data_5DEA
# 
_entry.id   5DEA 
# 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.319 
_audit_conform.dict_location   http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic 
# 
loop_
_database_2.database_id 
_database_2.database_code 
PDB   5DEA         
WWPDB D_1000213084 
# 
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.status_code_sf                  REL 
_pdbx_database_status.status_code_mr                  ? 
_pdbx_database_status.entry_id                        5DEA 
_pdbx_database_status.recvd_initial_deposition_date   2015-08-25 
_pdbx_database_status.SG_entry                        N 
_pdbx_database_status.deposit_site                    RCSB 
_pdbx_database_status.process_site                    RCSB 
_pdbx_database_status.status_code_cs                  ? 
_pdbx_database_status.methods_development_category    ? 
_pdbx_database_status.pdb_format_compatible           Y 
# 
loop_
_audit_author.name 
_audit_author.pdbx_ordinal 
'Vasilyev, N.'   1 
'Polonskaia, A.' 2 
'Darnell, J.C.'  3 
'Darnell, R.B.'  4 
'Patel, D.J.'    5 
'Serganov, A.'   6 
# 
_citation.abstract                  ? 
_citation.abstract_id_CAS           ? 
_citation.book_id_ISBN              ? 
_citation.book_publisher            ? 
_citation.book_publisher_city       ? 
_citation.book_title                ? 
_citation.coordinate_linkage        ? 
_citation.country                   US 
_citation.database_id_Medline       ? 
_citation.details                   ? 
_citation.id                        primary 
_citation.journal_abbrev            Proc.Natl.Acad.Sci.USA 
_citation.journal_id_ASTM           PNASA6 
_citation.journal_id_CSD            0040 
_citation.journal_id_ISSN           1091-6490 
_citation.journal_full              ? 
_citation.journal_issue             ? 
_citation.journal_volume            112 
_citation.language                  ? 
_citation.page_first                E5391 
_citation.page_last                 E5400 
_citation.title                     
'Crystal structure reveals specific recognition of a G-quadruplex RNA by a beta-turn in the RGG motif of FMRP.' 
_citation.year                      2015 
_citation.database_id_CSD           ? 
_citation.pdbx_database_id_DOI      10.1073/pnas.1515737112 
_citation.pdbx_database_id_PubMed   26374839 
_citation.unpublished_flag          ? 
# 
loop_
_citation_author.citation_id 
_citation_author.name 
_citation_author.ordinal 
_citation_author.identifier_ORCID 
primary 'Vasilyev, N.'   1 ? 
primary 'Polonskaia, A.' 2 ? 
primary 'Darnell, J.C.'  3 ? 
primary 'Darnell, R.B.'  4 ? 
primary 'Patel, D.J.'    5 ? 
primary 'Serganov, A.'   6 ? 
# 
_cell.angle_alpha                  90.00 
_cell.angle_alpha_esd              ? 
_cell.angle_beta                   90.00 
_cell.angle_beta_esd               ? 
_cell.angle_gamma                  90.00 
_cell.angle_gamma_esd              ? 
_cell.entry_id                     5DEA 
_cell.details                      ? 
_cell.formula_units_Z              ? 
_cell.length_a                     56.570 
_cell.length_a_esd                 ? 
_cell.length_b                     129.870 
_cell.length_b_esd                 ? 
_cell.length_c                     36.790 
_cell.length_c_esd                 ? 
_cell.volume                       ? 
_cell.volume_esd                   ? 
_cell.Z_PDB                        8 
_cell.reciprocal_angle_alpha       ? 
_cell.reciprocal_angle_beta        ? 
_cell.reciprocal_angle_gamma       ? 
_cell.reciprocal_angle_alpha_esd   ? 
_cell.reciprocal_angle_beta_esd    ? 
_cell.reciprocal_angle_gamma_esd   ? 
_cell.reciprocal_length_a          ? 
_cell.reciprocal_length_b          ? 
_cell.reciprocal_length_c          ? 
_cell.reciprocal_length_a_esd      ? 
_cell.reciprocal_length_b_esd      ? 
_cell.reciprocal_length_c_esd      ? 
_cell.pdbx_unique_axis             ? 
# 
_symmetry.entry_id                         5DEA 
_symmetry.cell_setting                     ? 
_symmetry.Int_Tables_number                18 
_symmetry.space_group_name_Hall            ? 
_symmetry.space_group_name_H-M             'P 21 21 2' 
_symmetry.pdbx_full_space_group_name_H-M   ? 
# 
loop_
_entity.id 
_entity.type 
_entity.src_method 
_entity.pdbx_description 
_entity.formula_weight 
_entity.pdbx_number_of_molecules 
_entity.pdbx_ec 
_entity.pdbx_mutation 
_entity.pdbx_fragment 
_entity.details 
1 polymer     syn sc1                                      11459.821 2 ? ?     ? ? 
2 polymer     syn 'Fragile X mental retardation protein 1' 1788.939  2 ? R527A ? ? 
3 non-polymer syn 'POTASSIUM ION'                          39.098    4 ? ?     ? ? 
4 non-polymer syn 'CESIUM ION'                             132.905   3 ? ?     ? ? 
5 water       nat water                                    18.015    8 ? ?     ? ? 
# 
_entity_name_com.entity_id   2 
_entity_name_com.name        'Protein FMR-1' 
# 
loop_
_entity_poly.entity_id 
_entity_poly.type 
_entity_poly.nstd_linkage 
_entity_poly.nstd_monomer 
_entity_poly.pdbx_seq_one_letter_code 
_entity_poly.pdbx_seq_one_letter_code_can 
_entity_poly.pdbx_strand_id 
_entity_poly.pdbx_target_identifier 
1 polyribonucleotide no no GCUGCGGUGUGGAAGGAGUGGCUGGGUUGCGCAGC GCUGCGGUGUGGAAGGAGUGGCUGGGUUGCGCAGC A,C ? 
2 'polypeptide(L)'   no no ARGDGRRRGGGGRGQGGR                  ARGDGRRRGGGGRGQGGR                  B,D ? 
# 
loop_
_entity_poly_seq.entity_id 
_entity_poly_seq.num 
_entity_poly_seq.mon_id 
_entity_poly_seq.hetero 
1 1  G   n 
1 2  C   n 
1 3  U   n 
1 4  G   n 
1 5  C   n 
1 6  G   n 
1 7  G   n 
1 8  U   n 
1 9  G   n 
1 10 U   n 
1 11 G   n 
1 12 G   n 
1 13 A   n 
1 14 A   n 
1 15 G   n 
1 16 G   n 
1 17 A   n 
1 18 G   n 
1 19 U   n 
1 20 G   n 
1 21 G   n 
1 22 C   n 
1 23 U   n 
1 24 G   n 
1 25 G   n 
1 26 G   n 
1 27 U   n 
1 28 U   n 
1 29 G   n 
1 30 C   n 
1 31 G   n 
1 32 C   n 
1 33 A   n 
1 34 G   n 
1 35 C   n 
2 1  ALA n 
2 2  ARG n 
2 3  GLY n 
2 4  ASP n 
2 5  GLY n 
2 6  ARG n 
2 7  ARG n 
2 8  ARG n 
2 9  GLY n 
2 10 GLY n 
2 11 GLY n 
2 12 GLY n 
2 13 ARG n 
2 14 GLY n 
2 15 GLN n 
2 16 GLY n 
2 17 GLY n 
2 18 ARG n 
# 
loop_
_pdbx_entity_src_syn.entity_id 
_pdbx_entity_src_syn.pdbx_src_id 
_pdbx_entity_src_syn.pdbx_alt_source_flag 
_pdbx_entity_src_syn.pdbx_beg_seq_num 
_pdbx_entity_src_syn.pdbx_end_seq_num 
_pdbx_entity_src_syn.organism_scientific 
_pdbx_entity_src_syn.organism_common_name 
_pdbx_entity_src_syn.ncbi_taxonomy_id 
_pdbx_entity_src_syn.details 
1 1 sample 1 35 'synthetic construct' ?     32630 ? 
2 1 sample 1 18 'Homo sapiens'        Human 9606  ? 
# 
loop_
_struct_ref.id 
_struct_ref.db_name 
_struct_ref.db_code 
_struct_ref.pdbx_db_accession 
_struct_ref.pdbx_db_isoform 
_struct_ref.entity_id 
_struct_ref.pdbx_seq_one_letter_code 
_struct_ref.pdbx_align_begin 
1 PDB 5DEA       5DEA   ? 1 ?                  1   
2 UNP FMR1_HUMAN Q06787 ? 2 RRGDGRRRGGGGRGQGGR 527 
# 
loop_
_struct_ref_seq.align_id 
_struct_ref_seq.ref_id 
_struct_ref_seq.pdbx_PDB_id_code 
_struct_ref_seq.pdbx_strand_id 
_struct_ref_seq.seq_align_beg 
_struct_ref_seq.pdbx_seq_align_beg_ins_code 
_struct_ref_seq.seq_align_end 
_struct_ref_seq.pdbx_seq_align_end_ins_code 
_struct_ref_seq.pdbx_db_accession 
_struct_ref_seq.db_align_beg 
_struct_ref_seq.pdbx_db_align_beg_ins_code 
_struct_ref_seq.db_align_end 
_struct_ref_seq.pdbx_db_align_end_ins_code 
_struct_ref_seq.pdbx_auth_seq_align_beg 
_struct_ref_seq.pdbx_auth_seq_align_end 
1 1 5DEA A 1 ? 35 ? 5DEA   1   ? 35  ? 1 35 
2 2 5DEA B 1 ? 18 ? Q06787 527 ? 544 ? 3 20 
3 1 5DEA C 1 ? 35 ? 5DEA   1   ? 35  ? 1 35 
4 2 5DEA D 1 ? 18 ? Q06787 527 ? 544 ? 3 20 
# 
loop_
_struct_ref_seq_dif.align_id 
_struct_ref_seq_dif.pdbx_pdb_id_code 
_struct_ref_seq_dif.mon_id 
_struct_ref_seq_dif.pdbx_pdb_strand_id 
_struct_ref_seq_dif.seq_num 
_struct_ref_seq_dif.pdbx_pdb_ins_code 
_struct_ref_seq_dif.pdbx_seq_db_name 
_struct_ref_seq_dif.pdbx_seq_db_accession_code 
_struct_ref_seq_dif.db_mon_id 
_struct_ref_seq_dif.pdbx_seq_db_seq_num 
_struct_ref_seq_dif.details 
_struct_ref_seq_dif.pdbx_auth_seq_num 
_struct_ref_seq_dif.pdbx_ordinal 
2 5DEA ALA B 1 ? UNP Q06787 ARG 527 conflict 3 1 
4 5DEA ALA D 1 ? UNP Q06787 ARG 527 conflict 3 2 
# 
loop_
_chem_comp.id 
_chem_comp.type 
_chem_comp.mon_nstd_flag 
_chem_comp.name 
_chem_comp.pdbx_synonyms 
_chem_comp.formula 
_chem_comp.formula_weight 
A   'RNA linking'       y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 
ALA 'L-peptide linking' y ALANINE                      ? 'C3 H7 N O2'      89.093  
ARG 'L-peptide linking' y ARGININE                     ? 'C6 H15 N4 O2 1'  175.209 
ASP 'L-peptide linking' y 'ASPARTIC ACID'              ? 'C4 H7 N O4'      133.103 
C   'RNA linking'       y "CYTIDINE-5'-MONOPHOSPHATE"  ? 'C9 H14 N3 O8 P'  323.197 
CS  non-polymer         . 'CESIUM ION'                 ? 'Cs 1'            132.905 
G   'RNA linking'       y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 
GLN 'L-peptide linking' y GLUTAMINE                    ? 'C5 H10 N2 O3'    146.144 
GLY 'peptide linking'   y GLYCINE                      ? 'C2 H5 N O2'      75.067  
HOH non-polymer         . WATER                        ? 'H2 O'            18.015  
K   non-polymer         . 'POTASSIUM ION'              ? 'K 1'             39.098  
U   'RNA linking'       y "URIDINE-5'-MONOPHOSPHATE"   ? 'C9 H13 N2 O9 P'  324.181 
# 
_exptl.absorpt_coefficient_mu     ? 
_exptl.absorpt_correction_T_max   ? 
_exptl.absorpt_correction_T_min   ? 
_exptl.absorpt_correction_type    ? 
_exptl.absorpt_process_details    ? 
_exptl.entry_id                   5DEA 
_exptl.crystals_number            ? 
_exptl.details                    ? 
_exptl.method                     'X-RAY DIFFRACTION' 
_exptl.method_details             ? 
# 
_exptl_crystal.colour                      ? 
_exptl_crystal.density_diffrn              ? 
_exptl_crystal.density_Matthews            2.64 
_exptl_crystal.density_method              ? 
_exptl_crystal.density_percent_sol         53.38 
_exptl_crystal.description                 ? 
_exptl_crystal.F_000                       ? 
_exptl_crystal.id                          1 
_exptl_crystal.preparation                 ? 
_exptl_crystal.size_max                    ? 
_exptl_crystal.size_mid                    ? 
_exptl_crystal.size_min                    ? 
_exptl_crystal.size_rad                    ? 
_exptl_crystal.colour_lustre               ? 
_exptl_crystal.colour_modifier             ? 
_exptl_crystal.colour_primary              ? 
_exptl_crystal.density_meas                ? 
_exptl_crystal.density_meas_esd            ? 
_exptl_crystal.density_meas_gt             ? 
_exptl_crystal.density_meas_lt             ? 
_exptl_crystal.density_meas_temp           ? 
_exptl_crystal.density_meas_temp_esd       ? 
_exptl_crystal.density_meas_temp_gt        ? 
_exptl_crystal.density_meas_temp_lt        ? 
_exptl_crystal.pdbx_crystal_image_url      ? 
_exptl_crystal.pdbx_crystal_image_format   ? 
_exptl_crystal.pdbx_mosaicity              ? 
_exptl_crystal.pdbx_mosaicity_esd          ? 
# 
_exptl_crystal_grow.apparatus       ? 
_exptl_crystal_grow.atmosphere      ? 
_exptl_crystal_grow.crystal_id      1 
_exptl_crystal_grow.details         ? 
_exptl_crystal_grow.method          'VAPOR DIFFUSION, HANGING DROP' 
_exptl_crystal_grow.method_ref      ? 
_exptl_crystal_grow.pH              5.6 
_exptl_crystal_grow.pressure        ? 
_exptl_crystal_grow.pressure_esd    ? 
_exptl_crystal_grow.seeding         ? 
_exptl_crystal_grow.seeding_ref     ? 
_exptl_crystal_grow.temp            293 
_exptl_crystal_grow.temp_details    ? 
_exptl_crystal_grow.temp_esd        ? 
_exptl_crystal_grow.time            ? 
_exptl_crystal_grow.pdbx_details    '0.1 M sodium citrate pH 5.6, 0.1 M ammonium acetate, 0.1 M cesium chloride, 18% PEG 4000' 
_exptl_crystal_grow.pdbx_pH_range   ? 
# 
_diffrn.ambient_environment    ? 
_diffrn.ambient_temp           100 
_diffrn.ambient_temp_details   ? 
_diffrn.ambient_temp_esd       ? 
_diffrn.crystal_id             1 
_diffrn.crystal_support        ? 
_diffrn.crystal_treatment      ? 
_diffrn.details                ? 
_diffrn.id                     1 
_diffrn.ambient_pressure       ? 
_diffrn.ambient_pressure_esd   ? 
_diffrn.ambient_pressure_gt    ? 
_diffrn.ambient_pressure_lt    ? 
_diffrn.ambient_temp_gt        ? 
_diffrn.ambient_temp_lt        ? 
# 
_diffrn_detector.details                      ? 
_diffrn_detector.detector                     CCD 
_diffrn_detector.diffrn_id                    1 
_diffrn_detector.type                         'ADSC QUANTUM 1' 
_diffrn_detector.area_resol_mean              ? 
_diffrn_detector.dtime                        ? 
_diffrn_detector.pdbx_frames_total            ? 
_diffrn_detector.pdbx_collection_time_total   ? 
_diffrn_detector.pdbx_collection_date         2007-12-03 
# 
_diffrn_radiation.collimation                      ? 
_diffrn_radiation.diffrn_id                        1 
_diffrn_radiation.filter_edge                      ? 
_diffrn_radiation.inhomogeneity                    ? 
_diffrn_radiation.monochromator                    ? 
_diffrn_radiation.polarisn_norm                    ? 
_diffrn_radiation.polarisn_ratio                   ? 
_diffrn_radiation.probe                            ? 
_diffrn_radiation.type                             ? 
_diffrn_radiation.xray_symbol                      ? 
_diffrn_radiation.wavelength_id                    1 
_diffrn_radiation.pdbx_monochromatic_or_laue_m_l   M 
_diffrn_radiation.pdbx_wavelength_list             ? 
_diffrn_radiation.pdbx_wavelength                  ? 
_diffrn_radiation.pdbx_diffrn_protocol             'SINGLE WAVELENGTH' 
_diffrn_radiation.pdbx_analyzer                    ? 
_diffrn_radiation.pdbx_scattering_type             x-ray 
# 
_diffrn_radiation_wavelength.id           1 
_diffrn_radiation_wavelength.wavelength   1.4938 
_diffrn_radiation_wavelength.wt           1.0 
# 
_diffrn_source.current                     ? 
_diffrn_source.details                     ? 
_diffrn_source.diffrn_id                   1 
_diffrn_source.power                       ? 
_diffrn_source.size                        ? 
_diffrn_source.source                      SYNCHROTRON 
_diffrn_source.target                      ? 
_diffrn_source.type                        'APS BEAMLINE 24-ID-E' 
_diffrn_source.voltage                     ? 
_diffrn_source.take-off_angle              ? 
_diffrn_source.pdbx_wavelength_list        1.4938 
_diffrn_source.pdbx_wavelength             ? 
_diffrn_source.pdbx_synchrotron_beamline   24-ID-E 
_diffrn_source.pdbx_synchrotron_site       APS 
# 
_reflns.B_iso_Wilson_estimate            ? 
_reflns.entry_id                         5DEA 
_reflns.data_reduction_details           ? 
_reflns.data_reduction_method            ? 
_reflns.d_resolution_high                2.797 
_reflns.d_resolution_low                 20.0 
_reflns.details                          ? 
_reflns.limit_h_max                      ? 
_reflns.limit_h_min                      ? 
_reflns.limit_k_max                      ? 
_reflns.limit_k_min                      ? 
_reflns.limit_l_max                      ? 
_reflns.limit_l_min                      ? 
_reflns.number_all                       ? 
_reflns.number_obs                       12553 
_reflns.observed_criterion               ? 
_reflns.observed_criterion_F_max         ? 
_reflns.observed_criterion_F_min         ? 
_reflns.observed_criterion_I_max         ? 
_reflns.observed_criterion_I_min         ? 
_reflns.observed_criterion_sigma_F       ? 
_reflns.observed_criterion_sigma_I       ? 
_reflns.percent_possible_obs             97.3 
_reflns.R_free_details                   ? 
_reflns.Rmerge_F_all                     ? 
_reflns.Rmerge_F_obs                     ? 
_reflns.Friedel_coverage                 ? 
_reflns.number_gt                        ? 
_reflns.threshold_expression             ? 
_reflns.pdbx_redundancy                  5.3 
_reflns.pdbx_Rmerge_I_obs                0.074 
_reflns.pdbx_Rmerge_I_all                ? 
_reflns.pdbx_Rsym_value                  ? 
_reflns.pdbx_netI_over_av_sigmaI         ? 
_reflns.pdbx_netI_over_sigmaI            15.3 
_reflns.pdbx_res_netI_over_av_sigmaI_2   ? 
_reflns.pdbx_res_netI_over_sigmaI_2      ? 
_reflns.pdbx_chi_squared                 ? 
_reflns.pdbx_scaling_rejects             ? 
_reflns.pdbx_d_res_high_opt              ? 
_reflns.pdbx_d_res_low_opt               ? 
_reflns.pdbx_d_res_opt_method            ? 
_reflns.phase_calculation_details        ? 
_reflns.pdbx_Rrim_I_all                  ? 
_reflns.pdbx_Rpim_I_all                  ? 
_reflns.pdbx_d_opt                       ? 
_reflns.pdbx_number_measured_all         ? 
_reflns.pdbx_diffrn_id                   1 
_reflns.pdbx_ordinal                     1 
_reflns.pdbx_CC_half                     ? 
_reflns.pdbx_R_split                     ? 
# 
_reflns_shell.Rmerge_F_all                ? 
_reflns_shell.Rmerge_F_gt                 ? 
_reflns_shell.Rmerge_F_obs                ? 
_reflns_shell.Rmerge_I_all                ? 
_reflns_shell.Rmerge_I_gt                 ? 
_reflns_shell.Rmerge_I_obs                0.509 
_reflns_shell.d_res_high                  2.797 
_reflns_shell.d_res_low                   2.87 
_reflns_shell.meanI_over_sigI_all         ? 
_reflns_shell.meanI_over_sigI_gt          ? 
_reflns_shell.meanI_over_sigI_obs         4.4 
_reflns_shell.meanI_over_uI_all           ? 
_reflns_shell.meanI_over_uI_gt            ? 
_reflns_shell.number_measured_all         ? 
_reflns_shell.number_measured_gt          ? 
_reflns_shell.number_measured_obs         ? 
_reflns_shell.number_possible             ? 
_reflns_shell.number_unique_all           639 
_reflns_shell.number_unique_gt            ? 
_reflns_shell.number_unique_obs           ? 
_reflns_shell.pdbx_CC_half                ? 
_reflns_shell.pdbx_R_split                ? 
_reflns_shell.pdbx_Rpim_I_all             ? 
_reflns_shell.pdbx_Rrim_I_all             ? 
_reflns_shell.pdbx_Rsym_value             ? 
_reflns_shell.pdbx_chi_squared            ? 
_reflns_shell.pdbx_diffrn_id              1 
_reflns_shell.pdbx_netI_over_sigmaI_all   ? 
_reflns_shell.pdbx_netI_over_sigmaI_obs   ? 
_reflns_shell.pdbx_ordinal                1 
_reflns_shell.pdbx_redundancy             5.4 
_reflns_shell.pdbx_rejects                ? 
_reflns_shell.percent_possible_all        69.5 
_reflns_shell.percent_possible_gt         ? 
_reflns_shell.percent_possible_obs        ? 
# 
_refine.aniso_B[1][1]                            ? 
_refine.aniso_B[1][2]                            ? 
_refine.aniso_B[1][3]                            ? 
_refine.aniso_B[2][2]                            ? 
_refine.aniso_B[2][3]                            ? 
_refine.aniso_B[3][3]                            ? 
_refine.B_iso_max                                ? 
_refine.B_iso_mean                               ? 
_refine.B_iso_min                                ? 
_refine.correlation_coeff_Fo_to_Fc               ? 
_refine.correlation_coeff_Fo_to_Fc_free          ? 
_refine.details                                  ? 
_refine.diff_density_max                         ? 
_refine.diff_density_max_esd                     ? 
_refine.diff_density_min                         ? 
_refine.diff_density_min_esd                     ? 
_refine.diff_density_rms                         ? 
_refine.diff_density_rms_esd                     ? 
_refine.entry_id                                 5DEA 
_refine.pdbx_refine_id                           'X-RAY DIFFRACTION' 
_refine.ls_abs_structure_details                 ? 
_refine.ls_abs_structure_Flack                   ? 
_refine.ls_abs_structure_Flack_esd               ? 
_refine.ls_abs_structure_Rogers                  ? 
_refine.ls_abs_structure_Rogers_esd              ? 
_refine.ls_d_res_high                            2.7973 
_refine.ls_d_res_low                             19.867 
_refine.ls_extinction_coef                       ? 
_refine.ls_extinction_coef_esd                   ? 
_refine.ls_extinction_expression                 ? 
_refine.ls_extinction_method                     ? 
_refine.ls_goodness_of_fit_all                   ? 
_refine.ls_goodness_of_fit_all_esd               ? 
_refine.ls_goodness_of_fit_obs                   ? 
_refine.ls_goodness_of_fit_obs_esd               ? 
_refine.ls_hydrogen_treatment                    ? 
_refine.ls_matrix_type                           ? 
_refine.ls_number_constraints                    ? 
_refine.ls_number_parameters                     ? 
_refine.ls_number_reflns_all                     ? 
_refine.ls_number_reflns_obs                     6947 
_refine.ls_number_reflns_R_free                  331 
_refine.ls_number_reflns_R_work                  ? 
_refine.ls_number_restraints                     ? 
_refine.ls_percent_reflns_obs                    97.53 
_refine.ls_percent_reflns_R_free                 4.76 
_refine.ls_R_factor_all                          ? 
_refine.ls_R_factor_obs                          0.2027 
_refine.ls_R_factor_R_free                       0.2256 
_refine.ls_R_factor_R_free_error                 ? 
_refine.ls_R_factor_R_free_error_details         ? 
_refine.ls_R_factor_R_work                       0.2015 
_refine.ls_R_Fsqd_factor_obs                     ? 
_refine.ls_R_I_factor_obs                        ? 
_refine.ls_redundancy_reflns_all                 ? 
_refine.ls_redundancy_reflns_obs                 ? 
_refine.ls_restrained_S_all                      ? 
_refine.ls_restrained_S_obs                      ? 
_refine.ls_shift_over_esd_max                    ? 
_refine.ls_shift_over_esd_mean                   ? 
_refine.ls_structure_factor_coef                 ? 
_refine.ls_weighting_details                     ? 
_refine.ls_weighting_scheme                      ? 
_refine.ls_wR_factor_all                         ? 
_refine.ls_wR_factor_obs                         ? 
_refine.ls_wR_factor_R_free                      ? 
_refine.ls_wR_factor_R_work                      ? 
_refine.occupancy_max                            ? 
_refine.occupancy_min                            ? 
_refine.solvent_model_details                    'FLAT BULK SOLVENT MODEL' 
_refine.solvent_model_param_bsol                 ? 
_refine.solvent_model_param_ksol                 ? 
_refine.ls_R_factor_gt                           ? 
_refine.ls_goodness_of_fit_gt                    ? 
_refine.ls_goodness_of_fit_ref                   ? 
_refine.ls_shift_over_su_max                     ? 
_refine.ls_shift_over_su_max_lt                  ? 
_refine.ls_shift_over_su_mean                    ? 
_refine.ls_shift_over_su_mean_lt                 ? 
_refine.pdbx_ls_sigma_I                          ? 
_refine.pdbx_ls_sigma_F                          1.36 
_refine.pdbx_ls_sigma_Fsqd                       ? 
_refine.pdbx_data_cutoff_high_absF               ? 
_refine.pdbx_data_cutoff_high_rms_absF           ? 
_refine.pdbx_data_cutoff_low_absF                ? 
_refine.pdbx_isotropic_thermal_model             ? 
_refine.pdbx_ls_cross_valid_method               THROUGHOUT 
_refine.pdbx_method_to_determine_struct          'MOLECULAR REPLACEMENT' 
_refine.pdbx_starting_model                      5DE8 
_refine.pdbx_stereochemistry_target_values       ML 
_refine.pdbx_R_Free_selection_details            ? 
_refine.pdbx_stereochem_target_val_spec_case     ? 
_refine.pdbx_overall_ESU_R                       ? 
_refine.pdbx_overall_ESU_R_Free                  ? 
_refine.pdbx_solvent_vdw_probe_radii             1.11 
_refine.pdbx_solvent_ion_probe_radii             ? 
_refine.pdbx_solvent_shrinkage_radii             0.90 
_refine.pdbx_real_space_R                        ? 
_refine.pdbx_density_correlation                 ? 
_refine.pdbx_pd_number_of_powder_patterns        ? 
_refine.pdbx_pd_number_of_points                 ? 
_refine.pdbx_pd_meas_number_of_points            ? 
_refine.pdbx_pd_proc_ls_prof_R_factor            ? 
_refine.pdbx_pd_proc_ls_prof_wR_factor           ? 
_refine.pdbx_pd_Marquardt_correlation_coeff      ? 
_refine.pdbx_pd_Fsqrd_R_factor                   ? 
_refine.pdbx_pd_ls_matrix_band_width             ? 
_refine.pdbx_overall_phase_error                 22.62 
_refine.pdbx_overall_SU_R_free_Cruickshank_DPI   ? 
_refine.pdbx_overall_SU_R_free_Blow_DPI          ? 
_refine.pdbx_overall_SU_R_Blow_DPI               ? 
_refine.pdbx_TLS_residual_ADP_flag               ? 
_refine.pdbx_diffrn_id                           1 
_refine.overall_SU_B                             ? 
_refine.overall_SU_ML                            0.25 
_refine.overall_SU_R_Cruickshank_DPI             ? 
_refine.overall_SU_R_free                        ? 
_refine.overall_FOM_free_R_set                   ? 
_refine.overall_FOM_work_R_set                   ? 
_refine.pdbx_average_fsc_overall                 ? 
_refine.pdbx_average_fsc_work                    ? 
_refine.pdbx_average_fsc_free                    ? 
# 
_refine_hist.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_refine_hist.cycle_id                         LAST 
_refine_hist.pdbx_number_atoms_protein        170 
_refine_hist.pdbx_number_atoms_nucleic_acid   1518 
_refine_hist.pdbx_number_atoms_ligand         7 
_refine_hist.number_atoms_solvent             8 
_refine_hist.number_atoms_total               1703 
_refine_hist.d_res_high                       2.7973 
_refine_hist.d_res_low                        19.867 
# 
loop_
_refine_ls_restr.pdbx_refine_id 
_refine_ls_restr.criterion 
_refine_ls_restr.dev_ideal 
_refine_ls_restr.dev_ideal_target 
_refine_ls_restr.number 
_refine_ls_restr.rejects 
_refine_ls_restr.type 
_refine_ls_restr.weight 
_refine_ls_restr.pdbx_restraint_function 
'X-RAY DIFFRACTION' ? 0.004  ? 1868 ? f_bond_d           ? ? 
'X-RAY DIFFRACTION' ? 1.287  ? 2868 ? f_angle_d          ? ? 
'X-RAY DIFFRACTION' ? 17.871 ? 896  ? f_dihedral_angle_d ? ? 
'X-RAY DIFFRACTION' ? 0.066  ? 360  ? f_chiral_restr     ? ? 
'X-RAY DIFFRACTION' ? 0.007  ? 104  ? f_plane_restr      ? ? 
# 
loop_
_refine_ls_shell.pdbx_refine_id 
_refine_ls_shell.d_res_high 
_refine_ls_shell.d_res_low 
_refine_ls_shell.number_reflns_all 
_refine_ls_shell.number_reflns_obs 
_refine_ls_shell.number_reflns_R_free 
_refine_ls_shell.number_reflns_R_work 
_refine_ls_shell.percent_reflns_obs 
_refine_ls_shell.percent_reflns_R_free 
_refine_ls_shell.R_factor_all 
_refine_ls_shell.R_factor_obs 
_refine_ls_shell.R_factor_R_free 
_refine_ls_shell.R_factor_R_free_error 
_refine_ls_shell.R_factor_R_work 
_refine_ls_shell.redundancy_reflns_all 
_refine_ls_shell.redundancy_reflns_obs 
_refine_ls_shell.wR_factor_all 
_refine_ls_shell.wR_factor_obs 
_refine_ls_shell.wR_factor_R_free 
_refine_ls_shell.wR_factor_R_work 
_refine_ls_shell.pdbx_total_number_of_bins_used 
_refine_ls_shell.pdbx_phase_error 
_refine_ls_shell.pdbx_fsc_work 
_refine_ls_shell.pdbx_fsc_free 
'X-RAY DIFFRACTION' 2.7973 3.5211  . . 162 3145 95.00  . . . 0.2720 . 0.2352 . . . . . . . . . . 
'X-RAY DIFFRACTION' 3.5211 19.8676 . . 169 3471 100.00 . . . 0.1973 . 0.1819 . . . . . . . . . . 
# 
_struct.entry_id                     5DEA 
_struct.title                        
'Crystal structure of the complex between human FMRP RGG motif and G-quadruplex RNA, cesium bound form.' 
_struct.pdbx_descriptor              'Fragile X mental retardation protein 1/RNA Complex' 
_struct.pdbx_model_details           ? 
_struct.pdbx_formula_weight          ? 
_struct.pdbx_formula_weight_method   ? 
_struct.pdbx_model_type_details      ? 
_struct.pdbx_CASP_flag               ? 
# 
_struct_keywords.entry_id        5DEA 
_struct_keywords.text            'Fragile X syndrome, RNA structure, RGG box, FMRP, G-quadruplex, RNA binding protein-RNA complex' 
_struct_keywords.pdbx_keywords   'RNA binding protein/RNA' 
# 
loop_
_struct_asym.id 
_struct_asym.pdbx_blank_PDB_chainid_flag 
_struct_asym.pdbx_modified 
_struct_asym.entity_id 
_struct_asym.details 
A N N 1 ? 
B N N 2 ? 
C N N 1 ? 
D N N 2 ? 
E N N 3 ? 
F N N 3 ? 
G N N 4 ? 
H N N 3 ? 
I N N 3 ? 
J N N 4 ? 
K N N 4 ? 
L N N 5 ? 
M N N 5 ? 
# 
loop_
_struct_conn.id 
_struct_conn.conn_type_id 
_struct_conn.pdbx_leaving_atom_flag 
_struct_conn.pdbx_PDB_id 
_struct_conn.ptnr1_label_asym_id 
_struct_conn.ptnr1_label_comp_id 
_struct_conn.ptnr1_label_seq_id 
_struct_conn.ptnr1_label_atom_id 
_struct_conn.pdbx_ptnr1_label_alt_id 
_struct_conn.pdbx_ptnr1_PDB_ins_code 
_struct_conn.pdbx_ptnr1_standard_comp_id 
_struct_conn.ptnr1_symmetry 
_struct_conn.ptnr2_label_asym_id 
_struct_conn.ptnr2_label_comp_id 
_struct_conn.ptnr2_label_seq_id 
_struct_conn.ptnr2_label_atom_id 
_struct_conn.pdbx_ptnr2_label_alt_id 
_struct_conn.pdbx_ptnr2_PDB_ins_code 
_struct_conn.ptnr1_auth_asym_id 
_struct_conn.ptnr1_auth_comp_id 
_struct_conn.ptnr1_auth_seq_id 
_struct_conn.ptnr2_auth_asym_id 
_struct_conn.ptnr2_auth_comp_id 
_struct_conn.ptnr2_auth_seq_id 
_struct_conn.ptnr2_symmetry 
_struct_conn.pdbx_ptnr3_label_atom_id 
_struct_conn.pdbx_ptnr3_label_seq_id 
_struct_conn.pdbx_ptnr3_label_comp_id 
_struct_conn.pdbx_ptnr3_label_asym_id 
_struct_conn.pdbx_ptnr3_label_alt_id 
_struct_conn.pdbx_ptnr3_PDB_ins_code 
_struct_conn.details 
_struct_conn.pdbx_dist_value 
_struct_conn.pdbx_value_order 
metalc1  metalc ? ? A G  6  O6 ? ? ? 1_555 G CS  .  CS ? ? A G  6   A CS  103 1_555 ? ? ? ? ? ? ?             3.329 ? 
metalc2  metalc ? ? A G  6  O6 ? ? ? 1_555 F K   .  K  ? ? A G  6   A K   102 1_555 ? ? ? ? ? ? ?             2.720 ? 
metalc3  metalc ? ? A U  8  O4 ? ? ? 1_555 G CS  .  CS ? ? A U  8   A CS  103 1_555 ? ? ? ? ? ? ?             3.220 ? 
metalc4  metalc ? ? A G  9  O6 ? ? ? 1_555 G CS  .  CS ? ? A G  9   A CS  103 1_555 ? ? ? ? ? ? ?             3.127 ? 
metalc5  metalc ? ? A G  9  O6 ? ? ? 1_555 F K   .  K  ? ? A G  9   A K   102 1_555 ? ? ? ? ? ? ?             2.866 ? 
metalc6  metalc ? ? A G  11 O6 ? ? ? 1_555 E K   .  K  ? ? A G  11  A K   101 1_555 ? ? ? ? ? ? ?             2.771 ? 
metalc7  metalc ? ? A G  12 O6 ? ? ? 1_555 E K   .  K  ? ? A G  12  A K   101 1_555 ? ? ? ? ? ? ?             2.644 ? 
metalc8  metalc ? ? A G  12 O6 ? ? ? 1_555 F K   .  K  ? ? A G  12  A K   102 1_555 ? ? ? ? ? ? ?             2.818 ? 
metalc9  metalc ? ? A G  15 O6 ? ? ? 1_555 E K   .  K  ? ? A G  15  A K   101 1_555 ? ? ? ? ? ? ?             2.647 ? 
metalc10 metalc ? ? A G  16 O6 ? ? ? 1_555 E K   .  K  ? ? A G  16  A K   101 1_555 ? ? ? ? ? ? ?             2.832 ? 
metalc11 metalc ? ? A G  16 O6 ? ? ? 1_555 F K   .  K  ? ? A G  16  A K   102 1_555 ? ? ? ? ? ? ?             2.976 ? 
metalc12 metalc ? ? A A  17 N1 ? ? ? 1_555 G CS  .  CS ? ? A A  17  A CS  103 1_555 ? ? ? ? ? ? ?             3.129 ? 
metalc13 metalc ? ? A G  18 O6 ? ? ? 1_555 G CS  .  CS ? ? A G  18  A CS  103 1_555 ? ? ? ? ? ? ?             3.073 ? 
metalc14 metalc ? ? A G  18 O6 ? ? ? 1_555 F K   .  K  ? ? A G  18  A K   102 1_555 ? ? ? ? ? ? ?             2.836 ? 
metalc15 metalc ? ? A G  20 O6 ? ? ? 1_555 E K   .  K  ? ? A G  20  A K   101 1_555 ? ? ? ? ? ? ?             2.645 ? 
metalc16 metalc ? ? A G  21 O6 ? ? ? 1_555 E K   .  K  ? ? A G  21  A K   101 1_555 ? ? ? ? ? ? ?             2.715 ? 
metalc17 metalc ? ? A G  21 O6 ? ? ? 1_555 F K   .  K  ? ? A G  21  A K   102 1_555 ? ? ? ? ? ? ?             2.848 ? 
metalc18 metalc ? ? A G  24 O6 ? ? ? 1_555 E K   .  K  ? ? A G  24  A K   101 1_555 ? ? ? ? ? ? ?             2.645 ? 
metalc19 metalc ? ? A G  25 O6 ? ? ? 1_555 E K   .  K  ? ? A G  25  A K   101 1_555 ? ? ? ? ? ? ?             2.990 ? 
metalc20 metalc ? ? A G  25 O6 ? ? ? 1_555 F K   .  K  ? ? A G  25  A K   102 1_555 ? ? ? ? ? ? ?             2.890 ? 
metalc21 metalc ? ? A G  26 O6 ? ? ? 1_555 G CS  .  CS ? ? A G  26  A CS  103 1_555 ? ? ? ? ? ? ?             3.284 ? 
metalc22 metalc ? ? A G  26 O6 ? ? ? 1_555 F K   .  K  ? ? A G  26  A K   102 1_555 ? ? ? ? ? ? ?             2.773 ? 
metalc23 metalc ? ? A G  29 O6 ? ? ? 1_555 G CS  .  CS ? ? A G  29  A CS  103 1_555 ? ? ? ? ? ? ?             3.006 ? 
metalc24 metalc ? ? C G  6  O6 ? ? ? 1_555 H K   .  K  ? ? C G  6   C K   101 1_555 ? ? ? ? ? ? ?             2.680 ? 
metalc25 metalc ? ? C G  6  O6 ? ? ? 1_555 J CS  .  CS ? ? C G  6   C CS  103 1_555 ? ? ? ? ? ? ?             3.346 ? 
metalc26 metalc ? ? C U  8  O4 ? ? ? 1_555 J CS  .  CS ? ? C U  8   C CS  103 1_555 ? ? ? ? ? ? ?             3.103 ? 
metalc27 metalc ? ? C G  9  O6 ? ? ? 1_555 H K   .  K  ? ? C G  9   C K   101 1_555 ? ? ? ? ? ? ?             2.951 ? 
metalc28 metalc ? ? C G  9  O6 ? ? ? 1_555 J CS  .  CS ? ? C G  9   C CS  103 1_555 ? ? ? ? ? ? ?             3.133 ? 
metalc29 metalc ? ? C G  11 O6 ? ? ? 1_555 I K   .  K  ? ? C G  11  C K   102 1_555 ? ? ? ? ? ? ?             2.799 ? 
metalc30 metalc ? ? C G  12 O6 ? ? ? 1_555 H K   .  K  ? ? C G  12  C K   101 1_555 ? ? ? ? ? ? ?             2.822 ? 
metalc31 metalc ? ? C G  12 O6 ? ? ? 1_555 I K   .  K  ? ? C G  12  C K   102 1_555 ? ? ? ? ? ? ?             2.754 ? 
metalc32 metalc ? ? C G  15 O6 ? ? ? 1_555 I K   .  K  ? ? C G  15  C K   102 1_555 ? ? ? ? ? ? ?             2.718 ? 
metalc33 metalc ? ? C G  16 O6 ? ? ? 1_555 H K   .  K  ? ? C G  16  C K   101 1_555 ? ? ? ? ? ? ?             3.156 ? 
metalc34 metalc ? ? C G  16 O6 ? ? ? 1_555 I K   .  K  ? ? C G  16  C K   102 1_555 ? ? ? ? ? ? ?             2.784 ? 
metalc35 metalc ? ? C A  17 N1 ? ? ? 1_555 J CS  .  CS ? ? C A  17  C CS  103 1_555 ? ? ? ? ? ? ?             3.178 ? 
metalc36 metalc ? ? C G  18 O6 ? ? ? 1_555 H K   .  K  ? ? C G  18  C K   101 1_555 ? ? ? ? ? ? ?             2.772 ? 
metalc37 metalc ? ? C G  18 O6 ? ? ? 1_555 J CS  .  CS ? ? C G  18  C CS  103 1_555 ? ? ? ? ? ? ?             2.994 ? 
metalc38 metalc ? ? C G  20 O6 ? ? ? 1_555 I K   .  K  ? ? C G  20  C K   102 1_555 ? ? ? ? ? ? ?             2.589 ? 
metalc39 metalc ? ? C G  21 O6 ? ? ? 1_555 H K   .  K  ? ? C G  21  C K   101 1_555 ? ? ? ? ? ? ?             2.965 ? 
metalc40 metalc ? ? C G  21 O6 ? ? ? 1_555 I K   .  K  ? ? C G  21  C K   102 1_555 ? ? ? ? ? ? ?             2.913 ? 
metalc41 metalc ? ? C G  24 O6 ? ? ? 1_555 I K   .  K  ? ? C G  24  C K   102 1_555 ? ? ? ? ? ? ?             2.753 ? 
metalc42 metalc ? ? C G  25 O6 ? ? ? 1_555 H K   .  K  ? ? C G  25  C K   101 1_555 ? ? ? ? ? ? ?             2.869 ? 
metalc43 metalc ? ? C G  25 O6 ? ? ? 1_555 I K   .  K  ? ? C G  25  C K   102 1_555 ? ? ? ? ? ? ?             3.058 ? 
metalc44 metalc ? ? C G  26 O6 ? ? ? 1_555 H K   .  K  ? ? C G  26  C K   101 1_555 ? ? ? ? ? ? ?             2.703 ? 
metalc45 metalc ? ? C G  26 O6 ? ? ? 1_555 J CS  .  CS ? ? C G  26  C CS  103 1_555 ? ? ? ? ? ? ?             3.437 ? 
metalc46 metalc ? ? C G  29 O6 ? ? ? 1_555 J CS  .  CS ? ? C G  29  C CS  103 1_555 ? ? ? ? ? ? ?             2.863 ? 
metalc47 metalc ? ? J CS .  CS ? ? ? 1_555 M HOH .  O  ? ? C CS 103 C HOH 202 1_555 ? ? ? ? ? ? ?             3.002 ? 
metalc48 metalc ? ? K CS .  CS ? ? ? 1_555 M HOH .  O  ? ? C CS 104 C HOH 205 1_555 ? ? ? ? ? ? ?             3.221 ? 
hydrog1  hydrog ? ? A G  1  N1 ? ? ? 1_555 A C   35 N3 ? ? A G  1   A C   35  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog2  hydrog ? ? A G  1  N2 ? ? ? 1_555 A C   35 O2 ? ? A G  1   A C   35  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog3  hydrog ? ? A G  1  O6 ? ? ? 1_555 A C   35 N4 ? ? A G  1   A C   35  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog4  hydrog ? ? A C  2  N3 ? ? ? 1_555 A G   34 N1 ? ? A C  2   A G   34  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog5  hydrog ? ? A C  2  N4 ? ? ? 1_555 A G   34 O6 ? ? A C  2   A G   34  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog6  hydrog ? ? A C  2  O2 ? ? ? 1_555 A G   34 N2 ? ? A C  2   A G   34  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog7  hydrog ? ? A U  3  N3 ? ? ? 1_555 A A   33 N1 ? ? A U  3   A A   33  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog8  hydrog ? ? A U  3  O4 ? ? ? 1_555 A A   33 N6 ? ? A U  3   A A   33  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog9  hydrog ? ? A G  4  N1 ? ? ? 1_555 A C   32 N3 ? ? A G  4   A C   32  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog10 hydrog ? ? A G  4  N2 ? ? ? 1_555 A C   32 O2 ? ? A G  4   A C   32  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog11 hydrog ? ? A G  4  O6 ? ? ? 1_555 A C   32 N4 ? ? A G  4   A C   32  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog12 hydrog ? ? A C  5  N3 ? ? ? 1_555 A G   31 N1 ? ? A C  5   A G   31  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog13 hydrog ? ? A C  5  N4 ? ? ? 1_555 A G   31 O6 ? ? A C  5   A G   31  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog14 hydrog ? ? A C  5  O2 ? ? ? 1_555 A G   31 N2 ? ? A C  5   A G   31  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog15 hydrog ? ? A G  6  N1 ? ? ? 1_555 A G   9  O6 ? ? A G  6   A G   9   1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog16 hydrog ? ? A G  6  N2 ? ? ? 1_555 A G   9  N7 ? ? A G  6   A G   9   1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog17 hydrog ? ? A G  6  N7 ? ? ? 1_555 A G   18 N2 ? ? A G  6   A G   18  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog18 hydrog ? ? A G  6  O6 ? ? ? 1_555 A G   18 N1 ? ? A G  6   A G   18  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog19 hydrog ? ? A G  7  N1 ? ? ? 1_555 A C   30 N3 ? ? A G  7   A C   30  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog20 hydrog ? ? A G  7  N2 ? ? ? 1_555 A C   30 O2 ? ? A G  7   A C   30  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog21 hydrog ? ? A G  7  O6 ? ? ? 1_555 A C   30 N4 ? ? A G  7   A C   30  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog22 hydrog ? ? A U  8  O4 ? ? ? 1_555 A A   17 N6 ? ? A U  8   A A   17  1_555 ? ? ? ? ? ? 'U-A PAIR'    ?     ? 
hydrog23 hydrog ? ? A U  8  N3 ? ? ? 1_555 A G   29 O6 ? ? A U  8   A G   29  1_555 ? ? ? ? ? ? TYPE_28_PAIR  ?     ? 
hydrog24 hydrog ? ? A U  8  O2 ? ? ? 1_555 A G   29 N1 ? ? A U  8   A G   29  1_555 ? ? ? ? ? ? TYPE_28_PAIR  ?     ? 
hydrog25 hydrog ? ? A G  9  N1 ? ? ? 1_555 A G   26 O6 ? ? A G  9   A G   26  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog26 hydrog ? ? A G  9  N2 ? ? ? 1_555 A G   26 N7 ? ? A G  9   A G   26  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog27 hydrog ? ? A G  11 N1 ? ? ? 1_555 A G   15 O6 ? ? A G  11  A G   15  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog28 hydrog ? ? A G  11 N2 ? ? ? 1_555 A G   15 N7 ? ? A G  11  A G   15  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog29 hydrog ? ? A G  11 N7 ? ? ? 1_555 A G   24 N2 ? ? A G  11  A G   24  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog30 hydrog ? ? A G  11 O6 ? ? ? 1_555 A G   24 N1 ? ? A G  11  A G   24  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog31 hydrog ? ? A G  11 O6 ? ? ? 1_555 A G   25 N1 ? ? A G  11  A G   25  1_555 ? ? ? ? ? ? 'G-G MISPAIR' ?     ? 
hydrog32 hydrog ? ? A G  12 N1 ? ? ? 1_555 A G   16 O6 ? ? A G  12  A G   16  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog33 hydrog ? ? A G  12 N2 ? ? ? 1_555 A G   16 N7 ? ? A G  12  A G   16  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog34 hydrog ? ? A G  12 N7 ? ? ? 1_555 A G   25 N2 ? ? A G  12  A G   25  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog35 hydrog ? ? A G  12 O6 ? ? ? 1_555 A G   25 N1 ? ? A G  12  A G   25  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog36 hydrog ? ? A G  15 N1 ? ? ? 1_555 A G   20 O6 ? ? A G  15  A G   20  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog37 hydrog ? ? A G  15 N2 ? ? ? 1_555 A G   20 N7 ? ? A G  15  A G   20  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog38 hydrog ? ? A G  16 N1 ? ? ? 1_555 A G   21 O6 ? ? A G  16  A G   21  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog39 hydrog ? ? A G  16 N2 ? ? ? 1_555 A G   21 N7 ? ? A G  16  A G   21  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog40 hydrog ? ? A G  18 N7 ? ? ? 1_555 A G   26 N2 ? ? A G  18  A G   26  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog41 hydrog ? ? A G  18 O6 ? ? ? 1_555 A G   26 N1 ? ? A G  18  A G   26  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog42 hydrog ? ? A G  20 N1 ? ? ? 1_555 A G   24 O6 ? ? A G  20  A G   24  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog43 hydrog ? ? A G  20 N2 ? ? ? 1_555 A G   24 N7 ? ? A G  20  A G   24  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog44 hydrog ? ? A G  21 N1 ? ? ? 1_555 A G   25 O6 ? ? A G  21  A G   25  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog45 hydrog ? ? A G  21 N2 ? ? ? 1_555 A G   25 N7 ? ? A G  21  A G   25  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog46 hydrog ? ? C G  1  N1 ? ? ? 1_555 C C   35 N3 ? ? C G  1   C C   35  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog47 hydrog ? ? C G  1  N2 ? ? ? 1_555 C C   35 O2 ? ? C G  1   C C   35  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog48 hydrog ? ? C G  1  O6 ? ? ? 1_555 C C   35 N4 ? ? C G  1   C C   35  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog49 hydrog ? ? C C  2  N3 ? ? ? 1_555 C G   34 N1 ? ? C C  2   C G   34  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog50 hydrog ? ? C C  2  N4 ? ? ? 1_555 C G   34 O6 ? ? C C  2   C G   34  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog51 hydrog ? ? C C  2  O2 ? ? ? 1_555 C G   34 N2 ? ? C C  2   C G   34  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog52 hydrog ? ? C U  3  N3 ? ? ? 1_555 C A   33 N1 ? ? C U  3   C A   33  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog53 hydrog ? ? C U  3  O4 ? ? ? 1_555 C A   33 N6 ? ? C U  3   C A   33  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog54 hydrog ? ? C G  4  N1 ? ? ? 1_555 C C   32 N3 ? ? C G  4   C C   32  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog55 hydrog ? ? C G  4  N2 ? ? ? 1_555 C C   32 O2 ? ? C G  4   C C   32  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog56 hydrog ? ? C G  4  O6 ? ? ? 1_555 C C   32 N4 ? ? C G  4   C C   32  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog57 hydrog ? ? C C  5  N3 ? ? ? 1_555 C G   31 N1 ? ? C C  5   C G   31  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog58 hydrog ? ? C C  5  N4 ? ? ? 1_555 C G   31 O6 ? ? C C  5   C G   31  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog59 hydrog ? ? C C  5  O2 ? ? ? 1_555 C G   31 N2 ? ? C C  5   C G   31  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog60 hydrog ? ? C G  6  N1 ? ? ? 1_555 C G   9  O6 ? ? C G  6   C G   9   1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog61 hydrog ? ? C G  6  N2 ? ? ? 1_555 C G   9  N7 ? ? C G  6   C G   9   1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog62 hydrog ? ? C G  6  N7 ? ? ? 1_555 C G   18 N2 ? ? C G  6   C G   18  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog63 hydrog ? ? C G  6  O6 ? ? ? 1_555 C G   18 N1 ? ? C G  6   C G   18  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog64 hydrog ? ? C G  7  N1 ? ? ? 1_555 C C   30 N3 ? ? C G  7   C C   30  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog65 hydrog ? ? C G  7  N2 ? ? ? 1_555 C C   30 O2 ? ? C G  7   C C   30  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog66 hydrog ? ? C G  7  O6 ? ? ? 1_555 C C   30 N4 ? ? C G  7   C C   30  1_555 ? ? ? ? ? ? WATSON-CRICK  ?     ? 
hydrog67 hydrog ? ? C U  8  O4 ? ? ? 1_555 C A   17 N6 ? ? C U  8   C A   17  1_555 ? ? ? ? ? ? 'U-A PAIR'    ?     ? 
hydrog68 hydrog ? ? C U  8  N3 ? ? ? 1_555 C G   29 O6 ? ? C U  8   C G   29  1_555 ? ? ? ? ? ? TYPE_28_PAIR  ?     ? 
hydrog69 hydrog ? ? C U  8  O2 ? ? ? 1_555 C G   29 N1 ? ? C U  8   C G   29  1_555 ? ? ? ? ? ? TYPE_28_PAIR  ?     ? 
hydrog70 hydrog ? ? C G  9  N1 ? ? ? 1_555 C G   26 O6 ? ? C G  9   C G   26  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog71 hydrog ? ? C G  9  N2 ? ? ? 1_555 C G   26 N7 ? ? C G  9   C G   26  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog72 hydrog ? ? C G  11 N1 ? ? ? 1_555 C G   15 O6 ? ? C G  11  C G   15  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog73 hydrog ? ? C G  11 N2 ? ? ? 1_555 C G   15 N7 ? ? C G  11  C G   15  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog74 hydrog ? ? C G  11 N7 ? ? ? 1_555 C G   24 N2 ? ? C G  11  C G   24  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog75 hydrog ? ? C G  11 O6 ? ? ? 1_555 C G   24 N1 ? ? C G  11  C G   24  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog76 hydrog ? ? C G  12 N1 ? ? ? 1_555 C G   16 O6 ? ? C G  12  C G   16  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog77 hydrog ? ? C G  12 N2 ? ? ? 1_555 C G   16 N7 ? ? C G  12  C G   16  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog78 hydrog ? ? C G  12 N7 ? ? ? 1_555 C G   25 N2 ? ? C G  12  C G   25  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog79 hydrog ? ? C G  12 O6 ? ? ? 1_555 C G   25 N1 ? ? C G  12  C G   25  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog80 hydrog ? ? C G  15 N1 ? ? ? 1_555 C G   20 O6 ? ? C G  15  C G   20  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog81 hydrog ? ? C G  15 N2 ? ? ? 1_555 C G   20 N7 ? ? C G  15  C G   20  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog82 hydrog ? ? C G  16 N1 ? ? ? 1_555 C G   20 O6 ? ? C G  16  C G   20  1_555 ? ? ? ? ? ? 'G-G MISPAIR' ?     ? 
hydrog83 hydrog ? ? C G  16 N1 ? ? ? 1_555 C G   21 O6 ? ? C G  16  C G   21  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog84 hydrog ? ? C G  16 N2 ? ? ? 1_555 C G   21 N7 ? ? C G  16  C G   21  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog85 hydrog ? ? C G  18 N7 ? ? ? 1_555 C G   26 N2 ? ? C G  18  C G   26  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog86 hydrog ? ? C G  18 O6 ? ? ? 1_555 C G   26 N1 ? ? C G  18  C G   26  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog87 hydrog ? ? C G  20 N1 ? ? ? 1_555 C G   24 O6 ? ? C G  20  C G   24  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog88 hydrog ? ? C G  20 N2 ? ? ? 1_555 C G   24 N7 ? ? C G  20  C G   24  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog89 hydrog ? ? C G  21 N1 ? ? ? 1_555 C G   25 O6 ? ? C G  21  C G   25  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
hydrog90 hydrog ? ? C G  21 N2 ? ? ? 1_555 C G   25 N7 ? ? C G  21  C G   25  1_555 ? ? ? ? ? ? TYPE_6_PAIR   ?     ? 
# 
loop_
_struct_conn_type.id 
_struct_conn_type.criteria 
_struct_conn_type.reference 
metalc ? ? 
hydrog ? ? 
# 
loop_
_struct_site.id 
_struct_site.pdbx_evidence_code 
_struct_site.pdbx_auth_asym_id 
_struct_site.pdbx_auth_comp_id 
_struct_site.pdbx_auth_seq_id 
_struct_site.pdbx_auth_ins_code 
_struct_site.pdbx_num_residues 
_struct_site.details 
AC1 Software A K  101 ? 9 'binding site for residue K A 101'  
AC2 Software A K  102 ? 9 'binding site for residue K A 102'  
AC3 Software A CS 103 ? 7 'binding site for residue CS A 103' 
AC4 Software C K  101 ? 9 'binding site for residue K C 101'  
AC5 Software C K  102 ? 9 'binding site for residue K C 102'  
AC6 Software C CS 103 ? 8 'binding site for residue CS C 103' 
