTAAAAATTATTTGCCCGTAGCATTTTCAAAGCCAGAATG AJ ? 
20  polydeoxyribonucleotide no no 
;(DA)(DC)(DA)(DG)(DT)(DT)(DT)(DA)(DT)(DT)(DG)(DC)(DA)(DG)(DT)(DA)(DT)(DG)(DG)(DT)
(DT)(DA)(DA)(DT)(DT)(DT)(DT)(DC)(DG)(DC)(DC)(DT)(DG)(DA)(DA)(DC)(DG)(DC)(DC)(DA)
(DA)(DC)(DT)(DA)(DC)(DA)(DG)(DA)(DG)(DG)(DT)(DT)(DA)(DT)(DC)(DA)(DT)(DC)(DA)(DG)
;
ACAGTTTATTGCAGTATGGTTAATTTTCGCCTGAACGCCAACTACAGAGGTTATCATCAG AK ? 
21  polydeoxyribonucleotide no no 
;(DA)(DT)(DA)(DA)(DA)(DA)(DT)(DT)(DT)(DT)(DG)(DC)(DT)(DC)(DT)(DT)(DT)(DC)(DG)(DG)
(DA)(DA)(DC)(DT)(DT)(DT)(DA)(DG)(DC)(DG)(DT)(DA)(DC)(DC)(DG)(DT)(DT)(DC)(DC)(DA)
(DG)(DT)(DA)(DA)(DG)(DC)(DG)(DT)
;
ATAAAATTTTGCTCTTTCGGAACTTTAGCGTACCGTTCCAGTAAGCGT AL ? 
22  polydeoxyribonucleotide no no 
;(DA)(DA)(DC)(DA)(DT)(DG)(DT)(DT)(DC)(DA)(DT)(DG)(DT)(DC)(DC)(DA)(DG)(DA)(DC)(DT)
(DC)(DA)(DT)(DT)(DT)(DT)(DA)(DA)(DT)(DA)(DA)(DC)(DG)(DG)(DT)(DC)(DA)(DC)(DC)(DG)
(DT)(DC)(DC)(DG)(DA)(DC)(DA)(DT)(DT)(DC)
;
AACATGTTCATGTCCAGACTCATTTTAATAACGGTCACCGTCCGACATTC AM ? 
23  polydeoxyribonucleotide no no 
;(DG)(DA)(DT)(DA)(DA)(DG)(DA)(DC)(DT)(DC)(DA)(DT)(DA)(DG)(DA)(DC)(DG)(DG)(DA)(DT)
(DA)(DT)(DT)(DC)(DA)(DT)(DG)(DA)(DG)(DC)(DC)(DG)(DC)(DC)(DG)(DC)(DC)(DA)(DG)(DC)
(DA)(DT)(DC)(DG)(DC)(DC)(DT)(DC)
;
GATAAGACTCATAGACGGATATTCATGAGCCGCCGCCAGCATCGCCTC AN ? 
24  polydeoxyribonucleotide no no 
;(DC)(DA)(DT)(DG)(DA)(DT)(DA)(DC)(DC)(DG)(DC)(DC)(DA)(DC)(DG)(DC)(DA)(DC)(DC)(DA)
(DT)(DT)(DA)(DC)(DC)(DA)(DT)(DT)(DA)(DG)(DT)(DT)(DT)(DC)(DA)(DT)(DC)(DG)(DT)(DA)
(DA)(DA)(DC)(DA)(DG)(DT)(DG)(DT)
;
CATGATACCGCCACGCACCATTACCATTAGTTTCATCGTAAACAGTGT AO ? 
25  polydeoxyribonucleotide no no 
;(DA)(DG)(DG)(DT)(DA)(DC)(DC)(DG)(DC)(DC)(DA)(DC)(DC)(DA)(DA)(DT)(DG)(DA)(DA)(DA)
(DC)(DC)(DA)(DT)(DC)(DG)(DA)(DA)(DG)(DT)(DT)(DT)(DG)(DC)(DC)(DC)(DT)(DA)(DT)(DT)
;
AGGTACCGCCACCAATGAAACCATCGAAGTTTGCCCTATT AP ? 
26  polydeoxyribonucleotide no no 
;(DG)(DC)(DC)(DG)(DT)(DC)(DG)(DA)(DG)(DA)(DG)(DG)(DG)(DT)(DC)(DA)(DG)(DG)(DC)(DG)
(DC)(DA)(DT)(DG)(DC)(DT)(DC)(DC)(DA)(DT)(DA)(DT)(DC)(DA)(DT)(DA)(DA)(DG)(DT)(DG)
(DA)(DG)(DG)(DA)(DA)(DG)(DG)(DC)(DG)(DG)(DA)(DA)(DC)(DA)(DG)(DC)(DC)
;
GCCGTCGAGAGGGTCAGGCGCATGCTCCATATCATAAGTGAGGAAGGCGGAACAGCC AQ ? 
27  polydeoxyribonucleotide no no 
;(DT)(DT)(DT)(DT)(DT)(DA)(DC)(DT)(DC)(DC)(DT)(DC)(DA)(DA)(DT)(DT)(DT)(DT)(DT)(DT)
(DT)(DT)(DT)(DT)(DT)(DT)(DA)(DA)(DG)(DC)(DA)(DG)(DT)(DA)(DG)(DC)(DG)(DA)(DC)(DA)
(DG)(DA)(DA)(DT)(DC)(DA)(DT)(DA)(DG)(DC)(DA)(DG)(DC)(DA)(DT)(DT)(DA)(DG)(DG)(DA)
(DT)(DG)(DT)
;
TTTTTACTCCTCAATTTTTTTTTTTTAAGCAGTAGCGACAGAATCATAGCAGCATTAGGATGT AR ? 
28  polydeoxyribonucleotide no no 
;(DT)(DT)(DT)(DT)(DT)(DC)(DC)(DA)(DA)(DG)(DA)(DA)(DG)(DG)(DA)(DA)(DT)(DT)(DT)(DT)
(DT)(DT)(DT)(DT)(DT)(DT)(DA)(DC)(DC)(DG)(DA)(DG)(DG)(DA)(DT)(DT)(DA)(DA)(DA)(DT)
(DA)(DA)(DG)(DA)(DA)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DA)(DA)(DA)(DC)
(DA)(DC)(DC)(DG)
;
TTTTTCCAAGAAGGAATTTTTTTTTTACCGAGGATTAAATAAGAATTTTTTTTTTTAAACACCG AS ? 
29  polydeoxyribonucleotide no no 
;(DA)(DT)(DG)(DT)(DG)(DA)(DA)(DT)(DT)(DA)(DA)(DA)(DT)(DA)(DC)(DC)(DC)(DA)(DA)(DC)
(DC)(DA)(DG)(DC)(DG)(DC)(DT)(DC)(DC)(DG)(DG)(DC)(DT)(DT)(DA)(DG)(DG)(DT)(DT)(DG)
(DG)(DG)(DA)(DG)(DA)(DA)(DG)(DA)
;
ATGTGAATTAAATACCCAACCAGCGCTCCGGCTTAGGTTGGGAGAAGA AT ? 
30  polydeoxyribonucleotide no no 
;(DT)(DA)(DC)(DC)(DT)(DC)(DA)(DG)(DA)(DG)(DA)(DA)(DT)(DA)(DG)(DG)(DA)(DA)(DA)(DT)
(DA)(DC)(DC)(DA)(DA)(DG)(DC)(DT)(DT)(DT)(DA)(DA)(DT)(DT)(DC)(DA)(DG)(DC)(DA)(DG)
(DC)(DG)(DG)(DA)(DA)(DC)(DA)(DA)
;
TACCTCAGAGAATAGGAAATACCAAGCTTTAATTCAGCAGCGGAACAA AU ? 
31  polydeoxyribonucleotide no no 
;(DG)(DT)(DC)(DA)(DA)(DG)(DG)(DC)(DC)(DG)(DC)(DG)(DT)(DA)(DG)(DA)(DA)(DA)(DC)(DT)
(DT)(DA)(DT)(DT)(DA)(DC)(DT)(DT)(DG)(DT)(DC)(DA)(DC)(DA)(DA)(DA)(DA)(DT)(DG)(DC)
(DT)(DG)(DA)(DT)(DG)(DC)(DA)(DA)(DA)(DT)(DA)(DA)
;
GTCAAGGCCGCGTAGAAACTTATTACTTGTCACAAAATGCTGATGCAAATAA AV ? 
32  polydeoxyribonucleotide no no 
;(DT)(DT)(DT)(DT)(DT)(DT)(DC)(DT)(DT)(DT)(DT)(DC)(DA)(DT)(DA)(DA)(DT)(DC)(DC)(DC)
(DT)(DT)(DG)(DA)(DT)(DA)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DC)(DA)
(DC)(DA)(DA)(DA)(DC)(DA)(DA)(DA)(DT)(DA)
;
TTTTTTCTTTTCATAATCCCTTGATATTTTTTTTTTTTCACAAACAAATA AW ? 
33  polydeoxyribonucleotide no no 
;(DT)(DG)(DC)(DC)(DT)(DA)(DT)(DT)(DA)(DG)(DC)(DA)(DA)(DA)(DG)(DA)(DA)(DA)(DC)(DG)
(DT)(DC)(DA)(DC)(DC)(DC)(DT)(DC)(DA)(DG)(DC)(DG)(DT)(DC)(DA)(DC)(DC)(DA)(DA)(DC)
(DT)(DA)(DA)(DA)(DA)(DC)(DG)(DA)
;
TGCCTATTAGCAAAGAAACGTCACCCTCAGCGTCACCAACTAAAACGA AX ? 
34  polydeoxyribonucleotide no no 
;(DA)(DT)(DG)(DA)(DG)(DT)(DG)(DT)(DA)(DC)(DA)(DG)(DA)(DG)(DC)(DC)(DA)(DC)(DT)(DT)
(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DC)(DA)(DC)(DC)(DC)(DT)(DC)(DA)(DG)(DA)(DG)(DC)
(DC)(DG)
;
ATGAGTGTACAGAGCCACTTTTTTTTTTCACCCTCAGAGCCG AY ? 
35  polydeoxyribonucleotide no no 
;(DA)(DA)(DG)(DT)(DA)(DG)(DA)(DG)(DA)(DA)(DG)(DG)(DA)(DC)(DC)(DG)(DT)(DA)(DA)(DT)
(DG)(DT)(DA)(DT)(DC)(DA)(DC)(DC)(DT)(DT)(DC)(DC)(DA)(DC)(DA)(DG)(DA)(DC)(DC)(DA)
(DA)(DC)(DC)(DT)(DA)(DG)(DT)(DT)(DG)(DC)(DG)(DC)(DC)(DC)
;
AAGTAGAGAAGGACCGTAATGTATCACCTTCCACAGACCAACCTAGTTGCGCCC AZ ? 
36  polydeoxyribonucleotide no no 
;(DT)(DT)(DC)(DG)(DC)(DC)(DA)(DT)(DA)(DT)(DT)(DA)(DG)(DG)(DG)(DT)(DA)(DA)(DT)(DT)
(DG)(DA)(DG)(DC)(DG)(DC)(DT)(DT)(DA)(DA)(DG)(DC)(DC)(DC)(DA)(DA)(DT)(DA)(DC)(DC)
(DG)(DA)(DT)(DA)(DA)
;
TTCGCCATATTAGGGTAATTGAGCGCTTAAGCCCAATACCGATAA Ab ? 
37  polydeoxyribonucleotide no no 
;(DA)(DT)(DA)(DT)(DA)(DA)(DT)(DA)(DC)(DT)(DA)(DG)(DA)(DA)(DT)(DG)(DT)(DG)(DA)(DT)
(DA)(DA)(DT)(DT)(DT)(DT)(DA)(DA)(DC)(DC)(DC)(DA)(DA)(DA)(DG)(DA)(DC)(DA)(DA)(DA)
(DA)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DG)(DG)(DG)(DA)(DC)(DC)(DG)(DA)(DC)
(DT)(DT)(DG)(DA)(DG)(DT)(DT)(DT)(DT)(DT)
;
ATATAATACTAGAATGTGATAATTTTAACCCAAAGACAAAATTTTTTTTTTGGGACCGACTTGAGTTTTT Ac ? 
38  polydeoxyribonucleotide no no 
;(DC)(DA)(DT)(DT)(DT)(DT)(DA)(DA)(DA)(DG)(DT)(DA)(DC)(DA)(DC)(DA)(DG)(DC)(DG)(DA)
(DT)(DT)(DC)(DC)(DC)(DA)(DT)(DG)(DT)(DA)(DT)(DA)(DC)(DC)(DG)(DA)(DA)(DG)(DC)(DC)
(DC)(DT)(DT)(DT)(DT)(DT)(DG)(DA)
;
CATTTTAAAGTACACAGCGATTCCCATGTATACCGAAGCCCTTTTTGA Ad ? 
39  polydeoxyribonucleotide no no 
;(DC)(DG)(DC)(DC)(DA)(DT)(DC)(DT)(DC)(DA)(DA)(DC)(DA)(DG)(DT)(DT)(DT)(DC)(DA)(DA)
(DA)(DT)(DA)(DA)(DG)(DA)(DC)(DA)(DA)(DA)(DA)(DA)(DG)(DA)(DC)(DA)(DC)(DC)(DA)(DC)
(DG)(DG)(DA)(DA)(DT)(DA)(DA)(DT)
;
CGCCATCTCAACAGTTTCAAATAAGACAAAAAGACACCACGGAATAAT Af ? 
40  polydeoxyribonucleotide no no 
;(DA)(DG)(DC)(DG)(DC)(DA)(DA)(DA)(DA)(DG)(DG)(DA)(DG)(DC)(DT)(DT)(DT)(DG)(DC)(DA)
(DC)(DC)(DC)(DG)(DA)(DC)(DT)(DT)(DG)(DC)(DG)(DG)(DG)(DA)(DG)(DG)(DT)(DT)(DT)(DT)
(DA)(DA)(DT)(DT)(DG)(DC)(DA)(DA)
;
AGCGCAAAAGGAGCTTTGCACCCGACTTGCGGGAGGTTTTAATTGCAA Ag ? 
41  polydeoxyribonucleotide no no 
;(DT)(DA)(DA)(DC)(DC)(DT)(DT)(DC)(DC)(DC)(DT)(DT)(DA)(DG)(DA)(DA)(DT)(DC)(DC)(DT)
(DT)(DG)(DC)(DC)(DA)(DA)(DT)(DC)(DG)(DC)(DA)(DT)(DA)(DT)(DT)(DT)(DT)(DA)(DA)(DG)
(DT)(DA)(DC)(DC)
;
TAACCTTCCCTTAGAATCCTTGCCAATCGCATATTTTAAGTACC Ah ? 
42  polydeoxyribonucleotide no no 
;(DT)(DA)(DA)(DC)(DG)(DA)(DA)(DG)(DG)(DC)(DA)(DC)(DA)(DG)(DC)(DC)(DC)(DT)(DC)(DA)
(DT)(DA)(DG)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DA)(DG)(DC)(DC)(DC)
(DC)(DA)(DC)(DA)(DA)(DG)
;
TAACGAAGGCACAGCCCTCATAGTTTTTTTTTTTTAGCCCCACAAG Ai ? 
43  polydeoxyribonucleotide no no 
;(DG)(DC)(DA)(DG)(DC)(DA)(DG)(DA)(DT)(DT)(DA)(DT)(DC)(DA)(DA)(DA)(DA)(DA)(DC)(DA)
(DG)(DA)(DT)(DA)(DG)(DG)(DC)(DA)(DG)(DA)(DT)(DT)(DA)(DT)(DA)(DC)(DA)(DA)(DG)(DA)
(DC)(DC)(DT)(DA)(DA)(DA)(DC)(DT)(DA)(DT)(DA)(DT)(DG)(DT)(DA)(DT)(DC)(DA)(DA)(DT)
(DA)(DG)
;
GCAGCAGATTATCAAAAACAGATAGGCAGATTATACAAGACCTAAACTATATGTATCAATAG Aj ? 
44  polydeoxyribonucleotide no no 
;(DA)(DG)(DG)(DC)(DA)(DA)(DG)(DT)(DC)(DG)(DA)(DA)(DA)(DT)(DG)(DA)(DG)(DG)(DT)(DT)
(DT)(DA)(DG)(DC)(DG)(DG)(DA)(DT)(DA)(DA)(DT)(DA)(DG)(DC)(DG)(DG)(DG)(DG)(DG)(DA)
(DA)(DA)(DC)(DG)(DC)(DA)
;
AGGCAAGTCGAAATGAGGTTTAGCGGATAATAGCGGGGGAAACGCA Ak ? 
45  polydeoxyribonucleotide no no 
;(DT)(DT)(DA)(DA)(DC)(DC)(DG)(DC)(DC)(DA)(DT)(DT)(DG)(DT)(DA)(DT)(DC)(DA)(DC)(DA)
(DT)(DC)(DT)(DT)(DC)(DT)(DA)(DT)(DT)(DC)(DT)(DT)(DA)(DC)(DG)(DC)(DG)(DA)(DT)(DA)
(DG)(DC)(DT)(DA)(DC)(DA)(DT)(DA)
;
TTAACCGCCATTGTATCACATCTTCTATTCTTACGCGATAGCTACATA Al ? 
46  polydeoxyribonucleotide no no 
;(DC)(DA)(DA)(DC)(DG)(DC)(DC)(DT)(DG)(DT)(DA)(DG)(DC)(DA)(DG)(DT)(DA)(DC)(DT)(DC)
(DA)(DG)(DC)(DC)(DG)(DC)(DG)(DA)(DC)(DC)(DG)(DA)(DA)(DA)(DA)(DC)(DT)(DT)(DT)(DA)
(DG)(DG)(DG)(DC)(DT)(DT)(DA)(DT)
;
CAACGCCTGTAGCAGTACTCAGCCGCGACCGAAAACTTTAGGGCTTAT Am ? 
47  polydeoxyribonucleotide no no 
;(DC)(DA)(DC)(DC)(DC)(DT)(DG)(DT)(DA)(DT)(DC)(DG)(DG)(DT)(DA)(DG)(DG)(DC)(DT)(DC)
(DC)(DA)(DT)(DT)(DA)(DG)(DA)(DC)(DG)(DG)(DT)(DG)(DT)(DT)(DT)(DA)(DA)(DC)(DG)(DT)
(DC)(DA)(DA)(DA)(DA)(DA)(DT)(DG)
;
CACCCTGTATCGGTAGGCTCCATTAGACGGTGTTTAACGTCAAAAATG An ? 
48  polydeoxyribonucleotide no no 
;(DG)(DG)(DG)(DA)(DT)(DC)(DC)(DG)(DA)(DG)(DG)(DG)(DT)(DA)(DT)(DT)(DG)(DA)(DC)(DC)
(DC)(DC)(DA)(DC)(DG)(DG)(DA)(DG)(DA)(DT)(DC)(DC)(DC)(DT)(DC)(DA)
;
GGGATCCGAGGGTATTGACCCCACGGAGATCCCTCA Ao ? 
49  polydeoxyribonucleotide no no 
;(DA)(DA)(DC)(DT)(DT)(DT)(DG)(DA)(DG)(DG)(DT)(DG)(DC)(DA)(DG)(DG)(DG)(DA)(DT)(DT)
(DT)(DC)(DT)(DT)(DA)(DA)(DT)(DA)(DA)(DT)(DT)(DT)(DT)(DT)(DA)(DA)(DA)(DG)(DT)(DC)
(DA)(DG)(DA)(DT)(DT)(DT)(DA)(DT)
;
AACTTTGAGGTGCAGGGATTTCTTAATAATTTTTAAAGTCAGATTTAT As ? 
50  polydeoxyribonucleotide no no 
;(DG)(DC)(DC)(DG)(DT)(DT)(DG)(DA)(DA)(DC)(DC)(DT)(DC)(DC)(DC)(DA)(DG)(DC)(DT)(DA)
(DC)(DA)(DA)(DT)(DT)(DT)(DT)(DA)(DT)(DC)(DC)(DG)(DA)(DT)(DT)(DT)(DT)(DT)(DG)(DA)
(DG)(DA)(DA)(DT)(DT)(DA)(DA)(DC)
;
GCCGTTGAACCTCCCAGCTACAATTTTATCCGATTTTTGAGAATTAAC Au ? 
51  polydeoxyribonucleotide no no 
;(DG)(DA)(DA)(DG)(DC)(DC)(DG)(DT)(DA)(DC)(DC)(DG)(DC)(DA)(DT)(DT)(DC)(DC)(DA)(DA)
(DG)(DA)(DA)(DT)(DA)(DA)(DT)(DC)(DG)(DG)(DT)(DA)(DA)(DG)(DC)(DA)(DG)(DA)(DT)(DA)
(DG)(DC)(DC)(DT)(DT)(DT)(DT)(DT)
;
GAAGCCGTACCGCATTCCAAGAATAATCGGTAAGCAGATAGCCTTTTT Av ? 
52  polydeoxyribonucleotide no no 
;(DG)(DC)(DT)(DT)(DT)(DA)(DT)(DT)(DT)(DT)(DC)(DA)(DA)(DA)(DA)(DA)(DA)(DA)(DT)(DT)
(DA)(DT)(DC)(DA)(DG)(DC)(DA)(DG)(DC)(DT)(DA)(DT)(DC)(DT)(DC)(DC)(DG)(DT)(DA)(DA)
(DC)(DA)(DC)(DT)(DG)(DA)(DG)(DT)
;
GCTTTATTTTCAAAAAAATTATCAGCAGCTATCTCCGTAACACTGAGT Aw ? 
53  polydeoxyribonucleotide no no 
;(DC)(DG)(DA)(DA)(DC)(DG)(DC)(DA)(DA)(DT)(DA)(DA)(DG)(DT)(DT)(DA)(DC)(DC)(DT)(DT)
(DT)(DG)(DG)(DG)(DA)(DA)(DT)(DT)(DA)(DG)(DA)(DG)(DC)(DC)(DT)(DT)(DA)(DG)(DC)(DG)
(DT)(DT)(DT)(DG)(DC)(DC)(DA)(DT)(DT)(DT)(DT)(DT)
;
CGAACGCAATAAGTTACCTTTGGGAATTAGAGCCTTAGCGTTTGCCATTTTT Ax ? 
54  polydeoxyribonucleotide no no 
;(DT)(DA)(DG)(DC)(DA)(DG)(DC)(DC)(DT)(DT)(DT)(DA)(DC)(DA)(DG)(DT)(DT)(DT)(DT)(DT)
(DT)(DT)(DT)(DT)(DT)(DA)(DG)(DA)(DG)(DA)(DA)(DT)(DA)(DA)(DC)(DA)(DT)(DA)
;
TAGCAGCCTTTACAGTTTTTTTTTTAGAGAATAACATA Ay ? 
55  polydeoxyribonucleotide no no 
;(DA)(DC)(DT)(DG)(DA)(DT)(DA)(DT)(DA)(DA)(DG)(DT)(DA)(DT)(DA)(DT)(DT)(DT)(DT)(DT)
(DT)(DT)(DT)(DT)(DT)(DG)(DC)(DC)(DC)(DG)(DG)(DA)(DA)(DT)(DA)(DG)(DG)(DT)(DA)(DG)
(DG)(DC)(DT)(DG)(DA)(DG)(DT)(DT)(DT)(DT)(DT)
;
ACTGATATAAGTATATTTTTTTTTTGCCCGGAATAGGTAGGCTGAGTTTTT Az ? 
56  polydeoxyribonucleotide no no 
;(DG)(DC)(DG)(DC)(DG)(DC)(DG)(DG)(DG)(DG)(DA)(DC)(DG)(DT)(DG)(DC)(DT)(DT)(DC)(DG)
(DC)(DC)(DG)(DC)(DT)(DA)(DC)(DA)(DG)(DC)(DT)(DT)(DT)(DC)(DA)(DA)(DT)(DA)(DG)(DG)
(DA)(DA)(DT)(DT)(DG)(DC)(DG)(DG)
;
GCGCGCGGGGACGTGCTTCGCCGCTACAGCTTTCAATAGGAATTGCGG B0 ? 
57  polydeoxyribonucleotide no no 
;(DT)(DT)(DT)(DT)(DT)(DT)(DA)(DA)(DA)(DT)(DC)(DA)(DT)(DT)(DC)(DC)(DT)(DT)(DT)(DT)
(DT)(DT)(DT)(DT)(DT)(DT)(DG)(DT)(DG)(DG)(DG)(DA)(DA)(DC)(DA)(DA)(DA)(DC)(DT)(DC)
(DA)(DG)(DG)(DA)(DA)(DA)(DA)(DT)(DA)(DG)(DT)(DA)(DG)(DT)(DG)(DA)(DA)(DA)(DA)
;
TTTTTTAAATCATTCCTTTTTTTTTTGTGGGAACAAACTCAGGAAAATAGTAGTGAAAA B1 ? 
58  polydeoxyribonucleotide no no 
;(DG)(DC)(DA)(DA)(DC)(DA)(DT)(DG)(DA)(DG)(DG)(DC)(DG)(DG)(DT)(DG)(DA)(DC)(DC)(DG)
(DT)(DA)(DA)(DG)(DC)(DG)(DA)(DG)(DT)(DA)(DC)(DC)(DA)(DC)(DC)(DA)
;
GCAACATGAGGCGGTGACCGTAAGCGAGTACCACCA B2 ? 
59  polydeoxyribonucleotide no no 
;(DT)(DC)(DT)(DT)(DT)(DG)(DA)(DT)(DT)(DA)(DG)(DT)(DA)(DA)(DG)(DA)(DG)(DT)(DC)(DT)
(DG)(DT)(DG)(DG)(DG)(DC)(DG)(DA)(DT)(DC)(DC)(DC)(DA)(DG)(DG)(DC)(DA)(DA)(DC)(DA)
(DA)(DT)(DA)(DA)(DC)(DC)(DC)(DA)
;
TCTTTGATTAGTAAGAGTCTGTGGGCGATCCCAGGCAACAATAACCCA B3 ? 
60  polydeoxyribonucleotide no no 
;(DT)(DT)(DT)(DT)(DT)(DA)(DA)(DC)(DC)(DA)(DG)(DA)(DG)(DG)(DA)(DA)(DT)(DT)(DT)(DT)
(DT)(DT)(DT)(DT)(DT)(DT)(DA)(DA)(DA)(DC)(DG)(DC)(DT)(DC)(DC)(DA)(DT)(DC)(DA)(DC)
(DC)(DT)(DC)(DA)(DT)(DT)(DA)(DG)
;
TTTTTAACCAGAGGAATTTTTTTTTTAAACGCTCCATCACCTCATTAG B4 ? 
61  polydeoxyribonucleotide no no 
;(DA)(DA)(DT)(DG)(DG)(DT)(DA)(DG)(DC)(DG)(DC)(DC)(DA)(DT)(DA)(DT)(DC)(DG)(DT)(DA)
(DA)(DC)(DA)(DG)(DA)(DA)(DT)(DC)(DA)(DG)(DC)(DA)(DC)(DG)(DT)(DA)(DT)(DA)(DA)(DG)
;
AATGGTAGCGCCATATCGTAACAGAATCAGCACGTATAAG B5 ? 
62  polydeoxyribonucleotide no no 
;(DG)(DA)(DA)(DA)(DG)(DA)(DG)(DA)(DA)(DC)(DA)(DA)(DT)(DG)(DT)(DT)(DG)(DG)(DG)(DA)
(DA)(DC)(DC)(DA)(DT)(DC)(DA)(DC)(DG)(DG)(DA)(DT)(DT)(DA)(DA)(DA)(DG)(DT)(DT)(DG)
(DC)(DA)(DG)(DC)(DA)(DT)(DT)(DT)(DT)(DT)
;
GAAAGAGAACAATGTTGGGAACCATCACGGATTAAAGTTGCAGCATTTTT B6 ? 
63  polydeoxyribonucleotide no no 
;(DG)(DT)(DT)(DG)(DG)(DT)(DC)(DA)(DT)(DA)(DG)(DC)(DT)(DG)(DT)(DT)(DT)(DC)(DC)(DT)
(DG)(DT)(DG)(DT)(DG)(DA)(DA)(DA)(DA)(DG)(DC)(DC)(DT)(DG)(DT)(DT)(DT)(DT)(DA)(DA)
(DC)(DC)(DA)(DT)
;
GTTGGTCATAGCTGTTTCCTGTGTGAAAAGCCTGTTTTAACCAT B7 ? 
64  polydeoxyribonucleotide no no 
;(DC)(DC)(DA)(DT)(DC)(DA)(DC)(DC)(DA)(DA)(DA)(DA)(DA)(DC)(DT)(DC)(DC)(DG)(DC)(DT)
(DC)(DA)(DC)(DA)(DA)(DT)(DT)(DC)(DC)(DA)(DC)(DA)(DC)(DT)(DT)(DT)(DT)(DT)(DT)(DT)
;
CCATCACCAAAAACTCCGCTCACAATTCCACACTTTTTTT B8 ? 
65  polydeoxyribonucleotide no no 
;(DA)(DC)(DA)(DA)(DA)(DA)(DT)(DA)(DA)(DT)(DA)(DT)(DA)(DC)(DG)(DA)(DG)(DC)(DG)(DT)
(DA)(DC)(DT)(DA)(DT)(DG)(DG)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DG)
(DC)(DT)(DT)(DT)(DT)(DG)(DA)(DC)(DG)(DC)(DT)(DT)(DT)(DT)(DT)
;
ACAAAATAATATACGAGCGTACTATGGTTTTTTTTTTTTGCTTTTGACGCTTTTT B9 ? 
66  polydeoxyribonucleotide no no 
;(DA)(DC)(DG)(DC)(DC)(DA)(DA)(DC)(DC)(DT)(DG)(DA)(DA)(DA)(DG)(DC)(DG)(DT)(DA)(DA)
(DG)(DA)(DA)(DG)(DA)(DT)(DA)(DG)(DA)(DA)(DC)(DA)(DT)(DA)(DT)(DG)(DT)(DA)(DC)(DC)
(DC)(DC)(DG)(DG)(DT)(DT)(DT)(DG)
;
ACGCCAACCTGAAAGCGTAAGAAGATAGAACATATGTACCCCGGTTTG BB ? 
67  polydeoxyribonucleotide no no 
;(DA)(DG)(DT)(DC)(DT)(DA)(DC)(DA)(DA)(DA)(DA)(DA)(DG)(DA)(DA)(DC)(DT)(DG)(DT)(DT)
(DG)(DT)(DG)(DA)(DA)(DT)(DT)(DA)(DC)(DC)(DT)(DT)(DA)(DT)(DA)(DG)(DA)(DA)(DA)(DT)
(DT)(DT)(DT)(DT)
;
AGTCTACAAAAAGAACTGTTGTGAATTACCTTATAGAAATTTTT BC ? 
68  polydeoxyribonucleotide no no 
;(DG)(DG)(DC)(DC)(DA)(DA)(DC)(DA)(DG)(DA)(DT)(DA)(DC)(DG)(DT)(DG)(DG)(DT)(DA)(DA)
(DT)(DG)(DC)(DC)(DG)(DG)(DG)(DG)(DA)(DA)(DG)(DA)(DA)(DG)(DG)
;
GGCCAACAGATACGTGGTAATGCCGGGGAAGAAGG BD ? 
69  polydeoxyribonucleotide no no 
;(DC)(DG)(DA)(DT)(DT)(DA)(DG)(DT)(DC)(DT)(DT)(DT)(DA)(DA)(DT)(DT)(DT)(DT)(DT)(DT)
(DT)(DT)(DT)(DT)(DT)(DG)(DC)(DG)(DC)(DG)(DA)(DA)(DT)(DA)(DT)(DG)(DA)(DT)(DA)(DA)
(DC)(DG)(DG)(DA)(DA)(DC)(DT)(DG)(DA)(DC)(DG)(DA)(DG)(DA)(DA)(DA)(DC)(DA)(DC)(DC)
(DA)(DG)(DT)(DC)(DA)(DA)(DT)(DA)
;
CGATTAGTCTTTAATTTTTTTTTTTGCGCGAATATGATAACGGAACTGACGAGAAACACCAGTCAATA BE ? 
70  polydeoxyribonucleotide no no 
;(DC)(DT)(DT)(DG)(DA)(DG)(DA)(DT)(DG)(DG)(DT)(DT)(DT)(DA)(DA)(DA)(DT)(DT)(DA)(DC)
(DC)(DT)(DT)(DA)(DT)(DT)(DT)(DC)(DA)(DA)(DA)(DA)(DT)(DT)(DA)(DA)(DG)(DC)(DT)(DA)
;
CTTGAGATGGTTTAAATTACCTTATTTCAAAATTAAGCTA BF ? 
71  polydeoxyribonucleotide no no 
;(DA)(DA)(DA)(DA)(DC)(DG)(DA)(DG)(DT)(DA)(DG)(DC)(DC)(DG)(DG)(DA)(DG)(DA)(DG)(DT)
(DT)(DC)(DT)(DA)(DG)(DC)(DG)(DA)(DA)(DA)(DA)(DG)(DC)(DC)(DT)(DA)(DA)(DA)(DA)(DG)
(DG)(DG)(DA)(DC)(DA)(DT)(DT)(DC)(DT)
;
AAAACGAGTAGCCGGAGAGTTCTAGCGAAAAGCCTAAAAGGGACATTCT BG ? 
72  polydeoxyribonucleotide no no 
;(DC)(DA)(DA)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DA)(DT)(DC)(DA)(DA)(DC)(DG)
(DT)(DA)(DA)(DC)(DA)(DA)(DA)(DG)(DC)(DT)(DG)(DC)(DT)(DC)(DA)(DT)(DT)(DC)(DA)(DG)
(DT)(DA)
;
CAATTTTTTTTTTATCAACGTAACAAAGCTGCTCATTCAGTA BH ? 
73  polydeoxyribonucleotide no no 
;(DT)(DT)(DT)(DT)(DT)(DA)(DC)(DG)(DA)(DG)(DA)(DC)(DA)(DA)(DA)(DA)(DT)(DT)(DC)(DC)
(DT)(DC)(DA)(DT)(DA)(DT)(DA)(DT)(DT)(DT)(DT)(DA)(DT)(DT)(DT)(DT)(DA)(DT)(DT)(DT)
(DT)(DA)
;
TTTTTACGAGACAAAATTCCTCATATATTTTATTTTATTTTA BI ? 
74  polydeoxyribonucleotide no no 
;(DT)(DA)(DT)(DG)(DA)(DC)(DC)(DC)(DT)(DG)(DA)(DA)(DA)(DT)(DC)(DG)(DG)(DT)(DC)(DT)
(DG)(DG)(DC)(DC)(DT)(DT)(DA)(DC)(DC)(DT)(DA)(DC)(DA)(DT)(DT)(DT)(DG)(DA)(DC)(DG)
(DA)(DG)(DA)(DG)(DC)(DG)(DG)(DG)(DA)(DG)(DC)(DT)(DA)(DT)(DT)(DT)(DT)(DT)
;
TATGACCCTGAAATCGGTCTGGCCTTACCTACATTTGACGAGAGCGGGAGCTATTTTT BJ ? 
75  polydeoxyribonucleotide no no 
;(DC)(DA)(DT)(DA)(DT)(DC)(DC)(DA)(DA)(DA)(DA)(DG)(DA)(DA)(DA)(DT)(DT)(DA)(DG)(DC)
(DA)(DA)(DC)(DG)(DC)(DA)(DA)(DG)(DG)(DA)(DG)(DT)(DT)(DA)(DA)(DA)(DT)(DC)(DT)(DA)
(DA)(DA)(DT)(DT)
;
CATATCCAAAAGAAATTAGCAACGCAAGGAGTTAAATCTAAATT BK ? 
76  polydeoxyribonucleotide no no 
;(DA)(DT)(DT)(DT)(DT)(DA)(DT)(DC)(DC)(DT)(DC)(DG)(DT)(DT)(DC)(DG)(DT)(DG)(DC)(DA)
(DT)(DC)(DT)(DG)(DG)(DT)(DG)(DT)(DA)(DG)(DC)(DA)(DC)(DC)(DA)(DG)(DC)(DA)(DC)(DT)
(DC)(DA)(DG)(DA)(DG)(DC)(DA)(DA)
;
ATTTTATCCTCGTTCGTGCATCTGGTGTAGCACCAGCACTCAGAGCAA BL ? 
77  polydeoxyribonucleotide no no 
;(DA)(DA)(DT)(DT)(DA)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DA)(DA)(DA)(DT)(DT)
(DC)(DG)(DC)(DA)(DT)(DT)(DT)(DC)(DG)(DG)(DA)(DT)(DT)(DC)(DA)(DC)(DA)(DG)(DG)(DC)
(DA)(DA)(DT)(DA)(DG)(DC)(DA)(DT)(DT)(DA)(DG)(DG)
;
AATTATTTTTTTTTTAAATTCGCATTTCGGATTCACAGGCAATAGCATTAGG BM ? 
78  polydeoxyribonucleotide no no 
;(DT)(DT)(DT)(DT)(DT)(DT)(DC)(DA)(DA)(DT)(DC)(DG)(DT)(DT)(DG)(DT)(DA)(DC)(DC)(DA)
(DA)(DC)(DC)(DT)(DA)(DA)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DA)(DA)(DC)(DA)
(DT)(DC)(DG)(DC)(DC)(DA)(DT)(DT)(DA)(DA)(DG)(DA)(DT)(DT)(DT)(DT)(DC)(DG)(DA)(DG)
(DC)(DG)(DG)
;
TTTTTTCAATCGTTGTACCAACCTAATTTTTTTTTTAACATCGCCATTAAGATTTTCGAGCGG BN ? 
79  polydeoxyribonucleotide no no 
;(DA)(DT)(DC)(DA)(DA)(DA)(DG)(DC)(DG)(DG)(DT)(DA)(DT)(DA)(DT)(DT)(DT)(DT)(DA)(DT)
(DA)(DT)(DA)(DA)(DC)(DA)(DC)(DC)(DT)(DC)(DT)(DT)(DC)(DG)(DC)(DT)(DA)(DT)(DC)(DG)
(DG)(DC)(DC)(DT)(DT)(DG)(DC)(DC)(DT)
;
ATCAAAGCGGTATATTTTATATAACACCTCTTCGCTATCGGCCTTGCCT BO ? 
80  polydeoxyribonucleotide no no 
;(DT)(DT)(DT)(DT)(DT)(DA)(DA)(DA)(DA)(DT)(DC)(DA)(DG)(DG)(DT)(DC)(DT)(DT)(DT)(DG)
(DG)(DC)(DA)(DT)(DC)(DA)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DA)(DT)(DT)(DC)
(DT)(DA)(DC)(DT)(DG)(DA)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DC)(DG)(DC)
(DA)(DC)(DT)(DC)(DC)(DA)
;
TTTTTAAAATCAGGTCTTTGGCATCATTTTTTTTTTATTCTACTGATTTTTTTTTTTCGCACTCCA BP ? 
81  polydeoxyribonucleotide no no 
;(DC)(DC)(DC)(DG)(DA)(DA)(DA)(DC)(DA)(DT)(DT)(DT)(DC)(DG)(DG)(DT)(DA)(DG)(DA)(DT)
(DT)(DT)(DG)(DC)(DG)(DC)(DA)(DA)(DC)(DT)(DA)(DT)(DT)(DA)(DC)(DC)(DG)(DC)(DT)(DA)
(DG)(DC)(DA)(DA)(DT)(DA)(DC)(DT)
;
CCCGAAACATTTCGGTAGATTTGCGCAACTATTACCGCTAGCAATACT BQ ? 
82  polydeoxyribonucleotide no no 
;(DA)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DA)(DT)(DT)(DT)(DT)(DT)(DA)(DA)(DA)(DT)(DA)(DT)
(DG)(DC)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DA)(DA)(DC)(DT)(DA)(DA)(DA)(DG)
(DG)(DG)(DA)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DG)(DT)(DG)(DC)(DT)(DG)
(DC)(DA)(DA)(DG)
;
ATTTTTTTATTTTTAAATATGCTTTTTTTTTTAACTAAAGGGATTTTTTTTTTTGTGCTGCAAG BR ? 
83  polydeoxyribonucleotide no no 
;(DT)(DT)(DG)(DC)(DT)(DC)(DT)(DT)(DC)(DA)(DT)(DT)(DC)(DC)(DC)(DA)(DT)(DT)(DT)(DG)
(DG)(DG)(DC)(DG)(DG)(DC)(DA)(DC)(DC)(DG)(DC)(DG)(DA)(DC)(DG)(DA)(DC)(DA)(DG)(DT)
(DA)(DA)(DA)(DA)(DC)(DG)(DC)(DG)
;
TTGCTCTTCATTCCCATTTGGGCGGCACCGCGACGACAGTAAAACGCG BS ? 
84  polydeoxyribonucleotide no no 
;(DT)(DT)(DT)(DT)(DT)(DG)(DC)(DA)(DA)(DC)(DG)(DC)(DT)(DA)(DG)(DT)(DT)(DT)(DG)(DA)
(DC)(DA)(DT)(DA)(DT)(DC)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DG)(DG)(DT)
(DC)(DA)(DG)(DT)(DT)(DG)(DG)(DC)(DA)(DC)(DC)(DG)
;
TTTTTGCAACGCTAGTTTGACATATCTTTTTTTTTTTGGTCAGTTGGCACCG BT ? 
85  polydeoxyribonucleotide no no 
;(DT)(DT)(DT)(DT)(DT)(DG)(DG)(DT)(DC)(DA)(DT)(DT)(DG)(DG)(DA)(DA)(DT)(DT)(DT)(DT)
(DT)(DT)(DT)(DT)(DT)(DT)(DC)(DG)(DG)(DT)(DA)(DA)(DT)(DC)(DG)(DT)(DA)(DA)(DT)(DA)
(DT)(DT)(DT)(DT)(DG)(DT)(DG)(DC)(DA)(DA)(DT)(DG)(DC)(DT)(DT)
;
TTTTTGGTCATTGGAATTTTTTTTTTCGGTAATCGTAATATTTTGTGCAATGCTT BU ? 
86  polydeoxyribonucleotide no no 
;(DC)(DT)(DA)(DT)(DT)(DT)(DA)(DT)(DG)(DT)(DC)(DA)(DA)(DT)(DC)(DC)(DC)(DT)(DT)(DC)
(DT)(DG)(DA)(DA)(DA)(DC)(DA)(DA)(DG)(DA)(DG)(DA)(DA)(DT)(DC)(DG)(DA)(DT)(DC)(DC)
(DT)(DG)(DA)(DG)
;
CTATTTATGTCAATCCCTTCTGAAACAAGAGAATCGATCCTGAG BV ? 
87  polydeoxyribonucleotide no no 
;(DT)(DT)(DT)(DT)(DT)(DG)(DA)(DA)(DT)(DG)(DG)(DC)(DT)(DA)(DC)(DC)(DA)(DG)(DT)(DA)
(DA)(DA)(DT)(DT)(DG)(DG)(DC)(DA)(DG)(DA)(DT)(DT)(DC)(DA)(DC)(DC)(DA)(DT)(DT)(DT)
(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DG)(DT)(DC)(DA)(DC)(DA)
;
TTTTTGAATGGCTACCAGTAAATTGGCAGATTCACCATTTTTTTTTTGTCACA BW ? 
88  polydeoxyribonucleotide no no 
;(DG)(DC)(DG)(DT)(DT)(DG)(DA)(DA)(DT)(DG)(DA)(DG)(DT)(DG)(DT)(DA)(DA)(DA)(DG)(DT)
(DG)(DT)(DA)(DA)(DT)(DT)(DG)(DT)(DT)(DA)(DA)(DG)(DG)(DA)(DA)(DG)(DA)(DT)(DG)(DA)
(DT)(DA)(DA)(DT)(DC)(DA)(DT)(DG)
;
GCGTTGAATGAGTGTAAAGTGTAATTGTTAAGGAAGATGATAATCATG BX ? 
89  polydeoxyribonucleotide no no 
;(DT)(DT)(DT)(DT)(DT)(DT)(DA)(DC)(DC)(DG)(DG)(DC)(DG)(DC)(DG)(DT)(DA)(DA)(DA)(DC)
(DA)(DA)(DC)(DC)(DC)(DG)(DA)(DA)(DA)(DT)(DT)(DT)(DT)(DT)(DT)(DA)(DA)(DA)(DA)(DA)
(DT)(DT)(DC)(DT)(DG)(DA)(DG)(DT)
;
TTTTTTACCGGCGCGTAAACAACCCGAAATTTTTTAAAAATTCTGAGT BY ? 
90  polydeoxyribonucleotide no no 
;(DT)(DT)(DT)(DA)(DA)(DC)(DT)(DC)(DG)(DC)(DG)(DT)(DC)(DT)(DT)(DT)(DT)(DT)(DT)(DT)
(DT)(DT)(DT)(DT)(DG)(DA)(DA)(DA)(DT)(DG)(DG)(DA)(DT)(DC)(DA)(DC)(DC)(DA)(DT)(DC)
(DA)(DA)(DC)(DT)(DG)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DA)(DT)(DA)(DG)(DC)
(DA)(DA)(DA)(DC)(DA)(DT)
;
TTTAACTCGCGTCTTTTTTTTTTTGAAATGGATCACCATCAACTGTTTTTTTTTTATAGCAAACAT BZ ? 
91  polydeoxyribonucleotide no no 
;(DA)(DA)(DT)(DG)(DT)(DG)(DA)(DT)(DG)(DG)(DG)(DA)(DT)(DA)(DC)(DT)(DG)(DC)(DA)(DG)
(DG)(DT)(DA)(DC)(DG)(DG)(DC)(DC)(DA)(DG)(DT)(DT)(DT)(DT)(DT)(DC)(DT)(DT)(DC)(DT)
(DT)(DC)(DA)(DC)(DC)(DG)(DG)(DC)
;
AATGTGATGGGATACTGCAGGTACGGCCAGTTTTTCTTCTTCACCGGC Ba ? 
92  polydeoxyribonucleotide no no 
;(DG)(DC)(DC)(DA)(DG)(DG)(DG)(DC)(DG)(DC)(DC)(DG)(DG)(DA)(DA)(DG)(DC)(DA)(DA)(DG)
(DC)(DT)(DA)(DA)(DC)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DC)(DA)(DC)(DA)
(DT)(DT)(DA)(DA)(DG)(DT)(DG)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DG)(DA)(DC)
(DT)(DC)(DC)(DA)(DA)(DC)(DG)(DT)
;
GCCAGGGCGCCGGAAGCAAGCTAACTTTTTTTTTTTCACATTAAGTGTTTTTTTTTTGACTCCAACGT Bb ? 
93  polydeoxyribonucleotide no no 
;(DC)(DA)(DA)(DA)(DG)(DG)(DG)(DC)(DG)(DG)(DG)(DT)(DG)(DC)(DC)(DT)(DC)(DG)(DC)(DT)
(DC)(DA)(DC)(DT)(DG)(DC)(DT)(DT)(DA)(DA)(DT)(DG)(DT)(DT)(DG)(DC)(DA)(DT)(DG)(DC)
(DG)(DG)(DT)(DC)(DA)(DC)(DG)(DT)(DT)(DG)
;
CAAAGGGCGGGTGCCTCGCTCACTGCTTAATGTTGCATGCGGTCACGTTG Bc ? 
94  polydeoxyribonucleotide no no 
;(DT)(DT)(DT)(DT)(DT)(DA)(DC)(DG)(DT)(DG)(DG)(DC)(DA)(DA)(DC)(DA)(DG)(DC)(DT)(DG)
(DA)(DG)(DA)(DA)(DG)(DT)(DT)(DT)(DT)(DC)(DC)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)
(DT)(DC)(DA)(DG)(DT)(DC)(DA)(DC)(DG)(DA)(DC)(DG)(DT)(DT)(DG)(DT)
;
TTTTTACGTGGCAACAGCTGAGAAGTTTTCCTTTTTTTTTTCAGTCACGACGTTGT Bd ? 
95  polydeoxyribonucleotide no no 
;(DG)(DA)(DC)(DT)(DT)(DC)(DT)(DG)(DG)(DT)(DC)(DG)(DG)(DT)(DA)(DC)(DG)(DC)(DA)(DG)
(DG)(DC)(DC)(DA)(DC)(DC)(DA)(DT)(DT)(DT)(DA)(DG)(DA)(DG)(DC)(DT)(DT)(DG)(DA)(DC)
(DG)(DG)(DC)(DT)(DA)(DA)(DA)(DG)
;
GACTTCTGGTCGGTACGCAGGCCACCATTTAGAGCTTGACGGCTAAAG Be ? 
96  polydeoxyribonucleotide no no 
;(DA)(DT)(DT)(DG)(DT)(DT)(DG)(DT)(DT)(DC)(DC)(DG)(DG)(DC)(DC)(DA)(DA)(DC)(DC)(DA)
(DG)(DG)(DG)(DT)(DG)(DG)(DT)(DG)(DC)(DC)(DA)(DA)(DG)(DC)(DG)(DA)(DC)(DA)(DG)(DG)
(DA)(DA)(DG)(DC)(DC)(DG)(DG)(DA)
;
ATTGTTGTTCCGGCCAACCAGGGTGGTGCCAAGCGACAGGAAGCCGGA Bf ? 
97  polydeoxyribonucleotide no no 
;(DT)(DT)(DA)(DG)(DG)(DA)(DG)(DG)(DC)(DC)(DC)(DA)(DA)(DA)(DT)(DT)(DA)(DA)(DC)(DC)
(DG)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DG)(DC)(DA)(DG)(DC)(DC)(DA)
(DT)(DT)(DT)(DT)(DT)(DT)(DT)
;
TTAGGAGGCCCAAATTAACCGTTTTTTTTTTTTGCAGCCATTTTTTT Bg ? 
98  polydeoxyribonucleotide no no 
;(DG)(DA)(DG)(DT)(DA)(DG)(DA)(DA)(DG)(DG)(DT)(DT)(DG)(DG)(DG)(DT)(DA)(DA)(DC)(DG)
(DC)(DC)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DA)(DG)(DG)(DG)(DT)(DG)(DT)(DT)
(DT)(DT)(DT)(DA)(DT)(DC)(DC)(DA)
;
GAGTAGAAGGTTGGGTAACGCCTTTTTTTTTTAGGGTGTTTTTATCCA Bh ? 
99  polydeoxyribonucleotide no no 
;(DA)(DT)(DT)(DA)(DC)(DG)(DA)(DA)(DT)(DC)(DA)(DG)(DT)(DG)(DC)(DA)(DG)(DA)(DA)(DT)
(DC)(DC)(DT)(DG)(DA)(DT)(DT)(DG)(DC)(DC)(DT)(DT)(DC)(DA)(DC)(DC)(DA)(DG)(DG)(DT)
(DC)(DG)(DA)(DG)(DG)(DT)(DA)(DT)(DC)(DA)(DC)(DC)(DC)(DA)(DA)(DA)(DT)(DC)(DA)(DA)
(DG)(DT)(DT)(DT)(DT)(DT)(DT)
;
ATTACGAATCAGTGCAGAATCCTGATTGCCTTCACCAGGTCGAGGTATCACCCAAATCAAGTTTTTT Bi ? 
100 polydeoxyribonucleotide no no 
;(DA)(DG)(DC)(DG)(DA)(DA)(DA)(DT)(DC)(DG)(DC)(DC)(DT)(DG)(DG)(DC)(DC)(DC)(DT)(DT)
(DG)(DC)(DC)(DC)(DC)(DA)(DG)(DA)(DG)(DT)(DA)(DA)(DA)(DA)(DT)(DA)(DA)(DC)(DA)(DT)
(DC)(DA)(DC)(DT)(DT)
;
AGCGAAATCGCCTGGCCCTTGCCCCAGAGTAAAATAACATCACTT Bj ? 
101 polydeoxyribonucleotide no no 
;(DA)(DA)(DC)(DC)(DT)(DA)(DA)(DG)(DG)(DG)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)
(DA)(DA)(DG)(DA)(DA)(DA)(DG)(DC)(DG)(DA)(DA)(DA)(DG)(DG)(DT)(DC)(DA)(DC)(DG)(DC)
(DT)(DA)(DG)(DC)(DT)(DC)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DG)(DA)(DA)(DT)
(DT)(DC)(DG)(DT)(DA)(DA)(DT)
;
AACCTAAGGGTTTTTTTTTTAAGAAAGCGAAAGGTCACGCTAGCTCTTTTTTTTTTGAATTCGTAAT Bk ? 
102 polydeoxyribonucleotide no no 
;(DC)(DA)(DG)(DT)(DG)(DT)(DA)(DG)(DC)(DG)(DG)(DA)(DG)(DC)(DG)(DG)(DG)(DC)(DG)(DC)
(DT)(DA)(DG)(DG)(DG)(DC)(DG)(DA)(DA)(DA)(DA)(DA)(DC)(DC)(DA)(DA)(DC)(DA)(DA)(DG)
(DA)(DG)(DT)(DC)(DC)(DA)(DC)(DT)
;
CAGTGTAGCGGAGCGGGCGCTAGGGCGAAAAACCAACAAGAGTCCACT Bl ? 
103 polydeoxyribonucleotide no no 
;(DA)(DA)(DC)(DC)(DC)(DG)(DC)(DC)(DG)(DC)(DG)(DC)(DC)(DC)(DG)(DC)(DT)(DT)(DT)(DA)
(DA)(DT)(DG)(DA)(DA)(DT)(DC)(DA)(DG)(DT)(DT)(DT)(DG)(DG)(DC)(DC)(DT)(DT)(DA)(DT)
(DA)(DA)(DA)(DT)(DC)(DA)(DA)(DA)
;
AACCCGCCGCGCCCGCTTTAATGAATCAGTTTGGCCTTATAAATCAAA Bm ? 
104 polydeoxyribonucleotide no no 
;(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DG)(DG)(DG)(DT)(DG)(DA)(DG)(DA)(DC)(DG)
(DG)(DG)(DC)(DG)(DA)(DG)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DA)(DA)(DA)(DG)
(DG)(DG)(DT)(DC)(DG)(DT)(DG)(DC)(DC)(DG)(DA)(DG)(DG)(DA)(DT)(DC)(DC)(DC)(DC)(DG)
(DG)(DG)(DT)(DT)(DT)(DT)(DT)
;
TTTTTTTTTTGGGTGAGACGGGCGAGTTTTTTTTTTAAAGGGTCGTGCCGAGGATCCCCGGGTTTTT Bn ? 
105 polydeoxyribonucleotide no no 
;(DA)(DC)(DT)(DC)(DT)(DA)(DA)(DG)(DC)(DT)(DG)(DC)(DA)(DT)(DT)(DC)(DC)(DA)(DG)(DT)
(DC)(DG)(DC)(DG)(DT)(DG)(DA)(DA)(DC)(DC)(DG)(DT)(DC)(DT)(DA)(DT)(DC)(DA)(DG)(DG)
(DG)(DC)(DG)(DA)(DT)(DG)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DG)(DC)(DC)(DC)
(DA)(DC)(DT)(DA)(DG)(DG)(DA)
;
ACTCTAAGCTGCATTCCAGTCGCGTGAACCGTCTATCAGGGCGATGTTTTTTTTTTGCCCACTAGGA Bo ? 
106 polydeoxyribonucleotide no no 
;(DA)(DA)(DA)(DA)(DT)(DC)(DA)(DG)(DC)(DC)(DC)(DC)(DC)(DG)(DG)(DC)(DA)(DG)(DG)(DC)
(DG)(DA)(DA)(DA)(DA)(DT)(DC)(DC)(DT)(DG)(DA)(DC)(DG)(DC)(DT)(DG)(DG)(DT)(DT)(DG)
(DA)(DG)(DA)(DG)(DA)(DG)(DG)(DG)
;
AAAATCAGCCCCCGGCAGGCGAAAATCCTGACGCTGGTTGAGAGAGGG Bp ? 
107 polydeoxyribonucleotide no no 
;(DA)(DG)(DG)(DC)(DG)(DG)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DG)
(DC)(DG)(DT)(DA)(DG)(DA)(DG)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DA)(DT)(DA)
(DG)(DG)(DG)(DT)(DT)(DG)(DA)(DG)(DT)(DA)(DA)(DA)(DG)(DA)(DA)(DC)(DT)(DT)
;
AGGCGGTTTTTTTTTTTTTGCGTAGAGTTTTTTTTTTATAGGGTTGAGTAAAGAACTT Bq ? 
108 polydeoxyribonucleotide no no 
;(DT)(DT)(DT)(DT)(DT)(DA)(DG)(DC)(DG)(DG)(DT)(DC)(DC)(DT)(DT)(DT)(DT)(DT)(DT)(DT)
(DT)(DT)(DT)(DT)(DT)(DT)(DG)(DA)(DT)(DG)(DG)(DT)(DG)(DG)(DT)(DT)(DC)(DA)(DA)(DT)
(DA)(DG)(DC)(DC)(DC)(DT)(DT)(DG)(DG)(DG)(DC)
;
TTTTTAGCGGTCCTTTTTTTTTTTTTGATGGTGGTTCAATAGCCCTTGGGC Br ? 
109 polydeoxyribonucleotide no no 
;(DG)(DG)(DG)(DC)(DC)(DG)(DT)(DA)(DA)(DA)(DG)(DC)(DA)(DC)(DT)(DA)(DA)(DA)(DT)(DT)
(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DC)(DG)(DG)(DA)(DA)(DC)(DC)(DG)(DG)(DA)(DA)
(DA)(DG)(DC)(DC)(DG)(DG)(DC)(DG)(DA)(DT)(DT)(DT)(DT)(DT)
;
GGGCCGTAAAGCACTAAATTTTTTTTTTTCGGAACCGGAAAGCCGGCGATTTTT Bs ? 
110 polydeoxyribonucleotide no no 
;(DT)(DC)(DG)(DA)(DC)(DT)(DG)(DG)(DA)(DT)(DA)(DG)(DC)(DG)(DT)(DC)(DC)(DA)(DT)(DT)
(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DA)(DT)(DA)(DC)(DT)(DG)(DC)(DG)(DA)(DA)(DA)(DT)
(DG)
;
TCGACTGGATAGCGTCCATTTTTTTTTTATACTGCGAAATG C0 ? 
111 polydeoxyribonucleotide no no 
;(DG)(DA)(DT)(DC)(DA)(DA)(DG)(DA)(DA)(DA)(DA)(DA)(DT)(DG)(DA)(DT)(DT)(DT)(DT)(DT)
(DT)(DT)(DT)(DT)(DT)(DC)(DC)(DA)(DT)(DA)(DT)(DG)(DA)(DA)(DT)(DA)(DA)(DT)(DA)(DC)
(DA)(DT)(DC)(DC)(DA)(DA)(DT)(DT)(DT)(DT)(DT)
;
GATCAAGAAAAATGATTTTTTTTTTCCATATGAATAATACATCCAATTTTT C1 ? 
112 polydeoxyribonucleotide no no 
;(DA)(DA)(DA)(DA)(DT)(DA)(DG)(DT)(DT)(DG)(DC)(DT)(DA)(DT)(DC)(DC)(DT)(DT)(DA)(DT)
(DC)(DA)(DC)(DT)(DC)(DA)(DT)(DC)(DG)(DA)(DA)(DT)(DA)(DA)(DT)(DA)(DT)(DC)(DG)(DT)
(DC)(DA)(DG)(DA)(DA)(DG)(DC)(DA)(DA)(DT)(DA)(DT)(DA)(DA)(DC)(DT)
;
AAAATAGTTGCTATCCTTATCACTCATCGAATAATATCGTCAGAAGCAATATAACT C2 ? 
113 polydeoxyribonucleotide no no 
;(DC)(DC)(DC)(DA)(DA)(DT)(DC)(DC)(DA)(DA)(DA)(DT)(DA)(DA)(DG)(DA)(DA)(DA)(DC)(DT)
(DG)(DA)(DA)(DT)(DC)(DT)(DA)(DA)(DA)(DA)(DT)(DC)(DT)(DC)(DC)(DA)(DT)(DC)(DG)(DT)
(DA)(DG)(DC)(DC)(DG)(DC)(DT)(DT)
;
CCCAATCCAAATAAGAAACTGAATCTAAAATCTCCATCGTAGCCGCTT C3 ? 
114 polydeoxyribonucleotide no no 
;(DG)(DG)(DT)(DA)(DA)(DA)(DG)(DT)(DA)(DA)(DT)(DT)(DC)(DG)(DC)(DT)(DA)(DA)(DT)(DG)
(DC)(DA)(DG)(DA)(DA)(DC)(DG)(DC)(DG)(DC)(DC)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)
(DT)(DT)(DG)(DT)(DT)(DT)(DA)(DT)(DC)(DA)(DA)(DC)(DA)(DT)(DA)(DT)(DA)(DC)(DT)(DT)
(DC)(DA)(DA)(DT)(DC)(DA)(DT)(DT)(DT)(DT)(DT)
;
GGTAAAGTAATTCGCTAATGCAGAACGCGCCTTTTTTTTTTTGTTTATCAACATATACTTCAATCATTTTT C4 ? 
115 polydeoxyribonucleotide no no 
;(DT)(DA)(DC)(DG)(DA)(DG)(DG)(DC)(DC)(DA)(DG)(DA)(DT)(DA)(DC)(DA)(DA)(DG)(DG)(DA)
(DC)(DG)(DT)(DT)(DG)(DA)(DG)(DA)(DG)(DG)(DG)(DT)(DT)(DA)(DA)(DA)(DG)(DA)(DT)(DT)
(DC)(DA)(DA)(DA)(DT)(DA)(DT)(DT)(DA)(DG)(DC)(DT)(DC)(DA)(DT)(DT)(DG)(DC)(DT)(DG)
(DG)(DC)
;
TACGAGGCCAGATACAAGGACGTTGAGAGGGTTAAAGATTCAAATATTAGCTCATTGCTGGC C5 ? 
116 polydeoxyribonucleotide no no 
;(DT)(DT)(DT)(DA)(DA)(DG)(DA)(DG)(DG)(DA)(DA)(DT)(DA)(DT)(DT)(DC)(DC)(DT)(DA)(DA)
(DT)(DG)(DA)(DA)(DA)(DA)(DG)(DA)(DA)(DC)(DG)(DA)(DA)(DC)(DA)(DT)(DG)(DG)(DG)(DC)
(DG)(DC)(DC)(DC)(DT)(DG)(DT)(DA)
;
TTTAAGAGGAATATTCCTAATGAAAAGAACGAACATGGGCGCCCTGTA C6 ? 
117 polydeoxyribonucleotide no no 
;(DG)(DA)(DT)(DA)(DT)(DA)(DG)(DA)(DT)(DT)(DT)(DT)(DG)(DC)(DA)(DA)(DT)(DC)(DC)(DT)
(DT)(DT)(DG)(DA)(DT)(DT)(DT)(DA)(DG)(DA)(DA)(DG)(DT)(DA)(DT)(DT)(DA)(DG)(DA)(DC)
(DT)(DT)(DT)(DA)(DC)(DA)(DT)(DT)(DA)(DG)(DT)(DA)
;
GATATAGATTTTGCAATCCTTTGATTTAGAAGTATTAGACTTTACATTAGTA C7 ? 
118 polydeoxyribonucleotide no no 
;(DC)(DG)(DA)(DA)(DA)(DG)(DC)(DC)(DT)(DG)(DC)(DA)(DA)(DT)(DA)(DG)(DT)(DG)(DT)(DT)
(DC)(DA)(DT)(DT)(DT)(DG)(DA)(DT)(DT)(DT)(DC)(DA)(DA)(DC)(DT)(DG)(DT)(DG)(DT)(DA)
(DG)(DG)(DA)(DG)
;
CGAAAGCCTGCAATAGTGTTCATTTGATTTCAACTGTGTAGGAG C8 ? 
119 polydeoxyribonucleotide no no 
;(DG)(DC)(DG)(DA)(DT)(DT)(DA)(DA)(DT)(DA)(DG)(DC)(DT)(DC)(DA)(DA)(DC)(DT)(DG)(DG)
(DA)(DA)(DG)(DT)(DC)(DT)(DT)(DT)(DT)(DG)(DA)(DT)(DC)(DT)(DA)(DT)(DT)(DA)(DT)(DA)
(DC)(DC)(DA)(DT)(DC)(DC)(DT)(DA)(DG)(DT)(DC)(DC)(DT)(DG)
;
GCGATTAATAGCTCAACTGGAAGTCTTTTGATCTATTATACCATCCTAGTCCTG CB ? 
120 polydeoxyribonucleotide no no 
;(DG)(DC)(DT)(DG)(DG)(DT)(DA)(DA)(DT)(DA)(DT)(DC)(DC)(DG)(DA)(DA)(DT)(DT)(DG)(DA)
(DG)(DC)(DC)(DA)(DA)(DT)(DT)(DC)(DT)(DA)(DG)(DG)(DT)(DC)(DA)(DG)(DG)(DA)(DA)(DA)
(DA)(DA)(DG)(DA)(DT)(DG)(DC)
;
GCTGGTAATATCCGAATTGAGCCAATTCTAGGTCAGGAAAAAGATGC CC ? 
121 polydeoxyribonucleotide no no 
;(DA)(DT)(DC)(DG)(DG)(DC)(DC)(DG)(DG)(DC)(DG)(DG)(DA)(DT)(DT)(DC)(DA)(DG)(DT)(DA)
(DT)(DT)(DG)(DG)(DC)(DA)(DA)(DA)(DG)(DA)(DG)(DA)(DT)(DG)(DA)(DT)(DG)(DA)(DT)(DT)
(DA)(DA)(DC)(DA)(DA)(DT)(DA)(DA)
;
ATCGGCCGGCGGATTCAGTATTGGCAAAGAGATGATGATTAACAATAA CD ? 
122 polydeoxyribonucleotide no no 
;(DG)(DT)(DA)(DA)(DT)(DT)(DA)(DA)(DT)(DA)(DA)(DA)(DG)(DA)(DC)(DA)(DG)(DA)(DG)(DG)
(DC)(DG)(DA)(DT)(DA)(DA)(DA)(DG)(DC)(DT)(DT)(DA)(DA)(DT)(DA)(DC)(DT)(DT)(DC)(DG)
;
GTAATTAATAAAGACAGAGGCGATAAAGCTTAATACTTCG CE ? 
123 polydeoxyribonucleotide no no 
;(DC)(DC)(DA)(DG)(DT)(DT)(DC)(DT)(DG)(DA)(DG)(DA)(DG)(DC)(DT)(DG)(DT)(DT)(DT)(DA)
(DG)(DC)(DA)(DT)(DT)(DG)(DC)(DA)(DT)(DC)(DA)(DT)(DT)(DA)(DG)(DA)(DG)(DA)(DA)(DA)
;
CCAGTTCTGAGAGCTGTTTAGCATTGCATCATTAGAGAAA CF ? 
124 polydeoxyribonucleotide no no 
;(DG)(DC)(DC)(DG)(DA)(DA)(DA)(DG)(DG)(DG)(DT)(DA)(DC)(DG)(DG)(DT)(DG)(DT)(DC)(DA)
(DT)(DG)(DT)(DT)(DT)(DT)(DG)(DC)(DG)(DG)(DA)(DT)(DG)(DG)(DC)(DT)(DT)(DA)(DG)(DA)
(DG)(DC)(DT)(DT)
;
GCCGAAAGGGTACGGTGTCATGTTTTGCGGATGGCTTAGAGCTT CG ? 
125 polydeoxyribonucleotide no no 
;(DA)(DA)(DG)(DG)(DT)(DG)(DC)(DG)(DG)(DG)(DG)(DT)(DT)(DG)(DA)(DT)(DT)(DC)(DG)(DA)
(DA)(DG)(DG)(DT)(DT)(DA)(DC)(DT)(DT)(DT)(DA)(DG)(DG)(DA)(DG)(DC)(DA)(DC)(DT)(DA)
(DA)(DC)(DG)(DT)(DT)(DT)(DT)(DA)
;
AAGGTGCGGGGTTGATTCGAAGGTTACTTTAGGAGCACTAACGTTTTA CH ? 
126 polydeoxyribonucleotide no no 
;(DA)(DA)(DT)(DC)(DG)(DT)(DC)(DC)(DG)(DG)(DA)(DT)(DA)(DT)(DA)(DA)(DT)(DA)(DA)(DC)
(DG)(DG)(DA)(DC)(DT)(DG)(DA)(DC)(DC)(DA)(DG)(DA)(DC)(DG)(DG)(DT)(DC)(DA)(DG)(DT)
(DT)(DA)(DC)(DT)
;
AATCGTCCGGATATAATAACGGACTGACCAGACGGTCAGTTACT CI ? 
127 polydeoxyribonucleotide no no 
;(DC)(DA)(DA)(DA)(DT)(DA)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DC)
(DA)(DA)(DA)(DC)(DC)(DC)(DT)(DC)(DA)(DA)(DT)(DC)(DA)(DT)(DG)(DC)(DT)(DG)(DA)(DA)
(DC)(DA)(DC)(DC)(DA)(DG)(DA)(DA)(DG)(DA)(DG)(DG)(DT)(DT)(DT)(DA)(DA)(DA)(DT)
;
CAAATATTTTTTTTTTTTTCAAACCCTCAATCATGCTGAACACCAGAAGAGGTTTAAAT CJ ? 
128 polydeoxyribonucleotide no no 
;(DC)(DA)(DA)(DC)(DA)(DT)(DA)(DA)(DT)(DA)(DA)(DA)(DG)(DC)(DG)(DA)(DA)(DG)(DA)(DT)
(DA)(DA)(DT)(DT)(DG)(DC)(DA)(DC)(DG)(DT)(DG)(DA)(DT)(DG)(DA)(DT)(DG)(DG)(DC)(DA)
(DT)(DC)(DG)(DG)(DA)(DA)(DG)(DT)
;
CAACATAATAAAGCGAAGATAATTGCACGTGATGATGGCATCGGAAGT CK ? 
129 polydeoxyribonucleotide no no 
;(DA)(DA)(DC)(DG)(DA)(DA)(DC)(DT)(DT)(DT)(DT)(DT)(DC)(DA)(DA)(DA)(DT)(DT)(DG)(DA)
(DG)(DA)(DC)(DG)(DT)(DC)(DA)(DG)(DA)(DT)(DG)(DA)(DT)(DT)(DG)(DC)(DT)(DT)(DT)(DG)
(DA)(DA)(DT)(DA)(DC)(DC)(DA)(DA)
;
AACGAACTTTTTCAAATTGAGACGTCAGATGATTGCTTTGAATACCAA CL ? 
130 polydeoxyribonucleotide no no 
;(DT)(DT)(DT)(DT)(DT)(DA)(DG)(DG)(DT)(DA)(DG)(DA)(DA)(DA)(DG)(DA)(DT)(DT)(DC)(DA)
(DT)(DC)(DA)(DG)(DT)(DA)(DC)(DC)(DA)(DG)(DA)(DC)(DG)(DA)(DC)(DG)(DA)(DT)(DT)(DT)
(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DA)(DA)(DA)(DA)(DA)(DC)
;
TTTTTAGGTAGAAAGATTCATCAGTACCAGACGACGATTTTTTTTTTTAAAAAC CM ? 
131 polydeoxyribonucleotide no no 
;(DC)(DA)(DA)(DA)(DA)(DT)(DA)(DG)(DC)(DG)(DA)(DG)(DA)(DG)(DG)(DC)(DT)(DT)(DT)(DT)
(DG)(DC)(DG)(DT)(DT)(DA)(DA)(DT)(DA)(DA)(DT)(DA)(DG)(DG)(DA)(DA)(DT)(DA)(DA)(DT)
(DA)
;
CAAAATAGCGAGAGGCTTTTGCGTTAATAATAGGAATAATA CN ? 
132 polydeoxyribonucleotide no no 
;(DT)(DA)(DT)(DA)(DA)(DG)(DC)(DA)(DA)(DA)(DA)(DG)(DG)(DG)(DG)(DA)(DA)(DG)(DC)(DC)
(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DA)(DA)(DT)(DA)(DT)(DT)(DT)(DC)(DA)(DA)(DT)(DC)(DA)
(DT)(DA)(DT)(DG)(DC)(DG)(DG)(DG)
;
TATAAGCAAAAGGGGAAGCCTTTTTTTAATATTTCAATCATATGCGGG CO ? 
133 polydeoxyribonucleotide no no 
;(DC)(DA)(DA)(DA)(DA)(DC)(DG)(DT)(DT)(DA)(DA)(DA)(DA)(DC)(DT)(DA)(DG)(DC)(DT)(DT)
(DG)(DA)(DG)(DA)(DG)(DA)(DT)(DC)(DT)(DG)(DG)(DA)(DG)(DC)(DT)(DC)(DA)(DT)(DT)(DG)
(DA)(DA)(DT)(DC)(DC)(DC)(DC)(DC)(DT)(DC)(DG)(DA)(DA)(DT)(DC)(DG)
;
CAAAACGTTAAAACTAGCTTGAGAGATCTGGAGCTCATTGAATCCCCCTCGAATCG CP ? 
134 polydeoxyribonucleotide no no 
;(DA)(DA)(DC)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DA)(DA)(DT)(DT)(DC)(DG)(DA)
(DC)(DA)(DA)(DC)(DT)(DT)(DT)(DT)(DA)(DA)(DA)(DA)(DC)(DA)(DT)(DC)(DG)(DC)
;
AACTTTTTTTTTTAATTCGACAACTTTTAAAACATCGC CQ ? 
135 polydeoxyribonucleotide no no 
;(DA)(DA)(DC)(DC)(DC)(DT)(DC)(DG)(DT)(DT)(DT)(DT)(DG)(DA)(DG)(DA)(DT)(DT)(DA)(DA)
(DC)(DG)(DA)(DA)(DC)(DT)(DA)(DT)(DT)(DC)(DA)(DA)(DC)(DC)(DC)(DA)(DG)(DT)(DC)(DA)
(DA)(DA)(DT)(DT)(DA)(DT)(DT)(DT)
;
AACCCTCGTTTTGAGATTAACGAACTATTCAACCCAGTCAAATTATTT CR ? 
136 polydeoxyribonucleotide no no 
;(DT)(DT)(DT)(DA)(DT)(DC)(DA)(DA)(DA)(DA)(DT)(DC)(DA)(DT)(DA)(DG)(DG)(DT)(DC)(DT)
(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DG)(DA)(DG)(DA)(DG)(DA)(DC)(DT)(DA)(DC)
(DC)(DT)(DA)(DT)(DA)(DA)(DG)(DG)
;
TTTATCAAAATCATAGGTCTTTTTTTTTTTGAGAGACTACCTATAAGG CS ? 
137 polydeoxyribonucleotide no no 
;(DG)(DT)(DT)(DT)(DT)(DA)(DG)(DT)(DA)(DT)(DT)(DA)(DC)(DC)(DT)(DG)(DA)(DG)(DA)(DA)
(DA)(DA)(DT)(DT)(DA)(DT)(DA)(DA)(DC)(DA)(DG)(DA)(DG)(DG)(DG)(DT)(DG)(DC)(DC)(DA)
(DC)(DG)(DT)(DG)(DA)(DG)(DG)(DG)
;
GTTTTAGTATTACCTGAGAAAATTATAACAGAGGGTGCCACGTGAGGG CT ? 
138 polydeoxyribonucleotide no no 
;(DA)(DT)(DA)(DA)(DA)(DT)(DC)(DA)(DC)(DA)(DG)(DA)(DC)(DA)(DC)(DC)(DA)(DC)(DA)(DT)
(DT)(DC)(DA)(DA)(DC)(DT)(DA)(DA)(DT)(DG)(DA)(DT)
;
ATAAATCACAGACACCACATTCAACTAATGAT CU ? 
139 polydeoxyribonucleotide no no 
;(DC)(DG)(DA)(DA)(DC)(DG)(DT)(DT)(DA)(DT)(DT)(DA)(DA)(DT)(DC)(DG)(DT)(DA)(DT)(DT)
(DA)(DT)(DA)(DA)(DA)(DC)(DA)(DA)(DC)(DT)(DG)(DA)(DA)(DT)(DT)(DT)(DT)(DG)(DT)(DC)
(DG)(DT)(DC)(DT)(DT)(DT)(DC)(DC)(DA)(DG)(DA)(DC)(DG)
;
CGAACGTTATTAATCGTATTATAAACAACTGAATTTTGTCGTCTTTCCAGACG CV ? 
140 polydeoxyribonucleotide no no 
;(DG)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DG)(DT)(DT)(DT)(DG)(DA)(DG)(DT)(DA)(DA)
(DC)(DA)(DT)(DT)(DT)(DA)(DC)(DC)(DT)(DT)(DT)(DT)(DG)(DA)(DG)(DG)(DC)(DG)
;
GTTTTTTTTTGTTTGAGTAACATTTACCTTTTGAGGCG CW ? 
141 polydeoxyribonucleotide no no 
;(DG)(DC)(DT)(DG)(DG)(DC)(DA)(DG)(DC)(DT)(DT)(DT)(DC)(DG)(DC)(DG)(DC)(DG)(DA)(DG)
(DC)(DA)(DA)(DC)(DA)(DC)(DC)(DG)(DC)(DT)(DC)(DC)(DT)(DG)(DA)(DT)(DT)(DT)(DA)(DG)
(DA)(DA)(DC)(DC)(DT)(DG)(DA)
;
GCTGGCAGCTTTCGCGCGAGCAACACCGCTCCTGATTTAGAACCTGA CX ? 
142 polydeoxyribonucleotide no no 
;(DT)(DA)(DG)(DA)(DA)(DC)(DA)(DA)(DT)(DT)(DA)(DC)(DA)(DT)(DA)(DA)(DC)(DA)(DA)(DA)
(DC)(DA)(DA)(DT)(DC)(DA)(DT)(DA)(DA)(DT)(DA)(DG)(DT)(DA)(DC)(DC)(DG)(DA)(DC)(DA)
(DA)(DA)(DA)
;
TAGAACAATTACATAACAAACAATCATAATAGTACCGACAAAA CY ? 
143 polydeoxyribonucleotide no no 
;(DG)(DA)(DT)(DG)(DA)(DG)(DA)(DA)(DA)(DG)(DG)(DT)(DA)(DA)(DA)(DT)(DT)(DG)(DA)(DA)
(DA)(DT)(DC)(DT)(DA)(DC)(DA)(DA)(DA)(DA)(DG)(DA)(DA)(DG)(DA)(DG)(DC)(DA)(DA)(DC)
(DA)(DC)(DT)(DA)(DT)(DC)(DA)(DT)
;
GATGAGAAAGGTAAATTGAAATCTACAAAAGAAGAGCAACACTATCAT CZ ? 
144 polydeoxyribonucleotide no no 
;(DT)(DA)(DT)(DG)(DT)(DG)(DA)(DG)(DT)(DG)(DA)(DA)(DG)(DT)(DT)(DA)(DC)(DA)(DA)(DG)
(DC)(DC)(DA)(DA)(DC)(DG)(DA)(DT)(DT)(DT)(DA)(DA)(DC)(DA)(DT)(DA)(DA)(DA)(DT)(DT)
(DG)(DT)(DA)(DA)
;
TATGTGAGTGAAGTTACAAGCCAACGATTTAACATAAATTGTAA Cb ? 
145 polydeoxyribonucleotide no no 
;(DA)(DC)(DA)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DC)(DG)(DG)(DG)(DA)(DG)
(DA)(DA)(DA)(DC)(DT)(DC)(DA)(DT)(DT)(DA)(DC)(DC)(DG)(DT)(DA)(DA)(DT)(DC)(DT)(DT)
(DG)(DA)(DC)(DA)(DA)(DG)(DA)(DA)(DC)(DT)(DG)(DA)(DC)(DC)(DT)(DT)(DG)(DT)(DA)(DC)
(DA)(DG)
;
ACATTTTTTTTTTTCGGGAGAAACTCATTACCGTAATCTTGACAAGAACTGACCTTGTACAG Cc ? 
146 polydeoxyribonucleotide no no 
;(DA)(DA)(DT)(DT)(DT)(DA)(DA)(DT)(DC)(DA)(DG)(DC)(DT)(DC)(DA)(DT)(DT)(DA)(DA)(DA)
(DT)(DG)(DT)(DT)(DT)(DA)(DA)(DT)(DA)(DA)(DA)(DT)(DA)(DT)(DA)(DA)(DA)(DG)(DG)(DA)
(DA)(DT)
;
AATTTAATCAGCTCATTAAATGTTTAATAAATATAAAGGAAT Cd ? 
147 polydeoxyribonucleotide no no 
;(DC)(DA)(DC)(DA)(DG)(DA)(DG)(DC)(DC)(DT)(DA)(DA)(DG)(DG)(DA)(DA)(DT)(DT)(DA)(DG)
(DC)(DA)(DA)(DA)(DT)(DC)(DT)(DT)(DC)(DG)(DG)(DT)(DC)(DG)(DG)(DT)(DT)(DT)(DT)(DA)
(DA)(DT)(DA)(DA)(DG)(DA)(DA)(DA)(DC)(DC)(DC)(DT)
;
CACAGAGCCTAAGGAATTAGCAAATCTTCGGTCGGTTTTAATAAGAAACCCT Ce ? 
148 polydeoxyribonucleotide no no 
;(DG)(DG)(DT)(DA)(DC)(DC)(DC)(DT)(DG)(DA)(DA)(DA)(DG)(DA)(DG)(DG)(DT)(DC)(DT)(DA)
(DA)(DA)(DC)(DC)(DA)(DA)(DT)(DT)(DA)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DT)(DA)
(DA)(DT)(DC)(DA)(DA)(DG)(DA)(DT)
;
GGTACCCTGAAAGAGGTCTAAACCAATTATTTTTTTTTTAATCAAGAT Cf ? 
149 polydeoxyribonucleotide no no 
;(DC)(DA)(DA)(DC)(DT)(DT)(DT)(DG)(DA)(DA)(DA)(DG)(DA)(DG)(DG)(DT)(DT)(DT)(DT)(DT)
(DT)(DT)(DT)(DT)(DT)(DA)(DC)(DA)(DG)(DA)(DT)(DG)(DA)(DA)(DC)(DG)(DG)(DT)(DC)(DA)
(DT)(DC)(DA)(DA)(DG)(DA)
;
CAACTTTGAAAGAGGTTTTTTTTTTACAGATGAACGGTCATCAAGA Cg ? 
150 polydeoxyribonucleotide no no 
;(DA)(DT)(DA)(DG)(DA)(DC)(DT)(DT)(DC)(DA)(DA)(DC)(DC)(DA)(DG)(DA)(DC)(DC)(DA)(DC)
(DC)(DG)(DC)(DG)(DC)(DC)(DT)(DC)(DC)(DG)(DG)(DT)(DA)(DT)(DC)(DT)(DA)(DA)(DC)(DG)
(DA)(DG)(DC)(DG)(DT)(DC)(DT)
;
ATAGACTTCAACCAGACCACCGCGCCTCCGGTATCTAACGAGCGTCT Ch ? 
151 polydeoxyribonucleotide no no 
;(DC)(DT)(DT)(DT)(DA)(DA)(DA)(DC)(DA)(DG)(DT)(DT)(DC)(DG)(DC)(DG)(DA)(DT)(DT)(DT)
(DT)(DG)(DG)(DC)(DT)(DA)(DT)(DC)(DA)
;
CTTTAAACAGTTCGCGATTTTGGCTATCA Ck ? 
152 polydeoxyribonucleotide no no 
;(DT)(DT)(DT)(DG)(DA)(DG)(DT)(DC)(DG)(DA)(DG)(DC)(DT)(DT)(DC)(DA)(DA)(DA)(DG)(DC)
(DG)(DA)(DA)(DA)(DT)(DA)(DT)(DC)(DG)(DC)(DC)(DT)(DG)(DA)(DG)(DG)(DC)(DT)(DA)(DC)
(DT)(DA)(DA)(DA)(DG)(DA)(DA)(DG)
;
TTTGAGTCGAGCTTCAAAGCGAAATATCGCCTGAGGCTACTAAAGAAG Cp ? 
153 polydeoxyribonucleotide no no 
;(DA)(DG)(DT)(DA)(DA)(DG)(DT)(DT)(DT)(DT)(DG)(DC)(DC)(DA)(DG)(DA)(DG)(DG)(DG)(DG)
(DG)(DT)(DA)(DA)(DT)(DA)(DG)(DT)(DA)(DA)(DT)(DA)(DC)(DC)(DA)(DG)(DT)(DC)(DT)(DA)
;
AGTAAGTTTTGCCAGAGGGGGTAATAGTAATACCAGTCTA Cq ? 
154 polydeoxyribonucleotide no no 
;(DC)(DC)(DA)(DA)(DA)(DC)(DG)(DG)(DG)(DT)(DA)(DA)(DA)(DA)(DT)(DT)(DT)(DT)(DT)(DT)
(DT)(DT)(DT)(DT)(DT)(DA)(DC)(DG)(DT)(DA)(DA)(DT)(DG)(DC)(DC)(DA)(DC)(DT)(DG)(DC)
(DC)(DG)(DG)(DA)(DA)(DC)
;
CCAAACGGGTAAAATTTTTTTTTTTACGTAATGCCACTGCCGGAAC Cr ? 
155 polydeoxyribonucleotide no no 
;(DG)(DG)(DT)(DG)(DA)(DA)(DG)(DT)(DT)(DA)(DA)(DA)(DG)(DG)(DG)(DA)(DA)(DT)(DC)(DA)
(DT)(DT)(DG)(DG)(DA)(DA)(DG)(DC)(DA)(DA)(DG)(DA)(DT)(DT)(DA)(DG)(DA)(DG)(DA)(DA)
(DT)(DC)(DA)(DA)(DC)(DA)(DG)(DT)(DT)
;
GGTGAAGTTAAAGGGAATCATTGGAAGCAAGATTAGAGAATCAACAGTT Cs ? 
156 polydeoxyribonucleotide no no 
;(DG)(DC)(DG)(DT)(DA)(DC)(DC)(DT)(DT)(DT)(DT)(DG)(DA)(DA)(DA)(DT)(DA)(DT)(DT)(DC)
(DT)(DA)(DA)(DA)(DT)(DA)(DT)(DA)(DA)(DT)(DG)(DC)(DT)(DG)(DA)(DA)(DC)(DT)(DC)(DA)
(DA)(DA)(DC)(DT)
;
GCGTACCTTTTGAAATATTCTAAATATAATGCTGAACTCAAACT Ct ? 
157 polydeoxyribonucleotide no no 
;(DA)(DA)(DC)(DA)(DT)(DA)(DC)(DA)(DG)(DT)(DA)(DT)(DA)(DA)(DA)(DA)(DA)(DT)(DC)(DG)
(DC)(DG)(DA)(DA)(DT)(DT)(DG)(DC)(DG)(DT)(DA)(DA)(DA)(DA)(DT)(DA)(DC)(DC)(DA)(DT)
(DC)(DT)(DA)(DA)(DA)(DG)(DA)(DT)(DG)(DG)(DA)(DA)(DA)(DT)(DT)(DC)(DG)(DC)(DC)(DA)
;
AACATACAGTATAAAAATCGCGAATTGCGTAAAATACCATCTAAAGATGGAAATTCGCCA Cu ? 
158 polydeoxyribonucleotide no no 
;(DT)(DA)(DA)(DT)(DT)(DT)(DT)(DG)(DC)(DT)(DT)(DC)(DT)(DG)(DT)(DG)(DA)(DA)(DT)(DA)
(DA)(DG)(DG)(DC)(DT)(DT)(DG)(DC)(DC)(DC)(DA)(DA)(DC)(DA)(DT)(DT)(DA)(DT)(DT)(DA)
(DC)(DT)(DT)(DT)(DT)(DT)
;
TAATTTTGCTTCTGTGAATAAGGCTTGCCCAACATTATTACTTTTT Cv ? 
159 polydeoxyribonucleotide no no 
;(DG)(DA)(DA)(DC)(DG)(DC)(DG)(DA)(DT)(DA)(DG)(DG)(DC)(DT)(DG)(DG)(DC)(DG)(DC)(DT)
(DA)(DT)(DT)(DA)(DG)(DG)(DA)(DA)(DC)(DC)(DG)(DA)(DA)(DT)(DT)(DC)(DG)(DC)(DC)(DT)
(DG)(DA)(DA)(DT)(DA)(DT)(DA)(DC)(DA)(DG)(DT)(DA)(DA)(DC)
;
GAACGCGATAGGCTGGCGCTATTAGGAACCGAATTCGCCTGAATATACAGTAAC Cw ? 
160 polydeoxyribonucleotide no no 
;(DA)(DA)(DT)(DT)(DT)(DC)(DA)(DA)(DC)(DA)(DG)(DT)(DT)(DT)(DC)(DT)(DT)(DT)(DT)(DT)
(DT)(DT)(DT)(DT)(DT)(DA)(DG)(DC)(DG)(DG)(DA)(DG)(DT)(DG)(DA)(DG)(DA)(DA)(DA)(DC)
(DA)(DA)(DC)(DA)(DA)(DC)
;
AATTTCAACAGTTTCTTTTTTTTTTAGCGGAGTGAGAAACAACAAC Cx ? 
161 polydeoxyribonucleotide no no 
;(DA)(DA)(DG)(DG)(DG)(DT)(DG)(DT)(DT)(DT)(DG)(DG)(DA)(DT)(DA)(DT)(DA)(DG)(DA)(DT)
(DA)(DA)(DA)(DT)(DT)(DT)(DA)(DC)(DG)(DA)(DG)(DC)(DA)(DT)(DG)(DT)(DT)(DT)(DT)(DT)
(DT)(DT)(DT)(DT)(DT)(DT)(DA)(DG)(DA)(DA)(DA)(DC)(DC)(DA)(DA)(DT)(DC)(DA)(DA)(DC)
(DG)(DG)(DG)(DT)(DA)(DT)
;
AAGGGTGTTTGGATATAGATAAATTTACGAGCATGTTTTTTTTTTTAGAAACCAATCAACGGGTAT Cy ? 
162 polydeoxyribonucleotide no no 
;(DC)(DC)(DA)(DA)(DC)(DG)(DT)(DC)(DT)(DA)(DA)(DG)(DA)(DA)(DC)(DG)(DC)(DG)(DA)(DG)
(DG)(DC)(DA)(DA)(DC)(DT)(DA)(DA)(DT)(DA)(DA)(DC)(DT)(DC)(DC)(DA)(DA)(DC)(DG)(DC)
(DG)(DA)(DA)(DC)(DG)(DA)(DC)(DA)
;
CCAACGTCTAAGAACGCGAGGCAACTAATAACTCCAACGCGAACGACA Cz ? 
# 
loop_
_entity_poly_seq.entity_id 
_entity_poly_seq.num 
_entity_poly_seq.mon_id 
_entity_poly_seq.hetero 
1   1    DT n 
1   2    DG n 
1   3    DA n 
1   4    DT n 
1   5    DA n 
1   6    DG n 
1   7    DA n 
1   8    DC n 
1   9    DG n 
1   10   DG n 
1   11   DT n 
1   12   DT n 
1   13   DT n 
1   14   DT n 
1   15   DT n 
1   16   DC n 
1   17   DG n 
1   18   DC n 
1   19   DC n 
1   20   DC n 
1   21   DT n 
1   22   DT n 
1   23   DT n 
1   24   DG n 
1   25   DA n 
1   26   DC n 
1   27   DG n 
1   28   DT n 
1   29   DT n 
1   30   DG n 
1   31   DG n 
1   32   DA n 
1   33   DG n 
1   34   DT n 
1   35   DC n 
1   36   DC n 
1   37   DA n 
1   38   DC n 
1   39   DG n 
1   40   DT n 
1   41   DT n 
1   42   DC n 
1   43   DT n 
1   44   DT n 
1   45   DT n 
1   46   DA n 
1   47   DA n 
1   48   DT n 
1   49   DA n 
1   50   DG n 
1   51   DT n 
1   52   DG n 
1   53   DG n 
1   54   DA n 
1   55   DC n 
1   56   DT n 
1   57   DC n 
1   58   DT n 
1   59   DT n 
1   60   DG n 
1   61   DT n 
1   62   DT n 
1   63   DC n 
1   64   DC n 
1   65   DA n 
1   66   DA n 
1   67   DA n 
1   68   DC n 
1   69   DT n 
1   70   DG n 
1   71   DG n 
1   72   DA n 
1   73   DA n 
1   74   DC n 
1   75   DA n 
1   76   DA n 
1   77   DC n 
1   78   DA n 
1   79   DC n 
1   80   DT n 
1   81   DC n 
1   82   DA n 
1   83   DA n 
1   84   DC n 
1   85   DC n 
1   86   DC n 
1   87   DT n 
1   88   DA n 
1   89   DT n 
1   90   DC n 
1   91   DT n 
1   92   DC n 
1   93   DG n 
1   94   DG n 
1   95   DG n 
1   96   DC n 
1   97   DT n 
1   98   DA n 
1   99   DT n 
1   100  DT n 
1   101  DC n 
1   102  DT n 
1   103  DT n 
1   104  DT n 
1   105  DT n 
1   106  DG n 
1   107  DA n 
1   108  DT n 
1   109  DT n 
1   110  DT n 
1   111  DA n 
1   112  DT n 
1   113  DA n 
1   114  DA n 
1   115  DG n 
1   116  DG n 
1   117  DG n 
1   118  DA n 
1   119  DT n 
1   120  DT n 
1   121  DT n 
1   122  DT n 
1   123  DG n 
1   124  DC n 
1   125  DC n 
1   126  DG n 
1   127  DA n 
1   128  DT n 
1   129  DT n 
1   130  DT n 
1   131  DC n 
1   132  DG n 
1   133  DG n 
1   134  DA n 
1   135  DA n 
1   136  DC n 
1   137  DC n 
1   138  DA n 
1   139  DC n 
1   140  DC n 
1   141  DA n 
1   142  DT n 
1   143  DC n 
1   144  DA n 
1   145  DA n 
1   146  DA n 
1   147  DC n 
1   148  DA n 
1   149  DG n 
1   150  DG n 
1   151  DA n 
1   152  DT n 
1   153  DT n 
1   154  DT n 
1   155  DT n 
1   156  DC n 
1   157  DG n 
1   158  DC n 
1   159  DC n 
1   160  DT n 
1   161  DG n 
1   162  DC n 
1   163  DT n 
1   164  DG n 
1   165  DG n 
1   166  DG n 
1   167  DG n 
1   168  DC n 
1   169  DA n 
1   170  DA n 
1   171  DA n 
1   172  DC n 
1   173  DC n 
1   174  DA n 
1   175  DG n 
1   176  DC n 
1   177  DG n 
1   178  DT n 
1   179  DG n 
1   180  DG n 
1   181  DA n 
1   182  DC n 
1   183  DC n 
1   184  DG n 
1   185  DC n 
1   186  DT n 
1   187  DT n 
1   188  DG n 
1   189  DC n 
1   190  DT n 
1   191  DG n 
1   192  DC n 
1   193  DA n 
1   194  DA n 
1   195  DC n 
1   196  DT n 
1   197  DC n 
1   198  DT n 
1   199  DC n 
1   200  DT n 
1   201  DC n 
1   202  DA n 
1   203  DG n 
1   204  DG n 
1   205  DG n 
1   206  DC n 
1   207  DC n 
1   208  DA n 
1   209  DG n 
1   210  DG n 
1   211  DC n 
1   212  DG n 
1   213  DG n 
1   214  DT n 
1   215  DG n 
1   216  DA n 
1   217  DA n 
1   218  DG n 
1   219  DG n 
1   220  DG n 
1   221  DC n 
1   222  DA n 
1   223  DA n 
1   224  DT n 
1   225  DC n 
1   226  DA n 
1   227  DG n 
1   228  DC n 
1   229  DT n 
1   230  DG n 
1   231  DT n 
1   232  DT n 
1   233  DG n 
1   234  DC n 
1   235  DC n 
1   236  DC n 
1   237  DG n 
1   238  DT n 
1   239  DC n 
1   240  DT n 
1   241  DC n 
1   242  DA n 
1   243  DC n 
1   244  DT n 
1   245  DG n 
1   246  DG n 
1   247  DT n 
1   248  DG n 
1   249  DA n 
1   250  DA n 
1   251  DA n 
1   252  DA n 
1   253  DG n 
1   254  DA n 
1   255  DA n 
1   256  DA n 
1   257  DA n 
1   258  DA n 
1   259  DC n 
1   260  DC n 
1   261  DA n 
1   262  DC n 
1   263  DC n 
1   264  DC n 
1   265  DT n 
1   266  DG n 
1   267  DG n 
1   268  DC n 
1   269  DG n 
1   270  DC n 
1   271  DC n 
1   272  DC n 
1   273  DA n 
1   274  DA n 
1   275  DT n 
1   276  DA n 
1   277  DC n 
1   278  DG n 
1   279  DC n 
1   280  DA n 
1   281  DA n 
1   282  DA n 
1   283  DC n 
1   284  DC n 
1   285  DG n 
1   286  DC n 
1   287  DC n 
1   288  DT n 
1   289  DC n 
1   290  DT n 
1   291  DC n 
1   292  DC n 
1   293  DC n 
1   294  DC n 
1   295  DG n 
1   296  DC n 
1   297  DG n 
1   298  DC n 
1   299  DG n 
1   300  DT n 
1   301  DT n 
1   302  DG n 
1   303  DG n 
1   304  DC n 
1   305  DC n 
1   306  DG n 
1   307  DA n 
1   308  DT n 
1   309  DT n 
1   310  DC n 
1   311  DA n 
1   312  DT n 
1   313  DT n 
1   314  DA n 
1   315  DA n 
1   316  DT n 
1   317  DG n 
1   318  DC n 
1   319  DA n 
1   320  DG n 
1   321  DC n 
1   322  DT n 
1   323  DG n 
1   324  DG n 
1   325  DC n 
1   326  DA n 
1   327  DC n 
1   328  DG n 
1   329  DA n 
1   330  DC n 
1   331  DA n 
1   332  DG n 
1   333  DG n 
1   334  DT n 
1   335  DT n 
1   336  DT n 
1   337  DC n 
1   338  DC n 
1   339  DC n 
1   340  DG n 
1   341  DA n 
1   342  DC n 
1   343  DT n 
1   344  DG n 
1   345  DG n 
1   346  DA n 
1   347  DA n 
1   348  DA n 
1   349  DG n 
1   350  DC n 
1   351  DG n 
1   352  DG n 
1   353  DG n 
1   354  DC n 
1   355  DA n 
1   356  DG n 
1   357  DT n 
1   358  DG n 
1   359  DA n 
1   360  DG n 
1   361  DC n 
1   362  DG n 
1   363  DC n 
1   364  DA n 
1   365  DA n 
1   366  DC n 
1   367  DG n 
1   368  DC n 
1   369  DA n 
1   370  DA n 
1   371  DT n 
1   372  DT n 
1   373  DA n 
1   374  DA n 
1   375  DT n 
1   376  DG n 
1   377  DT n 
1   378  DG n 
1   379  DA n 
1   380  DG n 
1   381  DT n 
1   382  DT n 
1   383  DA n 
1   384  DG n 
1   385  DC n 
1   386  DT n 
1   387  DC n 
1   388  DA n 
1   389  DC n 
1   390  DT n 
1   391  DC n 
1   392  DA n 
1   393  DT n 
1   394  DT n 
1   395  DA n 
1   396  DG n 
1   397  DG n 
1   398  DC n 
1   399  DA n 
1   400  DC n 
1   401  DC n 
1   402  DC n 
1   403  DC n 
1   404  DA n 
1   405  DG n 
1   406  DG n 
1   407  DC n 
1   408  DT n 
1   409  DT n 
1   410  DT n 
1   411  DA n 
1   412  DC n 
1   413  DA n 
1   414  DC n 
1   415  DT n 
1   416  DT n 
1   417  DT n 
1   418  DA n 
1   419  DT n 
1   420  DG n 
1   421  DC n 
1   422  DT n 
1   423  DT n 
1   424  DC n 
1   425  DC n 
1   426  DG n 
1   427  DG n 
1   428  DC n 
1   429  DT n 
1   430  DC n 
1   431  DG n 
1   432  DT n 
1   433  DA n 
1   434  DT n 
1   435  DG n 
1   436  DT n 
1   437  DT n 
1   438  DG n 
1   439  DT n 
1   440  DG n 
1   441  DT n 
1   442  DG n 
1   443  DG n 
1   444  DA n 
1   445  DA n 
1   446  DT n 
1   447  DT n 
1   448  DG n 
1   449  DT n 
1   450  DG n 
1   451  DA n 
1   452  DG n 
1   453  DC n 
1   454  DG n 
1   455  DG n 
1   456  DA n 
1   457  DT n 
1   458  DA n 
1   459  DA n 
1   460  DC n 
1   461  DA n 
1   462  DA n 
1   463  DT n 
1   464  DT n 
1   465  DT n 
1   466  DC n 
1   467  DA n 
1   468  DC n 
1   469  DA n 
1   470  DC n 
1   471  DA n 
1   472  DG n 
1   473  DG n 
1   474  DA n 
1   475  DA n 
1   476  DA n 
1   477  DC n 
1   478  DA n 
1   479  DG n 
1   480  DC n 
1   481  DT n 
1   482  DA n 
1   483  DT n 
1   484  DG n 
1   485  DA n 
1   486  DC n 
1   487  DC n 
1   488  DA n 
1   489  DT n 
1   490  DG n 
1   491  DA n 
1   492  DT n 
1   493  DT n 
1   494  DA n 
1   495  DC n 
1   496  DG n 
1   497  DA n 
1   498  DA n 
1   499  DT n 
1   500  DT n 
1   501  DC n 
1   502  DG n 
1   503  DA n 
1   504  DG n 
1   505  DC n 
1   506  DT n 
1   507  DC n 
1   508  DG n 
1   509  DG n 
1   510  DT n 
1   511  DA n 
1   512  DC n 
1   513  DC n 
1   514  DC n 
1   515  DG n 
1   516  DG n 
1   517  DG n 
1   518  DG n 
1   519  DA n 
1   520  DT n 
1   521  DC n 
1   522  DC n 
1   523  DT n 
1   524  DC n 
1   525  DT n 
1   526  DA n 
1   527  DG n 
1   528  DA n 
1   529  DG n 
1   530  DT n 
1   531  DC n 
1   532  DG n 
1   533  DA n 
1   534  DC n 
1   535  DC n 
1   536  DT n 
1   537  DG n 
1   538  DC n 
1   539  DA n 
1   540  DG n 
1   541  DG n 
1   542  DC n 
1   543  DA n 
1   544  DT n 
1   545  DG n 
1   546  DC n 
1   547  DA n 
1   548  DA n 
1   549  DG n 
1   550  DC n 
1   551  DT n 
1   552  DT n 
1   553  DG n 
1   554  DG n 
1   555  DC n 
1   556  DA n 
1   557  DC n 
1   558  DT n 
1   559  DG n 
1   560  DG n 
1   561  DC n 
1   562  DC n 
1   563  DG n 
1   564  DT n 
1   565  DC n 
1   566  DG n 
1   567  DT n 
1   568  DT n 
1   569  DT n 
1   570  DT n 
1   571  DA n 
1   572  DC n 
1   573  DA n 
1   574  DA n 
1   575  DC n 
1   576  DG n 
1   577  DT n 
1   578  DC n 
1   579  DG n 
1   580  DT n 
1   581  DG n 
1   582  DA n 
1   583  DC n 
1   584  DT n 
1   585  DG n 
1   586  DG n 
1   587  DG n 
1   588  DA n 
1   589  DA n 
1   590  DA n 
1   591  DA n 
1   592  DC n 
1   593  DC n 
1   594  DC n 
1   595  DT n 
1   596  DG n 
1   597  DG n 
1   598  DC n 
1   599  DG n 
1   600  DT n 
1   601  DT n 
1   602  DA n 
1   603  DC n 
1   604  DC n 
1   605  DC n 
1   606  DA n 
1   607  DA n 
1   608  DC n 
1   609  DT n 
1   610  DT n 
1   611  DA n 
1   612  DA n 
1   613  DT n 
1   614  DC n 
1   615  DG n 
1   616  DC n 
1   617  DC n 
1   618  DT n 
1   619  DT n 
1   620  DG n 
1   621  DC n 
1   622  DA n 
1   623  DG n 
1   624  DC n 
1   625  DA n 
1   626  DC n 
1   627  DA n 
1   628  DT n 
1   629  DC n 
1   630  DC n 
1   631  DC n 
1   632  DC n 
1   633  DC n 
1   634  DT n 
1   635  DT n 
1   636  DT n 
1   637  DC n 
1   638  DG n 
1   639  DC n 
1   640  DC n 
1   641  DA n 
1   642  DG n 
1   643  DC n 
1   644  DT n 
1   645  DG n 
1   646  DG n 
1   647  DC n 
1   648  DG n 
1   649  DT n 
1   650  DA n 
1   651  DA n 
1   652  DT n 
1   653  DA n 
1   654  DG n 
1   655  DC n 
1   656  DG n 
1   657  DA n 
1   658  DA n 
1   659  DG n 
1   660  DA n 
1   661  DG n 
1   662  DG n 
1   663  DC n 
1   664  DC n 
1   665  DC n 
1   666  DG n 
1   667  DC n 
1   668  DA n 
1   669  DC n 
1   670  DC n 
1   671  DG n 
1   672  DA n 
1   673  DT n 
1   674  DC n 
1   675  DG n 
1   676  DC n 
1   677  DC n 
1   678  DC n 
1   679  DT n 
1   680  DT n 
1   681  DC n 
1   682  DC n 
1   683  DC n 
1   684  DA n 
1   685  DA n 
1   686  DC n 
1   687  DA n 
1   688  DG n 
1   689  DT n 
1   690  DT n 
1   691  DG n 
1   692  DC n 
1   693  DG n 
1   694  DC n 
1   695  DA n 
1   696  DG n 
1   697  DC n 
1   698  DC n 
1   699  DT n 
1   700  DG n 
1   701  DA n 
1   702  DA n 
1   703  DT n 
1   704  DG n 
1   705  DG n 
1   706  DC n 
1   707  DG n 
1   708  DA n 
1   709  DA n 
1   710  DT n 
1   711  DG n 
1   712  DG n 
1   713  DC n 
1   714  DG n 
1   715  DC n 
1   716  DT n 
1   717  DT n 
1   718  DT n 
1   719  DG n 
1   720  DC n 
1   721  DC n 
1   722  DT n 
1   723  DG n 
1   724  DG n 
1   725  DT n 
1   726  DT n 
1   727  DT n 
1   728  DC n 
1   729  DC n 
1   730  DG n 
1   731  DG n 
1   732  DC n 
1   733  DA n 
1   734  DC n 
1   735  DC n 
1   736  DA n 
1   737  DG n 
1   738  DA n 
1   739  DA n 
1   740  DG n 
1   741  DC n 
1   742  DG n 
1   743  DG n 
1   744  DT n 
1   745  DG n 
1   746  DC n 
1   747  DC n 
1   748  DG n 
1   749  DG n 
1   750  DA n 
1   751  DA n 
1   752  DA n 
1   753  DG n 
1   754  DC n 
1   755  DT n 
1   756  DG n 
1   757  DG n 
1   758  DC n 
1   759  DT n 
1   760  DG n 
1   761  DG n 
1   762  DA n 
1   763  DG n 
1   764  DT n 
1   765  DG n 
1   766  DC n 
1   767  DG n 
1   768  DA n 
1   769  DT n 
1   770  DC n 
1   771  DT n 
1   772  DT n 
1   773  DC n 
1   774  DC n 
1   775  DT n 
1   776  DG n 
1   777  DA n 
1   778  DG n 
1   779  DG n 
1   780  DC n 
1   781  DC n 
1   782  DG n 
1   783  DA n 
1   784  DT n 
1   785  DA n 
1   786  DC n 
1   787  DT n 
1   788  DG n 
1   789  DT n 
1   790  DC n 
1   791  DG n 
1   792  DT n 
1   793  DC n 
1   794  DG n 
1   795  DT n 
1   796  DC n 
1   797  DC n 
1   798  DC n 
1   799  DC n 
1   800  DT n 
1   801  DC n 
1   802  DA n 
1   803  DA n 
1   804  DA n 
1   805  DC n 
1   806  DT n 
1   807  DG n 
1   808  DG n 
1   809  DC n 
1   810  DA n 
1   811  DG n 
1   812  DA n 
1   813  DT n 
1   814  DG n 
1   815  DC n 
1   816  DA n 
1   817  DC n 
1   818  DG n 
1   819  DG n 
1   820  DT n 
1   821  DT n 
1   822  DA n 
1   823  DC n 
1   824  DG n 
1   825  DA n 
1   826  DT n 
1   827  DG n 
1   828  DC n 
1   829  DG n 
1   830  DC n 
1   831  DC n 
1   832  DC n 
1   833  DA n 
1   834  DT n 
1   835  DC n 
1   836  DT n 
1   837  DA n 
1   838  DC n 
1   839  DA n 
1   840  DC n 
1   841  DC n 
1   842  DA n 
1   843  DA n 
1   844  DC n 
1   845  DG n 
1   846  DT n 
1   847  DG n 
1   848  DA n 
1   849  DC n 
1   850  DC n 
1   851  DT n 
1   852  DA n 
1   853  DT n 
1   854  DC n 
1   855  DC n 
1   856  DC n 
1   857  DA n 
1   858  DT n 
1   859  DT n 
1   860  DA n 
1   861  DC n 
1   862  DG n 
1   863  DG n 
1   864  DT n 
1   865  DC n 
1   866  DA n 
1   867  DA n 
1   868  DT n 
1   869  DC n 
1   870  DC n 
1   871  DG n 
1   872  DC n 
1   873  DC n 
1   874  DG n 
1   875  DT n 
1   876  DT n 
1   877  DT n 
1   878  DG n 
1   879  DT n 
1   880  DT n 
1   881  DC n 
1   882  DC n 
1   883  DC n 
1   884  DA n 
1   885  DC n 
1   886  DG n 
1   887  DG n 
1   888  DA n 
1   889  DG n 
1   890  DA n 
1   891  DA n 
1   892  DT n 
1   893  DC n 
1   894  DC n 
1   895  DG n 
1   896  DA n 
1   897  DC n 
1   898  DG n 
1   899  DG n 
1   900  DG n 
1   901  DT n 
1   902  DT n 
1   903  DG n 
1   904  DT n 
1   905  DT n 
1   906  DA n 
1   907  DC n 
1   908  DT n 
1   909  DC n 
1   910  DG n 
1   911  DC n 
1   912  DT n 
1   913  DC n 
1   914  DA n 
1   915  DC n 
1   916  DA n 
1   917  DT n 
1   918  DT n 
1   919  DT n 
1   920  DA n 
1   921  DA n 
1   922  DT n 
1   923  DG n 
1   924  DT n 
1   925  DT n 
1   926  DG n 
1   927  DA n 
1   928  DT n 
1   929  DG n 
1   930  DA n 
1   931  DA n 
1   932  DA n 
1   933  DG n 
1   934  DC n 
1   935  DT n 
1   936  DG n 
1   937  DG n 
1   938  DC n 
1   939  DT n 
1   940  DA n 
1   941  DC n 
1   942  DA n 
1   943  DG n 
1   944  DG n 
1   945  DA n 
1   946  DA n 
1   947  DG n 
1   948  DG n 
1   949  DC n 
1   950  DC n 
1   951  DA n 
1   952  DG n 
1   953  DA n 
1   954  DC n 
1   955  DG n 
1   956  DC n 
1   957  DG n 
1   958  DA n 
1   959  DA n 
1   960  DT n 
1   961  DT n 
1   962  DA n 
1   963  DT n 
1   964  DT n 
1   965  DT n 
1   966  DT n 
1   967  DT n 
1   968  DG n 
1   969  DA n 
1   970  DT n 
1   971  DG n 
1   972  DG n 
1   973  DC n 
1   974  DG n 
1   975  DT n 
1   976  DT n 
1   977  DC n 
1   978  DC n 
1   979  DT n 
1   980  DA n 
1   981  DT n 
1   982  DT n 
1   983  DG n 
1   984  DG n 
1   985  DT n 
1   986  DT n 
1   987  DA n 
1   988  DA n 
1   989  DA n 
1   990  DA n 
1   991  DA n 
1   992  DA n 
1   993  DT n 
1   994  DG n 
1   995  DA n 
1   996  DG n 
1   997  DC n 
1   998  DT n 
1   999  DG n 
1   1000 DA n 
1   1001 DT n 
1   1002 DT n 
1   1003 DT n 
1   1004 DA n 
1   1005 DA n 
1   1006 DC n 
1   1007 DA n 
1   1008 DA n 
1   1009 DA n 
1   1010 DA n 
1   1011 DA n 
1   1012 DT n 
1   1013 DT n 
1   1014 DT n 
1   1015 DA n 
1   1016 DA n 
1   1017 DT n 
1   1018 DG n 
1   1019 DC n 
1   1020 DG n 
1   1021 DA n 
1   1022 DA n 
1   1023 DT n 
1   1024 DT n 
1   1025 DT n 
1   1026 DT n 
1   1027 DA n 
1   1028 DA n 
1   1029 DC n 
1   1030 DA n 
1   1031 DA n 
1   1032 DA n 
1   1033 DA n 
1   1034 DT n 
1   1035 DA n 
1   1036 DT n 
1   1037 DT n 
1   1038 DA n 
1   1039 DA n 
1   1040 DC n 
1   1041 DG n 
1   1042 DT n 
1   1043 DT n 
1   1044 DT n 
1   1045 DA n 
1   1046 DC n 
1   1047 DA n 
1   1048 DA n 
1   1049 DT n 
1   1050 DT n 
1   1051 DT n 
1   1052 DA n 
1   1053 DA n 
1   1054 DA n 
1   1055 DT n 
1   1056 DA n 
1   1057 DT n 
1   1058 DT n 
1   1059 DT n 
1   1060 DG n 
1   1061 DC n 
1   1062 DT n 
1   1063 DT n 
1   1064 DA n 
1   1065 DT n 
1   1066 DA n 
1   1067 DC n 
1   1068 DA n 
1   1069 DA n 
1   1070 DT n 
1   1071 DC n 
1   1072 DT n 
1   1073 DT n 
1   1074 DC n 
1   1075 DC n 
1   1076 DT n 
1   1077 DG n 
1   1078 DT n 
1   1079 DT n 
1   1080 DT n 
1   1081 DT n 
1   1082 DT n 
1   1083 DG n 
1   1084 DG n 
1   1085 DG n 
1   1086 DG n 
1   1087 DC n 
1   1088 DT n 
1   1089 DT n 
1   1090 DT n 
1   1091 DT n 
1   1092 DC n 
1   1093 DT n 
1   1094 DG n 
1   1095 DA n 
1   1096 DT n 
1   1097 DT n 
1   1098 DA n 
1   1099 DT n 
1   1100 DC n 
1   1101 DA n 
1   1102 DA n 
1   1103 DC n 
1   1104 DC n 
1   1105 DG n 
1   1106 DG n 
1   1107 DG n 
1   1108 DG n 
1   1109 DT n 
1   1110 DA n 
1   1111 DC n 
1   1112 DA n 
1   1113 DT n 
1   1114 DA n 
1   1115 DT n 
1   1116 DG n 
1   1117 DA n 
1   1118 DT n 
1   1119 DT n 
1   1120 DG n 
1   1121 DA n 
1   1122 DC n 
1   1123 DA n 
1   1124 DT n 
1   1125 DG n 
1   1126 DC n 
1   1127 DT n 
1   1128 DA n 
1   1129 DG n 
1   1130 DT n 
1   1131 DT n 
1   1132 DT n 
1   1133 DT n 
1   1134 DA n 
1   1135 DC n 
1   1136 DG n 
1   1137 DA n 
1   1138 DT n 
1   1139 DT n 
1   1140 DA n 
1   1141 DC n 
1   1142 DC n 
1   1143 DG n 
1   1144 DT n 
1   1145 DT n 
1   1146 DC n 
1   1147 DA n 
1   1148 DT n 
1   1149 DC n 
1   1150 DG n 
1   1151 DA n 
1   1152 DT n 
1   1153 DT n 
1   1154 DC n 
1   1155 DT n 
1   1156 DC n 
1   1157 DT n 
1   1158 DT n 
1   1159 DG n 
1   1160 DT n 
1   1161 DT n 
1   1162 DT n 
1   1163 DG n 
1   1164 DC n 
1   1165 DT n 
1   1166 DC n 
1   1167 DC n 
1   1168 DA n 
1   1169 DG n 
1   1170 DA n 
1   1171 DC n 
1   1172 DT n 
1   1173 DC n 
1   1174 DT n 
1   1175 DC n 
1   1176 DA n 
1   1177 DG n 
1   1178 DG n 
1   1179 DC n 
1   1180 DA n 
1   1181 DA n 
1   1182 DT n 
1   1183 DG n 
1   1184 DA n 
1   1185 DC n 
1   1186 DC n 
1   1187 DT n 
1   1188 DG n 
1   1189 DA n 
1   1190 DT n 
1   1191 DA n 
1   1192 DG n 
1   1193 DC n 
1   1194 DC n 
1   1195 DT n 
1   1196 DT n 
1   1197 DT n 
1   1198 DG n 
1   1199 DT n 
1   1200 DA n 
1   1201 DG n 
1   1202 DA n 
1   1203 DT n 
1   1204 DC n 
1   1205 DT n 
1   1206 DC n 
1   1207 DT n 
1   1208 DC n 
1   1209 DA n 
1   1210 DA n 
1   1211 DA n 
1   1212 DA n 
1   1213 DA n 
1   1214 DT n 
1   1215 DA n 
1   1216 DG n 
1   1217 DC n 
1   1218 DT n 
1   1219 DA n 
1   1220 DC n 
1   1221 DC n 
1   1222 DC n 
1   1223 DT n 
1   1224 DC n 
1   1225 DT n 
1   1226 DC n 
1   1227 DC n 
1   1228 DG n 
1   1229 DG n 
1   1230 DC n 
1   1231 DA n 
1   1232 DT n 
1   1233 DT n 
1   1234 DA n 
1   1235 DA n 
1   1236 DT n 
1   1237 DT n 
1   1238 DT n 
1   1239 DA n 
1   1240 DT n 
1   1241 DC n 
1   1242 DA n 
1   1243 DG n 
1   1244 DC n 
1   1245 DT n 
1   1246 DA n 
1   1247 DG n 
1   1248 DA n 
1   1249 DA n 
1   1250 DC n 
1   1251 DG n 
1   1252 DG n 
1   1253 DT n 
1   1254 DT n 
1   1255 DG n 
1   1256 DA n 
1   1257 DA n 
1   1258 DT n 
1   1259 DA n 
1   1260 DT n 
1   1261 DC n 
1   1262 DA n 
1   1263 DT n 
1   1264 DA n 
1   1265 DT n 
1   1266 DT n 
1   1267 DG n 
1   1268 DA n 
1   1269 DT n 
1   1270 DG n 
1   1271 DG n 
1   1272 DT n 
1   1273 DG n 
1   1274 DA n 
1   1275 DT n 
1   1276 DT n 
1   1277 DT n 
1   1278 DG n 
1   1279 DA n 
1   1280 DC n 
1   1281 DT n 
1   1282 DG n 
1   1283 DT n 
1   1284 DC n 
1   1285 DT n 
1   1286 DC n 
1   1287 DC n 
1   1288 DG n 
1   1289 DG n 
1   1290 DC n 
1   1291 DC n 
1   1292 DT n 
1   1293 DT n 
1   1294 DT n 
1   1295 DC n 
1   1296 DT n 
1   1297 DC n 
1   1298 DA n 
1   1299 DC n 
1   1300 DC n 
1   1301 DC n 
1   1302 DT n 
1   1303 DT n 
1   1304 DT n 
1   1305 DT n 
1   1306 DG n 
1   1307 DA n 
1   1308 DA n 
1   1309 DT n 
1   1310 DC n 
1   1311 DT n 
1   1312 DT n 
1   1313 DT n 
1   1314 DA n 
1   1315 DC n 
1   1316 DC n 
1   1317 DT n 
1   1318 DA n 
1   1319 DC n 
1   1320 DA n 
1   1321 DC n 
1   1322 DA n 
1   1323 DT n 
1   1324 DT n 
1   1325 DA n 
1   1326 DC n 
1   1327 DT n 
1   1328 DC n 
1   1329 DA n 
1   1330 DG n 
1   1331 DG n 
1   1332 DC n 
1   1333 DA n 
1   1334 DT n 
1   1335 DT n 
1   1336 DG n 
1   1337 DC n 
1   1338 DA n 
1   1339 DT n 
1   1340 DT n 
1   1341 DT n 
1   1342 DA n 
1   1343 DA n 
1   1344 DA n 
1   1345 DA n 
1   1346 DT n 
1   1347 DA n 
1   1348 DT n 
1   1349 DA n 
1   1350 DT n 
1   1351 DG n 
1   1352 DA n 
1   1353 DG n 
1   1354 DG n 
1   1355 DG n 
1   1356 DT n 
1   1357 DT n 
1   1358 DC n 
1   1359 DT n 
1   1360 DA n 
1   1361 DA n 
1   1362 DA n 
1   1363 DA n 
1   1364 DA n 
1   1365 DT n 
1   1366 DT n 
1   1367 DT n 
1   1368 DT n 
1   1369 DT n 
1   1370 DA n 
1   1371 DT n 
1   1372 DC n 
1   1373 DC n 
1   1374 DT n 
1   1375 DT n 
1   1376 DG n 
1   1377 DC n 
1   1378 DG n 
1   1379 DT n 
1   1380 DT n 
1   1381 DG n 
1   1382 DA n 
1   1383 DA n 
1   1384 DA n 
1   1385 DT n 
1   1386 DA n 
1   1387 DA n 
1   1388 DA n 
1   1389 DG n 
1   1390 DG n 
1   1391 DC n 
1   1392 DT n 
1   1393 DT n 
1   1394 DC n 
1   1395 DT n 
1   1396 DC n 
1   1397 DC n 
1   1398 DC n 
1   1399 DG n 
1   1400 DC n 
1   1401 DA n 
1   1402 DA n 
1   1403 DA n 
1   1404 DA n 
1   1405 DG n 
1   1406 DT n 
1   1407 DA n 
1   1408 DT n 
1   1409 DT n 
1   1410 DA n 
1   1411 DC n 
1   1412 DA n 
1   1413 DG n 
1   1414 DG n 
1   1415 DG n 
1   1416 DT n 
1   1417 DC n 
1   1418 DA n 
1   1419 DT n 
1   1420 DA n 
1   1421 DA n 
1   1422 DT n 
1   1423 DG n 
1   1424 DT n 
1   1425 DT n 
1   1426 DT n 
1   1427 DT n 
1   1428 DT n 
1   1429 DG n 
1   1430 DG n 
1   1431 DT n 
1   1432 DA n 
1   1433 DC n 
1   1434 DA n 
1   1435 DA n 
1   1436 DC n 
1   1437 DC n 
1   1438 DG n 
1   1439 DA n 
1   1440 DT n 
1   1441 DT n 
1   1442 DT n 
1   1443 DA n 
1   1444 DG n 
1   1445 DC n 
1   1446 DT n 
1   1447 DT n 
1   1448 DT n 
1   1449 DA n 
1   1450 DT n 
1   1451 DG n 
1   1452 DC n 
1   1453 DT n 
1   1454 DC n 
1   1455 DT n 
1   1456 DG n 
1   1457 DA n 
1   1458 DG n 
1   1459 DG n 
1   1460 DC n 
1   1461 DT n 
1   1462 DT n 
1   1463 DT n 
1   1464 DA n 
1   1465 DT n 
1   1466 DT n 
1   1467 DG n 
1   1468 DC n 
1   1469 DT n 
1   1470 DT n 
1   1471 DA n 
1   1472 DA n 
1   1473 DT n 
1   1474 DT n 
1   1475 DT n 
1   1476 DT n 
1   1477 DG n 
1   1478 DC n 
1   1479 DT n 
1   1480 DA n 
1   1481 DA n 
1   1482 DT n 
1   1483 DT n 
1   1484 DC n 
1   1485 DT n 
1   1486 DT n 
1   1487 DT n 
1   1488 DG n 
1   1489 DC n 
1   1490 DC n 
1   1491 DT n 
1   1492 DT n 
1   1493 DG n 
1   1494 DC n 
1   1495 DC n 
1   1496 DT n 
1   1497 DG n 
1   1498 DT n 
1   1499 DA n 
1   1500 DT n 
1   1501 DG n 
1   1502 DA n 
1   1503 DT n 
1   1504 DT n 
1   1505 DT n 
1   1506 DA n 
1   1507 DT n 
1   1508 DT n 
1   1509 DG n 
1   1510 DG n 
1   1511 DA n 
1   1512 DT n 
1   1513 DG n 
1   1514 DT n 
1   1515 DT n 
1   1516 DA n 
1   1517 DA n 
1   1518 DT n 
1   1519 DG n 
1   1520 DC n 
1   1521 DT n 
1   1522 DA n 
1   1523 DC n 
1   1524 DT n 
1   1525 DA n 
1   1526 DC n 
1   1527 DT n 
1   1528 DA n 
1   1529 DT n 
1   1530 DT n 
1   1531 DA n 
1   1532 DG n 
1   1533 DT n 
1   1534 DA n 
1   1535 DG n 
1   1536 DA n 
1   1537 DA n 
1   1538 DT n 
1   1539 DT n 
1   1540 DG n 
1   1541 DA n 
1   1542 DT n 
1   1543 DG n 
1   1544 DC n 
1   1545 DC n 
1   1546 DA n 
1   1547 DC n 
1   1548 DC n 
1   1549 DT n 
1   1550 DT n 
1   1551 DT n 
1   1552 DT n 
1   1553 DC n 
1   1554 DA n 
1   1555 DG n 
1   1556 DC n 
1   1557 DT n 
1   1558 DC n 
1   1559 DG n 
1   1560 DC n 
1   1561 DG n 
1   1562 DC n 
1   1563 DC n 
1   1564 DC n 
1   1565 DC n 
1   1566 DA n 
1   1567 DA n 
1   1568 DA n 
1   1569 DT n 
1   1570 DG n 
1   1571 DA n 
1   1572 DA n 
1   1573 DA n 
1   1574 DA n 
1   1575 DT n 
1   1576 DA n 
1   1577 DT n 
1   1578 DA n 
1   1579 DG n 
1   1580 DC n 
1   1581 DT n 
1   1582 DA n 
1   1583 DA n 
1   1584 DA n 
1   1585 DC n 
1   1586 DA n 
1   1587 DG n 
1   1588 DG n 
1   1589 DT n 
1   1590 DT n 
1   1591 DA n 
1   1592 DT n 
1   1593 DT n 
1   1594 DG n 
1   1595 DA n 
1   1596 DC n 
1   1597 DC n 
1   1598 DA n 
1   1599 DT n 
1   1600 DT n 
1   1601 DT n 
1   1602 DG n 
1   1603 DC n 
1   1604 DG n 
1   1605 DA n 
1   1606 DA n 
1   1607 DA n 
1   1608 DT n 
1   1609 DG n 
1   1610 DT n 
1   1611 DA n 
1   1612 DT n 
1   1613 DC n 
1   1614 DT n 
1   1615 DA n 
1   1616 DA n 
1   1617 DT n 
1   1618 DG n 
1   1619 DG n 
1   1620 DT n 
1   1621 DC n 
1   1622 DA n 
1   1623 DA n 
1   1624 DA n 
1   1625 DC n 
1   1626 DT n 
1   1627 DA n 
1   1628 DA n 
1   1629 DA n 
1   1630 DT n 
1   1631 DC n 
1   1632 DT n 
1   1633 DA n 
1   1634 DC n 
1   1635 DT n 
1   1636 DC n 
1   1637 DG n 
1   1638 DT n 
1   1639 DT n 
1   1640 DC n 
1   1641 DG n 
1   1642 DC n 
1   1643 DA n 
1   1644 DG n 
1   1645 DA n 
1   1646 DA n 
1   1647 DT n 
1   1648 DT n 
1   1649 DG n 
1   1650 DG n 
1   1651 DG n 
1   1652 DA n 
1   1653 DA n 
1   1654 DT n 
1   1655 DC n 
1   1656 DA n 
1   1657 DA n 
1   1658 DC n 
1   1659 DT n 
1   1660 DG n 
1   1661 DT n 
1   1662 DT n 
1   1663 DA n 
1   1664 DT n 
1   1665 DA n 
1   1666 DT n 
1   1667 DG n 
1   1668 DG n 
1   1669 DA n 
1   1670 DA n 
1   1671 DT n 
1   1672 DG n 
1   1673 DA n 
1   1674 DA n 
1   1675 DA n 
1   1676 DC n 
1   1677 DT n 
1   1678 DT n 
1   1679 DC n 
1   1680 DC n 
1   1681 DA n 
1   1682 DG n 
1   1683 DA n 
1   1684 DC n 
1   1685 DA n 
1   1686 DC n 
1   1687 DC n 
1   1688 DG n 
1   1689 DT n 
1   1690 DA n 
1   1691 DC n 
1   1692 DT n 
1   1693 DT n 
1   1694 DT n 
1   1695 DA n 
1   1696 DG n 
1   1697 DT n 
1   1698 DT n 
1   1699 DG n 
1   1700 DC n 
1   1701 DA n 
1   1702 DT n 
1   1703 DA n 
1   1704 DT n 
1   1705 DT n 
1   1706 DT n 
1   1707 DA n 
1   1708 DA n 
1   1709 DA n 
1   1710 DA n 
1   1711 DC n 
1   1712 DA n 
1   1713 DT n 
1   1714 DG n 
1   1715 DT n 
1   1716 DT n 
1   1717 DG n 
1   1718 DA n 
1   1719 DG n 
1   1720 DC n 
1   1721 DT n 
1   1722 DA n 
1   1723 DC n 
1   1724 DA n 
1   1725 DG n 
1   1726 DC n 
1   1727 DA n 
1   1728 DT n 
1   1729 DT n 
1   1730 DA n 
1   1731 DT n 
1   1732 DA n 
1   1733 DT n 
1   1734 DT n 
1   1735 DC n 
1   1736 DA n 
1   1737 DG n 
1   1738 DC n 
1   1739 DA n 
1   1740 DA n 
1   1741 DT n 
1   1742 DT n 
1   1743 DA n 
1   1744 DA n 
1   1745 DG n 
1   1746 DC n 
1   1747 DT n 
1   1748 DC n 
1   1749 DT n 
1   1750 DA n 
1   1751 DA n 
1   1752 DG n 
1   1753 DC n 
1   1754 DC n 
1   1755 DA n 
1   1756 DT n 
1   1757 DC n 
1   1758 DC n 
1   1759 DG n 
1   1760 DC n 
1   1761 DA n 
1   1762 DA n 
1   1763 DA n 
1   1764 DA n 
1   1765 DA n 
1   1766 DT n 
1   1767 DG n 
1   1768 DA n 
1   1769 DC n 
1   1770 DC n 
1   1771 DT n 
1   1772 DC n 
1   1773 DT n 
1   1774 DT n 
1   1775 DA n 
1   1776 DT n 
1   1777 DC n 
1   1778 DA n 
1   1779 DA n 
1   1780 DA n 
1   1781 DA n 
1   1782 DG n 
1   1783 DG n 
1   1784 DA n 
1   1785 DG n 
1   1786 DC n 
1   1787 DA n 
1   1788 DA n 
1   1789 DT n 
1   1790 DT n 
1   1791 DA n 
1   1792 DA n 
1   1793 DA n 
1   1794 DG n 
1   1795 DG n 
1   1796 DT n 
1   1797 DA n 
1   1798 DC n 
1   1799 DT n 
1   1800 DC n 
1   1801 DT n 
1   1802 DC n 
1   1803 DT n 
1   1804 DA n 
1   1805 DA n 
1   1806 DT n 
1   1807 DC n 
1   1808 DC n 
1   1809 DT n 
1   1810 DG n 
1   1811 DA n 
1   1812 DC n 
1   1813 DC n 
1   1814 DT n 
1   1815 DG n 
1   1816 DT n 
1   1817 DT n 
1   1818 DG n 
1   1819 DG n 
1   1820 DA n 
1   1821 DG n 
1   1822 DT n 
1   1823 DT n 
1   1824 DT n 
1   1825 DG n 
1   1826 DC n 
1   1827 DT n 
1   1828 DT n 
1   1829 DC n 
1   1830 DC n 
1   1831 DG n 
1   1832 DG n 
1   1833 DT n 
1   1834 DC n 
1   1835 DT n 
1   1836 DG n 
1   1837 DG n 
1   1838 DT n 
1   1839 DT n 
1   1840 DC n 
1   1841 DG n 
1   1842 DC n 
1   1843 DT n 
1   1844 DT n 
1   1845 DT n 
1   1846 DG n 
1   1847 DA n 
1   1848 DA n 
1   1849 DG n 
1   1850 DC n 
1   1851 DT n 
1   1852 DC n 
1   1853 DG n 
1   1854 DA n 
1   1855 DA n 
1   1856 DT n 
1   1857 DT n 
1   1858 DA n 
1   1859 DA n 
1   1860 DA n 
1   1861 DA n 
1   1862 DC n 
1   1863 DG n 
1   1864 DC n 
1   1865 DG n 
1   1866 DA n 
1   1867 DT n 
1   1868 DA n 
1   1869 DT n 
1   1870 DT n 
1   1871 DT n 
1   1872 DG n 
1   1873 DA n 
1   1874 DA n 
1   1875 DG n 
1   1876 DT n 
1   1877 DC n 
1   1878 DT n 
1   1879 DT n 
1   1880 DT n 
1   1881 DC n 
1   1882 DG n 
1   1883 DG n 
1   1884 DG n 
1   1885 DC n 
1   1886 DT n 
1   1887 DT n 
1   1888 DC n 
1   1889 DC n 
1   1890 DT n 
1   1891 DC n 
1   1892 DT n 
1   1893 DT n 
1   1894 DA n 
1   1895 DA n 
1   1896 DT n 
1   1897 DC n 
1   1898 DT n 
1   1899 DT n 
1   1900 DT n 
1   1901 DT n 
1   1902 DT n 
1   1903 DG n 
1   1904 DA n 
1   1905 DT n 
1   1906 DG n 
1   1907 DC n 
1   1908 DA n 
1   1909 DA n 
1   1910 DT n 
1   1911 DC n 
1   1912 DC n 
1   1913 DG n 
1   1914 DC n 
1   1915 DT n 
1   1916 DT n 
1   1917 DT n 
1   1918 DG n 
1   1919 DC n 
1   1920 DT n 
1   1921 DT n 
1   1922 DC n 
1   1923 DT n 
1   1924 DG n 
1   1925 DA n 
1   1926 DC n 
1   1927 DT n 
1   1928 DA n 
1   1929 DT n 
1   1930 DA n 
1   1931 DA n 
1   1932 DT n 
1   1933 DA n 
1   1934 DG n 
1   1935 DT n 
1   1936 DC n 
1   1937 DA n 
1   1938 DG n 
1   1939 DG n 
1   1940 DG n 
1   1941 DT n 
1   1942 DA n 
1   1943 DA n 
1   1944 DA n 
1   1945 DG n 
1   1946 DA n 
1   1947 DC n 
1   1948 DC n 
1   1949 DT n 
1   1950 DG n 
1   1951 DA n 
1   1952 DT n 
1   1953 DT n 
1   1954 DT n 
1   1955 DT n 
1   1956 DT n 
1   1957 DG n 
1   1958 DA n 
1   1959 DT n 
1   1960 DT n 
1   1961 DT n 
1   1962 DA n 
1   1963 DT n 
1   1964 DG n 
1   1965 DG n 
1   1966 DT n 
1   1967 DC n 
1   1968 DA n 
1   1969 DT n 
1   1970 DT n 
1   1971 DC n 
1   1972 DT n 
1   1973 DC n 
1   1974 DG n 
1   1975 DT n 
1   1976 DT n 
1   1977 DT n 
1   1978 DT n 
1   1979 DC n 
1   1980 DT n 
1   1981 DG n 
1   1982 DA n 
1   1983 DA n 
1   1984 DC n 
1   1985 DT n 
1   1986 DG n 
1   1987 DT n 
1   1988 DT n 
1   1989 DT n 
1   1990 DA n 
1   1991 DA n 
1   1992 DA n 
1   1993 DG n 
1   1994 DC n 
1   1995 DA n 
1   1996 DT n 
1   1997 DT n 
1   1998 DT n 
1   1999 DG n 
1   2000 DA n 
1   2001 DG n 
1   2002 DG n 
1   2003 DG n 
1   2004 DG n 
1   2005 DG n 
1   2006 DA n 
1   2007 DT n 
1   2008 DT n 
1   2009 DC n 
1   2010 DA n 
1   2011 DA n 
1   2012 DT n 
1   2013 DG n 
1   2014 DA n 
1   2015 DA n 
1   2016 DT n 
1   2017 DA n 
1   2018 DT n 
1   2019 DT n 
1   2020 DT n 
1   2021 DA n 
1   2022 DT n 
1   2023 DG n 
1   2024 DA n 
1   2025 DC n 
1   2026 DG n 
1   2027 DA n 
1   2028 DT n 
1   2029 DT n 
1   2030 DC n 
1   2031 DC n 
1   2032 DG n 
1   2033 DC n 
1   2034 DA n 
1   2035 DG n 
1   2036 DT n 
1   2037 DA n 
1   2038 DT n 
1   2039 DT n 
1   2040 DG n 
1   2041 DG n 
1   2042 DA n 
1   2043 DC n 
1   2044 DG n 
1   2045 DC n 
1   2046 DT n 
1   2047 DA n 
1   2048 DT n 
1   2049 DC n 
1   2050 DC n 
1   2051 DA n 
1   2052 DG n 
1   2053 DT n 
1   2054 DC n 
1   2055 DT n 
1   2056 DA n 
1   2057 DA n 
1   2058 DA n 
1   2059 DC n 
1   2060 DA n 
1   2061 DT n 
1   2062 DT n 
1   2063 DT n 
1   2064 DT n 
1   2065 DA n 
1   2066 DC n 
1   2067 DT n 
1   2068 DA n 
1   2069 DT n 
1   2070 DT n 
1   2071 DA n 
1   2072 DC n 
1   2073 DC n 
1   2074 DC n 
1   2075 DC n 
1   2076 DC n 
1   2077 DT n 
1   2078 DC n 
1   2079 DT n 
1   2080 DG n 
1   2081 DG n 
1   2082 DC n 
1   2083 DA n 
1   2084 DA n 
1   2085 DA n 
1   2086 DA n 
1   2087 DC n 
1   2088 DT n 
1   2089 DT n 
1   2090 DC n 
1   2091 DT n 
1   2092 DT n 
1   2093 DT n 
1   2094 DT n 
1   2095 DG n 
1   2096 DC n 
1   2097 DA n 
1   2098 DA n 
1   2099 DA n 
1   2100 DA n 
1   2101 DG n 
1   2102 DC n 
1   2103 DC n 
1   2104 DT n 
1   2105 DC n 
1   2106 DT n 
1   2107 DC n 
1   2108 DG n 
1   2109 DC n 
1   2110 DT n 
1   2111 DA n 
1   2112 DT n 
1   2113 DT n 
1   2114 DT n 
1   2115 DT n 
1   2116 DG n 
1   2117 DG n 
1   2118 DT n 
1   2119 DT n 
1   2120 DT n 
1   2121 DT n 
1   2122 DT n 
1   2123 DA n 
1   2124 DT n 
1   2125 DC n 
1   2126 DG n 
1   2127 DT n 
1   2128 DC n 
1   2129 DG n 
1   2130 DT n 
1   2131 DC n 
1   2132 DT n 
1   2133 DG n 
1   2134 DG n 
1   2135 DT n 
1   2136 DA n 
1   2137 DA n 
1   2138 DA n 
1   2139 DC n 
1   2140 DG n 
1   2141 DA n 
1   2142 DG n 
1   2143 DG n 
1   2144 DG n 
1   2145 DT n 
1   2146 DT n 
1   2147 DA n 
1   2148 DT n 
1   2149 DG n 
1   2150 DA n 
1   2151 DT n 
1   2152 DA n 
1   2153 DG n 
1   2154 DT n 
1   2155 DG n 
1   2156 DT n 
1   2157 DT n 
1   2158 DG n 
1   2159 DC n 
1   2160 DT n 
1   2161 DC n 
1   2162 DT n 
1   2163 DT n 
1   2164 DA n 
1   2165 DC n 
1   2166 DT n 
1   2167 DA n 
1   2168 DT n 
1   2169 DG n 
1   2170 DC n 
1   2171 DC n 
1   2172 DT n 
1   2173 DC n 
1   2174 DG n 
1   2175 DT n 
1   2176 DA n 
1   2177 DA n 
1   2178 DT n 
1   2179 DT n 
1   2180 DC n 
1   2181 DC n 
1   2182 DT n 
1   2183 DT n 
1   2184 DT n 
1   2185 DT n 
1   2186 DG n 
1   2187 DG n 
1   2188 DC n 
1   2189 DG n 
1   2190 DT n 
1   2191 DT n 
1   2192 DA n 
1   2193 DT n 
1   2194 DG n 
1   2195 DT n 
1   2196 DA n 
1   2197 DT n 
1   2198 DC n 
1   2199 DT n 
1   2200 DG n 
1   2201 DC n 
1   2202 DA n 
1   2203 DT n 
1   2204 DT n 
1   2205 DA n 
1   2206 DG n 
1   2207 DT n 
1   2208 DT n 
1   2209 DG n 
1   2210 DA n 
1   2211 DA n 
1   2212 DT n 
1   2213 DG n 
1   2214 DT n 
1   2215 DG n 
1   2216 DG n 
1   2217 DT n 
1   2218 DA n 
1   2219 DT n 
1   2220 DT n 
1   2221 DC n 
1   2222 DC n 
1   2223 DT n 
1   2224 DA n 
1   2225 DA n 
1   2226 DA n 
1   2227 DT n 
1   2228 DC n 
1   2229 DT n 
1   2230 DC n 
1   2231 DA n 
1   2232 DA n 
1   2233 DC n 
1   2234 DT n 
1   2235 DG n 
1   2236 DA n 
1   2237 DT n 
1   2238 DG n 
1   2239 DA n 
1   2240 DA n 
1   2241 DT n 
1   2242 DC n 
1   2243 DT n 
1   2244 DT n 
1   2245 DT n 
1   2246 DC n 
1   2247 DT n 
1   2248 DA n 
1   2249 DC n 
1   2250 DC n 
1   2251 DT n 
1   2252 DG n 
1   2253 DT n 
1   2254 DA n 
1   2255 DA n 
1   2256 DT n 
1   2257 DA n 
1   2258 DA n 
1   2259 DT n 
1   2260 DG n 
1   2261 DT n 
1   2262 DT n 
1   2263 DG n 
1   2264 DT n 
1   2265 DT n 
1   2266 DC n 
1   2267 DC n 
1   2268 DG n 
1   2269 DT n 
1   2270 DT n 
1   2271 DA n 
1   2272 DG n 
1   2273 DT n 
1   2274 DT n 
1   2275 DC n 
1   2276 DG n 
1   2277 DT n 
1   2278 DT n 
1   2279 DT n 
1   2280 DT n 
1   2281 DA n 
1   2282 DT n 
1   2283 DT n 
1   2284 DA n 
1   2285 DA n 
1   2286 DC n 
1   2287 DG n 
1   2288 DT n 
1   2289 DA n 
1   2290 DG n 
1   2291 DA n 
1   2292 DT n 
1   2293 DT n 
1   2294 DT n 
1   2295 DT n 
1   2296 DT n 
1   2297 DC n 
1   2298 DT n 
1   2299 DT n 
1   2300 DC n 
1   2301 DC n 
1   2302 DC n 
1   2303 DA n 
1   2304 DA n 
1   2305 DC n 
1   2306 DG n 
1   2307 DT n 
1   2308 DC n 
1   2309 DC n 
1   2310 DT n 
1   2311 DG n 
1   2312 DA n 
1   2313 DC n 
1   2314 DT n 
1   2315 DG n 
1   2316 DG n 
1   2317 DT n 
1   2318 DA n 
1   2319 DT n 
1   2320 DA n 
1   2321 DA n 
1   2322 DT n 
1   2323 DG n 
1   2324 DA n 
1   2325 DG n 
1   2326 DC n 
1   2327 DC n 
1   2328 DA n 
1   2329 DG n 
1   2330 DT n 
1   2331 DT n 
1   2332 DC n 
1   2333 DT n 
1   2334 DT n 
1   2335 DA n 
1   2336 DA n 
1   2337 DA n 
1   2338 DA n 
1   2339 DT n 
1   2340 DC n 
1   2341 DG n 
1   2342 DC n 
1   2343 DA n 
1   2344 DT n 
1   2345 DA n 
1   2346 DA n 
1   2347 DG n 
1   2348 DG n 
1   2349 DT n 
1   2350 DA n 
1   2351 DA n 
1   2352 DT n 
1   2353 DT n 
1   2354 DC n 
1   2355 DA n 
1   2356 DC n 
1   2357 DA n 
1   2358 DA n 
1   2359 DT n 
1   2360 DG n 
1   2361 DA n 
1   2362 DT n 
1   2363 DT n 
1   2364 DA n 
1   2365 DA n 
1   2366 DA n 
1   2367 DG n 
1   2368 DT n 
1   2369 DT n 
1   2370 DG n 
1   2371 DA n 
1   2372 DA n 
1   2373 DA n 
1   2374 DT n 
1   2375 DT n 
1   2376 DA n 
1   2377 DA n 
1   2378 DA n 
1   2379 DC n 
1   2380 DC n 
1   2381 DA n 
1   2382 DT n 
1   2383 DC n 
1   2384 DT n 
1   2385 DC n 
1   2386 DA n 
1   2387 DA n 
1   2388 DG n 
1   2389 DC n 
1   2390 DC n 
1   2391 DC n 
1   2392 DA n 
1   2393 DA n 
1   2394 DT n 
1   2395 DT n 
1   2396 DT n 
1   2397 DA n 
1   2398 DC n 
1   2399 DT n 
1   2400 DA n 
1   2401 DC n 
1   2402 DT n 
1   2403 DC n 
1   2404 DG n 
1   2405 DT n 
1   2406 DT n 
1   2407 DC n 
1   2408 DT n 
1   2409 DG n 
1   2410 DG n 
1   2411 DT n 
1   2412 DG n 
1   2413 DT n 
1   2414 DT n 
1   2415 DT n 
1   2416 DC n 
1   2417 DT n 
1   2418 DC n 
1   2419 DG n 
1   2420 DT n 
1   2421 DC n 
1   2422 DA n 
1   2423 DG n 
1   2424 DG n 
1   2425 DG n 
1   2426 DC n 
1   2427 DA n 
1   2428 DA n 
1   2429 DG n 
1   2430 DC n 
1   2431 DC n 
1   2432 DT n 
1   2433 DT n 
1   2434 DA n 
1   2435 DT n 
1   2436 DT n 
1   2437 DC n 
1   2438 DA n 
1   2439 DC n 
1   2440 DT n 
1   2441 DG n 
1   2442 DA n 
1   2443 DA n 
1   2444 DT n 
1   2445 DG n 
1   2446 DA n 
1   2447 DG n 
1   2448 DC n 
1   2449 DA n 
1   2450 DG n 
1   2451 DC n 
1   2452 DT n 
1   2453 DT n 
1   2454 DT n 
1   2455 DG n 
1   2456 DT n 
1   2457 DT n 
1   2458 DA n 
1   2459 DC n 
1   2460 DG n 
1   2461 DT n 
1   2462 DT n 
1   2463 DG n 
1   2464 DA n 
1   2465 DT n 
1   2466 DT n 
1   2467 DT n 
1   2468 DG n 
1   2469 DG n 
1   2470 DG n 
1   2471 DT n 
1   2472 DA n 
1   2473 DA n 
1   2474 DT n 
1   2475 DG n 
1   2476 DA n 
1   2477 DA n 
1   2478 DT n 
1   2479 DA n 
1   2480 DT n 
1   2481 DC n 
1   2482 DC n 
1   2483 DG n 
1   2484 DG n 
1   2485 DT n 
1   2486 DT n 
1   2487 DC n 
1   2488 DT n 
1   2489 DT n 
1   2490 DG n 
1   2491 DT n 
1   2492 DC n 
1   2493 DA n 
1   2494 DA n 
1   2495 DG n 
1   2496 DA n 
1   2497 DT n 
1   2498 DT n 
1   2499 DA n 
1   2500 DC n 
1   2501 DT n 
1   2502 DC n 
1   2503 DT n 
1   2504 DT n 
1   2505 DG n 
1   2506 DA n 
1   2507 DT n 
1   2508 DG n 
1   2509 DA n 
1   2510 DA n 
1   2511 DG n 
1   2512 DG n 
1   2513 DT n 
1   2514 DC n 
1   2515 DA n 
1   2516 DG n 
1   2517 DC n 
1   2518 DC n 
1   2519 DA n 
1   2520 DG n 
1   2521 DC n 
1   2522 DC n 
1   2523 DT n 
1   2524 DA n 
1   2525 DT n 
1   2526 DG n 
1   2527 DC n 
1   2528 DG n 
1   2529 DC n 
1   2530 DC n 
1   2531 DT n 
1   2532 DG n 
1   2533 DG n 
1   2534 DT n 
1   2535 DC n 
1   2536 DT n 
1   2537 DG n 
1   2538 DT n 
1   2539 DA n 
1   2540 DC n 
1   2541 DA n 
1   2542 DC n 
1   2543 DC n 
1   2544 DG n 
1   2545 DT n 
1   2546 DT n 
1   2547 DC n 
1   2548 DA n 
1   2549 DT n 
1   2550 DC n 
1   2551 DT n 
1   2552 DG n 
1   2553 DT n 
1   2554 DC n 
1   2555 DC n 
1   2556 DT n 
1   2557 DC n 
1   2558 DT n 
1   2559 DT n 
1   2560 DT n 
1   2561 DC n 
1   2562 DA n 
1   2563 DA n 
1   2564 DA n 
1   2565 DG n 
1   2566 DT n 
1   2567 DT n 
1   2568 DG n 
1   2569 DG n 
1   2570 DT n 
1   2571 DC n 
1   2572 DA n 
1   2573 DG n 
1   2574 DT n 
1   2575 DT n 
1   2576 DC n 
1   2577 DG n 
1   2578 DG n 
1   2579 DT n 
1   2580 DT n 
1   2581 DC n 
1   2582 DC n 
1   2583 DC n 
1   2584 DT n 
1   2585 DT n 
1   2586 DA n 
1   2587 DT n 
1   2588 DG n 
1   2589 DA n 
1   2590 DT n 
1   2591 DT n 
1   2592 DG n 
1   2593 DA n 
1   2594 DC n 
1   2595 DC n 
1   2596 DG n 
1   2597 DT n 
1   2598 DC n 
1   2599 DT n 
1   2600 DG n 
1   2601 DC n 
1   2602 DG n 
1   2603 DC n 
1   2604 DC n 
1   2605 DT n 
1   2606 DC n 
1   2607 DG n 
1   2608 DT n 
1   2609 DT n 
1   2610 DC n 
1   2611 DC n 
1   2612 DG n 
1   2613 DG n 
1   2614 DC n 
1   2615 DT n 
1   2616 DA n 
1   2617 DA n 
1   2618 DG n 
1   2619 DT n 
1   2620 DA n 
1   2621 DA n 
1   2622 DC n 
1   2623 DA n 
1   2624 DT n 
1   2625 DG n 
1   2626 DG n 
1   2627 DA n 
1   2628 DG n 
1   2629 DC n 
1   2630 DA n 
1   2631 DG n 
1   2632 DG n 
1   2633 DT n 
1   2634 DC n 
1   2635 DG n 
1   2636 DC n 
1   2637 DG n 
1   2638 DG n 
1   2639 DA n 
1   2640 DT n 
1   2641 DT n 
1   2642 DT n 
1   2643 DC n 
1   2644 DG n 
1   2645 DA n 
1   2646 DC n 
1   2647 DA n 
1   2648 DC n 
1   2649 DA n 
1   2650 DA n 
1   2651 DT n 
1   2652 DT n 
1   2653 DT n 
1   2654 DA n 
1   2655 DT n 
1   2656 DC n 
1   2657 DA n 
1   2658 DG n 
1   2659 DG n 
1   2660 DC n 
1   2661 DG n 
1   2662 DA n 
1   2663 DT n 
1   2664 DG n 
1   2665 DA n 
1   2666 DT n 
1   2667 DA n 
1   2668 DC n 
1   2669 DA n 
1   2670 DA n 
1   2671 DA n 
1   2672 DT n 
1   2673 DC n 
1   2674 DT n 
1   2675 DC n 
1   2676 DC n 
1   2677 DG n 
1   2678 DT n 
1   2679 DT n 
1   2680 DG n 
1   2681 DT n 
1   2682 DA n 
1   2683 DC n 
1   2684 DT n 
1   2685 DT n 
1   2686 DT n 
1   2687 DG n 
1   2688 DT n 
1   2689 DT n 
1   2690 DT n 
1   2691 DC n 
1   2692 DG n 
1   2693 DC n 
1   2694 DG n 
1   2695 DC n 
1   2696 DT n 
1   2697 DT n 
1   2698 DG n 
1   2699 DG n 
1   2700 DT n 
1   2701 DA n 
1   2702 DT n 
1   2703 DA n 
1   2704 DA n 
1   2705 DT n 
1   2706 DC n 
1   2707 DG n 
1   2708 DC n 
1   2709 DT n 
1   2710 DG n 
1   2711 DG n 
1   2712 DG n 
1   2713 DG n 
1   2714 DG n 
1   2715 DT n 
1   2716 DC n 
1   2717 DA n 
1   2718 DA n 
1   2719 DA n 
1   2720 DG n 
1   2721 DA n 
1   2722 DT n 
1   2723 DG n 
1   2724 DA n 
1   2725 DG n 
1   2726 DT n 
1   2727 DG n 
1   2728 DT n 
1   2729 DT n 
1   2730 DT n 
1   2731 DT n 
1   2732 DA n 
1   2733 DG n 
1   2734 DT n 
1   2735 DG n 
1   2736 DT n 
1   2737 DA n 
1   2738 DT n 
1   2739 DT n 
1   2740 DC n 
1   2741 DT n 
1   2742 DT n 
1   2743 DT n 
1   2744 DT n 
1   2745 DG n 
1   2746 DC n 
1   2747 DC n 
1   2748 DT n 
1   2749 DC n 
1   2750 DT n 
1   2751 DT n 
1   2752 DT n 
1   2753 DC n 
1   2754 DG n 
1   2755 DT n 
1   2756 DT n 
1   2757 DT n 
1   2758 DT n 
1   2759 DA n 
1   2760 DG n 
1   2761 DG n 
1   2762 DT n 
1   2763 DT n 
1   2764 DG n 
1   2765 DG n 
1   2766 DT n 
1   2767 DG n 
1   2768 DC n 
1   2769 DC n 
1   2770 DT n 
1   2771 DT n 
1   2772 DC n 
1   2773 DG n 
1   2774 DT n 
1   2775 DA n 
1   2776 DG n 
1   2777 DT n 
1   2778 DG n 
1   2779 DG n 
1   2780 DC n 
1   2781 DA n 
1   2782 DT n 
1   2783 DT n 
1   2784 DA n 
1   2785 DC n 
1   2786 DG n 
1   2787 DT n 
1   2788 DA n 
1   2789 DT n 
1   2790 DT n 
1   2791 DT n 
1   2792 DT n 
1   2793 DA n 
1   2794 DC n 
1   2795 DC n 
1   2796 DC n 
1   2797 DG n 
1   2798 DT n 
1   2799 DT n 
1   2800 DT n 
1   2801 DA n 
1   2802 DA n 
1   2803 DT n 
1   2804 DG n 
1   2805 DG n 
1   2806 DA n 
1   2807 DA n 
1   2808 DA n 
1   2809 DC n 
1   2810 DT n 
1   2811 DT n 
1   2812 DC n 
1   2813 DC n 
1   2814 DT n 
1   2815 DC n 
1   2816 DA n 
1   2817 DT n 
1   2818 DG n 
1   2819 DA n 
1   2820 DA n 
1   2821 DA n 
1   2822 DA n 
1   2823 DA n 
1   2824 DG n 
1   2825 DT n 
1   2826 DC n 
1   2827 DT n 
1   2828 DT n 
1   2829 DT n 
1   2830 DA n 
1   2831 DG n 
1   2832 DT n 
1   2833 DC n 
1   2834 DC n 
1   2835 DT n 
1   2836 DC n 
1   2837 DA n 
1   2838 DA n 
1   2839 DA n 
1   2840 DG n 
1   2841 DC n 
1   2842 DC n 
1   2843 DT n 
1   2844 DC n 
1   2845 DT n 
1   2846 DG n 
1   2847 DT n 
1   2848 DA n 
1   2849 DG n 
1   2850 DC n 
1   2851 DC n 
1   2852 DG n 
1   2853 DT n 
1   2854 DT n 
1   2855 DG n 
1   2856 DC n 
1   2857 DT n 
1   2858 DA n 
1   2859 DC n 
1   2860 DC n 
1   2861 DC n 
1   2862 DT n 
1   2863 DC n 
1   2864 DG n 
1   2865 DT n 
1   2866 DT n 
1   2867 DC n 
1   2868 DC n 
1   2869 DG n 
1   2870 DA n 
1   2871 DT n 
1   2872 DG n 
1   2873 DC n 
1   2874 DT n 
1   2875 DG n 
1   2876 DT n 
1   2877 DC n 
1   2878 DT n 
1   2879 DT n 
1   2880 DT n 
1   2881 DC n 
1   2882 DG n 
1   2883 DC n 
1   2884 DT n 
1   2885 DG n 
1   2886 DC n 
1   2887 DT n 
1   2888 DG n 
1   2889 DA n 
1   2890 DG n 
1   2891 DG n 
1   2892 DG n 
1   2893 DT n 
1   2894 DG n 
1   2895 DA n 
1   2896 DC n 
1   2897 DG n 
1   2898 DA n 
1   2899 DT n 
1   2900 DC n 
1   2901 DC n 
1   2902 DC n 
1   2903 DG n 
1   2904 DC n 
1   2905 DA n 
1   2906 DA n 
1   2907 DA n 
1   2908 DA n 
1   2909 DG n 
1   2910 DC n 
1   2911 DG n 
1   2912 DG n 
1   2913 DC n 
1   2914 DC n 
1   2915 DT n 
1   2916 DT n 
1   2917 DT n 
1   2918 DA n 
1   2919 DA n 
1   2920 DC n 
1   2921 DT n 
1   2922 DC n 
1   2923 DC n 
1   2924 DC n 
1   2925 DT n 
1   2926 DG n 
1   2927 DC n 
1   2928 DA n 
1   2929 DA n 
1   2930 DG n 
1   2931 DC n 
1   2932 DC n 
1   2933 DT n 
1   2934 DC n 
1   2935 DA n 
1   2936 DG n 
1   2937 DC n 
1   2938 DG n 
1   2939 DA n 
1   2940 DC n 
1   2941 DC n 
1   2942 DG n 
1   2943 DA n 
1   2944 DA n 
1   2945 DT n 
1   2946 DA n 
1   2947 DT n 
1   2948 DA n 
1   2949 DT n 
1   2950 DC n 
1   2951 DG n 
1   2952 DG n 
1   2953 DT n 
1   2954 DT n 
1   2955 DA n 
1   2956 DT n 
1   2957 DG n 
1   2958 DC n 
1   2959 DG n 
1   2960 DT n 
1   2961 DG n 
1   2962 DG n 
1   2963 DG n 
1   2964 DC n 
1   2965 DG n 
1   2966 DA n 
1   2967 DT n 
1   2968 DG n 
1   2969 DG n 
1   2970 DT n 
1   2971 DT n 
1   2972 DG n 
1   2973 DT n 
1   2974 DT n 
1   2975 DG n 
1   2976 DT n 
1   2977 DC n 
1   2978 DA n 
1   2979 DT n 
1   2980 DT n 
1   2981 DG n 
1   2982 DT n 
1   2983 DC n 
1   2984 DG n 
1   2985 DG n 
1   2986 DC n 
1   2987 DG n 
1   2988 DC n 
1   2989 DA n 
1   2990 DA n 
1   2991 DC n 
1   2992 DT n 
1   2993 DA n 
1   2994 DT n 
1   2995 DC n 
1   2996 DG n 
1   2997 DG n 
1   2998 DT n 
1   2999 DA n 
1   3000 DT n 
1   3001 DC n 
1   3002 DA n 
1   3003 DA n 
1   3004 DG n 
1   3005 DC n 
1   3006 DT n 
1   3007 DG n 
1   3008 DT n 
1   3009 DT n 
1   3010 DT n 
1   3011 DA n 
1   3012 DA n 
1   3013 DG n 
1   3014 DA n 
1   3015 DA n 
1   3016 DA n 
1   3017 DT n 
1   3018 DT n 
1   3019 DC n 
1   3020 DA n 
1   3021 DC n 
1   3022 DC n 
1   3023 DT n 
1   3024 DC n 
1   3025 DG n 
1   3026 DA n 
1   3027 DA n 
1   3028 DA n 
1   3029 DG n 
1   3030 DC n 
1   3031 DA n 
1   3032 DA n 
1   3033 DG n 
1   3034 DC n 
1   3035 DT n 
1   3036 DG n 
1   3037 DA n 
1   3038 DT n 
1   3039 DA n 
1   3040 DA n 
1   3041 DA n 
1   3042 DC n 
1   3043 DC n 
1   3044 DG n 
1   3045 DA n 
1   3046 DT n 
1   3047 DA n 
1   3048 DC n 
1   3049 DA n 
1   3050 DA n 
1   3051 DT n 
1   3052 DT n 
1   3053 DA n 
1   3054 DA n 
1   3055 DA n 
1   3056 DG n 
1   3057 DG n 
1   3058 DC n 
1   3059 DT n 
1   3060 DC n 
1   3061 DC n 
1   3062 DT n 
1   3063 DT n 
1   3064 DT n 
1   3065 DT n 
1   3066 DG n 
1   3067 DG n 
1   3068 DA n 
1   3069 DG n 
1   3070 DC n 
1   3071 DC n 
1   3072 DT n 
1   3073 DT n 
1   3074 DT n 
1   3075 DT n 
1   3076 DT n 
1   3077 DT n 
1   3078 DT n 
1   3079 DT n 
1   3080 DG n 
1   3081 DG n 
1   3082 DA n 
1   3083 DG n 
1   3084 DA n 
1   3085 DT n 
1   3086 DT n 
1   3087 DT n 
1   3088 DT n 
1   3089 DC n 
1   3090 DA n 
1   3091 DA n 
1   3092 DC n 
1   3093 DG n 
1   3094 DT n 
1   3095 DG n 
1   3096 DA n 
1   3097 DA n 
1   3098 DA n 
1   3099 DA n 
1   3100 DA n 
1   3101 DA n 
1   3102 DT n 
1   3103 DT n 
1   3104 DA n 
1   3105 DT n 
1   3106 DT n 
1   3107 DA n 
1   3108 DT n 
1   3109 DT n 
1   3110 DC n 
1   3111 DG n 
1   3112 DC n 
1   3113 DA n 
1   3114 DA n 
1   3115 DT n 
1   3116 DT n 
1   3117 DC n 
1   3118 DC n 
1   3119 DT n 
1   3120 DT n 
1   3121 DT n 
1   3122 DA n 
1   3123 DG n 
1   3124 DT n 
1   3125 DT n 
1   3126 DG n 
1   3127 DT n 
1   3128 DT n 
1   3129 DC n 
1   3130 DC n 
1   3131 DT n 
1   3132 DT n 
1   3133 DT n 
1   3134 DC n 
1   3135 DT n 
1   3136 DA n 
1   3137 DT n 
1   3138 DT n 
1   3139 DC n 
1   3140 DT n 
1   3141 DC n 
1   3142 DA n 
1   3143 DC n 
1   3144 DT n 
1   3145 DC n 
1   3146 DC n 
1   3147 DG n 
1   3148 DC n 
1   3149 DT n 
1   3150 DG n 
1   3151 DA n 
1   3152 DA n 
1   3153 DA n 
1   3154 DC n 
1   3155 DT n 
1   3156 DG n 
1   3157 DT n 
1   3158 DT n 
1   3159 DG n 
1   3160 DA n 
1   3161 DA n 
1   3162 DA n 
1   3163 DG n 
1   3164 DT n 
1   3165 DT n 
1   3166 DG n 
1   3167 DT n 
1   3168 DT n 
1   3169 DT n 
1   3170 DA n 
1   3171 DG n 
1   3172 DC n 
1   3173 DA n 
1   3174 DA n 
1   3175 DA n 
1   3176 DA n 
1   3177 DT n 
1   3178 DC n 
1   3179 DC n 
1   3180 DC n 
1   3181 DA n 
1   3182 DT n 
1   3183 DA n 
1   3184 DC n 
1   3185 DA n 
1   3186 DG n 
1   3187 DA n 
1   3188 DA n 
1   3189 DA n 
1   3190 DA n 
1   3191 DT n 
1   3192 DT n 
1   3193 DC n 
1   3194 DA n 
1   3195 DT n 
1   3196 DT n 
1   3197 DT n 
1   3198 DA n 
1   3199 DC n 
1   3200 DT n 
1   3201 DA n 
1   3202 DA n 
1   3203 DC n 
1   3204 DG n 
1   3205 DT n 
1   3206 DC n 
1   3207 DT n 
1   3208 DG n 
1   3209 DG n 
1   3210 DA n 
1   3211 DA n 
1   3212 DA n 
1   3213 DG n 
1   3214 DA n 
1   3215 DC n 
1   3216 DG n 
1   3217 DA n 
1   3218 DC n 
1   3219 DA n 
1   3220 DA n 
1   3221 DA n 
1   3222 DA n 
1   3223 DC n 
1   3224 DT n 
1   3225 DT n 
1   3226 DT n 
1   3227 DA n 
1   3228 DG n 
1   3229 DA n 
1   3230 DT n 
1   3231 DC n 
1   3232 DG n 
1   3233 DT n 
1   3234 DT n 
1   3235 DA n 
1   3236 DC n 
1   3237 DG n 
1   3238 DC n 
1   3239 DT n 
1   3240 DA n 
1   3241 DA n 
1   3242 DC n 
1   3243 DT n 
1   3244 DA n 
1   3245 DT n 
1   3246 DG n 
1   3247 DA n 
1   3248 DG n 
1   3249 DG n 
1   3250 DG n 
1   3251 DC n 
1   3252 DT n 
1   3253 DG n 
1   3254 DT n 
1   3255 DC n 
1   3256 DT n 
1   3257 DG n 
1   3258 DT n 
1   3259 DG n 
1   3260 DG n 
1   3261 DA n 
1   3262 DA n 
1   3263 DT n 
1   3264 DG n 
1   3265 DC n 
1   3266 DT n 
1   3267 DA n 
1   3268 DC n 
1   3269 DA n 
1   3270 DG n 
1   3271 DG n 
1   3272 DC n 
1   3273 DG n 
1   3274 DT n 
1   3275 DT n 
1   3276 DG n 
1   3277 DT n 
1   3278 DA n 
1   3279 DG n 
1   3280 DT n 
1   3281 DT n 
1   3282 DT n 
1   3283 DG n 
1   3284 DT n 
1   3285 DA n 
1   3286 DC n 
1   3287 DT n 
1   3288 DG n 
1   3289 DG n 
1   3290 DT n 
1   3291 DG n 
1   3292 DA n 
1   3293 DC n 
1   3294 DG n 
1   3295 DA n 
1   3296 DA n 
1   3297 DA n 
1   3298 DC n 
1   3299 DT n 
1   3300 DC n 
1   3301 DA n 
1   3302 DG n 
1   3303 DT n 
1   3304 DG n 
1   3305 DT n 
1   3306 DT n 
1   3307 DA n 
1   3308 DC n 
1   3309 DG n 
1   3310 DG n 
1   3311 DT n 
1   3312 DA n 
1   3313 DC n 
1   3314 DA n 
1   3315 DT n 
1   3316 DG n 
1   3317 DG n 
1   3318 DG n 
1   3319 DT n 
1   3320 DT n 
1   3321 DC n 
1   3322 DC n 
1   3323 DT n 
1   3324 DA n 
1   3325 DT n 
1   3326 DT n 
1   3327 DG n 
1   3328 DG n 
1   3329 DG n 
1   3330 DC n 
1   3331 DT n 
1   3332 DT n 
1   3333 DG n 
1   3334 DC n 
1   3335 DT n 
1   3336 DA n 
1   3337 DT n 
1   3338 DC n 
1   3339 DC n 
1   3340 DC n 
1   3341 DT n 
1   3342 DG n 
1   3343 DA n 
1   3344 DA n 
1   3345 DA n 
1   3346 DA n 
1   3347 DT n 
1   3348 DG n 
1   3349 DA n 
1   3350 DG n 
1   3351 DG n 
1   3352 DG n 
1   3353 DT n 
1   3354 DG n 
1   3355 DG n 
1   3356 DT n 
1   3357 DG n 
1   3358 DG n 
1   3359 DC n 
1   3360 DT n 
1   3361 DC n 
1   3362 DT n 
1   3363 DG n 
1   3364 DA n 
1   3365 DG n 
1   3366 DG n 
1   3367 DG n 
1   3368 DT n 
1   3369 DG n 
1   3370 DG n 
1   3371 DC n 
1   3372 DG n 
1   3373 DG n 
1   3374 DT n 
1   3375 DT n 
1   3376 DC n 
1   3377 DT n 
1   3378 DG n 
1   3379 DA n 
1   3380 DG n 
1   3381 DG n 
1   3382 DG n 
1   3383 DT n 
1   3384 DG n 
1   3385 DG n 
1   3386 DC n 
1   3387 DG n 
1   3388 DG n 
1   3389 DT n 
1   3390 DT n 
1   3391 DC n 
1   3392 DT n 
1   3393 DG n 
1   3394 DA n 
1   3395 DG n 
1   3396 DG n 
1   3397 DG n 
1   3398 DT n 
1   3399 DG n 
1   3400 DG n 
1   3401 DC n 
1   3402 DG n 
1   3403 DG n 
1   3404 DT n 
1   3405 DA n 
1   3406 DC n 
1   3407 DT n 
1   3408 DA n 
1   3409 DA n 
1   3410 DA n 
