data_6BJX
# 
_entry.id   6BJX 
# 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.312 
_audit_conform.dict_location   http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic 
# 
loop_
_database_2.database_id 
_database_2.database_code 
PDB   6BJX         
WWPDB D_1000230985 
# 
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.status_code_sf                  REL 
_pdbx_database_status.status_code_mr                  ? 
_pdbx_database_status.entry_id                        6BJX 
_pdbx_database_status.recvd_initial_deposition_date   2017-11-07 
_pdbx_database_status.SG_entry                        N 
_pdbx_database_status.deposit_site                    RCSB 
_pdbx_database_status.process_site                    RCSB 
_pdbx_database_status.status_code_cs                  ? 
_pdbx_database_status.methods_development_category    ? 
_pdbx_database_status.pdb_format_compatible           Y 
# 
_audit_author.name               'Shoffner, G.M.' 
_audit_author.pdbx_ordinal       1 
_audit_author.identifier_ORCID   ? 
# 
_citation.abstract                  ? 
_citation.abstract_id_CAS           ? 
_citation.book_id_ISBN              ? 
_citation.book_publisher            ? 
_citation.book_publisher_city       ? 
_citation.book_title                ? 
_citation.coordinate_linkage        ? 
_citation.country                   UK 
_citation.database_id_Medline       ? 
_citation.details                   ? 
_citation.id                        primary 
_citation.journal_abbrev            Structure 
_citation.journal_id_ASTM           STRUE6 
_citation.journal_id_CSD            2005 
_citation.journal_id_ISSN           1878-4186 
_citation.journal_full              ? 
_citation.journal_issue             ? 
_citation.journal_volume            26 
_citation.language                  ? 
_citation.page_first                1275 
_citation.page_last                 ? 
_citation.title                     'In Crystallo Selection to Establish New RNA Crystal Contacts.' 
_citation.year                      2018 
_citation.database_id_CSD           ? 
_citation.pdbx_database_id_DOI      10.1016/j.str.2018.05.005 
_citation.pdbx_database_id_PubMed   29910185 
_citation.unpublished_flag          ? 
# 
loop_
_citation_author.citation_id 
_citation_author.name 
_citation_author.ordinal 
_citation_author.identifier_ORCID 
primary 'Shoffner, G.M.' 1 ? 
primary 'Wang, R.'       2 ? 
primary 'Podell, E.'     3 ? 
primary 'Cech, T.R.'     4 ? 
primary 'Guo, F.'        5 ? 
# 
_cell.angle_alpha                  90.000 
_cell.angle_alpha_esd              ? 
_cell.angle_beta                   90.000 
_cell.angle_beta_esd               ? 
_cell.angle_gamma                  90.000 
_cell.angle_gamma_esd              ? 
_cell.entry_id                     6BJX 
_cell.details                      ? 
_cell.formula_units_Z              ? 
_cell.length_a                     74.670 
_cell.length_a_esd                 ? 
_cell.length_b                     130.010 
_cell.length_b_esd                 ? 
_cell.length_c                     146.410 
_cell.length_c_esd                 ? 
_cell.volume                       1421325.835 
_cell.volume_esd                   ? 
_cell.Z_PDB                        8 
_cell.reciprocal_angle_alpha       ? 
_cell.reciprocal_angle_beta        ? 
_cell.reciprocal_angle_gamma       ? 
_cell.reciprocal_angle_alpha_esd   ? 
_cell.reciprocal_angle_beta_esd    ? 
_cell.reciprocal_angle_gamma_esd   ? 
_cell.reciprocal_length_a          ? 
_cell.reciprocal_length_b          ? 
_cell.reciprocal_length_c          ? 
_cell.reciprocal_length_a_esd      ? 
_cell.reciprocal_length_b_esd      ? 
_cell.reciprocal_length_c_esd      ? 
_cell.pdbx_unique_axis             ? 
# 
_symmetry.entry_id                         6BJX 
_symmetry.cell_setting                     ? 
_symmetry.Int_Tables_number                19 
_symmetry.space_group_name_Hall            'P 2ac 2ab' 
_symmetry.space_group_name_H-M             'P 21 21 21' 
_symmetry.pdbx_full_space_group_name_H-M   ? 
# 
loop_
_entity.id 
_entity.type 
_entity.src_method 
_entity.pdbx_description 
_entity.formula_weight 
_entity.pdbx_number_of_molecules 
_entity.pdbx_ec 
_entity.pdbx_mutation 
_entity.pdbx_fragment 
_entity.details 
1 polymer     syn 'Group I self-splicing intron P4-P6 domain' 51074.363 2  ? ? ? ? 
2 non-polymer syn 'MAGNESIUM ION'                             24.305    20 ? ? ? ? 
# 
_entity_poly.entity_id                      1 
_entity_poly.type                           polyribonucleotide 
_entity_poly.nstd_linkage                   no 
_entity_poly.nstd_monomer                   no 
_entity_poly.pdbx_seq_one_letter_code       
;GAAUUGCGGGAAAGGGGUCAACAGCCGUACAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGU
AAUAAGCUGACGGACAUGGUCCUAACCACGCAGCCAAGUCCUAAGUCAACAGAUCUUCUGUUGAUAUGGAUGCAGUUC
;
_entity_poly.pdbx_seq_one_letter_code_can   
;GAAUUGCGGGAAAGGGGUCAACAGCCGUACAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGU
AAUAAGCUGACGGACAUGGUCCUAACCACGCAGCCAAGUCCUAAGUCAACAGAUCUUCUGUUGAUAUGGAUGCAGUUC
;
_entity_poly.pdbx_strand_id                 A,B 
_entity_poly.pdbx_target_identifier         ? 
# 
loop_
_entity_poly_seq.entity_id 
_entity_poly_seq.num 
_entity_poly_seq.mon_id 
_entity_poly_seq.hetero 
1 1   G n 
1 2   A n 
1 3   A n 
1 4   U n 
1 5   U n 
1 6   G n 
1 7   C n 
1 8   G n 
1 9   G n 
1 10  G n 
1 11  A n 
1 12  A n 
1 13  A n 
1 14  G n 
1 15  G n 
1 16  G n 
1 17  G n 
1 18  U n 
1 19  C n 
1 20  A n 
1 21  A n 
1 22  C n 
1 23  A n 
1 24  G n 
1 25  C n 
1 26  C n 
1 27  G n 
1 28  U n 
1 29  A n 
1 30  C n 
1 31  A n 
1 32  G n 
1 33  U n 
1 34  A n 
1 35  C n 
1 36  C n 
1 37  A n 
1 38  A n 
1 39  G n 
1 40  U n 
1 41  C n 
1 42  U n 
1 43  C n 
1 44  A n 
1 45  G n 
1 46  G n 
1 47  G n 
1 48  G n 
1 49  A n 
1 50  A n 
1 51  A n 
1 52  C n 
1 53  U n 
1 54  U n 
1 55  U n 
1 56  G n 
1 57  A n 
1 58  G n 
1 59  A n 
1 60  U n 
1 61  G n 
1 62  G n 
1 63  C n 
1 64  C n 
1 65  U n 
1 66  U n 
1 67  G n 
1 68  C n 
1 69  A n 
1 70  A n 
1 71  A n 
1 72  G n 
1 73  G n 
1 74  G n 
1 75  U n 
1 76  A n 
1 77  U n 
1 78  G n 
1 79  G n 
1 80  U n 
1 81  A n 
1 82  A n 
1 83  U n 
1 84  A n 
1 85  A n 
1 86  G n 
1 87  C n 
1 88  U n 
1 89  G n 
1 90  A n 
1 91  C n 
1 92  G n 
1 93  G n 
1 94  A n 
1 95  C n 
1 96  A n 
1 97  U n 
1 98  G n 
1 99  G n 
1 100 U n 
1 101 C n 
1 102 C n 
1 103 U n 
1 104 A n 
1 105 A n 
1 106 C n 
1 107 C n 
1 108 A n 
1 109 C n 
1 110 G n 
1 111 C n 
1 112 A n 
1 113 G n 
1 114 C n 
1 115 C n 
1 116 A n 
1 117 A n 
1 118 G n 
1 119 U n 
1 120 C n 
1 121 C n 
1 122 U n 
1 123 A n 
1 124 A n 
1 125 G n 
1 126 U n 
1 127 C n 
1 128 A n 
1 129 A n 
1 130 C n 
1 131 A n 
1 132 G n 
1 133 A n 
1 134 U n 
1 135 C n 
1 136 U n 
1 137 U n 
1 138 C n 
1 139 U n 
1 140 G n 
1 141 U n 
1 142 U n 
1 143 G n 
1 144 A n 
1 145 U n 
1 146 A n 
1 147 U n 
1 148 G n 
1 149 G n 
1 150 A n 
1 151 U n 
1 152 G n 
1 153 C n 
1 154 A n 
1 155 G n 
1 156 U n 
1 157 U n 
1 158 C n 
# 
_pdbx_entity_src_syn.entity_id              1 
_pdbx_entity_src_syn.pdbx_src_id            1 
_pdbx_entity_src_syn.pdbx_alt_source_flag   sample 
_pdbx_entity_src_syn.pdbx_beg_seq_num       1 
_pdbx_entity_src_syn.pdbx_end_seq_num       158 
_pdbx_entity_src_syn.organism_scientific    'Tetrahymena thermophila' 
_pdbx_entity_src_syn.organism_common_name   ? 
_pdbx_entity_src_syn.ncbi_taxonomy_id       5911 
_pdbx_entity_src_syn.details                ? 
# 
_struct_ref.id                         1 
_struct_ref.db_name                    GB 
_struct_ref.db_code                    JN547815.1 
_struct_ref.pdbx_db_accession          345541658 
_struct_ref.pdbx_db_isoform            ? 
_struct_ref.entity_id                  1 
_struct_ref.pdbx_seq_one_letter_code   
;AAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGU
AAUAAGCUGACGGACAUGGUCCUAACCACGCAGCCAAGUCCUAAGUCAACAGAUCUUCUGUUGAUAUGGAUGCAGUUC
;
_struct_ref.pdbx_align_begin           2959 
# 
loop_
_struct_ref_seq.align_id 
_struct_ref_seq.ref_id 
_struct_ref_seq.pdbx_PDB_id_code 
_struct_ref_seq.pdbx_strand_id 
_struct_ref_seq.seq_align_beg 
_struct_ref_seq.pdbx_seq_align_beg_ins_code 
_struct_ref_seq.seq_align_end 
_struct_ref_seq.pdbx_seq_align_end_ins_code 
_struct_ref_seq.pdbx_db_accession 
_struct_ref_seq.db_align_beg 
_struct_ref_seq.pdbx_db_align_beg_ins_code 
_struct_ref_seq.db_align_end 
_struct_ref_seq.pdbx_db_align_end_ins_code 
_struct_ref_seq.pdbx_auth_seq_align_beg 
_struct_ref_seq.pdbx_auth_seq_align_end 
1 1 6BJX A 1 ? 158 ? 345541658 2959 ? 3116 ? 103 260 
2 1 6BJX B 1 ? 158 ? 345541658 2959 ? 3116 ? 103 260 
# 
loop_
_struct_ref_seq_dif.align_id 
_struct_ref_seq_dif.pdbx_pdb_id_code 
_struct_ref_seq_dif.mon_id 
_struct_ref_seq_dif.pdbx_pdb_strand_id 
_struct_ref_seq_dif.seq_num 
_struct_ref_seq_dif.pdbx_pdb_ins_code 
_struct_ref_seq_dif.pdbx_seq_db_name 
_struct_ref_seq_dif.pdbx_seq_db_accession_code 
_struct_ref_seq_dif.db_mon_id 
_struct_ref_seq_dif.pdbx_seq_db_seq_num 
_struct_ref_seq_dif.details 
_struct_ref_seq_dif.pdbx_auth_seq_num 
_struct_ref_seq_dif.pdbx_ordinal 
1 6BJX G A 1  ? GB 345541658 A 2959 conflict              103 1 
1 6BJX A A 29 ? GB 345541658 U 2987 'engineered mutation' 131 2 
2 6BJX G B 1  ? GB 345541658 A 2959 conflict              103 3 
2 6BJX A B 29 ? GB 345541658 U 2987 'engineered mutation' 131 4 
# 
loop_
_chem_comp.id 
_chem_comp.type 
_chem_comp.mon_nstd_flag 
_chem_comp.name 
_chem_comp.pdbx_synonyms 
_chem_comp.formula 
_chem_comp.formula_weight 
A  'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O7 P' 347.221 
C  'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE"  ? 'C9 H14 N3 O8 P'  323.197 
G  'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE" ? 'C10 H14 N5 O8 P' 363.221 
MG non-polymer   . 'MAGNESIUM ION'              ? 'Mg 2'            24.305  
U  'RNA linking' y "URIDINE-5'-MONOPHOSPHATE"   ? 'C9 H13 N2 O9 P'  324.181 
# 
_exptl.absorpt_coefficient_mu     ? 
_exptl.absorpt_correction_T_max   ? 
_exptl.absorpt_correction_T_min   ? 
_exptl.absorpt_correction_type    ? 
_exptl.absorpt_process_details    ? 
_exptl.entry_id                   6BJX 
_exptl.crystals_number            1 
_exptl.details                    ? 
_exptl.method                     'X-RAY DIFFRACTION' 
_exptl.method_details             ? 
# 
_exptl_crystal.colour                      ? 
_exptl_crystal.density_diffrn              ? 
_exptl_crystal.density_Matthews            3.48 
_exptl_crystal.density_method              ? 
_exptl_crystal.density_percent_sol         64.64 
_exptl_crystal.description                 ? 
_exptl_crystal.F_000                       ? 
_exptl_crystal.id                          1 
_exptl_crystal.preparation                 ? 
_exptl_crystal.size_max                    ? 
_exptl_crystal.size_mid                    ? 
_exptl_crystal.size_min                    ? 
_exptl_crystal.size_rad                    ? 
_exptl_crystal.colour_lustre               ? 
_exptl_crystal.colour_modifier             ? 
_exptl_crystal.colour_primary              ? 
_exptl_crystal.density_meas                ? 
_exptl_crystal.density_meas_esd            ? 
_exptl_crystal.density_meas_gt             ? 
_exptl_crystal.density_meas_lt             ? 
_exptl_crystal.density_meas_temp           ? 
_exptl_crystal.density_meas_temp_esd       ? 
_exptl_crystal.density_meas_temp_gt        ? 
_exptl_crystal.density_meas_temp_lt        ? 
_exptl_crystal.pdbx_crystal_image_url      ? 
_exptl_crystal.pdbx_crystal_image_format   ? 
_exptl_crystal.pdbx_mosaicity              ? 
_exptl_crystal.pdbx_mosaicity_esd          ? 
# 
_exptl_crystal_grow.apparatus       ? 
_exptl_crystal_grow.atmosphere      ? 
_exptl_crystal_grow.crystal_id      1 
_exptl_crystal_grow.details         ? 
_exptl_crystal_grow.method          'VAPOR DIFFUSION, HANGING DROP' 
_exptl_crystal_grow.method_ref      ? 
_exptl_crystal_grow.pH              ? 
_exptl_crystal_grow.pressure        ? 
_exptl_crystal_grow.pressure_esd    ? 
_exptl_crystal_grow.seeding         ? 
_exptl_crystal_grow.seeding_ref     ? 
_exptl_crystal_grow.temp            298 
_exptl_crystal_grow.temp_details    ? 
_exptl_crystal_grow.temp_esd        ? 
_exptl_crystal_grow.time            ? 
_exptl_crystal_grow.pdbx_details    'PEG 1000, sodium cacodylate, spermine' 
_exptl_crystal_grow.pdbx_pH_range   ? 
# 
_diffrn.ambient_environment    ? 
_diffrn.ambient_temp           100 
_diffrn.ambient_temp_details   ? 
_diffrn.ambient_temp_esd       ? 
_diffrn.crystal_id             1 
_diffrn.crystal_support        ? 
_diffrn.crystal_treatment      ? 
_diffrn.details                ? 
_diffrn.id                     1 
_diffrn.ambient_pressure       ? 
_diffrn.ambient_pressure_esd   ? 
_diffrn.ambient_pressure_gt    ? 
_diffrn.ambient_pressure_lt    ? 
_diffrn.ambient_temp_gt        ? 
_diffrn.ambient_temp_lt        ? 
# 
_diffrn_detector.details                      ? 
_diffrn_detector.detector                     PIXEL 
_diffrn_detector.diffrn_id                    1 
_diffrn_detector.type                         'DECTRIS PILATUS 6M-F' 
_diffrn_detector.area_resol_mean              ? 
_diffrn_detector.dtime                        ? 
_diffrn_detector.pdbx_frames_total            ? 
_diffrn_detector.pdbx_collection_time_total   ? 
_diffrn_detector.pdbx_collection_date         2016-12-08 
# 
_diffrn_radiation.collimation                      ? 
_diffrn_radiation.diffrn_id                        1 
_diffrn_radiation.filter_edge                      ? 
_diffrn_radiation.inhomogeneity                    ? 
_diffrn_radiation.monochromator                    ? 
_diffrn_radiation.polarisn_norm                    ? 
_diffrn_radiation.polarisn_ratio                   ? 
_diffrn_radiation.probe                            ? 
_diffrn_radiation.type                             ? 
_diffrn_radiation.xray_symbol                      ? 
_diffrn_radiation.wavelength_id                    1 
_diffrn_radiation.pdbx_monochromatic_or_laue_m_l   M 
_diffrn_radiation.pdbx_wavelength_list             ? 
_diffrn_radiation.pdbx_wavelength                  ? 
_diffrn_radiation.pdbx_diffrn_protocol             'SINGLE WAVELENGTH' 
_diffrn_radiation.pdbx_analyzer                    ? 
_diffrn_radiation.pdbx_scattering_type             x-ray 
# 
_diffrn_radiation_wavelength.id           1 
_diffrn_radiation_wavelength.wavelength   0.979100 
_diffrn_radiation_wavelength.wt           1.0 
# 
_diffrn_source.current                     ? 
_diffrn_source.details                     ? 
_diffrn_source.diffrn_id                   1 
_diffrn_source.power                       ? 
_diffrn_source.size                        ? 
_diffrn_source.source                      SYNCHROTRON 
_diffrn_source.target                      ? 
_diffrn_source.type                        'APS BEAMLINE 24-ID-C' 
_diffrn_source.voltage                     ? 
_diffrn_source.take-off_angle              ? 
_diffrn_source.pdbx_wavelength_list        0.979100 
_diffrn_source.pdbx_wavelength             ? 
_diffrn_source.pdbx_synchrotron_beamline   24-ID-C 
_diffrn_source.pdbx_synchrotron_site       APS 
# 
_reflns.B_iso_Wilson_estimate            113.088043928 
_reflns.entry_id                         6BJX 
_reflns.data_reduction_details           ? 
_reflns.data_reduction_method            ? 
_reflns.d_resolution_high                3.14 
_reflns.d_resolution_low                 63.8 
_reflns.details                          ? 
_reflns.limit_h_max                      ? 
_reflns.limit_h_min                      ? 
_reflns.limit_k_max                      ? 
_reflns.limit_k_min                      ? 
_reflns.limit_l_max                      ? 
_reflns.limit_l_min                      ? 
_reflns.number_all                       ? 
_reflns.number_obs                       25244 
_reflns.observed_criterion               ? 
_reflns.observed_criterion_F_max         ? 
_reflns.observed_criterion_F_min         ? 
_reflns.observed_criterion_I_max         ? 
_reflns.observed_criterion_I_min         ? 
_reflns.observed_criterion_sigma_F       ? 
_reflns.observed_criterion_sigma_I       ? 
_reflns.percent_possible_obs             98.9 
_reflns.R_free_details                   ? 
_reflns.Rmerge_F_all                     ? 
_reflns.Rmerge_F_obs                     ? 
_reflns.Friedel_coverage                 ? 
_reflns.number_gt                        ? 
_reflns.threshold_expression             ? 
_reflns.pdbx_redundancy                  12.9 
_reflns.pdbx_Rmerge_I_obs                ? 
_reflns.pdbx_Rmerge_I_all                ? 
_reflns.pdbx_Rsym_value                  ? 
_reflns.pdbx_netI_over_av_sigmaI         ? 
_reflns.pdbx_netI_over_sigmaI            16.3 
_reflns.pdbx_res_netI_over_av_sigmaI_2   ? 
_reflns.pdbx_res_netI_over_sigmaI_2      ? 
_reflns.pdbx_chi_squared                 ? 
_reflns.pdbx_scaling_rejects             ? 
_reflns.pdbx_d_res_high_opt              ? 
_reflns.pdbx_d_res_low_opt               ? 
_reflns.pdbx_d_res_opt_method            ? 
_reflns.phase_calculation_details        ? 
_reflns.pdbx_Rrim_I_all                  ? 
_reflns.pdbx_Rpim_I_all                  ? 
_reflns.pdbx_d_opt                       ? 
_reflns.pdbx_number_measured_all         ? 
_reflns.pdbx_diffrn_id                   1 
_reflns.pdbx_ordinal                     1 
_reflns.pdbx_CC_half                     ? 
_reflns.pdbx_R_split                     ? 
# 
_reflns_shell.d_res_high                  . 
_reflns_shell.d_res_low                   ? 
_reflns_shell.meanI_over_sigI_all         ? 
_reflns_shell.meanI_over_sigI_obs         ? 
_reflns_shell.number_measured_all         ? 
_reflns_shell.number_measured_obs         ? 
_reflns_shell.number_possible             ? 
_reflns_shell.number_unique_all           ? 
_reflns_shell.number_unique_obs           ? 
_reflns_shell.percent_possible_all        ? 
_reflns_shell.percent_possible_obs        ? 
_reflns_shell.Rmerge_F_all                ? 
_reflns_shell.Rmerge_F_obs                ? 
_reflns_shell.Rmerge_I_all                ? 
_reflns_shell.Rmerge_I_obs                ? 
_reflns_shell.meanI_over_sigI_gt          ? 
_reflns_shell.meanI_over_uI_all           ? 
_reflns_shell.meanI_over_uI_gt            ? 
_reflns_shell.number_measured_gt          ? 
_reflns_shell.number_unique_gt            ? 
_reflns_shell.percent_possible_gt         ? 
_reflns_shell.Rmerge_F_gt                 ? 
_reflns_shell.Rmerge_I_gt                 ? 
_reflns_shell.pdbx_redundancy             ? 
_reflns_shell.pdbx_Rsym_value             ? 
_reflns_shell.pdbx_chi_squared            ? 
_reflns_shell.pdbx_netI_over_sigmaI_all   ? 
_reflns_shell.pdbx_netI_over_sigmaI_obs   ? 
_reflns_shell.pdbx_Rrim_I_all             ? 
_reflns_shell.pdbx_Rpim_I_all             ? 
_reflns_shell.pdbx_rejects                ? 
_reflns_shell.pdbx_ordinal                1 
_reflns_shell.pdbx_diffrn_id              1 
_reflns_shell.pdbx_CC_half                ? 
_reflns_shell.pdbx_R_split                ? 
# 
_refine.aniso_B[1][1]                            ? 
_refine.aniso_B[1][2]                            ? 
_refine.aniso_B[1][3]                            ? 
_refine.aniso_B[2][2]                            ? 
_refine.aniso_B[2][3]                            ? 
_refine.aniso_B[3][3]                            ? 
_refine.B_iso_max                                ? 
_refine.B_iso_mean                               128.619241904 
_refine.B_iso_min                                ? 
_refine.correlation_coeff_Fo_to_Fc               ? 
_refine.correlation_coeff_Fo_to_Fc_free          ? 
_refine.details                                  ? 
_refine.diff_density_max                         ? 
_refine.diff_density_max_esd                     ? 
_refine.diff_density_min                         ? 
_refine.diff_density_min_esd                     ? 
_refine.diff_density_rms                         ? 
_refine.diff_density_rms_esd                     ? 
_refine.entry_id                                 6BJX 
_refine.pdbx_refine_id                           'X-RAY DIFFRACTION' 
_refine.ls_abs_structure_details                 ? 
_refine.ls_abs_structure_Flack                   ? 
_refine.ls_abs_structure_Flack_esd               ? 
_refine.ls_abs_structure_Rogers                  ? 
_refine.ls_abs_structure_Rogers_esd              ? 
_refine.ls_d_res_high                            3.14 
_refine.ls_d_res_low                             63.8 
_refine.ls_extinction_coef                       ? 
_refine.ls_extinction_coef_esd                   ? 
_refine.ls_extinction_expression                 ? 
_refine.ls_extinction_method                     ? 
_refine.ls_goodness_of_fit_all                   ? 
_refine.ls_goodness_of_fit_all_esd               ? 
_refine.ls_goodness_of_fit_obs                   ? 
_refine.ls_goodness_of_fit_obs_esd               ? 
_refine.ls_hydrogen_treatment                    ? 
_refine.ls_matrix_type                           ? 
_refine.ls_number_constraints                    ? 
_refine.ls_number_parameters                     ? 
_refine.ls_number_reflns_all                     ? 
_refine.ls_number_reflns_obs                     25212 
_refine.ls_number_reflns_R_free                  2520 
_refine.ls_number_reflns_R_work                  ? 
_refine.ls_number_restraints                     ? 
_refine.ls_percent_reflns_obs                    98.7466708444 
_refine.ls_percent_reflns_R_free                 9.99524036173 
_refine.ls_R_factor_all                          ? 
_refine.ls_R_factor_obs                          0.213003674255 
_refine.ls_R_factor_R_free                       0.22924417573 
_refine.ls_R_factor_R_free_error                 ? 
_refine.ls_R_factor_R_free_error_details         ? 
_refine.ls_R_factor_R_work                       0.211184378342 
_refine.ls_R_Fsqd_factor_obs                     ? 
_refine.ls_R_I_factor_obs                        ? 
_refine.ls_redundancy_reflns_all                 ? 
_refine.ls_redundancy_reflns_obs                 ? 
_refine.ls_restrained_S_all                      ? 
_refine.ls_restrained_S_obs                      ? 
_refine.ls_shift_over_esd_max                    ? 
_refine.ls_shift_over_esd_mean                   ? 
_refine.ls_structure_factor_coef                 ? 
_refine.ls_weighting_details                     ? 
_refine.ls_weighting_scheme                      ? 
_refine.ls_wR_factor_all                         ? 
_refine.ls_wR_factor_obs                         ? 
_refine.ls_wR_factor_R_free                      ? 
_refine.ls_wR_factor_R_work                      ? 
_refine.occupancy_max                            ? 
_refine.occupancy_min                            ? 
_refine.solvent_model_details                    ? 
_refine.solvent_model_param_bsol                 ? 
_refine.solvent_model_param_ksol                 ? 
_refine.ls_R_factor_gt                           ? 
_refine.ls_goodness_of_fit_gt                    ? 
_refine.ls_goodness_of_fit_ref                   ? 
_refine.ls_shift_over_su_max                     ? 
_refine.ls_shift_over_su_max_lt                  ? 
_refine.ls_shift_over_su_mean                    ? 
_refine.ls_shift_over_su_mean_lt                 ? 
_refine.pdbx_ls_sigma_I                          ? 
_refine.pdbx_ls_sigma_F                          1.32948920372 
_refine.pdbx_ls_sigma_Fsqd                       ? 
_refine.pdbx_data_cutoff_high_absF               ? 
_refine.pdbx_data_cutoff_high_rms_absF           ? 
_refine.pdbx_data_cutoff_low_absF                ? 
_refine.pdbx_isotropic_thermal_model             ? 
_refine.pdbx_ls_cross_valid_method               'FREE R-VALUE' 
_refine.pdbx_method_to_determine_struct          'MOLECULAR REPLACEMENT' 
_refine.pdbx_starting_model                      1GID 
_refine.pdbx_stereochemistry_target_values       ? 
_refine.pdbx_R_Free_selection_details            ? 
_refine.pdbx_stereochem_target_val_spec_case     ? 
_refine.pdbx_overall_ESU_R                       ? 
_refine.pdbx_overall_ESU_R_Free                  ? 
_refine.pdbx_solvent_vdw_probe_radii             1.11 
_refine.pdbx_solvent_ion_probe_radii             ? 
_refine.pdbx_solvent_shrinkage_radii             0.9 
_refine.pdbx_real_space_R                        ? 
_refine.pdbx_density_correlation                 ? 
_refine.pdbx_pd_number_of_powder_patterns        ? 
_refine.pdbx_pd_number_of_points                 ? 
_refine.pdbx_pd_meas_number_of_points            ? 
_refine.pdbx_pd_proc_ls_prof_R_factor            ? 
_refine.pdbx_pd_proc_ls_prof_wR_factor           ? 
_refine.pdbx_pd_Marquardt_correlation_coeff      ? 
_refine.pdbx_pd_Fsqrd_R_factor                   ? 
_refine.pdbx_pd_ls_matrix_band_width             ? 
_refine.pdbx_overall_phase_error                 29.7701007419 
_refine.pdbx_overall_SU_R_free_Cruickshank_DPI   ? 
_refine.pdbx_overall_SU_R_free_Blow_DPI          ? 
_refine.pdbx_overall_SU_R_Blow_DPI               ? 
_refine.pdbx_TLS_residual_ADP_flag               ? 
_refine.pdbx_diffrn_id                           1 
_refine.overall_SU_B                             ? 
_refine.overall_SU_ML                            0.349042001144 
_refine.overall_SU_R_Cruickshank_DPI             ? 
_refine.overall_SU_R_free                        ? 
_refine.overall_FOM_free_R_set                   ? 
_refine.overall_FOM_work_R_set                   ? 
_refine.pdbx_average_fsc_overall                 ? 
_refine.pdbx_average_fsc_work                    ? 
_refine.pdbx_average_fsc_free                    ? 
# 
_refine_hist.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_refine_hist.cycle_id                         LAST 
_refine_hist.pdbx_number_atoms_protein        0 
_refine_hist.pdbx_number_atoms_nucleic_acid   6770 
_refine_hist.pdbx_number_atoms_ligand         20 
_refine_hist.number_atoms_solvent             0 
_refine_hist.number_atoms_total               6790 
_refine_hist.d_res_high                       3.14 
_refine_hist.d_res_low                        63.8 
# 
loop_
_refine_ls_restr.pdbx_refine_id 
_refine_ls_restr.criterion 
_refine_ls_restr.dev_ideal 
_refine_ls_restr.dev_ideal_target 
_refine_ls_restr.number 
_refine_ls_restr.rejects 
_refine_ls_restr.type 
_refine_ls_restr.weight 
_refine_ls_restr.pdbx_restraint_function 
'X-RAY DIFFRACTION' ? 0.00300655661399 ? 7580  ? f_bond_d           ? ? 
'X-RAY DIFFRACTION' ? 0.633355654452   ? 11818 ? f_angle_d          ? ? 
'X-RAY DIFFRACTION' ? 0.0416861274456  ? 1580  ? f_chiral_restr     ? ? 
'X-RAY DIFFRACTION' ? 0.00398600576193 ? 316   ? f_plane_restr      ? ? 
'X-RAY DIFFRACTION' ? 15.0161921613    ? 3786  ? f_dihedral_angle_d ? ? 
# 
loop_
_refine_ls_shell.pdbx_refine_id 
_refine_ls_shell.d_res_high 
_refine_ls_shell.d_res_low 
_refine_ls_shell.number_reflns_all 
_refine_ls_shell.number_reflns_obs 
_refine_ls_shell.number_reflns_R_free 
_refine_ls_shell.number_reflns_R_work 
_refine_ls_shell.percent_reflns_obs 
_refine_ls_shell.percent_reflns_R_free 
_refine_ls_shell.R_factor_all 
_refine_ls_shell.R_factor_obs 
_refine_ls_shell.R_factor_R_free 
_refine_ls_shell.R_factor_R_free_error 
_refine_ls_shell.R_factor_R_work 
_refine_ls_shell.redundancy_reflns_all 
_refine_ls_shell.redundancy_reflns_obs 
_refine_ls_shell.wR_factor_all 
_refine_ls_shell.wR_factor_obs 
_refine_ls_shell.wR_factor_R_free 
_refine_ls_shell.wR_factor_R_work 
_refine_ls_shell.pdbx_total_number_of_bins_used 
_refine_ls_shell.pdbx_phase_error 
_refine_ls_shell.pdbx_fsc_work 
_refine_ls_shell.pdbx_fsc_free 
'X-RAY DIFFRACTION' 3.1426 3.2031  . . 117 1054 83.7625178827 . . . 0.503590806619 . 0.363585111648 . . . . . . . . . . 
'X-RAY DIFFRACTION' 3.2031 3.2685  . . 141 1261 99.4326241135 . . . 0.317717276368 . 0.310802826497 . . . . . . . . . . 
'X-RAY DIFFRACTION' 3.2685 3.3395  . . 137 1237 99.6374184191 . . . 0.328517378745 . 0.28991055984  . . . . . . . . . . 
'X-RAY DIFFRACTION' 3.3395 3.4172  . . 141 1264 99.7161107168 . . . 0.287707081813 . 0.288061171454 . . . . . . . . . . 
'X-RAY DIFFRACTION' 3.4172 3.5027  . . 136 1244 99.5670995671 . . . 0.290676863889 . 0.265888504206 . . . . . . . . . . 
'X-RAY DIFFRACTION' 3.5027 3.5974  . . 136 1242 99.5664739884 . . . 0.244311126099 . 0.239818580879 . . . . . . . . . . 
'X-RAY DIFFRACTION' 3.5974 3.7032  . . 140 1256 99.9284180387 . . . 0.231013905915 . 0.22848921486  . . . . . . . . . . 
'X-RAY DIFFRACTION' 3.7032 3.8227  . . 141 1261 99.5031937544 . . . 0.217297527463 . 0.208290444906 . . . . . . . . . . 
'X-RAY DIFFRACTION' 3.8227 3.9593  . . 140 1268 99.716713881  . . . 0.205392998456 . 0.212866450906 . . . . . . . . . . 
'X-RAY DIFFRACTION' 3.9593 4.1178  . . 139 1255 99.9283154122 . . . 0.255191856216 . 0.210655376392 . . . . . . . . . . 
'X-RAY DIFFRACTION' 4.1178 4.3052  . . 141 1260 99.6443812233 . . . 0.23340005209  . 0.221895191152 . . . . . . . . . . 
'X-RAY DIFFRACTION' 4.3052 4.5321  . . 140 1261 99.6443812233 . . . 0.213316333125 . 0.212972263941 . . . . . . . . . . 
'X-RAY DIFFRACTION' 4.5321 4.816   . . 142 1276 99.6486296557 . . . 0.238202505801 . 0.194134104613 . . . . . . . . . . 
'X-RAY DIFFRACTION' 4.816  5.1877  . . 142 1274 99.8589562764 . . . 0.193379469139 . 0.174653558592 . . . . . . . . . . 
'X-RAY DIFFRACTION' 5.1877 5.7094  . . 144 1298 99.9306999307 . . . 0.200909224972 . 0.182149360511 . . . . . . . . . . 
'X-RAY DIFFRACTION' 5.7094 6.5349  . . 145 1299 99.6549344375 . . . 0.197200208143 . 0.195450932441 . . . . . . . . . . 
'X-RAY DIFFRACTION' 6.5349 8.2305  . . 144 1303 98.9740082079 . . . 0.197699807829 . 0.197608201514 . . . . . . . . . . 
'X-RAY DIFFRACTION' 8.2305 63.8012 . . 154 1379 99.2875647668 . . . 0.244353729484 . 0.211465147082 . . . . . . . . . . 
# 
_struct.entry_id                     6BJX 
_struct.title                        'Group I self-splicing intron P4-P6 domain mutant U131A (with isopropanol soaking)' 
_struct.pdbx_descriptor              'Group I self-splicing intron P4-P6 domain' 
_struct.pdbx_model_details           ? 
_struct.pdbx_formula_weight          ? 
_struct.pdbx_formula_weight_method   ? 
_struct.pdbx_model_type_details      ? 
_struct.pdbx_CASP_flag               N 
# 
_struct_keywords.entry_id        6BJX 
_struct_keywords.text            'ribozyme, RNA' 
_struct_keywords.pdbx_keywords   RNA 
# 
loop_
_struct_asym.id 
_struct_asym.pdbx_blank_PDB_chainid_flag 
_struct_asym.pdbx_modified 
_struct_asym.entity_id 
_struct_asym.details 
A N N 1 ? 
B N N 1 ? 
C N N 2 ? 
D N N 2 ? 
E N N 2 ? 
F N N 2 ? 
G N N 2 ? 
H N N 2 ? 
I N N 2 ? 
J N N 2 ? 
K N N 2 ? 
L N N 2 ? 
M N N 2 ? 
N N N 2 ? 
O N N 2 ? 
P N N 2 ? 
Q N N 2 ? 
R N N 2 ? 
S N N 2 ? 
T N N 2 ? 
U N N 2 ? 
V N N 2 ? 
# 
loop_
_struct_conn.id 
_struct_conn.conn_type_id 
_struct_conn.pdbx_leaving_atom_flag 
_struct_conn.pdbx_PDB_id 
_struct_conn.ptnr1_label_asym_id 
_struct_conn.ptnr1_label_comp_id 
_struct_conn.ptnr1_label_seq_id 
_struct_conn.ptnr1_label_atom_id 
_struct_conn.pdbx_ptnr1_label_alt_id 
_struct_conn.pdbx_ptnr1_PDB_ins_code 
_struct_conn.pdbx_ptnr1_standard_comp_id 
_struct_conn.ptnr1_symmetry 
_struct_conn.ptnr2_label_asym_id 
_struct_conn.ptnr2_label_comp_id 
_struct_conn.ptnr2_label_seq_id 
_struct_conn.ptnr2_label_atom_id 
_struct_conn.pdbx_ptnr2_label_alt_id 
_struct_conn.pdbx_ptnr2_PDB_ins_code 
_struct_conn.ptnr1_auth_asym_id 
_struct_conn.ptnr1_auth_comp_id 
_struct_conn.ptnr1_auth_seq_id 
_struct_conn.ptnr2_auth_asym_id 
_struct_conn.ptnr2_auth_comp_id 
_struct_conn.ptnr2_auth_seq_id 
_struct_conn.ptnr2_symmetry 
_struct_conn.pdbx_ptnr3_label_atom_id 
_struct_conn.pdbx_ptnr3_label_seq_id 
_struct_conn.pdbx_ptnr3_label_comp_id 
_struct_conn.pdbx_ptnr3_label_asym_id 
_struct_conn.pdbx_ptnr3_label_alt_id 
_struct_conn.pdbx_ptnr3_PDB_ins_code 
_struct_conn.details 
_struct_conn.pdbx_dist_value 
_struct_conn.pdbx_value_order 
metalc1   metalc ? ? A G 10  OP2   ? ? ? 1_555 L MG .   MG ? ? A G 112 A MG 310 1_555 ? ? ? ? ? ? ?                    2.437 ? 
metalc2   metalc ? ? A G 62  O6    ? ? ? 1_555 F MG .   MG ? ? A G 164 A MG 304 1_555 ? ? ? ? ? ? ?                    2.321 ? 
metalc3   metalc ? ? A A 69  OP2   ? ? ? 1_555 G MG .   MG ? ? A A 171 A MG 305 1_555 ? ? ? ? ? ? ?                    2.440 ? 
metalc4   metalc ? ? A A 71  OP2   ? ? ? 1_555 H MG .   MG ? ? A A 173 A MG 306 1_555 ? ? ? ? ? ? ?                    2.248 ? 
metalc5   metalc ? ? A A 81  OP1   ? ? ? 1_555 D MG .   MG ? ? A A 183 A MG 302 1_555 ? ? ? ? ? ? ?                    2.204 ? 
metalc6   metalc ? ? A A 82  OP1   ? ? ? 1_555 E MG .   MG ? ? A A 184 A MG 303 1_555 ? ? ? ? ? ? ?                    2.022 ? 
metalc7   metalc ? ? A A 82  OP2   ? ? ? 1_555 D MG .   MG ? ? A A 184 A MG 302 1_555 ? ? ? ? ? ? ?                    2.396 ? 
metalc8   metalc ? ? A A 84  OP1   ? ? ? 1_555 E MG .   MG ? ? A A 186 A MG 303 1_555 ? ? ? ? ? ? ?                    2.271 ? 
metalc9   metalc ? ? A A 84  OP2   ? ? ? 1_555 D MG .   MG ? ? A A 186 A MG 302 1_555 ? ? ? ? ? ? ?                    2.575 ? 
metalc10  metalc ? ? A A 85  OP1   ? ? ? 1_555 E MG .   MG ? ? A A 187 A MG 303 1_555 ? ? ? ? ? ? ?                    2.811 ? 
metalc11  metalc ? ? A A 85  OP2   ? ? ? 1_555 E MG .   MG ? ? A A 187 A MG 303 1_555 ? ? ? ? ? ? ?                    2.228 ? 
metalc12  metalc ? ? A G 86  O6    ? ? ? 1_555 C MG .   MG ? ? A G 188 A MG 301 1_555 ? ? ? ? ? ? ?                    2.141 ? 
metalc13  metalc ? ? A A 146 "O2'" ? ? ? 1_555 J MG .   MG ? ? A A 248 A MG 308 1_555 ? ? ? ? ? ? ?                    2.605 ? 
metalc14  metalc ? ? A G 148 OP2   ? ? ? 1_555 J MG .   MG ? ? A G 250 A MG 308 1_555 ? ? ? ? ? ? ?                    2.422 ? 
metalc15  metalc ? ? B G 10  OP2   ? ? ? 1_555 S MG .   MG ? ? B G 112 B MG 307 1_555 ? ? ? ? ? ? ?                    2.337 ? 
metalc16  metalc ? ? B G 62  O6    ? ? ? 1_555 P MG .   MG ? ? B G 164 B MG 304 1_555 ? ? ? ? ? ? ?                    2.384 ? 
metalc17  metalc ? ? B A 69  OP2   ? ? ? 1_555 R MG .   MG ? ? B A 171 B MG 306 1_555 ? ? ? ? ? ? ?                    2.251 ? 
metalc18  metalc ? ? B A 71  OP2   ? ? ? 1_555 T MG .   MG ? ? B A 173 B MG 308 1_555 ? ? ? ? ? ? ?                    2.135 ? 
metalc19  metalc ? ? B A 81  OP1   ? ? ? 1_555 N MG .   MG ? ? B A 183 B MG 302 1_555 ? ? ? ? ? ? ?                    2.277 ? 
metalc20  metalc ? ? B A 82  OP1   ? ? ? 1_555 O MG .   MG ? ? B A 184 B MG 303 1_555 ? ? ? ? ? ? ?                    2.061 ? 
metalc21  metalc ? ? B A 82  OP2   ? ? ? 1_555 N MG .   MG ? ? B A 184 B MG 302 1_555 ? ? ? ? ? ? ?                    2.488 ? 
metalc22  metalc ? ? B A 84  OP1   ? ? ? 1_555 O MG .   MG ? ? B A 186 B MG 303 1_555 ? ? ? ? ? ? ?                    2.110 ? 
metalc23  metalc ? ? B A 84  OP2   ? ? ? 1_555 N MG .   MG ? ? B A 186 B MG 302 1_555 ? ? ? ? ? ? ?                    2.694 ? 
metalc24  metalc ? ? B A 85  OP2   ? ? ? 1_555 O MG .   MG ? ? B A 187 B MG 303 1_555 ? ? ? ? ? ? ?                    2.118 ? 
metalc25  metalc ? ? B G 86  O6    ? ? ? 1_555 M MG .   MG ? ? B G 188 B MG 301 1_555 ? ? ? ? ? ? ?                    2.100 ? 
metalc26  metalc ? ? B U 147 OP2   ? ? ? 1_555 U MG .   MG ? ? B U 249 B MG 309 1_555 ? ? ? ? ? ? ?                    2.758 ? 
metalc27  metalc ? ? B G 148 OP2   ? ? ? 1_555 U MG .   MG ? ? B G 250 B MG 309 1_555 ? ? ? ? ? ? ?                    2.032 ? 
hydrog1   hydrog ? ? A G 1   N1    ? ? ? 1_555 A C  115 N3 ? ? A G 103 A C  217 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog2   hydrog ? ? A G 1   N2    ? ? ? 1_555 A C  115 O2 ? ? A G 103 A C  217 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog3   hydrog ? ? A G 1   O6    ? ? ? 1_555 A C  115 N4 ? ? A G 103 A C  217 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog4   hydrog ? ? A A 2   N6    ? ? ? 1_555 A C  114 N3 ? ? A A 104 A C  216 1_555 ? ? ? ? ? ? 'A-C MISPAIR'        ?     ? 
hydrog5   hydrog ? ? A A 2   N7    ? ? ? 1_555 A G  155 N2 ? ? A A 104 A G  257 1_555 ? ? ? ? ? ? 'A-G MISPAIR'        ?     ? 
hydrog6   hydrog ? ? A A 3   N1    ? ? ? 1_555 A G  113 N1 ? ? A A 105 A G  215 1_555 ? ? ? ? ? ? TYPE_8_PAIR          ?     ? 
hydrog7   hydrog ? ? A A 3   N6    ? ? ? 1_555 A G  113 O6 ? ? A A 105 A G  215 1_555 ? ? ? ? ? ? TYPE_8_PAIR          ?     ? 
hydrog8   hydrog ? ? A A 3   N6    ? ? ? 1_555 A U  156 O4 ? ? A A 105 A U  258 1_555 ? ? ? ? ? ? HOOGSTEEN            ?     ? 
hydrog9   hydrog ? ? A A 3   N7    ? ? ? 1_555 A U  156 N3 ? ? A A 105 A U  258 1_555 ? ? ? ? ? ? HOOGSTEEN            ?     ? 
hydrog10  hydrog ? ? A U 5   N3    ? ? ? 1_555 A A  112 N1 ? ? A U 107 A A  214 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog11  hydrog ? ? A U 5   O4    ? ? ? 1_555 A A  112 N6 ? ? A U 107 A A  214 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog12  hydrog ? ? A U 5   O4    ? ? ? 1_555 A U  157 N3 ? ? A U 107 A U  259 1_555 ? ? ? ? ? ? 'U-U MISPAIR'        ?     ? 
hydrog13  hydrog ? ? A G 6   N1    ? ? ? 1_555 A C  111 N3 ? ? A G 108 A C  213 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog14  hydrog ? ? A G 6   N2    ? ? ? 1_555 A C  111 O2 ? ? A G 108 A C  213 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog15  hydrog ? ? A G 6   O6    ? ? ? 1_555 A C  111 N4 ? ? A G 108 A C  213 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog16  hydrog ? ? A G 6   O6    ? ? ? 1_555 A C  158 N4 ? ? A G 108 A C  260 1_555 ? ? ? ? ? ? 'G-C PAIR'           ?     ? 
hydrog17  hydrog ? ? A C 7   N3    ? ? ? 1_555 A G  110 N1 ? ? A C 109 A G  212 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog18  hydrog ? ? A C 7   N4    ? ? ? 1_555 A G  110 O6 ? ? A C 109 A G  212 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog19  hydrog ? ? A C 7   O2    ? ? ? 1_555 A G  110 N2 ? ? A C 109 A G  212 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog20  hydrog ? ? A G 8   N1    ? ? ? 1_555 A C  109 N3 ? ? A G 110 A C  211 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog21  hydrog ? ? A G 8   N2    ? ? ? 1_555 A C  109 O2 ? ? A G 110 A C  211 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog22  hydrog ? ? A G 8   O6    ? ? ? 1_555 A C  109 N4 ? ? A G 110 A C  211 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog23  hydrog ? ? A G 9   N1    ? ? ? 1_555 A C  107 N3 ? ? A G 111 A C  209 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog24  hydrog ? ? A G 9   N2    ? ? ? 1_555 A C  107 O2 ? ? A G 111 A C  209 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog25  hydrog ? ? A G 9   O6    ? ? ? 1_555 A C  107 N4 ? ? A G 111 A C  209 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog26  hydrog ? ? A G 10  N1    ? ? ? 1_555 A C  106 N3 ? ? A G 112 A C  208 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog27  hydrog ? ? A G 10  N2    ? ? ? 1_555 A C  106 O2 ? ? A G 112 A C  208 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog28  hydrog ? ? A G 10  O6    ? ? ? 1_555 A C  106 N4 ? ? A G 112 A C  208 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog29  hydrog ? ? A A 11  N3    ? ? ? 1_555 A A  105 N6 ? ? A A 113 A A  207 1_555 ? ? ? ? ? ? 'A-A MISPAIR'        ?     ? 
hydrog30  hydrog ? ? A A 12  N6    ? ? ? 1_555 A A  104 N3 ? ? A A 114 A A  206 1_555 ? ? ? ? ? ? 'A-A MISPAIR'        ?     ? 
hydrog31  hydrog ? ? A G 14  N1    ? ? ? 1_555 A U  103 O2 ? ? A G 116 A U  205 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog32  hydrog ? ? A G 14  O6    ? ? ? 1_555 A U  103 N3 ? ? A G 116 A U  205 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog33  hydrog ? ? A G 15  N1    ? ? ? 1_555 A C  102 N3 ? ? A G 117 A C  204 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog34  hydrog ? ? A G 15  N2    ? ? ? 1_555 A C  102 O2 ? ? A G 117 A C  204 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog35  hydrog ? ? A G 15  O6    ? ? ? 1_555 A C  102 N4 ? ? A G 117 A C  204 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog36  hydrog ? ? A G 16  N1    ? ? ? 1_555 A C  101 N3 ? ? A G 118 A C  203 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog37  hydrog ? ? A G 16  N2    ? ? ? 1_555 A C  101 O2 ? ? A G 118 A C  203 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog38  hydrog ? ? A G 16  O6    ? ? ? 1_555 A C  101 N4 ? ? A G 118 A C  203 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog39  hydrog ? ? A G 17  N1    ? ? ? 1_555 A U  100 O2 ? ? A G 119 A U  202 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog40  hydrog ? ? A G 17  O6    ? ? ? 1_555 A U  100 N3 ? ? A G 119 A U  202 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog41  hydrog ? ? A U 18  N3    ? ? ? 1_555 A G  99  O6 ? ? A U 120 A G  201 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog42  hydrog ? ? A U 18  O2    ? ? ? 1_555 A G  99  N1 ? ? A U 120 A G  201 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog43  hydrog ? ? A C 19  N3    ? ? ? 1_555 A G  98  N1 ? ? A C 121 A G  200 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog44  hydrog ? ? A C 19  N4    ? ? ? 1_555 A G  98  O6 ? ? A C 121 A G  200 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog45  hydrog ? ? A C 19  O2    ? ? ? 1_555 A G  98  N2 ? ? A C 121 A G  200 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog46  hydrog ? ? A C 22  N4    ? ? ? 1_555 A A  94  N1 ? ? A C 124 A A  196 1_555 ? ? ? ? ? ? 'C-A MISPAIR'        ?     ? 
hydrog47  hydrog ? ? A C 22  N4    ? ? ? 1_555 A C  95  O2 ? ? A C 124 A C  197 1_555 ? ? ? ? ? ? 'C-C MISPAIR'        ?     ? 
hydrog48  hydrog ? ? A C 22  N3    ? ? ? 1_555 A G  99  N2 ? ? A C 124 A G  201 1_555 ? ? ? ? ? ? 'C-G PAIR'           ?     ? 
hydrog49  hydrog ? ? A G 24  N1    ? ? ? 1_555 A A  94  N1 ? ? A G 126 A A  196 1_555 ? ? ? ? ? ? TYPE_8_PAIR          ?     ? 
hydrog50  hydrog ? ? A G 24  O6    ? ? ? 1_555 A A  94  N6 ? ? A G 126 A A  196 1_555 ? ? ? ? ? ? TYPE_8_PAIR          ?     ? 
hydrog51  hydrog ? ? A C 25  N3    ? ? ? 1_555 A G  93  N1 ? ? A C 127 A G  195 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog52  hydrog ? ? A C 25  N4    ? ? ? 1_555 A G  93  O6 ? ? A C 127 A G  195 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog53  hydrog ? ? A C 25  O2    ? ? ? 1_555 A G  93  N2 ? ? A C 127 A G  195 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog54  hydrog ? ? A C 26  N3    ? ? ? 1_555 A G  92  N1 ? ? A C 128 A G  194 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog55  hydrog ? ? A C 26  N4    ? ? ? 1_555 A G  92  O6 ? ? A C 128 A G  194 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog56  hydrog ? ? A C 26  O2    ? ? ? 1_555 A G  92  N2 ? ? A C 128 A G  194 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog57  hydrog ? ? A G 27  N1    ? ? ? 1_555 A C  91  N3 ? ? A G 129 A C  193 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog58  hydrog ? ? A G 27  N2    ? ? ? 1_555 A C  91  O2 ? ? A G 129 A C  193 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog59  hydrog ? ? A G 27  O6    ? ? ? 1_555 A C  91  N4 ? ? A G 129 A C  193 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog60  hydrog ? ? A U 28  N3    ? ? ? 1_555 A A  90  N1 ? ? A U 130 A A  192 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog61  hydrog ? ? A U 28  O4    ? ? ? 1_555 A A  90  N6 ? ? A U 130 A A  192 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog62  hydrog ? ? A C 30  N3    ? ? ? 1_555 A G  89  N1 ? ? A C 132 A G  191 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog63  hydrog ? ? A C 30  N4    ? ? ? 1_555 A G  89  O6 ? ? A C 132 A G  191 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog64  hydrog ? ? A C 30  O2    ? ? ? 1_555 A G  89  N2 ? ? A C 132 A G  191 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog65  hydrog ? ? A A 31  N1    ? ? ? 1_555 A U  88  N3 ? ? A A 133 A U  190 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog66  hydrog ? ? A A 31  N6    ? ? ? 1_555 A U  88  O4 ? ? A A 133 A U  190 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog67  hydrog ? ? A G 32  N1    ? ? ? 1_555 A C  87  N3 ? ? A G 134 A C  189 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog68  hydrog ? ? A G 32  N2    ? ? ? 1_555 A C  87  O2 ? ? A G 134 A C  189 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog69  hydrog ? ? A G 32  O6    ? ? ? 1_555 A C  87  N4 ? ? A G 134 A C  189 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog70  hydrog ? ? A U 33  N3    ? ? ? 1_555 A A  85  N7 ? ? A U 135 A A  187 1_555 ? ? ? ? ? ? HOOGSTEEN            ?     ? 
hydrog71  hydrog ? ? A U 33  O4    ? ? ? 1_555 A A  85  N6 ? ? A U 135 A A  187 1_555 ? ? ? ? ? ? HOOGSTEEN            ?     ? 
hydrog72  hydrog ? ? A A 34  N1    ? ? ? 1_555 A U  80  N3 ? ? A A 136 A U  182 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog73  hydrog ? ? A A 34  N6    ? ? ? 1_555 A U  80  O4 ? ? A A 136 A U  182 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog74  hydrog ? ? A C 35  N3    ? ? ? 1_555 A G  79  N1 ? ? A C 137 A G  181 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog75  hydrog ? ? A C 35  N4    ? ? ? 1_555 A G  79  O6 ? ? A C 137 A G  181 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog76  hydrog ? ? A C 35  O2    ? ? ? 1_555 A G  79  N2 ? ? A C 137 A G  181 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog77  hydrog ? ? A C 36  N3    ? ? ? 1_555 A G  78  N1 ? ? A C 138 A G  180 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog78  hydrog ? ? A C 36  N4    ? ? ? 1_555 A G  78  O6 ? ? A C 138 A G  180 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog79  hydrog ? ? A C 36  O2    ? ? ? 1_555 A G  78  N2 ? ? A C 138 A G  180 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog80  hydrog ? ? A A 37  N6    ? ? ? 1_555 A G  62  N3 ? ? A A 139 A G  164 1_555 ? ? ? ? ? ? TYPE_11_PAIR         ?     ? 
hydrog81  hydrog ? ? A A 37  N7    ? ? ? 1_555 A G  62  N2 ? ? A A 139 A G  164 1_555 ? ? ? ? ? ? TYPE_11_PAIR         ?     ? 
hydrog82  hydrog ? ? A A 38  N6    ? ? ? 1_555 A G  61  N3 ? ? A A 140 A G  163 1_555 ? ? ? ? ? ? TYPE_11_PAIR         ?     ? 
hydrog83  hydrog ? ? A A 38  N7    ? ? ? 1_555 A G  61  N2 ? ? A A 140 A G  163 1_555 ? ? ? ? ? ? TYPE_11_PAIR         ?     ? 
hydrog84  hydrog ? ? A G 39  N1    ? ? ? 1_555 A U  60  O2 ? ? A G 141 A U  162 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog85  hydrog ? ? A G 39  O6    ? ? ? 1_555 A U  60  N3 ? ? A G 141 A U  162 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog86  hydrog ? ? A U 40  N3    ? ? ? 1_555 A A  59  N1 ? ? A U 142 A A  161 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog87  hydrog ? ? A U 40  O4    ? ? ? 1_555 A A  59  N6 ? ? A U 142 A A  161 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog88  hydrog ? ? A C 41  N3    ? ? ? 1_555 A G  58  N1 ? ? A C 143 A G  160 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog89  hydrog ? ? A C 41  N4    ? ? ? 1_555 A G  58  O6 ? ? A C 143 A G  160 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog90  hydrog ? ? A C 41  O2    ? ? ? 1_555 A G  58  N2 ? ? A C 143 A G  160 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog91  hydrog ? ? A U 42  N3    ? ? ? 1_555 A A  57  N1 ? ? A U 144 A A  159 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog92  hydrog ? ? A U 42  O4    ? ? ? 1_555 A A  57  N6 ? ? A U 144 A A  159 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog93  hydrog ? ? A C 43  N3    ? ? ? 1_555 A G  56  N1 ? ? A C 145 A G  158 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog94  hydrog ? ? A C 43  N4    ? ? ? 1_555 A G  56  O6 ? ? A C 145 A G  158 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog95  hydrog ? ? A C 43  O2    ? ? ? 1_555 A G  56  N2 ? ? A C 145 A G  158 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog96  hydrog ? ? A A 44  N1    ? ? ? 1_555 A U  55  N3 ? ? A A 146 A U  157 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog97  hydrog ? ? A A 44  N6    ? ? ? 1_555 A U  55  O4 ? ? A A 146 A U  157 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog98  hydrog ? ? A G 45  N1    ? ? ? 1_555 A U  54  O2 ? ? A G 147 A U  156 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog99  hydrog ? ? A G 45  O6    ? ? ? 1_555 A U  54  N3 ? ? A G 147 A U  156 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog100 hydrog ? ? A G 46  N1    ? ? ? 1_555 A U  53  O2 ? ? A G 148 A U  155 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog101 hydrog ? ? A G 46  O6    ? ? ? 1_555 A U  53  N3 ? ? A G 148 A U  155 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog102 hydrog ? ? A G 47  N1    ? ? ? 1_555 A C  52  N3 ? ? A G 149 A C  154 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog103 hydrog ? ? A G 47  N2    ? ? ? 1_555 A C  52  O2 ? ? A G 149 A C  154 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog104 hydrog ? ? A G 47  O6    ? ? ? 1_555 A C  52  N4 ? ? A G 149 A C  154 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog105 hydrog ? ? A G 48  N2    ? ? ? 1_555 A A  51  N7 ? ? A G 150 A A  153 1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ?     ? 
hydrog106 hydrog ? ? A A 49  N1    ? ? ? 1_555 A A  146 N6 ? ? A A 151 A A  248 1_555 ? ? ? ? ? ? TYPE_1_PAIR          ?     ? 
hydrog107 hydrog ? ? A A 49  N6    ? ? ? 1_555 A A  146 N1 ? ? A A 151 A A  248 1_555 ? ? ? ? ? ? TYPE_1_PAIR          ?     ? 
hydrog108 hydrog ? ? A A 51  N3    ? ? ? 1_555 A G  148 N2 ? ? A A 153 A G  250 1_555 ? ? ? ? ? ? 'A-G MISPAIR'        ?     ? 
hydrog109 hydrog ? ? A G 61  O6    ? ? ? 1_555 A A  76  N6 ? ? A G 163 A A  178 1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ?     ? 
hydrog110 hydrog ? ? A C 63  N3    ? ? ? 1_555 A G  73  N1 ? ? A C 165 A G  175 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog111 hydrog ? ? A C 63  N4    ? ? ? 1_555 A G  73  O6 ? ? A C 165 A G  175 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog112 hydrog ? ? A C 63  O2    ? ? ? 1_555 A G  73  N2 ? ? A C 165 A G  175 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog113 hydrog ? ? A C 64  N3    ? ? ? 1_555 A G  72  N1 ? ? A C 166 A G  174 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog114 hydrog ? ? A C 64  N4    ? ? ? 1_555 A G  72  O6 ? ? A C 166 A G  174 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog115 hydrog ? ? A C 64  O2    ? ? ? 1_555 A G  72  N2 ? ? A C 166 A G  174 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog116 hydrog ? ? A U 65  O4    ? ? ? 1_555 A A  71  N6 ? ? A U 167 A A  173 1_555 ? ? ? ? ? ? 'U-A PAIR'           ?     ? 
hydrog117 hydrog ? ? A U 66  O4    ? ? ? 1_555 A G  86  N2 ? ? A U 168 A G  188 1_555 ? ? ? ? ? ? 'U-G MISPAIR'        ?     ? 
hydrog118 hydrog ? ? A G 67  N1    ? ? ? 1_555 B C  153 N3 ? ? A G 169 B C  255 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog119 hydrog ? ? A G 67  N2    ? ? ? 1_555 B C  153 O2 ? ? A G 169 B C  255 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog120 hydrog ? ? A G 67  O6    ? ? ? 1_555 B C  153 N4 ? ? A G 169 B C  255 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog121 hydrog ? ? A C 68  N3    ? ? ? 1_555 B G  152 N1 ? ? A C 170 B G  254 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog122 hydrog ? ? A C 68  N4    ? ? ? 1_555 B G  152 O6 ? ? A C 170 B G  254 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog123 hydrog ? ? A C 68  O2    ? ? ? 1_555 B G  152 N2 ? ? A C 170 B G  254 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog124 hydrog ? ? A G 79  N2    ? ? ? 1_555 A A  84  N3 ? ? A G 181 A A  186 1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ?     ? 
hydrog125 hydrog ? ? A A 82  N3    ? ? ? 1_555 A G  110 N2 ? ? A A 184 A G  212 1_555 ? ? ? ? ? ? 'A-G MISPAIR'        ?     ? 
hydrog126 hydrog ? ? A C 95  O2    ? ? ? 1_555 A G  98  N2 ? ? A C 197 A G  200 1_555 ? ? ? ? ? ? 'C-G PAIR'           ?     ? 
hydrog127 hydrog ? ? A G 118 N1    ? ? ? 1_555 A U  151 O2 ? ? A G 220 A U  253 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog128 hydrog ? ? A G 118 O6    ? ? ? 1_555 A U  151 N3 ? ? A G 220 A U  253 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog129 hydrog ? ? A U 119 N3    ? ? ? 1_555 A A  150 N1 ? ? A U 221 A A  252 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog130 hydrog ? ? A U 119 O4    ? ? ? 1_555 A A  150 N6 ? ? A U 221 A A  252 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog131 hydrog ? ? A C 120 N3    ? ? ? 1_555 A G  149 N1 ? ? A C 222 A G  251 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog132 hydrog ? ? A C 120 N4    ? ? ? 1_555 A G  149 O6 ? ? A C 222 A G  251 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog133 hydrog ? ? A C 120 O2    ? ? ? 1_555 A G  149 N2 ? ? A C 222 A G  251 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog134 hydrog ? ? A C 121 N3    ? ? ? 1_555 A G  148 N1 ? ? A C 223 A G  250 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog135 hydrog ? ? A C 121 N4    ? ? ? 1_555 A G  148 O6 ? ? A C 223 A G  250 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog136 hydrog ? ? A C 121 O2    ? ? ? 1_555 A G  148 N2 ? ? A C 223 A G  250 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog137 hydrog ? ? A U 122 N3    ? ? ? 1_555 A A  146 N7 ? ? A U 224 A A  248 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ?     ? 
hydrog138 hydrog ? ? A U 122 O2    ? ? ? 1_555 A A  146 N6 ? ? A U 224 A A  248 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ?     ? 
hydrog139 hydrog ? ? A A 124 N1    ? ? ? 1_555 A U  147 N3 ? ? A A 226 A U  249 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog140 hydrog ? ? A A 124 N6    ? ? ? 1_555 A U  147 O4 ? ? A A 226 A U  249 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog141 hydrog ? ? A G 125 N1    ? ? ? 1_555 A U  145 O2 ? ? A G 227 A U  247 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog142 hydrog ? ? A G 125 O6    ? ? ? 1_555 A U  145 N3 ? ? A G 227 A U  247 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog143 hydrog ? ? A G 125 N2    ? ? ? 1_555 A U  147 O4 ? ? A G 227 A U  249 1_555 ? ? ? ? ? ? 'G-U MISPAIR'        ?     ? 
hydrog144 hydrog ? ? A U 126 N3    ? ? ? 1_555 A A  144 N1 ? ? A U 228 A A  246 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog145 hydrog ? ? A U 126 O4    ? ? ? 1_555 A A  144 N6 ? ? A U 228 A A  246 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog146 hydrog ? ? A C 127 N3    ? ? ? 1_555 A G  143 N1 ? ? A C 229 A G  245 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog147 hydrog ? ? A C 127 N4    ? ? ? 1_555 A G  143 O6 ? ? A C 229 A G  245 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog148 hydrog ? ? A C 127 O2    ? ? ? 1_555 A G  143 N2 ? ? A C 229 A G  245 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog149 hydrog ? ? A A 128 N1    ? ? ? 1_555 A U  142 N3 ? ? A A 230 A U  244 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog150 hydrog ? ? A A 128 N6    ? ? ? 1_555 A U  142 O4 ? ? A A 230 A U  244 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog151 hydrog ? ? A A 129 N1    ? ? ? 1_555 A U  141 N3 ? ? A A 231 A U  243 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog152 hydrog ? ? A A 129 N6    ? ? ? 1_555 A U  141 O4 ? ? A A 231 A U  243 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog153 hydrog ? ? A C 130 N3    ? ? ? 1_555 A G  140 N1 ? ? A C 232 A G  242 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog154 hydrog ? ? A C 130 N4    ? ? ? 1_555 A G  140 O6 ? ? A C 232 A G  242 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog155 hydrog ? ? A C 130 O2    ? ? ? 1_555 A G  140 N2 ? ? A C 232 A G  242 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog156 hydrog ? ? A A 131 N1    ? ? ? 1_555 A U  139 N3 ? ? A A 233 A U  241 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog157 hydrog ? ? A A 131 N6    ? ? ? 1_555 A U  139 O4 ? ? A A 233 A U  241 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog158 hydrog ? ? A G 132 N1    ? ? ? 1_555 A C  138 N3 ? ? A G 234 A C  240 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog159 hydrog ? ? A G 132 N2    ? ? ? 1_555 A C  138 O2 ? ? A G 234 A C  240 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog160 hydrog ? ? A G 132 O6    ? ? ? 1_555 A C  138 N4 ? ? A G 234 A C  240 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog161 hydrog ? ? A A 133 N1    ? ? ? 1_555 A U  137 N3 ? ? A A 235 A U  239 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog162 hydrog ? ? A A 133 N6    ? ? ? 1_555 A U  137 O4 ? ? A A 235 A U  239 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog163 hydrog ? ? A G 152 N1    ? ? ? 1_555 B C  68  N3 ? ? A G 254 B C  170 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog164 hydrog ? ? A G 152 N2    ? ? ? 1_555 B C  68  O2 ? ? A G 254 B C  170 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog165 hydrog ? ? A G 152 O6    ? ? ? 1_555 B C  68  N4 ? ? A G 254 B C  170 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog166 hydrog ? ? A C 153 N3    ? ? ? 1_555 B G  67  N1 ? ? A C 255 B G  169 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog167 hydrog ? ? A C 153 N4    ? ? ? 1_555 B G  67  O6 ? ? A C 255 B G  169 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog168 hydrog ? ? A C 153 O2    ? ? ? 1_555 B G  67  N2 ? ? A C 255 B G  169 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog169 hydrog ? ? B G 1   N1    ? ? ? 1_555 B C  115 N3 ? ? B G 103 B C  217 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog170 hydrog ? ? B G 1   N2    ? ? ? 1_555 B C  115 O2 ? ? B G 103 B C  217 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog171 hydrog ? ? B G 1   O6    ? ? ? 1_555 B C  115 N4 ? ? B G 103 B C  217 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog172 hydrog ? ? B G 1   N7    ? ? ? 1_555 B A  154 N6 ? ? B G 103 B A  256 1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ?     ? 
hydrog173 hydrog ? ? B A 2   N6    ? ? ? 1_555 B C  114 N3 ? ? B A 104 B C  216 1_555 ? ? ? ? ? ? 'A-C MISPAIR'        ?     ? 
hydrog174 hydrog ? ? B A 2   N6    ? ? ? 1_555 B U  156 O4 ? ? B A 104 B U  258 1_555 ? ? ? ? ? ? HOOGSTEEN            ?     ? 
hydrog175 hydrog ? ? B A 2   N7    ? ? ? 1_555 B U  156 N3 ? ? B A 104 B U  258 1_555 ? ? ? ? ? ? HOOGSTEEN            ?     ? 
hydrog176 hydrog ? ? B A 3   N1    ? ? ? 1_555 B G  113 N1 ? ? B A 105 B G  215 1_555 ? ? ? ? ? ? TYPE_8_PAIR          ?     ? 
hydrog177 hydrog ? ? B A 3   N6    ? ? ? 1_555 B G  113 O6 ? ? B A 105 B G  215 1_555 ? ? ? ? ? ? TYPE_8_PAIR          ?     ? 
hydrog178 hydrog ? ? B A 3   N6    ? ? ? 1_555 B U  156 O4 ? ? B A 105 B U  258 1_555 ? ? ? ? ? ? HOOGSTEEN            ?     ? 
hydrog179 hydrog ? ? B A 3   N7    ? ? ? 1_555 B U  156 N3 ? ? B A 105 B U  258 1_555 ? ? ? ? ? ? HOOGSTEEN            ?     ? 
hydrog180 hydrog ? ? B U 5   N3    ? ? ? 1_555 B A  112 N1 ? ? B U 107 B A  214 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog181 hydrog ? ? B U 5   O4    ? ? ? 1_555 B A  112 N6 ? ? B U 107 B A  214 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog182 hydrog ? ? B U 5   O4    ? ? ? 1_555 B U  157 N3 ? ? B U 107 B U  259 1_555 ? ? ? ? ? ? 'U-U MISPAIR'        ?     ? 
hydrog183 hydrog ? ? B G 6   N1    ? ? ? 1_555 B C  111 N3 ? ? B G 108 B C  213 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog184 hydrog ? ? B G 6   N2    ? ? ? 1_555 B C  111 O2 ? ? B G 108 B C  213 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog185 hydrog ? ? B G 6   O6    ? ? ? 1_555 B C  111 N4 ? ? B G 108 B C  213 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog186 hydrog ? ? B G 6   O6    ? ? ? 1_555 B C  158 N4 ? ? B G 108 B C  260 1_555 ? ? ? ? ? ? 'G-C PAIR'           ?     ? 
hydrog187 hydrog ? ? B C 7   N3    ? ? ? 1_555 B G  110 N1 ? ? B C 109 B G  212 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog188 hydrog ? ? B C 7   N4    ? ? ? 1_555 B G  110 O6 ? ? B C 109 B G  212 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog189 hydrog ? ? B C 7   O2    ? ? ? 1_555 B G  110 N2 ? ? B C 109 B G  212 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog190 hydrog ? ? B G 8   N1    ? ? ? 1_555 B C  109 N3 ? ? B G 110 B C  211 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog191 hydrog ? ? B G 8   N2    ? ? ? 1_555 B C  109 O2 ? ? B G 110 B C  211 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog192 hydrog ? ? B G 8   O6    ? ? ? 1_555 B C  109 N4 ? ? B G 110 B C  211 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog193 hydrog ? ? B G 9   N1    ? ? ? 1_555 B C  107 N3 ? ? B G 111 B C  209 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog194 hydrog ? ? B G 9   N2    ? ? ? 1_555 B C  107 O2 ? ? B G 111 B C  209 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog195 hydrog ? ? B G 9   O6    ? ? ? 1_555 B C  107 N4 ? ? B G 111 B C  209 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog196 hydrog ? ? B G 10  N1    ? ? ? 1_555 B C  106 N3 ? ? B G 112 B C  208 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog197 hydrog ? ? B G 10  N2    ? ? ? 1_555 B C  106 O2 ? ? B G 112 B C  208 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog198 hydrog ? ? B G 10  O6    ? ? ? 1_555 B C  106 N4 ? ? B G 112 B C  208 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog199 hydrog ? ? B A 11  N3    ? ? ? 1_555 B A  105 N6 ? ? B A 113 B A  207 1_555 ? ? ? ? ? ? 'A-A MISPAIR'        ?     ? 
hydrog200 hydrog ? ? B A 12  N6    ? ? ? 1_555 B A  104 N3 ? ? B A 114 B A  206 1_555 ? ? ? ? ? ? 'A-A MISPAIR'        ?     ? 
hydrog201 hydrog ? ? B A 13  N6    ? ? ? 1_555 B A  104 N3 ? ? B A 115 B A  206 1_555 ? ? ? ? ? ? 'A-A MISPAIR'        ?     ? 
hydrog202 hydrog ? ? B G 14  N1    ? ? ? 1_555 B U  103 O2 ? ? B G 116 B U  205 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog203 hydrog ? ? B G 14  O6    ? ? ? 1_555 B U  103 N3 ? ? B G 116 B U  205 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog204 hydrog ? ? B G 15  N1    ? ? ? 1_555 B C  102 N3 ? ? B G 117 B C  204 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog205 hydrog ? ? B G 15  N2    ? ? ? 1_555 B C  102 O2 ? ? B G 117 B C  204 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog206 hydrog ? ? B G 15  O6    ? ? ? 1_555 B C  102 N4 ? ? B G 117 B C  204 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog207 hydrog ? ? B G 16  N1    ? ? ? 1_555 B C  101 N3 ? ? B G 118 B C  203 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog208 hydrog ? ? B G 16  N2    ? ? ? 1_555 B C  101 O2 ? ? B G 118 B C  203 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog209 hydrog ? ? B G 16  O6    ? ? ? 1_555 B C  101 N4 ? ? B G 118 B C  203 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog210 hydrog ? ? B G 17  N1    ? ? ? 1_555 B U  100 O2 ? ? B G 119 B U  202 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog211 hydrog ? ? B G 17  O6    ? ? ? 1_555 B U  100 N3 ? ? B G 119 B U  202 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog212 hydrog ? ? B U 18  N3    ? ? ? 1_555 B G  99  O6 ? ? B U 120 B G  201 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog213 hydrog ? ? B U 18  O2    ? ? ? 1_555 B G  99  N1 ? ? B U 120 B G  201 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog214 hydrog ? ? B C 19  N3    ? ? ? 1_555 B G  98  N1 ? ? B C 121 B G  200 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog215 hydrog ? ? B C 19  N4    ? ? ? 1_555 B G  98  O6 ? ? B C 121 B G  200 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog216 hydrog ? ? B C 19  O2    ? ? ? 1_555 B G  98  N2 ? ? B C 121 B G  200 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog217 hydrog ? ? B A 21  N1    ? ? ? 1_555 B A  96  N6 ? ? B A 123 B A  198 1_555 ? ? ? ? ? ? TYPE_5_PAIR          ?     ? 
hydrog218 hydrog ? ? B A 21  N6    ? ? ? 1_555 B A  96  N7 ? ? B A 123 B A  198 1_555 ? ? ? ? ? ? TYPE_5_PAIR          ?     ? 
hydrog219 hydrog ? ? B C 22  N4    ? ? ? 1_555 B A  94  N1 ? ? B C 124 B A  196 1_555 ? ? ? ? ? ? 'C-A MISPAIR'        ?     ? 
hydrog220 hydrog ? ? B C 22  N4    ? ? ? 1_555 B C  95  O2 ? ? B C 124 B C  197 1_555 ? ? ? ? ? ? 'C-C MISPAIR'        ?     ? 
hydrog221 hydrog ? ? B C 22  N3    ? ? ? 1_555 B G  99  N2 ? ? B C 124 B G  201 1_555 ? ? ? ? ? ? 'C-G PAIR'           ?     ? 
hydrog222 hydrog ? ? B G 24  N1    ? ? ? 1_555 B A  94  N1 ? ? B G 126 B A  196 1_555 ? ? ? ? ? ? TYPE_8_PAIR          ?     ? 
hydrog223 hydrog ? ? B G 24  O6    ? ? ? 1_555 B A  94  N6 ? ? B G 126 B A  196 1_555 ? ? ? ? ? ? TYPE_8_PAIR          ?     ? 
hydrog224 hydrog ? ? B C 25  N3    ? ? ? 1_555 B G  93  N1 ? ? B C 127 B G  195 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog225 hydrog ? ? B C 25  N4    ? ? ? 1_555 B G  93  O6 ? ? B C 127 B G  195 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog226 hydrog ? ? B C 25  O2    ? ? ? 1_555 B G  93  N2 ? ? B C 127 B G  195 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog227 hydrog ? ? B C 26  N3    ? ? ? 1_555 B G  92  N1 ? ? B C 128 B G  194 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog228 hydrog ? ? B C 26  N4    ? ? ? 1_555 B G  92  O6 ? ? B C 128 B G  194 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog229 hydrog ? ? B C 26  O2    ? ? ? 1_555 B G  92  N2 ? ? B C 128 B G  194 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog230 hydrog ? ? B G 27  N1    ? ? ? 1_555 B C  91  N3 ? ? B G 129 B C  193 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog231 hydrog ? ? B G 27  N2    ? ? ? 1_555 B C  91  O2 ? ? B G 129 B C  193 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog232 hydrog ? ? B G 27  O6    ? ? ? 1_555 B C  91  N4 ? ? B G 129 B C  193 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog233 hydrog ? ? B U 28  N3    ? ? ? 1_555 B A  90  N1 ? ? B U 130 B A  192 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog234 hydrog ? ? B U 28  O4    ? ? ? 1_555 B A  90  N6 ? ? B U 130 B A  192 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog235 hydrog ? ? B C 30  N3    ? ? ? 1_555 B G  89  N1 ? ? B C 132 B G  191 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog236 hydrog ? ? B C 30  N4    ? ? ? 1_555 B G  89  O6 ? ? B C 132 B G  191 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog237 hydrog ? ? B C 30  O2    ? ? ? 1_555 B G  89  N2 ? ? B C 132 B G  191 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog238 hydrog ? ? B A 31  N1    ? ? ? 1_555 B U  88  N3 ? ? B A 133 B U  190 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog239 hydrog ? ? B A 31  N6    ? ? ? 1_555 B U  88  O4 ? ? B A 133 B U  190 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog240 hydrog ? ? B G 32  N1    ? ? ? 1_555 B C  87  N3 ? ? B G 134 B C  189 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog241 hydrog ? ? B G 32  N2    ? ? ? 1_555 B C  87  O2 ? ? B G 134 B C  189 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog242 hydrog ? ? B G 32  O6    ? ? ? 1_555 B C  87  N4 ? ? B G 134 B C  189 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog243 hydrog ? ? B U 33  N3    ? ? ? 1_555 B A  85  N7 ? ? B U 135 B A  187 1_555 ? ? ? ? ? ? HOOGSTEEN            ?     ? 
hydrog244 hydrog ? ? B U 33  O4    ? ? ? 1_555 B A  85  N6 ? ? B U 135 B A  187 1_555 ? ? ? ? ? ? HOOGSTEEN            ?     ? 
hydrog245 hydrog ? ? B A 34  N1    ? ? ? 1_555 B U  80  N3 ? ? B A 136 B U  182 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog246 hydrog ? ? B A 34  N6    ? ? ? 1_555 B U  80  O4 ? ? B A 136 B U  182 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog247 hydrog ? ? B C 35  N3    ? ? ? 1_555 B G  79  N1 ? ? B C 137 B G  181 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog248 hydrog ? ? B C 35  N4    ? ? ? 1_555 B G  79  O6 ? ? B C 137 B G  181 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog249 hydrog ? ? B C 35  O2    ? ? ? 1_555 B G  79  N2 ? ? B C 137 B G  181 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog250 hydrog ? ? B C 36  N3    ? ? ? 1_555 B G  78  N1 ? ? B C 138 B G  180 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog251 hydrog ? ? B C 36  N4    ? ? ? 1_555 B G  78  O6 ? ? B C 138 B G  180 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog252 hydrog ? ? B C 36  O2    ? ? ? 1_555 B G  78  N2 ? ? B C 138 B G  180 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog253 hydrog ? ? B A 37  N6    ? ? ? 1_555 B G  62  N3 ? ? B A 139 B G  164 1_555 ? ? ? ? ? ? TYPE_11_PAIR         ?     ? 
hydrog254 hydrog ? ? B A 37  N7    ? ? ? 1_555 B G  62  N2 ? ? B A 139 B G  164 1_555 ? ? ? ? ? ? TYPE_11_PAIR         ?     ? 
hydrog255 hydrog ? ? B A 38  N6    ? ? ? 1_555 B G  61  N3 ? ? B A 140 B G  163 1_555 ? ? ? ? ? ? TYPE_11_PAIR         ?     ? 
hydrog256 hydrog ? ? B A 38  N7    ? ? ? 1_555 B G  61  N2 ? ? B A 140 B G  163 1_555 ? ? ? ? ? ? TYPE_11_PAIR         ?     ? 
hydrog257 hydrog ? ? B G 39  N1    ? ? ? 1_555 B U  60  O2 ? ? B G 141 B U  162 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog258 hydrog ? ? B G 39  O6    ? ? ? 1_555 B U  60  N3 ? ? B G 141 B U  162 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog259 hydrog ? ? B U 40  N3    ? ? ? 1_555 B A  59  N1 ? ? B U 142 B A  161 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog260 hydrog ? ? B U 40  O4    ? ? ? 1_555 B A  59  N6 ? ? B U 142 B A  161 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog261 hydrog ? ? B C 41  N3    ? ? ? 1_555 B G  58  N1 ? ? B C 143 B G  160 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog262 hydrog ? ? B C 41  N4    ? ? ? 1_555 B G  58  O6 ? ? B C 143 B G  160 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog263 hydrog ? ? B C 41  O2    ? ? ? 1_555 B G  58  N2 ? ? B C 143 B G  160 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog264 hydrog ? ? B U 42  N3    ? ? ? 1_555 B A  57  N1 ? ? B U 144 B A  159 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog265 hydrog ? ? B U 42  O4    ? ? ? 1_555 B A  57  N6 ? ? B U 144 B A  159 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog266 hydrog ? ? B C 43  N3    ? ? ? 1_555 B G  56  N1 ? ? B C 145 B G  158 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog267 hydrog ? ? B C 43  N4    ? ? ? 1_555 B G  56  O6 ? ? B C 145 B G  158 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog268 hydrog ? ? B C 43  O2    ? ? ? 1_555 B G  56  N2 ? ? B C 145 B G  158 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog269 hydrog ? ? B A 44  N1    ? ? ? 1_555 B U  55  N3 ? ? B A 146 B U  157 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog270 hydrog ? ? B A 44  N6    ? ? ? 1_555 B U  55  O4 ? ? B A 146 B U  157 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog271 hydrog ? ? B G 45  N1    ? ? ? 1_555 B U  54  O2 ? ? B G 147 B U  156 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog272 hydrog ? ? B G 45  O6    ? ? ? 1_555 B U  54  N3 ? ? B G 147 B U  156 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog273 hydrog ? ? B G 46  N1    ? ? ? 1_555 B U  53  O2 ? ? B G 148 B U  155 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog274 hydrog ? ? B G 46  O6    ? ? ? 1_555 B U  53  N3 ? ? B G 148 B U  155 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog275 hydrog ? ? B G 47  N1    ? ? ? 1_555 B C  52  N3 ? ? B G 149 B C  154 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog276 hydrog ? ? B G 47  N2    ? ? ? 1_555 B C  52  O2 ? ? B G 149 B C  154 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog277 hydrog ? ? B G 47  O6    ? ? ? 1_555 B C  52  N4 ? ? B G 149 B C  154 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog278 hydrog ? ? B G 48  N2    ? ? ? 1_555 B A  51  N7 ? ? B G 150 B A  153 1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ?     ? 
hydrog279 hydrog ? ? B A 49  N1    ? ? ? 1_555 B A  146 N6 ? ? B A 151 B A  248 1_555 ? ? ? ? ? ? TYPE_1_PAIR          ?     ? 
hydrog280 hydrog ? ? B A 49  N6    ? ? ? 1_555 B A  146 N1 ? ? B A 151 B A  248 1_555 ? ? ? ? ? ? TYPE_1_PAIR          ?     ? 
hydrog281 hydrog ? ? B A 51  N3    ? ? ? 1_555 B G  148 N2 ? ? B A 153 B G  250 1_555 ? ? ? ? ? ? 'A-G MISPAIR'        ?     ? 
hydrog282 hydrog ? ? B C 63  N3    ? ? ? 1_555 B G  73  N1 ? ? B C 165 B G  175 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog283 hydrog ? ? B C 63  N4    ? ? ? 1_555 B G  73  O6 ? ? B C 165 B G  175 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog284 hydrog ? ? B C 63  O2    ? ? ? 1_555 B G  73  N2 ? ? B C 165 B G  175 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog285 hydrog ? ? B C 64  N3    ? ? ? 1_555 B G  72  N1 ? ? B C 166 B G  174 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog286 hydrog ? ? B C 64  N4    ? ? ? 1_555 B G  72  O6 ? ? B C 166 B G  174 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog287 hydrog ? ? B C 64  O2    ? ? ? 1_555 B G  72  N2 ? ? B C 166 B G  174 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog288 hydrog ? ? B U 65  O4    ? ? ? 1_555 B A  71  N6 ? ? B U 167 B A  173 1_555 ? ? ? ? ? ? 'U-A PAIR'           ?     ? 
hydrog289 hydrog ? ? B U 66  O4    ? ? ? 1_555 B G  86  N2 ? ? B U 168 B G  188 1_555 ? ? ? ? ? ? 'U-G MISPAIR'        ?     ? 
hydrog290 hydrog ? ? B G 79  N2    ? ? ? 1_555 B A  84  N3 ? ? B G 181 B A  186 1_555 ? ? ? ? ? ? 'G-A MISPAIR'        ?     ? 
hydrog291 hydrog ? ? B A 82  N3    ? ? ? 1_555 B G  110 N2 ? ? B A 184 B G  212 1_555 ? ? ? ? ? ? 'A-G MISPAIR'        ?     ? 
hydrog292 hydrog ? ? B C 95  O2    ? ? ? 1_555 B G  98  N2 ? ? B C 197 B G  200 1_555 ? ? ? ? ? ? 'C-G PAIR'           ?     ? 
hydrog293 hydrog ? ? B G 118 N1    ? ? ? 1_555 B U  151 O2 ? ? B G 220 B U  253 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog294 hydrog ? ? B G 118 O6    ? ? ? 1_555 B U  151 N3 ? ? B G 220 B U  253 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog295 hydrog ? ? B U 119 N3    ? ? ? 1_555 B A  150 N1 ? ? B U 221 B A  252 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog296 hydrog ? ? B U 119 O4    ? ? ? 1_555 B A  150 N6 ? ? B U 221 B A  252 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog297 hydrog ? ? B C 120 N3    ? ? ? 1_555 B G  149 N1 ? ? B C 222 B G  251 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog298 hydrog ? ? B C 120 N4    ? ? ? 1_555 B G  149 O6 ? ? B C 222 B G  251 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog299 hydrog ? ? B C 120 O2    ? ? ? 1_555 B G  149 N2 ? ? B C 222 B G  251 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog300 hydrog ? ? B C 121 N3    ? ? ? 1_555 B G  148 N1 ? ? B C 223 B G  250 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog301 hydrog ? ? B C 121 N4    ? ? ? 1_555 B G  148 O6 ? ? B C 223 B G  250 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog302 hydrog ? ? B C 121 O2    ? ? ? 1_555 B G  148 N2 ? ? B C 223 B G  250 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog303 hydrog ? ? B U 122 N3    ? ? ? 1_555 B A  146 N7 ? ? B U 224 B A  248 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ?     ? 
hydrog304 hydrog ? ? B U 122 O2    ? ? ? 1_555 B A  146 N6 ? ? B U 224 B A  248 1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN' ?     ? 
hydrog305 hydrog ? ? B A 124 N1    ? ? ? 1_555 B U  147 N3 ? ? B A 226 B U  249 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog306 hydrog ? ? B A 124 N6    ? ? ? 1_555 B U  147 O4 ? ? B A 226 B U  249 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog307 hydrog ? ? B G 125 N1    ? ? ? 1_555 B U  145 O2 ? ? B G 227 B U  247 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog308 hydrog ? ? B G 125 O6    ? ? ? 1_555 B U  145 N3 ? ? B G 227 B U  247 1_555 ? ? ? ? ? ? TYPE_28_PAIR         ?     ? 
hydrog309 hydrog ? ? B G 125 N2    ? ? ? 1_555 B U  147 O4 ? ? B G 227 B U  249 1_555 ? ? ? ? ? ? 'G-U MISPAIR'        ?     ? 
hydrog310 hydrog ? ? B U 126 N3    ? ? ? 1_555 B A  144 N1 ? ? B U 228 B A  246 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog311 hydrog ? ? B U 126 O4    ? ? ? 1_555 B A  144 N6 ? ? B U 228 B A  246 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog312 hydrog ? ? B C 127 N3    ? ? ? 1_555 B G  143 N1 ? ? B C 229 B G  245 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog313 hydrog ? ? B C 127 N4    ? ? ? 1_555 B G  143 O6 ? ? B C 229 B G  245 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog314 hydrog ? ? B C 127 O2    ? ? ? 1_555 B G  143 N2 ? ? B C 229 B G  245 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog315 hydrog ? ? B A 128 N1    ? ? ? 1_555 B U  142 N3 ? ? B A 230 B U  244 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog316 hydrog ? ? B A 128 N6    ? ? ? 1_555 B U  142 O4 ? ? B A 230 B U  244 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog317 hydrog ? ? B A 129 N1    ? ? ? 1_555 B U  141 N3 ? ? B A 231 B U  243 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog318 hydrog ? ? B A 129 N6    ? ? ? 1_555 B U  141 O4 ? ? B A 231 B U  243 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog319 hydrog ? ? B C 130 N3    ? ? ? 1_555 B G  140 N1 ? ? B C 232 B G  242 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog320 hydrog ? ? B C 130 N4    ? ? ? 1_555 B G  140 O6 ? ? B C 232 B G  242 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog321 hydrog ? ? B C 130 O2    ? ? ? 1_555 B G  140 N2 ? ? B C 232 B G  242 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog322 hydrog ? ? B A 131 N1    ? ? ? 1_555 B U  139 N3 ? ? B A 233 B U  241 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog323 hydrog ? ? B A 131 N6    ? ? ? 1_555 B U  139 O4 ? ? B A 233 B U  241 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog324 hydrog ? ? B G 132 N1    ? ? ? 1_555 B C  138 N3 ? ? B G 234 B C  240 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog325 hydrog ? ? B G 132 N2    ? ? ? 1_555 B C  138 O2 ? ? B G 234 B C  240 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog326 hydrog ? ? B G 132 O6    ? ? ? 1_555 B C  138 N4 ? ? B G 234 B C  240 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog327 hydrog ? ? B A 133 N1    ? ? ? 1_555 B U  137 N3 ? ? B A 235 B U  239 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
hydrog328 hydrog ? ? B A 133 N6    ? ? ? 1_555 B U  137 O4 ? ? B A 235 B U  239 1_555 ? ? ? ? ? ? WATSON-CRICK         ?     ? 
# 
loop_
_struct_conn_type.id 
_struct_conn_type.criteria 
_struct_conn_type.reference 
metalc ? ? 
hydrog ? ? 
# 
loop_
_struct_site.id 
_struct_site.pdbx_evidence_code 
_struct_site.pdbx_auth_asym_id 
_struct_site.pdbx_auth_comp_id 
_struct_site.pdbx_auth_seq_id 
_struct_site.pdbx_auth_ins_code 
_struct_site.pdbx_num_residues 
_struct_site.details 
AC1 Software A MG 301 ? 2 'binding site for residue MG A 301' 
AC2 Software A MG 302 ? 3 'binding site for residue MG A 302' 
AC3 Software A MG 303 ? 4 'binding site for residue MG A 303' 
AC4 Software A MG 304 ? 2 'binding site for residue MG A 304' 
AC5 Software A MG 305 ? 1 'binding site for residue MG A 305' 
AC6 Software A MG 306 ? 1 'binding site for residue MG A 306' 
AC7 Software A MG 308 ? 3 'binding site for residue MG A 308' 
AC8 Software A MG 309 ? 1 'binding site for residue MG A 309' 
AC9 Software A MG 310 ? 1 'binding site for residue MG A 310' 
AD1 Software B MG 301 ? 2 'binding site for residue MG B 301' 
AD2 Software B MG 302 ? 3 'binding site for residue MG B 302' 
AD3 Software B MG 303 ? 3 'binding site for residue MG B 303' 
AD4 Software B MG 304 ? 2 'binding site for residue MG B 304' 
AD5 Software B MG 305 ? 1 'binding site for residue MG B 305' 
AD6 Software B MG 306 ? 1 'binding site for residue MG B 306' 
AD7 Software B MG 307 ? 1 'binding site for residue MG B 307' 
AD8 Software B MG 308 ? 2 'binding site for residue MG B 308' 
AD9 Software B MG 309 ? 3 'binding site for residue MG B 309' 
# 
loop_
_struct_site_gen.id 
_struct_site_gen.site_id 
_struct_site_gen.pdbx_num_res 
_struct_site_gen.label_comp_id 
_struct_site_gen.label_asym_id 
_struct_site_gen.label_seq_id 
_struct_site_gen.pdbx_auth_ins_code 
_struct_site_gen.auth_comp_id 
_struct_site_gen.auth_asym_id 
_struct_site_gen.auth_seq_id 
_struct_site_gen.label_atom_id 
_struct_site_gen.label_alt_id 
_struct_site_gen.symmetry 
_struct_site_gen.details 
1  AC1 2 U A 66  ? U A 168 . ? 1_555 ? 
2  AC1 2 G A 86  ? G A 188 . ? 1_555 ? 
3  AC2 3 A A 81  ? A A 183 . ? 1_555 ? 
4  AC2 3 A A 82  ? A A 184 . ? 1_555 ? 
5  AC2 3 A A 84  ? A A 186 . ? 1_555 ? 
6  AC3 4 A A 82  ? A A 184 . ? 1_555 ? 
7  AC3 4 A A 84  ? A A 186 . ? 1_555 ? 
8  AC3 4 A A 85  ? A A 187 . ? 1_555 ? 
9  AC3 4 G A 86  ? G A 188 . ? 1_555 ? 
10 AC4 2 G A 61  ? G A 163 . ? 1_555 ? 
11 AC4 2 G A 62  ? G A 164 . ? 1_555 ? 
12 AC5 1 A A 69  ? A A 171 . ? 1_555 ? 
13 AC6 1 A A 71  ? A A 173 . ? 1_555 ? 
14 AC7 3 A A 146 ? A A 248 . ? 1_555 ? 
15 AC7 3 U A 147 ? U A 249 . ? 1_555 ? 
16 AC7 3 G A 148 ? G A 250 . ? 1_555 ? 
17 AC8 1 U A 40  ? U A 142 . ? 1_555 ? 
18 AC9 1 G A 10  ? G A 112 . ? 1_555 ? 
19 AD1 2 U B 66  ? U B 168 . ? 1_555 ? 
20 AD1 2 G B 86  ? G B 188 . ? 1_555 ? 
21 AD2 3 A B 81  ? A B 183 . ? 1_555 ? 
22 AD2 3 A B 82  ? A B 184 . ? 1_555 ? 
23 AD2 3 A B 84  ? A B 186 . ? 1_555 ? 
24 AD3 3 A B 82  ? A B 184 . ? 1_555 ? 
25 AD3 3 A B 84  ? A B 186 . ? 1_555 ? 
26 AD3 3 A B 85  ? A B 187 . ? 1_555 ? 
27 AD4 2 G B 61  ? G B 163 . ? 1_555 ? 
28 AD4 2 G B 62  ? G B 164 . ? 1_555 ? 
29 AD5 1 C B 101 ? C B 203 . ? 1_555 ? 
30 AD6 1 A B 69  ? A B 171 . ? 1_555 ? 
31 AD7 1 G B 10  ? G B 112 . ? 1_555 ? 
32 AD8 2 A B 71  ? A B 173 . ? 1_555 ? 
33 AD8 2 G B 72  ? G B 174 . ? 1_555 ? 
34 AD9 3 A B 146 ? A B 248 . ? 1_555 ? 
35 AD9 3 U B 147 ? U B 249 . ? 1_555 ? 
36 AD9 3 G B 148 ? G B 250 . ? 1_555 ? 
# 
_atom_sites.entry_id                    6BJX 
_atom_sites.fract_transf_matrix[1][1]   0.013392 
_atom_sites.fract_transf_matrix[1][2]   0.000000 
_atom_sites.fract_transf_matrix[1][3]   0.000000 
_atom_sites.fract_transf_matrix[2][1]   0.000000 
_atom_sites.fract_transf_matrix[2][2]   0.007692 
_atom_sites.fract_transf_matrix[2][3]   0.000000 
_atom_sites.fract_transf_matrix[3][1]   0.000000 
_atom_sites.fract_transf_matrix[3][2]   0.000000 
_atom_sites.fract_transf_matrix[3][3]   0.006830 
_atom_sites.fract_transf_vector[1]      0.00000 
_atom_sites.fract_transf_vector[2]      0.00000 
_atom_sites.fract_transf_vector[3]      0.00000 
# 
loop_
_atom_type.symbol 
_atom_type.scat_dispersion_real 
_atom_type.scat_dispersion_imag 
_atom_type.scat_Cromer_Mann_a1 
_atom_type.scat_Cromer_Mann_a2 
_atom_type.scat_Cromer_Mann_b1 
_atom_type.scat_Cromer_Mann_b2 
_atom_type.scat_Cromer_Mann_c 
_atom_type.scat_source 
_atom_type.scat_dispersion_source 
C    ? ? 3.54356 2.42580 25.62398 1.50364  0.0 
;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31.
;
? 
MG   ? ? ?       ?       ?        ?        ?   ? ? 
MG2+ ? ? 9.95820 ?       3.10187  ?        0.0 
;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31.
;
? 
N    ? ? 6.96715 ?       11.43723 ?        0.0 
;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31.
;
? 
O    ? ? 7.96527 ?       9.05267  ?        0.0 
;1-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31.
;
? 
P    ? ? 9.51135 5.44231 1.42069  35.72801 0.0 
;2-Gaussian fit: Grosse-Kunstleve RW, Sauter NK, Adams PD: Newsletter of the IUCr Commission on Crystallographic Computing 2004, 3, 22-31.
;
? 
# 
loop_
_atom_site.group_PDB 
_atom_site.id 
_atom_site.type_symbol 
_atom_site.label_atom_id 
_atom_site.label_alt_id 
_atom_site.label_comp_id 
_atom_site.label_asym_id 
_atom_site.label_entity_id 
_atom_site.label_seq_id 
_atom_site.pdbx_PDB_ins_code 
_atom_site.Cartn_x 
_atom_site.Cartn_y 
_atom_site.Cartn_z 
_atom_site.occupancy 
_atom_site.B_iso_or_equiv 
_atom_site.pdbx_formal_charge 
_atom_site.auth_seq_id 
_atom_site.auth_comp_id 
_atom_site.auth_asym_id 
_atom_site.auth_atom_id 
_atom_site.pdbx_PDB_model_num 
ATOM   1    O  OP3   . G  A 1 1   ? 58.52300 49.08400 86.41300  1.000 185.90264 ? 103 G  A OP3   1 
ATOM   2    P  P     . G  A 1 1   ? 57.85900 48.16300 85.46000  1.000 197.60404 ? 103 G  A P     1 
ATOM   3    O  OP1   . G  A 1 1   ? 57.88100 48.80400 84.12200  1.000 177.25949 ? 103 G  A OP1   1 
ATOM   4    O  OP2   . G  A 1 1   ? 58.49200 46.82900 85.62100  1.000 190.92166 ? 103 G  A OP2   1 
ATOM   5    O  "O5'" . G  A 1 1   ? 56.32800 47.99900 85.87500  1.000 187.37386 ? 103 G  A "O5'" 1 
ATOM   6    C  "C5'" . G  A 1 1   ? 55.59100 49.08400 86.42700  1.000 178.83600 ? 103 G  A "C5'" 1 
ATOM   7    C  "C4'" . G  A 1 1   ? 55.72000 49.14400 87.93100  1.000 181.97322 ? 103 G  A "C4'" 1 
ATOM   8    O  "O4'" . G  A 1 1   ? 55.95500 50.51800 88.35300  1.000 175.37243 ? 103 G  A "O4'" 1 
ATOM   9    C  "C3'" . G  A 1 1   ? 54.49900 48.73200 88.74200  1.000 183.10230 ? 103 G  A "C3'" 1 
ATOM   10   O  "O3'" . G  A 1 1   ? 54.29000 47.33100 88.83900  1.000 189.34252 ? 103 G  A "O3'" 1 
ATOM   11   C  "C2'" . G  A 1 1   ? 54.76500 49.40800 90.07800  1.000 177.86746 ? 103 G  A "C2'" 1 
ATOM   12   O  "O2'" . G  A 1 1   ? 55.76600 48.70600 90.80000  1.000 170.71924 ? 103 G  A "O2'" 1 
ATOM   13   C  "C1'" . G  A 1 1   ? 55.35100 50.74000 89.61500  1.000 172.78790 ? 103 G  A "C1'" 1 
ATOM   14   N  N9    . G  A 1 1   ? 54.29800 51.76800 89.47500  1.000 172.48787 ? 103 G  A N9    1 
ATOM   15   C  C8    . G  A 1 1   ? 53.95300 52.46600 88.34000  1.000 165.86076 ? 103 G  A C8    1 
ATOM   16   N  N7    . G  A 1 1   ? 52.96800 53.30200 88.53300  1.000 165.81865 ? 103 G  A N7    1 
ATOM   17   C  C5    . G  A 1 1   ? 52.63800 53.14600 89.87200  1.000 172.07466 ? 103 G  A C5    1 
ATOM   18   C  C6    . G  A 1 1   ? 51.64000 53.79400 90.64800  1.000 169.52699 ? 103 G  A C6    1 
ATOM   19   O  O6    . G  A 1 1   ? 50.82200 54.65900 90.30600  1.000 167.18460 ? 103 G  A O6    1 
ATOM   20   N  N1    . G  A 1 1   ? 51.64700 53.34100 91.96400  1.000 167.00300 ? 103 G  A N1    1 
ATOM   21   C  C2    . G  A 1 1   ? 52.49600 52.38900 92.47300  1.000 169.70859 ? 103 G  A C2    1 
ATOM   22   N  N2    . G  A 1 1   ? 52.35000 52.08100 93.77200  1.000 170.04547 ? 103 G  A N2    1 
ATOM   23   N  N3    . G  A 1 1   ? 53.42700 51.78100 91.75700  1.000 169.41118 ? 103 G  A N3    1 
ATOM   24   C  C4    . G  A 1 1   ? 53.44700 52.20300 90.47100  1.000 172.81686 ? 103 G  A C4    1 
ATOM   25   P  P     . A  A 1 2   ? 52.80700 46.73700 88.62800  1.000 197.05184 ? 104 A  A P     1 
ATOM   26   O  OP1   . A  A 1 2   ? 52.89200 45.55600 87.73100  1.000 191.91439 ? 104 A  A OP1   1 
ATOM   27   O  OP2   . A  A 1 2   ? 51.92900 47.86900 88.24200  1.000 188.41923 ? 104 A  A OP2   1 
ATOM   28   O  "O5'" . A  A 1 2   ? 52.33800 46.24500 90.07400  1.000 189.68780 ? 104 A  A "O5'" 1 
ATOM   29   C  "C5'" . A  A 1 2   ? 53.07500 46.55600 91.24900  1.000 190.13259 ? 104 A  A "C5'" 1 
ATOM   30   C  "C4'" . A  A 1 2   ? 52.19900 47.11800 92.34500  1.000 192.69606 ? 104 A  A "C4'" 1 
ATOM   31   O  "O4'" . A  A 1 2   ? 51.98800 48.54000 92.15100  1.000 185.57415 ? 104 A  A "O4'" 1 
ATOM   32   C  "C3'" . A  A 1 2   ? 50.79300 46.55300 92.47200  1.000 200.18380 ? 104 A  A "C3'" 1 
ATOM   33   O  "O3'" . A  A 1 2   ? 50.77900 45.31300 93.16900  1.000 209.63756 ? 104 A  A "O3'" 1 
ATOM   34   C  "C2'" . A  A 1 2   ? 50.02900 47.66000 93.20500  1.000 198.25199 ? 104 A  A "C2'" 1 
ATOM   35   O  "O2'" . A  A 1 2   ? 50.16900 47.53100 94.61200  1.000 200.72071 ? 104 A  A "O2'" 1 
ATOM   36   C  "C1'" . A  A 1 2   ? 50.77500 48.92500 92.75600  1.000 185.91630 ? 104 A  A "C1'" 1 
ATOM   37   N  N9    . A  A 1 2   ? 50.00300 49.78700 91.83200  1.000 181.10256 ? 104 A  A N9    1 
ATOM   38   C  C8    . A  A 1 2   ? 50.31900 50.13000 90.54200  1.000 178.15221 ? 104 A  A C8    1 
ATOM   39   N  N7    . A  A 1 2   ? 49.45400 50.94100 89.98100  1.000 175.72560 ? 104 A  A N7    1 
ATOM   40   C  C5    . A  A 1 2   ? 48.50900 51.16500 90.96900  1.000 176.70467 ? 104 A  A C5    1 
ATOM   41   C  C6    . A  A 1 2   ? 47.33700 51.94300 90.99200  1.000 173.82538 ? 104 A  A C6    1 
ATOM   42   N  N6    . A  A 1 2   ? 46.90700 52.66300 89.95700  1.000 170.38023 ? 104 A  A N6    1 
ATOM   43   N  N1    . A  A 1 2   ? 46.61100 51.96100 92.12700  1.000 175.70981 ? 104 A  A N1    1 
ATOM   44   C  C2    . A  A 1 2   ? 47.04800 51.23400 93.16100  1.000 176.98102 ? 104 A  A C2    1 
ATOM   45   N  N3    . A  A 1 2   ? 48.13400 50.46600 93.26500  1.000 182.23691 ? 104 A  A N3    1 
ATOM   46   C  C4    . A  A 1 2   ? 48.83800 50.47000 92.11900  1.000 182.04478 ? 104 A  A C4    1 
ATOM   47   P  P     . A  A 1 3   ? 49.69500 44.17800 92.82200  1.000 218.30154 ? 105 A  A P     1 
ATOM   48   O  OP1   . A  A 1 3   ? 49.36300 43.47800 94.09000  1.000 211.15332 ? 105 A  A OP1   1 
ATOM   49   O  OP2   . A  A 1 3   ? 50.18800 43.39900 91.65600  1.000 208.85831 ? 105 A  A OP2   1 
ATOM   50   O  "O5'" . A  A 1 3   ? 48.40300 44.99500 92.38000  1.000 205.78162 ? 105 A  A "O5'" 1 
ATOM   51   C  "C5'" . A  A 1 3   ? 47.10200 44.48200 92.63900  1.000 205.56054 ? 105 A  A "C5'" 1 
ATOM   52   C  "C4'" . A  A 1 3   ? 46.36400 45.33100 93.64300  1.000 204.34724 ? 105 A  A "C4'" 1 
ATOM   53   O  "O4'" . A  A 1 3   ? 46.50500 46.72600 93.26400  1.000 197.27007 ? 105 A  A "O4'" 1 
ATOM   54   C  "C3'" . A  A 1 3   ? 44.86700 45.06100 93.73100  1.000 206.18167 ? 105 A  A "C3'" 1 
ATOM   55   O  "O3'" . A  A 1 3   ? 44.41100 45.29300 95.06600  1.000 211.08226 ? 105 A  A "O3'" 1 
ATOM   56   C  "C2'" . A  A 1 3   ? 44.28300 46.10300 92.77900  1.000 201.80483 ? 105 A  A "C2'" 1 
ATOM   57   O  "O2'" . A  A 1 3   ? 42.94700 46.46700 93.05300  1.000 203.30501 ? 105 A  A "O2'" 1 
ATOM   58   C  "C1'" . A  A 1 3   ? 45.23800 47.28200 92.96600  1.000 197.07795 ? 105 A  A "C1'" 1 
ATOM   59   N  N9    . A  A 1 3   ? 45.39200 48.11000 91.76500  1.000 190.70087 ? 105 A  A N9    1 
ATOM   60   C  C8    . A  A 1 3   ? 46.36400 48.00600 90.80000  1.000 185.77659 ? 105 A  A C8    1 
ATOM   61   N  N7    . A  A 1 3   ? 46.25500 48.89000 89.83900  1.000 182.29459 ? 105 A  A N7    1 
ATOM   62   C  C5    . A  A 1 3   ? 45.14100 49.63200 90.19700  1.000 180.91811 ? 105 A  A C5    1 
ATOM   63   C  C6    . A  A 1 3   ? 44.49500 50.72300 89.59100  1.000 174.45681 ? 105 A  A C6    1 
ATOM   64   N  N6    . A  A 1 3   ? 44.89500 51.28600 88.44900  1.000 171.78281 ? 105 A  A N6    1 
ATOM   65   N  N1    . A  A 1 3   ? 43.40700 51.22800 90.20900  1.000 172.67765 ? 105 A  A N1    1 
ATOM   66   C  C2    . A  A 1 3   ? 43.00400 50.66500 91.35500  1.000 175.69380 ? 105 A  A C2    1 
ATOM   67   N  N3    . A  A 1 3   ? 43.52400 49.64000 92.02300  1.000 181.05497 ? 105 A  A N3    1 
ATOM   68   C  C4    . A  A 1 3   ? 44.60500 49.16800 91.38500  1.000 184.73436 ? 105 A  A C4    1 
ATOM   69   P  P     . U  A 1 4   ? 43.93800 44.06000 95.98800  1.000 221.59080 ? 106 U  A P     1 
ATOM   70   O  OP1   . U  A 1 4   ? 43.49500 44.59200 97.30200  1.000 218.19829 ? 106 U  A OP1   1 
ATOM   71   O  OP2   . U  A 1 4   ? 44.99400 43.01800 95.94800  1.000 215.72694 ? 106 U  A OP2   1 
ATOM   72   O  "O5'" . U  A 1 4   ? 42.65400 43.48700 95.23700  1.000 210.09732 ? 106 U  A "O5'" 1 
ATOM   73   C  "C5'" . U  A 1 4   ? 41.39000 44.13700 95.33600  1.000 209.56568 ? 106 U  A "C5'" 1 
ATOM   74   C  "C4'" . U  A 1 4   ? 40.68300 44.19400 94.00300  1.000 215.56903 ? 106 U  A "C4'" 1 
ATOM   75   O  "O4'" . U  A 1 4   ? 40.45800 42.83900 93.52700  1.000 221.85136 ? 106 U  A "O4'" 1 
ATOM   76   C  "C3'" . U  A 1 4   ? 39.31400 44.87100 94.01900  1.000 214.16623 ? 106 U  A "C3'" 1 
ATOM   77   O  "O3'" . U  A 1 4   ? 39.09900 45.53900 92.77700  1.000 211.17377 ? 106 U  A "O3'" 1 
ATOM   78   C  "C2'" . U  A 1 4   ? 38.35500 43.69200 94.13200  1.000 214.35046 ? 106 U  A "C2'" 1 
ATOM   79   O  "O2'" . U  A 1 4   ? 37.05400 43.94100 93.64500  1.000 202.72012 ? 106 U  A "O2'" 1 
ATOM   80   C  "C1'" . U  A 1 4   ? 39.07700 42.63300 93.30200  1.000 220.67490 ? 106 U  A "C1'" 1 
ATOM   81   N  N1    . U  A 1 4   ? 38.74500 41.26200 93.70500  1.000 223.86739 ? 106 U  A N1    1 
ATOM   82   C  C2    . U  A 1 4   ? 38.03100 40.48100 92.81600  1.000 222.63040 ? 106 U  A C2    1 
ATOM   83   O  O2    . U  A 1 4   ? 37.67600 40.87800 91.71700  1.000 216.46651 ? 106 U  A O2    1 
ATOM   84   N  N3    . U  A 1 4   ? 37.75200 39.21300 93.26700  1.000 224.95173 ? 106 U  A N3    1 
ATOM   85   C  C4    . U  A 1 4   ? 38.10700 38.66900 94.48700  1.000 224.09374 ? 106 U  A C4    1 
ATOM   86   O  O4    . U  A 1 4   ? 37.78300 37.50900 94.75000  1.000 224.84909 ? 106 U  A O4    1 
ATOM   87   C  C5    . U  A 1 4   ? 38.84200 39.54700 95.34700  1.000 224.75697 ? 106 U  A C5    1 
ATOM   88   C  C6    . U  A 1 4   ? 39.12800 40.78500 94.93600  1.000 222.08034 ? 106 U  A C6    1 
ATOM   89   P  P     . U  A 1 5   ? 39.21900 47.13900 92.69500  1.000 206.47790 ? 107 U  A P     1 
ATOM   90   O  OP1   . U  A 1 5   ? 40.42200 47.47300 91.88800  1.000 190.61547 ? 107 U  A OP1   1 
ATOM   91   O  OP2   . U  A 1 5   ? 39.08200 47.66900 94.07700  1.000 197.26627 ? 107 U  A OP2   1 
ATOM   92   O  "O5'" . U  A 1 5   ? 37.92800 47.58500 91.87300  1.000 188.80736 ? 107 U  A "O5'" 1 
ATOM   93   C  "C5'" . U  A 1 5   ? 36.70100 47.84600 92.53800  1.000 182.33027 ? 107 U  A "C5'" 1 
ATOM   94   C  "C4'" . U  A 1 5   ? 36.20700 49.24500 92.26700  1.000 176.80066 ? 107 U  A "C4'" 1 
ATOM   95   O  "O4'" . U  A 1 5   ? 37.32900 50.16600 92.22400  1.000 177.30861 ? 107 U  A "O4'" 1 
ATOM   96   C  "C3'" . U  A 1 5   ? 35.49600 49.47200 90.94200  1.000 169.78403 ? 107 U  A "C3'" 1 
ATOM   97   O  "O3'" . U  A 1 5   ? 34.14300 49.03900 90.96300  1.000 168.38386 ? 107 U  A "O3'" 1 
ATOM   98   C  "C2'" . U  A 1 5   ? 35.65600 50.97500 90.74000  1.000 165.09662 ? 107 U  A "C2'" 1 
ATOM   99   O  "O2'" . U  A 1 5   ? 34.72600 51.69200 91.53900  1.000 159.44068 ? 107 U  A "O2'" 1 
ATOM   100  C  "C1'" . U  A 1 5   ? 37.05900 51.20800 91.30600  1.000 171.68162 ? 107 U  A "C1'" 1 
ATOM   101  N  N1    . U  A 1 5   ? 38.09900 51.19800 90.24900  1.000 166.04674 ? 107 U  A N1    1 
ATOM   102  C  C2    . U  A 1 5   ? 38.21600 52.29700 89.40900  1.000 159.72493 ? 107 U  A C2    1 
ATOM   103  O  O2    . U  A 1 5   ? 37.50200 53.28200 89.48500  1.000 156.23767 ? 107 U  A O2    1 
ATOM   104  N  N3    . U  A 1 5   ? 39.20500 52.20000 88.46100  1.000 159.28540 ? 107 U  A N3    1 
ATOM   105  C  C4    . U  A 1 5   ? 40.07300 51.14100 88.27200  1.000 163.19639 ? 107 U  A C4    1 
ATOM   106  O  O4    . U  A 1 5   ? 40.91900 51.19700 87.37700  1.000 160.95402 ? 107 U  A O4    1 
ATOM   107  C  C5    . U  A 1 5   ? 39.89100 50.05100 89.18000  1.000 169.59979 ? 107 U  A C5    1 
ATOM   108  C  C6    . U  A 1 5   ? 38.93400 50.11600 90.10900  1.000 168.08909 ? 107 U  A C6    1 
ATOM   109  P  P     . G  A 1 6   ? 33.37300 48.65800 89.60200  1.000 168.44811 ? 108 G  A P     1 
ATOM   110  O  OP1   . G  A 1 6   ? 32.05200 48.09600 89.97900  1.000 176.75174 ? 108 G  A OP1   1 
ATOM   111  O  OP2   . G  A 1 6   ? 34.27100 47.85300 88.74200  1.000 169.12187 ? 108 G  A OP2   1 
ATOM   112  O  "O5'" . G  A 1 6   ? 33.12500 50.06400 88.89800  1.000 158.12845 ? 108 G  A "O5'" 1 
ATOM   113  C  "C5'" . G  A 1 6   ? 32.34100 51.06000 89.54100  1.000 152.91204 ? 108 G  A "C5'" 1 
ATOM   114  C  "C4'" . G  A 1 6   ? 32.32000 52.35800 88.77500  1.000 144.99530 ? 108 G  A "C4'" 1 
ATOM   115  O  "O4'" . G  A 1 6   ? 33.65100 52.93800 88.72000  1.000 149.49057 ? 108 G  A "O4'" 1 
ATOM   116  C  "C3'" . G  A 1 6   ? 31.89900 52.27300 87.31900  1.000 135.80209 ? 108 G  A "C3'" 1 
ATOM   117  O  "O3'" . G  A 1 6   ? 30.49100 52.17100 87.15800  1.000 131.53316 ? 108 G  A "O3'" 1 
ATOM   118  C  "C2'" . G  A 1 6   ? 32.49900 53.54400 86.73000  1.000 140.06839 ? 108 G  A "C2'" 1 
ATOM   119  O  "O2'" . G  A 1 6   ? 31.70100 54.67400 87.04700  1.000 138.20764 ? 108 G  A "O2'" 1 
ATOM   120  C  "C1'" . G  A 1 6   ? 33.81300 53.64300 87.50800  1.000 143.93201 ? 108 G  A "C1'" 1 
ATOM   121  N  N9    . G  A 1 6   ? 34.92800 53.04200 86.75400  1.000 143.04506 ? 108 G  A N9    1 
ATOM   122  C  C8    . G  A 1 6   ? 35.43700 51.77400 86.88100  1.000 149.35371 ? 108 G  A C8    1 
ATOM   123  N  N7    . G  A 1 6   ? 36.42100 51.53900 86.05800  1.000 148.66416 ? 108 G  A N7    1 
ATOM   124  C  C5    . G  A 1 6   ? 36.56300 52.72200 85.34400  1.000 139.72888 ? 108 G  A C5    1 
ATOM   125  C  C6    . G  A 1 6   ? 37.46900 53.06700 84.30900  1.000 133.20967 ? 108 G  A C6    1 
ATOM   126  O  O6    . G  A 1 6   ? 38.35800 52.36800 83.80700  1.000 136.00211 ? 108 G  A O6    1 
ATOM   127  N  N1    . G  A 1 6   ? 37.26500 54.37000 83.86200  1.000 124.34808 ? 108 G  A N1    1 
ATOM   128  C  C2    . G  A 1 6   ? 36.30900 55.22900 84.34800  1.000 124.87183 ? 108 G  A C2    1 
ATOM   129  N  N2    . G  A 1 6   ? 36.26300 56.45000 83.79400  1.000 119.92124 ? 108 G  A N2    1 
ATOM   130  N  N3    . G  A 1 6   ? 35.46100 54.92000 85.31500  1.000 131.13311 ? 108 G  A N3    1 
ATOM   131  C  C4    . G  A 1 6   ? 35.64400 53.65900 85.76000  1.000 137.32332 ? 108 G  A C4    1 
ATOM   132  P  P     . C  A 1 7   ? 29.86100 51.40500 85.89000  1.000 139.04556 ? 109 C  A P     1 
ATOM   133  O  OP1   . C  A 1 7   ? 28.61200 50.74000 86.33600  1.000 150.21006 ? 109 C  A OP1   1 
ATOM   134  O  OP2   . C  A 1 7   ? 30.92300 50.60400 85.23000  1.000 137.98754 ? 109 C  A OP2   1 
ATOM   135  O  "O5'" . C  A 1 7   ? 29.43800 52.58000 84.90200  1.000 134.08444 ? 109 C  A "O5'" 1 
ATOM   136  C  "C5'" . C  A 1 7   ? 29.76500 52.51900 83.52200  1.000 127.24678 ? 109 C  A "C5'" 1 
ATOM   137  C  "C4'" . C  A 1 7   ? 30.49900 53.75800 83.07700  1.000 120.96708 ? 109 C  A "C4'" 1 
ATOM   138  O  "O4'" . C  A 1 7   ? 31.83300 53.77100 83.64900  1.000 126.69145 ? 109 C  A "O4'" 1 
ATOM   139  C  "C3'" . C  A 1 7   ? 30.73700 53.88400 81.58200  1.000 110.66058 ? 109 C  A "C3'" 1 
ATOM   140  O  "O3'" . C  A 1 7   ? 29.60200 54.37900 80.89600  1.000 108.35504 ? 109 C  A "O3'" 1 
ATOM   141  C  "C2'" . C  A 1 7   ? 31.94700 54.80500 81.51400  1.000 114.88740 ? 109 C  A "C2'" 1 
ATOM   142  O  "O2'" . C  A 1 7   ? 31.56000 56.15800 81.71400  1.000 112.75293 ? 109 C  A "O2'" 1 
ATOM   143  C  "C1'" . C  A 1 7   ? 32.74600 54.34700 82.73800  1.000 122.15143 ? 109 C  A "C1'" 1 
ATOM   144  N  N1    . C  A 1 7   ? 33.77800 53.33600 82.40000  1.000 122.42515 ? 109 C  A N1    1 
ATOM   145  C  C2    . C  A 1 7   ? 34.89400 53.68900 81.63300  1.000 117.14557 ? 109 C  A C2    1 
ATOM   146  O  O2    . C  A 1 7   ? 35.00900 54.85500 81.23100  1.000 115.77698 ? 109 C  A O2    1 
ATOM   147  N  N3    . C  A 1 7   ? 35.82100 52.75000 81.33600  1.000 121.25659 ? 109 C  A N3    1 
ATOM   148  C  C4    . C  A 1 7   ? 35.67600 51.50000 81.77800  1.000 123.24367 ? 109 C  A C4    1 
ATOM   149  N  N4    . C  A 1 7   ? 36.62100 50.61000 81.45800  1.000 129.10489 ? 109 C  A N4    1 
ATOM   150  C  C5    . C  A 1 7   ? 34.55300 51.11000 82.56500  1.000 132.00524 ? 109 C  A C5    1 
ATOM   151  C  C6    . C  A 1 7   ? 33.64500 52.05200 82.84700  1.000 130.22082 ? 109 C  A C6    1 
ATOM   152  P  P     . G  A 1 8   ? 29.03000 53.60100 79.61600  1.000 117.13100 ? 110 G  A P     1 
ATOM   153  O  OP1   . G  A 1 8   ? 27.63200 54.05100 79.42200  1.000 108.02201 ? 110 G  A OP1   1 
ATOM   154  O  OP2   . G  A 1 8   ? 29.33300 52.15600 79.76200  1.000 115.82295 ? 110 G  A OP2   1 
ATOM   155  O  "O5'" . G  A 1 8   ? 29.89900 54.18200 78.41600  1.000 112.01986 ? 110 G  A "O5'" 1 
ATOM   156  C  "C5'" . G  A 1 8   ? 30.06900 55.58400 78.26700  1.000 106.26391 ? 110 G  A "C5'" 1 
ATOM   157  C  "C4'" . G  A 1 8   ? 31.16800 55.91100 77.28900  1.000 100.49479 ? 110 G  A "C4'" 1 
ATOM   158  O  "O4'" . G  A 1 8   ? 32.45800 55.59300 77.86500  1.000 103.29776 ? 110 G  A "O4'" 1 
ATOM   159  C  "C3'" . G  A 1 8   ? 31.15200 55.13100 75.98800  1.000 99.41572  ? 110 G  A "C3'" 1 
ATOM   160  O  "O3'" . G  A 1 8   ? 30.21700 55.63600 75.05800  1.000 96.18638  ? 110 G  A "O3'" 1 
ATOM   161  C  "C2'" . G  A 1 8   ? 32.59200 55.24800 75.51900  1.000 100.81062 ? 110 G  A "C2'" 1 
ATOM   162  O  "O2'" . G  A 1 8   ? 32.82100 56.52500 74.94400  1.000 104.08470 ? 110 G  A "O2'" 1 
ATOM   163  C  "C1'" . G  A 1 8   ? 33.34200 55.17100 76.84800  1.000 99.63943  ? 110 G  A "C1'" 1 
ATOM   164  N  N9    . G  A 1 8   ? 33.78400 53.80000 77.15300  1.000 98.92882  ? 110 G  A N9    1 
ATOM   165  C  C8    . G  A 1 8   ? 33.26500 52.94600 78.09300  1.000 103.99785 ? 110 G  A C8    1 
ATOM   166  N  N7    . G  A 1 8   ? 33.88100 51.79500 78.13000  1.000 106.77976 ? 110 G  A N7    1 
ATOM   167  C  C5    . G  A 1 8   ? 34.86300 51.89700 77.15500  1.000 100.38162 ? 110 G  A C5    1 
ATOM   168  C  C6    . G  A 1 8   ? 35.84500 50.96500 76.73300  1.000 101.92918 ? 110 G  A C6    1 
ATOM   169  O  O6    . G  A 1 8   ? 36.04600 49.82200 77.15600  1.000 102.34765 ? 110 G  A O6    1 
ATOM   170  N  N1    . G  A 1 8   ? 36.64100 51.47900 75.71400  1.000 102.42397 ? 110 G  A N1    1 
ATOM   171  C  C2    . G  A 1 8   ? 36.50900 52.73200 75.17100  1.000 99.77629  ? 110 G  A C2    1 
ATOM   172  N  N2    . G  A 1 8   ? 37.37200 53.04300 74.19500  1.000 94.17035  ? 110 G  A N2    1 
ATOM   173  N  N3    . G  A 1 8   ? 35.60000 53.61500 75.55400  1.000 102.70559 ? 110 G  A N3    1 
ATOM   174  C  C4    . G  A 1 8   ? 34.81500 53.13100 76.54200  1.000 100.62376 ? 110 G  A C4    1 
ATOM   175  P  P     . G  A 1 9   ? 29.41600 54.62700 74.10800  1.000 94.20155  ? 111 G  A P     1 
ATOM   176  O  OP1   . G  A 1 9   ? 28.39200 55.42800 73.38600  1.000 94.24892  ? 111 G  A OP1   1 
ATOM   177  O  OP2   . G  A 1 9   ? 29.01200 53.45600 74.92600  1.000 98.23887  ? 111 G  A OP2   1 
ATOM   178  O  "O5'" . G  A 1 9   ? 30.51600 54.15600 73.05800  1.000 102.27620 ? 111 G  A "O5'" 1 
ATOM   179  C  "C5'" . G  A 1 9   ? 31.17600 55.11100 72.24000  1.000 102.36305 ? 111 G  A "C5'" 1 
ATOM   180  C  "C4'" . G  A 1 9   ? 32.37200 54.51800 71.54200  1.000 98.71261  ? 111 G  A "C4'" 1 
ATOM   181  O  "O4'" . G  A 1 9   ? 33.37200 54.13300 72.51700  1.000 96.73343  ? 111 G  A "O4'" 1 
ATOM   182  C  "C3'" . G  A 1 9   ? 32.12000 53.24200 70.76000  1.000 105.57923 ? 111 G  A "C3'" 1 
ATOM   183  O  "O3'" . G  A 1 9   ? 31.53000 53.47400 69.49600  1.000 104.01062 ? 111 G  A "O3'" 1 
ATOM   184  C  "C2'" . G  A 1 9   ? 33.50800 52.62200 70.68800  1.000 106.78463 ? 111 G  A "C2'" 1 
ATOM   185  O  "O2'" . G  A 1 9   ? 34.29500 53.25900 69.69200  1.000 113.32752 ? 111 G  A "O2'" 1 
ATOM   186  C  "C1'" . G  A 1 9   ? 34.07100 52.99200 72.06100  1.000 102.23146 ? 111 G  A "C1'" 1 
ATOM   187  N  N9    . G  A 1 9   ? 33.89100 51.90100 73.03700  1.000 95.88333  ? 111 G  A N9    1 
ATOM   188  C  C8    . G  A 1 9   ? 32.95900 51.82000 74.04000  1.000 95.22799  ? 111 G  A C8    1 
ATOM   189  N  N7    . G  A 1 9   ? 33.05400 50.72000 74.73700  1.000 99.61009  ? 111 G  A N7    1 
ATOM   190  C  C5    . G  A 1 9   ? 34.11000 50.03200 74.15500  1.000 93.39092  ? 111 G  A C5    1 
ATOM   191  C  C6    . G  A 1 9   ? 34.68200 48.77200 74.47800  1.000 95.99124  ? 111 G  A C6    1 
ATOM   192  O  O6    . G  A 1 9   ? 34.35600 47.98200 75.37300  1.000 96.74922  ? 111 G  A O6    1 
ATOM   193  N  N1    . G  A 1 9   ? 35.73500 48.45400 73.62700  1.000 97.82040  ? 111 G  A N1    1 
ATOM   194  C  C2    . G  A 1 9   ? 36.18500 49.24600 72.59900  1.000 99.34690  ? 111 G  A C2    1 
ATOM   195  N  N2    . G  A 1 9   ? 37.21800 48.76700 71.89100  1.000 98.52575  ? 111 G  A N2    1 
ATOM   196  N  N3    . G  A 1 9   ? 35.66100 50.42100 72.28900  1.000 104.49225 ? 111 G  A N3    1 
ATOM   197  C  C4    . G  A 1 9   ? 34.63500 50.74800 73.10200  1.000 98.49943  ? 111 G  A C4    1 
ATOM   198  P  P     . G  A 1 10  ? 30.46400 52.43100 68.90700  1.000 108.43540 ? 112 G  A P     1 
ATOM   199  O  OP1   . G  A 1 10  ? 29.83800 53.06600 67.72300  1.000 108.57489 ? 112 G  A OP1   1 
ATOM   200  O  OP2   . G  A 1 10  ? 29.60800 51.93300 70.01300  1.000 112.65433 ? 112 G  A OP2   1 
ATOM   201  O  "O5'" . G  A 1 10  ? 31.36900 51.23000 68.39100  1.000 109.35130 ? 112 G  A "O5'" 1 
ATOM   202  C  "C5'" . G  A 1 10  ? 32.28400 51.43000 67.32500  1.000 104.80602 ? 112 G  A "C5'" 1 
ATOM   203  C  "C4'" . G  A 1 10  ? 33.29500 50.31800 67.23500  1.000 98.64738  ? 112 G  A "C4'" 1 
ATOM   204  O  "O4'" . G  A 1 10  ? 34.05100 50.23800 68.47000  1.000 105.17448 ? 112 G  A "O4'" 1 
ATOM   205  C  "C3'" . G  A 1 10  ? 32.74300 48.91400 67.06300  1.000 98.64212  ? 112 G  A "C3'" 1 
ATOM   206  O  "O3'" . G  A 1 10  ? 32.33800 48.62900 65.73600  1.000 103.20582 ? 112 G  A "O3'" 1 
ATOM   207  C  "C2'" . G  A 1 10  ? 33.89600 48.05400 67.55700  1.000 102.11622 ? 112 G  A "C2'" 1 
ATOM   208  O  "O2'" . G  A 1 10  ? 34.92500 47.98000 66.58000  1.000 96.14972  ? 112 G  A "O2'" 1 
ATOM   209  C  "C1'" . G  A 1 10  ? 34.40300 48.89400 68.72800  1.000 105.37187 ? 112 G  A "C1'" 1 
ATOM   210  N  N9    . G  A 1 10  ? 33.77900 48.47500 69.99600  1.000 104.82181 ? 112 G  A N9    1 
ATOM   211  C  C8    . G  A 1 10  ? 32.77700 49.10400 70.69600  1.000 103.90854 ? 112 G  A C8    1 
ATOM   212  N  N7    . G  A 1 10  ? 32.43800 48.47000 71.78700  1.000 103.68220 ? 112 G  A N7    1 
ATOM   213  C  C5    . G  A 1 10  ? 33.26400 47.35400 71.80300  1.000 99.82647  ? 112 G  A C5    1 
ATOM   214  C  C6    . G  A 1 10  ? 33.36100 46.29300 72.74300  1.000 97.92888  ? 112 G  A C6    1 
ATOM   215  O  O6    . G  A 1 10  ? 32.71500 46.12300 73.78600  1.000 102.16623 ? 112 G  A O6    1 
ATOM   216  N  N1    . G  A 1 10  ? 34.33400 45.36800 72.37600  1.000 92.65193  ? 112 G  A N1    1 
ATOM   217  C  C2    . G  A 1 10  ? 35.11400 45.44900 71.25000  1.000 92.05186  ? 112 G  A C2    1 
ATOM   218  N  N2    . G  A 1 10  ? 35.99700 44.45400 71.06800  1.000 95.01274  ? 112 G  A N2    1 
ATOM   219  N  N3    . G  A 1 10  ? 35.03300 46.43100 70.36600  1.000 101.10294 ? 112 G  A N3    1 
ATOM   220  C  C4    . G  A 1 10  ? 34.09500 47.34200 70.70400  1.000 101.17400 ? 112 G  A C4    1 
ATOM   221  P  P     . A  A 1 11  ? 30.94500 47.87200 65.46200  1.000 102.54854 ? 113 A  A P     1 
ATOM   222  O  OP1   . A  A 1 11  ? 30.70800 47.84100 63.99700  1.000 102.18797 ? 113 A  A OP1   1 
ATOM   223  O  OP2   . A  A 1 11  ? 29.91100 48.46400 66.34700  1.000 108.65717 ? 113 A  A OP2   1 
ATOM   224  O  "O5'" . A  A 1 11  ? 31.22100 46.38100 65.94400  1.000 95.32136  ? 113 A  A "O5'" 1 
ATOM   225  C  "C5'" . A  A 1 11  ? 32.29600 45.63000 65.40200  1.000 95.70825  ? 113 A  A "C5'" 1 
ATOM   226  C  "C4'" . A  A 1 11  ? 32.69400 44.50700 66.32100  1.000 96.32937  ? 113 A  A "C4'" 1 
ATOM   227  O  "O4'" . A  A 1 11  ? 33.00000 45.04400 67.63200  1.000 99.22972  ? 113 A  A "O4'" 1 
ATOM   228  C  "C3'" . A  A 1 11  ? 31.62900 43.45500 66.58600  1.000 98.32172  ? 113 A  A "C3'" 1 
ATOM   229  O  "O3'" . A  A 1 11  ? 31.57400 42.47800 65.56200  1.000 93.92645  ? 113 A  A "O3'" 1 
ATOM   230  C  "C2'" . A  A 1 11  ? 32.03300 42.89900 67.94500  1.000 100.68779 ? 113 A  A "C2'" 1 
ATOM   231  O  "O2'" . A  A 1 11  ? 33.09500 41.96700 67.81300  1.000 101.43788 ? 113 A  A "O2'" 1 
ATOM   232  C  "C1'" . A  A 1 11  ? 32.57200 44.15200 68.63500  1.000 96.89260  ? 113 A  A "C1'" 1 
ATOM   233  N  N9    . A  A 1 11  ? 31.54000 44.83000 69.44100  1.000 103.17756 ? 113 A  A N9    1 
ATOM   234  C  C8    . A  A 1 11  ? 30.80600 45.94000 69.10900  1.000 103.55129 ? 113 A  A C8    1 
ATOM   235  N  N7    . A  A 1 11  ? 29.96400 46.31900 70.04000  1.000 102.91174 ? 113 A  A N7    1 
ATOM   236  C  C5    . A  A 1 11  ? 30.15900 45.39900 71.05900  1.000 99.69820  ? 113 A  A C5    1 
ATOM   237  C  C6    . A  A 1 11  ? 29.56700 45.24800 72.32200  1.000 105.26466 ? 113 A  A C6    1 
ATOM   238  N  N6    . A  A 1 11  ? 28.62400 46.06600 72.78900  1.000 111.59699 ? 113 A  A N6    1 
ATOM   239  N  N1    . A  A 1 11  ? 29.98700 44.22200 73.09300  1.000 110.63898 ? 113 A  A N1    1 
ATOM   240  C  C2    . A  A 1 11  ? 30.93500 43.40600 72.61800  1.000 104.80934 ? 113 A  A C2    1 
ATOM   241  N  N3    . A  A 1 11  ? 31.56800 43.44700 71.44800  1.000 102.76699 ? 113 A  A N3    1 
ATOM   242  C  C4    . A  A 1 11  ? 31.12900 44.47800 70.70300  1.000 103.55919 ? 113 A  A C4    1 
ATOM   243  P  P     . A  A 1 12  ? 30.34100 41.45500 65.48700  1.000 98.17004  ? 114 A  A P     1 
ATOM   244  O  OP1   . A  A 1 12  ? 29.97000 41.30800 64.06000  1.000 94.29326  ? 114 A  A OP1   1 
ATOM   245  O  OP2   . A  A 1 12  ? 29.31800 41.86700 66.48300  1.000 102.33370 ? 114 A  A OP2   1 
ATOM   246  O  "O5'" . A  A 1 12  ? 30.96400 40.07100 65.96000  1.000 93.94848  ? 114 A  A "O5'" 1 
ATOM   247  C  "C5'" . A  A 1 12  ? 31.97100 39.42000 65.20000  1.000 96.15401  ? 114 A  A "C5'" 1 
ATOM   248  C  "C4'" . A  A 1 12  ? 32.40100 38.14400 65.87400  1.000 94.62751  ? 114 A  A "C4'" 1 
ATOM   249  O  "O4'" . A  A 1 12  ? 32.80900 38.43900 67.23200  1.000 96.82251  ? 114 A  A "O4'" 1 
ATOM   250  C  "C3'" . A  A 1 12  ? 31.31600 37.08900 66.02800  1.000 101.11250 ? 114 A  A "C3'" 1 
ATOM   251  O  "O3'" . A  A 1 12  ? 31.17900 36.29000 64.87000  1.000 111.66113 ? 114 A  A "O3'" 1 
ATOM   252  C  "C2'" . A  A 1 12  ? 31.77000 36.30100 67.25000  1.000 100.62823 ? 114 A  A "C2'" 1 
ATOM   253  O  "O2'" . A  A 1 12  ? 32.76200 35.35000 66.89700  1.000 99.70707  ? 114 A  A "O2'" 1 
ATOM   254  C  "C1'" . A  A 1 12  ? 32.42700 37.39200 68.09500  1.000 100.25450 ? 114 A  A "C1'" 1 
ATOM   255  N  N9    . A  A 1 12  ? 31.52400 37.94000 69.12600  1.000 100.03079 ? 114 A  A N9    1 
ATOM   256  C  C8    . A  A 1 12  ? 30.98500 39.20200 69.17800  1.000 100.35451 ? 114 A  A C8    1 
ATOM   257  N  N7    . A  A 1 12  ? 30.22500 39.41500 70.22600  1.000 102.30211 ? 114 A  A N7    1 
ATOM   258  C  C5    . A  A 1 12  ? 30.27100 38.21300 70.91800  1.000 101.41780 ? 114 A  A C5    1 
ATOM   259  C  C6    . A  A 1 12  ? 29.67200 37.79000 72.11900  1.000 104.53922 ? 114 A  A C6    1 
ATOM   260  N  N6    . A  A 1 12  ? 28.88100 38.56600 72.86400  1.000 106.04993 ? 114 A  A N6    1 
ATOM   261  N  N1    . A  A 1 12  ? 29.92000 36.52800 72.53300  1.000 103.75229 ? 114 A  A N1    1 
ATOM   262  C  C2    . A  A 1 12  ? 30.71600 35.75400 71.78400  1.000 104.04969 ? 114 A  A C2    1 
ATOM   263  N  N3    . A  A 1 12  ? 31.33300 36.03800 70.64000  1.000 99.86235  ? 114 A  A N3    1 
ATOM   264  C  C4    . A  A 1 12  ? 31.06900 37.29800 70.25400  1.000 100.01236 ? 114 A  A C4    1 
ATOM   265  P  P     . A  A 1 13  ? 29.75400 36.13400 64.15100  1.000 113.09487 ? 115 A  A P     1 
ATOM   266  O  OP1   . A  A 1 13  ? 30.00700 35.69300 62.75700  1.000 101.62244 ? 115 A  A OP1   1 
ATOM   267  O  OP2   . A  A 1 13  ? 28.97400 37.37100 64.39700  1.000 100.68285 ? 115 A  A OP2   1 
ATOM   268  O  "O5'" . A  A 1 13  ? 29.04800 34.94800 64.94600  1.000 98.74578  ? 115 A  A "O5'" 1 
ATOM   269  C  "C5'" . A  A 1 13  ? 29.69900 33.70000 65.15500  1.000 103.18579 ? 115 A  A "C5'" 1 
ATOM   270  C  "C4'" . A  A 1 13  ? 29.15700 33.01500 66.38300  1.000 107.76791 ? 115 A  A "C4'" 1 
ATOM   271  O  "O4'" . A  A 1 13  ? 29.57200 33.75400 67.56100  1.000 104.39383 ? 115 A  A "O4'" 1 
ATOM   272  C  "C3'" . A  A 1 13  ? 27.63900 32.96900 66.47900  1.000 117.05587 ? 115 A  A "C3'" 1 
ATOM   273  O  "O3'" . A  A 1 13  ? 27.07400 31.88400 65.76600  1.000 122.27492 ? 115 A  A "O3'" 1 
ATOM   274  C  "C2'" . A  A 1 13  ? 27.39200 32.92800 67.98200  1.000 119.01400 ? 115 A  A "C2'" 1 
ATOM   275  O  "O2'" . A  A 1 13  ? 27.59800 31.62200 68.50100  1.000 125.11736 ? 115 A  A "O2'" 1 
ATOM   276  C  "C1'" . A  A 1 13  ? 28.51200 33.83400 68.48700  1.000 109.38127 ? 115 A  A "C1'" 1 
ATOM   277  N  N9    . A  A 1 13  ? 28.09100 35.24500 68.54800  1.000 108.86541 ? 115 A  A N9    1 
ATOM   278  C  C8    . A  A 1 13  ? 28.28800 36.20600 67.58900  1.000 107.85214 ? 115 A  A C8    1 
ATOM   279  N  N7    . A  A 1 13  ? 27.81100 37.38400 67.90300  1.000 108.33114 ? 115 A  A N7    1 
ATOM   280  C  C5    . A  A 1 13  ? 27.26700 37.19000 69.15900  1.000 109.94712 ? 115 A  A C5    1 
ATOM   281  C  C6    . A  A 1 13  ? 26.60900 38.06400 70.03700  1.000 114.27922 ? 115 A  A C6    1 
ATOM   282  N  N6    . A  A 1 13  ? 26.38300 39.35000 69.76700  1.000 116.90322 ? 115 A  A N6    1 
ATOM   283  N  N1    . A  A 1 13  ? 26.18000 37.56800 71.21400  1.000 110.86565 ? 115 A  A N1    1 
ATOM   284  C  C2    . A  A 1 13  ? 26.40900 36.27700 71.47500  1.000 109.17335 ? 115 A  A C2    1 
ATOM   285  N  N3    . A  A 1 13  ? 27.01700 35.35600 70.73200  1.000 108.84699 ? 115 A  A N3    1 
ATOM   286  C  C4    . A  A 1 13  ? 27.43000 35.88000 69.56900  1.000 111.12621 ? 115 A  A C4    1 
ATOM   287  P  P     . G  A 1 14  ? 25.76100 32.10200 64.86500  1.000 120.08344 ? 116 G  A P     1 
ATOM   288  O  OP1   . G  A 1 14  ? 25.78800 31.09000 63.77600  1.000 119.04385 ? 116 G  A OP1   1 
ATOM   289  O  OP2   . G  A 1 14  ? 25.67900 33.54400 64.51500  1.000 116.99097 ? 116 G  A OP2   1 
ATOM   290  O  "O5'" . G  A 1 14  ? 24.56000 31.76000 65.85600  1.000 116.53039 ? 116 G  A "O5'" 1 
ATOM   291  C  "C5'" . G  A 1 14  ? 24.47700 30.49400 66.49500  1.000 123.13907 ? 116 G  A "C5'" 1 
ATOM   292  C  "C4'" . G  A 1 14  ? 23.71900 30.58000 67.79500  1.000 133.10079 ? 116 G  A "C4'" 1 
ATOM   293  O  "O4'" . G  A 1 14  ? 24.43400 31.44500 68.72000  1.000 126.93163 ? 116 G  A "O4'" 1 
ATOM   294  C  "C3'" . G  A 1 14  ? 22.32900 31.19600 67.71300  1.000 136.29328 ? 116 G  A "C3'" 1 
ATOM   295  O  "O3'" . G  A 1 14  ? 21.33700 30.28900 67.26300  1.000 136.88546 ? 116 G  A "O3'" 1 
ATOM   296  C  "C2'" . G  A 1 14  ? 22.11500 31.70700 69.13100  1.000 133.04026 ? 116 G  A "C2'" 1 
ATOM   297  O  "O2'" . G  A 1 14  ? 21.79900 30.63600 70.01000  1.000 144.05737 ? 116 G  A "O2'" 1 
ATOM   298  C  "C1'" . G  A 1 14  ? 23.51700 32.21300 69.47100  1.000 128.58973 ? 116 G  A "C1'" 1 
ATOM   299  N  N9    . G  A 1 14  ? 23.68200 33.63100 69.09700  1.000 129.98463 ? 116 G  A N9    1 
ATOM   300  C  C8    . G  A 1 14  ? 24.16300 34.12200 67.90800  1.000 124.27079 ? 116 G  A C8    1 
ATOM   301  N  N7    . G  A 1 14  ? 24.17900 35.42300 67.85400  1.000 123.06801 ? 116 G  A N7    1 
ATOM   302  C  C5    . G  A 1 14  ? 23.67400 35.81800 69.08300  1.000 126.36051 ? 116 G  A C5    1 
ATOM   303  C  C6    . G  A 1 14  ? 23.45700 37.11800 69.60600  1.000 120.95723 ? 116 G  A C6    1 
ATOM   304  O  O6    . G  A 1 14  ? 23.67300 38.21600 69.07300  1.000 120.30716 ? 116 G  A O6    1 
ATOM   305  N  N1    . G  A 1 14  ? 22.93100 37.06700 70.89400  1.000 118.20164 ? 116 G  A N1    1 
ATOM   306  C  C2    . G  A 1 14  ? 22.64800 35.91800 71.58800  1.000 122.39425 ? 116 G  A C2    1 
ATOM   307  N  N2    . G  A 1 14  ? 22.14100 36.07600 72.82100  1.000 124.43660 ? 116 G  A N2    1 
ATOM   308  N  N3    . G  A 1 14  ? 22.84900 34.70300 71.10700  1.000 121.77575 ? 116 G  A N3    1 
ATOM   309  C  C4    . G  A 1 14  ? 23.35900 34.72600 69.86000  1.000 124.62346 ? 116 G  A C4    1 
ATOM   310  P  P     . G  A 1 15  ? 20.08500 30.82100 66.40500  1.000 143.04968 ? 117 G  A P     1 
ATOM   311  O  OP1   . G  A 1 15  ? 19.39100 29.63600 65.84000  1.000 138.89392 ? 117 G  A OP1   1 
ATOM   312  O  OP2   . G  A 1 15  ? 20.54700 31.90500 65.49800  1.000 127.21357 ? 117 G  A OP2   1 
ATOM   313  O  "O5'" . G  A 1 15  ? 19.12800 31.47600 67.49700  1.000 143.14443 ? 117 G  A "O5'" 1 
ATOM   314  C  "C5'" . G  A 1 15  ? 18.65600 30.71800 68.60100  1.000 144.06033 ? 117 G  A "C5'" 1 
ATOM   315  C  "C4'" . G  A 1 15  ? 18.04600 31.60300 69.65900  1.000 145.12098 ? 117 G  A "C4'" 1 
ATOM   316  O  "O4'" . G  A 1 15  ? 19.07100 32.44200 70.25500  1.000 143.89715 ? 117 G  A "O4'" 1 
ATOM   317  C  "C3'" . G  A 1 15  ? 17.00500 32.59500 69.17300  1.000 140.20460 ? 117 G  A "C3'" 1 
ATOM   318  O  "O3'" . G  A 1 15  ? 15.73400 32.01000 68.94900  1.000 138.31227 ? 117 G  A "O3'" 1 
ATOM   319  C  "C2'" . G  A 1 15  ? 17.03000 33.65400 70.26800  1.000 143.39446 ? 117 G  A "C2'" 1 
ATOM   320  O  "O2'" . G  A 1 15  ? 16.33800 33.19900 71.42200  1.000 146.68433 ? 117 G  A "O2'" 1 
ATOM   321  C  "C1'" . G  A 1 15  ? 18.52500 33.70300 70.59000  1.000 141.04944 ? 117 G  A "C1'" 1 
ATOM   322  N  N9    . G  A 1 15  ? 19.22000 34.74500 69.80600  1.000 132.83267 ? 117 G  A N9    1 
ATOM   323  C  C8    . G  A 1 15  ? 19.83300 34.59800 68.58500  1.000 130.36658 ? 117 G  A C8    1 
ATOM   324  N  N7    . G  A 1 15  ? 20.35600 35.70400 68.13100  1.000 126.71877 ? 117 G  A N7    1 
ATOM   325  C  C5    . G  A 1 15  ? 20.07000 36.64600 69.10900  1.000 127.10566 ? 117 G  A C5    1 
ATOM   326  C  C6    . G  A 1 15  ? 20.38300 38.03100 69.17600  1.000 125.72392 ? 117 G  A C6    1 
ATOM   327  O  O6    . G  A 1 15  ? 20.99800 38.73300 68.36100  1.000 121.63659 ? 117 G  A O6    1 
ATOM   328  N  N1    . G  A 1 15  ? 19.90300 38.60600 70.34800  1.000 124.27638 ? 117 G  A N1    1 
ATOM   329  C  C2    . G  A 1 15  ? 19.21000 37.94000 71.32800  1.000 128.72691 ? 117 G  A C2    1 
ATOM   330  N  N2    . G  A 1 15  ? 18.82700 38.67200 72.38600  1.000 130.00075 ? 117 G  A N2    1 
ATOM   331  N  N3    . G  A 1 15  ? 18.91300 36.65200 71.27500  1.000 132.79582 ? 117 G  A N3    1 
ATOM   332  C  C4    . G  A 1 15  ? 19.36800 36.07000 70.14700  1.000 130.16919 ? 117 G  A C4    1 
ATOM   333  P  P     . G  A 1 16  ? 14.89400 32.41500 67.64300  1.000 158.21951 ? 118 G  A P     1 
ATOM   334  O  OP1   . G  A 1 16  ? 13.73900 31.48900 67.53400  1.000 154.45064 ? 118 G  A OP1   1 
ATOM   335  O  OP2   . G  A 1 16  ? 15.84200 32.56100 66.50900  1.000 151.12129 ? 118 G  A OP2   1 
ATOM   336  O  "O5'" . G  A 1 16  ? 14.32600 33.85600 68.00800  1.000 143.20455 ? 118 G  A "O5'" 1 
ATOM   337  C  "C5'" . G  A 1 16  ? 13.48500 34.02700 69.13700  1.000 141.04903 ? 118 G  A "C5'" 1 
ATOM   338  C  "C4'" . G  A 1 16  ? 13.41300 35.46700 69.58100  1.000 137.24331 ? 118 G  A "C4'" 1 
ATOM   339  O  "O4'" . G  A 1 16  ? 14.72500 35.94300 69.97700  1.000 129.63187 ? 118 G  A "O4'" 1 
ATOM   340  C  "C3'" . G  A 1 16  ? 12.96800 36.48200 68.54400  1.000 127.45530 ? 118 G  A "C3'" 1 
ATOM   341  O  "O3'" . G  A 1 16  ? 11.57200 36.46700 68.30200  1.000 123.22058 ? 118 G  A "O3'" 1 
ATOM   342  C  "C2'" . G  A 1 16  ? 13.48000 37.78700 69.14000  1.000 130.75043 ? 118 G  A "C2'" 1 
ATOM   343  O  "O2'" . G  A 1 16  ? 12.64200 38.21800 70.20200  1.000 130.01086 ? 118 G  A "O2'" 1 
ATOM   344  C  "C1'" . G  A 1 16  ? 14.81700 37.33400 69.73300  1.000 130.99783 ? 118 G  A "C1'" 1 
ATOM   345  N  N9    . G  A 1 16  ? 15.92700 37.59900 68.79800  1.000 132.52959 ? 118 G  A N9    1 
ATOM   346  C  C8    . G  A 1 16  ? 16.55700 36.73000 67.94100  1.000 132.11112 ? 118 G  A C8    1 
ATOM   347  N  N7    . G  A 1 16  ? 17.49400 37.30400 67.23200  1.000 124.39703 ? 118 G  A N7    1 
ATOM   348  C  C5    . G  A 1 16  ? 17.47500 38.63100 67.63900  1.000 125.15239 ? 118 G  A C5    1 
ATOM   349  C  C6    . G  A 1 16  ? 18.26300 39.73800 67.22700  1.000 121.17823 ? 118 G  A C6    1 
ATOM   350  O  O6    . G  A 1 16  ? 19.17300 39.76600 66.38800  1.000 118.34894 ? 118 G  A O6    1 
ATOM   351  N  N1    . G  A 1 16  ? 17.90400 40.90200 67.90400  1.000 123.36533 ? 118 G  A N1    1 
ATOM   352  C  C2    . G  A 1 16  ? 16.91400 40.99000 68.85400  1.000 123.49693 ? 118 G  A C2    1 
ATOM   353  N  N2    . G  A 1 16  ? 16.70800 42.19800 69.40000  1.000 121.69145 ? 118 G  A N2    1 
ATOM   354  N  N3    . G  A 1 16  ? 16.17700 39.96500 69.24500  1.000 126.49465 ? 118 G  A N3    1 
ATOM   355  C  C4    . G  A 1 16  ? 16.50900 38.82700 68.60000  1.000 128.36593 ? 118 G  A C4    1 
ATOM   356  P  P     . G  A 1 17  ? 10.99200 36.97900 66.89200  1.000 137.31309 ? 119 G  A P     1 
ATOM   357  O  OP1   . G  A 1 17  ? 9.56500  36.58200 66.78000  1.000 133.02311 ? 119 G  A OP1   1 
ATOM   358  O  OP2   . G  A 1 17  ? 11.93800 36.54900 65.83300  1.000 147.04584 ? 119 G  A OP2   1 
ATOM   359  O  "O5'" . G  A 1 17  ? 11.06000 38.56700 67.00500  1.000 129.62270 ? 119 G  A "O5'" 1 
ATOM   360  C  "C5'" . G  A 1 17  ? 10.38800 39.24800 68.05400  1.000 125.43272 ? 119 G  A "C5'" 1 
ATOM   361  C  "C4'" . G  A 1 17  ? 10.76600 40.70700 68.10600  1.000 127.57508 ? 119 G  A "C4'" 1 
ATOM   362  O  "O4'" . G  A 1 17  ? 12.16900 40.85100 68.44900  1.000 128.58836 ? 119 G  A "O4'" 1 
ATOM   363  C  "C3'" . G  A 1 17  ? 10.63100 41.48100 66.80700  1.000 129.88326 ? 119 G  A "C3'" 1 
ATOM   364  O  "O3'" . G  A 1 17  ? 9.29600  41.85200 66.51700  1.000 129.46742 ? 119 G  A "O3'" 1 
ATOM   365  C  "C2'" . G  A 1 17  ? 11.56300 42.66300 67.03200  1.000 130.54649 ? 119 G  A "C2'" 1 
ATOM   366  O  "O2'" . G  A 1 17  ? 10.95000 43.64200 67.86000  1.000 132.76781 ? 119 G  A "O2'" 1 
ATOM   367  C  "C1'" . G  A 1 17  ? 12.69800 42.00300 67.81900  1.000 130.34647 ? 119 G  A "C1'" 1 
ATOM   368  N  N9    . G  A 1 17  ? 13.82200 41.60600 66.94800  1.000 127.37769 ? 119 G  A N9    1 
ATOM   369  C  C8    . G  A 1 17  ? 14.25200 40.33500 66.65200  1.000 127.75142 ? 119 G  A C8    1 
ATOM   370  N  N7    . G  A 1 17  ? 15.27900 40.31100 65.84700  1.000 127.05660 ? 119 G  A N7    1 
ATOM   371  C  C5    . G  A 1 17  ? 15.54700 41.64900 65.59300  1.000 124.98004 ? 119 G  A C5    1 
ATOM   372  C  C6    . G  A 1 17  ? 16.55200 42.25100 64.78700  1.000 123.04559 ? 119 G  A C6    1 
ATOM   373  O  O6    . G  A 1 17  ? 17.43700 41.70100 64.11400  1.000 122.84294 ? 119 G  A O6    1 
ATOM   374  N  N1    . G  A 1 17  ? 16.46200 43.64000 64.81400  1.000 120.59793 ? 119 G  A N1    1 
ATOM   375  C  C2    . G  A 1 17  ? 15.52800 44.35800 65.52000  1.000 122.65871 ? 119 G  A C2    1 
ATOM   376  N  N2    . G  A 1 17  ? 15.60200 45.69400 65.42100  1.000 125.56169 ? 119 G  A N2    1 
ATOM   377  N  N3    . G  A 1 17  ? 14.59000 43.80700 66.27000  1.000 125.29586 ? 119 G  A N3    1 
ATOM   378  C  C4    . G  A 1 17  ? 14.65700 42.46000 66.26400  1.000 125.24586 ? 119 G  A C4    1 
ATOM   379  P  P     . U  A 1 18  ? 8.67400  41.53500 65.07100  1.000 137.19324 ? 120 U  A P     1 
ATOM   380  O  OP1   . U  A 1 18  ? 7.20900  41.76000 65.14700  1.000 160.85397 ? 120 U  A OP1   1 
ATOM   381  O  OP2   . U  A 1 18  ? 9.18700  40.21200 64.63200  1.000 132.00841 ? 120 U  A OP2   1 
ATOM   382  O  "O5'" . U  A 1 18  ? 9.31300  42.64700 64.12300  1.000 137.52222 ? 120 U  A "O5'" 1 
ATOM   383  C  "C5'" . U  A 1 18  ? 9.10700  44.02900 64.37900  1.000 138.55130 ? 120 U  A "C5'" 1 
ATOM   384  C  "C4'" . U  A 1 18  ? 10.21100 44.88000 63.79900  1.000 137.64329 ? 120 U  A "C4'" 1 
ATOM   385  O  "O4'" . U  A 1 18  ? 11.49500 44.43100 64.30500  1.000 137.11954 ? 120 U  A "O4'" 1 
ATOM   386  C  "C3'" . U  A 1 18  ? 10.37300 44.83700 62.28700  1.000 138.17230 ? 120 U  A "C3'" 1 
ATOM   387  O  "O3'" . U  A 1 18  ? 9.44600  45.67200 61.61200  1.000 140.58838 ? 120 U  A "O3'" 1 
ATOM   388  C  "C2'" . U  A 1 18  ? 11.82700 45.25100 62.09300  1.000 135.28248 ? 120 U  A "C2'" 1 
ATOM   389  O  "O2'" . U  A 1 18  ? 11.96300 46.66400 62.17200  1.000 138.03808 ? 120 U  A "O2'" 1 
ATOM   390  C  "C1'" . U  A 1 18  ? 12.49400 44.62100 63.32300  1.000 131.13462 ? 120 U  A "C1'" 1 
ATOM   391  N  N1    . U  A 1 18  ? 13.13500 43.31500 63.02200  1.000 127.03676 ? 120 U  A N1    1 
ATOM   392  C  C2    . U  A 1 18  ? 14.36700 43.32600 62.38600  1.000 127.37627 ? 120 U  A C2    1 
ATOM   393  O  O2    . U  A 1 18  ? 14.94500 44.34900 62.05700  1.000 127.12361 ? 120 U  A O2    1 
ATOM   394  N  N3    . U  A 1 18  ? 14.90900 42.08600 62.13600  1.000 128.24743 ? 120 U  A N3    1 
ATOM   395  C  C4    . U  A 1 18  ? 14.36100 40.85600 62.45100  1.000 128.83697 ? 120 U  A C4    1 
ATOM   396  O  O4    . U  A 1 18  ? 14.96700 39.81800 62.16200  1.000 128.79749 ? 120 U  A O4    1 
ATOM   397  C  C5    . U  A 1 18  ? 13.09100 40.93000 63.10900  1.000 129.76603 ? 120 U  A C5    1 
ATOM   398  C  C6    . U  A 1 18  ? 12.54100 42.12300 63.36400  1.000 128.77118 ? 120 U  A C6    1 
ATOM   399  P  P     . C  A 1 19  ? 8.88100  45.25200 60.16600  1.000 148.71820 ? 121 C  A P     1 
ATOM   400  O  OP1   . C  A 1 19  ? 7.65400  46.04600 59.91200  1.000 147.68649 ? 121 C  A OP1   1 
ATOM   401  O  OP2   . C  A 1 19  ? 8.80800  43.76900 60.10700  1.000 141.63577 ? 121 C  A OP2   1 
ATOM   402  O  "O5'" . C  A 1 19  ? 10.00900 45.73800 59.14800  1.000 143.10173 ? 121 C  A "O5'" 1 
ATOM   403  C  "C5'" . C  A 1 19  ? 10.26000 47.12200 58.93900  1.000 140.78566 ? 121 C  A "C5'" 1 
ATOM   404  C  "C4'" . C  A 1 19  ? 11.45100 47.34800 58.04000  1.000 143.85709 ? 121 C  A "C4'" 1 
ATOM   405  O  "O4'" . C  A 1 19  ? 12.64500 46.80800 58.66100  1.000 144.89142 ? 121 C  A "O4'" 1 
ATOM   406  C  "C3'" . C  A 1 19  ? 11.40000 46.67300 56.67800  1.000 146.96272 ? 121 C  A "C3'" 1 
ATOM   407  O  "O3'" . C  A 1 19  ? 10.65100 47.41900 55.73500  1.000 153.36349 ? 121 C  A "O3'" 1 
ATOM   408  C  "C2'" . C  A 1 19  ? 12.87300 46.54100 56.30500  1.000 142.07003 ? 121 C  A "C2'" 1 
ATOM   409  O  "O2'" . C  A 1 19  ? 13.36600 47.75500 55.75800  1.000 147.19433 ? 121 C  A "O2'" 1 
ATOM   410  C  "C1'" . C  A 1 19  ? 13.52400 46.31700 57.67400  1.000 138.54592 ? 121 C  A "C1'" 1 
ATOM   411  N  N1    . C  A 1 19  ? 13.79400 44.88800 57.94800  1.000 136.06141 ? 121 C  A N1    1 
ATOM   412  C  C2    . C  A 1 19  ? 14.94100 44.30600 57.40600  1.000 136.62201 ? 121 C  A C2    1 
ATOM   413  O  O2    . C  A 1 19  ? 15.69400 44.99700 56.70500  1.000 136.21406 ? 121 C  A O2    1 
ATOM   414  N  N3    . C  A 1 19  ? 15.20100 43.00300 57.65700  1.000 137.39315 ? 121 C  A N3    1 
ATOM   415  C  C4    . C  A 1 19  ? 14.36700 42.29300 58.41800  1.000 135.65610 ? 121 C  A C4    1 
ATOM   416  N  N4    . C  A 1 19  ? 14.66000 41.01200 58.64300  1.000 136.25354 ? 121 C  A N4    1 
ATOM   417  C  C5    . C  A 1 19  ? 13.19400 42.86200 58.98900  1.000 135.78243 ? 121 C  A C5    1 
ATOM   418  C  C6    . C  A 1 19  ? 12.94900 44.15100 58.73000  1.000 137.19313 ? 121 C  A C6    1 
ATOM   419  P  P     . A  A 1 20  ? 9.38700  46.76400 54.99200  1.000 159.04959 ? 122 A  A P     1 
ATOM   420  O  OP1   . A  A 1 20  ? 8.98400  47.68300 53.89700  1.000 163.53434 ? 122 A  A OP1   1 
ATOM   421  O  OP2   . A  A 1 20  ? 8.39300  46.37700 56.02300  1.000 157.07567 ? 122 A  A OP2   1 
ATOM   422  O  "O5'" . A  A 1 20  ? 9.97400  45.43700 54.33300  1.000 145.28478 ? 122 A  A "O5'" 1 
ATOM   423  C  "C5'" . A  A 1 20  ? 9.61900  45.06900 53.00500  1.000 156.83880 ? 122 A  A "C5'" 1 
ATOM   424  C  "C4'" . A  A 1 20  ? 10.62400 45.58000 52.00100  1.000 156.99408 ? 122 A  A "C4'" 1 
ATOM   425  O  "O4'" . A  A 1 20  ? 11.82500 44.76500 52.07900  1.000 151.88821 ? 122 A  A "O4'" 1 
ATOM   426  C  "C3'" . A  A 1 20  ? 10.16900 45.53300 50.54400  1.000 163.87122 ? 122 A  A "C3'" 1 
ATOM   427  O  "O3'" . A  A 1 20  ? 10.74300 46.62900 49.82900  1.000 168.95341 ? 122 A  A "O3'" 1 
ATOM   428  C  "C2'" . A  A 1 20  ? 10.77500 44.22500 50.04800  1.000 157.30728 ? 122 A  A "C2'" 1 
ATOM   429  O  "O2'" . A  A 1 20  ? 10.97700 44.16100 48.65300  1.000 154.77276 ? 122 A  A "O2'" 1 
ATOM   430  C  "C1'" . A  A 1 20  ? 12.09400 44.18700 50.81500  1.000 154.24375 ? 122 A  A "C1'" 1 
ATOM   431  N  N9    . A  A 1 20  ? 12.61000 42.83500 51.03500  1.000 152.79095 ? 122 A  A N9    1 
ATOM   432  C  C8    . A  A 1 20  ? 12.06500 41.84100 51.80900  1.000 150.89598 ? 122 A  A C8    1 
ATOM   433  N  N7    . A  A 1 20  ? 12.76200 40.73000 51.80900  1.000 149.65110 ? 122 A  A N7    1 
ATOM   434  C  C5    . A  A 1 20  ? 13.83800 41.01300 50.98200  1.000 150.00377 ? 122 A  A C5    1 
ATOM   435  C  C6    . A  A 1 20  ? 14.94100 40.24700 50.57100  1.000 149.11945 ? 122 A  A C6    1 
ATOM   436  N  N6    . A  A 1 20  ? 15.15200 38.98700 50.95500  1.000 146.31122 ? 122 A  A N6    1 
ATOM   437  N  N1    . A  A 1 20  ? 15.83500 40.82600 49.74100  1.000 150.28801 ? 122 A  A N1    1 
ATOM   438  C  C2    . A  A 1 20  ? 15.62400 42.09100 49.35600  1.000 150.05378 ? 122 A  A C2    1 
ATOM   439  N  N3    . A  A 1 20  ? 14.62500 42.91100 49.67500  1.000 148.44306 ? 122 A  A N3    1 
ATOM   440  C  C4    . A  A 1 20  ? 13.75800 42.30600 50.50200  1.000 149.92481 ? 122 A  A C4    1 
ATOM   441  P  P     . A  A 1 21  ? 9.80200  47.73100 49.13200  1.000 178.61640 ? 123 A  A P     1 
ATOM   442  O  OP1   . A  A 1 21  ? 8.71600  48.07700 50.08600  1.000 168.61257 ? 123 A  A OP1   1 
ATOM   443  O  OP2   . A  A 1 21  ? 9.44700  47.23400 47.77800  1.000 173.17891 ? 123 A  A OP2   1 
ATOM   444  O  "O5'" . A  A 1 21  ? 10.76200 48.99400 48.96100  1.000 171.25763 ? 123 A  A "O5'" 1 
ATOM   445  C  "C5'" . A  A 1 21  ? 10.54700 50.19600 49.69000  1.000 171.93139 ? 123 A  A "C5'" 1 
ATOM   446  C  "C4'" . A  A 1 21  ? 10.98100 50.06100 51.13000  1.000 172.05772 ? 123 A  A "C4'" 1 
ATOM   447  O  "O4'" . A  A 1 21  ? 11.72300 48.83200 51.31400  1.000 168.16778 ? 123 A  A "O4'" 1 
ATOM   448  C  "C3'" . A  A 1 21  ? 11.90900 51.14300 51.66500  1.000 167.37032 ? 123 A  A "C3'" 1 
ATOM   449  O  "O3'" . A  A 1 21  ? 11.20800 52.32500 52.03400  1.000 171.11287 ? 123 A  A "O3'" 1 
ATOM   450  C  "C2'" . A  A 1 21  ? 12.60900 50.44100 52.83100  1.000 159.51411 ? 123 A  A "C2'" 1 
ATOM   451  O  "O2'" . A  A 1 21  ? 11.79600 50.44800 53.99300  1.000 164.78843 ? 123 A  A "O2'" 1 
ATOM   452  C  "C1'" . A  A 1 21  ? 12.70100 48.99800 52.31300  1.000 159.27198 ? 123 A  A "C1'" 1 
ATOM   453  N  N9    . A  A 1 21  ? 14.01900 48.66600 51.74500  1.000 150.83676 ? 123 A  A N9    1 
ATOM   454  C  C8    . A  A 1 21  ? 14.82800 49.41400 50.92700  1.000 151.91057 ? 123 A  A C8    1 
ATOM   455  N  N7    . A  A 1 21  ? 15.93900 48.80700 50.58700  1.000 155.78735 ? 123 A  A N7    1 
ATOM   456  C  C5    . A  A 1 21  ? 15.85100 47.57100 51.21400  1.000 153.17125 ? 123 A  A C5    1 
ATOM   457  C  C6    . A  A 1 21  ? 16.70700 46.45400 51.25700  1.000 150.21826 ? 123 A  A C6    1 
ATOM   458  N  N6    . A  A 1 21  ? 17.87900 46.38400 50.62600  1.000 148.66018 ? 123 A  A N6    1 
ATOM   459  N  N1    . A  A 1 21  ? 16.31700 45.38100 51.98100  1.000 144.27544 ? 123 A  A N1    1 
ATOM   460  C  C2    . A  A 1 21  ? 15.14000 45.43400 52.61700  1.000 147.37055 ? 123 A  A C2    1 
ATOM   461  N  N3    . A  A 1 21  ? 14.25000 46.42400 52.65300  1.000 152.37378 ? 123 A  A N3    1 
ATOM   462  C  C4    . A  A 1 21  ? 14.67100 47.47200 51.92400  1.000 150.74990 ? 123 A  A C4    1 
ATOM   463  P  P     . C  A 1 22  ? 11.86200 53.43600 53.00200  1.000 167.93195 ? 124 C  A P     1 
ATOM   464  O  OP1   . C  A 1 22  ? 11.13200 54.71000 52.78400  1.000 161.13640 ? 124 C  A OP1   1 
ATOM   465  O  OP2   . C  A 1 22  ? 13.34200 53.42800 52.84900  1.000 164.80789 ? 124 C  A OP2   1 
ATOM   466  O  "O5'" . C  A 1 22  ? 11.48100 52.93800 54.46700  1.000 159.00720 ? 124 C  A "O5'" 1 
ATOM   467  C  "C5'" . C  A 1 22  ? 11.76200 53.73400 55.61000  1.000 156.87010 ? 124 C  A "C5'" 1 
ATOM   468  C  "C4'" . C  A 1 22  ? 11.65500 52.92200 56.87600  1.000 156.30161 ? 124 C  A "C4'" 1 
ATOM   469  O  "O4'" . C  A 1 22  ? 12.11200 51.57300 56.63000  1.000 148.62437 ? 124 C  A "O4'" 1 
ATOM   470  C  "C3'" . C  A 1 22  ? 12.48800 53.40600 58.05700  1.000 157.94391 ? 124 C  A "C3'" 1 
ATOM   471  O  "O3'" . C  A 1 22  ? 11.79400 54.38700 58.81100  1.000 164.77368 ? 124 C  A "O3'" 1 
ATOM   472  C  "C2'" . C  A 1 22  ? 12.74300 52.13000 58.86500  1.000 154.03818 ? 124 C  A "C2'" 1 
ATOM   473  O  "O2'" . C  A 1 22  ? 11.70200 51.91400 59.80700  1.000 152.42483 ? 124 C  A "O2'" 1 
ATOM   474  C  "C1'" . C  A 1 22  ? 12.67500 51.02700 57.79900  1.000 149.07969 ? 124 C  A "C1'" 1 
ATOM   475  N  N1    . C  A 1 22  ? 13.98200 50.40200 57.47400  1.000 147.81375 ? 124 C  A N1    1 
ATOM   476  C  C2    . C  A 1 22  ? 14.60100 49.55700 58.40900  1.000 145.81088 ? 124 C  A C2    1 
ATOM   477  O  O2    . C  A 1 22  ? 14.07400 49.37200 59.51800  1.000 141.26033 ? 124 C  A O2    1 
ATOM   478  N  N3    . C  A 1 22  ? 15.77800 48.96500 58.09200  1.000 143.32900 ? 124 C  A N3    1 
ATOM   479  C  C4    . C  A 1 22  ? 16.33500 49.16700 56.89700  1.000 141.82882 ? 124 C  A C4    1 
