data_6TNA
# 
_entry.id   6TNA 
# 
_audit_conform.dict_name       mmcif_pdbx.dic 
_audit_conform.dict_version    5.279 
_audit_conform.dict_location   http://mmcif.pdb.org/dictionaries/ascii/mmcif_pdbx.dic 
# 
loop_
_database_2.database_id 
_database_2.database_code 
PDB   6TNA         
RCSB  TRNA04       
WWPDB D_1000179870 
# 
_pdbx_database_PDB_obs_spr.id               SPRSDE 
_pdbx_database_PDB_obs_spr.date             1979-01-16 
_pdbx_database_PDB_obs_spr.pdb_id           6TNA 
_pdbx_database_PDB_obs_spr.replace_pdb_id   5TNA 
_pdbx_database_PDB_obs_spr.details          ? 
# 
_pdbx_database_status.status_code                     REL 
_pdbx_database_status.entry_id                        6TNA 
_pdbx_database_status.recvd_initial_deposition_date   1978-11-16 
_pdbx_database_status.deposit_site                    BNL 
_pdbx_database_status.process_site                    BNL 
_pdbx_database_status.SG_entry                        . 
_pdbx_database_status.status_code_sf                  ? 
_pdbx_database_status.status_code_mr                  ? 
_pdbx_database_status.pdb_format_compatible           Y 
_pdbx_database_status.status_code_cs                  ? 
# 
loop_
_audit_author.name 
_audit_author.pdbx_ordinal 
'Sussman, J.L.'  1 
'Holbrook, S.R.' 2 
'Warrant, R.W.'  3 
'Church, G.M.'   4 
'Kim, S.-H.'     5 
# 
loop_
_citation.id 
_citation.title 
_citation.journal_abbrev 
_citation.journal_volume 
_citation.page_first 
_citation.page_last 
_citation.year 
_citation.journal_id_ASTM 
_citation.country 
_citation.journal_id_ISSN 
_citation.journal_id_CSD 
_citation.book_publisher 
_citation.pdbx_database_id_PubMed 
_citation.pdbx_database_id_DOI 
primary 'Crystal structure of yeast phenylalanine transfer RNA. I. Crystallographic refinement.' J.Mol.Biol. 123 607  630  1978 
JMOBAK UK 0022-2836     0070 ?                                                            357742 '10.1016/0022-2836(78)90209-7' 
1       'Crystal Structure of Yeast Phenylalanine T-RNA. II.Structural Features and Functional Implications' J.Mol.Biol. 123 631  
660  1978 JMOBAK UK 0022-2836     0070 ?                                                            ?      ? 
2       'Three Dimensional Structure of T-RNA and Its Functional Implications' 'Adv.Enzymol.Relat.Areas Mol.Biol.' 46  279  315  
1978 AERAAD US 0065-258X     0917 ?                                                            ?      ? 
3       'The Three-Dimensional Structure of Transfer RNA' Sci.Am.                                                  238 52   62   
1978 SCAMAC US 0036-8733     0420 ?                                                            ?      ? 
4       
'Crystal Structure of Yeast Phenylalanine T-RNA, Its Correlation to the Solution Structure and the Functional Implications' 
'Transfer RNA'                                           ?   ?    ?    1978 ?      ?  0262-01056-9  0974 
'MIT Press, Cambridge, Massachusetts'                        ?      ?                              
5       'RNA-Ligand Interactions. (1) Magnesium Binding Sites in Yeast T-RNA-PHE' 'Nucleic Acids Res.' 4   2811 2820 1977 NARHAD 
UK 0305-1048     0389 ?                                                            ?      ?                              
6       'Idealized Atomic Coordinates of Yeast Phenylalanine Transfer RNA' Biochem.Biophys.Res.Commun. 68  89   96   1976 BBRCA9 
US 0006-291X     0146 ?                                                            ?      ?                              
7       'Three-Dimensional Structure of a Transfer RNA in Two Crystal Forms' Science 192 853  858  1976 SCIEAS US 0036-8075     
0038 ?                                                            ?      ?                              
8       ? 'Atlas of Protein Sequence and Structure (Data Section)' 5   347  ?    1972 ?      ?  0-912466-02-2 0435 
'National Biomedical Research Foundation, Silver Spring,Md.' ?      ?                              
# 
loop_
_citation_author.citation_id 
_citation_author.name 
_citation_author.ordinal 
primary 'Sussman, J.L.'  1  
primary 'Holbrook, S.R.' 2  
primary 'Warrant, R.W.'  3  
primary 'Church, G.M.'   4  
primary 'Kim, S.H.'      5  
1       'Holbrook, S.R.' 6  
1       'Sussman, J.L.'  7  
1       'Warrant, R.W.'  8  
1       'Kim, S.-H.'     9  
2       'Kim, S.-H.'     10 
3       'Rich, A.'       11 
3       'Kim, S.H.'      12 
4       'Kim, S.-H.'     13 
5       'Holbrook, S.R.' 14 
5       'Sussman, J.L.'  15 
5       'Warrant, R.W.'  16 
5       'Church, G.M.'   17 
5       'Kim, S.-H.'     18 
6       'Sussman, J.L.'  19 
6       'Kim, S.-H.'     20 
7       'Sussman, J.L.'  21 
7       'Kim, S.-H.'     22 
# 
_cell.entry_id           6TNA 
_cell.length_a           33.000 
_cell.length_b           56.000 
_cell.length_c           161.000 
_cell.angle_alpha        90.00 
_cell.angle_beta         90.00 
_cell.angle_gamma        90.00 
_cell.Z_PDB              4 
_cell.pdbx_unique_axis   ? 
_cell.length_a_esd       ? 
_cell.length_b_esd       ? 
_cell.length_c_esd       ? 
_cell.angle_alpha_esd    ? 
_cell.angle_beta_esd     ? 
_cell.angle_gamma_esd    ? 
# 
_symmetry.entry_id                         6TNA 
_symmetry.space_group_name_H-M             'P 21 2 21' 
_symmetry.pdbx_full_space_group_name_H-M   ? 
_symmetry.cell_setting                     ? 
_symmetry.Int_Tables_number                18 
_symmetry.space_group_name_Hall            ? 
# 
loop_
_entity.id 
_entity.type 
_entity.src_method 
_entity.pdbx_description 
_entity.formula_weight 
_entity.pdbx_number_of_molecules 
_entity.pdbx_ec 
_entity.pdbx_mutation 
_entity.pdbx_fragment 
_entity.details 
1 polymer     nat TRNAPHE         24890.121 1  ? ? ? ? 
2 non-polymer syn 'MAGNESIUM ION' 24.305    4  ? ? ? ? 
3 water       nat water           18.015    84 ? ? ? ? 
# 
_entity_poly.entity_id                      1 
_entity_poly.type                           polyribonucleotide 
_entity_poly.nstd_linkage                   no 
_entity_poly.nstd_monomer                   yes 
_entity_poly.pdbx_seq_one_letter_code       
;GCGGAUUUA(2MG)CUCAG(H2U)(H2U)GGGAGAGC(M2G)CCAGA(OMC)U(OMG)AA(YG)A(PSU)(5MC)UGGAG
(7MG)UC(5MC)UGUG(5MU)(PSU)CG(1MA)UCCACAGAAUUCGCACCA
;
_entity_poly.pdbx_seq_one_letter_code_can   GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA 
_entity_poly.pdbx_strand_id                 A 
_entity_poly.pdbx_target_identifier         ? 
# 
loop_
_entity_poly_seq.entity_id 
_entity_poly_seq.num 
_entity_poly_seq.mon_id 
_entity_poly_seq.hetero 
1 1  G   n 
1 2  C   n 
1 3  G   n 
1 4  G   n 
1 5  A   n 
1 6  U   n 
1 7  U   n 
1 8  U   n 
1 9  A   n 
1 10 2MG n 
1 11 C   n 
1 12 U   n 
1 13 C   n 
1 14 A   n 
1 15 G   n 
1 16 H2U n 
1 17 H2U n 
1 18 G   n 
1 19 G   n 
1 20 G   n 
1 21 A   n 
1 22 G   n 
1 23 A   n 
1 24 G   n 
1 25 C   n 
1 26 M2G n 
1 27 C   n 
1 28 C   n 
1 29 A   n 
1 30 G   n 
1 31 A   n 
1 32 OMC n 
1 33 U   n 
1 34 OMG n 
1 35 A   n 
1 36 A   n 
1 37 YG  n 
1 38 A   n 
1 39 PSU n 
1 40 5MC n 
1 41 U   n 
1 42 G   n 
1 43 G   n 
1 44 A   n 
1 45 G   n 
1 46 7MG n 
1 47 U   n 
1 48 C   n 
1 49 5MC n 
1 50 U   n 
1 51 G   n 
1 52 U   n 
1 53 G   n 
1 54 5MU n 
1 55 PSU n 
1 56 C   n 
1 57 G   n 
1 58 1MA n 
1 59 U   n 
1 60 C   n 
1 61 C   n 
1 62 A   n 
1 63 C   n 
1 64 A   n 
1 65 G   n 
1 66 A   n 
1 67 A   n 
1 68 U   n 
1 69 U   n 
1 70 C   n 
1 71 G   n 
1 72 C   n 
1 73 A   n 
1 74 C   n 
1 75 C   n 
1 76 A   n 
# 
_entity_src_nat.entity_id                  1 
_entity_src_nat.pdbx_src_id                1 
_entity_src_nat.pdbx_alt_source_flag       sample 
_entity_src_nat.pdbx_beg_seq_num           ? 
_entity_src_nat.pdbx_end_seq_num           ? 
_entity_src_nat.common_name                
;baker's yeast
;
_entity_src_nat.pdbx_organism_scientific   'Saccharomyces cerevisiae' 
_entity_src_nat.pdbx_ncbi_taxonomy_id      4932 
_entity_src_nat.genus                      Saccharomyces 
_entity_src_nat.species                    ? 
_entity_src_nat.strain                     ? 
_entity_src_nat.tissue                     ? 
_entity_src_nat.tissue_fraction            ? 
_entity_src_nat.pdbx_secretion             ? 
_entity_src_nat.pdbx_fragment              ? 
_entity_src_nat.pdbx_variant               ? 
_entity_src_nat.pdbx_cell_line             ? 
_entity_src_nat.pdbx_atcc                  ? 
_entity_src_nat.pdbx_cellular_location     ? 
_entity_src_nat.pdbx_organ                 ? 
_entity_src_nat.pdbx_organelle             ? 
_entity_src_nat.pdbx_cell                  ? 
_entity_src_nat.pdbx_plasmid_name          ? 
_entity_src_nat.pdbx_plasmid_details       ? 
_entity_src_nat.details                    ? 
# 
_struct_ref.id                         1 
_struct_ref.entity_id                  1 
_struct_ref.db_name                    PDB 
_struct_ref.db_code                    6TNA 
_struct_ref.pdbx_db_accession          6TNA 
_struct_ref.pdbx_db_isoform            ? 
_struct_ref.pdbx_seq_one_letter_code   ? 
_struct_ref.pdbx_align_begin           ? 
# 
_struct_ref_seq.align_id                      1 
_struct_ref_seq.ref_id                        1 
_struct_ref_seq.pdbx_PDB_id_code              6TNA 
_struct_ref_seq.pdbx_strand_id                A 
_struct_ref_seq.seq_align_beg                 1 
_struct_ref_seq.pdbx_seq_align_beg_ins_code   ? 
_struct_ref_seq.seq_align_end                 76 
_struct_ref_seq.pdbx_seq_align_end_ins_code   ? 
_struct_ref_seq.pdbx_db_accession             6TNA 
_struct_ref_seq.db_align_beg                  1 
_struct_ref_seq.pdbx_db_align_beg_ins_code    ? 
_struct_ref_seq.db_align_end                  76 
_struct_ref_seq.pdbx_db_align_end_ins_code    ? 
_struct_ref_seq.pdbx_auth_seq_align_beg       1 
_struct_ref_seq.pdbx_auth_seq_align_end       76 
# 
loop_
_chem_comp.id 
_chem_comp.type 
_chem_comp.mon_nstd_flag 
_chem_comp.name 
_chem_comp.pdbx_synonyms 
_chem_comp.formula 
_chem_comp.formula_weight 
1MA 'RNA linking' n "6-HYDRO-1-METHYLADENOSINE-5'-MONOPHOSPHATE"  ? 'C11 H16 N5 O7 P'  361.248 
2MG 'RNA linking' n "2N-METHYLGUANOSINE-5'-MONOPHOSPHATE"         ? 'C11 H16 N5 O8 P'  377.247 
5MC 'RNA linking' n "5-METHYLCYTIDINE-5'-MONOPHOSPHATE"           ? 'C10 H16 N3 O8 P'  337.223 
5MU 'RNA linking' n 
;5-METHYLURIDINE 5'-MONOPHOSPHATE
;
?                                                                                                                                
'C10 H15 N2 O9 P'  338.208 
7MG 'RNA linking' n "7N-METHYL-8-HYDROGUANOSINE-5'-MONOPHOSPHATE" ? 'C11 H18 N5 O8 P'  379.263 
A   'RNA linking' y "ADENOSINE-5'-MONOPHOSPHATE"                  ? 'C10 H14 N5 O7 P'  347.221 
C   'RNA linking' y "CYTIDINE-5'-MONOPHOSPHATE"                   ? 'C9 H14 N3 O8 P'   323.197 
G   'RNA linking' y "GUANOSINE-5'-MONOPHOSPHATE"                  ? 'C10 H14 N5 O8 P'  363.221 
H2U 'RNA linking' n "5,6-DIHYDROURIDINE-5'-MONOPHOSPHATE"         ? 'C9 H15 N2 O9 P'   326.197 
HOH non-polymer   . WATER                                         ? 'H2 O'             18.015  
M2G 'RNA linking' n "N2-DIMETHYLGUANOSINE-5'-MONOPHOSPHATE"       ? 'C12 H18 N5 O8 P'  391.274 
MG  non-polymer   . 'MAGNESIUM ION'                               ? 'Mg 2'             24.305  
OMC 'RNA linking' n "O2'-METHYLYCYTIDINE-5'-MONOPHOSPHATE"        ? 'C10 H16 N3 O8 P'  337.223 
OMG 'RNA linking' n "O2'-METHYLGUANOSINE-5'-MONOPHOSPHATE"        ? 'C11 H16 N5 O8 P'  377.247 
PSU 'RNA linking' n "PSEUDOURIDINE-5'-MONOPHOSPHATE"              ? 'C9 H13 N2 O9 P'   324.181 
U   'RNA linking' y "URIDINE-5'-MONOPHOSPHATE"                    ? 'C9 H13 N2 O9 P'   324.181 
YG  'RNA linking' n WYBUTOSINE                                    
'Y-BASE; 1H-IMIDAZO(1,2-ALPHA)PURINE-7-BUTANOIC ACID,4,9-DIHYDRO-ALPHA-((METHOXYCARBONYL)AMINO)-4,6-DIMETHYL-9-OXO-METHYL ESTER' 
'C21 H29 N6 O12 P' 588.462 
# 
_exptl.entry_id          6TNA 
_exptl.method            'X-RAY DIFFRACTION' 
_exptl.crystals_number   ? 
# 
_exptl_crystal.id                    1 
_exptl_crystal.density_meas          ? 
_exptl_crystal.density_Matthews      2.99 
_exptl_crystal.density_percent_sol   58.84 
_exptl_crystal.description           ? 
_exptl_crystal.F_000                 ? 
_exptl_crystal.preparation           ? 
# 
_diffrn.id                     1 
_diffrn.ambient_temp           ? 
_diffrn.ambient_temp_details   ? 
_diffrn.crystal_id             1 
# 
_diffrn_radiation.diffrn_id                        1 
_diffrn_radiation.wavelength_id                    1 
_diffrn_radiation.monochromator                    ? 
_diffrn_radiation.pdbx_monochromatic_or_laue_m_l   ? 
_diffrn_radiation.pdbx_diffrn_protocol             ? 
_diffrn_radiation.pdbx_scattering_type             x-ray 
# 
_diffrn_radiation_wavelength.id           1 
_diffrn_radiation_wavelength.wavelength   . 
_diffrn_radiation_wavelength.wt           1.0 
# 
_refine.entry_id                                 6TNA 
_refine.ls_number_reflns_obs                     8426 
_refine.ls_number_reflns_all                     ? 
_refine.pdbx_ls_sigma_I                          ? 
_refine.pdbx_ls_sigma_F                          ? 
_refine.pdbx_data_cutoff_high_absF               ? 
_refine.pdbx_data_cutoff_low_absF                ? 
_refine.pdbx_data_cutoff_high_rms_absF           ? 
_refine.ls_d_res_low                             ? 
_refine.ls_d_res_high                            2.700 
_refine.ls_percent_reflns_obs                    ? 
_refine.ls_R_factor_obs                          0.1980000 
_refine.ls_R_factor_all                          ? 
_refine.ls_R_factor_R_work                       ? 
_refine.ls_R_factor_R_free                       ? 
_refine.ls_R_factor_R_free_error                 ? 
_refine.ls_R_factor_R_free_error_details         ? 
_refine.ls_percent_reflns_R_free                 ? 
_refine.ls_number_reflns_R_free                  ? 
_refine.ls_number_parameters                     ? 
_refine.ls_number_restraints                     ? 
_refine.occupancy_min                            ? 
_refine.occupancy_max                            ? 
_refine.B_iso_mean                               ? 
_refine.aniso_B[1][1]                            ? 
_refine.aniso_B[2][2]                            ? 
_refine.aniso_B[3][3]                            ? 
_refine.aniso_B[1][2]                            ? 
_refine.aniso_B[1][3]                            ? 
_refine.aniso_B[2][3]                            ? 
_refine.solvent_model_details                    ? 
_refine.solvent_model_param_ksol                 ? 
_refine.solvent_model_param_bsol                 ? 
_refine.pdbx_ls_cross_valid_method               ? 
_refine.details                                  ? 
_refine.pdbx_starting_model                      ? 
_refine.pdbx_method_to_determine_struct          ? 
_refine.pdbx_isotropic_thermal_model             ? 
_refine.pdbx_stereochemistry_target_values       ? 
_refine.pdbx_stereochem_target_val_spec_case     ? 
_refine.pdbx_R_Free_selection_details            ? 
_refine.pdbx_overall_ESU_R                       ? 
_refine.pdbx_overall_ESU_R_Free                  ? 
_refine.overall_SU_ML                            ? 
_refine.overall_SU_B                             ? 
_refine.ls_redundancy_reflns_obs                 ? 
_refine.pdbx_overall_phase_error                 ? 
_refine.correlation_coeff_Fo_to_Fc               ? 
_refine.correlation_coeff_Fo_to_Fc_free          ? 
_refine.pdbx_solvent_vdw_probe_radii             ? 
_refine.pdbx_solvent_ion_probe_radii             ? 
_refine.pdbx_solvent_shrinkage_radii             ? 
_refine.overall_SU_R_Cruickshank_DPI             ? 
_refine.overall_SU_R_free                        ? 
_refine.ls_wR_factor_R_free                      ? 
_refine.ls_wR_factor_R_work                      ? 
_refine.overall_FOM_free_R_set                   ? 
_refine.overall_FOM_work_R_set                   ? 
_refine.pdbx_refine_id                           'X-RAY DIFFRACTION' 
_refine.pdbx_diffrn_id                           1 
_refine.pdbx_TLS_residual_ADP_flag               ? 
_refine.pdbx_overall_SU_R_free_Cruickshank_DPI   ? 
_refine.pdbx_overall_SU_R_Blow_DPI               ? 
_refine.pdbx_overall_SU_R_free_Blow_DPI          ? 
# 
_refine_hist.pdbx_refine_id                   'X-RAY DIFFRACTION' 
_refine_hist.cycle_id                         LAST 
_refine_hist.pdbx_number_atoms_protein        0 
_refine_hist.pdbx_number_atoms_nucleic_acid   1652 
_refine_hist.pdbx_number_atoms_ligand         4 
_refine_hist.number_atoms_solvent             84 
_refine_hist.number_atoms_total               1740 
_refine_hist.d_res_high                       2.700 
_refine_hist.d_res_low                        . 
# 
_struct.entry_id                  6TNA 
_struct.title                     'CRYSTAL STRUCTURE OF YEAST PHENYLALANINE T-RNA. I.CRYSTALLOGRAPHIC REFINEMENT' 
_struct.pdbx_descriptor           'TRANSFER RIBO-NUCLEIC ACID (YEAST,PHE),T-RNA' 
_struct.pdbx_model_details        ? 
_struct.pdbx_CASP_flag            ? 
_struct.pdbx_model_type_details   ? 
# 
_struct_keywords.entry_id        6TNA 
_struct_keywords.pdbx_keywords   T-RNA 
_struct_keywords.text            'T-RNA, SINGLE STRAND, LOOPS' 
# 
loop_
_struct_asym.id 
_struct_asym.pdbx_blank_PDB_chainid_flag 
_struct_asym.pdbx_modified 
_struct_asym.entity_id 
_struct_asym.details 
A N N 1 ? 
B N N 2 ? 
C N N 2 ? 
D N N 2 ? 
E N N 2 ? 
F N N 3 ? 
# 
_struct_biol.id        1 
_struct_biol.details   ? 