# 
loop_
_struct_site_gen.id 
_struct_site_gen.site_id 
_struct_site_gen.pdbx_num_res 
_struct_site_gen.label_comp_id 
_struct_site_gen.label_asym_id 
_struct_site_gen.label_seq_id 
_struct_site_gen.pdbx_auth_ins_code 
_struct_site_gen.auth_comp_id 
_struct_site_gen.auth_asym_id 
_struct_site_gen.auth_seq_id 
_struct_site_gen.label_atom_id 
_struct_site_gen.label_alt_id 
_struct_site_gen.symmetry 
_struct_site_gen.details 
1  AC1 9 G   A 11 ? G   A 11  . ? 1_555 ? 
2  AC1 9 G   A 12 ? G   A 12  . ? 1_555 ? 
3  AC1 9 G   A 15 ? G   A 15  . ? 1_555 ? 
4  AC1 9 G   A 16 ? G   A 16  . ? 1_555 ? 
5  AC1 9 G   A 20 ? G   A 20  . ? 1_555 ? 
6  AC1 9 G   A 21 ? G   A 21  . ? 1_555 ? 
7  AC1 9 G   A 24 ? G   A 24  . ? 1_555 ? 
8  AC1 9 G   A 25 ? G   A 25  . ? 1_555 ? 
9  AC1 9 K   F .  ? K   A 102 . ? 1_555 ? 
10 AC2 9 G   A 6  ? G   A 6   . ? 1_555 ? 
11 AC2 9 G   A 9  ? G   A 9   . ? 1_555 ? 
12 AC2 9 G   A 12 ? G   A 12  . ? 1_555 ? 
13 AC2 9 G   A 16 ? G   A 16  . ? 1_555 ? 
14 AC2 9 G   A 18 ? G   A 18  . ? 1_555 ? 
15 AC2 9 G   A 21 ? G   A 21  . ? 1_555 ? 
16 AC2 9 G   A 25 ? G   A 25  . ? 1_555 ? 
17 AC2 9 G   A 26 ? G   A 26  . ? 1_555 ? 
18 AC2 9 K   E .  ? K   A 101 . ? 1_555 ? 
19 AC3 7 G   A 6  ? G   A 6   . ? 1_555 ? 
20 AC3 7 U   A 8  ? U   A 8   . ? 1_555 ? 
21 AC3 7 G   A 9  ? G   A 9   . ? 1_555 ? 
22 AC3 7 A   A 17 ? A   A 17  . ? 1_555 ? 
23 AC3 7 G   A 18 ? G   A 18  . ? 1_555 ? 
24 AC3 7 G   A 26 ? G   A 26  . ? 1_555 ? 
25 AC3 7 G   A 29 ? G   A 29  . ? 1_555 ? 
26 AC4 9 G   C 6  ? G   C 6   . ? 1_555 ? 
27 AC4 9 G   C 9  ? G   C 9   . ? 1_555 ? 
28 AC4 9 G   C 12 ? G   C 12  . ? 1_555 ? 
29 AC4 9 G   C 16 ? G   C 16  . ? 1_555 ? 
30 AC4 9 G   C 18 ? G   C 18  . ? 1_555 ? 
31 AC4 9 G   C 21 ? G   C 21  . ? 1_555 ? 
32 AC4 9 G   C 25 ? G   C 25  . ? 1_555 ? 
33 AC4 9 G   C 26 ? G   C 26  . ? 1_555 ? 
34 AC4 9 K   I .  ? K   C 102 . ? 1_555 ? 
35 AC5 9 G   C 11 ? G   C 11  . ? 1_555 ? 
36 AC5 9 G   C 12 ? G   C 12  . ? 1_555 ? 
37 AC5 9 G   C 15 ? G   C 15  . ? 1_555 ? 
38 AC5 9 G   C 16 ? G   C 16  . ? 1_555 ? 
39 AC5 9 G   C 20 ? G   C 20  . ? 1_555 ? 
40 AC5 9 G   C 21 ? G   C 21  . ? 1_555 ? 
41 AC5 9 G   C 24 ? G   C 24  . ? 1_555 ? 
42 AC5 9 G   C 25 ? G   C 25  . ? 1_555 ? 
43 AC5 9 K   H .  ? K   C 101 . ? 1_555 ? 
44 AC6 8 G   C 6  ? G   C 6   . ? 1_555 ? 
45 AC6 8 U   C 8  ? U   C 8   . ? 1_555 ? 
46 AC6 8 G   C 9  ? G   C 9   . ? 1_555 ? 
47 AC6 8 A   C 17 ? A   C 17  . ? 1_555 ? 
48 AC6 8 G   C 18 ? G   C 18  . ? 1_555 ? 
49 AC6 8 G   C 26 ? G   C 26  . ? 1_555 ? 
50 AC6 8 G   C 29 ? G   C 29  . ? 1_555 ? 
51 AC6 8 HOH M .  ? HOH C 202 . ? 1_555 ? 
# 
_atom_sites.entry_id                    5DEA 
_atom_sites.fract_transf_matrix[1][1]   0.017677 
_atom_sites.fract_transf_matrix[1][2]   0.000000 
_atom_sites.fract_transf_matrix[1][3]   0.000000 
_atom_sites.fract_transf_matrix[2][1]   0.000000 
_atom_sites.fract_transf_matrix[2][2]   0.007700 
_atom_sites.fract_transf_matrix[2][3]   0.000000 
_atom_sites.fract_transf_matrix[3][1]   0.000000 
_atom_sites.fract_transf_matrix[3][2]   0.000000 
_atom_sites.fract_transf_matrix[3][3]   0.027181 
_atom_sites.fract_transf_vector[1]      0.00000 
_atom_sites.fract_transf_vector[2]      0.00000 
_atom_sites.fract_transf_vector[3]      0.00000 
# 
loop_
_atom_type.symbol 
C  
CS 
K  
N  
O  
P  
# 
loop_
_atom_site.group_PDB 
_atom_site.id 
_atom_site.type_symbol 
_atom_site.label_atom_id 
_atom_site.label_alt_id 
_atom_site.label_comp_id 
_atom_site.label_asym_id 
_atom_site.label_entity_id 
_atom_site.label_seq_id 
_atom_site.pdbx_PDB_ins_code 
_atom_site.Cartn_x 
_atom_site.Cartn_y 
_atom_site.Cartn_z 
_atom_site.occupancy 
_atom_site.B_iso_or_equiv 
_atom_site.pdbx_formal_charge 
_atom_site.auth_seq_id 
_atom_site.auth_comp_id 
_atom_site.auth_asym_id 
_atom_site.auth_atom_id 
_atom_site.pdbx_PDB_model_num 
ATOM   1    O  "O5'" . G   A 1 1  ? -6.092  8.333   -0.964  1.00 44.84  ? 1   G   A "O5'" 1 
ATOM   2    C  "C5'" . G   A 1 1  ? -4.760  7.936   -0.699  1.00 29.34  ? 1   G   A "C5'" 1 
ATOM   3    C  "C4'" . G   A 1 1  ? -4.063  7.470   -1.951  1.00 30.84  ? 1   G   A "C4'" 1 
ATOM   4    O  "O4'" . G   A 1 1  ? -4.684  6.250   -2.439  1.00 33.70  ? 1   G   A "O4'" 1 
ATOM   5    C  "C3'" . G   A 1 1  ? -4.103  8.397   -3.155  1.00 31.71  ? 1   G   A "C3'" 1 
ATOM   6    O  "O3'" . G   A 1 1  ? -3.181  9.472   -3.080  1.00 39.81  ? 1   G   A "O3'" 1 
ATOM   7    C  "C2'" . G   A 1 1  ? -3.848  7.438   -4.308  1.00 29.91  ? 1   G   A "C2'" 1 
ATOM   8    O  "O2'" . G   A 1 1  ? -2.480  7.071   -4.371  1.00 30.52  ? 1   G   A "O2'" 1 
ATOM   9    C  "C1'" . G   A 1 1  ? -4.660  6.229   -3.855  1.00 29.39  ? 1   G   A "C1'" 1 
ATOM   10   N  N9    . G   A 1 1  ? -6.037  6.286   -4.381  1.00 18.10  ? 1   G   A N9    1 
ATOM   11   C  C8    . G   A 1 1  ? -7.211  6.528   -3.714  1.00 13.33  ? 1   G   A C8    1 
ATOM   12   N  N7    . G   A 1 1  ? -8.250  6.536   -4.505  1.00 13.50  ? 1   G   A N7    1 
ATOM   13   C  C5    . G   A 1 1  ? -7.725  6.307   -5.775  1.00 14.14  ? 1   G   A C5    1 
ATOM   14   C  C6    . G   A 1 1  ? -8.353  6.207   -7.048  1.00 15.22  ? 1   G   A C6    1 
ATOM   15   O  O6    . G   A 1 1  ? -9.547  6.302   -7.341  1.00 25.98  ? 1   G   A O6    1 
ATOM   16   N  N1    . G   A 1 1  ? -7.444  5.967   -8.063  1.00 19.00  ? 1   G   A N1    1 
ATOM   17   C  C2    . G   A 1 1  ? -6.091  5.837   -7.895  1.00 25.01  ? 1   G   A C2    1 
ATOM   18   N  N2    . G   A 1 1  ? -5.383  5.607   -9.013  1.00 24.24  ? 1   G   A N2    1 
ATOM   19   N  N3    . G   A 1 1  ? -5.488  5.926   -6.718  1.00 21.21  ? 1   G   A N3    1 
ATOM   20   C  C4    . G   A 1 1  ? -6.359  6.168   -5.712  1.00 14.78  ? 1   G   A C4    1 
ATOM   21   P  P     . C   A 1 2  ? -3.555  10.879  -3.761  1.00 30.29  ? 2   C   A P     1 
ATOM   22   O  OP1   . C   A 1 2  ? -2.506  11.875  -3.413  1.00 25.19  ? 2   C   A OP1   1 
ATOM   23   O  OP2   . C   A 1 2  ? -4.986  11.161  -3.476  1.00 33.40  ? 2   C   A OP2   1 
ATOM   24   O  "O5'" . C   A 1 2  ? -3.412  10.567  -5.315  1.00 19.55  ? 2   C   A "O5'" 1 
ATOM   25   C  "C5'" . C   A 1 2  ? -2.182  10.079  -5.825  1.00 13.49  ? 2   C   A "C5'" 1 
ATOM   26   C  "C4'" . C   A 1 2  ? -2.286  9.662   -7.268  1.00 20.96  ? 2   C   A "C4'" 1 
ATOM   27   O  "O4'" . C   A 1 2  ? -3.276  8.615   -7.448  1.00 23.68  ? 2   C   A "O4'" 1 
ATOM   28   C  "C3'" . C   A 1 2  ? -2.707  10.733  -8.252  1.00 28.86  ? 2   C   A "C3'" 1 
ATOM   29   O  "O3'" . C   A 1 2  ? -1.665  11.625  -8.583  1.00 36.28  ? 2   C   A "O3'" 1 
ATOM   30   C  "C2'" . C   A 1 2  ? -3.185  9.905   -9.437  1.00 29.18  ? 2   C   A "C2'" 1 
ATOM   31   O  "O2'" . C   A 1 2  ? -2.080  9.402   -10.173 1.00 35.74  ? 2   C   A "O2'" 1 
ATOM   32   C  "C1'" . C   A 1 2  ? -3.866  8.736   -8.728  1.00 19.64  ? 2   C   A "C1'" 1 
ATOM   33   N  N1    . C   A 1 2  ? -5.321  8.962   -8.589  1.00 19.40  ? 2   C   A N1    1 
ATOM   34   C  C2    . C   A 1 2  ? -6.113  8.776   -9.726  1.00 21.64  ? 2   C   A C2    1 
ATOM   35   O  O2    . C   A 1 2  ? -5.573  8.421   -10.783 1.00 20.94  ? 2   C   A O2    1 
ATOM   36   N  N3    . C   A 1 2  ? -7.447  8.982   -9.647  1.00 25.47  ? 2   C   A N3    1 
ATOM   37   C  C4    . C   A 1 2  ? -7.991  9.359   -8.488  1.00 20.69  ? 2   C   A C4    1 
ATOM   38   N  N4    . C   A 1 2  ? -9.309  9.551   -8.448  1.00 15.58  ? 2   C   A N4    1 
ATOM   39   C  C5    . C   A 1 2  ? -7.206  9.557   -7.317  1.00 13.55  ? 2   C   A C5    1 
ATOM   40   C  C6    . C   A 1 2  ? -5.888  9.351   -7.409  1.00 13.50  ? 2   C   A C6    1 
ATOM   41   P  P     . U   A 1 3  ? -2.010  13.151  -8.933  1.00 31.82  ? 3   U   A P     1 
ATOM   42   O  OP1   . U   A 1 3  ? -0.721  13.857  -9.167  1.00 18.55  ? 3   U   A OP1   1 
ATOM   43   O  OP2   . U   A 1 3  ? -2.913  13.658  -7.867  1.00 13.05  ? 3   U   A OP2   1 
ATOM   44   O  "O5'" . U   A 1 3  ? -2.821  13.041  -10.308 1.00 13.78  ? 3   U   A "O5'" 1 
ATOM   45   C  "C5'" . U   A 1 3  ? -2.180  12.578  -11.484 1.00 15.28  ? 3   U   A "C5'" 1 
ATOM   46   C  "C4'" . U   A 1 3  ? -3.144  12.294  -12.614 1.00 22.67  ? 3   U   A "C4'" 1 
ATOM   47   O  "O4'" . U   A 1 3  ? -4.159  11.334  -12.214 1.00 20.29  ? 3   U   A "O4'" 1 
ATOM   48   C  "C3'" . U   A 1 3  ? -3.959  13.461  -13.139 1.00 29.26  ? 3   U   A "C3'" 1 
ATOM   49   O  "O3'" . U   A 1 3  ? -3.224  14.349  -13.956 1.00 36.70  ? 3   U   A "O3'" 1 
ATOM   50   C  "C2'" . U   A 1 3  ? -5.078  12.752  -13.888 1.00 27.21  ? 3   U   A "C2'" 1 
ATOM   51   O  "O2'" . U   A 1 3  ? -4.623  12.264  -15.140 1.00 23.49  ? 3   U   A "O2'" 1 
ATOM   52   C  "C1'" . U   A 1 3  ? -5.337  11.559  -12.970 1.00 21.83  ? 3   U   A "C1'" 1 
ATOM   53   N  N1    . U   A 1 3  ? -6.490  11.818  -12.080 1.00 18.48  ? 3   U   A N1    1 
ATOM   54   C  C2    . U   A 1 3  ? -7.722  11.682  -12.688 1.00 20.59  ? 3   U   A C2    1 
ATOM   55   O  O2    . U   A 1 3  ? -7.851  11.375  -13.861 1.00 29.58  ? 3   U   A O2    1 
ATOM   56   N  N3    . U   A 1 3  ? -8.801  11.934  -11.888 1.00 18.97  ? 3   U   A N3    1 
ATOM   57   C  C4    . U   A 1 3  ? -8.772  12.294  -10.562 1.00 19.85  ? 3   U   A C4    1 
ATOM   58   O  O4    . U   A 1 3  ? -9.841  12.481  -9.980  1.00 26.29  ? 3   U   A O4    1 
ATOM   59   C  C5    . U   A 1 3  ? -7.460  12.413  -9.998  1.00 19.18  ? 3   U   A C5    1 
ATOM   60   C  C6    . U   A 1 3  ? -6.382  12.179  -10.758 1.00 20.27  ? 3   U   A C6    1 
ATOM   61   P  P     . G   A 1 4  ? -3.775  15.838  -14.181 1.00 38.58  ? 4   G   A P     1 
ATOM   62   O  OP1   . G   A 1 4  ? -2.682  16.631  -14.801 1.00 36.98  ? 4   G   A OP1   1 
ATOM   63   O  OP2   . G   A 1 4  ? -4.386  16.281  -12.903 1.00 35.43  ? 4   G   A OP2   1 
ATOM   64   O  "O5'" . G   A 1 4  ? -4.929  15.675  -15.272 1.00 24.67  ? 4   G   A "O5'" 1 
ATOM   65   C  "C5'" . G   A 1 4  ? -4.628  15.191  -16.571 1.00 25.09  ? 4   G   A "C5'" 1 
ATOM   66   C  "C4'" . G   A 1 4  ? -5.863  15.024  -17.422 1.00 34.70  ? 4   G   A "C4'" 1 
ATOM   67   O  "O4'" . G   A 1 4  ? -6.769  14.059  -16.827 1.00 37.56  ? 4   G   A "O4'" 1 
ATOM   68   C  "C3'" . G   A 1 4  ? -6.715  16.268  -17.615 1.00 38.44  ? 4   G   A "C3'" 1 
ATOM   69   O  "O3'" . G   A 1 4  ? -6.199  17.132  -18.614 1.00 32.08  ? 4   G   A "O3'" 1 
ATOM   70   C  "C2'" . G   A 1 4  ? -8.087  15.687  -17.950 1.00 40.63  ? 4   G   A "C2'" 1 
ATOM   71   O  "O2'" . G   A 1 4  ? -8.146  15.295  -19.314 1.00 45.21  ? 4   G   A "O2'" 1 
ATOM   72   C  "C1'" . G   A 1 4  ? -8.109  14.427  -17.085 1.00 31.06  ? 4   G   A "C1'" 1 
ATOM   73   N  N9    . G   A 1 4  ? -8.795  14.626  -15.793 1.00 26.60  ? 4   G   A N9    1 
ATOM   74   C  C8    . G   A 1 4  ? -8.168  14.625  -14.572 1.00 24.57  ? 4   G   A C8    1 
ATOM   75   N  N7    . G   A 1 4  ? -8.989  14.807  -13.580 1.00 17.12  ? 4   G   A N7    1 
ATOM   76   C  C5    . G   A 1 4  ? -10.233 14.944  -14.165 1.00 18.48  ? 4   G   A C5    1 
ATOM   77   C  C6    . G   A 1 4  ? -11.497 15.162  -13.557 1.00 23.09  ? 4   G   A C6    1 
ATOM   78   O  O6    . G   A 1 4  ? -11.763 15.287  -12.354 1.00 15.80  ? 4   G   A O6    1 
ATOM   79   N  N1    . G   A 1 4  ? -12.508 15.233  -14.509 1.00 27.96  ? 4   G   A N1    1 
ATOM   80   C  C2    . G   A 1 4  ? -12.317 15.108  -15.865 1.00 25.99  ? 4   G   A C2    1 
ATOM   81   N  N2    . G   A 1 4  ? -13.425 15.208  -16.611 1.00 25.55  ? 4   G   A N2    1 
ATOM   82   N  N3    . G   A 1 4  ? -11.139 14.904  -16.443 1.00 19.97  ? 4   G   A N3    1 
ATOM   83   C  C4    . G   A 1 4  ? -10.138 14.834  -15.539 1.00 20.33  ? 4   G   A C4    1 
ATOM   84   P  P     . C   A 1 5  ? -6.442  18.718  -18.511 1.00 26.40  ? 5   C   A P     1 
ATOM   85   O  OP1   . C   A 1 5  ? -5.756  19.411  -19.630 1.00 26.76  ? 5   C   A OP1   1 
ATOM   86   O  OP2   . C   A 1 5  ? -6.091  19.100  -17.120 1.00 41.07  ? 5   C   A OP2   1 
ATOM   87   O  "O5'" . C   A 1 5  ? -8.019  18.882  -18.691 1.00 22.78  ? 5   C   A "O5'" 1 
ATOM   88   C  "C5'" . C   A 1 5  ? -8.653  18.518  -19.909 1.00 21.61  ? 5   C   A "C5'" 1 
ATOM   89   C  "C4'" . C   A 1 5  ? -10.101 18.946  -19.948 1.00 29.45  ? 5   C   A "C4'" 1 
ATOM   90   O  "O4'" . C   A 1 5  ? -10.920 18.040  -19.161 1.00 34.10  ? 5   C   A "O4'" 1 
ATOM   91   C  "C3'" . C   A 1 5  ? -10.416 20.313  -19.366 1.00 26.67  ? 5   C   A "C3'" 1 
ATOM   92   O  "O3'" . C   A 1 5  ? -10.084 21.370  -20.247 1.00 26.95  ? 5   C   A "O3'" 1 
ATOM   93   C  "C2'" . C   A 1 5  ? -11.904 20.203  -19.049 1.00 25.93  ? 5   C   A "C2'" 1 
ATOM   94   O  "O2'" . C   A 1 5  ? -12.695 20.361  -20.218 1.00 27.41  ? 5   C   A "O2'" 1 
ATOM   95   C  "C1'" . C   A 1 5  ? -12.000 18.749  -18.579 1.00 24.63  ? 5   C   A "C1'" 1 
ATOM   96   N  N1    . C   A 1 5  ? -11.903 18.636  -17.105 1.00 24.93  ? 5   C   A N1    1 
ATOM   97   C  C2    . C   A 1 5  ? -13.045 18.823  -16.308 1.00 25.72  ? 5   C   A C2    1 
ATOM   98   O  O2    . C   A 1 5  ? -14.135 19.076  -16.836 1.00 14.75  ? 5   C   A O2    1 
ATOM   99   N  N3    . C   A 1 5  ? -12.940 18.722  -14.962 1.00 26.44  ? 5   C   A N3    1 
ATOM   100  C  C4    . C   A 1 5  ? -11.759 18.456  -14.403 1.00 27.26  ? 5   C   A C4    1 
ATOM   101  N  N4    . C   A 1 5  ? -11.711 18.368  -13.073 1.00 23.93  ? 5   C   A N4    1 
ATOM   102  C  C5    . C   A 1 5  ? -10.582 18.265  -15.184 1.00 23.86  ? 5   C   A C5    1 
ATOM   103  C  C6    . C   A 1 5  ? -10.699 18.363  -16.514 1.00 24.72  ? 5   C   A C6    1 
ATOM   104  P  P     . G   A 1 6  ? -9.642  22.795  -19.661 1.00 40.29  ? 6   G   A P     1 
ATOM   105  O  OP1   . G   A 1 6  ? -8.790  23.499  -20.652 1.00 41.88  ? 6   G   A OP1   1 
ATOM   106  O  OP2   . G   A 1 6  ? -9.123  22.596  -18.283 1.00 42.33  ? 6   G   A OP2   1 
ATOM   107  O  "O5'" . G   A 1 6  ? -11.034 23.562  -19.581 1.00 23.74  ? 6   G   A "O5'" 1 
ATOM   108  C  "C5'" . G   A 1 6  ? -11.285 24.514  -18.563 1.00 26.27  ? 6   G   A "C5'" 1 
ATOM   109  C  "C4'" . G   A 1 6  ? -12.558 25.283  -18.810 1.00 25.70  ? 6   G   A "C4'" 1 
ATOM   110  O  "O4'" . G   A 1 6  ? -12.939 25.946  -17.581 1.00 31.44  ? 6   G   A "O4'" 1 
ATOM   111  C  "C3'" . G   A 1 6  ? -12.454 26.379  -19.857 1.00 18.73  ? 6   G   A "C3'" 1 
ATOM   112  O  "O3'" . G   A 1 6  ? -13.761 26.603  -20.396 1.00 24.46  ? 6   G   A "O3'" 1 
ATOM   113  C  "C2'" . G   A 1 6  ? -12.032 27.577  -19.014 1.00 17.08  ? 6   G   A "C2'" 1 
ATOM   114  O  "O2'" . G   A 1 6  ? -12.292 28.831  -19.607 1.00 21.76  ? 6   G   A "O2'" 1 
ATOM   115  C  "C1'" . G   A 1 6  ? -12.856 27.350  -17.743 1.00 28.39  ? 6   G   A "C1'" 1 
ATOM   116  N  N9    . G   A 1 6  ? -12.242 27.829  -16.508 1.00 14.06  ? 6   G   A N9    1 
ATOM   117  C  C8    . G   A 1 6  ? -10.918 27.812  -16.156 1.00 19.77  ? 6   G   A C8    1 
ATOM   118  N  N7    . G   A 1 6  ? -10.708 28.265  -14.951 1.00 21.70  ? 6   G   A N7    1 
ATOM   119  C  C5    . G   A 1 6  ? -11.976 28.570  -14.475 1.00 25.88  ? 6   G   A C5    1 
ATOM   120  C  C6    . G   A 1 6  ? -12.393 29.093  -13.225 1.00 23.95  ? 6   G   A C6    1 
ATOM   121  O  O6    . G   A 1 6  ? -11.695 29.400  -12.249 1.00 19.33  ? 6   G   A O6    1 
ATOM   122  N  N1    . G   A 1 6  ? -13.775 29.247  -13.179 1.00 21.04  ? 6   G   A N1    1 
ATOM   123  C  C2    . G   A 1 6  ? -14.642 28.934  -14.199 1.00 18.69  ? 6   G   A C2    1 
ATOM   124  N  N2    . G   A 1 6  ? -15.943 29.146  -13.974 1.00 21.68  ? 6   G   A N2    1 
ATOM   125  N  N3    . G   A 1 6  ? -14.266 28.444  -15.363 1.00 21.78  ? 6   G   A N3    1 
ATOM   126  C  C4    . G   A 1 6  ? -12.930 28.295  -15.426 1.00 22.06  ? 6   G   A C4    1 
ATOM   127  P  P     . G   A 1 7  ? -14.359 25.649  -21.547 1.00 47.77  ? 7   G   A P     1 
ATOM   128  O  OP1   . G   A 1 7  ? -13.224 24.973  -22.233 1.00 43.79  ? 7   G   A OP1   1 
ATOM   129  O  OP2   . G   A 1 7  ? -15.348 26.448  -22.319 1.00 44.68  ? 7   G   A OP2   1 
ATOM   130  O  "O5'" . G   A 1 7  ? -15.211 24.545  -20.771 1.00 19.72  ? 7   G   A "O5'" 1 
ATOM   131  C  "C5'" . G   A 1 7  ? -16.116 24.910  -19.738 1.00 28.73  ? 7   G   A "C5'" 1 
ATOM   132  C  "C4'" . G   A 1 7  ? -16.991 23.752  -19.316 1.00 30.13  ? 7   G   A "C4'" 1 
ATOM   133  O  "O4'" . G   A 1 7  ? -16.169 22.645  -18.856 1.00 34.29  ? 7   G   A "O4'" 1 
ATOM   134  C  "C3'" . G   A 1 7  ? -17.932 24.031  -18.153 1.00 35.86  ? 7   G   A "C3'" 1 
ATOM   135  O  "O3'" . G   A 1 7  ? -19.130 24.662  -18.575 1.00 37.06  ? 7   G   A "O3'" 1 
ATOM   136  C  "C2'" . G   A 1 7  ? -18.150 22.649  -17.548 1.00 41.59  ? 7   G   A "C2'" 1 
ATOM   137  O  "O2'" . G   A 1 7  ? -19.101 21.914  -18.305 1.00 48.12  ? 7   G   A "O2'" 1 
ATOM   138  C  "C1'" . G   A 1 7  ? -16.777 22.009  -17.748 1.00 36.79  ? 7   G   A "C1'" 1 
ATOM   139  N  N9    . G   A 1 7  ? -15.884 22.148  -16.571 1.00 32.38  ? 7   G   A N9    1 
ATOM   140  C  C8    . G   A 1 7  ? -14.516 22.275  -16.665 1.00 30.28  ? 7   G   A C8    1 
ATOM   141  N  N7    . G   A 1 7  ? -13.907 22.384  -15.521 1.00 24.16  ? 7   G   A N7    1 
ATOM   142  C  C5    . G   A 1 7  ? -14.929 22.326  -14.591 1.00 29.18  ? 7   G   A C5    1 
ATOM   143  C  C6    . G   A 1 7  ? -14.853 22.394  -13.175 1.00 32.43  ? 7   G   A C6    1 
ATOM   144  O  O6    . G   A 1 7  ? -13.852 22.522  -12.461 1.00 33.69  ? 7   G   A O6    1 
ATOM   145  N  N1    . G   A 1 7  ? -16.105 22.295  -12.591 1.00 26.00  ? 7   G   A N1    1 
ATOM   146  C  C2    . G   A 1 7  ? -17.275 22.151  -13.281 1.00 21.28  ? 7   G   A C2    1 
ATOM   147  N  N2    . G   A 1 7  ? -18.377 22.074  -12.525 1.00 26.78  ? 7   G   A N2    1 
ATOM   148  N  N3    . G   A 1 7  ? -17.361 22.085  -14.600 1.00 22.93  ? 7   G   A N3    1 
ATOM   149  C  C4    . G   A 1 7  ? -16.159 22.181  -15.209 1.00 25.75  ? 7   G   A C4    1 
ATOM   150  P  P     . U   A 1 8  ? -19.582 26.055  -17.917 1.00 36.66  ? 8   U   A P     1 
ATOM   151  O  OP1   . U   A 1 8  ? -20.903 26.445  -18.475 1.00 42.81  ? 8   U   A OP1   1 
ATOM   152  O  OP2   . U   A 1 8  ? -18.431 26.995  -18.014 1.00 29.40  ? 8   U   A OP2   1 
ATOM   153  O  "O5'" . U   A 1 8  ? -19.775 25.685  -16.383 1.00 26.85  ? 8   U   A "O5'" 1 
ATOM   154  C  "C5'" . U   A 1 8  ? -20.903 24.941  -15.953 1.00 22.82  ? 8   U   A "C5'" 1 
ATOM   155  C  "C4'" . U   A 1 8  ? -21.112 25.105  -14.474 1.00 22.58  ? 8   U   A "C4'" 1 
ATOM   156  O  "O4'" . U   A 1 8  ? -20.067 24.400  -13.754 1.00 24.18  ? 8   U   A "O4'" 1 
ATOM   157  C  "C3'" . U   A 1 8  ? -21.028 26.535  -13.960 1.00 25.26  ? 8   U   A "C3'" 1 
ATOM   158  O  "O3'" . U   A 1 8  ? -22.241 27.250  -14.118 1.00 19.07  ? 8   U   A "O3'" 1 
ATOM   159  C  "C2'" . U   A 1 8  ? -20.600 26.360  -12.507 1.00 33.56  ? 8   U   A "C2'" 1 
ATOM   160  O  "O2'" . U   A 1 8  ? -21.722 26.074  -11.683 1.00 24.41  ? 8   U   A "O2'" 1 
ATOM   161  C  "C1'" . U   A 1 8  ? -19.719 25.109  -12.585 1.00 30.95  ? 8   U   A "C1'" 1 
ATOM   162  N  N1    . U   A 1 8  ? -18.272 25.427  -12.642 1.00 28.95  ? 8   U   A N1    1 
ATOM   163  C  C2    . U   A 1 8  ? -17.613 25.703  -11.458 1.00 29.46  ? 8   U   A C2    1 
ATOM   164  O  O2    . U   A 1 8  ? -18.168 25.727  -10.377 1.00 32.62  ? 8   U   A O2    1 
ATOM   165  N  N3    . U   A 1 8  ? -16.273 25.975  -11.579 1.00 24.94  ? 8   U   A N3    1 
ATOM   166  C  C4    . U   A 1 8  ? -15.529 25.983  -12.737 1.00 19.42  ? 8   U   A C4    1 
ATOM   167  O  O4    . U   A 1 8  ? -14.328 26.244  -12.674 1.00 20.14  ? 8   U   A O4    1 
ATOM   168  C  C5    . U   A 1 8  ? -16.275 25.675  -13.919 1.00 23.49  ? 8   U   A C5    1 
ATOM   169  C  C6    . U   A 1 8  ? -17.585 25.409  -13.833 1.00 26.68  ? 8   U   A C6    1 
ATOM   170  P  P     . G   A 1 9  ? -22.229 28.846  -14.302 1.00 43.42  ? 9   G   A P     1 
ATOM   171  O  OP1   . G   A 1 9  ? -23.565 29.258  -14.806 1.00 45.24  ? 9   G   A OP1   1 
ATOM   172  O  OP2   . G   A 1 9  ? -21.016 29.224  -15.065 1.00 47.12  ? 9   G   A OP2   1 
ATOM   173  O  "O5'" . G   A 1 9  ? -22.077 29.393  -12.815 1.00 39.10  ? 9   G   A "O5'" 1 
ATOM   174  C  "C5'" . G   A 1 9  ? -23.019 29.046  -11.807 1.00 35.58  ? 9   G   A "C5'" 1 
ATOM   175  C  "C4'" . G   A 1 9  ? -22.520 29.411  -10.432 1.00 33.68  ? 9   G   A "C4'" 1 
ATOM   176  O  "O4'" . G   A 1 9  ? -21.154 28.934  -10.260 1.00 28.22  ? 9   G   A "O4'" 1 
ATOM   177  C  "C3'" . G   A 1 9  ? -22.486 30.908  -10.115 1.00 38.70  ? 9   G   A "C3'" 1 
ATOM   178  O  "O3'" . G   A 1 9  ? -22.793 31.090  -8.738  1.00 55.03  ? 9   G   A "O3'" 1 
ATOM   179  C  "C2'" . G   A 1 9  ? -21.030 31.273  -10.341 1.00 30.52  ? 9   G   A "C2'" 1 
ATOM   180  O  "O2'" . G   A 1 9  ? -20.601 32.408  -9.620  1.00 37.66  ? 9   G   A "O2'" 1 
ATOM   181  C  "C1'" . G   A 1 9  ? -20.334 30.014  -9.854  1.00 25.16  ? 9   G   A "C1'" 1 
ATOM   182  N  N9    . G   A 1 9  ? -18.978 29.848  -10.374 1.00 24.89  ? 9   G   A N9    1 
ATOM   183  C  C8    . G   A 1 9  ? -18.572 29.888  -11.688 1.00 25.94  ? 9   G   A C8    1 
ATOM   184  N  N7    . G   A 1 9  ? -17.290 29.698  -11.827 1.00 25.52  ? 9   G   A N7    1 
ATOM   185  C  C5    . G   A 1 9  ? -16.827 29.513  -10.530 1.00 23.08  ? 9   G   A C5    1 
ATOM   186  C  C6    . G   A 1 9  ? -15.520 29.265  -10.045 1.00 16.12  ? 9   G   A C6    1 
ATOM   187  O  O6    . G   A 1 9  ? -14.479 29.160  -10.694 1.00 13.21  ? 9   G   A O6    1 
ATOM   188  N  N1    . G   A 1 9  ? -15.499 29.143  -8.657  1.00 16.61  ? 9   G   A N1    1 
ATOM   189  C  C2    . G   A 1 9  ? -16.597 29.248  -7.836  1.00 12.91  ? 9   G   A C2    1 
ATOM   190  N  N2    . G   A 1 9  ? -16.381 29.098  -6.520  1.00 12.69  ? 9   G   A N2    1 
ATOM   191  N  N3    . G   A 1 9  ? -17.820 29.478  -8.280  1.00 13.06  ? 9   G   A N3    1 
ATOM   192  C  C4    . G   A 1 9  ? -17.862 29.583  -9.623  1.00 25.36  ? 9   G   A C4    1 
ATOM   193  P  P     . U   A 1 10 ? -24.303 31.369  -8.290  1.00 50.17  ? 10  U   A P     1 
ATOM   194  O  OP1   . U   A 1 10 ? -24.674 30.317  -7.307  1.00 43.51  ? 10  U   A OP1   1 
ATOM   195  O  OP2   . U   A 1 10 ? -25.119 31.561  -9.518  1.00 45.05  ? 10  U   A OP2   1 
ATOM   196  O  "O5'" . U   A 1 10 ? -24.214 32.753  -7.504  1.00 42.85  ? 10  U   A "O5'" 1 
ATOM   197  C  "C5'" . U   A 1 10 ? -24.290 34.030  -8.131  1.00 44.51  ? 10  U   A "C5'" 1 
ATOM   198  C  "C4'" . U   A 1 10 ? -24.104 35.094  -7.078  1.00 50.89  ? 10  U   A "C4'" 1 
ATOM   199  O  "O4'" . U   A 1 10 ? -25.211 35.023  -6.146  1.00 60.06  ? 10  U   A "O4'" 1 
ATOM   200  C  "C3'" . U   A 1 10 ? -22.835 35.063  -6.234  1.00 54.78  ? 10  U   A "C3'" 1 
ATOM   201  O  "O3'" . U   A 1 10 ? -22.521 36.427  -5.966  1.00 54.00  ? 10  U   A "O3'" 1 
ATOM   202  C  "C2'" . U   A 1 10 ? -23.308 34.403  -4.943  1.00 59.59  ? 10  U   A "C2'" 1 
ATOM   203  O  "O2'" . U   A 1 10 ? -22.525 34.651  -3.795  1.00 55.47  ? 10  U   A "O2'" 1 
ATOM   204  C  "C1'" . U   A 1 10 ? -24.719 34.965  -4.824  1.00 66.81  ? 10  U   A "C1'" 1 
ATOM   205  N  N1    . U   A 1 10 ? -25.595 34.100  -4.042  1.00 68.93  ? 10  U   A N1    1 
ATOM   206  C  C2    . U   A 1 10 ? -25.920 34.508  -2.764  1.00 64.54  ? 10  U   A C2    1 
ATOM   207  O  O2    . U   A 1 10 ? -25.607 35.591  -2.297  1.00 67.24  ? 10  U   A O2    1 
ATOM   208  N  N3    . U   A 1 10 ? -26.703 33.623  -2.080  1.00 53.65  ? 10  U   A N3    1 
ATOM   209  C  C4    . U   A 1 10 ? -27.121 32.391  -2.525  1.00 49.78  ? 10  U   A C4    1 
ATOM   210  O  O4    . U   A 1 10 ? -27.803 31.716  -1.772  1.00 44.99  ? 10  U   A O4    1 
ATOM   211  C  C5    . U   A 1 10 ? -26.700 32.019  -3.840  1.00 55.53  ? 10  U   A C5    1 
ATOM   212  C  C6    . U   A 1 10 ? -25.948 32.869  -4.536  1.00 64.34  ? 10  U   A C6    1 
ATOM   213  P  P     . G   A 1 11 ? -21.570 37.403  -6.815  1.00 53.19  ? 11  G   A P     1 
ATOM   214  O  OP1   . G   A 1 11 ? -20.217 37.694  -6.277  1.00 47.93  ? 11  G   A OP1   1 
ATOM   215  O  OP2   . G   A 1 11 ? -22.544 38.522  -6.806  1.00 67.83  ? 11  G   A OP2   1 
ATOM   216  O  "O5'" . G   A 1 11 ? -21.545 36.986  -8.354  1.00 30.87  ? 11  G   A "O5'" 1 
ATOM   217  C  "C5'" . G   A 1 11 ? -22.320 37.729  -9.288  1.00 34.86  ? 11  G   A "C5'" 1 
ATOM   218  C  "C4'" . G   A 1 11 ? -21.635 37.871  -10.636 1.00 35.08  ? 11  G   A "C4'" 1 
ATOM   219  O  "O4'" . G   A 1 11 ? -20.323 38.450  -10.420 1.00 40.38  ? 11  G   A "O4'" 1 
ATOM   220  C  "C3'" . G   A 1 11 ? -21.356 36.625  -11.465 1.00 36.74  ? 11  G   A "C3'" 1 
ATOM   221  O  "O3'" . G   A 1 11 ? -22.486 36.264  -12.239 1.00 35.63  ? 11  G   A "O3'" 1 
ATOM   222  C  "C2'" . G   A 1 11 ? -20.155 37.033  -12.321 1.00 43.75  ? 11  G   A "C2'" 1 
ATOM   223  O  "O2'" . G   A 1 11 ? -20.572 37.759  -13.470 1.00 40.88  ? 11  G   A "O2'" 1 
ATOM   224  C  "C1'" . G   A 1 11 ? -19.407 37.987  -11.390 1.00 39.52  ? 11  G   A "C1'" 1 
ATOM   225  N  N9    . G   A 1 11 ? -18.282 37.320  -10.702 1.00 23.10  ? 11  G   A N9    1 
ATOM   226  C  C8    . G   A 1 11 ? -18.214 37.015  -9.366  1.00 17.49  ? 11  G   A C8    1 
ATOM   227  N  N7    . G   A 1 11 ? -17.117 36.397  -9.035  1.00 21.80  ? 11  G   A N7    1 
ATOM   228  C  C5    . G   A 1 11 ? -16.415 36.271  -10.224 1.00 23.32  ? 11  G   A C5    1 
ATOM   229  C  C6    . G   A 1 11 ? -15.149 35.684  -10.486 1.00 23.47  ? 11  G   A C6    1 
ATOM   230  O  O6    . G   A 1 11 ? -14.370 35.145  -9.694  1.00 25.50  ? 11  G   A O6    1 
ATOM   231  N  N1    . G   A 1 11 ? -14.816 35.765  -11.830 1.00 23.77  ? 11  G   A N1    1 
ATOM   232  C  C2    . G   A 1 11 ? -15.598 36.338  -12.797 1.00 23.68  ? 11  G   A C2    1 
ATOM   233  N  N2    . G   A 1 11 ? -15.096 36.319  -14.039 1.00 28.40  ? 11  G   A N2    1 
ATOM   234  N  N3    . G   A 1 11 ? -16.780 36.887  -12.568 1.00 24.85  ? 11  G   A N3    1 
ATOM   235  C  C4    . G   A 1 11 ? -17.134 36.809  -11.269 1.00 22.12  ? 11  G   A C4    1 
ATOM   236  P  P     . G   A 1 12 ? -22.813 34.723  -12.535 1.00 46.62  ? 12  G   A P     1 
ATOM   237  O  OP1   . G   A 1 12 ? -24.075 34.673  -13.322 1.00 43.67  ? 12  G   A OP1   1 
ATOM   238  O  OP2   . G   A 1 12 ? -22.724 33.981  -11.250 1.00 37.22  ? 12  G   A OP2   1 
ATOM   239  O  "O5'" . G   A 1 12 ? -21.613 34.253  -13.476 1.00 42.92  ? 12  G   A "O5'" 1 
ATOM   240  C  "C5'" . G   A 1 12 ? -21.436 34.827  -14.768 1.00 35.94  ? 12  G   A "C5'" 1 
ATOM   241  C  "C4'" . G   A 1 12 ? -20.335 34.146  -15.545 1.00 33.79  ? 12  G   A "C4'" 1 
ATOM   242  O  "O4'" . G   A 1 12 ? -19.072 34.253  -14.833 1.00 36.61  ? 12  G   A "O4'" 1 
ATOM   243  C  "C3'" . G   A 1 12 ? -20.559 32.656  -15.807 1.00 40.85  ? 12  G   A "C3'" 1 
ATOM   244  O  "O3'" . G   A 1 12 ? -20.016 32.322  -17.087 1.00 61.91  ? 12  G   A "O3'" 1 
ATOM   245  C  "C2'" . G   A 1 12 ? -19.689 32.006  -14.732 1.00 33.46  ? 12  G   A "C2'" 1 
ATOM   246  O  "O2'" . G   A 1 12 ? -19.294 30.678  -15.000 1.00 40.11  ? 12  G   A "O2'" 1 
ATOM   247  C  "C1'" . G   A 1 12 ? -18.507 32.967  -14.700 1.00 36.98  ? 12  G   A "C1'" 1 
ATOM   248  N  N9    . G   A 1 12 ? -17.672 32.913  -13.498 1.00 33.71  ? 12  G   A N9    1 
ATOM   249  C  C8    . G   A 1 12 ? -18.037 33.078  -12.185 1.00 33.43  ? 12  G   A C8    1 
ATOM   250  N  N7    . G   A 1 12 ? -17.029 32.951  -11.363 1.00 29.66  ? 12  G   A N7    1 
ATOM   251  C  C5    . G   A 1 12 ? -15.941 32.687  -12.180 1.00 21.01  ? 12  G   A C5    1 
ATOM   252  C  C6    . G   A 1 12 ? -14.582 32.458  -11.851 1.00 23.37  ? 12  G   A C6    1 
ATOM   253  O  O6    . G   A 1 12 ? -14.058 32.443  -10.734 1.00 16.65  ? 12  G   A O6    1 
ATOM   254  N  N1    . G   A 1 12 ? -13.810 32.229  -12.987 1.00 30.16  ? 12  G   A N1    1 
ATOM   255  C  C2    . G   A 1 12 ? -14.290 32.219  -14.274 1.00 24.88  ? 12  G   A C2    1 
ATOM   256  N  N2    . G   A 1 12 ? -13.385 31.975  -15.227 1.00 20.75  ? 12  G   A N2    1 
ATOM   257  N  N3    . G   A 1 12 ? -15.558 32.431  -14.596 1.00 27.27  ? 12  G   A N3    1 
ATOM   258  C  C4    . G   A 1 12 ? -16.322 32.655  -13.502 1.00 27.24  ? 12  G   A C4    1 
ATOM   259  P  P     . A   A 1 13 ? -20.910 32.547  -18.400 1.00 41.93  ? 13  A   A P     1 
ATOM   260  O  OP1   . A   A 1 13 ? -22.327 32.524  -17.954 1.00 43.84  ? 13  A   A OP1   1 
ATOM   261  O  OP2   . A   A 1 13 ? -20.457 31.595  -19.446 1.00 44.99  ? 13  A   A OP2   1 
ATOM   262  O  "O5'" . A   A 1 13 ? -20.545 34.044  -18.822 1.00 51.86  ? 13  A   A "O5'" 1 
ATOM   263  C  "C5'" . A   A 1 13 ? -19.258 34.396  -19.339 1.00 53.24  ? 13  A   A "C5'" 1 
ATOM   264  C  "C4'" . A   A 1 13 ? -19.175 35.876  -19.638 1.00 65.93  ? 13  A   A "C4'" 1 
ATOM   265  O  "O4'" . A   A 1 13 ? -20.160 36.249  -20.643 1.00 75.75  ? 13  A   A "O4'" 1 
ATOM   266  C  "C3'" . A   A 1 13 ? -19.466 36.737  -18.407 1.00 79.57  ? 13  A   A "C3'" 1 
ATOM   267  O  "O3'" . A   A 1 13 ? -18.689 37.936  -18.430 1.00 82.70  ? 13  A   A "O3'" 1 
ATOM   268  C  "C2'" . A   A 1 13 ? -20.935 37.103  -18.605 1.00 88.29  ? 13  A   A "C2'" 1 
ATOM   269  O  "O2'" . A   A 1 13 ? -21.352 38.269  -17.924 1.00 88.22  ? 13  A   A "O2'" 1 
ATOM   270  C  "C1'" . A   A 1 13 ? -20.995 37.264  -20.122 1.00 88.30  ? 13  A   A "C1'" 1 
ATOM   271  N  N9    . A   A 1 13 ? -22.328 37.141  -20.726 1.00 96.78  ? 13  A   A N9    1 
ATOM   272  C  C8    . A   A 1 13 ? -22.872 38.026  -21.625 1.00 101.42 ? 13  A   A C8    1 
ATOM   273  N  N7    . A   A 1 13 ? -24.082 37.716  -22.018 1.00 103.64 ? 13  A   A N7    1 
ATOM   274  C  C5    . A   A 1 13 ? -24.366 36.547  -21.328 1.00 102.87 ? 13  A   A C5    1 
ATOM   275  C  C6    . A   A 1 13 ? -25.503 35.718  -21.316 1.00 102.12 ? 13  A   A C6    1 
ATOM   276  N  N6    . A   A 1 13 ? -26.598 35.956  -22.043 1.00 104.67 ? 13  A   A N6    1 
ATOM   277  N  N1    . A   A 1 13 ? -25.481 34.624  -20.523 1.00 97.67  ? 13  A   A N1    1 
ATOM   278  C  C2    . A   A 1 13 ? -24.382 34.391  -19.796 1.00 96.05  ? 13  A   A C2    1 
ATOM   279  N  N3    . A   A 1 13 ? -23.252 35.095  -19.724 1.00 97.69  ? 13  A   A N3    1 
ATOM   280  C  C4    . A   A 1 13 ? -23.302 36.181  -20.518 1.00 99.26  ? 13  A   A C4    1 
ATOM   281  P  P     . A   A 1 14 ? -17.441 38.129  -17.430 1.00 90.36  ? 14  A   A P     1 
ATOM   282  O  OP1   . A   A 1 14 ? -17.482 37.056  -16.400 1.00 79.60  ? 14  A   A OP1   1 
ATOM   283  O  OP2   . A   A 1 14 ? -17.366 39.553  -17.014 1.00 92.61  ? 14  A   A OP2   1 
ATOM   284  O  "O5'" . A   A 1 14 ? -16.208 37.804  -18.384 1.00 101.10 ? 14  A   A "O5'" 1 
ATOM   285  C  "C5'" . A   A 1 14 ? -15.706 38.832  -19.237 1.00 95.91  ? 14  A   A "C5'" 1 
ATOM   286  C  "C4'" . A   A 1 14 ? -15.764 38.430  -20.690 1.00 87.90  ? 14  A   A "C4'" 1 
ATOM   287  O  "O4'" . A   A 1 14 ? -16.435 39.450  -21.468 1.00 86.23  ? 14  A   A "O4'" 1 
ATOM   288  C  "C3'" . A   A 1 14 ? -14.441 38.169  -21.389 1.00 81.96  ? 14  A   A "C3'" 1 
ATOM   289  O  "O3'" . A   A 1 14 ? -14.663 37.185  -22.397 1.00 83.54  ? 14  A   A "O3'" 1 
ATOM   290  C  "C2'" . A   A 1 14 ? -14.126 39.500  -22.062 1.00 81.97  ? 14  A   A "C2'" 1 
ATOM   291  O  "O2'" . A   A 1 14 ? -13.351 39.397  -23.238 1.00 88.26  ? 14  A   A "O2'" 1 
ATOM   292  C  "C1'" . A   A 1 14 ? -15.516 40.094  -22.337 1.00 82.25  ? 14  A   A "C1'" 1 
ATOM   293  N  N9    . A   A 1 14 ? -15.614 41.549  -22.190 1.00 77.28  ? 14  A   A N9    1 
ATOM   294  C  C8    . A   A 1 14 ? -15.815 42.416  -23.238 1.00 74.35  ? 14  A   A C8    1 
ATOM   295  N  N7    . A   A 1 14 ? -15.893 43.672  -22.886 1.00 75.91  ? 14  A   A N7    1 
ATOM   296  C  C5    . A   A 1 14 ? -15.745 43.631  -21.507 1.00 71.36  ? 14  A   A C5    1 
ATOM   297  C  C6    . A   A 1 14 ? -15.738 44.652  -20.545 1.00 61.85  ? 14  A   A C6    1 
ATOM   298  N  N6    . A   A 1 14 ? -15.883 45.942  -20.859 1.00 57.01  ? 14  A   A N6    1 
ATOM   299  N  N1    . A   A 1 14 ? -15.563 44.298  -19.251 1.00 61.63  ? 14  A   A N1    1 
ATOM   300  C  C2    . A   A 1 14 ? -15.415 42.999  -18.959 1.00 59.30  ? 14  A   A C2    1 
ATOM   301  N  N3    . A   A 1 14 ? -15.408 41.948  -19.777 1.00 61.01  ? 14  A   A N3    1 
ATOM   302  C  C4    . A   A 1 14 ? -15.588 42.330  -21.054 1.00 70.49  ? 14  A   A C4    1 
ATOM   303  P  P     . G   A 1 15 ? -14.638 35.636  -21.996 1.00 77.09  ? 15  G   A P     1 
ATOM   304  O  OP1   . G   A 1 15 ? -14.111 34.853  -23.143 1.00 64.33  ? 15  G   A OP1   1 
ATOM   305  O  OP2   . G   A 1 15 ? -15.948 35.275  -21.393 1.00 82.82  ? 15  G   A OP2   1 
ATOM   306  O  "O5'" . G   A 1 15 ? -13.554 35.610  -20.839 1.00 67.88  ? 15  G   A "O5'" 1 
ATOM   307  C  "C5'" . G   A 1 15 ? -12.778 34.455  -20.610 1.00 57.36  ? 15  G   A "C5'" 1 
ATOM   308  C  "C4'" . G   A 1 15 ? -11.398 34.810  -20.131 1.00 43.85  ? 15  G   A "C4'" 1 
ATOM   309  O  "O4'" . G   A 1 15 ? -11.471 35.794  -19.073 1.00 39.59  ? 15  G   A "O4'" 1 
ATOM   310  C  "C3'" . G   A 1 15 ? -10.653 33.644  -19.520 1.00 33.73  ? 15  G   A "C3'" 1 
ATOM   311  O  "O3'" . G   A 1 15 ? -10.048 32.835  -20.512 1.00 27.55  ? 15  G   A "O3'" 1 
ATOM   312  C  "C2'" . G   A 1 15 ? -9.665  34.329  -18.580 1.00 34.54  ? 15  G   A "C2'" 1 
ATOM   313  O  "O2'" . G   A 1 15 ? -8.528  34.795  -19.290 1.00 38.90  ? 15  G   A "O2'" 1 
ATOM   314  C  "C1'" . G   A 1 15 ? -10.468 35.548  -18.119 1.00 30.41  ? 15  G   A "C1'" 1 
ATOM   315  N  N9    . G   A 1 15 ? -11.145 35.338  -16.831 1.00 22.35  ? 15  G   A N9    1 
ATOM   316  C  C8    . G   A 1 15 ? -12.504 35.256  -16.659 1.00 13.80  ? 15  G   A C8    1 
ATOM   317  N  N7    . G   A 1 15 ? -12.857 35.101  -15.416 1.00 13.84  ? 15  G   A N7    1 
ATOM   318  C  C5    . G   A 1 15 ? -11.650 35.105  -14.731 1.00 21.83  ? 15  G   A C5    1 
ATOM   319  C  C6    . G   A 1 15 ? -11.393 34.971  -13.350 1.00 23.05  ? 15  G   A C6    1 
ATOM   320  O  O6    . G   A 1 15 ? -12.218 34.831  -12.440 1.00 25.55  ? 15  G   A O6    1 
ATOM   321  N  N1    . G   A 1 15 ? -10.028 35.033  -13.074 1.00 13.55  ? 15  G   A N1    1 
ATOM   322  C  C2    . G   A 1 15 ? -9.037  35.193  -14.007 1.00 18.53  ? 15  G   A C2    1 
ATOM   323  N  N2    . G   A 1 15 ? -7.777  35.225  -13.546 1.00 24.32  ? 15  G   A N2    1 
ATOM   324  N  N3    . G   A 1 15 ? -9.263  35.313  -15.302 1.00 16.34  ? 15  G   A N3    1 
ATOM   325  C  C4    . G   A 1 15 ? -10.582 35.273  -15.585 1.00 16.01  ? 15  G   A C4    1 
ATOM   326  P  P     . G   A 1 16 ? -9.911  31.253  -20.292 1.00 40.49  ? 16  G   A P     1 
ATOM   327  O  OP1   . G   A 1 16 ? -9.579  30.623  -21.596 1.00 46.55  ? 16  G   A OP1   1 
ATOM   328  O  OP2   . G   A 1 16 ? -11.112 30.806  -19.537 1.00 34.18  ? 16  G   A OP2   1 
ATOM   329  O  "O5'" . G   A 1 16 ? -8.640  31.095  -19.357 1.00 30.43  ? 16  G   A "O5'" 1 
ATOM   330  C  "C5'" . G   A 1 16 ? -7.364  31.603  -19.719 1.00 22.38  ? 16  G   A "C5'" 1 
ATOM   331  C  "C4'" . G   A 1 16 ? -6.375  31.312  -18.623 1.00 20.90  ? 16  G   A "C4'" 1 
ATOM   332  O  "O4'" . G   A 1 16 ? -6.858  31.920  -17.392 1.00 19.61  ? 16  G   A "O4'" 1 
ATOM   333  C  "C3'" . G   A 1 16 ? -6.186  29.830  -18.309 1.00 23.19  ? 16  G   A "C3'" 1 
ATOM   334  O  "O3'" . G   A 1 16 ? -4.862  29.589  -17.835 1.00 33.10  ? 16  G   A "O3'" 1 
ATOM   335  C  "C2'" . G   A 1 16 ? -7.180  29.609  -17.178 1.00 22.10  ? 16  G   A "C2'" 1 
ATOM   336  O  "O2'" . G   A 1 16 ? -6.920  28.486  -16.362 1.00 31.27  ? 16  G   A "O2'" 1 
ATOM   337  C  "C1'" . G   A 1 16 ? -7.042  30.915  -16.407 1.00 23.41  ? 16  G   A "C1'" 1 
ATOM   338  N  N9    . G   A 1 16 ? -8.225  31.226  -15.599 1.00 27.19  ? 16  G   A N9    1 
ATOM   339  C  C8    . G   A 1 16 ? -9.531  31.221  -16.022 1.00 13.31  ? 16  G   A C8    1 
ATOM   340  N  N7    . G   A 1 16 ? -10.374 31.493  -15.066 1.00 13.41  ? 16  G   A N7    1 
ATOM   341  C  C5    . G   A 1 16 ? -9.588  31.667  -13.936 1.00 13.34  ? 16  G   A C5    1 
ATOM   342  C  C6    . G   A 1 16 ? -9.949  31.979  -12.597 1.00 13.41  ? 16  G   A C6    1 
ATOM   343  O  O6    . G   A 1 16 ? -11.074 32.175  -12.115 1.00 15.97  ? 16  G   A O6    1 
ATOM   344  N  N1    . G   A 1 16 ? -8.840  32.064  -11.772 1.00 13.31  ? 16  G   A N1    1 
ATOM   345  C  C2    . G   A 1 16 ? -7.548  31.872  -12.178 1.00 21.85  ? 16  G   A C2    1 
ATOM   346  N  N2    . G   A 1 16 ? -6.621  31.997  -11.217 1.00 13.10  ? 16  G   A N2    1 
ATOM   347  N  N3    . G   A 1 16 ? -7.192  31.580  -13.424 1.00 15.24  ? 16  G   A N3    1 
ATOM   348  C  C4    . G   A 1 16 ? -8.259  31.491  -14.246 1.00 15.06  ? 16  G   A C4    1 
ATOM   349  P  P     . A   A 1 17 ? -4.134  28.201  -18.183 1.00 33.85  ? 17  A   A P     1 
ATOM   350  O  OP1   . A   A 1 17 ? -2.667  28.442  -18.176 1.00 35.66  ? 17  A   A OP1   1 
ATOM   351  O  OP2   . A   A 1 17 ? -4.805  27.640  -19.386 1.00 20.79  ? 17  A   A OP2   1 
ATOM   352  O  "O5'" . A   A 1 17 ? -4.475  27.260  -16.938 1.00 32.50  ? 17  A   A "O5'" 1 
ATOM   353  C  "C5'" . A   A 1 17 ? -3.921  27.513  -15.649 1.00 31.23  ? 17  A   A "C5'" 1 
ATOM   354  C  "C4'" . A   A 1 17 ? -4.129  26.352  -14.701 1.00 30.41  ? 17  A   A "C4'" 1 
ATOM   355  O  "O4'" . A   A 1 17 ? -5.519  26.281  -14.267 1.00 33.80  ? 17  A   A "O4'" 1 
ATOM   356  C  "C3'" . A   A 1 17 ? -3.786  24.967  -15.263 1.00 27.03  ? 17  A   A "C3'" 1 
ATOM   357  O  "O3'" . A   A 1 17 ? -3.259  24.139  -14.226 1.00 33.68  ? 17  A   A "O3'" 1 
ATOM   358  C  "C2'" . A   A 1 17 ? -5.159  24.418  -15.634 1.00 23.12  ? 17  A   A "C2'" 1 
ATOM   359  O  "O2'" . A   A 1 17 ? -5.219  23.009  -15.699 1.00 15.18  ? 17  A   A "O2'" 1 
ATOM   360  C  "C1'" . A   A 1 17 ? -6.006  24.973  -14.491 1.00 28.10  ? 17  A   A "C1'" 1 
ATOM   361  N  N9    . A   A 1 17 ? -7.456  25.013  -14.721 1.00 23.45  ? 17  A   A N9    1 
ATOM   362  C  C8    . A   A 1 17 ? -8.164  24.918  -15.894 1.00 26.02  ? 17  A   A C8    1 
ATOM   363  N  N7    . A   A 1 17 ? -9.469  24.978  -15.735 1.00 21.28  ? 17  A   A N7    1 
ATOM   364  C  C5    . A   A 1 17 ? -9.636  25.116  -14.367 1.00 19.12  ? 17  A   A C5    1 
ATOM   365  C  C6    . A   A 1 17 ? -10.783 25.232  -13.556 1.00 19.06  ? 17  A   A C6    1 
ATOM   366  N  N6    . A   A 1 17 ? -12.039 25.235  -14.018 1.00 20.06  ? 17  A   A N6    1 
ATOM   367  N  N1    . A   A 1 17 ? -10.592 25.348  -12.225 1.00 10.46  ? 17  A   A N1    1 
ATOM   368  C  C2    . A   A 1 17 ? -9.340  25.351  -11.748 1.00 8.61   ? 17  A   A C2    1 
ATOM   369  N  N3    . A   A 1 17 ? -8.187  25.250  -12.405 1.00 16.55  ? 17  A   A N3    1 
ATOM   370  C  C4    . A   A 1 17 ? -8.406  25.133  -13.730 1.00 22.21  ? 17  A   A C4    1 
ATOM   371  P  P     . G   A 1 18 ? -2.132  24.654  -13.199 1.00 31.18  ? 18  G   A P     1 
ATOM   372  O  OP1   . G   A 1 18 ? -1.359  25.811  -13.728 1.00 35.88  ? 18  G   A OP1   1 
ATOM   373  O  OP2   . G   A 1 18 ? -1.367  23.432  -12.837 1.00 29.96  ? 18  G   A OP2   1 
ATOM   374  O  "O5'" . G   A 1 18 ? -2.979  25.084  -11.917 1.00 40.56  ? 18  G   A "O5'" 1 
ATOM   375  C  "C5'" . G   A 1 18 ? -2.362  25.764  -10.831 1.00 34.87  ? 18  G   A "C5'" 1 
ATOM   376  C  "C4'" . G   A 1 18 ? -2.469  27.257  -11.000 1.00 32.27  ? 18  G   A "C4'" 1 
ATOM   377  O  "O4'" . G   A 1 18 ? -3.870  27.651  -11.085 1.00 28.38  ? 18  G   A "O4'" 1 
ATOM   378  C  "C3'" . G   A 1 18 ? -1.842  28.102  -9.888  1.00 34.75  ? 18  G   A "C3'" 1 
ATOM   379  O  "O3'" . G   A 1 18 ? -1.140  29.181  -10.495 1.00 50.45  ? 18  G   A "O3'" 1 
ATOM   380  C  "C2'" . G   A 1 18 ? -3.058  28.644  -9.131  1.00 26.82  ? 18  G   A "C2'" 1 
ATOM   381  O  "O2'" . G   A 1 18 ? -2.849  29.882  -8.484  1.00 28.93  ? 18  G   A "O2'" 1 
ATOM   382  C  "C1'" . G   A 1 18 ? -4.094  28.762  -10.245 1.00 21.35  ? 18  G   A "C1'" 1 
ATOM   383  N  N9    . G   A 1 18 ? -5.488  28.749  -9.781  1.00 15.05  ? 18  G   A N9    1 
ATOM   384  C  C8    . G   A 1 18 ? -5.902  28.834  -8.467  1.00 18.71  ? 18  G   A C8    1 
ATOM   385  N  N7    . G   A 1 18 ? -7.199  28.821  -8.318  1.00 10.99  ? 18  G   A N7    1 
ATOM   386  C  C5    . G   A 1 18 ? -7.680  28.732  -9.613  1.00 10.33  ? 18  G   A C5    1 
ATOM   387  C  C6    . G   A 1 18 ? -9.020  28.683  -10.065 1.00 10.25  ? 18  G   A C6    1 
ATOM   388  O  O6    . G   A 1 18 ? -10.055 28.714  -9.386  1.00 13.49  ? 18  G   A O6    1 
ATOM   389  N  N1    . G   A 1 18 ? -9.090  28.593  -11.451 1.00 7.34   ? 18  G   A N1    1 
ATOM   390  C  C2    . G   A 1 18 ? -8.004  28.559  -12.287 1.00 14.32  ? 18  G   A C2    1 
ATOM   391  N  N2    . G   A 1 18 ? -8.296  28.472  -13.594 1.00 17.16  ? 18  G   A N2    1 
ATOM   392  N  N3    . G   A 1 18 ? -6.740  28.609  -11.879 1.00 9.53   ? 18  G   A N3    1 
ATOM   393  C  C4    . G   A 1 18 ? -6.647  28.695  -10.533 1.00 10.07  ? 18  G   A C4    1 
ATOM   394  P  P     . U   A 1 19 ? 0.465   29.136  -10.601 1.00 42.50  ? 19  U   A P     1 
ATOM   395  O  OP1   . U   A 1 19 ? 0.797   28.058  -11.573 1.00 43.21  ? 19  U   A OP1   1 
ATOM   396  O  OP2   . U   A 1 19 ? 1.061   29.132  -9.238  1.00 22.10  ? 19  U   A OP2   1 
ATOM   397  O  "O5'" . U   A 1 19 ? 0.816   30.529  -11.279 1.00 70.36  ? 19  U   A "O5'" 1 
ATOM   398  C  "C5'" . U   A 1 19 ? 0.487   31.744  -10.624 1.00 71.02  ? 19  U   A "C5'" 1 
ATOM   399  C  "C4'" . U   A 1 19 ? 0.802   32.946  -11.472 1.00 72.63  ? 19  U   A "C4'" 1 
ATOM   400  O  "O4'" . U   A 1 19 ? 2.238   33.024  -11.686 1.00 78.94  ? 19  U   A "O4'" 1 
ATOM   401  C  "C3'" . U   A 1 19 ? 0.169   32.925  -12.859 1.00 73.98  ? 19  U   A "C3'" 1 
ATOM   402  O  "O3'" . U   A 1 19 ? -0.111  34.267  -13.254 1.00 78.96  ? 19  U   A "O3'" 1 
ATOM   403  C  "C2'" . U   A 1 19 ? 1.285   32.348  -13.725 1.00 77.24  ? 19  U   A "C2'" 1 
ATOM   404  O  "O2'" . U   A 1 19 ? 1.194   32.673  -15.096 1.00 79.31  ? 19  U   A "O2'" 1 
ATOM   405  C  "C1'" . U   A 1 19 ? 2.518   32.967  -13.074 1.00 84.48  ? 19  U   A "C1'" 1 
ATOM   406  N  N1    . U   A 1 19 ? 3.773   32.220  -13.265 1.00 92.67  ? 19  U   A N1    1 
ATOM   407  C  C2    . U   A 1 19 ? 4.691   32.734  -14.163 1.00 91.66  ? 19  U   A C2    1 
ATOM   408  O  O2    . U   A 1 19 ? 4.480   33.738  -14.824 1.00 87.75  ? 19  U   A O2    1 
ATOM   409  N  N3    . U   A 1 19 ? 5.853   32.007  -14.289 1.00 88.45  ? 19  U   A N3    1 
ATOM   410  C  C4    . U   A 1 19 ? 6.196   30.857  -13.604 1.00 83.10  ? 19  U   A C4    1 
ATOM   411  O  O4    . U   A 1 19 ? 7.282   30.319  -13.827 1.00 74.26  ? 19  U   A O4    1 
ATOM   412  C  C5    . U   A 1 19 ? 5.204   30.402  -12.675 1.00 86.59  ? 19  U   A C5    1 
ATOM   413  C  C6    . U   A 1 19 ? 4.061   31.086  -12.536 1.00 91.28  ? 19  U   A C6    1 
ATOM   414  P  P     . G   A 1 20 ? -1.611  34.840  -13.155 1.00 58.50  ? 20  G   A P     1 
ATOM   415  O  OP1   . G   A 1 20 ? -2.526  33.774  -13.634 1.00 57.82  ? 20  G   A OP1   1 
ATOM   416  O  OP2   . G   A 1 20 ? -1.633  36.190  -13.775 1.00 52.94  ? 20  G   A OP2   1 
ATOM   417  O  "O5'" . G   A 1 20 ? -1.883  35.029  -11.595 1.00 27.67  ? 20  G   A "O5'" 1 
ATOM   418  C  "C5'" . G   A 1 20 ? -1.116  35.933  -10.813 1.00 25.65  ? 20  G   A "C5'" 1 
ATOM   419  C  "C4'" . G   A 1 20 ? -1.779  36.200  -9.484  1.00 24.56  ? 20  G   A "C4'" 1 
ATOM   420  O  "O4'" . G   A 1 20 ? -3.032  36.885  -9.724  1.00 26.84  ? 20  G   A "O4'" 1 
ATOM   421  C  "C3'" . G   A 1 20 ? -2.136  34.955  -8.668  1.00 33.81  ? 20  G   A "C3'" 1 
ATOM   422  O  "O3'" . G   A 1 20 ? -1.233  34.596  -7.644  1.00 38.01  ? 20  G   A "O3'" 1 
ATOM   423  C  "C2'" . G   A 1 20 ? -3.531  35.210  -8.104  1.00 39.12  ? 20  G   A "C2'" 1 
ATOM   424  O  "O2'" . G   A 1 20 ? -3.441  35.588  -6.741  1.00 47.41  ? 20  G   A "O2'" 1 
ATOM   425  C  "C1'" . G   A 1 20 ? -4.018  36.442  -8.834  1.00 26.26  ? 20  G   A "C1'" 1 
ATOM   426  N  N9    . G   A 1 20 ? -5.257  36.122  -9.557  1.00 16.42  ? 20  G   A N9    1 
ATOM   427  C  C8    . G   A 1 20 ? -5.510  36.003  -10.902 1.00 20.62  ? 20  G   A C8    1 
ATOM   428  N  N7    . G   A 1 20 ? -6.764  35.722  -11.152 1.00 18.20  ? 20  G   A N7    1 
ATOM   429  C  C5    . G   A 1 20 ? -7.361  35.669  -9.898  1.00 12.05  ? 20  G   A C5    1 
ATOM   430  C  C6    . G   A 1 20 ? -8.698  35.409  -9.517  1.00 13.55  ? 20  G   A C6    1 
ATOM   431  O  O6    . G   A 1 20 ? -9.660  35.162  -10.247 1.00 16.98  ? 20  G   A O6    1 
ATOM   432  N  N1    . G   A 1 20 ? -8.862  35.455  -8.136  1.00 13.16  ? 20  G   A N1    1 
ATOM   433  C  C2    . G   A 1 20 ? -7.865  35.717  -7.230  1.00 14.51  ? 20  G   A C2    1 
ATOM   434  N  N2    . G   A 1 20 ? -8.214  35.717  -5.931  1.00 11.04  ? 20  G   A N2    1 
ATOM   435  N  N3    . G   A 1 20 ? -6.616  35.964  -7.574  1.00 8.11   ? 20  G   A N3    1 
ATOM   436  C  C4    . G   A 1 20 ? -6.449  35.945  -8.911  1.00 9.16   ? 20  G   A C4    1 
ATOM   437  P  P     . G   A 1 21 ? -1.040  33.029  -7.333  1.00 46.55  ? 21  G   A P     1 
ATOM   438  O  OP1   . G   A 1 21 ? 0.338   32.789  -6.834  1.00 52.45  ? 21  G   A OP1   1 
ATOM   439  O  OP2   . G   A 1 21 ? -1.568  32.318  -8.523  1.00 36.08  ? 21  G   A OP2   1 
ATOM   440  O  "O5'" . G   A 1 21 ? -2.084  32.675  -6.179  1.00 30.53  ? 21  G   A "O5'" 1 
ATOM   441  C  "C5'" . G   A 1 21 ? -2.345  33.530  -5.073  1.00 27.36  ? 21  G   A "C5'" 1 
ATOM   442  C  "C4'" . G   A 1 21 ? -3.512  33.013  -4.265  1.00 24.91  ? 21  G   A "C4'" 1 
ATOM   443  O  "O4'" . G   A 1 21 ? -4.768  33.303  -4.950  1.00 27.52  ? 21  G   A "O4'" 1 
ATOM   444  C  "C3'" . G   A 1 21 ? -3.502  31.503  -4.028  1.00 23.15  ? 21  G   A "C3'" 1 
ATOM   445  O  "O3'" . G   A 1 21 ? -4.075  31.220  -2.753  1.00 38.69  ? 21  G   A "O3'" 1 
ATOM   446  C  "C2'" . G   A 1 21 ? -4.452  30.989  -5.099  1.00 23.75  ? 21  G   A "C2'" 1 
ATOM   447  O  "O2'" . G   A 1 21 ? -5.032  29.732  -4.817  1.00 28.45  ? 21  G   A "O2'" 1 
ATOM   448  C  "C1'" . G   A 1 21 ? -5.493  32.099  -5.115  1.00 24.29  ? 21  G   A "C1'" 1 
ATOM   449  N  N9    . G   A 1 21 ? -6.318  32.150  -6.323  1.00 16.30  ? 21  G   A N9    1 
ATOM   450  C  C8    . G   A 1 21 ? -5.918  32.218  -7.630  1.00 11.63  ? 21  G   A C8    1 
ATOM   451  N  N7    . G   A 1 21 ? -6.923  32.247  -8.464  1.00 15.38  ? 21  G   A N7    1 
ATOM   452  C  C5    . G   A 1 21 ? -8.047  32.196  -7.662  1.00 7.82   ? 21  G   A C5    1 
ATOM   453  C  C6    . G   A 1 21 ? -9.422  32.193  -8.004  1.00 7.73   ? 21  G   A C6    1 
ATOM   454  O  O6    . G   A 1 21 ? -9.936  32.236  -9.127  1.00 7.61   ? 21  G   A O6    1 
ATOM   455  N  N1    . G   A 1 21 ? -10.219 32.131  -6.867  1.00 7.79   ? 21  G   A N1    1 
ATOM   456  C  C2    . G   A 1 21 ? -9.749  32.078  -5.576  1.00 7.92   ? 21  G   A C2    1 
ATOM   457  N  N2    . G   A 1 21 ? -10.664 32.022  -4.605  1.00 12.28  ? 21  G   A N2    1 
ATOM   458  N  N3    . G   A 1 21 ? -8.473  32.077  -5.247  1.00 11.27  ? 21  G   A N3    1 
ATOM   459  C  C4    . G   A 1 21 ? -7.687  32.148  -6.336  1.00 11.27  ? 21  G   A C4    1 
ATOM   460  P  P     . C   A 1 22 ? -3.171  31.158  -1.433  1.00 37.11  ? 22  C   A P     1 
ATOM   461  O  OP1   . C   A 1 22 ? -1.771  31.502  -1.802  1.00 34.45  ? 22  C   A OP1   1 
ATOM   462  O  OP2   . C   A 1 22 ? -3.482  29.871  -0.765  1.00 37.91  ? 22  C   A OP2   1 
ATOM   463  O  "O5'" . C   A 1 22 ? -3.727  32.317  -0.490  1.00 28.59  ? 22  C   A "O5'" 1 
ATOM   464  C  "C5'" . C   A 1 22 ? -3.617  33.696  -0.821  1.00 32.78  ? 22  C   A "C5'" 1 
ATOM   465  C  "C4'" . C   A 1 22 ? -3.722  34.546  0.421   1.00 40.69  ? 22  C   A "C4'" 1 
ATOM   466  O  "O4'" . C   A 1 22 ? -3.765  33.663  1.566   1.00 48.58  ? 22  C   A "O4'" 1 
ATOM   467  C  "C3'" . C   A 1 22 ? -2.532  35.487  0.603   1.00 46.23  ? 22  C   A "C3'" 1 
ATOM   468  O  "O3'" . C   A 1 22 ? -3.019  36.802  0.846   1.00 38.73  ? 22  C   A "O3'" 1 
ATOM   469  C  "C2'" . C   A 1 22 ? -1.826  35.001  1.874   1.00 59.50  ? 22  C   A "C2'" 1 
ATOM   470  O  "O2'" . C   A 1 22 ? -1.392  36.027  2.745   1.00 67.58  ? 22  C   A "O2'" 1 
ATOM   471  C  "C1'" . C   A 1 22 ? -2.840  34.071  2.546   1.00 55.55  ? 22  C   A "C1'" 1 
ATOM   472  N  N1    . C   A 1 22 ? -2.248  32.864  3.149   1.00 53.08  ? 22  C   A N1    1 
ATOM   473  C  C2    . C   A 1 22 ? -1.744  32.931  4.449   1.00 53.93  ? 22  C   A C2    1 
ATOM   474  O  O2    . C   A 1 22 ? -1.764  34.024  5.031   1.00 62.55  ? 22  C   A O2    1 
ATOM   475  N  N3    . C   A 1 22 ? -1.202  31.824  5.014   1.00 50.10  ? 22  C   A N3    1 
ATOM   476  C  C4    . C   A 1 22 ? -1.188  30.669  4.345   1.00 51.72  ? 22  C   A C4    1 
ATOM   477  N  N4    . C   A 1 22 ? -0.656  29.595  4.937   1.00 51.51  ? 22  C   A N4    1 
ATOM   478  C  C5    . C   A 1 22 ? -1.723  30.565  3.029   1.00 53.90  ? 22  C   A C5    1 
ATOM   479  C  C6    . C   A 1 22 ? -2.244  31.671  2.480   1.00 53.86  ? 22  C   A C6    1 
ATOM   480  P  P     . U   A 1 23 ? -2.909  37.953  -0.263  1.00 59.77  ? 23  U   A P     1 
ATOM   481  O  OP1   . U   A 1 23 ? -2.256  37.405  -1.483  1.00 57.26  ? 23  U   A OP1   1 
ATOM   482  O  OP2   . U   A 1 23 ? -2.367  39.172  0.390   1.00 61.60  ? 23  U   A OP2   1 
ATOM   483  O  "O5'" . U   A 1 23 ? -4.442  38.180  -0.605  1.00 51.76  ? 23  U   A "O5'" 1 
ATOM   484  C  "C5'" . U   A 1 23 ? -5.321  38.658  0.403   1.00 46.94  ? 23  U   A "C5'" 1 
ATOM   485  C  "C4'" . U   A 1 23 ? -6.728  38.759  -0.110  1.00 38.25  ? 23  U   A "C4'" 1 
ATOM   486  O  "O4'" . U   A 1 23 ? -6.814  39.778  -1.133  1.00 37.72  ? 23  U   A "O4'" 1 
ATOM   487  C  "C3'" . U   A 1 23 ? -7.237  37.492  -0.781  1.00 34.96  ? 23  U   A "C3'" 1 
ATOM   488  O  "O3'" . U   A 1 23 ? -7.743  36.572  0.179   1.00 23.41  ? 23  U   A "O3'" 1 
ATOM   489  C  "C2'" . U   A 1 23 ? -8.293  38.021  -1.745  1.00 38.90  ? 23  U   A "C2'" 1 
ATOM   490  O  "O2'" . U   A 1 23 ? -9.515  38.278  -1.070  1.00 43.86  ? 23  U   A "O2'" 1 
ATOM   491  C  "C1'" . U   A 1 23 ? -7.686  39.364  -2.158  1.00 36.51  ? 23  U   A "C1'" 1 
ATOM   492  N  N1    . U   A 1 23 ? -6.948  39.371  -3.441  1.00 29.67  ? 23  U   A N1    1 
ATOM   493  C  C2    . U   A 1 23 ? -7.676  39.333  -4.614  1.00 28.96  ? 23  U   A C2    1 
ATOM   494  O  O2    . U   A 1 23 ? -8.892  39.226  -4.624  1.00 40.49  ? 23  U   A O2    1 