ATOM   480  N  N4    . C  A 1 22  ? 17.50000 48.56400 56.63400  1.000 136.94666 ? 124 C  A N4    1 
ATOM   481  C  C5    . C  A 1 22  ? 15.72000 50.00600 55.92100  1.000 144.71864 ? 124 C  A C5    1 
ATOM   482  C  C6    . C  A 1 22  ? 14.55500 50.59000 56.24300  1.000 147.57951 ? 124 C  A C6    1 
ATOM   483  P  P     . A  A 1 23  ? 12.17600 55.94600 58.74500  1.000 171.61060 ? 125 A  A P     1 
ATOM   484  O  OP1   . A  A 1 23  ? 11.33200 56.56500 57.69000  1.000 161.80680 ? 125 A  A OP1   1 
ATOM   485  O  OP2   . A  A 1 23  ? 13.65400 56.08900 58.69100  1.000 170.57890 ? 125 A  A OP2   1 
ATOM   486  O  "O5'" . A  A 1 23  ? 11.66300 56.49500 60.15100  1.000 165.95729 ? 125 A  A "O5'" 1 
ATOM   487  C  "C5'" . A  A 1 23  ? 12.14500 57.72100 60.68700  1.000 159.89604 ? 125 A  A "C5'" 1 
ATOM   488  C  "C4'" . A  A 1 23  ? 12.27600 57.66000 62.18900  1.000 156.84304 ? 125 A  A "C4'" 1 
ATOM   489  O  "O4'" . A  A 1 23  ? 10.96300 57.43900 62.77000  1.000 165.91781 ? 125 A  A "O4'" 1 
ATOM   490  C  "C3'" . A  A 1 23  ? 13.18100 56.54800 62.72200  1.000 157.58261 ? 125 A  A "C3'" 1 
ATOM   491  O  "O3'" . A  A 1 23  ? 13.90700 57.01900 63.85500  1.000 160.98564 ? 125 A  A "O3'" 1 
ATOM   492  C  "C2'" . A  A 1 23  ? 12.18700 55.47000 63.15400  1.000 161.70678 ? 125 A  A "C2'" 1 
ATOM   493  O  "O2'" . A  A 1 23  ? 12.65200 54.61100 64.17500  1.000 158.99593 ? 125 A  A "O2'" 1 
ATOM   494  C  "C1'" . A  A 1 23  ? 10.99700 56.30600 63.61800  1.000 166.52315 ? 125 A  A "C1'" 1 
ATOM   495  N  N9    . A  A 1 23  ? 9.69900  55.62200 63.54100  1.000 169.73143 ? 125 A  A N9    1 
ATOM   496  C  C8    . A  A 1 23  ? 8.67500  55.72300 64.45100  1.000 169.82091 ? 125 A  A C8    1 
ATOM   497  N  N7    . A  A 1 23  ? 7.61900  55.01000 64.14800  1.000 176.47961 ? 125 A  A N7    1 
ATOM   498  C  C5    . A  A 1 23  ? 7.96100  54.39400 62.95500  1.000 177.21391 ? 125 A  A C5    1 
ATOM   499  C  C6    . A  A 1 23  ? 7.25900  53.50600 62.12200  1.000 178.27982 ? 125 A  A C6    1 
ATOM   500  N  N6    . A  A 1 23  ? 6.02500  53.07000 62.37300  1.000 170.02357 ? 125 A  A N6    1 
ATOM   501  N  N1    . A  A 1 23  ? 7.86900  53.06700 61.00300  1.000 179.54840 ? 125 A  A N1    1 
ATOM   502  C  C2    . A  A 1 23  ? 9.10600  53.50600 60.75200  1.000 172.48966 ? 125 A  A C2    1 
ATOM   503  N  N3    . A  A 1 23  ? 9.86700  54.34000 61.45400  1.000 172.66862 ? 125 A  A N3    1 
ATOM   504  C  C4    . A  A 1 23  ? 9.23600  54.76000 62.56500  1.000 172.79496 ? 125 A  A C4    1 
ATOM   505  P  P     . G  A 1 24  ? 15.46800 57.37800 63.70900  1.000 156.49036 ? 126 G  A P     1 
ATOM   506  O  OP1   . G  A 1 24  ? 15.90200 58.05700 64.95800  1.000 142.78609 ? 126 G  A OP1   1 
ATOM   507  O  OP2   . G  A 1 24  ? 15.65500 58.05700 62.39800  1.000 150.71335 ? 126 G  A OP2   1 
ATOM   508  O  "O5'" . G  A 1 24  ? 16.18400 55.95400 63.64200  1.000 145.87330 ? 126 G  A "O5'" 1 
ATOM   509  C  "C5'" . G  A 1 24  ? 16.31500 55.14800 64.80400  1.000 141.09904 ? 126 G  A "C5'" 1 
ATOM   510  C  "C4'" . G  A 1 24  ? 16.96300 53.82000 64.49600  1.000 138.13290 ? 126 G  A "C4'" 1 
ATOM   511  O  "O4'" . G  A 1 24  ? 16.14900 53.07900 63.55000  1.000 139.11196 ? 126 G  A "O4'" 1 
ATOM   512  C  "C3'" . G  A 1 24  ? 18.33200 53.87600 63.83600  1.000 131.14785 ? 126 G  A "C3'" 1 
ATOM   513  O  "O3'" . G  A 1 24  ? 19.38100 54.12400 64.75400  1.000 122.32048 ? 126 G  A "O3'" 1 
ATOM   514  C  "C2'" . G  A 1 24  ? 18.42400 52.51900 63.15400  1.000 126.20778 ? 126 G  A "C2'" 1 
ATOM   515  O  "O2'" . G  A 1 24  ? 18.74700 51.50400 64.09400  1.000 123.90751 ? 126 G  A "O2'" 1 
ATOM   516  C  "C1'" . G  A 1 24  ? 16.97800 52.31600 62.69800  1.000 131.38209 ? 126 G  A "C1'" 1 
ATOM   517  N  N9    . G  A 1 24  ? 16.77900 52.77200 61.31100  1.000 134.54036 ? 126 G  A N9    1 
ATOM   518  C  C8    . G  A 1 24  ? 16.05800 53.85500 60.87200  1.000 141.28854 ? 126 G  A C8    1 
ATOM   519  N  N7    . G  A 1 24  ? 16.08500 53.99000 59.57500  1.000 141.73596 ? 126 G  A N7    1 
ATOM   520  C  C5    . G  A 1 24  ? 16.87200 52.93300 59.13600  1.000 137.11435 ? 126 G  A C5    1 
ATOM   521  C  C6    . G  A 1 24  ? 17.26300 52.55500 57.82500  1.000 139.93048 ? 126 G  A C6    1 
ATOM   522  O  O6    . G  A 1 24  ? 16.98200 53.09300 56.74600  1.000 144.98635 ? 126 G  A O6    1 
ATOM   523  N  N1    . G  A 1 24  ? 18.06600 51.41900 57.84200  1.000 138.49347 ? 126 G  A N1    1 
ATOM   524  C  C2    . G  A 1 24  ? 18.44500 50.73000 58.96800  1.000 136.06160 ? 126 G  A C2    1 
ATOM   525  N  N2    . G  A 1 24  ? 19.22400 49.65500 58.78000  1.000 138.88562 ? 126 G  A N2    1 
ATOM   526  N  N3    . G  A 1 24  ? 18.08700 51.07300 60.19200  1.000 132.04006 ? 126 G  A N3    1 
ATOM   527  C  C4    . G  A 1 24  ? 17.30800 52.17400 60.19800  1.000 133.89555 ? 126 G  A C4    1 
ATOM   528  P  P     . C  A 1 25  ? 20.50700 55.21600 64.41100  1.000 118.98478 ? 127 C  A P     1 
ATOM   529  O  OP1   . C  A 1 25  ? 21.27300 55.47700 65.65500  1.000 118.51104 ? 127 C  A OP1   1 
ATOM   530  O  OP2   . C  A 1 25  ? 19.85700 56.35300 63.71000  1.000 131.61788 ? 127 C  A OP2   1 
ATOM   531  O  "O5'" . C  A 1 25  ? 21.46000 54.47300 63.37100  1.000 120.54550 ? 127 C  A "O5'" 1 
ATOM   532  C  "C5'" . C  A 1 25  ? 22.14700 53.28000 63.72600  1.000 119.23218 ? 127 C  A "C5'" 1 
ATOM   533  C  "C4'" . C  A 1 25  ? 22.69500 52.57600 62.50900  1.000 118.46103 ? 127 C  A "C4'" 1 
ATOM   534  O  "O4'" . C  A 1 25  ? 21.59900 52.19500 61.63900  1.000 125.26711 ? 127 C  A "O4'" 1 
ATOM   535  C  "C3'" . C  A 1 25  ? 23.61000 53.40400 61.61800  1.000 123.93538 ? 127 C  A "C3'" 1 
ATOM   536  O  "O3'" . C  A 1 25  ? 24.94700 53.43400 62.08600  1.000 124.46175 ? 127 C  A "O3'" 1 
ATOM   537  C  "C2'" . C  A 1 25  ? 23.45400 52.74000 60.25600  1.000 126.99627 ? 127 C  A "C2'" 1 
ATOM   538  O  "O2'" . C  A 1 25  ? 24.25800 51.57200 60.16600  1.000 126.25671 ? 127 C  A "O2'" 1 
ATOM   539  C  "C1'" . C  A 1 25  ? 21.98400 52.32200 60.28600  1.000 129.04125 ? 127 C  A "C1'" 1 
ATOM   540  N  N1    . C  A 1 25  ? 21.10800 53.32300 59.63600  1.000 131.95476 ? 127 C  A N1    1 
ATOM   541  C  C2    . C  A 1 25  ? 20.95300 53.27400 58.25000  1.000 135.10777 ? 127 C  A C2    1 
ATOM   542  O  O2    . C  A 1 25  ? 21.55500 52.39800 57.61300  1.000 136.43687 ? 127 C  A O2    1 
ATOM   543  N  N3    . C  A 1 25  ? 20.15400 54.18000 57.64600  1.000 138.93191 ? 127 C  A N3    1 
ATOM   544  C  C4    . C  A 1 25  ? 19.52800 55.10900 58.37200  1.000 136.55794 ? 127 C  A C4    1 
ATOM   545  N  N4    . C  A 1 25  ? 18.74900 55.98400 57.73200  1.000 144.40362 ? 127 C  A N4    1 
ATOM   546  C  C5    . C  A 1 25  ? 19.66800 55.18300 59.78700  1.000 132.18636 ? 127 C  A C5    1 
ATOM   547  C  C6    . C  A 1 25  ? 20.46100 54.27700 60.37000  1.000 133.37861 ? 127 C  A C6    1 
ATOM   548  P  P     . C  A 1 26  ? 25.81500 54.78000 61.97600  1.000 121.59494 ? 128 C  A P     1 
ATOM   549  O  OP1   . C  A 1 26  ? 27.09200 54.53100 62.69100  1.000 123.85311 ? 128 C  A OP1   1 
ATOM   550  O  OP2   . C  A 1 26  ? 24.96100 55.92000 62.39100  1.000 122.92405 ? 128 C  A OP2   1 
ATOM   551  O  "O5'" . C  A 1 26  ? 26.11100 54.92900 60.41500  1.000 122.15027 ? 128 C  A "O5'" 1 
ATOM   552  C  "C5'" . C  A 1 26  ? 26.96300 54.01300 59.73900  1.000 126.25866 ? 128 C  A "C5'" 1 
ATOM   553  C  "C4'" . C  A 1 26  ? 27.09400 54.34000 58.27000  1.000 133.37004 ? 128 C  A "C4'" 1 
ATOM   554  O  "O4'" . C  A 1 26  ? 25.84600 54.05300 57.58100  1.000 134.08328 ? 128 C  A "O4'" 1 
ATOM   555  C  "C3'" . C  A 1 26  ? 27.37300 55.79500 57.93100  1.000 136.51779 ? 128 C  A "C3'" 1 
ATOM   556  O  "O3'" . C  A 1 26  ? 28.73300 56.15500 58.08500  1.000 132.53047 ? 128 C  A "O3'" 1 
ATOM   557  C  "C2'" . C  A 1 26  ? 26.86600 55.90500 56.50300  1.000 141.61840 ? 128 C  A "C2'" 1 
ATOM   558  O  "O2'" . C  A 1 26  ? 27.79800 55.33500 55.59200  1.000 142.63957 ? 128 C  A "O2'" 1 
ATOM   559  C  "C1'" . C  A 1 26  ? 25.62700 55.01100 56.56300  1.000 137.13891 ? 128 C  A "C1'" 1 
ATOM   560  N  N1    . C  A 1 26  ? 24.41300 55.78800 56.90400  1.000 137.87058 ? 128 C  A N1    1 
ATOM   561  C  C2    . C  A 1 26  ? 23.80100 56.56900 55.92000  1.000 142.48166 ? 128 C  A C2    1 
ATOM   562  O  O2    . C  A 1 26  ? 24.27600 56.58600 54.77500  1.000 141.81053 ? 128 C  A O2    1 
ATOM   563  N  N3    . C  A 1 26  ? 22.69600 57.28100 56.23900  1.000 144.41873 ? 128 C  A N3    1 
ATOM   564  C  C4    . C  A 1 26  ? 22.20600 57.23600 57.48100  1.000 139.87082 ? 128 C  A C4    1 
ATOM   565  N  N4    . C  A 1 26  ? 21.11100 57.95400 57.75000  1.000 141.42364 ? 128 C  A N4    1 
ATOM   566  C  C5    . C  A 1 26  ? 22.81500 56.45200 58.50400  1.000 138.49697 ? 128 C  A C5    1 
ATOM   567  C  C6    . C  A 1 26  ? 23.90500 55.75600 58.17200  1.000 135.33080 ? 128 C  A C6    1 
ATOM   568  P  P     . G  A 1 27  ? 29.11800 57.63400 58.57500  1.000 138.25337 ? 129 G  A P     1 
ATOM   569  O  OP1   . G  A 1 27  ? 30.57100 57.62400 58.87700  1.000 143.28555 ? 129 G  A OP1   1 
ATOM   570  O  OP2   . G  A 1 27  ? 28.14800 58.05300 59.61900  1.000 125.29392 ? 129 G  A OP2   1 
ATOM   571  O  "O5'" . G  A 1 27  ? 28.87300 58.54400 57.28900  1.000 140.74051 ? 129 G  A "O5'" 1 
ATOM   572  C  "C5'" . G  A 1 27  ? 29.64500 58.35700 56.11000  1.000 142.30122 ? 129 G  A "C5'" 1 
ATOM   573  C  "C4'" . G  A 1 27  ? 29.04900 59.08000 54.92800  1.000 141.64062 ? 129 G  A "C4'" 1 
ATOM   574  O  "O4'" . G  A 1 27  ? 27.70700 58.59100 54.67900  1.000 142.00382 ? 129 G  A "O4'" 1 
ATOM   575  C  "C3'" . G  A 1 27  ? 28.87300 60.58300 55.08500  1.000 146.24906 ? 129 G  A "C3'" 1 
ATOM   576  O  "O3'" . G  A 1 27  ? 30.06600 61.29700 54.82500  1.000 155.28436 ? 129 G  A "O3'" 1 
ATOM   577  C  "C2'" . G  A 1 27  ? 27.76000 60.89200 54.09300  1.000 150.10216 ? 129 G  A "C2'" 1 
ATOM   578  O  "O2'" . G  A 1 27  ? 28.26900 60.94700 52.76800  1.000 150.37324 ? 129 G  A "O2'" 1 
ATOM   579  C  "C1'" . G  A 1 27  ? 26.88500 59.64500 54.22400  1.000 148.77568 ? 129 G  A "C1'" 1 
ATOM   580  N  N9    . G  A 1 27  ? 25.79000 59.84000 55.19200  1.000 143.39609 ? 129 G  A N9    1 
ATOM   581  C  C8    . G  A 1 27  ? 25.67400 59.27000 56.43400  1.000 141.61430 ? 129 G  A C8    1 
ATOM   582  N  N7    . G  A 1 27  ? 24.59600 59.63600 57.06600  1.000 143.11448 ? 129 G  A N7    1 
ATOM   583  C  C5    . G  A 1 27  ? 23.95800 60.50300 56.18800  1.000 149.44418 ? 129 G  A C5    1 
ATOM   584  C  C6    . G  A 1 27  ? 22.73600 61.21800 56.32300  1.000 152.81827 ? 129 G  A C6    1 
ATOM   585  O  O6    . G  A 1 27  ? 21.94700 61.22900 57.27900  1.000 155.10802 ? 129 G  A O6    1 
ATOM   586  N  N1    . G  A 1 27  ? 22.46200 61.97900 55.18900  1.000 152.59719 ? 129 G  A N1    1 
ATOM   587  C  C2    . G  A 1 27  ? 23.26200 62.04300 54.07400  1.000 154.40794 ? 129 G  A C2    1 
ATOM   588  N  N2    . G  A 1 27  ? 22.83300 62.83900 53.08300  1.000 157.07668 ? 129 G  A N2    1 
ATOM   589  N  N3    . G  A 1 27  ? 24.40200 61.38600 53.94000  1.000 154.21318 ? 129 G  A N3    1 
ATOM   590  C  C4    . G  A 1 27  ? 24.68600 60.64000 55.02700  1.000 148.53881 ? 129 G  A C4    1 
ATOM   591  P  P     . U  A 1 28  ? 30.60600 62.41500 55.84600  1.000 156.50192 ? 130 U  A P     1 
ATOM   592  O  OP1   . U  A 1 28  ? 32.06800 62.46200 55.60400  1.000 161.05247 ? 130 U  A OP1   1 
ATOM   593  O  OP2   . U  A 1 28  ? 30.12700 62.18700 57.23200  1.000 140.63949 ? 130 U  A OP2   1 
ATOM   594  O  "O5'" . U  A 1 28  ? 29.95100 63.78200 55.31900  1.000 159.84969 ? 130 U  A "O5'" 1 
ATOM   595  C  "C5'" . U  A 1 28  ? 30.10200 64.17600 53.94900  1.000 164.50025 ? 130 U  A "C5'" 1 
ATOM   596  C  "C4'" . U  A 1 28  ? 28.92500 64.98700 53.43400  1.000 163.53698 ? 130 U  A "C4'" 1 
ATOM   597  O  "O4'" . U  A 1 28  ? 27.66900 64.33400 53.72300  1.000 158.84957 ? 130 U  A "O4'" 1 
ATOM   598  C  "C3'" . U  A 1 28  ? 28.80800 66.41700 53.95700  1.000 168.17174 ? 130 U  A "C3'" 1 
ATOM   599  O  "O3'" . U  A 1 28  ? 29.50200 67.41900 53.18200  1.000 175.41472 ? 130 U  A "O3'" 1 
ATOM   600  C  "C2'" . U  A 1 28  ? 27.31500 66.67800 54.17000  1.000 167.86118 ? 130 U  A "C2'" 1 
ATOM   601  O  "O2'" . U  A 1 28  ? 26.70400 67.62000 53.30700  1.000 172.08800 ? 130 U  A "O2'" 1 
ATOM   602  C  "C1'" . U  A 1 28  ? 26.67500 65.30600 53.99100  1.000 163.76069 ? 130 U  A "C1'" 1 
ATOM   603  N  N1    . U  A 1 28  ? 25.83000 64.87600 55.15000  1.000 159.45491 ? 130 U  A N1    1 
ATOM   604  C  C2    . U  A 1 28  ? 24.44400 64.87400 55.01700  1.000 161.14985 ? 130 U  A C2    1 
ATOM   605  O  O2    . U  A 1 28  ? 23.83400 65.20800 54.00200  1.000 161.63148 ? 130 U  A O2    1 
ATOM   606  N  N3    . U  A 1 28  ? 23.77500 64.42300 56.14200  1.000 160.63663 ? 130 U  A N3    1 
ATOM   607  C  C4    . U  A 1 28  ? 24.32700 64.01800 57.35800  1.000 155.81500 ? 130 U  A C4    1 
ATOM   608  O  O4    . U  A 1 28  ? 23.59000 63.64700 58.27500  1.000 152.96729 ? 130 U  A O4    1 
ATOM   609  C  C5    . U  A 1 28  ? 25.76600 64.06600 57.42300  1.000 156.80722 ? 130 U  A C5    1 
ATOM   610  C  C6    . U  A 1 28  ? 26.43700 64.46900 56.33400  1.000 157.30728 ? 130 U  A C6    1 
ATOM   611  P  P     . A  A 1 29  ? 29.80100 67.58000 51.60000  1.000 179.23764 ? 131 A  A P     1 
ATOM   612  O  OP1   . A  A 1 29  ? 29.20800 66.47600 50.80000  1.000 172.07625 ? 131 A  A OP1   1 
ATOM   613  O  OP2   . A  A 1 29  ? 31.25700 67.82800 51.47800  1.000 179.38502 ? 131 A  A OP2   1 
ATOM   614  O  "O5'" . A  A 1 29  ? 29.01900 68.92200 51.16700  1.000 175.63457 ? 131 A  A "O5'" 1 
ATOM   615  C  "C5'" . A  A 1 29  ? 28.60600 69.99600 52.03800  1.000 176.70312 ? 131 A  A "C5'" 1 
ATOM   616  C  "C4'" . A  A 1 29  ? 29.79700 70.75300 52.59500  1.000 172.07625 ? 131 A  A "C4'" 1 
ATOM   617  O  "O4'" . A  A 1 29  ? 30.79000 70.81800 51.54900  1.000 174.77658 ? 131 A  A "O4'" 1 
ATOM   618  C  "C3'" . A  A 1 29  ? 29.50800 72.18000 53.03800  1.000 172.98952 ? 131 A  A "C3'" 1 
ATOM   619  O  "O3'" . A  A 1 29  ? 29.42200 72.23700 54.47300  1.000 176.11621 ? 131 A  A "O3'" 1 
ATOM   620  C  "C2'" . A  A 1 29  ? 30.66200 73.01500 52.47600  1.000 173.86594 ? 131 A  A "C2'" 1 
ATOM   621  O  "O2'" . A  A 1 29  ? 31.70300 73.27700 53.40000  1.000 179.22448 ? 131 A  A "O2'" 1 
ATOM   622  C  "C1'" . A  A 1 29  ? 31.23600 72.14000 51.37400  1.000 173.76330 ? 131 A  A "C1'" 1 
ATOM   623  N  N9    . A  A 1 29  ? 31.08000 72.59800 49.99100  1.000 165.77023 ? 131 A  A N9    1 
ATOM   624  C  C8    . A  A 1 29  ? 30.37500 72.00800 48.97100  1.000 162.02242 ? 131 A  A C8    1 
ATOM   625  N  N7    . A  A 1 29  ? 30.51300 72.61300 47.81000  1.000 158.55358 ? 131 A  A N7    1 
ATOM   626  C  C5    . A  A 1 29  ? 31.37900 73.66100 48.08200  1.000 159.80899 ? 131 A  A C5    1 
ATOM   627  C  C6    . A  A 1 29  ? 31.92400 74.70300 47.28600  1.000 159.44579 ? 131 A  A C6    1 
ATOM   628  N  N6    . A  A 1 29  ? 31.62600 74.85300 45.98900  1.000 157.68769 ? 131 A  A N6    1 
ATOM   629  N  N1    . A  A 1 29  ? 32.79000 75.59000 47.86600  1.000 157.14815 ? 131 A  A N1    1 
ATOM   630  C  C2    . A  A 1 29  ? 33.05800 75.47500 49.18300  1.000 156.84285 ? 131 A  A C2    1 
ATOM   631  N  N3    . A  A 1 29  ? 32.60000 74.54000 50.03000  1.000 162.99095 ? 131 A  A N3    1 
ATOM   632  C  C4    . A  A 1 29  ? 31.76100 73.65500 49.41900  1.000 161.03546 ? 131 A  A C4    1 
ATOM   633  P  P     . C  A 1 30  ? 28.30500 73.15200 55.18700  1.000 183.78684 ? 132 C  A P     1 
ATOM   634  O  OP1   . C  A 1 30  ? 28.33700 74.49500 54.55700  1.000 183.66314 ? 132 C  A OP1   1 
ATOM   635  O  OP2   . C  A 1 30  ? 28.46600 73.02800 56.66000  1.000 173.60404 ? 132 C  A OP2   1 
ATOM   636  O  "O5'" . C  A 1 30  ? 26.91900 72.47700 54.78000  1.000 181.35233 ? 132 C  A "O5'" 1 
ATOM   637  C  "C5'" . C  A 1 30  ? 26.13000 73.01200 53.72700  1.000 176.23856 ? 132 C  A "C5'" 1 
ATOM   638  C  "C4'" . C  A 1 30  ? 24.66500 73.05500 54.08900  1.000 176.72546 ? 132 C  A "C4'" 1 
ATOM   639  O  "O4'" . C  A 1 30  ? 24.09500 71.72100 54.03300  1.000 175.36477 ? 132 C  A "O4'" 1 
ATOM   640  C  "C3'" . C  A 1 30  ? 24.33200 73.54000 55.49200  1.000 176.07539 ? 132 C  A "C3'" 1 
ATOM   641  O  "O3'" . C  A 1 30  ? 24.36300 74.95200 55.61800  1.000 176.89917 ? 132 C  A "O3'" 1 
ATOM   642  C  "C2'" . C  A 1 30  ? 22.95400 72.93800 55.73000  1.000 174.19621 ? 132 C  A "C2'" 1 
ATOM   643  O  "O2'" . C  A 1 30  ? 21.94800 73.70900 55.08800  1.000 173.47507 ? 132 C  A "O2'" 1 
ATOM   644  C  "C1'" . C  A 1 30  ? 23.07700 71.59300 55.00600  1.000 173.35138 ? 132 C  A "C1'" 1 
ATOM   645  N  N1    . C  A 1 30  ? 23.43000 70.48300 55.92500  1.000 169.69567 ? 132 C  A N1    1 
ATOM   646  C  C2    . C  A 1 30  ? 22.51600 70.07900 56.91200  1.000 169.86675 ? 132 C  A C2    1 
ATOM   647  O  O2    . C  A 1 30  ? 21.41800 70.64900 57.01200  1.000 170.77212 ? 132 C  A O2    1 
ATOM   648  N  N3    . C  A 1 30  ? 22.83900 69.06300 57.74400  1.000 166.13735 ? 132 C  A N3    1 
ATOM   649  C  C4    . C  A 1 30  ? 24.01900 68.45400 57.62600  1.000 163.44756 ? 132 C  A C4    1 
ATOM   650  N  N4    . C  A 1 30  ? 24.29400 67.45800 58.47200  1.000 159.43655 ? 132 C  A N4    1 
ATOM   651  C  C5    . C  A 1 30  ? 24.96900 68.83700 56.63400  1.000 164.91089 ? 132 C  A C5    1 
ATOM   652  C  C6    . C  A 1 30  ? 24.63600 69.84300 55.81200  1.000 165.98470 ? 132 C  A C6    1 
ATOM   653  P  P     . A  A 1 31  ? 24.54600 75.63200 57.06400  1.000 184.90365 ? 133 A  A P     1 
ATOM   654  O  OP1   . A  A 1 31  ? 24.76500 77.08400 56.84900  1.000 184.18778 ? 133 A  A OP1   1 
ATOM   655  O  OP2   . A  A 1 31  ? 25.54400 74.84300 57.83200  1.000 176.43948 ? 133 A  A OP2   1 
ATOM   656  O  "O5'" . A  A 1 31  ? 23.12300 75.45200 57.76200  1.000 170.52825 ? 133 A  A "O5'" 1 
ATOM   657  C  "C5'" . A  A 1 31  ? 21.97200 76.11000 57.25200  1.000 170.59931 ? 133 A  A "C5'" 1 
ATOM   658  C  "C4'" . A  A 1 31  ? 20.71900 75.69500 57.98200  1.000 170.16241 ? 133 A  A "C4'" 1 
ATOM   659  O  "O4'" . A  A 1 31  ? 20.47100 74.27800 57.78100  1.000 167.70949 ? 133 A  A "O4'" 1 
ATOM   660  C  "C3'" . A  A 1 31  ? 20.74700 75.85200 59.49500  1.000 167.54631 ? 133 A  A "C3'" 1 
ATOM   661  O  "O3'" . A  A 1 31  ? 20.49900 77.18000 59.92300  1.000 165.33552 ? 133 A  A "O3'" 1 
ATOM   662  C  "C2'" . A  A 1 31  ? 19.69200 74.85100 59.94800  1.000 166.71200 ? 133 A  A "C2'" 1 
ATOM   663  O  "O2'" . A  A 1 31  ? 18.38400 75.36900 59.75000  1.000 167.31470 ? 133 A  A "O2'" 1 
ATOM   664  C  "C1'" . A  A 1 31  ? 19.91800 73.71500 58.95300  1.000 168.76488 ? 133 A  A "C1'" 1 
ATOM   665  N  N9    . A  A 1 31  ? 20.86400 72.71600 59.48400  1.000 167.14363 ? 133 A  A N9    1 
ATOM   666  C  C8    . A  A 1 31  ? 22.17500 72.52500 59.12800  1.000 167.44630 ? 133 A  A C8    1 
ATOM   667  N  N7    . A  A 1 31  ? 22.76500 71.55600 59.78300  1.000 164.82493 ? 133 A  A N7    1 
ATOM   668  C  C5    . A  A 1 31  ? 21.77300 71.08400 60.63400  1.000 161.64823 ? 133 A  A C5    1 
ATOM   669  C  C6    . A  A 1 31  ? 21.76000 70.05700 61.59400  1.000 156.23706 ? 133 A  A C6    1 
ATOM   670  N  N6    . A  A 1 31  ? 22.81900 69.28800 61.87200  1.000 154.87900 ? 133 A  A N6    1 
ATOM   671  N  N1    . A  A 1 31  ? 20.60800 69.84700 62.27400  1.000 151.67598 ? 133 A  A N1    1 
ATOM   672  C  C2    . A  A 1 31  ? 19.54700 70.61900 62.00300  1.000 155.41328 ? 133 A  A C2    1 
ATOM   673  N  N3    . A  A 1 31  ? 19.43800 71.60900 61.12000  1.000 161.66402 ? 133 A  A N3    1 
ATOM   674  C  C4    . A  A 1 31  ? 20.59800 71.79200 60.46400  1.000 162.84838 ? 133 A  A C4    1 
ATOM   675  P  P     . G  A 1 32  ? 21.15500 77.72800 61.28400  1.000 166.09411 ? 134 G  A P     1 
ATOM   676  O  OP1   . G  A 1 32  ? 20.94000 79.19600 61.34400  1.000 167.05475 ? 134 G  A OP1   1 
ATOM   677  O  OP2   . G  A 1 32  ? 22.53500 77.18900 61.38000  1.000 161.64094 ? 134 G  A OP2   1 
ATOM   678  O  "O5'" . G  A 1 32  ? 20.27200 77.06000 62.42900  1.000 161.79886 ? 134 G  A "O5'" 1 
ATOM   679  C  "C5'" . G  A 1 32  ? 18.86800 77.27300 62.48300  1.000 156.85089 ? 134 G  A "C5'" 1 
ATOM   680  C  "C4'" . G  A 1 32  ? 18.19200 76.31300 63.43000  1.000 155.50600 ? 134 G  A "C4'" 1 
ATOM   681  O  "O4'" . G  A 1 32  ? 18.33200 74.95200 62.94400  1.000 154.65589 ? 134 G  A "O4'" 1 
ATOM   682  C  "C3'" . G  A 1 32  ? 18.75500 76.25700 64.84000  1.000 153.74263 ? 134 G  A "C3'" 1 
ATOM   683  O  "O3'" . G  A 1 32  ? 18.30700 77.32500 65.65700  1.000 149.61318 ? 134 G  A "O3'" 1 
ATOM   684  C  "C2'" . G  A 1 32  ? 18.30900 74.88200 65.31700  1.000 154.40060 ? 134 G  A "C2'" 1 
ATOM   685  O  "O2'" . G  A 1 32  ? 16.93700 74.89600 65.68200  1.000 147.50767 ? 134 G  A "O2'" 1 
ATOM   686  C  "C1'" . G  A 1 32  ? 18.46000 74.06300 64.03600  1.000 157.04829 ? 134 G  A "C1'" 1 
ATOM   687  N  N9    . G  A 1 32  ? 19.78100 73.41200 63.96000  1.000 154.10320 ? 134 G  A N9    1 
ATOM   688  C  C8    . G  A 1 32  ? 20.80700 73.71200 63.09900  1.000 154.51640 ? 134 G  A C8    1 
ATOM   689  N  N7    . G  A 1 32  ? 21.86000 72.96400 63.27600  1.000 154.44008 ? 134 G  A N7    1 
ATOM   690  C  C5    . G  A 1 32  ? 21.50600 72.11700 64.31900  1.000 152.86621 ? 134 G  A C5    1 
ATOM   691  C  C6    . G  A 1 32  ? 22.23900 71.08200 64.95800  1.000 149.70793 ? 134 G  A C6    1 
ATOM   692  O  O6    . G  A 1 32  ? 23.38800 70.68900 64.71700  1.000 143.66774 ? 134 G  A O6    1 
ATOM   693  N  N1    . G  A 1 32  ? 21.50000 70.47600 65.97000  1.000 146.46018 ? 134 G  A N1    1 
ATOM   694  C  C2    . G  A 1 32  ? 20.22100 70.82400 66.32300  1.000 142.24388 ? 134 G  A C2    1 
ATOM   695  N  N2    . G  A 1 32  ? 19.67500 70.12300 67.32600  1.000 135.85627 ? 134 G  A N2    1 
ATOM   696  N  N3    . G  A 1 32  ? 19.52900 71.78700 65.73900  1.000 148.79993 ? 134 G  A N3    1 
ATOM   697  C  C4    . G  A 1 32  ? 20.22700 72.38500 64.75300  1.000 151.00809 ? 134 G  A C4    1 
ATOM   698  P  P     . U  A 1 33  ? 19.29200 77.97700 66.74500  1.000 154.09355 ? 135 U  A P     1 
ATOM   699  O  OP1   . U  A 1 33  ? 18.77700 79.32800 67.08200  1.000 153.26714 ? 135 U  A OP1   1 
ATOM   700  O  OP2   . U  A 1 33  ? 20.68600 77.82700 66.25800  1.000 156.76229 ? 135 U  A OP2   1 
ATOM   701  O  "O5'" . U  A 1 33  ? 19.10700 77.04500 68.02200  1.000 149.01399 ? 135 U  A "O5'" 1 
ATOM   702  C  "C5'" . U  A 1 33  ? 17.81300 76.78600 68.54900  1.000 148.97978 ? 135 U  A "C5'" 1 
ATOM   703  C  "C4'" . U  A 1 33  ? 17.83400 75.64200 69.53100  1.000 144.22658 ? 135 U  A "C4'" 1 
ATOM   704  O  "O4'" . U  A 1 33  ? 18.10600 74.39800 68.83100  1.000 142.94221 ? 135 U  A "O4'" 1 
ATOM   705  C  "C3'" . U  A 1 33  ? 18.91500 75.70700 70.59500  1.000 135.32814 ? 135 U  A "C3'" 1 
ATOM   706  O  "O3'" . U  A 1 33  ? 18.59500 76.57300 71.66900  1.000 138.56011 ? 135 U  A "O3'" 1 
ATOM   707  C  "C2'" . U  A 1 33  ? 19.07000 74.24700 70.99400  1.000 136.76779 ? 135 U  A "C2'" 1 
ATOM   708  O  "O2'" . U  A 1 33  ? 17.99800 73.84000 71.83500  1.000 124.62423 ? 135 U  A "O2'" 1 
ATOM   709  C  "C1'" . U  A 1 33  ? 18.90800 73.55700 69.63900  1.000 144.16341 ? 135 U  A "C1'" 1 
ATOM   710  N  N1    . U  A 1 33  ? 20.21100 73.35000 68.96000  1.000 144.36870 ? 135 U  A N1    1 
ATOM   711  C  C2    . U  A 1 33  ? 21.05200 72.34100 69.40100  1.000 135.58607 ? 135 U  A C2    1 
ATOM   712  O  O2    . U  A 1 33  ? 20.78100 71.59600 70.32700  1.000 132.92786 ? 135 U  A O2    1 
ATOM   713  N  N3    . U  A 1 33  ? 22.23600 72.22900 68.71100  1.000 137.67316 ? 135 U  A N3    1 
ATOM   714  C  C4    . U  A 1 33  ? 22.66500 73.00100 67.64700  1.000 144.48450 ? 135 U  A C4    1 
ATOM   715  O  O4    . U  A 1 33  ? 23.76600 72.77200 67.13300  1.000 143.33173 ? 135 U  A O4    1 
ATOM   716  C  C5    . U  A 1 33  ? 21.74200 74.02400 67.25400  1.000 145.13985 ? 135 U  A C5    1 
ATOM   717  C  C6    . U  A 1 33  ? 20.58500 74.15300 67.90900  1.000 146.71109 ? 135 U  A C6    1 
ATOM   718  P  P     . A  A 1 34  ? 19.72800 77.52100 72.29800  1.000 147.25172 ? 136 A  A P     1 
ATOM   719  O  OP1   . A  A 1 34  ? 19.05700 78.55700 73.11700  1.000 147.99655 ? 136 A  A OP1   1 
ATOM   720  O  OP2   . A  A 1 34  ? 20.65500 77.93800 71.21900  1.000 146.35425 ? 136 A  A OP2   1 
ATOM   721  O  "O5'" . A  A 1 34  ? 20.51300 76.55800 73.29500  1.000 146.39109 ? 136 A  A "O5'" 1 
ATOM   722  C  "C5'" . A  A 1 34  ? 19.85100 75.99600 74.42000  1.000 142.53274 ? 136 A  A "C5'" 1 
ATOM   723  C  "C4'" . A  A 1 34  ? 20.58100 74.79500 74.96600  1.000 137.27421 ? 136 A  A "C4'" 1 
ATOM   724  O  "O4'" . A  A 1 34  ? 20.66500 73.76400 73.94700  1.000 138.88493 ? 136 A  A "O4'" 1 
ATOM   725  C  "C3'" . A  A 1 34  ? 22.02700 75.02100 75.37400  1.000 126.20710 ? 136 A  A "C3'" 1 
ATOM   726  O  "O3'" . A  A 1 34  ? 22.16400 75.62800 76.64700  1.000 126.74927 ? 136 A  A "O3'" 1 
ATOM   727  C  "C2'" . A  A 1 34  ? 22.60600 73.61800 75.30000  1.000 126.43344 ? 136 A  A "C2'" 1 
ATOM   728  O  "O2'" . A  A 1 34  ? 22.20200 72.85600 76.42600  1.000 129.06270 ? 136 A  A "O2'" 1 
ATOM   729  C  "C1'" . A  A 1 34  ? 21.88900 73.07100 74.06700  1.000 134.52388 ? 136 A  A "C1'" 1 
ATOM   730  N  N9    . A  A 1 34  ? 22.67700 73.30200 72.84400  1.000 135.56085 ? 136 A  A N9    1 
ATOM   731  C  C8    . A  A 1 34  ? 22.42700 74.19100 71.82900  1.000 135.01078 ? 136 A  A C8    1 
ATOM   732  N  N7    . A  A 1 34  ? 23.32600 74.16900 70.87500  1.000 133.99750 ? 136 A  A N7    1 
ATOM   733  C  C5    . A  A 1 34  ? 24.22900 73.20200 71.29600  1.000 132.31046 ? 136 A  A C5    1 
ATOM   734  C  C6    . A  A 1 34  ? 25.41400 72.70500 70.72400  1.000 127.06772 ? 136 A  A C6    1 
ATOM   735  N  N6    . A  A 1 34  ? 25.90700 73.13200 69.55900  1.000 125.27014 ? 136 A  A N6    1 
ATOM   736  N  N1    . A  A 1 34  ? 26.08200 71.74300 71.39900  1.000 125.97812 ? 136 A  A N1    1 
ATOM   737  C  C2    . A  A 1 34  ? 25.58400 71.31700 72.56700  1.000 122.96197 ? 136 A  A C2    1 
ATOM   738  N  N3    . A  A 1 34  ? 24.48200 71.70700 73.20300  1.000 121.31177 ? 136 A  A N3    1 
ATOM   739  C  C4    . A  A 1 34  ? 23.84400 72.66300 72.50800  1.000 128.64686 ? 136 A  A C4    1 
ATOM   740  P  P     . C  A 1 35  ? 23.31800 76.71600 76.90300  1.000 136.70745 ? 137 C  A P     1 
ATOM   741  O  OP1   . C  A 1 35  ? 23.06000 77.35500 78.21600  1.000 142.04493 ? 137 C  A OP1   1 
ATOM   742  O  OP2   . C  A 1 35  ? 23.45500 77.55200 75.68300  1.000 130.25404 ? 137 C  A OP2   1 
ATOM   743  O  "O5'" . C  A 1 35  ? 24.64100 75.84400 77.05600  1.000 138.30238 ? 137 C  A "O5'" 1 
ATOM   744  C  "C5'" . C  A 1 35  ? 24.71800 74.80600 78.02200  1.000 136.28635 ? 137 C  A "C5'" 1 
ATOM   745  C  "C4'" . C  A 1 35  ? 25.80100 73.81900 77.67900  1.000 131.47788 ? 137 C  A "C4'" 1 
ATOM   746  O  "O4'" . C  A 1 35  ? 25.55800 73.28300 76.35400  1.000 124.21385 ? 137 C  A "O4'" 1 
ATOM   747  C  "C3'" . C  A 1 35  ? 27.20800 74.38600 77.59700  1.000 125.70087 ? 137 C  A "C3'" 1 
ATOM   748  O  "O3'" . C  A 1 35  ? 27.82800 74.50200 78.86600  1.000 126.70888 ? 137 C  A "O3'" 1 
ATOM   749  C  "C2'" . C  A 1 35  ? 27.90700 73.41100 76.66400  1.000 120.16336 ? 137 C  A "C2'" 1 
ATOM   750  O  "O2'" . C  A 1 35  ? 28.27400 72.23100 77.36500  1.000 123.83485 ? 137 C  A "O2'" 1 
ATOM   751  C  "C1'" . C  A 1 35  ? 26.78100 73.06600 75.68800  1.000 119.53697 ? 137 C  A "C1'" 1 
ATOM   752  N  N1    . C  A 1 35  ? 26.81100 73.90700 74.46800  1.000 125.50347 ? 137 C  A N1    1 
ATOM   753  C  C2    . C  A 1 35  ? 27.76700 73.63400 73.48600  1.000 122.38994 ? 137 C  A C2    1 
ATOM   754  O  O2    . C  A 1 35  ? 28.56400 72.70300 73.67000  1.000 115.66019 ? 137 C  A O2    1 
ATOM   755  N  N3    . C  A 1 35  ? 27.80200 74.38900 72.36500  1.000 124.87445 ? 137 C  A N3    1 
ATOM   756  C  C4    . C  A 1 35  ? 26.92500 75.38300 72.20400  1.000 125.11395 ? 137 C  A C4    1 
ATOM   757  N  N4    . C  A 1 35  ? 26.99600 76.10700 71.08500  1.000 119.83964 ? 137 C  A N4    1 
ATOM   758  C  C5    . C  A 1 35  ? 25.93600 75.68300 73.18500  1.000 131.10415 ? 137 C  A C5    1 
ATOM   759  C  C6    . C  A 1 35  ? 25.91400 74.92600 74.28900  1.000 129.88295 ? 137 C  A C6    1 
ATOM   760  P  P     . C  A 1 36  ? 28.87100 75.69100 79.14600  1.000 129.77798 ? 138 C  A P     1 
ATOM   761  O  OP1   . C  A 1 36  ? 29.29600 75.58900 80.56500  1.000 129.67270 ? 138 C  A OP1   1 
ATOM   762  O  OP2   . C  A 1 36  ? 28.26200 76.94800 78.63700  1.000 135.81818 ? 138 C  A OP2   1 
ATOM   763  O  "O5'" . C  A 1 36  ? 30.13100 75.32000 78.24300  1.000 129.42794 ? 138 C  A "O5'" 1 
ATOM   764  C  "C5'" . C  A 1 36  ? 30.84600 74.10700 78.46000  1.000 124.31416 ? 138 C  A "C5'" 1 
ATOM   765  C  "C4'" . C  A 1 36  ? 32.15100 74.07000 77.70600  1.000 115.73945 ? 138 C  A "C4'" 1 
ATOM   766  O  "O4'" . C  A 1 36  ? 31.88800 74.13900 76.27700  1.000 109.80190 ? 138 C  A "O4'" 1 
ATOM   767  C  "C3'" . C  A 1 36  ? 33.12200 75.20800 78.02000  1.000 114.17611 ? 138 C  A "C3'" 1 
ATOM   768  O  "O3'" . C  A 1 36  ? 34.45700 74.71100 78.00600  1.000 114.32613 ? 138 C  A "O3'" 1 
ATOM   769  C  "C2'" . C  A 1 36  ? 32.92600 76.16400 76.84800  1.000 119.21355 ? 138 C  A "C2'" 1 
ATOM   770  O  "O2'" . C  A 1 36  ? 34.04700 76.97800 76.57200  1.000 123.22456 ? 138 C  A "O2'" 1 
ATOM   771  C  "C1'" . C  A 1 36  ? 32.63500 75.19400 75.70700  1.000 112.82068 ? 138 C  A "C1'" 1 
ATOM   772  N  N1    . C  A 1 36  ? 31.84900 75.77500 74.60900  1.000 118.17395 ? 138 C  A N1    1 
ATOM   773  C  C2    . C  A 1 36  ? 32.45300 75.93300 73.35900  1.000 121.19011 ? 138 C  A C2    1 
ATOM   774  O  O2    . C  A 1 36  ? 33.63300 75.58600 73.21500  1.000 119.65834 ? 138 C  A O2    1 
ATOM   775  N  N3    . C  A 1 36  ? 31.74200 76.46500 72.34000  1.000 124.30101 ? 138 C  A N3    1 
ATOM   776  C  C4    . C  A 1 36  ? 30.47500 76.83000 72.53300  1.000 123.95623 ? 138 C  A C4    1 
ATOM   777  N  N4    . C  A 1 36  ? 29.81800 77.34900 71.49500  1.000 125.37482 ? 138 C  A N4    1 
ATOM   778  C  C5    . C  A 1 36  ? 29.82900 76.67900 73.79600  1.000 125.41430 ? 138 C  A C5    1 
ATOM   779  C  C6    . C  A 1 36  ? 30.54700 76.15000 74.79800  1.000 125.76960 ? 138 C  A C6    1 
ATOM   780  P  P     . A  A 1 37  ? 35.43700 75.01900 79.23800  1.000 117.07808 ? 139 A  A P     1 
ATOM   781  O  OP1   . A  A 1 37  ? 34.75500 76.00500 80.11000  1.000 113.09340 ? 139 A  A OP1   1 
ATOM   782  O  OP2   . A  A 1 37  ? 36.78500 75.32400 78.68700  1.000 124.22368 ? 139 A  A OP2   1 
ATOM   783  O  "O5'" . A  A 1 37  ? 35.51000 73.63800 80.03000  1.000 108.38494 ? 139 A  A "O5'" 1 
ATOM   784  C  "C5'" . A  A 1 37  ? 34.42000 73.18900 80.82500  1.000 110.76154 ? 139 A  A "C5'" 1 
ATOM   785  C  "C4'" . A  A 1 37  ? 34.49500 71.70200 81.05800  1.000 111.56163 ? 139 A  A "C4'" 1 
ATOM   786  O  "O4'" . A  A 1 37  ? 34.13700 71.00300 79.83800  1.000 99.90497  ? 139 A  A "O4'" 1 
ATOM   787  C  "C3'" . A  A 1 37  ? 35.87700 71.17100 81.41500  1.000 100.42609 ? 139 A  A "C3'" 1 
ATOM   788  O  "O3'" . A  A 1 37  ? 36.15000 71.26600 82.80000  1.000 102.48423 ? 139 A  A "O3'" 1 
ATOM   789  C  "C2'" . A  A 1 37  ? 35.83200 69.74000 80.90600  1.000 107.11899 ? 139 A  A "C2'" 1 
ATOM   790  O  "O2'" . A  A 1 37  ? 35.12800 68.90900 81.81800  1.000 113.69347 ? 139 A  A "O2'" 1 
ATOM   791  C  "C1'" . A  A 1 37  ? 34.99100 69.90100 79.64300  1.000 105.02664 ? 139 A  A "C1'" 1 
ATOM   792  N  N9    . A  A 1 37  ? 35.81900 70.20500 78.46500  1.000 112.25382 ? 139 A  A N9    1 
ATOM   793  C  C8    . A  A 1 37  ? 35.71600 71.32000 77.67100  1.000 112.73809 ? 139 A  A C8    1 
ATOM   794  N  N7    . A  A 1 37  ? 36.57700 71.34400 76.68500  1.000 110.24569 ? 139 A  A N7    1 
ATOM   795  C  C5    . A  A 1 37  ? 37.29100 70.16500 76.84600  1.000 107.81118 ? 139 A  A C5    1 
ATOM   796  C  C6    . A  A 1 37  ? 38.34900 69.60500 76.11500  1.000 106.55314 ? 139 A  A C6    1 
ATOM   797  N  N6    . A  A 1 37  ? 38.89100 70.18100 75.04100  1.000 106.57419 ? 139 A  A N6    1 
ATOM   798  N  N1    . A  A 1 37  ? 38.84200 68.42000 76.53100  1.000 105.56881 ? 139 A  A N1    1 
ATOM   799  C  C2    . A  A 1 37  ? 38.30000 67.84400 77.61100  1.000 109.99039 ? 139 A  A C2    1 
ATOM   800  N  N3    . A  A 1 37  ? 37.30100 68.26800 78.38000  1.000 107.44272 ? 139 A  A N3    1 
ATOM   801  C  C4    . A  A 1 37  ? 36.83500 69.45000 77.93800  1.000 109.35611 ? 139 A  A C4    1 
ATOM   802  P  P     . A  A 1 38  ? 37.58300 71.76300 83.32000  1.000 114.39919 ? 140 A  A P     1 
ATOM   803  O  OP1   . A  A 1 38  ? 37.46300 71.99200 84.78400  1.000 118.65233 ? 140 A  A OP1   1 
ATOM   804  O  OP2   . A  A 1 38  ? 38.05500 72.85900 82.43300  1.000 112.76478 ? 140 A  A OP2   1 
ATOM   805  O  "O5'" . A  A 1 38  ? 38.51600 70.49100 83.11400  1.000 112.34368 ? 140 A  A "O5'" 1 
ATOM   806  C  "C5'" . A  A 1 38  ? 38.17800 69.24400 83.70400  1.000 110.74085 ? 140 A  A "C5'" 1 
ATOM   807  C  "C4'" . A  A 1 38  ? 39.03100 68.13100 83.15600  1.000 111.59622 ? 140 A  A "C4'" 1 
ATOM   808  O  "O4'" . A  A 1 38  ? 38.74600 67.95600 81.74300  1.000 118.87077 ? 140 A  A "O4'" 1 
ATOM   809  C  "C3'" . A  A 1 38  ? 40.53300 68.36700 83.20900  1.000 105.89553 ? 140 A  A "C3'" 1 
ATOM   810  O  "O3'" . A  A 1 38  ? 41.09600 68.04800 84.46900  1.000 109.97760 ? 140 A  A "O3'" 1 
ATOM   811  C  "C2'" . A  A 1 38  ? 41.04900 67.49600 82.07300  1.000 108.83010 ? 140 A  A "C2'" 1 
ATOM   812  O  "O2'" . A  A 1 38  ? 41.09700 66.13300 82.47100  1.000 109.09855 ? 140 A  A "O2'" 1 
ATOM   813  C  "C1'" . A  A 1 38  ? 39.93600 67.66700 81.04200  1.000 109.09329 ? 140 A  A "C1'" 1 
ATOM   814  N  N9    . A  A 1 38  ? 40.21200 68.78700 80.12400  1.000 102.28721 ? 140 A  A N9    1 
ATOM   815  C  C8    . A  A 1 38  ? 39.55400 69.98600 80.04700  1.000 102.75042 ? 140 A  A C8    1 
ATOM   816  N  N7    . A  A 1 38  ? 40.02500 70.79200 79.13200  1.000 103.08204 ? 140 A  A N7    1 
ATOM   817  C  C5    . A  A 1 38  ? 41.06800 70.07100 78.57100  1.000 107.33518 ? 140 A  A C5    1 
ATOM   818  C  C6    . A  A 1 38  ? 41.97500 70.37000 77.54000  1.000 108.06421 ? 140 A  A C6    1 
ATOM   819  N  N6    . A  A 1 38  ? 41.97300 71.52400 76.86600  1.000 109.86443 ? 140 A  A N6    1 
ATOM   820  N  N1    . A  A 1 38  ? 42.89900 69.43200 77.22200  1.000 109.92496 ? 140 A  A N1    1 
ATOM   821  C  C2    . A  A 1 38  ? 42.90100 68.27400 77.90000  1.000 108.93274 ? 140 A  A C2    1 
ATOM   822  N  N3    . A  A 1 38  ? 42.09700 67.88000 78.88700  1.000 101.40552 ? 140 A  A N3    1 
ATOM   823  C  C4    . A  A 1 38  ? 41.19600 68.83500 79.17400  1.000 105.54549 ? 140 A  A C4    1 
ATOM   824  P  P     . G  A 1 39  ? 42.11000 69.06600 85.18800  1.000 110.01087 ? 141 G  A P     1 
ATOM   825  O  OP1   . G  A 1 39  ? 42.53300 68.44400 86.46900  1.000 104.20227 ? 141 G  A OP1   1 
ATOM   826  O  OP2   . G  A 1 39  ? 41.47500 70.41000 85.20000  1.000 110.47671 ? 141 G  A OP2   1 
ATOM   827  O  "O5'" . G  A 1 39  ? 43.37000 69.11600 84.21100  1.000 106.38675 ? 141 G  A "O5'" 1 
ATOM   828  C  "C5'" . G  A 1 39  ? 44.10900 67.93800 83.92000  1.000 104.46810 ? 141 G  A "C5'" 1 
ATOM   829  C  "C4'" . G  A 1 39  ? 45.03100 68.13300 82.74300  1.000 105.28662 ? 141 G  A "C4'" 1 
ATOM   830  O  "O4'" . G  A 1 39  ? 44.25800 68.40300 81.54400  1.000 105.77088 ? 141 G  A "O4'" 1 
ATOM   831  C  "C3'" . G  A 1 39  ? 45.98800 69.30900 82.83500  1.000 109.66872 ? 141 G  A "C3'" 1 
ATOM   832  O  "O3'" . G  A 1 39  ? 47.13000 69.03200 83.62600  1.000 118.15921 ? 141 G  A "O3'" 1 
ATOM   833  C  "C2'" . G  A 1 39  ? 46.30800 69.58700 81.37300  1.000 109.44238 ? 141 G  A "C2'" 1 
ATOM   834  O  "O2'" . G  A 1 39  ? 47.25200 68.64900 80.87700  1.000 116.01422 ? 141 G  A "O2'" 1 
ATOM   835  C  "C1'" . G  A 1 39  ? 44.95800 69.30800 80.71600  1.000 102.81790 ? 141 G  A "C1'" 1 
ATOM   836  N  N9    . G  A 1 39  ? 44.15600 70.53700 80.58600  1.000 101.72566 ? 141 G  A N9    1 
ATOM   837  C  C8    . G  A 1 39  ? 43.02000 70.85500 81.28700  1.000 109.70030 ? 141 G  A C8    1 
ATOM   838  N  N7    . G  A 1 39  ? 42.52300 72.01700 80.96400  1.000 110.61883 ? 141 G  A N7    1 
ATOM   839  C  C5    . G  A 1 39  ? 43.39100 72.50100 79.99400  1.000 102.03359 ? 141 G  A C5    1 
ATOM   840  C  C6    . G  A 1 39  ? 43.37000 73.72100 79.26600  1.000 106.05513 ? 141 G  A C6    1 
ATOM   841  O  O6    . G  A 1 39  ? 42.55300 74.64800 79.33800  1.000 107.70533 ? 141 G  A O6    1 
ATOM   842  N  N1    . G  A 1 39  ? 44.43800 73.80800 78.37900  1.000 110.95835 ? 141 G  A N1    1 
ATOM   843  C  C2    . G  A 1 39  ? 45.40100 72.84500 78.21200  1.000 110.57672 ? 141 G  A C2    1 
ATOM   844  N  N2    . G  A 1 39  ? 46.34900 73.11500 77.30400  1.000 115.85630 ? 141 G  A N2    1 
ATOM   845  N  N3    . G  A 1 39  ? 45.43400 71.70500 78.88500  1.000 106.21567 ? 141 G  A N3    1 
ATOM   846  C  C4    . G  A 1 39  ? 44.40600 71.60000 79.75200  1.000 99.40959  ? 141 G  A C4    1 
ATOM   847  P  P     . U  A 1 40  ? 47.70200 70.14500 84.63300  1.000 118.95310 ? 142 U  A P     1 
ATOM   848  O  OP1   . U  A 1 40  ? 48.77900 69.52400 85.44400  1.000 116.71336 ? 142 U  A OP1   1 
ATOM   849  O  OP2   . U  A 1 40  ? 46.54900 70.78000 85.31900  1.000 116.95023 ? 142 U  A OP2   1 
ATOM   850  O  "O5'" . U  A 1 40  ? 48.37500 71.21900 83.66900  1.000 108.51764 ? 142 U  A "O5'" 1 
ATOM   851  C  "C5'" . U  A 1 40  ? 49.42500 70.84600 82.78900  1.000 107.10694 ? 142 U  A "C5'" 1 
ATOM   852  C  "C4'" . U  A 1 40  ? 49.72500 71.93100 81.78700  1.000 110.84950 ? 142 U  A "C4'" 1 
ATOM   853  O  "O4'" . U  A 1 40  ? 48.57700 72.14800 80.92600  1.000 112.28125 ? 142 U  A "O4'" 1 
ATOM   854  C  "C3'" . U  A 1 40  ? 50.01000 73.30800 82.36200  1.000 114.77628 ? 142 U  A "C3'" 1 
ATOM   855  O  "O3'" . U  A 1 40  ? 51.32200 73.43800 82.87800  1.000 120.27957 ? 142 U  A "O3'" 1 
ATOM   856  C  "C2'" . U  A 1 40  ? 49.70600 74.22200 81.18200  1.000 114.87366 ? 142 U  A "C2'" 1 
ATOM   857  O  "O2'" . U  A 1 40  ? 50.76900 74.20500 80.23900  1.000 104.71192 ? 142 U  A "O2'" 1 
ATOM   858  C  "C1'" . U  A 1 40  ? 48.49900 73.51200 80.56500  1.000 113.64983 ? 142 U  A "C1'" 1 
ATOM   859  N  N1    . U  A 1 40  ? 47.22000 74.06100 81.06800  1.000 117.35554 ? 142 U  A N1    1 
ATOM   860  C  C2    . U  A 1 40  ? 46.77200 75.24300 80.50900  1.000 114.44730 ? 142 U  A C2    1 
ATOM   861  O  O2    . U  A 1 40  ? 47.37900 75.83600 79.63300  1.000 109.89412 ? 142 U  A O2    1 
ATOM   862  N  N3    . U  A 1 40  ? 45.58200 75.71000 81.01000  1.000 118.12932 ? 142 U  A N3    1 
ATOM   863  C  C4    . U  A 1 40  ? 44.81700 75.12000 81.99500  1.000 115.40794 ? 142 U  A C4    1 
ATOM   864  O  O4    . U  A 1 40  ? 43.76800 75.65400 82.34800  1.000 120.05060 ? 142 U  A O4    1 
ATOM   865  C  C5    . U  A 1 40  ? 45.34600 73.90100 82.52400  1.000 113.08924 ? 142 U  A C5    1 
ATOM   866  C  C6    . U  A 1 40  ? 46.50200 73.42500 82.05500  1.000 115.19475 ? 142 U  A C6    1 
ATOM   867  P  P     . C  A 1 41  ? 51.56800 74.25300 84.24100  1.000 123.90816 ? 143 C  A P     1 
ATOM   868  O  OP1   . C  A 1 41  ? 52.92000 73.91000 84.74600  1.000 123.15018 ? 143 C  A OP1   1 
ATOM   869  O  OP2   . C  A 1 41  ? 50.39700 74.06600 85.13500  1.000 122.16848 ? 143 C  A OP2   1 
ATOM   870  O  "O5'" . C  A 1 41  ? 51.60000 75.76800 83.76000  1.000 115.12290 ? 143 C  A "O5'" 1 
ATOM   871  C  "C5'" . C  A 1 41  ? 52.51800 76.17600 82.75700  1.000 113.29110 ? 143 C  A "C5'" 1 
ATOM   872  C  "C4'" . C  A 1 41  ? 52.12600 77.49500 82.14700  1.000 111.56195 ? 143 C  A "C4'" 1 
ATOM   873  O  "O4'" . C  A 1 41  ? 50.85800 77.36000 81.45400  1.000 116.27830 ? 143 C  A "O4'" 1 
ATOM   874  C  "C3'" . C  A 1 41  ? 51.89200 78.63400 83.12500  1.000 117.05208 ? 143 C  A "C3'" 1 
ATOM   875  O  "O3'" . C  A 1 41  ? 53.09300 79.24300 83.56700  1.000 120.17087 ? 143 C  A "O3'" 1 
ATOM   876  C  "C2'" . C  A 1 41  ? 50.97800 79.56200 82.33700  1.000 119.16023 ? 143 C  A "C2'" 1 
ATOM   877  O  "O2'" . C  A 1 41  ? 51.72300 80.32200 81.39600  1.000 120.84201 ? 143 C  A "O2'" 1 
ATOM   878  C  "C1'" . C  A 1 41  ? 50.11300 78.55500 81.57500  1.000 118.91546 ? 143 C  A "C1'" 1 
ATOM   879  N  N1    . C  A 1 41  ? 48.84400 78.25700 82.28200  1.000 118.26801 ? 143 C  A N1    1 
ATOM   880  C  C2    . C  A 1 41  ? 47.80300 79.19000 82.22900  1.000 120.17877 ? 143 C  A C2    1 
ATOM   881  O  O2    . C  A 1 41  ? 47.96300 80.24300 81.59400  1.000 119.85242 ? 143 C  A O2    1 
ATOM   882  N  N3    . C  A 1 41  ? 46.64200 78.92500 82.87200  1.000 121.43945 ? 143 C  A N3    1 
ATOM   883  C  C4    . C  A 1 41  ? 46.49500 77.78400 83.54800  1.000 119.35762 ? 143 C  A C4    1 
ATOM   884  N  N4    . C  A 1 41  ? 45.32800 77.56900 84.16700  1.000 114.77286 ? 143 C  A N4    1 
ATOM   885  C  C5    . C  A 1 41  ? 47.54100 76.81600 83.61800  1.000 118.83124 ? 143 C  A C5    1 
ATOM   886  C  C6    . C  A 1 41  ? 48.68400 77.09200 82.97800  1.000 116.68361 ? 143 C  A C6    1 
ATOM   887  P  P     . U  A 1 42  ? 53.23400 79.74100 85.08900  1.000 131.75108 ? 144 U  A P     1 
ATOM   888  O  OP1   . U  A 1 42  ? 54.68300 79.82700 85.40200  1.000 135.19360 ? 144 U  A OP1   1 
ATOM   889  O  OP2   . U  A 1 42  ? 52.37300 78.88700 85.94700  1.000 118.79689 ? 144 U  A OP2   1 
ATOM   890  O  "O5'" . U  A 1 42  ? 52.61500 81.21100 85.06700  1.000 132.91701 ? 144 U  A "O5'" 1 
ATOM   891  C  "C5'" . U  A 1 42  ? 53.02800 82.16400 84.09400  1.000 128.48753 ? 144 U  A "C5'" 1 
ATOM   892  C  "C4'" . U  A 1 42  ? 52.00300 83.25500 83.90900  1.000 129.12445 ? 144 U  A "C4'" 1 
ATOM   893  O  "O4'" . U  A 1 42  ? 50.78900 82.69400 83.34300  1.000 131.67475 ? 144 U  A "O4'" 1 
ATOM   894  C  "C3'" . U  A 1 42  ? 51.53700 83.94400 85.18100  1.000 133.61709 ? 144 U  A "C3'" 1 
ATOM   895  O  "O3'" . U  A 1 42  ? 52.42700 84.95500 85.61800  1.000 135.04095 ? 144 U  A "O3'" 1 
ATOM   896  C  "C2'" . U  A 1 42  ? 50.15200 84.45700 84.80700  1.000 137.68337 ? 144 U  A "C2'" 1 
ATOM   897  O  "O2'" . U  A 1 42  ? 50.23600 85.66900 84.06800  1.000 141.35223 ? 144 U  A "O2'" 1 
ATOM   898  C  "C1'" . U  A 1 42  ? 49.65600 83.34300 83.88200  1.000 134.34086 ? 144 U  A "C1'" 1 
ATOM   899  N  N1    . U  A 1 42  ? 48.84200 82.34200 84.61000  1.000 129.79558 ? 144 U  A N1    1 
ATOM   900  C  C2    . U  A 1 42  ? 47.51800 82.64800 84.86000  1.000 132.53538 ? 144 U  A C2    1 
ATOM   901  O  O2    . U  A 1 42  ? 47.00000 83.69300 84.50700  1.000 135.44889 ? 144 U  A O2    1 
ATOM   902  N  N3    . U  A 1 42  ? 46.81800 81.68100 85.54000  1.000 130.43776 ? 144 U  A N3    1 
ATOM   903  C  C4    . U  A 1 42  ? 47.30000 80.46600 85.98600  1.000 123.62115 ? 144 U  A C4    1 
ATOM   904  O  O4    . U  A 1 42  ? 46.54500 79.69800 86.58700  1.000 118.78636 ? 144 U  A O4    1 
ATOM   905  C  C5    . U  A 1 42  ? 48.67900 80.22500 85.68900  1.000 121.28403 ? 144 U  A C5    1 
ATOM   906  C  C6    . U  A 1 42  ? 49.38100 81.15000 85.03000  1.000 123.70801 ? 144 U  A C6    1 
ATOM   907  P  P     . C  A 1 43  ? 52.88200 85.01200 87.15600  1.000 140.90914 ? 145 C  A P     1 
ATOM   908  O  OP1   . C  A 1 43  ? 54.14100 85.80000 87.20400  1.000 144.05162 ? 145 C  A OP1   1 
ATOM   909  O  OP2   . C  A 1 43  ? 52.86100 83.62400 87.68700  1.000 128.44448 ? 145 C  A OP2   1 
ATOM   910  O  "O5'" . C  A 1 43  ? 51.70400 85.81300 87.87600  1.000 142.87253 ? 145 C  A "O5'" 1 
ATOM   911  C  "C5'" . C  A 1 43  ? 51.39900 87.15300 87.51300  1.000 143.75948 ? 145 C  A "C5'" 1 
ATOM   912  C  "C4'" . C  A 1 43  ? 49.98000 87.53000 87.86900  1.000 145.10174 ? 145 C  A "C4'" 1 
ATOM   913  O  "O4'" . C  A 1 43  ? 49.04400 86.66700 87.17000  1.000 140.36697 ? 145 C  A "O4'" 1 
ATOM   914  C  "C3'" . C  A 1 43  ? 49.58800 87.38300 89.33000  1.000 149.13907 ? 145 C  A "C3'" 1 
ATOM   915  O  "O3'" . C  A 1 43  ? 50.04200 88.45400 90.14100  1.000 151.11299 ? 145 C  A "O3'" 1 
ATOM   916  C  "C2'" . C  A 1 43  ? 48.07100 87.26600 89.25600  1.000 149.41805 ? 145 C  A "C2'" 1 
ATOM   917  O  "O2'" . C  A 1 43  ? 47.47300 88.54300 89.08000  1.000 153.89490 ? 145 C  A "O2'" 1 
ATOM   918  C  "C1'" . C  A 1 43  ? 47.89500 86.45600 87.96900  1.000 142.46985 ? 145 C  A "C1'" 1 
ATOM   919  N  N1    . C  A 1 43  ? 47.76000 85.00600 88.24800  1.000 138.82204 ? 145 C  A N1    1 
ATOM   920  C  C2    . C  A 1 43  ? 46.50900 84.49900 88.62700  1.000 141.73555 ? 145 C  A C2    1 
ATOM   921  O  O2    . C  A 1 43  ? 45.53900 85.26800 88.71000  1.000 143.94371 ? 145 C  A O2    1 
ATOM   922  N  N3    . C  A 1 43  ? 46.38300 83.17700 88.89300  1.000 139.76163 ? 145 C  A N3    1 
ATOM   923  C  C4    . C  A 1 43  ? 47.44200 82.37000 88.79600  1.000 136.89813 ? 145 C  A C4    1 
ATOM   924  N  N4    . C  A 1 43  ? 47.26900 81.07200 89.06700  1.000 137.48241 ? 145 C  A N4    1 
ATOM   925  C  C5    . C  A 1 43  ? 48.72700 82.86100 88.41600  1.000 136.52703 ? 145 C  A C5    1 
ATOM   926  C  C6    . C  A 1 43  ? 48.83800 84.17000 88.15600  1.000 137.60611 ? 145 C  A C6    1 
ATOM   927  P  P     . A  A 1 44  ? 50.31000 88.21900 91.70800  1.000 158.96992 ? 146 A  A P     1 
ATOM   928  O  OP1   . A  A 1 44  ? 51.01900 89.41200 92.23400  1.000 157.16971 ? 146 A  A OP1   1 
ATOM   929  O  OP2   . A  A 1 44  ? 50.91600 86.87400 91.88000  1.000 150.74788 ? 146 A  A OP2   1 
ATOM   930  O  "O5'" . A  A 1 44  ? 48.85300 88.17500 92.35300  1.000 151.75590 ? 146 A  A "O5'" 1 
ATOM   931  C  "C5'" . A  A 1 44  ? 47.99500 89.30500 92.30700  1.000 151.13740 ? 146 A  A "C5'" 1 
ATOM   932  C  "C4'" . A  A 1 44  ? 46.60300 88.96000 92.77500  1.000 152.27965 ? 146 A  A "C4'" 1 
ATOM   933  O  "O4'" . A  A 1 44  ? 45.97000 88.05200 91.83200  1.000 146.92900 ? 146 A  A "O4'" 1 
ATOM   934  C  "C3'" . A  A 1 44  ? 46.50700 88.22300 94.10000  1.000 150.40837 ? 146 A  A "C3'" 1 
ATOM   935  O  "O3'" . A  A 1 44  ? 46.66400 89.06500 95.22700  1.000 147.87385 ? 146 A  A "O3'" 1 
ATOM   936  C  "C2'" . A  A 1 44  ? 45.14300 87.55600 94.00000  1.000 148.83450 ? 146 A  A "C2'" 1 
ATOM   937  O  "O2'" . A  A 1 44  ? 44.10200 88.50100 94.20700  1.000 149.00031 ? 146 A  A "O2'" 1 
ATOM   938  C  "C1'" . A  A 1 44  ? 45.13200 87.14700 92.52800  1.000 148.10020 ? 146 A  A "C1'" 1 
ATOM   939  N  N9    . A  A 1 44  ? 45.66200 85.78100 92.34900  1.000 145.44198 ? 146 A  A N9    1 
ATOM   940  C  C8    . A  A 1 44  ? 46.91600 85.41400 91.92800  1.000 142.69955 ? 146 A  A C8    1 
ATOM   941  N  N7    . A  A 1 44  ? 47.09900 84.11700 91.87600  1.000 141.01251 ? 146 A  A N7    1 
ATOM   942  C  C5    . A  A 1 44  ? 45.88400 83.59200 92.29300  1.000 140.38085 ? 146 A  A C5    1 
ATOM   943  C  C6    . A  A 1 44  ? 45.42900 82.27100 92.45700  1.000 137.80949 ? 146 A  A C6    1 
ATOM   944  N  N6    . A  A 1 44  ? 46.17000 81.18900 92.21000  1.000 134.37487 ? 146 A  A N6    1 
ATOM   945  N  N1    . A  A 1 44  ? 44.16200 82.09400 92.89100  1.000 136.27773 ? 146 A  A N1    1 
ATOM   946  C  C2    . A  A 1 44  ? 43.41200 83.17500 93.14000  1.000 139.21755 ? 146 A  A C2    1 
ATOM   947  N  N3    . A  A 1 44  ? 43.72900 84.46300 93.02500  1.000 143.31015 ? 146 A  A N3    1 
ATOM   948  C  C4    . A  A 1 44  ? 44.99200 84.60600 92.59100  1.000 142.77324 ? 146 A  A C4    1 
ATOM   949  P  P     . G  A 1 45  ? 47.40300 88.51000 96.54100  1.000 156.55698 ? 147 G  A P     1 
ATOM   950  O  OP1   . G  A 1 45  ? 47.84800 89.67900 97.34300  1.000 159.74420 ? 147 G  A OP1   1 
ATOM   951  O  OP2   . G  A 1 45  ? 48.40400 87.49700 96.12200  1.000 156.87544 ? 147 G  A OP2   1 
ATOM   952  O  "O5'" . G  A 1 45  ? 46.24200 87.76100 97.33600  1.000 147.68486 ? 147 G  A "O5'" 1 
ATOM   953  C  "C5'" . G  A 1 45  ? 45.08300 88.46500 97.75700  1.000 148.53496 ? 147 G  A "C5'" 1 
ATOM   954  C  "C4'" . G  A 1 45  ? 44.02700 87.53500 98.30100  1.000 147.85857 ? 147 G  A "C4'" 1 
ATOM   955  O  "O4'" . G  A 1 45  ? 43.43100 86.76800 97.22100  1.000 149.61404 ? 147 G  A "O4'" 1 
ATOM   956  C  "C3'" . G  A 1 45  ? 44.50700 86.47400 99.27600  1.000 141.54202 ? 147 G  A "C3'" 1 
ATOM   957  O  "O3'" . G  A 1 45  ? 44.72300 86.96600 100.58700 1.000 137.28888 ? 147 G  A "O3'" 1 
ATOM   958  C  "C2'" . G  A 1 45  ? 43.41100 85.42200 99.17700  1.000 139.18121 ? 147 G  A "C2'" 1 
ATOM   959  O  "O2'" . G  A 1 45  ? 42.25600 85.82500 99.89700  1.000 134.54118 ? 147 G  A "O2'" 1 
ATOM   960  C  "C1'" . G  A 1 45  ? 43.09400 85.47300 97.68300  1.000 147.01899 ? 147 G  A "C1'" 1 
ATOM   961  N  N9    . G  A 1 45  ? 43.89000 84.48300 96.93500  1.000 145.60040 ? 147 G  A N9    1 
ATOM   962  C  C8    . G  A 1 45  ? 44.94300 84.72400 96.08600  1.000 140.01026 ? 147 G  A C8    1 
ATOM   963  N  N7    . G  A 1 45  ? 45.45400 83.63400 95.58200  1.000 137.82579 ? 147 G  A N7    1 
ATOM   964  C  C5    . G  A 1 45  ? 44.69600 82.61100 96.13300  1.000 136.90725 ? 147 G  A C5    1 
ATOM   965  C  C6    . G  A 1 45  ? 44.78200 81.20500 95.95900  1.000 133.97532 ? 147 G  A C6    1 
ATOM   966  O  O6    . G  A 1 45  ? 45.57000 80.55900 95.25500  1.000 133.28050 ? 147 G  A O6    1 
ATOM   967  N  N1    . G  A 1 45  ? 43.81900 80.53900 96.71000  1.000 134.38853 ? 147 G  A N1    1 
ATOM   968  C  C2    . G  A 1 45  ? 42.89400 81.14200 97.52500  1.000 133.35157 ? 147 G  A C2    1 
ATOM   969  N  N2    . G  A 1 45  ? 42.04500 80.32700 98.17000  1.000 126.24545 ? 147 G  A N2    1 
ATOM   970  N  N3    . G  A 1 45  ? 42.80700 82.45000 97.69500  1.000 137.51522 ? 147 G  A N3    1 
ATOM   971  C  C4    . G  A 1 45  ? 43.73000 83.11800 96.97400  1.000 140.51821 ? 147 G  A C4    1 
ATOM   972  P  P     . G  A 1 46  ? 45.91600 86.36700 101.48000 1.000 154.00871 ? 148 G  A P     1 
ATOM   973  O  OP1   . G  A 1 46  ? 45.99100 87.16700 102.73000 1.000 154.81670 ? 148 G  A OP1   1 
ATOM   974  O  OP2   . G  A 1 46  ? 47.11900 86.23300 100.61800 1.000 152.52695 ? 148 G  A OP2   1 
ATOM   975  O  "O5'" . G  A 1 46  ? 45.40900 84.90400 101.85700 1.000 143.06529 ? 148 G  A "O5'" 1 
ATOM   976  C  "C5'" . G  A 1 46  ? 44.21600 84.72800 102.60600 1.000 134.47479 ? 148 G  A "C5'" 1 
ATOM   977  C  "C4'" . G  A 1 46  ? 43.84900 83.27300 102.75600 1.000 129.91371 ? 148 G  A "C4'" 1 
ATOM   978  O  "O4'" . G  A 1 46  ? 43.49200 82.70800 101.46500 1.000 133.89840 ? 148 G  A "O4'" 1 
ATOM   979  C  "C3'" . G  A 1 46  ? 44.94400 82.35100 103.26200 1.000 124.64993 ? 148 G  A "C3'" 1 
ATOM   980  O  "O3'" . G  A 1 46  ? 45.15100 82.43300 104.66300 1.000 128.71883 ? 148 G  A "O3'" 1 
ATOM   981  C  "C2'" . G  A 1 46  ? 44.46300 80.98900 102.78400 1.000 126.87388 ? 148 G  A "C2'" 1 
ATOM   982  O  "O2'" . G  A 1 46  ? 43.40900 80.51200 103.60700 1.000 125.87112 ? 148 G  A "O2'" 1 
ATOM   983  C  "C1'" . G  A 1 46  ? 43.88200 81.34900 101.41500 1.000 136.82244 ? 148 G  A "C1'" 1 
ATOM   984  N  N9    . G  A 1 46  ? 44.89200 81.18700 100.35200 1.000 137.19617 ? 148 G  A N9    1 
ATOM   985  C  C8    . G  A 1 46  ? 45.45600 82.17000 99.57600  1.000 134.05895 ? 148 G  A C8    1 
ATOM   986  N  N7    . G  A 1 46  ? 46.33900 81.71600 98.72900  1.000 129.72685 ? 148 G  A N7    1 
ATOM   987  C  C5    . G  A 1 46  ? 46.36600 80.34800 98.96400  1.000 128.34511 ? 148 G  A C5    1 
ATOM   988  C  C6    . G  A 1 46  ? 47.13500 79.32400 98.34700  1.000 128.61882 ? 148 G  A C6    1 
ATOM   989  O  O6    . G  A 1 46  ? 47.97200 79.42400 97.43900  1.000 129.64000 ? 148 G  A O6    1 
ATOM   990  N  N1    . G  A 1 46  ? 46.84500 78.07500 98.89100  1.000 125.95271 ? 148 G  A N1    1 
ATOM   991  C  C2    . G  A 1 46  ? 45.93900 77.83800 99.89700  1.000 122.88919 ? 148 G  A C2    1 
ATOM   992  N  N2    . G  A 1 46  ? 45.79700 76.56400 100.29400 1.000 115.08562 ? 148 G  A N2    1 
ATOM   993  N  N3    . G  A 1 46  ? 45.22100 78.78400 100.47700 1.000 127.91611 ? 148 G  A N3    1 
ATOM   994  C  C4    . G  A 1 46  ? 45.48100 80.00600 99.96500  1.000 129.87950 ? 148 G  A C4    1 
ATOM   995  P  P     . G  A 1 47  ? 46.63500 82.29400 105.26300 1.000 144.71054 ? 149 G  A P     1 
ATOM   996  O  OP1   . G  A 1 47  ? 46.60600 82.67700 106.69900 1.000 145.36852 ? 149 G  A OP1   1 
ATOM   997  O  OP2   . G  A 1 47  ? 47.57200 82.98700 104.33800 1.000 137.59127 ? 149 G  A OP2   1 
ATOM   998  O  "O5'" . G  A 1 47  ? 46.92100 80.73000 105.19100 1.000 133.07231 ? 149 G  A "O5'" 1 
ATOM   999  C  "C5'" . G  A 1 47  ? 46.05500 79.80500 105.83200 1.000 127.42426 ? 149 G  A "C5'" 1 
ATOM   1000 C  "C4'" . G  A 1 47  ? 46.47400 78.38400 105.56100 1.000 126.92946 ? 149 G  A "C4'" 1 
ATOM   1001 O  "O4'" . G  A 1 47  ? 46.24500 78.05800 104.16500 1.000 130.24302 ? 149 G  A "O4'" 1 
ATOM   1002 C  "C3'" . G  A 1 47  ? 47.94800 78.08100 105.76700 1.000 121.40775 ? 149 G  A "C3'" 1 
ATOM   1003 O  "O3'" . G  A 1 47  ? 48.29400 77.89300 107.12800 1.000 111.30128 ? 149 G  A "O3'" 1 
ATOM   1004 C  "C2'" . G  A 1 47  ? 48.15300 76.85000 104.89500 1.000 123.14743 ? 149 G  A "C2'" 1 
ATOM   1005 O  "O2'" . G  A 1 47  ? 47.63600 75.69200 105.53600 1.000 125.10030 ? 149 G  A "O2'" 1 
ATOM   1006 C  "C1'" . G  A 1 47  ? 47.25800 77.18600 103.70200 1.000 126.78208 ? 149 G  A "C1'" 1 
ATOM   1007 N  N9    . G  A 1 47  ? 48.00500 77.86400 102.62300 1.000 128.79811 ? 149 G  A N9    1 
ATOM   1008 C  C8    . G  A 1 47  ? 47.94800 79.19600 102.29500 1.000 129.40345 ? 149 G  A C8    1 
ATOM   1009 N  N7    . G  A 1 47  ? 48.71800 79.51700 101.29300 1.000 127.37162 ? 149 G  A N7    1 
ATOM   1010 C  C5    . G  A 1 47  ? 49.32500 78.32400 100.93200 1.000 124.68709 ? 149 G  A C5    1 
ATOM   1011 C  C6    . G  A 1 47  ? 50.26600 78.05000 99.90500  1.000 117.84680 ? 149 G  A C6    1 
ATOM   1012 O  O6    . G  A 1 47  ? 50.76300 78.83800 99.08700  1.000 118.32580 ? 149 G  A O6    1 
ATOM   1013 N  N1    . G  A 1 47  ? 50.62000 76.70300 99.88600  1.000 117.23357 ? 149 G  A N1    1 
ATOM   1014 C  C2    . G  A 1 47  ? 50.13300 75.74700 100.74500 1.000 119.65754 ? 149 G  A C2    1 
ATOM   1015 N  N2    . G  A 1 47  ? 50.59300 74.49900 100.57100 1.000 118.46529 ? 149 G  A N2    1 
ATOM   1016 N  N3    . G  A 1 47  ? 49.25700 75.99400 101.70500 1.000 127.16370 ? 149 G  A N3    1 
ATOM   1017 C  C4    . G  A 1 47  ? 48.89700 77.29400 101.74300 1.000 128.54018 ? 149 G  A C4    1 
ATOM   1018 P  P     . G  A 1 48  ? 49.64300 78.54400 107.70700 1.000 123.08529 ? 150 G  A P     1 
ATOM   1019 O  OP1   . G  A 1 48  ? 49.68100 78.30900 109.17100 1.000 129.71240 ? 150 G  A OP1   1 
ATOM   1020 O  OP2   . G  A 1 48  ? 49.75000 79.92900 107.18600 1.000 116.84770 ? 150 G  A OP2   1 
ATOM   1021 O  "O5'" . G  A 1 48  ? 50.79400 77.66700 107.04400 1.000 131.09677 ? 150 G  A "O5'" 1 
ATOM   1022 C  "C5'" . G  A 1 48  ? 50.81000 76.25700 107.21500 1.000 128.02009 ? 150 G  A "C5'" 1 
ATOM   1023 C  "C4'" . G  A 1 48  ? 51.80900 75.59700 106.30100 1.000 122.70892 ? 150 G  A "C4'" 1 
ATOM   1024 O  "O4'" . G  A 1 48  ? 51.34900 75.66700 104.92400 1.000 128.24906 ? 150 G  A "O4'" 1 
ATOM   1025 C  "C3'" . G  A 1 48  ? 53.18400 76.24100 106.25400 1.000 120.82186 ? 150 G  A "C3'" 1 
ATOM   1026 O  "O3'" . G  A 1 48  ? 54.00700 75.91900 107.36200 1.000 125.20133 ? 150 G  A "O3'" 1 
ATOM   1027 C  "C2'" . G  A 1 48  ? 53.71800 75.75900 104.91500 1.000 117.20827 ? 150 G  A "C2'" 1 
ATOM   1028 O  "O2'" . G  A 1 48  ? 54.11800 74.39900 104.99600 1.000 119.21114 ? 150 G  A "O2'" 1 
ATOM   1029 C  "C1'" . G  A 1 48  ? 52.45500 75.84600 104.05900 1.000 119.61119 ? 150 G  A "C1'" 1 
ATOM   1030 N  N9    . G  A 1 48  ? 52.34400 77.17000 103.42000 1.000 119.70857 ? 150 G  A N9    1 
ATOM   1031 C  C8    . G  A 1 48  ? 51.60200 78.24100 103.85300 1.000 119.21114 ? 150 G  A C8    1 
ATOM   1032 N  N7    . G  A 1 48  ? 51.71700 79.28800 103.08600 1.000 118.52421 ? 150 G  A N7    1 
ATOM   1033 C  C5    . G  A 1 48  ? 52.59700 78.88700 102.09100 1.000 122.44310 ? 150 G  A C5    1 
ATOM   1034 C  C6    . G  A 1 48  ? 53.10300 79.59700 100.97000 1.000 121.16927 ? 150 G  A C6    1 
ATOM   1035 O  O6    . G  A 1 48  ? 52.86500 80.76300 100.62500 1.000 122.26940 ? 150 G  A O6    1 
ATOM   1036 N  N1    . G  A 1 48  ? 53.96900 78.81100 100.21400 1.000 120.69026 ? 150 G  A N1    1 
ATOM   1037 C  C2    . G  A 1 48  ? 54.30700 77.51000 100.49900 1.000 117.33986 ? 150 G  A C2    1 
ATOM   1038 N  N2    . G  A 1 48  ? 55.16100 76.91900 99.65000  1.000 111.41283 ? 150 G  A N2    1 
ATOM   1039 N  N3    . G  A 1 48  ? 53.84200 76.83700 101.53900 1.000 122.48785 ? 150 G  A N3    1 
ATOM   1040 C  C4    . G  A 1 48  ? 52.99900 77.58200 102.28500 1.000 123.88801 ? 150 G  A C4    1 
ATOM   1041 P  P     . A  A 1 49  ? 54.90900 77.06200 108.04800 1.000 122.43098 ? 151 A  A P     1 
ATOM   1042 O  OP1   . A  A 1 49  ? 55.78600 76.39800 109.04600 1.000 111.14279 ? 151 A  A OP1   1 
ATOM   1043 O  OP2   . A  A 1 49  ? 54.01100 78.16400 108.48300 1.000 129.35286 ? 151 A  A OP2   1 
ATOM   1044 O  "O5'" . A  A 1 49  ? 55.82500 77.59700 106.85500 1.000 120.67288 ? 151 A  A "O5'" 1 
ATOM   1045 C  "C5'" . A  A 1 49  ? 56.61900 78.76900 106.99800 1.000 115.78018 ? 151 A  A "C5'" 1 
ATOM   1046 C  "C4'" . A  A 1 49  ? 58.01800 78.55700 106.47500 1.000 116.80662 ? 151 A  A "C4'" 1 
ATOM   1047 O  "O4'" . A  A 1 49  ? 58.67100 77.53400 107.26400 1.000 117.14877 ? 151 A  A "O4'" 1 
ATOM   1048 C  "C3'" . A  A 1 49  ? 58.12500 78.06400 105.03700 1.000 114.03261 ? 151 A  A "C3'" 1 
ATOM   1049 O  "O3'" . A  A 1 49  ? 58.08900 79.13100 104.10400 1.000 111.09804 ? 151 A  A "O3'" 1 
ATOM   1050 C  "C2'" . A  A 1 49  ? 59.44700 77.29900 105.02600 1.000 113.99050 ? 151 A  A "C2'" 1 
ATOM   1051 O  "O2'" . A  A 1 49  ? 60.54500 78.17600 104.82600 1.000 114.05893 ? 151 A  A "O2'" 1 
ATOM   1052 C  "C1'" . A  A 1 49  ? 59.51200 76.75000 106.45300 1.000 112.31924 ? 151 A  A "C1'" 1 
ATOM   1053 N  N9    . A  A 1 49  ? 59.07200 75.34700 106.55100 1.000 110.58746 ? 151 A  A N9    1 
ATOM   1054 C  C8    . A  A 1 49  ? 57.99800 74.86300 107.25300 1.000 111.44809 ? 151 A  A C8    1 
ATOM   1055 N  N7    . A  A 1 49  ? 57.85400 73.56300 107.17200 1.000 112.21660 ? 151 A  A N7    1 
ATOM   1056 C  C5    . A  A 1 49  ? 58.91200 73.16200 106.36800 1.000 112.06658 ? 151 A  A C5    1 
ATOM   1057 C  C6    . A  A 1 49  ? 59.32300 71.90300 105.89700 1.000 111.22701 ? 151 A  A C6    1 
ATOM   1058 N  N6    . A  A 1 49  ? 58.68700 70.76600 106.18600 1.000 111.22437 ? 151 A  A N6    1 
ATOM   1059 N  N1    . A  A 1 49  ? 60.42300 71.85200 105.11200 1.000 111.31912 ? 151 A  A N1    1 
ATOM   1060 C  C2    . A  A 1 49  ? 61.05400 72.99800 104.82200 1.000 109.96370 ? 151 A  A C2    1 
ATOM   1061 N  N3    . A  A 1 49  ? 60.76800 74.24000 105.20300 1.000 112.42189 ? 151 A  A N3    1 
ATOM   1062 C  C4    . A  A 1 49  ? 59.67200 74.25200 105.98100 1.000 113.41148 ? 151 A  A C4    1 
ATOM   1063 P  P     . A  A 1 50  ? 56.91400 79.23600 103.01300 1.000 121.87019 ? 152 A  A P     1 
ATOM   1064 O  OP1   . A  A 1 50  ? 56.74500 80.67400 102.68200 1.000 124.92319 ? 152 A  A OP1   1 
ATOM   1065 O  OP2   . A  A 1 50  ? 55.74800 78.44600 103.48700 1.000 120.29632 ? 152 A  A OP2   1 
ATOM   1066 O  "O5'" . A  A 1 50  ? 57.51200 78.50900 101.72900 1.000 123.23614 ? 152 A  A "O5'" 1 
ATOM   1067 C  "C5'" . A  A 1 50  ? 58.73200 78.94000 101.13900 1.000 118.39872 ? 152 A  A "C5'" 1 
ATOM   1068 C  "C4'" . A  A 1 50  ? 59.59100 77.76300 100.75500 1.000 109.59240 ? 152 A  A "C4'" 1 
ATOM   1069 O  "O4'" . A  A 1 50  ? 59.71800 76.88400 101.89700 1.000 109.20288 ? 152 A  A "O4'" 1 
ATOM   1070 C  "C3'" . A  A 1 50  ? 59.04100 76.87500 99.64300  1.000 107.34213 ? 152 A  A "C3'" 1 
ATOM   1071 O  "O3'" . A  A 1 50  ? 59.37600 77.36100 98.35300  1.000 102.55998 ? 152 A  A "O3'" 1 
ATOM   1072 C  "C2'" . A  A 1 50  ? 59.65000 75.51200 99.95600  1.000 104.71024 ? 152 A  A "C2'" 1 
ATOM   1073 O  "O2'" . A  A 1 50  ? 60.97400 75.42400 99.44900  1.000 105.68930 ? 152 A  A "O2'" 1 
ATOM   1074 C  "C1'" . A  A 1 50  ? 59.72000 75.53600 101.48400 1.000 107.98695 ? 152 A  A "C1'" 1 
ATOM   1075 N  N9    . A  A 1 50  ? 58.59100 74.84100 102.13500 1.000 108.53701 ? 152 A  A N9    1 
ATOM   1076 C  C8    . A  A 1 50  ? 57.45700 75.40500 102.66100 1.000 110.93467 ? 152 A  A C8    1 
ATOM   1077 N  N7    . A  A 1 50  ? 56.63000 74.54200 103.19400 1.000 112.36379 ? 152 A  A N7    1 
ATOM   1078 C  C5    . A  A 1 50  ? 57.26500 73.32300 103.01700 1.000 110.40039 ? 152 A  A C5    1 
ATOM   1079 C  C6    . A  A 1 50  ? 56.90200 72.00900 103.36600 1.000 108.89232 ? 152 A  A C6    1 
ATOM   1080 N  N6    . A  A 1 50  ? 55.76500 71.68800 103.99100 1.000 110.80307 ? 152 A  A N6    1 
ATOM   1081 N  N1    . A  A 1 50  ? 57.76200 71.01400 103.05000 1.000 112.04796 ? 152 A  A N1    1 
ATOM   1082 C  C2    . A  A 1 50  ? 58.90200 71.32500 102.41800 1.000 110.02403 ? 152 A  A C2    1 
ATOM   1083 N  N3    . A  A 1 50  ? 59.35000 72.52200 102.04000 1.000 109.92402 ? 152 A  A N3    1 
ATOM   1084 C  C4    . A  A 1 50  ? 58.47700 73.49000 102.37000 1.000 110.15299 ? 152 A  A C4    1 
ATOM   1085 P  P     . A  A 1 51  ? 58.32200 77.26700 97.14200  1.000 113.18362 ? 153 A  A P     1 
ATOM   1086 O  OP1   . A  A 1 51  ? 58.87700 77.98900 95.96700  1.000 105.34320 ? 153 A  A OP1   1 
ATOM   1087 O  OP2   . A  A 1 51  ? 56.99800 77.67500 97.67900  1.000 119.94495 ? 153 A  A OP2   1 
ATOM   1088 O  "O5'" . A  A 1 51  ? 58.26700 75.71200 96.79000  1.000 106.99077 ? 153 A  A "O5'" 1 
ATOM   1089 C  "C5'" . A  A 1 51  ? 59.31200 75.07700 96.06200  1.000 102.87185 ? 153 A  A "C5'" 1 
ATOM   1090 C  "C4'" . A  A 1 51  ? 59.25900 73.57700 96.21900  1.000 102.38758 ? 153 A  A "C4'" 1 
ATOM   1091 O  "O4'" . A  A 1 51  ? 59.16900 73.24600 97.62900  1.000 108.67781 ? 153 A  A "O4'" 1 
ATOM   1092 C  "C3'" . A  A 1 51  ? 58.05800 72.87900 95.59200  1.000 102.60077 ? 153 A  A "C3'" 1 
ATOM   1093 O  "O3'" . A  A 1 51  ? 58.23600 72.62100 94.21000  1.000 99.65041  ? 153 A  A "O3'" 1 
ATOM   1094 C  "C2'" . A  A 1 51  ? 57.92500 71.61500 96.43400  1.000 106.85128 ? 153 A  A "C2'" 1 
ATOM   1095 O  "O2'" . A  A 1 51  ? 58.86800 70.63500 96.02300  1.000 101.11112 ? 153 A  A "O2'" 1 
ATOM   1096 C  "C1'" . A  A 1 51  ? 58.32400 72.13000 97.81600  1.000 110.56225 ? 153 A  A "C1'" 1 
ATOM   1097 N  N9    . A  A 1 51  ? 57.15600 72.55100 98.61400  1.000 106.29068 ? 153 A  A N9    1 
ATOM   1098 C  C8    . A  A 1 51  ? 56.52700 73.76900 98.60900  1.000 108.41725 ? 153 A  A C8    1 
ATOM   1099 N  N7    . A  A 1 51  ? 55.51300 73.84700 99.42900  1.000 112.32562 ? 153 A  A N7    1 
ATOM   1100 C  C5    . A  A 1 51  ? 55.47000 72.59300 100.01600 1.000 110.63331 ? 153 A  A C5    1 
ATOM   1101 C  C6    . A  A 1 51  ? 54.61700 72.03200 100.98400 1.000 115.20491 ? 153 A  A C6    1 
ATOM   1102 N  N6    . A  A 1 51  ? 53.60000 72.69100 101.55200 1.000 122.47420 ? 153 A  A N6    1 
ATOM   1103 N  N1    . A  A 1 51  ? 54.84500 70.75000 101.35800 1.000 112.77567 ? 153 A  A N1    1 
ATOM   1104 C  C2    . A  A 1 51  ? 55.86200 70.08600 100.79100 1.000 106.13277 ? 153 A  A C2    1 
ATOM   1105 N  N3    . A  A 1 51  ? 56.72800 70.51200 99.87200  1.000 101.77435 ? 153 A  A N3    1 
ATOM   1106 C  C4    . A  A 1 51  ? 56.47400 71.78400 99.52400  1.000 105.70640 ? 153 A  A C4    1 
ATOM   1107 P  P     . C  A 1 52  ? 57.14300 73.10600 93.13300  1.000 101.52034 ? 154 C  A P     1 
ATOM   1108 O  OP1   . C  A 1 52  ? 57.29900 72.23800 91.93600  1.000 114.78772 ? 154 C  A OP1   1 
ATOM   1109 O  OP2   . C  A 1 52  ? 57.24700 74.58200 92.99400  1.000 103.18633 ? 154 C  A OP2   1 
ATOM   1110 O  "O5'" . C  A 1 52  ? 55.73900 72.75700 93.80500  1.000 92.55348  ? 154 C  A "O5'" 1 
ATOM   1111 C  "C5'" . C  A 1 52  ? 55.19100 71.44900 93.71000  1.000 98.21468  ? 154 C  A "C5'" 1 
ATOM   1112 C  "C4'" . C  A 1 52  ? 54.37900 71.08400 94.93100  1.000 108.61330 ? 154 C  A "C4'" 1 
ATOM   1113 O  "O4'" . C  A 1 52  ? 54.80500 71.88600 96.06600  1.000 113.86656 ? 154 C  A "O4'" 1 
ATOM   1114 C  "C3'" . C  A 1 52  ? 52.88100 71.33500 94.85200  1.000 101.96513 ? 154 C  A "C3'" 1 
ATOM   1115 O  "O3'" . C  A 1 52  ? 52.17700 70.32700 94.14600  1.000 101.89670 ? 154 C  A "O3'" 1 
ATOM   1116 C  "C2'" . C  A 1 52  ? 52.49000 71.43200 96.31800  1.000 106.33671 ? 154 C  A "C2'" 1 
ATOM   1117 O  "O2'" . C  A 1 52  ? 52.41800 70.13800 96.90100  1.000 112.16899 ? 154 C  A "O2'" 1 
ATOM   1118 C  "C1'" . C  A 1 52  ? 53.69700 72.16200 96.90200  1.000 108.51065 ? 154 C  A "C1'" 1 
ATOM   1119 N  N1    . C  A 1 52  ? 53.47900 73.62800 96.94400  1.000 109.21863 ? 154 C  A N1    1 
ATOM   1120 C  C2    . C  A 1 52  ? 52.65300 74.18300 97.93200  1.000 118.06969 ? 154 C  A C2    1 
ATOM   1121 O  O2    . C  A 1 52  ? 52.11900 73.43700 98.76700  1.000 122.55181 ? 154 C  A O2    1 
ATOM   1122 N  N3    . C  A 1 52  ? 52.45600 75.52400 97.95400  1.000 121.37535 ? 154 C  A N3    1 
ATOM   1123 C  C4    . C  A 1 52  ? 53.04200 76.30300 97.04100  1.000 116.12735 ? 154 C  A C4    1 
ATOM   1124 N  N4    . C  A 1 52  ? 52.82200 77.61900 97.10100  1.000 121.34377 ? 154 C  A N4    1 
ATOM   1125 C  C5    . C  A 1 52  ? 53.88400 75.76600 96.02500  1.000 113.35597 ? 154 C  A C5    1 
ATOM   1126 C  C6    . C  A 1 52  ? 54.06900 74.44000 96.01800  1.000 112.32690 ? 154 C  A C6    1 
ATOM   1127 P  P     . U  A 1 53  ? 50.86200 70.70200 93.30000  1.000 105.70861 ? 155 U  A P     1 
ATOM   1128 O  OP1   . U  A 1 53  ? 50.40700 69.48900 92.58200  1.000 106.33500 ? 155 U  A OP1   1 
ATOM   1129 O  OP2   . U  A 1 53  ? 51.15000 71.93400 92.52600  1.000 100.16058 ? 155 U  A OP2   1 
ATOM   1130 O  "O5'" . U  A 1 53  ? 49.76700 71.05700 94.40400  1.000 109.28799 ? 155 U  A "O5'" 1 
ATOM   1131 C  "C5'" . U  A 1 53  ? 49.36900 70.10800 95.38500  1.000 110.63552 ? 155 U  A "C5'" 1 
ATOM   1132 C  "C4'" . U  A 1 53  ? 48.64500 70.77200 96.53100  1.000 113.47270 ? 155 U  A "C4'" 1 
ATOM   1133 O  "O4'" . U  A 1 53  ? 49.47700 71.82000 97.09100  1.000 109.89595 ? 155 U  A "O4'" 1 
ATOM   1134 C  "C3'" . U  A 1 53  ? 47.34900 71.47800 96.16700  1.000 116.24408 ? 155 U  A "C3'" 1 
ATOM   1135 O  "O3'" . U  A 1 53  ? 46.25100 70.58700 96.10500  1.000 112.27782 ? 155 U  A "O3'" 1 
ATOM   1136 C  "C2'" . U  A 1 53  ? 47.21400 72.53200 97.25600  1.000 113.82011 ? 155 U  A "C2'" 1 
ATOM   1137 O  "O2'" . U  A 1 53  ? 46.67300 71.96600 98.44200  1.000 119.18128 ? 155 U  A "O2'" 1 
ATOM   1138 C  "C1'" . U  A 1 53  ? 48.67700 72.90600 97.50800  1.000 113.22530 ? 155 U  A "C1'" 1 
ATOM   1139 N  N1    . U  A 1 53  ? 49.09200 74.12100 96.76500  1.000 115.25449 ? 155 U  A N1    1 
ATOM   1140 C  C2    . U  A 1 53  ? 48.65700 75.34200 97.24000  1.000 124.52666 ? 155 U  A C2    1 
ATOM   1141 O  O2    . U  A 1 53  ? 47.95500 75.45500 98.22600  1.000 132.70395 ? 155 U  A O2    1 
ATOM   1142 N  N3    . U  A 1 53  ? 49.07000 76.43300 96.52300  1.000 122.25796 ? 155 U  A N3    1 
ATOM   1143 C  C4    . U  A 1 53  ? 49.86300 76.42900 95.39600  1.000 119.37077 ? 155 U  A C4    1 
ATOM   1144 O  O4    . U  A 1 53  ? 50.15300 77.49900 94.85900  1.000 127.21908 ? 155 U  A O4    1 
ATOM   1145 C  C5    . U  A 1 53  ? 50.27900 75.13100 94.96300  1.000 117.97850 ? 155 U  A C5    1 
ATOM   1146 C  C6    . U  A 1 53  ? 49.89000 74.05100 95.64700  1.000 114.98077 ? 155 U  A C6    1 
ATOM   1147 P  P     . U  A 1 54  ? 45.24800 70.62200 94.85400  1.000 110.59246 ? 156 U  A P     1 
ATOM   1148 O  OP1   . U  A 1 54  ? 44.60500 69.28400 94.78500  1.000 111.69522 ? 156 U  A OP1   1 
ATOM   1149 O  OP2   . U  A 1 54  ? 45.97600 71.14900 93.67000  1.000 107.19468 ? 156 U  A OP2   1 
ATOM   1150 O  "O5'" . U  A 1 54  ? 44.15400 71.70000 95.28000  1.000 125.97588 ? 156 U  A "O5'" 1 
ATOM   1151 C  "C5'" . U  A 1 54  ? 43.44100 71.56400 96.50100  1.000 121.63852 ? 156 U  A "C5'" 1 
ATOM   1152 C  "C4'" . U  A 1 54  ? 42.89300 72.88300 96.98400  1.000 119.80146 ? 156 U  A "C4'" 1 
ATOM   1153 O  "O4'" . U  A 1 54  ? 43.98000 73.75200 97.39200  1.000 118.04335 ? 156 U  A "O4'" 1 
ATOM   1154 C  "C3'" . U  A 1 54  ? 42.13100 73.71100 95.96300  1.000 125.58636 ? 156 U  A "C3'" 1 
ATOM   1155 O  "O3'" . U  A 1 54  ? 40.80400 73.25900 95.76100  1.000 128.06561 ? 156 U  A "O3'" 1 
ATOM   1156 C  "C2'" . U  A 1 54  ? 42.22700 75.11800 96.53800  1.000 126.64175 ? 156 U  A "C2'" 1 
ATOM   1157 O  "O2'" . U  A 1 54  ? 41.27700 75.30400 97.57800  1.000 130.39483 ? 156 U  A "O2'" 1 
ATOM   1158 C  "C1'" . U  A 1 54  ? 43.63100 75.10300 97.15200  1.000 119.46458 ? 156 U  A "C1'" 1 
ATOM   1159 N  N1    . U  A 1 54  ? 44.64300 75.72100 96.26400  1.000 122.74655 ? 156 U  A N1    1 
ATOM   1160 C  C2    . U  A 1 54  ? 44.77500 77.09800 96.31000  1.000 127.21287 ? 156 U  A C2    1 
ATOM   1161 O  O2    . U  A 1 54  ? 44.10300 77.80400 97.04100  1.000 131.50549 ? 156 U  A O2    1 
ATOM   1162 N  N3    . U  A 1 54  ? 45.72400 77.62500 95.46800  1.000 128.44460 ? 156 U  A N3    1 
ATOM   1163 C  C4    . U  A 1 54  ? 46.54200 76.93000 94.59900  1.000 123.91774 ? 156 U  A C4    1 
ATOM   1164 O  O4    . U  A 1 54  ? 47.35400 77.55000 93.90300  1.000 119.41983 ? 156 U  A O4    1 
ATOM   1165 C  C5    . U  A 1 54  ? 46.34500 75.51000 94.61200  1.000 124.58887 ? 156 U  A C5    1 
ATOM   1166 C  C6    . U  A 1 54  ? 45.42700 74.97100 95.42200  1.000 125.10736 ? 156 U  A C6    1 
ATOM   1167 P  P     . U  A 1 55  ? 40.12700 73.40500 94.31300  1.000 128.50791 ? 157 U  A P     1 
ATOM   1168 O  OP1   . U  A 1 55  ? 38.97900 72.46800 94.25200  1.000 127.35777 ? 157 U  A OP1   1 
ATOM   1169 O  OP2   . U  A 1 55  ? 41.20400 73.30800 93.29300  1.000 127.40777 ? 157 U  A OP2   1 
ATOM   1170 O  "O5'" . U  A 1 55  ? 39.57100 74.90000 94.30500  1.000 130.06072 ? 157 U  A "O5'" 1 
ATOM   1171 C  "C5'" . U  A 1 55  ? 38.54100 75.29800 95.19900  1.000 131.09769 ? 157 U  A "C5'" 1 
ATOM   1172 C  "C4'" . U  A 1 55  ? 38.39100 76.80000 95.25900  1.000 131.98727 ? 157 U  A "C4'" 1 
ATOM   1173 O  "O4'" . U  A 1 55  ? 39.60500 77.40300 95.77600  1.000 131.15296 ? 157 U  A "O4'" 1 
ATOM   1174 C  "C3'" . U  A 1 55  ? 38.17000 77.50500 93.93100  1.000 132.75842 ? 157 U  A "C3'" 1 
ATOM   1175 O  "O3'" . U  A 1 55  ? 36.83200 77.42300 93.47500  1.000 131.84515 ? 157 U  A "O3'" 1 
ATOM   1176 C  "C2'" . U  A 1 55  ? 38.63300 78.92500 94.22800  1.000 135.90090 ? 157 U  A "C2'" 1 
ATOM   1177 O  "O2'" . U  A 1 55  ? 37.62800 79.65200 94.92200  1.000 139.70135 ? 157 U  A "O2'" 1 
ATOM   1178 C  "C1'" . U  A 1 55  ? 39.80500 78.66800 95.17800  1.000 133.64536 ? 157 U  A "C1'" 1 
ATOM   1179 N  N1    . U  A 1 55  ? 41.09800 78.65600 94.45900  1.000 132.72946 ? 157 U  A N1    1 
ATOM   1180 C  C2    . U  A 1 55  ? 41.68800 79.88200 94.22600  1.000 136.95892 ? 157 U  A C2    1 
ATOM   1181 O  O2    . U  A 1 55  ? 41.19300 80.93300 94.59400  1.000 140.80148 ? 157 U  A O2    1 
ATOM   1182 N  N3    . U  A 1 55  ? 42.88300 79.83400 93.55500  1.000 135.18765 ? 157 U  A N3    1 
ATOM   1183 C  C4    . U  A 1 55  ? 43.52500 78.69900 93.10400  1.000 133.40849 ? 157 U  A C4    1 
ATOM   1184 O  O4    . U  A 1 55  ? 44.60000 78.80900 92.51600  1.000 135.46137 ? 157 U  A O4    1 
ATOM   1185 C  C5    . U  A 1 55  ? 42.85000 77.46700 93.37900  1.000 131.29771 ? 157 U  A C5    1 
ATOM   1186 C  C6    . U  A 1 55  ? 41.68500 77.48900 94.03000  1.000 130.00809 ? 157 U  A C6    1 
ATOM   1187 P  P     . G  A 1 56  ? 36.52200 77.35700 91.90100  1.000 132.91009 ? 158 G  A P     1 
ATOM   1188 O  OP1   . G  A 1 56  ? 35.07800 77.04200 91.74400  1.000 134.97612 ? 158 G  A OP1   1 
ATOM   1189 O  OP2   . G  A 1 56  ? 37.54200 76.47500 91.27700  1.000 137.65013 ? 158 G  A OP2   1 
ATOM   1190 O  "O5'" . G  A 1 56  ? 36.77400 78.84800 91.39200  1.000 128.19373 ? 158 G  A "O5'" 1 
ATOM   1191 C  "C5'" . G  A 1 56  ? 35.93300 79.91100 91.81400  1.000 132.39950 ? 158 G  A "C5'" 1 
ATOM   1192 C  "C4'" . G  A 1 56  ? 36.54600 81.26300 91.54000  1.000 133.71545 ? 158 G  A "C4'" 1 
ATOM   1193 O  "O4'" . G  A 1 56  ? 37.83100 81.37100 92.20400  1.000 125.95136 ? 158 G  A "O4'" 1 
ATOM   1194 C  "C3'" . G  A 1 56  ? 36.85600 81.58900 90.08600  1.000 132.73112 ? 158 G  A "C3'" 1 
ATOM   1195 O  "O3'" . G  A 1 56  ? 35.71100 82.00300 89.36000  1.000 129.56495 ? 158 G  A "O3'" 1 
ATOM   1196 C  "C2'" . G  A 1 56  ? 37.92400 82.67100 90.21300  1.000 136.29207 ? 158 G  A "C2'" 1 
ATOM   1197 O  "O2'" . G  A 1 56  ? 37.33600 83.93200 90.49800  1.000 137.21323 ? 158 G  A "O2'" 1 
ATOM   1198 C  "C1'" . G  A 1 56  ? 38.69400 82.19800 91.44900  1.000 136.29470 ? 158 G  A "C1'" 1 
ATOM   1199 N  N9    . G  A 1 56  ? 39.90300 81.43500 91.08600  1.000 140.84262 ? 158 G  A N9    1 
ATOM   1200 C  C8    . G  A 1 56  ? 40.11300 80.08000 91.19000  1.000 136.23417 ? 158 G  A C8    1 
ATOM   1201 N  N7    . G  A 1 56  ? 41.29600 79.71200 90.77700  1.000 133.41804 ? 158 G  A N7    1 
ATOM   1202 C  C5    . G  A 1 56  ? 41.90200 80.89500 90.37500  1.000 135.92887 ? 158 G  A C5    1 
ATOM   1203 C  C6    . G  A 1 56  ? 43.19400 81.13400 89.83600  1.000 138.61603 ? 158 G  A C6    1 
ATOM   1204 O  O6    . G  A 1 56  ? 44.09400 80.31900 89.59400  1.000 138.37653 ? 158 G  A O6    1 
ATOM   1205 N  N1    . G  A 1 56  ? 43.39500 82.48600 89.57000  1.000 137.65802 ? 158 G  A N1    1 
ATOM   1206 C  C2    . G  A 1 56  ? 42.47500 83.48100 89.79100  1.000 135.32353 ? 158 G  A C2    1 
ATOM   1207 N  N2    . G  A 1 56  ? 42.85200 84.72700 89.47200  1.000 135.94729 ? 158 G  A N2    1 
ATOM   1208 N  N3    . G  A 1 56  ? 41.27100 83.27000 90.29200  1.000 137.12112 ? 158 G  A N3    1 
ATOM   1209 C  C4    . G  A 1 56  ? 41.05500 81.96600 90.55800  1.000 137.82646 ? 158 G  A C4    1 
ATOM   1210 P  P     . A  A 1 57  ? 35.63300 81.80300 87.76500  1.000 143.38455 ? 159 A  A P     1 
ATOM   1211 O  OP1   . A  A 1 57  ? 34.23400 82.04800 87.33700  1.000 142.65289 ? 159 A  A OP1   1 
ATOM   1212 O  OP2   . A  A 1 57  ? 36.27100 80.50700 87.42400  1.000 144.63470 ? 159 A  A OP2   1 
ATOM   1213 O  "O5'" . A  A 1 57  ? 36.53900 82.97700 87.18100  1.000 138.42606 ? 159 A  A "O5'" 1 
ATOM   1214 C  "C5'" . A  A 1 57  ? 36.19100 84.34200 87.37700  1.000 139.95783 ? 159 A  A "C5'" 1 
ATOM   1215 C  "C4'" . A  A 1 57  ? 37.29600 85.26200 86.92100  1.000 137.96811 ? 159 A  A "C4'" 1 
ATOM   1216 O  "O4'" . A  A 1 57  ? 38.47200 85.05000 87.74900  1.000 140.04994 ? 159 A  A "O4'" 1 
ATOM   1217 C  "C3'" . A  A 1 57  ? 37.79700 85.03600 85.50100  1.000 134.04396 ? 159 A  A "C3'" 1 
ATOM   1218 O  "O3'" . A  A 1 57  ? 36.98500 85.64500 84.51100  1.000 132.95962 ? 159 A  A "O3'" 1 
ATOM   1219 C  "C2'" . A  A 1 57  ? 39.22100 85.57100 85.56000  1.000 135.68100 ? 159 A  A "C2'" 1 
ATOM   1220 O  "O2'" . A  A 1 57  ? 39.23200 86.99100 85.52000  1.000 135.21515 ? 159 A  A "O2'" 1 
ATOM   1221 C  "C1'" . A  A 1 57  ? 39.64100 85.12600 86.95900  1.000 141.67908 ? 159 A  A "C1'" 1 
ATOM   1222 N  N9    . A  A 1 57  ? 40.27300 83.79200 86.94100  1.000 139.80518 ? 159 A  A N9    1 
ATOM   1223 C  C8    . A  A 1 57  ? 39.69300 82.59600 87.27300  1.000 140.57895 ? 159 A  A C8    1 
ATOM   1224 N  N7    . A  A 1 57  ? 40.48900 81.56400 87.15800  1.000 138.03917 ? 159 A  A N7    1 
ATOM   1225 C  C5    . A  A 1 57  ? 41.68100 82.11900 86.71800  1.000 136.39424 ? 159 A  A C5    1 
ATOM   1226 C  C6    . A  A 1 57  ? 42.93000 81.55000 86.40600  1.000 132.40166 ? 159 A  A C6    1 
ATOM   1227 N  N6    . A  A 1 57  ? 43.19400 80.24200 86.49200  1.000 128.47487 ? 159 A  A N6    1 
ATOM   1228 N  N1    . A  A 1 57  ? 43.91400 82.38200 85.99200  1.000 131.58314 ? 159 A  A N1    1 
ATOM   1229 C  C2    . A  A 1 57  ? 43.65100 83.69300 85.90200  1.000 132.82802 ? 159 A  A C2    1 
ATOM   1230 N  N3    . A  A 1 57  ? 42.51800 84.34100 86.17000  1.000 136.42845 ? 159 A  A N3    1 
ATOM   1231 C  C4    . A  A 1 57  ? 41.56200 83.48900 86.57800  1.000 136.44688 ? 159 A  A C4    1 
ATOM   1232 P  P     . G  A 1 58  ? 36.66300 84.85500 83.14900  1.000 137.21886 ? 160 G  A P     1 
ATOM   1233 O  OP1   . G  A 1 58  ? 35.51200 85.52200 82.48700  1.000 132.86571 ? 160 G  A OP1   1 
ATOM   1234 O  OP2   . G  A 1 58  ? 36.59200 83.40700 83.47500  1.000 141.86679 ? 160 G  A OP2   1 
ATOM   1235 O  "O5'" . G  A 1 58  ? 37.96300 85.08800 82.25700  1.000 136.98725 ? 160 G  A "O5'" 1 
ATOM   1236 C  "C5'" . G  A 1 58  ? 38.35700 86.39800 81.87400  1.000 137.44520 ? 160 G  A "C5'" 1 
ATOM   1237 C  "C4'" . G  A 1 58  ? 39.81700 86.45800 81.50000  1.000 135.96082 ? 160 G  A "C4'" 1 
ATOM   1238 O  "O4'" . G  A 1 58  ? 40.62800 86.00500 82.61600  1.000 137.07937 ? 160 G  A "O4'" 1 
ATOM   1239 C  "C3'" . G  A 1 58  ? 40.25600 85.56700 80.34900  1.000 131.53660 ? 160 G  A "C3'" 1 
ATOM   1240 O  "O3'" . G  A 1 58  ? 39.95000 86.10200 79.07200  1.000 128.44939 ? 160 G  A "O3'" 1 
ATOM   1241 C  "C2'" . G  A 1 58  ? 41.74900 85.41600 80.60700  1.000 129.74428 ? 160 G  A "C2'" 1 
ATOM   1242 O  "O2'" . G  A 1 58  ? 42.44600 86.58400 80.20400  1.000 133.96847 ? 160 G  A "O2'" 1 
ATOM   1243 C  "C1'" . G  A 1 58  ? 41.77900 85.34200 82.13400  1.000 129.42582 ? 160 G  A "C1'" 1 
ATOM   1244 N  N9    . G  A 1 58  ? 41.76400 83.94600 82.61000  1.000 130.69703 ? 160 G  A N9    1 
ATOM   1245 C  C8    . G  A 1 58  ? 40.70500 83.24800 83.13900  1.000 135.68184 ? 160 G  A C8    1 
ATOM   1246 N  N7    . G  A 1 58  ? 41.01100 82.01900 83.45800  1.000 133.65001 ? 160 G  A N7    1 
ATOM   1247 C  C5    . G  A 1 58  ? 42.35100 81.89600 83.11600  1.000 129.13105 ? 160 G  A C5    1 
ATOM   1248 C  C6    . G  A 1 58  ? 43.23500 80.79000 83.23000  1.000 123.28561 ? 160 G  A C6    1 
ATOM   1249 O  O6    . G  A 1 58  ? 43.00600 79.65800 83.67300  1.000 120.40632 ? 160 G  A O6    1 
ATOM   1250 N  N1    . G  A 1 58  ? 44.50900 81.10400 82.76700  1.000 122.03546 ? 160 G  A N1    1 
ATOM   1251 C  C2    . G  A 1 58  ? 44.88500 82.32200 82.25700  1.000 127.15187 ? 160 G  A C2    1 
ATOM   1252 N  N2    . G  A 1 58  ? 46.16200 82.42800 81.86000  1.000 127.09660 ? 160 G  A N2    1 
ATOM   1253 N  N3    . G  A 1 58  ? 44.07000 83.35800 82.14400  1.000 133.03941 ? 160 G  A N3    1 
ATOM   1254 C  C4    . G  A 1 58  ? 42.82800 83.07600 82.58900  1.000 131.49449 ? 160 G  A C4    1 
ATOM   1255 P  P     . A  A 1 59  ? 39.59800 85.11600 77.85200  1.000 140.62837 ? 161 A  A P     1 
ATOM   1256 O  OP1   . A  A 1 59  ? 39.20300 85.94500 76.68600  1.000 141.14949 ? 161 A  A OP1   1 
ATOM   1257 O  OP2   . A  A 1 59  ? 38.67300 84.07300 78.36400  1.000 132.57741 ? 161 A  A OP2   1 
ATOM   1258 O  "O5'" . A  A 1 59  ? 40.98800 84.41800 77.50500  1.000 137.79909 ? 161 A  A "O5'" 1 
ATOM   1259 C  "C5'" . A  A 1 59  ? 42.06400 85.17400 76.96900  1.000 128.36901 ? 161 A  A "C5'" 1 
ATOM   1260 C  "C4'" . A  A 1 59  ? 43.37800 84.43700 77.06200  1.000 125.17126 ? 161 A  A "C4'" 1 
ATOM   1261 O  "O4'" . A  A 1 59  ? 43.60600 83.98000 78.42000  1.000 128.48745 ? 161 A  A "O4'" 1 
ATOM   1262 C  "C3'" . A  A 1 59  ? 43.51700 83.17300 76.23300  1.000 118.18621 ? 161 A  A "C3'" 1 
ATOM   1263 O  "O3'" . A  A 1 59  ? 43.76500 83.43300 74.86200  1.000 121.48397 ? 161 A  A "O3'" 1 
ATOM   1264 C  "C2'" . A  A 1 59  ? 44.66100 82.45200 76.93500  1.000 123.11312 ? 161 A  A "C2'" 1 
ATOM   1265 O  "O2'" . A  A 1 59  ? 45.91000 83.01900 76.56800  1.000 123.99743 ? 161 A  A "O2'" 1 
ATOM   1266 C  "C1'" . A  A 1 59  ? 44.38600 82.80000 78.39900  1.000 124.91860 ? 161 A  A "C1'" 1 
ATOM   1267 N  N9    . A  A 1 59  ? 43.66400 81.71600 79.09600  1.000 121.73664 ? 161 A  A N9    1 
ATOM   1268 C  C8    . A  A 1 59  ? 42.35300 81.66700 79.50500  1.000 123.60528 ? 161 A  A C8    1 
ATOM   1269 N  N7    . A  A 1 59  ? 42.02800 80.54200 80.09700  1.000 122.50515 ? 161 A  A N7    1 
ATOM   1270 C  C5    . A  A 1 59  ? 43.20200 79.79900 80.07500  1.000 117.39927 ? 161 A  A C5    1 
ATOM   1271 C  C6    . A  A 1 59  ? 43.52500 78.51100 80.54300  1.000 113.64882 ? 161 A  A C6    1 
ATOM   1272 N  N6    . A  A 1 59  ? 42.65900 77.70000 81.15700  1.000 114.04361 ? 161 A  A N6    1 
ATOM   1273 N  N1    . A  A 1 59  ? 44.79200 78.07400 80.35900  1.000 114.56472 ? 161 A  A N1    1 
ATOM   1274 C  C2    . A  A 1 59  ? 45.66700 78.88000 79.74500  1.000 114.43050 ? 161 A  A C2    1 
ATOM   1275 N  N3    . A  A 1 59  ? 45.48200 80.10400 79.26100  1.000 116.64392 ? 161 A  A N3    1 
ATOM   1276 C  C4    . A  A 1 59  ? 44.21500 80.51100 79.46000  1.000 119.07579 ? 161 A  A C4    1 
ATOM   1277 P  P     . U  A 1 60  ? 43.21500 82.42500 73.73700  1.000 136.07315 ? 162 U  A P     1 
ATOM   1278 O  OP1   . U  A 1 60  ? 43.60300 82.97000 72.41100  1.000 122.90842 ? 162 U  A OP1   1 
ATOM   1279 O  OP2   . U  A 1 60  ? 41.78200 82.14200 74.01500  1.000 129.36709 ? 162 U  A OP2   1 
ATOM   1280 O  "O5'" . U  A 1 60  ? 44.05700 81.09300 73.97100  1.000 125.32976 ? 162 U  A "O5'" 1 
ATOM   1281 C  "C5'" . U  A 1 60  ? 45.45500 81.07200 73.71900  1.000 112.75983 ? 162 U  A "C5'" 1 
ATOM   1282 C  "C4'" . U  A 1 60  ? 46.11700 79.85100 74.30800  1.000 111.01752 ? 162 U  A "C4'" 1 
ATOM   1283 O  "O4'" . U  A 1 60  ? 45.87200 79.79300 75.74000  1.000 118.89741 ? 162 U  A "O4'" 1 
ATOM   1284 C  "C3'" . U  A 1 60  ? 45.62500 78.50700 73.80300  1.000 108.65145 ? 162 U  A "C3'" 1 
ATOM   1285 O  "O3'" . U  A 1 60  ? 46.15400 78.15400 72.53600  1.000 113.08619 ? 162 U  A "O3'" 1 
ATOM   1286 C  "C2'" . U  A 1 60  ? 46.03100 77.56800 74.92900  1.000 112.52033 ? 162 U  A "C2'" 1 
ATOM   1287 O  "O2'" . U  A 1 60  ? 47.42200 77.27600 74.87400  1.000 107.77239 ? 162 U  A "O2'" 1 
ATOM   1288 C  "C1'" . U  A 1 60  ? 45.76600 78.44400 76.15300  1.000 114.83903 ? 162 U  A "C1'" 1 
ATOM   1289 N  N1    . U  A 1 60  ? 44.41000 78.22100 76.70800  1.000 115.69703 ? 162 U  A N1    1 
ATOM   1290 C  C2    . U  A 1 60  ? 44.18300 77.05300 77.41900  1.000 116.88138 ? 162 U  A C2    1 
ATOM   1291 O  O2    . U  A 1 60  ? 45.04100 76.20700 77.61000  1.000 114.00209 ? 162 U  A O2    1 
ATOM   1292 N  N3    . U  A 1 60  ? 42.90600 76.90600 77.90600  1.000 118.34734 ? 162 U  A N3    1 
ATOM   1293 C  C4    . U  A 1 60  ? 41.85300 77.78700 77.75300  1.000 122.33466 ? 162 U  A C4    1 
ATOM   1294 O  O4    . U  A 1 60  ? 40.75600 77.51900 78.25100  1.000 124.55072 ? 162 U  A O4    1 
ATOM   1295 C  C5    . U  A 1 60  ? 42.16700 78.96800 77.00500  1.000 122.00568 ? 162 U  A C5    1 
ATOM   1296 C  C6    . U  A 1 60  ? 43.40100 79.13600 76.52200  1.000 115.62070 ? 162 U  A C6    1 
ATOM   1297 P  P     . G  A 1 61  ? 45.18200 77.61600 71.37500  1.000 115.87520 ? 163 G  A P     1 
ATOM   1298 O  OP1   . G  A 1 61  ? 45.99200 77.46200 70.14200  1.000 110.11136 ? 163 G  A OP1   1 
ATOM   1299 O  OP2   . G  A 1 61  ? 43.96500 78.46600 71.33700  1.000 118.85451 ? 163 G  A OP2   1 
ATOM   1300 O  "O5'" . G  A 1 61  ? 44.75200 76.16700 71.87700  1.000 106.23984 ? 163 G  A "O5'" 1 
ATOM   1301 C  "C5'" . G  A 1 61  ? 45.72700 75.19200 72.22400  1.000 106.17930 ? 163 G  A "C5'" 1 
ATOM   1302 C  "C4'" . G  A 1 61  ? 45.18300 74.21200 73.22900  1.000 104.88704 ? 163 G  A "C4'" 1 
ATOM   1303 O  "O4'" . G  A 1 61  ? 44.59300 74.94200 74.33100  1.000 111.09832 ? 163 G  A "O4'" 1 
ATOM   1304 C  "C3'" . G  A 1 61  ? 44.06600 73.31000 72.72600  1.000 105.46343 ? 163 G  A "C3'" 1 
ATOM   1305 O  "O3'" . G  A 1 61  ? 44.58200 72.16000 72.07300  1.000 101.24450 ? 163 G  A "O3'" 1 
ATOM   1306 C  "C2'" . G  A 1 61  ? 43.27300 72.99000 73.99200  1.000 108.44800 ? 163 G  A "C2'" 1 
ATOM   1307 O  "O2'" . G  A 1 61  ? 43.86400 71.90700 74.69600  1.000 106.56093 ? 163 G  A "O2'" 1 
ATOM   1308 C  "C1'" . G  A 1 61  ? 43.46200 74.26400 74.82200  1.000 109.64551 ? 163 G  A "C1'" 1 
ATOM   1309 N  N9    . G  A 1 61  ? 42.30600 75.18400 74.78800  1.000 114.29344 ? 163 G  A N9    1 
ATOM   1310 C  C8    . G  A 1 61  ? 42.14600 76.29800 73.99900  1.000 116.46738 ? 163 G  A C8    1 
ATOM   1311 N  N7    . G  A 1 61  ? 41.02300 76.92700 74.21300  1.000 119.87568 ? 163 G  A N7    1 
ATOM   1312 C  C5    . G  A 1 61  ? 40.40700 76.19700 75.22000  1.000 117.18589 ? 163 G  A C5    1 
ATOM   1313 C  C6    . G  A 1 61  ? 39.16100 76.40100 75.87400  1.000 119.04664 ? 163 G  A C6    1 
ATOM   1314 O  O6    . G  A 1 61  ? 38.32500 77.29600 75.68000  1.000 122.71813 ? 163 G  A O6    1 
ATOM   1315 N  N1    . G  A 1 61  ? 38.91900 75.42100 76.83200  1.000 118.39656 ? 163 G  A N1    1 
ATOM   1316 C  C2    . G  A 1 61  ? 39.77000 74.38400 77.12900  1.000 113.76442 ? 163 G  A C2    1 
ATOM   1317 N  N2    . G  A 1 61  ? 39.36400 73.54300 78.09200  1.000 106.61094 ? 163 G  A N2    1 
ATOM   1318 N  N3    . G  A 1 61  ? 40.93300 74.18500 76.52700  1.000 111.88788 ? 163 G  A N3    1 
ATOM   1319 C  C4    . G  A 1 61  ? 41.18800 75.12200 75.58900  1.000 114.04077 ? 163 G  A C4    1 
ATOM   1320 P  P     . G  A 1 62  ? 44.12900 71.77600 70.57900  1.000 100.24581 ? 164 G  A P     1 
ATOM   1321 O  OP1   . G  A 1 62  ? 45.11300 70.80400 70.04100  1.000 99.03777  ? 164 G  A OP1   1 
ATOM   1322 O  OP2   . G  A 1 62  ? 43.82800 73.02400 69.83400  1.000 101.24593 ? 164 G  A OP2   1 
ATOM   1323 O  "O5'" . G  A 1 62  ? 42.75900 70.99700 70.78900  1.000 100.88799 ? 164 G  A "O5'" 1 
ATOM   1324 C  "C5'" . G  A 1 62  ? 42.64400 69.95400 71.75100  1.000 94.27141  ? 164 G  A "C5'" 1 
ATOM   1325 C  "C4'" . G  A 1 62  ? 41.20200 69.58500 71.98400  1.000 94.39774  ? 164 G  A "C4'" 1 
ATOM   1326 O  "O4'" . G  A 1 62  ? 40.53300 70.71300 72.61400  1.000 102.27500 ? 164 G  A "O4'" 1 
ATOM   1327 C  "C3'" . G  A 1 62  ? 40.41900 69.27000 70.71400  1.000 91.72373  ? 164 G  A "C3'" 1 
ATOM   1328 O  "O3'" . G  A 1 62  ? 39.47900 68.22600 70.96000  1.000 90.94733  ? 164 G  A "O3'" 1 
ATOM   1329 C  "C2'" . G  A 1 62  ? 39.69900 70.58500 70.41300  1.000 98.41664  ? 164 G  A "C2'" 1 
ATOM   1330 O  "O2'" . G  A 1 62  ? 38.49800 70.44500 69.68300  1.000 105.86754 ? 164 G  A "O2'" 1 
ATOM   1331 C  "C1'" . G  A 1 62  ? 39.45100 71.15000 71.81200  1.000 100.87220 ? 164 G  A "C1'" 1 
ATOM   1332 N  N9    . G  A 1 62  ? 39.42300 72.62000 71.84800  1.000 105.65698 ? 164 G  A N9    1 
ATOM   1333 C  C8    . G  A 1 62  ? 40.22400 73.45100 71.10500  1.000 109.50481 ? 164 G  A C8    1 
ATOM   1334 N  N7    . G  A 1 62  ? 40.00200 74.72000 71.31100  1.000 114.28170 ? 164 G  A N7    1 
ATOM   1335 C  C5    . G  A 1 62  ? 38.98500 74.74400 72.25200  1.000 119.18229 ? 164 G  A C5    1 
ATOM   1336 C  C6    . G  A 1 62  ? 38.32800 75.84700 72.86100  1.000 122.15370 ? 164 G  A C6    1 
ATOM   1337 O  O6    . G  A 1 62  ? 38.51900 77.05800 72.68700  1.000 126.71740 ? 164 G  A O6    1 
ATOM   1338 N  N1    . G  A 1 62  ? 37.35600 75.42000 73.76000  1.000 118.61117 ? 164 G  A N1    1 
ATOM   1339 C  C2    . G  A 1 62  ? 37.05800 74.10900 74.03800  1.000 116.17667 ? 164 G  A C2    1 
ATOM   1340 N  N2    . G  A 1 62  ? 36.08600 73.90400 74.93700  1.000 115.18444 ? 164 G  A N2    1 
ATOM   1341 N  N3    . G  A 1 62  ? 37.66200 73.07300 73.47800  1.000 112.57097 ? 164 G  A N3    1 
ATOM   1342 C  C4    . G  A 1 62  ? 38.61200 73.45500 72.59500  1.000 113.28421 ? 164 G  A C4    1 
ATOM   1343 P  P     . C  A 1 63  ? 39.60200 66.84100 70.15100  1.000 96.91536  ? 165 C  A P     1 
ATOM   1344 O  OP1   . C  A 1 63  ? 38.48900 65.96100 70.58200  1.000 106.94814 ? 165 C  A OP1   1 
ATOM   1345 O  OP2   . C  A 1 63  ? 41.00100 66.35000 70.23800  1.000 99.61832  ? 165 C  A OP2   1 
ATOM   1346 O  "O5'" . C  A 1 63  ? 39.32600 67.25900 68.64000  1.000 94.33084  ? 165 C  A "O5'" 1 
ATOM   1347 C  "C5'" . C  A 1 63  ? 38.01200 67.57200 68.20300  1.000 94.34400  ? 165 C  A "C5'" 1 
ATOM   1348 C  "C4'" . C  A 1 63  ? 38.02300 68.23600 66.85000  1.000 101.18429 ? 165 C  A "C4'" 1 
ATOM   1349 O  "O4'" . C  A 1 63  ? 38.68200 69.52400 66.93900  1.000 101.16061 ? 165 C  A "O4'" 1 
ATOM   1350 C  "C3'" . C  A 1 63  ? 38.78700 67.50100 65.76200  1.000 96.33635  ? 165 C  A "C3'" 1 
ATOM   1351 O  "O3'" . C  A 1 63  ? 38.02500 66.46300 65.17300  1.000 98.28395  ? 165 C  A "O3'" 1 
ATOM   1352 C  "C2'" . C  A 1 63  ? 39.14800 68.61600 64.78900  1.000 101.38958 ? 165 C  A "C2'" 1 
ATOM   1353 O  "O2'" . C  A 1 63  ? 38.05200 68.91600 63.93700  1.000 103.82408 ? 165 C  A "O2'" 1 
ATOM   1354 C  "C1'" . C  A 1 63  ? 39.37000 69.79700 65.73800  1.000 101.21588 ? 165 C  A "C1'" 1 
ATOM   1355 N  N1    . C  A 1 63  ? 40.80100 70.02500 66.04700  1.000 100.36841 ? 165 C  A N1    1 
ATOM   1356 C  C2    . C  A 1 63  ? 41.62300 70.58300 65.06700  1.000 107.87720 ? 165 C  A C2    1 
ATOM   1357 O  O2    . C  A 1 63  ? 41.13900 70.86400 63.96300  1.000 111.45921 ? 165 C  A O2    1 
ATOM   1358 N  N3    . C  A 1 63  ? 42.92800 70.80100 65.33600  1.000 108.37989 ? 165 C  A N3    1 
ATOM   1359 C  C4    . C  A 1 63  ? 43.42200 70.48900 66.53300  1.000 108.81153 ? 165 C  A C4    1 
ATOM   1360 N  N4    . C  A 1 63  ? 44.71800 70.72500 66.74800  1.000 108.09565 ? 165 C  A N4    1 
ATOM   1361 C  C5    . C  A 1 63  ? 42.60800 69.92200 67.55600  1.000 107.02184 ? 165 C  A C5    1 
ATOM   1362 C  C6    . C  A 1 63  ? 41.31700 69.71100 67.27200  1.000 104.14781 ? 165 C  A C6    1 
ATOM   1363 P  P     . C  A 1 64  ? 38.56700 64.95200 65.19200  1.000 95.60862  ? 166 C  A P     1 
ATOM   1364 O  OP1   . C  A 1 64  ? 37.40500 64.04500 65.01500  1.000 99.09588  ? 166 C  A OP1   1 
ATOM   1365 O  OP2   . C  A 1 64  ? 39.43400 64.79600 66.38700  1.000 102.75948 ? 166 C  A OP2   1 
ATOM   1366 O  "O5'" . C  A 1 64  ? 39.48100 64.85300 63.89100  1.000 102.23837 ? 166 C  A "O5'" 1 
ATOM   1367 C  "C5'" . C  A 1 64  ? 38.90600 64.92800 62.59400  1.000 96.32450  ? 166 C  A "C5'" 1 
ATOM   1368 C  "C4'" . C  A 1 64  ? 39.89600 65.41800 61.56600  1.000 96.48241  ? 166 C  A "C4'" 1 
ATOM   1369 O  "O4'" . C  A 1 64  ? 40.47100 66.67700 61.99300  1.000 98.49055  ? 166 C  A "O4'" 1 
ATOM   1370 C  "C3'" . C  A 1 64  ? 41.10200 64.52800 61.31100  1.000 93.77419  ? 166 C  A "C3'" 1 
ATOM   1371 O  "O3'" . C  A 1 64  ? 40.80700 63.45400 60.43900  1.000 99.90387  ? 166 C  A "O3'" 1 
ATOM   1372 C  "C2'" . C  A 1 64  ? 42.11800 65.50800 60.73200  1.000 102.06729 ? 166 C  A "C2'" 1 
ATOM   1373 O  "O2'" . C  A 1 64  ? 41.86700 65.73800 59.35200  1.000 104.46232 ? 166 C  A "O2'" 1 
ATOM   1374 C  "C1'" . C  A 1 64  ? 41.79300 66.79100 61.50500  1.000 100.93031 ? 166 C  A "C1'" 1 
ATOM   1375 N  N1    . C  A 1 64  ? 42.71900 67.02200 62.63800  1.000 100.21181 ? 166 C  A N1    1 
ATOM   1376 C  C2    . C  A 1 64  ? 43.95700 67.61500 62.36900  1.000 105.13608 ? 166 C  A C2    1 
ATOM   1377 O  O2    . C  A 1 64  ? 44.23500 67.92500 61.20300  1.000 107.48636 ? 166 C  A O2    1 
ATOM   1378 N  N3    . C  A 1 64  ? 44.82300 67.83600 63.38300  1.000 106.04408 ? 166 C  A N3    1 
ATOM   1379 C  C4    . C  A 1 64  ? 44.49400 67.48800 64.62700  1.000 104.04385 ? 166 C  A C4    1 
ATOM   1380 N  N4    . C  A 1 64  ? 45.38400 67.72500 65.59600  1.000 102.49366 ? 166 C  A N4    1 
ATOM   1381 C  C5    . C  A 1 64  ? 43.23800 66.88400 64.93100  1.000 104.45968 ? 166 C  A C5    1 
ATOM   1382 C  C6    . C  A 1 64  ? 42.38900 66.66900 63.91700  1.000 100.00389 ? 166 C  A C6    1 
ATOM   1383 P  P     . U  A 1 65  ? 40.50800 61.98100 61.00700  1.000 108.06416 ? 167 U  A P     1 
ATOM   1384 O  OP1   . U  A 1 65  ? 41.15100 61.00200 60.09100  1.000 104.74008 ? 167 U  A OP1   1 
ATOM   1385 O  OP2   . U  A 1 65  ? 39.05000 61.88800 61.27100  1.000 104.44794 ? 167 U  A OP2   1 
ATOM   1386 O  "O5'" . U  A 1 65  ? 41.27900 61.92300 62.39900  1.000 96.29960  ? 167 U  A "O5'" 1 
ATOM   1387 C  "C5'" . U  A 1 65  ? 41.47300 60.68000 63.06600  1.000 98.33931  ? 167 U  A "C5'" 1 
ATOM   1388 C  "C4'" . U  A 1 65  ? 41.93200 60.86700 64.49200  1.000 89.56721  ? 167 U  A "C4'" 1 
ATOM   1389 O  "O4'" . U  A 1 65  ? 43.30900 61.33700 64.50500  1.000 92.84655  ? 167 U  A "O4'" 1 
ATOM   1390 C  "C3'" . U  A 1 65  ? 41.13200 61.87600 65.30900  1.000 87.67488  ? 167 U  A "C3'" 1 
ATOM   1391 O  "O3'" . U  A 1 65  ? 41.10200 61.45400 66.67200  1.000 90.05411  ? 167 U  A "O3'" 1 
ATOM   1392 C  "C2'" . U  A 1 65  ? 41.97900 63.13900 65.20100  1.000 92.81234  ? 167 U  A "C2'" 1 
ATOM   1393 O  "O2'" . U  A 1 65  ? 41.78200 64.06600 66.24300  1.000 101.67919 ? 167 U  A "O2'" 1 
ATOM   1394 C  "C1'" . U  A 1 65  ? 43.39100 62.55500 65.21800  1.000 92.82286  ? 167 U  A "C1'" 1 
ATOM   1395 N  N1    . U  A 1 65  ? 44.39900 63.40300 64.56700  1.000 90.52785  ? 167 U  A N1    1 
ATOM   1396 C  C2    . U  A 1 65  ? 45.33100 64.02900 65.36900  1.000 94.44411  ? 167 U  A C2    1 
ATOM   1397 O  O2    . U  A 1 65  ? 45.34500 63.90900 66.58100  1.000 104.25844 ? 167 U  A O2    1 
ATOM   1398 N  N3    . U  A 1 65  ? 46.24600 64.80500 64.70300  1.000 94.64940  ? 167 U  A N3    1 
ATOM   1399 C  C4    . U  A 1 65  ? 46.31900 65.01200 63.34100  1.000 103.31886 ? 167 U  A C4    1 
ATOM   1400 O  O4    . U  A 1 65  ? 47.20100 65.74100 62.88700  1.000 112.69893 ? 167 U  A O4    1 
ATOM   1401 C  C5    . U  A 1 65  ? 45.32000 64.32900 62.57700  1.000 100.82119 ? 167 U  A C5    1 
ATOM   1402 C  C6    . U  A 1 65  ? 44.41800 63.56700 63.20200  1.000 100.70539 ? 167 U  A C6    1 
ATOM   1403 P  P     . U  A 1 66  ? 39.87600 60.58500 67.23900  1.000 98.27222  ? 168 U  A P     1 
ATOM   1404 O  OP1   . U  A 1 66  ? 38.61700 61.05600 66.61300  1.000 103.26229 ? 168 U  A OP1   1 
ATOM   1405 O  OP2   . U  A 1 66  ? 40.01000 60.56100 68.71700  1.000 91.63721  ? 168 U  A OP2   1 
ATOM   1406 O  "O5'" . U  A 1 66  ? 40.17200 59.10700 66.73000  1.000 92.24254  ? 168 U  A "O5'" 1 
ATOM   1407 C  "C5'" . U  A 1 66  ? 41.36700 58.44000 67.11700  1.000 102.85171 ? 168 U  A "C5'" 1 
ATOM   1408 C  "C4'" . U  A 1 66  ? 41.12200 56.99100 67.44800  1.000 98.20905  ? 168 U  A "C4'" 1 
ATOM   1409 O  "O4'" . U  A 1 66  ? 40.07000 56.89700 68.44600  1.000 98.55383  ? 168 U  A "O4'" 1 
ATOM   1410 C  "C3'" . U  A 1 66  ? 40.67600 56.12300 66.27600  1.000 103.85710 ? 168 U  A "C3'" 1 
ATOM   1411 O  "O3'" . U  A 1 66  ? 41.18900 54.80300 66.45700  1.000 112.27389 ? 168 U  A "O3'" 1 
ATOM   1412 C  "C2'" . U  A 1 66  ? 39.16200 56.10600 66.43700  1.000 101.51997 ? 168 U  A "C2'" 1 
ATOM   1413 O  "O2'" . U  A 1 66  ? 38.52100 55.00600 65.82800  1.000 112.33180 ? 168 U  A "O2'" 1 
ATOM   1414 C  "C1'" . U  A 1 66  ? 39.02100 56.08400 67.95400  1.000 100.91201 ? 168 U  A "C1'" 1 
ATOM   1415 N  N1    . U  A 1 66  ? 37.75300 56.63600 68.44300  1.000 105.13093 ? 168 U  A N1    1 
ATOM   1416 C  C2    . U  A 1 66  ? 36.80300 55.74900 68.91100  1.000 108.89191 ? 168 U  A C2    1 
ATOM   1417 O  O2    . U  A 1 66  ? 36.96900 54.54000 68.92400  1.000 111.00795 ? 168 U  A O2    1 
ATOM   1418 N  N3    . U  A 1 66  ? 35.64200 56.33000 69.35500  1.000 111.23693 ? 168 U  A N3    1 
ATOM   1419 C  C4    . U  A 1 66  ? 35.35600 57.68000 69.38600  1.000 108.19446 ? 168 U  A C4    1 
ATOM   1420 O  O4    . U  A 1 66  ? 34.26600 58.05000 69.81900  1.000 112.72395 ? 168 U  A O4    1 
ATOM   1421 C  C5    . U  A 1 66  ? 36.39500 58.53200 68.89400  1.000 102.18321 ? 168 U  A C5    1 
ATOM   1422 C  C6    . U  A 1 66  ? 37.53300 57.99200 68.45400  1.000 105.77048 ? 168 U  A C6    1 
ATOM   1423 P  P     . G  A 1 67  ? 42.72400 54.47400 66.11100  1.000 120.29136 ? 169 G  A P     1 
ATOM   1424 O  OP1   . G  A 1 67  ? 43.19800 55.51000 65.16200  1.000 106.68973 ? 169 G  A OP1   1 
ATOM   1425 O  OP2   . G  A 1 67  ? 42.82100 53.03100 65.76300  1.000 121.91261 ? 169 G  A OP2   1 
ATOM   1426 O  "O5'" . G  A 1 67  ? 43.49600 54.71400 67.48300  1.000 100.47320 ? 169 G  A "O5'" 1 
ATOM   1427 C  "C5'" . G  A 1 67  ? 43.00500 54.18200 68.70300  1.000 101.16802 ? 169 G  A "C5'" 1 
ATOM   1428 C  "C4'" . G  A 1 67  ? 44.06000 54.24100 69.77500  1.000 100.36792 ? 169 G  A "C4'" 1 
ATOM   1429 O  "O4'" . G  A 1 67  ? 45.20700 53.45900 69.36900  1.000 108.77156 ? 169 G  A "O4'" 1 
ATOM   1430 C  "C3'" . G  A 1 67  ? 44.62900 55.62500 70.05600  1.000 102.90770 ? 169 G  A "C3'" 1 
ATOM   1431 O  "O3'" . G  A 1 67  ? 43.80700 56.38900 70.92100  1.000 96.58852  ? 169 G  A "O3'" 1 
ATOM   1432 C  "C2'" . G  A 1 67  ? 46.00300 55.30800 70.63300  1.000 107.49509 ? 169 G  A "C2'" 1 
ATOM   1433 O  "O2'" . G  A 1 67  ? 45.90300 54.95000 72.00300  1.000 102.76821 ? 169 G  A "O2'" 1 
ATOM   1434 C  "C1'" . G  A 1 67  ? 46.39800 54.06000 69.83700  1.000 115.27234 ? 169 G  A "C1'" 1 
ATOM   1435 N  N9    . G  A 1 67  ? 47.25400 54.36900 68.67700  1.000 112.12459 ? 169 G  A N9    1 
ATOM   1436 C  C8    . G  A 1 67  ? 46.99100 54.08000 67.35800  1.000 111.05604 ? 169 G  A C8    1 
ATOM   1437 N  N7    . G  A 1 67  ? 47.94000 54.47200 66.54900  1.000 112.68255 ? 169 G  A N7    1 
ATOM   1438 C  C5    . G  A 1 67  ? 48.88600 55.05600 67.38000  1.000 114.75649 ? 169 G  A C5    1 
ATOM   1439 C  C6    . G  A 1 67  ? 50.12700 55.66500 67.06400  1.000 111.99826 ? 169 G  A C6    1 
ATOM   1440 O  O6    . G  A 1 67  ? 50.65200 55.80900 65.95400  1.000 116.00664 ? 169 G  A O6    1 
ATOM   1441 N  N1    . G  A 1 67  ? 50.77100 56.13200 68.20500  1.000 105.25798 ? 169 G  A N1    1 
ATOM   1442 C  C2    . G  A 1 67  ? 50.28100 56.02700 69.48300  1.000 114.89335 ? 169 G  A C2    1 
ATOM   1443 N  N2    . G  A 1 67  ? 51.04300 56.53400 70.46300  1.000 114.97493 ? 169 G  A N2    1 
ATOM   1444 N  N3    . G  A 1 67  ? 49.12400 55.46500 69.78800  1.000 115.92768 ? 169 G  A N3    1 
ATOM   1445 C  C4    . G  A 1 67  ? 48.47800 55.00300 68.69600  1.000 111.87193 ? 169 G  A C4    1 
ATOM   1446 P  P     . C  A 1 68  ? 43.65700 57.97600 70.71500  1.000 106.83351 ? 170 C  A P     1 
ATOM   1447 O  OP1   . C  A 1 68  ? 42.56200 58.48100 71.57800  1.000 117.25844 ? 170 C  A OP1   1 
ATOM   1448 O  OP2   . C  A 1 68  ? 43.64400 58.25400 69.25700  1.000 100.91175 ? 170 C  A OP2   1 
ATOM   1449 O  "O5'" . C  A 1 68  ? 44.99800 58.56500 71.33000  1.000 95.52426  ? 170 C  A "O5'" 1 
ATOM   1450 C  "C5'" . C  A 1 68  ? 45.35600 58.30000 72.67800  1.000 97.12445  ? 170 C  A "C5'" 1 
ATOM   1451 C  "C4'" . C  A 1 68  ? 46.62300 59.02300 73.05200  1.000 96.45858  ? 170 C  A "C4'" 1 
ATOM   1452 O  "O4'" . C  A 1 68  ? 47.75900 58.36600 72.43400  1.000 97.02444  ? 170 C  A "O4'" 1 
ATOM   1453 C  "C3'" . C  A 1 68  ? 46.72000 60.46500 72.58000  1.000 94.86628  ? 170 C  A "C3'" 1 
ATOM   1454 O  "O3'" . C  A 1 68  ? 46.04200 61.36600 73.43800  1.000 95.39793  ? 170 C  A "O3'" 1 
ATOM   1455 C  "C2'" . C  A 1 68  ? 48.22200 60.69500 72.51900  1.000 100.03796 ? 170 C  A "C2'" 1 
ATOM   1456 O  "O2'" . C  A 1 68  ? 48.73600 60.94700 73.82000  1.000 101.54077 ? 170 C  A "O2'" 1 
ATOM   1457 C  "C1'" . C  A 1 68  ? 48.72100 59.32500 72.04800  1.000 100.05638 ? 170 C  A "C1'" 1 
ATOM   1458 N  N1    . C  A 1 68  ? 48.88700 59.25000 70.57800  1.000 103.23045 ? 170 C  A N1    1 
ATOM   1459 C  C2    . C  A 1 68  ? 49.93700 59.93300 69.95600  1.000 105.47282 ? 170 C  A C2    1 
ATOM   1460 O  O2    . C  A 1 68  ? 50.71900 60.60100 70.64500  1.000 104.53586 ? 170 C  A O2    1 
ATOM   1461 N  N3    . C  A 1 68  ? 50.08400 59.85000 68.61400  1.000 107.95733 ? 170 C  A N3    1 
ATOM   1462 C  C4    . C  A 1 68  ? 49.23200 59.12400 67.89100  1.000 108.07576 ? 170 C  A C4    1 
ATOM   1463 N  N4    . C  A 1 68  ? 49.40900 59.07000 66.56800  1.000 104.84116 ? 170 C  A N4    1 
ATOM   1464 C  C5    . C  A 1 68  ? 48.15700 58.41500 68.49600  1.000 107.83626 ? 170 C  A C5    1 
ATOM   1465 C  C6    . C  A 1 68  ? 48.02400 58.50800 69.82200  1.000 103.85684 ? 170 C  A C6    1 
ATOM   1466 P  P     . A  A 1 69  ? 45.63800 62.83300 72.92100  1.000 105.28210 ? 171 A  A P     1 
ATOM   1467 O  OP1   . A  A 1 69  ? 44.68400 63.42500 73.90400  1.000 101.78168 ? 171 A  A OP1   1 
ATOM   1468 O  OP2   . A  A 1 69  ? 45.26100 62.73700 71.48200  1.000 105.87165 ? 171 A  A OP2   1 
ATOM   1469 O  "O5'" . A  A 1 69  ? 47.00500 63.64600 73.00300  1.000 107.01126 ? 171 A  A "O5'" 1 
ATOM   1470 C  "C5'" . A  A 1 69  ? 47.27200 64.71000 72.10100  1.000 98.63394  ? 171 A  A "C5'" 1 
ATOM   1471 C  "C4'" . A  A 1 69  ? 48.64000 64.57700 71.48400  1.000 96.92057  ? 171 A  A "C4'" 1 
ATOM   1472 O  "O4'" . A  A 1 69  ? 48.70000 63.34500 70.71400  1.000 95.55725  ? 171 A  A "O4'" 1 
ATOM   1473 C  "C3'" . A  A 1 69  ? 49.01600 65.69400 70.52700  1.000 99.85777  ? 171 A  A "C3'" 1 
ATOM   1474 O  "O3'" . A  A 1 69  ? 50.42600 65.89600 70.59500  1.000 100.67102 ? 171 A  A "O3'" 1 
ATOM   1475 C  "C2'" . A  A 1 69  ? 48.62600 65.11700 69.17000  1.000 104.28725 ? 171 A  A "C2'" 1 
ATOM   1476 O  "O2'" . A  A 1 69  ? 49.30700 65.68100 68.07100  1.000 105.87428 ? 171 A  A "O2'" 1 
ATOM   1477 C  "C1'" . A  A 1 69  ? 48.95600 63.63600 69.35100  1.000 99.59195  ? 171 A  A "C1'" 1 
ATOM   1478 N  N9    . A  A 1 69  ? 48.12100 62.74200 68.54500  1.000 101.55797 ? 171 A  A N9    1 
ATOM   1479 C  C8    . A  A 1 69  ? 47.08000 61.99400 69.03000  1.000 104.12407 ? 171 A  A C8    1 
ATOM   1480 N  N7    . A  A 1 69  ? 46.48300 61.26200 68.12600  1.000 106.32960 ? 171 A  A N7    1 
ATOM   1481 C  C5    . A  A 1 69  ? 47.18500 61.53500 66.96100  1.000 101.04212 ? 171 A  A C5    1 
ATOM   1482 C  C6    . A  A 1 69  ? 47.03800 61.06400 65.64600  1.000 100.44994 ? 171 A  A C6    1 
ATOM   1483 N  N6    . A  A 1 69  ? 46.10300 60.18800 65.27100  1.000 101.18687 ? 171 A  A N6    1 
ATOM   1484 N  N1    . A  A 1 69  ? 47.89800 61.53300 64.71800  1.000 102.60547 ? 171 A  A N1    1 
ATOM   1485 C  C2    . A  A 1 69  ? 48.83500 62.41100 65.09300  1.000 100.92632 ? 171 A  A C2    1 
ATOM   1486 N  N3    . A  A 1 69  ? 49.07500 62.93100 66.29300  1.000 98.66289  ? 171 A  A N3    1 
ATOM   1487 C  C4    . A  A 1 69  ? 48.20700 62.44200 67.19900  1.000 100.04463 ? 171 A  A C4    1 
ATOM   1488 P  P     . A  A 1 70  ? 51.06000 66.72400 71.81900  1.000 103.62714 ? 172 A  A P     1 
ATOM   1489 O  OP1   . A  A 1 70  ? 50.96100 65.90900 73.05500  1.000 98.52390  ? 172 A  A OP1   1 
ATOM   1490 O  OP2   . A  A 1 70  ? 50.49600 68.09700 71.78600  1.000 105.05100 ? 172 A  A OP2   1 
ATOM   1491 O  "O5'" . A  A 1 70  ? 52.60500 66.80000 71.45200  1.000 110.21214 ? 172 A  A "O5'" 1 
ATOM   1492 C  "C5'" . A  A 1 70  ? 53.42500 67.86400 71.90600  1.000 98.26334  ? 172 A  A "C5'" 1 
ATOM   1493 C  "C4'" . A  A 1 70  ? 54.63600 68.00800 71.02300  1.000 100.55046 ? 172 A  A "C4'" 1 
ATOM   1494 O  "O4'" . A  A 1 70  ? 55.05100 66.68500 70.58200  1.000 100.33991 ? 172 A  A "O4'" 1 
ATOM   1495 C  "C3'" . A  A 1 70  ? 54.42900 68.78600 69.73000  1.000 97.95541  ? 172 A  A "C3'" 1 
ATOM   1496 O  "O3'" . A  A 1 70  ? 54.54000 70.19100 69.90300  1.000 100.52414 ? 172 A  A "O3'" 1 
ATOM   1497 C  "C2'" . A  A 1 70  ? 55.49400 68.19700 68.82000  1.000 99.82932  ? 172 A  A "C2'" 1 
ATOM   1498 O  "O2'" . A  A 1 70  ? 56.76900 68.71100 69.16800  1.000 103.33237 ? 172 A  A "O2'" 1 
ATOM   1499 C  "C1'" . A  A 1 70  ? 55.45500 66.72800 69.23300  1.000 96.43944  ? 172 A  A "C1'" 1 
ATOM   1500 N  N9    . A  A 1 70  ? 54.46500 65.96800 68.44600  1.000 104.44829 ? 172 A  A N9    1 
ATOM   1501 C  C8    . A  A 1 70  ? 53.31800 65.37100 68.91300  1.000 102.85073 ? 172 A  A C8    1 
ATOM   1502 N  N7    . A  A 1 70  ? 52.61100 64.77800 67.98300  1.000 102.73493 ? 172 A  A N7    1 
ATOM   1503 C  C5    . A  A 1 70  ? 53.34000 64.99600 66.82300  1.000 106.37484 ? 172 A  A C5    1 
ATOM   1504 C  C6    . A  A 1 70  ? 53.11400 64.61600 65.48500  1.000 105.09837 ? 172 A  A C6    1 
ATOM   1505 N  N6    . A  A 1 70  ? 52.05500 63.91100 65.07000  1.000 106.50380 ? 172 A  A N6    1 
ATOM   1506 N  N1    . A  A 1 70  ? 54.03000 64.99000 64.56500  1.000 103.04813 ? 172 A  A N1    1 
ATOM   1507 C  C2    . A  A 1 70  ? 55.09000 65.70000 64.97000  1.000 99.75563  ? 172 A  A C2    1 
ATOM   1508 N  N3    . A  A 1 70  ? 55.40800 66.11400 66.19500  1.000 100.05566 ? 172 A  A N3    1 
ATOM   1509 C  C4    . A  A 1 70  ? 54.48300 65.72900 67.09100  1.000 107.77764 ? 172 A  A C4    1 
ATOM   1510 P  P     . A  A 1 71  ? 53.62000 71.19400 69.05000  1.000 108.48210 ? 173 A  A P     1 
ATOM   1511 O  OP1   . A  A 1 71  ? 54.02400 72.57000 69.43000  1.000 110.92450 ? 173 A  A OP1   1 
ATOM   1512 O  OP2   . A  A 1 71  ? 52.19900 70.77100 69.16600  1.000 107.43197 ? 173 A  A OP2   1 
ATOM   1513 O  "O5'" . A  A 1 71  ? 54.10200 70.97300 67.54900  1.000 105.33698 ? 173 A  A "O5'" 1 
ATOM   1514 C  "C5'" . A  A 1 71  ? 55.40300 71.37000 67.13900  1.000 99.34942  ? 173 A  A "C5'" 1 
ATOM   1515 C  "C4'" . A  A 1 71  ? 55.67800 70.96400 65.71500  1.000 97.88609  ? 173 A  A "C4'" 1 
ATOM   1516 O  "O4'" . A  A 1 71  ? 55.50800 69.52700 65.57400  1.000 96.51750  ? 173 A  A "O4'" 1 
ATOM   1517 C  "C3'" . A  A 1 71  ? 54.74000 71.54700 64.67100  1.000 97.11494  ? 173 A  A "C3'" 1 
ATOM   1518 O  "O3'" . A  A 1 71  ? 55.07700 72.87300 64.30400  1.000 96.83596  ? 173 A  A "O3'" 1 
ATOM   1519 C  "C2'" . A  A 1 71  ? 54.85600 70.54200 63.53500  1.000 96.48855  ? 173 A  A "C2'" 1 
ATOM   1520 O  "O2'" . A  A 1 71  ? 56.07700 70.72500 62.83600  1.000 103.73942 ? 173 A  A "O2'" 1 
ATOM   1521 C  "C1'" . A  A 1 71  ? 54.95000 69.23100 64.31200  1.000 99.79421  ? 173 A  A "C1'" 1 
ATOM   1522 N  N9    . A  A 1 71  ? 53.62400 68.62100 64.52600  1.000 100.00476 ? 173 A  A N9    1 
ATOM   1523 C  C8    . A  A 1 71  ? 52.95200 68.48000 65.71400  1.000 104.11052 ? 173 A  A C8    1 
ATOM   1524 N  N7    . A  A 1 71  ? 51.78000 67.90400 65.59400  1.000 104.92378 ? 173 A  A N7    1 
ATOM   1525 C  C5    . A  A 1 71  ? 51.67300 67.63900 64.23700  1.000 102.73667 ? 173 A  A C5    1 
ATOM   1526 C  C6    . A  A 1 71  ? 50.66300 67.03500 63.46800  1.000 103.53940 ? 173 A  A C6    1 
ATOM   1527 N  N6    . A  A 1 71  ? 49.52800 66.56800 63.99400  1.000 104.25264 ? 173 A  A N6    1 
ATOM   1528 N  N1    . A  A 1 71  ? 50.86600 66.92800 62.13600  1.000 102.55244 ? 173 A  A N1    1 
ATOM   1529 C  C2    . A  A 1 71  ? 52.00900 67.39900 61.62200  1.000 101.44968 ? 173 A  A C2    1 
ATOM   1530 N  N3    . A  A 1 71  ? 53.03300 67.98200 62.24300  1.000 101.74708 ? 173 A  A N3    1 
ATOM   1531 C  C4    . A  A 1 71  ? 52.80200 68.07700 63.56600  1.000 102.05238 ? 173 A  A C4    1 
ATOM   1532 P  P     . G  A 1 72  ? 53.94800 74.01300 64.23700  1.000 105.22846 ? 174 G  A P     1 
ATOM   1533 O  OP1   . G  A 1 72  ? 54.63600 75.32500 64.16000  1.000 109.08945 ? 174 G  A OP1   1 
ATOM   1534 O  OP2   . G  A 1 72  ? 52.95900 73.76000 65.31300  1.000 109.02102 ? 174 G  A OP2   1 
ATOM   1535 O  "O5'" . G  A 1 72  ? 53.24000 73.75800 62.83500  1.000 105.76800 ? 174 G  A "O5'" 1 
ATOM   1536 C  "C5'" . G  A 1 72  ? 54.00300 73.53000 61.65800  1.000 99.89361  ? 174 G  A "C5'" 1 
ATOM   1537 C  "C4'" . G  A 1 72  ? 53.18700 72.81000 60.61600  1.000 96.60900  ? 174 G  A "C4'" 1 
ATOM   1538 O  "O4'" . G  A 1 72  ? 52.97700 71.43200 61.02300  1.000 93.58496  ? 174 G  A "O4'" 1 
ATOM   1539 C  "C3'" . G  A 1 72  ? 51.78500 73.35500 60.41100  1.000 101.81489 ? 174 G  A "C3'" 1 
ATOM   1540 O  "O3'" . G  A 1 72  ? 51.76100 74.49000 59.56700  1.000 108.88416 ? 174 G  A "O3'" 1 
ATOM   1541 C  "C2'" . G  A 1 72  ? 51.03300 72.14800 59.86700  1.000 103.89672 ? 174 G  A "C2'" 1 
ATOM   1542 O  "O2'" . G  A 1 72  ? 51.33100 71.95100 58.49300  1.000 114.07426 ? 174 G  A "O2'" 1 
ATOM   1543 C  "C1'" . G  A 1 72  ? 51.67500 71.01700 60.67100  1.000 98.02496  ? 174 G  A "C1'" 1 
ATOM   1544 N  N9    . G  A 1 72  ? 50.93200 70.72900 61.91300  1.000 103.16505 ? 174 G  A N9    1 
ATOM   1545 C  C8    . G  A 1 72  ? 51.31400 71.06200 63.18700  1.000 105.88643 ? 174 G  A C8    1 
ATOM   1546 N  N7    . G  A 1 72  ? 50.46700 70.68200 64.09900  1.000 102.91239 ? 174 G  A N7    1 
ATOM   1547 C  C5    . G  A 1 72  ? 49.45700 70.05400 63.38800  1.000 103.79144 ? 174 G  A C5    1 
ATOM   1548 C  C6    . G  A 1 72  ? 48.26100 69.43600 63.84100  1.000 105.83906 ? 174 G  A C6    1 
ATOM   1549 O  O6    . G  A 1 72  ? 47.84600 69.31700 65.00300  1.000 108.96048 ? 174 G  A O6    1 
ATOM   1550 N  N1    . G  A 1 72  ? 47.51800 68.92200 62.78200  1.000 102.02544 ? 174 G  A N1    1 
ATOM   1551 C  C2    . G  A 1 72  ? 47.87700 68.99500 61.46000  1.000 104.69155 ? 174 G  A C2    1 
ATOM   1552 N  N2    . G  A 1 72  ? 47.02200 68.44000 60.59300  1.000 111.60554 ? 174 G  A N2    1 
ATOM   1553 N  N3    . G  A 1 72  ? 48.98800 69.56800 61.02600  1.000 105.36795 ? 174 G  A N3    1 
ATOM   1554 C  C4    . G  A 1 72  ? 49.72900 70.07400 62.03500  1.000 104.65734 ? 174 G  A C4    1 
ATOM   1555 P  P     . G  A 1 73  ? 51.13800 75.87000 60.09700  1.000 116.82852 ? 175 G  A P     1 
ATOM   1556 O  OP1   . G  A 1 73  ? 51.78300 76.97100 59.34600  1.000 111.78318 ? 175 G  A OP1   1 
ATOM   1557 O  OP2   . G  A 1 73  ? 51.16600 75.87000 61.58000  1.000 109.55660 ? 175 G  A OP2   1 
ATOM   1558 O  "O5'" . G  A 1 73  ? 49.61800 75.78700 59.63600  1.000 112.73856 ? 175 G  A "O5'" 1 
ATOM   1559 C  "C5'" . G  A 1 73  ? 49.29500 75.51800 58.28000  1.000 112.10427 ? 175 G  A "C5'" 1 
ATOM   1560 C  "C4'" . G  A 1 73  ? 48.00700 74.74500 58.15200  1.000 114.28085 ? 175 G  A "C4'" 1 
ATOM   1561 O  "O4'" . G  A 1 73  ? 48.16600 73.41700 58.71900  1.000 109.04338 ? 175 G  A "O4'" 1 
ATOM   1562 C  "C3'" . G  A 1 73  ? 46.81900 75.31400 58.90300  1.000 111.64896 ? 175 G  A "C3'" 1 
ATOM   1563 O  "O3'" . G  A 1 73  ? 46.21400 76.42000 58.26200  1.000 112.43326 ? 175 G  A "O3'" 1 
ATOM   1564 C  "C2'" . G  A 1 73  ? 45.91900 74.09800 59.04700  1.000 112.52011 ? 175 G  A "C2'" 1 
ATOM   1565 O  "O2'" . G  A 1 73  ? 45.27500 73.80100 57.81700  1.000 115.89420 ? 175 G  A "O2'" 1 
ATOM   1566 C  "C1'" . G  A 1 73  ? 46.95500 73.00900 59.32400  1.000 111.74634 ? 175 G  A "C1'" 1 
ATOM   1567 N  N9    . G  A 1 73  ? 47.18300 72.86400 60.77200  1.000 109.74873 ? 175 G  A N9    1 
ATOM   1568 C  C8    . G  A 1 73  ? 48.26900 73.28200 61.50100  1.000 110.62778 ? 175 G  A C8    1 
ATOM   1569 N  N7    . G  A 1 73  ? 48.15100 73.02800 62.77600  1.000 111.62001 ? 175 G  A N7    1 
ATOM   1570 C  C5    . G  A 1 73  ? 46.91200 72.41200 62.89600  1.000 112.17797 ? 175 G  A C5    1 
ATOM   1571 C  C6    . G  A 1 73  ? 46.23200 71.90800 64.03700  1.000 113.33863 ? 175 G  A C6    1 
ATOM   1572 O  O6    . G  A 1 73  ? 46.60000 71.90000 65.21900  1.000 113.17545 ? 175 G  A O6    1 
ATOM   1573 N  N1    . G  A 1 73  ? 44.99600 71.36900 63.69800  1.000 112.22271 ? 175 G  A N1    1 
ATOM   1574 C  C2    . G  A 1 73  ? 44.47800 71.31800 62.42700  1.000 108.18538 ? 175 G  A C2    1 
ATOM   1575 N  N2    . G  A 1 73  ? 43.26800 70.75800 62.29100  1.000 109.31710 ? 175 G  A N2    1 
ATOM   1576 N  N3    . G  A 1 73  ? 45.09900 71.78300 61.35900  1.000 107.79849 ? 175 G  A N3    1 
ATOM   1577 C  C4    . G  A 1 73  ? 46.30100 72.31100 61.66600  1.000 108.84599 ? 175 G  A C4    1 
ATOM   1578 P  P     . G  A 1 74  ? 45.85500 77.72500 59.12500  1.000 123.12638 ? 176 G  A P     1 
ATOM   1579 O  OP1   . G  A 1 74  ? 45.43000 78.79000 58.18100  1.000 128.14014 ? 176 G  A OP1   1 
ATOM   1580 O  OP2   . G  A 1 74  ? 46.98000 77.97400 60.06400  1.000 118.41266 ? 176 G  A OP2   1 
ATOM   1581 O  "O5'" . G  A 1 74  ? 44.59900 77.26400 59.99200  1.000 121.26300 ? 176 G  A "O5'" 1 
ATOM   1582 C  "C5'" . G  A 1 74  ? 43.43700 76.74600 59.35900  1.000 119.79440 ? 176 G  A "C5'" 1 
ATOM   1583 C  "C4'" . G  A 1 74  ? 42.51700 76.06100 60.33900  1.000 124.71341 ? 176 G  A "C4'" 1 
ATOM   1584 O  "O4'" . G  A 1 74  ? 43.17500 74.91500 60.93900  1.000 123.31061 ? 176 G  A "O4'" 1 
ATOM   1585 C  "C3'" . G  A 1 74  ? 42.07400 76.88600 61.53300  1.000 125.30296 ? 176 G  A "C3'" 1 
ATOM   1586 O  "O3'" . G  A 1 74  ? 41.04500 77.80500 61.21900  1.000 127.32162 ? 176 G  A "O3'" 1 
ATOM   1587 C  "C2'" . G  A 1 74  ? 41.65600 75.81600 62.53000  1.000 121.97098 ? 176 G  A "C2'" 1 
ATOM   1588 O  "O2'" . G  A 1 74  ? 40.37200 75.30100 62.20700  1.000 131.89059 ? 176 G  A "O2'" 1 
ATOM   1589 C  "C1'" . G  A 1 74  ? 42.69900 74.73100 62.25900  1.000 118.44161 ? 176 G  A "C1'" 1 
ATOM   1590 N  N9    . G  A 1 74  ? 43.83500 74.81800 63.19600  1.000 116.92564 ? 176 G  A N9    1 
ATOM   1591 C  C8    . G  A 1 74  ? 45.12200 75.21500 62.92800  1.000 114.22268 ? 176 G  A C8    1 
ATOM   1592 N  N7    . G  A 1 74  ? 45.89300 75.18200 63.98100  1.000 119.81809 ? 176 G  A N7    1 
ATOM   1593 C  C5    . G  A 1 74  ? 45.07000 74.74400 65.00900  1.000 115.83867 ? 176 G  A C5    1 
ATOM   1594 C  C6    . G  A 1 74  ? 45.35000 74.51200 66.38200  1.000 114.54377 ? 176 G  A C6    1 
ATOM   1595 O  O6    . G  A 1 74  ? 46.42400 74.65800 66.98100  1.000 117.25726 ? 176 G  A O6    1 
ATOM   1596 N  N1    . G  A 1 74  ? 44.22200 74.06800 67.06600  1.000 115.94131 ? 176 G  A N1    1 
ATOM   1597 C  C2    . G  A 1 74  ? 42.98500 73.87200 66.49900  1.000 114.72274 ? 176 G  A C2    1 
ATOM   1598 N  N2    . G  A 1 74  ? 42.01300 73.44100 67.31400  1.000 112.03031 ? 176 G  A N2    1 
ATOM   1599 N  N3    . G  A 1 74  ? 42.71500 74.08500 65.22200  1.000 117.88628 ? 176 G  A N3    1 
ATOM   1600 C  C4    . G  A 1 74  ? 43.79600 74.51600 64.53800  1.000 118.18895 ? 176 G  A C4    1 
ATOM   1601 P  P     . U  A 1 75  ? 41.04100 79.26700 61.88300  1.000 138.91956 ? 177 U  A P     1 
ATOM   1602 O  OP1   . U  A 1 75  ? 39.90600 80.02800 61.30700  1.000 144.08334 ? 177 U  A OP1   1 
ATOM   1603 O  OP2   . U  A 1 75  ? 42.41600 79.81800 61.81400  1.000 132.55827 ? 177 U  A OP2   1 
ATOM   1604 O  "O5'" . U  A 1 75  ? 40.71400 78.99500 63.41600  1.000 134.85329 ? 177 U  A "O5'" 1 
ATOM   1605 C  "C5'" . U  A 1 75  ? 39.47800 78.41300 63.80400  1.000 133.46101 ? 177 U  A "C5'" 1 
ATOM   1606 C  "C4'" . U  A 1 75  ? 39.50000 77.98500 65.25000  1.000 128.62622 ? 177 U  A "C4'" 1 
ATOM   1607 O  "O4'" . U  A 1 75  ? 40.51700 76.96800 65.44300  1.000 121.83330 ? 177 U  A "O4'" 1 
ATOM   1608 C  "C3'" . U  A 1 75  ? 39.86100 79.06500 66.25700  1.000 125.45216 ? 177 U  A "C3'" 1 
ATOM   1609 O  "O3'" . U  A 1 75  ? 38.76200 79.89600 66.58500  1.000 128.12353 ? 177 U  A "O3'" 1 
ATOM   1610 C  "C2'" . U  A 1 75  ? 40.38700 78.25900 67.43500  1.000 126.23910 ? 177 U  A "C2'" 1 
ATOM   1611 O  "O2'" . U  A 1 75  ? 39.30900 77.72600 68.19100  1.000 137.02986 ? 177 U  A "O2'" 1 
ATOM   1612 C  "C1'" . U  A 1 75  ? 41.10600 77.11100 66.71900  1.000 115.49833 ? 177 U  A "C1'" 1 
ATOM   1613 N  N1    . U  A 1 75  ? 42.55400 77.37500 66.55200  1.000 116.80375 ? 177 U  A N1    1 
ATOM   1614 C  C2    . U  A 1 75  ? 43.36200 77.18100 67.65500  1.000 119.54882 ? 177 U  A C2    1 
ATOM   1615 O  O2    . U  A 1 75  ? 42.93600 76.80600 68.73100  1.000 124.27307 ? 177 U  A O2    1 
ATOM   1616 N  N3    . U  A 1 75  ? 44.69100 77.44500 67.45600  1.000 115.44833 ? 177 U  A N3    1 
ATOM   1617 C  C4    . U  A 1 75  ? 45.28500 77.87500 66.28800  1.000 117.64333 ? 177 U  A C4    1 
ATOM   1618 O  O4    . U  A 1 75  ? 46.50300 78.07200 66.26700  1.000 124.77839 ? 177 U  A O4    1 
ATOM   1619 C  C5    . U  A 1 75  ? 44.38400 78.05500 65.19000  1.000 121.82804 ? 177 U  A C5    1 
ATOM   1620 C  C6    . U  A 1 75  ? 43.08200 77.80600 65.35900  1.000 122.80711 ? 177 U  A C6    1 
ATOM   1621 P  P     . A  A 1 76  ? 38.86200 81.48600 66.39600  1.000 133.34837 ? 178 A  A P     1 
ATOM   1622 O  OP1   . A  A 1 76  ? 39.63200 81.76200 65.16000  1.000 142.20733 ? 178 A  A OP1   1 
ATOM   1623 O  OP2   . A  A 1 76  ? 39.30300 82.06200 67.68800  1.000 134.76960 ? 178 A  A OP2   1 
ATOM   1624 O  "O5'" . A  A 1 76  ? 37.35500 81.92800 66.14700  1.000 130.83491 ? 178 A  A "O5'" 1 
ATOM   1625 C  "C5'" . A  A 1 76  ? 36.56500 81.28300 65.15400  1.000 140.42817 ? 178 A  A "C5'" 1 
ATOM   1626 C  "C4'" . A  A 1 76  ? 35.14100 81.07900 65.60900  1.000 139.84389 ? 178 A  A "C4'" 1 
ATOM   1627 O  "O4'" . A  A 1 76  ? 35.10900 80.10600 66.69200  1.000 133.77474 ? 178 A  A "O4'" 1 
ATOM   1628 C  "C3'" . A  A 1 76  ? 34.44300 82.32800 66.14100  1.000 145.07346 ? 178 A  A "C3'" 1 
ATOM   1629 O  "O3'" . A  A 1 76  ? 33.05700 82.25500 65.81100  1.000 149.08710 ? 178 A  A "O3'" 1 
ATOM   1630 C  "C2'" . A  A 1 76  ? 34.61500 82.18600 67.65000  1.000 140.33869 ? 178 A  A "C2'" 1 
ATOM   1631 O  "O2'" . A  A 1 76  ? 33.66600 82.89000 68.42200  1.000 142.64422 ? 178 A  A "O2'" 1 
ATOM   1632 C  "C1'" . A  A 1 76  ? 34.48100 80.67800 67.82400  1.000 132.69566 ? 178 A  A "C1'" 1 
ATOM   1633 N  N9    . A  A 1 76  ? 35.11200 80.14300 69.03300  1.000 130.26116 ? 178 A  A N9    1 
ATOM   1634 C  C8    . A  A 1 76  ? 36.43700 79.85700 69.24900  1.000 132.59828 ? 178 A  A C8    1 
ATOM   1635 N  N7    . A  A 1 76  ? 36.68000 79.37200 70.44300  1.000 134.20374 ? 178 A  A N7    1 
ATOM   1636 C  C5    . A  A 1 76  ? 35.43100 79.33500 71.04900  1.000 127.27922 ? 178 A  A C5    1 
ATOM   1637 C  C6    . A  A 1 76  ? 35.00400 78.92500 72.32500  1.000 121.30746 ? 178 A  A C6    1 
ATOM   1638 N  N6    . A  A 1 76  ? 35.82700 78.44900 73.26400  1.000 124.26044 ? 178 A  A N6    1 
ATOM   1639 N  N1    . A  A 1 76  ? 33.68300 79.02200 72.60700  1.000 129.01891 ? 178 A  A N1    1 
ATOM   1640 C  C2    . A  A 1 76  ? 32.85500 79.49700 71.66800  1.000 129.86638 ? 178 A  A C2    1 
ATOM   1641 N  N3    . A  A 1 76  ? 33.13800 79.91200 70.43700  1.000 131.66922 ? 178 A  A N3    1 
ATOM   1642 C  C4    . A  A 1 76  ? 34.45600 79.80200 70.18900  1.000 131.26654 ? 178 A  A C4    1 
ATOM   1643 P  P     . U  A 1 77  ? 32.44400 83.22400 64.68800  1.000 153.73806 ? 179 U  A P     1 
ATOM   1644 O  OP1   . U  A 1 77  ? 33.36100 84.38100 64.54500  1.000 144.61854 ? 179 U  A OP1   1 
ATOM   1645 O  OP2   . U  A 1 77  ? 31.01300 83.45100 65.00400  1.000 159.89932 ? 179 U  A OP2   1 
ATOM   1646 O  "O5'" . U  A 1 77  ? 32.52900 82.37200 63.34400  1.000 145.29494 ? 179 U  A "O5'" 1 
ATOM   1647 C  "C5'" . U  A 1 77  ? 31.66100 81.26600 63.10900  1.000 142.54461 ? 179 U  A "C5'" 1 
ATOM   1648 C  "C4'" . U  A 1 77  ? 31.96400 80.59000 61.79100  1.000 148.71640 ? 179 U  A "C4'" 1 
ATOM   1649 O  "O4'" . U  A 1 77  ? 31.98100 81.59400 60.73800  1.000 160.55203 ? 179 U  A "O4'" 1 
ATOM   1650 C  "C3'" . U  A 1 77  ? 33.31400 79.88100 61.71700  1.000 148.72430 ? 179 U  A "C3'" 1 
ATOM   1651 O  "O3'" . U  A 1 77  ? 33.22500 78.77300 60.81900  1.000 148.07685 ? 179 U  A "O3'" 1 
ATOM   1652 C  "C2'" . U  A 1 77  ? 34.21300 80.94900 61.10300  1.000 154.49604 ? 179 U  A "C2'" 1 
ATOM   1653 O  "O2'" . U  A 1 77  ? 35.36300 80.44600 60.45900  1.000 151.30882 ? 179 U  A "O2'" 1 
ATOM   1654 C  "C1'" . U  A 1 77  ? 33.25500 81.61900 60.11800  1.000 165.14206 ? 179 U  A "C1'" 1 
ATOM   1655 N  N1    . U  A 1 77  ? 33.57900 83.02000 59.80800  1.000 171.71390 ? 179 U  A N1    1 
ATOM   1656 C  C2    . U  A 1 77  ? 34.68500 83.29800 59.01700  1.000 172.19290 ? 179 U  A C2    1 
ATOM   1657 O  O2    . U  A 1 77  ? 35.43000 82.43900 58.57000  1.000 170.37426 ? 179 U  A O2    1 
ATOM   1658 N  N3    . U  A 1 77  ? 34.90100 84.63500 58.78000  1.000 176.20128 ? 179 U  A N3    1 
ATOM   1659 C  C4    . U  A 1 77  ? 34.13700 85.69500 59.22800  1.000 177.97517 ? 179 U  A C4    1 
ATOM   1660 O  O4    . U  A 1 77  ? 34.45800 86.84600 58.92700  1.000 180.46231 ? 179 U  A O4    1 
ATOM   1661 C  C5    . U  A 1 77  ? 33.00900 85.32500 60.02800  1.000 174.26420 ? 179 U  A C5    1 
ATOM   1662 C  C6    . U  A 1 77  ? 32.77300 84.03300 60.28100  1.000 170.54534 ? 179 U  A C6    1 
ATOM   1663 P  P     . G  A 1 78  ? 32.96400 77.28500 61.37100  1.000 152.68310 ? 180 G  A P     1 
ATOM   1664 O  OP1   . G  A 1 78  ? 33.27000 76.34100 60.26400  1.000 141.09224 ? 180 G  A OP1   1 
ATOM   1665 O  OP2   . G  A 1 78  ? 31.61400 77.25500 61.99500  1.000 137.14966 ? 180 G  A OP2   1 
ATOM   1666 O  "O5'" . G  A 1 78  ? 34.06200 77.09200 62.51200  1.000 146.41393 ? 180 G  A "O5'" 1 
ATOM   1667 C  "C5'" . G  A 1 78  ? 35.45200 77.10300 62.20800  1.000 141.43965 ? 180 G  A "C5'" 1 
ATOM   1668 C  "C4'" . G  A 1 78  ? 36.27700 76.65700 63.38800  1.000 134.25721 ? 180 G  A "C4'" 1 
ATOM   1669 O  "O4'" . G  A 1 78  ? 36.07900 77.56800 64.49900  1.000 136.46010 ? 180 G  A "O4'" 1 
ATOM   1670 C  "C3'" . G  A 1 78  ? 35.92200 75.29400 63.95100  1.000 130.32253 ? 180 G  A "C3'" 1 
ATOM   1671 O  "O3'" . G  A 1 78  ? 36.52600 74.24100 63.22500  1.000 127.00634 ? 180 G  A "O3'" 1 
ATOM   1672 C  "C2'" . G  A 1 78  ? 36.38000 75.39000 65.40200  1.000 128.99079 ? 180 G  A "C2'" 1 
ATOM   1673 O  "O2'" . G  A 1 78  ? 37.78000 75.18000 65.51400  1.000 130.89102 ? 180 G  A "O2'" 1 
ATOM   1674 C  "C1'" . G  A 1 78  ? 36.07600 76.85500 65.71700  1.000 131.77533 ? 180 G  A "C1'" 1 
ATOM   1675 N  N9    . G  A 1 78  ? 34.75200 77.02200 66.33700  1.000 130.24094 ? 180 G  A N9    1 
ATOM   1676 C  C8    . G  A 1 78  ? 33.59700 77.41000 65.70500  1.000 134.40460 ? 180 G  A C8    1 
ATOM   1677 N  N7    . G  A 1 78  ? 32.57400 77.47300 66.51100  1.000 131.38055 ? 180 G  A N7    1 
ATOM   1678 C  C5    . G  A 1 78  ? 33.08800 77.10500 67.74800  1.000 127.09582 ? 180 G  A C5    1 
ATOM   1679 C  C6    . G  A 1 78  ? 32.45700 76.98800 69.01200  1.000 128.35387 ? 180 G  A C6    1 
ATOM   1680 O  O6    . G  A 1 78  ? 31.27200 77.19500 69.30000  1.000 131.37528 ? 180 G  A O6    1 
ATOM   1681 N  N1    . G  A 1 78  ? 33.35300 76.58500 69.99700  1.000 125.15349 ? 180 G  A N1    1 
ATOM   1682 C  C2    . G  A 1 78  ? 34.68600 76.32900 69.79400  1.000 127.30638 ? 180 G  A C2    1 
ATOM   1683 N  N2    . G  A 1 78  ? 35.38300 75.95100 70.87400  1.000 124.42182 ? 180 G  A N2    1 
ATOM   1684 N  N3    . G  A 1 78  ? 35.28900 76.43300 68.62300  1.000 129.28819 ? 180 G  A N3    1 
ATOM   1685 C  C4    . G  A 1 78  ? 34.43300 76.82200 67.65500  1.000 128.86183 ? 180 G  A C4    1 
ATOM   1686 P  P     . G  A 1 79  ? 35.79700 72.81800 63.12000  1.000 132.74765 ? 181 G  A P     1 
ATOM   1687 O  OP1   . G  A 1 79  ? 36.42900 72.07500 62.00100  1.000 123.70710 ? 181 G  A OP1   1 
ATOM   1688 O  OP2   . G  A 1 79  ? 34.33000 73.04600 63.12200  1.000 130.90533 ? 181 G  A OP2   1 
ATOM   1689 O  "O5'" . G  A 1 79  ? 36.18100 72.10400 64.48800  1.000 118.39856 ? 181 G  A "O5'" 1 
ATOM   1690 C  "C5'" . G  A 1 79  ? 35.23500 71.31700 65.18800  1.000 114.40598 ? 181 G  A "C5'" 1 
ATOM   1691 C  "C4'" . G  A 1 79  ? 35.39700 71.47000 66.67700  1.000 108.23156 ? 181 G  A "C4'" 1 
ATOM   1692 O  "O4'" . G  A 1 79  ? 35.05200 72.82100 67.07800  1.000 113.71642 ? 181 G  A "O4'" 1 
ATOM   1693 C  "C3'" . G  A 1 79  ? 34.49800 70.58500 67.52400  1.000 106.38923 ? 181 G  A "C3'" 1 
ATOM   1694 O  "O3'" . G  A 1 79  ? 35.01300 69.27400 67.66500  1.000 105.85496 ? 181 G  A "O3'" 1 
ATOM   1695 C  "C2'" . G  A 1 79  ? 34.41500 71.35600 68.83500  1.000 109.84491 ? 181 G  A "C2'" 1 
ATOM   1696 O  "O2'" . G  A 1 79  ? 35.58300 71.14700 69.61600  1.000 106.82612 ? 181 G  A "O2'" 1 
ATOM   1697 C  "C1'" . G  A 1 79  ? 34.41900 72.80400 68.34000  1.000 115.92195 ? 181 G  A "C1'" 1 
ATOM   1698 N  N9    . G  A 1 79  ? 33.05800 73.35400 68.19100  1.000 118.04852 ? 181 G  A N9    1 
ATOM   1699 C  C8    . G  A 1 79  ? 32.48600 73.82900 67.03600  1.000 124.55457 ? 181 G  A C8    1 
ATOM   1700 N  N7    . G  A 1 79  ? 31.26600 74.25400 67.20600  1.000 125.06252 ? 181 G  A N7    1 
ATOM   1701 C  C5    . G  A 1 79  ? 31.01400 74.04600 68.55400  1.000 123.43864 ? 181 G  A C5    1 
ATOM   1702 C  C6    . G  A 1 79  ? 29.85100 74.31300 69.32400  1.000 123.82816 ? 181 G  A C6    1 
ATOM   1703 O  O6    . G  A 1 79  ? 28.77600 74.80400 68.95000  1.000 124.29927 ? 181 G  A O6    1 
ATOM   1704 N  N1    . G  A 1 79  ? 30.02100 73.95100 70.65700  1.000 125.00988 ? 181 G  A N1    1 
ATOM   1705 C  C2    . G  A 1 79  ? 31.16400 73.40200 71.18200  1.000 123.40706 ? 181 G  A C2    1 
ATOM   1706 N  N2    . G  A 1 79  ? 31.13200 73.12100 72.49100  1.000 119.75136 ? 181 G  A N2    1 
ATOM   1707 N  N3    . G  A 1 79  ? 32.25300 73.14700 70.47500  1.000 123.68867 ? 181 G  A N3    1 
ATOM   1708 C  C4    . G  A 1 79  ? 32.11100 73.49200 69.17800  1.000 120.18825 ? 181 G  A C4    1 
ATOM   1709 P  P     . U  A 1 80  ? 34.09100 67.99800 67.34900  1.000 102.76752 ? 182 U  A P     1 
ATOM   1710 O  OP1   . U  A 1 80  ? 34.95900 66.89600 66.85900  1.000 96.55888  ? 182 U  A OP1   1 
ATOM   1711 O  OP2   . U  A 1 80  ? 32.95500 68.46300 66.51300  1.000 108.72350 ? 182 U  A OP2   1 
ATOM   1712 O  "O5'" . U  A 1 80  ? 33.53000 67.57600 68.77600  1.000 100.46198 ? 182 U  A "O5'" 1 
ATOM   1713 C  "C5'" . U  A 1 80  ? 34.32700 67.72600 69.94600  1.000 99.60135  ? 182 U  A "C5'" 1 
ATOM   1714 C  "C4'" . U  A 1 80  ? 33.49700 67.64300 71.20400  1.000 107.51019 ? 182 U  A "C4'" 1 
ATOM   1715 O  "O4'" . U  A 1 80  ? 32.62800 68.80500 71.28700  1.000 108.62875 ? 182 U  A "O4'" 1 
ATOM   1716 C  "C3'" . U  A 1 80  ? 32.59200 66.42000 71.31000  1.000 103.23863 ? 182 U  A "C3'" 1 
ATOM   1717 O  "O3'" . U  A 1 80  ? 32.51700 66.01100 72.67200  1.000 95.58771  ? 182 U  A "O3'" 1 
ATOM   1718 C  "C2'" . U  A 1 80  ? 31.23600 66.95600 70.86000  1.000 102.22008 ? 182 U  A "C2'" 1 
ATOM   1719 O  "O2'" . U  A 1 80  ? 30.13100 66.24200 71.37300  1.000 108.59716 ? 182 U  A "O2'" 1 
ATOM   1720 C  "C1'" . U  A 1 80  ? 31.27700 68.39400 71.37900  1.000 110.63162 ? 182 U  A "C1'" 1 
ATOM   1721 N  N1    . U  A 1 80  ? 30.47000 69.33500 70.58700  1.000 114.81370 ? 182 U  A N1    1 
ATOM   1722 C  C2    . U  A 1 80  ? 29.43600 70.01400 71.20600  1.000 118.54309 ? 182 U  A C2    1 
ATOM   1723 O  O2    . U  A 1 80  ? 29.16100 69.87200 72.38600  1.000 120.72230 ? 182 U  A O2    1 
ATOM   1724 N  N3    . U  A 1 80  ? 28.73600 70.87100 70.39200  1.000 118.82471 ? 182 U  A N3    1 
ATOM   1725 C  C4    . U  A 1 80  ? 28.95900 71.11200 69.05200  1.000 123.70687 ? 182 U  A C4    1 
ATOM   1726 O  O4    . U  A 1 80  ? 28.24000 71.91400 68.45500  1.000 131.43148 ? 182 U  A O4    1 
ATOM   1727 C  C5    . U  A 1 80  ? 30.04300 70.37200 68.48400  1.000 117.15872 ? 182 U  A C5    1 
ATOM   1728 C  C6    . U  A 1 80  ? 30.74200 69.53100 69.25300  1.000 112.63975 ? 182 U  A C6    1 
ATOM   1729 P  P     . A  A 1 81  ? 33.56000 64.93500 73.24800  1.000 101.78179 ? 183 A  A P     1 
ATOM   1730 O  OP1   . A  A 1 81  ? 33.51300 65.02300 74.72600  1.000 102.17657 ? 183 A  A OP1   1 
ATOM   1731 O  OP2   . A  A 1 81  ? 34.85800 65.09700 72.54900  1.000 109.55641 ? 183 A  A OP2   1 
ATOM   1732 O  "O5'" . A  A 1 81  ? 32.95900 63.53100 72.79800  1.000 98.38664  ? 183 A  A "O5'" 1 
ATOM   1733 C  "C5'" . A  A 1 81  ? 31.61900 63.17000 73.09600  1.000 98.92882  ? 183 A  A "C5'" 1 
ATOM   1734 C  "C4'" . A  A 1 81  ? 31.52200 61.72500 73.51600  1.000 97.02069  ? 183 A  A "C4'" 1 
ATOM   1735 O  "O4'" . A  A 1 81  ? 32.14500 60.87800 72.52200  1.000 93.77820  ? 183 A  A "O4'" 1 
ATOM   1736 C  "C3'" . A  A 1 81  ? 32.24100 61.36800 74.80600  1.000 99.62364  ? 183 A  A "C3'" 1 
ATOM   1737 O  "O3'" . A  A 1 81  ? 31.47700 61.69200 75.95100  1.000 99.23675  ? 183 A  A "O3'" 1 
ATOM   1738 C  "C2'" . A  A 1 81  ? 32.50000 59.87400 74.65100  1.000 102.80823 ? 183 A  A "C2'" 1 
ATOM   1739 O  "O2'" . A  A 1 81  ? 31.34800 59.12600 75.00700  1.000 103.71360 ? 183 A  A "O2'" 1 
ATOM   1740 C  "C1'" . A  A 1 81  ? 32.72000 59.74700 73.14000  1.000 96.70486  ? 183 A  A "C1'" 1 
ATOM   1741 N  N9    . A  A 1 81  ? 34.14700 59.68300 72.78100  1.000 103.41620 ? 183 A  A N9    1 
ATOM   1742 C  C8    . A  A 1 81  ? 34.95800 60.69800 72.33500  1.000 104.69793 ? 183 A  A C8    1 
ATOM   1743 N  N7    . A  A 1 81  ? 36.18900 60.31300 72.08700  1.000 104.19787 ? 183 A  A N7    1 
ATOM   1744 C  C5    . A  A 1 81  ? 36.19000 58.95600 72.38700  1.000 105.61646 ? 183 A  A C5    1 
ATOM   1745 C  C6    . A  A 1 81  ? 37.19000 57.96600 72.34000  1.000 108.82737 ? 183 A  A C6    1 
ATOM   1746 N  N6    . A  A 1 81  ? 38.44600 58.19600 71.94900  1.000 106.72449 ? 183 A  A N6    1 
ATOM   1747 N  N1    . A  A 1 81  ? 36.85100 56.71200 72.71100  1.000 107.50616 ? 183 A  A N1    1 
ATOM   1748 C  C2    . A  A 1 81  ? 35.59300 56.48000 73.09900  1.000 104.84268 ? 183 A  A C2    1 
ATOM   1749 N  N3    . A  A 1 81  ? 34.56900 57.32200 73.18600  1.000 106.56394 ? 183 A  A N3    1 
ATOM   1750 C  C4    . A  A 1 81  ? 34.93600 58.55800 72.81300  1.000 103.84256 ? 183 A  A C4    1 
ATOM   1751 P  P     . A  A 1 82  ? 32.07800 62.65700 77.08200  1.000 108.11526 ? 184 A  A P     1 
ATOM   1752 O  OP1   . A  A 1 82  ? 31.03000 63.64700 77.42800  1.000 111.37092 ? 184 A  A OP1   1 
ATOM   1753 O  OP2   . A  A 1 82  ? 33.41400 63.12500 76.64300  1.000 107.69679 ? 184 A  A OP2   1 
ATOM   1754 O  "O5'" . A  A 1 82  ? 32.29600 61.68400 78.32200  1.000 95.69535  ? 184 A  A "O5'" 1 
ATOM   1755 C  "C5'" . A  A 1 82  ? 31.41800 60.59100 78.55300  1.000 100.85650 ? 184 A  A "C5'" 1 
ATOM   1756 C  "C4'" . A  A 1 82  ? 32.16200 59.39300 79.08500  1.000 100.00640 ? 184 A  A "C4'" 1 
ATOM   1757 O  "O4'" . A  A 1 82  ? 32.87800 58.74200 78.00500  1.000 102.48301 ? 184 A  A "O4'" 1 
ATOM   1758 C  "C3'" . A  A 1 82  ? 33.23200 59.70500 80.12200  1.000 104.93067 ? 184 A  A "C3'" 1 
ATOM   1759 O  "O3'" . A  A 1 82  ? 32.70000 59.80500 81.42800  1.000 111.44461 ? 184 A  A "O3'" 1 
ATOM   1760 C  "C2'" . A  A 1 82  ? 34.22100 58.56000 79.95300  1.000 107.24147 ? 184 A  A "C2'" 1 
ATOM   1761 O  "O2'" . A  A 1 82  ? 33.75200 57.40000 80.62300  1.000 108.50215 ? 184 A  A "O2'" 1 
ATOM   1762 C  "C1'" . A  A 1 82  ? 34.14600 58.31300 78.44800  1.000 109.13644 ? 184 A  A "C1'" 1 
ATOM   1763 N  N9    . A  A 1 82  ? 35.16100 59.06800 77.68900  1.000 107.03619 ? 184 A  A N9    1 
ATOM   1764 C  C8    . A  A 1 82  ? 35.28500 60.43000 77.56300  1.000 106.32294 ? 184 A  A C8    1 
ATOM   1765 N  N7    . A  A 1 82  ? 36.27300 60.80200 76.78700  1.000 106.03344 ? 184 A  A N7    1 
ATOM   1766 C  C5    . A  A 1 82  ? 36.82600 59.60200 76.36700  1.000 108.16001 ? 184 A  A C5    1 
ATOM   1767 C  C6    . A  A 1 82  ? 37.91300 59.31100 75.52800  1.000 103.85159 ? 184 A  A C6    1 
ATOM   1768 N  N6    . A  A 1 82  ? 38.65900 60.24800 74.94000  1.000 99.07997  ? 184 A  A N6    1 
ATOM   1769 N  N1    . A  A 1 82  ? 38.20800 58.01000 75.31300  1.000 102.03822 ? 184 A  A N1    1 
ATOM   1770 C  C2    . A  A 1 82  ? 37.45700 57.07400 75.90800  1.000 103.56472 ? 184 A  A C2    1 
ATOM   1771 N  N3    . A  A 1 82  ? 36.41200 57.22500 76.71700  1.000 107.74153 ? 184 A  A N3    1 
ATOM   1772 C  C4    . A  A 1 82  ? 36.14600 58.52700 76.90500  1.000 106.94933 ? 184 A  A C4    1 
ATOM   1773 P  P     . U  A 1 83  ? 33.26300 60.91000 82.44600  1.000 117.68230 ? 185 U  A P     1 
ATOM   1774 O  OP1   . U  A 1 83  ? 34.67200 60.57100 82.76700  1.000 118.05076 ? 185 U  A OP1   1 
ATOM   1775 O  OP2   . U  A 1 83  ? 32.27400 61.06000 83.54300  1.000 125.61220 ? 185 U  A OP2   1 
ATOM   1776 O  "O5'" . U  A 1 83  ? 33.25700 62.25300 81.59200  1.000 113.17913 ? 185 U  A "O5'" 1 
ATOM   1777 C  "C5'" . U  A 1 83  ? 32.03900 62.92900 81.30100  1.000 110.32615 ? 185 U  A "C5'" 1 
ATOM   1778 C  "C4'" . U  A 1 83  ? 32.20000 64.42600 81.38200  1.000 113.36862 ? 185 U  A "C4'" 1 
ATOM   1779 O  "O4'" . U  A 1 83  ? 32.43100 64.81200 82.76500  1.000 119.93520 ? 185 U  A "O4'" 1 
ATOM   1780 C  "C3'" . U  A 1 83  ? 33.36700 64.99600 80.58500  1.000 115.03461 ? 185 U  A "C3'" 1 
ATOM   1781 O  "O3'" . U  A 1 83  ? 33.02200 66.30800 80.14600  1.000 106.55202 ? 185 U  A "O3'" 1 
ATOM   1782 C  "C2'" . U  A 1 83  ? 34.46800 65.09200 81.63600  1.000 123.08031 ? 185 U  A "C2'" 1 
ATOM   1783 O  "O2'" . U  A 1 83  ? 35.48200 66.02800 81.33900  1.000 123.95674 ? 185 U  A "O2'" 1 
ATOM   1784 C  "C1'" . U  A 1 83  ? 33.66600 65.49800 82.86800  1.000 122.00124 ? 185 U  A "C1'" 1 
ATOM   1785 N  N1    . U  A 1 83  ? 34.28400 65.14600 84.15500  1.000 130.63648 ? 185 U  A N1    1 
ATOM   1786 C  C2    . U  A 1 83  ? 35.25200 65.99200 84.66700  1.000 139.11908 ? 185 U  A C2    1 
ATOM   1787 O  O2    . U  A 1 83  ? 35.63700 66.99400 84.08700  1.000 138.85589 ? 185 U  A O2    1 
ATOM   1788 N  N3    . U  A 1 83  ? 35.77200 65.61200 85.88000  1.000 140.15078 ? 185 U  A N3    1 
ATOM   1789 C  C4    . U  A 1 83  ? 35.42200 64.50700 86.62700  1.000 142.05627 ? 185 U  A C4    1 
ATOM   1790 O  O4    . U  A 1 83  ? 35.98300 64.30300 87.70700  1.000 153.59450 ? 185 U  A O4    1 