1   3411 DC n 
1   3412 DC n 
1   3413 DT n 
1   3414 DC n 
1   3415 DC n 
1   3416 DT n 
1   3417 DG n 
1   3418 DA n 
1   3419 DG n 
1   3420 DT n 
1   3421 DA n 
1   3422 DC n 
1   3423 DG n 
1   3424 DG n 
1   3425 DT n 
1   3426 DG n 
1   3427 DA n 
1   3428 DT n 
1   3429 DA n 
1   3430 DC n 
1   3431 DA n 
1   3432 DC n 
1   3433 DC n 
1   3434 DT n 
1   3435 DA n 
1   3436 DT n 
1   3437 DT n 
1   3438 DC n 
1   3439 DC n 
1   3440 DG n 
1   3441 DG n 
1   3442 DG n 
1   3443 DC n 
1   3444 DT n 
1   3445 DA n 
1   3446 DT n 
1   3447 DA n 
1   3448 DC n 
1   3449 DT n 
1   3450 DT n 
1   3451 DA n 
1   3452 DT n 
1   3453 DA n 
1   3454 DT n 
1   3455 DC n 
1   3456 DA n 
1   3457 DA n 
1   3458 DC n 
1   3459 DC n 
1   3460 DC n 
1   3461 DT n 
1   3462 DC n 
1   3463 DT n 
1   3464 DC n 
1   3465 DG n 
1   3466 DA n 
1   3467 DC n 
1   3468 DG n 
1   3469 DG n 
1   3470 DC n 
1   3471 DA n 
1   3472 DC n 
1   3473 DT n 
1   3474 DT n 
1   3475 DA n 
1   3476 DT n 
1   3477 DC n 
1   3478 DC n 
1   3479 DG n 
1   3480 DC n 
1   3481 DC n 
1   3482 DT n 
1   3483 DG n 
1   3484 DG n 
1   3485 DT n 
1   3486 DA n 
1   3487 DC n 
1   3488 DT n 
1   3489 DG n 
1   3490 DA n 
1   3491 DG n 
1   3492 DC n 
1   3493 DA n 
1   3494 DA n 
1   3495 DA n 
1   3496 DA n 
1   3497 DC n 
1   3498 DC n 
1   3499 DC n 
1   3500 DC n 
1   3501 DG n 
1   3502 DC n 
1   3503 DT n 
1   3504 DA n 
1   3505 DA n 
1   3506 DT n 
1   3507 DC n 
1   3508 DC n 
1   3509 DT n 
1   3510 DA n 
1   3511 DA n 
1   3512 DT n 
1   3513 DC n 
1   3514 DC n 
1   3515 DT n 
1   3516 DT n 
1   3517 DC n 
1   3518 DT n 
1   3519 DC n 
1   3520 DT n 
1   3521 DT n 
1   3522 DG n 
1   3523 DA n 
1   3524 DG n 
1   3525 DG n 
1   3526 DA n 
1   3527 DG n 
1   3528 DT n 
1   3529 DC n 
1   3530 DT n 
1   3531 DC n 
1   3532 DA n 
1   3533 DG n 
1   3534 DC n 
1   3535 DC n 
1   3536 DT n 
1   3537 DC n 
1   3538 DT n 
1   3539 DT n 
1   3540 DA n 
1   3541 DA n 
1   3542 DT n 
1   3543 DA n 
1   3544 DC n 
1   3545 DT n 
1   3546 DT n 
1   3547 DT n 
1   3548 DC n 
1   3549 DA n 
1   3550 DT n 
1   3551 DG n 
1   3552 DT n 
1   3553 DT n 
1   3554 DT n 
1   3555 DC n 
1   3556 DA n 
1   3557 DG n 
1   3558 DA n 
1   3559 DA n 
1   3560 DT n 
1   3561 DA n 
1   3562 DA n 
1   3563 DT n 
1   3564 DA n 
1   3565 DG n 
1   3566 DG n 
1   3567 DT n 
1   3568 DT n 
1   3569 DC n 
1   3570 DC n 
1   3571 DG n 
1   3572 DA n 
1   3573 DA n 
1   3574 DA n 
1   3575 DT n 
1   3576 DA n 
1   3577 DG n 
1   3578 DG n 
1   3579 DC n 
1   3580 DA n 
1   3581 DG n 
1   3582 DG n 
1   3583 DG n 
1   3584 DG n 
1   3585 DG n 
1   3586 DC n 
1   3587 DA n 
1   3588 DT n 
1   3589 DT n 
1   3590 DA n 
1   3591 DA n 
1   3592 DC n 
1   3593 DT n 
1   3594 DG n 
1   3595 DT n 
1   3596 DT n 
1   3597 DT n 
1   3598 DA n 
1   3599 DT n 
1   3600 DA n 
1   3601 DC n 
1   3602 DG n 
1   3603 DG n 
1   3604 DG n 
1   3605 DC n 
1   3606 DA n 
1   3607 DC n 
1   3608 DT n 
1   3609 DG n 
1   3610 DT n 
1   3611 DT n 
1   3612 DA n 
1   3613 DC n 
1   3614 DT n 
1   3615 DC n 
1   3616 DA n 
1   3617 DA n 
1   3618 DG n 
1   3619 DG n 
1   3620 DC n 
1   3621 DA n 
1   3622 DC n 
1   3623 DT n 
1   3624 DG n 
1   3625 DA n 
1   3626 DC n 
1   3627 DC n 
1   3628 DC n 
1   3629 DC n 
1   3630 DG n 
1   3631 DT n 
1   3632 DT n 
1   3633 DA n 
1   3634 DA n 
1   3635 DA n 
1   3636 DA n 
1   3637 DC n 
1   3638 DT n 
1   3639 DT n 
1   3640 DA n 
1   3641 DT n 
1   3642 DT n 
1   3643 DA n 
1   3644 DC n 
1   3645 DC n 
1   3646 DA n 
1   3647 DG n 
1   3648 DT n 
1   3649 DA n 
1   3650 DC n 
1   3651 DA n 
1   3652 DC n 
1   3653 DT n 
1   3654 DC n 
1   3655 DC n 
1   3656 DT n 
1   3657 DG n 
1   3658 DT n 
1   3659 DA n 
1   3660 DT n 
1   3661 DC n 
1   3662 DA n 
1   3663 DT n 
1   3664 DC n 
1   3665 DA n 
1   3666 DA n 
1   3667 DA n 
1   3668 DA n 
1   3669 DG n 
1   3670 DC n 
1   3671 DC n 
1   3672 DA n 
1   3673 DT n 
1   3674 DG n 
1   3675 DT n 
1   3676 DA n 
1   3677 DT n 
1   3678 DG n 
1   3679 DA n 
1   3680 DC n 
1   3681 DG n 
1   3682 DC n 
1   3683 DT n 
1   3684 DT n 
1   3685 DA n 
1   3686 DC n 
1   3687 DT n 
1   3688 DG n 
1   3689 DG n 
1   3690 DA n 
1   3691 DA n 
1   3692 DC n 
1   3693 DG n 
1   3694 DG n 
1   3695 DT n 
1   3696 DA n 
1   3697 DA n 
1   3698 DA n 
1   3699 DT n 
1   3700 DT n 
1   3701 DC n 
1   3702 DA n 
1   3703 DG n 
1   3704 DA n 
1   3705 DG n 
1   3706 DA n 
1   3707 DC n 
1   3708 DT n 
1   3709 DG n 
1   3710 DC n 
1   3711 DG n 
1   3712 DC n 
1   3713 DT n 
1   3714 DT n 
1   3715 DT n 
1   3716 DC n 
1   3717 DC n 
1   3718 DA n 
1   3719 DT n 
1   3720 DT n 
1   3721 DC n 
1   3722 DT n 
1   3723 DG n 
1   3724 DG n 
1   3725 DC n 
1   3726 DT n 
1   3727 DT n 
1   3728 DT n 
1   3729 DA n 
1   3730 DA n 
1   3731 DT n 
1   3732 DG n 
1   3733 DA n 
1   3734 DG n 
1   3735 DG n 
1   3736 DA n 
1   3737 DT n 
1   3738 DT n 
1   3739 DT n 
1   3740 DA n 
1   3741 DT n 
1   3742 DT n 
1   3743 DT n 
1   3744 DG n 
1   3745 DT n 
1   3746 DT n 
1   3747 DT n 
1   3748 DG n 
1   3749 DT n 
1   3750 DG n 
1   3751 DA n 
1   3752 DA n 
1   3753 DT n 
1   3754 DA n 
1   3755 DT n 
1   3756 DC n 
1   3757 DA n 
1   3758 DA n 
1   3759 DG n 
1   3760 DG n 
1   3761 DC n 
1   3762 DC n 
1   3763 DA n 
1   3764 DA n 
1   3765 DT n 
1   3766 DC n 
1   3767 DG n 
1   3768 DT n 
1   3769 DC n 
1   3770 DT n 
1   3771 DG n 
1   3772 DA n 
1   3773 DC n 
1   3774 DC n 
1   3775 DT n 
1   3776 DG n 
1   3777 DC n 
1   3778 DC n 
1   3779 DT n 
1   3780 DC n 
1   3781 DA n 
1   3782 DA n 
1   3783 DC n 
1   3784 DC n 
1   3785 DT n 
1   3786 DC n 
1   3787 DC n 
1   3788 DT n 
1   3789 DG n 
1   3790 DT n 
1   3791 DC n 
1   3792 DA n 
1   3793 DA n 
1   3794 DT n 
1   3795 DG n 
1   3796 DC n 
1   3797 DT n 
1   3798 DG n 
1   3799 DG n 
1   3800 DC n 
1   3801 DG n 
1   3802 DG n 
1   3803 DC n 
1   3804 DG n 
1   3805 DG n 
1   3806 DC n 
1   3807 DT n 
1   3808 DC n 
1   3809 DT n 
1   3810 DG n 
1   3811 DG n 
1   3812 DT n 
1   3813 DG n 
1   3814 DG n 
1   3815 DT n 
1   3816 DG n 
1   3817 DG n 
1   3818 DT n 
1   3819 DT n 
1   3820 DC n 
1   3821 DT n 
1   3822 DG n 
1   3823 DG n 
1   3824 DT n 
1   3825 DG n 
1   3826 DG n 
1   3827 DC n 
1   3828 DG n 
1   3829 DG n 
1   3830 DC n 
1   3831 DT n 
1   3832 DC n 
1   3833 DT n 
1   3834 DG n 
1   3835 DA n 
1   3836 DG n 
1   3837 DG n 
1   3838 DG n 
1   3839 DT n 
1   3840 DG n 
1   3841 DG n 
1   3842 DT n 
1   3843 DG n 
1   3844 DG n 
1   3845 DC n 
1   3846 DT n 
1   3847 DC n 
1   3848 DT n 
1   3849 DG n 
1   3850 DA n 
1   3851 DG n 
1   3852 DG n 
1   3853 DG n 
1   3854 DT n 
1   3855 DG n 
1   3856 DG n 
1   3857 DC n 
1   3858 DG n 
1   3859 DG n 
1   3860 DT n 
1   3861 DT n 
1   3862 DC n 
1   3863 DT n 
1   3864 DG n 
1   3865 DA n 
1   3866 DG n 
1   3867 DG n 
1   3868 DG n 
1   3869 DT n 
1   3870 DG n 
1   3871 DG n 
1   3872 DC n 
1   3873 DG n 
1   3874 DG n 
1   3875 DC n 
1   3876 DT n 
1   3877 DC n 
1   3878 DT n 
1   3879 DG n 
1   3880 DA n 
1   3881 DG n 
1   3882 DG n 
1   3883 DG n 
1   3884 DA n 
1   3885 DG n 
1   3886 DG n 
1   3887 DC n 
1   3888 DG n 
1   3889 DG n 
1   3890 DT n 
1   3891 DT n 
1   3892 DC n 
1   3893 DC n 
1   3894 DG n 
1   3895 DG n 
1   3896 DT n 
1   3897 DG n 
1   3898 DG n 
1   3899 DT n 
1   3900 DG n 
1   3901 DG n 
1   3902 DC n 
1   3903 DT n 
1   3904 DC n 
1   3905 DT n 
1   3906 DG n 
1   3907 DG n 
1   3908 DT n 
1   3909 DT n 
1   3910 DC n 
1   3911 DC n 
1   3912 DG n 
1   3913 DG n 
1   3914 DT n 
1   3915 DG n 
1   3916 DA n 
1   3917 DT n 
1   3918 DT n 
1   3919 DT n 
1   3920 DT n 
1   3921 DG n 
1   3922 DA n 
1   3923 DT n 
1   3924 DT n 
1   3925 DA n 
1   3926 DT n 
1   3927 DG n 
1   3928 DA n 
1   3929 DA n 
1   3930 DA n 
1   3931 DA n 
1   3932 DG n 
1   3933 DA n 
1   3934 DT n 
1   3935 DG n 
1   3936 DG n 
1   3937 DC n 
1   3938 DA n 
1   3939 DA n 
1   3940 DA n 
1   3941 DC n 
1   3942 DG n 
1   3943 DC n 
1   3944 DT n 
1   3945 DA n 
1   3946 DA n 
1   3947 DT n 
1   3948 DA n 
1   3949 DA n 
1   3950 DG n 
1   3951 DG n 
1   3952 DG n 
1   3953 DG n 
1   3954 DG n 
1   3955 DC n 
1   3956 DT n 
1   3957 DA n 
1   3958 DT n 
1   3959 DG n 
1   3960 DA n 
1   3961 DC n 
1   3962 DC n 
1   3963 DG n 
1   3964 DA n 
1   3965 DA n 
1   3966 DA n 
1   3967 DA n 
1   3968 DT n 
1   3969 DG n 
1   3970 DC n 
1   3971 DC n 
1   3972 DG n 
1   3973 DA n 
1   3974 DT n 
1   3975 DG n 
1   3976 DA n 
1   3977 DA n 
1   3978 DA n 
1   3979 DA n 
1   3980 DC n 
1   3981 DG n 
1   3982 DC n 
1   3983 DG n 
1   3984 DC n 
1   3985 DT n 
1   3986 DA n 
1   3987 DC n 
1   3988 DA n 
1   3989 DG n 
1   3990 DT n 
1   3991 DC n 
1   3992 DT n 
1   3993 DG n 
1   3994 DA n 
1   3995 DC n 
1   3996 DG n 
1   3997 DC n 
1   3998 DT n 
1   3999 DA n 
1   4000 DA n 
1   4001 DA n 
1   4002 DG n 
1   4003 DG n 
1   4004 DC n 
1   4005 DA n 
1   4006 DA n 
1   4007 DA n 
1   4008 DC n 
1   4009 DT n 
1   4010 DT n 
1   4011 DG n 
1   4012 DA n 
1   4013 DT n 
1   4014 DT n 
1   4015 DC n 
1   4016 DT n 
1   4017 DG n 
1   4018 DT n 
1   4019 DC n 
1   4020 DG n 
1   4021 DC n 
1   4022 DT n 
1   4023 DA n 
1   4024 DC n 
1   4025 DT n 
1   4026 DG n 
1   4027 DA n 
1   4028 DT n 
1   4029 DT n 
1   4030 DA n 
1   4031 DC n 
1   4032 DG n 
1   4033 DG n 
1   4034 DT n 
1   4035 DG n 
1   4036 DC n 
1   4037 DT n 
1   4038 DG n 
1   4039 DC n 
1   4040 DT n 
1   4041 DA n 
1   4042 DT n 
1   4043 DC n 
1   4044 DG n 
1   4045 DA n 
1   4046 DT n 
1   4047 DG n 
1   4048 DG n 
1   4049 DT n 
1   4050 DT n 
1   4051 DT n 
1   4052 DC n 
1   4053 DA n 
1   4054 DT n 
1   4055 DT n 
1   4056 DG n 
1   4057 DG n 
1   4058 DT n 
1   4059 DG n 
1   4060 DA n 
1   4061 DC n 
1   4062 DG n 
1   4063 DT n 
1   4064 DT n 
1   4065 DT n 
1   4066 DC n 
1   4067 DC n 
1   4068 DG n 
1   4069 DG n 
1   4070 DC n 
1   4071 DC n 
1   4072 DT n 
1   4073 DT n 
1   4074 DG n 
1   4075 DC n 
1   4076 DT n 
1   4077 DA n 
1   4078 DA n 
1   4079 DT n 
1   4080 DG n 
1   4081 DG n 
1   4082 DT n 
1   4083 DA n 
1   4084 DA n 
1   4085 DT n 
1   4086 DG n 
1   4087 DG n 
1   4088 DT n 
1   4089 DG n 
1   4090 DC n 
1   4091 DT n 
1   4092 DA n 
1   4093 DC n 
1   4094 DT n 
1   4095 DG n 
1   4096 DG n 
1   4097 DT n 
1   4098 DG n 
1   4099 DA n 
1   4100 DT n 
1   4101 DT n 
1   4102 DT n 
1   4103 DT n 
1   4104 DG n 
1   4105 DC n 
1   4106 DT n 
1   4107 DG n 
1   4108 DG n 
1   4109 DC n 
1   4110 DT n 
1   4111 DC n 
1   4112 DT n 
1   4113 DA n 
1   4114 DA n 
1   4115 DT n 
1   4116 DT n 
1   4117 DC n 
1   4118 DC n 
1   4119 DC n 
1   4120 DA n 
1   4121 DA n 
1   4122 DA n 
1   4123 DT n 
1   4124 DG n 
1   4125 DG n 
1   4126 DC n 
1   4127 DT n 
1   4128 DC n 
1   4129 DA n 
1   4130 DA n 
1   4131 DG n 
1   4132 DT n 
1   4133 DC n 
1   4134 DG n 
1   4135 DG n 
1   4136 DT n 
1   4137 DG n 
1   4138 DA n 
1   4139 DC n 
1   4140 DG n 
1   4141 DG n 
1   4142 DT n 
1   4143 DG n 
1   4144 DA n 
1   4145 DT n 
1   4146 DA n 
1   4147 DA n 
1   4148 DT n 
1   4149 DT n 
1   4150 DC n 
1   4151 DA n 
1   4152 DC n 
1   4153 DC n 
1   4154 DT n 
1   4155 DT n 
1   4156 DT n 
1   4157 DA n 
1   4158 DA n 
1   4159 DT n 
1   4160 DG n 
1   4161 DA n 
1   4162 DA n 
1   4163 DT n 
1   4164 DA n 
1   4165 DA n 
1   4166 DT n 
1   4167 DT n 
1   4168 DT n 
1   4169 DC n 
1   4170 DC n 
1   4171 DG n 
1   4172 DT n 
1   4173 DC n 
1   4174 DA n 
1   4175 DA n 
1   4176 DT n 
1   4177 DA n 
1   4178 DT n 
1   4179 DT n 
1   4180 DT n 
1   4181 DA n 
1   4182 DC n 
1   4183 DC n 
1   4184 DT n 
1   4185 DT n 
1   4186 DC n 
1   4187 DC n 
1   4188 DC n 
1   4189 DT n 
1   4190 DC n 
1   4191 DC n 
1   4192 DC n 
1   4193 DT n 
1   4194 DC n 
1   4195 DA n 
1   4196 DA n 
1   4197 DT n 
1   4198 DC n 
1   4199 DG n 
1   4200 DG n 
1   4201 DT n 
1   4202 DT n 
1   4203 DG n 
1   4204 DA n 
1   4205 DA n 
1   4206 DT n 
1   4207 DG n 
1   4208 DT n 
1   4209 DC n 
1   4210 DG n 
1   4211 DC n 
1   4212 DC n 
1   4213 DC n 
1   4214 DT n 
1   4215 DT n 
1   4216 DT n 
1   4217 DT n 
1   4218 DG n 
1   4219 DT n 
1   4220 DC n 
1   4221 DT n 
1   4222 DT n 
1   4223 DT n 
1   4224 DG n 
1   4225 DG n 
1   4226 DC n 
1   4227 DG n 
1   4228 DC n 
1   4229 DT n 
1   4230 DG n 
1   4231 DG n 
1   4232 DT n 
1   4233 DA n 
1   4234 DA n 
1   4235 DA n 
1   4236 DC n 
1   4237 DC n 
1   4238 DA n 
1   4239 DT n 
1   4240 DA n 
1   4241 DT n 
1   4242 DG n 
1   4243 DA n 
1   4244 DA n 
1   4245 DT n 
1   4246 DT n 
1   4247 DT n 
1   4248 DT n 
1   4249 DC n 
1   4250 DT n 
1   4251 DA n 
1   4252 DT n 
1   4253 DT n 
1   4254 DG n 
1   4255 DA n 
1   4256 DT n 
1   4257 DT n 
1   4258 DG n 
1   4259 DT n 
1   4260 DG n 
1   4261 DA n 
1   4262 DC n 
1   4263 DA n 
1   4264 DA n 
1   4265 DA n 
1   4266 DA n 
1   4267 DT n 
1   4268 DA n 
1   4269 DA n 
1   4270 DA n 
1   4271 DC n 
1   4272 DT n 
1   4273 DT n 
1   4274 DA n 
1   4275 DT n 
1   4276 DT n 
1   4277 DC n 
1   4278 DC n 
1   4279 DG n 
1   4280 DT n 
1   4281 DG n 
1   4282 DG n 
1   4283 DT n 
1   4284 DG n 
1   4285 DT n 
1   4286 DC n 
1   4287 DT n 
1   4288 DT n 
1   4289 DT n 
1   4290 DG n 
1   4291 DC n 
1   4292 DG n 
1   4293 DT n 
1   4294 DT n 
1   4295 DT n 
1   4296 DC n 
1   4297 DT n 
1   4298 DT n 
1   4299 DT n 
1   4300 DT n 
1   4301 DA n 
1   4302 DT n 
1   4303 DA n 
1   4304 DT n 
1   4305 DG n 
1   4306 DT n 
1   4307 DT n 
1   4308 DG n 
1   4309 DC n 
1   4310 DC n 
1   4311 DA n 
1   4312 DC n 
1   4313 DC n 
1   4314 DT n 
1   4315 DT n 
1   4316 DT n 
1   4317 DA n 
1   4318 DT n 
1   4319 DG n 
1   4320 DT n 
1   4321 DA n 
1   4322 DT n 
1   4323 DG n 
1   4324 DT n 
1   4325 DA n 
1   4326 DT n 
1   4327 DT n 
1   4328 DT n 
1   4329 DT n 
1   4330 DC n 
1   4331 DT n 
1   4332 DA n 
1   4333 DC n 
1   4334 DG n 
1   4335 DT n 
1   4336 DT n 
1   4337 DT n 
1   4338 DG n 
1   4339 DC n 
1   4340 DT n 
1   4341 DA n 
1   4342 DA n 
1   4343 DC n 
1   4344 DA n 
1   4345 DT n 
1   4346 DA n 
1   4347 DC n 
1   4348 DT n 
1   4349 DG n 
1   4350 DC n 
1   4351 DG n 
1   4352 DT n 
1   4353 DA n 
1   4354 DA n 
1   4355 DT n 
1   4356 DA n 
1   4357 DA n 
1   4358 DG n 
1   4359 DG n 
1   4360 DA n 
1   4361 DG n 
1   4362 DT n 
1   4363 DC n 
1   4364 DT n 
1   4365 DT n 
1   4366 DA n 
1   4367 DA n 
1   4368 DT n 
1   4369 DC n 
1   4370 DA n 
1   4371 DT n 
1   4372 DG n 
1   4373 DC n 
1   4374 DC n 
1   4375 DA n 
1   4376 DG n 
1   4377 DT n 
1   4378 DT n 
1   4379 DC n 
1   4380 DT n 
1   4381 DT n 
1   4382 DT n 
1   4383 DT n 
1   4384 DG n 
1   4385 DG n 
1   4386 DG n 
1   4387 DT n 
1   4388 DA n 
1   4389 DT n 
1   4390 DT n 
1   4391 DC n 
1   4392 DC n 
1   4393 DG n 
1   4394 DT n 
1   4395 DT n 
1   4396 DA n 
1   4397 DT n 
1   4398 DT n 
1   4399 DA n 
1   4400 DT n 
1   4401 DT n 
1   4402 DG n 
1   4403 DC n 
1   4404 DG n 
1   4405 DT n 
1   4406 DT n 
1   4407 DT n 
1   4408 DC n 
1   4409 DC n 
1   4410 DT n 
1   4411 DC n 
1   4412 DG n 
1   4413 DG n 
1   4414 DT n 
1   4415 DT n 
1   4416 DT n 
1   4417 DC n 
1   4418 DC n 
1   4419 DT n 
1   4420 DT n 
1   4421 DC n 
1   4422 DT n 
1   4423 DG n 
1   4424 DG n 
1   4425 DT n 
1   4426 DA n 
1   4427 DA n 
1   4428 DC n 
1   4429 DT n 
1   4430 DT n 
1   4431 DT n 
1   4432 DG n 
1   4433 DT n 
1   4434 DT n 
1   4435 DC n 
1   4436 DG n 
1   4437 DG n 
1   4438 DC n 
1   4439 DT n 
1   4440 DA n 
1   4441 DT n 
1   4442 DC n 
1   4443 DT n 
1   4444 DG n 
1   4445 DC n 
1   4446 DT n 
1   4447 DT n 
1   4448 DA n 
1   4449 DC n 
1   4450 DT n 
1   4451 DT n 
1   4452 DT n 
1   4453 DT n 
1   4454 DC n 
1   4455 DT n 
1   4456 DT n 
1   4457 DA n 
1   4458 DA n 
1   4459 DA n 
1   4460 DA n 
1   4461 DA n 
1   4462 DG n 
1   4463 DG n 
1   4464 DG n 
1   4465 DC n 
1   4466 DT n 
1   4467 DT n 
1   4468 DC n 
1   4469 DG n 
1   4470 DG n 
1   4471 DT n 
1   4472 DA n 
1   4473 DA n 
1   4474 DG n 
1   4475 DA n 
1   4476 DT n 
1   4477 DA n 
1   4478 DG n 
1   4479 DC n 
1   4480 DT n 
1   4481 DA n 
1   4482 DT n 
1   4483 DT n 
1   4484 DG n 
1   4485 DC n 
1   4486 DT n 
1   4487 DA n 
1   4488 DT n 
1   4489 DT n 
1   4490 DT n 
1   4491 DC n 
1   4492 DA n 
1   4493 DT n 
1   4494 DT n 
1   4495 DG n 
1   4496 DT n 
1   4497 DT n 
1   4498 DT n 
1   4499 DC n 
1   4500 DT n 
1   4501 DT n 
1   4502 DG n 
1   4503 DC n 
1   4504 DT n 
1   4505 DC n 
1   4506 DT n 
1   4507 DT n 
1   4508 DA n 
1   4509 DT n 
1   4510 DT n 
1   4511 DA n 
1   4512 DT n 
1   4513 DT n 
1   4514 DG n 
1   4515 DG n 
1   4516 DG n 
1   4517 DC n 
1   4518 DT n 
1   4519 DT n 
1   4520 DA n 
1   4521 DA n 
1   4522 DC n 
1   4523 DT n 
1   4524 DC n 
1   4525 DA n 
1   4526 DA n 
1   4527 DT n 
1   4528 DT n 
1   4529 DC n 
1   4530 DT n 
1   4531 DT n 
1   4532 DG n 
1   4533 DT n 
1   4534 DG n 
1   4535 DG n 
1   4536 DG n 
1   4537 DT n 
1   4538 DT n 
1   4539 DA n 
1   4540 DT n 
1   4541 DC n 
1   4542 DT n 
1   4543 DC n 
1   4544 DT n 
1   4545 DC n 
1   4546 DT n 
1   4547 DG n 
1   4548 DA n 
1   4549 DT n 
1   4550 DA n 
1   4551 DT n 
1   4552 DT n 
1   4553 DA n 
1   4554 DG n 
1   4555 DC n 
1   4556 DG n 
1   4557 DC n 
1   4558 DT n 
1   4559 DC n 
1   4560 DA n 
1   4561 DA n 
1   4562 DT n 
1   4563 DT n 
1   4564 DA n 
1   4565 DC n 
1   4566 DC n 
1   4567 DC n 
1   4568 DT n 
1   4569 DC n 
1   4570 DT n 
1   4571 DG n 
1   4572 DA n 
1   4573 DC n 
1   4574 DT n 
1   4575 DT n 
1   4576 DT n 
1   4577 DG n 
1   4578 DT n 
1   4579 DT n 
1   4580 DC n 
1   4581 DA n 
1   4582 DG n 
1   4583 DG n 
1   4584 DG n 
1   4585 DT n 
1   4586 DG n 
1   4587 DT n 
1   4588 DT n 
1   4589 DC n 
1   4590 DA n 
1   4591 DG n 
1   4592 DT n 
1   4593 DT n 
1   4594 DA n 
1   4595 DA n 
1   4596 DT n 
1   4597 DT n 
1   4598 DC n 
1   4599 DT n 
1   4600 DC n 
1   4601 DC n 
1   4602 DC n 
1   4603 DG n 
1   4604 DT n 
1   4605 DC n 
1   4606 DT n 
1   4607 DA n 
1   4608 DA n 
1   4609 DT n 
1   4610 DG n 
1   4611 DC n 
1   4612 DG n 
1   4613 DC n 
1   4614 DT n 
1   4615 DT n 
1   4616 DC n 
1   4617 DC n 
1   4618 DC n 
1   4619 DT n 
1   4620 DG n 
1   4621 DT n 
1   4622 DT n 
1   4623 DT n 
1   4624 DT n 
1   4625 DT n 
1   4626 DA n 
1   4627 DT n 
1   4628 DG n 
1   4629 DT n 
1   4630 DT n 
1   4631 DA n 
1   4632 DT n 
1   4633 DT n 
1   4634 DC n 
1   4635 DT n 
1   4636 DC n 
1   4637 DT n 
1   4638 DC n 
1   4639 DT n 
1   4640 DG n 
1   4641 DT n 
1   4642 DA n 
1   4643 DA n 
1   4644 DA n 
1   4645 DG n 
1   4646 DG n 
1   4647 DC n 
1   4648 DT n 
1   4649 DG n 
1   4650 DC n 
1   4651 DT n 
1   4652 DA n 
1   4653 DT n 
1   4654 DT n 
1   4655 DT n 
1   4656 DT n 
1   4657 DC n 
1   4658 DA n 
1   4659 DT n 
1   4660 DT n 
1   4661 DT n 
1   4662 DT n 
1   4663 DT n 
1   4664 DG n 
1   4665 DA n 
1   4666 DC n 
1   4667 DG n 
1   4668 DT n 
1   4669 DT n 
1   4670 DA n 
1   4671 DA n 
1   4672 DA n 
1   4673 DC n 
1   4674 DA n 
1   4675 DA n 
1   4676 DA n 
1   4677 DA n 
1   4678 DA n 
1   4679 DA n 
1   4680 DT n 
1   4681 DC n 
1   4682 DG n 
1   4683 DT n 
1   4684 DT n 
1   4685 DT n 
1   4686 DC n 
1   4687 DT n 
1   4688 DT n 
1   4689 DA n 
1   4690 DT n 
1   4691 DT n 
1   4692 DT n 
1   4693 DG n 
1   4694 DG n 
1   4695 DA n 
1   4696 DT n 
1   4697 DT n 
1   4698 DG n 
1   4699 DG n 
1   4700 DG n 
1   4701 DA n 
1   4702 DT n 
1   4703 DA n 
1   4704 DA n 
1   4705 DA n 
1   4706 DT n 
1   4707 DA n 
1   4708 DA n 
1   4709 DT n 
1   4710 DA n 
1   4711 DT n 
1   4712 DG n 
1   4713 DG n 
1   4714 DC n 
1   4715 DT n 
1   4716 DG n 
1   4717 DT n 
1   4718 DT n 
1   4719 DT n 
1   4720 DA n 
1   4721 DT n 
1   4722 DT n 
1   4723 DT n 
1   4724 DT n 
1   4725 DG n 
1   4726 DT n 
1   4727 DA n 
1   4728 DA n 
1   4729 DC n 
1   4730 DT n 
1   4731 DG n 
1   4732 DG n 
1   4733 DC n 
1   4734 DA n 
1   4735 DA n 
1   4736 DA n 
1   4737 DT n 
1   4738 DT n 
1   4739 DA n 
1   4740 DG n 
1   4741 DG n 
1   4742 DC n 
1   4743 DT n 
1   4744 DC n 
1   4745 DT n 
1   4746 DG n 
1   4747 DG n 
1   4748 DA n 
1   4749 DA n 
1   4750 DA n 
1   4751 DG n 
1   4752 DA n 
1   4753 DC n 
1   4754 DG n 
1   4755 DC n 
1   4756 DT n 
1   4757 DC n 
1   4758 DG n 
1   4759 DT n 
1   4760 DT n 
1   4761 DA n 
1   4762 DG n 
1   4763 DC n 
1   4764 DG n 
1   4765 DT n 
1   4766 DT n 
1   4767 DG n 
1   4768 DG n 
1   4769 DT n 
1   4770 DA n 
1   4771 DA n 
1   4772 DG n 
1   4773 DA n 
1   4774 DT n 
1   4775 DT n 
1   4776 DC n 
1   4777 DA n 
1   4778 DG n 
1   4779 DG n 
1   4780 DA n 
1   4781 DT n 
1   4782 DA n 
1   4783 DA n 
1   4784 DA n 
1   4785 DA n 
1   4786 DT n 
1   4787 DT n 
1   4788 DG n 
1   4789 DT n 
1   4790 DA n 
1   4791 DG n 
1   4792 DC n 
1   4793 DT n 
1   4794 DG n 
1   4795 DG n 
1   4796 DG n 
1   4797 DT n 
1   4798 DG n 
1   4799 DC n 
1   4800 DA n 
1   4801 DA n 
1   4802 DA n 
1   4803 DA n 
1   4804 DT n 
1   4805 DA n 
1   4806 DG n 
1   4807 DC n 
1   4808 DA n 
1   4809 DA n 
1   4810 DC n 
1   4811 DT n 
1   4812 DA n 
1   4813 DA n 
1   4814 DT n 
1   4815 DC n 
1   4816 DT n 
1   4817 DT n 
1   4818 DG n 
1   4819 DA n 
1   4820 DT n 
1   4821 DT n 
1   4822 DT n 
1   4823 DA n 
1   4824 DA n 
1   4825 DG n 
1   4826 DG n 
1   4827 DC n 
1   4828 DT n 
1   4829 DT n 
1   4830 DC n 
1   4831 DA n 
1   4832 DA n 
1   4833 DA n 
1   4834 DA n 
1   4835 DC n 
1   4836 DC n 
1   4837 DT n 
1   4838 DC n 
1   4839 DC n 
1   4840 DC n 
1   4841 DG n 
1   4842 DC n 
1   4843 DA n 
1   4844 DA n 
1   4845 DG n 
1   4846 DT n 
1   4847 DC n 
1   4848 DG n 
1   4849 DG n 
1   4850 DG n 
1   4851 DA n 
1   4852 DG n 
1   4853 DG n 
1   4854 DT n 
1   4855 DT n 
1   4856 DC n 
1   4857 DG n 
1   4858 DC n 
1   4859 DT n 
1   4860 DA n 
1   4861 DA n 
1   4862 DA n 
1   4863 DA n 
1   4864 DC n 
1   4865 DG n 
1   4866 DC n 
1   4867 DC n 
1   4868 DT n 
1   4869 DC n 
1   4870 DG n 
1   4871 DC n 
1   4872 DG n 
1   4873 DT n 
1   4874 DT n 
1   4875 DC n 
1   4876 DT n 
1   4877 DT n 
1   4878 DA n 
1   4879 DG n 
1   4880 DA n 
1   4881 DA n 
1   4882 DT n 
1   4883 DA n 
1   4884 DC n 
1   4885 DC n 
1   4886 DG n 
1   4887 DG n 
1   4888 DA n 
1   4889 DT n 
1   4890 DA n 
1   4891 DA n 
1   4892 DG n 
1   4893 DC n 
1   4894 DC n 
1   4895 DT n 
1   4896 DT n 
1   4897 DC n 
1   4898 DT n 
1   4899 DA n 
1   4900 DT n 
1   4901 DA n 
1   4902 DT n 
1   4903 DC n 
1   4904 DT n 
1   4905 DG n 
1   4906 DA n 
1   4907 DT n 
1   4908 DT n 
1   4909 DT n 
1   4910 DG n 
1   4911 DC n 
1   4912 DT n 
1   4913 DT n 
1   4914 DG n 
1   4915 DC n 
1   4916 DT n 
1   4917 DA n 
1   4918 DT n 
1   4919 DT n 
1   4920 DG n 
1   4921 DG n 
1   4922 DG n 
1   4923 DC n 
1   4924 DG n 
1   4925 DC n 
1   4926 DG n 
1   4927 DG n 
1   4928 DT n 
1   4929 DA n 
1   4930 DA n 
1   4931 DT n 
1   4932 DG n 
1   4933 DA n 
1   4934 DT n 
1   4935 DT n 
1   4936 DC n 
1   4937 DC n 
1   4938 DT n 
1   4939 DA n 
1   4940 DC n 
1   4941 DG n 
1   4942 DA n 
1   4943 DT n 
1   4944 DG n 
1   4945 DA n 
1   4946 DA n 
1   4947 DA n 
1   4948 DA n 
1   4949 DT n 
1   4950 DA n 
1   4951 DA n 
1   4952 DA n 
1   4953 DA n 
1   4954 DA n 
1   4955 DC n 
1   4956 DG n 
1   4957 DG n 
1   4958 DC n 
1   4959 DT n 
1   4960 DT n 
1   4961 DG n 
1   4962 DC n 
1   4963 DT n 
1   4964 DT n 
1   4965 DG n 
1   4966 DT n 
1   4967 DT n 
1   4968 DC n 
1   4969 DT n 
1   4970 DC n 
1   4971 DG n 
1   4972 DA n 
1   4973 DT n 
1   4974 DG n 
1   4975 DA n 
1   4976 DG n 
1   4977 DT n 
1   4978 DG n 
1   4979 DC n 
1   4980 DG n 
1   4981 DG n 
1   4982 DT n 
1   4983 DA n 
1   4984 DC n 
1   4985 DT n 
1   4986 DT n 
1   4987 DG n 
1   4988 DG n 
1   4989 DT n 
1   4990 DT n 
1   4991 DT n 
1   4992 DA n 
1   4993 DA n 
1   4994 DT n 
1   4995 DA n 
1   4996 DC n 
1   4997 DC n 
1   4998 DC n 
1   4999 DG n 
1   5000 DT n 
1   5001 DT n 
1   5002 DC n 
1   5003 DT n 
1   5004 DT n 
1   5005 DG n 
1   5006 DG n 
1   5007 DA n 
1   5008 DA n 
1   5009 DT n 
1   5010 DG n 
1   5011 DA n 
1   5012 DT n 
1   5013 DA n 
1   5014 DA n 
1   5015 DG n 
1   5016 DG n 
1   5017 DA n 
1   5018 DA n 
1   5019 DA n 
1   5020 DG n 
1   5021 DA n 
1   5022 DC n 
1   5023 DA n 
1   5024 DG n 
1   5025 DC n 
1   5026 DC n 
1   5027 DG n 
1   5028 DA n 
1   5029 DT n 
1   5030 DT n 
1   5031 DA n 
1   5032 DT n 
1   5033 DT n 
1   5034 DG n 
1   5035 DA n 
1   5036 DT n 
1   5037 DT n 
1   5038 DG n 
1   5039 DG n 
1   5040 DT n 
1   5041 DT n 
1   5042 DT n 
1   5043 DC n 
1   5044 DT n 
1   5045 DA n 
1   5046 DC n 
1   5047 DA n 
1   5048 DT n 
1   5049 DG n 
1   5050 DC n 
1   5051 DT n 
1   5052 DC n 
1   5053 DG n 
1   5054 DT n 
1   5055 DA n 
1   5056 DA n 
1   5057 DA n 
1   5058 DT n 
1   5059 DT n 
1   5060 DA n 
1   5061 DG n 
1   5062 DG n 
1   5063 DA n 
1   5064 DT n 
1   5065 DG n 
1   5066 DG n 
1   5067 DG n 
1   5068 DA n 
1   5069 DT n 
1   5070 DA n 
1   5071 DT n 
1   5072 DT n 
1   5073 DA n 
1   5074 DT n 
1   5075 DT n 
1   5076 DT n 
1   5077 DT n 
1   5078 DT n 
1   5079 DC n 
1   5080 DT n 
1   5081 DT n 
1   5082 DG n 
1   5083 DT n 
1   5084 DT n 
1   5085 DC n 
1   5086 DA n 
1   5087 DG n 
1   5088 DG n 
1   5089 DA n 
1   5090 DC n 
1   5091 DT n 
1   5092 DT n 
1   5093 DA n 
1   5094 DT n 
1   5095 DC n 
1   5096 DT n 
1   5097 DA n 
1   5098 DT n 
1   5099 DT n 
1   5100 DG n 
1   5101 DT n 
1   5102 DT n 
1   5103 DG n 
1   5104 DA n 
1   5105 DT n 
1   5106 DA n 
1   5107 DA n 
1   5108 DA n 
1   5109 DC n 
1   5110 DA n 
1   5111 DG n 
1   5112 DG n 
1   5113 DC n 
1   5114 DG n 
1   5115 DC n 
1   5116 DG n 
1   5117 DT n 
1   5118 DT n 
1   5119 DC n 
1   5120 DT n 
1   5121 DG n 
1   5122 DC n 
1   5123 DA n 
1   5124 DT n 
1   5125 DT n 
1   5126 DA n 
1   5127 DG n 
1   5128 DC n 
1   5129 DT n 
1   5130 DG n 
1   5131 DA n 
1   5132 DA n 
1   5133 DC n 
1   5134 DA n 
1   5135 DT n 
1   5136 DG n 
1   5137 DT n 
1   5138 DT n 
1   5139 DG n 
1   5140 DT n 
1   5141 DT n 
1   5142 DT n 
1   5143 DA n 
1   5144 DT n 
1   5145 DT n 
1   5146 DG n 
1   5147 DT n 
1   5148 DC n 
1   5149 DG n 
1   5150 DT n 
1   5151 DC n 
1   5152 DG n 
1   5153 DT n 
1   5154 DC n 
1   5155 DT n 
1   5156 DG n 
1   5157 DG n 
1   5158 DA n 
1   5159 DC n 
1   5160 DA n 
1   5161 DG n 
1   5162 DA n 
1   5163 DA n 
1   5164 DT n 
1   5165 DT n 
1   5166 DA n 
1   5167 DC n 
1   5168 DT n 
1   5169 DT n 
1   5170 DT n 
1   5171 DA n 
1   5172 DC n 
1   5173 DC n 
1   5174 DT n 
1   5175 DT n 
1   5176 DT n 
1   5177 DT n 
1   5178 DG n 
1   5179 DT n 
1   5180 DC n 
1   5181 DG n 
1   5182 DG n 
1   5183 DT n 
1   5184 DA n 
1   5185 DC n 
1   5186 DT n 
1   5187 DT n 
1   5188 DT n 
1   5189 DA n 
1   5190 DT n 
1   5191 DA n 
1   5192 DT n 
1   5193 DT n 
1   5194 DC n 
1   5195 DT n 
1   5196 DC n 
1   5197 DT n 
1   5198 DT n 
1   5199 DA n 
1   5200 DT n 
1   5201 DT n 
1   5202 DA n 
1   5203 DC n 
1   5204 DT n 
1   5205 DG n 
1   5206 DG n 
1   5207 DC n 
1   5208 DT n 
1   5209 DC n 
1   5210 DG n 
1   5211 DA n 
1   5212 DA n 
1   5213 DA n 
1   5214 DA n 
1   5215 DT n 
1   5216 DG n 
1   5217 DC n 
1   5218 DC n 
1   5219 DT n 
1   5220 DC n 
1   5221 DT n 
1   5222 DG n 
1   5223 DC n 
1   5224 DC n 
1   5225 DT n 
1   5226 DA n 
1   5227 DA n 
1   5228 DA n 
1   5229 DT n 
1   5230 DT n 
1   5231 DA n 
1   5232 DC n 
1   5233 DA n 
1   5234 DT n 
1   5235 DG n 
1   5236 DT n 
1   5237 DT n 
1   5238 DG n 
1   5239 DG n 
1   5240 DC n 
1   5241 DG n 
1   5242 DT n 
1   5243 DT n 
1   5244 DG n 
1   5245 DT n 
1   5246 DT n 
1   5247 DA n 
1   5248 DA n 
1   5249 DA n 
1   5250 DT n 
1   5251 DA n 
1   5252 DT n 
1   5253 DG n 
1   5254 DG n 
1   5255 DC n 
1   5256 DG n 
1   5257 DA n 
1   5258 DT n 
1   5259 DT n 
1   5260 DC n 
1   5261 DT n 
1   5262 DC n 
1   5263 DA n 
1   5264 DA n 
1   5265 DT n 
1   5266 DT n 
1   5267 DA n 
1   5268 DA n 
1   5269 DG n 
1   5270 DC n 
1   5271 DC n 
1   5272 DC n 
1   5273 DT n 
1   5274 DA n 
1   5275 DC n 
1   5276 DT n 
1   5277 DG n 
1   5278 DT n 
1   5279 DT n 
1   5280 DG n 
1   5281 DA n 
1   5282 DG n 
1   5283 DC n 
1   5284 DG n 
1   5285 DT n 
1   5286 DT n 
1   5287 DG n 
1   5288 DG n 
1   5289 DC n 
1   5290 DT n 
1   5291 DT n 
1   5292 DT n 
1   5293 DA n 
1   5294 DT n 
1   5295 DA n 
1   5296 DC n 
1   5297 DT n 
1   5298 DG n 
1   5299 DG n 
1   5300 DT n 
1   5301 DA n 
1   5302 DA n 
1   5303 DG n 
1   5304 DA n 
1   5305 DA n 
1   5306 DT n 
1   5307 DT n 
1   5308 DT n 
1   5309 DG n 
1   5310 DT n 
1   5311 DA n 
1   5312 DT n 
1   5313 DA n 
1   5314 DA n 
1   5315 DC n 
1   5316 DG n 
1   5317 DC n 
1   5318 DA n 
1   5319 DT n 
1   5320 DA n 
1   5321 DT n 
1   5322 DG n 
1   5323 DA n 
1   5324 DT n 
1   5325 DA n 
1   5326 DC n 
1   5327 DT n 
1   5328 DA n 
1   5329 DA n 
1   5330 DA n 
1   5331 DC n 
1   5332 DA n 
1   5333 DG n 
1   5334 DG n 
1   5335 DC n 
1   5336 DT n 
1   5337 DT n 
1   5338 DT n 
1   5339 DT n 
1   5340 DT n 
1   5341 DC n 
1   5342 DT n 
1   5343 DA n 
1   5344 DG n 
1   5345 DT n 
1   5346 DA n 
1   5347 DA n 
1   5348 DT n 
1   5349 DT n 
1   5350 DA n 
1   5351 DT n 
1   5352 DG n 
1   5353 DA n 
1   5354 DT n 
1   5355 DT n 
1   5356 DC n 
1   5357 DC n 
1   5358 DG n 
1   5359 DG n 
1   5360 DT n 
1   5361 DG n 
1   5362 DT n 
1   5363 DT n 
1   5364 DT n 
1   5365 DA n 
1   5366 DT n 
1   5367 DT n 
1   5368 DC n 
1   5369 DT n 
1   5370 DT n 
1   5371 DA n 
1   5372 DT n 
1   5373 DT n 
1   5374 DT n 
1   5375 DA n 
1   5376 DA n 
1   5377 DC n 
1   5378 DG n 
1   5379 DC n 
1   5380 DC n 
1   5381 DT n 
1   5382 DT n 
1   5383 DA n 
1   5384 DT n 
1   5385 DT n 
1   5386 DT n 
1   5387 DA n 
1   5388 DT n 
1   5389 DC n 
1   5390 DA n 
1   5391 DC n 
1   5392 DA n 
1   5393 DC n 
1   5394 DG n 
1   5395 DG n 
1   5396 DT n 
1   5397 DC n 
1   5398 DG n 
1   5399 DG n 
1   5400 DT n 
1   5401 DA n 
1   5402 DT n 
1   5403 DT n 
1   5404 DT n 
1   5405 DC n 
1   5406 DA n 
1   5407 DA n 
1   5408 DA n 
1   5409 DC n 
1   5410 DC n 
1   5411 DA n 
1   5412 DT n 
1   5413 DT n 
1   5414 DA n 
1   5415 DA n 
1   5416 DA n 
1   5417 DT n 
1   5418 DT n 
1   5419 DT n 
1   5420 DA n 
1   5421 DG n 
1   5422 DG n 
1   5423 DT n 
1   5424 DC n 
1   5425 DA n 
1   5426 DG n 
1   5427 DA n 
1   5428 DA n 
1   5429 DG n 
1   5430 DA n 
1   5431 DT n 
1   5432 DG n 
1   5433 DA n 
1   5434 DA n 
1   5435 DA n 
1   5436 DT n 
1   5437 DT n 
1   5438 DA n 
1   5439 DA n 
1   5440 DC n 
1   5441 DT n 
1   5442 DA n 
1   5443 DA n 
1   5444 DA n 
1   5445 DA n 
1   5446 DT n 
1   5447 DA n 
1   5448 DT n 
1   5449 DA n 
1   5450 DT n 
1   5451 DT n 
1   5452 DT n 
1   5453 DG n 
1   5454 DA n 
1   5455 DA n 
1   5456 DA n 
1   5457 DA n 
1   5458 DA n 
1   5459 DG n 
1   5460 DT n 
1   5461 DT n 
1   5462 DT n 
1   5463 DT n 
1   5464 DC n 
1   5465 DT n 
1   5466 DC n 
1   5467 DG n 
1   5468 DC n 
1   5469 DG n 
1   5470 DT n 
1   5471 DT n 
1   5472 DC n 
1   5473 DT n 
1   5474 DT n 
1   5475 DT n 
1   5476 DG n 
1   5477 DT n 
1   5478 DC n 
1   5479 DT n 
1   5480 DT n 
1   5481 DG n 
1   5482 DC n 
1   5483 DG n 
1   5484 DA n 
1   5485 DT n 
1   5486 DT n 
1   5487 DG n 
1   5488 DG n 
1   5489 DA n 
1   5490 DT n 
1   5491 DT n 
1   5492 DT n 
1   5493 DG n 
1   5494 DC n 
1   5495 DA n 
1   5496 DT n 
1   5497 DC n 
1   5498 DA n 
1   5499 DG n 
1   5500 DC n 
1   5501 DA n 
1   5502 DT n 
1   5503 DT n 
1   5504 DT n 
1   5505 DA n 
1   5506 DC n 
1   5507 DA n 
1   5508 DT n 
1   5509 DA n 
1   5510 DT n 
1   5511 DA n 
1   5512 DG n 
1   5513 DT n 
1   5514 DT n 
1   5515 DA n 
1   5516 DT n 
1   5517 DA n 
1   5518 DT n 
1   5519 DA n 
1   5520 DA n 
1   5521 DC n 
1   5522 DC n 
1   5523 DC n 
1   5524 DA n 
1   5525 DA n 
1   5526 DC n 
1   5527 DC n 
1   5528 DT n 
1   5529 DA n 
1   5530 DA n 
1   5531 DG n 
1   5532 DC n 
1   5533 DC n 
1   5534 DG n 
1   5535 DG n 
1   5536 DA n 
1   5537 DG n 
1   5538 DG n 
1   5539 DT n 
1   5540 DT n 
1   5541 DA n 
1   5542 DA n 
1   5543 DA n 
1   5544 DA n 
1   5545 DA n 
1   5546 DG n 
1   5547 DG n 
1   5548 DT n 
1   5549 DA n 
1   5550 DG n 
1   5551 DT n 
1   5552 DC n 
1   5553 DT n 
1   5554 DC n 
1   5555 DT n 
1   5556 DC n 
1   5557 DA n 
1   5558 DG n 
1   5559 DA n 
1   5560 DC n 
1   5561 DC n 
1   5562 DT n 
1   5563 DA n 
1   5564 DT n 
1   5565 DG n 
1   5566 DA n 
1   5567 DT n 
1   5568 DT n 
1   5569 DT n 
1   5570 DT n 
1   5571 DG n 
1   5572 DA n 
1   5573 DT n 
1   5574 DA n 
1   5575 DA n 
1   5576 DA n 
1   5577 DT n 
1   5578 DT n 
1   5579 DC n 
1   5580 DA n 
1   5581 DC n 
1   5582 DT n 
1   5583 DA n 
1   5584 DT n 
1   5585 DT n 
1   5586 DG n 
1   5587 DA n 
1   5588 DC n 
1   5589 DT n 
1   5590 DC n 
1   5591 DT n 
1   5592 DT n 
1   5593 DC n 
1   5594 DT n 
1   5595 DC n 
1   5596 DA n 
1   5597 DG n 
1   5598 DC n 
1   5599 DG n 
1   5600 DT n 
1   5601 DC n 
1   5602 DT n 
1   5603 DT n 
1   5604 DA n 
1   5605 DA n 
1   5606 DT n 
1   5607 DC n 
1   5608 DT n 
1   5609 DA n 
1   5610 DA n 
1   5611 DG n 
1   5612 DC n 
1   5613 DT n 
1   5614 DA n 
1   5615 DT n 
1   5616 DC n 
1   5617 DG n 
1   5618 DC n 
1   5619 DT n 
1   5620 DA n 
1   5621 DT n 
1   5622 DG n 
1   5623 DT n 
1   5624 DT n 
1   5625 DT n 
1   5626 DT n 
1   5627 DC n 
1   5628 DA n 
1   5629 DA n 
1   5630 DG n 
1   5631 DG n 
1   5632 DA n 
1   5633 DT n 
1   5634 DT n 
1   5635 DC n 
1   5636 DT n 
1   5637 DA n 
1   5638 DA n 
1   5639 DG n 
1   5640 DG n 
1   5641 DG n 
1   5642 DA n 
1   5643 DA n 
1   5644 DA n 
1   5645 DA n 
1   5646 DT n 
1   5647 DT n 
1   5648 DA n 
1   5649 DA n 
1   5650 DT n 
1   5651 DT n 
1   5652 DA n 
1   5653 DA n 
1   5654 DT n 
1   5655 DA n 
1   5656 DG n 
1   5657 DC n 
1   5658 DG n 
1   5659 DA n 
1   5660 DC n 
1   5661 DG n 
1   5662 DA n 
1   5663 DT n 
1   5664 DT n 
1   5665 DT n 
1   5666 DA n 
1   5667 DC n 
1   5668 DA n 
1   5669 DG n 
1   5670 DA n 
1   5671 DA n 
1   5672 DG n 
1   5673 DC n 
1   5674 DA n 
1   5675 DA n 
1   5676 DG n 
1   5677 DG n 
1   5678 DT n 
1   5679 DT n 
1   5680 DA n 
1   5681 DT n 
1   5682 DT n 
1   5683 DC n 
1   5684 DA n 
1   5685 DC n 
1   5686 DT n 
1   5687 DC n 
1   5688 DA n 
1   5689 DC n 
1   5690 DA n 
1   5691 DT n 
1   5692 DA n 
1   5693 DT n 
1   5694 DA n 
1   5695 DT n 
1   5696 DT n 
1   5697 DG n 
1   5698 DA n 
1   5699 DT n 
1   5700 DT n 
1   5701 DT n 
1   5702 DA n 
1   5703 DT n 
1   5704 DG n 
1   5705 DT n 
1   5706 DA n 
1   5707 DC n 
1   5708 DT n 
1   5709 DG n 
1   5710 DT n 
1   5711 DT n 
1   5712 DT n 
1   5713 DC n 
1   5714 DC n 
1   5715 DA n 
1   5716 DT n 
1   5717 DT n 
1   5718 DA n 
1   5719 DA n 
1   5720 DA n 
1   5721 DA n 
1   5722 DA n 
1   5723 DA n 
1   5724 DG n 
1   5725 DG n 
1   5726 DT n 
1   5727 DA n 
1   5728 DA n 
1   5729 DT n 
1   5730 DT n 
1   5731 DC n 
1   5732 DA n 
1   5733 DA n 
1   5734 DA n 
1   5735 DT n 
1   5736 DG n 
1   5737 DA n 
1   5738 DA n 
1   5739 DA n 
1   5740 DT n 
1   5741 DT n 
1   5742 DG n 
1   5743 DT n 
1   5744 DT n 
1   5745 DA n 
1   5746 DA n 
1   5747 DA n 
1   5748 DT n 
1   5749 DG n 
1   5750 DT n 
1   5751 DA n 
1   5752 DA n 
1   5753 DT n 
1   5754 DT n 
1   5755 DA n 
1   5756 DA n 
1   5757 DT n 
1   5758 DT n 
1   5759 DT n 
1   5760 DT n 
1   5761 DG n 
1   5762 DT n 
1   5763 DT n 
1   5764 DT n 
1   5765 DT n 
1   5766 DC n 
1   5767 DT n 
1   5768 DT n 
1   5769 DG n 
1   5770 DA n 
1   5771 DT n 
1   5772 DG n 
1   5773 DT n 
1   5774 DT n 
1   5775 DT n 
1   5776 DG n 
1   5777 DT n 
1   5778 DT n 
1   5779 DT n 
1   5780 DC n 
1   5781 DA n 
1   5782 DT n 
1   5783 DC n 
1   5784 DA n 
1   5785 DT n 
1   5786 DC n 
1   5787 DT n 
1   5788 DT n 
1   5789 DC n 
1   5790 DT n 
1   5791 DT n 
1   5792 DT n 
1   5793 DT n 
1   5794 DG n 
1   5795 DC n 
1   5796 DT n 
1   5797 DC n 
1   5798 DA n 
1   5799 DG n 
1   5800 DG n 
1   5801 DT n 
1   5802 DA n 
1   5803 DA n 
1   5804 DT n 
1   5805 DT n 
1   5806 DG n 
1   5807 DA n 
1   5808 DA n 
1   5809 DA n 
1   5810 DT n 
1   5811 DG n 
1   5812 DA n 
1   5813 DA n 
1   5814 DT n 
1   5815 DA n 
1   5816 DA n 
1   5817 DT n 
1   5818 DT n 
1   5819 DC n 
1   5820 DG n 
1   5821 DC n 
1   5822 DC n 
1   5823 DT n 
1   5824 DC n 
1   5825 DT n 
1   5826 DG n 
1   5827 DC n 
1   5828 DG n 
1   5829 DC n 
1   5830 DG n 
1   5831 DA n 
1   5832 DT n 
1   5833 DT n 
1   5834 DT n 
1   5835 DT n 
1   5836 DG n 
1   5837 DT n 
1   5838 DA n 
1   5839 DA n 
1   5840 DC n 
1   5841 DT n 
1   5842 DT n 
1   5843 DG n 
1   5844 DG n 
1   5845 DT n 
1   5846 DA n 
1   5847 DT n 
1   5848 DT n 
1   5849 DC n 
1   5850 DA n 
1   5851 DA n 
1   5852 DA n 
1   5853 DG n 
1   5854 DC n 
1   5855 DA n 
1   5856 DA n 
1   5857 DT n 
1   5858 DC n 
1   5859 DA n 
1   5860 DG n 
1   5861 DG n 
1   5862 DC n 
1   5863 DG n 
1   5864 DA n 
1   5865 DA n 
1   5866 DT n 
1   5867 DC n 
1   5868 DC n 
1   5869 DG n 
1   5870 DT n 
1   5871 DT n 
1   5872 DA n 
1   5873 DT n 
1   5874 DT n 
1   5875 DG n 
1   5876 DT n 
1   5877 DT n 
1   5878 DT n 
1   5879 DC n 
1   5880 DT n 
1   5881 DC n 
1   5882 DC n 
1   5883 DC n 
1   5884 DG n 
1   5885 DA n 
1   5886 DT n 
1   5887 DG n 
1   5888 DT n 
1   5889 DA n 
1   5890 DA n 
1   5891 DA n 
1   5892 DA n 
1   5893 DG n 
1   5894 DG n 
1   5895 DT n 
1   5896 DA n 
1   5897 DC n 
1   5898 DT n 
1   5899 DG n 
1   5900 DT n 
1   5901 DT n 
1   5902 DA n 
1   5903 DC n 
1   5904 DT n 
1   5905 DG n 
1   5906 DT n 
1   5907 DA n 
1   5908 DT n 
1   5909 DA n 
1   5910 DT n 
1   5911 DT n 
1   5912 DC n 
1   5913 DA n 
1   5914 DT n 
1   5915 DC n 
1   5916 DT n 
1   5917 DG n 
1   5918 DA n 
1   5919 DC n 
1   5920 DG n 
1   5921 DT n 
1   5922 DT n 
1   5923 DA n 
1   5924 DA n 
1   5925 DA n 
1   5926 DC n 
1   5927 DC n 
1   5928 DT n 
1   5929 DG n 
1   5930 DA n 
1   5931 DA n 
1   5932 DA n 
1   5933 DA n 
1   5934 DT n 
1   5935 DC n 
1   5936 DT n 
1   5937 DA n 
1   5938 DC n 
1   5939 DG n 
1   5940 DC n 
1   5941 DA n 
1   5942 DA n 
1   5943 DT n 
1   5944 DT n 
1   5945 DT n 
1   5946 DC n 
1   5947 DT n 
1   5948 DT n 
1   5949 DT n 
1   5950 DA n 
1   5951 DT n 
1   5952 DT n 
1   5953 DT n 
1   5954 DC n 
1   5955 DT n 
1   5956 DG n 
1   5957 DT n 
1   5958 DT n 
1   5959 DT n 
1   5960 DT n 
1   5961 DA n 
1   5962 DC n 
1   5963 DG n 
1   5964 DT n 
1   5965 DG n 
1   5966 DC n 
1   5967 DA n 
1   5968 DA n 
1   5969 DA n 
1   5970 DT n 
1   5971 DA n 
1   5972 DA n 
1   5973 DT n 
1   5974 DT n 
1   5975 DT n 
1   5976 DT n 
1   5977 DG n 
1   5978 DA n 
1   5979 DT n 
1   5980 DA n 
1   5981 DT n 
1   5982 DG n 
1   5983 DG n 
1   5984 DT n 
1   5985 DA n 
1   5986 DG n 
1   5987 DG n 
1   5988 DT n 
1   5989 DT n 
1   5990 DC n 
1   5991 DT n 
1   5992 DA n 
1   5993 DA n 
1   5994 DC n 
1   5995 DC n 
1   5996 DC n 
1   5997 DT n 
1   5998 DT n 
1   5999 DC n 
1   6000 DC n 
1   6001 DA n 
1   6002 DT n 
1   6003 DT n 
1   6004 DA n 
1   6005 DT n 
1   6006 DT n 
1   6007 DC n 
1   6008 DA n 
1   6009 DG n 
1   6010 DA n 
1   6011 DA n 
1   6012 DG n 
1   6013 DT n 
1   6014 DA n 
1   6015 DT n 
1   6016 DA n 
1   6017 DA n 
1   6018 DT n 
1   6019 DC n 
1   6020 DC n 
1   6021 DA n 
1   6022 DA n 
1   6023 DA n 
1   6024 DC n 
1   6025 DA n 
1   6026 DA n 
1   6027 DT n 
1   6028 DC n 
1   6029 DA n 
1   6030 DG n 
1   6031 DG n 
1   6032 DA n 
1   6033 DT n 
1   6034 DT n 
1   6035 DA n 
1   6036 DT n 
1   6037 DA n 
1   6038 DT n 
1   6039 DT n 
1   6040 DG n 
1   6041 DA n 
1   6042 DT n 
1   6043 DG n 
1   6044 DA n 
1   6045 DA n 
1   6046 DT n 
1   6047 DT n 
1   6048 DG n 
1   6049 DC n 
1   6050 DC n 
1   6051 DA n 
1   6052 DT n 
1   6053 DC n 
1   6054 DA n 
1   6055 DT n 
1   6056 DC n 
1   6057 DT n 
1   6058 DG n 
1   6059 DA n 
1   6060 DT n 
1   6061 DA n 
1   6062 DA n 
1   6063 DT n 
1   6064 DC n 
1   6065 DA n 
1   6066 DG n 
1   6067 DG n 
1   6068 DA n 
1   6069 DA n 
1   6070 DT n 
1   6071 DA n 
1   6072 DT n 
1   6073 DG n 
1   6074 DA n 
1   6075 DT n 
1   6076 DG n 
1   6077 DA n 
1   6078 DT n 
1   6079 DA n 
1   6080 DA n 
1   6081 DT n 
1   6082 DT n 
1   6083 DC n 
1   6084 DC n 
1   6085 DG n 
1   6086 DC n 
1   6087 DT n 
1   6088 DC n 
1   6089 DC n 
1   6090 DT n 
1   6091 DT n 
1   6092 DC n 
1   6093 DT n 
1   6094 DG n 
1   6095 DG n 
1   6096 DT n 
1   6097 DG n 
1   6098 DG n 
1   6099 DT n 
1   6100 DT n 
1   6101 DT n 
1   6102 DC n 
1   6103 DT n 
1   6104 DT n 
1   6105 DT n 
1   6106 DG n 
1   6107 DT n 
1   6108 DT n 
1   6109 DC n 
1   6110 DC n 
1   6111 DG n 
1   6112 DC n 
1   6113 DA n 
1   6114 DA n 
1   6115 DA n 
1   6116 DA n 
1   6117 DT n 
1   6118 DG n 
1   6119 DA n 
1   6120 DT n 
1   6121 DA n 
1   6122 DA n 
1   6123 DT n 
1   6124 DG n 
1   6125 DT n 
1   6126 DT n 
1   6127 DA n 
1   6128 DC n 
1   6129 DT n 
1   6130 DC n 
1   6131 DA n 
1   6132 DA n 
1   6133 DA n 
1   6134 DC n 
1   6135 DT n 
1   6136 DT n 
1   6137 DT n 
1   6138 DT n 
1   6139 DA n 
1   6140 DA n 
1   6141 DA n 
1   6142 DA n 
1   6143 DT n 
1   6144 DT n 
1   6145 DA n 
1   6146 DA n 
1   6147 DT n 
1   6148 DA n 
1   6149 DA n 
1   6150 DC n 
1   6151 DG n 
1   6152 DT n 
1   6153 DT n 
1   6154 DC n 
1   6155 DG n 
1   6156 DG n 
1   6157 DG n 
1   6158 DC n 
1   6159 DA n 
1   6160 DA n 
1   6161 DA n 
1   6162 DG n 
1   6163 DG n 
1   6164 DA n 
1   6165 DT n 
1   6166 DT n 
1   6167 DT n 
1   6168 DA n 
1   6169 DA n 
1   6170 DT n 
1   6171 DA n 
1   6172 DC n 
1   6173 DG n 
1   6174 DA n 
1   6175 DG n 
1   6176 DT n 
1   6177 DT n 
1   6178 DG n 
1   6179 DT n 
1   6180 DC n 
1   6181 DG n 
1   6182 DA n 
1   6183 DA n 
1   6184 DT n 
1   6185 DT n 
1   6186 DG n 
1   6187 DT n 
1   6188 DT n 
1   6189 DT n 
1   6190 DG n 
1   6191 DT n 
1   6192 DA n 
1   6193 DA n 
1   6194 DA n 
1   6195 DG n 
1   6196 DT n 
1   6197 DC n 
1   6198 DT n 
1   6199 DA n 
1   6200 DA n 
1   6201 DT n 
1   6202 DA n 
1   6203 DC n 
1   6204 DT n 
1   6205 DT n 
1   6206 DC n 
1   6207 DT n 
1   6208 DA n 
1   6209 DA n 
1   6210 DA n 
1   6211 DT n 
1   6212 DC n 
1   6213 DC n 
1   6214 DT n 
1   6215 DC n 
1   6216 DA n 
1   6217 DA n 
1   6218 DA n 
1   6219 DT n 
1   6220 DG n 
1   6221 DT n 
1   6222 DA n 
1   6223 DT n 
1   6224 DT n 
1   6225 DA n 
1   6226 DT n 
1   6227 DC n 
1   6228 DT n 
1   6229 DA n 
1   6230 DT n 
1   6231 DT n 
1   6232 DG n 
1   6233 DA n 
1   6234 DC n 
1   6235 DG n 
1   6236 DG n 
1   6237 DC n 
1   6238 DT n 
1   6239 DC n 
1   6240 DT n 
1   6241 DA n 
1   6242 DA n 
1   6243 DT n 
1   6244 DC n 
1   6245 DT n 
1   6246 DA n 
1   6247 DT n 
1   6248 DT n 
1   6249 DA n 
1   6250 DG n 
1   6251 DT n 
1   6252 DT n 
1   6253 DG n 
1   6254 DT n 
1   6255 DT n 
1   6256 DA n 
1   6257 DG n 
1   6258 DT n 
1   6259 DG n 
1   6260 DC n 
1   6261 DT n 
1   6262 DC n 
1   6263 DC n 
1   6264 DT n 
1   6265 DA n 
1   6266 DA n 
1   6267 DA n 
1   6268 DG n 
1   6269 DA n 
1   6270 DT n 
1   6271 DA n 
1   6272 DT n 
1   6273 DT n 
1   6274 DT n 
1   6275 DT n 
1   6276 DA n 
1   6277 DG n 
1   6278 DA n 
1   6279 DT n 
1   6280 DA n 
1   6281 DA n 
1   6282 DC n 
1   6283 DC n 
1   6284 DT n 
1   6285 DT n 
1   6286 DC n 
1   6287 DC n 
1   6288 DT n 
1   6289 DC n 
1   6290 DA n 
1   6291 DA n 
1   6292 DT n 
1   6293 DT n 
1   6294 DC n 
1   6295 DC n 
1   6296 DT n 
1   6297 DT n 
1   6298 DT n 
1   6299 DC n 
1   6300 DA n 
1   6301 DA n 
1   6302 DC n 
1   6303 DT n 
1   6304 DG n 
1   6305 DT n 
1   6306 DT n 
1   6307 DG n 
1   6308 DA n 
1   6309 DT n 
1   6310 DT n 
1   6311 DT n 
1   6312 DG n 
1   6313 DC n 
1   6314 DC n 
1   6315 DA n 
1   6316 DA n 
1   6317 DC n 
1   6318 DT n 
1   6319 DG n 
1   6320 DA n 
1   6321 DC n 
1   6322 DC n 
1   6323 DA n 
1   6324 DG n 
1   6325 DA n 
1   6326 DT n 
1   6327 DA n 
1   6328 DT n 
1   6329 DT n 
1   6330 DG n 
1   6331 DA n 
1   6332 DT n 
1   6333 DT n 
1   6334 DG n 
1   6335 DA n 
1   6336 DG n 
1   6337 DG n 
1   6338 DG n 
1   6339 DT n 
1   6340 DT n 
1   6341 DT n 
1   6342 DG n 
1   6343 DA n 
1   6344 DT n 
1   6345 DA n 
1   6346 DT n 
1   6347 DT n 
1   6348 DT n 
1   6349 DG n 
1   6350 DA n 
1   6351 DG n 
1   6352 DG n 
1   6353 DT n 
1   6354 DT n 
1   6355 DC n 
1   6356 DA n 
1   6357 DG n 
1   6358 DC n 
1   6359 DA n 
1   6360 DA n 
1   6361 DG n 
1   6362 DG n 
1   6363 DT n 
1   6364 DG n 
1   6365 DA n 
1   6366 DT n 
1   6367 DG n 
1   6368 DC n 
1   6369 DT n 
1   6370 DT n 
1   6371 DT n 
1   6372 DA n 
1   6373 DG n 
1   6374 DA n 
1   6375 DT n 
1   6376 DT n 
1   6377 DT n 
1   6378 DT n 
1   6379 DT n 
1   6380 DC n 
1   6381 DA n 
1   6382 DT n 
1   6383 DT n 
1   6384 DT n 
1   6385 DG n 
1   6386 DC n 
1   6387 DT n 
1   6388 DG n 
1   6389 DC n 
1   6390 DT n 
1   6391 DG n 
1   6392 DG n 
1   6393 DC n 
1   6394 DT n 
1   6395 DC n 
1   6396 DT n 
1   6397 DC n 
1   6398 DA n 
1   6399 DG n 
1   6400 DC n 
1   6401 DG n 
1   6402 DT n 
1   6403 DG n 
1   6404 DG n 
1   6405 DC n 
1   6406 DA n 
1   6407 DC n 
1   6408 DT n 
1   6409 DG n 
1   6410 DT n 
1   6411 DT n 
1   6412 DG n 
1   6413 DC n 
1   6414 DA n 
1   6415 DG n 
1   6416 DG n 
1   6417 DC n 
1   6418 DG n 
1   6419 DG n 
1   6420 DT n 
1   6421 DG n 
1   6422 DT n 
1   6423 DT n 
1   6424 DA n 
1   6425 DA n 
1   6426 DT n 
1   6427 DA n 
1   6428 DC n 
1   6429 DT n 
1   6430 DG n 
1   6431 DA n 
1   6432 DC n 
1   6433 DC n 
1   6434 DG n 
1   6435 DC n 
1   6436 DC n 
1   6437 DT n 
1   6438 DC n 
1   6439 DA n 
1   6440 DC n 
1   6441 DC n 
1   6442 DT n 
1   6443 DC n 
1   6444 DT n 
1   6445 DG n 
1   6446 DT n 
1   6447 DT n 
1   6448 DT n 
1   6449 DT n 
1   6450 DA n 
1   6451 DT n 
1   6452 DC n 
1   6453 DT n 
1   6454 DT n 
1   6455 DC n 
1   6456 DT n 
1   6457 DG n 
1   6458 DC n 
1   6459 DT n 
1   6460 DG n 
1   6461 DG n 
1   6462 DT n 
1   6463 DG n 
1   6464 DG n 
1   6465 DT n 
1   6466 DT n 
1   6467 DC n 
1   6468 DG n 
1   6469 DT n 
1   6470 DT n 
1   6471 DC n 
1   6472 DG n 
1   6473 DG n 
1   6474 DT n 
1   6475 DA n 
1   6476 DT n 
1   6477 DT n 
1   6478 DT n 
1   6479 DT n 
1   6480 DT n 
1   6481 DA n 
1   6482 DA n 
1   6483 DT n 
1   6484 DG n 
1   6485 DG n 
1   6486 DC n 
1   6487 DG n 
1   6488 DA n 
1   6489 DT n 
1   6490 DG n 
1   6491 DT n 
1   6492 DT n 
1   6493 DT n 
1   6494 DT n 
1   6495 DA n 
1   6496 DG n 
1   6497 DG n 
1   6498 DG n 
1   6499 DC n 
1   6500 DT n 
1   6501 DA n 
1   6502 DT n 
1   6503 DC n 
1   6504 DA n 
1   6505 DG n 
1   6506 DT n 
1   6507 DT n 
1   6508 DC n 
1   6509 DG n 
1   6510 DC n 
1   6511 DG n 
1   6512 DC n 
1   6513 DA n 
1   6514 DT n 
1   6515 DT n 
1   6516 DA n 
1   6517 DA n 
1   6518 DA n 
1   6519 DG n 
1   6520 DA n 
1   6521 DC n 
1   6522 DT n 
1   6523 DA n 
1   6524 DA n 
1   6525 DT n 
1   6526 DA n 
1   6527 DG n 
1   6528 DC n 
1   6529 DC n 
1   6530 DA n 
1   6531 DT n 
1   6532 DT n 
1   6533 DC n 
1   6534 DA n 
1   6535 DA n 
1   6536 DA n 
1   6537 DA n 
1   6538 DA n 
1   6539 DT n 
1   6540 DA n 
1   6541 DT n 
1   6542 DT n 
1   6543 DG n 
1   6544 DT n 
1   6545 DC n 
1   6546 DT n 
1   6547 DG n 
1   6548 DT n 
1   6549 DG n 
1   6550 DC n 
1   6551 DC n 
1   6552 DA n 
1   6553 DC n 
1   6554 DG n 
1   6555 DT n 
1   6556 DA n 
1   6557 DT n 
1   6558 DT n 
1   6559 DC n 
1   6560 DT n 
1   6561 DT n 
1   6562 DA n 
1   6563 DC n 
1   6564 DG n 
1   6565 DC n 
1   6566 DT n 
1   6567 DT n 
1   6568 DT n 
1   6569 DC n 
1   6570 DA n 
1   6571 DG n 
1   6572 DG n 
1   6573 DT n 
1   6574 DC n 
1   6575 DA n 
1   6576 DG n 
1   6577 DA n 
1   6578 DA n 
1   6579 DG n 
1   6580 DG n 
1   6581 DG n 
1   6582 DT n 
1   6583 DT n 
1   6584 DC n 
1   6585 DT n 
1   6586 DA n 
1   6587 DT n 
1   6588 DC n 
1   6589 DT n 
1   6590 DC n 
1   6591 DT n 
1   6592 DG n 
1   6593 DT n 
1   6594 DT n 
1   6595 DG n 
1   6596 DG n 
1   6597 DC n 
1   6598 DC n 
1   6599 DA n 
1   6600 DG n 
1   6601 DA n 
1   6602 DA n 
1   6603 DT n 
1   6604 DG n 
1   6605 DT n 
1   6606 DC n 
1   6607 DC n 
1   6608 DC n 
1   6609 DT n 
1   6610 DT n 
1   6611 DT n 
1   6612 DT n 
1   6613 DA n 
1   6614 DT n 
1   6615 DT n 
1   6616 DA n 
1   6617 DC n 
1   6618 DT n 
1   6619 DG n 
1   6620 DG n 
1   6621 DT n 
1   6622 DC n 
1   6623 DG n 
1   6624 DT n 
1   6625 DG n 
1   6626 DT n 
1   6627 DG n 
1   6628 DA n 
1   6629 DC n 
1   6630 DT n 
1   6631 DG n 
1   6632 DG n 
1   6633 DT n 
1   6634 DG n 
1   6635 DA n 
1   6636 DA n 
1   6637 DT n 
1   6638 DC n 
1   6639 DT n 
1   6640 DG n 
1   6641 DC n 
1   6642 DC n 
1   6643 DA n 
1   6644 DA n 
1   6645 DT n 
1   6646 DG n 
1   6647 DT n 
1   6648 DA n 
1   6649 DA n 
1   6650 DA n 
1   6651 DT n 
1   6652 DA n 
1   6653 DA n 
1   6654 DT n 
1   6655 DC n 
1   6656 DC n 
1   6657 DA n 
1   6658 DT n 
1   6659 DT n 
1   6660 DT n 
1   6661 DC n 
1   6662 DA n 
1   6663 DG n 
1   6664 DA n 
1   6665 DC n 
1   6666 DG n 
1   6667 DA n 
1   6668 DT n 
1   6669 DT n 
1   6670 DG n 
1   6671 DA n 
1   6672 DG n 
1   6673 DC n 
1   6674 DG n 
1   6675 DT n 
1   6676 DC n 
1   6677 DA n 
1   6678 DA n 
1   6679 DA n 
1   6680 DA n 
1   6681 DT n 
1   6682 DG n 
1   6683 DT n 
1   6684 DA n 
1   6685 DG n 
1   6686 DG n 
1   6687 DT n 
1   6688 DA n 
1   6689 DT n 
1   6690 DT n 
1   6691 DT n 
1   6692 DC n 
1   6693 DC n 
1   6694 DA n 
1   6695 DT n 
1   6696 DG n 
1   6697 DA n 
1   6698 DG n 
1   6699 DC n 
1   6700 DG n 
1   6701 DT n 
1   6702 DT n 
1   6703 DT n 
1   6704 DT n 
1   6705 DT n 
1   6706 DC n 
1   6707 DC n 
1   6708 DT n 
1   6709 DG n 
1   6710 DT n 
1   6711 DT n 
1   6712 DG n 
1   6713 DC n 
1   6714 DA n 
1   6715 DA n 
1   6716 DT n 
1   6717 DG n 
1   6718 DG n 
1   6719 DC n 
1   6720 DT n 
1   6721 DG n 
1   6722 DG n 
1   6723 DC n 
1   6724 DG n 
1   6725 DG n 
1   6726 DT n 
1   6727 DA n 
1   6728 DA n 
1   6729 DT n 
1   6730 DA n 
1   6731 DT n 
1   6732 DT n 
1   6733 DG n 
1   6734 DT n 
1   6735 DT n 
1   6736 DC n 
1   6737 DT n 
1   6738 DG n 
1   6739 DG n 
1   6740 DA n 
1   6741 DT n 
1   6742 DA n 
1   6743 DT n 
1   6744 DT n 
1   6745 DA n 
1   6746 DC n 
1   6747 DC n 
1   6748 DA n 
1   6749 DG n 
1   6750 DC n 
1   6751 DA n 
1   6752 DA n 
1   6753 DG n 
1   6754 DG n 
1   6755 DC n 
1   6756 DC n 
1   6757 DG n 
1   6758 DA n 
1   6759 DT n 
1   6760 DA n 
1   6761 DG n 
1   6762 DT n 
1   6763 DT n 
1   6764 DT n 
1   6765 DG n 
1   6766 DA n 
1   6767 DG n 
1   6768 DT n 
1   6769 DT n 
1   6770 DC n 
1   6771 DT n 
1   6772 DT n 
1   6773 DC n 
1   6774 DT n 
1   6775 DA n 
1   6776 DC n 
1   6777 DT n 
1   6778 DC n 
1   6779 DA n 
1   6780 DG n 
1   6781 DG n 
1   6782 DC n 
1   6783 DA n 
1   6784 DA n 
1   6785 DG n 
1   6786 DT n 
1   6787 DG n 
1   6788 DA n 
1   6789 DT n 
1   6790 DG n 
1   6791 DT n 
1   6792 DT n 
1   6793 DA n 
1   6794 DT n 
1   6795 DT n 
1   6796 DA n 
1   6797 DC n 
1   6798 DT n 
1   6799 DA n 
1   6800 DA n 
1   6801 DT n 
1   6802 DC n 
1   6803 DA n 
1   6804 DA n 
1   6805 DA n 
1   6806 DG n 
1   6807 DA n 
1   6808 DA n 
1   6809 DG n 
1   6810 DT n 
1   6811 DA n 
1   6812 DT n 
1   6813 DT n 
1   6814 DG n 
1   6815 DC n 
1   6816 DT n 
1   6817 DA n 
1   6818 DC n 
1   6819 DA n 
1   6820 DA n 
1   6821 DC n 
1   6822 DG n 
1   6823 DG n 
1   6824 DT n 
1   6825 DT n 
1   6826 DA n 
1   6827 DA n 
1   6828 DT n 
1   6829 DT n 
1   6830 DT n 
1   6831 DG n 
1   6832 DC n 
1   6833 DG n 
1   6834 DT n 
1   6835 DG n 
1   6836 DA n 
1   6837 DT n 
1   6838 DG n 
1   6839 DG n 
1   6840 DA n 
1   6841 DC n 
1   6842 DA n 
1   6843 DG n 
1   6844 DA n 
1   6845 DC n 
1   6846 DT n 
1   6847 DC n 
1   6848 DT n 
1   6849 DT n 
1   6850 DT n 
1   6851 DT n 
1   6852 DA n 
1   6853 DC n 
1   6854 DT n 
1   6855 DC n 
1   6856 DG n 
1   6857 DG n 
1   6858 DT n 
1   6859 DG n 
1   6860 DG n 
1   6861 DC n 
1   6862 DC n 
1   6863 DT n 
1   6864 DC n 
1   6865 DA n 
1   6866 DC n 
1   6867 DT n 
1   6868 DG n 
1   6869 DA n 
1   6870 DT n 
1   6871 DT n 
1   6872 DA n 
1   6873 DT n 
1   6874 DA n 
1   6875 DA n 
1   6876 DA n 
1   6877 DA n 
1   6878 DA n 
1   6879 DC n 
1   6880 DA n 
1   6881 DC n 
1   6882 DT n 
1   6883 DT n 
1   6884 DC n 
1   6885 DT n 
1   6886 DC n 
1   6887 DA n 
1   6888 DG n 
1   6889 DG n 
1   6890 DA n 
1   6891 DT n 
1   6892 DT n 
1   6893 DC n 
1   6894 DT n 
1   6895 DG n 
1   6896 DG n 
1   6897 DC n 
1   6898 DG n 
1   6899 DT n 
1   6900 DA n 
1   6901 DC n 
1   6902 DC n 
1   6903 DG n 
1   6904 DT n 
1   6905 DT n 
1   6906 DC n 
1   6907 DC n 
1   6908 DT n 
1   6909 DG n 
1   6910 DT n 
1   6911 DC n 
1   6912 DT n 
1   6913 DA n 
1   6914 DA n 
1   6915 DA n 
1   6916 DA n 
1   6917 DT n 
1   6918 DC n 
1   6919 DC n 
1   6920 DC n 
1   6921 DT n 
1   6922 DT n 
1   6923 DT n 
1   6924 DA n 
1   6925 DA n 
1   6926 DT n 
1   6927 DC n 
1   6928 DG n 
1   6929 DG n 
1   6930 DC n 
1   6931 DC n 
1   6932 DT n 
1   6933 DC n 
1   6934 DC n 
1   6935 DT n 
1   6936 DG n 
1   6937 DT n 
1   6938 DT n 
1   6939 DT n 
1   6940 DA n 
1   6941 DG n 
1   6942 DC n 
1   6943 DT n 
1   6944 DC n 
1   6945 DC n 
1   6946 DC n 
1   6947 DG n 
1   6948 DC n 
1   6949 DT n 
1   6950 DC n 
1   6951 DT n 
1   6952 DG n 
1   6953 DA n 
1   6954 DT n 
1   6955 DT n 
1   6956 DC n 
1   6957 DT n 
1   6958 DA n 
1   6959 DA n 
1   6960 DC n 
1   6961 DG n 
1   6962 DA n 
1   6963 DG n 
1   6964 DG n 
1   6965 DA n 
1   6966 DA n 
1   6967 DA n 
1   6968 DG n 
1   6969 DC n 
1   6970 DA n 
1   6971 DC n 
1   6972 DG n 
1   6973 DT n 
1   6974 DT n 
1   6975 DA n 
1   6976 DT n 
1   6977 DA n 
1   6978 DC n 
1   6979 DG n 
1   6980 DT n 
1   6981 DG n 
1   6982 DC n 
1   6983 DT n 
1   6984 DC n 
1   6985 DG n 
1   6986 DT n 
1   6987 DC n 
1   6988 DA n 
1   6989 DA n 
1   6990 DA n 
1   6991 DG n 
1   6992 DC n 
1   6993 DA n 
1   6994 DA n 
1   6995 DC n 
1   6996 DC n 
1   6997 DA n 
1   6998 DT n 
1   6999 DA n 
1   7000 DG n 
1   7001 DT n 
1   7002 DA n 
1   7003 DC n 
1   7004 DG n 
1   7005 DC n 
1   7006 DG n 
1   7007 DC n 
1   7008 DC n 
1   7009 DC n 
1   7010 DT n 
1   7011 DG n 
1   7012 DT n 
1   7013 DA n 
1   7014 DG n 
1   7015 DC n 
1   7016 DG n 
1   7017 DG n 
1   7018 DC n 
1   7019 DG n 
1   7020 DC n 
1   7021 DA n 
1   7022 DT n 
1   7023 DT n 
1   7024 DA n 
1   7025 DA n 
1   7026 DG n 
1   7027 DC n 
1   7028 DG n 
1   7029 DC n 
1   7030 DG n 
1   7031 DG n 
1   7032 DC n 
1   7033 DG n 
1   7034 DG n 
1   7035 DG n 
1   7036 DT n 
1   7037 DG n 
1   7038 DT n 
1   7039 DG n 
1   7040 DG n 
1   7041 DT n 
1   7042 DG n 
1   7043 DG n 
1   7044 DT n 
1   7045 DT n 
1   7046 DA n 
1   7047 DC n 
1   7048 DG n 
1   7049 DC n 
1   7050 DG n 
1   7051 DC n 
1   7052 DA n 
1   7053 DG n 
1   7054 DC n 
1   7055 DG n 
1   7056 DT n 
1   7057 DG n 
1   7058 DA n 
1   7059 DC n 
1   7060 DC n 
1   7061 DG n 
1   7062 DC n 
1   7063 DT n 
1   7064 DA n 
1   7065 DC n 
1   7066 DA n 
1   7067 DC n 
1   7068 DT n 
1   7069 DT n 
1   7070 DG n 
1   7071 DC n 
1   7072 DC n 
1   7073 DA n 
1   7074 DG n 
1   7075 DC n 
1   7076 DG n 
1   7077 DC n 
1   7078 DC n 
1   7079 DC n 
1   7080 DT n 
1   7081 DA n 
1   7082 DG n 
1   7083 DC n 
1   7084 DG n 
1   7085 DC n 
1   7086 DC n 
1   7087 DC n 
1   7088 DG n 
1   7089 DC n 
1   7090 DT n 
1   7091 DC n 
1   7092 DC n 
1   7093 DT n 
1   7094 DT n 
1   7095 DT n 
1   7096 DC n 
1   7097 DG n 
1   7098 DC n 
1   7099 DT n 
1   7100 DT n 
1   7101 DT n 
1   7102 DC n 
1   7103 DT n 
1   7104 DT n 
1   7105 DC n 
1   7106 DC n 
1   7107 DC n 
1   7108 DT n 
1   7109 DT n 
1   7110 DC n 
1   7111 DC n 
1   7112 DT n 
1   7113 DT n 
1   7114 DT n 
1   7115 DC n 
1   7116 DT n 
1   7117 DC n 
1   7118 DG n 
1   7119 DC n 
1   7120 DC n 
1   7121 DA n 
1   7122 DC n 
1   7123 DG n 
1   7124 DT n 
1   7125 DT n 
1   7126 DC n 
1   7127 DG n 
1   7128 DC n 
1   7129 DC n 
1   7130 DG n 
1   7131 DG n 
1   7132 DC n 
1   7133 DT n 
1   7134 DT n 
1   7135 DT n 
1   7136 DC n 
1   7137 DC n 
1   7138 DC n 
1   7139 DC n 
1   7140 DG n 
1   7141 DT n 
1   7142 DC n 
1   7143 DA n 
1   7144 DA n 
1   7145 DG n 
1   7146 DC n 
1   7147 DT n 
1   7148 DC n 
1   7149 DT n 
1   7150 DA n 
1   7151 DA n 
1   7152 DA n 
1   7153 DT n 
1   7154 DC n 
1   7155 DG n 
1   7156 DG n 
1   7157 DG n 
1   7158 DG n 
1   7159 DG n 
1   7160 DC n 
1   7161 DT n 
1   7162 DC n 
1   7163 DC n 
1   7164 DC n 
1   7165 DT n 
1   7166 DT n 
1   7167 DT n 
1   7168 DA n 
1   7169 DG n 
1   7170 DG n 
1   7171 DG n 
1   7172 DT n 
1   7173 DT n 
1   7174 DC n 
1   7175 DC n 
1   7176 DG n 
1   7177 DA n 
1   7178 DT n 
1   7179 DT n 
1   7180 DT n 
1   7181 DA n 
1   7182 DG n 
1   7183 DT n 
1   7184 DG n 
1   7185 DC n 
1   7186 DT n 
1   7187 DT n 
1   7188 DT n 
1   7189 DA n 
1   7190 DC n 
1   7191 DG n 
1   7192 DG n 
1   7193 DC n 
1   7194 DA n 
1   7195 DC n 
1   7196 DC n 
1   7197 DT n 
1   7198 DC n 
1   7199 DG n 
1   7200 DA n 
1   7201 DC n 
1   7202 DC n 
1   7203 DC n 
1   7204 DC n 
1   7205 DA n 
1   7206 DA n 
1   7207 DA n 
1   7208 DA n 
1   7209 DA n 
1   7210 DA n 
1   7211 DC n 
1   7212 DT n 
1   7213 DT n 
1   7214 DG n 
1   7215 DA n 
1   7216 DT n 
1   7217 DT n 
1   7218 DT n 
1   7219 DG n 
1   7220 DG n 
1   7221 DG n 
1   7222 DT n 
1   7223 DG n 
1   7224 DA n 
1   7225 DT n 
1   7226 DG n 
1   7227 DG n 
1   7228 DT n 
1   7229 DT n 
1   7230 DC n 
1   7231 DA n 
1   7232 DC n 
1   7233 DG n 
1   7234 DT n 
1   7235 DA n 
1   7236 DG n 
1   7237 DT n 
1   7238 DG n 
1   7239 DG n 
1   7240 DG n 
1   7241 DC n 
1   7242 DC n 
1   7243 DA n 
1   7244 DT n 
1   7245 DC n 
1   7246 DG n 
1   7247 DC n 
1   7248 DC n 
1   7249 DC n 
2   1    DT n 
2   2    DC n 
2   3    DA n 
2   4    DA n 
2   5    DT n 
2   6    DA n 
2   7    DG n 
2   8    DA n 
2   9    DT n 
2   10   DA n 
2   11   DA n 
2   12   DT n 
2   13   DA n 
2   14   DA n 
2   15   DA n 
2   16   DG n 
2   17   DG n 
2   18   DC n 
2   19   DT n 
2   20   DT n 
2   21   DA n 
2   22   DC n 
2   23   DA n 
2   24   DA n 
2   25   DT n 
2   26   DA n 
2   27   DG n 
2   28   DC n 
2   29   DA n 
2   30   DG n 
2   31   DC n 
2   32   DG n 
2   33   DA n 
2   34   DA n 
2   35   DT n 
2   36   DA n 
2   37   DA n 
2   38   DA n 
2   39   DC n 
2   40   DA n 
2   41   DG n 
2   42   DC n 
2   43   DT n 
2   44   DT n 
2   45   DG n 
2   46   DA n 
2   47   DT n 
2   48   DA n 
2   49   DA n 
2   50   DT n 
2   51   DA n 
2   52   DA n 
2   53   DG n 
2   54   DT n 
2   55   DA n 
3   1    DA n 
3   2    DG n 
3   3    DA n 
3   4    DT n 
3   5    DC n 
3   6    DA n 
3   7    DT n 
3   8    DT n 
3   9    DT n 
3   10   DT n 
3   11   DT n 
3   12   DT n 
3   13   DT n 
3   14   DC n 
3   15   DC n 
3   16   DA n 
3   17   DT n 
3   18   DT n 
3   19   DA n 
3   20   DC n 
3   21   DG n 
3   22   DC n 
3   23   DA n 
3   24   DT n 
3   25   DA n 
3   26   DA n 
3   27   DC n 
3   28   DG n 
3   29   DA n 
3   30   DC n 
3   31   DA n 
3   32   DA n 
3   33   DT n 
3   34   DG n 
3   35   DT n 
3   36   DA n 
3   37   DG n 
3   38   DA n 
3   39   DA n 
3   40   DA n 
3   41   DG n 
3   42   DG n 
3   43   DA n 
3   44   DG n 
4   1    DA n 
4   2    DA n 
4   3    DA n 
4   4    DA n 
4   5    DC n 
4   6    DA n 
4   7    DG n 
4   8    DG n 
4   9    DA n 
4   10   DA n 
4   11   DG n 
4   12   DA n 
4   13   DA n 
4   14   DA n 
4   15   DA n 
4   16   DG n 
4   17   DC n 
4   18   DT n 
4   19   DG n 
4   20   DT n 
4   21   DC n 
4   22   DT n 
4   23   DT n 
4   24   DT n 
4   25   DA n 
4   26   DT n 
4   27   DA n 
4   28   DA n 
4   29   DA n 
4   30   DC n 
4   31   DA n 
4   32   DA n 
4   33   DC n 
4   34   DA n 
4   35   DA n 
4   36   DG n 
4   37   DA n 
4   38   DA n 
4   39   DA n 
4   40   DA n 
4   41   DT n 
4   42   DA n 
4   43   DA n 
4   44   DT n 
4   45   DA n 
4   46   DA n 
4   47   DG n 
4   48   DA n 
4   49   DA n 
4   50   DC n 
5   1    DT n 
5   2    DG n 
5   3    DA n 
5   4    DA n 
5   5    DC n 
5   6    DA n 
5   7    DA n 
5   8    DT n 
5   9    DA n 
5   10   DG n 
5   11   DC n 
5   12   DA n 
5   13   DA n 
5   14   DT n 
5   15   DT n 
5   16   DT n 
5   17   DG n 
5   18   DC n 
5   19   DT n 
5   20   DT n 
5   21   DT n 
5   22   DC n 
5   23   DA n 
5   24   DC n 
5   25   DT n 
5   26   DC n 
5   27   DA n 
5   28   DT n 
5   29   DC n 
5   30   DT n 
5   31   DG n 
5   32   DC n 
5   33   DA n 
5   34   DA n 
5   35   DC n 
5   36   DG n 
5   37   DG n 
5   38   DC n 
5   39   DA n 
5   40   DT n 
6   1    DA n 
6   2    DG n 
6   3    DA n 
6   4    DT n 
6   5    DA n 
6   6    DA n 
6   7    DG n 
6   8    DT n 
6   9    DA n 
6   10   DA n 
6   11   DC n 
6   12   DT n 
6   13   DT n 
6   14   DT n 
6   15   DT n 
6   16   DT n 
6   17   DT n 
6   18   DT n 
6   19   DT n 
6   20   DT n 
6   21   DT n 
6   22   DG n 
6   23   DA n 
6   24   DT n 
6   25   DC n 
6   26   DT n 
6   27   DA n 
6   28   DA n 
6   29   DA n 
6   30   DG n 
6   31   DT n 
6   32   DT n 
6   33   DT n 
6   34   DT n 
6   35   DA n 
6   36   DG n 
6   37   DT n 
6   38   DT n 
6   39   DA n 
6   40   DC n 
6   41   DA n 
6   42   DA n 
6   43   DA n 
6   44   DA n 
6   45   DT n 
6   46   DA n 
6   47   DA n 
6   48   DA n 
7   1    DG n 
7   2    DA n 
7   3    DA n 
7   4    DT n 
7   5    DA n 
7   6    DC n 
7   7    DG n 
7   8    DT n 
7   9    DA n 
7   10   DC n 
7   11   DA n 
7   12   DA n 
7   13   DA n 
7   14   DC n 
7   15   DA n 
7   16   DG n 
7   17   DC n 
7   18   DA n 
7   19   DA n 
7   20   DG n 
7   21   DA n 
7   22   DA n 
7   23   DA n 
7   24   DC n 
7   25   DA n 
7   26   DA n 
7   27   DT n 
7   28   DG n 
7   29   DA n 
7   30   DA n 
7   31   DC n 
7   32   DC n 
7   33   DC n 
7   34   DT n 
7   35   DG n 
7   36   DA n 
7   37   DA n 
7   38   DC n 
7   39   DT n 
7   40   DC n 
7   41   DA n 
7   42   DC n 
7   43   DG n 
7   44   DT n 
7   45   DT n 
7   46   DG n 
7   47   DT n 
7   48   DA n 
8   1    DA n 
8   2    DA n 
8   3    DT n 
8   4    DT n 
8   5    DG n 
8   6    DA n 
8   7    DG n 
8   8    DT n 
8   9    DA n 
8   10   DA n 
8   11   DT n 
8   12   DA n 
8   13   DT n 
8   14   DC n 
8   15   DA n 
8   16   DG n 
8   17   DA n 
8   18   DA n 
8   19   DC n 
8   20   DA n 
8   21   DA n 
8   22   DC n 
8   23   DT n 
8   24   DA n 
8   25   DA n 
8   26   DA n 
8   27   DT n 
8   28   DT n 
8   29   DT n 
8   30   DG n 
8   31   DC n 
8   32   DC n 
8   33   DC n 
8   34   DT n 
8   35   DG n 
8   36   DT n 
8   37   DA n 
8   38   DT n 
8   39   DG n 
8   40   DG n 
8   41   DA n 
8   42   DG n 
8   43   DA n 
8   44   DT n 
8   45   DA n 
8   46   DT n 
8   47   DA n 
8   48   DG n 
8   49   DC n 
8   50   DA n 
9   1    DT n 
9   2    DT n 
9   3    DT n 
9   4    DT n 
9   5    DT n 
9   6    DG n 
9   7    DA n 
9   8    DA n 
9   9    DC n 
9   10   DA n 
9   11   DC n 
9   12   DA n 
9   13   DG n 
9   14   DG n 
9   15   DG n 
9   16   DA n 
9   17   DT n 
9   18   DA n 
9   19   DG n 
9   20   DC n 
9   21   DA n 
9   22   DA n 
9   23   DG n 
9   24   DC n 
9   25   DC n 
9   26   DC n 
9   27   DC n 
9   28   DC n 
9   29   DA n 
9   30   DC n 
9   31   DC n 
9   32   DA n 
9   33   DC n 
9   34   DC n 
9   35   DC n 
9   36   DG n 
9   37   DA n 
9   38   DC n 
9   39   DG n 
9   40   DA n 
9   41   DC n 
9   42   DA n 
9   43   DA n 
9   44   DC n 
9   45   DC n 
9   46   DG n 
9   47   DA n 
9   48   DC n 
10  1    DT n 
10  2    DT n 
10  3    DA n 
10  4    DT n 
10  5    DT n 
10  6    DC n 
10  7    DG n 
10  8    DG n 
10  9    DA n 
10  10   DA n 
10  11   DA n 
10  12   DC n 
10  13   DA n 
10  14   DG n 
10  15   DT n 
10  16   DT n 
10  17   DA n 
10  18   DG n 
10  19   DA n 
10  20   DT n 
10  21   DT n 
10  22   DA n 
10  23   DA n 
10  24   DG n 
10  25   DA n 
10  26   DC n 
10  27   DG n 
10  28   DC n 
10  29   DT n 
10  30   DG n 
10  31   DT n 
10  32   DT n 
10  33   DA n 
10  34   DT n 
10  35   DA n 
10  36   DT n 
10  37   DA n 
10  38   DA n 
10  39   DT n 
10  40   DT n 
10  41   DT n 
10  42   DA n 
10  43   DA n 
10  44   DT n 
10  45   DG n 
10  46   DG n 
10  47   DG n 
10  48   DG n 
11  1    DG n 
11  2    DC n 
11  3    DC n 
11  4    DT n 
11  5    DT n 
11  6    DG n 
11  7    DT n 
11  8    DC n 
11  9    DA n 
11  10   DG n 
11  11   DA n 
11  12   DG n 
11  13   DC n 
11  14   DC n 
11  15   DG n 
11  16   DC n 
11  17   DC n 
11  18   DA n 
11  19   DC n 
11  20   DC n 
11  21   DC n 
11  22   DT n 
11  23   DC n 
11  24   DA n 
11  25   DG n 
11  26   DA n 
11  27   DA n 
11  28   DC n 
11  29   DC n 
11  30   DG n 
11  31   DA n 
11  32   DC n 
11  33   DC n 
11  34   DA n 
11  35   DG n 
11  36   DA n 
11  37   DA n 
11  38   DC n 
11  39   DC n 
11  40   DC n 
12  1    DA n 
12  2    DA n 
12  3    DA n 
12  4    DC n 
12  5    DG n 
12  6    DA n 
12  7    DT n 
12  8    DT n 
12  9    DG n 
12  10   DG n 
12  11   DA n 
12  12   DA n 
12  13   DA n 
12  14   DA n 
12  15   DT n 
12  16   DC n 
12  17   DA n 
12  18   DC n 
12  19   DG n 
12  20   DG n 
12  21   DT n 
12  22   DT n 
12  23   DG n 
12  24   DA n 
12  25   DG n 
12  26   DG n 
12  27   DA n 
12  28   DA n 
12  29   DC n 
12  30   DC n 
12  31   DG n 
12  32   DA n 
12  33   DT n 
12  34   DT n 
12  35   DG n 
12  36   DA n 
12  37   DG n 
12  38   DG n 
12  39   DG n 
12  40   DA n 
12  41   DG n 
12  42   DG n 
12  43   DT n 
12  44   DA n 
12  45   DT n 
12  46   DG n 
12  47   DG n 
12  48   DT n 
13  1    DG n 
13  2    DA n 
13  3    DA n 
13  4    DA n 
13  5    DG n 
13  6    DC n 
13  7    DG n 
13  8    DC n 
13  9    DA n 
13  10   DG n 
13  11   DT n 
13  12   DC n 
13  13   DC n 
13  14   DG n 
13  15   DG n 
13  16   DG n 
13  17   DG n 
13  18   DT n 
13  19   DC n 
13  20   DA n 
13  21   DT n 
13  22   DA n 
13  23   DA n 
13  24   DT n 
13  25   DG n 
13  26   DC n 
13  27   DC n 
13  28   DC n 
13  29   DC n 
13  30   DA n 
13  31   DC n 
13  32   DC n 
13  33   DA n 
13  34   DC n 
13  35   DC n 
13  36   DA n 
13  37   DA n 
13  38   DC n 
13  39   DA n 
13  40   DT n 
13  41   DA n 
13  42   DA n 
13  43   DA n 
13  44   DG n 
13  45   DG n 
13  46   DT n 
13  47   DG n 
13  48   DG n 
13  49   DC n 
13  50   DA n 
14  1    DC n 
14  2    DA n 
14  3    DT n 
14  4    DA n 
14  5    DC n 
14  6    DA n 
14  7    DT n 
14  8    DG n 
14  9    DG n 
14  10   DC n 
14  11   DT n 
14  12   DT n 
14  13   DT n 
14  14   DT n 
14  15   DT n 
14  16   DT n 
14  17   DT n 
14  18   DT n 
14  19   DT n 
14  20   DT n 
14  21   DT n 
14  22   DT n 
14  23   DT n 
14  24   DT n 
14  25   DG n 
14  26   DA n 
14  27   DT n 
14  28   DG n 
14  29   DA n 
14  30   DT n 
14  31   DA n 
14  32   DC n 
14  33   DA n 
14  34   DG n 
14  35   DT n 
14  36   DC n 
14  37   DT n 
14  38   DG n 
14  39   DA n 
14  40   DA n 
14  41   DA n 
14  42   DC n 
14  43   DA n 
14  44   DT n 
14  45   DG n 
14  46   DA n 
15  1    DC n 
15  2    DC n 
15  3    DC n 
15  4    DC n 
15  5    DA n 
15  6    DC n 
15  7    DC n 
15  8    DC n 
15  9    DT n 
15  10   DC n 
15  11   DT n 
15  12   DG n 
15  13   DG n 
15  14   DT n 
15  15   DA n 
15  16   DA n 
15  17   DT n 
15  18   DA n 
15  19   DA n 
15  20   DG n 
15  21   DT n 
15  22   DT n 
15  23   DT n 
15  24   DT n 
15  25   DA n 
15  26   DA n 
15  27   DT n 
15  28   DC n 
15  29   DT n 
15  30   DG n 
15  31   DA n 
15  32   DA n 
15  33   DT n 
15  34   DT n 
15  35   DT n 
15  36   DC n 
15  37   DA n 
15  38   DG n 
15  39   DA n 
15  40   DC n 
15  41   DT n 
15  42   DG n 
15  43   DT n 
15  44   DA n 
15  45   DG n 
15  46   DC n 
15  47   DG n 
15  48   DC n 
16  1    DC n 
16  2    DA n 
16  3    DG n 
16  4    DG n 
16  5    DT n 
16  6    DC n 
16  7    DA n 
16  8    DG n 
16  9    DA n 
16  10   DC n 
16  11   DC n 
16  12   DG n 
16  13   DG n 
16  14   DA n 
16  15   DA n 
16  16   DC n 
16  17   DT n 
16  18   DG n 
16  19   DA n 
16  20   DC n 
16  21   DA n 
16  22   DG n 
16  23   DG n 
16  24   DA n 
16  25   DC n 
16  26   DG n 
16  27   DG n 
16  28   DA n 
16  29   DA n 
16  30   DC n 
16  31   DC n 
16  32   DA n 
16  33   DC n 
16  34   DA n 
16  35   DT n 
16  36   DT n 
16  37   DA n 
16  38   DA n 
16  39   DA n 
16  40   DG n 
16  41   DC n 
16  42   DA n 
16  43   DC n 
16  44   DC n 
16  45   DA n 
16  46   DG n 
17  1    DC n 
17  2    DC n 
17  3    DA n 
17  4    DG n 
17  5    DT n 
17  6    DA n 
17  7    DA n 
17  8    DC n 
17  9    DA n 
17  10   DG n 
17  11   DG n 
17  12   DA n 
17  13   DG n 
17  14   DC n 
17  15   DC n 
17  16   DA n 
17  17   DC n 
17  18   DC n 
17  19   DT n 
17  20   DC n 
17  21   DC n 
17  22   DT n 
17  23   DC n 
17  24   DA n 
17  25   DT n 
17  26   DT n 
17  27   DG n 
17  28   DG n 
17  29   DT n 
17  30   DC n 
17  31   DA n 
17  32   DT n 
17  33   DA n 
17  34   DG n 
17  35   DC n 
17  36   DC n 
17  37   DC n 
17  38   DC n 
17  39   DC n 
17  40   DT n 
17  41   DT n 
17  42   DA n 
17  43   DA n 
17  44   DG n 
17  45   DC n 
17  46   DA n 
17  47   DA n 
17  48   DA n 
18  1    DT n 
18  2    DT n 
18  3    DA n 
18  4    DA n 
18  5    DA n 
18  6    DG n 
18  7    DA n 
18  8    DA n 
18  9    DC n 
18  10   DT n 
18  11   DT n 
18  12   DT n 
18  13   DT n 
18  14   DG n 
18  15   DA n 
18  16   DA n 
18  17   DA n 
18  18   DT n 
18  19   DC n 
18  20   DG n 
18  21   DC n 
18  22   DG n 
18  23   DA n 
18  24   DA n 
18  25   DA n 
18  26   DC n 
18  27   DC n 
18  28   DG n 
18  29   DA n 
18  30   DG n 
18  31   DC n 
18  32   DC n 
18  33   DA n 
18  34   DG n 
18  35   DA n 
18  36   DA n 
18  37   DA n 
18  38   DG n 
18  39   DA n 
18  40   DC n 
18  41   DA n 
18  42   DG n 
18  43   DC n 
18  44   DA n 
18  45   DA n 
18  46   DT n 
18  47   DT n 
18  48   DC n 
19  1    DA n 
19  2    DA n 
19  3    DA n 
19  4    DA n 
19  5    DT n 
19  6    DT n 
19  7    DC n 
19  8    DA n 
19  9    DG n 
19  10   DA n 
19  11   DA n 
19  12   DG n 
19  13   DG n 
19  14   DT n 
19  15   DA n 
19  16   DA n 
19  17   DA n 
19  18   DA n 
19  19   DA n 
19  20   DT n 
19  21   DT n 
19  22   DA n 
19  23   DT n 
19  24   DT n 
19  25   DT n 
19  26   DG n 
19  27   DC n 
19  28   DC n 
19  29   DC n 
19  30   DG n 
19  31   DT n 
19  32   DA n 
19  33   DG n 
19  34   DC n 
19  35   DA n 
19  36   DT n 
19  37   DT n 
19  38   DT n 
19  39   DT n 
19  40   DC n 
19  41   DA n 
19  42   DA n 
19  43   DA n 
19  44   DG n 
19  45   DC n 
19  46   DC n 
19  47   DA n 
19  48   DG n 
19  49   DA n 
19  50   DA n 
19  51   DT n 
19  52   DG n 
20  1    DA n 
20  2    DC n 
20  3    DA n 
20  4    DG n 
20  5    DT n 
20  6    DT n 
20  7    DT n 
20  8    DA n 
20  9    DT n 
20  10   DT n 
20  11   DG n 
20  12   DC n 
20  13   DA n 
20  14   DG n 
20  15   DT n 
20  16   DA n 
20  17   DT n 
20  18   DG n 
20  19   DG n 
20  20   DT n 
20  21   DT n 
20  22   DA n 
20  23   DA n 
20  24   DT n 
20  25   DT n 
20  26   DT n 
20  27   DT n 
20  28   DC n 
20  29   DG n 
20  30   DC n 
20  31   DC n 
20  32   DT n 
20  33   DG n 
20  34   DA n 
20  35   DA n 
20  36   DC n 
20  37   DG n 
20  38   DC n 
20  39   DC n 
20  40   DA n 
20  41   DA n 
20  42   DC n 
20  43   DT n 
20  44   DA n 
20  45   DC n 
20  46   DA n 
20  47   DG n 
20  48   DA n 
20  49   DG n 
20  50   DG n 
20  51   DT n 
20  52   DT n 
20  53   DA n 
20  54   DT n 
20  55   DC n 
20  56   DA n 
20  57   DT n 
20  58   DC n 
20  59   DA n 
20  60   DG n 
21  1    DA n 
21  2    DT n 
21  3    DA n 
21  4    DA n 
21  5    DA n 
21  6    DA n 
21  7    DT n 
21  8    DT n 
21  9    DT n 
21  10   DT n 
21  11   DG n 
21  12   DC n 
21  13   DT n 
21  14   DC n 
21  15   DT n 
21  16   DT n 
21  17   DT n 
21  18   DC n 
21  19   DG n 
21  20   DG n 
21  21   DA n 
21  22   DA n 
21  23   DC n 
21  24   DT n 
21  25   DT n 
21  26   DT n 
21  27   DA n 
21  28   DG n 
21  29   DC n 
21  30   DG n 
21  31   DT n 
21  32   DA n 
21  33   DC n 
21  34   DC n 
21  35   DG n 
21  36   DT n 
21  37   DT n 
21  38   DC n 
21  39   DC n 
21  40   DA n 
21  41   DG n 
21  42   DT n 
21  43   DA n 
21  44   DA n 
21  45   DG n 
21  46   DC n 
21  47   DG n 
21  48   DT n 
22  1    DA n 
22  2    DA n 
22  3    DC n 
22  4    DA n 
22  5    DT n 
22  6    DG n 
22  7    DT n 
22  8    DT n 
22  9    DC n 
22  10   DA n 
22  11   DT n 
22  12   DG n 
22  13   DT n 
22  14   DC n 
22  15   DC n 
22  16   DA n 
22  17   DG n 
22  18   DA n 
22  19   DC n 
22  20   DT n 
22  21   DC n 
22  22   DA n 
22  23   DT n 
22  24   DT n 
22  25   DT n 
22  26   DT n 
22  27   DA n 
22  28   DA n 
22  29   DT n 
22  30   DA n 
22  31   DA n 
22  32   DC n 
22  33   DG n 
22  34   DG n 
22  35   DT n 
22  36   DC n 
22  37   DA n 
22  38   DC n 
22  39   DC n 
22  40   DG n 
22  41   DT n 
22  42   DC n 
22  43   DC n 
22  44   DG n 
22  45   DA n 
22  46   DC n 
22  47   DA n 
22  48   DT n 
22  49   DT n 
22  50   DC n 
23  1    DG n 
23  2    DA n 
23  3    DT n 
23  4    DA n 
23  5    DA n 
23  6    DG n 
23  7    DA n 
23  8    DC n 
23  9    DT n 
23  10   DC n 
23  11   DA n 
23  12   DT n 
23  13   DA n 
23  14   DG n 
23  15   DA n 
23  16   DC n 
23  17   DG n 
23  18   DG n 
23  19   DA n 
23  20   DT n 
23  21   DA n 
23  22   DT n 
23  23   DT n 
23  24   DC n 
23  25   DA n 
23  26   DT n 
23  27   DG n 
23  28   DA n 
23  29   DG n 
23  30   DC n 
23  31   DC n 
23  32   DG n 
23  33   DC n 
23  34   DC n 
23  35   DG n 
23  36   DC n 
23  37   DC n 
23  38   DA n 
23  39   DG n 
23  40   DC n 
23  41   DA n 
23  42   DT n 
23  43   DC n 
23  44   DG n 
23  45   DC n 
23  46   DC n 
23  47   DT n 
23  48   DC n 
24  1    DC n 
24  2    DA n 
24  3    DT n 
24  4    DG n 
24  5    DA n 
24  6    DT n 
24  7    DA n 
24  8    DC n 
24  9    DC n 
24  10   DG n 
24  11   DC n 
24  12   DC n 
24  13   DA n 
24  14   DC n 
24  15   DG n 
24  16   DC n 
24  17   DA n 
24  18   DC n 
24  19   DC n 
24  20   DA n 
24  21   DT n 
24  22   DT n 
24  23   DA n 
24  24   DC n 
24  25   DC n 
24  26   DA n 
24  27   DT n 
24  28   DT n 
24  29   DA n 
24  30   DG n 
24  31   DT n 
24  32   DT n 
24  33   DT n 
24  34   DC n 
24  35   DA n 
24  36   DT n 
24  37   DC n 
24  38   DG n 
24  39   DT n 
24  40   DA n 
24  41   DA n 
24  42   DA n 
24  43   DC n 
24  44   DA n 
24  45   DG n 
24  46   DT n 
24  47   DG n 
24  48   DT n 
25  1    DA n 
25  2    DG n 
25  3    DG n 
25  4    DT n 
25  5    DA n 
25  6    DC n 
25  7    DC n 
25  8    DG n 
25  9    DC n 
25  10   DC n 
25  11   DA n 
25  12   DC n 
25  13   DC n 
25  14   DA n 
25  15   DA n 
25  16   DT n 
25  17   DG n 
25  18   DA n 
25  19   DA n 
25  20   DA n 
25  21   DC n 
25  22   DC n 
25  23   DA n 
25  24   DT n 
25  25   DC n 
25  26   DG n 
25  27   DA n 
25  28   DA n 
25  29   DG n 
25  30   DT n 
25  31   DT n 
25  32   DT n 
25  33   DG n 
25  34   DC n 
25  35   DC n 
25  36   DC n 
25  37   DT n 
25  38   DA n 
25  39   DT n 
25  40   DT n 
26  1    DG n 
26  2    DC n 
26  3    DC n 
26  4    DG n 
26  5    DT n 
26  6    DC n 
26  7    DG n 
26  8    DA n 
26  9    DG n 
26  10   DA n 
26  11   DG n 
26  12   DG n 
26  13   DG n 
26  14   DT n 
26  15   DC n 
26  16   DA n 
26  17   DG n 
26  18   DG n 
26  19   DC n 
26  20   DG n 
26  21   DC n 
26  22   DA n 
26  23   DT n 
26  24   DG n 
26  25   DC n 
26  26   DT n 
26  27   DC n 
26  28   DC n 
26  29   DA n 
26  30   DT n 
26  31   DA n 
26  32   DT n 
26  33   DC n 
26  34   DA n 
26  35   DT n 
26  36   DA n 
26  37   DA n 
26  38   DG n 
26  39   DT n 
26  40   DG n 
26  41   DA n 
26  42   DG n 
26  43   DG n 
26  44   DA n 
26  45   DA n 
26  46   DG n 
26  47   DG n 
26  48   DC n 
26  49   DG n 
26  50   DG n 
26  51   DA n 
26  52   DA n 
26  53   DC n 
26  54   DA n 
26  55   DG n 
26  56   DC n 
26  57   DC n 
27  1    DT n 
27  2    DT n 
27  3    DT n 
27  4    DT n 
27  5    DT n 
27  6    DA n 
27  7    DC n 
27  8    DT n 
27  9    DC n 
27  10   DC n 
27  11   DT n 
27  12   DC n 
27  13   DA n 
27  14   DA n 
27  15   DT n 
27  16   DT n 
27  17   DT n 
27  18   DT n 
27  19   DT n 
27  20   DT n 
27  21   DT n 
27  22   DT n 
27  23   DT n 
27  24   DT n 
27  25   DT n 
27  26   DT n 
27  27   DA n 
27  28   DA n 
27  29   DG n 
27  30   DC n 
27  31   DA n 
27  32   DG n 
27  33   DT n 
27  34   DA n 
27  35   DG n 
27  36   DC n 
27  37   DG n 
27  38   DA n 
27  39   DC n 
27  40   DA n 
27  41   DG n 
27  42   DA n 
27  43   DA n 
27  44   DT n 
27  45   DC n 
27  46   DA n 
27  47   DT n 
27  48   DA n 
27  49   DG n 
27  50   DC n 
27  51   DA n 
27  52   DG n 
27  53   DC n 
27  54   DA n 
27  55   DT n 
27  56   DT n 
27  57   DA n 
27  58   DG n 
27  59   DG n 
27  60   DA n 
27  61   DT n 
27  62   DG n 
27  63   DT n 
28  1    DT n 
28  2    DT n 
28  3    DT n 
28  4    DT n 
28  5    DT n 
28  6    DC n 
28  7    DC n 
28  8    DA n 
28  9    DA n 
28  10   DG n 
28  11   DA n 
28  12   DA n 
28  13   DG n 
28  14   DG n 
28  15   DA n 
28  16   DA n 
28  17   DT n 
28  18   DT n 
28  19   DT n 
28  20   DT n 
28  21   DT n 
28  22   DT n 
28  23   DT n 
28  24   DT n 
28  25   DT n 
28  26   DT n 
28  27   DA n 
28  28   DC n 
28  29   DC n 
28  30   DG n 
28  31   DA n 
28  32   DG n 
28  33   DG n 
28  34   DA n 
28  35   DT n 
28  36   DT n 
28  37   DA n 
28  38   DA n 
28  39   DA n 
28  40   DT n 
28  41   DA n 
28  42   DA n 
28  43   DG n 
28  44   DA n 
28  45   DA n 
28  46   DT n 
28  47   DT n 
28  48   DT n 
28  49   DT n 
28  50   DT n 
28  51   DT n 
28  52   DT n 
28  53   DT n 
28  54   DT n 
28  55   DT n 
28  56   DT n 
28  57   DA n 
28  58   DA n 
28  59   DA n 
28  60   DC n 
28  61   DA n 
28  62   DC n 
28  63   DC n 
28  64   DG n 
29  1    DA n 
29  2    DT n 
29  3    DG n 
29  4    DT n 
29  5    DG n 
29  6    DA n 
29  7    DA n 
29  8    DT n 
29  9    DT n 
29  10   DA n 
29  11   DA n 
29  12   DA n 
29  13   DT n 
29  14   DA n 
29  15   DC n 
29  16   DC n 
29  17   DC n 
29  18   DA n 
29  19   DA n 
29  20   DC n 
29  21   DC n 
29  22   DA n 
29  23   DG n 
29  24   DC n 
29  25   DG n 
29  26   DC n 
29  27   DT n 
29  28   DC n 
29  29   DC n 
29  30   DG n 
29  31   DG n 
29  32   DC n 
29  33   DT n 
29  34   DT n 
29  35   DA n 
29  36   DG n 
29  37   DG n 
29  38   DT n 
29  39   DT n 
29  40   DG n 
29  41   DG n 
29  42   DG n 
29  43   DA n 
29  44   DG n 
29  45   DA n 
29  46   DA n 
29  47   DG n 
29  48   DA n 
30  1    DT n 
30  2    DA n 
30  3    DC n 
30  4    DC n 
30  5    DT n 
30  6    DC n 
30  7    DA n 
30  8    DG n 
30  9    DA n 
30  10   DG n 
30  11   DA n 
30  12   DA n 
30  13   DT n 
30  14   DA n 
30  15   DG n 
30  16   DG n 
30  17   DA n 
30  18   DA n 
30  19   DA n 
30  20   DT n 
30  21   DA n 
30  22   DC n 
30  23   DC n 
30  24   DA n 
30  25   DA n 
30  26   DG n 
30  27   DC n 
30  28   DT n 
30  29   DT n 
30  30   DT n 
30  31   DA n 
30  32   DA n 
30  33   DT n 
30  34   DT n 
30  35   DC n 
30  36   DA n 
30  37   DG n 
30  38   DC n 
30  39   DA n 
30  40   DG n 
30  41   DC n 
30  42   DG n 
30  43   DG n 
30  44   DA n 
30  45   DA n 
30  46   DC n 
30  47   DA n 
30  48   DA n 
31  1    DG n 
31  2    DT n 
31  3    DC n 
31  4    DA n 
31  5    DA n 
31  6    DG n 
31  7    DG n 
31  8    DC n 
31  9    DC n 
31  10   DG n 
31  11   DC n 
31  12   DG n 
31  13   DT n 
31  14   DA n 
31  15   DG n 
31  16   DA n 
31  17   DA n 
31  18   DA n 
31  19   DC n 
31  20   DT n 
31  21   DT n 
31  22   DA n 
31  23   DT n 
31  24   DT n 
31  25   DA n 
31  26   DC n 
31  27   DT n 
31  28   DT n 
31  29   DG n 
31  30   DT n 
31  31   DC n 
31  32   DA n 
31  33   DC n 
31  34   DA n 
31  35   DA n 
31  36   DA n 
31  37   DA n 
31  38   DT n 
31  39   DG n 
31  40   DC n 
31  41   DT n 
31  42   DG n 
31  43   DA n 
31  44   DT n 
31  45   DG n 
31  46   DC n 
31  47   DA n 
31  48   DA n 
31  49   DA n 
31  50   DT n 
31  51   DA n 
31  52   DA n 
32  1    DT n 
32  2    DT n 
32  3    DT n 
32  4    DT n 
32  5    DT n 
32  6    DT n 
32  7    DC n 
32  8    DT n 
32  9    DT n 
32  10   DT n 
32  11   DT n 
32  12   DC n 
32  13   DA n 
32  14   DT n 
32  15   DA n 
32  16   DA n 
32  17   DT n 
32  18   DC n 
32  19   DC n 
32  20   DC n 
32  21   DT n 
32  22   DT n 
32  23   DG n 
32  24   DA n 
32  25   DT n 
32  26   DA n 
32  27   DT n 
32  28   DT n 
32  29   DT n 
32  30   DT n 
32  31   DT n 
32  32   DT n 
32  33   DT n 
32  34   DT n 
32  35   DT n 
32  36   DT n 
32  37   DT n 
32  38   DT n 
32  39   DC n 
32  40   DA n 
32  41   DC n 
32  42   DA n 
32  43   DA n 
32  44   DA n 
32  45   DC n 
32  46   DA n 
32  47   DA n 
32  48   DA n 
32  49   DT n 
32  50   DA n 
33  1    DT n 
33  2    DG n 
33  3    DC n 
33  4    DC n 
33  5    DT n 
33  6    DA n 
33  7    DT n 
33  8    DT n 
33  9    DA n 
33  10   DG n 
33  11   DC n 
33  12   DA n 
33  13   DA n 
33  14   DA n 
33  15   DG n 
33  16   DA n 
33  17   DA n 
33  18   DA n 
33  19   DC n 
33  20   DG n 
33  21   DT n 
33  22   DC n 
33  23   DA n 
33  24   DC n 
33  25   DC n 
33  26   DC n 
33  27   DT n 
33  28   DC n 
33  29   DA n 
33  30   DG n 
33  31   DC n 
33  32   DG n 
33  33   DT n 
33  34   DC n 
33  35   DA n 
33  36   DC n 
33  37   DC n 
33  38   DA n 
33  39   DA n 
33  40   DC n 
33  41   DT n 
33  42   DA n 
33  43   DA n 
33  44   DA n 
33  45   DA n 
33  46   DC n 
33  47   DG n 
33  48   DA n 
34  1    DA n 
34  2    DT n 
34  3    DG n 
34  4    DA n 
34  5    DG n 
34  6    DT n 
34  7    DG n 
34  8    DT n 
34  9    DA n 
34  10   DC n 
34  11   DA n 
34  12   DG n 
34  13   DA n 
34  14   DG n 
34  15   DC n 
34  16   DC n 
34  17   DA n 
34  18   DC n 
34  19   DT n 
34  20   DT n 
34  21   DT n 
34  22   DT n 
34  23   DT n 
34  24   DT n 
34  25   DT n 
34  26   DT n 
34  27   DT n 
34  28   DT n 
34  29   DC n 
34  30   DA n 
34  31   DC n 
34  32   DC n 
34  33   DC n 
34  34   DT n 
34  35   DC n 
34  36   DA n 
34  37   DG n 
34  38   DA n 
34  39   DG n 
34  40   DC n 
34  41   DC n 
34  42   DG n 
35  1    DA n 
35  2    DA n 
35  3    DG n 
35  4    DT n 
35  5    DA n 
35  6    DG n 
35  7    DA n 
35  8    DG n 
35  9    DA n 
35  10   DA n 
35  11   DG n 
35  12   DG n 
35  13   DA n 
35  14   DC n 
35  15   DC n 
35  16   DG n 
35  17   DT n 
35  18   DA n 
35  19   DA n 
35  20   DT n 
35  21   DG n 
35  22   DT n 
35  23   DA n 
35  24   DT n 
35  25   DC n 
35  26   DA n 
35  27   DC n 
35  28   DC n 
35  29   DT n 
35  30   DT n 
35  31   DC n 
35  32   DC n 
35  33   DA n 
35  34   DC n 
35  35   DA n 
35  36   DG n 
35  37   DA n 
35  38   DC n 
35  39   DC n 
35  40   DA n 
35  41   DA n 
35  42   DC n 
35  43   DC n 
35  44   DT n 
35  45   DA n 
35  46   DG n 
35  47   DT n 
35  48   DT n 
35  49   DG n 
35  50   DC n 
35  51   DG n 
35  52   DC n 
35  53   DC n 
35  54   DC n 
36  1    DT n 
36  2    DT n 
36  3    DC n 
36  4    DG n 
36  5    DC n 
36  6    DC n 
36  7    DA n 
36  8    DT n 
36  9    DA n 
36  10   DT n 
36  11   DT n 
36  12   DA n 
36  13   DG n 
36  14   DG n 
36  15   DG n 
36  16   DT n 
36  17   DA n 
36  18   DA n 
36  19   DT n 
36  20   DT n 
36  21   DG n 
36  22   DA n 
36  23   DG n 
36  24   DC n 
36  25   DG n 
36  26   DC n 
36  27   DT n 
36  28   DT n 
36  29   DA n 
36  30   DA n 
36  31   DG n 
36  32   DC n 
36  33   DC n 
36  34   DC n 
36  35   DA n 
36  36   DA n 
36  37   DT n 
36  38   DA n 
36  39   DC n 
36  40   DC n 
36  41   DG n 
36  42   DA n 
36  43   DT n 
36  44   DA n 
36  45   DA n 
37  1    DA n 
37  2    DT n 
37  3    DA n 
37  4    DT n 
37  5    DA n 
37  6    DA n 
37  7    DT n 
37  8    DA n 
37  9    DC n 
37  10   DT n 
37  11   DA n 
37  12   DG n 
37  13   DA n 
37  14   DA n 
37  15   DT n 
37  16   DG n 
37  17   DT n 
37  18   DG n 
37  19   DA n 
37  20   DT n 
37  21   DA n 
37  22   DA n 
37  23   DT n 
37  24   DT n 
37  25   DT n 
37  26   DT n 
37  27   DA n 
37  28   DA n 
37  29   DC n 
37  30   DC n 
37  31   DC n 
37  32   DA n 
37  33   DA n 
37  34   DA n 
37  35   DG n 
37  36   DA n 
37  37   DC n 
37  38   DA n 
37  39   DA n 
37  40   DA n 
37  41   DA n 
37  42   DT n 
37  43   DT n 
37  44   DT n 
37  45   DT n 
37  46   DT n 
37  47   DT n 
37  48   DT n 
37  49   DT n 
37  50   DT n 
37  51   DT n 
37  52   DG n 
37  53   DG n 
37  54   DG n 
37  55   DA n 
37  56   DC n 
37  57   DC n 
37  58   DG n 
37  59   DA n 
37  60   DC n 
37  61   DT n 
37  62   DT n 
37  63   DG n 
37  64   DA n 
37  65   DG n 
37  66   DT n 
37  67   DT n 
37  68   DT n 
37  69   DT n 
37  70   DT n 
38  1    DC n 
38  2    DA n 
38  3    DT n 
38  4    DT n 
38  5    DT n 
38  6    DT n 
38  7    DA n 
38  8    DA n 
38  9    DA n 
38  10   DG n 
38  11   DT n 
38  12   DA n 
38  13   DC n 
38  14   DA n 
38  15   DC n 
38  16   DA n 
38  17   DG n 
38  18   DC n 
38  19   DG n 
38  20   DA n 
38  21   DT n 
38  22   DT n 
38  23   DC n 
38  24   DC n 
38  25   DC n 
38  26   DA n 
38  27   DT n 
38  28   DG n 
38  29   DT n 
38  30   DA n 
38  31   DT n 
38  32   DA n 
38  33   DC n 
38  34   DC n 
38  35   DG n 
38  36   DA n 
38  37   DA n 
38  38   DG n 
38  39   DC n 
38  40   DC n 
38  41   DC n 
38  42   DT n 
38  43   DT n 
38  44   DT n 
38  45   DT n 
38  46   DT n 
38  47   DG n 
38  48   DA n 
39  1    DC n 
39  2    DG n 
39  3    DC n 
39  4    DC n 
39  5    DA n 
39  6    DT n 
39  7    DC n 
39  8    DT n 
39  9    DC n 
39  10   DA n 
39  11   DA n 
39  12   DC n 
39  13   DA n 
39  14   DG n 
39  15   DT n 
39  16   DT n 
39  17   DT n 
39  18   DC n 
39  19   DA n 
39  20   DA n 
39  21   DA n 
39  22   DT n 
39  23   DA n 
39  24   DA n 
39  25   DG n 
39  26   DA n 
39  27   DC n 
39  28   DA n 
39  29   DA n 
39  30   DA n 
39  31   DA n 
39  32   DA n 
39  33   DG n 
39  34   DA n 
39  35   DC n 
39  36   DA n 
39  37   DC n 
39  38   DC n 
39  39   DA n 
39  40   DC n 
39  41   DG n 
39  42   DG n 
39  43   DA n 
39  44   DA n 
39  45   DT n 
39  46   DA n 
39  47   DA n 
39  48   DT n 
40  1    DA n 
40  2    DG n 
40  3    DC n 
40  4    DG n 
40  5    DC n 
40  6    DA n 
40  7    DA n 
40  8    DA n 
40  9    DA n 
40  10   DG n 
40  11   DG n 
40  12   DA n 
40  13   DG n 
40  14   DC n 
40  15   DT n 
40  16   DT n 
40  17   DT n 
40  18   DG n 
40  19   DC n 
40  20   DA n 
40  21   DC n 
40  22   DC n 
40  23   DC n 
40  24   DG n 
40  25   DA n 
40  26   DC n 
40  27   DT n 
40  28   DT n 
40  29   DG n 
40  30   DC n 
40  31   DG n 
40  32   DG n 
40  33   DG n 
40  34   DA n 
40  35   DG n 
40  36   DG n 
40  37   DT n 
40  38   DT n 
40  39   DT n 
40  40   DT n 
40  41   DA n 
40  42   DA n 
40  43   DT n 
40  44   DT n 
40  45   DG n 
40  46   DC n 
40  47   DA n 
40  48   DA n 
41  1    DT n 
41  2    DA n 
41  3    DA n 
41  4    DC n 
41  5    DC n 
41  6    DT n 
41  7    DT n 
41  8    DC n 
41  9    DC n 
41  10   DC n 
41  11   DT n 
41  12   DT n 
41  13   DA n 
41  14   DG n 
41  15   DA n 
41  16   DA n 
41  17   DT n 
41  18   DC n 
41  19   DC n 
41  20   DT n 
41  21   DT n 
41  22   DG n 
41  23   DC n 
41  24   DC n 
41  25   DA n 
41  26   DA n 
41  27   DT n 
41  28   DC n 
41  29   DG n 
41  30   DC n 
41  31   DA n 
41  32   DT n 
41  33   DA n 
41  34   DT n 
41  35   DT n 
41  36   DT n 
41  37   DT n 
41  38   DA n 
41  39   DA n 
41  40   DG n 
41  41   DT n 
41  42   DA n 
41  43   DC n 
41  44   DC n 
42  1    DT n 
42  2    DA n 
42  3    DA n 
42  4    DC n 
42  5    DG n 
42  6    DA n 
42  7    DA n 
42  8    DG n 
42  9    DG n 
42  10   DC n 
42  11   DA n 
42  12   DC n 
42  13   DA n 
42  14   DG n 
42  15   DC n 
42  16   DC n 
42  17   DC n 
42  18   DT n 
42  19   DC n 
42  20   DA n 
42  21   DT n 
42  22   DA n 
42  23   DG n 
42  24   DT n 
42  25   DT n 
42  26   DT n 
42  27   DT n 
42  28   DT n 
42  29   DT n 
42  30   DT n 
42  31   DT n 
42  32   DT n 
42  33   DT n 
42  34   DT n 
42  35   DT n 
42  36   DA n 
42  37   DG n 
42  38   DC n 
42  39   DC n 
42  40   DC n 
42  41   DC n 
42  42   DA n 
42  43   DC n 
42  44   DA n 
42  45   DA n 
42  46   DG n 
43  1    DG n 
43  2    DC n 
43  3    DA n 
43  4    DG n 
43  5    DC n 
43  6    DA n 
43  7    DG n 
43  8    DA n 
43  9    DT n 
43  10   DT n 
43  11   DA n 
43  12   DT n 
43  13   DC n 
43  14   DA n 
43  15   DA n 
43  16   DA n 
43  17   DA n 
43  18   DA n 
43  19   DC n 
43  20   DA n 
43  21   DG n 
43  22   DA n 
43  23   DT n 
43  24   DA n 
43  25   DG n 
43  26   DG n 
43  27   DC n 
43  28   DA n 
43  29   DG n 
43  30   DA n 
43  31   DT n 
43  32   DT n 
43  33   DA n 
43  34   DT n 
43  35   DA n 
43  36   DC n 
43  37   DA n 
43  38   DA n 
43  39   DG n 
43  40   DA n 
43  41   DC n 
43  42   DC n 
43  43   DT n 
43  44   DA n 
43  45   DA n 
43  46   DA n 
43  47   DC n 
43  48   DT n 
43  49   DA n 
43  50   DT n 
43  51   DA n 
43  52   DT n 
43  53   DG n 
43  54   DT n 
43  55   DA n 
43  56   DT n 
43  57   DC n 
43  58   DA n 
43  59   DA n 
43  60   DT n 
43  61   DA n 
43  62   DG n 
44  1    DA n 
44  2    DG n 
44  3    DG n 
44  4    DC n 
44  5    DA n 
44  6    DA n 
44  7    DG n 
44  8    DT n 
44  9    DC n 
44  10   DG n 
44  11   DA n 
44  12   DA n 
44  13   DA n 
44  14   DT n 
44  15   DG n 
44  16   DA n 
44  17   DG n 
44  18   DG n 
44  19   DT n 
44  20   DT n 
44  21   DT n 
44  22   DA n 
44  23   DG n 
44  24   DC n 
44  25   DG n 
44  26   DG n 
44  27   DA n 
44  28   DT n 
44  29   DA n 
44  30   DA n 
44  31   DT n 
44  32   DA n 
44  33   DG n 
44  34   DC n 
44  35   DG n 
44  36   DG n 
44  37   DG n 
44  38   DG n 
44  39   DG n 
44  40   DA n 
44  41   DA n 
44  42   DA n 
44  43   DC n 
44  44   DG n 
44  45   DC n 
44  46   DA n 
45  1    DT n 
45  2    DT n 
45  3    DA n 
45  4    DA n 
45  5    DC n 
45  6    DC n 
45  7    DG n 
45  8    DC n 
45  9    DC n 
45  10   DA n 
45  11   DT n 
45  12   DT n 
45  13   DG n 
45  14   DT n 
45  15   DA n 
45  16   DT n 
45  17   DC n 
45  18   DA n 
45  19   DC n 
45  20   DA n 
45  21   DT n 
45  22   DC n 
45  23   DT n 
45  24   DT n 
45  25   DC n 
45  26   DT n 
45  27   DA n 
45  28   DT n 
45  29   DT n 
45  30   DC n 
45  31   DT n 
45  32   DT n 
45  33   DA n 
45  34   DC n 
45  35   DG n 
45  36   DC n 
45  37   DG n 
45  38   DA n 
45  39   DT n 
45  40   DA n 
45  41   DG n 
45  42   DC n 
45  43   DT n 
45  44   DA n 
45  45   DC n 
45  46   DA n 
45  47   DT n 
45  48   DA n 
46  1    DC n 
46  2    DA n 
46  3    DA n 
46  4    DC n 
46  5    DG n 
46  6    DC n 
46  7    DC n 
46  8    DT n 
46  9    DG n 
46  10   DT n 
46  11   DA n 
46  12   DG n 
46  13   DC n 
46  14   DA n 
46  15   DG n 
46  16   DT n 
46  17   DA n 
46  18   DC n 
46  19   DT n 
46  20   DC n 
46  21   DA n 
46  22   DG n 
46  23   DC n 
46  24   DC n 
46  25   DG n 
46  26   DC n 
46  27   DG n 
46  28   DA n 
46  29   DC n 
46  30   DC n 
46  31   DG n 
46  32   DA n 
46  33   DA n 
46  34   DA n 
46  35   DA n 
46  36   DC n 
46  37   DT n 
46  38   DT n 
46  39   DT n 
46  40   DA n 
46  41   DG n 
46  42   DG n 
46  43   DG n 
46  44   DC n 
46  45   DT n 
46  46   DT n 
46  47   DA n 
46  48   DT n 
47  1    DC n 
47  2    DA n 
47  3    DC n 
47  4    DC n 
47  5    DC n 
47  6    DT n 
47  7    DG n 
47  8    DT n 
47  9    DA n 
47  10   DT n 
47  11   DC n 
47  12   DG n 
47  13   DG n 
47  14   DT n 
47  15   DA n 
47  16   DG n 
47  17   DG n 
47  18   DC n 
47  19   DT n 
47  20   DC n 
47  21   DC n 
47  22   DA n 
47  23   DT n 
47  24   DT n 
47  25   DA n 
47  26   DG n 
47  27   DA n 
47  28   DC n 
47  29   DG n 
47  30   DG n 
47  31   DT n 
47  32   DG n 
47  33   DT n 
47  34   DT n 
47  35   DT n 
47  36   DA n 
47  37   DA n 
47  38   DC n 
47  39   DG n 
47  40   DT n 
47  41   DC n 
47  42   DA n 
47  43   DA n 
47  44   DA n 
47  45   DA n 
47  46   DA n 
47  47   DT n 
47  48   DG n 
48  1    DG n 
48  2    DG n 
48  3    DG n 
48  4    DA n 
48  5    DT n 
48  6    DC n 
48  7    DC n 
48  8    DG n 
48  9    DA n 
48  10   DG n 
48  11   DG n 
48  12   DG n 
48  13   DT n 
48  14   DA n 
48  15   DT n 
48  16   DT n 
48  17   DG n 
48  18   DA n 
48  19   DC n 
48  20   DC n 
48  21   DC n 
48  22   DC n 
48  23   DA n 
48  24   DC n 
48  25   DG n 
48  26   DG n 
48  27   DA n 
48  28   DG n 
48  29   DA n 
48  30   DT n 
48  31   DC n 
48  32   DC n 
48  33   DC n 
48  34   DT n 
48  35   DC n 
48  36   DA n 
49  1    DA n 
49  2    DA n 
49  3    DC n 
49  4    DT n 
49  5    DT n 
49  6    DT n 
49  7    DG n 
49  8    DA n 
49  9    DG n 
49  10   DG n 
49  11   DT n 
49  12   DG n 
49  13   DC n 
49  14   DA n 
49  15   DG n 
49  16   DG n 
49  17   DG n 
49  18   DA n 
49  19   DT n 
49  20   DT n 
49  21   DT n 
49  22   DC n 
49  23   DT n 
49  24   DT n 
49  25   DA n 
49  26   DA n 
49  27   DT n 
49  28   DA n 
49  29   DA n 
49  30   DT n 
49  31   DT n 
49  32   DT n 
49  33   DT n 
49  34   DT n 
49  35   DA n 
49  36   DA n 
49  37   DA n 
49  38   DG n 
49  39   DT n 
49  40   DC n 
49  41   DA n 
49  42   DG n 
49  43   DA n 
49  44   DT n 
49  45   DT n 
49  46   DT n 
49  47   DA n 
49  48   DT n 
50  1    DG n 
50  2    DC n 
50  3    DC n 
50  4    DG n 
50  5    DT n 
50  6    DT n 
50  7    DG n 
50  8    DA n 
50  9    DA n 
50  10   DC n 
50  11   DC n 
50  12   DT n 
50  13   DC n 
50  14   DC n 
50  15   DC n 
50  16   DA n 
50  17   DG n 
50  18   DC n 
50  19   DT n 
50  20   DA n 
50  21   DC n 
50  22   DA n 
50  23   DA n 
50  24   DT n 
50  25   DT n 
50  26   DT n 
50  27   DT n 
50  28   DA n 
50  29   DT n 
50  30   DC n 
50  31   DC n 
50  32   DG n 
50  33   DA n 
50  34   DT n 
50  35   DT n 
50  36   DT n 
50  37   DT n 
50  38   DT n 
50  39   DG n 
50  40   DA n 
50  41   DG n 
50  42   DA n 
50  43   DA n 
50  44   DT n 
50  45   DT n 
50  46   DA n 
50  47   DA n 
50  48   DC n 
51  1    DG n 
51  2    DA n 
51  3    DA n 
51  4    DG n 
51  5    DC n 
51  6    DC n 
51  7    DG n 
51  8    DT n 
51  9    DA n 
51  10   DC n 
51  11   DC n 
51  12   DG n 
51  13   DC n 
51  14   DA n 
51  15   DT n 
51  16   DT n 
51  17   DC n 
51  18   DC n 
51  19   DA n 
51  20   DA n 
51  21   DG n 
51  22   DA n 
51  23   DA n 
51  24   DT n 
51  25   DA n 
51  26   DA n 
51  27   DT n 
51  28   DC n 
51  29   DG n 
51  30   DG n 
51  31   DT n 
51  32   DA n 
51  33   DA n 
51  34   DG n 
51  35   DC n 