ATOM   495  N  N3    . U   A 1 23 ? -6.925  39.395  -5.765  1.00 17.75  ? 23  U   A N3    1 
ATOM   496  C  C4    . U   A 1 23 ? -5.550  39.518  -5.845  1.00 28.16  ? 23  U   A C4    1 
ATOM   497  O  O4    . U   A 1 23 ? -5.002  39.564  -6.951  1.00 34.38  ? 23  U   A O4    1 
ATOM   498  C  C5    . U   A 1 23 ? -4.875  39.580  -4.585  1.00 26.81  ? 23  U   A C5    1 
ATOM   499  C  C6    . U   A 1 23 ? -5.581  39.521  -3.453  1.00 27.23  ? 23  U   A C6    1 
ATOM   500  P  P     . G   A 1 24 ? -8.302  35.135  -0.267  1.00 18.29  ? 24  G   A P     1 
ATOM   501  O  OP1   . G   A 1 24 ? -8.120  34.211  0.883   1.00 13.83  ? 24  G   A OP1   1 
ATOM   502  O  OP2   . G   A 1 24 ? -7.679  34.779  -1.569  1.00 31.70  ? 24  G   A OP2   1 
ATOM   503  O  "O5'" . G   A 1 24 ? -9.865  35.381  -0.465  1.00 15.60  ? 24  G   A "O5'" 1 
ATOM   504  C  "C5'" . G   A 1 24 ? -10.679 35.919  0.568   1.00 11.68  ? 24  G   A "C5'" 1 
ATOM   505  C  "C4'" . G   A 1 24 ? -12.098 36.122  0.089   1.00 17.35  ? 24  G   A "C4'" 1 
ATOM   506  O  "O4'" . G   A 1 24 ? -12.087 36.973  -1.089  1.00 16.78  ? 24  G   A "O4'" 1 
ATOM   507  C  "C3'" . G   A 1 24 ? -12.849 34.872  -0.352  1.00 25.44  ? 24  G   A "C3'" 1 
ATOM   508  O  "O3'" . G   A 1 24 ? -13.485 34.177  0.700   1.00 27.91  ? 24  G   A "O3'" 1 
ATOM   509  C  "C2'" . G   A 1 24 ? -13.846 35.404  -1.373  1.00 25.58  ? 24  G   A "C2'" 1 
ATOM   510  O  "O2'" . G   A 1 24 ? -14.978 35.961  -0.723  1.00 36.46  ? 24  G   A "O2'" 1 
ATOM   511  C  "C1'" . G   A 1 24 ? -13.057 36.537  -2.016  1.00 17.57  ? 24  G   A "C1'" 1 
ATOM   512  N  N9    . G   A 1 24 ? -12.385 36.101  -3.249  1.00 10.63  ? 24  G   A N9    1 
ATOM   513  C  C8    . G   A 1 24 ? -11.071 35.755  -3.420  1.00 9.20   ? 24  G   A C8    1 
ATOM   514  N  N7    . G   A 1 24 ? -10.797 35.416  -4.654  1.00 15.25  ? 24  G   A N7    1 
ATOM   515  C  C5    . G   A 1 24 ? -12.005 35.548  -5.330  1.00 17.32  ? 24  G   A C5    1 
ATOM   516  C  C6    . G   A 1 24 ? -12.342 35.323  -6.693  1.00 15.96  ? 24  G   A C6    1 
ATOM   517  O  O6    . G   A 1 24 ? -11.611 34.952  -7.619  1.00 10.09  ? 24  G   A O6    1 
ATOM   518  N  N1    . G   A 1 24 ? -13.689 35.575  -6.940  1.00 15.43  ? 24  G   A N1    1 
ATOM   519  C  C2    . G   A 1 24 ? -14.594 36.001  -6.002  1.00 17.16  ? 24  G   A C2    1 
ATOM   520  N  N2    . G   A 1 24 ? -15.847 36.195  -6.430  1.00 7.81   ? 24  G   A N2    1 
ATOM   521  N  N3    . G   A 1 24 ? -14.292 36.216  -4.732  1.00 20.47  ? 24  G   A N3    1 
ATOM   522  C  C4    . G   A 1 24 ? -12.992 35.970  -4.471  1.00 15.21  ? 24  G   A C4    1 
ATOM   523  P  P     . G   A 1 25 ? -13.182 32.616  0.899   1.00 43.03  ? 25  G   A P     1 
ATOM   524  O  OP1   . G   A 1 25 ? -13.500 32.309  2.316   1.00 46.05  ? 25  G   A OP1   1 
ATOM   525  O  OP2   . G   A 1 25 ? -11.838 32.296  0.356   1.00 44.15  ? 25  G   A OP2   1 
ATOM   526  O  "O5'" . G   A 1 25 ? -14.305 31.896  0.028   1.00 26.28  ? 25  G   A "O5'" 1 
ATOM   527  C  "C5'" . G   A 1 25 ? -15.663 31.952  0.424   1.00 12.85  ? 25  G   A "C5'" 1 
ATOM   528  C  "C4'" . G   A 1 25 ? -16.630 31.934  -0.737  1.00 8.24   ? 25  G   A "C4'" 1 
ATOM   529  O  "O4'" . G   A 1 25 ? -16.295 32.939  -1.734  1.00 16.25  ? 25  G   A "O4'" 1 
ATOM   530  C  "C3'" . G   A 1 25 ? -16.737 30.643  -1.535  1.00 14.07  ? 25  G   A "C3'" 1 
ATOM   531  O  "O3'" . G   A 1 25 ? -17.527 29.668  -0.892  1.00 21.12  ? 25  G   A "O3'" 1 
ATOM   532  C  "C2'" . G   A 1 25 ? -17.331 31.113  -2.858  1.00 20.28  ? 25  G   A "C2'" 1 
ATOM   533  O  "O2'" . G   A 1 25 ? -18.734 31.301  -2.738  1.00 27.69  ? 25  G   A "O2'" 1 
ATOM   534  C  "C1'" . G   A 1 25 ? -16.658 32.475  -3.028  1.00 19.34  ? 25  G   A "C1'" 1 
ATOM   535  N  N9    . G   A 1 25 ? -15.471 32.403  -3.908  1.00 21.10  ? 25  G   A N9    1 
ATOM   536  C  C8    . G   A 1 25 ? -14.162 32.231  -3.531  1.00 19.12  ? 25  G   A C8    1 
ATOM   537  N  N7    . G   A 1 25 ? -13.334 32.192  -4.542  1.00 15.96  ? 25  G   A N7    1 
ATOM   538  C  C5    . G   A 1 25 ? -14.135 32.340  -5.658  1.00 18.82  ? 25  G   A C5    1 
ATOM   539  C  C6    . G   A 1 25 ? -13.784 32.373  -7.034  1.00 21.22  ? 25  G   A C6    1 
ATOM   540  O  O6    . G   A 1 25 ? -12.669 32.277  -7.560  1.00 22.45  ? 25  G   A O6    1 
ATOM   541  N  N1    . G   A 1 25 ? -14.897 32.536  -7.842  1.00 19.62  ? 25  G   A N1    1 
ATOM   542  C  C2    . G   A 1 25 ? -16.182 32.650  -7.392  1.00 17.87  ? 25  G   A C2    1 
ATOM   543  N  N2    . G   A 1 25 ? -17.094 32.798  -8.363  1.00 7.46   ? 25  G   A N2    1 
ATOM   544  N  N3    . G   A 1 25 ? -16.529 32.624  -6.108  1.00 19.57  ? 25  G   A N3    1 
ATOM   545  C  C4    . G   A 1 25 ? -15.462 32.459  -5.291  1.00 21.62  ? 25  G   A C4    1 
ATOM   546  P  P     . G   A 1 26 ? -16.968 28.177  -0.712  1.00 36.15  ? 26  G   A P     1 
ATOM   547  O  OP1   . G   A 1 26 ? -17.085 27.503  -2.033  1.00 28.41  ? 26  G   A OP1   1 
ATOM   548  O  OP2   . G   A 1 26 ? -17.656 27.579  0.459   1.00 43.17  ? 26  G   A OP2   1 
ATOM   549  O  "O5'" . G   A 1 26 ? -15.427 28.365  -0.346  1.00 19.17  ? 26  G   A "O5'" 1 
ATOM   550  C  "C5'" . G   A 1 26 ? -14.747 27.357  0.392   1.00 20.54  ? 26  G   A "C5'" 1 
ATOM   551  C  "C4'" . G   A 1 26 ? -13.259 27.342  0.126   1.00 24.16  ? 26  G   A "C4'" 1 
ATOM   552  O  "O4'" . G   A 1 26 ? -13.020 27.065  -1.279  1.00 27.42  ? 26  G   A "O4'" 1 
ATOM   553  C  "C3'" . G   A 1 26 ? -12.489 28.618  0.451   1.00 25.51  ? 26  G   A "C3'" 1 
ATOM   554  O  "O3'" . G   A 1 26 ? -11.237 28.234  1.025   1.00 39.25  ? 26  G   A "O3'" 1 
ATOM   555  C  "C2'" . G   A 1 26 ? -12.307 29.276  -0.917  1.00 24.12  ? 26  G   A "C2'" 1 
ATOM   556  O  "O2'" . G   A 1 26 ? -11.192 30.134  -1.018  1.00 32.23  ? 26  G   A "O2'" 1 
ATOM   557  C  "C1'" . G   A 1 26 ? -12.193 28.067  -1.842  1.00 26.81  ? 26  G   A "C1'" 1 
ATOM   558  N  N9    . G   A 1 26 ? -12.668 28.297  -3.210  1.00 17.49  ? 26  G   A N9    1 
ATOM   559  C  C8    . G   A 1 26 ? -13.982 28.356  -3.596  1.00 9.54   ? 26  G   A C8    1 
ATOM   560  N  N7    . G   A 1 26 ? -14.139 28.556  -4.874  1.00 11.56  ? 26  G   A N7    1 
ATOM   561  C  C5    . G   A 1 26 ? -12.848 28.626  -5.373  1.00 14.39  ? 26  G   A C5    1 
ATOM   562  C  C6    . G   A 1 26 ? -12.389 28.831  -6.702  1.00 18.85  ? 26  G   A C6    1 
ATOM   563  O  O6    . G   A 1 26 ? -13.035 28.996  -7.747  1.00 17.63  ? 26  G   A O6    1 
ATOM   564  N  N1    . G   A 1 26 ? -11.006 28.832  -6.759  1.00 18.67  ? 26  G   A N1    1 
ATOM   565  C  C2    . G   A 1 26 ? -10.169 28.665  -5.691  1.00 10.81  ? 26  G   A C2    1 
ATOM   566  N  N2    . G   A 1 26 ? -8.863  28.706  -5.983  1.00 12.52  ? 26  G   A N2    1 
ATOM   567  N  N3    . G   A 1 26 ? -10.577 28.475  -4.448  1.00 11.69  ? 26  G   A N3    1 
ATOM   568  C  C4    . G   A 1 26 ? -11.925 28.470  -4.359  1.00 14.58  ? 26  G   A C4    1 
ATOM   569  P  P     . U   A 1 27 ? -11.092 28.235  2.629   1.00 46.07  ? 27  U   A P     1 
ATOM   570  O  OP1   . U   A 1 27 ? -12.353 27.720  3.220   1.00 47.64  ? 27  U   A OP1   1 
ATOM   571  O  OP2   . U   A 1 27 ? -10.588 29.584  2.985   1.00 43.21  ? 27  U   A OP2   1 
ATOM   572  O  "O5'" . U   A 1 27 ? -9.932  27.189  2.959   1.00 76.45  ? 27  U   A "O5'" 1 
ATOM   573  C  "C5'" . U   A 1 27 ? -9.863  25.959  2.248   1.00 85.34  ? 27  U   A "C5'" 1 
ATOM   574  C  "C4'" . U   A 1 27 ? -8.535  25.799  1.572   1.00 99.84  ? 27  U   A "C4'" 1 
ATOM   575  O  "O4'" . U   A 1 27 ? -7.550  26.169  2.593   1.00 104.95 ? 27  U   A "O4'" 1 
ATOM   576  C  "C3'" . U   A 1 27 ? -8.190  24.362  1.183   1.00 107.92 ? 27  U   A "C3'" 1 
ATOM   577  O  "O3'" . U   A 1 27 ? -7.409  24.221  -0.021  1.00 106.64 ? 27  U   A "O3'" 1 
ATOM   578  C  "C2'" . U   A 1 27 ? -7.470  23.827  2.414   1.00 111.56 ? 27  U   A "C2'" 1 
ATOM   579  O  "O2'" . U   A 1 27 ? -6.585  22.756  2.166   1.00 111.36 ? 27  U   A "O2'" 1 
ATOM   580  C  "C1'" . U   A 1 27 ? -6.722  25.052  2.910   1.00 111.78 ? 27  U   A "C1'" 1 
ATOM   581  N  N1    . U   A 1 27 ? -6.591  24.944  4.376   1.00 120.03 ? 27  U   A N1    1 
ATOM   582  C  C2    . U   A 1 27 ? -5.358  24.771  4.982   1.00 124.34 ? 27  U   A C2    1 
ATOM   583  O  O2    . U   A 1 27 ? -4.304  24.777  4.372   1.00 124.66 ? 27  U   A O2    1 
ATOM   584  N  N3    . U   A 1 27 ? -5.408  24.616  6.347   1.00 126.34 ? 27  U   A N3    1 
ATOM   585  C  C4    . U   A 1 27 ? -6.527  24.587  7.160   1.00 126.14 ? 27  U   A C4    1 
ATOM   586  O  O4    . U   A 1 27 ? -6.405  24.442  8.378   1.00 128.47 ? 27  U   A O4    1 
ATOM   587  C  C5    . U   A 1 27 ? -7.762  24.737  6.455   1.00 122.47 ? 27  U   A C5    1 
ATOM   588  C  C6    . U   A 1 27 ? -7.746  24.887  5.126   1.00 121.70 ? 27  U   A C6    1 
ATOM   589  P  P     . U   A 1 28 ? -6.650  25.422  -0.797  1.00 55.69  ? 28  U   A P     1 
ATOM   590  O  OP1   . U   A 1 28 ? -5.409  24.811  -1.347  1.00 61.08  ? 28  U   A OP1   1 
ATOM   591  O  OP2   . U   A 1 28 ? -6.509  26.724  -0.111  1.00 59.20  ? 28  U   A OP2   1 
ATOM   592  O  "O5'" . U   A 1 28 ? -7.575  25.690  -2.073  1.00 34.22  ? 28  U   A "O5'" 1 
ATOM   593  C  "C5'" . U   A 1 28 ? -9.006  25.746  -2.004  1.00 27.80  ? 28  U   A "C5'" 1 
ATOM   594  C  "C4'" . U   A 1 28 ? -9.686  25.217  -3.261  1.00 19.31  ? 28  U   A "C4'" 1 
ATOM   595  O  "O4'" . U   A 1 28 ? -9.083  25.847  -4.430  1.00 13.77  ? 28  U   A "O4'" 1 
ATOM   596  C  "C3'" . U   A 1 28 ? -9.644  23.704  -3.525  1.00 19.06  ? 28  U   A "C3'" 1 
ATOM   597  O  "O3'" . U   A 1 28 ? -10.844 23.321  -4.189  1.00 20.01  ? 28  U   A "O3'" 1 
ATOM   598  C  "C2'" . U   A 1 28 ? -8.516  23.577  -4.533  1.00 13.11  ? 28  U   A "C2'" 1 
ATOM   599  O  "O2'" . U   A 1 28 ? -8.583  22.432  -5.352  1.00 7.61   ? 28  U   A "O2'" 1 
ATOM   600  C  "C1'" . U   A 1 28 ? -8.699  24.848  -5.352  1.00 7.68   ? 28  U   A "C1'" 1 
ATOM   601  N  N1    . U   A 1 28 ? -7.467  25.226  -6.046  1.00 13.31  ? 28  U   A N1    1 
ATOM   602  C  C2    . U   A 1 28 ? -7.487  25.365  -7.419  1.00 18.74  ? 28  U   A C2    1 
ATOM   603  O  O2    . U   A 1 28 ? -8.494  25.225  -8.099  1.00 11.48  ? 28  U   A O2    1 
ATOM   604  N  N3    . U   A 1 28 ? -6.268  25.663  -7.976  1.00 20.42  ? 28  U   A N3    1 
ATOM   605  C  C4    . U   A 1 28 ? -5.077  25.828  -7.306  1.00 19.56  ? 28  U   A C4    1 
ATOM   606  O  O4    . U   A 1 28 ? -4.068  26.095  -7.937  1.00 32.33  ? 28  U   A O4    1 
ATOM   607  C  C5    . U   A 1 28 ? -5.145  25.663  -5.891  1.00 19.95  ? 28  U   A C5    1 
ATOM   608  C  C6    . U   A 1 28 ? -6.316  25.366  -5.321  1.00 15.31  ? 28  U   A C6    1 
ATOM   609  P  P     . G   A 1 29 ? -11.329 21.791  -4.173  1.00 12.16  ? 29  G   A P     1 
ATOM   610  O  OP1   . G   A 1 29 ? -10.469 21.000  -3.251  1.00 15.95  ? 29  G   A OP1   1 
ATOM   611  O  OP2   . G   A 1 29 ? -11.472 21.399  -5.598  1.00 10.01  ? 29  G   A OP2   1 
ATOM   612  O  "O5'" . G   A 1 29 ? -12.783 21.872  -3.527  1.00 24.30  ? 29  G   A "O5'" 1 
ATOM   613  C  "C5'" . G   A 1 29 ? -12.972 22.301  -2.189  1.00 13.39  ? 29  G   A "C5'" 1 
ATOM   614  C  "C4'" . G   A 1 29 ? -14.269 23.055  -2.046  1.00 18.64  ? 29  G   A "C4'" 1 
ATOM   615  O  "O4'" . G   A 1 29 ? -14.101 24.404  -2.560  1.00 20.74  ? 29  G   A "O4'" 1 
ATOM   616  C  "C3'" . G   A 1 29 ? -15.438 22.489  -2.842  1.00 24.36  ? 29  G   A "C3'" 1 
ATOM   617  O  "O3'" . G   A 1 29 ? -16.100 21.435  -2.164  1.00 18.56  ? 29  G   A "O3'" 1 
ATOM   618  C  "C2'" . G   A 1 29 ? -16.312 23.709  -3.099  1.00 27.34  ? 29  G   A "C2'" 1 
ATOM   619  O  "O2'" . G   A 1 29 ? -17.121 23.998  -1.972  1.00 34.02  ? 29  G   A "O2'" 1 
ATOM   620  C  "C1'" . G   A 1 29 ? -15.269 24.817  -3.236  1.00 26.13  ? 29  G   A "C1'" 1 
ATOM   621  N  N9    . G   A 1 29 ? -14.928 25.086  -4.648  1.00 24.71  ? 29  G   A N9    1 
ATOM   622  C  C8    . G   A 1 29 ? -13.669 25.089  -5.198  1.00 14.33  ? 29  G   A C8    1 
ATOM   623  N  N7    . G   A 1 29 ? -13.662 25.375  -6.472  1.00 19.62  ? 29  G   A N7    1 
ATOM   624  C  C5    . G   A 1 29 ? -14.996 25.587  -6.793  1.00 21.14  ? 29  G   A C5    1 
ATOM   625  C  C6    . G   A 1 29 ? -15.610 25.930  -8.029  1.00 15.44  ? 29  G   A C6    1 
ATOM   626  O  O6    . G   A 1 29 ? -15.108 26.125  -9.137  1.00 15.20  ? 29  G   A O6    1 
ATOM   627  N  N1    . G   A 1 29 ? -16.984 26.051  -7.902  1.00 25.29  ? 29  G   A N1    1 
ATOM   628  C  C2    . G   A 1 29 ? -17.687 25.865  -6.745  1.00 23.87  ? 29  G   A C2    1 
ATOM   629  N  N2    . G   A 1 29 ? -19.008 26.030  -6.858  1.00 29.87  ? 29  G   A N2    1 
ATOM   630  N  N3    . G   A 1 29 ? -17.138 25.547  -5.584  1.00 26.95  ? 29  G   A N3    1 
ATOM   631  C  C4    . G   A 1 29 ? -15.792 25.429  -5.672  1.00 30.97  ? 29  G   A C4    1 
ATOM   632  P  P     . C   A 1 30 ? -16.462 20.061  -2.922  1.00 35.03  ? 30  C   A P     1 
ATOM   633  O  OP1   . C   A 1 30 ? -17.214 19.197  -1.976  1.00 28.53  ? 30  C   A OP1   1 
ATOM   634  O  OP2   . C   A 1 30 ? -15.232 19.527  -3.552  1.00 40.83  ? 30  C   A OP2   1 
ATOM   635  O  "O5'" . C   A 1 30 ? -17.439 20.493  -4.106  1.00 13.88  ? 30  C   A "O5'" 1 
ATOM   636  C  "C5'" . C   A 1 30 ? -18.678 21.133  -3.829  1.00 19.94  ? 30  C   A "C5'" 1 
ATOM   637  C  "C4'" . C   A 1 30 ? -19.437 21.452  -5.094  1.00 24.99  ? 30  C   A "C4'" 1 
ATOM   638  O  "O4'" . C   A 1 30 ? -18.837 22.583  -5.779  1.00 30.95  ? 30  C   A "O4'" 1 
ATOM   639  C  "C3'" . C   A 1 30 ? -19.452 20.355  -6.142  1.00 26.16  ? 30  C   A "C3'" 1 
ATOM   640  O  "O3'" . C   A 1 30 ? -20.388 19.330  -5.846  1.00 19.29  ? 30  C   A "O3'" 1 
ATOM   641  C  "C2'" . C   A 1 30 ? -19.758 21.128  -7.421  1.00 35.08  ? 30  C   A "C2'" 1 
ATOM   642  O  "O2'" . C   A 1 30 ? -21.144 21.422  -7.519  1.00 42.17  ? 30  C   A "O2'" 1 
ATOM   643  C  "C1'" . C   A 1 30 ? -18.995 22.436  -7.176  1.00 30.90  ? 30  C   A "C1'" 1 
ATOM   644  N  N1    . C   A 1 30 ? -17.656 22.440  -7.810  1.00 30.45  ? 30  C   A N1    1 
ATOM   645  C  C2    . C   A 1 30 ? -17.553 22.546  -9.203  1.00 27.28  ? 30  C   A C2    1 
ATOM   646  O  O2    . C   A 1 30 ? -18.570 22.642  -9.900  1.00 32.22  ? 30  C   A O2    1 
ATOM   647  N  N3    . C   A 1 30 ? -16.336 22.550  -9.781  1.00 24.00  ? 30  C   A N3    1 
ATOM   648  C  C4    . C   A 1 30 ? -15.243 22.450  -9.035  1.00 19.00  ? 30  C   A C4    1 
ATOM   649  N  N4    . C   A 1 30 ? -14.079 22.460  -9.685  1.00 14.66  ? 30  C   A N4    1 
ATOM   650  C  C5    . C   A 1 30 ? -15.304 22.337  -7.615  1.00 20.31  ? 30  C   A C5    1 
ATOM   651  C  C6    . C   A 1 30 ? -16.520 22.335  -7.051  1.00 28.24  ? 30  C   A C6    1 
ATOM   652  P  P     . G   A 1 31 ? -20.129 17.821  -6.338  1.00 42.08  ? 31  G   A P     1 
ATOM   653  O  OP1   . G   A 1 31 ? -21.139 16.924  -5.725  1.00 42.91  ? 31  G   A OP1   1 
ATOM   654  O  OP2   . G   A 1 31 ? -18.692 17.509  -6.143  1.00 45.08  ? 31  G   A OP2   1 
ATOM   655  O  "O5'" . G   A 1 31 ? -20.417 17.879  -7.901  1.00 29.50  ? 31  G   A "O5'" 1 
ATOM   656  C  "C5'" . G   A 1 31 ? -21.685 18.271  -8.397  1.00 27.61  ? 31  G   A "C5'" 1 
ATOM   657  C  "C4'" . G   A 1 31 ? -21.663 18.382  -9.900  1.00 34.12  ? 31  G   A "C4'" 1 
ATOM   658  O  "O4'" . G   A 1 31 ? -20.772 19.457  -10.301 1.00 35.41  ? 31  G   A "O4'" 1 
ATOM   659  C  "C3'" . G   A 1 31 ? -21.138 17.166  -10.649 1.00 33.56  ? 31  G   A "C3'" 1 
ATOM   660  O  "O3'" . G   A 1 31 ? -22.110 16.148  -10.803 1.00 39.69  ? 31  G   A "O3'" 1 
ATOM   661  C  "C2'" . G   A 1 31 ? -20.655 17.765  -11.963 1.00 37.50  ? 31  G   A "C2'" 1 
ATOM   662  O  "O2'" . G   A 1 31 ? -21.749 18.012  -12.833 1.00 42.94  ? 31  G   A "O2'" 1 
ATOM   663  C  "C1'" . G   A 1 31 ? -20.100 19.108  -11.494 1.00 36.70  ? 31  G   A "C1'" 1 
ATOM   664  N  N9    . G   A 1 31 ? -18.657 19.025  -11.205 1.00 37.58  ? 31  G   A N9    1 
ATOM   665  C  C8    . G   A 1 31 ? -18.076 18.959  -9.961  1.00 38.05  ? 31  G   A C8    1 
ATOM   666  N  N7    . G   A 1 31 ? -16.774 18.891  -10.007 1.00 35.62  ? 31  G   A N7    1 
ATOM   667  C  C5    . G   A 1 31 ? -16.480 18.909  -11.361 1.00 29.64  ? 31  G   A C5    1 
ATOM   668  C  C6    . G   A 1 31 ? -15.229 18.860  -12.016 1.00 23.48  ? 31  G   A C6    1 
ATOM   669  O  O6    . G   A 1 31 ? -14.110 18.786  -11.503 1.00 23.84  ? 31  G   A O6    1 
ATOM   670  N  N1    . G   A 1 31 ? -15.369 18.906  -13.399 1.00 28.04  ? 31  G   A N1    1 
ATOM   671  C  C2    . G   A 1 31 ? -16.566 18.988  -14.069 1.00 34.46  ? 31  G   A C2    1 
ATOM   672  N  N2    . G   A 1 31 ? -16.498 19.020  -15.410 1.00 32.97  ? 31  G   A N2    1 
ATOM   673  N  N3    . G   A 1 31 ? -17.745 19.035  -13.465 1.00 38.64  ? 31  G   A N3    1 
ATOM   674  C  C4    . G   A 1 31 ? -17.627 18.995  -12.119 1.00 36.50  ? 31  G   A C4    1 
ATOM   675  P  P     . C   A 1 32 ? -21.682 14.598  -10.782 1.00 58.18  ? 32  C   A P     1 
ATOM   676  O  OP1   . C   A 1 32 ? -22.920 13.779  -10.753 1.00 65.14  ? 32  C   A OP1   1 
ATOM   677  O  OP2   . C   A 1 32 ? -20.663 14.395  -9.722  1.00 50.55  ? 32  C   A OP2   1 
ATOM   678  O  "O5'" . C   A 1 32 ? -20.987 14.386  -12.201 1.00 57.69  ? 32  C   A "O5'" 1 
ATOM   679  C  "C5'" . C   A 1 32 ? -21.707 14.648  -13.399 1.00 50.95  ? 32  C   A "C5'" 1 
ATOM   680  C  "C4'" . C   A 1 32 ? -20.806 14.695  -14.608 1.00 43.83  ? 32  C   A "C4'" 1 
ATOM   681  O  "O4'" . C   A 1 32 ? -19.861 15.795  -14.502 1.00 44.11  ? 32  C   A "O4'" 1 
ATOM   682  C  "C3'" . C   A 1 32 ? -19.921 13.480  -14.819 1.00 47.69  ? 32  C   A "C3'" 1 
ATOM   683  O  "O3'" . C   A 1 32 ? -20.599 12.372  -15.377 1.00 48.77  ? 32  C   A "O3'" 1 
ATOM   684  C  "C2'" . C   A 1 32 ? -18.813 14.034  -15.705 1.00 50.03  ? 32  C   A "C2'" 1 
ATOM   685  O  "O2'" . C   A 1 32 ? -19.254 14.157  -17.049 1.00 51.65  ? 32  C   A "O2'" 1 
ATOM   686  C  "C1'" . C   A 1 32 ? -18.638 15.434  -15.118 1.00 46.87  ? 32  C   A "C1'" 1 
ATOM   687  N  N1    . C   A 1 32 ? -17.556 15.454  -14.105 1.00 42.85  ? 32  C   A N1    1 
ATOM   688  C  C2    . C   A 1 32 ? -16.236 15.569  -14.552 1.00 43.93  ? 32  C   A C2    1 
ATOM   689  O  O2    . C   A 1 32 ? -16.018 15.663  -15.768 1.00 44.20  ? 32  C   A O2    1 
ATOM   690  N  N3    . C   A 1 32 ? -15.226 15.577  -13.651 1.00 44.12  ? 32  C   A N3    1 
ATOM   691  C  C4    . C   A 1 32 ? -15.496 15.475  -12.349 1.00 39.95  ? 32  C   A C4    1 
ATOM   692  N  N4    . C   A 1 32 ? -14.470 15.491  -11.500 1.00 43.26  ? 32  C   A N4    1 
ATOM   693  C  C5    . C   A 1 32 ? -16.829 15.352  -11.863 1.00 36.77  ? 32  C   A C5    1 
ATOM   694  C  C6    . C   A 1 32 ? -17.818 15.342  -12.766 1.00 39.46  ? 32  C   A C6    1 
ATOM   695  P  P     . A   A 1 33 ? -20.209 10.880  -14.922 1.00 66.49  ? 33  A   A P     1 
ATOM   696  O  OP1   . A   A 1 33 ? -21.151 9.927   -15.562 1.00 75.70  ? 33  A   A OP1   1 
ATOM   697  O  OP2   . A   A 1 33 ? -20.048 10.865  -13.445 1.00 55.36  ? 33  A   A OP2   1 
ATOM   698  O  "O5'" . A   A 1 33 ? -18.775 10.660  -15.576 1.00 38.25  ? 33  A   A "O5'" 1 
ATOM   699  C  "C5'" . A   A 1 33 ? -18.614 10.700  -16.982 1.00 32.25  ? 33  A   A "C5'" 1 
ATOM   700  C  "C4'" . A   A 1 33 ? -17.160 10.740  -17.381 1.00 40.17  ? 33  A   A "C4'" 1 
ATOM   701  O  "O4'" . A   A 1 33 ? -16.512 11.915  -16.822 1.00 42.91  ? 33  A   A "O4'" 1 
ATOM   702  C  "C3'" . A   A 1 33 ? -16.300 9.595   -16.880 1.00 43.33  ? 33  A   A "C3'" 1 
ATOM   703  O  "O3'" . A   A 1 33 ? -16.500 8.395   -17.607 1.00 46.83  ? 33  A   A "O3'" 1 
ATOM   704  C  "C2'" . A   A 1 33 ? -14.896 10.179  -16.979 1.00 42.00  ? 33  A   A "C2'" 1 
ATOM   705  O  "O2'" . A   A 1 33 ? -14.441 10.183  -18.324 1.00 37.61  ? 33  A   A "O2'" 1 
ATOM   706  C  "C1'" . A   A 1 33 ? -15.150 11.626  -16.554 1.00 39.91  ? 33  A   A "C1'" 1 
ATOM   707  N  N9    . A   A 1 33 ? -14.872 11.819  -15.115 1.00 31.46  ? 33  A   A N9    1 
ATOM   708  C  C8    . A   A 1 33 ? -15.747 11.976  -14.069 1.00 29.03  ? 33  A   A C8    1 
ATOM   709  N  N7    . A   A 1 33 ? -15.158 12.113  -12.899 1.00 35.50  ? 33  A   A N7    1 
ATOM   710  C  C5    . A   A 1 33 ? -13.802 12.037  -13.191 1.00 31.94  ? 33  A   A C5    1 
ATOM   711  C  C6    . A   A 1 33 ? -12.641 12.110  -12.392 1.00 22.05  ? 33  A   A C6    1 
ATOM   712  N  N6    . A   A 1 33 ? -12.648 12.281  -11.069 1.00 13.04  ? 33  A   A N6    1 
ATOM   713  N  N1    . A   A 1 33 ? -11.442 11.996  -13.010 1.00 26.04  ? 33  A   A N1    1 
ATOM   714  C  C2    . A   A 1 33 ? -11.417 11.820  -14.336 1.00 19.23  ? 33  A   A C2    1 
ATOM   715  N  N3    . A   A 1 33 ? -12.436 11.738  -15.189 1.00 26.75  ? 33  A   A N3    1 
ATOM   716  C  C4    . A   A 1 33 ? -13.615 11.852  -14.551 1.00 31.20  ? 33  A   A C4    1 
ATOM   717  P  P     . G   A 1 34 ? -16.162 6.984   -16.918 1.00 72.39  ? 34  G   A P     1 
ATOM   718  O  OP1   . G   A 1 34 ? -16.698 5.912   -17.795 1.00 80.32  ? 34  G   A OP1   1 
ATOM   719  O  OP2   . G   A 1 34 ? -16.611 7.043   -15.503 1.00 60.94  ? 34  G   A OP2   1 
ATOM   720  O  "O5'" . G   A 1 34 ? -14.569 6.927   -16.967 1.00 41.73  ? 34  G   A "O5'" 1 
ATOM   721  C  "C5'" . G   A 1 34 ? -13.893 6.977   -18.216 1.00 28.38  ? 34  G   A "C5'" 1 
ATOM   722  C  "C4'" . G   A 1 34 ? -12.398 7.051   -18.047 1.00 30.34  ? 34  G   A "C4'" 1 
ATOM   723  O  "O4'" . G   A 1 34 ? -12.043 8.257   -17.324 1.00 33.65  ? 34  G   A "O4'" 1 
ATOM   724  C  "C3'" . G   A 1 34 ? -11.746 5.939   -17.243 1.00 39.66  ? 34  G   A "C3'" 1 
ATOM   725  O  "O3'" . G   A 1 34 ? -11.576 4.736   -17.972 1.00 40.14  ? 34  G   A "O3'" 1 
ATOM   726  C  "C2'" . G   A 1 34 ? -10.438 6.582   -16.799 1.00 40.89  ? 34  G   A "C2'" 1 
ATOM   727  O  "O2'" . G   A 1 34 ? -9.493  6.590   -17.861 1.00 36.35  ? 34  G   A "O2'" 1 
ATOM   728  C  "C1'" . G   A 1 34 ? -10.885 8.024   -16.547 1.00 37.03  ? 34  G   A "C1'" 1 
ATOM   729  N  N9    . G   A 1 34 ? -11.214 8.266   -15.129 1.00 29.96  ? 34  G   A N9    1 
ATOM   730  C  C8    . G   A 1 34 ? -12.466 8.446   -14.591 1.00 22.07  ? 34  G   A C8    1 
ATOM   731  N  N7    . G   A 1 34 ? -12.445 8.647   -13.300 1.00 21.35  ? 34  G   A N7    1 
ATOM   732  C  C5    . G   A 1 34 ? -11.098 8.599   -12.967 1.00 23.63  ? 34  G   A C5    1 
ATOM   733  C  C6    . G   A 1 34 ? -10.456 8.751   -11.709 1.00 21.60  ? 34  G   A C6    1 
ATOM   734  O  O6    . G   A 1 34 ? -10.964 8.966   -10.604 1.00 29.53  ? 34  G   A O6    1 
ATOM   735  N  N1    . G   A 1 34 ? -9.077  8.630   -11.812 1.00 16.38  ? 34  G   A N1    1 
ATOM   736  C  C2    . G   A 1 34 ? -8.395  8.394   -12.979 1.00 20.32  ? 34  G   A C2    1 
ATOM   737  N  N2    . G   A 1 34 ? -7.063  8.314   -12.861 1.00 11.29  ? 34  G   A N2    1 
ATOM   738  N  N3    . G   A 1 34 ? -8.977  8.253   -14.165 1.00 24.66  ? 34  G   A N3    1 
ATOM   739  C  C4    . G   A 1 34 ? -10.322 8.368   -14.085 1.00 26.99  ? 34  G   A C4    1 
ATOM   740  P  P     . C   A 1 35 ? -11.535 3.323   -17.203 1.00 49.95  ? 35  C   A P     1 
ATOM   741  O  OP1   . C   A 1 35 ? -11.392 2.270   -18.241 1.00 50.81  ? 35  C   A OP1   1 
ATOM   742  O  OP2   . C   A 1 35 ? -12.681 3.266   -16.257 1.00 48.29  ? 35  C   A OP2   1 
ATOM   743  O  "O5'" . C   A 1 35 ? -10.184 3.373   -16.352 1.00 39.85  ? 35  C   A "O5'" 1 
ATOM   744  C  "C5'" . C   A 1 35 ? -8.930  3.136   -16.975 1.00 43.02  ? 35  C   A "C5'" 1 
ATOM   745  C  "C4'" . C   A 1 35 ? -7.767  3.264   -16.017 1.00 52.42  ? 35  C   A "C4'" 1 
ATOM   746  O  "O4'" . C   A 1 35 ? -7.804  4.535   -15.321 1.00 53.69  ? 35  C   A "O4'" 1 
ATOM   747  C  "C3'" . C   A 1 35 ? -7.678  2.244   -14.892 1.00 54.10  ? 35  C   A "C3'" 1 
ATOM   748  O  "O3'" . C   A 1 35 ? -7.201  0.978   -15.314 1.00 60.97  ? 35  C   A "O3'" 1 
ATOM   749  C  "C2'" . C   A 1 35 ? -6.754  2.937   -13.899 1.00 43.12  ? 35  C   A "C2'" 1 
ATOM   750  O  "O2'" . C   A 1 35 ? -5.403  2.812   -14.312 1.00 38.29  ? 35  C   A "O2'" 1 
ATOM   751  C  "C1'" . C   A 1 35 ? -7.172  4.403   -14.060 1.00 41.52  ? 35  C   A "C1'" 1 
ATOM   752  N  N1    . C   A 1 35 ? -8.109  4.824   -12.992 1.00 29.44  ? 35  C   A N1    1 
ATOM   753  C  C2    . C   A 1 35 ? -7.577  5.177   -11.748 1.00 29.04  ? 35  C   A C2    1 
ATOM   754  O  O2    . C   A 1 35 ? -6.352  5.134   -11.584 1.00 35.46  ? 35  C   A O2    1 
ATOM   755  N  N3    . C   A 1 35 ? -8.402  5.555   -10.747 1.00 36.09  ? 35  C   A N3    1 
ATOM   756  C  C4    . C   A 1 35 ? -9.720  5.593   -10.947 1.00 39.13  ? 35  C   A C4    1 
ATOM   757  N  N4    . C   A 1 35 ? -10.495 5.975   -9.927  1.00 30.98  ? 35  C   A N4    1 
ATOM   758  C  C5    . C   A 1 35 ? -10.295 5.238   -12.206 1.00 38.09  ? 35  C   A C5    1 
ATOM   759  C  C6    . C   A 1 35 ? -9.462  4.863   -13.189 1.00 33.02  ? 35  C   A C6    1 
ATOM   760  N  N     . GLY B 2 3  ? -11.781 4.504   -2.407  1.00 53.88  ? 5   GLY B N     1 
ATOM   761  C  CA    . GLY B 2 3  ? -11.196 5.619   -3.131  1.00 64.40  ? 5   GLY B CA    1 
ATOM   762  C  C     . GLY B 2 3  ? -11.252 6.926   -2.361  1.00 71.77  ? 5   GLY B C     1 
ATOM   763  O  O     . GLY B 2 3  ? -11.881 7.891   -2.805  1.00 67.78  ? 5   GLY B O     1 
ATOM   764  N  N     . ASP B 2 4  ? -10.597 6.959   -1.202  1.00 73.68  ? 6   ASP B N     1 
ATOM   765  C  CA    . ASP B 2 4  ? -10.680 8.124   -0.328  1.00 69.43  ? 6   ASP B CA    1 
ATOM   766  C  C     . ASP B 2 4  ? -9.532  9.116   -0.527  1.00 60.70  ? 6   ASP B C     1 
ATOM   767  O  O     . ASP B 2 4  ? -8.928  9.578   0.443   1.00 58.87  ? 6   ASP B O     1 
ATOM   768  C  CB    . ASP B 2 4  ? -10.717 7.671   1.133   1.00 70.09  ? 6   ASP B CB    1 
ATOM   769  N  N     . GLY B 2 5  ? -9.234  9.442   -1.780  1.00 51.00  ? 7   GLY B N     1 
ATOM   770  C  CA    . GLY B 2 5  ? -8.147  10.354  -2.080  1.00 41.15  ? 7   GLY B CA    1 
ATOM   771  C  C     . GLY B 2 5  ? -8.613  11.592  -2.815  1.00 36.40  ? 7   GLY B C     1 
ATOM   772  O  O     . GLY B 2 5  ? -9.611  12.209  -2.450  1.00 43.70  ? 7   GLY B O     1 
ATOM   773  N  N     . ARG B 2 6  ? -7.869  11.942  -3.862  1.00 26.68  ? 8   ARG B N     1 
ATOM   774  C  CA    . ARG B 2 6  ? -8.145  13.098  -4.707  1.00 22.30  ? 8   ARG B CA    1 
ATOM   775  C  C     . ARG B 2 6  ? -9.492  12.888  -5.403  1.00 22.65  ? 8   ARG B C     1 
ATOM   776  O  O     . ARG B 2 6  ? -9.615  12.007  -6.259  1.00 19.39  ? 8   ARG B O     1 
ATOM   777  C  CB    . ARG B 2 6  ? -7.037  13.287  -5.746  1.00 26.32  ? 8   ARG B CB    1 
ATOM   778  C  CG    . ARG B 2 6  ? -6.880  14.699  -6.319  1.00 26.89  ? 8   ARG B CG    1 
ATOM   779  C  CD    . ARG B 2 6  ? -5.862  14.667  -7.459  1.00 35.71  ? 8   ARG B CD    1 
ATOM   780  N  NE    . ARG B 2 6  ? -4.983  15.832  -7.561  1.00 40.07  ? 8   ARG B NE    1 
ATOM   781  C  CZ    . ARG B 2 6  ? -5.230  16.906  -8.304  1.00 44.07  ? 8   ARG B CZ    1 
ATOM   782  N  NH1   . ARG B 2 6  ? -6.360  17.001  -8.968  1.00 41.67  ? 8   ARG B NH1   1 
ATOM   783  N  NH2   . ARG B 2 6  ? -4.366  17.909  -8.346  1.00 52.87  ? 8   ARG B NH2   1 
ATOM   784  N  N     . ARG B 2 7  ? -10.504 13.664  -5.035  1.00 21.18  ? 9   ARG B N     1 
ATOM   785  C  CA    . ARG B 2 7  ? -11.847 13.443  -5.567  1.00 17.27  ? 9   ARG B CA    1 
ATOM   786  C  C     . ARG B 2 7  ? -12.010 13.965  -6.998  1.00 18.49  ? 9   ARG B C     1 
ATOM   787  O  O     . ARG B 2 7  ? -12.987 13.647  -7.677  1.00 21.59  ? 9   ARG B O     1 
ATOM   788  C  CB    . ARG B 2 7  ? -12.887 14.101  -4.655  1.00 17.37  ? 9   ARG B CB    1 
ATOM   789  N  N     . ARG B 2 8  ? -11.039 14.748  -7.457  1.00 18.85  ? 10  ARG B N     1 
ATOM   790  C  CA    . ARG B 2 8  ? -11.179 15.494  -8.703  1.00 11.80  ? 10  ARG B CA    1 
ATOM   791  C  C     . ARG B 2 8  ? -9.825  15.993  -9.191  1.00 19.04  ? 10  ARG B C     1 
ATOM   792  O  O     . ARG B 2 8  ? -8.983  16.396  -8.391  1.00 20.06  ? 10  ARG B O     1 
ATOM   793  C  CB    . ARG B 2 8  ? -12.148 16.658  -8.509  1.00 10.63  ? 10  ARG B CB    1 
ATOM   794  C  CG    . ARG B 2 8  ? -11.782 17.939  -9.227  1.00 14.01  ? 10  ARG B CG    1 
ATOM   795  C  CD    . ARG B 2 8  ? -12.364 19.142  -8.503  1.00 8.54   ? 10  ARG B CD    1 
ATOM   796  N  NE    . ARG B 2 8  ? -13.812 19.031  -8.384  1.00 13.28  ? 10  ARG B NE    1 
ATOM   797  C  CZ    . ARG B 2 8  ? -14.462 19.039  -7.225  1.00 19.00  ? 10  ARG B CZ    1 
ATOM   798  N  NH1   . ARG B 2 8  ? -13.788 19.161  -6.091  1.00 15.49  ? 10  ARG B NH1   1 
ATOM   799  N  NH2   . ARG B 2 8  ? -15.784 18.937  -7.196  1.00 25.39  ? 10  ARG B NH2   1 
ATOM   800  N  N     . GLY B 2 9  ? -9.603  15.956  -10.501 1.00 28.85  ? 11  GLY B N     1 
ATOM   801  C  CA    . GLY B 2 9  ? -8.295  16.296  -11.024 1.00 27.72  ? 11  GLY B CA    1 
ATOM   802  C  C     . GLY B 2 9  ? -8.230  17.381  -12.079 1.00 29.56  ? 11  GLY B C     1 
ATOM   803  O  O     . GLY B 2 9  ? -9.247  17.950  -12.473 1.00 32.32  ? 11  GLY B O     1 
ATOM   804  N  N     . GLY B 2 10 ? -7.008  17.675  -12.514 1.00 27.61  ? 12  GLY B N     1 
ATOM   805  C  CA    . GLY B 2 10 ? -6.743  18.692  -13.516 1.00 21.90  ? 12  GLY B CA    1 
ATOM   806  C  C     . GLY B 2 10 ? -6.273  19.978  -12.865 1.00 21.32  ? 12  GLY B C     1 
ATOM   807  O  O     . GLY B 2 10 ? -7.010  20.606  -12.106 1.00 21.08  ? 12  GLY B O     1 
ATOM   808  N  N     . GLY B 2 11 ? -5.050  20.384  -13.191 1.00 25.86  ? 13  GLY B N     1 
ATOM   809  C  CA    . GLY B 2 11 ? -4.432  21.548  -12.582 1.00 17.77  ? 13  GLY B CA    1 
ATOM   810  C  C     . GLY B 2 11 ? -4.400  21.413  -11.073 1.00 16.77  ? 13  GLY B C     1 
ATOM   811  O  O     . GLY B 2 11 ? -3.990  20.379  -10.545 1.00 25.62  ? 13  GLY B O     1 
ATOM   812  N  N     . GLY B 2 12 ? -4.866  22.445  -10.377 1.00 12.14  ? 14  GLY B N     1 
ATOM   813  C  CA    . GLY B 2 12 ? -4.873  22.425  -8.929  1.00 6.71   ? 14  GLY B CA    1 
ATOM   814  C  C     . GLY B 2 12 ? -6.246  22.140  -8.355  1.00 25.32  ? 14  GLY B C     1 
ATOM   815  O  O     . GLY B 2 12 ? -6.507  22.489  -7.195  1.00 16.75  ? 14  GLY B O     1 
ATOM   816  N  N     . ARG B 2 13 ? -7.128  21.524  -9.150  1.00 16.32  ? 15  ARG B N     1 
ATOM   817  C  CA    . ARG B 2 13 ? -8.467  21.221  -8.653  1.00 14.59  ? 15  ARG B CA    1 
ATOM   818  C  C     . ARG B 2 13 ? -8.424  20.110  -7.630  1.00 19.95  ? 15  ARG B C     1 
ATOM   819  O  O     . ARG B 2 13 ? -7.676  19.137  -7.792  1.00 19.49  ? 15  ARG B O     1 
ATOM   820  C  CB    . ARG B 2 13 ? -9.374  20.760  -9.782  1.00 24.13  ? 15  ARG B CB    1 
ATOM   821  C  CG    . ARG B 2 13 ? -9.812  21.772  -10.797 1.00 27.69  ? 15  ARG B CG    1 
ATOM   822  C  CD    . ARG B 2 13 ? -10.249 20.979  -12.006 1.00 17.82  ? 15  ARG B CD    1 
ATOM   823  N  NE    . ARG B 2 13 ? -10.959 21.733  -13.023 1.00 18.27  ? 15  ARG B NE    1 
ATOM   824  C  CZ    . ARG B 2 13 ? -10.484 21.905  -14.248 1.00 26.32  ? 15  ARG B CZ    1 
ATOM   825  N  NH1   . ARG B 2 13 ? -9.292  21.412  -14.560 1.00 37.23  ? 15  ARG B NH1   1 
ATOM   826  N  NH2   . ARG B 2 13 ? -11.171 22.585  -15.152 1.00 28.70  ? 15  ARG B NH2   1 
ATOM   827  N  N     . GLY B 2 14 ? -9.241  20.229  -6.591  1.00 25.10  ? 16  GLY B N     1 
ATOM   828  C  CA    . GLY B 2 14 ? -9.432  19.131  -5.662  1.00 24.02  ? 16  GLY B CA    1 
ATOM   829  C  C     . GLY B 2 14 ? -8.157  19.060  -4.871  1.00 23.07  ? 16  GLY B C     1 
ATOM   830  O  O     . GLY B 2 14 ? -7.603  17.965  -4.731  1.00 23.86  ? 16  GLY B O     1 
ATOM   831  N  N     . GLN B 2 15 ? -7.719  20.133  -4.230  1.00 26.87  ? 17  GLN B N     1 
ATOM   832  C  CA    . GLN B 2 15 ? -6.595  19.906  -3.326  1.00 26.87  ? 17  GLN B CA    1 
ATOM   833  C  C     . GLN B 2 15 ? -7.013  20.448  -1.970  1.00 41.07  ? 17  GLN B C     1 
ATOM   834  O  O     . GLN B 2 15 ? -7.805  21.393  -1.903  1.00 40.34  ? 17  GLN B O     1 
ATOM   835  C  CB    . GLN B 2 15 ? -5.347  20.603  -3.889  1.00 28.79  ? 17  GLN B CB    1 
ATOM   836  C  CG    . GLN B 2 15 ? -4.731  19.855  -5.097  1.00 36.72  ? 17  GLN B CG    1 
ATOM   837  C  CD    . GLN B 2 15 ? -4.122  18.525  -4.753  1.00 51.30  ? 17  GLN B CD    1 
ATOM   838  O  OE1   . GLN B 2 15 ? -4.146  17.603  -5.557  1.00 46.60  ? 17  GLN B OE1   1 
ATOM   839  N  NE2   . GLN B 2 15 ? -3.560  18.419  -3.577  1.00 62.80  ? 17  GLN B NE2   1 
ATOM   840  N  N     . GLY B 2 16 ? -6.597  19.812  -0.889  1.00 53.81  ? 18  GLY B N     1 
ATOM   841  C  CA    . GLY B 2 16 ? -7.048  20.277  0.414   1.00 54.71  ? 18  GLY B CA    1 
ATOM   842  C  C     . GLY B 2 16 ? -8.532  20.079  0.712   1.00 47.26  ? 18  GLY B C     1 
ATOM   843  O  O     . GLY B 2 16 ? -9.286  19.455  -0.044  1.00 42.98  ? 18  GLY B O     1 
ATOM   844  O  "O5'" . G   C 1 1  ? -11.614 1.394   -10.394 1.00 43.97  ? 1   G   C "O5'" 1 
ATOM   845  C  "C5'" . G   C 1 1  ? -10.902 1.182   -11.601 1.00 31.09  ? 1   G   C "C5'" 1 
ATOM   846  C  "C4'" . G   C 1 1  ? -9.414  1.152   -11.364 1.00 28.91  ? 1   G   C "C4'" 1 
ATOM   847  O  "O4'" . G   C 1 1  ? -8.991  2.432   -10.823 1.00 31.26  ? 1   G   C "O4'" 1 
ATOM   848  C  "C3'" . G   C 1 1  ? -8.905  0.146   -10.342 1.00 29.13  ? 1   G   C "C3'" 1 
ATOM   849  O  "O3'" . G   C 1 1  ? -8.811  -1.184  -10.832 1.00 27.84  ? 1   G   C "O3'" 1 
ATOM   850  C  "C2'" . G   C 1 1  ? -7.582  0.763   -9.916  1.00 30.96  ? 1   G   C "C2'" 1 
ATOM   851  O  "O2'" . G   C 1 1  ? -6.600  0.590   -10.927 1.00 28.88  ? 1   G   C "O2'" 1 
ATOM   852  C  "C1'" . G   C 1 1  ? -7.965  2.239   -9.869  1.00 31.91  ? 1   G   C "C1'" 1 
ATOM   853  N  N9    . G   C 1 1  ? -8.511  2.588   -8.545  1.00 25.09  ? 1   G   C N9    1 
ATOM   854  C  C8    . G   C 1 1  ? -9.827  2.850   -8.256  1.00 22.08  ? 1   G   C C8    1 
ATOM   855  N  N7    . G   C 1 1  ? -10.031 3.101   -6.993  1.00 23.22  ? 1   G   C N7    1 
ATOM   856  C  C5    . G   C 1 1  ? -8.779  2.981   -6.409  1.00 14.64  ? 1   G   C C5    1 
ATOM   857  C  C6    . G   C 1 1  ? -8.386  3.137   -5.056  1.00 17.92  ? 1   G   C C6    1 
ATOM   858  O  O6    . G   C 1 1  ? -9.103  3.426   -4.090  1.00 17.08  ? 1   G   C O6    1 
ATOM   859  N  N1    . G   C 1 1  ? -7.018  2.925   -4.887  1.00 20.10  ? 1   G   C N1    1 
ATOM   860  C  C2    . G   C 1 1  ? -6.147  2.600   -5.903  1.00 20.05  ? 1   G   C C2    1 
ATOM   861  N  N2    . G   C 1 1  ? -4.863  2.429   -5.561  1.00 13.81  ? 1   G   C N2    1 
ATOM   862  N  N3    . G   C 1 1  ? -6.506  2.451   -7.171  1.00 19.65  ? 1   G   C N3    1 
ATOM   863  C  C4    . G   C 1 1  ? -7.830  2.649   -7.351  1.00 18.07  ? 1   G   C C4    1 
ATOM   864  P  P     . C   C 1 2  ? -9.089  -2.420  -9.839  1.00 38.87  ? 2   C   C P     1 
ATOM   865  O  OP1   . C   C 1 2  ? -9.040  -3.675  -10.626 1.00 47.16  ? 2   C   C OP1   1 
ATOM   866  O  OP2   . C   C 1 2  ? -10.269 -2.119  -8.987  1.00 36.82  ? 2   C   C OP2   1 
ATOM   867  O  "O5'" . C   C 1 2  ? -7.803  -2.435  -8.911  1.00 28.78  ? 2   C   C "O5'" 1 
ATOM   868  C  "C5'" . C   C 1 2  ? -6.518  -2.575  -9.491  1.00 26.44  ? 2   C   C "C5'" 1 
ATOM   869  C  "C4'" . C   C 1 2  ? -5.421  -2.374  -8.480  1.00 18.02  ? 2   C   C "C4'" 1 
ATOM   870  O  "O4'" . C   C 1 2  ? -5.531  -1.056  -7.881  1.00 26.20  ? 2   C   C "O4'" 1 
ATOM   871  C  "C3'" . C   C 1 2  ? -5.417  -3.312  -7.287  1.00 20.39  ? 2   C   C "C3'" 1 
ATOM   872  O  "O3'" . C   C 1 2  ? -4.885  -4.591  -7.571  1.00 27.32  ? 2   C   C "O3'" 1 
ATOM   873  C  "C2'" . C   C 1 2  ? -4.610  -2.524  -6.264  1.00 29.35  ? 2   C   C "C2'" 1 
ATOM   874  O  "O2'" . C   C 1 2  ? -3.223  -2.582  -6.569  1.00 27.05  ? 2   C   C "O2'" 1 
ATOM   875  C  "C1'" . C   C 1 2  ? -5.096  -1.101  -6.537  1.00 29.20  ? 2   C   C "C1'" 1 
ATOM   876  N  N1    . C   C 1 2  ? -6.234  -0.752  -5.656  1.00 20.45  ? 2   C   C N1    1 
ATOM   877  C  C2    . C   C 1 2  ? -5.994  -0.414  -4.316  1.00 19.10  ? 2   C   C C2    1 
ATOM   878  O  O2    . C   C 1 2  ? -4.833  -0.386  -3.886  1.00 22.16  ? 2   C   C O2    1 
ATOM   879  N  N3    . C   C 1 2  ? -7.037  -0.111  -3.514  1.00 17.18  ? 2   C   C N3    1 
ATOM   880  C  C4    . C   C 1 2  ? -8.279  -0.151  -3.995  1.00 14.69  ? 2   C   C C4    1 
ATOM   881  N  N4    . C   C 1 2  ? -9.287  0.149   -3.172  1.00 9.89   ? 2   C   C N4    1 
ATOM   882  C  C5    . C   C 1 2  ? -8.550  -0.499  -5.348  1.00 14.12  ? 2   C   C C5    1 
ATOM   883  C  C6    . C   C 1 2  ? -7.511  -0.794  -6.135  1.00 7.58   ? 2   C   C C6    1 
ATOM   884  P  P     . U   C 1 3  ? -5.454  -5.897  -6.822  1.00 28.51  ? 3   U   C P     1 
ATOM   885  O  OP1   . U   C 1 3  ? -4.738  -7.085  -7.352  1.00 34.42  ? 3   U   C OP1   1 
ATOM   886  O  OP2   . U   C 1 3  ? -6.937  -5.882  -6.880  1.00 31.73  ? 3   U   C OP2   1 
ATOM   887  O  "O5'" . U   C 1 3  ? -5.016  -5.666  -5.307  1.00 12.46  ? 3   U   C "O5'" 1 
ATOM   888  C  "C5'" . U   C 1 3  ? -3.641  -5.661  -4.963  1.00 11.91  ? 3   U   C "C5'" 1 
ATOM   889  C  "C4'" . U   C 1 3  ? -3.401  -5.210  -3.545  1.00 12.69  ? 3   U   C "C4'" 1 
ATOM   890  O  "O4'" . U   C 1 3  ? -3.985  -3.900  -3.311  1.00 16.12  ? 3   U   C "O4'" 1 
ATOM   891  C  "C3'" . U   C 1 3  ? -4.014  -6.062  -2.455  1.00 21.56  ? 3   U   C "C3'" 1 
ATOM   892  O  "O3'" . U   C 1 3  ? -3.310  -7.274  -2.251  1.00 25.06  ? 3   U   C "O3'" 1 
ATOM   893  C  "C2'" . U   C 1 3  ? -3.996  -5.111  -1.264  1.00 27.41  ? 3   U   C "C2'" 1 
ATOM   894  O  "O2'" . U   C 1 3  ? -2.693  -5.010  -0.711  1.00 26.35  ? 3   U   C "O2'" 1 
ATOM   895  C  "C1'" . U   C 1 3  ? -4.337  -3.780  -1.944  1.00 24.08  ? 3   U   C "C1'" 1 
ATOM   896  N  N1    . U   C 1 3  ? -5.779  -3.473  -1.812  1.00 20.91  ? 3   U   C N1    1 
ATOM   897  C  C2    . U   C 1 3  ? -6.161  -2.955  -0.591  1.00 17.16  ? 3   U   C C2    1 
ATOM   898  O  O2    . U   C 1 3  ? -5.358  -2.726  0.295   1.00 16.35  ? 3   U   C O2    1 
ATOM   899  N  N3    . U   C 1 3  ? -7.501  -2.689  -0.451  1.00 18.20  ? 3   U   C N3    1 
ATOM   900  C  C4    . U   C 1 3  ? -8.482  -2.908  -1.399  1.00 19.06  ? 3   U   C C4    1 
ATOM   901  O  O4    . U   C 1 3  ? -9.651  -2.623  -1.131  1.00 23.33  ? 3   U   C O4    1 
ATOM   902  C  C5    . U   C 1 3  ? -8.010  -3.462  -2.634  1.00 9.36   ? 3   U   C C5    1 
ATOM   903  C  C6    . U   C 1 3  ? -6.706  -3.729  -2.795  1.00 16.84  ? 3   U   C C6    1 
ATOM   904  P  P     . G   C 1 4  ? -4.029  -8.501  -1.512  1.00 26.78  ? 4   G   C P     1 
ATOM   905  O  OP1   . G   C 1 4  ? -3.220  -9.731  -1.709  1.00 32.84  ? 4   G   C OP1   1 
ATOM   906  O  OP2   . G   C 1 4  ? -5.445  -8.508  -1.964  1.00 37.39  ? 4   G   C OP2   1 
ATOM   907  O  "O5'" . G   C 1 4  ? -3.946  -8.123  0.031   1.00 17.19  ? 4   G   C "O5'" 1 
ATOM   908  C  "C5'" . G   C 1 4  ? -2.690  -7.993  0.676   1.00 7.57   ? 4   G   C "C5'" 1 
ATOM   909  C  "C4'" . G   C 1 4  ? -2.833  -7.519  2.101   1.00 16.30  ? 4   G   C "C4'" 1 
ATOM   910  O  "O4'" . G   C 1 4  ? -3.454  -6.207  2.131   1.00 17.81  ? 4   G   C "O4'" 1 
ATOM   911  C  "C3'" . G   C 1 4  ? -3.707  -8.368  3.014   1.00 19.24  ? 4   G   C "C3'" 1 
ATOM   912  O  "O3'" . G   C 1 4  ? -3.030  -9.516  3.512   1.00 25.97  ? 4   G   C "O3'" 1 
ATOM   913  C  "C2'" . G   C 1 4  ? -4.133  -7.371  4.091   1.00 23.24  ? 4   G   C "C2'" 1 
ATOM   914  O  "O2'" . G   C 1 4  ? -3.111  -7.192  5.059   1.00 21.88  ? 4   G   C "O2'" 1 
ATOM   915  C  "C1'" . G   C 1 4  ? -4.265  -6.079  3.281   1.00 19.85  ? 4   G   C "C1'" 1 
ATOM   916  N  N9    . G   C 1 4  ? -5.654  -5.820  2.851   1.00 17.57  ? 4   G   C N9    1 
ATOM   917  C  C8    . G   C 1 4  ? -6.125  -5.904  1.565   1.00 18.93  ? 4   G   C C8    1 
ATOM   918  N  N7    . G   C 1 4  ? -7.392  -5.620  1.473   1.00 19.20  ? 4   G   C N7    1 
ATOM   919  C  C5    . G   C 1 4  ? -7.789  -5.337  2.772   1.00 17.42  ? 4   G   C C5    1 
ATOM   920  C  C6    . G   C 1 4  ? -9.060  -4.967  3.286   1.00 16.55  ? 4   G   C C6    1 
ATOM   921  O  O6    . G   C 1 4  ? -10.126 -4.810  2.681   1.00 16.74  ? 4   G   C O6    1 
ATOM   922  N  N1    . G   C 1 4  ? -9.025  -4.773  4.657   1.00 8.66   ? 4   G   C N1    1 
ATOM   923  C  C2    . G   C 1 4  ? -7.911  -4.915  5.438   1.00 8.55   ? 4   G   C C2    1 
ATOM   924  N  N2    . G   C 1 4  ? -8.088  -4.677  6.745   1.00 8.79   ? 4   G   C N2    1 
ATOM   925  N  N3    . G   C 1 4  ? -6.719  -5.260  4.974   1.00 10.34  ? 4   G   C N3    1 
ATOM   926  C  C4    . G   C 1 4  ? -6.727  -5.456  3.639   1.00 10.48  ? 4   G   C C4    1 
ATOM   927  P  P     . C   C 1 5  ? -3.840  -10.863 3.869   1.00 28.46  ? 5   C   C P     1 
ATOM   928  O  OP1   . C   C 1 5  ? -2.891  -11.908 4.328   1.00 26.35  ? 5   C   C OP1   1 
ATOM   929  O  OP2   . C   C 1 5  ? -4.761  -11.173 2.750   1.00 34.27  ? 5   C   C OP2   1 
ATOM   930  O  "O5'" . C   C 1 5  ? -4.726  -10.442 5.117   1.00 15.49  ? 5   C   C "O5'" 1 
ATOM   931  C  "C5'" . C   C 1 5  ? -4.110  -10.071 6.338   1.00 14.81  ? 5   C   C "C5'" 1 
ATOM   932  C  "C4'" . C   C 1 5  ? -5.127  -9.924  7.436   1.00 23.68  ? 5   C   C "C4'" 1 
ATOM   933  O  "O4'" . C   C 1 5  ? -5.837  -8.669  7.284   1.00 35.23  ? 5   C   C "O4'" 1 
ATOM   934  C  "C3'" . C   C 1 5  ? -6.233  -10.963 7.459   1.00 22.33  ? 5   C   C "C3'" 1 
ATOM   935  O  "O3'" . C   C 1 5  ? -5.824  -12.195 8.021   1.00 18.18  ? 5   C   C "O3'" 1 
ATOM   936  C  "C2'" . C   C 1 5  ? -7.338  -10.252 8.227   1.00 27.50  ? 5   C   C "C2'" 1 
ATOM   937  O  "O2'" . C   C 1 5  ? -7.071  -10.271 9.622   1.00 30.47  ? 5   C   C "O2'" 1 
ATOM   938  C  "C1'" . C   C 1 5  ? -7.173  -8.816  7.720   1.00 27.96  ? 5   C   C "C1'" 1 
ATOM   939  N  N1    . C   C 1 5  ? -8.071  -8.513  6.583   1.00 20.14  ? 5   C   C N1    1 
ATOM   940  C  C2    . C   C 1 5  ? -9.388  -8.121  6.848   1.00 21.21  ? 5   C   C C2    1 
ATOM   941  O  O2    . C   C 1 5  ? -9.768  -8.031  8.023   1.00 16.65  ? 5   C   C O2    1 
ATOM   942  N  N3    . C   C 1 5  ? -10.216 -7.839  5.816   1.00 20.78  ? 5   C   C N3    1 
ATOM   943  C  C4    . C   C 1 5  ? -9.774  -7.938  4.561   1.00 14.20  ? 5   C   C C4    1 
ATOM   944  N  N4    . C   C 1 5  ? -10.636 -7.649  3.588   1.00 10.33  ? 5   C   C N4    1 
ATOM   945  C  C5    . C   C 1 5  ? -8.439  -8.337  4.259   1.00 13.65  ? 5   C   C C5    1 
ATOM   946  C  C6    . C   C 1 5  ? -7.628  -8.612  5.290   1.00 13.47  ? 5   C   C C6    1 
ATOM   947  P  P     . G   C 1 6  ? -6.492  -13.564 7.514   1.00 30.62  ? 6   G   C P     1 
ATOM   948  O  OP1   . G   C 1 6  ? -5.517  -14.665 7.715   1.00 40.59  ? 6   G   C OP1   1 
ATOM   949  O  OP2   . G   C 1 6  ? -7.044  -13.328 6.155   1.00 30.95  ? 6   G   C OP2   1 
ATOM   950  O  "O5'" . G   C 1 6  ? -7.714  -13.756 8.517   1.00 12.09  ? 6   G   C "O5'" 1 
ATOM   951  C  "C5'" . G   C 1 6  ? -8.920  -14.376 8.097   1.00 14.23  ? 6   G   C "C5'" 1 
ATOM   952  C  "C4'" . G   C 1 6  ? -9.839  -14.658 9.261   1.00 22.09  ? 6   G   C "C4'" 1 
ATOM   953  O  "O4'" . G   C 1 6  ? -11.162 -14.943 8.746   1.00 24.44  ? 6   G   C "O4'" 1 
ATOM   954  C  "C3'" . G   C 1 6  ? -9.455  -15.862 10.103  1.00 31.33  ? 6   G   C "C3'" 1 
ATOM   955  O  "O3'" . G   C 1 6  ? -9.993  -15.667 11.418  1.00 48.38  ? 6   G   C "O3'" 1 
ATOM   956  C  "C2'" . G   C 1 6  ? -10.205 -16.989 9.393   1.00 24.82  ? 6   G   C "C2'" 1 
ATOM   957  O  "O2'" . G   C 1 6  ? -10.419 -18.150 10.167  1.00 35.25  ? 6   G   C "O2'" 1 
ATOM   958  C  "C1'" . G   C 1 6  ? -11.512 -16.289 9.022   1.00 22.06  ? 6   G   C "C1'" 1 
ATOM   959  N  N9    . G   C 1 6  ? -12.159 -16.780 7.807   1.00 19.57  ? 6   G   C N9    1 
ATOM   960  C  C8    . G   C 1 6  ? -11.582 -17.240 6.645   1.00 19.34  ? 6   G   C C8    1 
ATOM   961  N  N7    . G   C 1 6  ? -12.466 -17.547 5.733   1.00 16.09  ? 6   G   C N7    1 
ATOM   962  C  C5    . G   C 1 6  ? -13.686 -17.252 6.326   1.00 13.83  ? 6   G   C C5    1 
ATOM   963  C  C6    . G   C 1 6  ? -15.005 -17.370 5.828   1.00 12.50  ? 6   G   C C6    1 
ATOM   964  O  O6    . G   C 1 6  ? -15.368 -17.779 4.724   1.00 28.30  ? 6   G   C O6    1 
ATOM   965  N  N1    . G   C 1 6  ? -15.946 -16.958 6.764   1.00 12.79  ? 6   G   C N1    1 
ATOM   966  C  C2    . G   C 1 6  ? -15.662 -16.490 8.022   1.00 19.37  ? 6   G   C C2    1 
ATOM   967  N  N2    . G   C 1 6  ? -16.716 -16.140 8.776   1.00 20.05  ? 6   G   C N2    1 
ATOM   968  N  N3    . G   C 1 6  ? -14.437 -16.369 8.501   1.00 13.71  ? 6   G   C N3    1 
ATOM   969  C  C4    . G   C 1 6  ? -13.512 -16.772 7.603   1.00 13.65  ? 6   G   C C4    1 
ATOM   970  P  P     . G   C 1 7  ? -9.240  -14.738 12.502  1.00 38.13  ? 7   G   C P     1 
ATOM   971  O  OP1   . G   C 1 7  ? -7.806  -14.602 12.135  1.00 28.31  ? 7   G   C OP1   1 
ATOM   972  O  OP2   . G   C 1 7  ? -9.626  -15.236 13.848  1.00 38.23  ? 7   G   C OP2   1 
ATOM   973  O  "O5'" . G   C 1 7  ? -9.936  -13.309 12.353  1.00 13.28  ? 7   G   C "O5'" 1 
ATOM   974  C  "C5'" . G   C 1 7  ? -11.351 -13.173 12.300  1.00 14.63  ? 7   G   C "C5'" 1 
ATOM   975  C  "C4'" . G   C 1 7  ? -11.774 -11.726 12.401  1.00 18.21  ? 7   G   C "C4'" 1 
ATOM   976  O  "O4'" . G   C 1 7  ? -11.182 -10.965 11.315  1.00 21.40  ? 7   G   C "O4'" 1 
ATOM   977  C  "C3'" . G   C 1 7  ? -13.269 -11.453 12.282  1.00 21.78  ? 7   G   C "C3'" 1 
ATOM   978  O  "O3'" . G   C 1 7  ? -13.958 -11.621 13.508  1.00 12.97  ? 7   G   C "O3'" 1 
ATOM   979  C  "C2'" . G   C 1 7  ? -13.316 -10.021 11.765  1.00 24.31  ? 7   G   C "C2'" 1 
ATOM   980  O  "O2'" . G   C 1 7  ? -13.108 -9.094  12.820  1.00 27.83  ? 7   G   C "O2'" 1 
ATOM   981  C  "C1'" . G   C 1 7  ? -12.094 -9.989  10.850  1.00 22.90  ? 7   G   C "C1'" 1 
ATOM   982  N  N9    . G   C 1 7  ? -12.392 -10.237 9.421   1.00 11.21  ? 7   G   C N9    1 
ATOM   983  C  C8    . G   C 1 7  ? -11.498 -10.825 8.562   1.00 14.39  ? 7   G   C C8    1 
ATOM   984  N  N7    . G   C 1 7  ? -11.932 -10.934 7.340   1.00 17.31  ? 7   G   C N7    1 
ATOM   985  C  C5    . G   C 1 7  ? -13.197 -10.376 7.384   1.00 14.71  ? 7   G   C C5    1 
ATOM   986  C  C6    . G   C 1 7  ? -14.137 -10.223 6.336   1.00 13.90  ? 7   G   C C6    1 
ATOM   987  O  O6    . G   C 1 7  ? -14.030 -10.558 5.154   1.00 16.71  ? 7   G   C O6    1 
ATOM   988  N  N1    . G   C 1 7  ? -15.299 -9.611  6.774   1.00 14.57  ? 7   G   C N1    1 
ATOM   989  C  C2    . G   C 1 7  ? -15.527 -9.201  8.057   1.00 11.30  ? 7   G   C C2    1 
ATOM   990  N  N2    . G   C 1 7  ? -16.720 -8.631  8.263   1.00 15.72  ? 7   G   C N2    1 
ATOM   991  N  N3    . G   C 1 7  ? -14.656 -9.334  9.049   1.00 22.66  ? 7   G   C N3    1 
ATOM   992  C  C4    . G   C 1 7  ? -13.507 -9.933  8.656   1.00 11.19  ? 7   G   C C4    1 
ATOM   993  P  P     . U   C 1 8  ? -15.223 -12.602 13.599  1.00 35.07  ? 8   U   C P     1 
ATOM   994  O  OP1   . U   C 1 8  ? -15.798 -12.487 14.967  1.00 43.08  ? 8   U   C OP1   1 
ATOM   995  O  OP2   . U   C 1 8  ? -14.757 -13.928 13.113  1.00 27.12  ? 8   U   C OP2   1 
ATOM   996  O  "O5'" . U   C 1 8  ? -16.265 -11.966 12.567  1.00 41.02  ? 8   U   C "O5'" 1 
ATOM   997  C  "C5'" . U   C 1 8  ? -16.985 -10.777 12.876  1.00 39.16  ? 8   U   C "C5'" 1 
ATOM   998  C  "C4'" . U   C 1 8  ? -18.197 -10.616 11.988  1.00 40.47  ? 8   U   C "C4'" 1 
ATOM   999  O  "O4'" . U   C 1 8  ? -17.765 -10.286 10.647  1.00 45.92  ? 8   U   C "O4'" 1 
ATOM   1000 C  "C3'" . U   C 1 8  ? -19.062 -11.854 11.813  1.00 38.54  ? 8   U   C "C3'" 1 
ATOM   1001 O  "O3'" . U   C 1 8  ? -19.988 -12.010 12.878  1.00 42.93  ? 8   U   C "O3'" 1 
ATOM   1002 C  "C2'" . U   C 1 8  ? -19.714 -11.636 10.450  1.00 36.78  ? 8   U   C "C2'" 1 
ATOM   1003 O  "O2'" . U   C 1 8  ? -20.844 -10.787 10.561  1.00 44.58  ? 8   U   C "O2'" 1 
ATOM   1004 C  "C1'" . U   C 1 8  ? -18.624 -10.873 9.697   1.00 38.73  ? 8   U   C "C1'" 1 
ATOM   1005 N  N1    . U   C 1 8  ? -17.802 -11.734 8.814   1.00 34.21  ? 8   U   C N1    1 
ATOM   1006 C  C2    . U   C 1 8  ? -18.281 -12.067 7.563   1.00 28.32  ? 8   U   C C2    1 
ATOM   1007 O  O2    . U   C 1 8  ? -19.375 -11.721 7.160   1.00 37.94  ? 8   U   C O2    1 
ATOM   1008 N  N3    . U   C 1 8  ? -17.439 -12.846 6.809   1.00 19.18  ? 8   U   C N3    1 
ATOM   1009 C  C4    . U   C 1 8  ? -16.184 -13.298 7.167   1.00 19.28  ? 8   U   C C4    1 
ATOM   1010 O  O4    . U   C 1 8  ? -15.534 -13.990 6.382   1.00 22.40  ? 8   U   C O4    1 
ATOM   1011 C  C5    . U   C 1 8  ? -15.754 -12.896 8.467   1.00 25.59  ? 8   U   C C5    1 
ATOM   1012 C  C6    . U   C 1 8  ? -16.554 -12.142 9.221   1.00 31.57  ? 8   U   C C6    1 
ATOM   1013 P  P     . G   C 1 9  ? -20.511 -13.467 13.302  1.00 47.94  ? 9   G   C P     1 
ATOM   1014 O  OP1   . G   C 1 9  ? -21.227 -13.309 14.591  1.00 50.00  ? 9   G   C OP1   1 
ATOM   1015 O  OP2   . G   C 1 9  ? -19.369 -14.414 13.242  1.00 51.58  ? 9   G   C OP2   1 
ATOM   1016 O  "O5'" . G   C 1 9  ? -21.610 -13.822 12.199  1.00 30.64  ? 9   G   C "O5'" 1 
ATOM   1017 C  "C5'" . G   C 1 9  ? -22.728 -12.965 11.981  1.00 33.79  ? 9   G   C "C5'" 1 
ATOM   1018 C  "C4'" . G   C 1 9  ? -23.487 -13.305 10.717  1.00 39.82  ? 9   G   C "C4'" 1 
ATOM   1019 O  "O4'" . G   C 1 9  ? -22.578 -13.387 9.580   1.00 44.04  ? 9   G   C "O4'" 1 
ATOM   1020 C  "C3'" . G   C 1 9  ? -24.263 -14.624 10.743  1.00 46.29  ? 9   G   C "C3'" 1 
ATOM   1021 O  "O3'" . G   C 1 9  ? -25.508 -14.466 10.060  1.00 53.81  ? 9   G   C "O3'" 1 
ATOM   1022 C  "C2'" . G   C 1 9  ? -23.360 -15.565 9.952   1.00 46.90  ? 9   G   C "C2'" 1 
ATOM   1023 O  "O2'" . G   C 1 9  ? -24.023 -16.661 9.358   1.00 51.51  ? 9   G   C "O2'" 1 
ATOM   1024 C  "C1'" . G   C 1 9  ? -22.777 -14.618 8.909   1.00 44.17  ? 9   G   C "C1'" 1 
ATOM   1025 N  N9    . G   C 1 9  ? -21.512 -15.071 8.317   1.00 36.17  ? 9   G   C N9    1 
ATOM   1026 C  C8    . G   C 1 9  ? -20.381 -15.485 8.980   1.00 28.41  ? 9   G   C C8    1 
ATOM   1027 N  N7    . G   C 1 9  ? -19.409 -15.829 8.178   1.00 17.39  ? 9   G   C N7    1 
ATOM   1028 C  C5    . G   C 1 9  ? -19.924 -15.626 6.909   1.00 15.69  ? 9   G   C C5    1 
ATOM   1029 C  C6    . G   C 1 9  ? -19.328 -15.831 5.639   1.00 14.05  ? 9   G   C C6    1 
ATOM   1030 O  O6    . G   C 1 9  ? -18.193 -16.244 5.382   1.00 17.67  ? 9   G   C O6    1 