# 
loop_
_struct_conn.id 
_struct_conn.conn_type_id 
_struct_conn.pdbx_leaving_atom_flag 
_struct_conn.pdbx_PDB_id 
_struct_conn.ptnr1_label_asym_id 
_struct_conn.ptnr1_label_comp_id 
_struct_conn.ptnr1_label_seq_id 
_struct_conn.ptnr1_label_atom_id 
_struct_conn.pdbx_ptnr1_label_alt_id 
_struct_conn.pdbx_ptnr1_PDB_ins_code 
_struct_conn.pdbx_ptnr1_standard_comp_id 
_struct_conn.ptnr1_symmetry 
_struct_conn.ptnr2_label_asym_id 
_struct_conn.ptnr2_label_comp_id 
_struct_conn.ptnr2_label_seq_id 
_struct_conn.ptnr2_label_atom_id 
_struct_conn.pdbx_ptnr2_label_alt_id 
_struct_conn.pdbx_ptnr2_PDB_ins_code 
_struct_conn.ptnr1_auth_asym_id 
_struct_conn.ptnr1_auth_comp_id 
_struct_conn.ptnr1_auth_seq_id 
_struct_conn.ptnr2_auth_asym_id 
_struct_conn.ptnr2_auth_comp_id 
_struct_conn.ptnr2_auth_seq_id 
_struct_conn.ptnr2_symmetry 
_struct_conn.pdbx_ptnr3_label_atom_id 
_struct_conn.pdbx_ptnr3_label_seq_id 
_struct_conn.pdbx_ptnr3_label_comp_id 
_struct_conn.pdbx_ptnr3_label_asym_id 
_struct_conn.pdbx_ptnr3_label_alt_id 
_struct_conn.pdbx_ptnr3_PDB_ins_code 
_struct_conn.details 
_struct_conn.pdbx_dist_value 
_struct_conn.pdbx_value_order 
covale1  covale ? ? A 2MG 10 P     ? ? ? 1_555 A A   9  "O3'" ? ? A 2MG 10 A A   9   1_555 ? ? ? ? ? ? ?                       
1.587 ? 
covale2  covale ? ? A 2MG 10 "O3'" ? ? ? 1_555 A C   11 P     ? ? A 2MG 10 A C   11  1_555 ? ? ? ? ? ? ?                       
1.590 ? 
covale3  covale ? ? A H2U 16 P     ? ? ? 1_555 A G   15 "O3'" ? ? A H2U 16 A G   15  1_555 ? ? ? ? ? ? ?                       
1.611 ? 
covale4  covale ? ? A H2U 16 "O3'" ? ? ? 1_555 A H2U 17 P     ? ? A H2U 16 A H2U 17  1_555 ? ? ? ? ? ? ?                       
1.604 ? 
covale5  covale ? ? A H2U 17 "O3'" ? ? ? 1_555 A G   18 P     ? ? A H2U 17 A G   18  1_555 ? ? ? ? ? ? ?                       
1.590 ? 
covale6  covale ? ? A M2G 26 P     ? ? ? 1_555 A C   25 "O3'" ? ? A M2G 26 A C   25  1_555 ? ? ? ? ? ? ?                       
1.611 ? 
covale7  covale ? ? A M2G 26 "O3'" ? ? ? 1_555 A C   27 P     ? ? A M2G 26 A C   27  1_555 ? ? ? ? ? ? ?                       
1.591 ? 
covale8  covale ? ? A OMC 32 P     ? ? ? 1_555 A A   31 "O3'" ? ? A OMC 32 A A   31  1_555 ? ? ? ? ? ? ?                       
1.598 ? 
covale9  covale ? ? A OMC 32 "O3'" ? ? ? 1_555 A U   33 P     ? ? A OMC 32 A U   33  1_555 ? ? ? ? ? ? ?                       
1.601 ? 
covale10 covale ? ? A OMG 34 P     ? ? ? 1_555 A U   33 "O3'" ? ? A OMG 34 A U   33  1_555 ? ? ? ? ? ? ?                       
1.597 ? 
covale11 covale ? ? A OMG 34 "O3'" ? ? ? 1_555 A A   35 P     ? ? A OMG 34 A A   35  1_555 ? ? ? ? ? ? ?                       
1.597 ? 
covale12 covale ? ? A YG  37 P     ? ? ? 1_555 A A   36 "O3'" ? ? A YG  37 A A   36  1_555 ? ? ? ? ? ? ?                       
1.590 ? 
covale13 covale ? ? A YG  37 "O3'" ? ? ? 1_555 A A   38 P     ? ? A YG  37 A A   38  1_555 ? ? ? ? ? ? ?                       
1.593 ? 
covale14 covale ? ? A PSU 39 P     ? ? ? 1_555 A A   38 "O3'" ? ? A PSU 39 A A   38  1_555 ? ? ? ? ? ? ?                       
1.618 ? 
covale15 covale ? ? A PSU 39 "O3'" ? ? ? 1_555 A 5MC 40 P     ? ? A PSU 39 A 5MC 40  1_555 ? ? ? ? ? ? ?                       
1.591 ? 
covale16 covale ? ? A 5MC 40 "O3'" ? ? ? 1_555 A U   41 P     ? ? A 5MC 40 A U   41  1_555 ? ? ? ? ? ? ?                       
1.601 ? 
covale17 covale ? ? A 7MG 46 P     ? ? ? 1_555 A G   45 "O3'" ? ? A 7MG 46 A G   45  1_555 ? ? ? ? ? ? ?                       
1.591 ? 
covale18 covale ? ? A 7MG 46 "O3'" ? ? ? 1_555 A U   47 P     ? ? A 7MG 46 A U   47  1_555 ? ? ? ? ? ? ?                       
1.598 ? 
covale19 covale ? ? A 5MC 49 P     ? ? ? 1_555 A C   48 "O3'" ? ? A 5MC 49 A C   48  1_555 ? ? ? ? ? ? ?                       
1.589 ? 
covale20 covale ? ? A 5MC 49 "O3'" ? ? ? 1_555 A U   50 P     ? ? A 5MC 49 A U   50  1_555 ? ? ? ? ? ? ?                       
1.595 ? 
covale21 covale ? ? A 5MU 54 P     ? ? ? 1_555 A G   53 "O3'" ? ? A 5MU 54 A G   53  1_555 ? ? ? ? ? ? ?                       
1.593 ? 
covale22 covale ? ? A 5MU 54 "O3'" ? ? ? 1_555 A PSU 55 P     ? ? A 5MU 54 A PSU 55  1_555 ? ? ? ? ? ? ?                       
1.599 ? 
covale23 covale ? ? A PSU 55 "O3'" ? ? ? 1_555 A C   56 P     ? ? A PSU 55 A C   56  1_555 ? ? ? ? ? ? ?                       
1.590 ? 
covale24 covale ? ? A 1MA 58 P     ? ? ? 1_555 A G   57 "O3'" ? ? A 1MA 58 A G   57  1_555 ? ? ? ? ? ? ?                       
1.594 ? 
covale25 covale ? ? A 1MA 58 "O3'" ? ? ? 1_555 A U   59 P     ? ? A 1MA 58 A U   59  1_555 ? ? ? ? ? ? ?                       
1.587 ? 
metalc1  metalc ? ? B MG  .  MG    ? ? ? 1_555 F HOH .  O     ? ? A MG  77 A HOH 149 1_555 ? ? ? ? ? ? ?                       
2.000 ? 
metalc2  metalc ? ? B MG  .  MG    ? ? ? 1_555 F HOH .  O     ? ? A MG  77 A HOH 146 1_555 ? ? ? ? ? ? ?                       
2.000 ? 
metalc3  metalc ? ? B MG  .  MG    ? ? ? 1_555 F HOH .  O     ? ? A MG  77 A HOH 147 1_555 ? ? ? ? ? ? ?                       
1.999 ? 
metalc4  metalc ? ? B MG  .  MG    ? ? ? 1_555 F HOH .  O     ? ? A MG  77 A HOH 148 1_555 ? ? ? ? ? ? ?                       
2.000 ? 
metalc5  metalc ? ? B MG  .  MG    ? ? ? 1_555 F HOH .  O     ? ? A MG  77 A HOH 145 1_555 ? ? ? ? ? ? ?                       
2.000 ? 
metalc6  metalc ? ? C MG  .  MG    ? ? ? 1_555 F HOH .  O     ? ? A MG  78 A HOH 152 1_555 ? ? ? ? ? ? ?                       
2.000 ? 
metalc7  metalc ? ? C MG  .  MG    ? ? ? 1_555 F HOH .  O     ? ? A MG  78 A HOH 151 1_555 ? ? ? ? ? ? ?                       
2.000 ? 
metalc8  metalc ? ? C MG  .  MG    ? ? ? 1_555 F HOH .  O     ? ? A MG  78 A HOH 150 1_555 ? ? ? ? ? ? ?                       
2.001 ? 
metalc9  metalc ? ? C MG  .  MG    ? ? ? 1_555 F HOH .  O     ? ? A MG  78 A HOH 153 1_555 ? ? ? ? ? ? ?                       
2.000 ? 
metalc10 metalc ? ? D MG  .  MG    ? ? ? 1_555 F HOH .  O     ? ? A MG  79 A HOH 154 1_555 ? ? ? ? ? ? ?                       
1.999 ? 
metalc11 metalc ? ? D MG  .  MG    ? ? ? 1_555 F HOH .  O     ? ? A MG  79 A HOH 158 1_555 ? ? ? ? ? ? ?                       
2.001 ? 
metalc12 metalc ? ? D MG  .  MG    ? ? ? 1_555 F HOH .  O     ? ? A MG  79 A HOH 156 1_555 ? ? ? ? ? ? ?                       
2.001 ? 
metalc13 metalc ? ? D MG  .  MG    ? ? ? 1_555 F HOH .  O     ? ? A MG  79 A HOH 157 1_555 ? ? ? ? ? ? ?                       
2.000 ? 
metalc14 metalc ? ? D MG  .  MG    ? ? ? 1_555 F HOH .  O     ? ? A MG  79 A HOH 155 1_555 ? ? ? ? ? ? ?                       
2.000 ? 
metalc15 metalc ? ? D MG  .  MG    ? ? ? 1_555 F HOH .  O     ? ? A MG  79 A HOH 159 1_555 ? ? ? ? ? ? ?                       
2.001 ? 
metalc16 metalc ? ? E MG  .  MG    ? ? ? 1_555 F HOH .  O     ? ? A MG  80 A HOH 163 1_555 ? ? ? ? ? ? ?                       
2.001 ? 
metalc17 metalc ? ? E MG  .  MG    ? ? ? 1_555 F HOH .  O     ? ? A MG  80 A HOH 164 1_555 ? ? ? ? ? ? ?                       
1.999 ? 
metalc18 metalc ? ? E MG  .  MG    ? ? ? 1_555 F HOH .  O     ? ? A MG  80 A HOH 160 1_555 ? ? ? ? ? ? ?                       
2.000 ? 
metalc19 metalc ? ? E MG  .  MG    ? ? ? 1_555 F HOH .  O     ? ? A MG  80 A HOH 161 1_555 ? ? ? ? ? ? ?                       
1.998 ? 
metalc20 metalc ? ? E MG  .  MG    ? ? ? 1_555 F HOH .  O     ? ? A MG  80 A HOH 162 1_555 ? ? ? ? ? ? ?                       
2.000 ? 
metalc21 metalc ? ? A G   19 OP1   ? ? ? 1_555 B MG  .  MG    ? ? A G   19 A MG  77  1_555 ? ? ? ? ? ? ?                       
1.907 ? 
metalc22 metalc ? ? A G   20 OP1   ? ? ? 1_555 C MG  .  MG    ? ? A G   20 A MG  78  1_555 ? ? ? ? ? ? ?                       
2.335 ? 
metalc23 metalc ? ? A A   21 OP2   ? ? ? 1_555 C MG  .  MG    ? ? A A   21 A MG  78  1_555 ? ? ? ? ? ? ?                       
1.757 ? 
metalc24 metalc ? ? A YG  37 OP2   ? ? ? 1_555 E MG  .  MG    ? ? A YG  37 A MG  80  1_555 ? ? ? ? ? ? ?                       
2.260 ? 
hydrog1  hydrog ? ? A G   1  N1    ? ? ? 1_555 A C   72 N3    ? ? A G   1  A C   72  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog2  hydrog ? ? A G   1  N2    ? ? ? 1_555 A C   72 O2    ? ? A G   1  A C   72  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog3  hydrog ? ? A G   1  O6    ? ? ? 1_555 A C   72 N4    ? ? A G   1  A C   72  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog4  hydrog ? ? A C   2  N3    ? ? ? 1_555 A G   71 N1    ? ? A C   2  A G   71  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog5  hydrog ? ? A C   2  N4    ? ? ? 1_555 A G   71 O6    ? ? A C   2  A G   71  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog6  hydrog ? ? A C   2  O2    ? ? ? 1_555 A G   71 N2    ? ? A C   2  A G   71  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog7  hydrog ? ? A G   3  N1    ? ? ? 1_555 A C   70 N3    ? ? A G   3  A C   70  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog8  hydrog ? ? A G   3  N2    ? ? ? 1_555 A C   70 O2    ? ? A G   3  A C   70  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog9  hydrog ? ? A G   3  O6    ? ? ? 1_555 A C   70 N4    ? ? A G   3  A C   70  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog10 hydrog ? ? A G   4  N1    ? ? ? 1_555 A U   69 O2    ? ? A G   4  A U   69  1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? ? 
hydrog11 hydrog ? ? A G   4  O6    ? ? ? 1_555 A U   69 N3    ? ? A G   4  A U   69  1_555 ? ? ? ? ? ? TYPE_28_PAIR            ? ? 
hydrog12 hydrog ? ? A A   5  N1    ? ? ? 1_555 A U   68 N3    ? ? A A   5  A U   68  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog13 hydrog ? ? A A   5  N6    ? ? ? 1_555 A U   68 O4    ? ? A A   5  A U   68  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog14 hydrog ? ? A U   6  N3    ? ? ? 1_555 A A   67 N1    ? ? A U   6  A A   67  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog15 hydrog ? ? A U   6  O4    ? ? ? 1_555 A A   67 N6    ? ? A U   6  A A   67  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog16 hydrog ? ? A U   7  N3    ? ? ? 1_555 A A   66 N1    ? ? A U   7  A A   66  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog17 hydrog ? ? A U   7  O4    ? ? ? 1_555 A A   66 N6    ? ? A U   7  A A   66  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog18 hydrog ? ? A U   8  N3    ? ? ? 1_555 A A   14 N7    ? ? A U   8  A A   14  1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN'    ? ? 
hydrog19 hydrog ? ? A U   8  O2    ? ? ? 1_555 A A   14 N6    ? ? A U   8  A A   14  1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN'    ? ? 
hydrog20 hydrog ? ? A A   9  N6    ? ? ? 1_555 A A   23 N7    ? ? A A   9  A A   23  1_555 ? ? ? ? ? ? TYPE_2_PAIR             ? ? 
hydrog21 hydrog ? ? A A   9  N7    ? ? ? 1_555 A A   23 N6    ? ? A A   9  A A   23  1_555 ? ? ? ? ? ? TYPE_2_PAIR             ? ? 
hydrog22 hydrog ? ? A 2MG 10 N1    ? ? ? 1_555 A C   25 N3    ? ? A 2MG 10 A C   25  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog23 hydrog ? ? A 2MG 10 N2    ? ? ? 1_555 A C   25 O2    ? ? A 2MG 10 A C   25  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog24 hydrog ? ? A 2MG 10 O6    ? ? ? 1_555 A C   25 N4    ? ? A 2MG 10 A C   25  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog25 hydrog ? ? A 2MG 10 O6    ? ? ? 1_555 A G   45 N2    ? ? A 2MG 10 A G   45  1_555 ? ? ? ? ? ? '2MG-G MISPAIR'         ? ? 
hydrog26 hydrog ? ? A C   11 N3    ? ? ? 1_555 A G   24 N1    ? ? A C   11 A G   24  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog27 hydrog ? ? A C   11 N4    ? ? ? 1_555 A G   24 O6    ? ? A C   11 A G   24  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog28 hydrog ? ? A C   11 O2    ? ? ? 1_555 A G   24 N2    ? ? A C   11 A G   24  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog29 hydrog ? ? A U   12 N3    ? ? ? 1_555 A A   23 N1    ? ? A U   12 A A   23  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog30 hydrog ? ? A U   12 O4    ? ? ? 1_555 A A   23 N6    ? ? A U   12 A A   23  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog31 hydrog ? ? A C   13 N3    ? ? ? 1_555 A G   22 N1    ? ? A C   13 A G   22  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog32 hydrog ? ? A C   13 N4    ? ? ? 1_555 A G   22 O6    ? ? A C   13 A G   22  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog33 hydrog ? ? A C   13 O2    ? ? ? 1_555 A G   22 N2    ? ? A C   13 A G   22  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog34 hydrog ? ? A G   15 N1    ? ? ? 1_555 A C   48 O2    ? ? A G   15 A C   48  1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? 
hydrog35 hydrog ? ? A G   15 N2    ? ? ? 1_555 A C   48 N3    ? ? A G   15 A C   48  1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? 
hydrog36 hydrog ? ? A G   18 N1    ? ? ? 1_555 A PSU 55 O4    ? ? A G   18 A PSU 55  1_555 ? ? ? ? ? ? 'G-PSU MISPAIR'         ? ? 
hydrog37 hydrog ? ? A G   19 N1    ? ? ? 1_555 A C   56 N3    ? ? A G   19 A C   56  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog38 hydrog ? ? A G   19 N2    ? ? ? 1_555 A C   56 O2    ? ? A G   19 A C   56  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog39 hydrog ? ? A G   19 O6    ? ? ? 1_555 A C   56 N4    ? ? A G   19 A C   56  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog40 hydrog ? ? A G   22 N7    ? ? ? 1_555 A 7MG 46 N1    ? ? A G   22 A 7MG 46  1_555 ? ? ? ? ? ? TYPE_7_PAIR             ? ? 
hydrog41 hydrog ? ? A G   22 O6    ? ? ? 1_555 A 7MG 46 N2    ? ? A G   22 A 7MG 46  1_555 ? ? ? ? ? ? TYPE_7_PAIR             ? ? 
hydrog42 hydrog ? ? A M2G 26 N1    ? ? ? 1_555 A A   44 N1    ? ? A M2G 26 A A   44  1_555 ? ? ? ? ? ? TYPE_8_PAIR             ? ? 
hydrog43 hydrog ? ? A M2G 26 O6    ? ? ? 1_555 A A   44 N6    ? ? A M2G 26 A A   44  1_555 ? ? ? ? ? ? TYPE_8_PAIR             ? ? 
hydrog44 hydrog ? ? A C   27 N3    ? ? ? 1_555 A G   43 N1    ? ? A C   27 A G   43  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog45 hydrog ? ? A C   27 N4    ? ? ? 1_555 A G   43 O6    ? ? A C   27 A G   43  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog46 hydrog ? ? A C   27 O2    ? ? ? 1_555 A G   43 N2    ? ? A C   27 A G   43  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog47 hydrog ? ? A C   28 N3    ? ? ? 1_555 A G   42 N1    ? ? A C   28 A G   42  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog48 hydrog ? ? A C   28 N4    ? ? ? 1_555 A G   42 O6    ? ? A C   28 A G   42  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog49 hydrog ? ? A C   28 O2    ? ? ? 1_555 A G   42 N2    ? ? A C   28 A G   42  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog50 hydrog ? ? A A   29 N1    ? ? ? 1_555 A U   41 N3    ? ? A A   29 A U   41  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog51 hydrog ? ? A A   29 N6    ? ? ? 1_555 A U   41 O4    ? ? A A   29 A U   41  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog52 hydrog ? ? A G   30 N1    ? ? ? 1_555 A 5MC 40 N3    ? ? A G   30 A 5MC 40  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog53 hydrog ? ? A G   30 N2    ? ? ? 1_555 A 5MC 40 O2    ? ? A G   30 A 5MC 40  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog54 hydrog ? ? A G   30 O6    ? ? ? 1_555 A 5MC 40 N4    ? ? A G   30 A 5MC 40  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog55 hydrog ? ? A A   31 N1    ? ? ? 1_555 A PSU 39 N3    ? ? A A   31 A PSU 39  1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? 
hydrog56 hydrog ? ? A A   31 N6    ? ? ? 1_555 A PSU 39 O2    ? ? A A   31 A PSU 39  1_555 ? ? ? ? ? ? 'REVERSED WATSON-CRICK' ? ? 
hydrog57 hydrog ? ? A 5MC 49 N3    ? ? ? 1_555 A G   65 N1    ? ? A 5MC 49 A G   65  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog58 hydrog ? ? A 5MC 49 N4    ? ? ? 1_555 A G   65 O6    ? ? A 5MC 49 A G   65  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog59 hydrog ? ? A 5MC 49 O2    ? ? ? 1_555 A G   65 N2    ? ? A 5MC 49 A G   65  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog60 hydrog ? ? A U   50 N3    ? ? ? 1_555 A A   64 N1    ? ? A U   50 A A   64  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog61 hydrog ? ? A U   50 O4    ? ? ? 1_555 A A   64 N6    ? ? A U   50 A A   64  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog62 hydrog ? ? A G   51 N1    ? ? ? 1_555 A C   63 N3    ? ? A G   51 A C   63  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog63 hydrog ? ? A G   51 N2    ? ? ? 1_555 A C   63 O2    ? ? A G   51 A C   63  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog64 hydrog ? ? A G   51 O6    ? ? ? 1_555 A C   63 N4    ? ? A G   51 A C   63  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog65 hydrog ? ? A U   52 N3    ? ? ? 1_555 A A   62 N1    ? ? A U   52 A A   62  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog66 hydrog ? ? A U   52 O4    ? ? ? 1_555 A A   62 N6    ? ? A U   52 A A   62  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog67 hydrog ? ? A G   53 N1    ? ? ? 1_555 A C   61 N3    ? ? A G   53 A C   61  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog68 hydrog ? ? A G   53 N2    ? ? ? 1_555 A C   61 O2    ? ? A G   53 A C   61  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog69 hydrog ? ? A G   53 O6    ? ? ? 1_555 A C   61 N4    ? ? A G   53 A C   61  1_555 ? ? ? ? ? ? WATSON-CRICK            ? ? 
hydrog70 hydrog ? ? A 5MU 54 N3    ? ? ? 1_555 A 1MA 58 N7    ? ? A 5MU 54 A 1MA 58  1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN'    ? ? 
hydrog71 hydrog ? ? A 5MU 54 O2    ? ? ? 1_555 A 1MA 58 N6    ? ? A 5MU 54 A 1MA 58  1_555 ? ? ? ? ? ? 'REVERSED HOOGSTEEN'    ? ? 