ATOM   1791 C  C5    . U  A 1 83  ? 34.40400 63.69200 86.03700  1.000 130.97600 ? 185 U  A C5    1 
ATOM   1792 C  C6    . U  A 1 83  ? 33.87600 64.03200 84.85300  1.000 131.00495 ? 185 U  A C6    1 
ATOM   1793 P  P     . A  A 1 84  ? 32.50500 66.56000 78.64500  1.000 117.14623 ? 186 A  A P     1 
ATOM   1794 O  OP1   . A  A 1 84  ? 31.06000 66.22000 78.58300  1.000 119.91498 ? 186 A  A OP1   1 
ATOM   1795 O  OP2   . A  A 1 84  ? 33.45800 65.91300 77.70300  1.000 115.33549 ? 186 A  A OP2   1 
ATOM   1796 O  "O5'" . A  A 1 84  ? 32.63000 68.13700 78.46500  1.000 110.07959 ? 186 A  A "O5'" 1 
ATOM   1797 C  "C5'" . A  A 1 84  ? 31.66400 69.02100 79.01700  1.000 114.95913 ? 186 A  A "C5'" 1 
ATOM   1798 C  "C4'" . A  A 1 84  ? 31.06400 69.88700 77.94000  1.000 115.86450 ? 186 A  A "C4'" 1 
ATOM   1799 O  "O4'" . A  A 1 84  ? 32.11600 70.62800 77.27700  1.000 112.73254 ? 186 A  A "O4'" 1 
ATOM   1800 C  "C3'" . A  A 1 84  ? 30.36600 69.11500 76.82900  1.000 114.01954 ? 186 A  A "C3'" 1 
ATOM   1801 O  "O3'" . A  A 1 84  ? 29.01600 68.84400 77.15400  1.000 123.95494 ? 186 A  A "O3'" 1 
ATOM   1802 C  "C2'" . A  A 1 84  ? 30.53500 70.01900 75.61100  1.000 113.01152 ? 186 A  A "C2'" 1 
ATOM   1803 O  "O2'" . A  A 1 84  ? 29.53400 71.02200 75.58500  1.000 117.10938 ? 186 A  A "O2'" 1 
ATOM   1804 C  "C1'" . A  A 1 84  ? 31.88600 70.68100 75.88900  1.000 109.06631 ? 186 A  A "C1'" 1 
ATOM   1805 N  N9    . A  A 1 84  ? 33.00700 70.00100 75.21500  1.000 110.00327 ? 186 A  A N9    1 
ATOM   1806 C  C8    . A  A 1 84  ? 33.55100 68.77400 75.50800  1.000 108.39781 ? 186 A  A C8    1 
ATOM   1807 N  N7    . A  A 1 84  ? 34.55700 68.44200 74.73700  1.000 106.92132 ? 186 A  A N7    1 
ATOM   1808 C  C5    . A  A 1 84  ? 34.68600 69.52500 73.87800  1.000 108.47414 ? 186 A  A C5    1 
ATOM   1809 C  C6    . A  A 1 84  ? 35.56900 69.79700 72.81900  1.000 103.31562 ? 186 A  A C6    1 
ATOM   1810 N  N6    . A  A 1 84  ? 36.53600 68.96800 72.41600  1.000 96.08318  ? 186 A  A N6    1 
ATOM   1811 N  N1    . A  A 1 84  ? 35.42400 70.97200 72.16900  1.000 104.22100 ? 186 A  A N1    1 
ATOM   1812 C  C2    . A  A 1 84  ? 34.45800 71.81300 72.56000  1.000 110.13486 ? 186 A  A C2    1 
ATOM   1813 N  N3    . A  A 1 84  ? 33.57200 71.67200 73.54100  1.000 114.90386 ? 186 A  A N3    1 
ATOM   1814 C  C4    . A  A 1 84  ? 33.74100 70.49300 74.16500  1.000 110.81389 ? 186 A  A C4    1 
ATOM   1815 P  P     . A  A 1 85  ? 28.30900 67.48400 76.67900  1.000 119.37441 ? 187 A  A P     1 
ATOM   1816 O  OP1   . A  A 1 85  ? 27.53500 66.95200 77.82700  1.000 118.69538 ? 187 A  A OP1   1 
ATOM   1817 O  OP2   . A  A 1 85  ? 29.31900 66.61900 76.02200  1.000 120.36664 ? 187 A  A OP2   1 
ATOM   1818 O  "O5'" . A  A 1 85  ? 27.27100 67.98100 75.58300  1.000 110.98656 ? 187 A  A "O5'" 1 
ATOM   1819 C  "C5'" . A  A 1 85  ? 26.97600 67.18400 74.45100  1.000 119.44810 ? 187 A  A "C5'" 1 
ATOM   1820 C  "C4'" . A  A 1 85  ? 25.49000 67.02600 74.27500  1.000 121.50888 ? 187 A  A "C4'" 1 
ATOM   1821 O  "O4'" . A  A 1 85  ? 24.95200 68.24200 73.70600  1.000 119.48232 ? 187 A  A "O4'" 1 
ATOM   1822 C  "C3'" . A  A 1 85  ? 25.04700 65.92300 73.31900  1.000 123.12749 ? 187 A  A "C3'" 1 
ATOM   1823 O  "O3'" . A  A 1 85  ? 24.93100 64.66100 73.96100  1.000 125.84624 ? 187 A  A "O3'" 1 
ATOM   1824 C  "C2'" . A  A 1 85  ? 23.70300 66.42700 72.79700  1.000 122.98274 ? 187 A  A "C2'" 1 
ATOM   1825 O  "O2'" . A  A 1 85  ? 22.64700 66.01300 73.65400  1.000 140.35587 ? 187 A  A "O2'" 1 
ATOM   1826 C  "C1'" . A  A 1 85  ? 23.84600 67.94800 72.89100  1.000 118.85330 ? 187 A  A "C1'" 1 
ATOM   1827 N  N9    . A  A 1 85  ? 24.00900 68.61600 71.58200  1.000 125.00403 ? 187 A  A N9    1 
ATOM   1828 C  C8    . A  A 1 85  ? 23.15900 69.56100 71.06500  1.000 132.63916 ? 187 A  A C8    1 
ATOM   1829 N  N7    . A  A 1 85  ? 23.50700 70.01400 69.88900  1.000 138.45301 ? 187 A  A N7    1 
ATOM   1830 C  C5    . A  A 1 85  ? 24.67500 69.32300 69.60900  1.000 135.15525 ? 187 A  A C5    1 
ATOM   1831 C  C6    . A  A 1 85  ? 25.54000 69.35500 68.50200  1.000 135.09472 ? 187 A  A C6    1 
ATOM   1832 N  N6    . A  A 1 85  ? 25.35100 70.14000 67.43900  1.000 141.91396 ? 187 A  A N6    1 
ATOM   1833 N  N1    . A  A 1 85  ? 26.62400 68.54500 68.52700  1.000 136.39750 ? 187 A  A N1    1 
ATOM   1834 C  C2    . A  A 1 85  ? 26.81800 67.75700 69.59400  1.000 126.82004 ? 187 A  A C2    1 
ATOM   1835 N  N3    . A  A 1 85  ? 26.07200 67.63900 70.69400  1.000 131.76274 ? 187 A  A N3    1 
ATOM   1836 C  C4    . A  A 1 85  ? 25.00200 68.45700 70.64100  1.000 134.75257 ? 187 A  A C4    1 
ATOM   1837 P  P     . G  A 1 86  ? 26.21900 63.82100 74.43600  1.000 142.40179 ? 188 G  A P     1 
ATOM   1838 O  OP1   . G  A 1 86  ? 25.78000 62.40600 74.52900  1.000 138.19076 ? 188 G  A OP1   1 
ATOM   1839 O  OP2   . G  A 1 86  ? 26.82000 64.44600 75.64100  1.000 137.08536 ? 188 G  A OP2   1 
ATOM   1840 O  "O5'" . G  A 1 86  ? 27.22600 63.91900 73.20600  1.000 114.52213 ? 188 G  A "O5'" 1 
ATOM   1841 C  "C5'" . G  A 1 86  ? 27.31200 62.85100 72.26900  1.000 116.96716 ? 188 G  A "C5'" 1 
ATOM   1842 C  "C4'" . G  A 1 86  ? 27.05100 63.31100 70.85600  1.000 119.74644 ? 188 G  A "C4'" 1 
ATOM   1843 O  "O4'" . G  A 1 86  ? 28.27000 63.89300 70.31800  1.000 114.60372 ? 188 G  A "O4'" 1 
ATOM   1844 C  "C3'" . G  A 1 86  ? 26.63500 62.20200 69.89000  1.000 113.87995 ? 188 G  A "C3'" 1 
ATOM   1845 O  "O3'" . G  A 1 86  ? 25.67100 62.69400 68.96300  1.000 123.32318 ? 188 G  A "O3'" 1 
ATOM   1846 C  "C2'" . G  A 1 86  ? 27.93600 61.87400 69.16100  1.000 110.52954 ? 188 G  A "C2'" 1 
ATOM   1847 O  "O2'" . G  A 1 86  ? 27.76700 61.33400 67.86500  1.000 120.91500 ? 188 G  A "O2'" 1 
ATOM   1848 C  "C1'" . G  A 1 86  ? 28.62900 63.23100 69.11500  1.000 111.55072 ? 188 G  A "C1'" 1 
ATOM   1849 N  N9    . G  A 1 86  ? 30.09900 63.18000 69.02900  1.000 109.32414 ? 188 G  A N9    1 
ATOM   1850 C  C8    . G  A 1 86  ? 30.87300 64.27200 68.72200  1.000 110.63482 ? 188 G  A C8    1 
ATOM   1851 N  N7    . G  A 1 86  ? 32.15200 64.04300 68.69800  1.000 111.50335 ? 188 G  A N7    1 
ATOM   1852 C  C5    . G  A 1 86  ? 32.25000 62.70100 69.01800  1.000 104.48672 ? 188 G  A C5    1 
ATOM   1853 C  C6    . G  A 1 86  ? 33.41200 61.89500 69.14200  1.000 104.57620 ? 188 G  A C6    1 
ATOM   1854 O  O6    . G  A 1 86  ? 34.59900 62.22400 68.99100  1.000 109.30835 ? 188 G  A O6    1 
ATOM   1855 N  N1    . G  A 1 86  ? 33.09300 60.58300 69.47800  1.000 100.18357 ? 188 G  A N1    1 
ATOM   1856 C  C2    . G  A 1 86  ? 31.82000 60.11000 69.67300  1.000 97.15689  ? 188 G  A C2    1 
ATOM   1857 N  N2    . G  A 1 86  ? 31.69700 58.81400 69.99300  1.000 99.41769  ? 188 G  A N2    1 
ATOM   1858 N  N3    . G  A 1 86  ? 30.73800 60.85600 69.55900  1.000 103.23657 ? 188 G  A N3    1 
ATOM   1859 C  C4    . G  A 1 86  ? 31.00300 62.14200 69.23300  1.000 104.31301 ? 188 G  A C4    1 
ATOM   1860 P  P     . C  A 1 87  ? 24.49800 61.72500 68.44300  1.000 114.62257 ? 189 C  A P     1 
ATOM   1861 O  OP1   . C  A 1 87  ? 24.55700 60.47100 69.23400  1.000 107.83755 ? 189 C  A OP1   1 
ATOM   1862 O  OP2   . C  A 1 87  ? 24.55400 61.66000 66.96000  1.000 111.96173 ? 189 C  A OP2   1 
ATOM   1863 O  "O5'" . C  A 1 87  ? 23.16300 62.48900 68.84500  1.000 123.71577 ? 189 C  A "O5'" 1 
ATOM   1864 C  "C5'" . C  A 1 87  ? 22.66900 62.46300 70.17500  1.000 125.63442 ? 189 C  A "C5'" 1 
ATOM   1865 C  "C4'" . C  A 1 87  ? 21.70500 63.59600 70.41000  1.000 133.35377 ? 189 C  A "C4'" 1 
ATOM   1866 O  "O4'" . C  A 1 87  ? 22.43700 64.84800 70.44600  1.000 130.56922 ? 189 C  A "O4'" 1 
ATOM   1867 C  "C3'" . C  A 1 87  ? 20.66300 63.80800 69.32500  1.000 137.38583 ? 189 C  A "C3'" 1 
ATOM   1868 O  "O3'" . C  A 1 87  ? 19.55800 62.93100 69.45000  1.000 132.02993 ? 189 C  A "O3'" 1 
ATOM   1869 C  "C2'" . C  A 1 87  ? 20.31000 65.28200 69.48200  1.000 137.43847 ? 189 C  A "C2'" 1 
ATOM   1870 O  "O2'" . C  A 1 87  ? 19.41300 65.47600 70.56700  1.000 136.57257 ? 189 C  A "O2'" 1 
ATOM   1871 C  "C1'" . C  A 1 87  ? 21.66700 65.87800 69.86100  1.000 136.26728 ? 189 C  A "C1'" 1 
ATOM   1872 N  N1    . C  A 1 87  ? 22.39800 66.41000 68.68700  1.000 137.05684 ? 189 C  A N1    1 
ATOM   1873 C  C2    . C  A 1 87  ? 22.10200 67.69900 68.23000  1.000 144.05242 ? 189 C  A C2    1 
ATOM   1874 O  O2    . C  A 1 87  ? 21.23700 68.36200 68.81900  1.000 148.92406 ? 189 C  A O2    1 
ATOM   1875 N  N3    . C  A 1 87  ? 22.76600 68.19300 67.15900  1.000 142.13114 ? 189 C  A N3    1 
ATOM   1876 C  C4    . C  A 1 87  ? 23.69200 67.45100 66.55000  1.000 139.20447 ? 189 C  A C4    1 
ATOM   1877 N  N4    . C  A 1 87  ? 24.31700 67.98400 65.49600  1.000 143.13389 ? 189 C  A N4    1 
ATOM   1878 C  C5    . C  A 1 87  ? 24.01400 66.13400 66.99200  1.000 133.66433 ? 189 C  A C5    1 
ATOM   1879 C  C6    . C  A 1 87  ? 23.35100 65.66100 68.05400  1.000 129.58753 ? 189 C  A C6    1 
ATOM   1880 P  P     . U  A 1 88  ? 18.87800 62.29600 68.14100  1.000 139.60357 ? 190 U  A P     1 
ATOM   1881 O  OP1   . U  A 1 88  ? 18.02400 61.16300 68.57600  1.000 139.50882 ? 190 U  A OP1   1 
ATOM   1882 O  OP2   . U  A 1 88  ? 19.93800 62.06500 67.12400  1.000 129.59710 ? 190 U  A OP2   1 
ATOM   1883 O  "O5'" . U  A 1 88  ? 17.93100 63.46000 67.60500  1.000 149.38632 ? 190 U  A "O5'" 1 
ATOM   1884 C  "C5'" . U  A 1 88  ? 17.03300 64.13400 68.47500  1.000 147.49135 ? 190 U  A "C5'" 1 
ATOM   1885 C  "C4'" . U  A 1 88  ? 16.50600 65.39900 67.84500  1.000 149.26525 ? 190 U  A "C4'" 1 
ATOM   1886 O  "O4'" . U  A 1 88  ? 17.52400 66.43700 67.86900  1.000 150.65752 ? 190 U  A "O4'" 1 
ATOM   1887 C  "C3'" . U  A 1 88  ? 16.13000 65.29800 66.37700  1.000 152.75251 ? 190 U  A "C3'" 1 
ATOM   1888 O  "O3'" . U  A 1 88  ? 14.87700 64.67900 66.15700  1.000 151.86030 ? 190 U  A "O3'" 1 
ATOM   1889 C  "C2'" . U  A 1 88  ? 16.20000 66.74800 65.92300  1.000 154.03424 ? 190 U  A "C2'" 1 
ATOM   1890 O  "O2'" . U  A 1 88  ? 15.05700 67.47300 66.35900  1.000 160.13761 ? 190 U  A "O2'" 1 
ATOM   1891 C  "C1'" . U  A 1 88  ? 17.41800 67.23800 66.70500  1.000 149.23630 ? 190 U  A "C1'" 1 
ATOM   1892 N  N1    . U  A 1 88  ? 18.65900 67.09800 65.90700  1.000 146.43333 ? 190 U  A N1    1 
ATOM   1893 C  C2    . U  A 1 88  ? 18.90900 68.07200 64.96100  1.000 150.97598 ? 190 U  A C2    1 
ATOM   1894 O  O2    . U  A 1 88  ? 18.16700 69.01900 64.77700  1.000 154.66063 ? 190 U  A O2    1 
ATOM   1895 N  N3    . U  A 1 88  ? 20.06200 67.90000 64.24000  1.000 150.03640 ? 190 U  A N3    1 
ATOM   1896 C  C4    . U  A 1 88  ? 20.97000 66.87000 64.35900  1.000 145.19897 ? 190 U  A C4    1 
ATOM   1897 O  O4    . U  A 1 88  ? 21.96200 66.86200 63.62900  1.000 146.47807 ? 190 U  A O4    1 
ATOM   1898 C  C5    . U  A 1 88  ? 20.64000 65.89700 65.35700  1.000 141.72224 ? 190 U  A C5    1 
ATOM   1899 C  C6    . U  A 1 88  ? 19.52200 66.04100 66.07400  1.000 143.91987 ? 190 U  A C6    1 
ATOM   1900 P  P     . G  A 1 89  ? 14.71600 63.60300 64.97600  1.000 154.66037 ? 191 G  A P     1 
ATOM   1901 O  OP1   . G  A 1 89  ? 13.38800 62.96200 65.14300  1.000 158.49241 ? 191 G  A OP1   1 
ATOM   1902 O  OP2   . G  A 1 89  ? 15.93600 62.76000 64.93200  1.000 150.48355 ? 191 G  A OP2   1 
ATOM   1903 O  "O5'" . G  A 1 89  ? 14.68800 64.49100 63.65400  1.000 150.44407 ? 191 G  A "O5'" 1 
ATOM   1904 C  "C5'" . G  A 1 89  ? 13.68200 65.47500 63.47800  1.000 157.87128 ? 191 G  A "C5'" 1 
ATOM   1905 C  "C4'" . G  A 1 89  ? 14.09800 66.56900 62.52300  1.000 154.86566 ? 191 G  A "C4'" 1 
ATOM   1906 O  "O4'" . G  A 1 89  ? 15.40800 67.08200 62.86100  1.000 148.47015 ? 191 G  A "O4'" 1 
ATOM   1907 C  "C3'" . G  A 1 89  ? 14.22900 66.19500 61.05800  1.000 155.71576 ? 191 G  A "C3'" 1 
ATOM   1908 O  "O3'" . G  A 1 89  ? 12.97200 66.08700 60.41600  1.000 154.39191 ? 191 G  A "O3'" 1 
ATOM   1909 C  "C2'" . G  A 1 89  ? 15.09200 67.32900 60.51200  1.000 158.49241 ? 191 G  A "C2'" 1 
ATOM   1910 O  "O2'" . G  A 1 89  ? 14.30200 68.48100 60.26000  1.000 161.03745 ? 191 G  A "O2'" 1 
ATOM   1911 C  "C1'" . G  A 1 89  ? 16.00900 67.62600 61.70300  1.000 155.56311 ? 191 G  A "C1'" 1 
ATOM   1912 N  N9    . G  A 1 89  ? 17.36700 67.07600 61.52100  1.000 158.72928 ? 191 G  A N9    1 
ATOM   1913 C  C8    . G  A 1 89  ? 17.95900 65.98300 62.10700  1.000 153.87343 ? 191 G  A C8    1 
ATOM   1914 N  N7    . G  A 1 89  ? 19.19000 65.79500 61.70400  1.000 156.03948 ? 191 G  A N7    1 
ATOM   1915 C  C5    . G  A 1 89  ? 19.42500 66.82300 60.79900  1.000 157.40807 ? 191 G  A C5    1 
ATOM   1916 C  C6    . G  A 1 89  ? 20.57800 67.14900 60.03400  1.000 157.92918 ? 191 G  A C6    1 
ATOM   1917 O  O6    . G  A 1 89  ? 21.67100 66.57200 59.99400  1.000 158.29238 ? 191 G  A O6    1 
ATOM   1918 N  N1    . G  A 1 89  ? 20.37000 68.27900 59.24800  1.000 154.96040 ? 191 G  A N1    1 
ATOM   1919 C  C2    . G  A 1 89  ? 19.20900 69.00700 59.20000  1.000 157.16856 ? 191 G  A C2    1 
ATOM   1920 N  N2    . G  A 1 89  ? 19.20400 70.06600 58.37700  1.000 159.55043 ? 191 G  A N2    1 
ATOM   1921 N  N3    . G  A 1 89  ? 18.13000 68.71400 59.90500  1.000 161.44013 ? 191 G  A N3    1 
ATOM   1922 C  C4    . G  A 1 89  ? 18.30700 67.62000 60.67800  1.000 159.67413 ? 191 G  A C4    1 
ATOM   1923 P  P     . A  A 1 90  ? 12.75300 65.09800 59.16500  1.000 159.78376 ? 192 A  A P     1 
ATOM   1924 O  OP1   . A  A 1 90  ? 11.29600 65.19000 58.89200  1.000 168.66903 ? 192 A  A OP1   1 
ATOM   1925 O  OP2   . A  A 1 90  ? 13.35700 63.76700 59.40700  1.000 156.91499 ? 192 A  A OP2   1 
ATOM   1926 O  "O5'" . A  A 1 90  ? 13.58700 65.76800 57.97800  1.000 154.12518 ? 192 A  A "O5'" 1 
ATOM   1927 C  "C5'" . A  A 1 90  ? 12.94600 66.77200 57.21300  1.000 159.66006 ? 192 A  A "C5'" 1 
ATOM   1928 C  "C4'" . A  A 1 90  ? 13.92100 67.72100 56.55400  1.000 160.76545 ? 192 A  A "C4'" 1 
ATOM   1929 O  "O4'" . A  A 1 90  ? 14.97100 68.10900 57.47700  1.000 160.75756 ? 192 A  A "O4'" 1 
ATOM   1930 C  "C3'" . A  A 1 90  ? 14.68500 67.17200 55.36100  1.000 157.94143 ? 192 A  A "C3'" 1 
ATOM   1931 O  "O3'" . A  A 1 90  ? 13.87600 66.99600 54.20200  1.000 159.92062 ? 192 A  A "O3'" 1 
ATOM   1932 C  "C2'" . A  A 1 90  ? 15.78000 68.22600 55.25900  1.000 160.94969 ? 192 A  A "C2'" 1 
ATOM   1933 O  "O2'" . A  A 1 90  ? 15.37700 69.46600 54.70100  1.000 151.88544 ? 192 A  A "O2'" 1 
ATOM   1934 C  "C1'" . A  A 1 90  ? 16.16800 68.34700 56.74700  1.000 165.75553 ? 192 A  A "C1'" 1 
ATOM   1935 N  N9    . A  A 1 90  ? 17.23400 67.38500 57.10000  1.000 161.29710 ? 192 A  A N9    1 
ATOM   1936 C  C8    . A  A 1 90  ? 17.14700 66.20200 57.78900  1.000 157.27556 ? 192 A  A C8    1 
ATOM   1937 N  N7    . A  A 1 90  ? 18.25800 65.50600 57.83500  1.000 156.09647 ? 192 A  A N7    1 
ATOM   1938 C  C5    . A  A 1 90  ? 19.14100 66.27100 57.10500  1.000 159.01261 ? 192 A  A C5    1 
ATOM   1939 C  C6    . A  A 1 90  ? 20.48700 66.07700 56.74600  1.000 158.66783 ? 192 A  A C6    1 
ATOM   1940 N  N6    . A  A 1 90  ? 21.17100 65.00100 57.11900  1.000 154.15414 ? 192 A  A N6    1 
ATOM   1941 N  N1    . A  A 1 90  ? 21.09500 67.02900 56.00300  1.000 163.31839 ? 192 A  A N1    1 
ATOM   1942 C  C2    . A  A 1 90  ? 20.36500 68.09100 55.60800  1.000 165.92397 ? 192 A  A C2    1 
ATOM   1943 N  N3    . A  A 1 90  ? 19.10000 68.39900 55.90000  1.000 163.61580 ? 192 A  A N3    1 
ATOM   1944 C  C4    . A  A 1 90  ? 18.52700 67.42000 56.63100  1.000 160.84178 ? 192 A  A C4    1 
ATOM   1945 P  P     . C  A 1 91  ? 13.58200 65.52000 53.64100  1.000 167.55016 ? 193 C  A P     1 
ATOM   1946 O  OP1   . C  A 1 91  ? 12.25200 65.51400 52.98000  1.000 171.44010 ? 193 C  A OP1   1 
ATOM   1947 O  OP2   . C  A 1 91  ? 13.86400 64.55400 54.73400  1.000 166.07366 ? 193 C  A OP2   1 
ATOM   1948 O  "O5'" . C  A 1 91  ? 14.68400 65.32300 52.51000  1.000 155.80664 ? 193 C  A "O5'" 1 
ATOM   1949 C  "C5'" . C  A 1 91  ? 14.93600 66.34500 51.56000  1.000 155.61451 ? 193 C  A "C5'" 1 
ATOM   1950 C  "C4'" . C  A 1 91  ? 16.36400 66.30600 51.08200  1.000 158.09113 ? 193 C  A "C4'" 1 
ATOM   1951 O  "O4'" . C  A 1 91  ? 17.26400 66.61500 52.18000  1.000 162.54429 ? 193 C  A "O4'" 1 
ATOM   1952 C  "C3'" . C  A 1 91  ? 16.85400 64.96000 50.58300  1.000 156.11457 ? 193 C  A "C3'" 1 
ATOM   1953 O  "O3'" . C  A 1 91  ? 16.42100 64.66000 49.27000  1.000 160.56248 ? 193 C  A "O3'" 1 
ATOM   1954 C  "C2'" . C  A 1 91  ? 18.36300 65.08700 50.73000  1.000 155.91718 ? 193 C  A "C2'" 1 
ATOM   1955 O  "O2'" . C  A 1 91  ? 18.90300 65.87600 49.67700  1.000 149.69802 ? 193 C  A "O2'" 1 
ATOM   1956 C  "C1'" . C  A 1 91  ? 18.46400 65.87800 52.03600  1.000 158.40169 ? 193 C  A "C1'" 1 
ATOM   1957 N  N1    . C  A 1 91  ? 18.63400 64.98600 53.21000  1.000 153.89852 ? 193 C  A N1    1 
ATOM   1958 C  C2    . C  A 1 91  ? 19.91700 64.50300 53.49500  1.000 155.90665 ? 193 C  A C2    1 
ATOM   1959 O  O2    . C  A 1 91  ? 20.86200 64.84000 52.76800  1.000 156.87519 ? 193 C  A O2    1 
ATOM   1960 N  N3    . C  A 1 91  ? 20.10600 63.68500 54.55600  1.000 156.84887 ? 193 C  A N3    1 
ATOM   1961 C  C4    . C  A 1 91  ? 19.07500 63.33900 55.32600  1.000 153.61954 ? 193 C  A C4    1 
ATOM   1962 N  N4    . C  A 1 91  ? 19.31600 62.52800 56.36200  1.000 151.85880 ? 193 C  A N4    1 
ATOM   1963 C  C5    . C  A 1 91  ? 17.75500 63.81200 55.06400  1.000 154.72493 ? 193 C  A C5    1 
ATOM   1964 C  C6    . C  A 1 91  ? 17.58200 64.62100 54.00700  1.000 156.74623 ? 193 C  A C6    1 
ATOM   1965 P  P     . G  A 1 92  ? 16.01100 63.15500 48.89600  1.000 168.47167 ? 194 G  A P     1 
ATOM   1966 O  OP1   . G  A 1 92  ? 15.33500 63.18600 47.57600  1.000 164.47119 ? 194 G  A OP1   1 
ATOM   1967 O  OP2   . G  A 1 92  ? 15.31200 62.58300 50.07500  1.000 159.58640 ? 194 G  A OP2   1 
ATOM   1968 O  "O5'" . G  A 1 92  ? 17.41200 62.41900 48.70300  1.000 154.23839 ? 194 G  A "O5'" 1 
ATOM   1969 C  "C5'" . G  A 1 92  ? 18.29400 62.82300 47.66600  1.000 150.71428 ? 194 G  A "C5'" 1 
ATOM   1970 C  "C4'" . G  A 1 92  ? 19.70700 62.35500 47.90200  1.000 150.46688 ? 194 G  A "C4'" 1 
ATOM   1971 O  "O4'" . G  A 1 92  ? 20.19900 62.86400 49.17000  1.000 156.37022 ? 194 G  A "O4'" 1 
ATOM   1972 C  "C3'" . G  A 1 92  ? 19.91000 60.85500 48.01800  1.000 151.23276 ? 194 G  A "C3'" 1 
ATOM   1973 O  "O3'" . G  A 1 92  ? 19.90800 60.18500 46.77100  1.000 158.09411 ? 194 G  A "O3'" 1 
ATOM   1974 C  "C2'" . G  A 1 92  ? 21.23400 60.76900 48.76000  1.000 152.84348 ? 194 G  A "C2'" 1 
ATOM   1975 O  "O2'" . G  A 1 92  ? 22.32100 61.06000 47.89200  1.000 155.46748 ? 194 G  A "O2'" 1 
ATOM   1976 C  "C1'" . G  A 1 92  ? 21.08300 61.92500 49.74900  1.000 154.96479 ? 194 G  A "C1'" 1 
ATOM   1977 N  N9    . G  A 1 92  ? 20.51400 61.46000 51.02700  1.000 149.48782 ? 194 G  A N9    1 
ATOM   1978 C  C8    . G  A 1 92  ? 19.31200 61.79900 51.60200  1.000 151.29066 ? 194 G  A C8    1 
ATOM   1979 N  N7    . G  A 1 92  ? 19.10500 61.19700 52.74200  1.000 152.51450 ? 194 G  A N7    1 
ATOM   1980 C  C5    . G  A 1 92  ? 20.23300 60.40800 52.92500  1.000 152.74347 ? 194 G  A C5    1 
ATOM   1981 C  C6    . G  A 1 92  ? 20.58400 59.52600 53.98200  1.000 147.74550 ? 194 G  A C6    1 
ATOM   1982 O  O6    . G  A 1 92  ? 19.94200 59.25700 55.00400  1.000 144.57144 ? 194 G  A O6    1 
ATOM   1983 N  N1    . G  A 1 92  ? 21.82300 58.92900 53.76300  1.000 144.80304 ? 194 G  A N1    1 
ATOM   1984 C  C2    . G  A 1 92  ? 22.62400 59.14900 52.67000  1.000 147.06384 ? 194 G  A C2    1 
ATOM   1985 N  N2    . G  A 1 92  ? 23.78900 58.48300 52.63500  1.000 144.59249 ? 194 G  A N2    1 
ATOM   1986 N  N3    . G  A 1 92  ? 22.30800 59.96800 51.68300  1.000 149.49045 ? 194 G  A N3    1 
ATOM   1987 C  C4    . G  A 1 92  ? 21.11000 60.55900 51.87400  1.000 149.01934 ? 194 G  A C4    1 
ATOM   1988 P  P     . G  A 1 93  ? 19.25300 58.72300 46.64900  1.000 168.81295 ? 195 G  A P     1 
ATOM   1989 O  OP1   . G  A 1 93  ? 19.24000 58.35800 45.21000  1.000 164.55717 ? 195 G  A OP1   1 
ATOM   1990 O  OP2   . G  A 1 93  ? 17.98500 58.70900 47.42500  1.000 153.79273 ? 195 G  A OP2   1 
ATOM   1991 O  "O5'" . G  A 1 93  ? 20.30700 57.77300 47.37400  1.000 149.07111 ? 195 G  A "O5'" 1 
ATOM   1992 C  "C5'" . G  A 1 93  ? 21.57800 57.52700 46.78800  1.000 153.04527 ? 195 G  A "C5'" 1 
ATOM   1993 C  "C4'" . G  A 1 93  ? 22.50900 56.80300 47.73000  1.000 151.65563 ? 195 G  A "C4'" 1 
ATOM   1994 O  "O4'" . G  A 1 93  ? 22.56000 57.50000 49.00200  1.000 148.60263 ? 195 G  A "O4'" 1 
ATOM   1995 C  "C3'" . G  A 1 93  ? 22.13100 55.37700 48.10500  1.000 152.22938 ? 195 G  A "C3'" 1 
ATOM   1996 O  "O3'" . G  A 1 93  ? 22.49000 54.42800 47.11200  1.000 153.64271 ? 195 G  A "O3'" 1 
ATOM   1997 C  "C2'" . G  A 1 93  ? 22.86200 55.18200 49.42800  1.000 143.38885 ? 195 G  A "C2'" 1 
ATOM   1998 O  "O2'" . G  A 1 93  ? 24.23900 54.92100 49.20500  1.000 146.21024 ? 195 G  A "O2'" 1 
ATOM   1999 C  "C1'" . G  A 1 93  ? 22.72900 56.57200 50.05200  1.000 142.36504 ? 195 G  A "C1'" 1 
ATOM   2000 N  N9    . G  A 1 93  ? 21.56300 56.65400 50.95100  1.000 147.45249 ? 195 G  A N9    1 
ATOM   2001 C  C8    . G  A 1 93  ? 20.39400 57.34800 50.75300  1.000 145.21801 ? 195 G  A C8    1 
ATOM   2002 N  N7    . G  A 1 93  ? 19.54300 57.21100 51.73200  1.000 141.24648 ? 195 G  A N7    1 
ATOM   2003 C  C5    . G  A 1 93  ? 20.19400 56.37900 52.63300  1.000 147.19983 ? 195 G  A C5    1 
ATOM   2004 C  C6    . G  A 1 93  ? 19.77200 55.87200 53.89100  1.000 144.24684 ? 195 G  A C6    1 
ATOM   2005 O  O6    . G  A 1 93  ? 18.70600 56.06700 54.49100  1.000 139.74104 ? 195 G  A O6    1 
ATOM   2006 N  N1    . G  A 1 93  ? 20.74500 55.06000 54.46700  1.000 140.14109 ? 195 G  A N1    1 
ATOM   2007 C  C2    . G  A 1 93  ? 21.96600 54.76700 53.91000  1.000 142.09132 ? 195 G  A C2    1 
ATOM   2008 N  N2    . G  A 1 93  ? 22.76800 53.96200 54.62400  1.000 137.89345 ? 195 G  A N2    1 
ATOM   2009 N  N3    . G  A 1 93  ? 22.36600 55.23100 52.73900  1.000 150.72657 ? 195 G  A N3    1 
ATOM   2010 C  C4    . G  A 1 93  ? 21.43900 56.02400 52.16300  1.000 150.52128 ? 195 G  A C4    1 
ATOM   2011 P  P     . A  A 1 94  ? 21.72200 53.01800 47.00500  1.000 153.92083 ? 196 A  A P     1 
ATOM   2012 O  OP1   . A  A 1 94  ? 22.12000 52.37800 45.72600  1.000 144.99081 ? 196 A  A OP1   1 
ATOM   2013 O  OP2   . A  A 1 94  ? 20.28200 53.24600 47.28900  1.000 148.06486 ? 196 A  A OP2   1 
ATOM   2014 O  "O5'" . A  A 1 94  ? 22.33700 52.14700 48.19000  1.000 151.96007 ? 196 A  A "O5'" 1 
ATOM   2015 C  "C5'" . A  A 1 94  ? 23.68100 51.69000 48.14300  1.000 147.67798 ? 196 A  A "C5'" 1 
ATOM   2016 C  "C4'" . A  A 1 94  ? 24.06700 50.99300 49.42200  1.000 147.15949 ? 196 A  A "C4'" 1 
ATOM   2017 O  "O4'" . A  A 1 94  ? 23.87500 51.90100 50.53700  1.000 147.01211 ? 196 A  A "O4'" 1 
ATOM   2018 C  "C3'" . A  A 1 94  ? 23.23800 49.76800 49.78300  1.000 146.11989 ? 196 A  A "C3'" 1 
ATOM   2019 O  "O3'" . A  A 1 94  ? 23.69500 48.59500 49.13200  1.000 147.83589 ? 196 A  A "O3'" 1 
ATOM   2020 C  "C2'" . A  A 1 94  ? 23.35600 49.71200 51.30200  1.000 146.49099 ? 196 A  A "C2'" 1 
ATOM   2021 O  "O2'" . A  A 1 94  ? 24.58800 49.12300 51.69700  1.000 147.83326 ? 196 A  A "O2'" 1 
ATOM   2022 C  "C1'" . A  A 1 94  ? 23.38700 51.19800 51.65900  1.000 143.85383 ? 196 A  A "C1'" 1 
ATOM   2023 N  N9    . A  A 1 94  ? 22.05100 51.73000 51.98500  1.000 140.87453 ? 196 A  A N9    1 
ATOM   2024 C  C8    . A  A 1 94  ? 21.29700 52.59400 51.23300  1.000 143.12217 ? 196 A  A C8    1 
ATOM   2025 N  N7    . A  A 1 94  ? 20.15100 52.91000 51.77700  1.000 140.30341 ? 196 A  A N7    1 
ATOM   2026 C  C5    . A  A 1 94  ? 20.15200 52.20800 52.97300  1.000 143.44852 ? 196 A  A C5    1 
ATOM   2027 C  C6    . A  A 1 94  ? 19.21300 52.12400 54.01600  1.000 143.00110 ? 196 A  A C6    1 
ATOM   2028 N  N6    . A  A 1 94  ? 18.04300 52.77100 54.01800  1.000 143.82751 ? 196 A  A N6    1 
ATOM   2029 N  N1    . A  A 1 94  ? 19.51800 51.33800 55.07300  1.000 139.56121 ? 196 A  A N1    1 
ATOM   2030 C  C2    . A  A 1 94  ? 20.69000 50.69000 55.07300  1.000 140.15076 ? 196 A  A C2    1 
ATOM   2031 N  N3    . A  A 1 94  ? 21.65300 50.69300 54.15300  1.000 143.59327 ? 196 A  A N3    1 
ATOM   2032 C  C4    . A  A 1 94  ? 21.31900 51.48000 53.11800  1.000 143.16428 ? 196 A  A C4    1 
ATOM   2033 P  P     . C  A 1 95  ? 22.71800 47.76000 48.16800  1.000 152.62788 ? 197 C  A P     1 
ATOM   2034 O  OP1   . C  A 1 95  ? 23.56100 47.11800 47.12700  1.000 148.47475 ? 197 C  A OP1   1 
ATOM   2035 O  OP2   . C  A 1 95  ? 21.60700 48.64800 47.74500  1.000 147.14038 ? 197 C  A OP2   1 
ATOM   2036 O  "O5'" . C  A 1 95  ? 22.11700 46.63100 49.12200  1.000 148.84585 ? 197 C  A "O5'" 1 
ATOM   2037 C  "C5'" . C  A 1 95  ? 22.97000 45.68500 49.75600  1.000 148.56687 ? 197 C  A "C5'" 1 
ATOM   2038 C  "C4'" . C  A 1 95  ? 22.42300 45.22100 51.08700  1.000 152.04360 ? 197 C  A "C4'" 1 
ATOM   2039 O  "O4'" . C  A 1 95  ? 22.20700 46.35800 51.96000  1.000 152.55945 ? 197 C  A "O4'" 1 
ATOM   2040 C  "C3'" . C  A 1 95  ? 21.08100 44.50500 51.05800  1.000 151.05927 ? 197 C  A "C3'" 1 
ATOM   2041 O  "O3'" . C  A 1 95  ? 21.21900 43.12600 50.75200  1.000 152.95161 ? 197 C  A "O3'" 1 
ATOM   2042 C  "C2'" . C  A 1 95  ? 20.53100 44.73800 52.46400  1.000 144.11897 ? 197 C  A "C2'" 1 
ATOM   2043 O  "O2'" . C  A 1 95  ? 21.05100 43.77800 53.37200  1.000 134.48623 ? 197 C  A "O2'" 1 
ATOM   2044 C  "C1'" . C  A 1 95  ? 21.11300 46.11100 52.81700  1.000 145.06645 ? 197 C  A "C1'" 1 
ATOM   2045 N  N1    . C  A 1 95  ? 20.13400 47.21400 52.67600  1.000 143.73734 ? 197 C  A N1    1 
ATOM   2046 C  C2    . C  A 1 95  ? 19.12700 47.38600 53.63700  1.000 142.15031 ? 197 C  A C2    1 
ATOM   2047 O  O2    . C  A 1 95  ? 19.05500 46.60500 54.60000  1.000 142.34507 ? 197 C  A O2    1 
ATOM   2048 N  N3    . C  A 1 95  ? 18.25200 48.41000 53.49500  1.000 146.53505 ? 197 C  A N3    1 
ATOM   2049 C  C4    . C  A 1 95  ? 18.35700 49.23900 52.45300  1.000 143.56364 ? 197 C  A C4    1 
ATOM   2050 N  N4    . C  A 1 95  ? 17.46800 50.23300 52.34800  1.000 147.27198 ? 197 C  A N4    1 
ATOM   2051 C  C5    . C  A 1 95  ? 19.37500 49.08500 51.46700  1.000 145.61125 ? 197 C  A C5    1 
ATOM   2052 C  C6    . C  A 1 95  ? 20.23400 48.07200 51.61900  1.000 147.29567 ? 197 C  A C6    1 
ATOM   2053 P  P     . A  A 1 96  ? 21.01100 42.58000 49.25700  1.000 157.22944 ? 198 A  A P     1 
ATOM   2054 O  OP1   . A  A 1 96  ? 22.30700 42.68300 48.54300  1.000 156.60569 ? 198 A  A OP1   1 
ATOM   2055 O  OP2   . A  A 1 96  ? 19.80100 43.22700 48.68900  1.000 154.04222 ? 198 A  A OP2   1 
ATOM   2056 O  "O5'" . A  A 1 96  ? 20.69700 41.03000 49.46000  1.000 150.32599 ? 198 A  A "O5'" 1 
ATOM   2057 C  "C5'" . A  A 1 96  ? 21.63400 40.15700 50.08800  1.000 147.76515 ? 198 A  A "C5'" 1 
ATOM   2058 C  "C4'" . A  A 1 96  ? 20.94700 39.07200 50.88700  1.000 155.11077 ? 198 A  A "C4'" 1 
ATOM   2059 O  "O4'" . A  A 1 96  ? 20.22200 39.68200 51.99000  1.000 150.90237 ? 198 A  A "O4'" 1 
ATOM   2060 C  "C3'" . A  A 1 96  ? 19.92400 38.23200 50.12000  1.000 156.95836 ? 198 A  A "C3'" 1 
ATOM   2061 O  "O3'" . A  A 1 96  ? 19.90100 36.90800 50.65700  1.000 165.40148 ? 198 A  A "O3'" 1 
ATOM   2062 C  "C2'" . A  A 1 96  ? 18.60900 38.92000 50.46600  1.000 153.50005 ? 198 A  A "C2'" 1 
ATOM   2063 O  "O2'" . A  A 1 96  ? 17.46500 38.10200 50.33500  1.000 146.65186 ? 198 A  A "O2'" 1 
ATOM   2064 C  "C1'" . A  A 1 96  ? 18.85700 39.31700 51.91800  1.000 152.40255 ? 198 A  A "C1'" 1 
ATOM   2065 N  N9    . A  A 1 96  ? 18.04200 40.44000 52.38300  1.000 147.44669 ? 198 A  A N9    1 
ATOM   2066 C  C8    . A  A 1 96  ? 18.18100 41.78300 52.13200  1.000 146.62291 ? 198 A  A C8    1 
ATOM   2067 N  N7    . A  A 1 96  ? 17.26500 42.52400 52.71200  1.000 141.44334 ? 198 A  A N7    1 
ATOM   2068 C  C5    . A  A 1 96  ? 16.47300 41.60400 53.38800  1.000 140.91696 ? 198 A  A C5    1 
ATOM   2069 C  C6    . A  A 1 96  ? 15.33100 41.73500 54.19800  1.000 145.06746 ? 198 A  A C6    1 
ATOM   2070 N  N6    . A  A 1 96  ? 14.76000 42.90700 54.48000  1.000 146.19391 ? 198 A  A N6    1 
ATOM   2071 N  N1    . A  A 1 96  ? 14.79100 40.61000 54.71700  1.000 147.05454 ? 198 A  A N1    1 
ATOM   2072 C  C2    . A  A 1 96  ? 15.36200 39.43300 54.43500  1.000 146.57027 ? 198 A  A C2    1 
ATOM   2073 N  N3    . A  A 1 96  ? 16.43400 39.18200 53.68900  1.000 144.18051 ? 198 A  A N3    1 
ATOM   2074 C  C4    . A  A 1 96  ? 16.94600 40.32100 53.19500  1.000 142.73297 ? 198 A  A C4    1 
ATOM   2075 P  P     . U  A 1 97  ? 21.03400 35.83400 50.27100  1.000 170.71580 ? 199 U  A P     1 
ATOM   2076 O  OP1   . U  A 1 97  ? 21.91300 36.41900 49.22700  1.000 167.52857 ? 199 U  A OP1   1 
ATOM   2077 O  OP2   . U  A 1 97  ? 20.36800 34.53400 50.01900  1.000 175.60322 ? 199 U  A OP2   1 
ATOM   2078 O  "O5'" . U  A 1 97  ? 21.86600 35.68300 51.62100  1.000 178.47199 ? 199 U  A "O5'" 1 
ATOM   2079 C  "C5'" . U  A 1 97  ? 22.68700 34.54800 51.87900  1.000 178.19827 ? 199 U  A "C5'" 1 
ATOM   2080 C  "C4'" . U  A 1 97  ? 23.65100 34.84100 53.00200  1.000 180.63541 ? 199 U  A "C4'" 1 
ATOM   2081 O  "O4'" . U  A 1 97  ? 24.71900 33.86600 52.95900  1.000 187.67046 ? 199 U  A "O4'" 1 
ATOM   2082 C  "C3'" . U  A 1 97  ? 24.28700 36.22400 52.93200  1.000 179.14575 ? 199 U  A "C3'" 1 
ATOM   2083 O  "O3'" . U  A 1 97  ? 24.06100 37.01200 54.10500  1.000 166.94692 ? 199 U  A "O3'" 1 
ATOM   2084 C  "C2'" . U  A 1 97  ? 25.78600 35.99700 52.69900  1.000 187.79153 ? 199 U  A "C2'" 1 
ATOM   2085 O  "O2'" . U  A 1 97  ? 26.62400 36.73900 53.56600  1.000 181.71185 ? 199 U  A "O2'" 1 
ATOM   2086 C  "C1'" . U  A 1 97  ? 25.98900 34.48000 52.87000  1.000 192.76844 ? 199 U  A "C1'" 1 
ATOM   2087 N  N1    . U  A 1 97  ? 26.67700 33.88700 51.70100  1.000 195.92145 ? 199 U  A N1    1 
ATOM   2088 C  C2    . U  A 1 97  ? 26.14600 34.10700 50.41500  1.000 198.34016 ? 199 U  A C2    1 
ATOM   2089 O  O2    . U  A 1 97  ? 25.13800 34.74400 50.14900  1.000 192.21311 ? 199 U  A O2    1 
ATOM   2090 N  N3    . U  A 1 97  ? 26.83700 33.53500 49.37900  1.000 206.18057 ? 199 U  A N3    1 
ATOM   2091 C  C4    . U  A 1 97  ? 27.98400 32.78100 49.45500  1.000 206.49114 ? 199 U  A C4    1 
ATOM   2092 O  O4    . U  A 1 97  ? 28.47200 32.34700 48.40600  1.000 205.58050 ? 199 U  A O4    1 
ATOM   2093 C  C5    . U  A 1 97  ? 28.47800 32.59400 50.79400  1.000 199.06920 ? 199 U  A C5    1 
ATOM   2094 C  C6    . U  A 1 97  ? 27.83000 33.13600 51.84300  1.000 194.53444 ? 199 U  A C6    1 
ATOM   2095 P  P     . G  A 1 98  ? 23.79000 36.40500 55.56100  1.000 181.00612 ? 200 G  A P     1 
ATOM   2096 O  OP1   . G  A 1 98  ? 24.94000 35.54300 55.92900  1.000 178.82954 ? 200 G  A OP1   1 
ATOM   2097 O  OP2   . G  A 1 98  ? 22.40600 35.86400 55.64100  1.000 177.91101 ? 200 G  A OP2   1 
ATOM   2098 O  "O5'" . G  A 1 98  ? 23.83700 37.72800 56.45300  1.000 162.92237 ? 200 G  A "O5'" 1 
ATOM   2099 C  "C5'" . G  A 1 98  ? 24.81300 38.73200 56.19400  1.000 149.39180 ? 200 G  A "C5'" 1 
ATOM   2100 C  "C4'" . G  A 1 98  ? 24.29800 39.85400 55.31300  1.000 139.15373 ? 200 G  A "C4'" 1 
ATOM   2101 O  "O4'" . G  A 1 98  ? 23.10700 39.44400 54.58700  1.000 142.34359 ? 200 G  A "O4'" 1 
ATOM   2102 C  "C3'" . G  A 1 98  ? 23.87000 41.12300 56.03100  1.000 135.23484 ? 200 G  A "C3'" 1 
ATOM   2103 O  "O3'" . G  A 1 98  ? 24.95900 41.95200 56.38500  1.000 128.87618 ? 200 G  A "O3'" 1 
ATOM   2104 C  "C2'" . G  A 1 98  ? 22.92000 41.77000 55.03500  1.000 137.42194 ? 200 G  A "C2'" 1 
ATOM   2105 O  "O2'" . G  A 1 98  ? 23.63500 42.43300 54.00100  1.000 134.00048 ? 200 G  A "O2'" 1 
ATOM   2106 C  "C1'" . G  A 1 98  ? 22.23200 40.54600 54.43300  1.000 142.88839 ? 200 G  A "C1'" 1 
ATOM   2107 N  N9    . G  A 1 98  ? 20.96600 40.22600 55.12100  1.000 143.42266 ? 200 G  A N9    1 
ATOM   2108 C  C8    . G  A 1 98  ? 20.61600 38.98400 55.59500  1.000 145.73084 ? 200 G  A C8    1 
ATOM   2109 N  N7    . G  A 1 98  ? 19.44800 38.96400 56.17200  1.000 141.18292 ? 200 G  A N7    1 
ATOM   2110 C  C5    . G  A 1 98  ? 18.99300 40.27100 56.07600  1.000 140.21965 ? 200 G  A C5    1 
ATOM   2111 C  C6    . G  A 1 98  ? 17.77500 40.84200 56.53100  1.000 138.77737 ? 200 G  A C6    1 
ATOM   2112 O  O6    . G  A 1 98  ? 16.84400 40.28200 57.12100  1.000 140.20912 ? 200 G  A O6    1 
ATOM   2113 N  N1    . G  A 1 98  ? 17.69900 42.19800 56.23800  1.000 135.14536 ? 200 G  A N1    1 
ATOM   2114 C  C2    . G  A 1 98  ? 18.67200 42.91200 55.58800  1.000 136.52447 ? 200 G  A C2    1 
ATOM   2115 N  N2    . G  A 1 98  ? 18.41200 44.21400 55.39900  1.000 137.56144 ? 200 G  A N2    1 
ATOM   2116 N  N3    . G  A 1 98  ? 19.81200 42.39100 55.15900  1.000 138.04834 ? 200 G  A N3    1 
ATOM   2117 C  C4    . G  A 1 98  ? 19.91400 41.07000 55.43000  1.000 139.14847 ? 200 G  A C4    1 
ATOM   2118 P  P     . G  A 1 99  ? 25.03300 42.59200 57.85200  1.000 127.79774 ? 201 G  A P     1 
ATOM   2119 O  OP1   . G  A 1 99  ? 26.41600 43.09600 58.03200  1.000 146.10256 ? 201 G  A OP1   1 
ATOM   2120 O  OP2   . G  A 1 99  ? 24.47600 41.61300 58.82000  1.000 123.39458 ? 201 G  A OP2   1 
ATOM   2121 O  "O5'" . G  A 1 99  ? 24.03900 43.83500 57.77700  1.000 128.96630 ? 201 G  A "O5'" 1 
ATOM   2122 C  "C5'" . G  A 1 99  ? 24.17000 44.81000 56.75200  1.000 130.62966 ? 201 G  A "C5'" 1 
ATOM   2123 C  "C4'" . G  A 1 99  ? 23.12800 45.89300 56.87900  1.000 129.69796 ? 201 G  A "C4'" 1 
ATOM   2124 O  "O4'" . G  A 1 99  ? 21.83900 45.39100 56.44300  1.000 134.38537 ? 201 G  A "O4'" 1 
ATOM   2125 C  "C3'" . G  A 1 99  ? 22.87000 46.40100 58.28800  1.000 126.78446 ? 201 G  A "C3'" 1 
ATOM   2126 O  "O3'" . G  A 1 99  ? 23.82200 47.35700 58.71400  1.000 124.33680 ? 201 G  A "O3'" 1 
ATOM   2127 C  "C2'" . G  A 1 99  ? 21.45300 46.94400 58.19400  1.000 129.80850 ? 201 G  A "C2'" 1 
ATOM   2128 O  "O2'" . G  A 1 99  ? 21.44100 48.22000 57.57000  1.000 133.98795 ? 201 G  A "O2'" 1 
ATOM   2129 C  "C1'" . G  A 1 99  ? 20.81300 45.93000 57.24900  1.000 129.72428 ? 201 G  A "C1'" 1 
ATOM   2130 N  N9    . G  A 1 99  ? 20.18700 44.82300 57.99200  1.000 128.85839 ? 201 G  A N9    1 
ATOM   2131 C  C8    . G  A 1 99  ? 20.64300 43.53100 58.08100  1.000 128.68469 ? 201 G  A C8    1 
ATOM   2132 N  N7    . G  A 1 99  ? 19.87900 42.77200 58.81400  1.000 132.50093 ? 201 G  A N7    1 
ATOM   2133 C  C5    . G  A 1 99  ? 18.86200 43.61700 59.23800  1.000 131.74558 ? 201 G  A C5    1 
ATOM   2134 C  C6    . G  A 1 99  ? 17.73700 43.35800 60.06100  1.000 130.04011 ? 201 G  A C6    1 
ATOM   2135 O  O6    . G  A 1 99  ? 17.40000 42.29400 60.59800  1.000 131.15340 ? 201 G  A O6    1 
ATOM   2136 N  N1    . G  A 1 99  ? 16.96000 44.50000 60.23400  1.000 130.25329 ? 201 G  A N1    1 
ATOM   2137 C  C2    . G  A 1 99  ? 17.22600 45.73200 59.68900  1.000 131.06655 ? 201 G  A C2    1 
ATOM   2138 N  N2    . G  A 1 99  ? 16.35600 46.71100 59.97800  1.000 135.56446 ? 201 G  A N2    1 
ATOM   2139 N  N3    . G  A 1 99  ? 18.27200 45.98500 58.92100  1.000 129.28213 ? 201 G  A N3    1 
ATOM   2140 C  C4    . G  A 1 99  ? 19.03800 44.88900 58.73900  1.000 131.29289 ? 201 G  A C4    1 
ATOM   2141 P  P     . U  A 1 100 ? 24.44500 47.26400 60.19300  1.000 116.51521 ? 202 U  A P     1 
ATOM   2142 O  OP1   . U  A 1 100 ? 25.47000 48.32800 60.33500  1.000 123.64764 ? 202 U  A OP1   1 
ATOM   2143 O  OP2   . U  A 1 100 ? 24.82800 45.85200 60.45400  1.000 112.46209 ? 202 U  A OP2   1 
ATOM   2144 O  "O5'" . U  A 1 100 ? 23.22600 47.63300 61.14800  1.000 123.69765 ? 202 U  A "O5'" 1 
ATOM   2145 C  "C5'" . U  A 1 100 ? 22.57700 48.89100 61.04200  1.000 124.49248 ? 202 U  A "C5'" 1 
ATOM   2146 C  "C4'" . U  A 1 100 ? 21.23700 48.88700 61.73200  1.000 122.07377 ? 202 U  A "C4'" 1 
ATOM   2147 O  "O4'" . U  A 1 100 ? 20.37800 47.88400 61.12900  1.000 122.49751 ? 202 U  A "O4'" 1 
ATOM   2148 C  "C3'" . U  A 1 100 ? 21.24900 48.52400 63.20900  1.000 115.58089 ? 202 U  A "C3'" 1 
ATOM   2149 O  "O3'" . U  A 1 100 ? 21.62000 49.61000 64.04200  1.000 110.71715 ? 202 U  A "O3'" 1 
ATOM   2150 C  "C2'" . U  A 1 100 ? 19.83100 48.02000 63.43900  1.000 117.55481 ? 202 U  A "C2'" 1 
ATOM   2151 O  "O2'" . U  A 1 100 ? 18.92400 49.10500 63.57900  1.000 118.44439 ? 202 U  A "O2'" 1 
ATOM   2152 C  "C1'" . U  A 1 100 ? 19.54600 47.30700 62.11400  1.000 123.82925 ? 202 U  A "C1'" 1 
ATOM   2153 N  N1    . U  A 1 100 ? 19.83100 45.85300 62.18900  1.000 120.56570 ? 202 U  A N1    1 
ATOM   2154 C  C2    . U  A 1 100 ? 18.86700 45.05500 62.77300  1.000 123.44499 ? 202 U  A C2    1 
ATOM   2155 O  O2    . U  A 1 100 ? 17.82300 45.49500 63.21600  1.000 126.80855 ? 202 U  A O2    1 
ATOM   2156 N  N3    . U  A 1 100 ? 19.16800 43.71900 62.82400  1.000 122.88703 ? 202 U  A N3    1 
ATOM   2157 C  C4    . U  A 1 100 ? 20.31500 43.10900 62.35800  1.000 122.83439 ? 202 U  A C4    1 
ATOM   2158 O  O4    . U  A 1 100 ? 20.44400 41.88800 62.47700  1.000 122.50803 ? 202 U  A O4    1 
ATOM   2159 C  C5    . U  A 1 100 ? 21.26800 43.99900 61.76600  1.000 121.55002 ? 202 U  A C5    1 
ATOM   2160 C  C6    . U  A 1 100 ? 21.00000 45.30900 61.70500  1.000 119.23922 ? 202 U  A C6    1 
ATOM   2161 P  P     . C  A 1 101 ? 22.59800 49.37000 65.29400  1.000 113.04424 ? 203 C  A P     1 
ATOM   2162 O  OP1   . C  A 1 101 ? 23.25000 50.66300 65.62400  1.000 107.49620 ? 203 C  A OP1   1 
ATOM   2163 O  OP2   . C  A 1 101 ? 23.44000 48.18600 64.98900  1.000 115.60770 ? 203 C  A OP2   1 
ATOM   2164 O  "O5'" . C  A 1 101 ? 21.60900 48.98800 66.48400  1.000 117.53425 ? 203 C  A "O5'" 1 
ATOM   2165 C  "C5'" . C  A 1 101 ? 20.51700 49.83300 66.81900  1.000 115.51822 ? 203 C  A "C5'" 1 
ATOM   2166 C  "C4'" . C  A 1 101 ? 19.47700 49.11700 67.64600  1.000 114.58390 ? 203 C  A "C4'" 1 
ATOM   2167 O  "O4'" . C  A 1 101 ? 18.76100 48.15500 66.83000  1.000 116.16830 ? 203 C  A "O4'" 1 
ATOM   2168 C  "C3'" . C  A 1 101 ? 19.98900 48.29200 68.81200  1.000 113.62325 ? 203 C  A "C3'" 1 
ATOM   2169 O  "O3'" . C  A 1 101 ? 20.31900 49.08200 69.94100  1.000 108.13312 ? 203 C  A "O3'" 1 
ATOM   2170 C  "C2'" . C  A 1 101 ? 18.84300 47.31800 69.05500  1.000 118.26855 ? 203 C  A "C2'" 1 
ATOM   2171 O  "O2'" . C  A 1 101 ? 17.79600 47.94900 69.78000  1.000 121.07941 ? 203 C  A "O2'" 1 
ATOM   2172 C  "C1'" . C  A 1 101 ? 18.35800 47.05800 67.62700  1.000 115.84194 ? 203 C  A "C1'" 1 
ATOM   2173 N  N1    . C  A 1 101 ? 18.92500 45.81200 67.06000  1.000 117.59742 ? 203 C  A N1    1 
ATOM   2174 C  C2    . C  A 1 101 ? 18.31300 44.59700 67.37900  1.000 122.35851 ? 203 C  A C2    1 
ATOM   2175 O  O2    . C  A 1 101 ? 17.31700 44.59900 68.11500  1.000 126.20897 ? 203 C  A O2    1 
ATOM   2176 N  N3    . C  A 1 101 ? 18.81400 43.44900 66.87500  1.000 125.74313 ? 203 C  A N3    1 
ATOM   2177 C  C4    . C  A 1 101 ? 19.88700 43.48500 66.08400  1.000 125.66417 ? 203 C  A C4    1 
ATOM   2178 N  N4    . C  A 1 101 ? 20.35100 42.32600 65.60900  1.000 130.35684 ? 203 C  A N4    1 
ATOM   2179 C  C5    . C  A 1 101 ? 20.53400 44.71000 65.74500  1.000 122.75856 ? 203 C  A C5    1 
ATOM   2180 C  C6    . C  A 1 101 ? 20.02400 45.83800 66.25200  1.000 120.81885 ? 203 C  A C6    1 
ATOM   2181 P  P     . C  A 1 102 ? 21.44300 48.58400 70.97500  1.000 111.20207 ? 204 C  A P     1 
ATOM   2182 O  OP1   . C  A 1 102 ? 21.74300 49.71800 71.88600  1.000 119.02932 ? 204 C  A OP1   1 
ATOM   2183 O  OP2   . C  A 1 102 ? 22.54900 47.95500 70.20700  1.000 116.00528 ? 204 C  A OP2   1 
ATOM   2184 O  "O5'" . C  A 1 102 ? 20.71200 47.44200 71.81100  1.000 115.33941 ? 204 C  A "O5'" 1 
ATOM   2185 C  "C5'" . C  A 1 102 ? 19.52500 47.72000 72.53900  1.000 106.70942 ? 204 C  A "C5'" 1 
ATOM   2186 C  "C4'" . C  A 1 102 ? 18.94500 46.46900 73.14700  1.000 106.15673 ? 204 C  A "C4'" 1 
ATOM   2187 O  "O4'" . C  A 1 102 ? 18.43300 45.59600 72.10700  1.000 109.87296 ? 204 C  A "O4'" 1 
ATOM   2188 C  "C3'" . C  A 1 102 ? 19.91500 45.59000 73.91300  1.000 104.75919 ? 204 C  A "C3'" 1 
ATOM   2189 O  "O3'" . C  A 1 102 ? 20.19600 46.07800 75.21200  1.000 106.48308 ? 204 C  A "O3'" 1 
ATOM   2190 C  "C2'" . C  A 1 102 ? 19.21800 44.23600 73.89500  1.000 108.13854 ? 204 C  A "C2'" 1 
ATOM   2191 O  "O2'" . C  A 1 102 ? 18.18800 44.18100 74.87200  1.000 116.07634 ? 204 C  A "O2'" 1 
ATOM   2192 C  "C1'" . C  A 1 102 ? 18.56700 44.24600 72.50900  1.000 111.32577 ? 204 C  A "C1'" 1 
ATOM   2193 N  N1    . C  A 1 102 ? 19.37200 43.51400 71.50300  1.000 116.84748 ? 204 C  A N1    1 
ATOM   2194 C  C2    . C  A 1 102 ? 19.26800 42.12000 71.45000  1.000 120.19788 ? 204 C  A C2    1 
ATOM   2195 O  O2    . C  A 1 102 ? 18.51100 41.54300 72.24600  1.000 123.27983 ? 204 C  A O2    1 
ATOM   2196 N  N3    . C  A 1 102 ? 19.99100 41.42900 70.53700  1.000 119.02669 ? 204 C  A N3    1 
ATOM   2197 C  C4    . C  A 1 102 ? 20.79700 42.07700 69.69700  1.000 115.97896 ? 204 C  A C4    1 
ATOM   2198 N  N4    . C  A 1 102 ? 21.48900 41.34900 68.81600  1.000 120.85849 ? 204 C  A N4    1 
ATOM   2199 C  C5    . C  A 1 102 ? 20.92300 43.49700 69.72600  1.000 113.89186 ? 204 C  A C5    1 
ATOM   2200 C  C6    . C  A 1 102 ? 20.19900 44.16800 70.63300  1.000 114.21822 ? 204 C  A C6    1 
ATOM   2201 P  P     . U  A 1 103 ? 21.70000 46.04400 75.77000  1.000 108.56048 ? 205 U  A P     1 
ATOM   2202 O  OP1   . U  A 1 103 ? 21.71800 46.76400 77.06400  1.000 120.88037 ? 205 U  A OP1   1 
ATOM   2203 O  OP2   . U  A 1 103 ? 22.61700 46.47000 74.68700  1.000 116.34825 ? 205 U  A OP2   1 
ATOM   2204 O  "O5'" . U  A 1 103 ? 21.95400 44.50100 76.06500  1.000 109.87642 ? 205 U  A "O5'" 1 
ATOM   2205 C  "C5'" . U  A 1 103 ? 21.14100 43.81500 77.00400  1.000 115.15337 ? 205 U  A "C5'" 1 
ATOM   2206 C  "C4'" . U  A 1 103 ? 21.23900 42.31800 76.85700  1.000 116.44037 ? 205 U  A "C4'" 1 
ATOM   2207 O  "O4'" . U  A 1 103 ? 20.77400 41.91700 75.54400  1.000 115.11126 ? 205 U  A "O4'" 1 
ATOM   2208 C  "C3'" . U  A 1 103 ? 22.63300 41.72400 76.94500  1.000 118.03793 ? 205 U  A "C3'" 1 
ATOM   2209 O  "O3'" . U  A 1 103 ? 23.10300 41.60400 78.27500  1.000 117.05360 ? 205 U  A "O3'" 1 
ATOM   2210 C  "C2'" . U  A 1 103 ? 22.46800 40.39300 76.22300  1.000 122.28581 ? 205 U  A "C2'" 1 
ATOM   2211 O  "O2'" . U  A 1 103 ? 21.84400 39.44000 77.07100  1.000 128.67605 ? 205 U  A "O2'" 1 
ATOM   2212 C  "C1'" . U  A 1 103 ? 21.48200 40.77200 75.11500  1.000 115.12442 ? 205 U  A "C1'" 1 
ATOM   2213 N  N1    . U  A 1 103 ? 22.16700 41.07100 73.83600  1.000 115.42709 ? 205 U  A N1    1 
ATOM   2214 C  C2    . U  A 1 103 ? 22.36600 40.01100 72.97400  1.000 124.45185 ? 205 U  A C2    1 
ATOM   2215 O  O2    . U  A 1 103 ? 21.99700 38.87500 73.22400  1.000 126.98637 ? 205 U  A O2    1 
ATOM   2216 N  N3    . U  A 1 103 ? 23.00800 40.32600 71.80100  1.000 123.66755 ? 205 U  A N3    1 
ATOM   2217 C  C4    . U  A 1 103 ? 23.46700 41.56800 71.41200  1.000 115.76660 ? 205 U  A C4    1 
ATOM   2218 O  O4    . U  A 1 103 ? 24.03100 41.69500 70.32200  1.000 111.12394 ? 205 U  A O4    1 
ATOM   2219 C  C5    . U  A 1 103 ? 23.22600 42.61300 72.36200  1.000 115.08494 ? 205 U  A C5    1 
ATOM   2220 C  C6    . U  A 1 103 ? 22.60200 42.33400 73.51100  1.000 116.49827 ? 205 U  A C6    1 
ATOM   2221 P  P     . A  A 1 104 ? 24.48200 42.30900 78.70000  1.000 124.74571 ? 206 A  A P     1 
ATOM   2222 O  OP1   . A  A 1 104 ? 24.81900 41.87900 80.08000  1.000 129.97791 ? 206 A  A OP1   1 
ATOM   2223 O  OP2   . A  A 1 104 ? 24.38600 43.75700 78.38300  1.000 119.21083 ? 206 A  A OP2   1 
ATOM   2224 O  "O5'" . A  A 1 104 ? 25.55100 41.67100 77.71100  1.000 120.71628 ? 206 A  A "O5'" 1 
ATOM   2225 C  "C5'" . A  A 1 104 ? 25.94100 40.30700 77.82800  1.000 121.98485 ? 206 A  A "C5'" 1 
ATOM   2226 C  "C4'" . A  A 1 104 ? 27.23400 40.04400 77.09500  1.000 117.90015 ? 206 A  A "C4'" 1 
ATOM   2227 O  "O4'" . A  A 1 104 ? 27.05000 40.36300 75.68700  1.000 117.95805 ? 206 A  A "O4'" 1 
ATOM   2228 C  "C3'" . A  A 1 104 ? 28.42600 40.87300 77.57000  1.000 118.64498 ? 206 A  A "C3'" 1 
ATOM   2229 O  "O3'" . A  A 1 104 ? 29.62600 40.11100 77.44100  1.000 121.49532 ? 206 A  A "O3'" 1 
ATOM   2230 C  "C2'" . A  A 1 104 ? 28.44300 42.03100 76.57800  1.000 115.64198 ? 206 A  A "C2'" 1 
ATOM   2231 O  "O2'" . A  A 1 104 ? 29.69900 42.66300 76.42900  1.000 106.96989 ? 206 A  A "O2'" 1 
ATOM   2232 C  "C1'" . A  A 1 104 ? 27.98900 41.34800 75.29200  1.000 111.13355 ? 206 A  A "C1'" 1 
ATOM   2233 N  N9    . A  A 1 104 ? 27.33300 42.25600 74.34500  1.000 111.57834 ? 206 A  A N9    1 
ATOM   2234 C  C8    . A  A 1 104 ? 26.41300 43.23000 74.64500  1.000 112.23631 ? 206 A  A C8    1 
ATOM   2235 N  N7    . A  A 1 104 ? 25.99500 43.90600 73.60600  1.000 114.99717 ? 206 A  A N7    1 
ATOM   2236 C  C5    . A  A 1 104 ? 26.69000 43.34400 72.54500  1.000 111.56255 ? 206 A  A C5    1 
ATOM   2237 C  C6    . A  A 1 104 ? 26.68600 43.62500 71.16900  1.000 110.22028 ? 206 A  A C6    1 
ATOM   2238 N  N6    . A  A 1 104 ? 25.93600 44.57800 70.61300  1.000 115.91307 ? 206 A  A N6    1 
ATOM   2239 N  N1    . A  A 1 104 ? 27.48900 42.88600 70.37400  1.000 111.45990 ? 206 A  A N1    1 
ATOM   2240 C  C2    . A  A 1 104 ? 28.23700 41.93200 70.94000  1.000 106.24875 ? 206 A  A C2    1 
ATOM   2241 N  N3    . A  A 1 104 ? 28.33000 41.57100 72.21900  1.000 107.24098 ? 206 A  A N3    1 
ATOM   2242 C  C4    . A  A 1 104 ? 27.52000 42.32600 72.98200  1.000 112.54424 ? 206 A  A C4    1 
ATOM   2243 P  P     . A  A 1 105 ? 30.82900 40.31500 78.48700  1.000 124.55848 ? 207 A  A P     1 
ATOM   2244 O  OP1   . A  A 1 105 ? 30.31800 39.97900 79.84100  1.000 121.75551 ? 207 A  A OP1   1 
ATOM   2245 O  OP2   . A  A 1 105 ? 31.42700 41.65700 78.25100  1.000 109.99358 ? 207 A  A OP2   1 
ATOM   2246 O  "O5'" . A  A 1 105 ? 31.90300 39.22000 78.04700  1.000 113.84667 ? 207 A  A "O5'" 1 
ATOM   2247 C  "C5'" . A  A 1 105 ? 31.73200 37.84600 78.36900  1.000 116.08378 ? 207 A  A "C5'" 1 
ATOM   2248 C  "C4'" . A  A 1 105 ? 32.32400 36.93500 77.31800  1.000 109.33034 ? 207 A  A "C4'" 1 
ATOM   2249 O  "O4'" . A  A 1 105 ? 31.57900 37.05700 76.07700  1.000 109.29876 ? 207 A  A "O4'" 1 
ATOM   2250 C  "C3'" . A  A 1 105 ? 33.76100 37.21200 76.90300  1.000 105.63516 ? 207 A  A "C3'" 1 
ATOM   2251 O  "O3'" . A  A 1 105 ? 34.72300 36.72300 77.82000  1.000 106.34314 ? 207 A  A "O3'" 1 
ATOM   2252 C  "C2'" . A  A 1 105 ? 33.83700 36.55400 75.53300  1.000 106.70108 ? 207 A  A "C2'" 1 
ATOM   2253 O  "O2'" . A  A 1 105 ? 33.97700 35.14500 75.65600  1.000 111.10160 ? 207 A  A "O2'" 1 
ATOM   2254 C  "C1'" . A  A 1 105 ? 32.44700 36.86300 74.97700  1.000 104.82454 ? 207 A  A "C1'" 1 
ATOM   2255 N  N9    . A  A 1 105 ? 32.45600 38.08200 74.15000  1.000 100.54244 ? 207 A  A N9    1 
ATOM   2256 C  C8    . A  A 1 105 ? 31.84800 39.28500 74.39800  1.000 103.93495 ? 207 A  A C8    1 
ATOM   2257 N  N7    . A  A 1 105 ? 32.05100 40.18000 73.46500  1.000 100.92933 ? 207 A  A N7    1 
ATOM   2258 C  C5    . A  A 1 105 ? 32.85200 39.52100 72.54200  1.000 96.32878  ? 207 A  A C5    1 
ATOM   2259 C  C6    . A  A 1 105 ? 33.41800 39.92300 71.31700  1.000 99.48179  ? 207 A  A C6    1 
ATOM   2260 N  N6    . A  A 1 105 ? 33.25800 41.14200 70.78900  1.000 97.73158  ? 207 A  A N6    1 
ATOM   2261 N  N1    . A  A 1 105 ? 34.16800 39.01900 70.64000  1.000 101.91892 ? 207 A  A N1    1 
ATOM   2262 C  C2    . A  A 1 105 ? 34.33500 37.79700 71.16800  1.000 101.57151 ? 207 A  A C2    1 
ATOM   2263 N  N3    . A  A 1 105 ? 33.85300 37.30800 72.31100  1.000 95.49184  ? 207 A  A N3    1 
ATOM   2264 C  C4    . A  A 1 105 ? 33.11200 38.22800 72.95400  1.000 95.69186  ? 207 A  A C4    1 
ATOM   2265 P  P     . C  A 1 106 ? 35.98000 37.64000 78.22500  1.000 109.85844 ? 208 C  A P     1 
ATOM   2266 O  OP1   . C  A 1 106 ? 36.98700 36.76300 78.87600  1.000 110.11636 ? 208 C  A OP1   1 
ATOM   2267 O  OP2   . C  A 1 106 ? 35.46300 38.81900 78.96200  1.000 99.63616  ? 208 C  A OP2   1 
ATOM   2268 O  "O5'" . C  A 1 106 ? 36.56400 38.15700 76.83200  1.000 103.67612 ? 208 C  A "O5'" 1 
ATOM   2269 C  "C5'" . C  A 1 106 ? 37.24900 37.27500 75.95100  1.000 103.81298 ? 208 C  A "C5'" 1 
ATOM   2270 C  "C4'" . C  A 1 106 ? 37.56100 37.92500 74.62500  1.000 100.11780 ? 208 C  A "C4'" 1 
ATOM   2271 O  "O4'" . C  A 1 106 ? 36.34500 38.43600 74.01900  1.000 102.19699 ? 208 C  A "O4'" 1 
ATOM   2272 C  "C3'" . C  A 1 106 ? 38.48100 39.13200 74.68100  1.000 103.04710 ? 208 C  A "C3'" 1 
ATOM   2273 O  "O3'" . C  A 1 106 ? 39.84400 38.76600 74.75700  1.000 103.00235 ? 208 C  A "O3'" 1 
ATOM   2274 C  "C2'" . C  A 1 106 ? 38.12500 39.89200 73.41300  1.000 105.08155 ? 208 C  A "C2'" 1 
ATOM   2275 O  "O2'" . C  A 1 106 ? 38.76500 39.31700 72.28300  1.000 103.18132 ? 208 C  A "O2'" 1 
ATOM   2276 C  "C1'" . C  A 1 106 ? 36.62200 39.62800 73.31200  1.000 97.70961  ? 208 C  A "C1'" 1 
ATOM   2277 N  N1    . C  A 1 106 ? 35.81700 40.72400 73.90000  1.000 97.77015  ? 208 C  A N1    1 
ATOM   2278 C  C2    . C  A 1 106 ? 35.67200 41.93100 73.20400  1.000 97.93332  ? 208 C  A C2    1 
ATOM   2279 O  O2    . C  A 1 106 ? 36.23000 42.07400 72.10500  1.000 97.90174  ? 208 C  A O2    1 
ATOM   2280 N  N3    . C  A 1 106 ? 34.92600 42.92000 73.74600  1.000 99.48877  ? 208 C  A N3    1 
ATOM   2281 C  C4    . C  A 1 106 ? 34.33900 42.74400 74.93100  1.000 98.72553  ? 208 C  A C4    1 
ATOM   2282 N  N4    . C  A 1 106 ? 33.61500 43.75200 75.42600  1.000 101.75220 ? 208 C  A N4    1 
ATOM   2283 C  C5    . C  A 1 106 ? 34.46600 41.52600 75.65900  1.000 102.43650 ? 208 C  A C5    1 
ATOM   2284 C  C6    . C  A 1 106 ? 35.20500 40.55600 75.10900  1.000 102.36544 ? 208 C  A C6    1 
ATOM   2285 P  P     . C  A 1 107 ? 40.85100 39.63500 75.65000  1.000 109.19558 ? 209 C  A P     1 
ATOM   2286 O  OP1   . C  A 1 107 ? 42.13800 38.90300 75.68900  1.000 110.64049 ? 209 C  A OP1   1 
ATOM   2287 O  OP2   . C  A 1 107 ? 40.15900 40.01000 76.91000  1.000 98.10215  ? 209 C  A OP2   1 
ATOM   2288 O  "O5'" . C  A 1 107 ? 41.07400 40.96300 74.80100  1.000 98.56273  ? 209 C  A "O5'" 1 
ATOM   2289 C  "C5'" . C  A 1 107 ? 41.71500 40.91300 73.53700  1.000 101.00250 ? 209 C  A "C5'" 1 
ATOM   2290 C  "C4'" . C  A 1 107 ? 41.67900 42.24900 72.84100  1.000 103.76072 ? 209 C  A "C4'" 1 
ATOM   2291 O  "O4'" . C  A 1 107 ? 40.31000 42.61100 72.54500  1.000 99.74708  ? 209 C  A "O4'" 1 
ATOM   2292 C  "C3'" . C  A 1 107 ? 42.21200 43.43500 73.62700  1.000 107.30062 ? 209 C  A "C3'" 1 
ATOM   2293 O  "O3'" . C  A 1 107 ? 43.62900 43.51500 73.60200  1.000 111.93012 ? 209 C  A "O3'" 1 
ATOM   2294 C  "C2'" . C  A 1 107 ? 41.52800 44.62000 72.94400  1.000 107.72435 ? 209 C  A "C2'" 1 
ATOM   2295 O  "O2'" . C  A 1 107 ? 42.22300 44.98300 71.76200  1.000 109.40350 ? 209 C  A "O2'" 1 
ATOM   2296 C  "C1'" . C  A 1 107 ? 40.17600 44.01500 72.54800  1.000 101.29464 ? 209 C  A "C1'" 1 
ATOM   2297 N  N1    . C  A 1 107 ? 39.08800 44.40400 73.47100  1.000 94.72543  ? 209 C  A N1    1 
ATOM   2298 C  C2    . C  A 1 107 ? 38.37300 45.56600 73.17200  1.000 93.45159  ? 209 C  A C2    1 
ATOM   2299 O  O2    . C  A 1 107 ? 38.67800 46.21600 72.16100  1.000 94.55699  ? 209 C  A O2    1 
ATOM   2300 N  N3    . C  A 1 107 ? 37.37000 45.95400 73.98600  1.000 93.82532  ? 209 C  A N3    1 
ATOM   2301 C  C4    . C  A 1 107 ? 37.07500 45.22600 75.06300  1.000 91.95404  ? 209 C  A C4    1 
ATOM   2302 N  N4    . C  A 1 107 ? 36.07600 45.64900 75.84100  1.000 90.90655  ? 209 C  A N4    1 
ATOM   2303 C  C5    . C  A 1 107 ? 37.78700 44.03500 75.39100  1.000 98.88382  ? 209 C  A C5    1 
ATOM   2304 C  C6    . C  A 1 107 ? 38.77800 43.66200 74.57300  1.000 98.19953  ? 209 C  A C6    1 
ATOM   2305 P  P     . A  A 1 108 ? 44.51400 42.84400 74.76800  1.000 112.96718 ? 210 A  A P     1 
ATOM   2306 O  OP1   . A  A 1 108 ? 44.80500 41.44600 74.35900  1.000 111.96443 ? 210 A  A OP1   1 
ATOM   2307 O  OP2   . A  A 1 108 ? 43.86100 43.10000 76.07900  1.000 105.18204 ? 210 A  A OP2   1 
ATOM   2308 O  "O5'" . A  A 1 108 ? 45.88400 43.65600 74.71800  1.000 110.60900 ? 210 A  A "O5'" 1 
ATOM   2309 C  "C5'" . A  A 1 108 ? 45.89100 45.07800 74.78400  1.000 110.47478 ? 210 A  A "C5'" 1 
ATOM   2310 C  "C4'" . A  A 1 108 ? 46.81500 45.68300 73.75700  1.000 111.73809 ? 210 A  A "C4'" 1 
ATOM   2311 O  "O4'" . A  A 1 108 ? 48.17700 45.27200 74.04500  1.000 115.40958 ? 210 A  A "O4'" 1 
ATOM   2312 C  "C3'" . A  A 1 108 ? 46.54000 45.27900 72.31200  1.000 110.78797 ? 210 A  A "C3'" 1 
ATOM   2313 O  "O3'" . A  A 1 108 ? 46.79500 46.38200 71.44300  1.000 111.59070 ? 210 A  A "O3'" 1 
ATOM   2314 C  "C2'" . A  A 1 108 ? 47.55300 44.16700 72.06000  1.000 109.70100 ? 210 A  A "C2'" 1 
ATOM   2315 O  "O2'" . A  A 1 108 ? 47.92400 44.01100 70.70800  1.000 104.46616 ? 210 A  A "O2'" 1 
ATOM   2316 C  "C1'" . A  A 1 108 ? 48.73200 44.60000 72.93300  1.000 111.80652 ? 210 A  A "C1'" 1 
ATOM   2317 N  N9    . A  A 1 108 ? 49.50500 43.46800 73.45000  1.000 113.29617 ? 210 A  A N9    1 
ATOM   2318 C  C8    . A  A 1 108 ? 49.00500 42.40800 74.16100  1.000 113.11720 ? 210 A  A C8    1 
ATOM   2319 N  N7    . A  A 1 108 ? 49.90500 41.52700 74.51300  1.000 110.42477 ? 210 A  A N7    1 
ATOM   2320 C  C5    . A  A 1 108 ? 51.08500 42.04400 74.00300  1.000 113.23037 ? 210 A  A C5    1 
ATOM   2321 C  C6    . A  A 1 108 ? 52.40800 41.57300 74.04200  1.000 118.69945 ? 210 A  A C6    1 
ATOM   2322 N  N6    . A  A 1 108 ? 52.76900 40.43700 74.63900  1.000 118.11780 ? 210 A  A N6    1 
ATOM   2323 N  N1    . A  A 1 108 ? 53.35900 42.31700 73.43700  1.000 125.21602 ? 210 A  A N1    1 
ATOM   2324 C  C2    . A  A 1 108 ? 52.99000 43.46000 72.84200  1.000 119.65483 ? 210 A  A C2    1 
ATOM   2325 N  N3    . A  A 1 108 ? 51.77800 44.00800 72.74000  1.000 110.10105 ? 210 A  A N3    1 
ATOM   2326 C  C4    . A  A 1 108 ? 50.85700 43.24200 73.35000  1.000 113.24353 ? 210 A  A C4    1 
ATOM   2327 P  P     . C  A 1 109 ? 45.64200 46.89800 70.45000  1.000 112.83362 ? 211 C  A P     1 
ATOM   2328 O  OP1   . C  A 1 109 ? 45.29100 45.78200 69.53600  1.000 107.58825 ? 211 C  A OP1   1 
ATOM   2329 O  OP2   . C  A 1 109 ? 46.07200 48.20000 69.88200  1.000 120.53981 ? 211 C  A OP2   1 
ATOM   2330 O  "O5'" . C  A 1 109 ? 44.38900 47.14800 71.40300  1.000 103.65883 ? 211 C  A "O5'" 1 
ATOM   2331 C  "C5'" . C  A 1 109 ? 44.44800 48.08300 72.47100  1.000 105.00373 ? 211 C  A "C5'" 1 
ATOM   2332 C  "C4'" . C  A 1 109 ? 43.62500 49.31200 72.18000  1.000 107.59352 ? 211 C  A "C4'" 1 
ATOM   2333 O  "O4'" . C  A 1 109 ? 42.23300 48.94400 71.97800  1.000 105.63012 ? 211 C  A "O4'" 1 
ATOM   2334 C  "C3'" . C  A 1 109 ? 43.56700 50.35100 73.28800  1.000 105.65118 ? 211 C  A "C3'" 1 
ATOM   2335 O  "O3'" . C  A 1 109 ? 44.71700 51.17900 73.35400  1.000 101.90862 ? 211 C  A "O3'" 1 
ATOM   2336 C  "C2'" . C  A 1 109 ? 42.28500 51.10400 72.96200  1.000 101.26644 ? 211 C  A "C2'" 1 
ATOM   2337 O  "O2'" . C  A 1 109 ? 42.49100 52.00500 71.88500  1.000 105.77488 ? 211 C  A "O2'" 1 
ATOM   2338 C  "C1'" . C  A 1 109 ? 41.39000 49.96700 72.46700  1.000 97.40282  ? 211 C  A "C1'" 1 
ATOM   2339 N  N1    . C  A 1 109 ? 40.54400 49.41200 73.54900  1.000 91.47053  ? 211 C  A N1    1 
ATOM   2340 C  C2    . C  A 1 109 ? 39.43800 50.14400 74.00200  1.000 95.62629  ? 211 C  A C2    1 
ATOM   2341 O  O2    . C  A 1 109 ? 39.18200 51.24400 73.48500  1.000 97.46072  ? 211 C  A O2    1 
ATOM   2342 N  N3    . C  A 1 109 ? 38.66900 49.63800 74.99600  1.000 93.97346  ? 211 C  A N3    1 
ATOM   2343 C  C4    . C  A 1 109 ? 38.96300 48.45300 75.53100  1.000 92.46539  ? 211 C  A C4    1 
ATOM   2344 N  N4    . C  A 1 109 ? 38.17700 47.99200 76.50700  1.000 94.08663  ? 211 C  A N4    1 
ATOM   2345 C  C5    . C  A 1 109 ? 40.08100 47.68800 75.08800  1.000 95.31310  ? 211 C  A C5    1 
ATOM   2346 C  C6    . C  A 1 109 ? 40.83500 48.19700 74.10500  1.000 93.39971  ? 211 C  A C6    1 
ATOM   2347 P  P     . G  A 1 110 ? 45.20900 51.74700 74.77500  1.000 113.06566 ? 212 G  A P     1 
ATOM   2348 O  OP1   . G  A 1 110 ? 46.53500 52.39100 74.58500  1.000 117.46092 ? 212 G  A OP1   1 
ATOM   2349 O  OP2   . G  A 1 110 ? 45.06100 50.66400 75.78200  1.000 105.76742 ? 212 G  A OP2   1 
ATOM   2350 O  "O5'" . G  A 1 110 ? 44.14200 52.88100 75.11900  1.000 103.29870 ? 212 G  A "O5'" 1 
ATOM   2351 C  "C5'" . G  A 1 110 ? 44.04100 54.04700 74.31200  1.000 101.51954 ? 212 G  A "C5'" 1 
ATOM   2352 C  "C4'" . G  A 1 110 ? 42.72600 54.77100 74.48500  1.000 95.26616  ? 212 G  A "C4'" 1 
ATOM   2353 O  "O4'" . G  A 1 110 ? 41.62100 53.83900 74.39400  1.000 94.85032  ? 212 G  A "O4'" 1 
ATOM   2354 C  "C3'" . G  A 1 110 ? 42.49800 55.48200 75.80700  1.000 93.65807  ? 212 G  A "C3'" 1 
ATOM   2355 O  "O3'" . G  A 1 110 ? 43.14100 56.74100 75.85600  1.000 94.59239  ? 212 G  A "O3'" 1 
ATOM   2356 C  "C2'" . G  A 1 110 ? 40.98300 55.58900 75.86900  1.000 93.33435  ? 212 G  A "C2'" 1 
ATOM   2357 O  "O2'" . G  A 1 110 ? 40.52900 56.66100 75.05800  1.000 100.68786 ? 212 G  A "O2'" 1 
ATOM   2358 C  "C1'" . G  A 1 110 ? 40.55800 54.27500 75.21200  1.000 93.92652  ? 212 G  A "C1'" 1 
ATOM   2359 N  N9    . G  A 1 110 ? 40.28700 53.22800 76.20800  1.000 94.17655  ? 212 G  A N9    1 
ATOM   2360 C  C8    . G  A 1 110 ? 40.97800 52.05300 76.39300  1.000 96.88214  ? 212 G  A C8    1 
ATOM   2361 N  N7    . G  A 1 110 ? 40.49000 51.33300 77.37000  1.000 98.76131  ? 212 G  A N7    1 
ATOM   2362 C  C5    . G  A 1 110 ? 39.42100 52.08000 77.85000  1.000 102.29332 ? 212 G  A C5    1 
ATOM   2363 C  C6    . G  A 1 110 ? 38.51100 51.81200 78.90100  1.000 105.48054 ? 212 G  A C6    1 
ATOM   2364 O  O6    . G  A 1 110 ? 38.46700 50.82500 79.64400  1.000 111.43652 ? 212 G  A O6    1 
ATOM   2365 N  N1    . G  A 1 110 ? 37.58100 52.83600 79.04800  1.000 107.97031 ? 212 G  A N1    1 
ATOM   2366 C  C2    . G  A 1 110 ? 37.53100 53.97600 78.28300  1.000 101.07738 ? 212 G  A C2    1 
ATOM   2367 N  N2    . G  A 1 110 ? 36.56000 54.85500 78.57000  1.000 102.38806 ? 212 G  A N2    1 
ATOM   2368 N  N3    . G  A 1 110 ? 38.37300 54.23700 77.30000  1.000 101.75904 ? 212 G  A N3    1 
ATOM   2369 C  C4    . G  A 1 110 ? 39.28100 53.25200 77.14100  1.000 101.96959 ? 212 G  A C4    1 
ATOM   2370 P  P     . C  A 1 111 ? 43.62000 57.34700 77.25900  1.000 97.78584  ? 213 C  A P     1 
ATOM   2371 O  OP1   . C  A 1 111 ? 44.47700 58.52200 76.95900  1.000 97.68056  ? 213 C  A OP1   1 
ATOM   2372 O  OP2   . C  A 1 111 ? 44.13600 56.22200 78.08500  1.000 96.10406  ? 213 C  A OP2   1 
ATOM   2373 O  "O5'" . C  A 1 111 ? 42.27600 57.85900 77.94500  1.000 108.21340 ? 213 C  A "O5'" 1 
ATOM   2374 C  "C5'" . C  A 1 111 ? 41.50200 58.90300 77.37400  1.000 109.94256 ? 213 C  A "C5'" 1 
ATOM   2375 C  "C4'" . C  A 1 111 ? 40.29900 59.21000 78.23300  1.000 106.35792 ? 213 C  A "C4'" 1 
ATOM   2376 O  "O4'" . C  A 1 111 ? 39.38700 58.08000 78.22700  1.000 107.68176 ? 213 C  A "O4'" 1 
ATOM   2377 C  "C3'" . C  A 1 111 ? 40.58300 59.44100 79.70800  1.000 104.51296 ? 213 C  A "C3'" 1 
ATOM   2378 O  "O3'" . C  A 1 111 ? 41.06500 60.74300 79.98800  1.000 109.01613 ? 213 C  A "O3'" 1 
ATOM   2379 C  "C2'" . C  A 1 111 ? 39.23900 59.12700 80.35600  1.000 108.36605 ? 213 C  A "C2'" 1 
ATOM   2380 O  "O2'" . C  A 1 111 ? 38.33700 60.21500 80.20400  1.000 115.53007 ? 213 C  A "O2'" 1 
ATOM   2381 C  "C1'" . C  A 1 111 ? 38.75400 57.96400 79.48800  1.000 107.95548 ? 213 C  A "C1'" 1 
ATOM   2382 N  N1    . C  A 1 111 ? 39.09100 56.64800 80.08500  1.000 102.15478 ? 213 C  A N1    1 
ATOM   2383 C  C2    . C  A 1 111 ? 38.26800 56.12800 81.09100  1.000 109.43987 ? 213 C  A C2    1 
ATOM   2384 O  O2    . C  A 1 111 ? 37.28200 56.78500 81.45100  1.000 114.11411 ? 213 C  A O2    1 
ATOM   2385 N  N3    . C  A 1 111 ? 38.56300 54.93000 81.64500  1.000 110.34524 ? 213 C  A N3    1 
ATOM   2386 C  C4    . C  A 1 111 ? 39.63300 54.25000 81.23300  1.000 107.52648 ? 213 C  A C4    1 
ATOM   2387 N  N4    . C  A 1 111 ? 39.88800 53.06900 81.80500  1.000 114.60101 ? 213 C  A N4    1 
ATOM   2388 C  C5    . C  A 1 111 ? 40.49200 54.75300 80.21200  1.000 100.52301 ? 213 C  A C5    1 
ATOM   2389 C  C6    . C  A 1 111 ? 40.18700 55.94100 79.67200  1.000 98.03850  ? 213 C  A C6    1 
ATOM   2390 P  P     . A  A 1 112 ? 42.18200 60.96400 81.12000  1.000 123.78799 ? 214 A  A P     1 
ATOM   2391 O  OP1   . A  A 1 112 ? 42.55800 62.39700 81.10300  1.000 118.97162 ? 214 A  A OP1   1 
ATOM   2392 O  OP2   . A  A 1 112 ? 43.22400 59.92200 80.96900  1.000 122.93789 ? 214 A  A OP2   1 
ATOM   2393 O  "O5'" . A  A 1 112 ? 41.40500 60.68600 82.48000  1.000 118.01625 ? 214 A  A "O5'" 1 
ATOM   2394 C  "C5'" . A  A 1 112 ? 40.27500 61.46800 82.83100  1.000 127.91480 ? 214 A  A "C5'" 1 
ATOM   2395 C  "C4'" . A  A 1 112 ? 39.47900 60.84800 83.95300  1.000 128.05429 ? 214 A  A "C4'" 1 
ATOM   2396 O  "O4'" . A  A 1 112 ? 38.97900 59.54400 83.56700  1.000 123.85642 ? 214 A  A "O4'" 1 
ATOM   2397 C  "C3'" . A  A 1 112 ? 40.23200 60.57100 85.24000  1.000 132.14162 ? 214 A  A "C3'" 1 
ATOM   2398 O  "O3'" . A  A 1 112 ? 40.45600 61.74000 86.00800  1.000 138.47923 ? 214 A  A "O3'" 1 
ATOM   2399 C  "C2'" . A  A 1 112 ? 39.33800 59.53800 85.91900  1.000 136.57110 ? 214 A  A "C2'" 1 
ATOM   2400 O  "O2'" . A  A 1 112 ? 38.21800 60.16200 86.52900  1.000 148.49622 ? 214 A  A "O2'" 1 
ATOM   2401 C  "C1'" . A  A 1 112 ? 38.84100 58.73100 84.71700  1.000 123.35899 ? 214 A  A "C1'" 1 
ATOM   2402 N  N9    . A  A 1 112 ? 39.60200 57.48000 84.53900  1.000 119.73224 ? 214 A  A N9    1 
ATOM   2403 C  C8    . A  A 1 112 ? 40.57700 57.17300 83.62200  1.000 119.08480 ? 214 A  A C8    1 
ATOM   2404 N  N7    . A  A 1 112 ? 41.05000 55.95300 83.74700  1.000 119.53748 ? 214 A  A N7    1 
ATOM   2405 C  C5    . A  A 1 112 ? 40.34300 55.42300 84.82000  1.000 123.53796 ? 214 A  A C5    1 
ATOM   2406 C  C6    . A  A 1 112 ? 40.37000 54.16900 85.46000  1.000 133.15490 ? 214 A  A C6    1 
ATOM   2407 N  N6    . A  A 1 112 ? 41.17400 53.16400 85.10200  1.000 133.95763 ? 214 A  A N6    1 
ATOM   2408 N  N1    . A  A 1 112 ? 39.52700 53.97800 86.50000  1.000 140.75318 ? 214 A  A N1    1 
ATOM   2409 C  C2    . A  A 1 112 ? 38.71600 54.97700 86.86700  1.000 139.38197 ? 214 A  A C2    1 
ATOM   2410 N  N3    . A  A 1 112 ? 38.60100 56.19400 86.34500  1.000 132.93119 ? 214 A  A N3    1 
ATOM   2411 C  C4    . A  A 1 112 ? 39.45100 56.35600 85.31500  1.000 124.89339 ? 214 A  A C4    1 
ATOM   2412 P  P     . G  A 1 113 ? 41.77700 61.88200 86.91500  1.000 145.01928 ? 215 G  A P     1 
ATOM   2413 O  OP1   . G  A 1 113 ? 41.95200 63.31500 87.27200  1.000 139.58442 ? 215 G  A OP1   1 
ATOM   2414 O  OP2   . G  A 1 113 ? 42.88700 61.16500 86.24000  1.000 146.26943 ? 215 G  A OP2   1 
ATOM   2415 O  "O5'" . G  A 1 113 ? 41.40600 61.08400 88.24200  1.000 140.75298 ? 215 G  A "O5'" 1 
ATOM   2416 C  "C5'" . G  A 1 113 ? 40.18300 61.33500 88.91800  1.000 146.45893 ? 215 G  A "C5'" 1 
ATOM   2417 C  "C4'" . G  A 1 113 ? 39.81300 60.20000 89.83600  1.000 154.12301 ? 215 G  A "C4'" 1 
ATOM   2418 O  "O4'" . G  A 1 113 ? 39.46000 59.02400 89.06600  1.000 146.80107 ? 215 G  A "O4'" 1 
ATOM   2419 C  "C3'" . G  A 1 113 ? 40.91100 59.71300 90.76200  1.000 156.91545 ? 215 G  A "C3'" 1 
ATOM   2420 O  "O3'" . G  A 1 113 ? 41.07200 60.54700 91.89300  1.000 158.11559 ? 215 G  A "O3'" 1 
ATOM   2421 C  "C2'" . G  A 1 113 ? 40.46100 58.29800 91.09600  1.000 155.87848 ? 215 G  A "C2'" 1 
ATOM   2422 O  "O2'" . G  A 1 113 ? 39.44200 58.30500 92.08700  1.000 154.63359 ? 215 G  A "O2'" 1 
ATOM   2423 C  "C1'" . G  A 1 113 ? 39.84500 57.85900 89.76700  1.000 150.63574 ? 215 G  A "C1'" 1 
ATOM   2424 N  N9    . G  A 1 113 ? 40.80500 57.10200 88.94400  1.000 143.23749 ? 215 G  A N9    1 
ATOM   2425 C  C8    . G  A 1 113 ? 41.50500 57.51900 87.83600  1.000 137.78157 ? 215 G  A C8    1 
ATOM   2426 N  N7    . G  A 1 113 ? 42.28100 56.58600 87.34800  1.000 135.22337 ? 215 G  A N7    1 
ATOM   2427 C  C5    . G  A 1 113 ? 42.08100 55.49500 88.18500  1.000 143.61122 ? 215 G  A C5    1 
ATOM   2428 C  C6    . G  A 1 113 ? 42.64100 54.19000 88.16400  1.000 147.34851 ? 215 G  A C6    1 
ATOM   2429 O  O6    . G  A 1 113 ? 43.46300 53.71400 87.37100  1.000 147.55906 ? 215 G  A O6    1 
ATOM   2430 N  N1    . G  A 1 113 ? 42.15000 53.40700 89.20700  1.000 155.00732 ? 215 G  A N1    1 
ATOM   2431 C  C2    . G  A 1 113 ? 41.23900 53.82400 90.14900  1.000 154.53621 ? 215 G  A C2    1 
ATOM   2432 N  N2    . G  A 1 113 ? 40.87800 52.93300 91.08300  1.000 157.57342 ? 215 G  A N2    1 
ATOM   2433 N  N3    . G  A 1 113 ? 40.71100 55.03300 90.17600  1.000 148.85658 ? 215 G  A N3    1 
ATOM   2434 C  C4    . G  A 1 113 ? 41.17500 55.80400 89.17300  1.000 146.49051 ? 215 G  A C4    1 
ATOM   2435 P  P     . C  A 1 114 ? 42.36200 60.38800 92.83200  1.000 163.31244 ? 216 C  A P     1 
ATOM   2436 O  OP1   . C  A 1 114 ? 42.65400 61.71200 93.43800  1.000 167.54979 ? 216 C  A OP1   1 
ATOM   2437 O  OP2   . C  A 1 114 ? 43.42200 59.68900 92.06300  1.000 155.21410 ? 216 C  A OP2   1 
ATOM   2438 O  "O5'" . C  A 1 114 ? 41.86700 59.40100 93.97900  1.000 157.62228 ? 216 C  A "O5'" 1 
ATOM   2439 C  "C5'" . C  A 1 114 ? 42.77600 58.91400 94.95100  1.000 161.84911 ? 216 C  A "C5'" 1 
ATOM   2440 C  "C4'" . C  A 1 114 ? 42.60200 57.43600 95.19500  1.000 161.61750 ? 216 C  A "C4'" 1 
ATOM   2441 O  "O4'" . C  A 1 114 ? 42.13800 56.77300 93.99000  1.000 150.06875 ? 216 C  A "O4'" 1 
ATOM   2442 C  "C3'" . C  A 1 114 ? 43.86800 56.68800 95.56700  1.000 165.79695 ? 216 C  A "C3'" 1 
ATOM   2443 O  "O3'" . C  A 1 114 ? 44.20100 56.84100 96.93300  1.000 159.23300 ? 216 C  A "O3'" 1 
ATOM   2444 C  "C2'" . C  A 1 114 ? 43.54300 55.25500 95.16400  1.000 162.21231 ? 216 C  A "C2'" 1 
ATOM   2445 O  "O2'" . C  A 1 114 ? 42.72700 54.62800 96.14400  1.000 165.43638 ? 216 C  A "O2'" 1 
ATOM   2446 C  "C1'" . C  A 1 114 ? 42.70900 55.48300 93.90000  1.000 155.68521 ? 216 C  A "C1'" 1 
ATOM   2447 N  N1    . C  A 1 114 ? 43.52300 55.43100 92.66300  1.000 156.56426 ? 216 C  A N1    1 
ATOM   2448 C  C2    . C  A 1 114 ? 44.09900 54.22900 92.22400  1.000 160.84899 ? 216 C  A C2    1 
ATOM   2449 O  O2    . C  A 1 114 ? 43.94100 53.18800 92.88400  1.000 159.23300 ? 216 C  A O2    1 
ATOM   2450 N  N3    . C  A 1 114 ? 44.82700 54.23600 91.08100  1.000 163.25454 ? 216 C  A N3    1 
ATOM   2451 C  C4    . C  A 1 114 ? 44.98400 55.37000 90.38800  1.000 160.56737 ? 216 C  A C4    1 
ATOM   2452 N  N4    . C  A 1 114 ? 45.70700 55.33500 89.26400  1.000 161.70172 ? 216 C  A N4    1 
ATOM   2453 C  C5    . C  A 1 114 ? 44.40400 56.60100 90.81300  1.000 159.93046 ? 216 C  A C5    1 
ATOM   2454 C  C6    . C  A 1 114 ? 43.68900 56.58300 91.94300  1.000 158.12498 ? 216 C  A C6    1 
ATOM   2455 P  P     . C  A 1 115 ? 45.45100 57.75300 97.36400  1.000 164.80894 ? 217 C  A P     1 
ATOM   2456 O  OP1   . C  A 1 115 ? 44.95900 58.81500 98.28400  1.000 165.65115 ? 217 C  A OP1   1 
ATOM   2457 O  OP2   . C  A 1 115 ? 46.19800 58.14200 96.13800  1.000 164.31152 ? 217 C  A OP2   1 
ATOM   2458 O  "O5'" . C  A 1 115 ? 46.35900 56.74900 98.20000  1.000 178.43426 ? 217 C  A "O5'" 1 
ATOM   2459 C  "C5'" . C  A 1 115 ? 45.83800 55.50600 98.64800  1.000 174.98911 ? 217 C  A "C5'" 1 
ATOM   2460 C  "C4'" . C  A 1 115 ? 46.73000 54.36400 98.23600  1.000 170.33066 ? 217 C  A "C4'" 1 
ATOM   2461 O  "O4'" . C  A 1 115 ? 46.42500 53.95700 96.87800  1.000 165.81170 ? 217 C  A "O4'" 1 
ATOM   2462 C  "C3'" . C  A 1 115 ? 48.21500 54.67800 98.20500  1.000 173.01782 ? 217 C  A "C3'" 1 
ATOM   2463 O  "O3'" . C  A 1 115 ? 48.81200 54.62800 99.48900  1.000 176.62878 ? 217 C  A "O3'" 1 
ATOM   2464 C  "C2'" . C  A 1 115 ? 48.75900 53.63900 97.23100  1.000 173.74423 ? 217 C  A "C2'" 1 
ATOM   2465 O  "O2'" . C  A 1 115 ? 48.94600 52.39000 97.88000  1.000 179.28436 ? 217 C  A "O2'" 1 
ATOM   2466 C  "C1'" . C  A 1 115 ? 47.60000 53.50900 96.23600  1.000 172.08087 ? 217 C  A "C1'" 1 
ATOM   2467 N  N1    . C  A 1 115 ? 47.81400 54.31100 95.00800  1.000 168.88838 ? 217 C  A N1    1 
ATOM   2468 C  C2    . C  A 1 115 ? 48.74600 53.85900 94.06700  1.000 168.85943 ? 217 C  A C2    1 
ATOM   2469 O  O2    . C  A 1 115 ? 49.37000 52.80800 94.28700  1.000 170.88599 ? 217 C  A O2    1 
ATOM   2470 N  N3    . C  A 1 115 ? 48.95600 54.57600 92.93800  1.000 165.43270 ? 217 C  A N3    1 
ATOM   2471 C  C4    . C  A 1 115 ? 48.27500 55.70300 92.72600  1.000 164.16939 ? 217 C  A C4    1 
ATOM   2472 N  N4    . C  A 1 115 ? 48.51200 56.38300 91.60000  1.000 160.41894 ? 217 C  A N4    1 
ATOM   2473 C  C5    . C  A 1 115 ? 47.31700 56.18600 93.66400  1.000 167.14607 ? 217 C  A C5    1 
ATOM   2474 C  C6    . C  A 1 115 ? 47.11500 55.46700 94.77900  1.000 168.01985 ? 217 C  A C6    1 
ATOM   2475 P  P     . A  A 1 116 ? 49.97000 55.66900 99.88700  1.000 187.96973 ? 218 A  A P     1 
ATOM   2476 O  OP1   . A  A 1 116 ? 50.35200 55.37600 101.29300 1.000 182.85859 ? 218 A  A OP1   1 
ATOM   2477 O  OP2   . A  A 1 116 ? 49.53500 57.03800 99.50200  1.000 183.03230 ? 218 A  A OP2   1 
ATOM   2478 O  "O5'" . A  A 1 116 ? 51.18900 55.26800 98.94300  1.000 172.59420 ? 218 A  A "O5'" 1 
ATOM   2479 C  "C5'" . A  A 1 116 ? 51.77700 53.97300 99.01600  1.000 169.75702 ? 218 A  A "C5'" 1 
ATOM   2480 C  "C4'" . A  A 1 116 ? 52.98800 53.86100 98.12200  1.000 168.68584 ? 218 A  A "C4'" 1 
ATOM   2481 O  "O4'" . A  A 1 116 ? 52.60800 54.20700 96.76300  1.000 166.76982 ? 218 A  A "O4'" 1 
ATOM   2482 C  "C3'" . A  A 1 116 ? 54.14900 54.77600 98.49500  1.000 166.86194 ? 218 A  A "C3'" 1 
ATOM   2483 O  "O3'" . A  A 1 116 ? 55.38700 54.11000 98.25200  1.000 163.36678 ? 218 A  A "O3'" 1 
ATOM   2484 C  "C2'" . A  A 1 116 ? 53.98300 55.95600 97.53900  1.000 162.47983 ? 218 A  A "C2'" 1 
ATOM   2485 O  "O2'" . A  A 1 116 ? 55.18400 56.64200 97.24700  1.000 148.04389 ? 218 A  A "O2'" 1 
ATOM   2486 C  "C1'" . A  A 1 116 ? 53.39700 55.28800 96.29600  1.000 161.44286 ? 218 A  A "C1'" 1 
ATOM   2487 N  N9    . A  A 1 116 ? 52.52100 56.16700 95.51400  1.000 158.42145 ? 218 A  A N9    1 
ATOM   2488 C  C8    . A  A 1 116 ? 51.36400 56.75600 95.95900  1.000 160.76910 ? 218 A  A C8    1 
ATOM   2489 N  N7    . A  A 1 116 ? 50.75600 57.49300 95.06500  1.000 154.91313 ? 218 A  A N7    1 
ATOM   2490 C  C5    . A  A 1 116 ? 51.56000 57.38500 93.94400  1.000 151.28112 ? 218 A  A C5    1 
ATOM   2491 C  C6    . A  A 1 116 ? 51.45500 57.93900 92.65600  1.000 153.61298 ? 218 A  A C6    1 
ATOM   2492 N  N6    . A  A 1 116 ? 50.46000 58.73800 92.27100  1.000 157.53450 ? 218 A  A N6    1 
ATOM   2493 N  N1    . A  A 1 116 ? 52.41900 57.64100 91.76300  1.000 147.85176 ? 218 A  A N1    1 
ATOM   2494 C  C2    . A  A 1 116 ? 53.41300 56.84000 92.15600  1.000 145.79099 ? 218 A  A C2    1 
ATOM   2495 N  N3    . A  A 1 116 ? 53.62300 56.25500 93.33300  1.000 149.54670 ? 218 A  A N3    1 
ATOM   2496 C  C4    . A  A 1 116 ? 52.64900 56.56900 94.20100  1.000 152.38652 ? 218 A  A C4    1 
ATOM   2497 P  P     . A  A 1 117 ? 56.09500 53.29700 99.44600  1.000 168.35314 ? 219 A  A P     1 
ATOM   2498 O  OP1   . A  A 1 117 ? 55.22000 52.15800 99.82500  1.000 161.14965 ? 219 A  A OP1   1 
ATOM   2499 O  OP2   . A  A 1 117 ? 56.52800 54.26900 100.48300 1.000 166.57135 ? 219 A  A OP2   1 
ATOM   2500 O  "O5'" . A  A 1 117 ? 57.39800 52.67400 98.78000  1.000 151.10108 ? 219 A  A "O5'" 1 
ATOM   2501 C  "C5'" . A  A 1 117 ? 57.83700 51.37100 99.13000  1.000 148.04545 ? 219 A  A "C5'" 1 
ATOM   2502 C  "C4'" . A  A 1 117 ? 58.34500 50.62500 97.92400  1.000 145.61358 ? 219 A  A "C4'" 1 
ATOM   2503 O  "O4'" . A  A 1 117 ? 57.25700 50.40600 96.98700  1.000 151.61693 ? 219 A  A "O4'" 1 
ATOM   2504 C  "C3'" . A  A 1 117 ? 59.40800 51.34200 97.10300  1.000 139.12596 ? 219 A  A "C3'" 1 
ATOM   2505 O  "O3'" . A  A 1 117 ? 60.71100 51.20000 97.64700  1.000 133.94376 ? 219 A  A "O3'" 1 
ATOM   2506 C  "C2'" . A  A 1 117 ? 59.24900 50.70900 95.72700  1.000 145.57936 ? 219 A  A "C2'" 1 
ATOM   2507 O  "O2'" . A  A 1 117 ? 59.89200 49.44300 95.67700  1.000 149.47456 ? 219 A  A "O2'" 1 
ATOM   2508 C  "C1'" . A  A 1 117 ? 57.73500 50.49200 95.66200  1.000 141.21305 ? 219 A  A "C1'" 1 
ATOM   2509 N  N9    . A  A 1 117 ? 57.04800 51.60900 94.98500  1.000 134.88861 ? 219 A  A N9    1 
ATOM   2510 C  C8    . A  A 1 117 ? 56.07700 52.43600 95.49000  1.000 143.73440 ? 219 A  A C8    1 
ATOM   2511 N  N7    . A  A 1 117 ? 55.66500 53.34500 94.64200  1.000 144.97929 ? 219 A  A N7    1 
ATOM   2512 C  C5    . A  A 1 117 ? 56.42000 53.09900 93.50200  1.000 143.51069 ? 219 A  A C5    1 
ATOM   2513 C  C6    . A  A 1 117 ? 56.46500 53.71700 92.23800  1.000 141.30253 ? 219 A  A C6    1 
ATOM   2514 N  N6    . A  A 1 117 ? 55.70700 54.75600 91.88400  1.000 133.12787 ? 219 A  A N6    1 
ATOM   2515 N  N1    . A  A 1 117 ? 57.33100 53.22600 91.32300  1.000 144.51081 ? 219 A  A N1    1 
ATOM   2516 C  C2    . A  A 1 117 ? 58.10100 52.18300 91.66000  1.000 145.45566 ? 219 A  A C2    1 
ATOM   2517 N  N3    . A  A 1 117 ? 58.14900 51.52000 92.81400  1.000 140.13134 ? 219 A  A N3    1 
ATOM   2518 C  C4    . A  A 1 117 ? 57.27600 52.03200 93.70000  1.000 139.23650 ? 219 A  A C4    1 
ATOM   2519 P  P     . G  A 1 118 ? 61.64400 52.48800 97.89200  1.000 146.62705 ? 220 G  A P     1 
ATOM   2520 O  OP1   . G  A 1 118 ? 62.88000 52.02300 98.57000  1.000 139.66569 ? 220 G  A OP1   1 
ATOM   2521 O  OP2   . G  A 1 118 ? 60.83800 53.55200 98.54100  1.000 136.72060 ? 220 G  A OP2   1 
ATOM   2522 O  "O5'" . G  A 1 118 ? 62.04300 52.96200 96.42300  1.000 139.33671 ? 220 G  A "O5'" 1 
ATOM   2523 C  "C5'" . G  A 1 118 ? 62.80100 52.11400 95.56800  1.000 129.95663 ? 220 G  A "C5'" 1 
ATOM   2524 C  "C4'" . G  A 1 118 ? 62.74400 52.56600 94.13000  1.000 126.55360 ? 220 G  A "C4'" 1 
ATOM   2525 O  "O4'" . G  A 1 118 ? 61.36500 52.56000 93.67400  1.000 131.10677 ? 220 G  A "O4'" 1 
ATOM   2526 C  "C3'" . G  A 1 118 ? 63.22900 53.98100 93.85900  1.000 120.22915 ? 220 G  A "C3'" 1 
ATOM   2527 O  "O3'" . G  A 1 118 ? 64.63600 54.05000 93.69800  1.000 118.90531 ? 220 G  A "O3'" 1 
ATOM   2528 C  "C2'" . G  A 1 118 ? 62.45900 54.37500 92.60700  1.000 118.51053 ? 220 G  A "C2'" 1 
ATOM   2529 O  "O2'" . G  A 1 118 ? 63.06700 53.82900 91.44600  1.000 118.90794 ? 220 G  A "O2'" 1 
ATOM   2530 C  "C1'" . G  A 1 118 ? 61.12600 53.66800 92.83900  1.000 125.11921 ? 220 G  A "C1'" 1 
ATOM   2531 N  N9    . G  A 1 118 ? 60.16100 54.54300 93.52200  1.000 123.10318 ? 220 G  A N9    1 
ATOM   2532 C  C8    . G  A 1 118 ? 59.79100 54.47700 94.83900  1.000 128.31170 ? 220 G  A C8    1 
ATOM   2533 N  N7    . G  A 1 118 ? 58.91700 55.38400 95.16700  1.000 131.40418 ? 220 G  A N7    1 
ATOM   2534 C  C5    . G  A 1 118 ? 58.70000 56.09000 93.99200  1.000 125.25081 ? 220 G  A C5    1 
ATOM   2535 C  C6    . G  A 1 118 ? 57.85100 57.19400 93.72300  1.000 127.20894 ? 220 G  A C6    1 
ATOM   2536 O  O6    . G  A 1 118 ? 57.09400 57.79000 94.49900  1.000 133.31493 ? 220 G  A O6    1 
ATOM   2537 N  N1    . G  A 1 118 ? 57.94100 57.59500 92.39200  1.000 123.72431 ? 220 G  A N1    1 
ATOM   2538 C  C2    . G  A 1 118 ? 58.74300 57.01100 91.44300  1.000 119.51328 ? 220 G  A C2    1 
ATOM   2539 N  N2    . G  A 1 118 ? 58.69100 57.54200 90.21400  1.000 118.73424 ? 220 G  A N2    1 
ATOM   2540 N  N3    . G  A 1 118 ? 59.53800 55.98300 91.68100  1.000 118.81319 ? 220 G  A N3    1 
ATOM   2541 C  C4    . G  A 1 118 ? 59.46600 55.58300 92.96700  1.000 119.85542 ? 220 G  A C4    1 
ATOM   2542 P  P     . U  A 1 119 ? 65.44500 55.35700 94.16200  1.000 122.61083 ? 221 U  A P     1 
ATOM   2543 O  OP1   . U  A 1 119 ? 66.87800 55.10500 93.87300  1.000 112.68595 ? 221 U  A OP1   1 
ATOM   2544 O  OP2   . U  A 1 119 ? 65.00600 55.70600 95.53700  1.000 119.52888 ? 221 U  A OP2   1 
ATOM   2545 O  "O5'" . U  A 1 119 ? 64.94300 56.50300 93.17500  1.000 112.95967 ? 221 U  A "O5'" 1 
ATOM   2546 C  "C5'" . U  A 1 119 ? 65.28000 56.48100 91.79600  1.000 113.29655 ? 221 U  A "C5'" 1 
ATOM   2547 C  "C4'" . U  A 1 119 ? 64.49000 57.50600 91.02500  1.000 100.64240 ? 221 U  A "C4'" 1 
ATOM   2548 O  "O4'" . U  A 1 119 ? 63.07100 57.24700 91.18900  1.000 99.26855  ? 221 U  A "O4'" 1 
ATOM   2549 C  "C3'" . U  A 1 119 ? 64.65500 58.94500 91.48400  1.000 100.20814 ? 221 U  A "C3'" 1 
ATOM   2550 O  "O3'" . U  A 1 119 ? 65.83600 59.56100 91.00000  1.000 104.56129 ? 221 U  A "O3'" 1 
ATOM   2551 C  "C2'" . U  A 1 119 ? 63.37000 59.59700 90.99800  1.000 100.77137 ? 221 U  A "C2'" 1 
ATOM   2552 O  "O2'" . U  A 1 119 ? 63.44200 59.88200 89.60700  1.000 105.75091 ? 221 U  A "O2'" 1 
ATOM   2553 C  "C1'" . U  A 1 119 ? 62.36000 58.46800 91.22200  1.000 106.44047 ? 221 U  A "C1'" 1 
ATOM   2554 N  N1    . U  A 1 119 ? 61.67300 58.58600 92.53000  1.000 112.62015 ? 221 U  A N1    1 
ATOM   2555 C  C2    . U  A 1 119 ? 60.67000 59.53200 92.63000  1.000 112.21747 ? 221 U  A C2    1 
ATOM   2556 O  O2    . U  A 1 119 ? 60.34100 60.25300 91.70300  1.000 104.86923 ? 221 U  A O2    1 
ATOM   2557 N  N3    . U  A 1 119 ? 60.05900 59.60300 93.85700  1.000 116.86014 ? 221 U  A N3    1 
ATOM   2558 C  C4    . U  A 1 119 ? 60.35100 58.84000 94.97000  1.000 115.35732 ? 221 U  A C4    1 
ATOM   2559 O  O4    . U  A 1 119 ? 59.71700 59.02300 96.01200  1.000 117.42599 ? 221 U  A O4    1 
ATOM   2560 C  C5    . U  A 1 119 ? 61.40100 57.88300 94.78500  1.000 113.07284 ? 221 U  A C5    1 
ATOM   2561 C  C6    . U  A 1 119 ? 62.01100 57.79300 93.60100  1.000 114.37036 ? 221 U  A C6    1 
ATOM   2562 P  P     . C  A 1 120 ? 66.65700 60.56700 91.94500  1.000 105.93766 ? 222 C  A P     1 
ATOM   2563 O  OP1   . C  A 1 120 ? 67.99200 60.79000 91.33800  1.000 90.75952  ? 222 C  A OP1   1 
ATOM   2564 O  OP2   . C  A 1 120 ? 66.56600 60.05800 93.33900  1.000 106.19032 ? 222 C  A OP2   1 
ATOM   2565 O  "O5'" . C  A 1 120 ? 65.83100 61.92800 91.86400  1.000 98.94735  ? 222 C  A "O5'" 1 
ATOM   2566 C  "C5'" . C  A 1 120 ? 65.62900 62.58900 90.62200  1.000 94.30205  ? 222 C  A "C5'" 1 
ATOM   2567 C  "C4'" . C  A 1 120 ? 64.41800 63.48700 90.66300  1.000 99.46057  ? 222 C  A "C4'" 1 
ATOM   2568 O  "O4'" . C  A 1 120 ? 63.25500 62.71900 91.06500  1.000 105.94292 ? 222 C  A "O4'" 1 
ATOM   2569 C  "C3'" . C  A 1 120 ? 64.47100 64.62700 91.66500  1.000 94.53103  ? 222 C  A "C3'" 1 
ATOM   2570 O  "O3'" . C  A 1 120 ? 65.20600 65.74000 91.19500  1.000 97.85774  ? 222 C  A "O3'" 1 
ATOM   2571 C  "C2'" . C  A 1 120 ? 62.99800 64.92400 91.91200  1.000 102.39776 ? 222 C  A "C2'" 1 
ATOM   2572 O  "O2'" . C  A 1 120 ? 62.45900 65.70400 90.85500  1.000 104.57171 ? 222 C  A "O2'" 1 
ATOM   2573 C  "C1'" . C  A 1 120 ? 62.39300 63.51900 91.84600  1.000 103.91900 ? 222 C  A "C1'" 1 
ATOM   2574 N  N1    . C  A 1 120 ? 62.26700 62.90800 93.19000  1.000 100.35541 ? 222 C  A N1    1 
ATOM   2575 C  C2    . C  A 1 120 ? 61.17200 63.25900 93.98100  1.000 104.69804 ? 222 C  A C2    1 
ATOM   2576 O  O2    . C  A 1 120 ? 60.34900 64.06100 93.51800  1.000 103.88215 ? 222 C  A O2    1 
ATOM   2577 N  N3    . C  A 1 120 ? 61.03500 62.71600 95.21500  1.000 111.31988 ? 222 C  A N3    1 
ATOM   2578 C  C4    . C  A 1 120 ? 61.94800 61.85300 95.66800  1.000 111.99102 ? 222 C  A C4    1 
ATOM   2579 N  N4    . C  A 1 120 ? 61.78500 61.33800 96.89000  1.000 111.65413 ? 222 C  A N4    1 
ATOM   2580 C  C5    . C  A 1 120 ? 63.07700 61.47700 94.88400  1.000 109.18805 ? 222 C  A C5    1 
ATOM   2581 C  C6    . C  A 1 120 ? 63.19500 62.02200 93.66500  1.000 104.92438 ? 222 C  A C6    1 
ATOM   2582 P  P     . C  A 1 121 ? 65.89300 66.74500 92.23900  1.000 98.60188  ? 223 C  A P     1 
ATOM   2583 O  OP1   . C  A 1 121 ? 66.77300 67.66300 91.47200  1.000 105.89223 ? 223 C  A OP1   1 
ATOM   2584 O  OP2   . C  A 1 121 ? 66.46000 65.94400 93.35600  1.000 96.30950  ? 223 C  A OP2   1 
ATOM   2585 O  "O5'" . C  A 1 121 ? 64.67300 67.58700 92.82300  1.000 99.60990  ? 223 C  A "O5'" 1 
ATOM   2586 C  "C5'" . C  A 1 121 ? 63.96700 68.51500 92.01200  1.000 102.12073 ? 223 C  A "C5'" 1 
ATOM   2587 C  "C4'" . C  A 1 121 ? 62.86900 69.20000 92.78600  1.000 102.79449 ? 223 C  A "C4'" 1 
ATOM   2588 O  "O4'" . C  A 1 121 ? 61.86500 68.22900 93.18000  1.000 101.06007 ? 223 C  A "O4'" 1 
ATOM   2589 C  "C3'" . C  A 1 121 ? 63.27300 69.85700 94.09600  1.000 95.77523  ? 223 C  A "C3'" 1 
ATOM   2590 O  "O3'" . C  A 1 121 ? 63.87900 71.12300 93.91800  1.000 94.47244  ? 223 C  A "O3'" 1 
ATOM   2591 C  "C2'" . C  A 1 121 ? 61.95600 69.91000 94.85700  1.000 96.30950  ? 223 C  A "C2'" 1 
ATOM   2592 O  "O2'" . C  A 1 121 ? 61.15300 70.98200 94.38200  1.000 106.32123 ? 223 C  A "O2'" 1 
ATOM   2593 C  "C1'" . C  A 1 121 ? 61.30700 68.59300 94.42700  1.000 95.55941  ? 223 C  A "C1'" 1 
ATOM   2594 N  N1    . C  A 1 121 ? 61.54900 67.49900 95.39700  1.000 96.37530  ? 223 C  A N1    1 
ATOM   2595 C  C2    . C  A 1 121 ? 60.78400 67.44500 96.56700  1.000 100.52053 ? 223 C  A C2    1 
ATOM   2596 O  O2    . C  A 1 121 ? 59.92700 68.31700 96.77000  1.000 104.44995 ? 223 C  A O2    1 
ATOM   2597 N  N3    . C  A 1 121 ? 60.99800 66.44800 97.45700  1.000 98.95982  ? 223 C  A N3    1 
ATOM   2598 C  C4    . C  A 1 121 ? 61.93000 65.52400 97.21200  1.000 101.11008 ? 223 C  A C4    1 
ATOM   2599 N  N4    . C  A 1 121 ? 62.11100 64.55400 98.11300  1.000 109.86902 ? 223 C  A N4    1 
ATOM   2600 C  C5    . C  A 1 121 ? 62.72000 65.55100 96.02700  1.000 99.25986  ? 223 C  A C5    1 
ATOM   2601 C  C6    . C  A 1 121 ? 62.49500 66.54300 95.15900  1.000 99.87835  ? 223 C  A C6    1 
ATOM   2602 P  P     . U  A 1 122 ? 65.07200 71.57700 94.89000  1.000 97.85492  ? 224 U  A P     1 
ATOM   2603 O  OP1   . U  A 1 122 ? 65.57700 72.87600 94.38000  1.000 101.84224 ? 224 U  A OP1   1 
ATOM   2604 O  OP2   . U  A 1 122 ? 66.00100 70.42600 95.05200  1.000 95.87311  ? 224 U  A OP2   1 
ATOM   2605 O  "O5'" . U  A 1 122 ? 64.35100 71.83900 96.28700  1.000 104.16884 ? 224 U  A "O5'" 1 
ATOM   2606 C  "C5'" . U  A 1 122 ? 63.36200 72.85100 96.40800  1.000 105.07947 ? 224 U  A "C5'" 1 
ATOM   2607 C  "C4'" . U  A 1 122 ? 62.56700 72.72000 97.68300  1.000 98.79451  ? 224 U  A "C4'" 1 
ATOM   2608 O  "O4'" . U  A 1 122 ? 61.91100 71.43000 97.73300  1.000 99.36300  ? 224 U  A "O4'" 1 
ATOM   2609 C  "C3'" . U  A 1 122 ? 63.35500 72.78100 98.97900  1.000 103.57666 ? 224 U  A "C3'" 1 
ATOM   2610 O  "O3'" . U  A 1 122 ? 63.68300 74.10800 99.35200  1.000 107.08234 ? 224 U  A "O3'" 1 
ATOM   2611 C  "C2'" . U  A 1 122 ? 62.42400 72.07900 99.96100  1.000 106.59544 ? 224 U  A "C2'" 1 
ATOM   2612 O  "O2'" . U  A 1 122 ? 61.40700 72.96400 100.40300 1.000 108.71938 ? 224 U  A "O2'" 1 
ATOM   2613 C  "C1'" . U  A 1 122 ? 61.78500 71.00800 99.07600  1.000 102.23703 ? 224 U  A "C1'" 1 
ATOM   2614 N  N1    . U  A 1 122 ? 62.43800 69.69100 99.24000  1.000 96.92586  ? 224 U  A N1    1 
ATOM   2615 C  C2    . U  A 1 122 ? 62.05400 68.92800 100.32800 1.000 105.34529 ? 224 U  A C2    1 
ATOM   2616 O  O2    . U  A 1 122 ? 61.21300 69.29100 101.13100 1.000 109.60370 ? 224 U  A O2    1 
ATOM   2617 N  N3    . U  A 1 122 ? 62.68800 67.71700 100.44300 1.000 104.06619 ? 224 U  A N3    1 
ATOM   2618 C  C4    . U  A 1 122 ? 63.65000 67.20600 99.59800  1.000 101.21322 ? 224 U  A C4    1 
ATOM   2619 O  O4    . U  A 1 122 ? 64.12800 66.09500 99.83200  1.000 100.46576 ? 224 U  A O4    1 
ATOM   2620 C  C5    . U  A 1 122 ? 63.99500 68.05600 98.49800  1.000 101.78171 ? 224 U  A C5    1 
ATOM   2621 C  C6    . U  A 1 122 ? 63.39200 69.24100 98.36100  1.000 97.81018  ? 224 U  A C6    1 
ATOM   2622 P  P     . A  A 1 123 ? 65.11100 74.43700 100.01000 1.000 112.88310 ? 225 A  A P     1 
ATOM   2623 O  OP1   . A  A 1 123 ? 65.15300 75.90400 100.24900 1.000 116.03348 ? 225 A  A OP1   1 
ATOM   2624 O  OP2   . A  A 1 123 ? 66.16600 73.78500 99.18800  1.000 109.97749 ? 225 A  A OP2   1 
ATOM   2625 O  "O5'" . A  A 1 123 ? 65.06300 73.69000 101.41800 1.000 107.77722 ? 225 A  A "O5'" 1 
ATOM   2626 C  "C5'" . A  A 1 123 ? 64.02100 73.95300 102.35200 1.000 109.64324 ? 225 A  A "C5'" 1 
ATOM   2627 C  "C4'" . A  A 1 123 ? 64.28500 73.29900 103.68600 1.000 110.69073 ? 225 A  A "C4'" 1 
ATOM   2628 O  "O4'" . A  A 1 123 ? 64.12800 71.85600 103.57400 1.000 106.89554 ? 225 A  A "O4'" 1 
ATOM   2629 C  "C3'" . A  A 1 123 ? 65.67900 73.54000 104.26700 1.000 110.10382 ? 225 A  A "C3'" 1 
ATOM   2630 O  "O3'" . A  A 1 123 ? 65.57900 73.74100 105.67400 1.000 119.21017 ? 225 A  A "O3'" 1 
ATOM   2631 C  "C2'" . A  A 1 123 ? 66.40500 72.22600 103.98200 1.000 106.10071 ? 225 A  A "C2'" 1 
ATOM   2632 O  "O2'" . A  A 1 123 ? 67.46700 71.94000 104.87100 1.000 115.15705 ? 225 A  A "O2'" 1 
ATOM   2633 C  "C1'" . A  A 1 123 ? 65.27300 71.21200 104.10400 1.000 105.08216 ? 225 A  A "C1'" 1 
ATOM   2634 N  N9    . A  A 1 123 ? 65.50300 69.96200 103.37000 1.000 106.11386 ? 225 A  A N9    1 
ATOM   2635 C  C8    . A  A 1 123 ? 65.88800 69.82000 102.06000 1.000 111.68559 ? 225 A  A C8    1 
ATOM   2636 N  N7    . A  A 1 123 ? 66.02500 68.57100 101.68100 1.000 109.99065 ? 225 A  A N7    1 
ATOM   2637 C  C5    . A  A 1 123 ? 65.71900 67.83500 102.82000 1.000 106.70341 ? 225 A  A C5    1 
ATOM   2638 C  C6    . A  A 1 123 ? 65.67700 66.45000 103.08000 1.000 105.27429 ? 225 A  A C6    1 
ATOM   2639 N  N6    . A  A 1 123 ? 65.95600 65.51400 102.17000 1.000 100.76849 ? 225 A  A N6    1 
ATOM   2640 N  N1    . A  A 1 123 ? 65.32500 66.05500 104.32500 1.000 108.91946 ? 225 A  A N1    1 
ATOM   2641 C  C2    . A  A 1 123 ? 65.04000 66.99200 105.24100 1.000 112.84362 ? 225 A  A C2    1 
ATOM   2642 N  N3    . A  A 1 123 ? 65.04600 68.31900 105.12000 1.000 112.73045 ? 225 A  A N3    1 
ATOM   2643 C  C4    . A  A 1 123 ? 65.39700 68.68100 103.87000 1.000 105.82699 ? 225 A  A C4    1 
ATOM   2644 P  P     . A  A 1 124 ? 65.71600 75.22800 106.26800 1.000 116.20621 ? 226 A  A P     1 
ATOM   2645 O  OP1   . A  A 1 124 ? 65.08300 76.17000 105.31100 1.000 109.15800 ? 226 A  A OP1   1 
ATOM   2646 O  OP2   . A  A 1 124 ? 67.13100 75.43000 106.67300 1.000 113.32692 ? 226 A  A OP2   1 
ATOM   2647 O  "O5'" . A  A 1 124 ? 64.81100 75.21400 107.57700 1.000 119.44871 ? 226 A  A "O5'" 1 
ATOM   2648 C  "C5'" . A  A 1 124 ? 63.83700 76.22400 107.80000 1.000 121.87005 ? 226 A  A "C5'" 1 
ATOM   2649 C  "C4'" . A  A 1 124 ? 62.72900 75.72600 108.69200 1.000 115.81406 ? 226 A  A "C4'" 1 
ATOM   2650 O  "O4'" . A  A 1 124 ? 61.91600 74.76800 107.96400 1.000 111.19772 ? 226 A  A "O4'" 1 
ATOM   2651 C  "C3'" . A  A 1 124 ? 63.17700 74.97600 109.93900 1.000 115.82196 ? 226 A  A "C3'" 1 
ATOM   2652 O  "O3'" . A  A 1 124 ? 63.50000 75.85100 111.00900 1.000 114.22176 ? 226 A  A "O3'" 1 
ATOM   2653 C  "C2'" . A  A 1 124 ? 61.99400 74.05900 110.22800 1.000 119.17762 ? 226 A  A "C2'" 1 
ATOM   2654 O  "O2'" . A  A 1 124 ? 60.95600 74.77100 110.88100 1.000 117.54321 ? 226 A  A "O2'" 1 
ATOM   2655 C  "C1'" . A  A 1 124 ? 61.52200 73.71500 108.81500 1.000 115.48244 ? 226 A  A "C1'" 1 
ATOM   2656 N  N9    . A  A 1 124 ? 62.13400 72.46900 108.32000 1.000 109.46330 ? 226 A  A N9    1 
ATOM   2657 C  C8    . A  A 1 124 ? 63.03800 72.32800 107.29800 1.000 106.59453 ? 226 A  A C8    1 
ATOM   2658 N  N7    . A  A 1 124 ? 63.41600 71.09400 107.08800 1.000 108.09471 ? 226 A  A N7    1 
ATOM   2659 C  C5    . A  A 1 124 ? 62.71000 70.37300 108.04100 1.000 104.37321 ? 226 A  A C5    1 
ATOM   2660 C  C6    . A  A 1 124 ? 62.66700 68.99900 108.34600 1.000 104.23899 ? 226 A  A C6    1 
ATOM   2661 N  N6    . A  A 1 124 ? 63.37400 68.06400 107.69800 1.000 100.83332 ? 226 A  A N6    1 
ATOM   2662 N  N1    . A  A 1 124 ? 61.85800 68.60400 109.36100 1.000 107.63413 ? 226 A  A N1    1 
ATOM   2663 C  C2    . A  A 1 124 ? 61.14500 69.53100 110.02100 1.000 109.17379 ? 226 A  A C2    1 
ATOM   2664 N  N3    . A  A 1 124 ? 61.10800 70.84800 109.82100 1.000 114.17965 ? 226 A  A N3    1 
ATOM   2665 C  C4    . A  A 1 124 ? 61.91700 71.20700 108.80900 1.000 109.81597 ? 226 A  A C4    1 
ATOM   2666 P  P     . G  A 1 125 ? 64.93000 75.76500 111.73800 1.000 122.34755 ? 227 G  A P     1 
ATOM   2667 O  OP1   . G  A 1 125 ? 64.92800 76.75000 112.84900 1.000 111.42782 ? 227 G  A OP1   1 
ATOM   2668 O  OP2   . G  A 1 125 ? 65.99000 75.82100 110.69600 1.000 121.01845 ? 227 G  A OP2   1 
ATOM   2669 O  "O5'" . G  A 1 125 ? 64.94600 74.31500 112.39600 1.000 112.07790 ? 227 G  A "O5'" 1 
ATOM   2670 C  "C5'" . G  A 1 125 ? 64.02200 73.96200 113.41500 1.000 109.11965 ? 227 G  A "C5'" 1 
ATOM   2671 C  "C4'" . G  A 1 125 ? 63.96000 72.46800 113.59900 1.000 110.04608 ? 227 G  A "C4'" 1 
ATOM   2672 O  "O4'" . G  A 1 125 ? 63.42500 71.85600 112.39700 1.000 109.27493 ? 227 G  A "O4'" 1 
ATOM   2673 C  "C3'" . G  A 1 125 ? 65.29500 71.77100 113.80600 1.000 105.99033 ? 227 G  A "C3'" 1 
ATOM   2674 O  "O3'" . G  A 1 125 ? 65.75100 71.84100 115.14500 1.000 110.00923 ? 227 G  A "O3'" 1 
ATOM   2675 C  "C2'" . G  A 1 125 ? 65.00800 70.35600 113.32700 1.000 107.69843 ? 227 G  A "C2'" 1 
ATOM   2676 O  "O2'" . G  A 1 125 ? 64.28500 69.63600 114.31400 1.000 99.47376  ? 227 G  A "O2'" 1 
ATOM   2677 C  "C1'" . G  A 1 125 ? 64.07400 70.62800 112.14800 1.000 110.51719 ? 227 G  A "C1'" 1 
ATOM   2678 N  N9    . G  A 1 125 ? 64.81300 70.75600 110.87900 1.000 112.32267 ? 227 G  A N9    1 
ATOM   2679 C  C8    . G  A 1 125 ? 64.99500 71.91300 110.16000 1.000 114.28606 ? 227 G  A C8    1 
ATOM   2680 N  N7    . G  A 1 125 ? 65.69900 71.73800 109.07500 1.000 115.09405 ? 227 G  A N7    1 
ATOM   2681 C  C5    . G  A 1 125 ? 65.99900 70.38400 109.07500 1.000 110.66984 ? 227 G  A C5    1 
ATOM   2682 C  C6    . G  A 1 125 ? 66.73600 69.61400 108.14200 1.000 106.30353 ? 227 G  A C6    1 
ATOM   2683 O  O6    . G  A 1 125 ? 67.28600 69.99600 107.10100 1.000 105.58239 ? 227 G  A O6    1 
ATOM   2684 N  N1    . G  A 1 125 ? 66.79600 68.27800 108.52700 1.000 106.13772 ? 227 G  A N1    1 
ATOM   2685 C  C2    . G  A 1 125 ? 66.22100 67.75000 109.65800 1.000 107.47735 ? 227 G  A C2    1 
ATOM   2686 N  N2    . G  A 1 125 ? 66.38800 66.43500 109.85900 1.000 108.58275 ? 227 G  A N2    1 
ATOM   2687 N  N3    . G  A 1 125 ? 65.53100 68.46000 110.53400 1.000 108.25376 ? 227 G  A N3    1 
ATOM   2688 C  C4    . G  A 1 125 ? 65.45900 69.76000 110.18100 1.000 109.96712 ? 227 G  A C4    1 
ATOM   2689 P  P     . U  A 1 126 ? 67.30000 72.12800 115.45000 1.000 117.06499 ? 228 U  A P     1 
ATOM   2690 O  OP1   . U  A 1 126 ? 67.43500 72.36000 116.90800 1.000 124.54221 ? 228 U  A OP1   1 
ATOM   2691 O  OP2   . U  A 1 126 ? 67.78700 73.15300 114.48600 1.000 118.31251 ? 228 U  A OP2   1 
ATOM   2692 O  "O5'" . U  A 1 126 ? 68.01500 70.74600 115.11000 1.000 115.68588 ? 228 U  A "O5'" 1 
ATOM   2693 C  "C5'" . U  A 1 126 ? 67.69200 69.55700 115.81700 1.000 113.65932 ? 228 U  A "C5'" 1 
ATOM   2694 C  "C4'" . U  A 1 126 ? 68.27800 68.34600 115.13700 1.000 115.12002 ? 228 U  A "C4'" 1 
ATOM   2695 O  "O4'" . U  A 1 126 ? 67.68500 68.19000 113.82100 1.000 117.35187 ? 228 U  A "O4'" 1 
ATOM   2696 C  "C3'" . U  A 1 126 ? 69.77300 68.40000 114.86300 1.000 113.81460 ? 228 U  A "C3'" 1 
ATOM   2697 O  "O3'" . U  A 1 126 ? 70.55900 68.06800 115.99300 1.000 115.15687 ? 228 U  A "O3'" 1 
ATOM   2698 C  "C2'" . U  A 1 126 ? 69.93500 67.44000 113.69300 1.000 116.57546 ? 228 U  A "C2'" 1 
ATOM   2699 O  "O2'" . U  A 1 126 ? 69.92500 66.09100 114.13900 1.000 119.07576 ? 228 U  A "O2'" 1 
ATOM   2700 C  "C1'" . U  A 1 126 ? 68.64900 67.70700 112.90900 1.000 112.74606 ? 228 U  A "C1'" 1 
ATOM   2701 N  N1    . U  A 1 126 ? 68.84600 68.72500 111.85100 1.000 113.82776 ? 228 U  A N1    1 
ATOM   2702 C  C2    . U  A 1 126 ? 69.41600 68.31300 110.66200 1.000 114.63839 ? 228 U  A C2    1 
ATOM   2703 O  O2    . U  A 1 126 ? 69.75700 67.16100 110.45900 1.000 118.76257 ? 228 U  A O2    1 
ATOM   2704 N  N3    . U  A 1 126 ? 69.57100 69.29900 109.72000 1.000 107.28224 ? 228 U  A N3    1 
ATOM   2705 C  C4    . U  A 1 126 ? 69.22200 70.62900 109.84800 1.000 110.73792 ? 228 U  A C4    1 
ATOM   2706 O  O4    . U  A 1 126 ? 69.42700 71.40300 108.91400 1.000 117.57558 ? 228 U  A O4    1 
ATOM   2707 C  C5    . U  A 1 126 ? 68.63600 70.97900 111.10400 1.000 112.87239 ? 228 U  A C5    1 
ATOM   2708 C  C6    . U  A 1 126 ? 68.47500 70.03700 112.03700 1.000 112.27495 ? 228 U  A C6    1 
ATOM   2709 P  P     . C  A 1 127 ? 71.90800 68.88400 116.29400 1.000 123.18084 ? 229 C  A P     1 
ATOM   2710 O  OP1   . C  A 1 127 ? 72.26000 68.66300 117.72100 1.000 121.20692 ? 229 C  A OP1   1 
ATOM   2711 O  OP2   . C  A 1 127 ? 71.70500 70.27100 115.79900 1.000 119.24090 ? 229 C  A OP2   1 
ATOM   2712 O  "O5'" . C  A 1 127 ? 72.99500 68.18500 115.35700 1.000 123.15189 ? 229 C  A "O5'" 1 
ATOM   2713 C  "C5'" . C  A 1 127 ? 73.29100 66.80200 115.48800 1.000 123.04135 ? 229 C  A "C5'" 1 
ATOM   2714 C  "C4'" . C  A 1 127 ? 74.14400 66.29600 114.35100 1.000 121.40958 ? 229 C  A "C4'" 1 
ATOM   2715 O  "O4'" . C  A 1 127 ? 73.37000 66.27700 113.12100 1.000 127.45241 ? 229 C  A "O4'" 1 
ATOM   2716 C  "C3'" . C  A 1 127 ? 75.36900 67.12600 114.00000 1.000 122.83870 ? 229 C  A "C3'" 1 
ATOM   2717 O  "O3'" . C  A 1 127 ? 76.46800 66.89300 114.86200 1.000 129.16577 ? 229 C  A "O3'" 1 
ATOM   2718 C  "C2'" . C  A 1 127 ? 75.63200 66.73200 112.55400 1.000 126.22331 ? 229 C  A "C2'" 1 
ATOM   2719 O  "O2'" . C  A 1 127 ? 76.28300 65.47100 112.48400 1.000 133.18731 ? 229 C  A "O2'" 1 
ATOM   2720 C  "C1'" . C  A 1 127 ? 74.20600 66.58100 112.02200 1.000 122.95713 ? 229 C  A "C1'" 1 
ATOM   2721 N  N1    . C  A 1 127 ? 73.72800 67.83400 111.39500 1.000 117.63807 ? 229 C  A N1    1 
ATOM   2722 C  C2    . C  A 1 127 ? 74.12900 68.13300 110.09300 1.000 118.01180 ? 229 C  A C2    1 
ATOM   2723 O  O2    . C  A 1 127 ? 74.86400 67.33400 109.49400 1.000 116.69586 ? 229 C  A O2    1 
ATOM   2724 N  N3    . C  A 1 127 ? 73.70000 69.28000 109.52000 1.000 119.35933 ? 229 C  A N3    1 
ATOM   2725 C  C4    . C  A 1 127 ? 72.90700 70.10900 110.20800 1.000 117.69071 ? 229 C  A C4    1 
ATOM   2726 N  N4    . C  A 1 127 ? 72.49900 71.23400 109.61600 1.000 118.54345 ? 229 C  A N4    1 
ATOM   2727 C  C5    . C  A 1 127 ? 72.48900 69.83000 111.53800 1.000 116.72744 ? 229 C  A C5    1 
ATOM   2728 C  C6    . C  A 1 127 ? 72.92200 68.69200 112.08200 1.000 117.16696 ? 229 C  A C6    1 
ATOM   2729 P  P     . A  A 1 128 ? 77.48400 68.08900 115.20400 1.000 137.45788 ? 230 A  A P     1 
ATOM   2730 O  OP1   . A  A 1 128 ? 78.31900 67.65900 116.35100 1.000 129.02003 ? 230 A  A OP1   1 
ATOM   2731 O  OP2   . A  A 1 128 ? 76.70000 69.34600 115.30500 1.000 130.49126 ? 230 A  A OP2   1 
ATOM   2732 O  "O5'" . A  A 1 128 ? 78.40700 68.20200 113.90900 1.000 131.22293 ? 230 A  A "O5'" 1 
ATOM   2733 C  "C5'" . A  A 1 128 ? 79.14100 67.08500 113.42700 1.000 132.21515 ? 230 A  A "C5'" 1 
ATOM   2734 C  "C4'" . A  A 1 128 ? 79.62900 67.30400 112.01500 1.000 139.99766 ? 230 A  A "C4'" 1 
ATOM   2735 O  "O4'" . A  A 1 128 ? 78.50200 67.43800 111.11300 1.000 133.25738 ? 230 A  A "O4'" 1 
ATOM   2736 C  "C3'" . A  A 1 128 ? 80.44700 68.56400 111.77200 1.000 143.88497 ? 230 A  A "C3'" 1 
ATOM   2737 O  "O3'" . A  A 1 128 ? 81.79700 68.41800 112.17400 1.000 150.96213 ? 230 A  A "O3'" 1 
ATOM   2738 C  "C2'" . A  A 1 128 ? 80.27000 68.79000 110.27400 1.000 134.91547 ? 230 A  A "C2'" 1 
ATOM   2739 O  "O2'" . A  A 1 128 ? 81.13100 67.94200 109.52900 1.000 133.62585 ? 230 A  A "O2'" 1 
ATOM   2740 C  "C1'" . A  A 1 128 ? 78.82800 68.32400 110.06200 1.000 134.48384 ? 230 A  A "C1'" 1 
ATOM   2741 N  N9    . A  A 1 128 ? 77.87200 69.44800 110.07100 1.000 136.03403 ? 230 A  A N9    1 
ATOM   2742 C  C8    . A  A 1 128 ? 76.98500 69.80100 111.05800 1.000 132.63889 ? 230 A  A C8    1 
ATOM   2743 N  N7    . A  A 1 128 ? 76.26300 70.85600 110.76700 1.000 128.29363 ? 230 A  A N7    1 
ATOM   2744 C  C5    . A  A 1 128 ? 76.70400 71.22100 109.50200 1.000 126.24338 ? 230 A  A C5    1 
ATOM   2745 C  C6    . A  A 1 128 ? 76.33600 72.26400 108.63400 1.000 125.01692 ? 230 A  A C6    1 
ATOM   2746 N  N6    . A  A 1 128 ? 75.39800 73.17000 108.92300 1.000 125.68016 ? 230 A  A N6    1 
ATOM   2747 N  N1    . A  A 1 128 ? 76.97200 72.34800 107.44500 1.000 125.56172 ? 230 A  A N1    1 
ATOM   2748 C  C2    . A  A 1 128 ? 77.91400 71.44100 107.15600 1.000 128.78053 ? 230 A  A C2    1 
ATOM   2749 N  N3    . A  A 1 128 ? 78.34600 70.41700 107.88700 1.000 129.03582 ? 230 A  A N3    1 
ATOM   2750 C  C4    . A  A 1 128 ? 77.69400 70.36300 109.06100 1.000 130.83867 ? 230 A  A C4    1 
ATOM   2751 P  P     . A  A 1 129 ? 82.65500 69.69300 112.64400 1.000 151.04866 ? 231 A  A P     1 
ATOM   2752 O  OP1   . A  A 1 129 ? 83.91900 69.18200 113.23100 1.000 151.39607 ? 231 A  A OP1   1 
ATOM   2753 O  OP2   . A  A 1 129 ? 81.79000 70.59500 113.44800 1.000 150.93286 ? 231 A  A OP2   1 
ATOM   2754 O  "O5'" . A  A 1 129 ? 83.02500 70.42300 111.27900 1.000 147.49034 ? 231 A  A "O5'" 1 
ATOM   2755 C  "C5'" . A  A 1 129 ? 83.79700 69.76000 110.28800 1.000 145.56116 ? 231 A  A "C5'" 1 
ATOM   2756 C  "C4'" . A  A 1 129 ? 83.91500 70.58500 109.03400 1.000 144.93477 ? 231 A  A "C4'" 1 
ATOM   2757 O  "O4'" . A  A 1 129 ? 82.63100 70.64600 108.35800 1.000 146.81131 ? 231 A  A "O4'" 1 
ATOM   2758 C  "C3'" . A  A 1 129 ? 84.29500 72.04200 109.23800 1.000 149.24581 ? 231 A  A "C3'" 1 
ATOM   2759 O  "O3'" . A  A 1 129 ? 85.68500 72.22600 109.43700 1.000 153.72530 ? 231 A  A "O3'" 1 
ATOM   2760 C  "C2'" . A  A 1 129 ? 83.74900 72.70200 107.97900 1.000 148.70891 ? 231 A  A "C2'" 1 
ATOM   2761 O  "O2'" . A  A 1 129 ? 84.59900 72.45400 106.86900 1.000 150.43280 ? 231 A  A "O2'" 1 
ATOM   2762 C  "C1'" . A  A 1 129 ? 82.45200 71.92000 107.77700 1.000 144.21363 ? 231 A  A "C1'" 1 
ATOM   2763 N  N9    . A  A 1 129 ? 81.31700 72.57400 108.45100 1.000 138.96037 ? 231 A  A N9    1 
ATOM   2764 C  C8    . A  A 1 129 ? 80.74800 72.23700 109.65200 1.000 141.71333 ? 231 A  A C8    1 
ATOM   2765 N  N7    . A  A 1 129 ? 79.75400 73.01100 110.00500 1.000 141.75544 ? 231 A  A N7    1 
ATOM   2766 C  C5    . A  A 1 129 ? 79.66500 73.92200 108.96400 1.000 139.13144 ? 231 A  A C5    1 
ATOM   2767 C  C6    . A  A 1 129 ? 78.80700 75.01100 108.72900 1.000 141.02378 ? 231 A  A C6    1 
ATOM   2768 N  N6    . A  A 1 129 ? 77.83400 75.38400 109.56500 1.000 141.98968 ? 231 A  A N6    1 
ATOM   2769 N  N1    . A  A 1 129 ? 78.98400 75.71900 107.59100 1.000 140.16841 ? 231 A  A N1    1 
ATOM   2770 C  C2    . A  A 1 129 ? 79.96100 75.35100 106.75300 1.000 139.66835 ? 231 A  A C2    1 
ATOM   2771 N  N3    . A  A 1 129 ? 80.82700 74.34800 106.86500 1.000 139.10512 ? 231 A  A N3    1 
ATOM   2772 C  C4    . A  A 1 129 ? 80.62400 73.66700 108.00300 1.000 136.70484 ? 231 A  A C4    1 
ATOM   2773 P  P     . C  A 1 130 ? 86.20900 73.30500 110.50600 1.000 162.33548 ? 232 C  A P     1 
ATOM   2774 O  OP1   . C  A 1 130 ? 87.66700 73.08500 110.69200 1.000 168.32567 ? 232 C  A OP1   1 
ATOM   2775 O  OP2   . C  A 1 130 ? 85.30000 73.26800 111.68100 1.000 156.84008 ? 232 C  A OP2   1 
ATOM   2776 O  "O5'" . C  A 1 130 ? 86.01500 74.69400 109.75400 1.000 157.03484 ? 232 C  A "O5'" 1 
ATOM   2777 C  "C5'" . C  A 1 130 ? 86.61500 74.91400 108.48700 1.000 156.38213 ? 232 C  A "C5'" 1 
ATOM   2778 C  "C4'" . C  A 1 130 ? 85.97400 76.06900 107.76500 1.000 157.36909 ? 232 C  A "C4'" 1 
ATOM   2779 O  "O4'" . C  A 1 130 ? 84.60200 75.73700 107.41700 1.000 153.77656 ? 232 C  A "O4'" 1 
ATOM   2780 C  "C3'" . C  A 1 130 ? 85.83700 77.35400 108.56000 1.000 163.98041 ? 232 C  A "C3'" 1 
ATOM   2781 O  "O3'" . C  A 1 130 ? 87.04300 78.08600 108.68700 1.000 168.05459 ? 232 C  A "O3'" 1 
ATOM   2782 C  "C2'" . C  A 1 130 ? 84.72900 78.07100 107.80700 1.000 161.93017 ? 232 C  A "C2'" 1 
ATOM   2783 O  "O2'" . C  A 1 130 ? 85.21500 78.60000 106.58000 1.000 162.35917 ? 232 C  A "O2'" 1 
ATOM   2784 C  "C1'" . C  A 1 130 ? 83.79600 76.89800 107.49900 1.000 155.26621 ? 232 C  A "C1'" 1 
ATOM   2785 N  N1    . C  A 1 130 ? 82.80600 76.71600 108.58700 1.000 151.23941 ? 232 C  A N1    1 
ATOM   2786 C  C2    . C  A 1 130 ? 81.70100 77.57200 108.62400 1.000 150.88937 ? 232 C  A C2    1 
ATOM   2787 O  O2    . C  A 1 130 ? 81.57500 78.43000 107.73600 1.000 148.36275 ? 232 C  A O2    1 
ATOM   2788 N  N3    . C  A 1 130 ? 80.79400 77.44200 109.62000 1.000 149.64975 ? 232 C  A N3    1 
ATOM   2789 C  C4    . C  A 1 130 ? 80.96300 76.50700 110.55900 1.000 149.29707 ? 232 C  A C4    1 
ATOM   2790 N  N4    . C  A 1 130 ? 80.04000 76.41000 111.52000 1.000 148.63121 ? 232 C  A N4    1 
ATOM   2791 C  C5    . C  A 1 130 ? 82.08300 75.62500 110.55100 1.000 150.32615 ? 232 C  A C5    1 
ATOM   2792 C  C6    . C  A 1 130 ? 82.97000 75.76600 109.56000 1.000 151.16572 ? 232 C  A C6    1 
ATOM   2793 P  P     . A  A 1 131 ? 87.33100 78.91900 110.03100 1.000 184.10384 ? 233 A  A P     1 
ATOM   2794 O  OP1   . A  A 1 131 ? 88.76600 79.29400 110.02200 1.000 187.51477 ? 233 A  A OP1   1 
ATOM   2795 O  OP2   . A  A 1 131 ? 86.77900 78.16600 111.18900 1.000 169.95477 ? 233 A  A OP2   1 
ATOM   2796 O  "O5'" . A  A 1 131 ? 86.46800 80.24500 109.83800 1.000 174.25266 ? 233 A  A "O5'" 1 
ATOM   2797 C  "C5'" . A  A 1 131 ? 86.61700 81.04400 108.67200 1.000 170.41009 ? 233 A  A "C5'" 1 
ATOM   2798 C  "C4'" . A  A 1 131 ? 85.43200 81.95300 108.46100 1.000 171.69972 ? 233 A  A "C4'" 1 
ATOM   2799 O  "O4'" . A  A 1 131 ? 84.22900 81.16600 108.24800 1.000 168.25457 ? 233 A  A "O4'" 1 
ATOM   2800 C  "C3'" . A  A 1 131 ? 85.06400 82.85200 109.62800 1.000 177.26091 ? 233 A  A "C3'" 1 
ATOM   2801 O  "O3'" . A  A 1 131 ? 85.90600 83.98100 109.77200 1.000 178.70845 ? 233 A  A "O3'" 1 
ATOM   2802 C  "C2'" . A  A 1 131 ? 83.61000 83.18400 109.32900 1.000 176.07919 ? 233 A  A "C2'" 1 
ATOM   2803 O  "O2'" . A  A 1 131 ? 83.51200 84.13800 108.28000 1.000 171.51286 ? 233 A  A "O2'" 1 
ATOM   2804 C  "C1'" . A  A 1 131 ? 83.11400 81.83700 108.80800 1.000 169.25732 ? 233 A  A "C1'" 1 
ATOM   2805 N  N9    . A  A 1 131 ? 82.56100 81.01800 109.90400 1.000 167.40447 ? 233 A  A N9    1 
ATOM   2806 C  C8    . A  A 1 131 ? 83.06300 79.86900 110.46400 1.000 164.43043 ? 233 A  A C8    1 
ATOM   2807 N  N7    . A  A 1 131 ? 82.32700 79.38700 111.43900 1.000 162.74865 ? 233 A  A N7    1 
ATOM   2808 C  C5    . A  A 1 131 ? 81.27300 80.28500 111.53500 1.000 162.58284 ? 233 A  A C5    1 
ATOM   2809 C  C6    . A  A 1 131 ? 80.14400 80.34000 112.37700 1.000 162.61705 ? 233 A  A C6    1 
ATOM   2810 N  N6    . A  A 1 131 ? 79.87800 79.43900 113.32700 1.000 162.36176 ? 233 A  A N6    1 
ATOM   2811 N  N1    . A  A 1 131 ? 79.28300 81.36900 112.20900 1.000 161.96434 ? 233 A  A N1    1 
ATOM   2812 C  C2    . A  A 1 131 ? 79.54600 82.27600 111.25900 1.000 159.98779 ? 233 A  A C2    1 
ATOM   2813 N  N3    . A  A 1 131 ? 80.57000 82.32800 110.40800 1.000 161.91170 ? 233 A  A N3    1 
ATOM   2814 C  C4    . A  A 1 131 ? 81.40800 81.29400 110.60000 1.000 163.80667 ? 233 A  A C4    1 
ATOM   2815 P  P     . G  A 1 132 ? 86.40400 84.42300 111.23600 1.000 186.52631 ? 234 G  A P     1 
ATOM   2816 O  OP1   . G  A 1 132 ? 87.85000 84.76400 111.16700 1.000 184.45764 ? 234 G  A OP1   1 
ATOM   2817 O  OP2   . G  A 1 132 ? 85.96200 83.37200 112.18600 1.000 184.34973 ? 234 G  A OP2   1 
ATOM   2818 O  "O5'" . G  A 1 132 ? 85.55300 85.73400 111.55400 1.000 190.40572 ? 234 G  A "O5'" 1 
ATOM   2819 C  "C5'" . G  A 1 132 ? 84.94500 86.48800 110.51200 1.000 185.18404 ? 234 G  A "C5'" 1 
ATOM   2820 C  "C4'" . G  A 1 132 ? 83.54600 86.92700 110.87600 1.000 186.89477 ? 234 G  A "C4'" 1 
ATOM   2821 O  "O4'" . G  A 1 132 ? 82.65500 85.78300 110.90700 1.000 181.48097 ? 234 G  A "O4'" 1 
ATOM   2822 C  "C3'" . G  A 1 132 ? 83.37300 87.56900 112.24500 1.000 193.64032 ? 234 G  A "C3'" 1 
ATOM   2823 O  "O3'" . G  A 1 132 ? 83.74100 88.94100 112.25200 1.000 201.92552 ? 234 G  A "O3'" 1 
ATOM   2824 C  "C2'" . G  A 1 132 ? 81.89300 87.33700 112.54500 1.000 187.18165 ? 234 G  A "C2'" 1 
ATOM   2825 O  "O2'" . G  A 1 132 ? 81.09000 88.32300 111.91600 1.000 187.09743 ? 234 G  A "O2'" 1 
ATOM   2826 C  "C1'" . G  A 1 132 ? 81.63600 85.98900 111.86100 1.000 179.81498 ? 234 G  A "C1'" 1 
ATOM   2827 N  N9    . G  A 1 132 ? 81.61900 84.85500 112.81000 1.000 177.60419 ? 234 G  A N9    1 
ATOM   2828 C  C8    . G  A 1 132 ? 82.59400 83.90500 113.01000 1.000 174.92755 ? 234 G  A C8    1 
ATOM   2829 N  N7    . G  A 1 132 ? 82.27400 83.02500 113.92200 1.000 173.58528 ? 234 G  A N7    1 
ATOM   2830 C  C5    . G  A 1 132 ? 81.00900 83.40900 114.34600 1.000 172.48778 ? 234 G  A C5    1 
ATOM   2831 C  C6    . G  A 1 132 ? 80.15200 82.83700 115.32200 1.000 172.17196 ? 234 G  A C6    1 
ATOM   2832 O  O6    . G  A 1 132 ? 80.34400 81.83900 116.02900 1.000 173.11417 ? 234 G  A O6    1 
ATOM   2833 N  N1    . G  A 1 132 ? 78.96200 83.55000 115.43600 1.000 173.17208 ? 234 G  A N1    1 
ATOM   2834 C  C2    . G  A 1 132 ? 78.63500 84.66900 114.70900 1.000 175.38287 ? 234 G  A C2    1 
ATOM   2835 N  N2    . G  A 1 132 ? 77.43700 85.21500 114.96500 1.000 176.18823 ? 234 G  A N2    1 
ATOM   2836 N  N3    . G  A 1 132 ? 79.42700 85.21100 113.79800 1.000 175.30654 ? 234 G  A N3    1 
ATOM   2837 C  C4    . G  A 1 132 ? 80.59100 84.53600 113.66900 1.000 175.46709 ? 234 G  A C4    1 
ATOM   2838 P  P     . A  A 1 133 ? 84.40000 89.61600 113.55700 1.000 205.00739 ? 235 A  A P     1 
ATOM   2839 O  OP1   . A  A 1 133 ? 84.13100 91.07700 113.50200 1.000 203.11242 ? 235 A  A OP1   1 
ATOM   2840 O  OP2   . A  A 1 133 ? 85.80200 89.13400 113.66700 1.000 199.49094 ? 235 A  A OP2   1 
ATOM   2841 O  "O5'" . A  A 1 133 ? 83.56200 89.01200 114.77100 1.000 197.36700 ? 235 A  A "O5'" 1 
ATOM   2842 C  "C5'" . A  A 1 133 ? 83.19500 89.81300 115.88700 1.000 202.52288 ? 235 A  A "C5'" 1 
ATOM   2843 C  "C4'" . A  A 1 133 ? 81.70700 89.74600 116.14100 1.000 204.59944 ? 235 A  A "C4'" 1 
ATOM   2844 O  "O4'" . A  A 1 133 ? 81.17000 88.53800 115.53400 1.000 195.35886 ? 235 A  A "O4'" 1 
ATOM   2845 C  "C3'" . A  A 1 133 ? 81.28400 89.64900 117.60100 1.000 207.24186 ? 235 A  A "C3'" 1 
ATOM   2846 O  "O3'" . A  A 1 133 ? 81.27400 90.88800 118.28600 1.000 214.20323 ? 235 A  A "O3'" 1 
ATOM   2847 C  "C2'" . A  A 1 133 ? 79.92200 88.97500 117.49500 1.000 201.69383 ? 235 A  A "C2'" 1 
ATOM   2848 O  "O2'" . A  A 1 133 ? 78.94300 89.89500 117.03400 1.000 202.82028 ? 235 A  A "O2'" 1 
ATOM   2849 C  "C1'" . A  A 1 133 ? 80.19200 87.96900 116.38100 1.000 192.75855 ? 235 A  A "C1'" 1 
ATOM   2850 N  N9    . A  A 1 133 ? 80.74800 86.71500 116.91800 1.000 186.72362 ? 235 A  A N9    1 
ATOM   2851 C  C8    . A  A 1 133 ? 82.00300 86.21200 116.69400 1.000 183.42848 ? 235 A  A C8    1 
ATOM   2852 N  N7    . A  A 1 133 ? 82.24000 85.08700 117.31600 1.000 179.23061 ? 235 A  A N7    1 
ATOM   2853 C  C5    . A  A 1 133 ? 81.06200 84.83700 118.00200 1.000 180.63078 ? 235 A  A C5    1 
ATOM   2854 C  C6    . A  A 1 133 ? 80.67900 83.78800 118.85200 1.000 180.92818 ? 235 A  A C6    1 
ATOM   2855 N  N6    . A  A 1 133 ? 81.48400 82.76700 119.15100 1.000 175.95390 ? 235 A  A N6    1 
ATOM   2856 N  N1    . A  A 1 133 ? 79.43600 83.82400 119.38500 1.000 186.20776 ? 235 A  A N1    1 
ATOM   2857 C  C2    . A  A 1 133 ? 78.64300 84.85700 119.06600 1.000 190.49512 ? 235 A  A C2    1 
ATOM   2858 N  N3    . A  A 1 133 ? 78.89400 85.90300 118.28000 1.000 190.62935 ? 235 A  A N3    1 
ATOM   2859 C  C4    . A  A 1 133 ? 80.13500 85.83200 117.77100 1.000 185.59980 ? 235 A  A C4    1 
ATOM   2860 P  P     . U  A 1 134 ? 82.27900 91.11500 119.52300 1.000 219.82676 ? 236 U  A P     1 
ATOM   2861 O  OP1   . U  A 1 134 ? 82.68500 92.54000 119.54200 1.000 217.01327 ? 236 U  A OP1   1 
ATOM   2862 O  OP2   . U  A 1 134 ? 83.31600 90.05800 119.47000 1.000 214.95249 ? 236 U  A OP2   1 
ATOM   2863 O  "O5'" . U  A 1 134 ? 81.38700 90.85300 120.81700 1.000 216.43951 ? 236 U  A "O5'" 1 
ATOM   2864 C  "C5'" . U  A 1 134 ? 81.27600 89.56000 121.39800 1.000 213.03910 ? 236 U  A "C5'" 1 
ATOM   2865 C  "C4'" . U  A 1 134 ? 80.12400 89.51100 122.37100 1.000 218.17393 ? 236 U  A "C4'" 1 
ATOM   2866 O  "O4'" . U  A 1 134 ? 79.13900 90.49500 121.95900 1.000 218.02128 ? 236 U  A "O4'" 1 
ATOM   2867 C  "C3'" . U  A 1 134 ? 79.34700 88.20200 122.42900 1.000 218.92402 ? 236 U  A "C3'" 1 
ATOM   2868 O  "O3'" . U  A 1 134 ? 79.93200 87.22800 123.27800 1.000 224.74314 ? 236 U  A "O3'" 1 
ATOM   2869 C  "C2'" . U  A 1 134 ? 77.95700 88.64900 122.87200 1.000 219.46093 ? 236 U  A "C2'" 1 
ATOM   2870 O  "O2'" . U  A 1 134 ? 77.92500 88.86900 124.27500 1.000 217.43437 ? 236 U  A "O2'" 1 
ATOM   2871 C  "C1'" . U  A 1 134 ? 77.83500 90.00200 122.16900 1.000 221.20061 ? 236 U  A "C1'" 1 
ATOM   2872 N  N1    . U  A 1 134 ? 77.14600 89.90200 120.85400 1.000 219.58726 ? 236 U  A N1    1 
ATOM   2873 C  C2    . U  A 1 134 ? 76.51700 91.03600 120.36900 1.000 220.71108 ? 236 U  A C2    1 
ATOM   2874 O  O2    . U  A 1 134 ? 76.53100 92.10400 120.95800 1.000 224.40626 ? 236 U  A O2    1 
ATOM   2875 N  N3    . U  A 1 134 ? 75.89500 90.88300 119.15100 1.000 216.26318 ? 236 U  A N3    1 
ATOM   2876 C  C4    . U  A 1 134 ? 75.81500 89.73500 118.38500 1.000 208.25432 ? 236 U  A C4    1 
ATOM   2877 O  O4    . U  A 1 134 ? 75.20700 89.75900 117.30800 1.000 206.57517 ? 236 U  A O4    1 
ATOM   2878 C  C5    . U  A 1 134 ? 76.47800 88.60300 118.96100 1.000 205.50925 ? 236 U  A C5    1 
ATOM   2879 C  C6    . U  A 1 134 ? 77.09100 88.72500 120.14100 1.000 210.24666 ? 236 U  A C6    1 
ATOM   2880 P  P     . C  A 1 135 ? 79.84600 85.66800 122.89600 1.000 211.40998 ? 237 C  A P     1 
ATOM   2881 O  OP1   . C  A 1 135 ? 81.19800 85.23200 122.46600 1.000 202.88791 ? 237 C  A OP1   1 
ATOM   2882 O  OP2   . C  A 1 135 ? 78.69100 85.48400 121.98500 1.000 201.74830 ? 237 C  A OP2   1 
ATOM   2883 O  "O5'" . C  A 1 135 ? 79.49000 84.94500 124.27000 1.000 211.44420 ? 237 C  A "O5'" 1 
ATOM   2884 C  "C5'" . C  A 1 135 ? 78.98700 83.61400 124.28300 1.000 206.43044 ? 237 C  A "C5'" 1 
ATOM   2885 C  "C4'" . C  A 1 135 ? 80.09500 82.61000 124.49500 1.000 209.82032 ? 237 C  A "C4'" 1 
ATOM   2886 O  "O4'" . C  A 1 135 ? 81.31800 83.32000 124.83400 1.000 221.47435 ? 237 C  A "O4'" 1 
ATOM   2887 C  "C3'" . C  A 1 135 ? 79.89600 81.62300 125.64500 1.000 212.73383 ? 237 C  A "C3'" 1 
ATOM   2888 O  "O3'" . C  A 1 135 ? 79.11500 80.49000 125.30100 1.000 212.51538 ? 237 C  A "O3'" 1 
ATOM   2889 C  "C2'" . C  A 1 135 ? 81.32500 81.28400 126.04100 1.000 220.94007 ? 237 C  A "C2'" 1 
ATOM   2890 O  "O2'" . C  A 1 135 ? 81.88600 80.35600 125.12200 1.000 217.02118 ? 237 C  A "O2'" 1 
ATOM   2891 C  "C1'" . C  A 1 135 ? 82.01300 82.63500 125.85600 1.000 223.83252 ? 237 C  A "C1'" 1 
ATOM   2892 N  N1    . C  A 1 135 ? 81.95700 83.47400 127.08100 1.000 223.86411 ? 237 C  A N1    1 
ATOM   2893 C  C2    . C  A 1 135 ? 82.53200 83.05900 128.29800 1.000 226.33282 ? 237 C  A C2    1 
ATOM   2894 O  O2    . C  A 1 135 ? 83.10500 81.96000 128.38600 1.000 225.53799 ? 237 C  A O2    1 
ATOM   2895 N  N3    . C  A 1 135 ? 82.44500 83.87700 129.37600 1.000 226.97237 ? 237 C  A N3    1 
ATOM   2896 C  C4    . C  A 1 135 ? 81.82900 85.05900 129.27900 1.000 226.41441 ? 237 C  A C4    1 
ATOM   2897 N  N4    . C  A 1 135 ? 81.77500 85.82400 130.37400 1.000 225.37745 ? 237 C  A N4    1 
ATOM   2898 C  C5    . C  A 1 135 ? 81.24200 85.51100 128.05900 1.000 223.50880 ? 237 C  A C5    1 
ATOM   2899 C  C6    . C  A 1 135 ? 81.33100 84.69200 127.00500 1.000 220.70847 ? 237 C  A C6    1 
ATOM   2900 P  P     . U  A 1 136 ? 78.41300 79.61300 126.45400 1.000 224.19092 ? 238 U  A P     1 
ATOM   2901 O  OP1   . U  A 1 136 ? 77.06900 80.19000 126.71300 1.000 212.44741 ? 238 U  A OP1   1 
ATOM   2902 O  OP2   . U  A 1 136 ? 79.37200 79.45600 127.57100 1.000 229.63368 ? 238 U  A OP2   1 
ATOM   2903 O  "O5'" . U  A 1 136 ? 78.20700 78.17600 125.79500 1.000 217.42432 ? 238 U  A "O5'" 1 
ATOM   2904 C  "C5'" . U  A 1 136 ? 79.29000 77.27000 125.62800 1.000 219.11400 ? 238 U  A "C5'" 1 
ATOM   2905 C  "C4'" . U  A 1 136 ? 79.04000 75.95800 126.33600 1.000 227.86505 ? 238 U  A "C4'" 1 
ATOM   2906 O  "O4'" . U  A 1 136 ? 79.82100 75.90100 127.55600 1.000 236.32133 ? 238 U  A "O4'" 1 
ATOM   2907 C  "C3'" . U  A 1 136 ? 77.61100 75.69200 126.79000 1.000 230.75750 ? 238 U  A "C3'" 1 
ATOM   2908 O  "O3'" . U  A 1 136 ? 76.80000 75.17800 125.74400 1.000 227.23076 ? 238 U  A "O3'" 1 
ATOM   2909 C  "C2'" . U  A 1 136 ? 77.79300 74.70800 127.94300 1.000 238.90058 ? 238 U  A "C2'" 1 
ATOM   2910 O  "O2'" . U  A 1 136 ? 77.93600 73.38400 127.45000 1.000 240.15073 ? 238 U  A "O2'" 1 
ATOM   2911 C  "C1'" . U  A 1 136 ? 79.13400 75.15800 128.53800 1.000 242.14571 ? 238 U  A "C1'" 1 
ATOM   2912 N  N1    . U  A 1 136 ? 78.98600 75.99900 129.75200 1.000 247.22263 ? 238 U  A N1    1 
ATOM   2913 C  C2    . U  A 1 136 ? 78.62000 75.40000 130.94900 1.000 249.29657 ? 238 U  A C2    1 
ATOM   2914 O  O2    . U  A 1 136 ? 78.38400 74.20800 131.05900 1.000 247.93061 ? 238 U  A O2    1 
ATOM   2915 N  N3    . U  A 1 136 ? 78.52500 76.25600 132.02400 1.000 256.88695 ? 238 U  A N3    1 
ATOM   2916 C  C4    . U  A 1 136 ? 78.76300 77.61700 132.03200 1.000 257.19225 ? 238 U  A C4    1 
ATOM   2917 O  O4    . U  A 1 136 ? 78.63700 78.25600 133.07900 1.000 259.89257 ? 238 U  A O4    1 
ATOM   2918 C  C5    . U  A 1 136 ? 79.14700 78.15700 130.76300 1.000 251.65737 ? 238 U  A C5    1 
ATOM   2919 C  C6    . U  A 1 136 ? 79.24900 77.34800 129.70200 1.000 245.85668 ? 238 U  A C6    1 
ATOM   2920 P  P     . U  A 1 137 ? 75.21500 75.45000 125.71500 1.000 245.27010 ? 239 U  A P     1 
ATOM   2921 O  OP1   . U  A 1 137 ? 74.90100 76.51600 126.69800 1.000 241.78021 ? 239 U  A OP1   1 
ATOM   2922 O  OP2   . U  A 1 137 ? 74.51100 74.14500 125.79800 1.000 243.74097 ? 239 U  A OP2   1 
ATOM   2923 O  "O5'" . U  A 1 137 ? 74.97400 76.03900 124.25600 1.000 227.01001 ? 239 U  A "O5'" 1 
ATOM   2924 C  "C5'" . U  A 1 137 ? 75.94400 76.88700 123.66100 1.000 217.92208 ? 239 U  A "C5'" 1 
ATOM   2925 C  "C4'" . U  A 1 137 ? 75.54400 78.33700 123.75700 1.000 212.18718 ? 239 U  A "C4'" 1 
ATOM   2926 O  "O4'" . U  A 1 137 ? 76.72700 79.16600 123.82700 1.000 207.93667 ? 239 U  A "O4'" 1 
ATOM   2927 C  "C3'" . U  A 1 137 ? 74.76300 78.88500 122.57400 1.000 201.46748 ? 239 U  A "C3'" 1 
ATOM   2928 O  "O3'" . U  A 1 137 ? 73.38000 78.59300 122.67500 1.000 204.22833 ? 239 U  A "O3'" 1 
ATOM   2929 C  "C2'" . U  A 1 137 ? 75.07800 80.37600 122.61400 1.000 195.74311 ? 239 U  A "C2'" 1 
ATOM   2930 O  "O2'" . U  A 1 137 ? 74.23500 81.03800 123.54700 1.000 196.92746 ? 239 U  A "O2'" 1 
ATOM   2931 C  "C1'" . U  A 1 137 ? 76.51200 80.38500 123.15500 1.000 197.43805 ? 239 U  A "C1'" 1 
ATOM   2932 N  N1    . U  A 1 137 ? 77.54200 80.50500 122.09900 1.000 190.23981 ? 239 U  A N1    1 
ATOM   2933 C  C2    . U  A 1 137 ? 77.75800 81.73500 121.50100 1.000 184.64704 ? 239 U  A C2    1 
ATOM   2934 O  O2    . U  A 1 137 ? 77.11800 82.73700 121.78200 1.000 183.00474 ? 239 U  A O2    1 
ATOM   2935 N  N3    . U  A 1 137 ? 78.75200 81.74100 120.54700 1.000 181.04398 ? 239 U  A N3    1 
ATOM   2936 C  C4    . U  A 1 137 ? 79.53600 80.67100 120.15000 1.000 177.09613 ? 239 U  A C4    1 
ATOM   2937 O  O4    . U  A 1 137 ? 80.39300 80.82300 119.27700 1.000 168.35561 ? 239 U  A O4    1 
ATOM   2938 C  C5    . U  A 1 137 ? 79.25800 79.44400 120.82700 1.000 184.91023 ? 239 U  A C5    1 
ATOM   2939 C  C6    . U  A 1 137 ? 78.30100 79.40700 121.75800 1.000 191.82685 ? 239 U  A C6    1 
ATOM   2940 P  P     . C  A 1 138 ? 72.51900 78.27000 121.36100 1.000 210.63776 ? 240 C  A P     1 
ATOM   2941 O  OP1   . C  A 1 138 ? 71.52600 77.22100 121.71300 1.000 209.07968 ? 240 C  A OP1   1 
ATOM   2942 O  OP2   . C  A 1 138 ? 73.46100 78.05300 120.23000 1.000 190.24584 ? 240 C  A OP2   1 
ATOM   2943 O  "O5'" . C  A 1 138 ? 71.72300 79.62300 121.10600 1.000 199.36273 ? 240 C  A "O5'" 1 
ATOM   2944 C  "C5'" . C  A 1 138 ? 71.36100 80.01100 119.79400 1.000 187.03230 ? 240 C  A "C5'" 1 
ATOM   2945 C  "C4'" . C  A 1 138 ? 71.75900 81.43600 119.51600 1.000 178.58392 ? 240 C  A "C4'" 1 
ATOM   2946 O  "O4'" . C  A 1 138 ? 73.10800 81.67400 119.99700 1.000 179.51035 ? 240 C  A "O4'" 1 
ATOM   2947 C  "C3'" . C  A 1 138 ? 71.81100 81.82600 118.05000 1.000 172.22789 ? 240 C  A "C3'" 1 
ATOM   2948 O  "O3'" . C  A 1 138 ? 70.53500 82.13500 117.52300 1.000 168.94855 ? 240 C  A "O3'" 1 
ATOM   2949 C  "C2'" . C  A 1 138 ? 72.78400 82.99700 118.05000 1.000 171.83837 ? 240 C  A "C2'" 1 
ATOM   2950 O  "O2'" . C  A 1 138 ? 72.14100 84.18700 118.48800 1.000 173.44909 ? 240 C  A "O2'" 1 
ATOM   2951 C  "C1'" . C  A 1 138 ? 73.78400 82.55400 119.12300 1.000 177.33114 ? 240 C  A "C1'" 1 
ATOM   2952 N  N1    . C  A 1 138 ? 74.95000 81.83600 118.55300 1.000 174.76241 ? 240 C  A N1    1 
ATOM   2953 C  C2    . C  A 1 138 ? 75.90400 82.53800 117.80100 1.000 168.56956 ? 240 C  A C2    1 
ATOM   2954 O  O2    . C  A 1 138 ? 75.76200 83.75600 117.61000 1.000 164.92439 ? 240 C  A O2    1 
ATOM   2955 N  N3    . C  A 1 138 ? 76.96400 81.87000 117.29100 1.000 165.96399 ? 240 C  A N3    1 
ATOM   2956 C  C4    . C  A 1 138 ? 77.09500 80.56000 117.51200 1.000 167.35889 ? 240 C  A C4    1 
ATOM   2957 N  N4    . C  A 1 138 ? 78.15700 79.94000 116.99200 1.000 166.54037 ? 240 C  A N4    1 
ATOM   2958 C  C5    . C  A 1 138 ? 76.14500 79.81900 118.27600 1.000 177.52063 ? 240 C  A C5    1 
ATOM   2959 C  C6    . C  A 1 138 ? 75.10100 80.49200 118.77300 1.000 175.70463 ? 240 C  A C6    1 
ATOM   2960 P  P     . U  A 1 139 ? 70.01700 81.38900 116.20100 1.000 171.66887 ? 241 U  A P     1 
ATOM   2961 O  OP1   . U  A 1 139 ? 68.55500 81.61200 116.08400 1.000 164.99965 ? 241 U  A OP1   1 
ATOM   2962 O  OP2   . U  A 1 139 ? 70.54500 80.00200 116.22100 1.000 159.26212 ? 241 U  A OP2   1 
ATOM   2963 O  "O5'" . U  A 1 139 ? 70.72800 82.18900 115.02400 1.000 169.13962 ? 241 U  A "O5'" 1 
ATOM   2964 C  "C5'" . U  A 1 139 ? 70.59000 83.59900 114.93600 1.000 166.28665 ? 241 U  A "C5'" 1 
ATOM   2965 C  "C4'" . U  A 1 139 ? 71.63400 84.21200 114.03800 1.000 159.80692 ? 241 U  A "C4'" 1 
ATOM   2966 O  "O4'" . U  A 1 139 ? 72.93900 84.14200 114.66800 1.000 160.23855 ? 241 U  A "O4'" 1 
ATOM   2967 C  "C3'" . U  A 1 139 ? 71.84600 83.53900 112.69400 1.000 160.73335 ? 241 U  A "C3'" 1 
ATOM   2968 O  "O3'" . U  A 1 139 ? 70.85000 83.86600 111.74100 1.000 161.72820 ? 241 U  A "O3'" 1 
ATOM   2969 C  "C2'" . U  A 1 139 ? 73.24300 84.00700 112.31400 1.000 162.20984 ? 241 U  A "C2'" 1 
ATOM   2970 O  "O2'" . U  A 1 139 ? 73.21100 85.33900 111.82100 1.000 167.05779 ? 241 U  A "O2'" 1 
ATOM   2971 C  "C1'" . U  A 1 139 ? 73.94000 84.00600 113.67700 1.000 159.74112 ? 241 U  A "C1'" 1 
ATOM   2972 N  N1    . U  A 1 139 ? 74.69000 82.74900 113.90600 1.000 160.07274 ? 241 U  A N1    1 
ATOM   2973 C  C2    . U  A 1 139 ? 75.93500 82.65600 113.31000 1.000 159.60690 ? 241 U  A C2    1 
ATOM   2974 O  O2    . U  A 1 139 ? 76.42400 83.55100 112.64200 1.000 158.28832 ? 241 U  A O2    1 
ATOM   2975 N  N3    . U  A 1 139 ? 76.60300 81.47900 113.53200 1.000 157.78036 ? 241 U  A N3    1 
ATOM   2976 C  C4    . U  A 1 139 ? 76.15600 80.40100 114.26900 1.000 160.90969 ? 241 U  A C4    1 
ATOM   2977 O  O4    . U  A 1 139 ? 76.87700 79.40600 114.37500 1.000 163.74424 ? 241 U  A O4    1 
ATOM   2978 C  C5    . U  A 1 139 ? 74.85600 80.57100 114.84800 1.000 160.69913 ? 241 U  A C5    1 
ATOM   2979 C  C6    . U  A 1 139 ? 74.18200 81.71000 114.65000 1.000 161.73084 ? 241 U  A C6    1 
ATOM   2980 P  P     . G  A 1 140 ? 70.46700 82.81900 110.58400 1.000 153.88959 ? 242 G  A P     1 
ATOM   2981 O  OP1   . G  A 1 140 ? 69.22300 83.30100 109.93400 1.000 151.40245 ? 242 G  A OP1   1 
ATOM   2982 O  OP2   . G  A 1 140 ? 70.49100 81.45200 111.16500 1.000 152.93684 ? 242 G  A OP2   1 
ATOM   2983 O  "O5'" . G  A 1 140 ? 71.66400 82.95000 109.53900 1.000 150.55761 ? 242 G  A "O5'" 1 
ATOM   2984 C  "C5'" . G  A 1 140 ? 71.98100 84.20700 108.95700 1.000 154.66336 ? 242 G  A "C5'" 1 
ATOM   2985 C  "C4'" . G  A 1 140 ? 73.33100 84.19400 108.28200 1.000 155.04762 ? 242 G  A "C4'" 1 
ATOM   2986 O  "O4'" . G  A 1 140 ? 74.38100 83.98700 109.26100 1.000 150.28126 ? 242 G  A "O4'" 1 
ATOM   2987 C  "C3'" . G  A 1 140 ? 73.55800 83.09200 107.26300 1.000 152.81577 ? 242 G  A "C3'" 1 
ATOM   2988 O  "O3'" . G  A 1 140 ? 72.97300 83.37900 106.00400 1.000 151.53931 ? 242 G  A "O3'" 1 
ATOM   2989 C  "C2'" . G  A 1 140 ? 75.07700 82.98400 107.22000 1.000 151.49720 ? 242 G  A "C2'" 1 
ATOM   2990 O  "O2'" . G  A 1 140 ? 75.63900 84.01000 106.41500 1.000 156.93206 ? 242 G  A "O2'" 1 
ATOM   2991 C  "C1'" . G  A 1 140 ? 75.44100 83.25500 108.68100 1.000 149.13112 ? 242 G  A "C1'" 1 
ATOM   2992 N  N9    . G  A 1 140 ? 75.63200 82.00800 109.44400 1.000 150.56024 ? 242 G  A N9    1 
ATOM   2993 C  C8    . G  A 1 140 ? 74.79100 81.47100 110.38800 1.000 153.82116 ? 242 G  A C8    1 
ATOM   2994 N  N7    . G  A 1 140 ? 75.23400 80.35500 110.89800 1.000 153.21319 ? 242 G  A N7    1 
ATOM   2995 C  C5    . G  A 1 140 ? 76.44300 80.14000 110.25200 1.000 154.06592 ? 242 G  A C5    1 
ATOM   2996 C  C6    . G  A 1 140 ? 77.38300 79.08700 110.39100 1.000 154.45281 ? 242 G  A C6    1 
ATOM   2997 O  O6    . G  A 1 140 ? 77.33300 78.09800 111.13200 1.000 156.06353 ? 242 G  A O6    1 
ATOM   2998 N  N1    . G  A 1 140 ? 78.47200 79.26200 109.54300 1.000 151.23401 ? 242 G  A N1    1 
ATOM   2999 C  C2    . G  A 1 140 ? 78.64000 80.31300 108.67400 1.000 153.26846 ? 242 G  A C2    1 
ATOM   3000 N  N2    . G  A 1 140 ? 79.76300 80.30600 107.93800 1.000 154.84760 ? 242 G  A N2    1 
ATOM   3001 N  N3    . G  A 1 140 ? 77.77100 81.30000 108.53800 1.000 153.89222 ? 242 G  A N3    1 
ATOM   3002 C  C4    . G  A 1 140 ? 76.70400 81.15200 109.35100 1.000 152.85525 ? 242 G  A C4    1 
ATOM   3003 P  P     . U  A 1 141 ? 72.35500 82.20000 105.10800 1.000 154.23082 ? 243 U  A P     1 
ATOM   3004 O  OP1   . U  A 1 141 ? 71.46100 82.82300 104.09900 1.000 157.12590 ? 243 U  A OP1   1 
ATOM   3005 O  OP2   . U  A 1 141 ? 71.82200 81.15400 106.01500 1.000 155.24410 ? 243 U  A OP2   1 
ATOM   3006 O  "O5'" . U  A 1 141 ? 73.61800 81.59000 104.35400 1.000 145.96141 ? 243 U  A "O5'" 1 
ATOM   3007 C  "C5'" . U  A 1 141 ? 74.37400 82.37900 103.44800 1.000 144.44017 ? 243 U  A "C5'" 1 
ATOM   3008 C  "C4'" . U  A 1 141 ? 75.64200 81.67800 103.03300 1.000 143.85852 ? 243 U  A "C4'" 1 
ATOM   3009 O  "O4'" . U  A 1 141 ? 76.53000 81.56100 104.17500 1.000 144.80337 ? 243 U  A "O4'" 1 
ATOM   3010 C  "C3'" . U  A 1 141 ? 75.47900 80.24700 102.54400 1.000 142.17411 ? 243 U  A "C3'" 1 
ATOM   3011 O  "O3'" . U  A 1 141 ? 75.06500 80.17200 101.19100 1.000 147.27472 ? 243 U  A "O3'" 1 
ATOM   3012 C  "C2'" . U  A 1 141 ? 76.85800 79.65500 102.79600 1.000 141.52666 ? 243 U  A "C2'" 1 
ATOM   3013 O  "O2'" . U  A 1 141 ? 77.76700 80.05500 101.78000 1.000 143.82431 ? 243 U  A "O2'" 1 
ATOM   3014 C  "C1'" . U  A 1 141 ? 77.24700 80.34600 104.10500 1.000 144.16909 ? 243 U  A "C1'" 1 
ATOM   3015 N  N1    . U  A 1 141 ? 76.90400 79.52400 105.29000 1.000 144.15066 ? 243 U  A N1    1 
ATOM   3016 C  C2    . U  A 1 141 ? 77.76400 78.49800 105.63900 1.000 143.34267 ? 243 U  A C2    1 
ATOM   3017 O  O2    . U  A 1 141 ? 78.78800 78.24500 105.02700 1.000 141.93987 ? 243 U  A O2    1 
ATOM   3018 N  N3    . U  A 1 141 ? 77.38500 77.77600 106.74300 1.000 144.83759 ? 243 U  A N3    1 
ATOM   3019 C  C4    . U  A 1 141 ? 76.25700 77.96900 107.51900 1.000 146.40356 ? 243 U  A C4    1 
ATOM   3020 O  O4    . U  A 1 141 ? 76.04900 77.23300 108.48700 1.000 149.09599 ? 243 U  A O4    1 
ATOM   3021 C  C5    . U  A 1 141 ? 75.41700 79.04800 107.09200 1.000 147.09838 ? 243 U  A C5    1 
ATOM   3022 C  C6    . U  A 1 141 ? 75.76300 79.76700 106.01900 1.000 147.80900 ? 243 U  A C6    1 
ATOM   3023 P  P     . U  A 1 142 ? 73.96800 79.09500 100.71300 1.000 136.28204 ? 244 U  A P     1 
ATOM   3024 O  OP1   . U  A 1 142 ? 73.68200 79.48000 99.31400  1.000 136.26888 ? 244 U  A OP1   1 
ATOM   3025 O  OP2   . U  A 1 142 ? 72.84100 79.02800 101.68000 1.000 135.82935 ? 244 U  A OP2   1 
ATOM   3026 O  "O5'" . U  A 1 142 ? 74.75800 77.70200 100.70300 1.000 131.08668 ? 244 U  A "O5'" 1 
ATOM   3027 C  "C5'" . U  A 1 142 ? 75.84900 77.52700 99.81300  1.000 128.41794 ? 244 U  A "C5'" 1 
ATOM   3028 C  "C4'" . U  A 1 142 ? 76.82400 76.48700 100.31900 1.000 129.90759 ? 244 U  A "C4'" 1 
ATOM   3029 O  "O4'" . U  A 1 142 ? 77.26600 76.78100 101.66800 1.000 133.45275 ? 244 U  A "O4'" 1 
ATOM   3030 C  "C3'" . U  A 1 142 ? 76.26200 75.09000 100.43200 1.000 127.72838 ? 244 U  A "C3'" 1 
ATOM   3031 O  "O3'" . U  A 1 142 ? 76.18800 74.49600 99.15600  1.000 128.78377 ? 244 U  A "O3'" 1 
ATOM   3032 C  "C2'" . U  A 1 142 ? 77.28300 74.44000 101.34700 1.000 128.20212 ? 244 U  A "C2'" 1 
ATOM   3033 O  "O2'" . U  A 1 142 ? 78.43000 73.95200 100.67600 1.000 126.49402 ? 244 U  A "O2'" 1 
ATOM   3034 C  "C1'" . U  A 1 142 ? 77.58900 75.57300 102.34200 1.000 131.37092 ? 244 U  A "C1'" 1 
ATOM   3035 N  N1    . U  A 1 142 ? 76.79400 75.45900 103.64300 1.000 134.13441 ? 244 U  A N1    1 
ATOM   3036 C  C2    . U  A 1 142 ? 76.99900 74.37100 104.48900 1.000 134.73712 ? 244 U  A C2    1 
ATOM   3037 O  O2    . U  A 1 142 ? 77.81100 73.48300 104.28900 1.000 133.10797 ? 244 U  A O2    1 
ATOM   3038 N  N3    . U  A 1 142 ? 76.16100 74.32500 105.57700 1.000 134.61342 ? 244 U  A N3    1 
ATOM   3039 C  C4    . U  A 1 142 ? 75.17500 75.23700 105.91400 1.000 137.03739 ? 244 U  A C4    1 
ATOM   3040 O  O4    . U  A 1 142 ? 74.52000 75.07100 106.93400 1.000 138.45072 ? 244 U  A O4    1 
ATOM   3041 C  C5    . U  A 1 142 ? 75.00500 76.33100 104.99200 1.000 136.97686 ? 244 U  A C5    1 
ATOM   3042 C  C6    . U  A 1 142 ? 75.81000 76.40100 103.92600 1.000 136.19256 ? 244 U  A C6    1 
ATOM   3043 P  P     . G  A 1 143 ? 74.87800 73.65400 98.75000  1.000 133.10024 ? 245 G  A P     1 
ATOM   3044 O  OP1   . G  A 1 143 ? 74.86000 73.51200 97.27000  1.000 136.02427 ? 245 G  A OP1   1 
ATOM   3045 O  OP2   . G  A 1 143 ? 73.68900 74.25900 99.42100  1.000 130.76048 ? 245 G  A OP2   1 
ATOM   3046 O  "O5'" . G  A 1 143 ? 75.19200 72.20900 99.39100  1.000 121.83573 ? 245 G  A "O5'" 1 
ATOM   3047 C  "C5'" . G  A 1 143 ? 76.38700 71.50300 99.01200  1.000 120.37503 ? 245 G  A "C5'" 1 
ATOM   3048 C  "C4'" . G  A 1 143 ? 76.85300 70.50200 100.05500 1.000 122.43054 ? 245 G  A "C4'" 1 
ATOM   3049 O  "O4'" . G  A 1 143 ? 77.06700 71.14200 101.34700 1.000 127.02846 ? 245 G  A "O4'" 1 
ATOM   3050 C  "C3'" . G  A 1 143 ? 75.82200 69.44500 100.38600 1.000 121.96733 ? 245 G  A "C3'" 1 
ATOM   3051 O  "O3'" . G  A 1 143 ? 75.64000 68.48800 99.36100  1.000 119.25384 ? 245 G  A "O3'" 1 
ATOM   3052 C  "C2'" . G  A 1 143 ? 76.24300 68.93900 101.76300 1.000 127.48114 ? 245 G  A "C2'" 1 
ATOM   3053 O  "O2'" . G  A 1 143 ? 77.23100 67.92400 101.75100 1.000 133.34764 ? 245 G  A "O2'" 1 
ATOM   3054 C  "C1'" . G  A 1 143 ? 76.75400 70.23700 102.40600 1.000 126.43628 ? 245 G  A "C1'" 1 
ATOM   3055 N  N9    . G  A 1 143 ? 75.82500 70.85500 103.37700 1.000 130.36307 ? 245 G  A N9    1 
ATOM   3056 C  C8    . G  A 1 143 ? 75.11800 72.03800 103.26000 1.000 131.00262 ? 245 G  A C8    1 
ATOM   3057 N  N7    . G  A 1 143 ? 74.37700 72.33400 104.29800 1.000 126.92581 ? 245 G  A N7    1 
ATOM   3058 C  C5    . G  A 1 143 ? 74.58200 71.27100 105.16400 1.000 125.73093 ? 245 G  A C5    1 
ATOM   3059 C  C6    . G  A 1 143 ? 74.03800 71.01800 106.45200 1.000 128.26808 ? 245 G  A C6    1 
ATOM   3060 O  O6    . G  A 1 143 ? 73.24000 71.71100 107.10200 1.000 127.74697 ? 245 G  A O6    1 
ATOM   3061 N  N1    . G  A 1 143 ? 74.50700 69.81500 106.99300 1.000 130.25779 ? 245 G  A N1    1 
ATOM   3062 C  C2    . G  A 1 143 ? 75.38200 68.95800 106.35900 1.000 128.46547 ? 245 G  A C2    1 
ATOM   3063 N  N2    . G  A 1 143 ? 75.72200 67.84200 107.01900 1.000 130.43413 ? 245 G  A N2    1 
ATOM   3064 N  N3    . G  A 1 143 ? 75.88900 69.18200 105.15100 1.000 127.24691 ? 245 G  A N3    1 
ATOM   3065 C  C4    . G  A 1 143 ? 75.45900 70.35400 104.61200 1.000 126.89423 ? 245 G  A C4    1 
ATOM   3066 P  P     . A  A 1 144 ? 74.15500 67.98200 99.01500  1.000 120.13543 ? 246 A  A P     1 
ATOM   3067 O  OP1   . A  A 1 144 ? 74.19500 67.24800 97.72500  1.000 125.85190 ? 246 A  A OP1   1 
ATOM   3068 O  OP2   . A  A 1 144 ? 73.23000 69.13500 99.17600  1.000 117.58775 ? 246 A  A OP2   1 
ATOM   3069 O  "O5'" . A  A 1 144 ? 73.83500 66.93100 100.16700 1.000 118.03781 ? 246 A  A "O5'" 1 
ATOM   3070 C  "C5'" . A  A 1 144 ? 74.63500 65.77100 100.33500 1.000 118.37469 ? 246 A  A "C5'" 1 
ATOM   3071 C  "C4'" . A  A 1 144 ? 74.38800 65.12000 101.67100 1.000 120.28018 ? 246 A  A "C4'" 1 
ATOM   3072 O  "O4'" . A  A 1 144 ? 74.73600 66.03900 102.73800 1.000 122.70416 ? 246 A  A "O4'" 1 
ATOM   3073 C  "C3'" . A  A 1 144 ? 72.94900 64.73700 101.97200 1.000 113.73466 ? 246 A  A "C3'" 1 
ATOM   3074 O  "O3'" . A  A 1 144 ? 72.55900 63.52300 101.35300 1.000 114.65319 ? 246 A  A "O3'" 1 
ATOM   3075 C  "C2'" . A  A 1 144 ? 72.93200 64.69100 103.49500 1.000 113.89521 ? 246 A  A "C2'" 1 
ATOM   3076 O  "O2'" . A  A 1 144 ? 73.52200 63.48900 103.96700 1.000 113.95837 ? 246 A  A "O2'" 1 
ATOM   3077 C  "C1'" . A  A 1 144 ? 73.87000 65.85000 103.83700 1.000 120.60391 ? 246 A  A "C1'" 1 
ATOM   3078 N  N9    . A  A 1 144 ? 73.13500 67.10600 104.07500 1.000 121.37768 ? 246 A  A N9    1 
ATOM   3079 C  C8    . A  A 1 144 ? 72.99800 68.18500 103.23900 1.000 117.66408 ? 246 A  A C8    1 
ATOM   3080 N  N7    . A  A 1 144 ? 72.27600 69.15600 103.74300 1.000 116.72186 ? 246 A  A N7    1 
ATOM   3081 C  C5    . A  A 1 144 ? 71.91400 68.68300 104.99600 1.000 118.91686 ? 246 A  A C5    1 
ATOM   3082 C  C6    . A  A 1 144 ? 71.14300 69.24000 106.03400 1.000 115.24010 ? 246 A  A C6    1 
ATOM   3083 N  N6    . A  A 1 144 ? 70.57300 70.44700 105.97400 1.000 110.32899 ? 246 A  A N6    1 
ATOM   3084 N  N1    . A  A 1 144 ? 70.97500 68.50600 107.15700 1.000 120.71444 ? 246 A  A N1    1 
ATOM   3085 C  C2    . A  A 1 144 ? 71.54700 67.29500 107.22300 1.000 119.50641 ? 246 A  A C2    1 
ATOM   3086 N  N3    . A  A 1 144 ? 72.29000 66.66600 106.31300 1.000 116.98242 ? 246 A  A N3    1 
ATOM   3087 C  C4    . A  A 1 144 ? 72.43700 67.42200 105.21200 1.000 120.56706 ? 246 A  A C4    1 
ATOM   3088 P  P     . U  A 1 145 ? 71.09100 63.38500 100.71600 1.000 111.43247 ? 247 U  A P     1 
ATOM   3089 O  OP1   . U  A 1 145 ? 71.00900 62.06800 100.03700 1.000 112.14308 ? 247 U  A OP1   1 
ATOM   3090 O  OP2   . U  A 1 145 ? 70.77600 64.62700 99.96200  1.000 99.63105  ? 247 U  A OP2   1 
ATOM   3091 O  "O5'" . U  A 1 145 ? 70.13800 63.30900 101.98800 1.000 117.53846 ? 247 U  A "O5'" 1 
ATOM   3092 C  "C5'" . U  A 1 145 ? 70.20700 62.20300 102.87300 1.000 115.70666 ? 247 U  A "C5'" 1 
ATOM   3093 C  "C4'" . U  A 1 145 ? 69.46200 62.47000 104.15500 1.000 113.47219 ? 247 U  A "C4'" 1 
ATOM   3094 O  "O4'" . U  A 1 145 ? 70.02100 63.63600 104.81400 1.000 113.32480 ? 247 U  A "O4'" 1 
ATOM   3095 C  "C3'" . U  A 1 145 ? 67.98400 62.80200 104.01900 1.000 110.17179 ? 247 U  A "C3'" 1 
ATOM   3096 O  "O3'" . U  A 1 145 ? 67.17200 61.65500 103.82700 1.000 108.11102 ? 247 U  A "O3'" 1 
ATOM   3097 C  "C2'" . U  A 1 145 ? 67.69900 63.54400 105.31800 1.000 116.74363 ? 247 U  A "C2'" 1 
ATOM   3098 O  "O2'" . U  A 1 145 ? 67.55700 62.63000 106.39500 1.000 119.28867 ? 247 U  A "O2'" 1 
ATOM   3099 C  "C1'" . U  A 1 145 ? 69.00200 64.32600 105.50900 1.000 112.45891 ? 247 U  A "C1'" 1 
ATOM   3100 N  N1    . U  A 1 145 ? 68.89900 65.70700 104.98400 1.000 108.00311 ? 247 U  A N1    1 
ATOM   3101 C  C2    . U  A 1 145 ? 68.40600 66.65400 105.85500 1.000 112.89054 ? 247 U  A C2    1 