ATOM   1031 N  N1    . G   C 1 9  ? -20.194 -15.502 4.603   1.00 13.29  ? 9   G   C N1    1 
ATOM   1032 C  C2    . G   C 1 9  ? -21.474 -15.040 4.771   1.00 15.17  ? 9   G   C C2    1 
ATOM   1033 N  N2    . G   C 1 9  ? -22.143 -14.778 3.641   1.00 18.90  ? 9   G   C N2    1 
ATOM   1034 N  N3    . G   C 1 9  ? -22.048 -14.846 5.951   1.00 18.45  ? 9   G   C N3    1 
ATOM   1035 C  C4    . G   C 1 9  ? -21.218 -15.150 6.973   1.00 23.90  ? 9   G   C C4    1 
ATOM   1036 P  P     . U   C 1 10 ? -26.837 -14.121 10.895  1.00 65.78  ? 10  U   C P     1 
ATOM   1037 O  OP1   . U   C 1 10 ? -27.462 -12.919 10.286  1.00 65.62  ? 10  U   C OP1   1 
ATOM   1038 O  OP2   . U   C 1 10 ? -26.490 -14.121 12.340  1.00 63.27  ? 10  U   C OP2   1 
ATOM   1039 O  "O5'" . U   C 1 10 ? -27.799 -15.358 10.603  1.00 73.98  ? 10  U   C "O5'" 1 
ATOM   1040 C  "C5'" . U   C 1 10 ? -27.669 -16.580 11.325  1.00 74.54  ? 10  U   C "C5'" 1 
ATOM   1041 C  "C4'" . U   C 1 10 ? -28.643 -17.627 10.837  1.00 78.03  ? 10  U   C "C4'" 1 
ATOM   1042 O  "O4'" . U   C 1 10 ? -29.999 -17.240 11.185  1.00 84.94  ? 10  U   C "O4'" 1 
ATOM   1043 C  "C3'" . U   C 1 10 ? -28.643 -17.891 9.331   1.00 77.00  ? 10  U   C "C3'" 1 
ATOM   1044 O  "O3'" . U   C 1 10 ? -28.904 -19.276 9.117   1.00 79.15  ? 10  U   C "O3'" 1 
ATOM   1045 C  "C2'" . U   C 1 10 ? -29.844 -17.075 8.853   1.00 77.52  ? 10  U   C "C2'" 1 
ATOM   1046 O  "O2'" . U   C 1 10 ? -30.410 -17.517 7.637   1.00 69.60  ? 10  U   C "O2'" 1 
ATOM   1047 C  "C1'" . U   C 1 10 ? -30.806 -17.244 10.026  1.00 87.55  ? 10  U   C "C1'" 1 
ATOM   1048 N  N1    . U   C 1 10 ? -31.808 -16.179 10.179  1.00 98.64  ? 10  U   C N1    1 
ATOM   1049 C  C2    . U   C 1 10 ? -33.107 -16.443 9.786   1.00 106.45 ? 10  U   C C2    1 
ATOM   1050 O  O2    . U   C 1 10 ? -33.450 -17.500 9.282   1.00 104.06 ? 10  U   C O2    1 
ATOM   1051 N  N3    . U   C 1 10 ? -33.989 -15.407 9.982   1.00 111.36 ? 10  U   C N3    1 
ATOM   1052 C  C4    . U   C 1 10 ? -33.714 -14.172 10.538  1.00 108.90 ? 10  U   C C4    1 
ATOM   1053 O  O4    . U   C 1 10 ? -34.618 -13.342 10.651  1.00 105.99 ? 10  U   C O4    1 
ATOM   1054 C  C5    . U   C 1 10 ? -32.351 -13.989 10.936  1.00 104.70 ? 10  U   C C5    1 
ATOM   1055 C  C6    . U   C 1 10 ? -31.470 -14.977 10.755  1.00 99.92  ? 10  U   C C6    1 
ATOM   1056 P  P     . G   C 1 11 ? -27.802 -20.218 8.429   1.00 72.65  ? 11  G   C P     1 
ATOM   1057 O  OP1   . G   C 1 11 ? -27.270 -19.499 7.244   1.00 74.71  ? 11  G   C OP1   1 
ATOM   1058 O  OP2   . G   C 1 11 ? -28.367 -21.581 8.253   1.00 71.14  ? 11  G   C OP2   1 
ATOM   1059 O  "O5'" . G   C 1 11 ? -26.659 -20.283 9.535   1.00 32.63  ? 11  G   C "O5'" 1 
ATOM   1060 C  "C5'" . G   C 1 11 ? -26.882 -20.907 10.792  1.00 33.67  ? 11  G   C "C5'" 1 
ATOM   1061 C  "C4'" . G   C 1 11 ? -25.627 -21.572 11.293  1.00 43.73  ? 11  G   C "C4'" 1 
ATOM   1062 O  "O4'" . G   C 1 11 ? -25.152 -22.520 10.312  1.00 49.21  ? 11  G   C "O4'" 1 
ATOM   1063 C  "C3'" . G   C 1 11 ? -24.446 -20.646 11.538  1.00 44.98  ? 11  G   C "C3'" 1 
ATOM   1064 O  "O3'" . G   C 1 11 ? -24.517 -20.046 12.820  1.00 48.40  ? 11  G   C "O3'" 1 
ATOM   1065 C  "C2'" . G   C 1 11 ? -23.239 -21.565 11.366  1.00 44.30  ? 11  G   C "C2'" 1 
ATOM   1066 O  "O2'" . G   C 1 11 ? -22.965 -22.268 12.570  1.00 46.37  ? 11  G   C "O2'" 1 
ATOM   1067 C  "C1'" . G   C 1 11 ? -23.745 -22.567 10.323  1.00 42.36  ? 11  G   C "C1'" 1 
ATOM   1068 N  N9    . G   C 1 11 ? -23.268 -22.329 8.948   1.00 35.15  ? 11  G   C N9    1 
ATOM   1069 C  C8    . G   C 1 11 ? -24.080 -22.043 7.876   1.00 36.46  ? 11  G   C C8    1 
ATOM   1070 N  N7    . G   C 1 11 ? -23.428 -21.915 6.754   1.00 33.63  ? 11  G   C N7    1 
ATOM   1071 C  C5    . G   C 1 11 ? -22.107 -22.145 7.106   1.00 23.50  ? 11  G   C C5    1 
ATOM   1072 C  C6    . G   C 1 11 ? -20.949 -22.141 6.294   1.00 19.16  ? 11  G   C C6    1 
ATOM   1073 O  O6    . G   C 1 11 ? -20.872 -21.927 5.078   1.00 27.80  ? 11  G   C O6    1 
ATOM   1074 N  N1    . G   C 1 11 ? -19.807 -22.424 7.035   1.00 17.98  ? 11  G   C N1    1 
ATOM   1075 C  C2    . G   C 1 11 ? -19.789 -22.677 8.388   1.00 24.75  ? 11  G   C C2    1 
ATOM   1076 N  N2    . G   C 1 11 ? -18.584 -22.929 8.920   1.00 27.73  ? 11  G   C N2    1 
ATOM   1077 N  N3    . G   C 1 11 ? -20.866 -22.684 9.162   1.00 15.80  ? 11  G   C N3    1 
ATOM   1078 C  C4    . G   C 1 11 ? -21.984 -22.408 8.456   1.00 24.58  ? 11  G   C C4    1 
ATOM   1079 P  P     . G   C 1 12 ? -23.993 -18.550 13.073  1.00 51.00  ? 12  G   C P     1 
ATOM   1080 O  OP1   . G   C 1 12 ? -24.237 -18.223 14.507  1.00 48.57  ? 12  G   C OP1   1 
ATOM   1081 O  OP2   . G   C 1 12 ? -24.589 -17.703 12.007  1.00 33.54  ? 12  G   C OP2   1 
ATOM   1082 O  "O5'" . G   C 1 12 ? -22.414 -18.660 12.859  1.00 48.90  ? 12  G   C "O5'" 1 
ATOM   1083 C  "C5'" . G   C 1 12 ? -21.610 -19.445 13.737  1.00 38.88  ? 12  G   C "C5'" 1 
ATOM   1084 C  "C4'" . G   C 1 12 ? -20.140 -19.337 13.413  1.00 40.03  ? 12  G   C "C4'" 1 
ATOM   1085 O  "O4'" . G   C 1 12 ? -19.918 -19.811 12.055  1.00 50.82  ? 12  G   C "O4'" 1 
ATOM   1086 C  "C3'" . G   C 1 12 ? -19.502 -17.943 13.486  1.00 38.73  ? 12  G   C "C3'" 1 
ATOM   1087 O  "O3'" . G   C 1 12 ? -18.157 -18.116 13.932  1.00 42.98  ? 12  G   C "O3'" 1 
ATOM   1088 C  "C2'" . G   C 1 12 ? -19.469 -17.519 12.025  1.00 42.42  ? 12  G   C "C2'" 1 
ATOM   1089 O  "O2'" . G   C 1 12 ? -18.497 -16.541 11.720  1.00 43.87  ? 12  G   C "O2'" 1 
ATOM   1090 C  "C1'" . G   C 1 12 ? -19.165 -18.850 11.346  1.00 43.46  ? 12  G   C "C1'" 1 
ATOM   1091 N  N9    . G   C 1 12 ? -19.522 -18.905 9.929   1.00 30.55  ? 12  G   C N9    1 
ATOM   1092 C  C8    . G   C 1 12 ? -20.732 -18.666 9.320   1.00 29.71  ? 12  G   C C8    1 
ATOM   1093 N  N7    . G   C 1 12 ? -20.673 -18.796 8.018   1.00 22.94  ? 12  G   C N7    1 
ATOM   1094 C  C5    . G   C 1 12 ? -19.348 -19.135 7.765   1.00 15.23  ? 12  G   C C5    1 
ATOM   1095 C  C6    . G   C 1 12 ? -18.670 -19.405 6.551   1.00 14.51  ? 12  G   C C6    1 
ATOM   1096 O  O6    . G   C 1 12 ? -19.124 -19.396 5.402   1.00 23.30  ? 12  G   C O6    1 
ATOM   1097 N  N1    . G   C 1 12 ? -17.327 -19.707 6.769   1.00 19.13  ? 12  G   C N1    1 
ATOM   1098 C  C2    . G   C 1 12 ? -16.707 -19.742 7.995   1.00 13.84  ? 12  G   C C2    1 
ATOM   1099 N  N2    . G   C 1 12 ? -15.400 -20.047 8.014   1.00 13.66  ? 12  G   C N2    1 
ATOM   1100 N  N3    . G   C 1 12 ? -17.331 -19.490 9.127   1.00 16.56  ? 12  G   C N3    1 
ATOM   1101 C  C4    . G   C 1 12 ? -18.631 -19.200 8.935   1.00 16.76  ? 12  G   C C4    1 
ATOM   1102 P  P     . A   C 1 13 ? -17.762 -18.095 15.486  1.00 39.05  ? 13  A   C P     1 
ATOM   1103 O  OP1   . A   C 1 13 ? -18.738 -17.212 16.177  1.00 45.50  ? 13  A   C OP1   1 
ATOM   1104 O  OP2   . A   C 1 13 ? -16.302 -17.844 15.638  1.00 41.00  ? 13  A   C OP2   1 
ATOM   1105 O  "O5'" . A   C 1 13 ? -18.017 -19.614 15.891  1.00 43.19  ? 13  A   C "O5'" 1 
ATOM   1106 C  "C5'" . A   C 1 13 ? -17.286 -20.689 15.300  1.00 42.23  ? 13  A   C "C5'" 1 
ATOM   1107 C  "C4'" . A   C 1 13 ? -17.004 -21.794 16.287  1.00 47.36  ? 13  A   C "C4'" 1 
ATOM   1108 O  "O4'" . A   C 1 13 ? -16.079 -21.352 17.319  1.00 45.43  ? 13  A   C "O4'" 1 
ATOM   1109 C  "C3'" . A   C 1 13 ? -18.257 -22.288 17.011  1.00 51.25  ? 13  A   C "C3'" 1 
ATOM   1110 O  "O3'" . A   C 1 13 ? -18.206 -23.686 17.294  1.00 54.45  ? 13  A   C "O3'" 1 
ATOM   1111 C  "C2'" . A   C 1 13 ? -18.178 -21.551 18.337  1.00 45.14  ? 13  A   C "C2'" 1 
ATOM   1112 O  "O2'" . A   C 1 13 ? -18.880 -22.196 19.371  1.00 47.43  ? 13  A   C "O2'" 1 
ATOM   1113 C  "C1'" . A   C 1 13 ? -16.671 -21.555 18.584  1.00 44.66  ? 13  A   C "C1'" 1 
ATOM   1114 N  N9    . A   C 1 13 ? -16.171 -20.542 19.516  1.00 41.96  ? 13  A   C N9    1 
ATOM   1115 C  C8    . A   C 1 13 ? -15.799 -19.246 19.259  1.00 44.69  ? 13  A   C C8    1 
ATOM   1116 N  N7    . A   C 1 13 ? -15.372 -18.606 20.325  1.00 49.61  ? 13  A   C N7    1 
ATOM   1117 C  C5    . A   C 1 13 ? -15.437 -19.553 21.341  1.00 54.90  ? 13  A   C C5    1 
ATOM   1118 C  C6    . A   C 1 13 ? -15.119 -19.508 22.714  1.00 59.94  ? 13  A   C C6    1 
ATOM   1119 N  N6    . A   C 1 13 ? -14.643 -18.421 23.329  1.00 69.28  ? 13  A   C N6    1 
ATOM   1120 N  N1    . A   C 1 13 ? -15.307 -20.633 23.442  1.00 48.64  ? 13  A   C N1    1 
ATOM   1121 C  C2    . A   C 1 13 ? -15.783 -21.724 22.827  1.00 45.82  ? 13  A   C C2    1 
ATOM   1122 N  N3    . A   C 1 13 ? -16.119 -21.890 21.548  1.00 45.63  ? 13  A   C N3    1 
ATOM   1123 C  C4    . A   C 1 13 ? -15.915 -20.755 20.850  1.00 48.41  ? 13  A   C C4    1 
ATOM   1124 P  P     . A   C 1 14 ? -19.189 -24.704 16.533  1.00 54.23  ? 14  A   C P     1 
ATOM   1125 O  OP1   . A   C 1 14 ? -19.835 -23.962 15.420  1.00 58.96  ? 14  A   C OP1   1 
ATOM   1126 O  OP2   . A   C 1 14 ? -20.051 -25.344 17.563  1.00 46.60  ? 14  A   C OP2   1 
ATOM   1127 O  "O5'" . A   C 1 14 ? -18.217 -25.808 15.915  1.00 69.94  ? 14  A   C "O5'" 1 
ATOM   1128 C  "C5'" . A   C 1 14 ? -16.816 -25.596 15.802  1.00 61.00  ? 14  A   C "C5'" 1 
ATOM   1129 C  "C4'" . A   C 1 14 ? -16.268 -26.041 14.464  1.00 55.11  ? 14  A   C "C4'" 1 
ATOM   1130 O  "O4'" . A   C 1 14 ? -17.208 -26.968 13.856  1.00 44.39  ? 14  A   C "O4'" 1 
ATOM   1131 C  "C3'" . A   C 1 14 ? -16.080 -24.971 13.402  1.00 53.06  ? 14  A   C "C3'" 1 
ATOM   1132 O  "O3'" . A   C 1 14 ? -14.880 -24.232 13.520  1.00 47.94  ? 14  A   C "O3'" 1 
ATOM   1133 C  "C2'" . A   C 1 14 ? -16.179 -25.744 12.096  1.00 46.32  ? 14  A   C "C2'" 1 
ATOM   1134 O  "O2'" . A   C 1 14 ? -14.944 -26.377 11.793  1.00 52.94  ? 14  A   C "O2'" 1 
ATOM   1135 C  "C1'" . A   C 1 14 ? -17.189 -26.826 12.452  1.00 32.76  ? 14  A   C "C1'" 1 
ATOM   1136 N  N9    . A   C 1 14 ? -18.546 -26.488 11.990  1.00 26.96  ? 14  A   C N9    1 
ATOM   1137 C  C8    . A   C 1 14 ? -19.681 -26.312 12.743  1.00 33.67  ? 14  A   C C8    1 
ATOM   1138 N  N7    . A   C 1 14 ? -20.749 -26.048 12.028  1.00 35.32  ? 14  A   C N7    1 
ATOM   1139 C  C5    . A   C 1 14 ? -20.282 -26.069 10.724  1.00 16.90  ? 14  A   C C5    1 
ATOM   1140 C  C6    . A   C 1 14 ? -20.924 -25.864 9.499   1.00 25.84  ? 14  A   C C6    1 
ATOM   1141 N  N6    . A   C 1 14 ? -22.226 -25.586 9.411   1.00 23.66  ? 14  A   C N6    1 
ATOM   1142 N  N1    . A   C 1 14 ? -20.179 -25.957 8.371   1.00 29.75  ? 14  A   C N1    1 
ATOM   1143 C  C2    . A   C 1 14 ? -18.872 -26.236 8.484   1.00 31.32  ? 14  A   C C2    1 
ATOM   1144 N  N3    . A   C 1 14 ? -18.155 -26.450 9.586   1.00 28.93  ? 14  A   C N3    1 
ATOM   1145 C  C4    . A   C 1 14 ? -18.934 -26.362 10.681  1.00 21.89  ? 14  A   C C4    1 
ATOM   1146 P  P     . G   C 1 15 ? -14.925 -22.722 12.995  1.00 34.23  ? 15  G   C P     1 
ATOM   1147 O  OP1   . G   C 1 15 ? -14.532 -21.843 14.126  1.00 41.48  ? 15  G   C OP1   1 
ATOM   1148 O  OP2   . G   C 1 15 ? -16.249 -22.522 12.345  1.00 33.11  ? 15  G   C OP2   1 
ATOM   1149 O  "O5'" . G   C 1 15 ? -13.759 -22.605 11.917  1.00 21.86  ? 15  G   C "O5'" 1 
ATOM   1150 C  "C5'" . G   C 1 15 ? -12.513 -23.255 12.100  1.00 22.12  ? 15  G   C "C5'" 1 
ATOM   1151 C  "C4'" . G   C 1 15 ? -11.836 -23.682 10.818  1.00 42.13  ? 15  G   C "C4'" 1 
ATOM   1152 O  "O4'" . G   C 1 15 ? -12.668 -24.676 10.149  1.00 44.75  ? 15  G   C "O4'" 1 
ATOM   1153 C  "C3'" . G   C 1 15 ? -11.665 -22.586 9.767   1.00 53.37  ? 15  G   C "C3'" 1 
ATOM   1154 O  "O3'" . G   C 1 15 ? -10.608 -21.633 9.951   1.00 13.72  ? 15  G   C "O3'" 1 
ATOM   1155 C  "C2'" . G   C 1 15 ? -11.611 -23.390 8.458   1.00 45.76  ? 15  G   C "C2'" 1 
ATOM   1156 O  "O2'" . G   C 1 15 ? -10.351 -24.017 8.294   1.00 47.05  ? 15  G   C "O2'" 1 
ATOM   1157 C  "C1'" . G   C 1 15 ? -12.568 -24.534 8.745   1.00 28.19  ? 15  G   C "C1'" 1 
ATOM   1158 N  N9    . G   C 1 15 ? -13.890 -24.186 8.189   1.00 16.56  ? 15  G   C N9    1 
ATOM   1159 C  C8    . G   C 1 15 ? -14.988 -23.739 8.878   1.00 21.49  ? 15  G   C C8    1 
ATOM   1160 N  N7    . G   C 1 15 ? -16.011 -23.482 8.104   1.00 28.80  ? 15  G   C N7    1 
ATOM   1161 C  C5    . G   C 1 15 ? -15.568 -23.764 6.816   1.00 21.00  ? 15  G   C C5    1 
ATOM   1162 C  C6    . G   C 1 15 ? -16.239 -23.672 5.559   1.00 17.42  ? 15  G   C C6    1 
ATOM   1163 O  O6    . G   C 1 15 ? -17.401 -23.315 5.307   1.00 19.20  ? 15  G   C O6    1 
ATOM   1164 N  N1    . G   C 1 15 ? -15.419 -24.055 4.510   1.00 13.87  ? 15  G   C N1    1 
ATOM   1165 C  C2    . G   C 1 15 ? -14.123 -24.473 4.641   1.00 26.41  ? 15  G   C C2    1 
ATOM   1166 N  N2    . G   C 1 15 ? -13.506 -24.797 3.492   1.00 15.62  ? 15  G   C N2    1 
ATOM   1167 N  N3    . G   C 1 15 ? -13.482 -24.562 5.804   1.00 29.65  ? 15  G   C N3    1 
ATOM   1168 C  C4    . G   C 1 15 ? -14.261 -24.208 6.853   1.00 21.35  ? 15  G   C C4    1 
ATOM   1169 P  P     . G   C 1 16 ? -9.068  -21.830 9.559   1.00 59.10  ? 16  G   C P     1 
ATOM   1170 O  OP1   . G   C 1 16 ? -8.667  -23.210 9.919   1.00 72.66  ? 16  G   C OP1   1 
ATOM   1171 O  OP2   . G   C 1 16 ? -8.341  -20.647 10.088  1.00 61.51  ? 16  G   C OP2   1 
ATOM   1172 O  "O5'" . G   C 1 16 ? -8.991  -21.687 7.980   1.00 19.22  ? 16  G   C "O5'" 1 
ATOM   1173 C  "C5'" . G   C 1 16 ? -8.090  -22.532 7.277   1.00 31.42  ? 16  G   C "C5'" 1 
ATOM   1174 C  "C4'" . G   C 1 16 ? -8.122  -22.360 5.784   1.00 25.19  ? 16  G   C "C4'" 1 
ATOM   1175 O  "O4'" . G   C 1 16 ? -9.479  -22.578 5.293   1.00 19.28  ? 16  G   C "O4'" 1 
ATOM   1176 C  "C3'" . G   C 1 16 ? -7.715  -20.983 5.282   1.00 23.35  ? 16  G   C "C3'" 1 
ATOM   1177 O  "O3'" . G   C 1 16 ? -7.141  -21.146 3.994   1.00 31.72  ? 16  G   C "O3'" 1 
ATOM   1178 C  "C2'" . G   C 1 16 ? -9.060  -20.280 5.152   1.00 15.18  ? 16  G   C "C2'" 1 
ATOM   1179 O  "O2'" . G   C 1 16 ? -9.059  -19.167 4.286   1.00 27.13  ? 16  G   C "O2'" 1 
ATOM   1180 C  "C1'" . G   C 1 16 ? -9.933  -21.414 4.624   1.00 13.96  ? 16  G   C "C1'" 1 
ATOM   1181 N  N9    . G   C 1 16 ? -11.370 -21.227 4.871   1.00 21.62  ? 16  G   C N9    1 
ATOM   1182 C  C8    . G   C 1 16 ? -11.966 -20.967 6.079   1.00 12.84  ? 16  G   C C8    1 
ATOM   1183 N  N7    . G   C 1 16 ? -13.261 -20.816 6.003   1.00 13.01  ? 16  G   C N7    1 
ATOM   1184 C  C5    . G   C 1 16 ? -13.550 -20.970 4.657   1.00 14.90  ? 16  G   C C5    1 
ATOM   1185 C  C6    . G   C 1 16 ? -14.798 -20.908 3.978   1.00 16.68  ? 16  G   C C6    1 
ATOM   1186 O  O6    . G   C 1 16 ? -15.929 -20.702 4.432   1.00 22.89  ? 16  G   C O6    1 
ATOM   1187 N  N1    . G   C 1 16 ? -14.653 -21.117 2.618   1.00 13.79  ? 16  G   C N1    1 
ATOM   1188 C  C2    . G   C 1 16 ? -13.465 -21.360 1.986   1.00 19.97  ? 16  G   C C2    1 
ATOM   1189 N  N2    . G   C 1 16 ? -13.568 -21.537 0.661   1.00 12.15  ? 16  G   C N2    1 
ATOM   1190 N  N3    . G   C 1 16 ? -12.288 -21.419 2.602   1.00 12.29  ? 16  G   C N3    1 
ATOM   1191 C  C4    . G   C 1 16 ? -12.397 -21.215 3.937   1.00 16.02  ? 16  G   C C4    1 
ATOM   1192 P  P     . A   C 1 17 ? -5.944  -20.187 3.522   1.00 32.52  ? 17  A   C P     1 
ATOM   1193 O  OP1   . A   C 1 17 ? -5.107  -20.949 2.559   1.00 39.34  ? 17  A   C OP1   1 
ATOM   1194 O  OP2   . A   C 1 17 ? -5.331  -19.603 4.745   1.00 17.39  ? 17  A   C OP2   1 
ATOM   1195 O  "O5'" . A   C 1 17 ? -6.670  -18.994 2.759   1.00 32.31  ? 17  A   C "O5'" 1 
ATOM   1196 C  "C5'" . A   C 1 17 ? -7.314  -19.253 1.518   1.00 28.31  ? 17  A   C "C5'" 1 
ATOM   1197 C  "C4'" . A   C 1 17 ? -7.668  -17.993 0.771   1.00 26.94  ? 17  A   C "C4'" 1 
ATOM   1198 O  "O4'" . A   C 1 17 ? -8.808  -17.343 1.397   1.00 19.70  ? 17  A   C "O4'" 1 
ATOM   1199 C  "C3'" . A   C 1 17 ? -6.559  -16.941 0.697   1.00 30.06  ? 17  A   C "C3'" 1 
ATOM   1200 O  "O3'" . A   C 1 17 ? -6.619  -16.262 -0.561  1.00 38.05  ? 17  A   C "O3'" 1 
ATOM   1201 C  "C2'" . A   C 1 17 ? -6.967  -15.962 1.798   1.00 24.04  ? 17  A   C "C2'" 1 
ATOM   1202 O  "O2'" . A   C 1 17 ? -6.462  -14.655 1.630   1.00 27.23  ? 17  A   C "O2'" 1 
ATOM   1203 C  "C1'" . A   C 1 17 ? -8.486  -15.996 1.666   1.00 16.35  ? 17  A   C "C1'" 1 
ATOM   1204 N  N9    . A   C 1 17 ? -9.243  -15.570 2.846   1.00 15.11  ? 17  A   C N9    1 
ATOM   1205 C  C8    . A   C 1 17 ? -8.869  -15.483 4.161   1.00 19.70  ? 17  A   C C8    1 
ATOM   1206 N  N7    . A   C 1 17 ? -9.832  -15.069 4.956   1.00 16.78  ? 17  A   C N7    1 
ATOM   1207 C  C5    . A   C 1 17 ? -10.914 -14.876 4.110   1.00 16.35  ? 17  A   C C5    1 
ATOM   1208 C  C6    . A   C 1 17 ? -12.240 -14.443 4.328   1.00 27.95  ? 17  A   C C6    1 
ATOM   1209 N  N6    . A   C 1 17 ? -12.742 -14.102 5.526   1.00 11.30  ? 17  A   C N6    1 
ATOM   1210 N  N1    . A   C 1 17 ? -13.050 -14.359 3.248   1.00 10.96  ? 17  A   C N1    1 
ATOM   1211 C  C2    . A   C 1 17 ? -12.565 -14.694 2.053   1.00 10.71  ? 17  A   C C2    1 
ATOM   1212 N  N3    . A   C 1 17 ? -11.347 -15.115 1.727   1.00 10.53  ? 17  A   C N3    1 
ATOM   1213 C  C4    . A   C 1 17 ? -10.560 -15.184 2.812   1.00 15.18  ? 17  A   C C4    1 
ATOM   1214 P  P     . G   C 1 18 ? -6.808  -17.060 -1.951  1.00 38.13  ? 18  G   C P     1 
ATOM   1215 O  OP1   . G   C 1 18 ? -6.392  -18.486 -1.857  1.00 41.07  ? 18  G   C OP1   1 
ATOM   1216 O  OP2   . G   C 1 18 ? -6.156  -16.227 -2.992  1.00 31.01  ? 18  G   C OP2   1 
ATOM   1217 O  "O5'" . G   C 1 18 ? -8.378  -16.948 -2.211  1.00 33.54  ? 18  G   C "O5'" 1 
ATOM   1218 C  "C5'" . G   C 1 18 ? -9.009  -17.670 -3.260  1.00 30.87  ? 18  G   C "C5'" 1 
ATOM   1219 C  "C4'" . G   C 1 18 ? -9.529  -19.002 -2.780  1.00 31.92  ? 18  G   C "C4'" 1 
ATOM   1220 O  "O4'" . G   C 1 18 ? -10.471 -18.803 -1.690  1.00 32.79  ? 18  G   C "O4'" 1 
ATOM   1221 C  "C3'" . G   C 1 18 ? -10.252 -19.843 -3.840  1.00 35.08  ? 18  G   C "C3'" 1 
ATOM   1222 O  "O3'" . G   C 1 18 ? -9.842  -21.203 -3.720  1.00 36.45  ? 18  G   C "O3'" 1 
ATOM   1223 C  "C2'" . G   C 1 18 ? -11.723 -19.709 -3.446  1.00 38.07  ? 18  G   C "C2'" 1 
ATOM   1224 O  "O2'" . G   C 1 18 ? -12.539 -20.798 -3.818  1.00 48.10  ? 18  G   C "O2'" 1 
ATOM   1225 C  "C1'" . G   C 1 18 ? -11.628 -19.571 -1.932  1.00 31.72  ? 18  G   C "C1'" 1 
ATOM   1226 N  N9    . G   C 1 18 ? -12.793 -18.932 -1.310  1.00 18.13  ? 18  G   C N9    1 
ATOM   1227 C  C8    . G   C 1 18 ? -13.972 -18.627 -1.942  1.00 20.08  ? 18  G   C C8    1 
ATOM   1228 N  N7    . G   C 1 18 ? -14.864 -18.087 -1.159  1.00 15.59  ? 18  G   C N7    1 
ATOM   1229 C  C5    . G   C 1 18 ? -14.237 -18.044 0.072   1.00 19.95  ? 18  G   C C5    1 
ATOM   1230 C  C6    . G   C 1 18 ? -14.724 -17.563 1.308   1.00 22.94  ? 18  G   C C6    1 
ATOM   1231 O  O6    . G   C 1 18 ? -15.830 -17.068 1.546   1.00 27.06  ? 18  G   C O6    1 
ATOM   1232 N  N1    . G   C 1 18 ? -13.777 -17.701 2.315   1.00 19.35  ? 18  G   C N1    1 
ATOM   1233 C  C2    . G   C 1 18 ? -12.523 -18.233 2.145   1.00 18.92  ? 18  G   C C2    1 
ATOM   1234 N  N2    . G   C 1 18 ? -11.754 -18.277 3.238   1.00 23.22  ? 18  G   C N2    1 
ATOM   1235 N  N3    . G   C 1 18 ? -12.054 -18.690 0.996   1.00 19.31  ? 18  G   C N3    1 
ATOM   1236 C  C4    . G   C 1 18 ? -12.960 -18.562 0.004   1.00 17.89  ? 18  G   C C4    1 
ATOM   1237 P  P     . U   C 1 19 ? -8.728  -21.785 -4.722  1.00 67.53  ? 19  U   C P     1 
ATOM   1238 O  OP1   . U   C 1 19 ? -7.430  -21.111 -4.457  1.00 59.69  ? 19  U   C OP1   1 
ATOM   1239 O  OP2   . U   C 1 19 ? -9.318  -21.710 -6.084  1.00 63.02  ? 19  U   C OP2   1 
ATOM   1240 O  "O5'" . U   C 1 19 ? -8.584  -23.321 -4.314  1.00 63.71  ? 19  U   C "O5'" 1 
ATOM   1241 C  "C5'" . U   C 1 19 ? -9.630  -24.261 -4.526  1.00 55.14  ? 19  U   C "C5'" 1 
ATOM   1242 C  "C4'" . U   C 1 19 ? -9.260  -25.646 -4.040  1.00 53.05  ? 19  U   C "C4'" 1 
ATOM   1243 O  "O4'" . U   C 1 19 ? -8.036  -26.084 -4.710  1.00 62.42  ? 19  U   C "O4'" 1 
ATOM   1244 C  "C3'" . U   C 1 19 ? -8.972  -25.771 -2.544  1.00 52.21  ? 19  U   C "C3'" 1 
ATOM   1245 O  "O3'" . U   C 1 19 ? -9.352  -27.068 -2.087  1.00 45.03  ? 19  U   C "O3'" 1 
ATOM   1246 C  "C2'" . U   C 1 19 ? -7.462  -25.649 -2.464  1.00 58.20  ? 19  U   C "C2'" 1 
ATOM   1247 O  "O2'" . U   C 1 19 ? -6.895  -26.238 -1.313  1.00 56.80  ? 19  U   C "O2'" 1 
ATOM   1248 C  "C1'" . U   C 1 19 ? -7.034  -26.367 -3.737  1.00 62.53  ? 19  U   C "C1'" 1 
ATOM   1249 N  N1    . U   C 1 19 ? -5.685  -26.014 -4.216  1.00 65.63  ? 19  U   C N1    1 
ATOM   1250 C  C2    . U   C 1 19 ? -5.327  -24.717 -4.553  1.00 73.07  ? 19  U   C C2    1 
ATOM   1251 O  O2    . U   C 1 19 ? -6.078  -23.765 -4.538  1.00 75.06  ? 19  U   C O2    1 
ATOM   1252 N  N3    . U   C 1 19 ? -4.022  -24.556 -4.949  1.00 79.75  ? 19  U   C N3    1 
ATOM   1253 C  C4    . U   C 1 19 ? -3.043  -25.523 -5.027  1.00 82.76  ? 19  U   C C4    1 
ATOM   1254 O  O4    . U   C 1 19 ? -1.913  -25.211 -5.405  1.00 84.48  ? 19  U   C O4    1 
ATOM   1255 C  C5    . U   C 1 19 ? -3.476  -26.830 -4.643  1.00 79.09  ? 19  U   C C5    1 
ATOM   1256 C  C6    . U   C 1 19 ? -4.742  -27.016 -4.255  1.00 72.11  ? 19  U   C C6    1 
ATOM   1257 P  P     . G   C 1 20 ? -10.654 -27.232 -1.172  1.00 83.86  ? 20  G   C P     1 
ATOM   1258 O  OP1   . G   C 1 20 ? -10.583 -26.189 -0.116  1.00 86.19  ? 20  G   C OP1   1 
ATOM   1259 O  OP2   . G   C 1 20 ? -10.755 -28.662 -0.784  1.00 86.55  ? 20  G   C OP2   1 
ATOM   1260 O  "O5'" . G   C 1 20 ? -11.891 -26.892 -2.117  1.00 39.88  ? 20  G   C "O5'" 1 
ATOM   1261 C  "C5'" . G   C 1 20 ? -12.321 -27.755 -3.171  1.00 32.27  ? 20  G   C "C5'" 1 
ATOM   1262 C  "C4'" . G   C 1 20 ? -13.661 -27.274 -3.663  1.00 27.33  ? 20  G   C "C4'" 1 
ATOM   1263 O  "O4'" . G   C 1 20 ? -14.524 -27.250 -2.506  1.00 36.34  ? 20  G   C "O4'" 1 
ATOM   1264 C  "C3'" . G   C 1 20 ? -13.669 -25.864 -4.251  1.00 38.00  ? 20  G   C "C3'" 1 
ATOM   1265 O  "O3'" . G   C 1 20 ? -14.139 -25.899 -5.607  1.00 49.35  ? 20  G   C "O3'" 1 
ATOM   1266 C  "C2'" . G   C 1 20 ? -14.627 -25.052 -3.377  1.00 42.07  ? 20  G   C "C2'" 1 
ATOM   1267 O  "O2'" . G   C 1 20 ? -15.565 -24.253 -4.047  1.00 61.94  ? 20  G   C "O2'" 1 
ATOM   1268 C  "C1'" . G   C 1 20 ? -15.300 -26.075 -2.480  1.00 32.12  ? 20  G   C "C1'" 1 
ATOM   1269 N  N9    . G   C 1 20 ? -15.430 -25.578 -1.118  1.00 20.77  ? 20  G   C N9    1 
ATOM   1270 C  C8    . G   C 1 20 ? -14.576 -25.627 -0.048  1.00 19.49  ? 20  G   C C8    1 
ATOM   1271 N  N7    . G   C 1 20 ? -15.066 -24.995 0.987   1.00 25.12  ? 20  G   C N7    1 
ATOM   1272 C  C5    . G   C 1 20 ? -16.280 -24.478 0.543   1.00 22.46  ? 20  G   C C5    1 
ATOM   1273 C  C6    . G   C 1 20 ? -17.267 -23.705 1.197   1.00 28.23  ? 20  G   C C6    1 
ATOM   1274 O  O6    . G   C 1 20 ? -17.258 -23.302 2.362   1.00 41.03  ? 20  G   C O6    1 
ATOM   1275 N  N1    . G   C 1 20 ? -18.339 -23.406 0.359   1.00 26.63  ? 20  G   C N1    1 
ATOM   1276 C  C2    . G   C 1 20 ? -18.448 -23.800 -0.954  1.00 28.05  ? 20  G   C C2    1 
ATOM   1277 N  N2    . G   C 1 20 ? -19.553 -23.416 -1.612  1.00 25.78  ? 20  G   C N2    1 
ATOM   1278 N  N3    . G   C 1 20 ? -17.534 -24.523 -1.576  1.00 17.52  ? 20  G   C N3    1 
ATOM   1279 C  C4    . G   C 1 20 ? -16.491 -24.803 -0.768  1.00 18.26  ? 20  G   C C4    1 
ATOM   1280 P  P     . G   C 1 21 ? -13.635 -24.793 -6.661  1.00 63.06  ? 21  G   C P     1 
ATOM   1281 O  OP1   . G   C 1 21 ? -13.671 -25.448 -7.992  1.00 58.79  ? 21  G   C OP1   1 
ATOM   1282 O  OP2   . G   C 1 21 ? -12.389 -24.164 -6.143  1.00 56.18  ? 21  G   C OP2   1 
ATOM   1283 O  "O5'" . G   C 1 21 ? -14.793 -23.690 -6.644  1.00 34.12  ? 21  G   C "O5'" 1 
ATOM   1284 C  "C5'" . G   C 1 21 ? -16.181 -24.014 -6.748  1.00 35.28  ? 21  G   C "C5'" 1 
ATOM   1285 C  "C4'" . G   C 1 21 ? -17.022 -22.793 -6.432  1.00 41.68  ? 21  G   C "C4'" 1 
ATOM   1286 O  "O4'" . G   C 1 21 ? -17.323 -22.667 -5.013  1.00 38.56  ? 21  G   C "O4'" 1 
ATOM   1287 C  "C3'" . G   C 1 21 ? -16.460 -21.446 -6.882  1.00 44.28  ? 21  G   C "C3'" 1 
ATOM   1288 O  "O3'" . G   C 1 21 ? -17.522 -20.609 -7.322  1.00 58.10  ? 21  G   C "O3'" 1 
ATOM   1289 C  "C2'" . G   C 1 21 ? -15.967 -20.846 -5.564  1.00 30.62  ? 21  G   C "C2'" 1 
ATOM   1290 O  "O2'" . G   C 1 21 ? -15.860 -19.438 -5.554  1.00 26.61  ? 21  G   C "O2'" 1 
ATOM   1291 C  "C1'" . G   C 1 21 ? -17.043 -21.345 -4.600  1.00 33.12  ? 21  G   C "C1'" 1 
ATOM   1292 N  N9    . G   C 1 21 ? -16.712 -21.309 -3.169  1.00 34.58  ? 21  G   C N9    1 
ATOM   1293 C  C8    . G   C 1 21 ? -15.574 -21.707 -2.511  1.00 32.85  ? 21  G   C C8    1 
ATOM   1294 N  N7    . G   C 1 21 ? -15.628 -21.484 -1.222  1.00 25.57  ? 21  G   C N7    1 
ATOM   1295 C  C5    . G   C 1 21 ? -16.858 -20.882 -1.011  1.00 21.99  ? 21  G   C C5    1 
ATOM   1296 C  C6    . G   C 1 21 ? -17.480 -20.411 0.181   1.00 24.04  ? 21  G   C C6    1 
ATOM   1297 O  O6    . G   C 1 21 ? -17.067 -20.421 1.351   1.00 24.12  ? 21  G   C O6    1 
ATOM   1298 N  N1    . G   C 1 21 ? -18.733 -19.876 -0.086  1.00 28.53  ? 21  G   C N1    1 
ATOM   1299 C  C2    . G   C 1 21 ? -19.315 -19.798 -1.324  1.00 21.78  ? 21  G   C C2    1 
ATOM   1300 N  N2    . G   C 1 21 ? -20.531 -19.240 -1.364  1.00 12.65  ? 21  G   C N2    1 
ATOM   1301 N  N3    . G   C 1 21 ? -18.749 -20.230 -2.435  1.00 24.41  ? 21  G   C N3    1 
ATOM   1302 C  C4    . G   C 1 21 ? -17.524 -20.746 -2.209  1.00 27.60  ? 21  G   C C4    1 
ATOM   1303 P  P     . C   C 1 22 ? -17.445 -19.708 -8.640  1.00 44.15  ? 22  C   C P     1 
ATOM   1304 O  OP1   . C   C 1 22 ? -16.060 -19.898 -9.166  1.00 33.01  ? 22  C   C OP1   1 
ATOM   1305 O  OP2   . C   C 1 22 ? -17.957 -18.342 -8.377  1.00 49.12  ? 22  C   C OP2   1 
ATOM   1306 O  "O5'" . C   C 1 22 ? -18.444 -20.380 -9.678  1.00 83.29  ? 22  C   C "O5'" 1 
ATOM   1307 C  "C5'" . C   C 1 22 ? -19.684 -20.980 -9.268  1.00 81.86  ? 22  C   C "C5'" 1 
ATOM   1308 C  "C4'" . C   C 1 22 ? -20.168 -21.853 -10.396 1.00 82.65  ? 22  C   C "C4'" 1 
ATOM   1309 O  "O4'" . C   C 1 22 ? -20.335 -21.091 -11.569 1.00 86.85  ? 22  C   C "O4'" 1 
ATOM   1310 C  "C3'" . C   C 1 22 ? -19.469 -23.166 -10.720 1.00 84.74  ? 22  C   C "C3'" 1 
ATOM   1311 O  "O3'" . C   C 1 22 ? -20.479 -24.096 -10.334 1.00 91.42  ? 22  C   C "O3'" 1 
ATOM   1312 C  "C2'" . C   C 1 22 ? -19.449 -23.199 -12.262 1.00 85.25  ? 22  C   C "C2'" 1 
ATOM   1313 O  "O2'" . C   C 1 22 ? -20.073 -24.326 -12.838 1.00 89.08  ? 22  C   C "O2'" 1 
ATOM   1314 C  "C1'" . C   C 1 22 ? -20.104 -21.861 -12.696 1.00 91.15  ? 22  C   C "C1'" 1 
ATOM   1315 N  N1    . C   C 1 22 ? -19.473 -20.946 -13.626 1.00 92.11  ? 22  C   C N1    1 
ATOM   1316 C  C2    . C   C 1 22 ? -19.564 -21.168 -14.974 1.00 90.90  ? 22  C   C C2    1 
ATOM   1317 O  O2    . C   C 1 22 ? -20.104 -22.211 -15.373 1.00 87.22  ? 22  C   C O2    1 
ATOM   1318 N  N3    . C   C 1 22 ? -19.055 -20.226 -15.795 1.00 96.39  ? 22  C   C N3    1 
ATOM   1319 C  C4    . C   C 1 22 ? -18.508 -19.120 -15.288 1.00 96.52  ? 22  C   C C4    1 
ATOM   1320 N  N4    . C   C 1 22 ? -18.000 -18.208 -16.115 1.00 97.21  ? 22  C   C N4    1 
ATOM   1321 C  C5    . C   C 1 22 ? -18.430 -18.881 -13.899 1.00 93.84  ? 22  C   C C5    1 
ATOM   1322 C  C6    . C   C 1 22 ? -18.956 -19.800 -13.102 1.00 93.46  ? 22  C   C C6    1 
ATOM   1323 P  P     . U   C 1 23 ? -20.543 -25.144 -9.132  1.00 101.01 ? 23  U   C P     1 
ATOM   1324 O  OP1   . U   C 1 23 ? -19.277 -25.201 -8.357  1.00 101.03 ? 23  U   C OP1   1 
ATOM   1325 O  OP2   . U   C 1 23 ? -21.190 -26.389 -9.645  1.00 96.15  ? 23  U   C OP2   1 
ATOM   1326 O  "O5'" . U   C 1 23 ? -21.638 -24.254 -8.387  1.00 155.79 ? 23  U   C "O5'" 1 
ATOM   1327 C  "C5'" . U   C 1 23 ? -22.816 -23.965 -9.150  1.00 155.22 ? 23  U   C "C5'" 1 
ATOM   1328 C  "C4'" . U   C 1 23 ? -23.873 -23.135 -8.463  1.00 156.70 ? 23  U   C "C4'" 1 
ATOM   1329 O  "O4'" . U   C 1 23 ? -23.970 -21.984 -9.341  1.00 157.18 ? 23  U   C "O4'" 1 
ATOM   1330 C  "C3'" . U   C 1 23 ? -25.285 -23.728 -8.381  1.00 159.61 ? 23  U   C "C3'" 1 
ATOM   1331 O  "O3'" . U   C 1 23 ? -25.838 -23.400 -7.105  1.00 160.19 ? 23  U   C "O3'" 1 
ATOM   1332 C  "C2'" . U   C 1 23 ? -26.087 -22.926 -9.411  1.00 161.17 ? 23  U   C "C2'" 1 
ATOM   1333 O  "O2'" . U   C 1 23 ? -27.438 -22.708 -9.063  1.00 163.07 ? 23  U   C "O2'" 1 
ATOM   1334 C  "C1'" . U   C 1 23 ? -25.310 -21.616 -9.502  1.00 159.62 ? 23  U   C "C1'" 1 
ATOM   1335 N  N1    . U   C 1 23 ? -25.439 -20.992 -10.830 1.00 161.51 ? 23  U   C N1    1 
ATOM   1336 C  C2    . U   C 1 23 ? -26.566 -20.235 -11.082 1.00 163.75 ? 23  U   C C2    1 
ATOM   1337 O  O2    . U   C 1 23 ? -27.401 -19.997 -10.227 1.00 163.98 ? 23  U   C O2    1 
ATOM   1338 N  N3    . U   C 1 23 ? -26.647 -19.704 -12.347 1.00 165.67 ? 23  U   C N3    1 
ATOM   1339 C  C4    . U   C 1 23 ? -25.761 -19.890 -13.389 1.00 165.60 ? 23  U   C C4    1 
ATOM   1340 O  O4    . U   C 1 23 ? -25.982 -19.352 -14.477 1.00 165.31 ? 23  U   C O4    1 
ATOM   1341 C  C5    . U   C 1 23 ? -24.641 -20.723 -13.066 1.00 164.04 ? 23  U   C C5    1 
ATOM   1342 C  C6    . U   C 1 23 ? -24.531 -21.242 -11.835 1.00 162.06 ? 23  U   C C6    1 
ATOM   1343 P  P     . G   C 1 24 ? -25.678 -24.368 -5.836  1.00 142.71 ? 24  G   C P     1 
ATOM   1344 O  OP1   . G   C 1 24 ? -24.629 -25.375 -6.138  1.00 141.18 ? 24  G   C OP1   1 
ATOM   1345 O  OP2   . G   C 1 24 ? -27.048 -24.820 -5.480  1.00 137.86 ? 24  G   C OP2   1 
ATOM   1346 O  "O5'" . G   C 1 24 ? -25.175 -23.404 -4.665  1.00 51.36  ? 24  G   C "O5'" 1 
ATOM   1347 C  "C5'" . G   C 1 24 ? -25.653 -22.069 -4.542  1.00 39.89  ? 24  G   C "C5'" 1 
ATOM   1348 C  "C4'" . G   C 1 24 ? -26.294 -21.825 -3.193  1.00 42.19  ? 24  G   C "C4'" 1 
ATOM   1349 O  "O4'" . G   C 1 24 ? -25.826 -22.829 -2.247  1.00 47.97  ? 24  G   C "O4'" 1 
ATOM   1350 C  "C3'" . G   C 1 24 ? -25.964 -20.493 -2.524  1.00 40.39  ? 24  G   C "C3'" 1 
ATOM   1351 O  "O3'" . G   C 1 24 ? -26.778 -19.388 -2.857  1.00 33.95  ? 24  G   C "O3'" 1 
ATOM   1352 C  "C2'" . G   C 1 24 ? -26.061 -20.801 -1.039  1.00 42.20  ? 24  G   C "C2'" 1 
ATOM   1353 O  "O2'" . G   C 1 24 ? -27.417 -20.761 -0.618  1.00 44.75  ? 24  G   C "O2'" 1 
ATOM   1354 C  "C1'" . G   C 1 24 ? -25.595 -22.241 -0.984  1.00 41.51  ? 24  G   C "C1'" 1 
ATOM   1355 N  N9    . G   C 1 24 ? -24.159 -22.305 -0.648  1.00 31.16  ? 24  G   C N9    1 
ATOM   1356 C  C8    . G   C 1 24 ? -23.090 -22.514 -1.485  1.00 25.60  ? 24  G   C C8    1 
ATOM   1357 N  N7    . G   C 1 24 ? -21.945 -22.525 -0.853  1.00 31.70  ? 24  G   C N7    1 
ATOM   1358 C  C5    . G   C 1 24 ? -22.279 -22.318 0.480   1.00 31.06  ? 24  G   C C5    1 
ATOM   1359 C  C6    . G   C 1 24 ? -21.460 -22.231 1.636   1.00 32.15  ? 24  G   C C6    1 
ATOM   1360 O  O6    . G   C 1 24 ? -20.229 -22.327 1.717   1.00 33.88  ? 24  G   C O6    1 
ATOM   1361 N  N1    . G   C 1 24 ? -22.215 -22.019 2.784   1.00 32.74  ? 24  G   C N1    1 
ATOM   1362 C  C2    . G   C 1 24 ? -23.581 -21.898 2.821   1.00 28.44  ? 24  G   C C2    1 
ATOM   1363 N  N2    . G   C 1 24 ? -24.119 -21.691 4.034   1.00 24.93  ? 24  G   C N2    1 
ATOM   1364 N  N3    . G   C 1 24 ? -24.355 -21.975 1.750   1.00 25.08  ? 24  G   C N3    1 
ATOM   1365 C  C4    . G   C 1 24 ? -23.644 -22.204 0.625   1.00 26.75  ? 24  G   C C4    1 
ATOM   1366 P  P     . G   C 1 25 ? -26.049 -18.055 -3.371  1.00 52.40  ? 25  G   C P     1 
ATOM   1367 O  OP1   . G   C 1 25 ? -26.969 -17.386 -4.329  1.00 44.89  ? 25  G   C OP1   1 
ATOM   1368 O  OP2   . G   C 1 25 ? -24.684 -18.423 -3.829  1.00 57.67  ? 25  G   C OP2   1 
ATOM   1369 O  "O5'" . G   C 1 25 ? -25.976 -17.149 -2.052  1.00 64.51  ? 25  G   C "O5'" 1 
ATOM   1370 C  "C5'" . G   C 1 25 ? -27.149 -16.627 -1.470  1.00 53.32  ? 25  G   C "C5'" 1 
ATOM   1371 C  "C4'" . G   C 1 25 ? -27.124 -16.500 0.043   1.00 49.62  ? 25  G   C "C4'" 1 
ATOM   1372 O  "O4'" . G   C 1 25 ? -26.614 -17.746 0.613   1.00 43.92  ? 25  G   C "O4'" 1 
ATOM   1373 C  "C3'" . G   C 1 25 ? -26.267 -15.425 0.719   1.00 50.74  ? 25  G   C "C3'" 1 
ATOM   1374 O  "O3'" . G   C 1 25 ? -26.912 -14.166 0.730   1.00 57.07  ? 25  G   C "O3'" 1 
ATOM   1375 C  "C2'" . G   C 1 25 ? -26.012 -15.992 2.106   1.00 44.06  ? 25  G   C "C2'" 1 
ATOM   1376 O  "O2'" . G   C 1 25 ? -27.142 -15.792 2.939   1.00 49.28  ? 25  G   C "O2'" 1 
ATOM   1377 C  "C1'" . G   C 1 25 ? -25.889 -17.481 1.805   1.00 38.58  ? 25  G   C "C1'" 1 
ATOM   1378 N  N9    . G   C 1 25 ? -24.474 -17.886 1.635   1.00 35.73  ? 25  G   C N9    1 
ATOM   1379 C  C8    . G   C 1 25 ? -23.800 -18.067 0.451   1.00 38.67  ? 25  G   C C8    1 
ATOM   1380 N  N7    . G   C 1 25 ? -22.555 -18.442 0.604   1.00 31.86  ? 25  G   C N7    1 
ATOM   1381 C  C5    . G   C 1 25 ? -22.384 -18.529 1.974   1.00 20.72  ? 25  G   C C5    1 
ATOM   1382 C  C6    . G   C 1 25 ? -21.237 -18.893 2.729   1.00 18.71  ? 25  G   C C6    1 
ATOM   1383 O  O6    . G   C 1 25 ? -20.114 -19.221 2.327   1.00 17.43  ? 25  G   C O6    1 
ATOM   1384 N  N1    . G   C 1 25 ? -21.494 -18.855 4.096   1.00 25.47  ? 25  G   C N1    1 
ATOM   1385 C  C2    . G   C 1 25 ? -22.702 -18.509 4.658   1.00 35.05  ? 25  G   C C2    1 
ATOM   1386 N  N2    . G   C 1 25 ? -22.758 -18.527 6.000   1.00 28.58  ? 25  G   C N2    1 
ATOM   1387 N  N3    . G   C 1 25 ? -23.778 -18.170 3.958   1.00 36.41  ? 25  G   C N3    1 
ATOM   1388 C  C4    . G   C 1 25 ? -23.561 -18.209 2.626   1.00 28.40  ? 25  G   C C4    1 
ATOM   1389 P  P     . G   C 1 26 ? -26.178 -12.898 0.068   1.00 73.53  ? 26  G   C P     1 
ATOM   1390 O  OP1   . G   C 1 26 ? -25.087 -12.484 0.987   1.00 70.81  ? 26  G   C OP1   1 
ATOM   1391 O  OP2   . G   C 1 26 ? -27.239 -11.935 -0.321  1.00 72.37  ? 26  G   C OP2   1 
ATOM   1392 O  "O5'" . G   C 1 26 ? -25.519 -13.412 -1.281  1.00 19.99  ? 26  G   C "O5'" 1 
ATOM   1393 C  "C5'" . G   C 1 26 ? -25.250 -12.540 -2.375  1.00 27.59  ? 26  G   C "C5'" 1 
ATOM   1394 C  "C4'" . G   C 1 26 ? -24.140 -13.136 -3.211  1.00 32.03  ? 26  G   C "C4'" 1 
ATOM   1395 O  "O4'" . G   C 1 26 ? -22.911 -13.230 -2.447  1.00 28.76  ? 26  G   C "O4'" 1 
ATOM   1396 C  "C3'" . G   C 1 26 ? -24.426 -14.519 -3.770  1.00 37.69  ? 26  G   C "C3'" 1 
ATOM   1397 O  "O3'" . G   C 1 26 ? -23.886 -14.650 -5.072  1.00 45.79  ? 26  G   C "O3'" 1 
ATOM   1398 C  "C2'" . G   C 1 26 ? -23.616 -15.436 -2.845  1.00 33.16  ? 26  G   C "C2'" 1 
ATOM   1399 O  "O2'" . G   C 1 26 ? -23.191 -16.640 -3.448  1.00 35.00  ? 26  G   C "O2'" 1 
ATOM   1400 C  "C1'" . G   C 1 26 ? -22.424 -14.555 -2.475  1.00 28.90  ? 26  G   C "C1'" 1 
ATOM   1401 N  N9    . G   C 1 26 ? -21.821 -14.851 -1.170  1.00 29.73  ? 26  G   C N9    1 
ATOM   1402 C  C8    . G   C 1 26 ? -22.336 -14.550 0.070   1.00 28.24  ? 26  G   C C8    1 
ATOM   1403 N  N7    . G   C 1 26 ? -21.572 -14.937 1.057   1.00 20.15  ? 26  G   C N7    1 
ATOM   1404 C  C5    . G   C 1 26 ? -20.483 -15.531 0.435   1.00 23.18  ? 26  G   C C5    1 
ATOM   1405 C  C6    . G   C 1 26 ? -19.327 -16.134 0.996   1.00 25.55  ? 26  G   C C6    1 
ATOM   1406 O  O6    . G   C 1 26 ? -19.025 -16.267 2.189   1.00 23.76  ? 26  G   C O6    1 
ATOM   1407 N  N1    . G   C 1 26 ? -18.473 -16.611 0.011   1.00 17.40  ? 26  G   C N1    1 
ATOM   1408 C  C2    . G   C 1 26 ? -18.702 -16.525 -1.337  1.00 20.49  ? 26  G   C C2    1 
ATOM   1409 N  N2    . G   C 1 26 ? -17.751 -17.053 -2.115  1.00 28.57  ? 26  G   C N2    1 
ATOM   1410 N  N3    . G   C 1 26 ? -19.773 -15.965 -1.880  1.00 19.76  ? 26  G   C N3    1 
ATOM   1411 C  C4    . G   C 1 26 ? -20.622 -15.495 -0.939  1.00 25.26  ? 26  G   C C4    1 
ATOM   1412 P  P     . U   C 1 27 ? -24.742 -14.383 -6.393  1.00 68.27  ? 27  U   C P     1 
ATOM   1413 O  OP1   . U   C 1 27 ? -25.159 -12.957 -6.395  1.00 59.77  ? 27  U   C OP1   1 
ATOM   1414 O  OP2   . U   C 1 27 ? -25.744 -15.465 -6.585  1.00 73.73  ? 27  U   C OP2   1 
ATOM   1415 O  "O5'" . U   C 1 27 ? -23.603 -14.536 -7.481  1.00 79.25  ? 27  U   C "O5'" 1 
ATOM   1416 C  "C5'" . U   C 1 27 ? -23.141 -15.865 -7.681  1.00 87.80  ? 27  U   C "C5'" 1 
ATOM   1417 C  "C4'" . U   C 1 27 ? -21.671 -16.007 -7.968  1.00 96.24  ? 27  U   C "C4'" 1 
ATOM   1418 O  "O4'" . U   C 1 27 ? -21.528 -16.850 -9.132  1.00 102.66 ? 27  U   C "O4'" 1 
ATOM   1419 C  "C3'" . U   C 1 27 ? -20.874 -14.739 -8.255  1.00 99.40  ? 27  U   C "C3'" 1 
ATOM   1420 O  "O3'" . U   C 1 27 ? -19.566 -15.007 -7.749  1.00 97.23  ? 27  U   C "O3'" 1 
ATOM   1421 C  "C2'" . U   C 1 27 ? -20.873 -14.697 -9.779  1.00 105.32 ? 27  U   C "C2'" 1 
ATOM   1422 O  "O2'" . U   C 1 27 ? -19.809 -13.963 -10.348 1.00 103.83 ? 27  U   C "O2'" 1 
ATOM   1423 C  "C1'" . U   C 1 27 ? -20.781 -16.179 -10.117 1.00 109.30 ? 27  U   C "C1'" 1 
ATOM   1424 N  N1    . U   C 1 27 ? -21.417 -16.559 -11.375 1.00 119.30 ? 27  U   C N1    1 
ATOM   1425 C  C2    . U   C 1 27 ? -20.600 -16.955 -12.386 1.00 126.95 ? 27  U   C C2    1 
ATOM   1426 O  O2    . U   C 1 27 ? -19.395 -16.849 -12.264 1.00 132.03 ? 27  U   C O2    1 
ATOM   1427 N  N3    . U   C 1 27 ? -21.255 -17.353 -13.526 1.00 126.51 ? 27  U   C N3    1 
ATOM   1428 C  C4    . U   C 1 27 ? -22.625 -17.454 -13.694 1.00 126.88 ? 27  U   C C4    1 
ATOM   1429 O  O4    . U   C 1 27 ? -23.079 -17.842 -14.771 1.00 130.75 ? 27  U   C O4    1 
ATOM   1430 C  C5    . U   C 1 27 ? -23.405 -17.081 -12.555 1.00 123.30 ? 27  U   C C5    1 
ATOM   1431 C  C6    . U   C 1 27 ? -22.783 -16.677 -11.448 1.00 120.54 ? 27  U   C C6    1 
ATOM   1432 P  P     . U   C 1 28 ? -18.415 -13.909 -7.521  1.00 48.59  ? 28  U   C P     1 
ATOM   1433 O  OP1   . U   C 1 28 ? -19.009 -12.566 -7.761  1.00 45.13  ? 28  U   C OP1   1 
ATOM   1434 O  OP2   . U   C 1 28 ? -17.186 -14.320 -8.245  1.00 50.55  ? 28  U   C OP2   1 
ATOM   1435 O  "O5'" . U   C 1 28 ? -18.113 -14.075 -5.966  1.00 49.28  ? 28  U   C "O5'" 1 
ATOM   1436 C  "C5'" . U   C 1 28 ? -19.104 -13.731 -5.008  1.00 40.44  ? 28  U   C "C5'" 1 
ATOM   1437 C  "C4'" . U   C 1 28 ? -18.477 -13.203 -3.743  1.00 30.28  ? 28  U   C "C4'" 1 
ATOM   1438 O  "O4'" . U   C 1 28 ? -17.471 -14.144 -3.275  1.00 21.21  ? 28  U   C "O4'" 1 
ATOM   1439 C  "C3'" . U   C 1 28 ? -17.787 -11.840 -3.839  1.00 32.29  ? 28  U   C "C3'" 1 
ATOM   1440 O  "O3'" . U   C 1 28 ? -17.949 -11.139 -2.609  1.00 36.75  ? 28  U   C "O3'" 1 
ATOM   1441 C  "C2'" . U   C 1 28 ? -16.319 -12.230 -3.978  1.00 29.95  ? 28  U   C "C2'" 1 
ATOM   1442 O  "O2'" . U   C 1 28 ? -15.397 -11.239 -3.577  1.00 30.55  ? 28  U   C "O2'" 1 
ATOM   1443 C  "C1'" . U   C 1 28 ? -16.251 -13.465 -3.081  1.00 28.87  ? 28  U   C "C1'" 1 
ATOM   1444 N  N1    . U   C 1 28 ? -15.142 -14.374 -3.392  1.00 31.55  ? 28  U   C N1    1 
ATOM   1445 C  C2    . U   C 1 28 ? -14.270 -14.666 -2.366  1.00 24.99  ? 28  U   C C2    1 
ATOM   1446 O  O2    . U   C 1 28 ? -14.394 -14.216 -1.242  1.00 18.07  ? 28  U   C O2    1 
ATOM   1447 N  N3    . U   C 1 28 ? -13.241 -15.499 -2.711  1.00 31.42  ? 28  U   C N3    1 
ATOM   1448 C  C4    . U   C 1 28 ? -13.014 -16.056 -3.951  1.00 30.75  ? 28  U   C C4    1 
ATOM   1449 O  O4    . U   C 1 28 ? -12.043 -16.790 -4.106  1.00 37.08  ? 28  U   C O4    1 
ATOM   1450 C  C5    . U   C 1 28 ? -13.962 -15.705 -4.957  1.00 27.82  ? 28  U   C C5    1 
ATOM   1451 C  C6    . U   C 1 28 ? -14.972 -14.889 -4.652  1.00 32.08  ? 28  U   C C6    1 
ATOM   1452 P  P     . G   C 1 29 ? -17.755 -9.544  -2.550  1.00 34.62  ? 29  G   C P     1 
ATOM   1453 O  OP1   . G   C 1 29 ? -17.538 -9.035  -3.927  1.00 31.77  ? 29  G   C OP1   1 
ATOM   1454 O  OP2   . G   C 1 29 ? -16.760 -9.248  -1.490  1.00 17.75  ? 29  G   C OP2   1 
ATOM   1455 O  "O5'" . G   C 1 29 ? -19.147 -9.017  -2.003  1.00 26.15  ? 29  G   C "O5'" 1 
ATOM   1456 C  "C5'" . G   C 1 29 ? -20.326 -9.168  -2.774  1.00 20.91  ? 29  G   C "C5'" 1 
ATOM   1457 C  "C4'" . G   C 1 29 ? -21.507 -9.406  -1.879  1.00 18.21  ? 29  G   C "C4'" 1 
ATOM   1458 O  "O4'" . G   C 1 29 ? -21.509 -10.785 -1.431  1.00 26.68  ? 29  G   C "O4'" 1 
ATOM   1459 C  "C3'" . G   C 1 29 ? -21.516 -8.584  -0.601  1.00 23.15  ? 29  G   C "C3'" 1 
ATOM   1460 O  "O3'" . G   C 1 29 ? -22.059 -7.293  -0.807  1.00 23.63  ? 29  G   C "O3'" 1 
ATOM   1461 C  "C2'" . G   C 1 29 ? -22.324 -9.448  0.359   1.00 34.07  ? 29  G   C "C2'" 1 
ATOM   1462 O  "O2'" . G   C 1 29 ? -23.719 -9.265  0.154   1.00 43.24  ? 29  G   C "O2'" 1 
ATOM   1463 C  "C1'" . G   C 1 29 ? -21.942 -10.861 -0.094  1.00 31.80  ? 29  G   C "C1'" 1 
ATOM   1464 N  N9    . G   C 1 29 ? -20.862 -11.459 0.712   1.00 18.27  ? 29  G   C N9    1 
ATOM   1465 C  C8    . G   C 1 29 ? -19.668 -11.968 0.251   1.00 18.16  ? 29  G   C C8    1 
ATOM   1466 N  N7    . G   C 1 29 ? -18.910 -12.445 1.201   1.00 18.13  ? 29  G   C N7    1 
ATOM   1467 C  C5    . G   C 1 29 ? -19.657 -12.248 2.357   1.00 26.30  ? 29  G   C C5    1 
ATOM   1468 C  C6    . G   C 1 29 ? -19.368 -12.558 3.711   1.00 24.21  ? 29  G   C C6    1 
ATOM   1469 O  O6    . G   C 1 29 ? -18.367 -13.084 4.194   1.00 26.15  ? 29  G   C O6    1 
ATOM   1470 N  N1    . G   C 1 29 ? -20.397 -12.184 4.563   1.00 28.04  ? 29  G   C N1    1 
ATOM   1471 C  C2    . G   C 1 29 ? -21.567 -11.590 4.173   1.00 29.82  ? 29  G   C C2    1 
ATOM   1472 N  N2    . G   C 1 29 ? -22.434 -11.312 5.156   1.00 33.06  ? 29  G   C N2    1 
ATOM   1473 N  N3    . G   C 1 29 ? -21.859 -11.292 2.918   1.00 25.27  ? 29  G   C N3    1 
ATOM   1474 C  C4    . G   C 1 29 ? -20.868 -11.648 2.070   1.00 27.17  ? 29  G   C C4    1 
ATOM   1475 P  P     . C   C 1 30 ? -21.306 -5.989  -0.251  1.00 38.24  ? 30  C   C P     1 
ATOM   1476 O  OP1   . C   C 1 30 ? -22.175 -4.812  -0.519  1.00 37.06  ? 30  C   C OP1   1 
ATOM   1477 O  OP2   . C   C 1 30 ? -19.910 -6.014  -0.759  1.00 35.12  ? 30  C   C OP2   1 
ATOM   1478 O  "O5'" . C   C 1 30 ? -21.267 -6.197  1.325   1.00 18.17  ? 30  C   C "O5'" 1 
ATOM   1479 C  "C5'" . C   C 1 30 ? -22.465 -6.295  2.077   1.00 18.32  ? 30  C   C "C5'" 1 
ATOM   1480 C  "C4'" . C   C 1 30 ? -22.173 -6.478  3.542   1.00 18.34  ? 30  C   C "C4'" 1 
ATOM   1481 O  "O4'" . C   C 1 30 ? -21.736 -7.837  3.805   1.00 20.20  ? 30  C   C "O4'" 1 
ATOM   1482 C  "C3'" . C   C 1 30 ? -21.052 -5.621  4.100   1.00 29.03  ? 30  C   C "C3'" 1 
ATOM   1483 O  "O3'" . C   C 1 30 ? -21.450 -4.281  4.349   1.00 30.21  ? 30  C   C "O3'" 1 
ATOM   1484 C  "C2'" . C   C 1 30 ? -20.633 -6.398  5.343   1.00 29.22  ? 30  C   C "C2'" 1 
ATOM   1485 O  "O2'" . C   C 1 30 ? -21.529 -6.168  6.420   1.00 32.77  ? 30  C   C "O2'" 1 
ATOM   1486 C  "C1'" . C   C 1 30 ? -20.803 -7.844  4.868   1.00 23.24  ? 30  C   C "C1'" 1 
ATOM   1487 N  N1    . C   C 1 30 ? -19.534 -8.444  4.395   1.00 27.41  ? 30  C   C N1    1 
ATOM   1488 C  C2    . C   C 1 30 ? -18.548 -8.776  5.335   1.00 28.49  ? 30  C   C C2    1 
ATOM   1489 O  O2    . C   C 1 30 ? -18.750 -8.564  6.541   1.00 29.69  ? 30  C   C O2    1 
ATOM   1490 N  N3    . C   C 1 30 ? -17.389 -9.328  4.914   1.00 17.98  ? 30  C   C N3    1 
ATOM   1491 C  C4    . C   C 1 30 ? -17.190 -9.550  3.616   1.00 17.93  ? 30  C   C C4    1 
ATOM   1492 N  N4    . C   C 1 30 ? -16.026 -10.095 3.256   1.00 17.82  ? 30  C   C N4    1 
ATOM   1493 C  C5    . C   C 1 30 ? -18.171 -9.222  2.633   1.00 18.78  ? 30  C   C C5    1 
ATOM   1494 C  C6    . C   C 1 30 ? -19.318 -8.677  3.065   1.00 28.16  ? 30  C   C C6    1 
ATOM   1495 P  P     . G   C 1 31 ? -20.379 -3.084  4.259   1.00 63.29  ? 31  G   C P     1 
ATOM   1496 O  OP1   . G   C 1 31 ? -21.115 -1.800  4.376   1.00 63.22  ? 31  G   C OP1   1 
ATOM   1497 O  OP2   . G   C 1 31 ? -19.509 -3.305  3.076   1.00 60.14  ? 31  G   C OP2   1 
ATOM   1498 O  "O5'" . G   C 1 31 ? -19.510 -3.291  5.576   1.00 28.94  ? 31  G   C "O5'" 1 
ATOM   1499 C  "C5'" . G   C 1 31 ? -20.115 -3.254  6.860   1.00 25.25  ? 31  G   C "C5'" 1 
ATOM   1500 C  "C4'" . G   C 1 31 ? -19.121 -3.600  7.938   1.00 33.81  ? 31  G   C "C4'" 1 
ATOM   1501 O  "O4'" . G   C 1 31 ? -18.682 -4.971  7.748   1.00 37.80  ? 31  G   C "O4'" 1 
ATOM   1502 C  "C3'" . G   C 1 31 ? -17.826 -2.798  7.964   1.00 32.96  ? 31  G   C "C3'" 1 
ATOM   1503 O  "O3'" . G   C 1 31 ? -17.958 -1.538  8.606   1.00 31.57  ? 31  G   C "O3'" 1 
ATOM   1504 C  "C2'" . G   C 1 31 ? -16.861 -3.750  8.657   1.00 31.94  ? 31  G   C "C2'" 1 
ATOM   1505 O  "O2'" . G   C 1 31 ? -17.079 -3.755  10.059  1.00 34.35  ? 31  G   C "O2'" 1 
ATOM   1506 C  "C1'" . G   C 1 31 ? -17.320 -5.096  8.098   1.00 33.22  ? 31  G   C "C1'" 1 
ATOM   1507 N  N9    . G   C 1 31 ? -16.561 -5.493  6.896   1.00 31.54  ? 31  G   C N9    1 
ATOM   1508 C  C8    . G   C 1 31 ? -16.972 -5.463  5.582   1.00 29.94  ? 31  G   C C8    1 
ATOM   1509 N  N7    . G   C 1 31 ? -16.058 -5.891  4.750   1.00 17.74  ? 31  G   C N7    1 
ATOM   1510 C  C5    . G   C 1 31 ? -14.982 -6.222  5.565   1.00 17.68  ? 31  G   C C5    1 
ATOM   1511 C  C6    . G   C 1 31 ? -13.701 -6.741  5.244   1.00 23.63  ? 31  G   C C6    1 
ATOM   1512 O  O6    . G   C 1 31 ? -13.230 -7.027  4.134   1.00 18.32  ? 31  G   C O6    1 
ATOM   1513 N  N1    . G   C 1 31 ? -12.931 -6.924  6.387   1.00 25.51  ? 31  G   C N1    1 
ATOM   1514 C  C2    . G   C 1 31 ? -13.330 -6.651  7.670   1.00 21.32  ? 31  G   C C2    1 
ATOM   1515 N  N2    . G   C 1 31 ? -12.437 -6.900  8.637   1.00 23.55  ? 31  G   C N2    1 
ATOM   1516 N  N3    . G   C 1 31 ? -14.517 -6.170  7.981   1.00 23.91  ? 31  G   C N3    1 
ATOM   1517 C  C4    . G   C 1 31 ? -15.280 -5.982  6.888   1.00 17.75  ? 31  G   C C4    1 
ATOM   1518 P  P     . C   C 1 32 ? -17.117 -0.268  8.089   1.00 40.80  ? 32  C   C P     1 
ATOM   1519 O  OP1   . C   C 1 32 ? -17.599 0.941   8.802   1.00 34.97  ? 32  C   C OP1   1 
ATOM   1520 O  OP2   . C   C 1 32 ? -17.097 -0.291  6.606   1.00 42.72  ? 32  C   C OP2   1 
ATOM   1521 O  "O5'" . C   C 1 32 ? -15.638 -0.554  8.606   1.00 33.56  ? 32  C   C "O5'" 1 
ATOM   1522 C  "C5'" . C   C 1 32 ? -15.373 -0.727  9.990   1.00 26.01  ? 32  C   C "C5'" 1 
ATOM   1523 C  "C4'" . C   C 1 32 ? -14.000 -1.303  10.229  1.00 29.49  ? 32  C   C "C4'" 1 
ATOM   1524 O  "O4'" . C   C 1 32 ? -13.901 -2.629  9.642   1.00 36.16  ? 32  C   C "O4'" 1 
ATOM   1525 C  "C3'" . C   C 1 32 ? -12.840 -0.544  9.606   1.00 34.29  ? 32  C   C "C3'" 1 
ATOM   1526 O  "O3'" . C   C 1 32 ? -12.462 0.601   10.346  1.00 37.17  ? 32  C   C "O3'" 1 
ATOM   1527 C  "C2'" . C   C 1 32 ? -11.755 -1.609  9.531   1.00 35.06  ? 32  C   C "C2'" 1 
ATOM   1528 O  "O2'" . C   C 1 32 ? -11.154 -1.813  10.802  1.00 34.86  ? 32  C   C "O2'" 1 
ATOM   1529 C  "C1'" . C   C 1 32 ? -12.581 -2.847  9.177   1.00 32.93  ? 32  C   C "C1'" 1 
ATOM   1530 N  N1    . C   C 1 32 ? -12.624 -3.081  7.717   1.00 23.97  ? 32  C   C N1    1 
ATOM   1531 C  C2    . C   C 1 32 ? -11.557 -3.741  7.104   1.00 23.44  ? 32  C   C C2    1 
ATOM   1532 O  O2    . C   C 1 32 ? -10.596 -4.096  7.803   1.00 20.77  ? 32  C   C O2    1 
ATOM   1533 N  N3    . C   C 1 32 ? -11.595 -3.958  5.765   1.00 20.44  ? 32  C   C N3    1 
ATOM   1534 C  C4    . C   C 1 32 ? -12.653 -3.550  5.056   1.00 19.83  ? 32  C   C C4    1 
ATOM   1535 N  N4    . C   C 1 32 ? -12.669 -3.779  3.742   1.00 27.03  ? 32  C   C N4    1 
ATOM   1536 C  C5    . C   C 1 32 ? -13.754 -2.884  5.659   1.00 17.77  ? 32  C   C C5    1 
ATOM   1537 C  C6    . C   C 1 32 ? -13.700 -2.676  6.978   1.00 22.46  ? 32  C   C C6    1 
ATOM   1538 P  P     . A   C 1 33 ? -11.975 1.929   9.586   1.00 50.47  ? 33  A   C P     1 
ATOM   1539 O  OP1   . A   C 1 33 ? -11.765 2.990   10.604  1.00 52.31  ? 33  A   C OP1   1 
ATOM   1540 O  OP2   . A   C 1 33 ? -12.884 2.197   8.442   1.00 40.02  ? 33  A   C OP2   1 
ATOM   1541 O  "O5'" . A   C 1 33 ? -10.552 1.506   9.005   1.00 32.90  ? 33  A   C "O5'" 1 
ATOM   1542 C  "C5'" . A   C 1 33 ? -9.489  1.155   9.879   1.00 17.14  ? 33  A   C "C5'" 1 
ATOM   1543 C  "C4'" . A   C 1 33 ? -8.324  0.541   9.140   1.00 24.98  ? 33  A   C "C4'" 1 
ATOM   1544 O  "O4'" . A   C 1 33 ? -8.731  -0.672  8.453   1.00 19.82  ? 33  A   C "O4'" 1 
ATOM   1545 C  "C3'" . A   C 1 33 ? -7.712  1.383   8.037   1.00 26.35  ? 33  A   C "C3'" 1 
ATOM   1546 O  "O3'" . A   C 1 33 ? -6.887  2.429   8.524   1.00 25.64  ? 33  A   C "O3'" 1 
ATOM   1547 C  "C2'" . A   C 1 33 ? -6.977  0.334   7.207   1.00 25.41  ? 33  A   C "C2'" 1 
ATOM   1548 O  "O2'" . A   C 1 33 ? -5.762  -0.057  7.829   1.00 25.13  ? 33  A   C "O2'" 1 
ATOM   1549 C  "C1'" . A   C 1 33 ? -7.956  -0.840  7.279   1.00 19.43  ? 33  A   C "C1'" 1 
ATOM   1550 N  N9    . A   C 1 33 ? -8.845  -0.872  6.098   1.00 20.27  ? 33  A   C N9    1 
ATOM   1551 C  C8    . A   C 1 33 ? -10.156 -0.478  5.991   1.00 22.18  ? 33  A   C C8    1 
ATOM   1552 N  N7    . A   C 1 33 ? -10.653 -0.614  4.782   1.00 21.73  ? 33  A   C N7    1 
ATOM   1553 C  C5    . A   C 1 33 ? -9.596  -1.116  4.032   1.00 17.65  ? 33  A   C C5    1 
ATOM   1554 C  C6    . A   C 1 33 ? -9.468  -1.480  2.676   1.00 19.47  ? 33  A   C C6    1 
ATOM   1555 N  N6    . A   C 1 33 ? -10.453 -1.392  1.779   1.00 16.98  ? 33  A   C N6    1 
ATOM   1556 N  N1    . A   C 1 33 ? -8.269  -1.945  2.258   1.00 25.77  ? 33  A   C N1    1 
ATOM   1557 C  C2    . A   C 1 33 ? -7.272  -2.039  3.147   1.00 23.22  ? 33  A   C C2    1 
ATOM   1558 N  N3    . A   C 1 33 ? -7.272  -1.730  4.442   1.00 25.33  ? 33  A   C N3    1 
ATOM   1559 C  C4    . A   C 1 33 ? -8.474  -1.263  4.829   1.00 19.74  ? 33  A   C C4    1 
ATOM   1560 P  P     . G   C 1 34 ? -6.626  3.728   7.615   1.00 43.42  ? 34  G   C P     1 
ATOM   1561 O  OP1   . G   C 1 34 ? -5.945  4.750   8.449   1.00 41.74  ? 34  G   C OP1   1 
ATOM   1562 O  OP2   . G   C 1 34 ? -7.891  4.073   6.916   1.00 45.83  ? 34  G   C OP2   1 
ATOM   1563 O  "O5'" . G   C 1 34 ? -5.587  3.207   6.532   1.00 21.83  ? 34  G   C "O5'" 1 
ATOM   1564 C  "C5'" . G   C 1 34 ? -4.329  2.706   6.942   1.00 17.32  ? 34  G   C "C5'" 1 
ATOM   1565 C  "C4'" . G   C 1 34 ? -3.550  2.145   5.784   1.00 24.74  ? 34  G   C "C4'" 1 
ATOM   1566 O  "O4'" . G   C 1 34 ? -4.260  1.022   5.204   1.00 30.78  ? 34  G   C "O4'" 1 