# 
loop_
_struct_conn_type.id 
_struct_conn_type.criteria 
_struct_conn_type.reference 
covale ? ? 
metalc ? ? 
hydrog ? ? 
# 
loop_
_struct_site.id 
_struct_site.pdbx_evidence_code 
_struct_site.pdbx_auth_asym_id 
_struct_site.pdbx_auth_comp_id 
_struct_site.pdbx_auth_seq_id 
_struct_site.pdbx_auth_ins_code 
_struct_site.pdbx_num_residues 
_struct_site.details 
AC1 Software ? ? ? ? 6 'BINDING SITE FOR RESIDUE MG A 77' 
AC2 Software ? ? ? ? 7 'BINDING SITE FOR RESIDUE MG A 78' 
AC3 Software ? ? ? ? 9 'BINDING SITE FOR RESIDUE MG A 79' 
AC4 Software ? ? ? ? 6 'BINDING SITE FOR RESIDUE MG A 80' 
# 
loop_
_struct_site_gen.id 
_struct_site_gen.site_id 
_struct_site_gen.pdbx_num_res 
_struct_site_gen.label_comp_id 
_struct_site_gen.label_asym_id 
_struct_site_gen.label_seq_id 
_struct_site_gen.pdbx_auth_ins_code 
_struct_site_gen.auth_comp_id 
_struct_site_gen.auth_asym_id 
_struct_site_gen.auth_seq_id 
_struct_site_gen.label_atom_id 
_struct_site_gen.label_alt_id 
_struct_site_gen.symmetry 
_struct_site_gen.details 
1  AC1 6 G   A 19 ? G   A 19  . ? 1_555 ? 
2  AC1 6 HOH F .  ? HOH A 145 . ? 1_555 ? 
3  AC1 6 HOH F .  ? HOH A 146 . ? 1_555 ? 
4  AC1 6 HOH F .  ? HOH A 147 . ? 1_555 ? 
5  AC1 6 HOH F .  ? HOH A 148 . ? 1_555 ? 
6  AC1 6 HOH F .  ? HOH A 149 . ? 1_555 ? 
7  AC2 7 H2U A 16 ? H2U A 16  . ? 3_555 ? 
8  AC2 7 G   A 20 ? G   A 20  . ? 1_555 ? 
9  AC2 7 A   A 21 ? A   A 21  . ? 1_555 ? 
10 AC2 7 HOH F .  ? HOH A 150 . ? 1_555 ? 
11 AC2 7 HOH F .  ? HOH A 151 . ? 1_555 ? 
12 AC2 7 HOH F .  ? HOH A 152 . ? 1_555 ? 
13 AC2 7 HOH F .  ? HOH A 153 . ? 1_555 ? 
14 AC3 9 U   A 8  ? U   A 8   . ? 1_555 ? 
15 AC3 9 U   A 12 ? U   A 12  . ? 1_555 ? 
16 AC3 9 HOH F .  ? HOH A 133 . ? 1_555 ? 
17 AC3 9 HOH F .  ? HOH A 154 . ? 1_555 ? 
18 AC3 9 HOH F .  ? HOH A 155 . ? 1_555 ? 
19 AC3 9 HOH F .  ? HOH A 156 . ? 1_555 ? 
20 AC3 9 HOH F .  ? HOH A 157 . ? 1_555 ? 
21 AC3 9 HOH F .  ? HOH A 158 . ? 1_555 ? 
22 AC3 9 HOH F .  ? HOH A 159 . ? 1_555 ? 
23 AC4 6 YG  A 37 ? YG  A 37  . ? 1_555 ? 
24 AC4 6 HOH F .  ? HOH A 160 . ? 1_555 ? 
25 AC4 6 HOH F .  ? HOH A 161 . ? 1_555 ? 
26 AC4 6 HOH F .  ? HOH A 162 . ? 1_555 ? 
27 AC4 6 HOH F .  ? HOH A 163 . ? 1_555 ? 
28 AC4 6 HOH F .  ? HOH A 164 . ? 1_555 ? 
# 
_database_PDB_matrix.entry_id          6TNA 
_database_PDB_matrix.origx[1][1]       1.000000 
_database_PDB_matrix.origx[1][2]       0.000000 
_database_PDB_matrix.origx[1][3]       0.000000 
_database_PDB_matrix.origx[2][1]       0.000000 
_database_PDB_matrix.origx[2][2]       1.000000 
_database_PDB_matrix.origx[2][3]       0.000000 
_database_PDB_matrix.origx[3][1]       0.000000 
_database_PDB_matrix.origx[3][2]       0.000000 
_database_PDB_matrix.origx[3][3]       1.000000 
_database_PDB_matrix.origx_vector[1]   0.00000 
_database_PDB_matrix.origx_vector[2]   0.00000 
_database_PDB_matrix.origx_vector[3]   0.00000 
# 
_atom_sites.entry_id                    6TNA 
_atom_sites.fract_transf_matrix[1][1]   0.026394 
_atom_sites.fract_transf_matrix[1][2]   0.014847 
_atom_sites.fract_transf_matrix[1][3]   -0.001038 
_atom_sites.fract_transf_matrix[2][1]   -0.007782 
_atom_sites.fract_transf_matrix[2][2]   0.014335 
_atom_sites.fract_transf_matrix[2][3]   0.007269 
_atom_sites.fract_transf_matrix[3][1]   0.001411 
_atom_sites.fract_transf_matrix[3][2]   -0.002105 
_atom_sites.fract_transf_matrix[3][3]   0.005670 
_atom_sites.fract_transf_vector[1]      -0.30448 
_atom_sites.fract_transf_vector[2]      -0.06000 
_atom_sites.fract_transf_vector[3]      -0.00907 
# 
loop_
_atom_type.symbol 
C  
MG 
N  
O  
P  
# 
loop_
_atom_site.group_PDB 
_atom_site.id 
_atom_site.type_symbol 
_atom_site.label_atom_id 
_atom_site.label_alt_id 
_atom_site.label_comp_id 
_atom_site.label_asym_id 
_atom_site.label_entity_id 
_atom_site.label_seq_id 
_atom_site.pdbx_PDB_ins_code 
_atom_site.Cartn_x 
_atom_site.Cartn_y 
_atom_site.Cartn_z 
_atom_site.occupancy 
_atom_site.B_iso_or_equiv 
_atom_site.pdbx_formal_charge 
_atom_site.auth_seq_id 
_atom_site.auth_comp_id 
_atom_site.auth_asym_id 
_atom_site.auth_atom_id 
_atom_site.pdbx_PDB_model_num 
ATOM   1    O  OP3   . G   A 1 1  ? 27.528 23.952  69.137  1.00 10.00 ? 1   G   A OP3   1 
ATOM   2    P  P     . G   A 1 1  ? 27.502 24.942  70.386  1.00 10.00 ? 1   G   A P     1 
ATOM   3    O  OP1   . G   A 1 1  ? 28.634 25.900  70.283  1.00 10.00 ? 1   G   A OP1   1 
ATOM   4    O  OP2   . G   A 1 1  ? 26.156 25.555  70.506  1.00 10.00 ? 1   G   A OP2   1 
ATOM   5    O  "O5'" . G   A 1 1  ? 27.763 23.943  71.606  1.00 10.00 ? 1   G   A "O5'" 1 
ATOM   6    C  "C5'" . G   A 1 1  ? 28.997 23.203  71.628  1.00 10.00 ? 1   G   A "C5'" 1 
ATOM   7    C  "C4'" . G   A 1 1  ? 28.930 22.062  72.644  1.00 10.00 ? 1   G   A "C4'" 1 
ATOM   8    O  "O4'" . G   A 1 1  ? 27.601 21.980  73.188  1.00 10.00 ? 1   G   A "O4'" 1 
ATOM   9    C  "C3'" . G   A 1 1  ? 29.309 20.686  72.124  1.00 10.00 ? 1   G   A "C3'" 1 
ATOM   10   O  "O3'" . G   A 1 1  ? 30.702 20.437  72.247  1.00 10.00 ? 1   G   A "O3'" 1 
ATOM   11   C  "C2'" . G   A 1 1  ? 28.449 19.768  72.984  1.00 10.00 ? 1   G   A "C2'" 1 
ATOM   12   O  "O2'" . G   A 1 1  ? 29.032 19.594  74.267  1.00 10.00 ? 1   G   A "O2'" 1 
ATOM   13   C  "C1'" . G   A 1 1  ? 27.188 20.613  73.182  1.00 10.00 ? 1   G   A "C1'" 1 
ATOM   14   N  N9    . G   A 1 1  ? 26.178 20.436  72.113  1.00 10.00 ? 1   G   A N9    1 
ATOM   15   C  C8    . G   A 1 1  ? 25.810 21.303  71.104  1.00 10.00 ? 1   G   A C8    1 
ATOM   16   N  N7    . G   A 1 1  ? 24.870 20.840  70.317  1.00 10.00 ? 1   G   A N7    1 
ATOM   17   C  C5    . G   A 1 1  ? 24.591 19.576  70.841  1.00 10.00 ? 1   G   A C5    1 
ATOM   18   C  C6    . G   A 1 1  ? 23.665 18.597  70.405  1.00 10.00 ? 1   G   A C6    1 
ATOM   19   O  O6    . G   A 1 1  ? 22.875 18.641  69.461  1.00 10.00 ? 1   G   A O6    1 
ATOM   20   N  N1    . G   A 1 1  ? 23.710 17.454  71.222  1.00 10.00 ? 1   G   A N1    1 
ATOM   21   C  C2    . G   A 1 1  ? 24.546 17.292  72.317  1.00 10.00 ? 1   G   A C2    1 
ATOM   22   N  N2    . G   A 1 1  ? 24.428 16.126  72.956  1.00 10.00 ? 1   G   A N2    1 
ATOM   23   N  N3    . G   A 1 1  ? 25.415 18.206  72.717  1.00 10.00 ? 1   G   A N3    1 
ATOM   24   C  C4    . G   A 1 1  ? 25.379 19.319  71.933  1.00 10.00 ? 1   G   A C4    1 
ATOM   25   P  P     . C   A 1 2  ? 31.659 20.469  70.978  1.00 10.00 ? 2   C   A P     1 
ATOM   26   O  OP1   . C   A 1 2  ? 32.973 21.044  71.364  1.00 10.00 ? 2   C   A OP1   1 
ATOM   27   O  OP2   . C   A 1 2  ? 30.973 21.143  69.849  1.00 10.00 ? 2   C   A OP2   1 
ATOM   28   O  "O5'" . C   A 1 2  ? 31.815 18.912  70.652  1.00 10.00 ? 2   C   A "O5'" 1 
ATOM   29   C  "C5'" . C   A 1 2  ? 30.629 18.184  70.293  1.00 10.00 ? 2   C   A "C5'" 1 
ATOM   30   C  "C4'" . C   A 1 2  ? 30.507 16.914  71.139  1.00 10.00 ? 2   C   A "C4'" 1 
ATOM   31   O  "O4'" . C   A 1 2  ? 29.293 17.051  71.947  1.00 10.00 ? 2   C   A "O4'" 1 
ATOM   32   C  "C3'" . C   A 1 2  ? 30.455 15.607  70.367  1.00 10.00 ? 2   C   A "C3'" 1 
ATOM   33   O  "O3'" . C   A 1 2  ? 31.724 14.971  70.316  1.00 10.00 ? 2   C   A "O3'" 1 
ATOM   34   C  "C2'" . C   A 1 2  ? 29.411 14.815  71.146  1.00 10.00 ? 2   C   A "C2'" 1 
ATOM   35   O  "O2'" . C   A 1 2  ? 29.987 14.227  72.301  1.00 10.00 ? 2   C   A "O2'" 1 
ATOM   36   C  "C1'" . C   A 1 2  ? 28.473 15.927  71.630  1.00 10.00 ? 2   C   A "C1'" 1 
ATOM   37   N  N1    . C   A 1 2  ? 27.474 16.346  70.621  1.00 10.00 ? 2   C   A N1    1 
ATOM   38   C  C2    . C   A 1 2  ? 26.658 15.368  70.068  1.00 10.00 ? 2   C   A C2    1 
ATOM   39   O  O2    . C   A 1 2  ? 26.802 14.198  70.441  1.00 10.00 ? 2   C   A O2    1 
ATOM   40   N  N3    . C   A 1 2  ? 25.726 15.730  69.143  1.00 10.00 ? 2   C   A N3    1 
ATOM   41   C  C4    . C   A 1 2  ? 25.601 17.008  68.767  1.00 10.00 ? 2   C   A C4    1 
ATOM   42   N  N4    . C   A 1 2  ? 24.682 17.314  67.872  1.00 10.00 ? 2   C   A N4    1 
ATOM   43   C  C5    . C   A 1 2  ? 26.436 18.041  69.324  1.00 10.00 ? 2   C   A C5    1 
ATOM   44   C  C6    . C   A 1 2  ? 27.351 17.658  70.243  1.00 10.00 ? 2   C   A C6    1 
ATOM   45   P  P     . G   A 1 3  ? 32.588 15.111  68.981  1.00 10.00 ? 3   G   A P     1 
ATOM   46   O  OP1   . G   A 1 3  ? 34.034 15.048  69.311  1.00 10.00 ? 3   G   A OP1   1 
ATOM   47   O  OP2   . G   A 1 3  ? 32.155 16.320  68.231  1.00 10.00 ? 3   G   A OP2   1 
ATOM   48   O  "O5'" . G   A 1 3  ? 32.150 13.804  68.175  1.00 10.00 ? 3   G   A "O5'" 1 
ATOM   49   C  "C5'" . G   A 1 3  ? 32.228 12.543  68.859  1.00 10.00 ? 3   G   A "C5'" 1 
ATOM   50   C  "C4'" . G   A 1 3  ? 30.989 11.694  68.566  1.00 10.00 ? 3   G   A "C4'" 1 
ATOM   51   O  "O4'" . G   A 1 3  ? 29.788 12.502  68.793  1.00 10.00 ? 3   G   A "O4'" 1 
ATOM   52   C  "C3'" . G   A 1 3  ? 30.822 11.250  67.122  1.00 10.00 ? 3   G   A "C3'" 1 
ATOM   53   O  "O3'" . G   A 1 3  ? 31.639 10.129  66.814  1.00 10.00 ? 3   G   A "O3'" 1 
ATOM   54   C  "C2'" . G   A 1 3  ? 29.330 10.950  67.050  1.00 10.00 ? 3   G   A "C2'" 1 
ATOM   55   O  "O2'" . G   A 1 3  ? 29.034 9.721   67.698  1.00 10.00 ? 3   G   A "O2'" 1 
ATOM   56   C  "C1'" . G   A 1 3  ? 28.744 12.064  67.923  1.00 10.00 ? 3   G   A "C1'" 1 
ATOM   57   N  N9    . G   A 1 3  ? 28.257 13.231  67.154  1.00 10.00 ? 3   G   A N9    1 
ATOM   58   C  C8    . G   A 1 3  ? 28.746 14.521  67.117  1.00 10.00 ? 3   G   A C8    1 
ATOM   59   N  N7    . G   A 1 3  ? 28.076 15.327  66.329  1.00 10.00 ? 3   G   A N7    1 
ATOM   60   C  C5    . G   A 1 3  ? 27.067 14.517  65.805  1.00 10.00 ? 3   G   A C5    1 
ATOM   61   C  C6    . G   A 1 3  ? 26.036 14.829  64.888  1.00 10.00 ? 3   G   A C6    1 
ATOM   62   O  O6    . G   A 1 3  ? 25.781 15.905  64.342  1.00 10.00 ? 3   G   A O6    1 
ATOM   63   N  N1    . G   A 1 3  ? 25.233 13.707  64.624  1.00 10.00 ? 3   G   A N1    1 
ATOM   64   C  C2    . G   A 1 3  ? 25.413 12.450  65.183  1.00 10.00 ? 3   G   A C2    1 
ATOM   65   N  N2    . G   A 1 3  ? 24.536 11.523  64.796  1.00 10.00 ? 3   G   A N2    1 
ATOM   66   N  N3    . G   A 1 3  ? 26.383 12.159  66.037  1.00 10.00 ? 3   G   A N3    1 
ATOM   67   C  C4    . G   A 1 3  ? 27.166 13.242  66.298  1.00 10.00 ? 3   G   A C4    1 
ATOM   68   P  P     . G   A 1 4  ? 32.395 10.124  65.407  1.00 10.00 ? 4   G   A P     1 
ATOM   69   O  OP1   . G   A 1 4  ? 33.653 9.342   65.516  1.00 10.00 ? 4   G   A OP1   1 
ATOM   70   O  OP2   . G   A 1 4  ? 32.550 11.522  64.926  1.00 10.00 ? 4   G   A OP2   1 
ATOM   71   O  "O5'" . G   A 1 4  ? 31.349 9.358   64.475  1.00 10.00 ? 4   G   A "O5'" 1 
ATOM   72   C  "C5'" . G   A 1 4  ? 31.226 9.792   63.107  1.00 10.00 ? 4   G   A "C5'" 1 
ATOM   73   C  "C4'" . G   A 1 4  ? 29.989 9.157   62.472  1.00 10.00 ? 4   G   A "C4'" 1 
ATOM   74   O  "O4'" . G   A 1 4  ? 28.823 9.589   63.274  1.00 10.00 ? 4   G   A "O4'" 1 
ATOM   75   C  "C3'" . G   A 1 4  ? 29.700 9.568   61.037  1.00 10.00 ? 4   G   A "C3'" 1 
ATOM   76   O  "O3'" . G   A 1 4  ? 30.332 8.707   60.100  1.00 10.00 ? 4   G   A "O3'" 1 
ATOM   77   C  "C2'" . G   A 1 4  ? 28.179 9.505   60.987  1.00 10.00 ? 4   G   A "C2'" 1 
ATOM   78   O  "O2'" . G   A 1 4  ? 27.735 8.158   60.909  1.00 10.00 ? 4   G   A "O2'" 1 
ATOM   79   C  "C1'" . G   A 1 4  ? 27.797 10.018  62.380  1.00 10.00 ? 4   G   A "C1'" 1 
ATOM   80   N  N9    . G   A 1 4  ? 27.690 11.492  62.462  1.00 10.00 ? 4   G   A N9    1 
ATOM   81   C  C8    . G   A 1 4  ? 28.450 12.385  63.188  1.00 10.00 ? 4   G   A C8    1 
ATOM   82   N  N7    . G   A 1 4  ? 28.089 13.637  63.046  1.00 10.00 ? 4   G   A N7    1 
ATOM   83   C  C5    . G   A 1 4  ? 27.011 13.573  62.163  1.00 10.00 ? 4   G   A C5    1 
ATOM   84   C  C6    . G   A 1 4  ? 26.211 14.614  61.627  1.00 10.00 ? 4   G   A C6    1 
ATOM   85   O  O6    . G   A 1 4  ? 26.277 15.828  61.834  1.00 10.00 ? 4   G   A O6    1 
ATOM   86   N  N1    . G   A 1 4  ? 25.227 14.106  60.766  1.00 10.00 ? 4   G   A N1    1 
ATOM   87   C  C2    . G   A 1 4  ? 25.047 12.764  60.466  1.00 10.00 ? 4   G   A C2    1 
ATOM   88   N  N2    . G   A 1 4  ? 24.050 12.497  59.620  1.00 10.00 ? 4   G   A N2    1 
ATOM   89   N  N3    . G   A 1 4  ? 25.800 11.794  60.961  1.00 10.00 ? 4   G   A N3    1 
ATOM   90   C  C4    . G   A 1 4  ? 26.758 12.276  61.801  1.00 10.00 ? 4   G   A C4    1 
ATOM   91   P  P     . A   A 1 5  ? 31.361 9.401   59.085  1.00 10.00 ? 5   A   A P     1 
ATOM   92   O  OP1   . A   A 1 5  ? 32.348 8.401   58.605  1.00 10.00 ? 5   A   A OP1   1 
ATOM   93   O  OP2   . A   A 1 5  ? 31.938 10.611  59.724  1.00 10.00 ? 5   A   A OP2   1 
ATOM   94   O  "O5'" . A   A 1 5  ? 30.399 9.843   57.889  1.00 10.00 ? 5   A   A "O5'" 1 
ATOM   95   C  "C5'" . A   A 1 5  ? 29.718 8.821   57.148  1.00 10.00 ? 5   A   A "C5'" 1 
ATOM   96   C  "C4'" . A   A 1 5  ? 28.368 9.333   56.644  1.00 10.00 ? 5   A   A "C4'" 1 
ATOM   97   O  "O4'" . A   A 1 5  ? 27.617 9.945   57.753  1.00 10.00 ? 5   A   A "O4'" 1 
ATOM   98   C  "C3'" . A   A 1 5  ? 28.427 10.416  55.580  1.00 10.00 ? 5   A   A "C3'" 1 
ATOM   99   O  "O3'" . A   A 1 5  ? 28.631 9.876   54.283  1.00 10.00 ? 5   A   A "O3'" 1 
ATOM   100  C  "C2'" . A   A 1 5  ? 27.076 11.101  55.746  1.00 10.00 ? 5   A   A "C2'" 1 
ATOM   101  O  "O2'" . A   A 1 5  ? 26.038 10.302  55.197  1.00 10.00 ? 5   A   A "O2'" 1 
ATOM   102  C  "C1'" . A   A 1 5  ? 26.897 11.079  57.265  1.00 10.00 ? 5   A   A "C1'" 1 
ATOM   103  N  N9    . A   A 1 5  ? 27.414 12.288  57.945  1.00 10.00 ? 5   A   A N9    1 
ATOM   104  C  C8    . A   A 1 5  ? 28.386 12.368  58.901  1.00 10.00 ? 5   A   A C8    1 