51  36   DA n 
51  37   DG n 
51  38   DA n 
51  39   DT n 
51  40   DA n 
51  41   DG n 
51  42   DC n 
51  43   DC n 
51  44   DT n 
51  45   DT n 
51  46   DT n 
51  47   DT n 
51  48   DT n 
52  1    DG n 
52  2    DC n 
52  3    DT n 
52  4    DT n 
52  5    DT n 
52  6    DA n 
52  7    DT n 
52  8    DT n 
52  9    DT n 
52  10   DT n 
52  11   DC n 
52  12   DA n 
52  13   DA n 
52  14   DA n 
52  15   DA n 
52  16   DA n 
52  17   DA n 
52  18   DA n 
52  19   DT n 
52  20   DT n 
52  21   DA n 
52  22   DT n 
52  23   DC n 
52  24   DA n 
52  25   DG n 
52  26   DC n 
52  27   DA n 
52  28   DG n 
52  29   DC n 
52  30   DT n 
52  31   DA n 
52  32   DT n 
52  33   DC n 
52  34   DT n 
52  35   DC n 
52  36   DC n 
52  37   DG n 
52  38   DT n 
52  39   DA n 
52  40   DA n 
52  41   DC n 
52  42   DA n 
52  43   DC n 
52  44   DT n 
52  45   DG n 
52  46   DA n 
52  47   DG n 
52  48   DT n 
53  1    DC n 
53  2    DG n 
53  3    DA n 
53  4    DA n 
53  5    DC n 
53  6    DG n 
53  7    DC n 
53  8    DA n 
53  9    DA n 
53  10   DT n 
53  11   DA n 
53  12   DA n 
53  13   DG n 
53  14   DT n 
53  15   DT n 
53  16   DA n 
53  17   DC n 
53  18   DC n 
53  19   DT n 
53  20   DT n 
53  21   DT n 
53  22   DG n 
53  23   DG n 
53  24   DG n 
53  25   DA n 
53  26   DA n 
53  27   DT n 
53  28   DT n 
53  29   DA n 
53  30   DG n 
53  31   DA n 
53  32   DG n 
53  33   DC n 
53  34   DC n 
53  35   DT n 
53  36   DT n 
53  37   DA n 
53  38   DG n 
53  39   DC n 
53  40   DG n 
53  41   DT n 
53  42   DT n 
53  43   DT n 
53  44   DG n 
53  45   DC n 
53  46   DC n 
53  47   DA n 
53  48   DT n 
53  49   DT n 
53  50   DT n 
53  51   DT n 
53  52   DT n 
54  1    DT n 
54  2    DA n 
54  3    DG n 
54  4    DC n 
54  5    DA n 
54  6    DG n 
54  7    DC n 
54  8    DC n 
54  9    DT n 
54  10   DT n 
54  11   DT n 
54  12   DA n 
54  13   DC n 
54  14   DA n 
54  15   DG n 
54  16   DT n 
54  17   DT n 
54  18   DT n 
54  19   DT n 
54  20   DT n 
54  21   DT n 
54  22   DT n 
54  23   DT n 
54  24   DT n 
54  25   DT n 
54  26   DA n 
54  27   DG n 
54  28   DA n 
54  29   DG n 
54  30   DA n 
54  31   DA n 
54  32   DT n 
54  33   DA n 
54  34   DA n 
54  35   DC n 
54  36   DA n 
54  37   DT n 
54  38   DA n 
55  1    DA n 
55  2    DC n 
55  3    DT n 
55  4    DG n 
55  5    DA n 
55  6    DT n 
55  7    DA n 
55  8    DT n 
55  9    DA n 
55  10   DA n 
55  11   DG n 
55  12   DT n 
55  13   DA n 
55  14   DT n 
55  15   DA n 
55  16   DT n 
55  17   DT n 
55  18   DT n 
55  19   DT n 
55  20   DT n 
55  21   DT n 
55  22   DT n 
55  23   DT n 
55  24   DT n 
55  25   DT n 
55  26   DG n 
55  27   DC n 
55  28   DC n 
55  29   DC n 
55  30   DG n 
55  31   DG n 
55  32   DA n 
55  33   DA n 
55  34   DT n 
55  35   DA n 
55  36   DG n 
55  37   DG n 
55  38   DT n 
55  39   DA n 
55  40   DG n 
55  41   DG n 
55  42   DC n 
55  43   DT n 
55  44   DG n 
55  45   DA n 
55  46   DG n 
55  47   DT n 
55  48   DT n 
55  49   DT n 
55  50   DT n 
55  51   DT n 
56  1    DG n 
56  2    DC n 
56  3    DG n 
56  4    DC n 
56  5    DG n 
56  6    DC n 
56  7    DG n 
56  8    DG n 
56  9    DG n 
56  10   DG n 
56  11   DA n 
56  12   DC n 
56  13   DG n 
56  14   DT n 
56  15   DG n 
56  16   DC n 
56  17   DT n 
56  18   DT n 
56  19   DC n 
56  20   DG n 
56  21   DC n 
56  22   DC n 
56  23   DG n 
56  24   DC n 
56  25   DT n 
56  26   DA n 
56  27   DC n 
56  28   DA n 
56  29   DG n 
56  30   DC n 
56  31   DT n 
56  32   DT n 
56  33   DT n 
56  34   DC n 
56  35   DA n 
56  36   DA n 
56  37   DT n 
56  38   DA n 
56  39   DG n 
56  40   DG n 
56  41   DA n 
56  42   DA n 
56  43   DT n 
56  44   DT n 
56  45   DG n 
56  46   DC n 
56  47   DG n 
56  48   DG n 
57  1    DT n 
57  2    DT n 
57  3    DT n 
57  4    DT n 
57  5    DT n 
57  6    DT n 
57  7    DA n 
57  8    DA n 
57  9    DA n 
57  10   DT n 
57  11   DC n 
57  12   DA n 
57  13   DT n 
57  14   DT n 
57  15   DC n 
57  16   DC n 
57  17   DT n 
57  18   DT n 
57  19   DT n 
57  20   DT n 
57  21   DT n 
57  22   DT n 
57  23   DT n 
57  24   DT n 
57  25   DT n 
57  26   DT n 
57  27   DG n 
57  28   DT n 
57  29   DG n 
57  30   DG n 
57  31   DG n 
57  32   DA n 
57  33   DA n 
57  34   DC n 
57  35   DA n 
57  36   DA n 
57  37   DA n 
57  38   DC n 
57  39   DT n 
57  40   DC n 
57  41   DA n 
57  42   DG n 
57  43   DG n 
57  44   DA n 
57  45   DA n 
57  46   DA n 
57  47   DA n 
57  48   DT n 
57  49   DA n 
57  50   DG n 
57  51   DT n 
57  52   DA n 
57  53   DG n 
57  54   DT n 
57  55   DG n 
57  56   DA n 
57  57   DA n 
57  58   DA n 
57  59   DA n 
58  1    DG n 
58  2    DC n 
58  3    DA n 
58  4    DA n 
58  5    DC n 
58  6    DA n 
58  7    DT n 
58  8    DG n 
58  9    DA n 
58  10   DG n 
58  11   DG n 
58  12   DC n 
58  13   DG n 
58  14   DG n 
58  15   DT n 
58  16   DG n 
58  17   DA n 
58  18   DC n 
58  19   DC n 
58  20   DG n 
58  21   DT n 
58  22   DA n 
58  23   DA n 
58  24   DG n 
58  25   DC n 
58  26   DG n 
58  27   DA n 
58  28   DG n 
58  29   DT n 
58  30   DA n 
58  31   DC n 
58  32   DC n 
58  33   DA n 
58  34   DC n 
58  35   DC n 
58  36   DA n 
59  1    DT n 
59  2    DC n 
59  3    DT n 
59  4    DT n 
59  5    DT n 
59  6    DG n 
59  7    DA n 
59  8    DT n 
59  9    DT n 
59  10   DA n 
59  11   DG n 
59  12   DT n 
59  13   DA n 
59  14   DA n 
59  15   DG n 
59  16   DA n 
59  17   DG n 
59  18   DT n 
59  19   DC n 
59  20   DT n 
59  21   DG n 
59  22   DT n 
59  23   DG n 
59  24   DG n 
59  25   DG n 
59  26   DC n 
59  27   DG n 
59  28   DA n 
59  29   DT n 
59  30   DC n 
59  31   DC n 
59  32   DC n 
59  33   DA n 
59  34   DG n 
59  35   DG n 
59  36   DC n 
59  37   DA n 
59  38   DA n 
59  39   DC n 
59  40   DA n 
59  41   DA n 
59  42   DT n 
59  43   DA n 
59  44   DA n 
59  45   DC n 
59  46   DC n 
59  47   DC n 
59  48   DA n 
60  1    DT n 
60  2    DT n 
60  3    DT n 
60  4    DT n 
60  5    DT n 
60  6    DA n 
60  7    DA n 
60  8    DC n 
60  9    DC n 
60  10   DA n 
60  11   DG n 
60  12   DA n 
60  13   DG n 
60  14   DG n 
60  15   DA n 
60  16   DA n 
60  17   DT n 
60  18   DT n 
60  19   DT n 
60  20   DT n 
60  21   DT n 
60  22   DT n 
60  23   DT n 
60  24   DT n 
60  25   DT n 
60  26   DT n 
60  27   DA n 
60  28   DA n 
60  29   DA n 
60  30   DC n 
60  31   DG n 
60  32   DC n 
60  33   DT n 
60  34   DC n 
60  35   DC n 
60  36   DA n 
60  37   DT n 
60  38   DC n 
60  39   DA n 
60  40   DC n 
60  41   DC n 
60  42   DT n 
60  43   DC n 
60  44   DA n 
60  45   DT n 
60  46   DT n 
60  47   DA n 
60  48   DG n 
61  1    DA n 
61  2    DA n 
61  3    DT n 
61  4    DG n 
61  5    DG n 
61  6    DT n 
61  7    DA n 
61  8    DG n 
61  9    DC n 
61  10   DG n 
61  11   DC n 
61  12   DC n 
61  13   DA n 
61  14   DT n 
61  15   DA n 
61  16   DT n 
61  17   DC n 
61  18   DG n 
61  19   DT n 
61  20   DA n 
61  21   DA n 
61  22   DC n 
61  23   DA n 
61  24   DG n 
61  25   DA n 
61  26   DA n 
61  27   DT n 
61  28   DC n 
61  29   DA n 
61  30   DG n 
61  31   DC n 
61  32   DA n 
61  33   DC n 
61  34   DG n 
61  35   DT n 
61  36   DA n 
61  37   DT n 
61  38   DA n 
61  39   DA n 
61  40   DG n 
62  1    DG n 
62  2    DA n 
62  3    DA n 
62  4    DA n 
62  5    DG n 
62  6    DA n 
62  7    DG n 
62  8    DA n 
62  9    DA n 
62  10   DC n 
62  11   DA n 
62  12   DA n 
62  13   DT n 
62  14   DG n 
62  15   DT n 
62  16   DT n 
62  17   DG n 
62  18   DG n 
62  19   DG n 
62  20   DA n 
62  21   DA n 
62  22   DC n 
62  23   DC n 
62  24   DA n 
62  25   DT n 
62  26   DC n 
62  27   DA n 
62  28   DC n 
62  29   DG n 
62  30   DG n 
62  31   DA n 
62  32   DT n 
62  33   DT n 
62  34   DA n 
62  35   DA n 
62  36   DA n 
62  37   DG n 
62  38   DT n 
62  39   DT n 
62  40   DG n 
62  41   DC n 
62  42   DA n 
62  43   DG n 
62  44   DC n 
62  45   DA n 
62  46   DT n 
62  47   DT n 
62  48   DT n 
62  49   DT n 
62  50   DT n 
63  1    DG n 
63  2    DT n 
63  3    DT n 
63  4    DG n 
63  5    DG n 
63  6    DT n 
63  7    DC n 
63  8    DA n 
63  9    DT n 
63  10   DA n 
63  11   DG n 
63  12   DC n 
63  13   DT n 
63  14   DG n 
63  15   DT n 
63  16   DT n 
63  17   DT n 
63  18   DC n 
63  19   DC n 
63  20   DT n 
63  21   DG n 
63  22   DT n 
63  23   DG n 
63  24   DT n 
63  25   DG n 
63  26   DA n 
63  27   DA n 
63  28   DA n 
63  29   DA n 
63  30   DG n 
63  31   DC n 
63  32   DC n 
63  33   DT n 
63  34   DG n 
63  35   DT n 
63  36   DT n 
63  37   DT n 
63  38   DT n 
63  39   DA n 
63  40   DA n 
63  41   DC n 
63  42   DC n 
63  43   DA n 
63  44   DT n 
64  1    DC n 
64  2    DC n 
64  3    DA n 
64  4    DT n 
64  5    DC n 
64  6    DA n 
64  7    DC n 
64  8    DC n 
64  9    DA n 
64  10   DA n 
64  11   DA n 
64  12   DA n 
64  13   DA n 
64  14   DC n 
64  15   DT n 
64  16   DC n 
64  17   DC n 
64  18   DG n 
64  19   DC n 
64  20   DT n 
64  21   DC n 
64  22   DA n 
64  23   DC n 
64  24   DA n 
64  25   DA n 
64  26   DT n 
64  27   DT n 
64  28   DC n 
64  29   DC n 
64  30   DA n 
64  31   DC n 
64  32   DA n 
64  33   DC n 
64  34   DT n 
64  35   DT n 
64  36   DT n 
64  37   DT n 
64  38   DT n 
64  39   DT n 
64  40   DT n 
65  1    DA n 
65  2    DC n 
65  3    DA n 
65  4    DA n 
65  5    DA n 
65  6    DA n 
65  7    DT n 
65  8    DA n 
65  9    DA n 
65  10   DT n 
65  11   DA n 
65  12   DT n 
65  13   DA n 
65  14   DC n 
65  15   DG n 
65  16   DA n 
65  17   DG n 
65  18   DC n 
65  19   DG n 
65  20   DT n 
65  21   DA n 
65  22   DC n 
65  23   DT n 
65  24   DA n 
65  25   DT n 
65  26   DG n 
65  27   DG n 
65  28   DT n 
65  29   DT n 
65  30   DT n 
65  31   DT n 
65  32   DT n 
65  33   DT n 
65  34   DT n 
65  35   DT n 
65  36   DT n 
65  37   DT n 
65  38   DT n 
65  39   DT n 
65  40   DG n 
65  41   DC n 
65  42   DT n 
65  43   DT n 
65  44   DT n 
65  45   DT n 
65  46   DG n 
65  47   DA n 
65  48   DC n 
65  49   DG n 
65  50   DC n 
65  51   DT n 
65  52   DT n 
65  53   DT n 
65  54   DT n 
65  55   DT n 
66  1    DA n 
66  2    DC n 
66  3    DG n 
66  4    DC n 
66  5    DC n 
66  6    DA n 
66  7    DA n 
66  8    DC n 
66  9    DC n 
66  10   DT n 
66  11   DG n 
66  12   DA n 
66  13   DA n 
66  14   DA n 
66  15   DG n 
66  16   DC n 
66  17   DG n 
66  18   DT n 
66  19   DA n 
66  20   DA n 
66  21   DG n 
66  22   DA n 
66  23   DA n 
66  24   DG n 
66  25   DA n 
66  26   DT n 
66  27   DA n 
66  28   DG n 
66  29   DA n 
66  30   DA n 
66  31   DC n 
66  32   DA n 
66  33   DT n 
66  34   DA n 
66  35   DT n 
66  36   DG n 
66  37   DT n 
66  38   DA n 
66  39   DC n 
66  40   DC n 
66  41   DC n 
66  42   DC n 
66  43   DG n 
66  44   DG n 
66  45   DT n 
66  46   DT n 
66  47   DT n 
66  48   DG n 
67  1    DA n 
67  2    DG n 
67  3    DT n 
67  4    DC n 
67  5    DT n 
67  6    DA n 
67  7    DC n 
67  8    DA n 
67  9    DA n 
67  10   DA n 
67  11   DA n 
67  12   DA n 
67  13   DG n 
67  14   DA n 
67  15   DA n 
67  16   DC n 
67  17   DT n 
67  18   DG n 
67  19   DT n 
67  20   DT n 
67  21   DG n 
67  22   DT n 
67  23   DG n 
67  24   DA n 
67  25   DA n 
67  26   DT n 
67  27   DT n 
67  28   DA n 
67  29   DC n 
67  30   DC n 
67  31   DT n 
67  32   DT n 
67  33   DA n 
67  34   DT n 
67  35   DA n 
67  36   DG n 
67  37   DA n 
67  38   DA n 
67  39   DA n 
67  40   DT n 
67  41   DT n 
67  42   DT n 
67  43   DT n 
67  44   DT n 
68  1    DG n 
68  2    DG n 
68  3    DC n 
68  4    DC n 
68  5    DA n 
68  6    DA n 
68  7    DC n 
68  8    DA n 
68  9    DG n 
68  10   DA n 
68  11   DT n 
68  12   DA n 
68  13   DC n 
68  14   DG n 
68  15   DT n 
68  16   DG n 
68  17   DG n 
68  18   DT n 
68  19   DA n 
68  20   DA n 
68  21   DT n 
68  22   DG n 
68  23   DC n 
68  24   DC n 
68  25   DG n 
68  26   DG n 
68  27   DG n 
68  28   DG n 
68  29   DA n 
68  30   DA n 
68  31   DG n 
68  32   DA n 
68  33   DA n 
68  34   DG n 
68  35   DG n 
69  1    DC n 
69  2    DG n 
69  3    DA n 
69  4    DT n 
69  5    DT n 
69  6    DA n 
69  7    DG n 
69  8    DT n 
69  9    DC n 
69  10   DT n 
69  11   DT n 
69  12   DT n 
69  13   DA n 
69  14   DA n 
69  15   DT n 
69  16   DT n 
69  17   DT n 
69  18   DT n 
69  19   DT n 
69  20   DT n 
69  21   DT n 
69  22   DT n 
69  23   DT n 
69  24   DT n 
69  25   DT n 
69  26   DG n 
69  27   DC n 
69  28   DG n 
69  29   DC n 
69  30   DG n 
69  31   DA n 
69  32   DA n 
69  33   DT n 
69  34   DA n 
69  35   DT n 
69  36   DG n 
69  37   DA n 
69  38   DT n 
69  39   DA n 
69  40   DA n 
69  41   DC n 
69  42   DG n 
69  43   DG n 
69  44   DA n 
69  45   DA n 
69  46   DC n 
69  47   DT n 
69  48   DG n 
69  49   DA n 
69  50   DC n 
69  51   DG n 
69  52   DA n 
69  53   DG n 
69  54   DA n 
69  55   DA n 
69  56   DA n 
69  57   DC n 
69  58   DA n 
69  59   DC n 
69  60   DC n 
69  61   DA n 
69  62   DG n 
69  63   DT n 
69  64   DC n 
69  65   DA n 
69  66   DA n 
69  67   DT n 
69  68   DA n 
70  1    DC n 
70  2    DT n 
70  3    DT n 
70  4    DG n 
70  5    DA n 
70  6    DG n 
70  7    DA n 
70  8    DT n 
70  9    DG n 
70  10   DG n 
70  11   DT n 
70  12   DT n 
70  13   DT n 
70  14   DA n 
70  15   DA n 
70  16   DA n 
70  17   DT n 
70  18   DT n 
70  19   DA n 
70  20   DC n 
70  21   DC n 
70  22   DT n 
70  23   DT n 
70  24   DA n 
70  25   DT n 
70  26   DT n 
70  27   DT n 
70  28   DC n 
70  29   DA n 
70  30   DA n 
70  31   DA n 
70  32   DA n 
70  33   DT n 
70  34   DT n 
70  35   DA n 
70  36   DA n 
70  37   DG n 
70  38   DC n 
70  39   DT n 
70  40   DA n 
71  1    DA n 
71  2    DA n 
71  3    DA n 
71  4    DA n 
71  5    DC n 
71  6    DG n 
71  7    DA n 
71  8    DG n 
71  9    DT n 
71  10   DA n 
71  11   DG n 
71  12   DC n 
71  13   DC n 
71  14   DG n 
71  15   DG n 
71  16   DA n 
71  17   DG n 
71  18   DA n 
71  19   DG n 
71  20   DT n 
71  21   DT n 
71  22   DC n 
71  23   DT n 
71  24   DA n 
71  25   DG n 
71  26   DC n 
71  27   DG n 
71  28   DA n 
71  29   DA n 
71  30   DA n 
71  31   DA n 
71  32   DG n 
71  33   DC n 
71  34   DC n 
71  35   DT n 
71  36   DA n 
71  37   DA n 
71  38   DA n 
71  39   DA n 
71  40   DG n 
71  41   DG n 
71  42   DG n 
71  43   DA n 
71  44   DC n 
71  45   DA n 
71  46   DT n 
71  47   DT n 
71  48   DC n 
71  49   DT n 
72  1    DC n 
72  2    DA n 
72  3    DA n 
72  4    DT n 
72  5    DT n 
72  6    DT n 
72  7    DT n 
72  8    DT n 
72  9    DT n 
72  10   DT n 
72  11   DT n 
72  12   DT n 
72  13   DT n 
72  14   DA n 
72  15   DT n 
72  16   DC n 
72  17   DA n 
72  18   DA n 
72  19   DC n 
72  20   DG n 
72  21   DT n 
72  22   DA n 
72  23   DA n 
72  24   DC n 
72  25   DA n 
72  26   DA n 
72  27   DA n 
72  28   DG n 
72  29   DC n 
72  30   DT n 
72  31   DG n 
72  32   DC n 
72  33   DT n 
72  34   DC n 
72  35   DA n 
72  36   DT n 
72  37   DT n 
72  38   DC n 
72  39   DA n 
72  40   DG n 
72  41   DT n 
72  42   DA n 
73  1    DT n 
73  2    DT n 
73  3    DT n 
73  4    DT n 
73  5    DT n 
73  6    DA n 
73  7    DC n 
73  8    DG n 
73  9    DA n 
73  10   DG n 
73  11   DA n 
73  12   DC n 
73  13   DA n 
73  14   DA n 
73  15   DA n 
73  16   DA n 
73  17   DT n 
73  18   DT n 
73  19   DC n 
73  20   DC n 
73  21   DT n 
73  22   DC n 
73  23   DA n 
73  24   DT n 
73  25   DA n 
73  26   DT n 
73  27   DA n 
73  28   DT n 
73  29   DT n 
73  30   DT n 
73  31   DT n 
73  32   DA n 
73  33   DT n 
73  34   DT n 
73  35   DT n 
73  36   DT n 
73  37   DA n 
73  38   DT n 
73  39   DT n 
73  40   DT n 
73  41   DT n 
73  42   DA n 
74  1    DT n 
74  2    DA n 
74  3    DT n 
74  4    DG n 
74  5    DA n 
74  6    DC n 
74  7    DC n 
74  8    DC n 
74  9    DT n 
74  10   DG n 
74  11   DA n 
74  12   DA n 
74  13   DA n 
74  14   DT n 
74  15   DC n 
74  16   DG n 
74  17   DG n 
74  18   DT n 
74  19   DC n 
74  20   DT n 
74  21   DG n 
74  22   DG n 
74  23   DC n 
74  24   DC n 
74  25   DT n 
74  26   DT n 
74  27   DA n 
74  28   DC n 
74  29   DC n 
74  30   DT n 
74  31   DA n 
74  32   DC n 
74  33   DA n 
74  34   DT n 
74  35   DT n 
74  36   DT n 
74  37   DG n 
74  38   DA n 
74  39   DC n 
74  40   DG n 
74  41   DA n 
74  42   DG n 
74  43   DA n 
74  44   DG n 
74  45   DC n 
74  46   DG n 
74  47   DG n 
74  48   DG n 
74  49   DA n 
74  50   DG n 
74  51   DC n 
74  52   DT n 
74  53   DA n 
74  54   DT n 
74  55   DT n 
74  56   DT n 
74  57   DT n 
74  58   DT n 
75  1    DC n 
75  2    DA n 
75  3    DT n 
75  4    DA n 
75  5    DT n 
75  6    DC n 
75  7    DC n 
75  8    DA n 
75  9    DA n 
75  10   DA n 
75  11   DA n 
75  12   DG n 
75  13   DA n 
75  14   DA n 
75  15   DA n 
75  16   DT n 
75  17   DT n 
75  18   DA n 
75  19   DG n 
75  20   DC n 
75  21   DA n 
75  22   DA n 
75  23   DC n 
75  24   DG n 
75  25   DC n 
75  26   DA n 
75  27   DA n 
75  28   DG n 
75  29   DG n 
75  30   DA n 
75  31   DG n 
75  32   DT n 
75  33   DT n 
75  34   DA n 
75  35   DA n 
75  36   DA n 
75  37   DT n 
75  38   DC n 
75  39   DT n 
75  40   DA n 
75  41   DA n 
75  42   DA n 
75  43   DT n 
75  44   DT n 
76  1    DA n 
76  2    DT n 
76  3    DT n 
76  4    DT n 
76  5    DT n 
76  6    DA n 
76  7    DT n 
76  8    DC n 
76  9    DC n 
76  10   DT n 
76  11   DC n 
76  12   DG n 
76  13   DT n 
76  14   DT n 
76  15   DC n 
76  16   DG n 
76  17   DT n 
76  18   DG n 
76  19   DC n 
76  20   DA n 
76  21   DT n 
76  22   DC n 
76  23   DT n 
76  24   DG n 
76  25   DG n 
76  26   DT n 
76  27   DG n 
76  28   DT n 
76  29   DA n 
76  30   DG n 
76  31   DC n 
76  32   DA n 
76  33   DC n 
76  34   DC n 
76  35   DA n 
76  36   DG n 
76  37   DC n 
76  38   DA n 
76  39   DC n 
76  40   DT n 
76  41   DC n 
76  42   DA n 
76  43   DG n 
76  44   DA n 
76  45   DG n 
76  46   DC n 
76  47   DA n 
76  48   DA n 
77  1    DA n 
77  2    DA n 
77  3    DT n 
77  4    DT n 
77  5    DA n 
77  6    DT n 
77  7    DT n 
77  8    DT n 
77  9    DT n 
77  10   DT n 
77  11   DT n 
77  12   DT n 
77  13   DT n 
77  14   DT n 
77  15   DT n 
77  16   DA n 
77  17   DA n 
77  18   DA n 
77  19   DT n 
77  20   DT n 
77  21   DC n 
77  22   DG n 
77  23   DC n 
77  24   DA n 
77  25   DT n 
77  26   DT n 
77  27   DT n 
77  28   DC n 
77  29   DG n 
77  30   DG n 
77  31   DA n 
77  32   DT n 
77  33   DT n 
77  34   DC n 
77  35   DA n 
77  36   DC n 
77  37   DA n 
77  38   DG n 
77  39   DG n 
77  40   DC n 
77  41   DA n 
77  42   DA n 
77  43   DT n 
77  44   DA n 
77  45   DG n 
77  46   DC n 
77  47   DA n 
77  48   DT n 
77  49   DT n 
77  50   DA n 
77  51   DG n 
77  52   DG n 
78  1    DT n 
78  2    DT n 
78  3    DT n 
78  4    DT n 
78  5    DT n 
78  6    DT n 
78  7    DC n 
78  8    DA n 
78  9    DA n 
78  10   DT n 
78  11   DC n 
78  12   DG n 
78  13   DT n 
78  14   DT n 
78  15   DG n 
78  16   DT n 
78  17   DA n 
78  18   DC n 
78  19   DC n 
78  20   DA n 
78  21   DA n 
78  22   DC n 
78  23   DC n 
78  24   DT n 
78  25   DA n 
78  26   DA n 
78  27   DT n 
78  28   DT n 
78  29   DT n 
78  30   DT n 
78  31   DT n 
78  32   DT n 
78  33   DT n 
78  34   DT n 
78  35   DT n 
78  36   DT n 
78  37   DA n 
78  38   DA n 
78  39   DC n 
78  40   DA n 
78  41   DT n 
78  42   DC n 
78  43   DG n 
78  44   DC n 
78  45   DC n 
78  46   DA n 
78  47   DT n 
78  48   DT n 
78  49   DA n 
78  50   DA n 
78  51   DG n 
78  52   DA n 
78  53   DT n 
78  54   DT n 
78  55   DT n 
78  56   DT n 
78  57   DC n 
78  58   DG n 
78  59   DA n 
78  60   DG n 
78  61   DC n 
78  62   DG n 
78  63   DG n 
79  1    DA n 
79  2    DT n 
79  3    DC n 
79  4    DA n 
79  5    DA n 
79  6    DA n 
79  7    DG n 
79  8    DC n 
79  9    DG n 
79  10   DG n 
79  11   DT n 
79  12   DA n 
79  13   DT n 
79  14   DA n 
79  15   DT n 
79  16   DT n 
79  17   DT n 
79  18   DT n 
79  19   DA n 
79  20   DT n 
79  21   DA n 
79  22   DT n 
79  23   DA n 
79  24   DA n 
79  25   DC n 
79  26   DA n 
79  27   DC n 
79  28   DC n 
79  29   DT n 
79  30   DC n 
79  31   DT n 
79  32   DT n 
79  33   DC n 
79  34   DG n 
79  35   DC n 
79  36   DT n 
79  37   DA n 
79  38   DT n 
79  39   DC n 
79  40   DG n 
79  41   DG n 
79  42   DC n 
79  43   DC n 
79  44   DT n 
79  45   DT n 
79  46   DG n 
79  47   DC n 
79  48   DC n 
79  49   DT n 
80  1    DT n 
80  2    DT n 
80  3    DT n 
80  4    DT n 
80  5    DT n 
80  6    DA n 
80  7    DA n 
80  8    DA n 
80  9    DA n 
80  10   DT n 
80  11   DC n 
80  12   DA n 
80  13   DG n 
80  14   DG n 
80  15   DT n 
80  16   DC n 
80  17   DT n 
80  18   DT n 
80  19   DT n 
80  20   DG n 
80  21   DG n 
80  22   DC n 
80  23   DA n 
80  24   DT n 
80  25   DC n 
80  26   DA n 
80  27   DT n 
80  28   DT n 
80  29   DT n 
80  30   DT n 
80  31   DT n 
80  32   DT n 
80  33   DT n 
80  34   DT n 
80  35   DT n 
80  36   DT n 
80  37   DA n 
80  38   DT n 
80  39   DT n 
80  40   DC n 
80  41   DT n 
80  42   DA n 
80  43   DC n 
80  44   DT n 
80  45   DG n 
80  46   DA n 
80  47   DT n 
80  48   DT n 
80  49   DT n 
80  50   DT n 
80  51   DT n 
80  52   DT n 
80  53   DT n 
80  54   DT n 
80  55   DT n 
80  56   DT n 
80  57   DT n 
80  58   DC n 
80  59   DG n 
80  60   DC n 
80  61   DA n 
80  62   DC n 
80  63   DT n 
80  64   DC n 
80  65   DC n 
80  66   DA n 
81  1    DC n 
81  2    DC n 
81  3    DC n 
81  4    DG n 
81  5    DA n 
81  6    DA n 
81  7    DA n 
81  8    DC n 
81  9    DA n 
81  10   DT n 
81  11   DT n 
81  12   DT n 
81  13   DC n 
81  14   DG n 
81  15   DG n 
81  16   DT n 
81  17   DA n 
81  18   DG n 
81  19   DA n 
81  20   DT n 
81  21   DT n 
81  22   DT n 
81  23   DG n 
81  24   DC n 
81  25   DG n 
81  26   DC n 
81  27   DA n 
81  28   DA n 
81  29   DC n 
81  30   DT n 
81  31   DA n 
81  32   DT n 
81  33   DT n 
81  34   DA n 
81  35   DC n 
81  36   DC n 
81  37   DG n 
81  38   DC n 
81  39   DT n 
81  40   DA n 
81  41   DG n 
81  42   DC n 
81  43   DA n 
81  44   DA n 
81  45   DT n 
81  46   DA n 
81  47   DC n 
81  48   DT n 
82  1    DA n 
82  2    DT n 
82  3    DT n 
82  4    DT n 
82  5    DT n 
82  6    DT n 
82  7    DT n 
82  8    DT n 
82  9    DA n 
82  10   DT n 
82  11   DT n 
82  12   DT n 
82  13   DT n 
82  14   DT n 
82  15   DA n 
82  16   DA n 
82  17   DA n 
82  18   DT n 
82  19   DA n 
82  20   DT n 
82  21   DG n 
82  22   DC n 
82  23   DT n 
82  24   DT n 
82  25   DT n 
82  26   DT n 
82  27   DT n 
82  28   DT n 
82  29   DT n 
82  30   DT n 
82  31   DT n 
82  32   DT n 
82  33   DA n 
82  34   DA n 
82  35   DC n 
82  36   DT n 
82  37   DA n 
82  38   DA n 
82  39   DA n 
82  40   DG n 
82  41   DG n 
82  42   DG n 
82  43   DA n 
82  44   DT n 
82  45   DT n 
82  46   DT n 
82  47   DT n 
82  48   DT n 
82  49   DT n 
82  50   DT n 
82  51   DT n 
82  52   DT n 
82  53   DT n 
82  54   DT n 
82  55   DG n 
82  56   DT n 
82  57   DG n 
82  58   DC n 
82  59   DT n 
82  60   DG n 
82  61   DC n 
82  62   DA n 
82  63   DA n 
82  64   DG n 
83  1    DT n 
83  2    DT n 
83  3    DG n 
83  4    DC n 
83  5    DT n 
83  6    DC n 
83  7    DT n 
83  8    DT n 
83  9    DC n 
83  10   DA n 
83  11   DT n 
83  12   DT n 
83  13   DC n 
83  14   DC n 
83  15   DC n 
83  16   DA n 
83  17   DT n 
83  18   DT n 
83  19   DT n 
83  20   DG n 
83  21   DG n 
83  22   DG n 
83  23   DC n 
83  24   DG n 
83  25   DG n 
83  26   DC n 
83  27   DA n 
83  28   DC n 
83  29   DC n 
83  30   DG n 
83  31   DC n 
83  32   DG n 
83  33   DA n 
83  34   DC n 
83  35   DG n 
83  36   DA n 
83  37   DC n 
83  38   DA n 
83  39   DG n 
83  40   DT n 
83  41   DA n 
83  42   DA n 
83  43   DA n 
83  44   DA n 
83  45   DC n 
83  46   DG n 
83  47   DC n 
83  48   DG n 
84  1    DT n 
84  2    DT n 
84  3    DT n 
84  4    DT n 
84  5    DT n 
84  6    DG n 
84  7    DC n 
84  8    DA n 
84  9    DA n 
84  10   DC n 
84  11   DG n 
84  12   DC n 
84  13   DT n 
84  14   DA n 
84  15   DG n 
84  16   DT n 
84  17   DT n 
84  18   DT n 
84  19   DG n 
84  20   DA n 
84  21   DC n 
84  22   DA n 
84  23   DT n 
84  24   DA n 
84  25   DT n 
84  26   DC n 
84  27   DT n 
84  28   DT n 
84  29   DT n 
84  30   DT n 
84  31   DT n 
84  32   DT n 
84  33   DT n 
84  34   DT n 
84  35   DT n 
84  36   DT n 
84  37   DT n 
84  38   DG n 
84  39   DG n 
84  40   DT n 
84  41   DC n 
84  42   DA n 
84  43   DG n 
84  44   DT n 
84  45   DT n 
84  46   DG n 
84  47   DG n 
84  48   DC n 
84  49   DA n 
84  50   DC n 
84  51   DC n 
84  52   DG n 
85  1    DT n 
85  2    DT n 
85  3    DT n 
85  4    DT n 
85  5    DT n 
85  6    DG n 
85  7    DG n 
85  8    DT n 
85  9    DC n 
85  10   DA n 
85  11   DT n 
85  12   DT n 
85  13   DG n 
85  14   DG n 
85  15   DA n 
85  16   DA n 
85  17   DT n 
85  18   DT n 
85  19   DT n 
85  20   DT n 
85  21   DT n 
85  22   DT n 
85  23   DT n 
85  24   DT n 
85  25   DT n 
85  26   DT n 
85  27   DC n 
85  28   DG n 
85  29   DG n 
85  30   DT n 
85  31   DA n 
85  32   DA n 
85  33   DT n 
85  34   DC n 
85  35   DG n 
85  36   DT n 
85  37   DA n 
85  38   DA n 
85  39   DT n 
85  40   DA n 
85  41   DT n 
85  42   DT n 
85  43   DT n 
85  44   DT n 
85  45   DG n 
85  46   DT n 
85  47   DG n 
85  48   DC n 
85  49   DA n 
85  50   DA n 
85  51   DT n 
85  52   DG n 
85  53   DC n 
85  54   DT n 
85  55   DT n 
86  1    DC n 
86  2    DT n 
86  3    DA n 
86  4    DT n 
86  5    DT n 
86  6    DT n 
86  7    DA n 
86  8    DT n 
86  9    DG n 
86  10   DT n 
86  11   DC n 
86  12   DA n 
86  13   DA n 
86  14   DT n 
86  15   DC n 
86  16   DC n 
86  17   DC n 
86  18   DT n 
86  19   DT n 
86  20   DC n 
86  21   DT n 
86  22   DG n 
86  23   DA n 
86  24   DA n 
86  25   DA n 
86  26   DC n 
86  27   DA n 
86  28   DA n 
86  29   DG n 
86  30   DA n 
86  31   DG n 
86  32   DA n 
86  33   DA n 
86  34   DT n 
86  35   DC n 
86  36   DG n 
86  37   DA n 
86  38   DT n 
86  39   DC n 
86  40   DC n 
86  41   DT n 
86  42   DG n 
86  43   DA n 
86  44   DG n 
87  1    DT n 
87  2    DT n 
87  3    DT n 
87  4    DT n 
87  5    DT n 
87  6    DG n 
87  7    DA n 
87  8    DA n 
87  9    DT n 
87  10   DG n 
87  11   DG n 
87  12   DC n 
87  13   DT n 
87  14   DA n 
87  15   DC n 
87  16   DC n 
87  17   DA n 
87  18   DG n 
87  19   DT n 
87  20   DA n 
87  21   DA n 
87  22   DA n 
87  23   DT n 
87  24   DT n 
87  25   DG n 
87  26   DG n 
87  27   DC n 
87  28   DA n 
87  29   DG n 
87  30   DA n 
87  31   DT n 
87  32   DT n 
87  33   DC n 
87  34   DA n 
87  35   DC n 
87  36   DC n 
87  37   DA n 
87  38   DT n 
87  39   DT n 
87  40   DT n 
87  41   DT n 
87  42   DT n 
87  43   DT n 
87  44   DT n 
87  45   DT n 
87  46   DT n 
87  47   DT n 
87  48   DG n 
87  49   DT n 
87  50   DC n 
87  51   DA n 
87  52   DC n 
87  53   DA n 
88  1    DG n 
88  2    DC n 
88  3    DG n 
88  4    DT n 
88  5    DT n 
88  6    DG n 
88  7    DA n 
88  8    DA n 
88  9    DT n 
88  10   DG n 
88  11   DA n 
88  12   DG n 
88  13   DT n 
88  14   DG n 
88  15   DT n 
88  16   DA n 
88  17   DA n 
88  18   DA n 
88  19   DG n 
88  20   DT n 
88  21   DG n 
88  22   DT n 
88  23   DA n 
88  24   DA n 
88  25   DT n 
88  26   DT n 
88  27   DG n 
88  28   DT n 
88  29   DT n 
88  30   DA n 
88  31   DA n 
88  32   DG n 
88  33   DG n 
88  34   DA n 
88  35   DA n 
88  36   DG n 
88  37   DA n 
88  38   DT n 
88  39   DG n 
88  40   DA n 
88  41   DT n 
88  42   DA n 
88  43   DA n 
88  44   DT n 
88  45   DC n 
88  46   DA n 
88  47   DT n 
88  48   DG n 
89  1    DT n 
89  2    DT n 
89  3    DT n 
89  4    DT n 
89  5    DT n 
89  6    DT n 
89  7    DA n 
89  8    DC n 
89  9    DC n 
89  10   DG n 
89  11   DG n 
89  12   DC n 
89  13   DG n 
89  14   DC n 
89  15   DG n 
89  16   DT n 
89  17   DA n 
89  18   DA n 
89  19   DA n 
89  20   DC n 
89  21   DA n 
89  22   DA n 
89  23   DC n 
89  24   DC n 
89  25   DC n 
89  26   DG n 
89  27   DA n 
89  28   DA n 
89  29   DA n 
89  30   DT n 
89  31   DT n 
89  32   DT n 
89  33   DT n 
89  34   DT n 
89  35   DT n 
89  36   DA n 
89  37   DA n 
89  38   DA n 
89  39   DA n 
89  40   DA n 
89  41   DT n 
89  42   DT n 
89  43   DC n 
89  44   DT n 
89  45   DG n 
89  46   DA n 
89  47   DG n 
89  48   DT n 
90  1    DT n 
90  2    DT n 
90  3    DT n 
90  4    DA n 
90  5    DA n 
90  6    DC n 
90  7    DT n 
90  8    DC n 
90  9    DG n 
90  10   DC n 
90  11   DG n 
90  12   DT n 
90  13   DC n 
90  14   DT n 
90  15   DT n 
90  16   DT n 
90  17   DT n 
90  18   DT n 
90  19   DT n 
90  20   DT n 
90  21   DT n 
90  22   DT n 
90  23   DT n 
90  24   DT n 
90  25   DG n 
90  26   DA n 
90  27   DA n 
90  28   DA n 
90  29   DT n 
90  30   DG n 
90  31   DG n 
90  32   DA n 
90  33   DT n 
90  34   DC n 
90  35   DA n 
90  36   DC n 
90  37   DC n 
90  38   DA n 
90  39   DT n 
90  40   DC n 
90  41   DA n 
90  42   DA n 
90  43   DC n 
90  44   DT n 
90  45   DG n 
90  46   DT n 
90  47   DT n 
90  48   DT n 
90  49   DT n 
90  50   DT n 
90  51   DT n 
90  52   DT n 
90  53   DT n 
90  54   DT n 
90  55   DT n 
90  56   DA n 
90  57   DT n 
90  58   DA n 
90  59   DG n 
90  60   DC n 
90  61   DA n 
90  62   DA n 
90  63   DA n 
90  64   DC n 
90  65   DA n 
90  66   DT n 
91  1    DA n 
91  2    DA n 
91  3    DT n 
91  4    DG n 
91  5    DT n 
91  6    DG n 
91  7    DA n 
91  8    DT n 
91  9    DG n 
91  10   DG n 
91  11   DG n 
91  12   DA n 
91  13   DT n 
91  14   DA n 
91  15   DC n 
91  16   DT n 
91  17   DG n 
91  18   DC n 
91  19   DA n 
91  20   DG n 
91  21   DG n 
91  22   DT n 
91  23   DA n 
91  24   DC n 
91  25   DG n 
91  26   DG n 
91  27   DC n 
91  28   DC n 
91  29   DA n 
91  30   DG n 
91  31   DT n 
91  32   DT n 
91  33   DT n 
91  34   DT n 
91  35   DT n 
91  36   DC n 
91  37   DT n 
91  38   DT n 
91  39   DC n 
91  40   DT n 
91  41   DT n 
91  42   DC n 
91  43   DA n 
91  44   DC n 
91  45   DC n 
91  46   DG n 
91  47   DG n 
91  48   DC n 
92  1    DG n 
92  2    DC n 
92  3    DC n 
92  4    DA n 
92  5    DG n 
92  6    DG n 
92  7    DG n 
92  8    DC n 
92  9    DG n 
92  10   DC n 
92  11   DC n 
92  12   DG n 
92  13   DG n 
92  14   DA n 
92  15   DA n 
92  16   DG n 
92  17   DC n 
92  18   DA n 
92  19   DA n 
92  20   DG n 
92  21   DC n 
92  22   DT n 
92  23   DA n 
92  24   DA n 
92  25   DC n 
92  26   DT n 
92  27   DT n 
92  28   DT n 
92  29   DT n 
92  30   DT n 
92  31   DT n 
92  32   DT n 
92  33   DT n 
92  34   DT n 
92  35   DT n 
92  36   DT n 
92  37   DC n 
92  38   DA n 
92  39   DC n 
92  40   DA n 
92  41   DT n 
92  42   DT n 
92  43   DA n 
92  44   DA n 
92  45   DG n 
92  46   DT n 
92  47   DG n 
92  48   DT n 
92  49   DT n 
92  50   DT n 
92  51   DT n 
92  52   DT n 
92  53   DT n 
92  54   DT n 
92  55   DT n 
92  56   DT n 
92  57   DT n 
92  58   DG n 
92  59   DA n 
92  60   DC n 
92  61   DT n 
92  62   DC n 
92  63   DC n 
92  64   DA n 
92  65   DA n 
92  66   DC n 
92  67   DG n 
92  68   DT n 
93  1    DC n 
93  2    DA n 
93  3    DA n 
93  4    DA n 
93  5    DG n 
93  6    DG n 
93  7    DG n 
93  8    DC n 
93  9    DG n 
93  10   DG n 
93  11   DG n 
93  12   DT n 
93  13   DG n 
93  14   DC n 
93  15   DC n 
93  16   DT n 
93  17   DC n 
93  18   DG n 
93  19   DC n 
93  20   DT n 
93  21   DC n 
93  22   DA n 
93  23   DC n 
93  24   DT n 
93  25   DG n 
93  26   DC n 
93  27   DT n 
93  28   DT n 
93  29   DA n 
93  30   DA n 
93  31   DT n 
93  32   DG n 
93  33   DT n 
93  34   DT n 
93  35   DG n 
93  36   DC n 
93  37   DA n 
93  38   DT n 
93  39   DG n 
93  40   DC n 
93  41   DG n 
93  42   DG n 
93  43   DT n 
93  44   DC n 
93  45   DA n 
93  46   DC n 
93  47   DG n 
93  48   DT n 
93  49   DT n 
93  50   DG n 
94  1    DT n 
94  2    DT n 
94  3    DT n 
94  4    DT n 
94  5    DT n 
94  6    DA n 
94  7    DC n 
94  8    DG n 
94  9    DT n 
94  10   DG n 
94  11   DG n 
94  12   DC n 
94  13   DA n 
94  14   DA n 
94  15   DC n 
94  16   DA n 
94  17   DG n 
94  18   DC n 
94  19   DT n 
94  20   DG n 
94  21   DA n 
94  22   DG n 
94  23   DA n 
94  24   DA n 
94  25   DG n 
94  26   DT n 
94  27   DT n 
94  28   DT n 
94  29   DT n 
94  30   DC n 
94  31   DC n 
94  32   DT n 
94  33   DT n 
94  34   DT n 
94  35   DT n 
94  36   DT n 
94  37   DT n 
94  38   DT n 
94  39   DT n 
94  40   DT n 
94  41   DT n 
94  42   DC n 
94  43   DA n 
94  44   DG n 
94  45   DT n 
94  46   DC n 
94  47   DA n 
94  48   DC n 
94  49   DG n 
94  50   DA n 
94  51   DC n 
94  52   DG n 
94  53   DT n 
94  54   DT n 
94  55   DG n 
94  56   DT n 
95  1    DG n 
95  2    DA n 
95  3    DC n 
95  4    DT n 
95  5    DT n 
95  6    DC n 
95  7    DT n 
95  8    DG n 
95  9    DG n 
95  10   DT n 
95  11   DC n 
95  12   DG n 
95  13   DG n 
95  14   DT n 
95  15   DA n 
95  16   DC n 
95  17   DG n 
95  18   DC n 
95  19   DA n 
95  20   DG n 
95  21   DG n 
95  22   DC n 
95  23   DC n 
95  24   DA n 
95  25   DC n 
95  26   DC n 
95  27   DA n 
95  28   DT n 
95  29   DT n 
95  30   DT n 
95  31   DA n 
95  32   DG n 
95  33   DA n 
95  34   DG n 
95  35   DC n 
95  36   DT n 
95  37   DT n 
95  38   DG n 
95  39   DA n 
95  40   DC n 
95  41   DG n 
95  42   DG n 
95  43   DC n 
95  44   DT n 
95  45   DA n 
95  46   DA n 
95  47   DA n 
95  48   DG n 
96  1    DA n 
96  2    DT n 
96  3    DT n 
96  4    DG n 
96  5    DT n 
96  6    DT n 
96  7    DG n 
96  8    DT n 
96  9    DT n 
96  10   DC n 
96  11   DC n 
96  12   DG n 
96  13   DG n 
96  14   DC n 
96  15   DC n 
96  16   DA n 
96  17   DA n 
96  18   DC n 
96  19   DC n 
96  20   DA n 
96  21   DG n 
96  22   DG n 
96  23   DG n 
96  24   DT n 
96  25   DG n 
96  26   DG n 
96  27   DT n 
96  28   DG n 
96  29   DC n 
96  30   DC n 
96  31   DA n 
96  32   DA n 
96  33   DG n 
96  34   DC n 
96  35   DG n 
96  36   DA n 
96  37   DC n 
96  38   DA n 
96  39   DG n 
96  40   DG n 
96  41   DA n 
96  42   DA n 
96  43   DG n 
96  44   DC n 
96  45   DC n 
96  46   DG n 
96  47   DG n 
96  48   DA n 
97  1    DT n 
97  2    DT n 
97  3    DA n 
97  4    DG n 
97  5    DG n 
97  6    DA n 
97  7    DG n 
97  8    DG n 
97  9    DC n 
97  10   DC n 
97  11   DC n 
97  12   DA n 
97  13   DA n 
97  14   DA n 
97  15   DT n 
97  16   DT n 
97  17   DA n 
97  18   DA n 
97  19   DC n 
97  20   DC n 
97  21   DG n 
97  22   DT n 
97  23   DT n 
97  24   DT n 
97  25   DT n 
97  26   DT n 
97  27   DT n 
97  28   DT n 
97  29   DT n 
97  30   DT n 
97  31   DT n 
97  32   DT n 
97  33   DT n 
97  34   DG n 
97  35   DC n 
97  36   DA n 
97  37   DG n 
97  38   DC n 
97  39   DC n 
97  40   DA n 
97  41   DT n 
97  42   DT n 
97  43   DT n 
97  44   DT n 
97  45   DT n 
97  46   DT n 
97  47   DT n 
98  1    DG n 
98  2    DA n 
98  3    DG n 
98  4    DT n 
98  5    DA n 
98  6    DG n 
98  7    DA n 
98  8    DA n 
98  9    DG n 
98  10   DG n 
98  11   DT n 
98  12   DT n 
98  13   DG n 
98  14   DG n 
98  15   DG n 
98  16   DT n 
98  17   DA n 
98  18   DA n 
98  19   DC n 
98  20   DG n 
98  21   DC n 
98  22   DC n 
98  23   DT n 
98  24   DT n 
98  25   DT n 
98  26   DT n 
98  27   DT n 
98  28   DT n 
98  29   DT n 
98  30   DT n 
98  31   DT n 
98  32   DT n 
98  33   DA n 
98  34   DG n 
98  35   DG n 
98  36   DG n 
98  37   DT n 
98  38   DG n 
98  39   DT n 
98  40   DT n 
98  41   DT n 
98  42   DT n 
98  43   DT n 
98  44   DA n 
98  45   DT n 
98  46   DC n 
98  47   DC n 
98  48   DA n 
99  1    DA n 
99  2    DT n 
99  3    DT n 
99  4    DA n 
99  5    DC n 
99  6    DG n 
99  7    DA n 
99  8    DA n 
99  9    DT n 
99  10   DC n 
99  11   DA n 
99  12   DG n 
99  13   DT n 
99  14   DG n 
99  15   DC n 
99  16   DA n 
99  17   DG n 
99  18   DA n 
99  19   DA n 
99  20   DT n 
99  21   DC n 
99  22   DC n 
99  23   DT n 
99  24   DG n 
99  25   DA n 
99  26   DT n 
99  27   DT n 
99  28   DG n 
99  29   DC n 
99  30   DC n 
99  31   DT n 
99  32   DT n 
99  33   DC n 
99  34   DA n 
99  35   DC n 
99  36   DC n 
99  37   DA n 
99  38   DG n 
99  39   DG n 
99  40   DT n 
99  41   DC n 
99  42   DG n 
99  43   DA n 
99  44   DG n 
99  45   DG n 
99  46   DT n 
99  47   DA n 
99  48   DT n 
99  49   DC n 
99  50   DA n 
99  51   DC n 
99  52   DC n 
99  53   DC n 
99  54   DA n 
99  55   DA n 
99  56   DA n 
99  57   DT n 
99  58   DC n 
99  59   DA n 
99  60   DA n 
99  61   DG n 
99  62   DT n 
99  63   DT n 
99  64   DT n 
99  65   DT n 
99  66   DT n 
99  67   DT n 
100 1    DA n 
100 2    DG n 
100 3    DC n 
100 4    DG n 
100 5    DA n 
100 6    DA n 
100 7    DA n 
100 8    DT n 
100 9    DC n 
100 10   DG n 
100 11   DC n 
100 12   DC n 
100 13   DT n 
100 14   DG n 
100 15   DG n 
100 16   DC n 
100 17   DC n 
100 18   DC n 
100 19   DT n 
100 20   DT n 
100 21   DG n 
100 22   DC n 
100 23   DC n 
100 24   DC n 
100 25   DC n 
100 26   DA n 
100 27   DG n 
100 28   DA n 
100 29   DG n 
100 30   DT n 
100 31   DA n 
100 32   DA n 
100 33   DA n 
100 34   DA n 
100 35   DT n 
100 36   DA n 
100 37   DA n 
100 38   DC n 
100 39   DA n 
100 40   DT n 
100 41   DC n 
100 42   DA n 
100 43   DC n 
100 44   DT n 
100 45   DT n 
101 1    DA n 
101 2    DA n 
101 3    DC n 
101 4    DC n 
101 5    DT n 
101 6    DA n 
101 7    DA n 
101 8    DG n 
101 9    DG n 
101 10   DG n 
101 11   DT n 
101 12   DT n 
101 13   DT n 
101 14   DT n 
101 15   DT n 
101 16   DT n 
101 17   DT n 
101 18   DT n 
101 19   DT n 
101 20   DT n 
101 21   DA n 
101 22   DA n 
101 23   DG n 
101 24   DA n 
101 25   DA n 
101 26   DA n 
101 27   DG n 
101 28   DC n 
101 29   DG n 
101 30   DA n 
101 31   DA n 
101 32   DA n 
101 33   DG n 
101 34   DG n 
101 35   DT n 
101 36   DC n 
101 37   DA n 
101 38   DC n 
101 39   DG n 
101 40   DC n 
101 41   DT n 
101 42   DA n 
101 43   DG n 
101 44   DC n 
101 45   DT n 
101 46   DC n 
101 47   DT n 
101 48   DT n 
101 49   DT n 
101 50   DT n 
101 51   DT n 
101 52   DT n 
101 53   DT n 
101 54   DT n 
101 55   DT n 
101 56   DT n 
101 57   DG n 
101 58   DA n 
101 59   DA n 
101 60   DT n 
101 61   DT n 
101 62   DC n 
101 63   DG n 
101 64   DT n 
101 65   DA n 
101 66   DA n 
101 67   DT n 
102 1    DC n 
102 2    DA n 
102 3    DG n 
102 4    DT n 
102 5    DG n 
102 6    DT n 
102 7    DA n 
102 8    DG n 
102 9    DC n 
102 10   DG n 
102 11   DG n 
102 12   DA n 
102 13   DG n 
102 14   DC n 
102 15   DG n 
102 16   DG n 
102 17   DG n 
102 18   DC n 
102 19   DG n 
102 20   DC n 
102 21   DT n 
102 22   DA n 
102 23   DG n 
102 24   DG n 
102 25   DG n 
102 26   DC n 
102 27   DG n 
102 28   DA n 
102 29   DA n 
102 30   DA n 
102 31   DA n 
102 32   DA n 
102 33   DC n 
102 34   DC n 
102 35   DA n 
102 36   DA n 
102 37   DC n 
102 38   DA n 
102 39   DA n 
102 40   DG n 
102 41   DA n 
102 42   DG n 
102 43   DT n 
102 44   DC n 
102 45   DC n 
102 46   DA n 
102 47   DC n 
102 48   DT n 
103 1    DA n 
103 2    DA n 
103 3    DC n 
103 4    DC n 
103 5    DC n 
103 6    DG n 
103 7    DC n 
103 8    DC n 
103 9    DG n 
103 10   DC n 
103 11   DG n 
103 12   DC n 
103 13   DC n 
103 14   DC n 
103 15   DG n 
103 16   DC n 
103 17   DT n 
103 18   DT n 
103 19   DT n 
103 20   DA n 
103 21   DA n 
103 22   DT n 
103 23   DG n 
103 24   DA n 
103 25   DA n 
103 26   DT n 
103 27   DC n 
103 28   DA n 
103 29   DG n 
103 30   DT n 
103 31   DT n 
103 32   DT n 
103 33   DG n 
103 34   DG n 
103 35   DC n 
103 36   DC n 
103 37   DT n 
103 38   DT n 
103 39   DA n 
103 40   DT n 
103 41   DA n 
103 42   DA n 
103 43   DA n 
103 44   DT n 
103 45   DC n 
103 46   DA n 
103 47   DA n 
103 48   DA n 
104 1    DT n 
104 2    DT n 
104 3    DT n 
104 4    DT n 
104 5    DT n 
104 6    DT n 
104 7    DT n 
104 8    DT n 
104 9    DT n 
104 10   DT n 
104 11   DG n 
104 12   DG n 
104 13   DG n 
104 14   DT n 
104 15   DG n 
104 16   DA n 
104 17   DG n 
104 18   DA n 
104 19   DC n 
104 20   DG n 
104 21   DG n 
104 22   DG n 
104 23   DC n 
104 24   DG n 
104 25   DA n 
104 26   DG n 
104 27   DT n 
104 28   DT n 
104 29   DT n 
104 30   DT n 
104 31   DT n 
104 32   DT n 
104 33   DT n 
104 34   DT n 
104 35   DT n 
104 36   DT n 
104 37   DA n 
104 38   DA n 
104 39   DA n 
104 40   DG n 
104 41   DG n 
104 42   DG n 
104 43   DT n 
104 44   DC n 
104 45   DG n 
104 46   DT n 
104 47   DG n 
104 48   DC n 
104 49   DC n 
104 50   DG n 
104 51   DA n 
104 52   DG n 
104 53   DG n 
104 54   DA n 
104 55   DT n 
104 56   DC n 
104 57   DC n 
104 58   DC n 
104 59   DC n 
104 60   DG n 
104 61   DG n 
104 62   DG n 
104 63   DT n 
104 64   DT n 
104 65   DT n 
104 66   DT n 
104 67   DT n 
105 1    DA n 
105 2    DC n 
105 3    DT n 
105 4    DC n 
105 5    DT n 
105 6    DA n 
105 7    DA n 
105 8    DG n 
105 9    DC n 
105 10   DT n 
105 11   DG n 
105 12   DC n 
105 13   DA n 
105 14   DT n 
105 15   DT n 
105 16   DC n 
105 17   DC n 
105 18   DA n 
105 19   DG n 
105 20   DT n 
105 21   DC n 
105 22   DG n 
105 23   DC n 
105 24   DG n 
105 25   DT n 
105 26   DG n 
105 27   DA n 
105 28   DA n 
105 29   DC n 
105 30   DC n 
105 31   DG n 
105 32   DT n 
105 33   DC n 
105 34   DT n 
105 35   DA n 
105 36   DT n 
105 37   DC n 
105 38   DA n 
105 39   DG n 
105 40   DG n 
105 41   DG n 
105 42   DC n 
105 43   DG n 
105 44   DA n 
105 45   DT n 
105 46   DG n 
105 47   DT n 
105 48   DT n 
105 49   DT n 
105 50   DT n 
105 51   DT n 
105 52   DT n 
105 53   DT n 
105 54   DT n 
105 55   DT n 
105 56   DT n 
105 57   DG n 
105 58   DC n 
105 59   DC n 
105 60   DC n 
105 61   DA n 
105 62   DC n 
105 63   DT n 
105 64   DA n 
105 65   DG n 
105 66   DG n 
105 67   DA n 
106 1    DA n 
106 2    DA n 
106 3    DA n 
106 4    DA n 
106 5    DT n 
106 6    DC n 
106 7    DA n 
106 8    DG n 
106 9    DC n 
106 10   DC n 
106 11   DC n 
106 12   DC n 
106 13   DC n 
106 14   DG n 
106 15   DG n 
106 16   DC n 
106 17   DA n 
106 18   DG n 
106 19   DG n 
106 20   DC n 
106 21   DG n 
106 22   DA n 
106 23   DA n 
106 24   DA n 
106 25   DA n 
106 26   DT n 
106 27   DC n 
106 28   DC n 
106 29   DT n 
106 30   DG n 
106 31   DA n 
106 32   DC n 
106 33   DG n 
106 34   DC n 
106 35   DT n 
106 36   DG n 
106 37   DG n 
106 38   DT n 
106 39   DT n 
106 40   DG n 
106 41   DA n 
106 42   DG n 
106 43   DA n 
106 44   DG n 
106 45   DA n 
106 46   DG n 
106 47   DG n 
106 48   DG n 
107 1    DA n 
107 2    DG n 
107 3    DG n 
107 4    DC n 
107 5    DG n 
107 6    DG n 
107 7    DT n 
107 8    DT n 
107 9    DT n 
107 10   DT n 
107 11   DT n 
107 12   DT n 
107 13   DT n 
107 14   DT n 
107 15   DT n 
107 16   DT n 
107 17   DT n 
107 18   DT n 
107 19   DT n 
107 20   DG n 
107 21   DC n 
107 22   DG n 
107 23   DT n 
107 24   DA n 
107 25   DG n 
107 26   DA n 
107 27   DG n 
107 28   DT n 
107 29   DT n 
107 30   DT n 
107 31   DT n 
107 32   DT n 
107 33   DT n 
107 34   DT n 
107 35   DT n 
107 36   DT n 
107 37   DT n 
107 38   DA n 
107 39   DT n 
107 40   DA n 
107 41   DG n 
107 42   DG n 
107 43   DG n 
107 44   DT n 
107 45   DT n 
107 46   DG n 
107 47   DA n 
107 48   DG n 
107 49   DT n 
107 50   DA n 
107 51   DA n 
107 52   DA n 
107 53   DG n 
107 54   DA n 
107 55   DA n 
107 56   DC n 
107 57   DT n 
107 58   DT n 
108 1    DT n 
108 2    DT n 
108 3    DT n 
108 4    DT n 
108 5    DT n 
108 6    DA n 
108 7    DG n 
108 8    DC n 
108 9    DG n 
108 10   DG n 
108 11   DT n 
108 12   DC n 
108 13   DC n 
108 14   DT n 
108 15   DT n 
108 16   DT n 
108 17   DT n 
108 18   DT n 
108 19   DT n 
108 20   DT n 
108 21   DT n 
108 22   DT n 
108 23   DT n 
108 24   DT n 
108 25   DT n 
108 26   DT n 
108 27   DG n 
108 28   DA n 
108 29   DT n 
108 30   DG n 
108 31   DG n 
108 32   DT n 
108 33   DG n 
108 34   DG n 
108 35   DT n 
108 36   DT n 
108 37   DC n 
108 38   DA n 
108 39   DA n 
108 40   DT n 
108 41   DA n 
108 42   DG n 
108 43   DC n 
108 44   DC n 
108 45   DC n 
108 46   DT n 
108 47   DT n 
108 48   DG n 
108 49   DG n 
108 50   DG n 
108 51   DC n 
109 1    DG n 
109 2    DG n 
109 3    DG n 
109 4    DC n 
109 5    DC n 
109 6    DG n 
109 7    DT n 
109 8    DA n 
109 9    DA n 
109 10   DA n 
109 11   DG n 
109 12   DC n 
109 13   DA n 
109 14   DC n 
109 15   DT n 
109 16   DA n 
109 17   DA n 
109 18   DA n 
109 19   DT n 
109 20   DT n 
109 21   DT n 
109 22   DT n 
109 23   DT n 
109 24   DT n 
109 25   DT n 
109 26   DT n 
109 27   DT n 
109 28   DT n 
109 29   DT n 
109 30   DC n 
109 31   DG n 
109 32   DG n 
109 33   DA n 
109 34   DA n 
109 35   DC n 
109 36   DC n 
109 37   DG n 
109 38   DG n 
109 39   DA n 
109 40   DA n 
109 41   DA n 
109 42   DG n 
109 43   DC n 
109 44   DC n 
109 45   DG n 
109 46   DG n 
109 47   DC n 
109 48   DG n 
109 49   DA n 
109 50   DT n 
109 51   DT n 
109 52   DT n 
109 53   DT n 
109 54   DT n 
110 1    DT n 
110 2    DC n 
110 3    DG n 
110 4    DA n 
110 5    DC n 
110 6    DT n 
110 7    DG n 
110 8    DG n 
110 9    DA n 
110 10   DT n 
110 11   DA n 
110 12   DG n 
110 13   DC n 
110 14   DG n 
110 15   DT n 
110 16   DC n 
110 17   DC n 
110 18   DA n 
110 19   DT n 
110 20   DT n 
110 21   DT n 
110 22   DT n 
110 23   DT n 
110 24   DT n 
110 25   DT n 
110 26   DT n 
110 27   DT n 
110 28   DT n 
110 29   DA n 
110 30   DT n 
110 31   DA n 
110 32   DC n 
110 33   DT n 
110 34   DG n 
110 35   DC n 
110 36   DG n 
110 37   DA n 
110 38   DA n 
110 39   DA n 
110 40   DT n 
110 41   DG n 
111 1    DG n 
111 2    DA n 
111 3    DT n 
111 4    DC n 
111 5    DA n 
111 6    DA n 
111 7    DG n 
111 8    DA n 
111 9    DA n 
111 10   DA n 
111 11   DA n 
111 12   DA n 
111 13   DT n 
111 14   DG n 
111 15   DA n 
111 16   DT n 
111 17   DT n 
111 18   DT n 
111 19   DT n 
111 20   DT n 
111 21   DT n 
111 22   DT n 
111 23   DT n 
111 24   DT n 
111 25   DT n 
111 26   DC n 
111 27   DC n 
111 28   DA n 
111 29   DT n 
111 30   DA n 
111 31   DT n 
111 32   DG n 
111 33   DA n 
111 34   DA n 
111 35   DT n 
111 36   DA n 
111 37   DA n 
111 38   DT n 
111 39   DA n 
111 40   DC n 
111 41   DA n 
111 42   DT n 
111 43   DC n 
111 44   DC n 
111 45   DA n 
111 46   DA n 
111 47   DT n 
111 48   DT n 
111 49   DT n 
111 50   DT n 
111 51   DT n 
112 1    DA n 
112 2    DA n 
112 3    DA n 
112 4    DA n 
112 5    DT n 
112 6    DA n 
112 7    DG n 
112 8    DT n 
112 9    DT n 
112 10   DG n 
112 11   DC n 
112 12   DT n 
112 13   DA n 
112 14   DT n 
112 15   DC n 
112 16   DC n 
112 17   DT n 
112 18   DT n 
112 19   DA n 
112 20   DT n 
112 21   DC n 
112 22   DA n 
112 23   DC n 
112 24   DT n 
112 25   DC n 
112 26   DA n 
112 27   DT n 
112 28   DC n 
112 29   DG n 
112 30   DA n 
112 31   DA n 
112 32   DT n 
112 33   DA n 
112 34   DA n 
112 35   DT n 
112 36   DA n 
112 37   DT n 
112 38   DC n 
112 39   DG n 
112 40   DT n 
112 41   DC n 
112 42   DA n 
112 43   DG n 
112 44   DA n 
112 45   DA n 
112 46   DG n 
112 47   DC n 
112 48   DA n 
112 49   DA n 
112 50   DT n 
112 51   DA n 
112 52   DT n 
112 53   DA n 
112 54   DA n 
112 55   DC n 
112 56   DT n 
113 1    DC n 
113 2    DC n 
113 3    DC n 
113 4    DA n 
113 5    DA n 
113 6    DT n 
113 7    DC n 
113 8    DC n 
113 9    DA n 
113 10   DA n 
113 11   DA n 
113 12   DT n 
113 13   DA n 
113 14   DA n 
113 15   DG n 
113 16   DA n 
113 17   DA n 
113 18   DA n 
113 19   DC n 
113 20   DT n 
113 21   DG n 
113 22   DA n 
113 23   DA n 
113 24   DT n 
113 25   DC n 
113 26   DT n 
113 27   DA n 
113 28   DA n 
113 29   DA n 
113 30   DA n 
113 31   DT n 
113 32   DC n 
113 33   DT n 
113 34   DC n 
113 35   DC n 
113 36   DA n 
113 37   DT n 
113 38   DC n 
113 39   DG n 
113 40   DT n 
113 41   DA n 
113 42   DG n 
113 43   DC n 
113 44   DC n 
113 45   DG n 
113 46   DC n 
113 47   DT n 
113 48   DT n 
114 1    DG n 
114 2    DG n 
114 3    DT n 
114 4    DA n 
114 5    DA n 
114 6    DA n 
114 7    DG n 
114 8    DT n 
114 9    DA n 
114 10   DA n 
114 11   DT n 
114 12   DT n 
114 13   DC n 
114 14   DG n 
114 15   DC n 
114 16   DT n 
114 17   DA n 
114 18   DA n 
114 19   DT n 
114 20   DG n 
114 21   DC n 
114 22   DA n 
114 23   DG n 
114 24   DA n 
114 25   DA n 
114 26   DC n 
114 27   DG n 
114 28   DC n 
114 29   DG n 
114 30   DC n 
114 31   DC n 
114 32   DT n 
114 33   DT n 
114 34   DT n 
114 35   DT n 
114 36   DT n 
114 37   DT n 
114 38   DT n 
114 39   DT n 
114 40   DT n 
114 41   DT n 
114 42   DT n 
114 43   DG n 
114 44   DT n 
114 45   DT n 
114 46   DT n 
114 47   DA n 
114 48   DT n 
114 49   DC n 
114 50   DA n 
114 51   DA n 
114 52   DC n 
114 53   DA n 
114 54   DT n 
114 55   DA n 
114 56   DT n 
114 57   DA n 
114 58   DC n 
114 59   DT n 
114 60   DT n 
114 61   DC n 
114 62   DA n 
114 63   DA n 
114 64   DT n 
114 65   DC n 
114 66   DA n 
114 67   DT n 
114 68   DT n 
114 69   DT n 
114 70   DT n 
114 71   DT n 
115 1    DT n 
115 2    DA n 
115 3    DC n 
115 4    DG n 
115 5    DA n 
115 6    DG n 
115 7    DG n 
115 8    DC n 
115 9    DC n 
115 10   DA n 
115 11   DG n 
115 12   DA n 
115 13   DT n 
115 14   DA n 
115 15   DC n 
115 16   DA n 
115 17   DA n 
115 18   DG n 
115 19   DG n 
115 20   DA n 
115 21   DC n 
115 22   DG n 
115 23   DT n 
115 24   DT n 
115 25   DG n 
115 26   DA n 
115 27   DG n 
115 28   DA n 
115 29   DG n 
115 30   DG n 
115 31   DG n 
115 32   DT n 
115 33   DT n 
115 34   DA n 
115 35   DA n 
115 36   DA n 
115 37   DG n 
115 38   DA n 
115 39   DT n 
115 40   DT n 
115 41   DC n 
115 42   DA n 
115 43   DA n 
115 44   DA n 
115 45   DT n 
115 46   DA n 
115 47   DT n 
115 48   DT n 
115 49   DA n 
115 50   DG n 
115 51   DC n 
115 52   DT n 
115 53   DC n 
115 54   DA n 
115 55   DT n 
115 56   DT n 
115 57   DG n 
115 58   DC n 
115 59   DT n 
115 60   DG n 
115 61   DG n 
115 62   DC n 
116 1    DT n 
116 2    DT n 
116 3    DT n 
116 4    DA n 
116 5    DA n 
116 6    DG n 
116 7    DA n 
116 8    DG n 
116 9    DG n 
116 10   DA n 
116 11   DA n 
116 12   DT n 
116 13   DA n 
116 14   DT n 
116 15   DT n 
116 16   DC n 
116 17   DC n 
116 18   DT n 
116 19   DA n 
116 20   DA n 
116 21   DT n 
116 22   DG n 
116 23   DA n 
116 24   DA n 
116 25   DA n 
116 26   DA n 
116 27   DG n 
116 28   DA n 
116 29   DA n 
116 30   DC n 
116 31   DG n 
116 32   DA n 
116 33   DA n 
116 34   DC n 
116 35   DA n 
116 36   DT n 
116 37   DG n 
116 38   DG n 
116 39   DG n 
116 40   DC n 
116 41   DG n 
116 42   DC n 
116 43   DC n 
116 44   DC n 
116 45   DT n 
116 46   DG n 
116 47   DT n 
116 48   DA n 
117 1    DG n 
117 2    DA n 
117 3    DT n 
117 4    DA n 
117 5    DT n 
117 6    DA n 
117 7    DG n 
117 8    DA n 
117 9    DT n 
117 10   DT n 
117 11   DT n 
117 12   DT n 
117 13   DG n 
117 14   DC n 
117 15   DA n 
117 16   DA n 
117 17   DT n 
117 18   DC n 
117 19   DC n 
117 20   DT n 
117 21   DT n 
117 22   DT n 
117 23   DG n 
117 24   DA n 
117 25   DT n 
117 26   DT n 
117 27   DT n 
117 28   DA n 
117 29   DG n 
117 30   DA n 
117 31   DA n 
117 32   DG n 
117 33   DT n 
117 34   DA n 
117 35   DT n 
117 36   DT n 
117 37   DA n 
117 38   DG n 
117 39   DA n 
117 40   DC n 
117 41   DT n 
117 42   DT n 
117 43   DT n 
117 44   DA n 
117 45   DC n 
117 46   DA n 
117 47   DT n 
117 48   DT n 
117 49   DA n 
117 50   DG n 
117 51   DT n 
117 52   DA n 
118 1    DC n 
118 2    DG n 
118 3    DA n 
118 4    DA n 
118 5    DA n 
118 6    DG n 
118 7    DC n 
118 8    DC n 
118 9    DT n 
118 10   DG n 
118 11   DC n 
118 12   DA n 
118 13   DA n 
118 14   DT n 
118 15   DA n 
118 16   DG n 
118 17   DT n 
118 18   DG n 
118 19   DT n 
118 20   DT n 
118 21   DC n 
118 22   DA n 
118 23   DT n 
118 24   DT n 
118 25   DT n 
118 26   DG n 
118 27   DA n 
118 28   DT n 
118 29   DT n 
118 30   DT n 
118 31   DC n 
118 32   DA n 
118 33   DA n 
118 34   DC n 
118 35   DT n 
118 36   DG n 
118 37   DT n 
118 38   DG n 
118 39   DT n 
118 40   DA n 
118 41   DG n 
118 42   DG n 
118 43   DA n 
118 44   DG n 
119 1    DG n 
119 2    DC n 
119 3    DG n 
119 4    DA n 
119 5    DT n 
119 6    DT n 
119 7    DA n 
119 8    DA n 
119 9    DT n 
119 10   DA n 
119 11   DG n 
119 12   DC n 
119 13   DT n 
119 14   DC n 
119 15   DA n 
119 16   DA n 
119 17   DC n 
119 18   DT n 
119 19   DG n 
119 20   DG n 
119 21   DA n 
119 22   DA n 
119 23   DG n 
119 24   DT n 
119 25   DC n 
119 26   DT n 
119 27   DT n 
119 28   DT n 
119 29   DT n 
119 30   DG n 
119 31   DA n 
119 32   DT n 
119 33   DC n 
119 34   DT n 
119 35   DA n 
119 36   DT n 
119 37   DT n 
119 38   DA n 
119 39   DT n 
119 40   DA n 
119 41   DC n 
119 42   DC n 
119 43   DA n 
119 44   DT n 
119 45   DC n 
119 46   DC n 
119 47   DT n 
119 48   DA n 
119 49   DG n 
119 50   DT n 
119 51   DC n 
119 52   DC n 
119 53   DT n 
119 54   DG n 
120 1    DG n 
120 2    DC n 
120 3    DT n 
120 4    DG n 
120 5    DG n 
120 6    DT n 
120 7    DA n 
120 8    DA n 
120 9    DT n 
120 10   DA n 
120 11   DT n 
120 12   DC n 
120 13   DC n 
120 14   DG n 
120 15   DA n 
120 16   DA n 
120 17   DT n 
120 18   DT n 
120 19   DG n 
120 20   DA n 
120 21   DG n 
120 22   DC n 
120 23   DC n 
120 24   DA n 
120 25   DA n 
120 26   DT n 
120 27   DT n 
120 28   DC n 
120 29   DT n 
120 30   DA n 
120 31   DG n 
120 32   DG n 
120 33   DT n 
120 34   DC n 
120 35   DA n 
120 36   DG n 
120 37   DG n 
120 38   DA n 
120 39   DA n 
120 40   DA n 
120 41   DA n 
120 42   DA n 
120 43   DG n 
120 44   DA n 
120 45   DT n 
120 46   DG n 
120 47   DC n 
121 1    DA n 
121 2    DT n 
121 3    DC n 
121 4    DG n 
121 5    DG n 
121 6    DC n 
121 7    DC n 
121 8    DG n 
121 9    DG n 
121 10   DC n 
121 11   DG n 
121 12   DG n 
121 13   DA n 
121 14   DT n 
121 15   DT n 
121 16   DC n 
121 17   DA n 
121 18   DG n 
121 19   DT n 
121 20   DA n 
121 21   DT n 
121 22   DT n 
121 23   DG n 
121 24   DG n 
121 25   DC n 
121 26   DA n 
121 27   DA n 
121 28   DA n 
121 29   DG n 
121 30   DA n 
121 31   DG n 
121 32   DA n 
121 33   DT n 
121 34   DG n 
121 35   DA n 
121 36   DT n 
121 37   DG n 
121 38   DA n 
121 39   DT n 
121 40   DT n 
121 41   DA n 
121 42   DA n 
121 43   DC n 
121 44   DA n 
121 45   DA n 
121 46   DT n 
121 47   DA n 
121 48   DA n 
122 1    DG n 
122 2    DT n 
122 3    DA n 
122 4    DA n 
122 5    DT n 
122 6    DT n 
122 7    DA n 
122 8    DA n 
122 9    DT n 
122 10   DA n 
122 11   DA n 
122 12   DA n 
122 13   DG n 
122 14   DA n 
122 15   DC n 
122 16   DA n 
122 17   DG n 
122 18   DA n 
122 19   DG n 
122 20   DG n 
122 21   DC n 
122 22   DG n 
122 23   DA n 
122 24   DT n 
122 25   DA n 
122 26   DA n 
122 27   DA n 
122 28   DG n 
122 29   DC n 
122 30   DT n 
122 31   DT n 
122 32   DA n 
122 33   DA n 
122 34   DT n 
122 35   DA n 
122 36   DC n 
122 37   DT n 
122 38   DT n 
122 39   DC n 
122 40   DG n 
123 1    DC n 
123 2    DC n 
123 3    DA n 
123 4    DG n 
123 5    DT n 
123 6    DT n 
123 7    DC n 
123 8    DT n 
123 9    DG n 
123 10   DA n 
123 11   DG n 
123 12   DA n 
123 13   DG n 
123 14   DC n 
123 15   DT n 
123 16   DG n 
123 17   DT n 
123 18   DT n 
123 19   DT n 
123 20   DA n 
123 21   DG n 
123 22   DC n 
123 23   DA n 
123 24   DT n 
123 25   DT n 
123 26   DG n 
123 27   DC n 
123 28   DA n 
123 29   DT n 
123 30   DC n 
123 31   DA n 
123 32   DT n 
123 33   DT n 
123 34   DA n 
123 35   DG n 
123 36   DA n 
123 37   DG n 
123 38   DA n 
123 39   DA n 
123 40   DA n 
124 1    DG n 
124 2    DC n 
124 3    DC n 
124 4    DG n 
124 5    DA n 
124 6    DA n 
124 7    DA n 
124 8    DG n 
124 9    DG n 
124 10   DG n 
124 11   DT n 
124 12   DA n 
124 13   DC n 
124 14   DG n 
124 15   DG n 
124 16   DT n 
124 17   DG n 
124 18   DT n 
124 19   DC n 
124 20   DA n 
124 21   DT n 
124 22   DG n 
124 23   DT n 
124 24   DT n 
124 25   DT n 
124 26   DT n 
124 27   DG n 
124 28   DC n 
124 29   DG n 
124 30   DG n 
124 31   DA n 
124 32   DT n 
124 33   DG n 
124 34   DG n 
124 35   DC n 
124 36   DT n 
124 37   DT n 
124 38   DA n 
124 39   DG n 
124 40   DA n 
124 41   DG n 
124 42   DC n 
124 43   DT n 
124 44   DT n 
125 1    DA n 
125 2    DA n 
125 3    DG n 
125 4    DG n 
125 5    DT n 
125 6    DG n 
125 7    DC n 
125 8    DG n 
125 9    DG n 
125 10   DG n 
125 11   DG n 
125 12   DT n 
125 13   DT n 
125 14   DG n 
125 15   DA n 
125 16   DT n 
125 17   DT n 
125 18   DC n 
125 19   DG n 
125 20   DA n 
125 21   DA n 
125 22   DG n 
125 23   DG n 
125 24   DT n 
125 25   DT n 
125 26   DA n 
125 27   DC n 
125 28   DT n 
125 29   DT n 
125 30   DT n 
125 31   DA n 
125 32   DG n 
125 33   DG n 
125 34   DA n 
125 35   DG n 
125 36   DC n 
125 37   DA n 
125 38   DC n 
125 39   DT n 
125 40   DA n 
125 41   DA n 
125 42   DC n 
125 43   DG n 
125 44   DT n 
125 45   DT n 
125 46   DT n 
125 47   DT n 
125 48   DA n 
126 1    DA n 
126 2    DA n 
126 3    DT n 
126 4    DC n 
126 5    DG n 
126 6    DT n 
126 7    DC n 
126 8    DC n 
126 9    DG n 
126 10   DG n 
126 11   DA n 
126 12   DT n 
126 13   DA n 
126 14   DT n 
126 15   DA n 
126 16   DA n 
126 17   DT n 
126 18   DA n 
126 19   DA n 
126 20   DC n 
126 21   DG n 
126 22   DG n 
126 23   DA n 
126 24   DC n 
126 25   DT n 
126 26   DG n 
126 27   DA n 
126 28   DC n 
126 29   DC n 
126 30   DA n 
126 31   DG n 
126 32   DA n 
126 33   DC n 
126 34   DG n 
126 35   DG n 
126 36   DT n 
126 37   DC n 
126 38   DA n 
126 39   DG n 
126 40   DT n 
126 41   DT n 
126 42   DA n 
126 43   DC n 
126 44   DT n 
127 1    DC n 
127 2    DA n 
127 3    DA n 
127 4    DA n 
127 5    DT n 
127 6    DA n 
127 7    DT n 
127 8    DT n 
127 9    DT n 
127 10   DT n 
127 11   DT n 
127 12   DT n 
127 13   DT n 
127 14   DT n 
127 15   DT n 
127 16   DT n 
127 17   DT n 
127 18   DT n 
127 19   DT n 
127 20   DC n 
127 21   DA n 
127 22   DA n 
127 23   DA n 
127 24   DC n 
127 25   DC n 
127 26   DC n 
127 27   DT n 
127 28   DC n 
127 29   DA n 
127 30   DA n 
127 31   DT n 
127 32   DC n 
127 33   DA n 
127 34   DT n 
127 35   DG n 
127 36   DC n 
127 37   DT n 
127 38   DG n 
127 39   DA n 
127 40   DA n 
127 41   DC n 
127 42   DA n 
127 43   DC n 
127 44   DC n 
127 45   DA n 
127 46   DG n 
127 47   DA n 
127 48   DA n 
127 49   DG n 
127 50   DA n 
127 51   DG n 
127 52   DG n 
127 53   DT n 
127 54   DT n 
127 55   DT n 
127 56   DA n 
127 57   DA n 
127 58   DA n 
127 59   DT n 
128 1    DC n 
128 2    DA n 
128 3    DA n 
128 4    DC n 
128 5    DA n 
128 6    DT n 
128 7    DA n 
128 8    DA n 
128 9    DT n 
128 10   DA n 
128 11   DA n 
128 12   DA n 
128 13   DG n 
128 14   DC n 
128 15   DG n 
128 16   DA n 
128 17   DA n 
128 18   DG n 
128 19   DA n 
128 20   DT n 
128 21   DA n 
128 22   DA n 
128 23   DT n 
128 24   DT n 
128 25   DG n 
128 26   DC n 
128 27   DA n 
128 28   DC n 
128 29   DG n 
128 30   DT n 
128 31   DG n 
128 32   DA n 
128 33   DT n 
128 34   DG n 
128 35   DA n 
128 36   DT n 
128 37   DG n 
128 38   DG n 
128 39   DC n 
128 40   DA n 
128 41   DT n 
128 42   DC n 
128 43   DG n 
128 44   DG n 
128 45   DA n 
128 46   DA n 
128 47   DG n 
128 48   DT n 
129 1    DA n 
129 2    DA n 
129 3    DC n 
129 4    DG n 
129 5    DA n 
129 6    DA n 
129 7    DC n 
129 8    DT n 
129 9    DT n 
129 10   DT n 
129 11   DT n 
129 12   DT n 
129 13   DC n 
129 14   DA n 
129 15   DA n 
129 16   DA n 
129 17   DT n 
129 18   DT n 
129 19   DG n 
129 20   DA n 
129 21   DG n 
129 22   DA n 
129 23   DC n 
129 24   DG n 
129 25   DT n 
129 26   DC n 
129 27   DA n 
129 28   DG n 
129 29   DA n 
129 30   DT n 
129 31   DG n 
129 32   DA n 
129 33   DT n 
129 34   DT n 
129 35   DG n 
129 36   DC n 
129 37   DT n 
129 38   DT n 
129 39   DT n 
129 40   DG n 
129 41   DA n 
129 42   DA n 
129 43   DT n 
129 44   DA n 
129 45   DC n 
129 46   DC n 
129 47   DA n 
129 48   DA n 
130 1    DT n 
130 2    DT n 
130 3    DT n 
130 4    DT n 
130 5    DT n 
130 6    DA n 
130 7    DG n 
130 8    DG n 
130 9    DT n 
130 10   DA n 
130 11   DG n 
130 12   DA n 
130 13   DA n 
130 14   DA n 
130 15   DG n 
130 16   DA n 
130 17   DT n 
130 18   DT n 
130 19   DC n 
130 20   DA n 
130 21   DT n 
130 22   DC n 
130 23   DA n 
130 24   DG n 
130 25   DT n 
130 26   DA n 
130 27   DC n 
130 28   DC n 
130 29   DA n 
130 30   DG n 
130 31   DA n 
130 32   DC n 
130 33   DG n 
130 34   DA n 
130 35   DC n 
130 36   DG n 
130 37   DA n 
130 38   DT n 
130 39   DT n 
130 40   DT n 
130 41   DT n 
130 42   DT n 
130 43   DT n 
130 44   DT n 
130 45   DT n 
130 46   DT n 
130 47   DT n 
130 48   DT n 
130 49   DA n 
130 50   DA n 
130 51   DA n 
130 52   DA n 
130 53   DA n 
130 54   DC n 
131 1    DC n 
131 2    DA n 
131 3    DA n 
131 4    DA n 
131 5    DA n 
131 6    DT n 
131 7    DA n 
131 8    DG n 
131 9    DC n 
131 10   DG n 
131 11   DA n 
131 12   DG n 
131 13   DA n 
131 14   DG n 
131 15   DG n 
131 16   DC n 
131 17   DT n 
131 18   DT n 
131 19   DT n 
131 20   DT n 
131 21   DG n 
131 22   DC n 
131 23   DG n 
131 24   DT n 
131 25   DT n 
131 26   DA n 
131 27   DA n 
131 28   DT n 
131 29   DA n 
131 30   DA n 
131 31   DT n 
131 32   DA n 
131 33   DG n 
131 34   DG n 
131 35   DA n 
131 36   DA n 
131 37   DT n 
131 38   DA n 
131 39   DA n 
131 40   DT n 
131 41   DA n 
132 1    DT n 
132 2    DA n 
132 3    DT n 
132 4    DA n 
132 5    DA n 
132 6    DG n 
132 7    DC n 
132 8    DA n 
132 9    DA n 
132 10   DA n 
132 11   DA n 
132 12   DG n 
132 13   DG n 
132 14   DG n 
132 15   DG n 
132 16   DA n 
132 17   DA n 
132 18   DG n 
132 19   DC n 
132 20   DC n 
132 21   DT n 
132 22   DT n 
132 23   DT n 
132 24   DT n 
132 25   DT n 
132 26   DT n 
132 27   DT n 
132 28   DA n 
132 29   DA n 
132 30   DT n 
132 31   DA n 
132 32   DT n 
132 33   DT n 
132 34   DT n 
132 35   DC n 
132 36   DA n 
132 37   DA n 
132 38   DT n 
132 39   DC n 
132 40   DA n 
132 41   DT n 
132 42   DA n 
132 43   DT n 
132 44   DG n 
132 45   DC n 
132 46   DG n 
132 47   DG n 
132 48   DG n 
133 1    DC n 
133 2    DA n 
133 3    DA n 
133 4    DA n 
133 5    DA n 
133 6    DC n 
133 7    DG n 
133 8    DT n 
133 9    DT n 
133 10   DA n 
133 11   DA n 
133 12   DA n 
133 13   DA n 
133 14   DC n 
133 15   DT n 
133 16   DA n 
133 17   DG n 
133 18   DC n 
133 19   DT n 
133 20   DT n 
133 21   DG n 
133 22   DA n 
133 23   DG n 
133 24   DA n 
133 25   DG n 
133 26   DA n 
133 27   DT n 
133 28   DC n 
133 29   DT n 
133 30   DG n 
133 31   DG n 
133 32   DA n 
133 33   DG n 
133 34   DC n 
133 35   DT n 
133 36   DC n 
133 37   DA n 
133 38   DT n 
133 39   DT n 
133 40   DG n 
133 41   DA n 
133 42   DA n 
133 43   DT n 
133 44   DC n 
133 45   DC n 
133 46   DC n 
133 47   DC n 
133 48   DC n 
133 49   DT n 
133 50   DC n 
133 51   DG n 
133 52   DA n 
133 53   DA n 
133 54   DT n 
133 55   DC n 
133 56   DG n 
134 1    DA n 
134 2    DA n 
134 3    DC n 
134 4    DT n 
134 5    DT n 
134 6    DT n 
134 7    DT n 
134 8    DT n 
134 9    DT n 
134 10   DT n 
134 11   DT n 
134 12   DT n 
134 13   DT n 
134 14   DA n 
134 15   DA n 
134 16   DT n 
134 17   DT n 
134 18   DC n 
134 19   DG n 
134 20   DA n 
134 21   DC n 
134 22   DA n 
134 23   DA n 
134 24   DC n 
134 25   DT n 
134 26   DT n 
134 27   DT n 
134 28   DT n 
134 29   DA n 
134 30   DA n 
134 31   DA n 
134 32   DA n 
134 33   DC n 
134 34   DA n 
134 35   DT n 
134 36   DC n 
134 37   DG n 
134 38   DC n 
135 1    DA n 
135 2    DA n 
135 3    DC n 
135 4    DC n 
135 5    DC n 
135 6    DT n 
135 7    DC n 
135 8    DG n 
135 9    DT n 
135 10   DT n 
135 11   DT n 
135 12   DT n 
135 13   DG n 
135 14   DA n 
135 15   DG n 
135 16   DA n 
135 17   DT n 
135 18   DT n 
135 19   DA n 
135 20   DA n 
135 21   DC n 
135 22   DG n 
135 23   DA n 
135 24   DA n 
135 25   DC n 
135 26   DT n 
135 27   DA n 
135 28   DT n 
135 29   DT n 
135 30   DC n 
135 31   DA n 
135 32   DA n 
135 33   DC n 
135 34   DC n 
135 35   DC n 
135 36   DA n 
135 37   DG n 
135 38   DT n 
135 39   DC n 
135 40   DA n 
135 41   DA n 
135 42   DA n 
135 43   DT n 
135 44   DT n 
135 45   DA n 
135 46   DT n 
135 47   DT n 
135 48   DT n 
136 1    DT n 
136 2    DT n 
136 3    DT n 
136 4    DA n 
136 5    DT n 
136 6    DC n 
136 7    DA n 
136 8    DA n 
136 9    DA n 
136 10   DA n 
136 11   DT n 
136 12   DC n 
136 13   DA n 
136 14   DT n 
136 15   DA n 
136 16   DG n 
136 17   DG n 
136 18   DT n 
136 19   DC n 
136 20   DT n 
136 21   DT n 
136 22   DT n 
136 23   DT n 
136 24   DT n 
136 25   DT n 
136 26   DT n 
136 27   DT n 
136 28   DT n 
136 29   DT n 
136 30   DT n 
136 31   DG n 
136 32   DA n 
136 33   DG n 
136 34   DA n 
136 35   DG n 
136 36   DA n 
136 37   DC n 
136 38   DT n 
136 39   DA n 
136 40   DC n 
136 41   DC n 
136 42   DT n 
136 43   DA n 
136 44   DT n 
136 45   DA n 
136 46   DA n 
136 47   DG n 
136 48   DG n 
137 1    DG n 
137 2    DT n 
137 3    DT n 
137 4    DT n 
137 5    DT n 
137 6    DA n 
137 7    DG n 
137 8    DT n 
137 9    DA n 
137 10   DT n 
137 11   DT n 
137 12   DA n 
137 13   DC n 
137 14   DC n 
137 15   DT n 
137 16   DG n 
137 17   DA n 
137 18   DG n 
137 19   DA n 
137 20   DA n 
137 21   DA n 
137 22   DA n 
137 23   DT n 
137 24   DT n 
137 25   DA n 
137 26   DT n 
137 27   DA n 
137 28   DA n 
137 29   DC n 
137 30   DA n 
137 31   DG n 
137 32   DA n 
137 33   DG n 
137 34   DG n 
137 35   DG n 
137 36   DT n 
137 37   DG n 
137 38   DC n 
137 39   DC n 
137 40   DA n 
137 41   DC n 
137 42   DG n 
137 43   DT n 
137 44   DG n 
137 45   DA n 
137 46   DG n 
137 47   DG n 
137 48   DG n 
138 1    DA n 
138 2    DT n 
138 3    DA n 
138 4    DA n 
138 5    DA n 
138 6    DT n 
138 7    DC n 
138 8    DA n 
138 9    DC n 
138 10   DA n 
138 11   DG n 
138 12   DA n 
138 13   DC n 
138 14   DA n 
138 15   DC n 
138 16   DC n 
138 17   DA n 
138 18   DC n 
138 19   DA n 
138 20   DT n 
138 21   DT n 
138 22   DC n 
138 23   DA n 
138 24   DA n 
138 25   DC n 
138 26   DT n 
138 27   DA n 
138 28   DA n 
138 29   DT n 
138 30   DG n 
138 31   DA n 
138 32   DT n 
139 1    DC n 
139 2    DG n 
139 3    DA n 
139 4    DA n 
139 5    DC n 
139 6    DG n 
139 7    DT n 
139 8    DT n 
139 9    DA n 
139 10   DT n 
139 11   DT n 
139 12   DA n 
139 13   DA n 
139 14   DT n 
139 15   DC n 
139 16   DG n 
139 17   DT n 
139 18   DA n 
139 19   DT n 
139 20   DT n 
139 21   DA n 
139 22   DT n 
139 23   DA n 
139 24   DA n 
139 25   DA n 
139 26   DC n 
139 27   DA n 
139 28   DA n 
139 29   DC n 
139 30   DT n 
139 31   DG n 
139 32   DA n 
139 33   DA n 
139 34   DT n 
139 35   DT n 
139 36   DT n 
139 37   DT n 
139 38   DG n 
139 39   DT n 
139 40   DC n 
139 41   DG n 
139 42   DT n 
139 43   DC n 
139 44   DT n 
139 45   DT n 
139 46   DT n 
139 47   DC n 
139 48   DC n 
139 49   DA n 
139 50   DG n 
139 51   DA n 
139 52   DC n 
139 53   DG n 
140 1    DG n 
140 2    DT n 
140 3    DT n 
140 4    DT n 
140 5    DT n 
140 6    DT n 
140 7    DT n 
140 8    DT n 
140 9    DT n 
140 10   DT n 
140 11   DG n 
140 12   DT n 
140 13   DT n 
140 14   DT n 
140 15   DG n 
140 16   DA n 
140 17   DG n 
140 18   DT n 
140 19   DA n 
140 20   DA n 
140 21   DC n 
140 22   DA n 
140 23   DT n 
140 24   DT n 
140 25   DT n 
140 26   DA n 
140 27   DC n 
140 28   DC n 
140 29   DT n 
140 30   DT n 
140 31   DT n 
140 32   DT n 
140 33   DG n 
140 34   DA n 
140 35   DG n 
140 36   DG n 
140 37   DC n 
140 38   DG n 
141 1    DG n 
141 2    DC n 
141 3    DT n 
141 4    DG n 
141 5    DG n 
141 6    DC n 
141 7    DA n 
141 8    DG n 
141 9    DC n 
141 10   DT n 
141 11   DT n 
141 12   DT n 
141 13   DC n 
141 14   DG n 
141 15   DC n 
141 16   DG n 
141 17   DC n 
141 18   DG n 
141 19   DA n 
141 20   DG n 
141 21   DC n 
141 22   DA n 
141 23   DA n 
141 24   DC n 
141 25   DA n 
141 26   DC n 
141 27   DC n 
141 28   DG n 
141 29   DC n 
141 30   DT n 
141 31   DC n 
141 32   DC n 
141 33   DT n 
141 34   DG n 
141 35   DA n 
141 36   DT n 
141 37   DT n 
141 38   DT n 
141 39   DA n 
141 40   DG n 
141 41   DA n 
141 42   DA n 
141 43   DC n 
141 44   DC n 
141 45   DT n 
141 46   DG n 
141 47   DA n 
142 1    DT n 
142 2    DA n 
142 3    DG n 
142 4    DA n 
142 5    DA n 
142 6    DC n 
142 7    DA n 
142 8    DA n 
142 9    DT n 
142 10   DT n 
142 11   DA n 
142 12   DC n 
142 13   DA n 
142 14   DT n 
142 15   DA n 
142 16   DA n 
142 17   DC n 
142 18   DA n 
142 19   DA n 
142 20   DA n 
142 21   DC n 
142 22   DA n 
142 23   DA n 
142 24   DT n 
142 25   DC n 
142 26   DA n 
142 27   DT n 
142 28   DA n 
142 29   DA n 
142 30   DT n 
142 31   DA n 
142 32   DG n 
142 33   DT n 
142 34   DA n 
142 35   DC n 
142 36   DC n 
142 37   DG n 
142 38   DA n 
142 39   DC n 
142 40   DA n 
142 41   DA n 
142 42   DA n 
142 43   DA n 
143 1    DG n 
143 2    DA n 
143 3    DT n 
143 4    DG n 
143 5    DA n 
143 6    DG n 
143 7    DA n 
143 8    DA n 
143 9    DA n 
143 10   DG n 
143 11   DG n 
143 12   DT n 
143 13   DA n 
143 14   DA n 
143 15   DA n 
143 16   DT n 
143 17   DT n 
143 18   DG n 
143 19   DA n 
143 20   DA n 
143 21   DA n 
143 22   DT n 
143 23   DC n 
143 24   DT n 
143 25   DA n 
143 26   DC n 
143 27   DA n 
143 28   DA n 
143 29   DA n 
143 30   DA n 
143 31   DG n 
143 32   DA n 
143 33   DA n 
143 34   DG n 
143 35   DA n 
143 36   DG n 
143 37   DC n 
143 38   DA n 
143 39   DA n 
143 40   DC n 
143 41   DA n 
143 42   DC n 
143 43   DT n 
143 44   DA n 
143 45   DT n 
143 46   DC n 
143 47   DA n 
143 48   DT n 
144 1    DT n 
144 2    DA n 
144 3    DT n 
144 4    DG n 
144 5    DT n 
144 6    DG n 
144 7    DA n 
144 8    DG n 
144 9    DT n 
144 10   DG n 
144 11   DA n 
144 12   DA n 
144 13   DG n 
144 14   DT n 
144 15   DT n 
144 16   DA n 
144 17   DC n 
144 18   DA n 
144 19   DA n 
144 20   DG n 
144 21   DC n 
144 22   DC n 
144 23   DA n 
144 24   DA n 
144 25   DC n 
144 26   DG n 
144 27   DA n 
144 28   DT n 
144 29   DT n 
144 30   DT n 
144 31   DA n 
144 32   DA n 
144 33   DC n 
144 34   DA n 
144 35   DT n 
144 36   DA n 
144 37   DA n 
144 38   DA n 
144 39   DT n 
144 40   DT n 
144 41   DG n 
144 42   DT n 
144 43   DA n 
144 44   DA n 
145 1    DA n 
145 2    DC n 
145 3    DA n 
145 4    DT n 
145 5    DT n 
145 6    DT n 
145 7    DT n 
145 8    DT n 
145 9    DT n 
145 10   DT n 
145 11   DT n 
145 12   DT n 
145 13   DT n 
145 14   DT n 
145 15   DC n 
145 16   DG n 
145 17   DG n 
145 18   DG n 
145 19   DA n 
145 20   DG n 
145 21   DA n 
145 22   DA n 
145 23   DA n 
145 24   DC n 
145 25   DT n 
145 26   DC n 
145 27   DA n 
145 28   DT n 
145 29   DT n 
145 30   DA n 
145 31   DC n 
145 32   DC n 
145 33   DG n 
145 34   DT n 
145 35   DA n 
145 36   DA n 
145 37   DT n 
145 38   DC n 
145 39   DT n 
145 40   DT n 
145 41   DG n 
145 42   DA n 
145 43   DC n 
145 44   DA n 
145 45   DA n 
145 46   DG n 
145 47   DA n 
145 48   DA n 
145 49   DC n 
145 50   DT n 
145 51   DG n 
145 52   DA n 
145 53   DC n 
145 54   DC n 
145 55   DT n 
145 56   DT n 
145 57   DG n 
145 58   DT n 
145 59   DA n 
145 60   DC n 
145 61   DA n 
145 62   DG n 
146 1    DA n 
146 2    DA n 
146 3    DT n 
146 4    DT n 
146 5    DT n 
146 6    DA n 
146 7    DA n 
146 8    DT n 
146 9    DC n 
146 10   DA n 
146 11   DG n 
146 12   DC n 
146 13   DT n 
146 14   DC n 
146 15   DA n 
146 16   DT n 
146 17   DT n 
146 18   DA n 
146 19   DA n 
146 20   DA n 
146 21   DT n 
146 22   DG n 
146 23   DT n 
146 24   DT n 
146 25   DT n 
146 26   DA n 
146 27   DA n 
146 28   DT n 
146 29   DA n 
146 30   DA n 
146 31   DA n 
146 32   DT n 
146 33   DA n 
146 34   DT n 
146 35   DA n 
146 36   DA n 
146 37   DA n 
146 38   DG n 
146 39   DG n 
146 40   DA n 
146 41   DA n 
146 42   DT n 
147 1    DC n 
147 2    DA n 
147 3    DC n 
147 4    DA n 
147 5    DG n 
147 6    DA n 
147 7    DG n 
147 8    DC n 
147 9    DC n 
147 10   DT n 
147 11   DA n 
147 12   DA n 
147 13   DG n 
147 14   DG n 
147 15   DA n 
147 16   DA n 
147 17   DT n 
147 18   DT n 
147 19   DA n 
147 20   DG n 
147 21   DC n 
147 22   DA n 
147 23   DA n 
147 24   DA n 
147 25   DT n 
147 26   DC n 
147 27   DT n 
147 28   DT n 
147 29   DC n 
147 30   DG n 
147 31   DG n 
147 32   DT n 
147 33   DC n 
147 34   DG n 
147 35   DG n 
147 36   DT n 
147 37   DT n 
147 38   DT n 
147 39   DT n 
147 40   DA n 
147 41   DA n 
147 42   DT n 
147 43   DA n 
147 44   DA n 
147 45   DG n 
147 46   DA n 
147 47   DA n 
147 48   DA n 
147 49   DC n 
147 50   DC n 
147 51   DC n 
147 52   DT n 
148 1    DG n 
148 2    DG n 
148 3    DT n 
148 4    DA n 
148 5    DC n 
148 6    DC n 
148 7    DC n 
148 8    DT n 
148 9    DG n 
148 10   DA n 
148 11   DA n 
148 12   DA n 
148 13   DG n 
148 14   DA n 
148 15   DG n 
148 16   DG n 
148 17   DT n 
148 18   DC n 
148 19   DT n 
148 20   DA n 
148 21   DA n 
148 22   DA n 
148 23   DC n 
148 24   DC n 
148 25   DA n 
148 26   DA n 
148 27   DT n 
148 28   DT n 
148 29   DA n 
148 30   DT n 
148 31   DT n 
148 32   DT n 
148 33   DT n 
148 34   DT n 
148 35   DT n 
148 36   DT n 
148 37   DT n 
148 38   DT n 
148 39   DT n 
148 40   DA n 
148 41   DA n 
148 42   DT n 
148 43   DC n 
148 44   DA n 
148 45   DA n 
148 46   DG n 
148 47   DA n 
148 48   DT n 
149 1    DC n 
149 2    DA n 
149 3    DA n 
149 4    DC n 
149 5    DT n 
149 6    DT n 
149 7    DT n 
149 8    DG n 
149 9    DA n 
149 10   DA n 
149 11   DA n 
149 12   DG n 
149 13   DA n 
149 14   DG n 
149 15   DG n 
149 16   DT n 
149 17   DT n 
149 18   DT n 
149 19   DT n 
149 20   DT n 
149 21   DT n 
149 22   DT n 
149 23   DT n 
149 24   DT n 
149 25   DT n 
149 26   DA n 
149 27   DC n 
149 28   DA n 
149 29   DG n 
149 30   DA n 
149 31   DT n 
149 32   DG n 
149 33   DA n 
149 34   DA n 
149 35   DC n 
149 36   DG n 
149 37   DG n 
149 38   DT n 
149 39   DC n 
149 40   DA n 
149 41   DT n 
149 42   DC n 
149 43   DA n 
149 44   DA n 
149 45   DG n 
149 46   DA n 
150 1    DA n 
150 2    DT n 
150 3    DA n 
150 4    DG n 
150 5    DA n 
150 6    DC n 
150 7    DT n 
150 8    DT n 
150 9    DC n 
150 10   DA n 
150 11   DA n 
150 12   DC n 
150 13   DC n 
150 14   DA n 
150 15   DG n 
150 16   DA n 
150 17   DC n 
150 18   DC n 
150 19   DA n 
150 20   DC n 
150 21   DC n 
150 22   DG n 
150 23   DC n 
150 24   DG n 
150 25   DC n 
150 26   DC n 
150 27   DT n 
150 28   DC n 
150 29   DC n 
150 30   DG n 
150 31   DG n 
150 32   DT n 
150 33   DA n 
150 34   DT n 
150 35   DC n 
150 36   DT n 
150 37   DA n 
150 38   DA n 
150 39   DC n 
150 40   DG n 
150 41   DA n 
150 42   DG n 
150 43   DC n 
150 44   DG n 
150 45   DT n 
150 46   DC n 
150 47   DT n 
151 1    DC n 
151 2    DT n 
151 3    DT n 
151 4    DT n 
151 5    DA n 
151 6    DA n 
151 7    DA n 
151 8    DC n 
151 9    DA n 
151 10   DG n 
151 11   DT n 
151 12   DT n 
151 13   DC n 
151 14   DG n 
151 15   DC n 
151 16   DG n 
151 17   DA n 
151 18   DT n 
151 19   DT n 
151 20   DT n 
151 21   DT n 
151 22   DG n 
151 23   DG n 
151 24   DC n 
151 25   DT n 
151 26   DA n 
151 27   DT n 
151 28   DC n 
151 29   DA n 
152 1    DT n 
152 2    DT n 
152 3    DT n 
152 4    DG n 
152 5    DA n 
152 6    DG n 
152 7    DT n 
152 8    DC n 
152 9    DG n 
152 10   DA n 
152 11   DG n 
152 12   DC n 
152 13   DT n 
152 14   DT n 
152 15   DC n 
152 16   DA n 
152 17   DA n 
152 18   DA n 
152 19   DG n 
152 20   DC n 
152 21   DG n 
152 22   DA n 
152 23   DA n 
152 24   DA n 
152 25   DT n 
152 26   DA n 
152 27   DT n 
152 28   DC n 
152 29   DG n 
152 30   DC n 
152 31   DC n 
152 32   DT n 
152 33   DG n 
152 34   DA n 
152 35   DG n 
152 36   DG n 
152 37   DC n 
152 38   DT n 
152 39   DA n 
152 40   DC n 
152 41   DT n 
152 42   DA n 
152 43   DA n 
152 44   DA n 
152 45   DG n 
152 46   DA n 
152 47   DA n 
152 48   DG n 
153 1    DA n 
153 2    DG n 
153 3    DT n 
153 4    DA n 
153 5    DA n 
153 6    DG n 
153 7    DT n 
153 8    DT n 
153 9    DT n 
153 10   DT n 
153 11   DG n 
153 12   DC n 
153 13   DC n 
153 14   DA n 
153 15   DG n 
153 16   DA n 
153 17   DG n 
153 18   DG n 
153 19   DG n 
153 20   DG n 
153 21   DG n 
153 22   DT n 
153 23   DA n 
153 24   DA n 
153 25   DT n 
153 26   DA n 
153 27   DG n 
153 28   DT n 
153 29   DA n 
153 30   DA n 
153 31   DT n 
153 32   DA n 
153 33   DC n 
153 34   DC n 
153 35   DA n 
153 36   DG n 
153 37   DT n 
153 38   DC n 
153 39   DT n 
153 40   DA n 
154 1    DC n 
154 2    DC n 
154 3    DA n 
154 4    DA n 
154 5    DA n 
154 6    DC n 
154 7    DG n 
154 8    DG n 
154 9    DG n 
154 10   DT n 
154 11   DA n 
154 12   DA n 
154 13   DA n 
154 14   DA n 
154 15   DT n 
154 16   DT n 
154 17   DT n 
154 18   DT n 
154 19   DT n 
154 20   DT n 
154 21   DT n 
154 22   DT n 
154 23   DT n 
154 24   DT n 
154 25   DT n 
154 26   DA n 
154 27   DC n 
154 28   DG n 
154 29   DT n 
154 30   DA n 
154 31   DA n 
154 32   DT n 
154 33   DG n 
154 34   DC n 
154 35   DC n 
154 36   DA n 
154 37   DC n 
154 38   DT n 
154 39   DG n 
154 40   DC n 
154 41   DC n 
154 42   DG n 
154 43   DG n 
154 44   DA n 
154 45   DA n 
154 46   DC n 
155 1    DG n 
155 2    DG n 
155 3    DT n 
155 4    DG n 
155 5    DA n 
155 6    DA n 
155 7    DG n 
155 8    DT n 
155 9    DT n 
155 10   DA n 
155 11   DA n 
155 12   DA n 
155 13   DG n 
155 14   DG n 
155 15   DG n 
155 16   DA n 
155 17   DA n 
155 18   DT n 
155 19   DC n 
155 20   DA n 
155 21   DT n 
155 22   DT n 
155 23   DG n 
155 24   DG n 
155 25   DA n 
155 26   DA n 
155 27   DG n 
155 28   DC n 
155 29   DA n 
155 30   DA n 
155 31   DG n 
155 32   DA n 
155 33   DT n 
155 34   DT n 
155 35   DA n 
155 36   DG n 
155 37   DA n 
155 38   DG n 
155 39   DA n 
155 40   DA n 
155 41   DT n 
155 42   DC n 
155 43   DA n 
155 44   DA n 
155 45   DC n 
155 46   DA n 
155 47   DG n 
155 48   DT n 
155 49   DT n 
156 1    DG n 
156 2    DC n 
156 3    DG n 
156 4    DT n 
156 5    DA n 
156 6    DC n 
156 7    DC n 
156 8    DT n 
156 9    DT n 
156 10   DT n 
156 11   DT n 
156 12   DG n 
156 13   DA n 
156 14   DA n 
156 15   DA n 
156 16   DT n 
156 17   DA n 
156 18   DT n 
156 19   DT n 
156 20   DC n 
156 21   DT n 
156 22   DA n 
156 23   DA n 
156 24   DA n 
156 25   DT n 
156 26   DA n 
156 27   DT n 
156 28   DA n 
156 29   DA n 
156 30   DT n 
156 31   DG n 
156 32   DC n 
156 33   DT n 
156 34   DG n 
156 35   DA n 
156 36   DA n 
156 37   DC n 
156 38   DT n 
156 39   DC n 
156 40   DA n 
156 41   DA n 
156 42   DA n 
156 43   DC n 
156 44   DT n 
157 1    DA n 
157 2    DA n 
157 3    DC n 
157 4    DA n 
157 5    DT n 
157 6    DA n 
157 7    DC n 
157 8    DA n 
157 9    DG n 
157 10   DT n 
157 11   DA n 
157 12   DT n 
157 13   DA n 
157 14   DA n 
157 15   DA n 
157 16   DA n 
157 17   DA n 
157 18   DT n 
157 19   DC n 
157 20   DG n 
157 21   DC n 
157 22   DG n 
157 23   DA n 
157 24   DA n 
157 25   DT n 
157 26   DT n 
157 27   DG n 
157 28   DC n 
157 29   DG n 
157 30   DT n 
157 31   DA n 
157 32   DA n 
157 33   DA n 
157 34   DA n 
157 35   DT n 
157 36   DA n 
157 37   DC n 
157 38   DC n 
157 39   DA n 
157 40   DT n 
157 41   DC n 
157 42   DT n 
157 43   DA n 
157 44   DA n 
157 45   DA n 
157 46   DG n 
157 47   DA n 
157 48   DT n 
157 49   DG n 
157 50   DG n 
157 51   DA n 
157 52   DA n 
157 53   DA n 
157 54   DT n 
157 55   DT n 
157 56   DC n 
157 57   DG n 
157 58   DC n 
157 59   DC n 
157 60   DA n 
158 1    DT n 
158 2    DA n 
158 3    DA n 
158 4    DT n 
158 5    DT n 
158 6    DT n 
158 7    DT n 
158 8    DG n 
158 9    DC n 
158 10   DT n 
158 11   DT n 
158 12   DC n 
158 13   DT n 
158 14   DG n 
158 15   DT n 
158 16   DG n 
158 17   DA n 
158 18   DA n 
158 19   DT n 
158 20   DA n 
158 21   DA n 
158 22   DG n 
158 23   DG n 
158 24   DC n 
158 25   DT n 
158 26   DT n 
158 27   DG n 
158 28   DC n 
158 29   DC n 
158 30   DC n 
158 31   DA n 
158 32   DA n 
158 33   DC n 
158 34   DA n 
158 35   DT n 
158 36   DT n 
158 37   DA n 
158 38   DT n 
158 39   DT n 
158 40   DA n 
158 41   DC n 
158 42   DT n 
158 43   DT n 
158 44   DT n 
158 45   DT n 
158 46   DT n 
159 1    DG n 
159 2    DA n 
159 3    DA n 
159 4    DC n 
159 5    DG n 
159 6    DC n 
159 7    DG n 
159 8    DA n 
159 9    DT n 
159 10   DA n 
159 11   DG n 
159 12   DG n 
159 13   DC n 
159 14   DT n 
159 15   DG n 
159 16   DG n 
159 17   DC n 
159 18   DG n 
159 19   DC n 
159 20   DT n 
159 21   DA n 
159 22   DT n 
159 23   DT n 
159 24   DA n 
159 25   DG n 
159 26   DG n 
159 27   DA n 
159 28   DA n 
159 29   DC n 
159 30   DC n 
159 31   DG n 
159 32   DA n 
159 33   DA n 
159 34   DT n 
159 35   DT n 
159 36   DC n 
159 37   DG n 
159 38   DC n 
159 39   DC n 
159 40   DT n 
159 41   DG n 
159 42   DA n 
159 43   DA n 
159 44   DT n 
159 45   DA n 
159 46   DT n 
159 47   DA n 
159 48   DC n 
159 49   DA n 
159 50   DG n 
159 51   DT n 
159 52   DA n 
159 53   DA n 
159 54   DC n 
160 1    DA n 
160 2    DA n 
160 3    DT n 
160 4    DT n 
160 5    DT n 
160 6    DC n 
160 7    DA n 
160 8    DA n 
160 9    DC n 
160 10   DA n 
160 11   DG n 
160 12   DT n 
160 13   DT n 
160 14   DT n 
160 15   DC n 
160 16   DT n 
160 17   DT n 
160 18   DT n 
160 19   DT n 
160 20   DT n 
160 21   DT n 
160 22   DT n 
160 23   DT n 
160 24   DT n 
160 25   DT n 
160 26   DA n 
160 27   DG n 
160 28   DC n 
160 29   DG n 
160 30   DG n 
160 31   DA n 
160 32   DG n 
160 33   DT n 
160 34   DG n 
160 35   DA n 
160 36   DG n 
160 37   DA n 
160 38   DA n 
160 39   DA n 
160 40   DC n 
160 41   DA n 
160 42   DA n 
160 43   DC n 
160 44   DA n 
160 45   DA n 
160 46   DC n 
161 1    DA n 
161 2    DA n 
161 3    DG n 
161 4    DG n 
161 5    DG n 
161 6    DT n 
161 7    DG n 
161 8    DT n 
161 9    DT n 
161 10   DT n 
161 11   DG n 
161 12   DG n 
161 13   DA n 
161 14   DT n 
161 15   DA n 
161 16   DT n 
161 17   DA n 
161 18   DG n 
161 19   DA n 
161 20   DT n 
161 21   DA n 
161 22   DA n 
161 23   DA n 
161 24   DT n 
161 25   DT n 
161 26   DT n 
161 27   DA n 
161 28   DC n 
161 29   DG n 
161 30   DA n 
161 31   DG n 
161 32   DC n 
161 33   DA n 
161 34   DT n 
161 35   DG n 
161 36   DT n 
161 37   DT n 
161 38   DT n 
161 39   DT n 
161 40   DT n 
161 41   DT n 
161 42   DT n 
161 43   DT n 
161 44   DT n 
161 45   DT n 
161 46   DT n 
161 47   DA n 
161 48   DG n 
161 49   DA n 
161 50   DA n 
161 51   DA n 
161 52   DC n 
161 53   DC n 
161 54   DA n 
161 55   DA n 
161 56   DT n 
161 57   DC n 
161 58   DA n 
161 59   DA n 
161 60   DC n 
161 61   DG n 
161 62   DG n 
161 63   DG n 
161 64   DT n 
161 65   DA n 
161 66   DT n 
162 1    DC n 
162 2    DC n 
162 3    DA n 
162 4    DA n 
162 5    DC n 
162 6    DG n 
162 7    DT n 
162 8    DC n 
162 9    DT n 
162 10   DA n 
162 11   DA n 
162 12   DG n 
162 13   DA n 
162 14   DA n 
162 15   DC n 
162 16   DG n 
162 17   DC n 
162 18   DG n 
162 19   DA n 
162 20   DG n 
162 21   DG n 
162 22   DC n 
162 23   DA n 
162 24   DA n 
162 25   DC n 
162 26   DT n 
162 27   DA n 
162 28   DA n 
162 29   DT n 
162 30   DA n 
162 31   DA n 
162 32   DC n 
162 33   DT n 
162 34   DC n 
162 35   DC n 
162 36   DA n 
162 37   DA n 
162 38   DC n 
162 39   DG n 
162 40   DC n 
162 41   DG n 
162 42   DA n 
162 43   DA n 
162 44   DC n 
162 45   DG n 
162 46   DA n 
162 47   DC n 
162 48   DA n 
# 
loop_
_entity_src_gen.entity_id 
_entity_src_gen.pdbx_src_id 
_entity_src_gen.pdbx_alt_source_flag 
_entity_src_gen.pdbx_seq_type 
_entity_src_gen.pdbx_beg_seq_num 
_entity_src_gen.pdbx_end_seq_num 
_entity_src_gen.gene_src_common_name 
_entity_src_gen.gene_src_genus 
_entity_src_gen.pdbx_gene_src_gene 
_entity_src_gen.gene_src_species 
_entity_src_gen.gene_src_strain 
_entity_src_gen.gene_src_tissue 
_entity_src_gen.gene_src_tissue_fraction 
_entity_src_gen.gene_src_details 
_entity_src_gen.pdbx_gene_src_fragment 
_entity_src_gen.pdbx_gene_src_scientific_name 
_entity_src_gen.pdbx_gene_src_ncbi_taxonomy_id 
_entity_src_gen.pdbx_gene_src_variant 
_entity_src_gen.pdbx_gene_src_cell_line 
_entity_src_gen.pdbx_gene_src_atcc 
_entity_src_gen.pdbx_gene_src_organ 
_entity_src_gen.pdbx_gene_src_organelle 
_entity_src_gen.pdbx_gene_src_cell 
_entity_src_gen.pdbx_gene_src_cellular_location 
_entity_src_gen.host_org_common_name 
_entity_src_gen.pdbx_host_org_scientific_name 
_entity_src_gen.pdbx_host_org_ncbi_taxonomy_id 
_entity_src_gen.host_org_genus 
_entity_src_gen.pdbx_host_org_gene 
_entity_src_gen.pdbx_host_org_organ 
_entity_src_gen.host_org_species 
_entity_src_gen.pdbx_host_org_tissue 
_entity_src_gen.pdbx_host_org_tissue_fraction 
_entity_src_gen.pdbx_host_org_strain 
_entity_src_gen.pdbx_host_org_variant 
_entity_src_gen.pdbx_host_org_cell_line 
_entity_src_gen.pdbx_host_org_atcc 
_entity_src_gen.pdbx_host_org_culture_collection 
_entity_src_gen.pdbx_host_org_cell 
_entity_src_gen.pdbx_host_org_organelle 
_entity_src_gen.pdbx_host_org_cellular_location 
_entity_src_gen.pdbx_host_org_vector_type 
_entity_src_gen.pdbx_host_org_vector 
_entity_src_gen.host_org_details 
_entity_src_gen.expression_system_id 
_entity_src_gen.plasmid_name 
_entity_src_gen.plasmid_details 
_entity_src_gen.pdbx_description 
1 1 sample 'Biological sequence' 1    4896 'M13 PHAGE' ? ? ? ? ? ? ? ? 'ENTEROBACTERIA PHAGE M13' 10870 ? ? ? ? ? ? ? ? 
'ESCHERICHIA COLI' 562 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 'M13 SINGLE-STRANDED PHAGE GENOME WAS PRODUCED IN E.COLI CELLS' 
1 2 sample 'Biological sequence' 4897 7249 'M13 PHAGE' ? ? ? ? ? ? ? ? 'ENTEROBACTERIA PHAGE M13' 10870 ? ? ? ? ? ? ? ? 
'ESCHERICHIA COLI' 562 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? 'M13 SINGLE-STRANDED PHAGE GENOME WAS PRODUCED IN E.COLI CELLS' 
# 
loop_
_pdbx_entity_src_syn.entity_id 
_pdbx_entity_src_syn.pdbx_src_id 
_pdbx_entity_src_syn.pdbx_alt_source_flag 
_pdbx_entity_src_syn.pdbx_beg_seq_num 
_pdbx_entity_src_syn.pdbx_end_seq_num 
_pdbx_entity_src_syn.organism_scientific 
_pdbx_entity_src_syn.organism_common_name 
_pdbx_entity_src_syn.ncbi_taxonomy_id 
_pdbx_entity_src_syn.details 
2   1 sample 1 55 'SYNTHETIC CONSTRUCT' ? 32630 ? 
3   1 sample 1 44 'SYNTHETIC CONSTRUCT' ? 32630 ? 
4   1 sample 1 50 'SYNTHETIC CONSTRUCT' ? 32630 ? 
5   1 sample 1 40 'SYNTHETIC CONSTRUCT' ? 32630 ? 
6   1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
7   1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
8   1 sample 1 50 'SYNTHETIC CONSTRUCT' ? 32630 ? 
9   1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
10  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
11  1 sample 1 40 'SYNTHETIC CONSTRUCT' ? 32630 ? 
12  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
13  1 sample 1 50 'SYNTHETIC CONSTRUCT' ? 32630 ? 
14  1 sample 1 46 'SYNTHETIC CONSTRUCT' ? 32630 ? 
15  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
16  1 sample 1 46 'SYNTHETIC CONSTRUCT' ? 32630 ? 
17  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
18  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
19  1 sample 1 52 'SYNTHETIC CONSTRUCT' ? 32630 ? 
20  1 sample 1 60 'SYNTHETIC CONSTRUCT' ? 32630 ? 
21  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
22  1 sample 1 50 'SYNTHETIC CONSTRUCT' ? 32630 ? 
23  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
24  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
25  1 sample 1 40 'SYNTHETIC CONSTRUCT' ? 32630 ? 
26  1 sample 1 57 'SYNTHETIC CONSTRUCT' ? 32630 ? 
27  1 sample 1 63 'SYNTHETIC CONSTRUCT' ? 32630 ? 
28  1 sample 1 64 'SYNTHETIC CONSTRUCT' ? 32630 ? 
29  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
30  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
31  1 sample 1 52 'SYNTHETIC CONSTRUCT' ? 32630 ? 
32  1 sample 1 50 'SYNTHETIC CONSTRUCT' ? 32630 ? 
33  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
34  1 sample 1 42 'SYNTHETIC CONSTRUCT' ? 32630 ? 
35  1 sample 1 54 'SYNTHETIC CONSTRUCT' ? 32630 ? 
36  1 sample 1 45 'SYNTHETIC CONSTRUCT' ? 32630 ? 
37  1 sample 1 70 'SYNTHETIC CONSTRUCT' ? 32630 ? 
38  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
39  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
40  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
41  1 sample 1 44 'SYNTHETIC CONSTRUCT' ? 32630 ? 
42  1 sample 1 46 'SYNTHETIC CONSTRUCT' ? 32630 ? 
43  1 sample 1 62 'SYNTHETIC CONSTRUCT' ? 32630 ? 
44  1 sample 1 46 'SYNTHETIC CONSTRUCT' ? 32630 ? 
45  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
46  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
47  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
48  1 sample 1 36 'SYNTHETIC CONSTRUCT' ? 32630 ? 
49  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
50  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
51  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
52  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
53  1 sample 1 52 'SYNTHETIC CONSTRUCT' ? 32630 ? 
54  1 sample 1 38 'SYNTHETIC CONSTRUCT' ? 32630 ? 
55  1 sample 1 51 'SYNTHETIC CONSTRUCT' ? 32630 ? 
56  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
57  1 sample 1 59 'SYNTHETIC CONSTRUCT' ? 32630 ? 
58  1 sample 1 36 'SYNTHETIC CONSTRUCT' ? 32630 ? 
59  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
60  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
61  1 sample 1 40 'SYNTHETIC CONSTRUCT' ? 32630 ? 
62  1 sample 1 50 'SYNTHETIC CONSTRUCT' ? 32630 ? 
63  1 sample 1 44 'SYNTHETIC CONSTRUCT' ? 32630 ? 
64  1 sample 1 40 'SYNTHETIC CONSTRUCT' ? 32630 ? 
65  1 sample 1 55 'SYNTHETIC CONSTRUCT' ? 32630 ? 
66  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
67  1 sample 1 44 'SYNTHETIC CONSTRUCT' ? 32630 ? 
68  1 sample 1 35 'SYNTHETIC CONSTRUCT' ? 32630 ? 
69  1 sample 1 68 'SYNTHETIC CONSTRUCT' ? 32630 ? 
70  1 sample 1 40 'SYNTHETIC CONSTRUCT' ? 32630 ? 
71  1 sample 1 49 'SYNTHETIC CONSTRUCT' ? 32630 ? 
72  1 sample 1 42 'SYNTHETIC CONSTRUCT' ? 32630 ? 
73  1 sample 1 42 'SYNTHETIC CONSTRUCT' ? 32630 ? 
74  1 sample 1 58 'SYNTHETIC CONSTRUCT' ? 32630 ? 
75  1 sample 1 44 'SYNTHETIC CONSTRUCT' ? 32630 ? 
76  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
77  1 sample 1 52 'SYNTHETIC CONSTRUCT' ? 32630 ? 
78  1 sample 1 63 'SYNTHETIC CONSTRUCT' ? 32630 ? 
79  1 sample 1 49 'SYNTHETIC CONSTRUCT' ? 32630 ? 
80  1 sample 1 66 'SYNTHETIC CONSTRUCT' ? 32630 ? 
81  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
82  1 sample 1 64 'SYNTHETIC CONSTRUCT' ? 32630 ? 
83  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
84  1 sample 1 52 'SYNTHETIC CONSTRUCT' ? 32630 ? 
85  1 sample 1 55 'SYNTHETIC CONSTRUCT' ? 32630 ? 
86  1 sample 1 44 'SYNTHETIC CONSTRUCT' ? 32630 ? 
87  1 sample 1 53 'SYNTHETIC CONSTRUCT' ? 32630 ? 
88  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
89  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
90  1 sample 1 66 'SYNTHETIC CONSTRUCT' ? 32630 ? 
91  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
92  1 sample 1 68 'SYNTHETIC CONSTRUCT' ? 32630 ? 
93  1 sample 1 50 'SYNTHETIC CONSTRUCT' ? 32630 ? 
94  1 sample 1 56 'SYNTHETIC CONSTRUCT' ? 32630 ? 
95  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
96  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
97  1 sample 1 47 'SYNTHETIC CONSTRUCT' ? 32630 ? 
98  1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
99  1 sample 1 67 'SYNTHETIC CONSTRUCT' ? 32630 ? 
100 1 sample 1 45 'SYNTHETIC CONSTRUCT' ? 32630 ? 
101 1 sample 1 67 'SYNTHETIC CONSTRUCT' ? 32630 ? 
102 1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
103 1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
104 1 sample 1 67 'SYNTHETIC CONSTRUCT' ? 32630 ? 
105 1 sample 1 67 'SYNTHETIC CONSTRUCT' ? 32630 ? 
106 1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
107 1 sample 1 58 'SYNTHETIC CONSTRUCT' ? 32630 ? 
108 1 sample 1 51 'SYNTHETIC CONSTRUCT' ? 32630 ? 
109 1 sample 1 54 'SYNTHETIC CONSTRUCT' ? 32630 ? 
110 1 sample 1 41 'SYNTHETIC CONSTRUCT' ? 32630 ? 
111 1 sample 1 51 'SYNTHETIC CONSTRUCT' ? 32630 ? 
112 1 sample 1 56 'SYNTHETIC CONSTRUCT' ? 32630 ? 
113 1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
114 1 sample 1 71 'SYNTHETIC CONSTRUCT' ? 32630 ? 
115 1 sample 1 62 'SYNTHETIC CONSTRUCT' ? 32630 ? 
116 1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
117 1 sample 1 52 'SYNTHETIC CONSTRUCT' ? 32630 ? 
118 1 sample 1 44 'SYNTHETIC CONSTRUCT' ? 32630 ? 
119 1 sample 1 54 'SYNTHETIC CONSTRUCT' ? 32630 ? 
120 1 sample 1 47 'SYNTHETIC CONSTRUCT' ? 32630 ? 
121 1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
122 1 sample 1 40 'SYNTHETIC CONSTRUCT' ? 32630 ? 
123 1 sample 1 40 'SYNTHETIC CONSTRUCT' ? 32630 ? 
124 1 sample 1 44 'SYNTHETIC CONSTRUCT' ? 32630 ? 
125 1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
126 1 sample 1 44 'SYNTHETIC CONSTRUCT' ? 32630 ? 
127 1 sample 1 59 'SYNTHETIC CONSTRUCT' ? 32630 ? 
128 1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
129 1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
130 1 sample 1 54 'SYNTHETIC CONSTRUCT' ? 32630 ? 
131 1 sample 1 41 'SYNTHETIC CONSTRUCT' ? 32630 ? 
132 1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
133 1 sample 1 56 'SYNTHETIC CONSTRUCT' ? 32630 ? 
134 1 sample 1 38 'SYNTHETIC CONSTRUCT' ? 32630 ? 
135 1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
136 1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
137 1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
138 1 sample 1 32 'SYNTHETIC CONSTRUCT' ? 32630 ? 
139 1 sample 1 53 'SYNTHETIC CONSTRUCT' ? 32630 ? 
140 1 sample 1 38 'SYNTHETIC CONSTRUCT' ? 32630 ? 
141 1 sample 1 47 'SYNTHETIC CONSTRUCT' ? 32630 ? 
142 1 sample 1 43 'SYNTHETIC CONSTRUCT' ? 32630 ? 
143 1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
144 1 sample 1 44 'SYNTHETIC CONSTRUCT' ? 32630 ? 
145 1 sample 1 62 'SYNTHETIC CONSTRUCT' ? 32630 ? 
146 1 sample 1 42 'SYNTHETIC CONSTRUCT' ? 32630 ? 
147 1 sample 1 52 'SYNTHETIC CONSTRUCT' ? 32630 ? 
148 1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
149 1 sample 1 46 'SYNTHETIC CONSTRUCT' ? 32630 ? 
150 1 sample 1 47 'SYNTHETIC CONSTRUCT' ? 32630 ? 
151 1 sample 1 29 'SYNTHETIC CONSTRUCT' ? 32630 ? 
152 1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
153 1 sample 1 40 'SYNTHETIC CONSTRUCT' ? 32630 ? 
154 1 sample 1 46 'SYNTHETIC CONSTRUCT' ? 32630 ? 
155 1 sample 1 49 'SYNTHETIC CONSTRUCT' ? 32630 ? 
156 1 sample 1 44 'SYNTHETIC CONSTRUCT' ? 32630 ? 
157 1 sample 1 60 'SYNTHETIC CONSTRUCT' ? 32630 ? 
158 1 sample 1 46 'SYNTHETIC CONSTRUCT' ? 32630 ? 
159 1 sample 1 54 'SYNTHETIC CONSTRUCT' ? 32630 ? 
160 1 sample 1 46 'SYNTHETIC CONSTRUCT' ? 32630 ? 
161 1 sample 1 66 'SYNTHETIC CONSTRUCT' ? 32630 ? 
162 1 sample 1 48 'SYNTHETIC CONSTRUCT' ? 32630 ? 