ATOM   1567 C  "C3'" . G   C 1 34 ? -3.315  3.071   4.606   1.00 25.21  ? 34  G   C "C3'" 1 
ATOM   1568 O  "O3'" . G   C 1 34 ? -2.278  4.007   4.840   1.00 28.67  ? 34  G   C "O3'" 1 
ATOM   1569 C  "C2'" . G   C 1 34 ? -3.033  2.089   3.475   1.00 25.10  ? 34  G   C "C2'" 1 
ATOM   1570 O  "O2'" . G   C 1 34 ? -1.715  1.577   3.581   1.00 25.18  ? 34  G   C "O2'" 1 
ATOM   1571 C  "C1'" . G   C 1 34 ? -3.997  0.954   3.818   1.00 25.97  ? 34  G   C "C1'" 1 
ATOM   1572 N  N9    . G   C 1 34 ? -5.270  1.049   3.079   1.00 22.71  ? 34  G   C N9    1 
ATOM   1573 C  C8    . G   C 1 34 ? -6.499  1.390   3.589   1.00 20.03  ? 34  G   C C8    1 
ATOM   1574 N  N7    . G   C 1 34 ? -7.445  1.383   2.688   1.00 20.19  ? 34  G   C N7    1 
ATOM   1575 C  C5    . G   C 1 34 ? -6.804  1.011   1.514   1.00 19.55  ? 34  G   C C5    1 
ATOM   1576 C  C6    . G   C 1 34 ? -7.317  0.833   0.204   1.00 20.25  ? 34  G   C C6    1 
ATOM   1577 O  O6    . G   C 1 34 ? -8.471  0.966   -0.210  1.00 19.30  ? 34  G   C O6    1 
ATOM   1578 N  N1    . G   C 1 34 ? -6.325  0.457   -0.688  1.00 28.87  ? 34  G   C N1    1 
ATOM   1579 C  C2    . G   C 1 34 ? -5.007  0.274   -0.372  1.00 16.36  ? 34  G   C C2    1 
ATOM   1580 N  N2    . G   C 1 34 ? -4.231  -0.090  -1.398  1.00 16.28  ? 34  G   C N2    1 
ATOM   1581 N  N3    . G   C 1 34 ? -4.507  0.433   0.842   1.00 16.34  ? 34  G   C N3    1 
ATOM   1582 C  C4    . G   C 1 34 ? -5.458  0.803   1.734   1.00 21.89  ? 34  G   C C4    1 
ATOM   1583 P  P     . C   C 1 35 ? -2.290  5.425   4.084   1.00 39.20  ? 35  C   C P     1 
ATOM   1584 O  OP1   . C   C 1 35 ? -1.097  6.193   4.527   1.00 48.83  ? 35  C   C OP1   1 
ATOM   1585 O  OP2   . C   C 1 35 ? -3.644  6.017   4.231   1.00 35.78  ? 35  C   C OP2   1 
ATOM   1586 O  "O5'" . C   C 1 35 ? -2.065  5.029   2.558   1.00 39.12  ? 35  C   C "O5'" 1 
ATOM   1587 C  "C5'" . C   C 1 35 ? -0.768  4.675   2.102   1.00 15.92  ? 35  C   C "C5'" 1 
ATOM   1588 C  "C4'" . C   C 1 35 ? -0.759  4.305   0.641   1.00 23.05  ? 35  C   C "C4'" 1 
ATOM   1589 O  "O4'" . C   C 1 35 ? -1.765  3.303   0.359   1.00 20.99  ? 35  C   C "O4'" 1 
ATOM   1590 C  "C3'" . C   C 1 35 ? -1.065  5.409   -0.356  1.00 25.60  ? 35  C   C "C3'" 1 
ATOM   1591 O  "O3'" . C   C 1 35 ? 0.024   6.292   -0.560  1.00 25.39  ? 35  C   C "O3'" 1 
ATOM   1592 C  "C2'" . C   C 1 35 ? -1.454  4.620   -1.600  1.00 28.58  ? 35  C   C "C2'" 1 
ATOM   1593 O  "O2'" . C   C 1 35 ? -0.299  4.140   -2.271  1.00 34.35  ? 35  C   C "O2'" 1 
ATOM   1594 C  "C1'" . C   C 1 35 ? -2.185  3.421   -0.986  1.00 26.69  ? 35  C   C "C1'" 1 
ATOM   1595 N  N1    . C   C 1 35 ? -3.657  3.571   -1.037  1.00 25.40  ? 35  C   C N1    1 
ATOM   1596 C  C2    . C   C 1 35 ? -4.278  3.274   -2.250  1.00 20.60  ? 35  C   C C2    1 
ATOM   1597 O  O2    . C   C 1 35 ? -3.568  2.901   -3.195  1.00 28.63  ? 35  C   C O2    1 
ATOM   1598 N  N3    . C   C 1 35 ? -5.621  3.392   -2.360  1.00 16.32  ? 35  C   C N3    1 
ATOM   1599 C  C4    . C   C 1 35 ? -6.332  3.795   -1.307  1.00 16.40  ? 35  C   C C4    1 
ATOM   1600 N  N4    . C   C 1 35 ? -7.655  3.901   -1.445  1.00 16.53  ? 35  C   C N4    1 
ATOM   1601 C  C5    . C   C 1 35 ? -5.720  4.109   -0.061  1.00 16.36  ? 35  C   C C5    1 
ATOM   1602 C  C6    . C   C 1 35 ? -4.391  3.986   0.035   1.00 16.24  ? 35  C   C C6    1 
ATOM   1603 N  N     . GLY D 2 3  ? -12.954 6.347   -6.901  1.00 48.96  ? 5   GLY D N     1 
ATOM   1604 C  CA    . GLY D 2 3  ? -12.742 4.979   -6.460  1.00 56.11  ? 5   GLY D CA    1 
ATOM   1605 C  C     . GLY D 2 3  ? -13.846 4.013   -6.858  1.00 64.18  ? 5   GLY D C     1 
ATOM   1606 O  O     . GLY D 2 3  ? -14.507 3.433   -5.992  1.00 63.83  ? 5   GLY D O     1 
ATOM   1607 N  N     . ASP D 2 4  ? -14.048 3.834   -8.162  1.00 66.74  ? 6   ASP D N     1 
ATOM   1608 C  CA    . ASP D 2 4  ? -15.140 2.997   -8.651  1.00 65.70  ? 6   ASP D CA    1 
ATOM   1609 C  C     . ASP D 2 4  ? -14.685 1.566   -8.930  1.00 61.50  ? 6   ASP D C     1 
ATOM   1610 O  O     . ASP D 2 4  ? -15.099 0.948   -9.913  1.00 56.44  ? 6   ASP D O     1 
ATOM   1611 C  CB    . ASP D 2 4  ? -15.746 3.605   -9.921  1.00 66.13  ? 6   ASP D CB    1 
ATOM   1612 N  N     . GLY D 2 5  ? -13.826 1.045   -8.060  1.00 61.59  ? 7   GLY D N     1 
ATOM   1613 C  CA    . GLY D 2 5  ? -13.290 -0.288  -8.245  1.00 58.11  ? 7   GLY D CA    1 
ATOM   1614 C  C     . GLY D 2 5  ? -13.452 -1.213  -7.055  1.00 50.96  ? 7   GLY D C     1 
ATOM   1615 O  O     . GLY D 2 5  ? -14.472 -1.201  -6.362  1.00 49.35  ? 7   GLY D O     1 
ATOM   1616 N  N     . ARG D 2 6  ? -12.416 -2.011  -6.817  1.00 39.20  ? 8   ARG D N     1 
ATOM   1617 C  CA    . ARG D 2 6  ? -12.400 -2.988  -5.737  1.00 26.03  ? 8   ARG D CA    1 
ATOM   1618 C  C     . ARG D 2 6  ? -12.543 -2.369  -4.345  1.00 29.04  ? 8   ARG D C     1 
ATOM   1619 O  O     . ARG D 2 6  ? -11.641 -1.677  -3.873  1.00 23.00  ? 8   ARG D O     1 
ATOM   1620 C  CB    . ARG D 2 6  ? -11.119 -3.824  -5.825  1.00 15.56  ? 8   ARG D CB    1 
ATOM   1621 C  CG    . ARG D 2 6  ? -11.158 -5.095  -5.003  1.00 9.76   ? 8   ARG D CG    1 
ATOM   1622 C  CD    . ARG D 2 6  ? -9.818  -5.811  -4.991  1.00 19.91  ? 8   ARG D CD    1 
ATOM   1623 N  NE    . ARG D 2 6  ? -9.966  -7.253  -4.798  1.00 32.83  ? 8   ARG D NE    1 
ATOM   1624 C  CZ    . ARG D 2 6  ? -8.960  -8.073  -4.506  1.00 33.12  ? 8   ARG D CZ    1 
ATOM   1625 N  NH1   . ARG D 2 6  ? -7.728  -7.599  -4.397  1.00 30.12  ? 8   ARG D NH1   1 
ATOM   1626 N  NH2   . ARG D 2 6  ? -9.180  -9.370  -4.336  1.00 35.08  ? 8   ARG D NH2   1 
ATOM   1627 N  N     . ARG D 2 7  ? -13.692 -2.600  -3.709  1.00 39.11  ? 9   ARG D N     1 
ATOM   1628 C  CA    . ARG D 2 7  ? -14.016 -1.989  -2.415  1.00 30.05  ? 9   ARG D CA    1 
ATOM   1629 C  C     . ARG D 2 7  ? -13.322 -2.673  -1.243  1.00 27.99  ? 9   ARG D C     1 
ATOM   1630 O  O     . ARG D 2 7  ? -13.291 -2.147  -0.130  1.00 30.77  ? 9   ARG D O     1 
ATOM   1631 C  CB    . ARG D 2 7  ? -15.529 -2.021  -2.174  1.00 29.16  ? 9   ARG D CB    1 
ATOM   1632 C  CG    . ARG D 2 7  ? -16.367 -1.361  -3.257  1.00 38.46  ? 9   ARG D CG    1 
ATOM   1633 C  CD    . ARG D 2 7  ? -17.858 -1.542  -2.988  1.00 46.22  ? 9   ARG D CD    1 
ATOM   1634 N  N     . ARG D 2 8  ? -12.743 -3.837  -1.502  1.00 31.84  ? 10  ARG D N     1 
ATOM   1635 C  CA    . ARG D 2 8  ? -12.258 -4.685  -0.423  1.00 23.33  ? 10  ARG D CA    1 
ATOM   1636 C  C     . ARG D 2 8  ? -11.302 -5.758  -0.933  1.00 21.91  ? 10  ARG D C     1 
ATOM   1637 O  O     . ARG D 2 8  ? -11.519 -6.344  -1.990  1.00 28.16  ? 10  ARG D O     1 
ATOM   1638 C  CB    . ARG D 2 8  ? -13.459 -5.305  0.301   1.00 10.00  ? 10  ARG D CB    1 
ATOM   1639 C  CG    . ARG D 2 8  ? -13.263 -6.716  0.791   1.00 11.26  ? 10  ARG D CG    1 
ATOM   1640 C  CD    . ARG D 2 8  ? -14.583 -7.478  0.844   1.00 18.03  ? 10  ARG D CD    1 
ATOM   1641 N  NE    . ARG D 2 8  ? -15.603 -6.803  1.647   1.00 13.24  ? 10  ARG D NE    1 
ATOM   1642 C  CZ    . ARG D 2 8  ? -16.797 -6.427  1.191   1.00 22.57  ? 10  ARG D CZ    1 
ATOM   1643 N  NH1   . ARG D 2 8  ? -17.144 -6.666  -0.067  1.00 8.34   ? 10  ARG D NH1   1 
ATOM   1644 N  NH2   . ARG D 2 8  ? -17.653 -5.818  1.999   1.00 28.98  ? 10  ARG D NH2   1 
ATOM   1645 N  N     . GLY D 2 9  ? -10.239 -6.010  -0.181  1.00 22.20  ? 11  GLY D N     1 
ATOM   1646 C  CA    . GLY D 2 9  ? -9.199  -6.907  -0.644  1.00 26.66  ? 11  GLY D CA    1 
ATOM   1647 C  C     . GLY D 2 9  ? -8.844  -8.048  0.288   1.00 22.29  ? 11  GLY D C     1 
ATOM   1648 O  O     . GLY D 2 9  ? -9.441  -8.227  1.349   1.00 14.64  ? 11  GLY D O     1 
ATOM   1649 N  N     . GLY D 2 10 ? -7.865  -8.835  -0.139  1.00 22.14  ? 12  GLY D N     1 
ATOM   1650 C  CA    . GLY D 2 10 ? -7.387  -9.981  0.607   1.00 20.67  ? 12  GLY D CA    1 
ATOM   1651 C  C     . GLY D 2 10 ? -7.989  -11.230 0.005   1.00 24.48  ? 12  GLY D C     1 
ATOM   1652 O  O     . GLY D 2 10 ? -9.206  -11.414 0.026   1.00 23.82  ? 12  GLY D O     1 
ATOM   1653 N  N     . GLY D 2 11 ? -7.124  -12.099 -0.509  1.00 28.27  ? 13  GLY D N     1 
ATOM   1654 C  CA    . GLY D 2 11 ? -7.553  -13.280 -1.229  1.00 13.45  ? 13  GLY D CA    1 
ATOM   1655 C  C     . GLY D 2 11 ? -8.450  -12.886 -2.383  1.00 16.56  ? 13  GLY D C     1 
ATOM   1656 O  O     . GLY D 2 11 ? -8.112  -12.000 -3.166  1.00 27.06  ? 13  GLY D O     1 
ATOM   1657 N  N     . GLY D 2 12 ? -9.608  -13.535 -2.471  1.00 21.88  ? 14  GLY D N     1 
ATOM   1658 C  CA    . GLY D 2 12 ? -10.571 -13.267 -3.523  1.00 8.61   ? 14  GLY D CA    1 
ATOM   1659 C  C     . GLY D 2 12 ? -11.761 -12.434 -3.086  1.00 25.58  ? 14  GLY D C     1 
ATOM   1660 O  O     . GLY D 2 12 ? -12.828 -12.498 -3.715  1.00 13.64  ? 14  GLY D O     1 
ATOM   1661 N  N     . ARG D 2 13 ? -11.596 -11.680 -1.999  1.00 28.63  ? 15  ARG D N     1 
ATOM   1662 C  CA    . ARG D 2 13 ? -12.671 -10.834 -1.494  1.00 26.56  ? 15  ARG D CA    1 
ATOM   1663 C  C     . ARG D 2 13 ? -12.870 -9.649  -2.426  1.00 25.69  ? 15  ARG D C     1 
ATOM   1664 O  O     . ARG D 2 13 ? -11.904 -9.120  -2.989  1.00 23.48  ? 15  ARG D O     1 
ATOM   1665 C  CB    . ARG D 2 13 ? -12.358 -10.304 -0.093  1.00 20.78  ? 15  ARG D CB    1 
ATOM   1666 C  CG    . ARG D 2 13 ? -12.375 -11.280 1.067   1.00 13.56  ? 15  ARG D CG    1 
ATOM   1667 C  CD    . ARG D 2 13 ? -11.559 -10.592 2.146   1.00 12.34  ? 15  ARG D CD    1 
ATOM   1668 N  NE    . ARG D 2 13 ? -11.581 -11.169 3.483   1.00 15.22  ? 15  ARG D NE    1 
ATOM   1669 C  CZ    . ARG D 2 13 ? -10.485 -11.608 4.096   1.00 19.88  ? 15  ARG D CZ    1 
ATOM   1670 N  NH1   . ARG D 2 13 ? -9.316  -11.555 3.471   1.00 22.40  ? 15  ARG D NH1   1 
ATOM   1671 N  NH2   . ARG D 2 13 ? -10.550 -12.103 5.324   1.00 23.74  ? 15  ARG D NH2   1 
ATOM   1672 N  N     . GLY D 2 14 ? -14.125 -9.261  -2.598  1.00 23.15  ? 16  GLY D N     1 
ATOM   1673 C  CA    . GLY D 2 14 ? -14.504 -8.036  -3.272  1.00 23.86  ? 16  GLY D CA    1 
ATOM   1674 C  C     . GLY D 2 14 ? -14.238 -8.165  -4.754  1.00 31.51  ? 16  GLY D C     1 
ATOM   1675 O  O     . GLY D 2 14 ? -13.504 -7.362  -5.307  1.00 35.11  ? 16  GLY D O     1 
ATOM   1676 N  N     . GLN D 2 15 ? -14.820 -9.167  -5.405  1.00 36.81  ? 17  GLN D N     1 
ATOM   1677 C  CA    . GLN D 2 15 ? -14.679 -9.277  -6.862  1.00 37.65  ? 17  GLN D CA    1 
ATOM   1678 C  C     . GLN D 2 15 ? -16.053 -9.333  -7.465  1.00 44.10  ? 17  GLN D C     1 
ATOM   1679 O  O     . GLN D 2 15 ? -16.245 -10.004 -8.477  1.00 46.97  ? 17  GLN D O     1 
ATOM   1680 C  CB    . GLN D 2 15 ? -13.866 -10.512 -7.278  1.00 41.98  ? 17  GLN D CB    1 
ATOM   1681 C  CG    . GLN D 2 15 ? -12.424 -10.502 -6.820  1.00 50.50  ? 17  GLN D CG    1 
ATOM   1682 C  CD    . GLN D 2 15 ? -11.594 -9.316  -7.308  1.00 64.07  ? 17  GLN D CD    1 
ATOM   1683 O  OE1   . GLN D 2 15 ? -10.692 -9.465  -8.136  1.00 66.57  ? 17  GLN D OE1   1 
ATOM   1684 N  NE2   . GLN D 2 15 ? -11.908 -8.130  -6.809  1.00 75.87  ? 17  GLN D NE2   1 
ATOM   1685 N  N     . GLY D 2 16 ? -17.019 -8.674  -6.845  1.00 50.56  ? 18  GLY D N     1 
ATOM   1686 C  CA    . GLY D 2 16 ? -18.389 -8.728  -7.302  1.00 59.98  ? 18  GLY D CA    1 
ATOM   1687 C  C     . GLY D 2 16 ? -18.637 -8.051  -8.649  1.00 68.99  ? 18  GLY D C     1 
ATOM   1688 O  O     . GLY D 2 16 ? -19.397 -8.561  -9.459  1.00 71.08  ? 18  GLY D O     1 
HETATM 1689 K  K     . K   E 3 .  ? -11.941 33.846  -9.999  1.00 8.82   ? 101 K   A K     1 
HETATM 1690 K  K     . K   F 3 .  ? -12.141 30.581  -9.840  1.00 11.91  ? 102 K   A K     1 
HETATM 1691 CS CS    . CS  G 4 .  ? -12.394 26.887  -10.181 0.52 42.76  ? 103 CS  A CS    1 
HETATM 1692 K  K     . K   H 3 .  ? -17.596 -18.265 3.316   1.00 19.39  ? 101 K   C K     1 
HETATM 1693 K  K     . K   I 3 .  ? -18.501 -21.445 3.670   1.00 25.33  ? 102 K   C K     1 
HETATM 1694 CS CS    . CS  J 4 .  ? -16.191 -14.793 3.458   0.50 41.33  ? 103 CS  C CS    1 
HETATM 1695 CS CS    . CS  K 4 .  ? -12.626 -17.785 13.332  1.00 181.01 ? 104 CS  C CS    1 
HETATM 1696 O  O     . HOH L 5 .  ? -5.827  25.442  -10.876 1.00 13.39  ? 201 HOH A O     1 
HETATM 1697 O  O     . HOH M 5 .  ? -6.849  -12.771 3.506   1.00 19.60  ? 201 HOH C O     1 
HETATM 1698 O  O     . HOH M 5 .  ? -16.391 -13.321 0.849   1.00 16.70  ? 202 HOH C O     1 
HETATM 1699 O  O     . HOH M 5 .  ? -11.115 -15.771 -0.896  1.00 12.53  ? 203 HOH C O     1 
HETATM 1700 O  O     . HOH M 5 .  ? -15.547 -10.815 0.642   1.00 2.71   ? 204 HOH C O     1 
HETATM 1701 O  O     . HOH M 5 .  ? -15.755 -17.597 12.590  1.00 35.88  ? 205 HOH C O     1 
HETATM 1702 O  O     . HOH M 5 .  ? -7.433  -11.623 12.497  1.00 31.76  ? 206 HOH C O     1 
HETATM 1703 O  O     . HOH M 5 .  ? -12.780 -5.516  11.804  1.00 21.23  ? 207 HOH C O     1 
# 
loop_
_atom_site_anisotrop.id 
_atom_site_anisotrop.type_symbol 
_atom_site_anisotrop.pdbx_label_atom_id 
_atom_site_anisotrop.pdbx_label_alt_id 
_atom_site_anisotrop.pdbx_label_comp_id 
_atom_site_anisotrop.pdbx_label_asym_id 
_atom_site_anisotrop.pdbx_label_seq_id 
_atom_site_anisotrop.pdbx_PDB_ins_code 
_atom_site_anisotrop.U[1][1] 
_atom_site_anisotrop.U[2][2] 
_atom_site_anisotrop.U[3][3] 
_atom_site_anisotrop.U[1][2] 
_atom_site_anisotrop.U[1][3] 
_atom_site_anisotrop.U[2][3] 
_atom_site_anisotrop.pdbx_auth_seq_id 
_atom_site_anisotrop.pdbx_auth_comp_id 
_atom_site_anisotrop.pdbx_auth_asym_id 
_atom_site_anisotrop.pdbx_auth_atom_id 
1    O "O5'" . G   A 1  ? 0.5177 0.5623 0.6238 0.0587  0.0465  -0.0044 1  G   A "O5'" 
2    C "C5'" . G   A 1  ? 0.3224 0.3612 0.4310 0.0568  0.0465  -0.0043 1  G   A "C5'" 
3    C "C4'" . G   A 1  ? 0.3410 0.3794 0.4514 0.0558  0.0485  -0.0072 1  G   A "C4'" 
4    O "O4'" . G   A 1  ? 0.3740 0.4167 0.4896 0.0544  0.0496  -0.0098 1  G   A "O4'" 
5    C "C3'" . G   A 1  ? 0.3531 0.3933 0.4585 0.0577  0.0497  -0.0082 1  G   A "C3'" 
6    O "O3'" . G   A 1  ? 0.4587 0.4942 0.5597 0.0585  0.0492  -0.0066 1  G   A "O3'" 
7    C "C2'" . G   A 1  ? 0.3284 0.3703 0.4377 0.0562  0.0517  -0.0116 1  G   A "C2'" 
8    O "O2'" . G   A 1  ? 0.3372 0.3736 0.4487 0.0543  0.0521  -0.0121 1  G   A "O2'" 
9    C "C1'" . G   A 1  ? 0.3188 0.3642 0.4337 0.0546  0.0515  -0.0126 1  G   A "C1'" 
10   N N9    . G   A 1  ? 0.1739 0.2263 0.2875 0.0560  0.0520  -0.0137 1  G   A N9    
11   C C8    . G   A 1  ? 0.1125 0.1688 0.2250 0.0573  0.0509  -0.0122 1  G   A C8    
12   N N7    . G   A 1  ? 0.1129 0.1756 0.2243 0.0584  0.0518  -0.0139 1  G   A N7    
13   C C5    . G   A 1  ? 0.1209 0.1838 0.2326 0.0577  0.0536  -0.0167 1  G   A C5    
14   C C6    . G   A 1  ? 0.1332 0.2014 0.2438 0.0582  0.0551  -0.0195 1  G   A C6    
15   O O6    . G   A 1  ? 0.2684 0.3424 0.3762 0.0590  0.0546  -0.0201 1  G   A O6    
16   N N1    . G   A 1  ? 0.1816 0.2476 0.2927 0.0571  0.0566  -0.0218 1  G   A N1    
17   C C2    . G   A 1  ? 0.2595 0.3189 0.3720 0.0557  0.0566  -0.0213 1  G   A C2    
18   N N2    . G   A 1  ? 0.2500 0.3083 0.3627 0.0547  0.0582  -0.0237 1  G   A N2    
19   N N3    . G   A 1  ? 0.2126 0.2671 0.3261 0.0552  0.0552  -0.0187 1  G   A N3    
20   C C4    . G   A 1  ? 0.1307 0.1872 0.2437 0.0563  0.0537  -0.0165 1  G   A C4    
21   P P     . C   A 2  ? 0.3400 0.3770 0.4338 0.0612  0.0494  -0.0060 2  C   A P     
22   O OP1   . C   A 2  ? 0.2786 0.3099 0.3688 0.0614  0.0487  -0.0041 2  C   A OP1   
23   O OP2   . C   A 2  ? 0.3783 0.4205 0.4702 0.0629  0.0486  -0.0051 2  C   A OP2   
24   O "O5'" . C   A 2  ? 0.2032 0.2425 0.2973 0.0611  0.0517  -0.0092 2  C   A "O5'" 
25   C "C5'" . C   A 2  ? 0.1267 0.1623 0.2234 0.0593  0.0528  -0.0107 2  C   A "C5'" 
26   C "C4'" . C   A 2  ? 0.2202 0.2589 0.3174 0.0591  0.0549  -0.0140 2  C   A "C4'" 
27   O "O4'" . C   A 2  ? 0.2515 0.2955 0.3528 0.0584  0.0555  -0.0158 2  C   A "O4'" 
28   C "C3'" . C   A 2  ? 0.3216 0.3626 0.4124 0.0615  0.0558  -0.0144 2  C   A "C3'" 
29   O "O3'" . C   A 2  ? 0.4184 0.4547 0.5054 0.0619  0.0560  -0.0137 2  C   A "O3'" 
30   C "C2'" . C   A 2  ? 0.3234 0.3691 0.4163 0.0609  0.0576  -0.0178 2  C   A "C2'" 
31   O "O2'" . C   A 2  ? 0.4067 0.4493 0.5019 0.0591  0.0589  -0.0198 2  C   A "O2'" 
32   C "C1'" . C   A 2  ? 0.1996 0.2482 0.2985 0.0594  0.0570  -0.0182 2  C   A "C1'" 
33   N N1    . C   A 2  ? 0.1951 0.2497 0.2921 0.0611  0.0565  -0.0177 2  C   A N1    
34   C C2    . C   A 2  ? 0.2221 0.2823 0.3180 0.0618  0.0579  -0.0203 2  C   A C2    
35   O O2    . C   A 2  ? 0.2131 0.2729 0.3097 0.0608  0.0595  -0.0229 2  C   A O2    
36   N N3    . C   A 2  ? 0.2693 0.3353 0.3631 0.0634  0.0574  -0.0200 2  C   A N3    
37   C C4    . C   A 2  ? 0.2091 0.2752 0.3020 0.0643  0.0556  -0.0172 2  C   A C4    
38   N N4    . C   A 2  ? 0.1432 0.2152 0.2336 0.0659  0.0549  -0.0168 2  C   A N4    
39   C C5    . C   A 2  ? 0.1201 0.1804 0.2142 0.0636  0.0541  -0.0146 2  C   A C5    
40   C C6    . C   A 2  ? 0.1206 0.1754 0.2167 0.0621  0.0547  -0.0150 2  C   A C6    
41   P P     . U   A 3  ? 0.3644 0.4009 0.4435 0.0645  0.0558  -0.0123 3  U   A P     
42   O OP1   . U   A 3  ? 0.1991 0.2300 0.2757 0.0642  0.0562  -0.0118 3  U   A OP1   
43   O OP2   . U   A 3  ? 0.1269 0.1648 0.2041 0.0657  0.0539  -0.0096 3  U   A OP2   
44   O "O5'" . U   A 3  ? 0.1349 0.1768 0.2119 0.0655  0.0575  -0.0150 3  U   A "O5'" 
45   C "C5'" . U   A 3  ? 0.1536 0.1952 0.2318 0.0645  0.0594  -0.0179 3  U   A "C5'" 
46   C "C4'" . U   A 3  ? 0.2457 0.2932 0.3226 0.0652  0.0607  -0.0204 3  U   A "C4'" 
47   O "O4'" . U   A 3  ? 0.2124 0.2649 0.2936 0.0647  0.0604  -0.0211 3  U   A "O4'" 
48   C "C3'" . U   A 3  ? 0.3309 0.3809 0.4001 0.0677  0.0606  -0.0197 3  U   A "C3'" 
49   O "O3'" . U   A 3  ? 0.4278 0.4744 0.4921 0.0683  0.0614  -0.0199 3  U   A "O3'" 
50   C "C2'" . U   A 3  ? 0.3024 0.3591 0.3724 0.0680  0.0614  -0.0222 3  U   A "C2'" 
51   O "O2'" . U   A 3  ? 0.2548 0.3121 0.3258 0.0670  0.0633  -0.0254 3  U   A "O2'" 
52   C "C1'" . U   A 3  ? 0.2312 0.2896 0.3087 0.0663  0.0608  -0.0223 3  U   A "C1'" 
53   N N1    . U   A 3  ? 0.1881 0.2498 0.2643 0.0676  0.0591  -0.0202 3  U   A N1    
54   C C2    . U   A 3  ? 0.2134 0.2817 0.2874 0.0687  0.0593  -0.0216 3  U   A C2    
55   O O2    . U   A 3  ? 0.3265 0.3976 0.3997 0.0685  0.0607  -0.0244 3  U   A O2    
56   N N3    . U   A 3  ? 0.1924 0.2639 0.2647 0.0698  0.0575  -0.0197 3  U   A N3    
57   C C4    . U   A 3  ? 0.2042 0.2730 0.2771 0.0700  0.0557  -0.0166 3  U   A C4    
58   O O4    . U   A 3  ? 0.2852 0.3575 0.3563 0.0709  0.0542  -0.0152 3  U   A O4    
59   C C5    . U   A 3  ? 0.1972 0.2591 0.2723 0.0689  0.0557  -0.0153 3  U   A C5    
60   C C6    . U   A 3  ? 0.2116 0.2703 0.2882 0.0678  0.0573  -0.0171 3  U   A C6    
61   P P     . G   A 4  ? 0.4547 0.5012 0.5102 0.0707  0.0607  -0.0179 4  G   A P     
62   O OP1   . G   A 4  ? 0.4372 0.4787 0.4891 0.0706  0.0616  -0.0179 4  G   A OP1   
63   O OP2   . G   A 4  ? 0.4150 0.4615 0.4695 0.0716  0.0587  -0.0147 4  G   A OP2   
64   O "O5'" . G   A 4  ? 0.2775 0.3301 0.3299 0.0717  0.0614  -0.0201 4  G   A "O5'" 
65   C "C5'" . G   A 4  ? 0.2822 0.3360 0.3351 0.0709  0.0633  -0.0234 4  G   A "C5'" 
66   C "C4'" . G   A 4  ? 0.4029 0.4629 0.4528 0.0718  0.0635  -0.0251 4  G   A "C4'" 
67   O "O4'" . G   A 4  ? 0.4358 0.5008 0.4905 0.0714  0.0628  -0.0256 4  G   A "O4'" 
68   C "C3'" . G   A 4  ? 0.4527 0.5138 0.4939 0.0740  0.0623  -0.0232 4  G   A "C3'" 
69   O "O3'" . G   A 4  ? 0.3751 0.4332 0.4105 0.0746  0.0632  -0.0236 4  G   A "O3'" 
70   C "C2'" . G   A 4  ? 0.4781 0.5463 0.5191 0.0744  0.0617  -0.0248 4  G   A "C2'" 
71   O "O2'" . G   A 4  ? 0.5357 0.6063 0.5757 0.0739  0.0632  -0.0280 4  G   A "O2'" 
72   C "C1'" . G   A 4  ? 0.3535 0.4236 0.4031 0.0729  0.0617  -0.0254 4  G   A "C1'" 
73   N N9    . G   A 4  ? 0.2965 0.3677 0.3465 0.0736  0.0596  -0.0226 4  G   A N9    
74   C C8    . G   A 4  ? 0.2709 0.3380 0.3246 0.0731  0.0590  -0.0203 4  G   A C8    
75   N N7    . G   A 4  ? 0.1760 0.2451 0.2292 0.0738  0.0571  -0.0182 4  G   A N7    
76   C C5    . G   A 4  ? 0.1928 0.2676 0.2417 0.0750  0.0565  -0.0191 4  G   A C5    
77   C C6    . G   A 4  ? 0.2506 0.3297 0.2972 0.0761  0.0545  -0.0176 4  G   A C6    
78   O O6    . G   A 4  ? 0.1579 0.2365 0.2059 0.0763  0.0530  -0.0152 4  G   A O6    
79   N N1    . G   A 4  ? 0.3118 0.3963 0.3542 0.0769  0.0543  -0.0194 4  G   A N1    
80   C C2    . G   A 4  ? 0.2872 0.3726 0.3277 0.0766  0.0557  -0.0222 4  G   A C2    
81   N N2    . G   A 4  ? 0.2812 0.3719 0.3175 0.0775  0.0550  -0.0235 4  G   A N2    
82   N N3    . G   A 4  ? 0.2116 0.2929 0.2543 0.0756  0.0577  -0.0235 4  G   A N3    
83   C C4    . G   A 4  ? 0.2164 0.2926 0.2633 0.0748  0.0579  -0.0218 4  G   A C4    
84   P P     . C   A 5  ? 0.3070 0.3626 0.3335 0.0768  0.0619  -0.0205 5  C   A P     
85   O OP1   . C   A 5  ? 0.3142 0.3665 0.3360 0.0769  0.0632  -0.0214 5  C   A OP1   
86   O OP2   . C   A 5  ? 0.4933 0.5455 0.5215 0.0769  0.0606  -0.0174 5  C   A OP2   
87   O "O5'" . C   A 5  ? 0.2606 0.3223 0.2828 0.0783  0.0604  -0.0204 5  C   A "O5'" 
88   C "C5'" . C   A 5  ? 0.2450 0.3110 0.2651 0.0784  0.0610  -0.0232 5  C   A "C5'" 
89   C "C4'" . C   A 5  ? 0.3443 0.4153 0.3592 0.0801  0.0591  -0.0224 5  C   A "C4'" 
90   O "O4'" . C   A 5  ? 0.3999 0.4757 0.4199 0.0796  0.0581  -0.0227 5  C   A "O4'" 
91   C "C3'" . C   A 5  ? 0.3121 0.3808 0.3202 0.0822  0.0574  -0.0189 5  C   A "C3'" 
92   O "O3'" . C   A 5  ? 0.3190 0.3846 0.3202 0.0832  0.0578  -0.0184 5  C   A "O3'" 
93   C "C2'" . C   A 5  ? 0.3013 0.3762 0.3078 0.0833  0.0554  -0.0185 5  C   A "C2'" 
94   O "O2'" . C   A 5  ? 0.3204 0.3991 0.3220 0.0841  0.0552  -0.0203 5  C   A "O2'" 
95   C "C1'" . C   A 5  ? 0.2808 0.3591 0.2961 0.0814  0.0559  -0.0204 5  C   A "C1'" 
96   N N1    . C   A 5  ? 0.2837 0.3606 0.3031 0.0812  0.0549  -0.0179 5  C   A N1    
97   C C2    . C   A 5  ? 0.2929 0.3736 0.3108 0.0823  0.0528  -0.0162 5  C   A C2    
98   O O2    . C   A 5  ? 0.1540 0.2391 0.1672 0.0834  0.0517  -0.0169 5  C   A O2    
99   N N3    . C   A 5  ? 0.3013 0.3805 0.3228 0.0820  0.0518  -0.0140 5  C   A N3    
100  C C4    . C   A 5  ? 0.3118 0.3859 0.3382 0.0807  0.0528  -0.0133 5  C   A C4    
101  N N4    . C   A 5  ? 0.2690 0.3417 0.2987 0.0804  0.0517  -0.0110 5  C   A N4    
102  C C5    . C   A 5  ? 0.2694 0.3397 0.2974 0.0796  0.0549  -0.0151 5  C   A C5    
103  C C6    . C   A 5  ? 0.2810 0.3529 0.3054 0.0799  0.0559  -0.0173 5  C   A C6    
104  P P     . G   A 6  ? 0.4917 0.5519 0.4873 0.0847  0.0569  -0.0147 6  G   A P     
105  O OP1   . G   A 6  ? 0.5147 0.5706 0.5062 0.0847  0.0582  -0.0152 6  G   A OP1   
106  O OP2   . G   A 6  ? 0.5167 0.5743 0.5174 0.0840  0.0564  -0.0127 6  G   A OP2   
107  O "O5'" . G   A 6  ? 0.2830 0.3470 0.2720 0.0870  0.0546  -0.0131 6  G   A "O5'" 
108  C "C5'" . G   A 6  ? 0.3168 0.3789 0.3023 0.0885  0.0529  -0.0095 6  G   A "C5'" 
109  C "C4'" . G   A 6  ? 0.3107 0.3765 0.2892 0.0907  0.0509  -0.0084 6  G   A "C4'" 
110  O "O4'" . G   A 6  ? 0.3843 0.4493 0.3611 0.0919  0.0490  -0.0051 6  G   A "O4'" 
111  C "C3'" . G   A 6  ? 0.2259 0.2892 0.1966 0.0920  0.0510  -0.0081 6  G   A "C3'" 
112  O "O3'" . G   A 6  ? 0.2983 0.3667 0.2644 0.0936  0.0494  -0.0086 6  G   A "O3'" 
113  C "C2'" . G   A 6  ? 0.2079 0.2662 0.1748 0.0933  0.0501  -0.0044 6  G   A "C2'" 
114  O "O2'" . G   A 6  ? 0.2705 0.3272 0.2293 0.0952  0.0493  -0.0029 6  G   A "O2'" 
115  C "C1'" . G   A 6  ? 0.3493 0.4108 0.3185 0.0938  0.0483  -0.0026 6  G   A "C1'" 
116  N N9    . G   A 6  ? 0.1689 0.2260 0.1392 0.0937  0.0479  0.0004  6  G   A N9    
117  C C8    . G   A 6  ? 0.2421 0.2936 0.2156 0.0923  0.0493  0.0010  6  G   A C8    
118  N N7    . G   A 6  ? 0.2673 0.3161 0.2412 0.0926  0.0483  0.0039  6  G   A N7    
119  C C5    . G   A 6  ? 0.3199 0.3728 0.2907 0.0942  0.0462  0.0053  6  G   A C5    
120  C C6    . G   A 6  ? 0.2960 0.3484 0.2655 0.0951  0.0444  0.0085  6  G   A C6    
121  O O6    . G   A 6  ? 0.2385 0.2866 0.2095 0.0946  0.0443  0.0107  6  G   A O6    
122  N N1    . G   A 6  ? 0.2585 0.3161 0.2246 0.0968  0.0426  0.0089  6  G   A N1    
123  C C2    . G   A 6  ? 0.2278 0.2904 0.1921 0.0974  0.0424  0.0065  6  G   A C2    
124  N N2    . G   A 6  ? 0.2650 0.3324 0.2262 0.0990  0.0404  0.0072  6  G   A N2    
125  N N3    . G   A 6  ? 0.2664 0.3295 0.2318 0.0965  0.0440  0.0036  6  G   A N3    
126  C C4    . G   A 6  ? 0.2705 0.3285 0.2391 0.0950  0.0459  0.0032  6  G   A C4    
127  P P     . G   A 7  ? 0.5913 0.6650 0.5588 0.0928  0.0501  -0.0125 7  G   A P     
128  O OP1   . G   A 7  ? 0.5404 0.6114 0.5121 0.0907  0.0526  -0.0149 7  G   A OP1   
129  O OP2   . G   A 7  ? 0.5537 0.6300 0.5139 0.0947  0.0485  -0.0122 7  G   A OP2   
130  O "O5'" . G   A 7  ? 0.2321 0.3116 0.2054 0.0920  0.0492  -0.0134 7  G   A "O5'" 
131  C "C5'" . G   A 7  ? 0.3458 0.4278 0.3179 0.0934  0.0470  -0.0110 7  G   A "C5'" 
132  C "C4'" . G   A 7  ? 0.3598 0.4480 0.3372 0.0924  0.0464  -0.0127 7  G   A "C4'" 
133  O "O4'" . G   A 7  ? 0.4100 0.4971 0.3958 0.0901  0.0480  -0.0139 7  G   A "O4'" 
134  C "C3'" . G   A 7  ? 0.4316 0.5225 0.4084 0.0936  0.0441  -0.0103 7  G   A "C3'" 
135  O "O3'" . G   A 7  ? 0.4476 0.5424 0.4181 0.0956  0.0422  -0.0100 7  G   A "O3'" 
136  C "C2'" . G   A 7  ? 0.5001 0.5948 0.4851 0.0917  0.0445  -0.0120 7  G   A "C2'" 
137  O "O2'" . G   A 7  ? 0.5805 0.6817 0.5663 0.0913  0.0442  -0.0150 7  G   A "O2'" 
138  C "C1'" . G   A 7  ? 0.4390 0.5294 0.4295 0.0897  0.0470  -0.0133 7  G   A "C1'" 
139  N N9    . G   A 7  ? 0.3837 0.4691 0.3775 0.0892  0.0472  -0.0108 7  G   A N9    
140  C C8    . G   A 7  ? 0.3586 0.4379 0.3541 0.0882  0.0489  -0.0106 7  G   A C8    
141  N N7    . G   A 7  ? 0.2813 0.3569 0.2798 0.0878  0.0487  -0.0083 7  G   A N7    
142  C C5    . G   A 7  ? 0.3436 0.4228 0.3424 0.0885  0.0468  -0.0068 7  G   A C5    
143  C C6    . G   A 7  ? 0.3844 0.4618 0.3859 0.0883  0.0457  -0.0042 7  G   A C6    
144  O O6    . G   A 7  ? 0.4012 0.4734 0.4054 0.0876  0.0462  -0.0025 7  G   A O6    
145  N N1    . G   A 7  ? 0.3016 0.3840 0.3025 0.0891  0.0439  -0.0035 7  G   A N1    
146  C C2    . G   A 7  ? 0.2406 0.3291 0.2387 0.0899  0.0431  -0.0052 7  G   A C2    
147  N N2    . G   A 7  ? 0.3090 0.4016 0.3071 0.0905  0.0413  -0.0042 7  G   A N2    
148  N N3    . G   A 7  ? 0.2617 0.3520 0.2574 0.0900  0.0440  -0.0077 7  G   A N3    
149  C C4    . G   A 7  ? 0.2991 0.3844 0.2951 0.0893  0.0459  -0.0084 7  G   A C4    
150  P P     . U   A 8  ? 0.4454 0.5383 0.4092 0.0981  0.0400  -0.0062 8  U   A P     
151  O OP1   . U   A 8  ? 0.5233 0.6214 0.4820 0.0998  0.0381  -0.0067 8  U   A OP1   
152  O OP2   . U   A 8  ? 0.3569 0.4427 0.3176 0.0985  0.0410  -0.0043 8  U   A OP2   
153  O "O5'" . U   A 8  ? 0.3193 0.4130 0.2877 0.0976  0.0392  -0.0043 8  U   A "O5'" 
154  C "C5'" . U   A 8  ? 0.2653 0.3654 0.2366 0.0973  0.0380  -0.0054 8  U   A "C5'" 
155  C "C4'" . U   A 8  ? 0.2618 0.3613 0.2348 0.0975  0.0367  -0.0025 8  U   A "C4'" 
156  O "O4'" . U   A 8  ? 0.2810 0.3769 0.2609 0.0955  0.0382  -0.0024 8  U   A "O4'" 
157  C "C3'" . U   A 8  ? 0.2993 0.3947 0.2658 0.0997  0.0354  0.0012  8  U   A "C3'" 
158  O "O3'" . U   A 8  ? 0.2217 0.3208 0.1822 0.1018  0.0332  0.0020  8  U   A "O3'" 
159  C "C2'" . U   A 8  ? 0.4039 0.4966 0.3747 0.0988  0.0353  0.0035  8  U   A "C2'" 
160  O "O2'" . U   A 8  ? 0.2860 0.3835 0.2580 0.0990  0.0335  0.0041  8  U   A "O2'" 
161  C "C1'" . U   A 8  ? 0.3685 0.4602 0.3474 0.0961  0.0374  0.0012  8  U   A "C1'" 
162  N N1    . U   A 8  ? 0.3452 0.4299 0.3248 0.0954  0.0391  0.0020  8  U   A N1    
163  C C2    . U   A 8  ? 0.3525 0.4327 0.3341 0.0950  0.0389  0.0047  8  U   A C2    
164  O O2    . U   A 8  ? 0.3918 0.4732 0.3743 0.0952  0.0375  0.0066  8  U   A O2    
165  N N3    . U   A 8  ? 0.2971 0.3711 0.2794 0.0943  0.0405  0.0052  8  U   A N3    
166  C C4    . U   A 8  ? 0.2282 0.3001 0.2096 0.0939  0.0422  0.0033  8  U   A C4    
167  O O4    . U   A 8  ? 0.2388 0.3051 0.2212 0.0931  0.0434  0.0040  8  U   A O4    
168  C C5    . U   A 8  ? 0.2787 0.3555 0.2581 0.0943  0.0423  0.0005  8  U   A C5    
169  C C6    . U   A 8  ? 0.3173 0.4002 0.2960 0.0950  0.0408  0.0000  8  U   A C6    
170  P P     . G   A 9  ? 0.5341 0.6295 0.4861 0.1045  0.0319  0.0050  9  G   A P     
171  O OP1   . G   A 9  ? 0.5570 0.6577 0.5043 0.1064  0.0298  0.0046  9  G   A OP1   
172  O OP2   . G   A 9  ? 0.5833 0.6730 0.5339 0.1041  0.0338  0.0047  9  G   A OP2   
173  O "O5'" . G   A 9  ? 0.4804 0.5727 0.4323 0.1049  0.0309  0.0086  9  G   A "O5'" 
174  C "C5'" . G   A 9  ? 0.4339 0.5304 0.3877 0.1049  0.0294  0.0094  9  G   A "C5'" 
175  C "C4'" . G   A 9  ? 0.4109 0.5030 0.3657 0.1047  0.0292  0.0126  9  G   A "C4'" 
176  O "O4'" . G   A 9  ? 0.3418 0.4288 0.3017 0.1026  0.0313  0.0123  9  G   A "O4'" 
177  C "C3'" . G   A 9  ? 0.4782 0.5664 0.4257 0.1069  0.0278  0.0161  9  G   A "C3'" 
178  O "O3'" . G   A 9  ? 0.6851 0.7729 0.6330 0.1069  0.0267  0.0187  9  G   A "O3'" 
179  C "C2'" . G   A 9  ? 0.3770 0.4582 0.3245 0.1062  0.0297  0.0168  9  G   A "C2'" 
180  O "O2'" . G   A 9  ? 0.4706 0.5467 0.4138 0.1072  0.0291  0.0204  9  G   A "O2'" 
181  C "C1'" . G   A 9  ? 0.3064 0.3870 0.2625 0.1034  0.0314  0.0153  9  G   A "C1'" 
182  N N9    . G   A 9  ? 0.3039 0.3795 0.2623 0.1020  0.0336  0.0143  9  G   A N9    
183  C C8    . G   A 9  ? 0.3179 0.3929 0.2747 0.1021  0.0349  0.0123  9  G   A C8    
184  N N7    . G   A 9  ? 0.3132 0.3833 0.2730 0.1006  0.0368  0.0118  9  G   A N7    
185  C C5    . G   A 9  ? 0.2819 0.3493 0.2457 0.0995  0.0367  0.0137  9  G   A C5    
186  C C6    . G   A 9  ? 0.1940 0.2561 0.1624 0.0976  0.0382  0.0142  9  G   A C6    
187  O O6    . G   A 9  ? 0.1578 0.2164 0.1277 0.0967  0.0400  0.0129  9  G   A O6    
188  N N1    . G   A 9  ? 0.1996 0.2605 0.1712 0.0968  0.0373  0.0163  9  G   A N1    
189  C C2    . G   A 9  ? 0.1519 0.2163 0.1223 0.0976  0.0354  0.0177  9  G   A C2    
190  N N2    . G   A 9  ? 0.1488 0.2110 0.1225 0.0964  0.0348  0.0196  9  G   A N2    
191  N N3    . G   A 9  ? 0.1536 0.2230 0.1196 0.0994  0.0341  0.0173  9  G   A N3    
192  C C4    . G   A 9  ? 0.3099 0.3807 0.2730 0.1002  0.0348  0.0153  9  G   A C4    
193  P P     . U   A 10 ? 0.5826 0.7801 0.5436 0.1017  0.0140  0.0335  10 U   A P     
194  O OP1   . U   A 10 ? 0.4963 0.6977 0.4593 0.1005  0.0141  0.0343  10 U   A OP1   
195  O OP2   . U   A 10 ? 0.5174 0.7165 0.4779 0.1026  0.0136  0.0325  10 U   A OP2   
196  O "O5'" . U   A 10 ? 0.4912 0.6865 0.4503 0.1034  0.0139  0.0327  10 U   A "O5'" 
197  C "C5'" . U   A 10 ? 0.5138 0.7066 0.4707 0.1051  0.0136  0.0315  10 U   A "C5'" 
198  C "C4'" . U   A 10 ? 0.5957 0.7866 0.5511 0.1063  0.0136  0.0310  10 U   A "C4'" 
199  O "O4'" . U   A 10 ? 0.7104 0.9056 0.6661 0.1068  0.0133  0.0307  10 U   A "O4'" 
200  C "C3'" . U   A 10 ? 0.6460 0.8337 0.6017 0.1056  0.0140  0.0319  10 U   A "C3'" 
201  O "O3'" . U   A 10 ? 0.6379 0.8224 0.5914 0.1072  0.0140  0.0311  10 U   A "O3'" 
202  C "C2'" . U   A 10 ? 0.7053 0.8966 0.6623 0.1049  0.0140  0.0324  10 U   A "C2'" 
203  O "O2'" . U   A 10 ? 0.6539 0.8431 0.6106 0.1049  0.0143  0.0328  10 U   A "O2'" 
204  C "C1'" . U   A 10 ? 0.7959 0.9906 0.7519 0.1065  0.0135  0.0313  10 U   A "C1'" 
205  N N1    . U   A 10 ? 0.8207 1.0202 0.7782 0.1059  0.0135  0.0318  10 U   A N1    
206  C C2    . U   A 10 ? 0.7649 0.9655 0.7218 0.1067  0.0134  0.0316  10 U   A C2    
207  O O2    . U   A 10 ? 0.8005 0.9985 0.7557 0.1080  0.0133  0.0310  10 U   A O2    
208  N N3    . U   A 10 ? 0.6250 0.8302 0.5834 0.1061  0.0134  0.0322  10 U   A N3    
209  C C4    . U   A 10 ? 0.5742 0.7827 0.5346 0.1046  0.0135  0.0329  10 U   A C4    
210  O O4    . U   A 10 ? 0.5118 0.7243 0.4734 0.1042  0.0136  0.0334  10 U   A O4    
211  C C5    . U   A 10 ? 0.6474 0.8545 0.6082 0.1038  0.0135  0.0330  10 U   A C5    
212  C C6    . U   A 10 ? 0.7608 0.9635 0.7203 0.1044  0.0135  0.0324  10 U   A C6    
213  P P     . G   A 11 ? 0.6299 0.8092 0.5817 0.1080  0.0141  0.0307  11 G   A P     
214  O OP1   . G   A 11 ? 0.5648 0.7401 0.5163 0.1076  0.0146  0.0313  11 G   A OP1   
215  O OP2   . G   A 11 ? 0.8157 0.9959 0.7656 0.1100  0.0136  0.0293  11 G   A OP2   
216  O "O5'" . G   A 11 ? 0.3474 0.5261 0.2996 0.1075  0.0142  0.0308  11 G   A "O5'" 
217  C "C5'" . G   A 11 ? 0.3983 0.5773 0.3490 0.1090  0.0138  0.0297  11 G   A "C5'" 
218  C "C4'" . G   A 11 ? 0.4024 0.5780 0.3525 0.1090  0.0141  0.0298  11 G   A "C4'" 
219  O "O4'" . G   A 11 ? 0.4714 0.6423 0.4207 0.1090  0.0146  0.0302  11 G   A "O4'" 
220  C "C3'" . G   A 11 ? 0.4226 0.5989 0.3745 0.1074  0.0144  0.0307  11 G   A "C3'" 
221  O "O3'" . G   A 11 ? 0.4073 0.5870 0.3595 0.1077  0.0139  0.0301  11 G   A "O3'" 
222  C "C2'" . G   A 11 ? 0.5134 0.6845 0.4644 0.1075  0.0149  0.0311  11 G   A "C2'" 
223  O "O2'" . G   A 11 ? 0.4779 0.6479 0.4273 0.1089  0.0146  0.0302  11 G   A "O2'" 
224  C "C1'" . G   A 11 ? 0.4612 0.6293 0.4110 0.1081  0.0151  0.0310  11 G   A "C1'" 
225  N N9    . G   A 11 ? 0.2532 0.4199 0.2045 0.1066  0.0156  0.0323  11 G   A N9    
226  C C8    . G   A 11 ? 0.1815 0.3497 0.1336 0.1059  0.0156  0.0327  11 G   A C8    
227  N N7    . G   A 11 ? 0.2362 0.4026 0.1895 0.1045  0.0162  0.0339  11 G   A N7    
228  C C5    . G   A 11 ? 0.2565 0.4200 0.2098 0.1042  0.0166  0.0344  11 G   A C5    
229  C C6    . G   A 11 ? 0.2590 0.4196 0.2133 0.1029  0.0173  0.0358  11 G   A C6    
230  O O6    . G   A 11 ? 0.2843 0.4445 0.2399 0.1017  0.0177  0.0367  11 G   A O6    
231  N N1    . G   A 11 ? 0.2637 0.4220 0.2175 0.1031  0.0176  0.0359  11 G   A N1    
232  C C2    . G   A 11 ? 0.2629 0.4215 0.2153 0.1044  0.0172  0.0349  11 G   A C2    
233  N N2    . G   A 11 ? 0.3238 0.4797 0.2758 0.1045  0.0176  0.0352  11 G   A N2    
234  N N3    . G   A 11 ? 0.2771 0.4384 0.2286 0.1057  0.0165  0.0336  11 G   A N3    
235  C C4    . G   A 11 ? 0.2415 0.4052 0.1936 0.1054  0.0163  0.0335  11 G   A C4    
236  P P     . G   A 12 ? 0.5445 0.7278 0.4989 0.1060  0.0140  0.0310  12 G   A P     
237  O OP1   . G   A 12 ? 0.5061 0.6929 0.4603 0.1068  0.0134  0.0300  12 G   A OP1   
238  O OP2   . G   A 12 ? 0.4243 0.6097 0.3804 0.1047  0.0141  0.0318  12 G   A OP2   
239  O "O5'" . G   A 12 ? 0.4988 0.6783 0.4537 0.1050  0.0145  0.0319  12 G   A "O5'" 
240  C "C5'" . G   A 12 ? 0.4118 0.5886 0.3652 0.1061  0.0145  0.0314  12 G   A "C5'" 
241  C "C4'" . G   A 12 ? 0.3853 0.5591 0.3394 0.1049  0.0151  0.0326  12 G   A "C4'" 
242  O "O4'" . G   A 12 ? 0.4221 0.5924 0.3765 0.1041  0.0157  0.0335  12 G   A "O4'" 
243  C "C3'" . G   A 12 ? 0.4730 0.6499 0.4293 0.1033  0.0152  0.0334  12 G   A "C3'" 
244  O "O3'" . G   A 12 ? 0.7405 0.9150 0.6967 0.1032  0.0155  0.0338  12 G   A "O3'" 
245  C "C2'" . G   A 12 ? 0.3790 0.5553 0.3369 0.1017  0.0156  0.0347  12 G   A "C2'" 
246  O "O2'" . G   A 12 ? 0.4623 0.6394 0.4222 0.0999  0.0159  0.0359  12 G   A "O2'" 
247  C "C1'" . G   A 12 ? 0.4259 0.5968 0.3825 0.1022  0.0161  0.0349  12 G   A "C1'" 
248  N N9    . G   A 12 ? 0.3846 0.5542 0.3419 0.1013  0.0165  0.0357  12 G   A N9    
249  C C8    . G   A 12 ? 0.3803 0.5520 0.3378 0.1014  0.0162  0.0355  12 G   A C8    
250  N N7    . G   A 12 ? 0.3331 0.5027 0.2912 0.1005  0.0167  0.0364  12 G   A N7    
251  C C5    . G   A 12 ? 0.2246 0.3906 0.1830 0.0998  0.0173  0.0373  12 G   A C5    
252  C C6    . G   A 12 ? 0.2553 0.4181 0.2145 0.0988  0.0179  0.0385  12 G   A C6    
253  O O6    . G   A 12 ? 0.1702 0.3325 0.1299 0.0982  0.0181  0.0390  12 G   A O6    
254  N N1    . G   A 12 ? 0.3424 0.5021 0.3016 0.0984  0.0185  0.0392  12 G   A N1    
255  C C2    . G   A 12 ? 0.2756 0.4354 0.2342 0.0990  0.0183  0.0388  12 G   A C2    
256  N N2    . G   A 12 ? 0.2245 0.3809 0.1832 0.0986  0.0189  0.0396  12 G   A N2    
257  N N3    . G   A 12 ? 0.3051 0.4680 0.2630 0.1000  0.0177  0.0376  12 G   A N3    
258  C C4    . G   A 12 ? 0.3038 0.4697 0.2617 0.1003  0.0172  0.0369  12 G   A C4    
259  P P     . A   A 13 ? 0.4875 0.6632 0.4424 0.1045  0.0151  0.0327  13 A   A P     
260  O OP1   . A   A 13 ? 0.5099 0.6908 0.4651 0.1050  0.0144  0.0317  13 A   A OP1   
261  O OP2   . A   A 13 ? 0.5262 0.7011 0.4820 0.1037  0.0154  0.0335  13 A   A OP2   
262  O "O5'" . A   A 13 ? 0.6156 0.7869 0.5680 0.1063  0.0151  0.0319  13 A   A "O5'" 
263  C "C5'" . A   A 13 ? 0.6351 0.8011 0.5868 0.1063  0.0158  0.0326  13 A   A "C5'" 
264  C "C4'" . A   A 13 ? 0.7977 0.9605 0.7469 0.1082  0.0158  0.0317  13 A   A "C4'" 
265  O "O4'" . A   A 13 ? 0.9220 1.0861 0.8699 0.1097  0.0152  0.0305  13 A   A "O4'" 
266  C "C3'" . A   A 13 ? 0.9704 1.1339 0.9190 0.1088  0.0155  0.0311  13 A   A "C3'" 
267  O "O3'" . A   A 13 ? 1.0122 1.1711 0.9589 0.1099  0.0158  0.0309  13 A   A "O3'" 
268  C "C2'" . A   A 13 ? 1.0798 1.2471 1.0276 0.1101  0.0147  0.0296  13 A   A "C2'" 
269  O "O2'" . A   A 13 ? 1.0796 1.2467 1.0259 0.1115  0.0143  0.0287  13 A   A "O2'" 
270  C "C1'" . A   A 13 ? 1.0810 1.2465 1.0276 0.1111  0.0147  0.0292  13 A   A "C1'" 
271  N N9    . A   A 13 ? 1.1872 1.3565 1.1336 0.1119  0.0140  0.0281  13 A   A N9    
272  C C8    . A   A 13 ? 1.2469 1.4153 1.1913 0.1138  0.0136  0.0270  13 A   A C8    
273  N N7    . A   A 13 ? 1.2735 1.4461 1.2181 0.1143  0.0130  0.0261  13 A   A N7    
274  C C5    . A   A 13 ? 1.2618 1.4384 1.2086 0.1127  0.0130  0.0267  13 A   A C5    
275  C C6    . A   A 13 ? 1.2499 1.4320 1.1981 0.1123  0.0125  0.0263  13 A   A C6    
276  N N6    . A   A 13 ? 1.2816 1.4663 1.2290 0.1136  0.0119  0.0250  13 A   A N6    
277  N N1    . A   A 13 ? 1.1919 1.3769 1.1423 0.1105  0.0126  0.0272  13 A   A N1    
278  C C2    . A   A 13 ? 1.1719 1.3544 1.1232 0.1093  0.0132  0.0284  13 A   A C2    
279  N N3    . A   A 13 ? 1.1947 1.3721 1.1449 0.1095  0.0137  0.0289  13 A   A N3    
280  C C4    . A   A 13 ? 1.2163 1.3909 1.1642 0.1112  0.0135  0.0280  13 A   A C4    
281  P P     . A   A 14 ? 1.1100 1.2660 1.0571 0.1091  0.0164  0.0319  14 A   A P     
282  O OP1   . A   A 14 ? 0.9720 1.1311 0.9214 0.1074  0.0164  0.0327  14 A   A OP1   
283  O OP2   . A   A 14 ? 1.1399 1.2938 1.0850 0.1107  0.0163  0.0310  14 A   A OP2   
284  O "O5'" . A   A 14 ? 1.2474 1.3993 1.1947 0.1085  0.0172  0.0331  14 A   A "O5'" 
285  C "C5'" . A   A 14 ? 1.1837 1.3314 1.1289 0.1099  0.0175  0.0328  14 A   A "C5'" 
286  C "C4'" . A   A 14 ? 1.0827 1.2294 1.0276 0.1101  0.0177  0.0329  14 A   A "C4'" 
287  O "O4'" . A   A 14 ? 1.0626 1.2086 1.0052 0.1120  0.0172  0.0316  14 A   A "O4'" 
288  C "C3'" . A   A 14 ? 1.0088 1.1513 0.9539 0.1094  0.0187  0.0342  14 A   A "C3'" 
289  O "O3'" . A   A 14 ? 1.0283 1.1717 0.9741 0.1089  0.0187  0.0346  14 A   A "O3'" 
290  C "C2'" . A   A 14 ? 1.0111 1.1496 0.9537 0.1112  0.0188  0.0337  14 A   A "C2'" 
291  O "O2'" . A   A 14 ? 1.0922 1.2270 1.0342 0.1113  0.0196  0.0344  14 A   A "O2'" 
292  C "C1'" . A   A 14 ? 1.0143 1.1554 0.9554 0.1128  0.0179  0.0320  14 A   A "C1'" 
293  N N9    . A   A 14 ? 0.9527 1.0918 0.8917 0.1145  0.0176  0.0311  14 A   A N9    
294  C C8    . A   A 14 ? 0.9171 1.0539 0.8539 0.1162  0.0175  0.0303  14 A   A C8    
295  N N7    . A   A 14 ? 0.9380 1.0733 0.8730 0.1176  0.0173  0.0296  14 A   A N7    
296  C C5    . A   A 14 ? 0.8795 1.0163 0.8156 0.1168  0.0172  0.0297  14 A   A C5    
297  C C6    . A   A 14 ? 0.7596 0.8958 0.6947 0.1177  0.0170  0.0291  14 A   A C6    
298  N N6    . A   A 14 ? 0.6998 0.8338 0.6325 0.1195  0.0168  0.0283  14 A   A N6    
299  N N1    . A   A 14 ? 0.7557 0.8937 0.6921 0.1167  0.0170  0.0295  14 A   A N1    
300  C C2    . A   A 14 ? 0.7247 0.8649 0.6635 0.1148  0.0172  0.0304  14 A   A C2    
301  N N3    . A   A 14 ? 0.7457 0.8867 0.6857 0.1138  0.0174  0.0310  14 A   A N3    
302  C C4    . A   A 14 ? 0.8669 1.0060 0.8054 0.1149  0.0174  0.0306  14 A   A C4    
303  P P     . G   A 15 ? 0.9447 1.0911 0.8932 0.1068  0.0188  0.0356  15 G   A P     
304  O OP1   . G   A 15 ? 0.7837 0.9282 0.7325 0.1063  0.0193  0.0365  15 G   A OP1   
305  O OP2   . G   A 15 ? 1.0152 1.1670 0.9645 0.1067  0.0179  0.0347  15 G   A OP2   
306  O "O5'" . G   A 15 ? 0.8283 0.9730 0.7779 0.1056  0.0194  0.0367  15 G   A "O5'" 
307  C "C5'" . G   A 15 ? 0.6944 0.8388 0.6461 0.1037  0.0199  0.0382  15 G   A "C5'" 
308  C "C4'" . G   A 15 ? 0.5246 0.6651 0.4765 0.1032  0.0208  0.0393  15 G   A "C4'" 
309  O "O4'" . G   A 15 ? 0.4709 0.6115 0.4219 0.1039  0.0205  0.0386  15 G   A "O4'" 
310  C "C3'" . G   A 15 ? 0.3954 0.5363 0.3497 0.1011  0.0212  0.0407  15 G   A "C3'" 
311  O "O3'" . G   A 15 ? 0.3176 0.4565 0.2726 0.1003  0.0219  0.0418  15 G   A "O3'" 
312  C "C2'" . G   A 15 ? 0.4067 0.5449 0.3609 0.1010  0.0217  0.0412  15 G   A "C2'" 
313  O "O2'" . G   A 15 ? 0.4637 0.5972 0.4171 0.1013  0.0227  0.0420  15 G   A "O2'" 
314  C "C1'" . G   A 15 ? 0.3546 0.4940 0.3069 0.1027  0.0210  0.0396  15 G   A "C1'" 
315  N N9    . G   A 15 ? 0.2509 0.3941 0.2041 0.1023  0.0204  0.0392  15 G   A N9    
316  C C8    . G   A 15 ? 0.1413 0.2886 0.0943 0.1028  0.0195  0.0380  15 G   A C8    
317  N N7    . G   A 15 ? 0.1406 0.2906 0.0944 0.1023  0.0191  0.0379  15 G   A N7    
318  C C5    . G   A 15 ? 0.2426 0.3900 0.1970 0.1015  0.0198  0.0389  15 G   A C5    
319  C C6    . G   A 15 ? 0.2573 0.4058 0.2126 0.1008  0.0197  0.0392  15 G   A C6    
320  O O6    . G   A 15 ? 0.2878 0.4397 0.2435 0.1008  0.0191  0.0386  15 G   A O6    
321  N N1    . G   A 15 ? 0.1381 0.2831 0.0938 0.1002  0.0205  0.0403  15 G   A N1    
322  C C2    . G   A 15 ? 0.2025 0.3436 0.1579 0.1002  0.0213  0.0411  15 G   A C2    
323  N N2    . G   A 15 ? 0.2765 0.4149 0.2326 0.0995  0.0221  0.0421  15 G   A N2    
324  N N3    . G   A 15 ? 0.1754 0.3154 0.1300 0.1008  0.0214  0.0408  15 G   A N3    
325  C C4    . G   A 15 ? 0.1704 0.3136 0.1244 0.1015  0.0206  0.0397  15 G   A C4    
326  P P     . G   A 16 ? 0.4798 0.6209 0.4375 0.0983  0.0219  0.0430  16 G   A P     
327  O OP1   . G   A 16 ? 0.5572 0.6964 0.5150 0.0981  0.0224  0.0437  16 G   A OP1   
328  O OP2   . G   A 16 ? 0.3980 0.5443 0.3565 0.0980  0.0210  0.0423  16 G   A OP2   
329  O "O5'" . G   A 16 ? 0.3528 0.4915 0.3118 0.0970  0.0227  0.0444  16 G   A "O5'" 
330  C "C5'" . G   A 16 ? 0.2526 0.3865 0.2111 0.0971  0.0237  0.0452  16 G   A "C5'" 
331  C "C4'" . G   A 16 ? 0.2337 0.3666 0.1938 0.0957  0.0242  0.0464  16 G   A "C4'" 
332  O "O4'" . G   A 16 ? 0.2167 0.3519 0.1764 0.0961  0.0235  0.0455  16 G   A "O4'" 
333  C "C3'" . G   A 16 ? 0.2613 0.3960 0.2240 0.0937  0.0242  0.0476  16 G   A "C3'" 
334  O "O3'" . G   A 16 ? 0.3873 0.5192 0.3513 0.0925  0.0250  0.0490  16 G   A "O3'" 
335  C "C2'" . G   A 16 ? 0.2457 0.3850 0.2090 0.0935  0.0232  0.0468  16 G   A "C2'" 
336  O "O2'" . G   A 16 ? 0.3605 0.5015 0.3261 0.0917  0.0232  0.0478  16 G   A "O2'" 
337  C "C1'" . G   A 16 ? 0.2632 0.4015 0.2250 0.0946  0.0232  0.0460  16 G   A "C1'" 
338  N N9    . G   A 16 ? 0.3099 0.4521 0.2711 0.0953  0.0222  0.0447  16 G   A N9    
339  C C8    . G   A 16 ? 0.1332 0.2786 0.0938 0.0961  0.0214  0.0435  16 G   A C8    
340  N N7    . G   A 16 ? 0.1336 0.2821 0.0939 0.0965  0.0207  0.0426  16 G   A N7    
341  C C5    . G   A 16 ? 0.1329 0.2803 0.0937 0.0959  0.0211  0.0431  16 G   A C5    
342  C C6    . G   A 16 ? 0.1330 0.2826 0.0938 0.0961  0.0206  0.0426  16 G   A C6    
343  O O6    . G   A 16 ? 0.1646 0.3175 0.1249 0.0968  0.0199  0.0415  16 G   A O6    
344  N N1    . G   A 16 ? 0.1323 0.2796 0.0937 0.0955  0.0212  0.0434  16 G   A N1    
345  C C2    . G   A 16 ? 0.2415 0.3852 0.2035 0.0947  0.0220  0.0447  16 G   A C2    
346  N N2    . G   A 16 ? 0.1310 0.2731 0.0935 0.0942  0.0225  0.0453  16 G   A N2    
347  N N3    . G   A 16 ? 0.1585 0.3001 0.1206 0.0945  0.0225  0.0453  16 G   A N3    
348  C C4    . G   A 16 ? 0.1557 0.2993 0.1171 0.0952  0.0220  0.0444  16 G   A C4    
349  P P     . A   A 17 ? 0.4345 0.4244 0.4273 0.0501  0.0301  0.0313  17 A   A P     
350  O OP1   . A   A 17 ? 0.4562 0.4458 0.4529 0.0498  0.0294  0.0319  17 A   A OP1   
351  O OP2   . A   A 17 ? 0.2696 0.2598 0.2607 0.0497  0.0320  0.0316  17 A   A OP2   
352  O "O5'" . A   A 17 ? 0.4176 0.4081 0.4092 0.0506  0.0299  0.0312  17 A   A "O5'" 
353  C "C5'" . A   A 17 ? 0.4011 0.3914 0.3940 0.0511  0.0281  0.0309  17 A   A "C5'" 
354  C "C4'" . A   A 17 ? 0.3909 0.3819 0.3828 0.0513  0.0285  0.0312  17 A   A "C4'" 
355  O "O4'" . A   A 17 ? 0.4348 0.4263 0.4230 0.0520  0.0287  0.0307  17 A   A "O4'" 
356  C "C3'" . A   A 17 ? 0.3477 0.3392 0.3403 0.0505  0.0303  0.0322  17 A   A "C3'" 
357  O "O3'" . A   A 17 ? 0.4313 0.4232 0.4250 0.0506  0.0299  0.0326  17 A   A "O3'" 
358  C "C2'" . A   A 17 ? 0.2990 0.2910 0.2884 0.0506  0.0315  0.0321  17 A   A "C2'" 
359  O "O2'" . A   A 17 ? 0.1983 0.1909 0.1876 0.0503  0.0328  0.0329  17 A   A "O2'" 
360  C "C1'" . A   A 17 ? 0.3628 0.3551 0.3500 0.0517  0.0303  0.0313  17 A   A "C1'" 
361  N N9    . A   A 17 ? 0.3048 0.2974 0.2886 0.0520  0.0309  0.0310  17 A   A N9    
362  C C8    . A   A 17 ? 0.3379 0.3304 0.3203 0.0516  0.0320  0.0311  17 A   A C8    
363  N N7    . A   A 17 ? 0.2788 0.2717 0.2582 0.0521  0.0321  0.0307  17 A   A N7    
364  C C5    . A   A 17 ? 0.2515 0.2450 0.2301 0.0530  0.0311  0.0304  17 A   A C5    
365  C C6    . A   A 17 ? 0.2515 0.2457 0.2271 0.0539  0.0308  0.0301  17 A   A C6    
366  N N6    . A   A 17 ? 0.2648 0.2593 0.2379 0.0540  0.0314  0.0301  17 A   A N6    
367  N N1    . A   A 17 ? 0.1425 0.1371 0.1179 0.0548  0.0298  0.0299  17 A   A N1    
368  C C2    . A   A 17 ? 0.1183 0.1125 0.0964 0.0547  0.0290  0.0299  17 A   A C2    
369  N N3    . A   A 17 ? 0.2181 0.2116 0.1992 0.0538  0.0291  0.0303  17 A   A N3    
370  C C4    . A   A 17 ? 0.2898 0.2830 0.2710 0.0530  0.0303  0.0305  17 A   A C4    
371  P P     . G   A 18 ? 0.3990 0.3903 0.3953 0.0509  0.0279  0.0326  18 G   A P     
372  O OP1   . G   A 18 ? 0.4582 0.4486 0.4567 0.0507  0.0268  0.0324  18 G   A OP1   
373  O OP2   . G   A 18 ? 0.3829 0.3747 0.3808 0.0505  0.0285  0.0334  18 G   A OP2   
374  O "O5'" . G   A 18 ? 0.5186 0.5100 0.5123 0.0520  0.0265  0.0317  18 G   A "O5'" 
375  C "C5'" . G   A 18 ? 0.4465 0.4371 0.4413 0.0526  0.0242  0.0313  18 G   A "C5'" 
376  C "C4'" . G   A 18 ? 0.4139 0.4035 0.4087 0.0530  0.0226  0.0304  18 G   A "C4'" 
377  O "O4'" . G   A 18 ? 0.3657 0.3558 0.3569 0.0537  0.0231  0.0296  18 G   A "O4'" 
378  C "C3'" . G   A 18 ? 0.4453 0.4338 0.4413 0.0537  0.0198  0.0298  18 G   A "C3'" 
379  O "O3'" . G   A 18 ? 0.6437 0.6310 0.6422 0.0533  0.0186  0.0297  18 G   A "O3'" 
380  C "C2'" . G   A 18 ? 0.3460 0.3347 0.3383 0.0549  0.0191  0.0288  18 G   A "C2'" 
381  O "O2'" . G   A 18 ? 0.3731 0.3604 0.3657 0.0556  0.0165  0.0280  18 G   A "O2'" 
382  C "C1'" . G   A 18 ? 0.2772 0.2665 0.2674 0.0547  0.0210  0.0287  18 G   A "C1'" 
383  N N9    . G   A 18 ? 0.1986 0.1887 0.1847 0.0556  0.0214  0.0281  18 G   A N9    
384  C C8    . G   A 18 ? 0.2455 0.2358 0.2295 0.0569  0.0203  0.0276  18 G   A C8    
385  N N7    . G   A 18 ? 0.1487 0.1399 0.1290 0.0576  0.0211  0.0272  18 G   A N7    
386  C C5    . G   A 18 ? 0.1404 0.1318 0.1204 0.0568  0.0228  0.0274  18 G   A C5    
387  C C6    . G   A 18 ? 0.1402 0.1325 0.1170 0.0570  0.0241  0.0273  18 G   A C6    
388  O O6    . G   A 18 ? 0.1819 0.1750 0.1555 0.0580  0.0241  0.0270  18 G   A O6    
389  N N1    . G   A 18 ? 0.1030 0.0952 0.0807 0.0559  0.0254  0.0276  18 G   A N1    
390  C C2    . G   A 18 ? 0.1906 0.1821 0.1716 0.0549  0.0256  0.0281  18 G   A C2    
391  N N2    . G   A 18 ? 0.2266 0.2180 0.2075 0.0541  0.0270  0.0284  18 G   A N2    
392  N N3    . G   A 18 ? 0.1290 0.1199 0.1131 0.0547  0.0245  0.0283  18 G   A N3    
393  C C4    . G   A 18 ? 0.1362 0.1270 0.1196 0.0556  0.0230  0.0279  18 G   A C4    
394  P P     . U   A 19 ? 0.5418 0.5283 0.5448 0.0525  0.0176  0.0306  19 U   A P     
395  O OP1   . U   A 19 ? 0.5501 0.5377 0.5540 0.0515  0.0201  0.0317  19 U   A OP1   
396  O OP2   . U   A 19 ? 0.2834 0.2691 0.2872 0.0530  0.0153  0.0304  19 U   A OP2   
397  O "O5'" . U   A 19 ? 0.8945 0.8798 0.8993 0.0523  0.0162  0.0303  19 U   A "O5'" 
398  C "C5'" . U   A 19 ? 0.9034 0.8875 0.9074 0.0531  0.0137  0.0293  19 U   A "C5'" 
399  C "C4'" . U   A 19 ? 0.9235 0.9067 0.9295 0.0527  0.0127  0.0292  19 U   A "C4'" 
400  O "O4'" . U   A 19 ? 1.0022 0.9847 1.0124 0.0520  0.0117  0.0301  19 U   A "O4'" 
401  C "C3'" . U   A 19 ? 0.9406 0.9248 0.9455 0.0523  0.0153  0.0294  19 U   A "C3'" 
402  O "O3'" . U   A 19 ? 1.0039 0.9872 1.0090 0.0525  0.0140  0.0288  19 U   A "O3'" 
403  C "C2'" . U   A 19 ? 0.9807 0.9653 0.9888 0.0512  0.0165  0.0307  19 U   A "C2'" 
404  O "O2'" . U   A 19 ? 1.0066 0.9917 1.0152 0.0507  0.0181  0.0312  19 U   A "O2'" 
405  C "C1'" . U   A 19 ? 1.0718 1.0549 1.0833 0.0511  0.0137  0.0310  19 U   A "C1'" 
406  N N1    . U   A 19 ? 1.1744 1.1578 1.1890 0.0503  0.0142  0.0322  19 U   A N1    
407  C C2    . U   A 19 ? 1.1606 1.1438 1.1782 0.0497  0.0142  0.0332  19 U   A C2    
408  O O2    . U   A 19 ? 1.1111 1.0938 1.1290 0.0497  0.0138  0.0329  19 U   A O2    
409  N N3    . U   A 19 ? 1.1189 1.1025 1.1392 0.0490  0.0149  0.0344  19 U   A N3    
410  C C4    . U   A 19 ? 1.0511 1.0351 1.0713 0.0489  0.0154  0.0348  19 U   A C4    
411  O O4    . U   A 19 ? 0.9381 0.9225 0.9609 0.0482  0.0160  0.0359  19 U   A O4    
412  C C5    . U   A 19 ? 1.0963 1.0804 1.1133 0.0496  0.0152  0.0337  19 U   A C5    
413  C C6    . U   A 19 ? 1.1566 1.1405 1.1709 0.0503  0.0147  0.0326  19 U   A C6    
414  P P     . G   A 20 ? 0.7461 0.7296 0.7471 0.0533  0.0142  0.0276  20 G   A P     
415  O OP1   . G   A 20 ? 0.7380 0.7231 0.7360 0.0532  0.0171  0.0277  20 G   A OP1   
416  O OP2   . G   A 20 ? 0.6756 0.6582 0.6777 0.0533  0.0130  0.0272  20 G   A OP2   
417  O "O5'" . G   A 20 ? 0.3564 0.3393 0.3559 0.0544  0.0120  0.0267  20 G   A "O5'" 
418  C "C5'" . G   A 20 ? 0.3305 0.3116 0.3323 0.0547  0.0088  0.0264  20 G   A "C5'" 