ATOM   105  N  N7    . A   A 1 5  ? 28.614 13.580  59.312  1.00 10.00 ? 5   A   A N7    1 
ATOM   106  C  C5    . A   A 1 5  ? 27.736 14.355  58.575  1.00 10.00 ? 5   A   A C5    1 
ATOM   107  C  C6    . A   A 1 5  ? 27.479 15.738  58.536  1.00 10.00 ? 5   A   A C6    1 
ATOM   108  N  N6    . A   A 1 5  ? 28.136 16.627  59.306  1.00 10.00 ? 5   A   A N6    1 
ATOM   109  N  N1    . A   A 1 5  ? 26.534 16.174  57.692  1.00 10.00 ? 5   A   A N1    1 
ATOM   110  C  C2    . A   A 1 5  ? 25.893 15.287  56.924  1.00 10.00 ? 5   A   A C2    1 
ATOM   111  N  N3    . A   A 1 5  ? 26.040 13.972  56.870  1.00 10.00 ? 5   A   A N3    1 
ATOM   112  C  C4    . A   A 1 5  ? 26.988 13.580  57.734  1.00 10.00 ? 5   A   A C4    1 
ATOM   113  P  P     . U   A 1 6  ? 30.093 10.277  53.657  1.00 10.00 ? 6   U   A P     1 
ATOM   114  O  OP1   . U   A 1 6  ? 30.492 9.281   52.632  1.00 10.00 ? 6   U   A OP1   1 
ATOM   115  O  OP2   . U   A 1 6  ? 31.071 10.492  54.754  1.00 10.00 ? 6   U   A OP2   1 
ATOM   116  O  "O5'" . U   A 1 6  ? 29.758 11.678  52.964  1.00 10.00 ? 6   U   A "O5'" 1 
ATOM   117  C  "C5'" . U   A 1 6  ? 28.848 11.597  51.832  1.00 10.00 ? 6   U   A "C5'" 1 
ATOM   118  C  "C4'" . U   A 1 6  ? 27.846 12.752  51.904  1.00 10.00 ? 6   U   A "C4'" 1 
ATOM   119  O  "O4'" . U   A 1 6  ? 27.551 13.085  53.311  1.00 10.00 ? 6   U   A "O4'" 1 
ATOM   120  C  "C3'" . U   A 1 6  ? 28.330 14.082  51.349  1.00 10.00 ? 6   U   A "C3'" 1 
ATOM   121  O  "O3'" . U   A 1 6  ? 28.283 14.116  49.931  1.00 10.00 ? 6   U   A "O3'" 1 
ATOM   122  C  "C2'" . U   A 1 6  ? 27.378 15.070  52.012  1.00 10.00 ? 6   U   A "C2'" 1 
ATOM   123  O  "O2'" . U   A 1 6  ? 26.095 15.012  51.404  1.00 10.00 ? 6   U   A "O2'" 1 
ATOM   124  C  "C1'" . U   A 1 6  ? 27.232 14.472  53.417  1.00 10.00 ? 6   U   A "C1'" 1 
ATOM   125  N  N1    . U   A 1 6  ? 28.130 15.085  54.419  1.00 10.00 ? 6   U   A N1    1 
ATOM   126  C  C2    . U   A 1 6  ? 28.032 16.442  54.608  1.00 10.00 ? 6   U   A C2    1 
ATOM   127  O  O2    . U   A 1 6  ? 27.256 17.150  53.988  1.00 10.00 ? 6   U   A O2    1 
ATOM   128  N  N3    . U   A 1 6  ? 28.882 16.974  55.552  1.00 10.00 ? 6   U   A N3    1 
ATOM   129  C  C4    . U   A 1 6  ? 29.809 16.277  56.313  1.00 10.00 ? 6   U   A C4    1 
ATOM   130  O  O4    . U   A 1 6  ? 30.508 16.865  57.134  1.00 10.00 ? 6   U   A O4    1 
ATOM   131  C  C5    . U   A 1 6  ? 29.837 14.860  56.046  1.00 10.00 ? 6   U   A C5    1 
ATOM   132  C  C6    . U   A 1 6  ? 29.016 14.312  55.136  1.00 10.00 ? 6   U   A C6    1 
ATOM   133  P  P     . U   A 1 7  ? 29.705 14.095  49.181  1.00 10.00 ? 7   U   A P     1 
ATOM   134  O  OP1   . U   A 1 7  ? 29.591 13.359  47.897  1.00 10.00 ? 7   U   A OP1   1 
ATOM   135  O  OP2   . U   A 1 7  ? 30.745 13.592  50.115  1.00 10.00 ? 7   U   A OP2   1 
ATOM   136  O  "O5'" . U   A 1 7  ? 29.949 15.649  48.904  1.00 10.00 ? 7   U   A "O5'" 1 
ATOM   137  C  "C5'" . U   A 1 7  ? 28.978 16.344  48.098  1.00 10.00 ? 7   U   A "C5'" 1 
ATOM   138  C  "C4'" . U   A 1 7  ? 28.800 17.771  48.584  1.00 10.00 ? 7   U   A "C4'" 1 
ATOM   139  O  "O4'" . U   A 1 7  ? 28.914 17.882  49.983  1.00 10.00 ? 7   U   A "O4'" 1 
ATOM   140  C  "C3'" . U   A 1 7  ? 29.825 18.714  47.933  1.00 10.00 ? 7   U   A "C3'" 1 
ATOM   141  O  "O3'" . U   A 1 7  ? 29.213 19.896  47.395  1.00 10.00 ? 7   U   A "O3'" 1 
ATOM   142  C  "C2'" . U   A 1 7  ? 30.732 19.017  49.132  1.00 10.00 ? 7   U   A "C2'" 1 
ATOM   143  O  "O2'" . U   A 1 7  ? 31.480 20.225  49.054  1.00 10.00 ? 7   U   A "O2'" 1 
ATOM   144  C  "C1'" . U   A 1 7  ? 29.756 18.986  50.281  1.00 10.00 ? 7   U   A "C1'" 1 
ATOM   145  N  N1    . U   A 1 7  ? 30.343 18.799  51.628  1.00 10.00 ? 7   U   A N1    1 
ATOM   146  C  C2    . U   A 1 7  ? 30.643 19.933  52.325  1.00 10.00 ? 7   U   A C2    1 
ATOM   147  O  O2    . U   A 1 7  ? 30.440 21.062  51.906  1.00 10.00 ? 7   U   A O2    1 
ATOM   148  N  N3    . U   A 1 7  ? 31.201 19.726  53.568  1.00 10.00 ? 7   U   A N3    1 
ATOM   149  C  C4    . U   A 1 7  ? 31.486 18.498  54.147  1.00 10.00 ? 7   U   A C4    1 
ATOM   150  O  O4    . U   A 1 7  ? 31.979 18.441  55.271  1.00 10.00 ? 7   U   A O4    1 
ATOM   151  C  C5    . U   A 1 7  ? 31.141 17.366  53.324  1.00 10.00 ? 7   U   A C5    1 
ATOM   152  C  C6    . U   A 1 7  ? 30.589 17.540  52.111  1.00 10.00 ? 7   U   A C6    1 
ATOM   153  P  P     . U   A 1 8  ? 28.764 19.810  45.858  1.00 10.00 ? 8   U   A P     1 
ATOM   154  O  OP1   . U   A 1 8  ? 28.500 21.175  45.333  1.00 10.00 ? 8   U   A OP1   1 
ATOM   155  O  OP2   . U   A 1 8  ? 27.638 18.848  45.726  1.00 10.00 ? 8   U   A OP2   1 
ATOM   156  O  "O5'" . U   A 1 8  ? 30.065 19.198  45.164  1.00 10.00 ? 8   U   A "O5'" 1 
ATOM   157  C  "C5'" . U   A 1 8  ? 31.219 20.027  44.988  1.00 10.00 ? 8   U   A "C5'" 1 
ATOM   158  C  "C4'" . U   A 1 8  ? 31.840 19.813  43.608  1.00 10.00 ? 8   U   A "C4'" 1 
ATOM   159  O  "O4'" . U   A 1 8  ? 32.464 18.482  43.574  1.00 10.00 ? 8   U   A "O4'" 1 
ATOM   160  C  "C3'" . U   A 1 8  ? 30.868 19.802  42.440  1.00 10.00 ? 8   U   A "C3'" 1 
ATOM   161  O  "O3'" . U   A 1 8  ? 30.556 21.115  41.995  1.00 10.00 ? 8   U   A "O3'" 1 
ATOM   162  C  "C2'" . U   A 1 8  ? 31.620 18.973  41.407  1.00 10.00 ? 8   U   A "C2'" 1 
ATOM   163  O  "O2'" . U   A 1 8  ? 32.667 19.733  40.822  1.00 10.00 ? 8   U   A "O2'" 1 
ATOM   164  C  "C1'" . U   A 1 8  ? 32.283 17.904  42.281  1.00 10.00 ? 8   U   A "C1'" 1 
ATOM   165  N  N1    . U   A 1 8  ? 31.477 16.671  42.430  1.00 10.00 ? 8   U   A N1    1 
ATOM   166  C  C2    . U   A 1 8  ? 31.519 15.762  41.403  1.00 10.00 ? 8   U   A C2    1 
ATOM   167  O  O2    . U   A 1 8  ? 32.173 15.934  40.385  1.00 10.00 ? 8   U   A O2    1 
ATOM   168  N  N3    . U   A 1 8  ? 30.759 14.627  41.576  1.00 10.00 ? 8   U   A N3    1 
ATOM   169  C  C4    . U   A 1 8  ? 29.970 14.326  42.676  1.00 10.00 ? 8   U   A C4    1 
ATOM   170  O  O4    . U   A 1 8  ? 29.341 13.269  42.723  1.00 10.00 ? 8   U   A O4    1 
ATOM   171  C  C5    . U   A 1 8  ? 29.991 15.336  43.706  1.00 10.00 ? 8   U   A C5    1 
ATOM   172  C  C6    . U   A 1 8  ? 30.728 16.449  43.565  1.00 10.00 ? 8   U   A C6    1 
ATOM   173  P  P     . A   A 1 9  ? 29.178 21.327  41.217  1.00 10.00 ? 9   A   A P     1 
ATOM   174  O  OP1   . A   A 1 9  ? 28.444 22.473  41.809  1.00 10.00 ? 9   A   A OP1   1 
ATOM   175  O  OP2   . A   A 1 9  ? 28.432 20.042  41.176  1.00 10.00 ? 9   A   A OP2   1 
ATOM   176  O  "O5'" . A   A 1 9  ? 29.678 21.695  39.746  1.00 10.00 ? 9   A   A "O5'" 1 
ATOM   177  C  "C5'" . A   A 1 9  ? 29.912 23.083  39.446  1.00 10.00 ? 9   A   A "C5'" 1 
ATOM   178  C  "C4'" . A   A 1 9  ? 29.420 23.423  38.053  1.00 10.00 ? 9   A   A "C4'" 1 
ATOM   179  O  "O4'" . A   A 1 9  ? 29.818 22.393  37.124  1.00 10.00 ? 9   A   A "O4'" 1 
ATOM   180  C  "C3'" . A   A 1 9  ? 27.887 23.515  38.008  1.00 10.00 ? 9   A   A "C3'" 1 
ATOM   181  O  "O3'" . A   A 1 9  ? 27.430 24.616  37.210  1.00 10.00 ? 9   A   A "O3'" 1 
ATOM   182  C  "C2'" . A   A 1 9  ? 27.539 22.156  37.387  1.00 10.00 ? 9   A   A "C2'" 1 
ATOM   183  O  "O2'" . A   A 1 9  ? 26.251 22.056  36.792  1.00 10.00 ? 9   A   A "O2'" 1 
ATOM   184  C  "C1'" . A   A 1 9  ? 28.670 21.959  36.408  1.00 10.00 ? 9   A   A "C1'" 1 
ATOM   185  N  N9    . A   A 1 9  ? 28.887 20.572  35.938  1.00 10.00 ? 9   A   A N9    1 
ATOM   186  C  C8    . A   A 1 9  ? 28.399 19.422  36.472  1.00 10.00 ? 9   A   A C8    1 
ATOM   187  N  N7    . A   A 1 9  ? 28.762 18.360  35.818  1.00 10.00 ? 9   A   A N7    1 
ATOM   188  C  C5    . A   A 1 9  ? 29.525 18.854  34.774  1.00 10.00 ? 9   A   A C5    1 
ATOM   189  C  C6    . A   A 1 9  ? 30.207 18.234  33.712  1.00 10.00 ? 9   A   A C6    1 
ATOM   190  N  N6    . A   A 1 9  ? 30.214 16.900  33.523  1.00 10.00 ? 9   A   A N6    1 
ATOM   191  N  N1    . A   A 1 9  ? 30.873 19.023  32.856  1.00 10.00 ? 9   A   A N1    1 
ATOM   192  C  C2    . A   A 1 9  ? 30.853 20.347  33.042  1.00 10.00 ? 9   A   A C2    1 
ATOM   193  N  N3    . A   A 1 9  ? 30.257 21.043  33.998  1.00 10.00 ? 9   A   A N3    1 
ATOM   194  C  C4    . A   A 1 9  ? 29.610 20.216  34.834  1.00 10.00 ? 9   A   A C4    1 
HETATM 195  P  P     . 2MG A 1 10 ? 27.199 26.049  37.852  1.00 10.00 ? 10  2MG A P     1 
HETATM 196  O  OP1   . 2MG A 1 10 ? 27.301 27.082  36.789  1.00 10.00 ? 10  2MG A OP1   1 
HETATM 197  O  OP2   . 2MG A 1 10 ? 28.112 26.231  39.008  1.00 10.00 ? 10  2MG A OP2   1 
HETATM 198  O  "O5'" . 2MG A 1 10 ? 25.694 25.949  38.377  1.00 10.00 ? 10  2MG A "O5'" 1 
HETATM 199  C  "C5'" . 2MG A 1 10 ? 24.866 27.128  38.262  1.00 10.00 ? 10  2MG A "C5'" 1 
HETATM 200  C  "C4'" . 2MG A 1 10 ? 23.391 26.728  38.331  1.00 10.00 ? 10  2MG A "C4'" 1 
HETATM 201  O  "O4'" . 2MG A 1 10 ? 22.854 26.730  36.982  1.00 10.00 ? 10  2MG A "O4'" 1 
HETATM 202  C  "C3'" . 2MG A 1 10 ? 23.100 25.374  38.953  1.00 10.00 ? 10  2MG A "C3'" 1 
HETATM 203  O  "O3'" . 2MG A 1 10 ? 22.878 25.468  40.354  1.00 10.00 ? 10  2MG A "O3'" 1 
HETATM 204  C  "C2'" . 2MG A 1 10 ? 21.873 24.919  38.175  1.00 10.00 ? 10  2MG A "C2'" 1 
HETATM 205  O  "O2'" . 2MG A 1 10 ? 20.704 25.561  38.662  1.00 10.00 ? 10  2MG A "O2'" 1 
HETATM 206  C  "C1'" . 2MG A 1 10 ? 22.150 25.503  36.784  1.00 10.00 ? 10  2MG A "C1'" 1 
HETATM 207  N  N9    . 2MG A 1 10 ? 22.973 24.625  35.924  1.00 10.00 ? 10  2MG A N9    1 
HETATM 208  C  C8    . 2MG A 1 10 ? 24.274 24.792  35.493  1.00 10.00 ? 10  2MG A C8    1 
HETATM 209  N  N7    . 2MG A 1 10 ? 24.713 23.823  34.727  1.00 10.00 ? 10  2MG A N7    1 
HETATM 210  C  C5    . 2MG A 1 10 ? 23.629 22.948  34.642  1.00 10.00 ? 10  2MG A C5    1 
HETATM 211  C  C6    . 2MG A 1 10 ? 23.506 21.717  33.954  1.00 10.00 ? 10  2MG A C6    1 
HETATM 212  O  O6    . 2MG A 1 10 ? 24.337 21.132  33.257  1.00 10.00 ? 10  2MG A O6    1 
HETATM 213  N  N1    . 2MG A 1 10 ? 22.232 21.155  34.137  1.00 10.00 ? 10  2MG A N1    1 
HETATM 214  C  C2    . 2MG A 1 10 ? 21.215 21.723  34.890  1.00 10.00 ? 10  2MG A C2    1 
HETATM 215  N  N2    . 2MG A 1 10 ? 20.080 21.022  34.934  1.00 10.00 ? 10  2MG A N2    1 
HETATM 216  C  CM2   . 2MG A 1 10 ? 19.002 21.624  35.731  1.00 10.00 ? 10  2MG A CM2   1 
HETATM 217  N  N3    . 2MG A 1 10 ? 21.333 22.871  35.536  1.00 10.00 ? 10  2MG A N3    1 
HETATM 218  C  C4    . 2MG A 1 10 ? 22.565 23.425  35.364  1.00 10.00 ? 10  2MG A C4    1 
ATOM   219  P  P     . C   A 1 11 ? 22.540 24.173  41.213  1.00 10.00 ? 11  C   A P     1 
ATOM   220  O  OP1   . C   A 1 11 ? 22.005 24.584  42.536  1.00 10.00 ? 11  C   A OP1   1 
ATOM   221  O  OP2   . C   A 1 11 ? 23.728 23.282  41.255  1.00 10.00 ? 11  C   A OP2   1 
ATOM   222  O  "O5'" . C   A 1 11 ? 21.391 23.481  40.344  1.00 10.00 ? 11  C   A "O5'" 1 
ATOM   223  C  "C5'" . C   A 1 11 ? 20.032 23.582  40.810  1.00 10.00 ? 11  C   A "C5'" 1 
ATOM   224  C  "C4'" . C   A 1 11 ? 19.351 22.215  40.702  1.00 10.00 ? 11  C   A "C4'" 1 
ATOM   225  O  "O4'" . C   A 1 11 ? 19.227 21.878  39.297  1.00 10.00 ? 11  C   A "O4'" 1 
ATOM   226  C  "C3'" . C   A 1 11 ? 20.083 21.057  41.357  1.00 10.00 ? 11  C   A "C3'" 1 
ATOM   227  O  "O3'" . C   A 1 11 ? 19.748 20.924  42.732  1.00 10.00 ? 11  C   A "O3'" 1 
ATOM   228  C  "C2'" . C   A 1 11 ? 19.636 19.873  40.507  1.00 10.00 ? 11  C   A "C2'" 1 
ATOM   229  O  "O2'" . C   A 1 11 ? 18.317 19.477  40.856  1.00 10.00 ? 11  C   A "O2'" 1 
ATOM   230  C  "C1'" . C   A 1 11 ? 19.557 20.500  39.114  1.00 10.00 ? 11  C   A "C1'" 1 
ATOM   231  N  N1    . C   A 1 11 ? 20.824 20.420  38.352  1.00 10.00 ? 11  C   A N1    1 
ATOM   232  C  C2    . C   A 1 11 ? 21.118 19.229  37.702  1.00 10.00 ? 11  C   A C2    1 
ATOM   233  O  O2    . C   A 1 11 ? 20.312 18.295  37.785  1.00 10.00 ? 11  C   A O2    1 
ATOM   234  N  N3    . C   A 1 11 ? 22.275 19.132  36.988  1.00 10.00 ? 11  C   A N3    1 
ATOM   235  C  C4    . C   A 1 11 ? 23.120 20.167  36.920  1.00 10.00 ? 11  C   A C4    1 
ATOM   236  N  N4    . C   A 1 11 ? 24.228 20.030  36.214  1.00 10.00 ? 11  C   A N4    1 
ATOM   237  C  C5    . C   A 1 11 ? 22.839 21.412  37.586  1.00 10.00 ? 11  C   A C5    1 
ATOM   238  C  C6    . C   A 1 11 ? 21.683 21.485  38.286  1.00 10.00 ? 11  C   A C6    1 
ATOM   239  P  P     . U   A 1 12 ? 20.240 19.682  43.593  1.00 10.00 ? 12  U   A P     1 
ATOM   240  O  OP1   . U   A 1 12 ? 19.513 19.668  44.887  1.00 10.00 ? 12  U   A OP1   1 
ATOM   241  O  OP2   . U   A 1 12 ? 21.722 19.704  43.693  1.00 10.00 ? 12  U   A OP2   1 
ATOM   242  O  "O5'" . U   A 1 12 ? 19.790 18.440  42.695  1.00 10.00 ? 12  U   A "O5'" 1 
ATOM   243  C  "C5'" . U   A 1 12 ? 19.124 17.340  43.317  1.00 10.00 ? 12  U   A "C5'" 1 
ATOM   244  C  "C4'" . U   A 1 12 ? 19.350 16.044  42.536  1.00 10.00 ? 12  U   A "C4'" 1 
ATOM   245  O  "O4'" . U   A 1 12 ? 19.713 16.354  41.153  1.00 10.00 ? 12  U   A "O4'" 1 
ATOM   246  C  "C3'" . U   A 1 12 ? 20.504 15.178  43.014  1.00 10.00 ? 12  U   A "C3'" 1 
ATOM   247  O  "O3'" . U   A 1 12 ? 20.153 14.407  44.155  1.00 10.00 ? 12  U   A "O3'" 1 
ATOM   248  C  "C2'" . U   A 1 12 ? 20.801 14.333  41.781  1.00 10.00 ? 12  U   A "C2'" 1 
ATOM   249  O  "O2'" . U   A 1 12 ? 19.820 13.320  41.619  1.00 10.00 ? 12  U   A "O2'" 1 
ATOM   250  C  "C1'" . U   A 1 12 ? 20.586 15.343  40.649  1.00 10.00 ? 12  U   A "C1'" 1 
ATOM   251  N  N1    . U   A 1 12 ? 21.833 15.993  40.185  1.00 10.00 ? 12  U   A N1    1 
ATOM   252  C  C2    . U   A 1 12 ? 22.603 15.306  39.281  1.00 10.00 ? 12  U   A C2    1 
ATOM   253  O  O2    . U   A 1 12 ? 22.311 14.197  38.861  1.00 10.00 ? 12  U   A O2    1 