# 
loop_
_struct_ref.id 
_struct_ref.db_name 
_struct_ref.db_code 
_struct_ref.pdbx_db_accession 
_struct_ref.pdbx_db_isoform 
_struct_ref.entity_id 
_struct_ref.pdbx_seq_one_letter_code 
_struct_ref.pdbx_align_begin 
1   PDB 4V5X 4V5X ? 1   ? 1    
2   PDB 4V5X 4V5X ? 1   ? 4897 
3   PDB 4V5X 4V5X ? 2   ? 1    
4   PDB 4V5X 4V5X ? 3   ? 1    
5   PDB 4V5X 4V5X ? 4   ? 1    
6   PDB 4V5X 4V5X ? 5   ? 1    
7   PDB 4V5X 4V5X ? 6   ? 1    
8   PDB 4V5X 4V5X ? 7   ? 1    
9   PDB 4V5X 4V5X ? 8   ? 1    
10  PDB 4V5X 4V5X ? 9   ? 1    
11  PDB 4V5X 4V5X ? 10  ? 1    
12  PDB 4V5X 4V5X ? 11  ? 1    
13  PDB 4V5X 4V5X ? 12  ? 1    
14  PDB 4V5X 4V5X ? 13  ? 1    
15  PDB 4V5X 4V5X ? 14  ? 1    
16  PDB 4V5X 4V5X ? 15  ? 1    
17  PDB 4V5X 4V5X ? 16  ? 1    
18  PDB 4V5X 4V5X ? 17  ? 1    
19  PDB 4V5X 4V5X ? 18  ? 1    
20  PDB 4V5X 4V5X ? 19  ? 1    
21  PDB 4V5X 4V5X ? 20  ? 1    
22  PDB 4V5X 4V5X ? 21  ? 1    
23  PDB 4V5X 4V5X ? 22  ? 1    
24  PDB 4V5X 4V5X ? 23  ? 1    
25  PDB 4V5X 4V5X ? 24  ? 1    
26  PDB 4V5X 4V5X ? 25  ? 1    
27  PDB 4V5X 4V5X ? 26  ? 1    
28  PDB 4V5X 4V5X ? 27  ? 1    
29  PDB 4V5X 4V5X ? 28  ? 1    
30  PDB 4V5X 4V5X ? 29  ? 1    
31  PDB 4V5X 4V5X ? 30  ? 1    
32  PDB 4V5X 4V5X ? 31  ? 1    
33  PDB 4V5X 4V5X ? 32  ? 1    
34  PDB 4V5X 4V5X ? 33  ? 1    
35  PDB 4V5X 4V5X ? 34  ? 1    
36  PDB 4V5X 4V5X ? 35  ? 1    
37  PDB 4V5X 4V5X ? 36  ? 1    
38  PDB 4V5X 4V5X ? 37  ? 1    
39  PDB 4V5X 4V5X ? 38  ? 1    
40  PDB 4V5X 4V5X ? 39  ? 1    
41  PDB 4V5X 4V5X ? 40  ? 1    
42  PDB 4V5X 4V5X ? 41  ? 1    
43  PDB 4V5X 4V5X ? 42  ? 1    
44  PDB 4V5X 4V5X ? 43  ? 1    
45  PDB 4V5X 4V5X ? 44  ? 1    
46  PDB 4V5X 4V5X ? 45  ? 1    
47  PDB 4V5X 4V5X ? 46  ? 1    
48  PDB 4V5X 4V5X ? 47  ? 1    
49  PDB 4V5X 4V5X ? 48  ? 1    
50  PDB 4V5X 4V5X ? 49  ? 1    
51  PDB 4V5X 4V5X ? 50  ? 1    
52  PDB 4V5X 4V5X ? 51  ? 1    
53  PDB 4V5X 4V5X ? 52  ? 1    
54  PDB 4V5X 4V5X ? 53  ? 1    
55  PDB 4V5X 4V5X ? 54  ? 1    
56  PDB 4V5X 4V5X ? 55  ? 1    
57  PDB 4V5X 4V5X ? 56  ? 1    
58  PDB 4V5X 4V5X ? 57  ? 1    
59  PDB 4V5X 4V5X ? 58  ? 1    
60  PDB 4V5X 4V5X ? 59  ? 1    
61  PDB 4V5X 4V5X ? 60  ? 1    
62  PDB 4V5X 4V5X ? 61  ? 1    
63  PDB 4V5X 4V5X ? 62  ? 1    
64  PDB 4V5X 4V5X ? 63  ? 1    
65  PDB 4V5X 4V5X ? 64  ? 1    
66  PDB 4V5X 4V5X ? 65  ? 1    
67  PDB 4V5X 4V5X ? 66  ? 1    
68  PDB 4V5X 4V5X ? 67  ? 1    
69  PDB 4V5X 4V5X ? 68  ? 1    
70  PDB 4V5X 4V5X ? 69  ? 1    
71  PDB 4V5X 4V5X ? 70  ? 1    
72  PDB 4V5X 4V5X ? 71  ? 1    
73  PDB 4V5X 4V5X ? 72  ? 1    
74  PDB 4V5X 4V5X ? 73  ? 1    
75  PDB 4V5X 4V5X ? 74  ? 1    
76  PDB 4V5X 4V5X ? 75  ? 1    
77  PDB 4V5X 4V5X ? 76  ? 1    
78  PDB 4V5X 4V5X ? 77  ? 1    
79  PDB 4V5X 4V5X ? 78  ? 1    
80  PDB 4V5X 4V5X ? 79  ? 1    
81  PDB 4V5X 4V5X ? 80  ? 1    
82  PDB 4V5X 4V5X ? 81  ? 1    
83  PDB 4V5X 4V5X ? 82  ? 1    
84  PDB 4V5X 4V5X ? 83  ? 1    
85  PDB 4V5X 4V5X ? 84  ? 1    
86  PDB 4V5X 4V5X ? 85  ? 1    
87  PDB 4V5X 4V5X ? 86  ? 1    
88  PDB 4V5X 4V5X ? 87  ? 1    
89  PDB 4V5X 4V5X ? 88  ? 1    
90  PDB 4V5X 4V5X ? 89  ? 1    
91  PDB 4V5X 4V5X ? 90  ? 1    
92  PDB 4V5X 4V5X ? 91  ? 1    
93  PDB 4V5X 4V5X ? 92  ? 1    
94  PDB 4V5X 4V5X ? 93  ? 1    
95  PDB 4V5X 4V5X ? 94  ? 1    
96  PDB 4V5X 4V5X ? 95  ? 1    
97  PDB 4V5X 4V5X ? 96  ? 1    
98  PDB 4V5X 4V5X ? 97  ? 1    
99  PDB 4V5X 4V5X ? 98  ? 1    
100 PDB 4V5X 4V5X ? 99  ? 1    
101 PDB 4V5X 4V5X ? 100 ? 1    
102 PDB 4V5X 4V5X ? 101 ? 1    
103 PDB 4V5X 4V5X ? 102 ? 1    
104 PDB 4V5X 4V5X ? 103 ? 1    
105 PDB 4V5X 4V5X ? 104 ? 1    
106 PDB 4V5X 4V5X ? 105 ? 1    
107 PDB 4V5X 4V5X ? 106 ? 1    
108 PDB 4V5X 4V5X ? 107 ? 1    
109 PDB 4V5X 4V5X ? 108 ? 1    
110 PDB 4V5X 4V5X ? 109 ? 1    
111 PDB 4V5X 4V5X ? 110 ? 1    
112 PDB 4V5X 4V5X ? 111 ? 1    
113 PDB 4V5X 4V5X ? 112 ? 1    
114 PDB 4V5X 4V5X ? 113 ? 1    
115 PDB 4V5X 4V5X ? 114 ? 1    
116 PDB 4V5X 4V5X ? 115 ? 1    
117 PDB 4V5X 4V5X ? 116 ? 1    
118 PDB 4V5X 4V5X ? 117 ? 1    
119 PDB 4V5X 4V5X ? 118 ? 1    
120 PDB 4V5X 4V5X ? 119 ? 1    
121 PDB 4V5X 4V5X ? 120 ? 1    
122 PDB 4V5X 4V5X ? 121 ? 1    
123 PDB 4V5X 4V5X ? 122 ? 1    
124 PDB 4V5X 4V5X ? 123 ? 1    
125 PDB 4V5X 4V5X ? 124 ? 1    
126 PDB 4V5X 4V5X ? 125 ? 1    
127 PDB 4V5X 4V5X ? 126 ? 1    
128 PDB 4V5X 4V5X ? 127 ? 1    
129 PDB 4V5X 4V5X ? 128 ? 1    
130 PDB 4V5X 4V5X ? 129 ? 1    
131 PDB 4V5X 4V5X ? 130 ? 1    
132 PDB 4V5X 4V5X ? 131 ? 1    
133 PDB 4V5X 4V5X ? 132 ? 1    
134 PDB 4V5X 4V5X ? 133 ? 1    
135 PDB 4V5X 4V5X ? 134 ? 1    
136 PDB 4V5X 4V5X ? 135 ? 1    
137 PDB 4V5X 4V5X ? 136 ? 1    
138 PDB 4V5X 4V5X ? 137 ? 1    
139 PDB 4V5X 4V5X ? 138 ? 1    
140 PDB 4V5X 4V5X ? 139 ? 1    
141 PDB 4V5X 4V5X ? 140 ? 1    
142 PDB 4V5X 4V5X ? 141 ? 1    
143 PDB 4V5X 4V5X ? 142 ? 1    
144 PDB 4V5X 4V5X ? 143 ? 1    
145 PDB 4V5X 4V5X ? 144 ? 1    
146 PDB 4V5X 4V5X ? 145 ? 1    
147 PDB 4V5X 4V5X ? 146 ? 1    
148 PDB 4V5X 4V5X ? 147 ? 1    
149 PDB 4V5X 4V5X ? 148 ? 1    
150 PDB 4V5X 4V5X ? 149 ? 1    
151 PDB 4V5X 4V5X ? 150 ? 1    
152 PDB 4V5X 4V5X ? 151 ? 1    
153 PDB 4V5X 4V5X ? 152 ? 1    
154 PDB 4V5X 4V5X ? 153 ? 1    
155 PDB 4V5X 4V5X ? 154 ? 1    
156 PDB 4V5X 4V5X ? 155 ? 1    
157 PDB 4V5X 4V5X ? 156 ? 1    
158 PDB 4V5X 4V5X ? 157 ? 1    
159 PDB 4V5X 4V5X ? 158 ? 1    
160 PDB 4V5X 4V5X ? 159 ? 1    
161 PDB 4V5X 4V5X ? 160 ? 1    
162 PDB 4V5X 4V5X ? 161 ? 1    
163 PDB 4V5X 4V5X ? 162 ? 1    
# 
loop_
_struct_ref_seq.align_id 
_struct_ref_seq.ref_id 
_struct_ref_seq.pdbx_PDB_id_code 
_struct_ref_seq.pdbx_strand_id 
_struct_ref_seq.seq_align_beg 
_struct_ref_seq.pdbx_seq_align_beg_ins_code 
_struct_ref_seq.seq_align_end 
_struct_ref_seq.pdbx_seq_align_end_ins_code 
_struct_ref_seq.pdbx_db_accession 
_struct_ref_seq.db_align_beg 
_struct_ref_seq.pdbx_db_align_beg_ins_code 
_struct_ref_seq.db_align_end 
_struct_ref_seq.pdbx_db_align_end_ins_code 
_struct_ref_seq.pdbx_auth_seq_align_beg 
_struct_ref_seq.pdbx_auth_seq_align_end 
1   1   4V5X AA 1    ? 4896 ? 4V5X 1    ? 4896 ? 1    4896 
2   2   4V5X AA 4897 ? 7249 ? 4V5X 4897 ? 7249 ? 4897 7249 
3   3   4V5X A0 1    ? 55   ? 4V5X 1    ? 55   ? 1    55   
4   4   4V5X A1 1    ? 44   ? 4V5X 1    ? 44   ? 1    44   
5   5   4V5X A2 1    ? 50   ? 4V5X 1    ? 50   ? 1    50   
6   6   4V5X A3 1    ? 40   ? 4V5X 1    ? 40   ? 1    40   
7   7   4V5X A4 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
8   8   4V5X A5 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
9   9   4V5X A6 1    ? 50   ? 4V5X 1    ? 50   ? 1    50   
10  10  4V5X A7 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
11  11  4V5X A8 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
12  12  4V5X AB 1    ? 40   ? 4V5X 1    ? 40   ? 1    40   
13  13  4V5X AC 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
14  14  4V5X AD 1    ? 50   ? 4V5X 1    ? 50   ? 1    50   
15  15  4V5X AE 1    ? 46   ? 4V5X 1    ? 46   ? 1    46   
16  16  4V5X AF 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
17  17  4V5X AG 1    ? 46   ? 4V5X 1    ? 46   ? 1    46   
18  18  4V5X AH 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
19  19  4V5X AI 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
20  20  4V5X AJ 1    ? 52   ? 4V5X 1    ? 52   ? 1    52   
21  21  4V5X AK 1    ? 60   ? 4V5X 1    ? 60   ? 1    60   
22  22  4V5X AL 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
23  23  4V5X AM 1    ? 50   ? 4V5X 1    ? 50   ? 1    50   
24  24  4V5X AN 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
25  25  4V5X AO 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
26  26  4V5X AP 1    ? 40   ? 4V5X 1    ? 40   ? 1    40   
27  27  4V5X AQ 1    ? 57   ? 4V5X 1    ? 57   ? 1    57   
28  28  4V5X AR 1    ? 63   ? 4V5X 1    ? 63   ? 1    63   
29  29  4V5X AS 1    ? 64   ? 4V5X 1    ? 64   ? 1    64   
30  30  4V5X AT 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
31  31  4V5X AU 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
32  32  4V5X AV 1    ? 52   ? 4V5X 1    ? 52   ? 1    52   
33  33  4V5X AW 1    ? 50   ? 4V5X 1    ? 50   ? 1    50   
34  34  4V5X AX 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
35  35  4V5X AY 1    ? 42   ? 4V5X 1    ? 42   ? 1    42   
36  36  4V5X AZ 1    ? 54   ? 4V5X 1    ? 54   ? 1    54   
37  37  4V5X Ab 1    ? 45   ? 4V5X 1    ? 45   ? 1    45   
38  38  4V5X Ac 1    ? 70   ? 4V5X 1    ? 70   ? 1    70   
39  39  4V5X Ad 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
40  40  4V5X Af 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
41  41  4V5X Ag 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
42  42  4V5X Ah 1    ? 44   ? 4V5X 1    ? 44   ? 1    44   
43  43  4V5X Ai 1    ? 46   ? 4V5X 1    ? 46   ? 1    46   
44  44  4V5X Aj 1    ? 62   ? 4V5X 1    ? 62   ? 1    62   
45  45  4V5X Ak 1    ? 46   ? 4V5X 1    ? 46   ? 1    46   
46  46  4V5X Al 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
47  47  4V5X Am 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
48  48  4V5X An 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
49  49  4V5X Ao 1    ? 36   ? 4V5X 1    ? 36   ? 1    36   
50  50  4V5X As 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
51  51  4V5X Au 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
52  52  4V5X Av 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
53  53  4V5X Aw 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
54  54  4V5X Ax 1    ? 52   ? 4V5X 1    ? 52   ? 1    52   
55  55  4V5X Ay 1    ? 38   ? 4V5X 1    ? 38   ? 1    38   
56  56  4V5X Az 1    ? 51   ? 4V5X 1    ? 51   ? 1    51   
57  57  4V5X B0 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
58  58  4V5X B1 1    ? 59   ? 4V5X 1    ? 59   ? 1    59   
59  59  4V5X B2 1    ? 36   ? 4V5X 1    ? 36   ? 1    36   
60  60  4V5X B3 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
61  61  4V5X B4 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
62  62  4V5X B5 1    ? 40   ? 4V5X 1    ? 40   ? 1    40   
63  63  4V5X B6 1    ? 50   ? 4V5X 1    ? 50   ? 1    50   
64  64  4V5X B7 1    ? 44   ? 4V5X 1    ? 44   ? 1    44   
65  65  4V5X B8 1    ? 40   ? 4V5X 1    ? 40   ? 1    40   
66  66  4V5X B9 1    ? 55   ? 4V5X 1    ? 55   ? 1    55   
67  67  4V5X BB 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
68  68  4V5X BC 1    ? 44   ? 4V5X 1    ? 44   ? 1    44   
69  69  4V5X BD 1    ? 35   ? 4V5X 1    ? 35   ? 1    35   
70  70  4V5X BE 1    ? 68   ? 4V5X 1    ? 68   ? 1    68   
71  71  4V5X BF 1    ? 40   ? 4V5X 1    ? 40   ? 1    40   
72  72  4V5X BG 1    ? 49   ? 4V5X 1    ? 49   ? 1    49   
73  73  4V5X BH 1    ? 42   ? 4V5X 1    ? 42   ? 1    42   
74  74  4V5X BI 1    ? 42   ? 4V5X 1    ? 52   ? 1    52   
75  75  4V5X BJ 1    ? 58   ? 4V5X 1    ? 58   ? 1    58   
76  76  4V5X BK 1    ? 44   ? 4V5X 1    ? 44   ? 1    44   
77  77  4V5X BL 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
78  78  4V5X BM 1    ? 52   ? 4V5X 1    ? 52   ? 1    52   
79  79  4V5X BN 1    ? 63   ? 4V5X 1    ? 63   ? 1    63   
80  80  4V5X BO 1    ? 49   ? 4V5X 1    ? 49   ? 1    49   
81  81  4V5X BP 1    ? 66   ? 4V5X 1    ? 66   ? 1    66   
82  82  4V5X BQ 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
83  83  4V5X BR 1    ? 64   ? 4V5X -7   ? 64   ? -7   64   
84  84  4V5X BS 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
85  85  4V5X BT 1    ? 52   ? 4V5X 1    ? 52   ? 1    52   
86  86  4V5X BU 1    ? 55   ? 4V5X 1    ? 55   ? 1    55   
87  87  4V5X BV 1    ? 44   ? 4V5X 1    ? 44   ? 1    44   
88  88  4V5X BW 1    ? 53   ? 4V5X 1    ? 53   ? 1    53   
89  89  4V5X BX 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
90  90  4V5X BY 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
91  91  4V5X BZ 1    ? 66   ? 4V5X 1    ? 66   ? 1    66   
92  92  4V5X Ba 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
93  93  4V5X Bb 1    ? 68   ? 4V5X 1    ? 68   ? 1    68   
94  94  4V5X Bc 1    ? 50   ? 4V5X 1    ? 50   ? 1    50   
95  95  4V5X Bd 1    ? 56   ? 4V5X 1    ? 56   ? 1    56   
96  96  4V5X Be 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
97  97  4V5X Bf 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
98  98  4V5X Bg 1    ? 47   ? 4V5X 1    ? 47   ? 1    47   
99  99  4V5X Bh 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
100 100 4V5X Bi 1    ? 67   ? 4V5X 1    ? 67   ? 1    67   
101 101 4V5X Bj 1    ? 45   ? 4V5X 1    ? 45   ? 1    45   
102 102 4V5X Bk 1    ? 67   ? 4V5X 1    ? 67   ? 1    67   
103 103 4V5X Bl 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
104 104 4V5X Bm 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
105 105 4V5X Bn 1    ? 67   ? 4V5X 1    ? 67   ? 1    67   
106 106 4V5X Bo 1    ? 67   ? 4V5X 1    ? 67   ? 1    67   
107 107 4V5X Bp 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
108 108 4V5X Bq 1    ? 58   ? 4V5X 1    ? 58   ? 1    58   
109 109 4V5X Br 1    ? 51   ? 4V5X 1    ? 51   ? 1    51   
110 110 4V5X Bs 1    ? 54   ? 4V5X 1    ? 54   ? 1    54   
111 111 4V5X C0 1    ? 41   ? 4V5X 1    ? 41   ? 1    41   
112 112 4V5X C1 1    ? 51   ? 4V5X 1    ? 51   ? 1    51   
113 113 4V5X C2 1    ? 56   ? 4V5X 1    ? 56   ? 1    56   
114 114 4V5X C3 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
115 115 4V5X C4 1    ? 71   ? 4V5X 1    ? 71   ? 1    71   
116 116 4V5X C5 1    ? 62   ? 4V5X 1    ? 62   ? 1    62   
117 117 4V5X C6 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
118 118 4V5X C7 1    ? 52   ? 4V5X 1    ? 52   ? 1    52   
119 119 4V5X C8 1    ? 44   ? 4V5X 1    ? 44   ? 1    44   
120 120 4V5X CB 1    ? 54   ? 4V5X 1    ? 54   ? 1    54   
121 121 4V5X CC 1    ? 47   ? 4V5X 1    ? 47   ? 1    47   
122 122 4V5X CD 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
123 123 4V5X CE 1    ? 40   ? 4V5X 1    ? 40   ? 1    40   
124 124 4V5X CF 1    ? 40   ? 4V5X 1    ? 40   ? 1    40   
125 125 4V5X CG 1    ? 44   ? 4V5X 1    ? 44   ? 1    44   
126 126 4V5X CH 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
127 127 4V5X CI 1    ? 44   ? 4V5X 1    ? 44   ? 1    44   
128 128 4V5X CJ 1    ? 59   ? 4V5X 1    ? 59   ? 1    59   
129 129 4V5X CK 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
130 130 4V5X CL 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
131 131 4V5X CM 1    ? 54   ? 4V5X 1    ? 54   ? 1    54   
132 132 4V5X CN 1    ? 41   ? 4V5X 1    ? 41   ? 1    41   
133 133 4V5X CO 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
134 134 4V5X CP 1    ? 56   ? 4V5X 1    ? 56   ? 1    56   
135 135 4V5X CQ 1    ? 38   ? 4V5X 1    ? 38   ? 1    38   
136 136 4V5X CR 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
137 137 4V5X CS 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
138 138 4V5X CT 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
139 139 4V5X CU 1    ? 32   ? 4V5X 1    ? 32   ? 1    32   
140 140 4V5X CV 1    ? 53   ? 4V5X 1    ? 53   ? 1    53   
141 141 4V5X CW 1    ? 38   ? 4V5X -9   ? 38   ? -9   38   
142 142 4V5X CX 1    ? 47   ? 4V5X 1    ? 47   ? 1    47   
143 143 4V5X CY 1    ? 43   ? 4V5X 1    ? 43   ? 1    43   
144 144 4V5X CZ 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
145 145 4V5X Cb 1    ? 44   ? 4V5X 1    ? 44   ? 1    44   
146 146 4V5X Cc 1    ? 62   ? 4V5X 1    ? 62   ? 1    62   
147 147 4V5X Cd 1    ? 42   ? 4V5X 1    ? 42   ? 1    42   
148 148 4V5X Ce 1    ? 52   ? 4V5X 1    ? 52   ? 1    52   
149 149 4V5X Cf 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
150 150 4V5X Cg 1    ? 46   ? 4V5X 1    ? 46   ? 1    46   
151 151 4V5X Ch 1    ? 47   ? 4V5X 1    ? 47   ? 1    47   
152 152 4V5X Ck 1    ? 29   ? 4V5X 1    ? 39   ? 1    39   
153 153 4V5X Cp 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
154 154 4V5X Cq 1    ? 40   ? 4V5X 1    ? 40   ? 1    40   
155 155 4V5X Cr 1    ? 46   ? 4V5X 1    ? 46   ? 1    46   
156 156 4V5X Cs 1    ? 49   ? 4V5X 1    ? 49   ? 1    49   
157 157 4V5X Ct 1    ? 44   ? 4V5X 1    ? 44   ? 1    44   
158 158 4V5X Cu 1    ? 60   ? 4V5X 1    ? 60   ? 1    60   
159 159 4V5X Cv 1    ? 46   ? 4V5X 1    ? 46   ? 1    46   
160 160 4V5X Cw 1    ? 54   ? 4V5X 1    ? 54   ? 1    54   
161 161 4V5X Cx 1    ? 46   ? 4V5X 1    ? 46   ? 1    46   
162 162 4V5X Cy 1    ? 66   ? 4V5X 1    ? 66   ? 1    66   
163 163 4V5X Cz 1    ? 48   ? 4V5X 1    ? 48   ? 1    48   
# 
loop_
_chem_comp.id 
_chem_comp.type 
_chem_comp.mon_nstd_flag 
_chem_comp.name 
_chem_comp.pdbx_synonyms 
_chem_comp.formula 
_chem_comp.formula_weight 
DA 'DNA linking' y "2'-DEOXYADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O6 P' 331.222 
DC 'DNA linking' y "2'-DEOXYCYTIDINE-5'-MONOPHOSPHATE"  ? 'C9 H14 N3 O7 P'  307.197 
DG 'DNA linking' y "2'-DEOXYGUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 
DT 'DNA linking' y "THYMIDINE-5'-MONOPHOSPHATE"         ? 'C10 H15 N2 O8 P' 322.208 
# 
_exptl.entry_id          4V5X 
_exptl.method            'ELECTRON MICROSCOPY' 
_exptl.crystals_number   ? 
# 
_exptl_crystal.id                    1 
_exptl_crystal.density_meas          ? 
_exptl_crystal.density_Matthews      ? 
_exptl_crystal.density_percent_sol   ? 
_exptl_crystal.description           ? 
# 
_diffrn.id                     1 
_diffrn.ambient_temp           ? 
_diffrn.ambient_temp_details   ? 
_diffrn.crystal_id             1 
# 
_diffrn_radiation.diffrn_id                        1 
_diffrn_radiation.wavelength_id                    1 
_diffrn_radiation.pdbx_monochromatic_or_laue_m_l   ? 
_diffrn_radiation.monochromator                    ? 
_diffrn_radiation.pdbx_diffrn_protocol             ? 
_diffrn_radiation.pdbx_scattering_type             ? 
# 
_diffrn_radiation_wavelength.id           1 
_diffrn_radiation_wavelength.wavelength   . 
_diffrn_radiation_wavelength.wt           1.0 
# 
_refine.pdbx_refine_id                           'ELECTRON MICROSCOPY' 
_refine.entry_id                                 4V5X 
_refine.pdbx_diffrn_id                           1 
_refine.pdbx_TLS_residual_ADP_flag               ? 
_refine.ls_number_reflns_obs                     ? 
_refine.ls_number_reflns_all                     ? 
_refine.pdbx_ls_sigma_I                          ? 
_refine.pdbx_ls_sigma_F                          ? 
_refine.pdbx_data_cutoff_high_absF               ? 
_refine.pdbx_data_cutoff_low_absF                ? 
_refine.pdbx_data_cutoff_high_rms_absF           ? 
_refine.ls_d_res_low                             ? 
_refine.ls_d_res_high                            11.50 
_refine.ls_percent_reflns_obs                    ? 
_refine.ls_R_factor_obs                          ? 
_refine.ls_R_factor_all                          ? 
_refine.ls_R_factor_R_work                       ? 
_refine.ls_R_factor_R_free                       ? 
_refine.ls_R_factor_R_free_error                 ? 
_refine.ls_R_factor_R_free_error_details         ? 
_refine.ls_percent_reflns_R_free                 ? 
_refine.ls_number_reflns_R_free                  ? 
_refine.ls_number_parameters                     ? 
_refine.ls_number_restraints                     ? 
_refine.occupancy_min                            ? 
_refine.occupancy_max                            ? 
_refine.correlation_coeff_Fo_to_Fc               ? 
_refine.correlation_coeff_Fo_to_Fc_free          ? 
_refine.B_iso_mean                               ? 
_refine.aniso_B[1][1]                            ? 
_refine.aniso_B[2][2]                            ? 
_refine.aniso_B[3][3]                            ? 
_refine.aniso_B[1][2]                            ? 
_refine.aniso_B[1][3]                            ? 
_refine.aniso_B[2][3]                            ? 
_refine.solvent_model_details                    ? 
_refine.solvent_model_param_ksol                 ? 
_refine.solvent_model_param_bsol                 ? 
_refine.pdbx_solvent_vdw_probe_radii             ? 
_refine.pdbx_solvent_ion_probe_radii             ? 
_refine.pdbx_solvent_shrinkage_radii             ? 
_refine.pdbx_ls_cross_valid_method               ? 
_refine.details                                  ? 
_refine.pdbx_starting_model                      ? 
_refine.pdbx_method_to_determine_struct          ? 
_refine.pdbx_isotropic_thermal_model             ? 
_refine.pdbx_stereochemistry_target_values       ? 
_refine.pdbx_stereochem_target_val_spec_case     ? 
_refine.pdbx_R_Free_selection_details            ? 
_refine.pdbx_overall_ESU_R                       ? 
_refine.pdbx_overall_ESU_R_Free                  ? 
_refine.overall_SU_ML                            ? 
_refine.pdbx_overall_phase_error                 ? 
_refine.overall_SU_B                             ? 
_refine.overall_SU_R_Cruickshank_DPI             ? 
_refine.pdbx_overall_SU_R_free_Cruickshank_DPI   ? 
_refine.pdbx_overall_SU_R_Blow_DPI               ? 
_refine.pdbx_overall_SU_R_free_Blow_DPI          ? 
# 
_refine_hist.pdbx_refine_id                   'ELECTRON MICROSCOPY' 
_refine_hist.cycle_id                         LAST 
_refine_hist.pdbx_number_atoms_protein        0 
_refine_hist.pdbx_number_atoms_nucleic_acid   99989 
_refine_hist.pdbx_number_atoms_ligand         0 
_refine_hist.number_atoms_solvent             0 
_refine_hist.number_atoms_total               99989 
_refine_hist.d_res_high                       11.50 
_refine_hist.d_res_low                        . 
# 
_struct.entry_id                  4V5X 
_struct.title                     'The cryo-EM structure of a 3D DNA-origami object' 
_struct.pdbx_descriptor           'DNA-origami object' 
_struct.pdbx_model_details        ? 
_struct.pdbx_CASP_flag            ? 
_struct.pdbx_model_type_details   ? 
# 
_struct_keywords.entry_id        4V5X 
_struct_keywords.pdbx_keywords   DNA 
_struct_keywords.text            'DNA, DNA-TEMPLATED DESIGN, SYNTHETIC BIOLOGY' 
# 
loop_
_struct_asym.id 
_struct_asym.pdbx_blank_PDB_chainid_flag 
_struct_asym.pdbx_modified 
_struct_asym.entity_id 
_struct_asym.details 
A  N N 1   ? 
B  N N 2   ? 
C  N N 3   ? 
D  N N 4   ? 
E  N N 5   ? 
F  N N 6   ? 
G  N N 7   ? 
H  N N 8   ? 
I  N N 9   ? 
J  N N 10  ? 
K  N N 11  ? 
L  N N 12  ? 
M  N N 13  ? 
N  N N 14  ? 
O  N N 15  ? 
P  N N 16  ? 
Q  N N 17  ? 
R  N N 18  ? 
S  N N 19  ? 
T  N N 20  ? 
U  N N 21  ? 
V  N N 22  ? 
W  N N 23  ? 
X  N N 24  ? 
Y  N N 25  ? 
Z  N N 26  ? 
AA N N 27  ? 
BA N N 28  ? 
CA N N 29  ? 
DA N N 30  ? 
EA N N 31  ? 
FA N N 32  ? 
GA N N 33  ? 
HA N N 34  ? 
IA N N 35  ? 
JA N N 36  ? 
KA N N 37  ? 
LA N N 38  ? 
MA N N 39  ? 
NA N N 40  ? 
OA N N 41  ? 
PA N N 42  ? 
QA N N 43  ? 
RA N N 44  ? 
SA N N 45  ? 
TA N N 46  ? 
UA N N 47  ? 
VA N N 48  ? 
WA N N 49  ? 
XA N N 50  ? 
YA N N 51  ? 
ZA N N 52  ? 
AB N N 53  ? 
BB N N 54  ? 
CB N N 55  ? 
DB N N 56  ? 
EB N N 57  ? 
FB N N 58  ? 
GB N N 59  ? 
HB N N 60  ? 
IB N N 61  ? 
JB N N 62  ? 
KB N N 63  ? 
LB N N 64  ? 
MB N N 65  ? 
NB N N 66  ? 
OB N N 67  ? 
PB N N 68  ? 
QB N N 69  ? 
RB N N 70  ? 
SB N N 71  ? 
TB N N 72  ? 
UB N N 73  ? 
VB N N 74  ? 
WB N N 75  ? 
XB N N 76  ? 
YB N N 77  ? 
ZB N N 78  ? 
AC N N 79  ? 
BC N N 80  ? 
CC N N 81  ? 
DC N N 82  ? 
EC N N 83  ? 
FC N N 84  ? 
GC N N 85  ? 
HC N N 86  ? 
IC N N 87  ? 
JC N N 88  ? 
KC N N 89  ? 
LC N N 90  ? 
MC N N 91  ? 
NC N N 92  ? 
OC N N 93  ? 
PC N N 94  ? 
QC N N 95  ? 
RC N N 96  ? 
SC N N 97  ? 
TC N N 98  ? 
UC N N 99  ? 
VC N N 100 ? 
WC N N 101 ? 
XC N N 102 ? 
YC N N 103 ? 
ZC N N 104 ? 
AD N N 105 ? 
BD N N 106 ? 
CD N N 107 ? 
DD N N 108 ? 
ED N N 109 ? 
FD N N 110 ? 
GD N N 111 ? 
HD N N 112 ? 
ID N N 113 ? 
JD N N 114 ? 
KD N N 115 ? 
LD N N 116 ? 
MD N N 117 ? 
ND N N 118 ? 
OD N N 119 ? 
PD N N 120 ? 
QD N N 121 ? 
RD N N 122 ? 
SD N N 123 ? 
TD N N 124 ? 
UD N N 125 ? 
VD N N 126 ? 
WD N N 127 ? 
XD N N 128 ? 
YD N N 129 ? 
ZD N N 130 ? 
AE N N 131 ? 
BE N N 132 ? 
CE N N 133 ? 
DE N N 134 ? 
EE N N 135 ? 
FE N N 136 ? 
GE N N 137 ? 
HE N N 138 ? 
IE N N 139 ? 
JE N N 140 ? 
KE N N 141 ? 
LE N N 142 ? 
ME N N 143 ? 
NE N N 144 ? 
OE N N 145 ? 
PE N N 146 ? 
QE N N 147 ? 
RE N N 148 ? 
SE N N 149 ? 
TE N N 150 ? 
UE N N 151 ? 
VE N N 152 ? 
WE N N 153 ? 
XE N N 154 ? 
YE N N 155 ? 
ZE N N 156 ? 
AF N N 157 ? 
BF N N 158 ? 
CF N N 159 ? 
DF N N 160 ? 
EF N N 161 ? 
FF N N 162 ? 
# 
_struct_biol.id   1 
# 
loop_
_struct_conn.id 
_struct_conn.conn_type_id 
_struct_conn.pdbx_leaving_atom_flag 
_struct_conn.pdbx_PDB_id 
_struct_conn.ptnr1_label_asym_id 
_struct_conn.ptnr1_label_comp_id 
_struct_conn.ptnr1_label_seq_id 
_struct_conn.ptnr1_label_atom_id 
_struct_conn.pdbx_ptnr1_label_alt_id 
_struct_conn.pdbx_ptnr1_PDB_ins_code 
_struct_conn.pdbx_ptnr1_standard_comp_id 
_struct_conn.ptnr1_symmetry 
_struct_conn.ptnr2_label_asym_id 
_struct_conn.ptnr2_label_comp_id 
_struct_conn.ptnr2_label_seq_id 
_struct_conn.ptnr2_label_atom_id 
_struct_conn.pdbx_ptnr2_label_alt_id 
_struct_conn.pdbx_ptnr2_PDB_ins_code 
_struct_conn.ptnr1_auth_asym_id 
_struct_conn.ptnr1_auth_comp_id 
_struct_conn.ptnr1_auth_seq_id 
_struct_conn.ptnr2_auth_asym_id 
_struct_conn.ptnr2_auth_comp_id 
_struct_conn.ptnr2_auth_seq_id 
_struct_conn.ptnr2_symmetry 
_struct_conn.pdbx_ptnr3_label_atom_id 
_struct_conn.pdbx_ptnr3_label_seq_id 
_struct_conn.pdbx_ptnr3_label_comp_id 
_struct_conn.pdbx_ptnr3_label_asym_id 
_struct_conn.pdbx_ptnr3_label_alt_id 
_struct_conn.pdbx_ptnr3_PDB_ins_code 
_struct_conn.details 
_struct_conn.pdbx_dist_value 
_struct_conn.pdbx_value_order 
hydrog1     hydrog ? ? A  DT 1    N3 ? ? ? 1_555 AD DA 38   N1 ? ? AA DT 1    Bo DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2     hydrog ? ? A  DT 1    O4 ? ? ? 1_555 AD DA 38   N6 ? ? AA DT 1    Bo DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3     hydrog ? ? A  DG 2    N1 ? ? ? 1_555 AD DC 37   N3 ? ? AA DG 2    Bo DC 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4     hydrog ? ? A  DG 2    N2 ? ? ? 1_555 AD DC 37   O2 ? ? AA DG 2    Bo DC 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog5     hydrog ? ? A  DG 2    O6 ? ? ? 1_555 AD DC 37   N4 ? ? AA DG 2    Bo DC 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog6     hydrog ? ? A  DA 3    N1 ? ? ? 1_555 AD DT 36   N3 ? ? AA DA 3    Bo DT 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog7     hydrog ? ? A  DA 3    N6 ? ? ? 1_555 AD DT 36   O4 ? ? AA DA 3    Bo DT 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog8     hydrog ? ? A  DT 4    N3 ? ? ? 1_555 AD DA 35   N1 ? ? AA DT 4    Bo DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog9     hydrog ? ? A  DT 4    O4 ? ? ? 1_555 AD DA 35   N6 ? ? AA DT 4    Bo DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog10    hydrog ? ? A  DA 5    N1 ? ? ? 1_555 AD DT 34   N3 ? ? AA DA 5    Bo DT 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog11    hydrog ? ? A  DA 5    N6 ? ? ? 1_555 AD DT 34   O4 ? ? AA DA 5    Bo DT 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog12    hydrog ? ? A  DG 6    N1 ? ? ? 1_555 AD DC 33   N3 ? ? AA DG 6    Bo DC 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog13    hydrog ? ? A  DG 6    N2 ? ? ? 1_555 AD DC 33   O2 ? ? AA DG 6    Bo DC 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog14    hydrog ? ? A  DG 6    O6 ? ? ? 1_555 AD DC 33   N4 ? ? AA DG 6    Bo DC 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog15    hydrog ? ? A  DA 7    N1 ? ? ? 1_555 AD DT 32   N3 ? ? AA DA 7    Bo DT 32   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog16    hydrog ? ? A  DC 8    N3 ? ? ? 1_555 AD DG 31   N1 ? ? AA DC 8    Bo DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog17    hydrog ? ? A  DC 8    N4 ? ? ? 1_555 AD DG 31   O6 ? ? AA DC 8    Bo DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog18    hydrog ? ? A  DC 8    O2 ? ? ? 1_555 AD DG 31   N2 ? ? AA DC 8    Bo DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog19    hydrog ? ? A  DG 9    N1 ? ? ? 1_555 XC DC 34   N3 ? ? AA DG 9    Bl DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog20    hydrog ? ? A  DG 9    N2 ? ? ? 1_555 XC DC 34   O2 ? ? AA DG 9    Bl DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog21    hydrog ? ? A  DG 9    O6 ? ? ? 1_555 XC DC 34   N4 ? ? AA DG 9    Bl DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog22    hydrog ? ? A  DG 10   N1 ? ? ? 1_555 XC DC 33   N3 ? ? AA DG 10   Bl DC 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog23    hydrog ? ? A  DG 10   N2 ? ? ? 1_555 XC DC 33   O2 ? ? AA DG 10   Bl DC 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog24    hydrog ? ? A  DG 10   O6 ? ? ? 1_555 XC DC 33   N4 ? ? AA DG 10   Bl DC 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog25    hydrog ? ? A  DT 11   N3 ? ? ? 1_555 XC DA 32   N1 ? ? AA DT 11   Bl DA 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog26    hydrog ? ? A  DT 11   O4 ? ? ? 1_555 XC DA 32   N6 ? ? AA DT 11   Bl DA 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog27    hydrog ? ? A  DT 12   N3 ? ? ? 1_555 XC DA 31   N1 ? ? AA DT 12   Bl DA 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog28    hydrog ? ? A  DT 12   O4 ? ? ? 1_555 XC DA 31   N6 ? ? AA DT 12   Bl DA 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog29    hydrog ? ? A  DT 13   N3 ? ? ? 1_555 XC DA 30   N1 ? ? AA DT 13   Bl DA 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog30    hydrog ? ? A  DT 13   O4 ? ? ? 1_555 XC DA 30   N6 ? ? AA DT 13   Bl DA 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog31    hydrog ? ? A  DT 14   N3 ? ? ? 1_555 XC DA 29   N1 ? ? AA DT 14   Bl DA 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog32    hydrog ? ? A  DT 14   O4 ? ? ? 1_555 XC DA 29   N6 ? ? AA DT 14   Bl DA 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog33    hydrog ? ? A  DT 15   N3 ? ? ? 1_555 XC DA 28   N1 ? ? AA DT 15   Bl DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog34    hydrog ? ? A  DT 15   O4 ? ? ? 1_555 XC DA 28   N6 ? ? AA DT 15   Bl DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog35    hydrog ? ? A  DC 16   N3 ? ? ? 1_555 XC DG 27   N1 ? ? AA DC 16   Bl DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog36    hydrog ? ? A  DC 16   N4 ? ? ? 1_555 XC DG 27   O6 ? ? AA DC 16   Bl DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog37    hydrog ? ? A  DC 16   O2 ? ? ? 1_555 XC DG 27   N2 ? ? AA DC 16   Bl DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog38    hydrog ? ? A  DC 18   N3 ? ? ? 1_555 OC DG 7    N1 ? ? AA DC 18   Bc DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog39    hydrog ? ? A  DC 18   N4 ? ? ? 1_555 OC DG 7    O6 ? ? AA DC 18   Bc DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog40    hydrog ? ? A  DC 18   O2 ? ? ? 1_555 OC DG 7    N2 ? ? AA DC 18   Bc DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog41    hydrog ? ? A  DC 19   N3 ? ? ? 1_555 OC DG 6    N1 ? ? AA DC 19   Bc DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog42    hydrog ? ? A  DC 19   N4 ? ? ? 1_555 OC DG 6    O6 ? ? AA DC 19   Bc DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog43    hydrog ? ? A  DC 19   O2 ? ? ? 1_555 OC DG 6    N2 ? ? AA DC 19   Bc DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog44    hydrog ? ? A  DC 20   N3 ? ? ? 1_555 OC DG 5    N1 ? ? AA DC 20   Bc DG 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog45    hydrog ? ? A  DC 20   N4 ? ? ? 1_555 OC DG 5    O6 ? ? AA DC 20   Bc DG 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog46    hydrog ? ? A  DC 20   O2 ? ? ? 1_555 OC DG 5    N2 ? ? AA DC 20   Bc DG 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog47    hydrog ? ? A  DT 21   N3 ? ? ? 1_555 OC DA 4    N1 ? ? AA DT 21   Bc DA 4    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog48    hydrog ? ? A  DT 22   N3 ? ? ? 1_555 OC DA 3    N1 ? ? AA DT 22   Bc DA 3    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog49    hydrog ? ? A  DT 23   N3 ? ? ? 1_555 OC DA 2    N1 ? ? AA DT 23   Bc DA 2    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog50    hydrog ? ? A  DG 24   N1 ? ? ? 1_555 OC DC 1    N3 ? ? AA DG 24   Bc DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog51    hydrog ? ? A  DG 24   N2 ? ? ? 1_555 OC DC 1    O2 ? ? AA DG 24   Bc DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog52    hydrog ? ? A  DG 24   O6 ? ? ? 1_555 OC DC 1    N4 ? ? AA DG 24   Bc DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog53    hydrog ? ? A  DA 25   N1 ? ? ? 1_555 NC DT 68   N3 ? ? AA DA 25   Bb DT 68   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog54    hydrog ? ? A  DA 25   N6 ? ? ? 1_555 NC DT 68   O4 ? ? AA DA 25   Bb DT 68   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog55    hydrog ? ? A  DC 26   N3 ? ? ? 1_555 NC DG 67   N1 ? ? AA DC 26   Bb DG 67   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog56    hydrog ? ? A  DC 26   N4 ? ? ? 1_555 NC DG 67   O6 ? ? AA DC 26   Bb DG 67   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog57    hydrog ? ? A  DC 26   O2 ? ? ? 1_555 NC DG 67   N2 ? ? AA DC 26   Bb DG 67   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog58    hydrog ? ? A  DG 27   N1 ? ? ? 1_555 NC DC 66   N3 ? ? AA DG 27   Bb DC 66   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog59    hydrog ? ? A  DG 27   N2 ? ? ? 1_555 NC DC 66   O2 ? ? AA DG 27   Bb DC 66   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog60    hydrog ? ? A  DG 27   O6 ? ? ? 1_555 NC DC 66   N4 ? ? AA DG 27   Bb DC 66   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog61    hydrog ? ? A  DT 28   N3 ? ? ? 1_555 NC DA 65   N1 ? ? AA DT 28   Bb DA 65   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog62    hydrog ? ? A  DT 29   N3 ? ? ? 1_555 NC DA 64   N1 ? ? AA DT 29   Bb DA 64   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog63    hydrog ? ? A  DG 30   N1 ? ? ? 1_555 NC DC 63   N3 ? ? AA DG 30   Bb DC 63   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog64    hydrog ? ? A  DG 30   N2 ? ? ? 1_555 NC DC 63   O2 ? ? AA DG 30   Bb DC 63   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog65    hydrog ? ? A  DG 30   O6 ? ? ? 1_555 NC DC 63   N4 ? ? AA DG 30   Bb DC 63   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog66    hydrog ? ? A  DG 31   N1 ? ? ? 1_555 NC DC 62   N3 ? ? AA DG 31   Bb DC 62   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog67    hydrog ? ? A  DG 31   N2 ? ? ? 1_555 NC DC 62   O2 ? ? AA DG 31   Bb DC 62   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog68    hydrog ? ? A  DG 31   O6 ? ? ? 1_555 NC DC 62   N4 ? ? AA DG 31   Bb DC 62   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog69    hydrog ? ? A  DA 32   N1 ? ? ? 1_555 NC DT 61   N3 ? ? AA DA 32   Bb DT 61   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog70    hydrog ? ? A  DA 32   N6 ? ? ? 1_555 NC DT 61   O4 ? ? AA DA 32   Bb DT 61   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog71    hydrog ? ? A  DG 33   N1 ? ? ? 1_555 NC DC 60   N3 ? ? AA DG 33   Bb DC 60   1_555 ? ? ? ? ? ? 'DG-DC PAIR'            
? ? 
hydrog72    hydrog ? ? A  DC 35   N3 ? ? ? 1_555 NC DG 58   N2 ? ? AA DC 35   Bb DG 58   1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' 
? ? 
hydrog73    hydrog ? ? A  DC 35   O2 ? ? ? 1_555 NC DG 58   N1 ? ? AA DC 35   Bb DG 58   1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' 
? ? 
hydrog74    hydrog ? ? A  DC 36   N3 ? ? ? 1_555 NC DG 47   N1 ? ? AA DC 36   Bb DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog75    hydrog ? ? A  DC 36   N4 ? ? ? 1_555 NC DG 47   O6 ? ? AA DC 36   Bb DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog76    hydrog ? ? A  DC 36   O2 ? ? ? 1_555 NC DG 47   N2 ? ? AA DC 36   Bb DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog77    hydrog ? ? A  DA 37   N1 ? ? ? 1_555 NC DT 46   N3 ? ? AA DA 37   Bb DT 46   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog78    hydrog ? ? A  DC 38   N3 ? ? ? 1_555 NC DG 45   N1 ? ? AA DC 38   Bb DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog79    hydrog ? ? A  DC 38   N4 ? ? ? 1_555 NC DG 45   O6 ? ? AA DC 38   Bb DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog80    hydrog ? ? A  DC 38   O2 ? ? ? 1_555 NC DG 45   N2 ? ? AA DC 38   Bb DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog81    hydrog ? ? A  DG 39   N1 ? ? ? 1_555 CD DC 56   N3 ? ? AA DG 39   Bq DC 56   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog82    hydrog ? ? A  DG 39   N2 ? ? ? 1_555 CD DC 56   O2 ? ? AA DG 39   Bq DC 56   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog83    hydrog ? ? A  DG 39   O6 ? ? ? 1_555 CD DC 56   N4 ? ? AA DG 39   Bq DC 56   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog84    hydrog ? ? A  DT 40   N3 ? ? ? 1_555 CD DA 55   N1 ? ? AA DT 40   Bq DA 55   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog85    hydrog ? ? A  DT 40   O4 ? ? ? 1_555 CD DA 55   N6 ? ? AA DT 40   Bq DA 55   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog86    hydrog ? ? A  DT 41   N3 ? ? ? 1_555 CD DA 54   N1 ? ? AA DT 41   Bq DA 54   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog87    hydrog ? ? A  DT 41   O4 ? ? ? 1_555 CD DA 54   N6 ? ? AA DT 41   Bq DA 54   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog88    hydrog ? ? A  DC 42   N3 ? ? ? 1_555 CD DG 53   N1 ? ? AA DC 42   Bq DG 53   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog89    hydrog ? ? A  DC 42   N4 ? ? ? 1_555 CD DG 53   O6 ? ? AA DC 42   Bq DG 53   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog90    hydrog ? ? A  DC 42   O2 ? ? ? 1_555 CD DG 53   N2 ? ? AA DC 42   Bq DG 53   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog91    hydrog ? ? A  DT 43   N3 ? ? ? 1_555 CD DA 52   N1 ? ? AA DT 43   Bq DA 52   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog92    hydrog ? ? A  DT 43   O4 ? ? ? 1_555 CD DA 52   N6 ? ? AA DT 43   Bq DA 52   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog93    hydrog ? ? A  DT 44   N3 ? ? ? 1_555 CD DA 51   N1 ? ? AA DT 44   Bq DA 51   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog94    hydrog ? ? A  DT 44   O4 ? ? ? 1_555 CD DA 51   N6 ? ? AA DT 44   Bq DA 51   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog95    hydrog ? ? A  DT 45   N3 ? ? ? 1_555 CD DA 50   N1 ? ? AA DT 45   Bq DA 50   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog96    hydrog ? ? A  DA 46   N1 ? ? ? 1_555 CD DT 49   N3 ? ? AA DA 46   Bq DT 49   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog97    hydrog ? ? A  DA 46   N6 ? ? ? 1_555 CD DT 49   O4 ? ? AA DA 46   Bq DT 49   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog98    hydrog ? ? A  DA 47   N1 ? ? ? 1_555 RC DT 2    N3 ? ? AA DA 47   Bf DT 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog99    hydrog ? ? A  DA 47   N6 ? ? ? 1_555 RC DT 2    O4 ? ? AA DA 47   Bf DT 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog100   hydrog ? ? A  DT 48   N3 ? ? ? 1_555 RC DA 1    N1 ? ? AA DT 48   Bf DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog101   hydrog ? ? A  DT 48   O4 ? ? ? 1_555 RC DA 1    N6 ? ? AA DT 48   Bf DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog102   hydrog ? ? A  DA 49   N1 ? ? ? 1_555 XC DT 48   N3 ? ? AA DA 49   Bl DT 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog103   hydrog ? ? A  DA 49   N6 ? ? ? 1_555 XC DT 48   O4 ? ? AA DA 49   Bl DT 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog104   hydrog ? ? A  DG 50   N1 ? ? ? 1_555 XC DC 47   N3 ? ? AA DG 50   Bl DC 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog105   hydrog ? ? A  DG 50   N2 ? ? ? 1_555 XC DC 47   O2 ? ? AA DG 50   Bl DC 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog106   hydrog ? ? A  DG 50   O6 ? ? ? 1_555 XC DC 47   N4 ? ? AA DG 50   Bl DC 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog107   hydrog ? ? A  DT 51   N3 ? ? ? 1_555 XC DA 46   N1 ? ? AA DT 51   Bl DA 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog108   hydrog ? ? A  DT 51   O4 ? ? ? 1_555 XC DA 46   N6 ? ? AA DT 51   Bl DA 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog109   hydrog ? ? A  DG 52   N1 ? ? ? 1_555 XC DC 45   N3 ? ? AA DG 52   Bl DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog110   hydrog ? ? A  DG 52   N2 ? ? ? 1_555 XC DC 45   O2 ? ? AA DG 52   Bl DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog111   hydrog ? ? A  DG 52   O6 ? ? ? 1_555 XC DC 45   N4 ? ? AA DG 52   Bl DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog112   hydrog ? ? A  DG 53   N1 ? ? ? 1_555 XC DC 44   N3 ? ? AA DG 53   Bl DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog113   hydrog ? ? A  DG 53   N2 ? ? ? 1_555 XC DC 44   O2 ? ? AA DG 53   Bl DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog114   hydrog ? ? A  DG 53   O6 ? ? ? 1_555 XC DC 44   N4 ? ? AA DG 53   Bl DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog115   hydrog ? ? A  DA 54   N1 ? ? ? 1_555 XC DT 43   N3 ? ? AA DA 54   Bl DT 43   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog116   hydrog ? ? A  DC 55   N3 ? ? ? 1_555 XC DG 42   N1 ? ? AA DC 55   Bl DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog117   hydrog ? ? A  DC 55   N4 ? ? ? 1_555 XC DG 42   O6 ? ? AA DC 55   Bl DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog118   hydrog ? ? A  DC 55   O2 ? ? ? 1_555 XC DG 42   N2 ? ? AA DC 55   Bl DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog119   hydrog ? ? A  DT 56   N3 ? ? ? 1_555 XC DA 41   N1 ? ? AA DT 56   Bl DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog120   hydrog ? ? A  DT 56   O4 ? ? ? 1_555 XC DA 41   N6 ? ? AA DT 56   Bl DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog121   hydrog ? ? A  DC 57   N3 ? ? ? 1_555 XC DG 40   N1 ? ? AA DC 57   Bl DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog122   hydrog ? ? A  DC 57   N4 ? ? ? 1_555 XC DG 40   O6 ? ? AA DC 57   Bl DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog123   hydrog ? ? A  DC 57   O2 ? ? ? 1_555 XC DG 40   N2 ? ? AA DC 57   Bl DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog124   hydrog ? ? A  DT 58   N3 ? ? ? 1_555 XC DA 39   N1 ? ? AA DT 58   Bl DA 39   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog125   hydrog ? ? A  DT 59   N3 ? ? ? 1_555 XC DA 38   N1 ? ? AA DT 59   Bl DA 38   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog126   hydrog ? ? A  DG 60   N1 ? ? ? 1_555 XC DC 37   N3 ? ? AA DG 60   Bl DC 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog127   hydrog ? ? A  DG 60   N2 ? ? ? 1_555 XC DC 37   O2 ? ? AA DG 60   Bl DC 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog128   hydrog ? ? A  DG 60   O6 ? ? ? 1_555 XC DC 37   N4 ? ? AA DG 60   Bl DC 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog129   hydrog ? ? A  DT 61   N3 ? ? ? 1_555 XC DA 36   N1 ? ? AA DT 61   Bl DA 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog130   hydrog ? ? A  DT 61   O4 ? ? ? 1_555 XC DA 36   N6 ? ? AA DT 61   Bl DA 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog131   hydrog ? ? A  DT 62   N3 ? ? ? 1_555 XC DA 35   N1 ? ? AA DT 62   Bl DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog132   hydrog ? ? A  DT 62   O4 ? ? ? 1_555 XC DA 35   N6 ? ? AA DT 62   Bl DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog133   hydrog ? ? A  DC 63   N3 ? ? ? 1_555 YC DG 34   N1 ? ? AA DC 63   Bm DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog134   hydrog ? ? A  DC 63   N4 ? ? ? 1_555 YC DG 34   O6 ? ? AA DC 63   Bm DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog135   hydrog ? ? A  DC 63   O2 ? ? ? 1_555 YC DG 34   N2 ? ? AA DC 63   Bm DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog136   hydrog ? ? A  DC 64   N3 ? ? ? 1_555 YC DG 33   N1 ? ? AA DC 64   Bm DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog137   hydrog ? ? A  DC 64   N4 ? ? ? 1_555 YC DG 33   O6 ? ? AA DC 64   Bm DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog138   hydrog ? ? A  DC 64   O2 ? ? ? 1_555 YC DG 33   N2 ? ? AA DC 64   Bm DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog139   hydrog ? ? A  DA 65   N1 ? ? ? 1_555 YC DT 32   N3 ? ? AA DA 65   Bm DT 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog140   hydrog ? ? A  DA 65   N6 ? ? ? 1_555 YC DT 32   O4 ? ? AA DA 65   Bm DT 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog141   hydrog ? ? A  DA 66   N1 ? ? ? 1_555 YC DT 31   N3 ? ? AA DA 66   Bm DT 31   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog142   hydrog ? ? A  DA 67   N1 ? ? ? 1_555 YC DT 30   N3 ? ? AA DA 67   Bm DT 30   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog143   hydrog ? ? A  DC 68   N3 ? ? ? 1_555 YC DG 29   N1 ? ? AA DC 68   Bm DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog144   hydrog ? ? A  DC 68   N4 ? ? ? 1_555 YC DG 29   O6 ? ? AA DC 68   Bm DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog145   hydrog ? ? A  DC 68   O2 ? ? ? 1_555 YC DG 29   N2 ? ? AA DC 68   Bm DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog146   hydrog ? ? A  DT 69   N3 ? ? ? 1_555 YC DA 28   N1 ? ? AA DT 69   Bm DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog147   hydrog ? ? A  DT 69   O4 ? ? ? 1_555 YC DA 28   N6 ? ? AA DT 69   Bm DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog148   hydrog ? ? A  DG 70   N1 ? ? ? 1_555 YC DC 27   N3 ? ? AA DG 70   Bm DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog149   hydrog ? ? A  DG 70   N2 ? ? ? 1_555 YC DC 27   O2 ? ? AA DG 70   Bm DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog150   hydrog ? ? A  DG 70   O6 ? ? ? 1_555 YC DC 27   N4 ? ? AA DG 70   Bm DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog151   hydrog ? ? A  DG 71   N1 ? ? ? 1_555 RC DC 10   N3 ? ? AA DG 71   Bf DC 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog152   hydrog ? ? A  DG 71   N2 ? ? ? 1_555 RC DC 10   O2 ? ? AA DG 71   Bf DC 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog153   hydrog ? ? A  DG 71   O6 ? ? ? 1_555 RC DC 10   N4 ? ? AA DG 71   Bf DC 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog154   hydrog ? ? A  DA 72   N1 ? ? ? 1_555 RC DT 9    N3 ? ? AA DA 72   Bf DT 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog155   hydrog ? ? A  DA 72   N6 ? ? ? 1_555 RC DT 9    O4 ? ? AA DA 72   Bf DT 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog156   hydrog ? ? A  DA 73   N1 ? ? ? 1_555 RC DT 8    N3 ? ? AA DA 73   Bf DT 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog157   hydrog ? ? A  DA 73   N6 ? ? ? 1_555 RC DT 8    O4 ? ? AA DA 73   Bf DT 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog158   hydrog ? ? A  DC 74   N3 ? ? ? 1_555 RC DG 7    N1 ? ? AA DC 74   Bf DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog159   hydrog ? ? A  DC 74   N4 ? ? ? 1_555 RC DG 7    O6 ? ? AA DC 74   Bf DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog160   hydrog ? ? A  DC 74   O2 ? ? ? 1_555 RC DG 7    N2 ? ? AA DC 74   Bf DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog161   hydrog ? ? A  DA 75   N1 ? ? ? 1_555 RC DT 6    N3 ? ? AA DA 75   Bf DT 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog162   hydrog ? ? A  DA 75   N6 ? ? ? 1_555 RC DT 6    O4 ? ? AA DA 75   Bf DT 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog163   hydrog ? ? A  DA 76   N1 ? ? ? 1_555 RC DT 5    N3 ? ? AA DA 76   Bf DT 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog164   hydrog ? ? A  DA 76   N6 ? ? ? 1_555 RC DT 5    O4 ? ? AA DA 76   Bf DT 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog165   hydrog ? ? A  DC 77   N3 ? ? ? 1_555 RC DG 4    N1 ? ? AA DC 77   Bf DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog166   hydrog ? ? A  DC 77   N4 ? ? ? 1_555 RC DG 4    O6 ? ? AA DC 77   Bf DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog167   hydrog ? ? A  DC 77   O2 ? ? ? 1_555 RC DG 4    N2 ? ? AA DC 77   Bf DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog168   hydrog ? ? A  DA 78   N1 ? ? ? 1_555 RC DT 3    N3 ? ? AA DA 78   Bf DT 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog169   hydrog ? ? A  DA 78   N6 ? ? ? 1_555 RC DT 3    O4 ? ? AA DA 78   Bf DT 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog170   hydrog ? ? A  DC 79   N3 ? ? ? 1_555 CD DG 48   N1 ? ? AA DC 79   Bq DG 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog171   hydrog ? ? A  DC 79   N4 ? ? ? 1_555 CD DG 48   O6 ? ? AA DC 79   Bq DG 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog172   hydrog ? ? A  DC 79   O2 ? ? ? 1_555 CD DG 48   N2 ? ? AA DC 79   Bq DG 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog173   hydrog ? ? A  DT 80   N3 ? ? ? 1_555 CD DA 47   N1 ? ? AA DT 80   Bq DA 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog174   hydrog ? ? A  DT 80   O4 ? ? ? 1_555 CD DA 47   N6 ? ? AA DT 80   Bq DA 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog175   hydrog ? ? A  DT 80   O2 ? ? ? 1_555 CD DG 48   N2 ? ? AA DT 80   Bq DG 48   1_555 ? ? ? ? ? ? 'DT-DG MISPAIR'         
? ? 
hydrog176   hydrog ? ? A  DC 81   N3 ? ? ? 1_555 CD DG 46   N1 ? ? AA DC 81   Bq DG 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog177   hydrog ? ? A  DC 81   N4 ? ? ? 1_555 CD DG 46   O6 ? ? AA DC 81   Bq DG 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog178   hydrog ? ? A  DC 81   O2 ? ? ? 1_555 CD DG 46   N2 ? ? AA DC 81   Bq DG 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog179   hydrog ? ? A  DA 82   N1 ? ? ? 1_555 CD DT 45   N3 ? ? AA DA 82   Bq DT 45   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog180   hydrog ? ? A  DA 83   N1 ? ? ? 1_555 CD DT 44   N3 ? ? AA DA 83   Bq DT 44   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog181   hydrog ? ? A  DC 84   N3 ? ? ? 1_555 CD DG 43   N1 ? ? AA DC 84   Bq DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog182   hydrog ? ? A  DC 84   N4 ? ? ? 1_555 CD DG 43   O6 ? ? AA DC 84   Bq DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog183   hydrog ? ? A  DC 84   O2 ? ? ? 1_555 CD DG 43   N2 ? ? AA DC 84   Bq DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog184   hydrog ? ? A  DC 85   N3 ? ? ? 1_555 CD DG 42   N1 ? ? AA DC 85   Bq DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog185   hydrog ? ? A  DC 85   N4 ? ? ? 1_555 CD DG 42   O6 ? ? AA DC 85   Bq DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog186   hydrog ? ? A  DC 85   O2 ? ? ? 1_555 CD DG 42   N2 ? ? AA DC 85   Bq DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog187   hydrog ? ? A  DC 86   N3 ? ? ? 1_555 CD DG 41   N1 ? ? AA DC 86   Bq DG 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog188   hydrog ? ? A  DC 86   N4 ? ? ? 1_555 CD DG 41   O6 ? ? AA DC 86   Bq DG 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog189   hydrog ? ? A  DC 86   O2 ? ? ? 1_555 CD DG 41   N2 ? ? AA DC 86   Bq DG 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog190   hydrog ? ? A  DT 87   N3 ? ? ? 1_555 CD DA 40   N1 ? ? AA DT 87   Bq DA 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog191   hydrog ? ? A  DT 87   O4 ? ? ? 1_555 CD DA 40   N6 ? ? AA DT 87   Bq DA 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog192   hydrog ? ? A  DA 88   N1 ? ? ? 1_555 CD DT 39   N3 ? ? AA DA 88   Bq DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog193   hydrog ? ? A  DA 88   N6 ? ? ? 1_555 CD DT 39   O4 ? ? AA DA 88   Bq DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog194   hydrog ? ? A  DT 89   N3 ? ? ? 1_555 CD DA 38   N1 ? ? AA DT 89   Bq DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog195   hydrog ? ? A  DT 89   O4 ? ? ? 1_555 CD DA 38   N6 ? ? AA DT 89   Bq DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog196   hydrog ? ? A  DC 90   N3 ? ? ? 1_555 CD DG 27   N1 ? ? AA DC 90   Bq DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog197   hydrog ? ? A  DC 90   N4 ? ? ? 1_555 CD DG 27   O6 ? ? AA DC 90   Bq DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog198   hydrog ? ? A  DC 90   O2 ? ? ? 1_555 CD DG 27   N2 ? ? AA DC 90   Bq DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog199   hydrog ? ? A  DT 91   N3 ? ? ? 1_555 CD DA 26   N1 ? ? AA DT 91   Bq DA 26   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog200   hydrog ? ? A  DC 92   N4 ? ? ? 1_555 CD DG 25   O6 ? ? AA DC 92   Bq DG 25   1_555 ? ? ? ? ? ? 'DC-DG PAIR'            
? ? 
hydrog201   hydrog ? ? A  DG 93   N1 ? ? ? 1_555 DD DC 45   N3 ? ? AA DG 93   Br DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog202   hydrog ? ? A  DG 93   N2 ? ? ? 1_555 DD DC 45   O2 ? ? AA DG 93   Br DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog203   hydrog ? ? A  DG 93   O6 ? ? ? 1_555 DD DC 45   N4 ? ? AA DG 93   Br DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog204   hydrog ? ? A  DG 94   N1 ? ? ? 1_555 DD DC 44   N3 ? ? AA DG 94   Br DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog205   hydrog ? ? A  DG 94   N2 ? ? ? 1_555 DD DC 44   O2 ? ? AA DG 94   Br DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog206   hydrog ? ? A  DG 94   O6 ? ? ? 1_555 DD DC 44   N4 ? ? AA DG 94   Br DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog207   hydrog ? ? A  DG 95   N1 ? ? ? 1_555 DD DC 43   N3 ? ? AA DG 95   Br DC 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog208   hydrog ? ? A  DG 95   N2 ? ? ? 1_555 DD DC 43   O2 ? ? AA DG 95   Br DC 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog209   hydrog ? ? A  DG 95   O6 ? ? ? 1_555 DD DC 43   N4 ? ? AA DG 95   Br DC 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog210   hydrog ? ? A  DC 96   N3 ? ? ? 1_555 DD DG 42   N1 ? ? AA DC 96   Br DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog211   hydrog ? ? A  DC 96   N4 ? ? ? 1_555 DD DG 42   O6 ? ? AA DC 96   Br DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog212   hydrog ? ? A  DC 96   O2 ? ? ? 1_555 DD DG 42   N2 ? ? AA DC 96   Br DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog213   hydrog ? ? A  DT 97   N3 ? ? ? 1_555 DD DA 41   N1 ? ? AA DT 97   Br DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog214   hydrog ? ? A  DT 97   O4 ? ? ? 1_555 DD DA 41   N6 ? ? AA DT 97   Br DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog215   hydrog ? ? A  DA 98   N1 ? ? ? 1_555 DD DT 40   N3 ? ? AA DA 98   Br DT 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog216   hydrog ? ? A  DA 98   N6 ? ? ? 1_555 DD DT 40   O4 ? ? AA DA 98   Br DT 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog217   hydrog ? ? A  DT 99   N3 ? ? ? 1_555 DD DA 39   N1 ? ? AA DT 99   Br DA 39   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog218   hydrog ? ? A  DT 100  N3 ? ? ? 1_555 DD DA 38   N1 ? ? AA DT 100  Br DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog219   hydrog ? ? A  DT 100  O4 ? ? ? 1_555 DD DA 38   N6 ? ? AA DT 100  Br DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog220   hydrog ? ? A  DC 101  N3 ? ? ? 1_555 VC DG 2    N1 ? ? AA DC 101  Bj DG 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog221   hydrog ? ? A  DC 101  N4 ? ? ? 1_555 VC DG 2    O6 ? ? AA DC 101  Bj DG 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog222   hydrog ? ? A  DC 101  O2 ? ? ? 1_555 VC DG 2    N2 ? ? AA DC 101  Bj DG 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog223   hydrog ? ? A  DT 102  N3 ? ? ? 1_555 VC DA 1    N1 ? ? AA DT 102  Bj DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog224   hydrog ? ? A  DT 102  O4 ? ? ? 1_555 VC DA 1    N6 ? ? AA DT 102  Bj DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog225   hydrog ? ? A  DT 103  N3 ? ? ? 1_555 YC DA 48   N1 ? ? AA DT 103  Bm DA 48   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog226   hydrog ? ? A  DT 104  N3 ? ? ? 1_555 YC DA 47   N1 ? ? AA DT 104  Bm DA 47   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog227   hydrog ? ? A  DT 105  N3 ? ? ? 1_555 YC DA 46   N1 ? ? AA DT 105  Bm DA 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog228   hydrog ? ? A  DT 105  O4 ? ? ? 1_555 YC DA 46   N6 ? ? AA DT 105  Bm DA 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog229   hydrog ? ? A  DG 106  N1 ? ? ? 1_555 YC DC 45   N3 ? ? AA DG 106  Bm DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog230   hydrog ? ? A  DG 106  N2 ? ? ? 1_555 YC DC 45   O2 ? ? AA DG 106  Bm DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog231   hydrog ? ? A  DG 106  O6 ? ? ? 1_555 YC DC 45   N4 ? ? AA DG 106  Bm DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog232   hydrog ? ? A  DA 107  N1 ? ? ? 1_555 YC DT 44   N3 ? ? AA DA 107  Bm DT 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog233   hydrog ? ? A  DA 107  N6 ? ? ? 1_555 YC DT 44   O4 ? ? AA DA 107  Bm DT 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog234   hydrog ? ? A  DT 108  N3 ? ? ? 1_555 YC DA 43   N1 ? ? AA DT 108  Bm DA 43   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog235   hydrog ? ? A  DT 109  N3 ? ? ? 1_555 YC DA 42   N1 ? ? AA DT 109  Bm DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog236   hydrog ? ? A  DT 109  O4 ? ? ? 1_555 YC DA 42   N6 ? ? AA DT 109  Bm DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog237   hydrog ? ? A  DT 110  N3 ? ? ? 1_555 YC DA 41   N1 ? ? AA DT 110  Bm DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog238   hydrog ? ? A  DT 110  O4 ? ? ? 1_555 YC DA 41   N6 ? ? AA DT 110  Bm DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog239   hydrog ? ? A  DA 111  N1 ? ? ? 1_555 YC DT 40   N3 ? ? AA DA 111  Bm DT 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog240   hydrog ? ? A  DA 111  N6 ? ? ? 1_555 YC DT 40   O4 ? ? AA DA 111  Bm DT 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog241   hydrog ? ? A  DT 112  N3 ? ? ? 1_555 YC DA 39   N1 ? ? AA DT 112  Bm DA 39   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog242   hydrog ? ? A  DA 113  N1 ? ? ? 1_555 YC DT 38   N3 ? ? AA DA 113  Bm DT 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog243   hydrog ? ? A  DA 113  N6 ? ? ? 1_555 YC DT 38   O4 ? ? AA DA 113  Bm DT 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog244   hydrog ? ? A  DA 114  N1 ? ? ? 1_555 YC DT 37   N3 ? ? AA DA 114  Bm DT 37   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog245   hydrog ? ? A  DG 115  N1 ? ? ? 1_555 YC DC 36   N3 ? ? AA DG 115  Bm DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog246   hydrog ? ? A  DG 115  N2 ? ? ? 1_555 YC DC 36   O2 ? ? AA DG 115  Bm DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog247   hydrog ? ? A  DG 115  O6 ? ? ? 1_555 YC DC 36   N4 ? ? AA DG 115  Bm DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog248   hydrog ? ? A  DG 116  N1 ? ? ? 1_555 YC DC 35   N3 ? ? AA DG 116  Bm DC 35   1_555 ? ? ? ? ? ? 'DG-DC PAIR'            
? ? 
hydrog249   hydrog ? ? A  DG 117  N1 ? ? ? 1_555 BD DC 6    N3 ? ? AA DG 117  Bp DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog250   hydrog ? ? A  DG 117  N2 ? ? ? 1_555 BD DC 6    O2 ? ? AA DG 117  Bp DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog251   hydrog ? ? A  DG 117  O6 ? ? ? 1_555 BD DC 6    N4 ? ? AA DG 117  Bp DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog252   hydrog ? ? A  DA 118  N1 ? ? ? 1_555 BD DT 5    N3 ? ? AA DA 118  Bp DT 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog253   hydrog ? ? A  DA 118  N6 ? ? ? 1_555 BD DT 5    O4 ? ? AA DA 118  Bp DT 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog254   hydrog ? ? A  DT 119  N3 ? ? ? 1_555 BD DA 4    N1 ? ? AA DT 119  Bp DA 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog255   hydrog ? ? A  DT 119  O4 ? ? ? 1_555 BD DA 4    N6 ? ? AA DT 119  Bp DA 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog256   hydrog ? ? A  DT 120  N3 ? ? ? 1_555 BD DA 3    N1 ? ? AA DT 120  Bp DA 3    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog257   hydrog ? ? A  DT 121  N3 ? ? ? 1_555 BD DA 2    N1 ? ? AA DT 121  Bp DA 2    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog258   hydrog ? ? A  DT 122  N3 ? ? ? 1_555 BD DA 1    N1 ? ? AA DT 122  Bp DA 1    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog259   hydrog ? ? A  DG 123  N1 ? ? ? 1_555 MC DC 48   N3 ? ? AA DG 123  Ba DC 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog260   hydrog ? ? A  DG 123  N2 ? ? ? 1_555 MC DC 48   O2 ? ? AA DG 123  Ba DC 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog261   hydrog ? ? A  DG 123  O6 ? ? ? 1_555 MC DC 48   N4 ? ? AA DG 123  Ba DC 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog262   hydrog ? ? A  DC 124  N3 ? ? ? 1_555 MC DG 47   N1 ? ? AA DC 124  Ba DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog263   hydrog ? ? A  DC 124  N4 ? ? ? 1_555 MC DG 47   O6 ? ? AA DC 124  Ba DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog264   hydrog ? ? A  DC 124  O2 ? ? ? 1_555 MC DG 47   N2 ? ? AA DC 124  Ba DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog265   hydrog ? ? A  DC 125  N3 ? ? ? 1_555 VC DG 10   N1 ? ? AA DC 125  Bj DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog266   hydrog ? ? A  DC 125  N4 ? ? ? 1_555 VC DG 10   O6 ? ? AA DC 125  Bj DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog267   hydrog ? ? A  DC 125  O2 ? ? ? 1_555 VC DG 10   N2 ? ? AA DC 125  Bj DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog268   hydrog ? ? A  DG 126  N1 ? ? ? 1_555 VC DC 9    N3 ? ? AA DG 126  Bj DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog269   hydrog ? ? A  DG 126  N2 ? ? ? 1_555 VC DC 9    O2 ? ? AA DG 126  Bj DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog270   hydrog ? ? A  DG 126  O6 ? ? ? 1_555 VC DC 9    N4 ? ? AA DG 126  Bj DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog271   hydrog ? ? A  DA 127  N1 ? ? ? 1_555 VC DT 8    N3 ? ? AA DA 127  Bj DT 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog272   hydrog ? ? A  DA 127  N6 ? ? ? 1_555 VC DT 8    O4 ? ? AA DA 127  Bj DT 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog273   hydrog ? ? A  DT 128  N3 ? ? ? 1_555 VC DA 7    N1 ? ? AA DT 128  Bj DA 7    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog274   hydrog ? ? A  DT 129  N3 ? ? ? 1_555 VC DA 6    N1 ? ? AA DT 129  Bj DA 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog275   hydrog ? ? A  DT 129  O4 ? ? ? 1_555 VC DA 6    N6 ? ? AA DT 129  Bj DA 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog276   hydrog ? ? A  DT 130  N3 ? ? ? 1_555 VC DA 5    N1 ? ? AA DT 130  Bj DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog277   hydrog ? ? A  DT 130  O4 ? ? ? 1_555 VC DA 5    N6 ? ? AA DT 130  Bj DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog278   hydrog ? ? A  DC 131  N3 ? ? ? 1_555 VC DG 4    N1 ? ? AA DC 131  Bj DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog279   hydrog ? ? A  DC 131  N4 ? ? ? 1_555 VC DG 4    O6 ? ? AA DC 131  Bj DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog280   hydrog ? ? A  DC 131  O2 ? ? ? 1_555 VC DG 4    N2 ? ? AA DC 131  Bj DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog281   hydrog ? ? A  DG 132  N1 ? ? ? 1_555 VC DC 3    N3 ? ? AA DG 132  Bj DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog282   hydrog ? ? A  DG 132  N2 ? ? ? 1_555 VC DC 3    O2 ? ? AA DG 132  Bj DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog283   hydrog ? ? A  DG 132  O6 ? ? ? 1_555 VC DC 3    N4 ? ? AA DG 132  Bj DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog284   hydrog ? ? A  DG 133  N1 ? ? ? 1_555 VC DC 3    N3 ? ? AA DG 133  Bj DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog285   hydrog ? ? A  DG 133  N2 ? ? ? 1_555 VC DC 3    O2 ? ? AA DG 133  Bj DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog286   hydrog ? ? A  DG 133  O6 ? ? ? 1_555 VC DC 3    N4 ? ? AA DG 133  Bj DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog287   hydrog ? ? A  DG 133  N1 ? ? ? 1_555 DD DC 37   N3 ? ? AA DG 133  Br DC 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog288   hydrog ? ? A  DG 133  N2 ? ? ? 1_555 DD DC 37   O2 ? ? AA DG 133  Br DC 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog289   hydrog ? ? A  DG 133  O6 ? ? ? 1_555 DD DC 37   N4 ? ? AA DG 133  Br DC 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog290   hydrog ? ? A  DA 134  N1 ? ? ? 1_555 DD DT 36   N3 ? ? AA DA 134  Br DT 36   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog291   hydrog ? ? A  DA 135  N1 ? ? ? 1_555 DD DT 35   N3 ? ? AA DA 135  Br DT 35   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog292   hydrog ? ? A  DC 136  N3 ? ? ? 1_555 DD DG 34   N1 ? ? AA DC 136  Br DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog293   hydrog ? ? A  DC 136  N4 ? ? ? 1_555 DD DG 34   O6 ? ? AA DC 136  Br DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog294   hydrog ? ? A  DC 136  O2 ? ? ? 1_555 DD DG 34   N2 ? ? AA DC 136  Br DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog295   hydrog ? ? A  DC 137  N3 ? ? ? 1_555 DD DG 33   N1 ? ? AA DC 137  Br DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog296   hydrog ? ? A  DC 137  N4 ? ? ? 1_555 DD DG 33   O6 ? ? AA DC 137  Br DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog297   hydrog ? ? A  DC 137  O2 ? ? ? 1_555 DD DG 33   N2 ? ? AA DC 137  Br DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog298   hydrog ? ? A  DA 138  N1 ? ? ? 1_555 DD DT 32   N3 ? ? AA DA 138  Br DT 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog299   hydrog ? ? A  DA 138  N6 ? ? ? 1_555 DD DT 32   O4 ? ? AA DA 138  Br DT 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog300   hydrog ? ? A  DC 139  N3 ? ? ? 1_555 DD DG 31   N1 ? ? AA DC 139  Br DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog301   hydrog ? ? A  DC 139  N4 ? ? ? 1_555 DD DG 31   O6 ? ? AA DC 139  Br DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog302   hydrog ? ? A  DC 139  O2 ? ? ? 1_555 DD DG 31   N2 ? ? AA DC 139  Br DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog303   hydrog ? ? A  DC 140  N3 ? ? ? 1_555 DD DG 30   N1 ? ? AA DC 140  Br DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog304   hydrog ? ? A  DC 140  N4 ? ? ? 1_555 DD DG 30   O6 ? ? AA DC 140  Br DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog305   hydrog ? ? A  DC 140  O2 ? ? ? 1_555 DD DG 30   N2 ? ? AA DC 140  Br DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog306   hydrog ? ? A  DA 141  N1 ? ? ? 1_555 DD DT 29   N3 ? ? AA DA 141  Br DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog307   hydrog ? ? A  DA 141  N6 ? ? ? 1_555 DD DT 29   O4 ? ? AA DA 141  Br DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog308   hydrog ? ? A  DT 142  N3 ? ? ? 1_555 DD DA 28   N1 ? ? AA DT 142  Br DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog309   hydrog ? ? A  DT 142  O4 ? ? ? 1_555 DD DA 28   N6 ? ? AA DT 142  Br DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog310   hydrog ? ? A  DC 143  N3 ? ? ? 1_555 DD DG 27   N1 ? ? AA DC 143  Br DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog311   hydrog ? ? A  DC 143  N4 ? ? ? 1_555 DD DG 27   O6 ? ? AA DC 143  Br DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog312   hydrog ? ? A  DC 143  O2 ? ? ? 1_555 DD DG 27   N2 ? ? AA DC 143  Br DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog313   hydrog ? ? A  DA 144  N1 ? ? ? 1_555 DD DT 16   N3 ? ? AA DA 144  Br DT 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog314   hydrog ? ? A  DA 144  N6 ? ? ? 1_555 DD DT 16   O4 ? ? AA DA 144  Br DT 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog315   hydrog ? ? A  DA 145  N1 ? ? ? 1_555 DD DT 15   N3 ? ? AA DA 145  Br DT 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog316   hydrog ? ? A  DA 145  N6 ? ? ? 1_555 DD DT 15   O4 ? ? AA DA 145  Br DT 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog317   hydrog ? ? A  DA 146  N1 ? ? ? 1_555 DD DT 14   N3 ? ? AA DA 146  Br DT 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog318   hydrog ? ? A  DA 146  N6 ? ? ? 1_555 DD DT 14   O4 ? ? AA DA 146  Br DT 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog319   hydrog ? ? A  DA 148  N1 ? ? ? 1_555 BD DT 29   N3 ? ? AA DA 148  Bp DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog320   hydrog ? ? A  DA 148  N6 ? ? ? 1_555 BD DT 29   O4 ? ? AA DA 148  Bp DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog321   hydrog ? ? A  DG 149  N1 ? ? ? 1_555 BD DC 28   N3 ? ? AA DG 149  Bp DC 28   1_555 ? ? ? ? ? ? 'DG-DC PAIR'            
? ? 
hydrog322   hydrog ? ? A  DG 150  N1 ? ? ? 1_555 BD DC 27   N3 ? ? AA DG 150  Bp DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog323   hydrog ? ? A  DG 150  N2 ? ? ? 1_555 BD DC 27   O2 ? ? AA DG 150  Bp DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog324   hydrog ? ? A  DG 150  O6 ? ? ? 1_555 BD DC 27   N4 ? ? AA DG 150  Bp DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog325   hydrog ? ? A  DA 151  N1 ? ? ? 1_555 BD DT 26   N3 ? ? AA DA 151  Bp DT 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog326   hydrog ? ? A  DA 151  N6 ? ? ? 1_555 BD DT 26   O4 ? ? AA DA 151  Bp DT 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog327   hydrog ? ? A  DT 152  N3 ? ? ? 1_555 BD DA 25   N1 ? ? AA DT 152  Bp DA 25   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog328   hydrog ? ? A  DT 153  N3 ? ? ? 1_555 BD DA 24   N1 ? ? AA DT 153  Bp DA 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog329   hydrog ? ? A  DT 153  O4 ? ? ? 1_555 BD DA 24   N6 ? ? AA DT 153  Bp DA 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog330   hydrog ? ? A  DT 154  N3 ? ? ? 1_555 BD DA 23   N1 ? ? AA DT 154  Bp DA 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog331   hydrog ? ? A  DT 154  O4 ? ? ? 1_555 BD DA 23   N6 ? ? AA DT 154  Bp DA 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog332   hydrog ? ? A  DT 155  N3 ? ? ? 1_555 BD DA 22   N1 ? ? AA DT 155  Bp DA 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog333   hydrog ? ? A  DT 155  O4 ? ? ? 1_555 BD DA 22   N6 ? ? AA DT 155  Bp DA 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog334   hydrog ? ? A  DC 156  N3 ? ? ? 1_555 BD DG 21   N1 ? ? AA DC 156  Bp DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog335   hydrog ? ? A  DC 156  N4 ? ? ? 1_555 BD DG 21   O6 ? ? AA DC 156  Bp DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog336   hydrog ? ? A  DC 156  O2 ? ? ? 1_555 BD DG 21   N2 ? ? AA DC 156  Bp DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog337   hydrog ? ? A  DG 157  N1 ? ? ? 1_555 BD DC 20   N3 ? ? AA DG 157  Bp DC 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog338   hydrog ? ? A  DG 157  N2 ? ? ? 1_555 BD DC 20   O2 ? ? AA DG 157  Bp DC 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog339   hydrog ? ? A  DG 157  O6 ? ? ? 1_555 BD DC 20   N4 ? ? AA DG 157  Bp DC 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog340   hydrog ? ? A  DC 158  N3 ? ? ? 1_555 BD DG 19   N1 ? ? AA DC 158  Bp DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog341   hydrog ? ? A  DC 158  N4 ? ? ? 1_555 BD DG 19   O6 ? ? AA DC 158  Bp DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog342   hydrog ? ? A  DC 158  O2 ? ? ? 1_555 BD DG 19   N2 ? ? AA DC 158  Bp DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog343   hydrog ? ? A  DC 159  N3 ? ? ? 1_555 BD DG 18   N1 ? ? AA DC 159  Bp DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog344   hydrog ? ? A  DC 159  N4 ? ? ? 1_555 BD DG 18   O6 ? ? AA DC 159  Bp DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog345   hydrog ? ? A  DC 159  O2 ? ? ? 1_555 BD DG 18   N2 ? ? AA DC 159  Bp DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog346   hydrog ? ? A  DT 160  N3 ? ? ? 1_555 BD DA 17   N1 ? ? AA DT 160  Bp DA 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog347   hydrog ? ? A  DT 160  O4 ? ? ? 1_555 BD DA 17   N6 ? ? AA DT 160  Bp DA 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog348   hydrog ? ? A  DG 161  N1 ? ? ? 1_555 BD DC 16   N3 ? ? AA DG 161  Bp DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog349   hydrog ? ? A  DG 161  N2 ? ? ? 1_555 BD DC 16   O2 ? ? AA DG 161  Bp DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog350   hydrog ? ? A  DG 161  O6 ? ? ? 1_555 BD DC 16   N4 ? ? AA DG 161  Bp DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog351   hydrog ? ? A  DC 162  N3 ? ? ? 1_555 BD DG 15   N1 ? ? AA DC 162  Bp DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog352   hydrog ? ? A  DC 162  N4 ? ? ? 1_555 BD DG 15   O6 ? ? AA DC 162  Bp DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog353   hydrog ? ? A  DC 162  O2 ? ? ? 1_555 BD DG 15   N2 ? ? AA DC 162  Bp DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog354   hydrog ? ? A  DT 163  N3 ? ? ? 1_555 VC DA 26   N1 ? ? AA DT 163  Bj DA 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog355   hydrog ? ? A  DT 163  O4 ? ? ? 1_555 VC DA 26   N6 ? ? AA DT 163  Bj DA 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog356   hydrog ? ? A  DG 164  N1 ? ? ? 1_555 VC DC 25   N3 ? ? AA DG 164  Bj DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog357   hydrog ? ? A  DG 164  N2 ? ? ? 1_555 VC DC 25   O2 ? ? AA DG 164  Bj DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog358   hydrog ? ? A  DG 164  O6 ? ? ? 1_555 VC DC 25   N4 ? ? AA DG 164  Bj DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog359   hydrog ? ? A  DG 165  N1 ? ? ? 1_555 VC DC 24   N3 ? ? AA DG 165  Bj DC 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog360   hydrog ? ? A  DG 165  N2 ? ? ? 1_555 VC DC 24   O2 ? ? AA DG 165  Bj DC 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog361   hydrog ? ? A  DG 165  O6 ? ? ? 1_555 VC DC 24   N4 ? ? AA DG 165  Bj DC 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog362   hydrog ? ? A  DG 166  N1 ? ? ? 1_555 VC DC 23   N3 ? ? AA DG 166  Bj DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog363   hydrog ? ? A  DG 166  N2 ? ? ? 1_555 VC DC 23   O2 ? ? AA DG 166  Bj DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog364   hydrog ? ? A  DG 166  O6 ? ? ? 1_555 VC DC 23   N4 ? ? AA DG 166  Bj DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog365   hydrog ? ? A  DG 167  N1 ? ? ? 1_555 VC DC 22   N3 ? ? AA DG 167  Bj DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog366   hydrog ? ? A  DG 167  N2 ? ? ? 1_555 VC DC 22   O2 ? ? AA DG 167  Bj DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog367   hydrog ? ? A  DG 167  O6 ? ? ? 1_555 VC DC 22   N4 ? ? AA DG 167  Bj DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog368   hydrog ? ? A  DC 168  N3 ? ? ? 1_555 VC DG 21   N1 ? ? AA DC 168  Bj DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog369   hydrog ? ? A  DC 168  N4 ? ? ? 1_555 VC DG 21   O6 ? ? AA DC 168  Bj DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog370   hydrog ? ? A  DC 168  O2 ? ? ? 1_555 VC DG 21   N2 ? ? AA DC 168  Bj DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog371   hydrog ? ? A  DA 169  N1 ? ? ? 1_555 VC DT 20   N3 ? ? AA DA 169  Bj DT 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog372   hydrog ? ? A  DA 169  N6 ? ? ? 1_555 VC DT 20   O4 ? ? AA DA 169  Bj DT 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog373   hydrog ? ? A  DA 170  N1 ? ? ? 1_555 VC DT 19   N3 ? ? AA DA 170  Bj DT 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog374   hydrog ? ? A  DA 170  N6 ? ? ? 1_555 VC DT 19   O4 ? ? AA DA 170  Bj DT 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog375   hydrog ? ? A  DA 171  N1 ? ? ? 1_555 BD DT 38   N3 ? ? AA DA 171  Bp DT 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog376   hydrog ? ? A  DA 171  N6 ? ? ? 1_555 BD DT 38   O4 ? ? AA DA 171  Bp DT 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog377   hydrog ? ? A  DC 172  N3 ? ? ? 1_555 BD DG 37   N1 ? ? AA DC 172  Bp DG 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog378   hydrog ? ? A  DC 172  N4 ? ? ? 1_555 BD DG 37   O6 ? ? AA DC 172  Bp DG 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog379   hydrog ? ? A  DC 172  O2 ? ? ? 1_555 BD DG 37   N2 ? ? AA DC 172  Bp DG 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog380   hydrog ? ? A  DC 173  N3 ? ? ? 1_555 BD DG 36   N1 ? ? AA DC 173  Bp DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog381   hydrog ? ? A  DC 173  N4 ? ? ? 1_555 BD DG 36   O6 ? ? AA DC 173  Bp DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog382   hydrog ? ? A  DC 173  O2 ? ? ? 1_555 BD DG 36   N2 ? ? AA DC 173  Bp DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog383   hydrog ? ? A  DA 174  N1 ? ? ? 1_555 BD DT 35   N3 ? ? AA DA 174  Bp DT 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog384   hydrog ? ? A  DA 174  N6 ? ? ? 1_555 BD DT 35   O4 ? ? AA DA 174  Bp DT 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog385   hydrog ? ? A  DG 175  N1 ? ? ? 1_555 BD DC 34   N3 ? ? AA DG 175  Bp DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog386   hydrog ? ? A  DG 175  N2 ? ? ? 1_555 BD DC 34   O2 ? ? AA DG 175  Bp DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog387   hydrog ? ? A  DG 175  O6 ? ? ? 1_555 BD DC 34   N4 ? ? AA DG 175  Bp DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog388   hydrog ? ? A  DC 176  N3 ? ? ? 1_555 BD DG 33   N1 ? ? AA DC 176  Bp DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog389   hydrog ? ? A  DC 176  N4 ? ? ? 1_555 BD DG 33   O6 ? ? AA DC 176  Bp DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog390   hydrog ? ? A  DC 176  O2 ? ? ? 1_555 BD DG 33   N2 ? ? AA DC 176  Bp DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog391   hydrog ? ? A  DT 178  N3 ? ? ? 1_555 BD DA 31   N1 ? ? AA DT 178  Bp DA 31   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog392   hydrog ? ? A  DG 179  N1 ? ? ? 1_555 DD DC 13   N3 ? ? AA DG 179  Br DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog393   hydrog ? ? A  DG 179  N2 ? ? ? 1_555 DD DC 13   O2 ? ? AA DG 179  Br DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog394   hydrog ? ? A  DG 179  O6 ? ? ? 1_555 DD DC 13   N4 ? ? AA DG 179  Br DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog395   hydrog ? ? A  DG 180  N1 ? ? ? 1_555 DD DC 12   N3 ? ? AA DG 180  Br DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog396   hydrog ? ? A  DG 180  N2 ? ? ? 1_555 DD DC 12   O2 ? ? AA DG 180  Br DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog397   hydrog ? ? A  DG 180  O6 ? ? ? 1_555 DD DC 12   N4 ? ? AA DG 180  Br DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog398   hydrog ? ? A  DA 181  N1 ? ? ? 1_555 DD DT 11   N3 ? ? AA DA 181  Br DT 11   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog399   hydrog ? ? A  DC 182  N3 ? ? ? 1_555 DD DG 10   N1 ? ? AA DC 182  Br DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog400   hydrog ? ? A  DC 182  N4 ? ? ? 1_555 DD DG 10   O6 ? ? AA DC 182  Br DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog401   hydrog ? ? A  DC 182  O2 ? ? ? 1_555 DD DG 10   N2 ? ? AA DC 182  Br DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog402   hydrog ? ? A  DC 183  N3 ? ? ? 1_555 DD DG 9    N1 ? ? AA DC 183  Br DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog403   hydrog ? ? A  DC 183  N4 ? ? ? 1_555 DD DG 9    O6 ? ? AA DC 183  Br DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog404   hydrog ? ? A  DC 183  O2 ? ? ? 1_555 DD DG 9    N2 ? ? AA DC 183  Br DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog405   hydrog ? ? A  DG 184  N1 ? ? ? 1_555 DD DC 8    N3 ? ? AA DG 184  Br DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog406   hydrog ? ? A  DG 184  N2 ? ? ? 1_555 DD DC 8    O2 ? ? AA DG 184  Br DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog407   hydrog ? ? A  DG 184  O6 ? ? ? 1_555 DD DC 8    N4 ? ? AA DG 184  Br DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog408   hydrog ? ? A  DC 185  N3 ? ? ? 1_555 DD DG 7    N1 ? ? AA DC 185  Br DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog409   hydrog ? ? A  DC 185  N4 ? ? ? 1_555 DD DG 7    O6 ? ? AA DC 185  Br DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog410   hydrog ? ? A  DC 185  O2 ? ? ? 1_555 DD DG 7    N2 ? ? AA DC 185  Br DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog411   hydrog ? ? A  DT 186  N3 ? ? ? 1_555 DD DA 6    N1 ? ? AA DT 186  Br DA 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog412   hydrog ? ? A  DT 186  O4 ? ? ? 1_555 DD DA 6    N6 ? ? AA DT 186  Br DA 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog413   hydrog ? ? A  DT 187  N3 ? ? ? 1_555 JB DA 45   N1 ? ? AA DT 187  B6 DA 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog414   hydrog ? ? A  DT 187  O4 ? ? ? 1_555 JB DA 45   N6 ? ? AA DT 187  B6 DA 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog415   hydrog ? ? A  DG 188  N1 ? ? ? 1_555 JB DC 44   N3 ? ? AA DG 188  B6 DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog416   hydrog ? ? A  DG 188  N2 ? ? ? 1_555 JB DC 44   O2 ? ? AA DG 188  B6 DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog417   hydrog ? ? A  DG 188  O6 ? ? ? 1_555 JB DC 44   N4 ? ? AA DG 188  B6 DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog418   hydrog ? ? A  DC 189  N3 ? ? ? 1_555 JB DG 43   N1 ? ? AA DC 189  B6 DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog419   hydrog ? ? A  DC 189  N4 ? ? ? 1_555 JB DG 43   O6 ? ? AA DC 189  B6 DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog420   hydrog ? ? A  DC 189  O2 ? ? ? 1_555 JB DG 43   N2 ? ? AA DC 189  B6 DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog421   hydrog ? ? A  DT 190  N3 ? ? ? 1_555 JB DA 42   N1 ? ? AA DT 190  B6 DA 42   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog422   hydrog ? ? A  DG 191  N1 ? ? ? 1_555 JB DC 41   N3 ? ? AA DG 191  B6 DC 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog423   hydrog ? ? A  DG 191  N2 ? ? ? 1_555 JB DC 41   O2 ? ? AA DG 191  B6 DC 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog424   hydrog ? ? A  DG 191  O6 ? ? ? 1_555 JB DC 41   N4 ? ? AA DG 191  B6 DC 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog425   hydrog ? ? A  DC 192  N3 ? ? ? 1_555 JB DG 40   N1 ? ? AA DC 192  B6 DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog426   hydrog ? ? A  DC 192  N4 ? ? ? 1_555 JB DG 40   O6 ? ? AA DC 192  B6 DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog427   hydrog ? ? A  DC 192  O2 ? ? ? 1_555 JB DG 40   N2 ? ? AA DC 192  B6 DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog428   hydrog ? ? A  DA 193  N1 ? ? ? 1_555 JB DT 39   N3 ? ? AA DA 193  B6 DT 39   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog429   hydrog ? ? A  DA 194  N1 ? ? ? 1_555 JB DT 38   N3 ? ? AA DA 194  B6 DT 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog430   hydrog ? ? A  DA 194  N6 ? ? ? 1_555 JB DT 38   O4 ? ? AA DA 194  B6 DT 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog431   hydrog ? ? A  DC 195  N3 ? ? ? 1_555 BD DG 46   N1 ? ? AA DC 195  Bp DG 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog432   hydrog ? ? A  DC 195  N4 ? ? ? 1_555 BD DG 46   O6 ? ? AA DC 195  Bp DG 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog433   hydrog ? ? A  DC 195  O2 ? ? ? 1_555 BD DG 46   N2 ? ? AA DC 195  Bp DG 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog434   hydrog ? ? A  DT 196  N3 ? ? ? 1_555 BD DA 45   N1 ? ? AA DT 196  Bp DA 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog435   hydrog ? ? A  DT 196  O4 ? ? ? 1_555 BD DA 45   N6 ? ? AA DT 196  Bp DA 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog436   hydrog ? ? A  DC 197  N3 ? ? ? 1_555 BD DG 44   N1 ? ? AA DC 197  Bp DG 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog437   hydrog ? ? A  DC 197  N4 ? ? ? 1_555 BD DG 44   O6 ? ? AA DC 197  Bp DG 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog438   hydrog ? ? A  DC 197  O2 ? ? ? 1_555 BD DG 44   N2 ? ? AA DC 197  Bp DG 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog439   hydrog ? ? A  DT 198  N3 ? ? ? 1_555 BD DA 43   N1 ? ? AA DT 198  Bp DA 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog440   hydrog ? ? A  DT 198  O4 ? ? ? 1_555 BD DA 43   N6 ? ? AA DT 198  Bp DA 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog441   hydrog ? ? A  DC 199  N3 ? ? ? 1_555 BD DG 42   N1 ? ? AA DC 199  Bp DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog442   hydrog ? ? A  DC 199  N4 ? ? ? 1_555 BD DG 42   O6 ? ? AA DC 199  Bp DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog443   hydrog ? ? A  DC 199  O2 ? ? ? 1_555 BD DG 42   N2 ? ? AA DC 199  Bp DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog444   hydrog ? ? A  DT 200  N3 ? ? ? 1_555 BD DA 41   N1 ? ? AA DT 200  Bp DA 41   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog445   hydrog ? ? A  DC 201  N3 ? ? ? 1_555 BD DG 40   N1 ? ? AA DC 201  Bp DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog446   hydrog ? ? A  DC 201  N4 ? ? ? 1_555 BD DG 40   O6 ? ? AA DC 201  Bp DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog447   hydrog ? ? A  DC 201  O2 ? ? ? 1_555 BD DG 40   N2 ? ? AA DC 201  Bp DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog448   hydrog ? ? A  DA 202  N1 ? ? ? 1_555 BD DT 39   N3 ? ? AA DA 202  Bp DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog449   hydrog ? ? A  DA 202  N6 ? ? ? 1_555 BD DT 39   O4 ? ? AA DA 202  Bp DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog450   hydrog ? ? A  DG 203  N1 ? ? ? 1_555 VC DC 18   N3 ? ? AA DG 203  Bj DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog451   hydrog ? ? A  DG 203  N2 ? ? ? 1_555 VC DC 18   O2 ? ? AA DG 203  Bj DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog452   hydrog ? ? A  DG 203  O6 ? ? ? 1_555 VC DC 18   N4 ? ? AA DG 203  Bj DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog453   hydrog ? ? A  DG 204  N1 ? ? ? 1_555 VC DC 17   N3 ? ? AA DG 204  Bj DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog454   hydrog ? ? A  DG 204  N2 ? ? ? 1_555 VC DC 17   O2 ? ? AA DG 204  Bj DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog455   hydrog ? ? A  DG 204  O6 ? ? ? 1_555 VC DC 17   N4 ? ? AA DG 204  Bj DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog456   hydrog ? ? A  DG 205  N1 ? ? ? 1_555 VC DC 16   N3 ? ? AA DG 205  Bj DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog457   hydrog ? ? A  DG 205  N2 ? ? ? 1_555 VC DC 16   O2 ? ? AA DG 205  Bj DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog458   hydrog ? ? A  DG 205  O6 ? ? ? 1_555 VC DC 16   N4 ? ? AA DG 205  Bj DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog459   hydrog ? ? A  DC 206  N3 ? ? ? 1_555 VC DG 15   N1 ? ? AA DC 206  Bj DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog460   hydrog ? ? A  DC 206  N4 ? ? ? 1_555 VC DG 15   O6 ? ? AA DC 206  Bj DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog461   hydrog ? ? A  DC 206  O2 ? ? ? 1_555 VC DG 15   N2 ? ? AA DC 206  Bj DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog462   hydrog ? ? A  DC 207  N3 ? ? ? 1_555 VC DG 14   N1 ? ? AA DC 207  Bj DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog463   hydrog ? ? A  DC 207  N4 ? ? ? 1_555 VC DG 14   O6 ? ? AA DC 207  Bj DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog464   hydrog ? ? A  DC 207  O2 ? ? ? 1_555 VC DG 14   N2 ? ? AA DC 207  Bj DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog465   hydrog ? ? A  DA 208  N1 ? ? ? 1_555 VC DT 13   N3 ? ? AA DA 208  Bj DT 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog466   hydrog ? ? A  DA 208  N6 ? ? ? 1_555 VC DT 13   O4 ? ? AA DA 208  Bj DT 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog467   hydrog ? ? A  DG 209  N1 ? ? ? 1_555 VC DC 12   N3 ? ? AA DG 209  Bj DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog468   hydrog ? ? A  DG 209  N2 ? ? ? 1_555 VC DC 12   O2 ? ? AA DG 209  Bj DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog469   hydrog ? ? A  DG 209  O6 ? ? ? 1_555 VC DC 12   N4 ? ? AA DG 209  Bj DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog470   hydrog ? ? A  DG 210  N1 ? ? ? 1_555 VC DC 11   N3 ? ? AA DG 210  Bj DC 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog471   hydrog ? ? A  DG 210  N2 ? ? ? 1_555 VC DC 11   O2 ? ? AA DG 210  Bj DC 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog472   hydrog ? ? A  DG 210  O6 ? ? ? 1_555 VC DC 11   N4 ? ? AA DG 210  Bj DC 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog473   hydrog ? ? A  DC 211  N3 ? ? ? 1_555 MC DG 46   N1 ? ? AA DC 211  Ba DG 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog474   hydrog ? ? A  DC 211  N4 ? ? ? 1_555 MC DG 46   O6 ? ? AA DC 211  Ba DG 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog475   hydrog ? ? A  DC 211  O2 ? ? ? 1_555 MC DG 46   N2 ? ? AA DC 211  Ba DG 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog476   hydrog ? ? A  DG 212  N1 ? ? ? 1_555 MC DC 45   N3 ? ? AA DG 212  Ba DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog477   hydrog ? ? A  DG 212  N2 ? ? ? 1_555 MC DC 45   O2 ? ? AA DG 212  Ba DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog478   hydrog ? ? A  DG 212  O6 ? ? ? 1_555 MC DC 45   N4 ? ? AA DG 212  Ba DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog479   hydrog ? ? A  DG 213  N1 ? ? ? 1_555 MC DC 44   N3 ? ? AA DG 213  Ba DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog480   hydrog ? ? A  DG 213  N2 ? ? ? 1_555 MC DC 44   O2 ? ? AA DG 213  Ba DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog481   hydrog ? ? A  DG 213  O6 ? ? ? 1_555 MC DC 44   N4 ? ? AA DG 213  Ba DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog482   hydrog ? ? A  DT 214  N3 ? ? ? 1_555 MC DA 43   N1 ? ? AA DT 214  Ba DA 43   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog483   hydrog ? ? A  DG 215  N1 ? ? ? 1_555 MC DC 42   N3 ? ? AA DG 215  Ba DC 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog484   hydrog ? ? A  DG 215  N2 ? ? ? 1_555 MC DC 42   O2 ? ? AA DG 215  Ba DC 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog485   hydrog ? ? A  DG 215  O6 ? ? ? 1_555 MC DC 42   N4 ? ? AA DG 215  Ba DC 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog486   hydrog ? ? A  DA 216  N1 ? ? ? 1_555 MC DT 41   N3 ? ? AA DA 216  Ba DT 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog487   hydrog ? ? A  DA 216  N6 ? ? ? 1_555 MC DT 41   O4 ? ? AA DA 216  Ba DT 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog488   hydrog ? ? A  DA 217  N1 ? ? ? 1_555 MC DT 40   N3 ? ? AA DA 217  Ba DT 40   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog489   hydrog ? ? A  DG 218  N1 ? ? ? 1_555 MC DC 39   N3 ? ? AA DG 218  Ba DC 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog490   hydrog ? ? A  DG 218  N2 ? ? ? 1_555 MC DC 39   O2 ? ? AA DG 218  Ba DC 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog491   hydrog ? ? A  DG 218  O6 ? ? ? 1_555 MC DC 39   N4 ? ? AA DG 218  Ba DC 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog492   hydrog ? ? A  DG 219  N1 ? ? ? 1_555 UC DC 30   N3 ? ? AA DG 219  Bi DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog493   hydrog ? ? A  DG 219  N2 ? ? ? 1_555 UC DC 30   O2 ? ? AA DG 219  Bi DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog494   hydrog ? ? A  DG 219  O6 ? ? ? 1_555 UC DC 30   N4 ? ? AA DG 219  Bi DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog495   hydrog ? ? A  DG 220  N1 ? ? ? 1_555 UC DC 29   N3 ? ? AA DG 220  Bi DC 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog496   hydrog ? ? A  DG 220  N2 ? ? ? 1_555 UC DC 29   O2 ? ? AA DG 220  Bi DC 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog497   hydrog ? ? A  DG 220  O6 ? ? ? 1_555 UC DC 29   N4 ? ? AA DG 220  Bi DC 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog498   hydrog ? ? A  DC 221  N3 ? ? ? 1_555 UC DG 28   N1 ? ? AA DC 221  Bi DG 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog499   hydrog ? ? A  DC 221  N4 ? ? ? 1_555 UC DG 28   O6 ? ? AA DC 221  Bi DG 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog500   hydrog ? ? A  DC 221  O2 ? ? ? 1_555 UC DG 28   N2 ? ? AA DC 221  Bi DG 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog501   hydrog ? ? A  DA 222  N1 ? ? ? 1_555 UC DT 27   N3 ? ? AA DA 222  Bi DT 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog502   hydrog ? ? A  DA 222  N6 ? ? ? 1_555 UC DT 27   O4 ? ? AA DA 222  Bi DT 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog503   hydrog ? ? A  DA 223  N1 ? ? ? 1_555 UC DT 26   N3 ? ? AA DA 223  Bi DT 26   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog504   hydrog ? ? A  DT 224  N3 ? ? ? 1_555 UC DA 25   N1 ? ? AA DT 224  Bi DA 25   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog505   hydrog ? ? A  DC 225  N3 ? ? ? 1_555 UC DG 24   N1 ? ? AA DC 225  Bi DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog506   hydrog ? ? A  DC 225  N4 ? ? ? 1_555 UC DG 24   O6 ? ? AA DC 225  Bi DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog507   hydrog ? ? A  DC 225  O2 ? ? ? 1_555 UC DG 24   N2 ? ? AA DC 225  Bi DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog508   hydrog ? ? A  DA 226  N1 ? ? ? 1_555 UC DT 23   N3 ? ? AA DA 226  Bi DT 23   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog509   hydrog ? ? A  DG 227  N1 ? ? ? 1_555 PC DC 18   N3 ? ? AA DG 227  Bd DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog510   hydrog ? ? A  DG 227  N2 ? ? ? 1_555 PC DC 18   O2 ? ? AA DG 227  Bd DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog511   hydrog ? ? A  DG 227  O6 ? ? ? 1_555 PC DC 18   N4 ? ? AA DG 227  Bd DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog512   hydrog ? ? A  DC 228  N3 ? ? ? 1_555 PC DG 17   N1 ? ? AA DC 228  Bd DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog513   hydrog ? ? A  DC 228  N4 ? ? ? 1_555 PC DG 17   O6 ? ? AA DC 228  Bd DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog514   hydrog ? ? A  DC 228  O2 ? ? ? 1_555 PC DG 17   N2 ? ? AA DC 228  Bd DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog515   hydrog ? ? A  DT 229  N3 ? ? ? 1_555 PC DA 16   N1 ? ? AA DT 229  Bd DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog516   hydrog ? ? A  DT 229  O4 ? ? ? 1_555 PC DA 16   N6 ? ? AA DT 229  Bd DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog517   hydrog ? ? A  DG 230  N1 ? ? ? 1_555 PC DC 15   N3 ? ? AA DG 230  Bd DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog518   hydrog ? ? A  DG 230  N2 ? ? ? 1_555 PC DC 15   O2 ? ? AA DG 230  Bd DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog519   hydrog ? ? A  DG 230  O6 ? ? ? 1_555 PC DC 15   N4 ? ? AA DG 230  Bd DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog520   hydrog ? ? A  DT 231  N3 ? ? ? 1_555 PC DA 14   N1 ? ? AA DT 231  Bd DA 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog521   hydrog ? ? A  DT 231  O4 ? ? ? 1_555 PC DA 14   N6 ? ? AA DT 231  Bd DA 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog522   hydrog ? ? A  DT 232  N3 ? ? ? 1_555 PC DA 13   N1 ? ? AA DT 232  Bd DA 13   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog523   hydrog ? ? A  DG 233  N1 ? ? ? 1_555 PC DC 12   N3 ? ? AA DG 233  Bd DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog524   hydrog ? ? A  DG 233  N2 ? ? ? 1_555 PC DC 12   O2 ? ? AA DG 233  Bd DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog525   hydrog ? ? A  DG 233  O6 ? ? ? 1_555 PC DC 12   N4 ? ? AA DG 233  Bd DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog526   hydrog ? ? A  DC 234  N3 ? ? ? 1_555 PC DG 11   N1 ? ? AA DC 234  Bd DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog527   hydrog ? ? A  DC 234  N4 ? ? ? 1_555 PC DG 11   O6 ? ? AA DC 234  Bd DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog528   hydrog ? ? A  DC 234  O2 ? ? ? 1_555 PC DG 11   N2 ? ? AA DC 234  Bd DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog529   hydrog ? ? A  DC 235  O2 ? ? ? 1_555 ZC DG 21   N2 ? ? AA DC 235  Bn DG 21   1_555 ? ? ? ? ? ? 'DC-DG PAIR'            
? ? 
hydrog530   hydrog ? ? A  DC 236  N3 ? ? ? 1_555 ZC DG 20   N1 ? ? AA DC 236  Bn DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog531   hydrog ? ? A  DC 236  N4 ? ? ? 1_555 ZC DG 20   O6 ? ? AA DC 236  Bn DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog532   hydrog ? ? A  DC 236  O2 ? ? ? 1_555 ZC DG 20   N2 ? ? AA DC 236  Bn DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog533   hydrog ? ? A  DG 237  N1 ? ? ? 1_555 ZC DC 19   N3 ? ? AA DG 237  Bn DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog534   hydrog ? ? A  DG 237  N2 ? ? ? 1_555 ZC DC 19   O2 ? ? AA DG 237  Bn DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog535   hydrog ? ? A  DG 237  O6 ? ? ? 1_555 ZC DC 19   N4 ? ? AA DG 237  Bn DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog536   hydrog ? ? A  DT 238  N3 ? ? ? 1_555 ZC DA 18   N1 ? ? AA DT 238  Bn DA 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog537   hydrog ? ? A  DT 238  O4 ? ? ? 1_555 ZC DA 18   N6 ? ? AA DT 238  Bn DA 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog538   hydrog ? ? A  DC 239  N3 ? ? ? 1_555 ZC DG 17   N1 ? ? AA DC 239  Bn DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog539   hydrog ? ? A  DC 239  N4 ? ? ? 1_555 ZC DG 17   O6 ? ? AA DC 239  Bn DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog540   hydrog ? ? A  DC 239  O2 ? ? ? 1_555 ZC DG 17   N2 ? ? AA DC 239  Bn DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog541   hydrog ? ? A  DT 240  N3 ? ? ? 1_555 ZC DA 16   N1 ? ? AA DT 240  Bn DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog542   hydrog ? ? A  DT 240  O4 ? ? ? 1_555 ZC DA 16   N6 ? ? AA DT 240  Bn DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog543   hydrog ? ? A  DC 241  N3 ? ? ? 1_555 ZC DG 15   N1 ? ? AA DC 241  Bn DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog544   hydrog ? ? A  DC 241  N4 ? ? ? 1_555 ZC DG 15   O6 ? ? AA DC 241  Bn DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog545   hydrog ? ? A  DC 241  O2 ? ? ? 1_555 ZC DG 15   N2 ? ? AA DC 241  Bn DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog546   hydrog ? ? A  DA 242  N1 ? ? ? 1_555 ZC DT 14   N3 ? ? AA DA 242  Bn DT 14   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog547   hydrog ? ? A  DC 243  N3 ? ? ? 1_555 UC DG 38   N1 ? ? AA DC 243  Bi DG 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog548   hydrog ? ? A  DC 243  N4 ? ? ? 1_555 UC DG 38   O6 ? ? AA DC 243  Bi DG 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog549   hydrog ? ? A  DC 243  O2 ? ? ? 1_555 UC DG 38   N2 ? ? AA DC 243  Bi DG 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog550   hydrog ? ? A  DT 244  N3 ? ? ? 1_555 UC DA 37   N1 ? ? AA DT 244  Bi DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog551   hydrog ? ? A  DT 244  O4 ? ? ? 1_555 UC DA 37   N6 ? ? AA DT 244  Bi DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog552   hydrog ? ? A  DG 245  N1 ? ? ? 1_555 UC DC 36   N3 ? ? AA DG 245  Bi DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog553   hydrog ? ? A  DG 245  N2 ? ? ? 1_555 UC DC 36   O2 ? ? AA DG 245  Bi DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog554   hydrog ? ? A  DG 245  O6 ? ? ? 1_555 UC DC 36   N4 ? ? AA DG 245  Bi DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog555   hydrog ? ? A  DG 246  N1 ? ? ? 1_555 UC DC 35   N3 ? ? AA DG 246  Bi DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog556   hydrog ? ? A  DG 246  N2 ? ? ? 1_555 UC DC 35   O2 ? ? AA DG 246  Bi DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog557   hydrog ? ? A  DG 246  O6 ? ? ? 1_555 UC DC 35   N4 ? ? AA DG 246  Bi DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog558   hydrog ? ? A  DT 247  N3 ? ? ? 1_555 UC DA 34   N1 ? ? AA DT 247  Bi DA 34   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog559   hydrog ? ? A  DG 248  N1 ? ? ? 1_555 UC DC 33   N3 ? ? AA DG 248  Bi DC 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog560   hydrog ? ? A  DG 248  N2 ? ? ? 1_555 UC DC 33   O2 ? ? AA DG 248  Bi DC 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog561   hydrog ? ? A  DG 248  O6 ? ? ? 1_555 UC DC 33   N4 ? ? AA DG 248  Bi DC 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog562   hydrog ? ? A  DA 249  N1 ? ? ? 1_555 UC DT 32   N3 ? ? AA DA 249  Bi DT 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog563   hydrog ? ? A  DA 249  N6 ? ? ? 1_555 UC DT 32   O4 ? ? AA DA 249  Bi DT 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog564   hydrog ? ? A  DA 250  N1 ? ? ? 1_555 UC DT 31   N3 ? ? AA DA 250  Bi DT 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog565   hydrog ? ? A  DA 250  N6 ? ? ? 1_555 UC DT 31   O4 ? ? AA DA 250  Bi DT 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog566   hydrog ? ? A  DA 251  N1 ? ? ? 1_555 MC DT 38   N3 ? ? AA DA 251  Ba DT 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog567   hydrog ? ? A  DA 251  N6 ? ? ? 1_555 MC DT 38   O4 ? ? AA DA 251  Ba DT 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog568   hydrog ? ? A  DA 252  N1 ? ? ? 1_555 MC DT 37   N3 ? ? AA DA 252  Ba DT 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog569   hydrog ? ? A  DA 252  N6 ? ? ? 1_555 MC DT 37   O4 ? ? AA DA 252  Ba DT 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog570   hydrog ? ? A  DG 253  N1 ? ? ? 1_555 MC DC 36   N3 ? ? AA DG 253  Ba DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog571   hydrog ? ? A  DG 253  N2 ? ? ? 1_555 MC DC 36   O2 ? ? AA DG 253  Ba DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog572   hydrog ? ? A  DG 253  O6 ? ? ? 1_555 MC DC 36   N4 ? ? AA DG 253  Ba DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog573   hydrog ? ? A  DA 254  N1 ? ? ? 1_555 MC DT 35   N3 ? ? AA DA 254  Ba DT 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog574   hydrog ? ? A  DA 254  N6 ? ? ? 1_555 MC DT 35   O4 ? ? AA DA 254  Ba DT 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog575   hydrog ? ? A  DA 255  N1 ? ? ? 1_555 MC DT 34   N3 ? ? AA DA 255  Ba DT 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog576   hydrog ? ? A  DA 255  N6 ? ? ? 1_555 MC DT 34   O4 ? ? AA DA 255  Ba DT 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog577   hydrog ? ? A  DA 256  N1 ? ? ? 1_555 MC DT 33   N3 ? ? AA DA 256  Ba DT 33   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog578   hydrog ? ? A  DA 257  N1 ? ? ? 1_555 MC DT 32   N3 ? ? AA DA 257  Ba DT 32   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog579   hydrog ? ? A  DA 258  N1 ? ? ? 1_555 MC DT 31   N3 ? ? AA DA 258  Ba DT 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog580   hydrog ? ? A  DA 258  N6 ? ? ? 1_555 MC DT 31   O4 ? ? AA DA 258  Ba DT 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog581   hydrog ? ? A  DC 259  N3 ? ? ? 1_555 RC DG 26   N1 ? ? AA DC 259  Bf DG 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog582   hydrog ? ? A  DC 259  N4 ? ? ? 1_555 RC DG 26   O6 ? ? AA DC 259  Bf DG 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog583   hydrog ? ? A  DC 259  O2 ? ? ? 1_555 RC DG 26   N2 ? ? AA DC 259  Bf DG 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog584   hydrog ? ? A  DC 260  N3 ? ? ? 1_555 RC DG 25   N1 ? ? AA DC 260  Bf DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog585   hydrog ? ? A  DC 260  N4 ? ? ? 1_555 RC DG 25   O6 ? ? AA DC 260  Bf DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog586   hydrog ? ? A  DC 260  O2 ? ? ? 1_555 RC DG 25   N2 ? ? AA DC 260  Bf DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog587   hydrog ? ? A  DA 261  N1 ? ? ? 1_555 RC DT 24   N3 ? ? AA DA 261  Bf DT 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog588   hydrog ? ? A  DA 261  N6 ? ? ? 1_555 RC DT 24   O4 ? ? AA DA 261  Bf DT 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog589   hydrog ? ? A  DC 262  N3 ? ? ? 1_555 RC DG 23   N1 ? ? AA DC 262  Bf DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog590   hydrog ? ? A  DC 262  N4 ? ? ? 1_555 RC DG 23   O6 ? ? AA DC 262  Bf DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog591   hydrog ? ? A  DC 262  O2 ? ? ? 1_555 RC DG 23   N2 ? ? AA DC 262  Bf DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog592   hydrog ? ? A  DC 263  N3 ? ? ? 1_555 RC DG 22   N1 ? ? AA DC 263  Bf DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog593   hydrog ? ? A  DC 263  N4 ? ? ? 1_555 RC DG 22   O6 ? ? AA DC 263  Bf DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog594   hydrog ? ? A  DC 263  O2 ? ? ? 1_555 RC DG 22   N2 ? ? AA DC 263  Bf DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog595   hydrog ? ? A  DC 264  N3 ? ? ? 1_555 RC DG 21   N1 ? ? AA DC 264  Bf DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog596   hydrog ? ? A  DC 264  N4 ? ? ? 1_555 RC DG 21   O6 ? ? AA DC 264  Bf DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog597   hydrog ? ? A  DC 264  O2 ? ? ? 1_555 RC DG 21   N2 ? ? AA DC 264  Bf DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog598   hydrog ? ? A  DT 265  N3 ? ? ? 1_555 RC DA 20   N1 ? ? AA DT 265  Bf DA 20   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog599   hydrog ? ? A  DG 266  O6 ? ? ? 1_555 RC DC 19   N4 ? ? AA DG 266  Bf DC 19   1_555 ? ? ? ? ? ? 'DG-DC PAIR'            
? ? 
hydrog600   hydrog ? ? A  DG 267  N1 ? ? ? 1_555 DB DC 2    N3 ? ? AA DG 267  B0 DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog601   hydrog ? ? A  DG 267  N2 ? ? ? 1_555 DB DC 2    O2 ? ? AA DG 267  B0 DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog602   hydrog ? ? A  DG 267  O6 ? ? ? 1_555 DB DC 2    N4 ? ? AA DG 267  B0 DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog603   hydrog ? ? A  DC 268  N3 ? ? ? 1_555 DB DG 1    N1 ? ? AA DC 268  B0 DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog604   hydrog ? ? A  DC 268  N4 ? ? ? 1_555 DB DG 1    O6 ? ? AA DC 268  B0 DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog605   hydrog ? ? A  DC 268  O2 ? ? ? 1_555 DB DG 1    N2 ? ? AA DC 268  B0 DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog606   hydrog ? ? A  DG 269  N1 ? ? ? 1_555 DD DC 51   N3 ? ? AA DG 269  Br DC 51   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog607   hydrog ? ? A  DG 269  N2 ? ? ? 1_555 DD DC 51   O2 ? ? AA DG 269  Br DC 51   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog608   hydrog ? ? A  DG 269  O6 ? ? ? 1_555 DD DC 51   N4 ? ? AA DG 269  Br DC 51   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog609   hydrog ? ? A  DC 270  N3 ? ? ? 1_555 DD DG 50   N1 ? ? AA DC 270  Br DG 50   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog610   hydrog ? ? A  DC 270  N4 ? ? ? 1_555 DD DG 50   O6 ? ? AA DC 270  Br DG 50   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog611   hydrog ? ? A  DC 270  O2 ? ? ? 1_555 DD DG 50   N2 ? ? AA DC 270  Br DG 50   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog612   hydrog ? ? A  DC 271  N3 ? ? ? 1_555 DD DG 49   N1 ? ? AA DC 271  Br DG 49   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog613   hydrog ? ? A  DC 271  N4 ? ? ? 1_555 DD DG 49   O6 ? ? AA DC 271  Br DG 49   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog614   hydrog ? ? A  DC 271  O2 ? ? ? 1_555 DD DG 49   N2 ? ? AA DC 271  Br DG 49   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog615   hydrog ? ? A  DC 272  N3 ? ? ? 1_555 DD DG 48   N1 ? ? AA DC 272  Br DG 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog616   hydrog ? ? A  DC 272  N4 ? ? ? 1_555 DD DG 48   O6 ? ? AA DC 272  Br DG 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog617   hydrog ? ? A  DC 272  O2 ? ? ? 1_555 DD DG 48   N2 ? ? AA DC 272  Br DG 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog618   hydrog ? ? A  DA 273  N1 ? ? ? 1_555 DD DT 47   N3 ? ? AA DA 273  Br DT 47   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog619   hydrog ? ? A  DA 274  N1 ? ? ? 1_555 DD DT 46   N3 ? ? AA DA 274  Br DT 46   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog620   hydrog ? ? A  DT 275  N3 ? ? ? 1_555 CD DA 24   N1 ? ? AA DT 275  Bq DA 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog621   hydrog ? ? A  DT 275  O4 ? ? ? 1_555 CD DA 24   N6 ? ? AA DT 275  Bq DA 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog622   hydrog ? ? A  DA 276  N1 ? ? ? 1_555 CD DT 23   N3 ? ? AA DA 276  Bq DT 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog623   hydrog ? ? A  DA 276  N6 ? ? ? 1_555 CD DT 23   O4 ? ? AA DA 276  Bq DT 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog624   hydrog ? ? A  DC 277  N3 ? ? ? 1_555 CD DG 22   N1 ? ? AA DC 277  Bq DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog625   hydrog ? ? A  DC 277  N4 ? ? ? 1_555 CD DG 22   O6 ? ? AA DC 277  Bq DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog626   hydrog ? ? A  DC 277  O2 ? ? ? 1_555 CD DG 22   N2 ? ? AA DC 277  Bq DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog627   hydrog ? ? A  DG 278  N1 ? ? ? 1_555 CD DC 21   N3 ? ? AA DG 278  Bq DC 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog628   hydrog ? ? A  DG 278  N2 ? ? ? 1_555 CD DC 21   O2 ? ? AA DG 278  Bq DC 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog629   hydrog ? ? A  DG 278  O6 ? ? ? 1_555 CD DC 21   N4 ? ? AA DG 278  Bq DC 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog630   hydrog ? ? A  DC 279  N3 ? ? ? 1_555 CD DG 20   N1 ? ? AA DC 279  Bq DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog631   hydrog ? ? A  DC 279  N4 ? ? ? 1_555 CD DG 20   O6 ? ? AA DC 279  Bq DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog632   hydrog ? ? A  DC 279  O2 ? ? ? 1_555 CD DG 20   N2 ? ? AA DC 279  Bq DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog633   hydrog ? ? A  DA 280  N1 ? ? ? 1_555 CD DT 19   N3 ? ? AA DA 280  Bq DT 19   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog634   hydrog ? ? A  DA 281  N1 ? ? ? 1_555 CD DT 18   N3 ? ? AA DA 281  Bq DT 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog635   hydrog ? ? A  DA 281  N6 ? ? ? 1_555 CD DT 18   O4 ? ? AA DA 281  Bq DT 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog636   hydrog ? ? A  DA 282  N1 ? ? ? 1_555 CD DT 17   N3 ? ? AA DA 282  Bq DT 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog637   hydrog ? ? A  DA 282  N6 ? ? ? 1_555 CD DT 17   O4 ? ? AA DA 282  Bq DT 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog638   hydrog ? ? A  DC 283  N3 ? ? ? 1_555 CD DG 6    N1 ? ? AA DC 283  Bq DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog639   hydrog ? ? A  DC 283  N4 ? ? ? 1_555 CD DG 6    O6 ? ? AA DC 283  Bq DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog640   hydrog ? ? A  DC 283  O2 ? ? ? 1_555 CD DG 6    N2 ? ? AA DC 283  Bq DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog641   hydrog ? ? A  DC 284  N3 ? ? ? 1_555 CD DG 5    N1 ? ? AA DC 284  Bq DG 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog642   hydrog ? ? A  DC 284  N4 ? ? ? 1_555 CD DG 5    O6 ? ? AA DC 284  Bq DG 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog643   hydrog ? ? A  DC 284  O2 ? ? ? 1_555 CD DG 5    N2 ? ? AA DC 284  Bq DG 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog644   hydrog ? ? A  DG 285  N1 ? ? ? 1_555 CD DC 4    N3 ? ? AA DG 285  Bq DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog645   hydrog ? ? A  DG 285  N2 ? ? ? 1_555 CD DC 4    O2 ? ? AA DG 285  Bq DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog646   hydrog ? ? A  DG 285  O6 ? ? ? 1_555 CD DC 4    N4 ? ? AA DG 285  Bq DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog647   hydrog ? ? A  DC 286  N3 ? ? ? 1_555 CD DG 3    N1 ? ? AA DC 286  Bq DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog648   hydrog ? ? A  DC 286  N4 ? ? ? 1_555 CD DG 3    O6 ? ? AA DC 286  Bq DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog649   hydrog ? ? A  DC 286  O2 ? ? ? 1_555 CD DG 3    N2 ? ? AA DC 286  Bq DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog650   hydrog ? ? A  DC 287  N3 ? ? ? 1_555 CD DG 2    N1 ? ? AA DC 287  Bq DG 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog651   hydrog ? ? A  DC 287  N4 ? ? ? 1_555 CD DG 2    O6 ? ? AA DC 287  Bq DG 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog652   hydrog ? ? A  DC 287  O2 ? ? ? 1_555 CD DG 2    N2 ? ? AA DC 287  Bq DG 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog653   hydrog ? ? A  DT 288  N3 ? ? ? 1_555 CD DA 1    N1 ? ? AA DT 288  Bq DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog654   hydrog ? ? A  DT 288  O4 ? ? ? 1_555 CD DA 1    N6 ? ? AA DT 288  Bq DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog655   hydrog ? ? A  DC 289  N3 ? ? ? 1_555 IB DG 40   N1 ? ? AA DC 289  B5 DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog656   hydrog ? ? A  DC 289  N4 ? ? ? 1_555 IB DG 40   O6 ? ? AA DC 289  B5 DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog657   hydrog ? ? A  DC 289  O2 ? ? ? 1_555 IB DG 40   N2 ? ? AA DC 289  B5 DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog658   hydrog ? ? A  DT 290  N3 ? ? ? 1_555 IB DA 39   N1 ? ? AA DT 290  B5 DA 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog659   hydrog ? ? A  DT 290  O4 ? ? ? 1_555 IB DA 39   N6 ? ? AA DT 290  B5 DA 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog660   hydrog ? ? A  DC 291  N3 ? ? ? 1_555 DB DG 10   N1 ? ? AA DC 291  B0 DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog661   hydrog ? ? A  DC 291  N4 ? ? ? 1_555 DB DG 10   O6 ? ? AA DC 291  B0 DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog662   hydrog ? ? A  DC 291  O2 ? ? ? 1_555 DB DG 10   N2 ? ? AA DC 291  B0 DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog663   hydrog ? ? A  DC 292  N3 ? ? ? 1_555 DB DG 9    N1 ? ? AA DC 292  B0 DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog664   hydrog ? ? A  DC 292  N4 ? ? ? 1_555 DB DG 9    O6 ? ? AA DC 292  B0 DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog665   hydrog ? ? A  DC 292  O2 ? ? ? 1_555 DB DG 9    N2 ? ? AA DC 292  B0 DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog666   hydrog ? ? A  DC 293  N3 ? ? ? 1_555 DB DG 8    N1 ? ? AA DC 293  B0 DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog667   hydrog ? ? A  DC 293  N4 ? ? ? 1_555 DB DG 8    O6 ? ? AA DC 293  B0 DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog668   hydrog ? ? A  DC 293  O2 ? ? ? 1_555 DB DG 8    N2 ? ? AA DC 293  B0 DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog669   hydrog ? ? A  DC 294  N3 ? ? ? 1_555 DB DG 7    N1 ? ? AA DC 294  B0 DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog670   hydrog ? ? A  DC 294  N4 ? ? ? 1_555 DB DG 7    O6 ? ? AA DC 294  B0 DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog671   hydrog ? ? A  DC 294  O2 ? ? ? 1_555 DB DG 7    N2 ? ? AA DC 294  B0 DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog672   hydrog ? ? A  DG 295  N1 ? ? ? 1_555 DB DC 6    N3 ? ? AA DG 295  B0 DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog673   hydrog ? ? A  DG 295  N2 ? ? ? 1_555 DB DC 6    O2 ? ? AA DG 295  B0 DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog674   hydrog ? ? A  DG 295  O6 ? ? ? 1_555 DB DC 6    N4 ? ? AA DG 295  B0 DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog675   hydrog ? ? A  DC 296  N3 ? ? ? 1_555 DB DG 5    N1 ? ? AA DC 296  B0 DG 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog676   hydrog ? ? A  DC 296  N4 ? ? ? 1_555 DB DG 5    O6 ? ? AA DC 296  B0 DG 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog677   hydrog ? ? A  DC 296  O2 ? ? ? 1_555 DB DG 5    N2 ? ? AA DC 296  B0 DG 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog678   hydrog ? ? A  DG 297  N1 ? ? ? 1_555 DB DC 4    N3 ? ? AA DG 297  B0 DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog679   hydrog ? ? A  DG 297  N2 ? ? ? 1_555 DB DC 4    O2 ? ? AA DG 297  B0 DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog680   hydrog ? ? A  DG 297  O6 ? ? ? 1_555 DB DC 4    N4 ? ? AA DG 297  B0 DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog681   hydrog ? ? A  DC 298  N3 ? ? ? 1_555 DB DG 3    N1 ? ? AA DC 298  B0 DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog682   hydrog ? ? A  DC 298  N4 ? ? ? 1_555 DB DG 3    O6 ? ? AA DC 298  B0 DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog683   hydrog ? ? A  DC 298  O2 ? ? ? 1_555 DB DG 3    N2 ? ? AA DC 298  B0 DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog684   hydrog ? ? A  DG 299  N1 ? ? ? 1_555 RC DC 18   N3 ? ? AA DG 299  Bf DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog685   hydrog ? ? A  DG 299  N2 ? ? ? 1_555 RC DC 18   O2 ? ? AA DG 299  Bf DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog686   hydrog ? ? A  DG 299  O6 ? ? ? 1_555 RC DC 18   N4 ? ? AA DG 299  Bf DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog687   hydrog ? ? A  DT 300  N3 ? ? ? 1_555 RC DA 17   N1 ? ? AA DT 300  Bf DA 17   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog688   hydrog ? ? A  DT 301  N3 ? ? ? 1_555 RC DA 16   N1 ? ? AA DT 301  Bf DA 16   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog689   hydrog ? ? A  DG 302  N1 ? ? ? 1_555 RC DC 15   N3 ? ? AA DG 302  Bf DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog690   hydrog ? ? A  DG 302  N2 ? ? ? 1_555 RC DC 15   O2 ? ? AA DG 302  Bf DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog691   hydrog ? ? A  DG 302  O6 ? ? ? 1_555 RC DC 15   N4 ? ? AA DG 302  Bf DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog692   hydrog ? ? A  DG 303  N1 ? ? ? 1_555 RC DC 14   N3 ? ? AA DG 303  Bf DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog693   hydrog ? ? A  DG 303  N2 ? ? ? 1_555 RC DC 14   O2 ? ? AA DG 303  Bf DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog694   hydrog ? ? A  DG 303  O6 ? ? ? 1_555 RC DC 14   N4 ? ? AA DG 303  Bf DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog695   hydrog ? ? A  DC 304  N3 ? ? ? 1_555 RC DG 13   N1 ? ? AA DC 304  Bf DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog696   hydrog ? ? A  DC 304  N4 ? ? ? 1_555 RC DG 13   O6 ? ? AA DC 304  Bf DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog697   hydrog ? ? A  DC 304  O2 ? ? ? 1_555 RC DG 13   N2 ? ? AA DC 304  Bf DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog698   hydrog ? ? A  DC 305  N3 ? ? ? 1_555 RC DG 12   N1 ? ? AA DC 305  Bf DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog699   hydrog ? ? A  DC 305  N4 ? ? ? 1_555 RC DG 12   O6 ? ? AA DC 305  Bf DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog700   hydrog ? ? A  DC 305  O2 ? ? ? 1_555 RC DG 12   N2 ? ? AA DC 305  Bf DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog701   hydrog ? ? A  DG 306  N1 ? ? ? 1_555 RC DC 11   N3 ? ? AA DG 306  Bf DC 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog702   hydrog ? ? A  DG 306  N2 ? ? ? 1_555 RC DC 11   O2 ? ? AA DG 306  Bf DC 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog703   hydrog ? ? A  DG 306  O6 ? ? ? 1_555 RC DC 11   N4 ? ? AA DG 306  Bf DC 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog704   hydrog ? ? A  DA 307  N1 ? ? ? 1_555 YC DT 26   N3 ? ? AA DA 307  Bm DT 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog705   hydrog ? ? A  DA 307  N6 ? ? ? 1_555 YC DT 26   O4 ? ? AA DA 307  Bm DT 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog706   hydrog ? ? A  DT 308  N3 ? ? ? 1_555 YC DA 25   N1 ? ? AA DT 308  Bm DA 25   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog707   hydrog ? ? A  DT 309  N3 ? ? ? 1_555 YC DA 24   N1 ? ? AA DT 309  Bm DA 24   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog708   hydrog ? ? A  DC 310  N3 ? ? ? 1_555 YC DG 23   N1 ? ? AA DC 310  Bm DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog709   hydrog ? ? A  DC 310  N4 ? ? ? 1_555 YC DG 23   O6 ? ? AA DC 310  Bm DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog710   hydrog ? ? A  DC 310  O2 ? ? ? 1_555 YC DG 23   N2 ? ? AA DC 310  Bm DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog711   hydrog ? ? A  DA 311  N1 ? ? ? 1_555 YC DT 22   N3 ? ? AA DA 311  Bm DT 22   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog712   hydrog ? ? A  DT 312  N3 ? ? ? 1_555 YC DA 21   N1 ? ? AA DT 312  Bm DA 21   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog713   hydrog ? ? A  DT 313  N3 ? ? ? 1_555 YC DA 20   N1 ? ? AA DT 313  Bm DA 20   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog714   hydrog ? ? A  DA 314  N1 ? ? ? 1_555 YC DT 19   N3 ? ? AA DA 314  Bm DT 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog715   hydrog ? ? A  DA 314  N6 ? ? ? 1_555 YC DT 19   O4 ? ? AA DA 314  Bm DT 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog716   hydrog ? ? A  DA 315  N1 ? ? ? 1_555 AD DT 14   N3 ? ? AA DA 315  Bo DT 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog717   hydrog ? ? A  DA 315  N6 ? ? ? 1_555 AD DT 14   O4 ? ? AA DA 315  Bo DT 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog718   hydrog ? ? A  DT 316  N3 ? ? ? 1_555 AD DA 13   N1 ? ? AA DT 316  Bo DA 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog719   hydrog ? ? A  DT 316  O4 ? ? ? 1_555 AD DA 13   N6 ? ? AA DT 316  Bo DA 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog720   hydrog ? ? A  DG 317  N1 ? ? ? 1_555 AD DC 12   N3 ? ? AA DG 317  Bo DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog721   hydrog ? ? A  DG 317  N2 ? ? ? 1_555 AD DC 12   O2 ? ? AA DG 317  Bo DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog722   hydrog ? ? A  DG 317  O6 ? ? ? 1_555 AD DC 12   N4 ? ? AA DG 317  Bo DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog723   hydrog ? ? A  DC 318  N3 ? ? ? 1_555 AD DG 11   N1 ? ? AA DC 318  Bo DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog724   hydrog ? ? A  DC 318  N4 ? ? ? 1_555 AD DG 11   O6 ? ? AA DC 318  Bo DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog725   hydrog ? ? A  DC 318  O2 ? ? ? 1_555 AD DG 11   N2 ? ? AA DC 318  Bo DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog726   hydrog ? ? A  DA 319  N1 ? ? ? 1_555 AD DT 10   N3 ? ? AA DA 319  Bo DT 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog727   hydrog ? ? A  DA 319  N6 ? ? ? 1_555 AD DT 10   O4 ? ? AA DA 319  Bo DT 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog728   hydrog ? ? A  DG 320  N1 ? ? ? 1_555 AD DC 9    N3 ? ? AA DG 320  Bo DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog729   hydrog ? ? A  DG 320  N2 ? ? ? 1_555 AD DC 9    O2 ? ? AA DG 320  Bo DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog730   hydrog ? ? A  DG 320  O6 ? ? ? 1_555 AD DC 9    N4 ? ? AA DG 320  Bo DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog731   hydrog ? ? A  DC 321  N3 ? ? ? 1_555 AD DG 8    N1 ? ? AA DC 321  Bo DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog732   hydrog ? ? A  DC 321  N4 ? ? ? 1_555 AD DG 8    O6 ? ? AA DC 321  Bo DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog733   hydrog ? ? A  DC 321  O2 ? ? ? 1_555 AD DG 8    N2 ? ? AA DC 321  Bo DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog734   hydrog ? ? A  DT 322  N3 ? ? ? 1_555 AD DA 7    N1 ? ? AA DT 322  Bo DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog735   hydrog ? ? A  DT 322  O4 ? ? ? 1_555 AD DA 7    N6 ? ? AA DT 322  Bo DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog736   hydrog ? ? A  DG 323  N1 ? ? ? 1_555 ZC DC 49   N3 ? ? AA DG 323  Bn DC 49   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog737   hydrog ? ? A  DG 323  N2 ? ? ? 1_555 ZC DC 49   O2 ? ? AA DG 323  Bn DC 49   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog738   hydrog ? ? A  DG 323  O6 ? ? ? 1_555 ZC DC 49   N4 ? ? AA DG 323  Bn DC 49   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog739   hydrog ? ? A  DG 324  N1 ? ? ? 1_555 ZC DC 48   N3 ? ? AA DG 324  Bn DC 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog740   hydrog ? ? A  DG 324  N2 ? ? ? 1_555 ZC DC 48   O2 ? ? AA DG 324  Bn DC 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog741   hydrog ? ? A  DG 324  O6 ? ? ? 1_555 ZC DC 48   N4 ? ? AA DG 324  Bn DC 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog742   hydrog ? ? A  DC 325  N3 ? ? ? 1_555 ZC DG 47   N1 ? ? AA DC 325  Bn DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog743   hydrog ? ? A  DC 325  N4 ? ? ? 1_555 ZC DG 47   O6 ? ? AA DC 325  Bn DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog744   hydrog ? ? A  DC 325  O2 ? ? ? 1_555 ZC DG 47   N2 ? ? AA DC 325  Bn DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog745   hydrog ? ? A  DA 326  N1 ? ? ? 1_555 ZC DT 46   N3 ? ? AA DA 326  Bn DT 46   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog746   hydrog ? ? A  DC 327  N3 ? ? ? 1_555 ZC DG 45   N1 ? ? AA DC 327  Bn DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog747   hydrog ? ? A  DC 327  N4 ? ? ? 1_555 ZC DG 45   O6 ? ? AA DC 327  Bn DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog748   hydrog ? ? A  DC 327  O2 ? ? ? 1_555 ZC DG 45   N2 ? ? AA DC 327  Bn DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog749   hydrog ? ? A  DG 328  N1 ? ? ? 1_555 ZC DC 44   N3 ? ? AA DG 328  Bn DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog750   hydrog ? ? A  DG 328  N2 ? ? ? 1_555 ZC DC 44   O2 ? ? AA DG 328  Bn DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog751   hydrog ? ? A  DG 328  O6 ? ? ? 1_555 ZC DC 44   N4 ? ? AA DG 328  Bn DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog752   hydrog ? ? A  DA 329  N1 ? ? ? 1_555 ZC DT 43   N3 ? ? AA DA 329  Bn DT 43   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog753   hydrog ? ? A  DC 330  N3 ? ? ? 1_555 ZC DG 42   N1 ? ? AA DC 330  Bn DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog754   hydrog ? ? A  DC 330  N4 ? ? ? 1_555 ZC DG 42   O6 ? ? AA DC 330  Bn DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog755   hydrog ? ? A  DC 330  O2 ? ? ? 1_555 ZC DG 42   N2 ? ? AA DC 330  Bn DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog756   hydrog ? ? A  DA 331  N1 ? ? ? 1_555 WC DT 5    N3 ? ? AA DA 331  Bk DT 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog757   hydrog ? ? A  DA 331  N6 ? ? ? 1_555 WC DT 5    O4 ? ? AA DA 331  Bk DT 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog758   hydrog ? ? A  DG 332  N1 ? ? ? 1_555 WC DC 4    N3 ? ? AA DG 332  Bk DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog759   hydrog ? ? A  DG 332  N2 ? ? ? 1_555 WC DC 4    O2 ? ? AA DG 332  Bk DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog760   hydrog ? ? A  DG 332  O6 ? ? ? 1_555 WC DC 4    N4 ? ? AA DG 332  Bk DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog761   hydrog ? ? A  DG 333  N1 ? ? ? 1_555 WC DC 3    N3 ? ? AA DG 333  Bk DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog762   hydrog ? ? A  DG 333  N2 ? ? ? 1_555 WC DC 3    O2 ? ? AA DG 333  Bk DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog763   hydrog ? ? A  DG 333  O6 ? ? ? 1_555 WC DC 3    N4 ? ? AA DG 333  Bk DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog764   hydrog ? ? A  DT 334  N3 ? ? ? 1_555 WC DA 2    N1 ? ? AA DT 334  Bk DA 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog765   hydrog ? ? A  DT 334  O4 ? ? ? 1_555 WC DA 2    N6 ? ? AA DT 334  Bk DA 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog766   hydrog ? ? A  DT 335  N3 ? ? ? 1_555 WC DA 1    N1 ? ? AA DT 335  Bk DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog767   hydrog ? ? A  DT 335  O4 ? ? ? 1_555 WC DA 1    N6 ? ? AA DT 335  Bk DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog768   hydrog ? ? A  DT 336  N3 ? ? ? 1_555 AD DA 67   N1 ? ? AA DT 336  Bo DA 67   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog769   hydrog ? ? A  DT 336  O4 ? ? ? 1_555 AD DA 67   N6 ? ? AA DT 336  Bo DA 67   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog770   hydrog ? ? A  DC 337  N3 ? ? ? 1_555 AD DG 66   N1 ? ? AA DC 337  Bo DG 66   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog771   hydrog ? ? A  DC 337  N4 ? ? ? 1_555 AD DG 66   O6 ? ? AA DC 337  Bo DG 66   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog772   hydrog ? ? A  DC 337  O2 ? ? ? 1_555 AD DG 66   N2 ? ? AA DC 337  Bo DG 66   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog773   hydrog ? ? A  DC 338  N3 ? ? ? 1_555 AD DG 65   N1 ? ? AA DC 338  Bo DG 65   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog774   hydrog ? ? A  DC 338  N4 ? ? ? 1_555 AD DG 65   O6 ? ? AA DC 338  Bo DG 65   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog775   hydrog ? ? A  DC 338  O2 ? ? ? 1_555 AD DG 65   N2 ? ? AA DC 338  Bo DG 65   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog776   hydrog ? ? A  DC 339  N3 ? ? ? 1_555 AD DG 22   N1 ? ? AA DC 339  Bo DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog777   hydrog ? ? A  DC 339  N4 ? ? ? 1_555 AD DG 22   O6 ? ? AA DC 339  Bo DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog778   hydrog ? ? A  DC 339  O2 ? ? ? 1_555 AD DG 22   N2 ? ? AA DC 339  Bo DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog779   hydrog ? ? A  DG 340  N1 ? ? ? 1_555 AD DC 21   N3 ? ? AA DG 340  Bo DC 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog780   hydrog ? ? A  DG 340  N2 ? ? ? 1_555 AD DC 21   O2 ? ? AA DG 340  Bo DC 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog781   hydrog ? ? A  DG 340  O6 ? ? ? 1_555 AD DC 21   N4 ? ? AA DG 340  Bo DC 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog782   hydrog ? ? A  DA 341  N1 ? ? ? 1_555 AD DT 20   N3 ? ? AA DA 341  Bo DT 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog783   hydrog ? ? A  DA 341  N6 ? ? ? 1_555 AD DT 20   O4 ? ? AA DA 341  Bo DT 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog784   hydrog ? ? A  DC 342  N3 ? ? ? 1_555 AD DG 19   N1 ? ? AA DC 342  Bo DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog785   hydrog ? ? A  DC 342  N4 ? ? ? 1_555 AD DG 19   O6 ? ? AA DC 342  Bo DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog786   hydrog ? ? A  DC 342  O2 ? ? ? 1_555 AD DG 19   N2 ? ? AA DC 342  Bo DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog787   hydrog ? ? A  DT 343  N3 ? ? ? 1_555 AD DA 18   N1 ? ? AA DT 343  Bo DA 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog788   hydrog ? ? A  DT 343  O4 ? ? ? 1_555 AD DA 18   N6 ? ? AA DT 343  Bo DA 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog789   hydrog ? ? A  DG 344  N1 ? ? ? 1_555 AD DC 17   N3 ? ? AA DG 344  Bo DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog790   hydrog ? ? A  DG 344  N2 ? ? ? 1_555 AD DC 17   O2 ? ? AA DG 344  Bo DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog791   hydrog ? ? A  DG 344  O6 ? ? ? 1_555 AD DC 17   N4 ? ? AA DG 344  Bo DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog792   hydrog ? ? A  DG 345  N1 ? ? ? 1_555 AD DC 16   N3 ? ? AA DG 345  Bo DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog793   hydrog ? ? A  DG 345  N2 ? ? ? 1_555 AD DC 16   O2 ? ? AA DG 345  Bo DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog794   hydrog ? ? A  DG 345  O6 ? ? ? 1_555 AD DC 16   N4 ? ? AA DG 345  Bo DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog795   hydrog ? ? A  DA 346  N1 ? ? ? 1_555 AD DT 15   N3 ? ? AA DA 346  Bo DT 15   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog796   hydrog ? ? A  DA 347  N1 ? ? ? 1_555 YC DT 18   N3 ? ? AA DA 347  Bm DT 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog797   hydrog ? ? A  DA 347  N6 ? ? ? 1_555 YC DT 18   O4 ? ? AA DA 347  Bm DT 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog798   hydrog ? ? A  DA 348  N1 ? ? ? 1_555 YC DT 17   N3 ? ? AA DA 348  Bm DT 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog799   hydrog ? ? A  DA 348  N6 ? ? ? 1_555 YC DT 17   O4 ? ? AA DA 348  Bm DT 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog800   hydrog ? ? A  DG 349  N1 ? ? ? 1_555 YC DC 16   N3 ? ? AA DG 349  Bm DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog801   hydrog ? ? A  DG 349  N2 ? ? ? 1_555 YC DC 16   O2 ? ? AA DG 349  Bm DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog802   hydrog ? ? A  DG 349  O6 ? ? ? 1_555 YC DC 16   N4 ? ? AA DG 349  Bm DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog803   hydrog ? ? A  DC 350  N3 ? ? ? 1_555 YC DG 15   N1 ? ? AA DC 350  Bm DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog804   hydrog ? ? A  DC 350  N4 ? ? ? 1_555 YC DG 15   O6 ? ? AA DC 350  Bm DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog805   hydrog ? ? A  DC 350  O2 ? ? ? 1_555 YC DG 15   N2 ? ? AA DC 350  Bm DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog806   hydrog ? ? A  DG 351  N1 ? ? ? 1_555 YC DC 14   N3 ? ? AA DG 351  Bm DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog807   hydrog ? ? A  DG 351  N2 ? ? ? 1_555 YC DC 14   O2 ? ? AA DG 351  Bm DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog808   hydrog ? ? A  DG 351  O6 ? ? ? 1_555 YC DC 14   N4 ? ? AA DG 351  Bm DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog809   hydrog ? ? A  DG 352  N1 ? ? ? 1_555 YC DC 13   N3 ? ? AA DG 352  Bm DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog810   hydrog ? ? A  DG 352  N2 ? ? ? 1_555 YC DC 13   O2 ? ? AA DG 352  Bm DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog811   hydrog ? ? A  DG 352  O6 ? ? ? 1_555 YC DC 13   N4 ? ? AA DG 352  Bm DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog812   hydrog ? ? A  DG 353  N1 ? ? ? 1_555 YC DC 12   N3 ? ? AA DG 353  Bm DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog813   hydrog ? ? A  DG 353  N2 ? ? ? 1_555 YC DC 12   O2 ? ? AA DG 353  Bm DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog814   hydrog ? ? A  DG 353  O6 ? ? ? 1_555 YC DC 12   N4 ? ? AA DG 353  Bm DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog815   hydrog ? ? A  DC 354  N3 ? ? ? 1_555 YC DG 11   N1 ? ? AA DC 354  Bm DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog816   hydrog ? ? A  DC 354  N4 ? ? ? 1_555 YC DG 11   O6 ? ? AA DC 354  Bm DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog817   hydrog ? ? A  DC 354  O2 ? ? ? 1_555 YC DG 11   N2 ? ? AA DC 354  Bm DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog818   hydrog ? ? A  DA 355  N1 ? ? ? 1_555 OC DT 24   N3 ? ? AA DA 355  Bc DT 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog819   hydrog ? ? A  DA 355  N6 ? ? ? 1_555 OC DT 24   O4 ? ? AA DA 355  Bc DT 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog820   hydrog ? ? A  DG 356  N1 ? ? ? 1_555 OC DC 23   N3 ? ? AA DG 356  Bc DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog821   hydrog ? ? A  DG 356  N2 ? ? ? 1_555 OC DC 23   O2 ? ? AA DG 356  Bc DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog822   hydrog ? ? A  DG 356  O6 ? ? ? 1_555 OC DC 23   N4 ? ? AA DG 356  Bc DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog823   hydrog ? ? A  DT 357  N3 ? ? ? 1_555 OC DA 22   N1 ? ? AA DT 357  Bc DA 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog824   hydrog ? ? A  DT 357  O4 ? ? ? 1_555 OC DA 22   N6 ? ? AA DT 357  Bc DA 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog825   hydrog ? ? A  DG 358  N1 ? ? ? 1_555 OC DC 21   N3 ? ? AA DG 358  Bc DC 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog826   hydrog ? ? A  DG 358  N2 ? ? ? 1_555 OC DC 21   O2 ? ? AA DG 358  Bc DC 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog827   hydrog ? ? A  DG 358  O6 ? ? ? 1_555 OC DC 21   N4 ? ? AA DG 358  Bc DC 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog828   hydrog ? ? A  DA 359  N1 ? ? ? 1_555 OC DT 20   N3 ? ? AA DA 359  Bc DT 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog829   hydrog ? ? A  DA 359  N6 ? ? ? 1_555 OC DT 20   O4 ? ? AA DA 359  Bc DT 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog830   hydrog ? ? A  DG 360  N1 ? ? ? 1_555 OC DC 19   N3 ? ? AA DG 360  Bc DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog831   hydrog ? ? A  DG 360  N2 ? ? ? 1_555 OC DC 19   O2 ? ? AA DG 360  Bc DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog832   hydrog ? ? A  DG 360  O6 ? ? ? 1_555 OC DC 19   N4 ? ? AA DG 360  Bc DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog833   hydrog ? ? A  DC 361  N3 ? ? ? 1_555 OC DG 18   N1 ? ? AA DC 361  Bc DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog834   hydrog ? ? A  DC 361  N4 ? ? ? 1_555 OC DG 18   O6 ? ? AA DC 361  Bc DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog835   hydrog ? ? A  DC 361  O2 ? ? ? 1_555 OC DG 18   N2 ? ? AA DC 361  Bc DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog836   hydrog ? ? A  DG 362  N1 ? ? ? 1_555 OC DC 17   N3 ? ? AA DG 362  Bc DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog837   hydrog ? ? A  DG 362  N2 ? ? ? 1_555 OC DC 17   O2 ? ? AA DG 362  Bc DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog838   hydrog ? ? A  DG 362  O6 ? ? ? 1_555 OC DC 17   N4 ? ? AA DG 362  Bc DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog839   hydrog ? ? A  DC 363  N3 ? ? ? 1_555 JC DG 6    N1 ? ? AA DC 363  BX DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog840   hydrog ? ? A  DC 363  N4 ? ? ? 1_555 JC DG 6    O6 ? ? AA DC 363  BX DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog841   hydrog ? ? A  DC 363  O2 ? ? ? 1_555 JC DG 6    N2 ? ? AA DC 363  BX DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog842   hydrog ? ? A  DA 364  N1 ? ? ? 1_555 JC DT 5    N3 ? ? AA DA 364  BX DT 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog843   hydrog ? ? A  DA 364  N6 ? ? ? 1_555 JC DT 5    O4 ? ? AA DA 364  BX DT 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog844   hydrog ? ? A  DA 365  N1 ? ? ? 1_555 JC DT 4    N3 ? ? AA DA 365  BX DT 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog845   hydrog ? ? A  DA 365  N6 ? ? ? 1_555 JC DT 4    O4 ? ? AA DA 365  BX DT 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog846   hydrog ? ? A  DC 366  N3 ? ? ? 1_555 JC DG 3    N1 ? ? AA DC 366  BX DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog847   hydrog ? ? A  DC 366  N4 ? ? ? 1_555 JC DG 3    O6 ? ? AA DC 366  BX DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog848   hydrog ? ? A  DC 366  O2 ? ? ? 1_555 JC DG 3    N2 ? ? AA DC 366  BX DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog849   hydrog ? ? A  DG 367  N1 ? ? ? 1_555 JC DC 2    N3 ? ? AA DG 367  BX DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog850   hydrog ? ? A  DG 367  N2 ? ? ? 1_555 JC DC 2    O2 ? ? AA DG 367  BX DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog851   hydrog ? ? A  DG 367  O6 ? ? ? 1_555 JC DC 2    N4 ? ? AA DG 367  BX DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog852   hydrog ? ? A  DC 368  N3 ? ? ? 1_555 JC DG 1    N1 ? ? AA DC 368  BX DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog853   hydrog ? ? A  DC 368  N4 ? ? ? 1_555 JC DG 1    O6 ? ? AA DC 368  BX DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog854   hydrog ? ? A  DC 368  O2 ? ? ? 1_555 JC DG 1    N2 ? ? AA DC 368  BX DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog855   hydrog ? ? A  DA 369  N1 ? ? ? 1_555 CD DT 58   N3 ? ? AA DA 369  Bq DT 58   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog856   hydrog ? ? A  DA 369  N6 ? ? ? 1_555 CD DT 58   O4 ? ? AA DA 369  Bq DT 58   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog857   hydrog ? ? A  DA 370  N1 ? ? ? 1_555 CD DT 57   N3 ? ? AA DA 370  Bq DT 57   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog858   hydrog ? ? A  DA 370  N6 ? ? ? 1_555 CD DT 57   O4 ? ? AA DA 370  Bq DT 57   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog859   hydrog ? ? A  DT 371  N3 ? ? ? 1_555 NC DA 44   N1 ? ? AA DT 371  Bb DA 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog860   hydrog ? ? A  DT 371  O4 ? ? ? 1_555 NC DA 44   N6 ? ? AA DT 371  Bb DA 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog861   hydrog ? ? A  DT 372  N3 ? ? ? 1_555 NC DA 43   N1 ? ? AA DT 372  Bb DA 43   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog862   hydrog ? ? A  DA 373  N1 ? ? ? 1_555 NC DT 42   N3 ? ? AA DA 373  Bb DT 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog863   hydrog ? ? A  DA 373  N6 ? ? ? 1_555 NC DT 42   O4 ? ? AA DA 373  Bb DT 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog864   hydrog ? ? A  DA 374  N1 ? ? ? 1_555 NC DT 41   N3 ? ? AA DA 374  Bb DT 41   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog865   hydrog ? ? A  DT 375  N3 ? ? ? 1_555 NC DA 40   N1 ? ? AA DT 375  Bb DA 40   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog866   hydrog ? ? A  DG 376  N1 ? ? ? 1_555 NC DC 39   N3 ? ? AA DG 376  Bb DC 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog867   hydrog ? ? A  DG 376  N2 ? ? ? 1_555 NC DC 39   O2 ? ? AA DG 376  Bb DC 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog868   hydrog ? ? A  DG 376  O6 ? ? ? 1_555 NC DC 39   N4 ? ? AA DG 376  Bb DC 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog869   hydrog ? ? A  DT 377  N3 ? ? ? 1_555 NC DA 38   N1 ? ? AA DT 377  Bb DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog870   hydrog ? ? A  DT 377  O4 ? ? ? 1_555 NC DA 38   N6 ? ? AA DT 377  Bb DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog871   hydrog ? ? A  DG 378  N1 ? ? ? 1_555 NC DC 37   N3 ? ? AA DG 378  Bb DC 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog872   hydrog ? ? A  DG 378  N2 ? ? ? 1_555 NC DC 37   O2 ? ? AA DG 378  Bb DC 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog873   hydrog ? ? A  DG 378  O6 ? ? ? 1_555 NC DC 37   N4 ? ? AA DG 378  Bb DC 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog874   hydrog ? ? A  DA 379  N1 ? ? ? 1_555 NC DT 26   N3 ? ? AA DA 379  Bb DT 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog875   hydrog ? ? A  DA 379  N6 ? ? ? 1_555 NC DT 26   O4 ? ? AA DA 379  Bb DT 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog876   hydrog ? ? A  DG 380  N1 ? ? ? 1_555 NC DC 25   N3 ? ? AA DG 380  Bb DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog877   hydrog ? ? A  DG 380  N2 ? ? ? 1_555 NC DC 25   O2 ? ? AA DG 380  Bb DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog878   hydrog ? ? A  DG 380  O6 ? ? ? 1_555 NC DC 25   N4 ? ? AA DG 380  Bb DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog879   hydrog ? ? A  DT 381  N3 ? ? ? 1_555 NC DA 24   N1 ? ? AA DT 381  Bb DA 24   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog880   hydrog ? ? A  DT 382  N3 ? ? ? 1_555 NC DA 23   N1 ? ? AA DT 382  Bb DA 23   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog881   hydrog ? ? A  DA 383  N1 ? ? ? 1_555 NC DT 22   N3 ? ? AA DA 383  Bb DT 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog882   hydrog ? ? A  DA 383  N6 ? ? ? 1_555 NC DT 22   O4 ? ? AA DA 383  Bb DT 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog883   hydrog ? ? A  DG 384  N1 ? ? ? 1_555 NC DC 21   N3 ? ? AA DG 384  Bb DC 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog884   hydrog ? ? A  DG 384  N2 ? ? ? 1_555 NC DC 21   O2 ? ? AA DG 384  Bb DC 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog885   hydrog ? ? A  DG 384  O6 ? ? ? 1_555 NC DC 21   N4 ? ? AA DG 384  Bb DC 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog886   hydrog ? ? A  DC 385  N3 ? ? ? 1_555 NC DG 20   N1 ? ? AA DC 385  Bb DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog887   hydrog ? ? A  DC 385  N4 ? ? ? 1_555 NC DG 20   O6 ? ? AA DC 385  Bb DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog888   hydrog ? ? A  DC 385  O2 ? ? ? 1_555 NC DG 20   N2 ? ? AA DC 385  Bb DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog889   hydrog ? ? A  DT 386  N3 ? ? ? 1_555 NC DA 19   N1 ? ? AA DT 386  Bb DA 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog890   hydrog ? ? A  DT 386  O4 ? ? ? 1_555 NC DA 19   N6 ? ? AA DT 386  Bb DA 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog891   hydrog ? ? A  DC 387  N3 ? ? ? 1_555 JC DG 14   N1 ? ? AA DC 387  BX DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog892   hydrog ? ? A  DC 387  N4 ? ? ? 1_555 JC DG 14   O6 ? ? AA DC 387  BX DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog893   hydrog ? ? A  DC 387  O2 ? ? ? 1_555 JC DG 14   N2 ? ? AA DC 387  BX DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog894   hydrog ? ? A  DA 388  N1 ? ? ? 1_555 JC DT 13   N3 ? ? AA DA 388  BX DT 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog895   hydrog ? ? A  DA 388  N6 ? ? ? 1_555 JC DT 13   O4 ? ? AA DA 388  BX DT 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog896   hydrog ? ? A  DC 389  N3 ? ? ? 1_555 JC DG 12   N1 ? ? AA DC 389  BX DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog897   hydrog ? ? A  DC 389  N4 ? ? ? 1_555 JC DG 12   O6 ? ? AA DC 389  BX DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog898   hydrog ? ? A  DC 389  O2 ? ? ? 1_555 JC DG 12   N2 ? ? AA DC 389  BX DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog899   hydrog ? ? A  DT 390  N3 ? ? ? 1_555 JC DA 11   N1 ? ? AA DT 390  BX DA 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog900   hydrog ? ? A  DT 390  O4 ? ? ? 1_555 JC DA 11   N6 ? ? AA DT 390  BX DA 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog901   hydrog ? ? A  DC 391  N3 ? ? ? 1_555 JC DG 10   N1 ? ? AA DC 391  BX DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog902   hydrog ? ? A  DC 391  N4 ? ? ? 1_555 JC DG 10   O6 ? ? AA DC 391  BX DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog903   hydrog ? ? A  DC 391  O2 ? ? ? 1_555 JC DG 10   N2 ? ? AA DC 391  BX DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog904   hydrog ? ? A  DA 392  N1 ? ? ? 1_555 JC DT 9    N3 ? ? AA DA 392  BX DT 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog905   hydrog ? ? A  DA 392  N6 ? ? ? 1_555 JC DT 9    O4 ? ? AA DA 392  BX DT 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog906   hydrog ? ? A  DT 393  N3 ? ? ? 1_555 JC DA 8    N1 ? ? AA DT 393  BX DA 8    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog907   hydrog ? ? A  DT 394  N3 ? ? ? 1_555 JC DA 7    N1 ? ? AA DT 394  BX DA 7    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog908   hydrog ? ? A  DA 395  N1 ? ? ? 1_555 OC DT 16   N3 ? ? AA DA 395  Bc DT 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog909   hydrog ? ? A  DA 395  N6 ? ? ? 1_555 OC DT 16   O4 ? ? AA DA 395  Bc DT 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog910   hydrog ? ? A  DG 396  N1 ? ? ? 1_555 OC DC 15   N3 ? ? AA DG 396  Bc DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog911   hydrog ? ? A  DG 396  N2 ? ? ? 1_555 OC DC 15   O2 ? ? AA DG 396  Bc DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog912   hydrog ? ? A  DG 396  O6 ? ? ? 1_555 OC DC 15   N4 ? ? AA DG 396  Bc DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog913   hydrog ? ? A  DG 397  N1 ? ? ? 1_555 OC DC 14   N3 ? ? AA DG 397  Bc DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog914   hydrog ? ? A  DG 397  N2 ? ? ? 1_555 OC DC 14   O2 ? ? AA DG 397  Bc DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog915   hydrog ? ? A  DG 397  O6 ? ? ? 1_555 OC DC 14   N4 ? ? AA DG 397  Bc DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog916   hydrog ? ? A  DC 398  N3 ? ? ? 1_555 OC DG 13   N1 ? ? AA DC 398  Bc DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog917   hydrog ? ? A  DC 398  N4 ? ? ? 1_555 OC DG 13   O6 ? ? AA DC 398  Bc DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog918   hydrog ? ? A  DC 398  O2 ? ? ? 1_555 OC DG 13   N2 ? ? AA DC 398  Bc DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog919   hydrog ? ? A  DA 399  N1 ? ? ? 1_555 OC DT 12   N3 ? ? AA DA 399  Bc DT 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog920   hydrog ? ? A  DA 399  N6 ? ? ? 1_555 OC DT 12   O4 ? ? AA DA 399  Bc DT 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog921   hydrog ? ? A  DC 400  N3 ? ? ? 1_555 OC DG 11   N1 ? ? AA DC 400  Bc DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog922   hydrog ? ? A  DC 400  N4 ? ? ? 1_555 OC DG 11   O6 ? ? AA DC 400  Bc DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog923   hydrog ? ? A  DC 400  O2 ? ? ? 1_555 OC DG 11   N2 ? ? AA DC 400  Bc DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog924   hydrog ? ? A  DC 401  N3 ? ? ? 1_555 OC DG 10   N1 ? ? AA DC 401  Bc DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog925   hydrog ? ? A  DC 401  N4 ? ? ? 1_555 OC DG 10   O6 ? ? AA DC 401  Bc DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog926   hydrog ? ? A  DC 401  O2 ? ? ? 1_555 OC DG 10   N2 ? ? AA DC 401  Bc DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog927   hydrog ? ? A  DC 402  N3 ? ? ? 1_555 OC DG 9    N1 ? ? AA DC 402  Bc DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog928   hydrog ? ? A  DC 402  N4 ? ? ? 1_555 OC DG 9    O6 ? ? AA DC 402  Bc DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog929   hydrog ? ? A  DC 402  O2 ? ? ? 1_555 OC DG 9    N2 ? ? AA DC 402  Bc DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog930   hydrog ? ? A  DA 404  N1 ? ? ? 1_555 KB DT 33   N3 ? ? AA DA 404  B7 DT 33   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog931   hydrog ? ? A  DG 405  N1 ? ? ? 1_555 KB DC 32   N3 ? ? AA DG 405  B7 DC 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog932   hydrog ? ? A  DG 405  N2 ? ? ? 1_555 KB DC 32   O2 ? ? AA DG 405  B7 DC 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog933   hydrog ? ? A  DG 405  O6 ? ? ? 1_555 KB DC 32   N4 ? ? AA DG 405  B7 DC 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog934   hydrog ? ? A  DG 406  N1 ? ? ? 1_555 KB DC 31   N3 ? ? AA DG 406  B7 DC 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog935   hydrog ? ? A  DG 406  N2 ? ? ? 1_555 KB DC 31   O2 ? ? AA DG 406  B7 DC 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog936   hydrog ? ? A  DG 406  O6 ? ? ? 1_555 KB DC 31   N4 ? ? AA DG 406  B7 DC 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog937   hydrog ? ? A  DC 407  N3 ? ? ? 1_555 KB DG 30   N1 ? ? AA DC 407  B7 DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog938   hydrog ? ? A  DC 407  N4 ? ? ? 1_555 KB DG 30   O6 ? ? AA DC 407  B7 DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog939   hydrog ? ? A  DC 407  O2 ? ? ? 1_555 KB DG 30   N2 ? ? AA DC 407  B7 DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog940   hydrog ? ? A  DT 408  N3 ? ? ? 1_555 KB DA 29   N1 ? ? AA DT 408  B7 DA 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog941   hydrog ? ? A  DT 408  O4 ? ? ? 1_555 KB DA 29   N6 ? ? AA DT 408  B7 DA 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog942   hydrog ? ? A  DT 409  N3 ? ? ? 1_555 KB DA 28   N1 ? ? AA DT 409  B7 DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog943   hydrog ? ? A  DT 409  O4 ? ? ? 1_555 KB DA 28   N6 ? ? AA DT 409  B7 DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog944   hydrog ? ? A  DT 410  N3 ? ? ? 1_555 KB DA 27   N1 ? ? AA DT 410  B7 DA 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog945   hydrog ? ? A  DT 410  O4 ? ? ? 1_555 KB DA 27   N6 ? ? AA DT 410  B7 DA 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog946   hydrog ? ? A  DA 411  N1 ? ? ? 1_555 JC DT 22   N3 ? ? AA DA 411  BX DT 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog947   hydrog ? ? A  DA 411  N6 ? ? ? 1_555 JC DT 22   O4 ? ? AA DA 411  BX DT 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog948   hydrog ? ? A  DC 412  N3 ? ? ? 1_555 JC DG 21   N1 ? ? AA DC 412  BX DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog949   hydrog ? ? A  DC 412  N4 ? ? ? 1_555 JC DG 21   O6 ? ? AA DC 412  BX DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog950   hydrog ? ? A  DC 412  O2 ? ? ? 1_555 JC DG 21   N2 ? ? AA DC 412  BX DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog951   hydrog ? ? A  DA 413  N1 ? ? ? 1_555 JC DT 20   N3 ? ? AA DA 413  BX DT 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog952   hydrog ? ? A  DA 413  N6 ? ? ? 1_555 JC DT 20   O4 ? ? AA DA 413  BX DT 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog953   hydrog ? ? A  DC 414  N3 ? ? ? 1_555 JC DG 19   N1 ? ? AA DC 414  BX DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog954   hydrog ? ? A  DC 414  N4 ? ? ? 1_555 JC DG 19   O6 ? ? AA DC 414  BX DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog955   hydrog ? ? A  DC 414  O2 ? ? ? 1_555 JC DG 19   N2 ? ? AA DC 414  BX DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog956   hydrog ? ? A  DT 415  N3 ? ? ? 1_555 JC DA 18   N1 ? ? AA DT 415  BX DA 18   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog957   hydrog ? ? A  DT 416  N3 ? ? ? 1_555 JC DA 17   N1 ? ? AA DT 416  BX DA 17   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog958   hydrog ? ? A  DT 417  N3 ? ? ? 1_555 JC DA 16   N1 ? ? AA DT 417  BX DA 16   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog959   hydrog ? ? A  DA 418  N1 ? ? ? 1_555 JC DT 15   N3 ? ? AA DA 418  BX DT 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog960   hydrog ? ? A  DA 418  N6 ? ? ? 1_555 JC DT 15   O4 ? ? AA DA 418  BX DT 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog961   hydrog ? ? A  DT 419  N3 ? ? ? 1_555 NC DA 18   N1 ? ? AA DT 419  Bb DA 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog962   hydrog ? ? A  DT 419  O4 ? ? ? 1_555 NC DA 18   N6 ? ? AA DT 419  Bb DA 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog963   hydrog ? ? A  DG 420  N1 ? ? ? 1_555 NC DC 17   N3 ? ? AA DG 420  Bb DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog964   hydrog ? ? A  DG 420  N2 ? ? ? 1_555 NC DC 17   O2 ? ? AA DG 420  Bb DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog965   hydrog ? ? A  DG 420  O6 ? ? ? 1_555 NC DC 17   N4 ? ? AA DG 420  Bb DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog966   hydrog ? ? A  DC 421  N3 ? ? ? 1_555 NC DG 16   N1 ? ? AA DC 421  Bb DG 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog967   hydrog ? ? A  DC 421  N4 ? ? ? 1_555 NC DG 16   O6 ? ? AA DC 421  Bb DG 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog968   hydrog ? ? A  DC 421  O2 ? ? ? 1_555 NC DG 16   N2 ? ? AA DC 421  Bb DG 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog969   hydrog ? ? A  DT 422  N3 ? ? ? 1_555 NC DA 15   N1 ? ? AA DT 422  Bb DA 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog970   hydrog ? ? A  DT 422  O4 ? ? ? 1_555 NC DA 15   N6 ? ? AA DT 422  Bb DA 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog971   hydrog ? ? A  DT 423  N3 ? ? ? 1_555 NC DA 14   N1 ? ? AA DT 423  Bb DA 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog972   hydrog ? ? A  DT 423  O4 ? ? ? 1_555 NC DA 14   N6 ? ? AA DT 423  Bb DA 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog973   hydrog ? ? A  DC 424  N3 ? ? ? 1_555 NC DG 13   N1 ? ? AA DC 424  Bb DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog974   hydrog ? ? A  DC 424  N4 ? ? ? 1_555 NC DG 13   O6 ? ? AA DC 424  Bb DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog975   hydrog ? ? A  DC 424  O2 ? ? ? 1_555 NC DG 13   N2 ? ? AA DC 424  Bb DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog976   hydrog ? ? A  DC 425  N3 ? ? ? 1_555 NC DG 12   N1 ? ? AA DC 425  Bb DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog977   hydrog ? ? A  DC 425  N4 ? ? ? 1_555 NC DG 12   O6 ? ? AA DC 425  Bb DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog978   hydrog ? ? A  DC 425  O2 ? ? ? 1_555 NC DG 12   N2 ? ? AA DC 425  Bb DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog979   hydrog ? ? A  DG 426  N1 ? ? ? 1_555 NC DC 11   N3 ? ? AA DG 426  Bb DC 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog980   hydrog ? ? A  DG 426  N2 ? ? ? 1_555 NC DC 11   O2 ? ? AA DG 426  Bb DC 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog981   hydrog ? ? A  DG 426  O6 ? ? ? 1_555 NC DC 11   N4 ? ? AA DG 426  Bb DC 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog982   hydrog ? ? A  DG 427  N1 ? ? ? 1_555 MB DC 18   N3 ? ? AA DG 427  B9 DC 18   1_555 ? ? ? ? ? ? 'DG-DC PAIR'            
? ? 