ATOM   3102 O  O2    . U  A 1 145 ? 68.08200 66.38100 106.99600 1.000 121.12574 ? 247 U  A O2    1 
ATOM   3103 N  N3    . U  A 1 145 ? 68.31100 67.92600 105.35500 1.000 110.43761 ? 247 U  A N3    1 
ATOM   3104 C  C4    . U  A 1 145 ? 68.65300 68.33800 104.08700 1.000 109.24273 ? 247 U  A C4    1 
ATOM   3105 O  O4    . U  A 1 145 ? 68.51300 69.52200 103.78200 1.000 106.61873 ? 247 U  A O4    1 
ATOM   3106 C  C5    . U  A 1 145 ? 69.15400 67.30300 103.23600 1.000 111.97201 ? 247 U  A C5    1 
ATOM   3107 C  C6    . U  A 1 145 ? 69.25700 66.05300 103.70100 1.000 108.11891 ? 247 U  A C6    1 
ATOM   3108 P  P     . A  A 1 146 ? 65.96800 61.67500 102.76200 1.000 104.88323 ? 248 A  A P     1 
ATOM   3109 O  OP1   . A  A 1 146 ? 65.79700 60.29500 102.24100 1.000 105.66754 ? 248 A  A OP1   1 
ATOM   3110 O  OP2   . A  A 1 146 ? 66.17500 62.81300 101.83700 1.000 107.73094 ? 248 A  A OP2   1 
ATOM   3111 O  "O5'" . A  A 1 146 ? 64.68100 61.98300 103.64100 1.000 115.23184 ? 248 A  A "O5'" 1 
ATOM   3112 C  "C5'" . A  A 1 146 ? 64.17700 60.99500 104.53100 1.000 113.45532 ? 248 A  A "C5'" 1 
ATOM   3113 C  "C4'" . A  A 1 146 ? 63.00100 61.49100 105.33000 1.000 106.17286 ? 248 A  A "C4'" 1 
ATOM   3114 O  "O4'" . A  A 1 146 ? 63.00900 62.94800 105.37700 1.000 101.07752 ? 248 A  A "O4'" 1 
ATOM   3115 C  "C3'" . A  A 1 146 ? 61.61800 61.09500 104.80100 1.000 106.56502 ? 248 A  A "C3'" 1 
ATOM   3116 O  "O3'" . A  A 1 146 ? 60.76200 60.85600 105.91500 1.000 117.00837 ? 248 A  A "O3'" 1 
ATOM   3117 C  "C2'" . A  A 1 146 ? 61.15500 62.36500 104.09600 1.000 108.62842 ? 248 A  A "C2'" 1 
ATOM   3118 O  "O2'" . A  A 1 146 ? 59.75500 62.48800 103.95400 1.000 109.34956 ? 248 A  A "O2'" 1 
ATOM   3119 C  "C1'" . A  A 1 146 ? 61.72800 63.42300 105.02400 1.000 102.20660 ? 248 A  A "C1'" 1 
ATOM   3120 N  N9    . A  A 1 146 ? 61.82300 64.77300 104.46500 1.000 98.69565  ? 248 A  A N9    1 
ATOM   3121 C  C8    . A  A 1 146 ? 62.42300 65.21500 103.31400 1.000 107.39669 ? 248 A  A C8    1 
ATOM   3122 N  N7    . A  A 1 146 ? 62.29800 66.51100 103.13600 1.000 109.06268 ? 248 A  A N7    1 
ATOM   3123 C  C5    . A  A 1 146 ? 61.56600 66.93900 104.23500 1.000 106.86242 ? 248 A  A C5    1 
ATOM   3124 C  C6    . A  A 1 146 ? 61.09800 68.19900 104.64300 1.000 109.95490 ? 248 A  A C6    1 
ATOM   3125 N  N6    . A  A 1 146 ? 61.30800 69.32200 103.95600 1.000 112.58679 ? 248 A  A N6    1 
ATOM   3126 N  N1    . A  A 1 146 ? 60.39900 68.26900 105.80000 1.000 105.75176 ? 248 A  A N1    1 
ATOM   3127 C  C2    . A  A 1 146 ? 60.18700 67.14300 106.49600 1.000 107.41249 ? 248 A  A C2    1 
ATOM   3128 N  N3    . A  A 1 146 ? 60.57600 65.90200 106.21300 1.000 107.78885 ? 248 A  A N3    1 
ATOM   3129 C  C4    . A  A 1 146 ? 61.26700 65.87600 105.05900 1.000 106.62818 ? 248 A  A C4    1 
ATOM   3130 P  P     . U  A 1 147 ? 59.98700 59.46000 106.06800 1.000 131.87947 ? 249 U  A P     1 
ATOM   3131 O  OP1   . U  A 1 147 ? 60.70700 58.63800 107.07300 1.000 127.63160 ? 249 U  A OP1   1 
ATOM   3132 O  OP2   . U  A 1 147 ? 59.74200 58.91100 104.70800 1.000 125.50239 ? 249 U  A OP2   1 
ATOM   3133 O  "O5'" . U  A 1 147 ? 58.59200 59.88700 106.70600 1.000 125.64188 ? 249 U  A "O5'" 1 
ATOM   3134 C  "C5'" . U  A 1 147 ? 58.38500 59.81700 108.10800 1.000 128.80016 ? 249 U  A "C5'" 1 
ATOM   3135 C  "C4'" . U  A 1 147 ? 58.03500 61.16400 108.69400 1.000 124.99444 ? 249 U  A "C4'" 1 
ATOM   3136 O  "O4'" . U  A 1 147 ? 59.17600 61.72100 109.38300 1.000 120.65708 ? 249 U  A "O4'" 1 
ATOM   3137 C  "C3'" . U  A 1 147 ? 57.61700 62.25500 107.72000 1.000 127.02363 ? 249 U  A "C3'" 1 
ATOM   3138 O  "O3'" . U  A 1 147 ? 56.25300 62.13600 107.34200 1.000 125.37080 ? 249 U  A "O3'" 1 
ATOM   3139 C  "C2'" . U  A 1 147 ? 57.91300 63.54600 108.49300 1.000 125.07866 ? 249 U  A "C2'" 1 
ATOM   3140 O  "O2'" . U  A 1 147 ? 56.80200 63.91600 109.29700 1.000 123.48899 ? 249 U  A "O2'" 1 
ATOM   3141 C  "C1'" . U  A 1 147 ? 59.06900 63.12500 109.41600 1.000 126.17616 ? 249 U  A "C1'" 1 
ATOM   3142 N  N1    . U  A 1 147 ? 60.38200 63.74700 109.09800 1.000 123.74429 ? 249 U  A N1    1 
ATOM   3143 C  C2    . U  A 1 147 ? 60.54100 65.11300 109.32200 1.000 121.57298 ? 249 U  A C2    1 
ATOM   3144 O  O2    . U  A 1 147 ? 59.64800 65.84200 109.72500 1.000 124.62071 ? 249 U  A O2    1 
ATOM   3145 N  N3    . U  A 1 147 ? 61.78800 65.61500 109.03500 1.000 118.88055 ? 249 U  A N3    1 
ATOM   3146 C  C4    . U  A 1 147 ? 62.88000 64.90900 108.57100 1.000 117.43301 ? 249 U  A C4    1 
ATOM   3147 O  O4    . U  A 1 147 ? 63.94500 65.49600 108.35700 1.000 115.55383 ? 249 U  A O4    1 
ATOM   3148 C  C5    . U  A 1 147 ? 62.64500 63.50700 108.39000 1.000 115.06956 ? 249 U  A C5    1 
ATOM   3149 C  C6    . U  A 1 147 ? 61.44200 62.98300 108.65600 1.000 117.43827 ? 249 U  A C6    1 
ATOM   3150 P  P     . G  A 1 148 ? 55.74900 62.60300 105.88600 1.000 117.51603 ? 250 G  A P     1 
ATOM   3151 O  OP1   . G  A 1 148 ? 54.26700 62.52800 105.87600 1.000 124.54319 ? 250 G  A OP1   1 
ATOM   3152 O  OP2   . G  A 1 148 ? 56.51500 61.86600 104.84900 1.000 126.77503 ? 250 G  A OP2   1 
ATOM   3153 O  "O5'" . G  A 1 148 ? 56.14500 64.14300 105.80700 1.000 112.21276 ? 250 G  A "O5'" 1 
ATOM   3154 C  "C5'" . G  A 1 148 ? 55.39600 65.12700 106.50500 1.000 114.40513 ? 250 G  A "C5'" 1 
ATOM   3155 C  "C4'" . G  A 1 148 ? 55.39300 66.43500 105.75800 1.000 107.04899 ? 250 G  A "C4'" 1 
ATOM   3156 O  "O4'" . G  A 1 148 ? 56.76200 66.85800 105.52100 1.000 101.96680 ? 250 G  A "O4'" 1 
ATOM   3157 C  "C3'" . G  A 1 148 ? 54.76400 66.38800 104.37500 1.000 100.96931 ? 250 G  A "C3'" 1 
ATOM   3158 O  "O3'" . G  A 1 148 ? 53.35300 66.53700 104.41200 1.000 101.90100 ? 250 G  A "O3'" 1 
ATOM   3159 C  "C2'" . G  A 1 148 ? 55.48400 67.50800 103.63600 1.000 106.08308 ? 250 G  A "C2'" 1 
ATOM   3160 O  "O2'" . G  A 1 148 ? 54.94800 68.77200 103.99100 1.000 104.86978 ? 250 G  A "O2'" 1 
ATOM   3161 C  "C1'" . G  A 1 148 ? 56.88800 67.40000 104.22700 1.000 105.40142 ? 250 G  A "C1'" 1 
ATOM   3162 N  N9    . G  A 1 148 ? 57.75300 66.49300 103.44900 1.000 110.81259 ? 250 G  A N9    1 
ATOM   3163 C  C8    . G  A 1 148 ? 58.20500 65.26800 103.87700 1.000 106.01465 ? 250 G  A C8    1 
ATOM   3164 N  N7    . G  A 1 148 ? 58.96300 64.66000 103.00900 1.000 103.37749 ? 250 G  A N7    1 
ATOM   3165 C  C5    . G  A 1 148 ? 59.01800 65.54100 101.94000 1.000 105.10928 ? 250 G  A C5    1 
ATOM   3166 C  C6    . G  A 1 148 ? 59.69500 65.42100 100.70400 1.000 105.31983 ? 250 G  A C6    1 
ATOM   3167 O  O6    . G  A 1 148 ? 60.39900 64.48800 100.30200 1.000 102.62214 ? 250 G  A O6    1 
ATOM   3168 N  N1    . G  A 1 148 ? 59.48800 66.53900 99.90200  1.000 106.82264 ? 250 G  A N1    1 
ATOM   3169 C  C2    . G  A 1 148 ? 58.73200 67.63300 100.24300 1.000 105.85937 ? 250 G  A C2    1 
ATOM   3170 N  N2    . G  A 1 148 ? 58.65700 68.61300 99.33100  1.000 105.45406 ? 250 G  A N2    1 
ATOM   3171 N  N3    . G  A 1 148 ? 58.09500 67.75700 101.39600 1.000 108.07016 ? 250 G  A N3    1 
ATOM   3172 C  C4    . G  A 1 148 ? 58.28000 66.68100 102.19200 1.000 109.88617 ? 250 G  A C4    1 
ATOM   3173 P  P     . G  A 1 149 ? 52.43800 65.89900 103.25600 1.000 114.49543 ? 251 G  A P     1 
ATOM   3174 O  OP1   . G  A 1 149 ? 51.01300 66.02000 103.65200 1.000 113.55848 ? 251 G  A OP1   1 
ATOM   3175 O  OP2   . G  A 1 149 ? 52.99000 64.56400 102.91900 1.000 113.59533 ? 251 G  A OP2   1 
ATOM   3176 O  "O5'" . G  A 1 149 ? 52.67000 66.87300 102.02200 1.000 110.14491 ? 251 G  A "O5'" 1 
ATOM   3177 C  "C5'" . G  A 1 149 ? 52.45800 66.43300 100.69400 1.000 106.21286 ? 251 G  A "C5'" 1 
ATOM   3178 C  "C4'" . G  A 1 149 ? 53.28600 67.23400 99.72700  1.000 100.12266 ? 251 G  A "C4'" 1 
ATOM   3179 O  "O4'" . G  A 1 149 ? 54.68900 67.14600 100.09200 1.000 114.59281 ? 251 G  A "O4'" 1 
ATOM   3180 C  "C3'" . G  A 1 149 ? 53.25300 66.75400 98.28800  1.000 95.30629  ? 251 G  A "C3'" 1 
ATOM   3181 O  "O3'" . G  A 1 149 ? 52.09900 67.18300 97.59700  1.000 103.03880 ? 251 G  A "O3'" 1 
ATOM   3182 C  "C2'" . G  A 1 149 ? 54.55800 67.30000 97.72800  1.000 100.56745 ? 251 G  A "C2'" 1 
ATOM   3183 O  "O2'" . G  A 1 149 ? 54.44400 68.69100 97.45700  1.000 103.92048 ? 251 G  A "O2'" 1 
ATOM   3184 C  "C1'" . G  A 1 149 ? 55.48900 67.12500 98.92700  1.000 110.84236 ? 251 G  A "C1'" 1 
ATOM   3185 N  N9    . G  A 1 149 ? 56.23300 65.84900 98.89400  1.000 108.23152 ? 251 G  A N9    1 
ATOM   3186 C  C8    . G  A 1 149 ? 56.20200 64.87000 99.85800  1.000 106.44184 ? 251 G  A C8    1 
ATOM   3187 N  N7    . G  A 1 149 ? 56.96000 63.84900 99.57600  1.000 105.11536 ? 251 G  A N7    1 
ATOM   3188 C  C5    . G  A 1 149 ? 57.52900 64.17100 98.35200  1.000 106.29971 ? 251 G  A C5    1 
ATOM   3189 C  C6    . G  A 1 149 ? 58.44000 63.44000 97.54600  1.000 106.46815 ? 251 G  A C6    1 
ATOM   3190 O  O6    . G  A 1 149 ? 58.93700 62.32700 97.76500  1.000 106.52869 ? 251 G  A O6    1 
ATOM   3191 N  N1    . G  A 1 149 ? 58.76000 64.13200 96.38200  1.000 102.39135 ? 251 G  A N1    1 
ATOM   3192 C  C2    . G  A 1 149 ? 58.26800 65.36700 96.03900  1.000 102.98879 ? 251 G  A C2    1 
ATOM   3193 N  N2    . G  A 1 149 ? 58.69100 65.87400 94.87200  1.000 97.92503  ? 251 G  A N2    1 
ATOM   3194 N  N3    . G  A 1 149 ? 57.41800 66.05500 96.78300  1.000 107.13666 ? 251 G  A N3    1 
ATOM   3195 C  C4    . G  A 1 149 ? 57.09300 65.40400 97.91800  1.000 106.52079 ? 251 G  A C4    1 
ATOM   3196 P  P     . A  A 1 150 ? 51.11100 66.09200 96.96000  1.000 105.69679 ? 252 A  A P     1 
ATOM   3197 O  OP1   . A  A 1 150 ? 49.74100 66.66200 96.94200  1.000 106.18895 ? 252 A  A OP1   1 
ATOM   3198 O  OP2   . A  A 1 150 ? 51.35600 64.79700 97.64600  1.000 102.70169 ? 252 A  A OP2   1 
ATOM   3199 O  "O5'" . A  A 1 150 ? 51.62500 65.97200 95.45900  1.000 106.63111 ? 252 A  A "O5'" 1 
ATOM   3200 C  "C5'" . A  A 1 150 ? 51.88400 67.14000 94.69300  1.000 102.33586 ? 252 A  A "C5'" 1 
ATOM   3201 C  "C4'" . A  A 1 150 ? 52.92900 66.90100 93.63400  1.000 99.07494  ? 252 A  A "C4'" 1 
ATOM   3202 O  "O4'" . A  A 1 150 ? 54.22400 66.68200 94.25100  1.000 99.77239  ? 252 A  A "O4'" 1 
ATOM   3203 C  "C3'" . A  A 1 150 ? 52.73100 65.67400 92.76400  1.000 103.59917 ? 252 A  A "C3'" 1 
ATOM   3204 O  "O3'" . A  A 1 150 ? 51.76700 65.86900 91.74300  1.000 107.32856 ? 252 A  A "O3'" 1 
ATOM   3205 C  "C2'" . A  A 1 150 ? 54.13800 65.41100 92.24900  1.000 105.54151 ? 252 A  A "C2'" 1 
ATOM   3206 O  "O2'" . A  A 1 150 ? 54.46000 66.32000 91.20800  1.000 110.70792 ? 252 A  A "O2'" 1 
ATOM   3207 C  "C1'" . A  A 1 150 ? 54.97500 65.77300 93.47500  1.000 100.03295 ? 252 A  A "C1'" 1 
ATOM   3208 N  N9    . A  A 1 150 ? 55.27700 64.58900 94.30000  1.000 104.71509 ? 252 A  A N9    1 
ATOM   3209 C  C8    . A  A 1 150 ? 54.72900 64.23400 95.50700  1.000 112.56866 ? 252 A  A C8    1 
ATOM   3210 N  N7    . A  A 1 150 ? 55.20000 63.11300 95.99600  1.000 111.17902 ? 252 A  A N7    1 
ATOM   3211 C  C5    . A  A 1 150 ? 56.12200 62.69900 95.04600  1.000 104.65982 ? 252 A  A C5    1 
ATOM   3212 C  C6    . A  A 1 150 ? 56.96700 61.57400 94.97900  1.000 108.47344 ? 252 A  A C6    1 
ATOM   3213 N  N6    . A  A 1 150 ? 57.02100 60.62500 95.92000  1.000 116.42702 ? 252 A  A N6    1 
ATOM   3214 N  N1    . A  A 1 150 ? 57.76900 61.45300 93.89800  1.000 107.66281 ? 252 A  A N1    1 
ATOM   3215 C  C2    . A  A 1 150 ? 57.71700 62.40600 92.96100  1.000 108.17603 ? 252 A  A C2    1 
ATOM   3216 N  N3    . A  A 1 150 ? 56.96700 63.50500 92.91500  1.000 106.89430 ? 252 A  A N3    1 
ATOM   3217 C  C4    . A  A 1 150 ? 56.17900 63.59800 93.99800  1.000 103.09648 ? 252 A  A C4    1 
ATOM   3218 P  P     . U  A 1 151 ? 50.76200 64.67900 91.35200  1.000 106.89962 ? 253 U  A P     1 
ATOM   3219 O  OP1   . U  A 1 151 ? 49.79000 65.22000 90.36700  1.000 117.41667 ? 253 U  A OP1   1 
ATOM   3220 O  OP2   . U  A 1 151 ? 50.27400 64.05500 92.61000  1.000 103.40709 ? 253 U  A OP2   1 
ATOM   3221 O  "O5'" . U  A 1 151 ? 51.69500 63.62200 90.60800  1.000 114.09522 ? 253 U  A "O5'" 1 
ATOM   3222 C  "C5'" . U  A 1 151 ? 52.42600 63.98600 89.44700  1.000 111.17908 ? 253 U  A "C5'" 1 
ATOM   3223 C  "C4'" . U  A 1 151 ? 53.52000 62.99300 89.14300  1.000 110.37898 ? 253 U  A "C4'" 1 
ATOM   3224 O  "O4'" . U  A 1 151 ? 54.43200 62.90100 90.26700  1.000 105.76790 ? 253 U  A "O4'" 1 
ATOM   3225 C  "C3'" . U  A 1 151 ? 53.08600 61.55600 88.90500  1.000 116.66921 ? 253 U  A "C3'" 1 
ATOM   3226 O  "O3'" . U  A 1 151 ? 52.58400 61.34600 87.59700  1.000 118.59313 ? 253 U  A "O3'" 1 
ATOM   3227 C  "C2'" . U  A 1 151 ? 54.35900 60.77500 89.20000  1.000 119.73537 ? 253 U  A "C2'" 1 
ATOM   3228 O  "O2'" . U  A 1 151 ? 55.24300 60.83200 88.08800  1.000 117.51142 ? 253 U  A "O2'" 1 
ATOM   3229 C  "C1'" . U  A 1 151 ? 54.96200 61.59300 90.34700  1.000 109.30517 ? 253 U  A "C1'" 1 
ATOM   3230 N  N1    . U  A 1 151 ? 54.64200 61.02700 91.67900  1.000 114.05048 ? 253 U  A N1    1 
ATOM   3231 C  C2    . U  A 1 151 ? 55.37400 59.92900 92.09900  1.000 117.29560 ? 253 U  A C2    1 
ATOM   3232 O  O2    . U  A 1 151 ? 56.25100 59.41400 91.42400  1.000 119.68273 ? 253 U  A O2    1 
ATOM   3233 N  N3    . U  A 1 151 ? 55.04300 59.44500 93.34000  1.000 124.95705 ? 253 U  A N3    1 
ATOM   3234 C  C4    . U  A 1 151 ? 54.07500 59.94800 94.18400  1.000 125.45711 ? 253 U  A C4    1 
ATOM   3235 O  O4    . U  A 1 151 ? 53.89300 59.40600 95.27300  1.000 128.81277 ? 253 U  A O4    1 
ATOM   3236 C  C5    . U  A 1 151 ? 53.36200 61.08600 93.68500  1.000 121.42241 ? 253 U  A C5    1 
ATOM   3237 C  C6    . U  A 1 151 ? 53.66700 61.57700 92.48000  1.000 118.91685 ? 253 U  A C6    1 
ATOM   3238 P  P     . G  A 1 152 ? 51.17500 60.60800 87.38000  1.000 122.16905 ? 254 G  A P     1 
ATOM   3239 O  OP1   . G  A 1 152 ? 50.15000 61.34600 88.16000  1.000 124.65619 ? 254 G  A OP1   1 
ATOM   3240 O  OP2   . G  A 1 152 ? 51.36500 59.15700 87.62600  1.000 121.42685 ? 254 G  A OP2   1 
ATOM   3241 O  "O5'" . G  A 1 152 ? 50.87100 60.82600 85.83100  1.000 113.36010 ? 254 G  A "O5'" 1 
ATOM   3242 C  "C5'" . G  A 1 152 ? 50.40200 62.08000 85.35300  1.000 113.85226 ? 254 G  A "C5'" 1 
ATOM   3243 C  "C4'" . G  A 1 152 ? 50.89400 62.37700 83.95600  1.000 116.61048 ? 254 G  A "C4'" 1 
ATOM   3244 O  "O4'" . G  A 1 152 ? 52.25700 62.87300 83.99600  1.000 114.13387 ? 254 G  A "O4'" 1 
ATOM   3245 C  "C3'" . G  A 1 152 ? 50.95900 61.19600 83.00100  1.000 118.10014 ? 254 G  A "C3'" 1 
ATOM   3246 O  "O3'" . G  A 1 152 ? 49.69800 60.86900 82.44300  1.000 125.55103 ? 254 G  A "O3'" 1 
ATOM   3247 C  "C2'" . G  A 1 152 ? 51.97800 61.66400 81.97100  1.000 116.22886 ? 254 G  A "C2'" 1 
ATOM   3248 O  "O2'" . G  A 1 152 ? 51.38600 62.57200 81.05400  1.000 117.54481 ? 254 G  A "O2'" 1 
ATOM   3249 C  "C1'" . G  A 1 152 ? 52.96100 62.43600 82.85100  1.000 113.78383 ? 254 G  A "C1'" 1 
ATOM   3250 N  N9    . G  A 1 152 ? 54.07900 61.58600 83.29000  1.000 110.85190 ? 254 G  A N9    1 
ATOM   3251 C  C8    . G  A 1 152 ? 54.39400 61.23500 84.57900  1.000 117.12107 ? 254 G  A C8    1 
ATOM   3252 N  N7    . G  A 1 152 ? 55.44500 60.46600 84.65300  1.000 112.78371 ? 254 G  A N7    1 
ATOM   3253 C  C5    . G  A 1 152 ? 55.84100 60.29700 83.33400  1.000 111.11246 ? 254 G  A C5    1 
ATOM   3254 C  C6    . G  A 1 152 ? 56.92400 59.55900 82.79100  1.000 113.81278 ? 254 G  A C6    1 
ATOM   3255 O  O6    . G  A 1 152 ? 57.77000 58.88600 83.39400  1.000 113.10743 ? 254 G  A O6    1 
ATOM   3256 N  N1    . G  A 1 152 ? 56.96400 59.66000 81.40200  1.000 113.27851 ? 254 G  A N1    1 
ATOM   3257 C  C2    . G  A 1 152 ? 56.07700 60.37800 80.63600  1.000 115.34454 ? 254 G  A C2    1 
ATOM   3258 N  N2    . G  A 1 152 ? 56.27700 60.35700 79.30900  1.000 115.16557 ? 254 G  A N2    1 
ATOM   3259 N  N3    . G  A 1 152 ? 55.06400 61.06600 81.13400  1.000 120.26092 ? 254 G  A N3    1 
ATOM   3260 C  C4    . G  A 1 152 ? 55.00700 60.98200 82.47900  1.000 113.55749 ? 254 G  A C4    1 
ATOM   3261 P  P     . C  A 1 153 ? 49.29300 59.33700 82.17400  1.000 125.13864 ? 255 C  A P     1 
ATOM   3262 O  OP1   . C  A 1 153 ? 47.92600 59.34200 81.59600  1.000 124.69648 ? 255 C  A OP1   1 
ATOM   3263 O  OP2   . C  A 1 153 ? 49.56900 58.53700 83.39500  1.000 123.19893 ? 255 C  A OP2   1 
ATOM   3264 O  "O5'" . C  A 1 153 ? 50.29500 58.86600 81.02800  1.000 123.09629 ? 255 C  A "O5'" 1 
ATOM   3265 C  "C5'" . C  A 1 153 ? 50.23600 59.44000 79.73100  1.000 127.27574 ? 255 C  A "C5'" 1 
ATOM   3266 C  "C4'" . C  A 1 153 ? 51.28100 58.85900 78.81200  1.000 125.62817 ? 255 C  A "C4'" 1 
ATOM   3267 O  "O4'" . C  A 1 153 ? 52.60700 59.27000 79.23900  1.000 129.71550 ? 255 C  A "O4'" 1 
ATOM   3268 C  "C3'" . C  A 1 153 ? 51.37200 57.34400 78.76400  1.000 129.46284 ? 255 C  A "C3'" 1 
ATOM   3269 O  "O3'" . C  A 1 153 ? 50.36000 56.74700 77.97300  1.000 131.89471 ? 255 C  A "O3'" 1 
ATOM   3270 C  "C2'" . C  A 1 153 ? 52.78400 57.12600 78.23800  1.000 136.27681 ? 255 C  A "C2'" 1 
ATOM   3271 O  "O2'" . C  A 1 153 ? 52.84200 57.37700 76.84200  1.000 139.55879 ? 255 C  A "O2'" 1 
ATOM   3272 C  "C1'" . C  A 1 153 ? 53.53900 58.24400 78.95900  1.000 130.31294 ? 255 C  A "C1'" 1 
ATOM   3273 N  N1    . C  A 1 153 ? 54.12100 57.76700 80.23500  1.000 120.33806 ? 255 C  A N1    1 
ATOM   3274 C  C2    . C  A 1 153 ? 55.28200 56.99000 80.19800  1.000 122.48569 ? 255 C  A C2    1 
ATOM   3275 O  O2    . C  A 1 153 ? 55.80000 56.73500 79.10300  1.000 127.10729 ? 255 C  A O2    1 
ATOM   3276 N  N3    . C  A 1 153 ? 55.81700 56.53500 81.35100  1.000 123.69373 ? 255 C  A N3    1 
ATOM   3277 C  C4    . C  A 1 153 ? 55.23100 56.82900 82.51200  1.000 121.16184 ? 255 C  A C4    1 
ATOM   3278 N  N4    . C  A 1 153 ? 55.79500 56.36300 83.62600  1.000 118.67997 ? 255 C  A N4    1 
ATOM   3279 C  C5    . C  A 1 153 ? 54.04600 57.61500 82.58600  1.000 122.69361 ? 255 C  A C5    1 
ATOM   3280 C  C6    . C  A 1 153 ? 53.53100 58.05700 81.43300  1.000 122.55938 ? 255 C  A C6    1 
ATOM   3281 P  P     . A  A 1 154 ? 49.59400 55.43800 78.50000  1.000 140.57603 ? 256 A  A P     1 
ATOM   3282 O  OP1   . A  A 1 154 ? 48.50800 55.14600 77.53400  1.000 134.76217 ? 256 A  A OP1   1 
ATOM   3283 O  OP2   . A  A 1 154 ? 49.27900 55.61300 79.94200  1.000 127.39813 ? 256 A  A OP2   1 
ATOM   3284 O  "O5'" . A  A 1 154 ? 50.68700 54.28600 78.37400  1.000 139.13638 ? 256 A  A "O5'" 1 
ATOM   3285 C  "C5'" . A  A 1 154 ? 51.37500 54.06000 77.15000  1.000 131.00646 ? 256 A  A "C5'" 1 
ATOM   3286 C  "C4'" . A  A 1 154 ? 52.62500 53.24300 77.36100  1.000 131.65390 ? 256 A  A "C4'" 1 
ATOM   3287 O  "O4'" . A  A 1 154 ? 53.59300 54.00400 78.13100  1.000 132.93827 ? 256 A  A "O4'" 1 
ATOM   3288 C  "C3'" . A  A 1 154 ? 52.44300 51.96300 78.15700  1.000 139.65750 ? 256 A  A "C3'" 1 
ATOM   3289 O  "O3'" . A  A 1 154 ? 51.93700 50.90100 77.37100  1.000 139.02584 ? 256 A  A "O3'" 1 
ATOM   3290 C  "C2'" . A  A 1 154 ? 53.83800 51.71700 78.71500  1.000 142.04462 ? 256 A  A "C2'" 1 
ATOM   3291 O  "O2'" . A  A 1 154 ? 54.69200 51.17200 77.71800  1.000 137.14140 ? 256 A  A "O2'" 1 
ATOM   3292 C  "C1'" . A  A 1 154 ? 54.29000 53.14700 79.01200  1.000 138.31523 ? 256 A  A "C1'" 1 
ATOM   3293 N  N9    . A  A 1 154 ? 53.96600 53.54200 80.39600  1.000 133.51465 ? 256 A  A N9    1 
ATOM   3294 C  C8    . A  A 1 154 ? 53.05400 54.48200 80.79800  1.000 133.50676 ? 256 A  A C8    1 
ATOM   3295 N  N7    . A  A 1 154 ? 52.97100 54.61000 82.09600  1.000 142.62101 ? 256 A  A N7    1 
ATOM   3296 C  C5    . A  A 1 154 ? 53.88700 53.68700 82.57900  1.000 140.35758 ? 256 A  A C5    1 
ATOM   3297 C  C6    . A  A 1 154 ? 54.27300 53.33500 83.88700  1.000 146.26092 ? 256 A  A C6    1 
ATOM   3298 N  N6    . A  A 1 154 ? 53.76600 53.89400 84.99300  1.000 148.00587 ? 256 A  A N6    1 
ATOM   3299 N  N1    . A  A 1 154 ? 55.21400 52.37400 84.02800  1.000 151.17993 ? 256 A  A N1    1 
ATOM   3300 C  C2    . A  A 1 154 ? 55.72500 51.81300 82.92400  1.000 142.85525 ? 256 A  A C2    1 
ATOM   3301 N  N3    . A  A 1 154 ? 55.44400 52.06300 81.64800  1.000 134.67269 ? 256 A  A N3    1 
ATOM   3302 C  C4    . A  A 1 154 ? 54.50800 53.02000 81.54200  1.000 134.45687 ? 256 A  A C4    1 
ATOM   3303 P  P     . G  A 1 155 ? 50.49000 50.28400 77.69000  1.000 148.61669 ? 257 G  A P     1 
ATOM   3304 O  OP1   . G  A 1 155 ? 50.05800 49.50800 76.49900  1.000 149.68787 ? 257 G  A OP1   1 
ATOM   3305 O  OP2   . G  A 1 155 ? 49.62300 51.37600 78.20400  1.000 149.40626 ? 257 G  A OP2   1 
ATOM   3306 O  "O5'" . G  A 1 155 ? 50.77300 49.26800 78.88400  1.000 150.86170 ? 257 G  A "O5'" 1 
ATOM   3307 C  "C5'" . G  A 1 155 ? 51.91800 48.42700 78.86100  1.000 154.02524 ? 257 G  A "C5'" 1 
ATOM   3308 C  "C4'" . G  A 1 155 ? 52.44500 48.16400 80.24900  1.000 155.31223 ? 257 G  A "C4'" 1 
ATOM   3309 O  "O4'" . G  A 1 155 ? 52.94300 49.39900 80.83300  1.000 151.70917 ? 257 G  A "O4'" 1 
ATOM   3310 C  "C3'" . G  A 1 155 ? 51.42200 47.67500 81.25900  1.000 165.68453 ? 257 G  A "C3'" 1 
ATOM   3311 O  "O3'" . G  A 1 155 ? 51.11500 46.29800 81.13200  1.000 168.68752 ? 257 G  A "O3'" 1 
ATOM   3312 C  "C2'" . G  A 1 155 ? 52.06200 48.06100 82.58400  1.000 167.20313 ? 257 G  A "C2'" 1 
ATOM   3313 O  "O2'" . G  A 1 155 ? 53.10800 47.16100 82.92300  1.000 175.04618 ? 257 G  A "O2'" 1 
ATOM   3314 C  "C1'" . G  A 1 155 ? 52.68300 49.41000 82.22300  1.000 156.73872 ? 257 G  A "C1'" 1 
ATOM   3315 N  N9    . G  A 1 155 ? 51.75800 50.52300 82.51700  1.000 155.48331 ? 257 G  A N9    1 
ATOM   3316 C  C8    . G  A 1 155 ? 51.11700 51.34200 81.61600  1.000 151.66969 ? 257 G  A C8    1 
ATOM   3317 N  N7    . G  A 1 155 ? 50.34800 52.23000 82.18900  1.000 155.49383 ? 257 G  A N7    1 
ATOM   3318 C  C5    . G  A 1 155 ? 50.48600 51.98400 83.54700  1.000 159.19428 ? 257 G  A C5    1 
ATOM   3319 C  C6    . G  A 1 155 ? 49.89200 52.63400 84.66000  1.000 162.57363 ? 257 G  A C6    1 
ATOM   3320 O  O6    . G  A 1 155 ? 49.10000 53.58500 84.66600  1.000 162.32886 ? 257 G  A O6    1 
ATOM   3321 N  N1    . G  A 1 155 ? 50.30500 52.06400 85.85900  1.000 169.10336 ? 257 G  A N1    1 
ATOM   3322 C  C2    . G  A 1 155 ? 51.17700 51.00800 85.97700  1.000 170.02189 ? 257 G  A C2    1 
ATOM   3323 N  N2    . G  A 1 155 ? 51.46200 50.59500 87.22300  1.000 175.62256 ? 257 G  A N2    1 
ATOM   3324 N  N3    . G  A 1 155 ? 51.73500 50.39800 84.94500  1.000 164.94497 ? 257 G  A N3    1 
ATOM   3325 C  C4    . G  A 1 155 ? 51.35000 50.93200 83.76600  1.000 160.17071 ? 257 G  A C4    1 
ATOM   3326 P  P     . U  A 1 156 ? 49.58700 45.83400 80.95700  1.000 173.13680 ? 258 U  A P     1 
ATOM   3327 O  OP1   . U  A 1 156 ? 49.57700 44.63100 80.09300  1.000 160.81427 ? 258 U  A OP1   1 
ATOM   3328 O  OP2   . U  A 1 156 ? 48.76500 47.00700 80.56900  1.000 165.54116 ? 258 U  A OP2   1 
ATOM   3329 O  "O5'" . U  A 1 156 ? 49.16000 45.38800 82.42400  1.000 175.98451 ? 258 U  A "O5'" 1 
ATOM   3330 C  "C5'" . U  A 1 156 ? 49.76900 44.26100 83.03800  1.000 178.17162 ? 258 U  A "C5'" 1 
ATOM   3331 C  "C4'" . U  A 1 156 ? 49.50400 44.21100 84.52200  1.000 183.16169 ? 258 U  A "C4'" 1 
ATOM   3332 O  "O4'" . U  A 1 156 ? 50.08000 45.37700 85.16800  1.000 180.99827 ? 258 U  A "O4'" 1 
ATOM   3333 C  "C3'" . U  A 1 156 ? 48.04700 44.24300 84.95300  1.000 188.58076 ? 258 U  A "C3'" 1 
ATOM   3334 O  "O3'" . U  A 1 156 ? 47.39100 42.99400 84.81100  1.000 191.57586 ? 258 U  A "O3'" 1 
ATOM   3335 C  "C2'" . U  A 1 156 ? 48.14500 44.73300 86.39300  1.000 189.38875 ? 258 U  A "C2'" 1 
ATOM   3336 O  "O2'" . U  A 1 156 ? 48.53300 43.67800 87.26300  1.000 194.15774 ? 258 U  A "O2'" 1 
ATOM   3337 C  "C1'" . U  A 1 156 ? 49.29900 45.73500 86.29200  1.000 185.53829 ? 258 U  A "C1'" 1 
ATOM   3338 N  N1    . U  A 1 156 ? 48.80900 47.12500 86.12800  1.000 183.07220 ? 258 U  A N1    1 
ATOM   3339 C  C2    . U  A 1 156 ? 48.31200 47.75800 87.25800  1.000 185.54355 ? 258 U  A C2    1 
ATOM   3340 O  O2    . U  A 1 156 ? 48.27100 47.23400 88.35900  1.000 188.79131 ? 258 U  A O2    1 
ATOM   3341 N  N3    . U  A 1 156 ? 47.86100 49.03900 87.05800  1.000 181.58518 ? 258 U  A N3    1 
ATOM   3342 C  C4    . U  A 1 156 ? 47.85300 49.74100 85.86900  1.000 173.64739 ? 258 U  A C4    1 
ATOM   3343 O  O4    . U  A 1 156 ? 47.41300 50.89400 85.84600  1.000 170.07328 ? 258 U  A O4    1 
ATOM   3344 C  C5    . U  A 1 156 ? 48.38100 49.01900 84.74900  1.000 171.34975 ? 258 U  A C5    1 
ATOM   3345 C  C6    . U  A 1 156 ? 48.82600 47.76700 84.91000  1.000 175.91345 ? 258 U  A C6    1 
ATOM   3346 P  P     . U  A 1 157 ? 45.82400 42.93700 84.44300  1.000 193.77892 ? 259 U  A P     1 
ATOM   3347 O  OP1   . U  A 1 157 ? 45.40400 41.51500 84.39500  1.000 195.94234 ? 259 U  A OP1   1 
ATOM   3348 O  OP2   . U  A 1 157 ? 45.59400 43.78500 83.24600  1.000 188.05718 ? 259 U  A OP2   1 
ATOM   3349 O  "O5'" . U  A 1 157 ? 45.10400 43.62200 85.69100  1.000 195.86338 ? 259 U  A "O5'" 1 
ATOM   3350 C  "C5'" . U  A 1 157 ? 45.15100 43.02300 86.97900  1.000 193.02094 ? 259 U  A "C5'" 1 
ATOM   3351 C  "C4'" . U  A 1 157 ? 44.22000 43.70400 87.95200  1.000 193.96842 ? 259 U  A "C4'" 1 
ATOM   3352 O  "O4'" . U  A 1 157 ? 44.72200 45.02300 88.29100  1.000 192.34454 ? 259 U  A "O4'" 1 
ATOM   3353 C  "C3'" . U  A 1 157 ? 42.80900 43.97000 87.45800  1.000 191.66025 ? 259 U  A "C3'" 1 
ATOM   3354 O  "O3'" . U  A 1 157 ? 41.98300 42.81600 87.47100  1.000 194.65798 ? 259 U  A "O3'" 1 
ATOM   3355 C  "C2'" . U  A 1 157 ? 42.34300 45.08700 88.38400  1.000 191.90501 ? 259 U  A "C2'" 1 
ATOM   3356 O  "O2'" . U  A 1 157 ? 41.95000 44.56900 89.64900  1.000 193.66838 ? 259 U  A "O2'" 1 
ATOM   3357 C  "C1'" . U  A 1 157 ? 43.63700 45.89000 88.56600  1.000 191.16019 ? 259 U  A "C1'" 1 
ATOM   3358 N  N1    . U  A 1 157 ? 43.70100 47.06300 87.66100  1.000 186.76492 ? 259 U  A N1    1 
ATOM   3359 C  C2    . U  A 1 157 ? 43.03200 48.20400 88.06900  1.000 181.96961 ? 259 U  A C2    1 
ATOM   3360 O  O2    . U  A 1 157 ? 42.42000 48.27000 89.12100  1.000 181.89855 ? 259 U  A O2    1 
ATOM   3361 N  N3    . U  A 1 157 ? 43.10400 49.27000 87.20500  1.000 177.35590 ? 259 U  A N3    1 
ATOM   3362 C  C4    . U  A 1 157 ? 43.76800 49.31400 85.99500  1.000 176.66635 ? 259 U  A C4    1 
ATOM   3363 O  O4    . U  A 1 157 ? 43.74700 50.35200 85.32500  1.000 177.05323 ? 259 U  A O4    1 
ATOM   3364 C  C5    . U  A 1 157 ? 44.43400 48.09300 85.64200  1.000 176.97954 ? 259 U  A C5    1 
ATOM   3365 C  C6    . U  A 1 157 ? 44.37900 47.03600 86.46300  1.000 183.44347 ? 259 U  A C6    1 
ATOM   3366 P  P     . C  A 1 158 ? 40.84100 42.63200 86.35500  1.000 197.95198 ? 260 C  A P     1 
ATOM   3367 O  OP1   . C  A 1 158 ? 40.49300 41.19300 86.25400  1.000 194.85951 ? 260 C  A OP1   1 
ATOM   3368 O  OP2   . C  A 1 158 ? 41.27800 43.35200 85.13300  1.000 191.11169 ? 260 C  A OP2   1 
ATOM   3369 O  "O5'" . C  A 1 158 ? 39.59300 43.40400 86.97100  1.000 196.39917 ? 260 C  A "O5'" 1 
ATOM   3370 C  "C5'" . C  A 1 158 ? 39.20000 43.18800 88.32000  1.000 197.28085 ? 260 C  A "C5'" 1 
ATOM   3371 C  "C4'" . C  A 1 158 ? 38.23700 44.24600 88.79600  1.000 194.81477 ? 260 C  A "C4'" 1 
ATOM   3372 O  "O4'" . C  A 1 158 ? 38.90800 45.53300 88.84700  1.000 192.17761 ? 260 C  A "O4'" 1 
ATOM   3373 C  "C3'" . C  A 1 158 ? 37.03100 44.49400 87.90400  1.000 189.03776 ? 260 C  A "C3'" 1 
ATOM   3374 O  "O3'" . C  A 1 158 ? 35.99700 43.54300 88.09200  1.000 191.09063 ? 260 C  A "O3'" 1 
ATOM   3375 C  "C2'" . C  A 1 158 ? 36.63300 45.91600 88.27200  1.000 182.10008 ? 260 C  A "C2'" 1 
ATOM   3376 O  "O2'" . C  A 1 158 ? 35.90800 45.93000 89.49400  1.000 178.61282 ? 260 C  A "O2'" 1 
ATOM   3377 C  "C1'" . C  A 1 158 ? 38.00000 46.56400 88.50800  1.000 183.96610 ? 260 C  A "C1'" 1 
ATOM   3378 N  N1    . C  A 1 158 ? 38.50500 47.27700 87.30600  1.000 177.47584 ? 260 C  A N1    1 
ATOM   3379 C  C2    . C  A 1 158 ? 37.99700 48.54600 86.97800  1.000 168.21158 ? 260 C  A C2    1 
ATOM   3380 O  O2    . C  A 1 158 ? 37.13000 49.05800 87.70400  1.000 163.28993 ? 260 C  A O2    1 
ATOM   3381 N  N3    . C  A 1 158 ? 38.46200 49.19500 85.87900  1.000 165.26385 ? 260 C  A N3    1 
ATOM   3382 C  C4    . C  A 1 158 ? 39.39600 48.63200 85.10800  1.000 164.99277 ? 260 C  A C4    1 
ATOM   3383 N  N4    . C  A 1 158 ? 39.82800 49.30600 84.03300  1.000 158.44198 ? 260 C  A N4    1 
ATOM   3384 C  C5    . C  A 1 158 ? 39.93000 47.34600 85.41800  1.000 176.38624 ? 260 C  A C5    1 
ATOM   3385 C  C6    . C  A 1 158 ? 39.46500 46.71500 86.50700  1.000 181.38421 ? 260 C  A C6    1 
ATOM   3386 O  OP3   . G  B 1 1   ? 48.26700 51.29300 62.64500  1.000 166.54802 ? 103 G  B OP3   1 
ATOM   3387 P  P     . G  B 1 1   ? 48.52100 50.16600 63.57200  1.000 179.24691 ? 103 G  B P     1 
ATOM   3388 O  OP1   . G  B 1 1   ? 48.34900 50.67400 64.95500  1.000 161.76586 ? 103 G  B OP1   1 
ATOM   3389 O  OP2   . G  B 1 1   ? 47.67900 49.03200 63.12300  1.000 159.86827 ? 103 G  B OP2   1 
ATOM   3390 O  "O5'" . G  B 1 1   ? 50.03900 49.70600 63.41700  1.000 168.86408 ? 103 G  B "O5'" 1 
ATOM   3391 C  "C5'" . G  B 1 1   ? 51.02200 50.59800 62.91100  1.000 154.60185 ? 103 G  B "C5'" 1 
ATOM   3392 C  "C4'" . G  B 1 1   ? 51.19500 50.44900 61.42000  1.000 154.40446 ? 103 G  B "C4'" 1 
ATOM   3393 O  "O4'" . G  B 1 1   ? 51.43600 51.75000 60.81900  1.000 147.44309 ? 103 G  B "O4'" 1 
ATOM   3394 C  "C3'" . G  B 1 1   ? 52.37800 49.61500 60.95200  1.000 150.63558 ? 103 G  B "C3'" 1 
ATOM   3395 O  "O3'" . G  B 1 1   ? 52.17300 48.21400 61.03900  1.000 154.65975 ? 103 G  B "O3'" 1 
ATOM   3396 C  "C2'" . G  B 1 1   ? 52.58300 50.11800 59.53000  1.000 142.79254 ? 103 G  B "C2'" 1 
ATOM   3397 O  "O2'" . G  B 1 1   ? 51.60900 49.56500 58.65800  1.000 136.39440 ? 103 G  B "O2'" 1 
ATOM   3398 C  "C1'" . G  B 1 1   ? 52.28800 51.60800 59.69900  1.000 142.20826 ? 103 G  B "C1'" 1 
ATOM   3399 N  N9    . G  B 1 1   ? 53.52700 52.37700 59.92700  1.000 140.13169 ? 103 G  B N9    1 
ATOM   3400 C  C8    . G  B 1 1   ? 53.94000 53.01100 61.07400  1.000 136.14964 ? 103 G  B C8    1 
ATOM   3401 N  N7    . G  B 1 1   ? 55.10100 53.59700 60.94600  1.000 135.57588 ? 103 G  B N7    1 
ATOM   3402 C  C5    . G  B 1 1   ? 55.47800 53.32700 59.63800  1.000 134.20467 ? 103 G  B C5    1 
ATOM   3403 C  C6    . G  B 1 1   ? 56.64500 53.70200 58.92500  1.000 133.58880 ? 103 G  B C6    1 
ATOM   3404 O  O6    . G  B 1 1   ? 57.61100 54.36800 59.32200  1.000 136.25491 ? 103 G  B O6    1 
ATOM   3405 N  N1    . G  B 1 1   ? 56.62000 53.21500 57.61900  1.000 134.28889 ? 103 G  B N1    1 
ATOM   3406 C  C2    . G  B 1 1   ? 55.60600 52.46500 57.06700  1.000 134.19151 ? 103 G  B C2    1 
ATOM   3407 N  N2    . G  B 1 1   ? 55.75300 52.08200 55.78700  1.000 134.29678 ? 103 G  B N2    1 
ATOM   3408 N  N3    . G  B 1 1   ? 54.51600 52.11300 57.72700  1.000 135.72064 ? 103 G  B N3    1 
ATOM   3409 C  C4    . G  B 1 1   ? 54.51900 52.57400 58.99600  1.000 136.95500 ? 103 G  B C4    1 
ATOM   3410 P  P     . A  B 1 2   ? 53.43400 47.23800 61.26300  1.000 155.41023 ? 104 A  B P     1 
ATOM   3411 O  OP1   . A  B 1 2   ? 52.92500 45.86500 61.50300  1.000 155.01545 ? 104 A  B OP1   1 
ATOM   3412 O  OP2   . A  B 1 2   ? 54.30600 47.85600 62.29300  1.000 145.61959 ? 104 A  B OP2   1 
ATOM   3413 O  "O5'" . A  B 1 2   ? 54.21100 47.26500 59.86700  1.000 142.07442 ? 104 A  B "O5'" 1 
ATOM   3414 C  "C5'" . A  B 1 2   ? 53.56700 46.85900 58.66500  1.000 146.40652 ? 104 A  B "C5'" 1 
ATOM   3415 C  "C4'" . A  B 1 2   ? 54.39100 47.16300 57.43600  1.000 151.60451 ? 104 A  B "C4'" 1 
ATOM   3416 O  "O4'" . A  B 1 2   ? 54.82300 48.54600 57.44100  1.000 148.63047 ? 104 A  B "O4'" 1 
ATOM   3417 C  "C3'" . A  B 1 2   ? 55.68000 46.37300 57.27500  1.000 151.23079 ? 104 A  B "C3'" 1 
ATOM   3418 O  "O3'" . A  B 1 2   ? 55.45200 45.08000 56.74000  1.000 153.90479 ? 104 A  B "O3'" 1 
ATOM   3419 C  "C2'" . A  B 1 2   ? 56.51700 47.26100 56.35600  1.000 141.57173 ? 104 A  B "C2'" 1 
ATOM   3420 O  "O2'" . A  B 1 2   ? 56.18500 47.03700 54.99400  1.000 146.81447 ? 104 A  B "O2'" 1 
ATOM   3421 C  "C1'" . A  B 1 2   ? 56.04600 48.66700 56.74700  1.000 138.98984 ? 104 A  B "C1'" 1 
ATOM   3422 N  N9    . A  B 1 2   ? 57.02000 49.40000 57.58100  1.000 140.15051 ? 104 A  B N9    1 
ATOM   3423 C  C8    . A  B 1 2   ? 56.82600 49.94400 58.82600  1.000 140.98482 ? 104 A  B C8    1 
ATOM   3424 N  N7    . A  B 1 2   ? 57.87800 50.55800 59.30800  1.000 133.47339 ? 104 A  B N7    1 
ATOM   3425 C  C5    . A  B 1 2   ? 58.83000 50.41700 58.30900  1.000 134.22348 ? 104 A  B C5    1 
ATOM   3426 C  C6    . A  B 1 2   ? 60.16300 50.84900 58.21400  1.000 130.83097 ? 104 A  B C6    1 
ATOM   3427 N  N6    . A  B 1 2   ? 60.77800 51.53900 59.17700  1.000 127.15685 ? 104 A  B N6    1 
ATOM   3428 N  N1    . A  B 1 2   ? 60.84500 50.55100 57.08700  1.000 130.05983 ? 104 A  B N1    1 
ATOM   3429 C  C2    . A  B 1 2   ? 60.22000 49.85700 56.13100  1.000 134.77355 ? 104 A  B C2    1 
ATOM   3430 N  N3    . A  B 1 2   ? 58.97000 49.39900 56.10500  1.000 137.25543 ? 104 A  B N3    1 
ATOM   3431 C  C4    . A  B 1 2   ? 58.31500 49.71300 57.23600  1.000 135.65787 ? 104 A  B C4    1 
ATOM   3432 P  P     . A  B 1 3   ? 56.27500 43.81000 57.27800  1.000 167.32803 ? 105 A  B P     1 
ATOM   3433 O  OP1   . A  B 1 3   ? 55.62300 42.60100 56.71700  1.000 166.59374 ? 105 A  B OP1   1 
ATOM   3434 O  OP2   . A  B 1 3   ? 56.46800 43.93300 58.74500  1.000 153.21318 ? 105 A  B OP2   1 
ATOM   3435 O  "O5'" . A  B 1 3   ? 57.70100 43.95800 56.58600  1.000 159.96399 ? 105 A  B "O5'" 1 
ATOM   3436 C  "C5'" . A  B 1 3   ? 57.80600 44.14400 55.17800  1.000 156.92942 ? 105 A  B "C5'" 1 
ATOM   3437 C  "C4'" . A  B 1 3   ? 59.22900 44.38900 54.74000  1.000 159.09810 ? 105 A  B "C4'" 1 
ATOM   3438 O  "O4'" . A  B 1 3   ? 59.71600 45.62600 55.33700  1.000 153.69219 ? 105 A  B "O4'" 1 
ATOM   3439 C  "C3'" . A  B 1 3   ? 60.23100 43.30400 55.13700  1.000 162.50904 ? 105 A  B "C3'" 1 
ATOM   3440 O  "O3'" . A  B 1 3   ? 61.21800 43.18400 54.11400  1.000 172.47076 ? 105 A  B "O3'" 1 
ATOM   3441 C  "C2'" . A  B 1 3   ? 60.87300 43.88900 56.39100  1.000 149.73119 ? 105 A  B "C2'" 1 
ATOM   3442 O  "O2'" . A  B 1 3   ? 62.15400 43.38200 56.69800  1.000 151.77091 ? 105 A  B "O2'" 1 
ATOM   3443 C  "C1'" . A  B 1 3   ? 60.92000 45.36700 56.03100  1.000 146.42290 ? 105 A  B "C1'" 1 
ATOM   3444 N  N9    . A  B 1 3   ? 61.02300 46.26400 57.18200  1.000 137.82187 ? 105 A  B N9    1 
ATOM   3445 C  C8    . A  B 1 3   ? 60.17500 46.39400 58.25200  1.000 137.28233 ? 105 A  B C8    1 
ATOM   3446 N  N7    . A  B 1 3   ? 60.56600 47.29400 59.12300  1.000 132.87390 ? 105 A  B N7    1 
ATOM   3447 C  C5    . A  B 1 3   ? 61.75100 47.78200 58.58800  1.000 133.30553 ? 105 A  B C5    1 
ATOM   3448 C  C6    . A  B 1 3   ? 62.66700 48.75200 59.02800  1.000 129.12082 ? 105 A  B C6    1 
ATOM   3449 N  N6    . A  B 1 3   ? 62.52500 49.44400 60.15900  1.000 126.38102 ? 105 A  B N6    1 
ATOM   3450 N  N1    . A  B 1 3   ? 63.75000 48.99300 58.25700  1.000 125.17824 ? 105 A  B N1    1 
ATOM   3451 C  C2    . A  B 1 3   ? 63.89700 48.30000 57.12100  1.000 124.69661 ? 105 A  B C2    1 
ATOM   3452 N  N3    . A  B 1 3   ? 63.10700 47.36400 56.60300  1.000 126.66263 ? 105 A  B N3    1 
ATOM   3453 C  C4    . A  B 1 3   ? 62.04400 47.15200 57.39500  1.000 131.04737 ? 105 A  B C4    1 
ATOM   3454 P  P     . U  B 1 4   ? 61.49600 41.76300 53.41900  1.000 175.57424 ? 106 U  B P     1 
ATOM   3455 O  OP1   . U  B 1 4   ? 62.06600 42.00400 52.06600  1.000 168.37338 ? 106 U  B OP1   1 
ATOM   3456 O  OP2   . U  B 1 4   ? 60.26300 40.94600 53.56300  1.000 168.14967 ? 106 U  B OP2   1 
ATOM   3457 O  "O5'" . U  B 1 4   ? 62.62200 41.11000 54.33800  1.000 179.65105 ? 106 U  B "O5'" 1 
ATOM   3458 C  "C5'" . U  B 1 4   ? 63.92700 41.66800 54.40600  1.000 181.66708 ? 106 U  B "C5'" 1 
ATOM   3459 C  "C4'" . U  B 1 4   ? 64.76600 40.96700 55.44300  1.000 188.05732 ? 106 U  B "C4'" 1 
ATOM   3460 O  "O4'" . U  B 1 4   ? 64.24400 39.63600 55.66400  1.000 193.15530 ? 106 U  B "O4'" 1 
ATOM   3461 C  "C3'" . U  B 1 4   ? 66.22900 40.74700 55.07800  1.000 188.58370 ? 106 U  B "C3'" 1 
ATOM   3462 O  "O3'" . U  B 1 4   ? 67.03000 41.88200 55.36700  1.000 172.98183 ? 106 U  B "O3'" 1 
ATOM   3463 C  "C2'" . U  B 1 4   ? 66.61400 39.52000 55.90400  1.000 191.92357 ? 106 U  B "C2'" 1 
ATOM   3464 O  "O2'" . U  B 1 4   ? 67.00000 39.90600 57.21300  1.000 169.87356 ? 106 U  B "O2'" 1 
ATOM   3465 C  "C1'" . U  B 1 4   ? 65.28900 38.75000 55.99300  1.000 199.09285 ? 106 U  B "C1'" 1 
ATOM   3466 N  N1    . U  B 1 4   ? 65.21900 37.55900 55.10800  1.000 208.43608 ? 106 U  B N1    1 
ATOM   3467 C  C2    . U  B 1 4   ? 65.89000 36.40600 55.49700  1.000 212.08915 ? 106 U  B C2    1 
ATOM   3468 O  O2    . U  B 1 4   ? 66.55800 36.32900 56.51900  1.000 206.39636 ? 106 U  B O2    1 
ATOM   3469 N  N3    . U  B 1 4   ? 65.76100 35.34000 54.63300  1.000 218.30831 ? 106 U  B N3    1 
ATOM   3470 C  C4    . U  B 1 4   ? 65.04000 35.29800 53.45300  1.000 214.09991 ? 106 U  B C4    1 
ATOM   3471 O  O4    . U  B 1 4   ? 65.02300 34.25700 52.78500  1.000 211.94966 ? 106 U  B O4    1 
ATOM   3472 C  C5    . U  B 1 4   ? 64.36800 36.52400 53.13100  1.000 207.88601 ? 106 U  B C5    1 
ATOM   3473 C  C6    . U  B 1 4   ? 64.47200 37.57900 53.95000  1.000 206.34372 ? 106 U  B C6    1 
ATOM   3474 P  P     . U  B 1 5   ? 67.63200 42.79400 54.18800  1.000 179.12054 ? 107 U  B P     1 
ATOM   3475 O  OP1   . U  B 1 5   ? 66.53100 43.18300 53.26800  1.000 171.83020 ? 107 U  B OP1   1 
ATOM   3476 O  OP2   . U  B 1 5   ? 68.82500 42.09600 53.64900  1.000 167.48757 ? 107 U  B OP2   1 
ATOM   3477 O  "O5'" . U  B 1 5   ? 68.12900 44.10800 54.94200  1.000 150.90137 ? 107 U  B "O5'" 1 
ATOM   3478 C  "C5'" . U  B 1 5   ? 69.09200 44.03500 55.98600  1.000 135.47057 ? 107 U  B "C5'" 1 
ATOM   3479 C  "C4'" . U  B 1 5   ? 69.90000 45.30600 56.08400  1.000 126.63004 ? 107 U  B "C4'" 1 
ATOM   3480 O  "O4'" . U  B 1 5   ? 69.00700 46.44800 56.13000  1.000 120.37929 ? 107 U  B "O4'" 1 
ATOM   3481 C  "C3'" . U  B 1 5   ? 70.76400 45.46100 57.32800  1.000 122.32952 ? 107 U  B "C3'" 1 
ATOM   3482 O  "O3'" . U  B 1 5   ? 71.99700 44.76600 57.24200  1.000 128.73819 ? 107 U  B "O3'" 1 
ATOM   3483 C  "C2'" . U  B 1 5   ? 70.92300 46.97200 57.43000  1.000 118.36063 ? 107 U  B "C2'" 1 
ATOM   3484 O  "O2'" . U  B 1 5   ? 71.90200 47.43400 56.51000  1.000 116.06562 ? 107 U  B "O2'" 1 
ATOM   3485 C  "C1'" . U  B 1 5   ? 69.55500 47.45700 56.95400  1.000 114.13644 ? 107 U  B "C1'" 1 
ATOM   3486 N  N1    . U  B 1 5   ? 68.62100 47.71400 58.07400  1.000 114.39699 ? 107 U  B N1    1 
ATOM   3487 C  C2    . U  B 1 5   ? 68.83300 48.82000 58.87500  1.000 110.24913 ? 107 U  B C2    1 
ATOM   3488 O  O2    . U  B 1 5   ? 69.76200 49.59000 58.71100  1.000 113.48899 ? 107 U  B O2    1 
ATOM   3489 N  N3    . U  B 1 5   ? 67.91800 48.98800 59.88400  1.000 106.70397 ? 107 U  B N3    1 
ATOM   3490 C  C4    . U  B 1 5   ? 66.83300 48.18300 60.16600  1.000 113.89430 ? 107 U  B C4    1 
ATOM   3491 O  O4    . U  B 1 5   ? 66.09900 48.47100 61.11300  1.000 115.74716 ? 107 U  B O4    1 
ATOM   3492 C  C5    . U  B 1 5   ? 66.67800 47.06300 59.29100  1.000 116.67885 ? 107 U  B C5    1 
ATOM   3493 C  C6    . U  B 1 5   ? 67.55700 46.87600 58.30300  1.000 118.19482 ? 107 U  B C6    1 
ATOM   3494 P  P     . G  B 1 6   ? 72.77000 44.31300 58.57600  1.000 125.33855 ? 108 G  B P     1 
ATOM   3495 O  OP1   . G  B 1 6   ? 73.95200 43.51000 58.16900  1.000 129.83909 ? 108 G  B OP1   1 
ATOM   3496 O  OP2   . G  B 1 6   ? 71.76500 43.72400 59.49600  1.000 118.85620 ? 108 G  B OP2   1 
ATOM   3497 O  "O5'" . G  B 1 6   ? 73.29900 45.68200 59.20100  1.000 115.60581 ? 108 G  B "O5'" 1 
ATOM   3498 C  "C5'" . G  B 1 6   ? 74.25200 46.47400 58.50200  1.000 113.58978 ? 108 G  B "C5'" 1 
ATOM   3499 C  "C4'" . G  B 1 6   ? 74.67000 47.69400 59.28600  1.000 109.62351 ? 108 G  B "C4'" 1 
ATOM   3500 O  "O4'" . G  B 1 6   ? 73.56100 48.62100 59.40600  1.000 111.99485 ? 108 G  B "O4'" 1 
ATOM   3501 C  "C3'" . G  B 1 6   ? 75.10500 47.45300 60.72000  1.000 108.33125 ? 108 G  B "C3'" 1 
ATOM   3502 O  "O3'" . G  B 1 6   ? 76.44000 46.98900 60.81100  1.000 116.25852 ? 108 G  B "O3'" 1 
ATOM   3503 C  "C2'" . G  B 1 6   ? 74.88700 48.81300 61.36800  1.000 109.66036 ? 108 G  B "C2'" 1 
ATOM   3504 O  "O2'" . G  B 1 6   ? 75.95300 49.69600 61.05500  1.000 117.94293 ? 108 G  B "O2'" 1 
ATOM   3505 C  "C1'" . G  B 1 6   ? 73.62700 49.29000 60.64800  1.000 106.54156 ? 108 G  B "C1'" 1 
ATOM   3506 N  N9    . G  B 1 6   ? 72.41700 48.95800 61.41600  1.000 108.80499 ? 108 G  B N9    1 
ATOM   3507 C  C8    . G  B 1 6   ? 71.59900 47.86600 61.24900  1.000 105.94149 ? 108 G  B C8    1 
ATOM   3508 N  N7    . G  B 1 6   ? 70.60600 47.84700 62.09600  1.000 108.06543 ? 108 G  B N7    1 
ATOM   3509 C  C5    . G  B 1 6   ? 70.78700 48.98800 62.86700  1.000 103.94388 ? 108 G  B C5    1 
ATOM   3510 C  C6    . G  B 1 6   ? 70.02100 49.49800 63.94400  1.000 100.66454 ? 108 G  B C6    1 
ATOM   3511 O  O6    . G  B 1 6   ? 68.99600 49.02600 64.44700  1.000 103.48330 ? 108 G  B O6    1 
ATOM   3512 N  N1    . G  B 1 6   ? 70.56000 50.68100 64.43800  1.000 94.84016  ? 108 G  B N1    1 
ATOM   3513 C  C2    . G  B 1 6   ? 71.68900 51.29800 63.96000  1.000 92.48988  ? 108 G  B C2    1 
ATOM   3514 N  N2    . G  B 1 6   ? 72.05300 52.43500 64.56900  1.000 93.50316  ? 108 G  B N2    1 
ATOM   3515 N  N3    . G  B 1 6   ? 72.40900 50.83400 62.95300  1.000 99.01961  ? 108 G  B N3    1 
ATOM   3516 C  C4    . G  B 1 6   ? 71.90400 49.68400 62.46200  1.000 105.07823 ? 108 G  B C4    1 
ATOM   3517 P  P     . C  B 1 7   ? 76.97200 46.30000 62.16000  1.000 118.32261 ? 109 C  B P     1 
ATOM   3518 O  OP1   . C  B 1 7   ? 78.28100 45.66700 61.84400  1.000 115.06696 ? 109 C  B OP1   1 
ATOM   3519 O  OP2   . C  B 1 7   ? 75.87800 45.48800 62.76100  1.000 98.86765  ? 109 C  B OP2   1 
ATOM   3520 O  "O5'" . C  B 1 7   ? 77.24200 47.52700 63.13700  1.000 111.02174 ? 109 C  B "O5'" 1 
ATOM   3521 C  "C5'" . C  B 1 7   ? 77.11700 47.36700 64.54000  1.000 107.50026 ? 109 C  B "C5'" 1 
ATOM   3522 C  "C4'" . C  B 1 7   ? 76.72400 48.65600 65.21500  1.000 106.33170 ? 109 C  B "C4'" 1 
ATOM   3523 O  "O4'" . C  B 1 7   ? 75.45700 49.13300 64.68500  1.000 101.11529 ? 109 C  B "O4'" 1 
ATOM   3524 C  "C3'" . C  B 1 7   ? 76.48000 48.56100 66.71200  1.000 99.61774  ? 109 C  B "C3'" 1 
ATOM   3525 O  "O3'" . C  B 1 7   ? 77.67600 48.56900 67.46700  1.000 95.03824  ? 109 C  B "O3'" 1 
ATOM   3526 C  "C2'" . C  B 1 7   ? 75.57400 49.75100 66.97200  1.000 100.98896 ? 109 C  B "C2'" 1 
ATOM   3527 O  "O2'" . C  B 1 7   ? 76.32500 50.95800 66.97900  1.000 103.86562 ? 109 C  B "O2'" 1 
ATOM   3528 C  "C1'" . C  B 1 7   ? 74.69500 49.73200 65.71700  1.000 103.42083 ? 109 C  B "C1'" 1 
ATOM   3529 N  N1    . C  B 1 7   ? 73.45700 48.93900 65.91500  1.000 100.82841 ? 109 C  B N1    1 
ATOM   3530 C  C2    . C  B 1 7   ? 72.43500 49.40000 66.75900  1.000 98.70710  ? 109 C  B C2    1 
ATOM   3531 O  O2    . C  B 1 7   ? 72.56000 50.48300 67.35000  1.000 93.84073  ? 109 C  B O2    1 
ATOM   3532 N  N3    . C  B 1 7   ? 71.32300 48.64700 66.92000  1.000 102.23384 ? 109 C  B N3    1 
ATOM   3533 C  C4    . C  B 1 7   ? 71.20100 47.48200 66.27700  1.000 100.35730 ? 109 C  B C4    1 
ATOM   3534 N  N4    . C  B 1 7   ? 70.08000 46.77600 66.46600  1.000 100.77051 ? 109 C  B N4    1 
ATOM   3535 C  C5    . C  B 1 7   ? 72.22100 46.98900 65.41400  1.000 96.11995  ? 109 C  B C5    1 
ATOM   3536 C  C6    . C  B 1 7   ? 73.31300 47.74500 65.27100  1.000 99.44140  ? 109 C  B C6    1 
ATOM   3537 P  P     . G  B 1 8   ? 77.86800 47.51400 68.65800  1.000 107.88626 ? 110 G  B P     1 
ATOM   3538 O  OP1   . G  B 1 8   ? 79.32300 47.32600 68.87300  1.000 108.57055 ? 110 G  B OP1   1 
ATOM   3539 O  OP2   . G  B 1 8   ? 77.00300 46.34200 68.37500  1.000 95.59268  ? 110 G  B OP2   1 
ATOM   3540 O  "O5'" . G  B 1 8   ? 77.26600 48.26500 69.92500  1.000 100.49853 ? 110 G  B "O5'" 1 
ATOM   3541 C  "C5'" . G  B 1 8   ? 77.58100 49.62700 70.17600  1.000 98.44828  ? 110 G  B "C5'" 1 
ATOM   3542 C  "C4'" . G  B 1 8   ? 76.64000 50.23800 71.18300  1.000 92.86867  ? 110 G  B "C4'" 1 
ATOM   3543 O  "O4'" . G  B 1 8   ? 75.30500 50.31400 70.62700  1.000 90.95791  ? 110 G  B "O4'" 1 
ATOM   3544 C  "C3'" . G  B 1 8   ? 76.45300 49.46000 72.47300  1.000 94.36622  ? 110 G  B "C3'" 1 
ATOM   3545 O  "O3'" . G  B 1 8   ? 77.51200 49.65600 73.38900  1.000 92.75287  ? 110 G  B "O3'" 1 
ATOM   3546 C  "C2'" . G  B 1 8   ? 75.10600 49.96300 72.97200  1.000 92.38440  ? 110 G  B "C2'" 1 
ATOM   3547 O  "O2'" . G  B 1 8   ? 75.25500 51.22500 73.60500  1.000 91.45271  ? 110 G  B "O2'" 1 
ATOM   3548 C  "C1'" . G  B 1 8   ? 74.34700 50.16100 71.65600  1.000 94.23989  ? 110 G  B "C1'" 1 
ATOM   3549 N  N9    . G  B 1 8   ? 73.46700 49.01900 71.33700  1.000 94.81890  ? 110 G  B N9    1 
ATOM   3550 C  C8    . G  B 1 8   ? 73.63600 48.07200 70.36000  1.000 99.09836  ? 110 G  B C8    1 
ATOM   3551 N  N7    . G  B 1 8   ? 72.67600 47.18700 70.33300  1.000 92.38440  ? 110 G  B N7    1 
ATOM   3552 C  C5    . G  B 1 8   ? 71.81600 47.57300 71.35300  1.000 92.03173  ? 110 G  B C5    1 
ATOM   3553 C  C6    . G  B 1 8   ? 70.59400 47.00100 71.80600  1.000 96.71387  ? 110 G  B C6    1 
ATOM   3554 O  O6    . G  B 1 8   ? 70.00200 46.00000 71.38300  1.000 95.89798  ? 110 G  B O6    1 
ATOM   3555 N  N1    . G  B 1 8   ? 70.05400 47.71900 72.86900  1.000 96.93758  ? 110 G  B N1    1 
ATOM   3556 C  C2    . G  B 1 8   ? 70.61800 48.84100 73.42400  1.000 94.18462  ? 110 G  B C2    1 
ATOM   3557 N  N2    . G  B 1 8   ? 69.95000 49.39100 74.44500  1.000 87.89965  ? 110 G  B N2    1 
ATOM   3558 N  N3    . G  B 1 8   ? 71.75100 49.38700 73.01300  1.000 93.13712  ? 110 G  B N3    1 
ATOM   3559 C  C4    . G  B 1 8   ? 72.29300 48.70500 71.98100  1.000 91.43692  ? 110 G  B C4    1 
ATOM   3560 P  P     . G  B 1 9   ? 78.01600 48.43300 74.29400  1.000 97.20884  ? 111 G  B P     1 
ATOM   3561 O  OP1   . G  B 1 9   ? 79.24200 48.88100 75.00600  1.000 91.57922  ? 111 G  B OP1   1 
ATOM   3562 O  OP2   . G  B 1 9   ? 78.06000 47.21500 73.44000  1.000 100.62504 ? 111 G  B OP2   1 
ATOM   3563 O  "O5'" . G  B 1 9   ? 76.85500 48.27200 75.37300  1.000 97.65100  ? 111 G  B "O5'" 1 
ATOM   3564 C  "C5'" . G  B 1 9   ? 76.52400 49.35000 76.23700  1.000 94.69012  ? 111 G  B "C5'" 1 
ATOM   3565 C  "C4'" . G  B 1 9   ? 75.24200 49.09600 76.98700  1.000 92.51617  ? 111 G  B "C4'" 1 
ATOM   3566 O  "O4'" . G  B 1 9   ? 74.11500 49.12300 76.07300  1.000 93.18468  ? 111 G  B "O4'" 1 
ATOM   3567 C  "C3'" . G  B 1 9   ? 75.12800 47.74200 77.65800  1.000 98.86167  ? 111 G  B "C3'" 1 
ATOM   3568 O  "O3'" . G  B 1 9   ? 75.84900 47.66000 78.87100  1.000 101.26722 ? 111 G  B "O3'" 1 
ATOM   3569 C  "C2'" . G  B 1 9   ? 73.62200 47.57900 77.80700  1.000 99.65387  ? 111 G  B "C2'" 1 
ATOM   3570 O  "O2'" . G  B 1 9   ? 73.12900 48.35900 78.88700  1.000 103.88333 ? 111 G  B "O2'" 1 
ATOM   3571 C  "C1'" . G  B 1 9   ? 73.13300 48.20000 76.49800  1.000 95.25861  ? 111 G  B "C1'" 1 
ATOM   3572 N  N9    . G  B 1 9   ? 72.96800 47.17600 75.45200  1.000 92.90569  ? 111 G  B N9    1 
ATOM   3573 C  C8    . G  B 1 9   ? 73.81700 46.89800 74.40900  1.000 97.37728  ? 111 G  B C8    1 
ATOM   3574 N  N7    . G  B 1 9   ? 73.39600 45.91800 73.65600  1.000 97.05093  ? 111 G  B N7    1 
ATOM   3575 C  C5    . G  B 1 9   ? 72.20000 45.52400 74.23900  1.000 98.84062  ? 111 G  B C5    1 
ATOM   3576 C  C6    . G  B 1 9   ? 71.28500 44.50400 73.86900  1.000 100.18025 ? 111 G  B C6    1 
ATOM   3577 O  O6    . G  B 1 9   ? 71.35200 43.71700 72.91900  1.000 101.80150 ? 111 G  B O6    1 
ATOM   3578 N  N1    . G  B 1 9   ? 70.20300 44.44500 74.74000  1.000 96.60877  ? 111 G  B N1    1 
ATOM   3579 C  C2    . G  B 1 9   ? 70.02100 45.26200 75.82800  1.000 98.46426  ? 111 G  B C2    1 
ATOM   3580 N  N2    . G  B 1 9   ? 68.91100 45.05700 76.55200  1.000 99.84337  ? 111 G  B N2    1 
ATOM   3581 N  N3    . G  B 1 9   ? 70.86500 46.21500 76.18400  1.000 100.29079 ? 111 G  B N3    1 
ATOM   3582 C  C4    . G  B 1 9   ? 71.92400 46.29000 75.35100  1.000 96.46665  ? 111 G  B C4    1 
ATOM   3583 P  P     . G  B 1 10  ? 76.60600 46.30100 79.25500  1.000 100.07498 ? 112 G  B P     1 
ATOM   3584 O  OP1   . G  B 1 10  ? 77.55800 46.65600 80.33900  1.000 108.01277 ? 112 G  B OP1   1 
ATOM   3585 O  OP2   . G  B 1 10  ? 77.09400 45.64200 78.01200  1.000 104.67816 ? 112 G  B OP2   1 
ATOM   3586 O  "O5'" . G  B 1 10  ? 75.44200 45.40500 79.86400  1.000 96.64562  ? 112 G  B "O5'" 1 
ATOM   3587 C  "C5'" . G  B 1 10  ? 74.62600 45.91300 80.90900  1.000 98.31161  ? 112 G  B "C5'" 1 
ATOM   3588 C  "C4'" . G  B 1 10  ? 73.34000 45.14000 81.04000  1.000 98.93537  ? 112 G  B "C4'" 1 
ATOM   3589 O  "O4'" . G  B 1 10  ? 72.50700 45.35300 79.87200  1.000 99.78021  ? 112 G  B "O4'" 1 
ATOM   3590 C  "C3'" . G  B 1 10  ? 73.48100 43.63300 81.12200  1.000 100.35659 ? 112 G  B "C3'" 1 
ATOM   3591 O  "O3'" . G  B 1 10  ? 73.84200 43.20000 82.42000  1.000 99.52755  ? 112 G  B "O3'" 1 
ATOM   3592 C  "C2'" . G  B 1 10  ? 72.10800 43.15200 80.66700  1.000 100.59873 ? 112 G  B "C2'" 1 
ATOM   3593 O  "O2'" . G  B 1 10  ? 71.15700 43.28900 81.71100  1.000 100.75927 ? 112 G  B "O2'" 1 
ATOM   3594 C  "C1'" . G  B 1 10  ? 71.77700 44.18000 79.58300  1.000 99.03275  ? 112 G  B "C1'" 1 
ATOM   3595 N  N9    . G  B 1 10  ? 72.16900 43.69900 78.25000  1.000 98.69587  ? 112 G  B N9    1 
ATOM   3596 C  C8    . G  B 1 10  ? 73.20200 44.14100 77.46400  1.000 102.57528 ? 112 G  B C8    1 
ATOM   3597 N  N7    . G  B 1 10  ? 73.29500 43.49100 76.33700  1.000 102.97270 ? 112 G  B N7    1 
ATOM   3598 C  C5    . G  B 1 10  ? 72.26100 42.56600 76.38900  1.000 98.90905  ? 112 G  B C5    1 
ATOM   3599 C  C6    . G  B 1 10  ? 71.85500 41.58000 75.45000  1.000 96.96145  ? 112 G  B C6    1 
ATOM   3600 O  O6    . G  B 1 10  ? 72.34300 41.31500 74.34400  1.000 102.16997 ? 112 G  B O6    1 
ATOM   3601 N  N1    . G  B 1 10  ? 70.75700 40.85400 75.90200  1.000 96.96145  ? 112 G  B N1    1 
ATOM   3602 C  C2    . G  B 1 10  ? 70.13100 41.05400 77.10600  1.000 99.85127  ? 112 G  B C2    1 
ATOM   3603 N  N2    . G  B 1 10  ? 69.08800 40.25700 77.37000  1.000 102.72793 ? 112 G  B N2    1 
ATOM   3604 N  N3    . G  B 1 10  ? 70.49700 41.96900 77.98900  1.000 99.79863  ? 112 G  B N3    1 
ATOM   3605 C  C4    . G  B 1 10  ? 71.56000 42.68200 77.56600  1.000 98.81694  ? 112 G  B C4    1 
ATOM   3606 P  P     . A  B 1 11  ? 74.97800 42.08700 82.62400  1.000 102.34713 ? 113 A  B P     1 
ATOM   3607 O  OP1   . A  B 1 11  ? 75.20700 41.96500 84.08600  1.000 113.15369 ? 113 A  B OP1   1 
ATOM   3608 O  OP2   . A  B 1 11  ? 76.10300 42.37300 81.69700  1.000 106.31866 ? 113 A  B OP2   1 
ATOM   3609 O  "O5'" . A  B 1 11  ? 74.28300 40.74500 82.13400  1.000 106.26339 ? 113 A  B "O5'" 1 
ATOM   3610 C  "C5'" . A  B 1 11  ? 73.05000 40.31300 82.68600  1.000 98.37824  ? 113 A  B "C5'" 1 
ATOM   3611 C  "C4'" . A  B 1 11  ? 72.39500 39.29500 81.79100  1.000 99.22307  ? 113 A  B "C4'" 1 
ATOM   3612 O  "O4'" . A  B 1 11  ? 72.03800 39.91300 80.53000  1.000 99.96527  ? 113 A  B "O4'" 1 
ATOM   3613 C  "C3'" . A  B 1 11  ? 73.27500 38.12100 81.39800  1.000 100.76800 ? 113 A  B "C3'" 1 
ATOM   3614 O  "O3'" . A  B 1 11  ? 73.28000 37.12400 82.39900  1.000 98.59142  ? 113 A  B "O3'" 1 
ATOM   3615 C  "C2'" . A  B 1 11  ? 72.66900 37.66700 80.07700  1.000 97.58867  ? 113 A  B "C2'" 1 
ATOM   3616 O  "O2'" . A  B 1 11  ? 71.51800 36.86600 80.30300  1.000 111.09555 ? 113 A  B "O2'" 1 
ATOM   3617 C  "C1'" . A  B 1 11  ? 72.22400 39.00000 79.47100  1.000 96.26219  ? 113 A  B "C1'" 1 
ATOM   3618 N  N9    . A  B 1 11  ? 73.22800 39.57100 78.55500  1.000 101.77864 ? 113 A  B N9    1 
ATOM   3619 C  C8    . A  B 1 11  ? 74.11300 40.58000 78.83300  1.000 102.85246 ? 113 A  B C8    1 
ATOM   3620 N  N7    . A  B 1 11  ? 74.88900 40.89700 77.82700  1.000 108.56104 ? 113 A  B N7    1 
ATOM   3621 C  C5    . A  B 1 11  ? 74.48100 40.04600 76.81300  1.000 95.80951  ? 113 A  B C5    1 
ATOM   3622 C  C6    . A  B 1 11  ? 74.91200 39.88400 75.48600  1.000 97.84396  ? 113 A  B C6    1 
ATOM   3623 N  N6    . A  B 1 11  ? 75.88900 40.60500 74.92900  1.000 106.28971 ? 113 A  B N6    1 
ATOM   3624 N  N1    . A  B 1 11  ? 74.29800 38.94000 74.73800  1.000 108.25310 ? 113 A  B N1    1 
ATOM   3625 C  C2    . A  B 1 11  ? 73.31700 38.21100 75.29000  1.000 103.09986 ? 113 A  B C2    1 
ATOM   3626 N  N3    . A  B 1 11  ? 72.82500 38.27600 76.52600  1.000 102.46031 ? 113 A  B N3    1 
ATOM   3627 C  C4    . A  B 1 11  ? 73.45700 39.22200 77.24500  1.000 101.24174 ? 113 A  B C4    1 
ATOM   3628 P  P     . A  B 1 12  ? 74.48300 36.07000 82.50900  1.000 109.37804 ? 114 A  B P     1 
ATOM   3629 O  OP1   . A  B 1 12  ? 75.13800 36.25800 83.82700  1.000 90.29680  ? 114 A  B OP1   1 
ATOM   3630 O  OP2   . A  B 1 12  ? 75.28400 36.11300 81.25800  1.000 103.91685 ? 114 A  B OP2   1 
ATOM   3631 O  "O5'" . A  B 1 12  ? 73.72200 34.67900 82.57700  1.000 95.36846  ? 114 A  B "O5'" 1 
ATOM   3632 C  "C5'" . A  B 1 12  ? 72.52700 34.55300 83.33200  1.000 89.63883  ? 114 A  B "C5'" 1 
ATOM   3633 C  "C4'" . A  B 1 12  ? 71.71100 33.38900 82.84600  1.000 89.17298  ? 114 A  B "C4'" 1 
ATOM   3634 O  "O4'" . A  B 1 12  ? 71.10600 33.72100 81.57200  1.000 97.30290  ? 114 A  B "O4'" 1 
ATOM   3635 C  "C3'" . A  B 1 12  ? 72.50300 32.12500 82.57000  1.000 92.48127  ? 114 A  B "C3'" 1 
ATOM   3636 O  "O3'" . A  B 1 12  ? 72.72700 31.37200 83.74700  1.000 94.17358  ? 114 A  B "O3'" 1 
ATOM   3637 C  "C2'" . A  B 1 12  ? 71.65000 31.40800 81.53200  1.000 98.42935  ? 114 A  B "C2'" 1 
ATOM   3638 O  "O2'" . A  B 1 12  ? 70.57500 30.71900 82.15200  1.000 106.71193 ? 114 A  B "O2'" 1 
ATOM   3639 C  "C1'" . A  B 1 12  ? 71.07500 32.58400 80.74000  1.000 100.56908 ? 114 A  B "C1'" 1 
ATOM   3640 N  N9    . A  B 1 12  ? 71.84100 32.88300 79.51300  1.000 98.44251  ? 114 A  B N9    1 
ATOM   3641 C  C8    . A  B 1 12  ? 72.72000 33.91600 79.31400  1.000 100.01112 ? 114 A  B C8    1 
ATOM   3642 N  N7    . A  B 1 12  ? 73.25000 33.94600 78.11600  1.000 97.33449  ? 114 A  B N7    1 
ATOM   3643 C  C5    . A  B 1 12  ? 72.67500 32.85900 77.47500  1.000 95.04737  ? 114 A  B C5    1 
ATOM   3644 C  C6    . A  B 1 12  ? 72.81900 32.33700 76.17800  1.000 99.99270  ? 114 A  B C6    1 
ATOM   3645 N  N6    . A  B 1 12  ? 73.62400 32.87000 75.25500  1.000 104.49061 ? 114 A  B N6    1 
ATOM   3646 N  N1    . A  B 1 12  ? 72.10100 31.23600 75.85800  1.000 103.86158 ? 114 A  B N1    1 
ATOM   3647 C  C2    . A  B 1 12  ? 71.29300 30.69800 76.78000  1.000 102.81672 ? 114 A  B C2    1 
ATOM   3648 N  N3    . A  B 1 12  ? 71.07700 31.10100 78.03100  1.000 100.67436 ? 114 A  B N3    1 
ATOM   3649 C  C4    . A  B 1 12  ? 71.80200 32.19700 78.32100  1.000 96.84232  ? 114 A  B C4    1 
ATOM   3650 P  P     . A  B 1 13  ? 74.19500 30.83100 84.09200  1.000 99.76313  ? 115 A  B P     1 
ATOM   3651 O  OP1   . A  B 1 13  ? 74.21300 30.46900 85.53300  1.000 104.43474 ? 115 A  B OP1   1 
ATOM   3652 O  OP2   . A  B 1 13  ? 75.18200 31.81100 83.56500  1.000 96.00478  ? 115 A  B OP2   1 
ATOM   3653 O  "O5'" . A  B 1 13  ? 74.30200 29.49400 83.23600  1.000 98.15504  ? 115 A  B "O5'" 1 
ATOM   3654 C  "C5'" . A  B 1 13  ? 73.32900 28.47000 83.37800  1.000 99.12621  ? 115 A  B "C5'" 1 
ATOM   3655 C  "C4'" . A  B 1 13  ? 73.28500 27.57900 82.16400  1.000 101.39490 ? 115 A  B "C4'" 1 
ATOM   3656 O  "O4'" . A  B 1 13  ? 72.70300 28.29500 81.04300  1.000 101.02907 ? 115 A  B "O4'" 1 
ATOM   3657 C  "C3'" . A  B 1 13  ? 74.63300 27.12100 81.63600  1.000 102.04761 ? 115 A  B "C3'" 1 
ATOM   3658 O  "O3'" . A  B 1 13  ? 75.20000 26.05800 82.37700  1.000 102.60294 ? 115 A  B "O3'" 1 
ATOM   3659 C  "C2'" . A  B 1 13  ? 74.31200 26.77500 80.19100  1.000 103.46883 ? 115 A  B "C2'" 1 
ATOM   3660 O  "O2'" . A  B 1 13  ? 73.63500 25.52900 80.10600  1.000 106.66659 ? 115 A  B "O2'" 1 
ATOM   3661 C  "C1'" . A  B 1 13  ? 73.32800 27.88900 79.84100  1.000 101.95023 ? 115 A  B "C1'" 1 
ATOM   3662 N  N9    . A  B 1 13  ? 74.02900 29.04900 79.26300  1.000 100.76588 ? 115 A  B N9    1 
ATOM   3663 C  C8    . A  B 1 13  ? 74.43700 30.20000 79.89100  1.000 101.11592 ? 115 A  B C8    1 
ATOM   3664 N  N7    . A  B 1 13  ? 75.05400 31.04500 79.10200  1.000 100.15002 ? 115 A  B N7    1 
ATOM   3665 C  C5    . A  B 1 13  ? 75.05800 30.40500 77.87300  1.000 96.97069  ? 115 A  B C5    1 
ATOM   3666 C  C6    . A  B 1 13  ? 75.56600 30.77600 76.61500  1.000 100.34478 ? 115 A  B C6    1 
ATOM   3667 N  N6    . A  B 1 13  ? 76.19000 31.93400 76.37600  1.000 100.86326 ? 115 A  B N6    1 
ATOM   3668 N  N1    . A  B 1 13  ? 75.40600 29.90400 75.59300  1.000 103.24775 ? 115 A  B N1    1 
ATOM   3669 C  C2    . A  B 1 13  ? 74.78000 28.74400 75.82600  1.000 101.57650 ? 115 A  B C2    1 
ATOM   3670 N  N3    . A  B 1 13  ? 74.26400 28.28900 76.96500  1.000 100.24476 ? 115 A  B N3    1 
ATOM   3671 C  C4    . A  B 1 13  ? 74.43700 29.17400 77.96000  1.000 98.52614  ? 115 A  B C4    1 
ATOM   3672 P  P     . G  B 1 14  ? 76.78400 26.02700 82.63700  1.000 104.30398 ? 116 G  B P     1 
ATOM   3673 O  OP1   . G  B 1 14  ? 77.05400 24.96100 83.63400  1.000 99.55868  ? 116 G  B OP1   1 
ATOM   3674 O  OP2   . G  B 1 14  ? 77.23200 27.41900 82.89300  1.000 101.41680 ? 116 G  B OP2   1 
ATOM   3675 O  "O5'" . G  B 1 14  ? 77.38800 25.57400 81.23500  1.000 103.42493 ? 116 G  B "O5'" 1 
ATOM   3676 C  "C5'" . G  B 1 14  ? 76.98900 24.34800 80.64100  1.000 97.46369  ? 116 G  B "C5'" 1 
ATOM   3677 C  "C4'" . G  B 1 14  ? 77.25800 24.31800 79.15700  1.000 94.49228  ? 116 G  B "C4'" 1 
ATOM   3678 O  "O4'" . G  B 1 14  ? 76.58600 25.42100 78.49600  1.000 91.69721  ? 116 G  B "O4'" 1 
ATOM   3679 C  "C3'" . G  B 1 14  ? 78.70400 24.47200 78.72800  1.000 101.36679 ? 116 G  B "C3'" 1 
ATOM   3680 O  "O3'" . G  B 1 14  ? 79.44900 23.28000 78.88400  1.000 104.80931 ? 116 G  B "O3'" 1 
ATOM   3681 C  "C2'" . G  B 1 14  ? 78.56500 24.92400 77.28100  1.000 102.71169 ? 116 G  B "C2'" 1 
ATOM   3682 O  "O2'" . G  B 1 14  ? 78.24800 23.82400 76.44400  1.000 107.20170 ? 116 G  B "O2'" 1 
ATOM   3683 C  "C1'" . G  B 1 14  ? 77.33600 25.82800 77.37000  1.000 96.80572  ? 116 G  B "C1'" 1 
ATOM   3684 N  N9    . G  B 1 14  ? 77.71900 27.24100 77.53400  1.000 94.38701  ? 116 G  B N9    1 
ATOM   3685 C  C8    . G  B 1 14  ? 77.69500 27.99500 78.68100  1.000 94.70547  ? 116 G  B C8    1 
ATOM   3686 N  N7    . G  B 1 14  ? 78.10600 29.22100 78.49100  1.000 98.31642  ? 116 G  B N7    1 
ATOM   3687 C  C5    . G  B 1 14  ? 78.42900 29.27600 77.14300  1.000 100.58512 ? 116 G  B C5    1 
ATOM   3688 C  C6    . G  B 1 14  ? 78.93200 30.34400 76.35500  1.000 97.34262  ? 116 G  B C6    1 
ATOM   3689 O  O6    . G  B 1 14  ? 79.20900 31.50000 76.69200  1.000 100.25087 ? 116 G  B O6    1 
ATOM   3690 N  N1    . G  B 1 14  ? 79.11200 29.95800 75.03400  1.000 89.18638  ? 116 G  B N1    1 
ATOM   3691 C  C2    . G  B 1 14  ? 78.84800 28.71200 74.52500  1.000 95.83718  ? 116 G  B C2    1 
ATOM   3692 N  N2    . G  B 1 14  ? 79.09100 28.53300 73.21700  1.000 104.60402 ? 116 G  B N2    1 
ATOM   3693 N  N3    . G  B 1 14  ? 78.38200 27.71100 75.24900  1.000 95.67400  ? 116 G  B N3    1 
ATOM   3694 C  C4    . G  B 1 14  ? 78.19700 28.06000 76.53900  1.000 97.85058  ? 116 G  B C4    1 
ATOM   3695 P  P     . G  B 1 15  ? 80.99400 23.34300 79.31600  1.000 102.15015 ? 117 G  B P     1 
ATOM   3696 O  OP1   . G  B 1 15  ? 81.43000 21.94600 79.57400  1.000 111.13544 ? 117 G  B OP1   1 
ATOM   3697 O  OP2   . G  B 1 15  ? 81.14800 24.38000 80.36800  1.000 101.97382 ? 117 G  B OP2   1 
ATOM   3698 O  "O5'" . G  B 1 15  ? 81.73700 23.85700 78.00400  1.000 101.74221 ? 117 G  B "O5'" 1 
ATOM   3699 C  "C5'" . G  B 1 15  ? 81.71100 23.09200 76.80900  1.000 106.38750 ? 117 G  B "C5'" 1 
ATOM   3700 C  "C4'" . G  B 1 15  ? 82.23700 23.88000 75.63800  1.000 102.98446 ? 117 G  B "C4'" 1 
ATOM   3701 O  "O4'" . G  B 1 15  ? 81.32600 24.96500 75.31900  1.000 96.54158  ? 117 G  B "O4'" 1 
ATOM   3702 C  "C3'" . G  B 1 15  ? 83.56900 24.57800 75.84700  1.000 105.30843 ? 117 G  B "C3'" 1 
ATOM   3703 O  "O3'" . G  B 1 15  ? 84.68500 23.71100 75.74300  1.000 106.51647 ? 117 G  B "O3'" 1 
ATOM   3704 C  "C2'" . G  B 1 15  ? 83.52400 25.67100 74.79000  1.000 99.20769  ? 117 G  B "C2'" 1 
ATOM   3705 O  "O2'" . G  B 1 15  ? 83.75700 25.13400 73.49600  1.000 101.51850 ? 117 G  B "O2'" 1 
ATOM   3706 C  "C1'" . G  B 1 15  ? 82.05900 26.09000 74.87700  1.000 95.20195  ? 117 G  B "C1'" 1 
ATOM   3707 N  N9    . G  B 1 15  ? 81.88000 27.17500 75.85600  1.000 94.58082  ? 117 G  B N9    1 
ATOM   3708 C  C8    . G  B 1 15  ? 81.37000 27.08700 77.12800  1.000 95.92572  ? 117 G  B C8    1 
ATOM   3709 N  N7    . G  B 1 15  ? 81.36100 28.23200 77.75600  1.000 93.71230  ? 117 G  B N7    1 
ATOM   3710 C  C5    . G  B 1 15  ? 81.90100 29.12900 76.84700  1.000 95.22564  ? 117 G  B C5    1 
ATOM   3711 C  C6    . G  B 1 15  ? 82.14300 30.52300 76.95800  1.000 94.10708  ? 117 G  B C6    1 
ATOM   3712 O  O6    . G  B 1 15  ? 81.92200 31.27600 77.91100  1.000 93.01748  ? 117 G  B O6    1 
ATOM   3713 N  N1    . G  B 1 15  ? 82.70600 31.03800 75.79700  1.000 92.33845  ? 117 G  B N1    1 
ATOM   3714 C  C2    . G  B 1 15  ? 83.00100 30.31200 74.67000  1.000 94.19393  ? 117 G  B C2    1 
ATOM   3715 N  N2    . G  B 1 15  ? 83.54500 30.99100 73.65100  1.000 97.25220  ? 117 G  B N2    1 
ATOM   3716 N  N3    . G  B 1 15  ? 82.77900 29.01400 74.55200  1.000 96.76266  ? 117 G  B N3    1 
ATOM   3717 C  C4    . G  B 1 15  ? 82.23100 28.49000 75.67000  1.000 93.94127  ? 117 G  B C4    1 
ATOM   3718 P  P     . G  B 1 16  ? 85.93600 23.88600 76.73600  1.000 111.23946 ? 118 G  B P     1 
ATOM   3719 O  OP1   . G  B 1 16  ? 86.82500 22.71000 76.54300  1.000 116.19005 ? 118 G  B OP1   1 
ATOM   3720 O  OP2   . G  B 1 16  ? 85.42400 24.20100 78.09700  1.000 106.74155 ? 118 G  B OP2   1 
ATOM   3721 O  "O5'" . G  B 1 16  ? 86.68400 25.16800 76.16000  1.000 103.00689 ? 118 G  B "O5'" 1 
ATOM   3722 C  "C5'" . G  B 1 16  ? 87.06000 25.22000 74.79300  1.000 105.56246 ? 118 G  B "C5'" 1 
ATOM   3723 C  "C4'" . G  B 1 16  ? 87.53400 26.59300 74.39100  1.000 106.53626 ? 118 G  B "C4'" 1 
ATOM   3724 O  "O4'" . G  B 1 16  ? 86.43600 27.53900 74.41300  1.000 103.07269 ? 118 G  B "O4'" 1 
ATOM   3725 C  "C3'" . G  B 1 16  ? 88.57600 27.22500 75.28900  1.000 107.35215 ? 118 G  B "C3'" 1 
ATOM   3726 O  "O3'" . G  B 1 16  ? 89.87200 26.70800 75.06000  1.000 117.42441 ? 118 G  B "O3'" 1 
ATOM   3727 C  "C2'" . G  B 1 16  ? 88.43100 28.70500 74.96100  1.000 102.63053 ? 118 G  B "C2'" 1 
ATOM   3728 O  "O2'" . G  B 1 16  ? 89.05800 29.01600 73.72500  1.000 114.22929 ? 118 G  B "O2'" 1 
ATOM   3729 C  "C1'" . G  B 1 16  ? 86.91800 28.81800 74.77500  1.000 98.42740  ? 118 G  B "C1'" 1 
ATOM   3730 N  N9    . G  B 1 16  ? 86.25800 29.22900 76.02300  1.000 99.42225  ? 118 G  B N9    1 
ATOM   3731 C  C8    . G  B 1 16  ? 85.61700 28.42900 76.93700  1.000 98.59321  ? 118 G  B C8    1 
ATOM   3732 N  N7    . G  B 1 16  ? 85.13900 29.09700 77.95200  1.000 99.66702  ? 118 G  B N7    1 
ATOM   3733 C  C5    . G  B 1 16  ? 85.49600 30.41400 77.69700  1.000 95.41651  ? 118 G  B C5    1 
ATOM   3734 C  C6    . G  B 1 16  ? 85.25700 31.59600 78.44300  1.000 95.20333  ? 118 G  B C6    1 
ATOM   3735 O  O6    . G  B 1 16  ? 84.66000 31.71900 79.52000  1.000 102.79108 ? 118 G  B O6    1 
ATOM   3736 N  N1    . G  B 1 16  ? 85.79500 32.71400 77.81100  1.000 91.59500  ? 118 G  B N1    1 
ATOM   3737 C  C2    . G  B 1 16  ? 86.47500 32.69900 76.61600  1.000 96.26924  ? 118 G  B C2    1 
ATOM   3738 N  N2    . G  B 1 16  ? 86.92100 33.87800 76.15900  1.000 95.08489  ? 118 G  B N2    1 
ATOM   3739 N  N3    . G  B 1 16  ? 86.70600 31.60300 75.91500  1.000 97.51676  ? 118 G  B N3    1 
ATOM   3740 C  C4    . G  B 1 16  ? 86.19200 30.50800 76.51100  1.000 97.60361  ? 118 G  B C4    1 
ATOM   3741 P  P     . G  B 1 17  ? 91.03800 26.92800 76.14000  1.000 120.12281 ? 119 G  B P     1 
ATOM   3742 O  OP1   . G  B 1 17  ? 92.18400 26.06500 75.74800  1.000 125.88139 ? 119 G  B OP1   1 
ATOM   3743 O  OP2   . G  B 1 17  ? 90.47000 26.81800 77.50900  1.000 115.65648 ? 119 G  B OP2   1 
ATOM   3744 O  "O5'" . G  B 1 17  ? 91.46000 28.44400 75.92100  1.000 108.98726 ? 119 G  B "O5'" 1 
ATOM   3745 C  "C5'" . G  B 1 17  ? 92.10100 29.16600 76.95500  1.000 113.42990 ? 119 G  B "C5'" 1 
ATOM   3746 C  "C4'" . G  B 1 17  ? 92.14900 30.64100 76.65600  1.000 111.65337 ? 119 G  B "C4'" 1 
ATOM   3747 O  "O4'" . G  B 1 17  ? 90.80600 31.15600 76.45400  1.000 106.65277 ? 119 G  B "O4'" 1 
ATOM   3748 C  "C3'" . G  B 1 17  ? 92.71500 31.50100 77.77200  1.000 115.02220 ? 119 G  B "C3'" 1 
ATOM   3749 O  "O3'" . G  B 1 17  ? 94.12900 31.50200 77.79000  1.000 119.08058 ? 119 G  B "O3'" 1 
ATOM   3750 C  "C2'" . G  B 1 17  ? 92.08500 32.85900 77.49700  1.000 109.65576 ? 119 G  B "C2'" 1 
ATOM   3751 O  "O2'" . G  B 1 17  ? 92.74700 33.51000 76.42200  1.000 107.63710 ? 119 G  B "O2'" 1 
ATOM   3752 C  "C1'" . G  B 1 17  ? 90.69100 32.44100 77.03100  1.000 105.80793 ? 119 G  B "C1'" 1 
ATOM   3753 N  N9    . G  B 1 17  ? 89.73900 32.35100 78.15500  1.000 101.89431 ? 119 G  B N9    1 
ATOM   3754 C  C8    . G  B 1 17  ? 89.03000 31.23400 78.52000  1.000 102.93654 ? 119 G  B C8    1 
ATOM   3755 N  N7    . G  B 1 17  ? 88.25300 31.42300 79.54800  1.000 104.20511 ? 119 G  B N7    1 
ATOM   3756 C  C5    . G  B 1 17  ? 88.46400 32.75000 79.88800  1.000 100.65468 ? 119 G  B C5    1 
ATOM   3757 C  C6    . G  B 1 17  ? 87.89100 33.52200 80.93100  1.000 96.93845  ? 119 G  B C6    1 
ATOM   3758 O  O6    . G  B 1 17  ? 87.05900 33.17200 81.78100  1.000 99.59929  ? 119 G  B O6    1 
ATOM   3759 N  N1    . G  B 1 17  ? 88.37800 34.82500 80.92700  1.000 91.99312  ? 119 G  B N1    1 
ATOM   3760 C  C2    . G  B 1 17  ? 89.29500 35.32400 80.03700  1.000 95.97518  ? 119 G  B C2    1 
ATOM   3761 N  N2    . G  B 1 17  ? 89.63500 36.61000 80.20000  1.000 101.43636 ? 119 G  B N2    1 
ATOM   3762 N  N3    . G  B 1 17  ? 89.83300 34.61300 79.06000  1.000 102.50227 ? 119 G  B N3    1 
ATOM   3763 C  C4    . G  B 1 17  ? 89.37700 33.34200 79.04100  1.000 101.75745 ? 119 G  B C4    1 
ATOM   3764 P  P     . U  B 1 18  ? 94.91200 30.73700 78.96400  1.000 127.20705 ? 120 U  B P     1 
ATOM   3765 O  OP1   . U  B 1 18  ? 96.31500 30.54400 78.52500  1.000 123.89875 ? 120 U  B OP1   1 
ATOM   3766 O  OP2   . U  B 1 18  ? 94.09800 29.57400 79.39300  1.000 114.33445 ? 120 U  B OP2   1 
ATOM   3767 O  "O5'" . U  B 1 18  ? 94.90000 31.78700 80.15800  1.000 118.36388 ? 120 U  B "O5'" 1 
ATOM   3768 C  "C5'" . U  B 1 18  ? 95.16800 33.15800 79.90800  1.000 119.22714 ? 120 U  B "C5'" 1 
ATOM   3769 C  "C4'" . U  B 1 18  ? 94.39900 34.04900 80.84700  1.000 114.65817 ? 120 U  B "C4'" 1 
ATOM   3770 O  "O4'" . U  B 1 18  ? 92.97600 33.92300 80.60100  1.000 112.89744 ? 120 U  B "O4'" 1 
ATOM   3771 C  "C3'" . U  B 1 18  ? 94.54400 33.73200 82.32400  1.000 120.96946 ? 120 U  B "C3'" 1 
ATOM   3772 O  "O3'" . U  B 1 18  ? 95.75000 34.23100 82.86800  1.000 127.44392 ? 120 U  B "O3'" 1 
ATOM   3773 C  "C2'" . U  B 1 18  ? 93.28900 34.35200 82.92300  1.000 114.33708 ? 120 U  B "C2'" 1 
ATOM   3774 O  "O2'" . U  B 1 18  ? 93.46000 35.75200 83.09900  1.000 115.93464 ? 120 U  B "O2'" 1 
ATOM   3775 C  "C1'" . U  B 1 18  ? 92.26300 34.11400 81.80700  1.000 110.89193 ? 120 U  B "C1'" 1 
ATOM   3776 N  N1    . U  B 1 18  ? 91.39500 32.93700 82.05900  1.000 104.66750 ? 120 U  B N1    1 
ATOM   3777 C  C2    . U  B 1 18  ? 90.38300 33.08300 82.99300  1.000 104.98070 ? 120 U  B C2    1 
ATOM   3778 O  O2    . U  B 1 18  ? 90.18400 34.11600 83.60900  1.000 102.60146 ? 120 U  B O2    1 
ATOM   3779 N  N3    . U  B 1 18  ? 89.60200 31.97300 83.19100  1.000 106.99673 ? 120 U  B N3    1 
ATOM   3780 C  C4    . U  B 1 18  ? 89.72000 30.75000 82.56300  1.000 110.03657 ? 120 U  B C4    1 
ATOM   3781 O  O4    . U  B 1 18  ? 88.93500 29.84100 82.85100  1.000 113.27116 ? 120 U  B O4    1 
ATOM   3782 C  C5    . U  B 1 18  ? 90.78400 30.67600 81.60500  1.000 106.42561 ? 120 U  B C5    1 
ATOM   3783 C  C6    . U  B 1 18  ? 91.56400 31.74300 81.39400  1.000 107.95737 ? 120 U  B C6    1 
ATOM   3784 P  P     . C  B 1 19  ? 96.43500 33.48600 84.11200  1.000 124.87428 ? 121 C  B P     1 
ATOM   3785 O  OP1   . C  B 1 19  ? 97.87300 33.85600 84.12100  1.000 123.45306 ? 121 C  B OP1   1 
ATOM   3786 O  OP2   . C  B 1 19  ? 96.03900 32.05400 84.05100  1.000 126.37183 ? 121 C  B OP2   1 
ATOM   3787 O  "O5'" . C  B 1 19  ? 95.74100 34.15800 85.37800  1.000 118.55247 ? 121 C  B "O5'" 1 
ATOM   3788 C  "C5'" . C  B 1 19  ? 95.85500 35.55500 85.60500  1.000 121.26595 ? 121 C  B "C5'" 1 
ATOM   3789 C  "C4'" . C  B 1 19  ? 94.96400 36.01600 86.73000  1.000 121.85023 ? 121 C  B "C4'" 1 
ATOM   3790 O  "O4'" . C  B 1 19  ? 93.57600 35.88300 86.33800  1.000 121.75285 ? 121 C  B "O4'" 1 
ATOM   3791 C  "C3'" . C  B 1 19  ? 95.05700 35.22800 88.02300  1.000 129.83540 ? 121 C  B "C3'" 1 
ATOM   3792 O  "O3'" . C  B 1 19  ? 96.16700 35.60200 88.81400  1.000 141.10781 ? 121 C  B "O3'" 1 
ATOM   3793 C  "C2'" . C  B 1 19  ? 93.71500 35.51100 88.68300  1.000 123.20303 ? 121 C  B "C2'" 1 
ATOM   3794 O  "O2'" . C  B 1 19  ? 93.73000 36.78400 89.31300  1.000 126.91137 ? 121 C  B "O2'" 1 
ATOM   3795 C  "C1'" . C  B 1 19  ? 92.78600 35.57700 87.46800  1.000 114.32828 ? 121 C  B "C1'" 1 
ATOM   3796 N  N1    . C  B 1 19  ? 92.07700 34.29800 87.23100  1.000 110.63047 ? 121 C  B N1    1 
ATOM   3797 C  C2    . C  B 1 19  ? 90.79600 34.13500 87.77000  1.000 113.27552 ? 121 C  B C2    1 
ATOM   3798 O  O2    . C  B 1 19  ? 90.29200 35.06200 88.42100  1.000 118.44720 ? 121 C  B O2    1 
ATOM   3799 N  N3    . C  B 1 19  ? 90.13500 32.97400 87.56600  1.000 113.00970 ? 121 C  B N3    1 
ATOM   3800 C  C4    . C  B 1 19  ? 90.70700 31.99700 86.86000  1.000 116.60224 ? 121 C  B C4    1 
ATOM   3801 N  N4    . C  B 1 19  ? 90.01700 30.86700 86.68400  1.000 120.05791 ? 121 C  B N4    1 
ATOM   3802 C  C5    . C  B 1 19  ? 92.01100 32.13500 86.30100  1.000 118.55773 ? 121 C  B C5    1 
ATOM   3803 C  C6    . C  B 1 19  ? 92.65000 33.29000 86.50900  1.000 117.64973 ? 121 C  B C6    1 
ATOM   3804 P  P     . A  B 1 20  ? 96.85400 34.51600 89.77100  1.000 140.08427 ? 122 A  B P     1 
ATOM   3805 O  OP1   . A  B 1 20  ? 98.11500 35.10000 90.29800  1.000 143.67417 ? 122 A  B OP1   1 
ATOM   3806 O  OP2   . A  B 1 20  ? 96.86900 33.21700 89.04700  1.000 130.49101 ? 122 A  B OP2   1 
ATOM   3807 O  "O5'" . A  B 1 20  ? 95.82900 34.37200 90.98100  1.000 132.25701 ? 122 A  B "O5'" 1 
ATOM   3808 C  "C5'" . A  B 1 20  ? 96.25400 33.82600 92.22500  1.000 144.26898 ? 122 A  B "C5'" 1 
ATOM   3809 C  "C4'" . A  B 1 20  ? 95.82000 34.67900 93.39100  1.000 146.78244 ? 122 A  B "C4'" 1 
ATOM   3810 O  "O4'" . A  B 1 20  ? 94.44800 34.34000 93.74400  1.000 143.67417 ? 122 A  B "O4'" 1 
ATOM   3811 C  "C3'" . A  B 1 20  ? 96.64000 34.49500 94.66500  1.000 149.07745 ? 122 A  B "C3'" 1 
ATOM   3812 O  "O3'" . A  B 1 20  ? 96.65200 35.72500 95.39300  1.000 150.71449 ? 122 A  B "O3'" 1 
ATOM   3813 C  "C2'" . A  B 1 20  ? 95.81900 33.46100 95.43000  1.000 157.85745 ? 122 A  B "C2'" 1 
ATOM   3814 O  "O2'" . A  B 1 20  ? 96.04600 33.43300 96.82200  1.000 157.18632 ? 122 A  B "O2'" 1 
ATOM   3815 C  "C1'" . A  B 1 20  ? 94.40000 33.90600 95.09000  1.000 151.11980 ? 122 A  B "C1'" 1 
ATOM   3816 N  N9    . A  B 1 20  ? 93.37900 32.86100 95.22100  1.000 156.83891 ? 122 A  B N9    1 
ATOM   3817 C  C8    . A  B 1 20  ? 92.67600 32.20100 94.24200  1.000 146.76401 ? 122 A  B C8    1 
ATOM   3818 N  N7    . A  B 1 20  ? 91.80900 31.33400 94.71100  1.000 153.00424 ? 122 A  B N7    1 
ATOM   3819 C  C5    . A  B 1 20  ? 91.94500 31.43100 96.08900  1.000 170.48528 ? 122 A  B C5    1 
ATOM   3820 C  C6    . A  B 1 20  ? 91.31600 30.77300 97.16300  1.000 174.27258 ? 122 A  B C6    1 
ATOM   3821 N  N6    . A  B 1 20  ? 90.37200 29.84000 97.02700  1.000 170.94060 ? 122 A  B N6    1 
ATOM   3822 N  N1    . A  B 1 20  ? 91.68900 31.11100 98.41700  1.000 177.12292 ? 122 A  B N1    1 
ATOM   3823 C  C2    . A  B 1 20  ? 92.63500 32.04600 98.57300  1.000 173.32509 ? 122 A  B C2    1 
ATOM   3824 N  N3    . A  B 1 20  ? 93.30000 32.73000 97.64400  1.000 171.53540 ? 122 A  B N3    1 
ATOM   3825 C  C4    . A  B 1 20  ? 92.89700 32.37800 96.41200  1.000 170.60635 ? 122 A  B C4    1 
ATOM   3826 P  P     . A  B 1 21  ? 97.85200 36.77800 95.20700  1.000 168.43493 ? 123 A  B P     1 
ATOM   3827 O  OP1   . A  B 1 21  ? 98.82600 36.20000 94.24700  1.000 156.87565 ? 123 A  B OP1   1 
ATOM   3828 O  OP2   . A  B 1 21  ? 98.32000 37.19500 96.55300  1.000 166.06623 ? 123 A  B OP2   1 
ATOM   3829 O  "O5'" . A  B 1 21  ? 97.15500 38.03200 94.51200  1.000 157.55468 ? 123 A  B "O5'" 1 
ATOM   3830 C  "C5'" . A  B 1 21  ? 97.48500 38.39300 93.17500  1.000 157.15463 ? 123 A  B "C5'" 1 
ATOM   3831 C  "C4'" . A  B 1 21  ? 96.32700 39.02400 92.43600  1.000 150.02483 ? 123 A  B "C4'" 1 
ATOM   3832 O  "O4'" . A  B 1 21  ? 95.19500 38.10800 92.40100  1.000 145.44007 ? 123 A  B "O4'" 1 
ATOM   3833 C  "C3'" . A  B 1 21  ? 95.79400 40.34700 93.00400  1.000 145.22162 ? 123 A  B "C3'" 1 
ATOM   3834 O  "O3'" . A  B 1 21  ? 95.50000 41.23700 91.92900  1.000 139.36829 ? 123 A  B "O3'" 1 
ATOM   3835 C  "C2'" . A  B 1 21  ? 94.49600 39.92800 93.69700  1.000 139.53673 ? 123 A  B "C2'" 1 
ATOM   3836 O  "O2'" . A  B 1 21  ? 93.52300 40.94800 93.79700  1.000 134.53613 ? 123 A  B "O2'" 1 
ATOM   3837 C  "C1'" . A  B 1 21  ? 94.02600 38.78700 92.80300  1.000 137.47859 ? 123 A  B "C1'" 1 
ATOM   3838 N  N9    . A  B 1 21  ? 93.12300 37.84300 93.47100  1.000 137.47859 ? 123 A  B N9    1 
ATOM   3839 C  C8    . A  B 1 21  ? 92.90700 37.70300 94.82000  1.000 139.20248 ? 123 A  B C8    1 
ATOM   3840 N  N7    . A  B 1 21  ? 92.02800 36.78000 95.12800  1.000 139.62359 ? 123 A  B N7    1 
ATOM   3841 C  C5    . A  B 1 21  ? 91.62900 36.28500 93.89500  1.000 144.26888 ? 123 A  B C5    1 
ATOM   3842 C  C6    . A  B 1 21  ? 90.71200 35.28700 93.52900  1.000 143.23191 ? 123 A  B C6    1 
ATOM   3843 N  N6    . A  B 1 21  ? 90.00400 34.57900 94.40800  1.000 144.72420 ? 123 A  B N6    1 
ATOM   3844 N  N1    . A  B 1 21  ? 90.54500 35.03600 92.21400  1.000 132.77276 ? 123 A  B N1    1 
ATOM   3845 C  C2    . A  B 1 21  ? 91.25800 35.74500 91.32900  1.000 132.38851 ? 123 A  B C2    1 
ATOM   3846 N  N3    . A  B 1 21  ? 92.15100 36.70800 91.54800  1.000 137.81284 ? 123 A  B N3    1 
ATOM   3847 C  C4    . A  B 1 21  ? 92.29200 36.93200 92.86700  1.000 141.03165 ? 123 A  B C4    1 
ATOM   3848 P  P     . C  B 1 22  ? 96.57900 42.34500 91.49300  1.000 151.91286 ? 124 C  B P     1 
ATOM   3849 O  OP1   . C  B 1 22  ? 97.84400 42.02800 92.20000  1.000 156.37919 ? 124 C  B OP1   1 
ATOM   3850 O  OP2   . C  B 1 22  ? 95.96500 43.68700 91.65500  1.000 147.86501 ? 124 C  B OP2   1 
ATOM   3851 O  "O5'" . C  B 1 22  ? 96.79900 42.08200 89.93600  1.000 153.41041 ? 124 C  B "O5'" 1 
ATOM   3852 C  "C5'" . C  B 1 22  ? 95.93300 42.65200 88.96300  1.000 149.84419 ? 124 C  B "C5'" 1 
ATOM   3853 C  "C4'" . C  B 1 22  ? 95.65900 41.68800 87.83500  1.000 144.84622 ? 124 C  B "C4'" 1 
ATOM   3854 O  "O4'" . C  B 1 22  ? 95.03800 40.49200 88.36200  1.000 137.51377 ? 124 C  B "O4'" 1 
ATOM   3855 C  "C3'" . C  B 1 22  ? 94.70000 42.17200 86.75800  1.000 146.11743 ? 124 C  B "C3'" 1 
ATOM   3856 O  "O3'" . C  B 1 22  ? 95.35900 42.95900 85.77400  1.000 169.17809 ? 124 C  B "O3'" 1 
ATOM   3857 C  "C2'" . C  B 1 22  ? 94.12900 40.87300 86.18800  1.000 140.71152 ? 124 C  B "C2'" 1 
ATOM   3858 O  "O2'" . C  B 1 22  ? 94.98400 40.35100 85.18300  1.000 156.28707 ? 124 C  B "O2'" 1 
ATOM   3859 C  "C1'" . C  B 1 22  ? 94.17200 39.93300 87.40100  1.000 132.00521 ? 124 C  B "C1'" 1 
ATOM   3860 N  N1    . C  B 1 22  ? 92.84600 39.67700 88.01500  1.000 128.08106 ? 124 C  B N1    1 
ATOM   3861 C  C2    . C  B 1 22  ? 91.90400 38.90800 87.32000  1.000 124.64643 ? 124 C  B C2    1 
ATOM   3862 O  O2    . C  B 1 22  ? 92.17900 38.48300 86.18700  1.000 129.89443 ? 124 C  B O2    1 
ATOM   3863 N  N3    . C  B 1 22  ? 90.70300 38.65000 87.88800  1.000 119.53266 ? 124 C  B N3    1 
ATOM   3864 C  C4    . C  B 1 22  ? 90.42600 39.11200 89.10800  1.000 123.10151 ? 124 C  B C4    1 
ATOM   3865 N  N4    . C  B 1 22  ? 89.22500 38.83200 89.62600  1.000 124.75961 ? 124 C  B N4    1 
ATOM   3866 C  C5    . C  B 1 22  ? 91.37200 39.88500 89.84400  1.000 128.00473 ? 124 C  B C5    1 
ATOM   3867 C  C6    . C  B 1 22  ? 92.55700 40.13300 89.27000  1.000 129.16803 ? 124 C  B C6    1 
ATOM   3868 P  P     . A  B 1 23  ? 95.52500 44.54900 85.94400  1.000 177.64415 ? 125 A  B P     1 
ATOM   3869 O  OP1   . A  B 1 23  ? 96.95400 44.80900 86.26200  1.000 160.07625 ? 125 A  B OP1   1 
ATOM   3870 O  OP2   . A  B 1 23  ? 94.46300 45.05700 86.85000  1.000 158.46817 ? 125 A  B OP2   1 
ATOM   3871 O  "O5'" . A  B 1 23  ? 95.25700 45.11100 84.47600  1.000 145.37976 ? 125 A  B "O5'" 1 
ATOM   3872 C  "C5'" . A  B 1 23  ? 96.30000 45.15800 83.51300  1.000 145.45082 ? 125 A  B "C5'" 1 
ATOM   3873 C  "C4'" . A  B 1 23  ? 95.79000 44.93900 82.10900  1.000 145.05603 ? 125 A  B "C4'" 1 
ATOM   3874 O  "O4'" . A  B 1 23  ? 96.11500 43.61100 81.65600  1.000 143.34793 ? 125 A  B "O4'" 1 
ATOM   3875 C  "C3'" . A  B 1 23  ? 94.28500 45.04200 81.89500  1.000 137.45775 ? 125 A  B "C3'" 1 
ATOM   3876 O  "O3'" . A  B 1 23  ? 93.87000 46.38900 81.75000  1.000 132.14922 ? 125 A  B "O3'" 1 
ATOM   3877 C  "C2'" . A  B 1 23  ? 94.05000 44.22000 80.62700  1.000 133.88890 ? 125 A  B "C2'" 1 
ATOM   3878 O  "O2'" . A  B 1 23  ? 94.14600 45.04000 79.46800  1.000 128.64091 ? 125 A  B "O2'" 1 
ATOM   3879 C  "C1'" . A  B 1 23  ? 95.22900 43.23500 80.62200  1.000 138.37102 ? 125 A  B "C1'" 1 
ATOM   3880 N  N9    . A  B 1 23  ? 94.87300 41.80400 80.72700  1.000 141.98198 ? 125 A  B N9    1 
ATOM   3881 C  C8    . A  B 1 23  ? 95.64100 40.80900 80.17200  1.000 141.25294 ? 125 A  B C8    1 
ATOM   3882 N  N7    . A  B 1 23  ? 95.19200 39.59600 80.35000  1.000 143.56112 ? 125 A  B N7    1 
ATOM   3883 C  C5    . A  B 1 23  ? 94.03000 39.79300 81.07300  1.000 148.91439 ? 125 A  B C5    1 
ATOM   3884 C  C6    . A  B 1 23  ? 93.09000 38.87500 81.56900  1.000 153.05699 ? 125 A  B C6    1 
ATOM   3885 N  N6    . A  B 1 23  ? 93.18200 37.55400 81.41000  1.000 147.29051 ? 125 A  B N6    1 
ATOM   3886 N  N1    . A  B 1 23  ? 92.03800 39.36100 82.25000  1.000 149.93556 ? 125 A  B N1    1 
ATOM   3887 C  C2    . A  B 1 23  ? 91.96000 40.68300 82.40400  1.000 141.42665 ? 125 A  B C2    1 
ATOM   3888 N  N3    . A  B 1 23  ? 92.77200 41.65100 81.98900  1.000 141.69773 ? 125 A  B N3    1 
ATOM   3889 C  C4    . A  B 1 23  ? 93.81300 41.14200 81.31700  1.000 144.80074 ? 125 A  B C4    1 
ATOM   3890 P  P     . G  B 1 24  ? 92.81700 47.05900 82.76100  1.000 136.32537 ? 126 G  B P     1 
ATOM   3891 O  OP1   . G  B 1 24  ? 92.35500 48.32400 82.12900  1.000 135.69372 ? 126 G  B OP1   1 
ATOM   3892 O  OP2   . G  B 1 24  ? 93.40800 47.09900 84.12500  1.000 145.80809 ? 126 G  B OP2   1 
ATOM   3893 O  "O5'" . G  B 1 24  ? 91.59300 46.04200 82.77800  1.000 128.17440 ? 126 G  B "O5'" 1 
ATOM   3894 C  "C5'" . G  B 1 24  ? 90.84200 45.77300 81.60300  1.000 121.54728 ? 126 G  B "C5'" 1 
ATOM   3895 C  "C4'" . G  B 1 24  ? 89.90700 44.61500 81.82200  1.000 113.75951 ? 126 G  B "C4'" 1 
ATOM   3896 O  "O4'" . G  B 1 24  ? 90.60800 43.58000 82.55900  1.000 122.53951 ? 126 G  B "O4'" 1 
ATOM   3897 C  "C3'" . G  B 1 24  ? 88.68700 44.91300 82.67800  1.000 109.04315 ? 126 G  B "C3'" 1 
ATOM   3898 O  "O3'" . G  B 1 24  ? 87.62700 45.49500 81.94200  1.000 112.36724 ? 126 G  B "O3'" 1 
ATOM   3899 C  "C2'" . G  B 1 24  ? 88.34400 43.55400 83.26600  1.000 110.16171 ? 126 G  B "C2'" 1 
ATOM   3900 O  "O2'" . G  B 1 24  ? 87.65500 42.75700 82.31600  1.000 110.37752 ? 126 G  B "O2'" 1 
ATOM   3901 C  "C1'" . G  B 1 24  ? 89.73200 42.95500 83.47100  1.000 119.06014 ? 126 G  B "C1'" 1 
ATOM   3902 N  N9    . G  B 1 24  ? 90.24400 43.17300 84.84000  1.000 124.54764 ? 126 G  B N9    1 
ATOM   3903 C  C8    . G  B 1 24  ? 91.29800 43.97300 85.22100  1.000 125.57408 ? 126 G  B C8    1 
ATOM   3904 N  N7    . G  B 1 24  ? 91.51500 43.95500 86.51200  1.000 127.54274 ? 126 G  B N7    1 
ATOM   3905 C  C5    . G  B 1 24  ? 90.54900 43.09400 87.01900  1.000 122.96851 ? 126 G  B C5    1 
ATOM   3906 C  C6    . G  B 1 24  ? 90.28100 42.68000 88.35200  1.000 119.96552 ? 126 G  B C6    1 
ATOM   3907 O  O6    . G  B 1 24  ? 90.86400 43.00100 89.39200  1.000 116.51247 ? 126 G  B O6    1 
ATOM   3908 N  N1    . G  B 1 24  ? 89.20700 41.80000 88.40600  1.000 119.58389 ? 126 G  B N1    1 
ATOM   3909 C  C2    . G  B 1 24  ? 88.48200 41.36900 87.32400  1.000 117.86263 ? 126 G  B C2    1 
ATOM   3910 N  N2    . G  B 1 24  ? 87.48100 40.51700 87.59200  1.000 115.29390 ? 126 G  B N2    1 
ATOM   3911 N  N3    . G  B 1 24  ? 88.71900 41.74700 86.07800  1.000 118.63378 ? 126 G  B N3    1 
ATOM   3912 C  C4    . G  B 1 24  ? 89.76100 42.60200 85.99700  1.000 120.48926 ? 126 G  B C4    1 
ATOM   3913 P  P     . C  B 1 25  ? 86.76300 46.68400 82.58700  1.000 103.22400 ? 127 C  B P     1 
ATOM   3914 O  OP1   . C  B 1 25  ? 85.83400 47.18000 81.54100  1.000 108.96680 ? 127 C  B OP1   1 
ATOM   3915 O  OP2   . C  B 1 25  ? 87.69800 47.63500 83.24500  1.000 106.88234 ? 127 C  B OP2   1 
ATOM   3916 O  "O5'" . C  B 1 25  ? 85.91700 45.96500 83.73100  1.000 100.21575 ? 127 C  B "O5'" 1 
ATOM   3917 C  "C5'" . C  B 1 25  ? 85.02600 44.90000 83.42900  1.000 98.82348  ? 127 C  B "C5'" 1 
ATOM   3918 C  "C4'" . C  B 1 25  ? 84.49400 44.25700 84.68600  1.000 109.48002 ? 127 C  B "C4'" 1 
ATOM   3919 O  "O4'" . C  B 1 25  ? 85.56700 43.56900 85.38100  1.000 110.25906 ? 127 C  B "O4'" 1 
ATOM   3920 C  "C3'" . C  B 1 25  ? 83.93000 45.21000 85.72700  1.000 107.50873 ? 127 C  B "C3'" 1 
ATOM   3921 O  "O3'" . C  B 1 25  ? 82.60100 45.60900 85.44600  1.000 109.13787 ? 127 C  B "O3'" 1 
ATOM   3922 C  "C2'" . C  B 1 25  ? 84.07000 44.42000 87.02000  1.000 110.08272 ? 127 C  B "C2'" 1 
ATOM   3923 O  "O2'" . C  B 1 25  ? 83.02300 43.46700 87.14100  1.000 110.54330 ? 127 C  B "O2'" 1 
ATOM   3924 C  "C1'" . C  B 1 25  ? 85.38500 43.67600 86.77900  1.000 114.23322 ? 127 C  B "C1'" 1 
ATOM   3925 N  N1    . C  B 1 25  ? 86.55200 44.39000 87.35000  1.000 121.23932 ? 127 C  B N1    1 
ATOM   3926 C  C2    . C  B 1 25  ? 86.80100 44.31200 88.72600  1.000 119.99707 ? 127 C  B C2    1 
ATOM   3927 O  O2    . C  B 1 25  ? 86.03900 43.65300 89.45000  1.000 119.20487 ? 127 C  B O2    1 
ATOM   3928 N  N3    . C  B 1 25  ? 87.87000 44.96200 89.24300  1.000 119.63387 ? 127 C  B N3    1 
ATOM   3929 C  C4    . C  B 1 25  ? 88.67400 45.66500 88.44300  1.000 117.68890 ? 127 C  B C4    1 
ATOM   3930 N  N4    . C  B 1 25  ? 89.71300 46.28900 88.99900  1.000 119.33120 ? 127 C  B N4    1 
ATOM   3931 C  C5    . C  B 1 25  ? 88.44900 45.76200 87.04000  1.000 121.50778 ? 127 C  B C5    1 
ATOM   3932 C  C6    . C  B 1 25  ? 87.38900 45.11300 86.54200  1.000 118.93905 ? 127 C  B C6    1 
ATOM   3933 P  P     . C  B 1 26  ? 82.17100 47.14500 85.62100  1.000 104.35721 ? 128 C  B P     1 
ATOM   3934 O  OP1   . C  B 1 26  ? 80.84300 47.30500 84.97400  1.000 114.41368 ? 128 C  B OP1   1 
ATOM   3935 O  OP2   . C  B 1 26  ? 83.30800 47.98900 85.17300  1.000 111.08170 ? 128 C  B OP2   1 
ATOM   3936 O  "O5'" . C  B 1 26  ? 82.01500 47.32700 87.19800  1.000 113.97941 ? 128 C  B "O5'" 1 
ATOM   3937 C  "C5'" . C  B 1 26  ? 81.07100 46.55900 87.93200  1.000 123.57267 ? 128 C  B "C5'" 1 
ATOM   3938 C  "C4'" . C  B 1 26  ? 81.13400 46.85200 89.41200  1.000 127.07572 ? 128 C  B "C4'" 1 
ATOM   3939 O  "O4'" . C  B 1 26  ? 82.30400 46.21400 89.99300  1.000 125.02548 ? 128 C  B "O4'" 1 
ATOM   3940 C  "C3'" . C  B 1 26  ? 81.27800 48.31300 89.80500  1.000 131.75786 ? 128 C  B "C3'" 1 
ATOM   3941 O  "O3'" . C  B 1 26  ? 80.05100 49.02300 89.76700  1.000 139.64828 ? 128 C  B "O3'" 1 
ATOM   3942 C  "C2'" . C  B 1 26  ? 81.89500 48.22500 91.19400  1.000 135.50305 ? 128 C  B "C2'" 1 
ATOM   3943 O  "O2'" . C  B 1 26  ? 80.90700 47.91900 92.16800  1.000 146.09906 ? 128 C  B "O2'" 1 
ATOM   3944 C  "C1'" . C  B 1 26  ? 82.81900 47.01600 91.03800  1.000 129.61813 ? 128 C  B "C1'" 1 
ATOM   3945 N  N1    . C  B 1 26  ? 84.19900 47.42500 90.68900  1.000 127.20995 ? 128 C  B N1    1 
ATOM   3946 C  C2    . C  B 1 26  ? 85.04700 47.92200 91.68600  1.000 133.16329 ? 128 C  B C2    1 
ATOM   3947 O  O2    . C  B 1 26  ? 84.63600 48.00000 92.85300  1.000 135.02404 ? 128 C  B O2    1 
ATOM   3948 N  N3    . C  B 1 26  ? 86.30100 48.30200 91.35200  1.000 134.08709 ? 128 C  B N3    1 
ATOM   3949 C  C4    . C  B 1 26  ? 86.71600 48.20400 90.08700  1.000 129.90238 ? 128 C  B C4    1 
ATOM   3950 N  N4    . C  B 1 26  ? 87.96400 48.58900 89.80300  1.000 129.43916 ? 128 C  B N4    1 
ATOM   3951 C  C5    . C  B 1 26  ? 85.87000 47.70600 89.05300  1.000 124.97810 ? 128 C  B C5    1 
ATOM   3952 C  C6    . C  B 1 26  ? 84.63400 47.33500 89.39900  1.000 121.08816 ? 128 C  B C6    1 
ATOM   3953 P  P     . G  B 1 27  ? 80.03200 50.58700 89.39900  1.000 141.19512 ? 129 G  B P     1 
ATOM   3954 O  OP1   . G  B 1 27  ? 78.61300 50.98400 89.22400  1.000 182.94486 ? 129 G  B OP1   1 
ATOM   3955 O  OP2   . G  B 1 27  ? 80.98100 50.81100 88.28100  1.000 138.51585 ? 129 G  B OP2   1 
ATOM   3956 O  "O5'" . G  B 1 27  ? 80.58800 51.29300 90.71700  1.000 147.60378 ? 129 G  B "O5'" 1 
ATOM   3957 C  "C5'" . G  B 1 27  ? 79.89900 51.14900 91.95200  1.000 154.17562 ? 129 G  B "C5'" 1 
ATOM   3958 C  "C4'" . G  B 1 27  ? 80.65500 51.75100 93.11100  1.000 145.55090 ? 129 G  B "C4'" 1 
ATOM   3959 O  "O4'" . G  B 1 27  ? 81.88400 51.02200 93.34800  1.000 138.46584 ? 129 G  B "O4'" 1 
ATOM   3960 C  "C3'" . G  B 1 27  ? 81.10400 53.19500 92.95400  1.000 144.63500 ? 129 G  B "C3'" 1 
ATOM   3961 O  "O3'" . G  B 1 27  ? 80.05300 54.10400 93.22400  1.000 148.04594 ? 129 G  B "O3'" 1 
ATOM   3962 C  "C2'" . G  B 1 27  ? 82.25500 53.29300 93.94800  1.000 144.90609 ? 129 G  B "C2'" 1 
ATOM   3963 O  "O2'" . G  B 1 27  ? 81.77300 53.46900 95.27300  1.000 145.61144 ? 129 G  B "O2'" 1 
ATOM   3964 C  "C1'" . G  B 1 27  ? 82.87600 51.90000 93.83300  1.000 142.22156 ? 129 G  B "C1'" 1 
ATOM   3965 N  N9    . G  B 1 27  ? 84.00600 51.88800 92.89400  1.000 141.36619 ? 129 G  B N9    1 
ATOM   3966 C  C8    . G  B 1 27  ? 84.05500 51.29500 91.65800  1.000 139.99234 ? 129 G  B C8    1 
ATOM   3967 N  N7    . G  B 1 27  ? 85.20500 51.45800 91.06600  1.000 137.18148 ? 129 G  B N7    1 
ATOM   3968 C  C5    . G  B 1 27  ? 85.94900 52.20300 91.97100  1.000 139.42122 ? 129 G  B C5    1 
ATOM   3969 C  C6    . G  B 1 27  ? 87.27600 52.68900 91.89100  1.000 140.76085 ? 129 G  B C6    1 
ATOM   3970 O  O6    . G  B 1 27  ? 88.08400 52.54900 90.96600  1.000 141.89257 ? 129 G  B O6    1 
ATOM   3971 N  N1    . G  B 1 27  ? 87.63600 53.39900 93.03400  1.000 142.84005 ? 129 G  B N1    1 
ATOM   3972 C  C2    . G  B 1 27  ? 86.82300 53.61900 94.11700  1.000 142.76899 ? 129 G  B C2    1 
ATOM   3973 N  N2    . G  B 1 27  ? 87.35600 54.32900 95.12200  1.000 141.43988 ? 129 G  B N2    1 
ATOM   3974 N  N3    . G  B 1 27  ? 85.58400 53.17000 94.20700  1.000 146.51681 ? 129 G  B N3    1 
ATOM   3975 C  C4    . G  B 1 27  ? 85.22100 52.47900 93.10600  1.000 141.58464 ? 129 G  B C4    1 
ATOM   3976 P  P     . U  B 1 28  ? 79.87600 55.47900 92.40500  1.000 147.03647 ? 130 U  B P     1 
ATOM   3977 O  OP1   . U  B 1 28  ? 78.51600 55.40800 91.83000  1.000 152.42133 ? 130 U  B OP1   1 
ATOM   3978 O  OP2   . U  B 1 28  ? 81.01400 55.77800 91.50900  1.000 145.72842 ? 130 U  B OP2   1 
ATOM   3979 O  "O5'" . U  B 1 28  ? 79.89600 56.57200 93.57100  1.000 156.31653 ? 130 U  B "O5'" 1 
ATOM   3980 C  "C5'" . U  B 1 28  ? 80.67000 56.43700 94.77200  1.000 160.40124 ? 130 U  B "C5'" 1 
ATOM   3981 C  "C4'" . U  B 1 28  ? 81.74400 57.49300 94.98500  1.000 160.65127 ? 130 U  B "C4'" 1 
ATOM   3982 O  "O4'" . U  B 1 28  ? 83.03700 56.84700 95.15400  1.000 151.33173 ? 130 U  B "O4'" 1 
ATOM   3983 C  "C3'" . U  B 1 28  ? 82.04000 58.47500 93.85700  1.000 167.36260 ? 130 U  B "C3'" 1 
ATOM   3984 O  "O3'" . U  B 1 28  ? 80.99600 59.36600 93.41200  1.000 174.23974 ? 130 U  B "O3'" 1 
ATOM   3985 C  "C2'" . U  B 1 28  ? 83.42500 59.00500 94.22500  1.000 168.10742 ? 130 U  B "C2'" 1 
ATOM   3986 O  "O2'" . U  B 1 28  ? 83.45900 59.88000 95.34300  1.000 177.05586 ? 130 U  B "O2'" 1 
ATOM   3987 C  "C1'" . U  B 1 28  ? 84.06500 57.66300 94.59600  1.000 159.57219 ? 130 U  B "C1'" 1 
ATOM   3988 N  N1    . U  B 1 28  ? 84.75500 56.98100 93.40900  1.000 157.79566 ? 130 U  B N1    1 
ATOM   3989 C  C2    . U  B 1 28  ? 86.15300 57.06300 93.24800  1.000 152.25289 ? 130 U  B C2    1 
ATOM   3990 O  O2    . U  B 1 28  ? 86.92900 57.57700 94.05000  1.000 153.60832 ? 130 U  B O2    1 
ATOM   3991 N  N3    . U  B 1 28  ? 86.62900 56.42800 92.10900  1.000 145.94687 ? 130 U  B N3    1 
ATOM   3992 C  C4    . U  B 1 28  ? 85.86700 55.76100 91.14500  1.000 142.37276 ? 130 U  B C4    1 
ATOM   3993 O  O4    . U  B 1 28  ? 86.41100 55.24900 90.17700  1.000 143.58869 ? 130 U  B O4    1 
ATOM   3994 C  C5    . U  B 1 28  ? 84.44300 55.73500 91.35600  1.000 141.60688 ? 130 U  B C5    1 
ATOM   3995 C  C6    . U  B 1 28  ? 83.96400 56.34000 92.44300  1.000 151.27909 ? 130 U  B C6    1 
ATOM   3996 P  P     . A  B 1 29  ? 80.21500 60.56700 94.15800  1.000 186.13871 ? 131 A  B P     1 
ATOM   3997 O  OP1   . A  B 1 29  ? 78.80700 60.14800 94.39300  1.000 179.30368 ? 131 A  B OP1   1 
ATOM   3998 O  OP2   . A  B 1 29  ? 80.45800 61.78000 93.32100  1.000 178.26408 ? 131 A  B OP2   1 
ATOM   3999 O  "O5'" . A  B 1 29  ? 80.92800 60.70800 95.60800  1.000 178.84047 ? 131 A  B "O5'" 1 
ATOM   4000 C  "C5'" . A  B 1 29  ? 80.59100 61.71900 96.55200  1.000 176.10856 ? 131 A  B "C5'" 1 
ATOM   4001 C  "C4'" . A  B 1 29  ? 81.20600 63.04400 96.13100  1.000 180.65121 ? 131 A  B "C4'" 1 
ATOM   4002 O  "O4'" . A  B 1 29  ? 80.35600 64.15500 96.51100  1.000 183.02255 ? 131 A  B "O4'" 1 
ATOM   4003 C  "C3'" . A  B 1 29  ? 82.63000 63.31300 96.60500  1.000 180.18800 ? 131 A  B "C3'" 1 
ATOM   4004 O  "O3'" . A  B 1 29  ? 83.60700 63.36100 95.52200  1.000 182.66724 ? 131 A  B "O3'" 1 
ATOM   4005 C  "C2'" . A  B 1 29  ? 82.51700 64.54700 97.50400  1.000 181.99085 ? 131 A  B "C2'" 1 
ATOM   4006 O  "O2'" . A  B 1 29  ? 83.53200 65.51200 97.29600  1.000 185.11227 ? 131 A  B "O2'" 1 
ATOM   4007 C  "C1'" . A  B 1 29  ? 81.08600 65.08900 97.28200  1.000 182.09086 ? 131 A  B "C1'" 1 
ATOM   4008 N  N9    . A  B 1 29  ? 80.34100 65.33000 98.52600  1.000 178.93522 ? 131 A  B N9    1 
ATOM   4009 C  C8    . A  B 1 29  ? 79.07400 64.88400 98.81200  1.000 173.33718 ? 131 A  B C8    1 
ATOM   4010 N  N7    . A  B 1 29  ? 78.59800 65.29400 99.97900  1.000 172.85554 ? 131 A  B N7    1 
ATOM   4011 C  C5    . A  B 1 29  ? 79.63100 66.07000 100.52200 1.000 184.74907 ? 131 A  B C5    1 
ATOM   4012 C  C6    . A  B 1 29  ? 79.76600 66.84000 101.74100 1.000 176.76917 ? 131 A  B C6    1 
ATOM   4013 N  N6    . A  B 1 29  ? 78.82800 66.92100 102.70700 1.000 158.86176 ? 131 A  B N6    1 
ATOM   4014 N  N1    . A  B 1 29  ? 80.94100 67.52000 101.94600 1.000 182.43564 ? 131 A  B N1    1 
ATOM   4015 C  C2    . A  B 1 29  ? 81.92900 67.41900 101.01200 1.000 184.82276 ? 131 A  B C2    1 
ATOM   4016 N  N3    . A  B 1 29  ? 81.91300 66.75900 99.83100  1.000 186.19661 ? 131 A  B N3    1 
ATOM   4017 C  C4    . A  B 1 29  ? 80.73200 66.08800 99.63200  1.000 184.34639 ? 131 A  B C4    1 
ATOM   4018 P  P     . C  B 1 30  ? 83.67000 64.50900 94.39400  1.000 190.65202 ? 132 C  B P     1 
ATOM   4019 O  OP1   . C  B 1 30  ? 83.28000 65.83600 94.92800  1.000 187.40163 ? 132 C  B OP1   1 
ATOM   4020 O  OP2   . C  B 1 30  ? 82.99200 63.99200 93.17700  1.000 173.15255 ? 132 C  B OP2   1 
ATOM   4021 O  "O5'" . C  B 1 30  ? 85.23200 64.57400 94.07600  1.000 187.19897 ? 132 C  B "O5'" 1 
ATOM   4022 C  "C5'" . C  B 1 30  ? 86.17600 64.65800 95.13700  1.000 179.70597 ? 132 C  B "C5'" 1 
ATOM   4023 C  "C4'" . C  B 1 30  ? 87.57500 64.28200 94.70500  1.000 175.25017 ? 132 C  B "C4'" 1 
ATOM   4024 O  "O4'" . C  B 1 30  ? 87.74300 62.83900 94.68600  1.000 172.86567 ? 132 C  B "O4'" 1 
ATOM   4025 C  "C3'" . C  B 1 30  ? 88.00300 64.71300 93.31400  1.000 169.87321 ? 132 C  B "C3'" 1 
ATOM   4026 O  "O3'" . C  B 1 30  ? 88.33500 66.08700 93.23900  1.000 167.98877 ? 132 C  B "O3'" 1 
ATOM   4027 C  "C2'" . C  B 1 30  ? 89.17500 63.78000 93.03000  1.000 168.73886 ? 132 C  B "C2'" 1 
ATOM   4028 O  "O2'" . C  B 1 30  ? 90.35600 64.23500 93.68100  1.000 164.71733 ? 132 C  B "O2'" 1 
ATOM   4029 C  "C1'" . C  B 1 30  ? 88.70700 62.48700 93.70900  1.000 170.44959 ? 132 C  B "C1'" 1 
ATOM   4030 N  N1    . C  B 1 30  ? 88.10800 61.53600 92.74000  1.000 163.52771 ? 132 C  B N1    1 
ATOM   4031 C  C2    . C  B 1 30  ? 88.97500 60.79100 91.92900  1.000 157.10589 ? 132 C  B C2    1 
ATOM   4032 O  O2    . C  B 1 30  ? 90.20100 60.94300 92.05100  1.000 159.47723 ? 132 C  B O2    1 
ATOM   4033 N  N3    . C  B 1 30  ? 88.46500 59.91900 91.02900  1.000 153.16858 ? 132 C  B N3    1 
ATOM   4034 C  C4    . C  B 1 30  ? 87.14400 59.77200 90.92000  1.000 154.44504 ? 132 C  B C4    1 
ATOM   4035 N  N4    . C  B 1 30  ? 86.68300 58.89800 90.01800  1.000 153.48440 ? 132 C  B N4    1 
ATOM   4036 C  C5    . C  B 1 30  ? 86.23600 60.51900 91.73100  1.000 160.15626 ? 132 C  B C5    1 
ATOM   4037 C  C6    . C  B 1 30  ? 86.75300 61.38300 92.61900  1.000 164.09357 ? 132 C  B C6    1 
ATOM   4038 P  P     . A  B 1 31  ? 88.19600 66.87200 91.84500  1.000 176.71886 ? 133 A  B P     1 
ATOM   4039 O  OP1   . A  B 1 31  ? 88.29500 68.32100 92.14100  1.000 175.36081 ? 133 A  B OP1   1 
ATOM   4040 O  OP2   . A  B 1 31  ? 87.00600 66.35000 91.12400  1.000 168.79423 ? 133 A  B OP2   1 
ATOM   4041 O  "O5'" . A  B 1 31  ? 89.50100 66.44600 91.03500  1.000 165.04904 ? 133 A  B "O5'" 1 
ATOM   4042 C  "C5'" . A  B 1 31  ? 90.79600 66.73200 91.54500  1.000 163.69099 ? 133 A  B "C5'" 1 
ATOM   4043 C  "C4'" . A  B 1 31  ? 91.88000 66.07900 90.72600  1.000 157.66395 ? 133 A  B "C4'" 1 
ATOM   4044 O  "O4'" . A  B 1 31  ? 91.78400 64.63500 90.83700  1.000 159.89316 ? 133 A  B "O4'" 1 
ATOM   4045 C  "C3'" . A  B 1 31  ? 91.83400 66.33400 89.22900  1.000 153.44239 ? 133 A  B "C3'" 1 
ATOM   4046 O  "O3'" . A  B 1 31  ? 92.36900 67.59600 88.86400  1.000 157.06914 ? 133 A  B "O3'" 1 
ATOM   4047 C  "C2'" . A  B 1 31  ? 92.60700 65.14700 88.66900  1.000 150.73417 ? 133 A  B "C2'" 1 
ATOM   4048 O  "O2'" . A  B 1 31  ? 94.00600 65.33600 88.82400  1.000 151.01052 ? 133 A  B "O2'" 1 
ATOM   4049 C  "C1'" . A  B 1 31  ? 92.16400 64.03200 89.61800  1.000 154.77150 ? 133 A  B "C1'" 1 
ATOM   4050 N  N9    . A  B 1 31  ? 91.01100 63.28800 89.08100  1.000 153.07656 ? 133 A  B N9    1 
ATOM   4051 C  C8    . A  B 1 31  ? 89.70600 63.33300 89.49800  1.000 154.46883 ? 133 A  B C8    1 
ATOM   4052 N  N7    . A  B 1 31  ? 88.90500 62.55600 88.81300  1.000 150.13410 ? 133 A  B N7    1 
ATOM   4053 C  C5    . A  B 1 31  ? 89.73900 61.96100 87.88000  1.000 145.20456 ? 133 A  B C5    1 
ATOM   4054 C  C6    . A  B 1 31  ? 89.50200 61.02900 86.85300  1.000 142.45423 ? 133 A  B C6    1 
ATOM   4055 N  N6    . A  B 1 31  ? 88.30100 60.50900 86.58400  1.000 140.46189 ? 133 A  B N6    1 
ATOM   4056 N  N1    . A  B 1 31  ? 90.55600 60.64200 86.09800  1.000 142.34106 ? 133 A  B N1    1 
ATOM   4057 C  C2    . A  B 1 31  ? 91.76200 61.16000 86.36400  1.000 145.73094 ? 133 A  B C2    1 
ATOM   4058 N  N3    . A  B 1 31  ? 92.10600 62.04200 87.30200  1.000 146.67316 ? 133 A  B N3    1 
ATOM   4059 C  C4    . A  B 1 31  ? 91.03900 62.40500 88.03200  1.000 146.91266 ? 133 A  B C4    1 
ATOM   4060 P  P     . G  B 1 32  ? 91.77100 68.39300 87.60300  1.000 157.28334 ? 134 G  B P     1 
ATOM   4061 O  OP1   . G  B 1 32  ? 92.20300 69.81100 87.70600  1.000 152.52751 ? 134 G  B OP1   1 
ATOM   4062 O  OP2   . G  B 1 32  ? 90.32400 68.07000 87.50900  1.000 152.31433 ? 134 G  B OP2   1 
ATOM   4063 O  "O5'" . G  B 1 32  ? 92.50400 67.73400 86.35100  1.000 145.41087 ? 134 G  B "O5'" 1 
ATOM   4064 C  "C5'" . G  B 1 32  ? 93.92100 67.66700 86.28600  1.000 144.94502 ? 134 G  B "C5'" 1 
ATOM   4065 C  "C4'" . G  B 1 32  ? 94.38100 66.65700 85.26500  1.000 139.27329 ? 134 G  B "C4'" 1 
ATOM   4066 O  "O4'" . G  B 1 32  ? 93.93800 65.33100 85.65100  1.000 143.40800 ? 134 G  B "O4'" 1 
ATOM   4067 C  "C3'" . G  B 1 32  ? 93.83300 66.83700 83.85900  1.000 130.76701 ? 134 G  B "C3'" 1 
ATOM   4068 O  "O3'" . G  B 1 32  ? 94.53700 67.81900 83.12000  1.000 131.84082 ? 134 G  B "O3'" 1 
ATOM   4069 C  "C2'" . G  B 1 32  ? 93.94300 65.43300 83.27600  1.000 128.64044 ? 134 G  B "C2'" 1 
ATOM   4070 O  "O2'" . G  B 1 32  ? 95.27400 65.16300 82.85800  1.000 125.68219 ? 134 G  B "O2'" 1 
ATOM   4071 C  "C1'" . G  B 1 32  ? 93.62900 64.57200 84.50000  1.000 137.19672 ? 134 G  B "C1'" 1 
ATOM   4072 N  N9    . G  B 1 32  ? 92.20700 64.18500 84.56100  1.000 138.38897 ? 134 G  B N9    1 
ATOM   4073 C  C8    . G  B 1 32  ? 91.27300 64.61100 85.47200  1.000 138.79955 ? 134 G  B C8    1 
ATOM   4074 N  N7    . G  B 1 32  ? 90.09200 64.09200 85.28000  1.000 137.67573 ? 134 G  B N7    1 
ATOM   4075 C  C5    . G  B 1 32  ? 90.25600 63.27100 84.17400  1.000 132.60670 ? 134 G  B C5    1 
ATOM   4076 C  C6    . G  B 1 32  ? 89.31800 62.44700 83.49700  1.000 133.28836 ? 134 G  B C6    1 
ATOM   4077 O  O6    . G  B 1 32  ? 88.11800 62.27200 83.75100  1.000 130.30906 ? 134 G  B O6    1 
ATOM   4078 N  N1    . G  B 1 32  ? 89.90600 61.78600 82.42300  1.000 133.74894 ? 134 G  B N1    1 
ATOM   4079 C  C2    . G  B 1 32  ? 91.22100 61.89800 82.04700  1.000 130.78017 ? 134 G  B C2    1 
ATOM   4080 N  N2    . G  B 1 32  ? 91.59800 61.17700 80.98100  1.000 121.87910 ? 134 G  B N2    1 
ATOM   4081 N  N3    . G  B 1 32  ? 92.10000 62.66600 82.66900  1.000 137.79680 ? 134 G  B N3    1 
ATOM   4082 C  C4    . G  B 1 32  ? 91.55500 63.31800 83.71600  1.000 134.09635 ? 134 G  B C4    1 
ATOM   4083 P  P     . U  B 1 33  ? 93.77100 68.72600 82.03700  1.000 138.95560 ? 135 U  B P     1 
ATOM   4084 O  OP1   . U  B 1 33  ? 94.65400 69.85800 81.66000  1.000 140.03468 ? 135 U  B OP1   1 
ATOM   4085 O  OP2   . U  B 1 33  ? 92.40800 69.01000 82.55200  1.000 138.59240 ? 135 U  B OP2   1 
ATOM   4086 O  "O5'" . U  B 1 33  ? 93.64700 67.77400 80.76700  1.000 129.37024 ? 135 U  B "O5'" 1 
ATOM   4087 C  "C5'" . U  B 1 33  ? 94.81000 67.23300 80.15500  1.000 126.59886 ? 135 U  B "C5'" 1 
ATOM   4088 C  "C4'" . U  B 1 33  ? 94.46700 66.15200 79.16200  1.000 125.66454 ? 135 U  B "C4'" 1 
ATOM   4089 O  "O4'" . U  B 1 33  ? 93.88300 65.01500 79.85000  1.000 122.96421 ? 135 U  B "O4'" 1 
ATOM   4090 C  "C3'" . U  B 1 33  ? 93.43200 66.51400 78.11200  1.000 119.22429 ? 135 U  B "C3'" 1 
ATOM   4091 O  "O3'" . U  B 1 33  ? 93.96400 67.27400 77.04300  1.000 121.64300 ? 135 U  B "O3'" 1 
ATOM   4092 C  "C2'" . U  B 1 33  ? 92.89700 65.15400 77.69400  1.000 121.30875 ? 135 U  B "C2'" 1 
ATOM   4093 O  "O2'" . U  B 1 33  ? 93.80500 64.50700 76.81300  1.000 119.66908 ? 135 U  B "O2'" 1 
ATOM   4094 C  "C1'" . U  B 1 33  ? 92.90000 64.41200 79.03200  1.000 122.35624 ? 135 U  B "C1'" 1 
ATOM   4095 N  N1    . U  B 1 33  ? 91.59100 64.51000 79.71700  1.000 124.53545 ? 135 U  B N1    1 
ATOM   4096 C  C2    . U  B 1 33  ? 90.56700 63.69700 79.26700  1.000 125.04867 ? 135 U  B C2    1 
ATOM   4097 O  O2    . U  B 1 33  ? 90.70000 62.91200 78.34500  1.000 127.97008 ? 135 U  B O2    1 
ATOM   4098 N  N3    . U  B 1 33  ? 89.37700 63.83500 79.93900  1.000 124.89076 ? 135 U  B N3    1 
ATOM   4099 C  C4    . U  B 1 33  ? 89.11000 64.68800 80.99200  1.000 130.59144 ? 135 U  B C4    1 
ATOM   4100 O  O4    . U  B 1 33  ? 87.98300 64.69900 81.49800  1.000 129.16496 ? 135 U  B O4    1 
ATOM   4101 C  C5    . U  B 1 33  ? 90.22200 65.49600 81.39700  1.000 130.80726 ? 135 U  B C5    1 
ATOM   4102 C  C6    . U  B 1 33  ? 91.39300 65.38400 80.76100  1.000 129.19127 ? 135 U  B C6    1 
ATOM   4103 P  P     . A  B 1 34  ? 93.15400 68.54100 76.48800  1.000 127.57650 ? 136 A  B P     1 
ATOM   4104 O  OP1   . A  B 1 34  ? 94.11400 69.39100 75.74400  1.000 132.85872 ? 136 A  B OP1   1 
ATOM   4105 O  OP2   . A  B 1 34  ? 92.37900 69.11900 77.61300  1.000 124.75511 ? 136 A  B OP2   1 
ATOM   4106 O  "O5'" . A  B 1 34  ? 92.13900 67.90700 75.43700  1.000 126.37373 ? 136 A  B "O5'" 1 
ATOM   4107 C  "C5'" . A  B 1 34  ? 92.63100 67.22200 74.29400  1.000 126.74219 ? 136 A  B "C5'" 1 
ATOM   4108 C  "C4'" . A  B 1 34  ? 91.65800 66.18700 73.78600  1.000 120.88096 ? 136 A  B "C4'" 1 
ATOM   4109 O  "O4'" . A  B 1 34  ? 91.32000 65.26000 74.85000  1.000 122.00478 ? 136 A  B "O4'" 1 
ATOM   4110 C  "C3'" . A  B 1 34  ? 90.31200 66.70800 73.31000  1.000 114.22490 ? 136 A  B "C3'" 1 
ATOM   4111 O  "O3'" . A  B 1 34  ? 90.36000 67.23200 71.99500  1.000 122.16533 ? 136 A  B "O3'" 1 
ATOM   4112 C  "C2'" . A  B 1 34  ? 89.42000 65.48200 73.44400  1.000 116.73310 ? 136 A  B "C2'" 1 
ATOM   4113 O  "O2'" . A  B 1 34  ? 89.62500 64.58700 72.36100  1.000 124.44981 ? 136 A  B "O2'" 1 
ATOM   4114 C  "C1'" . A  B 1 34  ? 89.97800 64.84400 74.71600  1.000 118.55963 ? 136 A  B "C1'" 1 
ATOM   4115 N  N9    . A  B 1 34  ? 89.23100 65.27900 75.90700  1.000 116.17514 ? 136 A  B N9    1 
ATOM   4116 C  C8    . A  B 1 34  ? 89.64200 66.11400 76.91400  1.000 116.14092 ? 136 A  B C8    1 
ATOM   4117 N  N7    . A  B 1 34  ? 88.73200 66.31400 77.83500  1.000 117.99378 ? 136 A  B N7    1 
ATOM   4118 C  C5    . A  B 1 34  ? 87.65000 65.56300 77.39700  1.000 117.41739 ? 136 A  B C5    1 
ATOM   4119 C  C6    . A  B 1 34  ? 86.36600 65.35200 77.92800  1.000 114.83813 ? 136 A  B C6    1 
ATOM   4120 N  N6    . A  B 1 34  ? 85.94100 65.90200 79.06700  1.000 112.09307 ? 136 A  B N6    1 
ATOM   4121 N  N1    . A  B 1 34  ? 85.52600 64.54400 77.24100  1.000 114.31175 ? 136 A  B N1    1 
ATOM   4122 C  C2    . A  B 1 34  ? 85.95200 63.99100 76.09600  1.000 115.71982 ? 136 A  B C2    1 
ATOM   4123 N  N3    . A  B 1 34  ? 87.13500 64.11600 75.49700  1.000 115.46452 ? 136 A  B N3    1 
ATOM   4124 C  C4    . A  B 1 34  ? 87.94300 64.92300 76.20800  1.000 116.44622 ? 136 A  B C4    1 
ATOM   4125 P  P     . C  B 1 35  ? 89.49100 68.52300 71.59400  1.000 129.31434 ? 137 C  B P     1 
ATOM   4126 O  OP1   . C  B 1 35  ? 89.93900 68.95400 70.24600  1.000 130.89611 ? 137 C  B OP1   1 
ATOM   4127 O  OP2   . C  B 1 35  ? 89.52300 69.49200 72.71500  1.000 112.94132 ? 137 C  B OP2   1 
ATOM   4128 O  "O5'" . C  B 1 35  ? 88.00500 67.96700 71.46000  1.000 120.51328 ? 137 C  B "O5'" 1 
ATOM   4129 C  "C5'" . C  B 1 35  ? 87.68800 66.96000 70.51000  1.000 121.07651 ? 137 C  B "C5'" 1 
ATOM   4130 C  "C4'" . C  B 1 35  ? 86.39100 66.26900 70.84500  1.000 116.83126 ? 137 C  B "C4'" 1 
ATOM   4131 O  "O4'" . C  B 1 35  ? 86.47900 65.68400 72.17200  1.000 112.61760 ? 137 C  B "O4'" 1 
ATOM   4132 C  "C3'" . C  B 1 35  ? 85.16100 67.16000 70.91600  1.000 109.93833 ? 137 C  B "C3'" 1 
ATOM   4133 O  "O3'" . C  B 1 35  ? 84.60300 67.43900 69.64300  1.000 110.42523 ? 137 C  B "O3'" 1 
ATOM   4134 C  "C2'" . C  B 1 35  ? 84.23600 66.37400 71.83100  1.000 108.03810 ? 137 C  B "C2'" 1 
ATOM   4135 O  "O2'" . C  B 1 35  ? 83.62700 65.30500 71.11900  1.000 108.44605 ? 137 C  B "O2'" 1 
ATOM   4136 C  "C1'" . C  B 1 35  ? 85.23100 65.78300 72.82700  1.000 110.39628 ? 137 C  B "C1'" 1 
ATOM   4137 N  N1    . C  B 1 35  ? 85.39400 66.63900 74.02900  1.000 109.95938 ? 137 C  B N1    1 
ATOM   4138 C  C2    . C  B 1 35  ? 84.40100 66.66500 75.01400  1.000 110.98319 ? 137 C  B C2    1 
ATOM   4139 O  O2    . C  B 1 35  ? 83.38500 65.97100 74.87200  1.000 107.05904 ? 137 C  B O2    1 
ATOM   4140 N  N3    . C  B 1 35  ? 84.57100 67.44900 76.10500  1.000 114.15199 ? 137 C  B N3    1 
ATOM   4141 C  C4    . C  B 1 35  ? 85.67200 68.18900 76.23800  1.000 111.75960 ? 137 C  B C4    1 
ATOM   4142 N  N4    . C  B 1 35  ? 85.79200 68.94800 77.33000  1.000 115.25212 ? 137 C  B N4    1 
ATOM   4143 C  C5    . C  B 1 35  ? 86.69900 68.18400 75.25300  1.000 111.12531 ? 137 C  B C5    1 
ATOM   4144 C  C6    . C  B 1 35  ? 86.51500 67.40300 74.18300  1.000 112.98080 ? 137 C  B C6    1 
ATOM   4145 P  P     . C  B 1 36  ? 83.85600 68.83700 69.37900  1.000 122.33267 ? 138 C  B P     1 
ATOM   4146 O  OP1   . C  B 1 36  ? 83.46500 68.87600 67.94500  1.000 102.24606 ? 138 C  B OP1   1 
ATOM   4147 O  OP2   . C  B 1 36  ? 84.69900 69.92200 69.94500  1.000 115.03443 ? 138 C  B OP2   1 
ATOM   4148 O  "O5'" . C  B 1 36  ? 82.52700 68.74600 70.25400  1.000 118.31377 ? 138 C  B "O5'" 1 
ATOM   4149 C  "C5'" . C  B 1 36  ? 81.56100 67.72800 70.01100  1.000 109.39428 ? 138 C  B "C5'" 1 
ATOM   4150 C  "C4'" . C  B 1 36  ? 80.27300 67.98100 70.75500  1.000 101.95392 ? 138 C  B "C4'" 1 
ATOM   4151 O  "O4'" . C  B 1 36  ? 80.53500 68.01500 72.18500  1.000 101.05644 ? 138 C  B "O4'" 1 
ATOM   4152 C  "C3'" . C  B 1 36  ? 79.56900 69.29600 70.41900  1.000 103.40672 ? 138 C  B "C3'" 1 
ATOM   4153 O  "O3'" . C  B 1 36  ? 78.15700 69.10000 70.45000  1.000 99.05094  ? 138 C  B "O3'" 1 
ATOM   4154 C  "C2'" . C  B 1 36  ? 79.97900 70.20800 71.56900  1.000 104.04890 ? 138 C  B "C2'" 1 
ATOM   4155 O  "O2'" . C  B 1 36  ? 79.07400 71.26200 71.82400  1.000 110.43651 ? 138 C  B "O2'" 1 
ATOM   4156 C  "C1'" . C  B 1 36  ? 80.04400 69.22300 72.73200  1.000 102.77770 ? 138 C  B "C1'" 1 
ATOM   4157 N  N1    . C  B 1 36  ? 80.93800 69.63400 73.82500  1.000 104.06206 ? 138 C  B N1    1 
ATOM   4158 C  C2    . C  B 1 36  ? 80.39900 69.78300 75.10700  1.000 112.08934 ? 138 C  B C2    1 
ATOM   4159 O  O2    . C  B 1 36  ? 79.19100 69.56700 75.28200  1.000 110.40230 ? 138 C  B O2    1 
ATOM   4160 N  N3    . C  B 1 36  ? 81.20400 70.16000 76.12700  1.000 113.82902 ? 138 C  B N3    1 
ATOM   4161 C  C4    . C  B 1 36  ? 82.49800 70.38700 75.90400  1.000 113.55794 ? 138 C  B C4    1 
ATOM   4162 N  N4    . C  B 1 36  ? 83.24700 70.75700 76.94600  1.000 121.83788 ? 138 C  B N4    1 
ATOM   4163 C  C5    . C  B 1 36  ? 83.07600 70.24300 74.60800  1.000 112.61835 ? 138 C  B C5    1 
ATOM   4164 C  C6    . C  B 1 36  ? 82.26800 69.86800 73.60500  1.000 111.90248 ? 138 C  B C6    1 
ATOM   4165 P  P     . A  B 1 37  ? 77.22900 69.78300 69.33300  1.000 104.52420 ? 139 A  B P     1 
ATOM   4166 O  OP1   . A  B 1 37  ? 78.07000 70.73400 68.56300  1.000 102.53185 ? 139 A  B OP1   1 
ATOM   4167 O  OP2   . A  B 1 37  ? 76.00100 70.27700 70.00800  1.000 112.74887 ? 139 A  B OP2   1 
ATOM   4168 O  "O5'" . A  B 1 37  ? 76.82400 68.57400 68.37700  1.000 100.55530 ? 139 A  B "O5'" 1 
ATOM   4169 C  "C5'" . A  B 1 37  ? 77.79100 67.92100 67.56300  1.000 105.19533 ? 139 A  B "C5'" 1 
ATOM   4170 C  "C4'" . A  B 1 37  ? 77.41700 66.48100 67.32700  1.000 103.56355 ? 139 A  B "C4'" 1 
ATOM   4171 O  "O4'" . A  B 1 37  ? 77.64100 65.71600 68.54200  1.000 97.54441  ? 139 A  B "O4'" 1 
ATOM   4172 C  "C3'" . A  B 1 37  ? 75.95200 66.24500 66.99100  1.000 99.70256  ? 139 A  B "C3'" 1 
ATOM   4173 O  "O3'" . A  B 1 37  ? 75.68000 66.41400 65.61200  1.000 96.45481  ? 139 A  B "O3'" 1 
ATOM   4174 C  "C2'" . A  B 1 37  ? 75.70800 64.83200 67.49800  1.000 100.82638 ? 139 A  B "C2'" 1 
ATOM   4175 O  "O2'" . A  B 1 37  ? 76.21200 63.87200 66.58100  1.000 105.35061 ? 139 A  B "O2'" 1 
ATOM   4176 C  "C1'" . A  B 1 37  ? 76.58000 64.81400 68.75000  1.000 98.68402  ? 139 A  B "C1'" 1 
ATOM   4177 N  N9    . A  B 1 37  ? 75.84700 65.28500 69.93500  1.000 102.55817 ? 139 A  B N9    1 
ATOM   4178 C  C8    . A  B 1 37  ? 76.18800 66.36400 70.71300  1.000 101.24749 ? 139 A  B C8    1 
ATOM   4179 N  N7    . A  B 1 37  ? 75.36600 66.57400 71.71200  1.000 105.03478 ? 139 A  B N7    1 
ATOM   4180 C  C5    . A  B 1 37  ? 74.42200 65.56500 71.57900  1.000 103.91886 ? 139 A  B C5    1 
ATOM   4181 C  C6    . A  B 1 37  ? 73.28200 65.24500 72.33400  1.000 100.55793 ? 139 A  B C6    1 
ATOM   4182 N  N6    . A  B 1 37  ? 72.89100 65.93200 73.40900  1.000 101.78176 ? 139 A  B N6    1 
ATOM   4183 N  N1    . A  B 1 37  ? 72.54700 64.18200 71.94300  1.000 94.77566  ? 139 A  B N1    1 
ATOM   4184 C  C2    . A  B 1 37  ? 72.94100 63.49500 70.86500  1.000 95.71788  ? 139 A  B C2    1 
ATOM   4185 N  N3    . A  B 1 37  ? 73.99300 63.69600 70.07500  1.000 95.67840  ? 139 A  B N3    1 
ATOM   4186 C  C4    . A  B 1 37  ? 74.70400 64.76100 70.48800  1.000 103.62146 ? 139 A  B C4    1 
ATOM   4187 P  P     . A  B 1 38  ? 74.40100 67.25300 65.13100  1.000 112.03333 ? 140 A  B P     1 
ATOM   4188 O  OP1   . A  B 1 38  ? 74.59900 67.55300 63.68900  1.000 111.79383 ? 140 A  B OP1   1 
ATOM   4189 O  OP2   . A  B 1 38  ? 74.13600 68.34700 66.10000  1.000 108.96981 ? 140 A  B OP2   1 
ATOM   4190 O  "O5'" . A  B 1 38  ? 73.20600 66.21400 65.25300  1.000 105.40096 ? 140 A  B "O5'" 1 
ATOM   4191 C  "C5'" . A  B 1 38  ? 73.29100 64.93700 64.64300  1.000 108.21445 ? 140 A  B "C5'" 1 
ATOM   4192 C  "C4'" . A  B 1 38  ? 72.23100 64.01700 65.18300  1.000 103.90867 ? 140 A  B "C4'" 1 
ATOM   4193 O  "O4'" . A  B 1 38  ? 72.45800 63.79600 66.60000  1.000 107.08800 ? 140 A  B "O4'" 1 
ATOM   4194 C  "C3'" . A  B 1 38  ? 70.81300 64.55600 65.12100  1.000 101.10571 ? 140 A  B "C3'" 1 
ATOM   4195 O  "O3'" . A  B 1 38  ? 70.21600 64.39800 63.84900  1.000 99.70817  ? 140 A  B "O3'" 1 
ATOM   4196 C  "C2'" . A  B 1 38  ? 70.11900 63.77800 66.22700  1.000 109.79359 ? 140 A  B "C2'" 1 
ATOM   4197 O  "O2'" . A  B 1 38  ? 69.85100 62.44700 65.80700  1.000 118.18144 ? 140 A  B "O2'" 1 
ATOM   4198 C  "C1'" . A  B 1 38  ? 71.22200 63.73200 67.27900  1.000 100.65302 ? 140 A  B "C1'" 1 
ATOM   4199 N  N9    . A  B 1 38  ? 71.14700 64.87800 68.20600  1.000 97.38421  ? 140 A  B N9    1 
ATOM   4200 C  C8    . A  B 1 38  ? 72.01900 65.93500 68.30200  1.000 100.98990 ? 140 A  B C8    1 
ATOM   4201 N  N7    . A  B 1 38  ? 71.70000 66.80400 69.23100  1.000 98.47118  ? 140 A  B N7    1 
ATOM   4202 C  C5    . A  B 1 38  ? 70.53900 66.28700 69.78700  1.000 102.17952 ? 140 A  B C5    1 
ATOM   4203 C  C6    . A  B 1 38  ? 69.70100 66.74200 70.82000  1.000 102.18741 ? 140 A  B C6    1 
ATOM   4204 N  N6    . A  B 1 38  ? 69.91700 67.86600 71.50600  1.000 99.77134  ? 140 A  B N6    1 
ATOM   4205 N  N1    . A  B 1 38  ? 68.62100 65.99300 71.12800  1.000 103.84814 ? 140 A  B N1    1 
ATOM   4206 C  C2    . A  B 1 38  ? 68.40700 64.86400 70.43900  1.000 97.14470  ? 140 A  B C2    1 
ATOM   4207 N  N3    . A  B 1 38  ? 69.12000 64.33200 69.44700  1.000 91.88618  ? 140 A  B N3    1 
ATOM   4208 C  C4    . A  B 1 38  ? 70.18700 65.10000 69.16400  1.000 99.53710  ? 140 A  B C4    1 
ATOM   4209 P  P     . G  B 1 39  ? 69.50900 65.64800 63.13100  1.000 104.37390 ? 141 G  B P     1 
ATOM   4210 O  OP1   . G  B 1 39  ? 68.91100 65.17600 61.85700  1.000 100.43922 ? 141 G  B OP1   1 
ATOM   4211 O  OP2   . G  B 1 39  ? 70.46300 66.78200 63.13800  1.000 101.73674 ? 141 G  B OP2   1 
ATOM   4212 O  "O5'" . G  B 1 39  ? 68.31100 66.02200 64.10600  1.000 96.21766  ? 141 G  B "O5'" 1 
ATOM   4213 C  "C5'" . G  B 1 39  ? 67.29800 65.07400 64.39900  1.000 98.78112  ? 141 G  B "C5'" 1 
ATOM   4214 C  "C4'" . G  B 1 39  ? 66.43200 65.52900 65.54400  1.000 96.75720  ? 141 G  B "C4'" 1 
ATOM   4215 O  "O4'" . G  B 1 39  ? 67.21900 65.61900 66.76100  1.000 98.24159  ? 141 G  B "O4'" 1 
ATOM   4216 C  "C3'" . G  B 1 39  ? 65.82300 66.91200 65.40500  1.000 100.54186 ? 141 G  B "C3'" 1 
ATOM   4217 O  "O3'" . G  B 1 39  ? 64.68900 66.93900 64.55500  1.000 106.34256 ? 141 G  B "O3'" 1 
ATOM   4218 C  "C2'" . G  B 1 39  ? 65.52700 67.28200 66.85100  1.000 97.07829  ? 141 G  B "C2'" 1 
ATOM   4219 O  "O2'" . G  B 1 39  ? 64.36900 66.60600 67.31200  1.000 101.83149 ? 141 G  B "O2'" 1 
ATOM   4220 C  "C1'" . G  B 1 39  ? 66.74000 66.68000 67.56200  1.000 100.55239 ? 141 G  B "C1'" 1 
ATOM   4221 N  N9    . G  B 1 39  ? 67.81800 67.67100 67.73200  1.000 98.32317  ? 141 G  B N9    1 
ATOM   4222 C  C8    . G  B 1 39  ? 69.01300 67.73000 67.06100  1.000 97.45991  ? 141 G  B C8    1 
ATOM   4223 N  N7    . G  B 1 39  ? 69.76300 68.73200 67.42700  1.000 98.92325  ? 141 G  B N7    1 
ATOM   4224 C  C5    . G  B 1 39  ? 69.01400 69.37900 68.39700  1.000 96.41768  ? 141 G  B C5    1 
ATOM   4225 C  C6    . G  B 1 39  ? 69.30600 70.53800 69.16300  1.000 102.95531 ? 141 G  B C6    1 
ATOM   4226 O  O6    . G  B 1 39  ? 70.32000 71.24700 69.13400  1.000 104.56603 ? 141 G  B O6    1 
ATOM   4227 N  N1    . G  B 1 39  ? 68.26900 70.85000 70.03600  1.000 104.72657 ? 141 G  B N1    1 
ATOM   4228 C  C2    . G  B 1 39  ? 67.10200 70.14000 70.16000  1.000 100.83137 ? 141 G  B C2    1 
ATOM   4229 N  N2    . G  B 1 39  ? 66.22300 70.60300 71.06300  1.000 107.87695 ? 141 G  B N2    1 
ATOM   4230 N  N3    . G  B 1 39  ? 66.81900 69.05900 69.45000  1.000 96.29662  ? 141 G  B N3    1 
ATOM   4231 C  C4    . G  B 1 39  ? 67.81200 68.73700 68.59600  1.000 96.53349  ? 141 G  B C4    1 
ATOM   4232 P  P     . U  B 1 40  ? 64.46600 68.16800 63.54500  1.000 108.49842 ? 142 U  B P     1 
ATOM   4233 O  OP1   . U  B 1 40  ? 63.38500 67.80000 62.59700  1.000 120.40248 ? 142 U  B OP1   1 
ATOM   4234 O  OP2   . U  B 1 40  ? 65.78800 68.57300 63.00700  1.000 105.43226 ? 142 U  B OP2   1 
ATOM   4235 O  "O5'" . U  B 1 40  ? 63.92300 69.32900 64.49000  1.000 100.11847 ? 142 U  B "O5'" 1 
ATOM   4236 C  "C5'" . U  B 1 40  ? 62.80100 69.11400 65.33500  1.000 100.07636 ? 142 U  B "C5'" 1 
ATOM   4237 C  "C4'" . U  B 1 40  ? 62.68000 70.19200 66.38200  1.000 109.89859 ? 142 U  B "C4'" 1 
ATOM   4238 O  "O4'" . U  B 1 40  ? 63.79800 70.11800 67.30700  1.000 106.12708 ? 142 U  B "O4'" 1 
ATOM   4239 C  "C3'" . U  B 1 40  ? 62.73400 71.61800 65.86600  1.000 112.08043 ? 142 U  B "C3'" 1 
ATOM   4240 O  "O3'" . U  B 1 40  ? 61.51300 72.05300 65.29900  1.000 111.46456 ? 142 U  B "O3'" 1 
ATOM   4241 C  "C2'" . U  B 1 40  ? 63.16300 72.39700 67.10000  1.000 116.28356 ? 142 U  B "C2'" 1 
ATOM   4242 O  "O2'" . U  B 1 40  ? 62.07400 72.56600 67.99400  1.000 122.30797 ? 142 U  B "O2'" 1 
ATOM   4243 C  "C1'" . U  B 1 40  ? 64.15800 71.42000 67.72800  1.000 106.53503 ? 142 U  B "C1'" 1 
ATOM   4244 N  N1    . U  B 1 40  ? 65.54200 71.69100 67.27600  1.000 111.83303 ? 142 U  B N1    1 
ATOM   4245 C  C2    . U  B 1 40  ? 66.20100 72.77500 67.83000  1.000 109.98544 ? 142 U  B C2    1 
ATOM   4246 O  O2    . U  B 1 40  ? 65.69600 73.50200 68.66900  1.000 106.61661 ? 142 U  B O2    1 
ATOM   4247 N  N3    . U  B 1 40  ? 67.47900 72.97700 67.36600  1.000 109.74067 ? 142 U  B N3    1 
ATOM   4248 C  C4    . U  B 1 40  ? 68.15100 72.22400 66.42300  1.000 108.02994 ? 142 U  B C4    1 
ATOM   4249 O  O4    . U  B 1 40  ? 69.30000 72.53100 66.10600  1.000 112.00673 ? 142 U  B O4    1 
ATOM   4250 C  C5    . U  B 1 40  ? 67.40600 71.12300 65.89600  1.000 107.43513 ? 142 U  B C5    1 
ATOM   4251 C  C6    . U  B 1 40  ? 66.15800 70.90200 66.32800  1.000 110.43023 ? 142 U  B C6    1 
ATOM   4252 P  P     . C  B 1 41  ? 61.52700 72.92700 63.95300  1.000 117.52479 ? 143 C  B P     1 
ATOM   4253 O  OP1   . C  B 1 41  ? 60.15500 72.90600 63.39200  1.000 124.45457 ? 143 C  B OP1   1 
ATOM   4254 O  OP2   . C  B 1 41  ? 62.67600 72.50300 63.11300  1.000 116.79313 ? 143 C  B OP2   1 
ATOM   4255 O  "O5'" . C  B 1 41  ? 61.82200 74.40100 64.47300  1.000 108.91587 ? 143 C  B "O5'" 1 
ATOM   4256 C  "C5'" . C  B 1 41  ? 60.99700 74.99800 65.46100  1.000 110.35025 ? 143 C  B "C5'" 1 
ATOM   4257 C  "C4'" . C  B 1 41  ? 61.68500 76.16700 66.11600  1.000 108.46844 ? 143 C  B "C4'" 1 
ATOM   4258 O  "O4'" . C  B 1 41  ? 62.90500 75.71600 66.76100  1.000 109.78439 ? 143 C  B "O4'" 1 
ATOM   4259 C  "C3'" . C  B 1 41  ? 62.15300 77.26900 65.18000  1.000 113.94015 ? 143 C  B "C3'" 1 
ATOM   4260 O  "O3'" . C  B 1 41  ? 61.11100 78.15000 64.79500  1.000 120.75413 ? 143 C  B "O3'" 1 
ATOM   4261 C  "C2'" . C  B 1 41  ? 63.26400 77.93400 65.98100  1.000 115.42980 ? 143 C  B "C2'" 1 
ATOM   4262 O  "O2'" . C  B 1 41  ? 62.72300 78.80000 66.96800  1.000 120.61464 ? 143 C  B "O2'" 1 
ATOM   4263 C  "C1'" . C  B 1 41  ? 63.89100 76.72600 66.68400  1.000 113.63748 ? 143 C  B "C1'" 1 
ATOM   4264 N  N1    . C  B 1 41  ? 65.06900 76.20000 65.95100  1.000 111.76621 ? 143 C  B N1    1 
ATOM   4265 C  C2    . C  B 1 41  ? 66.28800 76.87000 66.08900  1.000 112.60315 ? 143 C  B C2    1 
ATOM   4266 O  O2    . C  B 1 41  ? 66.33900 77.87100 66.81700  1.000 113.71381 ? 143 C  B O2    1 
ATOM   4267 N  N3    . C  B 1 41  ? 67.38100 76.41600 65.43200  1.000 115.65088 ? 143 C  B N3    1 
ATOM   4268 C  C4    . C  B 1 41  ? 67.29400 75.33400 64.65800  1.000 115.72984 ? 143 C  B C4    1 
ATOM   4269 N  N4    . C  B 1 41  ? 68.40000 74.92300 64.03000  1.000 114.55338 ? 143 C  B N4    1 
ATOM   4270 C  C5    . C  B 1 41  ? 66.06400 74.62900 64.49600  1.000 112.22153 ? 143 C  B C5    1 
ATOM   4271 C  C6    . C  B 1 41  ? 64.98900 75.09100 65.15300  1.000 111.72410 ? 143 C  B C6    1 
ATOM   4272 P  P     . U  B 1 42  ? 61.09700 78.80400 63.32600  1.000 124.97349 ? 144 U  B P     1 
ATOM   4273 O  OP1   . U  B 1 42  ? 59.75300 79.39000 63.09600  1.000 125.76306 ? 144 U  B OP1   1 
ATOM   4274 O  OP2   . U  B 1 42  ? 61.62600 77.81300 62.35300  1.000 118.36744 ? 144 U  B OP2   1 
ATOM   4275 O  "O5'" . U  B 1 42  ? 62.13800 80.00400 63.43900  1.000 123.13643 ? 144 U  B "O5'" 1 
ATOM   4276 C  "C5'" . U  B 1 42  ? 61.95600 81.03400 64.40000  1.000 120.43347 ? 144 U  B "C5'" 1 
ATOM   4277 C  "C4'" . U  B 1 42  ? 63.19800 81.87500 64.54900  1.000 124.56818 ? 144 U  B "C4'" 1 
ATOM   4278 O  "O4'" . U  B 1 42  ? 64.26800 81.06900 65.10700  1.000 129.78196 ? 144 U  B "O4'" 1 
ATOM   4279 C  "C3'" . U  B 1 42  ? 63.78400 82.42500 63.25800  1.000 131.26372 ? 144 U  B "C3'" 1 
ATOM   4280 O  "O3'" . U  B 1 42  ? 63.12300 83.59300 62.80500  1.000 135.40369 ? 144 U  B "O3'" 1 
ATOM   4281 C  "C2'" . U  B 1 42  ? 65.24500 82.64800 63.62200  1.000 131.09001 ? 144 U  B "C2'" 1 
ATOM   4282 O  "O2'" . U  B 1 42  ? 65.40300 83.85000 64.36400  1.000 132.18751 ? 144 U  B "O2'" 1 
ATOM   4283 C  "C1'" . U  B 1 42  ? 65.50700 81.45800 64.54900  1.000 125.80517 ? 144 U  B "C1'" 1 
ATOM   4284 N  N1    . U  B 1 42  ? 66.09000 80.30200 63.82800  1.000 118.82802 ? 144 U  B N1    1 
ATOM   4285 C  C2    . U  B 1 42  ? 67.45600 80.28700 63.63700  1.000 123.47331 ? 144 U  B C2    1 
ATOM   4286 O  O2    . U  B 1 42  ? 68.18800 81.17500 64.03300  1.000 128.92133 ? 144 U  B O2    1 
ATOM   4287 N  N3    . U  B 1 42  ? 67.94100 79.19100 62.96900  1.000 121.47307 ? 144 U  B N3    1 
ATOM   4288 C  C4    . U  B 1 42  ? 67.21100 78.12800 62.47600  1.000 116.67250 ? 144 U  B C4    1 
ATOM   4289 O  O4    . U  B 1 42  ? 67.79100 77.21000 61.89100  1.000 115.06441 ? 144 U  B O4    1 
ATOM   4290 C  C5    . U  B 1 42  ? 65.80200 78.21600 62.71200  1.000 118.18057 ? 144 U  B C5    1 
ATOM   4291 C  C6    . U  B 1 42  ? 65.30900 79.27200 63.36200  1.000 118.92277 ? 144 U  B C6    1 
ATOM   4292 P  P     . C  B 1 43  ? 62.87200 83.82000 61.23600  1.000 135.38962 ? 145 C  B P     1 
ATOM   4293 O  OP1   . C  B 1 43  ? 61.86300 84.90000 61.10300  1.000 132.65508 ? 145 C  B OP1   1 
ATOM   4294 O  OP2   . C  B 1 43  ? 62.61800 82.50000 60.60700  1.000 127.52815 ? 145 C  B OP2   1 
ATOM   4295 O  "O5'" . C  B 1 43  ? 64.27600 84.34900 60.69800  1.000 131.24702 ? 145 C  B "O5'" 1 
ATOM   4296 C  "C5'" . C  B 1 43  ? 64.87800 85.51400 61.24900  1.000 131.85762 ? 145 C  B "C5'" 1 
ATOM   4297 C  "C4'" . C  B 1 43  ? 66.35500 85.57700 60.94700  1.000 136.35026 ? 145 C  B "C4'" 1 
ATOM   4298 O  "O4'" . C  B 1 43  ? 67.03400 84.45600 61.57300  1.000 131.12859 ? 145 C  B "O4'" 1 
ATOM   4299 C  "C3'" . C  B 1 43  ? 66.73600 85.46200 59.48100  1.000 141.49299 ? 145 C  B "C3'" 1 
ATOM   4300 O  "O3'" . C  B 1 43  ? 66.58200 86.67500 58.76800  1.000 142.79577 ? 145 C  B "O3'" 1 
ATOM   4301 C  "C2'" . C  B 1 43  ? 68.17200 84.96000 59.54700  1.000 139.40853 ? 145 C  B "C2'" 1 
ATOM   4302 O  "O2'" . C  B 1 43  ? 69.06600 86.02400 59.84600  1.000 144.20121 ? 145 C  B "O2'" 1 
ATOM   4303 C  "C1'" . C  B 1 43  ? 68.10500 84.02300 60.75500  1.000 133.38675 ? 145 C  B "C1'" 1 
ATOM   4304 N  N1    . C  B 1 43  ? 67.86200 82.61700 60.35200  1.000 129.31521 ? 145 C  B N1    1 
ATOM   4305 C  C2    . C  B 1 43  ? 68.94600 81.83700 59.93300  1.000 127.14653 ? 145 C  B C2    1 
ATOM   4306 O  O2    . C  B 1 43  ? 70.08000 82.33800 59.91300  1.000 127.74134 ? 145 C  B O2    1 
ATOM   4307 N  N3    . C  B 1 43  ? 68.73400 80.55200 59.56200  1.000 123.93299 ? 145 C  B N3    1 
ATOM   4308 C  C4    . C  B 1 43  ? 67.50100 80.04100 59.59600  1.000 125.61213 ? 145 C  B C4    1 
ATOM   4309 N  N4    . C  B 1 43  ? 67.33900 78.76800 59.22100  1.000 125.17787 ? 145 C  B N4    1 
ATOM   4310 C  C5    . C  B 1 43  ? 66.37800 80.81300 60.01500  1.000 128.18876 ? 145 C  B C5    1 
ATOM   4311 C  C6    . C  B 1 43  ? 66.60400 82.08100 60.38000  1.000 129.42838 ? 145 C  B C6    1 
ATOM   4312 P  P     . A  B 1 44  ? 66.09300 86.65000 57.23900  1.000 143.20956 ? 146 A  B P     1 
ATOM   4313 O  OP1   . A  B 1 44  ? 65.73100 88.04200 56.86600  1.000 148.30754 ? 146 A  B OP1   1 
ATOM   4314 O  OP2   . A  B 1 44  ? 65.09000 85.56600 57.09200  1.000 139.88021 ? 146 A  B OP2   1 
ATOM   4315 O  "O5'" . A  B 1 44  ? 67.39300 86.21600 56.42500  1.000 142.50948 ? 146 A  B "O5'" 1 
ATOM   4316 C  "C5'" . A  B 1 44  ? 68.53800 87.05300 56.38800  1.000 142.99111 ? 146 A  B "C5'" 1 
ATOM   4317 C  "C4'" . A  B 1 44  ? 69.75900 86.31100 55.90500  1.000 144.33864 ? 146 A  B "C4'" 1 
ATOM   4318 O  "O4'" . A  B 1 44  ? 70.07500 85.22700 56.81700  1.000 138.87220 ? 146 A  B "O4'" 1 
ATOM   4319 C  "C3'" . A  B 1 44  ? 69.64500 85.62200 54.55500  1.000 144.00702 ? 146 A  B "C3'" 1 
ATOM   4320 O  "O3'" . A  B 1 44  ? 69.77100 86.50800 53.45500  1.000 145.67301 ? 146 A  B "O3'" 1 
ATOM   4321 C  "C2'" . A  B 1 44  ? 70.74600 84.57500 54.63300  1.000 144.14915 ? 146 A  B "C2'" 1 
ATOM   4322 O  "O2'" . A  B 1 44  ? 72.01900 85.16700 54.42200  1.000 151.87112 ? 146 A  B "O2'" 1 
ATOM   4323 C  "C1'" . A  B 1 44  ? 70.64900 84.15200 56.10000  1.000 138.79324 ? 146 A  B "C1'" 1 
ATOM   4324 N  N9    . A  B 1 44  ? 69.79800 82.95800 56.26100  1.000 136.21662 ? 146 A  B N9    1 
ATOM   4325 C  C8    . A  B 1 44  ? 68.48200 82.88300 56.64600  1.000 135.90868 ? 146 A  B C8    1 
ATOM   4326 N  N7    . A  B 1 44  ? 68.01000 81.65800 56.67600  1.000 132.95833 ? 146 A  B N7    1 
ATOM   4327 C  C5    . A  B 1 44  ? 69.08300 80.87400 56.28200  1.000 129.20788 ? 146 A  B C5    1 
ATOM   4328 C  C6    . A  B 1 44  ? 69.23400 79.48500 56.11200  1.000 124.00726 ? 146 A  B C6    1 
ATOM   4329 N  N6    . A  B 1 44  ? 68.26200 78.59600 56.32400  1.000 120.61475 ? 146 A  B N6    1 
ATOM   4330 N  N1    . A  B 1 44  ? 70.43800 79.02600 55.71000  1.000 123.67564 ? 146 A  B N1    1 
ATOM   4331 C  C2    . A  B 1 44  ? 71.41700 79.91100 55.49300  1.000 127.27870 ? 146 A  B C2    1 
ATOM   4332 N  N3    . A  B 1 44  ? 71.39600 81.23700 55.61800  1.000 132.22403 ? 146 A  B N3    1 
ATOM   4333 C  C4    . A  B 1 44  ? 70.18700 81.66200 56.02000  1.000 132.51880 ? 146 A  B C4    1 
ATOM   4334 P  P     . G  B 1 45  ? 69.02700 86.18300 52.06600  1.000 154.09305 ? 147 G  B P     1 
ATOM   4335 O  OP1   . G  B 1 45  ? 69.06200 87.40600 51.22600  1.000 160.86492 ? 147 G  B OP1   1 
ATOM   4336 O  OP2   . G  B 1 45  ? 67.71700 85.55600 52.37300  1.000 150.84529 ? 147 G  B OP2   1 
ATOM   4337 O  "O5'" . G  B 1 45  ? 69.96100 85.09800 51.36700  1.000 143.85761 ? 147 G  B "O5'" 1 
ATOM   4338 C  "C5'" . G  B 1 45  ? 71.20100 85.47800 50.78700  1.000 143.21280 ? 147 G  B "C5'" 1 
ATOM   4339 C  "C4'" . G  B 1 45  ? 71.94700 84.29200 50.23000  1.000 144.59718 ? 147 G  B "C4'" 1 
ATOM   4340 O  "O4'" . G  B 1 45  ? 72.34200 83.40200 51.30800  1.000 139.60710 ? 147 G  B "O4'" 1 
ATOM   4341 C  "C3'" . G  B 1 45  ? 71.17300 83.38800 49.28500  1.000 141.22835 ? 147 G  B "C3'" 1 
ATOM   4342 O  "O3'" . G  B 1 45  ? 71.05200 83.90400 47.97100  1.000 137.40947 ? 147 G  B "O3'" 1 
ATOM   4343 C  "C2'" . G  B 1 45  ? 71.95600 82.08600 49.37300  1.000 139.12020 ? 147 G  B "C2'" 1 
ATOM   4344 O  "O2'" . G  B 1 45  ? 73.16500 82.17200 48.63000  1.000 136.64622 ? 147 G  B "O2'" 1 
ATOM   4345 C  "C1'" . G  B 1 45  ? 72.30100 82.06000 50.86100  1.000 139.75975 ? 147 G  B "C1'" 1 
ATOM   4346 N  N9    . G  B 1 45  ? 71.27000 81.33700 51.62800  1.000 131.96671 ? 147 G  B N9    1 
ATOM   4347 C  C8    . G  B 1 45  ? 70.27600 81.87500 52.40900  1.000 130.22703 ? 147 G  B C8    1 
ATOM   4348 N  N7    . G  B 1 45  ? 69.50300 80.97600 52.95300  1.000 129.85857 ? 147 G  B N7    1 
ATOM   4349 C  C5    . G  B 1 45  ? 70.01400 79.76900 52.49400  1.000 126.70029 ? 147 G  B C5    1 
ATOM   4350 C  C6    . G  B 1 45  ? 69.59300 78.43500 52.74300  1.000 126.02916 ? 147 G  B C6    1 
ATOM   4351 O  O6    . G  B 1 45  ? 68.65300 78.03600 53.44400  1.000 125.61332 ? 147 G  B O6    1 
ATOM   4352 N  N1    . G  B 1 45  ? 70.39800 77.51400 52.07600  1.000 124.44739 ? 147 G  B N1    1 
ATOM   4353 C  C2    . G  B 1 45  ? 71.46700 77.83100 51.27300  1.000 125.24222 ? 147 G  B C2    1 
ATOM   4354 N  N2    . G  B 1 45  ? 72.12400 76.80400 50.71200  1.000 123.59203 ? 147 G  B N2    1 
ATOM   4355 N  N3    . G  B 1 45  ? 71.86600 79.06800 51.03600  1.000 128.02940 ? 147 G  B N3    1 
ATOM   4356 C  C4    . G  B 1 45  ? 71.10000 79.97600 51.67200  1.000 127.74252 ? 147 G  B C4    1 
ATOM   4357 P  P     . G  B 1 46  ? 69.76400 83.53500 47.08600  1.000 153.16103 ? 148 G  B P     1 
ATOM   4358 O  OP1   . G  B 1 46  ? 69.84100 84.30900 45.82000  1.000 157.14309 ? 148 G  B OP1   1 
ATOM   4359 O  OP2   . G  B 1 46  ? 68.56600 83.65700 47.95500  1.000 149.98960 ? 148 G  B OP2   1 
ATOM   4360 O  "O5'" . G  B 1 46  ? 69.97200 81.99500 46.73800  1.000 139.82259 ? 148 G  B "O5'" 1 
ATOM   4361 C  "C5'" . G  B 1 46  ? 71.07300 81.57600 45.94500  1.000 136.88540 ? 148 G  B "C5'" 1 
ATOM   4362 C  "C4'" . G  B 1 46  ? 71.10300 80.07900 45.77900  1.000 135.69578 ? 148 G  B "C4'" 1 
ATOM   4363 O  "O4'" . G  B 1 46  ? 71.31200 79.43400 47.06300  1.000 132.01376 ? 148 G  B "O4'" 1 
ATOM   4364 C  "C3'" . G  B 1 46  ? 69.82700 79.44000 45.26300  1.000 130.10827 ? 148 G  B "C3'" 1 
ATOM   4365 O  "O3'" . G  B 1 46  ? 69.64200 79.60000 43.86700  1.000 139.02250 ? 148 G  B "O3'" 1 
ATOM   4366 C  "C2'" . G  B 1 46  ? 69.98700 77.99600 45.71600  1.000 131.45054 ? 148 G  B "C2'" 1 
ATOM   4367 O  "O2'" . G  B 1 46  ? 70.91700 77.31000 44.89000  1.000 133.54816 ? 148 G  B "O2'" 1 
ATOM   4368 C  "C1'" . G  B 1 46  ? 70.62400 78.19700 47.09200  1.000 132.01376 ? 148 G  B "C1'" 1 
ATOM   4369 N  N9    . G  B 1 46  ? 69.60400 78.24300 48.15800  1.000 134.43774 ? 148 G  B N9    1 
ATOM   4370 C  C8    . G  B 1 46  ? 69.24400 79.32500 48.92600  1.000 133.89820 ? 148 G  B C8    1 
ATOM   4371 N  N7    . G  B 1 46  ? 68.30300 79.05700 49.79100  1.000 125.89198 ? 148 G  B N7    1 
ATOM   4372 C  C5    . G  B 1 46  ? 68.01800 77.71500 49.58400  1.000 125.79196 ? 148 G  B C5    1 
ATOM   4373 C  C6    . G  B 1 46  ? 67.08100 76.86600 50.22900  1.000 122.74423 ? 148 G  B C6    1 
ATOM   4374 O  O6    . G  B 1 46  ? 66.29100 77.13700 51.14400  1.000 123.88910 ? 148 G  B O6    1 
ATOM   4375 N  N1    . G  B 1 46  ? 67.12300 75.57700 49.70900  1.000 119.81493 ? 148 G  B N1    1 
ATOM   4376 C  C2    . G  B 1 46  ? 67.95000 75.15400 48.69900  1.000 121.73621 ? 148 G  B C2    1 
ATOM   4377 N  N2    . G  B 1 46  ? 67.83400 73.86500 48.34000  1.000 120.13602 ? 148 G  B N2    1 
ATOM   4378 N  N3    . G  B 1 46  ? 68.82600 75.93800 48.09100  1.000 128.08698 ? 148 G  B N3    1 
ATOM   4379 C  C4    . G  B 1 46  ? 68.81000 77.19700 48.57900  1.000 129.68454 ? 148 G  B C4    1 
ATOM   4380 P  P     . G  B 1 47  ? 68.17000 79.86800 43.27800  1.000 157.48880 ? 149 G  B P     1 
ATOM   4381 O  OP1   . G  B 1 47  ? 68.29700 80.21700 41.83800  1.000 151.74863 ? 149 G  B OP1   1 
ATOM   4382 O  OP2   . G  B 1 47  ? 67.45000 80.77900 44.20600  1.000 144.72937 ? 149 G  B OP2   1 
ATOM   4383 O  "O5'" . G  B 1 47  ? 67.47600 78.44000 43.35500  1.000 139.73140 ? 149 G  B "O5'" 1 
ATOM   4384 C  "C5'" . G  B 1 47  ? 68.05400 77.32500 42.69900  1.000 136.76789 ? 149 G  B "C5'" 1 
ATOM   4385 C  "C4'" . G  B 1 47  ? 67.33000 76.05400 43.04900  1.000 133.93597 ? 149 G  B "C4'" 1 
ATOM   4386 O  "O4'" . G  B 1 47  ? 67.50100 75.75800 44.46100  1.000 138.28912 ? 149 G  B "O4'" 1 
ATOM   4387 C  "C3'" . G  B 1 47  ? 65.82400 76.08400 42.86800  1.000 131.90152 ? 149 G  B "C3'" 1 
ATOM   4388 O  "O3'" . G  B 1 47  ? 65.42400 75.93500 41.51700  1.000 129.09592 ? 149 G  B "O3'" 1 
ATOM   4389 C  "C2'" . G  B 1 47  ? 65.36800 74.95900 43.78600  1.000 131.42514 ? 149 G  B "C2'" 1 
ATOM   4390 O  "O2'" . G  B 1 47  ? 65.61800 73.69600 43.18300  1.000 133.90176 ? 149 G  B "O2'" 1 
ATOM   4391 C  "C1'" . G  B 1 47  ? 66.33600 75.13100 44.96100  1.000 129.12750 ? 149 G  B "C1'" 1 
ATOM   4392 N  N9    . G  B 1 47  ? 65.76700 75.96300 46.04500  1.000 126.93513 ? 149 G  B N9    1 
ATOM   4393 C  C8    . G  B 1 47  ? 66.08800 77.26300 46.36200  1.000 130.34607 ? 149 G  B C8    1 
ATOM   4394 N  N7    . G  B 1 47  ? 65.42000 77.73300 47.38000  1.000 127.29833 ? 149 G  B N7    1 
ATOM   4395 C  C5    . G  B 1 47  ? 64.60200 76.68300 47.76900  1.000 125.49022 ? 149 G  B C5    1 
ATOM   4396 C  C6    . G  B 1 47  ? 63.64900 76.60100 48.82100  1.000 119.33685 ? 149 G  B C6    1 
ATOM   4397 O  O6    . G  B 1 47  ? 63.32800 77.46800 49.64800  1.000 116.98394 ? 149 G  B O6    1 
ATOM   4398 N  N1    . G  B 1 47  ? 63.04300 75.34700 48.86100  1.000 116.00487 ? 149 G  B N1    1 
ATOM   4399 C  C2    . G  B 1 47  ? 63.31600 74.31200 48.00200  1.000 115.22320 ? 149 G  B C2    1 
ATOM   4400 N  N2    . G  B 1 47  ? 62.62900 73.17800 48.19800  1.000 113.34929 ? 149 G  B N2    1 
ATOM   4401 N  N3    . G  B 1 47  ? 64.19900 74.38000 47.01900  1.000 120.63964 ? 149 G  B N3    1 
ATOM   4402 C  C4    . G  B 1 47  ? 64.80400 75.58400 46.95700  1.000 125.47706 ? 149 G  B C4    1 
ATOM   4403 P  P     . G  B 1 48  ? 64.28600 76.88900 40.90800  1.000 134.39061 ? 150 G  B P     1 
ATOM   4404 O  OP1   . G  B 1 48  ? 64.21900 76.68000 39.44100  1.000 134.87224 ? 150 G  B OP1   1 
ATOM   4405 O  OP2   . G  B 1 48  ? 64.49500 78.24800 41.46300  1.000 131.55079 ? 150 G  B OP2   1 
ATOM   4406 O  "O5'" . G  B 1 48  ? 62.94200 76.31200 41.53200  1.000 132.99307 ? 150 G  B "O5'" 1 
ATOM   4407 C  "C5'" . G  B 1 48  ? 62.60900 74.93800 41.39700  1.000 133.07729 ? 150 G  B "C5'" 1 
ATOM   4408 C  "C4'" . G  B 1 48  ? 61.47800 74.56200 42.31700  1.000 126.97919 ? 150 G  B "C4'" 1 
ATOM   4409 O  "O4'" . G  B 1 48  ? 61.94800 74.52900 43.69200  1.000 122.71026 ? 150 G  B "O4'" 1 
ATOM   4410 C  "C3'" . G  B 1 48  ? 60.32300 75.54300 42.36100  1.000 131.15074 ? 150 G  B "C3'" 1 
ATOM   4411 O  "O3'" . G  B 1 48  ? 59.44400 75.43900 41.26000  1.000 138.22001 ? 150 G  B "O3'" 1 
ATOM   4412 C  "C2'" . G  B 1 48  ? 59.68300 75.22800 43.70000  1.000 121.26272 ? 150 G  B "C2'" 1 