ATOM   254  N  N3    . U   A 1 12 ? 23.753 15.944  38.870  1.00 10.00 ? 12  U   A N3    1 
ATOM   255  C  C4    . U   A 1 12 ? 24.193 17.193  39.279  1.00 10.00 ? 12  U   A C4    1 
ATOM   256  O  O4    . U   A 1 12 ? 25.237 17.663  38.832  1.00 10.00 ? 12  U   A O4    1 
ATOM   257  C  C5    . U   A 1 12 ? 23.318 17.840  40.227  1.00 10.00 ? 12  U   A C5    1 
ATOM   258  C  C6    . U   A 1 12 ? 22.188 17.244  40.640  1.00 10.00 ? 12  U   A C6    1 
ATOM   259  P  P     . C   A 1 13 ? 21.284 14.191  45.263  1.00 10.00 ? 13  C   A P     1 
ATOM   260  O  OP1   . C   A 1 13 ? 20.937 13.033  46.124  1.00 10.00 ? 13  C   A OP1   1 
ATOM   261  O  OP2   . C   A 1 13 ? 21.535 15.467  45.979  1.00 10.00 ? 13  C   A OP2   1 
ATOM   262  O  "O5'" . C   A 1 13 ? 22.548 13.840  44.352  1.00 10.00 ? 13  C   A "O5'" 1 
ATOM   263  C  "C5'" . C   A 1 13 ? 23.230 12.601  44.583  1.00 10.00 ? 13  C   A "C5'" 1 
ATOM   264  C  "C4'" . C   A 1 13 ? 23.751 12.006  43.275  1.00 10.00 ? 13  C   A "C4'" 1 
ATOM   265  O  "O4'" . C   A 1 13 ? 23.817 13.033  42.248  1.00 10.00 ? 13  C   A "O4'" 1 
ATOM   266  C  "C3'" . C   A 1 13 ? 25.177 11.484  43.307  1.00 10.00 ? 13  C   A "C3'" 1 
ATOM   267  O  "O3'" . C   A 1 13 ? 25.263 10.216  43.943  1.00 10.00 ? 13  C   A "O3'" 1 
ATOM   268  C  "C2'" . C   A 1 13 ? 25.539 11.447  41.828  1.00 10.00 ? 13  C   A "C2'" 1 
ATOM   269  O  "O2'" . C   A 1 13 ? 24.934 10.331  41.193  1.00 10.00 ? 13  C   A "O2'" 1 
ATOM   270  C  "C1'" . C   A 1 13 ? 24.829 12.698  41.299  1.00 10.00 ? 13  C   A "C1'" 1 
ATOM   271  N  N1    . C   A 1 13 ? 25.722 13.868  41.133  1.00 10.00 ? 13  C   A N1    1 
ATOM   272  C  C2    . C   A 1 13 ? 26.726 13.791  40.178  1.00 10.00 ? 13  C   A C2    1 
ATOM   273  O  O2    . C   A 1 13 ? 26.825 12.756  39.508  1.00 10.00 ? 13  C   A O2    1 
ATOM   274  N  N3    . C   A 1 13 ? 27.557 14.855  40.002  1.00 10.00 ? 13  C   A N3    1 
ATOM   275  C  C4    . C   A 1 13 ? 27.415 15.958  40.747  1.00 10.00 ? 13  C   A C4    1 
ATOM   276  N  N4    . C   A 1 13 ? 28.240 16.968  40.541  1.00 10.00 ? 13  C   A N4    1 
ATOM   277  C  C5    . C   A 1 13 ? 26.384 16.062  41.746  1.00 10.00 ? 13  C   A C5    1 
ATOM   278  C  C6    . C   A 1 13 ? 25.569 14.992  41.899  1.00 10.00 ? 13  C   A C6    1 
ATOM   279  P  P     . A   A 1 14 ? 26.685 9.701   44.440  1.00 10.00 ? 14  A   A P     1 
ATOM   280  O  OP1   . A   A 1 14 ? 26.510 8.622   45.447  1.00 10.00 ? 14  A   A OP1   1 
ATOM   281  O  OP2   . A   A 1 14 ? 27.513 10.855  44.876  1.00 10.00 ? 14  A   A OP2   1 
ATOM   282  O  "O5'" . A   A 1 14 ? 27.287 9.101   43.089  1.00 10.00 ? 14  A   A "O5'" 1 
ATOM   283  C  "C5'" . A   A 1 14 ? 28.674 8.715   43.075  1.00 10.00 ? 14  A   A "C5'" 1 
ATOM   284  C  "C4'" . A   A 1 14 ? 29.013 8.068   41.731  1.00 10.00 ? 14  A   A "C4'" 1 
ATOM   285  O  "O4'" . A   A 1 14 ? 28.682 9.010   40.660  1.00 10.00 ? 14  A   A "O4'" 1 
ATOM   286  C  "C3'" . A   A 1 14 ? 30.474 7.706   41.523  1.00 10.00 ? 14  A   A "C3'" 1 
ATOM   287  O  "O3'" . A   A 1 14 ? 30.785 6.427   42.058  1.00 10.00 ? 14  A   A "O3'" 1 
ATOM   288  C  "C2'" . A   A 1 14 ? 30.607 7.779   40.006  1.00 10.00 ? 14  A   A "C2'" 1 
ATOM   289  O  "O2'" . A   A 1 14 ? 30.022 6.637   39.398  1.00 10.00 ? 14  A   A "O2'" 1 
ATOM   290  C  "C1'" . A   A 1 14 ? 29.708 8.972   39.667  1.00 10.00 ? 14  A   A "C1'" 1 
ATOM   291  N  N9    . A   A 1 14 ? 30.415 10.272  39.676  1.00 10.00 ? 14  A   A N9    1 
ATOM   292  C  C8    . A   A 1 14 ? 30.217 11.336  40.507  1.00 10.00 ? 14  A   A C8    1 
ATOM   293  N  N7    . A   A 1 14 ? 30.993 12.348  40.255  1.00 10.00 ? 14  A   A N7    1 
ATOM   294  C  C5    . A   A 1 14 ? 31.761 11.923  39.187  1.00 10.00 ? 14  A   A C5    1 
ATOM   295  C  C6    . A   A 1 14 ? 32.785 12.535  38.441  1.00 10.00 ? 14  A   A C6    1 
ATOM   296  N  N6    . A   A 1 14 ? 33.233 13.781  38.692  1.00 10.00 ? 14  A   A N6    1 
ATOM   297  N  N1    . A   A 1 14 ? 33.330 11.832  37.438  1.00 10.00 ? 14  A   A N1    1 
ATOM   298  C  C2    . A   A 1 14 ? 32.890 10.592  37.202  1.00 10.00 ? 14  A   A C2    1 
ATOM   299  N  N3    . A   A 1 14 ? 31.938 9.913   37.823  1.00 10.00 ? 14  A   A N3    1 
ATOM   300  C  C4    . A   A 1 14 ? 31.416 10.655  38.811  1.00 10.00 ? 14  A   A C4    1 
ATOM   301  P  P     . G   A 1 15 ? 31.738 6.418   43.353  1.00 10.00 ? 15  G   A P     1 
ATOM   302  O  OP1   . G   A 1 15 ? 31.800 5.055   43.940  1.00 10.00 ? 15  G   A OP1   1 
ATOM   303  O  OP2   . G   A 1 15 ? 31.314 7.495   44.284  1.00 10.00 ? 15  G   A OP2   1 
ATOM   304  O  "O5'" . G   A 1 15 ? 33.147 6.803   42.707  1.00 10.00 ? 15  G   A "O5'" 1 
ATOM   305  C  "C5'" . G   A 1 15 ? 33.281 6.539   41.279  1.00 10.00 ? 15  G   A "C5'" 1 
ATOM   306  C  "C4'" . G   A 1 15 ? 34.563 7.174   40.739  1.00 10.00 ? 15  G   A "C4'" 1 
ATOM   307  O  "O4'" . G   A 1 15 ? 34.139 8.432   40.031  1.00 10.00 ? 15  G   A "O4'" 1 
ATOM   308  C  "C3'" . G   A 1 15 ? 35.554 7.655   41.784  1.00 10.00 ? 15  G   A "C3'" 1 
ATOM   309  O  "O3'" . G   A 1 15 ? 36.442 6.623   42.188  1.00 10.00 ? 15  G   A "O3'" 1 
ATOM   310  C  "C2'" . G   A 1 15 ? 36.248 8.805   41.062  1.00 10.00 ? 15  G   A "C2'" 1 
ATOM   311  O  "O2'" . G   A 1 15 ? 37.132 8.310   40.068  1.00 10.00 ? 15  G   A "O2'" 1 
ATOM   312  C  "C1'" . G   A 1 15 ? 35.078 9.466   40.327  1.00 10.00 ? 15  G   A "C1'" 1 
ATOM   313  N  N9    . G   A 1 15 ? 34.389 10.510  41.118  1.00 10.00 ? 15  G   A N9    1 
ATOM   314  C  C8    . G   A 1 15 ? 33.297 10.395  41.955  1.00 10.00 ? 15  G   A C8    1 
ATOM   315  N  N7    . G   A 1 15 ? 32.926 11.524  42.507  1.00 10.00 ? 15  G   A N7    1 
ATOM   316  C  C5    . G   A 1 15 ? 33.833 12.457  42.003  1.00 10.00 ? 15  G   A C5    1 
ATOM   317  C  C6    . G   A 1 15 ? 33.938 13.848  42.249  1.00 10.00 ? 15  G   A C6    1 
ATOM   318  O  O6    . G   A 1 15 ? 33.236 14.565  42.963  1.00 10.00 ? 15  G   A O6    1 
ATOM   319  N  N1    . G   A 1 15 ? 35.007 14.413  41.533  1.00 10.00 ? 15  G   A N1    1 
ATOM   320  C  C2    . G   A 1 15 ? 35.857 13.711  40.690  1.00 10.00 ? 15  G   A C2    1 
ATOM   321  N  N2    . G   A 1 15 ? 36.811 14.442  40.108  1.00 10.00 ? 15  G   A N2    1 
ATOM   322  N  N3    . G   A 1 15 ? 35.762 12.410  40.469  1.00 10.00 ? 15  G   A N3    1 
ATOM   323  C  C4    . G   A 1 15 ? 34.727 11.853  41.158  1.00 10.00 ? 15  G   A C4    1 
HETATM 324  P  P     . H2U A 1 16 ? 36.961 6.769   43.706  1.00 10.00 ? 16  H2U A P     1 
HETATM 325  O  OP1   . H2U A 1 16 ? 35.817 7.124   44.581  1.00 10.00 ? 16  H2U A OP1   1 
HETATM 326  O  OP2   . H2U A 1 16 ? 38.111 7.709   43.746  1.00 10.00 ? 16  H2U A OP2   1 
HETATM 327  O  "O5'" . H2U A 1 16 ? 37.474 5.293   44.043  1.00 10.00 ? 16  H2U A "O5'" 1 
HETATM 328  C  "C5'" . H2U A 1 16 ? 38.182 4.577   43.004  1.00 10.00 ? 16  H2U A "C5'" 1 
HETATM 329  C  "C4'" . H2U A 1 16 ? 39.212 3.654   43.633  1.00 10.00 ? 16  H2U A "C4'" 1 
HETATM 330  O  "O4'" . H2U A 1 16 ? 38.772 3.234   44.939  1.00 10.00 ? 16  H2U A "O4'" 1 
HETATM 331  C  "C3'" . H2U A 1 16 ? 39.417 2.388   42.787  1.00 10.00 ? 16  H2U A "C3'" 1 
HETATM 332  O  "O3'" . H2U A 1 16 ? 40.798 2.011   42.699  1.00 10.00 ? 16  H2U A "O3'" 1 
HETATM 333  C  "C1'" . H2U A 1 16 ? 38.831 1.817   45.007  1.00 10.00 ? 16  H2U A "C1'" 1 
HETATM 334  C  "C2'" . H2U A 1 16 ? 38.585 1.376   43.587  1.00 10.00 ? 16  H2U A "C2'" 1 
HETATM 335  O  "O2'" . H2U A 1 16 ? 38.886 0.004   43.357  1.00 10.00 ? 16  H2U A "O2'" 1 
HETATM 336  N  N1    . H2U A 1 16 ? 37.882 1.348   45.992  1.00 10.00 ? 16  H2U A N1    1 
HETATM 337  C  C2    . H2U A 1 16 ? 38.033 1.733   47.282  1.00 10.00 ? 16  H2U A C2    1 
HETATM 338  O  O2    . H2U A 1 16 ? 38.897 2.500   47.683  1.00 10.00 ? 16  H2U A O2    1 
HETATM 339  N  N3    . H2U A 1 16 ? 37.119 1.207   48.187  1.00 10.00 ? 16  H2U A N3    1 
HETATM 340  C  C4    . H2U A 1 16 ? 35.988 0.509   47.884  1.00 10.00 ? 16  H2U A C4    1 
HETATM 341  O  O4    . H2U A 1 16 ? 35.225 0.157   48.782  1.00 10.00 ? 16  H2U A O4    1 
HETATM 342  C  C5    . H2U A 1 16 ? 35.736 0.277   46.431  1.00 10.00 ? 16  H2U A C5    1 
HETATM 343  C  C6    . H2U A 1 16 ? 37.034 0.219   45.660  1.00 10.00 ? 16  H2U A C6    1 
HETATM 344  P  P     . H2U A 1 17 ? 41.759 3.069   41.972  1.00 10.00 ? 17  H2U A P     1 
HETATM 345  O  OP1   . H2U A 1 17 ? 41.611 4.394   42.628  1.00 10.00 ? 17  H2U A OP1   1 
HETATM 346  O  OP2   . H2U A 1 17 ? 41.502 3.048   40.510  1.00 10.00 ? 17  H2U A OP2   1 
HETATM 347  O  "O5'" . H2U A 1 17 ? 43.212 2.473   42.260  1.00 10.00 ? 17  H2U A "O5'" 1 
HETATM 348  C  "C5'" . H2U A 1 17 ? 43.918 2.927   43.417  1.00 10.00 ? 17  H2U A "C5'" 1 
HETATM 349  C  "C4'" . H2U A 1 17 ? 45.216 3.625   43.054  1.00 10.00 ? 17  H2U A "C4'" 1 
HETATM 350  O  "O4'" . H2U A 1 17 ? 45.930 2.958   42.016  1.00 10.00 ? 17  H2U A "O4'" 1 
HETATM 351  C  "C3'" . H2U A 1 17 ? 44.967 5.082   42.630  1.00 10.00 ? 17  H2U A "C3'" 1 
HETATM 352  O  "O3'" . H2U A 1 17 ? 45.784 6.009   43.356  1.00 10.00 ? 17  H2U A "O3'" 1 
HETATM 353  C  "C1'" . H2U A 1 17 ? 46.427 3.962   41.140  1.00 10.00 ? 17  H2U A "C1'" 1 
HETATM 354  C  "C2'" . H2U A 1 17 ? 45.344 5.013   41.144  1.00 10.00 ? 17  H2U A "C2'" 1 
HETATM 355  O  "O2'" . H2U A 1 17 ? 45.741 6.241   40.545  1.00 10.00 ? 17  H2U A "O2'" 1 
HETATM 356  N  N1    . H2U A 1 17 ? 46.729 3.369   39.860  1.00 10.00 ? 17  H2U A N1    1 
HETATM 357  C  C2    . H2U A 1 17 ? 45.724 3.193   38.966  1.00 10.00 ? 17  H2U A C2    1 
HETATM 358  O  O2    . H2U A 1 17 ? 44.568 3.547   39.140  1.00 10.00 ? 17  H2U A O2    1 
HETATM 359  N  N3    . H2U A 1 17 ? 46.071 2.566   37.775  1.00 10.00 ? 17  H2U A N3    1 
HETATM 360  C  C4    . H2U A 1 17 ? 47.333 2.293   37.340  1.00 10.00 ? 17  H2U A C4    1 
HETATM 361  O  O4    . H2U A 1 17 ? 47.504 1.795   36.228  1.00 10.00 ? 17  H2U A O4    1 
HETATM 362  C  C5    . H2U A 1 17 ? 48.440 2.688   38.259  1.00 10.00 ? 17  H2U A C5    1 
HETATM 363  C  C6    . H2U A 1 17 ? 47.983 2.654   39.701  1.00 10.00 ? 17  H2U A C6    1 
ATOM   364  P  P     . G   A 1 18 ? 45.420 6.343   44.867  1.00 10.00 ? 18  G   A P     1 
ATOM   365  O  OP1   . G   A 1 18 ? 46.402 5.700   45.778  1.00 10.00 ? 18  G   A OP1   1 
ATOM   366  O  OP2   . G   A 1 18 ? 43.996 6.005   45.125  1.00 10.00 ? 18  G   A OP2   1 
ATOM   367  O  "O5'" . G   A 1 18 ? 45.600 7.931   44.894  1.00 10.00 ? 18  G   A "O5'" 1 
ATOM   368  C  "C5'" . G   A 1 18 ? 44.742 8.696   44.030  1.00 10.00 ? 18  G   A "C5'" 1 
ATOM   369  C  "C4'" . G   A 1 18 ? 45.517 9.782   43.302  1.00 10.00 ? 18  G   A "C4'" 1 
ATOM   370  O  "O4'" . G   A 1 18 ? 46.322 10.509  44.336  1.00 10.00 ? 18  G   A "O4'" 1 
ATOM   371  C  "C3'" . G   A 1 18 ? 46.516 9.180   42.302  1.00 10.00 ? 18  G   A "C3'" 1 
ATOM   372  O  "O3'" . G   A 1 18 ? 46.615 9.956   41.100  1.00 10.00 ? 18  G   A "O3'" 1 
ATOM   373  C  "C2'" . G   A 1 18 ? 47.805 9.220   43.130  1.00 10.00 ? 18  G   A "C2'" 1 
ATOM   374  O  "O2'" . G   A 1 18 ? 49.020 9.112   42.398  1.00 10.00 ? 18  G   A "O2'" 1 
ATOM   375  C  "C1'" . G   A 1 18 ? 47.663 10.526  43.873  1.00 10.00 ? 18  G   A "C1'" 1 
ATOM   376  N  N9    . G   A 1 18 ? 48.573 10.720  45.024  1.00 10.00 ? 18  G   A N9    1 
ATOM   377  C  C8    . G   A 1 18 ? 48.995 9.808   45.959  1.00 10.00 ? 18  G   A C8    1 
ATOM   378  N  N7    . G   A 1 18 ? 49.820 10.308  46.844  1.00 10.00 ? 18  G   A N7    1 
ATOM   379  C  C5    . G   A 1 18 ? 49.957 11.642  46.457  1.00 10.00 ? 18  G   A C5    1 
ATOM   380  C  C6    . G   A 1 18 ? 50.730 12.680  47.033  1.00 10.00 ? 18  G   A C6    1 
ATOM   381  O  O6    . G   A 1 18 ? 51.458 12.647  48.026  1.00 10.00 ? 18  G   A O6    1 
ATOM   382  N  N1    . G   A 1 18 ? 50.581 13.882  46.319  1.00 10.00 ? 18  G   A N1    1 
ATOM   383  C  C2    . G   A 1 18 ? 49.783 14.045  45.197  1.00 10.00 ? 18  G   A C2    1 
ATOM   384  N  N2    . G   A 1 18 ? 49.785 15.272  44.669  1.00 10.00 ? 18  G   A N2    1 
ATOM   385  N  N3    . G   A 1 18 ? 49.068 13.071  44.657  1.00 10.00 ? 18  G   A N3    1 
ATOM   386  C  C4    . G   A 1 18 ? 49.204 11.902  45.342  1.00 10.00 ? 18  G   A C4    1 
ATOM   387  P  P     . G   A 1 19 ? 45.922 9.722   39.750  1.00 10.00 ? 19  G   A P     1 
ATOM   388  O  OP1   . G   A 1 19 ? 44.453 9.876   39.892  1.00 10.00 ? 19  G   A OP1   1 
ATOM   389  O  OP2   . G   A 1 19 ? 46.377 8.417   39.205  1.00 10.00 ? 19  G   A OP2   1 
ATOM   390  O  "O5'" . G   A 1 19 ? 46.518 10.905  38.859  1.00 10.00 ? 19  G   A "O5'" 1 
ATOM   391  C  "C5'" . G   A 1 19 ? 46.056 12.210  38.931  1.00 10.00 ? 19  G   A "C5'" 1 
ATOM   392  C  "C4'" . G   A 1 19 ? 46.851 13.233  38.139  1.00 10.00 ? 19  G   A "C4'" 1 
ATOM   393  O  "O4'" . G   A 1 19 ? 48.257 13.155  38.431  1.00 10.00 ? 19  G   A "O4'" 1 
ATOM   394  C  "C3'" . G   A 1 19 ? 46.807 12.931  36.632  1.00 10.00 ? 19  G   A "C3'" 1 
ATOM   395  O  "O3'" . G   A 1 19 ? 47.041 14.101  35.836  1.00 10.00 ? 19  G   A "O3'" 1 
ATOM   396  C  "C2'" . G   A 1 19 ? 47.944 11.907  36.518  1.00 10.00 ? 19  G   A "C2'" 1 
ATOM   397  O  "O2'" . G   A 1 19 ? 48.402 11.634  35.200  1.00 10.00 ? 19  G   A "O2'" 1 
ATOM   398  C  "C1'" . G   A 1 19 ? 49.001 12.506  37.410  1.00 10.00 ? 19  G   A "C1'" 1 
ATOM   399  N  N9    . G   A 1 19 ? 49.944 11.550  38.030  1.00 10.00 ? 19  G   A N9    1 
ATOM   400  C  C8    . G   A 1 19 ? 49.788 10.205  38.268  1.00 10.00 ? 19  G   A C8    1 
ATOM   401  N  N7    . G   A 1 19 ? 50.832 9.643   38.823  1.00 10.00 ? 19  G   A N7    1 
ATOM   402  C  C5    . G   A 1 19 ? 51.745 10.691  38.955  1.00 10.00 ? 19  G   A C5    1 