hydrog983   hydrog ? ? A  DC 428  N3 ? ? ? 1_555 MB DG 17   N1 ? ? AA DC 428  B9 DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog984   hydrog ? ? A  DC 428  N4 ? ? ? 1_555 MB DG 17   O6 ? ? AA DC 428  B9 DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog985   hydrog ? ? A  DC 428  O2 ? ? ? 1_555 MB DG 17   N2 ? ? AA DC 428  B9 DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog986   hydrog ? ? A  DT 429  N3 ? ? ? 1_555 MB DA 16   N1 ? ? AA DT 429  B9 DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog987   hydrog ? ? A  DT 429  O4 ? ? ? 1_555 MB DA 16   N6 ? ? AA DT 429  B9 DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog988   hydrog ? ? A  DC 430  N3 ? ? ? 1_555 MB DG 15   N1 ? ? AA DC 430  B9 DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog989   hydrog ? ? A  DC 430  N4 ? ? ? 1_555 MB DG 15   O6 ? ? AA DC 430  B9 DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog990   hydrog ? ? A  DC 430  O2 ? ? ? 1_555 MB DG 15   N2 ? ? AA DC 430  B9 DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog991   hydrog ? ? A  DG 431  N1 ? ? ? 1_555 MB DC 14   N3 ? ? AA DG 431  B9 DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog992   hydrog ? ? A  DG 431  N2 ? ? ? 1_555 MB DC 14   O2 ? ? AA DG 431  B9 DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog993   hydrog ? ? A  DG 431  O6 ? ? ? 1_555 MB DC 14   N4 ? ? AA DG 431  B9 DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog994   hydrog ? ? A  DT 432  N3 ? ? ? 1_555 MB DA 13   N1 ? ? AA DT 432  B9 DA 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog995   hydrog ? ? A  DT 432  O4 ? ? ? 1_555 MB DA 13   N6 ? ? AA DT 432  B9 DA 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog996   hydrog ? ? A  DA 433  N1 ? ? ? 1_555 MB DT 12   N3 ? ? AA DA 433  B9 DT 12   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog997   hydrog ? ? A  DT 434  N3 ? ? ? 1_555 MB DA 11   N1 ? ? AA DT 434  B9 DA 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog998   hydrog ? ? A  DT 434  O4 ? ? ? 1_555 MB DA 11   N6 ? ? AA DT 434  B9 DA 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog999   hydrog ? ? A  DG 435  N1 ? ? ? 1_555 LC DC 6    N3 ? ? AA DG 435  BZ DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1000  hydrog ? ? A  DG 435  N2 ? ? ? 1_555 LC DC 6    O2 ? ? AA DG 435  BZ DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1001  hydrog ? ? A  DG 435  O6 ? ? ? 1_555 LC DC 6    N4 ? ? AA DG 435  BZ DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1002  hydrog ? ? A  DT 436  N3 ? ? ? 1_555 LC DA 5    N1 ? ? AA DT 436  BZ DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1003  hydrog ? ? A  DT 436  O4 ? ? ? 1_555 LC DA 5    N6 ? ? AA DT 436  BZ DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1004  hydrog ? ? A  DT 437  N3 ? ? ? 1_555 LC DA 4    N1 ? ? AA DT 437  BZ DA 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1005  hydrog ? ? A  DT 437  O4 ? ? ? 1_555 LC DA 4    N6 ? ? AA DT 437  BZ DA 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1006  hydrog ? ? A  DG 438  N1 ? ? ? 1_555 LB DC 33   N3 ? ? AA DG 438  B8 DC 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1007  hydrog ? ? A  DG 438  N2 ? ? ? 1_555 LB DC 33   O2 ? ? AA DG 438  B8 DC 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1008  hydrog ? ? A  DG 438  O6 ? ? ? 1_555 LB DC 33   N4 ? ? AA DG 438  B8 DC 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1009  hydrog ? ? A  DT 439  N3 ? ? ? 1_555 LB DA 32   N1 ? ? AA DT 439  B8 DA 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1010  hydrog ? ? A  DT 439  O4 ? ? ? 1_555 LB DA 32   N6 ? ? AA DT 439  B8 DA 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1011  hydrog ? ? A  DG 440  N1 ? ? ? 1_555 LB DC 31   N3 ? ? AA DG 440  B8 DC 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1012  hydrog ? ? A  DG 440  N2 ? ? ? 1_555 LB DC 31   O2 ? ? AA DG 440  B8 DC 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1013  hydrog ? ? A  DG 440  O6 ? ? ? 1_555 LB DC 31   N4 ? ? AA DG 440  B8 DC 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1014  hydrog ? ? A  DT 441  N3 ? ? ? 1_555 LB DA 30   N1 ? ? AA DT 441  B8 DA 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1015  hydrog ? ? A  DT 441  O4 ? ? ? 1_555 LB DA 30   N6 ? ? AA DT 441  B8 DA 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1016  hydrog ? ? A  DG 442  N1 ? ? ? 1_555 LB DC 29   N3 ? ? AA DG 442  B8 DC 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1017  hydrog ? ? A  DG 442  N2 ? ? ? 1_555 LB DC 29   O2 ? ? AA DG 442  B8 DC 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1018  hydrog ? ? A  DG 442  O6 ? ? ? 1_555 LB DC 29   N4 ? ? AA DG 442  B8 DC 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1019  hydrog ? ? A  DG 443  N1 ? ? ? 1_555 LB DC 28   N3 ? ? AA DG 443  B8 DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1020  hydrog ? ? A  DG 443  N2 ? ? ? 1_555 LB DC 28   O2 ? ? AA DG 443  B8 DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1021  hydrog ? ? A  DG 443  O6 ? ? ? 1_555 LB DC 28   N4 ? ? AA DG 443  B8 DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1022  hydrog ? ? A  DA 444  N1 ? ? ? 1_555 LB DT 27   N3 ? ? AA DA 444  B8 DT 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1023  hydrog ? ? A  DA 444  N6 ? ? ? 1_555 LB DT 27   O4 ? ? AA DA 444  B8 DT 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1024  hydrog ? ? A  DA 445  N1 ? ? ? 1_555 LB DT 26   N3 ? ? AA DA 445  B8 DT 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1025  hydrog ? ? A  DA 445  N6 ? ? ? 1_555 LB DT 26   O4 ? ? AA DA 445  B8 DT 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1026  hydrog ? ? A  DT 446  N3 ? ? ? 1_555 LB DA 25   N1 ? ? AA DT 446  B8 DA 25   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog1027  hydrog ? ? A  DT 447  N3 ? ? ? 1_555 LB DA 24   N1 ? ? AA DT 447  B8 DA 24   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog1028  hydrog ? ? A  DG 448  N1 ? ? ? 1_555 LB DC 23   N3 ? ? AA DG 448  B8 DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1029  hydrog ? ? A  DG 448  N2 ? ? ? 1_555 LB DC 23   O2 ? ? AA DG 448  B8 DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1030  hydrog ? ? A  DG 448  O6 ? ? ? 1_555 LB DC 23   N4 ? ? AA DG 448  B8 DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1031  hydrog ? ? A  DT 449  N3 ? ? ? 1_555 LB DA 22   N1 ? ? AA DT 449  B8 DA 22   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog1032  hydrog ? ? A  DG 450  N1 ? ? ? 1_555 LB DC 21   N3 ? ? AA DG 450  B8 DC 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1033  hydrog ? ? A  DG 450  N2 ? ? ? 1_555 LB DC 21   O2 ? ? AA DG 450  B8 DC 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1034  hydrog ? ? A  DG 450  O6 ? ? ? 1_555 LB DC 21   N4 ? ? AA DG 450  B8 DC 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1035  hydrog ? ? A  DA 451  N1 ? ? ? 1_555 LB DT 20   N3 ? ? AA DA 451  B8 DT 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1036  hydrog ? ? A  DA 451  N6 ? ? ? 1_555 LB DT 20   O4 ? ? AA DA 451  B8 DT 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1037  hydrog ? ? A  DG 452  N1 ? ? ? 1_555 LB DC 19   N3 ? ? AA DG 452  B8 DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1038  hydrog ? ? A  DG 452  N2 ? ? ? 1_555 LB DC 19   O2 ? ? AA DG 452  B8 DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1039  hydrog ? ? A  DG 452  O6 ? ? ? 1_555 LB DC 19   N4 ? ? AA DG 452  B8 DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1040  hydrog ? ? A  DC 453  N3 ? ? ? 1_555 LB DG 18   N1 ? ? AA DC 453  B8 DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1041  hydrog ? ? A  DC 453  N4 ? ? ? 1_555 LB DG 18   O6 ? ? AA DC 453  B8 DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1042  hydrog ? ? A  DC 453  O2 ? ? ? 1_555 LB DG 18   N2 ? ? AA DC 453  B8 DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1043  hydrog ? ? A  DG 454  N1 ? ? ? 1_555 LB DC 17   N3 ? ? AA DG 454  B8 DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1044  hydrog ? ? A  DG 454  N2 ? ? ? 1_555 LB DC 17   O2 ? ? AA DG 454  B8 DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1045  hydrog ? ? A  DG 454  O6 ? ? ? 1_555 LB DC 17   N4 ? ? AA DG 454  B8 DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1046  hydrog ? ? A  DG 455  N1 ? ? ? 1_555 LB DC 16   N3 ? ? AA DG 455  B8 DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1047  hydrog ? ? A  DG 455  N2 ? ? ? 1_555 LB DC 16   O2 ? ? AA DG 455  B8 DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1048  hydrog ? ? A  DG 455  O6 ? ? ? 1_555 LB DC 16   N4 ? ? AA DG 455  B8 DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1049  hydrog ? ? A  DA 456  N1 ? ? ? 1_555 LB DT 15   N3 ? ? AA DA 456  B8 DT 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1050  hydrog ? ? A  DA 456  N6 ? ? ? 1_555 LB DT 15   O4 ? ? AA DA 456  B8 DT 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1051  hydrog ? ? A  DT 457  N3 ? ? ? 1_555 JC DA 30   N1 ? ? AA DT 457  BX DA 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1052  hydrog ? ? A  DT 457  O4 ? ? ? 1_555 JC DA 30   N6 ? ? AA DT 457  BX DA 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1053  hydrog ? ? A  DA 458  N1 ? ? ? 1_555 JC DT 29   N3 ? ? AA DA 458  BX DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1054  hydrog ? ? A  DA 458  N6 ? ? ? 1_555 JC DT 29   O4 ? ? AA DA 458  BX DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1055  hydrog ? ? A  DA 459  N1 ? ? ? 1_555 JC DT 28   N3 ? ? AA DA 459  BX DT 28   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog1056  hydrog ? ? A  DC 460  N3 ? ? ? 1_555 JC DG 27   N1 ? ? AA DC 460  BX DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1057  hydrog ? ? A  DC 460  N4 ? ? ? 1_555 JC DG 27   O6 ? ? AA DC 460  BX DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1058  hydrog ? ? A  DC 460  O2 ? ? ? 1_555 JC DG 27   N2 ? ? AA DC 460  BX DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1059  hydrog ? ? A  DA 461  N1 ? ? ? 1_555 JC DT 26   N3 ? ? AA DA 461  BX DT 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1060  hydrog ? ? A  DA 461  N6 ? ? ? 1_555 JC DT 26   O4 ? ? AA DA 461  BX DT 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1061  hydrog ? ? A  DA 462  N1 ? ? ? 1_555 JC DT 25   N3 ? ? AA DA 462  BX DT 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1062  hydrog ? ? A  DA 462  N6 ? ? ? 1_555 JC DT 25   O4 ? ? AA DA 462  BX DT 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1063  hydrog ? ? A  DT 463  N3 ? ? ? 1_555 JC DA 24   N1 ? ? AA DT 463  BX DA 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1064  hydrog ? ? A  DT 463  O4 ? ? ? 1_555 JC DA 24   N6 ? ? AA DT 463  BX DA 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1065  hydrog ? ? A  DT 464  N3 ? ? ? 1_555 JC DA 23   N1 ? ? AA DT 464  BX DA 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1066  hydrog ? ? A  DT 464  O4 ? ? ? 1_555 JC DA 23   N6 ? ? AA DT 464  BX DA 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1067  hydrog ? ? A  DT 465  N3 ? ? ? 1_555 KB DA 26   N1 ? ? AA DT 465  B7 DA 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1068  hydrog ? ? A  DT 465  O4 ? ? ? 1_555 KB DA 26   N6 ? ? AA DT 465  B7 DA 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1069  hydrog ? ? A  DC 466  N3 ? ? ? 1_555 KB DG 25   N1 ? ? AA DC 466  B7 DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1070  hydrog ? ? A  DC 466  N4 ? ? ? 1_555 KB DG 25   O6 ? ? AA DC 466  B7 DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1071  hydrog ? ? A  DC 466  O2 ? ? ? 1_555 KB DG 25   N2 ? ? AA DC 466  B7 DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1072  hydrog ? ? A  DA 467  N1 ? ? ? 1_555 KB DT 24   N3 ? ? AA DA 467  B7 DT 24   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog1073  hydrog ? ? A  DC 468  N3 ? ? ? 1_555 KB DG 23   N1 ? ? AA DC 468  B7 DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1074  hydrog ? ? A  DC 468  N4 ? ? ? 1_555 KB DG 23   O6 ? ? AA DC 468  B7 DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1075  hydrog ? ? A  DC 468  O2 ? ? ? 1_555 KB DG 23   N2 ? ? AA DC 468  B7 DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1076  hydrog ? ? A  DA 469  N1 ? ? ? 1_555 KB DT 22   N3 ? ? AA DA 469  B7 DT 22   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog1077  hydrog ? ? A  DC 470  N3 ? ? ? 1_555 KB DG 21   N1 ? ? AA DC 470  B7 DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1078  hydrog ? ? A  DC 470  N4 ? ? ? 1_555 KB DG 21   O6 ? ? AA DC 470  B7 DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1079  hydrog ? ? A  DC 470  O2 ? ? ? 1_555 KB DG 21   N2 ? ? AA DC 470  B7 DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1080  hydrog ? ? A  DA 471  N1 ? ? ? 1_555 KB DT 20   N3 ? ? AA DA 471  B7 DT 20   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog1081  hydrog ? ? A  DG 472  N1 ? ? ? 1_555 KB DC 19   N3 ? ? AA DG 472  B7 DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1082  hydrog ? ? A  DG 472  N2 ? ? ? 1_555 KB DC 19   O2 ? ? AA DG 472  B7 DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1083  hydrog ? ? A  DG 472  O6 ? ? ? 1_555 KB DC 19   N4 ? ? AA DG 472  B7 DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1084  hydrog ? ? A  DG 473  N1 ? ? ? 1_555 KB DC 18   N3 ? ? AA DG 473  B7 DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1085  hydrog ? ? A  DG 473  N2 ? ? ? 1_555 KB DC 18   O2 ? ? AA DG 473  B7 DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1086  hydrog ? ? A  DG 473  O6 ? ? ? 1_555 KB DC 18   N4 ? ? AA DG 473  B7 DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1087  hydrog ? ? A  DA 474  N1 ? ? ? 1_555 KB DT 17   N3 ? ? AA DA 474  B7 DT 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1088  hydrog ? ? A  DA 474  N6 ? ? ? 1_555 KB DT 17   O4 ? ? AA DA 474  B7 DT 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1089  hydrog ? ? A  DA 475  N1 ? ? ? 1_555 KB DT 16   N3 ? ? AA DA 475  B7 DT 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1090  hydrog ? ? A  DA 475  N6 ? ? ? 1_555 KB DT 16   O4 ? ? AA DA 475  B7 DT 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1091  hydrog ? ? A  DA 476  N1 ? ? ? 1_555 KB DT 15   N3 ? ? AA DA 476  B7 DT 15   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog1092  hydrog ? ? A  DC 477  N3 ? ? ? 1_555 KB DG 14   N1 ? ? AA DC 477  B7 DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1093  hydrog ? ? A  DC 477  N4 ? ? ? 1_555 KB DG 14   O6 ? ? AA DC 477  B7 DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1094  hydrog ? ? A  DC 477  O2 ? ? ? 1_555 KB DG 14   N2 ? ? AA DC 477  B7 DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1095  hydrog ? ? A  DA 478  N1 ? ? ? 1_555 KB DT 13   N3 ? ? AA DA 478  B7 DT 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1096  hydrog ? ? A  DA 478  N6 ? ? ? 1_555 KB DT 13   O4 ? ? AA DA 478  B7 DT 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1097  hydrog ? ? A  DG 479  N1 ? ? ? 1_555 KB DC 12   N3 ? ? AA DG 479  B7 DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1098  hydrog ? ? A  DG 479  N2 ? ? ? 1_555 KB DC 12   O2 ? ? AA DG 479  B7 DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1099  hydrog ? ? A  DG 479  O6 ? ? ? 1_555 KB DC 12   N4 ? ? AA DG 479  B7 DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1100  hydrog ? ? A  DC 480  N3 ? ? ? 1_555 KB DG 11   N1 ? ? AA DC 480  B7 DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1101  hydrog ? ? A  DC 480  N4 ? ? ? 1_555 KB DG 11   O6 ? ? AA DC 480  B7 DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1102  hydrog ? ? A  DC 480  O2 ? ? ? 1_555 KB DG 11   N2 ? ? AA DC 480  B7 DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1103  hydrog ? ? A  DT 481  N3 ? ? ? 1_555 KB DA 10   N1 ? ? AA DT 481  B7 DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1104  hydrog ? ? A  DT 481  O4 ? ? ? 1_555 KB DA 10   N6 ? ? AA DT 481  B7 DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1105  hydrog ? ? A  DA 482  N1 ? ? ? 1_555 KB DT 9    N3 ? ? AA DA 482  B7 DT 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1106  hydrog ? ? A  DA 482  N6 ? ? ? 1_555 KB DT 9    O4 ? ? AA DA 482  B7 DT 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1107  hydrog ? ? A  DT 483  N3 ? ? ? 1_555 KB DA 8    N1 ? ? AA DT 483  B7 DA 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1108  hydrog ? ? A  DT 483  O4 ? ? ? 1_555 KB DA 8    N6 ? ? AA DT 483  B7 DA 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1109  hydrog ? ? A  DG 484  N1 ? ? ? 1_555 KB DC 7    N3 ? ? AA DG 484  B7 DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1110  hydrog ? ? A  DG 484  N2 ? ? ? 1_555 KB DC 7    O2 ? ? AA DG 484  B7 DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1111  hydrog ? ? A  DG 484  O6 ? ? ? 1_555 KB DC 7    N4 ? ? AA DG 484  B7 DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1112  hydrog ? ? A  DA 485  N1 ? ? ? 1_555 KB DT 6    N3 ? ? AA DA 485  B7 DT 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1113  hydrog ? ? A  DA 485  N6 ? ? ? 1_555 KB DT 6    O4 ? ? AA DA 485  B7 DT 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1114  hydrog ? ? A  DC 486  N3 ? ? ? 1_555 KB DG 5    N1 ? ? AA DC 486  B7 DG 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1115  hydrog ? ? A  DC 486  N4 ? ? ? 1_555 KB DG 5    O6 ? ? AA DC 486  B7 DG 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1116  hydrog ? ? A  DC 486  O2 ? ? ? 1_555 KB DG 5    N2 ? ? AA DC 486  B7 DG 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1117  hydrog ? ? A  DC 487  N3 ? ? ? 1_555 KB DG 4    N1 ? ? AA DC 487  B7 DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1118  hydrog ? ? A  DC 487  N4 ? ? ? 1_555 KB DG 4    O6 ? ? AA DC 487  B7 DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1119  hydrog ? ? A  DC 487  O2 ? ? ? 1_555 KB DG 4    N2 ? ? AA DC 487  B7 DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1120  hydrog ? ? A  DA 488  N1 ? ? ? 1_555 KB DT 3    N3 ? ? AA DA 488  B7 DT 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1121  hydrog ? ? A  DA 488  N6 ? ? ? 1_555 KB DT 3    O4 ? ? AA DA 488  B7 DT 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1122  hydrog ? ? A  DT 489  N3 ? ? ? 1_555 CE DA 2    N1 ? ? AA DT 489  CP DA 2    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog1123  hydrog ? ? A  DG 490  N1 ? ? ? 1_555 CE DC 1    N3 ? ? AA DG 490  CP DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1124  hydrog ? ? A  DG 490  N2 ? ? ? 1_555 CE DC 1    O2 ? ? AA DG 490  CP DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1125  hydrog ? ? A  DG 490  O6 ? ? ? 1_555 CE DC 1    N4 ? ? AA DG 490  CP DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1126  hydrog ? ? A  DA 491  N1 ? ? ? 1_555 WC DT 67   N3 ? ? AA DA 491  Bk DT 67   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1127  hydrog ? ? A  DA 491  N6 ? ? ? 1_555 WC DT 67   O4 ? ? AA DA 491  Bk DT 67   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1128  hydrog ? ? A  DT 492  N3 ? ? ? 1_555 WC DA 66   N1 ? ? AA DT 492  Bk DA 66   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1129  hydrog ? ? A  DT 492  O4 ? ? ? 1_555 WC DA 66   N6 ? ? AA DT 492  Bk DA 66   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1130  hydrog ? ? A  DT 493  N3 ? ? ? 1_555 WC DA 65   N1 ? ? AA DT 493  Bk DA 65   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1131  hydrog ? ? A  DT 493  O4 ? ? ? 1_555 WC DA 65   N6 ? ? AA DT 493  Bk DA 65   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1132  hydrog ? ? A  DA 494  N1 ? ? ? 1_555 WC DT 64   N3 ? ? AA DA 494  Bk DT 64   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1133  hydrog ? ? A  DA 494  N6 ? ? ? 1_555 WC DT 64   O4 ? ? AA DA 494  Bk DT 64   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1134  hydrog ? ? A  DC 495  N3 ? ? ? 1_555 WC DG 63   N1 ? ? AA DC 495  Bk DG 63   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1135  hydrog ? ? A  DC 495  N4 ? ? ? 1_555 WC DG 63   O6 ? ? AA DC 495  Bk DG 63   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1136  hydrog ? ? A  DC 495  O2 ? ? ? 1_555 WC DG 63   N2 ? ? AA DC 495  Bk DG 63   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1137  hydrog ? ? A  DG 496  N1 ? ? ? 1_555 WC DC 62   N3 ? ? AA DG 496  Bk DC 62   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1138  hydrog ? ? A  DG 496  N2 ? ? ? 1_555 WC DC 62   O2 ? ? AA DG 496  Bk DC 62   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1139  hydrog ? ? A  DG 496  O6 ? ? ? 1_555 WC DC 62   N4 ? ? AA DG 496  Bk DC 62   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1140  hydrog ? ? A  DA 497  N1 ? ? ? 1_555 WC DT 61   N3 ? ? AA DA 497  Bk DT 61   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog1141  hydrog ? ? A  DA 498  N1 ? ? ? 1_555 WC DT 60   N3 ? ? AA DA 498  Bk DT 60   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog1142  hydrog ? ? A  DT 499  N3 ? ? ? 1_555 WC DA 59   N1 ? ? AA DT 499  Bk DA 59   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1143  hydrog ? ? A  DT 499  O4 ? ? ? 1_555 WC DA 59   N6 ? ? AA DT 499  Bk DA 59   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1144  hydrog ? ? A  DT 500  N3 ? ? ? 1_555 WC DA 58   N1 ? ? AA DT 500  Bk DA 58   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1145  hydrog ? ? A  DT 500  O4 ? ? ? 1_555 WC DA 58   N6 ? ? AA DT 500  Bk DA 58   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1146  hydrog ? ? A  DC 501  N3 ? ? ? 1_555 WC DG 57   N1 ? ? AA DC 501  Bk DG 57   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1147  hydrog ? ? A  DC 501  N4 ? ? ? 1_555 WC DG 57   O6 ? ? AA DC 501  Bk DG 57   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1148  hydrog ? ? A  DC 501  O2 ? ? ? 1_555 WC DG 57   N2 ? ? AA DC 501  Bk DG 57   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1149  hydrog ? ? A  DG 502  N1 ? ? ? 1_555 WC DC 46   N3 ? ? AA DG 502  Bk DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1150  hydrog ? ? A  DG 502  N2 ? ? ? 1_555 WC DC 46   O2 ? ? AA DG 502  Bk DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1151  hydrog ? ? A  DG 502  O6 ? ? ? 1_555 WC DC 46   N4 ? ? AA DG 502  Bk DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1152  hydrog ? ? A  DA 503  N1 ? ? ? 1_555 WC DT 45   N3 ? ? AA DA 503  Bk DT 45   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog1153  hydrog ? ? A  DG 504  N1 ? ? ? 1_555 WC DC 44   N3 ? ? AA DG 504  Bk DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1154  hydrog ? ? A  DG 504  N2 ? ? ? 1_555 WC DC 44   O2 ? ? AA DG 504  Bk DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1155  hydrog ? ? A  DG 504  O6 ? ? ? 1_555 WC DC 44   N4 ? ? AA DG 504  Bk DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1156  hydrog ? ? A  DC 505  N3 ? ? ? 1_555 WC DG 43   N1 ? ? AA DC 505  Bk DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1157  hydrog ? ? A  DC 505  N4 ? ? ? 1_555 WC DG 43   O6 ? ? AA DC 505  Bk DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1158  hydrog ? ? A  DC 505  O2 ? ? ? 1_555 WC DG 43   N2 ? ? AA DC 505  Bk DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1159  hydrog ? ? A  DT 506  N3 ? ? ? 1_555 WC DA 42   N1 ? ? AA DT 506  Bk DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1160  hydrog ? ? A  DT 506  O4 ? ? ? 1_555 WC DA 42   N6 ? ? AA DT 506  Bk DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1161  hydrog ? ? A  DC 507  N3 ? ? ? 1_555 KC DG 10   N1 ? ? AA DC 507  BY DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1162  hydrog ? ? A  DC 507  N4 ? ? ? 1_555 KC DG 10   O6 ? ? AA DC 507  BY DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1163  hydrog ? ? A  DC 507  O2 ? ? ? 1_555 KC DG 10   N2 ? ? AA DC 507  BY DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1164  hydrog ? ? A  DG 508  N1 ? ? ? 1_555 KC DC 9    N3 ? ? AA DG 508  BY DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1165  hydrog ? ? A  DG 508  N2 ? ? ? 1_555 KC DC 9    O2 ? ? AA DG 508  BY DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1166  hydrog ? ? A  DG 508  O6 ? ? ? 1_555 KC DC 9    N4 ? ? AA DG 508  BY DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1167  hydrog ? ? A  DG 509  N2 ? ? ? 1_555 A  DA 511  N1 ? ? AA DG 509  AA DA 511  1_555 ? ? ? ? ? ? 'DG-DA MISPAIR'         
? ? 
hydrog1168  hydrog ? ? A  DG 509  N1 ? ? ? 1_555 KC DC 8    N3 ? ? AA DG 509  BY DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1169  hydrog ? ? A  DG 509  N2 ? ? ? 1_555 KC DC 8    O2 ? ? AA DG 509  BY DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1170  hydrog ? ? A  DG 509  O6 ? ? ? 1_555 KC DC 8    N4 ? ? AA DG 509  BY DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1171  hydrog ? ? A  DT 510  N3 ? ? ? 1_555 KC DA 7    N1 ? ? AA DT 510  BY DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1172  hydrog ? ? A  DT 510  O4 ? ? ? 1_555 KC DA 7    N6 ? ? AA DT 510  BY DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1173  hydrog ? ? A  DA 511  N6 ? ? ? 1_555 KC DA 7    N3 ? ? AA DA 511  BY DA 7    1_555 ? ? ? ? ? ? 'DA-DA MISPAIR'         
? ? 
hydrog1174  hydrog ? ? A  DA 511  N6 ? ? ? 1_555 KC DC 8    O2 ? ? AA DA 511  BY DC 8    1_555 ? ? ? ? ? ? 'DA-DC MISPAIR'         
? ? 
hydrog1175  hydrog ? ? A  DC 512  N3 ? ? ? 1_555 ZC DG 62   N1 ? ? AA DC 512  Bn DG 62   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1176  hydrog ? ? A  DC 512  N4 ? ? ? 1_555 ZC DG 62   O6 ? ? AA DC 512  Bn DG 62   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1177  hydrog ? ? A  DC 512  O2 ? ? ? 1_555 ZC DG 62   N2 ? ? AA DC 512  Bn DG 62   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1178  hydrog ? ? A  DC 513  N3 ? ? ? 1_555 ZC DG 61   N1 ? ? AA DC 513  Bn DG 61   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1179  hydrog ? ? A  DC 513  N4 ? ? ? 1_555 ZC DG 61   O6 ? ? AA DC 513  Bn DG 61   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1180  hydrog ? ? A  DC 513  O2 ? ? ? 1_555 ZC DG 61   N2 ? ? AA DC 513  Bn DG 61   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1181  hydrog ? ? A  DC 514  N3 ? ? ? 1_555 ZC DG 60   N1 ? ? AA DC 514  Bn DG 60   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1182  hydrog ? ? A  DC 514  N4 ? ? ? 1_555 ZC DG 60   O6 ? ? AA DC 514  Bn DG 60   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1183  hydrog ? ? A  DC 514  O2 ? ? ? 1_555 ZC DG 60   N2 ? ? AA DC 514  Bn DG 60   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1184  hydrog ? ? A  DG 515  N1 ? ? ? 1_555 ZC DC 59   N3 ? ? AA DG 515  Bn DC 59   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1185  hydrog ? ? A  DG 515  N2 ? ? ? 1_555 ZC DC 59   O2 ? ? AA DG 515  Bn DC 59   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1186  hydrog ? ? A  DG 515  O6 ? ? ? 1_555 ZC DC 59   N4 ? ? AA DG 515  Bn DC 59   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1187  hydrog ? ? A  DG 516  N1 ? ? ? 1_555 ZC DC 58   N3 ? ? AA DG 516  Bn DC 58   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1188  hydrog ? ? A  DG 516  N2 ? ? ? 1_555 ZC DC 58   O2 ? ? AA DG 516  Bn DC 58   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1189  hydrog ? ? A  DG 516  O6 ? ? ? 1_555 ZC DC 58   N4 ? ? AA DG 516  Bn DC 58   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1190  hydrog ? ? A  DG 517  N1 ? ? ? 1_555 ZC DC 57   N3 ? ? AA DG 517  Bn DC 57   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1191  hydrog ? ? A  DG 517  N2 ? ? ? 1_555 ZC DC 57   O2 ? ? AA DG 517  Bn DC 57   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1192  hydrog ? ? A  DG 517  O6 ? ? ? 1_555 ZC DC 57   N4 ? ? AA DG 517  Bn DC 57   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1193  hydrog ? ? A  DG 518  N1 ? ? ? 1_555 ZC DC 56   N3 ? ? AA DG 518  Bn DC 56   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1194  hydrog ? ? A  DG 518  N2 ? ? ? 1_555 ZC DC 56   O2 ? ? AA DG 518  Bn DC 56   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1195  hydrog ? ? A  DG 518  O6 ? ? ? 1_555 ZC DC 56   N4 ? ? AA DG 518  Bn DC 56   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1196  hydrog ? ? A  DA 519  N1 ? ? ? 1_555 ZC DT 55   N3 ? ? AA DA 519  Bn DT 55   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog1197  hydrog ? ? A  DT 520  N3 ? ? ? 1_555 ZC DA 54   N1 ? ? AA DT 520  Bn DA 54   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog1198  hydrog ? ? A  DC 521  N3 ? ? ? 1_555 ZC DG 53   N1 ? ? AA DC 521  Bn DG 53   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1199  hydrog ? ? A  DC 521  N4 ? ? ? 1_555 ZC DG 53   O6 ? ? AA DC 521  Bn DG 53   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1200  hydrog ? ? A  DC 521  O2 ? ? ? 1_555 ZC DG 53   N2 ? ? AA DC 521  Bn DG 53   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1201  hydrog ? ? A  DC 522  N3 ? ? ? 1_555 ZC DG 52   N1 ? ? AA DC 522  Bn DG 52   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1202  hydrog ? ? A  DC 522  N4 ? ? ? 1_555 ZC DG 52   O6 ? ? AA DC 522  Bn DG 52   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1203  hydrog ? ? A  DC 522  O2 ? ? ? 1_555 ZC DG 52   N2 ? ? AA DC 522  Bn DG 52   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1204  hydrog ? ? A  DT 523  N3 ? ? ? 1_555 ZC DA 51   N1 ? ? AA DT 523  Bn DA 51   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog1205  hydrog ? ? A  DC 524  N3 ? ? ? 1_555 ZC DG 50   N1 ? ? AA DC 524  Bn DG 50   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1206  hydrog ? ? A  DC 524  N4 ? ? ? 1_555 ZC DG 50   O6 ? ? AA DC 524  Bn DG 50   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1207  hydrog ? ? A  DC 524  O2 ? ? ? 1_555 ZC DG 50   N2 ? ? AA DC 524  Bn DG 50   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1208  hydrog ? ? A  DT 525  N3 ? ? ? 1_555 AD DA 6    N1 ? ? AA DT 525  Bo DA 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1209  hydrog ? ? A  DT 525  O4 ? ? ? 1_555 AD DA 6    N6 ? ? AA DT 525  Bo DA 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1210  hydrog ? ? A  DA 526  N1 ? ? ? 1_555 AD DT 5    N3 ? ? AA DA 526  Bo DT 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1211  hydrog ? ? A  DA 526  N6 ? ? ? 1_555 AD DT 5    O4 ? ? AA DA 526  Bo DT 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1212  hydrog ? ? A  DG 527  N1 ? ? ? 1_555 AD DC 4    N3 ? ? AA DG 527  Bo DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1213  hydrog ? ? A  DG 527  N2 ? ? ? 1_555 AD DC 4    O2 ? ? AA DG 527  Bo DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1214  hydrog ? ? A  DG 527  O6 ? ? ? 1_555 AD DC 4    N4 ? ? AA DG 527  Bo DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1215  hydrog ? ? A  DA 528  N1 ? ? ? 1_555 AD DT 3    N3 ? ? AA DA 528  Bo DT 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1216  hydrog ? ? A  DA 528  N6 ? ? ? 1_555 AD DT 3    O4 ? ? AA DA 528  Bo DT 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1217  hydrog ? ? A  DG 529  N1 ? ? ? 1_555 AD DC 2    N3 ? ? AA DG 529  Bo DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1218  hydrog ? ? A  DG 529  N2 ? ? ? 1_555 AD DC 2    O2 ? ? AA DG 529  Bo DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1219  hydrog ? ? A  DG 529  O6 ? ? ? 1_555 AD DC 2    N4 ? ? AA DG 529  Bo DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1220  hydrog ? ? A  DT 530  N3 ? ? ? 1_555 AD DA 1    N1 ? ? AA DT 530  Bo DA 1    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog1221  hydrog ? ? A  DC 531  N3 ? ? ? 1_555 EC DG 48   N1 ? ? AA DC 531  BS DG 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1222  hydrog ? ? A  DC 531  N4 ? ? ? 1_555 EC DG 48   O6 ? ? AA DC 531  BS DG 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1223  hydrog ? ? A  DC 531  O2 ? ? ? 1_555 EC DG 48   N2 ? ? AA DC 531  BS DG 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1224  hydrog ? ? A  DG 532  N1 ? ? ? 1_555 EC DC 47   N3 ? ? AA DG 532  BS DC 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1225  hydrog ? ? A  DG 532  N2 ? ? ? 1_555 EC DC 47   O2 ? ? AA DG 532  BS DC 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1226  hydrog ? ? A  DG 532  O6 ? ? ? 1_555 EC DC 47   N4 ? ? AA DG 532  BS DC 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1227  hydrog ? ? A  DA 533  N1 ? ? ? 1_555 MC DT 22   N3 ? ? AA DA 533  Ba DT 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1228  hydrog ? ? A  DA 533  N6 ? ? ? 1_555 MC DT 22   O4 ? ? AA DA 533  Ba DT 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1229  hydrog ? ? A  DC 534  N3 ? ? ? 1_555 MC DG 21   N1 ? ? AA DC 534  Ba DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1230  hydrog ? ? A  DC 534  N4 ? ? ? 1_555 MC DG 21   O6 ? ? AA DC 534  Ba DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1231  hydrog ? ? A  DC 534  O2 ? ? ? 1_555 MC DG 21   N2 ? ? AA DC 534  Ba DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1232  hydrog ? ? A  DC 535  N3 ? ? ? 1_555 MC DG 20   N1 ? ? AA DC 535  Ba DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1233  hydrog ? ? A  DC 535  N4 ? ? ? 1_555 MC DG 20   O6 ? ? AA DC 535  Ba DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1234  hydrog ? ? A  DC 535  O2 ? ? ? 1_555 MC DG 20   N2 ? ? AA DC 535  Ba DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1235  hydrog ? ? A  DT 536  N3 ? ? ? 1_555 MC DA 19   N1 ? ? AA DT 536  Ba DA 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1236  hydrog ? ? A  DT 536  O4 ? ? ? 1_555 MC DA 19   N6 ? ? AA DT 536  Ba DA 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1237  hydrog ? ? A  DG 537  N1 ? ? ? 1_555 MC DC 18   N3 ? ? AA DG 537  Ba DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1238  hydrog ? ? A  DG 537  N2 ? ? ? 1_555 MC DC 18   O2 ? ? AA DG 537  Ba DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1239  hydrog ? ? A  DG 537  O6 ? ? ? 1_555 MC DC 18   N4 ? ? AA DG 537  Ba DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1240  hydrog ? ? A  DC 538  N3 ? ? ? 1_555 MC DG 17   N1 ? ? AA DC 538  Ba DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1241  hydrog ? ? A  DC 538  N4 ? ? ? 1_555 MC DG 17   O6 ? ? AA DC 538  Ba DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1242  hydrog ? ? A  DC 538  O2 ? ? ? 1_555 MC DG 17   N2 ? ? AA DC 538  Ba DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1243  hydrog ? ? A  DA 539  N1 ? ? ? 1_555 MC DT 16   N3 ? ? AA DA 539  Ba DT 16   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog1244  hydrog ? ? A  DG 540  N1 ? ? ? 1_555 MC DC 15   N3 ? ? AA DG 540  Ba DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1245  hydrog ? ? A  DG 540  N2 ? ? ? 1_555 MC DC 15   O2 ? ? AA DG 540  Ba DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1246  hydrog ? ? A  DG 540  O6 ? ? ? 1_555 MC DC 15   N4 ? ? AA DG 540  Ba DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1247  hydrog ? ? A  DG 541  N1 ? ? ? 1_555 OC DC 40   N3 ? ? AA DG 541  Bc DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1248  hydrog ? ? A  DG 541  N2 ? ? ? 1_555 OC DC 40   O2 ? ? AA DG 541  Bc DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1249  hydrog ? ? A  DG 541  O6 ? ? ? 1_555 OC DC 40   N4 ? ? AA DG 541  Bc DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1250  hydrog ? ? A  DC 542  N3 ? ? ? 1_555 OC DG 39   N1 ? ? AA DC 542  Bc DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1251  hydrog ? ? A  DC 542  N4 ? ? ? 1_555 OC DG 39   O6 ? ? AA DC 542  Bc DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1252  hydrog ? ? A  DC 542  O2 ? ? ? 1_555 OC DG 39   N2 ? ? AA DC 542  Bc DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1253  hydrog ? ? A  DA 543  N1 ? ? ? 1_555 OC DT 38   N3 ? ? AA DA 543  Bc DT 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1254  hydrog ? ? A  DA 543  N6 ? ? ? 1_555 OC DT 38   O4 ? ? AA DA 543  Bc DT 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1255  hydrog ? ? A  DT 544  N3 ? ? ? 1_555 OC DA 37   N1 ? ? AA DT 544  Bc DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1256  hydrog ? ? A  DT 544  O4 ? ? ? 1_555 OC DA 37   N6 ? ? AA DT 544  Bc DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1257  hydrog ? ? A  DG 545  N1 ? ? ? 1_555 OC DC 36   N3 ? ? AA DG 545  Bc DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1258  hydrog ? ? A  DG 545  N2 ? ? ? 1_555 OC DC 36   O2 ? ? AA DG 545  Bc DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1259  hydrog ? ? A  DG 545  O6 ? ? ? 1_555 OC DC 36   N4 ? ? AA DG 545  Bc DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1260  hydrog ? ? A  DC 546  N3 ? ? ? 1_555 OC DG 35   N1 ? ? AA DC 546  Bc DG 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1261  hydrog ? ? A  DC 546  N4 ? ? ? 1_555 OC DG 35   O6 ? ? AA DC 546  Bc DG 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1262  hydrog ? ? A  DC 546  O2 ? ? ? 1_555 OC DG 35   N2 ? ? AA DC 546  Bc DG 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1263  hydrog ? ? A  DA 547  N1 ? ? ? 1_555 OC DT 34   N3 ? ? AA DA 547  Bc DT 34   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog1264  hydrog ? ? A  DA 548  N1 ? ? ? 1_555 OC DT 33   N3 ? ? AA DA 548  Bc DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1265  hydrog ? ? A  DA 548  N6 ? ? ? 1_555 OC DT 33   O4 ? ? AA DA 548  Bc DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1266  hydrog ? ? A  DG 549  N3 ? ? ? 1_555 A  DA 6965 N6 ? ? AA DG 549  AA DA 6965 1_555 ? ? ? ? ? ? 'DG-DA MISPAIR'         
? ? 
hydrog1267  hydrog ? ? A  DG 549  N1 ? ? ? 1_555 RC DC 34   N3 ? ? AA DG 549  Bf DC 34   1_555 ? ? ? ? ? ? 'DG-DC PAIR'            
? ? 
hydrog1268  hydrog ? ? A  DC 550  N3 ? ? ? 1_555 RC DG 33   N1 ? ? AA DC 550  Bf DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1269  hydrog ? ? A  DC 550  N4 ? ? ? 1_555 RC DG 33   O6 ? ? AA DC 550  Bf DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1270  hydrog ? ? A  DC 550  O2 ? ? ? 1_555 RC DG 33   N2 ? ? AA DC 550  Bf DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1271  hydrog ? ? A  DT 551  N3 ? ? ? 1_555 RC DA 32   N1 ? ? AA DT 551  Bf DA 32   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog1272  hydrog ? ? A  DT 552  N3 ? ? ? 1_555 RC DA 31   N1 ? ? AA DT 552  Bf DA 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1273  hydrog ? ? A  DT 552  O4 ? ? ? 1_555 RC DA 31   N6 ? ? AA DT 552  Bf DA 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1274  hydrog ? ? A  DG 553  N1 ? ? ? 1_555 RC DC 30   N3 ? ? AA DG 553  Bf DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1275  hydrog ? ? A  DG 553  N2 ? ? ? 1_555 RC DC 30   O2 ? ? AA DG 553  Bf DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1276  hydrog ? ? A  DG 553  O6 ? ? ? 1_555 RC DC 30   N4 ? ? AA DG 553  Bf DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1277  hydrog ? ? A  DG 554  N1 ? ? ? 1_555 RC DC 29   N3 ? ? AA DG 554  Bf DC 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1278  hydrog ? ? A  DG 554  N2 ? ? ? 1_555 RC DC 29   O2 ? ? AA DG 554  Bf DC 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1279  hydrog ? ? A  DG 554  O6 ? ? ? 1_555 RC DC 29   N4 ? ? AA DG 554  Bf DC 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1280  hydrog ? ? A  DC 555  N3 ? ? ? 1_555 RC DG 28   N1 ? ? AA DC 555  Bf DG 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1281  hydrog ? ? A  DC 555  N4 ? ? ? 1_555 RC DG 28   O6 ? ? AA DC 555  Bf DG 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1282  hydrog ? ? A  DC 555  O2 ? ? ? 1_555 RC DG 28   N2 ? ? AA DC 555  Bf DG 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1283  hydrog ? ? A  DA 556  N1 ? ? ? 1_555 RC DT 27   N3 ? ? AA DA 556  Bf DT 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1284  hydrog ? ? A  DA 556  N6 ? ? ? 1_555 RC DT 27   O4 ? ? AA DA 556  Bf DT 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1285  hydrog ? ? A  DC 557  N3 ? ? ? 1_555 MC DG 30   N1 ? ? AA DC 557  Ba DG 30   1_555 ? ? ? ? ? ? 'DC-DG PAIR'            
? ? 
hydrog1286  hydrog ? ? A  DT 558  N3 ? ? ? 1_555 MC DA 29   N1 ? ? AA DT 558  Ba DA 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1287  hydrog ? ? A  DT 558  O4 ? ? ? 1_555 MC DA 29   N6 ? ? AA DT 558  Ba DA 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1288  hydrog ? ? A  DG 559  N1 ? ? ? 1_555 MC DC 28   N3 ? ? AA DG 559  Ba DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1289  hydrog ? ? A  DG 559  N2 ? ? ? 1_555 MC DC 28   O2 ? ? AA DG 559  Ba DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1290  hydrog ? ? A  DG 559  O6 ? ? ? 1_555 MC DC 28   N4 ? ? AA DG 559  Ba DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1291  hydrog ? ? A  DG 560  N1 ? ? ? 1_555 MC DC 27   N3 ? ? AA DG 560  Ba DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1292  hydrog ? ? A  DG 560  N2 ? ? ? 1_555 MC DC 27   O2 ? ? AA DG 560  Ba DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1293  hydrog ? ? A  DG 560  O6 ? ? ? 1_555 MC DC 27   N4 ? ? AA DG 560  Ba DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1294  hydrog ? ? A  DC 561  N3 ? ? ? 1_555 MC DG 26   N1 ? ? AA DC 561  Ba DG 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1295  hydrog ? ? A  DC 561  N4 ? ? ? 1_555 MC DG 26   O6 ? ? AA DC 561  Ba DG 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1296  hydrog ? ? A  DC 561  O2 ? ? ? 1_555 MC DG 26   N2 ? ? AA DC 561  Ba DG 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1297  hydrog ? ? A  DC 562  N3 ? ? ? 1_555 MC DG 25   N1 ? ? AA DC 562  Ba DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1298  hydrog ? ? A  DC 562  N4 ? ? ? 1_555 MC DG 25   O6 ? ? AA DC 562  Ba DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1299  hydrog ? ? A  DC 562  O2 ? ? ? 1_555 MC DG 25   N2 ? ? AA DC 562  Ba DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1300  hydrog ? ? A  DG 563  N1 ? ? ? 1_555 MC DC 24   N3 ? ? AA DG 563  Ba DC 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1301  hydrog ? ? A  DG 563  N2 ? ? ? 1_555 MC DC 24   O2 ? ? AA DG 563  Ba DC 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1302  hydrog ? ? A  DG 563  O6 ? ? ? 1_555 MC DC 24   N4 ? ? AA DG 563  Ba DC 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1303  hydrog ? ? A  DT 564  N3 ? ? ? 1_555 MC DA 23   N1 ? ? AA DT 564  Ba DA 23   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog1304  hydrog ? ? A  DC 565  N3 ? ? ? 1_555 EC DG 46   N1 ? ? AA DC 565  BS DG 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1305  hydrog ? ? A  DC 565  N4 ? ? ? 1_555 EC DG 46   O6 ? ? AA DC 565  BS DG 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1306  hydrog ? ? A  DC 565  O2 ? ? ? 1_555 EC DG 46   N2 ? ? AA DC 565  BS DG 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1307  hydrog ? ? A  DG 566  N1 ? ? ? 1_555 EC DC 45   N3 ? ? AA DG 566  BS DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1308  hydrog ? ? A  DG 566  N2 ? ? ? 1_555 EC DC 45   O2 ? ? AA DG 566  BS DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1309  hydrog ? ? A  DG 566  O6 ? ? ? 1_555 EC DC 45   N4 ? ? AA DG 566  BS DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1310  hydrog ? ? A  DT 567  N3 ? ? ? 1_555 EC DA 44   N1 ? ? AA DT 567  BS DA 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1311  hydrog ? ? A  DT 567  O4 ? ? ? 1_555 EC DA 44   N6 ? ? AA DT 567  BS DA 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1312  hydrog ? ? A  DT 568  N3 ? ? ? 1_555 EC DA 43   N1 ? ? AA DT 568  BS DA 43   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog1313  hydrog ? ? A  DT 569  N3 ? ? ? 1_555 EC DA 42   N1 ? ? AA DT 569  BS DA 42   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog1314  hydrog ? ? A  DT 570  N3 ? ? ? 1_555 EC DA 41   N1 ? ? AA DT 570  BS DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1315  hydrog ? ? A  DT 570  O4 ? ? ? 1_555 EC DA 41   N6 ? ? AA DT 570  BS DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1316  hydrog ? ? A  DA 571  N1 ? ? ? 1_555 EC DT 40   N3 ? ? AA DA 571  BS DT 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1317  hydrog ? ? A  DA 571  N6 ? ? ? 1_555 EC DT 40   O4 ? ? AA DA 571  BS DT 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1318  hydrog ? ? A  DC 572  N3 ? ? ? 1_555 EC DG 39   N1 ? ? AA DC 572  BS DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1319  hydrog ? ? A  DC 572  N4 ? ? ? 1_555 EC DG 39   O6 ? ? AA DC 572  BS DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1320  hydrog ? ? A  DC 572  O2 ? ? ? 1_555 EC DG 39   N2 ? ? AA DC 572  BS DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1321  hydrog ? ? A  DA 573  N1 ? ? ? 1_555 PC DT 54   N3 ? ? AA DA 573  Bd DT 54   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1322  hydrog ? ? A  DA 573  N6 ? ? ? 1_555 PC DT 54   O4 ? ? AA DA 573  Bd DT 54   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1323  hydrog ? ? A  DA 574  N1 ? ? ? 1_555 PC DT 53   N3 ? ? AA DA 574  Bd DT 53   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1324  hydrog ? ? A  DA 574  N6 ? ? ? 1_555 PC DT 53   O4 ? ? AA DA 574  Bd DT 53   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1325  hydrog ? ? A  DC 575  N3 ? ? ? 1_555 PC DG 52   N1 ? ? AA DC 575  Bd DG 52   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1326  hydrog ? ? A  DC 575  N4 ? ? ? 1_555 PC DG 52   O6 ? ? AA DC 575  Bd DG 52   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1327  hydrog ? ? A  DC 575  O2 ? ? ? 1_555 PC DG 52   N2 ? ? AA DC 575  Bd DG 52   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1328  hydrog ? ? A  DG 576  N1 ? ? ? 1_555 PC DC 51   N3 ? ? AA DG 576  Bd DC 51   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1329  hydrog ? ? A  DG 576  N2 ? ? ? 1_555 PC DC 51   O2 ? ? AA DG 576  Bd DC 51   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1330  hydrog ? ? A  DG 576  O6 ? ? ? 1_555 PC DC 51   N4 ? ? AA DG 576  Bd DC 51   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1331  hydrog ? ? A  DT 577  N3 ? ? ? 1_555 PC DA 50   N1 ? ? AA DT 577  Bd DA 50   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog1332  hydrog ? ? A  DC 578  N3 ? ? ? 1_555 PC DG 49   N1 ? ? AA DC 578  Bd DG 49   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1333  hydrog ? ? A  DC 578  N4 ? ? ? 1_555 PC DG 49   O6 ? ? AA DC 578  Bd DG 49   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1334  hydrog ? ? A  DC 578  O2 ? ? ? 1_555 PC DG 49   N2 ? ? AA DC 578  Bd DG 49   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1335  hydrog ? ? A  DG 579  N1 ? ? ? 1_555 PC DC 48   N3 ? ? AA DG 579  Bd DC 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1336  hydrog ? ? A  DG 579  N2 ? ? ? 1_555 PC DC 48   O2 ? ? AA DG 579  Bd DC 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1337  hydrog ? ? A  DG 579  O6 ? ? ? 1_555 PC DC 48   N4 ? ? AA DG 579  Bd DC 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1338  hydrog ? ? A  DT 580  N3 ? ? ? 1_555 PC DA 47   N1 ? ? AA DT 580  Bd DA 47   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog1339  hydrog ? ? A  DG 581  N1 ? ? ? 1_555 PC DC 46   N3 ? ? AA DG 581  Bd DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1340  hydrog ? ? A  DG 581  N2 ? ? ? 1_555 PC DC 46   O2 ? ? AA DG 581  Bd DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1341  hydrog ? ? A  DG 581  O6 ? ? ? 1_555 PC DC 46   N4 ? ? AA DG 581  Bd DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1342  hydrog ? ? A  DA 582  N1 ? ? ? 1_555 PC DT 45   N3 ? ? AA DA 582  Bd DT 45   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog1343  hydrog ? ? A  DC 583  N3 ? ? ? 1_555 PC DG 44   N1 ? ? AA DC 583  Bd DG 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1344  hydrog ? ? A  DC 583  N4 ? ? ? 1_555 PC DG 44   O6 ? ? AA DC 583  Bd DG 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1345  hydrog ? ? A  DC 583  O2 ? ? ? 1_555 PC DG 44   N2 ? ? AA DC 583  Bd DG 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1346  hydrog ? ? A  DT 584  N3 ? ? ? 1_555 PC DA 43   N1 ? ? AA DT 584  Bd DA 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1347  hydrog ? ? A  DT 584  O4 ? ? ? 1_555 PC DA 43   N6 ? ? AA DT 584  Bd DA 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1348  hydrog ? ? A  DG 585  N1 ? ? ? 1_555 PC DC 42   N3 ? ? AA DG 585  Bd DC 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1349  hydrog ? ? A  DG 585  N2 ? ? ? 1_555 PC DC 42   O2 ? ? AA DG 585  Bd DC 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1350  hydrog ? ? A  DG 585  O6 ? ? ? 1_555 PC DC 42   N4 ? ? AA DG 585  Bd DC 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1351  hydrog ? ? A  DG 586  N1 ? ? ? 1_555 PC DC 31   N3 ? ? AA DG 586  Bd DC 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1352  hydrog ? ? A  DG 586  N2 ? ? ? 1_555 PC DC 31   O2 ? ? AA DG 586  Bd DC 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1353  hydrog ? ? A  DG 586  O6 ? ? ? 1_555 PC DC 31   N4 ? ? AA DG 586  Bd DC 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1354  hydrog ? ? A  DG 587  N1 ? ? ? 1_555 PC DC 30   N3 ? ? AA DG 587  Bd DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1355  hydrog ? ? A  DG 587  N2 ? ? ? 1_555 PC DC 30   O2 ? ? AA DG 587  Bd DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1356  hydrog ? ? A  DG 587  O6 ? ? ? 1_555 PC DC 30   N4 ? ? AA DG 587  Bd DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1357  hydrog ? ? A  DA 588  N1 ? ? ? 1_555 PC DT 29   N3 ? ? AA DA 588  Bd DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1358  hydrog ? ? A  DA 588  N6 ? ? ? 1_555 PC DT 29   O4 ? ? AA DA 588  Bd DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1359  hydrog ? ? A  DA 589  N1 ? ? ? 1_555 PC DT 28   N3 ? ? AA DA 589  Bd DT 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1360  hydrog ? ? A  DA 589  N6 ? ? ? 1_555 PC DT 28   O4 ? ? AA DA 589  Bd DT 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1361  hydrog ? ? A  DA 590  N1 ? ? ? 1_555 PC DT 27   N3 ? ? AA DA 590  Bd DT 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1362  hydrog ? ? A  DA 590  N6 ? ? ? 1_555 PC DT 27   O4 ? ? AA DA 590  Bd DT 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1363  hydrog ? ? A  DA 591  N1 ? ? ? 1_555 TC DT 37   N3 ? ? AA DA 591  Bh DT 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1364  hydrog ? ? A  DA 591  N6 ? ? ? 1_555 TC DT 37   O4 ? ? AA DA 591  Bh DT 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1365  hydrog ? ? A  DC 592  N3 ? ? ? 1_555 TC DG 36   N1 ? ? AA DC 592  Bh DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1366  hydrog ? ? A  DC 592  N4 ? ? ? 1_555 TC DG 36   O6 ? ? AA DC 592  Bh DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1367  hydrog ? ? A  DC 592  O2 ? ? ? 1_555 TC DG 36   N2 ? ? AA DC 592  Bh DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1368  hydrog ? ? A  DC 593  N3 ? ? ? 1_555 TC DG 35   N1 ? ? AA DC 593  Bh DG 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1369  hydrog ? ? A  DC 593  N4 ? ? ? 1_555 TC DG 35   O6 ? ? AA DC 593  Bh DG 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1370  hydrog ? ? A  DC 593  O2 ? ? ? 1_555 TC DG 35   N2 ? ? AA DC 593  Bh DG 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1371  hydrog ? ? A  DC 594  N3 ? ? ? 1_555 TC DG 34   N1 ? ? AA DC 594  Bh DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1372  hydrog ? ? A  DC 594  N4 ? ? ? 1_555 TC DG 34   O6 ? ? AA DC 594  Bh DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1373  hydrog ? ? A  DC 594  O2 ? ? ? 1_555 TC DG 34   N2 ? ? AA DC 594  Bh DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1374  hydrog ? ? A  DT 595  N3 ? ? ? 1_555 TC DA 33   N1 ? ? AA DT 595  Bh DA 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1375  hydrog ? ? A  DT 595  O4 ? ? ? 1_555 TC DA 33   N6 ? ? AA DT 595  Bh DA 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1376  hydrog ? ? A  DG 596  N1 ? ? ? 1_555 TC DC 22   N3 ? ? AA DG 596  Bh DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1377  hydrog ? ? A  DG 596  N2 ? ? ? 1_555 TC DC 22   O2 ? ? AA DG 596  Bh DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1378  hydrog ? ? A  DG 596  O6 ? ? ? 1_555 TC DC 22   N4 ? ? AA DG 596  Bh DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1379  hydrog ? ? A  DG 597  N1 ? ? ? 1_555 TC DC 21   N3 ? ? AA DG 597  Bh DC 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1380  hydrog ? ? A  DG 597  N2 ? ? ? 1_555 TC DC 21   O2 ? ? AA DG 597  Bh DC 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1381  hydrog ? ? A  DG 597  O6 ? ? ? 1_555 TC DC 21   N4 ? ? AA DG 597  Bh DC 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1382  hydrog ? ? A  DC 598  N3 ? ? ? 1_555 TC DG 20   N1 ? ? AA DC 598  Bh DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1383  hydrog ? ? A  DC 598  N4 ? ? ? 1_555 TC DG 20   O6 ? ? AA DC 598  Bh DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1384  hydrog ? ? A  DC 598  O2 ? ? ? 1_555 TC DG 20   N2 ? ? AA DC 598  Bh DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1385  hydrog ? ? A  DG 599  N1 ? ? ? 1_555 TC DC 19   N3 ? ? AA DG 599  Bh DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1386  hydrog ? ? A  DG 599  N2 ? ? ? 1_555 TC DC 19   O2 ? ? AA DG 599  Bh DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1387  hydrog ? ? A  DG 599  O6 ? ? ? 1_555 TC DC 19   N4 ? ? AA DG 599  Bh DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1388  hydrog ? ? A  DT 600  N3 ? ? ? 1_555 TC DA 18   N1 ? ? AA DT 600  Bh DA 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1389  hydrog ? ? A  DT 600  O4 ? ? ? 1_555 TC DA 18   N6 ? ? AA DT 600  Bh DA 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1390  hydrog ? ? A  DT 601  N3 ? ? ? 1_555 TC DA 17   N1 ? ? AA DT 601  Bh DA 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1391  hydrog ? ? A  DT 601  O4 ? ? ? 1_555 TC DA 17   N6 ? ? AA DT 601  Bh DA 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1392  hydrog ? ? A  DA 602  N1 ? ? ? 1_555 TC DT 16   N3 ? ? AA DA 602  Bh DT 16   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog1393  hydrog ? ? A  DC 603  N3 ? ? ? 1_555 TC DG 15   N1 ? ? AA DC 603  Bh DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1394  hydrog ? ? A  DC 603  N4 ? ? ? 1_555 TC DG 15   O6 ? ? AA DC 603  Bh DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1395  hydrog ? ? A  DC 603  O2 ? ? ? 1_555 TC DG 15   N2 ? ? AA DC 603  Bh DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1396  hydrog ? ? A  DC 604  N3 ? ? ? 1_555 TC DG 14   N1 ? ? AA DC 604  Bh DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1397  hydrog ? ? A  DC 604  N4 ? ? ? 1_555 TC DG 14   O6 ? ? AA DC 604  Bh DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1398  hydrog ? ? A  DC 604  O2 ? ? ? 1_555 TC DG 14   N2 ? ? AA DC 604  Bh DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1399  hydrog ? ? A  DC 605  N3 ? ? ? 1_555 TC DG 13   N1 ? ? AA DC 605  Bh DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1400  hydrog ? ? A  DC 605  N4 ? ? ? 1_555 TC DG 13   O6 ? ? AA DC 605  Bh DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1401  hydrog ? ? A  DC 605  O2 ? ? ? 1_555 TC DG 13   N2 ? ? AA DC 605  Bh DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1402  hydrog ? ? A  DA 606  N1 ? ? ? 1_555 TC DT 12   N3 ? ? AA DA 606  Bh DT 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1403  hydrog ? ? A  DA 606  N6 ? ? ? 1_555 TC DT 12   O4 ? ? AA DA 606  Bh DT 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1404  hydrog ? ? A  DA 607  N1 ? ? ? 1_555 TC DT 11   N3 ? ? AA DA 607  Bh DT 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1405  hydrog ? ? A  DA 607  N6 ? ? ? 1_555 TC DT 11   O4 ? ? AA DA 607  Bh DT 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1406  hydrog ? ? A  DC 608  N3 ? ? ? 1_555 TC DG 10   N1 ? ? AA DC 608  Bh DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1407  hydrog ? ? A  DC 608  N4 ? ? ? 1_555 TC DG 10   O6 ? ? AA DC 608  Bh DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1408  hydrog ? ? A  DC 608  O2 ? ? ? 1_555 TC DG 10   N2 ? ? AA DC 608  Bh DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1409  hydrog ? ? A  DT 609  N3 ? ? ? 1_555 OD DA 8    N1 ? ? AA DT 609  CB DA 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1410  hydrog ? ? A  DT 609  O4 ? ? ? 1_555 OD DA 8    N6 ? ? AA DT 609  CB DA 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1411  hydrog ? ? A  DT 610  N3 ? ? ? 1_555 OD DA 7    N1 ? ? AA DT 610  CB DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1412  hydrog ? ? A  DT 610  O4 ? ? ? 1_555 OD DA 7    N6 ? ? AA DT 610  CB DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1413  hydrog ? ? A  DA 611  N1 ? ? ? 1_555 OD DT 6    N3 ? ? AA DA 611  CB DT 6    1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog1414  hydrog ? ? A  DA 612  N1 ? ? ? 1_555 OD DT 5    N3 ? ? AA DA 612  CB DT 5    1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog1415  hydrog ? ? A  DT 613  N3 ? ? ? 1_555 OD DA 4    N1 ? ? AA DT 613  CB DA 4    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog1416  hydrog ? ? A  DC 614  N3 ? ? ? 1_555 OD DG 3    N1 ? ? AA DC 614  CB DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1417  hydrog ? ? A  DC 614  N4 ? ? ? 1_555 OD DG 3    O6 ? ? AA DC 614  CB DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1418  hydrog ? ? A  DC 614  O2 ? ? ? 1_555 OD DG 3    N2 ? ? AA DC 614  CB DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1419  hydrog ? ? A  DG 615  N1 ? ? ? 1_555 OD DC 2    N3 ? ? AA DG 615  CB DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1420  hydrog ? ? A  DG 615  N2 ? ? ? 1_555 OD DC 2    O2 ? ? AA DG 615  CB DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1421  hydrog ? ? A  DG 615  O6 ? ? ? 1_555 OD DC 2    N4 ? ? AA DG 615  CB DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1422  hydrog ? ? A  DC 616  N3 ? ? ? 1_555 OD DG 1    N1 ? ? AA DC 616  CB DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1423  hydrog ? ? A  DC 616  N4 ? ? ? 1_555 OD DG 1    O6 ? ? AA DC 616  CB DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1424  hydrog ? ? A  DC 616  O2 ? ? ? 1_555 OD DG 1    N2 ? ? AA DC 616  CB DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1425  hydrog ? ? A  DC 617  N3 ? ? ? 1_555 DC DG 64   N1 ? ? AA DC 617  BR DG 64   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1426  hydrog ? ? A  DC 617  N4 ? ? ? 1_555 DC DG 64   O6 ? ? AA DC 617  BR DG 64   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1427  hydrog ? ? A  DC 617  O2 ? ? ? 1_555 DC DG 64   N2 ? ? AA DC 617  BR DG 64   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1428  hydrog ? ? A  DT 618  N3 ? ? ? 1_555 DC DA 63   N1 ? ? AA DT 618  BR DA 63   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog1429  hydrog ? ? A  DT 619  N3 ? ? ? 1_555 DC DA 62   N1 ? ? AA DT 619  BR DA 62   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1430  hydrog ? ? A  DT 619  O4 ? ? ? 1_555 DC DA 62   N6 ? ? AA DT 619  BR DA 62   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1431  hydrog ? ? A  DG 620  N1 ? ? ? 1_555 DC DC 61   N3 ? ? AA DG 620  BR DC 61   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1432  hydrog ? ? A  DG 620  N2 ? ? ? 1_555 DC DC 61   O2 ? ? AA DG 620  BR DC 61   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1433  hydrog ? ? A  DG 620  O6 ? ? ? 1_555 DC DC 61   N4 ? ? AA DG 620  BR DC 61   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1434  hydrog ? ? A  DC 621  N3 ? ? ? 1_555 DC DG 60   N1 ? ? AA DC 621  BR DG 60   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1435  hydrog ? ? A  DC 621  N4 ? ? ? 1_555 DC DG 60   O6 ? ? AA DC 621  BR DG 60   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1436  hydrog ? ? A  DC 621  O2 ? ? ? 1_555 DC DG 60   N2 ? ? AA DC 621  BR DG 60   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1437  hydrog ? ? A  DA 622  N1 ? ? ? 1_555 DC DT 59   N3 ? ? AA DA 622  BR DT 59   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1438  hydrog ? ? A  DA 622  N6 ? ? ? 1_555 DC DT 59   O4 ? ? AA DA 622  BR DT 59   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1439  hydrog ? ? A  DG 623  N1 ? ? ? 1_555 DC DC 58   N3 ? ? AA DG 623  BR DC 58   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1440  hydrog ? ? A  DG 623  N2 ? ? ? 1_555 DC DC 58   O2 ? ? AA DG 623  BR DC 58   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1441  hydrog ? ? A  DG 623  O6 ? ? ? 1_555 DC DC 58   N4 ? ? AA DG 623  BR DC 58   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1442  hydrog ? ? A  DC 624  N3 ? ? ? 1_555 DC DG 57   N1 ? ? AA DC 624  BR DG 57   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1443  hydrog ? ? A  DC 624  N4 ? ? ? 1_555 DC DG 57   O6 ? ? AA DC 624  BR DG 57   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1444  hydrog ? ? A  DC 624  O2 ? ? ? 1_555 DC DG 57   N2 ? ? AA DC 624  BR DG 57   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1445  hydrog ? ? A  DA 625  N1 ? ? ? 1_555 DC DT 56   N3 ? ? AA DA 625  BR DT 56   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog1446  hydrog ? ? A  DC 626  N3 ? ? ? 1_555 DC DG 55   N1 ? ? AA DC 626  BR DG 55   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1447  hydrog ? ? A  DC 626  N4 ? ? ? 1_555 DC DG 55   O6 ? ? AA DC 626  BR DG 55   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1448  hydrog ? ? A  DC 626  O2 ? ? ? 1_555 DC DG 55   N2 ? ? AA DC 626  BR DG 55   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1449  hydrog ? ? A  DT 628  N3 ? ? ? 1_555 DC DA 43   N1 ? ? AA DT 628  BR DA 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1450  hydrog ? ? A  DT 628  O4 ? ? ? 1_555 DC DA 43   N6 ? ? AA DT 628  BR DA 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1451  hydrog ? ? A  DC 629  N3 ? ? ? 1_555 DC DG 42   N1 ? ? AA DC 629  BR DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1452  hydrog ? ? A  DC 629  N4 ? ? ? 1_555 DC DG 42   O6 ? ? AA DC 629  BR DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1453  hydrog ? ? A  DC 629  O2 ? ? ? 1_555 DC DG 42   N2 ? ? AA DC 629  BR DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1454  hydrog ? ? A  DC 630  N3 ? ? ? 1_555 DC DG 41   N1 ? ? AA DC 630  BR DG 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1455  hydrog ? ? A  DC 630  N4 ? ? ? 1_555 DC DG 41   O6 ? ? AA DC 630  BR DG 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1456  hydrog ? ? A  DC 630  O2 ? ? ? 1_555 DC DG 41   N2 ? ? AA DC 630  BR DG 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1457  hydrog ? ? A  DC 631  N3 ? ? ? 1_555 TD DG 10   N1 ? ? AA DC 631  CG DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1458  hydrog ? ? A  DC 631  N4 ? ? ? 1_555 TD DG 10   O6 ? ? AA DC 631  CG DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1459  hydrog ? ? A  DC 631  O2 ? ? ? 1_555 TD DG 10   N2 ? ? AA DC 631  CG DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1460  hydrog ? ? A  DC 632  N3 ? ? ? 1_555 TD DG 9    N1 ? ? AA DC 632  CG DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1461  hydrog ? ? A  DC 632  N4 ? ? ? 1_555 TD DG 9    O6 ? ? AA DC 632  CG DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1462  hydrog ? ? A  DC 632  O2 ? ? ? 1_555 TD DG 9    N2 ? ? AA DC 632  CG DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1463  hydrog ? ? A  DC 633  N3 ? ? ? 1_555 TD DG 8    N1 ? ? AA DC 633  CG DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1464  hydrog ? ? A  DC 633  N4 ? ? ? 1_555 TD DG 8    O6 ? ? AA DC 633  CG DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1465  hydrog ? ? A  DC 633  O2 ? ? ? 1_555 TD DG 8    N2 ? ? AA DC 633  CG DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1466  hydrog ? ? A  DT 634  N3 ? ? ? 1_555 TD DA 7    N1 ? ? AA DT 634  CG DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1467  hydrog ? ? A  DT 634  O4 ? ? ? 1_555 TD DA 7    N6 ? ? AA DT 634  CG DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1468  hydrog ? ? A  DT 635  N3 ? ? ? 1_555 TD DA 6    N1 ? ? AA DT 635  CG DA 6    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog1469  hydrog ? ? A  DT 636  N3 ? ? ? 1_555 TD DA 5    N1 ? ? AA DT 636  CG DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1470  hydrog ? ? A  DT 636  O4 ? ? ? 1_555 TD DA 5    N6 ? ? AA DT 636  CG DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1471  hydrog ? ? A  DC 637  N3 ? ? ? 1_555 TD DG 4    N1 ? ? AA DC 637  CG DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1472  hydrog ? ? A  DC 637  N4 ? ? ? 1_555 TD DG 4    O6 ? ? AA DC 637  CG DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1473  hydrog ? ? A  DC 637  O2 ? ? ? 1_555 TD DG 4    N2 ? ? AA DC 637  CG DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1474  hydrog ? ? A  DG 638  N1 ? ? ? 1_555 TD DC 3    N3 ? ? AA DG 638  CG DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1475  hydrog ? ? A  DG 638  N2 ? ? ? 1_555 TD DC 3    O2 ? ? AA DG 638  CG DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1476  hydrog ? ? A  DG 638  O6 ? ? ? 1_555 TD DC 3    N4 ? ? AA DG 638  CG DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1477  hydrog ? ? A  DC 639  N3 ? ? ? 1_555 KE DG 5    N1 ? ? AA DC 639  CX DG 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1478  hydrog ? ? A  DC 639  N4 ? ? ? 1_555 KE DG 5    O6 ? ? AA DC 639  CX DG 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1479  hydrog ? ? A  DC 639  O2 ? ? ? 1_555 KE DG 5    N2 ? ? AA DC 639  CX DG 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1480  hydrog ? ? A  DC 640  N3 ? ? ? 1_555 KE DG 4    N1 ? ? AA DC 640  CX DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1481  hydrog ? ? A  DC 640  N4 ? ? ? 1_555 KE DG 4    O6 ? ? AA DC 640  CX DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1482  hydrog ? ? A  DC 640  O2 ? ? ? 1_555 KE DG 4    N2 ? ? AA DC 640  CX DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1483  hydrog ? ? A  DA 641  N1 ? ? ? 1_555 KE DT 3    N3 ? ? AA DA 641  CX DT 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1484  hydrog ? ? A  DA 641  N6 ? ? ? 1_555 KE DT 3    O4 ? ? AA DA 641  CX DT 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1485  hydrog ? ? A  DG 642  N1 ? ? ? 1_555 KE DC 2    N3 ? ? AA DG 642  CX DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1486  hydrog ? ? A  DG 642  N2 ? ? ? 1_555 KE DC 2    O2 ? ? AA DG 642  CX DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1487  hydrog ? ? A  DG 642  O6 ? ? ? 1_555 KE DC 2    N4 ? ? AA DG 642  CX DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1488  hydrog ? ? A  DC 643  N3 ? ? ? 1_555 KE DG 1    N1 ? ? AA DC 643  CX DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1489  hydrog ? ? A  DC 643  N4 ? ? ? 1_555 KE DG 1    O6 ? ? AA DC 643  CX DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1490  hydrog ? ? A  DC 643  O2 ? ? ? 1_555 KE DG 1    N2 ? ? AA DC 643  CX DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1491  hydrog ? ? A  DT 644  N3 ? ? ? 1_555 TC DA 48   N1 ? ? AA DT 644  Bh DA 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1492  hydrog ? ? A  DT 644  O4 ? ? ? 1_555 TC DA 48   N6 ? ? AA DT 644  Bh DA 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1493  hydrog ? ? A  DG 645  N1 ? ? ? 1_555 TC DC 47   N3 ? ? AA DG 645  Bh DC 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1494  hydrog ? ? A  DG 645  N2 ? ? ? 1_555 TC DC 47   O2 ? ? AA DG 645  Bh DC 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1495  hydrog ? ? A  DG 645  O6 ? ? ? 1_555 TC DC 47   N4 ? ? AA DG 645  Bh DC 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1496  hydrog ? ? A  DG 646  N1 ? ? ? 1_555 TC DC 46   N3 ? ? AA DG 646  Bh DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1497  hydrog ? ? A  DG 646  N2 ? ? ? 1_555 TC DC 46   O2 ? ? AA DG 646  Bh DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1498  hydrog ? ? A  DG 646  O6 ? ? ? 1_555 TC DC 46   N4 ? ? AA DG 646  Bh DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1499  hydrog ? ? A  DC 647  N3 ? ? ? 1_555 UC DG 6    N1 ? ? AA DC 647  Bi DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1500  hydrog ? ? A  DC 647  N4 ? ? ? 1_555 UC DG 6    O6 ? ? AA DC 647  Bi DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1501  hydrog ? ? A  DC 647  O2 ? ? ? 1_555 UC DG 6    N2 ? ? AA DC 647  Bi DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1502  hydrog ? ? A  DG 648  N1 ? ? ? 1_555 UC DC 5    N3 ? ? AA DG 648  Bi DC 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1503  hydrog ? ? A  DG 648  N2 ? ? ? 1_555 UC DC 5    O2 ? ? AA DG 648  Bi DC 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1504  hydrog ? ? A  DG 648  O6 ? ? ? 1_555 UC DC 5    N4 ? ? AA DG 648  Bi DC 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1505  hydrog ? ? A  DT 649  N3 ? ? ? 1_555 UC DA 4    N1 ? ? AA DT 649  Bi DA 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1506  hydrog ? ? A  DT 649  O4 ? ? ? 1_555 UC DA 4    N6 ? ? AA DT 649  Bi DA 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1507  hydrog ? ? A  DA 650  N1 ? ? ? 1_555 UC DT 3    N3 ? ? AA DA 650  Bi DT 3    1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog1508  hydrog ? ? A  DA 651  N1 ? ? ? 1_555 UC DT 2    N3 ? ? AA DA 651  Bi DT 2    1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog1509  hydrog ? ? A  DT 652  N3 ? ? ? 1_555 UC DA 1    N1 ? ? AA DT 652  Bi DA 1    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog1510  hydrog ? ? A  DA 653  N1 ? ? ? 1_555 ZE DT 44   N3 ? ? AA DA 653  Ct DT 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1511  hydrog ? ? A  DA 653  N6 ? ? ? 1_555 ZE DT 44   O4 ? ? AA DA 653  Ct DT 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1512  hydrog ? ? A  DG 654  N1 ? ? ? 1_555 ZE DC 43   N3 ? ? AA DG 654  Ct DC 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1513  hydrog ? ? A  DG 654  N2 ? ? ? 1_555 ZE DC 43   O2 ? ? AA DG 654  Ct DC 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1514  hydrog ? ? A  DG 654  O6 ? ? ? 1_555 ZE DC 43   N4 ? ? AA DG 654  Ct DC 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1515  hydrog ? ? A  DC 655  N3 ? ? ? 1_555 AC DG 34   N1 ? ? AA DC 655  BO DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1516  hydrog ? ? A  DC 655  N4 ? ? ? 1_555 AC DG 34   O6 ? ? AA DC 655  BO DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1517  hydrog ? ? A  DC 655  O2 ? ? ? 1_555 AC DG 34   N2 ? ? AA DC 655  BO DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1518  hydrog ? ? A  DG 656  N1 ? ? ? 1_555 AC DC 33   N3 ? ? AA DG 656  BO DC 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1519  hydrog ? ? A  DG 656  N2 ? ? ? 1_555 AC DC 33   O2 ? ? AA DG 656  BO DC 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1520  hydrog ? ? A  DG 656  O6 ? ? ? 1_555 AC DC 33   N4 ? ? AA DG 656  BO DC 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1521  hydrog ? ? A  DA 657  N1 ? ? ? 1_555 AC DT 32   N3 ? ? AA DA 657  BO DT 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1522  hydrog ? ? A  DA 657  N6 ? ? ? 1_555 AC DT 32   O4 ? ? AA DA 657  BO DT 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1523  hydrog ? ? A  DA 658  N1 ? ? ? 1_555 AC DT 31   N3 ? ? AA DA 658  BO DT 31   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog1524  hydrog ? ? A  DG 659  N1 ? ? ? 1_555 AC DC 30   N3 ? ? AA DG 659  BO DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1525  hydrog ? ? A  DG 659  N2 ? ? ? 1_555 AC DC 30   O2 ? ? AA DG 659  BO DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1526  hydrog ? ? A  DG 659  O6 ? ? ? 1_555 AC DC 30   N4 ? ? AA DG 659  BO DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1527  hydrog ? ? A  DA 660  N1 ? ? ? 1_555 AC DT 29   N3 ? ? AA DA 660  BO DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1528  hydrog ? ? A  DA 660  N6 ? ? ? 1_555 AC DT 29   O4 ? ? AA DA 660  BO DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1529  hydrog ? ? A  DG 661  N1 ? ? ? 1_555 AC DC 28   N3 ? ? AA DG 661  BO DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1530  hydrog ? ? A  DG 661  N2 ? ? ? 1_555 AC DC 28   O2 ? ? AA DG 661  BO DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1531  hydrog ? ? A  DG 661  O6 ? ? ? 1_555 AC DC 28   N4 ? ? AA DG 661  BO DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1532  hydrog ? ? A  DG 662  N1 ? ? ? 1_555 AC DC 27   N3 ? ? AA DG 662  BO DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1533  hydrog ? ? A  DG 662  N2 ? ? ? 1_555 AC DC 27   O2 ? ? AA DG 662  BO DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1534  hydrog ? ? A  DG 662  O6 ? ? ? 1_555 AC DC 27   N4 ? ? AA DG 662  BO DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1535  hydrog ? ? A  DC 663  N3 ? ? ? 1_555 UD DG 10   N1 ? ? AA DC 663  CH DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1536  hydrog ? ? A  DC 663  N4 ? ? ? 1_555 UD DG 10   O6 ? ? AA DC 663  CH DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1537  hydrog ? ? A  DC 663  O2 ? ? ? 1_555 UD DG 10   N2 ? ? AA DC 663  CH DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1538  hydrog ? ? A  DC 664  N3 ? ? ? 1_555 UD DG 9    N1 ? ? AA DC 664  CH DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1539  hydrog ? ? A  DC 664  N4 ? ? ? 1_555 UD DG 9    O6 ? ? AA DC 664  CH DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1540  hydrog ? ? A  DC 664  O2 ? ? ? 1_555 UD DG 9    N2 ? ? AA DC 664  CH DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1541  hydrog ? ? A  DC 665  N3 ? ? ? 1_555 UD DG 8    N1 ? ? AA DC 665  CH DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1542  hydrog ? ? A  DC 665  N4 ? ? ? 1_555 UD DG 8    O6 ? ? AA DC 665  CH DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1543  hydrog ? ? A  DC 665  O2 ? ? ? 1_555 UD DG 8    N2 ? ? AA DC 665  CH DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1544  hydrog ? ? A  DG 666  N1 ? ? ? 1_555 UD DC 7    N3 ? ? AA DG 666  CH DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1545  hydrog ? ? A  DG 666  N2 ? ? ? 1_555 UD DC 7    O2 ? ? AA DG 666  CH DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1546  hydrog ? ? A  DG 666  O6 ? ? ? 1_555 UD DC 7    N4 ? ? AA DG 666  CH DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1547  hydrog ? ? A  DC 667  N3 ? ? ? 1_555 UD DG 6    N1 ? ? AA DC 667  CH DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1548  hydrog ? ? A  DC 667  N4 ? ? ? 1_555 UD DG 6    O6 ? ? AA DC 667  CH DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1549  hydrog ? ? A  DC 667  O2 ? ? ? 1_555 UD DG 6    N2 ? ? AA DC 667  CH DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1550  hydrog ? ? A  DA 668  N1 ? ? ? 1_555 UD DT 5    N3 ? ? AA DA 668  CH DT 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1551  hydrog ? ? A  DA 668  N6 ? ? ? 1_555 UD DT 5    O4 ? ? AA DA 668  CH DT 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1552  hydrog ? ? A  DC 669  N3 ? ? ? 1_555 UD DG 4    N1 ? ? AA DC 669  CH DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1553  hydrog ? ? A  DC 669  N4 ? ? ? 1_555 UD DG 4    O6 ? ? AA DC 669  CH DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1554  hydrog ? ? A  DC 669  O2 ? ? ? 1_555 UD DG 4    N2 ? ? AA DC 669  CH DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1555  hydrog ? ? A  DC 670  N3 ? ? ? 1_555 UD DG 3    N1 ? ? AA DC 670  CH DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1556  hydrog ? ? A  DC 670  N4 ? ? ? 1_555 UD DG 3    O6 ? ? AA DC 670  CH DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1557  hydrog ? ? A  DC 670  O2 ? ? ? 1_555 UD DG 3    N2 ? ? AA DC 670  CH DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1558  hydrog ? ? A  DG 671  N1 ? ? ? 1_555 GB DC 30   N3 ? ? AA DG 671  B3 DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1559  hydrog ? ? A  DG 671  N2 ? ? ? 1_555 GB DC 30   O2 ? ? AA DG 671  B3 DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1560  hydrog ? ? A  DG 671  O6 ? ? ? 1_555 GB DC 30   N4 ? ? AA DG 671  B3 DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1561  hydrog ? ? A  DA 672  N1 ? ? ? 1_555 GB DT 29   N3 ? ? AA DA 672  B3 DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1562  hydrog ? ? A  DA 672  N6 ? ? ? 1_555 GB DT 29   O4 ? ? AA DA 672  B3 DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1563  hydrog ? ? A  DT 673  N3 ? ? ? 1_555 GB DA 28   N1 ? ? AA DT 673  B3 DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1564  hydrog ? ? A  DT 673  O4 ? ? ? 1_555 GB DA 28   N6 ? ? AA DT 673  B3 DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1565  hydrog ? ? A  DC 674  N3 ? ? ? 1_555 GB DG 27   N1 ? ? AA DC 674  B3 DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1566  hydrog ? ? A  DC 674  N4 ? ? ? 1_555 GB DG 27   O6 ? ? AA DC 674  B3 DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1567  hydrog ? ? A  DC 674  O2 ? ? ? 1_555 GB DG 27   N2 ? ? AA DC 674  B3 DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1568  hydrog ? ? A  DG 675  N1 ? ? ? 1_555 GB DC 26   N3 ? ? AA DG 675  B3 DC 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1569  hydrog ? ? A  DG 675  N2 ? ? ? 1_555 GB DC 26   O2 ? ? AA DG 675  B3 DC 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1570  hydrog ? ? A  DG 675  O6 ? ? ? 1_555 GB DC 26   N4 ? ? AA DG 675  B3 DC 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1571  hydrog ? ? A  DC 676  N3 ? ? ? 1_555 GB DG 25   N1 ? ? AA DC 676  B3 DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1572  hydrog ? ? A  DC 676  N4 ? ? ? 1_555 GB DG 25   O6 ? ? AA DC 676  B3 DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1573  hydrog ? ? A  DC 676  O2 ? ? ? 1_555 GB DG 25   N2 ? ? AA DC 676  B3 DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1574  hydrog ? ? A  DC 677  N3 ? ? ? 1_555 GB DG 24   N1 ? ? AA DC 677  B3 DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1575  hydrog ? ? A  DC 677  N4 ? ? ? 1_555 GB DG 24   O6 ? ? AA DC 677  B3 DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1576  hydrog ? ? A  DC 677  O2 ? ? ? 1_555 GB DG 24   N2 ? ? AA DC 677  B3 DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1577  hydrog ? ? A  DC 678  N3 ? ? ? 1_555 GB DG 23   N1 ? ? AA DC 678  B3 DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1578  hydrog ? ? A  DC 678  N4 ? ? ? 1_555 GB DG 23   O6 ? ? AA DC 678  B3 DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1579  hydrog ? ? A  DC 678  O2 ? ? ? 1_555 GB DG 23   N2 ? ? AA DC 678  B3 DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1580  hydrog ? ? A  DT 679  N3 ? ? ? 1_555 JB DA 21   N1 ? ? AA DT 679  B6 DA 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1581  hydrog ? ? A  DT 679  O4 ? ? ? 1_555 JB DA 21   N6 ? ? AA DT 679  B6 DA 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1582  hydrog ? ? A  DT 680  N3 ? ? ? 1_555 JB DA 20   N1 ? ? AA DT 680  B6 DA 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1583  hydrog ? ? A  DT 680  O4 ? ? ? 1_555 JB DA 20   N6 ? ? AA DT 680  B6 DA 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1584  hydrog ? ? A  DC 681  N3 ? ? ? 1_555 JB DG 19   N1 ? ? AA DC 681  B6 DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1585  hydrog ? ? A  DC 681  N4 ? ? ? 1_555 JB DG 19   O6 ? ? AA DC 681  B6 DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1586  hydrog ? ? A  DC 681  O2 ? ? ? 1_555 JB DG 19   N2 ? ? AA DC 681  B6 DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1587  hydrog ? ? A  DC 682  N3 ? ? ? 1_555 JB DG 18   N1 ? ? AA DC 682  B6 DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1588  hydrog ? ? A  DC 682  N4 ? ? ? 1_555 JB DG 18   O6 ? ? AA DC 682  B6 DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1589  hydrog ? ? A  DC 682  O2 ? ? ? 1_555 JB DG 18   N2 ? ? AA DC 682  B6 DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1590  hydrog ? ? A  DC 683  N3 ? ? ? 1_555 JB DG 17   N1 ? ? AA DC 683  B6 DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1591  hydrog ? ? A  DC 683  N4 ? ? ? 1_555 JB DG 17   O6 ? ? AA DC 683  B6 DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1592  hydrog ? ? A  DC 683  O2 ? ? ? 1_555 JB DG 17   N2 ? ? AA DC 683  B6 DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1593  hydrog ? ? A  DA 684  N1 ? ? ? 1_555 JB DT 16   N3 ? ? AA DA 684  B6 DT 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1594  hydrog ? ? A  DA 684  N6 ? ? ? 1_555 JB DT 16   O4 ? ? AA DA 684  B6 DT 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1595  hydrog ? ? A  DA 685  N1 ? ? ? 1_555 JB DT 15   N3 ? ? AA DA 685  B6 DT 15   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog1596  hydrog ? ? A  DC 686  N3 ? ? ? 1_555 JB DG 14   N2 ? ? AA DC 686  B6 DG 14   1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' 
? ? 
hydrog1597  hydrog ? ? A  DC 686  O2 ? ? ? 1_555 JB DG 14   N1 ? ? AA DC 686  B6 DG 14   1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' 
? ? 
hydrog1598  hydrog ? ? A  DA 687  N1 ? ? ? 1_555 CC DT 30   N3 ? ? AA DA 687  BQ DT 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1599  hydrog ? ? A  DA 687  N6 ? ? ? 1_555 CC DT 30   O4 ? ? AA DA 687  BQ DT 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1600  hydrog ? ? A  DG 688  N1 ? ? ? 1_555 CC DC 29   N3 ? ? AA DG 688  BQ DC 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1601  hydrog ? ? A  DG 688  N2 ? ? ? 1_555 CC DC 29   O2 ? ? AA DG 688  BQ DC 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1602  hydrog ? ? A  DG 688  O6 ? ? ? 1_555 CC DC 29   N4 ? ? AA DG 688  BQ DC 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1603  hydrog ? ? A  DT 689  N3 ? ? ? 1_555 CC DA 28   N1 ? ? AA DT 689  BQ DA 28   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog1604  hydrog ? ? A  DT 690  N3 ? ? ? 1_555 CC DA 27   N1 ? ? AA DT 690  BQ DA 27   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog1605  hydrog ? ? A  DG 691  N1 ? ? ? 1_555 CC DC 26   N3 ? ? AA DG 691  BQ DC 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1606  hydrog ? ? A  DG 691  N2 ? ? ? 1_555 CC DC 26   O2 ? ? AA DG 691  BQ DC 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1607  hydrog ? ? A  DG 691  O6 ? ? ? 1_555 CC DC 26   N4 ? ? AA DG 691  BQ DC 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1608  hydrog ? ? A  DC 692  N3 ? ? ? 1_555 CC DG 25   N1 ? ? AA DC 692  BQ DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1609  hydrog ? ? A  DC 692  N4 ? ? ? 1_555 CC DG 25   O6 ? ? AA DC 692  BQ DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1610  hydrog ? ? A  DC 692  O2 ? ? ? 1_555 CC DG 25   N2 ? ? AA DC 692  BQ DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1611  hydrog ? ? A  DG 693  N1 ? ? ? 1_555 CC DC 24   N3 ? ? AA DG 693  BQ DC 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1612  hydrog ? ? A  DG 693  N2 ? ? ? 1_555 CC DC 24   O2 ? ? AA DG 693  BQ DC 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1613  hydrog ? ? A  DG 693  O6 ? ? ? 1_555 CC DC 24   N4 ? ? AA DG 693  BQ DC 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1614  hydrog ? ? A  DC 694  N3 ? ? ? 1_555 CC DG 23   N1 ? ? AA DC 694  BQ DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1615  hydrog ? ? A  DC 694  N4 ? ? ? 1_555 CC DG 23   O6 ? ? AA DC 694  BQ DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1616  hydrog ? ? A  DC 694  O2 ? ? ? 1_555 CC DG 23   N2 ? ? AA DC 694  BQ DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1617  hydrog ? ? A  DA 695  N1 ? ? ? 1_555 FC DT 13   N3 ? ? AA DA 695  BT DT 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1618  hydrog ? ? A  DA 695  N6 ? ? ? 1_555 FC DT 13   O4 ? ? AA DA 695  BT DT 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1619  hydrog ? ? A  DG 696  N1 ? ? ? 1_555 FC DC 12   N3 ? ? AA DG 696  BT DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1620  hydrog ? ? A  DG 696  N2 ? ? ? 1_555 FC DC 12   O2 ? ? AA DG 696  BT DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1621  hydrog ? ? A  DG 696  O6 ? ? ? 1_555 FC DC 12   N4 ? ? AA DG 696  BT DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1622  hydrog ? ? A  DC 697  N3 ? ? ? 1_555 FC DG 11   N1 ? ? AA DC 697  BT DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1623  hydrog ? ? A  DC 697  N4 ? ? ? 1_555 FC DG 11   O6 ? ? AA DC 697  BT DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1624  hydrog ? ? A  DC 697  O2 ? ? ? 1_555 FC DG 11   N2 ? ? AA DC 697  BT DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1625  hydrog ? ? A  DC 698  N3 ? ? ? 1_555 HB DG 11   N1 ? ? AA DC 698  B4 DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1626  hydrog ? ? A  DC 698  N4 ? ? ? 1_555 HB DG 11   O6 ? ? AA DC 698  B4 DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1627  hydrog ? ? A  DC 698  O2 ? ? ? 1_555 HB DG 11   N2 ? ? AA DC 698  B4 DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1628  hydrog ? ? A  DT 699  N3 ? ? ? 1_555 HB DA 10   N1 ? ? AA DT 699  B4 DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1629  hydrog ? ? A  DT 699  O4 ? ? ? 1_555 HB DA 10   N6 ? ? AA DT 699  B4 DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1630  hydrog ? ? A  DG 700  N1 ? ? ? 1_555 HB DC 9    N3 ? ? AA DG 700  B4 DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1631  hydrog ? ? A  DG 700  N2 ? ? ? 1_555 HB DC 9    O2 ? ? AA DG 700  B4 DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1632  hydrog ? ? A  DG 700  O6 ? ? ? 1_555 HB DC 9    N4 ? ? AA DG 700  B4 DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1633  hydrog ? ? A  DA 701  N1 ? ? ? 1_555 SC DT 2    N3 ? ? AA DA 701  Bg DT 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1634  hydrog ? ? A  DA 701  N6 ? ? ? 1_555 SC DT 2    O4 ? ? AA DA 701  Bg DT 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1635  hydrog ? ? A  DA 702  N1 ? ? ? 1_555 SC DT 1    N3 ? ? AA DA 702  Bg DT 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1636  hydrog ? ? A  DA 702  N6 ? ? ? 1_555 SC DT 1    O4 ? ? AA DA 702  Bg DT 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1637  hydrog ? ? A  DT 703  N3 ? ? ? 1_555 AF DA 60   N1 ? ? AA DT 703  Cu DA 60   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1638  hydrog ? ? A  DT 703  O4 ? ? ? 1_555 AF DA 60   N6 ? ? AA DT 703  Cu DA 60   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1639  hydrog ? ? A  DG 704  N1 ? ? ? 1_555 AF DC 59   N3 ? ? AA DG 704  Cu DC 59   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1640  hydrog ? ? A  DG 704  N2 ? ? ? 1_555 AF DC 59   O2 ? ? AA DG 704  Cu DC 59   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1641  hydrog ? ? A  DG 704  O6 ? ? ? 1_555 AF DC 59   N4 ? ? AA DG 704  Cu DC 59   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1642  hydrog ? ? A  DG 705  N1 ? ? ? 1_555 AF DC 58   N3 ? ? AA DG 705  Cu DC 58   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1643  hydrog ? ? A  DG 705  N2 ? ? ? 1_555 AF DC 58   O2 ? ? AA DG 705  Cu DC 58   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1644  hydrog ? ? A  DG 705  O6 ? ? ? 1_555 AF DC 58   N4 ? ? AA DG 705  Cu DC 58   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1645  hydrog ? ? A  DC 706  N3 ? ? ? 1_555 AF DG 57   N1 ? ? AA DC 706  Cu DG 57   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1646  hydrog ? ? A  DC 706  N4 ? ? ? 1_555 AF DG 57   O6 ? ? AA DC 706  Cu DG 57   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1647  hydrog ? ? A  DC 706  O2 ? ? ? 1_555 AF DG 57   N2 ? ? AA DC 706  Cu DG 57   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1648  hydrog ? ? A  DG 707  N1 ? ? ? 1_555 AF DC 56   N3 ? ? AA DG 707  Cu DC 56   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1649  hydrog ? ? A  DG 707  N2 ? ? ? 1_555 AF DC 56   O2 ? ? AA DG 707  Cu DC 56   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1650  hydrog ? ? A  DG 707  O6 ? ? ? 1_555 AF DC 56   N4 ? ? AA DG 707  Cu DC 56   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1651  hydrog ? ? A  DA 708  N1 ? ? ? 1_555 AF DT 55   N3 ? ? AA DA 708  Cu DT 55   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog1652  hydrog ? ? A  DA 709  N1 ? ? ? 1_555 IB DT 14   N3 ? ? AA DA 709  B5 DT 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1653  hydrog ? ? A  DA 709  N6 ? ? ? 1_555 IB DT 14   O4 ? ? AA DA 709  B5 DT 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1654  hydrog ? ? A  DT 710  N3 ? ? ? 1_555 IB DA 13   N1 ? ? AA DT 710  B5 DA 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1655  hydrog ? ? A  DT 710  O4 ? ? ? 1_555 IB DA 13   N6 ? ? AA DT 710  B5 DA 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1656  hydrog ? ? A  DG 711  N1 ? ? ? 1_555 IB DC 12   N3 ? ? AA DG 711  B5 DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1657  hydrog ? ? A  DG 711  N2 ? ? ? 1_555 IB DC 12   O2 ? ? AA DG 711  B5 DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1658  hydrog ? ? A  DG 711  O6 ? ? ? 1_555 IB DC 12   N4 ? ? AA DG 711  B5 DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1659  hydrog ? ? A  DG 712  N1 ? ? ? 1_555 IB DC 11   N3 ? ? AA DG 712  B5 DC 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1660  hydrog ? ? A  DG 712  N2 ? ? ? 1_555 IB DC 11   O2 ? ? AA DG 712  B5 DC 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1661  hydrog ? ? A  DG 712  O6 ? ? ? 1_555 IB DC 11   N4 ? ? AA DG 712  B5 DC 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1662  hydrog ? ? A  DC 713  N3 ? ? ? 1_555 IB DG 10   N1 ? ? AA DC 713  B5 DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1663  hydrog ? ? A  DC 713  N4 ? ? ? 1_555 IB DG 10   O6 ? ? AA DC 713  B5 DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1664  hydrog ? ? A  DC 713  O2 ? ? ? 1_555 IB DG 10   N2 ? ? AA DC 713  B5 DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1665  hydrog ? ? A  DG 714  N1 ? ? ? 1_555 IB DC 9    N3 ? ? AA DG 714  B5 DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1666  hydrog ? ? A  DG 714  N2 ? ? ? 1_555 IB DC 9    O2 ? ? AA DG 714  B5 DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1667  hydrog ? ? A  DG 714  O6 ? ? ? 1_555 IB DC 9    N4 ? ? AA DG 714  B5 DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1668  hydrog ? ? A  DC 715  N3 ? ? ? 1_555 IB DG 8    N1 ? ? AA DC 715  B5 DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1669  hydrog ? ? A  DC 715  N4 ? ? ? 1_555 IB DG 8    O6 ? ? AA DC 715  B5 DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1670  hydrog ? ? A  DC 715  O2 ? ? ? 1_555 IB DG 8    N2 ? ? AA DC 715  B5 DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1671  hydrog ? ? A  DT 716  N3 ? ? ? 1_555 IB DA 7    N1 ? ? AA DT 716  B5 DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1672  hydrog ? ? A  DT 716  O4 ? ? ? 1_555 IB DA 7    N6 ? ? AA DT 716  B5 DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1673  hydrog ? ? A  DT 717  N3 ? ? ? 1_555 GB DA 38   N1 ? ? AA DT 717  B3 DA 38   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog1674  hydrog ? ? A  DT 718  N3 ? ? ? 1_555 GB DA 37   N1 ? ? AA DT 718  B3 DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1675  hydrog ? ? A  DT 718  O4 ? ? ? 1_555 GB DA 37   N6 ? ? AA DT 718  B3 DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1676  hydrog ? ? A  DG 719  N1 ? ? ? 1_555 GB DC 36   N3 ? ? AA DG 719  B3 DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1677  hydrog ? ? A  DG 719  N2 ? ? ? 1_555 GB DC 36   O2 ? ? AA DG 719  B3 DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1678  hydrog ? ? A  DG 719  O6 ? ? ? 1_555 GB DC 36   N4 ? ? AA DG 719  B3 DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1679  hydrog ? ? A  DC 720  N3 ? ? ? 1_555 GB DG 35   N1 ? ? AA DC 720  B3 DG 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1680  hydrog ? ? A  DC 720  N4 ? ? ? 1_555 GB DG 35   O6 ? ? AA DC 720  B3 DG 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1681  hydrog ? ? A  DC 720  O2 ? ? ? 1_555 GB DG 35   N2 ? ? AA DC 720  B3 DG 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1682  hydrog ? ? A  DC 721  N3 ? ? ? 1_555 GB DG 34   N1 ? ? AA DC 721  B3 DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1683  hydrog ? ? A  DC 721  N4 ? ? ? 1_555 GB DG 34   O6 ? ? AA DC 721  B3 DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1684  hydrog ? ? A  DC 721  O2 ? ? ? 1_555 GB DG 34   N2 ? ? AA DC 721  B3 DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1685  hydrog ? ? A  DT 722  N3 ? ? ? 1_555 GB DA 33   N1 ? ? AA DT 722  B3 DA 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1686  hydrog ? ? A  DT 722  O4 ? ? ? 1_555 GB DA 33   N6 ? ? AA DT 722  B3 DA 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1687  hydrog ? ? A  DG 723  N1 ? ? ? 1_555 GB DC 32   N3 ? ? AA DG 723  B3 DC 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1688  hydrog ? ? A  DG 723  N2 ? ? ? 1_555 GB DC 32   O2 ? ? AA DG 723  B3 DC 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1689  hydrog ? ? A  DG 723  O6 ? ? ? 1_555 GB DC 32   N4 ? ? AA DG 723  B3 DC 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1690  hydrog ? ? A  DG 724  N1 ? ? ? 1_555 GB DC 31   N3 ? ? AA DG 724  B3 DC 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1691  hydrog ? ? A  DG 724  N2 ? ? ? 1_555 GB DC 31   O2 ? ? AA DG 724  B3 DC 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1692  hydrog ? ? A  DG 724  O6 ? ? ? 1_555 GB DC 31   N4 ? ? AA DG 724  B3 DC 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1693  hydrog ? ? A  DT 725  N3 ? ? ? 1_555 UD DA 2    N1 ? ? AA DT 725  CH DA 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1694  hydrog ? ? A  DT 725  O4 ? ? ? 1_555 UD DA 2    N6 ? ? AA DT 725  CH DA 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1695  hydrog ? ? A  DT 726  N3 ? ? ? 1_555 UD DA 1    N1 ? ? AA DT 726  CH DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1696  hydrog ? ? A  DT 726  O4 ? ? ? 1_555 UD DA 1    N6 ? ? AA DT 726  CH DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1697  hydrog ? ? A  DT 727  N3 ? ? ? 1_555 RC DA 48   N1 ? ? AA DT 727  Bf DA 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1698  hydrog ? ? A  DT 727  O4 ? ? ? 1_555 RC DA 48   N6 ? ? AA DT 727  Bf DA 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1699  hydrog ? ? A  DC 728  N3 ? ? ? 1_555 RC DG 47   N1 ? ? AA DC 728  Bf DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1700  hydrog ? ? A  DC 728  N4 ? ? ? 1_555 RC DG 47   O6 ? ? AA DC 728  Bf DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1701  hydrog ? ? A  DC 728  O2 ? ? ? 1_555 RC DG 47   N2 ? ? AA DC 728  Bf DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1702  hydrog ? ? A  DC 729  N3 ? ? ? 1_555 RC DG 46   N1 ? ? AA DC 729  Bf DG 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1703  hydrog ? ? A  DC 729  N4 ? ? ? 1_555 RC DG 46   O6 ? ? AA DC 729  Bf DG 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1704  hydrog ? ? A  DC 729  O2 ? ? ? 1_555 RC DG 46   N2 ? ? AA DC 729  Bf DG 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1705  hydrog ? ? A  DG 730  N1 ? ? ? 1_555 RC DC 45   N3 ? ? AA DG 730  Bf DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1706  hydrog ? ? A  DG 730  N2 ? ? ? 1_555 RC DC 45   O2 ? ? AA DG 730  Bf DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1707  hydrog ? ? A  DG 730  O6 ? ? ? 1_555 RC DC 45   N4 ? ? AA DG 730  Bf DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1708  hydrog ? ? A  DG 731  N1 ? ? ? 1_555 RC DC 44   N3 ? ? AA DG 731  Bf DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1709  hydrog ? ? A  DG 731  N2 ? ? ? 1_555 RC DC 44   O2 ? ? AA DG 731  Bf DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1710  hydrog ? ? A  DG 731  O6 ? ? ? 1_555 RC DC 44   N4 ? ? AA DG 731  Bf DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1711  hydrog ? ? A  DC 732  N3 ? ? ? 1_555 RC DG 43   N1 ? ? AA DC 732  Bf DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1712  hydrog ? ? A  DC 732  N4 ? ? ? 1_555 RC DG 43   O6 ? ? AA DC 732  Bf DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1713  hydrog ? ? A  DC 732  O2 ? ? ? 1_555 RC DG 43   N2 ? ? AA DC 732  Bf DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1714  hydrog ? ? A  DA 733  N1 ? ? ? 1_555 QC DT 10   N3 ? ? AA DA 733  Be DT 10   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog1715  hydrog ? ? A  DC 734  N3 ? ? ? 1_555 QC DG 9    N1 ? ? AA DC 734  Be DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1716  hydrog ? ? A  DC 734  N4 ? ? ? 1_555 QC DG 9    O6 ? ? AA DC 734  Be DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1717  hydrog ? ? A  DC 734  O2 ? ? ? 1_555 QC DG 9    N2 ? ? AA DC 734  Be DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1718  hydrog ? ? A  DC 735  N3 ? ? ? 1_555 QC DG 8    N1 ? ? AA DC 735  Be DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1719  hydrog ? ? A  DC 735  N4 ? ? ? 1_555 QC DG 8    O6 ? ? AA DC 735  Be DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1720  hydrog ? ? A  DC 735  O2 ? ? ? 1_555 QC DG 8    N2 ? ? AA DC 735  Be DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1721  hydrog ? ? A  DA 736  N1 ? ? ? 1_555 QC DT 7    N3 ? ? AA DA 736  Be DT 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1722  hydrog ? ? A  DA 736  N6 ? ? ? 1_555 QC DT 7    O4 ? ? AA DA 736  Be DT 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1723  hydrog ? ? A  DG 737  N1 ? ? ? 1_555 QC DC 6    N3 ? ? AA DG 737  Be DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1724  hydrog ? ? A  DG 737  N2 ? ? ? 1_555 QC DC 6    O2 ? ? AA DG 737  Be DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1725  hydrog ? ? A  DG 737  O6 ? ? ? 1_555 QC DC 6    N4 ? ? AA DG 737  Be DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1726  hydrog ? ? A  DA 738  N1 ? ? ? 1_555 QC DT 5    N3 ? ? AA DA 738  Be DT 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1727  hydrog ? ? A  DA 738  N6 ? ? ? 1_555 QC DT 5    O4 ? ? AA DA 738  Be DT 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1728  hydrog ? ? A  DA 739  N1 ? ? ? 1_555 QC DT 4    N3 ? ? AA DA 739  Be DT 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1729  hydrog ? ? A  DA 739  N6 ? ? ? 1_555 QC DT 4    O4 ? ? AA DA 739  Be DT 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1730  hydrog ? ? A  DG 740  N1 ? ? ? 1_555 QC DC 3    N3 ? ? AA DG 740  Be DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1731  hydrog ? ? A  DG 740  N2 ? ? ? 1_555 QC DC 3    O2 ? ? AA DG 740  Be DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1732  hydrog ? ? A  DG 740  O6 ? ? ? 1_555 QC DC 3    N4 ? ? AA DG 740  Be DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1733  hydrog ? ? A  DC 741  N3 ? ? ? 1_555 EC DG 30   N1 ? ? AA DC 741  BS DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1734  hydrog ? ? A  DC 741  N4 ? ? ? 1_555 EC DG 30   O6 ? ? AA DC 741  BS DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1735  hydrog ? ? A  DC 741  O2 ? ? ? 1_555 EC DG 30   N2 ? ? AA DC 741  BS DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1736  hydrog ? ? A  DG 742  N1 ? ? ? 1_555 EC DC 29   N3 ? ? AA DG 742  BS DC 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1737  hydrog ? ? A  DG 742  N2 ? ? ? 1_555 EC DC 29   O2 ? ? AA DG 742  BS DC 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1738  hydrog ? ? A  DG 742  O6 ? ? ? 1_555 EC DC 29   N4 ? ? AA DG 742  BS DC 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1739  hydrog ? ? A  DG 743  N1 ? ? ? 1_555 EC DC 28   N3 ? ? AA DG 743  BS DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1740  hydrog ? ? A  DG 743  N2 ? ? ? 1_555 EC DC 28   O2 ? ? AA DG 743  BS DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1741  hydrog ? ? A  DG 743  O6 ? ? ? 1_555 EC DC 28   N4 ? ? AA DG 743  BS DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1742  hydrog ? ? A  DT 744  N3 ? ? ? 1_555 EC DA 27   N1 ? ? AA DT 744  BS DA 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1743  hydrog ? ? A  DT 744  O4 ? ? ? 1_555 EC DA 27   N6 ? ? AA DT 744  BS DA 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1744  hydrog ? ? A  DG 745  N1 ? ? ? 1_555 EC DC 26   N3 ? ? AA DG 745  BS DC 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1745  hydrog ? ? A  DG 745  N2 ? ? ? 1_555 EC DC 26   O2 ? ? AA DG 745  BS DC 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1746  hydrog ? ? A  DG 745  O6 ? ? ? 1_555 EC DC 26   N4 ? ? AA DG 745  BS DC 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1747  hydrog ? ? A  DC 746  N3 ? ? ? 1_555 EC DG 25   N1 ? ? AA DC 746  BS DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1748  hydrog ? ? A  DC 746  N4 ? ? ? 1_555 EC DG 25   O6 ? ? AA DC 746  BS DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1749  hydrog ? ? A  DC 746  O2 ? ? ? 1_555 EC DG 25   N2 ? ? AA DC 746  BS DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1750  hydrog ? ? A  DC 747  N3 ? ? ? 1_555 EC DG 24   N1 ? ? AA DC 747  BS DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1751  hydrog ? ? A  DC 747  N4 ? ? ? 1_555 EC DG 24   O6 ? ? AA DC 747  BS DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1752  hydrog ? ? A  DC 747  O2 ? ? ? 1_555 EC DG 24   N2 ? ? AA DC 747  BS DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1753  hydrog ? ? A  DG 748  N1 ? ? ? 1_555 EC DC 23   N3 ? ? AA DG 748  BS DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1754  hydrog ? ? A  DG 748  N2 ? ? ? 1_555 EC DC 23   O2 ? ? AA DG 748  BS DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1755  hydrog ? ? A  DG 748  O6 ? ? ? 1_555 EC DC 23   N4 ? ? AA DG 748  BS DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1756  hydrog ? ? A  DG 749  N1 ? ? ? 1_555 KE DC 13   N3 ? ? AA DG 749  CX DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1757  hydrog ? ? A  DG 749  N2 ? ? ? 1_555 KE DC 13   O2 ? ? AA DG 749  CX DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1758  hydrog ? ? A  DG 749  O6 ? ? ? 1_555 KE DC 13   N4 ? ? AA DG 749  CX DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1759  hydrog ? ? A  DA 750  N1 ? ? ? 1_555 KE DT 12   N3 ? ? AA DA 750  CX DT 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1760  hydrog ? ? A  DA 750  N6 ? ? ? 1_555 KE DT 12   O4 ? ? AA DA 750  CX DT 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1761  hydrog ? ? A  DA 751  N1 ? ? ? 1_555 KE DT 11   N3 ? ? AA DA 751  CX DT 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1762  hydrog ? ? A  DA 751  N6 ? ? ? 1_555 KE DT 11   O4 ? ? AA DA 751  CX DT 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1763  hydrog ? ? A  DA 752  N1 ? ? ? 1_555 KE DT 10   N3 ? ? AA DA 752  CX DT 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1764  hydrog ? ? A  DA 752  N6 ? ? ? 1_555 KE DT 10   O4 ? ? AA DA 752  CX DT 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1765  hydrog ? ? A  DG 753  N1 ? ? ? 1_555 KE DC 9    N3 ? ? AA DG 753  CX DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1766  hydrog ? ? A  DG 753  N2 ? ? ? 1_555 KE DC 9    O2 ? ? AA DG 753  CX DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1767  hydrog ? ? A  DG 753  O6 ? ? ? 1_555 KE DC 9    N4 ? ? AA DG 753  CX DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1768  hydrog ? ? A  DC 754  N3 ? ? ? 1_555 KE DG 8    N1 ? ? AA DC 754  CX DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1769  hydrog ? ? A  DC 754  N4 ? ? ? 1_555 KE DG 8    O6 ? ? AA DC 754  CX DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1770  hydrog ? ? A  DC 754  O2 ? ? ? 1_555 KE DG 8    N2 ? ? AA DC 754  CX DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1771  hydrog ? ? A  DT 755  N3 ? ? ? 1_555 KE DA 7    N1 ? ? AA DT 755  CX DA 7    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog1772  hydrog ? ? A  DG 756  N1 ? ? ? 1_555 KE DC 6    N3 ? ? AA DG 756  CX DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1773  hydrog ? ? A  DG 756  N2 ? ? ? 1_555 KE DC 6    O2 ? ? AA DG 756  CX DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1774  hydrog ? ? A  DG 756  O6 ? ? ? 1_555 KE DC 6    N4 ? ? AA DG 756  CX DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1775  hydrog ? ? A  DG 757  N1 ? ? ? 1_555 TD DC 2    N3 ? ? AA DG 757  CG DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1776  hydrog ? ? A  DG 757  N2 ? ? ? 1_555 TD DC 2    O2 ? ? AA DG 757  CG DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1777  hydrog ? ? A  DG 757  O6 ? ? ? 1_555 TD DC 2    N4 ? ? AA DG 757  CG DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1778  hydrog ? ? A  DC 758  N3 ? ? ? 1_555 TD DG 1    N1 ? ? AA DC 758  CG DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1779  hydrog ? ? A  DC 758  N4 ? ? ? 1_555 TD DG 1    O6 ? ? AA DC 758  CG DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1780  hydrog ? ? A  DC 758  O2 ? ? ? 1_555 TD DG 1    N2 ? ? AA DC 758  CG DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1781  hydrog ? ? A  DT 759  N3 ? ? ? 1_555 BC DA 66   N1 ? ? AA DT 759  BP DA 66   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog1782  hydrog ? ? A  DG 760  N1 ? ? ? 1_555 BC DC 65   N3 ? ? AA DG 760  BP DC 65   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1783  hydrog ? ? A  DG 760  N2 ? ? ? 1_555 BC DC 65   O2 ? ? AA DG 760  BP DC 65   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1784  hydrog ? ? A  DG 760  O6 ? ? ? 1_555 BC DC 65   N4 ? ? AA DG 760  BP DC 65   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1785  hydrog ? ? A  DG 761  N1 ? ? ? 1_555 BC DC 64   N3 ? ? AA DG 761  BP DC 64   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1786  hydrog ? ? A  DG 761  N2 ? ? ? 1_555 BC DC 64   O2 ? ? AA DG 761  BP DC 64   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1787  hydrog ? ? A  DG 761  O6 ? ? ? 1_555 BC DC 64   N4 ? ? AA DG 761  BP DC 64   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1788  hydrog ? ? A  DA 762  N1 ? ? ? 1_555 BC DT 63   N3 ? ? AA DA 762  BP DT 63   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog1789  hydrog ? ? A  DG 763  N1 ? ? ? 1_555 BC DC 62   N3 ? ? AA DG 763  BP DC 62   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1790  hydrog ? ? A  DG 763  N2 ? ? ? 1_555 BC DC 62   O2 ? ? AA DG 763  BP DC 62   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1791  hydrog ? ? A  DG 763  O6 ? ? ? 1_555 BC DC 62   N4 ? ? AA DG 763  BP DC 62   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1792  hydrog ? ? A  DT 764  N3 ? ? ? 1_555 BC DA 61   N1 ? ? AA DT 764  BP DA 61   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog1793  hydrog ? ? A  DG 765  N1 ? ? ? 1_555 BC DC 60   N3 ? ? AA DG 765  BP DC 60   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1794  hydrog ? ? A  DG 765  N2 ? ? ? 1_555 BC DC 60   O2 ? ? AA DG 765  BP DC 60   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1795  hydrog ? ? A  DG 765  O6 ? ? ? 1_555 BC DC 60   N4 ? ? AA DG 765  BP DC 60   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1796  hydrog ? ? A  DC 766  N3 ? ? ? 1_555 BC DG 59   N1 ? ? AA DC 766  BP DG 59   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1797  hydrog ? ? A  DC 766  N4 ? ? ? 1_555 BC DG 59   O6 ? ? AA DC 766  BP DG 59   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1798  hydrog ? ? A  DC 766  O2 ? ? ? 1_555 BC DG 59   N2 ? ? AA DC 766  BP DG 59   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1799  hydrog ? ? A  DG 767  O6 ? ? ? 1_555 BC DC 58   N4 ? ? AA DG 767  BP DC 58   1_555 ? ? ? ? ? ? 'DG-DC PAIR'            
? ? 
hydrog1800  hydrog ? ? A  DG 767  N2 ? ? ? 1_555 BC DC 60   O2 ? ? AA DG 767  BP DC 60   1_555 ? ? ? ? ? ? 'DG-DC PAIR'            
? ? 
hydrog1801  hydrog ? ? A  DA 768  N1 ? ? ? 1_555 BC DT 47   N3 ? ? AA DA 768  BP DT 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1802  hydrog ? ? A  DA 768  N6 ? ? ? 1_555 BC DT 47   O4 ? ? AA DA 768  BP DT 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1803  hydrog ? ? A  DT 769  N3 ? ? ? 1_555 BC DA 46   N1 ? ? AA DT 769  BP DA 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1804  hydrog ? ? A  DT 769  O4 ? ? ? 1_555 BC DA 46   N6 ? ? AA DT 769  BP DA 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1805  hydrog ? ? A  DC 770  N3 ? ? ? 1_555 BC DG 45   N1 ? ? AA DC 770  BP DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1806  hydrog ? ? A  DC 770  N4 ? ? ? 1_555 BC DG 45   O6 ? ? AA DC 770  BP DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1807  hydrog ? ? A  DC 770  O2 ? ? ? 1_555 BC DG 45   N2 ? ? AA DC 770  BP DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1808  hydrog ? ? A  DT 771  N3 ? ? ? 1_555 EB DA 45   N1 ? ? AA DT 771  B1 DA 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1809  hydrog ? ? A  DT 771  O4 ? ? ? 1_555 EB DA 45   N6 ? ? AA DT 771  B1 DA 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1810  hydrog ? ? A  DT 772  N3 ? ? ? 1_555 EB DA 44   N1 ? ? AA DT 772  B1 DA 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1811  hydrog ? ? A  DT 772  O4 ? ? ? 1_555 EB DA 44   N6 ? ? AA DT 772  B1 DA 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1812  hydrog ? ? A  DC 773  N3 ? ? ? 1_555 EB DG 43   N1 ? ? AA DC 773  B1 DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1813  hydrog ? ? A  DC 773  N4 ? ? ? 1_555 EB DG 43   O6 ? ? AA DC 773  B1 DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1814  hydrog ? ? A  DC 773  O2 ? ? ? 1_555 EB DG 43   N2 ? ? AA DC 773  B1 DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1815  hydrog ? ? A  DC 774  N3 ? ? ? 1_555 EB DG 42   N1 ? ? AA DC 774  B1 DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1816  hydrog ? ? A  DC 774  N4 ? ? ? 1_555 EB DG 42   O6 ? ? AA DC 774  B1 DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1817  hydrog ? ? A  DC 774  O2 ? ? ? 1_555 EB DG 42   N2 ? ? AA DC 774  B1 DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1818  hydrog ? ? A  DT 775  N3 ? ? ? 1_555 EB DA 41   N1 ? ? AA DT 775  B1 DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1819  hydrog ? ? A  DT 775  O4 ? ? ? 1_555 EB DA 41   N6 ? ? AA DT 775  B1 DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1820  hydrog ? ? A  DG 776  N1 ? ? ? 1_555 EB DC 40   N3 ? ? AA DG 776  B1 DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1821  hydrog ? ? A  DG 776  N2 ? ? ? 1_555 EB DC 40   O2 ? ? AA DG 776  B1 DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1822  hydrog ? ? A  DG 776  O6 ? ? ? 1_555 EB DC 40   N4 ? ? AA DG 776  B1 DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1823  hydrog ? ? A  DA 777  N1 ? ? ? 1_555 EB DT 39   N3 ? ? AA DA 777  B1 DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1824  hydrog ? ? A  DA 777  N6 ? ? ? 1_555 EB DT 39   O4 ? ? AA DA 777  B1 DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1825  hydrog ? ? A  DG 778  N1 ? ? ? 1_555 EB DC 38   O2 ? ? AA DG 778  B1 DC 38   1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' 
? ? 
hydrog1826  hydrog ? ? A  DG 778  N2 ? ? ? 1_555 EB DC 38   N3 ? ? AA DG 778  B1 DC 38   1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' 
? ? 