ATOM   4413 O  "O2'" . G  B 1 48  ? 58.95100 74.01400 43.62100  1.000 122.69447 ? 150 G  B "O2'" 1 
ATOM   4414 C  "C1'" . G  B 1 48  ? 60.92500 74.99100 44.55600  1.000 122.22073 ? 150 G  B "C1'" 1 
ATOM   4415 N  N9    . G  B 1 48  ? 61.38200 76.23800 45.20200  1.000 126.16857 ? 150 G  B N9    1 
ATOM   4416 C  C8    . G  B 1 48  ? 62.38600 77.06800 44.76700  1.000 125.88169 ? 150 G  B C8    1 
ATOM   4417 N  N7    . G  B 1 48  ? 62.57400 78.10600 45.53200  1.000 122.21809 ? 150 G  B N7    1 
ATOM   4418 C  C5    . G  B 1 48  ? 61.63200 77.96000 46.53900  1.000 121.54959 ? 150 G  B C5    1 
ATOM   4419 C  C6    . G  B 1 48  ? 61.35900 78.78600 47.66100  1.000 123.10241 ? 150 G  B C6    1 
ATOM   4420 O  O6    . G  B 1 48  ? 61.91400 79.84100 47.99700  1.000 133.23257 ? 150 G  B O6    1 
ATOM   4421 N  N1    . G  B 1 48  ? 60.32000 78.27100 48.43200  1.000 119.43092 ? 150 G  B N1    1 
ATOM   4422 C  C2    . G  B 1 48  ? 59.63200 77.11400 48.15900  1.000 116.90430 ? 150 G  B C2    1 
ATOM   4423 N  N2    . G  B 1 48  ? 58.66200 76.78400 49.02500  1.000 110.61407 ? 150 G  B N2    1 
ATOM   4424 N  N3    . G  B 1 48  ? 59.87800 76.33600 47.11500  1.000 119.38618 ? 150 G  B N3    1 
ATOM   4425 C  C4    . G  B 1 48  ? 60.88500 76.81500 46.35000  1.000 123.91040 ? 150 G  B C4    1 
ATOM   4426 P  P     . A  B 1 49  ? 58.93100 76.78300 40.54900  1.000 136.80512 ? 151 A  B P     1 
ATOM   4427 O  OP1   . A  B 1 49  ? 57.79700 76.43500 39.65600  1.000 122.53499 ? 151 A  B OP1   1 
ATOM   4428 O  OP2   . A  B 1 49  ? 60.12200 77.47400 39.98900  1.000 133.77844 ? 151 A  B OP2   1 
ATOM   4429 O  "O5'" . A  B 1 49  ? 58.37100 77.65700 41.76000  1.000 129.78323 ? 151 A  B "O5'" 1 
ATOM   4430 C  "C5'" . A  B 1 49  ? 57.73800 78.91000 41.53800  1.000 122.72449 ? 151 A  B "C5'" 1 
ATOM   4431 C  "C4'" . A  B 1 49  ? 56.31500 78.90100 42.03600  1.000 117.55018 ? 151 A  B "C4'" 1 
ATOM   4432 O  "O4'" . A  B 1 49  ? 55.54900 77.94200 41.27200  1.000 117.30278 ? 151 A  B "O4'" 1 
ATOM   4433 C  "C3'" . A  B 1 49  ? 56.12000 78.47200 43.48500  1.000 118.99246 ? 151 A  B "C3'" 1 
ATOM   4434 O  "O3'" . A  B 1 49  ? 56.31600 79.54200 44.39400  1.000 124.83790 ? 151 A  B "O3'" 1 
ATOM   4435 C  "C2'" . A  B 1 49  ? 54.69700 77.92100 43.49500  1.000 113.91027 ? 151 A  B "C2'" 1 
ATOM   4436 O  "O2'" . A  B 1 49  ? 53.74300 78.96400 43.64300  1.000 120.55581 ? 151 A  B "O2'" 1 
ATOM   4437 C  "C1'" . A  B 1 49  ? 54.56800 77.34100 42.08400  1.000 110.78095 ? 151 A  B "C1'" 1 
ATOM   4438 N  N9    . A  B 1 49  ? 54.74600 75.87800 42.03100  1.000 110.57303 ? 151 A  B N9    1 
ATOM   4439 C  C8    . A  B 1 49  ? 55.73600 75.17600 41.39000  1.000 118.12657 ? 151 A  B C8    1 
ATOM   4440 N  N7    . A  B 1 49  ? 55.61800 73.87600 41.50200  1.000 118.20289 ? 151 A  B N7    1 
ATOM   4441 C  C5    . A  B 1 49  ? 54.46800 73.71200 42.25900  1.000 111.61526 ? 151 A  B C5    1 
ATOM   4442 C  C6    . A  B 1 49  ? 53.80000 72.57000 42.72900  1.000 108.73597 ? 151 A  B C6    1 
ATOM   4443 N  N6    . A  B 1 49  ? 54.21700 71.32500 42.48900  1.000 108.48331 ? 151 A  B N6    1 
ATOM   4444 N  N1    . A  B 1 49  ? 52.67800 72.75400 43.45900  1.000 108.07799 ? 151 A  B N1    1 
ATOM   4445 C  C2    . A  B 1 49  ? 52.26800 74.00600 43.69700  1.000 109.18865 ? 151 A  B C2    1 
ATOM   4446 N  N3    . A  B 1 49  ? 52.80800 75.15800 43.30900  1.000 111.78107 ? 151 A  B N3    1 
ATOM   4447 C  C4    . A  B 1 49  ? 53.92100 74.93800 42.58900  1.000 111.98899 ? 151 A  B C4    1 
ATOM   4448 P  P     . A  B 1 50  ? 57.39000 79.42200 45.58500  1.000 126.53957 ? 152 A  B P     1 
ATOM   4449 O  OP1   . A  B 1 50  ? 57.76700 80.79400 46.01400  1.000 126.83434 ? 152 A  B OP1   1 
ATOM   4450 O  OP2   . A  B 1 50  ? 58.46200 78.48700 45.15400  1.000 119.18343 ? 152 A  B OP2   1 
ATOM   4451 O  "O5'" . A  B 1 50  ? 56.56900 78.73800 46.76600  1.000 113.10112 ? 152 A  B "O5'" 1 
ATOM   4452 C  "C5'" . A  B 1 50  ? 55.42300 79.37000 47.32200  1.000 108.28212 ? 152 A  B "C5'" 1 
ATOM   4453 C  "C4'" . A  B 1 50  ? 54.36800 78.36300 47.70800  1.000 108.08999 ? 152 A  B "C4'" 1 
ATOM   4454 O  "O4'" . A  B 1 50  ? 54.09900 77.49700 46.57800  1.000 113.03006 ? 152 A  B "O4'" 1 
ATOM   4455 C  "C3'" . A  B 1 50  ? 54.73300 77.41200 48.84000  1.000 106.85037 ? 152 A  B "C3'" 1 
ATOM   4456 O  "O3'" . A  B 1 50  ? 54.47300 77.98000 50.11500  1.000 111.13773 ? 152 A  B "O3'" 1 
ATOM   4457 C  "C2'" . A  B 1 50  ? 53.88600 76.17700 48.54700  1.000 104.51588 ? 152 A  B "C2'" 1 
ATOM   4458 O  "O2'" . A  B 1 50  ? 52.56700 76.33000 49.05200  1.000 100.47329 ? 152 A  B "O2'" 1 
ATOM   4459 C  "C1'" . A  B 1 50  ? 53.82800 76.18700 47.01900  1.000 108.93746 ? 152 A  B "C1'" 1 
ATOM   4460 N  N9    . A  B 1 50  ? 54.80300 75.26800 46.40300  1.000 105.85551 ? 152 A  B N9    1 
ATOM   4461 C  C8    . A  B 1 50  ? 56.02500 75.57300 45.86200  1.000 108.04525 ? 152 A  B C8    1 
ATOM   4462 N  N7    . A  B 1 50  ? 56.66000 74.53700 45.37700  1.000 112.17996 ? 152 A  B N7    1 
ATOM   4463 C  C5    . A  B 1 50  ? 55.79300 73.48000 45.61200  1.000 106.07133 ? 152 A  B C5    1 
ATOM   4464 C  C6    . A  B 1 50  ? 55.88100 72.10400 45.33200  1.000 102.61039 ? 152 A  B C6    1 
ATOM   4465 N  N6    . A  B 1 50  ? 56.92900 71.53300 44.72700  1.000 104.03161 ? 152 A  B N6    1 
ATOM   4466 N  N1    . A  B 1 50  ? 54.83800 71.32200 45.69600  1.000 104.30796 ? 152 A  B N1    1 
ATOM   4467 C  C2    . A  B 1 50  ? 53.78600 71.88600 46.30400  1.000 105.34756 ? 152 A  B C2    1 
ATOM   4468 N  N3    . A  B 1 50  ? 53.59300 73.16500 46.61900  1.000 105.00541 ? 152 A  B N3    1 
ATOM   4469 C  C4    . A  B 1 50  ? 54.64400 73.91500 46.24300  1.000 105.40020 ? 152 A  B C4    1 
ATOM   4470 P  P     . A  B 1 51  ? 55.49700 77.78200 51.34000  1.000 113.12274 ? 153 A  B P     1 
ATOM   4471 O  OP1   . A  B 1 51  ? 55.04700 78.69200 52.42400  1.000 96.02332  ? 153 A  B OP1   1 
ATOM   4472 O  OP2   . A  B 1 51  ? 56.89000 77.89800 50.83800  1.000 109.46967 ? 153 A  B OP2   1 
ATOM   4473 O  "O5'" . A  B 1 51  ? 55.26200 76.27800 51.81800  1.000 105.76659 ? 153 A  B "O5'" 1 
ATOM   4474 C  "C5'" . A  B 1 51  ? 54.07700 75.89900 52.50500  1.000 100.23698 ? 153 A  B "C5'" 1 
ATOM   4475 C  "C4'" . A  B 1 51  ? 53.80400 74.42200 52.35900  1.000 99.18159  ? 153 A  B "C4'" 1 
ATOM   4476 O  "O4'" . A  B 1 51  ? 53.88100 74.06000 50.95700  1.000 105.41129 ? 153 A  B "O4'" 1 
ATOM   4477 C  "C3'" . A  B 1 51  ? 54.78900 73.48600 53.04800  1.000 103.27419 ? 153 A  B "C3'" 1 
ATOM   4478 O  "O3'" . A  B 1 51  ? 54.47200 73.28300 54.41700  1.000 103.66108 ? 153 A  B "O3'" 1 
ATOM   4479 C  "C2'" . A  B 1 51  ? 54.69200 72.21300 52.21300  1.000 102.51357 ? 153 A  B "C2'" 1 
ATOM   4480 O  "O2'" . A  B 1 51  ? 53.55900 71.44600 52.59200  1.000 102.85045 ? 153 A  B "O2'" 1 
ATOM   4481 C  "C1'" . A  B 1 51  ? 54.44800 72.77700 50.81300  1.000 105.52183 ? 153 A  B "C1'" 1 
ATOM   4482 N  N9    . A  B 1 51  ? 55.68900 72.90000 50.02200  1.000 102.79782 ? 153 A  B N9    1 
ATOM   4483 C  C8    . A  B 1 51  ? 56.55900 73.96100 49.98900  1.000 102.68991 ? 153 A  B C8    1 
ATOM   4484 N  N7    . A  B 1 51  ? 57.57500 73.78500 49.18100  1.000 104.61646 ? 153 A  B N7    1 
ATOM   4485 C  C5    . A  B 1 51  ? 57.35700 72.52700 48.63900  1.000 102.23459 ? 153 A  B C5    1 
ATOM   4486 C  C6    . A  B 1 51  ? 58.07900 71.75900 47.70700  1.000 106.70092 ? 153 A  B C6    1 
ATOM   4487 N  N6    . A  B 1 51  ? 59.21500 72.16500 47.13300  1.000 111.83311 ? 153 A  B N6    1 
ATOM   4488 N  N1    . A  B 1 51  ? 57.58800 70.54200 47.38000  1.000 104.99808 ? 153 A  B N1    1 
ATOM   4489 C  C2    . A  B 1 51  ? 56.45000 70.13500 47.95700  1.000 95.80751  ? 153 A  B C2    1 
ATOM   4490 N  N3    . A  B 1 51  ? 55.68200 70.76800 48.84100  1.000 98.16831  ? 153 A  B N3    1 
ATOM   4491 C  C4    . A  B 1 51  ? 56.19800 71.97000 49.14600  1.000 100.38174 ? 153 A  B C4    1 
ATOM   4492 P  P     . C  B 1 52  ? 55.58900 73.45600 55.56100  1.000 104.11235 ? 154 C  B P     1 
ATOM   4493 O  OP1   . C  B 1 52  ? 55.18700 72.58400 56.69400  1.000 114.78468 ? 154 C  B OP1   1 
ATOM   4494 O  OP2   . C  B 1 52  ? 55.80000 74.90900 55.79500  1.000 108.06809 ? 154 C  B OP2   1 
ATOM   4495 O  "O5'" . C  B 1 52  ? 56.91600 72.84700 54.91700  1.000 91.15027  ? 154 C  B "O5'" 1 
ATOM   4496 C  "C5'" . C  B 1 52  ? 57.26000 71.48100 55.10600  1.000 93.32948  ? 154 C  B "C5'" 1 
ATOM   4497 C  "C4'" . C  B 1 52  ? 58.03800 70.93300 53.93500  1.000 101.33307 ? 154 C  B "C4'" 1 
ATOM   4498 O  "O4'" . C  B 1 52  ? 57.80800 71.76500 52.76600  1.000 109.26823 ? 154 C  B "O4'" 1 
ATOM   4499 C  "C3'" . C  B 1 52  ? 59.55200 70.91200 54.08000  1.000 98.27744  ? 154 C  B "C3'" 1 
ATOM   4500 O  "O3'" . C  B 1 52  ? 60.02600 69.79900 54.82000  1.000 100.19872 ? 154 C  B "O3'" 1 
ATOM   4501 C  "C2'" . C  B 1 52  ? 60.02400 70.92300 52.63200  1.000 106.06258 ? 154 C  B "C2'" 1 
ATOM   4502 O  "O2'" . C  B 1 52  ? 59.92600 69.62800 52.05700  1.000 110.36047 ? 154 C  B "O2'" 1 
ATOM   4503 C  "C1'" . C  B 1 52  ? 58.97900 71.82700 51.97900  1.000 104.62031 ? 154 C  B "C1'" 1 
ATOM   4504 N  N1    . C  B 1 52  ? 59.43100 73.23600 51.91700  1.000 103.99128 ? 154 C  B N1    1 
ATOM   4505 C  C2    . C  B 1 52  ? 60.35500 73.61100 50.93700  1.000 106.83110 ? 154 C  B C2    1 
ATOM   4506 O  O2    . C  B 1 52  ? 60.76800 72.75300 50.14000  1.000 108.44182 ? 154 C  B O2    1 
ATOM   4507 N  N3    . C  B 1 52  ? 60.77300 74.89900 50.88300  1.000 110.15781 ? 154 C  B N3    1 
ATOM   4508 C  C4    . C  B 1 52  ? 60.30100 75.79100 51.75900  1.000 109.89725 ? 154 C  B C4    1 
ATOM   4509 N  N4    . C  B 1 52  ? 60.73600 77.05100 51.67300  1.000 115.73480 ? 154 C  B N4    1 
ATOM   4510 C  C5    . C  B 1 52  ? 59.36200 75.43500 52.76800  1.000 107.46802 ? 154 C  B C5    1 
ATOM   4511 C  C6    . C  B 1 52  ? 58.95900 74.16000 52.80800  1.000 106.77056 ? 154 C  B C6    1 
ATOM   4512 P  P     . U  B 1 53  ? 61.40800 69.89100 55.63900  1.000 101.61021 ? 155 U  B P     1 
ATOM   4513 O  OP1   . U  B 1 53  ? 61.56000 68.64200 56.42400  1.000 101.03383 ? 155 U  B OP1   1 
ATOM   4514 O  OP2   . U  B 1 53  ? 61.42700 71.19100 56.35000  1.000 96.00954  ? 155 U  B OP2   1 
ATOM   4515 O  "O5'" . U  B 1 53  ? 62.53700 69.92300 54.51200  1.000 106.18971 ? 155 U  B "O5'" 1 
ATOM   4516 C  "C5'" . U  B 1 53  ? 62.69900 68.84400 53.59900  1.000 106.31341 ? 155 U  B "C5'" 1 
ATOM   4517 C  "C4'" . U  B 1 53  ? 63.57500 69.22900 52.43000  1.000 111.20083 ? 155 U  B "C4'" 1 
ATOM   4518 O  "O4'" . U  B 1 53  ? 63.03200 70.40200 51.77100  1.000 99.49417  ? 155 U  B "O4'" 1 
ATOM   4519 C  "C3'" . U  B 1 53  ? 65.00300 69.62100 52.77100  1.000 112.27728 ? 155 U  B "C3'" 1 
ATOM   4520 O  "O3'" . U  B 1 53  ? 65.84200 68.49300 52.94200  1.000 109.33219 ? 155 U  B "O3'" 1 
ATOM   4521 C  "C2'" . U  B 1 53  ? 65.40300 70.50800 51.59900  1.000 112.63522 ? 155 U  B "C2'" 1 
ATOM   4522 O  "O2'" . U  B 1 53  ? 65.79000 69.72300 50.47900  1.000 120.78619 ? 155 U  B "O2'" 1 
ATOM   4523 C  "C1'" . U  B 1 53  ? 64.08100 71.21100 51.27900  1.000 108.59789 ? 155 U  B "C1'" 1 
ATOM   4524 N  N1    . U  B 1 53  ? 63.98900 72.55200 51.90600  1.000 106.64503 ? 155 U  B N1    1 
ATOM   4525 C  C2    . U  B 1 53  ? 64.70300 73.58400 51.32900  1.000 118.30695 ? 155 U  B C2    1 
ATOM   4526 O  O2    . U  B 1 53  ? 65.39600 73.44100 50.34000  1.000 128.00285 ? 155 U  B O2    1 
ATOM   4527 N  N3    . U  B 1 53  ? 64.57900 74.79900 51.95000  1.000 115.54346 ? 155 U  B N3    1 
ATOM   4528 C  C4    . U  B 1 53  ? 63.82700 75.08500 53.07000  1.000 112.35097 ? 155 U  B C4    1 
ATOM   4529 O  O4    . U  B 1 53  ? 63.81800 76.23600 53.51400  1.000 115.65400 ? 155 U  B O4    1 
ATOM   4530 C  C5    . U  B 1 53  ? 63.11600 73.96700 53.61100  1.000 109.01110 ? 155 U  B C5    1 
ATOM   4531 C  C6    . U  B 1 53  ? 63.21900 72.77000 53.02200  1.000 106.37394 ? 155 U  B C6    1 
ATOM   4532 P  P     . U  B 1 54  ? 66.93500 68.46300 54.11600  1.000 114.90688 ? 156 U  B P     1 
ATOM   4533 O  OP1   . U  B 1 54  ? 67.32100 67.04500 54.31500  1.000 116.69657 ? 156 U  B OP1   1 
ATOM   4534 O  OP2   . U  B 1 54  ? 66.43000 69.27600 55.25300  1.000 109.11408 ? 156 U  B OP2   1 
ATOM   4535 O  "O5'" . U  B 1 54  ? 68.18600 69.22100 53.49000  1.000 125.30286 ? 156 U  B "O5'" 1 
ATOM   4536 C  "C5'" . U  B 1 54  ? 68.82900 68.73300 52.32200  1.000 117.39139 ? 156 U  B "C5'" 1 
ATOM   4537 C  "C4'" . U  B 1 54  ? 69.71600 69.78800 51.71900  1.000 111.94600 ? 156 U  B "C4'" 1 
ATOM   4538 O  "O4'" . U  B 1 54  ? 68.89600 70.88400 51.23400  1.000 113.65673 ? 156 U  B "O4'" 1 
ATOM   4539 C  "C3'" . U  B 1 54  ? 70.68000 70.45200 52.68700  1.000 119.33899 ? 156 U  B "C3'" 1 
ATOM   4540 O  "O3'" . U  B 1 54  ? 71.84400 69.67900 52.92100  1.000 124.71069 ? 156 U  B "O3'" 1 
ATOM   4541 C  "C2'" . U  B 1 54  ? 70.93800 71.80000 52.03000  1.000 123.30526 ? 156 U  B "C2'" 1 
ATOM   4542 O  "O2'" . U  B 1 54  ? 71.86900 71.67000 50.96400  1.000 125.63712 ? 156 U  B "O2'" 1 
ATOM   4543 C  "C1'" . U  B 1 54  ? 69.56000 72.11300 51.44300  1.000 116.96502 ? 156 U  B "C1'" 1 
ATOM   4544 N  N1    . U  B 1 54  ? 68.74400 72.95700 52.35000  1.000 114.28575 ? 156 U  B N1    1 
ATOM   4545 C  C2    . U  B 1 54  ? 68.94500 74.32000 52.27700  1.000 121.60242 ? 156 U  B C2    1 
ATOM   4546 O  O2    . U  B 1 54  ? 69.74500 74.82400 51.51300  1.000 126.32404 ? 156 U  B O2    1 
ATOM   4547 N  N3    . U  B 1 54  ? 68.18000 75.07700 53.12400  1.000 122.53411 ? 156 U  B N3    1 
ATOM   4548 C  C4    . U  B 1 54  ? 67.24800 74.61900 54.02900  1.000 119.10739 ? 156 U  B C4    1 
ATOM   4549 O  O4    . U  B 1 54  ? 66.63900 75.43700 54.72600  1.000 121.96036 ? 156 U  B O4    1 
ATOM   4550 C  C5    . U  B 1 54  ? 67.09400 73.19400 54.05000  1.000 117.46508 ? 156 U  B C5    1 
ATOM   4551 C  C6    . U  B 1 54  ? 67.82800 72.43100 53.23100  1.000 114.93057 ? 156 U  B C6    1 
ATOM   4552 P  P     . U  B 1 55  ? 72.53300 69.68200 54.37100  1.000 125.47850 ? 157 U  B P     1 
ATOM   4553 O  OP1   . U  B 1 55  ? 73.47200 68.53300 54.43200  1.000 125.94698 ? 157 U  B OP1   1 
ATOM   4554 O  OP2   . U  B 1 55  ? 71.47100 69.83200 55.40100  1.000 119.59622 ? 157 U  B OP2   1 
ATOM   4555 O  "O5'" . U  B 1 55  ? 73.40800 71.01100 54.36100  1.000 123.40193 ? 157 U  B "O5'" 1 
ATOM   4556 C  "C5'" . U  B 1 55  ? 74.41300 71.20700 53.37900  1.000 124.17308 ? 157 U  B "C5'" 1 
ATOM   4557 C  "C4'" . U  B 1 55  ? 74.85700 72.64500 53.32700  1.000 122.92030 ? 157 U  B "C4'" 1 
ATOM   4558 O  "O4'" . U  B 1 55  ? 73.77500 73.48000 52.84000  1.000 124.89422 ? 157 U  B "O4'" 1 
ATOM   4559 C  "C3'" . U  B 1 55  ? 75.22600 73.27100 54.66100  1.000 121.17798 ? 157 U  B "C3'" 1 
ATOM   4560 O  "O3'" . U  B 1 55  ? 76.52500 72.91900 55.10100  1.000 122.74923 ? 157 U  B "O3'" 1 
ATOM   4561 C  "C2'" . U  B 1 55  ? 75.05100 74.75700 54.38600  1.000 121.01217 ? 157 U  B "C2'" 1 
ATOM   4562 O  "O2'" . U  B 1 55  ? 76.16700 75.27100 53.67300  1.000 129.68953 ? 157 U  B "O2'" 1 
ATOM   4563 C  "C1'" . U  B 1 55  ? 73.83400 74.74900 53.45800  1.000 121.63857 ? 157 U  B "C1'" 1 
ATOM   4564 N  N1    . U  B 1 55  ? 72.57400 74.98400 54.20000  1.000 124.28625 ? 157 U  B N1    1 
ATOM   4565 C  C2    . U  B 1 55  ? 72.25700 76.30400 54.45300  1.000 126.75760 ? 157 U  B C2    1 
ATOM   4566 O  O2    . U  B 1 55  ? 72.95600 77.23000 54.08200  1.000 127.46821 ? 157 U  B O2    1 
ATOM   4567 N  N3    . U  B 1 55  ? 71.08800 76.50300 55.14100  1.000 124.61787 ? 157 U  B N3    1 
ATOM   4568 C  C4    . U  B 1 55  ? 70.22700 75.52800 55.59700  1.000 120.67529 ? 157 U  B C4    1 
ATOM   4569 O  O4    . U  B 1 55  ? 69.21000 75.86600 56.20500  1.000 120.52264 ? 157 U  B O4    1 
ATOM   4570 C  C5    . U  B 1 55  ? 70.62500 74.18400 55.30100  1.000 121.47276 ? 157 U  B C5    1 
ATOM   4571 C  C6    . U  B 1 55  ? 71.76000 73.96000 54.63000  1.000 122.40182 ? 157 U  B C6    1 
ATOM   4572 P  P     . G  B 1 56  ? 76.84300 72.80100 56.67100  1.000 121.07789 ? 158 G  B P     1 
ATOM   4573 O  OP1   . G  B 1 56  ? 78.17100 72.15500 56.81800  1.000 127.81291 ? 158 G  B OP1   1 
ATOM   4574 O  OP2   . G  B 1 56  ? 75.66400 72.20000 57.34000  1.000 129.75525 ? 158 G  B OP2   1 
ATOM   4575 O  "O5'" . G  B 1 56  ? 76.96800 74.31500 57.15100  1.000 117.66433 ? 158 G  B "O5'" 1 
ATOM   4576 C  "C5'" . G  B 1 56  ? 77.96100 75.16800 56.60000  1.000 120.73838 ? 158 G  B "C5'" 1 
ATOM   4577 C  "C4'" . G  B 1 56  ? 77.65100 76.62600 56.84100  1.000 119.77774 ? 158 G  B "C4'" 1 
ATOM   4578 O  "O4'" . G  B 1 56  ? 76.38200 76.97300 56.23300  1.000 116.12993 ? 158 G  B "O4'" 1 
ATOM   4579 C  "C3'" . G  B 1 56  ? 77.48700 77.04700 58.29200  1.000 122.52544 ? 158 G  B "C3'" 1 
ATOM   4580 O  "O3'" . G  B 1 56  ? 78.72300 77.22900 58.95900  1.000 123.64136 ? 158 G  B "O3'" 1 
ATOM   4581 C  "C2'" . G  B 1 56  ? 76.65900 78.32100 58.17500  1.000 127.39444 ? 158 G  B "C2'" 1 
ATOM   4582 O  "O2'" . G  B 1 56  ? 77.47500 79.42700 57.81400  1.000 126.99702 ? 158 G  B "O2'" 1 
ATOM   4583 C  "C1'" . G  B 1 56  ? 75.74300 77.97900 56.99600  1.000 126.55487 ? 158 G  B "C1'" 1 
ATOM   4584 N  N9    . G  B 1 56  ? 74.42400 77.48600 57.43900  1.000 124.14931 ? 158 G  B N9    1 
ATOM   4585 C  C8    . G  B 1 56  ? 73.95100 76.19700 57.41500  1.000 121.44899 ? 158 G  B C8    1 
ATOM   4586 N  N7    . G  B 1 56  ? 72.73600 76.08400 57.87800  1.000 119.12766 ? 158 G  B N7    1 
ATOM   4587 C  C5    . G  B 1 56  ? 72.38100 77.37800 58.23200  1.000 122.40963 ? 158 G  B C5    1 
ATOM   4588 C  C6    . G  B 1 56  ? 71.17700 77.88800 58.79100  1.000 124.64674 ? 158 G  B C6    1 
ATOM   4589 O  O6    . G  B 1 56  ? 70.14400 77.27300 59.09800  1.000 118.45916 ? 158 G  B O6    1 
ATOM   4590 N  N1    . G  B 1 56  ? 71.25200 79.26600 58.98800  1.000 125.94164 ? 158 G  B N1    1 
ATOM   4591 C  C2    . G  B 1 56  ? 72.33800 80.05200 58.68900  1.000 124.19406 ? 158 G  B C2    1 
ATOM   4592 N  N2    . G  B 1 56  ? 72.22000 81.36300 58.94900  1.000 127.32338 ? 158 G  B N2    1 
ATOM   4593 N  N3    . G  B 1 56  ? 73.46100 79.58800 58.16800  1.000 120.05409 ? 158 G  B N3    1 
ATOM   4594 C  C4    . G  B 1 56  ? 73.41300 78.25400 57.96800  1.000 120.06988 ? 158 G  B C4    1 
ATOM   4595 P  P     . A  B 1 57  ? 78.84800 76.91200 60.52900  1.000 126.58478 ? 159 A  B P     1 
ATOM   4596 O  OP1   . A  B 1 57  ? 80.29200 76.86800 60.87200  1.000 134.68312 ? 159 A  B OP1   1 
ATOM   4597 O  OP2   . A  B 1 57  ? 77.99800 75.73400 60.83200  1.000 126.90850 ? 159 A  B OP2   1 
ATOM   4598 O  "O5'" . A  B 1 57  ? 78.19800 78.18700 61.23000  1.000 123.72128 ? 159 A  B "O5'" 1 
ATOM   4599 C  "C5'" . A  B 1 57  ? 78.79200 79.47100 61.09900  1.000 125.82153 ? 159 A  B "C5'" 1 
ATOM   4600 C  "C4'" . A  B 1 57  ? 77.89500 80.55400 61.64200  1.000 122.00529 ? 159 A  B "C4'" 1 
ATOM   4601 O  "O4'" . A  B 1 57  ? 76.70000 80.64900 60.82100  1.000 125.65046 ? 159 A  B "O4'" 1 
ATOM   4602 C  "C3'" . A  B 1 57  ? 77.35800 80.32600 63.04600  1.000 118.74700 ? 159 A  B "C3'" 1 
ATOM   4603 O  "O3'" . A  B 1 57  ? 78.28100 80.64500 64.07300  1.000 123.29755 ? 159 A  B "O3'" 1 
ATOM   4604 C  "C2'" . A  B 1 57  ? 76.09300 81.17100 63.05400  1.000 128.06127 ? 159 A  B "C2'" 1 
ATOM   4605 O  "O2'" . A  B 1 57  ? 76.41100 82.54900 63.19100  1.000 132.48286 ? 159 A  B "O2'" 1 
ATOM   4606 C  "C1'" . A  B 1 57  ? 75.57800 80.93300 61.63500  1.000 130.68527 ? 159 A  B "C1'" 1 
ATOM   4607 N  N9    . A  B 1 57  ? 74.65800 79.78100 61.57900  1.000 128.66398 ? 159 A  B N9    1 
ATOM   4608 C  C8    . A  B 1 57  ? 74.94500 78.50600 61.16800  1.000 127.22960 ? 159 A  B C8    1 
ATOM   4609 N  N7    . A  B 1 57  ? 73.93200 77.68400 61.23600  1.000 121.49207 ? 159 A  B N7    1 
ATOM   4610 C  C5    . A  B 1 57  ? 72.90400 78.47100 61.72900  1.000 120.66302 ? 159 A  B C5    1 
ATOM   4611 C  C6    . A  B 1 57  ? 71.56000 78.18600 62.03000  1.000 119.80765 ? 159 A  B C6    1 
ATOM   4612 N  N6    . A  B 1 57  ? 71.01000 76.97800 61.86600  1.000 119.08125 ? 159 A  B N6    1 
ATOM   4613 N  N1    . A  B 1 57  ? 70.79200 79.19300 62.50800  1.000 119.58921 ? 159 A  B N1    1 
ATOM   4614 C  C2    . A  B 1 57  ? 71.35300 80.40000 62.66800  1.000 121.02359 ? 159 A  B C2    1 
ATOM   4615 N  N3    . A  B 1 57  ? 72.60400 80.78600 62.42000  1.000 121.89738 ? 159 A  B N3    1 
ATOM   4616 C  C4    . A  B 1 57  ? 73.33600 79.76500 61.94800  1.000 121.17361 ? 159 A  B C4    1 
ATOM   4617 P  P     . G  B 1 58  ? 78.34600 79.73100 65.39300  1.000 135.60870 ? 160 G  B P     1 
ATOM   4618 O  OP1   . G  B 1 58  ? 79.61100 80.02700 66.11300  1.000 127.32087 ? 160 G  B OP1   1 
ATOM   4619 O  OP2   . G  B 1 58  ? 78.03600 78.33300 65.00000  1.000 135.09548 ? 160 G  B OP2   1 
ATOM   4620 O  "O5'" . G  B 1 58  ? 77.13200 80.26100 66.27700  1.000 126.51551 ? 160 G  B "O5'" 1 
ATOM   4621 C  "C5'" . G  B 1 58  ? 77.06500 81.62500 66.66600  1.000 125.67593 ? 160 G  B "C5'" 1 
ATOM   4622 C  "C4'" . G  B 1 58  ? 75.66900 82.02400 67.07200  1.000 127.48404 ? 160 G  B "C4'" 1 
ATOM   4623 O  "O4'" . G  B 1 58  ? 74.76100 81.84900 65.95100  1.000 130.71338 ? 160 G  B "O4'" 1 
ATOM   4624 C  "C3'" . G  B 1 58  ? 75.03100 81.20900 68.18300  1.000 117.88289 ? 160 G  B "C3'" 1 
ATOM   4625 O  "O3'" . G  B 1 58  ? 75.48000 81.57100 69.47800  1.000 123.23880 ? 160 G  B "O3'" 1 
ATOM   4626 C  "C2'" . G  B 1 58  ? 73.54900 81.45800 67.95200  1.000 120.94905 ? 160 G  B "C2'" 1 
ATOM   4627 O  "O2'" . G  B 1 58  ? 73.18500 82.75000 68.41400  1.000 124.97058 ? 160 G  B "O2'" 1 
ATOM   4628 C  "C1'" . G  B 1 58  ? 73.48800 81.45900 66.42400  1.000 122.05708 ? 160 G  B "C1'" 1 
ATOM   4629 N  N9    . G  B 1 58  ? 73.17500 80.11600 65.90100  1.000 120.61743 ? 160 G  B N9    1 
ATOM   4630 C  C8    . G  B 1 58  ? 74.03600 79.21200 65.32400  1.000 120.94379 ? 160 G  B C8    1 
ATOM   4631 N  N7    . G  B 1 58  ? 73.44900 78.09800 64.97600  1.000 120.74376 ? 160 G  B N7    1 
ATOM   4632 C  C5    . G  B 1 58  ? 72.12300 78.27300 65.35000  1.000 121.75704 ? 160 G  B C5    1 
ATOM   4633 C  C6    . G  B 1 58  ? 71.00400 77.40300 65.22700  1.000 113.34551 ? 160 G  B C6    1 
ATOM   4634 O  O6    . G  B 1 58  ? 70.94700 76.26300 64.74600  1.000 109.92141 ? 160 G  B O6    1 
ATOM   4635 N  N1    . G  B 1 58  ? 69.84800 77.98600 65.73500  1.000 109.95036 ? 160 G  B N1    1 
ATOM   4636 C  C2    . G  B 1 58  ? 69.77200 79.23900 66.29000  1.000 112.31380 ? 160 G  B C2    1 
ATOM   4637 N  N2    . G  B 1 58  ? 68.56300 79.62400 66.72600  1.000 114.24035 ? 160 G  B N2    1 
ATOM   4638 N  N3    . G  B 1 58  ? 70.80500 80.05500 66.41000  1.000 116.12216 ? 160 G  B N3    1 
ATOM   4639 C  C4    . G  B 1 58  ? 71.94000 79.51300 65.92400  1.000 122.50976 ? 160 G  B C4    1 
ATOM   4640 P  P     . A  B 1 59  ? 75.56300 80.46600 70.64200  1.000 133.26072 ? 161 A  B P     1 
ATOM   4641 O  OP1   . A  B 1 59  ? 76.24100 81.08600 71.80500  1.000 117.85624 ? 161 A  B OP1   1 
ATOM   4642 O  OP2   . A  B 1 59  ? 76.10200 79.20400 70.07400  1.000 128.69175 ? 161 A  B OP2   1 
ATOM   4643 O  "O5'" . A  B 1 59  ? 74.04300 80.22100 71.05200  1.000 130.73936 ? 161 A  B "O5'" 1 
ATOM   4644 C  "C5'" . A  B 1 59  ? 73.25300 81.27200 71.59100  1.000 117.70359 ? 161 A  B "C5'" 1 
ATOM   4645 C  "C4'" . A  B 1 59  ? 71.77700 80.97700 71.47500  1.000 117.92993 ? 161 A  B "C4'" 1 
ATOM   4646 O  "O4'" . A  B 1 59  ? 71.45300 80.62500 70.10600  1.000 116.17183 ? 161 A  B "O4'" 1 
ATOM   4647 C  "C3'" . A  B 1 59  ? 71.25600 79.80100 72.28600  1.000 114.55321 ? 161 A  B "C3'" 1 
ATOM   4648 O  "O3'" . A  B 1 59  ? 71.03400 80.12300 73.64900  1.000 116.55082 ? 161 A  B "O3'" 1 
ATOM   4649 C  "C2'" . A  B 1 59  ? 69.98600 79.42200 71.53500  1.000 112.33979 ? 161 A  B "C2'" 1 
ATOM   4650 O  "O2'" . A  B 1 59  ? 68.92900 80.31300 71.86100  1.000 113.82944 ? 161 A  B "O2'" 1 
ATOM   4651 C  "C1'" . A  B 1 59  ? 70.40100 79.68300 70.08600  1.000 113.48730 ? 161 A  B "C1'" 1 
ATOM   4652 N  N9    . A  B 1 59  ? 70.86200 78.45700 69.40200  1.000 112.98724 ? 161 A  B N9    1 
ATOM   4653 C  C8    . A  B 1 59  ? 72.13800 78.12300 69.01700  1.000 115.37963 ? 161 A  B C8    1 
ATOM   4654 N  N7    . A  B 1 59  ? 72.22600 76.95600 68.42300  1.000 115.60597 ? 161 A  B N7    1 
ATOM   4655 C  C5    . A  B 1 59  ? 70.92000 76.48600 68.41200  1.000 110.08952 ? 161 A  B C5    1 
ATOM   4656 C  C6    . A  B 1 59  ? 70.34400 75.29700 67.92200  1.000 107.21812 ? 161 A  B C6    1 
ATOM   4657 N  N6    . A  B 1 59  ? 71.03800 74.32500 67.32100  1.000 108.82621 ? 161 A  B N6    1 
ATOM   4658 N  N1    . A  B 1 59  ? 69.01000 75.13600 68.06900  1.000 106.05483 ? 161 A  B N1    1 
ATOM   4659 C  C2    . A  B 1 59  ? 68.31800 76.11000 68.66900  1.000 109.01571 ? 161 A  B C2    1 
ATOM   4660 N  N3    . A  B 1 59  ? 68.74600 77.26600 69.17000  1.000 109.45260 ? 161 A  B N3    1 
ATOM   4661 C  C4    . A  B 1 59  ? 70.07200 77.40000 69.01000  1.000 110.52378 ? 161 A  B C4    1 
ATOM   4662 P  P     . U  B 1 60  ? 71.30400 79.02900 74.79400  1.000 125.54147 ? 162 U  B P     1 
ATOM   4663 O  OP1   . U  B 1 60  ? 70.97600 79.65100 76.10300  1.000 116.98255 ? 162 U  B OP1   1 
ATOM   4664 O  OP2   . U  B 1 60  ? 72.65100 78.44500 74.56200  1.000 125.13616 ? 162 U  B OP2   1 
ATOM   4665 O  "O5'" . U  B 1 60  ? 70.22100 77.89600 74.51000  1.000 117.89581 ? 162 U  B "O5'" 1 
ATOM   4666 C  "C5'" . U  B 1 60  ? 68.83900 78.13100 74.73900  1.000 107.73670 ? 162 U  B "C5'" 1 
ATOM   4667 C  "C4'" . U  B 1 60  ? 67.98700 77.06300 74.10300  1.000 107.06294 ? 162 U  B "C4'" 1 
ATOM   4668 O  "O4'" . U  B 1 60  ? 68.30100 76.97000 72.68900  1.000 110.02645 ? 162 U  B "O4'" 1 
ATOM   4669 C  "C3'" . U  B 1 60  ? 68.19200 75.64700 74.61500  1.000 101.60439 ? 162 U  B "C3'" 1 
ATOM   4670 O  "O3'" . U  B 1 60  ? 67.52300 75.38900 75.83700  1.000 102.62030 ? 162 U  B "O3'" 1 
ATOM   4671 C  "C2'" . U  B 1 60  ? 67.69600 74.80300 73.45100  1.000 104.28366 ? 162 U  B "C2'" 1 
ATOM   4672 O  "O2'" . U  B 1 60  ? 66.27500 74.75500 73.43600  1.000 104.62843 ? 162 U  B "O2'" 1 
ATOM   4673 C  "C1'" . U  B 1 60  ? 68.16900 75.63200 72.25400  1.000 106.48655 ? 162 U  B "C1'" 1 
ATOM   4674 N  N1    . U  B 1 60  ? 69.47600 75.16900 71.72500  1.000 105.82068 ? 162 U  B N1    1 
ATOM   4675 C  C2    . U  B 1 60  ? 69.48800 73.99800 70.98300  1.000 108.10517 ? 162 U  B C2    1 
ATOM   4676 O  O2    . U  B 1 60  ? 68.48200 73.34400 70.76100  1.000 106.99714 ? 162 U  B O2    1 
ATOM   4677 N  N3    . U  B 1 60  ? 70.72100 73.60700 70.51300  1.000 108.10780 ? 162 U  B N3    1 
ATOM   4678 C  C4    . U  B 1 60  ? 71.92600 74.25800 70.70100  1.000 110.61863 ? 162 U  B C4    1 
ATOM   4679 O  O4    . U  B 1 60  ? 72.95900 73.79200 70.21400  1.000 116.67988 ? 162 U  B O4    1 
ATOM   4680 C  C5    . U  B 1 60  ? 71.83500 75.46200 71.47200  1.000 110.66600 ? 162 U  B C5    1 
ATOM   4681 C  C6    . U  B 1 60  ? 70.64700 75.86600 71.94200  1.000 108.10253 ? 162 U  B C6    1 
ATOM   4682 P  P     . G  B 1 61  ? 68.25300 74.53700 76.98300  1.000 103.33299 ? 163 G  B P     1 
ATOM   4683 O  OP1   . G  B 1 61  ? 67.35400 74.48900 78.16000  1.000 105.48325 ? 163 G  B OP1   1 
ATOM   4684 O  OP2   . G  B 1 61  ? 69.63800 75.05500 77.11900  1.000 114.39484 ? 163 G  B OP2   1 
ATOM   4685 O  "O5'" . G  B 1 61  ? 68.34700 73.07100 76.37000  1.000 99.37462  ? 163 G  B "O5'" 1 
ATOM   4686 C  "C5'" . G  B 1 61  ? 67.17900 72.32300 76.06400  1.000 99.56938  ? 163 G  B "C5'" 1 
ATOM   4687 C  "C4'" . G  B 1 61  ? 67.49100 71.22200 75.08500  1.000 99.90889  ? 163 G  B "C4'" 1 
ATOM   4688 O  "O4'" . G  B 1 61  ? 68.18600 71.78700 73.95000  1.000 101.63805 ? 163 G  B "O4'" 1 
ATOM   4689 C  "C3'" . G  B 1 61  ? 68.41800 70.13200 75.60100  1.000 101.14325 ? 163 G  B "C3'" 1 
ATOM   4690 O  "O3'" . G  B 1 61  ? 67.69700 69.12800 76.29600  1.000 101.12746 ? 163 G  B "O3'" 1 
ATOM   4691 C  "C2'" . G  B 1 61  ? 69.10100 69.62600 74.33200  1.000 102.84872 ? 163 G  B "C2'" 1 
ATOM   4692 O  "O2'" . G  B 1 61  ? 68.28200 68.68100 73.65800  1.000 100.41422 ? 163 G  B "O2'" 1 
ATOM   4693 C  "C1'" . G  B 1 61  ? 69.17000 70.89700 73.48000  1.000 102.61185 ? 163 G  B "C1'" 1 
ATOM   4694 N  N9    . G  B 1 61  ? 70.47700 71.58100 73.53900  1.000 108.51782 ? 163 G  B N9    1 
ATOM   4695 C  C8    . G  B 1 61  ? 70.81700 72.64700 74.33800  1.000 111.72873 ? 163 G  B C8    1 
ATOM   4696 N  N7    . G  B 1 61  ? 72.04500 73.05400 74.16200  1.000 112.96835 ? 163 G  B N7    1 
ATOM   4697 C  C5    . G  B 1 61  ? 72.54700 72.22200 73.17200  1.000 108.22305 ? 163 G  B C5    1 
ATOM   4698 C  C6    . G  B 1 61  ? 73.83100 72.18900 72.56000  1.000 107.47822 ? 163 G  B C6    1 
ATOM   4699 O  O6    . G  B 1 61  ? 74.81500 72.91100 72.77700  1.000 109.35476 ? 163 G  B O6    1 
ATOM   4700 N  N1    . G  B 1 61  ? 73.91400 71.17800 71.60800  1.000 108.38096 ? 163 G  B N1    1 
ATOM   4701 C  C2    . G  B 1 61  ? 72.89300 70.31800 71.28400  1.000 106.94921 ? 163 G  B C2    1 
ATOM   4702 N  N2    . G  B 1 61  ? 73.16300 69.41100 70.33400  1.000 102.55131 ? 163 G  B N2    1 
ATOM   4703 N  N3    . G  B 1 61  ? 71.69400 70.34200 71.84500  1.000 103.21718 ? 163 G  B N3    1 
ATOM   4704 C  C4    . G  B 1 61  ? 71.59000 71.31100 72.77500  1.000 106.02015 ? 163 G  B C4    1 
ATOM   4705 P  P     . G  B 1 62  ? 68.02400 68.77600 77.82900  1.000 104.80057 ? 164 G  B P     1 
ATOM   4706 O  OP1   . G  B 1 62  ? 66.81000 68.16500 78.43100  1.000 100.37898 ? 164 G  B OP1   1 
ATOM   4707 O  OP2   . G  B 1 62  ? 68.65900 69.96000 78.46300  1.000 103.69517 ? 164 G  B OP2   1 
ATOM   4708 O  "O5'" . G  B 1 62  ? 69.12100 67.63100 77.72300  1.000 104.28208 ? 164 G  B "O5'" 1 
ATOM   4709 C  "C5'" . G  B 1 62  ? 68.94100 66.52200 76.84800  1.000 97.59970  ? 164 G  B "C5'" 1 
ATOM   4710 C  "C4'" . G  B 1 62  ? 70.25200 65.83300 76.56200  1.000 95.80738  ? 164 G  B "C4'" 1 
ATOM   4711 O  "O4'" . G  B 1 62  ? 71.13700 66.77800 75.90400  1.000 92.34644  ? 164 G  B "O4'" 1 
ATOM   4712 C  "C3'" . G  B 1 62  ? 70.99000 65.33700 77.80100  1.000 91.37527  ? 164 G  B "C3'" 1 
ATOM   4713 O  "O3'" . G  B 1 62  ? 71.66800 64.11300 77.52100  1.000 88.36175  ? 164 G  B "O3'" 1 
ATOM   4714 C  "C2'" . G  B 1 62  ? 71.99500 66.45400 78.07700  1.000 93.45184  ? 164 G  B "C2'" 1 
ATOM   4715 O  "O2'" . G  B 1 62  ? 73.15900 66.04000 78.76100  1.000 95.75738  ? 164 G  B "O2'" 1 
ATOM   4716 C  "C1'" . G  B 1 62  ? 72.31300 66.96600 76.67200  1.000 90.37252  ? 164 G  B "C1'" 1 
ATOM   4717 N  N9    . G  B 1 62  ? 72.63900 68.39700 76.64100  1.000 97.53917  ? 164 G  B N9    1 
ATOM   4718 C  C8    . G  B 1 62  ? 72.04000 69.36700 77.40900  1.000 101.86600 ? 164 G  B C8    1 
ATOM   4719 N  N7    . G  B 1 62  ? 72.51000 70.56600 77.20400  1.000 105.90859 ? 164 G  B N7    1 
ATOM   4720 C  C5    . G  B 1 62  ? 73.48600 70.38800 76.23800  1.000 104.12417 ? 164 G  B C5    1 
ATOM   4721 C  C6    . G  B 1 62  ? 74.33400 71.34100 75.62100  1.000 108.93264 ? 164 G  B C6    1 
ATOM   4722 O  O6    . G  B 1 62  ? 74.39000 72.56300 75.80900  1.000 115.61502 ? 164 G  B O6    1 
ATOM   4723 N  N1    . G  B 1 62  ? 75.18300 70.74100 74.70000  1.000 109.31426 ? 164 G  B N1    1 
ATOM   4724 C  C2    . G  B 1 62  ? 75.20800 69.40200 74.40200  1.000 104.19260 ? 164 G  B C2    1 
ATOM   4725 N  N2    . G  B 1 62  ? 76.09800 69.02200 73.47500  1.000 103.22406 ? 164 G  B N2    1 
ATOM   4726 N  N3    . G  B 1 62  ? 74.42000 68.50100 74.97200  1.000 102.69242 ? 164 G  B N3    1 
ATOM   4727 C  C4    . G  B 1 62  ? 73.58400 69.05700 75.87700  1.000 102.46344 ? 164 G  B C4    1 
ATOM   4728 P  P     . C  B 1 63  ? 71.26000 62.77700 78.31900  1.000 87.72258  ? 165 C  B P     1 
ATOM   4729 O  OP1   . C  B 1 63  ? 72.15800 61.68000 77.88100  1.000 101.46107 ? 165 C  B OP1   1 
ATOM   4730 O  OP2   . C  B 1 63  ? 69.78900 62.59900 78.23000  1.000 94.87870  ? 165 C  B OP2   1 
ATOM   4731 O  "O5'" . C  B 1 63  ? 71.62900 63.10900 79.83200  1.000 87.78048  ? 165 C  B "O5'" 1 
ATOM   4732 C  "C5'" . C  B 1 63  ? 72.98500 63.16100 80.25100  1.000 91.09667  ? 165 C  B "C5'" 1 
ATOM   4733 C  "C4'" . C  B 1 63  ? 73.11400 63.77000 81.62200  1.000 97.48428  ? 165 C  B "C4'" 1 
ATOM   4734 O  "O4'" . C  B 1 63  ? 72.73300 65.16900 81.57500  1.000 96.58417  ? 165 C  B "O4'" 1 
ATOM   4735 C  "C3'" . C  B 1 63  ? 72.21200 63.17200 82.68700  1.000 97.19214  ? 165 C  B "C3'" 1 
ATOM   4736 O  "O3'" . C  B 1 63  ? 72.75500 61.99000 83.24500  1.000 98.47913  ? 165 C  B "O3'" 1 
ATOM   4737 C  "C2'" . C  B 1 63  ? 72.07200 64.30800 83.69100  1.000 102.45856 ? 165 C  B "C2'" 1 
ATOM   4738 O  "O2'" . C  B 1 63  ? 73.21400 64.37500 84.53200  1.000 105.05887 ? 165 C  B "O2'" 1 
ATOM   4739 C  "C1'" . C  B 1 63  ? 72.08300 65.53300 82.77300  1.000 100.42410 ? 165 C  B "C1'" 1 
ATOM   4740 N  N1    . C  B 1 63  ? 70.72500 66.03400 82.44500  1.000 98.67389  ? 165 C  B N1    1 
ATOM   4741 C  C2    . C  B 1 63  ? 69.95600 66.67800 83.41900  1.000 105.72211 ? 165 C  B C2    1 
ATOM   4742 O  O2    . C  B 1 63  ? 70.41100 66.80900 84.56400  1.000 108.44086 ? 165 C  B O2    1 
ATOM   4743 N  N3    . C  B 1 63  ? 68.72500 67.14200 83.09300  1.000 105.69579 ? 165 C  B N3    1 
ATOM   4744 C  C4    . C  B 1 63  ? 68.25200 66.99100 81.85400  1.000 102.24801 ? 165 C  B C4    1 
ATOM   4745 N  N4    . C  B 1 63  ? 67.03200 67.46200 81.58300  1.000 103.72976 ? 165 C  B N4    1 
ATOM   4746 C  C5    . C  B 1 63  ? 69.01500 66.34700 80.84000  1.000 101.43738 ? 165 C  B C5    1 
ATOM   4747 C  C6    . C  B 1 63  ? 70.22800 65.89500 81.18100  1.000 103.81398 ? 165 C  B C6    1 
ATOM   4748 P  P     . C  B 1 64  ? 71.86400 60.66100 83.33900  1.000 93.95123  ? 166 C  B P     1 
ATOM   4749 O  OP1   . C  B 1 64  ? 72.78100 59.53200 83.64100  1.000 96.51469  ? 166 C  B OP1   1 
ATOM   4750 O  OP2   . C  B 1 64  ? 70.99000 60.60700 82.14100  1.000 101.67847 ? 166 C  B OP2   1 
ATOM   4751 O  "O5'" . C  B 1 64  ? 70.96500 60.90300 84.63000  1.000 99.08079  ? 166 C  B "O5'" 1 
ATOM   4752 C  "C5'" . C  B 1 64  ? 71.56600 60.93100 85.91400  1.000 99.75456  ? 166 C  B "C5'" 1 
ATOM   4753 C  "C4'" . C  B 1 64  ? 70.69900 61.62200 86.93400  1.000 97.11476  ? 166 C  B "C4'" 1 
ATOM   4754 O  "O4'" . C  B 1 64  ? 70.35600 62.95300 86.47600  1.000 99.52032  ? 166 C  B "O4'" 1 
ATOM   4755 C  "C3'" . C  B 1 64  ? 69.35600 60.97600 87.22900  1.000 96.75420  ? 166 C  B "C3'" 1 
ATOM   4756 O  "O3'" . C  B 1 64  ? 69.46600 59.89000 88.13400  1.000 100.73625 ? 166 C  B "O3'" 1 
ATOM   4757 C  "C2'" . C  B 1 64  ? 68.54400 62.14000 87.78900  1.000 98.24911  ? 166 C  B "C2'" 1 
ATOM   4758 O  "O2'" . C  B 1 64  ? 68.85600 62.35300 89.15700  1.000 105.99741 ? 166 C  B "O2'" 1 
ATOM   4759 C  "C1'" . C  B 1 64  ? 69.09200 63.32300 86.98500  1.000 97.54113  ? 166 C  B "C1'" 1 
ATOM   4760 N  N1    . C  B 1 64  ? 68.20600 63.71800 85.86600  1.000 101.63899 ? 166 C  B N1    1 
ATOM   4761 C  C2    . C  B 1 64  ? 67.17200 64.62600 86.12500  1.000 104.34195 ? 166 C  B C2    1 
ATOM   4762 O  O2    . C  B 1 64  ? 67.03000 65.06600 87.27700  1.000 106.97911 ? 166 C  B O2    1 
ATOM   4763 N  N3    . C  B 1 64  ? 66.35100 65.00500 85.11900  1.000 103.84715 ? 166 C  B N3    1 
ATOM   4764 C  C4    . C  B 1 64  ? 66.53500 64.51500 83.89300  1.000 103.36288 ? 166 C  B C4    1 
ATOM   4765 N  N4    . C  B 1 64  ? 65.70000 64.91600 82.93100  1.000 110.76640 ? 166 C  B N4    1 
ATOM   4766 C  C5    . C  B 1 64  ? 67.58000 63.59100 83.59800  1.000 102.72333 ? 166 C  B C5    1 
ATOM   4767 C  C6    . C  B 1 64  ? 68.38300 63.22500 84.60500  1.000 105.47629 ? 166 C  B C6    1 
ATOM   4768 P  P     . U  B 1 65  ? 69.36200 58.36700 87.62600  1.000 100.49968 ? 167 U  B P     1 
ATOM   4769 O  OP1   . U  B 1 65  ? 68.49700 57.62900 88.58300  1.000 100.40494 ? 167 U  B OP1   1 
ATOM   4770 O  OP2   . U  B 1 65  ? 70.73800 57.87400 87.35300  1.000 102.39465 ? 167 U  B OP2   1 
ATOM   4771 O  "O5'" . U  B 1 65  ? 68.58500 58.45200 86.23800  1.000 94.23578  ? 167 U  B "O5'" 1 
ATOM   4772 C  "C5'" . U  B 1 65  ? 68.20400 57.26100 85.55600  1.000 96.92294  ? 167 U  B "C5'" 1 
ATOM   4773 C  "C4'" . U  B 1 65  ? 67.72800 57.53100 84.14800  1.000 90.49585  ? 167 U  B "C4'" 1 
ATOM   4774 O  "O4'" . U  B 1 65  ? 66.47700 58.27000 84.18600  1.000 90.90380  ? 167 U  B "O4'" 1 
ATOM   4775 C  "C3'" . U  B 1 65  ? 68.68200 58.34800 83.27800  1.000 90.41953  ? 167 U  B "C3'" 1 
ATOM   4776 O  "O3'" . U  B 1 65  ? 68.59100 57.89600 81.92700  1.000 93.85152  ? 167 U  B "O3'" 1 
ATOM   4777 C  "C2'" . U  B 1 65  ? 68.09900 59.75400 83.37500  1.000 92.37503  ? 167 U  B "C2'" 1 
ATOM   4778 O  "O2'" . U  B 1 65  ? 68.42900 60.59900 82.29300  1.000 106.69516 ? 167 U  B "O2'" 1 
ATOM   4779 C  "C1'" . U  B 1 65  ? 66.60300 59.45400 83.42400  1.000 92.51715  ? 167 U  B "C1'" 1 
ATOM   4780 N  N1    . U  B 1 65  ? 65.80400 60.50300 84.06600  1.000 94.27525  ? 167 U  B N1    1 
ATOM   4781 C  C2    . U  B 1 65  ? 65.01400 61.28900 83.25200  1.000 100.06805 ? 167 U  B C2    1 
ATOM   4782 O  O2    . U  B 1 65  ? 64.96600 61.13900 82.04300  1.000 106.02403 ? 167 U  B O2    1 
ATOM   4783 N  N3    . U  B 1 65  ? 64.28900 62.25500 83.90400  1.000 101.70772 ? 167 U  B N3    1 
ATOM   4784 C  C4    . U  B 1 65  ? 64.28200 62.50100 85.26200  1.000 108.73488 ? 167 U  B C4    1 
ATOM   4785 O  O4    . U  B 1 65  ? 63.58000 63.40500 85.71000  1.000 113.47756 ? 167 U  B O4    1 
ATOM   4786 C  C5    . U  B 1 65  ? 65.12500 61.64200 86.03800  1.000 105.57924 ? 167 U  B C5    1 
ATOM   4787 C  C6    . U  B 1 65  ? 65.84100 60.69200 85.42700  1.000 103.91852 ? 167 U  B C6    1 
ATOM   4788 P  P     . U  B 1 66  ? 69.62500 56.80300 81.35700  1.000 97.66915  ? 168 U  B P     1 
ATOM   4789 O  OP1   . U  B 1 66  ? 70.94400 57.03700 81.99800  1.000 107.98091 ? 168 U  B OP1   1 
ATOM   4790 O  OP2   . U  B 1 66  ? 69.52000 56.80200 79.87500  1.000 98.21132  ? 168 U  B OP2   1 
ATOM   4791 O  "O5'" . U  B 1 66  ? 69.05100 55.41000 81.87800  1.000 91.51578  ? 168 U  B "O5'" 1 
ATOM   4792 C  "C5'" . U  B 1 66  ? 67.74000 54.98400 81.52400  1.000 97.14540  ? 168 U  B "C5'" 1 
ATOM   4793 C  "C4'" . U  B 1 66  ? 67.64800 53.48300 81.38300  1.000 94.61615  ? 168 U  B "C4'" 1 
ATOM   4794 O  "O4'" . U  B 1 66  ? 68.61600 53.03300 80.39500  1.000 91.43946  ? 168 U  B "O4'" 1 
ATOM   4795 C  "C3'" . U  B 1 66  ? 67.92900 52.68100 82.65300  1.000 101.18799 ? 168 U  B "C3'" 1 
ATOM   4796 O  "O3'" . U  B 1 66  ? 67.10500 51.51300 82.66900  1.000 99.11669  ? 168 U  B "O3'" 1 
ATOM   4797 C  "C2'" . U  B 1 66  ? 69.38600 52.26800 82.47400  1.000 101.06166 ? 168 U  B "C2'" 1 
ATOM   4798 O  "O2'" . U  B 1 66  ? 69.75500 51.11100 83.19400  1.000 108.85997 ? 168 U  B "O2'" 1 
ATOM   4799 C  "C1'" . U  B 1 66  ? 69.45700 52.04900 80.96500  1.000 99.76414  ? 168 U  B "C1'" 1 
ATOM   4800 N  N1    . U  B 1 66  ? 70.79900 52.21200 80.38900  1.000 100.48265 ? 168 U  B N1    1 
ATOM   4801 C  C2    . U  B 1 66  ? 71.43800 51.08500 79.90500  1.000 105.17005 ? 168 U  B C2    1 
ATOM   4802 O  O2    . U  B 1 66  ? 70.94400 49.96900 79.94700  1.000 113.08416 ? 168 U  B O2    1 
ATOM   4803 N  N3    . U  B 1 66  ? 72.68500 51.30800 79.37500  1.000 104.00938 ? 168 U  B N3    1 
ATOM   4804 C  C4    . U  B 1 66  ? 73.33700 52.52000 79.27500  1.000 105.17005 ? 168 U  B C4    1 
ATOM   4805 O  O4    . U  B 1 66  ? 74.46000 52.55900 78.76900  1.000 108.45729 ? 168 U  B O4    1 
ATOM   4806 C  C5    . U  B 1 66  ? 72.60400 53.63900 79.79000  1.000 100.54581 ? 168 U  B C5    1 
ATOM   4807 C  C6    . U  B 1 66  ? 71.38700 53.45300 80.31400  1.000 99.41673  ? 168 U  B C6    1 
ATOM   4808 P  P     . G  B 1 67  ? 65.59500 51.58500 83.21700  1.000 107.39601 ? 169 G  B P     1 
ATOM   4809 O  OP1   . G  B 1 67  ? 65.43900 52.85600 83.96400  1.000 107.28020 ? 169 G  B OP1   1 
ATOM   4810 O  OP2   . G  B 1 67  ? 65.26400 50.28700 83.86000  1.000 104.84044 ? 169 G  B OP2   1 
ATOM   4811 O  "O5'" . G  B 1 67  ? 64.71100 51.71600 81.90100  1.000 98.46862  ? 169 G  B "O5'" 1 
ATOM   4812 C  "C5'" . G  B 1 67  ? 64.97300 50.91400 80.76100  1.000 101.29528 ? 169 G  B "C5'" 1 
ATOM   4813 C  "C4'" . G  B 1 67  ? 63.93000 51.13100 79.69700  1.000 100.55045 ? 169 G  B "C4'" 1 
ATOM   4814 O  "O4'" . G  B 1 67  ? 62.64800 50.64200 80.16300  1.000 105.25101 ? 169 G  B "O4'" 1 
ATOM   4815 C  "C3'" . G  B 1 67  ? 63.65600 52.57900 79.31500  1.000 95.45773  ? 169 G  B "C3'" 1 
ATOM   4816 O  "O3'" . G  B 1 67  ? 64.61100 53.10400 78.40800  1.000 93.48644  ? 169 G  B "O3'" 1 
ATOM   4817 C  "C2'" . G  B 1 67  ? 62.25000 52.50200 78.73800  1.000 98.10279  ? 169 G  B "C2'" 1 
ATOM   4818 O  "O2'" . G  B 1 67  ? 62.29000 52.00300 77.41000  1.000 100.89786 ? 169 G  B "O2'" 1 
ATOM   4819 C  "C1'" . G  B 1 67  ? 61.60700 51.43500 79.62800  1.000 105.43788 ? 169 G  B "C1'" 1 
ATOM   4820 N  N9    . G  B 1 67  ? 60.82800 52.01200 80.74100  1.000 105.28523 ? 169 G  B N9    1 
ATOM   4821 C  C8    . G  B 1 67  ? 61.03400 51.80100 82.08500  1.000 105.31155 ? 169 G  B C8    1 
ATOM   4822 N  N7    . G  B 1 67  ? 60.18300 52.43500 82.84600  1.000 111.25700 ? 169 G  B N7    1 
ATOM   4823 C  C5    . G  B 1 67  ? 59.35800 53.10500 81.95600  1.000 108.03556 ? 169 G  B C5    1 
ATOM   4824 C  C6    . G  B 1 67  ? 58.25300 53.96100 82.20000  1.000 117.70514 ? 169 G  B C6    1 
ATOM   4825 O  O6    . G  B 1 67  ? 57.76800 54.30800 83.28200  1.000 125.56661 ? 169 G  B O6    1 
ATOM   4826 N  N1    . G  B 1 67  ? 57.69500 54.43200 81.01900  1.000 117.06032 ? 169 G  B N1    1 
ATOM   4827 C  C2    . G  B 1 67  ? 58.15000 54.12500 79.76200  1.000 113.14143 ? 169 G  B C2    1 
ATOM   4828 N  N2    . G  B 1 67  ? 57.47700 54.67700 78.74300  1.000 111.82285 ? 169 G  B N2    1 
ATOM   4829 N  N3    . G  B 1 67  ? 59.18100 53.33100 79.52000  1.000 115.22063 ? 169 G  B N3    1 
ATOM   4830 C  C4    . G  B 1 67  ? 59.74100 52.85700 80.65400  1.000 109.81209 ? 169 G  B C4    1 
ATOM   4831 P  P     . C  B 1 68  ? 64.93100 54.67900 78.38000  1.000 95.11660  ? 170 C  B P     1 
ATOM   4832 O  OP1   . C  B 1 68  ? 66.00300 54.93800 77.38700  1.000 98.15380  ? 170 C  B OP1   1 
ATOM   4833 O  OP2   . C  B 1 68  ? 65.09000 55.14400 79.77900  1.000 104.14663 ? 170 C  B OP2   1 
ATOM   4834 O  "O5'" . C  B 1 68  ? 63.60700 55.32500 77.78400  1.000 95.85879  ? 170 C  B "O5'" 1 
ATOM   4835 C  "C5'" . C  B 1 68  ? 63.29900 55.20900 76.40400  1.000 98.49858  ? 170 C  B "C5'" 1 
ATOM   4836 C  "C4'" . C  B 1 68  ? 62.16600 56.12500 76.02000  1.000 98.61175  ? 170 C  B "C4'" 1 
ATOM   4837 O  "O4'" . C  B 1 68  ? 60.95200 55.71100 76.69900  1.000 99.93296  ? 170 C  B "O4'" 1 
ATOM   4838 C  "C3'" . C  B 1 68  ? 62.33300 57.58100 76.42400  1.000 93.40323  ? 170 C  B "C3'" 1 
ATOM   4839 O  "O3'" . C  B 1 68  ? 63.14100 58.31700 75.52600  1.000 91.39510  ? 170 C  B "O3'" 1 
ATOM   4840 C  "C2'" . C  B 1 68  ? 60.89700 58.07200 76.48800  1.000 100.70937 ? 170 C  B "C2'" 1 
ATOM   4841 O  "O2'" . C  B 1 68  ? 60.38400 58.30400 75.18400  1.000 106.10739 ? 170 C  B "O2'" 1 
ATOM   4842 C  "C1'" . C  B 1 68  ? 60.19800 56.84700 77.07200  1.000 106.74431 ? 170 C  B "C1'" 1 
ATOM   4843 N  N1    . C  B 1 68  ? 60.14100 56.89300 78.55200  1.000 104.35718 ? 170 C  B N1    1 
ATOM   4844 C  C2    . C  B 1 68  ? 59.28200 57.79400 79.19200  1.000 107.17594 ? 170 C  B C2    1 
ATOM   4845 O  O2    . C  B 1 68  ? 58.57700 58.55400 78.51400  1.000 105.67312 ? 170 C  B O2    1 
ATOM   4846 N  N3    . C  B 1 68  ? 59.23200 57.81800 80.54500  1.000 111.17642 ? 170 C  B N3    1 
ATOM   4847 C  C4    . C  B 1 68  ? 59.99600 56.99500 81.26300  1.000 109.05511 ? 170 C  B C4    1 
ATOM   4848 N  N4    . C  B 1 68  ? 59.91800 57.05600 82.59300  1.000 105.74155 ? 170 C  B N4    1 
ATOM   4849 C  C5    . C  B 1 68  ? 60.87500 56.06600 80.64300  1.000 106.33636 ? 170 C  B C5    1 
ATOM   4850 C  C6    . C  B 1 68  ? 60.91700 56.05200 79.30400  1.000 100.63041 ? 170 C  B C6    1 
ATOM   4851 P  P     . A  B 1 69  ? 63.98100 59.59200 76.03400  1.000 102.20663 ? 171 A  B P     1 
ATOM   4852 O  OP1   . A  B 1 69  ? 64.31000 60.42300 74.84600  1.000 109.59436 ? 171 A  B OP1   1 
ATOM   4853 O  OP2   . A  B 1 69  ? 65.08000 59.10600 76.90000  1.000 102.81986 ? 171 A  B OP2   1 
ATOM   4854 O  "O5'" . A  B 1 69  ? 62.96100 60.43000 76.93000  1.000 100.74329 ? 171 A  B "O5'" 1 
ATOM   4855 C  "C5'" . A  B 1 69  ? 62.56600 61.74200 76.52600  1.000 107.04405 ? 171 A  B "C5'" 1 
ATOM   4856 C  "C4'" . A  B 1 69  ? 61.36700 62.23800 77.29800  1.000 109.78648 ? 171 A  B "C4'" 1 
ATOM   4857 O  "O4'" . A  B 1 69  ? 60.98200 61.22500 78.26200  1.000 100.31430 ? 171 A  B "O4'" 1 
ATOM   4858 C  "C3'" . A  B 1 69  ? 61.58200 63.51900 78.08800  1.000 102.82775 ? 171 A  B "C3'" 1 
ATOM   4859 O  "O3'" . A  B 1 69  ? 60.34600 64.22700 78.17100  1.000 108.44159 ? 171 A  B "O3'" 1 
ATOM   4860 C  "C2'" . A  B 1 69  ? 61.96800 63.00000 79.47000  1.000 109.53645 ? 171 A  B "C2'" 1 
ATOM   4861 O  "O2'" . A  B 1 69  ? 61.69200 63.89600 80.52600  1.000 123.63814 ? 171 A  B "O2'" 1 
ATOM   4862 C  "C1'" . A  B 1 69  ? 61.13500 61.72100 79.58000  1.000 104.81484 ? 171 A  B "C1'" 1 
ATOM   4863 N  N9    . A  B 1 69  ? 61.79700 60.66600 80.35300  1.000 106.70717 ? 171 A  B N9    1 
ATOM   4864 C  C8    . A  B 1 69  ? 62.60100 59.69100 79.82200  1.000 106.37292 ? 171 A  B C8    1 
ATOM   4865 N  N7    . A  B 1 69  ? 63.08100 58.84900 80.69900  1.000 108.39684 ? 171 A  B N7    1 
ATOM   4866 C  C5    . A  B 1 69  ? 62.54500 59.29200 81.89800  1.000 111.09454 ? 171 A  B C5    1 
ATOM   4867 C  C6    . A  B 1 69  ? 62.67600 58.81300 83.21100  1.000 107.18880 ? 171 A  B C6    1 
ATOM   4868 N  N6    . A  B 1 69  ? 63.41200 57.74800 83.53200  1.000 110.64711 ? 171 A  B N6    1 
ATOM   4869 N  N1    . A  B 1 69  ? 62.01900 59.47300 84.18600  1.000 102.82775 ? 171 A  B N1    1 
ATOM   4870 C  C2    . A  B 1 69  ? 61.28400 60.54000 83.85100  1.000 106.35449 ? 171 A  B C2    1 
ATOM   4871 N  N3    . A  B 1 69  ? 61.08000 61.08900 82.65500  1.000 106.07025 ? 171 A  B N3    1 
ATOM   4872 C  C4    . A  B 1 69  ? 61.74300 60.40600 81.70600  1.000 109.49171 ? 171 A  B C4    1 
ATOM   4873 P  P     . A  B 1 70  ? 59.82200 65.13800 76.95000  1.000 112.09165 ? 172 A  B P     1 
ATOM   4874 O  OP1   . A  B 1 70  ? 59.80500 64.34600 75.69300  1.000 110.57304 ? 172 A  B OP1   1 
ATOM   4875 O  OP2   . A  B 1 70  ? 60.56300 66.42700 76.98600  1.000 108.35435 ? 172 A  B OP2   1 
ATOM   4876 O  "O5'" . A  B 1 70  ? 58.30200 65.40800 77.33300  1.000 108.30961 ? 172 A  B "O5'" 1 
ATOM   4877 C  "C5'" . A  B 1 70  ? 57.59800 66.52500 76.81900  1.000 103.96699 ? 172 A  B "C5'" 1 
ATOM   4878 C  "C4'" . A  B 1 70  ? 56.49200 66.93600 77.75400  1.000 111.94689 ? 172 A  B "C4'" 1 
ATOM   4879 O  "O4'" . A  B 1 70  ? 55.77400 65.75200 78.20600  1.000 109.09129 ? 172 A  B "O4'" 1 
ATOM   4880 C  "C3'" . A  B 1 70  ? 56.93200 67.61500 79.04300  1.000 108.61491 ? 172 A  B "C3'" 1 
ATOM   4881 O  "O3'" . A  B 1 70  ? 57.20900 68.99700 78.88200  1.000 106.63310 ? 172 A  B "O3'" 1 
ATOM   4882 C  "C2'" . A  B 1 70  ? 55.76600 67.32000 79.97600  1.000 112.42590 ? 172 A  B "C2'" 1 
ATOM   4883 O  "O2'" . A  B 1 70  ? 54.65500 68.14600 79.66400  1.000 121.70596 ? 172 A  B "O2'" 1 
ATOM   4884 C  "C1'" . A  B 1 70  ? 55.42200 65.89000 79.56400  1.000 111.68897 ? 172 A  B "C1'" 1 
ATOM   4885 N  N9    . A  B 1 70  ? 56.21600 64.91700 80.33300  1.000 117.74759 ? 172 A  B N9    1 
ATOM   4886 C  C8    . A  B 1 70  ? 57.19300 64.07500 79.86200  1.000 115.09200 ? 172 A  B C8    1 
ATOM   4887 N  N7    . A  B 1 70  ? 57.74500 63.33700 80.79300  1.000 111.92847 ? 172 A  B N7    1 
ATOM   4888 C  C5    . A  B 1 70  ? 57.09300 63.72600 81.95400  1.000 115.64733 ? 172 A  B C5    1 
ATOM   4889 C  C6    . A  B 1 70  ? 57.22200 63.31500 83.29400  1.000 113.42338 ? 172 A  B C6    1 
ATOM   4890 N  N6    . A  B 1 70  ? 58.08600 62.38400 83.71400  1.000 112.28377 ? 172 A  B N6    1 
ATOM   4891 N  N1    . A  B 1 70  ? 56.41800 63.90300 84.20900  1.000 112.52064 ? 172 A  B N1    1 
ATOM   4892 C  C2    . A  B 1 70  ? 55.55000 64.83900 83.80300  1.000 109.64135 ? 172 A  B C2    1 
ATOM   4893 N  N3    . A  B 1 70  ? 55.33900 65.30500 82.57400  1.000 107.98589 ? 172 A  B N3    1 
ATOM   4894 C  C4    . A  B 1 70  ? 56.15100 64.70300 81.68700  1.000 116.06054 ? 172 A  B C4    1 
ATOM   4895 P  P     . A  B 1 71  ? 58.42700 69.68400 79.67700  1.000 118.19249 ? 173 A  B P     1 
ATOM   4896 O  OP1   . A  B 1 71  ? 58.55100 71.07900 79.18600  1.000 120.43224 ? 173 A  B OP1   1 
ATOM   4897 O  OP2   . A  B 1 71  ? 59.61000 68.78400 79.62900  1.000 118.73203 ? 173 A  B OP2   1 
ATOM   4898 O  "O5'" . A  B 1 71  ? 57.90400 69.75300 81.18000  1.000 114.53679 ? 173 A  B "O5'" 1 
ATOM   4899 C  "C5'" . A  B 1 71  ? 56.70100 70.43900 81.50100  1.000 108.99139 ? 173 A  B "C5'" 1 
ATOM   4900 C  "C4'" . A  B 1 71  ? 56.24800 70.13200 82.90500  1.000 104.79352 ? 173 A  B "C4'" 1 
ATOM   4901 O  "O4'" . A  B 1 71  ? 56.10800 68.69500 83.06600  1.000 100.83778 ? 173 A  B "O4'" 1 
ATOM   4902 C  "C3'" . A  B 1 71  ? 57.21200 70.53800 84.00800  1.000 103.88288 ? 173 A  B "C3'" 1 
ATOM   4903 O  "O3'" . A  B 1 71  ? 57.10000 71.90600 84.35600  1.000 99.57974  ? 173 A  B "O3'" 1 
ATOM   4904 C  "C2'" . A  B 1 71  ? 56.84900 69.58500 85.13700  1.000 104.21977 ? 173 A  B "C2'" 1 
ATOM   4905 O  "O2'" . A  B 1 71  ? 55.66300 70.01100 85.79200  1.000 105.81733 ? 173 A  B "O2'" 1 
ATOM   4906 C  "C1'" . A  B 1 71  ? 56.52600 68.31000 84.35900  1.000 106.12263 ? 173 A  B "C1'" 1 
ATOM   4907 N  N9    . A  B 1 71  ? 57.70200 67.42700 84.21900  1.000 109.16773 ? 173 A  B N9    1 
ATOM   4908 C  C8    . A  B 1 71  ? 58.29100 67.01500 83.05000  1.000 115.31320 ? 173 A  B C8    1 
ATOM   4909 N  N7    . A  B 1 71  ? 59.33200 66.23900 83.22400  1.000 116.16067 ? 173 A  B N7    1 
ATOM   4910 C  C5    . A  B 1 71  ? 59.43600 66.12300 84.60300  1.000 107.56227 ? 173 A  B C5    1 
ATOM   4911 C  C6    . A  B 1 71  ? 60.33700 65.42700 85.43000  1.000 109.59673 ? 173 A  B C6    1 
ATOM   4912 N  N6    . A  B 1 71  ? 61.34400 64.68200 84.96400  1.000 117.61348 ? 173 A  B N6    1 
ATOM   4913 N  N1    . A  B 1 71  ? 60.16200 65.52500 86.76700  1.000 108.58081 ? 173 A  B N1    1 
ATOM   4914 C  C2    . A  B 1 71  ? 59.15400 66.26800 87.23300  1.000 110.31260 ? 173 A  B C2    1 
ATOM   4915 N  N3    . A  B 1 71  ? 58.24400 66.96200 86.55600  1.000 107.84915 ? 173 A  B N3    1 
ATOM   4916 C  C4    . A  B 1 71  ? 58.43900 66.85000 85.23000  1.000 106.44372 ? 173 A  B C4    1 
ATOM   4917 P  P     . G  B 1 72  ? 58.40100 72.84500 84.37500  1.000 111.13367 ? 174 G  B P     1 
ATOM   4918 O  OP1   . G  B 1 72  ? 57.93800 74.24500 84.51200  1.000 115.45524 ? 174 G  B OP1   1 
ATOM   4919 O  OP2   . G  B 1 72  ? 59.29100 72.45600 83.25300  1.000 111.91008 ? 174 G  B OP2   1 
ATOM   4920 O  "O5'" . G  B 1 72  ? 59.12800 72.44800 85.73200  1.000 114.82359 ? 174 G  B "O5'" 1 
ATOM   4921 C  "C5'" . G  B 1 72  ? 58.43000 72.47700 86.96900  1.000 108.63600 ? 174 G  B "C5'" 1 
ATOM   4922 C  "C4'" . G  B 1 72  ? 59.13800 71.64400 88.00400  1.000 101.89836 ? 174 G  B "C4'" 1 
ATOM   4923 O  "O4'" . G  B 1 72  ? 59.06400 70.24500 87.62500  1.000 98.66376  ? 174 G  B "O4'" 1 
ATOM   4924 C  "C3'" . G  B 1 72  ? 60.62700 71.91500 88.14200  1.000 103.43538 ? 174 G  B "C3'" 1 
ATOM   4925 O  "O3'" . G  B 1 72  ? 60.90400 73.03800 88.95900  1.000 108.33071 ? 174 G  B "O3'" 1 
ATOM   4926 C  "C2'" . G  B 1 72  ? 61.15900 70.59600 88.68400  1.000 109.47032 ? 174 G  B "C2'" 1 
ATOM   4927 O  "O2'" . G  B 1 72  ? 60.88800 70.48700 90.07500  1.000 113.91559 ? 174 G  B "O2'" 1 
ATOM   4928 C  "C1'" . G  B 1 72  ? 60.27600 69.59300 87.93900  1.000 108.87024 ? 174 G  B "C1'" 1 
ATOM   4929 N  N9    . G  B 1 72  ? 60.88400 69.12200 86.67800  1.000 108.90446 ? 174 G  B N9    1 
ATOM   4930 C  C8    . G  B 1 72  ? 60.46700 69.46200 85.41700  1.000 108.88867 ? 174 G  B C8    1 
ATOM   4931 N  N7    . G  B 1 72  ? 61.16700 68.91300 84.47000  1.000 107.03318 ? 174 G  B N7    1 
ATOM   4932 C  C5    . G  B 1 72  ? 62.10800 68.15400 85.14700  1.000 106.02253 ? 174 G  B C5    1 
ATOM   4933 C  C6    . G  B 1 72  ? 63.14800 67.32800 84.63800  1.000 110.35463 ? 174 G  B C6    1 
ATOM   4934 O  O6    . G  B 1 72  ? 63.44900 67.09300 83.45600  1.000 109.77562 ? 174 G  B O6    1 
ATOM   4935 N  N1    . G  B 1 72  ? 63.88000 66.73900 85.66600  1.000 108.09910 ? 174 G  B N1    1 
ATOM   4936 C  C2    . G  B 1 72  ? 63.63900 66.92000 87.00400  1.000 107.02002 ? 174 G  B C2    1 
ATOM   4937 N  N2    . G  B 1 72  ? 64.45400 66.26600 87.84100  1.000 110.32568 ? 174 G  B N2    1 
ATOM   4938 N  N3    . G  B 1 72  ? 62.67400 67.68400 87.48800  1.000 105.53827 ? 174 G  B N3    1 
ATOM   4939 C  C4    . G  B 1 72  ? 61.94900 68.26700 86.51200  1.000 103.62488 ? 174 G  B C4    1 
ATOM   4940 P  P     . G  B 1 73  ? 61.78200 74.25100 88.38300  1.000 113.33905 ? 175 G  B P     1 
ATOM   4941 O  OP1   . G  B 1 73  ? 61.46600 75.46800 89.17000  1.000 113.62592 ? 175 G  B OP1   1 
ATOM   4942 O  OP2   . G  B 1 73  ? 61.63100 74.26700 86.90800  1.000 115.69196 ? 175 G  B OP2   1 
ATOM   4943 O  "O5'" . G  B 1 73  ? 63.27500 73.82100 88.72500  1.000 108.83851 ? 175 G  B "O5'" 1 
ATOM   4944 C  "C5'" . G  B 1 73  ? 63.67200 73.61700 90.07300  1.000 112.66265 ? 175 G  B "C5'" 1 
ATOM   4945 C  "C4'" . G  B 1 73  ? 64.78400 72.60500 90.18500  1.000 112.07047 ? 175 G  B "C4'" 1 
ATOM   4946 O  "O4'" . G  B 1 73  ? 64.33600 71.32100 89.67400  1.000 108.84114 ? 175 G  B "O4'" 1 
ATOM   4947 C  "C3'" . G  B 1 73  ? 66.03700 72.89200 89.38000  1.000 108.15948 ? 175 G  B "C3'" 1 
ATOM   4948 O  "O3'" . G  B 1 73  ? 66.88000 73.86800 89.96400  1.000 107.10146 ? 175 G  B "O3'" 1 
ATOM   4949 C  "C2'" . G  B 1 73  ? 66.66400 71.51100 89.26300  1.000 111.00456 ? 175 G  B "C2'" 1 
ATOM   4950 O  "O2'" . G  B 1 73  ? 67.27300 71.13300 90.48800  1.000 113.95491 ? 175 G  B "O2'" 1 
ATOM   4951 C  "C1'" . G  B 1 73  ? 65.41900 70.64800 89.06300  1.000 110.31763 ? 175 G  B "C1'" 1 
ATOM   4952 N  N9    . G  B 1 73  ? 65.11900 70.47600 87.63100  1.000 108.85430 ? 175 G  B N9    1 
ATOM   4953 C  C8    . G  B 1 73  ? 64.10600 71.05700 86.90800  1.000 113.61013 ? 175 G  B C8    1 
ATOM   4954 N  N7    . G  B 1 73  ? 64.12200 70.71600 85.64900  1.000 112.65739 ? 175 G  B N7    1 
ATOM   4955 C  C5    . G  B 1 73  ? 65.21100 69.86300 85.53800  1.000 112.70213 ? 175 G  B C5    1 
ATOM   4956 C  C6    . G  B 1 73  ? 65.72800 69.17700 84.41200  1.000 108.85956 ? 175 G  B C6    1 
ATOM   4957 O  O6    . G  B 1 73  ? 65.30200 69.19000 83.25100  1.000 110.08076 ? 175 G  B O6    1 
ATOM   4958 N  N1    . G  B 1 73  ? 66.84800 68.41900 84.74500  1.000 106.70667 ? 175 G  B N1    1 
ATOM   4959 C  C2    . G  B 1 73  ? 67.39900 68.33200 86.00000  1.000 110.70189 ? 175 G  B C2    1 
ATOM   4960 N  N2    . G  B 1 73  ? 68.47900 67.54800 86.13000  1.000 107.64363 ? 175 G  B N2    1 
ATOM   4961 N  N3    . G  B 1 73  ? 66.92400 68.97000 87.05600  1.000 111.69148 ? 175 G  B N3    1 
ATOM   4962 C  C4    . G  B 1 73  ? 65.83800 69.70800 86.75200  1.000 109.70440 ? 175 G  B C4    1 
ATOM   4963 P  P     . G  B 1 74  ? 67.57400 74.97200 89.02700  1.000 113.72609 ? 176 G  B P     1 
ATOM   4964 O  OP1   . G  B 1 74  ? 68.29600 75.93300 89.89700  1.000 115.82371 ? 176 G  B OP1   1 
ATOM   4965 O  OP2   . G  B 1 74  ? 66.54000 75.47700 88.08800  1.000 112.03115 ? 176 G  B OP2   1 
ATOM   4966 O  "O5'" . G  B 1 74  ? 68.64400 74.13900 88.18800  1.000 108.79129 ? 176 G  B "O5'" 1 
ATOM   4967 C  "C5'" . G  B 1 74  ? 69.69900 73.44800 88.84100  1.000 109.31504 ? 176 G  B "C5'" 1 
ATOM   4968 C  "C4'" . G  B 1 74  ? 70.42600 72.51000 87.90900  1.000 115.53420 ? 176 G  B "C4'" 1 
ATOM   4969 O  "O4'" . G  B 1 74  ? 69.50200 71.53800 87.35400  1.000 115.58947 ? 176 G  B "O4'" 1 
ATOM   4970 C  "C3'" . G  B 1 74  ? 71.07100 73.13800 86.68300  1.000 117.00807 ? 176 G  B "C3'" 1 
ATOM   4971 O  "O3'" . G  B 1 74  ? 72.30500 73.77100 86.96800  1.000 115.61579 ? 176 G  B "O3'" 1 
ATOM   4972 C  "C2'" . G  B 1 74  ? 71.19300 71.95300 85.73400  1.000 114.48408 ? 176 G  B "C2'" 1 
ATOM   4973 O  "O2'" . G  B 1 74  ? 72.30000 71.13400 86.08600  1.000 116.39220 ? 176 G  B "O2'" 1 
ATOM   4974 C  "C1'" . G  B 1 74  ? 69.90600 71.18600 86.04500  1.000 113.41553 ? 176 G  B "C1'" 1 
ATOM   4975 N  N9    . G  B 1 74  ? 68.82100 71.51700 85.10300  1.000 113.39974 ? 176 G  B N9    1 
ATOM   4976 C  C8    . G  B 1 74  ? 67.65000 72.17900 85.38000  1.000 113.87874 ? 176 G  B C8    1 
ATOM   4977 N  N7    . G  B 1 74  ? 66.88400 72.31900 84.33500  1.000 113.94191 ? 176 G  B N7    1 
ATOM   4978 C  C5    . G  B 1 74  ? 67.59200 71.71700 83.30500  1.000 110.80206 ? 176 G  B C5    1 
ATOM   4979 C  C6    . G  B 1 74  ? 67.26300 71.56000 81.93500  1.000 112.48647 ? 176 G  B C6    1 
ATOM   4980 O  O6    . G  B 1 74  ? 66.24000 71.93300 81.34500  1.000 122.99563 ? 176 G  B O6    1 
ATOM   4981 N  N1    . G  B 1 74  ? 68.26400 70.88500 81.24100  1.000 110.55729 ? 176 G  B N1    1 
ATOM   4982 C  C2    . G  B 1 74  ? 69.43200 70.42000 81.79300  1.000 110.21515 ? 176 G  B C2    1 
ATOM   4983 N  N2    . G  B 1 74  ? 70.27400 69.79500 80.95700  1.000 110.16514 ? 176 G  B N2    1 
ATOM   4984 N  N3    . G  B 1 74  ? 69.74900 70.56100 83.06900  1.000 113.47080 ? 176 G  B N3    1 
ATOM   4985 C  C4    . G  B 1 74  ? 68.79000 71.21400 83.76100  1.000 115.59474 ? 176 G  B C4    1 
ATOM   4986 P  P     . U  B 1 75  ? 72.61600 75.23000 86.36800  1.000 125.98441 ? 177 U  B P     1 
ATOM   4987 O  OP1   . U  B 1 75  ? 73.89400 75.70100 86.95900  1.000 118.40193 ? 177 U  B OP1   1 
ATOM   4988 O  OP2   . U  B 1 75  ? 71.39400 76.05900 86.53100  1.000 115.36209 ? 177 U  B OP2   1 
ATOM   4989 O  "O5'" . U  B 1 75  ? 72.83400 74.97700 84.80600  1.000 122.95774 ? 177 U  B "O5'" 1 
ATOM   4990 C  "C5'" . U  B 1 75  ? 73.97300 74.27500 84.32400  1.000 119.74946 ? 177 U  B "C5'" 1 
ATOM   4991 C  "C4'" . U  B 1 75  ? 73.78600 73.79700 82.90200  1.000 116.78331 ? 177 U  B "C4'" 1 
ATOM   4992 O  "O4'" . U  B 1 75  ? 72.56300 73.02400 82.79800  1.000 114.41724 ? 177 U  B "O4'" 1 
ATOM   4993 C  "C3'" . U  B 1 75  ? 73.63600 74.87100 81.83400  1.000 121.87603 ? 177 U  B "C3'" 1 
ATOM   4994 O  "O3'" . U  B 1 75  ? 74.87600 75.41400 81.42000  1.000 126.04758 ? 177 U  B "O3'" 1 
ATOM   4995 C  "C2'" . U  B 1 75  ? 72.90100 74.13400 80.72100  1.000 121.54704 ? 177 U  B "C2'" 1 
ATOM   4996 O  "O2'" . U  B 1 75  ? 73.79900 73.33700 79.95800  1.000 121.20226 ? 177 U  B "O2'" 1 
ATOM   4997 C  "C1'" . U  B 1 75  ? 71.97800 73.21200 81.52500  1.000 110.97735 ? 177 U  B "C1'" 1 
ATOM   4998 N  N1    . U  B 1 75  ? 70.62800 73.79600 81.69200  1.000 109.83774 ? 177 U  B N1    1 
ATOM   4999 C  C2    . U  B 1 75  ? 69.77300 73.75000 80.60700  1.000 115.05942 ? 177 U  B C2    1 
ATOM   5000 O  O2    . U  B 1 75  ? 70.07900 73.25200 79.53800  1.000 117.14125 ? 177 U  B O2    1 
ATOM   5001 N  N3    . U  B 1 75  ? 68.54000 74.30700 80.82100  1.000 116.61487 ? 177 U  B N3    1 
ATOM   5002 C  C4    . U  B 1 75  ? 68.08500 74.89700 81.98400  1.000 113.58293 ? 177 U  B C4    1 
ATOM   5003 O  O4    . U  B 1 75  ? 66.94200 75.36300 82.02300  1.000 125.68701 ? 177 U  B O4    1 
ATOM   5004 C  C5    . U  B 1 75  ? 69.03200 74.90700 83.05800  1.000 111.76955 ? 177 U  B C5    1 
ATOM   5005 C  C6    . U  B 1 75  ? 70.24100 74.37100 82.87800  1.000 113.88560 ? 177 U  B C6    1 
ATOM   5006 P  P     . A  B 1 76  ? 75.47700 76.70900 82.15100  1.000 129.55065 ? 178 A  B P     1 
ATOM   5007 O  OP1   . A  B 1 76  ? 74.38700 77.34000 82.93700  1.000 119.88107 ? 178 A  B OP1   1 
ATOM   5008 O  OP2   . A  B 1 76  ? 76.20400 77.51700 81.13800  1.000 126.94508 ? 178 A  B OP2   1 
ATOM   5009 O  "O5'" . A  B 1 76  ? 76.54300 76.09800 83.16300  1.000 127.88993 ? 178 A  B "O5'" 1 
ATOM   5010 C  "C5'" . A  B 1 76  ? 77.75300 76.78800 83.44300  1.000 129.87438 ? 178 A  B "C5'" 1 
ATOM   5011 C  "C4'" . A  B 1 76  ? 78.96800 75.96200 83.10300  1.000 123.40255 ? 178 A  B "C4'" 1 
ATOM   5012 O  "O4'" . A  B 1 76  ? 78.61200 74.93400 82.13300  1.000 119.14414 ? 178 A  B "O4'" 1 
ATOM   5013 C  "C3'" . A  B 1 76  ? 80.11800 76.75100 82.48300  1.000 129.20324 ? 178 A  B "C3'" 1 
ATOM   5014 O  "O3'" . A  B 1 76  ? 81.35600 76.19000 82.91400  1.000 135.47505 ? 178 A  B "O3'" 1 
ATOM   5015 C  "C2'" . A  B 1 76  ? 79.92500 76.49800 80.99200  1.000 126.96877 ? 178 A  B "C2'" 1 
ATOM   5016 O  "O2'" . A  B 1 76  ? 81.08600 76.67100 80.21000  1.000 129.36116 ? 178 A  B "O2'" 1 
ATOM   5017 C  "C1'" . A  B 1 76  ? 79.44700 75.05200 80.99700  1.000 118.52302 ? 178 A  B "C1'" 1 
ATOM   5018 N  N9    . A  B 1 76  ? 78.68700 74.66100 79.80800  1.000 112.55125 ? 178 A  B N9    1 
ATOM   5019 C  C8    . A  B 1 76  ? 77.32600 74.57400 79.66900  1.000 119.63894 ? 178 A  B C8    1 
ATOM   5020 N  N7    . A  B 1 76  ? 76.94900 74.18100 78.47800  1.000 123.67100 ? 178 A  B N7    1 
ATOM   5021 C  C5    . A  B 1 76  ? 78.14400 73.99000 77.79500  1.000 114.68571 ? 178 A  B C5    1 
ATOM   5022 C  C6    . A  B 1 76  ? 78.42800 73.57500 76.48100  1.000 111.31426 ? 178 A  B C6    1 
ATOM   5023 N  N6    . A  B 1 76  ? 77.48400 73.26500 75.58600  1.000 114.13828 ? 178 A  B N6    1 
ATOM   5024 N  N1    . A  B 1 76  ? 79.73000 73.49000 76.11500  1.000 116.22274 ? 178 A  B N1    1 
ATOM   5025 C  C2    . A  B 1 76  ? 80.67400 73.80300 77.01400  1.000 115.26736 ? 178 A  B C2    1 
ATOM   5026 N  N3    . A  B 1 76  ? 80.53100 74.20500 78.27600  1.000 115.61477 ? 178 A  B N3    1 
ATOM   5027 C  C4    . A  B 1 76  ? 79.22700 74.27300 78.60700  1.000 114.53570 ? 178 A  B C4    1 
ATOM   5028 P  P     . U  B 1 77  ? 82.25000 76.95600 84.00700  1.000 139.25722 ? 179 U  B P     1 
ATOM   5029 O  OP1   . U  B 1 77  ? 81.79500 78.36700 84.07600  1.000 137.71756 ? 179 U  B OP1   1 
ATOM   5030 O  OP2   . U  B 1 77  ? 83.66800 76.64800 83.69800  1.000 115.68861 ? 179 U  B OP2   1 
ATOM   5031 O  "O5'" . U  B 1 77  ? 81.88200 76.24000 85.38200  1.000 139.28617 ? 179 U  B "O5'" 1 
ATOM   5032 C  "C5'" . U  B 1 77  ? 82.25100 74.88600 85.62000  1.000 140.06521 ? 179 U  B "C5'" 1 
ATOM   5033 C  "C4'" . U  B 1 77  ? 81.67700 74.36700 86.91700  1.000 134.10134 ? 179 U  B "C4'" 1 
ATOM   5034 O  "O4'" . U  B 1 77  ? 81.99000 75.29900 87.98800  1.000 152.88254 ? 179 U  B "O4'" 1 
ATOM   5035 C  "C3'" . U  B 1 77  ? 80.16200 74.19400 86.94100  1.000 136.37267 ? 179 U  B "C3'" 1 
ATOM   5036 O  "O3'" . U  B 1 77  ? 79.83200 73.12100 87.82200  1.000 137.37542 ? 179 U  B "O3'" 1 
ATOM   5037 C  "C2'" . U  B 1 77  ? 79.69300 75.50600 87.55500  1.000 144.96317 ? 179 U  B "C2'" 1 
ATOM   5038 O  "O2'" . U  B 1 77  ? 78.41700 75.45600 88.15400  1.000 140.24945 ? 179 U  B "O2'" 1 
ATOM   5039 C  "C1'" . U  B 1 77  ? 80.79200 75.76000 88.58300  1.000 157.86208 ? 179 U  B "C1'" 1 
ATOM   5040 N  N1    . U  B 1 77  ? 80.96700 77.17500 88.92700  1.000 167.97645 ? 179 U  B N1    1 
ATOM   5041 C  C2    . U  B 1 77  ? 80.01800 77.73700 89.75800  1.000 169.02395 ? 179 U  B C2    1 
ATOM   5042 O  O2    . U  B 1 77  ? 79.06600 77.11500 90.20000  1.000 166.62366 ? 179 U  B O2    1 
ATOM   5043 N  N3    . U  B 1 77  ? 80.22300 79.06000 90.04500  1.000 178.23558 ? 179 U  B N3    1 
ATOM   5044 C  C4    . U  B 1 77  ? 81.26100 79.85200 89.59700  1.000 185.86281 ? 179 U  B C4    1 
ATOM   5045 O  O4    . U  B 1 77  ? 81.30800 81.03200 89.94900  1.000 194.80599 ? 179 U  B O4    1 
ATOM   5046 C  C5    . U  B 1 77  ? 82.20500 79.19400 88.74300  1.000 178.66195 ? 179 U  B C5    1 
ATOM   5047 C  C6    . U  B 1 77  ? 82.03200 77.90200 88.44200  1.000 169.82668 ? 179 U  B C6    1 
ATOM   5048 P  P     . G  B 1 78  ? 79.76600 71.61500 87.27000  1.000 137.29381 ? 180 G  B P     1 
ATOM   5049 O  OP1   . G  B 1 78  ? 79.12900 70.76900 88.31300  1.000 123.03421 ? 180 G  B OP1   1 
ATOM   5050 O  OP2   . G  B 1 78  ? 81.10700 71.25300 86.74200  1.000 120.91553 ? 180 G  B OP2   1 
ATOM   5051 O  "O5'" . G  B 1 78  ? 78.74500 71.71800 86.05400  1.000 131.77736 ? 180 G  B "O5'" 1 
ATOM   5052 C  "C5'" . G  B 1 78  ? 77.38300 72.04800 86.28300  1.000 129.54025 ? 180 G  B "C5'" 1 
ATOM   5053 C  "C4'" . G  B 1 78  ? 76.54500 71.80100 85.05700  1.000 125.95561 ? 180 G  B "C4'" 1 
ATOM   5054 O  "O4'" . G  B 1 78  ? 77.01600 72.64000 83.97100  1.000 127.62686 ? 180 G  B "O4'" 1 
ATOM   5055 C  "C3'" . G  B 1 78  ? 76.60000 70.38800 84.49800  1.000 121.96829 ? 180 G  B "C3'" 1 
ATOM   5056 O  "O3'" . G  B 1 78  ? 75.71400 69.50700 85.17300  1.000 117.75726 ? 180 G  B "O3'" 1 
ATOM   5057 C  "C2'" . G  B 1 78  ? 76.26400 70.59500 83.02600  1.000 119.62854 ? 180 G  B "C2'" 1 
ATOM   5058 O  "O2'" . G  B 1 78  ? 74.86300 70.74800 82.85500  1.000 112.64086 ? 180 G  B "O2'" 1 
ATOM   5059 C  "C1'" . G  B 1 78  ? 76.93400 71.94200 82.74900  1.000 122.48940 ? 180 G  B "C1'" 1 
ATOM   5060 N  N9    . G  B 1 78  ? 78.30100 71.79800 82.21700  1.000 117.32300 ? 180 G  B N9    1 
ATOM   5061 C  C8    . G  B 1 78  ? 79.46500 72.00900 82.91300  1.000 118.20731 ? 180 G  B C8    1 
ATOM   5062 N  N7    . G  B 1 78  ? 80.53400 71.81700 82.19200  1.000 118.66000 ? 180 G  B N7    1 
ATOM   5063 C  C5    . G  B 1 78  ? 80.04400 71.46400 80.94300  1.000 116.42026 ? 180 G  B C5    1 
ATOM   5064 C  C6    . G  B 1 78  ? 80.73200 71.13400 79.74600  1.000 118.12309 ? 180 G  B C6    1 
ATOM   5065 O  O6    . G  B 1 78  ? 81.95200 71.08700 79.54100  1.000 116.32551 ? 180 G  B O6    1 
ATOM   5066 N  N1    . G  B 1 78  ? 79.84900 70.83400 78.71500  1.000 116.53606 ? 180 G  B N1    1 
ATOM   5067 C  C2    . G  B 1 78  ? 78.48200 70.84900 78.81700  1.000 115.11484 ? 180 G  B C2    1 
ATOM   5068 N  N2    . G  B 1 78  ? 77.80700 70.52700 77.70600  1.000 109.77999 ? 180 G  B N2    1 
ATOM   5069 N  N3    . G  B 1 78  ? 77.82700 71.15300 79.92500  1.000 118.68105 ? 180 G  B N3    1 
ATOM   5070 C  C4    . G  B 1 78  ? 78.66500 71.44800 80.94000  1.000 117.87833 ? 180 G  B C4    1 
ATOM   5071 P  P     . G  B 1 79  ? 76.06000 67.94500 85.32300  1.000 119.65294 ? 181 G  B P     1 
ATOM   5072 O  OP1   . G  B 1 79  ? 75.12800 67.35800 86.31700  1.000 112.55998 ? 181 G  B OP1   1 
ATOM   5073 O  OP2   . G  B 1 79  ? 77.52300 67.79300 85.50900  1.000 108.35948 ? 181 G  B OP2   1 
ATOM   5074 O  "O5'" . G  B 1 79  ? 75.67100 67.34500 83.90300  1.000 116.30517 ? 181 G  B "O5'" 1 
ATOM   5075 C  "C5'" . G  B 1 79  ? 76.44700 66.32800 83.29400  1.000 115.45507 ? 181 G  B "C5'" 1 
ATOM   5076 C  "C4'" . G  B 1 79  ? 76.38800 66.43500 81.79100  1.000 107.22250 ? 181 G  B "C4'" 1 
ATOM   5077 O  "O4'" . G  B 1 79  ? 77.02600 67.66300 81.35600  1.000 111.65198 ? 181 G  B "O4'" 1 
ATOM   5078 C  "C3'" . G  B 1 79  ? 77.11500 65.34400 81.02300  1.000 96.11854  ? 181 G  B "C3'" 1 
ATOM   5079 O  "O3'" . G  B 1 79  ? 76.34200 64.16500 80.91000  1.000 94.99472  ? 181 G  B "O3'" 1 
ATOM   5080 C  "C2'" . G  B 1 79  ? 77.40700 66.01600 79.68800  1.000 100.61381 ? 181 G  B "C2'" 1 
ATOM   5081 O  "O2'" . G  B 1 79  ? 76.24700 66.02300 78.86800  1.000 103.09306 ? 181 G  B "O2'" 1 
ATOM   5082 C  "C1'" . G  B 1 79  ? 77.68800 67.45400 80.12600  1.000 103.10885 ? 181 G  B "C1'" 1 
ATOM   5083 N  N9    . G  B 1 79  ? 79.12700 67.71900 80.32300  1.000 109.08062 ? 181 G  B N9    1 
ATOM   5084 C  C8    . G  B 1 79  ? 79.71800 68.15600 81.48500  1.000 109.77807 ? 181 G  B C8    1 
ATOM   5085 N  N7    . G  B 1 79  ? 81.00900 68.31400 81.37600  1.000 111.74936 ? 181 G  B N7    1 
ATOM   5086 C  C5    . G  B 1 79  ? 81.29000 67.96300 80.06200  1.000 110.82293 ? 181 G  B C5    1 
ATOM   5087 C  C6    . G  B 1 79  ? 82.52500 67.93800 79.36300  1.000 110.85452 ? 181 G  B C6    1 
ATOM   5088 O  O6    . G  B 1 79  ? 83.65100 68.22800 79.78400  1.000 117.20528 ? 181 G  B O6    1 
ATOM   5089 N  N1    . G  B 1 79  ? 82.36100 67.52300 78.04600  1.000 107.67519 ? 181 G  B N1    1 
ATOM   5090 C  C2    . G  B 1 79  ? 81.16300 67.17700 77.47500  1.000 109.43329 ? 181 G  B C2    1 
ATOM   5091 N  N2    . G  B 1 79  ? 81.21500 66.80000 76.19000  1.000 114.50232 ? 181 G  B N2    1 
ATOM   5092 N  N3    . G  B 1 79  ? 80.00500 67.19500 78.11500  1.000 112.52577 ? 181 G  B N3    1 
ATOM   5093 C  C4    . G  B 1 79  ? 80.13800 67.59800 79.39600  1.000 113.97331 ? 181 G  B C4    1 
ATOM   5094 P  P     . U  B 1 80  ? 77.01800 62.72700 81.13100  1.000 93.58428  ? 182 U  B P     1 
ATOM   5095 O  OP1   . U  B 1 80  ? 75.95600 61.76900 81.52200  1.000 93.93169  ? 182 U  B OP1   1 
ATOM   5096 O  OP2   . U  B 1 80  ? 78.22400 62.89500 81.98200  1.000 97.47422  ? 182 U  B OP2   1 
ATOM   5097 O  "O5'" . U  B 1 80  ? 77.47800 62.31600 79.66900  1.000 101.04570 ? 182 U  B "O5'" 1 
ATOM   5098 C  "C5'" . U  B 1 80  ? 76.64400 62.58400 78.54600  1.000 97.94533  ? 182 U  B "C5'" 1 
ATOM   5099 C  "C4'" . U  B 1 80  ? 77.35500 62.27900 77.25500  1.000 95.44503  ? 182 U  B "C4'" 1 
ATOM   5100 O  "O4'" . U  B 1 80  ? 78.47900 63.18500 77.11100  1.000 96.91363  ? 182 U  B "O4'" 1 
ATOM   5101 C  "C3'" . U  B 1 80  ? 77.92300 60.87100 77.16100  1.000 92.80261  ? 182 U  B "C3'" 1 
ATOM   5102 O  "O3'" . U  B 1 80  ? 77.86700 60.44000 75.80600  1.000 91.82881  ? 182 U  B "O3'" 1 
ATOM   5103 C  "C2'" . U  B 1 80  ? 79.37400 61.06100 77.59800  1.000 95.77665  ? 182 U  B "C2'" 1 
ATOM   5104 O  "O2'" . U  B 1 80  ? 80.26500 60.08200 77.10700  1.000 98.78754  ? 182 U  B "O2'" 1 
ATOM   5105 C  "C1'" . U  B 1 80  ? 79.69100 62.45200 77.05100  1.000 101.25362 ? 182 U  B "C1'" 1 
ATOM   5106 N  N1    . U  B 1 80  ? 80.69400 63.18200 77.84100  1.000 102.29322 ? 182 U  B N1    1 
ATOM   5107 C  C2    . U  B 1 80  ? 81.86400 63.55900 77.20600  1.000 109.40723 ? 182 U  B C2    1 
ATOM   5108 O  O2    . U  B 1 80  ? 82.08800 63.31300 76.03200  1.000 112.12861 ? 182 U  B O2    1 
ATOM   5109 N  N3    . U  B 1 80  ? 82.76100 64.23900 77.99400  1.000 111.86805 ? 182 U  B N3    1 
ATOM   5110 C  C4    . U  B 1 80  ? 82.61400 64.57300 79.32600  1.000 115.87116 ? 182 U  B C4    1 
ATOM   5111 O  O4    . U  B 1 80  ? 83.51400 65.19000 79.90400  1.000 117.98457 ? 182 U  B O4    1 
ATOM   5112 C  C5    . U  B 1 80  ? 81.37700 64.14600 79.91200  1.000 111.44432 ? 182 U  B C5    1 
ATOM   5113 C  C6    . U  B 1 80  ? 80.48200 63.48200 79.17000  1.000 102.93540 ? 182 U  B C6    1 
ATOM   5114 P  P     . A  B 1 81  ? 76.55000 59.70000 75.25700  1.000 92.74340  ? 183 A  B P     1 
ATOM   5115 O  OP1   . A  B 1 81  ? 76.56000 59.77000 73.77900  1.000 95.18317  ? 183 A  B OP1   1 
ATOM   5116 O  OP2   . A  B 1 81  ? 75.36100 60.20000 75.99500  1.000 102.20506 ? 183 A  B OP2   1 
ATOM   5117 O  "O5'" . A  B 1 81  ? 76.76300 58.17600 75.67000  1.000 88.64817  ? 183 A  B "O5'" 1 
ATOM   5118 C  "C5'" . A  B 1 81  ? 78.00500 57.52100 75.45700  1.000 87.39802  ? 183 A  B "C5'" 1 
ATOM   5119 C  "C4'" . A  B 1 81  ? 77.81000 56.09000 75.01800  1.000 89.89832  ? 183 A  B "C4'" 1 
ATOM   5120 O  "O4'" . A  B 1 81  ? 77.04300 55.37400 76.01200  1.000 91.63800  ? 183 A  B "O4'" 1 
ATOM   5121 C  "C3'" . A  B 1 81  ? 77.03200 55.89300 73.72200  1.000 88.36919  ? 183 A  B "C3'" 1 
ATOM   5122 O  "O3'" . A  B 1 81  ? 77.85000 56.03400 72.57300  1.000 87.02693  ? 183 A  B "O3'" 1 
ATOM   5123 C  "C2'" . A  B 1 81  ? 76.46100 54.48700 73.88000  1.000 87.98493  ? 183 A  B "C2'" 1 
ATOM   5124 O  "O2'" . A  B 1 81  ? 77.42500 53.51200 73.50700  1.000 89.45616  ? 183 A  B "O2'" 1 
ATOM   5125 C  "C1'" . A  B 1 81  ? 76.22900 54.40200 75.39100  1.000 92.74866  ? 183 A  B "C1'" 1 
ATOM   5126 N  N9    . A  B 1 81  ? 74.82500 54.65100 75.76600  1.000 96.51227  ? 183 A  B N9    1 
ATOM   5127 C  C8    . A  B 1 81  ? 74.26000 55.82000 76.21200  1.000 93.28031  ? 183 A  B C8    1 
ATOM   5128 N  N7    . A  B 1 81  ? 72.97900 55.72000 76.47100  1.000 96.77283  ? 183 A  B N7    1 
ATOM   5129 C  C5    . A  B 1 81  ? 72.68200 54.39800 76.17500  1.000 94.06198  ? 183 A  B C5    1 
ATOM   5130 C  C6    . A  B 1 81  ? 71.49100 53.65500 76.23400  1.000 93.98039  ? 183 A  B C6    1 
ATOM   5131 N  N6    . A  B 1 81  ? 70.32100 54.16000 76.63400  1.000 94.63573  ? 183 A  B N6    1 
ATOM   5132 N  N1    . A  B 1 81  ? 71.53800 52.35500 75.86400  1.000 95.63848  ? 183 A  B N1    1 
ATOM   5133 C  C2    . A  B 1 81  ? 72.71000 51.84400 75.46200  1.000 95.00420  ? 183 A  B C2    1 
ATOM   5134 N  N3    . A  B 1 81  ? 73.89500 52.44100 75.36600  1.000 94.40413  ? 183 A  B N3    1 
ATOM   5135 C  C4    . A  B 1 81  ? 73.80900 53.72900 75.73900  1.000 93.49875  ? 183 A  B C4    1 
ATOM   5136 P  P     . A  B 1 82  ? 77.48800 57.09900 71.42300  1.000 91.87167  ? 184 A  B P     1 
ATOM   5137 O  OP1   . A  B 1 82  ? 78.72700 57.84800 71.08700  1.000 100.80695 ? 184 A  B OP1   1 
ATOM   5138 O  OP2   . A  B 1 82  ? 76.28200 57.85800 71.83800  1.000 97.64604  ? 184 A  B OP2   1 
ATOM   5139 O  "O5'" . A  B 1 82  ? 77.07000 56.18900 70.18400  1.000 86.17098  ? 184 A  B "O5'" 1 
ATOM   5140 C  "C5'" . A  B 1 82  ? 77.58200 54.86900 70.04100  1.000 92.09801  ? 184 A  B "C5'" 1 
ATOM   5141 C  "C4'" . A  B 1 82  ? 76.57200 53.94300 69.40800  1.000 87.20005  ? 184 A  B "C4'" 1 
ATOM   5142 O  "O4'" . A  B 1 82  ? 75.64000 53.46900 70.41200  1.000 84.14179  ? 184 A  B "O4'" 1 
ATOM   5143 C  "C3'" . A  B 1 82  ? 75.70400 54.58200 68.33100  1.000 88.20017  ? 184 A  B "C3'" 1 
ATOM   5144 O  "O3'" . A  B 1 82  ? 76.31400 54.52600 67.05800  1.000 89.55823  ? 184 A  B "O3'" 1 
ATOM   5145 C  "C2'" . A  B 1 82  ? 74.39600 53.80300 68.41700  1.000 89.50296  ? 184 A  B "C2'" 1 
ATOM   5146 O  "O2'" . A  B 1 82  ? 74.47500 52.60100 67.66900  1.000 84.89978  ? 184 A  B "O2'" 1 
ATOM   5147 C  "C1'" . A  B 1 82  ? 74.32700 53.45600 69.90100  1.000 92.15591  ? 184 A  B "C1'" 1 
ATOM   5148 N  N9    . A  B 1 82  ? 73.54100 54.43000 70.67800  1.000 87.73959  ? 184 A  B N9    1 
ATOM   5149 C  C8    . A  B 1 82  ? 73.70400 55.79200 70.72900  1.000 82.22840  ? 184 A  B C8    1 
ATOM   5150 N  N7    . A  B 1 82  ? 72.87200 56.39200 71.54000  1.000 86.96845  ? 184 A  B N7    1 
ATOM   5151 C  C5    . A  B 1 82  ? 72.11700 55.35500 72.06500  1.000 90.31885  ? 184 A  B C5    1 
ATOM   5152 C  C6    . A  B 1 82  ? 71.06000 55.34000 72.99000  1.000 87.65800  ? 184 A  B C6    1 
ATOM   5153 N  N6    . A  B 1 82  ? 70.56200 56.43600 73.57000  1.000 82.77321  ? 184 A  B N6    1 
ATOM   5154 N  N1    . A  B 1 82  ? 70.52200 54.14300 73.30700  1.000 88.29229  ? 184 A  B N1    1 
ATOM   5155 C  C2    . A  B 1 82  ? 71.02200 53.04600 72.72800  1.000 88.01594  ? 184 A  B C2    1 
ATOM   5156 N  N3    . A  B 1 82  ? 72.01300 52.93500 71.84700  1.000 88.35809  ? 184 A  B N3    1 
ATOM   5157 C  C4    . A  B 1 82  ? 72.52600 54.14000 71.55300  1.000 87.97120  ? 184 A  B C4    1 
ATOM   5158 P  P     . U  B 1 83  ? 75.97900 55.63700 65.95000  1.000 101.76706 ? 185 U  B P     1 
ATOM   5159 O  OP1   . U  B 1 83  ? 74.52800 55.57600 65.64200  1.000 107.64144 ? 185 U  B OP1   1 
ATOM   5160 O  OP2   . U  B 1 83  ? 76.97000 55.50200 64.85400  1.000 102.44608 ? 185 U  B OP2   1 
ATOM   5161 O  "O5'" . U  B 1 83  ? 76.26600 57.00900 66.70000  1.000 97.34021  ? 185 U  B "O5'" 1 
ATOM   5162 C  "C5'" . U  B 1 83  ? 77.59200 57.39300 67.03800  1.000 94.95308  ? 185 U  B "C5'" 1 
ATOM   5163 C  "C4'" . U  B 1 83  ? 77.77000 58.88300 66.92500  1.000 97.96923  ? 185 U  B "C4'" 1 
ATOM   5164 O  "O4'" . U  B 1 83  ? 77.42000 59.30200 65.57800  1.000 99.86156  ? 185 U  B "O4'" 1 
ATOM   5165 C  "C3'" . U  B 1 83  ? 76.89400 59.70000 67.86700  1.000 98.03503  ? 185 U  B "C3'" 1 
ATOM   5166 O  "O3'" . U  B 1 83  ? 77.60300 60.86400 68.28000  1.000 96.22165  ? 185 U  B "O3'" 1 
ATOM   5167 C  "C2'" . U  B 1 83  ? 75.71500 60.09700 66.98400  1.000 109.16531 ? 185 U  B "C2'" 1 
ATOM   5168 O  "O2'" . U  B 1 83  ? 75.05700 61.27600 67.39100  1.000 109.69695 ? 185 U  B "O2'" 1 
ATOM   5169 C  "C1'" . U  B 1 83  ? 76.38900 60.26600 65.62400  1.000 107.64144 ? 185 U  B "C1'" 1 
ATOM   5170 N  N1    . U  B 1 83  ? 75.49000 60.03400 64.48400  1.000 112.75522 ? 185 U  B N1    1 
ATOM   5171 C  C2    . U  B 1 83  ? 75.59200 60.91600 63.42500  1.000 126.44896 ? 185 U  B C2    1 
ATOM   5172 O  O2    . U  B 1 83  ? 76.38800 61.84300 63.41600  1.000 129.17824 ? 185 U  B O2    1 
ATOM   5173 N  N3    . U  B 1 83  ? 74.73400 60.67200 62.37700  1.000 132.44705 ? 185 U  B N3    1 
ATOM   5174 C  C4    . U  B 1 83  ? 73.80000 59.65700 62.28300  1.000 125.93311 ? 185 U  B C4    1 
ATOM   5175 O  O4    . U  B 1 83  ? 73.09600 59.56600 61.27200  1.000 126.80427 ? 185 U  B O4    1 
ATOM   5176 C  C5    . U  B 1 83  ? 73.75600 58.79000 63.42500  1.000 118.68487 ? 185 U  B C5    1 
ATOM   5177 C  C6    . U  B 1 83  ? 74.57700 59.00100 64.46400  1.000 114.09485 ? 185 U  B C6    1 
ATOM   5178 P  P     . A  B 1 84  ? 78.18400 60.95800 69.77500  1.000 97.95804  ? 186 A  B P     1 
ATOM   5179 O  OP1   . A  B 1 84  ? 79.50100 60.27400 69.80400  1.000 99.06081  ? 186 A  B OP1   1 
ATOM   5180 O  OP2   . A  B 1 84  ? 77.11600 60.53300 70.71700  1.000 105.34577 ? 186 A  B OP2   1 
ATOM   5181 O  "O5'" . A  B 1 84  ? 78.43100 62.51500 69.98800  1.000 94.72608  ? 186 A  B "O5'" 1 
ATOM   5182 C  "C5'" . A  B 1 84  ? 79.60200 63.15400 69.49900  1.000 96.17888  ? 186 A  B "C5'" 1 
ATOM   5183 C  "C4'" . A  B 1 84  ? 80.33800 63.83400 70.62300  1.000 98.43178  ? 186 A  B "C4'" 1 
ATOM   5184 O  "O4'" . A  B 1 84  ? 79.44200 64.74700 71.30200  1.000 100.63205 ? 186 A  B "O4'" 1 
ATOM   5185 C  "C3'" . A  B 1 84  ? 80.84100 62.89300 71.71000  1.000 102.16644 ? 186 A  B "C3'" 1 
ATOM   5186 O  "O3'" . A  B 1 84  ? 82.11900 62.37200 71.38800  1.000 111.62547 ? 186 A  B "O3'" 1 
ATOM   5187 C  "C2'" . A  B 1 84  ? 80.82600 63.76000 72.96800  1.000 102.34015 ? 186 A  B "C2'" 1 
ATOM   5188 O  "O2'" . A  B 1 84  ? 82.02300 64.51200 73.07600  1.000 106.10902 ? 186 A  B "O2'" 1 
ATOM   5189 C  "C1'" . A  B 1 84  ? 79.66700 64.71900 72.69300  1.000 100.92419 ? 186 A  B "C1'" 1 
ATOM   5190 N  N9    . A  B 1 84  ? 78.40600 64.32200 73.35200  1.000 102.65598 ? 186 A  B N9    1 
ATOM   5191 C  C8    . A  B 1 84  ? 77.61900 63.22700 73.06900  1.000 100.61889 ? 186 A  B C8    1 
ATOM   5192 N  N7    . A  B 1 84  ? 76.53400 63.15500 73.80400  1.000 101.31371 ? 186 A  B N7    1 
ATOM   5193 C  C5    . A  B 1 84  ? 76.59900 64.28200 74.61500  1.000 102.52438 ? 186 A  B C5    1 
ATOM   5194 C  C6    . A  B 1 84  ? 75.73800 64.77700 75.61300  1.000 99.48454  ? 186 A  B C6    1 
ATOM   5195 N  N6    . A  B 1 84  ? 74.60000 64.17700 75.98400  1.000 97.66327  ? 186 A  B N6    1 
ATOM   5196 N  N1    . A  B 1 84  ? 76.09200 65.92600 76.22800  1.000 97.34481  ? 186 A  B N1    1 
ATOM   5197 C  C2    . A  B 1 84  ? 77.22900 66.52700 75.85800  1.000 100.02671 ? 186 A  B C2    1 
ATOM   5198 N  N3    . A  B 1 84  ? 78.11800 66.16400 74.93700  1.000 103.57977 ? 186 A  B N3    1 
ATOM   5199 C  C4    . A  B 1 84  ? 77.73900 65.02000 74.33800  1.000 103.35343 ? 186 A  B C4    1 
ATOM   5200 P  P     . A  B 1 85  ? 82.54500 60.88700 71.83000  1.000 108.00716 ? 187 A  B P     1 
ATOM   5201 O  OP1   . A  B 1 85  ? 83.64400 60.43800 70.94000  1.000 104.87258 ? 187 A  B OP1   1 
ATOM   5202 O  OP2   . A  B 1 85  ? 81.32000 60.05600 71.94800  1.000 106.95178 ? 187 A  B OP2   1 
ATOM   5203 O  "O5'" . A  B 1 85  ? 83.16100 61.09700 73.28200  1.000 107.95453 ? 187 A  B "O5'" 1 
ATOM   5204 C  "C5'" . A  B 1 85  ? 83.48100 59.98500 74.10000  1.000 111.55233 ? 187 A  B "C5'" 1 
ATOM   5205 C  "C4'" . A  B 1 85  ? 84.96200 59.71300 74.10700  1.000 110.56010 ? 187 A  B "C4'" 1 
ATOM   5206 O  "O4'" . A  B 1 85  ? 85.65300 60.85600 74.66700  1.000 110.47062 ? 187 A  B "O4'" 1 
ATOM   5207 C  "C3'" . A  B 1 85  ? 85.42500 58.53900 74.96200  1.000 110.39956 ? 187 A  B "C3'" 1 
ATOM   5208 O  "O3'" . A  B 1 85  ? 85.32600 57.29400 74.28800  1.000 111.37336 ? 187 A  B "O3'" 1 
ATOM   5209 C  "C2'" . A  B 1 85  ? 86.86800 58.90400 75.29700  1.000 117.94257 ? 187 A  B "C2'" 1 
ATOM   5210 O  "O2'" . A  B 1 85  ? 87.73800 58.49900 74.24900  1.000 130.86780 ? 187 A  B "O2'" 1 
ATOM   5211 C  "C1'" . A  B 1 85  ? 86.81800 60.43400 75.33800  1.000 116.43975 ? 187 A  B "C1'" 1 
ATOM   5212 N  N9    . A  B 1 85  ? 86.82900 60.98400 76.71200  1.000 113.42887 ? 187 A  B N9    1 
ATOM   5213 C  C8    . A  B 1 85  ? 87.88300 61.62400 77.31900  1.000 117.08457 ? 187 A  B C8    1 
ATOM   5214 N  N7    . A  B 1 85  ? 87.63600 62.02000 78.54200  1.000 118.45052 ? 187 A  B N7    1 
ATOM   5215 C  C5    . A  B 1 85  ? 86.32600 61.61300 78.75800  1.000 121.00872 ? 187 A  B C5    1 
ATOM   5216 C  C6    . A  B 1 85  ? 85.46800 61.73300 79.86700  1.000 118.89794 ? 187 A  B C6    1 
ATOM   5217 N  N6    . A  B 1 85  ? 85.81400 62.32200 81.01500  1.000 122.86421 ? 187 A  B N6    1 
ATOM   5218 N  N1    . A  B 1 85  ? 84.22100 61.21800 79.75500  1.000 116.08971 ? 187 A  B N1    1 
ATOM   5219 C  C2    . A  B 1 85  ? 83.86200 60.62400 78.60600  1.000 112.48665 ? 187 A  B C2    1 
ATOM   5220 N  N3    . A  B 1 85  ? 84.58200 60.45300 77.49800  1.000 117.19511 ? 187 A  B N3    1 
ATOM   5221 C  C4    . A  B 1 85  ? 85.81600 60.97300 77.64100  1.000 118.58738 ? 187 A  B C4    1 
ATOM   5222 P  P     . G  B 1 86  ? 83.90000 56.61000 74.00100  1.000 127.22336 ? 188 G  B P     1 
ATOM   5223 O  OP1   . G  B 1 86  ? 84.06300 55.14400 74.16100  1.000 128.18663 ? 188 G  B OP1   1 
ATOM   5224 O  OP2   . G  B 1 86  ? 83.39800 57.14800 72.71000  1.000 122.41752 ? 188 G  B OP2   1 
ATOM   5225 O  "O5'" . G  B 1 86  ? 82.96600 57.14100 75.18000  1.000 115.22981 ? 188 G  B "O5'" 1 
ATOM   5226 C  "C5'" . G  B 1 86  ? 82.29000 56.23300 76.04500  1.000 111.89783 ? 188 G  B "C5'" 1 
ATOM   5227 C  "C4'" . G  B 1 86  ? 82.55100 56.54500 77.50000  1.000 114.44814 ? 188 G  B "C4'" 1 
ATOM   5228 O  "O4'" . G  B 1 86  ? 81.46600 57.36600 78.01900  1.000 113.24010 ? 188 G  B "O4'" 1 
ATOM   5229 C  "C3'" . G  B 1 86  ? 82.65100 55.32400 78.41700  1.000 118.29334 ? 188 G  B "C3'" 1 
ATOM   5230 O  "O3'" . G  B 1 86  ? 83.67000 55.53300 79.39200  1.000 123.23077 ? 188 G  B "O3'" 1 
ATOM   5231 C  "C2'" . G  B 1 86  ? 81.28500 55.29200 79.09800  1.000 108.35794 ? 188 G  B "C2'" 1 
ATOM   5232 O  "O2'" . G  B 1 86  ? 81.27100 54.66300 80.36500  1.000 120.18830 ? 188 G  B "O2'" 1 
ATOM   5233 C  "C1'" . G  B 1 86  ? 80.94400 56.77500 79.19700  1.000 107.15516 ? 188 G  B "C1'" 1 
ATOM   5234 N  N9    . G  B 1 86  ? 79.50600 57.08800 79.29900  1.000 107.28149 ? 188 G  B N9    1 
ATOM   5235 C  C8    . G  B 1 86  ? 79.02900 58.34500 79.57000  1.000 109.43964 ? 188 G  B C8    1 
ATOM   5236 N  N7    . G  B 1 86  ? 77.73300 58.43800 79.62800  1.000 107.38940 ? 188 G  B N7    1 
ATOM   5237 C  C5    . G  B 1 86  ? 77.30400 57.14900 79.36700  1.000 103.47314 ? 188 G  B C5    1 
ATOM   5238 C  C6    . G  B 1 86  ? 75.98100 56.63800 79.30000  1.000 107.15516 ? 188 G  B C6    1 
ATOM   5239 O  O6    . G  B 1 86  ? 74.91000 57.24200 79.46000  1.000 110.96614 ? 188 G  B O6    1 
ATOM   5240 N  N1    . G  B 1 86  ? 75.97000 55.27400 79.02000  1.000 101.54922 ? 188 G  B N1    1 
ATOM   5241 C  C2    . G  B 1 86  ? 77.08900 54.50400 78.82500  1.000 98.59887  ? 188 G  B C2    1 
ATOM   5242 N  N2    . G  B 1 86  ? 76.89800 53.20400 78.56300  1.000 98.13039  ? 188 G  B N2    1 
ATOM   5243 N  N3    . G  B 1 86  ? 78.31700 54.97500 78.89300  1.000 103.62316 ? 188 G  B N3    1 
ATOM   5244 C  C4    . G  B 1 86  ? 78.37300 56.29700 79.15900  1.000 103.44419 ? 188 G  B C4    1 
ATOM   5245 P  P     . C  B 1 87  ? 84.60600 54.30800 79.84600  1.000 116.67920 ? 189 C  B P     1 
ATOM   5246 O  OP1   . C  B 1 87  ? 84.22100 53.12400 79.03900  1.000 117.41877 ? 189 C  B OP1   1 
ATOM   5247 O  OP2   . C  B 1 87  ? 84.57900 54.21800 81.33200  1.000 113.44724 ? 189 C  B OP2   1 
ATOM   5248 O  "O5'" . C  B 1 87  ? 86.06400 54.76100 79.39100  1.000 115.55012 ? 189 C  B "O5'" 1 
ATOM   5249 C  "C5'" . C  B 1 87  ? 86.48600 54.64500 78.03900  1.000 121.79034 ? 189 C  B "C5'" 1 
ATOM   5250 C  "C4'" . C  B 1 87  ? 87.68600 55.51800 77.76800  1.000 126.50143 ? 189 C  B "C4'" 1 
ATOM   5251 O  "O4'" . C  B 1 87  ? 87.28400 56.91400 77.79300  1.000 122.09827 ? 189 C  B "O4'" 1 
ATOM   5252 C  "C3'" . C  B 1 87  ? 88.80800 55.43600 78.79400  1.000 133.18645 ? 189 C  B "C3'" 1 
ATOM   5253 O  "O3'" . C  B 1 87  ? 89.66200 54.32200 78.59300  1.000 133.58123 ? 189 C  B "O3'" 1 
ATOM   5254 C  "C2'" . C  B 1 87  ? 89.49900 56.78500 78.64300  1.000 129.99133 ? 189 C  B "C2'" 1 
ATOM   5255 O  "O2'" . C  B 1 87  ? 90.35800 56.79200 77.50800  1.000 124.88545 ? 189 C  B "O2'" 1 
ATOM   5256 C  "C1'" . C  B 1 87  ? 88.30600 57.70300 78.36500  1.000 123.08260 ? 189 C  B "C1'" 1 
ATOM   5257 N  N1    . C  B 1 87  ? 87.77500 58.32300 79.60200  1.000 119.48743 ? 189 C  B N1    1 
ATOM   5258 C  C2    . C  B 1 87  ? 88.45100 59.40900 80.17100  1.000 126.12770 ? 189 C  B C2    1 
ATOM   5259 O  O2    . C  B 1 87  ? 89.48100 59.84000 79.63300  1.000 132.20475 ? 189 C  B O2    1 
ATOM   5260 N  N3    . C  B 1 87  ? 87.96200 59.96700 81.30100  1.000 127.15941 ? 189 C  B N3    1 
ATOM   5261 C  C4    . C  B 1 87  ? 86.84900 59.48000 81.85800  1.000 126.73304 ? 189 C  B C4    1 
ATOM   5262 N  N4    . C  B 1 87  ? 86.39900 60.06100 82.97400  1.000 136.41052 ? 189 C  B N4    1 
ATOM   5263 C  C5    . C  B 1 87  ? 86.14100 58.37600 81.29700  1.000 122.76414 ? 189 C  B C5    1 
ATOM   5264 C  C6    . C  B 1 87  ? 86.63500 57.83400 80.18000  1.000 118.14780 ? 189 C  B C6    1 
ATOM   5265 P  P     . U  B 1 88  ? 90.20700 53.47300 79.84500  1.000 132.26381 ? 190 U  B P     1 
ATOM   5266 O  OP1   . U  B 1 88  ? 90.76100 52.20200 79.31600  1.000 125.38140 ? 190 U  B OP1   1 
ATOM   5267 O  OP2   . U  B 1 88  ? 89.15000 53.42300 80.88400  1.000 115.38020 ? 190 U  B OP2   1 
ATOM   5268 O  "O5'" . U  B 1 88  ? 91.40300 54.35600 80.42100  1.000 139.47256 ? 190 U  B "O5'" 1 
ATOM   5269 C  "C5'" . U  B 1 88  ? 92.47400 54.78000 79.58700  1.000 139.05146 ? 190 U  B "C5'" 1 
ATOM   5270 C  "C4'" . U  B 1 88  ? 93.30300 55.86100 80.24000  1.000 136.89857 ? 190 U  B "C4'" 1 
ATOM   5271 O  "O4'" . U  B 1 88  ? 92.54500 57.09700 80.31600  1.000 137.05649 ? 190 U  B "O4'" 1 
ATOM   5272 C  "C3'" . U  B 1 88  ? 93.72800 55.60500 81.67600  1.000 140.45163 ? 190 U  B "C3'" 1 
ATOM   5273 O  "O3'" . U  B 1 88  ? 94.84100 54.73400 81.77500  1.000 139.78313 ? 190 U  B "O3'" 1 
ATOM   5274 C  "C2'" . U  B 1 88  ? 93.99300 57.01200 82.19700  1.000 139.85156 ? 190 U  B "C2'" 1 
ATOM   5275 O  "O2'" . U  B 1 88  ? 95.24700 57.49500 81.73600  1.000 137.09070 ? 190 U  B "O2'" 1 
ATOM   5276 C  "C1'" . U  B 1 88  ? 92.88500 57.79900 81.49600  1.000 134.49302 ? 190 U  B "C1'" 1 
ATOM   5277 N  N1    . U  B 1 88  ? 91.67600 57.92200 82.34300  1.000 131.20052 ? 190 U  B N1    1 
ATOM   5278 C  C2    . U  B 1 88  ? 91.68800 58.87100 83.34500  1.000 135.07467 ? 190 U  B C2    1 
ATOM   5279 O  O2    . U  B 1 88  ? 92.63900 59.60300 83.55200  1.000 143.97047 ? 190 U  B O2    1 
ATOM   5280 N  N3    . U  B 1 88  ? 90.54200 58.93400 84.09400  1.000 130.78468 ? 190 U  B N3    1 
ATOM   5281 C  C4    . U  B 1 88  ? 89.41100 58.15700 83.94400  1.000 134.24562 ? 190 U  B C4    1 
ATOM   5282 O  O4    . U  B 1 88  ? 88.45400 58.33400 84.70100  1.000 135.63526 ? 190 U  B O4    1 
ATOM   5283 C  C5    . U  B 1 88  ? 89.47800 57.19500 82.88600  1.000 129.76614 ? 190 U  B C5    1 
ATOM   5284 C  C6    . U  B 1 88  ? 90.58400 57.11500 82.14500  1.000 129.49242 ? 190 U  B C6    1 
ATOM   5285 P  P     . G  B 1 89  ? 94.90000 53.62600 82.93700  1.000 136.69401 ? 191 G  B P     1 
ATOM   5286 O  OP1   . G  B 1 89  ? 95.99100 52.68100 82.59500  1.000 141.06559 ? 191 G  B OP1   1 
ATOM   5287 O  OP2   . G  B 1 89  ? 93.52900 53.10900 83.17800  1.000 143.95278 ? 191 G  B OP2   1 
ATOM   5288 O  "O5'" . G  B 1 89  ? 95.35700 54.44700 84.22400  1.000 135.64652 ? 191 G  B "O5'" 1 
ATOM   5289 C  "C5'" . G  B 1 89  ? 96.62100 55.09200 84.25600  1.000 145.33715 ? 191 G  B "C5'" 1 
ATOM   5290 C  "C4'" . G  B 1 89  ? 96.66300 56.20900 85.26900  1.000 146.61362 ? 191 G  B "C4'" 1 
ATOM   5291 O  "O4'" . G  B 1 89  ? 95.57400 57.13500 85.03900  1.000 140.71291 ? 191 G  B "O4'" 1 
ATOM   5292 C  "C3'" . G  B 1 89  ? 96.50000 55.80500 86.72600  1.000 151.10627 ? 191 G  B "C3'" 1 
ATOM   5293 O  "O3'" . G  B 1 89  ? 97.70200 55.30200 87.28400  1.000 146.64520 ? 191 G  B "O3'" 1 
ATOM   5294 C  "C2'" . G  B 1 89  ? 96.02100 57.09800 87.37700  1.000 149.24815 ? 191 G  B "C2'" 1 
ATOM   5295 O  "O2'" . G  B 1 89  ? 97.11400 57.96400 87.64300  1.000 149.82453 ? 191 G  B "O2'" 1 
ATOM   5296 C  "C1'" . G  B 1 89  ? 95.16900 57.71400 86.26300  1.000 144.72129 ? 191 G  B "C1'" 1 
ATOM   5297 N  N9    . G  B 1 89  ? 93.72600 57.47900 86.46200  1.000 141.86305 ? 191 G  B N9    1 
ATOM   5298 C  C8    . G  B 1 89  ? 92.89800 56.65100 85.74400  1.000 142.10782 ? 191 G  B C8    1 
ATOM   5299 N  N7    . G  B 1 89  ? 91.66200 56.67100 86.16800  1.000 141.46827 ? 191 G  B N7    1 
ATOM   5300 C  C5    . G  B 1 89  ? 91.67300 57.57000 87.22500  1.000 144.46600 ? 191 G  B C5    1 
ATOM   5301 C  C6    . G  B 1 89  ? 90.62400 58.00500 88.07600  1.000 146.41886 ? 191 G  B C6    1 
ATOM   5302 O  O6    . G  B 1 89  ? 89.43200 57.67400 88.06600  1.000 147.72428 ? 191 G  B O6    1 
ATOM   5303 N  N1    . G  B 1 89  ? 91.07500 58.92500 89.01700  1.000 144.54232 ? 191 G  B N1    1 
ATOM   5304 C  C2    . G  B 1 89  ? 92.37000 59.37000 89.12800  1.000 149.40080 ? 191 G  B C2    1 
ATOM   5305 N  N2    . G  B 1 89  ? 92.61400 60.26200 90.09900  1.000 153.98293 ? 191 G  B N2    1 
ATOM   5306 N  N3    . G  B 1 89  ? 93.35600 58.97400 88.34000  1.000 149.95876 ? 191 G  B N3    1 
ATOM   5307 C  C4    . G  B 1 89  ? 92.93900 58.08000 87.41800  1.000 145.97933 ? 191 G  B C4    1 
ATOM   5308 P  P     . A  B 1 90  ? 97.66100 54.17700 88.43200  1.000 150.90687 ? 192 A  B P     1 
ATOM   5309 O  OP1   . A  B 1 90  ? 99.05000 53.77200 88.72900  1.000 151.40693 ? 192 A  B OP1   1 
ATOM   5310 O  OP2   . A  B 1 90  ? 96.66700 53.14000 88.06100  1.000 151.04899 ? 192 A  B OP2   1 
ATOM   5311 O  "O5'" . A  B 1 90  ? 97.08300 54.95100 89.70300  1.000 144.49294 ? 192 A  B "O5'" 1 
ATOM   5312 C  "C5'" . A  B 1 90  ? 97.76400 56.01500 90.35500  1.000 141.62944 ? 192 A  B "C5'" 1 
ATOM   5313 C  "C4'" . A  B 1 90  ? 96.81200 56.80500 91.23500  1.000 149.48301 ? 192 A  B "C4'" 1 
ATOM   5314 O  "O4'" . A  B 1 90  ? 95.65900 57.26800 90.48200  1.000 151.75697 ? 192 A  B "O4'" 1 
ATOM   5315 C  "C3'" . A  B 1 90  ? 96.15100 56.02100 92.35700  1.000 153.49928 ? 192 A  B "C3'" 1 
ATOM   5316 O  "O3'" . A  B 1 90  ? 97.04400 55.66700 93.40600  1.000 153.78353 ? 192 A  B "O3'" 1 
ATOM   5317 C  "C2'" . A  B 1 90  ? 95.02600 56.97100 92.74300  1.000 147.78281 ? 192 A  B "C2'" 1 
ATOM   5318 O  "O2'" . A  B 1 90  ? 95.43500 58.11900 93.46200  1.000 146.72216 ? 192 A  B "O2'" 1 
ATOM   5319 C  "C1'" . A  B 1 90  ? 94.53800 57.35600 91.34800  1.000 147.33539 ? 192 A  B "C1'" 1 
ATOM   5320 N  N9    . A  B 1 90  ? 93.32000 56.67200 90.84400  1.000 145.26935 ? 192 A  B N9    1 
ATOM   5321 C  C8    . A  B 1 90  ? 93.17000 55.85000 89.75700  1.000 146.28263 ? 192 A  B C8    1 
ATOM   5322 N  N7    . A  B 1 90  ? 91.94500 55.40300 89.57800  1.000 144.91404 ? 192 A  B N7    1 
ATOM   5323 C  C5    . A  B 1 90  ? 91.22000 55.98700 90.59800  1.000 143.08225 ? 192 A  B C5    1 
ATOM   5324 C  C6    . A  B 1 90  ? 89.86200 55.91800 90.98400  1.000 142.98487 ? 192 A  B C6    1 
ATOM   5325 N  N6    . A  B 1 90  ? 88.96800 55.16700 90.35100  1.000 140.02925 ? 192 A  B N6    1 
ATOM   5326 N  N1    . A  B 1 90  ? 89.46800 56.59400 92.08200  1.000 148.19602 ? 192 A  B N1    1 
ATOM   5327 C  C2    . A  B 1 90  ? 90.37800 57.31800 92.74200  1.000 150.30153 ? 192 A  B C2    1 
ATOM   5328 N  N3    . A  B 1 90  ? 91.67900 57.45100 92.48000  1.000 152.00700 ? 192 A  B N3    1 
ATOM   5329 C  C4    . A  B 1 90  ? 92.05100 56.76200 91.38600  1.000 147.31433 ? 192 A  B C4    1 
ATOM   5330 P  P     . C  B 1 91  ? 97.04500 54.17800 94.00900  1.000 151.82789 ? 193 C  B P     1 
ATOM   5331 O  OP1   . C  B 1 91  ? 98.35000 53.97600 94.69000  1.000 154.25186 ? 193 C  B OP1   1 
ATOM   5332 O  OP2   . C  B 1 91  ? 96.62800 53.24200 92.93200  1.000 156.83375 ? 193 C  B OP2   1 
ATOM   5333 O  "O5'" . C  B 1 91  ? 95.89000 54.20800 95.10700  1.000 141.82406 ? 193 C  B "O5'" 1 
ATOM   5334 C  "C5'" . C  B 1 91  ? 95.89800 55.17000 96.15100  1.000 144.69545 ? 193 C  B "C5'" 1 
ATOM   5335 C  "C4'" . C  B 1 91  ? 94.53000 55.32500 96.77100  1.000 141.32400 ? 193 C  B "C4'" 1 
ATOM   5336 O  "O4'" . C  B 1 91  ? 93.62800 55.95100 95.81800  1.000 144.84810 ? 193 C  B "O4'" 1 
ATOM   5337 C  "C3'" . C  B 1 91  ? 93.82000 54.03500 97.15400  1.000 141.37137 ? 193 C  B "C3'" 1 
ATOM   5338 O  "O3'" . C  B 1 91  ? 94.26500 53.48300 98.38100  1.000 144.69809 ? 193 C  B "O3'" 1 
ATOM   5339 C  "C2'" . C  B 1 91  ? 92.35700 54.45400 97.15100  1.000 143.96379 ? 193 C  B "C2'" 1 
ATOM   5340 O  "O2'" . C  B 1 91  ? 92.04000 55.19000 98.32500  1.000 142.41887 ? 193 C  B "O2'" 1 
ATOM   5341 C  "C1'" . C  B 1 91  ? 92.32800 55.40400 95.95300  1.000 145.56661 ? 193 C  B "C1'" 1 
ATOM   5342 N  N1    . C  B 1 91  ? 91.98100 54.68300 94.70500  1.000 142.43202 ? 193 C  B N1    1 
ATOM   5343 C  C2    . C  B 1 91  ? 90.64500 54.35800 94.45300  1.000 140.85815 ? 193 C  B C2    1 
ATOM   5344 O  O2    . C  B 1 91  ? 89.77300 54.69300 95.26600  1.000 141.52139 ? 193 C  B O2    1 
ATOM   5345 N  N3    . C  B 1 91  ? 90.33400 53.68900 93.32100  1.000 144.25330 ? 193 C  B N3    1 
ATOM   5346 C  C4    . C  B 1 91  ? 91.29400 53.33900 92.46200  1.000 142.60310 ? 193 C  B C4    1 
ATOM   5347 N  N4    . C  B 1 91  ? 90.93200 52.68000 91.35600  1.000 142.10304 ? 193 C  B N4    1 
ATOM   5348 C  C5    . C  B 1 91  ? 92.66400 53.65200 92.69600  1.000 141.98460 ? 193 C  B C5    1 
ATOM   5349 C  C6    . C  B 1 91  ? 92.95500 54.31400 93.82000  1.000 144.04011 ? 193 C  B C6    1 
ATOM   5350 P  P     . G  B 1 92  ? 94.38800 51.88900 98.54300  1.000 153.30061 ? 194 G  B P     1 
ATOM   5351 O  OP1   . G  B 1 92  ? 95.11700 51.62900 99.81000  1.000 159.73559 ? 194 G  B OP1   1 
ATOM   5352 O  OP2   . G  B 1 92  ? 94.92000 51.32700 97.27500  1.000 138.54095 ? 194 G  B OP2   1 
ATOM   5353 O  "O5'" . G  B 1 92  ? 92.87900 51.40900 98.72900  1.000 133.21662 ? 194 G  B "O5'" 1 
ATOM   5354 C  "C5'" . G  B 1 92  ? 92.13800 51.81700 99.86900  1.000 134.62206 ? 194 G  B "C5'" 1 
ATOM   5355 C  "C4'" . G  B 1 92  ? 90.65100 51.63000 99.69200  1.000 135.62481 ? 194 G  B "C4'" 1 
ATOM   5356 O  "O4'" . G  B 1 92  ? 90.18000 52.37900 98.54200  1.000 135.45637 ? 194 G  B "O4'" 1 
ATOM   5357 C  "C3'" . G  B 1 92  ? 90.16900 50.21700 99.41600  1.000 134.90893 ? 194 G  B "C3'" 1 
ATOM   5358 O  "O3'" . G  B 1 92  ? 90.14100 49.39200 100.56700 1.000 139.34894 ? 194 G  B "O3'" 1 
ATOM   5359 C  "C2'" . G  B 1 92  ? 88.79900 50.46500 98.80000  1.000 133.88776 ? 194 G  B "C2'" 1 
ATOM   5360 O  "O2'" . G  B 1 92  ? 87.84500 50.80300 99.79600  1.000 131.37430 ? 194 G  B "O2'" 1 
ATOM   5361 C  "C1'" . G  B 1 92  ? 89.08100 51.70700 97.95700  1.000 138.29618 ? 194 G  B "C1'" 1 
ATOM   5362 N  N9    . G  B 1 92  ? 89.43000 51.33000 96.57600  1.000 138.63833 ? 194 G  B N9    1 
ATOM   5363 C  C8    . G  B 1 92  ? 90.65200 51.39400 95.94900  1.000 138.81730 ? 194 G  B C8    1 
ATOM   5364 N  N7    . G  B 1 92  ? 90.60700 50.95700 94.71700  1.000 139.48316 ? 194 G  B N7    1 
ATOM   5365 C  C5    . G  B 1 92  ? 89.28300 50.57700 94.52500  1.000 140.52276 ? 194 G  B C5    1 
ATOM   5366 C  C6    . G  B 1 92  ? 88.62700 50.02900 93.39100  1.000 136.36174 ? 194 G  B C6    1 
ATOM   5367 O  O6    . G  B 1 92  ? 89.10100 49.75800 92.28200  1.000 131.45062 ? 194 G  B O6    1 
ATOM   5368 N  N1    . G  B 1 92  ? 87.27900 49.79400 93.64200  1.000 133.10345 ? 194 G  B N1    1 
ATOM   5369 C  C2    . G  B 1 92  ? 86.63900 50.05000 94.82900  1.000 134.00093 ? 194 G  B C2    1 
ATOM   5370 N  N2    . G  B 1 92  ? 85.33200 49.75300 94.88000  1.000 134.82471 ? 194 G  B N2    1 
ATOM   5371 N  N3    . G  B 1 92  ? 87.23800 50.56100 95.89000  1.000 136.88285 ? 194 G  B N3    1 
ATOM   5372 C  C4    . G  B 1 92  ? 88.54800 50.79700 95.66800  1.000 135.95379 ? 194 G  B C4    1 
ATOM   5373 P  P     . G  B 1 93  ? 90.49800 47.82900 100.44400 1.000 145.22092 ? 195 G  B P     1 
ATOM   5374 O  OP1   . G  B 1 93  ? 90.49600 47.26800 101.81900 1.000 147.44487 ? 195 G  B OP1   1 
ATOM   5375 O  OP2   . G  B 1 93  ? 91.71300 47.68400 99.60100  1.000 123.88152 ? 195 G  B OP2   1 
ATOM   5376 O  "O5'" . G  B 1 93  ? 89.25400 47.21400 99.66000  1.000 134.29592 ? 195 G  B "O5'" 1 
ATOM   5377 C  "C5'" . G  B 1 93  ? 87.95000 47.28900 100.21900 1.000 137.48578 ? 195 G  B "C5'" 1 
ATOM   5378 C  "C4'" . G  B 1 93  ? 86.87300 46.90600 99.23200  1.000 138.98596 ? 195 G  B "C4'" 1 
ATOM   5379 O  "O4'" . G  B 1 93  ? 86.99300 47.68800 98.01500  1.000 142.79957 ? 195 G  B "O4'" 1 
ATOM   5380 C  "C3'" . G  B 1 93  ? 86.87500 45.46900 98.74000  1.000 140.42560 ? 195 G  B "C3'" 1 
ATOM   5381 O  "O3'" . G  B 1 93  ? 86.32200 44.56500 99.67900  1.000 142.10739 ? 195 G  B "O3'" 1 
ATOM   5382 C  "C2'" . G  B 1 93  ? 86.07500 45.56700 97.44900  1.000 139.81237 ? 195 G  B "C2'" 1 
ATOM   5383 O  "O2'" . G  B 1 93  ? 84.68200 45.63100 97.72100  1.000 133.55636 ? 195 G  B "O2'" 1 
ATOM   5384 C  "C1'" . G  B 1 93  ? 86.53500 46.92600 96.91400  1.000 138.39641 ? 195 G  B "C1'" 1 
ATOM   5385 N  N9    . G  B 1 93  ? 87.63200 46.77400 95.94100  1.000 135.19603 ? 195 G  B N9    1 
ATOM   5386 C  C8    . G  B 1 93  ? 88.95400 47.12000 96.08100  1.000 134.46700 ? 195 G  B C8    1 
ATOM   5387 N  N7    . G  B 1 93  ? 89.66900 46.83900 95.02500  1.000 137.14100 ? 195 G  B N7    1 
ATOM   5388 C  C5    . G  B 1 93  ? 88.76300 46.26700 94.13900  1.000 133.36950 ? 195 G  B C5    1 
ATOM   5389 C  C6    . G  B 1 93  ? 88.94700 45.75800 92.82500  1.000 126.58447 ? 195 G  B C6    1 
ATOM   5390 O  O6    . G  B 1 93  ? 89.98700 45.70900 92.15100  1.000 123.97363 ? 195 G  B O6    1 
ATOM   5391 N  N1    . G  B 1 93  ? 87.75400 45.26800 92.29400  1.000 126.85556 ? 195 G  B N1    1 
ATOM   5392 C  C2    . G  B 1 93  ? 86.54100 45.26900 92.93900  1.000 126.18706 ? 195 G  B C2    1 
ATOM   5393 N  N2    . G  B 1 93  ? 85.50400 44.75100 92.26300  1.000 126.32655 ? 195 G  B N2    1 
ATOM   5394 N  N3    . G  B 1 93  ? 86.35900 45.74000 94.16000  1.000 131.26924 ? 195 G  B N3    1 
ATOM   5395 C  C4    . G  B 1 93  ? 87.50300 46.21700 94.69400  1.000 132.86417 ? 195 G  B C4    1 
ATOM   5396 P  P     . A  B 1 94  ? 86.85600 43.05100 99.76100  1.000 145.66963 ? 196 A  B P     1 
ATOM   5397 O  OP1   . A  B 1 94  ? 86.44600 42.50100 101.07600 1.000 154.31540 ? 196 A  B OP1   1 
ATOM   5398 O  OP2   . A  B 1 94  ? 88.29300 43.02800 99.38700  1.000 135.65264 ? 196 A  B OP2   1 
ATOM   5399 O  "O5'" . A  B 1 94  ? 86.03500 42.28500 98.63000  1.000 137.68446 ? 196 A  B "O5'" 1 
ATOM   5400 C  "C5'" . A  B 1 94  ? 84.61500 42.24600 98.65100  1.000 134.53408 ? 196 A  B "C5'" 1 
ATOM   5401 C  "C4'" . A  B 1 94  ? 84.05800 41.68200 97.36700  1.000 135.73422 ? 196 A  B "C4'" 1 
ATOM   5402 O  "O4'" . A  B 1 94  ? 84.43400 42.53400 96.25300  1.000 134.32353 ? 196 A  B "O4'" 1 
ATOM   5403 C  "C3'" . A  B 1 94  ? 84.56300 40.30300 96.96700  1.000 137.83711 ? 196 A  B "C3'" 1 
ATOM   5404 O  "O3'" . A  B 1 94  ? 83.88700 39.25400 97.63800  1.000 138.36875 ? 196 A  B "O3'" 1 
ATOM   5405 C  "C2'" . A  B 1 94  ? 84.35400 40.29500 95.45700  1.000 135.00782 ? 196 A  B "C2'" 1 
ATOM   5406 O  "O2'" . A  B 1 94  ? 82.99400 40.03400 95.13700  1.000 132.73913 ? 196 A  B "O2'" 1 
ATOM   5407 C  "C1'" . A  B 1 94  ? 84.66800 41.75000 95.10100  1.000 132.60227 ? 196 A  B "C1'" 1 
ATOM   5408 N  N9    . A  B 1 94  ? 86.07000 41.93500 94.67700  1.000 129.41505 ? 196 A  B N9    1 
ATOM   5409 C  C8    . A  B 1 94  ? 87.11300 42.42100 95.42200  1.000 132.97863 ? 196 A  B C8    1 
ATOM   5410 N  N7    . A  B 1 94  ? 88.25000 42.47800 94.77700  1.000 135.30786 ? 196 A  B N7    1 
ATOM   5411 C  C5    . A  B 1 94  ? 87.93600 41.99600 93.51600  1.000 126.87527 ? 196 A  B C5    1 
ATOM   5412 C  C6    . A  B 1 94  ? 88.71300 41.80300 92.35800  1.000 125.40404 ? 196 A  B C6    1 
ATOM   5413 N  N6    . A  B 1 94  ? 90.01800 42.08500 92.28900  1.000 126.31731 ? 196 A  B N6    1 
ATOM   5414 N  N1    . A  B 1 94  ? 88.09600 41.30300 91.26100  1.000 126.96475 ? 196 A  B N1    1 
ATOM   5415 C  C2    . A  B 1 94  ? 86.78800 41.02200 91.33500  1.000 124.04335 ? 196 A  B C2    1 
ATOM   5416 N  N3    . A  B 1 94  ? 85.95600 41.16200 92.36700  1.000 124.90924 ? 196 A  B N3    1 
ATOM   5417 C  C4    . A  B 1 94  ? 86.59800 41.65700 93.43900  1.000 125.98042 ? 196 A  B C4    1 
ATOM   5418 P  P     . C  B 1 95  ? 84.70900 38.00500 98.22400  1.000 139.89029 ? 197 C  B P     1 
ATOM   5419 O  OP1   . C  B 1 95  ? 83.83300 37.29500 99.18900  1.000 144.33556 ? 197 C  B OP1   1 
ATOM   5420 O  OP2   . C  B 1 95  ? 86.03900 38.50100 98.65600  1.000 125.72017 ? 197 C  B OP2   1 
ATOM   5421 O  "O5'" . C  B 1 95  ? 84.93900 37.06000 96.96100  1.000 145.27514 ? 197 C  B "O5'" 1 
ATOM   5422 C  "C5'" . C  B 1 95  ? 83.84400 36.52500 96.22900  1.000 141.42994 ? 197 C  B "C5'" 1 
ATOM   5423 C  "C4'" . C  B 1 95  ? 84.28600 36.02300 94.87800  1.000 139.19283 ? 197 C  B "C4'" 1 
ATOM   5424 O  "O4'" . C  B 1 95  ? 84.79600 37.13600 94.10200  1.000 137.85846 ? 197 C  B "O4'" 1 
ATOM   5425 C  "C3'" . C  B 1 95  ? 85.42700 35.01600 94.88600  1.000 144.13816 ? 197 C  B "C3'" 1 
ATOM   5426 O  "O3'" . C  B 1 95  ? 84.98600 33.68700 95.11700  1.000 151.95752 ? 197 C  B "O3'" 1 
ATOM   5427 C  "C2'" . C  B 1 95  ? 86.06600 35.21000 93.51500  1.000 135.08971 ? 197 C  B "C2'" 1 
ATOM   5428 O  "O2'" . C  B 1 95  ? 85.34500 34.49800 92.52000  1.000 129.59168 ? 197 C  B "O2'" 1 
ATOM   5429 C  "C1'" . C  B 1 95  ? 85.86400 36.71100 93.28400  1.000 133.16316 ? 197 C  B "C1'" 1 
ATOM   5430 N  N1    . C  B 1 95  ? 87.07000 37.50800 93.61000  1.000 131.07607 ? 197 C  B N1    1 
ATOM   5431 C  C2    . C  B 1 95  ? 88.07900 37.63100 92.65000  1.000 133.98958 ? 197 C  B C2    1 
ATOM   5432 O  O2    . C  B 1 95  ? 87.94200 37.06300 91.55600  1.000 130.99711 ? 197 C  B O2    1 
ATOM   5433 N  N3    . C  B 1 95  ? 89.18000 38.36200 92.93500  1.000 131.06028 ? 197 C  B N3    1 
ATOM   5434 C  C4    . C  B 1 95  ? 89.29700 38.95900 94.12300  1.000 128.62841 ? 197 C  B C4    1 
ATOM   5435 N  N4    . C  B 1 95  ? 90.40500 39.66900 94.35500  1.000 128.54682 ? 197 C  B N4    1 
ATOM   5436 C  C5    . C  B 1 95  ? 88.28100 38.85200 95.11800  1.000 126.37288 ? 197 C  B C5    1 
ATOM   5437 C  C6    . C  B 1 95  ? 87.19700 38.12700 94.81900  1.000 126.96505 ? 197 C  B C6    1 
ATOM   5438 P  P     . A  B 1 96  ? 84.96400 33.07800 96.60500  1.000 161.89597 ? 198 A  B P     1 
ATOM   5439 O  OP1   . A  B 1 96  ? 83.66700 33.44900 97.22300  1.000 151.38944 ? 198 A  B OP1   1 
ATOM   5440 O  OP2   . A  B 1 96  ? 86.23400 33.44300 97.28100  1.000 150.40775 ? 198 A  B OP2   1 
ATOM   5441 O  "O5'" . A  B 1 96  ? 84.95400 31.50100 96.38100  1.000 155.62153 ? 198 A  B "O5'" 1 
ATOM   5442 C  "C5'" . A  B 1 96  ? 83.76900 30.83000 95.96100  1.000 157.45859 ? 198 A  B "C5'" 1 
ATOM   5443 C  "C4'" . A  B 1 96  ? 84.06400 29.73700 94.96200  1.000 157.14013 ? 198 A  B "C4'" 1 
ATOM   5444 O  "O4'" . A  B 1 96  ? 84.84800 30.29100 93.87000  1.000 149.56291 ? 198 A  B "O4'" 1 
ATOM   5445 C  "C3'" . A  B 1 96  ? 84.86400 28.55000 95.49700  1.000 162.34602 ? 198 A  B "C3'" 1 
ATOM   5446 O  "O3'" . A  B 1 96  ? 84.46600 27.37200 94.79800  1.000 171.96033 ? 198 A  B "O3'" 1 
ATOM   5447 C  "C2'" . A  B 1 96  ? 86.29100 28.90100 95.09000  1.000 153.41600 ? 198 A  B "C2'" 1 
ATOM   5448 O  "O2'" . A  B 1 96  ? 87.15800 27.79100 94.98200  1.000 148.96810 ? 198 A  B "O2'" 1 
ATOM   5449 C  "C1'" . A  B 1 96  ? 86.05700 29.56800 93.73900  1.000 151.71317 ? 198 A  B "C1'" 1 
ATOM   5450 N  N9    . A  B 1 96  ? 87.11000 30.49900 93.31700  1.000 143.57535 ? 198 A  B N9    1 
ATOM   5451 C  C8    . A  B 1 96  ? 87.41800 31.74100 93.81600  1.000 141.75408 ? 198 A  B C8    1 
ATOM   5452 N  N7    . A  B 1 96  ? 88.41700 32.32700 93.19600  1.000 135.64808 ? 198 A  B N7    1 
ATOM   5453 C  C5    . A  B 1 96  ? 88.78700 31.41300 92.21900  1.000 133.64258 ? 198 A  B C5    1 
ATOM   5454 C  C6    . A  B 1 96  ? 89.78200 31.42300 91.22300  1.000 130.58958 ? 198 A  B C6    1 
ATOM   5455 N  N6    . A  B 1 96  ? 90.63500 32.43300 91.03200  1.000 124.12039 ? 198 A  B N6    1 
ATOM   5456 N  N1    . A  B 1 96  ? 89.87700 30.34300 90.41500  1.000 129.83423 ? 198 A  B N1    1 
ATOM   5457 C  C2    . A  B 1 96  ? 89.02600 29.32500 90.59900  1.000 133.80313 ? 198 A  B C2    1 
ATOM   5458 N  N3    . A  B 1 96  ? 88.05400 29.20000 91.49800  1.000 136.19815 ? 198 A  B N3    1 
ATOM   5459 C  C4    . A  B 1 96  ? 87.98400 30.28900 92.28100  1.000 136.56135 ? 198 A  B C4    1 
ATOM   5460 P  P     . U  B 1 97  ? 83.53000 26.27200 95.50200  1.000 180.30966 ? 199 U  B P     1 
ATOM   5461 O  OP1   . U  B 1 97  ? 82.60600 26.96200 96.43500  1.000 167.33969 ? 199 U  B OP1   1 
ATOM   5462 O  OP2   . U  B 1 97  ? 84.40400 25.18300 96.00500  1.000 177.52512 ? 199 U  B OP2   1 
ATOM   5463 O  "O5'" . U  B 1 97  ? 82.66800 25.68600 94.29800  1.000 181.63614 ? 199 U  B "O5'" 1 
ATOM   5464 C  "C5'" . U  B 1 97  ? 81.88800 26.54400 93.47800  1.000 177.79621 ? 199 U  B "C5'" 1 
ATOM   5465 C  "C4'" . U  B 1 97  ? 80.51200 25.97300 93.24900  1.000 184.09170 ? 199 U  B "C4'" 1 
ATOM   5466 O  "O4'" . U  B 1 97  ? 79.92400 25.59900 94.52200  1.000 192.11634 ? 199 U  B "O4'" 1 
ATOM   5467 C  "C3'" . U  B 1 97  ? 79.48800 26.90400 92.62000  1.000 186.12878 ? 199 U  B "C3'" 1 
ATOM   5468 O  "O3'" . U  B 1 97  ? 79.60800 26.96400 91.20700  1.000 183.05736 ? 199 U  B "O3'" 1 
ATOM   5469 C  "C2'" . U  B 1 97  ? 78.16300 26.30200 93.08500  1.000 192.33742 ? 199 U  B "C2'" 1 
ATOM   5470 O  "O2'" . U  B 1 97  ? 77.81900 25.17700 92.28500  1.000 193.31649 ? 199 U  B "O2'" 1 
ATOM   5471 C  "C1'" . U  B 1 97  ? 78.52900 25.80300 94.48900  1.000 201.28586 ? 199 U  B "C1'" 1 
ATOM   5472 N  N1    . U  B 1 97  ? 78.16400 26.75800 95.56700  1.000 212.37404 ? 199 U  B N1    1 
ATOM   5473 C  C2    . U  B 1 97  ? 76.84500 26.78700 96.00200  1.000 216.09290 ? 199 U  B C2    1 
ATOM   5474 O  O2    . U  B 1 97  ? 75.97300 26.07500 95.53100  1.000 219.23012 ? 199 U  B O2    1 
ATOM   5475 N  N3    . U  B 1 97  ? 76.57700 27.68600 97.00800  1.000 227.54691 ? 199 U  B N3    1 
ATOM   5476 C  C4    . U  B 1 97  ? 77.47700 28.54200 97.61700  1.000 224.79395 ? 199 U  B C4    1 
ATOM   5477 O  O4    . U  B 1 97  ? 77.08900 29.29900 98.51200  1.000 229.89719 ? 199 U  B O4    1 
ATOM   5478 C  C5    . U  B 1 97  ? 78.81800 28.45100 97.12000  1.000 212.46878 ? 199 U  B C5    1 
ATOM   5479 C  C6    . U  B 1 97  ? 79.10900 27.58400 96.14200  1.000 209.21839 ? 199 U  B C6    1 
ATOM   5480 P  P     . G  B 1 98  ? 80.40100 28.16500 90.48600  1.000 178.04907 ? 200 G  B P     1 
ATOM   5481 O  OP1   . G  B 1 98  ? 79.72500 28.44500 89.19400  1.000 166.41346 ? 200 G  B OP1   1 
ATOM   5482 O  OP2   . G  B 1 98  ? 81.84800 27.84000 90.47800  1.000 168.39528 ? 200 G  B OP2   1 
ATOM   5483 O  "O5'" . G  B 1 98  ? 80.17600 29.42300 91.43600  1.000 167.94260 ? 200 G  B "O5'" 1 
ATOM   5484 C  "C5'" . G  B 1 98  ? 79.98500 30.71700 90.88100  1.000 156.17013 ? 200 G  B "C5'" 1 
ATOM   5485 C  "C4'" . G  B 1 98  ? 80.88900 31.74600 91.51300  1.000 140.57879 ? 200 G  B "C4'" 1 
ATOM   5486 O  "O4'" . G  B 1 98  ? 82.12000 31.12000 91.95900  1.000 136.57568 ? 200 G  B "O4'" 1 
ATOM   5487 C  "C3'" . G  B 1 98  ? 81.35500 32.86200 90.58900  1.000 136.09667 ? 200 G  B "C3'" 1 
ATOM   5488 O  "O3'" . G  B 1 98  ? 80.39300 33.88700 90.43300  1.000 135.06234 ? 200 G  B "O3'" 1 
ATOM   5489 C  "C2'" . G  B 1 98  ? 82.64600 33.32200 91.24900  1.000 132.04619 ? 200 G  B "C2'" 1 
ATOM   5490 O  "O2'" . G  B 1 98  ? 82.37200 34.14700 92.37200  1.000 127.53775 ? 200 G  B "O2'" 1 
ATOM   5491 C  "C1'" . G  B 1 98  ? 83.21000 31.99500 91.75500  1.000 136.77307 ? 200 G  B "C1'" 1 
ATOM   5492 N  N9    . G  B 1 98  ? 84.12400 31.37100 90.77800  1.000 137.80740 ? 200 G  B N9    1 
ATOM   5493 C  C8    . G  B 1 98  ? 83.95000 30.15000 90.17400  1.000 139.33653 ? 200 G  B C8    1 
ATOM   5494 N  N7    . G  B 1 98  ? 84.91200 29.84300 89.35000  1.000 129.27743 ? 200 G  B N7    1 
ATOM   5495 C  C5    . G  B 1 98  ? 85.77900 30.92400 89.41700  1.000 129.28796 ? 200 G  B C5    1 
ATOM   5496 C  C6    . G  B 1 98  ? 87.00200 31.15900 88.73800  1.000 127.08506 ? 200 G  B C6    1 
ATOM   5497 O  O6    . G  B 1 98  ? 87.58200 30.43400 87.92100  1.000 118.30506 ? 200 G  B O6    1 
ATOM   5498 N  N1    . G  B 1 98  ? 87.55800 32.38300 89.09300  1.000 122.97405 ? 200 G  B N1    1 
ATOM   5499 C  C2    . G  B 1 98  ? 87.00700 33.27000 89.98200  1.000 124.36632 ? 200 G  B C2    1 
ATOM   5500 N  N2    . G  B 1 98  ? 87.69700 34.40100 90.18600  1.000 121.67126 ? 200 G  B N2    1 
ATOM   5501 N  N3    . G  B 1 98  ? 85.86600 33.06200 90.62000  1.000 128.06413 ? 200 G  B N3    1 
ATOM   5502 C  C4    . G  B 1 98  ? 85.30800 31.87700 90.29400  1.000 129.64853 ? 200 G  B C4    1 
ATOM   5503 P  P     . G  B 1 99  ? 80.20700 34.60700 89.01000  1.000 126.36837 ? 201 G  B P     1 
ATOM   5504 O  OP1   . G  B 1 99  ? 78.96000 35.41200 89.06400  1.000 118.65955 ? 201 G  B OP1   1 
ATOM   5505 O  OP2   . G  B 1 99  ? 80.38000 33.59000 87.94100  1.000 114.70644 ? 201 G  B OP2   1 
ATOM   5506 O  "O5'" . G  B 1 99  ? 81.42900 35.62400 88.94400  1.000 124.24706 ? 201 G  B "O5'" 1 
ATOM   5507 C  "C5'" . G  B 1 99  ? 81.57700 36.63800 89.92800  1.000 118.49111 ? 201 G  B "C5'" 1 
ATOM   5508 C  "C4'" . G  B 1 99  ? 82.83700 37.43800 89.71600  1.000 114.20375 ? 201 G  B "C4'" 1 
ATOM   5509 O  "O4'" . G  B 1 99  ? 83.99600 36.61000 89.99300  1.000 122.97849 ? 201 G  B "O4'" 1 
ATOM   5510 C  "C3'" . G  B 1 99  ? 83.07200 37.94500 88.30100  1.000 109.69795 ? 201 G  B "C3'" 1 
ATOM   5511 O  "O3'" . G  B 1 99  ? 82.35000 39.12800 88.00600  1.000 109.41897 ? 201 G  B "O3'" 1 
ATOM   5512 C  "C2'" . G  B 1 99  ? 84.58200 38.12500 88.26500  1.000 108.84258 ? 201 G  B "C2'" 1 
ATOM   5513 O  "O2'" . G  B 1 99  ? 84.95400 39.31800 88.93800  1.000 116.30664 ? 201 G  B "O2'" 1 
ATOM   5514 C  "C1'" . G  B 1 99  ? 85.04300 36.93200 89.10100  1.000 115.75920 ? 201 G  B "C1'" 1 
ATOM   5515 N  N9    . G  B 1 99  ? 85.31700 35.75300 88.25800  1.000 115.39863 ? 201 G  B N9    1 
ATOM   5516 C  C8    . G  B 1 99  ? 84.55600 34.61500 88.15600  1.000 119.02802 ? 201 G  B C8    1 
ATOM   5517 N  N7    . G  B 1 99  ? 85.04800 33.74600 87.31600  1.000 119.49649 ? 201 G  B N7    1 
ATOM   5518 C  C5    . G  B 1 99  ? 86.20500 34.34400 86.83400  1.000 114.55380 ? 201 G  B C5    1 
ATOM   5519 C  C6    . G  B 1 99  ? 87.16100 33.87900 85.89100  1.000 112.61146 ? 201 G  B C6    1 
ATOM   5520 O  O6    . G  B 1 99  ? 87.17900 32.80400 85.27700  1.000 115.83026 ? 201 G  B O6    1 
ATOM   5521 N  N1    . G  B 1 99  ? 88.17800 34.80900 85.69300  1.000 108.23198 ? 201 G  B N1    1 
ATOM   5522 C  C2    . G  B 1 99  ? 88.26100 36.02800 86.31800  1.000 108.83206 ? 201 G  B C2    1 
ATOM   5523 N  N2    . G  B 1 99  ? 89.31500 36.78800 85.99200  1.000 113.04572 ? 201 G  B N2    1 
ATOM   5524 N  N3    . G  B 1 99  ? 87.37800 36.47300 87.19600  1.000 114.47484 ? 201 G  B N3    1 
ATOM   5525 C  C4    . G  B 1 99  ? 86.38300 35.58600 87.40600  1.000 115.64603 ? 201 G  B C4    1 
ATOM   5526 P  P     . U  B 1 100 ? 81.69800 39.33000 86.55100  1.000 105.95378 ? 202 U  B P     1 
ATOM   5527 O  OP1   . U  B 1 100 ? 80.96000 40.61600 86.52500  1.000 93.49966  ? 202 U  B OP1   1 
ATOM   5528 O  OP2   . U  B 1 100 ? 81.01000 38.06800 86.17600  1.000 105.00367 ? 202 U  B OP2   1 
ATOM   5529 O  "O5'" . U  B 1 100 ? 82.95400 39.51200 85.59300  1.000 106.79072 ? 202 U  B "O5'" 1 
ATOM   5530 C  "C5'" . U  B 1 100 ? 83.85300 40.59800 85.76000  1.000 104.34833 ? 202 U  B "C5'" 1 
ATOM   5531 C  "C4'" . U  B 1 100 ? 85.10500 40.37800 84.95500  1.000 100.77158 ? 202 U  B "C4'" 1 
ATOM   5532 O  "O4'" . U  B 1 100 ? 85.74500 39.15200 85.39700  1.000 104.14567 ? 202 U  B "O4'" 1 
ATOM   5533 C  "C3'" . U  B 1 100 ? 84.88800 40.16500 83.46700  1.000 94.55505  ? 202 U  B "C3'" 1 
ATOM   5534 O  "O3'" . U  B 1 100 ? 84.71300 41.37800 82.75200  1.000 90.27559  ? 202 U  B "O3'" 1 
ATOM   5535 C  "C2'" . U  B 1 100 ? 86.11600 39.36500 83.05900  1.000 94.68401  ? 202 U  B "C2'" 1 
ATOM   5536 O  "O2'" . U  B 1 100 ? 87.24400 40.21700 82.91600  1.000 108.50146 ? 202 U  B "O2'" 1 
ATOM   5537 C  "C1'" . U  B 1 100 ? 86.32700 38.48700 84.29600  1.000 98.38445  ? 202 U  B "C1'" 1 
ATOM   5538 N  N1    . U  B 1 100 ? 85.70300 37.14800 84.16100  1.000 100.93213 ? 202 U  B N1    1 
ATOM   5539 C  C2    . U  B 1 100 ? 86.38700 36.21600 83.40900  1.000 105.25107 ? 202 U  B C2    1 
ATOM   5540 O  O2    . U  B 1 100 ? 87.44700 36.46300 82.86400  1.000 112.93883 ? 202 U  B O2    1 
ATOM   5541 N  N3    . U  B 1 100 ? 85.78600 34.98800 83.30800  1.000 103.49296 ? 202 U  B N3    1 
ATOM   5542 C  C4    . U  B 1 100 ? 84.59300 34.59900 83.87900  1.000 108.15141 ? 202 U  B C4    1 
ATOM   5543 O  O4    . U  B 1 100 ? 84.18100 33.45200 83.69700  1.000 114.71536 ? 202 U  B O4    1 
ATOM   5544 C  C5    . U  B 1 100 ? 83.94400 35.61500 84.65100  1.000 110.32010 ? 202 U  B C5    1 
ATOM   5545 C  C6    . U  B 1 100 ? 84.50900 36.82300 84.76500  1.000 106.70124 ? 202 U  B C6    1 
ATOM   5546 P  P     . C  B 1 101 ? 83.56600 41.48700 81.63300  1.000 91.17550  ? 203 C  B P     1 
ATOM   5547 O  OP1   . C  B 1 101 ? 83.17700 42.91600 81.50000  1.000 91.95454  ? 203 C  B OP1   1 
ATOM   5548 O  OP2   . C  B 1 101 ? 82.52100 40.48500 81.97300  1.000 88.65415  ? 203 C  B OP2   1 
ATOM   5549 O  "O5'" . C  B 1 101 ? 84.30400 41.01500 80.29900  1.000 94.14165  ? 203 C  B "O5'" 1 
ATOM   5550 C  "C5'" . C  B 1 101 ? 85.53300 41.61000 79.90300  1.000 90.95706  ? 203 C  B "C5'" 1 
ATOM   5551 C  "C4'" . C  B 1 101 ? 86.28600 40.76000 78.90700  1.000 90.73598  ? 203 C  B "C4'" 1 
ATOM   5552 O  "O4'" . C  B 1 101 ? 86.83000 39.58500 79.56100  1.000 86.60390  ? 203 C  B "O4'" 1 
ATOM   5553 C  "C3'" . C  B 1 101 ? 85.48300 40.19200 77.74900  1.000 94.80225  ? 203 C  B "C3'" 1 
ATOM   5554 O  "O3'" . C  B 1 101 ? 85.24800 41.13800 76.72100  1.000 88.83049  ? 203 C  B "O3'" 1 
ATOM   5555 C  "C2'" . C  B 1 101 ? 86.33500 39.01200 77.30700  1.000 95.48391  ? 203 C  B "C2'" 1 
ATOM   5556 O  "O2'" . C  B 1 101 ? 87.42900 39.45600 76.51600  1.000 96.46561  ? 203 C  B "O2'" 1 
ATOM   5557 C  "C1'" . C  B 1 101 ? 86.87400 38.50600 78.64800  1.000 87.97249  ? 203 C  B "C1'" 1 
ATOM   5558 N  N1    . C  B 1 101 ? 86.07100 37.38700 79.19400  1.000 93.84424  ? 203 C  B N1    1 
ATOM   5559 C  C2    . C  B 1 101 ? 86.34000 36.08300 78.76100  1.000 96.58668  ? 203 C  B C2    1 
ATOM   5560 O  O2    . C  B 1 101 ? 87.24700 35.90000 77.93400  1.000 104.00862 ? 203 C  B O2    1 
ATOM   5561 N  N3    . C  B 1 101 ? 85.61200 35.05300 79.25600  1.000 96.09978  ? 203 C  B N3    1 
ATOM   5562 C  C4    . C  B 1 101 ? 84.64700 35.29400 80.14700  1.000 97.93684  ? 203 C  B C4    1 
ATOM   5563 N  N4    . C  B 1 101 ? 83.94900 34.25700 80.61400  1.000 100.39766 ? 203 C  B N4    1 
ATOM   5564 C  C5    . C  B 1 101 ? 84.34900 36.60900 80.60600  1.000 94.32062  ? 203 C  B C5    1 
ATOM   5565 C  C6    . C  B 1 101 ? 85.07900 37.61100 80.10600  1.000 95.75500  ? 203 C  B C6    1 
ATOM   5566 P  P     . C  B 1 102 ? 83.89700 41.06800 75.85700  1.000 91.84118  ? 204 C  B P     1 
ATOM   5567 O  OP1   . C  B 1 102 ? 83.80700 42.33800 75.09200  1.000 94.55992  ? 204 C  B OP1   1 
ATOM   5568 O  OP2   . C  B 1 102 ? 82.78700 40.67500 76.76500  1.000 95.69427  ? 204 C  B OP2   1 
ATOM   5569 O  "O5'" . C  B 1 102 ? 84.14900 39.85800 74.84900  1.000 101.20809 ? 204 C  B "O5'" 1 
ATOM   5570 C  "C5'" . C  B 1 102 ? 85.26100 39.86400 73.96400  1.000 98.27353  ? 204 C  B "C5'" 1 
ATOM   5571 C  "C4'" . C  B 1 102 ? 85.41100 38.54900 73.23800  1.000 98.84465  ? 204 C  B "C4'" 1 
ATOM   5572 O  "O4'" . C  B 1 102 ? 85.83700 37.51400 74.16100  1.000 93.74930  ? 204 C  B "O4'" 1 
ATOM   5573 C  "C3'" . C  B 1 102 ? 84.15000 37.98300 72.61000  1.000 98.19983  ? 204 C  B "C3'" 1 
ATOM   5574 O  "O3'" . C  B 1 102 ? 83.82100 38.58800 71.37200  1.000 100.33167 ? 204 C  B "O3'" 1 
ATOM   5575 C  "C2'" . C  B 1 102 ? 84.47000 36.49900 72.49700  1.000 99.71054  ? 204 C  B "C2'" 1 
ATOM   5576 O  "O2'" . C  B 1 102 ? 85.28600 36.24600 71.36300  1.000 101.94502 ? 204 C  B "O2'" 1 
ATOM   5577 C  "C1'" . C  B 1 102 ? 85.30000 36.26900 73.76400  1.000 99.45525  ? 204 C  B "C1'" 1 
ATOM   5578 N  N1    . C  B 1 102 ? 84.48400 35.72500 74.87300  1.000 93.45190  ? 204 C  B N1    1 
ATOM   5579 C  C2    . C  B 1 102 ? 84.16100 34.36300 74.86800  1.000 97.94717  ? 204 C  B C2    1 
ATOM   5580 O  O2    . C  B 1 102 ? 84.56700 33.64700 73.94100  1.000 98.48934  ? 204 C  B O2    1 
ATOM   5581 N  N3    . C  B 1 102 ? 83.41400 33.85600 75.87600  1.000 97.36816  ? 204 C  B N3    1 
ATOM   5582 C  C4    . C  B 1 102 ? 82.99600 34.65500 76.85700  1.000 93.24134  ? 204 C  B C4    1 
ATOM   5583 N  N4    . C  B 1 102 ? 82.26400 34.11600 77.83000  1.000 94.88365  ? 204 C  B N4    1 
ATOM   5584 C  C5    . C  B 1 102 ? 83.30600 36.04500 76.89100  1.000 93.98617  ? 204 C  B C5    1 
ATOM   5585 C  C6    . C  B 1 102 ? 84.04300 36.53300 75.88600  1.000 91.06740  ? 204 C  B C6    1 
ATOM   5586 P  P     . U  B 1 103 ? 82.28100 38.82000 70.98100  1.000 95.55027  ? 205 U  B P     1 
ATOM   5587 O  OP1   . U  B 1 103 ? 82.23100 39.53700 69.68000  1.000 102.95642 ? 205 U  B OP1   1 
ATOM   5588 O  OP2   . U  B 1 103 ? 81.61000 39.41600 72.16500  1.000 95.35814  ? 205 U  B OP2   1 
ATOM   5589 O  "O5'" . U  B 1 103 ? 81.71300 37.34400 70.77100  1.000 103.30909 ? 205 U  B "O5'" 1 
ATOM   5590 C  "C5'" . U  B 1 103 ? 82.20000 36.51500 69.72500  1.000 98.27954  ? 205 U  B "C5'" 1 
ATOM   5591 C  "C4'" . U  B 1 103 ? 81.71600 35.09000 69.85900  1.000 96.51617  ? 205 U  B "C4'" 1 
ATOM   5592 O  "O4'" . U  B 1 103 ? 82.20900 34.51400 71.09500  1.000 106.53316 ? 205 U  B "O4'" 1 
ATOM   5593 C  "C3'" . U  B 1 103 ? 80.21300 34.88800 69.93700  1.000 100.61667 ? 205 U  B "C3'" 1 
ATOM   5594 O  "O3'" . U  B 1 103 ? 79.58800 34.94200 68.66900  1.000 104.25394 ? 205 U  B "O3'" 1 
ATOM   5595 C  "C2'" . U  B 1 103 ? 80.09400 33.53200 70.62100  1.000 100.50349 ? 205 U  B "C2'" 1 
ATOM   5596 O  "O2'" . U  B 1 103 ? 80.30400 32.47500 69.69400  1.000 108.13862 ? 205 U  B "O2'" 1 
ATOM   5597 C  "C1'" . U  B 1 103 ? 81.27700 33.57600 71.59300  1.000 98.83487  ? 205 U  B "C1'" 1 
ATOM   5598 N  N1    . U  B 1 103 ? 80.86000 33.98500 72.95300  1.000 97.97951  ? 205 U  B N1    1 
ATOM   5599 C  C2    . U  B 1 103 ? 80.31900 33.00700 73.76700  1.000 100.45875 ? 205 U  B C2    1 
ATOM   5600 O  O2    . U  B 1 103 ? 80.18900 31.84600 73.42000  1.000 105.84361 ? 205 U  B O2    1 
ATOM   5601 N  N3    . U  B 1 103 ? 79.93600 33.43400 75.01000  1.000 96.35300  ? 205 U  B N3    1 
ATOM   5602 C  C4    . U  B 1 103 ? 80.03600 34.71600 75.51000  1.000 93.80269  ? 205 U  B C4    1 
ATOM   5603 O  O4    . U  B 1 103 ? 79.64900 34.94300 76.65700  1.000 107.83332 ? 205 U  B O4    1 
ATOM   5604 C  C5    . U  B 1 103 ? 80.60500 35.67300 74.60900  1.000 93.56056  ? 205 U  B C5    1 
ATOM   5605 C  C6    . U  B 1 103 ? 80.98600 35.28300 73.38800  1.000 98.70065  ? 205 U  B C6    1 
ATOM   5606 P  P     . A  B 1 104 ? 78.46000 36.04400 68.38100  1.000 101.75762 ? 206 A  B P     1 
ATOM   5607 O  OP1   . A  B 1 104 ? 78.11600 35.95400 66.94000  1.000 104.67376 ? 206 A  B OP1   1 
ATOM   5608 O  OP2   . A  B 1 104 ? 78.92500 37.33700 68.94800  1.000 103.15516 ? 206 A  B OP2   1 
ATOM   5609 O  "O5'" . A  B 1 104 ? 77.21100 35.54300 69.23500  1.000 94.40148  ? 206 A  B "O5'" 1 
ATOM   5610 C  "C5'" . A  B 1 104 ? 76.70400 34.22600 69.07800  1.000 98.41775  ? 206 A  B "C5'" 1 
ATOM   5611 C  "C4'" . A  B 1 104 ? 75.83100 33.82700 70.24100  1.000 99.32049  ? 206 A  B "C4'" 1 
ATOM   5612 O  "O4'" . A  B 1 104 ? 76.62500 33.78000 71.45300  1.000 110.60868 ? 206 A  B "O4'" 1 
ATOM   5613 C  "C3'" . A  B 1 104 ? 74.69300 34.78000 70.57500  1.000 102.14714 ? 206 A  B "C3'" 1 
ATOM   5614 O  "O3'" . A  B 1 104 ? 73.55600 34.57800 69.75400  1.000 109.82964 ? 206 A  B "O3'" 1 
ATOM   5615 C  "C2'" . A  B 1 104 ? 74.43900 34.49700 72.04900  1.000 103.69206 ? 206 A  B "C2'" 1 
ATOM   5616 O  "O2'" . A  B 1 104 ? 73.66300 33.31900 72.20600  1.000 105.04749 ? 206 A  B "O2'" 1 
ATOM   5617 C  "C1'" . A  B 1 104 ? 75.85500 34.21500 72.55300  1.000 104.72903 ? 206 A  B "C1'" 1 
ATOM   5618 N  N9    . A  B 1 104 ? 76.49400 35.41600 73.11600  1.000 98.65462  ? 206 A  B N9    1 
ATOM   5619 C  C8    . A  B 1 104 ? 77.26100 36.34700 72.46400  1.000 100.15217 ? 206 A  B C8    1 
ATOM   5620 N  N7    . A  B 1 104 ? 77.70600 37.31000 73.22900  1.000 102.84723 ? 206 A  B N7    1 
ATOM   5621 C  C5    . A  B 1 104 ? 77.19900 36.99100 74.47600  1.000 99.12836  ? 206 A  B C5    1 
ATOM   5622 C  C6    . A  B 1 104 ? 77.31300 37.63100 75.72300  1.000 99.73896  ? 206 A  B C6    1 
ATOM   5623 N  N6    . A  B 1 104 ? 78.00200 38.75900 75.92700  1.000 100.39430 ? 206 A  B N6    1 
ATOM   5624 N  N1    . A  B 1 104 ? 76.68900 37.06100 76.77700  1.000 100.03899 ? 206 A  B N1    1 
ATOM   5625 C  C2    . A  B 1 104 ? 75.99500 35.93100 76.58300  1.000 102.87091 ? 206 A  B C2    1 
ATOM   5626 N  N3    . A  B 1 104 ? 75.81700 35.24100 75.45500  1.000 102.51824 ? 206 A  B N3    1 
ATOM   5627 C  C4    . A  B 1 104 ? 76.44900 35.83000 74.42400  1.000 100.07847 ? 206 A  B C4    1 
ATOM   5628 P  P     . A  B 1 105 ? 72.52100 35.77700 69.48400  1.000 108.91229 ? 207 A  B P     1 
ATOM   5629 O  OP1   . A  B 1 105 ? 72.55100 36.06000 68.02900  1.000 103.56691 ? 207 A  B OP1   1 
ATOM   5630 O  OP2   . A  B 1 105 ? 72.78000 36.86600 70.45900  1.000 106.95416 ? 207 A  B OP2   1 
ATOM   5631 O  "O5'" . A  B 1 105 ? 71.10700 35.13600 69.83900  1.000 108.90176 ? 207 A  B "O5'" 1 
ATOM   5632 C  "C5'" . A  B 1 105 ? 70.70400 33.91000 69.24700  1.000 110.49406 ? 207 A  B "C5'" 1 
ATOM   5633 C  "C4'" . A  B 1 105 ? 69.96700 33.02400 70.22000  1.000 107.29367 ? 207 A  B "C4'" 1 
ATOM   5634 O  "O4'" . A  B 1 105 ? 70.78000 32.78700 71.39900  1.000 104.29331 ? 207 A  B "O4'" 1 
ATOM   5635 C  "C3'" . A  B 1 105 ? 68.67300 33.57900 70.78200  1.000 108.08850 ? 207 A  B "C3'" 1 
ATOM   5636 O  "O3'" . A  B 1 105 ? 67.58600 33.47900 69.87800  1.000 107.79900 ? 207 A  B "O3'" 1 
ATOM   5637 C  "C2'" . A  B 1 105 ? 68.49700 32.75900 72.05400  1.000 109.34129 ? 207 A  B "C2'" 1 
ATOM   5638 O  "O2'" . A  B 1 105 ? 68.02100 31.45700 71.75000  1.000 110.52037 ? 207 A  B "O2'" 1 
ATOM   5639 C  "C1'" . A  B 1 105 ? 69.94500 32.64400 72.53200  1.000 108.77806 ? 207 A  B "C1'" 1 
ATOM   5640 N  N9    . A  B 1 105 ? 70.28200 33.68800 73.51800  1.000 108.82543 ? 207 A  B N9    1 
ATOM   5641 C  C8    . A  B 1 105 ? 71.04100 34.81600 73.33800  1.000 106.99890 ? 207 A  B C8    1 
ATOM   5642 N  N7    . A  B 1 105 ? 71.15800 35.55600 74.41200  1.000 103.01158 ? 207 A  B N7    1 
ATOM   5643 C  C5    . A  B 1 105 ? 70.42100 34.87000 75.36800  1.000 100.26388 ? 207 A  B C5    1 
ATOM   5644 C  C6    . A  B 1 105 ? 70.14900 35.13300 76.72500  1.000 105.35133 ? 207 A  B C6    1 
ATOM   5645 N  N6    . A  B 1 105 ? 70.60400 36.20100 77.38900  1.000 103.88274 ? 207 A  B N6    1 
ATOM   5646 N  N1    . A  B 1 105 ? 69.37800 34.24700 77.39500  1.000 105.04603 ? 207 A  B N1    1 
ATOM   5647 C  C2    . A  B 1 105 ? 68.91600 33.17100 76.74100  1.000 107.20682 ? 207 A  B C2    1 
ATOM   5648 N  N3    . A  B 1 105 ? 69.10500 32.81900 75.46900  1.000 101.06924 ? 207 A  B N3    1 
ATOM   5649 C  C4    . A  B 1 105 ? 69.87400 33.71900 74.83000  1.000 99.91647  ? 207 A  B C4    1 
ATOM   5650 P  P     . C  B 1 106 ? 66.81600 34.80100 69.38800  1.000 118.69383 ? 208 C  B P     1 
ATOM   5651 O  OP1   . C  B 1 106 ? 65.71500 34.39000 68.48200  1.000 126.57899 ? 208 C  B OP1   1 
ATOM   5652 O  OP2   . C  B 1 106 ? 67.82600 35.78900 68.93800  1.000 97.47287  ? 208 C  B OP2   1 
ATOM   5653 O  "O5'" . C  B 1 106 ? 66.14500 35.36900 70.71200  1.000 105.37118 ? 208 C  B "O5'" 1 
ATOM   5654 C  "C5'" . C  B 1 106 ? 65.34200 34.53900 71.53600  1.000 101.40228 ? 208 C  B "C5'" 1 
ATOM   5655 C  "C4'" . C  B 1 106 ? 65.40800 34.98900 72.96900  1.000 114.26172 ? 208 C  B "C4'" 1 
ATOM   5656 O  "O4'" . C  B 1 106 ? 66.78600 34.95100 73.43000  1.000 117.53580 ? 208 C  B "O4'" 1 
ATOM   5657 C  "C3'" . C  B 1 106 ? 64.98500 36.42300 73.21500  1.000 119.18073 ? 208 C  B "C3'" 1 
ATOM   5658 O  "O3'" . C  B 1 106 ? 63.57800 36.58100 73.25400  1.000 122.16267 ? 208 C  B "O3'" 1 
ATOM   5659 C  "C2'" . C  B 1 106 ? 65.70100 36.75600 74.51700  1.000 113.83535 ? 208 C  B "C2'" 1 
ATOM   5660 O  "O2'" . C  B 1 106 ? 65.03300 36.16700 75.62400  1.000 108.08466 ? 208 C  B "O2'" 1 
ATOM   5661 C  "C1'" . C  B 1 106 ? 67.02800 36.02800 74.31300  1.000 111.50350 ? 208 C  B "C1'" 1 
ATOM   5662 N  N1    . C  B 1 106 ? 68.05300 36.91700 73.71600  1.000 105.51330 ? 208 C  B N1    1 
ATOM   5663 C  C2    . C  B 1 106 ? 68.66000 37.88100 74.52600  1.000 104.12366 ? 208 C  B C2    1 
ATOM   5664 O  O2    . C  B 1 106 ? 68.32800 37.96100 75.71800  1.000 107.96097 ? 208 C  B O2    1 
ATOM   5665 N  N3    . C  B 1 106 ? 69.59500 38.70600 74.00100  1.000 102.77613 ? 208 C  B N3    1 
ATOM   5666 C  C4    . C  B 1 106 ? 69.92800 38.59800 72.71500  1.000 108.25047 ? 208 C  B C4    1 
ATOM   5667 N  N4    . C  B 1 106 ? 70.85500 39.43700 72.24100  1.000 111.50876 ? 208 C  B N4    1 
ATOM   5668 C  C5    . C  B 1 106 ? 69.32400 37.62600 71.86200  1.000 108.95845 ? 208 C  B C5    1 
ATOM   5669 C  C6    . C  B 1 106 ? 68.40200 36.81700 72.39900  1.000 105.14221 ? 208 C  B C6    1 
ATOM   5670 P  P     . C  B 1 107 ? 62.89100 37.88400 72.61800  1.000 132.99119 ? 209 C  B P     1 
ATOM   5671 O  OP1   . C  B 1 107 ? 61.43300 37.62800 72.54400  1.000 141.92121 ? 209 C  B OP1   1 
ATOM   5672 O  OP2   . C  B 1 107 ? 63.63800 38.27700 71.39700  1.000 117.74726 ? 209 C  B OP2   1 
ATOM   5673 O  "O5'" . C  B 1 107 ? 63.11400 38.98400 73.74100  1.000 122.62942 ? 209 C  B "O5'" 1 
ATOM   5674 C  "C5'" . C  B 1 107 ? 62.93700 38.63900 75.10900  1.000 128.33537 ? 209 C  B "C5'" 1 
ATOM   5675 C  "C4'" . C  B 1 107 ? 63.07200 39.83000 76.01200  1.000 132.32532 ? 209 C  B "C4'" 1 
ATOM   5676 O  "O4'" . C  B 1 107 ? 64.46700 40.21500 76.10000  1.000 124.50596 ? 209 C  B "O4'" 1 
ATOM   5677 C  "C3'" . C  B 1 107 ? 62.29700 41.06500 75.57000  1.000 135.53360 ? 209 C  B "C3'" 1 
ATOM   5678 O  "O3'" . C  B 1 107 ? 61.66200 41.64700 76.70600  1.000 151.45919 ? 209 C  B "O3'" 1 
ATOM   5679 C  "C2'" . C  B 1 107 ? 63.37900 41.97800 74.98200  1.000 124.55597 ? 209 C  B "C2'" 1 
ATOM   5680 O  "O2'" . C  B 1 107 ? 63.10900 43.36200 75.07800  1.000 134.04395 ? 209 C  B "O2'" 1 
ATOM   5681 C  "C1'" . C  B 1 107 ? 64.61900 41.58200 75.77800  1.000 119.65801 ? 209 C  B "C1'" 1 
ATOM   5682 N  N1    . C  B 1 107 ? 65.86000 41.69900 75.00100  1.000 112.81245 ? 209 C  B N1    1 
ATOM   5683 C  C2    . C  B 1 107 ? 66.89100 42.53200 75.43800  1.000 107.40917 ? 209 C  B C2    1 
ATOM   5684 O  O2    . C  B 1 107 ? 66.73500 43.17500 76.48800  1.000 107.40917 ? 209 C  B O2    1 
ATOM   5685 N  N3    . C  B 1 107 ? 68.02000 42.61000 74.69400  1.000 104.13510 ? 209 C  B N3    1 
ATOM   5686 C  C4    . C  B 1 107 ? 68.13300 41.89800 73.56900  1.000 103.15340 ? 209 C  B C4    1 
ATOM   5687 N  N4    . C  B 1 107 ? 69.26400 42.00000 72.86700  1.000 103.17446 ? 209 C  B N4    1 
ATOM   5688 C  C5    . C  B 1 107 ? 67.09300 41.04000 73.10900  1.000 104.54831 ? 209 C  B C5    1 
ATOM   5689 C  C6    . C  B 1 107 ? 65.98500 40.96900 73.85200  1.000 110.56218 ? 209 C  B C6    1 
ATOM   5690 P  P     . A  B 1 108 ? 60.28300 41.00600 77.24100  1.000 166.98312 ? 210 A  B P     1 
ATOM   5691 O  OP1   . A  B 1 108 ? 60.23700 41.14500 78.72300  1.000 144.41462 ? 210 A  B OP1   1 
ATOM   5692 O  OP2   . A  B 1 108 ? 60.11100 39.65800 76.63200  1.000 161.97989 ? 210 A  B OP2   1 
ATOM   5693 O  "O5'" . A  B 1 108 ? 59.15800 41.91900 76.57900  1.000 159.36115 ? 210 A  B "O5'" 1 
ATOM   5694 C  "C5'" . A  B 1 108 ? 58.94600 41.91400 75.16800  1.000 152.79984 ? 210 A  B "C5'" 1 
ATOM   5695 C  "C4'" . A  B 1 108 ? 58.55900 43.28000 74.66400  1.000 149.38364 ? 210 A  B "C4'" 1 
ATOM   5696 O  "O4'" . A  B 1 108 ? 57.11300 43.41100 74.69400  1.000 150.43640 ? 210 A  B "O4'" 1 
ATOM   5697 C  "C3'" . A  B 1 108 ? 59.11900 44.43300 75.48300  1.000 147.07810 ? 210 A  B "C3'" 1 
ATOM   5698 O  "O3'" . A  B 1 108 ? 59.48300 45.50400 74.61200  1.000 140.42467 ? 210 A  B "O3'" 1 
ATOM   5699 C  "C2'" . A  B 1 108 ? 57.94600 44.82100 76.39300  1.000 145.51212 ? 210 A  B "C2'" 1 
ATOM   5700 O  "O2'" . A  B 1 108 ? 57.94700 46.16800 76.82600  1.000 145.53318 ? 210 A  B "O2'" 1 
ATOM   5701 C  "C1'" . A  B 1 108 ? 56.73000 44.49900 75.51900  1.000 144.15933 ? 210 A  B "C1'" 1 
ATOM   5702 N  N9    . A  B 1 108 ? 55.54500 44.06100 76.27200  1.000 139.04029 ? 210 A  B N9    1 
ATOM   5703 C  C8    . A  B 1 108 ? 55.51000 42.99800 77.13700  1.000 142.45123 ? 210 A  B C8    1 
ATOM   5704 N  N7    . A  B 1 108 ? 54.34400 42.76600 77.68200  1.000 140.12727 ? 210 A  B N7    1 
ATOM   5705 C  C5    . A  B 1 108 ? 53.52800 43.74000 77.13500  1.000 133.28434 ? 210 A  B C5    1 
ATOM   5706 C  C6    . A  B 1 108 ? 52.16100 44.02100 77.32500  1.000 130.68403 ? 210 A  B C6    1 
ATOM   5707 N  N6    . A  B 1 108 ? 51.36500 43.32400 78.14000  1.000 130.22345 ? 210 A  B N6    1 
ATOM   5708 N  N1    . A  B 1 108 ? 51.63200 45.05500 76.64100  1.000 131.08144 ? 210 A  B N1    1 
ATOM   5709 C  C2    . A  B 1 108 ? 52.43800 45.74700 75.82800  1.000 128.56535 ? 210 A  B C2    1 
ATOM   5710 N  N3    . A  B 1 108 ? 53.73700 45.58000 75.56700  1.000 133.33171 ? 210 A  B N3    1 
ATOM   5711 C  C4    . A  B 1 108 ? 54.24400 44.54200 76.25700  1.000 135.31616 ? 210 A  B C4    1 
ATOM   5712 P  P     . C  B 1 109 ? 60.97400 45.56900 74.00000  1.000 150.16164 ? 211 C  B P     1 
ATOM   5713 O  OP1   . C  B 1 109 ? 61.08300 46.75400 73.11400  1.000 135.01245 ? 211 C  B OP1   1 
ATOM   5714 O  OP2   . C  B 1 109 ? 61.33100 44.24400 73.42600  1.000 133.59912 ? 211 C  B OP2   1 
ATOM   5715 O  "O5'" . C  B 1 109 ? 61.90200 45.81200 75.27400  1.000 139.41824 ? 211 C  B "O5'" 1 
ATOM   5716 C  "C5'" . C  B 1 109 ? 61.54200 46.74900 76.28200  1.000 124.60857 ? 211 C  B "C5'" 1 
ATOM   5717 C  "C4'" . C  B 1 109 ? 62.66500 47.70700 76.57500  1.000 112.12550 ? 211 C  B "C4'" 1 
ATOM   5718 O  "O4'" . C  B 1 109 ? 63.89100 46.96200 76.81200  1.000 112.06496 ? 211 C  B "O4'" 1 
ATOM   5719 C  "C3'" . C  B 1 109 ? 63.02900 48.65900 75.44900  1.000 100.52411 ? 211 C  B "C3'" 1 
ATOM   5720 O  "O3'" . C  B 1 109 ? 62.16700 49.78200 75.35800  1.000 101.78742 ? 211 C  B "O3'" 1 
ATOM   5721 C  "C2'" . C  B 1 109 ? 64.46700 49.02000 75.77700  1.000 103.05336 ? 211 C  B "C2'" 1 
ATOM   5722 O  "O2'" . C  B 1 109 ? 64.52200 49.97800 76.82300  1.000 103.91662 ? 211 C  B "O2'" 1 