419  C "C4'" . G   A 20 ? 0.3179 0.2986 0.3168 0.0560  0.0072  0.0254  20 G   A "C4'" 
420  O "O4'" . G   A 20 ? 0.3478 0.3288 0.3433 0.0567  0.0077  0.0244  20 G   A "O4'" 
421  C "C3'" . G   A 20 ? 0.4354 0.4174 0.4319 0.0565  0.0085  0.0255  20 G   A "C3'" 
422  O "O3'" . G   A 20 ? 0.4882 0.4695 0.4865 0.0566  0.0068  0.0258  20 G   A "O3'" 
423  C "C2'" . G   A 20 ? 0.5040 0.4865 0.4957 0.0578  0.0088  0.0245  20 G   A "C2'" 
424  O "O2'" . G   A 20 ? 0.6097 0.5913 0.6004 0.0589  0.0064  0.0238  20 G   A "O2'" 
425  C "C1'" . G   A 20 ? 0.3415 0.3234 0.3328 0.0578  0.0083  0.0238  20 G   A "C1'" 
426  N N9    . G   A 20 ? 0.2176 0.2009 0.2054 0.0579  0.0109  0.0236  20 G   A N9    
427  C C8    . G   A 20 ? 0.2704 0.2544 0.2586 0.0570  0.0129  0.0240  20 G   A C8    
428  N N7    . G   A 20 ? 0.2407 0.2258 0.2251 0.0574  0.0147  0.0237  20 G   A N7    
429  C C5    . G   A 20 ? 0.1638 0.1491 0.1451 0.0586  0.0138  0.0230  20 G   A C5    
430  C C6    . G   A 20 ? 0.1839 0.1704 0.1606 0.0596  0.0149  0.0225  20 G   A C6    
431  O O6    . G   A 20 ? 0.2277 0.2152 0.2022 0.0594  0.0168  0.0226  20 G   A O6    
432  N N1    . G   A 20 ? 0.1797 0.1660 0.1543 0.0609  0.0135  0.0220  20 G   A N1    
433  C C2    . G   A 20 ? 0.1965 0.1816 0.1732 0.0612  0.0113  0.0219  20 G   A C2    
434  N N2    . G   A 20 ? 0.1534 0.1386 0.1273 0.0626  0.0102  0.0213  20 G   A N2    
435  N N3    . G   A 20 ? 0.1143 0.0982 0.0955 0.0602  0.0101  0.0224  20 G   A N3    
436  C C4    . G   A 20 ? 0.1268 0.1110 0.1101 0.0590  0.0115  0.0229  20 G   A C4    
437  P P     . G   A 21 ? 0.5960 0.5787 0.5939 0.0563  0.0087  0.0266  21 G   A P     
438  O OP1   . G   A 21 ? 0.6699 0.6516 0.6715 0.0559  0.0070  0.0273  21 G   A OP1   
439  O OP2   . G   A 21 ? 0.4633 0.4474 0.4602 0.0556  0.0118  0.0272  21 G   A OP2   
440  O "O5'" . G   A 21 ? 0.3944 0.3778 0.3878 0.0577  0.0088  0.0259  21 G   A "O5'" 
441  C "C5'" . G   A 21 ? 0.3551 0.3375 0.3469 0.0590  0.0064  0.0250  21 G   A "C5'" 
442  C "C4'" . G   A 21 ? 0.3252 0.3089 0.3122 0.0603  0.0075  0.0245  21 G   A "C4'" 
443  O "O4'" . G   A 21 ? 0.3590 0.3437 0.3428 0.0606  0.0092  0.0240  21 G   A "O4'" 
444  C "C3'" . G   A 21 ? 0.3026 0.2879 0.2892 0.0600  0.0096  0.0254  21 G   A "C3'" 
445  O "O3'" . G   A 21 ? 0.5004 0.4862 0.4836 0.0614  0.0092  0.0249  21 G   A "O3'" 
446  C "C2'" . G   A 21 ? 0.3103 0.2971 0.2951 0.0595  0.0125  0.0257  21 G   A "C2'" 
447  O "O2'" . G   A 21 ? 0.3699 0.3585 0.3528 0.0597  0.0145  0.0263  21 G   A "O2'" 
448  C "C1'" . G   A 21 ? 0.3183 0.3048 0.2999 0.0605  0.0119  0.0245  21 G   A "C1'" 
449  N N9    . G   A 21 ? 0.2171 0.2045 0.1977 0.0599  0.0139  0.0246  21 G   A N9    
450  C C8    . G   A 21 ? 0.1572 0.1444 0.1403 0.0586  0.0149  0.0251  21 G   A C8    
451  N N7    . G   A 21 ? 0.2051 0.1931 0.1860 0.0585  0.0166  0.0249  21 G   A N7    
452  C C5    . G   A 21 ? 0.1105 0.0993 0.0873 0.0598  0.0168  0.0244  21 G   A C5    
453  C C6    . G   A 21 ? 0.1102 0.1000 0.0833 0.0602  0.0182  0.0241  21 G   A C6    
454  O O6    . G   A 21 ? 0.1088 0.0989 0.0816 0.0595  0.0196  0.0243  21 G   A O6    
455  N N1    . G   A 21 ? 0.1119 0.1025 0.0815 0.0616  0.0179  0.0237  21 G   A N1    
456  C C2    . G   A 21 ? 0.1137 0.1040 0.0831 0.0626  0.0163  0.0235  21 G   A C2    
457  N N2    . G   A 21 ? 0.1699 0.1611 0.1355 0.0640  0.0163  0.0231  21 G   A N2    
458  N N3    . G   A 21 ? 0.1554 0.1446 0.1282 0.0621  0.0149  0.0237  21 G   A N3    
459  C C4    . G   A 21 ? 0.1545 0.1429 0.1309 0.0607  0.0152  0.0241  21 G   A C4    
460  P P     . C   A 22 ? 0.4803 0.4651 0.4646 0.0620  0.0068  0.0249  22 C   A P     
461  O OP1   . C   A 22 ? 0.4455 0.4287 0.4349 0.0609  0.0051  0.0254  22 C   A OP1   
462  O OP2   . C   A 22 ? 0.4905 0.4770 0.4730 0.0625  0.0084  0.0255  22 C   A OP2   
463  O "O5'" . C   A 22 ? 0.3738 0.3576 0.3550 0.0637  0.0046  0.0236  22 C   A "O5'" 
464  C "C5'" . C   A 22 ? 0.4271 0.4093 0.4091 0.0637  0.0027  0.0228  22 C   A "C5'" 
465  C "C4'" . C   A 22 ? 0.5285 0.5094 0.5081 0.0653  0.0000  0.0217  22 C   A "C4'" 
466  O "O4'" . C   A 22 ? 0.6288 0.6106 0.6064 0.0663  0.0002  0.0219  22 C   A "O4'" 
467  C "C3'" . C   A 22 ? 0.5980 0.5766 0.5817 0.0648  -0.0031 0.0217  22 C   A "C3'" 
468  O "O3'" . C   A 22 ? 0.5042 0.4816 0.4858 0.0659  -0.0049 0.0205  22 C   A "O3'" 
469  C "C2'" . C   A 22 ? 0.7662 0.7444 0.7503 0.0654  -0.0047 0.0219  22 C   A "C2'" 
470  O "O2'" . C   A 22 ? 0.8691 0.8453 0.8533 0.0663  -0.0078 0.0212  22 C   A "O2'" 
471  C "C1'" . C   A 22 ? 0.7171 0.6972 0.6962 0.0667  -0.0026 0.0217  22 C   A "C1'" 
472  N N1    . C   A 22 ? 0.6853 0.6662 0.6655 0.0665  -0.0021 0.0226  22 C   A N1    
473  C C2    . C   A 22 ? 0.6964 0.6764 0.6761 0.0675  -0.0042 0.0223  22 C   A C2    
474  O O2    . C   A 22 ? 0.8066 0.7850 0.7849 0.0686  -0.0066 0.0213  22 C   A O2    
475  N N3    . C   A 22 ? 0.6474 0.6281 0.6281 0.0674  -0.0037 0.0231  22 C   A N3    
476  C C4    . C   A 22 ? 0.6669 0.6492 0.6490 0.0662  -0.0012 0.0242  22 C   A C4    
477  N N4    . C   A 22 ? 0.6638 0.6467 0.6468 0.0661  -0.0007 0.0250  22 C   A N4    
478  C C5    . C   A 22 ? 0.6940 0.6773 0.6766 0.0652  0.0011  0.0245  22 C   A C5    
479  C C6    . C   A 22 ? 0.6942 0.6767 0.6757 0.0654  0.0006  0.0237  22 C   A C6    
480  P P     . U   A 23 ? 0.7701 0.7464 0.7543 0.0649  -0.0057 0.0204  23 U   A P     
481  O OP1   . U   A 23 ? 0.7368 0.7135 0.7253 0.0631  -0.0042 0.0216  23 U   A OP1   
482  O OP2   . U   A 23 ? 0.7937 0.7678 0.7790 0.0655  -0.0090 0.0198  23 U   A OP2   
483  O "O5'" . U   A 23 ? 0.6700 0.6475 0.6489 0.0659  -0.0038 0.0194  23 U   A "O5'" 
484  C "C5'" . U   A 23 ? 0.6108 0.5882 0.5845 0.0678  -0.0046 0.0181  23 U   A "C5'" 
485  C "C4'" . U   A 23 ? 0.5017 0.4805 0.4711 0.0684  -0.0025 0.0174  23 U   A "C4'" 
486  O "O4'" . U   A 23 ? 0.4948 0.4727 0.4657 0.0677  -0.0029 0.0172  23 U   A "O4'" 
487  C "C3'" . U   A 23 ? 0.4595 0.4405 0.4284 0.0677  0.0008  0.0184  23 U   A "C3'" 
488  O "O3'" . U   A 23 ? 0.3138 0.2963 0.2795 0.0688  0.0019  0.0185  23 U   A "O3'" 
489  C "C2'" . U   A 23 ? 0.5098 0.4915 0.4767 0.0676  0.0023  0.0179  23 U   A "C2'" 
490  O "O2'" . U   A 23 ? 0.5742 0.5567 0.5355 0.0694  0.0025  0.0169  23 U   A "O2'" 
491  C "C1'" . U   A 23 ? 0.4793 0.4589 0.4489 0.0671  -0.0001 0.0174  23 U   A "C1'" 
492  N N1    . U   A 23 ? 0.3911 0.3704 0.3657 0.0653  0.0005  0.0184  23 U   A N1    
493  C C2    . U   A 23 ? 0.3821 0.3624 0.3559 0.0646  0.0027  0.0186  23 U   A C2    
494  O O2    . U   A 23 ? 0.5291 0.5107 0.4986 0.0654  0.0042  0.0180  23 U   A O2    
495  N N3    . U   A 23 ? 0.2387 0.2187 0.2171 0.0630  0.0031  0.0194  23 U   A N3    
496  C C4    . U   A 23 ? 0.3692 0.3480 0.3528 0.0620  0.0015  0.0202  23 U   A C4    
497  O O4    . U   A 23 ? 0.4469 0.4256 0.4340 0.0607  0.0021  0.0209  23 U   A O4    
498  C C5    . U   A 23 ? 0.3523 0.3300 0.3365 0.0627  -0.0009 0.0200  23 U   A C5    
499  C C6    . U   A 23 ? 0.3591 0.3370 0.3388 0.0643  -0.0013 0.0191  23 U   A C6    
500  P P     . G   A 24 ? 0.2483 0.2333 0.2133 0.0682  0.0052  0.0196  24 G   A P     
501  O OP1   . G   A 24 ? 0.1919 0.1777 0.1559 0.0691  0.0053  0.0200  24 G   A OP1   
502  O OP2   . G   A 24 ? 0.4167 0.4017 0.3861 0.0663  0.0064  0.0206  24 G   A OP2   
503  O "O5'" . G   A 24 ? 0.2155 0.2018 0.1756 0.0693  0.0068  0.0190  24 G   A "O5'" 
504  C "C5'" . G   A 24 ? 0.1673 0.1537 0.1226 0.0713  0.0059  0.0178  24 G   A "C5'" 
505  C "C4'" . G   A 24 ? 0.2400 0.2278 0.1915 0.0719  0.0077  0.0175  24 G   A "C4'" 
506  O "O4'" . G   A 24 ? 0.2325 0.2193 0.1857 0.0708  0.0075  0.0172  24 G   A "O4'" 
507  C "C3'" . G   A 24 ? 0.3419 0.3322 0.2927 0.0714  0.0107  0.0187  24 G   A "C3'" 
508  O "O3'" . G   A 24 ? 0.3737 0.3656 0.3213 0.0728  0.0115  0.0190  24 G   A "O3'" 
509  C "C2'" . G   A 24 ? 0.3440 0.3348 0.2933 0.0711  0.0119  0.0185  24 G   A "C2'" 
510  O "O2'" . G   A 24 ? 0.4832 0.4746 0.4275 0.0729  0.0118  0.0175  24 G   A "O2'" 
511  C "C1'" . G   A 24 ? 0.2423 0.2308 0.1943 0.0702  0.0100  0.0177  24 G   A "C1'" 
512  N N9    . G   A 24 ? 0.1530 0.1413 0.1094 0.0682  0.0111  0.0188  24 G   A N9    
513  C C8    . G   A 24 ? 0.1337 0.1212 0.0947 0.0670  0.0104  0.0194  24 G   A C8    
514  N N7    . G   A 24 ? 0.2093 0.1970 0.1732 0.0654  0.0118  0.0202  24 G   A N7    
515  C C5    . G   A 24 ? 0.2361 0.2248 0.1971 0.0655  0.0134  0.0201  24 G   A C5    
516  C C6    . G   A 24 ? 0.2184 0.2076 0.1803 0.0642  0.0153  0.0206  24 G   A C6    
517  O O6    . G   A 24 ? 0.1430 0.1319 0.1085 0.0627  0.0160  0.0214  24 G   A O6    
518  N N1    . G   A 24 ? 0.2127 0.2029 0.1709 0.0648  0.0163  0.0203  24 G   A N1    
519  C C2    . G   A 24 ? 0.2358 0.2264 0.1897 0.0665  0.0157  0.0195  24 G   A C2    
520  N N2    . G   A 24 ? 0.1182 0.1098 0.0689 0.0668  0.0168  0.0194  24 G   A N2    
521  N N3    . G   A 24 ? 0.2783 0.2684 0.2311 0.0678  0.0141  0.0189  24 G   A N3    
522  C C4    . G   A 24 ? 0.2107 0.1999 0.1672 0.0672  0.0130  0.0192  24 G   A C4    
523  P P     . G   A 25 ? 0.5640 0.5576 0.5134 0.0721  0.0133  0.0205  25 G   A P     
524  O OP1   . G   A 25 ? 0.6029 0.5975 0.5492 0.0740  0.0130  0.0203  25 G   A OP1   
525  O OP2   . G   A 25 ? 0.5769 0.5693 0.5314 0.0704  0.0127  0.0211  25 G   A OP2   
526  O "O5'" . G   A 25 ? 0.3514 0.3472 0.2998 0.0715  0.0161  0.0215  25 G   A "O5'" 
527  C "C5'" . G   A 25 ? 0.1822 0.1797 0.1263 0.0729  0.0172  0.0214  25 G   A "C5'" 
528  C "C4'" . G   A 25 ? 0.1238 0.1221 0.0672 0.0720  0.0189  0.0219  25 G   A "C4'" 
529  O "O4'" . G   A 25 ? 0.2254 0.2219 0.1703 0.0711  0.0179  0.0211  25 G   A "O4'" 
530  C "C3'" . G   A 25 ? 0.1964 0.1961 0.1421 0.0705  0.0211  0.0236  25 G   A "C3'" 
531  O "O3'" . G   A 25 ? 0.2856 0.2875 0.2295 0.0712  0.0226  0.0247  25 G   A "O3'" 
532  C "C2'" . G   A 25 ? 0.2753 0.2746 0.2209 0.0694  0.0218  0.0235  25 G   A "C2'" 
533  O "O2'" . G   A 25 ? 0.3699 0.3705 0.3115 0.0705  0.0226  0.0236  25 G   A "O2'" 
534  C "C1'" . G   A 25 ? 0.2639 0.2609 0.2101 0.0695  0.0197  0.0220  25 G   A "C1'" 
535  N N9    . G   A 25 ? 0.2852 0.2807 0.2359 0.0678  0.0194  0.0222  25 G   A N9    
536  C C8    . G   A 25 ? 0.2593 0.2538 0.2133 0.0673  0.0182  0.0223  25 G   A C8    
537  N N7    . G   A 25 ? 0.2184 0.2119 0.1761 0.0657  0.0183  0.0226  25 G   A N7    
538  C C5    . G   A 25 ? 0.2548 0.2487 0.2116 0.0651  0.0197  0.0228  25 G   A C5    
539  C C6    . G   A 25 ? 0.2844 0.2777 0.2440 0.0635  0.0204  0.0231  25 G   A C6    
540  O O6    . G   A 25 ? 0.2991 0.2915 0.2624 0.0623  0.0202  0.0234  25 G   A O6    
541  N N1    . G   A 25 ? 0.2647 0.2586 0.2221 0.0633  0.0216  0.0232  25 G   A N1    
542  C C2    . G   A 25 ? 0.2436 0.2386 0.1969 0.0644  0.0220  0.0230  25 G   A C2    
543  N N2    . G   A 25 ? 0.1120 0.1073 0.0640 0.0639  0.0230  0.0232  25 G   A N2    
544  N N3    . G   A 25 ? 0.2657 0.2614 0.2165 0.0660  0.0214  0.0227  25 G   A N3    
545  C C4    . G   A 25 ? 0.2913 0.2864 0.2439 0.0662  0.0203  0.0226  25 G   A C4    
546  P P     . G   A 26 ? 0.4746 0.4777 0.4214 0.0703  0.0238  0.0262  26 G   A P     
547  O OP1   . G   A 26 ? 0.3757 0.3788 0.3247 0.0684  0.0253  0.0272  26 G   A OP1   
548  O OP2   . G   A 26 ? 0.5637 0.5688 0.5079 0.0719  0.0245  0.0268  26 G   A OP2   
549  O "O5'" . G   A 26 ? 0.2591 0.2603 0.2088 0.0699  0.0220  0.0256  26 G   A "O5'" 
550  C "C5'" . G   A 26 ? 0.2757 0.2775 0.2271 0.0699  0.0222  0.0264  26 G   A "C5'" 
551  C "C4'" . G   A 26 ? 0.3209 0.3208 0.2763 0.0687  0.0210  0.0263  26 G   A "C4'" 
552  O "O4'" . G   A 26 ? 0.3614 0.3608 0.3196 0.0668  0.0220  0.0268  26 G   A "O4'" 
553  C "C3'" . G   A 26 ? 0.3387 0.3363 0.2943 0.0692  0.0184  0.0248  26 G   A "C3'" 
554  O "O3'" . G   A 26 ? 0.5120 0.5088 0.4704 0.0689  0.0172  0.0250  26 G   A "O3'" 
555  C "C2'" . G   A 26 ? 0.3209 0.3172 0.2785 0.0678  0.0184  0.0245  26 G   A "C2'" 
556  O "O2'" . G   A 26 ? 0.4234 0.4176 0.3835 0.0674  0.0162  0.0237  26 G   A "O2'" 
557  C "C1'" . G   A 26 ? 0.3537 0.3510 0.3139 0.0662  0.0205  0.0259  26 G   A "C1'" 
558  N N9    . G   A 26 ? 0.2356 0.2328 0.1962 0.0651  0.0216  0.0260  26 G   A N9    
559  C C8    . G   A 26 ? 0.1355 0.1338 0.0932 0.0654  0.0228  0.0261  26 G   A C8    
560  N N7    . G   A 26 ? 0.1610 0.1587 0.1196 0.0642  0.0235  0.0261  26 G   A N7    
561  C C5    . G   A 26 ? 0.1960 0.1923 0.1584 0.0631  0.0229  0.0261  26 G   A C5    
562  C C6    . G   A 26 ? 0.2519 0.2473 0.2169 0.0616  0.0233  0.0262  26 G   A C6    
563  O O6    . G   A 26 ? 0.2367 0.2321 0.2010 0.0610  0.0243  0.0262  26 G   A O6    
564  N N1    . G   A 26 ? 0.2489 0.2431 0.2175 0.0609  0.0224  0.0262  26 G   A N1    
565  C C2    . G   A 26 ? 0.1490 0.1429 0.1188 0.0614  0.0211  0.0262  26 G   A C2    
566  N N2    . G   A 26 ? 0.1698 0.1626 0.1434 0.0604  0.0203  0.0264  26 G   A N2    
567  N N3    . G   A 26 ? 0.1607 0.1554 0.1281 0.0627  0.0206  0.0261  26 G   A N3    
568  C C4    . G   A 26 ? 0.1981 0.1941 0.1618 0.0635  0.0216  0.0260  26 G   A C4    
569  P P     . U   A 27 ? 0.5991 0.5960 0.5554 0.0707  0.0158  0.0246  27 U   A P     
570  O OP1   . U   A 27 ? 0.6194 0.6187 0.5720 0.0720  0.0175  0.0251  27 U   A OP1   
571  O OP2   . U   A 27 ? 0.5637 0.5583 0.5196 0.0714  0.0131  0.0232  27 U   A OP2   
572  O "O5'" . U   A 27 ? 0.9827 0.9795 0.9425 0.0698  0.0158  0.0256  27 U   A "O5'" 
573  C "C5'" . U   A 27 ? 1.0940 1.0921 1.0562 0.0683  0.0179  0.0271  27 U   A "C5'" 
574  C "C4'" . U   A 27 ? 1.2767 1.2733 1.2434 0.0666  0.0173  0.0274  27 U   A "C4'" 
575  O "O4'" . U   A 27 ? 1.3416 1.3368 1.3092 0.0673  0.0149  0.0269  27 U   A "O4'" 
576  C "C3'" . U   A 27 ? 1.3778 1.3756 1.3471 0.0653  0.0192  0.0288  27 U   A "C3'" 
577  O "O3'" . U   A 27 ? 1.3607 1.3575 1.3337 0.0635  0.0196  0.0292  27 U   A "O3'" 
578  C "C2'" . U   A 27 ? 1.4237 1.4216 1.3936 0.0659  0.0182  0.0291  27 U   A "C2'" 
579  O "O2'" . U   A 27 ? 1.4200 1.4180 1.3933 0.0646  0.0190  0.0302  27 U   A "O2'" 
580  C "C1'" . U   A 27 ? 1.4272 1.4228 1.3973 0.0666  0.0153  0.0279  27 U   A "C1'" 
581  N N1    . U   A 27 ? 1.5322 1.5280 1.5005 0.0681  0.0141  0.0277  27 U   A N1    
582  C C2    . U   A 27 ? 1.5863 1.5809 1.5571 0.0678  0.0124  0.0278  27 U   A C2    
583  O O2    . U   A 27 ? 1.5895 1.5828 1.5642 0.0664  0.0118  0.0281  27 U   A O2    
584  N N3    . U   A 27 ? 1.6122 1.6072 1.5808 0.0694  0.0115  0.0276  27 U   A N3    
585  C C4    . U   A 27 ? 1.6106 1.6072 1.5748 0.0712  0.0122  0.0274  27 U   A C4    
586  O O4    . U   A 27 ? 1.6406 1.6374 1.6032 0.0725  0.0113  0.0272  27 U   A O4    
587  C C5    . U   A 27 ? 1.5645 1.5624 1.5265 0.0713  0.0140  0.0274  27 U   A C5    
588  C C6    . U   A 27 ? 1.5541 1.5516 1.5183 0.0697  0.0149  0.0275  27 U   A C6    
589  P P     . U   A 28 ? 0.7154 0.7100 0.6905 0.0628  0.0180  0.0283  28 U   A P     
590  O OP1   . U   A 28 ? 0.7825 0.7764 0.7618 0.0613  0.0182  0.0291  28 U   A OP1   
591  O OP2   . U   A 28 ? 0.7608 0.7539 0.7347 0.0639  0.0155  0.0271  28 U   A OP2   
592  O "O5'" . U   A 28 ? 0.4437 0.4388 0.4178 0.0622  0.0196  0.0283  28 U   A "O5'" 
593  C "C5'" . U   A 28 ? 0.3632 0.3596 0.3334 0.0631  0.0207  0.0281  28 U   A "C5'" 
594  C "C4'" . U   A 28 ? 0.2554 0.2526 0.2258 0.0620  0.0229  0.0288  28 U   A "C4'" 
595  O "O4'" . U   A 28 ? 0.1849 0.1807 0.1576 0.0608  0.0226  0.0284  28 U   A "O4'" 
596  C "C3'" . U   A 28 ? 0.2512 0.2498 0.2231 0.0611  0.0248  0.0302  28 U   A "C3'" 
597  O "O3'" . U   A 28 ? 0.2635 0.2632 0.2336 0.0609  0.0266  0.0306  28 U   A "O3'" 
598  C "C2'" . U   A 28 ? 0.1751 0.1724 0.1507 0.0595  0.0249  0.0304  28 U   A "C2'" 
599  O "O2'" . U   A 28 ? 0.1048 0.1028 0.0817 0.0583  0.0268  0.0314  28 U   A "O2'" 
600  C "C1'" . U   A 28 ? 0.1069 0.1030 0.0820 0.0594  0.0242  0.0294  28 U   A "C1'" 
601  N N1    . U   A 28 ? 0.1775 0.1721 0.1561 0.0583  0.0235  0.0294  28 U   A N1    
602  C C2    . U   A 28 ? 0.2460 0.2402 0.2257 0.0572  0.0245  0.0295  28 U   A C2    
603  O O2    . U   A 28 ? 0.1545 0.1494 0.1323 0.0571  0.0259  0.0296  28 U   A O2    
604  N N3    . U   A 28 ? 0.2665 0.2596 0.2497 0.0563  0.0239  0.0296  28 U   A N3    
605  C C4    . U   A 28 ? 0.2551 0.2474 0.2408 0.0563  0.0223  0.0296  28 U   A C4    
606  O O4    . U   A 28 ? 0.4162 0.4075 0.4049 0.0555  0.0219  0.0298  28 U   A O4    
607  C C5    . U   A 28 ? 0.2604 0.2529 0.2447 0.0574  0.0211  0.0294  28 U   A C5    
608  C C6    . U   A 28 ? 0.2024 0.1961 0.1833 0.0584  0.0219  0.0293  28 U   A C6    
609  P P     . G   A 29 ? 0.1635 0.1649 0.1338 0.0604  0.0284  0.0321  29 G   A P     
610  O OP1   . G   A 29 ? 0.2108 0.2126 0.1828 0.0605  0.0281  0.0326  29 G   A OP1   
611  O OP2   . G   A 29 ? 0.1360 0.1370 0.1075 0.0590  0.0297  0.0325  29 G   A OP2   
612  O "O5'" . G   A 29 ? 0.3180 0.3210 0.2845 0.0618  0.0289  0.0322  29 G   A "O5'" 
613  C "C5'" . G   A 29 ? 0.1803 0.1840 0.1446 0.0635  0.0279  0.0317  29 G   A "C5'" 
614  C "C4'" . G   A 29 ? 0.2478 0.2522 0.2083 0.0646  0.0280  0.0312  29 G   A "C4'" 
615  O "O4'" . G   A 29 ? 0.2751 0.2778 0.2351 0.0647  0.0267  0.0299  29 G   A "O4'" 
616  C "C3'" . G   A 29 ? 0.3201 0.3257 0.2798 0.0641  0.0297  0.0322  29 G   A "C3'" 
617  O "O3'" . G   A 29 ? 0.2461 0.2538 0.2051 0.0646  0.0308  0.0335  29 G   A "O3'" 
618  C "C2'" . G   A 29 ? 0.3590 0.3642 0.3156 0.0649  0.0291  0.0313  29 G   A "C2'" 
619  O "O2'" . G   A 29 ? 0.4442 0.4509 0.3976 0.0667  0.0289  0.0311  29 G   A "O2'" 
620  C "C1'" . G   A 29 ? 0.3440 0.3471 0.3017 0.0647  0.0274  0.0298  29 G   A "C1'" 
621  N N9    . G   A 29 ? 0.3258 0.3274 0.2855 0.0632  0.0276  0.0296  29 G   A N9    
622  C C8    . G   A 29 ? 0.1937 0.1939 0.1568 0.0621  0.0271  0.0294  29 G   A C8    
623  N N7    . G   A 29 ? 0.2606 0.2599 0.2247 0.0609  0.0276  0.0293  29 G   A N7    
624  C C5    . G   A 29 ? 0.2806 0.2807 0.2418 0.0613  0.0282  0.0294  29 G   A C5    
625  C C6    . G   A 29 ? 0.2088 0.2083 0.1695 0.0605  0.0288  0.0293  29 G   A C6    
626  O O6    . G   A 29 ? 0.2055 0.2038 0.1681 0.0594  0.0289  0.0292  29 G   A O6    
627  N N1    . G   A 29 ? 0.3343 0.3348 0.2918 0.0613  0.0292  0.0296  29 G   A N1    
628  C C2    . G   A 29 ? 0.3166 0.3186 0.2717 0.0627  0.0292  0.0299  29 G   A C2    
629  N N2    . G   A 29 ? 0.3932 0.3961 0.3455 0.0632  0.0295  0.0302  29 G   A N2    
630  N N3    . G   A 29 ? 0.3553 0.3579 0.3106 0.0635  0.0288  0.0299  29 G   A N3    
631  C C4    . G   A 29 ? 0.4056 0.4071 0.3641 0.0627  0.0283  0.0296  29 G   A C4    
632  P P     . C   A 30 ? 0.4538 0.4624 0.4148 0.0632  0.0325  0.0352  30 C   A P     
633  O OP1   . C   A 30 ? 0.3710 0.3820 0.3311 0.0641  0.0334  0.0364  30 C   A OP1   
634  O OP2   . C   A 30 ? 0.5265 0.5337 0.4910 0.0618  0.0325  0.0352  30 C   A OP2   
635  O "O5'" . C   A 30 ? 0.1866 0.1946 0.1463 0.0627  0.0329  0.0351  30 C   A "O5'" 
636  C "C5'" . C   A 30 ? 0.2635 0.2724 0.2216 0.0632  0.0321  0.0344  30 C   A "C5'" 
637  C "C4'" . C   A 30 ? 0.3277 0.3356 0.2862 0.0620  0.0319  0.0340  30 C   A "C4'" 
638  O "O4'" . C   A 30 ? 0.4042 0.4103 0.3615 0.0621  0.0315  0.0331  30 C   A "O4'" 
639  C "C3'" . C   A 30 ? 0.3417 0.3493 0.3031 0.0604  0.0327  0.0348  30 C   A "C3'" 
640  O "O3'" . C   A 30 ? 0.2537 0.2630 0.2164 0.0601  0.0330  0.0356  30 C   A "O3'" 
641  C "C2'" . C   A 30 ? 0.4553 0.4613 0.4163 0.0596  0.0324  0.0340  30 C   A "C2'" 
642  O "O2'" . C   A 30 ? 0.5451 0.5518 0.5054 0.0596  0.0317  0.0337  30 C   A "O2'" 
643  C "C1'" . C   A 30 ? 0.4034 0.4084 0.3622 0.0606  0.0318  0.0331  30 C   A "C1'" 
644  N N1    . C   A 30 ? 0.3978 0.4012 0.3579 0.0600  0.0323  0.0332  30 C   A N1    
645  C C2    . C   A 30 ? 0.3577 0.3597 0.3190 0.0588  0.0325  0.0331  30 C   A C2    
646  O O2    . C   A 30 ? 0.4205 0.4224 0.3812 0.0583  0.0324  0.0330  30 C   A O2    
647  N N3    . C   A 30 ? 0.3158 0.3165 0.2797 0.0578  0.0324  0.0326  30 C   A N3    
648  C C4    . C   A 30 ? 0.2519 0.2526 0.2174 0.0580  0.0320  0.0324  30 C   A C4    
649  N N4    . C   A 30 ? 0.1964 0.1959 0.1647 0.0570  0.0319  0.0322  30 C   A N4    
650  C C5    . C   A 30 ? 0.2685 0.2704 0.2330 0.0592  0.0316  0.0325  30 C   A C5    
651  C C6    . C   A 30 ? 0.3693 0.3726 0.3310 0.0603  0.0318  0.0329  30 C   A C6    
652  P P     . G   A 31 ? 0.5413 0.5507 0.5070 0.0589  0.0340  0.0368  31 G   A P     
653  O OP1   . G   A 31 ? 0.5507 0.5623 0.5175 0.0590  0.0342  0.0377  31 G   A OP1   
654  O OP2   . G   A 31 ? 0.5792 0.5880 0.5457 0.0589  0.0346  0.0372  31 G   A OP2   
655  O "O5'" . G   A 31 ? 0.3822 0.3900 0.3487 0.0576  0.0340  0.0365  31 G   A "O5'" 
656  C "C5'" . G   A 31 ? 0.3584 0.3664 0.3243 0.0574  0.0335  0.0361  31 G   A "C5'" 
657  C "C4'" . G   A 31 ? 0.4412 0.4474 0.4077 0.0563  0.0336  0.0357  31 G   A "C4'" 
658  O "O4'" . G   A 31 ? 0.4585 0.4630 0.4237 0.0564  0.0333  0.0348  31 G   A "O4'" 
659  C "C3'" . G   A 31 ? 0.4337 0.4392 0.4024 0.0554  0.0345  0.0364  31 G   A "C3'" 
660  O "O3'" . G   A 31 ? 0.5105 0.5170 0.4807 0.0550  0.0348  0.0372  31 G   A "O3'" 
661  C "C2'" . G   A 31 ? 0.4844 0.4877 0.4528 0.0547  0.0345  0.0357  31 G   A "C2'" 
662  O "O2'" . G   A 31 ? 0.5535 0.5565 0.5216 0.0543  0.0341  0.0353  31 G   A "O2'" 
663  C "C1'" . G   A 31 ? 0.4750 0.4779 0.4415 0.0554  0.0339  0.0349  31 G   A "C1'" 
664  N N9    . G   A 31 ? 0.4862 0.4886 0.4532 0.0556  0.0345  0.0352  31 G   A N9    
665  C C8    . G   A 31 ? 0.4919 0.4952 0.4585 0.0565  0.0345  0.0356  31 G   A C8    
666  N N7    . G   A 31 ? 0.4611 0.4637 0.4285 0.0564  0.0351  0.0359  31 G   A N7    
667  C C5    . G   A 31 ? 0.3856 0.3866 0.3541 0.0552  0.0353  0.0355  31 G   A C5    
668  C C6    . G   A 31 ? 0.3072 0.3069 0.2781 0.0543  0.0353  0.0351  31 G   A C6    
669  O O6    . G   A 31 ? 0.3112 0.3109 0.2837 0.0543  0.0351  0.0350  31 G   A O6    
670  N N1    . G   A 31 ? 0.3653 0.3638 0.3365 0.0534  0.0356  0.0349  31 G   A N1    
671  C C2    . G   A 31 ? 0.4471 0.4454 0.4167 0.0534  0.0357  0.0350  31 G   A C2    
672  N N2    . G   A 31 ? 0.4286 0.4255 0.3987 0.0526  0.0359  0.0347  31 G   A N2    
673  N N3    . G   A 31 ? 0.5001 0.4996 0.4684 0.0540  0.0352  0.0350  31 G   A N3    
674  C C4    . G   A 31 ? 0.4728 0.4736 0.4406 0.0549  0.0350  0.0353  31 G   A C4    
675  P P     . C   A 32 ? 0.7436 0.7507 0.7163 0.0545  0.0358  0.0383  32 C   A P     
676  O OP1   . C   A 32 ? 0.8309 0.8394 0.8047 0.0545  0.0359  0.0391  32 C   A OP1   
677  O OP2   . C   A 32 ? 0.6467 0.6544 0.6196 0.0550  0.0361  0.0388  32 C   A OP2   
678  O "O5'" . C   A 32 ? 0.7380 0.7428 0.7113 0.0536  0.0362  0.0380  32 C   A "O5'" 
679  C "C5'" . C   A 32 ? 0.6530 0.6567 0.6260 0.0531  0.0360  0.0375  32 C   A "C5'" 
680  C "C4'" . C   A 32 ? 0.5635 0.5651 0.5367 0.0524  0.0363  0.0371  32 C   A "C4'" 
681  O "O4'" . C   A 32 ? 0.5678 0.5685 0.5398 0.0526  0.0360  0.0364  32 C   A "O4'" 
682  C "C3'" . C   A 32 ? 0.6119 0.6130 0.5869 0.0520  0.0373  0.0378  32 C   A "C3'" 
683  O "O3'" . C   A 32 ? 0.6252 0.6265 0.6015 0.0517  0.0378  0.0384  32 C   A "O3'" 
684  C "C2'" . C   A 32 ? 0.6423 0.6415 0.6170 0.0515  0.0374  0.0372  32 C   A "C2'" 
685  O "O2'" . C   A 32 ? 0.6634 0.6612 0.6377 0.0511  0.0374  0.0367  32 C   A "O2'" 
686  C "C1'" . C   A 32 ? 0.6029 0.6022 0.5758 0.0521  0.0367  0.0366  32 C   A "C1'" 
687  N N1    . C   A 32 ? 0.5516 0.5515 0.5249 0.0524  0.0370  0.0370  32 C   A N1    
688  C C2    . C   A 32 ? 0.5655 0.5642 0.5395 0.0521  0.0375  0.0371  32 C   A C2    
689  O O2    . C   A 32 ? 0.5693 0.5665 0.5435 0.0514  0.0376  0.0366  32 C   A O2    
690  N N3    . C   A 32 ? 0.5674 0.5666 0.5423 0.0523  0.0375  0.0371  32 C   A N3    
691  C C4    . C   A 32 ? 0.5143 0.5151 0.4887 0.0531  0.0373  0.0376  32 C   A C4    
692  N N4    . C   A 32 ? 0.5557 0.5568 0.5312 0.0533  0.0371  0.0375  32 C   A N4    
693  C C5    . C   A 32 ? 0.4738 0.4759 0.4472 0.0536  0.0370  0.0378  32 C   A C5    
694  C C6    . C   A 32 ? 0.5081 0.5098 0.4813 0.0532  0.0368  0.0374  32 C   A C6    
695  P P     . A   A 33 ? 0.8484 0.8507 0.8271 0.0515  0.0386  0.0396  33 A   A P     
696  O OP1   . A   A 33 ? 0.9647 0.9671 0.9444 0.0514  0.0390  0.0401  33 A   A OP1   
697  O OP2   . A   A 33 ? 0.7068 0.7109 0.6857 0.0520  0.0385  0.0401  33 A   A OP2   
698  O "O5'" . A   A 33 ? 0.4912 0.4917 0.4704 0.0510  0.0392  0.0394  33 A   A "O5'" 
699  C "C5'" . A   A 33 ? 0.4160 0.4145 0.3948 0.0506  0.0394  0.0389  33 A   A "C5'" 
700  C "C4'" . A   A 33 ? 0.5166 0.5139 0.4959 0.0502  0.0398  0.0387  33 A   A "C4'" 
701  O "O4'" . A   A 33 ? 0.5516 0.5489 0.5299 0.0504  0.0393  0.0383  33 A   A "O4'" 
702  C "C3'" . A   A 33 ? 0.5556 0.5534 0.5372 0.0499  0.0403  0.0393  33 A   A "C3'" 
703  O "O3'" . A   A 33 ? 0.5997 0.5970 0.5828 0.0496  0.0407  0.0395  33 A   A "O3'" 
704  C "C2'" . A   A 33 ? 0.5390 0.5359 0.5209 0.0495  0.0402  0.0388  33 A   A "C2'" 
705  O "O2'" . A   A 33 ? 0.4839 0.4790 0.4660 0.0490  0.0403  0.0381  33 A   A "O2'" 
706  C "C1'" . A   A 33 ? 0.5132 0.5103 0.4931 0.0500  0.0396  0.0383  33 A   A "C1'" 
707  N N9    . A   A 33 ? 0.4055 0.4041 0.3856 0.0505  0.0394  0.0388  33 A   A N9    
708  C C8    . A   A 33 ? 0.3746 0.3748 0.3535 0.0513  0.0393  0.0393  33 A   A C8    
709  N N7    . A   A 33 ? 0.4561 0.4573 0.4353 0.0517  0.0391  0.0396  33 A   A N7    
710  C C5    . A   A 33 ? 0.4108 0.4110 0.3916 0.0511  0.0392  0.0392  33 A   A C5    
711  C C6    . A   A 33 ? 0.2850 0.2856 0.2671 0.0512  0.0390  0.0392  33 A   A C6    
712  N N6    . A   A 33 ? 0.1706 0.1725 0.1523 0.0519  0.0386  0.0395  33 A   A N6    
713  N N1    . A   A 33 ? 0.3354 0.3347 0.3192 0.0505  0.0391  0.0389  33 A   A N1    
714  C C2    . A   A 33 ? 0.2496 0.2476 0.2336 0.0498  0.0394  0.0386  33 A   A C2    
715  N N3    . A   A 33 ? 0.3453 0.3428 0.3281 0.0498  0.0396  0.0385  33 A   A N3    
716  C C4    . A   A 33 ? 0.4018 0.4005 0.3832 0.0504  0.0394  0.0388  33 A   A C4    
717  P P     . G   A 34 ? 0.9222 0.9206 0.9078 0.0494  0.0412  0.0404  34 G   A P     
718  O OP1   . G   A 34 ? 1.0224 1.0203 1.0092 0.0493  0.0414  0.0404  34 G   A OP1   
719  O OP2   . G   A 34 ? 0.7765 0.7770 0.7620 0.0500  0.0412  0.0414  34 G   A OP2   
720  O "O5'" . G   A 34 ? 0.5338 0.5314 0.5204 0.0490  0.0413  0.0402  34 G   A "O5'" 
721  C "C5'" . G   A 34 ? 0.3653 0.3611 0.3519 0.0486  0.0414  0.0394  34 G   A "C5'" 
722  C "C4'" . G   A 34 ? 0.3899 0.3852 0.3775 0.0482  0.0415  0.0394  34 G   A "C4'" 
723  O "O4'" . G   A 34 ? 0.4320 0.4278 0.4187 0.0484  0.0412  0.0393  34 G   A "O4'" 
724  C "C3'" . G   A 34 ? 0.5069 0.5031 0.4968 0.0481  0.0419  0.0402  34 G   A "C3'" 
725  O "O3'" . G   A 34 ? 0.5128 0.5082 0.5040 0.0478  0.0422  0.0402  34 G   A "O3'" 
726  C "C2'" . G   A 34 ? 0.5224 0.5185 0.5127 0.0479  0.0418  0.0401  34 G   A "C2'" 
727  O "O2'" . G   A 34 ? 0.4653 0.4599 0.4560 0.0475  0.0420  0.0397  34 G   A "O2'" 
728  C "C1'" . G   A 34 ? 0.4741 0.4704 0.4625 0.0482  0.0413  0.0397  34 G   A "C1'" 
729  N N9    . G   A 34 ? 0.3841 0.3821 0.3722 0.0488  0.0410  0.0402  34 G   A N9    
730  C C8    . G   A 34 ? 0.2843 0.2834 0.2710 0.0493  0.0408  0.0404  34 G   A C8    
731  N N7    . G   A 34 ? 0.2747 0.2752 0.2613 0.0498  0.0406  0.0409  34 G   A N7    
732  C C5    . G   A 34 ? 0.3031 0.3034 0.2912 0.0495  0.0406  0.0408  34 G   A C5    
733  C C6    . G   A 34 ? 0.2769 0.2782 0.2656 0.0499  0.0403  0.0411  34 G   A C6    
734  O O6    . G   A 34 ? 0.3772 0.3799 0.3650 0.0506  0.0400  0.0415  34 G   A O6    
735  N N1    . G   A 34 ? 0.2105 0.2110 0.2010 0.0494  0.0403  0.0410  34 G   A N1    
736  C C2    . G   A 34 ? 0.2604 0.2596 0.2519 0.0487  0.0406  0.0407  34 G   A C2    
737  N N2    . G   A 34 ? 0.1456 0.1444 0.1389 0.0483  0.0406  0.0407  34 G   A N2    
738  N N3    . G   A 34 ? 0.3161 0.3143 0.3068 0.0484  0.0410  0.0404  34 G   A N3    
739  C C4    . G   A 34 ? 0.3459 0.3447 0.3350 0.0489  0.0409  0.0405  34 G   A C4    
740  P P     . C   A 35 ? 0.6359 0.6325 0.6295 0.0477  0.0425  0.0411  35 C   A P     
741  O OP1   . C   A 35 ? 0.6469 0.6422 0.6414 0.0475  0.0426  0.0408  35 C   A OP1   
742  O OP2   . C   A 35 ? 0.6144 0.6127 0.6078 0.0481  0.0424  0.0419  35 C   A OP2   
743  O "O5'" . C   A 35 ? 0.5074 0.5045 0.5022 0.0475  0.0426  0.0416  35 C   A "O5'" 
744  C "C5'" . C   A 35 ? 0.5477 0.5436 0.5433 0.0471  0.0428  0.0413  35 C   A "C5'" 
745  C "C4'" . C   A 35 ? 0.6661 0.6627 0.6629 0.0469  0.0429  0.0418  35 C   A "C4'" 
746  O "O4'" . C   A 35 ? 0.6824 0.6796 0.6780 0.0472  0.0425  0.0416  35 C   A "O4'" 
747  C "C3'" . C   A 35 ? 0.6863 0.6843 0.6850 0.0469  0.0430  0.0427  35 C   A "C3'" 
748  O "O3'" . C   A 35 ? 0.7729 0.7704 0.7733 0.0466  0.0433  0.0430  35 C   A "O3'" 
749  C "C2'" . C   A 35 ? 0.5468 0.5455 0.5459 0.0469  0.0428  0.0429  35 C   A "C2'" 
750  O "O2'" . C   A 35 ? 0.4856 0.4834 0.4858 0.0465  0.0430  0.0428  35 C   A "O2'" 
751  C "C1'" . C   A 35 ? 0.5274 0.5258 0.5243 0.0472  0.0423  0.0422  35 C   A "C1'" 
752  N N1    . C   A 35 ? 0.3743 0.3742 0.3701 0.0478  0.0420  0.0425  35 C   A N1    
753  C C2    . C   A 35 ? 0.3688 0.3697 0.3650 0.0481  0.0416  0.0428  35 C   A C2    
754  O O2    . C   A 35 ? 0.4497 0.4503 0.4473 0.0478  0.0416  0.0428  35 C   A O2    
755  N N3    . C   A 35 ? 0.4580 0.4603 0.4530 0.0488  0.0413  0.0431  35 C   A N3    
756  C C4    . C   A 35 ? 0.4968 0.4996 0.4905 0.0492  0.0415  0.0432  35 C   A C4    
757  N N4    . C   A 35 ? 0.3935 0.3978 0.3859 0.0499  0.0412  0.0435  35 C   A N4    
758  C C5    . C   A 35 ? 0.4840 0.4857 0.4774 0.0488  0.0418  0.0429  35 C   A C5    
759  C C6    . C   A 35 ? 0.4199 0.4202 0.4144 0.0482  0.0420  0.0425  35 C   A C6    
760  N N     . GLY B 3  ? 0.6589 0.6773 0.7110 0.0271  -0.0309 -0.0378 5  GLY B N     
761  C CA    . GLY B 3  ? 0.7917 0.8107 0.8444 0.0271  -0.0306 -0.0376 5  GLY B CA    
762  C C     . GLY B 3  ? 0.8854 0.9038 0.9378 0.0272  -0.0305 -0.0369 5  GLY B C     
763  O O     . GLY B 3  ? 0.8345 0.8537 0.8871 0.0272  -0.0301 -0.0362 5  GLY B O     
764  N N     . ASP B 4  ? 0.9101 0.9273 0.9622 0.0272  -0.0309 -0.0371 6  ASP B N     
765  C CA    . ASP B 4  ? 0.8566 0.8731 0.9084 0.0273  -0.0308 -0.0366 6  ASP B CA    
766  C C     . ASP B 4  ? 0.7457 0.7623 0.7982 0.0272  -0.0307 -0.0366 6  ASP B C     
767  O O     . ASP B 4  ? 0.7229 0.7387 0.7753 0.0272  -0.0309 -0.0367 6  ASP B O     
768  C CB    . ASP B 4  ? 0.8656 0.8809 0.9166 0.0273  -0.0313 -0.0367 6  ASP B CB    
769  N N     . GLY B 5  ? 0.6223 0.6400 0.6756 0.0271  -0.0303 -0.0366 7  GLY B N     
770  C CA    . GLY B 5  ? 0.4972 0.5150 0.5513 0.0270  -0.0302 -0.0367 7  GLY B CA    
771  C C     . GLY B 5  ? 0.4366 0.4553 0.4911 0.0271  -0.0296 -0.0359 7  GLY B C     
772  O O     . GLY B 5  ? 0.5292 0.5479 0.5833 0.0273  -0.0293 -0.0352 7  GLY B O     
773  N N     . ARG B 6  ? 0.3129 0.3324 0.3683 0.0270  -0.0293 -0.0360 8  ARG B N     
774  C CA    . ARG B 6  ? 0.2570 0.2774 0.3129 0.0271  -0.0287 -0.0353 8  ARG B CA    
775  C C     . ARG B 6  ? 0.2612 0.2827 0.3169 0.0272  -0.0283 -0.0347 8  ARG B C     
776  O O     . ARG B 6  ? 0.2194 0.2418 0.2753 0.0271  -0.0283 -0.0350 8  ARG B O     
777  C CB    . ARG B 6  ? 0.3073 0.3284 0.3642 0.0269  -0.0285 -0.0357 8  ARG B CB    
778  C CG    . ARG B 6  ? 0.3142 0.3359 0.3718 0.0270  -0.0279 -0.0351 8  ARG B CG    
779  C CD    . ARG B 6  ? 0.4253 0.4478 0.4839 0.0269  -0.0278 -0.0355 8  ARG B CD    
780  N NE    . ARG B 6  ? 0.4802 0.5026 0.5395 0.0269  -0.0275 -0.0354 8  ARG B NE    
781  C CZ    . ARG B 6  ? 0.5304 0.5536 0.5903 0.0270  -0.0268 -0.0347 8  ARG B CZ    
782  N NH1   . ARG B 6  ? 0.4997 0.5240 0.5595 0.0272  -0.0264 -0.0338 8  ARG B NH1   
783  N NH2   . ARG B 6  ? 0.6417 0.6648 0.7023 0.0270  -0.0266 -0.0347 8  ARG B NH2   
784  N N     . ARG B 7  ? 0.2426 0.2642 0.2980 0.0275  -0.0280 -0.0338 9  ARG B N     
785  C CA    . ARG B 7  ? 0.1927 0.2155 0.2479 0.0276  -0.0277 -0.0332 9  ARG B CA    
786  C C     . ARG B 7  ? 0.2074 0.2319 0.2634 0.0277  -0.0270 -0.0326 9  ARG B C     
787  O O     . ARG B 7  ? 0.2462 0.2721 0.3021 0.0278  -0.0268 -0.0322 9  ARG B O     
788  C CB    . ARG B 7  ? 0.1944 0.2167 0.2490 0.0279  -0.0275 -0.0324 9  ARG B CB    
789  N N     . ARG B 8  ? 0.2116 0.2363 0.2684 0.0277  -0.0268 -0.0326 10 ARG B N     
790  C CA    . ARG B 8  ? 0.1216 0.1478 0.1791 0.0278  -0.0261 -0.0319 10 ARG B CA    
791  C C     . ARG B 8  ? 0.2130 0.2391 0.2713 0.0276  -0.0260 -0.0323 10 ARG B C     
792  O O     . ARG B 8  ? 0.2264 0.2512 0.2848 0.0276  -0.0263 -0.0328 10 ARG B O     
793  C CB    . ARG B 8  ? 0.1066 0.1332 0.1641 0.0282  -0.0255 -0.0307 10 ARG B CB    
794  C CG    . ARG B 8  ? 0.1489 0.1762 0.2073 0.0284  -0.0248 -0.0300 10 ARG B CG    
795  C CD    . ARG B 8  ? 0.0798 0.1066 0.1382 0.0287  -0.0244 -0.0292 10 ARG B CD    
796  N NE    . ARG B 8  ? 0.1397 0.1673 0.1976 0.0290  -0.0242 -0.0283 10 ARG B NE    
797  C CZ    . ARG B 8  ? 0.2128 0.2393 0.2699 0.0291  -0.0243 -0.0282 10 ARG B CZ    
798  N NH1   . ARG B 8  ? 0.1691 0.1938 0.2259 0.0290  -0.0247 -0.0288 10 ARG B NH1   
799  N NH2   . ARG B 8  ? 0.2936 0.3208 0.3502 0.0294  -0.0241 -0.0274 10 ARG B NH2   
800  N N     . GLY B 9  ? 0.3365 0.3641 0.3956 0.0276  -0.0257 -0.0322 11 GLY B N     
801  C CA    . GLY B 9  ? 0.3220 0.3495 0.3818 0.0274  -0.0257 -0.0327 11 GLY B CA    
802  C C     . GLY B 9  ? 0.3445 0.3734 0.4052 0.0276  -0.0250 -0.0319 11 GLY B C     
803  O O     . GLY B 9  ? 0.3791 0.4090 0.4398 0.0278  -0.0244 -0.0309 11 GLY B O     
804  N N     . GLY B 10 ? 0.3197 0.3483 0.3811 0.0274  -0.0249 -0.0324 12 GLY B N     
805  C CA    . GLY B 10 ? 0.2466 0.2764 0.3089 0.0275  -0.0242 -0.0317 12 GLY B CA    
806  C C     . GLY B 10 ? 0.2394 0.2683 0.3022 0.0277  -0.0239 -0.0315 12 GLY B C     
807  O O     . GLY B 10 ? 0.2367 0.2650 0.2991 0.0280  -0.0237 -0.0308 12 GLY B O     
808  N N     . GLY B 11 ? 0.2969 0.3255 0.3604 0.0276  -0.0239 -0.0319 13 GLY B N     
809  C CA    . GLY B 11 ? 0.1946 0.2222 0.2585 0.0277  -0.0236 -0.0319 13 GLY B CA    
810  C C     . GLY B 11 ? 0.1826 0.2086 0.2459 0.0276  -0.0242 -0.0324 13 GLY B C     
811  O O     . GLY B 11 ? 0.2951 0.3204 0.3579 0.0273  -0.0249 -0.0333 13 GLY B O     
812  N N     . GLY B 12 ? 0.1242 0.1497 0.1876 0.0279  -0.0237 -0.0319 14 GLY B N     
813  C CA    . GLY B 12 ? 0.0560 0.0800 0.1188 0.0279  -0.0242 -0.0323 14 GLY B CA    
814  C C     . GLY B 12 ? 0.2920 0.3160 0.3540 0.0281  -0.0242 -0.0317 14 GLY B C     
815  O O     . GLY B 12 ? 0.1841 0.2069 0.2456 0.0282  -0.0243 -0.0317 14 GLY B O     
816  N N     . ARG B 13 ? 0.1778 0.2029 0.2394 0.0282  -0.0241 -0.0311 15 ARG B N     
817  C CA    . ARG B 13 ? 0.1562 0.1813 0.2169 0.0284  -0.0241 -0.0305 15 ARG B CA    
818  C C     . ARG B 13 ? 0.2247 0.2487 0.2846 0.0281  -0.0250 -0.0314 15 ARG B C     
819  O O     . ARG B 13 ? 0.2190 0.2428 0.2787 0.0278  -0.0255 -0.0323 15 ARG B O     
820  C CB    . ARG B 13 ? 0.2764 0.3033 0.3371 0.0285  -0.0238 -0.0299 15 ARG B CB    
821  C CG    . ARG B 13 ? 0.3208 0.3491 0.3823 0.0289  -0.0229 -0.0287 15 ARG B CG    
822  C CD    . ARG B 13 ? 0.1952 0.2253 0.2567 0.0288  -0.0229 -0.0285 15 ARG B CD    
823  N NE    . ARG B 13 ? 0.2000 0.2319 0.2621 0.0292  -0.0220 -0.0272 15 ARG B NE    
824  C CZ    . ARG B 13 ? 0.3013 0.3345 0.3641 0.0291  -0.0217 -0.0271 15 ARG B CZ    
825  N NH1   . ARG B 13 ? 0.4395 0.4724 0.5027 0.0287  -0.0221 -0.0281 15 ARG B NH1   
826  N NH2   . ARG B 13 ? 0.3306 0.3657 0.3940 0.0295  -0.0209 -0.0258 15 ARG B NH2   
827  N N     . GLY B 14 ? 0.2905 0.3137 0.3496 0.0283  -0.0250 -0.0311 16 GLY B N     
828  C CA    . GLY B 14 ? 0.2774 0.2997 0.3355 0.0281  -0.0258 -0.0317 16 GLY B CA    
829  C C     . GLY B 14 ? 0.2657 0.2867 0.3240 0.0279  -0.0263 -0.0327 16 GLY B C     
830  O O     . GLY B 14 ? 0.2759 0.2966 0.3339 0.0276  -0.0270 -0.0336 16 GLY B O     
831  N N     . GLN B 15 ? 0.3139 0.3343 0.3726 0.0279  -0.0261 -0.0327 17 GLN B N     
832  C CA    . GLN B 15 ? 0.3142 0.3336 0.3730 0.0277  -0.0268 -0.0338 17 GLN B CA    
833  C C     . GLN B 15 ? 0.4946 0.5129 0.5529 0.0278  -0.0268 -0.0337 17 GLN B C     
834  O O     . GLN B 15 ? 0.4853 0.5037 0.5437 0.0281  -0.0262 -0.0329 17 GLN B O     
835  C CB    . GLN B 15 ? 0.3381 0.3577 0.3979 0.0275  -0.0266 -0.0342 17 GLN B CB    
836  C CG    . GLN B 15 ? 0.4381 0.4586 0.4983 0.0273  -0.0267 -0.0345 17 GLN B CG    
837  C CD    . GLN B 15 ? 0.6232 0.6432 0.6829 0.0271  -0.0275 -0.0354 17 GLN B CD    
838  O OE1   . GLN B 15 ? 0.5635 0.5841 0.6230 0.0270  -0.0276 -0.0355 17 GLN B OE1   
839  N NE2   . GLN B 15 ? 0.7693 0.7883 0.8287 0.0270  -0.0280 -0.0360 17 GLN B NE2   
840  N N     . GLY B 16 ? 0.6564 0.6738 0.7142 0.0276  -0.0276 -0.0344 18 GLY B N     
841  C CA    . GLY B 16 ? 0.6682 0.6848 0.7256 0.0277  -0.0277 -0.0343 18 GLY B CA    
842  C C     . GLY B 16 ? 0.5742 0.5906 0.6307 0.0280  -0.0275 -0.0335 18 GLY B C     
843  O O     . GLY B 16 ? 0.5199 0.5370 0.5760 0.0281  -0.0274 -0.0331 18 GLY B O     
844  O "O5'" . G   C 1  ? 0.5581 0.5311 0.5816 -0.0219 0.0043  -0.0205 1  G   C "O5'" 
845  C "C5'" . G   C 1  ? 0.3948 0.3679 0.4188 -0.0196 0.0023  -0.0188 1  G   C "C5'" 
846  C "C4'" . G   C 1  ? 0.3699 0.3390 0.3894 -0.0178 -0.0002 -0.0165 1  G   C "C4'" 
847  O "O4'" . G   C 1  ? 0.3957 0.3709 0.4213 -0.0155 -0.0003 -0.0169 1  G   C "O4'" 
848  C "C3'" . G   C 1  ? 0.3793 0.3384 0.3890 -0.0196 -0.0017 -0.0153 1  G   C "C3'" 
849  O "O3'" . G   C 1  ? 0.3664 0.3195 0.3718 -0.0201 -0.0031 -0.0143 1  G   C "O3'" 
850  C "C2'" . G   C 1  ? 0.4036 0.3618 0.4111 -0.0174 -0.0031 -0.0139 1  G   C "C2'" 
851  O "O2'" . G   C 1  ? 0.3772 0.3357 0.3842 -0.0151 -0.0034 -0.0126 1  G   C "O2'" 
852  C "C1'" . G   C 1  ? 0.4083 0.3774 0.4269 -0.0157 -0.0016 -0.0155 1  G   C "C1'" 
853  N N9    . G   C 1  ? 0.3224 0.2907 0.3402 -0.0177 -0.0006 -0.0169 1  G   C N9    
854  C C8    . G   C 1  ? 0.2817 0.2539 0.3035 -0.0196 0.0021  -0.0192 1  G   C C8    
855  N N7    . G   C 1  ? 0.2971 0.2679 0.3172 -0.0211 0.0030  -0.0202 1  G   C N7    
856  C C5    . G   C 1  ? 0.1921 0.1574 0.2067 -0.0201 0.0004  -0.0183 1  G   C C5    
857  C C6    . G   C 1  ? 0.2361 0.1976 0.2470 -0.0207 -0.0002 -0.0183 1  G   C C6    
858  O O6    . G   C 1  ? 0.2248 0.1875 0.2366 -0.0225 0.0020  -0.0201 1  G   C O6    
859  N N1    . G   C 1  ? 0.2675 0.2233 0.2728 -0.0188 -0.0034 -0.0161 1  G   C N1    
860  C C2    . G   C 1  ? 0.2685 0.2224 0.2708 -0.0171 -0.0045 -0.0143 1  G   C C2    
861  N N2    . G   C 1  ? 0.1928 0.1430 0.1888 -0.0154 -0.0043 -0.0127 1  G   C N2    
862  N N3    . G   C 1  ? 0.2606 0.2188 0.2672 -0.0166 -0.0035 -0.0144 1  G   C N3    
863  C C4    . G   C 1  ? 0.2368 0.2003 0.2494 -0.0180 -0.0016 -0.0163 1  G   C C4    
864  P P     . C   C 2  ? 0.5087 0.4568 0.5112 -0.0220 -0.0012 -0.0152 2  C   C P     
865  O OP1   . C   C 2  ? 0.6156 0.5604 0.6159 -0.0221 -0.0007 -0.0147 2  C   C OP1   
866  O OP2   . C   C 2  ? 0.4821 0.4321 0.4847 -0.0250 0.0025  -0.0174 2  C   C OP2   
867  O "O5'" . C   C 2  ? 0.3824 0.3275 0.3835 -0.0200 -0.0026 -0.0143 2  C   C "O5'" 
868  C "C5'" . C   C 2  ? 0.3516 0.2976 0.3553 -0.0165 -0.0046 -0.0128 2  C   C "C5'" 
869  C "C4'" . C   C 2  ? 0.2455 0.1905 0.2487 -0.0152 -0.0037 -0.0127 2  C   C "C4'" 
870  O "O4'" . C   C 2  ? 0.3466 0.2960 0.3529 -0.0143 -0.0060 -0.0127 2  C   C "O4'" 
871  C "C3'" . C   C 2  ? 0.2820 0.2188 0.2740 -0.0175 -0.0014 -0.0124 2  C   C "C3'" 
872  O "O3'" . C   C 2  ? 0.3747 0.3055 0.3580 -0.0174 -0.0006 -0.0107 2  C   C "O3'" 
873  C "C2'" . C   C 2  ? 0.3950 0.3323 0.3877 -0.0161 -0.0020 -0.0123 2  C   C "C2'" 
874  O "O2'" . C   C 2  ? 0.3666 0.3033 0.3579 -0.0132 -0.0027 -0.0105 2  C   C "O2'" 
875  C "C1'" . C   C 2  ? 0.3868 0.3324 0.3902 -0.0151 -0.0041 -0.0135 2  C   C "C1'" 
876  N N1    . C   C 2  ? 0.2775 0.2214 0.2779 -0.0182 -0.0035 -0.0148 2  C   C N1    
877  C C2    . C   C 2  ? 0.2619 0.2040 0.2597 -0.0187 -0.0026 -0.0154 2  C   C C2    
878  O O2    . C   C 2  ? 0.3012 0.2421 0.2987 -0.0166 -0.0030 -0.0147 2  C   C O2    
879  N N3    . C   C 2  ? 0.2382 0.1805 0.2338 -0.0216 -0.0003 -0.0168 2  C   C N3    
880  C C4    . C   C 2  ? 0.2055 0.1504 0.2022 -0.0241 0.0019  -0.0180 2  C   C C4    
881  N N4    . C   C 2  ? 0.1445 0.0907 0.1404 -0.0269 0.0052  -0.0198 2  C   C N4    
882  C C5    . C   C 2  ? 0.1969 0.1436 0.1960 -0.0236 0.0012  -0.0175 2  C   C C5    
883  C C6    . C   C 2  ? 0.1142 0.0597 0.1142 -0.0207 -0.0019 -0.0157 2  C   C C6    
884  P P     . U   C 3  ? 0.3965 0.3191 0.3674 -0.0207 0.0021  -0.0106 3  U   C P     
885  O OP1   . U   C 3  ? 0.4758 0.3931 0.4389 -0.0197 0.0017  -0.0086 3  U   C OP1   
886  O OP2   . U   C 3  ? 0.4360 0.3605 0.4090 -0.0238 0.0043  -0.0125 3  U   C OP2   
887  O "O5'" . U   C 3  ? 0.1965 0.1153 0.1616 -0.0210 0.0026  -0.0104 3  U   C "O5'" 
888  C "C5'" . U   C 3  ? 0.1916 0.1079 0.1530 -0.0183 0.0006  -0.0085 3  U   C "C5'" 
889  C "C4'" . U   C 3  ? 0.2035 0.1174 0.1613 -0.0187 0.0009  -0.0088 3  U   C "C4'" 
890  O "O4'" . U   C 3  ? 0.2413 0.1620 0.2091 -0.0190 0.0009  -0.0107 3  U   C "O4'" 
891  C "C3'" . U   C 3  ? 0.3218 0.2285 0.2688 -0.0220 0.0037  -0.0091 3  U   C "C3'" 
892  O "O3'" . U   C 3  ? 0.3726 0.2715 0.3080 -0.0216 0.0035  -0.0072 3  U   C "O3'" 
893  C "C2'" . U   C 3  ? 0.3951 0.3028 0.3436 -0.0223 0.0038  -0.0100 3  U   C "C2'" 
894  O "O2'" . U   C 3  ? 0.3839 0.2887 0.3283 -0.0196 0.0015  -0.0083 3  U   C "O2'" 
895  C "C1'" . U   C 3  ? 0.3450 0.2623 0.3076 -0.0211 0.0025  -0.0115 3  U   C "C1'" 
896  N N1    . U   C 3  ? 0.3027 0.2231 0.2688 -0.0243 0.0048  -0.0138 3  U   C N1    
897  C C2    . U   C 3  ? 0.2560 0.1757 0.2204 -0.0259 0.0062  -0.0150 3  U   C C2    
898  O O2    . U   C 3  ? 0.2478 0.1647 0.2088 -0.0248 0.0052  -0.0142 3  U   C O2    
899  N N3    . U   C 3  ? 0.2673 0.1900 0.2342 -0.0290 0.0087  -0.0170 3  U   C N3    
900  C C4    . U   C 3  ? 0.2758 0.2018 0.2464 -0.0305 0.0099  -0.0179 3  U   C C4    
901  O O4    . U   C 3  ? 0.3284 0.2571 0.3007 -0.0332 0.0126  -0.0198 3  U   C O4    
902  C C5    . U   C 3  ? 0.1525 0.0786 0.1245 -0.0285 0.0081  -0.0166 3  U   C C5    
903  C C6    . U   C 3  ? 0.2489 0.1722 0.2187 -0.0256 0.0057  -0.0146 3  U   C C6    
904  P P     . G   C 4  ? 0.4011 0.2919 0.3245 -0.0252 0.0067  -0.0074 4  G   C P     
905  O OP1   . G   C 4  ? 0.4834 0.3675 0.3968 -0.0241 0.0058  -0.0055 4  G   C OP1   
906  O OP2   . G   C 4  ? 0.5328 0.4269 0.4608 -0.0283 0.0094  -0.0093 4  G   C OP2   
907  O "O5'" . G   C 4  ? 0.2825 0.1698 0.2008 -0.0262 0.0076  -0.0077 4  G   C "O5'" 
908  C "C5'" . G   C 4  ? 0.1633 0.0474 0.0771 -0.0236 0.0051  -0.0062 4  G   C "C5'" 
909  C "C4'" . G   C 4  ? 0.2758 0.1575 0.1861 -0.0249 0.0063  -0.0069 4  G   C "C4'" 
910  O "O4'" . G   C 4  ? 0.2886 0.1780 0.2102 -0.0254 0.0066  -0.0087 4  G   C "O4'" 
911  C "C3'" . G   C 4  ? 0.3187 0.1936 0.2189 -0.0289 0.0100  -0.0075 4  G   C "C3'" 
912  O "O3'" . G   C 4  ? 0.4113 0.2772 0.2983 -0.0286 0.0097  -0.0059 4  G   C "O3'" 
913  C "C2'" . G   C 4  ? 0.3678 0.2446 0.2708 -0.0303 0.0111  -0.0090 4  G   C "C2'" 
914  O "O2'" . G   C 4  ? 0.3539 0.2264 0.2511 -0.0283 0.0092  -0.0077 4  G   C "O2'" 
915  C "C1'" . G   C 4  ? 0.3164 0.2035 0.2343 -0.0285 0.0094  -0.0101 4  G   C "C1'" 
916  N N9    . G   C 4  ? 0.2836 0.1759 0.2081 -0.0314 0.0121  -0.0123 4  G   C N9    
917  C C8    . G   C 4  ? 0.2969 0.1940 0.2283 -0.0313 0.0119  -0.0128 4  G   C C8    
918  N N7    . G   C 4  ? 0.2975 0.1986 0.2333 -0.0341 0.0144  -0.0149 4  G   C N7    
919  C C5    . G   C 4  ? 0.2770 0.1759 0.2089 -0.0363 0.0166  -0.0159 4  G   C C5    
920  C C6    . G   C 4  ? 0.2645 0.1661 0.1983 -0.0398 0.0199  -0.0183 4  G   C C6    
921  O O6    . G   C 4  ? 0.2633 0.1700 0.2029 -0.0415 0.0217  -0.0200 4  G   C O6    
922  N N1    . G   C 4  ? 0.1678 0.0656 0.0958 -0.0411 0.0213  -0.0186 4  G   C N1    
923  C C2    . G   C 4  ? 0.1707 0.0626 0.0917 -0.0393 0.0196  -0.0169 4  G   C C2    
924  N N2    . G   C 4  ? 0.1764 0.0652 0.0925 -0.0411 0.0213  -0.0176 4  G   C N2    
925  N N3    . G   C 4  ? 0.1948 0.0842 0.1139 -0.0360 0.0164  -0.0147 4  G   C N3    
926  C C4    . G   C 4  ? 0.1934 0.0867 0.1182 -0.0347 0.0151  -0.0143 4  G   C C4    
927  P P     . C   C 5  ? 0.4490 0.3075 0.3248 -0.0324 0.0132  -0.0062 5  C   C P     
928  O OP1   . C   C 5  ? 0.4294 0.2792 0.2926 -0.0311 0.0119  -0.0045 5  C   C OP1   
929  O OP2   . C   C 5  ? 0.5195 0.3819 0.4008 -0.0340 0.0148  -0.0071 5  C   C OP2   
930  O "O5'" . C   C 5  ? 0.2858 0.1430 0.1596 -0.0358 0.0164  -0.0077 5  C   C "O5'" 
931  C "C5'" . C   C 5  ? 0.2802 0.1336 0.1488 -0.0350 0.0156  -0.0072 5  C   C "C5'" 
932  C "C4'" . C   C 5  ? 0.3944 0.2458 0.2596 -0.0389 0.0194  -0.0087 5  C   C "C4'" 
933  O "O4'" . C   C 5  ? 0.5336 0.3938 0.4112 -0.0396 0.0201  -0.0107 5  C   C "O4'" 
934  C "C3'" . C   C 5  ? 0.3808 0.2283 0.2395 -0.0430 0.0235  -0.0097 5  C   C "C3'" 
935  O "O3'" . C   C 5  ? 0.3362 0.1739 0.1808 -0.0436 0.0240  -0.0084 5  C   C "O3'" 
936  C "C2'" . C   C 5  ? 0.4442 0.2946 0.3062 -0.0464 0.0269  -0.0119 5  C   C "C2'" 
937  O "O2'" . C   C 5  ? 0.4870 0.3310 0.3399 -0.0473 0.0278  -0.0115 5  C   C "O2'" 
938  C "C1'" . C   C 5  ? 0.4420 0.3021 0.3182 -0.0440 0.0245  -0.0126 5  C   C "C1'" 
939  N N1    . C   C 5  ? 0.3367 0.2049 0.2236 -0.0448 0.0253  -0.0142 5  C   C N1    
940  C C2    . C   C 5  ? 0.3476 0.2197 0.2385 -0.0483 0.0289  -0.0167 5  C   C C2    
941  O O2    . C   C 5  ? 0.2927 0.1616 0.1782 -0.0507 0.0314  -0.0175 5  C   C O2    
942  N N3    . C   C 5  ? 0.3366 0.2160 0.2369 -0.0489 0.0296  -0.0182 5  C   C N3    
943  C C4    . C   C 5  ? 0.2504 0.1329 0.1561 -0.0463 0.0268  -0.0172 5  C   C C4    
944  N N4    . C   C 5  ? 0.1962 0.0856 0.1109 -0.0470 0.0275  -0.0187 5  C   C N4    
945  C C5    . C   C 5  ? 0.2460 0.1246 0.1479 -0.0428 0.0233  -0.0147 5  C   C C5    
946  C C6    . C   C 5  ? 0.2492 0.1209 0.1418 -0.0422 0.0227  -0.0133 5  C   C C6    
947  P P     . G   C 6  ? 0.4974 0.3308 0.3353 -0.0461 0.0266  -0.0086 6  G   C P     
948  O OP1   . G   C 6  ? 0.6306 0.4554 0.4564 -0.0445 0.0247  -0.0069 6  G   C OP1   
949  O OP2   . G   C 6  ? 0.4953 0.3365 0.3443 -0.0459 0.0264  -0.0094 6  G   C OP2   
950  O "O5'" . G   C 6  ? 0.2654 0.0958 0.0981 -0.0510 0.0315  -0.0104 6  G   C "O5'" 
951  C "C5'" . G   C 6  ? 0.2923 0.1234 0.1251 -0.0544 0.0351  -0.0119 6  G   C "C5'" 
952  C "C4'" . G   C 6  ? 0.3963 0.2223 0.2208 -0.0589 0.0397  -0.0134 6  G   C "C4'" 
953  O "O4'" . G   C 6  ? 0.4234 0.2532 0.2522 -0.0621 0.0431  -0.0155 6  G   C "O4'" 
954  C "C3'" . G   C 6  ? 0.5232 0.3369 0.3303 -0.0602 0.0409  -0.0124 6  G   C "C3'" 
955  O "O3'" . G   C 6  ? 0.7435 0.5522 0.5427 -0.0638 0.0446  -0.0136 6  G   C "O3'" 
956  C "C2'" . G   C 6  ? 0.4419 0.2544 0.2469 -0.0623 0.0430  -0.0132 6  G   C "C2'" 
957  O "O2'" . G   C 6  ? 0.5811 0.3844 0.3740 -0.0646 0.0450  -0.0134 6  G   C "O2'" 
958  C "C1'" . G   C 6  ? 0.4002 0.2215 0.2166 -0.0648 0.0458  -0.0156 6  G   C "C1'" 
959  N N9    . G   C 6  ? 0.3651 0.1907 0.1876 -0.0652 0.0462  -0.0163 6  G   C N9    
960  C C8    . G   C 6  ? 0.3612 0.1876 0.1859 -0.0626 0.0433  -0.0150 6  G   C C8    
961  N N7    . G   C 6  ? 0.3171 0.1473 0.1469 -0.0641 0.0448  -0.0162 6  G   C N7    
962  C C5    . G   C 6  ? 0.2873 0.1196 0.1187 -0.0679 0.0489  -0.0186 6  G   C C5    
963  C C6    . G   C 6  ? 0.2673 0.1039 0.1039 -0.0709 0.0521  -0.0209 6  G   C C6    
964  O O6    . G   C 6  ? 0.4650 0.3042 0.3059 -0.0707 0.0517  -0.0211 6  G   C O6    
965  N N1    . G   C 6  ? 0.2706 0.1081 0.1071 -0.0742 0.0559  -0.0231 6  G   C N1    
966  C C2    . G   C 6  ? 0.3565 0.1911 0.1882 -0.0747 0.0567  -0.0230 6  G   C C2    
967  N N2    . G   C 6  ? 0.3646 0.2005 0.1966 -0.0783 0.0609  -0.0255 6  G   C N2    
968  N N3    . G   C 6  ? 0.2881 0.1183 0.1146 -0.0721 0.0538  -0.0208 6  G   C N3    
969  C C4    . G   C 6  ? 0.2874 0.1169 0.1143 -0.0687 0.0499  -0.0187 6  G   C C4    
970  P P     . G   C 7  ? 0.6150 0.4216 0.4120 -0.0624 0.0431  -0.0127 7  G   C P     
971  O OP1   . G   C 7  ? 0.4904 0.2969 0.2884 -0.0573 0.0377  -0.0104 7  G   C OP1   
972  O OP2   . G   C 7  ? 0.6214 0.4210 0.4102 -0.0652 0.0456  -0.0134 7  G   C OP2   
973  O "O5'" . G   C 7  ? 0.2920 0.1093 0.1035 -0.0630 0.0441  -0.0145 7  G   C "O5'" 
974  C "C5'" . G   C 7  ? 0.3060 0.1278 0.1221 -0.0670 0.0485  -0.0171 7  G   C "C5'" 
975  C "C4'" . G   C 7  ? 0.3441 0.1750 0.1726 -0.0669 0.0487  -0.0188 7  G   C "C4'" 
976  O "O4'" . G   C 7  ? 0.3770 0.2169 0.2191 -0.0626 0.0440  -0.0181 7  G   C "O4'" 
977  C "C3'" . G   C 7  ? 0.3852 0.2223 0.2203 -0.0707 0.0530  -0.0219 7  G   C "C3'" 
978  O "O3'" . G   C 7  ? 0.2786 0.1100 0.1042 -0.0750 0.0579  -0.0233 7  G   C "O3'" 
979  C "C2'" . G   C 7  ? 0.4078 0.2566 0.2591 -0.0683 0.0506  -0.0229 7  G   C "C2'" 
980  O "O2'" . G   C 7  ? 0.4528 0.3012 0.3033 -0.0686 0.0509  -0.0233 7  G   C "O2'" 
981  C "C1'" . G   C 7  ? 0.3880 0.2384 0.2438 -0.0633 0.0449  -0.0204 7  G   C "C1'" 
982  N N9    . G   C 7  ? 0.2347 0.0916 0.0997 -0.0618 0.0434  -0.0206 7  G   C N9    
983  C C8    . G   C 7  ? 0.2761 0.1310 0.1398 -0.0589 0.0401  -0.0185 7  G   C C8    
984  N N7    . G   C 7  ? 0.3089 0.1690 0.1798 -0.0585 0.0397  -0.0190 7  G   C N7    
985  C C5    . G   C 7  ? 0.2717 0.1379 0.1493 -0.0614 0.0429  -0.0217 7  G   C C5    
986  C C6    . G   C 7  ? 0.2560 0.1293 0.1427 -0.0622 0.0439  -0.0234 7  G   C C6    
987  O O6    . G   C 7  ? 0.2896 0.1651 0.1802 -0.0607 0.0421  -0.0228 7  G   C O6    
988  N N1    . G   C 7  ? 0.2614 0.1394 0.1527 -0.0651 0.0472  -0.0262 7  G   C N1    
989  C C2    . G   C 7  ? 0.2218 0.0981 0.1094 -0.0670 0.0495  -0.0272 7  G   C C2    
990  N N2    . G   C 7  ? 0.2741 0.1559 0.1672 -0.0696 0.0528  -0.0300 7  G   C N2    
991  N N3    . G   C 7  ? 0.3708 0.2402 0.2498 -0.0663 0.0486  -0.0255 7  G   C N3    