hydrog1827  hydrog ? ? A  DG 779  N1 ? ? ? 1_555 QD DC 6    N3 ? ? AA DG 779  CD DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1828  hydrog ? ? A  DG 779  N2 ? ? ? 1_555 QD DC 6    O2 ? ? AA DG 779  CD DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1829  hydrog ? ? A  DG 779  O6 ? ? ? 1_555 QD DC 6    N4 ? ? AA DG 779  CD DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1830  hydrog ? ? A  DC 780  N3 ? ? ? 1_555 QD DG 5    N1 ? ? AA DC 780  CD DG 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1831  hydrog ? ? A  DC 780  N4 ? ? ? 1_555 QD DG 5    O6 ? ? AA DC 780  CD DG 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1832  hydrog ? ? A  DC 780  O2 ? ? ? 1_555 QD DG 5    N2 ? ? AA DC 780  CD DG 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1833  hydrog ? ? A  DC 781  N3 ? ? ? 1_555 QD DG 4    N1 ? ? AA DC 781  CD DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1834  hydrog ? ? A  DC 781  N4 ? ? ? 1_555 QD DG 4    O6 ? ? AA DC 781  CD DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1835  hydrog ? ? A  DC 781  O2 ? ? ? 1_555 QD DG 4    N2 ? ? AA DC 781  CD DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1836  hydrog ? ? A  DG 782  N1 ? ? ? 1_555 QD DC 3    N3 ? ? AA DG 782  CD DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1837  hydrog ? ? A  DG 782  N2 ? ? ? 1_555 QD DC 3    O2 ? ? AA DG 782  CD DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1838  hydrog ? ? A  DG 782  O6 ? ? ? 1_555 QD DC 3    N4 ? ? AA DG 782  CD DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1839  hydrog ? ? A  DA 783  N1 ? ? ? 1_555 QD DT 2    N3 ? ? AA DA 783  CD DT 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1840  hydrog ? ? A  DA 783  N6 ? ? ? 1_555 QD DT 2    O4 ? ? AA DA 783  CD DT 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1841  hydrog ? ? A  DT 784  N3 ? ? ? 1_555 QD DA 1    N1 ? ? AA DT 784  CD DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1842  hydrog ? ? A  DT 784  O4 ? ? ? 1_555 QD DA 1    N6 ? ? AA DT 784  CD DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1843  hydrog ? ? A  DA 785  N1 ? ? ? 1_555 PC DT 56   N3 ? ? AA DA 785  Bd DT 56   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1844  hydrog ? ? A  DA 785  N6 ? ? ? 1_555 PC DT 56   O4 ? ? AA DA 785  Bd DT 56   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1845  hydrog ? ? A  DC 786  N3 ? ? ? 1_555 PC DG 55   N1 ? ? AA DC 786  Bd DG 55   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1846  hydrog ? ? A  DC 786  N4 ? ? ? 1_555 PC DG 55   O6 ? ? AA DC 786  Bd DG 55   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1847  hydrog ? ? A  DC 786  O2 ? ? ? 1_555 PC DG 55   N2 ? ? AA DC 786  Bd DG 55   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1848  hydrog ? ? A  DT 787  N3 ? ? ? 1_555 EC DA 38   N1 ? ? AA DT 787  BS DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1849  hydrog ? ? A  DT 787  O4 ? ? ? 1_555 EC DA 38   N6 ? ? AA DT 787  BS DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1850  hydrog ? ? A  DG 788  N1 ? ? ? 1_555 EC DC 37   N3 ? ? AA DG 788  BS DC 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1851  hydrog ? ? A  DG 788  N2 ? ? ? 1_555 EC DC 37   O2 ? ? AA DG 788  BS DC 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1852  hydrog ? ? A  DG 788  O6 ? ? ? 1_555 EC DC 37   N4 ? ? AA DG 788  BS DC 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1853  hydrog ? ? A  DT 789  N3 ? ? ? 1_555 EC DA 36   N1 ? ? AA DT 789  BS DA 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1854  hydrog ? ? A  DT 789  O4 ? ? ? 1_555 EC DA 36   N6 ? ? AA DT 789  BS DA 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1855  hydrog ? ? A  DC 790  N3 ? ? ? 1_555 EC DG 35   N1 ? ? AA DC 790  BS DG 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1856  hydrog ? ? A  DC 790  N4 ? ? ? 1_555 EC DG 35   O6 ? ? AA DC 790  BS DG 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1857  hydrog ? ? A  DC 790  O2 ? ? ? 1_555 EC DG 35   N2 ? ? AA DC 790  BS DG 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1858  hydrog ? ? A  DG 791  N1 ? ? ? 1_555 EC DC 34   N3 ? ? AA DG 791  BS DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1859  hydrog ? ? A  DG 791  N2 ? ? ? 1_555 EC DC 34   O2 ? ? AA DG 791  BS DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1860  hydrog ? ? A  DG 791  O6 ? ? ? 1_555 EC DC 34   N4 ? ? AA DG 791  BS DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1861  hydrog ? ? A  DT 792  N3 ? ? ? 1_555 EC DA 33   N1 ? ? AA DT 792  BS DA 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1862  hydrog ? ? A  DT 792  O4 ? ? ? 1_555 EC DA 33   N6 ? ? AA DT 792  BS DA 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1863  hydrog ? ? A  DC 793  N3 ? ? ? 1_555 EC DG 32   N1 ? ? AA DC 793  BS DG 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1864  hydrog ? ? A  DC 793  N4 ? ? ? 1_555 EC DG 32   O6 ? ? AA DC 793  BS DG 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1865  hydrog ? ? A  DC 793  O2 ? ? ? 1_555 EC DG 32   N2 ? ? AA DC 793  BS DG 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1866  hydrog ? ? A  DG 794  N1 ? ? ? 1_555 EC DC 31   N3 ? ? AA DG 794  BS DC 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1867  hydrog ? ? A  DG 794  N2 ? ? ? 1_555 EC DC 31   O2 ? ? AA DG 794  BS DC 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1868  hydrog ? ? A  DG 794  O6 ? ? ? 1_555 EC DC 31   N4 ? ? AA DG 794  BS DC 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1869  hydrog ? ? A  DT 795  N3 ? ? ? 1_555 QC DA 2    N1 ? ? AA DT 795  Be DA 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1870  hydrog ? ? A  DT 795  O4 ? ? ? 1_555 QC DA 2    N6 ? ? AA DT 795  Be DA 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1871  hydrog ? ? A  DC 796  N3 ? ? ? 1_555 QC DG 1    N1 ? ? AA DC 796  Be DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1872  hydrog ? ? A  DC 796  N4 ? ? ? 1_555 QC DG 1    O6 ? ? AA DC 796  Be DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1873  hydrog ? ? A  DC 796  O2 ? ? ? 1_555 QC DG 1    N2 ? ? AA DC 796  Be DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1874  hydrog ? ? A  DC 797  N3 ? ? ? 1_555 GE DG 48   N1 ? ? AA DC 797  CT DG 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1875  hydrog ? ? A  DC 797  N4 ? ? ? 1_555 GE DG 48   O6 ? ? AA DC 797  CT DG 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1876  hydrog ? ? A  DC 797  O2 ? ? ? 1_555 GE DG 48   N2 ? ? AA DC 797  CT DG 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1877  hydrog ? ? A  DC 798  N3 ? ? ? 1_555 GE DG 47   N1 ? ? AA DC 798  CT DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1878  hydrog ? ? A  DC 798  N4 ? ? ? 1_555 GE DG 47   O6 ? ? AA DC 798  CT DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1879  hydrog ? ? A  DC 798  O2 ? ? ? 1_555 GE DG 47   N2 ? ? AA DC 798  CT DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1880  hydrog ? ? A  DC 799  N3 ? ? ? 1_555 GE DG 46   N1 ? ? AA DC 799  CT DG 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1881  hydrog ? ? A  DC 799  N4 ? ? ? 1_555 GE DG 46   O6 ? ? AA DC 799  CT DG 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1882  hydrog ? ? A  DC 799  O2 ? ? ? 1_555 GE DG 46   N2 ? ? AA DC 799  CT DG 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1883  hydrog ? ? A  DT 800  N3 ? ? ? 1_555 GE DA 45   N1 ? ? AA DT 800  CT DA 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1884  hydrog ? ? A  DT 800  O4 ? ? ? 1_555 GE DA 45   N6 ? ? AA DT 800  CT DA 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1885  hydrog ? ? A  DC 801  N3 ? ? ? 1_555 GE DG 44   N1 ? ? AA DC 801  CT DG 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1886  hydrog ? ? A  DC 801  N4 ? ? ? 1_555 GE DG 44   O6 ? ? AA DC 801  CT DG 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1887  hydrog ? ? A  DC 801  O2 ? ? ? 1_555 GE DG 44   N2 ? ? AA DC 801  CT DG 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1888  hydrog ? ? A  DA 802  N1 ? ? ? 1_555 GE DT 43   N3 ? ? AA DA 802  CT DT 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1889  hydrog ? ? A  DA 802  N6 ? ? ? 1_555 GE DT 43   O4 ? ? AA DA 802  CT DT 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1890  hydrog ? ? A  DA 803  N1 ? ? ? 1_555 SD DT 6    N3 ? ? AA DA 803  CF DT 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1891  hydrog ? ? A  DA 803  N6 ? ? ? 1_555 SD DT 6    O4 ? ? AA DA 803  CF DT 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1892  hydrog ? ? A  DA 804  N1 ? ? ? 1_555 SD DT 5    N3 ? ? AA DA 804  CF DT 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1893  hydrog ? ? A  DA 804  N6 ? ? ? 1_555 SD DT 5    O4 ? ? AA DA 804  CF DT 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1894  hydrog ? ? A  DC 805  N3 ? ? ? 1_555 SD DG 4    N1 ? ? AA DC 805  CF DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1895  hydrog ? ? A  DC 805  N4 ? ? ? 1_555 SD DG 4    O6 ? ? AA DC 805  CF DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1896  hydrog ? ? A  DC 805  O2 ? ? ? 1_555 SD DG 4    N2 ? ? AA DC 805  CF DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1897  hydrog ? ? A  DT 806  N3 ? ? ? 1_555 SD DA 3    N1 ? ? AA DT 806  CF DA 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1898  hydrog ? ? A  DT 806  O4 ? ? ? 1_555 SD DA 3    N6 ? ? AA DT 806  CF DA 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1899  hydrog ? ? A  DG 807  N1 ? ? ? 1_555 SD DC 2    N3 ? ? AA DG 807  CF DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1900  hydrog ? ? A  DG 807  N2 ? ? ? 1_555 SD DC 2    O2 ? ? AA DG 807  CF DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1901  hydrog ? ? A  DG 807  O6 ? ? ? 1_555 SD DC 2    N4 ? ? AA DG 807  CF DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1902  hydrog ? ? A  DG 808  N1 ? ? ? 1_555 SD DC 1    N3 ? ? AA DG 808  CF DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1903  hydrog ? ? A  DG 808  N2 ? ? ? 1_555 SD DC 1    O2 ? ? AA DG 808  CF DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1904  hydrog ? ? A  DG 808  O6 ? ? ? 1_555 SD DC 1    N4 ? ? AA DG 808  CF DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1905  hydrog ? ? A  DC 809  N3 ? ? ? 1_555 OC DG 50   N1 ? ? AA DC 809  Bc DG 50   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1906  hydrog ? ? A  DC 809  N4 ? ? ? 1_555 OC DG 50   O6 ? ? AA DC 809  Bc DG 50   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1907  hydrog ? ? A  DC 809  O2 ? ? ? 1_555 OC DG 50   N2 ? ? AA DC 809  Bc DG 50   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1908  hydrog ? ? A  DA 810  N1 ? ? ? 1_555 OC DT 49   N3 ? ? AA DA 810  Bc DT 49   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1909  hydrog ? ? A  DA 810  N6 ? ? ? 1_555 OC DT 49   O4 ? ? AA DA 810  Bc DT 49   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1910  hydrog ? ? A  DG 811  N1 ? ? ? 1_555 XB DC 22   N3 ? ? AA DG 811  BL DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1911  hydrog ? ? A  DG 811  N2 ? ? ? 1_555 XB DC 22   O2 ? ? AA DG 811  BL DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1912  hydrog ? ? A  DG 811  O6 ? ? ? 1_555 XB DC 22   N4 ? ? AA DG 811  BL DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1913  hydrog ? ? A  DA 812  N1 ? ? ? 1_555 XB DT 21   N3 ? ? AA DA 812  BL DT 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1914  hydrog ? ? A  DA 812  N6 ? ? ? 1_555 XB DT 21   O4 ? ? AA DA 812  BL DT 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1915  hydrog ? ? A  DT 813  N3 ? ? ? 1_555 XB DA 20   N1 ? ? AA DT 813  BL DA 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1916  hydrog ? ? A  DT 813  O4 ? ? ? 1_555 XB DA 20   N6 ? ? AA DT 813  BL DA 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1917  hydrog ? ? A  DG 814  N1 ? ? ? 1_555 XB DC 19   N3 ? ? AA DG 814  BL DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1918  hydrog ? ? A  DG 814  N2 ? ? ? 1_555 XB DC 19   O2 ? ? AA DG 814  BL DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1919  hydrog ? ? A  DG 814  O6 ? ? ? 1_555 XB DC 19   N4 ? ? AA DG 814  BL DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1920  hydrog ? ? A  DC 815  N3 ? ? ? 1_555 XB DG 18   N1 ? ? AA DC 815  BL DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1921  hydrog ? ? A  DC 815  N4 ? ? ? 1_555 XB DG 18   O6 ? ? AA DC 815  BL DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1922  hydrog ? ? A  DC 815  O2 ? ? ? 1_555 XB DG 18   N2 ? ? AA DC 815  BL DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1923  hydrog ? ? A  DA 816  N1 ? ? ? 1_555 XB DT 17   N3 ? ? AA DA 816  BL DT 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1924  hydrog ? ? A  DA 816  N6 ? ? ? 1_555 XB DT 17   O4 ? ? AA DA 816  BL DT 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1925  hydrog ? ? A  DC 817  N3 ? ? ? 1_555 XB DG 16   N1 ? ? AA DC 817  BL DG 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1926  hydrog ? ? A  DC 817  N4 ? ? ? 1_555 XB DG 16   O6 ? ? AA DC 817  BL DG 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1927  hydrog ? ? A  DC 817  O2 ? ? ? 1_555 XB DG 16   N2 ? ? AA DC 817  BL DG 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1928  hydrog ? ? A  DG 818  N1 ? ? ? 1_555 XB DC 15   N3 ? ? AA DG 818  BL DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1929  hydrog ? ? A  DG 818  N2 ? ? ? 1_555 XB DC 15   O2 ? ? AA DG 818  BL DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1930  hydrog ? ? A  DG 818  O6 ? ? ? 1_555 XB DC 15   N4 ? ? AA DG 818  BL DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1931  hydrog ? ? A  DG 819  N1 ? ? ? 1_555 IB DC 22   N3 ? ? AA DG 819  B5 DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1932  hydrog ? ? A  DG 819  N2 ? ? ? 1_555 IB DC 22   O2 ? ? AA DG 819  B5 DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1933  hydrog ? ? A  DG 819  O6 ? ? ? 1_555 IB DC 22   N4 ? ? AA DG 819  B5 DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1934  hydrog ? ? A  DT 820  N3 ? ? ? 1_555 IB DA 21   N1 ? ? AA DT 820  B5 DA 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1935  hydrog ? ? A  DT 820  O4 ? ? ? 1_555 IB DA 21   N6 ? ? AA DT 820  B5 DA 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1936  hydrog ? ? A  DT 821  N3 ? ? ? 1_555 IB DA 20   N1 ? ? AA DT 821  B5 DA 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1937  hydrog ? ? A  DT 821  O4 ? ? ? 1_555 IB DA 20   N6 ? ? AA DT 821  B5 DA 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1938  hydrog ? ? A  DA 822  N1 ? ? ? 1_555 IB DT 19   N3 ? ? AA DA 822  B5 DT 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1939  hydrog ? ? A  DA 822  N6 ? ? ? 1_555 IB DT 19   O4 ? ? AA DA 822  B5 DT 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1940  hydrog ? ? A  DC 823  N3 ? ? ? 1_555 IB DG 18   N1 ? ? AA DC 823  B5 DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1941  hydrog ? ? A  DC 823  N4 ? ? ? 1_555 IB DG 18   O6 ? ? AA DC 823  B5 DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1942  hydrog ? ? A  DC 823  O2 ? ? ? 1_555 IB DG 18   N2 ? ? AA DC 823  B5 DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1943  hydrog ? ? A  DG 824  N1 ? ? ? 1_555 IB DC 17   N3 ? ? AA DG 824  B5 DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1944  hydrog ? ? A  DG 824  N2 ? ? ? 1_555 IB DC 17   O2 ? ? AA DG 824  B5 DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1945  hydrog ? ? A  DG 824  O6 ? ? ? 1_555 IB DC 17   N4 ? ? AA DG 824  B5 DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1946  hydrog ? ? A  DA 825  N1 ? ? ? 1_555 IB DT 16   N3 ? ? AA DA 825  B5 DT 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1947  hydrog ? ? A  DA 825  N6 ? ? ? 1_555 IB DT 16   O4 ? ? AA DA 825  B5 DT 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1948  hydrog ? ? A  DT 826  N3 ? ? ? 1_555 IB DA 15   N1 ? ? AA DT 826  B5 DA 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1949  hydrog ? ? A  DT 826  O4 ? ? ? 1_555 IB DA 15   N6 ? ? AA DT 826  B5 DA 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1950  hydrog ? ? A  DG 827  N1 ? ? ? 1_555 LD DC 42   N3 ? ? AA DG 827  C6 DC 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1951  hydrog ? ? A  DG 827  N2 ? ? ? 1_555 LD DC 42   O2 ? ? AA DG 827  C6 DC 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1952  hydrog ? ? A  DG 827  O6 ? ? ? 1_555 LD DC 42   N4 ? ? AA DG 827  C6 DC 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1953  hydrog ? ? A  DC 828  N3 ? ? ? 1_555 LD DG 41   N1 ? ? AA DC 828  C6 DG 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1954  hydrog ? ? A  DC 828  N4 ? ? ? 1_555 LD DG 41   O6 ? ? AA DC 828  C6 DG 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1955  hydrog ? ? A  DC 828  O2 ? ? ? 1_555 LD DG 41   N2 ? ? AA DC 828  C6 DG 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1956  hydrog ? ? A  DG 829  N1 ? ? ? 1_555 LD DC 40   N3 ? ? AA DG 829  C6 DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1957  hydrog ? ? A  DG 829  N2 ? ? ? 1_555 LD DC 40   O2 ? ? AA DG 829  C6 DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1958  hydrog ? ? A  DG 829  O6 ? ? ? 1_555 LD DC 40   N4 ? ? AA DG 829  C6 DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1959  hydrog ? ? A  DC 830  N3 ? ? ? 1_555 LD DG 39   N1 ? ? AA DC 830  C6 DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1960  hydrog ? ? A  DC 830  N4 ? ? ? 1_555 LD DG 39   O6 ? ? AA DC 830  C6 DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1961  hydrog ? ? A  DC 830  O2 ? ? ? 1_555 LD DG 39   N2 ? ? AA DC 830  C6 DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1962  hydrog ? ? A  DC 831  N3 ? ? ? 1_555 LD DG 38   N1 ? ? AA DC 831  C6 DG 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1963  hydrog ? ? A  DC 831  N4 ? ? ? 1_555 LD DG 38   O6 ? ? AA DC 831  C6 DG 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1964  hydrog ? ? A  DC 831  O2 ? ? ? 1_555 LD DG 38   N2 ? ? AA DC 831  C6 DG 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1965  hydrog ? ? A  DC 832  N3 ? ? ? 1_555 LD DG 37   N1 ? ? AA DC 832  C6 DG 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1966  hydrog ? ? A  DC 832  N4 ? ? ? 1_555 LD DG 37   O6 ? ? AA DC 832  C6 DG 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1967  hydrog ? ? A  DC 832  O2 ? ? ? 1_555 LD DG 37   N2 ? ? AA DC 832  C6 DG 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1968  hydrog ? ? A  DA 833  N1 ? ? ? 1_555 LD DT 36   N3 ? ? AA DA 833  C6 DT 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1969  hydrog ? ? A  DA 833  N6 ? ? ? 1_555 LD DT 36   O4 ? ? AA DA 833  C6 DT 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1970  hydrog ? ? A  DT 834  N3 ? ? ? 1_555 LD DA 35   N1 ? ? AA DT 834  C6 DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1971  hydrog ? ? A  DT 834  O4 ? ? ? 1_555 LD DA 35   N6 ? ? AA DT 834  C6 DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1972  hydrog ? ? A  DC 835  N3 ? ? ? 1_555 XB DG 30   N1 ? ? AA DC 835  BL DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1973  hydrog ? ? A  DC 835  N4 ? ? ? 1_555 XB DG 30   O6 ? ? AA DC 835  BL DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1974  hydrog ? ? A  DC 835  O2 ? ? ? 1_555 XB DG 30   N2 ? ? AA DC 835  BL DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1975  hydrog ? ? A  DT 836  N3 ? ? ? 1_555 XB DA 29   N1 ? ? AA DT 836  BL DA 29   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog1976  hydrog ? ? A  DA 837  N1 ? ? ? 1_555 XB DT 28   N3 ? ? AA DA 837  BL DT 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1977  hydrog ? ? A  DA 837  N6 ? ? ? 1_555 XB DT 28   O4 ? ? AA DA 837  BL DT 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1978  hydrog ? ? A  DC 838  N3 ? ? ? 1_555 XB DG 27   N1 ? ? AA DC 838  BL DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1979  hydrog ? ? A  DC 838  N4 ? ? ? 1_555 XB DG 27   O6 ? ? AA DC 838  BL DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1980  hydrog ? ? A  DC 838  O2 ? ? ? 1_555 XB DG 27   N2 ? ? AA DC 838  BL DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1981  hydrog ? ? A  DA 839  N1 ? ? ? 1_555 XB DT 26   N3 ? ? AA DA 839  BL DT 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1982  hydrog ? ? A  DA 839  N6 ? ? ? 1_555 XB DT 26   O4 ? ? AA DA 839  BL DT 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1983  hydrog ? ? A  DC 840  N3 ? ? ? 1_555 XB DG 25   N1 ? ? AA DC 840  BL DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1984  hydrog ? ? A  DC 840  N4 ? ? ? 1_555 XB DG 25   O6 ? ? AA DC 840  BL DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1985  hydrog ? ? A  DC 840  O2 ? ? ? 1_555 XB DG 25   N2 ? ? AA DC 840  BL DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1986  hydrog ? ? A  DC 841  N3 ? ? ? 1_555 XB DG 24   N1 ? ? AA DC 841  BL DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1987  hydrog ? ? A  DC 841  N4 ? ? ? 1_555 XB DG 24   O6 ? ? AA DC 841  BL DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1988  hydrog ? ? A  DC 841  O2 ? ? ? 1_555 XB DG 24   N2 ? ? AA DC 841  BL DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1989  hydrog ? ? A  DA 842  N1 ? ? ? 1_555 XB DT 23   N3 ? ? AA DA 842  BL DT 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1990  hydrog ? ? A  DA 842  N6 ? ? ? 1_555 XB DT 23   O4 ? ? AA DA 842  BL DT 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1991  hydrog ? ? A  DA 843  N1 ? ? ? 1_555 OC DT 48   N3 ? ? AA DA 843  Bc DT 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1992  hydrog ? ? A  DA 843  N6 ? ? ? 1_555 OC DT 48   O4 ? ? AA DA 843  Bc DT 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1993  hydrog ? ? A  DC 844  N3 ? ? ? 1_555 OC DG 47   N1 ? ? AA DC 844  Bc DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1994  hydrog ? ? A  DC 844  N4 ? ? ? 1_555 OC DG 47   O6 ? ? AA DC 844  Bc DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1995  hydrog ? ? A  DC 844  O2 ? ? ? 1_555 OC DG 47   N2 ? ? AA DC 844  Bc DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1996  hydrog ? ? A  DG 845  N1 ? ? ? 1_555 OC DC 46   N3 ? ? AA DG 845  Bc DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1997  hydrog ? ? A  DG 845  N2 ? ? ? 1_555 OC DC 46   O2 ? ? AA DG 845  Bc DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1998  hydrog ? ? A  DG 845  O6 ? ? ? 1_555 OC DC 46   N4 ? ? AA DG 845  Bc DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog1999  hydrog ? ? A  DT 846  N3 ? ? ? 1_555 OC DA 45   N1 ? ? AA DT 846  Bc DA 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2000  hydrog ? ? A  DT 846  O4 ? ? ? 1_555 OC DA 45   N6 ? ? AA DT 846  Bc DA 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2001  hydrog ? ? A  DG 847  N1 ? ? ? 1_555 OC DC 44   N3 ? ? AA DG 847  Bc DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2002  hydrog ? ? A  DG 847  N2 ? ? ? 1_555 OC DC 44   O2 ? ? AA DG 847  Bc DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2003  hydrog ? ? A  DG 847  O6 ? ? ? 1_555 OC DC 44   N4 ? ? AA DG 847  Bc DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2004  hydrog ? ? A  DA 848  N1 ? ? ? 1_555 OC DT 43   N3 ? ? AA DA 848  Bc DT 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2005  hydrog ? ? A  DA 848  N6 ? ? ? 1_555 OC DT 43   O4 ? ? AA DA 848  Bc DT 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2006  hydrog ? ? A  DC 849  N3 ? ? ? 1_555 OC DG 42   N1 ? ? AA DC 849  Bc DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2007  hydrog ? ? A  DC 849  N4 ? ? ? 1_555 OC DG 42   O6 ? ? AA DC 849  Bc DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2008  hydrog ? ? A  DC 849  O2 ? ? ? 1_555 OC DG 42   N2 ? ? AA DC 849  Bc DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2009  hydrog ? ? A  DC 850  N3 ? ? ? 1_555 OC DG 41   N1 ? ? AA DC 850  Bc DG 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2010  hydrog ? ? A  DC 850  N4 ? ? ? 1_555 OC DG 41   O6 ? ? AA DC 850  Bc DG 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2011  hydrog ? ? A  DC 850  O2 ? ? ? 1_555 OC DG 41   N2 ? ? AA DC 850  Bc DG 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2012  hydrog ? ? A  DT 851  N3 ? ? ? 1_555 MC DA 14   N1 ? ? AA DT 851  Ba DA 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2013  hydrog ? ? A  DT 851  O4 ? ? ? 1_555 MC DA 14   N6 ? ? AA DT 851  Ba DA 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2014  hydrog ? ? A  DA 852  N1 ? ? ? 1_555 MC DT 13   N3 ? ? AA DA 852  Ba DT 13   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2015  hydrog ? ? A  DT 853  N3 ? ? ? 1_555 MC DA 12   N1 ? ? AA DT 853  Ba DA 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2016  hydrog ? ? A  DT 853  O4 ? ? ? 1_555 MC DA 12   N6 ? ? AA DT 853  Ba DA 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2017  hydrog ? ? A  DC 854  N3 ? ? ? 1_555 MC DG 11   N1 ? ? AA DC 854  Ba DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2018  hydrog ? ? A  DC 854  N4 ? ? ? 1_555 MC DG 11   O6 ? ? AA DC 854  Ba DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2019  hydrog ? ? A  DC 854  O2 ? ? ? 1_555 MC DG 11   N2 ? ? AA DC 854  Ba DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2020  hydrog ? ? A  DC 855  N3 ? ? ? 1_555 MC DG 10   N1 ? ? AA DC 855  Ba DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2021  hydrog ? ? A  DC 855  N4 ? ? ? 1_555 MC DG 10   O6 ? ? AA DC 855  Ba DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2022  hydrog ? ? A  DC 855  O2 ? ? ? 1_555 MC DG 10   N2 ? ? AA DC 855  Ba DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2023  hydrog ? ? A  DC 856  N3 ? ? ? 1_555 MC DG 9    N1 ? ? AA DC 856  Ba DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2024  hydrog ? ? A  DC 856  N4 ? ? ? 1_555 MC DG 9    O6 ? ? AA DC 856  Ba DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2025  hydrog ? ? A  DC 856  O2 ? ? ? 1_555 MC DG 9    N2 ? ? AA DC 856  Ba DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2026  hydrog ? ? A  DA 857  N1 ? ? ? 1_555 MC DT 8    N3 ? ? AA DA 857  Ba DT 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2027  hydrog ? ? A  DA 857  N6 ? ? ? 1_555 MC DT 8    O4 ? ? AA DA 857  Ba DT 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2028  hydrog ? ? A  DT 858  N3 ? ? ? 1_555 MC DA 7    N1 ? ? AA DT 858  Ba DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2029  hydrog ? ? A  DT 858  O4 ? ? ? 1_555 MC DA 7    N6 ? ? AA DT 858  Ba DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2030  hydrog ? ? A  DT 859  N3 ? ? ? 1_555 FB DA 22   N1 ? ? AA DT 859  B2 DA 22   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2031  hydrog ? ? A  DA 860  N1 ? ? ? 1_555 FB DT 21   N3 ? ? AA DA 860  B2 DT 21   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2032  hydrog ? ? A  DC 861  N3 ? ? ? 1_555 FB DG 20   N1 ? ? AA DC 861  B2 DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2033  hydrog ? ? A  DC 861  N4 ? ? ? 1_555 FB DG 20   O6 ? ? AA DC 861  B2 DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2034  hydrog ? ? A  DC 861  O2 ? ? ? 1_555 FB DG 20   N2 ? ? AA DC 861  B2 DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2035  hydrog ? ? A  DG 862  N1 ? ? ? 1_555 FB DC 19   N3 ? ? AA DG 862  B2 DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2036  hydrog ? ? A  DG 862  N2 ? ? ? 1_555 FB DC 19   O2 ? ? AA DG 862  B2 DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2037  hydrog ? ? A  DG 862  O6 ? ? ? 1_555 FB DC 19   N4 ? ? AA DG 862  B2 DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2038  hydrog ? ? A  DG 863  N1 ? ? ? 1_555 FB DC 18   N3 ? ? AA DG 863  B2 DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2039  hydrog ? ? A  DG 863  N2 ? ? ? 1_555 FB DC 18   O2 ? ? AA DG 863  B2 DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2040  hydrog ? ? A  DG 863  O6 ? ? ? 1_555 FB DC 18   N4 ? ? AA DG 863  B2 DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2041  hydrog ? ? A  DT 864  N3 ? ? ? 1_555 FB DA 17   N1 ? ? AA DT 864  B2 DA 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2042  hydrog ? ? A  DT 864  O4 ? ? ? 1_555 FB DA 17   N6 ? ? AA DT 864  B2 DA 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2043  hydrog ? ? A  DC 865  N3 ? ? ? 1_555 FB DG 16   N1 ? ? AA DC 865  B2 DG 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2044  hydrog ? ? A  DC 865  N4 ? ? ? 1_555 FB DG 16   O6 ? ? AA DC 865  B2 DG 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2045  hydrog ? ? A  DC 865  O2 ? ? ? 1_555 FB DG 16   N2 ? ? AA DC 865  B2 DG 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2046  hydrog ? ? A  DA 866  N1 ? ? ? 1_555 FB DT 15   N3 ? ? AA DA 866  B2 DT 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2047  hydrog ? ? A  DA 866  N6 ? ? ? 1_555 FB DT 15   O4 ? ? AA DA 866  B2 DT 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2048  hydrog ? ? A  DA 867  N1 ? ? ? 1_555 QD DT 14   N3 ? ? AA DA 867  CD DT 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2049  hydrog ? ? A  DA 867  N6 ? ? ? 1_555 QD DT 14   O4 ? ? AA DA 867  CD DT 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2050  hydrog ? ? A  DT 868  N3 ? ? ? 1_555 QD DA 13   N1 ? ? AA DT 868  CD DA 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2051  hydrog ? ? A  DT 868  O4 ? ? ? 1_555 QD DA 13   N6 ? ? AA DT 868  CD DA 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2052  hydrog ? ? A  DC 869  N3 ? ? ? 1_555 QD DG 12   N1 ? ? AA DC 869  CD DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2053  hydrog ? ? A  DC 869  N4 ? ? ? 1_555 QD DG 12   O6 ? ? AA DC 869  CD DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2054  hydrog ? ? A  DC 869  O2 ? ? ? 1_555 QD DG 12   N2 ? ? AA DC 869  CD DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2055  hydrog ? ? A  DC 870  N3 ? ? ? 1_555 QD DG 11   N1 ? ? AA DC 870  CD DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2056  hydrog ? ? A  DC 870  N4 ? ? ? 1_555 QD DG 11   O6 ? ? AA DC 870  CD DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2057  hydrog ? ? A  DC 870  O2 ? ? ? 1_555 QD DG 11   N2 ? ? AA DC 870  CD DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2058  hydrog ? ? A  DG 871  N1 ? ? ? 1_555 QD DC 10   N3 ? ? AA DG 871  CD DC 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2059  hydrog ? ? A  DG 871  N2 ? ? ? 1_555 QD DC 10   O2 ? ? AA DG 871  CD DC 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2060  hydrog ? ? A  DG 871  O6 ? ? ? 1_555 QD DC 10   N4 ? ? AA DG 871  CD DC 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2061  hydrog ? ? A  DC 872  N3 ? ? ? 1_555 QD DG 9    N1 ? ? AA DC 872  CD DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2062  hydrog ? ? A  DC 872  N4 ? ? ? 1_555 QD DG 9    O6 ? ? AA DC 872  CD DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2063  hydrog ? ? A  DC 872  O2 ? ? ? 1_555 QD DG 9    N2 ? ? AA DC 872  CD DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2064  hydrog ? ? A  DC 873  N3 ? ? ? 1_555 QD DG 8    N1 ? ? AA DC 873  CD DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2065  hydrog ? ? A  DC 873  N4 ? ? ? 1_555 QD DG 8    O6 ? ? AA DC 873  CD DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2066  hydrog ? ? A  DC 873  O2 ? ? ? 1_555 QD DG 8    N2 ? ? AA DC 873  CD DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2067  hydrog ? ? A  DG 874  N1 ? ? ? 1_555 QD DC 7    N3 ? ? AA DG 874  CD DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2068  hydrog ? ? A  DG 874  N2 ? ? ? 1_555 QD DC 7    O2 ? ? AA DG 874  CD DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2069  hydrog ? ? A  DG 874  O6 ? ? ? 1_555 QD DC 7    N4 ? ? AA DG 874  CD DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2070  hydrog ? ? A  DT 875  N3 ? ? ? 1_555 EB DA 37   N1 ? ? AA DT 875  B1 DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2071  hydrog ? ? A  DT 875  O4 ? ? ? 1_555 EB DA 37   N6 ? ? AA DT 875  B1 DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2072  hydrog ? ? A  DT 876  N3 ? ? ? 1_555 EB DA 36   N1 ? ? AA DT 876  B1 DA 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2073  hydrog ? ? A  DT 876  O4 ? ? ? 1_555 EB DA 36   N6 ? ? AA DT 876  B1 DA 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2074  hydrog ? ? A  DT 877  N3 ? ? ? 1_555 EB DA 35   N1 ? ? AA DT 877  B1 DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2075  hydrog ? ? A  DT 877  O4 ? ? ? 1_555 EB DA 35   N6 ? ? AA DT 877  B1 DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2076  hydrog ? ? A  DG 878  N1 ? ? ? 1_555 EB DC 34   N3 ? ? AA DG 878  B1 DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2077  hydrog ? ? A  DG 878  N2 ? ? ? 1_555 EB DC 34   O2 ? ? AA DG 878  B1 DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2078  hydrog ? ? A  DG 878  O6 ? ? ? 1_555 EB DC 34   N4 ? ? AA DG 878  B1 DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2079  hydrog ? ? A  DT 879  N3 ? ? ? 1_555 EB DA 33   N1 ? ? AA DT 879  B1 DA 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2080  hydrog ? ? A  DT 879  O4 ? ? ? 1_555 EB DA 33   N6 ? ? AA DT 879  B1 DA 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2081  hydrog ? ? A  DT 880  N3 ? ? ? 1_555 EB DA 32   N1 ? ? AA DT 880  B1 DA 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2082  hydrog ? ? A  DT 880  O4 ? ? ? 1_555 EB DA 32   N6 ? ? AA DT 880  B1 DA 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2083  hydrog ? ? A  DC 881  N3 ? ? ? 1_555 EB DG 31   N1 ? ? AA DC 881  B1 DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2084  hydrog ? ? A  DC 881  N4 ? ? ? 1_555 EB DG 31   O6 ? ? AA DC 881  B1 DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2085  hydrog ? ? A  DC 881  O2 ? ? ? 1_555 EB DG 31   N2 ? ? AA DC 881  B1 DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2086  hydrog ? ? A  DC 882  N3 ? ? ? 1_555 EB DG 30   N1 ? ? AA DC 882  B1 DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2087  hydrog ? ? A  DC 882  N4 ? ? ? 1_555 EB DG 30   O6 ? ? AA DC 882  B1 DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2088  hydrog ? ? A  DC 882  O2 ? ? ? 1_555 EB DG 30   N2 ? ? AA DC 882  B1 DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2089  hydrog ? ? A  DC 883  N3 ? ? ? 1_555 EB DG 29   N1 ? ? AA DC 883  B1 DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2090  hydrog ? ? A  DC 883  N4 ? ? ? 1_555 EB DG 29   O6 ? ? AA DC 883  B1 DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2091  hydrog ? ? A  DC 883  O2 ? ? ? 1_555 EB DG 29   N2 ? ? AA DC 883  B1 DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2092  hydrog ? ? A  DA 884  N1 ? ? ? 1_555 EB DT 28   N3 ? ? AA DA 884  B1 DT 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2093  hydrog ? ? A  DA 884  N6 ? ? ? 1_555 EB DT 28   O4 ? ? AA DA 884  B1 DT 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2094  hydrog ? ? A  DC 885  N3 ? ? ? 1_555 EB DG 27   N1 ? ? AA DC 885  B1 DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2095  hydrog ? ? A  DC 885  N4 ? ? ? 1_555 EB DG 27   O6 ? ? AA DC 885  B1 DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2096  hydrog ? ? A  DC 885  O2 ? ? ? 1_555 EB DG 27   N2 ? ? AA DC 885  B1 DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2097  hydrog ? ? A  DG 886  N1 ? ? ? 1_555 EB DC 16   N3 ? ? AA DG 886  B1 DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2098  hydrog ? ? A  DG 886  N2 ? ? ? 1_555 EB DC 16   O2 ? ? AA DG 886  B1 DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2099  hydrog ? ? A  DG 886  O6 ? ? ? 1_555 EB DC 16   N4 ? ? AA DG 886  B1 DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2100  hydrog ? ? A  DG 887  N1 ? ? ? 1_555 EB DC 15   N3 ? ? AA DG 887  B1 DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2101  hydrog ? ? A  DG 887  N2 ? ? ? 1_555 EB DC 15   O2 ? ? AA DG 887  B1 DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2102  hydrog ? ? A  DG 887  O6 ? ? ? 1_555 EB DC 15   N4 ? ? AA DG 887  B1 DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2103  hydrog ? ? A  DA 888  N1 ? ? ? 1_555 EB DT 14   N3 ? ? AA DA 888  B1 DT 14   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2104  hydrog ? ? A  DG 889  N2 ? ? ? 1_555 YB DC 34   N3 ? ? AA DG 889  BM DC 34   1_555 ? ? ? ? ? ? 'DG-DC PAIR'            
? ? 
hydrog2105  hydrog ? ? A  DA 890  N1 ? ? ? 1_555 YB DT 33   N3 ? ? AA DA 890  BM DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2106  hydrog ? ? A  DA 890  N6 ? ? ? 1_555 YB DT 33   O4 ? ? AA DA 890  BM DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2107  hydrog ? ? A  DA 891  N1 ? ? ? 1_555 YB DT 32   N3 ? ? AA DA 891  BM DT 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2108  hydrog ? ? A  DA 891  N6 ? ? ? 1_555 YB DT 32   O4 ? ? AA DA 891  BM DT 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2109  hydrog ? ? A  DT 892  N3 ? ? ? 1_555 YB DA 31   N1 ? ? AA DT 892  BM DA 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2110  hydrog ? ? A  DT 892  O4 ? ? ? 1_555 YB DA 31   N6 ? ? AA DT 892  BM DA 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2111  hydrog ? ? A  DC 893  N3 ? ? ? 1_555 YB DG 30   N1 ? ? AA DC 893  BM DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2112  hydrog ? ? A  DC 893  N4 ? ? ? 1_555 YB DG 30   O6 ? ? AA DC 893  BM DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2113  hydrog ? ? A  DC 893  O2 ? ? ? 1_555 YB DG 30   N2 ? ? AA DC 893  BM DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2114  hydrog ? ? A  DC 894  N3 ? ? ? 1_555 YB DG 29   N1 ? ? AA DC 894  BM DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2115  hydrog ? ? A  DC 894  N4 ? ? ? 1_555 YB DG 29   O6 ? ? AA DC 894  BM DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2116  hydrog ? ? A  DC 894  O2 ? ? ? 1_555 YB DG 29   N2 ? ? AA DC 894  BM DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2117  hydrog ? ? A  DG 895  N1 ? ? ? 1_555 YB DC 28   N3 ? ? AA DG 895  BM DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2118  hydrog ? ? A  DG 895  N2 ? ? ? 1_555 YB DC 28   O2 ? ? AA DG 895  BM DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2119  hydrog ? ? A  DG 895  O6 ? ? ? 1_555 YB DC 28   N4 ? ? AA DG 895  BM DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2120  hydrog ? ? A  DA 896  N1 ? ? ? 1_555 YB DT 27   N3 ? ? AA DA 896  BM DT 27   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2121  hydrog ? ? A  DC 897  N3 ? ? ? 1_555 KC DG 26   N1 ? ? AA DC 897  BY DG 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2122  hydrog ? ? A  DC 897  N4 ? ? ? 1_555 KC DG 26   O6 ? ? AA DC 897  BY DG 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2123  hydrog ? ? A  DC 897  O2 ? ? ? 1_555 KC DG 26   N2 ? ? AA DC 897  BY DG 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2124  hydrog ? ? A  DG 898  N1 ? ? ? 1_555 KC DC 25   N3 ? ? AA DG 898  BY DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2125  hydrog ? ? A  DG 898  N2 ? ? ? 1_555 KC DC 25   O2 ? ? AA DG 898  BY DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2126  hydrog ? ? A  DG 898  O6 ? ? ? 1_555 KC DC 25   N4 ? ? AA DG 898  BY DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2127  hydrog ? ? A  DG 899  N1 ? ? ? 1_555 KC DC 24   N3 ? ? AA DG 899  BY DC 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2128  hydrog ? ? A  DG 899  N2 ? ? ? 1_555 KC DC 24   O2 ? ? AA DG 899  BY DC 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2129  hydrog ? ? A  DG 899  O6 ? ? ? 1_555 KC DC 24   N4 ? ? AA DG 899  BY DC 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2130  hydrog ? ? A  DG 900  N1 ? ? ? 1_555 KC DC 23   N3 ? ? AA DG 900  BY DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2131  hydrog ? ? A  DG 900  N2 ? ? ? 1_555 KC DC 23   O2 ? ? AA DG 900  BY DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2132  hydrog ? ? A  DG 900  O6 ? ? ? 1_555 KC DC 23   N4 ? ? AA DG 900  BY DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2133  hydrog ? ? A  DT 901  N3 ? ? ? 1_555 KC DA 22   N1 ? ? AA DT 901  BY DA 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2134  hydrog ? ? A  DT 901  O4 ? ? ? 1_555 KC DA 22   N6 ? ? AA DT 901  BY DA 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2135  hydrog ? ? A  DT 902  N3 ? ? ? 1_555 KC DA 21   N1 ? ? AA DT 902  BY DA 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2136  hydrog ? ? A  DT 902  O4 ? ? ? 1_555 KC DA 21   N6 ? ? AA DT 902  BY DA 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2137  hydrog ? ? A  DG 903  N1 ? ? ? 1_555 KC DC 20   N3 ? ? AA DG 903  BY DC 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2138  hydrog ? ? A  DG 903  N2 ? ? ? 1_555 KC DC 20   O2 ? ? AA DG 903  BY DC 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2139  hydrog ? ? A  DG 903  O6 ? ? ? 1_555 KC DC 20   N4 ? ? AA DG 903  BY DC 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2140  hydrog ? ? A  DT 904  N3 ? ? ? 1_555 KC DA 19   N1 ? ? AA DT 904  BY DA 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2141  hydrog ? ? A  DT 904  O4 ? ? ? 1_555 KC DA 19   N6 ? ? AA DT 904  BY DA 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2142  hydrog ? ? A  DT 905  N3 ? ? ? 1_555 FB DA 30   N1 ? ? AA DT 905  B2 DA 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2143  hydrog ? ? A  DT 905  O4 ? ? ? 1_555 FB DA 30   N6 ? ? AA DT 905  B2 DA 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2144  hydrog ? ? A  DA 906  N1 ? ? ? 1_555 FB DT 29   N3 ? ? AA DA 906  B2 DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2145  hydrog ? ? A  DA 906  N6 ? ? ? 1_555 FB DT 29   O4 ? ? AA DA 906  B2 DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2146  hydrog ? ? A  DC 907  N3 ? ? ? 1_555 FB DG 28   N1 ? ? AA DC 907  B2 DG 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2147  hydrog ? ? A  DC 907  N4 ? ? ? 1_555 FB DG 28   O6 ? ? AA DC 907  B2 DG 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2148  hydrog ? ? A  DC 907  O2 ? ? ? 1_555 FB DG 28   N2 ? ? AA DC 907  B2 DG 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2149  hydrog ? ? A  DT 908  N3 ? ? ? 1_555 FB DA 27   N1 ? ? AA DT 908  B2 DA 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2150  hydrog ? ? A  DT 908  O4 ? ? ? 1_555 FB DA 27   N6 ? ? AA DT 908  B2 DA 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2151  hydrog ? ? A  DC 909  N3 ? ? ? 1_555 FB DG 26   N1 ? ? AA DC 909  B2 DG 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2152  hydrog ? ? A  DC 909  N4 ? ? ? 1_555 FB DG 26   O6 ? ? AA DC 909  B2 DG 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2153  hydrog ? ? A  DC 909  O2 ? ? ? 1_555 FB DG 26   N2 ? ? AA DC 909  B2 DG 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2154  hydrog ? ? A  DG 910  N1 ? ? ? 1_555 FB DC 25   N3 ? ? AA DG 910  B2 DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2155  hydrog ? ? A  DG 910  N2 ? ? ? 1_555 FB DC 25   O2 ? ? AA DG 910  B2 DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2156  hydrog ? ? A  DG 910  O6 ? ? ? 1_555 FB DC 25   N4 ? ? AA DG 910  B2 DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2157  hydrog ? ? A  DC 911  N3 ? ? ? 1_555 FB DG 24   N1 ? ? AA DC 911  B2 DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2158  hydrog ? ? A  DC 911  N4 ? ? ? 1_555 FB DG 24   O6 ? ? AA DC 911  B2 DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2159  hydrog ? ? A  DC 911  O2 ? ? ? 1_555 FB DG 24   N2 ? ? AA DC 911  B2 DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2160  hydrog ? ? A  DT 912  N3 ? ? ? 1_555 FB DA 23   N1 ? ? AA DT 912  B2 DA 23   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2161  hydrog ? ? A  DC 913  N3 ? ? ? 1_555 MC DG 6    N1 ? ? AA DC 913  Ba DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2162  hydrog ? ? A  DC 913  N4 ? ? ? 1_555 MC DG 6    O6 ? ? AA DC 913  Ba DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2163  hydrog ? ? A  DC 913  O2 ? ? ? 1_555 MC DG 6    N2 ? ? AA DC 913  Ba DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2164  hydrog ? ? A  DA 914  N1 ? ? ? 1_555 MC DT 5    N3 ? ? AA DA 914  Ba DT 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2165  hydrog ? ? A  DA 914  N6 ? ? ? 1_555 MC DT 5    O4 ? ? AA DA 914  Ba DT 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2166  hydrog ? ? A  DC 915  N3 ? ? ? 1_555 MC DG 4    N1 ? ? AA DC 915  Ba DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2167  hydrog ? ? A  DC 915  N4 ? ? ? 1_555 MC DG 4    O6 ? ? AA DC 915  Ba DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2168  hydrog ? ? A  DC 915  O2 ? ? ? 1_555 MC DG 4    N2 ? ? AA DC 915  Ba DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2169  hydrog ? ? A  DA 916  N1 ? ? ? 1_555 MC DT 3    N3 ? ? AA DA 916  Ba DT 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2170  hydrog ? ? A  DA 916  N6 ? ? ? 1_555 MC DT 3    O4 ? ? AA DA 916  Ba DT 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2171  hydrog ? ? A  DT 917  N3 ? ? ? 1_555 MC DA 2    N1 ? ? AA DT 917  Ba DA 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2172  hydrog ? ? A  DT 917  O4 ? ? ? 1_555 MC DA 2    N6 ? ? AA DT 917  Ba DA 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2173  hydrog ? ? A  DT 918  N3 ? ? ? 1_555 MC DA 1    N1 ? ? AA DT 918  Ba DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2174  hydrog ? ? A  DT 918  O4 ? ? ? 1_555 MC DA 1    N6 ? ? AA DT 918  Ba DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2175  hydrog ? ? A  DT 919  N3 ? ? ? 1_555 RB DA 40   N1 ? ? AA DT 919  BF DA 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2176  hydrog ? ? A  DT 919  O4 ? ? ? 1_555 RB DA 40   N6 ? ? AA DT 919  BF DA 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2177  hydrog ? ? A  DA 920  N1 ? ? ? 1_555 RB DT 39   N3 ? ? AA DA 920  BF DT 39   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2178  hydrog ? ? A  DA 921  N1 ? ? ? 1_555 XD DT 6    N3 ? ? AA DA 921  CK DT 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2179  hydrog ? ? A  DA 921  N6 ? ? ? 1_555 XD DT 6    O4 ? ? AA DA 921  CK DT 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2180  hydrog ? ? A  DT 922  N3 ? ? ? 1_555 XD DA 5    N1 ? ? AA DT 922  CK DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2181  hydrog ? ? A  DT 922  O4 ? ? ? 1_555 XD DA 5    N6 ? ? AA DT 922  CK DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2182  hydrog ? ? A  DG 923  N1 ? ? ? 1_555 XD DC 4    N3 ? ? AA DG 923  CK DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2183  hydrog ? ? A  DG 923  N2 ? ? ? 1_555 XD DC 4    O2 ? ? AA DG 923  CK DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2184  hydrog ? ? A  DG 923  O6 ? ? ? 1_555 XD DC 4    N4 ? ? AA DG 923  CK DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2185  hydrog ? ? A  DT 924  N3 ? ? ? 1_555 XD DA 3    N1 ? ? AA DT 924  CK DA 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2186  hydrog ? ? A  DT 924  O4 ? ? ? 1_555 XD DA 3    N6 ? ? AA DT 924  CK DA 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2187  hydrog ? ? A  DT 925  N3 ? ? ? 1_555 XD DA 2    N1 ? ? AA DT 925  CK DA 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2188  hydrog ? ? A  DT 925  O4 ? ? ? 1_555 XD DA 2    N6 ? ? AA DT 925  CK DA 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2189  hydrog ? ? A  DG 926  N1 ? ? ? 1_555 XD DC 1    N3 ? ? AA DG 926  CK DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2190  hydrog ? ? A  DG 926  N2 ? ? ? 1_555 XD DC 1    O2 ? ? AA DG 926  CK DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2191  hydrog ? ? A  DG 926  O6 ? ? ? 1_555 XD DC 1    N4 ? ? AA DG 926  CK DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2192  hydrog ? ? A  DA 927  N1 ? ? ? 1_555 KB DT 44   N3 ? ? AA DA 927  B7 DT 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2193  hydrog ? ? A  DA 927  N6 ? ? ? 1_555 KB DT 44   O4 ? ? AA DA 927  B7 DT 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2194  hydrog ? ? A  DT 928  N3 ? ? ? 1_555 KB DA 43   N1 ? ? AA DT 928  B7 DA 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2195  hydrog ? ? A  DT 928  O4 ? ? ? 1_555 KB DA 43   N6 ? ? AA DT 928  B7 DA 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2196  hydrog ? ? A  DG 929  N1 ? ? ? 1_555 DB DC 34   N3 ? ? AA DG 929  B0 DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2197  hydrog ? ? A  DG 929  N2 ? ? ? 1_555 DB DC 34   O2 ? ? AA DG 929  B0 DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2198  hydrog ? ? A  DG 929  O6 ? ? ? 1_555 DB DC 34   N4 ? ? AA DG 929  B0 DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2199  hydrog ? ? A  DA 930  N1 ? ? ? 1_555 DB DT 33   N3 ? ? AA DA 930  B0 DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2200  hydrog ? ? A  DA 930  N6 ? ? ? 1_555 DB DT 33   O4 ? ? AA DA 930  B0 DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2201  hydrog ? ? A  DA 931  N1 ? ? ? 1_555 DB DT 32   N3 ? ? AA DA 931  B0 DT 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2202  hydrog ? ? A  DA 931  N6 ? ? ? 1_555 DB DT 32   O4 ? ? AA DA 931  B0 DT 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2203  hydrog ? ? A  DA 932  N1 ? ? ? 1_555 DB DT 31   N3 ? ? AA DA 932  B0 DT 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2204  hydrog ? ? A  DA 932  N6 ? ? ? 1_555 DB DT 31   O4 ? ? AA DA 932  B0 DT 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2205  hydrog ? ? A  DG 933  N1 ? ? ? 1_555 DB DC 30   N3 ? ? AA DG 933  B0 DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2206  hydrog ? ? A  DG 933  N2 ? ? ? 1_555 DB DC 30   O2 ? ? AA DG 933  B0 DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2207  hydrog ? ? A  DG 933  O6 ? ? ? 1_555 DB DC 30   N4 ? ? AA DG 933  B0 DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2208  hydrog ? ? A  DC 934  N3 ? ? ? 1_555 DB DG 29   N1 ? ? AA DC 934  B0 DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2209  hydrog ? ? A  DC 934  N4 ? ? ? 1_555 DB DG 29   O6 ? ? AA DC 934  B0 DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2210  hydrog ? ? A  DC 934  O2 ? ? ? 1_555 DB DG 29   N2 ? ? AA DC 934  B0 DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2211  hydrog ? ? A  DT 935  N3 ? ? ? 1_555 DB DA 28   N1 ? ? AA DT 935  B0 DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2212  hydrog ? ? A  DT 935  O4 ? ? ? 1_555 DB DA 28   N6 ? ? AA DT 935  B0 DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2213  hydrog ? ? A  DG 936  N1 ? ? ? 1_555 DB DC 27   N3 ? ? AA DG 936  B0 DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2214  hydrog ? ? A  DG 936  N2 ? ? ? 1_555 DB DC 27   O2 ? ? AA DG 936  B0 DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2215  hydrog ? ? A  DG 936  O6 ? ? ? 1_555 DB DC 27   N4 ? ? AA DG 936  B0 DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2216  hydrog ? ? A  DG 937  N1 ? ? ? 1_555 NC DC 2    N3 ? ? AA DG 937  Bb DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2217  hydrog ? ? A  DG 937  N2 ? ? ? 1_555 NC DC 2    O2 ? ? AA DG 937  Bb DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2218  hydrog ? ? A  DG 937  O6 ? ? ? 1_555 NC DC 2    N4 ? ? AA DG 937  Bb DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2219  hydrog ? ? A  DC 938  N3 ? ? ? 1_555 NC DG 1    N1 ? ? AA DC 938  Bb DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2220  hydrog ? ? A  DC 938  N4 ? ? ? 1_555 NC DG 1    O6 ? ? AA DC 938  Bb DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2221  hydrog ? ? A  DC 938  O2 ? ? ? 1_555 NC DG 1    N2 ? ? AA DC 938  Bb DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2222  hydrog ? ? A  DT 939  N3 ? ? ? 1_555 LD DA 48   N1 ? ? AA DT 939  C6 DA 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2223  hydrog ? ? A  DT 939  O4 ? ? ? 1_555 LD DA 48   N6 ? ? AA DT 939  C6 DA 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2224  hydrog ? ? A  DA 940  N1 ? ? ? 1_555 LD DT 47   N3 ? ? AA DA 940  C6 DT 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2225  hydrog ? ? A  DA 940  N6 ? ? ? 1_555 LD DT 47   O4 ? ? AA DA 940  C6 DT 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2226  hydrog ? ? A  DC 941  N3 ? ? ? 1_555 LD DG 46   N1 ? ? AA DC 941  C6 DG 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2227  hydrog ? ? A  DC 941  N4 ? ? ? 1_555 LD DG 46   O6 ? ? AA DC 941  C6 DG 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2228  hydrog ? ? A  DC 941  O2 ? ? ? 1_555 LD DG 46   N2 ? ? AA DC 941  C6 DG 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2229  hydrog ? ? A  DA 942  N1 ? ? ? 1_555 LD DT 45   N3 ? ? AA DA 942  C6 DT 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2230  hydrog ? ? A  DA 942  N6 ? ? ? 1_555 LD DT 45   O4 ? ? AA DA 942  C6 DT 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2231  hydrog ? ? A  DG 943  N1 ? ? ? 1_555 LD DC 44   N3 ? ? AA DG 943  C6 DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2232  hydrog ? ? A  DG 943  N2 ? ? ? 1_555 LD DC 44   O2 ? ? AA DG 943  C6 DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2233  hydrog ? ? A  DG 943  O6 ? ? ? 1_555 LD DC 44   N4 ? ? AA DG 943  C6 DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2234  hydrog ? ? A  DG 944  N1 ? ? ? 1_555 LD DC 43   N3 ? ? AA DG 944  C6 DC 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2235  hydrog ? ? A  DG 944  N2 ? ? ? 1_555 LD DC 43   O2 ? ? AA DG 944  C6 DC 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2236  hydrog ? ? A  DG 944  O6 ? ? ? 1_555 LD DC 43   N4 ? ? AA DG 944  C6 DC 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2237  hydrog ? ? A  DA 945  N1 ? ? ? 1_555 VB DT 26   N3 ? ? AA DA 945  BJ DT 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2238  hydrog ? ? A  DA 945  N6 ? ? ? 1_555 VB DT 26   O4 ? ? AA DA 945  BJ DT 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2239  hydrog ? ? A  DA 946  N1 ? ? ? 1_555 VB DT 25   N3 ? ? AA DA 946  BJ DT 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2240  hydrog ? ? A  DA 946  N6 ? ? ? 1_555 VB DT 25   O4 ? ? AA DA 946  BJ DT 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2241  hydrog ? ? A  DG 947  N1 ? ? ? 1_555 VB DC 24   N3 ? ? AA DG 947  BJ DC 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2242  hydrog ? ? A  DG 947  N2 ? ? ? 1_555 VB DC 24   O2 ? ? AA DG 947  BJ DC 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2243  hydrog ? ? A  DG 947  O6 ? ? ? 1_555 VB DC 24   N4 ? ? AA DG 947  BJ DC 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2244  hydrog ? ? A  DG 948  N1 ? ? ? 1_555 VB DC 23   N3 ? ? AA DG 948  BJ DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2245  hydrog ? ? A  DG 948  N2 ? ? ? 1_555 VB DC 23   O2 ? ? AA DG 948  BJ DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2246  hydrog ? ? A  DG 948  O6 ? ? ? 1_555 VB DC 23   N4 ? ? AA DG 948  BJ DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2247  hydrog ? ? A  DC 949  N3 ? ? ? 1_555 VB DG 22   N1 ? ? AA DC 949  BJ DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2248  hydrog ? ? A  DC 949  N4 ? ? ? 1_555 VB DG 22   O6 ? ? AA DC 949  BJ DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2249  hydrog ? ? A  DC 949  O2 ? ? ? 1_555 VB DG 22   N2 ? ? AA DC 949  BJ DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2250  hydrog ? ? A  DC 950  N3 ? ? ? 1_555 VB DG 21   N1 ? ? AA DC 950  BJ DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2251  hydrog ? ? A  DC 950  N4 ? ? ? 1_555 VB DG 21   O6 ? ? AA DC 950  BJ DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2252  hydrog ? ? A  DC 950  O2 ? ? ? 1_555 VB DG 21   N2 ? ? AA DC 950  BJ DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2253  hydrog ? ? A  DA 951  N1 ? ? ? 1_555 VB DT 20   N3 ? ? AA DA 951  BJ DT 20   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2254  hydrog ? ? A  DG 952  N1 ? ? ? 1_555 VB DC 19   N3 ? ? AA DG 952  BJ DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2255  hydrog ? ? A  DG 952  N2 ? ? ? 1_555 VB DC 19   O2 ? ? AA DG 952  BJ DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2256  hydrog ? ? A  DG 952  O6 ? ? ? 1_555 VB DC 19   N4 ? ? AA DG 952  BJ DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2257  hydrog ? ? A  DA 953  N1 ? ? ? 1_555 ZB DT 13   N3 ? ? AA DA 953  BN DT 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2258  hydrog ? ? A  DA 953  N6 ? ? ? 1_555 ZB DT 13   O4 ? ? AA DA 953  BN DT 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2259  hydrog ? ? A  DC 954  N3 ? ? ? 1_555 ZB DG 12   N1 ? ? AA DC 954  BN DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2260  hydrog ? ? A  DC 954  N4 ? ? ? 1_555 ZB DG 12   O6 ? ? AA DC 954  BN DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2261  hydrog ? ? A  DC 954  O2 ? ? ? 1_555 ZB DG 12   N2 ? ? AA DC 954  BN DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2262  hydrog ? ? A  DG 955  N1 ? ? ? 1_555 ZB DC 11   N3 ? ? AA DG 955  BN DC 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2263  hydrog ? ? A  DG 955  N2 ? ? ? 1_555 ZB DC 11   O2 ? ? AA DG 955  BN DC 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2264  hydrog ? ? A  DG 955  O6 ? ? ? 1_555 ZB DC 11   N4 ? ? AA DG 955  BN DC 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2265  hydrog ? ? A  DC 956  N3 ? ? ? 1_555 LC DG 9    N1 ? ? AA DC 956  BZ DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2266  hydrog ? ? A  DC 956  N4 ? ? ? 1_555 LC DG 9    O6 ? ? AA DC 956  BZ DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2267  hydrog ? ? A  DC 956  O2 ? ? ? 1_555 LC DG 9    N2 ? ? AA DC 956  BZ DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2268  hydrog ? ? A  DG 957  N1 ? ? ? 1_555 LC DC 8    N3 ? ? AA DG 957  BZ DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2269  hydrog ? ? A  DG 957  N2 ? ? ? 1_555 LC DC 8    O2 ? ? AA DG 957  BZ DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2270  hydrog ? ? A  DG 957  O6 ? ? ? 1_555 LC DC 8    N4 ? ? AA DG 957  BZ DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2271  hydrog ? ? A  DA 958  N1 ? ? ? 1_555 LC DT 7    N3 ? ? AA DA 958  BZ DT 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2272  hydrog ? ? A  DA 958  N6 ? ? ? 1_555 LC DT 7    O4 ? ? AA DA 958  BZ DT 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2273  hydrog ? ? A  DA 959  N1 ? ? ? 1_555 MB DT 10   N3 ? ? AA DA 959  B9 DT 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2274  hydrog ? ? A  DA 959  N6 ? ? ? 1_555 MB DT 10   O4 ? ? AA DA 959  B9 DT 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2275  hydrog ? ? A  DT 960  N3 ? ? ? 1_555 MB DA 9    N1 ? ? AA DT 960  B9 DA 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2276  hydrog ? ? A  DT 960  O4 ? ? ? 1_555 MB DA 9    N6 ? ? AA DT 960  B9 DA 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2277  hydrog ? ? A  DT 961  N3 ? ? ? 1_555 MB DA 8    N1 ? ? AA DT 961  B9 DA 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2278  hydrog ? ? A  DT 961  O4 ? ? ? 1_555 MB DA 8    N6 ? ? AA DT 961  B9 DA 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2279  hydrog ? ? A  DA 962  N1 ? ? ? 1_555 MB DT 7    N3 ? ? AA DA 962  B9 DT 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2280  hydrog ? ? A  DA 962  N6 ? ? ? 1_555 MB DT 7    O4 ? ? AA DA 962  B9 DT 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2281  hydrog ? ? A  DT 963  N3 ? ? ? 1_555 MB DA 6    N1 ? ? AA DT 963  B9 DA 6    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2282  hydrog ? ? A  DT 964  N3 ? ? ? 1_555 MB DA 5    N1 ? ? AA DT 964  B9 DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2283  hydrog ? ? A  DT 964  O4 ? ? ? 1_555 MB DA 5    N6 ? ? AA DT 964  B9 DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2284  hydrog ? ? A  DT 965  N3 ? ? ? 1_555 MB DA 4    N1 ? ? AA DT 965  B9 DA 4    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2285  hydrog ? ? A  DT 966  N3 ? ? ? 1_555 MB DA 3    N1 ? ? AA DT 966  B9 DA 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2286  hydrog ? ? A  DT 966  O4 ? ? ? 1_555 MB DA 3    N6 ? ? AA DT 966  B9 DA 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2287  hydrog ? ? A  DT 967  N3 ? ? ? 1_555 LB DA 6    N1 ? ? AA DT 967  B8 DA 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2288  hydrog ? ? A  DT 967  O4 ? ? ? 1_555 LB DA 6    N6 ? ? AA DT 967  B8 DA 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2289  hydrog ? ? A  DG 968  N1 ? ? ? 1_555 LB DC 5    N3 ? ? AA DG 968  B8 DC 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2290  hydrog ? ? A  DG 968  N2 ? ? ? 1_555 LB DC 5    O2 ? ? AA DG 968  B8 DC 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2291  hydrog ? ? A  DG 968  O6 ? ? ? 1_555 LB DC 5    N4 ? ? AA DG 968  B8 DC 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2292  hydrog ? ? A  DA 969  N1 ? ? ? 1_555 LB DT 4    N3 ? ? AA DA 969  B8 DT 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2293  hydrog ? ? A  DA 969  N6 ? ? ? 1_555 LB DT 4    O4 ? ? AA DA 969  B8 DT 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2294  hydrog ? ? A  DT 970  N3 ? ? ? 1_555 LB DA 3    N1 ? ? AA DT 970  B8 DA 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2295  hydrog ? ? A  DT 970  O4 ? ? ? 1_555 LB DA 3    N6 ? ? AA DT 970  B8 DA 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2296  hydrog ? ? A  DG 971  N1 ? ? ? 1_555 LB DC 2    N3 ? ? AA DG 971  B8 DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2297  hydrog ? ? A  DG 971  N2 ? ? ? 1_555 LB DC 2    O2 ? ? AA DG 971  B8 DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2298  hydrog ? ? A  DG 971  O6 ? ? ? 1_555 LB DC 2    N4 ? ? AA DG 971  B8 DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2299  hydrog ? ? A  DG 972  N1 ? ? ? 1_555 LB DC 1    N3 ? ? AA DG 972  B8 DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2300  hydrog ? ? A  DG 972  N2 ? ? ? 1_555 LB DC 1    O2 ? ? AA DG 972  B8 DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2301  hydrog ? ? A  DG 972  O6 ? ? ? 1_555 LB DC 1    N4 ? ? AA DG 972  B8 DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2302  hydrog ? ? A  DC 973  N3 ? ? ? 1_555 RD DG 40   N1 ? ? AA DC 973  CE DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2303  hydrog ? ? A  DC 973  N4 ? ? ? 1_555 RD DG 40   O6 ? ? AA DC 973  CE DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2304  hydrog ? ? A  DC 973  O2 ? ? ? 1_555 RD DG 40   N2 ? ? AA DC 973  CE DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2305  hydrog ? ? A  DG 974  N1 ? ? ? 1_555 RD DC 39   N3 ? ? AA DG 974  CE DC 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2306  hydrog ? ? A  DG 974  N2 ? ? ? 1_555 RD DC 39   O2 ? ? AA DG 974  CE DC 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2307  hydrog ? ? A  DG 974  O6 ? ? ? 1_555 RD DC 39   N4 ? ? AA DG 974  CE DC 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2308  hydrog ? ? A  DT 975  N3 ? ? ? 1_555 DB DA 42   N1 ? ? AA DT 975  B0 DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2309  hydrog ? ? A  DT 975  O4 ? ? ? 1_555 DB DA 42   N6 ? ? AA DT 975  B0 DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2310  hydrog ? ? A  DT 976  N3 ? ? ? 1_555 DB DA 41   N1 ? ? AA DT 976  B0 DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2311  hydrog ? ? A  DT 976  O4 ? ? ? 1_555 DB DA 41   N6 ? ? AA DT 976  B0 DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2312  hydrog ? ? A  DC 977  N3 ? ? ? 1_555 DB DG 40   N1 ? ? AA DC 977  B0 DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2313  hydrog ? ? A  DC 977  N4 ? ? ? 1_555 DB DG 40   O6 ? ? AA DC 977  B0 DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2314  hydrog ? ? A  DC 977  O2 ? ? ? 1_555 DB DG 40   N2 ? ? AA DC 977  B0 DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2315  hydrog ? ? A  DC 978  N3 ? ? ? 1_555 DB DG 39   N1 ? ? AA DC 978  B0 DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2316  hydrog ? ? A  DC 978  N4 ? ? ? 1_555 DB DG 39   O6 ? ? AA DC 978  B0 DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2317  hydrog ? ? A  DC 978  O2 ? ? ? 1_555 DB DG 39   N2 ? ? AA DC 978  B0 DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2318  hydrog ? ? A  DT 979  N3 ? ? ? 1_555 DB DA 38   N1 ? ? AA DT 979  B0 DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2319  hydrog ? ? A  DT 979  O4 ? ? ? 1_555 DB DA 38   N6 ? ? AA DT 979  B0 DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2320  hydrog ? ? A  DA 980  N1 ? ? ? 1_555 DB DT 37   N3 ? ? AA DA 980  B0 DT 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2321  hydrog ? ? A  DA 980  N6 ? ? ? 1_555 DB DT 37   O4 ? ? AA DA 980  B0 DT 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2322  hydrog ? ? A  DT 981  N3 ? ? ? 1_555 DB DA 36   N1 ? ? AA DT 981  B0 DA 36   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2323  hydrog ? ? A  DT 982  N3 ? ? ? 1_555 DB DA 35   N1 ? ? AA DT 982  B0 DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2324  hydrog ? ? A  DT 982  O4 ? ? ? 1_555 DB DA 35   N6 ? ? AA DT 982  B0 DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2325  hydrog ? ? A  DG 983  N1 ? ? ? 1_555 KB DC 42   N3 ? ? AA DG 983  B7 DC 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2326  hydrog ? ? A  DG 983  N2 ? ? ? 1_555 KB DC 42   O2 ? ? AA DG 983  B7 DC 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2327  hydrog ? ? A  DG 983  O6 ? ? ? 1_555 KB DC 42   N4 ? ? AA DG 983  B7 DC 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2328  hydrog ? ? A  DG 984  N1 ? ? ? 1_555 KB DC 41   N3 ? ? AA DG 984  B7 DC 41   1_555 ? ? ? ? ? ? 'DG-DC PAIR'            
? ? 
hydrog2329  hydrog ? ? A  DT 985  N3 ? ? ? 1_555 KB DA 40   N1 ? ? AA DT 985  B7 DA 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2330  hydrog ? ? A  DT 985  O4 ? ? ? 1_555 KB DA 40   N6 ? ? AA DT 985  B7 DA 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2331  hydrog ? ? A  DT 986  N3 ? ? ? 1_555 KB DA 39   N1 ? ? AA DT 986  B7 DA 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2332  hydrog ? ? A  DT 986  O4 ? ? ? 1_555 KB DA 39   N6 ? ? AA DT 986  B7 DA 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2333  hydrog ? ? A  DA 987  N1 ? ? ? 1_555 KB DT 38   N3 ? ? AA DA 987  B7 DT 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2334  hydrog ? ? A  DA 987  N6 ? ? ? 1_555 KB DT 38   O4 ? ? AA DA 987  B7 DT 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2335  hydrog ? ? A  DA 988  N1 ? ? ? 1_555 KB DT 37   N3 ? ? AA DA 988  B7 DT 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2336  hydrog ? ? A  DA 988  N6 ? ? ? 1_555 KB DT 37   O4 ? ? AA DA 988  B7 DT 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2337  hydrog ? ? A  DA 989  N1 ? ? ? 1_555 KB DT 36   N3 ? ? AA DA 989  B7 DT 36   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2338  hydrog ? ? A  DA 990  N1 ? ? ? 1_555 KB DT 35   N3 ? ? AA DA 990  B7 DT 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2339  hydrog ? ? A  DA 990  N6 ? ? ? 1_555 KB DT 35   O4 ? ? AA DA 990  B7 DT 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2340  hydrog ? ? A  DA 991  N1 ? ? ? 1_555 KD DT 56   N3 ? ? AA DA 991  C5 DT 56   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2341  hydrog ? ? A  DA 991  N6 ? ? ? 1_555 KD DT 56   O4 ? ? AA DA 991  C5 DT 56   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2342  hydrog ? ? A  DA 992  N1 ? ? ? 1_555 KD DT 55   N3 ? ? AA DA 992  C5 DT 55   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2343  hydrog ? ? A  DA 992  N6 ? ? ? 1_555 KD DT 55   O4 ? ? AA DA 992  C5 DT 55   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2344  hydrog ? ? A  DT 993  N3 ? ? ? 1_555 KD DA 54   N1 ? ? AA DT 993  C5 DA 54   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2345  hydrog ? ? A  DT 993  O4 ? ? ? 1_555 KD DA 54   N6 ? ? AA DT 993  C5 DA 54   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2346  hydrog ? ? A  DG 994  N1 ? ? ? 1_555 KD DC 53   N3 ? ? AA DG 994  C5 DC 53   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2347  hydrog ? ? A  DG 994  N2 ? ? ? 1_555 KD DC 53   O2 ? ? AA DG 994  C5 DC 53   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2348  hydrog ? ? A  DG 994  O6 ? ? ? 1_555 KD DC 53   N4 ? ? AA DG 994  C5 DC 53   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2349  hydrog ? ? A  DA 995  N1 ? ? ? 1_555 KD DT 52   N3 ? ? AA DA 995  C5 DT 52   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2350  hydrog ? ? A  DA 995  N6 ? ? ? 1_555 KD DT 52   O4 ? ? AA DA 995  C5 DT 52   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2351  hydrog ? ? A  DG 996  N1 ? ? ? 1_555 KD DC 51   N3 ? ? AA DG 996  C5 DC 51   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2352  hydrog ? ? A  DG 996  N2 ? ? ? 1_555 KD DC 51   O2 ? ? AA DG 996  C5 DC 51   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2353  hydrog ? ? A  DG 996  O6 ? ? ? 1_555 KD DC 51   N4 ? ? AA DG 996  C5 DC 51   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2354  hydrog ? ? A  DC 997  N3 ? ? ? 1_555 KD DG 50   N1 ? ? AA DC 997  C5 DG 50   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2355  hydrog ? ? A  DC 997  N4 ? ? ? 1_555 KD DG 50   O6 ? ? AA DC 997  C5 DG 50   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2356  hydrog ? ? A  DC 997  O2 ? ? ? 1_555 KD DG 50   N2 ? ? AA DC 997  C5 DG 50   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2357  hydrog ? ? A  DT 998  N3 ? ? ? 1_555 KD DA 49   N1 ? ? AA DT 998  C5 DA 49   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2358  hydrog ? ? A  DT 998  O4 ? ? ? 1_555 KD DA 49   N6 ? ? AA DT 998  C5 DA 49   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2359  hydrog ? ? A  DG 999  N1 ? ? ? 1_555 WB DC 38   N3 ? ? AA DG 999  BK DC 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2360  hydrog ? ? A  DG 999  N2 ? ? ? 1_555 WB DC 38   O2 ? ? AA DG 999  BK DC 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2361  hydrog ? ? A  DG 999  O6 ? ? ? 1_555 WB DC 38   N4 ? ? AA DG 999  BK DC 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2362  hydrog ? ? A  DA 1000 N1 ? ? ? 1_555 WB DT 37   N3 ? ? AA DA 1000 BK DT 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2363  hydrog ? ? A  DA 1000 N6 ? ? ? 1_555 WB DT 37   O4 ? ? AA DA 1000 BK DT 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2364  hydrog ? ? A  DT 1001 N3 ? ? ? 1_555 WB DA 36   N1 ? ? AA DT 1001 BK DA 36   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2365  hydrog ? ? A  DT 1002 N3 ? ? ? 1_555 WB DA 35   N1 ? ? AA DT 1002 BK DA 35   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2366  hydrog ? ? A  DT 1003 N3 ? ? ? 1_555 WB DA 34   N1 ? ? AA DT 1003 BK DA 34   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2367  hydrog ? ? A  DA 1004 N1 ? ? ? 1_555 WB DT 33   N3 ? ? AA DA 1004 BK DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2368  hydrog ? ? A  DA 1004 N6 ? ? ? 1_555 WB DT 33   O4 ? ? AA DA 1004 BK DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2369  hydrog ? ? A  DA 1005 N1 ? ? ? 1_555 WB DT 32   N3 ? ? AA DA 1005 BK DT 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2370  hydrog ? ? A  DA 1005 N6 ? ? ? 1_555 WB DT 32   O4 ? ? AA DA 1005 BK DT 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2371  hydrog ? ? A  DC 1006 N3 ? ? ? 1_555 WB DG 31   N1 ? ? AA DC 1006 BK DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2372  hydrog ? ? A  DC 1006 N4 ? ? ? 1_555 WB DG 31   O6 ? ? AA DC 1006 BK DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2373  hydrog ? ? A  DC 1006 O2 ? ? ? 1_555 WB DG 31   N2 ? ? AA DC 1006 BK DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2374  hydrog ? ? A  DA 1007 N1 ? ? ? 1_555 KC DT 34   N3 ? ? AA DA 1007 BY DT 34   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2375  hydrog ? ? A  DA 1008 N1 ? ? ? 1_555 KC DT 33   N3 ? ? AA DA 1008 BY DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2376  hydrog ? ? A  DA 1008 N6 ? ? ? 1_555 KC DT 33   O4 ? ? AA DA 1008 BY DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2377  hydrog ? ? A  DA 1009 N1 ? ? ? 1_555 KC DT 32   N3 ? ? AA DA 1009 BY DT 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2378  hydrog ? ? A  DA 1009 N6 ? ? ? 1_555 KC DT 32   O4 ? ? AA DA 1009 BY DT 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2379  hydrog ? ? A  DA 1010 N1 ? ? ? 1_555 KC DT 31   N3 ? ? AA DA 1010 BY DT 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2380  hydrog ? ? A  DA 1010 N6 ? ? ? 1_555 KC DT 31   O4 ? ? AA DA 1010 BY DT 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2381  hydrog ? ? A  DA 1011 N1 ? ? ? 1_555 KC DT 30   N3 ? ? AA DA 1011 BY DT 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2382  hydrog ? ? A  DA 1011 N6 ? ? ? 1_555 KC DT 30   O4 ? ? AA DA 1011 BY DT 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2383  hydrog ? ? A  DT 1012 N3 ? ? ? 1_555 KC DA 29   N1 ? ? AA DT 1012 BY DA 29   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2384  hydrog ? ? A  DT 1013 N3 ? ? ? 1_555 KC DA 28   N1 ? ? AA DT 1013 BY DA 28   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2385  hydrog ? ? A  DT 1014 N3 ? ? ? 1_555 KC DA 27   N1 ? ? AA DT 1014 BY DA 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2386  hydrog ? ? A  DT 1014 O4 ? ? ? 1_555 KC DA 27   N6 ? ? AA DT 1014 BY DA 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2387  hydrog ? ? A  DA 1015 N1 ? ? ? 1_555 YB DT 26   N3 ? ? AA DA 1015 BM DT 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2388  hydrog ? ? A  DA 1015 N6 ? ? ? 1_555 YB DT 26   O4 ? ? AA DA 1015 BM DT 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2389  hydrog ? ? A  DA 1016 N1 ? ? ? 1_555 YB DT 25   N3 ? ? AA DA 1016 BM DT 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2390  hydrog ? ? A  DA 1016 N6 ? ? ? 1_555 YB DT 25   O4 ? ? AA DA 1016 BM DT 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2391  hydrog ? ? A  DT 1017 N3 ? ? ? 1_555 YB DA 24   N1 ? ? AA DT 1017 BM DA 24   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2392  hydrog ? ? A  DG 1018 N1 ? ? ? 1_555 YB DC 23   N3 ? ? AA DG 1018 BM DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2393  hydrog ? ? A  DG 1018 N2 ? ? ? 1_555 YB DC 23   O2 ? ? AA DG 1018 BM DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2394  hydrog ? ? A  DG 1018 O6 ? ? ? 1_555 YB DC 23   N4 ? ? AA DG 1018 BM DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2395  hydrog ? ? A  DC 1019 N3 ? ? ? 1_555 YB DG 22   N1 ? ? AA DC 1019 BM DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2396  hydrog ? ? A  DC 1019 N4 ? ? ? 1_555 YB DG 22   O6 ? ? AA DC 1019 BM DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2397  hydrog ? ? A  DC 1019 O2 ? ? ? 1_555 YB DG 22   N2 ? ? AA DC 1019 BM DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2398  hydrog ? ? A  DG 1020 N1 ? ? ? 1_555 YB DC 21   N3 ? ? AA DG 1020 BM DC 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2399  hydrog ? ? A  DG 1020 N2 ? ? ? 1_555 YB DC 21   O2 ? ? AA DG 1020 BM DC 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2400  hydrog ? ? A  DG 1020 O6 ? ? ? 1_555 YB DC 21   N4 ? ? AA DG 1020 BM DC 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2401  hydrog ? ? A  DA 1021 N1 ? ? ? 1_555 YB DT 20   N3 ? ? AA DA 1021 BM DT 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2402  hydrog ? ? A  DA 1021 N6 ? ? ? 1_555 YB DT 20   O4 ? ? AA DA 1021 BM DT 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2403  hydrog ? ? A  DA 1022 N1 ? ? ? 1_555 YB DT 19   N3 ? ? AA DA 1022 BM DT 19   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2404  hydrog ? ? A  DT 1023 N3 ? ? ? 1_555 YB DA 18   N1 ? ? AA DT 1023 BM DA 18   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2405  hydrog ? ? A  DT 1024 N3 ? ? ? 1_555 YB DA 17   N1 ? ? AA DT 1024 BM DA 17   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2406  hydrog ? ? A  DT 1025 N3 ? ? ? 1_555 YB DA 16   N1 ? ? AA DT 1025 BM DA 16   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2407  hydrog ? ? A  DT 1026 N3 ? ? ? 1_555 YB DA 5    N1 ? ? AA DT 1026 BM DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2408  hydrog ? ? A  DT 1026 O4 ? ? ? 1_555 YB DA 5    N6 ? ? AA DT 1026 BM DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2409  hydrog ? ? A  DA 1027 N1 ? ? ? 1_555 YB DT 4    N3 ? ? AA DA 1027 BM DT 4    1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2410  hydrog ? ? A  DA 1028 N1 ? ? ? 1_555 YB DT 3    N3 ? ? AA DA 1028 BM DT 3    1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2411  hydrog ? ? A  DA 1030 N1 ? ? ? 1_555 GC DT 44   N3 ? ? AA DA 1030 BU DT 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2412  hydrog ? ? A  DA 1030 N6 ? ? ? 1_555 GC DT 44   O4 ? ? AA DA 1030 BU DT 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2413  hydrog ? ? A  DA 1031 N1 ? ? ? 1_555 GC DT 43   N3 ? ? AA DA 1031 BU DT 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2414  hydrog ? ? A  DA 1031 N6 ? ? ? 1_555 GC DT 43   O4 ? ? AA DA 1031 BU DT 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2415  hydrog ? ? A  DA 1032 N1 ? ? ? 1_555 GC DT 42   N3 ? ? AA DA 1032 BU DT 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2416  hydrog ? ? A  DA 1032 N6 ? ? ? 1_555 GC DT 42   O4 ? ? AA DA 1032 BU DT 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2417  hydrog ? ? A  DA 1033 N1 ? ? ? 1_555 GC DT 41   N3 ? ? AA DA 1033 BU DT 41   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2418  hydrog ? ? A  DT 1034 N3 ? ? ? 1_555 GC DA 40   N1 ? ? AA DT 1034 BU DA 40   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2419  hydrog ? ? A  DA 1035 N1 ? ? ? 1_555 GC DT 39   N3 ? ? AA DA 1035 BU DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2420  hydrog ? ? A  DA 1035 N6 ? ? ? 1_555 GC DT 39   O4 ? ? AA DA 1035 BU DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2421  hydrog ? ? A  DT 1036 N3 ? ? ? 1_555 GC DA 38   N1 ? ? AA DT 1036 BU DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2422  hydrog ? ? A  DT 1036 O4 ? ? ? 1_555 GC DA 38   N6 ? ? AA DT 1036 BU DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2423  hydrog ? ? A  DT 1037 N3 ? ? ? 1_555 CE DA 10   N1 ? ? AA DT 1037 CP DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2424  hydrog ? ? A  DT 1037 O4 ? ? ? 1_555 CE DA 10   N6 ? ? AA DT 1037 CP DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2425  hydrog ? ? A  DA 1038 N1 ? ? ? 1_555 CE DT 9    N3 ? ? AA DA 1038 CP DT 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2426  hydrog ? ? A  DA 1038 N6 ? ? ? 1_555 CE DT 9    O4 ? ? AA DA 1038 CP DT 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2427  hydrog ? ? A  DA 1039 N1 ? ? ? 1_555 CE DT 8    N3 ? ? AA DA 1039 CP DT 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2428  hydrog ? ? A  DA 1039 N6 ? ? ? 1_555 CE DT 8    O4 ? ? AA DA 1039 CP DT 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2429  hydrog ? ? A  DC 1040 N3 ? ? ? 1_555 CE DG 7    N1 ? ? AA DC 1040 CP DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2430  hydrog ? ? A  DC 1040 N4 ? ? ? 1_555 CE DG 7    O6 ? ? AA DC 1040 CP DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2431  hydrog ? ? A  DC 1040 O2 ? ? ? 1_555 CE DG 7    N2 ? ? AA DC 1040 CP DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2432  hydrog ? ? A  DG 1041 N1 ? ? ? 1_555 CE DC 6    N3 ? ? AA DG 1041 CP DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2433  hydrog ? ? A  DG 1041 N2 ? ? ? 1_555 CE DC 6    O2 ? ? AA DG 1041 CP DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2434  hydrog ? ? A  DG 1041 O6 ? ? ? 1_555 CE DC 6    N4 ? ? AA DG 1041 CP DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2435  hydrog ? ? A  DT 1042 N3 ? ? ? 1_555 CE DA 5    N1 ? ? AA DT 1042 CP DA 5    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2436  hydrog ? ? A  DT 1043 N3 ? ? ? 1_555 CE DA 4    N1 ? ? AA DT 1043 CP DA 4    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2437  hydrog ? ? A  DT 1044 N3 ? ? ? 1_555 CE DA 3    N1 ? ? AA DT 1044 CP DA 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2438  hydrog ? ? A  DT 1044 O4 ? ? ? 1_555 CE DA 3    N6 ? ? AA DT 1044 CP DA 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2439  hydrog ? ? A  DA 1045 N1 ? ? ? 1_555 KB DT 2    N3 ? ? AA DA 1045 B7 DT 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2440  hydrog ? ? A  DA 1045 N6 ? ? ? 1_555 KB DT 2    O4 ? ? AA DA 1045 B7 DT 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2441  hydrog ? ? A  DC 1046 N3 ? ? ? 1_555 KB DG 1    N1 ? ? AA DC 1046 B7 DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2442  hydrog ? ? A  DC 1046 N4 ? ? ? 1_555 KB DG 1    O6 ? ? AA DC 1046 B7 DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2443  hydrog ? ? A  DC 1046 O2 ? ? ? 1_555 KB DG 1    N2 ? ? AA DC 1046 B7 DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2444  hydrog ? ? A  DA 1047 N1 ? ? ? 1_555 WB DT 44   N3 ? ? AA DA 1047 BK DT 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2445  hydrog ? ? A  DA 1047 N6 ? ? ? 1_555 WB DT 44   O4 ? ? AA DA 1047 BK DT 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2446  hydrog ? ? A  DA 1048 N1 ? ? ? 1_555 WB DT 43   N3 ? ? AA DA 1048 BK DT 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2447  hydrog ? ? A  DA 1048 N6 ? ? ? 1_555 WB DT 43   O4 ? ? AA DA 1048 BK DT 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2448  hydrog ? ? A  DT 1049 N3 ? ? ? 1_555 WB DA 42   N1 ? ? AA DT 1049 BK DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2449  hydrog ? ? A  DT 1049 O4 ? ? ? 1_555 WB DA 42   N6 ? ? AA DT 1049 BK DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2450  hydrog ? ? A  DT 1050 N3 ? ? ? 1_555 WB DA 41   N1 ? ? AA DT 1050 BK DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2451  hydrog ? ? A  DT 1050 O4 ? ? ? 1_555 WB DA 41   N6 ? ? AA DT 1050 BK DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2452  hydrog ? ? A  DT 1051 N3 ? ? ? 1_555 WB DA 40   N1 ? ? AA DT 1051 BK DA 40   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2453  hydrog ? ? A  DA 1052 N1 ? ? ? 1_555 WB DT 39   N3 ? ? AA DA 1052 BK DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2454  hydrog ? ? A  DA 1052 N6 ? ? ? 1_555 WB DT 39   O4 ? ? AA DA 1052 BK DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2455  hydrog ? ? A  DA 1053 N1 ? ? ? 1_555 KD DT 48   N3 ? ? AA DA 1053 C5 DT 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2456  hydrog ? ? A  DA 1053 N6 ? ? ? 1_555 KD DT 48   O4 ? ? AA DA 1053 C5 DT 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2457  hydrog ? ? A  DA 1054 N1 ? ? ? 1_555 KD DT 47   N3 ? ? AA DA 1054 C5 DT 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2458  hydrog ? ? A  DA 1054 N6 ? ? ? 1_555 KD DT 47   O4 ? ? AA DA 1054 C5 DT 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2459  hydrog ? ? A  DT 1055 N3 ? ? ? 1_555 KD DA 46   N1 ? ? AA DT 1055 C5 DA 46   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2460  hydrog ? ? A  DA 1056 N1 ? ? ? 1_555 KD DT 45   N3 ? ? AA DA 1056 C5 DT 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2461  hydrog ? ? A  DA 1056 N6 ? ? ? 1_555 KD DT 45   O4 ? ? AA DA 1056 C5 DT 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2462  hydrog ? ? A  DT 1057 N3 ? ? ? 1_555 KD DA 44   N1 ? ? AA DT 1057 C5 DA 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2463  hydrog ? ? A  DT 1057 O4 ? ? ? 1_555 KD DA 44   N6 ? ? AA DT 1057 C5 DA 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2464  hydrog ? ? A  DT 1058 N3 ? ? ? 1_555 KD DA 43   N1 ? ? AA DT 1058 C5 DA 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2465  hydrog ? ? A  DT 1058 O4 ? ? ? 1_555 KD DA 43   N6 ? ? AA DT 1058 C5 DA 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2466  hydrog ? ? A  DT 1059 N3 ? ? ? 1_555 KD DA 42   N1 ? ? AA DT 1059 C5 DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2467  hydrog ? ? A  DT 1059 O4 ? ? ? 1_555 KD DA 42   N6 ? ? AA DT 1059 C5 DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2468  hydrog ? ? A  DG 1060 N1 ? ? ? 1_555 KD DC 41   N3 ? ? AA DG 1060 C5 DC 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2469  hydrog ? ? A  DG 1060 N2 ? ? ? 1_555 KD DC 41   O2 ? ? AA DG 1060 C5 DC 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2470  hydrog ? ? A  DG 1060 O6 ? ? ? 1_555 KD DC 41   N4 ? ? AA DG 1060 C5 DC 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2471  hydrog ? ? A  DC 1061 N3 ? ? ? 1_555 BE DG 6    N1 ? ? AA DC 1061 CO DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2472  hydrog ? ? A  DC 1061 N4 ? ? ? 1_555 BE DG 6    O6 ? ? AA DC 1061 CO DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2473  hydrog ? ? A  DC 1061 O2 ? ? ? 1_555 BE DG 6    N2 ? ? AA DC 1061 CO DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2474  hydrog ? ? A  DT 1062 N3 ? ? ? 1_555 BE DA 5    N1 ? ? AA DT 1062 CO DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2475  hydrog ? ? A  DT 1062 O4 ? ? ? 1_555 BE DA 5    N6 ? ? AA DT 1062 CO DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2476  hydrog ? ? A  DT 1063 N3 ? ? ? 1_555 BE DA 4    N1 ? ? AA DT 1063 CO DA 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2477  hydrog ? ? A  DT 1063 O4 ? ? ? 1_555 BE DA 4    N6 ? ? AA DT 1063 CO DA 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2478  hydrog ? ? A  DA 1064 N1 ? ? ? 1_555 BE DT 3    N3 ? ? AA DA 1064 CO DT 3    1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2479  hydrog ? ? A  DT 1065 N3 ? ? ? 1_555 BE DA 2    N1 ? ? AA DT 1065 CO DA 2    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2480  hydrog ? ? A  DA 1066 N1 ? ? ? 1_555 BE DT 1    N3 ? ? AA DA 1066 CO DT 1    1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2481  hydrog ? ? A  DC 1067 N3 ? ? ? 1_555 NB DG 48   N1 ? ? AA DC 1067 BB DG 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2482  hydrog ? ? A  DC 1067 N4 ? ? ? 1_555 NB DG 48   O6 ? ? AA DC 1067 BB DG 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2483  hydrog ? ? A  DC 1067 O2 ? ? ? 1_555 NB DG 48   N2 ? ? AA DC 1067 BB DG 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2484  hydrog ? ? A  DA 1068 N1 ? ? ? 1_555 NB DT 47   N3 ? ? AA DA 1068 BB DT 47   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2485  hydrog ? ? A  DA 1069 N1 ? ? ? 1_555 NB DT 47   N3 ? ? AA DA 1069 BB DT 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2486  hydrog ? ? A  DA 1069 N6 ? ? ? 1_555 NB DT 47   O4 ? ? AA DA 1069 BB DT 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2487  hydrog ? ? A  DA 1069 N1 ? ? ? 1_555 JC DT 38   N3 ? ? AA DA 1069 BX DT 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2488  hydrog ? ? A  DA 1069 N6 ? ? ? 1_555 JC DT 38   O4 ? ? AA DA 1069 BX DT 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2489  hydrog ? ? A  DT 1070 N3 ? ? ? 1_555 JC DA 37   N1 ? ? AA DT 1070 BX DA 37   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2490  hydrog ? ? A  DC 1071 N3 ? ? ? 1_555 JC DG 36   N1 ? ? AA DC 1071 BX DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2491  hydrog ? ? A  DC 1071 N4 ? ? ? 1_555 JC DG 36   O6 ? ? AA DC 1071 BX DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2492  hydrog ? ? A  DC 1071 O2 ? ? ? 1_555 JC DG 36   N2 ? ? AA DC 1071 BX DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2493  hydrog ? ? A  DT 1072 N3 ? ? ? 1_555 JC DA 35   N1 ? ? AA DT 1072 BX DA 35   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2494  hydrog ? ? A  DT 1073 N3 ? ? ? 1_555 JC DA 34   N1 ? ? AA DT 1073 BX DA 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2495  hydrog ? ? A  DT 1073 O4 ? ? ? 1_555 JC DA 34   N6 ? ? AA DT 1073 BX DA 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2496  hydrog ? ? A  DC 1074 N3 ? ? ? 1_555 JC DG 33   N1 ? ? AA DC 1074 BX DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2497  hydrog ? ? A  DC 1074 N4 ? ? ? 1_555 JC DG 33   O6 ? ? AA DC 1074 BX DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2498  hydrog ? ? A  DC 1074 O2 ? ? ? 1_555 JC DG 33   N2 ? ? AA DC 1074 BX DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2499  hydrog ? ? A  DC 1075 N3 ? ? ? 1_555 JC DG 32   N1 ? ? AA DC 1075 BX DG 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2500  hydrog ? ? A  DC 1075 N4 ? ? ? 1_555 JC DG 32   O6 ? ? AA DC 1075 BX DG 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2501  hydrog ? ? A  DC 1075 O2 ? ? ? 1_555 JC DG 32   N2 ? ? AA DC 1075 BX DG 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2502  hydrog ? ? A  DT 1076 N3 ? ? ? 1_555 JC DA 31   N1 ? ? AA DT 1076 BX DA 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2503  hydrog ? ? A  DT 1076 O4 ? ? ? 1_555 JC DA 31   N6 ? ? AA DT 1076 BX DA 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2504  hydrog ? ? A  DG 1077 N1 ? ? ? 1_555 LB DC 14   N3 ? ? AA DG 1077 B8 DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2505  hydrog ? ? A  DG 1077 N2 ? ? ? 1_555 LB DC 14   O2 ? ? AA DG 1077 B8 DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2506  hydrog ? ? A  DG 1077 O6 ? ? ? 1_555 LB DC 14   N4 ? ? AA DG 1077 B8 DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2507  hydrog ? ? A  DT 1078 N3 ? ? ? 1_555 LB DA 13   N1 ? ? AA DT 1078 B8 DA 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2508  hydrog ? ? A  DT 1078 O4 ? ? ? 1_555 LB DA 13   N6 ? ? AA DT 1078 B8 DA 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2509  hydrog ? ? A  DT 1079 N3 ? ? ? 1_555 LB DA 12   N1 ? ? AA DT 1079 B8 DA 12   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2510  hydrog ? ? A  DT 1080 N3 ? ? ? 1_555 LB DA 11   N1 ? ? AA DT 1080 B8 DA 11   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2511  hydrog ? ? A  DT 1081 N3 ? ? ? 1_555 LB DA 10   N1 ? ? AA DT 1081 B8 DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2512  hydrog ? ? A  DT 1081 O4 ? ? ? 1_555 LB DA 10   N6 ? ? AA DT 1081 B8 DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2513  hydrog ? ? A  DT 1082 N3 ? ? ? 1_555 LB DA 9    N1 ? ? AA DT 1082 B8 DA 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2514  hydrog ? ? A  DT 1082 O4 ? ? ? 1_555 LB DA 9    N6 ? ? AA DT 1082 B8 DA 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2515  hydrog ? ? A  DG 1083 N1 ? ? ? 1_555 LB DC 8    N3 ? ? AA DG 1083 B8 DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2516  hydrog ? ? A  DG 1083 N2 ? ? ? 1_555 LB DC 8    O2 ? ? AA DG 1083 B8 DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2517  hydrog ? ? A  DG 1083 O6 ? ? ? 1_555 LB DC 8    N4 ? ? AA DG 1083 B8 DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2518  hydrog ? ? A  DG 1084 N1 ? ? ? 1_555 LB DC 7    N3 ? ? AA DG 1084 B8 DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2519  hydrog ? ? A  DG 1084 N2 ? ? ? 1_555 LB DC 7    O2 ? ? AA DG 1084 B8 DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2520  hydrog ? ? A  DG 1084 O6 ? ? ? 1_555 LB DC 7    N4 ? ? AA DG 1084 B8 DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2521  hydrog ? ? A  DG 1085 N1 ? ? ? 1_555 SB DC 34   N3 ? ? AA DG 1085 BG DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2522  hydrog ? ? A  DG 1085 N2 ? ? ? 1_555 SB DC 34   O2 ? ? AA DG 1085 BG DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2523  hydrog ? ? A  DG 1085 O6 ? ? ? 1_555 SB DC 34   N4 ? ? AA DG 1085 BG DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2524  hydrog ? ? A  DG 1086 N1 ? ? ? 1_555 SB DC 33   N3 ? ? AA DG 1086 BG DC 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2525  hydrog ? ? A  DG 1086 N2 ? ? ? 1_555 SB DC 33   O2 ? ? AA DG 1086 BG DC 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2526  hydrog ? ? A  DG 1086 O6 ? ? ? 1_555 SB DC 33   N4 ? ? AA DG 1086 BG DC 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2527  hydrog ? ? A  DC 1087 O2 ? ? ? 1_555 SB DG 32   N2 ? ? AA DC 1087 BG DG 32   1_555 ? ? ? ? ? ? 'DC-DG PAIR'            
? ? 
hydrog2528  hydrog ? ? A  DT 1088 N3 ? ? ? 1_555 SB DA 31   N1 ? ? AA DT 1088 BG DA 31   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2529  hydrog ? ? A  DT 1089 N3 ? ? ? 1_555 SB DA 30   N1 ? ? AA DT 1089 BG DA 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2530  hydrog ? ? A  DT 1089 O4 ? ? ? 1_555 SB DA 30   N6 ? ? AA DT 1089 BG DA 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2531  hydrog ? ? A  DT 1090 N3 ? ? ? 1_555 SB DA 29   N1 ? ? AA DT 1090 BG DA 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2532  hydrog ? ? A  DT 1090 O4 ? ? ? 1_555 SB DA 29   N6 ? ? AA DT 1090 BG DA 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2533  hydrog ? ? A  DT 1091 N3 ? ? ? 1_555 SB DA 28   N1 ? ? AA DT 1091 BG DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2534  hydrog ? ? A  DT 1091 O4 ? ? ? 1_555 SB DA 28   N6 ? ? AA DT 1091 BG DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2535  hydrog ? ? A  DC 1092 N3 ? ? ? 1_555 SB DG 27   N1 ? ? AA DC 1092 BG DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2536  hydrog ? ? A  DC 1092 N4 ? ? ? 1_555 SB DG 27   O6 ? ? AA DC 1092 BG DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2537  hydrog ? ? A  DC 1092 O2 ? ? ? 1_555 SB DG 27   N2 ? ? AA DC 1092 BG DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2538  hydrog ? ? A  DT 1093 N3 ? ? ? 1_555 JC DA 46   N1 ? ? AA DT 1093 BX DA 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2539  hydrog ? ? A  DT 1093 O4 ? ? ? 1_555 JC DA 46   N6 ? ? AA DT 1093 BX DA 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2540  hydrog ? ? A  DG 1094 N1 ? ? ? 1_555 JC DC 45   N3 ? ? AA DG 1094 BX DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2541  hydrog ? ? A  DG 1094 N2 ? ? ? 1_555 JC DC 45   O2 ? ? AA DG 1094 BX DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2542  hydrog ? ? A  DG 1094 O6 ? ? ? 1_555 JC DC 45   N4 ? ? AA DG 1094 BX DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2543  hydrog ? ? A  DA 1095 N1 ? ? ? 1_555 JC DT 44   N3 ? ? AA DA 1095 BX DT 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2544  hydrog ? ? A  DA 1095 N6 ? ? ? 1_555 JC DT 44   O4 ? ? AA DA 1095 BX DT 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2545  hydrog ? ? A  DT 1096 N3 ? ? ? 1_555 JC DA 43   N1 ? ? AA DT 1096 BX DA 43   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2546  hydrog ? ? A  DT 1097 N3 ? ? ? 1_555 JC DA 42   N1 ? ? AA DT 1097 BX DA 42   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2547  hydrog ? ? A  DA 1098 N1 ? ? ? 1_555 JC DT 41   N3 ? ? AA DA 1098 BX DT 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2548  hydrog ? ? A  DA 1098 N6 ? ? ? 1_555 JC DT 41   O4 ? ? AA DA 1098 BX DT 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2549  hydrog ? ? A  DT 1099 N3 ? ? ? 1_555 JC DA 40   N1 ? ? AA DT 1099 BX DA 40   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2550  hydrog ? ? A  DC 1100 N3 ? ? ? 1_555 JC DG 39   N1 ? ? AA DC 1100 BX DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2551  hydrog ? ? A  DC 1100 N4 ? ? ? 1_555 JC DG 39   O6 ? ? AA DC 1100 BX DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2552  hydrog ? ? A  DC 1100 O2 ? ? ? 1_555 JC DG 39   N2 ? ? AA DC 1100 BX DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2553  hydrog ? ? A  DA 1101 N1 ? ? ? 1_555 NB DT 46   N3 ? ? AA DA 1101 BB DT 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2554  hydrog ? ? A  DA 1101 N6 ? ? ? 1_555 NB DT 46   O4 ? ? AA DA 1101 BB DT 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2555  hydrog ? ? A  DA 1102 N1 ? ? ? 1_555 NB DT 45   N3 ? ? AA DA 1102 BB DT 45   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2556  hydrog ? ? A  DC 1103 N3 ? ? ? 1_555 NB DG 44   N1 ? ? AA DC 1103 BB DG 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2557  hydrog ? ? A  DC 1103 N4 ? ? ? 1_555 NB DG 44   O6 ? ? AA DC 1103 BB DG 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2558  hydrog ? ? A  DC 1103 O2 ? ? ? 1_555 NB DG 44   N2 ? ? AA DC 1103 BB DG 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2559  hydrog ? ? A  DC 1104 N3 ? ? ? 1_555 NB DG 43   N1 ? ? AA DC 1104 BB DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2560  hydrog ? ? A  DC 1104 N4 ? ? ? 1_555 NB DG 43   O6 ? ? AA DC 1104 BB DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2561  hydrog ? ? A  DC 1104 O2 ? ? ? 1_555 NB DG 43   N2 ? ? AA DC 1104 BB DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2562  hydrog ? ? A  DG 1105 N1 ? ? ? 1_555 NB DC 42   N3 ? ? AA DG 1105 BB DC 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2563  hydrog ? ? A  DG 1105 N2 ? ? ? 1_555 NB DC 42   O2 ? ? AA DG 1105 BB DC 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2564  hydrog ? ? A  DG 1105 O6 ? ? ? 1_555 NB DC 42   N4 ? ? AA DG 1105 BB DC 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2565  hydrog ? ? A  DG 1106 N1 ? ? ? 1_555 NB DC 41   N3 ? ? AA DG 1106 BB DC 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2566  hydrog ? ? A  DG 1106 N2 ? ? ? 1_555 NB DC 41   O2 ? ? AA DG 1106 BB DC 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2567  hydrog ? ? A  DG 1106 O6 ? ? ? 1_555 NB DC 41   N4 ? ? AA DG 1106 BB DC 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2568  hydrog ? ? A  DG 1107 N1 ? ? ? 1_555 NB DC 40   N3 ? ? AA DG 1107 BB DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2569  hydrog ? ? A  DG 1107 N2 ? ? ? 1_555 NB DC 40   O2 ? ? AA DG 1107 BB DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2570  hydrog ? ? A  DG 1107 O6 ? ? ? 1_555 NB DC 40   N4 ? ? AA DG 1107 BB DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2571  hydrog ? ? A  DG 1108 N2 ? ? ? 1_555 NB DC 39   O2 ? ? AA DG 1108 BB DC 39   1_555 ? ? ? ? ? ? 'DG-DC PAIR'            
? ? 
hydrog2572  hydrog ? ? A  DT 1109 N3 ? ? ? 1_555 NB DA 38   N1 ? ? AA DT 1109 BB DA 38   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2573  hydrog ? ? A  DA 1110 N1 ? ? ? 1_555 NB DT 37   N3 ? ? AA DA 1110 BB DT 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2574  hydrog ? ? A  DA 1110 N6 ? ? ? 1_555 NB DT 37   O4 ? ? AA DA 1110 BB DT 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2575  hydrog ? ? A  DC 1111 N3 ? ? ? 1_555 NB DG 36   N1 ? ? AA DC 1111 BB DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2576  hydrog ? ? A  DC 1111 N4 ? ? ? 1_555 NB DG 36   O6 ? ? AA DC 1111 BB DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2577  hydrog ? ? A  DC 1111 O2 ? ? ? 1_555 NB DG 36   N2 ? ? AA DC 1111 BB DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2578  hydrog ? ? A  DA 1112 N1 ? ? ? 1_555 NB DT 35   N3 ? ? AA DA 1112 BB DT 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2579  hydrog ? ? A  DA 1112 N6 ? ? ? 1_555 NB DT 35   O4 ? ? AA DA 1112 BB DT 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2580  hydrog ? ? A  DT 1113 N3 ? ? ? 1_555 NB DA 34   N1 ? ? AA DT 1113 BB DA 34   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2581  hydrog ? ? A  DA 1114 N1 ? ? ? 1_555 NB DT 33   N3 ? ? AA DA 1114 BB DT 33   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2582  hydrog ? ? A  DT 1115 N3 ? ? ? 1_555 NB DA 32   N1 ? ? AA DT 1115 BB DA 32   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2583  hydrog ? ? A  DG 1116 N1 ? ? ? 1_555 NB DC 31   N3 ? ? AA DG 1116 BB DC 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2584  hydrog ? ? A  DG 1116 N2 ? ? ? 1_555 NB DC 31   O2 ? ? AA DG 1116 BB DC 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2585  hydrog ? ? A  DG 1116 O6 ? ? ? 1_555 NB DC 31   N4 ? ? AA DG 1116 BB DC 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2586  hydrog ? ? A  DA 1117 N1 ? ? ? 1_555 HC DT 14   N3 ? ? AA DA 1117 BV DT 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2587  hydrog ? ? A  DA 1117 N6 ? ? ? 1_555 HC DT 14   O4 ? ? AA DA 1117 BV DT 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2588  hydrog ? ? A  DT 1118 N3 ? ? ? 1_555 HC DA 13   N1 ? ? AA DT 1118 BV DA 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2589  hydrog ? ? A  DT 1118 O4 ? ? ? 1_555 HC DA 13   N6 ? ? AA DT 1118 BV DA 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2590  hydrog ? ? A  DT 1119 N3 ? ? ? 1_555 HC DA 12   N1 ? ? AA DT 1119 BV DA 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2591  hydrog ? ? A  DT 1119 O4 ? ? ? 1_555 HC DA 12   N6 ? ? AA DT 1119 BV DA 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2592  hydrog ? ? A  DG 1120 N1 ? ? ? 1_555 HC DC 11   N3 ? ? AA DG 1120 BV DC 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2593  hydrog ? ? A  DG 1120 N2 ? ? ? 1_555 HC DC 11   O2 ? ? AA DG 1120 BV DC 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2594  hydrog ? ? A  DG 1120 O6 ? ? ? 1_555 HC DC 11   N4 ? ? AA DG 1120 BV DC 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2595  hydrog ? ? A  DA 1121 N1 ? ? ? 1_555 HC DT 10   N3 ? ? AA DA 1121 BV DT 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2596  hydrog ? ? A  DA 1121 N6 ? ? ? 1_555 HC DT 10   O4 ? ? AA DA 1121 BV DT 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2597  hydrog ? ? A  DC 1122 N3 ? ? ? 1_555 HC DG 9    N1 ? ? AA DC 1122 BV DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2598  hydrog ? ? A  DC 1122 N4 ? ? ? 1_555 HC DG 9    O6 ? ? AA DC 1122 BV DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2599  hydrog ? ? A  DC 1122 O2 ? ? ? 1_555 HC DG 9    N2 ? ? AA DC 1122 BV DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2600  hydrog ? ? A  DA 1123 N1 ? ? ? 1_555 HC DT 8    N3 ? ? AA DA 1123 BV DT 8    1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2601  hydrog ? ? A  DT 1124 N3 ? ? ? 1_555 HC DA 7    N1 ? ? AA DT 1124 BV DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2602  hydrog ? ? A  DT 1124 O4 ? ? ? 1_555 HC DA 7    N6 ? ? AA DT 1124 BV DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2603  hydrog ? ? A  DG 1125 N1 ? ? ? 1_555 CE DC 18   N3 ? ? AA DG 1125 CP DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2604  hydrog ? ? A  DG 1125 N2 ? ? ? 1_555 CE DC 18   O2 ? ? AA DG 1125 CP DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2605  hydrog ? ? A  DG 1125 O6 ? ? ? 1_555 CE DC 18   N4 ? ? AA DG 1125 CP DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2606  hydrog ? ? A  DC 1126 N3 ? ? ? 1_555 CE DG 17   N1 ? ? AA DC 1126 CP DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2607  hydrog ? ? A  DC 1126 N4 ? ? ? 1_555 CE DG 17   O6 ? ? AA DC 1126 CP DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2608  hydrog ? ? A  DC 1126 O2 ? ? ? 1_555 CE DG 17   N2 ? ? AA DC 1126 CP DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2609  hydrog ? ? A  DT 1127 N3 ? ? ? 1_555 CE DA 16   N1 ? ? AA DT 1127 CP DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2610  hydrog ? ? A  DT 1127 O4 ? ? ? 1_555 CE DA 16   N6 ? ? AA DT 1127 CP DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2611  hydrog ? ? A  DA 1128 N1 ? ? ? 1_555 CE DT 15   N3 ? ? AA DA 1128 CP DT 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2612  hydrog ? ? A  DA 1128 N6 ? ? ? 1_555 CE DT 15   O4 ? ? AA DA 1128 CP DT 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2613  hydrog ? ? A  DG 1129 N1 ? ? ? 1_555 CE DC 14   N3 ? ? AA DG 1129 CP DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2614  hydrog ? ? A  DG 1129 N2 ? ? ? 1_555 CE DC 14   O2 ? ? AA DG 1129 CP DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2615  hydrog ? ? A  DG 1129 O6 ? ? ? 1_555 CE DC 14   N4 ? ? AA DG 1129 CP DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2616  hydrog ? ? A  DT 1130 N3 ? ? ? 1_555 CE DA 13   N1 ? ? AA DT 1130 CP DA 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2617  hydrog ? ? A  DT 1130 O4 ? ? ? 1_555 CE DA 13   N6 ? ? AA DT 1130 CP DA 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2618  hydrog ? ? A  DT 1131 N3 ? ? ? 1_555 CE DA 12   N1 ? ? AA DT 1131 CP DA 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2619  hydrog ? ? A  DT 1131 O4 ? ? ? 1_555 CE DA 12   N6 ? ? AA DT 1131 CP DA 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2620  hydrog ? ? A  DT 1132 N3 ? ? ? 1_555 CE DA 11   N1 ? ? AA DT 1132 CP DA 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2621  hydrog ? ? A  DT 1132 O4 ? ? ? 1_555 CE DA 11   N6 ? ? AA DT 1132 CP DA 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2622  hydrog ? ? A  DT 1133 N3 ? ? ? 1_555 GC DA 37   N1 ? ? AA DT 1133 BU DA 37   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2623  hydrog ? ? A  DA 1134 N1 ? ? ? 1_555 GC DT 36   N3 ? ? AA DA 1134 BU DT 36   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2624  hydrog ? ? A  DC 1135 N3 ? ? ? 1_555 GC DG 35   N1 ? ? AA DC 1135 BU DG 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2625  hydrog ? ? A  DC 1135 N4 ? ? ? 1_555 GC DG 35   O6 ? ? AA DC 1135 BU DG 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2626  hydrog ? ? A  DC 1135 O2 ? ? ? 1_555 GC DG 35   N2 ? ? AA DC 1135 BU DG 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2627  hydrog ? ? A  DG 1136 N1 ? ? ? 1_555 GC DC 34   N3 ? ? AA DG 1136 BU DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2628  hydrog ? ? A  DG 1136 N2 ? ? ? 1_555 GC DC 34   O2 ? ? AA DG 1136 BU DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2629  hydrog ? ? A  DG 1136 O6 ? ? ? 1_555 GC DC 34   N4 ? ? AA DG 1136 BU DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2630  hydrog ? ? A  DA 1137 N1 ? ? ? 1_555 GC DT 33   N3 ? ? AA DA 1137 BU DT 33   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2631  hydrog ? ? A  DT 1138 N3 ? ? ? 1_555 GC DA 32   N1 ? ? AA DT 1138 BU DA 32   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2632  hydrog ? ? A  DT 1139 N3 ? ? ? 1_555 GC DA 31   N1 ? ? AA DT 1139 BU DA 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2633  hydrog ? ? A  DT 1139 O4 ? ? ? 1_555 GC DA 31   N6 ? ? AA DT 1139 BU DA 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2634  hydrog ? ? A  DA 1140 N1 ? ? ? 1_555 GC DT 30   N3 ? ? AA DA 1140 BU DT 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2635  hydrog ? ? A  DA 1140 N6 ? ? ? 1_555 GC DT 30   O4 ? ? AA DA 1140 BU DT 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2636  hydrog ? ? A  DC 1141 N3 ? ? ? 1_555 GC DG 29   N1 ? ? AA DC 1141 BU DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2637  hydrog ? ? A  DC 1141 N4 ? ? ? 1_555 GC DG 29   O6 ? ? AA DC 1141 BU DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2638  hydrog ? ? A  DC 1141 O2 ? ? ? 1_555 GC DG 29   N2 ? ? AA DC 1141 BU DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2639  hydrog ? ? A  DC 1142 N3 ? ? ? 1_555 GC DG 28   N1 ? ? AA DC 1142 BU DG 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2640  hydrog ? ? A  DC 1142 N4 ? ? ? 1_555 GC DG 28   O6 ? ? AA DC 1142 BU DG 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2641  hydrog ? ? A  DC 1142 O2 ? ? ? 1_555 GC DG 28   N2 ? ? AA DC 1142 BU DG 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2642  hydrog ? ? A  DG 1143 N1 ? ? ? 1_555 GC DC 27   N3 ? ? AA DG 1143 BU DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2643  hydrog ? ? A  DG 1143 N2 ? ? ? 1_555 GC DC 27   O2 ? ? AA DG 1143 BU DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2644  hydrog ? ? A  DG 1143 O6 ? ? ? 1_555 GC DC 27   N4 ? ? AA DG 1143 BU DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2645  hydrog ? ? A  DT 1144 N3 ? ? ? 1_555 GC DA 16   N1 ? ? AA DT 1144 BU DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2646  hydrog ? ? A  DT 1144 O4 ? ? ? 1_555 GC DA 16   N6 ? ? AA DT 1144 BU DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2647  hydrog ? ? A  DT 1145 N3 ? ? ? 1_555 GC DA 15   N1 ? ? AA DT 1145 BU DA 15   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2648  hydrog ? ? A  DC 1146 N3 ? ? ? 1_555 GC DG 14   N1 ? ? AA DC 1146 BU DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2649  hydrog ? ? A  DC 1146 N4 ? ? ? 1_555 GC DG 14   O6 ? ? AA DC 1146 BU DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2650  hydrog ? ? A  DC 1146 O2 ? ? ? 1_555 GC DG 14   N2 ? ? AA DC 1146 BU DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2651  hydrog ? ? A  DA 1147 N1 ? ? ? 1_555 HC DT 38   N3 ? ? AA DA 1147 BV DT 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2652  hydrog ? ? A  DA 1147 N6 ? ? ? 1_555 HC DT 38   O4 ? ? AA DA 1147 BV DT 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2653  hydrog ? ? A  DT 1148 N3 ? ? ? 1_555 HC DA 37   N1 ? ? AA DT 1148 BV DA 37   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2654  hydrog ? ? A  DC 1149 N3 ? ? ? 1_555 HC DG 36   N1 ? ? AA DC 1149 BV DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2655  hydrog ? ? A  DC 1149 N4 ? ? ? 1_555 HC DG 36   O6 ? ? AA DC 1149 BV DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2656  hydrog ? ? A  DC 1149 O2 ? ? ? 1_555 HC DG 36   N2 ? ? AA DC 1149 BV DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2657  hydrog ? ? A  DG 1150 N1 ? ? ? 1_555 HC DC 35   N3 ? ? AA DG 1150 BV DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2658  hydrog ? ? A  DG 1150 N2 ? ? ? 1_555 HC DC 35   O2 ? ? AA DG 1150 BV DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2659  hydrog ? ? A  DG 1150 O6 ? ? ? 1_555 HC DC 35   N4 ? ? AA DG 1150 BV DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2660  hydrog ? ? A  DA 1151 N1 ? ? ? 1_555 HC DT 34   N3 ? ? AA DA 1151 BV DT 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2661  hydrog ? ? A  DA 1151 N6 ? ? ? 1_555 HC DT 34   O4 ? ? AA DA 1151 BV DT 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2662  hydrog ? ? A  DT 1152 N3 ? ? ? 1_555 HC DA 33   N1 ? ? AA DT 1152 BV DA 33   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2663  hydrog ? ? A  DT 1153 N3 ? ? ? 1_555 HC DA 32   N1 ? ? AA DT 1153 BV DA 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2664  hydrog ? ? A  DT 1153 O4 ? ? ? 1_555 HC DA 32   N6 ? ? AA DT 1153 BV DA 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2665  hydrog ? ? A  DC 1154 N3 ? ? ? 1_555 HC DG 31   N1 ? ? AA DC 1154 BV DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2666  hydrog ? ? A  DC 1154 N4 ? ? ? 1_555 HC DG 31   O6 ? ? AA DC 1154 BV DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2667  hydrog ? ? A  DC 1154 O2 ? ? ? 1_555 HC DG 31   N2 ? ? AA DC 1154 BV DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2668  hydrog ? ? A  DT 1155 N3 ? ? ? 1_555 HC DA 30   N1 ? ? AA DT 1155 BV DA 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2669  hydrog ? ? A  DT 1155 O4 ? ? ? 1_555 HC DA 30   N6 ? ? AA DT 1155 BV DA 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2670  hydrog ? ? A  DC 1156 N3 ? ? ? 1_555 HC DG 29   N1 ? ? AA DC 1156 BV DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2671  hydrog ? ? A  DC 1156 N4 ? ? ? 1_555 HC DG 29   O6 ? ? AA DC 1156 BV DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2672  hydrog ? ? A  DC 1156 O2 ? ? ? 1_555 HC DG 29   N2 ? ? AA DC 1156 BV DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2673  hydrog ? ? A  DT 1157 N3 ? ? ? 1_555 HC DA 28   N1 ? ? AA DT 1157 BV DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2674  hydrog ? ? A  DT 1157 O4 ? ? ? 1_555 HC DA 28   N6 ? ? AA DT 1157 BV DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2675  hydrog ? ? A  DT 1158 N3 ? ? ? 1_555 HC DA 27   N1 ? ? AA DT 1158 BV DA 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2676  hydrog ? ? A  DT 1158 O4 ? ? ? 1_555 HC DA 27   N6 ? ? AA DT 1158 BV DA 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2677  hydrog ? ? A  DG 1159 N1 ? ? ? 1_555 HC DC 26   N3 ? ? AA DG 1159 BV DC 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2678  hydrog ? ? A  DG 1159 N2 ? ? ? 1_555 HC DC 26   O2 ? ? AA DG 1159 BV DC 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2679  hydrog ? ? A  DG 1159 O6 ? ? ? 1_555 HC DC 26   N4 ? ? AA DG 1159 BV DC 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2680  hydrog ? ? A  DT 1160 N3 ? ? ? 1_555 HC DA 25   N1 ? ? AA DT 1160 BV DA 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2681  hydrog ? ? A  DT 1160 O4 ? ? ? 1_555 HC DA 25   N6 ? ? AA DT 1160 BV DA 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2682  hydrog ? ? A  DT 1161 N3 ? ? ? 1_555 HC DA 24   N1 ? ? AA DT 1161 BV DA 24   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2683  hydrog ? ? A  DT 1162 N3 ? ? ? 1_555 HC DA 23   N1 ? ? AA DT 1162 BV DA 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2684  hydrog ? ? A  DT 1162 O4 ? ? ? 1_555 HC DA 23   N6 ? ? AA DT 1162 BV DA 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2685  hydrog ? ? A  DG 1163 N1 ? ? ? 1_555 CE DC 34   N3 ? ? AA DG 1163 CP DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2686  hydrog ? ? A  DG 1163 N2 ? ? ? 1_555 CE DC 34   O2 ? ? AA DG 1163 CP DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2687  hydrog ? ? A  DG 1163 O6 ? ? ? 1_555 CE DC 34   N4 ? ? AA DG 1163 CP DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2688  hydrog ? ? A  DC 1164 N3 ? ? ? 1_555 CE DG 33   N1 ? ? AA DC 1164 CP DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2689  hydrog ? ? A  DC 1164 N4 ? ? ? 1_555 CE DG 33   O6 ? ? AA DC 1164 CP DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2690  hydrog ? ? A  DC 1164 O2 ? ? ? 1_555 CE DG 33   N2 ? ? AA DC 1164 CP DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2691  hydrog ? ? A  DT 1165 N3 ? ? ? 1_555 CE DA 32   N1 ? ? AA DT 1165 CP DA 32   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2692  hydrog ? ? A  DC 1166 N3 ? ? ? 1_555 CE DG 31   N1 ? ? AA DC 1166 CP DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2693  hydrog ? ? A  DC 1166 N4 ? ? ? 1_555 CE DG 31   O6 ? ? AA DC 1166 CP DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2694  hydrog ? ? A  DC 1166 O2 ? ? ? 1_555 CE DG 31   N2 ? ? AA DC 1166 CP DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2695  hydrog ? ? A  DC 1167 N3 ? ? ? 1_555 CE DG 30   N1 ? ? AA DC 1167 CP DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2696  hydrog ? ? A  DC 1167 N4 ? ? ? 1_555 CE DG 30   O6 ? ? AA DC 1167 CP DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2697  hydrog ? ? A  DC 1167 O2 ? ? ? 1_555 CE DG 30   N2 ? ? AA DC 1167 CP DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2698  hydrog ? ? A  DA 1168 N1 ? ? ? 1_555 CE DT 29   N3 ? ? AA DA 1168 CP DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2699  hydrog ? ? A  DA 1168 N6 ? ? ? 1_555 CE DT 29   O4 ? ? AA DA 1168 CP DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2700  hydrog ? ? A  DG 1169 N1 ? ? ? 1_555 CE DC 28   N3 ? ? AA DG 1169 CP DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2701  hydrog ? ? A  DG 1169 N2 ? ? ? 1_555 CE DC 28   O2 ? ? AA DG 1169 CP DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2702  hydrog ? ? A  DG 1169 O6 ? ? ? 1_555 CE DC 28   N4 ? ? AA DG 1169 CP DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2703  hydrog ? ? A  DA 1170 N1 ? ? ? 1_555 CE DT 27   N3 ? ? AA DA 1170 CP DT 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2704  hydrog ? ? A  DA 1170 N6 ? ? ? 1_555 CE DT 27   O4 ? ? AA DA 1170 CP DT 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2705  hydrog ? ? A  DC 1171 N3 ? ? ? 1_555 OB DG 2    N1 ? ? AA DC 1171 BC DG 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2706  hydrog ? ? A  DC 1171 N4 ? ? ? 1_555 OB DG 2    O6 ? ? AA DC 1171 BC DG 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2707  hydrog ? ? A  DC 1171 O2 ? ? ? 1_555 OB DG 2    N2 ? ? AA DC 1171 BC DG 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2708  hydrog ? ? A  DT 1172 N3 ? ? ? 1_555 OB DA 1    N1 ? ? AA DT 1172 BC DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2709  hydrog ? ? A  DT 1172 O4 ? ? ? 1_555 OB DA 1    N6 ? ? AA DT 1172 BC DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2710  hydrog ? ? A  DC 1173 N3 ? ? ? 1_555 HC DG 44   N1 ? ? AA DC 1173 BV DG 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2711  hydrog ? ? A  DC 1173 N4 ? ? ? 1_555 HC DG 44   O6 ? ? AA DC 1173 BV DG 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2712  hydrog ? ? A  DC 1173 O2 ? ? ? 1_555 HC DG 44   N2 ? ? AA DC 1173 BV DG 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2713  hydrog ? ? A  DT 1174 N3 ? ? ? 1_555 HC DA 43   N1 ? ? AA DT 1174 BV DA 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2714  hydrog ? ? A  DT 1174 O4 ? ? ? 1_555 HC DA 43   N6 ? ? AA DT 1174 BV DA 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2715  hydrog ? ? A  DC 1175 N3 ? ? ? 1_555 HC DG 42   N1 ? ? AA DC 1175 BV DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2716  hydrog ? ? A  DC 1175 N4 ? ? ? 1_555 HC DG 42   O6 ? ? AA DC 1175 BV DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2717  hydrog ? ? A  DC 1175 O2 ? ? ? 1_555 HC DG 42   N2 ? ? AA DC 1175 BV DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2718  hydrog ? ? A  DA 1176 N1 ? ? ? 1_555 HC DT 41   N3 ? ? AA DA 1176 BV DT 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2719  hydrog ? ? A  DA 1176 N6 ? ? ? 1_555 HC DT 41   O4 ? ? AA DA 1176 BV DT 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2720  hydrog ? ? A  DG 1177 N1 ? ? ? 1_555 HC DC 40   N3 ? ? AA DG 1177 BV DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2721  hydrog ? ? A  DG 1177 N2 ? ? ? 1_555 HC DC 40   O2 ? ? AA DG 1177 BV DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2722  hydrog ? ? A  DG 1177 O6 ? ? ? 1_555 HC DC 40   N4 ? ? AA DG 1177 BV DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2723  hydrog ? ? A  DG 1178 N1 ? ? ? 1_555 HC DC 39   N3 ? ? AA DG 1178 BV DC 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2724  hydrog ? ? A  DG 1178 N2 ? ? ? 1_555 HC DC 39   O2 ? ? AA DG 1178 BV DC 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2725  hydrog ? ? A  DG 1178 O6 ? ? ? 1_555 HC DC 39   N4 ? ? AA DG 1178 BV DC 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2726  hydrog ? ? A  DC 1179 N3 ? ? ? 1_555 GC DG 13   N1 ? ? AA DC 1179 BU DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2727  hydrog ? ? A  DC 1179 N4 ? ? ? 1_555 GC DG 13   O6 ? ? AA DC 1179 BU DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2728  hydrog ? ? A  DC 1179 O2 ? ? ? 1_555 GC DG 13   N2 ? ? AA DC 1179 BU DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2729  hydrog ? ? A  DA 1180 N1 ? ? ? 1_555 GC DT 12   N3 ? ? AA DA 1180 BU DT 12   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2730  hydrog ? ? A  DA 1181 N1 ? ? ? 1_555 GC DT 11   N3 ? ? AA DA 1181 BU DT 11   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2731  hydrog ? ? A  DT 1182 N3 ? ? ? 1_555 GC DA 10   N1 ? ? AA DT 1182 BU DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2732  hydrog ? ? A  DT 1182 O4 ? ? ? 1_555 GC DA 10   N6 ? ? AA DT 1182 BU DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2733  hydrog ? ? A  DG 1183 N1 ? ? ? 1_555 GC DC 9    N3 ? ? AA DG 1183 BU DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2734  hydrog ? ? A  DG 1183 N2 ? ? ? 1_555 GC DC 9    O2 ? ? AA DG 1183 BU DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2735  hydrog ? ? A  DG 1183 O6 ? ? ? 1_555 GC DC 9    N4 ? ? AA DG 1183 BU DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2736  hydrog ? ? A  DA 1184 N1 ? ? ? 1_555 GC DT 8    N3 ? ? AA DA 1184 BU DT 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2737  hydrog ? ? A  DA 1184 N6 ? ? ? 1_555 GC DT 8    O4 ? ? AA DA 1184 BU DT 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2738  hydrog ? ? A  DC 1185 N3 ? ? ? 1_555 GC DG 7    N1 ? ? AA DC 1185 BU DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2739  hydrog ? ? A  DC 1185 N4 ? ? ? 1_555 GC DG 7    O6 ? ? AA DC 1185 BU DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2740  hydrog ? ? A  DC 1185 O2 ? ? ? 1_555 GC DG 7    N2 ? ? AA DC 1185 BU DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2741  hydrog ? ? A  DC 1186 N3 ? ? ? 1_555 GC DG 6    N1 ? ? AA DC 1186 BU DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2742  hydrog ? ? A  DC 1186 N4 ? ? ? 1_555 GC DG 6    O6 ? ? AA DC 1186 BU DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2743  hydrog ? ? A  DC 1186 O2 ? ? ? 1_555 GC DG 6    N2 ? ? AA DC 1186 BU DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2744  hydrog ? ? A  DT 1187 N3 ? ? ? 1_555 UE DA 29   N1 ? ? AA DT 1187 Ck DA 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2745  hydrog ? ? A  DT 1187 O4 ? ? ? 1_555 UE DA 29   N6 ? ? AA DT 1187 Ck DA 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2746  hydrog ? ? A  DG 1188 N1 ? ? ? 1_555 UE DC 28   N3 ? ? AA DG 1188 Ck DC 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2747  hydrog ? ? A  DG 1188 N2 ? ? ? 1_555 UE DC 28   O2 ? ? AA DG 1188 Ck DC 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2748  hydrog ? ? A  DG 1188 O6 ? ? ? 1_555 UE DC 28   N4 ? ? AA DG 1188 Ck DC 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2749  hydrog ? ? A  DA 1189 N1 ? ? ? 1_555 UE DT 27   N3 ? ? AA DA 1189 Ck DT 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2750  hydrog ? ? A  DA 1189 N6 ? ? ? 1_555 UE DT 27   O4 ? ? AA DA 1189 Ck DT 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2751  hydrog ? ? A  DT 1190 N3 ? ? ? 1_555 UE DA 26   N1 ? ? AA DT 1190 Ck DA 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2752  hydrog ? ? A  DT 1190 O4 ? ? ? 1_555 UE DA 26   N6 ? ? AA DT 1190 Ck DA 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2753  hydrog ? ? A  DA 1191 N1 ? ? ? 1_555 UE DT 25   N3 ? ? AA DA 1191 Ck DT 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2754  hydrog ? ? A  DA 1191 N6 ? ? ? 1_555 UE DT 25   O4 ? ? AA DA 1191 Ck DT 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2755  hydrog ? ? A  DG 1192 N1 ? ? ? 1_555 UE DC 24   N3 ? ? AA DG 1192 Ck DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2756  hydrog ? ? A  DG 1192 N2 ? ? ? 1_555 UE DC 24   O2 ? ? AA DG 1192 Ck DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2757  hydrog ? ? A  DG 1192 O6 ? ? ? 1_555 UE DC 24   N4 ? ? AA DG 1192 Ck DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2758  hydrog ? ? A  DC 1193 N3 ? ? ? 1_555 UE DG 23   N1 ? ? AA DC 1193 Ck DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2759  hydrog ? ? A  DC 1193 N4 ? ? ? 1_555 UE DG 23   O6 ? ? AA DC 1193 Ck DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2760  hydrog ? ? A  DC 1193 O2 ? ? ? 1_555 UE DG 23   N2 ? ? AA DC 1193 Ck DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2761  hydrog ? ? A  DC 1194 N3 ? ? ? 1_555 UE DG 22   N1 ? ? AA DC 1194 Ck DG 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2762  hydrog ? ? A  DC 1194 N4 ? ? ? 1_555 UE DG 22   O6 ? ? AA DC 1194 Ck DG 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2763  hydrog ? ? A  DC 1194 O2 ? ? ? 1_555 UE DG 22   N2 ? ? AA DC 1194 Ck DG 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2764  hydrog ? ? A  DT 1195 N3 ? ? ? 1_555 OB DA 10   N1 ? ? AA DT 1195 BC DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2765  hydrog ? ? A  DT 1195 O4 ? ? ? 1_555 OB DA 10   N6 ? ? AA DT 1195 BC DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2766  hydrog ? ? A  DT 1196 N3 ? ? ? 1_555 OB DA 9    N1 ? ? AA DT 1196 BC DA 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2767  hydrog ? ? A  DT 1196 O4 ? ? ? 1_555 OB DA 9    N6 ? ? AA DT 1196 BC DA 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2768  hydrog ? ? A  DT 1197 N3 ? ? ? 1_555 OB DA 8    N1 ? ? AA DT 1197 BC DA 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2769  hydrog ? ? A  DT 1197 O4 ? ? ? 1_555 OB DA 8    N6 ? ? AA DT 1197 BC DA 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2770  hydrog ? ? A  DG 1198 N1 ? ? ? 1_555 OB DC 7    N3 ? ? AA DG 1198 BC DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2771  hydrog ? ? A  DG 1198 N2 ? ? ? 1_555 OB DC 7    O2 ? ? AA DG 1198 BC DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2772  hydrog ? ? A  DG 1198 O6 ? ? ? 1_555 OB DC 7    N4 ? ? AA DG 1198 BC DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2773  hydrog ? ? A  DT 1199 N3 ? ? ? 1_555 OB DA 6    N1 ? ? AA DT 1199 BC DA 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2774  hydrog ? ? A  DT 1199 O4 ? ? ? 1_555 OB DA 6    N6 ? ? AA DT 1199 BC DA 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2775  hydrog ? ? A  DA 1200 N1 ? ? ? 1_555 OB DT 5    N3 ? ? AA DA 1200 BC DT 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2776  hydrog ? ? A  DA 1200 N6 ? ? ? 1_555 OB DT 5    O4 ? ? AA DA 1200 BC DT 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2777  hydrog ? ? A  DG 1201 N1 ? ? ? 1_555 OB DC 4    N3 ? ? AA DG 1201 BC DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2778  hydrog ? ? A  DG 1201 N2 ? ? ? 1_555 OB DC 4    O2 ? ? AA DG 1201 BC DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2779  hydrog ? ? A  DG 1201 O6 ? ? ? 1_555 OB DC 4    N4 ? ? AA DG 1201 BC DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2780  hydrog ? ? A  DA 1202 N1 ? ? ? 1_555 OB DT 3    N3 ? ? AA DA 1202 BC DT 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2781  hydrog ? ? A  DA 1202 N6 ? ? ? 1_555 OB DT 3    O4 ? ? AA DA 1202 BC DT 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2782  hydrog ? ? A  DT 1203 N3 ? ? ? 1_555 CE DA 26   N1 ? ? AA DT 1203 CP DA 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2783  hydrog ? ? A  DT 1203 O4 ? ? ? 1_555 CE DA 26   N6 ? ? AA DT 1203 CP DA 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2784  hydrog ? ? A  DC 1204 N3 ? ? ? 1_555 CE DG 25   N1 ? ? AA DC 1204 CP DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2785  hydrog ? ? A  DC 1204 N4 ? ? ? 1_555 CE DG 25   O6 ? ? AA DC 1204 CP DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2786  hydrog ? ? A  DC 1204 O2 ? ? ? 1_555 CE DG 25   N2 ? ? AA DC 1204 CP DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2787  hydrog ? ? A  DT 1205 N3 ? ? ? 1_555 CE DA 24   N1 ? ? AA DT 1205 CP DA 24   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2788  hydrog ? ? A  DC 1206 N3 ? ? ? 1_555 CE DG 23   N1 ? ? AA DC 1206 CP DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2789  hydrog ? ? A  DC 1206 N4 ? ? ? 1_555 CE DG 23   O6 ? ? AA DC 1206 CP DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2790  hydrog ? ? A  DC 1206 O2 ? ? ? 1_555 CE DG 23   N2 ? ? AA DC 1206 CP DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2791  hydrog ? ? A  DT 1207 N3 ? ? ? 1_555 CE DA 22   N1 ? ? AA DT 1207 CP DA 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2792  hydrog ? ? A  DT 1207 O4 ? ? ? 1_555 CE DA 22   N6 ? ? AA DT 1207 CP DA 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2793  hydrog ? ? A  DC 1208 N3 ? ? ? 1_555 CE DG 21   N1 ? ? AA DC 1208 CP DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2794  hydrog ? ? A  DC 1208 N4 ? ? ? 1_555 CE DG 21   O6 ? ? AA DC 1208 CP DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2795  hydrog ? ? A  DC 1208 O2 ? ? ? 1_555 CE DG 21   N2 ? ? AA DC 1208 CP DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2796  hydrog ? ? A  DA 1209 N1 ? ? ? 1_555 CE DT 20   N3 ? ? AA DA 1209 CP DT 20   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2797  hydrog ? ? A  DA 1210 N1 ? ? ? 1_555 CE DT 19   N3 ? ? AA DA 1210 CP DT 19   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2798  hydrog ? ? A  DA 1211 N1 ? ? ? 1_555 HC DT 6    N3 ? ? AA DA 1211 BV DT 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2799  hydrog ? ? A  DA 1211 N6 ? ? ? 1_555 HC DT 6    O4 ? ? AA DA 1211 BV DT 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2800  hydrog ? ? A  DA 1212 N1 ? ? ? 1_555 HC DT 5    N3 ? ? AA DA 1212 BV DT 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2801  hydrog ? ? A  DA 1212 N6 ? ? ? 1_555 HC DT 5    O4 ? ? AA DA 1212 BV DT 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2802  hydrog ? ? A  DA 1213 N1 ? ? ? 1_555 HC DT 4    N3 ? ? AA DA 1213 BV DT 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2803  hydrog ? ? A  DA 1213 N6 ? ? ? 1_555 HC DT 4    O4 ? ? AA DA 1213 BV DT 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2804  hydrog ? ? A  DT 1214 N3 ? ? ? 1_555 HC DA 3    N1 ? ? AA DT 1214 BV DA 3    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2805  hydrog ? ? A  DA 1215 N1 ? ? ? 1_555 HC DT 2    N3 ? ? AA DA 1215 BV DT 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2806  hydrog ? ? A  DA 1215 N6 ? ? ? 1_555 HC DT 2    O4 ? ? AA DA 1215 BV DT 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2807  hydrog ? ? A  DG 1216 N1 ? ? ? 1_555 HC DC 1    N3 ? ? AA DG 1216 BV DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2808  hydrog ? ? A  DG 1216 N2 ? ? ? 1_555 HC DC 1    O2 ? ? AA DG 1216 BV DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2809  hydrog ? ? A  DG 1216 O6 ? ? ? 1_555 HC DC 1    N4 ? ? AA DG 1216 BV DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2810  hydrog ? ? A  DC 1217 N3 ? ? ? 1_555 ND DG 44   N1 ? ? AA DC 1217 C8 DG 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2811  hydrog ? ? A  DC 1217 N4 ? ? ? 1_555 ND DG 44   O6 ? ? AA DC 1217 C8 DG 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2812  hydrog ? ? A  DC 1217 O2 ? ? ? 1_555 ND DG 44   N2 ? ? AA DC 1217 C8 DG 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2813  hydrog ? ? A  DT 1218 N3 ? ? ? 1_555 ND DA 43   N1 ? ? AA DT 1218 C8 DA 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2814  hydrog ? ? A  DT 1218 O4 ? ? ? 1_555 ND DA 43   N6 ? ? AA DT 1218 C8 DA 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2815  hydrog ? ? A  DA 1219 N1 ? ? ? 1_555 KD DT 32   N3 ? ? AA DA 1219 C5 DT 32   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2816  hydrog ? ? A  DC 1220 N3 ? ? ? 1_555 KD DG 31   N1 ? ? AA DC 1220 C5 DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2817  hydrog ? ? A  DC 1220 N4 ? ? ? 1_555 KD DG 31   O6 ? ? AA DC 1220 C5 DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2818  hydrog ? ? A  DC 1220 O2 ? ? ? 1_555 KD DG 31   N2 ? ? AA DC 1220 C5 DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2819  hydrog ? ? A  DC 1221 N3 ? ? ? 1_555 KD DG 30   N1 ? ? AA DC 1221 C5 DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2820  hydrog ? ? A  DC 1221 N4 ? ? ? 1_555 KD DG 30   O6 ? ? AA DC 1221 C5 DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2821  hydrog ? ? A  DC 1221 O2 ? ? ? 1_555 KD DG 30   N2 ? ? AA DC 1221 C5 DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2822  hydrog ? ? A  DC 1222 N3 ? ? ? 1_555 KD DG 29   N1 ? ? AA DC 1222 C5 DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2823  hydrog ? ? A  DC 1222 N4 ? ? ? 1_555 KD DG 29   O6 ? ? AA DC 1222 C5 DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2824  hydrog ? ? A  DC 1222 O2 ? ? ? 1_555 KD DG 29   N2 ? ? AA DC 1222 C5 DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2825  hydrog ? ? A  DT 1223 N3 ? ? ? 1_555 KD DA 28   N1 ? ? AA DT 1223 C5 DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2826  hydrog ? ? A  DT 1223 O4 ? ? ? 1_555 KD DA 28   N6 ? ? AA DT 1223 C5 DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2827  hydrog ? ? A  DC 1224 N3 ? ? ? 1_555 KD DG 27   N1 ? ? AA DC 1224 C5 DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2828  hydrog ? ? A  DC 1224 N4 ? ? ? 1_555 KD DG 27   O6 ? ? AA DC 1224 C5 DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2829  hydrog ? ? A  DC 1224 O2 ? ? ? 1_555 KD DG 27   N2 ? ? AA DC 1224 C5 DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2830  hydrog ? ? A  DT 1225 N3 ? ? ? 1_555 KD DA 26   N1 ? ? AA DT 1225 C5 DA 26   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2831  hydrog ? ? A  DC 1226 N3 ? ? ? 1_555 KD DG 25   N1 ? ? AA DC 1226 C5 DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2832  hydrog ? ? A  DC 1226 N4 ? ? ? 1_555 KD DG 25   O6 ? ? AA DC 1226 C5 DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2833  hydrog ? ? A  DC 1226 O2 ? ? ? 1_555 KD DG 25   N2 ? ? AA DC 1226 C5 DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2834  hydrog ? ? A  DC 1227 N3 ? ? ? 1_555 PB DG 25   N1 ? ? AA DC 1227 BD DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2835  hydrog ? ? A  DC 1227 N4 ? ? ? 1_555 PB DG 25   O6 ? ? AA DC 1227 BD DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2836  hydrog ? ? A  DC 1227 O2 ? ? ? 1_555 PB DG 25   N2 ? ? AA DC 1227 BD DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2837  hydrog ? ? A  DG 1228 N1 ? ? ? 1_555 PB DC 24   N3 ? ? AA DG 1228 BD DC 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2838  hydrog ? ? A  DG 1228 N2 ? ? ? 1_555 PB DC 24   O2 ? ? AA DG 1228 BD DC 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2839  hydrog ? ? A  DG 1228 O6 ? ? ? 1_555 PB DC 24   N4 ? ? AA DG 1228 BD DC 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2840  hydrog ? ? A  DG 1229 N1 ? ? ? 1_555 PB DC 23   N3 ? ? AA DG 1229 BD DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2841  hydrog ? ? A  DG 1229 N2 ? ? ? 1_555 PB DC 23   O2 ? ? AA DG 1229 BD DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2842  hydrog ? ? A  DG 1229 O6 ? ? ? 1_555 PB DC 23   N4 ? ? AA DG 1229 BD DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2843  hydrog ? ? A  DC 1230 N3 ? ? ? 1_555 PB DG 22   N1 ? ? AA DC 1230 BD DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2844  hydrog ? ? A  DC 1230 N4 ? ? ? 1_555 PB DG 22   O6 ? ? AA DC 1230 BD DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2845  hydrog ? ? A  DC 1230 O2 ? ? ? 1_555 PB DG 22   N2 ? ? AA DC 1230 BD DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2846  hydrog ? ? A  DA 1231 N1 ? ? ? 1_555 PB DT 21   N3 ? ? AA DA 1231 BD DT 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2847  hydrog ? ? A  DA 1231 N6 ? ? ? 1_555 PB DT 21   O4 ? ? AA DA 1231 BD DT 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2848  hydrog ? ? A  DT 1232 N3 ? ? ? 1_555 PB DA 20   N1 ? ? AA DT 1232 BD DA 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2849  hydrog ? ? A  DT 1232 O4 ? ? ? 1_555 PB DA 20   N6 ? ? AA DT 1232 BD DA 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2850  hydrog ? ? A  DT 1233 N3 ? ? ? 1_555 PB DA 19   N1 ? ? AA DT 1233 BD DA 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2851  hydrog ? ? A  DT 1233 O4 ? ? ? 1_555 PB DA 19   N6 ? ? AA DT 1233 BD DA 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2852  hydrog ? ? A  DA 1234 N1 ? ? ? 1_555 PB DT 18   N3 ? ? AA DA 1234 BD DT 18   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2853  hydrog ? ? A  DA 1235 N1 ? ? ? 1_555 HE DT 6    N3 ? ? AA DA 1235 CU DT 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2854  hydrog ? ? A  DA 1235 N6 ? ? ? 1_555 HE DT 6    O4 ? ? AA DA 1235 CU DT 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2855  hydrog ? ? A  DT 1236 N3 ? ? ? 1_555 HE DA 5    N1 ? ? AA DT 1236 CU DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2856  hydrog ? ? A  DT 1236 O4 ? ? ? 1_555 HE DA 5    N6 ? ? AA DT 1236 CU DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2857  hydrog ? ? A  DT 1237 N3 ? ? ? 1_555 HE DA 4    N1 ? ? AA DT 1237 CU DA 4    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2858  hydrog ? ? A  DT 1238 N3 ? ? ? 1_555 HE DA 3    N1 ? ? AA DT 1238 CU DA 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2859  hydrog ? ? A  DT 1238 O4 ? ? ? 1_555 HE DA 3    N6 ? ? AA DT 1238 CU DA 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2860  hydrog ? ? A  DA 1239 N1 ? ? ? 1_555 HE DT 2    N3 ? ? AA DA 1239 CU DT 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2861  hydrog ? ? A  DA 1239 N6 ? ? ? 1_555 HE DT 2    O4 ? ? AA DA 1239 CU DT 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2862  hydrog ? ? A  DT 1240 N3 ? ? ? 1_555 HE DA 1    N1 ? ? AA DT 1240 CU DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2863  hydrog ? ? A  DT 1240 O4 ? ? ? 1_555 HE DA 1    N6 ? ? AA DT 1240 CU DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2864  hydrog ? ? A  DC 1241 N3 ? ? ? 1_555 JC DG 48   N1 ? ? AA DC 1241 BX DG 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2865  hydrog ? ? A  DC 1241 N4 ? ? ? 1_555 JC DG 48   O6 ? ? AA DC 1241 BX DG 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2866  hydrog ? ? A  DC 1241 O2 ? ? ? 1_555 JC DG 48   N2 ? ? AA DC 1241 BX DG 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2867  hydrog ? ? A  DA 1242 N1 ? ? ? 1_555 JC DT 47   N3 ? ? AA DA 1242 BX DT 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2868  hydrog ? ? A  DA 1242 N6 ? ? ? 1_555 JC DT 47   O4 ? ? AA DA 1242 BX DT 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2869  hydrog ? ? A  DG 1243 N1 ? ? ? 1_555 SB DC 26   N3 ? ? AA DG 1243 BG DC 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2870  hydrog ? ? A  DG 1243 N2 ? ? ? 1_555 SB DC 26   O2 ? ? AA DG 1243 BG DC 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2871  hydrog ? ? A  DG 1243 O6 ? ? ? 1_555 SB DC 26   N4 ? ? AA DG 1243 BG DC 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2872  hydrog ? ? A  DC 1244 N3 ? ? ? 1_555 SB DG 25   N1 ? ? AA DC 1244 BG DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2873  hydrog ? ? A  DC 1244 N4 ? ? ? 1_555 SB DG 25   O6 ? ? AA DC 1244 BG DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2874  hydrog ? ? A  DC 1244 O2 ? ? ? 1_555 SB DG 25   N2 ? ? AA DC 1244 BG DG 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2875  hydrog ? ? A  DT 1245 N3 ? ? ? 1_555 SB DA 24   N1 ? ? AA DT 1245 BG DA 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2876  hydrog ? ? A  DT 1245 O4 ? ? ? 1_555 SB DA 24   N6 ? ? AA DT 1245 BG DA 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2877  hydrog ? ? A  DA 1246 N1 ? ? ? 1_555 SB DT 23   N3 ? ? AA DA 1246 BG DT 23   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2878  hydrog ? ? A  DG 1247 N1 ? ? ? 1_555 SB DC 22   N3 ? ? AA DG 1247 BG DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2879  hydrog ? ? A  DG 1247 N2 ? ? ? 1_555 SB DC 22   O2 ? ? AA DG 1247 BG DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2880  hydrog ? ? A  DG 1247 O6 ? ? ? 1_555 SB DC 22   N4 ? ? AA DG 1247 BG DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2881  hydrog ? ? A  DA 1248 N1 ? ? ? 1_555 SB DT 21   N3 ? ? AA DA 1248 BG DT 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2882  hydrog ? ? A  DA 1248 N6 ? ? ? 1_555 SB DT 21   O4 ? ? AA DA 1248 BG DT 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2883  hydrog ? ? A  DA 1249 N1 ? ? ? 1_555 SB DT 20   N3 ? ? AA DA 1249 BG DT 20   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2884  hydrog ? ? A  DC 1250 N3 ? ? ? 1_555 SB DG 19   N1 ? ? AA DC 1250 BG DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2885  hydrog ? ? A  DC 1250 N4 ? ? ? 1_555 SB DG 19   O6 ? ? AA DC 1250 BG DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2886  hydrog ? ? A  DC 1250 O2 ? ? ? 1_555 SB DG 19   N2 ? ? AA DC 1250 BG DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2887  hydrog ? ? A  DG 1251 N1 ? ? ? 1_555 EE DC 34   N3 ? ? AA DG 1251 CR DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2888  hydrog ? ? A  DG 1251 N2 ? ? ? 1_555 EE DC 34   O2 ? ? AA DG 1251 CR DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2889  hydrog ? ? A  DG 1251 O6 ? ? ? 1_555 EE DC 34   N4 ? ? AA DG 1251 CR DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2890  hydrog ? ? A  DG 1252 N1 ? ? ? 1_555 EE DC 33   N3 ? ? AA DG 1252 CR DC 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2891  hydrog ? ? A  DG 1252 N2 ? ? ? 1_555 EE DC 33   O2 ? ? AA DG 1252 CR DC 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2892  hydrog ? ? A  DG 1252 O6 ? ? ? 1_555 EE DC 33   N4 ? ? AA DG 1252 CR DC 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2893  hydrog ? ? A  DT 1253 N3 ? ? ? 1_555 EE DA 32   N1 ? ? AA DT 1253 CR DA 32   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2894  hydrog ? ? A  DT 1254 N3 ? ? ? 1_555 EE DA 31   N1 ? ? AA DT 1254 CR DA 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2895  hydrog ? ? A  DT 1254 O4 ? ? ? 1_555 EE DA 31   N6 ? ? AA DT 1254 CR DA 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2896  hydrog ? ? A  DG 1255 N1 ? ? ? 1_555 EE DC 30   N3 ? ? AA DG 1255 CR DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2897  hydrog ? ? A  DG 1255 N2 ? ? ? 1_555 EE DC 30   O2 ? ? AA DG 1255 CR DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2898  hydrog ? ? A  DG 1255 O6 ? ? ? 1_555 EE DC 30   N4 ? ? AA DG 1255 CR DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2899  hydrog ? ? A  DA 1256 N1 ? ? ? 1_555 EE DT 29   N3 ? ? AA DA 1256 CR DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2900  hydrog ? ? A  DA 1256 N6 ? ? ? 1_555 EE DT 29   O4 ? ? AA DA 1256 CR DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2901  hydrog ? ? A  DA 1257 N1 ? ? ? 1_555 EE DT 28   N3 ? ? AA DA 1257 CR DT 28   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2902  hydrog ? ? A  DT 1258 N3 ? ? ? 1_555 EE DA 27   N1 ? ? AA DT 1258 CR DA 27   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2903  hydrog ? ? A  DA 1259 N1 ? ? ? 1_555 QB DT 38   N3 ? ? AA DA 1259 BE DT 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2904  hydrog ? ? A  DA 1259 N6 ? ? ? 1_555 QB DT 38   O4 ? ? AA DA 1259 BE DT 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2905  hydrog ? ? A  DT 1260 N3 ? ? ? 1_555 QB DA 37   N1 ? ? AA DT 1260 BE DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2906  hydrog ? ? A  DT 1260 O4 ? ? ? 