ATOM   5723 C  "C1'" . C  B 1 109 ? 64.99500 47.68700 76.31100  1.000 107.44336 ? 211 C  B "C1'" 1 
ATOM   5724 N  N1    . C  B 1 109 ? 65.64900 46.89200 75.24000  1.000 99.41082  ? 211 C  B N1    1 
ATOM   5725 C  C2    . C  B 1 109 ? 66.89700 47.31100 74.75700  1.000 97.85800  ? 211 C  B C2    1 
ATOM   5726 O  O2    . C  B 1 109 ? 67.42200 48.32200 75.24800  1.000 95.19189  ? 211 C  B O2    1 
ATOM   5727 N  N3    . C  B 1 109 ? 67.51200 46.61500 73.76900  1.000 103.21390 ? 211 C  B N3    1 
ATOM   5728 C  C4    . C  B 1 109 ? 66.93000 45.53000 73.26200  1.000 102.82175 ? 211 C  B C4    1 
ATOM   5729 N  N4    . C  B 1 109 ? 67.57400 44.87300 72.29600  1.000 98.16067  ? 211 C  B N4    1 
ATOM   5730 C  C5    . C  B 1 109 ? 65.66200 45.07300 73.72700  1.000 107.09858 ? 211 C  B C5    1 
ATOM   5731 C  C6    . C  B 1 109 ? 65.06500 45.77500 74.70400  1.000 102.53487 ? 211 C  B C6    1 
ATOM   5732 P  P     . G  B 1 110 ? 61.87900 50.47100 73.93400  1.000 112.69044 ? 212 G  B P     1 
ATOM   5733 O  OP1   . G  B 1 110 ? 60.89300 51.55700 74.15600  1.000 114.31958 ? 212 G  B OP1   1 
ATOM   5734 O  OP2   . G  B 1 110 ? 61.57800 49.40600 72.94600  1.000 118.48587 ? 212 G  B OP2   1 
ATOM   5735 O  "O5'" . G  B 1 110 ? 63.27000 51.13700 73.53100  1.000 95.86474  ? 212 G  B "O5'" 1 
ATOM   5736 C  "C5'" . G  B 1 110 ? 63.74000 52.30000 74.20000  1.000 90.76676  ? 212 G  B "C5'" 1 
ATOM   5737 C  "C4'" . G  B 1 110 ? 65.23100 52.49700 74.03300  1.000 89.49292  ? 212 G  B "C4'" 1 
ATOM   5738 O  "O4'" . G  B 1 110 ? 65.91800 51.22300 74.02700  1.000 91.50106  ? 212 G  B "O4'" 1 
ATOM   5739 C  "C3'" . G  B 1 110 ? 65.69500 53.16600 72.74800  1.000 85.02396  ? 212 G  B "C3'" 1 
ATOM   5740 O  "O3'" . G  B 1 110 ? 65.53900 54.57000 72.77100  1.000 81.28141  ? 212 G  B "O3'" 1 
ATOM   5741 C  "C2'" . G  B 1 110 ? 67.15200 52.73300 72.66500  1.000 87.62428  ? 212 G  B "C2'" 1 
ATOM   5742 O  "O2'" . G  B 1 110 ? 67.96000 53.53200 73.51800  1.000 87.25581  ? 212 G  B "O2'" 1 
ATOM   5743 C  "C1'" . G  B 1 110 ? 67.09400 51.31800 73.24500  1.000 88.60071  ? 212 G  B "C1'" 1 
ATOM   5744 N  N9    . G  B 1 110 ? 67.07500 50.27500 72.20000  1.000 94.39877  ? 212 G  B N9    1 
ATOM   5745 C  C8    . G  B 1 110 ? 66.10300 49.32500 71.98600  1.000 95.53838  ? 212 G  B C8    1 
ATOM   5746 N  N7    . G  B 1 110 ? 66.37400 48.53200 70.98400  1.000 96.10687  ? 212 G  B N7    1 
ATOM   5747 C  C5    . G  B 1 110 ? 67.59700 48.98100 70.50300  1.000 94.90410  ? 212 G  B C5    1 
ATOM   5748 C  C6    . G  B 1 110 ? 68.39000 48.51100 69.42000  1.000 97.46756  ? 212 G  B C6    1 
ATOM   5749 O  O6    . G  B 1 110 ? 68.16600 47.57300 68.64400  1.000 103.32353 ? 212 G  B O6    1 
ATOM   5750 N  N1    . G  B 1 110 ? 69.55700 49.25100 69.27600  1.000 98.13343  ? 212 G  B N1    1 
ATOM   5751 C  C2    . G  B 1 110 ? 69.92000 50.31000 70.06700  1.000 98.63086  ? 212 G  B C2    1 
ATOM   5752 N  N2    . G  B 1 110 ? 71.09000 50.89300 69.76200  1.000 95.30414  ? 212 G  B N2    1 
ATOM   5753 N  N3    . G  B 1 110 ? 69.19000 50.75800 71.07800  1.000 101.25223 ? 212 G  B N3    1 
ATOM   5754 C  C4    . G  B 1 110 ? 68.04700 50.05400 71.24400  1.000 96.76221  ? 212 G  B C4    1 
ATOM   5755 P  P     . C  B 1 111 ? 65.25500 55.37300 71.41000  1.000 89.19861  ? 213 C  B P     1 
ATOM   5756 O  OP1   . C  B 1 111 ? 64.85300 56.74800 71.79600  1.000 92.84378  ? 213 C  B OP1   1 
ATOM   5757 O  OP2   . C  B 1 111 ? 64.35400 54.53800 70.57400  1.000 83.39002  ? 213 C  B OP2   1 
ATOM   5758 O  "O5'" . C  B 1 111 ? 66.67500 55.44900 70.68300  1.000 96.13102  ? 213 C  B "O5'" 1 
ATOM   5759 C  "C5'" . C  B 1 111 ? 67.76000 56.17000 71.25700  1.000 98.88398  ? 213 C  B "C5'" 1 
ATOM   5760 C  "C4'" . C  B 1 111 ? 68.99800 56.12800 70.38800  1.000 95.92047  ? 213 C  B "C4'" 1 
ATOM   5761 O  "O4'" . C  B 1 111 ? 69.53100 54.77800 70.33600  1.000 95.14932  ? 213 C  B "O4'" 1 
ATOM   5762 C  "C3'" . C  B 1 111 ? 68.81500 56.50300 68.92500  1.000 92.30687  ? 213 C  B "C3'" 1 
ATOM   5763 O  "O3'" . C  B 1 111 ? 68.77200 57.89900 68.70900  1.000 93.17014  ? 213 C  B "O3'" 1 
ATOM   5764 C  "C2'" . C  B 1 111 ? 70.00800 55.83200 68.26100  1.000 94.61768  ? 213 C  B "C2'" 1 
ATOM   5765 O  "O2'" . C  B 1 111 ? 71.18500 56.60300 68.45500  1.000 103.34241 ? 213 C  B "O2'" 1 
ATOM   5766 C  "C1'" . C  B 1 111 ? 70.12500 54.54300 69.07500  1.000 90.57509  ? 213 C  B "C1'" 1 
ATOM   5767 N  N1    . C  B 1 111 ? 69.42400 53.41200 68.42500  1.000 90.82249  ? 213 C  B N1    1 
ATOM   5768 C  C2    . C  B 1 111 ? 70.01900 52.76600 67.33100  1.000 97.60488  ? 213 C  B C2    1 
ATOM   5769 O  O2    . C  B 1 111 ? 71.12600 53.15200 66.92200  1.000 103.17133 ? 213 C  B O2    1 
ATOM   5770 N  N3    . C  B 1 111 ? 69.36700 51.73600 66.74300  1.000 97.45749  ? 213 C  B N3    1 
ATOM   5771 C  C4    . C  B 1 111 ? 68.17700 51.34300 67.20300  1.000 99.03136  ? 213 C  B C4    1 
ATOM   5772 N  N4    . C  B 1 111 ? 67.57200 50.32000 66.58900  1.000 98.64711  ? 213 C  B N4    1 
ATOM   5773 C  C5    . C  B 1 111 ? 67.55500 51.98400 68.31600  1.000 96.92848  ? 213 C  B C5    1 
ATOM   5774 C  C6    . C  B 1 111 ? 68.20500 53.00400 68.89200  1.000 88.29060  ? 213 C  B C6    1 
ATOM   5775 P  P     . A  B 1 112 ? 67.78300 58.50200 67.60000  1.000 105.78203 ? 214 A  B P     1 
ATOM   5776 O  OP1   . A  B 1 112 ? 67.96200 59.97700 67.62300  1.000 93.39896  ? 214 A  B OP1   1 
ATOM   5777 O  OP2   . A  B 1 112 ? 66.44200 57.92000 67.85000  1.000 98.41536  ? 214 A  B OP2   1 
ATOM   5778 O  "O5'" . A  B 1 112 ? 68.35700 57.93200 66.22200  1.000 92.85943  ? 214 A  B "O5'" 1 
ATOM   5779 C  "C5'" . A  B 1 112 ? 69.58400 58.42800 65.70000  1.000 100.53140 ? 214 A  B "C5'" 1 
ATOM   5780 C  "C4'" . A  B 1 112 ? 70.13800 57.60400 64.55400  1.000 102.88431 ? 214 A  B "C4'" 1 
ATOM   5781 O  "O4'" . A  B 1 112 ? 70.27900 56.21100 64.92400  1.000 99.85237  ? 214 A  B "O4'" 1 
ATOM   5782 C  "C3'" . A  B 1 112 ? 69.32100 57.54400 63.27600  1.000 108.87977 ? 214 A  B "C3'" 1 
ATOM   5783 O  "O3'" . A  B 1 112 ? 69.39700 58.72900 62.51000  1.000 111.99856 ? 214 A  B "O3'" 1 
ATOM   5784 C  "C2'" . A  B 1 112 ? 69.91400 56.33000 62.57300  1.000 107.91649 ? 214 A  B "C2'" 1 
ATOM   5785 O  "O2'" . A  B 1 112 ? 71.14200 56.66200 61.94000  1.000 115.22790 ? 214 A  B "O2'" 1 
ATOM   5786 C  "C1'" . A  B 1 112 ? 70.20800 55.40700 63.75700  1.000 100.96040 ? 214 A  B "C1'" 1 
ATOM   5787 N  N9    . A  B 1 112 ? 69.15700 54.38800 63.91200  1.000 100.13398 ? 214 A  B N9    1 
ATOM   5788 C  C8    . A  B 1 112 ? 68.16100 54.29200 64.85000  1.000 95.67029  ? 214 A  B C8    1 
ATOM   5789 N  N7    . A  B 1 112 ? 67.38700 53.24600 64.68200  1.000 97.93635  ? 214 A  B N7    1 
ATOM   5790 C  C5    . A  B 1 112 ? 67.90500 52.62500 63.55200  1.000 100.94724 ? 214 A  B C5    1 
ATOM   5791 C  C6    . A  B 1 112 ? 67.53700 51.46500 62.84800  1.000 100.52877 ? 214 A  B C6    1 
ATOM   5792 N  N6    . A  B 1 112 ? 66.51000 50.68300 63.19100  1.000 104.24237 ? 214 A  B N6    1 
ATOM   5793 N  N1    . A  B 1 112 ? 68.27000 51.12800 61.76000  1.000 102.36583 ? 214 A  B N1    1 
ATOM   5794 C  C2    . A  B 1 112 ? 69.30500 51.90400 61.40400  1.000 102.08422 ? 214 A  B C2    1 
ATOM   5795 N  N3    . A  B 1 112 ? 69.74600 53.01600 61.99000  1.000 99.06017  ? 214 A  B N3    1 
ATOM   5796 C  C4    . A  B 1 112 ? 68.99400 53.32000 63.06500  1.000 102.00789 ? 214 A  B C4    1 
ATOM   5797 P  P     . G  B 1 113 ? 68.18400 59.14800 61.54300  1.000 113.00987 ? 215 G  B P     1 
ATOM   5798 O  OP1   . G  B 1 113 ? 68.47100 60.52600 61.06500  1.000 109.35944 ? 215 G  B OP1   1 
ATOM   5799 O  OP2   . G  B 1 113 ? 66.90800 58.87800 62.24900  1.000 113.68101 ? 215 G  B OP2   1 
ATOM   5800 O  "O5'" . G  B 1 113 ? 68.29300 58.13700 60.31300  1.000 105.79059 ? 215 G  B "O5'" 1 
ATOM   5801 C  "C5'" . G  B 1 113 ? 69.33700 58.26400 59.35800  1.000 112.98092 ? 215 G  B "C5'" 1 
ATOM   5802 C  "C4'" . G  B 1 113 ? 69.48600 57.03100 58.49600  1.000 118.19734 ? 215 G  B "C4'" 1 
ATOM   5803 O  "O4'" . G  B 1 113 ? 69.54100 55.84100 59.32400  1.000 112.09134 ? 215 G  B "O4'" 1 
ATOM   5804 C  "C3'" . G  B 1 113 ? 68.36300 56.73300 57.51700  1.000 117.81571 ? 215 G  B "C3'" 1 
ATOM   5805 O  "O3'" . G  B 1 113 ? 68.40900 57.53400 56.34900  1.000 114.47321 ? 215 G  B "O3'" 1 
ATOM   5806 C  "C2'" . G  B 1 113 ? 68.55900 55.24800 57.24200  1.000 113.17832 ? 215 G  B "C2'" 1 
ATOM   5807 O  "O2'" . G  B 1 113 ? 69.63200 55.04000 56.33400  1.000 107.90400 ? 215 G  B "O2'" 1 
ATOM   5808 C  "C1'" . G  B 1 113 ? 68.98800 54.74500 58.62000  1.000 110.94384 ? 215 G  B "C1'" 1 
ATOM   5809 N  N9    . G  B 1 113 ? 67.84600 54.20600 59.37900  1.000 100.28466 ? 215 G  B N9    1 
ATOM   5810 C  C8    . G  B 1 113 ? 67.23800 54.73700 60.49000  1.000 104.86416 ? 215 G  B C8    1 
ATOM   5811 N  N7    . G  B 1 113 ? 66.24200 54.01000 60.91900  1.000 109.45418 ? 215 G  B N7    1 
ATOM   5812 C  C5    . G  B 1 113 ? 66.19100 52.93700 60.03700  1.000 107.62502 ? 215 G  B C5    1 
ATOM   5813 C  C6    . G  B 1 113 ? 65.32000 51.81600 59.99700  1.000 110.78329 ? 215 G  B C6    1 
ATOM   5814 O  O6    . G  B 1 113 ? 64.38800 51.53600 60.76000  1.000 108.61724 ? 215 G  B O6    1 
ATOM   5815 N  N1    . G  B 1 113 ? 65.62000 50.96800 58.93700  1.000 107.97243 ? 215 G  B N1    1 
ATOM   5816 C  C2    . G  B 1 113 ? 66.63000 51.17100 58.03200  1.000 109.25942 ? 215 G  B C2    1 
ATOM   5817 N  N2    . G  B 1 113 ? 66.76200 50.24000 57.07600  1.000 117.95784 ? 215 G  B N2    1 
ATOM   5818 N  N3    . G  B 1 113 ? 67.44800 52.21000 58.05900  1.000 107.34077 ? 215 G  B N3    1 
ATOM   5819 C  C4    . G  B 1 113 ? 67.17500 53.04500 59.08200  1.000 101.21635 ? 215 G  B C4    1 
ATOM   5820 P  P     . C  B 1 114 ? 67.05600 57.88600 55.55900  1.000 122.61231 ? 216 C  B P     1 
ATOM   5821 O  OP1   . C  B 1 114 ? 67.41200 58.77500 54.42600  1.000 121.63851 ? 216 C  B OP1   1 
ATOM   5822 O  OP2   . C  B 1 114 ? 66.03800 58.31200 56.55200  1.000 113.39805 ? 216 C  B OP2   1 
ATOM   5823 O  "O5'" . C  B 1 114 ? 66.59700 56.49400 54.93500  1.000 114.49555 ? 216 C  B "O5'" 1 
ATOM   5824 C  "C5'" . C  B 1 114 ? 67.34000 55.89000 53.88600  1.000 110.57402 ? 216 C  B "C5'" 1 
ATOM   5825 C  "C4'" . C  B 1 114 ? 66.71400 54.59300 53.44200  1.000 110.16082 ? 216 C  B "C4'" 1 
ATOM   5826 O  "O4'" . C  B 1 114 ? 66.73000 53.64100 54.54100  1.000 110.52402 ? 216 C  B "O4'" 1 
ATOM   5827 C  "C3'" . C  B 1 114 ? 65.24900 54.66800 53.04400  1.000 114.31395 ? 216 C  B "C3'" 1 
ATOM   5828 O  "O3'" . C  B 1 114 ? 65.05000 55.16100 51.72900  1.000 118.96450 ? 216 C  B "O3'" 1 
ATOM   5829 C  "C2'" . C  B 1 114 ? 64.77600 53.23700 53.26000  1.000 116.33261 ? 216 C  B "C2'" 1 
ATOM   5830 O  "O2'" . C  B 1 114 ? 65.20700 52.39400 52.20000  1.000 119.99094 ? 216 C  B "O2'" 1 
ATOM   5831 C  "C1'" . C  B 1 114 ? 65.54900 52.86400 54.52300  1.000 109.43441 ? 216 C  B "C1'" 1 
ATOM   5832 N  N1    . C  B 1 114 ? 64.77300 53.16700 55.74700  1.000 109.73182 ? 216 C  B N1    1 
ATOM   5833 C  C2    . C  B 1 114 ? 63.72100 52.32200 56.12000  1.000 113.76651 ? 216 C  B C2    1 
ATOM   5834 O  O2    . C  B 1 114 ? 63.46000 51.32700 55.42500  1.000 112.68217 ? 216 C  B O2    1 
ATOM   5835 N  N3    . C  B 1 114 ? 63.01800 52.61400 57.23800  1.000 114.28763 ? 216 C  B N3    1 
ATOM   5836 C  C4    . C  B 1 114 ? 63.32800 53.69000 57.96700  1.000 113.10854 ? 216 C  B C4    1 
ATOM   5837 N  N4    . C  B 1 114 ? 62.60500 53.93300 59.06600  1.000 111.04776 ? 216 C  B N4    1 
ATOM   5838 C  C5    . C  B 1 114 ? 64.39400 54.56500 57.60400  1.000 110.40821 ? 216 C  B C5    1 
ATOM   5839 C  C6    . C  B 1 114 ? 65.07900 54.26900 56.49600  1.000 104.63384 ? 216 C  B C6    1 
ATOM   5840 P  P     . C  B 1 115 ? 63.78400 56.09300 51.39900  1.000 121.53631 ? 217 C  B P     1 
ATOM   5841 O  OP1   . C  B 1 115 ? 63.94000 56.60500 50.01400  1.000 133.32457 ? 217 C  B OP1   1 
ATOM   5842 O  OP2   . C  B 1 115 ? 63.60500 57.06700 52.50700  1.000 115.07501 ? 217 C  B OP2   1 
ATOM   5843 O  "O5'" . C  B 1 115 ? 62.56100 55.07200 51.40200  1.000 123.45233 ? 217 C  B "O5'" 1 
ATOM   5844 C  "C5'" . C  B 1 115 ? 62.57900 53.92500 50.56200  1.000 122.99964 ? 217 C  B "C5'" 1 
ATOM   5845 C  "C4'" . C  B 1 115 ? 61.51200 52.92700 50.94000  1.000 127.43175 ? 217 C  B "C4'" 1 
ATOM   5846 O  "O4'" . C  B 1 115 ? 61.73300 52.43900 52.29000  1.000 133.92201 ? 217 C  B "O4'" 1 
ATOM   5847 C  "C3'" . C  B 1 115 ? 60.09000 53.45600 50.97100  1.000 133.10612 ? 217 C  B "C3'" 1 
ATOM   5848 O  "O3'" . C  B 1 115 ? 59.50900 53.54200 49.68300  1.000 135.92751 ? 217 C  B "O3'" 1 
ATOM   5849 C  "C2'" . C  B 1 115 ? 59.39000 52.46700 51.88900  1.000 136.67497 ? 217 C  B "C2'" 1 
ATOM   5850 O  "O2'" . C  B 1 115 ? 59.08200 51.26700 51.19000  1.000 146.85514 ? 217 C  B "O2'" 1 
ATOM   5851 C  "C1'" . C  B 1 115 ? 60.49000 52.17800 52.91300  1.000 132.96926 ? 217 C  B "C1'" 1 
ATOM   5852 N  N1    . C  B 1 115 ? 60.37200 53.03500 54.11600  1.000 131.46382 ? 217 C  B N1    1 
ATOM   5853 C  C2    . C  B 1 115 ? 59.30900 52.82200 55.00700  1.000 131.09798 ? 217 C  B C2    1 
ATOM   5854 O  O2    . C  B 1 115 ? 58.47900 51.92900 54.77800  1.000 134.32732 ? 217 C  B O2    1 
ATOM   5855 N  N3    . C  B 1 115 ? 59.20000 53.60000 56.10700  1.000 122.74435 ? 217 C  B N3    1 
ATOM   5856 C  C4    . C  B 1 115 ? 60.09900 54.55800 56.33500  1.000 121.08362 ? 217 C  B C4    1 
ATOM   5857 N  N4    . C  B 1 115 ? 59.95000 55.30200 57.43400  1.000 121.10468 ? 217 C  B N4    1 
ATOM   5858 C  C5    . C  B 1 115 ? 61.19200 54.79500 55.45000  1.000 120.43355 ? 217 C  B C5    1 
ATOM   5859 C  C6    . C  B 1 115 ? 61.28800 54.02000 54.36300  1.000 120.98624 ? 217 C  B C6    1 
ATOM   5860 P  P     . A  B 1 116 ? 58.69400 54.85400 49.24500  1.000 143.39853 ? 218 A  B P     1 
ATOM   5861 O  OP1   . A  B 1 116 ? 58.30300 54.67000 47.82500  1.000 141.55357 ? 218 A  B OP1   1 
ATOM   5862 O  OP2   . A  B 1 116 ? 59.47200 56.05000 49.65400  1.000 135.57390 ? 218 A  B OP2   1 
ATOM   5863 O  "O5'" . A  B 1 116 ? 57.37700 54.80900 50.14000  1.000 144.87765 ? 218 A  B "O5'" 1 
ATOM   5864 C  "C5'" . A  B 1 116 ? 56.57500 53.63400 50.19000  1.000 141.80360 ? 218 A  B "C5'" 1 
ATOM   5865 C  "C4'" . A  B 1 116 ? 55.44000 53.76600 51.17400  1.000 141.35091 ? 218 A  B "C4'" 1 
ATOM   5866 O  "O4'" . A  B 1 116 ? 55.97700 54.02100 52.49900  1.000 137.68995 ? 218 A  B "O4'" 1 
ATOM   5867 C  "C3'" . A  B 1 116 ? 54.45800 54.89500 50.87500  1.000 143.44590 ? 218 A  B "C3'" 1 
ATOM   5868 O  "O3'" . A  B 1 116 ? 53.13100 54.46800 51.16200  1.000 138.64269 ? 218 A  B "O3'" 1 
ATOM   5869 C  "C2'" . A  B 1 116 ? 54.88600 55.99900 51.84000  1.000 139.03221 ? 218 A  B "C2'" 1 
ATOM   5870 O  "O2'" . A  B 1 116 ? 53.84500 56.87500 52.22000  1.000 128.97838 ? 218 A  B "O2'" 1 
ATOM   5871 C  "C1'" . A  B 1 116 ? 55.41300 55.20600 53.03200  1.000 137.93735 ? 218 A  B "C1'" 1 
ATOM   5872 N  N9    . A  B 1 116 ? 56.46300 55.91100 53.77000  1.000 131.17338 ? 218 A  B N9    1 
ATOM   5873 C  C8    . A  B 1 116 ? 57.68200 56.29000 53.27100  1.000 132.93148 ? 218 A  B C8    1 
ATOM   5874 N  N7    . A  B 1 116 ? 58.44500 56.91300 54.13300  1.000 127.66243 ? 218 A  B N7    1 
ATOM   5875 C  C5    . A  B 1 116 ? 57.67500 56.95400 55.28400  1.000 124.86209 ? 218 A  B C5    1 
ATOM   5876 C  C6    . A  B 1 116 ? 57.92200 57.48800 56.55900  1.000 129.28368 ? 218 A  B C6    1 
ATOM   5877 N  N6    . A  B 1 116 ? 59.05700 58.10400 56.89200  1.000 127.46241 ? 218 A  B N6    1 
ATOM   5878 N  N1    . A  B 1 116 ? 56.95000 57.36700 57.49000  1.000 126.95445 ? 218 A  B N1    1 
ATOM   5879 C  C2    . A  B 1 116 ? 55.81500 56.74800 57.14900  1.000 125.46217 ? 218 A  B C2    1 
ATOM   5880 N  N3    . A  B 1 116 ? 55.46500 56.20500 55.98400  1.000 125.87800 ? 218 A  B N3    1 
ATOM   5881 C  C4    . A  B 1 116 ? 56.45100 56.34100 55.07900  1.000 126.52019 ? 218 A  B C4    1 
ATOM   5882 P  P     . A  B 1 117 ? 52.24900 53.82300 49.98300  1.000 153.77219 ? 219 A  B P     1 
ATOM   5883 O  OP1   . A  B 1 117 ? 52.93300 52.59100 49.51900  1.000 144.69479 ? 219 A  B OP1   1 
ATOM   5884 O  OP2   . A  B 1 117 ? 51.93000 54.89100 49.00100  1.000 149.04794 ? 219 A  B OP2   1 
ATOM   5885 O  "O5'" . A  B 1 117 ? 50.90000 53.38200 50.70100  1.000 138.06768 ? 219 A  B "O5'" 1 
ATOM   5886 C  "C5'" . A  B 1 117 ? 50.31400 52.11700 50.43600  1.000 130.69048 ? 219 A  B "C5'" 1 
ATOM   5887 C  "C4'" . A  B 1 117 ? 49.59700 51.58600 51.64900  1.000 129.00343 ? 219 A  B "C4'" 1 
ATOM   5888 O  "O4'" . A  B 1 117 ? 50.56400 51.19100 52.65800  1.000 134.91730 ? 219 A  B "O4'" 1 
ATOM   5889 C  "C3'" . A  B 1 117 ? 48.69300 52.57800 52.36500  1.000 132.72230 ? 219 A  B "C3'" 1 
ATOM   5890 O  "O3'" . A  B 1 117 ? 47.41800 52.69200 51.75800  1.000 132.16960 ? 219 A  B "O3'" 1 
ATOM   5891 C  "C2'" . A  B 1 117 ? 48.64700 52.02700 53.78300  1.000 128.54548 ? 219 A  B "C2'" 1 
ATOM   5892 O  "O2'" . A  B 1 117 ? 47.74300 50.93400 53.87500  1.000 133.15656 ? 219 A  B "O2'" 1 
ATOM   5893 C  "C1'" . A  B 1 117 ? 50.07300 51.49800 53.94400  1.000 124.40288 ? 219 A  B "C1'" 1 
ATOM   5894 N  N9    . A  B 1 117 ? 50.96200 52.50500 54.54900  1.000 125.14244 ? 219 A  B N9    1 
ATOM   5895 C  C8    . A  B 1 117 ? 52.07400 53.09000 53.99700  1.000 132.41963 ? 219 A  B C8    1 
ATOM   5896 N  N7    . A  B 1 117 ? 52.65800 53.95700 54.78500  1.000 131.02473 ? 219 A  B N7    1 
ATOM   5897 C  C5    . A  B 1 117 ? 51.87300 53.94200 55.93100  1.000 125.44774 ? 219 A  B C5    1 
ATOM   5898 C  C6    . A  B 1 117 ? 51.95400 54.64400 57.14700  1.000 123.27643 ? 219 A  B C6    1 
ATOM   5899 N  N6    . A  B 1 117 ? 52.90400 55.53900 57.43300  1.000 121.53938 ? 219 A  B N6    1 
ATOM   5900 N  N1    . A  B 1 117 ? 51.00900 54.39300 58.08200  1.000 122.39211 ? 219 A  B N1    1 
ATOM   5901 C  C2    . A  B 1 117 ? 50.04700 53.50100 57.81000  1.000 124.55553 ? 219 A  B C2    1 
ATOM   5902 N  N3    . A  B 1 117 ? 49.86700 52.78200 56.70500  1.000 125.41090 ? 219 A  B N3    1 
ATOM   5903 C  C4    . A  B 1 117 ? 50.82400 53.05200 55.79800  1.000 123.08957 ? 219 A  B C4    1 
ATOM   5904 P  P     . G  B 1 118 ? 46.86200 54.12400 51.28800  1.000 130.52931 ? 220 G  B P     1 
ATOM   5905 O  OP1   . G  B 1 118 ? 45.63600 53.89100 50.48800  1.000 133.61915 ? 220 G  B OP1   1 
ATOM   5906 O  OP2   . G  B 1 118 ? 47.97100 54.90500 50.68800  1.000 120.67549 ? 220 G  B OP2   1 
ATOM   5907 O  "O5'" . G  B 1 118 ? 46.42500 54.82700 52.64900  1.000 123.37845 ? 220 G  B "O5'" 1 
ATOM   5908 C  "C5'" . G  B 1 118 ? 45.48500 54.20800 53.51700  1.000 115.77490 ? 220 G  B "C5'" 1 
ATOM   5909 C  "C4'" . G  B 1 118 ? 45.61100 54.71900 54.93000  1.000 114.77215 ? 220 G  B "C4'" 1 
ATOM   5910 O  "O4'" . G  B 1 118 ? 46.90900 54.34800 55.46400  1.000 119.33849 ? 220 G  B "O4'" 1 
ATOM   5911 C  "C3'" . G  B 1 118 ? 45.55100 56.22900 55.10300  1.000 110.70324 ? 220 G  B "C3'" 1 
ATOM   5912 O  "O3'" . G  B 1 118 ? 44.22300 56.72600 55.13500  1.000 108.61352 ? 220 G  B "O3'" 1 
ATOM   5913 C  "C2'" . G  B 1 118 ? 46.32000 56.44400 56.40000  1.000 110.70851 ? 220 G  B "C2'" 1 
ATOM   5914 O  "O2'" . G  B 1 118 ? 45.51400 56.12200 57.52400  1.000 112.33239 ? 220 G  B "O2'" 1 
ATOM   5915 C  "C1'" . G  B 1 118 ? 47.41300 55.38600 56.27500  1.000 112.54557 ? 220 G  B "C1'" 1 
ATOM   5916 N  N9    . G  B 1 118 ? 48.61600 55.92500 55.61900  1.000 114.07470 ? 220 G  B N9    1 
ATOM   5917 C  C8    . G  B 1 118 ? 49.05900 55.62100 54.35500  1.000 115.74069 ? 220 G  B C8    1 
ATOM   5918 N  N7    . G  B 1 118 ? 50.15200 56.25100 54.03100  1.000 117.85673 ? 220 G  B N7    1 
ATOM   5919 C  C5    . G  B 1 118 ? 50.44500 57.01700 55.15100  1.000 113.24565 ? 220 G  B C5    1 
ATOM   5920 C  C6    . G  B 1 118 ? 51.52100 57.90800 55.38800  1.000 113.26408 ? 220 G  B C6    1 
ATOM   5921 O  O6    . G  B 1 118 ? 52.45200 58.20300 54.62700  1.000 116.49868 ? 220 G  B O6    1 
ATOM   5922 N  N1    . G  B 1 118 ? 51.44400 58.47500 56.65800  1.000 115.12746 ? 220 G  B N1    1 
ATOM   5923 C  C2    . G  B 1 118 ? 50.45700 58.21700 57.58000  1.000 110.07948 ? 220 G  B C2    1 
ATOM   5924 N  N2    . G  B 1 118 ? 50.55800 58.86700 58.75000  1.000 111.35069 ? 220 G  B N2    1 
ATOM   5925 N  N3    . G  B 1 118 ? 49.44700 57.38700 57.36900  1.000 110.63218 ? 220 G  B N3    1 
ATOM   5926 C  C4    . G  B 1 118 ? 49.50600 56.82900 56.14100  1.000 115.02745 ? 220 G  B C4    1 
ATOM   5927 P  P     . U  B 1 119 ? 43.86700 58.16300 54.50900  1.000 111.68531 ? 221 U  B P     1 
ATOM   5928 O  OP1   . U  B 1 119 ? 42.39900 58.33400 54.63200  1.000 113.83820 ? 221 U  B OP1   1 
ATOM   5929 O  OP2   . U  B 1 119 ? 44.51400 58.30600 53.18000  1.000 111.73006 ? 221 U  B OP2   1 
ATOM   5930 O  "O5'" . U  B 1 119 ? 44.55200 59.19100 55.51200  1.000 105.50826 ? 221 U  B "O5'" 1 
ATOM   5931 C  "C5'" . U  B 1 119 ? 44.15000 59.24400 56.87300  1.000 108.28227 ? 221 U  B "C5'" 1 
ATOM   5932 C  "C4'" . U  B 1 119 ? 45.11900 60.04300 57.70500  1.000 98.80482  ? 221 U  B "C4'" 1 
ATOM   5933 O  "O4'" . U  B 1 119 ? 46.43800 59.44000 57.63900  1.000 101.12352 ? 221 U  B "O4'" 1 
ATOM   5934 C  "C3'" . U  B 1 119 ? 45.35000 61.47500 57.25500  1.000 97.55467  ? 221 U  B "C3'" 1 
ATOM   5935 O  "O3'" . U  B 1 119 ? 44.32700 62.35900 57.67400  1.000 100.40238 ? 221 U  B "O3'" 1 
ATOM   5936 C  "C2'" . U  B 1 119 ? 46.71400 61.78900 57.84700  1.000 97.14410  ? 221 U  B "C2'" 1 
ATOM   5937 O  "O2'" . U  B 1 119 ? 46.60800 62.06300 59.23800  1.000 101.62621 ? 221 U  B "O2'" 1 
ATOM   5938 C  "C1'" . U  B 1 119 ? 47.42900 60.44900 57.67000  1.000 103.89491 ? 221 U  B "C1'" 1 
ATOM   5939 N  N1    . U  B 1 119 ? 48.21200 60.39000 56.41300  1.000 110.57729 ? 221 U  B N1    1 
ATOM   5940 C  C2    . U  B 1 119 ? 49.39100 61.10700 56.36000  1.000 108.77707 ? 221 U  B C2    1 
ATOM   5941 O  O2    . U  B 1 119 ? 49.80000 61.77400 57.29000  1.000 106.35309 ? 221 U  B O2    1 
ATOM   5942 N  N3    . U  B 1 119 ? 50.07800 61.01200 55.17900  1.000 108.55599 ? 221 U  B N3    1 
ATOM   5943 C  C4    . U  B 1 119 ? 49.71400 60.28900 54.06300  1.000 108.29806 ? 221 U  B C4    1 
ATOM   5944 O  O4    . U  B 1 119 ? 50.44400 60.30900 53.06900  1.000 111.83270 ? 221 U  B O4    1 
ATOM   5945 C  C5    . U  B 1 119 ? 48.48000 59.57400 54.19500  1.000 103.72646 ? 221 U  B C5    1 
ATOM   5946 C  C6    . U  B 1 119 ? 47.78900 59.64800 55.33600  1.000 105.72144 ? 221 U  B C6    1 
ATOM   5947 P  P     . C  B 1 120 ? 43.70200 63.41100 56.63600  1.000 106.45005 ? 222 C  B P     1 
ATOM   5948 O  OP1   . C  B 1 120 ? 42.37400 63.84200 57.14100  1.000 99.53869  ? 222 C  B OP1   1 
ATOM   5949 O  OP2   . C  B 1 120 ? 43.82300 62.83300 55.27400  1.000 99.85979  ? 222 C  B OP2   1 
ATOM   5950 O  "O5'" . C  B 1 120 ? 44.68500 64.65900 56.72700  1.000 100.05191 ? 222 C  B "O5'" 1 
ATOM   5951 C  "C5'" . C  B 1 120 ? 44.92500 65.30700 57.96700  1.000 94.68811  ? 222 C  B "C5'" 1 
ATOM   5952 C  "C4'" . C  B 1 120 ? 46.29700 65.92700 58.00200  1.000 99.24919  ? 222 C  B "C4'" 1 
ATOM   5953 O  "O4'" . C  B 1 120 ? 47.29300 64.90900 57.73600  1.000 97.99114  ? 222 C  B "O4'" 1 
ATOM   5954 C  "C3'" . C  B 1 120 ? 46.56400 66.98800 56.95000  1.000 98.93599  ? 222 C  B "C3'" 1 
ATOM   5955 O  "O3'" . C  B 1 120 ? 46.05200 68.25400 57.31600  1.000 98.28591  ? 222 C  B "O3'" 1 
ATOM   5956 C  "C2'" . C  B 1 120 ? 48.07900 66.95100 56.81200  1.000 97.01997  ? 222 C  B "C2'" 1 
ATOM   5957 O  "O2'" . C  B 1 120 ? 48.69600 67.66700 57.87000  1.000 98.16221  ? 222 C  B "O2'" 1 
ATOM   5958 C  "C1'" . C  B 1 120 ? 48.36800 65.46200 57.00700  1.000 96.39358  ? 222 C  B "C1'" 1 
ATOM   5959 N  N1    . C  B 1 120 ? 48.49000 64.74000 55.72200  1.000 95.82246  ? 222 C  B N1    1 
ATOM   5960 C  C2    . C  B 1 120 ? 49.70200 64.81800 55.03500  1.000 99.74398  ? 222 C  B C2    1 
ATOM   5961 O  O2    . C  B 1 120 ? 50.61700 65.48900 55.53000  1.000 99.60712  ? 222 C  B O2    1 
ATOM   5962 N  N3    . C  B 1 120 ? 49.85000 64.16600 53.85700  1.000 105.17358 ? 222 C  B N3    1 
ATOM   5963 C  C4    . C  B 1 120 ? 48.83800 63.45500 53.36100  1.000 105.40256 ? 222 C  B C4    1 
ATOM   5964 N  N4    . C  B 1 120 ? 49.02100 62.82900 52.19700  1.000 104.30769 ? 222 C  B N4    1 
ATOM   5965 C  C5    . C  B 1 120 ? 47.59000 63.35300 54.04000  1.000 108.53188 ? 222 C  B C5    1 
ATOM   5966 C  C6    . C  B 1 120 ? 47.46100 64.00200 55.20600  1.000 104.67352 ? 222 C  B C6    1 
ATOM   5967 P  P     . C  B 1 121 ? 45.68500 69.32700 56.18400  1.000 105.73483 ? 223 C  B P     1 
ATOM   5968 O  OP1   . C  B 1 121 ? 45.04300 70.47000 56.87700  1.000 100.25786 ? 223 C  B OP1   1 
ATOM   5969 O  OP2   . C  B 1 121 ? 44.99000 68.63400 55.06700  1.000 93.77813  ? 223 C  B OP2   1 
ATOM   5970 O  "O5'" . C  B 1 121 ? 47.10400 69.81100 55.64800  1.000 103.05556 ? 223 C  B "O5'" 1 
ATOM   5971 C  "C5'" . C  B 1 121 ? 47.99600 70.51900 56.49500  1.000 103.06082 ? 223 C  B "C5'" 1 
ATOM   5972 C  "C4'" . C  B 1 121 ? 49.26100 70.89900 55.76900  1.000 101.21850 ? 223 C  B "C4'" 1 
ATOM   5973 O  "O4'" . C  B 1 121 ? 50.02800 69.70900 55.45600  1.000 104.39256 ? 223 C  B "O4'" 1 
ATOM   5974 C  "C3'" . C  B 1 121 ? 49.07900 71.58000 54.42400  1.000 100.47893 ? 223 C  B "C3'" 1 
ATOM   5975 O  "O3'" . C  B 1 121 ? 48.78700 72.95900 54.54300  1.000 105.33215 ? 223 C  B "O3'" 1 
ATOM   5976 C  "C2'" . C  B 1 121 ? 50.40300 71.29900 53.73000  1.000 94.83615  ? 223 C  B "C2'" 1 
ATOM   5977 O  "O2'" . C  B 1 121 ? 51.40800 72.18700 54.19500  1.000 102.25020 ? 223 C  B "O2'" 1 
ATOM   5978 C  "C1'" . C  B 1 121 ? 50.72100 69.89200 54.24000  1.000 92.89908  ? 223 C  B "C1'" 1 
ATOM   5979 N  N1    . C  B 1 121 ? 50.28500 68.84600 53.29100  1.000 89.33813  ? 223 C  B N1    1 
ATOM   5980 C  C2    . C  B 1 121 ? 51.07400 68.61500 52.16500  1.000 98.17866  ? 223 C  B C2    1 
ATOM   5981 O  O2    . C  B 1 121 ? 52.10200 69.28700 52.00100  1.000 103.98199 ? 223 C  B O2    1 
ATOM   5982 N  N3    . C  B 1 121 ? 50.70000 67.66500 51.28300  1.000 98.94191  ? 223 C  B N3    1 
ATOM   5983 C  C4    . C  B 1 121 ? 49.58800 66.96500 51.50000  1.000 99.08666  ? 223 C  B C4    1 
ATOM   5984 N  N4    . C  B 1 121 ? 49.25700 66.03700 50.60500  1.000 106.82970 ? 223 C  B N4    1 
ATOM   5985 C  C5    . C  B 1 121 ? 48.76300 67.17400 52.64200  1.000 100.09468 ? 223 C  B C5    1 
ATOM   5986 C  C6    . C  B 1 121 ? 49.14800 68.11800 53.50900  1.000 98.32604  ? 223 C  B C6    1 
ATOM   5987 P  P     . U  B 1 122 ? 47.72400 73.64000 53.55500  1.000 106.58290 ? 224 U  B P     1 
ATOM   5988 O  OP1   . U  B 1 122 ? 47.47600 75.01100 54.06100  1.000 103.78783 ? 224 U  B OP1   1 
ATOM   5989 O  OP2   . U  B 1 122 ? 46.59700 72.69300 53.37200  1.000 94.26037  ? 224 U  B OP2   1 
ATOM   5990 O  "O5'" . U  B 1 122 ? 48.50200 73.73700 52.16900  1.000 96.68435  ? 224 U  B "O5'" 1 
ATOM   5991 C  "C5'" . U  B 1 122 ? 49.74000 74.42700 52.07400  1.000 102.45083 ? 224 U  B "C5'" 1 
ATOM   5992 C  "C4'" . U  B 1 122 ? 50.50100 74.05700 50.82200  1.000 101.59020 ? 224 U  B "C4'" 1 
ATOM   5993 O  "O4'" . U  B 1 122 ? 50.84000 72.64800 50.83600  1.000 102.29028 ? 224 U  B "O4'" 1 
ATOM   5994 C  "C3'" . U  B 1 122 ? 49.77000 74.23700 49.50600  1.000 106.23023 ? 224 U  B "C3'" 1 
ATOM   5995 O  "O3'" . U  B 1 122 ? 49.74400 75.58500 49.07700  1.000 112.14673 ? 224 U  B "O3'" 1 
ATOM   5996 C  "C2'" . U  B 1 122 ? 50.54600 73.31300 48.57400  1.000 104.09050 ? 224 U  B "C2'" 1 
ATOM   5997 O  "O2'" . U  B 1 122 ? 51.75600 73.92200 48.15600  1.000 98.96620  ? 224 U  B "O2'" 1 
ATOM   5998 C  "C1'" . U  B 1 122 ? 50.89200 72.15700 49.51200  1.000 98.49509  ? 224 U  B "C1'" 1 
ATOM   5999 N  N1    . U  B 1 122 ? 49.95100 71.02700 49.36500  1.000 91.87061  ? 224 U  B N1    1 
ATOM   6000 C  C2    . U  B 1 122 ? 50.15900 70.18500 48.29100  1.000 102.36134 ? 224 U  B C2    1 
ATOM   6001 O  O2    . U  B 1 122 ? 51.06800 70.33900 47.49500  1.000 106.63027 ? 224 U  B O2    1 
ATOM   6002 N  N3    . U  B 1 122 ? 49.26700 69.15100 48.18400  1.000 100.86906 ? 224 U  B N3    1 
ATOM   6003 C  C4    . U  B 1 122 ? 48.20900 68.88500 49.02600  1.000 93.84190  ? 224 U  B C4    1 
ATOM   6004 O  O4    . U  B 1 122 ? 47.49400 67.90900 48.79300  1.000 92.65755  ? 224 U  B O4    1 
ATOM   6005 C  C5    . U  B 1 122 ? 48.05800 69.80600 50.11300  1.000 94.04719  ? 224 U  B C5    1 
ATOM   6006 C  C6    . U  B 1 122 ? 48.91400 70.82300 50.23900  1.000 92.28382  ? 224 U  B C6    1 
ATOM   6007 P  P     . A  B 1 123 ? 48.40600 76.20900 48.44600  1.000 106.25355 ? 225 A  B P     1 
ATOM   6008 O  OP1   . A  B 1 123 ? 48.63100 77.66800 48.28300  1.000 111.04886 ? 225 A  B OP1   1 
ATOM   6009 O  OP2   . A  B 1 123 ? 47.25200 75.72300 49.24700  1.000 104.98761 ? 225 A  B OP2   1 
ATOM   6010 O  "O5'" . A  B 1 123 ? 48.31700 75.54300 47.00100  1.000 103.99801 ? 225 A  B "O5'" 1 
ATOM   6011 C  "C5'" . A  B 1 123 ? 49.45000 75.51300 46.13900  1.000 109.25917 ? 225 A  B "C5'" 1 
ATOM   6012 C  "C4'" . A  B 1 123 ? 49.11600 74.93900 44.78300  1.000 111.11202 ? 225 A  B "C4'" 1 
ATOM   6013 O  "O4'" . A  B 1 123 ? 48.96900 73.49600 44.88200  1.000 102.59258 ? 225 A  B "O4'" 1 
ATOM   6014 C  "C3'" . A  B 1 123 ? 47.83100 75.46500 44.14400  1.000 115.92313 ? 225 A  B "C3'" 1 
ATOM   6015 O  "O3'" . A  B 1 123 ? 48.03400 75.65500 42.74600  1.000 121.97648 ? 225 A  B "O3'" 1 
ATOM   6016 C  "C2'" . A  B 1 123 ? 46.83400 74.33200 44.37900  1.000 111.29626 ? 225 A  B "C2'" 1 
ATOM   6017 O  "O2'" . A  B 1 123 ? 45.79000 74.26500 43.42900  1.000 118.99455 ? 225 A  B "O2'" 1 
ATOM   6018 C  "C1'" . A  B 1 123 ? 47.73400 73.10200 44.31400  1.000 104.73494 ? 225 A  B "C1'" 1 
ATOM   6019 N  N9    . A  B 1 123 ? 47.22800 71.94800 45.06500  1.000 100.92659 ? 225 A  B N9    1 
ATOM   6020 C  C8    . A  B 1 123 ? 46.74800 71.92900 46.34900  1.000 106.35619 ? 225 A  B C8    1 
ATOM   6021 N  N7    . A  B 1 123 ? 46.35900 70.74600 46.75900  1.000 103.27951 ? 225 A  B N7    1 
ATOM   6022 C  C5    . A  B 1 123 ? 46.59600 69.92500 45.66700  1.000 101.53456 ? 225 A  B C5    1 
ATOM   6023 C  C6    . A  B 1 123 ? 46.39700 68.55100 45.45000  1.000 102.71891 ? 225 A  B C6    1 
ATOM   6024 N  N6    . A  B 1 123 ? 45.89600 67.72300 46.36500  1.000 102.17674 ? 225 A  B N6    1 
ATOM   6025 N  N1    . A  B 1 123 ? 46.73700 68.04700 44.24500  1.000 104.69546 ? 225 A  B N1    1 
ATOM   6026 C  C2    . A  B 1 123 ? 47.24500 68.87700 43.32500  1.000 109.34602 ? 225 A  B C2    1 
ATOM   6027 N  N3    . A  B 1 123 ? 47.47800 70.18600 43.40700  1.000 110.61460 ? 225 A  B N3    1 
ATOM   6028 C  C4    . A  B 1 123 ? 47.12900 70.65200 44.61800  1.000 103.40584 ? 225 A  B C4    1 
ATOM   6029 P  P     . A  B 1 124 ? 48.21600 77.14600 42.17900  1.000 120.35907 ? 226 A  B P     1 
ATOM   6030 O  OP1   . A  B 1 124 ? 49.05000 77.90100 43.14700  1.000 111.11059 ? 226 A  B OP1   1 
ATOM   6031 O  OP2   . A  B 1 124 ? 46.86400 77.65700 41.83800  1.000 127.86524 ? 226 A  B OP2   1 
ATOM   6032 O  "O5'" . A  B 1 124 ? 49.07000 76.96300 40.84600  1.000 117.58769 ? 226 A  B "O5'" 1 
ATOM   6033 C  "C5'" . A  B 1 124 ? 50.24200 77.73700 40.62100  1.000 118.77994 ? 226 A  B "C5'" 1 
ATOM   6034 C  "C4'" . A  B 1 124 ? 51.27600 76.97300 39.83100  1.000 122.00137 ? 226 A  B "C4'" 1 
ATOM   6035 O  "O4'" . A  B 1 124 ? 51.80600 75.88700 40.63400  1.000 116.45334 ? 226 A  B "O4'" 1 
ATOM   6036 C  "C3'" . A  B 1 124 ? 50.78000 76.29900 38.56200  1.000 124.86751 ? 226 A  B "C3'" 1 
ATOM   6037 O  "O3'" . A  B 1 124 ? 50.73800 77.19400 37.46400  1.000 124.50431 ? 226 A  B "O3'" 1 
ATOM   6038 C  "C2'" . A  B 1 124 ? 51.76700 75.15200 38.37500  1.000 121.19601 ? 226 A  B "C2'" 1 
ATOM   6039 O  "O2'" . A  B 1 124 ? 52.97200 75.61000 37.78100  1.000 118.15091 ? 226 A  B "O2'" 1 
ATOM   6040 C  "C1'" . A  B 1 124 ? 52.06100 74.76300 39.82300  1.000 116.09540 ? 226 A  B "C1'" 1 
ATOM   6041 N  N9    . A  B 1 124 ? 51.19500 73.66600 40.28000  1.000 114.68471 ? 226 A  B N9    1 
ATOM   6042 C  C8    . A  B 1 124 ? 50.19100 73.72400 41.21300  1.000 111.97912 ? 226 A  B C8    1 
ATOM   6043 N  N7    . A  B 1 124 ? 49.58900 72.57800 41.40700  1.000 110.54211 ? 226 A  B N7    1 
ATOM   6044 C  C5    . A  B 1 124 ? 50.24100 71.71200 40.54200  1.000 108.19972 ? 226 A  B C5    1 
ATOM   6045 C  C6    . A  B 1 124 ? 50.07400 70.34300 40.26800  1.000 104.41242 ? 226 A  B C6    1 
ATOM   6046 N  N6    . A  B 1 124 ? 49.16000 69.57800 40.86700  1.000 99.99874  ? 226 A  B N6    1 
ATOM   6047 N  N1    . A  B 1 124 ? 50.88700 69.77900 39.34600  1.000 104.80721 ? 226 A  B N1    1 
ATOM   6048 C  C2    . A  B 1 124 ? 51.80700 70.54700 38.74500  1.000 111.62118 ? 226 A  B C2    1 
ATOM   6049 N  N3    . A  B 1 124 ? 52.05800 71.84400 38.91800  1.000 112.59762 ? 226 A  B N3    1 
ATOM   6050 C  C4    . A  B 1 124 ? 51.23300 72.37000 39.84000  1.000 111.52643 ? 226 A  B C4    1 
ATOM   6051 P  P     . G  B 1 125 ? 49.38200 77.40700 36.62800  1.000 128.04078 ? 227 G  B P     1 
ATOM   6052 O  OP1   . G  B 1 125 ? 49.70800 78.34800 35.52500  1.000 133.71251 ? 227 G  B OP1   1 
ATOM   6053 O  OP2   . G  B 1 125 ? 48.26800 77.71300 37.56600  1.000 112.40470 ? 227 G  B OP2   1 
ATOM   6054 O  "O5'" . G  B 1 125 ? 49.08700 75.97700 35.99500  1.000 124.23243 ? 227 G  B "O5'" 1 
ATOM   6055 C  "C5'" . G  B 1 125 ? 49.96700 75.38800 35.05100  1.000 123.37706 ? 227 G  B "C5'" 1 
ATOM   6056 C  "C4'" . G  B 1 125 ? 49.69100 73.91400 34.91600  1.000 120.46356 ? 227 G  B "C4'" 1 
ATOM   6057 O  "O4'" . G  B 1 125 ? 49.97400 73.25800 36.18000  1.000 120.03719 ? 227 G  B "O4'" 1 
ATOM   6058 C  "C3'" . G  B 1 125 ? 48.24700 73.53600 34.62100  1.000 122.33220 ? 227 G  B "C3'" 1 
ATOM   6059 O  "O3'" . G  B 1 125 ? 47.90200 73.65400 33.25000  1.000 132.15970 ? 227 G  B "O3'" 1 
ATOM   6060 C  "C2'" . G  B 1 125 ? 48.16100 72.11400 35.15800  1.000 119.26341 ? 227 G  B "C2'" 1 
ATOM   6061 O  "O2'" . G  B 1 125 ? 48.75600 71.20300 34.24700  1.000 122.28220 ? 227 G  B "O2'" 1 
ATOM   6062 C  "C1'" . G  B 1 125 ? 49.05700 72.20600 36.39500  1.000 116.23147 ? 227 G  B "C1'" 1 
ATOM   6063 N  N9    . G  B 1 125 ? 48.29500 72.49100 37.62900  1.000 114.40494 ? 227 G  B N9    1 
ATOM   6064 C  C8    . G  B 1 125 ? 48.26300 73.67600 38.32700  1.000 113.28901 ? 227 G  B C8    1 
ATOM   6065 N  N7    . G  B 1 125 ? 47.50200 73.63700 39.38900  1.000 111.48617 ? 227 G  B N7    1 
ATOM   6066 C  C5    . G  B 1 125 ? 46.99900 72.34600 39.40500  1.000 107.29619 ? 227 G  B C5    1 
ATOM   6067 C  C6    . G  B 1 125 ? 46.11900 71.71900 40.32700  1.000 108.36737 ? 227 G  B C6    1 
ATOM   6068 O  O6    . G  B 1 125 ? 45.58900 72.19500 41.34000  1.000 105.38017 ? 227 G  B O6    1 
ATOM   6069 N  N1    . G  B 1 125 ? 45.86900 70.39800 39.96800  1.000 107.46463 ? 227 G  B N1    1 
ATOM   6070 C  C2    . G  B 1 125 ? 46.39700 69.76000 38.87100  1.000 107.09617 ? 227 G  B C2    1 
ATOM   6071 N  N2    . G  B 1 125 ? 46.03600 68.47900 38.69400  1.000 107.46726 ? 227 G  B N2    1 
ATOM   6072 N  N3    . G  B 1 125 ? 47.21800 70.33700 38.00600  1.000 106.34871 ? 227 G  B N3    1 
ATOM   6073 C  C4    . G  B 1 125 ? 47.48000 71.62300 38.32900  1.000 108.41474 ? 227 G  B C4    1 
ATOM   6074 P  P     . U  B 1 126 ? 46.45500 74.21900 32.83600  1.000 126.85616 ? 228 U  B P     1 
ATOM   6075 O  OP1   . U  B 1 126 ? 46.42400 74.41500 31.36700  1.000 128.83535 ? 228 U  B OP1   1 
ATOM   6076 O  OP2   . U  B 1 126 ? 46.14000 75.36900 33.72100  1.000 129.42752 ? 228 U  B OP2   1 
ATOM   6077 O  "O5'" . U  B 1 126 ? 45.45900 73.02900 33.20000  1.000 117.00498 ? 228 U  B "O5'" 1 
ATOM   6078 C  "C5'" . U  B 1 126 ? 45.53100 71.78200 32.52200  1.000 120.49487 ? 228 U  B "C5'" 1 
ATOM   6079 C  "C4'" . U  B 1 126 ? 44.71000 70.72200 33.21800  1.000 121.89767 ? 228 U  B "C4'" 1 
ATOM   6080 O  "O4'" . U  B 1 126 ? 45.20400 70.52100 34.56900  1.000 123.97950 ? 228 U  B "O4'" 1 
ATOM   6081 C  "C3'" . U  B 1 126 ? 43.23400 71.03300 33.41200  1.000 120.73174 ? 228 U  B "C3'" 1 
ATOM   6082 O  "O3'" . U  B 1 126 ? 42.45600 70.81300 32.25000  1.000 122.45037 ? 228 U  B "O3'" 1 
ATOM   6083 C  "C2'" . U  B 1 126 ? 42.85700 70.13400 34.58300  1.000 116.38385 ? 228 U  B "C2'" 1 
ATOM   6084 O  "O2'" . U  B 1 126 ? 42.66200 68.79500 34.14600  1.000 116.12330 ? 228 U  B "O2'" 1 
ATOM   6085 C  "C1'" . U  B 1 126 ? 44.13100 70.19500 35.43100  1.000 114.35729 ? 228 U  B "C1'" 1 
ATOM   6086 N  N1    . U  B 1 126 ? 44.05000 71.21500 36.50900  1.000 111.86226 ? 228 U  B N1    1 
ATOM   6087 C  C2    . U  B 1 126 ? 43.39600 70.88300 37.68500  1.000 115.47585 ? 228 U  B C2    1 
ATOM   6088 O  O2    . U  B 1 126 ? 42.87900 69.79700 37.87600  1.000 118.38146 ? 228 U  B O2    1 
ATOM   6089 N  N3    . U  B 1 126 ? 43.36400 71.87100 38.64100  1.000 112.93870 ? 228 U  B N3    1 
ATOM   6090 C  C4    . U  B 1 126 ? 43.90500 73.13800 38.55000  1.000 112.27020 ? 228 U  B C4    1 
ATOM   6091 O  O4    . U  B 1 126 ? 43.79100 73.92200 39.49600  1.000 118.15512 ? 228 U  B O4    1 
ATOM   6092 C  C5    . U  B 1 126 ? 44.56500 73.40700 37.30900  1.000 110.01204 ? 228 U  B C5    1 
ATOM   6093 C  C6    . U  B 1 126 ? 44.61100 72.46300 36.36100  1.000 114.22307 ? 228 U  B C6    1 
ATOM   6094 P  P     . C  B 1 127 ? 41.24400 71.80500 31.90800  1.000 133.73204 ? 229 C  B P     1 
ATOM   6095 O  OP1   . C  B 1 127 ? 40.87700 71.61600 30.48400  1.000 129.15517 ? 229 C  B OP1   1 
ATOM   6096 O  OP2   . C  B 1 127 ? 41.63200 73.14800 32.40200  1.000 120.99630 ? 229 C  B OP2   1 
ATOM   6097 O  "O5'" . C  B 1 127 ? 40.05100 71.28100 32.82500  1.000 122.52017 ? 229 C  B "O5'" 1 
ATOM   6098 C  "C5'" . C  B 1 127 ? 39.52600 69.97100 32.66200  1.000 122.28856 ? 229 C  B "C5'" 1 
ATOM   6099 C  "C4'" . C  B 1 127 ? 38.61800 69.59000 33.80400  1.000 121.35950 ? 229 C  B "C4'" 1 
ATOM   6100 O  "O4'" . C  B 1 127 ? 39.38000 69.52800 35.03700  1.000 117.38271 ? 229 C  B "O4'" 1 
ATOM   6101 C  "C3'" . C  B 1 127 ? 37.50100 70.56900 34.11600  1.000 131.13173 ? 229 C  B "C3'" 1 
ATOM   6102 O  "O3'" . C  B 1 127 ? 36.39500 70.44400 33.24200  1.000 134.29000 ? 229 C  B "O3'" 1 
ATOM   6103 C  "C2'" . C  B 1 127 ? 37.18100 70.25600 35.57100  1.000 128.16821 ? 229 C  B "C2'" 1 
ATOM   6104 O  "O2'" . C  B 1 127 ? 36.38100 69.08500 35.66900  1.000 134.18472 ? 229 C  B "O2'" 1 
ATOM   6105 C  "C1'" . C  B 1 127 ? 38.57500 69.94500 36.12200  1.000 116.80896 ? 229 C  B "C1'" 1 
ATOM   6106 N  N1    . C  B 1 127 ? 39.20300 71.13000 36.75400  1.000 116.15888 ? 229 C  B N1    1 
ATOM   6107 C  C2    . C  B 1 127 ? 38.83600 71.47000 38.05900  1.000 116.34048 ? 229 C  B C2    1 
ATOM   6108 O  O2    . C  B 1 127 ? 37.99700 70.77100 38.64500  1.000 113.49014 ? 229 C  B O2    1 
ATOM   6109 N  N3    . C  B 1 127 ? 39.40300 72.54800 38.64800  1.000 114.72713 ? 229 C  B N3    1 
ATOM   6110 C  C4    . C  B 1 127 ? 40.30300 73.27500 37.98100  1.000 118.08016 ? 229 C  B C4    1 
ATOM   6111 N  N4    . C  B 1 127 ? 40.84000 74.33200 38.59700  1.000 122.02537 ? 229 C  B N4    1 
ATOM   6112 C  C5    . C  B 1 127 ? 40.69600 72.95400 36.65000  1.000 120.26726 ? 229 C  B C5    1 
ATOM   6113 C  C6    . C  B 1 127 ? 40.12800 71.88200 36.08300  1.000 119.77247 ? 229 C  B C6    1 
ATOM   6114 P  P     . A  B 1 128 ? 35.53700 71.74100 32.84500  1.000 127.72930 ? 230 A  B P     1 
ATOM   6115 O  OP1   . A  B 1 128 ? 34.60900 71.33700 31.76100  1.000 133.38524 ? 230 A  B OP1   1 
ATOM   6116 O  OP2   . A  B 1 128 ? 36.47200 72.87100 32.61600  1.000 111.81423 ? 230 A  B OP2   1 
ATOM   6117 O  "O5'" . A  B 1 128 ? 34.68500 72.05100 34.15700  1.000 124.68156 ? 230 A  B "O5'" 1 
ATOM   6118 C  "C5'" . A  B 1 128 ? 33.77700 71.08900 34.67300  1.000 128.99261 ? 230 A  B "C5'" 1 
ATOM   6119 C  "C4'" . A  B 1 128 ? 33.32800 71.42800 36.07200  1.000 141.72835 ? 230 A  B "C4'" 1 
ATOM   6120 O  "O4'" . A  B 1 128 ? 34.46700 71.49100 36.96600  1.000 132.01139 ? 230 A  B "O4'" 1 
ATOM   6121 C  "C3'" . A  B 1 128 ? 32.65000 72.77500 36.25300  1.000 148.18965 ? 230 A  B "C3'" 1 
ATOM   6122 O  "O3'" . A  B 1 128 ? 31.29500 72.75900 35.84100  1.000 151.14526 ? 230 A  B "O3'" 1 
ATOM   6123 C  "C2'" . A  B 1 128 ? 32.83700 73.04400 37.74100  1.000 141.19407 ? 230 A  B "C2'" 1 
ATOM   6124 O  "O2'" . A  B 1 128 ? 31.88000 72.32900 38.50900  1.000 136.19610 ? 230 A  B "O2'" 1 
ATOM   6125 C  "C1'" . A  B 1 128 ? 34.21800 72.43100 37.99300  1.000 134.31167 ? 230 A  B "C1'" 1 
ATOM   6126 N  N9    . A  B 1 128 ? 35.29000 73.44500 37.99300  1.000 130.77177 ? 230 A  B N9    1 
ATOM   6127 C  C8    . A  B 1 128 ? 36.18600 73.74400 36.99700  1.000 127.97406 ? 230 A  B C8    1 
ATOM   6128 N  N7    . A  B 1 128 ? 37.02400 74.70500 37.31000  1.000 127.22924 ? 230 A  B N7    1 
ATOM   6129 C  C5    . A  B 1 128 ? 36.65600 75.06400 38.60000  1.000 128.30042 ? 230 A  B C5    1 
ATOM   6130 C  C6    . A  B 1 128 ? 37.15400 76.02700 39.49900  1.000 126.64759 ? 230 A  B C6    1 
ATOM   6131 N  N6    . A  B 1 128 ? 38.17600 76.84400 39.23000  1.000 127.89774 ? 230 A  B N6    1 
ATOM   6132 N  N1    . A  B 1 128 ? 36.55700 76.12600 40.70700  1.000 128.49255 ? 230 A  B N1    1 
ATOM   6133 C  C2    . A  B 1 128 ? 35.53300 75.31100 40.98300  1.000 131.30604 ? 230 A  B C2    1 
ATOM   6134 N  N3    . A  B 1 128 ? 34.97700 74.37100 40.22400  1.000 127.14239 ? 230 A  B N3    1 
ATOM   6135 C  C4    . A  B 1 128 ? 35.59000 74.29600 39.03100  1.000 126.68970 ? 230 A  B C4    1 
ATOM   6136 P  P     . A  B 1 129 ? 30.59700 74.10200 35.30800  1.000 148.93393 ? 231 A  B P     1 
ATOM   6137 O  OP1   . A  B 1 129 ? 29.29500 73.71900 34.70600  1.000 151.47371 ? 231 A  B OP1   1 
ATOM   6138 O  OP2   . A  B 1 129 ? 31.59100 74.85200 34.49900  1.000 146.64155 ? 231 A  B OP2   1 
ATOM   6139 O  "O5'" . A  B 1 129 ? 30.30800 74.93500 36.63600  1.000 147.65747 ? 231 A  B "O5'" 1 
ATOM   6140 C  "C5'" . A  B 1 129 ? 29.44400 74.42600 37.64300  1.000 146.79157 ? 231 A  B "C5'" 1 
ATOM   6141 C  "C4'" . A  B 1 129 ? 29.46100 75.28900 38.87900  1.000 148.97341 ? 231 A  B "C4'" 1 
ATOM   6142 O  "O4'" . A  B 1 129 ? 30.74400 75.16900 39.55000  1.000 146.97054 ? 231 A  B "O4'" 1 
ATOM   6143 C  "C3'" . A  B 1 129 ? 29.30800 76.78400 38.64700  1.000 154.83464 ? 231 A  B "C3'" 1 
ATOM   6144 O  "O3'" . A  B 1 129 ? 27.96400 77.18000 38.43600  1.000 161.70126 ? 231 A  B "O3'" 1 
ATOM   6145 C  "C2'" . A  B 1 129 ? 29.94100 77.37600 39.89900  1.000 149.94195 ? 231 A  B "C2'" 1 
ATOM   6146 O  "O2'" . A  B 1 129 ? 29.05500 77.28000 41.00500  1.000 150.28936 ? 231 A  B "O2'" 1 
ATOM   6147 C  "C1'" . A  B 1 129 ? 31.10500 76.41000 40.12300  1.000 144.82555 ? 231 A  B "C1'" 1 
ATOM   6148 N  N9    . A  B 1 129 ? 32.33500 76.88900 39.46600  1.000 137.89840 ? 231 A  B N9    1 
ATOM   6149 C  C8    . A  B 1 129 ? 32.84300 76.50900 38.25200  1.000 141.06457 ? 231 A  B C8    1 
ATOM   6150 N  N7    . A  B 1 129 ? 33.95400 77.11900 37.92700  1.000 141.21722 ? 231 A  B N7    1 
ATOM   6151 C  C5    . A  B 1 129 ? 34.18900 77.96500 39.00000  1.000 140.97772 ? 231 A  B C5    1 
ATOM   6152 C  C6    . A  B 1 129 ? 35.21800 78.88600 39.27100  1.000 143.19904 ? 231 A  B C6    1 
ATOM   6153 N  N6    . A  B 1 129 ? 36.24200 79.12100 38.44600  1.000 141.71465 ? 231 A  B N6    1 
ATOM   6154 N  N1    . A  B 1 129 ? 35.16100 79.57100 40.43500  1.000 141.81992 ? 231 A  B N1    1 
ATOM   6155 C  C2    . A  B 1 129 ? 34.13400 79.33800 41.26400  1.000 138.79061 ? 231 A  B C2    1 
ATOM   6156 N  N3    . A  B 1 129 ? 33.11000 78.49700 41.11700  1.000 139.12750 ? 231 A  B N3    1 
ATOM   6157 C  C4    . A  B 1 129 ? 33.19800 77.83600 39.95300  1.000 138.50900 ? 231 A  B C4    1 
ATOM   6158 P  P     . C  B 1 130 ? 27.61300 78.28700 37.32400  1.000 166.39212 ? 232 C  B P     1 
ATOM   6159 O  OP1   . C  B 1 130 ? 26.13500 78.31700 37.16800  1.000 152.51940 ? 232 C  B OP1   1 
ATOM   6160 O  OP2   . C  B 1 130 ? 28.46200 78.03100 36.13300  1.000 159.68868 ? 232 C  B OP2   1 
ATOM   6161 O  "O5'" . C  B 1 130 ? 28.08900 79.65900 37.98400  1.000 161.61260 ? 232 C  B "O5'" 1 
ATOM   6162 C  "C5'" . C  B 1 130 ? 27.50300 80.12800 39.18900  1.000 162.12055 ? 232 C  B "C5'" 1 
ATOM   6163 C  "C4'" . C  B 1 130 ? 28.34200 81.18900 39.86000  1.000 157.97006 ? 232 C  B "C4'" 1 
ATOM   6164 O  "O4'" . C  B 1 130 ? 29.65000 80.65700 40.19900  1.000 148.38996 ? 232 C  B "O4'" 1 
ATOM   6165 C  "C3'" . C  B 1 130 ? 28.66500 82.42600 39.04100  1.000 164.86825 ? 232 C  B "C3'" 1 
ATOM   6166 O  "O3'" . C  B 1 130 ? 27.59300 83.34300 38.94000  1.000 171.06110 ? 232 C  B "O3'" 1 
ATOM   6167 C  "C2'" . C  B 1 130 ? 29.88200 82.98200 39.76600  1.000 158.64908 ? 232 C  B "C2'" 1 
ATOM   6168 O  "O2'" . C  B 1 130 ? 29.49600 83.64400 40.96200  1.000 159.05966 ? 232 C  B "O2'" 1 
ATOM   6169 C  "C1'" . C  B 1 130 ? 30.61500 81.69100 40.13700  1.000 149.89014 ? 232 C  B "C1'" 1 
ATOM   6170 N  N1    . C  B 1 130 ? 31.64000 81.35000 39.12300  1.000 145.86860 ? 232 C  B N1    1 
ATOM   6171 C  C2    . C  B 1 130 ? 32.87400 82.01200 39.19000  1.000 146.10811 ? 232 C  B C2    1 
ATOM   6172 O  O2    . C  B 1 130 ? 33.07000 82.83400 40.09800  1.000 144.16840 ? 232 C  B O2    1 
ATOM   6173 N  N3    . C  B 1 130 ? 33.82900 81.73900 38.27300  1.000 147.25825 ? 232 C  B N3    1 
ATOM   6174 C  C4    . C  B 1 130 ? 33.58900 80.84700 37.31100  1.000 148.08992 ? 232 C  B C4    1 
ATOM   6175 N  N4    . C  B 1 130 ? 34.56600 80.60900 36.43100  1.000 145.81860 ? 232 C  B N4    1 
ATOM   6176 C  C5    . C  B 1 130 ? 32.34100 80.16200 37.21300  1.000 149.86645 ? 232 C  B C5    1 
ATOM   6177 C  C6    . C  B 1 130 ? 31.40100 80.44300 38.12700  1.000 147.07664 ? 232 C  B C6    1 
ATOM   6178 P  P     . A  B 1 131 ? 27.49100 84.29300 37.65000  1.000 179.47763 ? 233 A  B P     1 
ATOM   6179 O  OP1   . A  B 1 131 ? 26.18900 85.00100 37.71700  1.000 173.80853 ? 233 A  B OP1   1 
ATOM   6180 O  OP2   . A  B 1 131 ? 27.82100 83.47400 36.45600  1.000 170.26337 ? 233 A  B OP2   1 
ATOM   6181 O  "O5'" . A  B 1 131 ? 28.65700 85.36100 37.85800  1.000 167.41566 ? 233 A  B "O5'" 1 
ATOM   6182 C  "C5'" . A  B 1 131 ? 28.54600 86.36000 38.85900  1.000 165.68913 ? 233 A  B "C5'" 1 
ATOM   6183 C  "C4'" . A  B 1 131 ? 29.86000 87.05300 39.12300  1.000 163.53098 ? 233 A  B "C4'" 1 
ATOM   6184 O  "O4'" . A  B 1 131 ? 30.90000 86.07700 39.40000  1.000 158.00137 ? 233 A  B "O4'" 1 
ATOM   6185 C  "C3'" . A  B 1 131 ? 30.44100 87.87400 37.98400  1.000 174.57441 ? 233 A  B "C3'" 1 
ATOM   6186 O  "O3'" . A  B 1 131 ? 29.81100 89.12900 37.80500  1.000 182.82803 ? 233 A  B "O3'" 1 
ATOM   6187 C  "C2'" . A  B 1 131 ? 31.90600 87.97200 38.38200  1.000 169.45274 ? 233 A  B "C2'" 1 
ATOM   6188 O  "O2'" . A  B 1 131 ? 32.08700 88.91100 39.43400  1.000 164.84166 ? 233 A  B "O2'" 1 
ATOM   6189 C  "C1'" . A  B 1 131 ? 32.14500 86.56700 38.93600  1.000 161.40967 ? 233 A  B "C1'" 1 
ATOM   6190 N  N9    . A  B 1 131 ? 32.66000 85.66900 37.88500  1.000 157.35392 ? 233 A  B N9    1 
ATOM   6191 C  C8    . A  B 1 131 ? 32.05900 84.58200 37.30300  1.000 155.22735 ? 233 A  B C8    1 
ATOM   6192 N  N7    . A  B 1 131 ? 32.79200 84.00500 36.38200  1.000 151.65061 ? 233 A  B N7    1 
ATOM   6193 C  C5    . A  B 1 131 ? 33.95000 84.77100 36.34700  1.000 151.76115 ? 233 A  B C5    1 
ATOM   6194 C  C6    . A  B 1 131 ? 35.12800 84.68400 35.58100  1.000 153.06130 ? 233 A  B C6    1 
ATOM   6195 N  N6    . A  B 1 131 ? 35.34100 83.74400 34.65600  1.000 151.78483 ? 233 A  B N6    1 
ATOM   6196 N  N1    . A  B 1 131 ? 36.09300 85.61000 35.80000  1.000 151.70324 ? 233 A  B N1    1 
ATOM   6197 C  C2    . A  B 1 131 ? 35.88000 86.55700 36.72500  1.000 151.56112 ? 233 A  B C2    1 
ATOM   6198 N  N3    . A  B 1 131 ? 34.81600 86.73800 37.50600  1.000 147.30535 ? 233 A  B N3    1 
ATOM   6199 C  C4    . A  B 1 131 ? 33.87800 85.80300 37.26500  1.000 150.97421 ? 233 A  B C4    1 
ATOM   6200 P  P     . G  B 1 132 ? 29.47500 89.65900 36.32600  1.000 188.20374 ? 234 G  B P     1 
ATOM   6201 O  OP1   . G  B 1 132 ? 28.12300 90.27700 36.35400  1.000 181.81613 ? 234 G  B OP1   1 
ATOM   6202 O  OP2   . G  B 1 132 ? 29.75700 88.56000 35.36900  1.000 175.37063 ? 234 G  B OP2   1 
ATOM   6203 O  "O5'" . G  B 1 132 ? 30.56400 90.79400 36.06700  1.000 184.25064 ? 234 G  B "O5'" 1 
ATOM   6204 C  "C5'" . G  B 1 132 ? 31.29200 91.37300 37.14200  1.000 176.48128 ? 234 G  B "C5'" 1 
ATOM   6205 C  "C4'" . G  B 1 132 ? 32.73900 91.59900 36.77500  1.000 177.57352 ? 234 G  B "C4'" 1 
ATOM   6206 O  "O4'" . G  B 1 132 ? 33.47400 90.35000 36.83400  1.000 172.45712 ? 234 G  B "O4'" 1 
ATOM   6207 C  "C3'" . G  B 1 132 ? 32.99400 92.11100 35.36700  1.000 189.49337 ? 234 G  B "C3'" 1 
ATOM   6208 O  "O3'" . G  B 1 132 ? 32.78800 93.51000 35.25500  1.000 197.19956 ? 234 G  B "O3'" 1 
ATOM   6209 C  "C2'" . G  B 1 132 ? 34.43400 91.68000 35.10700  1.000 183.05049 ? 234 G  B "C2'" 1 
ATOM   6210 O  "O2'" . G  B 1 132 ? 35.34700 92.59000 35.70200  1.000 177.10768 ? 234 G  B "O2'" 1 
ATOM   6211 C  "C1'" . G  B 1 132 ? 34.50300 90.35200 35.86700  1.000 174.43630 ? 234 G  B "C1'" 1 
ATOM   6212 N  N9    . G  B 1 132 ? 34.33900 89.18300 34.98000  1.000 167.30387 ? 234 G  B N9    1 
ATOM   6213 C  C8    . G  B 1 132 ? 33.22200 88.40100 34.80800  1.000 162.79017 ? 234 G  B C8    1 
ATOM   6214 N  N7    . G  B 1 132 ? 33.40200 87.43200 33.95200  1.000 156.22096 ? 234 G  B N7    1 
ATOM   6215 C  C5    . G  B 1 132 ? 34.71900 87.57900 33.54100  1.000 157.71061 ? 234 G  B C5    1 
ATOM   6216 C  C6    . G  B 1 132 ? 35.48300 86.82000 32.61700  1.000 162.33748 ? 234 G  B C6    1 
ATOM   6217 O  O6    . G  B 1 132 ? 35.13700 85.83000 31.95700  1.000 162.06640 ? 234 G  B O6    1 
ATOM   6218 N  N1    . G  B 1 132 ? 36.77700 87.31900 32.49500  1.000 166.50114 ? 234 G  B N1    1 
ATOM   6219 C  C2    . G  B 1 132 ? 37.27500 88.40700 33.17000  1.000 166.49588 ? 234 G  B C2    1 
ATOM   6220 N  N2    . G  B 1 132 ? 38.55200 88.73400 32.91700  1.000 164.55354 ? 234 G  B N2    1 
ATOM   6221 N  N3    . G  B 1 132 ? 36.57100 89.12200 34.03200  1.000 160.76624 ? 234 G  B N3    1 
ATOM   6222 C  C4    . G  B 1 132 ? 35.31100 88.65500 34.16500  1.000 160.71887 ? 234 G  B C4    1 
ATOM   6223 P  P     . A  B 1 133 ? 32.19800 94.15500 33.90400  1.000 193.92924 ? 235 A  B P     1 
ATOM   6224 O  OP1   . A  B 1 133 ? 32.59600 95.58500 33.90900  1.000 191.18943 ? 235 A  B OP1   1 
ATOM   6225 O  OP2   . A  B 1 133 ? 30.76400 93.78800 33.76800  1.000 189.77611 ? 235 A  B OP2   1 
ATOM   6226 O  "O5'" . A  B 1 133 ? 33.00000 93.42500 32.73700  1.000 185.58350 ? 235 A  B "O5'" 1 
ATOM   6227 C  "C5'" . A  B 1 133 ? 33.53800 94.15900 31.64500  1.000 195.58470 ? 235 A  B "C5'" 1 
ATOM   6228 C  "C4'" . A  B 1 133 ? 34.99500 93.82500 31.43000  1.000 194.39771 ? 235 A  B "C4'" 1 
ATOM   6229 O  "O4'" . A  B 1 133 ? 35.28900 92.54500 32.05200  1.000 187.62585 ? 235 A  B "O4'" 1 
ATOM   6230 C  "C3'" . A  B 1 133 ? 35.43600 93.64300 29.98400  1.000 197.41913 ? 235 A  B "C3'" 1 
ATOM   6231 O  "O3'" . A  B 1 133 ? 35.67700 94.85600 29.29400  1.000 207.27031 ? 235 A  B "O3'" 1 
ATOM   6232 C  "C2'" . A  B 1 133 ? 36.66100 92.75200 30.13500  1.000 189.61030 ? 235 A  B "C2'" 1 
ATOM   6233 O  "O2'" . A  B 1 133 ? 37.76800 93.50000 30.62200  1.000 194.86356 ? 235 A  B "O2'" 1 
ATOM   6234 C  "C1'" . A  B 1 133 ? 36.19300 91.81800 31.24400  1.000 186.45992 ? 235 A  B "C1'" 1 
ATOM   6235 N  N9    . A  B 1 133 ? 35.47300 90.65100 30.70000  1.000 179.13273 ? 235 A  B N9    1 
ATOM   6236 C  C8    . A  B 1 133 ? 34.15100 90.33000 30.87800  1.000 176.15079 ? 235 A  B C8    1 
ATOM   6237 N  N7    . A  B 1 133 ? 33.78200 89.23600 30.26300  1.000 168.90782 ? 235 A  B N7    1 
ATOM   6238 C  C5    . A  B 1 133 ? 34.93900 88.80900 29.63200  1.000 169.71054 ? 235 A  B C5    1 
ATOM   6239 C  C6    . A  B 1 133 ? 35.20500 87.69800 28.81500  1.000 173.93737 ? 235 A  B C6    1 
ATOM   6240 N  N6    . A  B 1 133 ? 34.27700 86.79500 28.49500  1.000 174.01896 ? 235 A  B N6    1 
ATOM   6241 N  N1    . A  B 1 133 ? 36.46100 87.54800 28.33700  1.000 180.83293 ? 235 A  B N1    1 
ATOM   6242 C  C2    . A  B 1 133 ? 37.37600 88.46600 28.67300  1.000 183.72275 ? 235 A  B C2    1 
ATOM   6243 N  N3    . A  B 1 133 ? 37.24400 89.55100 29.43400  1.000 179.47224 ? 235 A  B N3    1 
ATOM   6244 C  C4    . A  B 1 133 ? 35.98700 89.66900 29.89000  1.000 174.24003 ? 235 A  B C4    1 
ATOM   6245 P  P     . U  B 1 134 ? 34.79700 95.21900 27.99700  1.000 213.81709 ? 236 U  B P     1 
ATOM   6246 O  OP1   . U  B 1 134 ? 34.68400 96.69300 27.89900  1.000 213.94869 ? 236 U  B OP1   1 
ATOM   6247 O  OP2   . U  B 1 134 ? 33.56900 94.39000 28.02800  1.000 197.53619 ? 236 U  B OP2   1 
ATOM   6248 O  "O5'" . U  B 1 134 ? 35.68000 94.72900 26.76500  1.000 215.93314 ? 236 U  B "O5'" 1 
ATOM   6249 C  "C5'" . U  B 1 134 ? 35.51300 93.43600 26.19500  1.000 209.90610 ? 236 U  B "C5'" 1 
ATOM   6250 C  "C4'" . U  B 1 134 ? 36.60200 93.14900 25.19100  1.000 213.78025 ? 236 U  B "C4'" 1 
ATOM   6251 O  "O4'" . U  B 1 134 ? 37.78700 93.89300 25.57700  1.000 213.54864 ? 236 U  B "O4'" 1 
ATOM   6252 C  "C3'" . U  B 1 134 ? 37.07400 91.70300 25.10600  1.000 211.39575 ? 236 U  B "C3'" 1 
ATOM   6253 O  "O3'" . U  B 1 134 ? 36.26800 90.89700 24.26300  1.000 217.42016 ? 236 U  B "O3'" 1 
ATOM   6254 C  "C2'" . U  B 1 134 ? 38.51900 91.83800 24.63300  1.000 212.11426 ? 236 U  B "C2'" 1 
ATOM   6255 O  "O2'" . U  B 1 134 ? 38.57500 92.03600 23.22700  1.000 205.87667 ? 236 U  B "O2'" 1 
ATOM   6256 C  "C1'" . U  B 1 134 ? 38.94800 93.13400 25.32500  1.000 213.55654 ? 236 U  B "C1'" 1 
ATOM   6257 N  N1    . U  B 1 134 ? 39.65000 92.89600 26.61400  1.000 209.51921 ? 236 U  B N1    1 
ATOM   6258 C  C2    . U  B 1 134 ? 40.71200 93.73000 26.92300  1.000 210.90622 ? 236 U  B C2    1 
ATOM   6259 O  O2    . U  B 1 134 ? 41.06700 94.64800 26.19900  1.000 213.28282 ? 236 U  B O2    1 
ATOM   6260 N  N3    . U  B 1 134 ? 41.33000 93.46700 28.12500  1.000 209.20075 ? 236 U  B N3    1 
ATOM   6261 C  C4    . U  B 1 134 ? 41.02200 92.46700 29.03100  1.000 201.86829 ? 236 U  B C4    1 
ATOM   6262 O  O4    . U  B 1 134 ? 41.68200 92.35500 30.07200  1.000 194.41740 ? 236 U  B O4    1 
ATOM   6263 C  C5    . U  B 1 134 ? 39.92000 91.64200 28.63400  1.000 198.57053 ? 236 U  B C5    1 
ATOM   6264 C  C6    . U  B 1 134 ? 39.30000 91.88000 27.47600  1.000 204.16857 ? 236 U  B C6    1 
ATOM   6265 P  P     . C  B 1 135 ? 36.02500 89.34600 24.60900  1.000 216.46970 ? 237 C  B P     1 
ATOM   6266 O  OP1   . C  B 1 135 ? 34.56300 89.14600 24.78800  1.000 213.62462 ? 237 C  B OP1   1 
ATOM   6267 O  OP2   . C  B 1 135 ? 36.95100 88.96700 25.70400  1.000 201.69161 ? 237 C  B OP2   1 
ATOM   6268 O  "O5'" . C  B 1 135 ? 36.48200 88.58500 23.28400  1.000 218.68049 ? 237 C  B "O5'" 1 
ATOM   6269 C  "C5'" . C  B 1 135 ? 36.83400 87.20800 23.31300  1.000 214.18785 ? 237 C  B "C5'" 1 
ATOM   6270 C  "C4'" . C  B 1 135 ? 35.64900 86.32600 23.00000  1.000 216.55918 ? 237 C  B "C4'" 1 
ATOM   6271 O  "O4'" . C  B 1 135 ? 34.54700 87.14400 22.51900  1.000 226.11823 ? 237 C  B "O4'" 1 
ATOM   6272 C  "C3'" . C  B 1 135 ? 35.85100 85.28400 21.90200  1.000 219.41742 ? 237 C  B "C3'" 1 
ATOM   6273 O  "O3'" . C  B 1 135 ? 36.49500 84.10300 22.35800  1.000 214.87740 ? 237 C  B "O3'" 1 
ATOM   6274 C  "C2'" . C  B 1 135 ? 34.43100 85.05200 21.40200  1.000 223.10734 ? 237 C  B "C2'" 1 
ATOM   6275 O  "O2'" . C  B 1 135 ? 33.72800 84.19700 22.29300  1.000 212.91138 ? 237 C  B "O2'" 1 
ATOM   6276 C  "C1'" . C  B 1 135 ? 33.84100 86.46000 21.50200  1.000 228.22111 ? 237 C  B "C1'" 1 
ATOM   6277 N  N1    . C  B 1 135 ? 33.98400 87.22800 20.23800  1.000 233.40594 ? 237 C  B N1    1 
ATOM   6278 C  C2    . C  B 1 135 ? 33.27600 86.86400 19.07800  1.000 235.15352 ? 237 C  B C2    1 
ATOM   6279 O  O2    . C  B 1 135 ? 32.52000 85.87700 19.10200  1.000 226.29456 ? 237 C  B O2    1 
ATOM   6280 N  N3    . C  B 1 135 ? 33.43700 87.59800 17.94700  1.000 237.77225 ? 237 C  B N3    1 
ATOM   6281 C  C4    . C  B 1 135 ? 34.25500 88.65600 17.94700  1.000 237.09323 ? 237 C  B C4    1 
ATOM   6282 N  N4    . C  B 1 135 ? 34.37600 89.34600 16.80900  1.000 231.68468 ? 237 C  B N4    1 
ATOM   6283 C  C5    . C  B 1 135 ? 34.98300 89.05400 19.11000  1.000 234.10603 ? 237 C  B C5    1 
ATOM   6284 C  C6    . C  B 1 135 ? 34.81300 88.31700 20.21300  1.000 231.19515 ? 237 C  B C6    1 
ATOM   6285 P  P     . U  B 1 136 ? 37.18900 83.09500 21.31000  1.000 218.53527 ? 238 U  B P     1 
ATOM   6286 O  OP1   . U  B 1 136 ? 38.64000 83.41400 21.26000  1.000 210.42903 ? 238 U  B OP1   1 
ATOM   6287 O  OP2   . U  B 1 136 ? 36.39800 83.07800 20.05500  1.000 222.39889 ? 238 U  B OP2   1 
ATOM   6288 O  "O5'" . U  B 1 136 ? 37.02800 81.66100 21.98800  1.000 208.14455 ? 238 U  B "O5'" 1 
ATOM   6289 C  "C5'" . U  B 1 136 ? 35.82400 80.91600 21.86000  1.000 209.60525 ? 238 U  B "C5'" 1 
ATOM   6290 C  "C4'" . U  B 1 136 ? 36.05500 79.58800 21.17600  1.000 211.44231 ? 238 U  B "C4'" 1 
ATOM   6291 O  "O4'" . U  B 1 136 ? 35.22500 79.48900 19.98900  1.000 207.30497 ? 238 U  B "O4'" 1 
ATOM   6292 C  "C3'" . U  B 1 136 ? 37.46800 79.32000 20.67400  1.000 215.17434 ? 238 U  B "C3'" 1 
ATOM   6293 O  "O3'" . U  B 1 136 ? 38.31300 78.83100 21.70600  1.000 214.76376 ? 238 U  B "O3'" 1 
ATOM   6294 C  "C2'" . U  B 1 136 ? 37.25100 78.31300 19.54700  1.000 216.56135 ? 238 U  B "C2'" 1 
ATOM   6295 O  "O2'" . U  B 1 136 ? 37.12200 76.99900 20.06900  1.000 215.74809 ? 238 U  B "O2'" 1 
ATOM   6296 C  "C1'" . U  B 1 136 ? 35.89100 78.75000 18.98900  1.000 213.06093 ? 238 U  B "C1'" 1 
ATOM   6297 N  N1    . U  B 1 136 ? 35.98700 79.59300 17.77000  1.000 215.19013 ? 238 U  B N1    1 
ATOM   6298 C  C2    . U  B 1 136 ? 36.49100 79.07100 16.58200  1.000 221.67775 ? 238 U  B C2    1 
ATOM   6299 O  O2    . U  B 1 136 ? 36.91400 77.93100 16.45700  1.000 223.95434 ? 238 U  B O2    1 
ATOM   6300 N  N3    . U  B 1 136 ? 36.50200 79.95100 15.52100  1.000 223.67536 ? 238 U  B N3    1 
ATOM   6301 C  C4    . U  B 1 136 ? 36.06100 81.26200 15.51300  1.000 221.48825 ? 238 U  B C4    1 
ATOM   6302 O  O4    . U  B 1 136 ? 36.13600 81.92800 14.47600  1.000 219.80911 ? 238 U  B O4    1 
ATOM   6303 C  C5    . U  B 1 136 ? 35.54300 81.72000 16.76600  1.000 213.96367 ? 238 U  B C5    1 
ATOM   6304 C  C6    . U  B 1 136 ? 35.51900 80.88900 17.81500  1.000 211.82394 ? 238 U  B C6    1 
ATOM   6305 P  P     . U  B 1 137 ? 39.89100 79.13500 21.71200  1.000 229.29847 ? 239 U  B P     1 
ATOM   6306 O  OP1   . U  B 1 137 ? 40.14700 80.40300 20.98300  1.000 224.32156 ? 239 U  B OP1   1 
ATOM   6307 O  OP2   . U  B 1 137 ? 40.60300 77.89700 21.30600  1.000 222.87139 ? 239 U  B OP2   1 
ATOM   6308 O  "O5'" . U  B 1 137 ? 40.20200 79.38900 23.25200  1.000 220.58953 ? 239 U  B "O5'" 1 
ATOM   6309 C  "C5'" . U  B 1 137 ? 39.33700 80.20000 24.03300  1.000 213.34656 ? 239 U  B "C5'" 1 
ATOM   6310 C  "C4'" . U  B 1 137 ? 39.79800 81.63400 24.05100  1.000 210.43568 ? 239 U  B "C4'" 1 
ATOM   6311 O  "O4'" . U  B 1 137 ? 38.65400 82.51900 23.99500  1.000 211.74374 ? 239 U  B "O4'" 1 
ATOM   6312 C  "C3'" . U  B 1 137 ? 40.55100 82.07400 25.29400  1.000 201.13194 ? 239 U  B "C3'" 1 
ATOM   6313 O  "O3'" . U  B 1 137 ? 41.91700 81.69400 25.26000  1.000 203.28483 ? 239 U  B "O3'" 1 
ATOM   6314 C  "C2'" . U  B 1 137 ? 40.33100 83.58400 25.31200  1.000 199.27645 ? 239 U  B "C2'" 1 
ATOM   6315 O  "O2'" . U  B 1 137 ? 41.26200 84.23900 24.46400  1.000 200.66872 ? 239 U  B "O2'" 1 
ATOM   6316 C  "C1'" . U  B 1 137 ? 38.93100 83.71000 24.69400  1.000 203.81121 ? 239 U  B "C1'" 1 
ATOM   6317 N  N1    . U  B 1 137 ? 37.86300 83.93000 25.69700  1.000 197.24463 ? 239 U  B N1    1 
ATOM   6318 C  C2    . U  B 1 137 ? 37.76500 85.18600 26.26900  1.000 189.87006 ? 239 U  B C2    1 
ATOM   6319 O  O2    . U  B 1 137 ? 38.52200 86.10600 25.99600  1.000 187.66717 ? 239 U  B O2    1 
ATOM   6320 N  N3    . U  B 1 137 ? 36.75000 85.32600 27.18500  1.000 185.33004 ? 239 U  B N3    1 
ATOM   6321 C  C4    . U  B 1 137 ? 35.83700 84.36200 27.57200  1.000 181.12428 ? 239 U  B C4    1 
ATOM   6322 O  O4    . U  B 1 137 ? 34.97600 84.64200 28.41100  1.000 177.26592 ? 239 U  B O4    1 
ATOM   6323 C  C5    . U  B 1 137 ? 35.99900 83.09400 26.92500  1.000 184.24307 ? 239 U  B C5    1 
ATOM   6324 C  C6    . U  B 1 137 ? 36.97900 82.92700 26.02900  1.000 192.87568 ? 239 U  B C6    1 
ATOM   6325 P  P     . C  B 1 138 ? 42.64900 81.19700 26.59800  1.000 208.19187 ? 240 C  B P     1 
ATOM   6326 O  OP1   . C  B 1 138 ? 43.54200 80.05900 26.26200  1.000 206.03109 ? 240 C  B OP1   1 
ATOM   6327 O  OP2   . C  B 1 138 ? 41.60600 81.03800 27.64200  1.000 195.38244 ? 240 C  B OP2   1 
ATOM   6328 O  "O5'" . C  B 1 138 ? 43.56600 82.43200 27.00000  1.000 192.78476 ? 240 C  B "O5'" 1 
ATOM   6329 C  "C5'" . C  B 1 138 ? 43.86800 82.69900 28.35800  1.000 186.86037 ? 240 C  B "C5'" 1 
ATOM   6330 C  "C4'" . C  B 1 138 ? 43.69300 84.16000 28.68300  1.000 185.63917 ? 240 C  B "C4'" 1 
ATOM   6331 O  "O4'" . C  B 1 138 ? 42.45400 84.64800 28.10300  1.000 186.01290 ? 240 C  B "O4'" 1 
ATOM   6332 C  "C3'" . C  B 1 138 ? 43.57200 84.49700 30.16100  1.000 179.22524 ? 240 C  B "C3'" 1 
ATOM   6333 O  "O3'" . C  B 1 138 ? 44.83000 84.56300 30.81100  1.000 173.32980 ? 240 C  B "O3'" 1 
ATOM   6334 C  "C2'" . C  B 1 138 ? 42.81200 85.81700 30.13900  1.000 175.20634 ? 240 C  B "C2'" 1 
ATOM   6335 O  "O2'" . C  B 1 138 ? 43.68000 86.89400 29.80500  1.000 175.84852 ? 240 C  B "O2'" 1 
ATOM   6336 C  "C1'" . C  B 1 138 ? 41.85100 85.58800 28.97000  1.000 179.39368 ? 240 C  B "C1'" 1 
ATOM   6337 N  N1    . C  B 1 138 ? 40.54300 85.04700 29.41500  1.000 179.35684 ? 240 C  B N1    1 
ATOM   6338 C  C2    . C  B 1 138 ? 39.61300 85.90000 30.02300  1.000 173.71669 ? 240 C  B C2    1 
ATOM   6339 O  O2    . C  B 1 138 ? 39.89800 87.09800 30.17900  1.000 174.22201 ? 240 C  B O2    1 
ATOM   6340 N  N3    . C  B 1 138 ? 38.42300 85.39800 30.42800  1.000 169.85833 ? 240 C  B N3    1 
ATOM   6341 C  C4    . C  B 1 138 ? 38.14800 84.10200 30.24700  1.000 169.52408 ? 240 C  B C4    1 
ATOM   6342 N  N4    . C  B 1 138 ? 36.96000 83.65100 30.66300  1.000 170.82950 ? 240 C  B N4    1 
ATOM   6343 C  C5    . C  B 1 138 ? 39.07600 83.21100 29.63100  1.000 175.68797 ? 240 C  B C5    1 
ATOM   6344 C  C6    . C  B 1 138 ? 40.24500 83.72400 29.23500  1.000 179.61476 ? 240 C  B C6    1 
ATOM   6345 P  P     . U  B 1 139 ? 45.04600 83.86400 32.24000  1.000 173.68431 ? 241 U  B P     1 
ATOM   6346 O  OP1   . U  B 1 139 ? 46.50500 83.77200 32.49800  1.000 181.47472 ? 241 U  B OP1   1 
ATOM   6347 O  OP2   . U  B 1 139 ? 44.22200 82.63100 32.27800  1.000 163.63048 ? 241 U  B OP2   1 
ATOM   6348 O  "O5'" . U  B 1 139 ? 44.42200 84.90600 33.27100  1.000 167.97310 ? 241 U  B "O5'" 1 
ATOM   6349 C  "C5'" . U  B 1 139 ? 44.81100 86.27300 33.26000  1.000 169.27589 ? 241 U  B "C5'" 1 
ATOM   6350 C  "C4'" . U  B 1 139 ? 43.88200 87.11600 34.09700  1.000 164.73324 ? 241 U  B "C4'" 1 
ATOM   6351 O  "O4'" . U  B 1 139 ? 42.61100 87.27500 33.41300  1.000 164.67008 ? 241 U  B "O4'" 1 
ATOM   6352 C  "C3'" . U  B 1 139 ? 43.49700 86.53700 35.44700  1.000 165.08328 ? 241 U  B "C3'" 1 
ATOM   6353 O  "O3'" . U  B 1 139 ? 44.49300 86.71400 36.43700  1.000 165.54650 ? 241 U  B "O3'" 1 
ATOM   6354 C  "C2'" . U  B 1 139 ? 42.19000 87.25000 35.75000  1.000 162.88302 ? 241 U  B "C2'" 1 
ATOM   6355 O  "O2'" . U  B 1 139 ? 42.43300 88.57600 36.20000  1.000 167.23354 ? 241 U  B "O2'" 1 
ATOM   6356 C  "C1'" . U  B 1 139 ? 41.56000 87.31100 34.35900  1.000 160.84593 ? 241 U  B "C1'" 1 
ATOM   6357 N  N1    . U  B 1 139 ? 40.66500 86.15500 34.12100  1.000 158.16403 ? 241 U  B N1    1 
ATOM   6358 C  C2    . U  B 1 139 ? 39.42300 86.20200 34.72200  1.000 158.26931 ? 241 U  B C2    1 
ATOM   6359 O  O2    . U  B 1 139 ? 39.05300 87.14000 35.40500  1.000 159.17994 ? 241 U  B O2    1 
ATOM   6360 N  N3    . U  B 1 139 ? 38.62300 85.11500 34.49200  1.000 156.13747 ? 241 U  B N3    1 
ATOM   6361 C  C4    . U  B 1 139 ? 38.93900 84.00500 33.73600  1.000 158.08244 ? 241 U  B C4    1 
ATOM   6362 O  O4    . U  B 1 139 ? 38.10500 83.10500 33.62200  1.000 159.85634 ? 241 U  B O4    1 
ATOM   6363 C  C5    . U  B 1 139 ? 40.24500 84.02700 33.14800  1.000 161.55391 ? 241 U  B C5    1 
ATOM   6364 C  C6    . U  B 1 139 ? 41.04500 85.07700 33.35800  1.000 162.34874 ? 241 U  B C6    1 
ATOM   6365 P  P     . G  B 1 140 ? 44.70600 85.59000 37.56300  1.000 163.85876 ? 242 G  B P     1 
ATOM   6366 O  OP1   . G  B 1 140 ? 46.01600 85.86100 38.20700  1.000 167.67764 ? 242 G  B OP1   1 
ATOM   6367 O  OP2   . G  B 1 140 ? 44.47000 84.25800 36.94800  1.000 161.52164 ? 242 G  B OP2   1 
ATOM   6368 O  "O5'" . G  B 1 140 ? 43.54000 85.88300 38.61100  1.000 151.64414 ? 242 G  B "O5'" 1 
ATOM   6369 C  "C5'" . G  B 1 140 ? 43.41700 87.16800 39.20400  1.000 153.99968 ? 242 G  B "C5'" 1 
ATOM   6370 C  "C4'" . G  B 1 140 ? 42.06500 87.38100 39.83900  1.000 154.83399 ? 242 G  B "C4'" 1 
ATOM   6371 O  "O4'" . G  B 1 140 ? 41.02600 87.36600 38.82600  1.000 156.42629 ? 242 G  B "O4'" 1 
ATOM   6372 C  "C3'" . G  B 1 140 ? 41.61400 86.32900 40.83900  1.000 151.77573 ? 242 G  B "C3'" 1 
ATOM   6373 O  "O3'" . G  B 1 140 ? 42.20800 86.48800 42.11700  1.000 149.15173 ? 242 G  B "O3'" 1 
ATOM   6374 C  "C2'" . G  B 1 140 ? 40.10000 86.50100 40.83800  1.000 152.76532 ? 242 G  B "C2'" 1 
ATOM   6375 O  "O2'" . G  B 1 140 ? 39.70900 87.61700 41.62600  1.000 148.09108 ? 242 G  B "O2'" 1 
ATOM   6376 C  "C1'" . G  B 1 140 ? 39.83800 86.82500 39.36600  1.000 152.13893 ? 242 G  B "C1'" 1 
ATOM   6377 N  N9    . G  B 1 140 ? 39.48000 85.61700 38.60500  1.000 144.87754 ? 242 G  B N9    1 
ATOM   6378 C  C8    . G  B 1 140 ? 40.24600 84.93900 37.69000  1.000 151.79942 ? 242 G  B C8    1 
ATOM   6379 N  N7    . G  B 1 140 ? 39.63900 83.89800 37.19100  1.000 148.54903 ? 242 G  B N7    1 
ATOM   6380 C  C5    . G  B 1 140 ? 38.40200 83.89100 37.82000  1.000 145.42234 ? 242 G  B C5    1 
ATOM   6381 C  C6    . G  B 1 140 ? 37.30800 82.99900 37.68500  1.000 145.62499 ? 242 G  B C6    1 
ATOM   6382 O  O6    . G  B 1 140 ? 37.21300 82.00300 36.95900  1.000 145.18810 ? 242 G  B O6    1 
ATOM   6383 N  N1    . G  B 1 140 ? 36.24800 83.36100 38.51000  1.000 145.03808 ? 242 G  B N1    1 
ATOM   6384 C  C2    . G  B 1 140 ? 36.23600 84.44100 39.35800  1.000 146.86462 ? 242 G  B C2    1 
ATOM   6385 N  N2    . G  B 1 140 ? 35.11500 84.62200 40.07300  1.000 148.26215 ? 242 G  B N2    1 
ATOM   6386 N  N3    . G  B 1 140 ? 37.25100 85.27900 39.49400  1.000 144.02217 ? 242 G  B N3    1 
ATOM   6387 C  C4    . G  B 1 140 ? 38.28900 84.94400 38.69900  1.000 142.72991 ? 242 G  B C4    1 
ATOM   6388 P  P     . U  B 1 141 ? 42.64900 85.20100 42.97600  1.000 152.57639 ? 243 U  B P     1 
ATOM   6389 O  OP1   . U  B 1 141 ? 43.63700 85.67000 43.98300  1.000 150.46034 ? 243 U  B OP1   1 
ATOM   6390 O  OP2   . U  B 1 141 ? 43.04200 84.11000 42.04800  1.000 153.71863 ? 243 U  B OP2   1 
ATOM   6391 O  "O5'" . U  B 1 141 ? 41.31000 84.75800 43.72200  1.000 143.62005 ? 243 U  B "O5'" 1 
ATOM   6392 C  "C5'" . U  B 1 141 ? 40.66500 85.63300 44.63900  1.000 146.11245 ? 243 U  B "C5'" 1 
ATOM   6393 C  "C4'" . U  B 1 141 ? 39.26700 85.17100 44.97200  1.000 148.99438 ? 243 U  B "C4'" 1 
ATOM   6394 O  "O4'" . U  B 1 141 ? 38.44200 85.19900 43.77700  1.000 149.34442 ? 243 U  B "O4'" 1 
ATOM   6395 C  "C3'" . U  B 1 141 ? 39.14200 83.74300 45.47900  1.000 149.50497 ? 243 U  B "C3'" 1 
ATOM   6396 O  "O3'" . U  B 1 141 ? 39.42200 83.62800 46.86300  1.000 152.73693 ? 243 U  B "O3'" 1 
ATOM   6397 C  "C2'" . U  B 1 141 ? 37.70800 83.38100 45.12000  1.000 145.10970 ? 243 U  B "C2'" 1 
ATOM   6398 O  "O2'" . U  B 1 141 ? 36.80000 83.92000 46.07100  1.000 139.77485 ? 243 U  B "O2'" 1 
ATOM   6399 C  "C1'" . U  B 1 141 ? 37.53000 84.12100 43.79400  1.000 147.32049 ? 243 U  B "C1'" 1 
ATOM   6400 N  N1    . U  B 1 141 ? 37.81300 83.24800 42.63100  1.000 146.10982 ? 243 U  B N1    1 
ATOM   6401 C  C2    . U  B 1 141 ? 36.83500 82.35700 42.22700  1.000 144.19907 ? 243 U  B C2    1 
ATOM   6402 O  O2    . U  B 1 141 ? 35.75200 82.25600 42.77600  1.000 141.72245 ? 243 U  B O2    1 
ATOM   6403 N  N3    . U  B 1 141 ? 37.17200 81.58400 41.14300  1.000 142.01459 ? 243 U  B N3    1 
ATOM   6404 C  C4    . U  B 1 141 ? 38.36100 81.60700 40.44000  1.000 144.78598 ? 243 U  B C4    1 
ATOM   6405 O  O4    . U  B 1 141 ? 38.51600 80.84600 39.48000  1.000 145.10970 ? 243 U  B O4    1 
ATOM   6406 C  C5    . U  B 1 141 ? 39.32000 82.55600 40.92400  1.000 145.38868 ? 243 U  B C5    1 
ATOM   6407 C  C6    . U  B 1 141 ? 39.01900 83.32200 41.97600  1.000 145.12813 ? 243 U  B C6    1 
ATOM   6408 P  P     . U  B 1 142 ? 40.20300 82.34500 47.43200  1.000 150.58282 ? 244 U  B P     1 
ATOM   6409 O  OP1   . U  B 1 142 ? 40.46000 82.62400 48.86300  1.000 141.75545 ? 244 U  B OP1   1 
ATOM   6410 O  OP2   . U  B 1 142 ? 41.35700 82.04000 46.55500  1.000 147.03240 ? 244 U  B OP2   1 
ATOM   6411 O  "O5'" . U  B 1 142 ? 39.16000 81.14300 47.30200  1.000 133.30180 ? 244 U  B "O5'" 1 
ATOM   6412 C  "C5'" . U  B 1 142 ? 38.03800 81.15900 48.15800  1.000 137.41019 ? 244 U  B "C5'" 1 
ATOM   6413 C  "C4'" . U  B 1 142 ? 36.92800 80.26700 47.65400  1.000 138.97353 ? 244 U  B "C4'" 1 
ATOM   6414 O  "O4'" . U  B 1 142 ? 36.53800 80.61500 46.29800  1.000 139.01301 ? 244 U  B "O4'" 1 
ATOM   6415 C  "C3'" . U  B 1 142 ? 37.26800 78.79000 47.59600  1.000 138.79457 ? 244 U  B "C3'" 1 
ATOM   6416 O  "O3'" . U  B 1 142 ? 37.17800 78.20700 48.88100  1.000 139.11039 ? 244 U  B "O3'" 1 
ATOM   6417 C  "C2'" . U  B 1 142 ? 36.19700 78.29800 46.63700  1.000 140.68690 ? 244 U  B "C2'" 1 
ATOM   6418 O  "O2'" . U  B 1 142 ? 34.93000 78.09700 47.23600  1.000 142.83979 ? 244 U  B "O2'" 1 
ATOM   6419 C  "C1'" . U  B 1 142 ? 36.17700 79.42900 45.59800  1.000 138.44189 ? 244 U  B "C1'" 1 
ATOM   6420 N  N1    . U  B 1 142 ? 37.07000 79.17500 44.36700  1.000 137.54968 ? 244 U  B N1    1 
ATOM   6421 C  C2    . U  B 1 142 ? 36.74500 78.12900 43.51200  1.000 133.96767 ? 244 U  B C2    1 
ATOM   6422 O  O2    . U  B 1 142 ? 35.78500 77.39200 43.67400  1.000 128.10644 ? 244 U  B O2    1 
ATOM   6423 N  N3    . U  B 1 142 ? 37.62300 77.94400 42.46400  1.000 137.82076 ? 244 U  B N3    1 
ATOM   6424 C  C4    . U  B 1 142 ? 38.76100 78.68500 42.16400  1.000 142.52133 ? 244 U  B C4    1 
ATOM   6425 O  O4    . U  B 1 142 ? 39.43800 78.40000 41.18000  1.000 145.10322 ? 244 U  B O4    1 
ATOM   6426 C  C5    . U  B 1 142 ? 39.04800 79.74900 43.09700  1.000 140.95798 ? 244 U  B C5    1 
ATOM   6427 C  C6    . U  B 1 142 ? 38.21000 79.94600 44.13100  1.000 141.57911 ? 244 U  B C6    1 
ATOM   6428 P  P     . G  B 1 143 ? 38.32100 77.21100 49.42200  1.000 144.40063 ? 245 G  B P     1 
ATOM   6429 O  OP1   . G  B 1 143 ? 38.13100 77.08300 50.89400  1.000 138.45518 ? 245 G  B OP1   1 
ATOM   6430 O  OP2   . G  B 1 143 ? 39.66300 77.63300 48.92300  1.000 141.18445 ? 245 G  B OP2   1 
ATOM   6431 O  "O5'" . G  B 1 143 ? 37.90700 75.83100 48.69800  1.000 132.48078 ? 245 G  B "O5'" 1 
ATOM   6432 C  "C5'" . G  B 1 143 ? 36.70300 75.13800 49.04600  1.000 128.75138 ? 245 G  B "C5'" 1 
ATOM   6433 C  "C4'" . G  B 1 143 ? 36.17100 74.25300 47.93100  1.000 131.24379 ? 245 G  B "C4'" 1 
ATOM   6434 O  "O4'" . G  B 1 143 ? 36.10800 74.97100 46.67500  1.000 138.78943 ? 245 G  B "O4'" 1 
ATOM   6435 C  "C3'" . G  B 1 143 ? 36.99400 73.04000 47.54600  1.000 126.83799 ? 245 G  B "C3'" 1 
ATOM   6436 O  "O3'" . G  B 1 143 ? 37.00300 72.03300 48.53000  1.000 123.58760 ? 245 G  B "O3'" 1 
ATOM   6437 C  "C2'" . G  B 1 143 ? 36.36200 72.65700 46.21200  1.000 127.70915 ? 245 G  B "C2'" 1 
ATOM   6438 O  "O2'" . G  B 1 143 ? 35.08400 72.04900 46.28800  1.000 123.69551 ? 245 G  B "O2'" 1 
ATOM   6439 C  "C1'" . G  B 1 143 ? 36.24200 74.05100 45.59800  1.000 132.07283 ? 245 G  B "C1'" 1 
ATOM   6440 N  N9    . G  B 1 143 ? 37.31100 74.45500 44.66600  1.000 127.05118 ? 245 G  B N9    1 
ATOM   6441 C  C8    . G  B 1 143 ? 38.18100 75.51400 44.79600  1.000 131.49645 ? 245 G  B C8    1 
ATOM   6442 N  N7    . G  B 1 143 ? 39.00100 75.66300 43.79000  1.000 130.89374 ? 245 G  B N7    1 
ATOM   6443 C  C5    . G  B 1 143 ? 38.66000 74.63700 42.92300  1.000 126.07475 ? 245 G  B C5    1 
ATOM   6444 C  C6    . G  B 1 143 ? 39.20400 74.28100 41.65500  1.000 124.33506 ? 245 G  B C6    1 
ATOM   6445 O  O6    . G  B 1 143 ? 40.12000 74.83500 41.02500  1.000 122.64012 ? 245 G  B O6    1 
ATOM   6446 N  N1    . G  B 1 143 ? 38.56600 73.15900 41.10800  1.000 123.80079 ? 245 G  B N1    1 
ATOM   6447 C  C2    . G  B 1 143 ? 37.52400 72.46700 41.71700  1.000 124.92724 ? 245 G  B C2    1 
ATOM   6448 N  N2    . G  B 1 143 ? 37.01400 71.41000 41.06000  1.000 122.71908 ? 245 G  B N2    1 
ATOM   6449 N  N3    . G  B 1 143 ? 37.01800 72.79300 42.90600  1.000 120.62409 ? 245 G  B N3    1 
ATOM   6450 C  C4    . G  B 1 143 ? 37.61900 73.88700 43.44800  1.000 122.82699 ? 245 G  B C4    1 
ATOM   6451 P  P     . A  B 1 144 ? 38.40100 71.38300 48.98600  1.000 129.57274 ? 246 A  B P     1 
ATOM   6452 O  OP1   . A  B 1 144 ? 38.24800 70.82400 50.35400  1.000 127.18561 ? 246 A  B OP1   1 
ATOM   6453 O  OP2   . A  B 1 144 ? 39.47800 72.37300 48.72600  1.000 122.08500 ? 246 A  B OP2   1 
ATOM   6454 O  "O5'" . A  B 1 144 ? 38.58700 70.17100 47.97500  1.000 117.14230 ? 246 A  B "O5'" 1 
ATOM   6455 C  "C5'" . A  B 1 144 ? 37.51100 69.28300 47.72100  1.000 114.97098 ? 246 A  B "C5'" 1 
ATOM   6456 C  "C4'" . A  B 1 144 ? 37.62100 68.66600 46.35400  1.000 114.24985 ? 246 A  B "C4'" 1 
ATOM   6457 O  "O4'" . A  B 1 144 ? 37.51600 69.69700 45.34100  1.000 112.73124 ? 246 A  B "O4'" 1 
ATOM   6458 C  "C3'" . A  B 1 144 ? 38.94300 67.98300 46.04900  1.000 118.55036 ? 246 A  B "C3'" 1 
ATOM   6459 O  "O3'" . A  B 1 144 ? 39.01700 66.67700 46.59200  1.000 125.67753 ? 246 A  B "O3'" 1 
ATOM   6460 C  "C2'" . A  B 1 144 ? 39.00100 68.02600 44.52700  1.000 111.27054 ? 246 A  B "C2'" 1 
ATOM   6461 O  "O2'" . A  B 1 144 ? 38.20400 66.99500 43.96100  1.000 111.22317 ? 246 A  B "O2'" 1 
ATOM   6462 C  "C1'" . A  B 1 144 ? 38.32900 69.37100 44.23500  1.000 112.37594 ? 246 A  B "C1'" 1 
ATOM   6463 N  N9    . A  B 1 144 ? 39.30300 70.46100 44.02100  1.000 117.52392 ? 246 A  B N9    1 
ATOM   6464 C  C8    . A  B 1 144 ? 39.62400 71.50000 44.86100  1.000 116.81857 ? 246 A  B C8    1 
ATOM   6465 N  N7    . A  B 1 144 ? 40.53100 72.31200 44.36600  1.000 113.41817 ? 246 A  B N7    1 
ATOM   6466 C  C5    . A  B 1 144 ? 40.82400 71.77600 43.11700  1.000 112.22329 ? 246 A  B C5    1 
ATOM   6467 C  C6    . A  B 1 144 ? 41.70600 72.15900 42.08800  1.000 113.29710 ? 246 A  B C6    1 
ATOM   6468 N  N6    . A  B 1 144 ? 42.49700 73.23200 42.14700  1.000 111.78113 ? 246 A  B N6    1 
ATOM   6469 N  N1    . A  B 1 144 ? 41.74300 71.39200 40.97700  1.000 113.47344 ? 246 A  B N1    1 
ATOM   6470 C  C2    . A  B 1 144 ? 40.94900 70.31900 40.90900  1.000 113.36816 ? 246 A  B C2    1 
ATOM   6471 N  N3    . A  B 1 144 ? 40.08300 69.85600 41.80300  1.000 108.27808 ? 246 A  B N3    1 
ATOM   6472 C  C4    . A  B 1 144 ? 40.06900 70.63800 42.89500  1.000 112.95759 ? 246 A  B C4    1 
ATOM   6473 P  P     . U  B 1 145 ? 40.36000 66.18100 47.31700  1.000 115.65876 ? 247 U  B P     1 
ATOM   6474 O  OP1   . U  B 1 145 ? 40.07800 64.84200 47.88700  1.000 111.84778 ? 247 U  B OP1   1 
ATOM   6475 O  OP2   . U  B 1 145 ? 40.88100 67.25300 48.20400  1.000 97.45921  ? 247 U  B OP2   1 
ATOM   6476 O  "O5'" . U  B 1 145 ? 41.37900 65.98100 46.11300  1.000 100.17269 ? 247 U  B "O5'" 1 
ATOM   6477 C  "C5'" . U  B 1 145 ? 41.17000 64.94400 45.16800  1.000 107.65517 ? 247 U  B "C5'" 1 
ATOM   6478 C  "C4'" . U  B 1 145 ? 42.07400 65.08700 43.97100  1.000 111.33719 ? 247 U  B "C4'" 1 
ATOM   6479 O  "O4'" . U  B 1 145 ? 41.80200 66.33900 43.29200  1.000 110.69237 ? 247 U  B "O4'" 1 
ATOM   6480 C  "C3'" . U  B 1 145 ? 43.56600 65.13600 44.25600  1.000 109.61066 ? 247 U  B "C3'" 1 
ATOM   6481 O  "O3'" . U  B 1 145 ? 44.11700 63.84700 44.47700  1.000 104.54427 ? 247 U  B "O3'" 1 
ATOM   6482 C  "C2'" . U  B 1 145 ? 44.11400 65.84000 43.01800  1.000 112.30836 ? 247 U  B "C2'" 1 
ATOM   6483 O  "O2'" . U  B 1 145 ? 44.22800 64.92900 41.93300  1.000 117.02208 ? 247 U  B "O2'" 1 
ATOM   6484 C  "C1'" . U  B 1 145 ? 42.98900 66.83400 42.70600  1.000 110.38971 ? 247 U  B "C1'" 1 
ATOM   6485 N  N1    . U  B 1 145 ? 43.26200 68.19500 43.23000  1.000 107.92888 ? 247 U  B N1    1 
ATOM   6486 C  C2    . U  B 1 145 ? 43.99800 69.04900 42.42600  1.000 108.05522 ? 247 U  B C2    1 
ATOM   6487 O  O2    . U  B 1 145 ? 44.42000 68.72700 41.32900  1.000 106.97877 ? 247 U  B O2    1 
ATOM   6488 N  N3    . U  B 1 145 ? 44.22700 70.29800 42.94900  1.000 107.28407 ? 247 U  B N3    1 
ATOM   6489 C  C4    . U  B 1 145 ? 43.80400 70.77400 44.17700  1.000 109.76858 ? 247 U  B C4    1 
ATOM   6490 O  O4    . U  B 1 145 ? 44.08600 71.92800 44.51900  1.000 107.16300 ? 247 U  B O4    1 
ATOM   6491 C  C5    . U  B 1 145 ? 43.04500 69.83000 44.94700  1.000 108.63160 ? 247 U  B C5    1 
ATOM   6492 C  C6    . U  B 1 145 ? 42.80600 68.60700 44.46100  1.000 105.47333 ? 247 U  B C6    1 
ATOM   6493 P  P     . A  B 1 146 ? 45.21700 63.60800 45.62300  1.000 101.53605 ? 248 A  B P     1 
ATOM   6494 O  OP1   . A  B 1 146 ? 45.08100 62.21200 46.10700  1.000 110.23183 ? 248 A  B OP1   1 
ATOM   6495 O  OP2   . A  B 1 146 ? 45.13800 64.73400 46.58400  1.000 109.40278 ? 248 A  B OP2   1 
ATOM   6496 O  "O5'" . A  B 1 146 ? 46.60300 63.70200 44.84600  1.000 110.50818 ? 248 A  B "O5'" 1 
ATOM   6497 C  "C5'" . A  B 1 146 ? 46.81600 62.96000 43.65100  1.000 107.87628 ? 248 A  B "C5'" 1 
ATOM   6498 C  "C4'" . A  B 1 146 ? 48.24700 63.04400 43.18100  1.000 107.66573 ? 248 A  B "C4'" 1 
ATOM   6499 O  "O4'" . A  B 1 146 ? 48.65100 64.44000 43.09100  1.000 104.79960 ? 248 A  B "O4'" 1 
ATOM   6500 C  "C3'" . A  B 1 146 ? 49.28100 62.36200 44.07700  1.000 103.86791 ? 248 A  B "C3'" 1 
ATOM   6501 O  "O3'" . A  B 1 146 ? 50.32200 61.85100 43.24800  1.000 109.32382 ? 248 A  B "O3'" 1 
ATOM   6502 C  "C2'" . A  B 1 146 ? 49.83400 63.53100 44.88300  1.000 102.70198 ? 248 A  B "C2'" 1 
ATOM   6503 O  "O2'" . A  B 1 146 ? 51.11600 63.31300 45.43100  1.000 110.69767 ? 248 A  B "O2'" 1 
ATOM   6504 C  "C1'" . A  B 1 146 ? 49.84600 64.62100 43.82200  1.000 102.93622 ? 248 A  B "C1'" 1 
ATOM   6505 N  N9    . A  B 1 146 ? 49.90700 65.99300 44.32900  1.000 98.85152  ? 248 A  B N9    1 
ATOM   6506 C  C8    . A  B 1 146 ? 49.26300 66.57300 45.39300  1.000 101.34918 ? 248 A  B C8    1 
ATOM   6507 N  N7    . A  B 1 146 ? 49.57400 67.83800 45.55600  1.000 99.84374  ? 248 A  B N7    1 
ATOM   6508 C  C5    . A  B 1 146 ? 50.48400 68.10000 44.53900  1.000 99.78847  ? 248 A  B C5    1 
ATOM   6509 C  C6    . A  B 1 146 ? 51.19100 69.25500 44.16200  1.000 102.89147 ? 248 A  B C6    1 
ATOM   6510 N  N6    . A  B 1 146 ? 51.08600 70.42400 44.79900  1.000 105.43652 ? 248 A  B N6    1 
ATOM   6511 N  N1    . A  B 1 146 ? 52.01900 69.16700 43.09600  1.000 105.42336 ? 248 A  B N1    1 
ATOM   6512 C  C2    . A  B 1 146 ? 52.12400 67.99700 42.45400  1.000 109.27645 ? 248 A  B C2    1 
ATOM   6513 N  N3    . A  B 1 146 ? 51.51000 66.84500 42.71000  1.000 106.40242 ? 248 A  B N3    1 
ATOM   6514 C  C4    . A  B 1 146 ? 50.69900 66.96900 43.77800  1.000 102.21245 ? 248 A  B C4    1 
ATOM   6515 P  P     . U  B 1 147 ? 50.70100 60.29300 43.25800  1.000 114.24154 ? 249 U  B P     1 
ATOM   6516 O  OP1   . U  B 1 147 ? 49.61900 59.54900 42.56700  1.000 118.97632 ? 249 U  B OP1   1 
ATOM   6517 O  OP2   . U  B 1 147 ? 51.08200 59.91100 44.64300  1.000 117.85776 ? 249 U  B OP2   1 
ATOM   6518 O  "O5'" . U  B 1 147 ? 52.00600 60.23500 42.34600  1.000 109.36727 ? 249 U  B "O5'" 1 
ATOM   6519 C  "C5'" . U  B 1 147 ? 51.90600 60.30100 40.93100  1.000 109.42254 ? 249 U  B "C5'" 1 
ATOM   6520 C  "C4'" . U  B 1 147 ? 52.66500 61.48300 40.36200  1.000 110.78323 ? 249 U  B "C4'" 1 
ATOM   6521 O  "O4'" . U  B 1 147 ? 51.75300 62.28000 39.55400  1.000 123.13471 ? 249 U  B "O4'" 1 
ATOM   6522 C  "C3'" . U  B 1 147 ? 53.27600 62.46700 41.34600  1.000 116.56287 ? 249 U  B "C3'" 1 
ATOM   6523 O  "O3'" . U  B 1 147 ? 54.56000 62.03900 41.78800  1.000 120.01065 ? 249 U  B "O3'" 1 
ATOM   6524 C  "C2'" . U  B 1 147 ? 53.33900 63.77600 40.54800  1.000 118.76050 ? 249 U  B "C2'" 1 
ATOM   6525 O  "O2'" . U  B 1 147 ? 54.58500 63.88400 39.86900  1.000 127.04307 ? 249 U  B "O2'" 1 
ATOM   6526 C  "C1'" . U  B 1 147 ? 52.22900 63.60800 39.52200  1.000 122.83468 ? 249 U  B "C1'" 1 
ATOM   6527 N  N1    . U  B 1 147 ? 51.08000 64.55500 39.67300  1.000 121.28186 ? 249 U  B N1    1 
ATOM   6528 C  C2    . U  B 1 147 ? 51.33500 65.90600 39.46800  1.000 119.55797 ? 249 U  B C2    1 
ATOM   6529 O  O2    . U  B 1 147 ? 52.43700 66.35700 39.19800  1.000 119.96854 ? 249 U  B O2    1 
ATOM   6530 N  N3    . U  B 1 147 ? 50.24500 66.73100 39.60200  1.000 117.49983 ? 249 U  B N3    1 
ATOM   6531 C  C4    . U  B 1 147 ? 48.95200 66.35200 39.90500  1.000 120.79759 ? 249 U  B C4    1 
ATOM   6532 O  O4    . U  B 1 147 ? 48.07400 67.21700 39.99300  1.000 125.32182 ? 249 U  B O4    1 
ATOM   6533 C  C5    . U  B 1 147 ? 48.77100 64.94000 40.08400  1.000 119.23161 ? 249 U  B C5    1 
ATOM   6534 C  C6    . U  B 1 147 ? 49.81200 64.11100 39.96000  1.000 118.42888 ? 249 U  B C6    1 
ATOM   6535 P  P     . G  B 1 148 ? 55.26600 62.67800 43.08900  1.000 118.42408 ? 250 G  B P     1 
ATOM   6536 O  OP1   . G  B 1 148 ? 56.69000 62.25800 43.08700  1.000 107.92019 ? 250 G  B OP1   1 
ATOM   6537 O  OP2   . G  B 1 148 ? 54.41000 62.36700 44.26100  1.000 120.55591 ? 250 G  B OP2   1 
ATOM   6538 O  "O5'" . G  B 1 148 ? 55.21900 64.25400 42.86000  1.000 109.05980 ? 250 G  B "O5'" 1 
ATOM   6539 C  "C5'" . G  B 1 148 ? 56.34200 64.97500 42.37500  1.000 110.63104 ? 250 G  B "C5'" 1 
ATOM   6540 C  "C4'" . G  B 1 148 ? 56.50700 66.26700 43.13200  1.000 104.40924 ? 250 G  B "C4'" 1 
ATOM   6541 O  "O4'" . G  B 1 148 ? 55.20400 66.87400 43.33300  1.000 100.92724 ? 250 G  B "O4'" 1 
ATOM   6542 C  "C3'" . G  B 1 148 ? 57.07300 66.13100 44.53300  1.000 100.66142 ? 250 G  B "C3'" 1 
ATOM   6543 O  "O3'" . G  B 1 148 ? 58.48400 66.05000 44.54100  1.000 104.89877 ? 250 G  B "O3'" 1 
ATOM   6544 C  "C2'" . G  B 1 148 ? 56.52200 67.36000 45.24300  1.000 105.05932 ? 250 G  B "C2'" 1 
ATOM   6545 O  "O2'" . G  B 1 148 ? 57.26500 68.52200 44.90400  1.000 102.00106 ? 250 G  B "O2'" 1 
ATOM   6546 C  "C1'" . G  B 1 148 ? 55.13800 67.47100 44.61000  1.000 98.72435  ? 250 G  B "C1'" 1 
ATOM   6547 N  N9    . G  B 1 148 ? 54.11100 66.75600 45.39400  1.000 106.84901 ? 250 G  B N9    1 
ATOM   6548 C  C8    . G  B 1 148 ? 53.51300 65.56500 45.05500  1.000 107.58067 ? 250 G  B C8    1 
ATOM   6549 N  N7    . G  B 1 148 ? 52.62700 65.15800 45.92400  1.000 107.02008 ? 250 G  B N7    1 
ATOM   6550 C  C5    . G  B 1 148 ? 52.63800 66.13800 46.90300  1.000 99.46917  ? 250 G  B C5    1 
ATOM   6551 C  C6    . G  B 1 148 ? 51.88500 66.23600 48.10000  1.000 97.56105  ? 250 G  B C6    1 
ATOM   6552 O  O6    . G  B 1 148 ? 51.03400 65.45600 48.54400  1.000 98.40326  ? 250 G  B O6    1 
ATOM   6553 N  N1    . G  B 1 148 ? 52.20400 67.38800 48.80800  1.000 97.66896  ? 250 G  B N1    1 
ATOM   6554 C  C2    . G  B 1 148 ? 53.12600 68.32700 48.42000  1.000 101.35887 ? 250 G  B C2    1 
ATOM   6555 N  N2    . G  B 1 148 ? 53.28800 69.37400 49.24500  1.000 103.30384 ? 250 G  B N2    1 
ATOM   6556 N  N3    . G  B 1 148 ? 53.83600 68.24700 47.30500  1.000 100.55088 ? 250 G  B N3    1 
ATOM   6557 C  C4    . G  B 1 148 ? 53.54600 67.13400 46.59400  1.000 103.24068 ? 250 G  B C4    1 
ATOM   6558 P  P     . G  B 1 149 ? 59.22900 65.28500 45.73400  1.000 115.76721 ? 251 G  B P     1 
ATOM   6559 O  OP1   . G  B 1 149 ? 60.66500 65.16000 45.38100  1.000 106.97405 ? 251 G  B OP1   1 
ATOM   6560 O  OP2   . G  B 1 149 ? 58.44300 64.06700 46.05500  1.000 107.00300 ? 251 G  B OP2   1 
ATOM   6561 O  "O5'" . G  B 1 149 ? 59.09900 66.29500 46.95400  1.000 104.06844 ? 251 G  B "O5'" 1 
ATOM   6562 C  "C5'" . G  B 1 149 ? 59.02700 65.81200 48.28300  1.000 103.97896 ? 251 G  B "C5'" 1 
ATOM   6563 C  "C4'" . G  B 1 149 ? 58.34700 66.80700 49.18500  1.000 101.07861 ? 251 G  B "C4'" 1 
ATOM   6564 O  "O4'" . G  B 1 149 ? 56.96800 66.98600 48.76900  1.000 102.96305 ? 251 G  B "O4'" 1 
ATOM   6565 C  "C3'" . G  B 1 149 ? 58.24200 66.40400 50.64400  1.000 96.18592  ? 251 G  B "C3'" 1 
ATOM   6566 O  "O3'" . G  B 1 149 ? 59.43800 66.63800 51.36500  1.000 105.21331 ? 251 G  B "O3'" 1 
ATOM   6567 C  "C2'" . G  B 1 149 ? 57.05500 67.22200 51.12900  1.000 98.13615  ? 251 G  B "C2'" 1 
ATOM   6568 O  "O2'" . G  B 1 149 ? 57.43100 68.57400 51.36000  1.000 98.70727  ? 251 G  B "O2'" 1 
ATOM   6569 C  "C1'" . G  B 1 149 ? 56.14600 67.18200 49.90100  1.000 102.43403 ? 251 G  B "C1'" 1 
ATOM   6570 N  N9    . G  B 1 149 ? 55.16700 66.07900 49.95900  1.000 97.94929  ? 251 G  B N9    1 
ATOM   6571 C  C8    . G  B 1 149 ? 55.00500 65.07900 49.03000  1.000 96.18328  ? 251 G  B C8    1 
ATOM   6572 N  N7    . G  B 1 149 ? 54.05300 64.24200 49.33600  1.000 94.54361  ? 251 G  B N7    1 
ATOM   6573 C  C5    . G  B 1 149 ? 53.56000 64.71800 50.54200  1.000 97.87822  ? 251 G  B C5    1 
ATOM   6574 C  C6    . G  B 1 149 ? 52.51900 64.21700 51.36000  1.000 103.05253 ? 251 G  B C6    1 
ATOM   6575 O  O6    . G  B 1 149 ? 51.81000 63.22200 51.16900  1.000 109.21906 ? 251 G  B O6    1 
ATOM   6576 N  N1    . G  B 1 149 ? 52.33900 65.00100 52.49600  1.000 101.23652 ? 251 G  B N1    1 
ATOM   6577 C  C2    . G  B 1 149 ? 53.06600 66.12400 52.80500  1.000 101.42865 ? 251 G  B C2    1 
ATOM   6578 N  N2    . G  B 1 149 ? 52.74200 66.74700 53.95000  1.000 98.03877  ? 251 G  B N2    1 
ATOM   6579 N  N3    . G  B 1 149 ? 54.04200 66.59600 52.04800  1.000 98.76254  ? 251 G  B N3    1 
ATOM   6580 C  C4    . G  B 1 149 ? 54.23400 65.85200 50.94000  1.000 96.39647  ? 251 G  B C4    1 
ATOM   6581 P  P     . A  B 1 150 ? 60.15700 65.42900 52.13700  1.000 111.06807 ? 252 A  B P     1 
ATOM   6582 O  OP1   . A  B 1 150 ? 61.59100 65.77300 52.29000  1.000 114.29478 ? 252 A  B OP1   1 
ATOM   6583 O  OP2   . A  B 1 150 ? 59.79400 64.15900 51.46000  1.000 101.89855 ? 252 A  B OP2   1 
ATOM   6584 O  "O5'" . A  B 1 150 ? 59.47700 65.45600 53.57600  1.000 101.33270 ? 252 A  B "O5'" 1 
ATOM   6585 C  "C5'" . A  B 1 150 ? 59.45800 66.65800 54.33200  1.000 99.21665  ? 252 A  B "C5'" 1 
ATOM   6586 C  "C4'" . A  B 1 150 ? 58.35500 66.67000 55.35900  1.000 98.60869  ? 252 A  B "C4'" 1 
ATOM   6587 O  "O4'" . A  B 1 150 ? 57.06000 66.67900 54.70100  1.000 103.30662 ? 252 A  B "O4'" 1 
ATOM   6588 C  "C3'" . A  B 1 150 ? 58.28200 65.46600 56.27800  1.000 99.15875  ? 252 A  B "C3'" 1 
ATOM   6589 O  "O3'" . A  B 1 150 ? 59.23900 65.50000 57.32100  1.000 96.14523  ? 252 A  B "O3'" 1 
ATOM   6590 C  "C2'" . A  B 1 150 ? 56.83700 65.50500 56.75200  1.000 105.15158 ? 252 A  B "C2'" 1 
ATOM   6591 O  "O2'" . A  B 1 150 ? 56.66100 66.50300 57.74800  1.000 109.69423 ? 252 A  B "O2'" 1 
ATOM   6592 C  "C1'" . A  B 1 150 ? 56.12400 65.96000 55.48100  1.000 100.30099 ? 252 A  B "C1'" 1 
ATOM   6593 N  N9    . A  B 1 150 ? 55.63300 64.81100 54.69700  1.000 95.77940  ? 252 A  B N9    1 
ATOM   6594 C  C8    . A  B 1 150 ? 56.16500 64.27600 53.55500  1.000 97.28747  ? 252 A  B C8    1 
ATOM   6595 N  N7    . A  B 1 150 ? 55.49900 63.24700 53.09500  1.000 98.85608  ? 252 A  B N7    1 
ATOM   6596 C  C5    . A  B 1 150 ? 54.46100 63.09200 54.00100  1.000 100.37732 ? 252 A  B C5    1 
ATOM   6597 C  C6    . A  B 1 150 ? 53.39600 62.17100 54.07100  1.000 105.38845 ? 252 A  B C6    1 
ATOM   6598 N  N6    . A  B 1 150 ? 53.19200 61.19000 53.18200  1.000 107.65188 ? 252 A  B N6    1 
ATOM   6599 N  N1    . A  B 1 150 ? 52.52800 62.29200 55.10300  1.000 103.08291 ? 252 A  B N1    1 
ATOM   6600 C  C2    . A  B 1 150 ? 52.72400 63.27300 55.99600  1.000 106.02536 ? 252 A  B C2    1 
ATOM   6601 N  N3    . A  B 1 150 ? 53.68700 64.19400 56.03000  1.000 106.23065 ? 252 A  B N3    1 
ATOM   6602 C  C4    . A  B 1 150 ? 54.53200 64.04800 54.99600  1.000 101.12741 ? 252 A  B C4    1 
ATOM   6603 P  P     . U  B 1 151 ? 59.98900 64.14900 57.76100  1.000 103.25954 ? 253 U  B P     1 
ATOM   6604 O  OP1   . U  B 1 151 ? 61.05000 64.52900 58.72800  1.000 105.78089 ? 253 U  B OP1   1 
ATOM   6605 O  OP2   . U  B 1 151 ? 60.33600 63.37900 56.53800  1.000 103.22006 ? 253 U  B OP2   1 
ATOM   6606 O  "O5'" . U  B 1 151 ? 58.86800 63.31900 58.53100  1.000 104.63339 ? 253 U  B "O5'" 1 
ATOM   6607 C  "C5'" . U  B 1 151 ? 58.21700 63.86200 59.66800  1.000 107.10737 ? 253 U  B "C5'" 1 
ATOM   6608 C  "C4'" . U  B 1 151 ? 56.92300 63.14700 59.96100  1.000 102.03571 ? 253 U  B "C4'" 1 
ATOM   6609 O  "O4'" . U  B 1 151 ? 56.05700 63.19800 58.79900  1.000 106.91787 ? 253 U  B "O4'" 1 
ATOM   6610 C  "C3'" . U  B 1 151 ? 57.02900 61.66500 60.27400  1.000 103.84645 ? 253 U  B "C3'" 1 
ATOM   6611 O  "O3'" . U  B 1 151 ? 57.41800 61.42400 61.61500  1.000 108.03379 ? 253 U  B "O3'" 1 
ATOM   6612 C  "C2'" . U  B 1 151 ? 55.63400 61.15500 59.94300  1.000 105.65456 ? 253 U  B "C2'" 1 
ATOM   6613 O  "O2'" . U  B 1 151 ? 54.73900 61.44100 61.00900  1.000 113.14756 ? 253 U  B "O2'" 1 
ATOM   6614 C  "C1'" . U  B 1 151 ? 55.26500 62.03000 58.74100  1.000 103.29375 ? 253 U  B "C1'" 1 
ATOM   6615 N  N1    . U  B 1 151 ? 55.49800 61.34900 57.44600  1.000 107.65480 ? 253 U  B N1    1 
ATOM   6616 C  C2    . U  B 1 151 ? 54.53500 60.44300 57.04200  1.000 111.38683 ? 253 U  B C2    1 
ATOM   6617 O  O2    . U  B 1 151 ? 53.54200 60.18900 57.70400  1.000 115.26887 ? 253 U  B O2    1 
ATOM   6618 N  N3    . U  B 1 151 ? 54.77100 59.83600 55.83500  1.000 108.76809 ? 253 U  B N3    1 
ATOM   6619 C  C4    . U  B 1 151 ? 55.85400 60.05000 55.00900  1.000 107.46530 ? 253 U  B C4    1 
ATOM   6620 O  O4    . U  B 1 151 ? 55.92400 59.42400 53.95100  1.000 116.18740 ? 253 U  B O4    1 
ATOM   6621 C  C5    . U  B 1 151 ? 56.80600 61.00700 55.49000  1.000 107.48899 ? 253 U  B C5    1 
ATOM   6622 C  C6    . U  B 1 151 ? 56.59700 61.61100 56.66300  1.000 108.36015 ? 253 U  B C6    1 
ATOM   6623 P  P     . G  B 1 152 ? 58.60300 60.39500 61.94200  1.000 113.73875 ? 254 G  B P     1 
ATOM   6624 O  OP1   . G  B 1 152 ? 59.79400 60.80400 61.15700  1.000 112.42281 ? 254 G  B OP1   1 
ATOM   6625 O  OP2   . G  B 1 152 ? 58.07200 59.01600 61.79900  1.000 108.00649 ? 254 G  B OP2   1 
ATOM   6626 O  "O5'" . G  B 1 152 ? 58.91200 60.66100 63.48100  1.000 102.30580 ? 254 G  B "O5'" 1 
ATOM   6627 C  "C5'" . G  B 1 152 ? 59.60000 61.83400 63.89400  1.000 102.42687 ? 254 G  B "C5'" 1 
ATOM   6628 C  "C4'" . G  B 1 152 ? 59.12500 62.31300 65.24400  1.000 110.98842 ? 254 G  B "C4'" 1 
ATOM   6629 O  "O4'" . G  B 1 152 ? 57.87100 63.02900 65.10200  1.000 110.01725 ? 254 G  B "O4'" 1 
ATOM   6630 C  "C3'" . G  B 1 152 ? 58.81700 61.23400 66.26900  1.000 107.67750 ? 254 G  B "C3'" 1 
ATOM   6631 O  "O3'" . G  B 1 152 ? 59.97900 60.72600 66.90300  1.000 107.02216 ? 254 G  B "O3'" 1 
ATOM   6632 C  "C2'" . G  B 1 152 ? 57.85900 61.94400 67.21700  1.000 110.04620 ? 254 G  B "C2'" 1 
ATOM   6633 O  "O2'" . G  B 1 152 ? 58.57700 62.79500 68.09900  1.000 117.41288 ? 254 G  B "O2'" 1 
ATOM   6634 C  "C1'" . G  B 1 152 ? 57.06200 62.81300 66.24200  1.000 108.37758 ? 254 G  B "C1'" 1 
ATOM   6635 N  N9    . G  B 1 152 ? 55.80200 62.16800 65.82100  1.000 105.10877 ? 254 G  B N9    1 
ATOM   6636 C  C8    . G  B 1 152 ? 55.48600 61.73000 64.56000  1.000 109.85144 ? 254 G  B C8    1 
ATOM   6637 N  N7    . G  B 1 152 ? 54.30100 61.20000 64.48300  1.000 108.39601 ? 254 G  B N7    1 
ATOM   6638 C  C5    . G  B 1 152 ? 53.80100 61.29100 65.77300  1.000 108.69604 ? 254 G  B C5    1 
ATOM   6639 C  C6    . G  B 1 152 ? 52.55000 60.87300 66.29900  1.000 114.02826 ? 254 G  B C6    1 
ATOM   6640 O  O6    . G  B 1 152 ? 51.61300 60.32500 65.69800  1.000 111.56481 ? 254 G  B O6    1 
ATOM   6641 N  N1    . G  B 1 152 ? 52.44700 61.15700 67.66100  1.000 109.36718 ? 254 G  B N1    1 
ATOM   6642 C  C2    . G  B 1 152 ? 53.42700 61.76100 68.41200  1.000 109.51983 ? 254 G  B C2    1 
ATOM   6643 N  N2    . G  B 1 152 ? 53.14200 61.94900 69.70900  1.000 115.39685 ? 254 G  B N2    1 
ATOM   6644 N  N3    . G  B 1 152 ? 54.59600 62.15100 67.92900  1.000 111.73851 ? 254 G  B N3    1 
ATOM   6645 C  C4    . G  B 1 152 ? 54.71400 61.88700 66.61200  1.000 107.28798 ? 254 G  B C4    1 
ATOM   6646 P  P     . C  B 1 153 ? 60.06300 59.17400 67.31300  1.000 112.30276 ? 255 C  B P     1 
ATOM   6647 O  OP1   . C  B 1 153 ? 61.39200 58.93700 67.93100  1.000 110.39726 ? 255 C  B OP1   1 
ATOM   6648 O  OP2   . C  B 1 153 ? 59.63100 58.35400 66.15000  1.000 107.51008 ? 255 C  B OP2   1 
ATOM   6649 O  "O5'" . C  B 1 153 ? 58.99000 59.03200 68.47900  1.000 123.15143 ? 255 C  B "O5'" 1 
ATOM   6650 C  "C5'" . C  B 1 153 ? 59.15000 59.75400 69.69100  1.000 125.18325 ? 255 C  B "C5'" 1 
ATOM   6651 C  "C4'" . C  B 1 153 ? 57.97100 59.56700 70.61100  1.000 118.95619 ? 255 C  B "C4'" 1 
ATOM   6652 O  "O4'" . C  B 1 153 ? 56.78600 60.16900 70.02400  1.000 118.51929 ? 255 C  B "O4'" 1 
ATOM   6653 C  "C3'" . C  B 1 153 ? 57.56100 58.13100 70.87100  1.000 124.54633 ? 255 C  B "C3'" 1 
ATOM   6654 O  "O3'" . C  B 1 153 ? 58.37400 57.49200 71.83900  1.000 122.81454 ? 255 C  B "O3'" 1 
ATOM   6655 C  "C2'" . C  B 1 153 ? 56.10300 58.27300 71.27900  1.000 126.30970 ? 255 C  B "C2'" 1 
ATOM   6656 O  "O2'" . C  B 1 153 ? 56.00100 58.72700 72.62200  1.000 122.88560 ? 255 C  B "O2'" 1 
ATOM   6657 C  "C1'" . C  B 1 153 ? 55.64600 59.39800 70.35000  1.000 120.66428 ? 255 C  B "C1'" 1 
ATOM   6658 N  N1    . C  B 1 153 ? 55.05300 58.87300 69.09600  1.000 110.81047 ? 255 C  B N1    1 
ATOM   6659 C  C2    . C  B 1 153 ? 53.76500 58.32600 69.11600  1.000 115.88476 ? 255 C  B C2    1 
ATOM   6660 O  O2    . C  B 1 153 ? 53.13300 58.29200 70.18200  1.000 121.88548 ? 255 C  B O2    1 
ATOM   6661 N  N3    . C  B 1 153 ? 53.23000 57.84900 67.96800  1.000 118.81933 ? 255 C  B N3    1 
ATOM   6662 C  C4    . C  B 1 153 ? 53.93000 57.89800 66.83200  1.000 114.37932 ? 255 C  B C4    1 
ATOM   6663 N  N4    . C  B 1 153 ? 53.36300 57.41800 65.72200  1.000 111.20526 ? 255 C  B N4    1 
ATOM   6664 C  C5    . C  B 1 153 ? 55.24200 58.45100 66.78300  1.000 113.18970 ? 255 C  B C5    1 
ATOM   6665 C  C6    . C  B 1 153 ? 55.75600 58.91900 67.92600  1.000 114.42406 ? 255 C  B C6    1 
ATOM   6666 P  P     . A  B 1 154 ? 59.06600 56.08400 71.49900  1.000 137.89068 ? 256 A  B P     1 
ATOM   6667 O  OP1   . A  B 1 154 ? 59.92200 55.71300 72.65100  1.000 125.18126 ? 256 A  B OP1   1 
ATOM   6668 O  OP2   . A  B 1 154 ? 59.66100 56.15300 70.14000  1.000 138.21966 ? 256 A  B OP2   1 
ATOM   6669 O  "O5'" . A  B 1 154 ? 57.83900 55.07200 71.43700  1.000 131.67151 ? 256 A  B "O5'" 1 
ATOM   6670 C  "C5'" . A  B 1 154 ? 56.86900 55.04900 72.47300  1.000 129.25543 ? 256 A  B "C5'" 1 
ATOM   6671 C  "C4'" . A  B 1 154 ? 55.58000 54.40700 72.02500  1.000 123.60738 ? 256 A  B "C4'" 1 
ATOM   6672 O  "O4'" . A  B 1 154 ? 54.89900 55.24000 71.05000  1.000 121.46239 ? 256 A  B "O4'" 1 
ATOM   6673 C  "C3'" . A  B 1 154 ? 55.71100 53.07200 71.32200  1.000 128.44744 ? 256 A  B "C3'" 1 
ATOM   6674 O  "O3'" . A  B 1 154 ? 55.94800 52.00500 72.22000  1.000 137.16954 ? 256 A  B "O3'" 1 
ATOM   6675 C  "C2'" . A  B 1 154 ? 54.39200 52.96700 70.56900  1.000 126.67091 ? 256 A  B "C2'" 1 
ATOM   6676 O  "O2'" . A  B 1 154 ? 53.34000 52.58300 71.44300  1.000 134.44553 ? 256 A  B "O2'" 1 
ATOM   6677 C  "C1'" . A  B 1 154 ? 54.17400 54.42200 70.15100  1.000 123.48632 ? 256 A  B "C1'" 1 
ATOM   6678 N  N9    . A  B 1 154 ? 54.66000 54.66200 68.78100  1.000 122.17563 ? 256 A  B N9    1 
ATOM   6679 C  C8    . A  B 1 154 ? 55.73400 55.40500 68.36300  1.000 123.93637 ? 256 A  B C8    1 
ATOM   6680 N  N7    . A  B 1 154 ? 55.89700 55.39800 67.06200  1.000 125.94187 ? 256 A  B N7    1 
ATOM   6681 C  C5    . A  B 1 154 ? 54.86200 54.60000 66.59600  1.000 121.49397 ? 256 A  B C5    1 
ATOM   6682 C  C6    . A  B 1 154 ? 54.47900 54.19800 65.30400  1.000 125.67605 ? 256 A  B C6    1 
ATOM   6683 N  N6    . A  B 1 154 ? 55.11500 54.56300 64.18900  1.000 132.31369 ? 256 A  B N6    1 
ATOM   6684 N  N1    . A  B 1 154 ? 53.39800 53.39600 65.18700  1.000 128.52376 ? 256 A  B N1    1 
ATOM   6685 C  C2    . A  B 1 154 ? 52.75400 53.02700 66.30200  1.000 129.32386 ? 256 A  B C2    1 
ATOM   6686 N  N3    . A  B 1 154 ? 53.01700 53.34000 67.56900  1.000 127.79736 ? 256 A  B N3    1 
ATOM   6687 C  C4    . A  B 1 154 ? 54.09600 54.13700 67.64600  1.000 123.69424 ? 256 A  B C4    1 
ATOM   6688 P  P     . G  B 1 155 ? 57.18400 51.01200 71.97400  1.000 143.26598 ? 257 G  B P     1 
ATOM   6689 O  OP1   . G  B 1 155 ? 57.37900 50.22100 73.21500  1.000 136.52044 ? 257 G  B OP1   1 
ATOM   6690 O  OP2   . G  B 1 155 ? 58.32800 51.80000 71.44300  1.000 128.72213 ? 257 G  B OP2   1 
ATOM   6691 O  "O5'" . G  B 1 155 ? 56.65400 50.04300 70.82600  1.000 121.39757 ? 257 G  B "O5'" 1 
ATOM   6692 C  "C5'" . G  B 1 155 ? 55.32300 49.54700 70.86200  1.000 121.43179 ? 257 G  B "C5'" 1 
ATOM   6693 C  "C4'" . G  B 1 155 ? 54.83000 49.16700 69.49000  1.000 126.51924 ? 257 G  B "C4'" 1 
ATOM   6694 O  "O4'" . G  B 1 155 ? 54.70600 50.34200 68.64700  1.000 132.04622 ? 257 G  B "O4'" 1 
ATOM   6695 C  "C3'" . G  B 1 155 ? 55.73500 48.24900 68.69600  1.000 135.66770 ? 257 G  B "C3'" 1 
ATOM   6696 O  "O3'" . G  B 1 155 ? 55.63500 46.90100 69.11000  1.000 137.53109 ? 257 G  B "O3'" 1 
ATOM   6697 C  "C2'" . G  B 1 155 ? 55.29100 48.49700 67.26000  1.000 136.22830 ? 257 G  B "C2'" 1 
ATOM   6698 O  "O2'" . G  B 1 155 ? 54.09900 47.78300 66.96100  1.000 133.61746 ? 257 G  B "O2'" 1 
ATOM   6699 C  "C1'" . G  B 1 155 ? 54.96600 49.99400 67.30100  1.000 135.37556 ? 257 G  B "C1'" 1 
ATOM   6700 N  N9    . G  B 1 155 ? 56.08300 50.81600 66.79500  1.000 129.48012 ? 257 G  B N9    1 
ATOM   6701 C  C8    . G  B 1 155 ? 56.94800 51.60100 67.51600  1.000 127.06667 ? 257 G  B C8    1 
ATOM   6702 N  N7    . G  B 1 155 ? 57.83300 52.20500 66.77000  1.000 132.47258 ? 257 G  B N7    1 
ATOM   6703 C  C5    . G  B 1 155 ? 57.54000 51.79500 65.47800  1.000 128.25103 ? 257 G  B C5    1 
ATOM   6704 C  C6    . G  B 1 155 ? 58.16200 52.12200 64.24500  1.000 126.75611 ? 257 G  B C6    1 
ATOM   6705 O  O6    . G  B 1 155 ? 59.13000 52.86600 64.04200  1.000 126.47450 ? 257 G  B O6    1 
ATOM   6706 N  N1    . G  B 1 155 ? 57.54000 51.48300 63.17800  1.000 135.87299 ? 257 G  B N1    1 
ATOM   6707 C  C2    . G  B 1 155 ? 56.46100 50.63800 63.27700  1.000 136.59940 ? 257 G  B C2    1 
ATOM   6708 N  N2    . G  B 1 155 ? 55.99700 50.11600 62.13100  1.000 137.47055 ? 257 G  B N2    1 
ATOM   6709 N  N3    . G  B 1 155 ? 55.87500 50.32800 64.42200  1.000 132.16992 ? 257 G  B N3    1 
ATOM   6710 C  C4    . G  B 1 155 ? 56.46100 50.93700 65.47600  1.000 128.31419 ? 257 G  B C4    1 
ATOM   6711 P  P     . U  B 1 156 ? 56.89000 45.92200 68.92500  1.000 148.54436 ? 258 U  B P     1 
ATOM   6712 O  OP1   . U  B 1 156 ? 56.91200 44.99500 70.08400  1.000 141.97252 ? 258 U  B OP1   1 
ATOM   6713 O  OP2   . U  B 1 156 ? 58.09600 46.73800 68.62100  1.000 133.21621 ? 258 U  B OP2   1 
ATOM   6714 O  "O5'" . U  B 1 156 ? 56.52600 45.10700 67.60900  1.000 135.97443 ? 258 U  B "O5'" 1 
ATOM   6715 C  "C5'" . U  B 1 156 ? 57.54700 44.66000 66.73700  1.000 132.68720 ? 258 U  B "C5'" 1 
ATOM   6716 C  "C4'" . U  B 1 156 ? 57.00300 44.31700 65.37500  1.000 137.97994 ? 258 U  B "C4'" 1 
ATOM   6717 O  "O4'" . U  B 1 156 ? 56.49300 45.51400 64.72400  1.000 141.52773 ? 258 U  B "O4'" 1 
ATOM   6718 C  "C3'" . U  B 1 156 ? 58.02500 43.77100 64.39500  1.000 145.67033 ? 258 U  B "C3'" 1 
ATOM   6719 O  "O3'" . U  B 1 156 ? 58.29600 42.39700 64.59800  1.000 151.93950 ? 258 U  B "O3'" 1 
ATOM   6720 C  "C2'" . U  B 1 156 ? 57.40100 44.10100 63.04600  1.000 139.46169 ? 258 U  B "C2'" 1 
ATOM   6721 O  "O2'" . U  B 1 156 ? 56.35800 43.18500 62.73300  1.000 144.26227 ? 258 U  B "O2'" 1 
ATOM   6722 C  "C1'" . U  B 1 156 ? 56.78100 45.46900 63.34000  1.000 140.32232 ? 258 U  B "C1'" 1 
ATOM   6723 N  N1    . U  B 1 156 ? 57.70600 46.58700 63.02800  1.000 134.91115 ? 258 U  B N1    1 
ATOM   6724 C  C2    . U  B 1 156 ? 58.05000 46.84000 61.70800  1.000 135.59281 ? 258 U  B C2    1 
ATOM   6725 O  O2    . U  B 1 156 ? 57.63200 46.19300 60.76200  1.000 137.14826 ? 258 U  B O2    1 
ATOM   6726 N  N3    . U  B 1 156 ? 58.91300 47.89200 61.52900  1.000 134.75323 ? 258 U  B N3    1 
ATOM   6727 C  C4    . U  B 1 156 ? 59.45600 48.69700 62.51500  1.000 129.51576 ? 258 U  B C4    1 
ATOM   6728 O  O4    . U  B 1 156 ? 60.21900 49.61300 62.19900  1.000 128.08138 ? 258 U  B O4    1 
ATOM   6729 C  C5    . U  B 1 156 ? 59.05300 48.37300 63.85000  1.000 127.89978 ? 258 U  B C5    1 
ATOM   6730 C  C6    . U  B 1 156 ? 58.21600 47.35400 64.05100  1.000 132.39506 ? 258 U  B C6    1 
ATOM   6731 P  P     . U  B 1 157 ? 59.71500 41.94200 65.19800  1.000 145.63872 ? 259 U  B P     1 
ATOM   6732 O  OP1   . U  B 1 157 ? 59.55500 40.59000 65.78900  1.000 135.47697 ? 259 U  B OP1   1 
ATOM   6733 O  OP2   . U  B 1 157 ? 60.22400 43.04000 66.05700  1.000 129.87893 ? 259 U  B OP2   1 
ATOM   6734 O  "O5'" . U  B 1 157 ? 60.65200 41.85300 63.91100  1.000 139.06687 ? 259 U  B "O5'" 1 
ATOM   6735 C  "C5'" . U  B 1 157 ? 60.15900 41.31600 62.69000  1.000 132.93982 ? 259 U  B "C5'" 1 
ATOM   6736 C  "C4'" . U  B 1 157 ? 60.97500 41.76000 61.49800  1.000 140.48547 ? 259 U  B "C4'" 1 
ATOM   6737 O  "O4'" . U  B 1 157 ? 60.68400 43.14100 61.16700  1.000 138.68525 ? 259 U  B "O4'" 1 
ATOM   6738 C  "C3'" . U  B 1 157 ? 62.48300 41.73900 61.66800  1.000 138.80895 ? 259 U  B "C3'" 1 
ATOM   6739 O  "O3'" . U  B 1 157 ? 63.03300 40.44100 61.55200  1.000 143.64374 ? 259 U  B "O3'" 1 
ATOM   6740 C  "C2'" . U  B 1 157 ? 62.95100 42.70500 60.58800  1.000 132.39502 ? 259 U  B "C2'" 1 
ATOM   6741 O  "O2'" . U  B 1 157 ? 62.95700 42.07300 59.31700  1.000 139.53798 ? 259 U  B "O2'" 1 
ATOM   6742 C  "C1'" . U  B 1 157 ? 61.83300 43.75100 60.61100  1.000 131.33437 ? 259 U  B "C1'" 1 
ATOM   6743 N  N1    . U  B 1 157 ? 62.19500 44.93300 61.42600  1.000 130.47111 ? 259 U  B N1    1 
ATOM   6744 C  C2    . U  B 1 157 ? 63.07500 45.84700 60.87000  1.000 126.75487 ? 259 U  B C2    1 
ATOM   6745 O  O2    . U  B 1 157 ? 63.55300 45.72000 59.75400  1.000 129.49994 ? 259 U  B O2    1 
ATOM   6746 N  N3    . U  B 1 157 ? 63.38000 46.92400 61.66700  1.000 122.29381 ? 259 U  B N3    1 
ATOM   6747 C  C4    . U  B 1 157 ? 62.90700 47.17700 62.94000  1.000 123.34657 ? 259 U  B C4    1 
ATOM   6748 O  O4    . U  B 1 157 ? 63.27000 48.19500 63.53500  1.000 118.91972 ? 259 U  B O4    1 
ATOM   6749 C  C5    . U  B 1 157 ? 62.00300 46.18500 63.44300  1.000 125.11783 ? 259 U  B C5    1 
ATOM   6750 C  C6    . U  B 1 157 ? 61.68500 45.12400 62.69000  1.000 129.72102 ? 259 U  B C6    1 
ATOM   6751 P  P     . C  B 1 158 ? 64.16100 39.95600 62.58300  1.000 140.56766 ? 260 C  B P     1 
ATOM   6752 O  OP1   . C  B 1 158 ? 64.16600 38.47300 62.55800  1.000 141.60200 ? 260 C  B OP1   1 
ATOM   6753 O  OP2   . C  B 1 158 ? 63.94700 40.67300 63.86600  1.000 130.02429 ? 260 C  B OP2   1 
ATOM   6754 O  "O5'" . C  B 1 158 ? 65.52000 40.48600 61.94100  1.000 130.40592 ? 260 C  B "O5'" 1 
ATOM   6755 C  "C5'" . C  B 1 158 ? 65.96000 40.01400 60.67600  1.000 132.79831 ? 260 C  B "C5'" 1 
ATOM   6756 C  "C4'" . C  B 1 158 ? 67.18200 40.75600 60.18700  1.000 141.00456 ? 260 C  B "C4'" 1 
ATOM   6757 O  "O4'" . C  B 1 158 ? 66.86800 42.15500 59.96400  1.000 133.61946 ? 260 C  B "O4'" 1 
ATOM   6758 C  "C3'" . C  B 1 158 ? 68.37500 40.79500 61.12500  1.000 136.91196 ? 260 C  B "C3'" 1 
ATOM   6759 O  "O3'" . C  B 1 158 ? 69.12600 39.59400 61.11200  1.000 137.98840 ? 260 C  B "O3'" 1 
ATOM   6760 C  "C2'" . C  B 1 158 ? 69.14900 42.00700 60.62300  1.000 133.02728 ? 260 C  B "C2'" 1 
ATOM   6761 O  "O2'" . C  B 1 158 ? 69.89900 41.67900 59.46200  1.000 129.48739 ? 260 C  B "O2'" 1 
ATOM   6762 C  "C1'" . C  B 1 158 ? 68.01100 42.94800 60.21500  1.000 125.77641 ? 260 C  B "C1'" 1 
ATOM   6763 N  N1    . C  B 1 158 ? 67.70000 43.93200 61.27900  1.000 123.23400 ? 260 C  B N1    1 
ATOM   6764 C  C2    . C  B 1 158 ? 68.45200 45.11200 61.32800  1.000 121.37589 ? 260 C  B C2    1 
ATOM   6765 O  O2    . C  B 1 158 ? 69.33800 45.29300 60.47700  1.000 122.89449 ? 260 C  B O2    1 
ATOM   6766 N  N3    . C  B 1 158 ? 68.19400 46.02400 62.29700  1.000 116.79639 ? 260 C  B N3    1 
ATOM   6767 C  C4    . C  B 1 158 ? 67.23300 45.79500 63.19500  1.000 118.12286 ? 260 C  B C4    1 
ATOM   6768 N  N4    . C  B 1 158 ? 67.01200 46.72300 64.13300  1.000 114.83036 ? 260 C  B N4    1 
ATOM   6769 C  C5    . C  B 1 158 ? 66.45500 44.59800 63.16600  1.000 123.74722 ? 260 C  B C5    1 
ATOM   6770 C  C6    . C  B 1 158 ? 66.71900 43.70300 62.20400  1.000 128.35830 ? 260 C  B C6    1 
HETATM 6771 MG MG    . MG C 2 .   ? 36.63000 62.86000 68.76200  1.000 94.75841  2 301 MG A MG    1 
HETATM 6772 MG MG    . MG D 2 .   ? 35.14600 64.71300 76.17300  1.000 87.03172  2 302 MG A MG    1 
HETATM 6773 MG MG    . MG E 2 .   ? 29.50100 64.96800 77.50700  1.000 107.01286 2 303 MG A MG    1 
HETATM 6774 MG MG    . MG F 2 .   ? 40.46100 78.22800 72.19000  1.000 119.54487 2 304 MG A MG    1 
HETATM 6775 MG MG    . MG G 2 .   ? 43.23000 62.56100 70.14100  1.000 105.05422 2 305 MG A MG    1 
HETATM 6776 MG MG    . MG H 2 .   ? 50.36700 70.69600 67.86600  1.000 90.31958  2 306 MG A MG    1 
HETATM 6777 MG MG    . MG I 2 .   ? 27.16100 50.58600 63.67300  1.000 116.85156 2 307 MG A MG    1 
HETATM 6778 MG MG    . MG J 2 .   ? 57.90300 60.84200 103.14900 1.000 114.39234 2 308 MG A MG    1 
HETATM 6779 MG MG    . MG K 2 .   ? 50.39300 69.32300 88.73600  1.000 127.13062 2 309 MG A MG    1 
HETATM 6780 MG MG    . MG L 2 .   ? 28.29500 49.91500 70.39300  1.000 109.32591 2 310 MG A MG    1 
HETATM 6781 MG MG    . MG M 2 .   ? 73.31800 58.52600 79.93500  1.000 93.62741  2 301 MG B MG    1 
HETATM 6782 MG MG    . MG N 2 .   ? 74.94100 59.92500 72.18600  1.000 78.61044  2 302 MG B MG    1 
HETATM 6783 MG MG    . MG O 2 .   ? 80.56700 58.62600 70.57900  1.000 96.97531  2 303 MG B MG    1 
HETATM 6784 MG MG    . MG P 2 .   ? 72.76400 74.24800 76.25600  1.000 110.05927 2 304 MG B MG    1 
HETATM 6785 MG MG    . MG Q 2 .   ? 80.21400 43.21400 83.40600  1.000 105.17872 2 305 MG B MG    1 
HETATM 6786 MG MG    . MG R 2 .   ? 66.31500 59.20200 78.77900  1.000 91.81472  2 306 MG B MG    1 
HETATM 6787 MG MG    . MG S 2 .   ? 77.71000 43.51800 77.25700  1.000 95.04440  2 307 MG B MG    1 
HETATM 6788 MG MG    . MG T 2 .   ? 61.28300 68.12700 80.78200  1.000 93.58113  2 308 MG B MG    1 
HETATM 6789 MG MG    . MG U 2 .   ? 53.37500 61.16200 45.52800  1.000 109.61381 2 309 MG B MG    1 
HETATM 6790 MG MG    . MG V 2 .   ? 78.28500 33.32000 80.33800  1.000 92.32120  2 310 MG B MG    1 
# 
loop_
_atom_site_anisotrop.id 
_atom_site_anisotrop.type_symbol 
_atom_site_anisotrop.pdbx_label_atom_id 
_atom_site_anisotrop.pdbx_label_alt_id 
_atom_site_anisotrop.pdbx_label_comp_id 
_atom_site_anisotrop.pdbx_label_asym_id 
_atom_site_anisotrop.pdbx_label_seq_id 
_atom_site_anisotrop.pdbx_PDB_ins_code 
_atom_site_anisotrop.U[1][1] 
_atom_site_anisotrop.U[2][2] 
_atom_site_anisotrop.U[3][3] 
_atom_site_anisotrop.U[1][2] 
_atom_site_anisotrop.U[1][3] 
_atom_site_anisotrop.U[2][3] 
_atom_site_anisotrop.pdbx_auth_seq_id 
_atom_site_anisotrop.pdbx_auth_comp_id 
_atom_site_anisotrop.pdbx_auth_asym_id 
_atom_site_anisotrop.pdbx_auth_atom_id 
1    O  OP3   . G  A 1   ? 2.41032 2.37582 2.27732 0.02390  0.06620  0.03070  103 G  A OP3   
2    P  P     . G  A 1   ? 2.55802 2.51792 2.43212 0.02270  0.06680  0.03160  103 G  A P     
3    O  OP1   . G  A 1   ? 2.29652 2.26012 2.17842 0.02320  0.06700  0.02570  103 G  A OP1   
4    O  OP2   . G  A 1   ? 2.47592 2.42852 2.34972 0.02490  0.06300  0.03590  103 G  A OP2   
5    O  "O5'" . G  A 1   ? 2.42912 2.38772 2.30252 0.01830  0.07180  0.03480  103 G  A "O5'" 
6    C  "C5'" . G  A 1   ? 2.31992 2.28462 2.19042 0.01610  0.07610  0.03330  103 G  A "C5'" 
7    C  "C4'" . G  A 1   ? 2.36292 2.32872 2.22252 0.01570  0.07700  0.03710  103 G  A "C4'" 
8    O  "O4'" . G  A 1   ? 2.27782 2.25132 2.13422 0.01620  0.07820  0.03230  103 G  A "O4'" 
9    C  "C3'" . G  A 1   ? 2.37882 2.34342 2.23482 0.01190  0.08200  0.04210  103 G  A "C3'" 
10   O  "O3'" . G  A 1   ? 2.46042 2.41692 2.31682 0.01080  0.08140  0.04860  103 G  A "O3'" 
11   C  "C2'" . G  A 1   ? 2.31452 2.28442 2.15922 0.01220  0.08320  0.04260  103 G  A "C2'" 
12   O  "O2'" . G  A 1   ? 2.22782 2.19442 2.06432 0.01470  0.07890  0.04730  103 G  A "O2'" 
13   C  "C1'" . G  A 1   ? 2.24702 2.22322 2.09492 0.01410  0.08190  0.03460  103 G  A "C1'" 
14   N  N9    . G  A 1   ? 2.24012 2.22152 2.09212 0.01180  0.08710  0.03030  103 G  A N9    
15   C  C8    . G  A 1   ? 2.15212 2.13552 2.01432 0.01180  0.08790  0.02550  103 G  A C8    
16   N  N7    . G  A 1   ? 2.14922 2.13732 2.01382 0.00990  0.09270  0.02290  103 G  A N7    
17   C  C5    . G  A 1   ? 2.23102 2.22082 2.08622 0.00830  0.09570  0.02560  103 G  A C5    
18   C  C6    . G  A 1   ? 2.19762 2.19272 2.05092 0.00610  0.10160  0.02390  103 G  A C6    
19   O  O6    . G  A 1   ? 2.16412 2.16332 2.02482 0.00530  0.10520  0.01960  103 G  A O6    
20   N  N1    . G  A 1   ? 2.16942 2.16522 2.01072 0.00510  0.10340  0.02790  103 G  A N1    
21   C  C2    . G  A 1   ? 2.20812 2.19952 2.04052 0.00630  0.09950  0.03360  103 G  A C2    
22   N  N2    . G  A 1   ? 2.21582 2.20912 2.03602 0.00520  0.10190  0.03770  103 G  A N2    
23   N  N3    . G  A 1   ? 2.20522 2.19122 2.04042 0.00860  0.09360  0.03510  103 G  A N3    
24   C  C4    . G  A 1   ? 2.24462 2.23032 2.09132 0.00940  0.09230  0.03060  103 G  A C4    
25   P  P     . A  A 2   ? 2.55676 2.51066 2.41966 0.00610  0.08630  0.05130  104 A  A P     
26   O  OP1   . A  A 2   ? 2.49166 2.43736 2.36286 0.00630  0.08330  0.05270  104 A  A OP1   
27   O  OP2   . A  A 2   ? 2.44326 2.40476 2.31106 0.00430  0.09020  0.04560  104 A  A OP2   
28   O  "O5'" . A  A 2   ? 2.46726 2.41976 2.32026 0.00360  0.09010  0.05930  104 A  A "O5'" 
29   C  "C5'" . A  A 2   ? 2.47636 2.43156 2.31626 0.00560  0.08900  0.06180  104 A  A "C5'" 
30   C  "C4'" . A  A 2   ? 2.50926 2.47086 2.34146 0.00250  0.09540  0.06320  104 A  A "C4'" 
31   O  "O4'" . A  A 2   ? 2.41546 2.38586 2.24966 0.00280  0.09740  0.05470  104 A  A "O4'" 
32   C  "C3'" . A  A 2   ? 2.60316 2.56316 2.43976 -0.00260 0.10190  0.06750  104 A  A "C3'" 
33   O  "O3'" . A  A 2   ? 2.72716 2.67976 2.55836 -0.00400 0.10230  0.07750  104 A  A "O3'" 
34   C  "C2'" . A  A 2   ? 2.57696 2.54686 2.40886 -0.00450 0.10810  0.06400  104 A  A "C2'" 
35   O  "O2'" . A  A 2   ? 2.61246 2.58446 2.42956 -0.00480 0.11030  0.06960  104 A  A "O2'" 
36   C  "C1'" . A  A 2   ? 2.41846 2.39406 2.25146 -0.00080 0.10460  0.05490  104 A  A "C1'" 
37   N  N9    . A  A 2   ? 2.35196 2.33216 2.19696 -0.00180 0.10710  0.04780  104 A  A N9    
38   C  C8    . A  A 2   ? 2.31156 2.29086 2.16656 0.00010  0.10330  0.04250  104 A  A C8    
39   N  N7    . A  A 2   ? 2.27616 2.26066 2.13996 -0.00100 0.10640  0.03750  104 A  A N7    
40   C  C5    . A  A 2   ? 2.28816 2.27746 2.14836 -0.00380 0.11290  0.03880  104 A  A C5    
41   C  C6    . A  A 2   ? 2.24726 2.24336 2.11396 -0.00580 0.11850  0.03500  104 A  A C6    
42   N  N6    . A  A 2   ? 2.19876 2.19776 2.07716 -0.00500 0.11810  0.02960  104 A  A N6    
43   N  N1    . A  A 2   ? 2.27166 2.27206 2.13246 -0.00840 0.12490  0.03710  104 A  A N1    
44   C  C2    . A  A 2   ? 2.29286 2.29066 2.14096 -0.00910 0.12520  0.04330  104 A  A C2    
45   N  N3    . A  A 2   ? 2.36416 2.35516 2.20486 -0.00720 0.11970  0.04800  104 A  A N3    
46   C  C4    . A  A 2   ? 2.36066 2.34756 2.20866 -0.00450 0.11360  0.04500  104 A  A C4    
47   P  P     . A  A 3   ? 2.83592 2.78152 2.67702 -0.00880 0.10600  0.08290  105 A  A P     
48   O  OP1   . A  A 3   ? 2.74962 2.69272 2.58052 -0.01140 0.11020  0.09330  105 A  A OP1   
49   O  OP2   . A  A 3   ? 2.71552 2.65272 2.56742 -0.00700 0.10040  0.08160  105 A  A OP2   
50   O  "O5'" . A  A 3   ? 2.67152 2.62532 2.52192 -0.01240 0.11200  0.07650  105 A  A "O5'" 
51   C  "C5'" . A  A 3   ? 2.66692 2.62072 2.52272 -0.01790 0.11870  0.08070  105 A  A "C5'" 
52   C  "C4'" . A  A 3   ? 2.65062 2.61442 2.49922 -0.02010 0.12590  0.08020  105 A  A "C4'" 
53   O  "O4'" . A  A 3   ? 2.55762 2.53002 2.40772 -0.01720 0.12500  0.07030  105 A  A "O4'" 
54   C  "C3'" . A  A 3   ? 2.66982 2.63662 2.52752 -0.02600 0.13370  0.08210  105 A  A "C3'" 
55   O  "O3'" . A  A 3   ? 2.73362 2.70652 2.58002 -0.02820 0.14080  0.08640  105 A  A "O3'" 
56   C  "C2'" . A  A 3   ? 2.60772 2.58242 2.47752 -0.02550 0.13400  0.07170  105 A  A "C2'" 
57   O  "O2'" . A  A 3   ? 2.62182 2.60462 2.49822 -0.02960 0.14180  0.07030  105 A  A "O2'" 
58   C  "C1'" . A  A 3   ? 2.54932 2.52892 2.40982 -0.02030 0.13060  0.06580  105 A  A "C1'" 
59   N  N9    . A  A 3   ? 2.46442 2.44662 2.33472 -0.01750 0.12660  0.05700  105 A  A N9    
60   C  C8    . A  A 3   ? 2.40282 2.37992 2.27592 -0.01400 0.11920  0.05450  105 A  A C8    
61   N  N7    . A  A 3   ? 2.35452 2.33592 2.23592 -0.01220 0.11740  0.04710  105 A  A N7    
62   C  C5    . A  A 3   ? 2.33302 2.32272 2.21832 -0.01440 0.12370  0.04440  105 A  A C5    
63   C  C6    . A  A 3   ? 2.24572 2.24262 2.14022 -0.01370 0.12510  0.03760  105 A  A C6    
64   N  N6    . A  A 3   ? 2.20972 2.20672 2.11052 -0.01060 0.12020  0.03260  105 A  A N6    
65   N  N1    . A  A 3   ? 2.21972 2.22422 2.11702 -0.01600 0.13190  0.03630  105 A  A N1    
66   C  C2    . A  A 3   ? 2.26012 2.26512 2.15032 -0.01930 0.13750  0.04170  105 A  A C2    
67   N  N3    . A  A 3   ? 2.33352 2.33202 2.21372 -0.02050 0.13700  0.04910  105 A  A N3    
68   C  C4    . A  A 3   ? 2.38332 2.37392 2.26182 -0.01780 0.12960  0.05010  105 A  A C4    
69   P  P     . U  A 4   ? 2.87025 2.83765 2.71155 -0.03290 0.14610  0.09880  106 U  A P     
70   O  OP1   . U  A 4   ? 2.82855 2.80515 2.65685 -0.03450 0.15370  0.10110  106 U  A OP1   
71   O  OP2   . U  A 4   ? 2.80165 2.75685 2.63815 -0.03050 0.13940  0.10600  106 U  A OP2   
72   O  "O5'" . U  A 4   ? 2.71865 2.68495 2.57915 -0.03850 0.15030  0.09860  106 U  A "O5'" 
73   C  "C5'" . U  A 4   ? 2.70575 2.68285 2.57395 -0.04220 0.15800  0.09420  106 U  A "C5'" 
74   C  "C4'" . U  A 4   ? 2.77465 2.75285 2.66315 -0.04360 0.15620  0.08710  106 U  A "C4'" 
75   O  "O4'" . U  A 4   ? 2.85425 2.82225 2.75285 -0.04730 0.15490  0.09280  106 U  A "O4'" 
76   C  "C3'" . U  A 4   ? 2.74935 2.73945 2.64855 -0.04700 0.16370  0.08210  106 U  A "C3'" 
77   O  "O3'" . U  A 4   ? 2.70565 2.69965 2.61835 -0.04480 0.15920  0.07250  106 U  A "O3'" 
78   C  "C2'" . U  A 4   ? 2.74945 2.73605 2.65885 -0.05390 0.16890  0.08920  106 U  A "C2'" 
79   O  "O2'" . U  A 4   ? 2.59345 2.58865 2.52035 -0.05770 0.17340  0.08420  106 U  A "O2'" 
80   C  "C1'" . U  A 4   ? 2.83255 2.80555 2.74655 -0.05310 0.16100  0.09190  106 U  A "C1'" 
81   N  N1    . U  A 4   ? 2.87495 2.83895 2.79205 -0.05860 0.16430  0.10210  106 U  A N1    
82   C  C2    . U  A 4   ? 2.85425 2.81435 2.79035 -0.06290 0.16360  0.10070  106 U  A C2    
83   O  O2    . U  A 4   ? 2.77035 2.73485 2.71955 -0.06210 0.15990  0.09150  106 U  A O2    
84   N  N3    . U  A 4   ? 2.88565 2.83665 2.82485 -0.06820 0.16700  0.11070  106 U  A N3    
85   C  C4    . U  A 4   ? 2.88155 2.82695 2.80605 -0.06930 0.17110  0.12260  106 U  A C4    
86   O  O4    . U  A 4   ? 2.89225 2.82875 2.82225 -0.07440 0.17410  0.13150  106 U  A O4    
87   C  C5    . U  A 4   ? 2.89495 2.84585 2.79895 -0.06430 0.17130  0.12320  106 U  A C5    
88   C  C6    . U  A 4   ? 2.85895 2.81865 2.76045 -0.05940 0.16790  0.11270  106 U  A C6    
89   P  P     . U  A 5   ? 2.64364 2.64774 2.55384 -0.04010 0.15880  0.06310  107 U  A P     
90   O  OP1   . U  A 5   ? 2.44564 2.44444 2.35244 -0.03450 0.14960  0.05910  107 U  A OP1   
91   O  OP2   . U  A 5   ? 2.52904 2.53994 2.42624 -0.04050 0.16600  0.06500  107 U  A OP2   
92   O  "O5'" . U  A 5   ? 2.41044 2.42324 2.34014 -0.04210 0.16120  0.05660  107 U  A "O5'" 
93   C  "C5'" . U  A 5   ? 2.32324 2.34584 2.25864 -0.04600 0.17030  0.05650  107 U  A "C5'" 
94   C  "C4'" . U  A 5   ? 2.24724 2.28094 2.18944 -0.04290 0.17160  0.04730  107 U  A "C4'" 
95   O  "O4'" . U  A 5   ? 2.25784 2.29004 2.18904 -0.03680 0.16640  0.04320  107 U  A "O4'" 
96   C  "C3'" . U  A 5   ? 2.15064 2.18814 2.11224 -0.04250 0.16780  0.04140  107 U  A "C3'" 
97   O  "O3'" . U  A 5   ? 2.12574 2.16984 2.10224 -0.04790 0.17370  0.04210  107 U  A "O3'" 
98   C  "C2'" . U  A 5   ? 2.08904 2.13334 2.05054 -0.03700 0.16640  0.03350  107 U  A "C2'" 
99   O  "O2'" . U  A 5   ? 2.01254 2.06794 1.97754 -0.03800 0.17490  0.03070  107 U  A "O2'" 
100  C  "C1'" . U  A 5   ? 2.18104 2.21874 2.12334 -0.03340 0.16340  0.03500  107 U  A "C1'" 
101  N  N1    . U  A 5   ? 2.11264 2.14264 2.05374 -0.02950 0.15380  0.03350  107 U  A N1    
102  C  C2    . U  A 5   ? 2.02934 2.06284 1.97664 -0.02510 0.14980  0.02670  107 U  A C2    
103  O  O2    . U  A 5   ? 1.97994 2.02204 1.93434 -0.02390 0.15330  0.02180  107 U  A O2    
104  N  N3    . U  A 5   ? 2.02674 2.05334 1.97204 -0.02190 0.14170  0.02600  107 U  A N3    
105  C  C4    . U  A 5   ? 2.08174 2.09864 2.02034 -0.02240 0.13720  0.03060  107 U  A C4    
106  O  O4    . U  A 5   ? 2.05514 2.06744 1.99294 -0.01920 0.13040  0.02890  107 U  A O4    
107  C  C5    . U  A 5   ? 2.16584 2.17904 2.09914 -0.02670 0.14130  0.03740  107 U  A C5    
108  C  C6    . U  A 5   ? 2.14424 2.16384 2.07854 -0.03010 0.14930  0.03900  107 U  A C6    
109  P  P     . G  A 6   ? 2.11915 2.16485 2.11625 -0.04950 0.16910  0.03850  108 G  A P     
110  O  OP1   . G  A 6   ? 2.21755 2.27015 2.22805 -0.05600 0.17680  0.04060  108 G  A OP1   
111  O  OP2   . G  A 6   ? 2.13235 2.16655 2.12695 -0.04850 0.16040  0.04020  108 G  A OP2   
112  O  "O5'" . G  A 6   ? 1.98285 2.03765 1.98765 -0.04410 0.16620  0.02980  108 G  A "O5'" 
113  C  "C5'" . G  A 6   ? 1.91165 1.97785 1.92045 -0.04340 0.17320  0.02610  108 G  A "C5'" 
114  C  "C4'" . G  A 6   ? 1.80735 1.87915 1.82265 -0.03750 0.16880  0.01860  108 G  A "C4'" 
115  O  "O4'" . G  A 6   ? 1.87165 1.93625 1.87205 -0.03230 0.16370  0.01790  108 G  A "O4'" 
116  C  "C3'" . G  A 6   ? 1.68525 1.75865 1.71595 -0.03640 0.16150  0.01540  108 G  A "C3'" 
117  O  "O3'" . G  A 6   ? 1.62145 1.70535 1.67085 -0.03970 0.16520  0.01330  108 G  A "O3'" 
118  C  "C2'" . G  A 6   ? 1.74005 1.81385 1.76805 -0.02940 0.15620  0.01060  108 G  A "C2'" 
119  O  "O2'" . G  A 6   ? 1.71005 1.79445 1.74675 -0.02720 0.16090  0.00590  108 G  A "O2'" 
120  C  "C1'" . G  A 6   ? 1.79855 1.86385 1.80635 -0.02770 0.15640  0.01320  108 G  A "C1'" 
121  N  N9    . G  A 6   ? 1.79345 1.84815 1.79345 -0.02630 0.14840  0.01550  108 G  A N9    
122  C  C8    . G  A 6   ? 1.87855 1.92445 1.87175 -0.02960 0.14700  0.02090  108 G  A C8    
123  N  N7    . G  A 6   ? 1.87405 1.91225 1.86225 -0.02700 0.13940  0.02090  108 G  A N7    
124  C  C5    . G  A 6   ? 1.75845 1.80075 1.74985 -0.02190 0.13580  0.01590  108 G  A C5    
125  C  C6    . G  A 6   ? 1.67825 1.71645 1.66665 -0.01760 0.12820  0.01400  108 G  A C6    
126  O  O6    . G  A 6   ? 1.71825 1.74855 1.70065 -0.01710 0.12310  0.01570  108 G  A O6    
127  N  N1    . G  A 6   ? 1.56225 1.60645 1.55595 -0.01340 0.12720  0.00980  108 G  A N1    
128  C  C2    . G  A 6   ? 1.56335 1.61615 1.56505 -0.01310 0.13250  0.00710  108 G  A C2    
129  N  N2    . G  A 6   ? 1.49765 1.55435 1.50445 -0.00850 0.13040  0.00350  108 G  A N2    
130  N  N3    . G  A 6   ? 1.64005 1.69755 1.64485 -0.01700 0.13970  0.00800  108 G  A N3    
131  C  C4    . G  A 6   ? 1.72225 1.77415 1.72125 -0.02140 0.14100  0.01270  108 G  A C4    
132  P  P     . C  A 7   ? 1.71067 1.79597 1.77647 -0.04210 0.15900  0.01200  109 C  A P     
133  O  OP1   . C  A 7   ? 1.84477 1.93767 1.92487 -0.04860 0.16600  0.01310  109 C  A OP1   
134  O  OP2   . C  A 7   ? 1.70447 1.77737 1.76107 -0.04170 0.15140  0.01450  109 C  A OP2   
135  O  "O5'" . C  A 7   ? 1.64117 1.73507 1.71837 -0.03630 0.15380  0.00560  109 C  A "O5'" 
136  C  "C5'" . C  A 7   ? 1.55437 1.64567 1.63477 -0.03340 0.14380  0.00350  109 C  A "C5'" 
137  C  "C4'" . C  A 7   ? 1.47757 1.56767 1.55097 -0.02610 0.13930  0.00120  109 C  A "C4'" 
138  O  "O4'" . C  A 7   ? 1.56017 1.63947 1.61407 -0.02470 0.13960  0.00410  109 C  A "O4'" 
139  C  "C3'" . C  A 7   ? 1.34597 1.43557 1.42307 -0.02240 0.12930  -0.00100 109 C  A "C3'" 
140  O  "O3'" . C  A 7   ? 1.30707 1.40827 1.40167 -0.02090 0.12720  -0.00460 109 C  A "O3'" 
141  C  "C2'" . C  A 7   ? 1.40647 1.48947 1.46927 -0.01670 0.12670  -0.00060 109 C  A "C2'" 
142  O  "O2'" . C  A 7   ? 1.37537 1.46517 1.44357 -0.01240 0.12900  -0.00330 109 C  A "O2'" 
143  C  "C1'" . C  A 7   ? 1.50627 1.58097 1.55397 -0.01930 0.13210  0.00290  109 C  A "C1'" 
144  N  N1    . C  A 7   ? 1.51697 1.58087 1.55377 -0.02060 0.12750  0.00590  109 C  A N1    
145  C  C2    . C  A 7   ? 1.45507 1.51297 1.48297 -0.01620 0.12090  0.00550  109 C  A C2    
146  O  O2    . C  A 7   ? 1.43627 1.49747 1.46527 -0.01140 0.11900  0.00320  109 C  A O2    
147  N  N3    . C  A 7   ? 1.51317 1.56187 1.53217 -0.01710 0.11700  0.00770  109 C  A N3    
148  C  C4    . C  A 7   ? 1.53977 1.58417 1.55877 -0.02220 0.11910  0.01050  109 C  A C4    
149  N  N4    . C  A 7   ? 1.61987 1.65467 1.63087 -0.02250 0.11500  0.01230  109 C  A N4    
150  C  C5    . C  A 7   ? 1.64617 1.69567 1.67377 -0.02720 0.12580  0.01170  109 C  A C5    
151  C  C6    . C  A 7   ? 1.61737 1.67697 1.65347 -0.02620 0.12990  0.00910  109 C  A C6    
152  P  P     . G  A 8   ? 1.41288 1.51808 1.51948 -0.02260 0.11960  -0.00670 110 G  A P     
153  O  OP1   . G  A 8   ? 1.28628 1.40548 1.41258 -0.02240 0.12060  -0.01010 110 G  A OP1   
154  O  OP2   . G  A 8   ? 1.40038 1.49758 1.50278 -0.02860 0.11980  -0.00450 110 G  A OP2   
155  O  "O5'" . G  A 8   ? 1.35208 1.45348 1.45068 -0.01640 0.11050  -0.00740 110 G  A "O5'" 
156  C  "C5'" . G  A 8   ? 1.27868 1.38278 1.37608 -0.01000 0.10960  -0.00790 110 G  A "C5'" 
157  C  "C4'" . G  A 8   ? 1.21158 1.30918 1.29758 -0.00530 0.10230  -0.00690 110 G  A "C4'" 
158  O  "O4'" . G  A 8   ? 1.25678 1.34248 1.32558 -0.00610 0.10430  -0.00430 110 G  A "O4'" 
159  C  "C3'" . G  A 8   ? 1.19698 1.29538 1.28498 -0.00580 0.09400  -0.00820 110 G  A "C3'" 
160  O  "O3'" . G  A 8   ? 1.14798 1.25748 1.24918 -0.00290 0.08890  -0.01050 110 G  A "O3'" 
161  C  "C2'" . G  A 8   ? 1.22348 1.31208 1.29478 -0.00270 0.09020  -0.00630 110 G  A "C2'" 
162  O  "O2'" . G  A 8   ? 1.26458 1.35558 1.33458 0.00350  0.08720  -0.00560 110 G  A "O2'" 
163  C  "C1'" . G  A 8   ? 1.21518 1.29508 1.27558 -0.00470 0.09730  -0.00390 110 G  A "C1'" 
164  N  N9    . G  A 8   ? 1.21068 1.28308 1.26508 -0.00960 0.09790  -0.00280 110 G  A N9    
165  C  C8    . G  A 8   ? 1.27388 1.34548 1.33208 -0.01530 0.10360  -0.00180 110 G  A C8    
166  N  N7    . G  A 8   ? 1.31418 1.37718 1.36578 -0.01840 0.10250  -0.00040 110 G  A N7    
167  C  C5    . G  A 8   ? 1.23748 1.29598 1.28058 -0.01450 0.09590  -0.00120 110 G  A C5    
168  C  C6    . G  A 8   ? 1.26298 1.31248 1.29738 -0.01510 0.09210  -0.00080 110 G  A C6    
169  O  O6    . G  A 8   ? 1.27118 1.31368 1.30388 -0.01910 0.09350  0.00060  110 G  A O6    
170  N  N1    . G  A 8   ? 1.27168 1.32058 1.29938 -0.01010 0.08630  -0.00210 110 G  A N1    
171  C  C2    . G  A 8   ? 1.23558 1.29088 1.26458 -0.00540 0.08430  -0.00270 110 G  A C2    
172  N  N2    . G  A 8   ? 1.16768 1.22128 1.18908 -0.00140 0.07920  -0.00320 110 G  A N2    
173  N  N3    . G  A 8   ? 1.26728 1.33018 1.30488 -0.00460 0.08750  -0.00280 110 G  A N3    
174  C  C4    . G  A 8   ? 1.23818 1.30258 1.28248 -0.00920 0.09320  -0.00240 110 G  A C4    
175  P  P     . G  A 9   ? 1.11678 1.23328 1.22918 -0.00600 0.08270  -0.01390 111 G  A P     
176  O  OP1   . G  A 9   ? 1.10838 1.23778 1.23488 -0.00210 0.07840  -0.01580 111 G  A OP1   
177  O  OP2   . G  A 9   ? 1.16688 1.28148 1.28428 -0.01340 0.08810  -0.01450 111 G  A OP2   
178  O  "O5'" . G  A 9   ? 1.22598 1.33528 1.32478 -0.00440 0.07550  -0.01390 111 G  A "O5'" 
179  C  "C5'" . G  A 9   ? 1.23008 1.33878 1.32048 0.00200  0.07070  -0.01220 111 G  A "C5'" 
180  C  "C4'" . G  A 9   ? 1.19148 1.29188 1.26728 0.00250  0.06630  -0.01200 111 G  A "C4'" 
181  O  "O4'" . G  A 9   ? 1.17418 1.26278 1.23848 0.00020  0.07190  -0.00980 111 G  A "O4'" 
182  C  "C3'" . G  A 9   ? 1.27678 1.37888 1.35588 -0.00110 0.06100  -0.01630 111 G  A "C3'" 
183  O  "O3'" . G  A 9   ? 1.25148 1.36398 1.33648 0.00190  0.05310  -0.01890 111 G  A "O3'" 
184  C  "C2'" . G  A 9   ? 1.30128 1.39148 1.36458 -0.00140 0.06070  -0.01550 111 G  A "C2'" 
185  O  "O2'" . G  A 9   ? 1.38758 1.47778 1.44058 0.00400  0.05570  -0.01450 111 G  A "O2'" 
186  C  "C1'" . G  A 9   ? 1.24838 1.33048 1.30548 -0.00210 0.06870  -0.01140 111 G  A "C1'" 
187  N  N9    . G  A 9   ? 1.16888 1.24558 1.22868 -0.00830 0.07370  -0.01140 111 G  A N9    
188  C  C8    . G  A 9   ? 1.15608 1.23618 1.22598 -0.01210 0.07980  -0.01080 111 G  A C8    
189  N  N7    . G  A 9   ? 1.21398 1.28738 1.28338 -0.01740 0.08340  -0.01000 111 G  A N7    
190  C  C5    . G  A 9   ? 1.14148 1.20638 1.20058 -0.01680 0.07910  -0.01060 111 G  A C5    
191  C  C6    . G  A 9   ? 1.17918 1.23398 1.23408 -0.02070 0.07990  -0.00990 111 G  A C6    
192  O  O6    . G  A 9   ? 1.18888 1.23948 1.24768 -0.02580 0.08480  -0.00790 111 G  A O6    
193  N  N1    . G  A 9   ? 1.20748 1.25658 1.25268 -0.01790 0.07450  -0.01160 111 G  A N1    
194  C  C2    . G  A 9   ? 1.22738 1.28048 1.26688 -0.01240 0.06930  -0.01330 111 G  A C2    
195  N  N2    . G  A 9   ? 1.22188 1.26928 1.25238 -0.01050 0.06520  -0.01500 111 G  A N2    
196  N  N3    . G  A 9   ? 1.28838 1.35058 1.33128 -0.00890 0.06840  -0.01300 111 G  A N3    
197  C  C4    . G  A 9   ? 1.20738 1.27478 1.26038 -0.01120 0.07330  -0.01180 111 G  A C4    
198  P  P     . G  A 10  ? 1.30002 1.42112 1.39892 -0.00230 0.04830  -0.02480 112 G  A P     
199  O  OP1   . G  A 10  ? 1.29592 1.42932 1.40012 0.00240  0.04040  -0.02640 112 G  A OP1   
200  O  OP2   . G  A 10  ? 1.34872 1.47092 1.46072 -0.00820 0.05480  -0.02550 112 G  A OP2   
201  O  "O5'" . G  A 10  ? 1.31782 1.43052 1.40652 -0.00480 0.04520  -0.02790 112 G  A "O5'" 
202  C  "C5'" . G  A 10  ? 1.26522 1.37642 1.34052 -0.00020 0.03950  -0.02820 112 G  A "C5'" 
203  C  "C4'" . G  A 10  ? 1.19402 1.29462 1.25952 -0.00280 0.03930  -0.03050 112 G  A "C4'" 
204  O  "O4'" . G  A 10  ? 1.28282 1.37152 1.34182 -0.00460 0.04700  -0.02610 112 G  A "O4'" 
205  C  "C3'" . G  A 10  ? 1.19052 1.29152 1.26592 -0.00860 0.03710  -0.03690 112 G  A "C3'" 
206  O  "O3'" . G  A 10  ? 1.24422 1.35452 1.32262 -0.00740 0.02850  -0.04310 112 G  A "O3'" 
207  C  "C2'" . G  A 10  ? 1.24272 1.32922 1.30802 -0.01080 0.04050  -0.03630 112 G  A "C2'" 
208  O  "O2'" . G  A 10  ? 1.17222 1.25642 1.22462 -0.00690 0.03590  -0.03840 112 G  A "O2'" 
209  C  "C1'" . G  A 10  ? 1.28822 1.36852 1.34692 -0.00930 0.04790  -0.02880 112 G  A "C1'" 
210  N  N9    . G  A 10  ? 1.27922 1.35642 1.34712 -0.01470 0.05470  -0.02680 112 G  A N9    
211  C  C8    . G  A 10  ? 1.26192 1.34602 1.34012 -0.01580 0.05890  -0.02460 112 G  A C8    
212  N  N7    . G  A 10  ? 1.25862 1.33822 1.34262 -0.02120 0.06520  -0.02290 112 G  A N7    
213  C  C5    . G  A 10  ? 1.21572 1.28422 1.29302 -0.02360 0.06470  -0.02350 112 G  A C5    
214  C  C6    . G  A 10  ? 1.19432 1.25322 1.27332 -0.02920 0.06970  -0.02140 112 G  A C6    
215  O  O6    . G  A 10  ? 1.24562 1.30452 1.33172 -0.03350 0.07630  -0.01830 112 G  A O6    
216  N  N1    . G  A 10  ? 1.13342 1.18212 1.20482 -0.02940 0.06680  -0.02290 112 G  A N1    
217  C  C2    . G  A 10  ? 1.12862 1.17722 1.19172 -0.02490 0.06030  -0.02660 112 G  A C2    
218  N  N2    . G  A 10  ? 1.17142 1.20962 1.22902 -0.02550 0.05870  -0.02830 112 G  A N2    
219  N  N3    . G  A 10  ? 1.24102 1.29892 1.30152 -0.01990 0.05590  -0.02840 112 G  A N3    
220  C  C4    . G  A 10  ? 1.23642 1.30342 1.30432 -0.01960 0.05820  -0.02640 112 G  A C4    
221  P  P     . A  A 11  ? 1.22613 1.34643 1.32383 -0.01230 0.02480  -0.04980 113 A  A P     
222  O  OP1   . A  A 11  ? 1.21833 1.34933 1.31503 -0.00940 0.01510  -0.05580 113 A  A OP1   
223  O  OP2   . A  A 11  ? 1.29713 1.42323 1.40813 -0.01390 0.02960  -0.04630 113 A  A OP2   
224  O  "O5'" . A  A 11  ? 1.13723 1.24643 1.23813 -0.01900 0.02760  -0.05340 113 A  A "O5'" 
225  C  "C5'" . A  A 11  ? 1.14873 1.24943 1.23833 -0.01840 0.02500  -0.05680 113 A  A "C5'" 
226  C  "C4'" . A  A 11  ? 1.16053 1.24733 1.25223 -0.02390 0.03050  -0.05630 113 A  A "C4'" 
227  O  "O4'" . A  A 11  ? 1.20103 1.28073 1.28853 -0.02400 0.03890  -0.04760 113 A  A "O4'" 
228  C  "C3'" . A  A 11  ? 1.17903 1.26723 1.28953 -0.03130 0.03080  -0.06090 113 A  A "C3'" 
229  O  "O3'" . A  A 11  ? 1.12143 1.21113 1.23623 -0.03310 0.02390  -0.07030 113 A  A "O3'" 
230  C  "C2'" . A  A 11  ? 1.21383 1.28803 1.32383 -0.03550 0.03940  -0.05480 113 A  A "C2'" 
231  O  "O2'" . A  A 11  ? 1.23023 1.29173 1.33223 -0.03580 0.03870  -0.05670 113 A  A "O2'" 
232  C  "C1'" . A  A 11  ? 1.17023 1.24333 1.26793 -0.03070 0.04430  -0.04640 113 A  A "C1'" 
233  N  N9    . A  A 11  ? 1.24403 1.32443 1.35183 -0.03250 0.04930  -0.04240 113 A  A N9    
234  C  C8    . A  A 11  ? 1.24293 1.33633 1.35523 -0.02900 0.04740  -0.04220 113 A  A C8    
235  N  N7    . A  A 11  ? 1.23003 1.32783 1.35233 -0.03150 0.05340  -0.03880 113 A  A N7    
236  C  C5    . A  A 11  ? 1.19263 1.27953 1.31593 -0.03720 0.05990  -0.03610 113 A  A C5    
237  C  C6    . A  A 11  ? 1.26093 1.34653 1.39213 -0.04210 0.06840  -0.03170 113 A  A C6    
238  N  N6    . A  A 11  ? 1.33453 1.43063 1.47503 -0.04200 0.07220  -0.03020 113 A  A N6    
239  N  N1    . A  A 11  ? 1.33383 1.40713 1.46283 -0.04700 0.07320  -0.02880 113 A  A N1    
240  C  C2    . A  A 11  ? 1.26623 1.32893 1.38713 -0.04670 0.06930  -0.03060 113 A  A C2    
241  N  N3    . A  A 11  ? 1.24273 1.30573 1.35623 -0.04220 0.06150  -0.03560 113 A  A N3    
242  C  C4    . A  A 11  ? 1.24813 1.32383 1.36283 -0.03770 0.05720  -0.03790 113 A  A C4    
243  P  P     . A  A 12  ? 1.16624 1.26084 1.30294 -0.04050 0.02190  -0.07740 114 A  A P     
244  O  OP1   . A  A 12  ? 1.11224 1.21864 1.25184 -0.03880 0.01200  -0.08740 114 A  A OP1   
245  O  OP2   . A  A 12  ? 1.21304 1.31244 1.36274 -0.04410 0.02790  -0.07210 114 A  A OP2   
246  O  "O5'" . A  A 12  ? 1.11774 1.19584 1.25604 -0.04550 0.02510  -0.07880 114 A  A "O5'" 
247  C  "C5'" . A  A 12  ? 1.15134 1.22214 1.27994 -0.04320 0.02080  -0.08450 114 A  A "C5'" 
248  C  "C4'" . A  A 12  ? 1.13584 1.19034 1.26924 -0.04830 0.02490  -0.08430 114 A  A "C4'" 
249  O  "O4'" . A  A 12  ? 1.16884 1.21354 1.29644 -0.04880 0.03370  -0.07290 114 A  A "O4'" 
250  C  "C3'" . A  A 12  ? 1.21064 1.26524 1.36594 -0.05670 0.02490  -0.08940 114 A  A "C3'" 
251  O  "O3'" . A  A 12  ? 1.34094 1.39884 1.50284 -0.05780 0.01700  -0.10190 114 A  A "O3'" 
252  C  "C2'" . A  A 12  ? 1.20984 1.24694 1.36664 -0.06090 0.03270  -0.08210 114 A  A "C2'" 