992  C C4    . G   C 7  ? 0.2288 0.0933 0.1031 -0.0634 0.0452  -0.0228 7  G   C C4    
993  P P     . U   C 8  ? 0.5615 0.3899 0.3812 -0.0797 0.0633  -0.0254 8  U   C P     
994  O OP1   . U   C 8  ? 0.6672 0.4907 0.4791 -0.0836 0.0677  -0.0269 8  U   C OP1   
995  O OP2   . U   C 8  ? 0.4660 0.2875 0.2771 -0.0789 0.0620  -0.0236 8  U   C OP2   
996  O "O5'" . U   C 8  ? 0.6273 0.4681 0.4631 -0.0799 0.0638  -0.0278 8  U   C "O5'" 
997  C "C5'" . U   C 8  ? 0.5980 0.4467 0.4431 -0.0810 0.0655  -0.0302 8  U   C "C5'" 
998  C "C4'" . U   C 8  ? 0.6078 0.4656 0.4641 -0.0821 0.0670  -0.0328 8  U   C "C4'" 
999  O "O4'" . U   C 8  ? 0.6706 0.5358 0.5385 -0.0779 0.0622  -0.0316 8  U   C "O4'" 
1000 C "C3'" . U   C 8  ? 0.5870 0.4406 0.4368 -0.0853 0.0706  -0.0339 8  U   C "C3'" 
1001 O "O3'" . U   C 8  ? 0.6461 0.4961 0.4889 -0.0899 0.0762  -0.0364 8  U   C "O3'" 
1002 C "C2'" . U   C 8  ? 0.5569 0.4203 0.4204 -0.0838 0.0690  -0.0350 8  U   C "C2'" 
1003 O "O2'" . U   C 8  ? 0.6500 0.5214 0.5224 -0.0855 0.0716  -0.0381 8  U   C "O2'" 
1004 C "C1'" . U   C 8  ? 0.5771 0.4455 0.4491 -0.0789 0.0632  -0.0328 8  U   C "C1'" 
1005 N N1    . U   C 8  ? 0.5221 0.3867 0.3909 -0.0765 0.0601  -0.0302 8  U   C N1    
1006 C C2    . U   C 8  ? 0.4442 0.3128 0.3189 -0.0762 0.0597  -0.0308 8  U   C C2    
1007 O O2    . U   C 8  ? 0.5614 0.4365 0.4436 -0.0778 0.0618  -0.0333 8  U   C O2    
1008 N N3    . U   C 8  ? 0.3308 0.1956 0.2021 -0.0739 0.0567  -0.0283 8  U   C N3    
1009 C C4    . U   C 8  ? 0.3374 0.1951 0.2002 -0.0717 0.0541  -0.0256 8  U   C C4    
1010 O O4    . U   C 8  ? 0.3785 0.2336 0.2392 -0.0697 0.0516  -0.0237 8  U   C O4    
1011 C C5    . U   C 8  ? 0.4204 0.2743 0.2777 -0.0720 0.0545  -0.0252 8  U   C C5    
1012 C C6    . U   C 8  ? 0.4939 0.3513 0.3543 -0.0744 0.0574  -0.0274 8  U   C C6    
1013 P P     . G   C 9  ? 0.7175 0.5576 0.5464 -0.0937 0.0804  -0.0371 9  G   C P     
1014 O OP1   . G   C 9  ? 0.7454 0.5831 0.5710 -0.0970 0.0840  -0.0391 9  G   C OP1   
1015 O OP2   . G   C 9  ? 0.7697 0.6011 0.5892 -0.0915 0.0771  -0.0338 9  G   C OP2   
1016 O "O5'" . G   C 9  ? 0.4932 0.3400 0.3311 -0.0944 0.0813  -0.0391 9  G   C "O5'" 
1017 C "C5'" . G   C 9  ? 0.5258 0.3824 0.3755 -0.0954 0.0832  -0.0421 9  G   C "C5'" 
1018 C "C4'" . G   C 9  ? 0.5972 0.4600 0.4560 -0.0948 0.0824  -0.0431 9  G   C "C4'" 
1019 O "O4'" . G   C 9  ? 0.6485 0.5131 0.5118 -0.0909 0.0772  -0.0403 9  G   C "O4'" 
1020 C "C3'" . G   C 9  ? 0.6839 0.5405 0.5345 -0.0982 0.0860  -0.0443 9  G   C "C3'" 
1021 O "O3'" . G   C 9  ? 0.7735 0.6375 0.6336 -0.0995 0.0878  -0.0471 9  G   C "O3'" 
1022 C "C2'" . G   C 9  ? 0.6945 0.5465 0.5410 -0.0958 0.0823  -0.0411 9  G   C "C2'" 
1023 O "O2'" . G   C 9  ? 0.7546 0.6042 0.5985 -0.0976 0.0839  -0.0419 9  G   C "O2'" 
1024 C "C1'" . G   C 9  ? 0.6531 0.5135 0.5118 -0.0917 0.0776  -0.0398 9  G   C "C1'" 
1025 N N9    . G   C 9  ? 0.5540 0.4107 0.4095 -0.0883 0.0732  -0.0364 9  G   C N9    
1026 C C8    . G   C 9  ? 0.4619 0.3104 0.3072 -0.0870 0.0715  -0.0338 9  G   C C8    
1027 N N7    . G   C 9  ? 0.3228 0.1700 0.1680 -0.0838 0.0675  -0.0312 9  G   C N7    
1028 C C5    . G   C 9  ? 0.2953 0.1499 0.1510 -0.0831 0.0665  -0.0320 9  G   C C5    
1029 C C6    . G   C 9  ? 0.2723 0.1290 0.1325 -0.0800 0.0627  -0.0303 9  G   C C6    
1030 O O6    . G   C 9  ? 0.3211 0.1734 0.1768 -0.0773 0.0595  -0.0276 9  G   C O6    
1031 N N1    . G   C 9  ? 0.2566 0.1211 0.1274 -0.0802 0.0630  -0.0320 9  G   C N1    
1032 C C2    . G   C 9  ? 0.2767 0.1465 0.1531 -0.0829 0.0665  -0.0351 9  G   C C2    
1033 N N2    . G   C 9  ? 0.3183 0.1952 0.2047 -0.0825 0.0659  -0.0364 9  G   C N2    
1034 N N3    . G   C 9  ? 0.3201 0.1883 0.1927 -0.0858 0.0701  -0.0369 9  G   C N3    
1035 C C4    . G   C 9  ? 0.3951 0.2556 0.2573 -0.0857 0.0699  -0.0352 9  G   C C4    
1036 P P     . U   C 10 ? 0.9239 0.7903 0.7852 -0.1033 0.0931  -0.0511 10 U   C P     
1037 O OP1   . U   C 10 ? 0.9134 0.7910 0.7889 -0.1022 0.0926  -0.0533 10 U   C OP1   
1038 O OP2   . U   C 10 ? 0.8987 0.7572 0.7481 -0.1057 0.0961  -0.0514 10 U   C OP2   
1039 O "O5'" . U   C 10 ? 1.0306 0.8930 0.8873 -0.1065 0.0963  -0.0528 10 U   C "O5'" 
1040 C "C5'" . U   C 10 ? 1.0463 0.8976 0.8883 -0.1091 0.0989  -0.0523 10 U   C "C5'" 
1041 C "C4'" . U   C 10 ? 1.0914 0.9411 0.9324 -0.1115 0.1011  -0.0539 10 U   C "C4'" 
1042 O "O4'" . U   C 10 ? 1.1758 1.0300 1.0217 -0.1145 0.1055  -0.0579 10 U   C "O4'" 
1043 C "C3'" . U   C 10 ? 1.0742 0.9285 0.9229 -0.1094 0.0982  -0.0529 10 U   C "C3'" 
1044 O "O3'" . U   C 10 ? 1.1065 0.9538 0.9472 -0.1113 0.0995  -0.0526 10 U   C "O3'" 
1045 C "C2'" . U   C 10 ? 1.0734 0.9375 0.9346 -0.1102 0.0999  -0.0562 10 U   C "C2'" 
1046 O "O2'" . U   C 10 ? 0.9699 0.8375 0.8372 -0.1101 0.0992  -0.0567 10 U   C "O2'" 
1047 C "C1'" . U   C 10 ? 1.2033 1.0642 1.0591 -0.1144 0.1053  -0.0594 10 U   C "C1'" 
1048 N N1    . U   C 10 ? 1.3377 1.2070 1.2033 -0.1153 0.1076  -0.0629 10 U   C N1    
1049 C C2    . U   C 10 ? 1.4339 1.3064 1.3043 -0.1177 0.1106  -0.0661 10 U   C C2    
1050 O O2    . U   C 10 ? 1.4059 1.2749 1.2732 -0.1191 0.1113  -0.0660 10 U   C O2    
1051 N N3    . U   C 10 ? 1.4905 1.3707 1.3699 -0.1184 0.1126  -0.0694 10 U   C N3    
1052 C C4    . U   C 10 ? 1.4564 1.3413 1.3401 -0.1170 0.1120  -0.0699 10 U   C C4    
1053 O O4    . U   C 10 ? 1.4146 1.3062 1.3063 -0.1177 0.1141  -0.0732 10 U   C O4    
1054 C C5    . U   C 10 ? 1.4062 1.2873 1.2845 -0.1147 0.1089  -0.0664 10 U   C C5    
1055 C C6    . U   C 10 ? 1.3511 1.2246 1.2207 -0.1140 0.1069  -0.0631 10 U   C C6    
1056 P P     . G   C 11 ? 1.0280 0.8695 0.8627 -0.1089 0.0957  -0.0489 11 G   C P     
1057 O OP1   . G   C 11 ? 1.0480 0.8971 0.8935 -0.1050 0.0912  -0.0473 11 G   C OP1   
1058 O OP2   . G   C 11 ? 1.0134 0.8487 0.8410 -0.1115 0.0979  -0.0496 11 G   C OP2   
1059 O "O5'" . G   C 11 ? 0.5275 0.3612 0.3511 -0.1080 0.0947  -0.0467 11 G   C "O5'" 
1060 C "C5'" . G   C 11 ? 0.5473 0.3724 0.3598 -0.1112 0.0979  -0.0476 11 G   C "C5'" 
1061 C "C4'" . G   C 11 ? 0.6813 0.4971 0.4833 -0.1095 0.0949  -0.0442 11 G   C "C4'" 
1062 O "O4'" . G   C 11 ? 0.7525 0.5656 0.5518 -0.1078 0.0924  -0.0422 11 G   C "O4'" 
1063 C "C3'" . G   C 11 ? 0.6961 0.5133 0.4995 -0.1061 0.0914  -0.0418 11 G   C "C3'" 
1064 O "O3'" . G   C 11 ? 0.7407 0.5563 0.5420 -0.1075 0.0930  -0.0427 11 G   C "O3'" 
1065 C "C2'" . G   C 11 ? 0.6928 0.5024 0.4880 -0.1036 0.0876  -0.0384 11 G   C "C2'" 
1066 O "O2'" . G   C 11 ? 0.7258 0.5258 0.5102 -0.1049 0.0882  -0.0377 11 G   C "O2'" 
1067 C "C1'" . G   C 11 ? 0.6683 0.4776 0.4635 -0.1043 0.0881  -0.0388 11 G   C "C1'" 
1068 N N9    . G   C 11 ? 0.5731 0.3879 0.3747 -0.1012 0.0850  -0.0375 11 G   C N9    
1069 C C8    . G   C 11 ? 0.5830 0.4061 0.3960 -0.1013 0.0852  -0.0389 11 G   C C8    
1070 N N7    . G   C 11 ? 0.5440 0.3707 0.3631 -0.0980 0.0811  -0.0369 11 G   C N7    
1071 C C5    . G   C 11 ? 0.4203 0.2409 0.2315 -0.0954 0.0782  -0.0340 11 G   C C5    
1072 C C6    . G   C 11 ? 0.3646 0.1857 0.1775 -0.0914 0.0734  -0.0311 11 G   C C6    
1073 O O6    . G   C 11 ? 0.4693 0.2961 0.2910 -0.0892 0.0708  -0.0305 11 G   C O6    
1074 N N1    . G   C 11 ? 0.3556 0.1692 0.1585 -0.0898 0.0716  -0.0290 11 G   C N1    
1075 C C2    . G   C 11 ? 0.4467 0.2536 0.2403 -0.0916 0.0736  -0.0293 11 G   C C2    
1076 N N2    . G   C 11 ? 0.4885 0.2894 0.2757 -0.0891 0.0703  -0.0268 11 G   C N2    
1077 N N3    . G   C 11 ? 0.3339 0.1402 0.1264 -0.0955 0.0778  -0.0319 11 G   C N3    
1078 C C4    . G   C 11 ? 0.4401 0.2533 0.2403 -0.0973 0.0805  -0.0343 11 G   C C4    
1079 P P     . G   C 12 ? 0.7693 0.5911 0.5773 -0.1053 0.0914  -0.0423 12 G   C P     
1080 O OP1   . G   C 12 ? 0.7411 0.5594 0.5449 -0.1076 0.0938  -0.0434 12 G   C OP1   
1081 O OP2   . G   C 12 ? 0.5403 0.3731 0.3608 -0.1046 0.0917  -0.0441 12 G   C OP2   
1082 O "O5'" . G   C 12 ? 0.7454 0.5632 0.5493 -0.1013 0.0863  -0.0384 12 G   C "O5'" 
1083 C "C5'" . G   C 12 ? 0.6258 0.4333 0.4183 -0.1009 0.0849  -0.0362 12 G   C "C5'" 
1084 C "C4'" . G   C 12 ? 0.6415 0.4472 0.4324 -0.0966 0.0799  -0.0328 12 G   C "C4'" 
1085 O "O4'" . G   C 12 ? 0.7763 0.5845 0.5703 -0.0946 0.0778  -0.0318 12 G   C "O4'" 
1086 C "C3'" . G   C 12 ? 0.6210 0.4323 0.4182 -0.0942 0.0779  -0.0321 12 G   C "C3'" 
1087 O "O3'" . G   C 12 ? 0.6791 0.4841 0.4697 -0.0913 0.0741  -0.0291 12 G   C "O3'" 
1088 C "C2'" . G   C 12 ? 0.6618 0.4814 0.4685 -0.0921 0.0762  -0.0320 12 G   C "C2'" 
1089 O "O2'" . G   C 12 ? 0.6773 0.5008 0.4887 -0.0887 0.0729  -0.0303 12 G   C "O2'" 
1090 C "C1'" . G   C 12 ? 0.6787 0.4930 0.4798 -0.0912 0.0746  -0.0305 12 G   C "C1'" 
1091 N N9    . G   C 12 ? 0.5105 0.3311 0.3191 -0.0904 0.0741  -0.0309 12 G   C N9    
1092 C C8    . G   C 12 ? 0.4938 0.3223 0.3127 -0.0920 0.0760  -0.0333 12 G   C C8    
1093 N N7    . G   C 12 ? 0.4038 0.2372 0.2306 -0.0898 0.0732  -0.0325 12 G   C N7    
1094 C C5    . G   C 12 ? 0.3091 0.1382 0.1313 -0.0864 0.0692  -0.0294 12 G   C C5    
1095 C C6    . G   C 12 ? 0.2983 0.1290 0.1241 -0.0833 0.0653  -0.0275 12 G   C C6    
1096 O O6    . G   C 12 ? 0.4050 0.2412 0.2391 -0.0828 0.0647  -0.0280 12 G   C O6    
1097 N N1    . G   C 12 ? 0.3612 0.1860 0.1798 -0.0804 0.0620  -0.0247 12 G   C N1    
1098 C C2    . G   C 12 ? 0.2995 0.1176 0.1086 -0.0805 0.0622  -0.0238 12 G   C C2    
1099 N N2    . G   C 12 ? 0.3009 0.1140 0.1041 -0.0773 0.0586  -0.0212 12 G   C N2    
1100 N N3    . G   C 12 ? 0.3366 0.1521 0.1406 -0.0839 0.0663  -0.0257 12 G   C N3    
1101 C C4    . G   C 12 ? 0.3346 0.1562 0.1461 -0.0866 0.0695  -0.0284 12 G   C C4    
1102 P P     . A   C 13 ? 0.6348 0.4321 0.4167 -0.0920 0.0744  -0.0285 13 A   C P     
1103 O OP1   . A   C 13 ? 0.7137 0.5153 0.4998 -0.0951 0.0783  -0.0312 13 A   C OP1   
1104 O OP2   . A   C 13 ? 0.6614 0.4557 0.4406 -0.0880 0.0698  -0.0255 13 A   C OP2   
1105 O "O5'" . A   C 13 ? 0.6937 0.4819 0.4655 -0.0940 0.0757  -0.0285 13 A   C "O5'" 
1106 C "C5'" . A   C 13 ? 0.6847 0.4682 0.4516 -0.0917 0.0727  -0.0265 13 A   C "C5'" 
1107 C "C4'" . A   C 13 ? 0.7571 0.5299 0.5123 -0.0926 0.0727  -0.0258 13 A   C "C4'" 
1108 O "O4'" . A   C 13 ? 0.7356 0.5042 0.4862 -0.0908 0.0707  -0.0243 13 A   C "O4'" 
1109 C "C3'" . A   C 13 ? 0.8088 0.5785 0.5600 -0.0973 0.0777  -0.0285 13 A   C "C3'" 
1110 O "O3'" . A   C 13 ? 0.8554 0.6163 0.5970 -0.0982 0.0778  -0.0281 13 A   C "O3'" 
1111 C "C2'" . A   C 13 ? 0.7332 0.5005 0.4815 -0.0983 0.0788  -0.0288 13 A   C "C2'" 
1112 O "O2'" . A   C 13 ? 0.7670 0.5275 0.5075 -0.1019 0.0823  -0.0305 13 A   C "O2'" 
1113 C "C1'" . A   C 13 ? 0.7300 0.4928 0.4739 -0.0941 0.0740  -0.0258 13 A   C "C1'" 
1114 N N9    . A   C 13 ? 0.6960 0.4586 0.4397 -0.0933 0.0732  -0.0252 13 A   C N9    
1115 C C8    . A   C 13 ? 0.7257 0.4952 0.4771 -0.0913 0.0717  -0.0246 13 A   C C8    
1116 N N7    . A   C 13 ? 0.7900 0.5567 0.5383 -0.0911 0.0714  -0.0241 13 A   C N7    
1117 C C5    . A   C 13 ? 0.8637 0.6209 0.6014 -0.0928 0.0726  -0.0242 13 A   C C5    
1118 C C6    . A   C 13 ? 0.9326 0.6826 0.6623 -0.0934 0.0729  -0.0238 13 A   C C6    
1119 N N6    . A   C 13 ? 1.0500 0.8012 0.7812 -0.0922 0.0719  -0.0231 13 A   C N6    
1120 N N1    . A   C 13 ? 0.7959 0.5369 0.5156 -0.0952 0.0742  -0.0243 13 A   C N1    
1121 C C2    . A   C 13 ? 0.7611 0.5006 0.4792 -0.0964 0.0752  -0.0251 13 A   C C2    
1122 N N3    . A   C 13 ? 0.7544 0.5001 0.4793 -0.0960 0.0751  -0.0254 13 A   C N3    
1123 C C4    . A   C 13 ? 0.7834 0.5379 0.5181 -0.0941 0.0737  -0.0249 13 A   C C4    
1124 P P     . A   C 14 ? 0.8527 0.6136 0.5943 -0.1007 0.0803  -0.0297 14 A   C P     
1125 O OP1   . A   C 14 ? 0.9054 0.6766 0.6582 -0.1009 0.0813  -0.0309 14 A   C OP1   
1126 O OP2   . A   C 14 ? 0.7606 0.5151 0.4949 -0.1049 0.0844  -0.0317 14 A   C OP2   
1127 O "O5'" . A   C 14 ? 1.0548 0.8108 0.7916 -0.0978 0.0764  -0.0272 14 A   C "O5'" 
1128 C "C5'" . A   C 14 ? 0.9422 0.6973 0.6784 -0.0933 0.0716  -0.0245 14 A   C "C5'" 
1129 C "C4'" . A   C 14 ? 0.8655 0.6234 0.6052 -0.0904 0.0683  -0.0230 14 A   C "C4'" 
1130 O "O4'" . A   C 14 ? 0.7301 0.4874 0.4690 -0.0930 0.0709  -0.0244 14 A   C "O4'" 
1131 C "C3'" . A   C 14 ? 0.8326 0.6002 0.5831 -0.0881 0.0667  -0.0225 14 A   C "C3'" 
1132 O "O3'" . A   C 14 ? 0.7669 0.5356 0.5190 -0.0842 0.0628  -0.0205 14 A   C "O3'" 
1133 C "C2'" . A   C 14 ? 0.7459 0.5153 0.4986 -0.0873 0.0657  -0.0222 14 A   C "C2'" 
1134 O "O2'" . A   C 14 ? 0.8323 0.5979 0.5814 -0.0835 0.0613  -0.0198 14 A   C "O2'" 
1135 C "C1'" . A   C 14 ? 0.5780 0.3420 0.3246 -0.0912 0.0694  -0.0239 14 A   C "C1'" 
1136 N N9    . A   C 14 ? 0.5004 0.2705 0.2533 -0.0945 0.0734  -0.0265 14 A   C N9    
1137 C C8    . A   C 14 ? 0.5857 0.3557 0.3379 -0.0986 0.0779  -0.0290 14 A   C C8    
1138 N N7    . A   C 14 ? 0.6021 0.3785 0.3613 -0.1007 0.0807  -0.0311 14 A   C N7    
1139 C C5    . A   C 14 ? 0.3657 0.1464 0.1299 -0.0978 0.0777  -0.0297 14 A   C C5    
1140 C C6    . A   C 14 ? 0.4739 0.2618 0.2462 -0.0980 0.0785  -0.0308 14 A   C C6    
1141 N N6    . A   C 14 ? 0.4431 0.2357 0.2203 -0.1014 0.0826  -0.0337 14 A   C N6    
1142 N N1    . A   C 14 ? 0.5216 0.3120 0.2970 -0.0947 0.0749  -0.0288 14 A   C N1    
1143 C C2    . A   C 14 ? 0.5444 0.3304 0.3153 -0.0913 0.0708  -0.0261 14 A   C C2    
1144 N N3    . A   C 14 ? 0.5188 0.2981 0.2823 -0.0906 0.0696  -0.0250 14 A   C N3    
1145 C C4    . A   C 14 ? 0.4316 0.2084 0.1919 -0.0941 0.0733  -0.0269 14 A   C C4    
1146 P P     . G   C 15 ? 0.5864 0.3648 0.3492 -0.0831 0.0625  -0.0208 15 G   C P     
1147 O OP1   . G   C 15 ? 0.6791 0.4563 0.4405 -0.0828 0.0623  -0.0205 15 G   C OP1   
1148 O OP2   . G   C 15 ? 0.5681 0.3527 0.3373 -0.0862 0.0662  -0.0232 15 G   C OP2   
1149 O "O5'" . G   C 15 ? 0.4274 0.2089 0.1942 -0.0784 0.0576  -0.0185 15 G   C "O5'" 
1150 C "C5'" . G   C 15 ? 0.4346 0.2103 0.1956 -0.0751 0.0536  -0.0163 15 G   C "C5'" 
1151 C "C4'" . G   C 15 ? 0.6861 0.4642 0.4503 -0.0718 0.0502  -0.0148 15 G   C "C4'" 
1152 O "O4'" . G   C 15 ? 0.7200 0.4973 0.4831 -0.0740 0.0523  -0.0158 15 G   C "O4'" 
1153 C "C3'" . G   C 15 ? 0.8222 0.6093 0.5965 -0.0697 0.0487  -0.0145 15 G   C "C3'" 
1154 O "O3'" . G   C 15 ? 0.3184 0.1076 0.0955 -0.0663 0.0454  -0.0130 15 G   C "O3'" 
1155 C "C2'" . G   C 15 ? 0.7247 0.5131 0.5008 -0.0685 0.0473  -0.0140 15 G   C "C2'" 
1156 O "O2'" . G   C 15 ? 0.7433 0.5281 0.5160 -0.0647 0.0431  -0.0120 15 G   C "O2'" 
1157 C "C1'" . G   C 15 ? 0.5059 0.2892 0.2759 -0.0722 0.0507  -0.0153 15 G   C "C1'" 
1158 N N9    . G   C 15 ? 0.3548 0.1438 0.1306 -0.0754 0.0544  -0.0174 15 G   C N9    
1159 C C8    . G   C 15 ? 0.4166 0.2068 0.1932 -0.0792 0.0586  -0.0196 15 G   C C8    
1160 N N7    . G   C 15 ? 0.5050 0.3012 0.2880 -0.0812 0.0612  -0.0214 15 G   C N7    
1161 C C5    . G   C 15 ? 0.4048 0.2029 0.1903 -0.0789 0.0587  -0.0202 15 G   C C5    
1162 C C6    . G   C 15 ? 0.3551 0.1591 0.1478 -0.0795 0.0596  -0.0212 15 G   C C6    
1163 O O6    . G   C 15 ? 0.3733 0.1829 0.1734 -0.0819 0.0623  -0.0233 15 G   C O6    
1164 N N1    . G   C 15 ? 0.3096 0.1137 0.1036 -0.0762 0.0558  -0.0192 15 G   C N1    
1165 C C2    . G   C 15 ? 0.4727 0.2712 0.2596 -0.0732 0.0524  -0.0170 15 G   C C2    
1166 N N2    . G   C 15 ? 0.3347 0.1346 0.1243 -0.0704 0.0493  -0.0156 15 G   C N2    
1167 N N3    . G   C 15 ? 0.5170 0.3109 0.2988 -0.0723 0.0513  -0.0162 15 G   C N3    
1168 C C4    . G   C 15 ? 0.4121 0.2058 0.1932 -0.0753 0.0545  -0.0178 15 G   C C4    
1169 P P     . G   C 16 ? 0.8935 0.6816 0.6702 -0.0612 0.0400  -0.0107 16 G   C P     
1170 O OP1   . G   C 16 ? 1.0707 0.8511 0.8390 -0.0609 0.0391  -0.0102 16 G   C OP1   
1171 O OP2   . G   C 16 ? 0.9225 0.7128 0.7019 -0.0590 0.0381  -0.0099 16 G   C OP2   
1172 O "O5'" . G   C 16 ? 0.3840 0.1784 0.1679 -0.0594 0.0385  -0.0103 16 G   C "O5'" 
1173 C "C5'" . G   C 16 ? 0.5401 0.3319 0.3217 -0.0565 0.0352  -0.0089 16 G   C "C5'" 
1174 C "C4'" . G   C 16 ? 0.4575 0.2545 0.2450 -0.0553 0.0343  -0.0087 16 G   C "C4'" 
1175 O "O4'" . G   C 16 ? 0.3815 0.1805 0.1707 -0.0591 0.0382  -0.0104 16 G   C "O4'" 
1176 C "C3'" . G   C 16 ? 0.4293 0.2331 0.2246 -0.0531 0.0326  -0.0083 16 G   C "C3'" 
1177 O "O3'" . G   C 16 ? 0.5328 0.3397 0.3329 -0.0502 0.0297  -0.0073 16 G   C "O3'" 
1178 C "C2'" . G   C 16 ? 0.3208 0.1311 0.1249 -0.0563 0.0361  -0.0100 16 G   C "C2'" 
1179 O "O2'" . G   C 16 ? 0.4642 0.2843 0.2822 -0.0543 0.0343  -0.0100 16 G   C "O2'" 
1180 C "C1'" . G   C 16 ? 0.3075 0.1152 0.1078 -0.0590 0.0386  -0.0110 16 G   C "C1'" 
1181 N N9    . G   C 16 ? 0.4025 0.2130 0.2061 -0.0632 0.0430  -0.0132 16 G   C N9    
1182 C C8    . G   C 16 ? 0.2933 0.1016 0.0930 -0.0661 0.0462  -0.0145 16 G   C C8    
1183 N N7    . G   C 16 ? 0.2926 0.1048 0.0971 -0.0695 0.0498  -0.0166 16 G   C N7    
1184 C C5    . G   C 16 ? 0.3122 0.1294 0.1243 -0.0687 0.0488  -0.0167 16 G   C C5    
1185 C C6    . G   C 16 ? 0.3304 0.1533 0.1502 -0.0711 0.0513  -0.0187 16 G   C C6    
1186 O O6    . G   C 16 ? 0.4077 0.2326 0.2293 -0.0745 0.0550  -0.0210 16 G   C O6    
1187 N N1    . G   C 16 ? 0.2905 0.1170 0.1163 -0.0691 0.0490  -0.0180 16 G   C N1    
1188 C C2    . G   C 16 ? 0.3697 0.1947 0.1944 -0.0654 0.0450  -0.0157 16 G   C C2    
1189 N N2    . G   C 16 ? 0.2672 0.0963 0.0984 -0.0641 0.0435  -0.0155 16 G   C N2    
1190 N N3    . G   C 16 ? 0.2763 0.0964 0.0941 -0.0631 0.0427  -0.0140 16 G   C N3    
1191 C C4    . G   C 16 ? 0.3269 0.1432 0.1387 -0.0649 0.0447  -0.0146 16 G   C C4    
1192 P P     . A   C 17 ? 0.5385 0.3508 0.3465 -0.0456 0.0252  -0.0059 17 A   C P     
1193 O OP1   . A   C 17 ? 0.6259 0.4367 0.4321 -0.0428 0.0222  -0.0048 17 A   C OP1   
1194 O OP2   . A   C 17 ? 0.3490 0.1587 0.1532 -0.0447 0.0243  -0.0055 17 A   C OP2   
1195 O "O5'" . A   C 17 ? 0.5271 0.3501 0.3504 -0.0458 0.0257  -0.0067 17 A   C "O5'" 
1196 C "C5'" . A   C 17 ? 0.4729 0.3002 0.3026 -0.0464 0.0263  -0.0072 17 A   C "C5'" 
1197 C "C4'" . A   C 17 ? 0.4473 0.2848 0.2917 -0.0455 0.0255  -0.0078 17 A   C "C4'" 
1198 O "O4'" . A   C 17 ? 0.3532 0.1938 0.2016 -0.0487 0.0288  -0.0097 17 A   C "O4'" 
1199 C "C3'" . A   C 17 ? 0.4833 0.3250 0.3340 -0.0415 0.0218  -0.0067 17 A   C "C3'" 
1200 O "O3'" . A   C 17 ? 0.5776 0.4276 0.4405 -0.0397 0.0201  -0.0068 17 A   C "O3'" 
1201 C "C2'" . A   C 17 ? 0.4056 0.2492 0.2587 -0.0430 0.0234  -0.0077 17 A   C "C2'" 
1202 O "O2'" . A   C 17 ? 0.4403 0.2908 0.3036 -0.0403 0.0209  -0.0075 17 A   C "O2'" 
1203 C "C1'" . A   C 17 ? 0.3060 0.1524 0.1627 -0.0470 0.0273  -0.0098 17 A   C "C1'" 
1204 N N9    . A   C 17 ? 0.2911 0.1369 0.1461 -0.0501 0.0304  -0.0113 17 A   C N9    
1205 C C8    . A   C 17 ? 0.3536 0.1942 0.2009 -0.0505 0.0310  -0.0109 17 A   C C8    
1206 N N7    . A   C 17 ? 0.3160 0.1576 0.1640 -0.0538 0.0343  -0.0127 17 A   C N7    
1207 C C5    . A   C 17 ? 0.3054 0.1536 0.1622 -0.0555 0.0360  -0.0145 17 A   C C5    
1208 C C6    . A   C 17 ? 0.4493 0.3018 0.3110 -0.0589 0.0396  -0.0170 17 A   C C6    
1209 N N6    . A   C 17 ? 0.2399 0.0910 0.0984 -0.0614 0.0424  -0.0183 17 A   C N6    
1210 N N1    . A   C 17 ? 0.2291 0.0879 0.0993 -0.0595 0.0402  -0.0183 17 A   C N1    
1211 C C2    . A   C 17 ? 0.2245 0.0847 0.0978 -0.0570 0.0375  -0.0170 17 A   C C2    
1212 N N3    . A   C 17 ? 0.2248 0.0812 0.0940 -0.0538 0.0342  -0.0147 17 A   C N3    
1213 C C4    . A   C 17 ? 0.2884 0.1389 0.1493 -0.0532 0.0336  -0.0135 17 A   C C4    
1214 P P     . G   C 18 ? 0.5778 0.4287 0.4424 -0.0393 0.0197  -0.0066 18 G   C P     
1215 O OP1   . G   C 18 ? 0.6219 0.4643 0.4742 -0.0395 0.0197  -0.0056 18 G   C OP1   
1216 O OP2   . G   C 18 ? 0.4817 0.3397 0.3568 -0.0357 0.0164  -0.0059 18 G   C OP2   
1217 O "O5'" . G   C 18 ? 0.5165 0.3712 0.3865 -0.0430 0.0232  -0.0087 18 G   C "O5'" 
1218 C "C5'" . G   C 18 ? 0.4821 0.3374 0.3533 -0.0441 0.0240  -0.0091 18 G   C "C5'" 
1219 C "C4'" . G   C 18 ? 0.5019 0.3493 0.3616 -0.0471 0.0268  -0.0094 18 G   C "C4'" 
1220 O "O4'" . G   C 18 ? 0.5139 0.3604 0.3715 -0.0507 0.0303  -0.0110 18 G   C "O4'" 
1221 C "C3'" . G   C 18 ? 0.5415 0.3892 0.4021 -0.0485 0.0278  -0.0099 18 G   C "C3'" 
1222 O "O3'" . G   C 18 ? 0.5657 0.4050 0.4144 -0.0487 0.0279  -0.0089 18 G   C "O3'" 
1223 C "C2'" . G   C 18 ? 0.5780 0.4277 0.4409 -0.0526 0.0318  -0.0122 18 G   C "C2'" 
1224 O "O2'" . G   C 18 ? 0.7075 0.5539 0.5660 -0.0552 0.0340  -0.0130 18 G   C "O2'" 
1225 C "C1'" . G   C 18 ? 0.5015 0.3467 0.3572 -0.0541 0.0335  -0.0124 18 G   C "C1'" 
1226 N N9    . G   C 18 ? 0.3267 0.1755 0.1866 -0.0573 0.0368  -0.0147 18 G   C N9    
1227 C C8    . G   C 18 ? 0.3465 0.2014 0.2149 -0.0592 0.0386  -0.0166 18 G   C C8    
1228 N N7    . G   C 18 ? 0.2882 0.1454 0.1586 -0.0619 0.0415  -0.0186 18 G   C N7    
1229 C C5    . G   C 18 ? 0.3479 0.1999 0.2104 -0.0619 0.0418  -0.0178 18 G   C C5    
1230 C C6    . G   C 18 ? 0.3865 0.2379 0.2470 -0.0643 0.0445  -0.0192 18 G   C C6    
1231 O O6    . G   C 18 ? 0.4355 0.2914 0.3011 -0.0669 0.0474  -0.0215 18 G   C O6    
1232 N N1    . G   C 18 ? 0.3462 0.1913 0.1978 -0.0633 0.0436  -0.0177 18 G   C N1    
1233 C C2    . G   C 18 ? 0.3444 0.1844 0.1899 -0.0603 0.0404  -0.0153 18 G   C C2    
1234 N N2    . G   C 18 ? 0.4036 0.2378 0.2408 -0.0597 0.0399  -0.0142 18 G   C N2    
1235 N N3    . G   C 18 ? 0.3486 0.1893 0.1960 -0.0580 0.0379  -0.0141 18 G   C N3    
1236 C C4    . G   C 18 ? 0.3257 0.1724 0.1817 -0.0590 0.0388  -0.0154 18 G   C C4    
1237 P P     . U   C 19 ? 0.9603 0.7981 0.8073 -0.0451 0.0243  -0.0071 19 U   C P     
1238 O OP1   . U   C 19 ? 0.8605 0.6991 0.7084 -0.0415 0.0211  -0.0058 19 U   C OP1   
1239 O OP2   . U   C 19 ? 0.8984 0.7418 0.7542 -0.0450 0.0241  -0.0076 19 U   C OP2   
1240 O "O5'" . U   C 19 ? 0.9200 0.7479 0.7530 -0.0465 0.0254  -0.0068 19 U   C "O5'" 
1241 C "C5'" . U   C 19 ? 0.8135 0.6386 0.6429 -0.0497 0.0282  -0.0078 19 U   C "C5'" 
1242 C "C4'" . U   C 19 ? 0.7949 0.6103 0.6105 -0.0505 0.0286  -0.0074 19 U   C "C4'" 
1243 O "O4'" . U   C 19 ? 0.9150 0.7286 0.7281 -0.0468 0.0250  -0.0058 19 U   C "O4'" 
1244 C "C3'" . U   C 19 ? 0.7895 0.5986 0.5955 -0.0515 0.0297  -0.0075 19 U   C "C3'" 
1245 O "O3'" . U   C 19 ? 0.7052 0.5060 0.4998 -0.0541 0.0318  -0.0080 19 U   C "O3'" 
1246 C "C2'" . U   C 19 ? 0.8669 0.6742 0.6701 -0.0474 0.0258  -0.0059 19 U   C "C2'" 
1247 O "O2'" . U   C 19 ? 0.8558 0.6550 0.6474 -0.0476 0.0257  -0.0058 19 U   C "O2'" 
1248 C "C1'" . U   C 19 ? 0.9216 0.7289 0.7254 -0.0454 0.0236  -0.0052 19 U   C "C1'" 
1249 N N1    . U   C 19 ? 0.9594 0.7687 0.7656 -0.0410 0.0196  -0.0039 19 U   C N1    
1250 C C2    . U   C 19 ? 1.0474 0.8645 0.8645 -0.0387 0.0177  -0.0034 19 U   C C2    
1251 O O2    . U   C 19 ? 1.0678 0.8908 0.8933 -0.0400 0.0192  -0.0041 19 U   C O2    
1252 N N3    . U   C 19 ? 1.1314 0.9494 0.9493 -0.0347 0.0141  -0.0024 19 U   C N3    
1253 C C4    . U   C 19 ? 1.1743 0.9864 0.9837 -0.0328 0.0120  -0.0019 19 U   C C4    
1254 O O4    . U   C 19 ? 1.1946 1.0088 1.0065 -0.0293 0.0088  -0.0012 19 U   C O4    
1255 C C5    . U   C 19 ? 1.1338 0.9383 0.9330 -0.0353 0.0139  -0.0024 19 U   C C5    
1256 C C6    . U   C 19 ? 1.0465 0.8495 0.8438 -0.0392 0.0175  -0.0033 19 U   C C6    
1257 P P     . G   C 20 ? 1.1988 0.9974 0.9901 -0.0589 0.0365  -0.0099 20 G   C P     
1258 O OP1   . G   C 20 ? 1.2271 1.0276 1.0201 -0.0591 0.0371  -0.0102 20 G   C OP1   
1259 O OP2   . G   C 20 ? 1.2397 1.0295 1.0194 -0.0606 0.0377  -0.0101 20 G   C OP2   
1260 O "O5'" . G   C 20 ? 0.6357 0.4417 0.4378 -0.0608 0.0384  -0.0111 20 G   C "O5'" 
1261 C "C5'" . G   C 20 ? 0.5394 0.3450 0.3419 -0.0614 0.0386  -0.0112 20 G   C "C5'" 
1262 C "C4'" . G   C 20 ? 0.4713 0.2836 0.2835 -0.0640 0.0410  -0.0129 20 G   C "C4'" 
1263 O "O4'" . G   C 20 ? 0.5874 0.3975 0.3958 -0.0677 0.0449  -0.0146 20 G   C "O4'" 
1264 C "C3'" . G   C 20 ? 0.5986 0.4207 0.4245 -0.0620 0.0395  -0.0130 20 G   C "C3'" 
1265 O "O3'" . G   C 20 ? 0.7379 0.5651 0.5719 -0.0616 0.0387  -0.0133 20 G   C "O3'" 
1266 C "C2'" . G   C 20 ? 0.6477 0.4732 0.4775 -0.0649 0.0426  -0.0149 20 G   C "C2'" 
1267 O "O2'" . G   C 20 ? 0.8926 0.7265 0.7343 -0.0657 0.0434  -0.0165 20 G   C "O2'" 
1268 C "C1'" . G   C 20 ? 0.5277 0.3458 0.3468 -0.0687 0.0462  -0.0160 20 G   C "C1'" 
1269 N N9    . G   C 20 ? 0.3858 0.2022 0.2013 -0.0704 0.0483  -0.0169 20 G   C N9    
1270 C C8    . G   C 20 ? 0.3744 0.1850 0.1812 -0.0695 0.0477  -0.0159 20 G   C C8    
1271 N N7    . G   C 20 ? 0.4454 0.2568 0.2523 -0.0716 0.0501  -0.0172 20 G   C N7    
1272 C C5    . G   C 20 ? 0.4061 0.2245 0.2227 -0.0737 0.0524  -0.0191 20 G   C C5    
1273 C C6    . G   C 20 ? 0.4762 0.2988 0.2976 -0.0765 0.0556  -0.0213 20 G   C C6    
1274 O O6    . G   C 20 ? 0.6402 0.4609 0.4578 -0.0776 0.0572  -0.0219 20 G   C O6    
1275 N N1    . G   C 20 ? 0.4502 0.2799 0.2815 -0.0778 0.0569  -0.0231 20 G   C N1    
1276 C C2    . G   C 20 ? 0.4658 0.2980 0.3019 -0.0767 0.0552  -0.0227 20 G   C C2    
1277 N N2    . G   C 20 ? 0.4316 0.2706 0.2773 -0.0782 0.0567  -0.0246 20 G   C N2    
1278 N N3    . G   C 20 ? 0.3352 0.1635 0.1669 -0.0742 0.0524  -0.0206 20 G   C N3    
1279 C C4    . G   C 20 ? 0.3499 0.1716 0.1722 -0.0729 0.0511  -0.0189 20 G   C C4    
1280 P P     . G   C 21 ? 0.9047 0.7403 0.7509 -0.0580 0.0353  -0.0125 21 G   C P     
1281 O OP1   . G   C 21 ? 0.8499 0.6860 0.6980 -0.0570 0.0339  -0.0120 21 G   C OP1   
1282 O OP2   . G   C 21 ? 0.8181 0.6534 0.6632 -0.0549 0.0327  -0.0110 21 G   C OP2   
1283 O "O5'" . G   C 21 ? 0.5319 0.3755 0.3891 -0.0600 0.0373  -0.0147 21 G   C "O5'" 
1284 C "C5'" . G   C 21 ? 0.5455 0.3903 0.4046 -0.0636 0.0405  -0.0167 21 G   C "C5'" 
1285 C "C4'" . G   C 21 ? 0.6210 0.4732 0.4895 -0.0649 0.0421  -0.0187 21 G   C "C4'" 
1286 O "O4'" . G   C 21 ? 0.5843 0.4335 0.4474 -0.0674 0.0450  -0.0198 21 G   C "O4'" 
1287 C "C3'" . G   C 21 ? 0.6479 0.5075 0.5269 -0.0616 0.0390  -0.0183 21 G   C "C3'" 
1288 O "O3'" . G   C 21 ? 0.8167 0.6842 0.7066 -0.0627 0.0400  -0.0204 21 G   C "O3'" 
1289 C "C2'" . G   C 21 ? 0.4766 0.3348 0.3522 -0.0616 0.0396  -0.0181 21 G   C "C2'" 
1290 O "O2'" . G   C 21 ? 0.4201 0.2856 0.3055 -0.0599 0.0382  -0.0185 21 G   C "O2'" 
1291 C "C1'" . G   C 21 ? 0.5113 0.3660 0.3811 -0.0659 0.0440  -0.0200 21 G   C "C1'" 
1292 N N9    . G   C 21 ? 0.5342 0.3839 0.3959 -0.0670 0.0455  -0.0198 21 G   C N9    
1293 C C8    . G   C 21 ? 0.5175 0.3606 0.3699 -0.0654 0.0440  -0.0179 21 G   C C8    
1294 N N7    . G   C 21 ? 0.4281 0.2682 0.2753 -0.0670 0.0460  -0.0184 21 G   C N7    
1295 C C5    . G   C 21 ? 0.3787 0.2241 0.2325 -0.0698 0.0490  -0.0209 21 G   C C5    
1296 C C6    . G   C 21 ? 0.4052 0.2506 0.2575 -0.0725 0.0522  -0.0226 21 G   C C6    
1297 O O6    . G   C 21 ? 0.4105 0.2508 0.2550 -0.0731 0.0530  -0.0222 21 G   C O6    
1298 N N1    . G   C 21 ? 0.4569 0.3091 0.3179 -0.0747 0.0545  -0.0252 21 G   C N1    
1299 C C2    . G   C 21 ? 0.3666 0.2246 0.2365 -0.0743 0.0538  -0.0260 21 G   C C2    
1300 N N2    . G   C 21 ? 0.2465 0.1105 0.1238 -0.0765 0.0563  -0.0286 21 G   C N2    
1301 N N3    . G   C 21 ? 0.3995 0.2573 0.2706 -0.0719 0.0508  -0.0243 21 G   C N3    
1302 C C4    . G   C 21 ? 0.4448 0.2963 0.3077 -0.0697 0.0486  -0.0218 21 G   C C4    
1303 P P     . C   C 22 ? 0.6929 0.5010 0.4837 -0.0903 -0.0903 0.0501  22 C   C P     
1304 O OP1   . C   C 22 ? 0.5525 0.3592 0.3424 -0.0893 -0.0890 0.0499  22 C   C OP1   
1305 O OP2   . C   C 22 ? 0.7545 0.5646 0.5472 -0.0899 -0.0909 0.0504  22 C   C OP2   
1306 O "O5'" . C   C 22 ? 1.1899 0.9966 0.9783 -0.0912 -0.0913 0.0499  22 C   C "O5'" 
1307 C "C5'" . C   C 22 ? 1.1717 0.9787 0.9598 -0.0926 -0.0924 0.0498  22 C   C "C5'" 
1308 C "C4'" . C   C 22 ? 1.1833 0.9884 0.9687 -0.0933 -0.0930 0.0495  22 C   C "C4'" 
1309 O "O4'" . C   C 22 ? 1.2368 1.0417 1.0215 -0.0926 -0.0934 0.0496  22 C   C "O4'" 
1310 C "C3'" . C   C 22 ? 1.2113 1.0139 0.9945 -0.0935 -0.0922 0.0491  22 C   C "C3'" 
1311 O "O3'" . C   C 22 ? 1.2963 1.0987 1.0787 -0.0950 -0.0930 0.0489  22 C   C "O3'" 
1312 C "C2'" . C   C 22 ? 1.2190 1.0201 1.0000 -0.0932 -0.0924 0.0490  22 C   C "C2'" 
1313 O "O2'" . C   C 22 ? 1.2690 1.0683 1.0476 -0.0943 -0.0930 0.0486  22 C   C "O2'" 
1314 C "C1'" . C   C 22 ? 1.2928 1.0956 1.0750 -0.0927 -0.0933 0.0493  22 C   C "C1'" 
1315 N N1    . C   C 22 ? 1.3051 1.1076 1.0871 -0.0916 -0.0929 0.0494  22 C   C N1    
1316 C C2    . C   C 22 ? 1.2910 1.0920 1.0708 -0.0915 -0.0932 0.0493  22 C   C C2    
1317 O O2    . C   C 22 ? 1.2454 1.0451 1.0234 -0.0925 -0.0936 0.0490  22 C   C O2    
1318 N N3    . C   C 22 ? 1.3605 1.1614 1.1403 -0.0905 -0.0929 0.0495  22 C   C N3    
1319 C C4    . C   C 22 ? 1.3610 1.1634 1.1428 -0.0896 -0.0924 0.0498  22 C   C C4    
1320 N N4    . C   C 22 ? 1.3700 1.1722 1.1515 -0.0887 -0.0922 0.0499  22 C   C N4    
1321 C C5    . C   C 22 ? 1.3257 1.1297 1.1098 -0.0896 -0.0922 0.0499  22 C   C C5    
1322 C C6    . C   C 22 ? 1.3209 1.1250 1.1051 -0.0906 -0.0924 0.0497  22 C   C C6    
1323 P P     . U   C 23 ? 1.4179 1.2199 1.2003 -0.0961 -0.0928 0.0487  23 U   C P     
1324 O OP1   . U   C 23 ? 1.4178 1.2197 1.2013 -0.0951 -0.0915 0.0488  23 U   C OP1   
1325 O OP2   . U   C 23 ? 1.3578 1.1579 1.1376 -0.0974 -0.0934 0.0484  23 U   C OP2   
1326 O "O5'" . U   C 23 ? 2.1100 1.9148 1.8946 -0.0966 -0.0938 0.0490  23 U   C "O5'" 
1327 C "C5'" . U   C 23 ? 2.1028 1.9082 1.8867 -0.0972 -0.0951 0.0490  23 U   C "C5'" 
1328 C "C4'" . U   C 23 ? 2.1199 1.9281 1.9058 -0.0977 -0.0961 0.0492  23 U   C "C4'" 
1329 O "O4'" . U   C 23 ? 2.1256 1.9346 1.9120 -0.0965 -0.0965 0.0494  23 U   C "O4'" 
1330 C "C3'" . U   C 23 ? 2.1568 1.9657 1.9419 -0.0993 -0.0973 0.0490  23 U   C "C3'" 
1331 O "O3'" . U   C 23 ? 2.1626 1.9739 1.9498 -0.0999 -0.0977 0.0491  23 U   C "O3'" 
1332 C "C2'" . U   C 23 ? 2.1763 1.9863 1.9613 -0.0989 -0.0983 0.0490  23 U   C "C2'" 
1333 O "O2'" . U   C 23 ? 2.1992 2.0115 1.9850 -0.0999 -0.0996 0.0488  23 U   C "O2'" 
1334 C "C1'" . U   C 23 ? 2.1558 1.9665 1.9424 -0.0972 -0.0978 0.0494  23 U   C "C1'" 
1335 N N1    . U   C 23 ? 2.1802 1.9904 1.9659 -0.0963 -0.0983 0.0494  23 U   C N1    
1336 C C2    . U   C 23 ? 2.2077 2.0199 1.9942 -0.0963 -0.0996 0.0493  23 U   C C2    
1337 O O2    . U   C 23 ? 2.2094 2.0239 1.9974 -0.0969 -0.1003 0.0493  23 U   C O2    
1338 N N3    . U   C 23 ? 2.2326 2.0441 2.0180 -0.0955 -0.0999 0.0493  23 U   C N3    
1339 C C4    . U   C 23 ? 2.2330 2.0422 2.0168 -0.0949 -0.0992 0.0494  23 U   C C4    
1340 O O4    . U   C 23 ? 2.2297 2.0386 2.0126 -0.0943 -0.0997 0.0494  23 U   C O4    
1341 C C5    . U   C 23 ? 2.2141 2.0214 1.9971 -0.0950 -0.0979 0.0493  23 U   C C5    
1342 C C6    . U   C 23 ? 2.1886 1.9965 1.9726 -0.0956 -0.0975 0.0493  23 U   C C6    
1343 P P     . G   C 24 ? 1.9414 1.7524 1.7287 -0.1011 -0.0972 0.0490  24 G   C P     
1344 O OP1   . G   C 24 ? 1.9236 1.7316 1.7090 -0.1009 -0.0961 0.0489  24 G   C OP1   
1345 O OP2   . G   C 24 ? 1.8795 1.6919 1.6665 -0.1029 -0.0983 0.0488  24 G   C OP2   
1346 O "O5'" . G   C 24 ? 0.7828 0.5958 0.5730 -0.1003 -0.0967 0.0494  24 G   C "O5'" 
1347 C "C5'" . G   C 24 ? 0.6359 0.4514 0.4282 -0.0996 -0.0973 0.0497  24 G   C "C5'" 
1348 C "C4'" . G   C 24 ? 0.6635 0.4817 0.4579 -0.1004 -0.0978 0.0497  24 G   C "C4'" 
1349 O "O4'" . G   C 24 ? 0.7372 0.5543 0.5312 -0.1013 -0.0970 0.0497  24 G   C "O4'" 
1350 C "C3'" . G   C 24 ? 0.6391 0.4593 0.4362 -0.0992 -0.0976 0.0501  24 G   C "C3'" 
1351 O "O3'" . G   C 24 ? 0.5565 0.3788 0.3546 -0.0987 -0.0987 0.0501  24 G   C "O3'" 
1352 C "C2'" . G   C 24 ? 0.6611 0.4827 0.4596 -0.1002 -0.0974 0.0502  24 G   C "C2'" 
1353 O "O2'" . G   C 24 ? 0.6925 0.5164 0.4915 -0.1014 -0.0987 0.0499  24 G   C "O2'" 
1354 C "C1'" . G   C 24 ? 0.6540 0.4730 0.4504 -0.1011 -0.0967 0.0500  24 G   C "C1'" 
1355 N N9    . G   C 24 ? 0.5230 0.3408 0.3200 -0.1000 -0.0953 0.0501  24 G   C N9    
1356 C C8    . G   C 24 ? 0.4538 0.2693 0.2496 -0.0989 -0.0943 0.0500  24 G   C C8    
1357 N N7    . G   C 24 ? 0.5308 0.3460 0.3277 -0.0980 -0.0931 0.0501  24 G   C N7    
1358 C C5    . G   C 24 ? 0.5214 0.3386 0.3202 -0.0987 -0.0933 0.0503  24 G   C C5    
1359 C C6    . G   C 24 ? 0.5343 0.3523 0.3350 -0.0983 -0.0923 0.0504  24 G   C C6    
1360 O O6    . G   C 24 ? 0.5564 0.3736 0.3574 -0.0971 -0.0911 0.0503  24 G   C O6    
1361 N N1    . G   C 24 ? 0.5406 0.3607 0.3428 -0.0993 -0.0928 0.0505  24 G   C N1    
1362 C C2    . G   C 24 ? 0.4857 0.3072 0.2878 -0.1006 -0.0942 0.0505  24 G   C C2    
1363 N N2    . G   C 24 ? 0.4400 0.2636 0.2437 -0.1015 -0.0945 0.0507  24 G   C N2    
1364 N N3    . G   C 24 ? 0.4439 0.2649 0.2443 -0.1009 -0.0951 0.0504  24 G   C N3    
1365 C C4    . G   C 24 ? 0.4663 0.2850 0.2652 -0.1000 -0.0946 0.0503  24 G   C C4    
1366 P P     . G   C 25 ? 0.7898 0.6122 0.5890 -0.0967 -0.0983 0.0505  25 G   C P     
1367 O OP1   . G   C 25 ? 0.6945 0.5177 0.4933 -0.0963 -0.0996 0.0503  25 G   C OP1   
1368 O OP2   . G   C 25 ? 0.8578 0.6776 0.6560 -0.0959 -0.0970 0.0506  25 G   C OP2   
1369 O "O5'" . G   C 25 ? 0.9414 0.7662 0.7434 -0.0964 -0.0983 0.0508  25 G   C "O5'" 
1370 C "C5'" . G   C 25 ? 0.7983 0.6260 0.6018 -0.0969 -0.0995 0.0506  25 G   C "C5'" 
1371 C "C4'" . G   C 25 ? 0.7501 0.5796 0.5557 -0.0974 -0.0993 0.0508  25 G   C "C4'" 
1372 O "O4'" . G   C 25 ? 0.6787 0.5067 0.4833 -0.0985 -0.0984 0.0508  25 G   C "O4'" 
1373 C "C3'" . G   C 25 ? 0.7634 0.5936 0.5711 -0.0961 -0.0985 0.0512  25 G   C "C3'" 
1374 O "O3'" . G   C 25 ? 0.8422 0.6746 0.6514 -0.0953 -0.0995 0.0513  25 G   C "O3'" 
1375 C "C2'" . G   C 25 ? 0.6781 0.5090 0.4869 -0.0971 -0.0979 0.0513  25 G   C "C2'" 
1376 O "O2'" . G   C 25 ? 0.7429 0.5766 0.5530 -0.0980 -0.0990 0.0511  25 G   C "O2'" 
1377 C "C1'" . G   C 25 ? 0.6102 0.4389 0.4167 -0.0982 -0.0975 0.0511  25 G   C "C1'" 
1378 N N9    . G   C 25 ? 0.5751 0.4014 0.3810 -0.0975 -0.0960 0.0512  25 G   C N9    
1379 C C8    . G   C 25 ? 0.6136 0.4377 0.4179 -0.0966 -0.0954 0.0511  25 G   C C8    
1380 N N7    . G   C 25 ? 0.5279 0.3505 0.3321 -0.0960 -0.0941 0.0511  25 G   C N7    
1381 C C5    . G   C 25 ? 0.3858 0.2097 0.1917 -0.0964 -0.0936 0.0512  25 G   C C5    
1382 C C6    . G   C 25 ? 0.3602 0.1837 0.1669 -0.0960 -0.0923 0.0512  25 G   C C6    
1383 O O6    . G   C 25 ? 0.3448 0.1667 0.1509 -0.0951 -0.0912 0.0511  25 G   C O6    
1384 N N1    . G   C 25 ? 0.4446 0.2699 0.2531 -0.0967 -0.0923 0.0513  25 G   C N1    
1385 C C2    . G   C 25 ? 0.5651 0.3923 0.3744 -0.0978 -0.0935 0.0515  25 G   C C2    
1386 N N2    . G   C 25 ? 0.4820 0.3108 0.2930 -0.0984 -0.0933 0.0516  25 G   C N2    
1387 N N3    . G   C 25 ? 0.5823 0.4102 0.3910 -0.0981 -0.0948 0.0514  25 G   C N3    
1388 C C4    . G   C 25 ? 0.4820 0.3081 0.2889 -0.0974 -0.0948 0.0513  25 G   C C4    
1389 P P     . G   C 26 ? 1.0508 0.8825 0.8605 -0.0934 -0.0992 0.0516  26 G   C P     
1390 O OP1   . G   C 26 ? 1.0158 0.8476 0.8271 -0.0928 -0.0980 0.0520  26 G   C OP1   
1391 O OP2   . G   C 26 ? 1.0353 0.8688 0.8456 -0.0929 -0.1007 0.0514  26 G   C OP2   
1392 O "O5'" . G   C 26 ? 0.3744 0.2032 0.1818 -0.0930 -0.0986 0.0516  26 G   C "O5'" 
1393 C "C5'" . G   C 26 ? 0.4712 0.2991 0.2780 -0.0917 -0.0987 0.0517  26 G   C "C5'" 
1394 C "C4'" . G   C 26 ? 0.5289 0.3540 0.3340 -0.0913 -0.0974 0.0517  26 G   C "C4'" 
1395 O "O4'" . G   C 26 ? 0.4873 0.3121 0.2934 -0.0910 -0.0959 0.0519  26 G   C "O4'" 
1396 C "C3'" . G   C 26 ? 0.6019 0.4255 0.4048 -0.0925 -0.0975 0.0514  26 G   C "C3'" 
1397 O "O3'" . G   C 26 ? 0.7058 0.5272 0.5068 -0.0918 -0.0971 0.0513  26 G   C "O3'" 
1398 C "C2'" . G   C 26 ? 0.5446 0.3676 0.3478 -0.0931 -0.0963 0.0514  26 G   C "C2'" 
1399 O "O2'" . G   C 26 ? 0.5693 0.3901 0.3703 -0.0936 -0.0957 0.0511  26 G   C "O2'" 
1400 C "C1'" . G   C 26 ? 0.4900 0.3132 0.2948 -0.0917 -0.0951 0.0517  26 G   C "C1'" 
1401 N N9    . G   C 26 ? 0.4998 0.3238 0.3061 -0.0920 -0.0942 0.0517  26 G   C N9    
1402 C C8    . G   C 26 ? 0.4796 0.3057 0.2878 -0.0925 -0.0946 0.0519  26 G   C C8    
1403 N N7    . G   C 26 ? 0.3766 0.2029 0.1859 -0.0927 -0.0936 0.0519  26 G   C N7    
1404 C C5    . G   C 26 ? 0.4162 0.2404 0.2242 -0.0921 -0.0924 0.0517  26 G   C C5    
1405 C C6    . G   C 26 ? 0.4464 0.2699 0.2547 -0.0918 -0.0910 0.0516  26 G   C C6    
1406 O O6    . G   C 26 ? 0.4228 0.2473 0.2326 -0.0921 -0.0904 0.0517  26 G   C O6    
1407 N N1    . G   C 26 ? 0.3443 0.1658 0.1509 -0.0912 -0.0902 0.0514  26 G   C N1    
1408 C C2    . G   C 26 ? 0.3845 0.2046 0.1892 -0.0909 -0.0907 0.0514  26 G   C C2    
1409 N N2    . G   C 26 ? 0.4880 0.3063 0.2912 -0.0904 -0.0898 0.0512  26 G   C N2    
1410 N N3    . G   C 26 ? 0.3752 0.1958 0.1796 -0.0912 -0.0920 0.0515  26 G   C N3    
1411 C C4    . G   C 26 ? 0.4436 0.2664 0.2497 -0.0917 -0.0928 0.0516  26 G   C C4    
1412 P P     . U   C 27 ? 0.9912 0.8122 0.7906 -0.0917 -0.0983 0.0511  27 U   C P     
1413 O OP1   . U   C 27 ? 0.8824 0.7051 0.6833 -0.0907 -0.0991 0.0513  27 U   C OP1   
1414 O OP2   . U   C 27 ? 1.0607 0.8818 0.8588 -0.0931 -0.0991 0.0508  27 U   C OP2   
1415 O "O5'" . U   C 27 ? 1.1316 0.9502 0.9294 -0.0909 -0.0972 0.0512  27 U   C "O5'" 
1416 C "C5'" . U   C 27 ? 1.2410 1.0577 1.0371 -0.0916 -0.0965 0.0509  27 U   C "C5'" 
1417 C "C4'" . U   C 27 ? 1.3486 1.1637 1.1443 -0.0908 -0.0950 0.0510  27 U   C "C4'" 
1418 O "O4'" . U   C 27 ? 1.4315 1.2444 1.2246 -0.0910 -0.0949 0.0507  27 U   C "O4'" 
1419 C "C3'" . U   C 27 ? 1.3882 1.2036 1.1848 -0.0894 -0.0944 0.0512  27 U   C "C3'" 
1420 O "O3'" . U   C 27 ? 1.3607 1.1756 1.1579 -0.0889 -0.0929 0.0512  27 U   C "O3'" 
1421 C "C2'" . U   C 27 ? 1.4645 1.2782 1.2590 -0.0890 -0.0947 0.0511  27 U   C "C2'" 
1422 O "O2'" . U   C 27 ? 1.4459 1.2589 1.2403 -0.0879 -0.0938 0.0513  27 U   C "O2'" 
1423 C "C1'" . U   C 27 ? 1.5161 1.3282 1.3086 -0.0899 -0.0944 0.0508  27 U   C "C1'" 
1424 N N1    . U   C 27 ? 1.6440 1.4547 1.4343 -0.0903 -0.0951 0.0506  27 U   C N1    
1425 C C2    . U   C 27 ? 1.7422 1.5509 1.5306 -0.0899 -0.0944 0.0505  27 U   C C2    
1426 O O2    . U   C 27 ? 1.8065 1.6147 1.5952 -0.0892 -0.0932 0.0505  27 U   C O2    
1427 N N3    . U   C 27 ? 1.7377 1.5452 1.5240 -0.0903 -0.0952 0.0503  27 U   C N3    
1428 C C4    . U   C 27 ? 1.7421 1.5505 1.5281 -0.0911 -0.0966 0.0502  27 U   C C4    
1429 O O4    . U   C 27 ? 1.7923 1.5995 1.5763 -0.0914 -0.0971 0.0500  27 U   C O4    
1430 C C5    . U   C 27 ? 1.6955 1.5060 1.4835 -0.0915 -0.0973 0.0503  27 U   C C5    
1431 C C6    . U   C 27 ? 1.6594 1.4710 1.4494 -0.0911 -0.0965 0.0505  27 U   C C6    
1432 P P     . U   C 28 ? 0.7440 0.5596 0.5427 -0.0876 -0.0918 0.0515  28 U   C P     
1433 O OP1   . U   C 28 ? 0.6995 0.5161 0.4991 -0.0871 -0.0927 0.0517  28 U   C OP1   
1434 O OP2   . U   C 28 ? 0.7698 0.5836 0.5671 -0.0871 -0.0906 0.0513  28 U   C OP2   
1435 O "O5'" . U   C 28 ? 0.7515 0.5685 0.5523 -0.0879 -0.0912 0.0515  28 U   C "O5'" 
1436 C "C5'" . U   C 28 ? 0.6383 0.4572 0.4408 -0.0885 -0.0922 0.0517  28 U   C "C5'" 
1437 C "C4'" . U   C 28 ? 0.5084 0.3288 0.3132 -0.0880 -0.0914 0.0519  28 U   C "C4'" 
1438 O "O4'" . U   C 28 ? 0.3938 0.2135 0.1986 -0.0881 -0.0901 0.0517  28 U   C "O4'" 
1439 C "C3'" . U   C 28 ? 0.5333 0.3543 0.3394 -0.0868 -0.0908 0.0521  28 U   C "C3'" 
1440 O "O3'" . U   C 28 ? 0.5882 0.4113 0.3967 -0.0867 -0.0909 0.0524  28 U   C "O3'" 
1441 C "C2'" . U   C 28 ? 0.5041 0.3241 0.3098 -0.0862 -0.0892 0.0520  28 U   C "C2'" 
1442 O "O2'" . U   C 28 ? 0.5109 0.3319 0.3181 -0.0852 -0.0883 0.0522  28 U   C "O2'" 
1443 C "C1'" . U   C 28 ? 0.4904 0.3104 0.2962 -0.0870 -0.0888 0.0518  28 U   C "C1'" 
1444 N N1    . U   C 28 ? 0.5252 0.3437 0.3298 -0.0868 -0.0876 0.0516  28 U   C N1    
1445 C C2    . U   C 28 ? 0.4415 0.2607 0.2474 -0.0866 -0.0865 0.0515  28 U   C C2    
1446 O O2    . U   C 28 ? 0.3525 0.1734 0.1605 -0.0866 -0.0865 0.0517  28 U   C O2    
1447 N N3    . U   C 28 ? 0.5238 0.3416 0.3284 -0.0862 -0.0855 0.0513  28 U   C N3    
1448 C C4    . U   C 28 ? 0.5168 0.3325 0.3189 -0.0861 -0.0854 0.0511  28 U   C C4    
1449 O O4    . U   C 28 ? 0.5977 0.4124 0.3989 -0.0858 -0.0844 0.0509  28 U   C O4    
1450 C C5    . U   C 28 ? 0.4803 0.2955 0.2812 -0.0864 -0.0866 0.0511  28 U   C C5    
1451 C C6    . U   C 28 ? 0.5334 0.3500 0.3356 -0.0867 -0.0876 0.0514  28 U   C C6    
1452 P P     . G   C 29 ? 0.3267 0.3353 0.6532 -0.0016 0.0147  -0.0551 29 G   C P     
1453 O OP1   . G   C 29 ? 0.2909 0.2998 0.6165 -0.0014 0.0130  -0.0555 29 G   C OP1   
1454 O OP2   . G   C 29 ? 0.1137 0.1224 0.4383 -0.0019 0.0160  -0.0552 29 G   C OP2   
1455 O "O5'" . G   C 29 ? 0.2188 0.2270 0.5477 -0.0018 0.0159  -0.0546 29 G   C "O5'" 
1456 C "C5'" . G   C 29 ? 0.1517 0.1598 0.4830 -0.0016 0.0150  -0.0544 29 G   C "C5'" 
1457 C "C4'" . G   C 29 ? 0.1167 0.1244 0.4507 -0.0018 0.0164  -0.0539 29 G   C "C4'" 
1458 O "O4'" . G   C 29 ? 0.2236 0.2313 0.5588 -0.0019 0.0167  -0.0537 29 G   C "O4'" 
1459 C "C3'" . G   C 29 ? 0.1795 0.1869 0.5130 -0.0021 0.0183  -0.0537 29 G   C "C3'" 
1460 O "O3'" . G   C 29 ? 0.1856 0.1929 0.5192 -0.0020 0.0185  -0.0537 29 G   C "O3'" 
1461 C "C2'" . G   C 29 ? 0.3171 0.3242 0.6531 -0.0023 0.0196  -0.0533 29 G   C "C2'" 
1462 O "O2'" . G   C 29 ? 0.4325 0.4394 0.7711 -0.0022 0.0197  -0.0530 29 G   C "O2'" 
1463 C "C1'" . G   C 29 ? 0.2882 0.2955 0.6245 -0.0022 0.0186  -0.0534 29 G   C "C1'" 
1464 N N9    . G   C 29 ? 0.1173 0.1246 0.4522 -0.0023 0.0193  -0.0535 29 G   C N9    
1465 C C8    . G   C 29 ? 0.1164 0.1242 0.4494 -0.0022 0.0182  -0.0539 29 G   C C8    
1466 N N7    . G   C 29 ? 0.1163 0.1239 0.4486 -0.0024 0.0192  -0.0538 29 G   C N7    
1467 C C5    . G   C 29 ? 0.2194 0.2266 0.5532 -0.0027 0.0210  -0.0534 29 G   C C5    
1468 C C6    . G   C 29 ? 0.1930 0.1999 0.5271 -0.0030 0.0226  -0.0532 29 G   C C6    
1469 O O6    . G   C 29 ? 0.2179 0.2248 0.5509 -0.0031 0.0229  -0.0532 29 G   C O6    
1470 N N1    . G   C 29 ? 0.2410 0.2475 0.5770 -0.0032 0.0242  -0.0529 29 G   C N1    
1471 C C2    . G   C 29 ? 0.2630 0.2695 0.6005 -0.0031 0.0241  -0.0528 29 G   C C2    
1472 N N2    . G   C 29 ? 0.3037 0.3097 0.6429 -0.0034 0.0258  -0.0526 29 G   C N2    
1473 N N3    . G   C 29 ? 0.2054 0.2120 0.5427 -0.0028 0.0225  -0.0529 29 G   C N3    
1474 C C4    . G   C 29 ? 0.2299 0.2370 0.5654 -0.0026 0.0210  -0.0532 29 G   C C4    
1475 P P     . C   C 30 ? 0.3715 0.3787 0.7027 -0.0021 0.0194  -0.0539 30 C   C P     
1476 O OP1   . C   C 30 ? 0.3563 0.3633 0.6885 -0.0021 0.0195  -0.0538 30 C   C OP1   
1477 O OP2   . C   C 30 ? 0.3328 0.3405 0.6612 -0.0020 0.0184  -0.0544 30 C   C OP2   
1478 O "O5'" . C   C 30 ? 0.1173 0.1243 0.4488 -0.0025 0.0216  -0.0539 30 C   C "O5'" 
1479 C "C5'" . C   C 30 ? 0.1184 0.1250 0.4526 -0.0027 0.0229  -0.0536 30 C   C "C5'" 
1480 C "C4'" . C   C 30 ? 0.1188 0.1251 0.4528 -0.0030 0.0249  -0.0537 30 C   C "C4'" 
1481 O "O4'" . C   C 30 ? 0.1423 0.1487 0.4766 -0.0031 0.0248  -0.0535 30 C   C "O4'" 
1482 C "C3'" . C   C 30 ? 0.2551 0.2615 0.5864 -0.0032 0.0256  -0.0541 30 C   C "C3'" 
1483 O "O3'" . C   C 30 ? 0.2702 0.2764 0.6014 -0.0033 0.0265  -0.0543 30 C   C "O3'" 
1484 C "C2'" . C   C 30 ? 0.2576 0.2638 0.5890 -0.0035 0.0271  -0.0541 30 C   C "C2'" 
1485 O "O2'" . C   C 30 ? 0.3020 0.3078 0.6353 -0.0038 0.0290  -0.0540 30 C   C "O2'" 
1486 C "C1'" . C   C 30 ? 0.1813 0.1876 0.5140 -0.0034 0.0261  -0.0537 30 C   C "C1'" 
1487 N N1    . C   C 30 ? 0.2346 0.2414 0.5653 -0.0032 0.0249  -0.0539 30 C   C N1    
1488 C C2    . C   C 30 ? 0.2488 0.2555 0.5782 -0.0035 0.0259  -0.0540 30 C   C C2    
1489 O O2    . C   C 30 ? 0.2640 0.2703 0.5940 -0.0038 0.0277  -0.0540 30 C   C O2    
1490 N N3    . C   C 30 ? 0.1162 0.1232 0.4438 -0.0034 0.0248  -0.0541 30 C   C N3    
1491 C C4    . C   C 30 ? 0.1156 0.1230 0.4426 -0.0030 0.0229  -0.0543 30 C   C C4    
1492 N N4    . C   C 30 ? 0.1148 0.1225 0.4400 -0.0029 0.0220  -0.0545 30 C   C N4    
1493 C C5    . C   C 30 ? 0.1260 0.1335 0.4542 -0.0028 0.0219  -0.0542 30 C   C C5    
1494 C C6    . C   C 30 ? 0.2442 0.2513 0.5743 -0.0029 0.0229  -0.0540 30 C   C C6    
1495 P P     . G   C 31 ? 0.6901 0.6964 1.0182 -0.0033 0.0264  -0.0547 31 G   C P     
1496 O OP1   . G   C 31 ? 0.6890 0.6950 1.0179 -0.0033 0.0271  -0.0548 31 G   C OP1   
1497 O OP2   . G   C 31 ? 0.6507 0.6575 0.9770 -0.0029 0.0244  -0.0548 31 G   C OP2   
1498 O "O5'" . G   C 31 ? 0.2555 0.2618 0.5824 -0.0036 0.0281  -0.0550 31 G   C "O5'" 
1499 C "C5'" . G   C 31 ? 0.2084 0.2142 0.5368 -0.0040 0.0302  -0.0551 31 G   C "C5'" 
1500 C "C4'" . G   C 31 ? 0.3173 0.3231 0.6443 -0.0044 0.0315  -0.0554 31 G   C "C4'" 
1501 O "O4'" . G   C 31 ? 0.3678 0.3737 0.6949 -0.0043 0.0307  -0.0550 31 G   C "O4'" 
1502 C "C3'" . G   C 31 ? 0.3075 0.3135 0.6313 -0.0044 0.0314  -0.0558 31 G   C "C3'" 
1503 O "O3'" . G   C 31 ? 0.2901 0.2958 0.6134 -0.0047 0.0329  -0.0563 31 G   C "O3'" 
1504 C "C2'" . G   C 31 ? 0.2949 0.3009 0.6177 -0.0046 0.0320  -0.0558 31 G   C "C2'" 
1505 O "O2'" . G   C 31 ? 0.3253 0.3309 0.6491 -0.0051 0.0342  -0.0560 31 G   C "O2'" 
1506 C "C1'" . G   C 31 ? 0.3105 0.3166 0.6352 -0.0044 0.0308  -0.0553 31 G   C "C1'" 
1507 N N9    . G   C 31 ? 0.2895 0.2961 0.6127 -0.0040 0.0287  -0.0552 31 G   C N9    
1508 C C8    . G   C 31 ? 0.2690 0.2760 0.5925 -0.0036 0.0269  -0.0551 31 G   C C8    
1509 N N7    . G   C 31 ? 0.1150 0.1223 0.4368 -0.0034 0.0253  -0.0552 31 G   C N7    
1510 C C5    . G   C 31 ? 0.1146 0.1220 0.4350 -0.0036 0.0261  -0.0553 31 G   C C5    
1511 C C6    . G   C 31 ? 0.1906 0.1983 0.5089 -0.0035 0.0252  -0.0554 31 G   C C6    
1512 O O6    . G   C 31 ? 0.1235 0.1316 0.4409 -0.0032 0.0234  -0.0556 31 G   C O6    
1513 N N1    . G   C 31 ? 0.2147 0.2223 0.5323 -0.0038 0.0265  -0.0555 31 G   C N1    
1514 C C2    . G   C 31 ? 0.1614 0.1685 0.4799 -0.0042 0.0286  -0.0555 31 G   C C2    
1515 N N2    . G   C 31 ? 0.1901 0.1970 0.5076 -0.0045 0.0297  -0.0555 31 G   C N2    
1516 N N3    . G   C 31 ? 0.1939 0.2006 0.5142 -0.0043 0.0295  -0.0554 31 G   C N3    
1517 C C4    . G   C 31 ? 0.1154 0.1223 0.4366 -0.0040 0.0282  -0.0553 31 G   C C4    
1518 P P     . C   C 32 ? 0.4080 0.4139 0.7285 -0.0045 0.0322  -0.0567 32 C   C P     
1519 O OP1   . C   C 32 ? 0.3341 0.3396 0.6550 -0.0048 0.0338  -0.0571 32 C   C OP1   
1520 O OP2   . C   C 32 ? 0.4322 0.4385 0.7524 -0.0040 0.0299  -0.0563 32 C   C OP2   
1521 O "O5'" . C   C 32 ? 0.3171 0.3232 0.6350 -0.0047 0.0325  -0.0569 32 C   C "O5'" 
1522 C "C5'" . C   C 32 ? 0.2215 0.2273 0.5394 -0.0052 0.0346  -0.0572 32 C   C "C5'" 
1523 C "C4'" . C   C 32 ? 0.2661 0.2722 0.5819 -0.0052 0.0344  -0.0573 32 C   C "C4'" 
1524 O "O4'" . C   C 32 ? 0.3503 0.3567 0.6669 -0.0050 0.0331  -0.0568 32 C   C "O4'" 
1525 C "C3'" . C   C 32 ? 0.3279 0.3345 0.6407 -0.0050 0.0334  -0.0576 32 C   C "C3'" 
1526 O "O3'" . C   C 32 ? 0.3649 0.3712 0.6762 -0.0054 0.0348  -0.0582 32 C   C "O3'" 
1527 C "C2'" . C   C 32 ? 0.3379 0.3448 0.6495 -0.0050 0.0326  -0.0574 32 C   C "C2'" 
1528 O "O2'" . C   C 32 ? 0.3357 0.3423 0.6468 -0.0055 0.0344  -0.0576 32 C   C "O2'" 
1529 C "C1'" . C   C 32 ? 0.3100 0.3169 0.6241 -0.0048 0.0319  -0.0568 32 C   C "C1'" 
1530 N N1    . C   C 32 ? 0.1965 0.2038 0.5104 -0.0043 0.0296  -0.0566 32 C   C N1    
1531 C C2    . C   C 32 ? 0.1902 0.1980 0.5025 -0.0041 0.0282  -0.0566 32 C   C C2    
1532 O O2    . C   C 32 ? 0.1568 0.1645 0.4679 -0.0044 0.0289  -0.0567 32 C   C O2    
1533 N N3    . C   C 32 ? 0.1521 0.1603 0.4642 -0.0037 0.0262  -0.0565 32 C   C N3    
1534 C C4    . C   C 32 ? 0.1439 0.1521 0.4575 -0.0035 0.0256  -0.0563 32 C   C C4    
1535 N N4    . C   C 32 ? 0.2350 0.2435 0.5484 -0.0031 0.0236  -0.0563 32 C   C N4    
1536 C C5    . C   C 32 ? 0.1174 0.1250 0.4326 -0.0037 0.0269  -0.0563 32 C   C C5    
1537 C C6    . C   C 32 ? 0.1770 0.1842 0.4923 -0.0041 0.0289  -0.0564 32 C   C C6    
1538 P P     . A   C 33 ? 0.5339 0.5406 0.8431 -0.0051 0.0339  -0.0585 33 A   C P     
1539 O OP1   . A   C 33 ? 0.5577 0.5640 0.8660 -0.0056 0.0357  -0.0591 33 A   C OP1   
1540 O OP2   . A   C 33 ? 0.4011 0.4079 0.7117 -0.0047 0.0324  -0.0581 33 A   C OP2   
1541 O "O5'" . A   C 33 ? 0.3120 0.3193 0.6186 -0.0049 0.0325  -0.0584 33 A   C "O5'" 
1542 C "C5'" . A   C 33 ? 0.1130 0.1203 0.4181 -0.0052 0.0334  -0.0586 33 A   C "C5'" 
1543 C "C4'" . A   C 33 ? 0.2126 0.2206 0.5159 -0.0050 0.0318  -0.0585 33 A   C "C4'" 
1544 O "O4'" . A   C 33 ? 0.1467 0.1548 0.4516 -0.0047 0.0305  -0.0580 33 A   C "O4'" 
1545 C "C3'" . A   C 33 ? 0.2304 0.2391 0.5317 -0.0046 0.0302  -0.0586 33 A   C "C3'" 
1546 O "O3'" . A   C 33 ? 0.2220 0.2309 0.5211 -0.0049 0.0310  -0.0591 33 A   C "O3'" 
1547 C "C2'" . A   C 33 ? 0.2185 0.2277 0.5191 -0.0044 0.0284  -0.0583 33 A   C "C2'" 
1548 O "O2'" . A   C 33 ? 0.2155 0.2248 0.5144 -0.0046 0.0289  -0.0585 33 A   C "O2'" 
1549 C "C1'" . A   C 33 ? 0.1420 0.1508 0.4453 -0.0043 0.0284  -0.0579 33 A   C "C1'" 
1550 N N9    . A   C 33 ? 0.1522 0.1612 0.4569 -0.0039 0.0269  -0.0577 33 A   C N9    
1551 C C8    . A   C 33 ? 0.1758 0.1844 0.4825 -0.0039 0.0272  -0.0575 33 A   C C8    
1552 N N7    . A   C 33 ? 0.1698 0.1786 0.4773 -0.0035 0.0255  -0.0573 33 A   C N7    
1553 C C5    . A   C 33 ? 0.1185 0.1278 0.4243 -0.0033 0.0240  -0.0574 33 A   C C5    
1554 C C6    . A   C 33 ? 0.1416 0.1513 0.4471 -0.0029 0.0219  -0.0573 33 A   C C6    
1555 N N6    . A   C 33 ? 0.1096 0.1191 0.4166 -0.0026 0.0209  -0.0571 33 A   C N6    
1556 N N1    . A   C 33 ? 0.2218 0.2320 0.5253 -0.0028 0.0209  -0.0575 33 A   C N1    
1557 C C2    . A   C 33 ? 0.1900 0.2002 0.4920 -0.0031 0.0219  -0.0577 33 A   C C2    
1558 N N3    . A   C 33 ? 0.2168 0.2267 0.5189 -0.0035 0.0238  -0.0577 33 A   C N3    
1559 C C4    . A   C 33 ? 0.1456 0.1550 0.4495 -0.0036 0.0248  -0.0576 33 A   C C4    
1560 P P     . G   C 34 ? 0.4476 0.4570 0.7452 -0.0046 0.0299  -0.0593 34 G   C P     
1561 O OP1   . G   C 34 ? 0.4270 0.4363 0.7228 -0.0049 0.0313  -0.0598 34 G   C OP1   
1562 O OP2   . G   C 34 ? 0.4776 0.4866 0.7771 -0.0043 0.0292  -0.0590 34 G   C OP2   
1563 O "O5'" . G   C 34 ? 0.1745 0.1846 0.4704 -0.0043 0.0278  -0.0591 34 G   C "O5'" 
1564 C "C5'" . G   C 34 ? 0.1179 0.1284 0.4120 -0.0045 0.0280  -0.0593 34 G   C "C5'" 