ATOM   403  C  C6    . G   A 1 19 ? 53.058 10.693  39.482  1.00 10.00 ? 19  G   A C6    1 
ATOM   404  O  O6    . G   A 1 19 ? 53.701 9.759   39.965  1.00 10.00 ? 19  G   A O6    1 
ATOM   405  N  N1    . G   A 1 19 ? 53.632 11.974  39.418  1.00 10.00 ? 19  G   A N1    1 
ATOM   406  C  C2    . G   A 1 19 ? 53.004 13.101  38.908  1.00 10.00 ? 19  G   A C2    1 
ATOM   407  N  N2    . G   A 1 19 ? 53.729 14.221  38.939  1.00 10.00 ? 19  G   A N2    1 
ATOM   408  N  N3    . G   A 1 19 ? 51.779 13.096  38.407  1.00 10.00 ? 19  G   A N3    1 
ATOM   409  C  C4    . G   A 1 19 ? 51.214 11.858  38.467  1.00 10.00 ? 19  G   A C4    1 
ATOM   410  P  P     . G   A 1 20 ? 45.742 15.011  35.596  1.00 10.00 ? 20  G   A P     1 
ATOM   411  O  OP1   . G   A 1 20 ? 46.048 16.433  35.301  1.00 10.00 ? 20  G   A OP1   1 
ATOM   412  O  OP2   . G   A 1 20 ? 44.853 14.776  36.763  1.00 10.00 ? 20  G   A OP2   1 
ATOM   413  O  "O5'" . G   A 1 20 ? 45.120 14.302  34.309  1.00 10.00 ? 20  G   A "O5'" 1 
ATOM   414  C  "C5'" . G   A 1 20 ? 45.524 14.868  33.032  1.00 10.00 ? 20  G   A "C5'" 1 
ATOM   415  C  "C4'" . G   A 1 20 ? 44.360 14.616  32.073  1.00 10.00 ? 20  G   A "C4'" 1 
ATOM   416  O  "O4'" . G   A 1 20 ? 43.980 13.215  32.289  1.00 10.00 ? 20  G   A "O4'" 1 
ATOM   417  C  "C3'" . G   A 1 20 ? 43.082 15.381  32.368  1.00 10.00 ? 20  G   A "C3'" 1 
ATOM   418  O  "O3'" . G   A 1 20 ? 43.088 16.676  31.782  1.00 10.00 ? 20  G   A "O3'" 1 
ATOM   419  C  "C2'" . G   A 1 20 ? 42.016 14.458  31.790  1.00 10.00 ? 20  G   A "C2'" 1 
ATOM   420  O  "O2'" . G   A 1 20 ? 42.001 14.537  30.372  1.00 10.00 ? 20  G   A "O2'" 1 
ATOM   421  C  "C1'" . G   A 1 20 ? 42.566 13.075  32.154  1.00 10.00 ? 20  G   A "C1'" 1 
ATOM   422  N  N9    . G   A 1 20 ? 42.027 12.533  33.420  1.00 10.00 ? 20  G   A N9    1 
ATOM   423  C  C8    . G   A 1 20 ? 42.701 12.100  34.547  1.00 10.00 ? 20  G   A C8    1 
ATOM   424  N  N7    . G   A 1 20 ? 41.921 11.667  35.506  1.00 10.00 ? 20  G   A N7    1 
ATOM   425  C  C5    . G   A 1 20 ? 40.636 11.819  34.983  1.00 10.00 ? 20  G   A C5    1 
ATOM   426  C  C6    . G   A 1 20 ? 39.379 11.525  35.566  1.00 10.00 ? 20  G   A C6    1 
ATOM   427  O  O6    . G   A 1 20 ? 39.128 11.051  36.676  1.00 10.00 ? 20  G   A O6    1 
ATOM   428  N  N1    . G   A 1 20 ? 38.327 11.838  34.688  1.00 10.00 ? 20  G   A N1    1 
ATOM   429  C  C2    . G   A 1 20 ? 38.485 12.364  33.412  1.00 10.00 ? 20  G   A C2    1 
ATOM   430  N  N2    . G   A 1 20 ? 37.351 12.588  32.745  1.00 10.00 ? 20  G   A N2    1 
ATOM   431  N  N3    . G   A 1 20 ? 39.660 12.645  32.874  1.00 10.00 ? 20  G   A N3    1 
ATOM   432  C  C4    . G   A 1 20 ? 40.687 12.344  33.717  1.00 10.00 ? 20  G   A C4    1 
ATOM   433  P  P     . A   A 1 21 ? 43.199 17.940  32.753  1.00 10.00 ? 21  A   A P     1 
ATOM   434  O  OP1   . A   A 1 21 ? 42.847 19.176  32.008  1.00 10.00 ? 21  A   A OP1   1 
ATOM   435  O  OP2   . A   A 1 21 ? 44.531 17.948  33.410  1.00 10.00 ? 21  A   A OP2   1 
ATOM   436  O  "O5'" . A   A 1 21 ? 42.076 17.613  33.841  1.00 10.00 ? 21  A   A "O5'" 1 
ATOM   437  C  "C5'" . A   A 1 21 ? 40.743 18.126  33.663  1.00 10.00 ? 21  A   A "C5'" 1 
ATOM   438  C  "C4'" . A   A 1 21 ? 39.716 17.074  34.089  1.00 10.00 ? 21  A   A "C4'" 1 
ATOM   439  O  "O4'" . A   A 1 21 ? 39.552 17.054  35.493  1.00 10.00 ? 21  A   A "O4'" 1 
ATOM   440  C  "C3'" . A   A 1 21 ? 38.334 17.216  33.478  1.00 10.00 ? 21  A   A "C3'" 1 
ATOM   441  O  "O3'" . A   A 1 21 ? 38.261 16.630  32.185  1.00 10.00 ? 21  A   A "O3'" 1 
ATOM   442  C  "C2'" . A   A 1 21 ? 37.454 16.520  34.508  1.00 10.00 ? 21  A   A "C2'" 1 
ATOM   443  O  "O2'" . A   A 1 21 ? 37.523 15.109  34.356  1.00 10.00 ? 21  A   A "O2'" 1 
ATOM   444  C  "C1'" . A   A 1 21 ? 38.175 16.860  35.816  1.00 10.00 ? 21  A   A "C1'" 1 
ATOM   445  N  N9    . A   A 1 21 ? 37.672 18.087  36.473  1.00 10.00 ? 21  A   A N9    1 
ATOM   446  C  C8    . A   A 1 21 ? 38.086 19.375  36.284  1.00 10.00 ? 21  A   A C8    1 
ATOM   447  N  N7    . A   A 1 21 ? 37.453 20.240  37.018  1.00 10.00 ? 21  A   A N7    1 
ATOM   448  C  C5    . A   A 1 21 ? 36.554 19.472  37.740  1.00 10.00 ? 21  A   A C5    1 
ATOM   449  C  C6    . A   A 1 21 ? 35.582 19.791  38.703  1.00 10.00 ? 21  A   A C6    1 
ATOM   450  N  N6    . A   A 1 21 ? 35.344 21.049  39.119  1.00 10.00 ? 21  A   A N6    1 
ATOM   451  N  N1    . A   A 1 21 ? 34.866 18.781  39.223  1.00 10.00 ? 21  A   A N1    1 
ATOM   452  C  C2    . A   A 1 21 ? 35.099 17.536  38.801  1.00 10.00 ? 21  A   A C2    1 
ATOM   453  N  N3    . A   A 1 21 ? 35.981 17.111  37.911  1.00 10.00 ? 21  A   A N3    1 
ATOM   454  C  C4    . A   A 1 21 ? 36.679 18.148  37.422  1.00 10.00 ? 21  A   A C4    1 
ATOM   455  P  P     . G   A 1 22 ? 36.937 16.521  31.328  1.00 10.00 ? 22  G   A P     1 
ATOM   456  O  OP1   . G   A 1 22 ? 37.254 15.907  30.015  1.00 10.00 ? 22  G   A OP1   1 
ATOM   457  O  OP2   . G   A 1 22 ? 36.274 17.848  31.270  1.00 10.00 ? 22  G   A OP2   1 
ATOM   458  O  "O5'" . G   A 1 22 ? 36.047 15.522  32.202  1.00 10.00 ? 22  G   A "O5'" 1 
ATOM   459  C  "C5'" . G   A 1 22 ? 34.623 15.535  31.963  1.00 10.00 ? 22  G   A "C5'" 1 
ATOM   460  C  "C4'" . G   A 1 22 ? 34.024 14.160  32.270  1.00 10.00 ? 22  G   A "C4'" 1 
ATOM   461  O  "O4'" . G   A 1 22 ? 34.335 13.839  33.661  1.00 10.00 ? 22  G   A "O4'" 1 
ATOM   462  C  "C3'" . G   A 1 22 ? 32.518 14.043  32.100  1.00 10.00 ? 22  G   A "C3'" 1 
ATOM   463  O  "O3'" . G   A 1 22 ? 32.163 13.631  30.789  1.00 10.00 ? 22  G   A "O3'" 1 
ATOM   464  C  "C2'" . G   A 1 22 ? 32.153 13.027  33.176  1.00 10.00 ? 22  G   A "C2'" 1 
ATOM   465  O  "O2'" . G   A 1 22 ? 32.473 11.710  32.752  1.00 10.00 ? 22  G   A "O2'" 1 
ATOM   466  C  "C1'" . G   A 1 22 ? 33.139 13.384  34.294  1.00 10.00 ? 22  G   A "C1'" 1 
ATOM   467  N  N9    . G   A 1 22 ? 32.653 14.451  35.197  1.00 10.00 ? 22  G   A N9    1 
ATOM   468  C  C8    . G   A 1 22 ? 33.139 15.730  35.382  1.00 10.00 ? 22  G   A C8    1 
ATOM   469  N  N7    . G   A 1 22 ? 32.479 16.430  36.270  1.00 10.00 ? 22  G   A N7    1 
ATOM   470  C  C5    . G   A 1 22 ? 31.485 15.555  36.713  1.00 10.00 ? 22  G   A C5    1 
ATOM   471  C  C6    . G   A 1 22 ? 30.460 15.752  37.669  1.00 10.00 ? 22  G   A C6    1 
ATOM   472  O  O6    . G   A 1 22 ? 30.216 16.751  38.350  1.00 10.00 ? 22  G   A O6    1 
ATOM   473  N  N1    . G   A 1 22 ? 29.666 14.602  37.810  1.00 10.00 ? 22  G   A N1    1 
ATOM   474  C  C2    . G   A 1 22 ? 29.850 13.419  37.110  1.00 10.00 ? 22  G   A C2    1 
ATOM   475  N  N2    . G   A 1 22 ? 28.980 12.447  37.396  1.00 10.00 ? 22  G   A N2    1 
ATOM   476  N  N3    . G   A 1 22 ? 30.803 13.240  36.212  1.00 10.00 ? 22  G   A N3    1 
ATOM   477  C  C4    . G   A 1 22 ? 31.580 14.350  36.067  1.00 10.00 ? 22  G   A C4    1 
ATOM   478  P  P     . A   A 1 23 ? 30.828 14.221  30.141  1.00 10.00 ? 23  A   A P     1 
ATOM   479  O  OP1   . A   A 1 23 ? 30.866 14.053  28.668  1.00 10.00 ? 23  A   A OP1   1 
ATOM   480  O  OP2   . A   A 1 23 ? 30.616 15.611  30.622  1.00 10.00 ? 23  A   A OP2   1 
ATOM   481  O  "O5'" . A   A 1 23 ? 29.713 13.268  30.777  1.00 10.00 ? 23  A   A "O5'" 1 
ATOM   482  C  "C5'" . A   A 1 23 ? 29.929 11.832  30.666  1.00 10.00 ? 23  A   A "C5'" 1 
ATOM   483  C  "C4'" . A   A 1 23 ? 28.781 11.099  31.365  1.00 10.00 ? 23  A   A "C4'" 1 
ATOM   484  O  "O4'" . A   A 1 23 ? 28.998 11.195  32.812  1.00 10.00 ? 23  A   A "O4'" 1 
ATOM   485  C  "C3'" . A   A 1 23 ? 27.394 11.676  31.132  1.00 10.00 ? 23  A   A "C3'" 1 
ATOM   486  O  "O3'" . A   A 1 23 ? 26.804 11.176  29.943  1.00 10.00 ? 23  A   A "O3'" 1 
ATOM   487  C  "C2'" . A   A 1 23 ? 26.657 11.252  32.398  1.00 10.00 ? 23  A   A "C2'" 1 
ATOM   488  O  "O2'" . A   A 1 23 ? 26.327 9.871   32.348  1.00 10.00 ? 23  A   A "O2'" 1 
ATOM   489  C  "C1'" . A   A 1 23 ? 27.747 11.409  33.465  1.00 10.00 ? 23  A   A "C1'" 1 
ATOM   490  N  N9    . A   A 1 23 ? 27.772 12.748  34.096  1.00 10.00 ? 23  A   A N9    1 
ATOM   491  C  C8    . A   A 1 23 ? 28.657 13.766  33.881  1.00 10.00 ? 23  A   A C8    1 
ATOM   492  N  N7    . A   A 1 23 ? 28.421 14.822  34.600  1.00 10.00 ? 23  A   A N7    1 
ATOM   493  C  C5    . A   A 1 23 ? 27.299 14.482  35.337  1.00 10.00 ? 23  A   A C5    1 
ATOM   494  C  C6    . A   A 1 23 ? 26.538 15.175  36.295  1.00 10.00 ? 23  A   A C6    1 
ATOM   495  N  N6    . A   A 1 23 ? 26.818 16.434  36.684  1.00 10.00 ? 23  A   A N6    1 
ATOM   496  N  N1    . A   A 1 23 ? 25.489 14.537  36.836  1.00 10.00 ? 23  A   A N1    1 
ATOM   497  C  C2    . A   A 1 23 ? 25.209 13.294  36.436  1.00 10.00 ? 23  A   A C2    1 
ATOM   498  N  N3    . A   A 1 23 ? 25.846 12.540  35.553  1.00 10.00 ? 23  A   A N3    1 
ATOM   499  C  C4    . A   A 1 23 ? 26.890 13.211  35.043  1.00 10.00 ? 23  A   A C4    1 
ATOM   500  P  P     . G   A 1 24 ? 26.115 12.217  28.940  1.00 10.00 ? 24  G   A P     1 
ATOM   501  O  OP1   . G   A 1 24 ? 26.455 11.861  27.540  1.00 10.00 ? 24  G   A OP1   1 
ATOM   502  O  OP2   . G   A 1 24 ? 26.460 13.603  29.348  1.00 10.00 ? 24  G   A OP2   1 
ATOM   503  O  "O5'" . G   A 1 24 ? 24.565 11.955  29.216  1.00 10.00 ? 24  G   A "O5'" 1 
ATOM   504  C  "C5'" . G   A 1 24 ? 24.207 10.740  29.913  1.00 10.00 ? 24  G   A "C5'" 1 
ATOM   505  C  "C4'" . G   A 1 24 ? 22.996 11.007  30.809  1.00 10.00 ? 24  G   A "C4'" 1 
ATOM   506  O  "O4'" . G   A 1 24 ? 23.461 11.343  32.143  1.00 10.00 ? 24  G   A "O4'" 1 
ATOM   507  C  "C3'" . G   A 1 24 ? 22.121 12.181  30.402  1.00 10.00 ? 24  G   A "C3'" 1 
ATOM   508  O  "O3'" . G   A 1 24 ? 21.191 11.825  29.387  1.00 10.00 ? 24  G   A "O3'" 1 
ATOM   509  C  "C2'" . G   A 1 24 ? 21.462 12.561  31.722  1.00 10.00 ? 24  G   A "C2'" 1 
ATOM   510  O  "O2'" . G   A 1 24 ? 20.431 11.641  32.051  1.00 10.00 ? 24  G   A "O2'" 1 
ATOM   511  C  "C1'" . G   A 1 24 ? 22.601 12.326  32.720  1.00 10.00 ? 24  G   A "C1'" 1 
ATOM   512  N  N9    . G   A 1 24 ? 23.400 13.538  33.006  1.00 10.00 ? 24  G   A N9    1 
ATOM   513  C  C8    . G   A 1 24 ? 24.673 13.866  32.587  1.00 10.00 ? 24  G   A C8    1 
ATOM   514  N  N7    . G   A 1 24 ? 25.101 15.024  33.025  1.00 10.00 ? 24  G   A N7    1 
ATOM   515  C  C5    . G   A 1 24 ? 24.040 15.500  33.798  1.00 10.00 ? 24  G   A C5    1 
ATOM   516  C  C6    . G   A 1 24 ? 23.913 16.710  34.522  1.00 10.00 ? 24  G   A C6    1 
ATOM   517  O  O6    . G   A 1 24 ? 24.728 17.626  34.650  1.00 10.00 ? 24  G   A O6    1 
ATOM   518  N  N1    . G   A 1 24 ? 22.665 16.794  35.160  1.00 10.00 ? 24  G   A N1    1 
ATOM   519  C  C2    . G   A 1 24 ? 21.675 15.823  35.100  1.00 10.00 ? 24  G   A C2    1 
ATOM   520  N  N2    . G   A 1 24 ? 20.563 16.101  35.781  1.00 10.00 ? 24  G   A N2    1 
ATOM   521  N  N3    . G   A 1 24 ? 21.793 14.696  34.417  1.00 10.00 ? 24  G   A N3    1 
ATOM   522  C  C4    . G   A 1 24 ? 23.000 14.606  33.793  1.00 10.00 ? 24  G   A C4    1 
ATOM   523  P  P     . C   A 1 25 ? 19.784 12.544  29.244  1.00 10.00 ? 25  C   A P     1 
ATOM   524  O  OP1   . C   A 1 25 ? 18.806 11.906  30.161  1.00 10.00 ? 25  C   A OP1   1 
ATOM   525  O  OP2   . C   A 1 25 ? 19.394 12.569  27.813  1.00 10.00 ? 25  C   A OP2   1 
ATOM   526  O  "O5'" . C   A 1 25 ? 20.107 14.030  29.729  1.00 10.00 ? 25  C   A "O5'" 1 
ATOM   527  C  "C5'" . C   A 1 25 ? 19.137 15.051  29.406  1.00 10.00 ? 25  C   A "C5'" 1 
ATOM   528  C  "C4'" . C   A 1 25 ? 18.227 15.299  30.611  1.00 10.00 ? 25  C   A "C4'" 1 
ATOM   529  O  "O4'" . C   A 1 25 ? 18.992 14.904  31.812  1.00 10.00 ? 25  C   A "O4'" 1 
ATOM   530  C  "C3'" . C   A 1 25 ? 17.733 16.726  30.782  1.00 10.00 ? 25  C   A "C3'" 1 
ATOM   531  O  "O3'" . C   A 1 25 ? 16.422 16.901  30.259  1.00 10.00 ? 25  C   A "O3'" 1 
ATOM   532  C  "C2'" . C   A 1 25 ? 17.816 16.915  32.290  1.00 10.00 ? 25  C   A "C2'" 1 
ATOM   533  O  "O2'" . C   A 1 25 ? 16.698 16.319  32.932  1.00 10.00 ? 25  C   A "O2'" 1 
ATOM   534  C  "C1'" . C   A 1 25 ? 19.038 16.061  32.648  1.00 10.00 ? 25  C   A "C1'" 1 
ATOM   535  N  N1    . C   A 1 25 ? 20.329 16.748  32.424  1.00 10.00 ? 25  C   A N1    1 
ATOM   536  C  C2    . C   A 1 25 ? 20.561 17.938  33.103  1.00 10.00 ? 25  C   A C2    1 
ATOM   537  O  O2    . C   A 1 25 ? 19.682 18.365  33.861  1.00 10.00 ? 25  C   A O2    1 
ATOM   538  N  N3    . C   A 1 25 ? 21.744 18.587  32.921  1.00 10.00 ? 25  C   A N3    1 
ATOM   539  C  C4    . C   A 1 25 ? 22.669 18.090  32.091  1.00 10.00 ? 25  C   A C4    1 
ATOM   540  N  N4    . C   A 1 25 ? 23.805 18.749  31.948  1.00 10.00 ? 25  C   A N4    1 
ATOM   541  C  C5    . C   A 1 25 ? 22.455 16.861  31.374  1.00 10.00 ? 25  C   A C5    1 
ATOM   542  C  C6    . C   A 1 25 ? 21.273 16.232  31.576  1.00 10.00 ? 25  C   A C6    1 
HETATM 543  P  P     . M2G A 1 26 ? 16.329 17.670  28.846  1.00 10.00 ? 26  M2G A P     1 
HETATM 544  O  OP1   . M2G A 1 26 ? 14.965 17.533  28.280  1.00 10.00 ? 26  M2G A OP1   1 
HETATM 545  O  OP2   . M2G A 1 26 ? 17.436 17.211  27.969  1.00 10.00 ? 26  M2G A OP2   1 
HETATM 546  O  "O5'" . M2G A 1 26 ? 16.594 19.184  29.283  1.00 10.00 ? 26  M2G A "O5'" 1 
HETATM 547  C  "C5'" . M2G A 1 26 ? 15.993 19.625  30.526  1.00 10.00 ? 26  M2G A "C5'" 1 
HETATM 548  C  "C4'" . M2G A 1 26 ? 16.619 20.950  30.966  1.00 10.00 ? 26  M2G A "C4'" 1 
HETATM 549  O  "O4'" . M2G A 1 26 ? 17.795 20.656  31.769  1.00 10.00 ? 26  M2G A "O4'" 1 
HETATM 550  C  "C3'" . M2G A 1 26 ? 17.078 21.869  29.844  1.00 10.00 ? 26  M2G A "C3'" 1 
HETATM 551  O  "O3'" . M2G A 1 26 ? 16.032 22.718  29.393  1.00 10.00 ? 26  M2G A "O3'" 1 