253  O  "O2'" . A  A 12  ? 1.20404 1.22844 1.35594 -0.06000 0.03050  -0.08650 114 A  A "O2'" 
254  C  "C1'" . A  A 12  ? 1.21134 1.24614 1.35174 -0.05600 0.03850  -0.07080 114 A  A "C1'" 
255  N  N9    . A  A 12  ? 1.20434 1.24414 1.35224 -0.05940 0.04520  -0.06330 114 A  A N9    
256  C  C8    . A  A 12  ? 1.20474 1.25744 1.35084 -0.05630 0.04590  -0.06050 114 A  A C8    
257  N  N7    . A  A 12  ? 1.22594 1.28064 1.38044 -0.06030 0.05290  -0.05430 114 A  A N7    
258  C  C5    . A  A 12  ? 1.21654 1.25874 1.37814 -0.06670 0.05730  -0.05220 114 A  A C5    
259  C  C6    . A  A 12  ? 1.25424 1.29224 1.42554 -0.07330 0.06570  -0.04560 114 A  A C6    
260  N  N6    . A  A 12  ? 1.26894 1.31594 1.44454 -0.07450 0.07160  -0.04060 114 A  A N6    
261  N  N1    . A  A 12  ? 1.24724 1.27124 1.42364 -0.07860 0.06820  -0.04410 114 A  A N1    
262  C  C2    . A  A 12  ? 1.25524 1.27014 1.42804 -0.07700 0.06240  -0.04980 114 A  A C2    
263  N  N3    . A  A 12  ? 1.20404 1.22234 1.36794 -0.07090 0.05460  -0.05710 114 A  A N3    
264  C  C4    . A  A 12  ? 1.20324 1.23554 1.36124 -0.06610 0.05240  -0.05760 114 A  A C4    
265  P  P     . A  A 13  ? 1.34736 1.42126 1.52846 -0.06190 0.01090  -0.11120 115 A  A P     
266  O  OP1   . A  A 13  ? 1.20126 1.28026 1.37966 -0.05950 0.00150  -0.12390 115 A  A OP1   
267  O  OP2   . A  A 13  ? 1.18516 1.27296 1.36736 -0.05990 0.01210  -0.10540 115 A  A OP2   
268  O  "O5'" . A  A 13  ? 1.16136 1.22666 1.36386 -0.07170 0.01560  -0.11160 115 A  A "O5'" 
269  C  "C5'" . A  A 13  ? 1.22246 1.27056 1.42756 -0.07500 0.01720  -0.11380 115 A  A "C5'" 
270  C  "C4'" . A  A 13  ? 1.27866 1.31706 1.49896 -0.08320 0.02540  -0.10680 115 A  A "C4'" 
271  O  "O4'" . A  A 13  ? 1.24186 1.27476 1.44986 -0.08090 0.03380  -0.09280 115 A  A "O4'" 
272  C  "C3'" . A  A 13  ? 1.38466 1.43566 1.62726 -0.09010 0.02560  -0.10960 115 A  A "C3'" 
273  O  "O3'" . A  A 13  ? 1.44426 1.49616 1.70546 -0.09590 0.02010  -0.12180 115 A  A "O3'" 
274  C  "C2'" . A  A 13  ? 1.41076 1.45346 1.65776 -0.09490 0.03670  -0.09660 115 A  A "C2'" 
275  O  "O2'" . A  A 13  ? 1.49056 1.51626 1.74706 -0.10130 0.04050  -0.09550 115 A  A "O2'" 
276  C  "C1'" . A  A 13  ? 1.29896 1.33586 1.52116 -0.08720 0.04040  -0.08670 115 A  A "C1'" 
277  N  N9    . A  A 13  ? 1.28946 1.34146 1.50546 -0.08270 0.04100  -0.08280 115 A  A N9    
278  C  C8    . A  A 13  ? 1.27636 1.34016 1.48136 -0.07530 0.03420  -0.08700 115 A  A C8    
279  N  N7    . A  A 13  ? 1.27946 1.35446 1.48216 -0.07250 0.03650  -0.08180 115 A  A N7    
280  C  C5    . A  A 13  ? 1.29806 1.36906 1.51036 -0.07830 0.04560  -0.07420 115 A  A C5    
281  C  C6    . A  A 13  ? 1.34936 1.42806 1.56466 -0.07870 0.05230  -0.06680 115 A  A C6    
282  N  N6    . A  A 13  ? 1.38016 1.47156 1.59006 -0.07270 0.05040  -0.06600 115 A  A N6    
283  N  N1    . A  A 13  ? 1.30506 1.37776 1.52956 -0.08540 0.06140  -0.06030 115 A  A N1    
284  C  C2    . A  A 13  ? 1.28616 1.34526 1.51666 -0.09140 0.06330  -0.06050 115 A  A C2    
285  N  N3    . A  A 13  ? 1.28536 1.33536 1.51496 -0.09160 0.05740  -0.06700 115 A  A N3    
286  C  C4    . A  A 13  ? 1.31506 1.37206 1.53516 -0.08480 0.04860  -0.07420 115 A  A C4    
287  P  P     . G  A 14  ? 1.40374 1.47694 1.68194 -0.09830 0.01250  -0.13260 116 G  A P     
288  O  OP1   . G  A 14  ? 1.38794 1.46044 1.67474 -0.10040 0.00400  -0.14760 116 G  A OP1   
289  O  OP2   . G  A 14  ? 1.36384 1.45264 1.62864 -0.09070 0.00970  -0.12960 116 G  A OP2   
290  O  "O5'" . G  A 14  ? 1.35034 1.42524 1.65204 -0.10790 0.01980  -0.12780 116 G  A "O5'" 
291  C  "C5'" . G  A 14  ? 1.43414 1.49374 1.75084 -0.11640 0.02510  -0.12670 116 G  A "C5'" 
292  C  "C4'" . G  A 14  ? 1.55664 1.61564 1.88494 -0.12280 0.03570  -0.11540 116 G  A "C4'" 
293  O  "O4'" . G  A 14  ? 1.48734 1.54084 1.79464 -0.11720 0.04300  -0.10170 116 G  A "O4'" 
294  C  "C3'" . G  A 14  ? 1.58434 1.66454 1.92964 -0.12570 0.03500  -0.11800 116 G  A "C3'" 
295  O  "O3'" . G  A 14  ? 1.58104 1.66684 1.95314 -0.13420 0.03130  -0.12850 116 G  A "O3'" 
296  C  "C2'" . G  A 14  ? 1.54464 1.62244 1.88784 -0.12760 0.04710  -0.10330 116 G  A "C2'" 
297  O  "O2'" . G  A 14  ? 1.68304 1.74864 2.04184 -0.13720 0.05520  -0.09850 116 G  A "O2'" 
298  C  "C1'" . G  A 14  ? 1.50214 1.56734 1.81634 -0.11930 0.04930  -0.09480 116 G  A "C1'" 
299  N  N9    . G  A 14  ? 1.52074 1.59904 1.81904 -0.11020 0.04600  -0.09370 116 G  A N9    
300  C  C8    . G  A 14  ? 1.45014 1.53524 1.73634 -0.10260 0.03610  -0.10140 116 G  A C8    
301  N  N7    . G  A 14  ? 1.43524 1.53104 1.70974 -0.09570 0.03550  -0.09750 116 G  A N7    
302  C  C5    . G  A 14  ? 1.47514 1.57164 1.75434 -0.09880 0.04550  -0.08760 116 G  A C5    
303  C  C6    . G  A 14  ? 1.40594 1.51174 1.67814 -0.09410 0.04970  -0.08040 116 G  A C6    
304  O  O6    . G  A 14  ? 1.39864 1.51334 1.65914 -0.08620 0.04520  -0.08070 116 G  A O6    
305  N  N1    . G  A 14  ? 1.36904 1.47264 1.64944 -0.09960 0.06060  -0.07210 116 G  A N1    
306  C  C2    . G  A 14  ? 1.42104 1.51494 1.71444 -0.10860 0.06680  -0.06980 116 G  A C2    
307  N  N2    . G  A 14  ? 1.44504 1.53924 1.74374 -0.11280 0.07760  -0.06090 116 G  A N2    
308  N  N3    . G  A 14  ? 1.41394 1.49824 1.71474 -0.11310 0.06290  -0.07580 116 G  A N3    
309  C  C4    . G  A 14  ? 1.45184 1.53814 1.74514 -0.10770 0.05220  -0.08500 116 G  A C4    
310  P  P     . G  A 15  ? 1.64505 1.75645 2.03375 -0.13470 0.02340  -0.13890 117 G  A P     
311  O  OP1   . G  A 15  ? 1.58355 1.69615 1.99765 -0.14340 0.01840  -0.15150 117 G  A OP1   
312  O  OP2   . G  A 15  ? 1.44755 1.57005 1.81595 -0.12390 0.01500  -0.14200 117 G  A OP2   
313  O  "O5'" . G  A 15  ? 1.63945 1.76035 2.03905 -0.13820 0.03310  -0.12870 117 G  A "O5'" 
314  C  "C5'" . G  A 15  ? 1.64855 1.76045 2.06465 -0.14800 0.04380  -0.12180 117 G  A "C5'" 
315  C  "C4'" . G  A 15  ? 1.65855 1.77925 2.07615 -0.14840 0.05360  -0.11070 117 G  A "C4'" 
316  O  "O4'" . G  A 15  ? 1.65525 1.76755 2.04465 -0.14020 0.05830  -0.09960 117 G  A "O4'" 
317  C  "C3'" . G  A 15  ? 1.58445 1.73015 2.01255 -0.14560 0.04890  -0.11590 117 G  A "C3'" 
318  O  "O3'" . G  A 15  ? 1.54595 1.70415 2.00515 -0.15450 0.04740  -0.12400 117 G  A "O3'" 
319  C  "C2'" . G  A 15  ? 1.62795 1.77585 2.04455 -0.14190 0.05900  -0.10290 117 G  A "C2'" 
320  O  "O2'" . G  A 15  ? 1.66485 1.81075 2.09775 -0.15110 0.07100  -0.09580 117 G  A "O2'" 
321  C  "C1'" . G  A 15  ? 1.61465 1.74265 2.00195 -0.13600 0.06120  -0.09510 117 G  A "C1'" 
322  N  N9    . G  A 15  ? 1.51605 1.64925 1.88175 -0.12470 0.05320  -0.09720 117 G  A N9    
323  C  C8    . G  A 15  ? 1.48825 1.62055 1.84455 -0.11970 0.04200  -0.10630 117 G  A C8    
324  N  N7    . G  A 15  ? 1.44645 1.58455 1.78375 -0.11000 0.03750  -0.10500 117 G  A N7    
325  C  C5    . G  A 15  ? 1.45075 1.59345 1.78525 -0.10830 0.04600  -0.09510 117 G  A C5    
326  C  C6    . G  A 15  ? 1.43675 1.58555 1.75465 -0.09930 0.04620  -0.08970 117 G  A C6    
327  O  O6    . G  A 15  ? 1.38935 1.54105 1.69125 -0.09090 0.03890  -0.09170 117 G  A O6    
328  N  N1    . G  A 15  ? 1.41605 1.56795 1.73795 -0.10080 0.05670  -0.08100 117 G  A N1    
329  C  C2    . G  A 15  ? 1.46755 1.61745 1.80605 -0.10980 0.06600  -0.07750 117 G  A C2    
330  N  N2    . G  A 15  ? 1.48205 1.63645 1.82095 -0.10970 0.07570  -0.06950 117 G  A N2    
331  N  N3    . G  A 15  ? 1.51595 1.65985 1.86985 -0.11850 0.06620  -0.08150 117 G  A N3    
332  C  C4    . G  A 15  ? 1.48475 1.62495 1.83615 -0.11720 0.05580  -0.09050 117 G  A C4    
333  P  P     . G  A 16  ? 1.78581 1.96751 2.25831 -0.15180 0.03410  -0.13810 118 G  A P     
334  O  OP1   . G  A 16  ? 1.72431 1.91391 2.23021 -0.16290 0.03350  -0.14650 118 G  A OP1   
335  O  OP2   . G  A 16  ? 1.70401 1.88241 2.15551 -0.14330 0.02270  -0.14500 118 G  A OP2   
336  O  "O5'" . G  A 16  ? 1.59071 1.78981 2.06061 -0.14570 0.03700  -0.13190 118 G  A "O5'" 
337  C  "C5'" . G  A 16  ? 1.55631 1.76101 2.04191 -0.15140 0.04870  -0.12420 118 G  A "C5'" 
338  C  "C4'" . G  A 16  ? 1.50871 1.72351 1.98241 -0.14320 0.05250  -0.11660 118 G  A "C4'" 
339  O  "O4'" . G  A 16  ? 1.42821 1.62671 1.87051 -0.13590 0.05590  -0.10730 118 G  A "O4'" 
340  C  "C3'" . G  A 16  ? 1.37761 1.61291 1.85221 -0.13480 0.04100  -0.12370 118 G  A "C3'" 
341  O  "O3'" . G  A 16  ? 1.30691 1.56331 1.81161 -0.13950 0.03840  -0.13090 118 G  A "O3'" 
342  C  "C2'" . G  A 16  ? 1.42681 1.66111 1.88001 -0.12570 0.04640  -0.11320 118 G  A "C2'" 
343  O  "O2'" . G  A 16  ? 1.40991 1.65281 1.87711 -0.12900 0.05750  -0.10710 118 G  A "O2'" 
344  C  "C1'" . G  A 16  ? 1.44621 1.65571 1.87541 -0.12560 0.05260  -0.10520 118 G  A "C1'" 
345  N  N9    . G  A 16  ? 1.47601 1.67851 1.88101 -0.11700 0.04300  -0.10790 118 G  A N9    
346  C  C8    . G  A 16  ? 1.47561 1.66891 1.87511 -0.11780 0.03500  -0.11520 118 G  A C8    
347  N  N7    . G  A 16  ? 1.38661 1.57691 1.76301 -0.10870 0.02820  -0.11560 118 G  A N7    
348  C  C5    . G  A 16  ? 1.39711 1.59441 1.76371 -0.10160 0.03160  -0.10800 118 G  A C5    
349  C  C6    . G  A 16  ? 1.35441 1.55201 1.69781 -0.09100 0.02760  -0.10440 118 G  A C6    
350  O  O6    . G  A 16  ? 1.32641 1.51851 1.65181 -0.08550 0.02030  -0.10720 118 G  A O6    
351  N  N1    . G  A 16  ? 1.37981 1.58501 1.72251 -0.08690 0.03340  -0.09710 118 G  A N1    
352  C  C2    . G  A 16  ? 1.37281 1.58531 1.73421 -0.09220 0.04220  -0.09390 118 G  A C2    
353  N  N2    . G  A 16  ? 1.34881 1.56821 1.70671 -0.08670 0.04690  -0.08770 118 G  A N2    
354  N  N3    . G  A 16  ? 1.40351 1.61661 1.78611 -0.10220 0.04630  -0.09680 118 G  A N3    
355  C  C4    . G  A 16  ? 1.42941 1.63431 1.81361 -0.10650 0.04050  -0.10360 118 G  A C4    
356  P  P     . G  A 17  ? 1.47572 1.75352 1.98802 -0.13350 0.02250  -0.14260 119 G  A P     
357  O  OP1   . G  A 17  ? 1.40332 1.70002 1.95092 -0.14140 0.02100  -0.15060 119 G  A OP1   
358  O  OP2   . G  A 17  ? 1.60812 1.87642 2.10252 -0.12970 0.01170  -0.14910 119 G  A OP2   
359  O  "O5'" . G  A 17  ? 1.37992 1.66722 1.87792 -0.12210 0.02270  -0.13560 119 G  A "O5'" 
360  C  "C5'" . G  A 17  ? 1.32082 1.61592 1.82912 -0.12280 0.03360  -0.12820 119 G  A "C5'" 
361  C  "C4'" . G  A 17  ? 1.35302 1.65172 1.84252 -0.11110 0.03330  -0.12150 119 G  A "C4'" 
362  O  "O4'" . G  A 17  ? 1.38332 1.66082 1.84162 -0.10670 0.03720  -0.11350 119 G  A "O4'" 
363  C  "C3'" . G  A 17  ? 1.37852 1.69192 1.86452 -0.10160 0.01840  -0.12770 119 G  A "C3'" 
364  O  "O3'" . G  A 17  ? 1.35632 1.69362 1.86922 -0.10180 0.01410  -0.13330 119 G  A "O3'" 
365  C  "C2'" . G  A 17  ? 1.39882 1.70412 1.85722 -0.09110 0.02070  -0.11830 119 G  A "C2'" 
366  O  "O2'" . G  A 17  ? 1.42112 1.73562 1.88782 -0.08840 0.02880  -0.11240 119 G  A "O2'" 
367  C  "C1'" . G  A 17  ? 1.41092 1.69162 1.85002 -0.09510 0.03010  -0.11170 119 G  A "C1'" 
368  N  N9    . G  A 17  ? 1.38472 1.65292 1.80212 -0.09180 0.02180  -0.11440 119 G  A N9    
369  C  C8    . G  A 17  ? 1.39352 1.65002 1.81042 -0.09820 0.01960  -0.11960 119 G  A C8    
370  N  N7    . G  A 17  ? 1.39482 1.64272 1.79002 -0.09270 0.01220  -0.12140 119 G  A N7    
371  C  C5    . G  A 17  ? 1.37142 1.62552 1.75172 -0.08240 0.00940  -0.11660 119 G  A C5    
372  C  C6    . G  A 17  ? 1.35672 1.60662 1.71182 -0.07320 0.00230  -0.11540 119 G  A C6    
373  O  O6    . G  A 17  ? 1.36232 1.60262 1.70252 -0.07220 -0.00290 -0.11910 119 G  A O6    
374  N  N1    . G  A 17  ? 1.32522 1.58332 1.67362 -0.06460 0.00210  -0.10940 119 G  A N1    
375  C  C2    . G  A 17  ? 1.34242 1.61152 1.70652 -0.06440 0.00770  -0.10570 119 G  A C2    
376  N  N2    . G  A 17  ? 1.38012 1.65512 1.73552 -0.05520 0.00630  -0.10020 119 G  A N2    
377  N  N3    . G  A 17  ? 1.36642 1.64052 1.75372 -0.07280 0.01450  -0.10720 119 G  A N3    
378  C  C4    . G  A 17  ? 1.36622 1.63232 1.76022 -0.08160 0.01500  -0.11230 119 G  A C4    
379  P  P     . U  A 18  ? 1.44391 1.79831 1.97051 -0.10110 -0.00270 -0.14620 120 U  A P     
380  O  OP1   . U  A 18  ? 1.72491 2.10281 2.28401 -0.10380 -0.00340 -0.15080 120 U  A OP1   
381  O  OP2   . U  A 18  ? 1.38341 1.72531 1.90701 -0.10820 -0.00620 -0.15290 120 U  A OP2   
382  O  "O5'" . U  A 18  ? 1.45511 1.81251 1.95761 -0.08770 -0.01340 -0.14430 120 U  A "O5'" 
383  C  "C5'" . U  A 18  ? 1.46651 1.83221 1.96561 -0.07870 -0.01170 -0.13720 120 U  A "C5'" 
384  C  "C4'" . U  A 18  ? 1.46821 1.82541 1.93621 -0.06770 -0.01710 -0.13170 120 U  A "C4'" 
385  O  "O4'" . U  A 18  ? 1.47771 1.81061 1.92161 -0.06970 -0.00960 -0.12630 120 U  A "O4'" 
386  C  "C3'" . U  A 18  ? 1.47501 1.84021 1.93471 -0.06250 -0.03350 -0.13900 120 U  A "C3'" 
387  O  "O3'" . U  A 18  ? 1.49371 1.88121 1.96681 -0.05590 -0.04320 -0.14150 120 U  A "O3'" 
388  C  "C2'" . U  A 18  ? 1.45591 1.80311 1.88111 -0.05570 -0.03320 -0.13210 120 U  A "C2'" 
389  O  "O2'" . U  A 18  ? 1.49311 1.84351 1.90821 -0.04560 -0.03270 -0.12350 120 U  A "O2'" 
390  C  "C1'" . U  A 18  ? 1.41251 1.73871 1.83131 -0.06280 -0.01870 -0.12670 120 U  A "C1'" 
391  N  N1    . U  A 18  ? 1.36711 1.68031 1.77941 -0.06940 -0.02030 -0.13250 120 U  A N1    
392  C  C2    . U  A 18  ? 1.38461 1.68561 1.76951 -0.06430 -0.02490 -0.13150 120 U  A C2    
393  O  O2    . U  A 18  ? 1.38791 1.68841 1.75381 -0.05500 -0.02750 -0.12570 120 U  A O2    
394  N  N3    . U  A 18  ? 1.40081 1.69011 1.78191 -0.07040 -0.02600 -0.13770 120 U  A N3    
395  C  C4    . U  A 18  ? 1.40191 1.68951 1.80381 -0.08120 -0.02330 -0.14440 120 U  A C4    
396  O  O4    . U  A 18  ? 1.40721 1.68281 1.80371 -0.08540 -0.02490 -0.14970 120 U  A O4    
397  C  C5    . U  A 18  ? 1.40021 1.70061 1.82971 -0.08640 -0.01840 -0.14440 120 U  A C5    
398  C  C6    . U  A 18  ? 1.38211 1.69501 1.81561 -0.08040 -0.01710 -0.13880 120 U  A C6    
399  P  P     . C  A 19  ? 1.58774 1.99314 2.06974 -0.05510 -0.06040 -0.15340 121 C  A P     
400  O  OP1   . C  A 19  ? 1.55924 1.98864 2.06354 -0.05050 -0.06660 -0.15480 121 C  A OP1   
401  O  OP2   . C  A 19  ? 1.49614 1.89664 1.98874 -0.06640 -0.06040 -0.16320 121 C  A OP2   
402  O  "O5'" . C  A 19  ? 1.52994 1.92824 1.97904 -0.04560 -0.06930 -0.15060 121 C  A "O5'" 
403  C  "C5'" . C  A 19  ? 1.50434 1.90564 1.93924 -0.03410 -0.07160 -0.14150 121 C  A "C5'" 
404  C  "C4'" . C  A 19  ? 1.55704 1.94884 1.96004 -0.02730 -0.07820 -0.13900 121 C  A "C4'" 
405  O  "O4'" . C  A 19  ? 1.58444 1.95234 1.96844 -0.03130 -0.06820 -0.13550 121 C  A "O4'" 
406  C  "C3'" . C  A 19  ? 1.59414 1.99594 1.99384 -0.02740 -0.09270 -0.15000 121 C  A "C3'" 
407  O  "O3'" . C  A 19  ? 1.66604 2.08934 2.07174 -0.01970 -0.10560 -0.15130 121 C  A "O3'" 
408  C  "C2'" . C  A 19  ? 1.54924 1.93274 1.91604 -0.02460 -0.09200 -0.14690 121 C  A "C2'" 
409  O  "O2'" . C  A 19  ? 1.62034 2.00544 1.96694 -0.01340 -0.09630 -0.13800 121 C  A "O2'" 
410  C  "C1'" . C  A 19  ? 1.51304 1.87504 1.87604 -0.02980 -0.07580 -0.13990 121 C  A "C1'" 
411  N  N1    . C  A 19  ? 1.48394 1.83454 1.85124 -0.04010 -0.07180 -0.14760 121 C  A N1    
412  C  C2    . C  A 19  ? 1.50304 1.84034 1.84764 -0.03990 -0.07390 -0.15020 121 C  A C2    
413  O  O2    . C  A 19  ? 1.50604 1.84214 1.82734 -0.03140 -0.07880 -0.14610 121 C  A O2    
414  N  N3    . C  A 19  ? 1.51494 1.84104 1.86434 -0.04890 -0.07040 -0.15720 121 C  A N3    
415  C  C4    . C  A 19  ? 1.48394 1.81134 1.85904 -0.05810 -0.06480 -0.16070 121 C  A C4    
416  N  N4    . C  A 19  ? 1.49414 1.80914 1.87374 -0.06680 -0.06140 -0.16680 121 C  A N4    
417  C  C5    . C  A 19  ? 1.47324 1.81464 1.87124 -0.05900 -0.06200 -0.15790 121 C  A C5    
418  C  C6    . C  A 19  ? 1.48884 1.84164 1.88224 -0.04960 -0.06570 -0.15170 121 C  A C6    
419  P  P     . A  A 20  ? 1.72139 2.16829 2.15349 -0.02380 -0.11780 -0.16490 122 A  A P     
420  O  OP1   . A  A 20  ? 1.77329 2.23899 2.20129 -0.01320 -0.13200 -0.16370 122 A  A OP1   
421  O  OP2   . A  A 20  ? 1.68429 2.13589 2.14799 -0.03220 -0.10940 -0.16750 122 A  A OP2   
422  O  "O5'" . A  A 20  ? 1.55269 1.99239 1.97509 -0.03030 -0.12260 -0.17630 122 A  A "O5'" 
423  C  "C5'" . A  A 20  ? 1.69329 2.14979 2.11609 -0.02870 -0.13850 -0.18750 122 A  A "C5'" 
424  C  "C4'" . A  A 20  ? 1.70749 2.16069 2.09689 -0.01940 -0.14580 -0.18380 122 A  A "C4'" 
425  O  "O4'" . A  A 20  ? 1.65649 2.08859 2.02599 -0.02370 -0.13980 -0.18590 122 A  A "O4'" 
426  C  "C3'" . A  A 20  ? 1.78819 2.26279 2.17539 -0.01490 -0.16370 -0.19320 122 A  A "C3'" 
427  O  "O3'" . A  A 20  ? 1.86049 2.33729 2.22169 -0.00320 -0.16920 -0.18340 122 A  A "O3'" 
428  C  "C2'" . A  A 20  ? 1.71059 2.17719 2.08919 -0.02180 -0.16600 -0.20590 122 A  A "C2'" 
429  O  "O2'" . A  A 20  ? 1.68009 2.15869 2.04189 -0.01650 -0.18020 -0.21310 122 A  A "O2'" 
430  C  "C1'" . A  A 20  ? 1.68809 2.12719 2.04529 -0.02260 -0.15200 -0.19680 122 A  A "C1'" 
431  N  N9    . A  A 20  ? 1.67429 2.09869 2.03239 -0.03210 -0.14710 -0.20630 122 A  A N9    
432  C  C8    . A  A 20  ? 1.64329 2.06319 2.02689 -0.04330 -0.14090 -0.21310 122 A  A C8    
433  N  N7    . A  A 20  ? 1.63439 2.03939 2.01229 -0.04960 -0.13780 -0.22050 122 A  A N7    
434  C  C5    . A  A 20  ? 1.65099 2.05099 1.99749 -0.04210 -0.14220 -0.21900 122 A  A C5    
435  C  C6    . A  A 20  ? 1.65099 2.03679 1.97809 -0.04330 -0.14160 -0.22480 122 A  A C6    
436  N  N6    . A  A 20  ? 1.61649 1.98899 1.95369 -0.05260 -0.13670 -0.23340 122 A  A N6    
437  N  N1    . A  A 20  ? 1.67579 2.06139 1.97309 -0.03430 -0.14620 -0.22130 122 A  A N1    
438  C  C2    . A  A 20  ? 1.67189 2.06989 1.95959 -0.02500 -0.15100 -0.21190 122 A  A C2    
439  N  N3    . A  A 20  ? 1.64159 2.05279 1.94579 -0.02270 -0.15240 -0.20560 122 A  A N3    
440  C  C4    . A  A 20  ? 1.65029 2.06209 1.98409 -0.03160 -0.14770 -0.21000 122 A  A C4    
441  P  P     . A  A 21  ? 1.97237 2.47327 2.34097 0.00660  -0.18160 -0.17930 123 A  A P     
442  O  OP1   . A  A 21  ? 1.83277 2.34107 2.23267 0.00430  -0.17620 -0.17670 123 A  A OP1   
443  O  OP2   . A  A 21  ? 1.89807 2.41787 2.26407 0.00780  -0.19830 -0.19160 123 A  A OP2   
444  O  "O5'" . A  A 21  ? 1.89247 2.38337 2.23117 0.01770  -0.17910 -0.16310 123 A  A "O5'" 
445  C  "C5'" . A  A 21  ? 1.89987 2.38847 2.24427 0.02360  -0.17250 -0.14950 123 A  A "C5'" 
446  C  "C4'" . A  A 21  ? 1.90697 2.37447 2.25597 0.01740  -0.15490 -0.14440 123 A  A "C4'" 
447  O  "O4'" . A  A 21  ? 1.86537 2.31797 2.20627 0.00850  -0.14940 -0.15230 123 A  A "O4'" 
448  C  "C3'" . A  A 21  ? 1.85987 2.31037 2.18907 0.02400  -0.14530 -0.12900 123 A  A "C3'" 
449  O  "O3'" . A  A 21  ? 1.90007 2.35877 2.24267 0.03070  -0.14470 -0.12000 123 A  A "O3'" 
450  C  "C2'" . A  A 21  ? 1.76827 2.19667 2.09587 0.01520  -0.13000 -0.12910 123 A  A "C2'" 
451  O  "O2'" . A  A 21  ? 1.82597 2.25537 2.17987 0.01020  -0.12110 -0.12870 123 A  A "O2'" 
452  C  "C1'" . A  A 21  ? 1.76477 2.19397 2.09287 0.00700  -0.13470 -0.14330 123 A  A "C1'" 
453  N  N9    . A  A 21  ? 1.67257 2.08807 1.97047 0.00820  -0.13490 -0.14330 123 A  A N9    
454  C  C8    . A  A 21  ? 1.69567 2.10977 1.96647 0.01710  -0.13960 -0.13620 123 A  A C8    
455  N  N7    . A  A 21  ? 1.75627 2.15777 2.00517 0.01540  -0.13790 -0.13910 123 A  A N7    
456  C  C5    . A  A 21  ? 1.72117 2.11467 1.98397 0.00490  -0.13220 -0.14870 123 A  A C5    
457  C  C6    . A  A 21  ? 1.69187 2.07077 1.94497 -0.00140 -0.12800 -0.15590 123 A  A C6    
458  N  N6    . A  A 21  ? 1.68407 2.05437 1.90997 0.00200  -0.12890 -0.15520 123 A  A N6    
459  N  N1    . A  A 21  ? 1.61167 1.98517 1.88497 -0.01150 -0.12270 -0.16380 123 A  A N1    
460  C  C2    . A  A 21  ? 1.63847 2.02137 1.93957 -0.01530 -0.12120 -0.16450 123 A  A C2    
461  N  N3    . A  A 21  ? 1.69287 2.09057 2.00607 -0.01020 -0.12450 -0.15890 123 A  A N3    
462  C  C4    . A  A 21  ? 1.67767 2.07977 1.97037 0.00010  -0.13020 -0.15110 123 A  A C4    
463  P  P     . C  A 22  ? 1.86865 2.31005 2.20195 0.03550  -0.13190 -0.10540 124 C  A P     
464  O  OP1   . C  A 22  ? 1.77485 2.22955 2.11805 0.04530  -0.13760 -0.09750 124 C  A OP1   
465  O  OP2   . C  A 22  ? 1.84625 2.26805 2.14765 0.03660  -0.12720 -0.10000 124 C  A OP2   
466  O  "O5'" . C  A 22  ? 1.75105 2.18455 2.10595 0.02620  -0.11790 -0.10800 124 C  A "O5'" 
467  C  "C5'" . C  A 22  ? 1.72815 2.14885 2.08335 0.02790  -0.10490 -0.09820 124 C  A "C5'" 
468  C  "C4'" . C  A 22  ? 1.71975 2.13065 2.08835 0.01740  -0.09170 -0.10220 124 C  A "C4'" 
469  O  "O4'" . C  A 22  ? 1.62695 2.03125 1.98885 0.00900  -0.09240 -0.11100 124 C  A "O4'" 
470  C  "C3'" . C  A 22  ? 1.75105 2.14155 2.10855 0.01720  -0.07680 -0.09310 124 C  A "C3'" 
471  O  "O3'" . C  A 22  ? 1.83015 2.22615 2.20435 0.02110  -0.07130 -0.08770 124 C  A "O3'" 
472  C  "C2'" . C  A 22  ? 1.70435 2.08325 2.06515 0.00550  -0.06730 -0.09900 124 C  A "C2'" 
473  O  "O2'" . C  A 22  ? 1.67225 2.05855 2.06065 -0.00030 -0.06030 -0.10200 124 C  A "O2'" 
474  C  "C1'" . C  A 22  ? 1.63965 2.02555 1.99915 0.00140  -0.07830 -0.10960 124 C  A "C1'" 
475  N  N1    . C  A 22  ? 1.63805 2.00705 1.97115 -0.00040 -0.07740 -0.11010 124 C  A N1    
476  C  C2    . C  A 22  ? 1.61975 1.97095 1.94945 -0.00860 -0.06600 -0.11070 124 C  A C2    
477  O  O2    . C  A 22  ? 1.55695 1.90625 1.90405 -0.01430 -0.05630 -0.11010 124 C  A O2    
478  N  N3    . C  A 22  ? 1.60075 1.93715 1.90795 -0.00990 -0.06570 -0.11160 124 C  A N3    
479  C  C4    . C  A 22  ? 1.58705 1.92645 1.87535 -0.00380 -0.07550 -0.11240 124 C  A C4    
480  N  N4    . C  A 22  ? 1.53695 1.86215 1.80425 -0.00530 -0.07430 -0.11380 124 C  A N4    
481  C  C5    . C  A 22  ? 1.61695 1.97455 1.90715 0.00420  -0.08710 -0.11150 124 C  A C5    
482  C  C6    . C  A 22  ? 1.64095 2.01255 1.95385 0.00580  -0.08800 -0.11030 124 C  A C6    
483  P  P     . A  A 23  ? 1.92184 2.31404 2.28454 0.03260  -0.07120 -0.07600 125 A  A P     
484  O  OP1   . A  A 23  ? 1.78764 2.19994 2.16034 0.04070  -0.08520 -0.07600 125 A  A OP1   
485  O  OP2   . A  A 23  ? 1.92574 2.29774 2.25774 0.03420  -0.06720 -0.06960 125 A  A OP2   
486  O  "O5'" . A  A 23  ? 1.84484 2.23494 2.22584 0.03140  -0.05820 -0.07300 125 A  A "O5'" 
487  C  "C5'" . A  A 23  ? 1.77414 2.15434 2.14684 0.03840  -0.05160 -0.06340 125 A  A "C5'" 
488  C  "C4'" . A  A 23  ? 1.73754 2.10644 2.11534 0.03280  -0.03570 -0.06250 125 A  A "C4'" 
489  O  "O4'" . A  A 23  ? 1.83724 2.22144 2.24544 0.02890  -0.03260 -0.06830 125 A  A "O4'" 
490  C  "C3'" . A  A 23  ? 1.75754 2.10984 2.12004 0.02350  -0.02780 -0.06480 125 A  A "C3'" 
491  O  "O3'" . A  A 23  ? 1.80944 2.14554 2.16174 0.02320  -0.01500 -0.05890 125 A  A "O3'" 
492  C  "C2'" . A  A 23  ? 1.79844 2.16114 2.18454 0.01400  -0.02520 -0.07350 125 A  A "C2'" 
493  O  "O2'" . A  A 23  ? 1.77014 2.11914 2.15184 0.00480  -0.01350 -0.07460 125 A  A "O2'" 
494  C  "C1'" . A  A 23  ? 1.84574 2.22364 2.25774 0.01780  -0.02310 -0.07330 125 A  A "C1'" 
495  N  N9    . A  A 23  ? 1.87054 2.26734 2.31114 0.01230  -0.02620 -0.08180 125 A  A N9    
496  C  C8    . A  A 23  ? 1.85954 2.26674 2.32614 0.00930  -0.01820 -0.08420 125 A  A C8    
497  N  N7    . A  A 23  ? 1.93024 2.35454 2.42064 0.00420  -0.02320 -0.09230 125 A  A N7    
498  C  C5    . A  A 23  ? 1.94304 2.36824 2.42204 0.00390  -0.03570 -0.09590 125 A  A C5    
499  C  C6    . A  A 23  ? 1.94674 2.38684 2.44024 -0.00050 -0.04630 -0.10510 125 A  A C6    
500  N  N6    . A  A 23  ? 1.82604 2.28354 2.35054 -0.00600 -0.04580 -0.11220 125 A  A N6    
501  N  N1    . A  A 23  ? 1.96974 2.40714 2.44514 0.00060  -0.05750 -0.10740 125 A  A N1    
502  C  C2    . A  A 23  ? 1.89594 2.31674 2.34114 0.00590  -0.05740 -0.10030 125 A  A C2    
503  N  N3    . A  A 23  ? 1.90834 2.31404 2.33824 0.01020  -0.04820 -0.09100 125 A  A N3    
504  C  C4    . A  A 23  ? 1.90294 2.31154 2.35094 0.00900  -0.03760 -0.08940 125 A  A C4    
505  P  P     . G  A 24  ? 1.76961 2.08591 2.09041 0.02660  -0.01330 -0.05190 126 G  A P     
506  O  OP1   . G  A 24  ? 1.60131 1.90551 1.91841 0.02710  -0.00060 -0.04680 126 G  A OP1   
507  O  OP2   . G  A 24  ? 1.69791 2.01951 2.00901 0.03530  -0.02560 -0.04830 126 G  A OP2   
508  O  "O5'" . G  A 24  ? 1.64281 1.94901 1.95071 0.01780  -0.01230 -0.05650 126 G  A "O5'" 
509  C  "C5'" . G  A 24  ? 1.58451 1.88151 1.89511 0.00900  -0.00090 -0.05850 126 G  A "C5'" 
510  C  "C4'" . G  A 24  ? 1.55361 1.84191 1.85291 0.00200  -0.00250 -0.06290 126 G  A "C4'" 
511  O  "O4'" . G  A 24  ? 1.55661 1.85961 1.86941 -0.00050 -0.01280 -0.07090 126 G  A "O4'" 
512  C  "C3'" . G  A 24  ? 1.47871 1.75401 1.75031 0.00560  -0.00610 -0.05940 126 G  A "C3'" 
513  O  "O3'" . G  A 24  ? 1.37811 1.63581 1.63371 0.00520  0.00390  -0.05350 126 G  A "O3'" 
514  C  "C2'" . G  A 24  ? 1.41651 1.69221 1.68661 -0.00050 -0.01210 -0.06710 126 G  A "C2'" 
515  O  "O2'" . G  A 24  ? 1.39131 1.65501 1.66161 -0.00920 -0.00290 -0.06880 126 G  A "O2'" 
516  C  "C1'" . G  A 24  ? 1.46681 1.76281 1.76231 -0.00190 -0.01910 -0.07380 126 G  A "C1'" 
517  N  N9    . G  A 24  ? 1.50381 1.81231 1.79581 0.00530  -0.03270 -0.07510 126 G  A N9    
518  C  C8    . G  A 24  ? 1.58161 1.90411 1.88261 0.01310  -0.03870 -0.07210 126 G  A C8    
519  N  N7    . G  A 24  ? 1.58691 1.91821 1.88021 0.01830  -0.05110 -0.07350 126 G  A N7    
520  C  C5    . G  A 24  ? 1.53611 1.85901 1.81461 0.01350  -0.05290 -0.07840 126 G  A C5    
521  C  C6    . G  A 24  ? 1.57511 1.90221 1.83941 0.01570  -0.06400 -0.08250 126 G  A C6    
522  O  O6    . G  A 24  ? 1.63601 1.97581 1.89701 0.02250  -0.07510 -0.08190 126 G  A O6    
523  N  N1    . G  A 24  ? 1.56471 1.87961 1.81781 0.00920  -0.06140 -0.08770 126 G  A N1    
524  C  C2    . G  A 24  ? 1.53811 1.83841 1.79321 0.00170  -0.05000 -0.08800 126 G  A C2    
525  N  N2    . G  A 24  ? 1.58111 1.87081 1.82511 -0.00330 -0.04950 -0.09320 126 G  A N2    
526  N  N3    . G  A 24  ? 1.48451 1.78091 1.75151 -0.00050 -0.03980 -0.08360 126 G  A N3    
527  C  C4    . G  A 24  ? 1.50031 1.80871 1.77841 0.00560  -0.04180 -0.07940 126 G  A C4    
528  P  P     . C  A 25  ? 1.34646 1.59456 1.57986 0.01350  0.00290  -0.04570 127 C  A P     
529  O  OP1   . C  A 25  ? 1.34846 1.58156 1.57286 0.01190  0.01480  -0.04090 127 C  A OP1   
530  O  OP2   . C  A 25  ? 1.49966 1.76056 1.74066 0.02180  -0.00430 -0.04290 127 C  A OP2   
531  O  "O5'" . C  A 25  ? 1.37456 1.61676 1.58886 0.01300  -0.00410 -0.04790 127 C  A "O5'" 
532  C  "C5'" . C  A 25  ? 1.36456 1.59496 1.57076 0.00590  0.00000  -0.05120 127 C  A "C5'" 
533  C  "C4'" . C  A 25  ? 1.35886 1.58936 1.55276 0.00610  -0.00900 -0.05560 127 C  A "C4'" 
534  O  "O4'" . C  A 25  ? 1.43436 1.68176 1.64346 0.00540  -0.01860 -0.06270 127 C  A "O4'" 
535  C  "C3'" . C  A 25  ? 1.43586 1.66376 1.60936 0.01390  -0.01390 -0.05040 127 C  A "C3'" 
536  O  "O3'" . C  A 25  ? 1.45436 1.66546 1.60916 0.01380  -0.00720 -0.04590 127 C  A "O3'" 
537  C  "C2'" . C  A 25  ? 1.47236 1.70986 1.64306 0.01420  -0.02530 -0.05730 127 C  A "C2'" 
538  O  "O2'" . C  A 25  ? 1.46966 1.69716 1.63036 0.00910  -0.02420 -0.06250 127 C  A "O2'" 
539  C  "C1'" . C  A 25  ? 1.48486 1.73746 1.68066 0.01050  -0.02890 -0.06390 127 C  A "C1'" 
540  N  N1    . C  A 25  ? 1.51346 1.78216 1.71806 0.01740  -0.03660 -0.06160 127 C  A N1    
541  C  C2    . C  A 25  ? 1.55126 1.83166 1.75056 0.02130  -0.04880 -0.06500 127 C  A C2    
542  O  O2    . C  A 25  ? 1.57316 1.85026 1.76056 0.01880  -0.05240 -0.07050 127 C  A O2    
543  N  N3    . C  A 25  ? 1.59216 1.88746 1.79916 0.02800  -0.05640 -0.06220 127 C  A N3    
544  C  C4    . C  A 25  ? 1.55656 1.85466 1.77736 0.03090  -0.05190 -0.05670 127 C  A C4    
545  N  N4    . C  A 25  ? 1.64826 1.96106 1.87736 0.03800  -0.06000 -0.05380 127 C  A N4    
546  C  C5    . C  A 25  ? 1.50306 1.78966 1.72976 0.02690  -0.03910 -0.05400 127 C  A C5    
547  C  C6    . C  A 25  ? 1.52596 1.79826 1.74356 0.02020  -0.03190 -0.05640 127 C  A C6    
548  P  P     . C  A 26  ? 1.42532 1.63032 1.56442 0.02150  -0.00570 -0.03670 128 C  A P     
549  O  OP1   . C  A 26  ? 1.46462 1.65252 1.58872 0.01920  0.00230  -0.03400 128 C  A OP1   
550  O  OP2   . C  A 26  ? 1.43522 1.64752 1.58782 0.02560  -0.00420 -0.03220 128 C  A OP2   
551  O  "O5'" . C  A 26  ? 1.43402 1.64632 1.56082 0.02680  -0.01640 -0.03700 128 C  A "O5'" 
552  C  "C5'" . C  A 26  ? 1.49252 1.70002 1.60472 0.02480  -0.01930 -0.04150 128 C  A "C5'" 
553  C  "C4'" . C  A 26  ? 1.58312 1.80012 1.68422 0.03060  -0.02930 -0.04120 128 C  A "C4'" 
554  O  "O4'" . C  A 26  ? 1.58172 1.81572 1.69712 0.03050  -0.03840 -0.04730 128 C  A "O4'" 
555  C  "C3'" . C  A 26  ? 1.62542 1.84342 1.71822 0.03850  -0.03010 -0.03100 128 C  A "C3'" 
556  O  "O3'" . C  A 26  ? 1.58542 1.79002 1.66012 0.04010  -0.02450 -0.02530 128 C  A "O3'" 
557  C  "C2'" . C  A 26  ? 1.68572 1.91922 1.77592 0.04310  -0.04200 -0.03270 128 C  A "C2'" 
558  O  "O2'" . C  A 26  ? 1.70572 1.93712 1.77682 0.04320  -0.04530 -0.03560 128 C  A "O2'" 
559  C  "C1'" . C  A 26  ? 1.61862 1.86342 1.72862 0.03820  -0.04630 -0.04230 128 C  A "C1'" 
560  N  N1    . C  A 26  ? 1.61802 1.87292 1.74752 0.04080  -0.04770 -0.03950 128 C  A N1    
561  C  C2    . C  A 26  ? 1.67122 1.94032 1.80212 0.04780  -0.05730 -0.03610 128 C  A C2    
562  O  O2    . C  A 26  ? 1.66682 1.93992 1.78142 0.05150  -0.06430 -0.03540 128 C  A O2    
563  N  N3    . C  A 26  ? 1.68622 1.96482 1.83622 0.05070  -0.05860 -0.03360 128 C  A N3    
564  C  C4    . C  A 26  ? 1.62432 1.89902 1.79112 0.04650  -0.05030 -0.03480 128 C  A C4    
565  N  N4    . C  A 26  ? 1.63402 1.91912 1.82032 0.04980  -0.05160 -0.03280 128 C  A N4    
566  C  C5    . C  A 26  ? 1.61242 1.87292 1.77692 0.03910  -0.04020 -0.03790 128 C  A C5    
567  C  C6    . C  A 26  ? 1.58172 1.83262 1.72762 0.03670  -0.03960 -0.03980 128 C  A C6    
568  P  P     . G  A 27  ? 1.66110 1.85910 1.73280 0.04540  -0.01910 -0.01430 129 G  A P     
569  O  OP1   . G  A 27  ? 1.73530 1.91870 1.79020 0.04460  -0.01260 -0.01130 129 G  A OP1   
570  O  OP2   . G  A 27  ? 1.48990 1.68970 1.58100 0.04440  -0.01490 -0.01360 129 G  A OP2   
571  O  "O5'" . G  A 27  ? 1.69080 1.89980 1.75690 0.05310  -0.02790 -0.00870 129 G  A "O5'" 
572  C  "C5'" . G  A 27  ? 1.71620 1.92700 1.76360 0.05540  -0.03300 -0.00820 129 G  A "C5'" 
573  C  "C4'" . G  A 27  ? 1.70380 1.92840 1.74950 0.06220  -0.04260 -0.00370 129 G  A "C4'" 
574  O  "O4'" . G  A 27  ? 1.69810 1.93730 1.76010 0.06120  -0.05010 -0.01070 129 G  A "O4'" 
575  C  "C3'" . G  A 27  ? 1.76130 1.98470 1.81080 0.06860  -0.04130 0.00770  129 G  A "C3'" 
576  O  "O3'" . G  A 27  ? 1.88460 2.09850 1.91700 0.07170  -0.03750 0.01620  129 G  A "O3'" 
577  C  "C2'" . G  A 27  ? 1.80200 2.04290 1.85830 0.07370  -0.05250 0.00850  129 G  A "C2'" 
578  O  "O2'" . G  A 27  ? 1.80980 2.05640 1.84730 0.07760  -0.05920 0.01150  129 G  A "O2'" 
579  C  "C1'" . G  A 27  ? 1.77790 2.02760 1.84730 0.06790  -0.05610 -0.00400 129 G  A "C1'" 
580  N  N9    . G  A 27  ? 1.70080 1.95360 1.79400 0.06650  -0.05360 -0.00560 129 G  A N9    
581  C  C8    . G  A 27  ? 1.67700 1.92210 1.78160 0.05990  -0.04520 -0.01080 129 G  A C8    
582  N  N7    . G  A 27  ? 1.68700 1.93830 1.81240 0.06020  -0.04430 -0.01120 129 G  A N7    
583  C  C5    . G  A 27  ? 1.76200 2.02540 1.89080 0.06780  -0.05300 -0.00600 129 G  A C5    
584  C  C6    . G  A 27  ? 1.79410 2.06880 1.94350 0.07190  -0.05640 -0.00410 129 G  A C6    
585  O  O6    . G  A 27  ? 1.81580 2.09250 1.98510 0.06950  -0.05170 -0.00720 129 G  A O6    
586  N  N1    . G  A 27  ? 1.78930 2.07420 1.93450 0.07990  -0.06630 0.00230  129 G  A N1    
587  C  C2    . G  A 27  ? 1.81970 2.10430 1.94280 0.08320  -0.07170 0.00640  129 G  A C2    
588  N  N2    . G  A 27  ? 1.85040 2.14580 1.97200 0.09120  -0.08110 0.01340  129 G  A N2    
589  N  N3    . G  A 27  ? 1.82700 2.10160 1.93080 0.07920  -0.06800 0.00430  129 G  A N3    
590  C  C4    . G  A 27  ? 1.75700 2.02130 1.86550 0.07170  -0.05890 -0.00210 129 G  A C4    
591  P  P     . U  A 28  ? 1.90372 2.10372 1.93892 0.07310  -0.02800 0.02470  130 U  A P     
592  O  OP1   . U  A 28  ? 1.97132 2.16102 1.98692 0.07270  -0.02350 0.02830  130 U  A OP1   
593  O  OP2   . U  A 28  ? 1.69902 1.89392 1.75072 0.06860  -0.02140 0.01990  130 U  A OP2   
594  O  "O5'" . U  A 28  ? 1.94192 2.14852 1.98312 0.08110  -0.03300 0.03470  130 U  A "O5'" 
595  C  "C5'" . U  A 28  ? 2.00262 2.21702 2.03062 0.08660  -0.04070 0.04110  130 U  A "C5'" 
596  C  "C4'" . U  A 28  ? 1.98232 2.20892 2.02242 0.09330  -0.04880 0.04650  130 U  A "C4'" 
597  O  "O4'" . U  A 28  ? 1.91322 2.15092 1.97142 0.09110  -0.05320 0.03750  130 U  A "O4'" 
598  C  "C3'" . U  A 28  ? 2.04012 2.25962 2.09002 0.09830  -0.04480 0.05680  130 U  A "C3'" 
599  O  "O3'" . U  A 28  ? 2.13762 2.35322 2.17412 0.10400  -0.04580 0.06920  130 U  A "O3'" 
600  C  "C2'" . U  A 28  ? 2.02482 2.25572 2.09742 0.10130  -0.05010 0.05490  130 U  A "C2'" 
601  O  "O2'" . U  A 28  ? 2.07432 2.31422 2.15002 0.10950  -0.05830 0.06400  130 U  A "O2'" 
602  C  "C1'" . U  A 28  ? 1.96772 2.21032 2.04412 0.09620  -0.05520 0.04250  130 U  A "C1'" 
603  N  N1    . U  A 28  ? 1.90572 2.14932 2.00352 0.09170  -0.05100 0.03410  130 U  A N1    
604  C  C2    . U  A 28  ? 1.91572 2.17442 2.03282 0.09390  -0.05790 0.03090  130 U  A C2    
605  O  O2    . U  A 28  ? 1.91722 2.18882 2.03522 0.09970  -0.06820 0.03440  130 U  A O2    
606  N  N3    . U  A 28  ? 1.90292 2.16182 2.03872 0.08880  -0.05240 0.02310  130 U  A N3    
607  C  C4    . U  A 28  ? 1.84612 2.09192 1.98222 0.08230  -0.04120 0.01910  130 U  A C4    
608  O  O4    . U  A 28  ? 1.80342 2.05172 1.95692 0.07830  -0.03700 0.01280  130 U  A O4    
609  C  C5    . U  A 28  ? 1.87072 2.10122 1.98602 0.08080  -0.03520 0.02290  130 U  A C5    
610  C  C6    . U  A 28  ? 1.88282 2.11322 1.98092 0.08530  -0.04020 0.02980  130 U  A C6    
611  P  P     . A  A 29  ? 2.18954 2.41394 2.20674 0.10890  -0.05410 0.07660  131 A  A P     
612  O  OP1   . A  A 29  ? 2.09494 2.33494 2.10824 0.10750  -0.06330 0.06760  131 A  A OP1   
613  O  OP2   . A  A 29  ? 2.20164 2.41364 2.20054 0.10750  -0.04710 0.08230  131 A  A OP2   
614  O  "O5'" . A  A 29  ? 2.13904 2.36834 2.16594 0.11770  -0.05990 0.08880  131 A  A "O5'" 
615  C  "C5'" . A  A 29  ? 2.14894 2.37054 2.19444 0.12080  -0.05550 0.09410  131 A  A "C5'" 
616  C  "C4'" . A  A 29  ? 2.09844 2.30194 2.13774 0.11980  -0.04520 0.10100  131 A  A "C4'" 
617  O  "O4'" . A  A 29  ? 2.14064 2.34304 2.15704 0.12080  -0.04630 0.10840  131 A  A "O4'" 
618  C  "C3'" . A  A 29  ? 2.10764 2.30354 2.16164 0.12540  -0.04260 0.11070  131 A  A "C3'" 
619  O  "O3'" . A  A 29  ? 2.14514 2.33174 2.21474 0.12160  -0.03400 0.10370  131 A  A "O3'" 
620  C  "C2'" . A  A 29  ? 2.12744 2.31294 2.16574 0.12770  -0.03930 0.12330  131 A  A "C2'" 
621  O  "O2'" . A  A 29  ? 2.20124 2.37024 2.23824 0.12320  -0.02820 0.12260  131 A  A "O2'" 
622  C  "C1'" . A  A 29  ? 2.13124 2.32454 2.14644 0.12580  -0.04360 0.12230  131 A  A "C1'" 
623  N  N9    . A  A 29  ? 2.03074 2.23334 2.03444 0.13230  -0.05220 0.13340  131 A  A N9    
624  C  C8    . A  A 29  ? 1.97964 2.19954 1.97694 0.13490  -0.06310 0.13130  131 A  A C8    
625  N  N7    . A  A 29  ? 1.93844 2.16334 1.92254 0.14080  -0.06870 0.14370  131 A  A N7    
626  C  C5    . A  A 29  ? 1.96014 2.16934 1.94254 0.14180  -0.06060 0.15500  131 A  A C5    
627  C  C6    . A  A 29  ? 1.96064 2.16544 1.93214 0.14690  -0.06050 0.17160  131 A  A C6    
628  N  N6    . A  A 29  ? 1.93854 2.15584 1.89704 0.15250  -0.06980 0.18050  131 A  A N6    
629  N  N1    . A  A 29  ? 1.93644 2.12374 1.91074 0.14580  -0.05070 0.17910  131 A  A N1    
630  C  C2    . A  A 29  ? 1.93214 2.10774 1.91944 0.14040  -0.04190 0.17020  131 A  A C2    
631  N  N3    . A  A 29  ? 2.00574 2.18444 2.00274 0.13570  -0.04110 0.15500  131 A  A N3    
632  C  C4    . A  A 29  ? 1.97634 2.17164 1.97064 0.13650  -0.05050 0.14820  131 A  A C4    
633  P  P     . C  A 30  ? 2.23335 2.42075 2.32895 0.12640  -0.03390 0.10490  132 C  A P     
634  O  OP1   . C  A 30  ? 2.23255 2.41635 2.32945 0.13440  -0.03680 0.11920  132 C  A OP1   
635  O  OP2   . C  A 30  ? 2.10415 2.28175 2.21025 0.12100  -0.02370 0.09640  132 C  A OP2   
636  O  "O5'" . C  A 30  ? 2.19245 2.39895 2.29915 0.12800  -0.04370 0.09850  132 C  A "O5'" 
637  C  "C5'" . C  A 30  ? 2.12255 2.34095 2.23275 0.13590  -0.05440 0.10640  132 C  A "C5'" 
638  C  "C4'" . C  A 30  ? 2.11635 2.34695 2.25145 0.13890  -0.05910 0.10120  132 C  A "C4'" 
639  O  "O4'" . C  A 30  ? 2.09435 2.33805 2.23065 0.13350  -0.06310 0.08890  132 C  A "O4'" 
640  C  "C3'" . C  A 30  ? 2.10385 2.32635 2.25985 0.13780  -0.05000 0.09670  132 C  A "C3'" 
641  O  "O3'" . C  A 30  ? 2.11425 2.32785 2.27925 0.14470  -0.04810 0.10700  132 C  A "O3'" 
642  C  "C2'" . C  A 30  ? 2.06805 2.30685 2.24375 0.13740  -0.05490 0.08710  132 C  A "C2'" 
643  O  "O2'" . C  A 30  ? 2.05055 2.30045 2.24025 0.14640  -0.06420 0.09380  132 C  A "O2'" 
644  C  "C1'" . C  A 30  ? 2.05915 2.30785 2.21955 0.13210  -0.06060 0.08060  132 C  A "C1'" 
645  N  N1    . C  A 30  ? 2.01515 2.25905 2.17345 0.12240  -0.05260 0.06870  132 C  A N1    
646  C  C2    . C  A 30  ? 2.00855 2.25785 2.18775 0.11890  -0.04900 0.05910  132 C  A C2    
647  O  O2    . C  A 30  ? 2.00995 2.26855 2.21005 0.12410  -0.05250 0.05970  132 C  A O2    
648  N  N3    . C  A 30  ? 1.96375 2.20825 2.14045 0.11010  -0.04160 0.04940  132 C  A N3    
649  C  C4    . C  A 30  ? 1.94005 2.17485 2.09535 0.10510  -0.03820 0.04870  132 C  A C4    
650  N  N4    . C  A 30  ? 1.89125 2.12135 2.04525 0.09680  -0.03130 0.03970  132 C  A N4    
651  C  C5    . C  A 30  ? 1.96715 2.19695 2.10175 0.10850  -0.04160 0.05760  132 C  A C5    
652  C  C6    . C  A 30  ? 1.97855 2.21315 2.11495 0.11680  -0.04850 0.06750  132 C  A C6    
653  P  P     . A  A 31  ? 2.21557 2.41477 2.39517 0.14310  -0.03620 0.10380  133 A  A P     
654  O  OP1   . A  A 31  ? 2.20817 2.39757 2.39257 0.15060  -0.03590 0.11620  133 A  A OP1   
655  O  OP2   . A  A 31  ? 2.11597 2.30527 2.28267 0.13390  -0.02690 0.09600  133 A  A OP2   
656  O  "O5'" . A  A 31  ? 2.02067 2.23217 2.22647 0.14400  -0.03720 0.09450  133 A  A "O5'" 
657  C  "C5'" . A  A 31  ? 2.01177 2.23487 2.23537 0.15260  -0.04580 0.09920  133 A  A "C5'" 
658  C  "C4'" . A  A 31  ? 1.99417 2.22987 2.24137 0.15150  -0.04540 0.08820  133 A  A "C4'" 
659  O  "O4'" . A  A 31  ? 1.96127 2.20887 2.20207 0.14470  -0.04870 0.07890  133 A  A "O4'" 
660  C  "C3'" . A  A 31  ? 1.95977 2.18647 2.21977 0.14740  -0.03290 0.08000  133 A  A "C3'" 
661  O  "O3'" . A  A 31  ? 1.92857 2.14827 2.20517 0.15440  -0.02990 0.08490  133 A  A "O3'" 
662  C  "C2'" . A  A 31  ? 1.93927 2.18147 2.21357 0.14300  -0.03350 0.06800  133 A  A "C2'" 
663  O  "O2'" . A  A 31  ? 1.93417 2.19037 2.23267 0.15030  -0.04000 0.06850  133 A  A "O2'" 
664  C  "C1'" . A  A 31  ? 1.96857 2.21907 2.22467 0.13890  -0.04140 0.06700  133 A  A "C1'" 
665  N  N9    . A  A 31  ? 1.95677 2.19837 2.19557 0.12910  -0.03380 0.06050  133 A  A N9    
666  C  C8    . A  A 31  ? 1.97287 2.20247 2.18687 0.12610  -0.03180 0.06470  133 A  A C8    
667  N  N7    . A  A 31  ? 1.94477 2.16867 2.14917 0.11740  -0.02490 0.05700  133 A  A N7    
668  C  C5    . A  A 31  ? 1.89527 2.12767 2.11897 0.11420  -0.02180 0.04750  133 A  A C5    
669  C  C6    . A  A 31  ? 1.82647 2.05817 2.05167 0.10550  -0.01450 0.03740  133 A  A C6    
670  N  N6    . A  A 31  ? 1.81887 2.04027 2.02557 0.09860  -0.00940 0.03490  133 A  A N6    
671  N  N1    . A  A 31  ? 1.75787 2.00007 2.00507 0.10430  -0.01260 0.03030  133 A  A N1    
672  C  C2    . A  A 31  ? 1.79497 2.04807 2.06197 0.11160  -0.01780 0.03250  133 A  A C2    
673  N  N3    . A  A 31  ? 1.87317 2.12797 2.14137 0.12050  -0.02550 0.04170  133 A  A N3    
674  C  C4    . A  A 31  ? 1.89957 2.14317 2.14477 0.12120  -0.02700 0.04920  133 A  A C4    
675  P  P     . G  A 32  ? 1.94267 2.14537 2.22277 0.15120  -0.01620 0.08080  134 G  A P     
676  O  OP1   . G  A 32  ? 1.95197 2.14767 2.24767 0.16010  -0.01580 0.08810  134 G  A OP1   
677  O  OP2   . G  A 32  ? 1.89887 2.08897 2.15377 0.14380  -0.01080 0.08080  134 G  A OP2   
678  O  "O5'" . G  A 32  ? 1.87947 2.09147 2.17667 0.14640  -0.01010 0.06690  134 G  A "O5'" 
679  C  "C5'" . G  A 32  ? 1.80317 2.03047 2.12597 0.15150  -0.01420 0.06360  134 G  A "C5'" 
680  C  "C4'" . G  A 32  ? 1.77937 2.01647 2.11267 0.14450  -0.00840 0.05050  134 G  A "C4'" 
681  O  "O4'" . G  A 32  ? 1.77107 2.01557 2.08957 0.13740  -0.01250 0.04710  134 G  A "O4'" 
682  C  "C3'" . G  A 32  ? 1.76167 1.98697 2.09287 0.13820  0.00540  0.04300  134 G  A "C3'" 
683  O  "O3'" . G  A 32  ? 1.70367 1.92597 2.05497 0.14330  0.01150  0.04100  134 G  A "O3'" 
684  C  "C2'" . G  A 32  ? 1.76627 2.00227 2.09797 0.12940  0.00810  0.03280  134 G  A "C2'" 
685  O  "O2'" . G  A 32  ? 1.66497 1.91677 2.02287 0.13160  0.00800  0.02660  134 G  A "O2'" 
686  C  "C1'" . G  A 32  ? 1.80247 2.04527 2.11937 0.12810  -0.00280 0.03690  134 G  A "C1'" 
687  N  N9    . G  A 32  ? 1.77837 2.00867 2.06817 0.12150  0.00010  0.03800  134 G  A N9    
688  C  C8    . G  A 32  ? 1.79357 2.01407 2.06327 0.12350  -0.00400 0.04700  134 G  A C8    
689  N  N7    . G  A 32  ? 1.80257 2.01377 2.05167 0.11640  0.00020  0.04520  134 G  A N7    
690  C  C5    . G  A 32  ? 1.77937 1.99387 2.03497 0.10930  0.00730  0.03500  134 G  A C5    
691  C  C6    . G  A 32  ? 1.74637 1.95417 1.98767 0.10020  0.01390  0.02930  134 G  A C6    
692  O  O6    . G  A 32  ? 1.68027 1.87797 1.90047 0.09670  0.01470  0.03160  134 G  A O6    
693  N  N1    . G  A 32  ? 1.69867 1.91287 1.95327 0.09510  0.02020  0.02030  134 G  A N1    
694  C  C2    . G  A 32  ? 1.63307 1.85947 1.91207 0.09820  0.02040  0.01670  134 G  A C2    
695  N  N2    . G  A 32  ? 1.54727 1.77887 1.83577 0.09200  0.02770  0.00820  134 G  A N2    
696  N  N3    . G  A 32  ? 1.70907 1.94217 2.00247 0.10690  0.01410  0.02120  134 G  A N3    
697  C  C4    . G  A 32  ? 1.74367 1.96997 2.02397 0.11200  0.00770  0.03050  134 G  A C4    
698  P  P     . U  A 33  ? 1.76872 1.97232 2.11382 0.14110  0.02340  0.03900  135 U  A P     
699  O  OP1   . U  A 33  ? 1.75192 1.95282 2.11872 0.14960  0.02540  0.04010  135 U  A OP1   
700  O  OP2   . U  A 33  ? 1.81612 2.00562 2.13452 0.13780  0.02270  0.04570  135 U  A OP2   
701  O  "O5'" . U  A 33  ? 1.70272 1.91012 2.04902 0.13210  0.03360  0.02660  135 U  A "O5'" 
702  C  "C5'" . U  A 33  ? 1.68962 1.91272 2.05822 0.13230  0.03560  0.01860  135 U  A "C5'" 
703  C  "C4'" . U  A 33  ? 1.63032 1.85642 1.99322 0.12220  0.04420  0.00910  135 U  A "C4'" 
704  O  "O4'" . U  A 33  ? 1.61812 1.84812 1.96492 0.11610  0.03840  0.01040  135 U  A "O4'" 
705  C  "C3'" . U  A 33  ? 1.52782 1.73832 1.87572 0.11690  0.05500  0.00590  135 U  A "C3'" 
706  O  "O3'" . U  A 33  ? 1.56442 1.77282 1.92742 0.11970  0.06400  0.00020  135 U  A "O3'" 
707  C  "C2'" . U  A 33  ? 1.54902 1.76312 1.88442 0.10670  0.05850  0.00060  135 U  A "C2'" 
708  O  "O2'" . U  A 33  ? 1.38502 1.61202 1.73812 0.10390  0.06460  -0.00790 135 U  A "O2'" 
709  C  "C1'" . U  A 33  ? 1.64202 1.86382 1.97172 0.10690  0.04660  0.00590  135 U  A "C1'" 
710  N  N1    . U  A 33  ? 1.65742 1.86642 1.96152 0.10510  0.04290  0.01250  135 U  A N1    
711  C  C2    . U  A 33  ? 1.55482 1.75682 1.84002 0.09650  0.04760  0.00970  135 U  A C2    
712  O  O2    . U  A 33  ? 1.51922 1.72462 1.80682 0.09010  0.05470  0.00250  135 U  A O2    
713  N  N3    . U  A 33  ? 1.59212 1.78332 1.85552 0.09570  0.04390  0.01580  135 U  A N3    
714  C  C4    . U  A 33  ? 1.68182 1.86842 1.93952 0.10200  0.03660  0.02480  135 U  A C4    
715  O  O4    . U  A 33  ? 1.67712 1.85442 1.91442 0.10010  0.03470  0.02940  135 U  A O4    
716  C  C5    . U  A 33  ? 1.68122 1.87482 1.95862 0.11070  0.03200  0.02810  135 U  A C5    
717  C  C6    . U  A 33  ? 1.69012 1.89442 1.98982 0.11200  0.03500  0.02180  135 U  A C6    
718  P  P     . A  A 34  ? 1.68413 1.87353 2.03723 0.12080  0.07070  0.00090  136 A  A P     
719  O  OP1   . A  A 34  ? 1.68563 1.87673 2.06083 0.12630  0.07710  -0.00490 136 A  A OP1   
720  O  OP2   . A  A 34  ? 1.68133 1.85943 2.02003 0.12390  0.06300  0.01160  136 A  A OP2   
721  O  "O5'" . A  A 34  ? 1.68153 1.86523 2.01543 0.11050  0.07960  -0.00510 136 A  A "O5'" 
722  C  "C5'" . A  A 34  ? 1.62703 1.81973 1.96883 0.10570  0.08830  -0.01470 136 A  A "C5'" 
723  C  "C4'" . A  A 34  ? 1.56883 1.75753 1.88943 0.09580  0.09310  -0.01710 136 A  A "C4'" 
724  O  "O4'" . A  A 34  ? 1.59123 1.78393 1.90183 0.09250  0.08460  -0.01220 136 A  A "O4'" 
725  C  "C3'" . A  A 34  ? 1.44143 1.61293 1.74093 0.09310  0.09690  -0.01570 136 A  A "C3'" 
726  O  "O3'" . A  A 34  ? 1.44873 1.61573 1.75143 0.09290  0.10710  -0.02280 136 A  A "O3'" 
727  C  "C2'" . A  A 34  ? 1.45133 1.62173 1.73083 0.08470  0.09620  -0.01480 136 A  A "C2'" 
728  O  "O2'" . A  A 34  ? 1.48223 1.65873 1.76283 0.07830  0.10490  -0.02210 136 A  A "O2'" 
729  C  "C1'" . A  A 34  ? 1.54803 1.72933 1.83393 0.08620  0.08620  -0.01050 136 A  A "C1'" 
730  N  N9    . A  A 34  ? 1.56783 1.74143 1.84143 0.08930  0.07710  -0.00180 136 A  A N9    
731  C  C8    . A  A 34  ? 1.55773 1.73233 1.83973 0.09730  0.06920  0.00470  136 A  A C8    
732  N  N7    . A  A 34  ? 1.55293 1.71973 1.81863 0.09800  0.06280  0.01220  136 A  A N7    
733  C  C5    . A  A 34  ? 1.54013 1.70053 1.78653 0.09010  0.06680  0.01000  136 A  A C5    
734  C  C6    . A  A 34  ? 1.48413 1.63543 1.70843 0.08690  0.06380  0.01460  136 A  A C6    
735  N  N6    . A  A 34  ? 1.46503 1.61263 1.68203 0.09110  0.05640  0.02280  136 A  A N6    
736  N  N1    . A  A 34  ? 1.47663 1.62333 1.68663 0.07930  0.06900  0.01060  136 A  A N1    
737  C  C2    . A  A 34  ? 1.43493 1.58563 1.65143 0.07500  0.07670  0.00320  136 A  A C2    
738  N  N3    . A  A 34  ? 1.40463 1.56413 1.64053 0.07700  0.08070  -0.00170 136 A  A N3    
739  C  C4    . A  A 34  ? 1.49103 1.65513 1.74183 0.08480  0.07530  0.00170  136 A  A C4    
740  P  P     . C  A 35  ? 1.58329 1.73349 1.87749 0.09560  0.10930  -0.02160 137 C  A P     
741  O  OP1   . C  A 35  ? 1.64769 1.79799 1.95139 0.09630  0.11940  -0.03100 137 C  A OP1   
742  O  OP2   . C  A 35  ? 1.50159 1.64679 1.80069 0.10280  0.10030  -0.01280 137 C  A OP2   
743  O  "O5'" . C  A 35  ? 1.61589 1.75609 1.88289 0.08800  0.11020  -0.01960 137 C  A "O5'" 
744  C  "C5'" . C  A 35  ? 1.59269 1.73599 1.84959 0.08030  0.11700  -0.02520 137 C  A "C5'" 
745  C  "C4'" . C  A 35  ? 1.54199 1.67799 1.77559 0.07440  0.11400  -0.02070 137 C  A "C4'" 
746  O  "O4'" . C  A 35  ? 1.44859 1.58909 1.68189 0.07540  0.10440  -0.01400 137 C  A "O4'" 
747  C  "C3'" . C  A 35  ? 1.47889 1.59959 1.69759 0.07490  0.11330  -0.01750 137 C  A "C3'" 
748  O  "O3'" . C  A 35  ? 1.49639 1.61119 1.70679 0.07150  0.12160  -0.02380 137 C  A "O3'" 
749  C  "C2'" . C  A 35  ? 1.41529 1.53319 1.61719 0.07140  0.10650  -0.01090 137 C  A "C2'" 
750  O  "O2'" . C  A 35  ? 1.46639 1.58429 1.65449 0.06400  0.11060  -0.01390 137 C  A "O2'" 
751  C  "C1'" . C  A 35  ? 1.39919 1.52909 1.61359 0.07390  0.09980  -0.00800 137 C  A "C1'" 
752  N  N1    . C  A 35  ? 1.47379 1.60149 1.69329 0.08080  0.09170  -0.00070 137 C  A N1    
753  C  C2    . C  A 35  ? 1.44189 1.56289 1.64549 0.08010  0.08550  0.00640  137 C  A C2    
754  O  O2    . C  A 35  ? 1.36379 1.48049 1.55029 0.07410  0.08680  0.00580  137 C  A O2    
755  N  N3    . C  A 35  ? 1.47279 1.59209 1.67979 0.08620  0.07850  0.01390  137 C  A N3    
756  C  C4    . C  A 35  ? 1.46799 1.59159 1.69419 0.09310  0.07700  0.01480  137 C  A C4    
757  N  N4    . C  A 35  ? 1.40119 1.52259 1.62959 0.09910  0.06980  0.02340  137 C  A N4    
758  C  C5    . C  A 35  ? 1.53559 1.66609 1.77969 0.09420  0.08300  0.00720  137 C  A C5    
759  C  C6    . C  A 35  ? 1.52089 1.65349 1.76059 0.08780  0.09040  -0.00050 137 C  A C6    
760  P  P     . C  A 36  ? 1.54089 1.64239 1.74769 0.07430  0.12340  -0.02440 138 C  A P     
761  O  OP1   . C  A 36  ? 1.54309 1.64219 1.74169 0.07000  0.13200  -0.03250 138 C  A OP1   
762  O  OP2   . C  A 36  ? 1.61089 1.71239 1.83719 0.08220  0.12090  -0.02300 138 C  A OP2   
763  O  "O5'" . C  A 36  ? 1.54579 1.63749 1.73439 0.07230  0.11700  -0.01650 138 C  A "O5'" 
764  C  "C5'" . C  A 36  ? 1.48789 1.57799 1.65749 0.06560  0.11750  -0.01600 138 C  A "C5'" 
765  C  "C4'" . C  A 36  ? 1.38769 1.46759 1.54229 0.06480  0.11260  -0.00970 138 C  A "C4'" 
766  O  "O4'" . C  A 36  ? 1.31049 1.39249 1.46899 0.06860  0.10450  -0.00180 138 C  A "O4'" 
767  C  "C3'" . C  A 36  ? 1.37209 1.44069 1.52539 0.06680  0.11480  -0.01060 138 C  A "C3'" 
768  O  "O3'" . C  A 36  ? 1.38269 1.44359 1.51759 0.06260  0.11400  -0.00860 138 C  A "O3'" 
769  C  "C2'" . C  A 36  ? 1.43309 1.49929 1.59719 0.07310  0.10910  -0.00350 138 C  A "C2'" 
770  O  "O2'" . C  A 36  ? 1.48929 1.54389 1.64879 0.07420  0.10830  -0.00010 138 C  A "O2'" 
771  C  "C1'" . C  A 36  ? 1.35189 1.42439 1.51039 0.07240  0.10210  0.00300  138 C  A "C1'" 
772  N  N1    . C  A 36  ? 1.41389 1.49079 1.58539 0.07860  0.09600  0.00910  138 C  A N1    
773  C  C2    . C  A 36  ? 1.45589 1.52849 1.62029 0.08070  0.08950  0.01820  138 C  A C2    
774  O  O2    . C  A 36  ? 1.44419 1.50969 1.59259 0.07720  0.08940  0.02040  138 C  A O2    
775  N  N3    . C  A 36  ? 1.49029 1.56719 1.66539 0.08660  0.08350  0.02450  138 C  A N3    
776  C  C4    . C  A 36  ? 1.47709 1.56219 1.67049 0.09060  0.08350  0.02180  138 C  A C4    
777  N  N4    . C  A 36  ? 1.49019 1.57969 1.69379 0.09690  0.07680  0.02860  138 C  A N4    
778  C  C5    . C  A 36  ? 1.49099 1.58099 1.69319 0.08860  0.09050  0.01200  138 C  A C5    
779  C  C6    . C  A 36  ? 1.50099 1.58659 1.69109 0.08250  0.09670  0.00610  138 C  A C6    
780  P  P     . A  A 37  ? 1.42271 1.47631 1.54941 0.05960  0.12000  -0.01510 139 A  A P     
781  O  OP1   . A  A 37  ? 1.36691 1.42201 1.50811 0.06250  0.12550  -0.02230 139 A  A OP1   
782  O  OP2   . A  A 37  ? 1.51981 1.56331 1.63681 0.05910  0.11700  -0.01050 139 A  A OP2   
783  O  "O5'" . A  A 37  ? 1.31571 1.37371 1.42871 0.05340  0.12290  -0.01830 139 A  A "O5'" 
784  C  "C5'" . A  A 37  ? 1.34071 1.40801 1.45971 0.05200  0.12760  -0.02350 139 A  A "C5'" 
785  C  "C4'" . A  A 37  ? 1.35401 1.42481 1.46001 0.04640  0.12780  -0.02250 139 A  A "C4'" 
786  O  "O4'" . A  A 37  ? 1.20491 1.27911 1.31191 0.04660  0.12130  -0.01610 139 A  A "O4'" 
787  C  "C3'" . A  A 37  ? 1.22181 1.28481 1.30911 0.04240  0.12760  -0.02180 139 A  A "C3'" 
788  O  "O3'" . A  A 37  ? 1.25001 1.31241 1.33151 0.04010  0.13410  -0.02830 139 A  A "O3'" 
789  C  "C2'" . A  A 37  ? 1.30851 1.37421 1.38731 0.03870  0.12420  -0.01740 139 A  A "C2'" 
790  O  "O2'" . A  A 37  ? 1.38991 1.46211 1.46781 0.03490  0.12920  -0.02060 139 A  A "O2'" 
791  C  "C1'" . A  A 37  ? 1.27641 1.34691 1.36721 0.04230  0.11880  -0.01310 139 A  A "C1'" 
792  N  N9    . A  A 37  ? 1.37151 1.43581 1.45781 0.04460  0.11250  -0.00720 139 A  A N9    
793  C  C8    . A  A 37  ? 1.37501 1.43761 1.47091 0.04990  0.10950  -0.00410 139 A  A C8    
794  N  N7    . A  A 37  ? 1.34771 1.40511 1.43601 0.05070  0.10450  0.00160  139 A  A N7    
795  C  C5    . A  A 37  ? 1.32241 1.37811 1.39581 0.04590  0.10420  0.00150  139 A  A C5    
796  C  C6    . A  A 37  ? 1.31231 1.36341 1.37281 0.04440  0.10020  0.00570  139 A  A C6    
797  N  N6    . A  A 37  ? 1.31401 1.36171 1.37361 0.04740  0.09610  0.01110  139 A  A N6    
798  N  N1    . A  A 37  ? 1.30401 1.35431 1.35281 0.03980  0.10090  0.00420  139 A  A N1    
799  C  C2    . A  A 37  ? 1.35881 1.41231 1.40801 0.03670  0.10530  -0.00030 139 A  A C2    
800  N  N3    . A  A 37  ? 1.32131 1.37981 1.38121 0.03740  0.10980  -0.00430 139 A  A N3    
801  C  C4    . A  A 37  ? 1.34111 1.40061 1.41331 0.04220  0.10890  -0.00350 139 A  A C4    
802  P  P     . A  A 38  ? 1.40765 1.46095 1.47805 0.03930  0.13460  -0.03070 140 A  A P     
803  O  OP1   . A  A 38  ? 1.46135 1.51725 1.52965 0.03780  0.14160  -0.03880 140 A  A OP1   
804  O  OP2   . A  A 38  ? 1.38665 1.43345 1.46445 0.04340  0.13080  -0.02800 140 A  A OP2   
805  O  "O5'" . A  A 38  ? 1.38845 1.43855 1.44155 0.03500  0.13120  -0.02600 140 A  A "O5'" 
806  C  "C5'" . A  A 38  ? 1.36935 1.42395 1.41435 0.03090  0.13350  -0.02590 140 A  A "C5'" 
807  C  "C4'" . A  A 38  ? 1.38585 1.43635 1.41795 0.02810  0.12880  -0.02050 140 A  A "C4'" 
808  O  "O4'" . A  A 38  ? 1.47585 1.52695 1.51375 0.02990  0.12300  -0.01510 140 A  A "O4'" 
809  C  "C3'" . A  A 38  ? 1.31995 1.36245 1.34115 0.02790  0.12660  -0.02020 140 A  A "C3'" 
810  O  "O3'" . A  A 38  ? 1.37565 1.41735 1.38565 0.02510  0.13010  -0.02380 140 A  A "O3'" 
811  C  "C2'" . A  A 38  ? 1.35995 1.39975 1.37535 0.02710  0.12060  -0.01390 140 A  A "C2'" 
812  O  "O2'" . A  A 38  ? 1.36635 1.40705 1.37185 0.02330  0.12090  -0.01250 140 A  A "O2'" 
813  C  "C1'" . A  A 38  ? 1.35745 1.40205 1.38555 0.02960  0.11830  -0.01120 140 A  A "C1'" 
814  N  N9    . A  A 38  ? 1.26995 1.31145 1.30505 0.03380  0.11520  -0.00900 140 A  A N9    
815  C  C8    . A  A 38  ? 1.27085 1.31375 1.31945 0.03760  0.11660  -0.01050 140 A  A C8    
816  N  N7    . A  A 38  ? 1.27535 1.31385 1.32745 0.04070  0.11320  -0.00680 140 A  A N7    
817  C  C5    . A  A 38  ? 1.33465 1.36935 1.37425 0.03870  0.10960  -0.00300 140 A  A C5    
818  C  C6    . A  A 38  ? 1.34665 1.37655 1.38275 0.04000  0.10570  0.00210  140 A  A C6    
819  N  N6    . A  A 38  ? 1.36735 1.39475 1.41225 0.04380  0.10450  0.00520  140 A  A N6    
820  N  N1    . A  A 38  ? 1.37505 1.40295 1.39865 0.03750  0.10330  0.00420  140 A  A N1    
821  C  C2    . A  A 38  ? 1.36455 1.39425 1.38015 0.03400  0.10440  0.00170  140 A  A C2    
822  N  N3    . A  A 38  ? 1.26735 1.30085 1.28475 0.03220  0.10800  -0.00220 140 A  A N3    
823  C  C4    . A  A 38  ? 1.31475 1.35115 1.34435 0.03460  0.11060  -0.00460 140 A  A C4    
824  P  P     . G  A 39  ? 1.37874 1.41584 1.38534 0.02600  0.13150  -0.02910 141 G  A P     
825  O  OP1   . G  A 39  ? 1.30924 1.34744 1.30254 0.02280  0.13450  -0.03210 141 G  A OP1   
826  O  OP2   . G  A 39  ? 1.37944 1.41764 1.40054 0.02940  0.13400  -0.03350 141 G  A OP2   
827  O  "O5'" . G  A 39  ? 1.33654 1.36674 1.33894 0.02660  0.12560  -0.02470 141 G  A "O5'" 
828  C  "C5'" . G  A 39  ? 1.31694 1.34494 1.30744 0.02430  0.12210  -0.02030 141 G  A "C5'" 
829  C  "C4'" . G  A 39  ? 1.32894 1.35204 1.31944 0.02570  0.11710  -0.01600 141 G  A "C4'" 
830  O  "O4'" . G  A 39  ? 1.33124 1.35584 1.33174 0.02810  0.11500  -0.01210 141 G  A "O4'" 
831  C  "C3'" . G  A 39  ? 1.38514 1.40364 1.37814 0.02700  0.11710  -0.01880 141 G  A "C3'" 
832  O  "O3'" . G  A 39  ? 1.49694 1.51324 1.47934 0.02490  0.11690  -0.02150 141 G  A "O3'" 
833  C  "C2'" . G  A 39  ? 1.38174 1.39734 1.37924 0.02900  0.11310  -0.01300 141 G  A "C2'" 
834  O  "O2'" . G  A 39  ? 1.46894 1.48274 1.45634 0.02750  0.10960  -0.00930 141 G  A "O2'" 
835  C  "C1'" . G  A 39  ? 1.29394 1.31414 1.29854 0.03040  0.11260  -0.00990 141 G  A "C1'" 
836  N  N9    . G  A 39  ? 1.27524 1.29614 1.29374 0.03360  0.11440  -0.01130 141 G  A N9    
837  C  C8    . G  A 39  ? 1.37204 1.39744 1.39864 0.03440  0.11820  -0.01550 141 G  A C8    
838  N  N7    . G  A 39  ? 1.37954 1.40424 1.41924 0.03790  0.11890  -0.01590 141 G  A N7    
839  C  C5    . G  A 39  ? 1.27274 1.29174 1.31234 0.03920  0.11540  -0.01100 141 G  A C5    
840  C  C6    . G  A 39  ? 1.32114 1.33634 1.37214 0.04290  0.11440  -0.00820 141 G  A C6    
841  O  O6    . G  A 39  ? 1.33744 1.35314 1.40174 0.04600  0.11610  -0.00980 141 G  A O6    
842  N  N1    . G  A 39  ? 1.38654 1.39684 1.43254 0.04260  0.11120  -0.00270 141 G  A N1    
843  C  C2    . G  A 39  ? 1.38634 1.39604 1.41904 0.03960  0.10920  -0.00100 141 G  A C2    
844  N  N2    . G  A 39  ? 1.45534 1.46094 1.48574 0.03990  0.10680  0.00420  141 G  A N2    
845  N  N3    . G  A 39  ? 1.33334 1.34624 1.35614 0.03670  0.10970  -0.00380 141 G  A N3    
846  C  C4    . G  A 39  ? 1.24444 1.26164 1.27104 0.03650  0.11280  -0.00840 141 G  A C4    
847  P  P     . U  A 40  ? 1.50693 1.52163 1.49113 0.02500  0.11950  -0.02890 142 U  A P     
848  O  OP1   . U  A 40  ? 1.48293 1.49733 1.45433 0.02260  0.11830  -0.03090 142 U  A OP1   
849  O  OP2   . U  A 40  ? 1.47773 1.49613 1.46973 0.02600  0.12420  -0.03400 142 U  A OP2   
850  O  "O5'" . U  A 40  ? 1.37343 1.38303 1.36673 0.02680  0.11740  -0.02720 142 U  A "O5'" 
851  C  "C5'" . U  A 40  ? 1.35803 1.36463 1.34693 0.02630  0.11340  -0.02220 142 U  A "C5'" 
852  C  "C4'" . U  A 40  ? 1.40333 1.40573 1.40273 0.02820  0.11260  -0.01930 142 U  A "C4'" 
853  O  "O4'" . U  A 40  ? 1.41833 1.42193 1.42593 0.03080  0.11250  -0.01490 142 U  A "O4'" 
854  C  "C3'" . U  A 40  ? 1.45103 1.45023 1.45973 0.02870  0.11510  -0.02530 142 U  A "C3'" 
855  O  "O3'" . U  A 40  ? 1.52283 1.52013 1.52713 0.02650  0.11430  -0.02900 142 U  A "O3'" 
856  C  "C2'" . U  A 40  ? 1.44943 1.44503 1.47023 0.03130  0.11460  -0.01980 142 U  A "C2'" 
857  O  "O2'" . U  A 40  ? 1.32243 1.31493 1.34123 0.03070  0.11200  -0.01440 142 U  A "O2'" 
858  C  "C1'" . U  A 40  ? 1.43273 1.43253 1.45293 0.03300  0.11360  -0.01490 142 U  A "C1'" 
859  N  N1    . U  A 40  ? 1.47573 1.47783 1.50543 0.03510  0.11660  -0.01860 142 U  A N1    
860  C  C2    . U  A 40  ? 1.43523 1.43423 1.47903 0.03830  0.11720  -0.01680 142 U  A C2    
861  O  O2    . U  A 40  ? 1.37783 1.37203 1.42563 0.03920  0.11550  -0.01180 142 U  A O2    
862  N  N3    . U  A 40  ? 1.47773 1.47953 1.53113 0.04050  0.12010  -0.02080 142 U  A N3    
863  C  C4    . U  A 40  ? 1.44243 1.45023 1.49233 0.03940  0.12290  -0.02630 142 U  A C4    
864  O  O4    . U  A 40  ? 1.49683 1.50733 1.55723 0.04170  0.12580  -0.02990 142 U  A O4    
865  C  C5    . U  A 40  ? 1.41733 1.42773 1.45183 0.03580  0.12230  -0.02710 142 U  A C5    
866  C  C6    . U  A 40  ? 1.44803 1.45543 1.47343 0.03390  0.11910  -0.02330 142 U  A C6    
867  P  P     . C  A 41  ? 1.56798 1.56508 1.57488 0.02550  0.11690  -0.03930 143 C  A P     
868  O  OP1   . C  A 41  ? 1.56108 1.55848 1.55958 0.02300  0.11470  -0.04220 143 C  A OP1   
869  O  OP2   . C  A 41  ? 1.54498 1.54648 1.55038 0.02610  0.12010  -0.04380 143 C  A OP2   
870  O  "O5'" . C  A 41  ? 1.45318 1.44458 1.47638 0.02700  0.11840  -0.04030 143 C  A "O5'" 
871  C  "C5'" . C  A 41  ? 1.42998 1.41678 1.45778 0.02660  0.11650  -0.03490 143 C  A "C5'" 
872  C  "C4'" . C  A 41  ? 1.40458 1.38578 1.44848 0.02880  0.11820  -0.03310 143 C  A "C4'" 
873  O  "O4'" . C  A 41  ? 1.46278 1.44528 1.50998 0.03200  0.11830  -0.02720 143 C  A "O4'" 
874  C  "C3'" . C  A 41  ? 1.47138 1.45008 1.52598 0.02910  0.12130  -0.04280 143 C  A "C3'" 
875  O  "O3'" . C  A 41  ? 1.51088 1.48648 1.56858 0.02640  0.12120  -0.04850 143 C  A "O3'" 
876  C  "C2'" . C  A 41  ? 1.49468 1.46898 1.56388 0.03260  0.12270  -0.03820 143 C  A "C2'" 
877  O  "O2'" . C  A 41  ? 1.51538 1.48298 1.59308 0.03240  0.12190  -0.03220 143 C  A "O2'" 
878  C  "C1'" . C  A 41  ? 1.49238 1.47138 1.55448 0.03450  0.12090  -0.03000 143 C  A "C1'" 
879  N  N1    . C  A 41  ? 1.48248 1.46678 1.54438 0.03620  0.12300  -0.03440 143 C  A N1    
880  C  C2    . C  A 41  ? 1.50238 1.48508 1.57878 0.03970  0.12520  -0.03570 143 C  A C2    
881  O  O2    . C  A 41  ? 1.49628 1.47238 1.58518 0.04150  0.12520  -0.03260 143 C  A O2    
882  N  N3    . C  A 41  ? 1.51608 1.50468 1.59338 0.04110  0.12760  -0.04010 143 C  A N3    
883  C  C4    . C  A 41  ? 1.49198 1.48718 1.55588 0.03890  0.12800  -0.04250 143 C  A C4    
884  N  N4    . C  A 41  ? 1.43128 1.43248 1.49708 0.04010  0.13100  -0.04650 143 C  A N4    
885  C  C5    . C  A 41  ? 1.49008 1.48618 1.53878 0.03540  0.12550  -0.04070 143 C  A C5    
886  C  C6    . C  A 41  ? 1.46468 1.45548 1.51328 0.03430  0.12300  -0.03700 143 C  A C6    
887  P  P     . U  A 42  ? 1.65665 1.63385 1.71545 0.02500  0.12320  -0.06220 144 U  A P     
888  O  OP1   . U  A 42  ? 1.70115 1.67785 1.75775 0.02150  0.12120  -0.06610 144 U  A OP1   
889  O  OP2   . U  A 42  ? 1.49395 1.47825 1.54155 0.02570  0.12430  -0.06580 144 U  A OP2   
890  O  "O5'" . U  A 42  ? 1.66715 1.63805 1.74505 0.02720  0.12640  -0.06610 144 U  A "O5'" 
891  C  "C5'" . U  A 42  ? 1.60915 1.57185 1.70095 0.02760  0.12640  -0.06040 144 U  A "C5'" 
892  C  "C4'" . U  A 42  ? 1.61345 1.57085 1.72185 0.03120  0.12910  -0.06100 144 U  A "C4'" 
893  O  "O4'" . U  A 42  ? 1.64555 1.60645 1.75105 0.03480  0.12900  -0.05370 144 U  A "O4'" 
894  C  "C3'" . U  A 42  ? 1.66785 1.62585 1.78315 0.03180  0.13230  -0.07480 144 U  A "C3'" 
895  O  "O3'" . U  A 42  ? 1.68425 1.63655 1.81015 0.02940  0.13300  -0.08280 144 U  A "O3'" 
896  C  "C2'" . U  A 42  ? 1.71605 1.67215 1.84315 0.03670  0.13450  -0.07200 144 U  A "C2'" 
897  O  "O2'" . U  A 42  ? 1.75975 1.70585 1.90515 0.03830  0.13500  -0.06800 144 U  A "O2'" 
898  C  "C1'" . U  A 42  ? 1.67575 1.63665 1.79195 0.03800  0.13200  -0.05990 144 U  A "C1'" 
899  N  N1    . U  A 42  ? 1.61905 1.58935 1.72325 0.03840  0.13290  -0.06360 144 U  A N1    
900  C  C2    . U  A 42  ? 1.65015 1.62285 1.76275 0.04200  0.13570  -0.06650 144 U  A C2    
901  O  O2    . U  A 42  ? 1.68325 1.65055 1.81265 0.04540  0.13700  -0.06610 144 U  A O2    
902  N  N3    . U  A 42  ? 1.62425 1.60605 1.72575 0.04170  0.13700  -0.06950 144 U  A N3    
903  C  C4    . U  A 42  ? 1.54215 1.52985 1.62505 0.03830  0.13570  -0.06940 144 U  A C4    
904  O  O4    . U  A 42  ? 1.48105 1.47625 1.55605 0.03820  0.13760  -0.07160 144 U  A O4    
905  C  C5    . U  A 42  ? 1.51615 1.50055 1.59155 0.03510  0.13240  -0.06640 144 U  A C5    
906  C  C6    . U  A 42  ? 1.54595 1.52235 1.63205 0.03520  0.13130  -0.06400 144 U  A C6    
907  P  P     . C  A 43  ? 1.75867 1.71577 1.87947 0.02680  0.13380  -0.09870 145 C  A P     
908  O  OP1   . C  A 43  ? 1.79727 1.74877 1.92727 0.02320  0.13280  -0.10320 145 C  A OP1   
909  O  OP2   . C  A 43  ? 1.60457 1.57167 1.70407 0.02570  0.13220  -0.09850 145 C  A OP2   
910  O  "O5'" . C  A 43  ? 1.77997 1.73657 1.91197 0.03020  0.13800  -0.10840 145 C  A "O5'" 
911  C  "C5'" . C  A 43  ? 1.78717 1.73417 1.94087 0.03240  0.14010  -0.10970 145 C  A "C5'" 
912  C  "C4'" . C  A 43  ? 1.80097 1.74937 1.96287 0.03710  0.14380  -0.11420 145 C  A "C4'" 
913  O  "O4'" . C  A 43  ? 1.74187 1.69497 1.89647 0.04000  0.14310  -0.10300 145 C  A "O4'" 
914  C  "C3'" . C  A 43  ? 1.85167 1.80837 2.00657 0.03690  0.14660  -0.12930 145 C  A "C3'" 
915  O  "O3'" . C  A 43  ? 1.87417 1.82687 2.04057 0.03570  0.14830  -0.14350 145 C  A "O3'" 
916  C  "C2'" . C  A 43  ? 1.85267 1.81317 2.01137 0.04180  0.14960  -0.12740 145 C  A "C2'" 
917  O  "O2'" . C  A 43  ? 1.90437 1.85717 2.08577 0.04560  0.15220  -0.13100 145 C  A "O2'" 
918  C  "C1'" . C  A 43  ? 1.76667 1.72717 1.91937 0.04260  0.14640  -0.11020 145 C  A "C1'" 
919  N  N1    . C  A 43  ? 1.72417 1.69497 1.85547 0.04080  0.14540  -0.10710 145 C  A N1    
920  C  C2    . C  A 43  ? 1.75947 1.73827 1.88757 0.04330  0.14820  -0.10840 145 C  A C2    
921  O  O2    . C  A 43  ? 1.78267 1.76057 1.92597 0.04720  0.15140  -0.11240 145 C  A O2    
922  N  N3    . C  A 43  ? 1.73777 1.72527 1.84727 0.04130  0.14750  -0.10520 145 C  A N3    
923  C  C4    . C  A 43  ? 1.70627 1.69437 1.80087 0.03760  0.14390  -0.10100 145 C  A C4    
924  N  N4    . C  A 43  ? 1.71677 1.71267 1.79427 0.03590  0.14330  -0.09770 145 C  A N4    
925  C  C5    . C  A 43  ? 1.70297 1.68387 1.80057 0.03530  0.14080  -0.10000 145 C  A C5    
926  C  C6    . C  A 43  ? 1.71327 1.68587 1.82927 0.03680  0.14180  -0.10310 145 C  A C6    
927  P  P     . A  A 44  ? 1.97471 1.93661 2.12881 0.03330  0.14950  -0.15990 146 A  A P     
928  O  OP1   . A  A 44  ? 1.94921 1.90481 2.11771 0.03150  0.15000  -0.17290 146 A  A OP1   
929  O  OP2   . A  A 44  ? 1.87561 1.84591 2.00621 0.03010  0.14620  -0.15490 146 A  A OP2   
930  O  "O5'" . A  A 44  ? 1.88101 1.84961 2.03541 0.03740  0.15450  -0.16610 146 A  A "O5'" 
931  C  "C5'" . A  A 44  ? 1.86791 1.83091 2.04371 0.04170  0.15830  -0.17160 146 A  A "C5'" 
932  C  "C4'" . A  A 44  ? 1.88031 1.85201 2.05361 0.04550  0.16280  -0.17450 146 A  A "C4'" 
933  O  "O4'" . A  A 44  ? 1.81371 1.78801 1.98091 0.04710  0.16130  -0.15880 146 A  A "O4'" 
934  C  "C3'" . A  A 44  ? 1.85881 1.84331 2.01271 0.04340  0.16510  -0.18490 146 A  A "C3'" 
935  O  "O3'" . A  A 44  ? 1.82451 1.81021 1.98381 0.04320  0.16810  -0.20310 146 A  A "O3'" 
936  C  "C2'" . A  A 44  ? 1.83731 1.82971 1.98801 0.04670  0.16850  -0.17940 146 A  A "C2'" 
937  O  "O2'" . A  A 44  ? 1.83341 1.82481 2.00311 0.05140  0.17350  -0.18750 146 A  A "O2'" 
938  C  "C1'" . A  A 44  ? 1.82901 1.81561 1.98251 0.04750  0.16430  -0.16120 146 A  A "C1'" 
939  N  N9    . A  A 44  ? 1.80091 1.79281 1.93241 0.04390  0.16080  -0.15170 146 A  A N9    
940  C  C8    . A  A 44  ? 1.77041 1.75841 1.89311 0.04020  0.15570  -0.14570 146 A  A C8    
941  N  N7    . A  A 44  ? 1.75331 1.74751 1.85701 0.03790  0.15360  -0.13810 146 A  A N7    
942  C  C5    . A  A 44  ? 1.74391 1.74651 1.84341 0.03980  0.15750  -0.13900 146 A  A C5    
943  C  C6    . A  A 44  ? 1.71401 1.72521 1.79691 0.03860  0.15790  -0.13300 146 A  A C6    
944  N  N6    . A  A 44  ? 1.67551 1.68801 1.74211 0.03550  0.15380  -0.12490 146 A  A N6    
945  N  N1    . A  A 44  ? 1.69151 1.71021 1.77621 0.04070  0.16290  -0.13580 146 A  A N1    
946  C  C2    . A  A 44  ? 1.72321 1.74111 1.82531 0.04430  0.16720  -0.14440 146 A  A C2    
947  N  N3    . A  A 44  ? 1.77231 1.78181 1.89101 0.04610  0.16710  -0.15080 146 A  A N3    
948  C  C4    . A  A 44  ? 1.76881 1.77071 1.88521 0.04350  0.16210  -0.14740 146 A  A C4    
949  P  P     . G  A 45  ? 1.93832 1.93412 2.07602 0.03900  0.16760  -0.21430 147 G  A P     
950  O  OP1   . G  A 45  ? 1.97582 1.96872 2.12502 0.03850  0.16890  -0.23210 147 G  A OP1   
951  O  OP2   . G  A 45  ? 1.94772 1.94442 2.06842 0.03500  0.16190  -0.20300 147 G  A OP2   
952  O  "O5'" . G  A 45  ? 1.82592 1.83492 1.95052 0.04080  0.17290  -0.21730 147 G  A "O5'" 
953  C  "C5'" . G  A 45  ? 1.83132 1.84272 1.96962 0.04500  0.17930  -0.22690 147 G  A "C5'" 
954  C  "C4'" . G  A 45  ? 1.82302 1.84742 1.94752 0.04600  0.18420  -0.22560 147 G  A "C4'" 
955  O  "O4'" . G  A 45  ? 1.84542 1.86902 1.97022 0.04720  0.18280  -0.20830 147 G  A "O4'" 
956  C  "C3'" . G  A 45  ? 1.74852 1.78412 1.84532 0.04200  0.18380  -0.22760 147 G  A "C3'" 
957  O  "O3'" . G  A 45  ? 1.69432 1.73632 1.78572 0.04120  0.18680  -0.24550 147 G  A "O3'" 
958  C  "C2'" . G  A 45  ? 1.71872 1.76302 1.80652 0.04290  0.18740  -0.21810 147 G  A "C2'" 
959  O  "O2'" . G  A 45  ? 1.65512 1.70722 1.74962 0.04590  0.19520  -0.22860 147 G  A "O2'" 
960  C  "C1'" . G  A 45  ? 1.81592 1.85082 1.91932 0.04510  0.18430  -0.20350 147 G  A "C1'" 
961  N  N9    . G  A 45  ? 1.80342 1.83522 1.89352 0.04190  0.17790  -0.18880 147 G  A N9    
962  C  C8    . G  A 45  ? 1.73462 1.75612 1.82902 0.04050  0.17170  -0.18240 147 G  A C8    
963  N  N7    . G  A 45  ? 1.71162 1.73362 1.79152 0.03790  0.16730  -0.17010 147 G  A N7    
964  C  C5    . G  A 45  ? 1.70132 1.73382 1.76672 0.03740  0.17070  -0.16810 147 G  A C5    
965  C  C6    . G  A 45  ? 1.66872 1.70562 1.71612 0.03490  0.16850  -0.15690 147 G  A C6    
966  O  O6    . G  A 45  ? 1.66362 1.69642 1.70402 0.03290  0.16290  -0.14670 147 G  A O6    
967  N  N1    . G  A 45  ? 1.67352 1.72092 1.71172 0.03490  0.17390  -0.15850 147 G  A N1    
968  C  C2    . G  A 45  ? 1.65602 1.70982 1.70092 0.03700  0.18080  -0.16970 147 G  A C2    
969  N  N2    . G  A 45  ? 1.56612 1.63042 1.60022 0.03620  0.18600  -0.16900 147 G  A N2    
970  N  N3    . G  A 45  ? 1.70442 1.75452 1.76602 0.03970  0.18290  -0.18100 147 G  A N3    
971  C  C4    . G  A 45  ? 1.74292 1.78192 1.81422 0.03970  0.17740  -0.17930 147 G  A C4    
972  P  P     . G  A 46  ? 1.91211 1.96021 1.97931 0.03650  0.18270  -0.25000 148 G  A P     
973  O  OP1   . G  A 46  ? 1.92041 1.97441 1.98751 0.03670  0.18610  -0.27050 148 G  A OP1   
974  O  OP2   . G  A 46  ? 1.89621 1.93491 1.96421 0.03390  0.17480  -0.24030 148 G  A OP2   
975  O  "O5'" . G  A 46  ? 1.77761 1.83731 1.82091 0.03520  0.18480  -0.24060 148 G  A "O5'" 
976  C  "C5'" . G  A 46  ? 1.66661 1.73701 1.70581 0.03700  0.19280  -0.24610 148 G  A "C5'" 
977  C  "C4'" . G  A 46  ? 1.61301 1.69201 1.63111 0.03510  0.19400  -0.23400 148 G  A "C4'" 
978  O  "O4'" . G  A 46  ? 1.66311 1.73571 1.68871 0.03570  0.19150  -0.21700 148 G  A "O4'" 
979  C  "C3'" . G  A 46  ? 1.55341 1.63611 1.54661 0.03110  0.18860  -0.23010 148 G  A "C3'" 
980  O  "O3'" . G  A 46  ? 1.60671 1.69991 1.58411 0.03000  0.19130  -0.24350 148 G  A "O3'" 
981  C  "C2'" . G  A 46  ? 1.58451 1.66961 1.56651 0.02990  0.18880  -0.21300 148 G  A "C2'" 
982  O  "O2'" . G  A 46  ? 1.57101 1.66791 1.54361 0.03010  0.19670  -0.21520 148 G  A "O2'" 
983  C  "C1'" . G  A 46  ? 1.70601 1.78171 1.71091 0.03240  0.18820  -0.20460 148 G  A "C1'" 
984  N  N9    . G  A 46  ? 1.71341 1.77841 1.72101 0.03120  0.18000  -0.19420 148 G  A N9    
985  C  C8    . G  A 46  ? 1.67131 1.72541 1.69691 0.03230  0.17610  -0.19570 148 G  A C8    
986  N  N7    . G  A 46  ? 1.61961 1.66701 1.64241 0.03050  0.16950  -0.18490 148 G  A N7    
987  C  C5    . G  A 46  ? 1.60691 1.66061 1.60901 0.02830  0.16860  -0.17600 148 G  A C5    
988  C  C6    . G  A 46  ? 1.61501 1.66591 1.60601 0.02600  0.16260  -0.16320 148 G  A C6    
989  O  O6    . G  A 46  ? 1.62871 1.67151 1.62551 0.02550  0.15700  -0.15710 148 G  A O6    
990  N  N1    . G  A 46  ? 1.58511 1.64381 1.55671 0.02440  0.16390  -0.15750 148 G  A N1    
991  C  C2    . G  A 46  ? 1.54571 1.61431 1.50921 0.02450  0.17060  -0.16280 148 G  A C2    
992  N  N2    . G  A 46  ? 1.45111 1.52561 1.39601 0.02250  0.17120  -0.15490 148 G  A N2    
993  N  N3    . G  A 46  ? 1.60491 1.67721 1.57811 0.02660  0.17660  -0.17490 148 G  A N3    
994  C  C4    . G  A 46  ? 1.62601 1.69031 1.61851 0.02850  0.17500  -0.18120 148 G  A C4    
995  P  P     . G  A 47  ? 1.81441 1.90861 1.77531 0.02690  0.18390  -0.24800 149 G  A P     
996  O  OP1   . G  A 47  ? 1.82291 1.92841 1.77201 0.02690  0.18780  -0.26500 149 G  A OP1   
997  O  OP2   . G  A 47  ? 1.72281 1.80441 1.70061 0.02660  0.17700  -0.24700 149 G  A OP2   
998  O  "O5'" . G  A 47  ? 1.67341 1.77111 1.61161 0.02440  0.18060  -0.23150 149 G  A "O5'" 
999  C  "C5'" . G  A 47  ? 1.60391 1.71191 1.52571 0.02400  0.18660  -0.22690 149 G  A "C5'" 
1000 C  "C4'" . G  A 47  ? 1.60351 1.71141 1.50781 0.02150  0.18220  -0.21020 149 G  A "C4'" 
1001 O  "O4'" . G  A 47  ? 1.64411 1.74221 1.56231 0.02200  0.17990  -0.19640 149 G  A "O4'" 
1002 C  "C3'" . G  A 47  ? 1.53851 1.64491 1.42951 0.01960  0.17320  -0.20930 149 G  A "C3'" 
1003 O  "O3'" . G  A 47  ? 1.41391 1.53141 1.28361 0.01850  0.17360  -0.21760 149 G  A "O3'" 
1004 C  "C2'" . G  A 47  ? 1.56411 1.66531 1.44961 0.01830  0.16900  -0.19040 149 G  A "C2'" 
1005 O  "O2'" . G  A 47  ? 1.59281 1.70201 1.45841 0.01700  0.17250  -0.18270 149 G  A "O2'" 
1006 C  "C1'" . G  A 47  ? 1.60531 1.69871 1.51311 0.02000  0.17200  -0.18490 149 G  A "C1'" 
1007 N  N9    . G  A 47  ? 1.62881 1.71081 1.55411 0.02060  0.16600  -0.18380 149 G  A N9    
1008 C  C8    . G  A 47  ? 1.63131 1.70781 1.57761 0.02240  0.16700  -0.19360 149 G  A C8    
1009 N  N7    . G  A 47  ? 1.60501 1.67151 1.56301 0.02220  0.16120  -0.18890 149 G  A N7    
1010 C  C5    . G  A 47  ? 1.57581 1.64171 1.52001 0.02030  0.15610  -0.17600 149 G  A C5    
1011 C  C6    . G  A 47  ? 1.49061 1.54841 1.43861 0.01930  0.14930  -0.16650 149 G  A C6    
1012 O  O6    . G  A 47  ? 1.49401 1.54341 1.45841 0.01970  0.14650  -0.16700 149 G  A O6    
1013 N  N1    . G  A 47  ? 1.48781 1.54801 1.41851 0.01780  0.14600  -0.15540 149 G  A N1    
1014 C  C2    . G  A 47  ? 1.52191 1.59051 1.43401 0.01710  0.14880  -0.15280 149 G  A C2    
1015 N  N2    . G  A 47  ? 1.51141 1.58001 1.40971 0.01580  0.14480  -0.14130 149 G  A N2    
1016 N  N3    . G  A 47  ? 1.61581 1.69221 1.52361 0.01770  0.15540  -0.16090 149 G  A N3    
1017 C  C4    . G  A 47  ? 1.62821 1.70311 1.55261 0.01940  0.15880  -0.17260 149 G  A C4    
1018 P  P     . G  A 48  ? 1.56413 1.68283 1.42973 0.01780  0.16630  -0.23000 150 G  A P     
1019 O  OP1   . G  A 48  ? 1.65133 1.78363 1.49353 0.01720  0.16840  -0.23850 150 G  A OP1   
1020 O  OP2   . G  A 48  ? 1.47933 1.59013 1.37023 0.01900  0.16610  -0.24120 150 G  A OP2   
1021 O  "O5'" . G  A 48  ? 1.66973 1.78243 1.52893 0.01610  0.15680  -0.21630 150 G  A "O5'" 
1022 C  "C5'" . G  A 48  ? 1.63633 1.75263 1.47523 0.01510  0.15550  -0.20210 150 G  A "C5'" 
1023 C  "C4'" . G  A 48  ? 1.57143 1.67953 1.41143 0.01420  0.14700  -0.18970 150 G  A "C4'" 
1024 O  "O4'" . G  A 48  ? 1.63863 1.73603 1.49823 0.01480  0.14810  -0.18080 150 G  A "O4'" 
1025 C  "C3'" . G  A 48  ? 1.54653 1.65223 1.39193 0.01360  0.13870  -0.19750 150 G  A "C3'" 
1026 O  "O3'" . G  A 48  ? 1.60563 1.72053 1.43093 0.01300  0.13390  -0.20250 150 G  A "O3'" 
1027 C  "C2'" . G  A 48  ? 1.50093 1.59603 1.35643 0.01330  0.13360  -0.18390 150 G  A "C2'" 
1028 O  "O2'" . G  A 48  ? 1.53163 1.62863 1.36923 0.01270  0.12950  -0.17100 150 G  A "O2'" 
1029 C  "C1'" . G  A 48  ? 1.52863 1.61793 1.39813 0.01430  0.14050  -0.17780 150 G  A "C1'" 
1030 N  N9    . G  A 48  ? 1.52423 1.60643 1.41773 0.01520  0.14190  -0.18610 150 G  A N9    
1031 C  C8    . G  A 48  ? 1.51383 1.59793 1.41773 0.01640  0.14800  -0.19900 150 G  A C8    
1032 N  N7    . G  A 48  ? 1.50063 1.57603 1.42673 0.01720  0.14750  -0.20320 150 G  A N7    
1033 C  C5    . G  A 48  ? 1.55153 1.61953 1.48123 0.01610  0.14100  -0.19240 150 G  A C5    
1034 C  C6    . G  A 48  ? 1.53213 1.58963 1.48213 0.01600  0.13810  -0.19030 150 G  A C6    
1035 O  O6    . G  A 48  ? 1.54153 1.59303 1.51113 0.01700  0.14040  -0.19730 150 G  A O6    
1036 N  N1    . G  A 48  ? 1.52863 1.58253 1.47453 0.01470  0.13210  -0.17830 150 G  A N1    
1037 C  C2    . G  A 48  ? 1.49113 1.55013 1.41713 0.01390  0.12890  -0.16980 150 G  A C2    
1038 N  N2    . G  A 48  ? 1.41753 1.47183 1.34383 0.01310  0.12330  -0.15950 150 G  A N2    
1039 N  N3    . G  A 48  ? 1.55953 1.62743 1.46703 0.01400  0.13130  -0.17090 150 G  A N3    
1040 C  C4    . G  A 48  ? 1.57493 1.64723 1.48503 0.01500  0.13750  -0.18230 150 G  A C4    
1041 P  P     . A  A 49  ? 1.56777 1.68697 1.39707 0.01250  0.12960  -0.22110 151 A  A P     
1042 O  OP1   . A  A 49  ? 1.42927 1.55837 1.23527 0.01200  0.12320  -0.22170 151 A  A OP1   
1043 O  OP2   . A  A 49  ? 1.65137 1.77297 1.49047 0.01340  0.13730  -0.23580 151 A  A OP2   
1044 O  "O5'" . A  A 49  ? 1.54187 1.64987 1.39327 0.01170  0.12360  -0.21940 151 A  A "O5'" 
1045 C  "C5'" . A  A 49  ? 1.47577 1.58287 1.34047 0.01080  0.11990  -0.23430 151 A  A "C5'" 
1046 C  "C4'" . A  A 49  ? 1.48857 1.59247 1.35707 0.00940  0.11060  -0.23000 151 A  A "C4'" 
1047 O  "O4'" . A  A 49  ? 1.49767 1.61097 1.34247 0.00940  0.10480  -0.22590 151 A  A "O4'" 
1048 C  "C3'" . A  A 49  ? 1.45327 1.54617 1.33327 0.00930  0.10950  -0.21380 151 A  A "C3'" 
1049 O  "O3'" . A  A 49  ? 1.41107 1.49377 1.31637 0.00880  0.11130  -0.21720 151 A  A "O3'" 
1050 C  "C2'" . A  A 49  ? 1.45487 1.55057 1.32567 0.00840  0.10030  -0.20800 151 A  A "C2'" 
1051 O  "O2'" . A  A 49  ? 1.45127 1.54517 1.33727 0.00670  0.09500  -0.21720 151 A  A "O2'" 
1052 C  "C1'" . A  A 49  ? 1.43777 1.54627 1.28357 0.00900  0.09850  -0.21270 151 A  A "C1'" 
1053 N  N9    . A  A 49  ? 1.42157 1.53217 1.24807 0.01020  0.09930  -0.19760 151 A  A N9    
1054 C  C8    . A  A 49  ? 1.43587 1.55187 1.24677 0.01100  0.10570  -0.19530 151 A  A C8    
1055 N  N7    . A  A 49  ? 1.45037 1.56637 1.24697 0.01160  0.10500  -0.18030 151 A  A N7    
1056 C  C5    . A  A 49  ? 1.44817 1.55867 1.25117 0.01140  0.09740  -0.17280 151 A  A C5    
1057 C  C6    . A  A 49  ? 1.44107 1.54857 1.23647 0.01200  0.09310  -0.15730 151 A  A C6    
1058 N  N6    . A  A 49  ? 1.44597 1.55487 1.22517 0.01270  0.09580  -0.14580 151 A  A N6    
1059 N  N1    . A  A 49  ? 1.44017 1.54317 1.24627 0.01190  0.08630  -0.15430 151 A  A N1    
1060 C  C2    . A  A 49  ? 1.41787 1.51927 1.24097 0.01080  0.08410  -0.16540 151 A  A C2    
1061 N  N3    . A  A 49  ? 1.44537 1.54847 1.27767 0.00990  0.08750  -0.18000 151 A  A N3    
1062 C  C4    . A  A 49  ? 1.46007 1.56777 1.28127 0.01050  0.09410  -0.18320 151 A  A C4    
1063 P  P     . A  A 50  ? 1.54600 1.61920 1.46530 0.01030  0.11820  -0.20780 152 A  A P     
1064 O  OP1   . A  A 50  ? 1.57920 1.64550 1.52180 0.01030  0.12110  -0.21840 152 A  A OP1   
1065 O  OP2   . A  A 50  ? 1.52950 1.60790 1.43330 0.01180  0.12390  -0.20250 152 A  A OP2   
1066 O  "O5'" . A  A 50  ? 1.56440 1.63000 1.48800 0.00980  0.11390  -0.19170 152 A  A "O5'" 
1067 C  "C5'" . A  A 50  ? 1.50050 1.56170 1.43640 0.00810  0.10810  -0.19270 152 A  A "C5'" 
1068 C  "C4'" . A  A 50  ? 1.39210 1.45450 1.31740 0.00770  0.10200  -0.18070 152 A  A "C4'" 
1069 O  "O4'" . A  A 50  ? 1.39150 1.46410 1.29360 0.00810  0.09950  -0.18150 152 A  A "O4'" 
1070 C  "C3'" . A  A 50  ? 1.36580 1.42190 1.29080 0.00880  0.10390  -0.16410 152 A  A "C3'" 
1071 O  "O3'" . A  A 50  ? 1.30200 1.34910 1.24570 0.00830  0.10350  -0.15910 152 A  A "O3'" 
1072 C  "C2'" . A  A 50  ? 1.33700 1.39860 1.24290 0.00900  0.09860  -0.15580 152 A  A "C2'" 
1073 O  "O2'" . A  A 50  ? 1.34790 1.40830 1.25950 0.00790  0.09210  -0.15380 152 A  A "O2'" 
1074 C  "C1'" . A  A 50  ? 1.38020 1.45240 1.27040 0.00900  0.09760  -0.16650 152 A  A "C1'" 
1075 N  N9    . A  A 50  ? 1.39110 1.46760 1.26520 0.01020  0.10270  -0.16280 152 A  A N9    
1076 C  C8    . A  A 50  ? 1.42060 1.49920 1.29520 0.01080  0.10980  -0.16990 152 A  A C8    
1077 N  N7    . A  A 50  ? 1.44250 1.52570 1.30110 0.01150  0.11350  -0.16410 152 A  A N7    
1078 C  C5    . A  A 50  ? 1.42160 1.50490 1.26820 0.01150  0.10810  -0.15220 152 A  A C5    
1079 C  C6    . A  A 50  ? 1.40760 1.49390 1.23590 0.01190  0.10860  -0.14120 152 A  A C6    
1080 N  N6    . A  A 50  ? 1.43370 1.52440 1.25190 0.01210  0.11540  -0.14000 152 A  A N6    
1081 N  N1    . A  A 50  ? 1.45030 1.53510 1.27190 0.01220  0.10210  -0.13110 152 A  A N1    
1082 C  C2    . A  A 50  ? 1.42220 1.50360 1.25460 0.01190  0.09580  -0.13240 152 A  A C2    
1083 N  N3    . A  A 50  ? 1.41610 1.49490 1.26560 0.01110  0.09500  -0.14200 152 A  A N3    
1084 C  C4    . A  A 50  ? 1.41660 1.49610 1.27260 0.01090  0.10130  -0.15160 152 A  A C4    
1085 P  P     . A  A 51  ? 1.43629 1.47499 1.38919 0.00980  0.10850  -0.14790 153 A  A P     
1086 O  OP1   . A  A 51  ? 1.33339 1.36379 1.30539 0.00890  0.10760  -0.14510 153 A  A OP1   
1087 O  OP2   . A  A 51  ? 1.52139 1.56159 1.47439 0.01130  0.11500  -0.15320 153 A  A OP2   
1088 O  "O5'" . A  A 51  ? 1.36249 1.40269 1.29999 0.01060  0.10640  -0.13400 153 A  A "O5'" 
1089 C  "C5'" . A  A 51  ? 1.31099 1.34949 1.24819 0.00990  0.10110  -0.12600 153 A  A "C5'" 
1090 C  "C4'" . A  A 51  ? 1.30969 1.35149 1.22909 0.01080  0.09890  -0.11640 153 A  A "C4'" 
1091 O  "O4'" . A  A 51  ? 1.39209 1.44209 1.29509 0.01080  0.09840  -0.12230 153 A  A "O4'" 
1092 C  "C3'" . A  A 51  ? 1.31429 1.35269 1.23139 0.01200  0.10320  -0.10620 153 A  A "C3'" 
1093 O  "O3'" . A  A 51  ? 1.27609 1.30819 1.20199 0.01230  0.10210  -0.09680 153 A  A "O3'" 
1094 C  "C2'" . A  A 51  ? 1.37289 1.41699 1.26999 0.01240  0.10190  -0.10190 153 A  A "C2'" 
1095 O  "O2'" . A  A 51  ? 1.30229 1.34569 1.19379 0.01250  0.09620  -0.09410 153 A  A "O2'" 
1096 C  "C1'" . A  A 51  ? 1.41999 1.47149 1.30939 0.01180  0.10070  -0.11370 153 A  A "C1'" 
1097 N  N9    . A  A 51  ? 1.36589 1.42079 1.25189 0.01210  0.10700  -0.11990 153 A  A N9    
1098 C  C8    . A  A 51  ? 1.38889 1.44229 1.28819 0.01220  0.11180  -0.12870 153 A  A C8    
1099 N  N7    . A  A 51  ? 1.43899 1.49719 1.33169 0.01270  0.11730  -0.13320 153 A  A N7    
1100 C  C5    . A  A 51  ? 1.42239 1.48549 1.29569 0.01260  0.11620  -0.12620 153 A  A C5    
1101 C  C6    . A  A 51  ? 1.48309 1.55289 1.34129 0.01260  0.12070  -0.12580 153 A  A C6    
1102 N  N6    . A  A 51  ? 1.57309 1.64679 1.43359 0.01300  0.12760  -0.13370 153 A  A N6    
1103 N  N1    . A  A 51  ? 1.45719 1.52979 1.29799 0.01240  0.11810  -0.11670 153 A  A N1    
1104 C  C2    . A  A 51  ? 1.37469 1.44369 1.21419 0.01240  0.11130  -0.10920 153 A  A C2    
1105 N  N3    . A  A 51  ? 1.31689 1.38029 1.16979 0.01250  0.10680  -0.10940 153 A  A N3    
1106 C  C4    . A  A 51  ? 1.36209 1.42289 1.23139 0.01240  0.10970  -0.11790 153 A  A C4    
1107 P  P     . C  A 52  ? 1.29747 1.32327 1.23657 0.01330  0.10700  -0.09230 154 C  A P     
1108 O  OP1   . C  A 52  ? 1.46677 1.48877 1.40587 0.01380  0.10500  -0.08060 154 C  A OP1   
1109 O  OP2   . C  A 52  ? 1.31427 1.33667 1.26967 0.01300  0.10880  -0.10030 154 C  A OP2   
1110 O  "O5'" . C  A 52  ? 1.18537 1.21447 1.11677 0.01420  0.11200  -0.09250 154 C  A "O5'" 
1111 C  "C5'" . C  A 52  ? 1.26037 1.29077 1.18057 0.01450  0.11230  -0.08340 154 C  A "C5'" 
1112 C  "C4'" . C  A 52  ? 1.39407 1.43067 1.30207 0.01430  0.11600  -0.08660 154 C  A "C4'" 
1113 O  "O4'" . C  A 52  ? 1.45997 1.50127 1.36517 0.01390  0.11610  -0.09830 154 C  A "O4'" 
1114 C  "C3'" . C  A 52  ? 1.30777 1.34477 1.22167 0.01510  0.12250  -0.08650 154 C  A "C3'" 
1115 O  "O3'" . C  A 52  ? 1.30797 1.34337 1.22027 0.01520  0.12330  -0.07610 154 C  A "O3'" 
1116 C  "C2'" . C  A 52  ? 1.36427 1.40877 1.26727 0.01460  0.12600  -0.09440 154 C  A "C2'" 
1117 O  "O2'" . C  A 52  ? 1.44257 1.49097 1.32837 0.01370  0.12550  -0.08800 154 C  A "O2'" 
1118 C  "C1'" . C  A 52  ? 1.39157 1.43757 1.29377 0.01420  0.12210  -0.10380 154 C  A "C1'" 
1119 N  N1    . C  A 52  ? 1.39597 1.44057 1.31327 0.01480  0.12500  -0.11450 154 C  A N1    
1120 C  C2    . C  A 52  ? 1.50677 1.55687 1.42247 0.01520  0.13050  -0.12390 154 C  A C2    
1121 O  O2    . C  A 52  ? 1.56627 1.62287 1.46727 0.01490  0.13320  -0.12270 154 C  A O2    
1122 N  N3    . C  A 52  ? 1.54427 1.59237 1.47507 0.01600  0.13310  -0.13420 154 C  A N3    
1123 C  C4    . C  A 52  ? 1.47497 1.51557 1.42177 0.01620  0.13040  -0.13430 154 C  A C4    
1124 N  N4    . C  A 52  ? 1.53677 1.57467 1.49907 0.01700  0.13310  -0.14420 154 C  A N4    
1125 C  C5    . C  A 52  ? 1.44127 1.47667 1.38907 0.01550  0.12510  -0.12430 154 C  A C5    
1126 C  C6    . C  A 52  ? 1.43237 1.47027 1.36527 0.01490  0.12260  -0.11510 154 C  A C6    
1127 P  P     . U  A 53  ? 1.35245 1.38555 1.27845 0.01640  0.12770  -0.07350 155 U  A P     
1128 O  OP1   . U  A 53  ? 1.36195 1.39375 1.28455 0.01600  0.12690  -0.06280 155 U  A OP1   
1129 O  OP2   . U  A 53  ? 1.27845 1.30655 1.22065 0.01770  0.12690  -0.07690 155 U  A OP2   
1130 O  "O5'" . U  A 53  ? 1.39615 1.43585 1.32045 0.01650  0.13440  -0.08060 155 U  A "O5'" 
1131 C  "C5'" . U  A 53  ? 1.41635 1.46195 1.32535 0.01510  0.13690  -0.07890 155 U  A "C5'" 
1132 C  "C4'" . U  A 53  ? 1.45055 1.50285 1.35805 0.01530  0.14310  -0.08860 155 U  A "C4'" 
1133 O  "O4'" . U  A 53  ? 1.40455 1.45745 1.31355 0.01570  0.14140  -0.09940 155 U  A "O4'" 
1134 C  "C3'" . U  A 53  ? 1.48015 1.53335 1.40325 0.01680  0.14880  -0.09130 155 U  A "C3'" 
1135 O  "O3'" . U  A 53  ? 1.42945 1.48615 1.35045 0.01600  0.15270  -0.08460 155 U  A "O3'" 
1136 C  "C2'" . U  A 53  ? 1.44745 1.50575 1.37145 0.01750  0.15300  -0.10460 155 U  A "C2'" 
1137 O  "O2'" . U  A 53  ? 1.51725 1.58415 1.42695 0.01620  0.15800  -0.10650 155 U  A "O2'" 
1138 C  "C1'" . U  A 53  ? 1.44245 1.49815 1.36145 0.01700  0.14710  -0.10930 155 U  A "C1'" 
1139 N  N1    . U  A 53  ? 1.46445 1.51355 1.40115 0.01850  0.14500  -0.11400 155 U  A N1    
1140 C  C2    . U  A 53  ? 1.57795 1.62835 1.52515 0.01990  0.14920  -0.12570 155 U  A C2    
1141 O  O2    . U  A 53  ? 1.68075 1.73835 1.62305 0.02010  0.15460  -0.13270 155 U  A O2    
1142 N  N3    . U  A 53  ? 1.54595 1.58915 1.51015 0.02110  0.14710  -0.12900 155 U  A N3    
1143 C  C4    . U  A 53  ? 1.50975 1.54525 1.48055 0.02090  0.14180  -0.12160 155 U  A C4    
1144 O  O4    . U  A 53  ? 1.60605 1.63525 1.59245 0.02180  0.14100  -0.12500 155 U  A O4    
1145 C  C5    . U  A 53  ? 1.49625 1.53165 1.45475 0.01950  0.13790  -0.11030 155 U  A C5    
1146 C  C6    . U  A 53  ? 1.46145 1.50315 1.40415 0.01850  0.13940  -0.10720 155 U  A C6    
1147 P  P     . U  A 54  ? 1.40350 1.45740 1.34110 0.01730  0.15370  -0.07880 156 U  A P     
1148 O  OP1   . U  A 54  ? 1.41900 1.47540 1.34950 0.01520  0.15510  -0.06980 156 U  A OP1   
1149 O  OP2   . U  A 54  ? 1.35970 1.40560 1.30760 0.01890  0.14800  -0.07640 156 U  A OP2   
1150 O  "O5'" . U  A 54  ? 1.59250 1.65130 1.54270 0.01930  0.16050  -0.08800 156 U  A "O5'" 
1151 C  "C5'" . U  A 54  ? 1.53710 1.60480 1.47980 0.01830  0.16740  -0.09330 156 U  A "C5'" 
1152 C  "C4'" . U  A 54  ? 1.50880 1.57980 1.46330 0.02080  0.17250  -0.10530 156 U  A "C4'" 
1153 O  "O4'" . U  A 54  ? 1.48820 1.55610 1.44080 0.02140  0.16940  -0.11390 156 U  A "O4'" 
1154 C  "C3'" . U  A 54  ? 1.57570 1.64340 1.55260 0.02390  0.17300  -0.10550 156 U  A "C3'" 
1155 O  "O3'" . U  A 54  ? 1.60290 1.67630 1.58670 0.02410  0.17760  -0.10170 156 U  A "O3'" 
1156 C  "C2'" . U  A 54  ? 1.58600 1.65390 1.57190 0.02630  0.17560  -0.11880 156 U  A "C2'" 
1157 O  "O2'" . U  A 54  ? 1.63050 1.70810 1.61580 0.02670  0.18370  -0.12690 156 U  A "O2'" 
1158 C  "C1'" . U  A 54  ? 1.50080 1.56640 1.47190 0.02440  0.17140  -0.12240 156 U  A "C1'" 
1159 N  N1    . U  A 54  ? 1.54280 1.59860 1.52240 0.02530  0.16480  -0.12110 156 U  A N1    
1160 C  C2    . U  A 54  ? 1.59570 1.64810 1.58970 0.02750  0.16560  -0.13110 156 U  A C2    
1161 O  O2    . U  A 54  ? 1.64660 1.70360 1.64640 0.02900  0.17120  -0.14130 156 U  A O2    
1162 N  N3    . U  A 54  ? 1.61180 1.65490 1.61360 0.02780  0.15990  -0.12880 156 U  A N3    
1163 C  C4    . U  A 54  ? 1.55790 1.59590 1.55450 0.02630  0.15380  -0.11810 156 U  A C4    
1164 O  O4    . U  A 54  ? 1.50060 1.53110 1.50570 0.02660  0.14980  -0.11720 156 U  A O4    
1165 C  C5    . U  A 54  ? 1.57000 1.61210 1.55170 0.02440  0.15320  -0.10910 156 U  A C5    
1166 C  C6    . U  A 54  ? 1.57640 1.62660 1.55050 0.02390  0.15850  -0.11060 156 U  A C6    
1167 P  P     . U  A 55  ? 1.60360 1.67310 1.60600 0.02650  0.17500  -0.09470 157 U  A P     
1168 O  OP1   . U  A 55  ? 1.58640 1.66290 1.58970 0.02500  0.17870  -0.08910 157 U  A OP1   
1169 O  OP2   . U  A 55  ? 1.59330 1.65320 1.59440 0.02650  0.16690  -0.08790 157 U  A OP2   
1170 O  "O5'" . U  A 55  ? 1.61680 1.68630 1.63860 0.03080  0.17810  -0.10430 157 U  A "O5'" 
1171 C  "C5'" . U  A 55  ? 1.62510 1.70360 1.65240 0.03190  0.18620  -0.11290 157 U  A "C5'" 
1172 C  "C4'" . U  A 55  ? 1.63150 1.70760 1.67580 0.03610  0.18800  -0.12330 157 U  A "C4'" 
1173 O  "O4'" . U  A 55  ? 1.62520 1.69590 1.66210 0.03550  0.18550  -0.13030 157 U  A "O4'" 
1174 C  "C3'" . U  A 55  ? 1.63710 1.70580 1.70130 0.04000  0.18360  -0.11870 157 U  A "C3'" 
1175 O  "O3'" . U  A 55  ? 1.61880 1.69340 1.69730 0.04230  0.18640  -0.11580 157 U  A "O3'" 
1176 C  "C2'" . U  A 55  ? 1.67530 1.73840 1.74990 0.04280  0.18410  -0.12930 157 U  A "C2'" 
1177 O  "O2'" . U  A 55  ? 1.71710 1.78710 1.80380 0.04570  0.19130  -0.13990 157 U  A "O2'" 
1178 C  "C1'" . U  A 55  ? 1.65340 1.71620 1.70830 0.03910  0.18330  -0.13430 157 U  A "C1'" 
1179 N  N1    . U  A 55  ? 1.64660 1.69940 1.69710 0.03780  0.17560  -0.12840 157 U  A N1    
1180 C  C2    . U  A 55  ? 1.69870 1.74340 1.76170 0.03980  0.17360  -0.13410 157 U  A C2    
1181 O  O2    . U  A 55  ? 1.74270 1.78750 1.81960 0.04280  0.17760  -0.14390 157 U  A O2    
1182 N  N3    . U  A 55  ? 1.68040 1.71660 1.73950 0.03820  0.16710  -0.12820 157 U  A N3    
1183 C  C4    . U  A 55  ? 1.66290 1.69850 1.70750 0.03530  0.16240  -0.11790 157 U  A C4    
1184 O  O4    . U  A 55  ? 1.69170 1.72000 1.73520 0.03430  0.15720  -0.11400 157 U  A O4    
1185 C  C5    . U  A 55  ? 1.63750 1.68100 1.67020 0.03360  0.16450  -0.11270 157 U  A C5    
1186 C  C6    . U  A 55  ? 1.61740 1.66890 1.65340 0.03470  0.17100  -0.11780 157 U  A C6    
1187 P  P     . G  A 56  ? 1.62969 1.69919 1.72109 0.04470  0.18010  -0.10460 158 G  A P     
1188 O  OP1   . G  A 56  ? 1.64889 1.72789 1.75169 0.04610  0.18390  -0.10310 158 G  A OP1   
1189 O  OP2   . G  A 56  ? 1.69669 1.76009 1.77329 0.04140  0.17350  -0.09490 158 G  A OP2   
1190 O  "O5'" . G  A 56  ? 1.56699 1.62779 1.67599 0.04950  0.17790  -0.10860 158 G  A "O5'" 
1191 C  "C5'" . G  A 56  ? 1.61329 1.67729 1.73999 0.05380  0.18310  -0.11810 158 G  A "C5'" 
1192 C  "C4'" . G  A 56  ? 1.62939 1.68269 1.76849 0.05710  0.18090  -0.12260 158 G  A "C4'" 
1193 O  "O4'" . G  A 56  ? 1.53739 1.58569 1.66249 0.05380  0.18000  -0.12790 158 G  A "O4'" 
1194 C  "C3'" . G  A 56  ? 1.61699 1.66059 1.76559 0.05950  0.17360  -0.11160 158 G  A "C3'" 
1195 O  "O3'" . G  A 56  ? 1.56969 1.61549 1.73769 0.06460  0.17350  -0.10820 158 G  A "O3'" 
1196 C  "C2'" . G  A 56  ? 1.66449 1.69719 1.81679 0.06000  0.17220  -0.11710 158 G  A "C2'" 
1197 O  "O2'" . G  A 56  ? 1.66999 1.70099 1.84249 0.06470  0.17590  -0.12620 158 G  A "O2'" 
1198 C  "C1'" . G  A 56  ? 1.66979 1.70599 1.80279 0.05510  0.17480  -0.12530 158 G  A "C1'" 
1199 N  N9    . G  A 56  ? 1.73469 1.76629 1.85039 0.05090  0.16930  -0.11760 158 G  A N9    
1200 C  C8    . G  A 56  ? 1.68089 1.71769 1.77769 0.04690  0.16800  -0.11140 158 G  A C8    
1201 N  N7    . G  A 56  ? 1.65079 1.68159 1.73689 0.04410  0.16270  -0.10580 158 G  A N7    
1202 C  C5    . G  A 56  ? 1.68159 1.70299 1.78009 0.04610  0.16060  -0.10810 158 G  A C5    
1203 C  C6    . G  A 56  ? 1.71939 1.73199 1.81539 0.04440  0.15570  -0.10440 158 G  A C6    
1204 O  O6    . G  A 56  ? 1.72139 1.73309 1.80319 0.04110  0.15180  -0.09850 158 G  A O6    
1205 N  N1    . G  A 56  ? 1.70419 1.70859 1.81759 0.04690  0.15570  -0.10830 158 G  A N1    
1206 C  C2    . G  A 56  ? 1.66879 1.67289 1.79999 0.05110  0.15970  -0.11510 158 G  A C2    
1207 N  N2    . G  A 56  ? 1.67459 1.66889 1.82189 0.05300  0.15900  -0.11780 158 G  A N2    
1208 N  N3    . G  A 56  ? 1.68779 1.70049 1.82169 0.05310  0.16420  -0.11910 158 G  A N3    
1209 C  C4    . G  A 56  ? 1.69949 1.72079 1.81649 0.05020  0.16460  -0.11520 158 G  A C4    
1210 P  P     . A  A 57  ? 1.74439 1.78569 1.91789 0.06660  0.16590  -0.09370 159 A  A P     
1211 O  OP1   . A  A 57  ? 1.72669 1.77469 1.91879 0.07160  0.16690  -0.09230 159 A  A OP1   
1212 O  OP2   . A  A 57  ? 1.76669 1.80879 1.91999 0.06160  0.16210  -0.08530 159 A  A OP2   
1213 O  "O5'" . A  A 57  ? 1.68329 1.71079 1.86549 0.06900  0.16220  -0.09220 159 A  A "O5'" 
1214 C  "C5'" . A  A 57  ? 1.69749 1.72039 1.89989 0.07390  0.16480  -0.09940 159 A  A "C5'" 
1215 C  "C4'" . A  A 57  ? 1.67549 1.68459 1.88209 0.07420  0.16150  -0.09750 159 A  A "C4'" 
1216 O  "O4'" . A  A 57  ? 1.70799 1.71459 1.89869 0.06880  0.16260  -0.10400 159 A  A "O4'" 
1217 C  "C3'" . A  A 57  ? 1.62889 1.63149 1.83269 0.07420  0.15440  -0.08240 159 A  A "C3'" 
1218 O  "O3'" . A  A 57  ? 1.60989 1.61039 1.83159 0.08020  0.15170  -0.07500 159 A  A "O3'" 
1219 C  "C2'" . A  A 57  ? 1.65479 1.64629 1.85419 0.07120  0.15300  -0.08370 159 A  A "C2'" 
1220 O  "O2'" . A  A 57  ? 1.64539 1.62749 1.86469 0.07510  0.15420  -0.08770 159 A  A "O2'" 
1221 C  "C1'" . A  A 57  ? 1.73359 1.73049 1.91909 0.06670  0.15740  -0.09590 159 A  A "C1'" 
1222 N  N9    . A  A 57  ? 1.71589 1.71729 1.87879 0.06150  0.15490  -0.09060 159 A  A N9    
1223 C  C8    . A  A 57  ? 1.72639 1.73819 1.87679 0.05950  0.15610  -0.08950 159 A  A C8    
1224 N  N7    . A  A 57  ? 1.70009 1.71269 1.83209 0.05510  0.15320  -0.08430 159 A  A N7    
1225 C  C5    . A  A 57  ? 1.68249 1.68519 1.81469 0.05400  0.14990  -0.08190 159 A  A C5    
1226 C  C6    . A  A 57  ? 1.63789 1.63689 1.75589 0.05010  0.14600  -0.07690 159 A  A C6    
1227 N  N6    . A  A 57  ? 1.59229 1.59669 1.69249 0.04660  0.14440  -0.07300 159 A  A N6    
1228 N  N1    . A  A 57  ? 1.62869 1.61829 1.75259 0.04980  0.14390  -0.07580 159 A  A N1    
1229 C  C2    . A  A 57  ? 1.64039 1.62349 1.78299 0.05320  0.14550  -0.07940 159 A  A C2    
1230 N  N3    . A  A 57  ? 1.68039 1.66549 1.83779 0.05740  0.14890  -0.08430 159 A  A N3    
1231 C  C4    . A  A 57  ? 1.67929 1.67479 1.83029 0.05770  0.15100  -0.08550 159 A  A C4    
1232 P  P     . G  A 58  ? 1.66436 1.66796 1.88136 0.08110  0.14540  -0.05990 160 G  A P     
1233 O  OP1   . G  A 58  ? 1.60186 1.60696 1.83946 0.08810  0.14390  -0.05590 160 G  A OP1   
1234 O  OP2   . G  A 58  ? 1.72606 1.73976 1.92446 0.07630  0.14570  -0.05980 160 G  A OP2   
1235 O  "O5'" . G  A 58  ? 1.66746 1.65966 1.87776 0.07920  0.14060  -0.05070 160 G  A "O5'" 
1236 C  "C5'" . G  A 58  ? 1.67226 1.65256 1.89746 0.08230  0.14000  -0.04890 160 G  A "C5'" 
1237 C  "C4'" . G  A 58  ? 1.65996 1.63096 1.87496 0.07810  0.13780  -0.04420 160 G  A "C4'" 
1238 O  "O4'" . G  A 58  ? 1.67806 1.65086 1.87946 0.07240  0.14090  -0.05440 160 G  A "O4'" 
1239 C  "C3'" . G  A 58  ? 1.60826 1.58066 1.80886 0.07620  0.13240  -0.03100 160 G  A "C3'" 
1240 O  "O3'" . G  A 58  ? 1.56736 1.53546 1.77766 0.08080  0.12830  -0.01880 160 G  A "O3'" 
1241 C  "C2'" . G  A 58  ? 1.59176 1.55836 1.77956 0.07040  0.13260  -0.03260 160 G  A "C2'" 
1242 O  "O2'" . G  A 58  ? 1.64536 1.60006 1.84476 0.07120  0.13250  -0.02970 160 G  A "O2'" 
1243 C  "C1'" . G  A 58  ? 1.58736 1.55776 1.77246 0.06770  0.13760  -0.04770 160 G  A "C1'" 
1244 N  N9    . G  A 58  ? 1.60646 1.58686 1.77256 0.06380  0.13770  -0.04950 160 G  A N9    
1245 C  C8    . G  A 58  ? 1.66696 1.65776 1.83056 0.06450  0.13980  -0.05340 160 G  A C8    
1246 N  N7    . G  A 58  ? 1.64526 1.64216 1.79066 0.06020  0.13940  -0.05330 160 G  A N7    
1247 C  C5    . G  A 58  ? 1.59346 1.58396 1.72896 0.05680  0.13660  -0.04950 160 G  A C5    
1248 C  C6    . G  A 58  ? 1.52506 1.51776 1.64146 0.05200  0.13470  -0.04760 160 G  A C6    
1249 O  O6    . G  A 58  ? 1.49036 1.49046 1.59406 0.04960  0.13520  -0.04860 160 G  A O6    
1250 N  N1    . G  A 58  ? 1.51266 1.49786 1.62626 0.05010  0.13230  -0.04410 160 G  A N1    
1251 C  C2    . G  A 58  ? 1.57596 1.55206 1.70316 0.05200  0.13200  -0.04210 160 G  A C2    
1252 N  N2    . G  A 58  ? 1.57866 1.54906 1.70136 0.04910  0.13010  -0.03870 160 G  A N2    
1253 N  N3    . G  A 58  ? 1.64566 1.61866 1.79056 0.05640  0.13370  -0.04330 160 G  A N3    
1254 C  C4    . G  A 58  ? 1.62246 1.60316 1.77056 0.05880  0.13570  -0.04710 160 G  A C4    
1255 P  P     . A  A 59  ? 1.72285 1.69785 1.92255 0.08150  0.12250  -0.00620 161 A  A P     
1256 O  OP1   . A  A 59  ? 1.72675 1.69685 1.93945 0.08730  0.11880  0.00500  161 A  A OP1   
1257 O  OP2   . A  A 59  ? 1.61855 1.60625 1.81255 0.08080  0.12330  -0.01140 161 A  A OP2   
1258 O  "O5'" . A  A 59  ? 1.69435 1.66655 1.87485 0.07560  0.12080  -0.00180 161 A  A "O5'" 
1259 C  "C5'" . A  A 59  ? 1.57785 1.53935 1.76025 0.07470  0.12030  0.00390  161 A  A "C5'" 
1260 C  "C4'" . A  A 59  ? 1.54345 1.50425 1.70825 0.06840  0.12020  0.00360  161 A  A "C4'" 
1261 O  "O4'" . A  A 59  ? 1.58645 1.55085 1.74465 0.06460  0.12370  -0.00920 161 A  A "O4'" 
1262 C  "C3'" . A  A 59  ? 1.45835 1.42625 1.60595 0.06670  0.11620  0.01140  161 A  A "C3'" 
1263 O  "O3'" . A  A 59  ? 1.50125 1.46585 1.64875 0.06870  0.11260  0.02430  161 A  A "O3'" 
1264 C  "C2'" . A  A 59  ? 1.52545 1.49385 1.65845 0.06060  0.11770  0.00530  161 A  A "C2'" 
1265 O  "O2'" . A  A 59  ? 1.53935 1.49955 1.67245 0.05830  0.11800  0.00890  161 A  A "O2'" 
1266 C  "C1'" . A  A 59  ? 1.54615 1.51485 1.68535 0.05990  0.12220  -0.00810 161 A  A "C1'" 
1267 N  N9    . A  A 59  ? 1.50545 1.48425 1.63575 0.05880  0.12290  -0.01370 161 A  A N9    
1268 C  C8    . A  A 59  ? 1.52455 1.50965 1.66225 0.06170  0.12450  -0.01770 161 A  A C8    
1269 N  N7    . A  A 59  ? 1.51155 1.50505 1.63805 0.05920  0.12530  -0.02160 161 A  A N7    
1270 C  C5    . A  A 59  ? 1.45265 1.44475 1.56325 0.05460  0.12380  -0.02010 161 A  A C5    
1271 C  C6    . A  A 59  ? 1.40885 1.40635 1.50295 0.05050  0.12360  -0.02200 161 A  A C6    
1272 N  N6    . A  A 59  ? 1.41245 1.41795 1.50275 0.04980  0.12530  -0.02570 161 A  A N6    
1273 N  N1    . A  A 59  ? 1.42545 1.41975 1.50775 0.04710  0.12170  -0.01970 161 A  A N1    
1274 C  C2    . A  A 59  ? 1.42475 1.41155 1.51155 0.04740  0.12060  -0.01590 161 A  A C2    
1275 N  N3    . A  A 59  ? 1.44985 1.43065 1.55145 0.05060  0.12090  -0.01330 161 A  A N3    
1276 C  C4    . A  A 59  ? 1.47595 1.45955 1.58885 0.05440  0.12240  -0.01560 161 A  A C4    
1277 P  P     . U  A 60  ? 1.68662 1.66002 1.82352 0.07030  0.10740  0.03350  162 U  A P     
1278 O  OP1   . U  A 60  ? 1.52122 1.48982 1.65892 0.07250  0.10460  0.04640  162 U  A OP1   
1279 O  OP2   . U  A 60  ? 1.59682 1.57832 1.74022 0.07370  0.10650  0.03000  162 U  A OP2   
1280 O  "O5'" . U  A 60  ? 1.55552 1.53362 1.67282 0.06460  0.10720  0.03040  162 U  A "O5'" 
1281 C  "C5'" . U  A 60  ? 1.40082 1.37382 1.50972 0.06080  0.10770  0.03290  162 U  A "C5'" 
1282 C  "C4'" . U  A 60  ? 1.38242 1.36002 1.47572 0.05590  0.10810  0.02700  162 U  A "C4'" 
1283 O  "O4'" . U  A 60  ? 1.48102 1.45982 1.57672 0.05420  0.11150  0.01540  162 U  A "O4'" 
1284 C  "C3'" . U  A 60  ? 1.35352 1.34012 1.43462 0.05570  0.10460  0.02950  162 U  A "C3'" 
1285 O  "O3'" . U  A 60  ? 1.41222 1.39972 1.48482 0.05570  0.10140  0.03870  162 U  A "O3'" 
1286 C  "C2'" . U  A 60  ? 1.40482 1.39432 1.47612 0.05130  0.10650  0.02050  162 U  A "C2'" 
1287 O  "O2'" . U  A 60  ? 1.34882 1.33542 1.41062 0.04770  0.10670  0.02080  162 U  A "O2'" 
1288 C  "C1'" . U  A 60  ? 1.43162 1.41772 1.51402 0.05160  0.11070  0.01170  162 U  A "C1'" 
1289 N  N1    . U  A 60  ? 1.43862 1.43092 1.52642 0.05360  0.11160  0.00720  162 U  A N1    
1290 C  C2    . U  A 60  ? 1.45492 1.45352 1.53252 0.05080  0.11220  0.00210  162 U  A C2    
1291 O  O2    . U  A 60  ? 1.42262 1.42172 1.48722 0.04710  0.11170  0.00130  162 U  A O2    
1292 N  N3    . U  A 60  ? 1.46932 1.47402 1.55332 0.05250  0.11370  -0.00170 162 U  A N3    
1293 C  C4    . U  A 60  ? 1.51432 1.51982 1.61402 0.05700  0.11430  -0.00150 162 U  A C4    
1294 O  O4    . U  A 60  ? 1.53842 1.55072 1.64322 0.05800  0.11600  -0.00560 162 U  A O4    
1295 C  C5    . U  A 60  ? 1.50932 1.50742 1.61892 0.06020  0.11310  0.00400  162 U  A C5    
1296 C  C6    . U  A 60  ? 1.43272 1.42442 1.53592 0.05820  0.11200  0.00830  162 U  A C6    
1297 P  P     . G  A 61  ? 1.44604 1.44094 1.51574 0.05920  0.09640  0.04610  163 G  A P     
1298 O  OP1   . G  A 61  ? 1.37624 1.37084 1.43664 0.05890  0.09410  0.05490  163 G  A OP1   
1299 O  OP2   . G  A 61  ? 1.47874 1.47384 1.56334 0.06410  0.09580  0.04750  163 G  A OP2   
1300 O  "O5'" . G  A 61  ? 1.32454 1.32744 1.38464 0.05670  0.09540  0.03970  163 G  A "O5'" 
1301 C  "C5'" . G  A 61  ? 1.32804 1.33124 1.37504 0.05220  0.09610  0.03610  163 G  A "C5'" 
1302 C  "C4'" . G  A 61  ? 1.31124 1.31924 1.35474 0.05000  0.09700  0.02830  163 G  A "C4'" 
1303 O  "O4'" . G  A 61  ? 1.38684 1.39314 1.44124 0.05070  0.10070  0.02210  163 G  A "O4'" 
1304 C  "C3'" . G  A 61  ? 1.31634 1.33244 1.35834 0.05110  0.09350  0.02960  163 G  A "C3'" 
1305 O  "O3'" . G  A 61  ? 1.26624 1.28524 1.29534 0.04910  0.09060  0.03160  163 G  A "O3'" 
1306 C  "C2'" . G  A 61  ? 1.35174 1.37084 1.39794 0.04980  0.09660  0.02170  163 G  A "C2'" 
1307 O  "O2'" . G  A 61  ? 1.33154 1.35094 1.36634 0.04540  0.09780  0.01730  163 G  A "O2'" 
1308 C  "C1'" . G  A 61  ? 1.36564 1.37874 1.42164 0.05070  0.10080  0.01810  163 G  A "C1'" 
1309 N  N9    . G  A 61  ? 1.41884 1.43354 1.49024 0.05500  0.10130  0.01840  163 G  A N9    
1310 C  C8    . G  A 61  ? 1.44424 1.45534 1.52564 0.05920  0.09980  0.02440  163 G  A C8    
1311 N  N7    . G  A 61  ? 1.48194 1.49544 1.57734 0.06290  0.10060  0.02290  163 G  A N7    
1312 C  C5    . G  A 61  ? 1.44624 1.46564 1.54064 0.06060  0.10320  0.01510  163 G  A C5    
1313 C  C6    . G  A 61  ? 1.46394 1.48884 1.57044 0.06270  0.10560  0.00980  163 G  A C6    
1314 O  O6    . G  A 61  ? 1.50514 1.53084 1.62674 0.06740  0.10540  0.01080  163 G  A O6    
1315 N  N1    . G  A 61  ? 1.45614 1.48634 1.55604 0.05870  0.10850  0.00320  163 G  A N1    
1316 C  C2    . G  A 61  ? 1.40304 1.43244 1.48704 0.05380  0.10870  0.00210  163 G  A C2    
1317 N  N2    . G  A 61  ? 1.31214 1.34664 1.39194 0.05060  0.11190  -0.00360 163 G  A N2    
1318 N  N3    . G  A 61  ? 1.38454 1.40874 1.45794 0.05230  0.10610  0.00650  163 G  A N3    
1319 C  C4    . G  A 61  ? 1.41134 1.43104 1.49064 0.05570  0.10370  0.01270  163 G  A C4    
1320 P  P     . G  A 62  ? 1.25269 1.27749 1.27869 0.05160  0.08510  0.03850  164 G  A P     
1321 O  OP1   . G  A 62  ? 1.24179 1.26709 1.25409 0.04910  0.08350  0.03930  164 G  A OP1   
1322 O  OP2   . G  A 62  ? 1.26299 1.28609 1.29779 0.05600  0.08400  0.04520  164 G  A OP2   
1323 O  "O5'" . G  A 62  ? 1.25689 1.28949 1.28689 0.05180  0.08330  0.03500  164 G  A "O5'" 
1324 C  "C5'" . G  A 62  ? 1.17389 1.20809 1.19989 0.04790  0.08520  0.02840  164 G  A "C5'" 
1325 C  "C4'" . G  A 62  ? 1.17029 1.21169 1.20469 0.04850  0.08440  0.02570  164 G  A "C4'" 
1326 O  "O4'" . G  A 62  ? 1.26589 1.30659 1.31349 0.05110  0.08750  0.02420  164 G  A "O4'" 
1327 C  "C3'" . G  A 62  ? 1.13339 1.18219 1.16949 0.05100  0.07850  0.02990  164 G  A "C3'" 
1328 O  "O3'" . G  A 62  ? 1.12049 1.17619 1.15889 0.04890  0.07750  0.02580  164 G  A "O3'" 
1329 C  "C2'" . G  A 62  ? 1.21349 1.26319 1.26269 0.05610  0.07790  0.03350  164 G  A "C2'" 
1330 O  "O2'" . G  A 62  ? 1.30249 1.36099 1.35899 0.05890  0.07310  0.03540  164 G  A "O2'" 
1331 C  "C1'" . G  A 62  ? 1.24279 1.28929 1.30059 0.05530  0.08390  0.02780  164 G  A "C1'" 
1332 N  N9    . G  A 62  ? 1.30139 1.34329 1.36979 0.05930  0.08550  0.03030  164 G  A N9    
1333 C  C8    . G  A 62  ? 1.35279 1.38859 1.41929 0.06150  0.08430  0.03670  164 G  A C8    
1334 N  N7    . G  A 62  ? 1.41069 1.44219 1.48929 0.06490  0.08620  0.03780  164 G  A N7    
1335 C  C5    . G  A 62  ? 1.46789 1.50349 1.55699 0.06520  0.08890  0.03120  164 G  A C5    
1336 C  C6    . G  A 62  ? 1.50079 1.53469 1.60579 0.06860  0.09200  0.02850  164 G  A C6    
1337 O  O6    . G  A 62  ? 1.55779 1.58529 1.67159 0.07200  0.09260  0.03160  164 G  A O6    
1338 N  N1    . G  A 62  ? 1.45159 1.49219 1.56289 0.06760  0.09470  0.02120  164 G  A N1    
1339 C  C2    . G  A 62  ? 1.42109 1.46849 1.52459 0.06360  0.09460  0.01780  164 G  A C2    
1340 N  N2    . G  A 62  ? 1.40369 1.45729 1.51549 0.06300  0.09820  0.01130  164 G  A N2    
1341 N  N3    . G  A 62  ? 1.37989 1.42799 1.46929 0.06050  0.09150  0.02040  164 G  A N3    
1342 C  C4    . G  A 62  ? 1.39309 1.43539 1.47579 0.06160  0.08870  0.02680  164 G  A C4    
1343 P  P     . C  A 63  ? 1.19795 1.25775 1.22665 0.04660  0.07290  0.02570  165 C  A P     
1344 O  OP1   . C  A 63  ? 1.32075 1.38705 1.35575 0.04420  0.07280  0.02120  165 C  A OP1   
1345 O  OP2   . C  A 63  ? 1.23885 1.29195 1.25425 0.04390  0.07420  0.02540  165 C  A OP2   
1346 O  "O5'" . C  A 63  ? 1.16345 1.22815 1.19255 0.05090  0.06660  0.03160  165 C  A "O5'" 
1347 C  "C5'" . C  A 63  ? 1.15695 1.22995 1.19775 0.05410  0.06310  0.03270  165 C  A "C5'" 
1348 C  "C4'" . C  A 63  ? 1.24315 1.31895 1.28245 0.05890  0.05770  0.03980  165 C  A "C4'" 
1349 O  "O4'" . C  A 63  ? 1.24495 1.31305 1.28565 0.06160  0.06060  0.04480  165 C  A "O4'" 
1350 C  "C3'" . C  A 63  ? 1.18615 1.26325 1.21095 0.05810  0.05370  0.04190  165 C  A "C3'" 
1351 O  "O3'" . C  A 63  ? 1.20785 1.29415 1.23235 0.05720  0.04840  0.03870  165 C  A "O3'" 
1352 C  "C2'" . C  A 63  ? 1.25125 1.32715 1.27395 0.06290  0.05150  0.05050  165 C  A "C2'" 
1353 O  "O2'" . C  A 63  ? 1.27685 1.36165 1.30635 0.06730  0.04550  0.05400  165 C  A "O2'" 
1354 C  "C1'" . C  A 63  ? 1.24895 1.31645 1.28035 0.06390  0.05730  0.05170  165 C  A "C1'" 
1355 N  N1    . C  A 63  ? 1.24425 1.30235 1.26695 0.06160  0.06190  0.05260  165 C  A N1    
1356 C  C2    . C  A 63  ? 1.34265 1.39825 1.35795 0.06360  0.06070  0.06000  165 C  A C2    
1357 O  O2    . C  A 63  ? 1.38625 1.44745 1.40125 0.06740  0.05580  0.06610  165 C  A O2    
1358 N  N3    . C  A 63  ? 1.35385 1.40155 1.36255 0.06130  0.06500  0.06060  165 C  A N3    
1359 C  C4    . C  A 63  ? 1.36095 1.40355 1.36985 0.05750  0.06960  0.05410  165 C  A C4    
1360 N  N4    . C  A 63  ? 1.35605 1.39195 1.35915 0.05540  0.07320  0.05470  165 C  A N4    
1361 C  C5    . C  A 63  ? 1.33555 1.38035 1.35045 0.05560  0.07080  0.04690  165 C  A C5    
1362 C  C6    . C  A 63  ? 1.29435 1.34665 1.31615 0.05750  0.06710  0.04650  165 C  A C6    
1363 P  P     . C  A 64  ? 1.17760 1.26350 1.19160 0.05220  0.04810  0.03290  166 C  A P     
1364 O  OP1   . C  A 64  ? 1.21640 1.31150 1.23730 0.05080  0.04400  0.02820  166 C  A OP1   
1365 O  OP2   . C  A 64  ? 1.27250 1.34880 1.28310 0.04860  0.05480  0.03020  166 C  A OP2   
1366 O  "O5'" . C  A 64  ? 1.26600 1.35260 1.26600 0.05390  0.04450  0.03690  166 C  A "O5'" 
1367 C  "C5'" . C  A 64  ? 1.18850 1.28430 1.18710 0.05750  0.03760  0.04000  166 C  A "C5'" 
1368 C  "C4'" . C  A 64  ? 1.19510 1.28950 1.18130 0.06010  0.03650  0.04640  166 C  A "C4'" 
1369 O  "O4'" . C  A 64  ? 1.22240 1.30870 1.21110 0.06190  0.04140  0.05250  166 C  A "O4'" 
1370 C  "C3'" . C  A 64  ? 1.16650 1.25780 1.13870 0.05710  0.03800  0.04340  166 C  A "C3'" 
1371 O  "O3'" . C  A 64  ? 1.24340 1.34280 1.20970 0.05650  0.03250  0.03900  166 C  A "O3'" 
1372 C  "C2'" . C  A 64  ? 1.27550 1.36280 1.23980 0.05970  0.04010  0.05140  166 C  A "C2'" 
1373 O  "O2'" . C  A 64  ? 1.30520 1.40080 1.26310 0.06350  0.03450  0.05660  166 C  A "O2'" 
1374 C  "C1'" . C  A 64  ? 1.25900 1.34070 1.23520 0.06150  0.04350  0.05600  166 C  A "C1'" 
1375 N  N1    . C  A 64  ? 1.25310 1.32440 1.23010 0.05850  0.05050  0.05420  166 C  A N1    
1376 C  C2    . C  A 64  ? 1.31970 1.38530 1.28970 0.05870  0.05380  0.05900  166 C  A C2    
1377 O  O2    . C  A 64  ? 1.35070 1.41990 1.31340 0.06130  0.05140  0.06520  166 C  A O2    
1378 N  N3    . C  A 64  ? 1.33370 1.39060 1.30490 0.05590  0.05960  0.05690  166 C  A N3    
1379 C  C4    . C  A 64  ? 1.30720 1.36110 1.28490 0.05330  0.06210  0.05060  166 C  A C4    
1380 N  N4    . C  A 64  ? 1.29010 1.33620 1.26800 0.05090  0.06720  0.04850  166 C  A N4    
1381 C  C5    . C  A 64  ? 1.30840 1.36780 1.29280 0.05300  0.05940  0.04610  166 C  A C5    
1382 C  C6    . C  A 64  ? 1.24910 1.31700 1.23360 0.05550  0.05370  0.04790  166 C  A C6    
1383 P  P     . U  A 65  ? 1.34578 1.44568 1.31448 0.05160  0.03210  0.02910  167 U  A P     
1384 O  OP1   . U  A 65  ? 1.30678 1.40958 1.26328 0.05080  0.02930  0.02530  167 U  A OP1   
1385 O  OP2   . U  A 65  ? 1.29328 1.39978 1.27548 0.05160  0.02900  0.02660  167 U  A OP2   
1386 O  "O5'" . U  A 65  ? 1.20018 1.28858 1.17018 0.04810  0.03970  0.02740  167 U  A "O5'" 
1387 C  "C5'" . U  A 65  ? 1.22738 1.31228 1.19678 0.04360  0.04130  0.02040  167 U  A "C5'" 
1388 C  "C4'" . U  A 65  ? 1.11838 1.19388 1.09088 0.04110  0.04790  0.02000  167 U  A "C4'" 
1389 O  "O4'" . U  A 65  ? 1.16498 1.23398 1.12878 0.04170  0.05130  0.02320  167 U  A "O4'" 
1390 C  "C3'" . U  A 65  ? 1.09068 1.16578 1.07478 0.04210  0.05060  0.02250  167 U  A "C3'" 
1391 O  "O3'" . U  A 65  ? 1.12128 1.19098 1.10938 0.03840  0.05540  0.01890  167 U  A "O3'" 
1392 C  "C2'" . U  A 65  ? 1.15848 1.22888 1.13908 0.04500  0.05320  0.02870  167 U  A "C2'" 
1393 O  "O2'" . U  A 65  ? 1.26948 1.33538 1.25848 0.04530  0.05770  0.03000  167 U  A "O2'" 
1394 C  "C1'" . U  A 65  ? 1.16448 1.22888 1.13348 0.04300  0.05540  0.02730  167 U  A "C1'" 
1395 N  N1    . U  A 65  ? 1.13838 1.20068 1.10058 0.04540  0.05640  0.03290  167 U  A N1    
1396 C  C2    . U  A 65  ? 1.19068 1.24508 1.15268 0.04450  0.06150  0.03420  167 U  A C2    
1397 O  O2    . U  A 65  ? 1.31528 1.36488 1.28118 0.04210  0.06500  0.03090  167 U  A O2    
1398 N  N3    . U  A 65  ? 1.19558 1.24838 1.15228 0.04640  0.06260  0.03960  167 U  A N3    
1399 C  C4    . U  A 65  ? 1.30558 1.36378 1.25628 0.04920  0.05940  0.04420  167 U  A C4    
1400 O  O4    . U  A 65  ? 1.42648 1.48248 1.37308 0.05030  0.06150  0.04950  167 U  A O4    
1401 C  C5    . U  A 65  ? 1.27138 1.33798 1.22138 0.05030  0.05380  0.04240  167 U  A C5    
1402 C  C6    . U  A 65  ? 1.26728 1.33548 1.22358 0.04830  0.05230  0.03660  167 U  A C6    
1403 P  P     . U  A 66  ? 1.22073 1.29463 1.21853 0.03520  0.05490  0.01390  168 U  A P     
1404 O  OP1   . U  A 66  ? 1.27743 1.36083 1.28523 0.03790  0.05080  0.01500  168 U  A OP1   
1405 O  OP2   . U  A 66  ? 1.13793 1.20553 1.13833 0.03220  0.06120  0.01240  168 U  A OP2   
1406 O  "O5'" . U  A 66  ? 1.14633 1.22073 1.13773 0.03230  0.05180  0.00940  168 U  A "O5'" 
1407 C  "C5'" . U  A 66  ? 1.28653 1.35283 1.26853 0.03010  0.05440  0.00800  168 U  A "C5'" 
1408 C  "C4'" . U  A 66  ? 1.22773 1.29263 1.21113 0.02580  0.05390  0.00280  168 U  A "C4'" 
1409 O  "O4'" . U  A 66  ? 1.22813 1.29413 1.22233 0.02300  0.05670  0.00170  168 U  A "O4'" 
1410 C  "C3'" . U  A 66  ? 1.29703 1.36843 1.28063 0.02560  0.04770  -0.00120 168 U  A "C3'" 
1411 O  "O3'" . U  A 66  ? 1.40653 1.47263 1.38673 0.02220  0.04790  -0.00550 168 U  A "O3'" 
1412 C  "C2'" . U  A 66  ? 1.26043 1.33933 1.25753 0.02430  0.04630  -0.00270 168 U  A "C2'" 
1413 O  "O2'" . U  A 66  ? 1.39433 1.47823 1.39553 0.02190  0.04160  -0.00820 168 U  A "O2'" 
1414 C  "C1'" . U  A 66  ? 1.25313 1.32593 1.25513 0.02110  0.05280  -0.00210 168 U  A "C1'" 
1415 N  N1    . U  A 66  ? 1.30023 1.37913 1.31513 0.02090  0.05420  -0.00160 168 U  A N1    
1416 C  C2    . U  A 66  ? 1.34373 1.42533 1.36833 0.01650  0.05500  -0.00510 168 U  A C2    
1417 O  O2    . U  A 66  ? 1.37213 1.45043 1.39523 0.01280  0.05430  -0.00840 168 U  A O2    
1418 N  N3    . U  A 66  ? 1.36703 1.45523 1.40423 0.01660  0.05670  -0.00480 168 U  A N3    
1419 C  C4    . U  A 66  ? 1.32603 1.41773 1.36713 0.02090  0.05760  -0.00150 168 U  A C4    
1420 O  O4    . U  A 66  ? 1.37703 1.47513 1.43083 0.02080  0.05930  -0.00210 168 U  A O4    
1421 C  C5    . U  A 66  ? 1.25483 1.34233 1.28533 0.02520  0.05660  0.00230  168 U  A C5    
1422 C  C6    . U  A 66  ? 1.30643 1.38803 1.32433 0.02490  0.05520  0.00230  168 U  A C6    
1423 P  P     . G  A 67  ? 1.51431 1.57431 1.48191 0.02340  0.04830  -0.00580 169 G  A P     
1424 O  OP1   . G  A 67  ? 1.34291 1.40701 1.30381 0.02780  0.04670  -0.00210 169 G  A OP1   
1425 O  OP2   . G  A 67  ? 1.53561 1.59401 1.50251 0.02090  0.04570  -0.01180 169 G  A OP2   
1426 O  "O5'" . G  A 67  ? 1.26721 1.31781 1.23251 0.02210  0.05440  -0.00290 169 G  A "O5'" 
1427 C  "C5'" . G  A 67  ? 1.27541 1.32181 1.24671 0.01840  0.05770  -0.00360 169 G  A "C5'" 
1428 C  "C4'" . G  A 67  ? 1.27011 1.30791 1.23551 0.01780  0.06230  -0.00150 169 G  A "C4'" 
1429 O  "O4'" . G  A 67  ? 1.38071 1.41381 1.33831 0.01830  0.06080  -0.00340 169 G  A "O4'" 
1430 C  "C3'" . G  A 67  ? 1.30361 1.34071 1.26571 0.02060  0.06500  0.00250  169 G  A "C3'" 
1431 O  "O3'" . G  A 67  ? 1.22081 1.25941 1.18971 0.02000  0.06830  0.00420  169 G  A "O3'" 
1432 C  "C2'" . G  A 67  ? 1.36691 1.39641 1.32101 0.02040  0.06710  0.00280  169 G  A "C2'" 
1433 O  "O2'" . G  A 67  ? 1.30831 1.33281 1.26361 0.01760  0.07070  0.00320  169 G  A "O2'" 
1434 C  "C1'" . G  A 67  ? 1.46681 1.49531 1.41771 0.01990  0.06360  -0.00070 169 G  A "C1'" 
1435 N  N9    . G  A 67  ? 1.42821 1.45931 1.37271 0.02310  0.06130  -0.00090 169 G  A N9    
1436 C  C8    . G  A 67  ? 1.41301 1.45011 1.35651 0.02450  0.05710  -0.00330 169 G  A C8    
1437 N  N7    . G  A 67  ? 1.43541 1.47411 1.37191 0.02720  0.05660  -0.00250 169 G  A N7    
1438 C  C5    . G  A 67  ? 1.46431 1.49771 1.39821 0.02750  0.06060  0.00050  169 G  A C5    
1439 C  C6    . G  A 67  ? 1.43151 1.46441 1.35951 0.02970  0.06220  0.00250  169 G  A C6    
1440 O  O6    . G  A 67  ? 1.48261 1.51961 1.40551 0.03180  0.06090  0.00250  169 G  A O6    
1441 N  N1    . G  A 67  ? 1.34791 1.37521 1.27621 0.02900  0.06580  0.00450  169 G  A N1    
1442 C  C2    . G  A 67  ? 1.47001 1.49321 1.40221 0.02670  0.06760  0.00470  169 G  A C2    
1443 N  N2    . G  A 67  ? 1.47281 1.49181 1.40391 0.02650  0.07070  0.00620  169 G  A N2    
1444 N  N3    . G  A 67  ? 1.48131 1.50501 1.41841 0.02470  0.06680  0.00340  169 G  A N3    
1445 C  C4    . G  A 67  ? 1.42781 1.45661 1.36621 0.02510  0.06320  0.00130  169 G  A C4    
1446 P  P     . C  A 68  ? 1.34856 1.39056 1.32006 0.02360  0.06920  0.00750  170 C  A P     
1447 O  OP1   . C  A 68  ? 1.47666 1.52116 1.45746 0.02260  0.07220  0.00760  170 C  A OP1   
1448 O  OP2   . C  A 68  ? 1.27226 1.31966 1.24226 0.02660  0.06450  0.00850  170 C  A OP2   
1449 O  "O5'" . C  A 68  ? 1.20996 1.24526 1.17426 0.02440  0.07250  0.00920  170 C  A "O5'" 
1450 C  "C5'" . C  A 68  ? 1.23266 1.26256 1.19506 0.02200  0.07640  0.00840  170 C  A "C5'" 
1451 C  "C4'" . C  A 68  ? 1.22766 1.25306 1.18426 0.02330  0.07840  0.00970  170 C  A "C4'" 
1452 O  "O4'" . C  A 68  ? 1.23816 1.26106 1.18726 0.02380  0.07610  0.00930  170 C  A "O4'" 
1453 C  "C3'" . C  A 68  ? 1.20596 1.23316 1.16536 0.02630  0.07890  0.01210  170 C  A "C3'" 
1454 O  "O3'" . C  A 68  ? 1.21026 1.23806 1.17636 0.02640  0.08220  0.01210  170 C  A "O3'" 
1455 C  "C2'" . C  A 68  ? 1.27516 1.29826 1.22756 0.02710  0.07940  0.01290  170 C  A "C2'" 
1456 O  "O2'" . C  A 68  ? 1.29596 1.31496 1.24716 0.02570  0.08270  0.01150  170 C  A "O2'" 
1457 C  "C1'" . C  A 68  ? 1.27766 1.29996 1.22406 0.02610  0.07670  0.01120  170 C  A "C1'" 
1458 N  N1    . C  A 68  ? 1.31736 1.34346 1.26146 0.02810  0.07330  0.01220  170 C  A N1    
1459 C  C2    . C  A 68  ? 1.34706 1.37306 1.28736 0.03000  0.07370  0.01430  170 C  A C2    
1460 O  O2    . C  A 68  ? 1.33646 1.35886 1.27656 0.02990  0.07650  0.01510  170 C  A O2    
1461 N  N3    . C  A 68  ? 1.37816 1.40846 1.31526 0.03190  0.07110  0.01540  170 C  A N3    
1462 C  C4    . C  A 68  ? 1.37806 1.41276 1.31556 0.03200  0.06760  0.01380  170 C  A C4    
1463 N  N4    . C  A 68  ? 1.33696 1.37656 1.26996 0.03400  0.06500  0.01450  170 C  A N4    
1464 C  C5    . C  A 68  ? 1.37336 1.40806 1.31586 0.02980  0.06680  0.01110  170 C  A C5    
1465 C  C6    . C  A 68  ? 1.32336 1.35366 1.26906 0.02790  0.07000  0.01080  170 C  A C6    
1466 P  P     . A  A 69  ? 1.33228 1.36258 1.30538 0.02970  0.08230  0.01470  171 A  A P     
1467 O  OP1   . A  A 69  ? 1.28478 1.31628 1.26618 0.02940  0.08580  0.01300  171 A  A OP1   
1468 O  OP2   . A  A 69  ? 1.33798 1.37298 1.31168 0.03180  0.07790  0.01720  171 A  A OP2   
1469 O  "O5'" . A  A 69  ? 1.35728 1.38258 1.32608 0.03060  0.08390  0.01600  171 A  A "O5'" 
1470 C  "C5'" . A  A 69  ? 1.25028 1.27588 1.22148 0.03350  0.08310  0.01990  171 A  A "C5'" 
1471 C  "C4'" . A  A 69  ? 1.23188 1.25528 1.19538 0.03350  0.08230  0.02140  171 A  A "C4'" 
1472 O  "O4'" . A  A 69  ? 1.21578 1.24198 1.17298 0.03310  0.07900  0.02080  171 A  A "O4'" 
1473 C  "C3'" . A  A 69  ? 1.26848 1.29188 1.23378 0.03610  0.08220  0.02650  171 A  A "C3'" 
1474 O  "O3'" . A  A 69  ? 1.28138 1.30128 1.24238 0.03520  0.08390  0.02670  171 A  A "O3'" 
1475 C  "C2'" . A  A 69  ? 1.32398 1.35298 1.28548 0.03770  0.07800  0.02900  171 A  A "C2'" 
1476 O  "O2'" . A  A 69  ? 1.34488 1.37478 1.30308 0.03960  0.07740  0.03390  171 A  A "O2'" 
1477 C  "C1'" . A  A 69  ? 1.26678 1.29598 1.22128 0.03530  0.07670  0.02460  171 A  A "C1'" 
1478 N  N9    . A  A 69  ? 1.29028 1.32498 1.24348 0.03570  0.07270  0.02370  171 A  A N9    
1479 C  C8    . A  A 69  ? 1.32088 1.35738 1.27798 0.03410  0.07170  0.02050  171 A  A C8    
1480 N  N7    . A  A 69  ? 1.34738 1.38918 1.30348 0.03450  0.06760  0.01950  171 A  A N7    
1481 C  C5    . A  A 69  ? 1.28178 1.32568 1.23168 0.03670  0.06590  0.02240  171 A  A C5    
1482 C  C6    . A  A 69  ? 1.27388 1.32388 1.21888 0.03820  0.06160  0.02250  171 A  A C6    
1483 N  N6    . A  A 69  ? 1.28088 1.33588 1.22788 0.03760  0.05770  0.01900  171 A  A N6    
1484 N  N1    . A  A 69  ? 1.30298 1.35428 1.24128 0.04030  0.06160  0.02600  171 A  A N1    
1485 C  C2    . A  A 69  ? 1.28348 1.32988 1.22138 0.04050  0.06560  0.02930  171 A  A C2    
1486 N  N3    . A  A 69  ? 1.25518 1.29548 1.19808 0.03910  0.06940  0.02910  171 A  A N3    
1487 C  C4    . A  A 69  ? 1.27118 1.31068 1.21938 0.03740  0.06930  0.02540  171 A  A C4    
1488 P  P     . A  A 70  ? 1.31919 1.33389 1.28429 0.03390  0.08770  0.02420  172 A  A P     
1489 O  OP1   . A  A 70  ? 1.25579 1.26939 1.21829 0.03160  0.08850  0.01890  172 A  A OP1   
1490 O  OP2   . A  A 70  ? 1.33459 1.34779 1.30909 0.03570  0.08930  0.02680  172 A  A OP2   
1491 O  "O5'" . A  A 70  ? 1.40479 1.41759 1.36519 0.03310  0.08850  0.02520  172 A  A "O5'" 
1492 C  "C5'" . A  A 70  ? 1.25309 1.26219 1.21829 0.03250  0.09130  0.02510  172 A  A "C5'" 
1493 C  "C4'" . A  A 70  ? 1.28289 1.29239 1.24519 0.03240  0.09170  0.02830  172 A  A "C4'" 
1494 O  "O4'" . A  A 70  ? 1.28209 1.29489 1.23549 0.03210  0.08950  0.02700  172 A  A "O4'" 
1495 C  "C3'" . A  A 70  ? 1.24889 1.25969 1.21329 0.03450  0.09180  0.03550  172 A  A "C3'" 
1496 O  "O3'" . A  A 70  ? 1.27979 1.28639 1.25329 0.03460  0.09450  0.03810  172 A  A "O3'" 
1497 C  "C2'" . A  A 70  ? 1.27409 1.28799 1.23099 0.03410  0.09150  0.03720  172 A  A "C2'" 
1498 O  "O2'" . A  A 70  ? 1.31829 1.32979 1.27809 0.03220  0.09440  0.03630  172 A  A "O2'" 
1499 C  "C1'" . A  A 70  ? 1.23279 1.24869 1.18279 0.03340  0.08920  0.03170  172 A  A "C1'" 
1500 N  N9    . A  A 70  ? 1.33429 1.35439 1.27989 0.03500  0.08590  0.03270  172 A  A N9    
1501 C  C8    . A  A 70  ? 1.31359 1.33429 1.25999 0.03500  0.08380  0.03000  172 A  A C8    
1502 N  N7    . A  A 70  ? 1.31169 1.33709 1.25469 0.03640  0.08080  0.03110  172 A  A N7    
1503 C  C5    . A  A 70  ? 1.35839 1.38649 1.29689 0.03760  0.08090  0.03490  172 A  A C5    
1504 C  C6    . A  A 70  ? 1.34229 1.37629 1.27469 0.03940  0.07820  0.03730  172 A  A C6    
1505 N  N6    . A  A 70  ? 1.35919 1.39739 1.29009 0.04030  0.07440  0.03570  172 A  A N6    
1506 N  N1    . A  A 70  ? 1.31709 1.35319 1.24509 0.04020  0.07980  0.04120  172 A  A N1    
1507 C  C2    . A  A 70  ? 1.27569 1.30799 1.20659 0.03890  0.08380  0.04260  172 A  A C2    
1508 N  N3    . A  A 70  ? 1.27919 1.30589 1.21659 0.03710  0.08600  0.04010  172 A  A N3    
1509 C  C4    . A  A 70  ? 1.37669 1.40149 1.31689 0.03660  0.08430  0.03620  172 A  A C4    
1510 P  P     . A  A 71  ? 1.37871 1.38491 1.35821 0.03760  0.09420  0.04520  173 A  A P     
1511 O  OP1   . A  A 71  ? 1.40821 1.40841 1.39801 0.03700  0.09750  0.04670  173 A  A OP1   
1512 O  OP2   . A  A 71  ? 1.36421 1.37331 1.34441 0.03940  0.09150  0.04400  173 A  A OP2   
1513 O  "O5'" . A  A 71  ? 1.33991 1.35041 1.31201 0.03870  0.09320  0.05200  173 A  A "O5'" 
1514 C  "C5'" . A  A 71  ? 1.26471 1.27401 1.23611 0.03710  0.09610  0.05480  173 A  A "C5'" 
1515 C  "C4'" . A  A 71  ? 1.24731 1.26231 1.20961 0.03850  0.09520  0.06040  173 A  A "C4'" 
1516 O  "O4'" . A  A 71  ? 1.23141 1.25161 1.18421 0.03860  0.09200  0.05560  173 A  A "O4'" 
1517 C  "C3'" . A  A 71  ? 1.23691 1.25381 1.19921 0.04180  0.09340  0.06860  173 A  A "C3'" 
1518 O  "O3'" . A  A 71  ? 1.23251 1.24511 1.20171 0.04210  0.09650  0.07630  173 A  A "O3'" 
1519 C  "C2'" . A  A 71  ? 1.23051 1.25531 1.18031 0.04290  0.09100  0.06980  173 A  A "C2'" 
1520 O  "O2'" . A  A 71  ? 1.32321 1.34961 1.26881 0.04170  0.09440  0.07360  173 A  A "O2'" 
1521 C  "C1'" . A  A 71  ? 1.27321 1.29941 1.21911 0.04110  0.08940  0.06020  173 A  A "C1'" 
1522 N  N9    . A  A 71  ? 1.27521 1.30351 1.22101 0.04260  0.08520  0.05710  173 A  A N9    
1523 C  C8    . A  A 71  ? 1.32621 1.35131 1.27821 0.04170  0.08470  0.05180  173 A  A C8    
1524 N  N7    . A  A 71  ? 1.33551 1.36421 1.28691 0.04300  0.08110  0.05030  173 A  A N7    
1525 C  C5    . A  A 71  ? 1.30821 1.34301 1.25231 0.04500  0.07850  0.05440  173 A  A C5    
1526 C  C6    . A  A 71  ? 1.31731 1.35881 1.25791 0.04700  0.07370  0.05440  173 A  A C6    
1527 N  N6    . A  A 71  ? 1.32431 1.36721 1.26961 0.04690  0.07110  0.05040  173 A  A N6    
1528 N  N1    . A  A 71  ? 1.30561 1.35301 1.23791 0.04880  0.07190  0.05860  173 A  A N1    
1529 C  C2    . A  A 71  ? 1.29341 1.33991 1.22131 0.04850  0.07520  0.06290  173 A  A C2    
1530 N  N3    . A  A 71  ? 1.29791 1.33841 1.22961 0.04650  0.08000  0.06350  173 A  A N3    
1531 C  C4    . A  A 71  ? 1.30101 1.33561 1.24091 0.04480  0.08110  0.05880  173 A  A C4    
1532 P  P     . G  A 72  ? 1.33687 1.34557 1.31577 0.04510  0.09560  0.08220  174 G  A P     
1533 O  OP1   . G  A 72  ? 1.38507 1.38707 1.37277 0.04420  0.09990  0.08820  174 G  A OP1   
1534 O  OP2   . G  A 72  ? 1.38347 1.39087 1.36797 0.04560  0.09360  0.07490  174 G  A OP2   
1535 O  "O5'" . G  A 72  ? 1.34417 1.36007 1.31447 0.04880  0.09170  0.08970  174 G  A "O5'" 
1536 C  "C5'" . G  A 72  ? 1.27167 1.29237 1.23147 0.04880  0.09260  0.09530  174 G  A "C5'" 
1537 C  "C4'" . G  A 72  ? 1.23057 1.26017 1.17997 0.05190  0.08750  0.09760  174 G  A "C4'" 
1538 O  "O4'" . G  A 72  ? 1.19277 1.22667 1.13637 0.05080  0.08470  0.08760  174 G  A "O4'" 
1539 C  "C3'" . G  A 72  ? 1.29447 1.32457 1.24947 0.05600  0.08340  0.10210  174 G  A "C3'" 
1540 O  "O3'" . G  A 72  ? 1.38397 1.41227 1.34087 0.05850  0.08430  0.11400  174 G  A "O3'" 
1541 C  "C2'" . G  A 72  ? 1.32097 1.36047 1.26617 0.05760  0.07780  0.09800  174 G  A "C2'" 
1542 O  "O2'" . G  A 72  ? 1.45157 1.49837 1.38437 0.05920  0.07650  0.10420  174 G  A "O2'" 
1543 C  "C1'" . G  A 72  ? 1.24777 1.28707 1.18967 0.05370  0.07920  0.08720  174 G  A "C1'" 
1544 N  N9    . G  A 72  ? 1.31107 1.34717 1.26157 0.05280  0.07810  0.07950  174 G  A N9    
1545 C  C8    . G  A 72  ? 1.34517 1.37397 1.30407 0.05030  0.08180  0.07490  174 G  A C8    
1546 N  N7    . G  A 72  ? 1.30597 1.33417 1.27007 0.05000  0.08030  0.06860  174 G  A N7    
1547 C  C5    . G  A 72  ? 1.31597 1.35147 1.27617 0.05220  0.07530  0.06900  174 G  A C5    
1548 C  C6    . G  A 72  ? 1.33947 1.37837 1.30357 0.05260  0.07210  0.06390  174 G  A C6    
1549 O  O6    . G  A 72  ? 1.37777 1.41357 1.34867 0.05110  0.07350  0.05820  174 G  A O6    
1550 N  N1    . G  A 72  ? 1.29017 1.33727 1.24907 0.05500  0.06690  0.06580  174 G  A N1    
1551 C  C2    . G  A 72  ? 1.32537 1.37717 1.27527 0.05690  0.06500  0.07180  174 G  A C2    
1552 N  N2    . G  A 72  ? 1.41147 1.47197 1.35707 0.05910  0.05930  0.07190  174 G  A N2    
1553 N  N3    . G  A 72  ? 1.33647 1.38527 1.28177 0.05660  0.06850  0.07710  174 G  A N3    
1554 C  C4    . G  A 72  ? 1.32817 1.36867 1.27967 0.05410  0.07360  0.07540  174 G  A C4    
1555 P  P     . G  A 73  ? 1.48212 1.50172 1.45512 0.06050  0.08520  0.11890  175 G  A P     
1556 O  OP1   . G  A 73  ? 1.41922 1.43452 1.39352 0.06090  0.08870  0.13080  175 G  A OP1   
1557 O  OP2   . G  A 73  ? 1.38862 1.40192 1.37212 0.05780  0.08740  0.10890  175 G  A OP2   
1558 O  "O5'" . G  A 73  ? 1.42812 1.45352 1.40192 0.06550  0.07860  0.12140  175 G  A "O5'" 
1559 C  "C5'" . G  A 73  ? 1.42102 1.45522 1.38322 0.06870  0.07430  0.12860  175 G  A "C5'" 
1560 C  "C4'" . G  A 73  ? 1.44632 1.48892 1.40692 0.07140  0.06750  0.12400  175 G  A "C4'" 
1561 O  "O4'" . G  A 73  ? 1.38052 1.42672 1.33592 0.06800  0.06710  0.11200  175 G  A "O4'" 
1562 C  "C3'" . G  A 73  ? 1.40882 1.44832 1.38502 0.07410  0.06530  0.12260  175 G  A "C3'" 
1563 O  "O3'" . G  A 73  ? 1.41712 1.45542 1.39942 0.07900  0.06310  0.13380  175 G  A "O3'" 
1564 C  "C2'" . G  A 73  ? 1.41792 1.46622 1.39112 0.07410  0.06020  0.11350  175 G  A "C2'" 
1565 O  "O2'" . G  A 73  ? 1.46002 1.51862 1.42482 0.07780  0.05390  0.11850  175 G  A "O2'" 
1566 C  "C1'" . G  A 73  ? 1.41142 1.46022 1.37422 0.06910  0.06310  0.10550  175 G  A "C1'" 
1567 N  N9    . G  A 73  ? 1.38562 1.42752 1.35682 0.06550  0.06720  0.09660  175 G  A N9    
1568 C  C8    . G  A 73  ? 1.39862 1.43212 1.37262 0.06220  0.07310  0.09510  175 G  A C8    
1569 N  N7    . G  A 73  ? 1.41022 1.43982 1.39102 0.05980  0.07510  0.08650  175 G  A N7    
1570 C  C5    . G  A 73  ? 1.41452 1.45012 1.39762 0.06130  0.07070  0.08240  175 G  A C5    
1571 C  C6    . G  A 73  ? 1.42712 1.46252 1.41672 0.05980  0.07090  0.07370  175 G  A C6    
1572 O  O6    . G  A 73  ? 1.42552 1.45552 1.41912 0.05690  0.07490  0.06760  175 G  A O6    
1573 N  N1    . G  A 73  ? 1.40982 1.45322 1.40092 0.06180  0.06590  0.07240  175 G  A N1    
1574 C  C2    . G  A 73  ? 1.35772 1.40852 1.34432 0.06520  0.06060  0.07820  175 G  A C2    
1575 N  N2    . G  A 73  ? 1.36832 1.42692 1.35832 0.06670  0.05580  0.07520  175 G  A N2    
1576 N  N3    . G  A 73  ? 1.35522 1.40632 1.33432 0.06700  0.06010  0.08640  175 G  A N3    
1577 C  C4    . G  A 73  ? 1.37152 1.41472 1.34942 0.06480  0.06560  0.08830  175 G  A C4    
1578 P  P     . G  A 74  ? 1.54968 1.57718 1.55138 0.08060  0.06590  0.13590  176 G  A P     
1579 O  OP1   . G  A 74  ? 1.61238 1.63888 1.61748 0.08590  0.06340  0.14970  176 G  A OP1   
1580 O  OP2   . G  A 74  ? 1.49188 1.50978 1.49748 0.07560  0.07310  0.13100  176 G  A OP2   
1581 O  "O5'" . G  A 74  ? 1.52158 1.55278 1.53308 0.08180  0.06260  0.12620  176 G  A "O5'" 
1582 C  "C5'" . G  A 74  ? 1.50008 1.54208 1.50948 0.08550  0.05550  0.12670  176 G  A "C5'" 
1583 C  "C4'" . G  A 74  ? 1.55848 1.60408 1.57598 0.08450  0.05410  0.11520  176 G  A "C4'" 
1584 O  "O4'" . G  A 74  ? 1.54338 1.58958 1.55228 0.07890  0.05690  0.10520  176 G  A "O4'" 
1585 C  "C3'" . G  A 74  ? 1.56248 1.60048 1.59798 0.08510  0.05780  0.11150  176 G  A "C3'" 
1586 O  "O3'" . G  A 74  ? 1.58358 1.62238 1.63168 0.09110  0.05430  0.11790  176 G  A "O3'" 
1587 C  "C2'" . G  A 74  ? 1.51858 1.56058 1.55518 0.08160  0.05840  0.09870  176 G  A "C2'" 
1588 O  "O2'" . G  A 74  ? 1.63958 1.69208 1.67958 0.08430  0.05240  0.09700  176 G  A "O2'" 
1589 C  "C1'" . G  A 74  ? 1.47898 1.52278 1.49848 0.07690  0.05930  0.09560  176 G  A "C1'" 
1590 N  N9    . G  A 74  ? 1.46308 1.49778 1.48178 0.07230  0.06600  0.09100  176 G  A N9    
1591 C  C8    . G  A 74  ? 1.43298 1.46148 1.44548 0.07040  0.06960  0.09540  176 G  A C8    
1592 N  N7    . G  A 74  ? 1.50538 1.52748 1.51968 0.06630  0.07470  0.08880  176 G  A N7    
1593 C  C5    . G  A 74  ? 1.45218 1.47598 1.47318 0.06560  0.07460  0.08010  176 G  A C5    
1594 C  C6    . G  A 74  ? 1.43608 1.45568 1.46038 0.06190  0.07880  0.07080  176 G  A C6    
1595 O  O6    . G  A 74  ? 1.47308 1.48658 1.49558 0.05860  0.08290  0.06800  176 G  A O6    
1596 N  N1    . G  A 74  ? 1.45028 1.47428 1.48068 0.06230  0.07760  0.06450  176 G  A N1    
1597 C  C2    . G  A 74  ? 1.43098 1.46268 1.46528 0.06570  0.07290  0.06650  176 G  A C2    
1598 N  N2    . G  A 74  ? 1.39328 1.42888 1.43448 0.06520  0.07310  0.05960  176 G  A N2    
1599 N  N3    . G  A 74  ? 1.47058 1.50648 1.50208 0.06930  0.06840  0.07470  176 G  A N3    
1600 C  C4    . G  A 74  ? 1.47828 1.50978 1.50258 0.06910  0.06960  0.08130  176 G  A C4    
1601 P  P     . U  A 75  ? 1.72857 1.75557 1.79417 0.09340  0.05870  0.12090  177 U  A P     
1602 O  OP1   . U  A 75  ? 1.78917 1.81927 1.86607 0.10050  0.05350  0.12860  177 U  A OP1   
1603 O  OP2   . U  A 75  ? 1.65297 1.66997 1.71367 0.09030  0.06400  0.12550  177 U  A OP2   
1604 O  "O5'" . U  A 75  ? 1.67437 1.69937 1.75007 0.09040  0.06280  0.10740  177 U  A "O5'" 
1605 C  "C5'" . U  A 75  ? 1.65157 1.68547 1.73387 0.09180  0.05980  0.10060  177 U  A "C5'" 
1606 C  "C4'" . U  A 75  ? 1.58957 1.62137 1.67627 0.08730  0.06500  0.08810  177 U  A "C4'" 
1607 O  "O4'" . U  A 75  ? 1.50887 1.54037 1.57987 0.08130  0.06720  0.08340  177 U  A "O4'" 
1608 C  "C3'" . U  A 75  ? 1.54907 1.56967 1.64787 0.08700  0.07120  0.08520  177 U  A "C3'" 
1609 O  "O3'" . U  A 75  ? 1.57667 1.59757 1.69387 0.09200  0.07080  0.08470  177 U  A "O3'" 
1610 C  "C2'" . U  A 75  ? 1.56127 1.58097 1.65427 0.08090  0.07600  0.07390  177 U  A "C2'" 
1611 O  "O2'" . U  A 75  ? 1.69337 1.72007 1.79307 0.08090  0.07600  0.06570  177 U  A "O2'" 
1612 C  "C1'" . U  A 75  ? 1.43007 1.45417 1.50417 0.07750  0.07360  0.07560  177 U  A "C1'" 
1613 N  N1    . U  A 75  ? 1.45207 1.46827 1.51767 0.07450  0.07670  0.07880  177 U  A N1    
1614 C  C2    . U  A 75  ? 1.48927 1.50017 1.55287 0.06980  0.08180  0.07080  177 U  A C2    
1615 O  O2    . U  A 75  ? 1.54737 1.55977 1.61467 0.06800  0.08390  0.06180  177 U  A O2    
1616 N  N3    . U  A 75  ? 1.44157 1.44617 1.49877 0.06710  0.08440  0.07370  177 U  A N3    
1617 C  C4    . U  A 75  ? 1.47157 1.47447 1.52387 0.06840  0.08320  0.08400  177 U  A C4    
1618 O  O4    . U  A 75  ? 1.56517 1.56277 1.61307 0.06540  0.08640  0.08530  177 U  A O4    
1619 C  C5    . U  A 75  ? 1.52237 1.53077 1.57577 0.07350  0.07810  0.09240  177 U  A C5    
1620 C  C6    . U  A 75  ? 1.53047 1.54517 1.59047 0.07640  0.07480  0.08940  177 U  A C6    
1621 P  P     . A  A 76  ? 1.64168 1.65208 1.77288 0.09670  0.07220  0.09220  178 A  A P     
1622 O  OP1   . A  A 76  ? 1.75828 1.76548 1.87948 0.09750  0.06970  0.10470  178 A  A OP1   
1623 O  OP2   . A  A 76  ? 1.65978 1.66098 1.79988 0.09400  0.07910  0.08350  178 A  A OP2   
1624 O  "O5'" . A  A 76  ? 1.60238 1.61928 1.74948 0.10370  0.06770  0.09450  178 A  A "O5'" 
1625 C  "C5'" . A  A 76  ? 1.72158 1.75038 1.86368 0.10670  0.06030  0.09940  178 A  A "C5'" 
1626 C  "C4'" . A  A 76  ? 1.70628 1.74478 1.86238 0.10970  0.05830  0.09300  178 A  A "C4'" 
1627 O  "O4'" . A  A 76  ? 1.62928 1.67168 1.78188 0.10390  0.06250  0.08030  178 A  A "O4'" 
1628 C  "C3'" . A  A 76  ? 1.76668 1.80018 1.94528 0.11530  0.06030  0.09240  178 A  A "C3'" 
1629 O  "O3'" . A  A 76  ? 1.80978 1.85468 2.00018 0.12070  0.05470  0.09300  178 A  A "O3'" 
1630 C  "C2'" . A  A 76  ? 1.70638 1.73638 1.88948 0.11060  0.06810  0.07900  178 A  A "C2'" 
1631 O  "O2'" . A  A 76  ? 1.72858 1.75898 1.93228 0.11460  0.07050  0.07310  178 A  A "O2'" 
1632 C  "C1'" . A  A 76  ? 1.61048 1.65108 1.78028 0.10530  0.06720  0.07230  178 A  A "C1'" 
1633 N  N9    . A  A 76  ? 1.58298 1.62018 1.74618 0.09870  0.07400  0.06180  178 A  A N9    
1634 C  C8    . A  A 76  ? 1.61988 1.64968 1.76858 0.09320  0.07730  0.06090  178 A  A C8    
1635 N  N7    . A  A 76  ? 1.64138 1.67058 1.78718 0.08840  0.08270  0.05060  178 A  A N7    
1636 C  C5    . A  A 76  ? 1.54668 1.58348 1.70588 0.09050  0.08360  0.04440  178 A  A C5    
1637 C  C6    . A  A 76  ? 1.46868 1.50908 1.63138 0.08760  0.08900  0.03340  178 A  A C6    
1638 N  N6    . A  A 76  ? 1.51088 1.54748 1.66298 0.08180  0.09400  0.02660  178 A  A N6    
1639 N  N1    . A  A 76  ? 1.55848 1.60748 1.73618 0.09090  0.08900  0.02960  178 A  A N1    
1640 C  C2    . A  A 76  ? 1.56398 1.61748 1.75288 0.09700  0.08330  0.03650  178 A  A C2    
1641 N  N3    . A  A 76  ? 1.58868 1.63918 1.77498 0.10060  0.07750  0.04730  178 A  A N3    
1642 C  C4    . A  A 76  ? 1.59168 1.63358 1.76228 0.09680  0.07830  0.05090  178 A  A C4    
1643 P  P     . U  A 77  ? 1.86512 1.91052 2.06572 0.12950  0.04780  0.10610  179 U  A P     
1644 O  OP1   . U  A 77  ? 1.75412 1.78412 1.95662 0.13070  0.05100  0.11390  179 U  A OP1   
1645 O  OP2   . U  A 77  ? 1.93342 1.98772 2.15432 0.13490  0.04550  0.10180  179 U  A OP2   
1646 O  "O5'" . U  A 77  ? 1.76102 1.81612 1.94342 0.12930  0.03990  0.11420  179 U  A "O5'" 