1_555 QB DA 37   N6 ? ? AA DT 1260 BE DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2907  hydrog ? ? A  DC 1261 N3 ? ? ? 1_555 QB DG 36   N1 ? ? AA DC 1261 BE DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2908  hydrog ? ? A  DC 1261 N4 ? ? ? 1_555 QB DG 36   O6 ? ? AA DC 1261 BE DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2909  hydrog ? ? A  DC 1261 O2 ? ? ? 1_555 QB DG 36   N2 ? ? AA DC 1261 BE DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2910  hydrog ? ? A  DA 1262 N1 ? ? ? 1_555 QB DT 35   N3 ? ? AA DA 1262 BE DT 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2911  hydrog ? ? A  DA 1262 N6 ? ? ? 1_555 QB DT 35   O4 ? ? AA DA 1262 BE DT 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2912  hydrog ? ? A  DT 1263 N3 ? ? ? 1_555 QB DA 34   N1 ? ? AA DT 1263 BE DA 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2913  hydrog ? ? A  DT 1263 O4 ? ? ? 1_555 QB DA 34   N6 ? ? AA DT 1263 BE DA 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2914  hydrog ? ? A  DA 1264 N1 ? ? ? 1_555 QB DT 33   N3 ? ? AA DA 1264 BE DT 33   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog2915  hydrog ? ? A  DT 1265 N3 ? ? ? 1_555 QB DA 32   N1 ? ? AA DT 1265 BE DA 32   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2916  hydrog ? ? A  DT 1266 N3 ? ? ? 1_555 QB DA 31   N1 ? ? AA DT 1266 BE DA 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2917  hydrog ? ? A  DT 1266 O4 ? ? ? 1_555 QB DA 31   N6 ? ? AA DT 1266 BE DA 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2918  hydrog ? ? A  DG 1267 N1 ? ? ? 1_555 LC DC 40   N3 ? ? AA DG 1267 BZ DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2919  hydrog ? ? A  DG 1267 N2 ? ? ? 1_555 LC DC 40   O2 ? ? AA DG 1267 BZ DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2920  hydrog ? ? A  DG 1267 O6 ? ? ? 1_555 LC DC 40   N4 ? ? AA DG 1267 BZ DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2921  hydrog ? ? A  DA 1268 N1 ? ? ? 1_555 LC DT 39   N3 ? ? AA DA 1268 BZ DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2922  hydrog ? ? A  DA 1268 N6 ? ? ? 1_555 LC DT 39   O4 ? ? AA DA 1268 BZ DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2923  hydrog ? ? A  DT 1269 N3 ? ? ? 1_555 LC DA 38   N1 ? ? AA DT 1269 BZ DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2924  hydrog ? ? A  DT 1269 O4 ? ? ? 1_555 LC DA 38   N6 ? ? AA DT 1269 BZ DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2925  hydrog ? ? A  DG 1270 N1 ? ? ? 1_555 LC DC 37   N3 ? ? AA DG 1270 BZ DC 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2926  hydrog ? ? A  DG 1270 N2 ? ? ? 1_555 LC DC 37   O2 ? ? AA DG 1270 BZ DC 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2927  hydrog ? ? A  DG 1270 O6 ? ? ? 1_555 LC DC 37   N4 ? ? AA DG 1270 BZ DC 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2928  hydrog ? ? A  DG 1271 N1 ? ? ? 1_555 LC DC 36   N3 ? ? AA DG 1271 BZ DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2929  hydrog ? ? A  DG 1271 N2 ? ? ? 1_555 LC DC 36   O2 ? ? AA DG 1271 BZ DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2930  hydrog ? ? A  DG 1271 O6 ? ? ? 1_555 LC DC 36   N4 ? ? AA DG 1271 BZ DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2931  hydrog ? ? A  DT 1272 N3 ? ? ? 1_555 LC DA 35   N1 ? ? AA DT 1272 BZ DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2932  hydrog ? ? A  DT 1272 O4 ? ? ? 1_555 LC DA 35   N6 ? ? AA DT 1272 BZ DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2933  hydrog ? ? A  DG 1273 N1 ? ? ? 1_555 LC DC 34   N3 ? ? AA DG 1273 BZ DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2934  hydrog ? ? A  DG 1273 N2 ? ? ? 1_555 LC DC 34   O2 ? ? AA DG 1273 BZ DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2935  hydrog ? ? A  DG 1273 O6 ? ? ? 1_555 LC DC 34   N4 ? ? AA DG 1273 BZ DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2936  hydrog ? ? A  DA 1274 N1 ? ? ? 1_555 LC DT 33   N3 ? ? AA DA 1274 BZ DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2937  hydrog ? ? A  DA 1274 N6 ? ? ? 1_555 LC DT 33   O4 ? ? AA DA 1274 BZ DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2938  hydrog ? ? A  DT 1275 N3 ? ? ? 1_555 EE DA 42   N1 ? ? AA DT 1275 CR DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2939  hydrog ? ? A  DT 1275 O4 ? ? ? 1_555 EE DA 42   N6 ? ? AA DT 1275 CR DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2940  hydrog ? ? A  DT 1276 N3 ? ? ? 1_555 EE DA 41   N1 ? ? AA DT 1276 CR DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2941  hydrog ? ? A  DT 1276 O4 ? ? ? 1_555 EE DA 41   N6 ? ? AA DT 1276 CR DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2942  hydrog ? ? A  DT 1277 N3 ? ? ? 1_555 EE DA 40   N1 ? ? AA DT 1277 CR DA 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2943  hydrog ? ? A  DT 1277 O4 ? ? ? 1_555 EE DA 40   N6 ? ? AA DT 1277 CR DA 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2944  hydrog ? ? A  DG 1278 N1 ? ? ? 1_555 EE DC 39   N3 ? ? AA DG 1278 CR DC 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2945  hydrog ? ? A  DG 1278 N2 ? ? ? 1_555 EE DC 39   O2 ? ? AA DG 1278 CR DC 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2946  hydrog ? ? A  DG 1278 O6 ? ? ? 1_555 EE DC 39   N4 ? ? AA DG 1278 CR DC 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2947  hydrog ? ? A  DA 1279 N1 ? ? ? 1_555 EE DT 38   N3 ? ? AA DA 1279 CR DT 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2948  hydrog ? ? A  DA 1279 N6 ? ? ? 1_555 EE DT 38   O4 ? ? AA DA 1279 CR DT 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2949  hydrog ? ? A  DC 1280 N3 ? ? ? 1_555 EE DG 37   N1 ? ? AA DC 1280 CR DG 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2950  hydrog ? ? A  DC 1280 N4 ? ? ? 1_555 EE DG 37   O6 ? ? AA DC 1280 CR DG 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2951  hydrog ? ? A  DC 1280 O2 ? ? ? 1_555 EE DG 37   N2 ? ? AA DC 1280 CR DG 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2952  hydrog ? ? A  DT 1281 N3 ? ? ? 1_555 EE DA 36   N1 ? ? AA DT 1281 CR DA 36   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog2953  hydrog ? ? A  DG 1282 N1 ? ? ? 1_555 EE DC 35   N3 ? ? AA DG 1282 CR DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2954  hydrog ? ? A  DG 1282 N2 ? ? ? 1_555 EE DC 35   O2 ? ? AA DG 1282 CR DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2955  hydrog ? ? A  DG 1282 O6 ? ? ? 1_555 EE DC 35   N4 ? ? AA DG 1282 CR DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2956  hydrog ? ? A  DT 1283 N3 ? ? ? 1_555 SB DA 18   N1 ? ? AA DT 1283 BG DA 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2957  hydrog ? ? A  DT 1283 O4 ? ? ? 1_555 SB DA 18   N6 ? ? AA DT 1283 BG DA 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2958  hydrog ? ? A  DC 1284 N3 ? ? ? 1_555 SB DG 17   N1 ? ? AA DC 1284 BG DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2959  hydrog ? ? A  DC 1284 N4 ? ? ? 1_555 SB DG 17   O6 ? ? AA DC 1284 BG DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2960  hydrog ? ? A  DC 1284 O2 ? ? ? 1_555 SB DG 17   N2 ? ? AA DC 1284 BG DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2961  hydrog ? ? A  DT 1285 N3 ? ? ? 1_555 SB DA 16   N1 ? ? AA DT 1285 BG DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2962  hydrog ? ? A  DT 1285 O4 ? ? ? 1_555 SB DA 16   N6 ? ? AA DT 1285 BG DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2963  hydrog ? ? A  DC 1286 N3 ? ? ? 1_555 SB DG 15   N1 ? ? AA DC 1286 BG DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2964  hydrog ? ? A  DC 1286 N4 ? ? ? 1_555 SB DG 15   O6 ? ? AA DC 1286 BG DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2965  hydrog ? ? A  DC 1286 O2 ? ? ? 1_555 SB DG 15   N2 ? ? AA DC 1286 BG DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2966  hydrog ? ? A  DC 1287 N3 ? ? ? 1_555 SB DG 14   N1 ? ? AA DC 1287 BG DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2967  hydrog ? ? A  DC 1287 N4 ? ? ? 1_555 SB DG 14   O6 ? ? AA DC 1287 BG DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2968  hydrog ? ? A  DC 1287 O2 ? ? ? 1_555 SB DG 14   N2 ? ? AA DC 1287 BG DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2969  hydrog ? ? A  DG 1288 N1 ? ? ? 1_555 SB DC 13   N3 ? ? AA DG 1288 BG DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2970  hydrog ? ? A  DG 1288 N2 ? ? ? 1_555 SB DC 13   O2 ? ? AA DG 1288 BG DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2971  hydrog ? ? A  DG 1288 O6 ? ? ? 1_555 SB DC 13   N4 ? ? AA DG 1288 BG DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2972  hydrog ? ? A  DG 1289 N1 ? ? ? 1_555 SB DC 12   N3 ? ? AA DG 1289 BG DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2973  hydrog ? ? A  DG 1289 N2 ? ? ? 1_555 SB DC 12   O2 ? ? AA DG 1289 BG DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2974  hydrog ? ? A  DG 1289 O6 ? ? ? 1_555 SB DC 12   N4 ? ? AA DG 1289 BG DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2975  hydrog ? ? A  DC 1290 N3 ? ? ? 1_555 SB DG 11   N1 ? ? AA DC 1290 BG DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2976  hydrog ? ? A  DC 1290 N4 ? ? ? 1_555 SB DG 11   O6 ? ? AA DC 1290 BG DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2977  hydrog ? ? A  DC 1290 O2 ? ? ? 1_555 SB DG 11   N2 ? ? AA DC 1290 BG DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2978  hydrog ? ? A  DC 1291 N3 ? ? ? 1_555 ME DG 10   N1 ? ? AA DC 1291 CZ DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2979  hydrog ? ? A  DC 1291 N4 ? ? ? 1_555 ME DG 10   O6 ? ? AA DC 1291 CZ DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2980  hydrog ? ? A  DC 1291 O2 ? ? ? 1_555 ME DG 10   N2 ? ? AA DC 1291 CZ DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2981  hydrog ? ? A  DT 1292 N3 ? ? ? 1_555 ME DA 9    N1 ? ? AA DT 1292 CZ DA 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2982  hydrog ? ? A  DT 1292 O4 ? ? ? 1_555 ME DA 9    N6 ? ? AA DT 1292 CZ DA 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2983  hydrog ? ? A  DT 1293 N3 ? ? ? 1_555 ME DA 8    N1 ? ? AA DT 1293 CZ DA 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2984  hydrog ? ? A  DT 1293 O4 ? ? ? 1_555 ME DA 8    N6 ? ? AA DT 1293 CZ DA 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2985  hydrog ? ? A  DT 1294 N3 ? ? ? 1_555 ME DA 7    N1 ? ? AA DT 1294 CZ DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2986  hydrog ? ? A  DT 1294 O4 ? ? ? 1_555 ME DA 7    N6 ? ? AA DT 1294 CZ DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2987  hydrog ? ? A  DC 1295 N3 ? ? ? 1_555 ME DG 6    N1 ? ? AA DC 1295 CZ DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2988  hydrog ? ? A  DC 1295 N4 ? ? ? 1_555 ME DG 6    O6 ? ? AA DC 1295 CZ DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2989  hydrog ? ? A  DC 1295 O2 ? ? ? 1_555 ME DG 6    N2 ? ? AA DC 1295 CZ DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2990  hydrog ? ? A  DT 1296 N3 ? ? ? 1_555 ME DA 5    N1 ? ? AA DT 1296 CZ DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2991  hydrog ? ? A  DT 1296 O4 ? ? ? 1_555 ME DA 5    N6 ? ? AA DT 1296 CZ DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2992  hydrog ? ? A  DC 1297 N3 ? ? ? 1_555 ME DG 4    N1 ? ? AA DC 1297 CZ DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2993  hydrog ? ? A  DC 1297 N4 ? ? ? 1_555 ME DG 4    O6 ? ? AA DC 1297 CZ DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2994  hydrog ? ? A  DC 1297 O2 ? ? ? 1_555 ME DG 4    N2 ? ? AA DC 1297 CZ DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2995  hydrog ? ? A  DA 1298 N1 ? ? ? 1_555 ME DT 3    N3 ? ? AA DA 1298 CZ DT 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2996  hydrog ? ? A  DA 1298 N6 ? ? ? 1_555 ME DT 3    O4 ? ? AA DA 1298 CZ DT 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2997  hydrog ? ? A  DC 1299 N3 ? ? ? 1_555 BE DG 14   N1 ? ? AA DC 1299 CO DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2998  hydrog ? ? A  DC 1299 N4 ? ? ? 1_555 BE DG 14   O6 ? ? AA DC 1299 CO DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog2999  hydrog ? ? A  DC 1299 O2 ? ? ? 1_555 BE DG 14   N2 ? ? AA DC 1299 CO DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3000  hydrog ? ? A  DC 1300 N3 ? ? ? 1_555 BE DG 13   N1 ? ? AA DC 1300 CO DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3001  hydrog ? ? A  DC 1300 N4 ? ? ? 1_555 BE DG 13   O6 ? ? AA DC 1300 CO DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3002  hydrog ? ? A  DC 1300 O2 ? ? ? 1_555 BE DG 13   N2 ? ? AA DC 1300 CO DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3003  hydrog ? ? A  DC 1301 N3 ? ? ? 1_555 BE DG 12   N1 ? ? AA DC 1301 CO DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3004  hydrog ? ? A  DC 1301 N4 ? ? ? 1_555 BE DG 12   O6 ? ? AA DC 1301 CO DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3005  hydrog ? ? A  DC 1301 O2 ? ? ? 1_555 BE DG 12   N2 ? ? AA DC 1301 CO DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3006  hydrog ? ? A  DT 1302 N3 ? ? ? 1_555 BE DA 11   N1 ? ? AA DT 1302 CO DA 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3007  hydrog ? ? A  DT 1302 O4 ? ? ? 1_555 BE DA 11   N6 ? ? AA DT 1302 CO DA 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3008  hydrog ? ? A  DT 1303 N3 ? ? ? 1_555 BE DA 10   N1 ? ? AA DT 1303 CO DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3009  hydrog ? ? A  DT 1303 O4 ? ? ? 1_555 BE DA 10   N6 ? ? AA DT 1303 CO DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3010  hydrog ? ? A  DT 1304 N3 ? ? ? 1_555 BE DA 9    N1 ? ? AA DT 1304 CO DA 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3011  hydrog ? ? A  DT 1304 O4 ? ? ? 1_555 BE DA 9    N6 ? ? AA DT 1304 CO DA 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3012  hydrog ? ? A  DT 1305 N3 ? ? ? 1_555 BE DA 8    N1 ? ? AA DT 1305 CO DA 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3013  hydrog ? ? A  DT 1305 O4 ? ? ? 1_555 BE DA 8    N6 ? ? AA DT 1305 CO DA 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3014  hydrog ? ? A  DG 1306 N1 ? ? ? 1_555 BE DC 7    N3 ? ? AA DG 1306 CO DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3015  hydrog ? ? A  DG 1306 N2 ? ? ? 1_555 BE DC 7    O2 ? ? AA DG 1306 CO DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3016  hydrog ? ? A  DG 1306 O6 ? ? ? 1_555 BE DC 7    N4 ? ? AA DG 1306 CO DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3017  hydrog ? ? A  DA 1307 N1 ? ? ? 1_555 KD DT 40   N3 ? ? AA DA 1307 C5 DT 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3018  hydrog ? ? A  DA 1307 N6 ? ? ? 1_555 KD DT 40   O4 ? ? AA DA 1307 C5 DT 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3019  hydrog ? ? A  DA 1308 N1 ? ? ? 1_555 KD DT 39   N3 ? ? AA DA 1308 C5 DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3020  hydrog ? ? A  DA 1308 N6 ? ? ? 1_555 KD DT 39   O4 ? ? AA DA 1308 C5 DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3021  hydrog ? ? A  DT 1309 N3 ? ? ? 1_555 KD DA 38   N1 ? ? AA DT 1309 C5 DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3022  hydrog ? ? A  DT 1309 O4 ? ? ? 1_555 KD DA 38   N6 ? ? AA DT 1309 C5 DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3023  hydrog ? ? A  DC 1310 N3 ? ? ? 1_555 KD DG 37   N1 ? ? AA DC 1310 C5 DG 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3024  hydrog ? ? A  DC 1310 N4 ? ? ? 1_555 KD DG 37   O6 ? ? AA DC 1310 C5 DG 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3025  hydrog ? ? A  DC 1310 O2 ? ? ? 1_555 KD DG 37   N2 ? ? AA DC 1310 C5 DG 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3026  hydrog ? ? A  DT 1311 N3 ? ? ? 1_555 KD DA 36   N1 ? ? AA DT 1311 C5 DA 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3027  hydrog ? ? A  DT 1311 O4 ? ? ? 1_555 KD DA 36   N6 ? ? AA DT 1311 C5 DA 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3028  hydrog ? ? A  DT 1312 N3 ? ? ? 1_555 KD DA 35   N1 ? ? AA DT 1312 C5 DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3029  hydrog ? ? A  DT 1312 O4 ? ? ? 1_555 KD DA 35   N6 ? ? AA DT 1312 C5 DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3030  hydrog ? ? A  DT 1313 N3 ? ? ? 1_555 KD DA 34   N1 ? ? AA DT 1313 C5 DA 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3031  hydrog ? ? A  DT 1313 O4 ? ? ? 1_555 KD DA 34   N6 ? ? AA DT 1313 C5 DA 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3032  hydrog ? ? A  DA 1314 N1 ? ? ? 1_555 KD DT 33   N3 ? ? AA DA 1314 C5 DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3033  hydrog ? ? A  DA 1314 N6 ? ? ? 1_555 KD DT 33   O4 ? ? AA DA 1314 C5 DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3034  hydrog ? ? A  DC 1315 N3 ? ? ? 1_555 ND DG 42   N1 ? ? AA DC 1315 C8 DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3035  hydrog ? ? A  DC 1315 N4 ? ? ? 1_555 ND DG 42   O6 ? ? AA DC 1315 C8 DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3036  hydrog ? ? A  DC 1315 O2 ? ? ? 1_555 ND DG 42   N2 ? ? AA DC 1315 C8 DG 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3037  hydrog ? ? A  DC 1316 N3 ? ? ? 1_555 ND DG 41   N1 ? ? AA DC 1316 C8 DG 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3038  hydrog ? ? A  DC 1316 N4 ? ? ? 1_555 ND DG 41   O6 ? ? AA DC 1316 C8 DG 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3039  hydrog ? ? A  DC 1316 O2 ? ? ? 1_555 ND DG 41   N2 ? ? AA DC 1316 C8 DG 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3040  hydrog ? ? A  DT 1317 N3 ? ? ? 1_555 ND DA 40   N1 ? ? AA DT 1317 C8 DA 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3041  hydrog ? ? A  DT 1317 O4 ? ? ? 1_555 ND DA 40   N6 ? ? AA DT 1317 C8 DA 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3042  hydrog ? ? A  DA 1318 N1 ? ? ? 1_555 ND DT 39   N3 ? ? AA DA 1318 C8 DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3043  hydrog ? ? A  DA 1318 N6 ? ? ? 1_555 ND DT 39   O4 ? ? AA DA 1318 C8 DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3044  hydrog ? ? A  DC 1319 N3 ? ? ? 1_555 ND DG 38   N1 ? ? AA DC 1319 C8 DG 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3045  hydrog ? ? A  DC 1319 N4 ? ? ? 1_555 ND DG 38   O6 ? ? AA DC 1319 C8 DG 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3046  hydrog ? ? A  DC 1319 O2 ? ? ? 1_555 ND DG 38   N2 ? ? AA DC 1319 C8 DG 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3047  hydrog ? ? A  DA 1320 N1 ? ? ? 1_555 ND DT 37   N3 ? ? AA DA 1320 C8 DT 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3048  hydrog ? ? A  DA 1320 N6 ? ? ? 1_555 ND DT 37   O4 ? ? AA DA 1320 C8 DT 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3049  hydrog ? ? A  DC 1321 N3 ? ? ? 1_555 ND DG 36   N1 ? ? AA DC 1321 C8 DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3050  hydrog ? ? A  DC 1321 N4 ? ? ? 1_555 ND DG 36   O6 ? ? AA DC 1321 C8 DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3051  hydrog ? ? A  DC 1321 O2 ? ? ? 1_555 ND DG 36   N2 ? ? AA DC 1321 C8 DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3052  hydrog ? ? A  DA 1322 N1 ? ? ? 1_555 ND DT 35   N3 ? ? AA DA 1322 C8 DT 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3053  hydrog ? ? A  DA 1322 N6 ? ? ? 1_555 ND DT 35   O4 ? ? AA DA 1322 C8 DT 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3054  hydrog ? ? A  DT 1323 N3 ? ? ? 1_555 PE DA 2    N1 ? ? AA DT 1323 Cd DA 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3055  hydrog ? ? A  DT 1323 O4 ? ? ? 1_555 PE DA 2    N6 ? ? AA DT 1323 Cd DA 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3056  hydrog ? ? A  DT 1324 N3 ? ? ? 1_555 PE DA 1    N1 ? ? AA DT 1324 Cd DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3057  hydrog ? ? A  DT 1324 O4 ? ? ? 1_555 PE DA 1    N6 ? ? AA DT 1324 Cd DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3058  hydrog ? ? A  DA 1325 N1 ? ? ? 1_555 KC DT 48   N3 ? ? AA DA 1325 BY DT 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3059  hydrog ? ? A  DA 1325 N6 ? ? ? 1_555 KC DT 48   O4 ? ? AA DA 1325 BY DT 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3060  hydrog ? ? A  DC 1326 N3 ? ? ? 1_555 KC DG 47   N1 ? ? AA DC 1326 BY DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3061  hydrog ? ? A  DC 1326 N4 ? ? ? 1_555 KC DG 47   O6 ? ? AA DC 1326 BY DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3062  hydrog ? ? A  DC 1326 O2 ? ? ? 1_555 KC DG 47   N2 ? ? AA DC 1326 BY DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3063  hydrog ? ? A  DT 1327 N3 ? ? ? 1_555 KC DA 46   N1 ? ? AA DT 1327 BY DA 46   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3064  hydrog ? ? A  DC 1328 N3 ? ? ? 1_555 KC DG 45   N1 ? ? AA DC 1328 BY DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3065  hydrog ? ? A  DC 1328 N4 ? ? ? 1_555 KC DG 45   O6 ? ? AA DC 1328 BY DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3066  hydrog ? ? A  DC 1328 O2 ? ? ? 1_555 KC DG 45   N2 ? ? AA DC 1328 BY DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3067  hydrog ? ? A  DA 1329 N1 ? ? ? 1_555 KC DT 44   N3 ? ? AA DA 1329 BY DT 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3068  hydrog ? ? A  DA 1329 N6 ? ? ? 1_555 KC DT 44   O4 ? ? AA DA 1329 BY DT 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3069  hydrog ? ? A  DG 1330 N1 ? ? ? 1_555 KC DC 43   N3 ? ? AA DG 1330 BY DC 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3070  hydrog ? ? A  DG 1330 N2 ? ? ? 1_555 KC DC 43   O2 ? ? AA DG 1330 BY DC 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3071  hydrog ? ? A  DG 1330 O6 ? ? ? 1_555 KC DC 43   N4 ? ? AA DG 1330 BY DC 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3072  hydrog ? ? A  DG 1331 N1 ? ? ? 1_555 GC DC 53   N3 ? ? AA DG 1331 BU DC 53   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3073  hydrog ? ? A  DG 1331 N2 ? ? ? 1_555 GC DC 53   O2 ? ? AA DG 1331 BU DC 53   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3074  hydrog ? ? A  DG 1331 O6 ? ? ? 1_555 GC DC 53   N4 ? ? AA DG 1331 BU DC 53   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3075  hydrog ? ? A  DC 1332 N3 ? ? ? 1_555 GC DG 52   N1 ? ? AA DC 1332 BU DG 52   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3076  hydrog ? ? A  DC 1332 N4 ? ? ? 1_555 GC DG 52   O6 ? ? AA DC 1332 BU DG 52   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3077  hydrog ? ? A  DC 1332 O2 ? ? ? 1_555 GC DG 52   N2 ? ? AA DC 1332 BU DG 52   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3078  hydrog ? ? A  DA 1333 N1 ? ? ? 1_555 GC DT 51   N3 ? ? AA DA 1333 BU DT 51   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3079  hydrog ? ? A  DA 1333 N6 ? ? ? 1_555 GC DT 51   O4 ? ? AA DA 1333 BU DT 51   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3080  hydrog ? ? A  DT 1334 N3 ? ? ? 1_555 GC DA 50   N1 ? ? AA DT 1334 BU DA 50   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3081  hydrog ? ? A  DT 1335 N3 ? ? ? 1_555 GC DA 49   N1 ? ? AA DT 1335 BU DA 49   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3082  hydrog ? ? A  DG 1336 N1 ? ? ? 1_555 GC DC 48   N3 ? ? AA DG 1336 BU DC 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3083  hydrog ? ? A  DG 1336 N2 ? ? ? 1_555 GC DC 48   O2 ? ? AA DG 1336 BU DC 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3084  hydrog ? ? A  DG 1336 O6 ? ? ? 1_555 GC DC 48   N4 ? ? AA DG 1336 BU DC 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3085  hydrog ? ? A  DC 1337 N3 ? ? ? 1_555 GC DG 47   N1 ? ? AA DC 1337 BU DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3086  hydrog ? ? A  DC 1337 N4 ? ? ? 1_555 GC DG 47   O6 ? ? AA DC 1337 BU DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3087  hydrog ? ? A  DC 1337 O2 ? ? ? 1_555 GC DG 47   N2 ? ? AA DC 1337 BU DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3088  hydrog ? ? A  DA 1338 N1 ? ? ? 1_555 GC DT 46   N3 ? ? AA DA 1338 BU DT 46   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3089  hydrog ? ? A  DT 1339 N3 ? ? ? 1_555 YB DA 2    N1 ? ? AA DT 1339 BM DA 2    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3090  hydrog ? ? A  DT 1340 N3 ? ? ? 1_555 YB DA 1    N1 ? ? AA DT 1340 BM DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3091  hydrog ? ? A  DT 1340 O4 ? ? ? 1_555 YB DA 1    N6 ? ? AA DT 1340 BM DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3092  hydrog ? ? A  DT 1341 N3 ? ? ? 1_555 UB DA 32   N1 ? ? AA DT 1341 BI DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3093  hydrog ? ? A  DT 1341 O4 ? ? ? 1_555 UB DA 32   N6 ? ? AA DT 1341 BI DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3094  hydrog ? ? A  DA 1342 N1 ? ? ? 1_555 UB DT 31   N3 ? ? AA DA 1342 BI DT 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3095  hydrog ? ? A  DA 1342 N6 ? ? ? 1_555 UB DT 31   O4 ? ? AA DA 1342 BI DT 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3096  hydrog ? ? A  DA 1343 N1 ? ? ? 1_555 UB DT 30   N3 ? ? AA DA 1343 BI DT 40   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3097  hydrog ? ? A  DA 1344 N1 ? ? ? 1_555 UB DT 29   N3 ? ? AA DA 1344 BI DT 39   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3098  hydrog ? ? A  DA 1345 N1 ? ? ? 1_555 UB DT 28   N3 ? ? AA DA 1345 BI DT 38   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3099  hydrog ? ? A  DT 1346 N3 ? ? ? 1_555 UB DA 27   N1 ? ? AA DT 1346 BI DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3100  hydrog ? ? A  DT 1346 O4 ? ? ? 1_555 UB DA 27   N6 ? ? AA DT 1346 BI DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3101  hydrog ? ? A  DA 1347 N1 ? ? ? 1_555 UB DT 26   N3 ? ? AA DA 1347 BI DT 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3102  hydrog ? ? A  DA 1347 N6 ? ? ? 1_555 UB DT 26   O4 ? ? AA DA 1347 BI DT 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3103  hydrog ? ? A  DT 1348 N3 ? ? ? 1_555 UB DA 25   N1 ? ? AA DT 1348 BI DA 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3104  hydrog ? ? A  DT 1348 O4 ? ? ? 1_555 UB DA 25   N6 ? ? AA DT 1348 BI DA 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3105  hydrog ? ? A  DA 1349 N1 ? ? ? 1_555 UB DT 24   N3 ? ? AA DA 1349 BI DT 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3106  hydrog ? ? A  DA 1349 N6 ? ? ? 1_555 UB DT 24   O4 ? ? AA DA 1349 BI DT 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3107  hydrog ? ? A  DT 1350 N3 ? ? ? 1_555 UB DA 23   N1 ? ? AA DT 1350 BI DA 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3108  hydrog ? ? A  DT 1350 O4 ? ? ? 1_555 UB DA 23   N6 ? ? AA DT 1350 BI DA 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3109  hydrog ? ? A  DG 1351 N1 ? ? ? 1_555 UB DC 22   N3 ? ? AA DG 1351 BI DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3110  hydrog ? ? A  DG 1351 N2 ? ? ? 1_555 UB DC 22   O2 ? ? AA DG 1351 BI DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3111  hydrog ? ? A  DG 1351 O6 ? ? ? 1_555 UB DC 22   N4 ? ? AA DG 1351 BI DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3112  hydrog ? ? A  DA 1352 N1 ? ? ? 1_555 UB DT 21   N3 ? ? AA DA 1352 BI DT 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3113  hydrog ? ? A  DA 1352 N6 ? ? ? 1_555 UB DT 21   O4 ? ? AA DA 1352 BI DT 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3114  hydrog ? ? A  DG 1353 N1 ? ? ? 1_555 UB DC 20   N3 ? ? AA DG 1353 BI DC 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3115  hydrog ? ? A  DG 1353 N2 ? ? ? 1_555 UB DC 20   O2 ? ? AA DG 1353 BI DC 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3116  hydrog ? ? A  DG 1353 O6 ? ? ? 1_555 UB DC 20   N4 ? ? AA DG 1353 BI DC 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3117  hydrog ? ? A  DG 1354 N1 ? ? ? 1_555 UB DC 19   N3 ? ? AA DG 1354 BI DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3118  hydrog ? ? A  DG 1354 N2 ? ? ? 1_555 UB DC 19   O2 ? ? AA DG 1354 BI DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3119  hydrog ? ? A  DG 1354 O6 ? ? ? 1_555 UB DC 19   N4 ? ? AA DG 1354 BI DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3120  hydrog ? ? A  DG 1355 N1 ? ? ? 1_555 LE DC 6    N3 ? ? AA DG 1355 CY DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3121  hydrog ? ? A  DG 1355 N2 ? ? ? 1_555 LE DC 6    O2 ? ? AA DG 1355 CY DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3122  hydrog ? ? A  DG 1355 O6 ? ? ? 1_555 LE DC 6    N4 ? ? AA DG 1355 CY DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3123  hydrog ? ? A  DT 1356 N3 ? ? ? 1_555 LE DA 5    N1 ? ? AA DT 1356 CY DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3124  hydrog ? ? A  DT 1356 O4 ? ? ? 1_555 LE DA 5    N6 ? ? AA DT 1356 CY DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3125  hydrog ? ? A  DT 1357 N3 ? ? ? 1_555 LE DA 4    N1 ? ? AA DT 1357 CY DA 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3126  hydrog ? ? A  DT 1357 O4 ? ? ? 1_555 LE DA 4    N6 ? ? AA DT 1357 CY DA 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3127  hydrog ? ? A  DC 1358 N3 ? ? ? 1_555 LE DG 3    N1 ? ? AA DC 1358 CY DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3128  hydrog ? ? A  DC 1358 N4 ? ? ? 1_555 LE DG 3    O6 ? ? AA DC 1358 CY DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3129  hydrog ? ? A  DC 1358 O2 ? ? ? 1_555 LE DG 3    N2 ? ? AA DC 1358 CY DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3130  hydrog ? ? A  DT 1359 N3 ? ? ? 1_555 LE DA 2    N1 ? ? AA DT 1359 CY DA 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3131  hydrog ? ? A  DT 1359 O4 ? ? ? 1_555 LE DA 2    N6 ? ? AA DT 1359 CY DA 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3132  hydrog ? ? A  DA 1360 N1 ? ? ? 1_555 LE DT 1    N3 ? ? AA DA 1360 CY DT 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3133  hydrog ? ? A  DA 1360 N6 ? ? ? 1_555 LE DT 1    O4 ? ? AA DA 1360 CY DT 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3134  hydrog ? ? A  DA 1361 N1 ? ? ? 1_555 GC DT 55   N3 ? ? AA DA 1361 BU DT 55   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3135  hydrog ? ? A  DA 1361 N6 ? ? ? 1_555 GC DT 55   O4 ? ? AA DA 1361 BU DT 55   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3136  hydrog ? ? A  DA 1362 N1 ? ? ? 1_555 GC DT 54   N3 ? ? AA DA 1362 BU DT 54   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3137  hydrog ? ? A  DA 1362 N6 ? ? ? 1_555 GC DT 54   O4 ? ? AA DA 1362 BU DT 54   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3138  hydrog ? ? A  DA 1363 N1 ? ? ? 1_555 KC DT 42   N3 ? ? AA DA 1363 BY DT 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3139  hydrog ? ? A  DA 1363 N6 ? ? ? 1_555 KC DT 42   O4 ? ? AA DA 1363 BY DT 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3140  hydrog ? ? A  DA 1364 N1 ? ? ? 1_555 KC DT 41   N3 ? ? AA DA 1364 BY DT 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3141  hydrog ? ? A  DA 1364 N6 ? ? ? 1_555 KC DT 41   O4 ? ? AA DA 1364 BY DT 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3142  hydrog ? ? A  DT 1365 N3 ? ? ? 1_555 KC DA 40   N1 ? ? AA DT 1365 BY DA 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3143  hydrog ? ? A  DT 1365 O4 ? ? ? 1_555 KC DA 40   N6 ? ? AA DT 1365 BY DA 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3144  hydrog ? ? A  DT 1366 N3 ? ? ? 1_555 KC DA 39   N1 ? ? AA DT 1366 BY DA 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3145  hydrog ? ? A  DT 1366 O4 ? ? ? 1_555 KC DA 39   N6 ? ? AA DT 1366 BY DA 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3146  hydrog ? ? A  DT 1367 N3 ? ? ? 1_555 KC DA 38   N1 ? ? AA DT 1367 BY DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3147  hydrog ? ? A  DT 1367 O4 ? ? ? 1_555 KC DA 38   N6 ? ? AA DT 1367 BY DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3148  hydrog ? ? A  DT 1368 N3 ? ? ? 1_555 KC DA 37   N1 ? ? AA DT 1368 BY DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3149  hydrog ? ? A  DT 1368 O4 ? ? ? 1_555 KC DA 37   N6 ? ? AA DT 1368 BY DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3150  hydrog ? ? A  DT 1369 N3 ? ? ? 1_555 KC DA 36   N1 ? ? AA DT 1369 BY DA 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3151  hydrog ? ? A  DT 1369 O4 ? ? ? 1_555 KC DA 36   N6 ? ? AA DT 1369 BY DA 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3152  hydrog ? ? A  DA 1370 N1 ? ? ? 1_555 KC DT 35   N3 ? ? AA DA 1370 BY DT 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3153  hydrog ? ? A  DA 1370 N6 ? ? ? 1_555 KC DT 35   O4 ? ? AA DA 1370 BY DT 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3154  hydrog ? ? A  DT 1371 N3 ? ? ? 1_555 WB DA 30   N1 ? ? AA DT 1371 BK DA 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3155  hydrog ? ? A  DT 1371 O4 ? ? ? 1_555 WB DA 30   N6 ? ? AA DT 1371 BK DA 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3156  hydrog ? ? A  DC 1372 N3 ? ? ? 1_555 WB DG 29   N1 ? ? AA DC 1372 BK DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3157  hydrog ? ? A  DC 1372 N4 ? ? ? 1_555 WB DG 29   O6 ? ? AA DC 1372 BK DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3158  hydrog ? ? A  DC 1372 O2 ? ? ? 1_555 WB DG 29   N2 ? ? AA DC 1372 BK DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3159  hydrog ? ? A  DC 1373 N3 ? ? ? 1_555 WB DG 28   N1 ? ? AA DC 1373 BK DG 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3160  hydrog ? ? A  DC 1373 N4 ? ? ? 1_555 WB DG 28   O6 ? ? AA DC 1373 BK DG 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3161  hydrog ? ? A  DC 1373 O2 ? ? ? 1_555 WB DG 28   N2 ? ? AA DC 1373 BK DG 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3162  hydrog ? ? A  DT 1374 N3 ? ? ? 1_555 WB DA 27   N1 ? ? AA DT 1374 BK DA 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3163  hydrog ? ? A  DT 1374 O4 ? ? ? 1_555 WB DA 27   N6 ? ? AA DT 1374 BK DA 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3164  hydrog ? ? A  DT 1375 N3 ? ? ? 1_555 WB DA 26   N1 ? ? AA DT 1375 BK DA 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3165  hydrog ? ? A  DT 1375 O4 ? ? ? 1_555 WB DA 26   N6 ? ? AA DT 1375 BK DA 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3166  hydrog ? ? A  DG 1376 N1 ? ? ? 1_555 WB DC 25   N3 ? ? AA DG 1376 BK DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3167  hydrog ? ? A  DG 1376 N2 ? ? ? 1_555 WB DC 25   O2 ? ? AA DG 1376 BK DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3168  hydrog ? ? A  DG 1376 O6 ? ? ? 1_555 WB DC 25   N4 ? ? AA DG 1376 BK DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3169  hydrog ? ? A  DC 1377 N3 ? ? ? 1_555 WB DG 24   N1 ? ? AA DC 1377 BK DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3170  hydrog ? ? A  DC 1377 N4 ? ? ? 1_555 WB DG 24   O6 ? ? AA DC 1377 BK DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3171  hydrog ? ? A  DC 1377 O2 ? ? ? 1_555 WB DG 24   N2 ? ? AA DC 1377 BK DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3172  hydrog ? ? A  DG 1378 N1 ? ? ? 1_555 WB DC 23   N3 ? ? AA DG 1378 BK DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3173  hydrog ? ? A  DG 1378 N2 ? ? ? 1_555 WB DC 23   O2 ? ? AA DG 1378 BK DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3174  hydrog ? ? A  DG 1378 O6 ? ? ? 1_555 WB DC 23   N4 ? ? AA DG 1378 BK DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3175  hydrog ? ? A  DT 1379 N3 ? ? ? 1_555 RB DA 30   N1 ? ? AA DT 1379 BF DA 30   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3176  hydrog ? ? A  DT 1380 N3 ? ? ? 1_555 RB DA 29   N1 ? ? AA DT 1380 BF DA 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3177  hydrog ? ? A  DT 1380 O4 ? ? ? 1_555 RB DA 29   N6 ? ? AA DT 1380 BF DA 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3178  hydrog ? ? A  DG 1381 N1 ? ? ? 1_555 RB DC 28   N3 ? ? AA DG 1381 BF DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3179  hydrog ? ? A  DG 1381 N2 ? ? ? 1_555 RB DC 28   O2 ? ? AA DG 1381 BF DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3180  hydrog ? ? A  DG 1381 O6 ? ? ? 1_555 RB DC 28   N4 ? ? AA DG 1381 BF DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3181  hydrog ? ? A  DA 1382 N1 ? ? ? 1_555 RB DT 27   N3 ? ? AA DA 1382 BF DT 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3182  hydrog ? ? A  DA 1382 N6 ? ? ? 1_555 RB DT 27   O4 ? ? AA DA 1382 BF DT 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3183  hydrog ? ? A  DA 1383 N1 ? ? ? 1_555 RB DT 26   N3 ? ? AA DA 1383 BF DT 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3184  hydrog ? ? A  DA 1383 N6 ? ? ? 1_555 RB DT 26   O4 ? ? AA DA 1383 BF DT 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3185  hydrog ? ? A  DA 1384 N1 ? ? ? 1_555 RB DT 25   N3 ? ? AA DA 1384 BF DT 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3186  hydrog ? ? A  DA 1384 N6 ? ? ? 1_555 RB DT 25   O4 ? ? AA DA 1384 BF DT 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3187  hydrog ? ? A  DT 1385 N3 ? ? ? 1_555 RB DA 24   N1 ? ? AA DT 1385 BF DA 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3188  hydrog ? ? A  DT 1385 O4 ? ? ? 1_555 RB DA 24   N6 ? ? AA DT 1385 BF DA 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3189  hydrog ? ? A  DA 1386 N1 ? ? ? 1_555 RB DT 23   N3 ? ? AA DA 1386 BF DT 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3190  hydrog ? ? A  DA 1386 N6 ? ? ? 1_555 RB DT 23   O4 ? ? AA DA 1386 BF DT 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3191  hydrog ? ? A  DA 1388 N1 ? ? ? 1_555 BE DT 21   N3 ? ? AA DA 1388 CO DT 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3192  hydrog ? ? A  DA 1388 N6 ? ? ? 1_555 BE DT 21   O4 ? ? AA DA 1388 CO DT 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3193  hydrog ? ? A  DG 1389 N1 ? ? ? 1_555 BE DC 20   N3 ? ? AA DG 1389 CO DC 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3194  hydrog ? ? A  DG 1389 N2 ? ? ? 1_555 BE DC 20   O2 ? ? AA DG 1389 CO DC 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3195  hydrog ? ? A  DG 1389 O6 ? ? ? 1_555 BE DC 20   N4 ? ? AA DG 1389 CO DC 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3196  hydrog ? ? A  DG 1390 N1 ? ? ? 1_555 BE DC 19   N3 ? ? AA DG 1390 CO DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3197  hydrog ? ? A  DG 1390 N2 ? ? ? 1_555 BE DC 19   O2 ? ? AA DG 1390 CO DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3198  hydrog ? ? A  DG 1390 O6 ? ? ? 1_555 BE DC 19   N4 ? ? AA DG 1390 CO DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3199  hydrog ? ? A  DC 1391 N3 ? ? ? 1_555 BE DG 18   N1 ? ? AA DC 1391 CO DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3200  hydrog ? ? A  DC 1391 N4 ? ? ? 1_555 BE DG 18   O6 ? ? AA DC 1391 CO DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3201  hydrog ? ? A  DC 1391 O2 ? ? ? 1_555 BE DG 18   N2 ? ? AA DC 1391 CO DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3202  hydrog ? ? A  DT 1392 N3 ? ? ? 1_555 BE DA 17   N1 ? ? AA DT 1392 CO DA 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3203  hydrog ? ? A  DT 1392 O4 ? ? ? 1_555 BE DA 17   N6 ? ? AA DT 1392 CO DA 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3204  hydrog ? ? A  DT 1393 N3 ? ? ? 1_555 BE DA 16   N1 ? ? AA DT 1393 CO DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3205  hydrog ? ? A  DT 1393 O4 ? ? ? 1_555 BE DA 16   N6 ? ? AA DT 1393 CO DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3206  hydrog ? ? A  DC 1394 N3 ? ? ? 1_555 BE DG 15   N1 ? ? AA DC 1394 CO DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3207  hydrog ? ? A  DC 1394 N4 ? ? ? 1_555 BE DG 15   O6 ? ? AA DC 1394 CO DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3208  hydrog ? ? A  DC 1394 O2 ? ? ? 1_555 BE DG 15   N2 ? ? AA DC 1394 CO DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3209  hydrog ? ? A  DT 1395 N3 ? ? ? 1_555 ME DA 2    N1 ? ? AA DT 1395 CZ DA 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3210  hydrog ? ? A  DT 1395 O4 ? ? ? 1_555 ME DA 2    N6 ? ? AA DT 1395 CZ DA 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3211  hydrog ? ? A  DC 1396 N3 ? ? ? 1_555 ME DG 1    N1 ? ? AA DC 1396 CZ DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3212  hydrog ? ? A  DC 1396 N4 ? ? ? 1_555 ME DG 1    O6 ? ? AA DC 1396 CZ DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3213  hydrog ? ? A  DC 1396 O2 ? ? ? 1_555 ME DG 1    N2 ? ? AA DC 1396 CZ DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3214  hydrog ? ? A  DC 1397 N3 ? ? ? 1_555 DB DG 48   N1 ? ? AA DC 1397 B0 DG 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3215  hydrog ? ? A  DC 1397 N4 ? ? ? 1_555 DB DG 48   O6 ? ? AA DC 1397 B0 DG 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3216  hydrog ? ? A  DC 1397 O2 ? ? ? 1_555 DB DG 48   N2 ? ? AA DC 1397 B0 DG 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3217  hydrog ? ? A  DC 1398 N3 ? ? ? 1_555 DB DG 47   N1 ? ? AA DC 1398 B0 DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3218  hydrog ? ? A  DC 1398 N4 ? ? ? 1_555 DB DG 47   O6 ? ? AA DC 1398 B0 DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3219  hydrog ? ? A  DC 1398 O2 ? ? ? 1_555 DB DG 47   N2 ? ? AA DC 1398 B0 DG 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3220  hydrog ? ? A  DG 1399 N1 ? ? ? 1_555 DB DC 46   N3 ? ? AA DG 1399 B0 DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3221  hydrog ? ? A  DG 1399 N2 ? ? ? 1_555 DB DC 46   O2 ? ? AA DG 1399 B0 DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3222  hydrog ? ? A  DG 1399 O6 ? ? ? 1_555 DB DC 46   N4 ? ? AA DG 1399 B0 DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3223  hydrog ? ? A  DC 1400 N3 ? ? ? 1_555 DB DG 45   N1 ? ? AA DC 1400 B0 DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3224  hydrog ? ? A  DC 1400 N4 ? ? ? 1_555 DB DG 45   O6 ? ? AA DC 1400 B0 DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3225  hydrog ? ? A  DC 1400 O2 ? ? ? 1_555 DB DG 45   N2 ? ? AA DC 1400 B0 DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3226  hydrog ? ? A  DA 1401 N1 ? ? ? 1_555 DB DT 44   N3 ? ? AA DA 1401 B0 DT 44   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3227  hydrog ? ? A  DA 1402 N1 ? ? ? 1_555 DB DT 43   N3 ? ? AA DA 1402 B0 DT 43   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3228  hydrog ? ? A  DA 1403 N1 ? ? ? 1_555 RD DT 38   N3 ? ? AA DA 1403 CE DT 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3229  hydrog ? ? A  DA 1403 N6 ? ? ? 1_555 RD DT 38   O4 ? ? AA DA 1403 CE DT 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3230  hydrog ? ? A  DA 1404 N1 ? ? ? 1_555 RD DT 37   N3 ? ? AA DA 1404 CE DT 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3231  hydrog ? ? A  DA 1404 N6 ? ? ? 1_555 RD DT 37   O4 ? ? AA DA 1404 CE DT 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3232  hydrog ? ? A  DG 1405 N1 ? ? ? 1_555 RD DC 36   N3 ? ? AA DG 1405 CE DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3233  hydrog ? ? A  DG 1405 N2 ? ? ? 1_555 RD DC 36   O2 ? ? AA DG 1405 CE DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3234  hydrog ? ? A  DG 1405 O6 ? ? ? 1_555 RD DC 36   N4 ? ? AA DG 1405 CE DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3235  hydrog ? ? A  DT 1406 N3 ? ? ? 1_555 RD DA 35   N1 ? ? AA DT 1406 CE DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3236  hydrog ? ? A  DT 1406 O4 ? ? ? 1_555 RD DA 35   N6 ? ? AA DT 1406 CE DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3237  hydrog ? ? A  DA 1407 N1 ? ? ? 1_555 RD DT 34   N3 ? ? AA DA 1407 CE DT 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3238  hydrog ? ? A  DA 1407 N6 ? ? ? 1_555 RD DT 34   O4 ? ? AA DA 1407 CE DT 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3239  hydrog ? ? A  DT 1408 N3 ? ? ? 1_555 RD DA 33   N1 ? ? AA DT 1408 CE DA 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3240  hydrog ? ? A  DT 1408 O4 ? ? ? 1_555 RD DA 33   N6 ? ? AA DT 1408 CE DA 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3241  hydrog ? ? A  DT 1409 N3 ? ? ? 1_555 RD DA 32   N1 ? ? AA DT 1409 CE DA 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3242  hydrog ? ? A  DT 1409 O4 ? ? ? 1_555 RD DA 32   N6 ? ? AA DT 1409 CE DA 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3243  hydrog ? ? A  DA 1410 N1 ? ? ? 1_555 RD DT 31   N3 ? ? AA DA 1410 CE DT 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3244  hydrog ? ? A  DA 1410 N6 ? ? ? 1_555 RD DT 31   O4 ? ? AA DA 1410 CE DT 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3245  hydrog ? ? A  DC 1411 N3 ? ? ? 1_555 VB DG 10   N1 ? ? AA DC 1411 BJ DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3246  hydrog ? ? A  DC 1411 N4 ? ? ? 1_555 VB DG 10   O6 ? ? AA DC 1411 BJ DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3247  hydrog ? ? A  DC 1411 O2 ? ? ? 1_555 VB DG 10   N2 ? ? AA DC 1411 BJ DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3248  hydrog ? ? A  DA 1412 N1 ? ? ? 1_555 VB DT 9    N3 ? ? AA DA 1412 BJ DT 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3249  hydrog ? ? A  DA 1412 N6 ? ? ? 1_555 VB DT 9    O4 ? ? AA DA 1412 BJ DT 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3250  hydrog ? ? A  DG 1413 N1 ? ? ? 1_555 VB DC 8    N3 ? ? AA DG 1413 BJ DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3251  hydrog ? ? A  DG 1413 N2 ? ? ? 1_555 VB DC 8    O2 ? ? AA DG 1413 BJ DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3252  hydrog ? ? A  DG 1413 O6 ? ? ? 1_555 VB DC 8    N4 ? ? AA DG 1413 BJ DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3253  hydrog ? ? A  DG 1414 N1 ? ? ? 1_555 VB DC 7    N3 ? ? AA DG 1414 BJ DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3254  hydrog ? ? A  DG 1414 N2 ? ? ? 1_555 VB DC 7    O2 ? ? AA DG 1414 BJ DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3255  hydrog ? ? A  DG 1414 O6 ? ? ? 1_555 VB DC 7    N4 ? ? AA DG 1414 BJ DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3256  hydrog ? ? A  DG 1415 N1 ? ? ? 1_555 VB DC 6    N3 ? ? AA DG 1415 BJ DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3257  hydrog ? ? A  DG 1415 N2 ? ? ? 1_555 VB DC 6    O2 ? ? AA DG 1415 BJ DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3258  hydrog ? ? A  DG 1415 O6 ? ? ? 1_555 VB DC 6    N4 ? ? AA DG 1415 BJ DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3259  hydrog ? ? A  DT 1416 N3 ? ? ? 1_555 VB DA 5    N1 ? ? AA DT 1416 BJ DA 5    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3260  hydrog ? ? A  DC 1417 N3 ? ? ? 1_555 VB DG 4    N1 ? ? AA DC 1417 BJ DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3261  hydrog ? ? A  DC 1417 N4 ? ? ? 1_555 VB DG 4    O6 ? ? AA DC 1417 BJ DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3262  hydrog ? ? A  DC 1417 O2 ? ? ? 1_555 VB DG 4    N2 ? ? AA DC 1417 BJ DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3263  hydrog ? ? A  DA 1418 N1 ? ? ? 1_555 VB DT 3    N3 ? ? AA DA 1418 BJ DT 3    1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3264  hydrog ? ? A  DT 1419 N3 ? ? ? 1_555 NE DA 2    N1 ? ? AA DT 1419 Cb DA 2    1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' 
? ? 
hydrog3265  hydrog ? ? A  DT 1419 O2 ? ? ? 1_555 NE DA 2    N6 ? ? AA DT 1419 Cb DA 2    1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' 
? ? 
hydrog3266  hydrog ? ? A  DA 1420 N1 ? ? ? 1_555 NE DT 1    N3 ? ? AA DA 1420 Cb DT 1    1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3267  hydrog ? ? A  DA 1420 N3 ? ? ? 1_555 NE DA 2    N6 ? ? AA DA 1420 Cb DA 2    1_555 ? ? ? ? ? ? 'DA-DA MISPAIR'         
? ? 
hydrog3268  hydrog ? ? A  DA 1421 N1 ? ? ? 1_555 LC DT 66   N3 ? ? AA DA 1421 BZ DT 66   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3269  hydrog ? ? A  DA 1421 N6 ? ? ? 1_555 LC DT 66   O4 ? ? AA DA 1421 BZ DT 66   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3270  hydrog ? ? A  DT 1422 N3 ? ? ? 1_555 LC DA 65   N1 ? ? AA DT 1422 BZ DA 65   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3271  hydrog ? ? A  DG 1423 N2 ? ? ? 1_555 LC DC 64   O2 ? ? AA DG 1423 BZ DC 64   1_555 ? ? ? ? ? ? 'DG-DC PAIR'            
? ? 
hydrog3272  hydrog ? ? A  DT 1424 N3 ? ? ? 1_555 LC DA 63   N1 ? ? AA DT 1424 BZ DA 63   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3273  hydrog ? ? A  DT 1425 N3 ? ? ? 1_555 LC DA 62   N1 ? ? AA DT 1425 BZ DA 62   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3274  hydrog ? ? A  DT 1425 O4 ? ? ? 1_555 LC DA 62   N6 ? ? AA DT 1425 BZ DA 62   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3275  hydrog ? ? A  DT 1426 N3 ? ? ? 1_555 LC DA 61   N1 ? ? AA DT 1426 BZ DA 61   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3276  hydrog ? ? A  DT 1426 O4 ? ? ? 1_555 LC DA 61   N6 ? ? AA DT 1426 BZ DA 61   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3277  hydrog ? ? A  DT 1427 N3 ? ? ? 1_555 ZB DA 21   N1 ? ? AA DT 1427 BN DA 21   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3278  hydrog ? ? A  DT 1428 N3 ? ? ? 1_555 ZB DA 20   N1 ? ? AA DT 1428 BN DA 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3279  hydrog ? ? A  DT 1428 O4 ? ? ? 1_555 ZB DA 20   N6 ? ? AA DT 1428 BN DA 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3280  hydrog ? ? A  DG 1429 N1 ? ? ? 1_555 ZB DC 19   N3 ? ? AA DG 1429 BN DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3281  hydrog ? ? A  DG 1429 N2 ? ? ? 1_555 ZB DC 19   O2 ? ? AA DG 1429 BN DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3282  hydrog ? ? A  DG 1429 O6 ? ? ? 1_555 ZB DC 19   N4 ? ? AA DG 1429 BN DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3283  hydrog ? ? A  DG 1430 N1 ? ? ? 1_555 ZB DC 18   N3 ? ? AA DG 1430 BN DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3284  hydrog ? ? A  DG 1430 N2 ? ? ? 1_555 ZB DC 18   O2 ? ? AA DG 1430 BN DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3285  hydrog ? ? A  DG 1430 O6 ? ? ? 1_555 ZB DC 18   N4 ? ? AA DG 1430 BN DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3286  hydrog ? ? A  DT 1431 N3 ? ? ? 1_555 ZB DA 17   N1 ? ? AA DT 1431 BN DA 17   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3287  hydrog ? ? A  DA 1432 N1 ? ? ? 1_555 ZB DT 16   N3 ? ? AA DA 1432 BN DT 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3288  hydrog ? ? A  DA 1432 N6 ? ? ? 1_555 ZB DT 16   O4 ? ? AA DA 1432 BN DT 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3289  hydrog ? ? A  DC 1433 N3 ? ? ? 1_555 ZB DG 15   N1 ? ? AA DC 1433 BN DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3290  hydrog ? ? A  DC 1433 N4 ? ? ? 1_555 ZB DG 15   O6 ? ? AA DC 1433 BN DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3291  hydrog ? ? A  DC 1433 O2 ? ? ? 1_555 ZB DG 15   N2 ? ? AA DC 1433 BN DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3292  hydrog ? ? A  DA 1434 N1 ? ? ? 1_555 ZB DT 14   N3 ? ? AA DA 1434 BN DT 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3293  hydrog ? ? A  DA 1434 N6 ? ? ? 1_555 ZB DT 14   O4 ? ? AA DA 1434 BN DT 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3294  hydrog ? ? A  DA 1435 N1 ? ? ? 1_555 VB DT 18   N3 ? ? AA DA 1435 BJ DT 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3295  hydrog ? ? A  DA 1435 N6 ? ? ? 1_555 VB DT 18   O4 ? ? AA DA 1435 BJ DT 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3296  hydrog ? ? A  DC 1436 N3 ? ? ? 1_555 VB DG 17   N1 ? ? AA DC 1436 BJ DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3297  hydrog ? ? A  DC 1436 N4 ? ? ? 1_555 VB DG 17   O6 ? ? AA DC 1436 BJ DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3298  hydrog ? ? A  DC 1436 O2 ? ? ? 1_555 VB DG 17   N2 ? ? AA DC 1436 BJ DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3299  hydrog ? ? A  DC 1437 N3 ? ? ? 1_555 VB DG 16   N1 ? ? AA DC 1437 BJ DG 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3300  hydrog ? ? A  DC 1437 N4 ? ? ? 1_555 VB DG 16   O6 ? ? AA DC 1437 BJ DG 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3301  hydrog ? ? A  DC 1437 O2 ? ? ? 1_555 VB DG 16   N2 ? ? AA DC 1437 BJ DG 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3302  hydrog ? ? A  DG 1438 N1 ? ? ? 1_555 VB DC 15   N3 ? ? AA DG 1438 BJ DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3303  hydrog ? ? A  DG 1438 N2 ? ? ? 1_555 VB DC 15   O2 ? ? AA DG 1438 BJ DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3304  hydrog ? ? A  DG 1438 O6 ? ? ? 1_555 VB DC 15   N4 ? ? AA DG 1438 BJ DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3305  hydrog ? ? A  DA 1439 N1 ? ? ? 1_555 VB DT 14   N3 ? ? AA DA 1439 BJ DT 14   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3306  hydrog ? ? A  DT 1440 N3 ? ? ? 1_555 VB DA 13   N1 ? ? AA DT 1440 BJ DA 13   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3307  hydrog ? ? A  DT 1441 N3 ? ? ? 1_555 VB DA 12   N1 ? ? AA DT 1441 BJ DA 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3308  hydrog ? ? A  DT 1441 O4 ? ? ? 1_555 VB DA 12   N6 ? ? AA DT 1441 BJ DA 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3309  hydrog ? ? A  DT 1442 N3 ? ? ? 1_555 VB DA 11   N1 ? ? AA DT 1442 BJ DA 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3310  hydrog ? ? A  DT 1442 O4 ? ? ? 1_555 VB DA 11   N6 ? ? AA DT 1442 BJ DA 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3311  hydrog ? ? A  DA 1443 N1 ? ? ? 1_555 RD DT 30   N3 ? ? AA DA 1443 CE DT 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3312  hydrog ? ? A  DA 1443 N6 ? ? ? 1_555 RD DT 30   O4 ? ? AA DA 1443 CE DT 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3313  hydrog ? ? A  DG 1444 N1 ? ? ? 1_555 RD DC 29   N3 ? ? AA DG 1444 CE DC 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3314  hydrog ? ? A  DG 1444 N2 ? ? ? 1_555 RD DC 29   O2 ? ? AA DG 1444 CE DC 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3315  hydrog ? ? A  DG 1444 O6 ? ? ? 1_555 RD DC 29   N4 ? ? AA DG 1444 CE DC 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3316  hydrog ? ? A  DC 1445 N3 ? ? ? 1_555 RD DG 28   N1 ? ? AA DC 1445 CE DG 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3317  hydrog ? ? A  DC 1445 N4 ? ? ? 1_555 RD DG 28   O6 ? ? AA DC 1445 CE DG 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3318  hydrog ? ? A  DC 1445 O2 ? ? ? 1_555 RD DG 28   N2 ? ? AA DC 1445 CE DG 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3319  hydrog ? ? A  DT 1446 N3 ? ? ? 1_555 RD DA 27   N1 ? ? AA DT 1446 CE DA 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3320  hydrog ? ? A  DT 1446 O4 ? ? ? 1_555 RD DA 27   N6 ? ? AA DT 1446 CE DA 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3321  hydrog ? ? A  DT 1447 N3 ? ? ? 1_555 RD DA 26   N1 ? ? AA DT 1447 CE DA 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3322  hydrog ? ? A  DT 1447 O4 ? ? ? 1_555 RD DA 26   N6 ? ? AA DT 1447 CE DA 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3323  hydrog ? ? A  DT 1448 N3 ? ? ? 1_555 RD DA 25   N1 ? ? AA DT 1448 CE DA 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3324  hydrog ? ? A  DT 1448 O4 ? ? ? 1_555 RD DA 25   N6 ? ? AA DT 1448 CE DA 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3325  hydrog ? ? A  DA 1449 N1 ? ? ? 1_555 RD DT 24   N3 ? ? AA DA 1449 CE DT 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3326  hydrog ? ? A  DA 1449 N6 ? ? ? 1_555 RD DT 24   O4 ? ? AA DA 1449 CE DT 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3327  hydrog ? ? A  DT 1450 N3 ? ? ? 1_555 RD DA 23   N1 ? ? AA DT 1450 CE DA 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3328  hydrog ? ? A  DT 1450 O4 ? ? ? 1_555 RD DA 23   N6 ? ? AA DT 1450 CE DA 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3329  hydrog ? ? A  DG 1451 N2 ? ? ? 1_555 XB DC 46   O2 ? ? AA DG 1451 BL DC 46   1_555 ? ? ? ? ? ? 'DG-DC PAIR'            
? ? 
hydrog3330  hydrog ? ? A  DC 1452 N3 ? ? ? 1_555 XB DG 45   N1 ? ? AA DC 1452 BL DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3331  hydrog ? ? A  DC 1452 N4 ? ? ? 1_555 XB DG 45   O6 ? ? AA DC 1452 BL DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3332  hydrog ? ? A  DC 1452 O2 ? ? ? 1_555 XB DG 45   N2 ? ? AA DC 1452 BL DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3333  hydrog ? ? A  DT 1453 N3 ? ? ? 1_555 XB DA 44   N1 ? ? AA DT 1453 BL DA 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3334  hydrog ? ? A  DT 1453 O4 ? ? ? 1_555 XB DA 44   N6 ? ? AA DT 1453 BL DA 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3335  hydrog ? ? A  DC 1454 N3 ? ? ? 1_555 XB DG 43   N1 ? ? AA DC 1454 BL DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3336  hydrog ? ? A  DC 1454 N4 ? ? ? 1_555 XB DG 43   O6 ? ? AA DC 1454 BL DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3337  hydrog ? ? A  DC 1454 O2 ? ? ? 1_555 XB DG 43   N2 ? ? AA DC 1454 BL DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3338  hydrog ? ? A  DT 1455 N3 ? ? ? 1_555 XB DA 42   N1 ? ? AA DT 1455 BL DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3339  hydrog ? ? A  DT 1455 O4 ? ? ? 1_555 XB DA 42   N6 ? ? AA DT 1455 BL DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3340  hydrog ? ? A  DG 1456 N1 ? ? ? 1_555 XB DC 41   N3 ? ? AA DG 1456 BL DC 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3341  hydrog ? ? A  DG 1456 N2 ? ? ? 1_555 XB DC 41   O2 ? ? AA DG 1456 BL DC 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3342  hydrog ? ? A  DG 1456 O6 ? ? ? 1_555 XB DC 41   N4 ? ? AA DG 1456 BL DC 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3343  hydrog ? ? A  DA 1457 N1 ? ? ? 1_555 XB DT 40   N3 ? ? AA DA 1457 BL DT 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3344  hydrog ? ? A  DA 1457 N6 ? ? ? 1_555 XB DT 40   O4 ? ? AA DA 1457 BL DT 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3345  hydrog ? ? A  DG 1458 N1 ? ? ? 1_555 XB DC 39   N3 ? ? AA DG 1458 BL DC 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3346  hydrog ? ? A  DG 1458 N2 ? ? ? 1_555 XB DC 39   O2 ? ? AA DG 1458 BL DC 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3347  hydrog ? ? A  DG 1458 O6 ? ? ? 1_555 XB DC 39   N4 ? ? AA DG 1458 BL DC 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3348  hydrog ? ? A  DG 1459 N1 ? ? ? 1_555 XD DC 14   N3 ? ? AA DG 1459 CK DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3349  hydrog ? ? A  DG 1459 N2 ? ? ? 1_555 XD DC 14   O2 ? ? AA DG 1459 CK DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3350  hydrog ? ? A  DG 1459 O6 ? ? ? 1_555 XD DC 14   N4 ? ? AA DG 1459 CK DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3351  hydrog ? ? A  DC 1460 N3 ? ? ? 1_555 XD DG 13   N1 ? ? AA DC 1460 CK DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3352  hydrog ? ? A  DC 1460 N4 ? ? ? 1_555 XD DG 13   O6 ? ? AA DC 1460 CK DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3353  hydrog ? ? A  DC 1460 O2 ? ? ? 1_555 XD DG 13   N2 ? ? AA DC 1460 CK DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3354  hydrog ? ? A  DT 1461 N3 ? ? ? 1_555 XD DA 12   N1 ? ? AA DT 1461 CK DA 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3355  hydrog ? ? A  DT 1461 O4 ? ? ? 1_555 XD DA 12   N6 ? ? AA DT 1461 CK DA 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3356  hydrog ? ? A  DT 1462 N3 ? ? ? 1_555 XD DA 11   N1 ? ? AA DT 1462 CK DA 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3357  hydrog ? ? A  DT 1462 O4 ? ? ? 1_555 XD DA 11   N6 ? ? AA DT 1462 CK DA 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3358  hydrog ? ? A  DT 1463 N3 ? ? ? 1_555 XD DA 10   N1 ? ? AA DT 1463 CK DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3359  hydrog ? ? A  DT 1463 O4 ? ? ? 1_555 XD DA 10   N6 ? ? AA DT 1463 CK DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3360  hydrog ? ? A  DA 1464 N1 ? ? ? 1_555 XD DT 9    N3 ? ? AA DA 1464 CK DT 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3361  hydrog ? ? A  DA 1464 N6 ? ? ? 1_555 XD DT 9    O4 ? ? AA DA 1464 CK DT 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3362  hydrog ? ? A  DT 1465 N3 ? ? ? 1_555 XD DA 8    N1 ? ? AA DT 1465 CK DA 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3363  hydrog ? ? A  DT 1465 O4 ? ? ? 1_555 XD DA 8    N6 ? ? AA DT 1465 CK DA 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3364  hydrog ? ? A  DT 1466 N3 ? ? ? 1_555 XD DA 7    N1 ? ? AA DT 1466 CK DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3365  hydrog ? ? A  DT 1466 O4 ? ? ? 1_555 XD DA 7    N6 ? ? AA DT 1466 CK DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3366  hydrog ? ? A  DG 1467 N1 ? ? ? 1_555 RB DC 38   N3 ? ? AA DG 1467 BF DC 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3367  hydrog ? ? A  DG 1467 N2 ? ? ? 1_555 RB DC 38   O2 ? ? AA DG 1467 BF DC 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3368  hydrog ? ? A  DG 1467 O6 ? ? ? 1_555 RB DC 38   N4 ? ? AA DG 1467 BF DC 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3369  hydrog ? ? A  DC 1468 N3 ? ? ? 1_555 RB DG 37   N1 ? ? AA DC 1468 BF DG 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3370  hydrog ? ? A  DC 1468 N4 ? ? ? 1_555 RB DG 37   O6 ? ? AA DC 1468 BF DG 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3371  hydrog ? ? A  DC 1468 O2 ? ? ? 1_555 RB DG 37   N2 ? ? AA DC 1468 BF DG 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3372  hydrog ? ? A  DT 1469 N3 ? ? ? 1_555 RB DA 36   N1 ? ? AA DT 1469 BF DA 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3373  hydrog ? ? A  DT 1469 O4 ? ? ? 1_555 RB DA 36   N6 ? ? AA DT 1469 BF DA 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3374  hydrog ? ? A  DT 1470 N3 ? ? ? 1_555 RB DA 35   N1 ? ? AA DT 1470 BF DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3375  hydrog ? ? A  DT 1470 O4 ? ? ? 1_555 RB DA 35   N6 ? ? AA DT 1470 BF DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3376  hydrog ? ? A  DA 1471 N1 ? ? ? 1_555 RB DT 34   N3 ? ? AA DA 1471 BF DT 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3377  hydrog ? ? A  DA 1471 N6 ? ? ? 1_555 RB DT 34   O4 ? ? AA DA 1471 BF DT 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3378  hydrog ? ? A  DA 1472 N1 ? ? ? 1_555 RB DT 33   N3 ? ? AA DA 1472 BF DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3379  hydrog ? ? A  DA 1472 N6 ? ? ? 1_555 RB DT 33   O4 ? ? AA DA 1472 BF DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3380  hydrog ? ? A  DT 1473 N3 ? ? ? 1_555 RB DA 32   N1 ? ? AA DT 1473 BF DA 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3381  hydrog ? ? A  DT 1473 O4 ? ? ? 1_555 RB DA 32   N6 ? ? AA DT 1473 BF DA 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3382  hydrog ? ? A  DT 1474 N3 ? ? ? 1_555 RB DA 31   N1 ? ? AA DT 1474 BF DA 31   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3383  hydrog ? ? A  DT 1475 N3 ? ? ? 1_555 WB DA 22   N1 ? ? AA DT 1475 BK DA 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3384  hydrog ? ? A  DT 1475 O4 ? ? ? 1_555 WB DA 22   N6 ? ? AA DT 1475 BK DA 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3385  hydrog ? ? A  DT 1476 N3 ? ? ? 1_555 WB DA 21   N1 ? ? AA DT 1476 BK DA 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3386  hydrog ? ? A  DT 1476 O4 ? ? ? 1_555 WB DA 21   N6 ? ? AA DT 1476 BK DA 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3387  hydrog ? ? A  DG 1477 N1 ? ? ? 1_555 WB DC 20   N3 ? ? AA DG 1477 BK DC 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3388  hydrog ? ? A  DG 1477 N2 ? ? ? 1_555 WB DC 20   O2 ? ? AA DG 1477 BK DC 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3389  hydrog ? ? A  DG 1477 O6 ? ? ? 1_555 WB DC 20   N4 ? ? AA DG 1477 BK DC 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3390  hydrog ? ? A  DC 1478 N3 ? ? ? 1_555 WB DG 19   N1 ? ? AA DC 1478 BK DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3391  hydrog ? ? A  DC 1478 N4 ? ? ? 1_555 WB DG 19   O6 ? ? AA DC 1478 BK DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3392  hydrog ? ? A  DC 1478 O2 ? ? ? 1_555 WB DG 19   N2 ? ? AA DC 1478 BK DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3393  hydrog ? ? A  DT 1479 N3 ? ? ? 1_555 WB DA 18   N1 ? ? AA DT 1479 BK DA 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3394  hydrog ? ? A  DT 1479 O4 ? ? ? 1_555 WB DA 18   N6 ? ? AA DT 1479 BK DA 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3395  hydrog ? ? A  DA 1480 N1 ? ? ? 1_555 WB DT 17   N3 ? ? AA DA 1480 BK DT 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3396  hydrog ? ? A  DA 1480 N6 ? ? ? 1_555 WB DT 17   O4 ? ? AA DA 1480 BK DT 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3397  hydrog ? ? A  DA 1481 N1 ? ? ? 1_555 WB DT 16   N3 ? ? AA DA 1481 BK DT 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3398  hydrog ? ? A  DA 1481 N6 ? ? ? 1_555 WB DT 16   O4 ? ? AA DA 1481 BK DT 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3399  hydrog ? ? A  DT 1482 N3 ? ? ? 1_555 WB DA 15   N1 ? ? AA DT 1482 BK DA 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3400  hydrog ? ? A  DT 1482 O4 ? ? ? 1_555 WB DA 15   N6 ? ? AA DT 1482 BK DA 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3401  hydrog ? ? A  DT 1483 N3 ? ? ? 1_555 QD DA 30   N1 ? ? AA DT 1483 CD DA 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3402  hydrog ? ? A  DT 1483 O4 ? ? ? 1_555 QD DA 30   N6 ? ? AA DT 1483 CD DA 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3403  hydrog ? ? A  DC 1484 N3 ? ? ? 1_555 QD DG 29   N1 ? ? AA DC 1484 CD DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3404  hydrog ? ? A  DC 1484 N4 ? ? ? 1_555 QD DG 29   O6 ? ? AA DC 1484 CD DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3405  hydrog ? ? A  DC 1484 O2 ? ? ? 1_555 QD DG 29   N2 ? ? AA DC 1484 CD DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3406  hydrog ? ? A  DT 1485 N3 ? ? ? 1_555 QD DA 28   N1 ? ? AA DT 1485 CD DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3407  hydrog ? ? A  DT 1485 O4 ? ? ? 1_555 QD DA 28   N6 ? ? AA DT 1485 CD DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3408  hydrog ? ? A  DT 1486 N3 ? ? ? 1_555 QD DA 27   N1 ? ? AA DT 1486 CD DA 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3409  hydrog ? ? A  DT 1486 O4 ? ? ? 1_555 QD DA 27   N6 ? ? AA DT 1486 CD DA 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3410  hydrog ? ? A  DT 1487 N3 ? ? ? 1_555 QD DA 26   N1 ? ? AA DT 1487 CD DA 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3411  hydrog ? ? A  DT 1487 O4 ? ? ? 1_555 QD DA 26   N6 ? ? AA DT 1487 CD DA 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3412  hydrog ? ? A  DG 1488 N1 ? ? ? 1_555 QD DC 25   N3 ? ? AA DG 1488 CD DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3413  hydrog ? ? A  DG 1488 N2 ? ? ? 1_555 QD DC 25   O2 ? ? AA DG 1488 CD DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3414  hydrog ? ? A  DG 1488 O6 ? ? ? 1_555 QD DC 25   N4 ? ? AA DG 1488 CD DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3415  hydrog ? ? A  DC 1489 N3 ? ? ? 1_555 QD DG 24   N1 ? ? AA DC 1489 CD DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3416  hydrog ? ? A  DC 1489 N4 ? ? ? 1_555 QD DG 24   O6 ? ? AA DC 1489 CD DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3417  hydrog ? ? A  DC 1489 O2 ? ? ? 1_555 QD DG 24   N2 ? ? AA DC 1489 CD DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3418  hydrog ? ? A  DC 1490 N3 ? ? ? 1_555 QD DG 23   N1 ? ? AA DC 1490 CD DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3419  hydrog ? ? A  DC 1490 N4 ? ? ? 1_555 QD DG 23   O6 ? ? AA DC 1490 CD DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3420  hydrog ? ? A  DC 1490 O2 ? ? ? 1_555 QD DG 23   N2 ? ? AA DC 1490 CD DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3421  hydrog ? ? A  DT 1491 N3 ? ? ? 1_555 YB DA 42   N1 ? ? AA DT 1491 BM DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3422  hydrog ? ? A  DT 1491 O4 ? ? ? 1_555 YB DA 42   N6 ? ? AA DT 1491 BM DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3423  hydrog ? ? A  DT 1492 N3 ? ? ? 1_555 YB DA 41   N1 ? ? AA DT 1492 BM DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3424  hydrog ? ? A  DT 1492 O4 ? ? ? 1_555 YB DA 41   N6 ? ? AA DT 1492 BM DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3425  hydrog ? ? A  DG 1493 N1 ? ? ? 1_555 YB DC 40   N3 ? ? AA DG 1493 BM DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3426  hydrog ? ? A  DG 1493 N2 ? ? ? 1_555 YB DC 40   O2 ? ? AA DG 1493 BM DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3427  hydrog ? ? A  DG 1493 O6 ? ? ? 1_555 YB DC 40   N4 ? ? AA DG 1493 BM DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3428  hydrog ? ? A  DC 1494 N3 ? ? ? 1_555 YB DG 39   N1 ? ? AA DC 1494 BM DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3429  hydrog ? ? A  DC 1494 N4 ? ? ? 1_555 YB DG 39   O6 ? ? AA DC 1494 BM DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3430  hydrog ? ? A  DC 1494 O2 ? ? ? 1_555 YB DG 39   N2 ? ? AA DC 1494 BM DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3431  hydrog ? ? A  DC 1495 N3 ? ? ? 1_555 YB DG 38   N1 ? ? AA DC 1495 BM DG 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3432  hydrog ? ? A  DC 1495 N4 ? ? ? 1_555 YB DG 38   O6 ? ? AA DC 1495 BM DG 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3433  hydrog ? ? A  DC 1495 O2 ? ? ? 1_555 YB DG 38   N2 ? ? AA DC 1495 BM DG 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3434  hydrog ? ? A  DT 1496 N3 ? ? ? 1_555 YB DA 37   N1 ? ? AA DT 1496 BM DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3435  hydrog ? ? A  DT 1496 O4 ? ? ? 1_555 YB DA 37   N6 ? ? AA DT 1496 BM DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3436  hydrog ? ? A  DG 1497 N1 ? ? ? 1_555 YB DC 36   N3 ? ? AA DG 1497 BM DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3437  hydrog ? ? A  DG 1497 N2 ? ? ? 1_555 YB DC 36   O2 ? ? AA DG 1497 BM DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3438  hydrog ? ? A  DG 1497 O6 ? ? ? 1_555 YB DC 36   N4 ? ? AA DG 1497 BM DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3439  hydrog ? ? A  DT 1498 N3 ? ? ? 1_555 YB DA 35   N1 ? ? AA DT 1498 BM DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3440  hydrog ? ? A  DT 1498 O4 ? ? ? 1_555 YB DA 35   N6 ? ? AA DT 1498 BM DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3441  hydrog ? ? A  DA 1499 N1 ? ? ? 1_555 EB DT 13   N3 ? ? AA DA 1499 B1 DT 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3442  hydrog ? ? A  DA 1499 N6 ? ? ? 1_555 EB DT 13   O4 ? ? AA DA 1499 B1 DT 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3443  hydrog ? ? A  DT 1500 N3 ? ? ? 1_555 EB DA 12   N1 ? ? AA DT 1500 B1 DA 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3444  hydrog ? ? A  DT 1500 O4 ? ? ? 1_555 EB DA 12   N6 ? ? AA DT 1500 B1 DA 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3445  hydrog ? ? A  DG 1501 N1 ? ? ? 1_555 EB DC 11   N3 ? ? AA DG 1501 B1 DC 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3446  hydrog ? ? A  DG 1501 N2 ? ? ? 1_555 EB DC 11   O2 ? ? AA DG 1501 B1 DC 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3447  hydrog ? ? A  DG 1501 O6 ? ? ? 1_555 EB DC 11   N4 ? ? AA DG 1501 B1 DC 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3448  hydrog ? ? A  DA 1502 N1 ? ? ? 1_555 EB DT 10   N3 ? ? AA DA 1502 B1 DT 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3449  hydrog ? ? A  DA 1502 N6 ? ? ? 1_555 EB DT 10   O4 ? ? AA DA 1502 B1 DT 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3450  hydrog ? ? A  DT 1503 N3 ? ? ? 1_555 EB DA 9    N1 ? ? AA DT 1503 B1 DA 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3451  hydrog ? ? A  DT 1503 O4 ? ? ? 1_555 EB DA 9    N6 ? ? AA DT 1503 B1 DA 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3452  hydrog ? ? A  DT 1504 N3 ? ? ? 1_555 EB DA 8    N1 ? ? AA DT 1504 B1 DA 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3453  hydrog ? ? A  DT 1504 O4 ? ? ? 1_555 EB DA 8    N6 ? ? AA DT 1504 B1 DA 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3454  hydrog ? ? A  DT 1505 N3 ? ? ? 1_555 EB DA 7    N1 ? ? AA DT 1505 B1 DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3455  hydrog ? ? A  DT 1505 O4 ? ? ? 1_555 EB DA 7    N6 ? ? AA DT 1505 B1 DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3456  hydrog ? ? A  DA 1506 N1 ? ? ? 1_555 EB DT 6    N3 ? ? AA DA 1506 B1 DT 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3457  hydrog ? ? A  DA 1506 N6 ? ? ? 1_555 EB DT 6    O4 ? ? AA DA 1506 B1 DT 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3458  hydrog ? ? A  DT 1507 N3 ? ? ? 1_555 GD DA 46   N1 ? ? AA DT 1507 C1 DA 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3459  hydrog ? ? A  DT 1507 O4 ? ? ? 1_555 GD DA 46   N6 ? ? AA DT 1507 C1 DA 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3460  hydrog ? ? A  DT 1508 N3 ? ? ? 1_555 GD DA 45   N1 ? ? AA DT 1508 C1 DA 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3461  hydrog ? ? A  DT 1508 O4 ? ? ? 1_555 GD DA 45   N6 ? ? AA DT 1508 C1 DA 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3462  hydrog ? ? A  DG 1509 N1 ? ? ? 1_555 GD DC 44   N3 ? ? AA DG 1509 C1 DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3463  hydrog ? ? A  DG 1509 N2 ? ? ? 1_555 GD DC 44   O2 ? ? AA DG 1509 C1 DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3464  hydrog ? ? A  DG 1509 O6 ? ? ? 1_555 GD DC 44   N4 ? ? AA DG 1509 C1 DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3465  hydrog ? ? A  DG 1510 N1 ? ? ? 1_555 GD DC 43   N3 ? ? AA DG 1510 C1 DC 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3466  hydrog ? ? A  DG 1510 N2 ? ? ? 1_555 GD DC 43   O2 ? ? AA DG 1510 C1 DC 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3467  hydrog ? ? A  DG 1510 O6 ? ? ? 1_555 GD DC 43   N4 ? ? AA DG 1510 C1 DC 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3468  hydrog ? ? A  DA 1511 N1 ? ? ? 1_555 GD DT 42   N3 ? ? AA DA 1511 C1 DT 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3469  hydrog ? ? A  DA 1511 N6 ? ? ? 1_555 GD DT 42   O4 ? ? AA DA 1511 C1 DT 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3470  hydrog ? ? A  DT 1512 N3 ? ? ? 1_555 GD DA 41   N1 ? ? AA DT 1512 C1 DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3471  hydrog ? ? A  DT 1512 O4 ? ? ? 1_555 GD DA 41   N6 ? ? AA DT 1512 C1 DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3472  hydrog ? ? A  DG 1513 N1 ? ? ? 1_555 GD DC 40   N3 ? ? AA DG 1513 C1 DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3473  hydrog ? ? A  DG 1513 N2 ? ? ? 1_555 GD DC 40   O2 ? ? AA DG 1513 C1 DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3474  hydrog ? ? A  DG 1513 O6 ? ? ? 1_555 GD DC 40   N4 ? ? AA DG 1513 C1 DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3475  hydrog ? ? A  DT 1514 N3 ? ? ? 1_555 GD DA 39   N1 ? ? AA DT 1514 C1 DA 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3476  hydrog ? ? A  DT 1514 O4 ? ? ? 1_555 GD DA 39   N6 ? ? AA DT 1514 C1 DA 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3477  hydrog ? ? A  DT 1515 N3 ? ? ? 1_555 YB DA 50   N1 ? ? AA DT 1515 BM DA 50   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3478  hydrog ? ? A  DT 1515 O4 ? ? ? 1_555 YB DA 50   N6 ? ? AA DT 1515 BM DA 50   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3479  hydrog ? ? A  DA 1516 N1 ? ? ? 1_555 YB DT 49   N3 ? ? AA DA 1516 BM DT 49   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3480  hydrog ? ? A  DA 1516 N6 ? ? ? 1_555 YB DT 49   O4 ? ? AA DA 1516 BM DT 49   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3481  hydrog ? ? A  DA 1517 N1 ? ? ? 1_555 YB DT 48   N3 ? ? AA DA 1517 BM DT 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3482  hydrog ? ? A  DA 1517 N6 ? ? ? 1_555 YB DT 48   O4 ? ? AA DA 1517 BM DT 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3483  hydrog ? ? A  DT 1518 N3 ? ? ? 1_555 YB DA 47   N1 ? ? AA DT 1518 BM DA 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3484  hydrog ? ? A  DT 1518 O4 ? ? ? 1_555 YB DA 47   N6 ? ? AA DT 1518 BM DA 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3485  hydrog ? ? A  DG 1519 N1 ? ? ? 1_555 YB DC 46   N3 ? ? AA DG 1519 BM DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3486  hydrog ? ? A  DG 1519 N2 ? ? ? 1_555 YB DC 46   O2 ? ? AA DG 1519 BM DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3487  hydrog ? ? A  DG 1519 O6 ? ? ? 1_555 YB DC 46   N4 ? ? AA DG 1519 BM DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3488  hydrog ? ? A  DC 1520 N3 ? ? ? 1_555 YB DG 45   N1 ? ? AA DC 1520 BM DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3489  hydrog ? ? A  DC 1520 N4 ? ? ? 1_555 YB DG 45   O6 ? ? AA DC 1520 BM DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3490  hydrog ? ? A  DC 1520 O2 ? ? ? 1_555 YB DG 45   N2 ? ? AA DC 1520 BM DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3491  hydrog ? ? A  DT 1521 N3 ? ? ? 1_555 YB DA 44   N1 ? ? AA DT 1521 BM DA 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3492  hydrog ? ? A  DT 1521 O4 ? ? ? 1_555 YB DA 44   N6 ? ? AA DT 1521 BM DA 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3493  hydrog ? ? A  DA 1522 N1 ? ? ? 1_555 YB DT 43   N3 ? ? AA DA 1522 BM DT 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3494  hydrog ? ? A  DA 1522 N6 ? ? ? 1_555 YB DT 43   O4 ? ? AA DA 1522 BM DT 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3495  hydrog ? ? A  DC 1523 N4 ? ? ? 1_555 EB DG 53   O6 ? ? AA DC 1523 B1 DG 53   1_555 ? ? ? ? ? ? 'DC-DG PAIR'            
? ? 
hydrog3496  hydrog ? ? A  DT 1524 N3 ? ? ? 1_555 EB DA 52   N1 ? ? AA DT 1524 B1 DA 52   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3497  hydrog ? ? A  DT 1524 O4 ? ? ? 1_555 EB DA 52   N6 ? ? AA DT 1524 B1 DA 52   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3498  hydrog ? ? A  DA 1525 N1 ? ? ? 1_555 EB DT 51   N3 ? ? AA DA 1525 B1 DT 51   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3499  hydrog ? ? A  DA 1525 N6 ? ? ? 1_555 EB DT 51   O4 ? ? AA DA 1525 B1 DT 51   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3500  hydrog ? ? A  DC 1526 N3 ? ? ? 1_555 EB DG 50   N1 ? ? AA DC 1526 B1 DG 50   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3501  hydrog ? ? A  DC 1526 N4 ? ? ? 1_555 EB DG 50   O6 ? ? AA DC 1526 B1 DG 50   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3502  hydrog ? ? A  DC 1526 O2 ? ? ? 1_555 EB DG 50   N2 ? ? AA DC 1526 B1 DG 50   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3503  hydrog ? ? A  DT 1527 N3 ? ? ? 1_555 EB DA 49   N1 ? ? AA DT 1527 B1 DA 49   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3504  hydrog ? ? A  DT 1527 O4 ? ? ? 1_555 EB DA 49   N6 ? ? AA DT 1527 B1 DA 49   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3505  hydrog ? ? A  DA 1528 N1 ? ? ? 1_555 EB DT 48   N3 ? ? AA DA 1528 B1 DT 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3506  hydrog ? ? A  DA 1528 N6 ? ? ? 1_555 EB DT 48   O4 ? ? AA DA 1528 B1 DT 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3507  hydrog ? ? A  DT 1529 N3 ? ? ? 1_555 EB DA 47   N1 ? ? AA DT 1529 B1 DA 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3508  hydrog ? ? A  DT 1529 O4 ? ? ? 1_555 EB DA 47   N6 ? ? AA DT 1529 B1 DA 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3509  hydrog ? ? A  DT 1530 N3 ? ? ? 1_555 EB DA 46   N1 ? ? AA DT 1530 B1 DA 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3510  hydrog ? ? A  DT 1530 O4 ? ? ? 1_555 EB DA 46   N6 ? ? AA DT 1530 B1 DA 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3511  hydrog ? ? A  DA 1531 N1 ? ? ? 1_555 BC DT 44   N3 ? ? AA DA 1531 BP DT 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3512  hydrog ? ? A  DA 1531 N6 ? ? ? 1_555 BC DT 44   O4 ? ? AA DA 1531 BP DT 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3513  hydrog ? ? A  DG 1532 N1 ? ? ? 1_555 BC DC 43   N3 ? ? AA DG 1532 BP DC 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3514  hydrog ? ? A  DG 1532 N2 ? ? ? 1_555 BC DC 43   O2 ? ? AA DG 1532 BP DC 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3515  hydrog ? ? A  DG 1532 O6 ? ? ? 1_555 BC DC 43   N4 ? ? AA DG 1532 BP DC 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3516  hydrog ? ? A  DT 1533 N3 ? ? ? 1_555 BC DA 42   N1 ? ? AA DT 1533 BP DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3517  hydrog ? ? A  DT 1533 O4 ? ? ? 1_555 BC DA 42   N6 ? ? AA DT 1533 BP DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3518  hydrog ? ? A  DA 1534 N1 ? ? ? 1_555 BC DT 41   N3 ? ? AA DA 1534 BP DT 41   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3519  hydrog ? ? A  DG 1535 N1 ? ? ? 1_555 BC DC 40   N3 ? ? AA DG 1535 BP DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3520  hydrog ? ? A  DG 1535 N2 ? ? ? 1_555 BC DC 40   O2 ? ? AA DG 1535 BP DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3521  hydrog ? ? A  DG 1535 O6 ? ? ? 1_555 BC DC 40   N4 ? ? AA DG 1535 BP DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3522  hydrog ? ? A  DA 1536 N1 ? ? ? 1_555 BC DT 39   N3 ? ? AA DA 1536 BP DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3523  hydrog ? ? A  DA 1536 N6 ? ? ? 1_555 BC DT 39   O4 ? ? AA DA 1536 BP DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3524  hydrog ? ? A  DA 1537 N1 ? ? ? 1_555 BC DT 38   N3 ? ? AA DA 1537 BP DT 38   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3525  hydrog ? ? A  DT 1538 N3 ? ? ? 1_555 BC DA 37   N1 ? ? AA DT 1538 BP DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3526  hydrog ? ? A  DT 1538 O4 ? ? ? 1_555 BC DA 37   N6 ? ? AA DT 1538 BP DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3527  hydrog ? ? A  DT 1539 N3 ? ? ? 1_555 BC DA 26   N1 ? ? AA DT 1539 BP DA 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3528  hydrog ? ? A  DT 1539 O4 ? ? ? 1_555 BC DA 26   N6 ? ? AA DT 1539 BP DA 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3529  hydrog ? ? A  DG 1540 N1 ? ? ? 1_555 BC DC 25   N3 ? ? AA DG 1540 BP DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3530  hydrog ? ? A  DG 1540 N2 ? ? ? 1_555 BC DC 25   O2 ? ? AA DG 1540 BP DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3531  hydrog ? ? A  DG 1540 O6 ? ? ? 1_555 BC DC 25   N4 ? ? AA DG 1540 BP DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3532  hydrog ? ? A  DA 1541 N1 ? ? ? 1_555 BC DT 24   N3 ? ? AA DA 1541 BP DT 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3533  hydrog ? ? A  DA 1541 N6 ? ? ? 1_555 BC DT 24   O4 ? ? AA DA 1541 BP DT 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3534  hydrog ? ? A  DT 1542 N3 ? ? ? 1_555 BC DA 23   N1 ? ? AA DT 1542 BP DA 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3535  hydrog ? ? A  DT 1542 O4 ? ? ? 1_555 BC DA 23   N6 ? ? AA DT 1542 BP DA 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3536  hydrog ? ? A  DG 1543 N1 ? ? ? 1_555 BC DC 22   N3 ? ? AA DG 1543 BP DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3537  hydrog ? ? A  DG 1543 N2 ? ? ? 1_555 BC DC 22   O2 ? ? AA DG 1543 BP DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3538  hydrog ? ? A  DG 1543 O6 ? ? ? 1_555 BC DC 22   N4 ? ? AA DG 1543 BP DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3539  hydrog ? ? A  DC 1544 N3 ? ? ? 1_555 BC DG 21   N1 ? ? AA DC 1544 BP DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3540  hydrog ? ? A  DC 1544 N4 ? ? ? 1_555 BC DG 21   O6 ? ? AA DC 1544 BP DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3541  hydrog ? ? A  DC 1544 O2 ? ? ? 1_555 BC DG 21   N2 ? ? AA DC 1544 BP DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3542  hydrog ? ? A  DC 1545 N3 ? ? ? 1_555 BC DG 20   N1 ? ? AA DC 1545 BP DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3543  hydrog ? ? A  DC 1545 N4 ? ? ? 1_555 BC DG 20   O6 ? ? AA DC 1545 BP DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3544  hydrog ? ? A  DC 1545 O2 ? ? ? 1_555 BC DG 20   N2 ? ? AA DC 1545 BP DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3545  hydrog ? ? A  DA 1546 N1 ? ? ? 1_555 BC DT 19   N3 ? ? AA DA 1546 BP DT 19   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3546  hydrog ? ? A  DC 1547 N4 ? ? ? 1_555 RE DG 2    O6 ? ? AA DC 1547 Cf DG 2    1_555 ? ? ? ? ? ? 'DC-DG PAIR'            
? ? 
hydrog3547  hydrog ? ? A  DC 1548 N3 ? ? ? 1_555 RE DG 1    N1 ? ? AA DC 1548 Cf DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3548  hydrog ? ? A  DC 1548 N4 ? ? ? 1_555 RE DG 1    O6 ? ? AA DC 1548 Cf DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3549  hydrog ? ? A  DC 1548 O2 ? ? ? 1_555 RE DG 1    N2 ? ? AA DC 1548 Cf DG 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3550  hydrog ? ? A  DT 1549 N3 ? ? ? 1_555 EB DA 59   N1 ? ? AA DT 1549 B1 DA 59   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3551  hydrog ? ? A  DT 1549 O4 ? ? ? 1_555 EB DA 59   N6 ? ? AA DT 1549 B1 DA 59   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3552  hydrog ? ? A  DT 1550 N3 ? ? ? 1_555 EB DA 58   N1 ? ? AA DT 1550 B1 DA 58   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3553  hydrog ? ? A  DT 1550 O4 ? ? ? 1_555 EB DA 58   N6 ? ? AA DT 1550 B1 DA 58   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3554  hydrog ? ? A  DT 1551 N3 ? ? ? 1_555 EB DA 57   N1 ? ? AA DT 1551 B1 DA 57   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3555  hydrog ? ? A  DT 1551 O4 ? ? ? 1_555 EB DA 57   N6 ? ? AA DT 1551 B1 DA 57   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3556  hydrog ? ? A  DT 1552 N3 ? ? ? 1_555 EB DA 56   N1 ? ? AA DT 1552 B1 DA 56   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3557  hydrog ? ? A  DT 1552 O4 ? ? ? 1_555 EB DA 56   N6 ? ? AA DT 1552 B1 DA 56   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3558  hydrog ? ? A  DC 1553 N3 ? ? ? 1_555 EB DG 55   N1 ? ? AA DC 1553 B1 DG 55   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3559  hydrog ? ? A  DC 1553 N4 ? ? ? 1_555 EB DG 55   O6 ? ? AA DC 1553 B1 DG 55   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3560  hydrog ? ? A  DC 1553 O2 ? ? ? 1_555 EB DG 55   N2 ? ? AA DC 1553 B1 DG 55   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3561  hydrog ? ? A  DA 1554 N1 ? ? ? 1_555 EB DT 54   N3 ? ? AA DA 1554 B1 DT 54   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3562  hydrog ? ? A  DA 1554 N6 ? ? ? 1_555 EB DT 54   O4 ? ? AA DA 1554 B1 DT 54   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3563  hydrog ? ? A  DG 1555 N1 ? ? ? 1_555 KE DC 21   N3 ? ? AA DG 1555 CX DC 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3564  hydrog ? ? A  DG 1555 N2 ? ? ? 1_555 KE DC 21   O2 ? ? AA DG 1555 CX DC 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3565  hydrog ? ? A  DG 1555 O6 ? ? ? 1_555 KE DC 21   N4 ? ? AA DG 1555 CX DC 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3566  hydrog ? ? A  DC 1556 N3 ? ? ? 1_555 KE DG 20   N1 ? ? AA DC 1556 CX DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3567  hydrog ? ? A  DC 1556 N4 ? ? ? 1_555 KE DG 20   O6 ? ? AA DC 1556 CX DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3568  hydrog ? ? A  DC 1556 O2 ? ? ? 1_555 KE DG 20   N2 ? ? AA DC 1556 CX DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3569  hydrog ? ? A  DT 1557 N3 ? ? ? 1_555 KE DA 19   N1 ? ? AA DT 1557 CX DA 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3570  hydrog ? ? A  DT 1557 O4 ? ? ? 1_555 KE DA 19   N6 ? ? AA DT 1557 CX DA 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3571  hydrog ? ? A  DC 1558 N3 ? ? ? 1_555 KE DG 18   N1 ? ? AA DC 1558 CX DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3572  hydrog ? ? A  DC 1558 N4 ? ? ? 1_555 KE DG 18   O6 ? ? AA DC 1558 CX DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3573  hydrog ? ? A  DC 1558 O2 ? ? ? 1_555 KE DG 18   N2 ? ? AA DC 1558 CX DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3574  hydrog ? ? A  DG 1559 N1 ? ? ? 1_555 KE DC 17   N3 ? ? AA DG 1559 CX DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3575  hydrog ? ? A  DG 1559 N2 ? ? ? 1_555 KE DC 17   O2 ? ? AA DG 1559 CX DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3576  hydrog ? ? A  DG 1559 O6 ? ? ? 1_555 KE DC 17   N4 ? ? AA DG 1559 CX DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3577  hydrog ? ? A  DC 1560 N3 ? ? ? 1_555 KE DG 16   N1 ? ? AA DC 1560 CX DG 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3578  hydrog ? ? A  DC 1560 N4 ? ? ? 1_555 KE DG 16   O6 ? ? AA DC 1560 CX DG 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3579  hydrog ? ? A  DC 1560 O2 ? ? ? 1_555 KE DG 16   N2 ? ? AA DC 1560 CX DG 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3580  hydrog ? ? A  DG 1561 N1 ? ? ? 1_555 KE DC 15   N3 ? ? AA DG 1561 CX DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3581  hydrog ? ? A  DG 1561 N2 ? ? ? 1_555 KE DC 15   O2 ? ? AA DG 1561 CX DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3582  hydrog ? ? A  DG 1561 O6 ? ? ? 1_555 KE DC 15   N4 ? ? AA DG 1561 CX DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3583  hydrog ? ? A  DC 1562 N3 ? ? ? 1_555 KE DG 14   N1 ? ? AA DC 1562 CX DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3584  hydrog ? ? A  DC 1562 N4 ? ? ? 1_555 KE DG 14   O6 ? ? AA DC 1562 CX DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3585  hydrog ? ? A  DC 1562 O2 ? ? ? 1_555 KE DG 14   N2 ? ? AA DC 1562 CX DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3586  hydrog ? ? A  DC 1563 N3 ? ? ? 1_555 EC DG 22   N1 ? ? AA DC 1563 BS DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3587  hydrog ? ? A  DC 1563 N4 ? ? ? 1_555 EC DG 22   O6 ? ? AA DC 1563 BS DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3588  hydrog ? ? A  DC 1563 O2 ? ? ? 1_555 EC DG 22   N2 ? ? AA DC 1563 BS DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3589  hydrog ? ? A  DC 1564 N3 ? ? ? 1_555 EC DG 21   N1 ? ? AA DC 1564 BS DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3590  hydrog ? ? A  DC 1564 N4 ? ? ? 1_555 EC DG 21   O6 ? ? AA DC 1564 BS DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3591  hydrog ? ? A  DC 1564 O2 ? ? ? 1_555 EC DG 21   N2 ? ? AA DC 1564 BS DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3592  hydrog ? ? A  DC 1565 N3 ? ? ? 1_555 EC DG 20   N1 ? ? AA DC 1565 BS DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3593  hydrog ? ? A  DC 1565 N4 ? ? ? 1_555 EC DG 20   O6 ? ? AA DC 1565 BS DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3594  hydrog ? ? A  DC 1565 O2 ? ? ? 1_555 EC DG 20   N2 ? ? AA DC 1565 BS DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3595  hydrog ? ? A  DA 1566 N1 ? ? ? 1_555 EC DT 19   N3 ? ? AA DA 1566 BS DT 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3596  hydrog ? ? A  DA 1566 N6 ? ? ? 1_555 EC DT 19   O4 ? ? AA DA 1566 BS DT 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3597  hydrog ? ? A  DA 1567 N1 ? ? ? 1_555 EC DT 18   N3 ? ? AA DA 1567 BS DT 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3598  hydrog ? ? A  DA 1567 N6 ? ? ? 1_555 EC DT 18   O4 ? ? AA DA 1567 BS DT 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3599  hydrog ? ? A  DA 1568 N1 ? ? ? 1_555 EC DT 17   N3 ? ? AA DA 1568 BS DT 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3600  hydrog ? ? A  DA 1568 N6 ? ? ? 1_555 EC DT 17   O4 ? ? AA DA 1568 BS DT 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3601  hydrog ? ? A  DT 1569 N3 ? ? ? 1_555 EC DA 16   N1 ? ? AA DT 1569 BS DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3602  hydrog ? ? A  DT 1569 O4 ? ? ? 1_555 EC DA 16   N6 ? ? AA DT 1569 BS DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3603  hydrog ? ? A  DT 1569 N3 ? ? ? 1_555 EC DT 17   O4 ? ? AA DT 1569 BS DT 17   1_555 ? ? ? ? ? ? TYPE_16_PAIR            
? ? 
hydrog3604  hydrog ? ? A  DT 1569 O2 ? ? ? 1_555 EC DT 17   N3 ? ? AA DT 1569 BS DT 17   1_555 ? ? ? ? ? ? TYPE_16_PAIR            
? ? 
hydrog3605  hydrog ? ? A  DG 1570 N1 ? ? ? 1_555 EC DC 15   N3 ? ? AA DG 1570 BS DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3606  hydrog ? ? A  DG 1570 N2 ? ? ? 1_555 EC DC 15   O2 ? ? AA DG 1570 BS DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3607  hydrog ? ? A  DG 1570 O6 ? ? ? 1_555 EC DC 15   N4 ? ? AA DG 1570 BS DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3608  hydrog ? ? A  DA 1572 N1 ? ? ? 1_555 AC DT 17   N3 ? ? AA DA 1572 BO DT 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3609  hydrog ? ? A  DA 1572 N6 ? ? ? 1_555 AC DT 17   O4 ? ? AA DA 1572 BO DT 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3610  hydrog ? ? A  DA 1573 N1 ? ? ? 1_555 AC DT 16   N3 ? ? AA DA 1573 BO DT 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3611  hydrog ? ? A  DA 1573 N6 ? ? ? 1_555 AC DT 16   O4 ? ? AA DA 1573 BO DT 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3612  hydrog ? ? A  DA 1574 N1 ? ? ? 1_555 AC DT 15   N3 ? ? AA DA 1574 BO DT 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3613  hydrog ? ? A  DA 1574 N6 ? ? ? 1_555 AC DT 15   O4 ? ? AA DA 1574 BO DT 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3614  hydrog ? ? A  DT 1575 N3 ? ? ? 1_555 AC DA 14   N1 ? ? AA DT 1575 BO DA 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3615  hydrog ? ? A  DT 1575 O4 ? ? ? 1_555 AC DA 14   N6 ? ? AA DT 1575 BO DA 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3616  hydrog ? ? A  DA 1576 N1 ? ? ? 1_555 AC DT 13   N3 ? ? AA DA 1576 BO DT 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3617  hydrog ? ? A  DA 1576 N6 ? ? ? 1_555 AC DT 13   O4 ? ? AA DA 1576 BO DT 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3618  hydrog ? ? A  DT 1577 N3 ? ? ? 1_555 AC DA 12   N1 ? ? AA DT 1577 BO DA 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3619  hydrog ? ? A  DT 1577 O4 ? ? ? 1_555 AC DA 12   N6 ? ? AA DT 1577 BO DA 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3620  hydrog ? ? A  DA 1578 N1 ? ? ? 1_555 AC DT 11   N3 ? ? AA DA 1578 BO DT 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3621  hydrog ? ? A  DA 1578 N6 ? ? ? 1_555 AC DT 11   O4 ? ? AA DA 1578 BO DT 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3622  hydrog ? ? A  DG 1579 N1 ? ? ? 1_555 SD DC 22   N3 ? ? AA DG 1579 CF DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3623  hydrog ? ? A  DG 1579 N2 ? ? ? 1_555 SD DC 22   O2 ? ? AA DG 1579 CF DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3624  hydrog ? ? A  DG 1579 O6 ? ? ? 1_555 SD DC 22   N4 ? ? AA DG 1579 CF DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3625  hydrog ? ? A  DC 1580 N3 ? ? ? 1_555 SD DG 21   N1 ? ? AA DC 1580 CF DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3626  hydrog ? ? A  DC 1580 N4 ? ? ? 1_555 SD DG 21   O6 ? ? AA DC 1580 CF DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3627  hydrog ? ? A  DC 1580 O2 ? ? ? 1_555 SD DG 21   N2 ? ? AA DC 1580 CF DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3628  hydrog ? ? A  DT 1581 N3 ? ? ? 1_555 SD DA 20   N1 ? ? AA DT 1581 CF DA 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3629  hydrog ? ? A  DT 1581 O4 ? ? ? 1_555 SD DA 20   N6 ? ? AA DT 1581 CF DA 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3630  hydrog ? ? A  DA 1582 N1 ? ? ? 1_555 SD DT 19   N3 ? ? AA DA 1582 CF DT 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3631  hydrog ? ? A  DA 1582 N6 ? ? ? 1_555 SD DT 19   O4 ? ? AA DA 1582 CF DT 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3632  hydrog ? ? A  DA 1583 N1 ? ? ? 1_555 SD DT 18   N3 ? ? AA DA 1583 CF DT 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3633  hydrog ? ? A  DA 1583 N6 ? ? ? 1_555 SD DT 18   O4 ? ? AA DA 1583 CF DT 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3634  hydrog ? ? A  DA 1584 N1 ? ? ? 1_555 SD DT 17   N3 ? ? AA DA 1584 CF DT 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3635  hydrog ? ? A  DA 1584 N6 ? ? ? 1_555 SD DT 17   O4 ? ? AA DA 1584 CF DT 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3636  hydrog ? ? A  DC 1585 N3 ? ? ? 1_555 SD DG 16   N1 ? ? AA DC 1585 CF DG 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3637  hydrog ? ? A  DC 1585 N4 ? ? ? 1_555 SD DG 16   O6 ? ? AA DC 1585 CF DG 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3638  hydrog ? ? A  DC 1585 O2 ? ? ? 1_555 SD DG 16   N2 ? ? AA DC 1585 CF DG 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3639  hydrog ? ? A  DA 1586 N1 ? ? ? 1_555 SD DT 15   N3 ? ? AA DA 1586 CF DT 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3640  hydrog ? ? A  DA 1586 N6 ? ? ? 1_555 SD DT 15   O4 ? ? AA DA 1586 CF DT 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3641  hydrog ? ? A  DG 1587 N1 ? ? ? 1_555 GB DC 46   N3 ? ? AA DG 1587 B3 DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3642  hydrog ? ? A  DG 1587 N2 ? ? ? 1_555 GB DC 46   O2 ? ? AA DG 1587 B3 DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3643  hydrog ? ? A  DG 1587 O6 ? ? ? 1_555 GB DC 46   N4 ? ? AA DG 1587 B3 DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3644  hydrog ? ? A  DG 1588 N1 ? ? ? 1_555 GB DC 45   N3 ? ? AA DG 1588 B3 DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3645  hydrog ? ? A  DG 1588 N2 ? ? ? 1_555 GB DC 45   O2 ? ? AA DG 1588 B3 DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3646  hydrog ? ? A  DG 1588 O6 ? ? ? 1_555 GB DC 45   N4 ? ? AA DG 1588 B3 DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3647  hydrog ? ? A  DT 1589 N3 ? ? ? 1_555 GB DA 44   N1 ? ? AA DT 1589 B3 DA 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3648  hydrog ? ? A  DT 1589 O4 ? ? ? 1_555 GB DA 44   N6 ? ? AA DT 1589 B3 DA 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3649  hydrog ? ? A  DT 1590 N3 ? ? ? 1_555 GB DA 43   N1 ? ? AA DT 1590 B3 DA 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3650  hydrog ? ? A  DT 1590 O4 ? ? ? 1_555 GB DA 43   N6 ? ? AA DT 1590 B3 DA 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3651  hydrog ? ? A  DA 1591 N1 ? ? ? 1_555 GB DT 42   N3 ? ? AA DA 1591 B3 DT 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3652  hydrog ? ? A  DA 1591 N6 ? ? ? 1_555 GB DT 42   O4 ? ? AA DA 1591 B3 DT 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3653  hydrog ? ? A  DT 1592 N3 ? ? ? 1_555 GB DA 41   N1 ? ? AA DT 1592 B3 DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3654  hydrog ? ? A  DT 1592 O4 ? ? ? 1_555 GB DA 41   N6 ? ? AA DT 1592 B3 DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3655  hydrog ? ? A  DT 1593 N3 ? ? ? 1_555 GB DA 40   N1 ? ? AA DT 1593 B3 DA 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3656  hydrog ? ? A  DT 1593 O4 ? ? ? 1_555 GB DA 40   N6 ? ? AA DT 1593 B3 DA 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3657  hydrog ? ? A  DG 1594 N1 ? ? ? 1_555 GB DC 39   N3 ? ? AA DG 1594 B3 DC 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3658  hydrog ? ? A  DG 1594 N2 ? ? ? 1_555 GB DC 39   O2 ? ? AA DG 1594 B3 DC 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3659  hydrog ? ? A  DG 1594 O6 ? ? ? 1_555 GB DC 39   N4 ? ? AA DG 1594 B3 DC 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3660  hydrog ? ? A  DC 1596 N3 ? ? ? 1_555 IB DG 5    N1 ? ? AA DC 1596 B5 DG 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3661  hydrog ? ? A  DC 1596 N4 ? ? ? 1_555 IB DG 5    O6 ? ? AA DC 1596 B5 DG 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3662  hydrog ? ? A  DC 1596 O2 ? ? ? 1_555 IB DG 5    N2 ? ? AA DC 1596 B5 DG 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3663  hydrog ? ? A  DC 1597 N3 ? ? ? 1_555 IB DG 4    N1 ? ? AA DC 1597 B5 DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3664  hydrog ? ? A  DC 1597 N4 ? ? ? 1_555 IB DG 4    O6 ? ? AA DC 1597 B5 DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3665  hydrog ? ? A  DC 1597 O2 ? ? ? 1_555 IB DG 4    N2 ? ? AA DC 1597 B5 DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3666  hydrog ? ? A  DA 1598 N1 ? ? ? 1_555 IB DT 3    N3 ? ? AA DA 1598 B5 DT 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3667  hydrog ? ? A  DA 1598 N6 ? ? ? 1_555 IB DT 3    O4 ? ? AA DA 1598 B5 DT 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3668  hydrog ? ? A  DT 1599 N3 ? ? ? 1_555 IB DA 2    N1 ? ? AA DT 1599 B5 DA 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3669  hydrog ? ? A  DT 1599 O4 ? ? ? 1_555 IB DA 2    N6 ? ? AA DT 1599 B5 DA 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3670  hydrog ? ? A  DT 1600 N3 ? ? ? 1_555 IB DA 1    N1 ? ? AA DT 1600 B5 DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3671  hydrog ? ? A  DT 1600 O4 ? ? ? 1_555 IB DA 1    N6 ? ? AA DT 1600 B5 DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3672  hydrog ? ? A  DT 1601 N3 ? ? ? 1_555 FF DA 48   N1 ? ? AA DT 1601 Cz DA 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3673  hydrog ? ? A  DT 1601 O4 ? ? ? 1_555 FF DA 48   N6 ? ? AA DT 1601 Cz DA 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3674  hydrog ? ? A  DG 1602 N1 ? ? ? 1_555 FF DC 47   N3 ? ? AA DG 1602 Cz DC 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3675  hydrog ? ? A  DG 1602 N2 ? ? ? 1_555 FF DC 47   O2 ? ? AA DG 1602 Cz DC 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3676  hydrog ? ? A  DG 1602 O6 ? ? ? 1_555 FF DC 47   N4 ? ? AA DG 1602 Cz DC 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3677  hydrog ? ? A  DC 1603 N3 ? ? ? 1_555 CC DG 14   N1 ? ? AA DC 1603 BQ DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3678  hydrog ? ? A  DC 1603 N4 ? ? ? 1_555 CC DG 14   O6 ? ? AA DC 1603 BQ DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3679  hydrog ? ? A  DC 1603 O2 ? ? ? 1_555 CC DG 14   N2 ? ? AA DC 1603 BQ DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3680  hydrog ? ? A  DG 1604 N1 ? ? ? 1_555 CC DC 13   N3 ? ? AA DG 1604 BQ DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3681  hydrog ? ? A  DG 1604 N2 ? ? ? 1_555 CC DC 13   O2 ? ? AA DG 1604 BQ DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3682  hydrog ? ? A  DG 1604 O6 ? ? ? 1_555 CC DC 13   N4 ? ? AA DG 1604 BQ DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3683  hydrog ? ? A  DA 1605 N1 ? ? ? 1_555 CC DT 12   N3 ? ? AA DA 1605 BQ DT 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3684  hydrog ? ? A  DA 1605 N6 ? ? ? 1_555 CC DT 12   O4 ? ? AA DA 1605 BQ DT 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3685  hydrog ? ? A  DA 1606 N1 ? ? ? 1_555 CC DT 11   N3 ? ? AA DA 1606 BQ DT 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3686  hydrog ? ? A  DA 1606 N6 ? ? ? 1_555 CC DT 11   O4 ? ? AA DA 1606 BQ DT 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3687  hydrog ? ? A  DA 1607 N1 ? ? ? 1_555 CC DT 10   N3 ? ? AA DA 1607 BQ DT 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3688  hydrog ? ? A  DA 1607 N6 ? ? ? 1_555 CC DT 10   O4 ? ? AA DA 1607 BQ DT 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3689  hydrog ? ? A  DT 1608 N3 ? ? ? 1_555 CC DA 9    N1 ? ? AA DT 1608 BQ DA 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3690  hydrog ? ? A  DT 1608 O4 ? ? ? 1_555 CC DA 9    N6 ? ? AA DT 1608 BQ DA 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3691  hydrog ? ? A  DG 1609 N1 ? ? ? 1_555 CC DC 8    N3 ? ? AA DG 1609 BQ DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3692  hydrog ? ? A  DG 1609 N2 ? ? ? 1_555 CC DC 8    O2 ? ? AA DG 1609 BQ DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3693  hydrog ? ? A  DG 1609 O6 ? ? ? 1_555 CC DC 8    N4 ? ? AA DG 1609 BQ DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3694  hydrog ? ? A  DT 1610 N3 ? ? ? 1_555 CC DA 7    N1 ? ? AA DT 1610 BQ DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3695  hydrog ? ? A  DT 1610 O4 ? ? ? 1_555 CC DA 7    N6 ? ? AA DT 1610 BQ DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3696  hydrog ? ? A  DA 1611 N1 ? ? ? 1_555 TE DT 2    N3 ? ? AA DA 1611 Ch DT 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3697  hydrog ? ? A  DA 1611 N6 ? ? ? 1_555 TE DT 2    O4 ? ? AA DA 1611 Ch DT 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3698  hydrog ? ? A  DT 1612 N3 ? ? ? 1_555 TE DA 1    N1 ? ? AA DT 1612 Ch DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3699  hydrog ? ? A  DT 1612 O4 ? ? ? 1_555 TE DA 1    N6 ? ? AA DT 1612 Ch DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3700  hydrog ? ? A  DC 1613 N3 ? ? ? 1_555 HB DG 48   N1 ? ? AA DC 1613 B4 DG 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3701  hydrog ? ? A  DC 1613 N4 ? ? ? 1_555 HB DG 48   O6 ? ? AA DC 1613 B4 DG 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3702  hydrog ? ? A  DC 1613 O2 ? ? ? 1_555 HB DG 48   N2 ? ? AA DC 1613 B4 DG 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3703  hydrog ? ? A  DT 1614 N3 ? ? ? 1_555 HB DA 47   N1 ? ? AA DT 1614 B4 DA 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3704  hydrog ? ? A  DT 1614 O4 ? ? ? 1_555 HB DA 47   N6 ? ? AA DT 1614 B4 DA 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3705  hydrog ? ? A  DA 1615 N1 ? ? ? 1_555 HB DT 46   N3 ? ? AA DA 1615 B4 DT 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3706  hydrog ? ? A  DA 1615 N6 ? ? ? 1_555 HB DT 46   O4 ? ? AA DA 1615 B4 DT 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3707  hydrog ? ? A  DA 1616 N1 ? ? ? 1_555 HB DT 45   N3 ? ? AA DA 1616 B4 DT 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3708  hydrog ? ? A  DA 1616 N6 ? ? ? 1_555 HB DT 45   O4 ? ? AA DA 1616 B4 DT 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3709  hydrog ? ? A  DT 1617 N3 ? ? ? 1_555 HB DA 44   N1 ? ? AA DT 1617 B4 DA 44   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3710  hydrog ? ? A  DG 1618 N1 ? ? ? 1_555 HB DC 43   N3 ? ? AA DG 1618 B4 DC 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3711  hydrog ? ? A  DG 1618 N2 ? ? ? 1_555 HB DC 43   O2 ? ? AA DG 1618 B4 DC 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3712  hydrog ? ? A  DG 1618 O6 ? ? ? 1_555 HB DC 43   N4 ? ? AA DG 1618 B4 DC 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3713  hydrog ? ? A  DG 1619 N2 ? ? ? 1_555 FC DC 21   O2 ? ? AA DG 1619 BT DC 21   1_555 ? ? ? ? ? ? 'DG-DC PAIR'            
? ? 
hydrog3714  hydrog ? ? A  DT 1620 N3 ? ? ? 1_555 FC DA 20   N1 ? ? AA DT 1620 BT DA 20   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3715  hydrog ? ? A  DC 1621 N3 ? ? ? 1_555 FC DG 19   N1 ? ? AA DC 1621 BT DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3716  hydrog ? ? A  DC 1621 N4 ? ? ? 1_555 FC DG 19   O6 ? ? AA DC 1621 BT DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3717  hydrog ? ? A  DC 1621 O2 ? ? ? 1_555 FC DG 19   N2 ? ? AA DC 1621 BT DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3718  hydrog ? ? A  DA 1622 N1 ? ? ? 1_555 FC DT 18   N3 ? ? AA DA 1622 BT DT 18   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3719  hydrog ? ? A  DA 1623 N1 ? ? ? 1_555 FC DT 17   N3 ? ? AA DA 1623 BT DT 17   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3720  hydrog ? ? A  DA 1624 N1 ? ? ? 1_555 FC DT 16   N3 ? ? AA DA 1624 BT DT 16   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3721  hydrog ? ? A  DC 1625 N3 ? ? ? 1_555 FC DG 15   N1 ? ? AA DC 1625 BT DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3722  hydrog ? ? A  DC 1625 N4 ? ? ? 1_555 FC DG 15   O6 ? ? AA DC 1625 BT DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3723  hydrog ? ? A  DC 1625 O2 ? ? ? 1_555 FC DG 15   N2 ? ? AA DC 1625 BT DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3724  hydrog ? ? A  DT 1626 N3 ? ? ? 1_555 FC DA 14   N1 ? ? AA DT 1626 BT DA 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3725  hydrog ? ? A  DT 1626 O4 ? ? ? 1_555 FC DA 14   N6 ? ? AA DT 1626 BT DA 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3726  hydrog ? ? A  DA 1627 N1 ? ? ? 1_555 CC DT 22   N3 ? ? AA DA 1627 BQ DT 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3727  hydrog ? ? A  DA 1627 N6 ? ? ? 1_555 CC DT 22   O4 ? ? AA DA 1627 BQ DT 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3728  hydrog ? ? A  DA 1628 N1 ? ? ? 1_555 CC DT 21   N3 ? ? AA DA 1628 BQ DT 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3729  hydrog ? ? A  DA 1628 N6 ? ? ? 1_555 CC DT 21   O4 ? ? AA DA 1628 BQ DT 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3730  hydrog ? ? A  DA 1629 N1 ? ? ? 1_555 CC DT 20   N3 ? ? AA DA 1629 BQ DT 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3731  hydrog ? ? A  DA 1629 N6 ? ? ? 1_555 CC DT 20   O4 ? ? AA DA 1629 BQ DT 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3732  hydrog ? ? A  DT 1630 N3 ? ? ? 1_555 CC DA 19   N1 ? ? AA DT 1630 BQ DA 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3733  hydrog ? ? A  DT 1630 O4 ? ? ? 1_555 CC DA 19   N6 ? ? AA DT 1630 BQ DA 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3734  hydrog ? ? A  DC 1631 N3 ? ? ? 1_555 CC DG 18   N1 ? ? AA DC 1631 BQ DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3735  hydrog ? ? A  DC 1631 N4 ? ? ? 1_555 CC DG 18   O6 ? ? AA DC 1631 BQ DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3736  hydrog ? ? A  DC 1631 O2 ? ? ? 1_555 CC DG 18   N2 ? ? AA DC 1631 BQ DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3737  hydrog ? ? A  DT 1632 N3 ? ? ? 1_555 CC DA 17   N1 ? ? AA DT 1632 BQ DA 17   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3738  hydrog ? ? A  DA 1633 N1 ? ? ? 1_555 CC DT 16   N3 ? ? AA DA 1633 BQ DT 16   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3739  hydrog ? ? A  DC 1634 N3 ? ? ? 1_555 CC DG 15   N1 ? ? AA DC 1634 BQ DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3740  hydrog ? ? A  DC 1634 N4 ? ? ? 1_555 CC DG 15   O6 ? ? AA DC 1634 BQ DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3741  hydrog ? ? A  DC 1634 O2 ? ? ? 1_555 CC DG 15   N2 ? ? AA DC 1634 BQ DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3742  hydrog ? ? A  DT 1635 N3 ? ? ? 1_555 FF DA 46   N1 ? ? AA DT 1635 Cz DA 46   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3743  hydrog ? ? A  DC 1636 N3 ? ? ? 1_555 FF DG 45   N1 ? ? AA DC 1636 Cz DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3744  hydrog ? ? A  DC 1636 N4 ? ? ? 1_555 FF DG 45   O6 ? ? AA DC 1636 Cz DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3745  hydrog ? ? A  DC 1636 O2 ? ? ? 1_555 FF DG 45   N2 ? ? AA DC 1636 Cz DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3746  hydrog ? ? A  DG 1637 N1 ? ? ? 1_555 FF DC 44   N3 ? ? AA DG 1637 Cz DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3747  hydrog ? ? A  DG 1637 N2 ? ? ? 1_555 FF DC 44   O2 ? ? AA DG 1637 Cz DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3748  hydrog ? ? A  DG 1637 O6 ? ? ? 1_555 FF DC 44   N4 ? ? AA DG 1637 Cz DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3749  hydrog ? ? A  DT 1638 N3 ? ? ? 1_555 FF DA 43   N1 ? ? AA DT 1638 Cz DA 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3750  hydrog ? ? A  DT 1638 O4 ? ? ? 1_555 FF DA 43   N6 ? ? AA DT 1638 Cz DA 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3751  hydrog ? ? A  DT 1639 N3 ? ? ? 1_555 FF DA 42   N1 ? ? AA DT 1639 Cz DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3752  hydrog ? ? A  DT 1639 O4 ? ? ? 1_555 FF DA 42   N6 ? ? AA DT 1639 Cz DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3753  hydrog ? ? A  DC 1640 N3 ? ? ? 1_555 FF DG 41   N1 ? ? AA DC 1640 Cz DG 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3754  hydrog ? ? A  DC 1640 N4 ? ? ? 1_555 FF DG 41   O6 ? ? AA DC 1640 Cz DG 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3755  hydrog ? ? A  DC 1640 O2 ? ? ? 1_555 FF DG 41   N2 ? ? AA DC 1640 Cz DG 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3756  hydrog ? ? A  DG 1641 N1 ? ? ? 1_555 FF DC 40   N3 ? ? AA DG 1641 Cz DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3757  hydrog ? ? A  DG 1641 N2 ? ? ? 1_555 FF DC 40   O2 ? ? AA DG 1641 Cz DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3758  hydrog ? ? A  DG 1641 O6 ? ? ? 1_555 FF DC 40   N4 ? ? AA DG 1641 Cz DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3759  hydrog ? ? A  DC 1642 N3 ? ? ? 1_555 FF DG 39   N1 ? ? AA DC 1642 Cz DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3760  hydrog ? ? A  DC 1642 N4 ? ? ? 1_555 FF DG 39   O6 ? ? AA DC 1642 Cz DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3761  hydrog ? ? A  DC 1642 O2 ? ? ? 1_555 FF DG 39   N2 ? ? AA DC 1642 Cz DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3762  hydrog ? ? A  DA 1643 N1 ? ? ? 1_555 PD DT 29   N3 ? ? AA DA 1643 CC DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3763  hydrog ? ? A  DA 1643 N6 ? ? ? 1_555 PD DT 29   O4 ? ? AA DA 1643 CC DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3764  hydrog ? ? A  DG 1644 N1 ? ? ? 1_555 PD DC 28   N3 ? ? AA DG 1644 CC DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3765  hydrog ? ? A  DG 1644 N2 ? ? ? 1_555 PD DC 28   O2 ? ? AA DG 1644 CC DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3766  hydrog ? ? A  DG 1644 O6 ? ? ? 1_555 PD DC 28   N4 ? ? AA DG 1644 CC DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3767  hydrog ? ? A  DA 1645 N1 ? ? ? 1_555 PD DT 27   N3 ? ? AA DA 1645 CC DT 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3768  hydrog ? ? A  DA 1645 N6 ? ? ? 1_555 PD DT 27   O4 ? ? AA DA 1645 CC DT 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3769  hydrog ? ? A  DA 1646 N1 ? ? ? 1_555 PD DT 26   N3 ? ? AA DA 1646 CC DT 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3770  hydrog ? ? A  DA 1646 N6 ? ? ? 1_555 PD DT 26   O4 ? ? AA DA 1646 CC DT 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3771  hydrog ? ? A  DT 1647 N3 ? ? ? 1_555 PD DA 25   N1 ? ? AA DT 1647 CC DA 25   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3772  hydrog ? ? A  DT 1648 N3 ? ? ? 1_555 PD DA 24   N1 ? ? AA DT 1648 CC DA 24   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3773  hydrog ? ? A  DG 1649 N1 ? ? ? 1_555 PD DC 23   N3 ? ? AA DG 1649 CC DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3774  hydrog ? ? A  DG 1649 N2 ? ? ? 1_555 PD DC 23   O2 ? ? AA DG 1649 CC DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3775  hydrog ? ? A  DG 1649 O6 ? ? ? 1_555 PD DC 23   N4 ? ? AA DG 1649 CC DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3776  hydrog ? ? A  DG 1650 N1 ? ? ? 1_555 PD DC 22   N3 ? ? AA DG 1650 CC DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3777  hydrog ? ? A  DG 1650 N2 ? ? ? 1_555 PD DC 22   O2 ? ? AA DG 1650 CC DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3778  hydrog ? ? A  DG 1650 O6 ? ? ? 1_555 PD DC 22   N4 ? ? AA DG 1650 CC DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3779  hydrog ? ? A  DG 1651 N1 ? ? ? 1_555 UD DC 18   N3 ? ? AA DG 1651 CH DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3780  hydrog ? ? A  DG 1651 N2 ? ? ? 1_555 UD DC 18   O2 ? ? AA DG 1651 CH DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3781  hydrog ? ? A  DG 1651 O6 ? ? ? 1_555 UD DC 18   N4 ? ? AA DG 1651 CH DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3782  hydrog ? ? A  DA 1652 N1 ? ? ? 1_555 UD DT 17   N3 ? ? AA DA 1652 CH DT 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3783  hydrog ? ? A  DA 1652 N6 ? ? ? 1_555 UD DT 17   O4 ? ? AA DA 1652 CH DT 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3784  hydrog ? ? A  DA 1653 N1 ? ? ? 1_555 UD DT 16   N3 ? ? AA DA 1653 CH DT 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3785  hydrog ? ? A  DA 1653 N6 ? ? ? 1_555 UD DT 16   O4 ? ? AA DA 1653 CH DT 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3786  hydrog ? ? A  DT 1654 N3 ? ? ? 1_555 UD DA 15   N1 ? ? AA DT 1654 CH DA 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3787  hydrog ? ? A  DT 1654 O4 ? ? ? 1_555 UD DA 15   N6 ? ? AA DT 1654 CH DA 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3788  hydrog ? ? A  DC 1655 N3 ? ? ? 1_555 UD DG 14   N1 ? ? AA DC 1655 CH DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3789  hydrog ? ? A  DC 1655 N4 ? ? ? 1_555 UD DG 14   O6 ? ? AA DC 1655 CH DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3790  hydrog ? ? A  DC 1655 O2 ? ? ? 1_555 UD DG 14   N2 ? ? AA DC 1655 CH DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3791  hydrog ? ? A  DA 1656 N1 ? ? ? 1_555 UD DT 13   N3 ? ? AA DA 1656 CH DT 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3792  hydrog ? ? A  DA 1656 N6 ? ? ? 1_555 UD DT 13   O4 ? ? AA DA 1656 CH DT 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3793  hydrog ? ? A  DA 1657 N1 ? ? ? 1_555 UD DT 12   N3 ? ? AA DA 1657 CH DT 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3794  hydrog ? ? A  DA 1657 N6 ? ? ? 1_555 UD DT 12   O4 ? ? AA DA 1657 CH DT 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3795  hydrog ? ? A  DC 1658 N3 ? ? ? 1_555 UD DG 11   N1 ? ? AA DC 1658 CH DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3796  hydrog ? ? A  DC 1658 N4 ? ? ? 1_555 UD DG 11   O6 ? ? AA DC 1658 CH DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3797  hydrog ? ? A  DC 1658 O2 ? ? ? 1_555 UD DG 11   N2 ? ? AA DC 1658 CH DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3798  hydrog ? ? A  DT 1659 N3 ? ? ? 1_555 AC DA 26   N1 ? ? AA DT 1659 BO DA 26   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3799  hydrog ? ? A  DG 1660 N1 ? ? ? 1_555 AC DC 25   N3 ? ? AA DG 1660 BO DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3800  hydrog ? ? A  DG 1660 N2 ? ? ? 1_555 AC DC 25   O2 ? ? AA DG 1660 BO DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3801  hydrog ? ? A  DG 1660 O6 ? ? ? 1_555 AC DC 25   N4 ? ? AA DG 1660 BO DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3802  hydrog ? ? A  DT 1661 N3 ? ? ? 1_555 AC DA 24   N1 ? ? AA DT 1661 BO DA 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3803  hydrog ? ? A  DT 1661 O4 ? ? ? 1_555 AC DA 24   N6 ? ? AA DT 1661 BO DA 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3804  hydrog ? ? A  DT 1662 N3 ? ? ? 1_555 AC DA 23   N1 ? ? AA DT 1662 BO DA 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3805  hydrog ? ? A  DT 1662 O4 ? ? ? 1_555 AC DA 23   N6 ? ? AA DT 1662 BO DA 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3806  hydrog ? ? A  DA 1663 N1 ? ? ? 1_555 AC DT 22   N3 ? ? AA DA 1663 BO DT 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3807  hydrog ? ? A  DA 1663 N6 ? ? ? 1_555 AC DT 22   O4 ? ? AA DA 1663 BO DT 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3808  hydrog ? ? A  DT 1664 N3 ? ? ? 1_555 AC DA 21   N1 ? ? AA DT 1664 BO DA 21   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3809  hydrog ? ? A  DA 1665 N1 ? ? ? 1_555 AC DT 20   N3 ? ? AA DA 1665 BO DT 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3810  hydrog ? ? A  DA 1665 N6 ? ? ? 1_555 AC DT 20   O4 ? ? AA DA 1665 BO DT 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3811  hydrog ? ? A  DT 1666 N3 ? ? ? 1_555 AC DA 19   N1 ? ? AA DT 1666 BO DA 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3812  hydrog ? ? A  DT 1666 O4 ? ? ? 1_555 AC DA 19   N6 ? ? AA DT 1666 BO DA 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3813  hydrog ? ? A  DG 1667 N1 ? ? ? 1_555 EC DC 14   N3 ? ? AA DG 1667 BS DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3814  hydrog ? ? A  DG 1667 N2 ? ? ? 1_555 EC DC 14   O2 ? ? AA DG 1667 BS DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3815  hydrog ? ? A  DG 1667 O6 ? ? ? 1_555 EC DC 14   N4 ? ? AA DG 1667 BS DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3816  hydrog ? ? A  DG 1668 N1 ? ? ? 1_555 EC DC 13   N3 ? ? AA DG 1668 BS DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3817  hydrog ? ? A  DG 1668 N2 ? ? ? 1_555 EC DC 13   O2 ? ? AA DG 1668 BS DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3818  hydrog ? ? A  DG 1668 O6 ? ? ? 1_555 EC DC 13   N4 ? ? AA DG 1668 BS DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3819  hydrog ? ? A  DA 1669 N1 ? ? ? 1_555 EC DT 12   N3 ? ? AA DA 1669 BS DT 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3820  hydrog ? ? A  DA 1669 N6 ? ? ? 1_555 EC DT 12   O4 ? ? AA DA 1669 BS DT 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3821  hydrog ? ? A  DA 1670 N1 ? ? ? 1_555 EC DT 11   N3 ? ? AA DA 1670 BS DT 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3822  hydrog ? ? A  DA 1670 N6 ? ? ? 1_555 EC DT 11   O4 ? ? AA DA 1670 BS DT 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3823  hydrog ? ? A  DT 1671 N3 ? ? ? 1_555 EC DA 10   N1 ? ? AA DT 1671 BS DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3824  hydrog ? ? A  DT 1671 O4 ? ? ? 1_555 EC DA 10   N6 ? ? AA DT 1671 BS DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3825  hydrog ? ? A  DG 1672 N1 ? ? ? 1_555 EC DC 9    N3 ? ? AA DG 1672 BS DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3826  hydrog ? ? A  DG 1672 N2 ? ? ? 1_555 EC DC 9    O2 ? ? AA DG 1672 BS DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3827  hydrog ? ? A  DG 1672 O6 ? ? ? 1_555 EC DC 9    N4 ? ? AA DG 1672 BS DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3828  hydrog ? ? A  DA 1673 N1 ? ? ? 1_555 EC DT 8    N3 ? ? AA DA 1673 BS DT 8    1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3829  hydrog ? ? A  DA 1674 N1 ? ? ? 1_555 EC DT 7    N3 ? ? AA DA 1674 BS DT 7    1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3830  hydrog ? ? A  DC 1676 N3 ? ? ? 1_555 OD DG 23   N1 ? ? AA DC 1676 CB DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3831  hydrog ? ? A  DC 1676 N4 ? ? ? 1_555 OD DG 23   O6 ? ? AA DC 1676 CB DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3832  hydrog ? ? A  DC 1676 O2 ? ? ? 1_555 OD DG 23   N2 ? ? AA DC 1676 CB DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3833  hydrog ? ? A  DT 1677 N3 ? ? ? 1_555 OD DA 22   N1 ? ? AA DT 1677 CB DA 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3834  hydrog ? ? A  DT 1677 O4 ? ? ? 1_555 OD DA 22   N6 ? ? AA DT 1677 CB DA 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3835  hydrog ? ? A  DT 1678 N3 ? ? ? 1_555 OD DA 21   N1 ? ? AA DT 1678 CB DA 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3836  hydrog ? ? A  DT 1678 O4 ? ? ? 1_555 OD DA 21   N6 ? ? AA DT 1678 CB DA 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3837  hydrog ? ? A  DC 1679 N3 ? ? ? 1_555 OD DG 20   N1 ? ? AA DC 1679 CB DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3838  hydrog ? ? A  DC 1679 N4 ? ? ? 1_555 OD DG 20   O6 ? ? AA DC 1679 CB DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3839  hydrog ? ? A  DC 1679 O2 ? ? ? 1_555 OD DG 20   N2 ? ? AA DC 1679 CB DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3840  hydrog ? ? A  DC 1680 N3 ? ? ? 1_555 OD DG 19   N1 ? ? AA DC 1680 CB DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3841  hydrog ? ? A  DC 1680 N4 ? ? ? 1_555 OD DG 19   O6 ? ? AA DC 1680 CB DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3842  hydrog ? ? A  DC 1680 O2 ? ? ? 1_555 OD DG 19   N2 ? ? AA DC 1680 CB DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3843  hydrog ? ? A  DA 1681 N1 ? ? ? 1_555 OD DT 18   N3 ? ? AA DA 1681 CB DT 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3844  hydrog ? ? A  DA 1681 N6 ? ? ? 1_555 OD DT 18   O4 ? ? AA DA 1681 CB DT 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3845  hydrog ? ? A  DG 1682 N1 ? ? ? 1_555 OD DC 17   N3 ? ? AA DG 1682 CB DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3846  hydrog ? ? A  DG 1682 N2 ? ? ? 1_555 OD DC 17   O2 ? ? AA DG 1682 CB DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3847  hydrog ? ? A  DG 1682 O6 ? ? ? 1_555 OD DC 17   N4 ? ? AA DG 1682 CB DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3848  hydrog ? ? A  DA 1683 N1 ? ? ? 1_555 TD DT 18   N3 ? ? AA DA 1683 CG DT 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3849  hydrog ? ? A  DA 1683 N6 ? ? ? 1_555 TD DT 18   O4 ? ? AA DA 1683 CG DT 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3850  hydrog ? ? A  DC 1684 N3 ? ? ? 1_555 TD DG 17   N1 ? ? AA DC 1684 CG DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3851  hydrog ? ? A  DC 1684 N4 ? ? ? 1_555 TD DG 17   O6 ? ? AA DC 1684 CG DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3852  hydrog ? ? A  DC 1684 O2 ? ? ? 1_555 TD DG 17   N2 ? ? AA DC 1684 CG DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3853  hydrog ? ? A  DA 1685 N1 ? ? ? 1_555 TD DT 16   N3 ? ? AA DA 1685 CG DT 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3854  hydrog ? ? A  DA 1685 N6 ? ? ? 1_555 TD DT 16   O4 ? ? AA DA 1685 CG DT 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3855  hydrog ? ? A  DC 1686 N3 ? ? ? 1_555 TD DG 15   N1 ? ? AA DC 1686 CG DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3856  hydrog ? ? A  DC 1686 N4 ? ? ? 1_555 TD DG 15   O6 ? ? AA DC 1686 CG DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3857  hydrog ? ? A  DC 1686 O2 ? ? ? 1_555 TD DG 15   N2 ? ? AA DC 1686 CG DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3858  hydrog ? ? A  DC 1687 N3 ? ? ? 1_555 TD DG 14   N1 ? ? AA DC 1687 CG DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3859  hydrog ? ? A  DC 1687 N4 ? ? ? 1_555 TD DG 14   O6 ? ? AA DC 1687 CG DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3860  hydrog ? ? A  DC 1687 O2 ? ? ? 1_555 TD DG 14   N2 ? ? AA DC 1687 CG DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3861  hydrog ? ? A  DG 1688 N1 ? ? ? 1_555 TD DC 13   N3 ? ? AA DG 1688 CG DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3862  hydrog ? ? A  DG 1688 N2 ? ? ? 1_555 TD DC 13   O2 ? ? AA DG 1688 CG DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3863  hydrog ? ? A  DG 1688 O6 ? ? ? 1_555 TD DC 13   N4 ? ? AA DG 1688 CG DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3864  hydrog ? ? A  DT 1689 N3 ? ? ? 1_555 TD DA 12   N1 ? ? AA DT 1689 CG DA 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3865  hydrog ? ? A  DT 1689 O4 ? ? ? 1_555 TD DA 12   N6 ? ? AA DT 1689 CG DA 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3866  hydrog ? ? A  DA 1690 N1 ? ? ? 1_555 TD DT 11   N3 ? ? AA DA 1690 CG DT 11   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3867  hydrog ? ? A  DC 1691 N3 ? ? ? 1_555 DC DG 40   N1 ? ? AA DC 1691 BR DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3868  hydrog ? ? A  DC 1691 N4 ? ? ? 1_555 DC DG 40   O6 ? ? AA DC 1691 BR DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3869  hydrog ? ? A  DC 1691 O2 ? ? ? 1_555 DC DG 40   N2 ? ? AA DC 1691 BR DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3870  hydrog ? ? A  DT 1692 N3 ? ? ? 1_555 DC DA 39   N1 ? ? AA DT 1692 BR DA 39   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3871  hydrog ? ? A  DT 1692 O2 ? ? ? 1_555 DC DG 40   N2 ? ? AA DT 1692 BR DG 40   1_555 ? ? ? ? ? ? 'DT-DG MISPAIR'         
? ? 
hydrog3872  hydrog ? ? A  DT 1693 N3 ? ? ? 1_555 DC DA 38   N1 ? ? AA DT 1693 BR DA 38   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3873  hydrog ? ? A  DT 1694 N3 ? ? ? 1_555 DC DA 37   N1 ? ? AA DT 1694 BR DA 37   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3874  hydrog ? ? A  DA 1695 N1 ? ? ? 1_555 DC DT 36   N3 ? ? AA DA 1695 BR DT 36   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3875  hydrog ? ? A  DG 1696 N1 ? ? ? 1_555 DC DC 35   N3 ? ? AA DG 1696 BR DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3876  hydrog ? ? A  DG 1696 N2 ? ? ? 1_555 DC DC 35   O2 ? ? AA DG 1696 BR DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3877  hydrog ? ? A  DG 1696 O6 ? ? ? 1_555 DC DC 35   N4 ? ? AA DG 1696 BR DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3878  hydrog ? ? A  DT 1697 N3 ? ? ? 1_555 DC DA 34   N1 ? ? AA DT 1697 BR DA 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3879  hydrog ? ? A  DT 1697 O4 ? ? ? 1_555 DC DA 34   N6 ? ? AA DT 1697 BR DA 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3880  hydrog ? ? A  DT 1698 N3 ? ? ? 1_555 DC DA 33   N1 ? ? AA DT 1698 BR DA 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3881  hydrog ? ? A  DT 1698 O4 ? ? ? 1_555 DC DA 33   N6 ? ? AA DT 1698 BR DA 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3882  hydrog ? ? A  DG 1699 N1 ? ? ? 1_555 DC DC 22   N3 ? ? AA DG 1699 BR DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3883  hydrog ? ? A  DG 1699 N2 ? ? ? 1_555 DC DC 22   O2 ? ? AA DG 1699 BR DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3884  hydrog ? ? A  DG 1699 O6 ? ? ? 1_555 DC DC 22   N4 ? ? AA DG 1699 BR DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3885  hydrog ? ? A  DC 1700 N3 ? ? ? 1_555 DC DG 21   N1 ? ? AA DC 1700 BR DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3886  hydrog ? ? A  DC 1700 N4 ? ? ? 1_555 DC DG 21   O6 ? ? AA DC 1700 BR DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3887  hydrog ? ? A  DC 1700 O2 ? ? ? 1_555 DC DG 21   N2 ? ? AA DC 1700 BR DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3888  hydrog ? ? A  DA 1701 N1 ? ? ? 1_555 DC DT 20   N3 ? ? AA DA 1701 BR DT 20   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3889  hydrog ? ? A  DT 1702 N3 ? ? ? 1_555 DC DA 19   N1 ? ? AA DT 1702 BR DA 19   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3890  hydrog ? ? A  DA 1703 N1 ? ? ? 1_555 DC DT 18   N3 ? ? AA DA 1703 BR DT 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3891  hydrog ? ? A  DA 1703 N6 ? ? ? 1_555 DC DT 18   O4 ? ? AA DA 1703 BR DT 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3892  hydrog ? ? A  DT 1704 N3 ? ? ? 1_555 DC DA 17   N1 ? ? AA DT 1704 BR DA 17   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3893  hydrog ? ? A  DT 1705 N3 ? ? ? 1_555 DC DA 16   N1 ? ? AA DT 1705 BR DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3894  hydrog ? ? A  DT 1705 O4 ? ? ? 1_555 DC DA 16   N6 ? ? AA DT 1705 BR DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3895  hydrog ? ? A  DT 1706 N3 ? ? ? 1_555 DC DA 15   N1 ? ? AA DT 1706 BR DA 15   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3896  hydrog ? ? A  DA 1707 N1 ? ? ? 1_555 TD DT 26   N3 ? ? AA DA 1707 CG DT 26   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3897  hydrog ? ? A  DA 1708 N1 ? ? ? 1_555 TD DT 25   N3 ? ? AA DA 1708 CG DT 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3898  hydrog ? ? A  DA 1708 N6 ? ? ? 1_555 TD DT 25   O4 ? ? AA DA 1708 CG DT 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3899  hydrog ? ? A  DA 1709 N1 ? ? ? 1_555 TD DT 24   N3 ? ? AA DA 1709 CG DT 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3900  hydrog ? ? A  DA 1709 N6 ? ? ? 1_555 TD DT 24   O4 ? ? AA DA 1709 CG DT 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3901  hydrog ? ? A  DA 1710 N1 ? ? ? 1_555 TD DT 23   N3 ? ? AA DA 1710 CG DT 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3902  hydrog ? ? A  DA 1710 N6 ? ? ? 1_555 TD DT 23   O4 ? ? AA DA 1710 CG DT 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3903  hydrog ? ? A  DC 1711 N3 ? ? ? 1_555 TD DG 22   N1 ? ? AA DC 1711 CG DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3904  hydrog ? ? A  DC 1711 N4 ? ? ? 1_555 TD DG 22   O6 ? ? AA DC 1711 CG DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3905  hydrog ? ? A  DC 1711 O2 ? ? ? 1_555 TD DG 22   N2 ? ? AA DC 1711 CG DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3906  hydrog ? ? A  DA 1712 N1 ? ? ? 1_555 TD DT 21   N3 ? ? AA DA 1712 CG DT 21   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3907  hydrog ? ? A  DT 1713 N3 ? ? ? 1_555 TD DA 20   N1 ? ? AA DT 1713 CG DA 20   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3908  hydrog ? ? A  DG 1714 N1 ? ? ? 1_555 TD DC 19   N3 ? ? AA DG 1714 CG DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3909  hydrog ? ? A  DG 1714 N2 ? ? ? 1_555 TD DC 19   O2 ? ? AA DG 1714 CG DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3910  hydrog ? ? A  DG 1714 O6 ? ? ? 1_555 TD DC 19   N4 ? ? AA DG 1714 CG DC 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3911  hydrog ? ? A  DT 1715 N3 ? ? ? 1_555 OD DA 16   N1 ? ? AA DT 1715 CB DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3912  hydrog ? ? A  DT 1715 O4 ? ? ? 1_555 OD DA 16   N6 ? ? AA DT 1715 CB DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3913  hydrog ? ? A  DT 1716 N3 ? ? ? 1_555 OD DA 15   N1 ? ? AA DT 1716 CB DA 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3914  hydrog ? ? A  DT 1716 O4 ? ? ? 1_555 OD DA 15   N6 ? ? AA DT 1716 CB DA 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3915  hydrog ? ? A  DG 1717 N1 ? ? ? 1_555 OD DC 14   N3 ? ? AA DG 1717 CB DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3916  hydrog ? ? A  DG 1717 N2 ? ? ? 1_555 OD DC 14   O2 ? ? AA DG 1717 CB DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3917  hydrog ? ? A  DG 1717 O6 ? ? ? 1_555 OD DC 14   N4 ? ? AA DG 1717 CB DC 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3918  hydrog ? ? A  DA 1718 N1 ? ? ? 1_555 OD DT 13   N3 ? ? AA DA 1718 CB DT 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3919  hydrog ? ? A  DA 1718 N6 ? ? ? 1_555 OD DT 13   O4 ? ? AA DA 1718 CB DT 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3920  hydrog ? ? A  DG 1719 N1 ? ? ? 1_555 OD DC 12   N3 ? ? AA DG 1719 CB DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3921  hydrog ? ? A  DG 1719 N2 ? ? ? 1_555 OD DC 12   O2 ? ? AA DG 1719 CB DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3922  hydrog ? ? A  DG 1719 O6 ? ? ? 1_555 OD DC 12   N4 ? ? AA DG 1719 CB DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3923  hydrog ? ? A  DC 1720 N3 ? ? ? 1_555 OD DG 11   N1 ? ? AA DC 1720 CB DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3924  hydrog ? ? A  DC 1720 N4 ? ? ? 1_555 OD DG 11   O6 ? ? AA DC 1720 CB DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3925  hydrog ? ? A  DC 1720 O2 ? ? ? 1_555 OD DG 11   N2 ? ? AA DC 1720 CB DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3926  hydrog ? ? A  DT 1721 N3 ? ? ? 1_555 OD DA 10   N1 ? ? AA DT 1721 CB DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3927  hydrog ? ? A  DT 1721 O4 ? ? ? 1_555 OD DA 10   N6 ? ? AA DT 1721 CB DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3928  hydrog ? ? A  DA 1722 N1 ? ? ? 1_555 OD DT 9    N3 ? ? AA DA 1722 CB DT 9    1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3929  hydrog ? ? A  DC 1723 N3 ? ? ? 1_555 ZE DG 34   N1 ? ? AA DC 1723 Ct DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3930  hydrog ? ? A  DC 1723 N4 ? ? ? 1_555 ZE DG 34   O6 ? ? AA DC 1723 Ct DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3931  hydrog ? ? A  DC 1723 O2 ? ? ? 1_555 ZE DG 34   N2 ? ? AA DC 1723 Ct DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3932  hydrog ? ? A  DA 1724 N1 ? ? ? 1_555 ZE DT 33   N3 ? ? AA DA 1724 Ct DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3933  hydrog ? ? A  DA 1724 N6 ? ? ? 1_555 ZE DT 33   O4 ? ? AA DA 1724 Ct DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3934  hydrog ? ? A  DG 1725 N1 ? ? ? 1_555 ZE DC 32   N3 ? ? AA DG 1725 Ct DC 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3935  hydrog ? ? A  DG 1725 N2 ? ? ? 1_555 ZE DC 32   O2 ? ? AA DG 1725 Ct DC 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3936  hydrog ? ? A  DG 1725 O6 ? ? ? 1_555 ZE DC 32   N4 ? ? AA DG 1725 Ct DC 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3937  hydrog ? ? A  DC 1726 N3 ? ? ? 1_555 ZE DG 31   N1 ? ? AA DC 1726 Ct DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3938  hydrog ? ? A  DC 1726 N4 ? ? ? 1_555 ZE DG 31   O6 ? ? AA DC 1726 Ct DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3939  hydrog ? ? A  DC 1726 O2 ? ? ? 1_555 ZE DG 31   N2 ? ? AA DC 1726 Ct DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3940  hydrog ? ? A  DA 1727 N1 ? ? ? 1_555 ZE DT 30   N3 ? ? AA DA 1727 Ct DT 30   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3941  hydrog ? ? A  DT 1728 N3 ? ? ? 1_555 ZE DA 29   N1 ? ? AA DT 1728 Ct DA 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3942  hydrog ? ? A  DT 1728 O4 ? ? ? 1_555 ZE DA 29   N6 ? ? AA DT 1728 Ct DA 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3943  hydrog ? ? A  DT 1729 N3 ? ? ? 1_555 ZE DA 28   N1 ? ? AA DT 1729 Ct DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3944  hydrog ? ? A  DT 1729 O4 ? ? ? 1_555 ZE DA 28   N6 ? ? AA DT 1729 Ct DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3945  hydrog ? ? A  DA 1730 N1 ? ? ? 1_555 ZE DT 27   N3 ? ? AA DA 1730 Ct DT 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3946  hydrog ? ? A  DA 1730 N6 ? ? ? 1_555 ZE DT 27   O4 ? ? AA DA 1730 Ct DT 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3947  hydrog ? ? A  DT 1731 N3 ? ? ? 1_555 ZE DA 26   N1 ? ? AA DT 1731 Ct DA 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3948  hydrog ? ? A  DT 1731 O4 ? ? ? 1_555 ZE DA 26   N6 ? ? AA DT 1731 Ct DA 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3949  hydrog ? ? A  DA 1732 N1 ? ? ? 1_555 ZE DT 25   N3 ? ? AA DA 1732 Ct DT 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3950  hydrog ? ? A  DA 1732 N6 ? ? ? 1_555 ZE DT 25   O4 ? ? AA DA 1732 Ct DT 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3951  hydrog ? ? A  DT 1733 N3 ? ? ? 1_555 ZE DA 24   N1 ? ? AA DT 1733 Ct DA 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3952  hydrog ? ? A  DT 1733 O4 ? ? ? 1_555 ZE DA 24   N6 ? ? AA DT 1733 Ct DA 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3953  hydrog ? ? A  DT 1734 N3 ? ? ? 1_555 ZE DA 13   N1 ? ? AA DT 1734 Ct DA 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3954  hydrog ? ? A  DT 1734 O4 ? ? ? 1_555 ZE DA 13   N6 ? ? AA DT 1734 Ct DA 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3955  hydrog ? ? A  DC 1735 N3 ? ? ? 1_555 ZE DG 12   N1 ? ? AA DC 1735 Ct DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3956  hydrog ? ? A  DC 1735 N4 ? ? ? 1_555 ZE DG 12   O6 ? ? AA DC 1735 Ct DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3957  hydrog ? ? A  DC 1735 O2 ? ? ? 1_555 ZE DG 12   N2 ? ? AA DC 1735 Ct DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3958  hydrog ? ? A  DA 1736 N1 ? ? ? 1_555 ZE DT 11   N3 ? ? AA DA 1736 Ct DT 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3959  hydrog ? ? A  DA 1736 N6 ? ? ? 1_555 ZE DT 11   O4 ? ? AA DA 1736 Ct DT 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3960  hydrog ? ? A  DG 1737 N1 ? ? ? 1_555 NA DC 46   N3 ? ? AA DG 1737 Ag DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3961  hydrog ? ? A  DG 1737 N2 ? ? ? 1_555 NA DC 46   O2 ? ? AA DG 1737 Ag DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3962  hydrog ? ? A  DG 1737 O6 ? ? ? 1_555 NA DC 46   N4 ? ? AA DG 1737 Ag DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3963  hydrog ? ? A  DC 1738 N3 ? ? ? 1_555 NA DG 45   N1 ? ? AA DC 1738 Ag DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3964  hydrog ? ? A  DC 1738 N4 ? ? ? 1_555 NA DG 45   O6 ? ? AA DC 1738 Ag DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3965  hydrog ? ? A  DC 1738 O2 ? ? ? 1_555 NA DG 45   N2 ? ? AA DC 1738 Ag DG 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3966  hydrog ? ? A  DA 1739 N1 ? ? ? 1_555 NA DT 44   N3 ? ? AA DA 1739 Ag DT 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3967  hydrog ? ? A  DA 1739 N6 ? ? ? 1_555 NA DT 44   O4 ? ? AA DA 1739 Ag DT 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3968  hydrog ? ? A  DA 1740 N1 ? ? ? 1_555 NA DT 43   N3 ? ? AA DA 1740 Ag DT 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3969  hydrog ? ? A  DA 1740 N6 ? ? ? 1_555 NA DT 43   O4 ? ? AA DA 1740 Ag DT 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3970  hydrog ? ? A  DT 1741 N3 ? ? ? 1_555 NA DA 42   N1 ? ? AA DT 1741 Ag DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3971  hydrog ? ? A  DT 1741 O4 ? ? ? 1_555 NA DA 42   N6 ? ? AA DT 1741 Ag DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3972  hydrog ? ? A  DT 1742 N3 ? ? ? 1_555 NA DA 41   N1 ? ? AA DT 1742 Ag DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3973  hydrog ? ? A  DT 1742 O4 ? ? ? 1_555 NA DA 41   N6 ? ? AA DT 1742 Ag DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3974  hydrog ? ? A  DA 1743 N6 ? ? ? 1_555 NA DT 39   O4 ? ? AA DA 1743 Ag DT 39   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3975  hydrog ? ? A  DA 1743 N1 ? ? ? 1_555 NA DT 40   N3 ? ? AA DA 1743 Ag DT 40   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3976  hydrog ? ? A  DA 1744 N1 ? ? ? 1_555 NA DT 39   N3 ? ? AA DA 1744 Ag DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3977  hydrog ? ? A  DA 1744 N6 ? ? ? 1_555 NA DT 39   O4 ? ? AA DA 1744 Ag DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3978  hydrog ? ? A  DG 1745 N1 ? ? ? 1_555 TD DC 42   N3 ? ? AA DG 1745 CG DC 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3979  hydrog ? ? A  DG 1745 N2 ? ? ? 1_555 TD DC 42   O2 ? ? AA DG 1745 CG DC 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3980  hydrog ? ? A  DG 1745 O6 ? ? ? 1_555 TD DC 42   N4 ? ? AA DG 1745 CG DC 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3981  hydrog ? ? A  DC 1746 N3 ? ? ? 1_555 TD DG 41   N1 ? ? AA DC 1746 CG DG 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3982  hydrog ? ? A  DC 1746 N4 ? ? ? 1_555 TD DG 41   O6 ? ? AA DC 1746 CG DG 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3983  hydrog ? ? A  DC 1746 O2 ? ? ? 1_555 TD DG 41   N2 ? ? AA DC 1746 CG DG 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3984  hydrog ? ? A  DT 1747 N3 ? ? ? 1_555 TD DA 40   N1 ? ? AA DT 1747 CG DA 40   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3985  hydrog ? ? A  DT 1747 O2 ? ? ? 1_555 TD DG 41   N2 ? ? AA DT 1747 CG DG 41   1_555 ? ? ? ? ? ? 'DT-DG MISPAIR'         
? ? 