1565 C "C4'" . G   C 34 ? 0.2120 0.2230 0.5049 -0.0042 0.0258  -0.0592 34 G   C "C4'" 
1566 O "O4'" . G   C 34 ? 0.2880 0.2988 0.5828 -0.0040 0.0249  -0.0588 34 G   C "O4'" 
1567 C "C3'" . G   C 34 ? 0.2182 0.2298 0.5098 -0.0039 0.0243  -0.0593 34 G   C "C3'" 
1568 O "O3'" . G   C 34 ? 0.2628 0.2747 0.5520 -0.0042 0.0246  -0.0596 34 G   C "O3'" 
1569 C "C2'" . G   C 34 ? 0.2168 0.2286 0.5083 -0.0036 0.0223  -0.0591 34 G   C "C2'" 
1570 O "O2'" . G   C 34 ? 0.2184 0.2305 0.5079 -0.0037 0.0220  -0.0594 34 G   C "O2'" 
1571 C "C1'" . G   C 34 ? 0.2272 0.2384 0.5212 -0.0036 0.0228  -0.0588 34 G   C "C1'" 
1572 N N9    . G   C 34 ? 0.1852 0.1963 0.4813 -0.0032 0.0220  -0.0585 34 G   C N9    
1573 C C8    . G   C 34 ? 0.1508 0.1614 0.4490 -0.0033 0.0232  -0.0583 34 G   C C8    
1574 N N7    . G   C 34 ? 0.1523 0.1627 0.4520 -0.0030 0.0221  -0.0581 34 G   C N7    
1575 C C5    . G   C 34 ? 0.1445 0.1554 0.4431 -0.0027 0.0202  -0.0582 34 G   C C5    
1576 C C6    . G   C 34 ? 0.1531 0.1640 0.4525 -0.0023 0.0184  -0.0581 34 G   C C6    
1577 O O6    . G   C 34 ? 0.1404 0.1509 0.4419 -0.0021 0.0181  -0.0578 34 G   C O6    
1578 N N1    . G   C 34 ? 0.2626 0.2739 0.5603 -0.0021 0.0168  -0.0583 34 G   C N1    
1579 C C2    . G   C 34 ? 0.1048 0.1166 0.4003 -0.0023 0.0169  -0.0587 34 G   C C2    
1580 N N2    . G   C 34 ? 0.1041 0.1162 0.3981 -0.0020 0.0153  -0.0589 34 G   C N2    
1581 N N3    . G   C 34 ? 0.1048 0.1165 0.3995 -0.0026 0.0185  -0.0587 34 G   C N3    
1582 C C4    . G   C 34 ? 0.1747 0.1859 0.4710 -0.0028 0.0201  -0.0585 34 G   C C4    
1583 P P     . C   C 35 ? 0.3962 0.4086 0.6845 -0.0040 0.0238  -0.0597 35 C   C P     
1584 O OP1   . C   C 35 ? 0.5189 0.5317 0.8048 -0.0044 0.0243  -0.0601 35 C   C OP1   
1585 O OP2   . C   C 35 ? 0.3524 0.3644 0.6429 -0.0039 0.0245  -0.0596 35 C   C OP2   
1586 O "O5'" . C   C 35 ? 0.3953 0.4080 0.6832 -0.0035 0.0214  -0.0596 35 C   C "O5'" 
1587 C "C5'" . C   C 35 ? 0.1021 0.1152 0.3877 -0.0034 0.0203  -0.0599 35 C   C "C5'" 
1588 C "C4'" . C   C 35 ? 0.1924 0.2057 0.4779 -0.0029 0.0181  -0.0598 35 C   C "C4'" 
1589 O "O4'" . C   C 35 ? 0.1656 0.1785 0.4534 -0.0027 0.0178  -0.0595 35 C   C "O4'" 
1590 C "C3'" . C   C 35 ? 0.2247 0.2381 0.5100 -0.0026 0.0170  -0.0598 35 C   C "C3'" 
1591 O "O3'" . C   C 35 ? 0.2227 0.2366 0.5056 -0.0026 0.0166  -0.0601 35 C   C "O3'" 
1592 C "C2'" . C   C 35 ? 0.2621 0.2754 0.5483 -0.0021 0.0152  -0.0597 35 C   C "C2'" 
1593 O "O2'" . C   C 35 ? 0.3358 0.3494 0.6199 -0.0020 0.0139  -0.0601 35 C   C "O2'" 
1594 C "C1'" . C   C 35 ? 0.2376 0.2506 0.5259 -0.0022 0.0160  -0.0595 35 C   C "C1'" 
1595 N N1    . C   C 35 ? 0.2206 0.2331 0.5115 -0.0021 0.0163  -0.0591 35 C   C N1    
1596 C C2    . C   C 35 ? 0.1595 0.1717 0.4515 -0.0017 0.0147  -0.0590 35 C   C C2    
1597 O O2    . C   C 35 ? 0.2615 0.2740 0.5523 -0.0015 0.0132  -0.0593 35 C   C O2    
1598 N N3    . C   C 35 ? 0.1046 0.1163 0.3991 -0.0016 0.0149  -0.0586 35 C   C N3    
1599 C C4    . C   C 35 ? 0.1054 0.1167 0.4011 -0.0019 0.0166  -0.0584 35 C   C C4    
1600 N N4    . C   C 35 ? 0.1064 0.1172 0.4046 -0.0018 0.0168  -0.0581 35 C   C N4    
1601 C C5    . C   C 35 ? 0.1052 0.1167 0.3998 -0.0023 0.0183  -0.0586 35 C   C C5    
1602 C C6    . C   C 35 ? 0.1042 0.1163 0.3964 -0.0024 0.0181  -0.0589 35 C   C C6    
1603 N N     . GLY D 3  ? 0.5879 0.6466 0.6258 -0.0498 -0.0240 0.0008  5  GLY D N     
1604 C CA    . GLY D 3  ? 0.6787 0.7370 0.7164 -0.0495 -0.0246 0.0002  5  GLY D CA    
1605 C C     . GLY D 3  ? 0.7815 0.8393 0.8177 -0.0498 -0.0251 0.0010  5  GLY D C     
1606 O O     . GLY D 3  ? 0.7772 0.8347 0.8132 -0.0493 -0.0256 0.0013  5  GLY D O     
1607 N N     . ASP D 4  ? 0.8143 0.8721 0.8494 -0.0506 -0.0250 0.0014  6  ASP D N     
1608 C CA    . ASP D 4  ? 0.8018 0.8591 0.8353 -0.0509 -0.0255 0.0023  6  ASP D CA    
1609 C C     . ASP D 4  ? 0.7490 0.8059 0.7820 -0.0510 -0.0260 0.0014  6  ASP D C     
1610 O O     . ASP D 4  ? 0.6854 0.7419 0.7170 -0.0517 -0.0262 0.0018  6  ASP D O     
1611 C CB    . ASP D 4  ? 0.8076 0.8650 0.8401 -0.0518 -0.0253 0.0032  6  ASP D CB    
1612 N N     . GLY D 5  ? 0.7497 0.8065 0.7837 -0.0504 -0.0261 0.0003  7  GLY D N     
1613 C CA    . GLY D 5  ? 0.7060 0.7623 0.7396 -0.0504 -0.0264 -0.0005 7  GLY D CA    
1614 C C     . GLY D 5  ? 0.6154 0.6714 0.6494 -0.0495 -0.0270 -0.0008 7  GLY D C     
1615 O O     . GLY D 5  ? 0.5951 0.6510 0.6289 -0.0492 -0.0273 0.0001  7  GLY D O     
1616 N N     . ARG D 6  ? 0.4663 0.5222 0.5009 -0.0493 -0.0272 -0.0021 8  ARG D N     
1617 C CA    . ARG D 6  ? 0.2995 0.3550 0.3345 -0.0485 -0.0277 -0.0025 8  ARG D CA    
1618 C C     . ARG D 6  ? 0.3372 0.3929 0.3733 -0.0477 -0.0277 -0.0024 8  ARG D C     
1619 O O     . ARG D 6  ? 0.2601 0.3162 0.2976 -0.0474 -0.0274 -0.0031 8  ARG D O     
1620 C CB    . ARG D 6  ? 0.1667 0.2221 0.2024 -0.0484 -0.0278 -0.0039 8  ARG D CB    
1621 C CG    . ARG D 6  ? 0.0935 0.1484 0.1291 -0.0478 -0.0284 -0.0044 8  ARG D CG    
1622 C CD    . ARG D 6  ? 0.2217 0.2766 0.2583 -0.0476 -0.0285 -0.0058 8  ARG D CD    
1623 N NE    . ARG D 6  ? 0.3857 0.4399 0.4216 -0.0474 -0.0291 -0.0061 8  ARG D NE    
1624 C CZ    . ARG D 6  ? 0.3892 0.4433 0.4260 -0.0470 -0.0293 -0.0073 8  ARG D CZ    
1625 N NH1   . ARG D 6  ? 0.3506 0.4051 0.3889 -0.0469 -0.0290 -0.0082 8  ARG D NH1   
1626 N NH2   . ARG D 6  ? 0.4144 0.4679 0.4505 -0.0468 -0.0299 -0.0075 8  ARG D NH2   
1627 N N     . ARG D 7  ? 0.4651 0.5205 0.5006 -0.0474 -0.0281 -0.0015 9  ARG D N     
1628 C CA    . ARG D 7  ? 0.3500 0.4055 0.3863 -0.0467 -0.0281 -0.0012 9  ARG D CA    
1629 C C     . ARG D 7  ? 0.3237 0.3790 0.3609 -0.0459 -0.0285 -0.0022 9  ARG D C     
1630 O O     . ARG D 7  ? 0.3587 0.4140 0.3966 -0.0454 -0.0285 -0.0023 9  ARG D O     
1631 C CB    . ARG D 7  ? 0.3391 0.3945 0.3745 -0.0467 -0.0284 0.0002  9  ARG D CB    
1632 C CG    . ARG D 7  ? 0.4571 0.5127 0.4916 -0.0475 -0.0281 0.0014  9  ARG D CG    
1633 C CD    . ARG D 7  ? 0.5556 0.6110 0.5894 -0.0475 -0.0285 0.0029  9  ARG D CD    
1634 N N     . ARG D 8  ? 0.3726 0.4275 0.4096 -0.0459 -0.0288 -0.0031 10 ARG D N     
1635 C CA    . ARG D 8  ? 0.2648 0.3193 0.3024 -0.0451 -0.0293 -0.0039 10 ARG D CA    
1636 C C     . ARG D 8  ? 0.2468 0.3011 0.2846 -0.0452 -0.0295 -0.0050 10 ARG D C     
1637 O O     . ARG D 8  ? 0.3263 0.3805 0.3631 -0.0458 -0.0295 -0.0049 10 ARG D O     
1638 C CB    . ARG D 8  ? 0.0963 0.1504 0.1331 -0.0448 -0.0298 -0.0031 10 ARG D CB    
1639 C CG    . ARG D 8  ? 0.1124 0.1661 0.1492 -0.0444 -0.0304 -0.0037 10 ARG D CG    
1640 C CD    . ARG D 8  ? 0.1987 0.2520 0.2342 -0.0444 -0.0308 -0.0027 10 ARG D CD    
1641 N NE    . ARG D 8  ? 0.1381 0.1915 0.1735 -0.0442 -0.0308 -0.0016 10 ARG D NE    
1642 C CZ    . ARG D 8  ? 0.2564 0.3100 0.2911 -0.0447 -0.0307 -0.0002 10 ARG D CZ    
1643 N NH1   . ARG D 8  ? 0.0765 0.1300 0.1102 -0.0453 -0.0306 0.0003  10 ARG D NH1   
1644 N NH2   . ARG D 8  ? 0.3376 0.3913 0.3724 -0.0445 -0.0306 0.0008  10 ARG D NH2   
1645 N N     . GLY D 9  ? 0.2500 0.3043 0.2890 -0.0446 -0.0297 -0.0062 11 GLY D N     
1646 C CA    . GLY D 9  ? 0.3064 0.3605 0.3458 -0.0447 -0.0298 -0.0073 11 GLY D CA    
1647 C C     . GLY D 9  ? 0.2512 0.3047 0.2910 -0.0440 -0.0304 -0.0081 11 GLY D C     
1648 O O     . GLY D 9  ? 0.1545 0.2078 0.1942 -0.0434 -0.0308 -0.0078 11 GLY D O     
1649 N N     . GLY D 10 ? 0.2492 0.3027 0.2895 -0.0441 -0.0306 -0.0091 12 GLY D N     
1650 C CA    . GLY D 10 ? 0.2305 0.2835 0.2713 -0.0434 -0.0311 -0.0099 12 GLY D CA    
1651 C C     . GLY D 10 ? 0.2793 0.3319 0.3188 -0.0437 -0.0315 -0.0097 12 GLY D C     
1652 O O     . GLY D 10 ? 0.2716 0.3239 0.3097 -0.0438 -0.0316 -0.0087 12 GLY D O     
1653 N N     . GLY D 11 ? 0.3274 0.3798 0.3671 -0.0439 -0.0316 -0.0106 13 GLY D N     
1654 C CA    . GLY D 11 ? 0.1403 0.1922 0.1786 -0.0442 -0.0319 -0.0105 13 GLY D CA    
1655 C C     . GLY D 11 ? 0.1801 0.2322 0.2169 -0.0451 -0.0316 -0.0095 13 GLY D C     
1656 O O     . GLY D 11 ? 0.3129 0.3654 0.3498 -0.0457 -0.0310 -0.0094 13 GLY D O     
1657 N N     . GLY D 12 ? 0.2481 0.2997 0.2834 -0.0451 -0.0320 -0.0086 14 GLY D N     
1658 C CA    . GLY D 12 ? 0.0806 0.1322 0.1144 -0.0459 -0.0318 -0.0076 14 GLY D CA    
1659 C C     . GLY D 12 ? 0.2956 0.3474 0.3291 -0.0458 -0.0317 -0.0063 14 GLY D C     
1660 O O     . GLY D 12 ? 0.1449 0.1965 0.1769 -0.0463 -0.0318 -0.0052 14 GLY D O     
1661 N N     . ARG D 13 ? 0.3337 0.3858 0.3683 -0.0452 -0.0316 -0.0064 15 ARG D N     
1662 C CA    . ARG D 13 ? 0.3075 0.3598 0.3419 -0.0451 -0.0315 -0.0052 15 ARG D CA    
1663 C C     . ARG D 13 ? 0.2965 0.3492 0.3306 -0.0458 -0.0309 -0.0045 15 ARG D C     
1664 O O     . ARG D 13 ? 0.2681 0.3212 0.3028 -0.0461 -0.0305 -0.0052 15 ARG D O     
1665 C CB    . ARG D 13 ? 0.2338 0.2862 0.2694 -0.0443 -0.0315 -0.0055 15 ARG D CB    
1666 C CG    . ARG D 13 ? 0.1424 0.1945 0.1783 -0.0435 -0.0320 -0.0060 15 ARG D CG    
1667 C CD    . ARG D 13 ? 0.1264 0.1786 0.1638 -0.0429 -0.0319 -0.0067 15 ARG D CD    
1668 N NE    . ARG D 13 ? 0.1629 0.2147 0.2006 -0.0421 -0.0324 -0.0070 15 ARG D NE    
1669 C CZ    . ARG D 13 ? 0.2216 0.2733 0.2603 -0.0416 -0.0327 -0.0083 15 ARG D CZ    
1670 N NH1   . ARG D 13 ? 0.2532 0.3050 0.2928 -0.0418 -0.0325 -0.0092 15 ARG D NH1   
1671 N NH2   . ARG D 13 ? 0.2705 0.3219 0.3095 -0.0409 -0.0331 -0.0085 15 ARG D NH2   
1672 N N     . GLY D 14 ? 0.2646 0.3173 0.2978 -0.0461 -0.0309 -0.0032 16 GLY D N     
1673 C CA    . GLY D 14 ? 0.2735 0.3267 0.3064 -0.0466 -0.0304 -0.0023 16 GLY D CA    
1674 C C     . GLY D 14 ? 0.3707 0.4238 0.4027 -0.0475 -0.0302 -0.0024 16 GLY D C     
1675 O O     . GLY D 14 ? 0.4160 0.4696 0.4485 -0.0479 -0.0297 -0.0028 16 GLY D O     
1676 N N     . GLN D 15 ? 0.4384 0.4910 0.4691 -0.0479 -0.0307 -0.0021 17 GLN D N     
1677 C CA    . GLN D 15 ? 0.4495 0.5019 0.4791 -0.0489 -0.0306 -0.0020 17 GLN D CA    
1678 C C     . GLN D 15 ? 0.5318 0.5839 0.5599 -0.0494 -0.0309 -0.0006 17 GLN D C     
1679 O O     . GLN D 15 ? 0.5688 0.6204 0.5955 -0.0501 -0.0312 -0.0004 17 GLN D O     
1680 C CB    . GLN D 15 ? 0.5046 0.5566 0.5338 -0.0490 -0.0308 -0.0031 17 GLN D CB    
1681 C CG    . GLN D 15 ? 0.6119 0.6642 0.6426 -0.0486 -0.0306 -0.0046 17 GLN D CG    
1682 C CD    . GLN D 15 ? 0.7832 0.8362 0.8147 -0.0490 -0.0298 -0.0049 17 GLN D CD    
1683 O OE1   . GLN D 15 ? 0.8149 0.8680 0.8464 -0.0496 -0.0295 -0.0057 17 GLN D OE1   
1684 N NE2   . GLN D 15 ? 0.9324 0.9859 0.9646 -0.0488 -0.0295 -0.0043 17 GLN D NE2   
1685 N N     . GLY D 16 ? 0.6135 0.6658 0.6418 -0.0491 -0.0309 0.0005  18 GLY D N     
1686 C CA    . GLY D 16 ? 0.7333 0.7852 0.7604 -0.0495 -0.0312 0.0020  18 GLY D CA    
1687 C C     . GLY D 16 ? 0.8477 0.8997 0.8739 -0.0505 -0.0310 0.0027  18 GLY D C     
1688 O O     . GLY D 16 ? 0.8748 0.9262 0.8996 -0.0511 -0.0315 0.0034  18 GLY D O     
# 
loop_
_pdbx_poly_seq_scheme.asym_id 
_pdbx_poly_seq_scheme.entity_id 
_pdbx_poly_seq_scheme.seq_id 
_pdbx_poly_seq_scheme.mon_id 
_pdbx_poly_seq_scheme.ndb_seq_num 
_pdbx_poly_seq_scheme.pdb_seq_num 
_pdbx_poly_seq_scheme.auth_seq_num 
_pdbx_poly_seq_scheme.pdb_mon_id 
_pdbx_poly_seq_scheme.auth_mon_id 
_pdbx_poly_seq_scheme.pdb_strand_id 
_pdbx_poly_seq_scheme.pdb_ins_code 
_pdbx_poly_seq_scheme.hetero 
A 1 1  G   1  1  1  G   G   A . n 
A 1 2  C   2  2  2  C   C   A . n 
A 1 3  U   3  3  3  U   U   A . n 
A 1 4  G   4  4  4  G   G   A . n 
A 1 5  C   5  5  5  C   C   A . n 
A 1 6  G   6  6  6  G   G   A . n 
A 1 7  G   7  7  7  G   G   A . n 
A 1 8  U   8  8  8  U   U   A . n 
A 1 9  G   9  9  9  G   G   A . n 
A 1 10 U   10 10 10 U   U   A . n 
A 1 11 G   11 11 11 G   G   A . n 
A 1 12 G   12 12 12 G   G   A . n 
A 1 13 A   13 13 13 A   A   A . n 
A 1 14 A   14 14 14 A   A   A . n 
A 1 15 G   15 15 15 G   G   A . n 
A 1 16 G   16 16 16 G   G   A . n 
A 1 17 A   17 17 17 A   A   A . n 
A 1 18 G   18 18 18 G   G   A . n 
A 1 19 U   19 19 19 U   U   A . n 
A 1 20 G   20 20 20 G   G   A . n 
A 1 21 G   21 21 21 G   G   A . n 
A 1 22 C   22 22 22 C   C   A . n 
A 1 23 U   23 23 23 U   U   A . n 
A 1 24 G   24 24 24 G   G   A . n 
A 1 25 G   25 25 25 G   G   A . n 
A 1 26 G   26 26 26 G   G   A . n 
A 1 27 U   27 27 27 U   U   A . n 
A 1 28 U   28 28 28 U   U   A . n 
A 1 29 G   29 29 29 G   G   A . n 
A 1 30 C   30 30 30 C   C   A . n 
A 1 31 G   31 31 31 G   G   A . n 
A 1 32 C   32 32 32 C   C   A . n 
A 1 33 A   33 33 33 A   A   A . n 
A 1 34 G   34 34 34 G   G   A . n 
A 1 35 C   35 35 35 C   C   A . n 
B 2 1  ALA 1  3  ?  ?   ?   B . n 
B 2 2  ARG 2  4  ?  ?   ?   B . n 
B 2 3  GLY 3  5  5  GLY GLY B . n 
B 2 4  ASP 4  6  6  ASP ASP B . n 
B 2 5  GLY 5  7  7  GLY GLY B . n 
B 2 6  ARG 6  8  8  ARG ARG B . n 
B 2 7  ARG 7  9  9  ARG ARG B . n 
B 2 8  ARG 8  10 10 ARG ARG B . n 
B 2 9  GLY 9  11 11 GLY GLY B . n 
B 2 10 GLY 10 12 12 GLY GLY B . n 
B 2 11 GLY 11 13 13 GLY GLY B . n 
B 2 12 GLY 12 14 14 GLY GLY B . n 
B 2 13 ARG 13 15 15 ARG ARG B . n 
B 2 14 GLY 14 16 16 GLY GLY B . n 
B 2 15 GLN 15 17 17 GLN GLN B . n 
B 2 16 GLY 16 18 18 GLY GLY B . n 
B 2 17 GLY 17 19 ?  ?   ?   B . n 
B 2 18 ARG 18 20 ?  ?   ?   B . n 
C 1 1  G   1  1  1  G   G   C . n 
C 1 2  C   2  2  2  C   C   C . n 
C 1 3  U   3  3  3  U   U   C . n 
C 1 4  G   4  4  4  G   G   C . n 
C 1 5  C   5  5  5  C   C   C . n 
C 1 6  G   6  6  6  G   G   C . n 
C 1 7  G   7  7  7  G   G   C . n 
C 1 8  U   8  8  8  U   U   C . n 
C 1 9  G   9  9  9  G   G   C . n 
C 1 10 U   10 10 10 U   U   C . n 
C 1 11 G   11 11 11 G   G   C . n 
C 1 12 G   12 12 12 G   G   C . n 
C 1 13 A   13 13 13 A   A   C . n 
C 1 14 A   14 14 14 A   A   C . n 
C 1 15 G   15 15 15 G   G   C . n 
C 1 16 G   16 16 16 G   G   C . n 
C 1 17 A   17 17 17 A   A   C . n 
C 1 18 G   18 18 18 G   G   C . n 
C 1 19 U   19 19 19 U   U   C . n 
C 1 20 G   20 20 20 G   G   C . n 
C 1 21 G   21 21 21 G   G   C . n 
C 1 22 C   22 22 22 C   C   C . n 
C 1 23 U   23 23 23 U   U   C . n 
C 1 24 G   24 24 24 G   G   C . n 
C 1 25 G   25 25 25 G   G   C . n 
C 1 26 G   26 26 26 G   G   C . n 
C 1 27 U   27 27 27 U   U   C . n 
C 1 28 U   28 28 28 U   U   C . n 
C 1 29 G   29 29 29 G   G   C . n 
C 1 30 C   30 30 30 C   C   C . n 
C 1 31 G   31 31 31 G   G   C . n 
C 1 32 C   32 32 32 C   C   C . n 
C 1 33 A   33 33 33 A   A   C . n 
C 1 34 G   34 34 34 G   G   C . n 
C 1 35 C   35 35 35 C   C   C . n 
D 2 1  ALA 1  3  ?  ?   ?   D . n 
D 2 2  ARG 2  4  ?  ?   ?   D . n 
D 2 3  GLY 3  5  5  GLY GLY D . n 
D 2 4  ASP 4  6  6  ASP ASP D . n 
D 2 5  GLY 5  7  7  GLY GLY D . n 
D 2 6  ARG 6  8  8  ARG ARG D . n 
D 2 7  ARG 7  9  9  ARG ARG D . n 
D 2 8  ARG 8  10 10 ARG ARG D . n 
D 2 9  GLY 9  11 11 GLY GLY D . n 
D 2 10 GLY 10 12 12 GLY GLY D . n 
D 2 11 GLY 11 13 13 GLY GLY D . n 
D 2 12 GLY 12 14 14 GLY GLY D . n 
D 2 13 ARG 13 15 15 ARG ARG D . n 
D 2 14 GLY 14 16 16 GLY GLY D . n 
D 2 15 GLN 15 17 17 GLN GLN D . n 
D 2 16 GLY 16 18 18 GLY GLY D . n 
D 2 17 GLY 17 19 ?  ?   ?   D . n 
D 2 18 ARG 18 20 ?  ?   ?   D . n 
# 
loop_
_pdbx_nonpoly_scheme.asym_id 
_pdbx_nonpoly_scheme.entity_id 
_pdbx_nonpoly_scheme.mon_id 
_pdbx_nonpoly_scheme.ndb_seq_num 
_pdbx_nonpoly_scheme.pdb_seq_num 
_pdbx_nonpoly_scheme.auth_seq_num 
_pdbx_nonpoly_scheme.pdb_mon_id 
_pdbx_nonpoly_scheme.auth_mon_id 
_pdbx_nonpoly_scheme.pdb_strand_id 
_pdbx_nonpoly_scheme.pdb_ins_code 
E 3 K   1 101 1 K   K   A . 
F 3 K   1 102 2 K   K   A . 
G 4 CS  1 103 2 CS  CS  A . 
H 3 K   1 101 3 K   K   C . 
I 3 K   1 102 4 K   K   C . 
J 4 CS  1 103 1 CS  CS  C . 
K 4 CS  1 104 3 CS  CS  C . 
L 5 HOH 1 201 1 HOH HOH A . 
M 5 HOH 1 201 6 HOH HOH C . 
M 5 HOH 2 202 3 HOH HOH C . 
M 5 HOH 3 203 2 HOH HOH C . 
M 5 HOH 4 204 4 HOH HOH C . 
M 5 HOH 5 205 5 HOH HOH C . 
M 5 HOH 6 206 8 HOH HOH C . 
M 5 HOH 7 207 7 HOH HOH C . 
# 
loop_
_pdbx_struct_assembly.id 
_pdbx_struct_assembly.details 
_pdbx_struct_assembly.method_details 
_pdbx_struct_assembly.oligomeric_details 
_pdbx_struct_assembly.oligomeric_count 
1 author_and_software_defined_assembly PISA dimeric 2 
2 author_and_software_defined_assembly PISA dimeric 2 
# 
loop_
_pdbx_struct_assembly_gen.assembly_id 
_pdbx_struct_assembly_gen.oper_expression 
_pdbx_struct_assembly_gen.asym_id_list 
1 1 A,B,E,F,G,L   
2 1 C,D,H,I,J,K,M 
# 
loop_
_pdbx_struct_assembly_prop.biol_id 
_pdbx_struct_assembly_prop.type 
_pdbx_struct_assembly_prop.value 
_pdbx_struct_assembly_prop.details 
1 'ABSA (A^2)' 2000 ? 
1 MORE         -50  ? 
1 'SSA (A^2)'  6240 ? 
2 'ABSA (A^2)' 2270 ? 
2 MORE         -87  ? 
2 'SSA (A^2)'  6020 ? 
# 
_pdbx_struct_oper_list.id                   1 
_pdbx_struct_oper_list.type                 'identity operation' 
_pdbx_struct_oper_list.name                 1_555 
_pdbx_struct_oper_list.symmetry_operation   x,y,z 
_pdbx_struct_oper_list.matrix[1][1]         1.0000000000 
_pdbx_struct_oper_list.matrix[1][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[1][3]         0.0000000000 
_pdbx_struct_oper_list.vector[1]            0.0000000000 
_pdbx_struct_oper_list.matrix[2][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[2][2]         1.0000000000 
_pdbx_struct_oper_list.matrix[2][3]         0.0000000000 
_pdbx_struct_oper_list.vector[2]            0.0000000000 
_pdbx_struct_oper_list.matrix[3][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][3]         1.0000000000 
_pdbx_struct_oper_list.vector[3]            0.0000000000 
# 
loop_
_pdbx_struct_conn_angle.id 
_pdbx_struct_conn_angle.ptnr1_label_atom_id 
_pdbx_struct_conn_angle.ptnr1_label_alt_id 
_pdbx_struct_conn_angle.ptnr1_label_asym_id 
_pdbx_struct_conn_angle.ptnr1_label_comp_id 
_pdbx_struct_conn_angle.ptnr1_label_seq_id 
_pdbx_struct_conn_angle.ptnr1_auth_atom_id 
_pdbx_struct_conn_angle.ptnr1_auth_asym_id 
_pdbx_struct_conn_angle.ptnr1_auth_comp_id 
_pdbx_struct_conn_angle.ptnr1_auth_seq_id 
_pdbx_struct_conn_angle.ptnr1_PDB_ins_code 
_pdbx_struct_conn_angle.ptnr1_symmetry 
_pdbx_struct_conn_angle.ptnr2_label_atom_id 
_pdbx_struct_conn_angle.ptnr2_label_alt_id 
_pdbx_struct_conn_angle.ptnr2_label_asym_id 
_pdbx_struct_conn_angle.ptnr2_label_comp_id 
_pdbx_struct_conn_angle.ptnr2_label_seq_id 
_pdbx_struct_conn_angle.ptnr2_auth_atom_id 
_pdbx_struct_conn_angle.ptnr2_auth_asym_id 
_pdbx_struct_conn_angle.ptnr2_auth_comp_id 
_pdbx_struct_conn_angle.ptnr2_auth_seq_id 
_pdbx_struct_conn_angle.ptnr2_PDB_ins_code 
_pdbx_struct_conn_angle.ptnr2_symmetry 
_pdbx_struct_conn_angle.ptnr3_label_atom_id 
_pdbx_struct_conn_angle.ptnr3_label_alt_id 
_pdbx_struct_conn_angle.ptnr3_label_asym_id 
_pdbx_struct_conn_angle.ptnr3_label_comp_id 
_pdbx_struct_conn_angle.ptnr3_label_seq_id 
_pdbx_struct_conn_angle.ptnr3_auth_atom_id 
_pdbx_struct_conn_angle.ptnr3_auth_asym_id 
_pdbx_struct_conn_angle.ptnr3_auth_comp_id 
_pdbx_struct_conn_angle.ptnr3_auth_seq_id 
_pdbx_struct_conn_angle.ptnr3_PDB_ins_code 
_pdbx_struct_conn_angle.ptnr3_symmetry 
_pdbx_struct_conn_angle.value 
_pdbx_struct_conn_angle.value_esd 
1   O6 ? A G 6  ? A G 6  ? 1_555 CS ? G CS . ? A CS 103 ? 1_555 O4 ? A U   8  ? A U   8   ? 1_555 78.2  ? 
2   O6 ? A G 6  ? A G 6  ? 1_555 CS ? G CS . ? A CS 103 ? 1_555 O6 ? A G   9  ? A G   9   ? 1_555 59.3  ? 
3   O4 ? A U 8  ? A U 8  ? 1_555 CS ? G CS . ? A CS 103 ? 1_555 O6 ? A G   9  ? A G   9   ? 1_555 67.5  ? 
4   O6 ? A G 6  ? A G 6  ? 1_555 CS ? G CS . ? A CS 103 ? 1_555 N1 ? A A   17 ? A A   17  ? 1_555 81.1  ? 
5   O4 ? A U 8  ? A U 8  ? 1_555 CS ? G CS . ? A CS 103 ? 1_555 N1 ? A A   17 ? A A   17  ? 1_555 75.0  ? 
6   O6 ? A G 9  ? A G 9  ? 1_555 CS ? G CS . ? A CS 103 ? 1_555 N1 ? A A   17 ? A A   17  ? 1_555 129.4 ? 
7   O6 ? A G 6  ? A G 6  ? 1_555 CS ? G CS . ? A CS 103 ? 1_555 O6 ? A G   18 ? A G   18  ? 1_555 63.4  ? 
8   O4 ? A U 8  ? A U 8  ? 1_555 CS ? G CS . ? A CS 103 ? 1_555 O6 ? A G   18 ? A G   18  ? 1_555 140.9 ? 
9   O6 ? A G 9  ? A G 9  ? 1_555 CS ? G CS . ? A CS 103 ? 1_555 O6 ? A G   18 ? A G   18  ? 1_555 96.8  ? 
10  N1 ? A A 17 ? A A 17 ? 1_555 CS ? G CS . ? A CS 103 ? 1_555 O6 ? A G   18 ? A G   18  ? 1_555 91.3  ? 
11  O6 ? A G 6  ? A G 6  ? 1_555 CS ? G CS . ? A CS 103 ? 1_555 O6 ? A G   26 ? A G   26  ? 1_555 91.0  ? 
12  O4 ? A U 8  ? A U 8  ? 1_555 CS ? G CS . ? A CS 103 ? 1_555 O6 ? A G   26 ? A G   26  ? 1_555 125.8 ? 
13  O6 ? A G 9  ? A G 9  ? 1_555 CS ? G CS . ? A CS 103 ? 1_555 O6 ? A G   26 ? A G   26  ? 1_555 61.6  ? 
14  N1 ? A A 17 ? A A 17 ? 1_555 CS ? G CS . ? A CS 103 ? 1_555 O6 ? A G   26 ? A G   26  ? 1_555 155.8 ? 
15  O6 ? A G 18 ? A G 18 ? 1_555 CS ? G CS . ? A CS 103 ? 1_555 O6 ? A G   26 ? A G   26  ? 1_555 64.8  ? 
16  O6 ? A G 6  ? A G 6  ? 1_555 CS ? G CS . ? A CS 103 ? 1_555 O6 ? A G   29 ? A G   29  ? 1_555 126.6 ? 
17  O4 ? A U 8  ? A U 8  ? 1_555 CS ? G CS . ? A CS 103 ? 1_555 O6 ? A G   29 ? A G   29  ? 1_555 71.1  ? 
18  O6 ? A G 9  ? A G 9  ? 1_555 CS ? G CS . ? A CS 103 ? 1_555 O6 ? A G   29 ? A G   29  ? 1_555 68.9  ? 
19  N1 ? A A 17 ? A A 17 ? 1_555 CS ? G CS . ? A CS 103 ? 1_555 O6 ? A G   29 ? A G   29  ? 1_555 128.5 ? 
20  O6 ? A G 18 ? A G 18 ? 1_555 CS ? G CS . ? A CS 103 ? 1_555 O6 ? A G   29 ? A G   29  ? 1_555 138.4 ? 
21  O6 ? A G 26 ? A G 26 ? 1_555 CS ? G CS . ? A CS 103 ? 1_555 O6 ? A G   29 ? A G   29  ? 1_555 74.3  ? 
22  O6 ? A G 6  ? A G 6  ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   9  ? A G   9   ? 1_555 69.8  ? 
23  O6 ? A G 6  ? A G 6  ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   12 ? A G   12  ? 1_555 96.7  ? 
24  O6 ? A G 9  ? A G 9  ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   12 ? A G   12  ? 1_555 71.2  ? 
25  O6 ? A G 6  ? A G 6  ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   16 ? A G   16  ? 1_555 59.8  ? 
26  O6 ? A G 9  ? A G 9  ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   16 ? A G   16  ? 1_555 109.3 ? 
27  O6 ? A G 12 ? A G 12 ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   16 ? A G   16  ? 1_555 69.4  ? 
28  O6 ? A G 6  ? A G 6  ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   18 ? A G   18  ? 1_555 74.7  ? 
29  O6 ? A G 9  ? A G 9  ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   18 ? A G   18  ? 1_555 108.7 ? 
30  O6 ? A G 12 ? A G 12 ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   18 ? A G   18  ? 1_555 170.4 ? 
31  O6 ? A G 16 ? A G 16 ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   18 ? A G   18  ? 1_555 102.2 ? 
32  O6 ? A G 6  ? A G 6  ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   21 ? A G   21  ? 1_555 110.3 ? 
33  O6 ? A G 9  ? A G 9  ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   21 ? A G   21  ? 1_555 173.9 ? 
34  O6 ? A G 12 ? A G 12 ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   21 ? A G   21  ? 1_555 102.8 ? 
35  O6 ? A G 16 ? A G 16 ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   21 ? A G   21  ? 1_555 66.6  ? 
36  O6 ? A G 18 ? A G 18 ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   21 ? A G   21  ? 1_555 76.9  ? 
37  O6 ? A G 6  ? A G 6  ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   25 ? A G   25  ? 1_555 169.6 ? 
38  O6 ? A G 9  ? A G 9  ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   25 ? A G   25  ? 1_555 112.1 ? 
39  O6 ? A G 12 ? A G 12 ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   25 ? A G   25  ? 1_555 74.8  ? 
40  O6 ? A G 16 ? A G 16 ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   25 ? A G   25  ? 1_555 110.7 ? 
41  O6 ? A G 18 ? A G 18 ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   25 ? A G   25  ? 1_555 113.2 ? 
42  O6 ? A G 21 ? A G 21 ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   25 ? A G   25  ? 1_555 66.6  ? 
43  O6 ? A G 6  ? A G 6  ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   26 ? A G   26  ? 1_555 118.2 ? 
44  O6 ? A G 9  ? A G 9  ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   26 ? A G   26  ? 1_555 71.3  ? 
45  O6 ? A G 12 ? A G 12 ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   26 ? A G   26  ? 1_555 113.4 ? 
46  O6 ? A G 16 ? A G 16 ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   26 ? A G   26  ? 1_555 177.0 ? 
47  O6 ? A G 18 ? A G 18 ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   26 ? A G   26  ? 1_555 74.9  ? 
48  O6 ? A G 21 ? A G 21 ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   26 ? A G   26  ? 1_555 113.1 ? 
49  O6 ? A G 25 ? A G 25 ? 1_555 K  ? F K  . ? A K  102 ? 1_555 O6 ? A G   26 ? A G   26  ? 1_555 71.4  ? 
50  O6 ? A G 11 ? A G 11 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   12 ? A G   12  ? 1_555 65.0  ? 
51  O6 ? A G 11 ? A G 11 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   15 ? A G   15  ? 1_555 80.5  ? 
52  O6 ? A G 12 ? A G 12 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   15 ? A G   15  ? 1_555 81.8  ? 
53  O6 ? A G 11 ? A G 11 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   16 ? A G   16  ? 1_555 128.8 ? 
54  O6 ? A G 12 ? A G 12 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   16 ? A G   16  ? 1_555 74.0  ? 
55  O6 ? A G 15 ? A G 15 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   16 ? A G   16  ? 1_555 64.1  ? 
56  O6 ? A G 11 ? A G 11 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   20 ? A G   20  ? 1_555 122.2 ? 
57  O6 ? A G 12 ? A G 12 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   20 ? A G   20  ? 1_555 158.2 ? 
58  O6 ? A G 15 ? A G 15 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   20 ? A G   20  ? 1_555 79.6  ? 
59  O6 ? A G 16 ? A G 16 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   20 ? A G   20  ? 1_555 87.7  ? 
60  O6 ? A G 11 ? A G 11 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   21 ? A G   21  ? 1_555 152.8 ? 
61  O6 ? A G 12 ? A G 12 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   21 ? A G   21  ? 1_555 111.5 ? 
62  O6 ? A G 15 ? A G 15 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   21 ? A G   21  ? 1_555 126.5 ? 
63  O6 ? A G 16 ? A G 16 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   21 ? A G   21  ? 1_555 70.4  ? 
64  O6 ? A G 20 ? A G 20 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   21 ? A G   21  ? 1_555 71.8  ? 
65  O6 ? A G 11 ? A G 11 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   24 ? A G   24  ? 1_555 79.3  ? 
66  O6 ? A G 12 ? A G 12 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   24 ? A G   24  ? 1_555 124.9 ? 
67  O6 ? A G 15 ? A G 15 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   24 ? A G   24  ? 1_555 133.4 ? 
68  O6 ? A G 16 ? A G 16 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   24 ? A G   24  ? 1_555 151.7 ? 
69  O6 ? A G 20 ? A G 20 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   24 ? A G   24  ? 1_555 76.6  ? 
70  O6 ? A G 21 ? A G 21 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   24 ? A G   24  ? 1_555 82.3  ? 
71  O6 ? A G 11 ? A G 11 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   25 ? A G   25  ? 1_555 86.7  ? 
72  O6 ? A G 12 ? A G 12 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   25 ? A G   25  ? 1_555 75.7  ? 
73  O6 ? A G 15 ? A G 15 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   25 ? A G   25  ? 1_555 157.2 ? 
74  O6 ? A G 16 ? A G 16 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   25 ? A G   25  ? 1_555 112.0 ? 
75  O6 ? A G 20 ? A G 20 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   25 ? A G   25  ? 1_555 123.2 ? 
76  O6 ? A G 21 ? A G 21 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   25 ? A G   25  ? 1_555 66.8  ? 
77  O6 ? A G 24 ? A G 24 ? 1_555 K  ? E K  . ? A K  101 ? 1_555 O6 ? A G   25 ? A G   25  ? 1_555 61.0  ? 
78  O6 ? C G 6  ? C G 6  ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   9  ? C G   9   ? 1_555 71.1  ? 
79  O6 ? C G 6  ? C G 6  ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   12 ? C G   12  ? 1_555 97.7  ? 
80  O6 ? C G 9  ? C G 9  ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   12 ? C G   12  ? 1_555 69.4  ? 
81  O6 ? C G 6  ? C G 6  ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   16 ? C G   16  ? 1_555 61.0  ? 
82  O6 ? C G 9  ? C G 9  ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   16 ? C G   16  ? 1_555 112.8 ? 
83  O6 ? C G 12 ? C G 12 ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   16 ? C G   16  ? 1_555 73.5  ? 
84  O6 ? C G 6  ? C G 6  ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   18 ? C G   18  ? 1_555 74.2  ? 
85  O6 ? C G 9  ? C G 9  ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   18 ? C G   18  ? 1_555 106.3 ? 
86  O6 ? C G 12 ? C G 12 ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   18 ? C G   18  ? 1_555 171.8 ? 
87  O6 ? C G 16 ? C G 16 ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   18 ? C G   18  ? 1_555 102.9 ? 
88  O6 ? C G 6  ? C G 6  ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   21 ? C G   21  ? 1_555 109.4 ? 
89  O6 ? C G 9  ? C G 9  ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   21 ? C G   21  ? 1_555 176.5 ? 
90  O6 ? C G 12 ? C G 12 ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   21 ? C G   21  ? 1_555 107.2 ? 
91  O6 ? C G 16 ? C G 16 ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   21 ? C G   21  ? 1_555 65.1  ? 
92  O6 ? C G 18 ? C G 18 ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   21 ? C G   21  ? 1_555 77.1  ? 
93  O6 ? C G 6  ? C G 6  ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   25 ? C G   25  ? 1_555 166.2 ? 
94  O6 ? C G 9  ? C G 9  ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   25 ? C G   25  ? 1_555 107.0 ? 
95  O6 ? C G 12 ? C G 12 ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   25 ? C G   25  ? 1_555 69.3  ? 
96  O6 ? C G 16 ? C G 16 ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   25 ? C G   25  ? 1_555 109.2 ? 
97  O6 ? C G 18 ? C G 18 ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   25 ? C G   25  ? 1_555 118.9 ? 
98  O6 ? C G 21 ? C G 21 ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   25 ? C G   25  ? 1_555 71.7  ? 
99  O6 ? C G 6  ? C G 6  ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   26 ? C G   26  ? 1_555 121.6 ? 
100 O6 ? C G 9  ? C G 9  ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   26 ? C G   26  ? 1_555 71.3  ? 
101 O6 ? C G 12 ? C G 12 ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   26 ? C G   26  ? 1_555 108.6 ? 
102 O6 ? C G 16 ? C G 16 ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   26 ? C G   26  ? 1_555 175.9 ? 
103 O6 ? C G 18 ? C G 18 ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   26 ? C G   26  ? 1_555 75.6  ? 
104 O6 ? C G 21 ? C G 21 ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   26 ? C G   26  ? 1_555 110.8 ? 
105 O6 ? C G 25 ? C G 25 ? 1_555 K  ? H K  . ? C K  101 ? 1_555 O6 ? C G   26 ? C G   26  ? 1_555 68.8  ? 
106 O6 ? C G 6  ? C G 6  ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 O4 ? C U   8  ? C U   8   ? 1_555 79.8  ? 
107 O6 ? C G 6  ? C G 6  ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 O6 ? C G   9  ? C G   9   ? 1_555 60.8  ? 
108 O4 ? C U 8  ? C U 8  ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 O6 ? C G   9  ? C G   9   ? 1_555 71.1  ? 
109 O6 ? C G 6  ? C G 6  ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 N1 ? C A   17 ? C A   17  ? 1_555 84.5  ? 
110 O4 ? C U 8  ? C U 8  ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 N1 ? C A   17 ? C A   17  ? 1_555 79.5  ? 
111 O6 ? C G 9  ? C G 9  ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 N1 ? C A   17 ? C A   17  ? 1_555 137.3 ? 
112 O6 ? C G 6  ? C G 6  ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 O6 ? C G   18 ? C G   18  ? 1_555 62.2  ? 
113 O4 ? C U 8  ? C U 8  ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 O6 ? C G   18 ? C G   18  ? 1_555 140.6 ? 
114 O6 ? C G 9  ? C G 9  ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 O6 ? C G   18 ? C G   18  ? 1_555 96.7  ? 
115 N1 ? C A 17 ? C A 17 ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 O6 ? C G   18 ? C G   18  ? 1_555 86.7  ? 
116 O6 ? C G 6  ? C G 6  ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 O6 ? C G   26 ? C G   26  ? 1_555 87.7  ? 
117 O4 ? C U 8  ? C U 8  ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 O6 ? C G   26 ? C G   26  ? 1_555 129.3 ? 
118 O6 ? C G 9  ? C G 9  ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 O6 ? C G   26 ? C G   26  ? 1_555 60.1  ? 
119 N1 ? C A 17 ? C A 17 ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 O6 ? C G   26 ? C G   26  ? 1_555 148.1 ? 
120 O6 ? C G 18 ? C G 18 ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 O6 ? C G   26 ? C G   26  ? 1_555 62.5  ? 
121 O6 ? C G 6  ? C G 6  ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 O6 ? C G   29 ? C G   29  ? 1_555 128.5 ? 
122 O4 ? C U 8  ? C U 8  ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 O6 ? C G   29 ? C G   29  ? 1_555 76.4  ? 
123 O6 ? C G 9  ? C G 9  ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 O6 ? C G   29 ? C G   29  ? 1_555 68.5  ? 
124 N1 ? C A 17 ? C A 17 ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 O6 ? C G   29 ? C G   29  ? 1_555 133.4 ? 
125 O6 ? C G 18 ? C G 18 ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 O6 ? C G   29 ? C G   29  ? 1_555 135.2 ? 
126 O6 ? C G 26 ? C G 26 ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 O6 ? C G   29 ? C G   29  ? 1_555 74.0  ? 
127 O6 ? C G 6  ? C G 6  ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 O  ? M HOH .  ? C HOH 202 ? 1_555 141.5 ? 
128 O4 ? C U 8  ? C U 8  ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 O  ? M HOH .  ? C HOH 202 ? 1_555 134.9 ? 
129 O6 ? C G 9  ? C G 9  ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 O  ? M HOH .  ? C HOH 202 ? 1_555 135.9 ? 
130 N1 ? C A 17 ? C A 17 ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 O  ? M HOH .  ? C HOH 202 ? 1_555 86.6  ? 
131 O6 ? C G 18 ? C G 18 ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 O  ? M HOH .  ? C HOH 202 ? 1_555 80.0  ? 
132 O6 ? C G 26 ? C G 26 ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 O  ? M HOH .  ? C HOH 202 ? 1_555 80.5  ? 
133 O6 ? C G 29 ? C G 29 ? 1_555 CS ? J CS . ? C CS 103 ? 1_555 O  ? M HOH .  ? C HOH 202 ? 1_555 83.1  ? 
134 O6 ? C G 11 ? C G 11 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   12 ? C G   12  ? 1_555 67.7  ? 
135 O6 ? C G 11 ? C G 11 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   15 ? C G   15  ? 1_555 85.5  ? 
136 O6 ? C G 12 ? C G 12 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   15 ? C G   15  ? 1_555 103.0 ? 
137 O6 ? C G 11 ? C G 11 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   16 ? C G   16  ? 1_555 133.7 ? 
138 O6 ? C G 12 ? C G 12 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   16 ? C G   16  ? 1_555 80.7  ? 
139 O6 ? C G 15 ? C G 15 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   16 ? C G   16  ? 1_555 69.2  ? 
140 O6 ? C G 11 ? C G 11 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   20 ? C G   20  ? 1_555 122.5 ? 
141 O6 ? C G 12 ? C G 12 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   20 ? C G   20  ? 1_555 163.7 ? 
142 O6 ? C G 15 ? C G 15 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   20 ? C G   20  ? 1_555 67.5  ? 
143 O6 ? C G 16 ? C G 16 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   20 ? C G   20  ? 1_555 83.5  ? 
144 O6 ? C G 11 ? C G 11 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   21 ? C G   21  ? 1_555 151.4 ? 
145 O6 ? C G 12 ? C G 12 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   21 ? C G   21  ? 1_555 110.5 ? 
146 O6 ? C G 15 ? C G 15 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   21 ? C G   21  ? 1_555 121.5 ? 
147 O6 ? C G 16 ? C G 16 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   21 ? C G   21  ? 1_555 70.7  ? 
148 O6 ? C G 20 ? C G 20 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   21 ? C G   21  ? 1_555 67.3  ? 
149 O6 ? C G 11 ? C G 11 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   24 ? C G   24  ? 1_555 76.7  ? 
150 O6 ? C G 12 ? C G 12 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   24 ? C G   24  ? 1_555 122.9 ? 
151 O6 ? C G 15 ? C G 15 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   24 ? C G   24  ? 1_555 117.4 ? 
152 O6 ? C G 16 ? C G 16 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   24 ? C G   24  ? 1_555 149.3 ? 
153 O6 ? C G 20 ? C G 20 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   24 ? C G   24  ? 1_555 73.3  ? 
154 O6 ? C G 21 ? C G 21 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   24 ? C G   24  ? 1_555 81.8  ? 
155 O6 ? C G 11 ? C G 11 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   25 ? C G   25  ? 1_555 84.2  ? 
156 O6 ? C G 12 ? C G 12 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   25 ? C G   25  ? 1_555 67.4  ? 
157 O6 ? C G 15 ? C G 15 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   25 ? C G   25  ? 1_555 168.1 ? 
158 O6 ? C G 16 ? C G 16 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   25 ? C G   25  ? 1_555 114.4 ? 
159 O6 ? C G 20 ? C G 20 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   25 ? C G   25  ? 1_555 123.6 ? 
160 O6 ? C G 21 ? C G 21 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   25 ? C G   25  ? 1_555 69.8  ? 
161 O6 ? C G 24 ? C G 24 ? 1_555 K  ? I K  . ? C K  102 ? 1_555 O6 ? C G   25 ? C G   25  ? 1_555 65.8  ? 
# 
loop_
_pdbx_audit_revision_history.ordinal 
_pdbx_audit_revision_history.data_content_type 
_pdbx_audit_revision_history.major_revision 
_pdbx_audit_revision_history.minor_revision 
_pdbx_audit_revision_history.revision_date 
1 'Structure model' 1 0 2015-09-23 
2 'Structure model' 1 1 2015-09-30 
3 'Structure model' 1 2 2015-10-14 
4 'Structure model' 1 3 2017-09-06 
5 'Structure model' 1 4 2019-11-27 
# 
_pdbx_audit_revision_details.ordinal             1 
_pdbx_audit_revision_details.revision_ordinal    1 
_pdbx_audit_revision_details.data_content_type   'Structure model' 
_pdbx_audit_revision_details.provider            repository 
_pdbx_audit_revision_details.type                'Initial release' 
_pdbx_audit_revision_details.description         ? 
_pdbx_audit_revision_details.details             ? 
# 
loop_
_pdbx_audit_revision_group.ordinal 
_pdbx_audit_revision_group.revision_ordinal 
_pdbx_audit_revision_group.data_content_type 
_pdbx_audit_revision_group.group 
1 2 'Structure model' 'Database references'        
2 3 'Structure model' 'Database references'        
3 4 'Structure model' 'Author supporting evidence' 
4 4 'Structure model' 'Database references'        
5 4 'Structure model' 'Derived calculations'       
6 5 'Structure model' 'Author supporting evidence' 
# 
loop_
_pdbx_audit_revision_category.ordinal 
_pdbx_audit_revision_category.revision_ordinal 
_pdbx_audit_revision_category.data_content_type 
_pdbx_audit_revision_category.category 
1 4 'Structure model' citation              
2 4 'Structure model' pdbx_audit_support    
3 4 'Structure model' pdbx_struct_oper_list 
4 5 'Structure model' pdbx_audit_support    
# 
loop_
_pdbx_audit_revision_item.ordinal 
_pdbx_audit_revision_item.revision_ordinal 
_pdbx_audit_revision_item.data_content_type 
_pdbx_audit_revision_item.item 
1 4 'Structure model' '_citation.journal_id_CSD'                  
2 4 'Structure model' '_pdbx_audit_support.funding_organization'  
3 4 'Structure model' '_pdbx_struct_oper_list.symmetry_operation' 
4 5 'Structure model' '_pdbx_audit_support.funding_organization'  
# 
loop_
_pdbx_refine_tls.id 
_pdbx_refine_tls.pdbx_refine_id 
_pdbx_refine_tls.details 
_pdbx_refine_tls.method 
_pdbx_refine_tls.origin_x 
_pdbx_refine_tls.origin_y 
_pdbx_refine_tls.origin_z 
_pdbx_refine_tls.T[1][1] 
_pdbx_refine_tls.T[1][1]_esd 
_pdbx_refine_tls.T[1][2] 
_pdbx_refine_tls.T[1][2]_esd 
_pdbx_refine_tls.T[1][3] 
_pdbx_refine_tls.T[1][3]_esd 
_pdbx_refine_tls.T[2][2] 
_pdbx_refine_tls.T[2][2]_esd 
_pdbx_refine_tls.T[2][3] 
_pdbx_refine_tls.T[2][3]_esd 
_pdbx_refine_tls.T[3][3] 
_pdbx_refine_tls.T[3][3]_esd 
_pdbx_refine_tls.L[1][1] 
_pdbx_refine_tls.L[1][1]_esd 
_pdbx_refine_tls.L[1][2] 
_pdbx_refine_tls.L[1][2]_esd 
_pdbx_refine_tls.L[1][3] 
_pdbx_refine_tls.L[1][3]_esd 
_pdbx_refine_tls.L[2][2] 
_pdbx_refine_tls.L[2][2]_esd 
_pdbx_refine_tls.L[2][3] 
_pdbx_refine_tls.L[2][3]_esd 
_pdbx_refine_tls.L[3][3] 
_pdbx_refine_tls.L[3][3]_esd 
_pdbx_refine_tls.S[1][1] 
_pdbx_refine_tls.S[1][1]_esd 
_pdbx_refine_tls.S[1][2] 
_pdbx_refine_tls.S[1][2]_esd 
_pdbx_refine_tls.S[1][3] 
_pdbx_refine_tls.S[1][3]_esd 
_pdbx_refine_tls.S[2][1] 
_pdbx_refine_tls.S[2][1]_esd 
_pdbx_refine_tls.S[2][2] 
_pdbx_refine_tls.S[2][2]_esd 
_pdbx_refine_tls.S[2][3] 
_pdbx_refine_tls.S[2][3]_esd 
_pdbx_refine_tls.S[3][1] 
_pdbx_refine_tls.S[3][1]_esd 
_pdbx_refine_tls.S[3][2] 
_pdbx_refine_tls.S[3][2]_esd 
_pdbx_refine_tls.S[3][3] 
_pdbx_refine_tls.S[3][3]_esd 
1 'X-RAY DIFFRACTION' ? refined -11.3220 19.2035  -13.1630 0.1426 ? 0.0893  ? 0.0563  ? 0.2185 ? -0.0099 ? 0.1695 ? 0.0104 ? 
-0.0175 ? -0.0256 ? 0.0438 ? 0.0550  ? 0.0715 ? 0.0015  ? 0.0993  ? -0.1135 ? -0.0659 ? -0.0057 ? -0.0543 ? -0.0428 ? -0.1319 ? 
-0.0205 ? 
2 'X-RAY DIFFRACTION' ? refined -17.0341 35.0903  -14.8954 0.1216 ? 0.1338  ? 0.0219  ? 0.3314 ? 0.0394  ? 0.0910 ? 0.0407 ? 
-0.0588 ? -0.0072 ? 0.1083 ? -0.0269 ? 0.0609 ? -0.0071 ? -0.0264 ? -0.0012 ? -0.0197 ? -0.0252 ? 0.0110  ? -0.0473 ? -0.1199 ? 
-0.1790 ? 
3 'X-RAY DIFFRACTION' ? refined -10.0684 24.9012  -7.6315  0.1045 ? 0.0861  ? 0.0318  ? 0.0969 ? 0.0400  ? 0.0821 ? 0.1065 ? 
-0.1095 ? 0.0716  ? 0.1174 ? -0.0791 ? 0.0529 ? -0.0398 ? -0.0476 ? -0.0006 ? 0.0349  ? 0.0089  ? -0.0651 ? -0.0301 ? -0.0335 ? 
-0.2775 ? 
4 'X-RAY DIFFRACTION' ? refined -8.6376  16.8478  -6.7776  0.0452 ? 0.0388  ? -0.0330 ? 0.0790 ? -0.0394 ? 0.1245 ? 0.0621 ? 
0.0093  ? -0.0580 ? 0.0028 ? -0.0088 ? 0.0540 ? 0.0056  ? 0.0257  ? 0.0134  ? 0.0116  ? 0.0166  ? -0.0190 ? -0.0020 ? -0.0105 ? 
0.0524  ? 
5 'X-RAY DIFFRACTION' ? refined -13.7557 -15.9585 4.7171   0.3007 ? -0.1098 ? 0.0593  ? 0.0325 ? -0.0347 ? 0.1041 ? 0.0413 ? 
-0.0110 ? 0.0329  ? 0.2161 ? 0.0522  ? 0.0462 ? 0.0070  ? -0.0740 ? 0.0107  ? 0.2090  ? -0.0788 ? 0.1050  ? 0.2617  ? -0.0913 ? 
-0.3478 ? 
6 'X-RAY DIFFRACTION' ? refined -22.0603 -18.2415 -5.1922  0.3627 ? -0.0957 ? -0.0986 ? 0.1716 ? 0.0556  ? 0.1472 ? 0.0246 ? 
0.0191  ? 0.0215  ? 0.0189 ? 0.0379  ? 0.1182 ? 0.0002  ? 0.0139  ? 0.0019  ? -0.0508 ? -0.0138 ? 0.0175  ? 0.0313  ? -0.0432 ? 
-0.0909 ? 
7 'X-RAY DIFFRACTION' ? refined -12.7098 -2.5660  4.1411   0.0956 ? -0.0119 ? 0.0269  ? 0.1045 ? -0.0648 ? 0.4575 ? 0.1222 ? 
0.0588  ? 0.0030  ? 0.0338 ? -0.0069 ? 0.0155 ? 0.0119  ? -0.0170 ? -0.0119 ? 0.0194  ? 0.0006  ? 0.0932  ? 0.0130  ? -0.0150 ? 
0.0199  ? 
8 'X-RAY DIFFRACTION' ? refined -12.6254 -6.4242  -3.4083  0.0703 ? -0.0620 ? -0.0379 ? 0.1409 ? -0.0026 ? 0.1118 ? 0.0103 ? 
0.0020  ? 0.0063  ? 0.1012 ? -0.0336 ? 0.0160 ? -0.0010 ? 0.0187  ? 0.0034  ? -0.0221 ? 0.0325  ? -0.0170 ? 0.0123  ? 0.0006  ? 
0.0364  ? 
# 
loop_
_pdbx_refine_tls_group.id 
_pdbx_refine_tls_group.pdbx_refine_id 
_pdbx_refine_tls_group.refine_tls_id 
_pdbx_refine_tls_group.beg_label_asym_id 
_pdbx_refine_tls_group.beg_label_seq_id 
_pdbx_refine_tls_group.beg_auth_asym_id 
_pdbx_refine_tls_group.beg_auth_seq_id 
_pdbx_refine_tls_group.end_label_asym_id 
_pdbx_refine_tls_group.end_label_seq_id 
_pdbx_refine_tls_group.end_auth_asym_id 
_pdbx_refine_tls_group.end_auth_seq_id 
_pdbx_refine_tls_group.selection 
_pdbx_refine_tls_group.selection_details 
1 'X-RAY DIFFRACTION' 1 ? ? ? ? ? ? ? ? ? 
;chain 'A' and (resid 1 through 9 )
;
2 'X-RAY DIFFRACTION' 2 ? ? ? ? ? ? ? ? ? 
;chain 'A' and (resid 10 through 16 )
;
3 'X-RAY DIFFRACTION' 3 ? ? ? ? ? ? ? ? ? 
;chain 'A' and (resid 17 through 35 )
;
4 'X-RAY DIFFRACTION' 4 ? ? ? ? ? ? ? ? ? 
;chain 'B' and (resid 5 through 18 )
;
5 'X-RAY DIFFRACTION' 5 ? ? ? ? ? ? ? ? ? 
;chain 'C' and (resid 1 through 21 )
;
6 'X-RAY DIFFRACTION' 6 ? ? ? ? ? ? ? ? ? 
;chain 'C' and (resid 22 through 28 )
;
7 'X-RAY DIFFRACTION' 7 ? ? ? ? ? ? ? ? ? 
;chain 'C' and (resid 29 through 35 )
;
8 'X-RAY DIFFRACTION' 8 ? ? ? ? ? ? ? ? ? 
;chain 'D' and (resid 5 through 18 )
;
# 
loop_
_software.citation_id 
_software.classification 
_software.compiler_name 
_software.compiler_version 
_software.contact_author 
_software.contact_author_email 
_software.date 
_software.description 
_software.dependencies 
_software.hardware 
_software.language 
_software.location 
_software.mods 
_software.name 
_software.os 
_software.os_version 
_software.type 
_software.version 
_software.pdbx_ordinal 
? 'data reduction' ? ? ? ? ? ? ? ? ? ? ? XDS    ? ? ? .        1 
? 'data scaling'   ? ? ? ? ? ? ? ? ? ? ? XSCALE ? ? ? .        2 
? phasing          ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? .        3 
? 'model building' ? ? ? ? ? ? ? ? ? ? ? Coot   ? ? ? .        4 
? refinement       ? ? ? ? ? ? ? ? ? ? ? PHENIX ? ? ? 1.9_1692 5 
# 
loop_
_pdbx_validate_rmsd_angle.id 
_pdbx_validate_rmsd_angle.PDB_model_num 
_pdbx_validate_rmsd_angle.auth_atom_id_1 
_pdbx_validate_rmsd_angle.auth_asym_id_1 
_pdbx_validate_rmsd_angle.auth_comp_id_1 
_pdbx_validate_rmsd_angle.auth_seq_id_1 
_pdbx_validate_rmsd_angle.PDB_ins_code_1 
_pdbx_validate_rmsd_angle.label_alt_id_1 
_pdbx_validate_rmsd_angle.auth_atom_id_2 
_pdbx_validate_rmsd_angle.auth_asym_id_2 
_pdbx_validate_rmsd_angle.auth_comp_id_2 
_pdbx_validate_rmsd_angle.auth_seq_id_2 
_pdbx_validate_rmsd_angle.PDB_ins_code_2 
_pdbx_validate_rmsd_angle.label_alt_id_2 
_pdbx_validate_rmsd_angle.auth_atom_id_3 
_pdbx_validate_rmsd_angle.auth_asym_id_3 
_pdbx_validate_rmsd_angle.auth_comp_id_3 
_pdbx_validate_rmsd_angle.auth_seq_id_3 
_pdbx_validate_rmsd_angle.PDB_ins_code_3 
_pdbx_validate_rmsd_angle.label_alt_id_3 
_pdbx_validate_rmsd_angle.angle_value 
_pdbx_validate_rmsd_angle.angle_target_value 
_pdbx_validate_rmsd_angle.angle_deviation 
_pdbx_validate_rmsd_angle.angle_standard_deviation 
_pdbx_validate_rmsd_angle.linker_flag 
1 1 "C3'" A U 10 ? ? "O3'" A U 10 ? ? P     A G 11 ? ? 127.80 119.70 8.10   1.20 Y 
2 1 "O3'" A U 10 ? ? P     A G 11 ? ? OP1   A G 11 ? ? 117.86 110.50 7.36   1.10 Y 
3 1 "O3'" A U 27 ? ? P     A U 28 ? ? OP2   A U 28 ? ? 118.40 110.50 7.90   1.10 Y 
4 1 N1    C C 22 ? ? "C1'" C C 22 ? ? "C2'" C C 22 ? ? 122.69 114.00 8.69   1.30 N 
5 1 C6    C C 22 ? ? N1    C C 22 ? ? C2    C C 22 ? ? 122.71 120.30 2.41   0.40 N 
6 1 "C3'" C C 22 ? ? "O3'" C C 22 ? ? P     C U 23 ? ? 131.33 119.70 11.63  1.20 Y 
7 1 "O3'" C C 22 ? ? P     C U 23 ? ? "O5'" C U 23 ? ? 90.74  104.00 -13.26 1.90 Y 
# 
loop_
_pdbx_validate_torsion.id 
_pdbx_validate_torsion.PDB_model_num 
_pdbx_validate_torsion.auth_comp_id 
_pdbx_validate_torsion.auth_asym_id 
_pdbx_validate_torsion.auth_seq_id 
_pdbx_validate_torsion.PDB_ins_code 
_pdbx_validate_torsion.label_alt_id 
_pdbx_validate_torsion.phi 
_pdbx_validate_torsion.psi 
1 1 ASP B 6 ? ? -94.96 46.85 
2 1 ASP D 6 ? ? -94.70 39.38 
# 
loop_
_pdbx_unobs_or_zero_occ_atoms.id 
_pdbx_unobs_or_zero_occ_atoms.PDB_model_num 
_pdbx_unobs_or_zero_occ_atoms.polymer_flag 
_pdbx_unobs_or_zero_occ_atoms.occupancy_flag 
_pdbx_unobs_or_zero_occ_atoms.auth_asym_id 
_pdbx_unobs_or_zero_occ_atoms.auth_comp_id 
_pdbx_unobs_or_zero_occ_atoms.auth_seq_id 
_pdbx_unobs_or_zero_occ_atoms.PDB_ins_code 
_pdbx_unobs_or_zero_occ_atoms.auth_atom_id 
_pdbx_unobs_or_zero_occ_atoms.label_alt_id 
_pdbx_unobs_or_zero_occ_atoms.label_asym_id 
_pdbx_unobs_or_zero_occ_atoms.label_comp_id 
_pdbx_unobs_or_zero_occ_atoms.label_seq_id 
_pdbx_unobs_or_zero_occ_atoms.label_atom_id 
1  1 Y 1 B ASP 6 ? CG  ? B ASP 4 CG  
2  1 Y 1 B ASP 6 ? OD1 ? B ASP 4 OD1 
3  1 Y 1 B ASP 6 ? OD2 ? B ASP 4 OD2 
4  1 Y 1 B ARG 9 ? CG  ? B ARG 7 CG  
5  1 Y 1 B ARG 9 ? CD  ? B ARG 7 CD  
6  1 Y 1 B ARG 9 ? NE  ? B ARG 7 NE  
7  1 Y 1 B ARG 9 ? CZ  ? B ARG 7 CZ  
8  1 Y 1 B ARG 9 ? NH1 ? B ARG 7 NH1 
9  1 Y 1 B ARG 9 ? NH2 ? B ARG 7 NH2 
10 1 Y 1 D ASP 6 ? CG  ? D ASP 4 CG  
11 1 Y 1 D ASP 6 ? OD1 ? D ASP 4 OD1 
12 1 Y 1 D ASP 6 ? OD2 ? D ASP 4 OD2 
13 1 Y 1 D ARG 9 ? NE  ? D ARG 7 NE  
14 1 Y 1 D ARG 9 ? CZ  ? D ARG 7 CZ  
15 1 Y 1 D ARG 9 ? NH1 ? D ARG 7 NH1 
16 1 Y 1 D ARG 9 ? NH2 ? D ARG 7 NH2 
# 
loop_
_pdbx_unobs_or_zero_occ_residues.id 
_pdbx_unobs_or_zero_occ_residues.PDB_model_num 
_pdbx_unobs_or_zero_occ_residues.polymer_flag 
_pdbx_unobs_or_zero_occ_residues.occupancy_flag 
_pdbx_unobs_or_zero_occ_residues.auth_asym_id 
_pdbx_unobs_or_zero_occ_residues.auth_comp_id 
_pdbx_unobs_or_zero_occ_residues.auth_seq_id 
_pdbx_unobs_or_zero_occ_residues.PDB_ins_code 
_pdbx_unobs_or_zero_occ_residues.label_asym_id 
_pdbx_unobs_or_zero_occ_residues.label_comp_id 
_pdbx_unobs_or_zero_occ_residues.label_seq_id 
1 1 Y 1 B ALA 3  ? B ALA 1  
2 1 Y 1 B ARG 4  ? B ARG 2  
3 1 Y 1 B GLY 19 ? B GLY 17 
4 1 Y 1 B ARG 20 ? B ARG 18 
5 1 Y 1 D ALA 3  ? D ALA 1  
6 1 Y 1 D ARG 4  ? D ARG 2  
7 1 Y 1 D GLY 19 ? D GLY 17 
8 1 Y 1 D ARG 20 ? D ARG 18 
# 
loop_
_ndb_struct_conf_na.entry_id 
_ndb_struct_conf_na.feature 
5DEA 'bulge loop'      
5DEA 'quadruple helix' 
# 
loop_
_pdbx_audit_support.funding_organization 
_pdbx_audit_support.country 
_pdbx_audit_support.grant_number 
_pdbx_audit_support.ordinal 
'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' 'P41 GM103403'  1 
'National Institutes of Health/National Institute of Mental Health (NIH/NIMH)'             'United States' R21MH103655     2 
'National Institutes of Health/National Institute of General Medical Sciences (NIH/NIGMS)' 'United States' 'TR01 GM104962' 3 
'Whitehead Institute for Biomedical Research'                                              'United States' ?               4 
'Edward Mallinckrodt, Jr. Foundation'                                                      'United States' ?               5 
'New York University'                                                                      'United States' ?               6 
# 
loop_
_pdbx_entity_nonpoly.entity_id 
_pdbx_entity_nonpoly.name 
_pdbx_entity_nonpoly.comp_id 
3 'POTASSIUM ION' K   
4 'CESIUM ION'    CS  
5 water           HOH 
#