HETATM 552  C  "C2'" . M2G A 1 26 ? 18.230 22.621  30.497  1.00 10.00 ? 26  M2G A "C2'" 1 
HETATM 553  O  "O2'" . M2G A 1 26 ? 17.740 23.629  31.369  1.00 10.00 ? 26  M2G A "O2'" 1 
HETATM 554  C  "C1'" . M2G A 1 26 ? 18.853 21.535  31.380  1.00 10.00 ? 26  M2G A "C1'" 1 
HETATM 555  N  N9    . M2G A 1 26 ? 19.895 20.736  30.695  1.00 10.00 ? 26  M2G A N9    1 
HETATM 556  C  C8    . M2G A 1 26 ? 19.822 19.456  30.185  1.00 10.00 ? 26  M2G A C8    1 
HETATM 557  N  N7    . M2G A 1 26 ? 20.936 19.032  29.641  1.00 10.00 ? 26  M2G A N7    1 
HETATM 558  C  C5    . M2G A 1 26 ? 21.814 20.105  29.803  1.00 10.00 ? 26  M2G A C5    1 
HETATM 559  C  C6    . M2G A 1 26 ? 23.167 20.239  29.407  1.00 10.00 ? 26  M2G A C6    1 
HETATM 560  O  O6    . M2G A 1 26 ? 23.892 19.425  28.832  1.00 10.00 ? 26  M2G A O6    1 
HETATM 561  N  N1    . M2G A 1 26 ? 23.680 21.498  29.763  1.00 10.00 ? 26  M2G A N1    1 
HETATM 562  C  C2    . M2G A 1 26 ? 22.967 22.488  30.423  1.00 10.00 ? 26  M2G A C2    1 
HETATM 563  N  N2    . M2G A 1 26 ? 23.645 23.612  30.666  1.00 10.00 ? 26  M2G A N2    1 
HETATM 564  N  N3    . M2G A 1 26 ? 21.701 22.363  30.785  1.00 10.00 ? 26  M2G A N3    1 
HETATM 565  C  C4    . M2G A 1 26 ? 21.194 21.146  30.443  1.00 10.00 ? 26  M2G A C4    1 
HETATM 566  C  CM1   . M2G A 1 26 ? 24.613 23.688  31.769  1.00 10.00 ? 26  M2G A CM1   1 
HETATM 567  C  CM2   . M2G A 1 26 ? 23.338 24.737  29.770  1.00 10.00 ? 26  M2G A CM2   1 
ATOM   568  P  P     . C   A 1 27 ? 15.851 22.993  27.836  1.00 10.00 ? 27  C   A P     1 
ATOM   569  O  OP1   . C   A 1 27 ? 14.484 23.514  27.578  1.00 10.00 ? 27  C   A OP1   1 
ATOM   570  O  OP2   . C   A 1 27 ? 16.225 21.776  27.069  1.00 10.00 ? 27  C   A OP2   1 
ATOM   571  O  "O5'" . C   A 1 27 ? 16.933 24.138  27.570  1.00 10.00 ? 27  C   A "O5'" 1 
ATOM   572  C  "C5'" . C   A 1 27 ? 17.297 24.996  28.669  1.00 10.00 ? 27  C   A "C5'" 1 
ATOM   573  C  "C4'" . C   A 1 27 ? 18.480 25.876  28.259  1.00 10.00 ? 27  C   A "C4'" 1 
ATOM   574  O  "O4'" . C   A 1 27 ? 19.670 25.375  28.868  1.00 10.00 ? 27  C   A "O4'" 1 
ATOM   575  C  "C3'" . C   A 1 27 ? 18.748 25.966  26.765  1.00 10.00 ? 27  C   A "C3'" 1 
ATOM   576  O  "O3'" . C   A 1 27 ? 17.981 26.990  26.148  1.00 10.00 ? 27  C   A "O3'" 1 
ATOM   577  C  "C2'" . C   A 1 27 ? 20.249 26.226  26.724  1.00 10.00 ? 27  C   A "C2'" 1 
ATOM   578  O  "O2'" . C   A 1 27 ? 20.530 27.588  27.010  1.00 10.00 ? 27  C   A "O2'" 1 
ATOM   579  C  "C1'" . C   A 1 27 ? 20.741 25.410  27.925  1.00 10.00 ? 27  C   A "C1'" 1 
ATOM   580  N  N1    . C   A 1 27 ? 21.112 24.017  27.587  1.00 10.00 ? 27  C   A N1    1 
ATOM   581  C  C2    . C   A 1 27 ? 22.318 23.806  26.930  1.00 10.00 ? 27  C   A C2    1 
ATOM   582  O  O2    . C   A 1 27 ? 23.023 24.785  26.662  1.00 10.00 ? 27  C   A O2    1 
ATOM   583  N  N3    . C   A 1 27 ? 22.686 22.532  26.616  1.00 10.00 ? 27  C   A N3    1 
ATOM   584  C  C4    . C   A 1 27 ? 21.895 21.499  26.929  1.00 10.00 ? 27  C   A C4    1 
ATOM   585  N  N4    . C   A 1 27 ? 22.293 20.282  26.607  1.00 10.00 ? 27  C   A N4    1 
ATOM   586  C  C5    . C   A 1 27 ? 20.640 21.691  27.609  1.00 10.00 ? 27  C   A C5    1 
ATOM   587  C  C6    . C   A 1 27 ? 20.298 22.964  27.912  1.00 10.00 ? 27  C   A C6    1 
ATOM   588  P  P     . C   A 1 28 ? 17.984 27.068  24.555  1.00 10.00 ? 28  C   A P     1 
ATOM   589  O  OP1   . C   A 1 28 ? 17.080 28.153  24.098  1.00 10.00 ? 28  C   A OP1   1 
ATOM   590  O  OP2   . C   A 1 28 ? 17.693 25.719  24.006  1.00 10.00 ? 28  C   A OP2   1 
ATOM   591  O  "O5'" . C   A 1 28 ? 19.503 27.450  24.245  1.00 10.00 ? 28  C   A "O5'" 1 
ATOM   592  C  "C5'" . C   A 1 28 ? 19.718 28.623  23.432  1.00 10.00 ? 28  C   A "C5'" 1 
ATOM   593  C  "C4'" . C   A 1 28 ? 21.022 28.460  22.649  1.00 10.00 ? 28  C   A "C4'" 1 
ATOM   594  O  "O4'" . C   A 1 28 ? 21.892 27.549  23.417  1.00 10.00 ? 28  C   A "O4'" 1 
ATOM   595  C  "C3'" . C   A 1 28 ? 20.902 27.764  21.304  1.00 10.00 ? 28  C   A "C3'" 1 
ATOM   596  O  "O3'" . C   A 1 28 ? 20.484 28.655  20.280  1.00 10.00 ? 28  C   A "O3'" 1 
ATOM   597  C  "C2'" . C   A 1 28 ? 22.312 27.223  21.099  1.00 10.00 ? 28  C   A "C2'" 1 
ATOM   598  O  "O2'" . C   A 1 28 ? 23.204 28.270  20.746  1.00 10.00 ? 28  C   A "O2'" 1 
ATOM   599  C  "C1'" . C   A 1 28 ? 22.688 26.778  22.516  1.00 10.00 ? 28  C   A "C1'" 1 
ATOM   600  N  N1    . C   A 1 28 ? 22.434 25.343  22.778  1.00 10.00 ? 28  C   A N1    1 
ATOM   601  C  C2    . C   A 1 28 ? 23.348 24.420  22.288  1.00 10.00 ? 28  C   A C2    1 
ATOM   602  O  O2    . C   A 1 28 ? 24.328 24.836  21.658  1.00 10.00 ? 28  C   A O2    1 
ATOM   603  N  N3    . C   A 1 28 ? 23.141 23.093  22.520  1.00 10.00 ? 28  C   A N3    1 
ATOM   604  C  C4    . C   A 1 28 ? 22.068 22.683  23.208  1.00 10.00 ? 28  C   A C4    1 
ATOM   605  N  N4    . C   A 1 28 ? 21.909 21.388  23.415  1.00 10.00 ? 28  C   A N4    1 
ATOM   606  C  C5    . C   A 1 28 ? 21.105 23.620  23.727  1.00 10.00 ? 28  C   A C5    1 
ATOM   607  C  C6    . C   A 1 28 ? 21.335 24.931  23.485  1.00 10.00 ? 28  C   A C6    1 
ATOM   608  P  P     . A   A 1 29 ? 19.296 28.151  19.332  1.00 10.00 ? 29  A   A P     1 
ATOM   609  O  OP1   . A   A 1 29 ? 18.815 29.280  18.497  1.00 10.00 ? 29  A   A OP1   1 
ATOM   610  O  OP2   . A   A 1 29 ? 18.258 27.474  20.152  1.00 10.00 ? 29  A   A OP2   1 
ATOM   611  O  "O5'" . A   A 1 29 ? 20.038 27.069  18.421  1.00 10.00 ? 29  A   A "O5'" 1 
ATOM   612  C  "C5'" . A   A 1 29 ? 20.464 27.519  17.128  1.00 10.00 ? 29  A   A "C5'" 1 
ATOM   613  C  "C4'" . A   A 1 29 ? 21.837 26.944  16.777  1.00 10.00 ? 29  A   A "C4'" 1 
ATOM   614  O  "O4'" . A   A 1 29 ? 22.508 26.476  18.007  1.00 10.00 ? 29  A   A "O4'" 1 
ATOM   615  C  "C3'" . A   A 1 29 ? 21.832 25.747  15.843  1.00 10.00 ? 29  A   A "C3'" 1 
ATOM   616  O  "O3'" . A   A 1 29 ? 21.772 26.140  14.478  1.00 10.00 ? 29  A   A "O3'" 1 
ATOM   617  C  "C2'" . A   A 1 29 ? 23.133 25.045  16.215  1.00 10.00 ? 29  A   A "C2'" 1 
ATOM   618  O  "O2'" . A   A 1 29 ? 24.248 25.742  15.679  1.00 10.00 ? 29  A   A "O2'" 1 
ATOM   619  C  "C1'" . A   A 1 29 ? 23.172 25.242  17.732  1.00 10.00 ? 29  A   A "C1'" 1 
ATOM   620  N  N9    . A   A 1 29 ? 22.496 24.166  18.492  1.00 10.00 ? 29  A   A N9    1 
ATOM   621  C  C8    . A   A 1 29 ? 21.498 24.284  19.417  1.00 10.00 ? 29  A   A C8    1 
ATOM   622  N  N7    . A   A 1 29 ? 21.114 23.150  19.920  1.00 10.00 ? 29  A   A N7    1 
ATOM   623  C  C5    . A   A 1 29 ? 21.909 22.214  19.280  1.00 10.00 ? 29  A   A C5    1 
ATOM   624  C  C6    . A   A 1 29 ? 21.996 20.812  19.367  1.00 10.00 ? 29  A   A C6    1 
ATOM   625  N  N6    . A   A 1 29 ? 21.217 20.077  20.184  1.00 10.00 ? 29  A   A N6    1 
ATOM   626  N  N1    . A   A 1 29 ? 22.901 20.196  18.594  1.00 10.00 ? 29  A   A N1    1 
ATOM   627  C  C2    . A   A 1 29 ? 23.664 20.929  17.777  1.00 10.00 ? 29  A   A C2    1 
ATOM   628  N  N3    . A   A 1 29 ? 23.679 22.244  17.609  1.00 10.00 ? 29  A   A N3    1 
ATOM   629  C  C4    . A   A 1 29 ? 22.765 22.820  18.403  1.00 10.00 ? 29  A   A C4    1 
ATOM   630  P  P     . G   A 1 30 ? 20.523 25.487  13.713  1.00 10.00 ? 30  G   A P     1 
ATOM   631  O  OP1   . G   A 1 30 ? 20.058 26.386  12.626  1.00 10.00 ? 30  G   A OP1   1 
ATOM   632  O  OP2   . G   A 1 30 ? 19.489 25.097  14.703  1.00 10.00 ? 30  G   A OP2   1 
ATOM   633  O  "O5'" . G   A 1 30 ? 21.185 24.172  13.093  1.00 10.00 ? 30  G   A "O5'" 1 
ATOM   634  C  "C5'" . G   A 1 30 ? 22.600 24.159  12.831  1.00 10.00 ? 30  G   A "C5'" 1 
ATOM   635  C  "C4'" . G   A 1 30 ? 23.132 22.728  12.922  1.00 10.00 ? 30  G   A "C4'" 1 
ATOM   636  O  "O4'" . G   A 1 30 ? 22.942 22.270  14.279  1.00 10.00 ? 30  G   A "O4'" 1 
ATOM   637  C  "C3'" . G   A 1 30 ? 22.355 21.682  12.140  1.00 10.00 ? 30  G   A "C3'" 1 
ATOM   638  O  "O3'" . G   A 1 30 ? 22.676 21.709  10.756  1.00 10.00 ? 30  G   A "O3'" 1 
ATOM   639  C  "C2'" . G   A 1 30 ? 22.767 20.390  12.835  1.00 10.00 ? 30  G   A "C2'" 1 
ATOM   640  O  "O2'" . G   A 1 30 ? 24.063 19.988  12.416  1.00 10.00 ? 30  G   A "O2'" 1 
ATOM   641  C  "C1'" . G   A 1 30 ? 22.893 20.842  14.292  1.00 10.00 ? 30  G   A "C1'" 1 
ATOM   642  N  N9    . G   A 1 30 ? 21.760 20.420  15.148  1.00 10.00 ? 30  G   A N9    1 
ATOM   643  C  C8    . G   A 1 30 ? 20.736 21.178  15.677  1.00 10.00 ? 30  G   A C8    1 
ATOM   644  N  N7    . G   A 1 30 ? 19.885 20.495  16.403  1.00 10.00 ? 30  G   A N7    1 
ATOM   645  C  C5    . G   A 1 30 ? 20.379 19.191  16.358  1.00 10.00 ? 30  G   A C5    1 
ATOM   646  C  C6    . G   A 1 30 ? 19.878 18.007  16.952  1.00 10.00 ? 30  G   A C6    1 
ATOM   647  O  O6    . G   A 1 30 ? 18.884 17.856  17.665  1.00 10.00 ? 30  G   A O6    1 
ATOM   648  N  N1    . G   A 1 30 ? 20.688 16.899  16.646  1.00 10.00 ? 30  G   A N1    1 
ATOM   649  C  C2    . G   A 1 30 ? 21.833 16.948  15.865  1.00 10.00 ? 30  G   A C2    1 
ATOM   650  N  N2    . G   A 1 30 ? 22.455 15.779  15.698  1.00 10.00 ? 30  G   A N2    1 
ATOM   651  N  N3    . G   A 1 30 ? 22.296 18.053  15.307  1.00 10.00 ? 30  G   A N3    1 
ATOM   652  C  C4    . G   A 1 30 ? 21.518 19.133  15.598  1.00 10.00 ? 30  G   A C4    1 
ATOM   653  P  P     . A   A 1 31 ? 21.546 21.975  9.667   1.00 10.00 ? 31  A   A P     1 
ATOM   654  O  OP1   . A   A 1 31 ? 22.018 21.488  8.347   1.00 10.00 ? 31  A   A OP1   1 
ATOM   655  O  OP2   . A   A 1 31 ? 21.125 23.399  9.710   1.00 10.00 ? 31  A   A OP2   1 
ATOM   656  O  "O5'" . A   A 1 31 ? 20.353 21.055  10.199  1.00 10.00 ? 31  A   A "O5'" 1 
ATOM   657  C  "C5'" . A   A 1 31 ? 19.895 19.992  9.342   1.00 10.00 ? 31  A   A "C5'" 1 
ATOM   658  C  "C4'" . A   A 1 31 ? 20.579 18.674  9.714   1.00 10.00 ? 31  A   A "C4'" 1 
ATOM   659  O  "O4'" . A   A 1 31 ? 21.153 18.826  11.046  1.00 10.00 ? 31  A   A "O4'" 1 
ATOM   660  C  "C3'" . A   A 1 31 ? 19.685 17.445  9.724   1.00 10.00 ? 31  A   A "C3'" 1 
ATOM   661  O  "O3'" . A   A 1 31 ? 19.689 16.776  8.472   1.00 10.00 ? 31  A   A "O3'" 1 
ATOM   662  C  "C2'" . A   A 1 31 ? 20.288 16.618  10.856  1.00 10.00 ? 31  A   A "C2'" 1 
ATOM   663  O  "O2'" . A   A 1 31 ? 21.461 15.949  10.416  1.00 10.00 ? 31  A   A "O2'" 1 
ATOM   664  C  "C1'" . A   A 1 31 ? 20.739 17.707  11.834  1.00 10.00 ? 31  A   A "C1'" 1 
ATOM   665  N  N9    . A   A 1 31 ? 19.673 18.156  12.756  1.00 10.00 ? 31  A   A N9    1 
ATOM   666  C  C8    . A   A 1 31 ? 19.234 19.428  12.983  1.00 10.00 ? 31  A   A C8    1 
ATOM   667  N  N7    . A   A 1 31 ? 18.284 19.502  13.868  1.00 10.00 ? 31  A   A N7    1 
ATOM   668  C  C5    . A   A 1 31 ? 18.078 18.186  14.249  1.00 10.00 ? 31  A   A C5    1 
ATOM   669  C  C6    . A   A 1 31 ? 17.197 17.581  15.164  1.00 10.00 ? 31  A   A C6    1 
ATOM   670  N  N6    . A   A 1 31 ? 16.304 18.277  15.892  1.00 10.00 ? 31  A   A N6    1 
ATOM   671  N  N1    . A   A 1 31 ? 17.260 16.248  15.301  1.00 10.00 ? 31  A   A N1    1 
ATOM   672  C  C2    . A   A 1 31 ? 18.140 15.561  14.568  1.00 10.00 ? 31  A   A C2    1 
ATOM   673  N  N3    . A   A 1 31 ? 19.018 16.013  13.683  1.00 10.00 ? 31  A   A N3    1 
ATOM   674  C  C4    . A   A 1 31 ? 18.925 17.347  13.582  1.00 10.00 ? 31  A   A C4    1 
HETATM 675  N  N1    . OMC A 1 32 ? 15.721 16.450  11.397  1.00 10.00 ? 32  OMC A N1    1 
HETATM 676  C  C2    . OMC A 1 32 ? 14.889 16.870  12.425  1.00 10.00 ? 32  OMC A C2    1 
HETATM 677  N  N3    . OMC A 1 32 ? 14.831 18.195  12.732  1.00 10.00 ? 32  OMC A N3    1 
HETATM 678  C  C4    . OMC A 1 32 ? 15.560 19.084  12.048  1.00 10.00 ? 32  OMC A C4    1 
HETATM 679  C  C5    . OMC A 1 32 ? 16.430 18.676  10.975  1.00 10.00 ? 32  OMC A C5    1 
HETATM 680  C  C6    . OMC A 1 32 ? 16.473 17.353  10.692  1.00 10.00 ? 32  OMC A C6    1 
HETATM 681  O  O2    . OMC A 1 32 ? 14.231 16.018  13.038  1.00 10.00 ? 32  OMC A O2    1 
HETATM 682  N  N4    . OMC A 1 32 ? 15.478 20.359  12.382  1.00 10.00 ? 32  OMC A N4    1 
HETATM 683  C  "C1'" . OMC A 1 32 ? 15.769 15.003  11.090  1.00 10.00 ? 32  OMC A "C1'" 1 
HETATM 684  C  "C2'" . OMC A 1 32 ? 14.675 14.540  10.125  1.00 10.00 ? 32  OMC A "C2'" 1 
HETATM 685  O  "O2'" . OMC A 1 32 ? 14.419 13.174  10.415  1.00 10.00 ? 32  OMC A "O2'" 1 
HETATM 686  C  CM2   . OMC A 1 32 ? 13.775 12.815  11.629  1.00 10.00 ? 32  OMC A CM2   1 
HETATM 687  C  "C3'" . OMC A 1 32 ? 15.369 14.682  8.775   1.00 10.00 ? 32  OMC A "C3'" 1 
HETATM 688  C  "C4'" . OMC A 1 32 ? 16.783 14.225  9.095   1.00 10.00 ? 32  OMC A "C4'" 1 
HETATM 689  O  "O4'" . OMC A 1 32 ? 17.021 14.716  10.465  1.00 10.00 ? 32  OMC A "O4'" 1 
HETATM 690  O  "O3'" . OMC A 1 32 ? 14.778 13.897  7.749   1.00 10.00 ? 32  OMC A "O3'" 1 
HETATM 691  C  "C5'" . OMC A 1 32 ? 17.886 14.805  8.207   1.00 10.00 ? 32  OMC A "C5'" 1 
HETATM 692  O  "O5'" . OMC A 1 32 ? 17.446 16.089  7.696   1.00 10.00 ? 32  OMC A "O5'" 1 
HETATM 693  P  P     . OMC A 1 32 ? 18.591 17.159  7.376   1.00 10.00 ? 32  OMC A P     1 
HETATM 694  O  OP1   . OMC A 1 32 ? 19.140 16.931  6.017   1.00 10.00 ? 32  OMC A OP1   1 
HETATM 695  O  OP2   . OMC A 1 32 ? 18.072 18.526  7.636   1.00 10.00 ? 32  OMC A OP2   1 
ATOM   696  P  P     . U   A 1 33 ? 14.164 14.670  6.488   1.00 10.00 ? 33  U   A P     1 
ATOM   697  O  OP1   . U   A 1 33 ? 13.756 13.689  5.453   1.00 10.00 ? 33  U   A OP1   1 
ATOM   698  O  OP2   . U   A 1 33 ? 15.116 15.718  6.037   1.00 10.00 ? 33  U   A OP2   1 
ATOM   699  O  "O5'" . U   A 1 33 ? 12.876 15.366  7.126   1.00 10.00 ? 33  U   A "O5'" 1 
ATOM   700  C  "C5'" . U   A 1 33 ? 11.575 14.983  6.674   1.00 10.00 ? 33  U   A "C5'" 1 