hydrog3986  hydrog ? ? A  DC 1748 N3 ? ? ? 1_555 TD DG 39   N1 ? ? AA DC 1748 CG DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3987  hydrog ? ? A  DC 1748 N4 ? ? ? 1_555 TD DG 39   O6 ? ? AA DC 1748 CG DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3988  hydrog ? ? A  DC 1748 O2 ? ? ? 1_555 TD DG 39   N2 ? ? AA DC 1748 CG DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3989  hydrog ? ? A  DT 1749 N3 ? ? ? 1_555 TD DA 38   N1 ? ? AA DT 1749 CG DA 38   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog3990  hydrog ? ? A  DA 1750 N1 ? ? ? 1_555 TD DT 37   N3 ? ? AA DA 1750 CG DT 37   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3991  hydrog ? ? A  DA 1751 N1 ? ? ? 1_555 TD DT 36   N3 ? ? AA DA 1751 CG DT 36   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog3992  hydrog ? ? A  DG 1752 N1 ? ? ? 1_555 TD DC 35   N3 ? ? AA DG 1752 CG DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3993  hydrog ? ? A  DG 1752 N2 ? ? ? 1_555 TD DC 35   O2 ? ? AA DG 1752 CG DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3994  hydrog ? ? A  DG 1752 O6 ? ? ? 1_555 TD DC 35   N4 ? ? AA DG 1752 CG DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3995  hydrog ? ? A  DC 1753 N3 ? ? ? 1_555 TD DG 34   N1 ? ? AA DC 1753 CG DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3996  hydrog ? ? A  DC 1753 N4 ? ? ? 1_555 TD DG 34   O6 ? ? AA DC 1753 CG DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3997  hydrog ? ? A  DC 1753 O2 ? ? ? 1_555 TD DG 34   N2 ? ? AA DC 1753 CG DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3998  hydrog ? ? A  DC 1754 N3 ? ? ? 1_555 TD DG 33   N1 ? ? AA DC 1754 CG DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog3999  hydrog ? ? A  DC 1754 N4 ? ? ? 1_555 TD DG 33   O6 ? ? AA DC 1754 CG DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4000  hydrog ? ? A  DC 1754 O2 ? ? ? 1_555 TD DG 33   N2 ? ? AA DC 1754 CG DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4001  hydrog ? ? A  DA 1755 N1 ? ? ? 1_555 TD DT 32   N3 ? ? AA DA 1755 CG DT 32   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog4002  hydrog ? ? A  DT 1756 N3 ? ? ? 1_555 TD DA 31   N1 ? ? AA DT 1756 CG DA 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4003  hydrog ? ? A  DT 1756 O4 ? ? ? 1_555 TD DA 31   N6 ? ? AA DT 1756 CG DA 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4004  hydrog ? ? A  DC 1757 N3 ? ? ? 1_555 TD DG 30   N1 ? ? AA DC 1757 CG DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4005  hydrog ? ? A  DC 1757 N4 ? ? ? 1_555 TD DG 30   O6 ? ? AA DC 1757 CG DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4006  hydrog ? ? A  DC 1757 O2 ? ? ? 1_555 TD DG 30   N2 ? ? AA DC 1757 CG DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4007  hydrog ? ? A  DC 1758 N3 ? ? ? 1_555 TD DG 29   N1 ? ? AA DC 1758 CG DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4008  hydrog ? ? A  DC 1758 N4 ? ? ? 1_555 TD DG 29   O6 ? ? AA DC 1758 CG DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4009  hydrog ? ? A  DC 1758 O2 ? ? ? 1_555 TD DG 29   N2 ? ? AA DC 1758 CG DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4010  hydrog ? ? A  DG 1759 N1 ? ? ? 1_555 TD DC 28   N3 ? ? AA DG 1759 CG DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4011  hydrog ? ? A  DG 1759 N2 ? ? ? 1_555 TD DC 28   O2 ? ? AA DG 1759 CG DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4012  hydrog ? ? A  DG 1759 O6 ? ? ? 1_555 TD DC 28   N4 ? ? AA DG 1759 CG DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4013  hydrog ? ? A  DC 1760 N3 ? ? ? 1_555 TD DG 27   N1 ? ? AA DC 1760 CG DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4014  hydrog ? ? A  DC 1760 N4 ? ? ? 1_555 TD DG 27   O6 ? ? AA DC 1760 CG DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4015  hydrog ? ? A  DC 1760 O2 ? ? ? 1_555 TD DG 27   N2 ? ? AA DC 1760 CG DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4016  hydrog ? ? A  DA 1761 N1 ? ? ? 1_555 DC DT 14   N3 ? ? AA DA 1761 BR DT 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4017  hydrog ? ? A  DA 1761 N6 ? ? ? 1_555 DC DT 14   O4 ? ? AA DA 1761 BR DT 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4018  hydrog ? ? A  DA 1762 N1 ? ? ? 1_555 DC DT 13   N3 ? ? AA DA 1762 BR DT 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4019  hydrog ? ? A  DA 1762 N6 ? ? ? 1_555 DC DT 13   O4 ? ? AA DA 1762 BR DT 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4020  hydrog ? ? A  DA 1764 N1 ? ? ? 1_555 DC DT 11   N3 ? ? AA DA 1764 BR DT 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4021  hydrog ? ? A  DA 1764 N6 ? ? ? 1_555 DC DT 11   O4 ? ? AA DA 1764 BR DT 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4022  hydrog ? ? A  DA 1765 N1 ? ? ? 1_555 DC DT 10   N3 ? ? AA DA 1765 BR DT 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4023  hydrog ? ? A  DA 1765 N6 ? ? ? 1_555 DC DT 10   O4 ? ? AA DA 1765 BR DT 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4024  hydrog ? ? A  DT 1766 N3 ? ? ? 1_555 DC DA 9    N1 ? ? AA DT 1766 BR DA 1    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4025  hydrog ? ? A  DG 1767 N1 ? ? ? 1_555 RE DC 18   N3 ? ? AA DG 1767 Cf DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4026  hydrog ? ? A  DG 1767 N2 ? ? ? 1_555 RE DC 18   O2 ? ? AA DG 1767 Cf DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4027  hydrog ? ? A  DG 1767 O6 ? ? ? 1_555 RE DC 18   N4 ? ? AA DG 1767 Cf DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4028  hydrog ? ? A  DA 1768 N1 ? ? ? 1_555 RE DT 17   N3 ? ? AA DA 1768 Cf DT 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4029  hydrog ? ? A  DA 1768 N6 ? ? ? 1_555 RE DT 17   O4 ? ? AA DA 1768 Cf DT 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4030  hydrog ? ? A  DC 1769 N3 ? ? ? 1_555 RE DG 16   N1 ? ? AA DC 1769 Cf DG 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4031  hydrog ? ? A  DC 1769 N4 ? ? ? 1_555 RE DG 16   O6 ? ? AA DC 1769 Cf DG 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4032  hydrog ? ? A  DC 1769 O2 ? ? ? 1_555 RE DG 16   N2 ? ? AA DC 1769 Cf DG 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4033  hydrog ? ? A  DC 1770 N3 ? ? ? 1_555 RE DG 15   N1 ? ? AA DC 1770 Cf DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4034  hydrog ? ? A  DC 1770 N4 ? ? ? 1_555 RE DG 15   O6 ? ? AA DC 1770 Cf DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4035  hydrog ? ? A  DC 1770 O2 ? ? ? 1_555 RE DG 15   N2 ? ? AA DC 1770 Cf DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4036  hydrog ? ? A  DT 1771 N3 ? ? ? 1_555 RE DA 14   N1 ? ? AA DT 1771 Cf DA 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4037  hydrog ? ? A  DT 1771 O4 ? ? ? 1_555 RE DA 14   N6 ? ? AA DT 1771 Cf DA 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4038  hydrog ? ? A  DC 1772 N3 ? ? ? 1_555 RE DG 13   N1 ? ? AA DC 1772 Cf DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4039  hydrog ? ? A  DC 1772 N4 ? ? ? 1_555 RE DG 13   O6 ? ? AA DC 1772 Cf DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4040  hydrog ? ? A  DC 1772 O2 ? ? ? 1_555 RE DG 13   N2 ? ? AA DC 1772 Cf DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4041  hydrog ? ? A  DT 1773 N3 ? ? ? 1_555 RE DA 12   N1 ? ? AA DT 1773 Cf DA 12   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4042  hydrog ? ? A  DT 1774 N3 ? ? ? 1_555 RE DA 11   N1 ? ? AA DT 1774 Cf DA 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4043  hydrog ? ? A  DT 1774 O4 ? ? ? 1_555 RE DA 11   N6 ? ? AA DT 1774 Cf DA 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4044  hydrog ? ? A  DA 1775 N1 ? ? ? 1_555 OD DT 32   N3 ? ? AA DA 1775 CB DT 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4045  hydrog ? ? A  DA 1775 N6 ? ? ? 1_555 OD DT 32   O4 ? ? AA DA 1775 CB DT 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4046  hydrog ? ? A  DT 1776 N3 ? ? ? 1_555 OD DG 30   O6 ? ? AA DT 1776 CB DG 30   1_555 ? ? ? ? ? ? TYPE_28_PAIR            
? ? 
hydrog4047  hydrog ? ? A  DT 1776 O2 ? ? ? 1_555 OD DG 30   N1 ? ? AA DT 1776 CB DG 30   1_555 ? ? ? ? ? ? TYPE_28_PAIR            
? ? 
hydrog4048  hydrog ? ? A  DT 1776 N3 ? ? ? 1_555 OD DA 31   N1 ? ? AA DT 1776 CB DA 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4049  hydrog ? ? A  DT 1776 O4 ? ? ? 1_555 OD DA 31   N6 ? ? AA DT 1776 CB DA 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4050  hydrog ? ? A  DC 1777 N3 ? ? ? 1_555 OD DG 30   N1 ? ? AA DC 1777 CB DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4051  hydrog ? ? A  DC 1777 N4 ? ? ? 1_555 OD DG 30   O6 ? ? AA DC 1777 CB DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4052  hydrog ? ? A  DC 1777 O2 ? ? ? 1_555 OD DG 30   N2 ? ? AA DC 1777 CB DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4053  hydrog ? ? A  DA 1778 N1 ? ? ? 1_555 OD DT 29   N3 ? ? AA DA 1778 CB DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4054  hydrog ? ? A  DA 1778 N6 ? ? ? 1_555 OD DT 29   O4 ? ? AA DA 1778 CB DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4055  hydrog ? ? A  DA 1779 N1 ? ? ? 1_555 OD DT 28   N3 ? ? AA DA 1779 CB DT 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4056  hydrog ? ? A  DA 1779 N6 ? ? ? 1_555 OD DT 28   O4 ? ? AA DA 1779 CB DT 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4057  hydrog ? ? A  DA 1780 N1 ? ? ? 1_555 OD DT 27   N3 ? ? AA DA 1780 CB DT 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4058  hydrog ? ? A  DA 1780 N6 ? ? ? 1_555 OD DT 27   O4 ? ? AA DA 1780 CB DT 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4059  hydrog ? ? A  DA 1781 N1 ? ? ? 1_555 OD DT 26   N3 ? ? AA DA 1781 CB DT 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4060  hydrog ? ? A  DA 1781 N6 ? ? ? 1_555 OD DT 26   O4 ? ? AA DA 1781 CB DT 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4061  hydrog ? ? A  DG 1782 N1 ? ? ? 1_555 OD DC 25   N3 ? ? AA DG 1782 CB DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4062  hydrog ? ? A  DG 1782 N2 ? ? ? 1_555 OD DC 25   O2 ? ? AA DG 1782 CB DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4063  hydrog ? ? A  DG 1782 O6 ? ? ? 1_555 OD DC 25   N4 ? ? AA DG 1782 CB DC 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4064  hydrog ? ? A  DG 1783 N1 ? ? ? 1_555 EC DC 6    N3 ? ? AA DG 1783 BS DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4065  hydrog ? ? A  DG 1783 N2 ? ? ? 1_555 EC DC 6    O2 ? ? AA DG 1783 BS DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4066  hydrog ? ? A  DG 1783 O6 ? ? ? 1_555 EC DC 6    N4 ? ? AA DG 1783 BS DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4067  hydrog ? ? A  DA 1784 N1 ? ? ? 1_555 EC DT 5    N3 ? ? AA DA 1784 BS DT 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4068  hydrog ? ? A  DA 1784 N6 ? ? ? 1_555 EC DT 5    O4 ? ? AA DA 1784 BS DT 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4069  hydrog ? ? A  DG 1785 N1 ? ? ? 1_555 EC DC 4    N3 ? ? AA DG 1785 BS DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4070  hydrog ? ? A  DG 1785 N2 ? ? ? 1_555 EC DC 4    O2 ? ? AA DG 1785 BS DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4071  hydrog ? ? A  DG 1785 O6 ? ? ? 1_555 EC DC 4    N4 ? ? AA DG 1785 BS DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4072  hydrog ? ? A  DC 1786 N3 ? ? ? 1_555 EC DG 3    N1 ? ? AA DC 1786 BS DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4073  hydrog ? ? A  DC 1786 N4 ? ? ? 1_555 EC DG 3    O6 ? ? AA DC 1786 BS DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4074  hydrog ? ? A  DC 1786 O2 ? ? ? 1_555 EC DG 3    N2 ? ? AA DC 1786 BS DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4075  hydrog ? ? A  DA 1787 N1 ? ? ? 1_555 EC DT 2    N3 ? ? AA DA 1787 BS DT 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4076  hydrog ? ? A  DA 1787 N6 ? ? ? 1_555 EC DT 2    O4 ? ? AA DA 1787 BS DT 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4077  hydrog ? ? A  DA 1788 N1 ? ? ? 1_555 EC DT 1    N3 ? ? AA DA 1788 BS DT 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4078  hydrog ? ? A  DA 1788 N6 ? ? ? 1_555 EC DT 1    O4 ? ? AA DA 1788 BS DT 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4079  hydrog ? ? A  DT 1789 N3 ? ? ? 1_555 NA DA 48   N1 ? ? AA DT 1789 Ag DA 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4080  hydrog ? ? A  DT 1789 O4 ? ? ? 1_555 NA DA 48   N6 ? ? AA DT 1789 Ag DA 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4081  hydrog ? ? A  DT 1790 N3 ? ? ? 1_555 NA DA 47   N1 ? ? AA DT 1790 Ag DA 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4082  hydrog ? ? A  DT 1790 O4 ? ? ? 1_555 NA DA 47   N6 ? ? AA DT 1790 Ag DA 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4083  hydrog ? ? A  DA 1791 N1 ? ? ? 1_555 ZE DT 10   N3 ? ? AA DA 1791 Ct DT 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4084  hydrog ? ? A  DA 1791 N6 ? ? ? 1_555 ZE DT 10   O4 ? ? AA DA 1791 Ct DT 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4085  hydrog ? ? A  DA 1792 N1 ? ? ? 1_555 ZE DT 9    N3 ? ? AA DA 1792 Ct DT 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4086  hydrog ? ? A  DA 1792 N6 ? ? ? 1_555 ZE DT 9    O4 ? ? AA DA 1792 Ct DT 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4087  hydrog ? ? A  DA 1793 N1 ? ? ? 1_555 ZE DT 8    N3 ? ? AA DA 1793 Ct DT 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4088  hydrog ? ? A  DA 1793 N6 ? ? ? 1_555 ZE DT 8    O4 ? ? AA DA 1793 Ct DT 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4089  hydrog ? ? A  DG 1794 N1 ? ? ? 1_555 ZE DC 7    N3 ? ? AA DG 1794 Ct DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4090  hydrog ? ? A  DG 1794 N2 ? ? ? 1_555 ZE DC 7    O2 ? ? AA DG 1794 Ct DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4091  hydrog ? ? A  DG 1794 O6 ? ? ? 1_555 ZE DC 7    N4 ? ? AA DG 1794 Ct DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4092  hydrog ? ? A  DG 1795 N1 ? ? ? 1_555 ZE DC 6    N3 ? ? AA DG 1795 Ct DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4093  hydrog ? ? A  DG 1795 N2 ? ? ? 1_555 ZE DC 6    O2 ? ? AA DG 1795 Ct DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4094  hydrog ? ? A  DG 1795 O6 ? ? ? 1_555 ZE DC 6    N4 ? ? AA DG 1795 Ct DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4095  hydrog ? ? A  DT 1796 N3 ? ? ? 1_555 ZE DA 5    N1 ? ? AA DT 1796 Ct DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4096  hydrog ? ? A  DT 1796 O4 ? ? ? 1_555 ZE DA 5    N6 ? ? AA DT 1796 Ct DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4097  hydrog ? ? A  DA 1797 N1 ? ? ? 1_555 ZE DT 4    N3 ? ? AA DA 1797 Ct DT 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4098  hydrog ? ? A  DA 1797 N6 ? ? ? 1_555 ZE DT 4    O4 ? ? AA DA 1797 Ct DT 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4099  hydrog ? ? A  DC 1798 N3 ? ? ? 1_555 ZE DG 3    N1 ? ? AA DC 1798 Ct DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4100  hydrog ? ? A  DC 1798 N4 ? ? ? 1_555 ZE DG 3    O6 ? ? AA DC 1798 Ct DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4101  hydrog ? ? A  DC 1798 O2 ? ? ? 1_555 ZE DG 3    N2 ? ? AA DC 1798 Ct DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4102  hydrog ? ? A  DT 1799 N3 ? ? ? 1_555 SD DA 38   N1 ? ? AA DT 1799 CF DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4103  hydrog ? ? A  DT 1799 O4 ? ? ? 1_555 SD DA 38   N6 ? ? AA DT 1799 CF DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4104  hydrog ? ? A  DC 1800 N3 ? ? ? 1_555 SD DG 37   N1 ? ? AA DC 1800 CF DG 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4105  hydrog ? ? A  DC 1800 N4 ? ? ? 1_555 SD DG 37   O6 ? ? AA DC 1800 CF DG 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4106  hydrog ? ? A  DC 1800 O2 ? ? ? 1_555 SD DG 37   N2 ? ? AA DC 1800 CF DG 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4107  hydrog ? ? A  DT 1801 N3 ? ? ? 1_555 SD DA 36   N1 ? ? AA DT 1801 CF DA 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4108  hydrog ? ? A  DT 1801 O4 ? ? ? 1_555 SD DA 36   N6 ? ? AA DT 1801 CF DA 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4109  hydrog ? ? A  DC 1802 N3 ? ? ? 1_555 SD DG 35   N1 ? ? AA DC 1802 CF DG 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4110  hydrog ? ? A  DC 1802 N4 ? ? ? 1_555 SD DG 35   O6 ? ? AA DC 1802 CF DG 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4111  hydrog ? ? A  DC 1802 O2 ? ? ? 1_555 SD DG 35   N2 ? ? AA DC 1802 CF DG 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4112  hydrog ? ? A  DT 1803 N3 ? ? ? 1_555 SD DA 34   N1 ? ? AA DT 1803 CF DA 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4113  hydrog ? ? A  DT 1803 O4 ? ? ? 1_555 SD DA 34   N6 ? ? AA DT 1803 CF DA 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4114  hydrog ? ? A  DA 1804 N1 ? ? ? 1_555 SD DT 33   N3 ? ? AA DA 1804 CF DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4115  hydrog ? ? A  DA 1804 N6 ? ? ? 1_555 SD DT 33   O4 ? ? AA DA 1804 CF DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4116  hydrog ? ? A  DA 1805 N1 ? ? ? 1_555 SD DT 32   N3 ? ? AA DA 1805 CF DT 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4117  hydrog ? ? A  DA 1805 N6 ? ? ? 1_555 SD DT 32   O4 ? ? AA DA 1805 CF DT 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4118  hydrog ? ? A  DT 1806 N3 ? ? ? 1_555 SD DA 31   N1 ? ? AA DT 1806 CF DA 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4119  hydrog ? ? A  DT 1806 O4 ? ? ? 1_555 SD DA 31   N6 ? ? AA DT 1806 CF DA 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4120  hydrog ? ? A  DC 1807 N3 ? ? ? 1_555 PD DG 37   N1 ? ? AA DC 1807 CC DG 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4121  hydrog ? ? A  DC 1807 N4 ? ? ? 1_555 PD DG 37   O6 ? ? AA DC 1807 CC DG 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4122  hydrog ? ? A  DC 1807 O2 ? ? ? 1_555 PD DG 37   N2 ? ? AA DC 1807 CC DG 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4123  hydrog ? ? A  DC 1808 N3 ? ? ? 1_555 PD DG 36   N1 ? ? AA DC 1808 CC DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4124  hydrog ? ? A  DC 1808 N4 ? ? ? 1_555 PD DG 36   O6 ? ? AA DC 1808 CC DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4125  hydrog ? ? A  DC 1808 O2 ? ? ? 1_555 PD DG 36   N2 ? ? AA DC 1808 CC DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4126  hydrog ? ? A  DT 1809 N3 ? ? ? 1_555 PD DA 35   N1 ? ? AA DT 1809 CC DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4127  hydrog ? ? A  DT 1809 O4 ? ? ? 1_555 PD DA 35   N6 ? ? AA DT 1809 CC DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4128  hydrog ? ? A  DG 1810 N1 ? ? ? 1_555 PD DC 34   N3 ? ? AA DG 1810 CC DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4129  hydrog ? ? A  DG 1810 N2 ? ? ? 1_555 PD DC 34   O2 ? ? AA DG 1810 CC DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4130  hydrog ? ? A  DG 1810 O6 ? ? ? 1_555 PD DC 34   N4 ? ? AA DG 1810 CC DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4131  hydrog ? ? A  DA 1811 N1 ? ? ? 1_555 PD DT 33   N3 ? ? AA DA 1811 CC DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4132  hydrog ? ? A  DA 1811 N6 ? ? ? 1_555 PD DT 33   O4 ? ? AA DA 1811 CC DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4133  hydrog ? ? A  DC 1812 N3 ? ? ? 1_555 PD DG 32   N1 ? ? AA DC 1812 CC DG 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4134  hydrog ? ? A  DC 1812 N4 ? ? ? 1_555 PD DG 32   O6 ? ? AA DC 1812 CC DG 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4135  hydrog ? ? A  DC 1812 O2 ? ? ? 1_555 PD DG 32   N2 ? ? AA DC 1812 CC DG 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4136  hydrog ? ? A  DC 1813 N3 ? ? ? 1_555 PD DG 31   N1 ? ? AA DC 1813 CC DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4137  hydrog ? ? A  DC 1813 N4 ? ? ? 1_555 PD DG 31   O6 ? ? AA DC 1813 CC DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4138  hydrog ? ? A  DC 1813 O2 ? ? ? 1_555 PD DG 31   N2 ? ? AA DC 1813 CC DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4139  hydrog ? ? A  DT 1814 N3 ? ? ? 1_555 PD DA 30   N1 ? ? AA DT 1814 CC DA 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4140  hydrog ? ? A  DT 1814 O4 ? ? ? 1_555 PD DA 30   N6 ? ? AA DT 1814 CC DA 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4141  hydrog ? ? A  DG 1815 N1 ? ? ? 1_555 FF DC 38   N3 ? ? AA DG 1815 Cz DC 38   1_555 ? ? ? ? ? ? 'DG-DC PAIR'            
? ? 
hydrog4142  hydrog ? ? A  DT 1816 N3 ? ? ? 1_555 FF DA 37   N1 ? ? AA DT 1816 Cz DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4143  hydrog ? ? A  DT 1816 O4 ? ? ? 1_555 FF DA 37   N6 ? ? AA DT 1816 Cz DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4144  hydrog ? ? A  DT 1817 N3 ? ? ? 1_555 FF DA 36   N1 ? ? AA DT 1817 Cz DA 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4145  hydrog ? ? A  DT 1817 O4 ? ? ? 1_555 FF DA 36   N6 ? ? AA DT 1817 Cz DA 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4146  hydrog ? ? A  DG 1818 N1 ? ? ? 1_555 FF DC 35   N3 ? ? AA DG 1818 Cz DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4147  hydrog ? ? A  DG 1818 N2 ? ? ? 1_555 FF DC 35   O2 ? ? AA DG 1818 Cz DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4148  hydrog ? ? A  DG 1818 O6 ? ? ? 1_555 FF DC 35   N4 ? ? AA DG 1818 Cz DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4149  hydrog ? ? A  DG 1819 N1 ? ? ? 1_555 FF DC 34   N3 ? ? AA DG 1819 Cz DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4150  hydrog ? ? A  DG 1819 N2 ? ? ? 1_555 FF DC 34   O2 ? ? AA DG 1819 Cz DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4151  hydrog ? ? A  DG 1819 O6 ? ? ? 1_555 FF DC 34   N4 ? ? AA DG 1819 Cz DC 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4152  hydrog ? ? A  DA 1820 N1 ? ? ? 1_555 FF DT 33   N3 ? ? AA DA 1820 Cz DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4153  hydrog ? ? A  DA 1820 N6 ? ? ? 1_555 FF DT 33   O4 ? ? AA DA 1820 Cz DT 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4154  hydrog ? ? A  DG 1821 N1 ? ? ? 1_555 FF DC 32   N3 ? ? AA DG 1821 Cz DC 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4155  hydrog ? ? A  DG 1821 N2 ? ? ? 1_555 FF DC 32   O2 ? ? AA DG 1821 Cz DC 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4156  hydrog ? ? A  DG 1821 O6 ? ? ? 1_555 FF DC 32   N4 ? ? AA DG 1821 Cz DC 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4157  hydrog ? ? A  DT 1822 N3 ? ? ? 1_555 FF DA 31   N1 ? ? AA DT 1822 Cz DA 31   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4158  hydrog ? ? A  DT 1823 N3 ? ? ? 1_555 YE DA 30   N1 ? ? AA DT 1823 Cs DA 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4159  hydrog ? ? A  DT 1823 O4 ? ? ? 1_555 YE DA 30   N6 ? ? AA DT 1823 Cs DA 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4160  hydrog ? ? A  DT 1824 N3 ? ? ? 1_555 YE DA 29   N1 ? ? AA DT 1824 Cs DA 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4161  hydrog ? ? A  DT 1824 O4 ? ? ? 1_555 YE DA 29   N6 ? ? AA DT 1824 Cs DA 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4162  hydrog ? ? A  DG 1825 N1 ? ? ? 1_555 YE DC 28   N3 ? ? AA DG 1825 Cs DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4163  hydrog ? ? A  DG 1825 N2 ? ? ? 1_555 YE DC 28   O2 ? ? AA DG 1825 Cs DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4164  hydrog ? ? A  DG 1825 O6 ? ? ? 1_555 YE DC 28   N4 ? ? AA DG 1825 Cs DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4165  hydrog ? ? A  DC 1826 N3 ? ? ? 1_555 YE DG 27   N1 ? ? AA DC 1826 Cs DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4166  hydrog ? ? A  DC 1826 N4 ? ? ? 1_555 YE DG 27   O6 ? ? AA DC 1826 Cs DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4167  hydrog ? ? A  DC 1826 O2 ? ? ? 1_555 YE DG 27   N2 ? ? AA DC 1826 Cs DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4168  hydrog ? ? A  DT 1827 N3 ? ? ? 1_555 YE DA 26   N1 ? ? AA DT 1827 Cs DA 26   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4169  hydrog ? ? A  DT 1828 N3 ? ? ? 1_555 YE DA 25   N1 ? ? AA DT 1828 Cs DA 25   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4170  hydrog ? ? A  DC 1829 N3 ? ? ? 1_555 YE DG 24   N1 ? ? AA DC 1829 Cs DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4171  hydrog ? ? A  DC 1829 N4 ? ? ? 1_555 YE DG 24   O6 ? ? AA DC 1829 Cs DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4172  hydrog ? ? A  DC 1829 O2 ? ? ? 1_555 YE DG 24   N2 ? ? AA DC 1829 Cs DG 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4173  hydrog ? ? A  DC 1830 N3 ? ? ? 1_555 YE DG 23   N1 ? ? AA DC 1830 Cs DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4174  hydrog ? ? A  DC 1830 N4 ? ? ? 1_555 YE DG 23   O6 ? ? AA DC 1830 Cs DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4175  hydrog ? ? A  DC 1830 O2 ? ? ? 1_555 YE DG 23   N2 ? ? AA DC 1830 Cs DG 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4176  hydrog ? ? A  DG 1831 N1 ? ? ? 1_555 TE DC 18   N3 ? ? AA DG 1831 Ch DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4177  hydrog ? ? A  DG 1831 N2 ? ? ? 1_555 TE DC 18   O2 ? ? AA DG 1831 Ch DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4178  hydrog ? ? A  DG 1831 O6 ? ? ? 1_555 TE DC 18   N4 ? ? AA DG 1831 Ch DC 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4179  hydrog ? ? A  DG 1832 N1 ? ? ? 1_555 TE DC 17   N3 ? ? AA DG 1832 Ch DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4180  hydrog ? ? A  DG 1832 N2 ? ? ? 1_555 TE DC 17   O2 ? ? AA DG 1832 Ch DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4181  hydrog ? ? A  DG 1832 O6 ? ? ? 1_555 TE DC 17   N4 ? ? AA DG 1832 Ch DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4182  hydrog ? ? A  DT 1833 N3 ? ? ? 1_555 TE DA 16   N1 ? ? AA DT 1833 Ch DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4183  hydrog ? ? A  DT 1833 O4 ? ? ? 1_555 TE DA 16   N6 ? ? AA DT 1833 Ch DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4184  hydrog ? ? A  DC 1834 N3 ? ? ? 1_555 TE DG 15   N1 ? ? AA DC 1834 Ch DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4185  hydrog ? ? A  DC 1834 N4 ? ? ? 1_555 TE DG 15   O6 ? ? AA DC 1834 Ch DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4186  hydrog ? ? A  DC 1834 O2 ? ? ? 1_555 TE DG 15   N2 ? ? AA DC 1834 Ch DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4187  hydrog ? ? A  DT 1835 N3 ? ? ? 1_555 TE DA 14   N1 ? ? AA DT 1835 Ch DA 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4188  hydrog ? ? A  DT 1835 O4 ? ? ? 1_555 TE DA 14   N6 ? ? AA DT 1835 Ch DA 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4189  hydrog ? ? A  DG 1836 N1 ? ? ? 1_555 TE DC 13   N3 ? ? AA DG 1836 Ch DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4190  hydrog ? ? A  DG 1836 N2 ? ? ? 1_555 TE DC 13   O2 ? ? AA DG 1836 Ch DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4191  hydrog ? ? A  DG 1836 O6 ? ? ? 1_555 TE DC 13   N4 ? ? AA DG 1836 Ch DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4192  hydrog ? ? A  DG 1837 N1 ? ? ? 1_555 TE DC 12   N3 ? ? AA DG 1837 Ch DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4193  hydrog ? ? A  DG 1837 N2 ? ? ? 1_555 TE DC 12   O2 ? ? AA DG 1837 Ch DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4194  hydrog ? ? A  DG 1837 O6 ? ? ? 1_555 TE DC 12   N4 ? ? AA DG 1837 Ch DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4195  hydrog ? ? A  DT 1838 N3 ? ? ? 1_555 TE DA 11   N1 ? ? AA DT 1838 Ch DA 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4196  hydrog ? ? A  DT 1838 O4 ? ? ? 1_555 TE DA 11   N6 ? ? AA DT 1838 Ch DA 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4197  hydrog ? ? A  DT 1839 N3 ? ? ? 1_555 VE DA 22   N1 ? ? AA DT 1839 Cp DA 22   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4198  hydrog ? ? A  DC 1840 N3 ? ? ? 1_555 VE DG 21   N1 ? ? AA DC 1840 Cp DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4199  hydrog ? ? A  DC 1840 N4 ? ? ? 1_555 VE DG 21   O6 ? ? AA DC 1840 Cp DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4200  hydrog ? ? A  DC 1840 O2 ? ? ? 1_555 VE DG 21   N2 ? ? AA DC 1840 Cp DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4201  hydrog ? ? A  DG 1841 N1 ? ? ? 1_555 VE DC 20   N3 ? ? AA DG 1841 Cp DC 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4202  hydrog ? ? A  DG 1841 N2 ? ? ? 1_555 VE DC 20   O2 ? ? AA DG 1841 Cp DC 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4203  hydrog ? ? A  DG 1841 O6 ? ? ? 1_555 VE DC 20   N4 ? ? AA DG 1841 Cp DC 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4204  hydrog ? ? A  DC 1842 N3 ? ? ? 1_555 VE DG 19   N1 ? ? AA DC 1842 Cp DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4205  hydrog ? ? A  DC 1842 N4 ? ? ? 1_555 VE DG 19   O6 ? ? AA DC 1842 Cp DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4206  hydrog ? ? A  DC 1842 O2 ? ? ? 1_555 VE DG 19   N2 ? ? AA DC 1842 Cp DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4207  hydrog ? ? A  DT 1843 N3 ? ? ? 1_555 VE DA 18   N1 ? ? AA DT 1843 Cp DA 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4208  hydrog ? ? A  DT 1843 O4 ? ? ? 1_555 VE DA 18   N6 ? ? AA DT 1843 Cp DA 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4209  hydrog ? ? A  DT 1844 N3 ? ? ? 1_555 VE DA 17   N1 ? ? AA DT 1844 Cp DA 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4210  hydrog ? ? A  DT 1844 O4 ? ? ? 1_555 VE DA 17   N6 ? ? AA DT 1844 Cp DA 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4211  hydrog ? ? A  DT 1845 N3 ? ? ? 1_555 VE DA 16   N1 ? ? AA DT 1845 Cp DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4212  hydrog ? ? A  DT 1845 O4 ? ? ? 1_555 VE DA 16   N6 ? ? AA DT 1845 Cp DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4213  hydrog ? ? A  DG 1846 N1 ? ? ? 1_555 VE DC 15   N3 ? ? AA DG 1846 Cp DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4214  hydrog ? ? A  DG 1846 N2 ? ? ? 1_555 VE DC 15   O2 ? ? AA DG 1846 Cp DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4215  hydrog ? ? A  DG 1846 O6 ? ? ? 1_555 VE DC 15   N4 ? ? AA DG 1846 Cp DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4216  hydrog ? ? A  DA 1847 N1 ? ? ? 1_555 VE DT 14   N3 ? ? AA DA 1847 Cp DT 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4217  hydrog ? ? A  DA 1847 N6 ? ? ? 1_555 VE DT 14   O4 ? ? AA DA 1847 Cp DT 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4218  hydrog ? ? A  DA 1848 N1 ? ? ? 1_555 VE DT 13   N3 ? ? AA DA 1848 Cp DT 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4219  hydrog ? ? A  DA 1848 N6 ? ? ? 1_555 VE DT 13   O4 ? ? AA DA 1848 Cp DT 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4220  hydrog ? ? A  DG 1849 N1 ? ? ? 1_555 VE DC 12   N3 ? ? AA DG 1849 Cp DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4221  hydrog ? ? A  DG 1849 N2 ? ? ? 1_555 VE DC 12   O2 ? ? AA DG 1849 Cp DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4222  hydrog ? ? A  DG 1849 O6 ? ? ? 1_555 VE DC 12   N4 ? ? AA DG 1849 Cp DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4223  hydrog ? ? A  DC 1850 N3 ? ? ? 1_555 VE DG 11   N1 ? ? AA DC 1850 Cp DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4224  hydrog ? ? A  DC 1850 N4 ? ? ? 1_555 VE DG 11   O6 ? ? AA DC 1850 Cp DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4225  hydrog ? ? A  DC 1850 O2 ? ? ? 1_555 VE DG 11   N2 ? ? AA DC 1850 Cp DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4226  hydrog ? ? A  DT 1851 N3 ? ? ? 1_555 VE DA 10   N1 ? ? AA DT 1851 Cp DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4227  hydrog ? ? A  DT 1851 O4 ? ? ? 1_555 VE DA 10   N6 ? ? AA DT 1851 Cp DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4228  hydrog ? ? A  DC 1852 N3 ? ? ? 1_555 VE DG 9    N1 ? ? AA DC 1852 Cp DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4229  hydrog ? ? A  DC 1852 N4 ? ? ? 1_555 VE DG 9    O6 ? ? AA DC 1852 Cp DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4230  hydrog ? ? A  DC 1852 O2 ? ? ? 1_555 VE DG 9    N2 ? ? AA DC 1852 Cp DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4231  hydrog ? ? A  DG 1853 N1 ? ? ? 1_555 VE DC 8    N3 ? ? AA DG 1853 Cp DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4232  hydrog ? ? A  DG 1853 N2 ? ? ? 1_555 VE DC 8    O2 ? ? AA DG 1853 Cp DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4233  hydrog ? ? A  DG 1853 O6 ? ? ? 1_555 VE DC 8    N4 ? ? AA DG 1853 Cp DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4234  hydrog ? ? A  DA 1854 N1 ? ? ? 1_555 VE DT 7    N3 ? ? AA DA 1854 Cp DT 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4235  hydrog ? ? A  DA 1854 N6 ? ? ? 1_555 VE DT 7    O4 ? ? AA DA 1854 Cp DT 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4236  hydrog ? ? A  DA 1855 N1 ? ? ? 1_555 QE DT 42   N3 ? ? AA DA 1855 Ce DT 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4237  hydrog ? ? A  DA 1855 N6 ? ? ? 1_555 QE DT 42   O4 ? ? AA DA 1855 Ce DT 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4238  hydrog ? ? A  DT 1856 N3 ? ? ? 1_555 QE DA 41   N1 ? ? AA DT 1856 Ce DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4239  hydrog ? ? A  DT 1856 O4 ? ? ? 1_555 QE DA 41   N6 ? ? AA DT 1856 Ce DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4240  hydrog ? ? A  DT 1857 N3 ? ? ? 1_555 QE DA 40   N1 ? ? AA DT 1857 Ce DA 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4241  hydrog ? ? A  DT 1857 O4 ? ? ? 1_555 QE DA 40   N6 ? ? AA DT 1857 Ce DA 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4242  hydrog ? ? A  DA 1858 N1 ? ? ? 1_555 QE DT 39   N3 ? ? AA DA 1858 Ce DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4243  hydrog ? ? A  DA 1858 N6 ? ? ? 1_555 QE DT 39   O4 ? ? AA DA 1858 Ce DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4244  hydrog ? ? A  DA 1859 N1 ? ? ? 1_555 QE DT 38   N3 ? ? AA DA 1859 Ce DT 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4245  hydrog ? ? A  DA 1859 N6 ? ? ? 1_555 QE DT 38   O4 ? ? AA DA 1859 Ce DT 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4246  hydrog ? ? A  DA 1860 N1 ? ? ? 1_555 QE DT 37   N3 ? ? AA DA 1860 Ce DT 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4247  hydrog ? ? A  DA 1860 N6 ? ? ? 1_555 QE DT 37   O4 ? ? AA DA 1860 Ce DT 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4248  hydrog ? ? A  DA 1861 N1 ? ? ? 1_555 QE DT 36   N3 ? ? AA DA 1861 Ce DT 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4249  hydrog ? ? A  DA 1861 N6 ? ? ? 1_555 QE DT 36   O4 ? ? AA DA 1861 Ce DT 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4250  hydrog ? ? A  DC 1862 N3 ? ? ? 1_555 QE DG 35   N1 ? ? AA DC 1862 Ce DG 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4251  hydrog ? ? A  DC 1862 N4 ? ? ? 1_555 QE DG 35   O6 ? ? AA DC 1862 Ce DG 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4252  hydrog ? ? A  DC 1862 O2 ? ? ? 1_555 QE DG 35   N2 ? ? AA DC 1862 Ce DG 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4253  hydrog ? ? A  DG 1863 N1 ? ? ? 1_555 VE DC 30   N3 ? ? AA DG 1863 Cp DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4254  hydrog ? ? A  DG 1863 N2 ? ? ? 1_555 VE DC 30   O2 ? ? AA DG 1863 Cp DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4255  hydrog ? ? A  DG 1863 O6 ? ? ? 1_555 VE DC 30   N4 ? ? AA DG 1863 Cp DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4256  hydrog ? ? A  DC 1864 N3 ? ? ? 1_555 VE DG 29   N1 ? ? AA DC 1864 Cp DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4257  hydrog ? ? A  DC 1864 N4 ? ? ? 1_555 VE DG 29   O6 ? ? AA DC 1864 Cp DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4258  hydrog ? ? A  DC 1864 O2 ? ? ? 1_555 VE DG 29   N2 ? ? AA DC 1864 Cp DG 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4259  hydrog ? ? A  DG 1865 N1 ? ? ? 1_555 VE DC 28   N3 ? ? AA DG 1865 Cp DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4260  hydrog ? ? A  DG 1865 N2 ? ? ? 1_555 VE DC 28   O2 ? ? AA DG 1865 Cp DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4261  hydrog ? ? A  DG 1865 O6 ? ? ? 1_555 VE DC 28   N4 ? ? AA DG 1865 Cp DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4262  hydrog ? ? A  DA 1866 N1 ? ? ? 1_555 VE DT 27   N3 ? ? AA DA 1866 Cp DT 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4263  hydrog ? ? A  DA 1866 N6 ? ? ? 1_555 VE DT 27   O4 ? ? AA DA 1866 Cp DT 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4264  hydrog ? ? A  DT 1867 N3 ? ? ? 1_555 VE DA 26   N1 ? ? AA DT 1867 Cp DA 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4265  hydrog ? ? A  DT 1867 O4 ? ? ? 1_555 VE DA 26   N6 ? ? AA DT 1867 Cp DA 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4266  hydrog ? ? A  DA 1868 N1 ? ? ? 1_555 VE DT 25   N3 ? ? AA DA 1868 Cp DT 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4267  hydrog ? ? A  DA 1868 N6 ? ? ? 1_555 VE DT 25   O4 ? ? AA DA 1868 Cp DT 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4268  hydrog ? ? A  DT 1869 N3 ? ? ? 1_555 VE DA 24   N1 ? ? AA DT 1869 Cp DA 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4269  hydrog ? ? A  DT 1869 O4 ? ? ? 1_555 VE DA 24   N6 ? ? AA DT 1869 Cp DA 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4270  hydrog ? ? A  DT 1870 N3 ? ? ? 1_555 VE DA 23   N1 ? ? AA DT 1870 Cp DA 23   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4271  hydrog ? ? A  DT 1871 N3 ? ? ? 1_555 TE DA 10   N1 ? ? AA DT 1871 Ch DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4272  hydrog ? ? A  DT 1871 O4 ? ? ? 1_555 TE DA 10   N6 ? ? AA DT 1871 Ch DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4273  hydrog ? ? A  DG 1872 N1 ? ? ? 1_555 TE DC 9    N3 ? ? AA DG 1872 Ch DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4274  hydrog ? ? A  DG 1872 N2 ? ? ? 1_555 TE DC 9    O2 ? ? AA DG 1872 Ch DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4275  hydrog ? ? A  DG 1872 O6 ? ? ? 1_555 TE DC 9    N4 ? ? AA DG 1872 Ch DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4276  hydrog ? ? A  DA 1873 N1 ? ? ? 1_555 TE DT 8    N3 ? ? AA DA 1873 Ch DT 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4277  hydrog ? ? A  DA 1873 N6 ? ? ? 1_555 TE DT 8    O4 ? ? AA DA 1873 Ch DT 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4278  hydrog ? ? A  DA 1874 N1 ? ? ? 1_555 TE DT 7    N3 ? ? AA DA 1874 Ch DT 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4279  hydrog ? ? A  DA 1874 N6 ? ? ? 1_555 TE DT 7    O4 ? ? AA DA 1874 Ch DT 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4280  hydrog ? ? A  DG 1875 N1 ? ? ? 1_555 TE DC 6    N3 ? ? AA DG 1875 Ch DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4281  hydrog ? ? A  DG 1875 N2 ? ? ? 1_555 TE DC 6    O2 ? ? AA DG 1875 Ch DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4282  hydrog ? ? A  DG 1875 O6 ? ? ? 1_555 TE DC 6    N4 ? ? AA DG 1875 Ch DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4283  hydrog ? ? A  DT 1876 N3 ? ? ? 1_555 TE DA 5    N1 ? ? AA DT 1876 Ch DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4284  hydrog ? ? A  DT 1876 O4 ? ? ? 1_555 TE DA 5    N6 ? ? AA DT 1876 Ch DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4285  hydrog ? ? A  DC 1877 N3 ? ? ? 1_555 TE DG 4    N1 ? ? AA DC 1877 Ch DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4286  hydrog ? ? A  DC 1877 N4 ? ? ? 1_555 TE DG 4    O6 ? ? AA DC 1877 Ch DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4287  hydrog ? ? A  DC 1877 O2 ? ? ? 1_555 TE DG 4    N2 ? ? AA DC 1877 Ch DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4288  hydrog ? ? A  DT 1878 N3 ? ? ? 1_555 TE DA 3    N1 ? ? AA DT 1878 Ch DA 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4289  hydrog ? ? A  DT 1878 O4 ? ? ? 1_555 TE DA 3    N6 ? ? AA DT 1878 Ch DA 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4290  hydrog ? ? A  DT 1879 N3 ? ? ? 1_555 CC DA 6    N1 ? ? AA DT 1879 BQ DA 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4291  hydrog ? ? A  DT 1879 O4 ? ? ? 1_555 CC DA 6    N6 ? ? AA DT 1879 BQ DA 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4292  hydrog ? ? A  DT 1880 N3 ? ? ? 1_555 CC DA 5    N1 ? ? AA DT 1880 BQ DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4293  hydrog ? ? A  DT 1880 O4 ? ? ? 1_555 CC DA 5    N6 ? ? AA DT 1880 BQ DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4294  hydrog ? ? A  DC 1881 N3 ? ? ? 1_555 CC DG 4    N1 ? ? AA DC 1881 BQ DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4295  hydrog ? ? A  DC 1881 N4 ? ? ? 1_555 CC DG 4    O6 ? ? AA DC 1881 BQ DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4296  hydrog ? ? A  DC 1881 O2 ? ? ? 1_555 CC DG 4    N2 ? ? AA DC 1881 BQ DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4297  hydrog ? ? A  DG 1882 N1 ? ? ? 1_555 CC DC 3    N3 ? ? AA DG 1882 BQ DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4298  hydrog ? ? A  DG 1882 N2 ? ? ? 1_555 CC DC 3    O2 ? ? AA DG 1882 BQ DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4299  hydrog ? ? A  DG 1882 O6 ? ? ? 1_555 CC DC 3    N4 ? ? AA DG 1882 BQ DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4300  hydrog ? ? A  DG 1883 N1 ? ? ? 1_555 CC DC 2    N3 ? ? AA DG 1883 BQ DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4301  hydrog ? ? A  DG 1883 N2 ? ? ? 1_555 CC DC 2    O2 ? ? AA DG 1883 BQ DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4302  hydrog ? ? A  DG 1883 O6 ? ? ? 1_555 CC DC 2    N4 ? ? AA DG 1883 BQ DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4303  hydrog ? ? A  DG 1884 N1 ? ? ? 1_555 CC DC 1    N3 ? ? AA DG 1884 BQ DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4304  hydrog ? ? A  DG 1884 N2 ? ? ? 1_555 CC DC 1    O2 ? ? AA DG 1884 BQ DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4305  hydrog ? ? A  DG 1884 O6 ? ? ? 1_555 CC DC 1    N4 ? ? AA DG 1884 BQ DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4306  hydrog ? ? A  DC 1885 N3 ? ? ? 1_555 T  DG 60   N1 ? ? AA DC 1885 AK DG 60   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4307  hydrog ? ? A  DC 1885 N4 ? ? ? 1_555 T  DG 60   O6 ? ? AA DC 1885 AK DG 60   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4308  hydrog ? ? A  DC 1885 O2 ? ? ? 1_555 T  DG 60   N2 ? ? AA DC 1885 AK DG 60   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4309  hydrog ? ? A  DT 1886 N3 ? ? ? 1_555 T  DA 59   N1 ? ? AA DT 1886 AK DA 59   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4310  hydrog ? ? A  DT 1886 O4 ? ? ? 1_555 T  DA 59   N6 ? ? AA DT 1886 AK DA 59   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4311  hydrog ? ? A  DT 1887 N3 ? ? ? 1_555 LD DA 10   N1 ? ? AA DT 1887 C6 DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4312  hydrog ? ? A  DT 1887 O4 ? ? ? 1_555 LD DA 10   N6 ? ? AA DT 1887 C6 DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4313  hydrog ? ? A  DC 1888 N3 ? ? ? 1_555 LD DG 9    N1 ? ? AA DC 1888 C6 DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4314  hydrog ? ? A  DC 1888 N4 ? ? ? 1_555 LD DG 9    O6 ? ? AA DC 1888 C6 DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4315  hydrog ? ? A  DC 1888 O2 ? ? ? 1_555 LD DG 9    N2 ? ? AA DC 1888 C6 DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4316  hydrog ? ? A  DC 1889 N3 ? ? ? 1_555 LD DG 8    N1 ? ? AA DC 1889 C6 DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4317  hydrog ? ? A  DC 1889 N4 ? ? ? 1_555 LD DG 8    O6 ? ? AA DC 1889 C6 DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4318  hydrog ? ? A  DC 1889 O2 ? ? ? 1_555 LD DG 8    N2 ? ? AA DC 1889 C6 DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4319  hydrog ? ? A  DT 1890 N3 ? ? ? 1_555 LD DA 7    N1 ? ? AA DT 1890 C6 DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4320  hydrog ? ? A  DT 1890 O4 ? ? ? 1_555 LD DA 7    N6 ? ? AA DT 1890 C6 DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4321  hydrog ? ? A  DC 1891 N3 ? ? ? 1_555 LD DG 6    N1 ? ? AA DC 1891 C6 DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4322  hydrog ? ? A  DC 1891 N4 ? ? ? 1_555 LD DG 6    O6 ? ? AA DC 1891 C6 DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4323  hydrog ? ? A  DC 1891 O2 ? ? ? 1_555 LD DG 6    N2 ? ? AA DC 1891 C6 DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4324  hydrog ? ? A  DT 1892 N3 ? ? ? 1_555 LD DA 5    N1 ? ? AA DT 1892 C6 DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4325  hydrog ? ? A  DT 1892 O4 ? ? ? 1_555 LD DA 5    N6 ? ? AA DT 1892 C6 DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4326  hydrog ? ? A  DT 1893 N3 ? ? ? 1_555 LD DA 4    N1 ? ? AA DT 1893 C6 DA 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4327  hydrog ? ? A  DT 1893 O4 ? ? ? 1_555 LD DA 4    N6 ? ? AA DT 1893 C6 DA 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4328  hydrog ? ? A  DA 1894 N1 ? ? ? 1_555 LD DT 3    N3 ? ? AA DA 1894 C6 DT 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4329  hydrog ? ? A  DA 1894 N6 ? ? ? 1_555 LD DT 3    O4 ? ? AA DA 1894 C6 DT 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4330  hydrog ? ? A  DA 1895 N1 ? ? ? 1_555 PD DT 45   N3 ? ? AA DA 1895 CC DT 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4331  hydrog ? ? A  DA 1895 N6 ? ? ? 1_555 PD DT 45   O4 ? ? AA DA 1895 CC DT 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4332  hydrog ? ? A  DT 1896 N3 ? ? ? 1_555 PD DA 44   N1 ? ? AA DT 1896 CC DA 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4333  hydrog ? ? A  DT 1896 O4 ? ? ? 1_555 PD DA 44   N6 ? ? AA DT 1896 CC DA 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4334  hydrog ? ? A  DC 1897 N3 ? ? ? 1_555 PD DG 43   N1 ? ? AA DC 1897 CC DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4335  hydrog ? ? A  DC 1897 N4 ? ? ? 1_555 PD DG 43   O6 ? ? AA DC 1897 CC DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4336  hydrog ? ? A  DC 1897 O2 ? ? ? 1_555 PD DG 43   N2 ? ? AA DC 1897 CC DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4337  hydrog ? ? A  DT 1898 N3 ? ? ? 1_555 PD DA 42   N1 ? ? AA DT 1898 CC DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4338  hydrog ? ? A  DT 1898 O4 ? ? ? 1_555 PD DA 42   N6 ? ? AA DT 1898 CC DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4339  hydrog ? ? A  DT 1899 N3 ? ? ? 1_555 PD DA 41   N1 ? ? AA DT 1899 CC DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4340  hydrog ? ? A  DT 1899 O4 ? ? ? 1_555 PD DA 41   N6 ? ? AA DT 1899 CC DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4341  hydrog ? ? A  DT 1900 N3 ? ? ? 1_555 PD DA 40   N1 ? ? AA DT 1900 CC DA 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4342  hydrog ? ? A  DT 1900 O4 ? ? ? 1_555 PD DA 40   N6 ? ? AA DT 1900 CC DA 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4343  hydrog ? ? A  DT 1901 N3 ? ? ? 1_555 PD DA 39   N1 ? ? AA DT 1901 CC DA 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4344  hydrog ? ? A  DT 1901 O4 ? ? ? 1_555 PD DA 39   N6 ? ? AA DT 1901 CC DA 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4345  hydrog ? ? A  DT 1902 N3 ? ? ? 1_555 PD DA 38   N1 ? ? AA DT 1902 CC DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4346  hydrog ? ? A  DT 1902 O4 ? ? ? 1_555 PD DA 38   N6 ? ? AA DT 1902 CC DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4347  hydrog ? ? A  DG 1903 N1 ? ? ? 1_555 SD DC 30   N3 ? ? AA DG 1903 CF DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4348  hydrog ? ? A  DG 1903 N2 ? ? ? 1_555 SD DC 30   O2 ? ? AA DG 1903 CF DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4349  hydrog ? ? A  DG 1903 O6 ? ? ? 1_555 SD DC 30   N4 ? ? AA DG 1903 CF DC 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4350  hydrog ? ? A  DA 1904 N1 ? ? ? 1_555 SD DT 29   N3 ? ? AA DA 1904 CF DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4351  hydrog ? ? A  DA 1904 N6 ? ? ? 1_555 SD DT 29   O4 ? ? AA DA 1904 CF DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4352  hydrog ? ? A  DT 1905 N3 ? ? ? 1_555 SD DA 28   N1 ? ? AA DT 1905 CF DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4353  hydrog ? ? A  DT 1905 O4 ? ? ? 1_555 SD DA 28   N6 ? ? AA DT 1905 CF DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4354  hydrog ? ? A  DG 1906 N1 ? ? ? 1_555 SD DC 27   N3 ? ? AA DG 1906 CF DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4355  hydrog ? ? A  DG 1906 N2 ? ? ? 1_555 SD DC 27   O2 ? ? AA DG 1906 CF DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4356  hydrog ? ? A  DG 1906 O6 ? ? ? 1_555 SD DC 27   N4 ? ? AA DG 1906 CF DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4357  hydrog ? ? A  DC 1907 N3 ? ? ? 1_555 SD DG 26   N1 ? ? AA DC 1907 CF DG 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4358  hydrog ? ? A  DC 1907 N4 ? ? ? 1_555 SD DG 26   O6 ? ? AA DC 1907 CF DG 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4359  hydrog ? ? A  DC 1907 O2 ? ? ? 1_555 SD DG 26   N2 ? ? AA DC 1907 CF DG 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4360  hydrog ? ? A  DA 1908 N1 ? ? ? 1_555 SD DT 25   N3 ? ? AA DA 1908 CF DT 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4361  hydrog ? ? A  DA 1908 N6 ? ? ? 1_555 SD DT 25   O4 ? ? AA DA 1908 CF DT 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4362  hydrog ? ? A  DA 1909 N1 ? ? ? 1_555 SD DT 24   N3 ? ? AA DA 1909 CF DT 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4363  hydrog ? ? A  DA 1909 N6 ? ? ? 1_555 SD DT 24   O4 ? ? AA DA 1909 CF DT 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4364  hydrog ? ? A  DT 1910 N3 ? ? ? 1_555 SD DA 23   N1 ? ? AA DT 1910 CF DA 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4365  hydrog ? ? A  DT 1910 O4 ? ? ? 1_555 SD DA 23   N6 ? ? AA DT 1910 CF DA 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4366  hydrog ? ? A  DC 1911 N3 ? ? ? 1_555 AC DG 10   N1 ? ? AA DC 1911 BO DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4367  hydrog ? ? A  DC 1911 N4 ? ? ? 1_555 AC DG 10   O6 ? ? AA DC 1911 BO DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4368  hydrog ? ? A  DC 1911 O2 ? ? ? 1_555 AC DG 10   N2 ? ? AA DC 1911 BO DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4369  hydrog ? ? A  DC 1912 N3 ? ? ? 1_555 AC DG 9    N1 ? ? AA DC 1912 BO DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4370  hydrog ? ? A  DC 1912 N4 ? ? ? 1_555 AC DG 9    O6 ? ? AA DC 1912 BO DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4371  hydrog ? ? A  DC 1912 O2 ? ? ? 1_555 AC DG 9    N2 ? ? AA DC 1912 BO DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4372  hydrog ? ? A  DG 1913 N1 ? ? ? 1_555 AC DC 8    N3 ? ? AA DG 1913 BO DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4373  hydrog ? ? A  DG 1913 N2 ? ? ? 1_555 AC DC 8    O2 ? ? AA DG 1913 BO DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4374  hydrog ? ? A  DG 1913 O6 ? ? ? 1_555 AC DC 8    N4 ? ? AA DG 1913 BO DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4375  hydrog ? ? A  DC 1914 N3 ? ? ? 1_555 AC DG 7    N1 ? ? AA DC 1914 BO DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4376  hydrog ? ? A  DC 1914 N4 ? ? ? 1_555 AC DG 7    O6 ? ? AA DC 1914 BO DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4377  hydrog ? ? A  DC 1914 O2 ? ? ? 1_555 AC DG 7    N2 ? ? AA DC 1914 BO DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4378  hydrog ? ? A  DT 1915 N3 ? ? ? 1_555 AC DA 6    N1 ? ? AA DT 1915 BO DA 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4379  hydrog ? ? A  DT 1915 O4 ? ? ? 1_555 AC DA 6    N6 ? ? AA DT 1915 BO DA 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4380  hydrog ? ? A  DT 1916 N3 ? ? ? 1_555 AC DA 5    N1 ? ? AA DT 1916 BO DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4381  hydrog ? ? A  DT 1916 O4 ? ? ? 1_555 AC DA 5    N6 ? ? AA DT 1916 BO DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4382  hydrog ? ? A  DT 1917 N3 ? ? ? 1_555 AC DA 4    N1 ? ? AA DT 1917 BO DA 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4383  hydrog ? ? A  DT 1917 O4 ? ? ? 1_555 AC DA 4    N6 ? ? AA DT 1917 BO DA 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4384  hydrog ? ? A  DG 1918 N1 ? ? ? 1_555 AC DC 3    N3 ? ? AA DG 1918 BO DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4385  hydrog ? ? A  DG 1918 N2 ? ? ? 1_555 AC DC 3    O2 ? ? AA DG 1918 BO DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4386  hydrog ? ? A  DG 1918 O6 ? ? ? 1_555 AC DC 3    N4 ? ? AA DG 1918 BO DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4387  hydrog ? ? A  DC 1919 N3 ? ? ? 1_555 HD DG 46   N1 ? ? AA DC 1919 C2 DG 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4388  hydrog ? ? A  DC 1919 N4 ? ? ? 1_555 HD DG 46   O6 ? ? AA DC 1919 C2 DG 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4389  hydrog ? ? A  DC 1919 O2 ? ? ? 1_555 HD DG 46   N2 ? ? AA DC 1919 C2 DG 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4390  hydrog ? ? A  DT 1920 N3 ? ? ? 1_555 HD DA 45   N1 ? ? AA DT 1920 C2 DA 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4391  hydrog ? ? A  DT 1920 O4 ? ? ? 1_555 HD DA 45   N6 ? ? AA DT 1920 C2 DA 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4392  hydrog ? ? A  DT 1921 N3 ? ? ? 1_555 HD DA 44   N1 ? ? AA DT 1921 C2 DA 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4393  hydrog ? ? A  DT 1921 O4 ? ? ? 1_555 HD DA 44   N6 ? ? AA DT 1921 C2 DA 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4394  hydrog ? ? A  DC 1922 N3 ? ? ? 1_555 HD DG 43   N1 ? ? AA DC 1922 C2 DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4395  hydrog ? ? A  DC 1922 N4 ? ? ? 1_555 HD DG 43   O6 ? ? AA DC 1922 C2 DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4396  hydrog ? ? A  DC 1922 O2 ? ? ? 1_555 HD DG 43   N2 ? ? AA DC 1922 C2 DG 43   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4397  hydrog ? ? A  DT 1923 N3 ? ? ? 1_555 HD DA 42   N1 ? ? AA DT 1923 C2 DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4398  hydrog ? ? A  DT 1923 O4 ? ? ? 1_555 HD DA 42   N6 ? ? AA DT 1923 C2 DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4399  hydrog ? ? A  DG 1924 N1 ? ? ? 1_555 HD DC 41   N3 ? ? AA DG 1924 C2 DC 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4400  hydrog ? ? A  DG 1924 N2 ? ? ? 1_555 HD DC 41   O2 ? ? AA DG 1924 C2 DC 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4401  hydrog ? ? A  DG 1924 O6 ? ? ? 1_555 HD DC 41   N4 ? ? AA DG 1924 C2 DC 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4402  hydrog ? ? A  DA 1925 N1 ? ? ? 1_555 HD DT 40   N3 ? ? AA DA 1925 C2 DT 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4403  hydrog ? ? A  DA 1925 N6 ? ? ? 1_555 HD DT 40   O4 ? ? AA DA 1925 C2 DT 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4404  hydrog ? ? A  DC 1926 N3 ? ? ? 1_555 HD DG 39   N1 ? ? AA DC 1926 C2 DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4405  hydrog ? ? A  DC 1926 N4 ? ? ? 1_555 HD DG 39   O6 ? ? AA DC 1926 C2 DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4406  hydrog ? ? A  DC 1926 O2 ? ? ? 1_555 HD DG 39   N2 ? ? AA DC 1926 C2 DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4407  hydrog ? ? A  DT 1927 N3 ? ? ? 1_555 OD DA 40   N1 ? ? AA DT 1927 CB DA 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4408  hydrog ? ? A  DT 1927 O4 ? ? ? 1_555 OD DA 40   N6 ? ? AA DT 1927 CB DA 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4409  hydrog ? ? A  DA 1928 N1 ? ? ? 1_555 OD DT 39   N3 ? ? AA DA 1928 CB DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4410  hydrog ? ? A  DA 1928 N6 ? ? ? 1_555 OD DT 39   O4 ? ? AA DA 1928 CB DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4411  hydrog ? ? A  DT 1929 N3 ? ? ? 1_555 OD DA 38   N1 ? ? AA DT 1929 CB DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4412  hydrog ? ? A  DT 1929 O4 ? ? ? 1_555 OD DA 38   N6 ? ? AA DT 1929 CB DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4413  hydrog ? ? A  DA 1930 N1 ? ? ? 1_555 OD DT 37   N3 ? ? AA DA 1930 CB DT 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4414  hydrog ? ? A  DA 1930 N6 ? ? ? 1_555 OD DT 37   O4 ? ? AA DA 1930 CB DT 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4415  hydrog ? ? A  DA 1931 N1 ? ? ? 1_555 OD DT 36   N3 ? ? AA DA 1931 CB DT 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4416  hydrog ? ? A  DA 1931 N6 ? ? ? 1_555 OD DT 36   O4 ? ? AA DA 1931 CB DT 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4417  hydrog ? ? A  DT 1932 N3 ? ? ? 1_555 OD DA 35   N1 ? ? AA DT 1932 CB DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4418  hydrog ? ? A  DT 1932 O4 ? ? ? 1_555 OD DA 35   N6 ? ? AA DT 1932 CB DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4419  hydrog ? ? A  DA 1933 N1 ? ? ? 1_555 OD DT 34   N3 ? ? AA DA 1933 CB DT 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4420  hydrog ? ? A  DA 1933 N6 ? ? ? 1_555 OD DT 34   O4 ? ? AA DA 1933 CB DT 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4421  hydrog ? ? A  DG 1934 N1 ? ? ? 1_555 OD DC 33   N3 ? ? AA DG 1934 CB DC 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4422  hydrog ? ? A  DG 1934 N2 ? ? ? 1_555 OD DC 33   O2 ? ? AA DG 1934 CB DC 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4423  hydrog ? ? A  DG 1934 O6 ? ? ? 1_555 OD DC 33   N4 ? ? AA DG 1934 CB DC 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4424  hydrog ? ? A  DT 1935 N3 ? ? ? 1_555 RE DA 10   N1 ? ? AA DT 1935 Cf DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4425  hydrog ? ? A  DT 1935 O4 ? ? ? 1_555 RE DA 10   N6 ? ? AA DT 1935 Cf DA 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4426  hydrog ? ? A  DC 1936 N3 ? ? ? 1_555 RE DG 9    N1 ? ? AA DC 1936 Cf DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4427  hydrog ? ? A  DC 1936 N4 ? ? ? 1_555 RE DG 9    O6 ? ? AA DC 1936 Cf DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4428  hydrog ? ? A  DC 1936 O2 ? ? ? 1_555 RE DG 9    N2 ? ? AA DC 1936 Cf DG 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4429  hydrog ? ? A  DA 1937 N1 ? ? ? 1_555 RE DT 8    N3 ? ? AA DA 1937 Cf DT 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4430  hydrog ? ? A  DA 1937 N6 ? ? ? 1_555 RE DT 8    O4 ? ? AA DA 1937 Cf DT 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4431  hydrog ? ? A  DG 1938 N1 ? ? ? 1_555 RE DC 7    N3 ? ? AA DG 1938 Cf DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4432  hydrog ? ? A  DG 1938 N2 ? ? ? 1_555 RE DC 7    O2 ? ? AA DG 1938 Cf DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4433  hydrog ? ? A  DG 1938 O6 ? ? ? 1_555 RE DC 7    N4 ? ? AA DG 1938 Cf DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4434  hydrog ? ? A  DG 1939 N1 ? ? ? 1_555 RE DC 6    N3 ? ? AA DG 1939 Cf DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4435  hydrog ? ? A  DG 1939 N2 ? ? ? 1_555 RE DC 6    O2 ? ? AA DG 1939 Cf DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4436  hydrog ? ? A  DG 1939 O6 ? ? ? 1_555 RE DC 6    N4 ? ? AA DG 1939 Cf DC 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4437  hydrog ? ? A  DG 1940 N1 ? ? ? 1_555 RE DC 5    N3 ? ? AA DG 1940 Cf DC 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4438  hydrog ? ? A  DG 1940 N2 ? ? ? 1_555 RE DC 5    O2 ? ? AA DG 1940 Cf DC 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4439  hydrog ? ? A  DG 1940 O6 ? ? ? 1_555 RE DC 5    N4 ? ? AA DG 1940 Cf DC 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4440  hydrog ? ? A  DT 1941 N3 ? ? ? 1_555 RE DA 4    N1 ? ? AA DT 1941 Cf DA 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4441  hydrog ? ? A  DT 1941 O4 ? ? ? 1_555 RE DA 4    N6 ? ? AA DT 1941 Cf DA 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4442  hydrog ? ? A  DA 1942 N1 ? ? ? 1_555 RE DT 3    N3 ? ? AA DA 1942 Cf DT 3    1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog4443  hydrog ? ? A  DA 1944 N1 ? ? ? 1_555 BC DT 17   N3 ? ? AA DA 1944 BP DT 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4444  hydrog ? ? A  DA 1944 N6 ? ? ? 1_555 BC DT 17   O4 ? ? AA DA 1944 BP DT 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4445  hydrog ? ? A  DG 1945 N1 ? ? ? 1_555 BC DC 16   N3 ? ? AA DG 1945 BP DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4446  hydrog ? ? A  DG 1945 N2 ? ? ? 1_555 BC DC 16   O2 ? ? AA DG 1945 BP DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4447  hydrog ? ? A  DG 1945 O6 ? ? ? 1_555 BC DC 16   N4 ? ? AA DG 1945 BP DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4448  hydrog ? ? A  DA 1946 N1 ? ? ? 1_555 BC DT 15   N3 ? ? AA DA 1946 BP DT 15   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog4449  hydrog ? ? A  DC 1947 N3 ? ? ? 1_555 BC DG 14   N1 ? ? AA DC 1947 BP DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4450  hydrog ? ? A  DC 1947 N4 ? ? ? 1_555 BC DG 14   O6 ? ? AA DC 1947 BP DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4451  hydrog ? ? A  DC 1947 O2 ? ? ? 1_555 BC DG 14   N2 ? ? AA DC 1947 BP DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4452  hydrog ? ? A  DC 1948 N3 ? ? ? 1_555 BC DG 13   N1 ? ? AA DC 1948 BP DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4453  hydrog ? ? A  DC 1948 N4 ? ? ? 1_555 BC DG 13   O6 ? ? AA DC 1948 BP DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4454  hydrog ? ? A  DC 1948 O2 ? ? ? 1_555 BC DG 13   N2 ? ? AA DC 1948 BP DG 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4455  hydrog ? ? A  DT 1949 N3 ? ? ? 1_555 BC DA 12   N1 ? ? AA DT 1949 BP DA 12   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4456  hydrog ? ? A  DG 1950 N1 ? ? ? 1_555 BC DC 11   N3 ? ? AA DG 1950 BP DC 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4457  hydrog ? ? A  DG 1950 N2 ? ? ? 1_555 BC DC 11   O2 ? ? AA DG 1950 BP DC 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4458  hydrog ? ? A  DG 1950 O6 ? ? ? 1_555 BC DC 11   N4 ? ? AA DG 1950 BP DC 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4459  hydrog ? ? A  DA 1951 N1 ? ? ? 1_555 BC DT 10   N3 ? ? AA DA 1951 BP DT 10   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog4460  hydrog ? ? A  DT 1952 N3 ? ? ? 1_555 BC DA 9    N1 ? ? AA DT 1952 BP DA 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4461  hydrog ? ? A  DT 1952 O4 ? ? ? 1_555 BC DA 9    N6 ? ? AA DT 1952 BP DA 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4462  hydrog ? ? A  DT 1953 N3 ? ? ? 1_555 BC DA 8    N1 ? ? AA DT 1953 BP DA 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4463  hydrog ? ? A  DT 1953 O4 ? ? ? 1_555 BC DA 8    N6 ? ? AA DT 1953 BP DA 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4464  hydrog ? ? A  DT 1954 N3 ? ? ? 1_555 BC DA 7    N1 ? ? AA DT 1954 BP DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4465  hydrog ? ? A  DT 1954 O4 ? ? ? 1_555 BC DA 7    N6 ? ? AA DT 1954 BP DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4466  hydrog ? ? A  DT 1956 N3 ? ? ? 1_555 JD DA 66   N1 ? ? AA DT 1956 C4 DA 66   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4467  hydrog ? ? A  DG 1957 N1 ? ? ? 1_555 JD DC 65   N3 ? ? AA DG 1957 C4 DC 65   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4468  hydrog ? ? A  DG 1957 N2 ? ? ? 1_555 JD DC 65   O2 ? ? AA DG 1957 C4 DC 65   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4469  hydrog ? ? A  DG 1957 O6 ? ? ? 1_555 JD DC 65   N4 ? ? AA DG 1957 C4 DC 65   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4470  hydrog ? ? A  DA 1958 N1 ? ? ? 1_555 JD DT 64   N3 ? ? AA DA 1958 C4 DT 64   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4471  hydrog ? ? A  DA 1958 N6 ? ? ? 1_555 JD DT 64   O4 ? ? AA DA 1958 C4 DT 64   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4472  hydrog ? ? A  DT 1959 N3 ? ? ? 1_555 JD DA 63   N1 ? ? AA DT 1959 C4 DA 63   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4473  hydrog ? ? A  DT 1959 O4 ? ? ? 1_555 JD DA 63   N6 ? ? AA DT 1959 C4 DA 63   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4474  hydrog ? ? A  DT 1960 N3 ? ? ? 1_555 JD DA 62   N1 ? ? AA DT 1960 C4 DA 62   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4475  hydrog ? ? A  DT 1960 O4 ? ? ? 1_555 JD DA 62   N6 ? ? AA DT 1960 C4 DA 62   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4476  hydrog ? ? A  DT 1961 N3 ? ? ? 1_555 GD DA 30   N1 ? ? AA DT 1961 C1 DA 30   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4477  hydrog ? ? A  DA 1962 N1 ? ? ? 1_555 GD DT 29   N3 ? ? AA DA 1962 C1 DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4478  hydrog ? ? A  DA 1962 N6 ? ? ? 1_555 GD DT 29   O4 ? ? AA DA 1962 C1 DT 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4479  hydrog ? ? A  DT 1963 N3 ? ? ? 1_555 GD DA 28   N1 ? ? AA DT 1963 C1 DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4480  hydrog ? ? A  DT 1963 O4 ? ? ? 1_555 GD DA 28   N6 ? ? AA DT 1963 C1 DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4481  hydrog ? ? A  DG 1964 N1 ? ? ? 1_555 GD DC 27   N3 ? ? AA DG 1964 C1 DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4482  hydrog ? ? A  DG 1964 N2 ? ? ? 1_555 GD DC 27   O2 ? ? AA DG 1964 C1 DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4483  hydrog ? ? A  DG 1964 O6 ? ? ? 1_555 GD DC 27   N4 ? ? AA DG 1964 C1 DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4484  hydrog ? ? A  DG 1965 O6 ? ? ? 1_555 GD DC 26   N4 ? ? AA DG 1965 C1 DC 26   1_555 ? ? ? ? ? ? 'DG-DC PAIR'            
? ? 
hydrog4485  hydrog ? ? A  DT 1966 N3 ? ? ? 1_555 GD DA 15   N1 ? ? AA DT 1966 C1 DA 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4486  hydrog ? ? A  DT 1966 O4 ? ? ? 1_555 GD DA 15   N6 ? ? AA DT 1966 C1 DA 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4487  hydrog ? ? A  DC 1967 N3 ? ? ? 1_555 GD DG 14   N1 ? ? AA DC 1967 C1 DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4488  hydrog ? ? A  DC 1967 N4 ? ? ? 1_555 GD DG 14   O6 ? ? AA DC 1967 C1 DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4489  hydrog ? ? A  DC 1967 O2 ? ? ? 1_555 GD DG 14   N2 ? ? AA DC 1967 C1 DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4490  hydrog ? ? A  DA 1968 N1 ? ? ? 1_555 GD DT 13   N3 ? ? AA DA 1968 C1 DT 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4491  hydrog ? ? A  DA 1968 N6 ? ? ? 1_555 GD DT 13   O4 ? ? AA DA 1968 C1 DT 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4492  hydrog ? ? A  DT 1969 N3 ? ? ? 1_555 GD DA 12   N1 ? ? AA DT 1969 C1 DA 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4493  hydrog ? ? A  DT 1969 O4 ? ? ? 1_555 GD DA 12   N6 ? ? AA DT 1969 C1 DA 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4494  hydrog ? ? A  DT 1970 N3 ? ? ? 1_555 GD DA 11   N1 ? ? AA DT 1970 C1 DA 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4495  hydrog ? ? A  DT 1970 O4 ? ? ? 1_555 GD DA 11   N6 ? ? AA DT 1970 C1 DA 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4496  hydrog ? ? A  DC 1971 N4 ? ? ? 1_555 UB DG 10   O6 ? ? AA DC 1971 BI DG 10   1_555 ? ? ? ? ? ? 'DC-DG PAIR'            
? ? 
hydrog4497  hydrog ? ? A  DT 1972 N3 ? ? ? 1_555 UB DA 9    N1 ? ? AA DT 1972 BI DA 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4498  hydrog ? ? A  DT 1972 O4 ? ? ? 1_555 UB DA 9    N6 ? ? AA DT 1972 BI DA 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4499  hydrog ? ? A  DC 1973 N3 ? ? ? 1_555 UB DG 8    N1 ? ? AA DC 1973 BI DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4500  hydrog ? ? A  DC 1973 N4 ? ? ? 1_555 UB DG 8    O6 ? ? AA DC 1973 BI DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4501  hydrog ? ? A  DC 1973 O2 ? ? ? 1_555 UB DG 8    N2 ? ? AA DC 1973 BI DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4502  hydrog ? ? A  DG 1974 N1 ? ? ? 1_555 UB DC 7    N3 ? ? AA DG 1974 BI DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4503  hydrog ? ? A  DG 1974 N2 ? ? ? 1_555 UB DC 7    O2 ? ? AA DG 1974 BI DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4504  hydrog ? ? A  DG 1974 O6 ? ? ? 1_555 UB DC 7    N4 ? ? AA DG 1974 BI DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4505  hydrog ? ? A  DT 1975 N3 ? ? ? 1_555 UB DA 6    N1 ? ? AA DT 1975 BI DA 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4506  hydrog ? ? A  DT 1975 O4 ? ? ? 1_555 UB DA 6    N6 ? ? AA DT 1975 BI DA 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4507  hydrog ? ? A  DT 1976 N3 ? ? ? 1_555 OB DA 39   N1 ? ? AA DT 1976 BC DA 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4508  hydrog ? ? A  DT 1976 O4 ? ? ? 1_555 OB DA 39   N6 ? ? AA DT 1976 BC DA 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4509  hydrog ? ? A  DT 1977 N3 ? ? ? 1_555 OB DA 38   N1 ? ? AA DT 1977 BC DA 38   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4510  hydrog ? ? A  DT 1978 N3 ? ? ? 1_555 OB DA 37   N1 ? ? AA DT 1978 BC DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4511  hydrog ? ? A  DT 1978 O4 ? ? ? 1_555 OB DA 37   N6 ? ? AA DT 1978 BC DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4512  hydrog ? ? A  DC 1979 N3 ? ? ? 1_555 OB DG 36   N1 ? ? AA DC 1979 BC DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4513  hydrog ? ? A  DC 1979 N4 ? ? ? 1_555 OB DG 36   O6 ? ? AA DC 1979 BC DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4514  hydrog ? ? A  DC 1979 O2 ? ? ? 1_555 OB DG 36   N2 ? ? AA DC 1979 BC DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4515  hydrog ? ? A  DT 1980 N3 ? ? ? 1_555 OB DA 35   N1 ? ? AA DT 1980 BC DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4516  hydrog ? ? A  DT 1980 O4 ? ? ? 1_555 OB DA 35   N6 ? ? AA DT 1980 BC DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4517  hydrog ? ? A  DG 1981 N1 ? ? ? 1_555 UE DC 13   N3 ? ? AA DG 1981 Ck DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4518  hydrog ? ? A  DG 1981 N2 ? ? ? 1_555 UE DC 13   O2 ? ? AA DG 1981 Ck DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4519  hydrog ? ? A  DG 1981 O6 ? ? ? 1_555 UE DC 13   N4 ? ? AA DG 1981 Ck DC 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4520  hydrog ? ? A  DA 1982 N1 ? ? ? 1_555 UE DT 12   N3 ? ? AA DA 1982 Ck DT 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4521  hydrog ? ? A  DA 1982 N6 ? ? ? 1_555 UE DT 12   O4 ? ? AA DA 1982 Ck DT 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4522  hydrog ? ? A  DA 1983 N1 ? ? ? 1_555 UE DT 11   N3 ? ? AA DA 1983 Ck DT 21   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog4523  hydrog ? ? A  DC 1984 N3 ? ? ? 1_555 UE DG 10   N1 ? ? AA DC 1984 Ck DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4524  hydrog ? ? A  DC 1984 N4 ? ? ? 1_555 UE DG 10   O6 ? ? AA DC 1984 Ck DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4525  hydrog ? ? A  DC 1984 O2 ? ? ? 1_555 UE DG 10   N2 ? ? AA DC 1984 Ck DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4526  hydrog ? ? A  DT 1985 N3 ? ? ? 1_555 UE DA 9    N1 ? ? AA DT 1985 Ck DA 19   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4527  hydrog ? ? A  DT 1985 O4 ? ? ? 1_555 UE DG 10   N2 ? ? AA DT 1985 Ck DG 20   1_555 ? ? ? ? ? ? 'DT-DG MISPAIR'         
? ? 
hydrog4528  hydrog ? ? A  DG 1986 N1 ? ? ? 1_555 UE DC 8    N3 ? ? AA DG 1986 Ck DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4529  hydrog ? ? A  DG 1986 N2 ? ? ? 1_555 UE DC 8    O2 ? ? AA DG 1986 Ck DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4530  hydrog ? ? A  DG 1986 O6 ? ? ? 1_555 UE DC 8    N4 ? ? AA DG 1986 Ck DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4531  hydrog ? ? A  DT 1987 N3 ? ? ? 1_555 UE DA 7    N1 ? ? AA DT 1987 Ck DA 7    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4532  hydrog ? ? A  DT 1988 N3 ? ? ? 1_555 UE DA 6    N1 ? ? AA DT 1988 Ck DA 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4533  hydrog ? ? A  DT 1988 O4 ? ? ? 1_555 UE DA 6    N6 ? ? AA DT 1988 Ck DA 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4534  hydrog ? ? A  DT 1989 N3 ? ? ? 1_555 UE DA 5    N1 ? ? AA DT 1989 Ck DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4535  hydrog ? ? A  DT 1989 O4 ? ? ? 1_555 UE DA 5    N6 ? ? AA DT 1989 Ck DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4536  hydrog ? ? A  DA 1990 N1 ? ? ? 1_555 UE DT 4    N3 ? ? AA DA 1990 Ck DT 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4537  hydrog ? ? A  DA 1990 N6 ? ? ? 1_555 UE DT 4    O4 ? ? AA DA 1990 Ck DT 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4538  hydrog ? ? A  DA 1991 N1 ? ? ? 1_555 UE DT 3    N3 ? ? AA DA 1991 Ck DT 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4539  hydrog ? ? A  DA 1991 N6 ? ? ? 1_555 UE DT 3    O4 ? ? AA DA 1991 Ck DT 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4540  hydrog ? ? A  DA 1992 N1 ? ? ? 1_555 UE DT 2    N3 ? ? AA DA 1992 Ck DT 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4541  hydrog ? ? A  DA 1992 N6 ? ? ? 1_555 UE DT 2    O4 ? ? AA DA 1992 Ck DT 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4542  hydrog ? ? A  DG 1993 N1 ? ? ? 1_555 UE DC 1    N3 ? ? AA DG 1993 Ck DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4543  hydrog ? ? A  DG 1993 N2 ? ? ? 1_555 UE DC 1    O2 ? ? AA DG 1993 Ck DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4544  hydrog ? ? A  DG 1993 O6 ? ? ? 1_555 UE DC 1    N4 ? ? AA DG 1993 Ck DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4545  hydrog ? ? A  DC 1994 N3 ? ? ? 1_555 FD DG 41   N1 ? ? AA DC 1994 C0 DG 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4546  hydrog ? ? A  DC 1994 N4 ? ? ? 1_555 FD DG 41   O6 ? ? AA DC 1994 C0 DG 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4547  hydrog ? ? A  DC 1994 O2 ? ? ? 1_555 FD DG 41   N2 ? ? AA DC 1994 C0 DG 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4548  hydrog ? ? A  DA 1995 N1 ? ? ? 1_555 FD DT 40   N3 ? ? AA DA 1995 C0 DT 40   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog4549  hydrog ? ? A  DT 1996 N3 ? ? ? 1_555 FD DA 39   N1 ? ? AA DT 1996 C0 DA 39   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4550  hydrog ? ? A  DT 1997 N3 ? ? ? 1_555 FD DA 38   N1 ? ? AA DT 1997 C0 DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4551  hydrog ? ? A  DT 1997 O4 ? ? ? 1_555 FD DA 38   N6 ? ? AA DT 1997 C0 DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4552  hydrog ? ? A  DT 1998 N3 ? ? ? 1_555 FD DA 37   N1 ? ? AA DT 1998 C0 DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4553  hydrog ? ? A  DT 1998 O4 ? ? ? 1_555 FD DA 37   N6 ? ? AA DT 1998 C0 DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4554  hydrog ? ? A  DG 1999 N1 ? ? ? 1_555 CE DC 50   N3 ? ? AA DG 1999 CP DC 50   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4555  hydrog ? ? A  DG 1999 N2 ? ? ? 1_555 CE DC 50   O2 ? ? AA DG 1999 CP DC 50   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4556  hydrog ? ? A  DG 1999 O6 ? ? ? 1_555 CE DC 50   N4 ? ? AA DG 1999 CP DC 50   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4557  hydrog ? ? A  DA 2000 N1 ? ? ? 1_555 CE DT 49   N3 ? ? AA DA 2000 CP DT 49   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4558  hydrog ? ? A  DA 2000 N6 ? ? ? 1_555 CE DT 49   O4 ? ? AA DA 2000 CP DT 49   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4559  hydrog ? ? A  DG 2001 N1 ? ? ? 1_555 CE DC 48   N3 ? ? AA DG 2001 CP DC 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4560  hydrog ? ? A  DG 2001 N2 ? ? ? 1_555 CE DC 48   O2 ? ? AA DG 2001 CP DC 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4561  hydrog ? ? A  DG 2001 O6 ? ? ? 1_555 CE DC 48   N4 ? ? AA DG 2001 CP DC 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4562  hydrog ? ? A  DG 2002 N1 ? ? ? 1_555 CE DC 47   N3 ? ? AA DG 2002 CP DC 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4563  hydrog ? ? A  DG 2002 N2 ? ? ? 1_555 CE DC 47   O2 ? ? AA DG 2002 CP DC 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4564  hydrog ? ? A  DG 2002 O6 ? ? ? 1_555 CE DC 47   N4 ? ? AA DG 2002 CP DC 47   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4565  hydrog ? ? A  DG 2003 N1 ? ? ? 1_555 CE DC 46   N3 ? ? AA DG 2003 CP DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4566  hydrog ? ? A  DG 2003 N2 ? ? ? 1_555 CE DC 46   O2 ? ? AA DG 2003 CP DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4567  hydrog ? ? A  DG 2003 O6 ? ? ? 1_555 CE DC 46   N4 ? ? AA DG 2003 CP DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4568  hydrog ? ? A  DG 2004 N1 ? ? ? 1_555 CE DC 45   N3 ? ? AA DG 2004 CP DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4569  hydrog ? ? A  DG 2004 N2 ? ? ? 1_555 CE DC 45   O2 ? ? AA DG 2004 CP DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4570  hydrog ? ? A  DG 2004 O6 ? ? ? 1_555 CE DC 45   N4 ? ? AA DG 2004 CP DC 45   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4571  hydrog ? ? A  DG 2005 N1 ? ? ? 1_555 CE DC 44   N3 ? ? AA DG 2005 CP DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4572  hydrog ? ? A  DG 2005 N2 ? ? ? 1_555 CE DC 44   O2 ? ? AA DG 2005 CP DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4573  hydrog ? ? A  DG 2005 O6 ? ? ? 1_555 CE DC 44   N4 ? ? AA DG 2005 CP DC 44   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4574  hydrog ? ? A  DA 2006 N1 ? ? ? 1_555 CE DT 43   N3 ? ? AA DA 2006 CP DT 43   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog4575  hydrog ? ? A  DT 2007 N3 ? ? ? 1_555 CE DA 42   N1 ? ? AA DT 2007 CP DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4576  hydrog ? ? A  DT 2007 O4 ? ? ? 1_555 CE DA 42   N6 ? ? AA DT 2007 CP DA 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4577  hydrog ? ? A  DT 2008 N3 ? ? ? 1_555 CE DA 41   N1 ? ? AA DT 2008 CP DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4578  hydrog ? ? A  DT 2008 O4 ? ? ? 1_555 CE DA 41   N6 ? ? AA DT 2008 CP DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4579  hydrog ? ? A  DC 2009 N3 ? ? ? 1_555 CE DG 40   N1 ? ? AA DC 2009 CP DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4580  hydrog ? ? A  DC 2009 N4 ? ? ? 1_555 CE DG 40   O6 ? ? AA DC 2009 CP DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4581  hydrog ? ? A  DC 2009 O2 ? ? ? 1_555 CE DG 40   N2 ? ? AA DC 2009 CP DG 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4582  hydrog ? ? A  DA 2010 N1 ? ? ? 1_555 CE DT 39   N3 ? ? AA DA 2010 CP DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4583  hydrog ? ? A  DA 2010 N6 ? ? ? 1_555 CE DT 39   O4 ? ? AA DA 2010 CP DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4584  hydrog ? ? A  DA 2011 N1 ? ? ? 1_555 CE DT 38   N3 ? ? AA DA 2011 CP DT 38   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog4585  hydrog ? ? A  DT 2012 N3 ? ? ? 1_555 CE DA 37   N1 ? ? AA DT 2012 CP DA 37   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4586  hydrog ? ? A  DG 2013 N1 ? ? ? 1_555 CE DC 36   N3 ? ? AA DG 2013 CP DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4587  hydrog ? ? A  DG 2013 N2 ? ? ? 1_555 CE DC 36   O2 ? ? AA DG 2013 CP DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4588  hydrog ? ? A  DG 2013 O6 ? ? ? 1_555 CE DC 36   N4 ? ? AA DG 2013 CP DC 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4589  hydrog ? ? A  DA 2014 N1 ? ? ? 1_555 CE DT 35   N3 ? ? AA DA 2014 CP DT 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4590  hydrog ? ? A  DA 2014 N6 ? ? ? 1_555 CE DT 35   O4 ? ? AA DA 2014 CP DT 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4591  hydrog ? ? A  DA 2015 N1 ? ? ? 1_555 PE DT 34   N3 ? ? AA DA 2015 Cd DT 34   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog4592  hydrog ? ? A  DT 2016 N3 ? ? ? 1_555 PE DA 33   N1 ? ? AA DT 2016 Cd DA 33   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4593  hydrog ? ? A  DA 2017 N1 ? ? ? 1_555 PE DT 32   N3 ? ? AA DA 2017 Cd DT 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4594  hydrog ? ? A  DA 2017 N6 ? ? ? 1_555 PE DT 32   O4 ? ? AA DA 2017 Cd DT 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4595  hydrog ? ? A  DT 2018 N3 ? ? ? 1_555 PE DA 31   N1 ? ? AA DT 2018 Cd DA 31   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4596  hydrog ? ? A  DT 2019 N3 ? ? ? 1_555 PE DA 30   N1 ? ? AA DT 2019 Cd DA 30   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4597  hydrog ? ? A  DT 2020 N3 ? ? ? 1_555 PE DA 29   N1 ? ? AA DT 2020 Cd DA 29   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4598  hydrog ? ? A  DA 2021 N1 ? ? ? 1_555 PE DT 28   N3 ? ? AA DA 2021 Cd DT 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4599  hydrog ? ? A  DA 2021 N6 ? ? ? 1_555 PE DT 28   O4 ? ? AA DA 2021 Cd DT 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4600  hydrog ? ? A  DT 2022 N3 ? ? ? 1_555 PE DA 27   N1 ? ? AA DT 2022 Cd DA 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4601  hydrog ? ? A  DT 2022 O4 ? ? ? 1_555 PE DA 27   N6 ? ? AA DT 2022 Cd DA 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4602  hydrog ? ? A  DG 2023 N1 ? ? ? 1_555 FD DC 2    N3 ? ? AA DG 2023 C0 DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4603  hydrog ? ? A  DG 2023 N2 ? ? ? 1_555 FD DC 2    O2 ? ? AA DG 2023 C0 DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4604  hydrog ? ? A  DG 2023 O6 ? ? ? 1_555 FD DC 2    N4 ? ? AA DG 2023 C0 DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4605  hydrog ? ? A  DA 2024 N1 ? ? ? 1_555 FD DT 1    N3 ? ? AA DA 2024 C0 DT 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4606  hydrog ? ? A  DA 2024 N6 ? ? ? 1_555 FD DT 1    O4 ? ? AA DA 2024 C0 DT 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4607  hydrog ? ? A  DC 2025 N3 ? ? ? 1_555 CE DG 56   N1 ? ? AA DC 2025 CP DG 56   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4608  hydrog ? ? A  DC 2025 N4 ? ? ? 1_555 CE DG 56   O6 ? ? AA DC 2025 CP DG 56   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4609  hydrog ? ? A  DC 2025 O2 ? ? ? 1_555 CE DG 56   N2 ? ? AA DC 2025 CP DG 56   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4610  hydrog ? ? A  DG 2026 N1 ? ? ? 1_555 CE DC 55   N3 ? ? AA DG 2026 CP DC 55   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4611  hydrog ? ? A  DG 2026 N2 ? ? ? 1_555 CE DC 55   O2 ? ? AA DG 2026 CP DC 55   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4612  hydrog ? ? A  DG 2026 O6 ? ? ? 1_555 CE DC 55   N4 ? ? AA DG 2026 CP DC 55   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4613  hydrog ? ? A  DA 2027 N1 ? ? ? 1_555 CE DT 54   N3 ? ? AA DA 2027 CP DT 54   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4614  hydrog ? ? A  DA 2027 N6 ? ? ? 1_555 CE DT 54   O4 ? ? AA DA 2027 CP DT 54   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4615  hydrog ? ? A  DT 2028 N3 ? ? ? 1_555 CE DA 53   N1 ? ? AA DT 2028 CP DA 53   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4616  hydrog ? ? A  DT 2029 N3 ? ? ? 1_555 CE DA 52   N1 ? ? AA DT 2029 CP DA 52   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4617  hydrog ? ? A  DC 2030 N3 ? ? ? 1_555 CE DG 51   N1 ? ? AA DC 2030 CP DG 51   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4618  hydrog ? ? A  DC 2030 N4 ? ? ? 1_555 CE DG 51   O6 ? ? AA DC 2030 CP DG 51   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4619  hydrog ? ? A  DC 2030 O2 ? ? ? 1_555 CE DG 51   N2 ? ? AA DC 2030 CP DG 51   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4620  hydrog ? ? A  DC 2031 N3 ? ? ? 1_555 FD DG 36   N1 ? ? AA DC 2031 C0 DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4621  hydrog ? ? A  DC 2031 N4 ? ? ? 1_555 FD DG 36   O6 ? ? AA DC 2031 C0 DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4622  hydrog ? ? A  DC 2031 O2 ? ? ? 1_555 FD DG 36   N2 ? ? AA DC 2031 C0 DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4623  hydrog ? ? A  DG 2032 N1 ? ? ? 1_555 FD DC 35   N3 ? ? AA DG 2032 C0 DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4624  hydrog ? ? A  DG 2032 N2 ? ? ? 1_555 FD DC 35   O2 ? ? AA DG 2032 C0 DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4625  hydrog ? ? A  DG 2032 O6 ? ? ? 1_555 FD DC 35   N4 ? ? AA DG 2032 C0 DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4626  hydrog ? ? A  DC 2033 N3 ? ? ? 1_555 FD DG 34   N1 ? ? AA DC 2033 C0 DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4627  hydrog ? ? A  DC 2033 N4 ? ? ? 1_555 FD DG 34   O6 ? ? AA DC 2033 C0 DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4628  hydrog ? ? A  DC 2033 O2 ? ? ? 1_555 FD DG 34   N2 ? ? AA DC 2033 C0 DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4629  hydrog ? ? A  DA 2034 N1 ? ? ? 1_555 FD DT 33   N3 ? ? AA DA 2034 C0 DT 33   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog4630  hydrog ? ? A  DG 2035 N1 ? ? ? 1_555 FD DC 32   N3 ? ? AA DG 2035 C0 DC 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4631  hydrog ? ? A  DG 2035 N2 ? ? ? 1_555 FD DC 32   O2 ? ? AA DG 2035 C0 DC 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4632  hydrog ? ? A  DG 2035 O6 ? ? ? 1_555 FD DC 32   N4 ? ? AA DG 2035 C0 DC 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4633  hydrog ? ? A  DT 2036 N3 ? ? ? 1_555 FD DA 31   N1 ? ? AA DT 2036 C0 DA 31   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4634  hydrog ? ? A  DA 2037 N1 ? ? ? 1_555 FD DT 30   N3 ? ? AA DA 2037 C0 DT 30   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog4635  hydrog ? ? A  DT 2038 N3 ? ? ? 1_555 FD DA 29   N1 ? ? AA DT 2038 C0 DA 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4636  hydrog ? ? A  DT 2038 O4 ? ? ? 1_555 FD DA 29   N6 ? ? AA DT 2038 C0 DA 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4637  hydrog ? ? A  DT 2039 N3 ? ? ? 1_555 FD DA 18   N1 ? ? AA DT 2039 C0 DA 18   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4638  hydrog ? ? A  DG 2040 N1 ? ? ? 1_555 FD DC 17   N3 ? ? AA DG 2040 C0 DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4639  hydrog ? ? A  DG 2040 N2 ? ? ? 1_555 FD DC 17   O2 ? ? AA DG 2040 C0 DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4640  hydrog ? ? A  DG 2040 O6 ? ? ? 1_555 FD DC 17   N4 ? ? AA DG 2040 C0 DC 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4641  hydrog ? ? A  DG 2041 N1 ? ? ? 1_555 FD DC 16   N3 ? ? AA DG 2041 C0 DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4642  hydrog ? ? A  DG 2041 N2 ? ? ? 1_555 FD DC 16   O2 ? ? AA DG 2041 C0 DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4643  hydrog ? ? A  DG 2041 O6 ? ? ? 1_555 FD DC 16   N4 ? ? AA DG 2041 C0 DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4644  hydrog ? ? A  DA 2042 N1 ? ? ? 1_555 FD DT 15   N3 ? ? AA DA 2042 C0 DT 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4645  hydrog ? ? A  DA 2042 N6 ? ? ? 1_555 FD DT 15   O4 ? ? AA DA 2042 C0 DT 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4646  hydrog ? ? A  DC 2043 N3 ? ? ? 1_555 FD DG 14   N1 ? ? AA DC 2043 C0 DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4647  hydrog ? ? A  DC 2043 N4 ? ? ? 1_555 FD DG 14   O6 ? ? AA DC 2043 C0 DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4648  hydrog ? ? A  DC 2043 O2 ? ? ? 1_555 FD DG 14   N2 ? ? AA DC 2043 C0 DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4649  hydrog ? ? A  DG 2044 N1 ? ? ? 1_555 FD DC 13   N3 ? ? AA DG 2044 C0 DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4650  hydrog ? ? A  DG 2044 N2 ? ? ? 1_555 FD DC 13   O2 ? ? AA DG 2044 C0 DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4651  hydrog ? ? A  DG 2044 O6 ? ? ? 1_555 FD DC 13   N4 ? ? AA DG 2044 C0 DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4652  hydrog ? ? A  DC 2045 N3 ? ? ? 1_555 FD DG 12   N1 ? ? AA DC 2045 C0 DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4653  hydrog ? ? A  DC 2045 N4 ? ? ? 1_555 FD DG 12   O6 ? ? AA DC 2045 C0 DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4654  hydrog ? ? A  DC 2045 O2 ? ? ? 1_555 FD DG 12   N2 ? ? AA DC 2045 C0 DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4655  hydrog ? ? A  DT 2046 N3 ? ? ? 1_555 FD DA 11   N1 ? ? AA DT 2046 C0 DA 11   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4656  hydrog ? ? A  DA 2047 N1 ? ? ? 1_555 FD DT 10   N3 ? ? AA DA 2047 C0 DT 10   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog4657  hydrog ? ? A  DT 2048 N3 ? ? ? 1_555 FD DA 9    N1 ? ? AA DT 2048 C0 DA 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4658  hydrog ? ? A  DT 2048 O4 ? ? ? 1_555 FD DA 9    N6 ? ? AA DT 2048 C0 DA 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4659  hydrog ? ? A  DC 2049 N3 ? ? ? 1_555 FD DG 8    N1 ? ? AA DC 2049 C0 DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4660  hydrog ? ? A  DC 2049 N4 ? ? ? 1_555 FD DG 8    O6 ? ? AA DC 2049 C0 DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4661  hydrog ? ? A  DC 2049 O2 ? ? ? 1_555 FD DG 8    N2 ? ? AA DC 2049 C0 DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4662  hydrog ? ? A  DC 2050 N3 ? ? ? 1_555 FD DG 7    N1 ? ? AA DC 2050 C0 DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4663  hydrog ? ? A  DC 2050 N4 ? ? ? 1_555 FD DG 7    O6 ? ? AA DC 2050 C0 DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4664  hydrog ? ? A  DC 2050 O2 ? ? ? 1_555 FD DG 7    N2 ? ? AA DC 2050 C0 DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4665  hydrog ? ? A  DA 2051 N1 ? ? ? 1_555 FD DT 6    N3 ? ? AA DA 2051 C0 DT 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4666  hydrog ? ? A  DA 2051 N6 ? ? ? 1_555 FD DT 6    O4 ? ? AA DA 2051 C0 DT 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4667  hydrog ? ? A  DG 2052 N1 ? ? ? 1_555 FD DC 5    N3 ? ? AA DG 2052 C0 DC 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4668  hydrog ? ? A  DG 2052 N2 ? ? ? 1_555 FD DC 5    O2 ? ? AA DG 2052 C0 DC 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4669  hydrog ? ? A  DG 2052 O6 ? ? ? 1_555 FD DC 5    N4 ? ? AA DG 2052 C0 DC 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4670  hydrog ? ? A  DT 2053 N3 ? ? ? 1_555 FD DA 4    N1 ? ? AA DT 2053 C0 DA 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4671  hydrog ? ? A  DT 2053 O4 ? ? ? 1_555 FD DA 4    N6 ? ? AA DT 2053 C0 DA 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4672  hydrog ? ? A  DC 2054 N3 ? ? ? 1_555 FD DG 3    N1 ? ? AA DC 2054 C0 DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4673  hydrog ? ? A  DC 2054 N4 ? ? ? 1_555 FD DG 3    O6 ? ? AA DC 2054 C0 DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4674  hydrog ? ? A  DC 2054 O2 ? ? ? 1_555 FD DG 3    N2 ? ? AA DC 2054 C0 DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4675  hydrog ? ? A  DT 2055 N3 ? ? ? 1_555 PE DA 26   N1 ? ? AA DT 2055 Cd DA 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4676  hydrog ? ? A  DT 2055 O4 ? ? ? 1_555 PE DA 26   N6 ? ? AA DT 2055 Cd DA 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4677  hydrog ? ? A  DA 2056 N1 ? ? ? 1_555 PE DT 25   N3 ? ? AA DA 2056 Cd DT 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4678  hydrog ? ? A  DA 2056 N6 ? ? ? 1_555 PE DT 25   O4 ? ? AA DA 2056 Cd DT 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4679  hydrog ? ? A  DA 2057 N1 ? ? ? 1_555 PE DT 24   N3 ? ? AA DA 2057 Cd DT 24   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog4680  hydrog ? ? A  DA 2058 N1 ? ? ? 1_555 PE DT 23   N3 ? ? AA DA 2058 Cd DT 23   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog4681  hydrog ? ? A  DC 2059 N3 ? ? ? 1_555 PE DG 22   N1 ? ? AA DC 2059 Cd DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4682  hydrog ? ? A  DC 2059 N4 ? ? ? 1_555 PE DG 22   O6 ? ? AA DC 2059 Cd DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4683  hydrog ? ? A  DC 2059 O2 ? ? ? 1_555 PE DG 22   N2 ? ? AA DC 2059 Cd DG 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4684  hydrog ? ? A  DA 2060 N1 ? ? ? 1_555 PE DT 21   N3 ? ? AA DA 2060 Cd DT 21   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog4685  hydrog ? ? A  DT 2061 N3 ? ? ? 1_555 PE DA 20   N1 ? ? AA DT 2061 Cd DA 20   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4686  hydrog ? ? A  DT 2062 N3 ? ? ? 1_555 PE DA 19   N1 ? ? AA DT 2062 Cd DA 19   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4687  hydrog ? ? A  DT 2063 N3 ? ? ? 1_555 WE DA 30   N1 ? ? AA DT 2063 Cq DA 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4688  hydrog ? ? A  DT 2063 O4 ? ? ? 1_555 WE DA 30   N6 ? ? AA DT 2063 Cq DA 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4689  hydrog ? ? A  DT 2064 N3 ? ? ? 1_555 WE DA 29   N1 ? ? AA DT 2064 Cq DA 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4690  hydrog ? ? A  DT 2064 O4 ? ? ? 1_555 WE DA 29   N6 ? ? AA DT 2064 Cq DA 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4691  hydrog ? ? A  DA 2065 N1 ? ? ? 1_555 WE DT 28   N3 ? ? AA DA 2065 Cq DT 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4692  hydrog ? ? A  DA 2065 N6 ? ? ? 1_555 WE DT 28   O4 ? ? AA DA 2065 Cq DT 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4693  hydrog ? ? A  DC 2066 N3 ? ? ? 1_555 WE DG 27   N1 ? ? AA DC 2066 Cq DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4694  hydrog ? ? A  DC 2066 N4 ? ? ? 1_555 WE DG 27   O6 ? ? AA DC 2066 Cq DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4695  hydrog ? ? A  DC 2066 O2 ? ? ? 1_555 WE DG 27   N2 ? ? AA DC 2066 Cq DG 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4696  hydrog ? ? A  DT 2067 N3 ? ? ? 1_555 WE DA 26   N1 ? ? AA DT 2067 Cq DA 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4697  hydrog ? ? A  DT 2067 O4 ? ? ? 1_555 WE DA 26   N6 ? ? AA DT 2067 Cq DA 26   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4698  hydrog ? ? A  DA 2068 N1 ? ? ? 1_555 WE DT 25   N3 ? ? AA DA 2068 Cq DT 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4699  hydrog ? ? A  DA 2068 N6 ? ? ? 1_555 WE DT 25   O4 ? ? AA DA 2068 Cq DT 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4700  hydrog ? ? A  DT 2069 N3 ? ? ? 1_555 WE DA 24   N1 ? ? AA DT 2069 Cq DA 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4701  hydrog ? ? A  DT 2069 O4 ? ? ? 1_555 WE DA 24   N6 ? ? AA DT 2069 Cq DA 24   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4702  hydrog ? ? A  DT 2070 N3 ? ? ? 1_555 WE DA 23   N1 ? ? AA DT 2070 Cq DA 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4703  hydrog ? ? A  DT 2070 O4 ? ? ? 1_555 WE DA 23   N6 ? ? AA DT 2070 Cq DA 23   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4704  hydrog ? ? A  DA 2071 N1 ? ? ? 1_555 WE DT 22   N3 ? ? AA DA 2071 Cq DT 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4705  hydrog ? ? A  DA 2071 N6 ? ? ? 1_555 WE DT 22   O4 ? ? AA DA 2071 Cq DT 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4706  hydrog ? ? A  DC 2072 N3 ? ? ? 1_555 WE DG 21   N1 ? ? AA DC 2072 Cq DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4707  hydrog ? ? A  DC 2072 N4 ? ? ? 1_555 WE DG 21   O6 ? ? AA DC 2072 Cq DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4708  hydrog ? ? A  DC 2072 O2 ? ? ? 1_555 WE DG 21   N2 ? ? AA DC 2072 Cq DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4709  hydrog ? ? A  DC 2073 N3 ? ? ? 1_555 WE DG 20   N1 ? ? AA DC 2073 Cq DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4710  hydrog ? ? A  DC 2073 N4 ? ? ? 1_555 WE DG 20   O6 ? ? AA DC 2073 Cq DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4711  hydrog ? ? A  DC 2073 O2 ? ? ? 1_555 WE DG 20   N2 ? ? AA DC 2073 Cq DG 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4712  hydrog ? ? A  DC 2074 N3 ? ? ? 1_555 WE DG 19   N1 ? ? AA DC 2074 Cq DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4713  hydrog ? ? A  DC 2074 N4 ? ? ? 1_555 WE DG 19   O6 ? ? AA DC 2074 Cq DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4714  hydrog ? ? A  DC 2074 O2 ? ? ? 1_555 WE DG 19   N2 ? ? AA DC 2074 Cq DG 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4715  hydrog ? ? A  DC 2075 N3 ? ? ? 1_555 WE DG 18   N1 ? ? AA DC 2075 Cq DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4716  hydrog ? ? A  DC 2075 N4 ? ? ? 1_555 WE DG 18   O6 ? ? AA DC 2075 Cq DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4717  hydrog ? ? A  DC 2075 O2 ? ? ? 1_555 WE DG 18   N2 ? ? AA DC 2075 Cq DG 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4718  hydrog ? ? A  DC 2076 N3 ? ? ? 1_555 WE DG 17   N1 ? ? AA DC 2076 Cq DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4719  hydrog ? ? A  DC 2076 N4 ? ? ? 1_555 WE DG 17   O6 ? ? AA DC 2076 Cq DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4720  hydrog ? ? A  DC 2076 O2 ? ? ? 1_555 WE DG 17   N2 ? ? AA DC 2076 Cq DG 17   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4721  hydrog ? ? A  DT 2077 N3 ? ? ? 1_555 WE DA 16   N1 ? ? AA DT 2077 Cq DA 16   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4722  hydrog ? ? A  DC 2078 N3 ? ? ? 1_555 WE DG 15   N1 ? ? AA DC 2078 Cq DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4723  hydrog ? ? A  DC 2078 N4 ? ? ? 1_555 WE DG 15   O6 ? ? AA DC 2078 Cq DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4724  hydrog ? ? A  DC 2078 O2 ? ? ? 1_555 WE DG 15   N2 ? ? AA DC 2078 Cq DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4725  hydrog ? ? A  DT 2079 N3 ? ? ? 1_555 WE DA 14   N1 ? ? AA DT 2079 Cq DA 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4726  hydrog ? ? A  DT 2079 O4 ? ? ? 1_555 WE DA 14   N6 ? ? AA DT 2079 Cq DA 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4727  hydrog ? ? A  DG 2080 N1 ? ? ? 1_555 WE DC 13   N3 ? ? AA DG 2080 Cq DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4728  hydrog ? ? A  DG 2080 N2 ? ? ? 1_555 WE DC 13   O2 ? ? AA DG 2080 Cq DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4729  hydrog ? ? A  DG 2080 O6 ? ? ? 1_555 WE DC 13   N4 ? ? AA DG 2080 Cq DC 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4730  hydrog ? ? A  DG 2081 N1 ? ? ? 1_555 WE DC 12   N3 ? ? AA DG 2081 Cq DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4731  hydrog ? ? A  DG 2081 N2 ? ? ? 1_555 WE DC 12   O2 ? ? AA DG 2081 Cq DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4732  hydrog ? ? A  DG 2081 O6 ? ? ? 1_555 WE DC 12   N4 ? ? AA DG 2081 Cq DC 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4733  hydrog ? ? A  DC 2082 N3 ? ? ? 1_555 WE DG 11   N1 ? ? AA DC 2082 Cq DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4734  hydrog ? ? A  DC 2082 N4 ? ? ? 1_555 WE DG 11   O6 ? ? AA DC 2082 Cq DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4735  hydrog ? ? A  DC 2082 O2 ? ? ? 1_555 WE DG 11   N2 ? ? AA DC 2082 Cq DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4736  hydrog ? ? A  DA 2083 N1 ? ? ? 1_555 WE DT 10   N3 ? ? AA DA 2083 Cq DT 10   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog4737  hydrog ? ? A  DA 2084 N1 ? ? ? 1_555 WE DT 9    N3 ? ? AA DA 2084 Cq DT 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4738  hydrog ? ? A  DA 2084 N6 ? ? ? 1_555 WE DT 9    O4 ? ? AA DA 2084 Cq DT 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4739  hydrog ? ? A  DA 2085 N1 ? ? ? 1_555 WE DT 8    N3 ? ? AA DA 2085 Cq DT 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4740  hydrog ? ? A  DA 2085 N6 ? ? ? 1_555 WE DT 8    O4 ? ? AA DA 2085 Cq DT 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4741  hydrog ? ? A  DA 2086 N1 ? ? ? 1_555 WE DT 7    N3 ? ? AA DA 2086 Cq DT 7    1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog4742  hydrog ? ? A  DA 2086 N1 ? ? ? 1_555 WE DT 8    N3 ? ? AA DA 2086 Cq DT 8    1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog4743  hydrog ? ? A  DC 2087 N3 ? ? ? 1_555 ME DG 34   N1 ? ? AA DC 2087 CZ DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4744  hydrog ? ? A  DC 2087 N4 ? ? ? 1_555 ME DG 34   O6 ? ? AA DC 2087 CZ DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4745  hydrog ? ? A  DC 2087 O2 ? ? ? 1_555 ME DG 34   N2 ? ? AA DC 2087 CZ DG 34   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4746  hydrog ? ? A  DT 2088 N3 ? ? ? 1_555 ME DA 33   N1 ? ? AA DT 2088 CZ DA 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4747  hydrog ? ? A  DT 2088 O4 ? ? ? 1_555 ME DA 33   N6 ? ? AA DT 2088 CZ DA 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4748  hydrog ? ? A  DT 2089 N3 ? ? ? 1_555 ME DA 32   N1 ? ? AA DT 2089 CZ DA 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4749  hydrog ? ? A  DT 2089 O4 ? ? ? 1_555 ME DA 32   N6 ? ? AA DT 2089 CZ DA 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4750  hydrog ? ? A  DC 2090 N3 ? ? ? 1_555 ME DG 31   N1 ? ? AA DC 2090 CZ DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4751  hydrog ? ? A  DC 2090 N4 ? ? ? 1_555 ME DG 31   O6 ? ? AA DC 2090 CZ DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4752  hydrog ? ? A  DC 2090 O2 ? ? ? 1_555 ME DG 31   N2 ? ? AA DC 2090 CZ DG 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4753  hydrog ? ? A  DT 2091 N3 ? ? ? 1_555 ME DA 30   N1 ? ? AA DT 2091 CZ DA 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4754  hydrog ? ? A  DT 2091 O4 ? ? ? 1_555 ME DA 30   N6 ? ? AA DT 2091 CZ DA 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4755  hydrog ? ? A  DT 2092 N3 ? ? ? 1_555 ME DA 29   N1 ? ? AA DT 2092 CZ DA 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4756  hydrog ? ? A  DT 2092 O4 ? ? ? 1_555 ME DA 29   N6 ? ? AA DT 2092 CZ DA 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4757  hydrog ? ? A  DT 2093 N3 ? ? ? 1_555 ME DA 28   N1 ? ? AA DT 2093 CZ DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4758  hydrog ? ? A  DT 2093 O4 ? ? ? 1_555 ME DA 28   N6 ? ? AA DT 2093 CZ DA 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4759  hydrog ? ? A  DT 2094 N3 ? ? ? 1_555 ME DA 27   N1 ? ? AA DT 2094 CZ DA 27   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4760  hydrog ? ? A  DG 2095 N1 ? ? ? 1_555 AE DC 22   N3 ? ? AA DG 2095 CN DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4761  hydrog ? ? A  DG 2095 N2 ? ? ? 1_555 AE DC 22   O2 ? ? AA DG 2095 CN DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4762  hydrog ? ? A  DG 2095 O6 ? ? ? 1_555 AE DC 22   N4 ? ? AA DG 2095 CN DC 22   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4763  hydrog ? ? A  DC 2096 N3 ? ? ? 1_555 AE DG 21   N1 ? ? AA DC 2096 CN DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4764  hydrog ? ? A  DC 2096 N4 ? ? ? 1_555 AE DG 21   O6 ? ? AA DC 2096 CN DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4765  hydrog ? ? A  DC 2096 O2 ? ? ? 1_555 AE DG 21   N2 ? ? AA DC 2096 CN DG 21   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4766  hydrog ? ? A  DA 2097 N1 ? ? ? 1_555 AE DT 20   N3 ? ? AA DA 2097 CN DT 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4767  hydrog ? ? A  DA 2097 N6 ? ? ? 1_555 AE DT 20   O4 ? ? AA DA 2097 CN DT 20   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4768  hydrog ? ? A  DA 2098 N1 ? ? ? 1_555 AE DT 19   N3 ? ? AA DA 2098 CN DT 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4769  hydrog ? ? A  DA 2098 N6 ? ? ? 1_555 AE DT 19   O4 ? ? AA DA 2098 CN DT 19   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4770  hydrog ? ? A  DA 2099 N1 ? ? ? 1_555 AE DT 18   N3 ? ? AA DA 2099 CN DT 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4771  hydrog ? ? A  DA 2099 N6 ? ? ? 1_555 AE DT 18   O4 ? ? AA DA 2099 CN DT 18   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4772  hydrog ? ? A  DA 2100 N1 ? ? ? 1_555 AE DT 17   N3 ? ? AA DA 2100 CN DT 17   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog4773  hydrog ? ? A  DG 2101 N1 ? ? ? 1_555 AE DC 16   N3 ? ? AA DG 2101 CN DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4774  hydrog ? ? A  DG 2101 N2 ? ? ? 1_555 AE DC 16   O2 ? ? AA DG 2101 CN DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4775  hydrog ? ? A  DG 2101 O6 ? ? ? 1_555 AE DC 16   N4 ? ? AA DG 2101 CN DC 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4776  hydrog ? ? A  DC 2102 N3 ? ? ? 1_555 AE DG 15   N1 ? ? AA DC 2102 CN DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4777  hydrog ? ? A  DC 2102 N4 ? ? ? 1_555 AE DG 15   O6 ? ? AA DC 2102 CN DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4778  hydrog ? ? A  DC 2102 O2 ? ? ? 1_555 AE DG 15   N2 ? ? AA DC 2102 CN DG 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4779  hydrog ? ? A  DC 2103 N3 ? ? ? 1_555 AE DG 14   N1 ? ? AA DC 2103 CN DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4780  hydrog ? ? A  DC 2103 N4 ? ? ? 1_555 AE DG 14   O6 ? ? AA DC 2103 CN DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4781  hydrog ? ? A  DC 2103 O2 ? ? ? 1_555 AE DG 14   N2 ? ? AA DC 2103 CN DG 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4782  hydrog ? ? A  DT 2104 N3 ? ? ? 1_555 AE DA 13   N1 ? ? AA DT 2104 CN DA 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4783  hydrog ? ? A  DT 2104 O4 ? ? ? 1_555 AE DA 13   N6 ? ? AA DT 2104 CN DA 13   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4784  hydrog ? ? A  DC 2105 N3 ? ? ? 1_555 AE DG 12   N1 ? ? AA DC 2105 CN DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4785  hydrog ? ? A  DC 2105 N4 ? ? ? 1_555 AE DG 12   O6 ? ? AA DC 2105 CN DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4786  hydrog ? ? A  DC 2105 O2 ? ? ? 1_555 AE DG 12   N2 ? ? AA DC 2105 CN DG 12   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4787  hydrog ? ? A  DT 2106 N3 ? ? ? 1_555 AE DA 11   N1 ? ? AA DT 2106 CN DA 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4788  hydrog ? ? A  DT 2106 O4 ? ? ? 1_555 AE DA 11   N6 ? ? AA DT 2106 CN DA 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4789  hydrog ? ? A  DC 2107 N3 ? ? ? 1_555 AE DG 10   N1 ? ? AA DC 2107 CN DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4790  hydrog ? ? A  DC 2107 N4 ? ? ? 1_555 AE DG 10   O6 ? ? AA DC 2107 CN DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4791  hydrog ? ? A  DC 2107 O2 ? ? ? 1_555 AE DG 10   N2 ? ? AA DC 2107 CN DG 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4792  hydrog ? ? A  DG 2108 N1 ? ? ? 1_555 AE DC 9    N3 ? ? AA DG 2108 CN DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4793  hydrog ? ? A  DG 2108 N2 ? ? ? 1_555 AE DC 9    O2 ? ? AA DG 2108 CN DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4794  hydrog ? ? A  DG 2108 O6 ? ? ? 1_555 AE DC 9    N4 ? ? AA DG 2108 CN DC 9    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4795  hydrog ? ? A  DC 2109 N3 ? ? ? 1_555 AE DG 8    N1 ? ? AA DC 2109 CN DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4796  hydrog ? ? A  DC 2109 N4 ? ? ? 1_555 AE DG 8    O6 ? ? AA DC 2109 CN DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4797  hydrog ? ? A  DC 2109 O2 ? ? ? 1_555 AE DG 8    N2 ? ? AA DC 2109 CN DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4798  hydrog ? ? A  DT 2110 N3 ? ? ? 1_555 AE DA 7    N1 ? ? AA DT 2110 CN DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4799  hydrog ? ? A  DT 2110 O4 ? ? ? 1_555 AE DA 7    N6 ? ? AA DT 2110 CN DA 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4800  hydrog ? ? A  DA 2111 N1 ? ? ? 1_555 AE DT 6    N3 ? ? AA DA 2111 CN DT 6    1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog4801  hydrog ? ? A  DT 2112 N3 ? ? ? 1_555 AE DA 5    N1 ? ? AA DT 2112 CN DA 5    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4802  hydrog ? ? A  DT 2113 N3 ? ? ? 1_555 AE DA 4    N1 ? ? AA DT 2113 CN DA 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4803  hydrog ? ? A  DT 2113 O4 ? ? ? 1_555 AE DA 4    N6 ? ? AA DT 2113 CN DA 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4804  hydrog ? ? A  DT 2114 N3 ? ? ? 1_555 AE DA 3    N1 ? ? AA DT 2114 CN DA 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4805  hydrog ? ? A  DT 2114 O4 ? ? ? 1_555 AE DA 3    N6 ? ? AA DT 2114 CN DA 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4806  hydrog ? ? A  DT 2115 N3 ? ? ? 1_555 AE DA 2    N1 ? ? AA DT 2115 CN DA 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4807  hydrog ? ? A  DT 2115 O4 ? ? ? 1_555 AE DA 2    N6 ? ? AA DT 2115 CN DA 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4808  hydrog ? ? A  DG 2116 N1 ? ? ? 1_555 AE DC 1    N3 ? ? AA DG 2116 CN DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4809  hydrog ? ? A  DG 2116 N2 ? ? ? 1_555 AE DC 1    O2 ? ? AA DG 2116 CN DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4810  hydrog ? ? A  DG 2116 O6 ? ? ? 1_555 AE DC 1    N4 ? ? AA DG 2116 CN DC 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4811  hydrog ? ? A  DG 2117 N1 ? ? ? 1_555 ZD DC 54   N3 ? ? AA DG 2117 CM DC 54   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4812  hydrog ? ? A  DG 2117 N2 ? ? ? 1_555 ZD DC 54   O2 ? ? AA DG 2117 CM DC 54   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4813  hydrog ? ? A  DG 2117 O6 ? ? ? 1_555 ZD DC 54   N4 ? ? AA DG 2117 CM DC 54   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4814  hydrog ? ? A  DT 2118 N3 ? ? ? 1_555 ZD DA 53   N1 ? ? AA DT 2118 CM DA 53   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4815  hydrog ? ? A  DT 2119 N3 ? ? ? 1_555 ZD DA 52   N1 ? ? AA DT 2119 CM DA 52   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4816  hydrog ? ? A  DT 2119 O4 ? ? ? 1_555 ZD DA 52   N6 ? ? AA DT 2119 CM DA 52   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4817  hydrog ? ? A  DT 2120 N3 ? ? ? 1_555 ZD DA 51   N1 ? ? AA DT 2120 CM DA 51   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4818  hydrog ? ? A  DT 2120 O4 ? ? ? 1_555 ZD DA 51   N6 ? ? AA DT 2120 CM DA 51   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4819  hydrog ? ? A  DT 2121 N3 ? ? ? 1_555 ZD DA 50   N1 ? ? AA DT 2121 CM DA 50   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4820  hydrog ? ? A  DT 2121 O4 ? ? ? 1_555 ZD DA 50   N6 ? ? AA DT 2121 CM DA 50   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4821  hydrog ? ? A  DT 2122 N3 ? ? ? 1_555 ZD DA 49   N1 ? ? AA DT 2122 CM DA 49   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4822  hydrog ? ? A  DT 2122 O4 ? ? ? 1_555 ZD DA 49   N6 ? ? AA DT 2122 CM DA 49   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4823  hydrog ? ? A  DA 2123 N1 ? ? ? 1_555 ZD DT 48   N3 ? ? AA DA 2123 CM DT 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4824  hydrog ? ? A  DA 2123 N6 ? ? ? 1_555 ZD DT 48   O4 ? ? AA DA 2123 CM DT 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4825  hydrog ? ? A  DT 2124 N3 ? ? ? 1_555 ZD DA 37   N1 ? ? AA DT 2124 CM DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4826  hydrog ? ? A  DT 2124 O4 ? ? ? 1_555 ZD DA 37   N6 ? ? AA DT 2124 CM DA 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4827  hydrog ? ? A  DC 2125 N3 ? ? ? 1_555 ZD DG 36   N1 ? ? AA DC 2125 CM DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4828  hydrog ? ? A  DC 2125 N4 ? ? ? 1_555 ZD DG 36   O6 ? ? AA DC 2125 CM DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4829  hydrog ? ? A  DC 2125 O2 ? ? ? 1_555 ZD DG 36   N2 ? ? AA DC 2125 CM DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4830  hydrog ? ? A  DG 2126 N1 ? ? ? 1_555 ZD DC 35   N3 ? ? AA DG 2126 CM DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4831  hydrog ? ? A  DG 2126 N2 ? ? ? 1_555 ZD DC 35   O2 ? ? AA DG 2126 CM DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4832  hydrog ? ? A  DG 2126 O6 ? ? ? 1_555 ZD DC 35   N4 ? ? AA DG 2126 CM DC 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4833  hydrog ? ? A  DT 2127 N3 ? ? ? 1_555 ZD DA 34   N1 ? ? AA DT 2127 CM DA 34   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4834  hydrog ? ? A  DC 2128 N3 ? ? ? 1_555 ZD DG 33   N1 ? ? AA DC 2128 CM DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4835  hydrog ? ? A  DC 2128 N4 ? ? ? 1_555 ZD DG 33   O6 ? ? AA DC 2128 CM DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4836  hydrog ? ? A  DC 2128 O2 ? ? ? 1_555 ZD DG 33   N2 ? ? AA DC 2128 CM DG 33   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4837  hydrog ? ? A  DG 2129 N1 ? ? ? 1_555 ZD DC 32   N3 ? ? AA DG 2129 CM DC 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4838  hydrog ? ? A  DG 2129 N2 ? ? ? 1_555 ZD DC 32   O2 ? ? AA DG 2129 CM DC 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4839  hydrog ? ? A  DG 2129 O6 ? ? ? 1_555 ZD DC 32   N4 ? ? AA DG 2129 CM DC 32   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4840  hydrog ? ? A  DT 2130 N3 ? ? ? 1_555 ZD DA 31   N1 ? ? AA DT 2130 CM DA 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4841  hydrog ? ? A  DT 2130 O4 ? ? ? 1_555 ZD DA 31   N6 ? ? AA DT 2130 CM DA 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4842  hydrog ? ? A  DC 2131 N3 ? ? ? 1_555 ZD DG 30   N1 ? ? AA DC 2131 CM DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4843  hydrog ? ? A  DC 2131 N4 ? ? ? 1_555 ZD DG 30   O6 ? ? AA DC 2131 CM DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4844  hydrog ? ? A  DC 2131 O2 ? ? ? 1_555 ZD DG 30   N2 ? ? AA DC 2131 CM DG 30   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4845  hydrog ? ? A  DT 2132 N3 ? ? ? 1_555 ZD DA 29   N1 ? ? AA DT 2132 CM DA 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4846  hydrog ? ? A  DT 2132 O4 ? ? ? 1_555 ZD DA 29   N6 ? ? AA DT 2132 CM DA 29   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4847  hydrog ? ? A  DG 2133 N1 ? ? ? 1_555 ZD DC 28   N3 ? ? AA DG 2133 CM DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4848  hydrog ? ? A  DG 2133 N2 ? ? ? 1_555 ZD DC 28   O2 ? ? AA DG 2133 CM DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4849  hydrog ? ? A  DG 2133 O6 ? ? ? 1_555 ZD DC 28   N4 ? ? AA DG 2133 CM DC 28   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4850  hydrog ? ? A  DG 2134 N1 ? ? ? 1_555 ZD DC 27   N3 ? ? AA DG 2134 CM DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4851  hydrog ? ? A  DG 2134 N2 ? ? ? 1_555 ZD DC 27   O2 ? ? AA DG 2134 CM DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4852  hydrog ? ? A  DG 2134 O6 ? ? ? 1_555 ZD DC 27   N4 ? ? AA DG 2134 CM DC 27   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4853  hydrog ? ? A  DT 2135 N3 ? ? ? 1_555 ZD DA 26   N1 ? ? AA DT 2135 CM DA 26   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4854  hydrog ? ? A  DA 2136 N1 ? ? ? 1_555 ZD DT 25   N3 ? ? AA DA 2136 CM DT 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4855  hydrog ? ? A  DA 2136 N6 ? ? ? 1_555 ZD DT 25   O4 ? ? AA DA 2136 CM DT 25   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4856  hydrog ? ? A  DA 2137 N1 ? ? ? 1_555 EE DT 10   N3 ? ? AA DA 2137 CR DT 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4857  hydrog ? ? A  DA 2137 N6 ? ? ? 1_555 EE DT 10   O4 ? ? AA DA 2137 CR DT 10   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4858  hydrog ? ? A  DA 2138 N1 ? ? ? 1_555 EE DT 9    N3 ? ? AA DA 2138 CR DT 9    1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog4859  hydrog ? ? A  DC 2139 N3 ? ? ? 1_555 EE DG 8    N1 ? ? AA DC 2139 CR DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4860  hydrog ? ? A  DC 2139 N4 ? ? ? 1_555 EE DG 8    O6 ? ? AA DC 2139 CR DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4861  hydrog ? ? A  DC 2139 O2 ? ? ? 1_555 EE DG 8    N2 ? ? AA DC 2139 CR DG 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4862  hydrog ? ? A  DG 2140 N1 ? ? ? 1_555 EE DC 7    N3 ? ? AA DG 2140 CR DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4863  hydrog ? ? A  DG 2140 N2 ? ? ? 1_555 EE DC 7    O2 ? ? AA DG 2140 CR DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4864  hydrog ? ? A  DG 2140 O6 ? ? ? 1_555 EE DC 7    N4 ? ? AA DG 2140 CR DC 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4865  hydrog ? ? A  DA 2141 N1 ? ? ? 1_555 EE DT 6    N3 ? ? AA DA 2141 CR DT 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4866  hydrog ? ? A  DA 2141 N6 ? ? ? 1_555 EE DT 6    O4 ? ? AA DA 2141 CR DT 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4867  hydrog ? ? A  DG 2142 N1 ? ? ? 1_555 EE DC 5    N3 ? ? AA DG 2142 CR DC 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4868  hydrog ? ? A  DG 2142 N2 ? ? ? 1_555 EE DC 5    O2 ? ? AA DG 2142 CR DC 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4869  hydrog ? ? A  DG 2142 O6 ? ? ? 1_555 EE DC 5    N4 ? ? AA DG 2142 CR DC 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4870  hydrog ? ? A  DG 2143 N1 ? ? ? 1_555 EE DC 4    N3 ? ? AA DG 2143 CR DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4871  hydrog ? ? A  DG 2143 N2 ? ? ? 1_555 EE DC 4    O2 ? ? AA DG 2143 CR DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4872  hydrog ? ? A  DG 2143 O6 ? ? ? 1_555 EE DC 4    N4 ? ? AA DG 2143 CR DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4873  hydrog ? ? A  DG 2144 N1 ? ? ? 1_555 EE DC 3    N3 ? ? AA DG 2144 CR DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4874  hydrog ? ? A  DG 2144 N2 ? ? ? 1_555 EE DC 3    O2 ? ? AA DG 2144 CR DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4875  hydrog ? ? A  DG 2144 O6 ? ? ? 1_555 EE DC 3    N4 ? ? AA DG 2144 CR DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4876  hydrog ? ? A  DT 2145 N3 ? ? ? 1_555 EE DA 2    N1 ? ? AA DT 2145 CR DA 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4877  hydrog ? ? A  DT 2145 O4 ? ? ? 1_555 EE DA 2    N6 ? ? AA DT 2145 CR DA 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4878  hydrog ? ? A  DT 2146 N3 ? ? ? 1_555 EE DA 1    N1 ? ? AA DT 2146 CR DA 1    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4879  hydrog ? ? A  DA 2147 N1 ? ? ? 1_555 ME DT 48   N3 ? ? AA DA 2147 CZ DT 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4880  hydrog ? ? A  DA 2147 N6 ? ? ? 1_555 ME DT 48   O4 ? ? AA DA 2147 CZ DT 48   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4881  hydrog ? ? A  DT 2148 N3 ? ? ? 1_555 ME DA 47   N1 ? ? AA DT 2148 CZ DA 47   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4882  hydrog ? ? A  DG 2149 N1 ? ? ? 1_555 ME DC 46   N3 ? ? AA DG 2149 CZ DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4883  hydrog ? ? A  DG 2149 N2 ? ? ? 1_555 ME DC 46   O2 ? ? AA DG 2149 CZ DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4884  hydrog ? ? A  DG 2149 O6 ? ? ? 1_555 ME DC 46   N4 ? ? AA DG 2149 CZ DC 46   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4885  hydrog ? ? A  DA 2150 N1 ? ? ? 1_555 ME DT 45   N3 ? ? AA DA 2150 CZ DT 45   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog4886  hydrog ? ? A  DT 2151 N3 ? ? ? 1_555 ME DA 44   N1 ? ? AA DT 2151 CZ DA 44   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4887  hydrog ? ? A  DA 2152 N1 ? ? ? 1_555 ME DT 43   N3 ? ? AA DA 2152 CZ DT 43   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog4888  hydrog ? ? A  DG 2153 N1 ? ? ? 1_555 ME DC 42   N3 ? ? AA DG 2153 CZ DC 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4889  hydrog ? ? A  DG 2153 N2 ? ? ? 1_555 ME DC 42   O2 ? ? AA DG 2153 CZ DC 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4890  hydrog ? ? A  DG 2153 O6 ? ? ? 1_555 ME DC 42   N4 ? ? AA DG 2153 CZ DC 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4891  hydrog ? ? A  DT 2154 N3 ? ? ? 1_555 ME DA 41   N1 ? ? AA DT 2154 CZ DA 41   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4892  hydrog ? ? A  DG 2155 N1 ? ? ? 1_555 ME DC 40   N3 ? ? AA DG 2155 CZ DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4893  hydrog ? ? A  DG 2155 N2 ? ? ? 1_555 ME DC 40   O2 ? ? AA DG 2155 CZ DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4894  hydrog ? ? A  DG 2155 O6 ? ? ? 1_555 ME DC 40   N4 ? ? AA DG 2155 CZ DC 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4895  hydrog ? ? A  DT 2156 N3 ? ? ? 1_555 ME DA 39   N1 ? ? AA DT 2156 CZ DA 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4896  hydrog ? ? A  DT 2156 O4 ? ? ? 1_555 ME DA 39   N6 ? ? AA DT 2156 CZ DA 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4897  hydrog ? ? A  DT 2157 N3 ? ? ? 1_555 ME DA 38   N1 ? ? AA DT 2157 CZ DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4898  hydrog ? ? A  DT 2157 O4 ? ? ? 1_555 ME DA 38   N6 ? ? AA DT 2157 CZ DA 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4899  hydrog ? ? A  DG 2158 N1 ? ? ? 1_555 ME DC 37   N3 ? ? AA DG 2158 CZ DC 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4900  hydrog ? ? A  DG 2158 N2 ? ? ? 1_555 ME DC 37   O2 ? ? AA DG 2158 CZ DC 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4901  hydrog ? ? A  DG 2158 O6 ? ? ? 1_555 ME DC 37   N4 ? ? AA DG 2158 CZ DC 37   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4902  hydrog ? ? A  DC 2159 N3 ? ? ? 1_555 ME DG 36   N1 ? ? AA DC 2159 CZ DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4903  hydrog ? ? A  DC 2159 N4 ? ? ? 1_555 ME DG 36   O6 ? ? AA DC 2159 CZ DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4904  hydrog ? ? A  DC 2159 O2 ? ? ? 1_555 ME DG 36   N2 ? ? AA DC 2159 CZ DG 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4905  hydrog ? ? A  DT 2160 N3 ? ? ? 1_555 ME DA 35   N1 ? ? AA DT 2160 CZ DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4906  hydrog ? ? A  DT 2160 O4 ? ? ? 1_555 ME DA 35   N6 ? ? AA DT 2160 CZ DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4907  hydrog ? ? A  DC 2161 N3 ? ? ? 1_555 WE DG 6    N1 ? ? AA DC 2161 Cq DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4908  hydrog ? ? A  DC 2161 N4 ? ? ? 1_555 WE DG 6    O6 ? ? AA DC 2161 Cq DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4909  hydrog ? ? A  DC 2161 O2 ? ? ? 1_555 WE DG 6    N2 ? ? AA DC 2161 Cq DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4910  hydrog ? ? A  DT 2162 N3 ? ? ? 1_555 WE DA 5    N1 ? ? AA DT 2162 Cq DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4911  hydrog ? ? A  DT 2162 O4 ? ? ? 1_555 WE DA 5    N6 ? ? AA DT 2162 Cq DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4912  hydrog ? ? A  DT 2163 N3 ? ? ? 1_555 WE DA 4    N1 ? ? AA DT 2163 Cq DA 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4913  hydrog ? ? A  DT 2163 O4 ? ? ? 1_555 WE DA 4    N6 ? ? AA DT 2163 Cq DA 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4914  hydrog ? ? A  DA 2164 N1 ? ? ? 1_555 WE DT 3    N3 ? ? AA DA 2164 Cq DT 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4915  hydrog ? ? A  DA 2164 N6 ? ? ? 1_555 WE DT 3    O4 ? ? AA DA 2164 Cq DT 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4916  hydrog ? ? A  DC 2165 N3 ? ? ? 1_555 WE DG 2    N1 ? ? AA DC 2165 Cq DG 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4917  hydrog ? ? A  DC 2165 N4 ? ? ? 1_555 WE DG 2    O6 ? ? AA DC 2165 Cq DG 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4918  hydrog ? ? A  DC 2165 O2 ? ? ? 1_555 WE DG 2    N2 ? ? AA DC 2165 Cq DG 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4919  hydrog ? ? A  DT 2166 N3 ? ? ? 1_555 WE DA 1    N1 ? ? AA DT 2166 Cq DA 1    1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4920  hydrog ? ? A  DA 2167 N1 ? ? ? 1_555 HE DT 32   N3 ? ? AA DA 2167 CU DT 32   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog4921  hydrog ? ? A  DT 2168 N3 ? ? ? 1_555 HE DA 31   N1 ? ? AA DT 2168 CU DA 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4922  hydrog ? ? A  DT 2168 O4 ? ? ? 1_555 HE DA 31   N6 ? ? AA DT 2168 CU DA 31   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4923  hydrog ? ? A  DG 2169 N1 ? ? ? 1_555 KD DC 8    N3 ? ? AA DG 2169 C5 DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4924  hydrog ? ? A  DG 2169 N2 ? ? ? 1_555 KD DC 8    O2 ? ? AA DG 2169 C5 DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4925  hydrog ? ? A  DG 2169 O6 ? ? ? 1_555 KD DC 8    N4 ? ? AA DG 2169 C5 DC 8    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4926  hydrog ? ? A  DC 2170 N3 ? ? ? 1_555 KD DG 7    N1 ? ? AA DC 2170 C5 DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4927  hydrog ? ? A  DC 2170 N4 ? ? ? 1_555 KD DG 7    O6 ? ? AA DC 2170 C5 DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4928  hydrog ? ? A  DC 2170 O2 ? ? ? 1_555 KD DG 7    N2 ? ? AA DC 2170 C5 DG 7    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4929  hydrog ? ? A  DC 2171 N3 ? ? ? 1_555 KD DG 6    N1 ? ? AA DC 2171 C5 DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4930  hydrog ? ? A  DC 2171 N4 ? ? ? 1_555 KD DG 6    O6 ? ? AA DC 2171 C5 DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4931  hydrog ? ? A  DC 2171 O2 ? ? ? 1_555 KD DG 6    N2 ? ? AA DC 2171 C5 DG 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4932  hydrog ? ? A  DT 2172 N3 ? ? ? 1_555 KD DA 5    N1 ? ? AA DT 2172 C5 DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4933  hydrog ? ? A  DT 2172 O4 ? ? ? 1_555 KD DA 5    N6 ? ? AA DT 2172 C5 DA 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4934  hydrog ? ? A  DC 2173 N3 ? ? ? 1_555 KD DG 4    N1 ? ? AA DC 2173 C5 DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4935  hydrog ? ? A  DC 2173 N4 ? ? ? 1_555 KD DG 4    O6 ? ? AA DC 2173 C5 DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4936  hydrog ? ? A  DC 2173 O2 ? ? ? 1_555 KD DG 4    N2 ? ? AA DC 2173 C5 DG 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4937  hydrog ? ? A  DG 2174 N1 ? ? ? 1_555 KD DC 3    N3 ? ? AA DG 2174 C5 DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4938  hydrog ? ? A  DG 2174 N2 ? ? ? 1_555 KD DC 3    O2 ? ? AA DG 2174 C5 DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4939  hydrog ? ? A  DG 2174 O6 ? ? ? 1_555 KD DC 3    N4 ? ? AA DG 2174 C5 DC 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4940  hydrog ? ? A  DT 2175 N3 ? ? ? 1_555 KD DA 2    N1 ? ? AA DT 2175 C5 DA 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4941  hydrog ? ? A  DT 2175 O4 ? ? ? 1_555 KD DA 2    N6 ? ? AA DT 2175 C5 DA 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4942  hydrog ? ? A  DA 2176 N1 ? ? ? 1_555 KD DT 1    N3 ? ? AA DA 2176 C5 DT 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4943  hydrog ? ? A  DA 2176 N6 ? ? ? 1_555 KD DT 1    O4 ? ? AA DA 2176 C5 DT 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4944  hydrog ? ? A  DA 2177 N1 ? ? ? 1_555 PE DT 42   N3 ? ? AA DA 2177 Cd DT 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4945  hydrog ? ? A  DA 2177 N6 ? ? ? 1_555 PE DT 42   O4 ? ? AA DA 2177 Cd DT 42   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4946  hydrog ? ? A  DT 2178 N3 ? ? ? 1_555 PE DA 41   N1 ? ? AA DT 2178 Cd DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4947  hydrog ? ? A  DT 2178 O4 ? ? ? 1_555 PE DA 41   N6 ? ? AA DT 2178 Cd DA 41   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4948  hydrog ? ? A  DT 2179 N3 ? ? ? 1_555 PE DA 40   N1 ? ? AA DT 2179 Cd DA 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4949  hydrog ? ? A  DT 2179 O4 ? ? ? 1_555 PE DA 40   N6 ? ? AA DT 2179 Cd DA 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4950  hydrog ? ? A  DC 2180 N3 ? ? ? 1_555 PE DG 39   N1 ? ? AA DC 2180 Cd DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4951  hydrog ? ? A  DC 2180 N4 ? ? ? 1_555 PE DG 39   O6 ? ? AA DC 2180 Cd DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4952  hydrog ? ? A  DC 2180 O2 ? ? ? 1_555 PE DG 39   N2 ? ? AA DC 2180 Cd DG 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4953  hydrog ? ? A  DC 2181 N3 ? ? ? 1_555 PE DG 38   N1 ? ? AA DC 2181 Cd DG 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4954  hydrog ? ? A  DC 2181 N4 ? ? ? 1_555 PE DG 38   O6 ? ? AA DC 2181 Cd DG 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4955  hydrog ? ? A  DC 2181 O2 ? ? ? 1_555 PE DG 38   N2 ? ? AA DC 2181 Cd DG 38   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4956  hydrog ? ? A  DT 2182 N3 ? ? ? 1_555 PE DA 37   N1 ? ? AA DT 2182 Cd DA 37   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4957  hydrog ? ? A  DT 2183 N3 ? ? ? 1_555 PE DA 36   N1 ? ? AA DT 2183 Cd DA 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4958  hydrog ? ? A  DT 2183 O4 ? ? ? 1_555 PE DA 36   N6 ? ? AA DT 2183 Cd DA 36   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4959  hydrog ? ? A  DT 2184 N3 ? ? ? 1_555 PE DA 35   N1 ? ? AA DT 2184 Cd DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4960  hydrog ? ? A  DT 2184 O4 ? ? ? 1_555 PE DA 35   N6 ? ? AA DT 2184 Cd DA 35   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4961  hydrog ? ? A  DT 2185 N3 ? ? ? 1_555 NB DA 6    N1 ? ? AA DT 2185 BB DA 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4962  hydrog ? ? A  DT 2185 O4 ? ? ? 1_555 NB DA 6    N6 ? ? AA DT 2185 BB DA 6    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4963  hydrog ? ? A  DG 2186 N1 ? ? ? 1_555 NB DC 5    N3 ? ? AA DG 2186 BB DC 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4964  hydrog ? ? A  DG 2186 N2 ? ? ? 1_555 NB DC 5    O2 ? ? AA DG 2186 BB DC 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4965  hydrog ? ? A  DG 2186 O6 ? ? ? 1_555 NB DC 5    N4 ? ? AA DG 2186 BB DC 5    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4966  hydrog ? ? A  DG 2187 N1 ? ? ? 1_555 NB DC 4    N3 ? ? AA DG 2187 BB DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4967  hydrog ? ? A  DG 2187 N2 ? ? ? 1_555 NB DC 4    O2 ? ? AA DG 2187 BB DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4968  hydrog ? ? A  DG 2187 O6 ? ? ? 1_555 NB DC 4    N4 ? ? AA DG 2187 BB DC 4    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4969  hydrog ? ? A  DC 2188 N3 ? ? ? 1_555 NB DG 3    N1 ? ? AA DC 2188 BB DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4970  hydrog ? ? A  DC 2188 N4 ? ? ? 1_555 NB DG 3    O6 ? ? AA DC 2188 BB DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4971  hydrog ? ? A  DC 2188 O2 ? ? ? 1_555 NB DG 3    N2 ? ? AA DC 2188 BB DG 3    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4972  hydrog ? ? A  DG 2189 N1 ? ? ? 1_555 NB DC 2    N3 ? ? AA DG 2189 BB DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4973  hydrog ? ? A  DG 2189 N2 ? ? ? 1_555 NB DC 2    O2 ? ? AA DG 2189 BB DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4974  hydrog ? ? A  DG 2189 O6 ? ? ? 1_555 NB DC 2    N4 ? ? AA DG 2189 BB DC 2    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4975  hydrog ? ? A  DT 2190 N3 ? ? ? 1_555 NB DA 1    N1 ? ? AA DT 2190 BB DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4976  hydrog ? ? A  DT 2190 O4 ? ? ? 1_555 NB DA 1    N6 ? ? AA DT 2190 BB DA 1    1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4977  hydrog ? ? A  DT 2191 N3 ? ? ? 1_555 WE DA 40   N1 ? ? AA DT 2191 Cq DA 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4978  hydrog ? ? A  DT 2191 O4 ? ? ? 1_555 WE DA 40   N6 ? ? AA DT 2191 Cq DA 40   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4979  hydrog ? ? A  DA 2192 N1 ? ? ? 1_555 WE DT 39   N3 ? ? AA DA 2192 Cq DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4980  hydrog ? ? A  DA 2192 N6 ? ? ? 1_555 WE DT 39   O4 ? ? AA DA 2192 Cq DT 39   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4981  hydrog ? ? A  DT 2193 N3 ? ? ? 1_555 KD DA 16   N1 ? ? AA DT 2193 C5 DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4982  hydrog ? ? A  DT 2193 O4 ? ? ? 1_555 KD DA 16   N6 ? ? AA DT 2193 C5 DA 16   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4983  hydrog ? ? A  DG 2194 N1 ? ? ? 1_555 KD DC 15   N3 ? ? AA DG 2194 C5 DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4984  hydrog ? ? A  DG 2194 N2 ? ? ? 1_555 KD DC 15   O2 ? ? AA DG 2194 C5 DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4985  hydrog ? ? A  DG 2194 O6 ? ? ? 1_555 KD DC 15   N4 ? ? AA DG 2194 C5 DC 15   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4986  hydrog ? ? A  DT 2195 N3 ? ? ? 1_555 KD DA 14   N1 ? ? AA DT 2195 C5 DA 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4987  hydrog ? ? A  DT 2195 O4 ? ? ? 1_555 KD DA 14   N6 ? ? AA DT 2195 C5 DA 14   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4988  hydrog ? ? A  DA 2196 N1 ? ? ? 1_555 KD DT 13   N3 ? ? AA DA 2196 C5 DT 13   1_555 ? ? ? ? ? ? 'DA-DT PAIR'            
? ? 
hydrog4989  hydrog ? ? A  DT 2197 N3 ? ? ? 1_555 KD DA 12   N1 ? ? AA DT 2197 C5 DA 12   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4990  hydrog ? ? A  DC 2198 N3 ? ? ? 1_555 KD DG 11   N1 ? ? AA DC 2198 C5 DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4991  hydrog ? ? A  DC 2198 N4 ? ? ? 1_555 KD DG 11   O6 ? ? AA DC 2198 C5 DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4992  hydrog ? ? A  DC 2198 O2 ? ? ? 1_555 KD DG 11   N2 ? ? AA DC 2198 C5 DG 11   1_555 ? ? ? ? ? ? WATSON-CRICK            
? ? 
hydrog4993  hydrog ? ? A  DT 2199 N3 ? ? ? 1_555 KD DA 10   N1 ? ? AA DT 2199 C5 DA 10   1_555 ? ? ? ? ? ? 'DT-DA PAIR'            
? ? 
hydrog4994  hydrog ? ? A  DG 2200 N1 ? ? ? 1_555 KD DC 9    N3 ? ? AA DG 2200 C5 DC 9    1_