1647 C  "C5'" . U  A 77  ? 1.72202 1.79262 1.90142 0.12870  0.03470  0.10930  179 U  A "C5'" 
1648 C  "C4'" . U  A 77  ? 1.80412 1.88172 1.96472 0.12840  0.02770  0.11710  179 U  A "C4'" 
1649 O  "O4'" . U  A 77  ? 1.95462 2.02902 2.11662 0.13520  0.02290  0.13150  179 U  A "O4'" 
1650 C  "C3'" . U  A 77  ? 1.81322 1.88552 1.95212 0.12130  0.03140  0.11610  179 U  A "C3'" 
1651 O  "O3'" . U  A 77  ? 1.80622 1.89012 1.92992 0.11970  0.02520  0.11650  179 U  A "O3'" 
1652 C  "C2'" . U  A 77  ? 1.89152 1.95222 2.02642 0.12370  0.03260  0.12830  179 U  A "C2'" 
1653 O  "O2'" . U  A 77  ? 1.85882 1.91752 1.97272 0.11950  0.03320  0.13240  179 U  A "O2'" 
1654 C  "C1'" . U  A 77  ? 2.02142 2.08822 2.16502 0.13220  0.02450  0.13900  179 U  A "C1'" 
1655 N  N1    . U  A 77  ? 2.10602 2.16092 2.25742 0.13710  0.02570  0.15080  179 U  A N1    
1656 C  C2    . U  A 77  ? 2.11942 2.16732 2.25582 0.13580  0.02670  0.16140  179 U  A C2    
1657 O  O2    . U  A 77  ? 2.10182 2.15322 2.21842 0.13100  0.02670  0.16090  179 U  A O2    
1658 N  N3    . U  A 77  ? 2.17082 2.20712 2.31692 0.14030  0.02800  0.17260  179 U  A N3    
1659 C  C4    . U  A 77  ? 2.18742 2.21822 2.35662 0.14620  0.02810  0.17390  179 U  A C4    
1660 O  O4    . U  A 77  ? 2.22032 2.23972 2.39672 0.14970  0.02940  0.18480  179 U  A O4    
1661 C  C5    . U  A 77  ? 2.13282 2.17212 2.31632 0.14750  0.02700  0.16190  179 U  A C5    
1662 C  C6    . U  A 77  ? 2.08492 2.13592 2.25912 0.14290  0.02600  0.15130  179 U  A C6    
1663 P  P     . G  A 78  ? 1.86345 1.95615 1.98165 0.11340  0.02580  0.10370  180 G  A P     
1664 O  OP1   . G  A 78  ? 1.72015 1.82085 1.81985 0.11180  0.02000  0.10620  180 G  A OP1   
1665 O  OP2   . G  A 78  ? 1.65755 1.75855 1.79495 0.11560  0.02460  0.09690  180 G  A OP2   
1666 O  "O5'" . G  A 78  ? 1.78975 1.87085 1.90245 0.10660  0.03540  0.09650  180 G  A "O5'" 
1667 C  "C5'" . G  A 78  ? 1.73495 1.80735 1.83175 0.10340  0.03840  0.10070  180 G  A "C5'" 
1668 C  "C4'" . G  A 78  ? 1.64775 1.71275 1.74065 0.09670  0.04620  0.09150  180 G  A "C4'" 
1669 O  "O4'" . G  A 78  ? 1.67295 1.73025 1.78165 0.09760  0.05190  0.08780  180 G  A "O4'" 
1670 C  "C3'" . G  A 78  ? 1.59675 1.66915 1.68575 0.09180  0.04640  0.08090  180 G  A "C3'" 
1671 O  "O3'" . G  A 78  ? 1.55925 1.63565 1.63075 0.08850  0.04360  0.08110  180 G  A "O3'" 
1672 C  "C2'" . G  A 78  ? 1.58125 1.64535 1.67445 0.08750  0.05470  0.07280  180 G  A "C2'" 
1673 O  "O2'" . G  A 78  ? 1.61265 1.66855 1.69205 0.08320  0.05850  0.07290  180 G  A "O2'" 
1674 C  "C1'" . G  A 78  ? 1.61335 1.67085 1.72265 0.09240  0.05690  0.07630  180 G  A "C1'" 
1675 N  N9    . G  A 78  ? 1.58595 1.64985 1.71275 0.09510  0.05680  0.07100  180 G  A N9    
1676 C  C8    . G  A 78  ? 1.63205 1.70385 1.77085 0.10120  0.05110  0.07520  180 G  A C8    
1677 N  N7    . G  A 78  ? 1.58685 1.66375 1.74125 0.10230  0.05290  0.06820  180 G  A N7    
1678 C  C5    . G  A 78  ? 1.53535 1.60715 1.68655 0.09650  0.06050  0.05910  180 G  A C5    
1679 C  C6    . G  A 78  ? 1.54685 1.62115 1.70885 0.09470  0.06610  0.04920  180 G  A C6    
1680 O  O6    . G  A 78  ? 1.57715 1.65915 1.75535 0.09780  0.06580  0.04590  180 G  A O6    
1681 N  N1    . G  A 78  ? 1.51185 1.57945 1.66395 0.08860  0.07270  0.04280  180 G  A N1    
1682 C  C2    . G  A 78  ? 1.54735 1.60695 1.68275 0.08490  0.07350  0.04540  180 G  A C2    
1683 N  N2    . G  A 78  ? 1.51475 1.56945 1.64325 0.07960  0.07960  0.03830  180 G  A N2    
1684 N  N3    . G  A 78  ? 1.57625 1.63365 1.70245 0.08640  0.06880  0.05420  180 G  A N3    
1685 C  C4    . G  A 78  ? 1.56605 1.62975 1.70035 0.09220  0.06260  0.06080  180 G  A C4    
1686 P  P     . G  A 79  ? 1.62907 1.71727 1.69747 0.08570  0.03950  0.07370  181 G  A P     
1687 O  OP1   . G  A 79  ? 1.51917 1.61107 1.57007 0.08460  0.03530  0.07660  181 G  A OP1   
1688 O  OP2   . G  A 79  ? 1.59727 1.69467 1.68187 0.08970  0.03550  0.07270  181 G  A OP2   
1689 O  "O5'" . G  A 79  ? 1.44927 1.53247 1.51687 0.07930  0.04650  0.06370  181 G  A "O5'" 
1690 C  "C5'" . G  A 79  ? 1.39377 1.48377 1.46937 0.07690  0.04680  0.05550  181 G  A "C5'" 
1691 C  "C4'" . G  A 79  ? 1.31587 1.39907 1.39737 0.07370  0.05480  0.04910  181 G  A "C4'" 
1692 O  "O4'" . G  A 79  ? 1.38207 1.46127 1.47737 0.07810  0.05730  0.05140  181 G  A "O4'" 
1693 C  "C3'" . G  A 79  ? 1.28797 1.37777 1.37657 0.07020  0.05660  0.04070  181 G  A "C3'" 
1694 O  "O3'" . G  A 79  ? 1.28527 1.37497 1.36177 0.06450  0.05710  0.03640  181 G  A "O3'" 
1695 C  "C2'" . G  A 79  ? 1.33027 1.41437 1.42897 0.07010  0.06390  0.03690  181 G  A "C2'" 
1696 O  "O2'" . G  A 79  ? 1.29877 1.37357 1.38657 0.06580  0.06950  0.03410  181 G  A "O2'" 
1697 C  "C1'" . G  A 79  ? 1.40597 1.48607 1.51247 0.07640  0.06260  0.04370  181 G  A "C1'" 
1698 N  N9    . G  A 79  ? 1.42427 1.51257 1.54847 0.08140  0.05980  0.04420  181 G  A N9    
1699 C  C8    . G  A 79  ? 1.50307 1.59697 1.63247 0.08710  0.05270  0.05140  181 G  A C8    
1700 N  N7    . G  A 79  ? 1.50117 1.60237 1.64827 0.09110  0.05140  0.04990  181 G  A N7    
1701 C  C5    . G  A 79  ? 1.47857 1.57917 1.63237 0.08750  0.05870  0.04100  181 G  A C5    
1702 C  C6    . G  A 79  ? 1.47507 1.58237 1.64747 0.08920  0.06160  0.03530  181 G  A C6    
1703 O  O6    . G  A 79  ? 1.47307 1.58837 1.66137 0.09460  0.05780  0.03680  181 G  A O6    
1704 N  N1    . G  A 79  ? 1.49127 1.59577 1.66277 0.08400  0.06980  0.02700  181 G  A N1    
1705 C  C2    . G  A 79  ? 1.47927 1.57537 1.63427 0.07830  0.07400  0.02490  181 G  A C2    
1706 N  N2    . G  A 79  ? 1.43287 1.52817 1.58897 0.07420  0.08150  0.01710  181 G  A N2    
1707 N  N3    . G  A 79  ? 1.49027 1.58017 1.62917 0.07690  0.07110  0.02990  181 G  A N3    
1708 C  C4    . G  A 79  ? 1.44497 1.53747 1.58417 0.08150  0.06380  0.03770  181 G  A C4    
1709 P  P     . U  A 80  ? 1.24187 1.34247 1.32037 0.06190  0.05280  0.03200  182 U  A P     
1710 O  OP1   . U  A 80  ? 1.16917 1.26787 1.23177 0.05820  0.05090  0.03110  182 U  A OP1   
1711 O  OP2   . U  A 80  ? 1.31007 1.42077 1.40017 0.06710  0.04650  0.03500  182 U  A OP2   
1712 O  "O5'" . U  A 80  ? 1.20967 1.31067 1.29677 0.05780  0.05930  0.02480  182 U  A "O5'" 
1713 C  "C5'" . U  A 80  ? 1.20347 1.29517 1.28577 0.05490  0.06680  0.02230  182 U  A "C5'" 
1714 C  "C4'" . U  A 80  ? 1.29897 1.39357 1.39237 0.05270  0.07260  0.01650  182 U  A "C4'" 
1715 O  "O4'" . U  A 80  ? 1.30657 1.40497 1.41587 0.05780  0.07310  0.01720  182 U  A "O4'" 
1716 C  "C3'" . U  A 80  ? 1.24047 1.34377 1.33837 0.04870  0.07170  0.01220  182 U  A "C3'" 
1717 O  "O3'" . U  A 80  ? 1.14397 1.24527 1.24267 0.04420  0.07910  0.00740  182 U  A "O3'" 
1718 C  "C2'" . U  A 80  ? 1.21807 1.33227 1.33357 0.05290  0.06820  0.01250  182 U  A "C2'" 
1719 O  "O2'" . U  A 80  ? 1.29217 1.41527 1.41877 0.04970  0.07000  0.00750  182 U  A "O2'" 
1720 C  "C1'" . U  A 80  ? 1.32357 1.43337 1.44657 0.05750  0.07220  0.01390  182 U  A "C1'" 
1721 N  N1    . U  A 80  ? 1.37007 1.48607 1.50627 0.06410  0.06710  0.01760  182 U  A N1    
1722 C  C2    . U  A 80  ? 1.40947 1.53097 1.56367 0.06690  0.07030  0.01460  182 U  A C2    
1723 O  O2    . U  A 80  ? 1.43537 1.55727 1.59427 0.06380  0.07750  0.00880  182 U  A O2    
1724 N  N3    . U  A 80  ? 1.40707 1.53417 1.57357 0.07360  0.06480  0.01880  182 U  A N3    
1725 C  C4    . U  A 80  ? 1.47047 1.59807 1.63177 0.07760  0.05660  0.02600  182 U  A C4    
1726 O  O4    . U  A 80  ? 1.56237 1.69537 1.73607 0.08400  0.05200  0.02980  182 U  A O4    
1727 C  C5    . U  A 80  ? 1.39587 1.51817 1.53747 0.07410  0.05420  0.02840  182 U  A C5    
1728 C  C6    . U  A 80  ? 1.34417 1.46087 1.47477 0.06770  0.05950  0.02400  182 U  A C6    
1729 P  P     . A  A 81  ? 1.23031 1.32381 1.31311 0.03840  0.08210  0.00590  183 A  A P     
1730 O  OP1   . A  A 81  ? 1.23571 1.32671 1.31981 0.03560  0.09030  0.00220  183 A  A OP1   
1731 O  OP2   . A  A 81  ? 1.33601 1.42161 1.40501 0.03980  0.07900  0.00970  183 A  A OP2   
1732 O  "O5'" . A  A 81  ? 1.18481 1.28471 1.26871 0.03430  0.07860  0.00400  183 A  A "O5'" 
1733 C  "C5'" . A  A 81  ? 1.18351 1.29331 1.28201 0.03260  0.07970  0.00080  183 A  A "C5'" 
1734 C  "C4'" . A  A 81  ? 1.16041 1.27011 1.25581 0.02590  0.08150  -0.00200 183 A  A "C4'" 
1735 O  "O4'" . A  A 81  ? 1.12351 1.23061 1.20901 0.02480  0.07520  -0.00100 183 A  A "O4'" 
1736 C  "C3'" . A  A 81  ? 1.19941 1.30061 1.28521 0.02190  0.08890  -0.00280 183 A  A "C3'" 
1737 O  "O3'" . A  A 81  ? 1.19011 1.29531 1.28511 0.02070  0.09610  -0.00530 183 A  A "O3'" 
1738 C  "C2'" . A  A 81  ? 1.24281 1.34151 1.32191 0.01660  0.08720  -0.00350 183 A  A "C2'" 
1739 O  "O2'" . A  A 81  ? 1.24781 1.35391 1.33891 0.01240  0.08940  -0.00610 183 A  A "O2'" 
1740 C  "C1'" . A  A 81  ? 1.16581 1.26621 1.24231 0.01930  0.07840  -0.00230 183 A  A "C1'" 
1741 N  N9    . A  A 81  ? 1.25941 1.35031 1.31961 0.02030  0.07650  -0.00000 183 A  A N9    
1742 C  C8    . A  A 81  ? 1.27921 1.36611 1.33271 0.02500  0.07490  0.00310  183 A  A C8    
1743 N  N7    . A  A 81  ? 1.28001 1.35921 1.31981 0.02450  0.07380  0.00430  183 A  A N7    
1744 C  C5    . A  A 81  ? 1.29941 1.37691 1.33661 0.01950  0.07430  0.00190  183 A  A C5    
1745 C  C6    . A  A 81  ? 1.34631 1.41651 1.37211 0.01700  0.07360  0.00150  183 A  A C6    
1746 N  N6    . A  A 81  ? 1.32551 1.38971 1.33981 0.01910  0.07220  0.00330  183 A  A N6    
1747 N  N1    . A  A 81  ? 1.32911 1.39861 1.35701 0.01210  0.07450  -0.00080 183 A  A N1    
1748 C  C2    . A  A 81  ? 1.28901 1.36511 1.32941 0.00960  0.07630  -0.00260 183 A  A C2    
1749 N  N3    . A  A 81  ? 1.30421 1.38841 1.35631 0.01140  0.07730  -0.00280 183 A  A N3    
1750 C  C4    . A  A 81  ? 1.27051 1.35481 1.32021 0.01670  0.07610  -0.00050 183 A  A C4    
1751 P  P     . A  A 82  ? 1.30636 1.40546 1.39606 0.02220  0.10300  -0.00580 184 A  A P     
1752 O  OP1   . A  A 82  ? 1.33966 1.44676 1.44516 0.02540  0.10620  -0.00820 184 A  A OP1   
1753 O  OP2   . A  A 82  ? 1.30856 1.39826 1.38516 0.02490  0.09990  -0.00300 184 A  A OP2   
1754 O  "O5'" . A  A 82  ? 1.15276 1.24856 1.23466 0.01600  0.10960  -0.00710 184 A  A "O5'" 
1755 C  "C5'" . A  A 82  ? 1.21406 1.31546 1.30256 0.01100  0.11150  -0.00810 184 A  A "C5'" 
1756 C  "C4'" . A  A 82  ? 1.21026 1.30396 1.28556 0.00570  0.11330  -0.00660 184 A  A "C4'" 
1757 O  "O4'" . A  A 82  ? 1.24576 1.33436 1.31376 0.00590  0.10590  -0.00470 184 A  A "O4'" 
1758 C  "C3'" . A  A 82  ? 1.28026 1.36546 1.34116 0.00570  0.11800  -0.00590 184 A  A "C3'" 
1759 O  "O3'" . A  A 82  ? 1.36086 1.44956 1.42396 0.00330  0.12640  -0.00760 184 A  A "O3'" 
1760 C  "C2'" . A  A 82  ? 1.31686 1.39336 1.36446 0.00270  0.11510  -0.00320 184 A  A "C2'" 
1761 O  "O2'" . A  A 82  ? 1.33236 1.40946 1.38076 -0.00310 0.11900  -0.00240 184 A  A "O2'" 
1762 C  "C1'" . A  A 82  ? 1.33886 1.41706 1.39076 0.00450  0.10680  -0.00280 184 A  A "C1'" 
1763 N  N9    . A  A 82  ? 1.31646 1.38976 1.36066 0.00920  0.10210  -0.00160 184 A  A N9    
1764 C  C8    . A  A 82  ? 1.30636 1.38056 1.35286 0.01410  0.10210  -0.00170 184 A  A C8    
1765 N  N7    . A  A 82  ? 1.30706 1.37606 1.34566 0.01720  0.09760  0.00030  184 A  A N7    
1766 C  C5    . A  A 82  ? 1.33796 1.40306 1.36856 0.01440  0.09430  0.00110  184 A  A C5    
1767 C  C6    . A  A 82  ? 1.28856 1.34826 1.30906 0.01560  0.08950  0.00270  184 A  A C6    
1768 N  N6    . A  A 82  ? 1.23026 1.28766 1.24666 0.01970  0.08730  0.00450  184 A  A N6    
1769 N  N1    . A  A 82  ? 1.26826 1.32506 1.28366 0.01230  0.08750  0.00240  184 A  A N1    
1770 C  C2    . A  A 82  ? 1.28536 1.34386 1.30576 0.00790  0.09000  0.00120  184 A  A C2    
1771 N  N3    . A  A 82  ? 1.33346 1.39716 1.36306 0.00600  0.09490  0.00030  184 A  A N3    
1772 C  C4    . A  A 82  ? 1.32066 1.38796 1.35496 0.00960  0.09680  0.00000  184 A  A C4    
1773 P  P     . U  A 83  ? 1.44303 1.52903 1.49933 0.00590  0.13160  -0.00960 185 U  A P     
1774 O  OP1   . U  A 83  ? 1.45713 1.53273 1.49553 0.00510  0.13050  -0.00750 185 U  A OP1   
1775 O  OP2   . U  A 83  ? 1.53843 1.63213 1.60213 0.00390  0.14000  -0.01250 185 U  A OP2   
1776 O  "O5'" . U  A 83  ? 1.38293 1.47023 1.44713 0.01230  0.12740  -0.01100 185 U  A "O5'" 
1777 C  "C5'" . U  A 83  ? 1.33773 1.43463 1.41953 0.01500  0.12800  -0.01330 185 U  A "C5'" 
1778 C  "C4'" . U  A 83  ? 1.37513 1.47113 1.46123 0.02060  0.12880  -0.01560 185 U  A "C4'" 
1779 O  "O4'" . U  A 83  ? 1.46053 1.55523 1.54123 0.01960  0.13660  -0.01920 185 U  A "O4'" 
1780 C  "C3'" . U  A 83  ? 1.40193 1.48913 1.47973 0.02420  0.12290  -0.01280 185 U  A "C3'" 
1781 O  "O3'" . U  A 83  ? 1.29003 1.37913 1.37933 0.02990  0.12150  -0.01370 185 U  A "O3'" 
1782 C  "C2'" . U  A 83  ? 1.51123 1.59073 1.57453 0.02250  0.12700  -0.01420 185 U  A "C2'" 
1783 O  "O2'" . U  A 83  ? 1.52633 1.59863 1.58483 0.02600  0.12450  -0.01370 185 U  A "O2'" 
1784 C  "C1'" . U  A 83  ? 1.49333 1.57893 1.56323 0.02180  0.13520  -0.01930 185 U  A "C1'" 
1785 N  N1    . U  A 83  ? 1.60833 1.69063 1.66463 0.01840  0.14080  -0.02110 185 U  A N1    
1786 C  C2    . U  A 83  ? 1.72033 1.79663 1.76893 0.02040  0.14190  -0.02360 185 U  A C2    
1787 O  O2    . U  A 83  ? 1.71673 1.78943 1.76973 0.02450  0.13870  -0.02410 185 U  A O2    
1788 N  N3    . U  A 83  ? 1.73833 1.81283 1.77393 0.01720  0.14660  -0.02540 185 U  A N3    
1789 C  C4    . U  A 83  ? 1.76353 1.84113 1.79283 0.01240  0.15070  -0.02400 185 U  A C4    
1790 O  O4    . U  A 83  ? 1.91453 1.99033 1.93103 0.01030  0.15450  -0.02520 185 U  A O4    
1791 C  C5    . U  A 83  ? 1.61813 1.70133 1.65703 0.01030  0.15000  -0.02110 185 U  A C5    
1792 C  C6    . U  A 83  ? 1.61333 1.69893 1.66533 0.01320  0.14500  -0.02020 185 U  A C6    
1793 P  P     . A  A 84  ? 1.41947 1.51257 1.51897 0.03390  0.11360  -0.01010 186 A  A P     
1794 O  OP1   . A  A 84  ? 1.44557 1.55027 1.56037 0.03340  0.11430  -0.01190 186 A  A OP1   
1795 O  OP2   . A  A 84  ? 1.40277 1.48987 1.48957 0.03300  0.10730  -0.00570 186 A  A OP2   
1796 O  "O5'" . A  A 84  ? 1.32837 1.41877 1.43537 0.04020  0.11330  -0.01020 186 A  A "O5'" 
1797 C  "C5'" . A  A 84  ? 1.38297 1.47927 1.50567 0.04320  0.11770  -0.01430 186 A  A "C5'" 
1798 C  "C4'" . A  A 84  ? 1.38867 1.48837 1.52527 0.04940  0.11210  -0.01130 186 A  A "C4'" 
1799 O  "O4'" . A  A 84  ? 1.35447 1.44457 1.48427 0.05250  0.10820  -0.00690 186 A  A "O4'" 
1800 C  "C3'" . A  A 84  ? 1.36117 1.46867 1.50237 0.04930  0.10530  -0.00780 186 A  A "C3'" 
1801 O  "O3'" . A  A 84  ? 1.47807 1.59727 1.63437 0.04870  0.10770  -0.01140 186 A  A "O3'" 
1802 C  "C2'" . A  A 84  ? 1.34787 1.45317 1.49287 0.05550  0.09820  -0.00220 186 A  A "C2'" 
1803 O  "O2'" . A  A 84  ? 1.39147 1.50277 1.55537 0.06100  0.09850  -0.00330 186 A  A "O2'" 
1804 C  "C1'" . A  A 84  ? 1.30607 1.39867 1.43927 0.05590  0.10030  -0.00100 186 A  A "C1'" 
1805 N  N9    . A  A 84  ? 1.32577 1.41207 1.44177 0.05340  0.09610  0.00330  186 A  A N9    
1806 C  C8    . A  A 84  ? 1.31047 1.39507 1.41307 0.04770  0.09690  0.00220  186 A  A C8    
1807 N  N7    . A  A 84  ? 1.29787 1.37687 1.38777 0.04710  0.09270  0.00630  186 A  A N7    
1808 C  C5    . A  A 84  ? 1.31667 1.39367 1.41117 0.05250  0.08900  0.01090  186 A  A C5    
1809 C  C6    . A  A 84  ? 1.25577 1.32787 1.34187 0.05450  0.08430  0.01690  186 A  A C6    
1810 N  N6    . A  A 84  ? 1.17037 1.23877 1.24157 0.05150  0.08220  0.01840  186 A  A N6    
1811 N  N1    . A  A 84  ? 1.26497 1.33597 1.35897 0.06000  0.08180  0.02150  186 A  A N1    
1812 C  C2    . A  A 84  ? 1.33337 1.40777 1.44347 0.06350  0.08370  0.01970  186 A  A C2    
1813 N  N3    . A  A 84  ? 1.38877 1.46847 1.50857 0.06230  0.08820  0.01340  186 A  A N3    
1814 C  C4    . A  A 84  ? 1.33957 1.42057 1.45027 0.05650  0.09080  0.00940  186 A  A C4    
1815 P  P     . A  A 85  ? 1.41643 1.54443 1.57483 0.04430  0.10430  -0.01100 187 A  A P     
1816 O  OP1   . A  A 85  ? 1.40343 1.53813 1.56833 0.03980  0.11220  -0.01620 187 A  A OP1   
1817 O  OP2   . A  A 85  ? 1.43713 1.55803 1.57823 0.04130  0.09940  -0.00730 187 A  A OP2   
1818 O  "O5'" . A  A 85  ? 1.30123 1.43903 1.47673 0.04980  0.09730  -0.00920 187 A  A "O5'" 
1819 C  "C5'" . A  A 85  ? 1.40653 1.55003 1.58193 0.04900  0.08920  -0.00660 187 A  A "C5'" 
1820 C  "C4'" . A  A 85  ? 1.42093 1.57923 1.61663 0.04980  0.08770  -0.00930 187 A  A "C4'" 
1821 O  "O4'" . A  A 85  ? 1.38933 1.55183 1.59863 0.05770  0.08370  -0.00730 187 A  A "O4'" 
1822 C  "C3'" . A  A 85  ? 1.43853 1.60443 1.63533 0.04700  0.08030  -0.00880 187 A  A "C3'" 
1823 O  "O3'" . A  A 85  ? 1.47363 1.64063 1.66733 0.03910  0.08470  -0.01230 187 A  A "O3'" 
1824 C  "C2'" . A  A 85  ? 1.42473 1.60473 1.64333 0.05180  0.07590  -0.00980 187 A  A "C2'" 
1825 O  "O2'" . A  A 85  ? 1.63633 1.82633 1.87023 0.04800  0.08220  -0.01530 187 A  A "O2'" 
1826 C  "C1'" . A  A 85  ? 1.37213 1.54803 1.59573 0.05930  0.07700  -0.00740 187 A  A "C1'" 
1827 N  N9    . A  A 85  ? 1.45043 1.62603 1.67313 0.06600  0.06740  -0.00120 187 A  A N9    
1828 C  C8    . A  A 85  ? 1.53883 1.72233 1.77853 0.07330  0.06290  0.00070  187 A  A C8    
1829 N  N7    . A  A 85  ? 1.61503 1.79643 1.84913 0.07840  0.05430  0.00740  187 A  A N7    
1830 C  C5    . A  A 85  ? 1.58373 1.75573 1.79583 0.07400  0.05350  0.00950  187 A  A C5    
1831 C  C6    . A  A 85  ? 1.59003 1.75653 1.78643 0.07600  0.04670  0.01600  187 A  A C6    
1832 N  N6    . A  A 85  ? 1.67433 1.84373 1.87403 0.08300  0.03900  0.02240  187 A  A N6    
1833 N  N1    . A  A 85  ? 1.61573 1.77383 1.79293 0.07050  0.04820  0.01580  187 A  A N1    
1834 C  C2    . A  A 85  ? 1.49673 1.65153 1.67033 0.06380  0.05560  0.01020  187 A  A C2    
1835 N  N3    . A  A 85  ? 1.55373 1.71293 1.73973 0.06120  0.06250  0.00450  187 A  A N3    
1836 C  C4    . A  A 85  ? 1.58213 1.75033 1.78753 0.06650  0.06130  0.00420  187 A  A C4    
1837 P  P     . G  A 86  ? 1.69494 1.84884 1.86684 0.03350  0.08810  -0.01130 188 G  A P     
1838 O  OP1   . G  A 86  ? 1.63954 1.79784 1.81324 0.02640  0.08850  -0.01370 188 G  A OP1   
1839 O  OP2   . G  A 86  ? 1.63244 1.77834 1.79784 0.03340  0.09670  -0.01210 188 G  A OP2   
1840 O  "O5'" . G  A 86  ? 1.34884 1.49584 1.50664 0.03660  0.07960  -0.00660 188 G  A "O5'" 
1841 C  "C5'" . G  A 86  ? 1.38094 1.52984 1.53344 0.03390  0.07280  -0.00640 188 G  A "C5'" 
1842 C  "C4'" . G  A 86  ? 1.41294 1.56804 1.56884 0.03950  0.06290  -0.00360 188 G  A "C4'" 
1843 O  "O4'" . G  A 86  ? 1.35644 1.50144 1.49654 0.04310  0.06050  0.00140  188 G  A "O4'" 
1844 C  "C3'" . G  A 86  ? 1.33574 1.49834 1.49284 0.03680  0.05540  -0.00560 188 G  A "C3'" 
1845 O  "O3'" . G  A 86  ? 1.44684 1.62174 1.61714 0.04180  0.04790  -0.00500 188 G  A "O3'" 
1846 C  "C2'" . G  A 86  ? 1.30324 1.45634 1.44004 0.03690  0.05150  -0.00270 188 G  A "C2'" 
1847 O  "O2'" . G  A 86  ? 1.43324 1.59284 1.56814 0.03760  0.04230  -0.00310 188 G  A "O2'" 
1848 C  "C1'" . G  A 86  ? 1.32044 1.46664 1.45134 0.04290  0.05260  0.00260  188 G  A "C1'" 
1849 N  N9    . G  A 86  ? 1.30284 1.43664 1.41434 0.04230  0.05370  0.00550  188 G  A N9    
1850 C  C8    . G  A 86  ? 1.32394 1.45124 1.42844 0.04720  0.05330  0.01070  188 G  A C8    
1851 N  N7    . G  A 86  ? 1.34364 1.46104 1.43194 0.04570  0.05460  0.01230  188 G  A N7    
1852 C  C5    . G  A 86  ? 1.25644 1.37314 1.34044 0.03970  0.05580  0.00800  188 G  A C5    
1853 C  C6    . G  A 86  ? 1.26554 1.37344 1.33444 0.03610  0.05730  0.00740  188 G  A C6    
1854 O  O6    . G  A 86  ? 1.33244 1.43204 1.38874 0.03740  0.05790  0.01030  188 G  A O6    
1855 N  N1    . G  A 86  ? 1.20904 1.31824 1.27924 0.03050  0.05800  0.00290  188 G  A N1    
1856 C  C2    . G  A 86  ? 1.16294 1.28114 1.24744 0.02810  0.05770  -0.00060 188 G  A C2    
1857 N  N2    . G  A 86  ? 1.19184 1.30924 1.27634 0.02220  0.05880  -0.00440 188 G  A N2    
1858 N  N3    . G  A 86  ? 1.23204 1.35954 1.33094 0.03130  0.05640  -0.00050 188 G  A N3    
1859 C  C4    . G  A 86  ? 1.24644 1.37264 1.34434 0.03730  0.05540  0.00390  188 G  A C4    
1860 P  P     . C  A 87  ? 1.32728 1.51628 1.51158 0.03860  0.04240  -0.01000 189 C  A P     
1861 O  OP1   . C  A 87  ? 1.24298 1.42858 1.42578 0.03010  0.04820  -0.01430 189 C  A OP1   
1862 O  OP2   . C  A 87  ? 1.29348 1.48788 1.47268 0.04220  0.03120  -0.00830 189 C  A OP2   
1863 O  "O5'" . C  A 87  ? 1.43068 1.63178 1.63818 0.04180  0.04410  -0.01150 189 C  A "O5'" 
1864 C  "C5'" . C  A 87  ? 1.45128 1.65308 1.66918 0.03810  0.05410  -0.01470 189 C  A "C5'" 
1865 C  "C4'" . C  A 87  ? 1.53968 1.75058 1.77658 0.04400  0.05530  -0.01480 189 C  A "C4'" 
1866 O  "O4'" . C  A 87  ? 1.51008 1.71178 1.73918 0.05040  0.05640  -0.01000 189 C  A "O4'" 
1867 C  "C3'" . C  A 87  ? 1.58048 1.80648 1.83308 0.04860  0.04530  -0.01510 189 C  A "C3'" 
1868 O  "O3'" . C  A 87  ? 1.50268 1.74178 1.77208 0.04360  0.04510  -0.02080 189 C  A "O3'" 
1869 C  "C2'" . C  A 87  ? 1.57688 1.80478 1.84038 0.05680  0.04630  -0.01230 189 C  A "C2'" 
1870 O  "O2'" . C  A 87  ? 1.55758 1.79228 1.83928 0.05550  0.05470  -0.01690 189 C  A "O2'" 
1871 C  "C1'" . C  A 87  ? 1.57438 1.78478 1.81838 0.05820  0.05110  -0.00790 189 C  A "C1'" 
1872 N  N1    . C  A 87  ? 1.59028 1.79558 1.82168 0.06370  0.04260  -0.00130 189 C  A N1    
1873 C  C2    . C  A 87  ? 1.67528 1.88268 1.91538 0.07240  0.03880  0.00330  189 C  A C2    
1874 O  O2    . C  A 87  ? 1.72868 1.94228 1.98748 0.07540  0.04240  0.00110  189 C  A O2    
1875 N  N3    . C  A 87  ? 1.65648 1.85918 1.88468 0.07730  0.03160  0.01040  189 C  A N3    
1876 C  C4    . C  A 87  ? 1.62798 1.82488 1.83628 0.07390  0.02830  0.01200  189 C  A C4    
1877 N  N4    . C  A 87  ? 1.68278 1.87598 1.87968 0.07890  0.02180  0.01920  189 C  A N4    
1878 C  C5    . C  A 87  ? 1.56138 1.75598 1.76128 0.06550  0.03190  0.00660  189 C  A C5    
1879 C  C6    . C  A 87  ? 1.50448 1.70298 1.71628 0.06070  0.03880  0.00050  189 C  A C6    
1880 P  P     . U  A 88  ? 1.59170 1.84410 1.86850 0.04380  0.03290  -0.02290 190 U  A P     
1881 O  OP1   . U  A 88  ? 1.58280 1.84420 1.87370 0.03580  0.03580  -0.02950 190 U  A OP1   
1882 O  OP2   . U  A 88  ? 1.47500 1.71910 1.73000 0.04520  0.02560  -0.01930 190 U  A OP2   
1883 O  "O5'" . U  A 88  ? 1.70540 1.97050 2.00010 0.05290  0.02680  -0.02100 190 U  A "O5'" 
1884 C  "C5'" . U  A 88  ? 1.67220 1.94440 1.98740 0.05490  0.03340  -0.02310 190 U  A "C5'" 
1885 C  "C4'" . U  A 88  ? 1.68830 1.96790 2.01520 0.06520  0.02680  -0.01930 190 U  A "C4'" 
1886 O  "O4'" . U  A 88  ? 1.71590 1.98070 2.02770 0.07080  0.02850  -0.01270 190 U  A "O4'" 
1887 C  "C3'" . U  A 88  ? 1.72830 2.01860 2.05700 0.06940  0.01250  -0.01740 190 U  A "C3'" 
1888 O  "O3'" . U  A 88  ? 1.70380 2.01250 2.05370 0.06710  0.00810  -0.02350 190 U  A "O3'" 
1889 C  "C2'" . U  A 88  ? 1.74460 2.03310 2.07490 0.08010  0.00830  -0.01020 190 U  A "C2'" 
1890 O  "O2'" . U  A 88  ? 1.80940 2.10940 2.16570 0.08480  0.01010  -0.01230 190 U  A "O2'" 
1891 C  "C1'" . U  A 88  ? 1.69620 1.96510 2.00900 0.07950  0.01780  -0.00680 190 U  A "C1'" 
1892 N  N1    . U  A 88  ? 1.67320 1.93030 1.96030 0.07960  0.01310  -0.00110 190 U  A N1    
1893 C  C2    . U  A 88  ? 1.73280 1.98840 2.01520 0.08810  0.00550  0.00670  190 U  A C2    
1894 O  O2    . U  A 88  ? 1.77170 2.03440 2.07030 0.09550  0.00220  0.00940  190 U  A O2    
1895 N  N3    . U  A 88  ? 1.73220 1.97770 1.99080 0.08780  0.00200  0.01180  190 U  A N3    
1896 C  C4    . U  A 88  ? 1.67990 1.91700 1.92000 0.08030  0.00500  0.00920  190 U  A C4    
1897 O  O4    . U  A 88  ? 1.70530 1.93460 1.92560 0.08130  0.00140  0.01410  190 U  A O4    
1898 C  C5    . U  A 88  ? 1.63320 1.87180 1.87980 0.07210  0.01230  0.00120  190 U  A C5    
1899 C  C6    . U  A 88  ? 1.65030 1.89870 1.91930 0.07190  0.01620  -0.00330 190 U  A C6    
1900 P  P     . G  A 89  ? 1.73766 2.05526 2.08346 0.06380  -0.00350 -0.02630 191 G  A P     
1901 O  OP1   . G  A 89  ? 1.77166 2.10726 2.14306 0.05970  -0.00440 -0.03400 191 G  A OP1   
1902 O  OP2   . G  A 89  ? 1.69816 2.00076 2.01876 0.05770  -0.00130 -0.02590 191 G  A OP2   
1903 O  "O5'" . G  A 89  ? 1.68356 2.00656 2.02606 0.07410  -0.01650 -0.01980 191 G  A "O5'" 
1904 C  "C5'" . G  A 89  ? 1.76626 2.10206 2.13006 0.08230  -0.02080 -0.01810 191 G  A "C5'" 
1905 C  "C4'" . G  A 89  ? 1.73266 2.06506 2.08646 0.09250  -0.02920 -0.00860 191 G  A "C4'" 
1906 O  "O4'" . G  A 89  ? 1.66576 1.97766 1.99776 0.09320  -0.02240 -0.00240 191 G  A "O4'" 
1907 C  "C3'" . G  A 89  ? 1.74516 2.08456 2.08676 0.09480  -0.04310 -0.00620 191 G  A "C3'" 
1908 O  "O3'" . G  A 89  ? 1.71446 2.07506 2.07666 0.09790  -0.05340 -0.00970 191 G  A "O3'" 
1909 C  "C2'" . G  A 89  ? 1.78976 2.11756 2.11466 0.10320  -0.04570 0.00500  191 G  A "C2'" 
1910 O  "O2'" . G  A 89  ? 1.81336 2.14956 2.15576 0.11300  -0.05070 0.01010  191 G  A "O2'" 
1911 C  "C1'" . G  A 89  ? 1.76206 2.07056 2.07806 0.09980  -0.03160 0.00610  191 G  A "C1'" 
1912 N  N9    . G  A 89  ? 1.81646 2.11006 2.10446 0.09500  -0.02920 0.00800  191 G  A N9    
1913 C  C8    . G  A 89  ? 1.76106 2.04696 2.03846 0.08560  -0.02240 0.00210  191 G  A C8    
1914 N  N7    . G  A 89  ? 1.80086 2.07426 2.05366 0.08430  -0.02240 0.00590  191 G  A N7    
1915 C  C5    . G  A 89  ? 1.82046 2.09346 2.06686 0.09300  -0.02930 0.01500  191 G  A C5    
1916 C  C6    . G  A 89  ? 1.83826 2.10106 2.06126 0.09580  -0.03200 0.02270  191 G  A C6    
1917 O  O6    . G  A 89  ? 1.85316 2.10526 2.05596 0.09110  -0.02890 0.02230  191 G  A O6    
1918 N  N1    . G  A 89  ? 1.79886 2.06506 2.02386 0.10520  -0.03900 0.03170  191 G  A N1    
1919 C  C2    . G  A 89  ? 1.81556 2.09336 2.06276 0.11160  -0.04330 0.03310  191 G  A C2    
1920 N  N2    . G  A 89  ? 1.84606 2.12466 2.09146 0.12070  -0.05020 0.04330  191 G  A N2    
1921 N  N3    . G  A 89  ? 1.85876 2.14666 2.12856 0.10940  -0.04100 0.02540  191 G  A N3    
1922 C  C4    . G  A 89  ? 1.83806 2.12296 2.10586 0.09980  -0.03380 0.01670  191 G  A C4    
1923 P  P     . A  A 90  ? 1.78058 2.15398 2.13648 0.09560  -0.06660 -0.01370 192 A  A P     
1924 O  OP1   . A  A 90  ? 1.87618 2.27198 2.26048 0.09890  -0.07450 -0.01800 192 A  A OP1   
1925 O  OP2   . A  A 90  ? 1.75098 2.11718 2.09388 0.08490  -0.06200 -0.02060 192 A  A OP2   
1926 O  "O5'" . A  A 90  ? 1.71868 2.08638 2.05098 0.10350  -0.07560 -0.00340 192 A  A "O5'" 
1927 C  "C5'" . A  A 90  ? 1.78198 2.16068 2.12368 0.11410  -0.08570 0.00340  192 A  A "C5'" 
1928 C  "C4'" . A  A 90  ? 1.80738 2.17388 2.12708 0.12160  -0.08830 0.01580  192 A  A "C4'" 
1929 O  "O4'" . A  A 90  ? 1.81838 2.16338 2.12628 0.11910  -0.07510 0.01930  192 A  A "O4'" 
1930 C  "C3'" . A  A 90  ? 1.78058 2.14668 2.07378 0.12090  -0.09670 0.01800  192 A  A "C3'" 
1931 O  "O3'" . A  A 90  ? 1.79738 2.18338 2.09548 0.12520  -0.11160 0.01710  192 A  A "O3'" 
1932 C  "C2'" . A  A 90  ? 1.83078 2.17938 2.10518 0.12630  -0.09280 0.03040  192 A  A "C2'" 
1933 O  "O2'" . A  A 90  ? 1.71228 2.06528 1.99338 0.13730  -0.09970 0.04100  192 A  A "O2'" 
1934 C  "C1'" . A  A 90  ? 1.89488 2.22798 2.17508 0.12120  -0.07720 0.02760  192 A  A "C1'" 
1935 N  N9    . A  A 90  ? 1.84918 2.16958 2.10978 0.11200  -0.06980 0.02300  192 A  A N9    
1936 C  C8    . A  A 90  ? 1.79698 2.11758 2.06118 0.10230  -0.06400 0.01230  192 A  A C8    
1937 N  N7    . A  A 90  ? 1.79328 2.10158 2.03608 0.09630  -0.05950 0.01090  192 A  A N7    
1938 C  C5    . A  A 90  ? 1.83938 2.13948 2.06288 0.10220  -0.06240 0.02100  192 A  A C5    
1939 C  C6    . A  A 90  ? 1.84808 2.13518 2.04538 0.10030  -0.06020 0.02460  192 A  A C6    
1940 N  N6    . A  A 90  ? 1.79708 2.07668 1.98338 0.09200  -0.05470 0.01790  192 A  A N6    
1941 N  N1    . A  A 90  ? 1.91318 2.19538 2.09678 0.10730  -0.06350 0.03560  192 A  A N1    
1942 C  C2    . A  A 90  ? 1.93968 2.22938 2.13528 0.11600  -0.06950 0.04290  192 A  A C2    
1943 N  N3    . A  A 90  ? 1.89808 2.19978 2.11878 0.11920  -0.07240 0.04040  192 A  A N3    
1944 C  C4    . A  A 90  ? 1.85678 2.16398 2.09048 0.11170  -0.06870 0.02880  192 A  A C4    
1945 P  P     . C  A 91  ? 1.89055 2.28955 2.18605 0.11760  -0.11860 0.00510  193 C  A P     
1946 O  OP1   . C  A 91  ? 1.92505 2.34785 2.24105 0.12200  -0.13160 0.00160  193 C  A OP1   
1947 O  OP2   . C  A 91  ? 1.87415 2.26355 2.17235 0.10650  -0.10660 -0.00430 193 C  A OP2   
1948 O  "O5'" . C  A 91  ? 1.75465 2.14795 2.01735 0.11880  -0.12440 0.01000  193 C  A "O5'" 
1949 C  "C5'" . C  A 91  ? 1.75605 2.15035 2.00625 0.12880  -0.13220 0.02260  193 C  A "C5'" 
1950 C  "C4'" . C  A 91  ? 1.80305 2.18245 2.02125 0.12790  -0.12930 0.02850  193 C  A "C4'" 
1951 O  "O4'" . C  A 91  ? 1.86815 2.22605 2.08175 0.12430  -0.11450 0.03140  193 C  A "O4'" 
1952 C  "C3'" . C  A 91  ? 1.78285 2.16445 1.98435 0.12020  -0.13160 0.01870  193 C  A "C3'" 
1953 O  "O3'" . C  A 91  ? 1.83545 2.23495 2.03025 0.12380  -0.14620 0.01710  193 C  A "O3'" 
1954 C  "C2'" . C  A 91  ? 1.79575 2.15665 1.97175 0.11820  -0.12230 0.02460  193 C  A "C2'" 
1955 O  "O2'" . C  A 91  ? 1.72365 2.08425 1.87995 0.12590  -0.12830 0.03660  193 C  A "O2'" 
1956 C  "C1'" . C  A 91  ? 1.82765 2.17415 2.01675 0.11830  -0.10990 0.02910  193 C  A "C1'" 
1957 N  N1    . C  A 91  ? 1.77125 2.10905 1.96715 0.10840  -0.09900 0.01890  193 C  A N1    
1958 C  C2    . C  A 91  ? 1.80895 2.13035 1.98445 0.10270  -0.09060 0.01820  193 C  A C2    
1959 O  O2    . C  A 91  ? 1.83075 2.14585 1.98395 0.10590  -0.09220 0.02560  193 C  A O2    
1960 N  N3    . C  A 91  ? 1.82195 2.13505 2.00255 0.09410  -0.08100 0.00990  193 C  A N3    
1961 C  C4    . C  A 91  ? 1.77055 2.09115 1.97515 0.09050  -0.07890 0.00260  193 C  A C4    
1962 N  N4    . C  A 91  ? 1.75015 2.06185 1.95795 0.08190  -0.06900 -0.00440 193 C  A N4    
1963 C  C5    . C  A 91  ? 1.77155 2.10925 1.99805 0.09580  -0.08670 0.00260  193 C  A C5    
1964 C  C6    . C  A 91  ? 1.79615 2.14185 2.01765 0.10480  -0.09680 0.01070  193 C  A C6    
1965 P  P     . G  A 92  ? 1.93052 2.34302 2.12762 0.11590  -0.15230 0.00110  194 G  A P     
1966 O  OP1   . G  A 92  ? 1.87352 2.30732 2.06832 0.12210  -0.16870 0.00110  194 G  A OP1   
1967 O  OP2   . G  A 92  ? 1.80932 2.22192 2.03232 0.10860  -0.14500 -0.00880 194 G  A OP2   
1968 O  "O5'" . G  A 92  ? 1.76452 2.16262 1.93322 0.11010  -0.14640 -0.00120 194 G  A "O5'" 
1969 C  "C5'" . G  A 92  ? 1.72992 2.12562 1.87092 0.11540  -0.15060 0.00740  194 G  A "C5'" 
1970 C  "C4'" . G  A 92  ? 1.74032 2.11762 1.85912 0.10980  -0.14050 0.00680  194 G  A "C4'" 
1971 O  "O4'" . G  A 92  ? 1.81932 2.17782 1.94422 0.10770  -0.12670 0.01180  194 G  A "O4'" 
1972 C  "C3'" . G  A 92  ? 1.75072 2.12792 1.86752 0.10020  -0.13890 -0.00840 194 G  A "C3'" 
1973 O  "O3'" . G  A 92  ? 1.83782 2.22852 1.94052 0.10070  -0.14990 -0.01470 194 G  A "O3'" 
1974 C  "C2'" . G  A 92  ? 1.78322 2.13812 1.88602 0.09580  -0.12520 -0.00570 194 G  A "C2'" 
1975 O  "O2'" . G  A 92  ? 1.82722 2.17742 1.90242 0.09940  -0.12610 0.00130  194 G  A "O2'" 
1976 C  "C1'" . G  A 92  ? 1.80892 2.15412 1.92492 0.09920  -0.11730 0.00440  194 G  A "C1'" 
1977 N  N9    . G  A 92  ? 1.73322 2.07472 1.87192 0.09260  -0.10980 -0.00330 194 G  A N9    
1978 C  C8    . G  A 92  ? 1.74432 2.09452 1.90952 0.09380  -0.11070 -0.00450 194 G  A C8    
1979 N  N7    . G  A 92  ? 1.75702 2.10122 1.93662 0.08640  -0.10190 -0.01170 194 G  A N7    
1980 C  C5    . G  A 92  ? 1.77042 2.10092 1.93222 0.08020  -0.09530 -0.01520 194 G  A C5    
1981 C  C6    . G  A 92  ? 1.70982 2.02862 1.87522 0.07130  -0.08500 -0.02220 194 G  A C6    
1982 O  O6    . G  A 92  ? 1.66312 1.98172 1.84822 0.06660  -0.07900 -0.02660 194 G  A O6    
1983 N  N1    . G  A 92  ? 1.68392 1.99092 1.82702 0.06800  -0.08170 -0.02340 194 G  A N1    
1984 C  C2    . G  A 92  ? 1.72022 2.02712 1.84042 0.07240  -0.08690 -0.01900 194 G  A C2    
1985 N  N2    . G  A 92  ? 1.69892 1.99412 1.80082 0.06840  -0.08220 -0.02150 194 G  A N2    
1986 N  N3    . G  A 92  ? 1.74882 2.06662 1.86452 0.08040  -0.09600 -0.01220 194 G  A N3    
1987 C  C4    . G  A 92  ? 1.73202 2.06092 1.86912 0.08400  -0.10000 -0.01050 194 G  A C4    
1988 P  P     . G  A 93  ? 1.96584 2.36814 2.08014 0.09290  -0.15530 -0.03280 195 G  A P     
1989 O  OP1   . G  A 93  ? 1.91234 2.33014 2.00994 0.09600  -0.16820 -0.03700 195 G  A OP1   
1990 O  OP2   . G  A 93  ? 1.76244 2.17264 1.90834 0.09090  -0.15580 -0.03720 195 G  A OP2   
1991 O  "O5'" . G  A 93  ? 1.72484 2.10844 1.83074 0.08390  -0.14330 -0.03960 195 G  A "O5'" 
1992 C  "C5'" . G  A 93  ? 1.78734 2.16224 1.86544 0.08390  -0.14100 -0.03840 195 G  A "C5'" 
1993 C  "C4'" . G  A 93  ? 1.77724 2.13284 1.85214 0.07610  -0.12830 -0.04290 195 G  A "C4'" 
1994 O  "O4'" . G  A 93  ? 1.73914 2.08124 1.82584 0.07560  -0.11750 -0.03490 195 G  A "O4'" 
1995 C  "C3'" . G  A 93  ? 1.77964 2.13644 1.86794 0.06690  -0.12800 -0.05870 195 G  A "C3'" 
1996 O  "O3'" . G  A 93  ? 1.80014 2.16324 1.87434 0.06500  -0.13450 -0.06890 195 G  A "O3'" 
1997 C  "C2'" . G  A 93  ? 1.67384 2.00954 1.76474 0.06130  -0.11340 -0.05690 195 G  A "C2'" 
1998 O  "O2'" . G  A 93  ? 1.72164 2.04464 1.78904 0.06060  -0.10830 -0.05580 195 G  A "O2'" 
1999 C  "C1'" . G  A 93  ? 1.66064 1.99154 1.75704 0.06690  -0.10850 -0.04310 195 G  A "C1'" 
2000 N  N9    . G  A 93  ? 1.71424 2.04984 1.83844 0.06460  -0.10690 -0.04520 195 G  A N9    
2001 C  C8    . G  A 93  ? 1.67544 2.02594 1.81624 0.06950  -0.11400 -0.04230 195 G  A C8    
2002 N  N7    . G  A 93  ? 1.61654 1.96844 1.78174 0.06560  -0.10970 -0.04580 195 G  A N7    
2003 C  C5    . G  A 93  ? 1.69764 2.03414 1.86114 0.05750  -0.09910 -0.05070 195 G  A C5    
2004 C  C6    . G  A 93  ? 1.65584 1.98654 1.83834 0.05020  -0.09010 -0.05520 195 G  A C6    
2005 O  O6    . G  A 93  ? 1.58834 1.92694 1.79424 0.04930  -0.08920 -0.05640 195 G  A O6    
2006 N  N1    . G  A 93  ? 1.61284 1.92704 1.78484 0.04370  -0.08140 -0.05820 195 G  A N1    
2007 C  C2    . G  A 93  ? 1.64874 1.95364 1.79644 0.04410  -0.08120 -0.05770 195 G  A C2    
2008 N  N2    . G  A 93  ? 1.60254 1.89204 1.74474 0.03760  -0.07240 -0.06090 195 G  A N2    
2009 N  N3    . G  A 93  ? 1.76204 2.07264 1.89224 0.05060  -0.08890 -0.05400 195 G  A N3    
2010 C  C4    . G  A 93  ? 1.75134 2.07764 1.89014 0.05690  -0.09760 -0.05040 195 G  A C4    
2011 P  P     . A  A 94  ? 1.79520 2.16770 1.88540 0.05740  -0.14020 -0.08670 196 A  A P     
2012 O  OP1   . A  A 94  ? 1.68530 2.06690 1.75680 0.05830  -0.14880 -0.09520 196 A  A OP1   
2013 O  OP2   . A  A 94  ? 1.70750 2.09380 1.82450 0.05750  -0.14570 -0.08820 196 A  A OP2   
2014 O  "O5'" . A  A 94  ? 1.77500 2.12780 1.87100 0.04860  -0.12740 -0.09150 196 A  A "O5'" 
2015 C  "C5'" . A  A 94  ? 1.73250 2.07060 1.80800 0.04680  -0.12100 -0.09240 196 A  A "C5'" 
2016 C  "C4'" . A  A 94  ? 1.72860 2.04890 1.81390 0.03910  -0.10920 -0.09510 196 A  A "C4'" 
2017 O  "O4'" . A  A 94  ? 1.72600 2.03830 1.82150 0.04010  -0.10100 -0.08400 196 A  A "O4'" 
2018 C  "C3'" . A  A 94  ? 1.70700 2.03070 1.81420 0.03070  -0.11080 -0.10850 196 A  A "C3'" 
2019 O  "O3'" . A  A 94  ? 1.73150 2.05480 1.83080 0.02690  -0.11430 -0.12100 196 A  A "O3'" 
2020 C  "C2'" . A  A 94  ? 1.71300 2.02040 1.83260 0.02560  -0.09810 -0.10400 196 A  A "C2'" 
2021 O  "O2'" . A  A 94  ? 1.74050 2.02980 1.84670 0.02240  -0.08980 -0.10460 196 A  A "O2'" 
2022 C  "C1'" . A  A 94  ? 1.68120 1.98730 1.79730 0.03240  -0.09460 -0.08920 196 A  A "C1'" 
2023 N  N9    . A  A 94  ? 1.63180 1.95020 1.77060 0.03340  -0.09760 -0.08750 196 A  A N9    
2024 C  C8    . A  A 94  ? 1.65380 1.98870 1.79550 0.04040  -0.10700 -0.08360 196 A  A C8    
2025 N  N7    . A  A 94  ? 1.60740 1.95090 1.77260 0.03990  -0.10750 -0.08310 196 A  A N7    
2026 C  C5    . A  A 94  ? 1.64690 1.97870 1.82480 0.03170  -0.09730 -0.08680 196 A  A C5    
2027 C  C6    . A  A 94  ? 1.63220 1.96580 1.83540 0.02710  -0.09190 -0.08800 196 A  A C6    
2028 N  N6    . A  A 94  ? 1.63130 1.98000 1.85350 0.03040  -0.09650 -0.08650 196 A  A N6    
2029 N  N1    . A  A 94  ? 1.59150 1.91120 1.80000 0.01910  -0.08140 -0.09080 196 A  A N1    
2030 C  C2    . A  A 94  ? 1.61000 1.91470 1.80040 0.01630  -0.07720 -0.09230 196 A  A C2    
2031 N  N3    . A  A 94  ? 1.66240 1.96400 1.82950 0.02020  -0.08140 -0.09190 196 A  A N3    
2032 C  C4    . A  A 94  ? 1.65400 1.97000 1.81560 0.02780  -0.09130 -0.08910 196 A  A C4    
2033 P  P     . C  A 95  ? 1.78225 2.12465 1.89225 0.02460  -0.12720 -0.13600 197 C  A P     
2034 O  OP1   . C  A 95  ? 1.73635 2.07945 1.82555 0.02550  -0.13160 -0.14440 197 C  A OP1   
2035 O  OP2   . C  A 95  ? 1.70335 2.06455 1.82275 0.02990  -0.13610 -0.13170 197 C  A OP2   
2036 O  "O5'" . C  A 95  ? 1.72785 2.06405 1.86355 0.01440  -0.12260 -0.14550 197 C  A "O5'" 
2037 C  "C5'" . C  A 95  ? 1.73135 2.04885 1.86465 0.00820  -0.11360 -0.14950 197 C  A "C5'" 
2038 C  "C4'" . C  A 95  ? 1.77055 2.07885 1.92755 0.00050  -0.10520 -0.14940 197 C  A "C4'" 
2039 O  "O4'" . C  A 95  ? 1.77665 2.08215 1.93775 0.00360  -0.09860 -0.13560 197 C  A "O4'" 
2040 C  "C3'" . C  A 95  ? 1.74465 2.06605 1.92885 -0.00570 -0.11130 -0.16040 197 C  A "C3'" 
2041 O  "O3'" . C  A 95  ? 1.76825 2.08625 1.95695 -0.01240 -0.11360 -0.17460 197 C  A "O3'" 
2042 C  "C2'" . C  A 95  ? 1.65255 1.96705 1.85625 -0.01000 -0.10130 -0.15300 197 C  A "C2'" 
2043 O  "O2'" . C  A 95  ? 1.53535 1.83135 1.74315 -0.01750 -0.09150 -0.15500 197 C  A "O2'" 
2044 C  "C1'" . C  A 95  ? 1.67165 1.98055 1.85965 -0.00220 -0.09580 -0.13740 197 C  A "C1'" 
2045 N  N1    . C  A 95  ? 1.64625 1.97115 1.84395 0.00320  -0.10070 -0.13140 197 C  A N1    
2046 C  C2    . C  A 95  ? 1.61685 1.94515 1.83905 -0.00030 -0.09610 -0.12930 197 C  A C2    
2047 O  O2    . C  A 95  ? 1.61855 1.93655 1.85335 -0.00840 -0.08770 -0.13190 197 C  A O2    
2048 N  N3    . C  A 95  ? 1.66425 2.00735 1.89605 0.00530  -0.10070 -0.12400 197 C  A N3    
2049 C  C4    . C  A 95  ? 1.62795 1.98135 1.84545 0.01410  -0.10980 -0.12020 197 C  A C4    
2050 N  N4    . C  A 95  ? 1.66655 2.03395 1.89515 0.01980  -0.11440 -0.11470 197 C  A N4    
2051 C  C5    . C  A 95  ? 1.66365 2.01375 1.85515 0.01760  -0.11440 -0.12150 197 C  A C5    
2052 C  C6    . C  A 95  ? 1.69265 2.02865 1.87525 0.01200  -0.10940 -0.12750 197 C  A C6    
2053 P  P     . A  A 96  ? 1.81890 2.15310 2.00200 -0.01090 -0.12750 -0.18900 198 A  A P     
2054 O  OP1   . A  A 96  ? 1.82300 2.15070 1.97660 -0.00550 -0.12760 -0.18790 198 A  A OP1   
2055 O  OP2   . A  A 96  ? 1.76720 2.12420 1.96150 -0.00750 -0.13800 -0.18960 198 A  A OP2   
2056 O  "O5'" . A  A 96  ? 1.72660 2.05580 1.92930 -0.02130 -0.12740 -0.20420 198 A  A "O5'" 
2057 C  "C5'" . A  A 96  ? 1.70260 2.01010 1.90170 -0.02630 -0.11800 -0.20580 198 A  A "C5'" 
2058 C  "C4'" . A  A 96  ? 1.78840 2.08970 2.01540 -0.03680 -0.11410 -0.21290 198 A  A "C4'" 
2059 O  "O4'" . A  A 96  ? 1.72980 2.03090 1.97290 -0.03870 -0.10710 -0.20200 198 A  A "O4'" 
2060 C  "C3'" . A  A 96  ? 1.80000 2.11730 2.04640 -0.04190 -0.12510 -0.22980 198 A  A "C3'" 
2061 O  "O3'" . A  A 96  ? 1.90550 2.20970 2.16930 -0.05160 -0.12040 -0.23850 198 A  A "O3'" 
2062 C  "C2'" . A  A 96  ? 1.74410 2.07710 2.01110 -0.04230 -0.12740 -0.22510 198 A  A "C2'" 
2063 O  "O2'" . A  A 96  ? 1.64420 1.98870 1.93920 -0.05000 -0.13330 -0.23790 198 A  A "O2'" 
2064 C  "C1'" . A  A 96  ? 1.73460 2.05100 2.00500 -0.04420 -0.11300 -0.21030 198 A  A "C1'" 
2065 N  N9    . A  A 96  ? 1.66510 1.99250 1.94470 -0.04090 -0.11180 -0.19990 198 A  A N9    
2066 C  C8    . A  A 96  ? 1.65740 1.99180 1.92180 -0.03130 -0.11370 -0.18890 198 A  A C8    
2067 N  N7    . A  A 96  ? 1.58350 1.92670 1.86400 -0.03070 -0.11170 -0.18210 198 A  A N7    
2068 C  C5    . A  A 96  ? 1.56800 1.91060 1.87560 -0.04060 -0.10810 -0.18880 198 A  A C5    
2069 C  C6    . A  A 96  ? 1.60900 1.95920 1.94370 -0.04520 -0.10420 -0.18680 198 A  A C6    
2070 N  N6    . A  A 96  ? 1.61830 1.97870 1.95770 -0.03960 -0.10350 -0.17760 198 A  A N6    
2071 N  N1    . A  A 96  ? 1.62750 1.97450 1.98540 -0.05580 -0.10050 -0.19480 198 A  A N1    
2072 C  C2    . A  A 96  ? 1.62620 1.96220 1.98060 -0.06120 -0.10120 -0.20410 198 A  A C2    
2073 N  N3    . A  A 96  ? 1.60660 1.93460 1.93700 -0.05740 -0.10500 -0.20760 198 A  A N3    
2074 C  C4    . A  A 96  ? 1.59450 1.92680 1.90190 -0.04710 -0.10810 -0.19940 198 A  A C4    
2075 P  P     . U  A 97  ? 1.98207 2.27097 2.23337 -0.05320 -0.11940 -0.24820 199 U  A P     
2076 O  OP1   . U  A 97  ? 1.94987 2.24407 2.17137 -0.04380 -0.12480 -0.24800 199 U  A OP1   
2077 O  OP2   . U  A 97  ? 2.03537 2.32667 2.31007 -0.06210 -0.12440 -0.26510 199 U  A OP2   
2078 O  "O5'" . U  A 97  ? 2.08967 2.35307 2.33837 -0.05590 -0.10450 -0.23590 199 U  A "O5'" 
2079 C  "C5'" . U  A 97  ? 2.09277 2.33687 2.34107 -0.06040 -0.09940 -0.24160 199 U  A "C5'" 
2080 C  "C4'" . U  A 97  ? 2.13427 2.35777 2.37127 -0.05910 -0.08660 -0.22650 199 U  A "C4'" 
2081 O  "O4'" . U  A 97  ? 2.23167 2.43777 2.46117 -0.06040 -0.08350 -0.23230 199 U  A "O4'" 
2082 C  "C3'" . U  A 97  ? 2.12257 2.34907 2.33507 -0.04950 -0.08480 -0.21330 199 U  A "C3'" 
2083 O  "O3'" . U  A 97  ? 1.96837 2.19007 2.18477 -0.04960 -0.07590 -0.19810 199 U  A "O3'" 
2084 C  "C2'" . U  A 97  ? 2.24457 2.45677 2.43387 -0.04520 -0.08150 -0.21290 199 U  A "C2'" 
2085 O  "O2'" . U  A 97  ? 2.17647 2.37597 2.35177 -0.04150 -0.07180 -0.19750 199 U  A "O2'" 
2086 C  "C1'" . U  A 97  ? 2.30777 2.50617 2.51037 -0.05260 -0.07990 -0.22420 199 U  A "C1'" 
2087 N  N1    . U  A 97  ? 2.35127 2.55147 2.54137 -0.04980 -0.08650 -0.23770 199 U  A N1    
2088 C  C2    . U  A 97  ? 2.37617 2.59747 2.56237 -0.04660 -0.09830 -0.24830 199 U  A C2    
2089 O  O2    . U  A 97  ? 2.29047 2.52917 2.48357 -0.04590 -0.10420 -0.24730 199 U  A O2    
2090 N  N3    . U  A 97  ? 2.47927 2.70177 2.65287 -0.04390 -0.10360 -0.26110 199 U  A N3    
2091 C  C4    . U  A 97  ? 2.49157 2.69707 2.65707 -0.04380 -0.09860 -0.26480 199 U  A C4    
2092 O  O4    . U  A 97  ? 2.48207 2.69237 2.63667 -0.04100 -0.10440 -0.27760 199 U  A O4    
2093 C  C5    . U  A 97  ? 2.40287 2.58707 2.57377 -0.04690 -0.08710 -0.25310 199 U  A C5    
2094 C  C6    . U  A 97  ? 2.34237 2.52467 2.52437 -0.04970 -0.08160 -0.24020 199 U  A C6    
2095 P  P     . G  A 98  ? 2.14520 2.35160 2.38060 -0.05800 -0.06500 -0.19240 200 G  A P     
2096 O  OP1   . G  A 98  ? 2.12750 2.31260 2.35460 -0.05980 -0.05890 -0.19280 200 G  A OP1   
2097 O  OP2   . G  A 98  ? 2.09290 2.31000 2.35690 -0.06570 -0.06830 -0.20000 200 G  A OP2   
2098 O  "O5'" . G  A 98  ? 1.91900 2.12460 2.14670 -0.05350 -0.05740 -0.17540 200 G  A "O5'" 
2099 C  "C5'" . G  A 98  ? 1.75680 1.96060 1.95880 -0.04460 -0.05660 -0.16700 200 G  A "C5'" 
2100 C  "C4'" . G  A 98  ? 1.62260 1.84620 1.81840 -0.03760 -0.06500 -0.16590 200 G  A "C4'" 
2101 O  "O4'" . G  A 98  ? 1.65110 1.89230 1.86500 -0.04080 -0.07470 -0.17750 200 G  A "O4'" 
2102 C  "C3'" . G  A 98  ? 1.57100 1.79900 1.76830 -0.03420 -0.06030 -0.15270 200 G  A "C3'" 
2103 O  "O3'" . G  A 98  ? 1.50100 1.71860 1.67710 -0.02830 -0.05410 -0.14140 200 G  A "O3'" 
2104 C  "C2'" . G  A 98  ? 1.58960 1.84030 1.79150 -0.03000 -0.07130 -0.15650 200 G  A "C2'" 
2105 O  "O2'" . G  A 98  ? 1.55240 1.80820 1.73080 -0.02160 -0.07720 -0.15510 200 G  A "O2'" 
2106 C  "C1'" . G  A 98  ? 1.65080 1.90880 1.86950 -0.03660 -0.07870 -0.17210 200 G  A "C1'" 
2107 N  N9    . G  A 98  ? 1.64600 1.91000 1.89340 -0.04380 -0.07690 -0.17410 200 G  A N9    
2108 C  C8    . G  A 98  ? 1.67120 1.92810 1.93780 -0.05340 -0.07390 -0.18170 200 G  A C8    
2109 N  N7    . G  A 98  ? 1.60270 1.86780 1.89380 -0.05860 -0.07210 -0.18150 200 G  A N7    
2110 C  C5    . G  A 98  ? 1.58700 1.86560 1.87510 -0.05170 -0.07440 -0.17380 200 G  A C5    
2111 C  C6    . G  A 98  ? 1.55720 1.84960 1.86610 -0.05280 -0.07370 -0.17060 200 G  A C6    
2112 O  O6    . G  A 98  ? 1.56570 1.86160 1.90000 -0.06070 -0.07060 -0.17410 200 G  A O6    
2113 N  N1    . G  A 98  ? 1.51120 1.81390 1.80980 -0.04360 -0.07690 -0.16250 200 G  A N1    
2114 C  C2    . G  A 98  ? 1.53870 1.83850 1.81010 -0.03480 -0.08000 -0.15760 200 G  A C2    
2115 N  N2    . G  A 98  ? 1.55010 1.86020 1.81640 -0.02680 -0.08260 -0.14930 200 G  A N2    
2116 N  N3    . G  A 98  ? 1.56860 1.85630 1.82030 -0.03400 -0.08020 -0.16040 200 G  A N3    
2117 C  C4    . G  A 98  ? 1.58270 1.86030 1.84400 -0.04250 -0.07750 -0.16880 200 G  A C4    
2118 P  P     . G  A 99  ? 1.48994 1.69694 1.66884 -0.02910 -0.04230 -0.12810 201 G  A P     
2119 O  OP1   . G  A 99  ? 1.73394 1.92794 1.88934 -0.02390 -0.03710 -0.12000 201 G  A OP1   
2120 O  OP2   . G  A 99  ? 1.42984 1.62964 1.62894 -0.03830 -0.03630 -0.13050 201 G  A OP2   
2121 O  "O5'" . G  A 99  ? 1.49684 1.72034 1.68294 -0.02470 -0.04530 -0.12260 201 G  A "O5'" 
2122 C  "C5'" . G  A 99  ? 1.51874 1.75354 1.69104 -0.01630 -0.05290 -0.12050 201 G  A "C5'" 
2123 C  "C4'" . G  A 99  ? 1.49844 1.74734 1.68214 -0.01290 -0.05480 -0.11490 201 G  A "C4'" 
2124 O  "O4'" . G  A 99  ? 1.54524 1.81024 1.75054 -0.01660 -0.06240 -0.12440 201 G  A "O4'" 
2125 C  "C3'" . G  A 99  ? 1.46064 1.70254 1.65404 -0.01480 -0.04390 -0.10590 201 G  A "C3'" 
2126 O  "O3'" . G  A 99  ? 1.43904 1.67054 1.61464 -0.00930 -0.03770 -0.09500 201 G  A "O3'" 
2127 C  "C2'" . G  A 99  ? 1.48604 1.74624 1.69984 -0.01400 -0.04860 -0.10670 201 G  A "C2'" 
2128 O  "O2'" . G  A 99  ? 1.53904 1.80844 1.74344 -0.00480 -0.05380 -0.10040 201 G  A "O2'" 
2129 C  "C1'" . G  A 99  ? 1.47754 1.74924 1.70214 -0.01790 -0.05860 -0.11980 201 G  A "C1'" 
2130 N  N9    . G  A 99  ? 1.46044 1.72904 1.70654 -0.02790 -0.05390 -0.12600 201 G  A N9    
2131 C  C8    . G  A 99  ? 1.46194 1.71904 1.70844 -0.03470 -0.05190 -0.13300 201 G  A C8    
2132 N  N7    . G  A 99  ? 1.50314 1.75954 1.77174 -0.04320 -0.04740 -0.13640 201 G  A N7    
2133 C  C5    . G  A 99  ? 1.48434 1.75344 1.76794 -0.04180 -0.04610 -0.13180 201 G  A C5    
2134 C  C6    . G  A 99  ? 1.45194 1.72714 1.76184 -0.04860 -0.04100 -0.13260 201 G  A C6    
2135 O  O6    . G  A 99  ? 1.46264 1.73254 1.78804 -0.05770 -0.03650 -0.13710 201 G  A O6    
2136 N  N1    . G  A 99  ? 1.44734 1.73604 1.76564 -0.04370 -0.04130 -0.12730 201 G  A N1    
2137 C  C2    . G  A 99  ? 1.46054 1.75514 1.76424 -0.03360 -0.04600 -0.12140 201 G  A C2    
2138 N  N2    . G  A 99  ? 1.50904 1.81614 1.82564 -0.02990 -0.04550 -0.11700 201 G  A N2    
2139 N  N3    . G  A 99  ? 1.44814 1.73674 1.72724 -0.02750 -0.05060 -0.11990 201 G  A N3    
2140 C  C4    . G  A 99  ? 1.48064 1.75704 1.75084 -0.03220 -0.05030 -0.12550 201 G  A C4    
2141 P  P     . U  A 100 ? 1.34665 1.56005 1.52035 -0.01310 -0.02450 -0.08810 202 U  A P     
2142 O  OP1   . U  A 100 ? 1.44625 1.65165 1.60015 -0.00640 -0.02070 -0.07840 202 U  A OP1   
2143 O  OP2   . U  A 100 ? 1.29835 1.50065 1.47405 -0.02040 -0.02190 -0.09440 202 U  A OP2   
2144 O  "O5'" . U  A 100 ? 1.42785 1.64845 1.62365 -0.01600 -0.01960 -0.08540 202 U  A "O5'" 
2145 C  "C5'" . U  A 100 ? 1.43235 1.66475 1.63305 -0.00990 -0.02170 -0.08040 202 U  A "C5'" 
2146 C  "C4'" . U  A 100 ? 1.38985 1.63235 1.61605 -0.01400 -0.01880 -0.08180 202 U  A "C4'" 
2147 O  "O4'" . U  A 100 ? 1.38615 1.63955 1.62865 -0.01930 -0.02590 -0.09230 202 U  A "O4'" 
2148 C  "C3'" . U  A 100 ? 1.30905 1.54035 1.54215 -0.02040 -0.00620 -0.07850 202 U  A "C3'" 
2149 O  "O3'" . U  A 100 ? 1.25195 1.47725 1.47755 -0.01610 0.00150  -0.06930 202 U  A "O3'" 
2150 C  "C2'" . U  A 100 ? 1.32055 1.56495 1.58105 -0.02640 -0.00670 -0.08440 202 U  A "C2'" 
2151 O  "O2'" . U  A 100 ? 1.32315 1.58115 1.59605 -0.02190 -0.00700 -0.08130 202 U  A "O2'" 
2152 C  "C1'" . U  A 100 ? 1.39565 1.64985 1.65945 -0.02710 -0.01890 -0.09410 202 U  A "C1'" 
2153 N  N1    . U  A 100 ? 1.35675 1.60145 1.62275 -0.03540 -0.01760 -0.10080 202 U  A N1    
2154 C  C2    . U  A 100 ? 1.38405 1.63275 1.67355 -0.04400 -0.01400 -0.10520 202 U  A C2    
2155 O  O2    . U  A 100 ? 1.41665 1.67695 1.72455 -0.04490 -0.01170 -0.10420 202 U  A O2    
2156 N  N3    . U  A 100 ? 1.37965 1.61815 1.67135 -0.05150 -0.01280 -0.11090 202 U  A N3    
2157 C  C4    . U  A 100 ? 1.38945 1.61485 1.66285 -0.05090 -0.01510 -0.11320 202 U  A C4    
2158 O  O4    . U  A 100 ? 1.38625 1.60295 1.66555 -0.05800 -0.01370 -0.11850 202 U  A O4    
2159 C  C5    . U  A 100 ? 1.38195 1.60505 1.63135 -0.04170 -0.01860 -0.10870 202 U  A C5    
2160 C  C6    . U  A 100 ? 1.35055 1.58295 1.59705 -0.03470 -0.01960 -0.10250 202 U  A C6    
2161 P  P     . C  A 101 ? 1.29169 1.49789 1.50559 -0.01940 0.01330  -0.06360 203 C  A P     
2162 O  OP1   . C  A 101 ? 1.22759 1.42889 1.42789 -0.01240 0.01690  -0.05550 203 C  A OP1   
2163 O  OP2   . C  A 101 ? 1.33139 1.52629 1.53489 -0.02350 0.01190  -0.06750 203 C  A OP2   
2164 O  "O5'" . C  A 101 ? 1.34079 1.54979 1.57519 -0.02650 0.02200  -0.06390 203 C  A "O5'" 
2165 C  "C5'" . C  A 101 ? 1.30519 1.52769 1.55629 -0.02450 0.02370  -0.06280 203 C  A "C5'" 
2166 C  "C4'" . C  A 101 ? 1.28429 1.51199 1.55739 -0.03280 0.03010  -0.06570 203 C  A "C4'" 
2167 O  "O4'" . C  A 101 ? 1.29629 1.53339 1.58419 -0.03750 0.02230  -0.07420 203 C  A "O4'" 
2168 C  "C3'" . C  A 101 ? 1.27879 1.49129 1.54709 -0.04000 0.04090  -0.06270 203 C  A "C3'" 
2169 O  "O3'" . C  A 101 ? 1.21379 1.42019 1.47459 -0.03780 0.05080  -0.05550 203 C  A "O3'" 
2170 C  "C2'" . C  A 101 ? 1.32669 1.54769 1.61929 -0.04870 0.04270  -0.06800 203 C  A "C2'" 
2171 O  "O2'" . C  A 101 ? 1.35259 1.58529 1.66259 -0.04910 0.04890  -0.06660 203 C  A "O2'" 
2172 C  "C1'" . C  A 101 ? 1.28909 1.52239 1.58999 -0.04730 0.02950  -0.07620 203 C  A "C1'" 
2173 N  N1    . C  A 101 ? 1.31629 1.54039 1.61149 -0.05190 0.02500  -0.08140 203 C  A N1    
2174 C  C2    . C  A 101 ? 1.37079 1.59469 1.68359 -0.06160 0.02770  -0.08610 203 C  A C2    
2175 O  O2    . C  A 101 ? 1.41039 1.64239 1.74259 -0.06630 0.03400  -0.08550 203 C  A O2    
2176 N  N3    . C  A 101 ? 1.41789 1.63279 1.72699 -0.06590 0.02370  -0.09130 203 C  A N3    
2177 C  C4    . C  A 101 ? 1.42639 1.63359 1.71469 -0.06060 0.01740  -0.09220 203 C  A C4    
2178 N  N4    . C  A 101 ? 1.48949 1.68799 1.77549 -0.06470 0.01380  -0.09820 203 C  A N4    
2179 C  C5    . C  A 101 ? 1.39559 1.60349 1.66519 -0.05090 0.01480  -0.08710 203 C  A C5    
2180 C  C6    . C  A 101 ? 1.36689 1.58279 1.64089 -0.04700 0.01870  -0.08170 203 C  A C6    
2181 P  P     . C  A 102 ? 1.26492 1.45192 1.50832 -0.04120 0.05990  -0.04990 204 C  A P     
2182 O  OP1   . C  A 102 ? 1.36772 1.55202 1.60282 -0.03670 0.06750  -0.04370 204 C  A OP1   
2183 O  OP2   . C  A 102 ? 1.33502 1.51082 1.56182 -0.04040 0.05370  -0.05120 204 C  A OP2   
2184 O  "O5'" . C  A 102 ? 1.31202 1.49882 1.57152 -0.05140 0.06730  -0.05120 204 C  A "O5'" 
2185 C  "C5'" . C  A 102 ? 1.19222 1.39092 1.47132 -0.05440 0.07400  -0.05120 204 C  A "C5'" 
2186 C  "C4'" . C  A 102 ? 1.18092 1.37822 1.47432 -0.06480 0.08000  -0.05230 204 C  A "C4'" 
2187 O  "O4'" . C  A 102 ? 1.22132 1.42472 1.52862 -0.06850 0.07100  -0.06000 204 C  A "O4'" 
2188 C  "C3'" . C  A 102 ? 1.17452 1.35282 1.45302 -0.06950 0.08650  -0.04720 204 C  A "C3'" 
2189 O  "O3'" . C  A 102 ? 1.20122 1.37412 1.47052 -0.06930 0.09760  -0.04000 204 C  A "O3'" 
2190 C  "C2'" . C  A 102 ? 1.21092 1.39002 1.50782 -0.07930 0.08730  -0.05090 204 C  A "C2'" 
2191 O  "O2'" . C  A 102 ? 1.30292 1.49032 1.61712 -0.08520 0.09720  -0.04890 204 C  A "O2'" 
2192 C  "C1'" . C  A 102 ? 1.24212 1.43502 1.55272 -0.07740 0.07510  -0.06000 204 C  A "C1'" 
2193 N  N1    . C  A 102 ? 1.31852 1.50222 1.61892 -0.07680 0.06580  -0.06430 204 C  A N1    
2194 C  C2    . C  A 102 ? 1.36002 1.53702 1.66992 -0.08520 0.06580  -0.06780 204 C  A C2    
2195 O  O2    . C  A 102 ? 1.39302 1.57162 1.71942 -0.09320 0.07360  -0.06630 204 C  A O2    
2196 N  N3    . C  A 102 ? 1.35072 1.51952 1.65222 -0.08460 0.05750  -0.07270 204 C  A N3    
2197 C  C4    . C  A 102 ? 1.31842 1.48632 1.60192 -0.07610 0.04990  -0.07380 204 C  A C4    
2198 N  N4    . C  A 102 ? 1.38522 1.54582 1.66102 -0.07580 0.04250  -0.07920 204 C  A N4    
2199 C  C5    . C  A 102 ? 1.29312 1.46762 1.56662 -0.06780 0.04990  -0.06940 204 C  A C5    
2200 C  C6    . C  A 102 ? 1.29172 1.47362 1.57442 -0.06840 0.05770  -0.06500 204 C  A C6    
2201 P  P     . U  A 103 ? 1.24287 1.39677 1.48517 -0.06690 0.10080  -0.03340 205 U  A P     
2202 O  OP1   . U  A 103 ? 1.40107 1.55457 1.63727 -0.06600 0.11160  -0.02750 205 U  A OP1   
2203 O  OP2   . U  A 103 ? 1.34777 1.49757 1.57537 -0.05960 0.09070  -0.03540 205 U  A OP2   
2204 O  "O5'" . U  A 103 ? 1.26327 1.40487 1.50667 -0.07540 0.10330  -0.03200 205 U  A "O5'" 
2205 C  "C5'" . U  A 103 ? 1.32477 1.46817 1.58237 -0.08390 0.11260  -0.02950 205 U  A "C5'" 
2206 C  "C4'" . U  A 103 ? 1.34247 1.47577 1.60597 -0.09160 0.11170  -0.03020 205 U  A "C4'" 
2207 O  "O4'" . U  A 103 ? 1.31857 1.45917 1.59597 -0.09210 0.10100  -0.03930 205 U  A "O4'" 
2208 C  "C3'" . U  A 103 ? 1.37617 1.48997 1.61877 -0.09040 0.11040  -0.02600 205 U  A "C3'" 
2209 O  "O3'" . U  A 103 ? 1.37097 1.47477 1.60177 -0.09250 0.12060  -0.01680 205 U  A "O3'" 
2210 C  "C2'" . U  A 103 ? 1.42747 1.53637 1.68247 -0.09640 0.10490  -0.03120 205 U  A "C2'" 
2211 O  "O2'" . U  A 103 ? 1.50497 1.61057 1.77357 -0.10580 0.11340  -0.02740 205 U  A "O2'" 
2212 C  "C1'" . U  A 103 ? 1.32497 1.45157 1.59767 -0.09510 0.09670  -0.04080 205 U  A "C1'" 
2213 N  N1    . U  A 103 ? 1.33247 1.45877 1.59447 -0.08800 0.08500  -0.04670 205 U  A N1    
2214 C  C2    . U  A 103 ? 1.44707 1.56787 1.71367 -0.09100 0.07780  -0.05320 205 U  A C2    
2215 O  O2    . U  A 103 ? 1.47647 1.59207 1.75637 -0.09910 0.08050  -0.05410 205 U  A O2    
2216 N  N3    . U  A 103 ? 1.44057 1.56217 1.69607 -0.08420 0.06750  -0.05860 205 U  A N3    
2217 C  C4    . U  A 103 ? 1.34367 1.47047 1.58447 -0.07510 0.06390  -0.05740 205 U  A C4    
2218 O  O4    . U  A 103 ? 1.28787 1.41497 1.51937 -0.07000 0.05500  -0.06220 205 U  A O4    
2219 C  C5    . U  A 103 ? 1.33447 1.46577 1.57247 -0.07270 0.07170  -0.05050 205 U  A C5    
2220 C  C6    . U  A 103 ? 1.34897 1.48017 1.59727 -0.07900 0.08170  -0.04600 205 U  A C6    
2221 P  P     . A  A 104 ? 1.48109 1.57419 1.68449 -0.08500 0.12120  -0.01130 206 A  A P     
2222 O  OP1   . A  A 104 ? 1.55369 1.63689 1.74799 -0.08900 0.13140  -0.00210 206 A  A OP1   
2223 O  OP2   . A  A 104 ? 1.40849 1.51289 1.60809 -0.07730 0.11860  -0.01400 206 A  A OP2   
2224 O  "O5'" . A  A 104 ? 1.43739 1.51839 1.63089 -0.08240 0.11160  -0.01430 206 A  A "O5'" 
2225 C  "C5'" . A  A 104 ? 1.45769 1.52499 1.65219 -0.08790 0.11190  -0.01240 206 A  A "C5'" 
2226 C  "C4'" . A  A 104 ? 1.41499 1.47049 1.59419 -0.08290 0.10410  -0.01430 206 A  A "C4'" 
2227 O  "O4'" . A  A 104 ? 1.41089 1.47559 1.59539 -0.07910 0.09400  -0.02370 206 A  A "O4'" 
2228 C  "C3'" . A  A 104 ? 1.43429 1.48349 1.59019 -0.07580 0.10540  -0.00880 206 A  A "C3'" 
2229 O  "O3'" . A  A 104 ? 1.47959 1.51329 1.62339 -0.07450 0.10240  -0.00720 206 A  A "O3'" 
2230 C  "C2'" . A  A 104 ? 1.39359 1.45379 1.54649 -0.06860 0.09840  -0.01480 206 A  A "C2'" 
2231 O  "O2'" . A  A 104 ? 1.29249 1.34639 1.42549 -0.06140 0.09560  -0.01300 206 A  A "O2'" 
2232 C  "C1'" . A  A 104 ? 1.33059 1.39489 1.49709 -0.07040 0.08990  -0.02360 206 A  A "C1'" 
2233 N  N9    . A  A 104 ? 1.32879 1.40869 1.50199 -0.06640 0.08380  -0.02990 206 A  A N9    
2234 C  C8    . A  A 104 ? 1.32989 1.42329 1.51129 -0.06530 0.08700  -0.02930 206 A  A C8    
2235 N  N7    . A  A 104 ? 1.35909 1.46469 1.54559 -0.06100 0.07960  -0.03510 206 A  A N7    
2236 C  C5    . A  A 104 ? 1.31959 1.41959 1.49969 -0.05920 0.07120  -0.03990 206 A  A C5    
2237 C  C6    . A  A 104 ? 1.29999 1.40799 1.47989 -0.05470 0.06100  -0.04670 206 A  A C6    
2238 N  N6    . A  A 104 ? 1.36479 1.48779 1.55159 -0.05080 0.05700  -0.04910 206 A  A N6    
2239 N  N1    . A  A 104 ? 1.32089 1.42099 1.49309 -0.05400 0.05500  -0.05080 206 A  A N1    
2240 C  C2    . A  A 104 ? 1.26199 1.34669 1.42829 -0.05740 0.05880  -0.04810 206 A  A C2    
2241 N  N3    . A  A 104 ? 1.27769 1.35329 1.44369 -0.06160 0.06780  -0.04110 206 A  A N3    
2242 C  C4    . A  A 104 ? 1.33979 1.42409 1.51229 -0.06240 0.07380  -0.03720 206 A  A C4    
2243 P  P     . A  A 105 ? 1.52942 1.55122 1.65202 -0.07130 0.10710  0.00170  207 A  A P     
2244 O  OP1   . A  A 105 ? 1.49372 1.51342 1.61902 -0.07710 0.11710  0.00980  207 A  A OP1   
2245 O  OP2   . A  A 105 ? 1.34762 1.37502 1.45662 -0.06330 0.10450  0.00060  207 A  A OP2   
2246 O  "O5'" . A  A 105 ? 1.40082 1.40732 1.51752 -0.07080 0.10200  0.00120  207 A  A "O5'" 
2247 C  "C5'" . A  A 105 ? 1.42962 1.42552 1.55552 -0.07740 0.10420  0.00370  207 A  A "C5'" 
2248 C  "C4'" . A  A 105 ? 1.34602 1.33342 1.47462 -0.07650 0.09620  -0.00280 207 A  A "C4'" 
2249 O  "O4'" . A  A 105 ? 1.33742 1.33632 1.47912 -0.07680 0.08970  -0.01340 207 A  A "O4'" 
2250 C  "C3'" . A  A 105 ? 1.30742 1.28802 1.41822 -0.06880 0.09110  -0.00360 207 A  A "C3'" 
2251 O  "O3'" . A  A 105 ? 1.32492 1.29142 1.42422 -0.06810 0.09450  0.00490  207 A  A "O3'" 
2252 C  "C2'" . A  A 105 ? 1.31842 1.29832 1.43742 -0.06840 0.08260  -0.01400 207 A  A "C2'" 
2253 O  "O2'" . A  A 105 ? 1.37592 1.34232 1.50312 -0.07310 0.08280  -0.01340 207 A  A "O2'" 
2254 C  "C1'" . A  A 105 ? 1.28412 1.27922 1.41952 -0.07190 0.08140  -0.02030 207 A  A "C1'" 
2255 N  N9    . A  A 105 ? 1.22762 1.23582 1.35672 -0.06560 0.07640  -0.02530 207 A  A N9    
2256 C  C8    . A  A 105 ? 1.26662 1.28742 1.39502 -0.06380 0.07900  -0.02350 207 A  A C8    
2257 N  N7    . A  A 105 ? 1.22762 1.25722 1.35002 -0.05770 0.07310  -0.02830 207 A  A N7    
2258 C  C5    . A  A 105 ? 1.17302 1.19602 1.29102 -0.05560 0.06650  -0.03380 207 A  A C5    
2259 C  C6    . A  A 105 ? 1.21412 1.24152 1.32422 -0.04970 0.05890  -0.04020 207 A  A C6    
2260 N  N6    . A  A 105 ? 1.18962 1.22892 1.29482 -0.04460 0.05620  -0.04120 207 A  A N6    
2261 N  N1    . A  A 105 ? 1.24862 1.26772 1.35612 -0.04900 0.05430  -0.04540 207 A  A N1    
2262 C  C2    . A  A 105 ? 1.24652 1.25292 1.35982 -0.05380 0.05680  -0.04410 207 A  A C2    
2263 N  N3    . A  A 105 ? 1.16902 1.16932 1.28992 -0.05960 0.06370  -0.03740 207 A  A N3    
2264 C  C4    . A  A 105 ? 1.16792 1.17762 1.29032 -0.06030 0.06850  -0.03250 207 A  A C4    
2265 P  P     . C  A 106 ? 1.37741 1.34181 1.45491 -0.06050 0.09440  0.00920  208 C  A P     
2266 O  OP1   . C  A 106 ? 1.38861 1.33721 1.45811 -0.06010 0.09540  0.01590  208 C  A OP1   
2267 O  OP2   . C  A 106 ? 1.24591 1.22091 1.31891 -0.06000 0.09990  0.01300  208 C  A OP2   
2268 O  "O5'" . C  A 106 ? 1.29881 1.26831 1.37211 -0.05420 0.08600  -0.00010 208 C  A "O5'" 
2269 C  "C5'" . C  A 106 ? 1.30271 1.26421 1.37751 -0.05280 0.07980  -0.00570 208 C  A "C5'" 
2270 C  "C4'" . C  A 106 ? 1.25431 1.22431 1.32541 -0.04740 0.07290  -0.01450 208 C  A "C4'" 
2271 O  "O4'" . C  A 106 ? 1.27231 1.25641 1.35431 -0.04940 0.07140  -0.01990 208 C  A "O4'" 
2272 C  "C3'" . C  A 106 ? 1.29581 1.26941 1.35011 -0.04040 0.07260  -0.01210 208 C  A "C3'" 
2273 O  "O3'" . C  A 106 ? 1.30241 1.26541 1.34581 -0.03650 0.07100  -0.01040 208 C  A "O3'" 
2274 C  "C2'" . C  A 106 ? 1.31671 1.30311 1.37281 -0.03740 0.06710  -0.02000 208 C  A "C2'" 
2275 O  "O2'" . C  A 106 ? 1.29391 1.27761 1.34891 -0.03480 0.06080  -0.02740 208 C  A "O2'" 
2276 C  "C1'" . C  A 106 ? 1.21511 1.20921 1.28821 -0.04330 0.06790  -0.02290 208 C  A "C1'" 
2277 N  N1    . C  A 106 ? 1.21201 1.21641 1.28641 -0.04360 0.07220  -0.01900 208 C  A N1    
2278 C  C2    . C  A 106 ? 1.21131 1.22761 1.28211 -0.03880 0.06910  -0.02180 208 C  A C2    
2279 O  O2    . C  A 106 ? 1.21201 1.23031 1.27751 -0.03460 0.06290  -0.02710 208 C  A O2    
2280 N  N3    . C  A 106 ? 1.22721 1.25241 1.30051 -0.03880 0.07310  -0.01870 208 C  A N3    
2281 C  C4    . C  A 106 ? 1.21631 1.24001 1.29481 -0.04350 0.08030  -0.01330 208 C  A C4    
2282 N  N4    . C  A 106 ? 1.25051 1.28381 1.33181 -0.04300 0.08440  -0.01120 208 C  A N4    
2283 C  C5    . C  A 106 ? 1.26621 1.27851 1.34741 -0.04870 0.08390  -0.00970 208 C  A C5    
2284 C  C6    . C  A 106 ? 1.26921 1.27171 1.34851 -0.04850 0.07950  -0.01250 208 C  A C6    
2285 P  P     . C  A 107 ? 1.38701 1.34791 1.41401 -0.03190 0.07420  -0.00300 209 C  A P     
2286 O  OP1   . C  A 107 ? 1.41151 1.36061 1.43171 -0.02890 0.07200  -0.00200 209 C  A OP1   
2287 O  OP2   . C  A 107 ? 1.24591 1.20851 1.27301 -0.03540 0.08100  0.00450  209 C  A OP2   
2288 O  "O5'" . C  A 107 ? 1.25081 1.22311 1.27101 -0.02660 0.07110  -0.00730 209 C  A "O5'" 
2289 C  "C5'" . C  A 107 ? 1.28201 1.25591 1.29971 -0.02260 0.06510  -0.01440 209 C  A "C5'" 
2290 C  "C4'" . C  A 107 ? 1.31481 1.30041 1.32721 -0.01840 0.06320  -0.01660 209 C  A "C4'" 
2291 O  "O4'" . C  A 107 ? 1.25711 1.25301 1.27981 -0.02130 0.06310  -0.01900 209 C  A "O4'" 
2292 C  "C3'" . C  A 107 ? 1.36271 1.34991 1.36431 -0.01530 0.06690  -0.01050 209 C  A "C3'" 
2293 O  "O3'" . C  A 107 ? 1.42691 1.40851 1.41741 -0.01090 0.06570  -0.00960 209 C  A "O3'" 
2294 C  "C2'" . C  A 107 ? 1.36331 1.36311 1.36661 -0.01340 0.06550  -0.01290 209 C  A "C2'" 
2295 O  "O2'" . C  A 107 ? 1.38531 1.38871 1.38281 -0.00880 0.06070  -0.01720 209 C  A "O2'" 
2296 C  "C1'" . C  A 107 ? 1.27541 1.28021 1.29311 -0.01800 0.06410  -0.01690 209 C  A "C1'" 
2297 N  N1    . C  A 107 ? 1.18841 1.19751 1.21321 -0.02160 0.06920  -0.01300 209 C  A N1    
2298 C  C2    . C  A 107 ? 1.16751 1.18811 1.19511 -0.01970 0.06900  -0.01370 209 C  A C2    
2299 O  O2    . C  A 107 ? 1.18101 1.20721 1.20451 -0.01530 0.06450  -0.01670 209 C  A O2    
2300 N  N3    . C  A 107 ? 1.16811 1.19371 1.20311 -0.02260 0.07390  -0.01090 209 C  A N3    
2301 C  C4    . C  A 107 ? 1.14521 1.16491 1.18371 -0.02750 0.07920  -0.00720 209 C  A C4    
2302 N  N4    . C  A 107 ? 1.12751 1.15331 1.17321 -0.03020 0.08450  -0.00480 209 C  A N4    
2303 C  C5    . C  A 107 ? 1.23811 1.24571 1.27331 -0.02960 0.07940  -0.00550 209 C  A C5    
2304 C  C6    . C  A 107 ? 1.23331 1.23571 1.26211 -0.02640 0.07420  -0.00870 209 C  A C6    
2305 P  P     . A  A 108 ? 1.44595 1.41555 1.43075 -0.01120 0.06850  -0.00370 210 A  A P     
2306 O  OP1   . A  A 108 ? 1.43435 1.39545 1.42435 -0.01230 0.06560  -0.00690 210 A  A OP1   
2307 O  OP2   . A  A 108 ? 1.34725 1.31665 1.33255 -0.01450 0.07420  0.00290  210 A  A OP2   
2308 O  "O5'" . A  A 108 ? 1.42005 1.38995 1.39265 -0.00550 0.06760  -0.00270 210 A  A "O5'" 
2309 C  "C5'" . A  A 108 ? 1.41755 1.39525 1.38475 -0.00320 0.06910  -0.00140 210 A  A "C5'" 
2310 C  "C4'" . A  A 108 ? 1.43415 1.41575 1.39565 0.00170  0.06580  -0.00490 210 A  A "C4'" 
2311 O  "O4'" . A  A 108 ? 1.48535 1.45965 1.44005 0.00430  0.06520  -0.00380 210 A  A "O4'" 
2312 C  "C3'" . A  A 108 ? 1.41925 1.40495 1.38525 0.00230  0.06130  -0.01170 210 A  A "C3'" 
2313 O  "O3'" . A  A 108 ? 1.42815 1.42215 1.38965 0.00590  0.05980  -0.01330 210 A  A "O3'" 
2314 C  "C2'" . A  A 108 ? 1.40865 1.38635 1.37315 0.00370  0.05900  -0.01430 210 A  A "C2'" 
2315 O  "O2'" . A  A 108 ? 1.34125 1.32295 1.30505 0.00630  0.05510  -0.02090 210 A  A "O2'" 
2316 C  "C1'" . A  A 108 ? 1.43965 1.41305 1.39545 0.00640  0.06120  -0.00930 210 A  A "C1'" 
2317 N  N9    . A  A 108 ? 1.46205 1.42515 1.41755 0.00660  0.06070  -0.00820 210 A  A N9    
2318 C  C8    . A  A 108 ? 1.46055 1.41575 1.42165 0.00300  0.06170  -0.00570 210 A  A C8    
2319 N  N7    . A  A 108 ? 1.42985 1.37595 1.38985 0.00440  0.06070  -0.00450 210 A  A N7    
2320 C  C5    . A  A 108 ? 1.46655 1.41555 1.42015 0.00940  0.05900  -0.00680 210 A  A C5    
2321 C  C6    . A  A 108 ? 1.53855 1.48235 1.48915 0.01320  0.05720  -0.00720 210 A  A C6    
2322 N  N6    . A  A 108 ? 1.53365 1.46715 1.48715 0.01310  0.05650  -0.00480 210 A  A N6    
2323 N  N1    . A  A 108 ? 1.62085 1.57065 1.56615 0.01730  0.05630  -0.00990 210 A  A N1    
2324 C  C2    . A  A 108 ? 1.54805 1.50755 1.49075 0.01750  0.05710  -0.01140 210 A  A C2    
2325 N  N3    . A  A 108 ? 1.42465 1.38925 1.36945 0.01450  0.05830  -0.01090 210 A  A N3    
2326 C  C4    . A  A 108 ? 1.46425 1.42365 1.41485 0.01050  0.05920  -0.00890 210 A  A C4    
2327 P  P     . C  A 109 ? 1.43859 1.44299 1.40559 0.00550  0.05740  -0.01650 211 C  A P     
2328 O  OP1   . C  A 109 ? 1.37019 1.37489 1.34279 0.00410  0.05330  -0.02300 211 C  A OP1   
2329 O  OP2   . C  A 109 ? 1.53609 1.54719 1.49669 0.00960  0.05710  -0.01520 211 C  A OP2   
2330 O  "O5'" . C  A 109 ? 1.31929 1.32549 1.29379 0.00170  0.06080  -0.01310 211 C  A "O5'" 
2331 C  "C5'" . C  A 109 ? 1.33749 1.34349 1.30869 0.00200  0.06530  -0.00770 211 C  A "C5'" 
2332 C  "C4'" . C  A 109 ? 1.36609 1.38149 1.34049 0.00320  0.06570  -0.00710 211 C  A "C4'" 
2333 O  "O4'" . C  A 109 ? 1.33569 1.35649 1.32129 0.00000  0.06490  -0.00930 211 C  A "O4'" 
2334 C  "C3'" . C  A 109 ? 1.34199 1.35779 1.31449 0.00360  0.07060  -0.00260 211 C  A "C3'" 
2335 O  "O3'" . C  A 109 ? 1.29819 1.31219 1.26169 0.00710  0.07120  -0.00080 211 C  A "O3'" 
2336 C  "C2'" . C  A 109 ? 1.28049 1.30559 1.26159 0.00340  0.07050  -0.00330 211 C  A "C2'" 
2337 O  "O2'" . C  A 109 ? 1.33639 1.36719 1.31539 0.00750  0.06720  -0.00400 211 C  A "O2'" 
2338 C  "C1'" . C  A 109 ? 1.22799 1.25489 1.21799 -0.00010 0.06780  -0.00690 211 C  A "C1'" 
2339 N  N1    . C  A 109 ? 1.15099 1.17619 1.14829 -0.00490 0.07220  -0.00530 211 C  A N1    
2340 C  C2    . C  A 109 ? 1.19859 1.23099 1.20379 -0.00590 0.07530  -0.00430 211 C  A C2    
2341 O  O2    . C  A 109 ? 1.21909 1.25849 1.22549 -0.00240 0.07380  -0.00460 211 C  A O2    
2342 N  N3    . C  A 109 ? 1.17579 1.20739 1.18739 -0.01050 0.08000  -0.00270 211 C  A N3    
2343 C  C4    . C  A 109 ? 1.15989 1.18319 1.17019 -0.01410 0.08140  -0.00140 211 C  A C4    
2344 N  N4    . C  A 109 ? 1.17849 1.20139 1.19499 -0.01880 0.08660  0.00090  211 C  A N4    
2345 C  C5    . C  A 109 ? 1.20119 1.21629 1.20399 -0.01280 0.07790  -0.00230 211 C  A C5    
2346 C  C6    . C  A 109 ? 1.17839 1.19519 1.17519 -0.00820 0.07340  -0.00460 211 C  A C6    
2347 P  P     . G  A 110 ? 1.44256 1.45246 1.40096 0.00700  0.07610  0.00300  212 G  A P     
2348 O  OP1   . G  A 110 ? 1.50156 1.50956 1.45186 0.01050  0.07530  0.00360  212 G  A OP1   
2349 O  OP2   . G  A 110 ? 1.35206 1.35586 1.31076 0.00340  0.07830  0.00460  212 G  A OP2   
2350 O  "O5'" . G  A 110 ? 1.31456 1.33126 1.27906 0.00690  0.07900  0.00390  212 G  A "O5'" 
2351 C  "C5'" . G  A 110 ? 1.28956 1.31206 1.25566 0.01030  0.07740  0.00360  212 G  A "C5'" 
2352 C  "C4'" . G  A 110 ? 1.20496 1.23436 1.18036 0.00980  0.07930  0.00360  212 G  A "C4'" 
2353 O  "O4'" . G  A 110 ? 1.19596 1.22826 1.17966 0.00640  0.07860  0.00190  212 G  A "O4'" 
2354 C  "C3'" . G  A 110 ? 1.18456 1.21346 1.16056 0.00910  0.08490  0.00500  212 G  A "C3'" 
2355 O  "O3'" . G  A 110 ? 1.19756 1.22626 1.17026 0.01250  0.08580  0.00590  212 G  A "O3'" 
2356 C  "C2'" . G  A 110 ? 1.17416 1.21026 1.16186 0.00750  0.08630  0.00400  212 G  A "C2'" 
2357 O  "O2'" . G  A 110 ? 1.26326 1.30566 1.25676 0.01100  0.08420  0.00370  212 G  A "O2'" 
2358 C  "C1'" . G  A 110 ? 1.18026 1.21686 1.17166 0.00480  0.08290  0.00240  212 G  A "C1'" 
2359 N  N9    . G  A 110 ? 1.18456 1.21716 1.17656 0.00010  0.08650  0.00320  212 G  A N9    
2360 C  C8    . G  A 110 ? 1.22336 1.24816 1.20956 -0.00200 0.08570  0.00380  212 G  A C8    
2361 N  N7    . G  A 110 ? 1.24716 1.26966 1.23566 -0.00620 0.08980  0.00550  212 G  A N7    
2362 C  C5    . G  A 110 ? 1.28686 1.31676 1.28306 -0.00700 0.09370  0.00540  212 G  A C5    
2363 C  C6    . G  A 110 ? 1.32476 1.35676 1.32626 -0.01100 0.09970  0.00690  212 G  A C6    
2364 O  O6    . G  A 110 ? 1.40226 1.42946 1.40236 -0.01510 0.10260  0.00940  212 G  A O6    
2365 N  N1    . G  A 110 ? 1.35056 1.39156 1.36026 -0.01000 0.10240  0.00540  212 G  A N1    
2366 C  C2    . G  A 110 ? 1.26066 1.30676 1.27306 -0.00540 0.09940  0.00350  212 G  A C2    
2367 N  N2    . G  A 110 ? 1.27146 1.32566 1.29316 -0.00460 0.10270  0.00220  212 G  A N2    
2368 N  N3    . G  A 110 ? 1.27186 1.31566 1.27886 -0.00180 0.09390  0.00300  212 G  A N3    
2369 C  C4    . G  A 110 ? 1.27986 1.31586 1.27866 -0.00290 0.09150  0.00370  212 G  A C4    
2370 P  P     . C  A 111 ? 1.24067 1.26607 1.20867 0.01210  0.09090  0.00640  213 C  A P     
2371 O  OP1   . C  A 111 ? 1.24057 1.26497 1.20587 0.01560  0.09030  0.00670  213 C  A OP1   
2372 O  OP2   . C  A 111 ? 1.22357 1.24337 1.18457 0.00930  0.09210  0.00720  213 C  A OP2   
2373 O  "O5'" . C  A 111 ? 1.36777 1.39887 1.34497 0.01100  0.09510  0.00550  213 C  A "O5'" 
2374 C  "C5'" . C  A 111 ? 1.38457 1.42167 1.37107 0.01370  0.09460  0.00480  213 C  A "C5'" 
2375 C  "C4'" . C  A 111 ? 1.33457 1.37687 1.32967 0.01220  0.09950  0.00340  213 C  A "C4'" 
2376 O  "O4'" . C  A 111 ? 1.34857 1.39397 1.34887 0.00860  0.09960  0.00320  213 C  A "O4'" 
2377 C  "C3'" . C  A 111 ? 1.31377 1.35367 1.30357 0.01080  0.10540  0.00250  213 C  A "C3'" 
2378 O  "O3'" . C  A 111 ? 1.37137 1.41027 1.36047 0.01390  0.10690  0.00120  213 C  A "O3'" 
2379 C  "C2'" . C  A 111 ? 1.35767 1.40367 1.35607 0.00790  0.10980  0.00150  213 C  A "C2'" 
2380 O  "O2'" . C  A 111 ? 1.44237 1.49497 1.45227 0.01060  0.11130  -0.00060 213 C  A "O2'" 
2381 C  "C1'" . C  A 111 ? 1.35067 1.39797 1.35317 0.00570  0.10590  0.00260  213 C  A "C1'" 
2382 N  N1    . C  A 111 ? 1.28137 1.32347 1.27657 0.00150  0.10720  0.00430  213 C  A N1    
2383 C  C2    . C  A 111 ? 1.37167 1.41637 1.37017 -0.00260 0.11280  0.00470  213 C  A C2    
2384 O  O2    . C  A 111 ? 1.42547 1.47737 1.43297 -0.00240 0.11680  0.00290  213 C  A O2    
2385 N  N3    . C  A 111 ? 1.38707 1.42627 1.37927 -0.00640 0.11410  0.00740  213 C  A N3    
2386 C  C4    . C  A 111 ? 1.35677 1.38837 1.34037 -0.00600 0.10970  0.00900  213 C  A C4    
2387 N  N4    . C  A 111 ? 1.45007 1.47577 1.42847 -0.00940 0.11090  0.01200  213 C  A N4    
2388 C  C5    . C  A 111 ? 1.26977 1.29937 1.25027 -0.00180 0.10410  0.00780  213 C  A C5    
2389 C  C6    . C  A 111 ? 1.23467 1.26957 1.22077 0.00160  0.10320  0.00580  213 C  A C6    
2390 P  P     . A  A 112 ? 1.56393 1.59753 1.54193 0.01330  0.10970  0.00030  214 A  A P     
2391 O  OP1   . A  A 112 ? 1.50213 1.53533 1.48293 0.01670  0.11020  -0.00170 214 A  A OP1   
2392 O  OP2   . A  A 112 ? 1.55853 1.58643 1.52613 0.01190  0.10650  0.00250  214 A  A OP2   
2393 O  "O5'" . A  A 112 ? 1.48973 1.52663 1.46773 0.01040  0.11590  -0.00130 214 A  A "O5'" 
2394 C  "C5'" . A  A 112 ? 1.60943 1.65283 1.59793 0.01110  0.12010  -0.00410 214 A  A "C5'" 
2395 C  "C4'" . A  A 112 ? 1.61003 1.65733 1.59813 0.00740  0.12610  -0.00460 214 A  A "C4'" 
2396 O  "O4'" . A  A 112 ? 1.55613 1.60393 1.54593 0.00410  0.12470  -0.00140 214 A  A "O4'" 
2397 C  "C3'" . A  A 112 ? 1.66743 1.71133 1.64203 0.00550  0.12950  -0.00470 214 A  A "C3'" 
2398 O  "O3'" . A  A 112 ? 1.74763 1.79293 1.72103 0.00760  0.13280  -0.00920 214 A  A "O3'" 
2399 C  "C2'" . A  A 112 ? 1.72233 1.76963 1.69713 0.00110  0.13410  -0.00270 214 A  A "C2'" 
2400 O  "O2'" . A  A 112 ? 1.86773 1.92313 1.85133 0.00090  0.14030  -0.00610 214 A  A "O2'" 
2401 C  "C1'" . A  A 112 ? 1.55223 1.59963 1.53523 0.00010  0.12960  -0.00000 214 A  A "C1'" 
2402 N  N9    . A  A 112 ? 1.51163 1.55203 1.48563 -0.00220 0.12610  0.00410  214 A  A N9    
2403 C  C8    . A  A 112 ? 1.50693 1.54123 1.47653 -0.00050 0.11970  0.00550  214 A  A C8    
2404 N  N7    . A  A 112 ? 1.51683 1.54553 1.47953 -0.00300 0.11820  0.00880  214 A  A N7    
2405 C  C5    . A  A 112 ? 1.56703 1.59773 1.52913 -0.00680 0.12410  0.01050  214 A  A C5    
2406 C  C6    . A  A 112 ? 1.69203 1.71863 1.64863 -0.01070 0.12590  0.01490  214 A  A C6    
2407 N  N6    . A  A 112 ? 1.70663 1.72543 1.65773 -0.01120 0.12150  0.01800  214 A  A N6    
2408 N  N1    . A  A 112 ? 1.78663 1.81733 1.74403 -0.01410 0.13280  0.01630  214 A  A N1    
2409 C  C2    . A  A 112 ? 1.76443 1.80343 1.72803 -0.01340 0.13750  0.01260  214 A  A C2    
2410 N  N3    . A  A 112 ? 1.67913 1.72243 1.64923 -0.00950 0.13620  0.00780  214 A  A N3    
2411 C  C4    . A  A 112 ? 1.57943 1.61783 1.54813 -0.00640 0.12920  0.00740  214 A  A C4    
2412 P  P     . G  A 113 ? 1.83702 1.87742 1.79562 0.00760  0.13280  -0.01040 215 G  A P     
2413 O  OP1   . G  A 113 ? 1.76652 1.80842 1.72862 0.01050  0.13470  -0.01620 215 G  A OP1   
2414 O  OP2   . G  A 113 ? 1.85752 1.89122 1.80882 0.00770  0.12670  -0.00640 215 G  A OP2   
2415 O  "O5'" . G  A 113 ? 1.78492 1.82812 1.73492 0.00390  0.13840  -0.00930 215 G  A "O5'" 
2416 C  "C5'" . G  A 113 ? 1.85252 1.90332 1.80892 0.00270  0.14530  -0.01190 215 G  A "C5'" 
2417 C  "C4'" . G  A 113 ? 1.95172 2.00412 1.90012 -0.00170 0.14970  -0.00810 215 G  A "C4'" 
2418 O  "O4'" . G  A 113 ? 1.85842 1.90842 1.81092 -0.00420 0.14700  -0.00250 215 G  A "O4'" 
2419 C  "C3'" . G  A 113 ? 1.99452 2.04242 1.92512 -0.00270 0.14910  -0.00590 215 G  A "C3'" 
2420 O  "O3'" . G  A 113 ? 2.01062 2.06252 1.93452 -0.00180 0.15350  -0.01120 215 G  A "O3'" 
2421 C  "C2'" . G  A 113 ? 1.98302 2.03012 1.90952 -0.00710 0.15140  0.00090  215 G  A "C2'" 
2422 O  "O2'" . G  A 113 ? 1.96452 2.01922 1.89162 -0.00960 0.15970  0.00000  215 G  A "O2'" 
2423 C  "C1'" . G  A 113 ? 1.91232 1.95842 1.85272 -0.00750 0.14790  0.00280  215 G  A "C1'" 
2424 N  N9    . G  A 113 ? 1.82282 1.86052 1.75902 -0.00700 0.14060  0.00680  215 G  A N9    
2425 C  C8    . G  A 113 ? 1.75392 1.78792 1.69322 -0.00370 0.13410  0.00530  215 G  A C8    
2426 N  N7    . G  A 113 ? 1.72552 1.75262 1.65972 -0.00410 0.12910  0.00920  215 G  A N7    
2427 C  C5    . G  A 113 ? 1.83442 1.85992 1.76222 -0.00780 0.13220  0.01380  215 G  A C5    
2428 C  C6    . G  A 113 ? 1.88632 1.90452 1.80772 -0.00960 0.12930  0.01940  215 G  A C6    
2429 O  O6    . G  A 113 ? 1.89142 1.90352 1.81162 -0.00810 0.12330  0.02060  215 G  A O6    
2430 N  N1    . G  A 113 ? 1.98492 2.00332 1.90132 -0.01340 0.13450  0.02390  215 G  A N1    
2431 C  C2    . G  A 113 ? 1.97632 2.00212 1.89322 -0.01540 0.14200  0.02290  215 G  A C2    
2432 N  N2    . G  A 113 ? 2.01702 2.04212 1.92792 -0.01920 0.14680  0.02850  215 G  A N2    
2433 N  N3    . G  A 113 ? 1.89992 1.93302 1.82292 -0.01360 0.14480  0.01680  215 G  A N3    
2434 C  C4    . G  A 113 ? 1.86852 1.90052 1.79692 -0.00980 0.13950  0.01280  215 G  A C4    
2435 P  P     . C  A 114 ? 2.08368 2.13218 1.98928 -0.00160 0.15160  -0.01080 216 C  A P     
2436 O  OP1   . C  A 114 ? 2.13648 2.18858 2.04108 0.00100  0.15340  -0.01920 216 C  A OP1   
2437 O  OP2   . C  A 114 ? 1.98518 2.02548 1.88678 -0.00100 0.14400  -0.00580 216 C  A OP2   
2438 O  "O5'" . C  A 114 ? 2.01408 2.06578 1.90908 -0.00550 0.15740  -0.00600 216 C  A "O5'" 
2439 C  "C5'" . C  A 114 ? 2.07418 2.12388 1.95148 -0.00610 0.15650  -0.00320 216 C  A "C5'" 
2440 C  "C4'" . C  A 114 ? 2.07458 2.12088 1.94528 -0.00960 0.15730  0.00640  216 C  A "C4'" 
2441 O  "O4'" . C  A 114 ? 1.92548 1.96758 1.80888 -0.01080 0.15470  0.01030  216 C  A "O4'" 
2442 C  "C3'" . C  A 114 ? 2.13468 2.17458 1.99028 -0.00910 0.15190  0.01170  216 C  A "C3'" 
2443 O  "O3'" . C  A 114 ? 2.05538 2.09958 1.89518 -0.00920 0.15480  0.01100  216 C  A "O3'" 
2444 C  "C2'" . C  A 114 ? 2.09058 2.12458 1.94818 -0.01220 0.15120  0.02090  216 C  A "C2'" 
2445 O  "O2'" . C  A 114 ? 2.13208 2.16988 1.98388 -0.01600 0.15860  0.02590  216 C  A "O2'" 
2446 C  "C1'" . C  A 114 ? 2.00148 2.03598 1.87788 -0.01240 0.15090  0.01830  216 C  A "C1'" 
2447 N  N1    . C  A 114 ? 2.01308 2.04078 1.89488 -0.00970 0.14280  0.01800  216 C  A N1    
2448 C  C2    . C  A 114 ? 2.07098 2.09048 1.95008 -0.01050 0.13790  0.02440  216 C  A C2    
2449 O  O2    . C  A 114 ? 2.05358 2.07058 1.92598 -0.01340 0.14020  0.03120  216 C  A O2    
2450 N  N3    . C  A 114 ? 2.10148 2.11588 1.98558 -0.00790 0.13110  0.02320  216 C  A N3    
2451 C  C4    . C  A 114 ? 2.06428 2.08128 1.95528 -0.00500 0.12910  0.01690  216 C  A C4    
2452 N  N4    . C  A 114 ? 2.07878 2.09128 1.97388 -0.00270 0.12280  0.01630  216 C  A N4    
2453 C  C5    . C  A 114 ? 2.05258 2.07698 1.94708 -0.00420 0.13360  0.01090  216 C  A C5    
2454 C  C6    . C  A 114 ? 2.02948 2.05908 1.91948 -0.00650 0.14030  0.01120  216 C  A C6    
2455 P  P     . C  A 115 ? 2.12880 2.17380 1.95940 -0.00560 0.15010  0.00440  217 C  A P     
2456 O  OP1   . C  A 115 ? 2.13730 2.19150 1.96520 -0.00530 0.15630  -0.00390 217 C  A OP1   
2457 O  OP2   . C  A 115 ? 2.12110 2.16030 1.96170 -0.00290 0.14290  0.00180  217 C  A OP2   
2458 O  "O5'" . C  A 115 ? 2.30850 2.35030 2.12090 -0.00590 0.14680  0.01190  217 C  A "O5'" 
2459 C  "C5'" . C  A 115 ? 2.26760 2.30750 2.07370 -0.00920 0.15030  0.02180  217 C  A "C5'" 
2460 C  "C4'" . C  A 115 ? 2.21300 2.24340 2.01540 -0.00860 0.14320  0.03030  217 C  A "C4'" 
2461 O  "O4'" . C  A 115 ? 2.15260 2.17670 1.97080 -0.00910 0.14080  0.03180  217 C  A "O4'" 
2462 C  "C3'" . C  A 115 ? 2.25010 2.27790 2.04590 -0.00460 0.13490  0.02750  217 C  A "C3'" 
2463 O  "O3'" . C  A 115 ? 2.30050 2.33220 2.07840 -0.00380 0.13440  0.02890  217 C  A "O3'" 
2464 C  "C2'" . C  A 115 ? 2.26070 2.27860 2.06220 -0.00400 0.12870  0.03410  217 C  A "C2'" 
2465 O  "O2'" . C  A 115 ? 2.33600 2.34940 2.12660 -0.00520 0.12820  0.04440  217 C  A "O2'" 
2466 C  "C1'" . C  A 115 ? 2.23470 2.25120 2.05240 -0.00650 0.13240  0.03400  217 C  A "C1'" 
2467 N  N1    . C  A 115 ? 2.19000 2.20580 2.02120 -0.00430 0.12870  0.02710  217 C  A N1    
2468 C  C2    . C  A 115 ? 2.19080 2.19950 2.02560 -0.00210 0.12150  0.02870  217 C  A C2    
2469 O  O2    . C  A 115 ? 2.22070 2.22370 2.04850 -0.00190 0.11810  0.03540  217 C  A O2    
2470 N  N3    . C  A 115 ? 2.14380 2.15210 1.98980 -0.00020 0.11850  0.02310  217 C  A N3    
2471 C  C4    . C  A 115 ? 2.12330 2.13720 1.97720 -0.00010 0.12210  0.01660  217 C  A C4    
2472 N  N4    . C  A 115 ? 2.07260 2.08560 1.93700 0.00190  0.11890  0.01230  217 C  A N4    
2473 C  C5    . C  A 115 ? 2.15950 2.18020 2.01110 -0.00200 0.12920  0.01430  217 C  A C5    
2474 C  C6    . C  A 115 ? 2.17400 2.19590 2.01410 -0.00410 0.13250  0.01940  217 C  A C6    
2475 P  P     . A  A 116 ? 2.44490 2.48090 2.21620 -0.00020 0.12920  0.02010  218 A  A P     
2476 O  OP1   . A  A 116 ? 2.38520 2.42600 2.13660 0.00000  0.12940  0.02330  218 A  A OP1   
2477 O  OP2   . A  A 116 ? 2.37690 2.41780 2.15970 0.00020  0.13210  0.00890  218 A  A OP2   
2478 O  "O5'" . A  A 116 ? 2.25110 2.27910 2.02760 0.00250  0.11980  0.02220  218 A  A "O5'" 
2479 C  "C5'" . A  A 116 ? 2.21960 2.24100 1.98940 0.00310  0.11530  0.03230  218 A  A "C5'" 
2480 C  "C4'" . A  A 116 ? 2.20570 2.22170 1.98190 0.00620  0.10680  0.03130  218 A  A "C4'" 
2481 O  "O4'" . A  A 116 ? 2.17680 2.18960 1.97010 0.00590  0.10720  0.02750  218 A  A "O4'" 
2482 C  "C3'" . A  A 116 ? 2.18250 2.20350 1.95400 0.00920  0.10150  0.02360  218 A  A "C3'" 
2483 O  "O3'" . A  A 116 ? 2.14030 2.15680 1.91010 0.01210  0.09340  0.02750  218 A  A "O3'" 
2484 C  "C2'" . A  A 116 ? 2.12150 2.14400 1.90800 0.00940  0.10260  0.01420  218 A  A "C2'" 
2485 O  "O2'" . A  A 116 ? 1.93720 1.96080 1.72700 0.01200  0.09650  0.00790  218 A  A "O2'" 
2486 C  "C1'" . A  A 116 ? 2.10660 2.12180 1.90570 0.00820  0.10350  0.01890  218 A  A "C1'" 
2487 N  N9    . A  A 116 ? 2.06330 2.08020 1.87580 0.00710  0.10780  0.01310  218 A  A N9    
2488 C  C8    . A  A 116 ? 2.09090 2.11310 1.90450 0.00500  0.11500  0.00980  218 A  A C8    
2489 N  N7    . A  A 116 ? 2.01200 2.03460 1.83940 0.00490  0.11710  0.00510  218 A  A N7    
2490 C  C5    . A  A 116 ? 1.96530 1.98260 1.80010 0.00670  0.11120  0.00560  218 A  A C5    
2491 C  C6    . A  A 116 ? 1.99080 2.00620 1.83960 0.00760  0.11010  0.00260  218 A  A C6    
2492 N  N6    . A  A 116 ? 2.03620 2.05450 1.89490 0.00690  0.11450  -0.00130 218 A  A N6    
2493 N  N1    . A  A 116 ? 1.91820 1.92910 1.77040 0.00940  0.10430  0.00390  218 A  A N1    
2494 C  C2    . A  A 116 ? 1.89590 1.90420 1.73930 0.01040  0.09980  0.00770  218 A  A C2    
2495 N  N3    . A  A 116 ? 1.94740 1.95670 1.77800 0.01010  0.09970  0.01110  218 A  A N3    
2496 C  C4    . A  A 116 ? 1.98330 1.99720 1.80950 0.00810  0.10570  0.01000  218 A  A C4    
2497 P  P     . A  A 117 ? 2.20892 2.22642 1.96132 0.01380  0.08930  0.03470  219 A  A P     
2498 O  OP1   . A  A 117 ? 2.12122 2.13412 1.86762 0.01140  0.09380  0.04550  219 A  A OP1   
2499 O  OP2   . A  A 117 ? 2.18662 2.21382 1.92852 0.01480  0.08840  0.02720  219 A  A OP2   
2500 O  "O5'" . A  A 117 ? 1.99072 2.00252 1.74792 0.01740  0.08040  0.03740  219 A  A "O5'" 
2501 C  "C5'" . A  A 117 ? 1.95632 1.96252 1.70622 0.01900  0.07650  0.04790  219 A  A "C5'" 
2502 C  "C4'" . A  A 117 ? 1.92422 1.92172 1.68672 0.02080  0.07220  0.05070  219 A  A "C4'" 
2503 O  "O4'" . A  A 117 ? 1.99822 1.99042 1.77212 0.01770  0.07780  0.05150  219 A  A "O4'" 
2504 C  "C3'" . A  A 117 ? 1.83792 1.83762 1.61062 0.02350  0.06680  0.04230  219 A  A "C3'" 
2505 O  "O3'" . A  A 117 ? 1.77332 1.77602 1.53992 0.02730  0.05920  0.04260  219 A  A "O3'" 
2506 C  "C2'" . A  A 117 ? 1.91772 1.90912 1.70452 0.02340  0.06680  0.04420  219 A  A "C2'" 
2507 O  "O2'" . A  A 117 ? 1.96962 1.95422 1.75552 0.02600  0.06180  0.05200  219 A  A "O2'" 
2508 C  "C1'" . A  A 117 ? 1.86292 1.85162 1.65092 0.01910  0.07460  0.04730  219 A  A "C1'" 
2509 N  N9    . A  A 117 ? 1.77842 1.77092 1.57582 0.01700  0.07920  0.03910  219 A  A N9    
2510 C  C8    . A  A 117 ? 1.88942 1.88752 1.68432 0.01430  0.08550  0.03550  219 A  A C8    
2511 N  N7    . A  A 117 ? 1.90082 1.90082 1.70692 0.01340  0.08800  0.02860  219 A  A N7    
2512 C  C5    . A  A 117 ? 1.88052 1.87622 1.69602 0.01550  0.08320  0.02790  219 A  A C5    
2513 C  C6    . A  A 117 ? 1.84842 1.84372 1.67672 0.01590  0.08290  0.02270  219 A  A C6    
2514 N  N6    . A  A 117 ? 1.74152 1.74032 1.57642 0.01440  0.08720  0.01730  219 A  A N6    
2515 N  N1    . A  A 117 ? 1.88842 1.87972 1.72262 0.01820  0.07800  0.02350  219 A  A N1    
2516 C  C2    . A  A 117 ? 1.90342 1.89092 1.73232 0.02020  0.07350  0.02870  219 A  A C2    
2517 N  N3    . A  A 117 ? 1.84002 1.82682 1.65752 0.02030  0.07280  0.03440  219 A  A N3    
2518 C  C4    . A  A 117 ? 1.82952 1.82072 1.64012 0.01770  0.07790  0.03390  219 A  A C4    
2519 P  P     . G  A 118 ? 1.93052 1.94292 1.69772 0.02880  0.05550  0.03180  220 G  A P     
2520 O  OP1   . G  A 118 ? 1.84392 1.85902 1.60372 0.03280  0.04720  0.03450  220 G  A OP1   
2521 O  OP2   . G  A 118 ? 1.80462 1.82372 1.56642 0.02590  0.06130  0.02560  220 G  A OP2   
2522 O  "O5'" . G  A 118 ? 1.83292 1.84312 1.61812 0.02920  0.05470  0.02570  220 G  A "O5'" 
2523 C  "C5'" . G  A 118 ? 1.71332 1.71782 1.50662 0.03190  0.05000  0.02920  220 G  A "C5'" 
2524 C  "C4'" . G  A 118 ? 1.66582 1.66812 1.47452 0.03110  0.05200  0.02410  220 G  A "C4'" 
2525 O  "O4'" . G  A 118 ? 1.72392 1.72212 1.53542 0.02770  0.05890  0.02560  220 G  A "O4'" 
2526 C  "C3'" . G  A 118 ? 1.58112 1.59042 1.39662 0.03070  0.05200  0.01410  220 G  A "C3'" 
2527 O  "O3'" . G  A 118 ? 1.56172 1.57442 1.38172 0.03370  0.04560  0.01120  220 G  A "O3'" 
2528 C  "C2'" . G  A 118 ? 1.55672 1.56252 1.38362 0.02850  0.05710  0.01190  220 G  A "C2'" 
2529 O  "O2'" . G  A 118 ? 1.55982 1.56172 1.39642 0.03040  0.05450  0.01300  220 G  A "O2'" 
2530 C  "C1'" . G  A 118 ? 1.64382 1.64472 1.46542 0.02620  0.06200  0.01820  220 G  A "C1'" 
2531 N  N9    . G  A 118 ? 1.61842 1.62352 1.43542 0.02340  0.06750  0.01490  220 G  A N9    
2532 C  C8    . G  A 118 ? 1.68762 1.69602 1.49162 0.02260  0.06900  0.01680  220 G  A C8    
2533 N  N7    . G  A 118 ? 1.72562 1.73802 1.52912 0.02020  0.07460  0.01210  220 G  A N7    
2534 C  C5    . G  A 118 ? 1.64352 1.65472 1.46072 0.01950  0.07640  0.00740  220 G  A C5    
2535 C  C6    . G  A 118 ? 1.66522 1.67892 1.48922 0.01760  0.08180  0.00150  220 G  A C6    
2536 O  O6    . G  A 118 ? 1.74262 1.76052 1.56222 0.01600  0.08640  -0.00160 220 G  A O6    
2537 N  N1    . G  A 118 ? 1.61752 1.62862 1.45482 0.01790  0.08160  -0.00070 220 G  A N1    
2538 C  C2    . G  A 118 ? 1.56362 1.57092 1.40642 0.01960  0.07730  0.00180  220 G  A C2    
2539 N  N2    . G  A 118 ? 1.55032 1.55632 1.40472 0.01960  0.07810  -0.00060 220 G  A N2    
2540 N  N3    . G  A 118 ? 1.55732 1.56242 1.39462 0.02150  0.07250  0.00640  220 G  A N3    
2541 C  C4    . G  A 118 ? 1.57402 1.58092 1.39902 0.02140  0.07220  0.00920  220 G  A C4    
2542 P  P     . U  A 119 ? 1.60502 1.62702 1.42662 0.03360  0.04330  0.00180  221 U  A P     
2543 O  OP1   . U  A 119 ? 1.47632 1.50102 1.30422 0.03690  0.03650  0.00060  221 U  A OP1   
2544 O  OP2   . U  A 119 ? 1.56882 1.59572 1.37702 0.03250  0.04420  0.00080  221 U  A OP2   
2545 O  "O5'" . U  A 119 ? 1.47882 1.50082 1.31232 0.03080  0.04880  -0.00450 221 U  A "O5'" 
2546 C  "C5'" . U  A 119 ? 1.47982 1.49882 1.32612 0.03130  0.04910  -0.00500 221 U  A "C5'" 
2547 C  "C4'" . U  A 119 ? 1.31722 1.33522 1.17152 0.02850  0.05510  -0.00900 221 U  A "C4'" 
2548 O  "O4'" . U  A 119 ? 1.30282 1.31702 1.15192 0.02650  0.06020  -0.00530 221 U  A "O4'" 
2549 C  "C3'" . U  A 119 ? 1.30882 1.33272 1.16592 0.02680  0.05630  -0.01720 221 U  A "C3'" 
2550 O  "O3'" . U  A 119 ? 1.35942 1.38702 1.22642 0.02740  0.05340  -0.02210 221 U  A "O3'" 
2551 C  "C2'" . U  A 119 ? 1.31562 1.33662 1.17662 0.02430  0.06300  -0.01800 221 U  A "C2'" 
2552 O  "O2'" . U  A 119 ? 1.37562 1.39402 1.24842 0.02410  0.06460  -0.01790 221 U  A "O2'" 
2553 C  "C1'" . U  A 119 ? 1.39172 1.40822 1.24432 0.02420  0.06490  -0.01070 221 U  A "C1'" 
2554 N  N1    . U  A 119 ? 1.47282 1.49202 1.31422 0.02300  0.06710  -0.01120 221 U  A N1    
2555 C  C2    . U  A 119 ? 1.46652 1.48692 1.31032 0.02080  0.07270  -0.01540 221 U  A C2    
2556 O  O2    . U  A 119 ? 1.37032 1.38922 1.22502 0.02000  0.07550  -0.01790 221 U  A O2    
2557 N  N3    . U  A 119 ? 1.52782 1.55152 1.36082 0.01980  0.07510  -0.01620 221 U  A N3    
2558 C  C4    . U  A 119 ? 1.51262 1.53852 1.33192 0.02070  0.07230  -0.01270 221 U  A C4    
2559 O  O4    . U  A 119 ? 1.54082 1.57042 1.35042 0.01950  0.07540  -0.01400 221 U  A O4    
2560 C  C5    . U  A 119 ? 1.48492 1.50882 1.30252 0.02310  0.06600  -0.00780 221 U  A C5    
2561 C  C6    . U  A 119 ? 1.49862 1.51932 1.32762 0.02420  0.06370  -0.00760 221 U  A C6    
2562 P  P     . C  A 120 ? 1.37412 1.40962 1.24142 0.02680  0.05040  -0.03040 222 C  A P     
2563 O  OP1   . C  A 120 ? 1.17712 1.21602 1.05532 0.02770  0.04660  -0.03330 222 C  A OP1   
2564 O  OP2   . C  A 120 ? 1.38122 1.41972 1.23382 0.02780  0.04750  -0.02920 222 C  A OP2   
2565 O  "O5'" . C  A 120 ? 1.28392 1.31912 1.15652 0.02370  0.05630  -0.03620 222 C  A "O5'" 
2566 C  "C5'" . C  A 120 ? 1.22192 1.25382 1.10732 0.02250  0.06010  -0.03670 222 C  A "C5'" 
2567 C  "C4'" . C  A 120 ? 1.28742 1.31712 1.17452 0.02040  0.06610  -0.03930 222 C  A "C4'" 
2568 O  "O4'" . C  A 120 ? 1.37382 1.40092 1.25062 0.02050  0.06860  -0.03430 222 C  A "O4'" 
2569 C  "C3'" . C  A 120 ? 1.22342 1.25772 1.11062 0.01890  0.06660  -0.04810 222 C  A "C3'" 
2570 O  "O3'" . C  A 120 ? 1.26072 1.29622 1.16122 0.01760  0.06650  -0.05390 222 C  A "O3'" 
2571 C  "C2'" . C  A 120 ? 1.32502 1.35672 1.20892 0.01780  0.07240  -0.04800 222 C  A "C2'" 
2572 O  "O2'" . C  A 120 ? 1.34982 1.37742 1.24602 0.01690  0.07670  -0.04800 222 C  A "O2'" 
2573 C  "C1'" . C  A 120 ? 1.34852 1.37732 1.22262 0.01900  0.07250  -0.03910 222 C  A "C1'" 
2574 N  N1    . C  A 120 ? 1.30722 1.33942 1.16642 0.01950  0.07090  -0.03850 222 C  A N1    
2575 C  C2    . C  A 120 ? 1.36372 1.39742 1.21692 0.01820  0.07560  -0.04090 222 C  A C2    
2576 O  O2    . C  A 120 ? 1.35122 1.38302 1.21282 0.01710  0.08060  -0.04350 222 C  A O2    
2577 N  N3    . C  A 120 ? 1.45122 1.48872 1.28972 0.01850  0.07470  -0.03990 222 C  A N3    
2578 C  C4    . C  A 120 ? 1.46192 1.50122 1.29202 0.02020  0.06880  -0.03640 222 C  A C4    
2579 N  N4    . C  A 120 ? 1.46152 1.50452 1.27632 0.02060  0.06800  -0.03470 222 C  A N4    
2580 C  C5    . C  A 120 ? 1.42462 1.46222 1.26182 0.02180  0.06350  -0.03430 222 C  A C5    
2581 C  C6    . C  A 120 ? 1.36692 1.40132 1.21842 0.02130  0.06510  -0.03570 222 C  A C6    
2582 P  P     . C  A 121 ? 1.26744 1.30914 1.16984 0.01620  0.06420  -0.06440 223 C  A P     
2583 O  OP1   . C  A 121 ? 1.35434 1.39624 1.27284 0.01470  0.06400  -0.06830 223 C  A OP1   
2584 O  OP2   . C  A 121 ? 1.24074 1.28834 1.13024 0.01780  0.05850  -0.06480 223 C  A OP2   
2585 O  "O5'" . C  A 121 ? 1.28114 1.32164 1.18194 0.01490  0.06950  -0.06930 223 C  A "O5'" 
2586 C  "C5'" . C  A 121 ? 1.31064 1.34614 1.22334 0.01370  0.07490  -0.07000 223 C  A "C5'" 
2587 C  "C4'" . C  A 121 ? 1.31994 1.35564 1.23014 0.01300  0.07930  -0.07540 223 C  A "C4'" 
2588 O  "O4'" . C  A 121 ? 1.30244 1.33784 1.19954 0.01410  0.08120  -0.06980 223 C  A "O4'" 
2589 C  "C3'" . C  A 121 ? 1.23014 1.27214 1.13674 0.01220  0.07740  -0.08620 223 C  A "C3'" 
2590 O  "O3'" . C  A 121 ? 1.20884 1.25054 1.13014 0.01040  0.07740  -0.09440 223 C  A "O3'" 
2591 C  "C2'" . C  A 121 ? 1.23954 1.28214 1.13764 0.01240  0.08220  -0.08800 223 C  A "C2'" 
2592 O  "O2'" . C  A 121 ? 1.36354 1.40184 1.27434 0.01170  0.08770  -0.09140 223 C  A "O2'" 
2593 C  "C1'" . C  A 121 ? 1.23394 1.27374 1.12314 0.01370  0.08320  -0.07650 223 C  A "C1'" 
2594 N  N1    . C  A 121 ? 1.24844 1.29294 1.12044 0.01460  0.07970  -0.07360 223 C  A N1    
2595 C  C2    . C  A 121 ? 1.30364 1.35234 1.16334 0.01450  0.08240  -0.07660 223 C  A C2    
2596 O  O2    . C  A 121 ? 1.35184 1.40064 1.21614 0.01370  0.08770  -0.08240 223 C  A O2    
2597 N  N3    . C  A 121 ? 1.28794 1.34084 1.13124 0.01540  0.07930  -0.07290 223 C  A N3    
2598 C  C4    . C  A 121 ? 1.31654 1.36884 1.15634 0.01670  0.07340  -0.06660 223 C  A C4    
2599 N  N4    . C  A 121 ? 1.43164 1.48754 1.25534 0.01790  0.07030  -0.06220 223 C  A N4    
2600 C  C5    . C  A 121 ? 1.29004 1.33844 1.14294 0.01700  0.07070  -0.06430 223 C  A C5    
2601 C  C6    . C  A 121 ? 1.29404 1.33884 1.16204 0.01580  0.07410  -0.06780 223 C  A C6    
2602 P  P     . U  A 122 ? 1.24925 1.29835 1.17045 0.00930  0.07200  -0.10470 224 U  A P     
2603 O  OP1   . U  A 122 ? 1.29425 1.34085 1.23445 0.00700  0.07320  -0.11130 224 U  A OP1   
2604 O  OP2   . U  A 122 ? 1.22575 1.27945 1.13755 0.01070  0.06570  -0.09970 224 U  A OP2   
2605 O  "O5'" . U  A 122 ? 1.33145 1.38545 1.24105 0.00940  0.07350  -0.11280 224 U  A "O5'" 
2606 C  "C5'" . U  A 122 ? 1.34175 1.39275 1.25805 0.00860  0.07950  -0.11890 224 U  A "C5'" 
2607 C  "C4'" . U  A 122 ? 1.26525 1.32175 1.16675 0.00930  0.08150  -0.12390 224 U  A "C4'" 
2608 O  "O4'" . U  A 122 ? 1.27745 1.33395 1.16395 0.01090  0.08250  -0.11330 224 U  A "O4'" 
2609 C  "C3'" . U  A 122 ? 1.32605 1.39205 1.21735 0.00900  0.07630  -0.13340 224 U  A "C3'" 
2610 O  "O3'" . U  A 122 ? 1.36605 1.43365 1.26895 0.00720  0.07650  -0.14710 224 U  A "O3'" 
2611 C  "C2'" . U  A 122 ? 1.36935 1.43985 1.24095 0.01030  0.07890  -0.13150 224 U  A "C2'" 
2612 O  "O2'" . U  A 122 ? 1.39515 1.46585 1.26985 0.00990  0.08530  -0.13980 224 U  A "O2'" 
2613 C  "C1'" . U  A 122 ? 1.31715 1.38145 1.18595 0.01150  0.08130  -0.11680 224 U  A "C1'" 
2614 N  N1    . U  A 122 ? 1.25345 1.32035 1.10895 0.01280  0.07570  -0.10800 224 U  A N1    
2615 C  C2    . U  A 122 ? 1.36475 1.43715 1.20075 0.01370  0.07550  -0.10590 224 U  A C2    
2616 O  O2    . U  A 122 ? 1.41975 1.49575 1.24895 0.01330  0.08020  -0.11130 224 U  A O2    
2617 N  N3    . U  A 122 ? 1.35175 1.42555 1.17675 0.01520  0.07000  -0.09710 224 U  A N3    
2618 C  C4    . U  A 122 ? 1.31435 1.38505 1.14625 0.01600  0.06480  -0.09120 224 U  A C4    
2619 O  O4    . U  A 122 ? 1.30795 1.38005 1.12925 0.01780  0.06010  -0.08370 224 U  A O4    
2620 C  C5    . U  A 122 ? 1.31655 1.38245 1.16825 0.01480  0.06580  -0.09440 224 U  A C5    
2621 C  C6    . U  A 122 ? 1.26335 1.32735 1.12565 0.01320  0.07100  -0.10200 224 U  A C6    
2622 P  P     . A  A 123 ? 1.43655 1.51185 1.34065 0.00590  0.06880  -0.15680 225 A  A P     
2623 O  OP1   . A  A 123 ? 1.47165 1.54635 1.39075 0.00370  0.07080  -0.17100 225 A  A OP1   
2624 O  OP2   . A  A 123 ? 1.39855 1.47275 1.30735 0.00600  0.06370  -0.14830 225 A  A OP2   
2625 O  "O5'" . A  A 123 ? 1.37635 1.46195 1.25675 0.00750  0.06540  -0.15910 225 A  A "O5'" 
2626 C  "C5'" . A  A 123 ? 1.40235 1.49135 1.27225 0.00790  0.07030  -0.16520 225 A  A "C5'" 
2627 C  "C4'" . A  A 123 ? 1.41945 1.51945 1.26685 0.00910  0.06580  -0.16770 225 A  A "C4'" 
2628 O  "O4'" . A  A 123 ? 1.37655 1.47605 1.20895 0.01110  0.06460  -0.15270 225 A  A "O4'" 
2629 C  "C3'" . A  A 123 ? 1.40915 1.51765 1.25665 0.00850  0.05680  -0.17650 225 A  A "C3'" 
2630 O  "O3'" . A  A 123 ? 1.52625 1.64525 1.35795 0.00890  0.05540  -0.18710 225 A  A "O3'" 
2631 C  "C2'" . A  A 123 ? 1.36105 1.47045 1.19985 0.01040  0.05060  -0.16340 225 A  A "C2'" 
2632 O  "O2'" . A  A 123 ? 1.47555 1.59565 1.30425 0.01120  0.04170  -0.16790 225 A  A "O2'" 
2633 C  "C1'" . A  A 123 ? 1.35455 1.46125 1.17685 0.01220  0.05570  -0.15150 225 A  A "C1'" 
2634 N  N9    . A  A 123 ? 1.37025 1.47215 1.18945 0.01390  0.05340  -0.13600 225 A  A N9    
2635 C  C8    . A  A 123 ? 1.43825 1.53225 1.27305 0.01360  0.05300  -0.12920 225 A  A C8    
2636 N  N7    . A  A 123 ? 1.42005 1.51145 1.24765 0.01550  0.05080  -0.11630 225 A  A N7    
2637 C  C5    . A  A 123 ? 1.38355 1.48095 1.18975 0.01710  0.04940  -0.11370 225 A  A C5    
2638 C  C6    . A  A 123 ? 1.37065 1.46805 1.16125 0.01940  0.04700  -0.10140 225 A  A C6    
2639 N  N6    . A  A 123 ? 1.31435 1.40525 1.10915 0.02080  0.04520  -0.09000 225 A  A N6    
2640 N  N1    . A  A 123 ? 1.42135 1.52555 1.19155 0.02030  0.04660  -0.10120 225 A  A N1    
2641 C  C2    . A  A 123 ? 1.47025 1.58155 1.23575 0.01910  0.04860  -0.11340 225 A  A C2    
2642 N  N3    . A  A 123 ? 1.46395 1.57595 1.24335 0.01700  0.05080  -0.12670 225 A  A N3    
2643 C  C4    . A  A 123 ? 1.37215 1.47655 1.17225 0.01610  0.05110  -0.12560 225 A  A C4    
2644 P  P     . A  A 124 ? 1.48324 1.60634 1.32574 0.00670  0.05600  -0.20700 226 A  A P     
2645 O  OP1   . A  A 124 ? 1.39034 1.50234 1.25484 0.00510  0.06330  -0.20890 226 A  A OP1   
2646 O  OP2   . A  A 124 ? 1.44314 1.57444 1.28834 0.00580  0.04630  -0.21510 226 A  A OP2   
2647 O  "O5'" . A  A 124 ? 1.52834 1.65994 1.35024 0.00780  0.05980  -0.21370 226 A  A "O5'" 
2648 C  "C5'" . A  A 124 ? 1.55734 1.68694 1.38624 0.00700  0.06770  -0.22450 226 A  A "C5'" 
2649 C  "C4'" . A  A 124 ? 1.48584 1.62134 1.29324 0.00860  0.07350  -0.22280 226 A  A "C4'" 
2650 O  "O4'" . A  A 124 ? 1.43104 1.55904 1.23494 0.00980  0.07850  -0.20540 226 A  A "O4'" 
2651 C  "C3'" . A  A 124 ? 1.49034 1.63894 1.27144 0.01000  0.06770  -0.22330 226 A  A "C3'" 
2652 O  "O3'" . A  A 124 ? 1.46794 1.62694 1.24504 0.00930  0.06530  -0.24190 226 A  A "O3'" 
2653 C  "C2'" . A  A 124 ? 1.53884 1.68774 1.30164 0.01150  0.07480  -0.21180 226 A  A "C2'" 
2654 O  "O2'" . A  A 124 ? 1.51774 1.67054 1.27784 0.01120  0.08300  -0.22270 226 A  A "O2'" 
2655 C  "C1'" . A  A 124 ? 1.49134 1.62664 1.26984 0.01130  0.07890  -0.19810 226 A  A "C1'" 
2656 N  N9    . A  A 124 ? 1.41824 1.55064 1.19024 0.01230  0.07320  -0.18190 226 A  A N9    
2657 C  C8    . A  A 124 ? 1.37924 1.50504 1.16584 0.01200  0.06770  -0.17630 226 A  A C8    
2658 N  N7    . A  A 124 ? 1.40184 1.52664 1.17864 0.01350  0.06350  -0.16220 226 A  A N7    
2659 C  C5    . A  A 124 ? 1.36034 1.49094 1.11444 0.01460  0.06630  -0.15770 226 A  A C5    
2660 C  C6    . A  A 124 ? 1.36444 1.49624 1.09994 0.01640  0.06430  -0.14340 226 A  A C6    
2661 N  N6    . A  A 124 ? 1.32234 1.44944 1.05944 0.01760  0.05850  -0.13140 226 A  A N6    
2662 N  N1    . A  A 124 ? 1.41214 1.55024 1.12724 0.01680  0.06880  -0.14170 226 A  A N1    
2663 C  C2    . A  A 124 ? 1.43034 1.57394 1.14384 0.01570  0.07500  -0.15440 226 A  A C2    
2664 N  N3    . A  A 124 ? 1.48834 1.63124 1.21874 0.01440  0.07720  -0.16920 226 A  A N3    
2665 C  C4    . A  A 124 ? 1.42874 1.56454 1.17924 0.01380  0.07250  -0.16970 226 A  A C4    
2666 P  P     . G  A 125 ? 1.56978 1.74008 1.33878 0.00930  0.05320  -0.24890 227 G  A P     
2667 O  OP1   . G  A 125 ? 1.42938 1.61008 1.19428 0.00850  0.05290  -0.26950 227 G  A OP1   
2668 O  OP2   . G  A 125 ? 1.54848 1.71198 1.33768 0.00810  0.04700  -0.24480 227 G  A OP2   
2669 O  "O5'" . G  A 125 ? 1.44688 1.62448 1.18708 0.01200  0.04970  -0.23480 227 G  A "O5'" 
2670 C  "C5'" . G  A 125 ? 1.41478 1.59988 1.13138 0.01320  0.05510  -0.23460 227 G  A "C5'" 
2671 C  "C4'" . G  A 125 ? 1.43328 1.61968 1.12828 0.01550  0.05320  -0.21570 227 G  A "C4'" 
2672 O  "O4'" . G  A 125 ? 1.42438 1.59708 1.13048 0.01540  0.05820  -0.19980 227 G  A "O4'" 
2673 C  "C3'" . G  A 125 ? 1.38258 1.57468 1.06988 0.01710  0.04080  -0.21050 227 G  A "C3'" 
2674 O  "O3'" . G  A 125 ? 1.43508 1.64268 1.10208 0.01820  0.03480  -0.21990 227 G  A "O3'" 
2675 C  "C2'" . G  A 125 ? 1.40958 1.59468 1.08778 0.01880  0.04180  -0.18850 227 G  A "C2'" 
2676 O  "O2'" . G  A 125 ? 1.31208 1.50388 0.96358 0.02020  0.04540  -0.18210 227 G  A "O2'" 
2677 C  "C1'" . G  A 125 ? 1.44338 1.61458 1.14118 0.01710  0.05150  -0.18410 227 G  A "C1'" 
2678 N  N9    . G  A 125 ? 1.46158 1.62318 1.18298 0.01640  0.04770  -0.18080 227 G  A N9    
2679 C  C8    . G  A 125 ? 1.48008 1.63628 1.22598 0.01430  0.04920  -0.19150 227 G  A C8    
2680 N  N7    . G  A 125 ? 1.48738 1.63598 1.24968 0.01400  0.04540  -0.18500 227 G  A N7    
2681 C  C5    . G  A 125 ? 1.43588 1.58478 1.18428 0.01630  0.04110  -0.16980 227 G  A C5    
2682 C  C6    . G  A 125 ? 1.37988 1.52278 1.13638 0.01740  0.03610  -0.15800 227 G  A C6    
2683 O  O6    . G  A 125 ? 1.36588 1.50248 1.14328 0.01620  0.03490  -0.15850 227 G  A O6    
2684 N  N1    . G  A 125 ? 1.38348 1.52828 1.12098 0.02010  0.03280  -0.14460 227 G  A N1    
2685 C  C2    . G  A 125 ? 1.40628 1.55778 1.11958 0.02140  0.03420  -0.14180 227 G  A C2    
2686 N  N2    . G  A 125 ? 1.42528 1.57678 1.12358 0.02400  0.03050  -0.12720 227 G  A N2    
2687 N  N3    . G  A 125 ? 1.41688 1.57488 1.12138 0.02020  0.03910  -0.15250 227 G  A N3    
2688 C  C4    . G  A 125 ? 1.43288 1.58918 1.15618 0.01780  0.04230  -0.16660 227 G  A C4    
2689 P  P     . U  A 126 ? 1.52015 1.73675 1.19105 0.01860  0.02120  -0.22940 228 U  A P     
2690 O  OP1   . U  A 126 ? 1.61675 1.84995 1.26535 0.01960  0.01730  -0.24140 228 U  A OP1   
2691 O  OP2   . U  A 126 ? 1.52805 1.73705 1.23025 0.01590  0.02070  -0.23910 228 U  A OP2   
2692 O  "O5'" . U  A 126 ? 1.50585 1.72035 1.16935 0.02140  0.01350  -0.21000 228 U  A "O5'" 
2693 C  "C5'" . U  A 126 ? 1.48775 1.70675 1.12405 0.02430  0.01300  -0.19610 228 U  A "C5'" 
2694 C  "C4'" . U  A 126 ? 1.50805 1.72025 1.14575 0.02660  0.00740  -0.17750 228 U  A "C4'" 
2695 O  "O4'" . U  A 126 ? 1.53545 1.73165 1.19175 0.02510  0.01510  -0.16820 228 U  A "O4'" 
2696 C  "C3'" . U  A 126 ? 1.48605 1.70215 1.13625 0.02770  -0.00500 -0.18090 228 U  A "C3'" 
2697 O  "O3'" . U  A 126 ? 1.50465 1.73545 1.13535 0.03050  -0.01550 -0.18330 228 U  A "O3'" 
2698 C  "C2'" . U  A 126 ? 1.52165 1.72485 1.18285 0.02890  -0.00500 -0.16340 228 U  A "C2'" 
2699 O  "O2'" . U  A 126 ? 1.55995 1.76435 1.20005 0.03250  -0.00830 -0.14690 228 U  A "O2'" 
2700 C  "C1'" . U  A 126 ? 1.47415 1.66465 1.14505 0.02620  0.00820  -0.16040 228 U  A "C1'" 
2701 N  N1    . U  A 126 ? 1.48075 1.66385 1.18035 0.02330  0.01070  -0.16950 228 U  A N1    
2702 C  C2    . U  A 126 ? 1.48825 1.66225 1.20525 0.02360  0.00830  -0.16060 228 U  A C2    
2703 O  O2    . U  A 126 ? 1.54345 1.71525 1.25375 0.02630  0.00420  -0.14650 228 U  A O2    
2704 N  N3    . U  A 126 ? 1.38875 1.55635 1.13115 0.02060  0.01120  -0.16870 228 U  A N3    
2705 C  C4    . U  A 126 ? 1.42865 1.59715 1.18175 0.01760  0.01590  -0.18440 228 U  A C4    
2706 O  O4    . U  A 126 ? 1.50975 1.67125 1.28635 0.01520  0.01800  -0.18910 228 U  A O4    
2707 C  C5    . U  A 126 ? 1.45865 1.63635 1.19365 0.01770  0.01790  -0.19370 228 U  A C5    
2708 C  C6    . U  A 126 ? 1.45735 1.64225 1.16635 0.02040  0.01540  -0.18620 228 U  A C6    
2709 P  P     . C  A 127 ? 1.59864 1.84114 1.24054 0.03010  -0.02710 -0.20010 229 C  A P     
2710 O  OP1   . C  A 127 ? 1.57684 1.83624 1.19224 0.03280  -0.03510 -0.20440 229 C  A OP1   
2711 O  OP2   . C  A 127 ? 1.54224 1.78084 1.20754 0.02560  -0.02140 -0.21690 229 C  A OP2   
2712 O  "O5'" . C  A 127 ? 1.59464 1.83204 1.25254 0.03200  -0.03520 -0.18930 229 C  A "O5'" 
2713 C  "C5'" . C  A 127 ? 1.59824 1.83554 1.24124 0.03640  -0.04070 -0.17130 229 C  A "C5'" 
2714 C  "C4'" . C  A 127 ? 1.57314 1.80284 1.23704 0.03760  -0.04530 -0.16260 229 C  A "C4'" 
2715 O  "O4'" . C  A 127 ? 1.65004 1.86304 1.32954 0.03520  -0.03450 -0.15540 229 C  A "O4'" 
2716 C  "C3'" . C  A 127 ? 1.58144 1.81724 1.26864 0.03600  -0.05310 -0.17630 229 C  A "C3'" 
2717 O  "O3'" . C  A 127 ? 1.65944 1.91054 1.33774 0.03920  -0.06650 -0.18010 229 C  A "O3'" 
2718 C  "C2'" . C  A 127 ? 1.62124 1.84384 1.33084 0.03580  -0.05060 -0.16620 229 C  A "C2'" 
2719 O  "O2'" . C  A 127 ? 1.71124 1.93444 1.41484 0.04060  -0.05820 -0.15170 229 C  A "O2'" 
2720 C  "C1'" . C  A 127 ? 1.58564 1.79404 1.29214 0.03400  -0.03720 -0.15780 229 C  A "C1'" 
2721 N  N1    . C  A 127 ? 1.51384 1.71614 1.23974 0.02910  -0.02870 -0.16980 229 C  A N1    
2722 C  C2    . C  A 127 ? 1.51284 1.70614 1.26494 0.02710  -0.02680 -0.16910 229 C  A C2    
2723 O  O2    . C  A 127 ? 1.49474 1.68594 1.25324 0.02950  -0.03190 -0.15920 229 C  A O2    
2724 N  N3    . C  A 127 ? 1.52604 1.71324 1.29584 0.02290  -0.01930 -0.17900 229 C  A N3    
2725 C  C4    . C  A 127 ? 1.50624 1.69604 1.26944 0.02080  -0.01400 -0.19000 229 C  A C4    
2726 N  N4    . C  A 127 ? 1.51304 1.69604 1.29504 0.01690  -0.00690 -0.19930 229 C  A N4    
2727 C  C5    . C  A 127 ? 1.49964 1.69914 1.23634 0.02270  -0.01560 -0.19200 229 C  A C5    
2728 C  C6    . C  A 127 ? 1.50934 1.71474 1.22774 0.02670  -0.02290 -0.18130 229 C  A C6    
2729 P  P     . A  A 128 ? 1.75506 2.01936 1.44836 0.03660  -0.07450 -0.20160 230 A  A P     
2730 O  OP1   . A  A 128 ? 1.64846 1.92986 1.32386 0.04080  -0.08780 -0.20340 230 A  A OP1   
2731 O  OP2   . A  A 128 ? 1.66566 1.92786 1.36456 0.03170  -0.06550 -0.21700 230 A  A OP2   
2732 O  "O5'" . A  A 128 ? 1.66756 1.92566 1.39266 0.03530  -0.07660 -0.20060 230 A  A "O5'" 
2733 C  "C5'" . A  A 128 ? 1.67966 1.93616 1.40776 0.03960  -0.08300 -0.18620 230 A  A "C5'" 
2734 C  "C4'" . A  A 128 ? 1.77126 2.01836 1.52966 0.03720  -0.08000 -0.18500 230 A  A "C4'" 
2735 O  "O4'" . A  A 128 ? 1.68956 1.92006 1.45356 0.03440  -0.06650 -0.17900 230 A  A "O4'" 
2736 C  "C3'" . A  A 128 ? 1.80996 2.06356 1.59346 0.03270  -0.08270 -0.20300 230 A  A "C3'" 
2737 O  "O3'" . A  A 128 ? 1.89286 2.16106 1.68196 0.03490  -0.09600 -0.20800 230 A  A "O3'" 
2738 C  "C2'" . A  A 128 ? 1.69326 1.93186 1.50106 0.02950  -0.07350 -0.19820 230 A  A "C2'" 
2739 O  "O2'" . A  A 128 ? 1.67356 1.91126 1.49236 0.03260  -0.07830 -0.18770 230 A  A "O2'" 
2740 C  "C1'" . A  A 128 ? 1.69746 1.92236 1.48996 0.03000  -0.06240 -0.18650 230 A  A "C1'" 
2741 N  N9    . A  A 128 ? 1.71776 1.93726 1.51366 0.02530  -0.05270 -0.19690 230 A  A N9    
2742 C  C8    . A  A 128 ? 1.67996 1.90276 1.45696 0.02480  -0.04930 -0.20320 230 A  A C8    
2743 N  N7    . A  A 128 ? 1.62366 1.83976 1.41116 0.02050  -0.04030 -0.21240 230 A  A N7    
2744 C  C5    . A  A 128 ? 1.59156 1.79916 1.40596 0.01800  -0.03780 -0.21140 230 A  A C5    
2745 C  C6    . A  A 128 ? 1.57206 1.76976 1.40826 0.01340  -0.02930 -0.21760 230 A  A C6    
2746 N  N6    . A  A 128 ? 1.58186 1.77606 1.41736 0.01080  -0.02180 -0.22690 230 A  A N6    
2747 N  N1    . A  A 128 ? 1.57326 1.76496 1.43256 0.01190  -0.02870 -0.21360 230 A  A N1    
2748 C  C2    . A  A 128 ? 1.61216 1.80786 1.47306 0.01470  -0.03590 -0.20490 230 A  A C2    
2749 N  N3    . A  A 128 ? 1.61846 1.82296 1.46136 0.01940  -0.04440 -0.19880 230 A  A N3    
2750 C  C4    . A  A 128 ? 1.64726 1.85726 1.46676 0.02070  -0.04500 -0.20210 230 A  A C4    
2751 P  P     . A  A 129 ? 1.88415 2.16615 1.68885 0.03080  -0.10260 -0.23010 231 A  A P     
2752 O  OP1   . A  A 129 ? 1.88355 2.18195 1.68685 0.03490  -0.11750 -0.23120 231 A  A OP1   
2753 O  OP2   . A  A 129 ? 1.88605 2.16985 1.67885 0.02770  -0.09770 -0.24290 231 A  A OP2   
2754 O  "O5'" . A  A 129 ? 1.83065 2.10355 1.66975 0.02570  -0.09640 -0.23380 231 A  A "O5'" 
2755 C  "C5'" . A  A 129 ? 1.80185 2.07155 1.65725 0.02760  -0.09840 -0.22340 231 A  A "C5'" 
2756 C  "C4'" . A  A 129 ? 1.78725 2.04735 1.67225 0.02200  -0.09010 -0.22730 231 A  A "C4'" 
2757 O  "O4'" . A  A 129 ? 1.81805 2.06085 1.69925 0.02040  -0.07690 -0.21940 231 A  A "O4'" 
2758 C  "C3'" . A  A 129 ? 1.83365 2.09975 1.73725 0.01580  -0.09050 -0.24720 231 A  A "C3'" 
2759 O  "O3'" . A  A 129 ? 1.88005 2.16115 1.79965 0.01540  -0.10140 -0.25620 231 A  A "O3'" 
2760 C  "C2'" . A  A 129 ? 1.82565 2.07555 1.74905 0.01090  -0.07770 -0.24510 231 A  A "C2'" 
2761 O  "O2'" . A  A 129 ? 1.84075 2.08875 1.78625 0.01040  -0.07770 -0.23890 231 A  A "O2'" 
2762 C  "C1'" . A  A 129 ? 1.78015 2.01685 1.68245 0.01410  -0.06940 -0.23000 231 A  A "C1'" 
2763 N  N9    . A  A 129 ? 1.71935 1.95255 1.60795 0.01220  -0.06340 -0.23730 231 A  A N9    
2764 C  C8    . A  A 129 ? 1.76125 2.00065 1.62255 0.01510  -0.06620 -0.23840 231 A  A C8    
2765 N  N7    . A  A 129 ? 1.76515 2.00005 1.62085 0.01250  -0.05880 -0.24630 231 A  A N7    
2766 C  C5    . A  A 129 ? 1.72685 1.95125 1.60825 0.00760  -0.05100 -0.25030 231 A  A C5    
2767 C  C6    . A  A 129 ? 1.75085 1.96595 1.64145 0.00350  -0.04130 -0.25850 231 A  A C6    
2768 N  N6    . A  A 129 ? 1.76825 1.98375 1.64295 0.00350  -0.03730 -0.26530 231 A  A N6    
2769 N  N1    . A  A 129 ? 1.73435 1.93975 1.65165 -0.00060 -0.03560 -0.25920 231 A  A N1    
2770 C  C2    . A  A 129 ? 1.72255 1.92845 1.65575 -0.00070 -0.03890 -0.25260 231 A  A C2    
2771 N  N3    . A  A 129 ? 1.71445 1.92895 1.64195 0.00300  -0.04760 -0.24540 231 A  A N3    
2772 C  C4    . A  A 129 ? 1.68985 1.91315 1.59115 0.00720  -0.05360 -0.24450 231 A  A C4    
2773 P  P     . C  A 130 ? 1.98270 2.27900 1.90630 0.01180  -0.10920 -0.27810 232 C  A P     
2774 O  OP1   . C  A 130 ? 2.04870 2.36150 1.98540 0.01330  -0.12200 -0.28280 232 C  A OP1   
2775 O  OP2   . C  A 130 ? 1.92210 2.22110 1.81600 0.01390  -0.10960 -0.28140 232 C  A OP2   
2776 O  "O5'" . C  A 130 ? 1.90980 2.19660 1.86020 0.00390  -0.09950 -0.28930 232 C  A "O5'" 
2777 C  "C5'" . C  A 130 ? 1.89400 2.17470 1.87310 0.00060  -0.09520 -0.28560 232 C  A "C5'" 
2778 C  "C4'" . C  A 130 ? 1.90540 2.17200 1.90190 -0.00580 -0.08310 -0.29100 232 C  A "C4'" 
2779 O  "O4'" . C  A 130 ? 1.87070 2.12150 1.85060 -0.00400 -0.07260 -0.27910 232 C  A "O4'" 
2780 C  "C3'" . C  A 130 ? 1.98590 2.25690 1.98770 -0.01080 -0.08380 -0.31130 232 C  A "C3'" 
2781 O  "O3'" . C  A 130 ? 2.02550 2.30840 2.05140 -0.01510 -0.09100 -0.32600 232 C  A "O3'" 
2782 C  "C2'" . C  A 130 ? 1.96390 2.21610 1.97260 -0.01430 -0.06970 -0.30900 232 C  A "C2'" 
2783 O  "O2'" . C  A 130 ? 1.96200 2.20650 2.00040 -0.01900 -0.06410 -0.30690 232 C  A "O2'" 
2784 C  "C1'" . C  A 130 ? 1.89050 2.13320 1.87570 -0.00870 -0.06470 -0.28960 232 C  A "C1'" 
2785 N  N1    . C  A 130 ? 1.84850 2.09280 1.80510 -0.00570 -0.06460 -0.29200 232 C  A N1    
2786 C  C2    . C  A 130 ? 1.84770 2.08170 1.80370 -0.00850 -0.05500 -0.29800 232 C  A C2    
2787 O  O2    . C  A 130 ? 1.81170 2.03480 1.79060 -0.01310 -0.04730 -0.30030 232 C  A O2    
2788 N  N3    . C  A 130 ? 1.83970 2.07600 1.77030 -0.00590 -0.05410 -0.30090 232 C  A N3    
2789 C  C4    . C  A 130 ? 1.83970 2.08770 1.74520 -0.00100 -0.06240 -0.29730 232 C  A C4    
2790 N  N4    . C  A 130 ? 1.83880 2.08920 1.71930 0.00110  -0.06060 -0.29990 232 C  A N4    
2791 C  C5    . C  A 130 ? 1.84940 2.10750 1.75480 0.00210  -0.07280 -0.29060 232 C  A C5    
2792 C  C6    . C  A 130 ? 1.85200 2.10800 1.78360 -0.00020 -0.07350 -0.28860 232 C  A C6    
2793 P  P     . A  A 131 ? 2.22480 2.52230 2.24800 -0.01750 -0.09960 -0.34830 233 A  A P     
2794 O  OP1   . A  A 131 ? 2.25490 2.56650 2.30330 -0.02080 -0.10880 -0.35910 233 A  A OP1   
2795 O  OP2   . A  A 131 ? 2.05490 2.35990 2.04270 -0.01130 -0.10520 -0.34620 233 A  A OP2   
2796 O  "O5'" . A  A 131 ? 2.10060 2.38470 2.13550 -0.02350 -0.08870 -0.35910 233 A  A "O5'" 
2797 C  "C5'" . A  A 131 ? 2.04580 2.31780 2.11120 -0.02940 -0.08000 -0.35870 233 A  A "C5'" 
2798 C  "C4'" . A  A 131 ? 2.06680 2.32260 2.13440 -0.03250 -0.06820 -0.36230 233 A  A "C4'" 
2799 O  "O4'" . A  A 131 ? 2.03500 2.27970 2.07820 -0.02740 -0.06100 -0.34630 233 A  A "O4'" 
2800 C  "C3'" . A  A 131 ? 2.13730 2.39870 2.19910 -0.03450 -0.07060 -0.38270 233 A  A "C3'" 
2801 O  "O3'" . A  A 131 ? 2.14450 2.41170 2.23390 -0.04110 -0.07430 -0.40130 233 A  A "O3'" 
2802 C  "C2'" . A  A 131 ? 2.13080 2.37470 2.18470 -0.03410 -0.05790 -0.37790 233 A  A "C2'" 
2803 O  "O2'" . A  A 131 ? 2.06830 2.29740 2.15100 -0.03960 -0.04870 -0.37810 233 A  A "O2'" 
2804 C  "C1'" . A  A 131 ? 2.05310 2.29150 2.08640 -0.02810 -0.05500 -0.35490 233 A  A "C1'" 
2805 N  N9    . A  A 131 ? 2.03830 2.28510 2.03720 -0.02230 -0.05950 -0.35310 233 A  A N9    
2806 C  C8    . A  A 131 ? 2.00310 2.26260 1.98190 -0.01700 -0.06910 -0.34610 233 A  A C8    
2807 N  N7    . A  A 131 ? 1.99020 2.25440 1.93910 -0.01280 -0.07030 -0.34560 233 A  A N7    
2808 C  C5    . A  A 131 ? 1.99100 2.24550 1.94090 -0.01540 -0.06080 -0.35380 233 A  A C5    
2809 C  C6    . A  A 131 ? 1.99940 2.25360 1.92570 -0.01330 -0.05660 -0.35770 233 A  A C6    
2810 N  N6    . A  A 131 ? 2.00330 2.26740 1.89830 -0.00820 -0.06140 -0.35310 233 A  A N6    
2811 N  N1    . A  A 131 ? 1.99130 2.23470 1.92790 -0.01650 -0.04680 -0.36640 233 A  A N1    
2812 C  C2    . A  A 131 ? 1.95940 2.19220 1.92720 -0.02160 -0.04200 -0.37000 233 A  A C2    
2813 N  N3    . A  A 131 ? 1.97630 2.20810 1.96750 -0.02430 -0.04490 -0.36630 233 A  A N3    
2814 C  C4    . A  A 131 ? 1.99990 2.24330 1.98070 -0.02100 -0.05440 -0.35850 233 A  A C4    
2815 P  P     . G  A 132 ? 2.23945 2.52555 2.32215 -0.04180 -0.08600 -0.42400 234 G  A P     
2816 O  OP1   . G  A 132 ? 2.20025 2.49905 2.30925 -0.04620 -0.09500 -0.43390 234 G  A OP1   
2817 O  OP2   . G  A 132 ? 2.22125 2.51685 2.26635 -0.03440 -0.09170 -0.41830 234 G  A OP2   
2818 O  "O5'" . G  A 132 ? 2.28925 2.56575 2.37955 -0.04610 -0.07840 -0.44040 234 G  A "O5'" 
2819 C  "C5'" . G  A 132 ? 2.22305 2.47925 2.33385 -0.05010 -0.06560 -0.43580 234 G  A "C5'" 
2820 C  "C4'" . G  A 132 ? 2.25295 2.49845 2.34975 -0.04860 -0.05690 -0.43960 234 G  A "C4'" 
2821 O  "O4'" . G  A 132 ? 2.19575 2.43845 2.26125 -0.04160 -0.05380 -0.42210 234 G  A "O4'" 
2822 C  "C3'" . G  A 132 ? 2.33795 2.59445 2.42505 -0.04910 -0.06210 -0.46270 234 G  A "C3'" 
2823 O  "O3'" . G  A 132 ? 2.43385 2.68735 2.55105 -0.05610 -0.06120 -0.48200 234 G  A "O3'" 
2824 C  "C2'" . G  A 132 ? 2.26755 2.51555 2.32895 -0.04450 -0.05360 -0.45720 234 G  A "C2'" 
2825 O  "O2'" . G  A 132 ? 2.26635 2.49605 2.34645 -0.04760 -0.04190 -0.45960 234 G  A "O2'" 
2826 C  "C1'" . G  A 132 ? 2.18145 2.42515 2.22555 -0.03920 -0.05130 -0.43110 234 G  A "C1'" 
2827 N  N9    . G  A 132 ? 2.15995 2.41835 2.16985 -0.03310 -0.05920 -0.42650 234 G  A N9    
2828 C  C8    . G  A 132 ? 2.12435 2.39645 2.12565 -0.03040 -0.07000 -0.41980 234 G  A C8    
2829 N  N7    . G  A 132 ? 2.11485 2.39715 2.08345 -0.02470 -0.07480 -0.41590 234 G  A N7    
2830 C  C5    . G  A 132 ? 2.10785 2.38335 2.06255 -0.02390 -0.06620 -0.42040 234 G  A C5    
2831 C  C6    . G  A 132 ? 2.11325 2.39485 2.03365 -0.01900 -0.06580 -0.41880 234 G  A C6    
2832 O  O6    . G  A 132 ? 2.12985 2.42375 2.02395 -0.01430 -0.07330 -0.41210 234 G  A O6    
2833 N  N1    . G  A 132 ? 2.12975 2.40145 2.04855 -0.02000 -0.05500 -0.42550 234 G  A N1    
2834 C  C2    . G  A 132 ? 2.15325 2.41055 2.09995 -0.02470 -0.04630 -0.43260 234 G  A C2    
2835 N  N2    . G  A 132 ? 2.16785 2.41765 2.10885 -0.02440 -0.03680 -0.43850 234 G  A N2    
2836 N  N3    . G  A 132 ? 2.14395 2.39475 2.12215 -0.02930 -0.04680 -0.43330 234 G  A N3    
2837 C  C4    . G  A 132 ? 2.14195 2.40275 2.12225 -0.02880 -0.05670 -0.42720 234 G  A C4    
2838 P  P     . A  A 133 ? 2.46615 2.73785 2.58535 -0.05880 -0.07220 -0.50950 235 A  A P     
2839 O  OP1   . A  A 133 ? 2.43695 2.69785 2.58255 -0.06500 -0.06600 -0.52730 235 A  A OP1   
2840 O  OP2   . A  A 133 ? 2.38845 2.67705 2.51425 -0.05980 -0.08470 -0.51020 235 A  A OP2   
2841 O  "O5'" . A  A 133 ? 2.37955 2.66115 2.45835 -0.05220 -0.07480 -0.51250 235 A  A "O5'" 
2842 C  "C5'" . A  A 133 ? 2.44465 2.73305 2.51725 -0.05320 -0.07650 -0.53580 235 A  A "C5'" 
2843 C  "C4'" . A  A 133 ? 2.48155 2.76055 2.53175 -0.04900 -0.06620 -0.53190 235 A  A "C4'" 
2844 O  "O4'" . A  A 133 ? 2.37325 2.64575 2.40375 -0.04360 -0.06150 -0.50530 235 A  A "O4'" 
2845 C  "C3'" . A  A 133 ? 2.51995 2.81465 2.53965 -0.04540 -0.07100 -0.54670 235 A  A "C3'" 
2846 O  "O3'" . A  A 133 ? 2.60265 2.90045 2.63565 -0.04950 -0.07170 -0.57370 235 A  A "O3'" 
2847 C  "C2'" . A  A 133 ? 2.46145 2.74675 2.45525 -0.03980 -0.06070 -0.53010 235 A  A "C2'" 
2848 O  "O2'" . A  A 133 ? 2.47635 2.74395 2.48595 -0.04180 -0.04810 -0.53440 235 A  A "O2'" 
2849 C  "C1'" . A  A 133 ? 2.35025 2.62775 2.34595 -0.03800 -0.05950 -0.50330 235 A  A "C1'" 
2850 N  N9    . A  A 133 ? 2.27735 2.57095 2.24635 -0.03320 -0.06990 -0.49330 235 A  A N9    
2851 C  C8    . A  A 133 ? 2.22975 2.53285 2.20685 -0.03370 -0.08030 -0.48840 235 A  A C8    
2852 N  N7    . A  A 133 ? 2.18155 2.49815 2.13025 -0.02830 -0.08850 -0.47960 235 A  A N7    
2853 C  C5    . A  A 133 ? 2.20915 2.52525 2.12875 -0.02440 -0.08270 -0.47840 235 A  A C5    
2854 C  C6    . A  A 133 ? 2.22185 2.54865 2.10395 -0.01820 -0.08630 -0.46970 235 A  A C6    
2855 N  N6    . A  A 133 ? 2.15945 2.49915 2.02685 -0.01450 -0.09740 -0.46020 235 A  A N6    
2856 N  N1    . A  A 133 ? 2.29695 2.62065 2.15745 -0.01590 -0.07780 -0.47090 235 A  A N1    
2857 C  C2    . A  A 133 ? 2.35015 2.66085 2.22695 -0.01930 -0.06690 -0.48060 235 A  A C2    
2858 N  N3    . A  A 133 ? 2.34395 2.64315 2.25595 -0.02480 -0.06290 -0.48920 235 A  A N3    
2859 C  C4    . A  A 133 ? 2.27245 2.57505 2.20445 -0.02730 -0.07120 -0.48730 235 A  A C4    
2860 P  P     . U  A 134 ? 2.66751 2.98961 2.69531 -0.05090 -0.08670 -0.59690 236 U  A P     
2861 O  OP1   . U  A 134 ? 2.62161 2.94031 2.68361 -0.05810 -0.08680 -0.62100 236 U  A OP1   
2862 O  OP2   . U  A 134 ? 2.60421 2.93961 2.62341 -0.04870 -0.09800 -0.58410 236 U  A OP2   
2863 O  "O5'" . U  A 134 ? 2.63351 2.96721 2.62301 -0.04560 -0.08670 -0.60560 236 U  A "O5'" 
2864 C  "C5'" . U  A 134 ? 2.59881 2.94551 2.55021 -0.03890 -0.09190 -0.59150 236 U  A "C5'" 
2865 C  "C4'" . U  A 134 ? 2.67281 3.02401 2.59281 -0.03480 -0.08650 -0.59790 236 U  A "C4'" 
2866 O  "O4'" . U  A 134 ? 2.67091 3.00431 2.60861 -0.03720 -0.07300 -0.60530 236 U  A "O4'" 
2867 C  "C3'" . U  A 134 ? 2.69411 3.04501 2.57901 -0.02800 -0.08240 -0.57390 236 U  A "C3'" 
2868 O  "O3'" . U  A 134 ? 2.77091 3.14191 2.62641 -0.02380 -0.09450 -0.56960 236 U  A "O3'" 
2869 C  "C2'" . U  A 134 ? 2.70721 3.05231 2.57901 -0.02640 -0.07040 -0.58130 236 U  A "C2'" 
2870 O  "O2'" . U  A 134 ? 2.68281 3.04731 2.53141 -0.02490 -0.07620 -0.60140 236 U  A "O2'" 
2871 C  "C1'" . U  A 134 ? 2.72161 3.05041 2.63261 -0.03220 -0.06300 -0.59480 236 U  A "C1'" 
2872 N  N1    . U  A 134 ? 2.70361 3.00931 2.63041 -0.03230 -0.05080 -0.57460 236 U  A N1    
2873 C  C2    . U  A 134 ? 2.71461 3.00401 2.66741 -0.03560 -0.04050 -0.58440 236 U  A C2    
2874 O  O2    . U  A 134 ? 2.75641 3.04901 2.72101 -0.03840 -0.04090 -0.60900 236 U  A O2    
2875 N  N3    . U  A 134 ? 2.66071 2.93001 2.62631 -0.03520 -0.03000 -0.56450 236 U  A N3    
2876 C  C4    . U  A 134 ? 2.56461 2.82841 2.51971 -0.03220 -0.02860 -0.53720 236 U  A C4    
2877 O  O4    . U  A 134 ? 2.54491 2.79061 2.51341 -0.03230 -0.01890 -0.52250 236 U  A O4    
2878 C  C5    . U  A 134 ? 2.53301 2.81371 2.46171 -0.02910 -0.03920 -0.52920 236 U  A C5    
2879 C  C6    . U  A 134 ? 2.59081 2.89111 2.50651 -0.02910 -0.04960 -0.54710 236 U  A C6    
2880 P  P     . C  A 135 ? 2.61024 2.97984 2.44254 -0.01810 -0.09520 -0.53880 237 C  A P     
2881 O  OP1   . C  A 135 ? 2.49544 2.87124 2.34214 -0.01890 -0.10700 -0.53220 237 C  A OP1   
2882 O  OP2   . C  A 135 ? 2.49404 2.84244 2.32904 -0.01720 -0.08000 -0.52160 237 C  A OP2   
2883 O  "O5'" . C  A 135 ? 2.61914 3.00744 2.40734 -0.01240 -0.10010 -0.53970 237 C  A "O5'" 
2884 C  "C5'" . C  A 135 ? 2.56574 2.95324 2.32444 -0.00670 -0.09800 -0.51490 237 C  A "C5'" 
2885 C  "C4'" . C  A 135 ? 2.60784 3.00894 2.35544 -0.00340 -0.11240 -0.50390 237 C  A "C4'" 
2886 O  "O4'" . C  A 135 ? 2.74474 3.15954 2.51074 -0.00680 -0.12510 -0.52440 237 C  A "O4'" 
2887 C  "C3'" . C  A 135 ? 2.65364 3.07114 2.35814 0.00280  -0.11830 -0.49670 237 C  A "C3'" 
2888 O  "O3'" . C  A 135 ? 2.66074 3.06844 2.34544 0.00700  -0.11080 -0.47050 237 C  A "O3'" 
2889 C  "C2'" . C  A 135 ? 2.75144 3.18684 2.45644 0.00410  -0.13610 -0.50000 237 C  A "C2'" 
2890 O  "O2'" . C  A 135 ? 2.70114 3.12894 2.41574 0.00600  -0.13910 -0.47750 237 C  A "O2'" 
2891 C  "C1'" . C  A 135 ? 2.77584 3.21274 2.51604 -0.00250 -0.13940 -0.52520 237 C  A "C1'" 
2892 N  N1    . C  A 135 ? 2.77464 3.22784 2.50334 -0.00380 -0.14370 -0.55220 237 C  A N1    
2893 C  C2    . C  A 135 ? 2.80704 3.28454 2.50804 0.00000  -0.15770 -0.55900 237 C  A C2    
2894 O  O2    . C  A 135 ? 2.79944 3.28474 2.48524 0.00470  -0.16690 -0.54160 237 C  A O2    
2895 N  N3    . C  A 135 ? 2.81354 3.30574 2.50464 -0.00140 -0.16100 -0.58480 237 C  A N3    
2896 C  C4    . C  A 135 ? 2.80354 3.28674 2.51244 -0.00620 -0.15090 -0.60380 237 C  A C4    
2897 N  N4    . C  A 135 ? 2.78874 3.28744 2.48714 -0.00730 -0.15470 -0.63000 237 C  A N4    
2898 C  C5    . C  A 135 ? 2.76544 3.22354 2.50334 -0.00990 -0.13690 -0.59690 237 C  A C5    
2899 C  C6    . C  A 135 ? 2.73184 3.17624 2.47784 -0.00850 -0.13390 -0.57110 237 C  A C6    
2900 P  P     . U  A 136 ? 2.81994 3.23944 2.45884 0.01270  -0.11060 -0.46230 238 U  A P     
2901 O  OP1   . U  A 136 ? 2.67604 3.08914 2.30684 0.01140  -0.09610 -0.46990 238 U  A OP1   
2902 O  OP2   . U  A 136 ? 2.88684 3.33024 2.50794 0.01510  -0.12670 -0.47260 238 U  A OP2   
2903 O  "O5'" . U  A 136 ? 2.74144 3.15044 2.36924 0.01690  -0.10820 -0.43030 238 U  A "O5'" 
2904 C  "C5'" . U  A 136 ? 2.76104 3.17594 2.38834 0.02010  -0.12080 -0.41700 238 U  A "C5'" 
2905 C  "C4'" . U  A 136 ? 2.88194 3.30444 2.47144 0.02640  -0.12410 -0.39790 238 U  A "C4'" 
2906 O  "O4'" . U  A 136 ? 2.98794 3.43404 2.55714 0.02920  -0.13870 -0.40870 238 U  A "O4'" 
2907 C  "C3'" . U  A 136 ? 2.92904 3.34714 2.49154 0.02780  -0.11100 -0.39100 238 U  A "C3'" 
2908 O  "O3'" . U  A 136 ? 2.88864 3.28574 2.45934 0.02750  -0.09860 -0.37150 238 U  A "O3'" 
2909 C  "C2'" . U  A 136 ? 3.03944 3.47444 2.56324 0.03350  -0.12000 -0.38160 238 U  A "C2'" 
2910 O  "O2'" . U  A 136 ? 3.06014 3.48734 2.57714 0.03760  -0.12190 -0.35440 238 U  A "O2'" 
2911 C  "C1'" . U  A 136 ? 3.07234 3.52664 2.60144 0.03370  -0.13710 -0.39910 238 U  A "C1'" 
2912 N  N1    . U  A 136 ? 3.13624 3.60834 2.64874 0.03270  -0.13960 -0.42320 238 U  A N1    
2913 C  C2    . U  A 136 ? 3.17124 3.65804 2.64284 0.03710  -0.14200 -0.41870 238 U  A C2    
2914 O  O2    . U  A 136 ? 3.16214 3.64714 2.61094 0.04170  -0.14190 -0.39510 238 U  A O2    
2915 N  N3    . U  A 136 ? 3.26624 3.77004 2.72424 0.03590  -0.14420 -0.44300 238 U  A N3    
2916 C  C4    . U  A 136 ? 3.26114 3.76804 2.74294 0.03080  -0.14450 -0.47130 238 U  A C4    
2917 O  O4    . U  A 136 ? 3.29534 3.81844 2.76094 0.03040  -0.14670 -0.49200 238 U  A O4    
2918 C  C5    . U  A 136 ? 3.18234 3.67254 2.70694 0.02630  -0.14210 -0.47340 238 U  A C5    
2919 C  C6    . U  A 136 ? 3.10994 3.58424 2.64724 0.02740  -0.13980 -0.44970 238 U  A C6    
2920 P  P     . U  A 137 ? 3.12348 3.50968 2.68598 0.02590  -0.08090 -0.37050 239 U  A P     
2921 O  OP1   . U  A 137 ? 3.07778 3.47638 2.63238 0.02400  -0.07930 -0.39560 239 U  A OP1   
2922 O  OP2   . U  A 137 ? 3.11428 3.49598 2.65078 0.02990  -0.07590 -0.34550 239 U  A OP2   
2923 O  "O5'" . U  A 137 ? 2.88668 3.25168 2.48698 0.02160  -0.07160 -0.36960 239 U  A "O5'" 
2924 C  "C5'" . U  A 137 ? 2.76118 3.12468 2.39418 0.01800  -0.07770 -0.38310 239 U  A "C5'" 
2925 C  "C4'" . U  A 137 ? 2.68338 3.04528 2.33348 0.01340  -0.07120 -0.40720 239 U  A "C4'" 
2926 O  "O4'" . U  A 137 ? 2.61948 2.98998 2.29118 0.01040  -0.08200 -0.42600 239 U  A "O4'" 
2927 C  "C3'" . U  A 137 ? 2.54588 2.88658 2.22238 0.01000  -0.05770 -0.40410 239 U  A "C3'" 
2928 O  "O3'" . U  A 137 ? 2.58878 2.92248 2.24848 0.01150  -0.04480 -0.39550 239 U  A "O3'" 
2929 C  "C2'" . U  A 137 ? 2.46448 2.80628 2.16658 0.00520  -0.05810 -0.43030 239 U  A "C2'" 
2930 O  "O2'" . U  A 137 ? 2.48198 2.83038 2.16998 0.00500  -0.05200 -0.44690 239 U  A "O2'" 
2931 C  "C1'" . U  A 137 ? 2.47988 2.83868 2.18318 0.00520  -0.07460 -0.44020 239 U  A "C1'" 
2932 N  N1    . U  A 137 ? 2.38058 2.73208 2.11558 0.00250  -0.07990 -0.43650 239 U  A N1    
2933 C  C2    . U  A 137 ? 2.30108 2.64448 2.07018 -0.00300 -0.07680 -0.45200 239 U  A C2    
2934 O  O2    . U  A 137 ? 2.27918 2.61988 2.05428 -0.00560 -0.06980 -0.46870 239 U  A O2    
2935 N  N3    . U  A 137 ? 2.24808 2.58618 2.04458 -0.00540 -0.08170 -0.44690 239 U  A N3    
2936 C  C4    . U  A 137 ? 2.19818 2.53878 1.99188 -0.00250 -0.08940 -0.42930 239 U  A C4    
2937 O  O4    . U  A 137 ? 2.07988 2.41598 1.90088 -0.00520 -0.09260 -0.42710 239 U  A O4    
2938 C  C5    . U  A 137 ? 2.30618 2.65498 2.06458 0.00350  -0.09280 -0.41460 239 U  A C5    
2939 C  C6    . U  A 137 ? 2.40128 2.75508 2.13218 0.00560  -0.08800 -0.41830 239 U  A C6    
2940 P  P     . C  A 138 ? 2.67229 2.98399 2.34699 0.01090  -0.03240 -0.37700 240 C  A P     
2941 O  OP1   . C  A 138 ? 2.66239 2.97369 2.30799 0.01440  -0.02570 -0.35960 240 C  A OP1   
2942 O  OP2   . C  A 138 ? 2.40869 2.71149 2.10829 0.00970  -0.03800 -0.36750 240 C  A OP2   
2943 O  "O5'" . C  A 138 ? 2.52549 2.82839 2.22099 0.00720  -0.02150 -0.39420 240 C  A "O5'" 
2944 C  "C5'" . C  A 138 ? 2.36619 2.64989 2.09029 0.00470  -0.01330 -0.38810 240 C  A "C5'" 
2945 C  "C4'" . C  A 138 ? 2.25019 2.53029 2.00489 0.00030  -0.01350 -0.40900 240 C  A "C4'" 
2946 O  "O4'" . C  A 138 ? 2.25609 2.54949 2.01499 -0.00090 -0.02710 -0.42130 240 C  A "O4'" 
2947 C  "C3'" . C  A 138 ? 2.16489 2.42629 1.95269 -0.00250 -0.00850 -0.40170 240 C  A "C3'" 
2948 O  "O3'" . C  A 138 ? 2.12579 2.37349 1.91999 -0.00250 0.00490  -0.39770 240 C  A "O3'" 
2949 C  "C2'" . C  A 138 ? 2.15039 2.41449 1.96419 -0.00680 -0.01480 -0.42220 240 C  A "C2'" 
2950 O  "O2'" . C  A 138 ? 2.16839 2.43129 1.99059 -0.00870 -0.00840 -0.44250 240 C  A "O2'" 
2951 C  "C1'" . C  A 138 ? 2.21959 2.50409 2.01409 -0.00530 -0.02840 -0.42900 240 C  A "C1'" 
2952 N  N1    . C  A 138 ? 2.18419 2.47019 1.98579 -0.00500 -0.03810 -0.41650 240 C  A N1    
2953 C  C2    . C  A 138 ? 2.09649 2.37769 1.93069 -0.00930 -0.04200 -0.42320 240 C  A C2    
2954 O  O2    . C  A 138 ? 2.04479 2.31969 1.90189 -0.01340 -0.03750 -0.43890 240 C  A O2    
2955 N  N3    . C  A 138 ? 2.06039 2.34409 1.90139 -0.00890 -0.05050 -0.41210 240 C  A N3    
2956 C  C4    . C  A 138 ? 2.08409 2.37379 1.90099 -0.00420 -0.05530 -0.39520 240 C  A C4    
2957 N  N4    . C  A 138 ? 2.06999 2.36209 1.89569 -0.00350 -0.06360 -0.38530 240 C  A N4    
2958 C  C5    . C  A 138 ? 2.22259 2.51629 2.00609 0.00020  -0.05170 -0.38750 240 C  A C5    
2959 C  C6    . C  A 138 ? 2.20239 2.49439 1.97919 -0.00060 -0.04300 -0.39850 240 C  A C6    
2960 P  P     . U  A 139 ? 2.16334 2.39424 1.96504 -0.00150 0.01180  -0.37320 241 U  A P     
2961 O  OP1   . U  A 139 ? 2.08244 2.30494 1.88184 -0.00060 0.02480  -0.37130 241 U  A OP1   
2962 O  OP2   . U  A 139 ? 2.01084 2.24704 1.79334 0.00130  0.00470  -0.35500 241 U  A OP2   
2963 O  "O5'" . U  A 139 ? 2.12314 2.34204 1.96134 -0.00550 0.01080  -0.37570 241 U  A "O5'" 
2964 C  "C5'" . U  A 139 ? 2.08084 2.29434 1.94294 -0.00890 0.01480  -0.39400 241 U  A "C5'" 
2965 C  "C4'" . U  A 139 ? 1.99074 2.19724 1.88394 -0.01290 0.01050  -0.39650 241 U  A "C4'" 
2966 O  "O4'" . U  A 139 ? 1.99214 2.21324 1.88294 -0.01410 -0.00200 -0.40580 241 U  A "O4'" 
2967 C  "C3'" . U  A 139 ? 2.00284 2.19754 1.90674 -0.01270 0.01200  -0.37480 241 U  A "C3'" 
2968 O  "O3'" . U  A 139 ? 2.01654 2.19464 1.93374 -0.01290 0.02300  -0.36670 241 U  A "O3'" 
2969 C  "C2'" . U  A 139 ? 2.01324 2.20984 1.94014 -0.01660 0.00370  -0.38130 241 U  A "C2'" 
2970 O  "O2'" . U  A 139 ? 2.06804 2.25454 2.02484 -0.02090 0.00850  -0.39320 241 U  A "O2'" 
2971 C  "C1'" . U  A 139 ? 1.98064 2.19664 1.89214 -0.01630 -0.00660 -0.39710 241 U  A "C1'" 
2972 N  N1    . U  A 139 ? 1.98754 2.21434 1.88014 -0.01330 -0.01590 -0.38480 241 U  A N1    
2973 C  C2    . U  A 139 ? 1.97524 2.20354 1.88554 -0.01540 -0.02340 -0.38190 241 U  A C2    
2974 O  O2    . U  A 139 ? 1.95104 2.17264 1.89054 -0.01990 -0.02230 -0.38890 241 U  A O2    
2975 N  N3    . U  A 139 ? 1.95444 2.19264 1.84784 -0.01200 -0.03200 -0.37060 241 U  A N3    
2976 C  C4    . U  A 139 ? 2.00244 2.24814 1.86324 -0.00700 -0.03390 -0.36110 241 U  A C4    
2977 O  O4    . U  A 139 ? 2.03934 2.29294 1.88924 -0.00420 -0.04230 -0.35090 241 U  A O4    
2978 C  C5    . U  A 139 ? 2.00624 2.24974 1.84984 -0.00560 -0.02540 -0.36430 241 U  A C5    
2979 C  C6    . U  A 139 ? 2.01684 2.25154 1.87664 -0.00860 -0.01680 -0.37600 241 U  A C6    
2980 P  P     . G  A 140 ? 1.92173 2.08913 1.83623 -0.01070 0.02720  -0.34130 242 G  A P     
2981 O  OP1   . G  A 140 ? 1.89163 2.04503 1.81593 -0.01040 0.03870  -0.33750 242 G  A OP1   
2982 O  OP2   . G  A 140 ? 1.91633 2.09363 1.80093 -0.00690 0.02270  -0.32980 242 G  A OP2   
2983 O  "O5'" . G  A 140 ? 1.87323 2.03543 1.81183 -0.01380 0.02230  -0.33620 242 G  A "O5'" 
2984 C  "C5'" . G  A 140 ? 1.91793 2.07163 1.88693 -0.01810 0.02470  -0.34620 242 G  A "C5'" 
2985 C  "C4'" . G  A 140 ? 1.91653 2.07093 1.90363 -0.02110 0.01800  -0.34330 242 G  A "C4'" 
2986 O  "O4'" . G  A 140 ? 1.85343 2.02463 1.83193 -0.02150 0.00700  -0.35390 242 G  A "O4'" 
2987 C  "C3'" . G  A 140 ? 1.89083 2.04063 1.87483 -0.01920 0.01790  -0.32140 242 G  A "C3'" 
2988 O  "O3'" . G  A 140 ? 1.87463 2.00843 1.87473 -0.02000 0.02670  -0.31050 242 G  A "O3'" 
2989 C  "C2'" . G  A 140 ? 1.86763 2.02653 1.86203 -0.02150 0.00820  -0.32450 242 G  A "C2'" 
2990 O  "O2'" . G  A 140 ? 1.92863 2.07983 1.95423 -0.02650 0.01020  -0.32950 242 G  A "O2'" 
2991 C  "C1'" . G  A 140 ? 1.83643 2.01083 1.81903 -0.02160 0.00050  -0.34290 242 G  A "C1'" 
2992 N  N9    . G  A 140 ? 1.85983 2.04703 1.81373 -0.01710 -0.00660 -0.33620 242 G  A N9    
2993 C  C8    . G  A 140 ? 1.90873 2.10163 1.83413 -0.01330 -0.00560 -0.33570 242 G  A C8    
2994 N  N7    . G  A 140 ? 1.90443 2.10813 1.80883 -0.00980 -0.01320 -0.32790 242 G  A N7    
2995 C  C5    . G  A 140 ? 1.90933 2.11483 1.82963 -0.01120 -0.01980 -0.32360 242 G  A C5    
2996 C  C6    . G  A 140 ? 1.91413 2.12953 1.82483 -0.00840 -0.02950 -0.31500 242 G  A C6    
2997 O  O6    . G  A 140 ? 1.94023 2.16443 1.82503 -0.00400 -0.03460 -0.30860 242 G  A O6    
2998 N  N1    . G  A 140 ? 1.86543 2.08003 1.80073 -0.01100 -0.03300 -0.31380 242 G  A N1    
2999 C  C2    . G  A 140 ? 1.88463 2.08953 1.84933 -0.01610 -0.02770 -0.31930 242 G  A C2    
3000 N  N2    . G  A 140 ? 1.89723 2.10363 1.88263 -0.01830 -0.03170 -0.31670 242 G  A N2    
3001 N  N3    . G  A 140 ? 1.89293 2.08773 1.86653 -0.01870 -0.01890 -0.32660 242 G  A N3    
3002 C  C4    . G  A 140 ? 1.88713 2.08283 1.83783 -0.01590 -0.01550 -0.32860 242 G  A C4    
3003 P  P     . U  A 141 ? 1.91522 2.04162 1.90322 -0.01640 0.03100  -0.28770 243 U  A P     
3004 O  OP1   . U  A 141 ? 1.95192 2.06272 1.95542 -0.01710 0.04070  -0.28200 243 U  A OP1   
3005 O  OP2   . U  A 141 ? 1.93532 2.07022 1.89302 -0.01210 0.02900  -0.28360 243 U  A OP2   
3006 O  "O5'" . U  A 141 ? 1.80682 1.93572 1.80332 -0.01730 0.02490  -0.27820 243 U  A "O5'" 
3007 C  "C5'" . U  A 141 ? 1.78022 1.90322 1.80462 -0.02160 0.02570  -0.27980 243 U  A "C5'" 
3008 C  "C4'" . U  A 141 ? 1.76932 1.89902 1.79762 -0.02200 0.01870  -0.27310 243 U  A "C4'" 
3009 O  "O4'" . U  A 141 ? 1.77842 1.92392 1.79952 -0.02210 0.00870  -0.28530 243 U  A "O4'" 
3010 C  "C3'" . U  A 141 ? 1.75382 1.88312 1.76502 -0.01760 0.01830  -0.25450 243 U  A "C3'" 
3011 O  "O3'" . U  A 141 ? 1.81932 1.93582 1.84062 -0.01780 0.02570  -0.24080 243 U  A "O3'" 
3012 C  "C2'" . U  A 141 ? 1.74132 1.88332 1.75272 -0.01750 0.00830  -0.25540 243 U  A "C2'" 
3013 O  "O2'" . U  A 141 ? 1.76312 1.90222 1.79932 -0.02100 0.00880  -0.25340 243 U  A "O2'" 
3014 C  "C1'" . U  A 141 ? 1.77142 1.92492 1.78142 -0.01920 0.00200  -0.27480 243 U  A "C1'" 
3015 N  N1    . U  A 141 ? 1.77752 1.94102 1.75852 -0.01480 -0.00300 -0.27550 243 U  A N1    
3016 C  C2    . U  A 141 ? 1.76732 1.94222 1.73682 -0.01190 -0.01220 -0.27050 243 U  A C2    
3017 O  O2    . U  A 141 ? 1.74422 1.92172 1.72712 -0.01270 -0.01630 -0.26630 243 U  A O2    
3018 N  N3    . U  A 141 ? 1.79262 1.97592 1.73462 -0.00780 -0.01640 -0.27030 243 U  A N3    
3019 C  C4    . U  A 141 ? 1.81852 2.00082 1.74332 -0.00670 -0.01180 -0.27480 243 U  A C4    
3020 O  O4    . U  A 141 ? 1.85802 2.04912 1.75782 -0.00310 -0.01600 -0.27330 243 U  A O4    
3021 C  C5    . U  A 141 ? 1.82642 1.99722 1.76542 -0.00970 -0.00220 -0.28070 243 U  A C5    
3022 C  C6    . U  A 141 ? 1.82952 1.99122 1.79532 -0.01350 0.00150  -0.28060 243 U  A C6    
3023 P  P     . U  A 142 ? 1.68867 1.79817 1.69127 -0.01330 0.03070  -0.22400 244 U  A P     
3024 O  OP1   . U  A 142 ? 1.68707 1.78377 1.70677 -0.01490 0.03810  -0.21470 244 U  A OP1   
3025 O  OP2   . U  A 142 ? 1.68887 1.79947 1.67257 -0.01090 0.03300  -0.22810 244 U  A OP2   
3026 O  "O5'" . U  A 142 ? 1.62437 1.74207 1.61427 -0.01020 0.02360  -0.21400 244 U  A "O5'" 
3027 C  "C5'" . U  A 142 ? 1.58517 1.70377 1.59037 -0.01160 0.02120  -0.20880 244 U  A "C5'" 
3028 C  "C4'" . U  A 142 ? 1.60347 1.73427 1.59817 -0.00880 0.01170  -0.20680 244 U  A "C4'" 
3029 O  "O4'" . U  A 142 ? 1.64657 1.78947 1.63457 -0.00920 0.00430  -0.22090 244 U  A "O4'" 
3030 C  "C3'" . U  A 142 ? 1.58377 1.71417 1.55517 -0.00360 0.01090  -0.19370 244 U  A "C3'" 
3031 O  "O3'" . U  A 142 ? 1.59807 1.72037 1.57477 -0.00260 0.01510  -0.17980 244 U  A "O3'" 
3032 C  "C2'" . U  A 142 ? 1.58807 1.73267 1.55037 -0.00140 0.00010  -0.19740 244 U  A "C2'" 
3033 O  "O2'" . U  A 142 ? 1.56127 1.70977 1.53517 -0.00100 -0.00430 -0.19230 244 U  A "O2'" 
3034 C  "C1'" . U  A 142 ? 1.62377 1.77607 1.59167 -0.00470 -0.00330 -0.21560 244 U  A "C1'" 
3035 N  N1    . U  A 142 ? 1.66497 1.82197 1.60957 -0.00250 -0.00460 -0.22120 244 U  A N1    
3036 C  C2    . U  A 142 ? 1.67687 1.84317 1.59937 0.00190  -0.01190 -0.21670 244 U  A C2    
3037 O  O2    . U  A 142 ? 1.65507 1.82617 1.57627 0.00440  -0.01800 -0.20910 244 U  A O2    
3038 N  N3    . U  A 142 ? 1.68127 1.85087 1.58257 0.00350  -0.01120 -0.22080 244 U  A N3    
3039 C  C4    . U  A 142 ? 1.71367 1.87887 1.61427 0.00130  -0.00430 -0.22960 244 U  A C4    
3040 O  O4    . U  A 142 ? 1.73677 1.90687 1.61687 0.00310  -0.00420 -0.23290 244 U  A O4    
3041 C  C5    . U  A 142 ? 1.70817 1