ATOM   701  C  "C4'" . U   A 1 33 ? 10.547 15.095  7.803   1.00 10.00 ? 33  U   A "C4'" 1 
ATOM   702  O  "O4'" . U   A 1 33 ? 11.188 15.616  9.006   1.00 10.00 ? 33  U   A "O4'" 1 
ATOM   703  C  "C3'" . U   A 1 33 ? 9.421  16.088  7.571   1.00 10.00 ? 33  U   A "C3'" 1 
ATOM   704  O  "O3'" . U   A 1 33 ? 8.421  15.566  6.709   1.00 10.00 ? 33  U   A "O3'" 1 
ATOM   705  C  "C2'" . U   A 1 33 ? 8.925  16.343  8.991   1.00 10.00 ? 33  U   A "C2'" 1 
ATOM   706  O  "O2'" . U   A 1 33 ? 8.153  15.245  9.456   1.00 10.00 ? 33  U   A "O2'" 1 
ATOM   707  C  "C1'" . U   A 1 33 ? 10.234 16.334  9.787   1.00 10.00 ? 33  U   A "C1'" 1 
ATOM   708  N  N1    . U   A 1 33 ? 10.774 17.685  10.059  1.00 10.00 ? 33  U   A N1    1 
ATOM   709  C  C2    . U   A 1 33 ? 10.217 18.390  11.096  1.00 10.00 ? 33  U   A C2    1 
ATOM   710  O  O2    . U   A 1 33 ? 9.303  17.960  11.783  1.00 10.00 ? 33  U   A O2    1 
ATOM   711  N  N3    . U   A 1 33 ? 10.747 19.641  11.321  1.00 10.00 ? 33  U   A N3    1 
ATOM   712  C  C4    . U   A 1 33 ? 11.774 20.241  10.606  1.00 10.00 ? 33  U   A C4    1 
ATOM   713  O  O4    . U   A 1 33 ? 12.170 21.365  10.908  1.00 10.00 ? 33  U   A O4    1 
ATOM   714  C  C5    . U   A 1 33 ? 12.299 19.425  9.538   1.00 10.00 ? 33  U   A C5    1 
ATOM   715  C  C6    . U   A 1 33 ? 11.804 18.199  9.302   1.00 10.00 ? 33  U   A C6    1 
HETATM 716  P  P     . OMG A 1 34 ? 8.429  16.050  5.187   1.00 10.00 ? 34  OMG A P     1 
HETATM 717  O  OP1   . OMG A 1 34 ? 7.124  15.732  4.559   1.00 10.00 ? 34  OMG A OP1   1 
HETATM 718  O  OP2   . OMG A 1 34 ? 9.623  15.499  4.495   1.00 10.00 ? 34  OMG A OP2   1 
HETATM 719  O  "O5'" . OMG A 1 34 ? 8.595  17.631  5.346   1.00 10.00 ? 34  OMG A "O5'" 1 
HETATM 720  C  "C5'" . OMG A 1 34 ? 8.167  18.472  4.262   1.00 10.00 ? 34  OMG A "C5'" 1 
HETATM 721  C  "C4'" . OMG A 1 34 ? 7.199  19.537  4.778   1.00 10.00 ? 34  OMG A "C4'" 1 
HETATM 722  O  "O4'" . OMG A 1 34 ? 5.828  19.015  4.642   1.00 10.00 ? 34  OMG A "O4'" 1 
HETATM 723  C  "C3'" . OMG A 1 34 ? 7.340  19.904  6.243   1.00 10.00 ? 34  OMG A "C3'" 1 
HETATM 724  O  "O3'" . OMG A 1 34 ? 8.330  20.904  6.447   1.00 10.00 ? 34  OMG A "O3'" 1 
HETATM 725  C  "C2'" . OMG A 1 34 ? 5.932  20.366  6.596   1.00 10.00 ? 34  OMG A "C2'" 1 
HETATM 726  O  "O2'" . OMG A 1 34 ? 5.682  21.660  6.066   1.00 10.00 ? 34  OMG A "O2'" 1 
HETATM 727  C  CM2   . OMG A 1 34 ? 4.424  22.284  6.276   1.00 10.00 ? 34  OMG A CM2   1 
HETATM 728  C  "C1'" . OMG A 1 34 ? 5.070  19.385  5.794   1.00 10.00 ? 34  OMG A "C1'" 1 
HETATM 729  N  N9    . OMG A 1 34 ? 4.719  18.154  6.538   1.00 10.00 ? 34  OMG A N9    1 
HETATM 730  C  C8    . OMG A 1 34 ? 5.085  16.847  6.290   1.00 10.00 ? 34  OMG A C8    1 
HETATM 731  N  N7    . OMG A 1 34 ? 4.596  15.981  7.145   1.00 10.00 ? 34  OMG A N7    1 
HETATM 732  C  C5    . OMG A 1 34 ? 3.847  16.767  8.022   1.00 10.00 ? 34  OMG A C5    1 
HETATM 733  C  C6    . OMG A 1 34 ? 3.090  16.391  9.157   1.00 10.00 ? 34  OMG A C6    1 
HETATM 734  O  O6    . OMG A 1 34 ? 2.906  15.267  9.633   1.00 10.00 ? 34  OMG A O6    1 
HETATM 735  N  N1    . OMG A 1 34 ? 2.493  17.508  9.765   1.00 10.00 ? 34  OMG A N1    1 
HETATM 736  C  C2    . OMG A 1 34 ? 2.617  18.816  9.317   1.00 10.00 ? 34  OMG A C2    1 
HETATM 737  N  N2    . OMG A 1 34 ? 1.968  19.729  10.041  1.00 10.00 ? 34  OMG A N2    1 
HETATM 738  N  N3    . OMG A 1 34 ? 3.331  19.166  8.258   1.00 10.00 ? 34  OMG A N3    1 
HETATM 739  C  C4    . OMG A 1 34 ? 3.914  18.089  7.664   1.00 10.00 ? 34  OMG A C4    1 
ATOM   740  P  P     . A   A 1 35 ? 8.592  21.319  7.967   1.00 10.00 ? 35  A   A P     1 
ATOM   741  O  OP1   . A   A 1 35 ? 9.958  21.886  8.093   1.00 10.00 ? 35  A   A OP1   1 
ATOM   742  O  OP2   . A   A 1 35 ? 8.290  20.175  8.866   1.00 10.00 ? 35  A   A OP2   1 
ATOM   743  O  "O5'" . A   A 1 35 ? 7.500  22.464  8.184   1.00 10.00 ? 35  A   A "O5'" 1 
ATOM   744  C  "C5'" . A   A 1 35 ? 7.700  23.401  9.247   1.00 10.00 ? 35  A   A "C5'" 1 
ATOM   745  C  "C4'" . A   A 1 35 ? 6.773  23.084  10.424  1.00 10.00 ? 35  A   A "C4'" 1 
ATOM   746  O  "O4'" . A   A 1 35 ? 5.894  21.974  10.067  1.00 10.00 ? 35  A   A "O4'" 1 
ATOM   747  C  "C3'" . A   A 1 35 ? 7.446  22.520  11.663  1.00 10.00 ? 35  A   A "C3'" 1 
ATOM   748  O  "O3'" . A   A 1 35 ? 8.124  23.526  12.404  1.00 10.00 ? 35  A   A "O3'" 1 
ATOM   749  C  "C2'" . A   A 1 35 ? 6.271  21.903  12.412  1.00 10.00 ? 35  A   A "C2'" 1 
ATOM   750  O  "O2'" . A   A 1 35 ? 5.504  22.909  13.056  1.00 10.00 ? 35  A   A "O2'" 1 
ATOM   751  C  "C1'" . A   A 1 35 ? 5.417  21.360  11.264  1.00 10.00 ? 35  A   A "C1'" 1 
ATOM   752  N  N9    . A   A 1 35 ? 5.499  19.891  11.102  1.00 10.00 ? 35  A   A N9    1 
ATOM   753  C  C8    . A   A 1 35 ? 6.100  19.185  10.100  1.00 10.00 ? 35  A   A C8    1 
ATOM   754  N  N7    . A   A 1 35 ? 5.994  17.896  10.233  1.00 10.00 ? 35  A   A N7    1 
ATOM   755  C  C5    . A   A 1 35 ? 5.280  17.737  11.410  1.00 10.00 ? 35  A   A C5    1 
ATOM   756  C  C6    . A   A 1 35 ? 4.834  16.604  12.113  1.00 10.00 ? 35  A   A C6    1 
ATOM   757  N  N6    . A   A 1 35 ? 5.071  15.343  11.702  1.00 10.00 ? 35  A   A N6    1 
ATOM   758  N  N1    . A   A 1 35 ? 4.145  16.805  13.247  1.00 10.00 ? 35  A   A N1    1 
ATOM   759  C  C2    . A   A 1 35 ? 3.923  18.059  13.654  1.00 10.00 ? 35  A   A C2    1 
ATOM   760  N  N3    . A   A 1 35 ? 4.284  19.198  13.082  1.00 10.00 ? 35  A   A N3    1 
ATOM   761  C  C4    . A   A 1 35 ? 4.963  18.951  11.952  1.00 10.00 ? 35  A   A C4    1 
ATOM   762  P  P     . A   A 1 36 ? 9.496  23.096  13.104  1.00 10.00 ? 36  A   A P     1 
ATOM   763  O  OP1   . A   A 1 36 ? 9.666  23.832  14.381  1.00 10.00 ? 36  A   A OP1   1 
ATOM   764  O  OP2   . A   A 1 36 ? 10.616 23.227  12.136  1.00 10.00 ? 36  A   A OP2   1 
ATOM   765  O  "O5'" . A   A 1 36 ? 9.223  21.548  13.391  1.00 10.00 ? 36  A   A "O5'" 1 
ATOM   766  C  "C5'" . A   A 1 36 ? 9.663  20.971  14.614  1.00 10.00 ? 36  A   A "C5'" 1 
ATOM   767  C  "C4'" . A   A 1 36 ? 8.480  20.627  15.521  1.00 10.00 ? 36  A   A "C4'" 1 
ATOM   768  O  "O4'" . A   A 1 36 ? 7.461  19.938  14.745  1.00 10.00 ? 36  A   A "O4'" 1 
ATOM   769  C  "C3'" . A   A 1 36 ? 8.776  19.658  16.654  1.00 10.00 ? 36  A   A "C3'" 1 
ATOM   770  O  "O3'" . A   A 1 36 ? 9.389  20.307  17.758  1.00 10.00 ? 36  A   A "O3'" 1 
ATOM   771  C  "C2'" . A   A 1 36 ? 7.392  19.102  16.968  1.00 10.00 ? 36  A   A "C2'" 1 
ATOM   772  O  "O2'" . A   A 1 36 ? 6.625  20.049  17.696  1.00 10.00 ? 36  A   A "O2'" 1 
ATOM   773  C  "C1'" . A   A 1 36 ? 6.769  19.004  15.572  1.00 10.00 ? 36  A   A "C1'" 1 
ATOM   774  N  N9    . A   A 1 36 ? 6.884  17.660  14.963  1.00 10.00 ? 36  A   A N9    1 
ATOM   775  C  C8    . A   A 1 36 ? 7.534  17.309  13.814  1.00 10.00 ? 36  A   A C8    1 
ATOM   776  N  N7    . A   A 1 36 ? 7.447  16.043  13.533  1.00 10.00 ? 36  A   A N7    1 
ATOM   777  C  C5    . A   A 1 36 ? 6.691  15.520  14.568  1.00 10.00 ? 36  A   A C5    1 
ATOM   778  C  C6    . A   A 1 36 ? 6.240  14.220  14.863  1.00 10.00 ? 36  A   A C6    1 
ATOM   779  N  N6    . A   A 1 36 ? 6.513  13.155  14.085  1.00 10.00 ? 36  A   A N6    1 
ATOM   780  N  N1    . A   A 1 36 ? 5.505  14.052  15.972  1.00 10.00 ? 36  A   A N1    1 
ATOM   781  C  C2    . A   A 1 36 ? 5.245  15.111  16.744  1.00 10.00 ? 36  A   A C2    1 
ATOM   782  N  N3    . A   A 1 36 ? 5.608  16.374  16.574  1.00 10.00 ? 36  A   A N3    1 
ATOM   783  C  C4    . A   A 1 36 ? 6.333  16.498  15.452  1.00 10.00 ? 36  A   A C4    1 
HETATM 784  N  N1    . YG  A 1 37 ? 8.999  11.066  16.657  1.00 10.00 ? 37  YG  A N1    1 
HETATM 785  N  N2    . YG  A 1 37 ? 8.079  9.958   18.366  1.00 10.00 ? 37  YG  A N2    1 
HETATM 786  C  C2    . YG  A 1 37 ? 8.378  11.125  17.896  1.00 10.00 ? 37  YG  A C2    1 
HETATM 787  N  N3    . YG  A 1 37 ? 8.126  12.255  18.537  1.00 10.00 ? 37  YG  A N3    1 
HETATM 788  C  C3    . YG  A 1 37 ? 7.478  12.327  19.854  1.00 10.00 ? 37  YG  A C3    1 
HETATM 789  C  C4    . YG  A 1 37 ? 8.540  13.343  17.829  1.00 10.00 ? 37  YG  A C4    1 
HETATM 790  C  C5    . YG  A 1 37 ? 9.153  13.389  16.603  1.00 10.00 ? 37  YG  A C5    1 
HETATM 791  C  C6    . YG  A 1 37 ? 9.431  12.181  15.918  1.00 10.00 ? 37  YG  A C6    1 
HETATM 792  O  O6    . YG  A 1 37 ? 9.964  12.017  14.820  1.00 10.00 ? 37  YG  A O6    1 
HETATM 793  N  N7    . YG  A 1 37 ? 9.416  14.710  16.233  1.00 10.00 ? 37  YG  A N7    1 
HETATM 794  C  C8    . YG  A 1 37 ? 8.955  15.413  17.238  1.00 10.00 ? 37  YG  A C8    1 
HETATM 795  N  N9    . YG  A 1 37 ? 8.407  14.654  18.253  1.00 10.00 ? 37  YG  A N9    1 
HETATM 796  C  C10   . YG  A 1 37 ? 8.388  7.563   17.498  1.00 10.00 ? 37  YG  A C10   1 
HETATM 797  C  C11   . YG  A 1 37 ? 8.519  9.084   17.401  1.00 10.00 ? 37  YG  A C11   1 
HETATM 798  C  C12   . YG  A 1 37 ? 9.076  9.724   16.362  1.00 10.00 ? 37  YG  A C12   1 
HETATM 799  C  C13   . YG  A 1 37 ? 9.676  9.091   15.105  1.00 10.00 ? 37  YG  A C13   1 
HETATM 800  C  C14   . YG  A 1 37 ? 8.977  9.655   13.853  1.00 10.00 ? 37  YG  A C14   1 
HETATM 801  C  C15   . YG  A 1 37 ? 8.163  8.542   13.166  1.00 10.00 ? 37  YG  A C15   1 
HETATM 802  C  C16   . YG  A 1 37 ? 6.710  8.593   13.642  1.00 10.00 ? 37  YG  A C16   1 
HETATM 803  O  O17   . YG  A 1 37 ? 6.274  9.615   14.193  1.00 10.00 ? 37  YG  A O17   1 
HETATM 804  O  O18   . YG  A 1 37 ? 5.896  7.519   13.458  1.00 10.00 ? 37  YG  A O18   1 
HETATM 805  C  C19   . YG  A 1 37 ? 5.990  6.393   14.336  1.00 10.00 ? 37  YG  A C19   1 
HETATM 806  N  N20   . YG  A 1 37 ? 8.227  8.708   11.707  1.00 10.00 ? 37  YG  A N20   1 
HETATM 807  C  C21   . YG  A 1 37 ? 7.689  9.772   11.139  1.00 10.00 ? 37  YG  A C21   1 
HETATM 808  O  O22   . YG  A 1 37 ? 7.129  10.632  11.836  1.00 10.00 ? 37  YG  A O22   1 
HETATM 809  O  O23   . YG  A 1 37 ? 7.748  9.926   9.788   1.00 10.00 ? 37  YG  A O23   1 
HETATM 810  C  C24   . YG  A 1 37 ? 6.742  10.682  9.110   1.00 10.00 ? 37  YG  A C24   1 
HETATM 811  C  "C1'" . YG  A 1 37 ? 7.793  15.094  19.526  1.00 10.00 ? 37  YG  A "C1'" 1 
HETATM 812  C  "C2'" . YG  A 1 37 ? 8.759  15.080  20.714  1.00 10.00 ? 37  YG  A "C2'" 1 
HETATM 813  O  "O2'" . YG  A 1 37 ? 7.975  14.869  21.878  1.00 10.00 ? 37  YG  A "O2'" 1 
HETATM 814  C  "C3'" . YG  A 1 37 ? 9.308  16.502  20.685  1.00 10.00 ? 37  YG  A "C3'" 1 
HETATM 815  O  "O3'" . YG  A 1 37 ? 9.862  16.919  21.925  1.00 10.00 ? 37  YG  A "O3'" 1 
HETATM 816  C  "C4'" . YG  A 1 37 ? 8.078  17.313  20.312  1.00 10.00 ? 37  YG  A "C4'" 1 
HETATM 817  O  "O4'" . YG  A 1 37 ? 7.347  16.443  19.368  1.00 10.00 ? 37  YG  A "O4'" 1 
HETATM 818  C  "C5'" . YG  A 1 37 ? 8.349  18.656  19.628  1.00 10.00 ? 37  YG  A "C5'" 1 
HETATM 819  O  "O5'" . YG  A 1 37 ? 9.743  18.970  19.804  1.00 10.00 ? 37  YG  A "O5'" 1 
HETATM 820  P  P     . YG  A 1 37 ? 10.551 19.585  18.568  1.00 10.00 ? 37  YG  A P     1 
HETATM 821  O  OP1   . YG  A 1 37 ? 11.523 20.599  19.046  1.00 10.00 ? 37  YG  A OP1   1 
HETATM 822  O  OP2   . YG  A 1 37 ? 11.126 18.479  17.760  1.00 10.00 ? 37  YG  A OP2   1 
ATOM   823  P  P     . A   A 1 38 ? 11.267 16.304  22.354  1.00 10.00 ? 38  A   A P     1 
ATOM   824  O  OP1   . A   A 1 38 ? 11.552 16.764  23.736  1.00 10.00 ? 38  A   A OP1   1 
ATOM   825  O  OP2   . A   A 1 38 ? 12.310 16.625  21.345  1.00 10.00 ? 38  A   A OP2   1 
ATOM   826  O  "O5'" . A   A 1 38 ? 10.984 14.733  22.343  1.00 10.00 ? 38  A   A "O5'" 1 
ATOM   827  C  "C5'" . A   A 1 38 ? 12.132 13.907  22.718  1.00 10.00 ? 38  A   A "C5'" 1 
ATOM   828  C  "C4'" . A   A 1 38 ? 11.717 12.435  22.652  1.00 10.00 ? 38  A   A "C4'" 1 
ATOM   829  O  "O4'" . A   A 1 38 ? 10.613 12.356  21.631  1.00 10.00 ? 38  A   A "O4'" 1 
ATOM   830  C  "C3'" . A   A 1 38 ? 12.806 11.459  22.244  1.00 10.00 ? 38  A   A "C3'" 1 
ATOM   831  O  "O3'" . A   A 1 38 ? 13.423 10.850  23.371  1.00 10.00 ? 38  A   A "O3'" 1 
ATOM   832  C  "C2'" . A   A 1 38 ? 12.042 10.475  21.365  1.00 10.00 ? 38  A   A "C2'" 1 
ATOM   833  O  "O2'" . A   A 1 38 ? 11.289 9.573   22.163  1.00 10.00 ? 38  A   A "O2'" 1 
ATOM   834  C  "C1'" . A   A 1 38 ? 11.038 11.395  20.666  1.00 10.00 ? 38  A   A "C1'" 1 
ATOM   835  N  N9    . A   A 1 38 ? 11.601 12.119  19.501  1.00 10.00 ? 38  A   A N9    1 
ATOM   836  C  C8    . A   A 1 38 ? 11.791 13.463  19.357  1.00 10.00 ? 38  A   A C8    1 
ATOM   837  N  N7    . A   A 1 38 ? 12.300 13.798  18.208  1.00 10.00 ? 38  A   A N7    1 
ATOM   838  C  C5    . A   A 1 38 ? 12.464 12.589  17.553  1.00 10.00 ? 38  A   A C5    1 
ATOM   839  C  C6    . A   A 1 38 ? 12.965 12.251  16.283  1.00 10.00 ? 38  A   A C6    1 
ATOM   840  N  N6    . A   A 1 38 ? 13.424 13.167  15.407  1.00 10.00 ? 38  A   A N6    1 
ATOM   841  N  N1    . A   A 1 38 ? 12.980 10.954  15.944  1.00 10.00 ? 38  A   A N1    1 
ATOM   842  C  C2    . A   A 1 38 ? 12.534 10.049  16.822  1.00 10.00 ? 38  A   A C2    1 
ATOM   843  N  N3    . A   A 1 38 ? 12.039 10.240  18.035  1.00 10.00 ? 38  A   A N3    1 
ATOM   844  C  C4    . A   A 1 38 ? 12.035 11.550  18.328  1.00 10.00 ? 38  A   A C4    1 
HETATM 845  N  N1    . PSU A 1 39 ? 14.863 14.234  19.358  1.00 10.00 ? 39  PSU A N1    1 
HETATM 846  C  C2    . PSU A 1 39 ? 15.685 14.910  18.384  1.00 10.00 ? 39  PSU A C2    1 
HETATM 847  N  N3    . PSU A 1 39 ? 16.497 14.061  17.646  1.00 10.00 ? 39  PSU A N3    1 
HETATM 848  C  C4    . PSU A 1 39 ? 16.575 12.692  17.771  1.00 10.00 ? 39  PSU A C4    1 
HETATM 849  C  C5    . PSU A 1 39 ? 15.760 12.134  18.726  1.00 10.00 ? 39  PSU A C5    1 
HETATM 850  C  C6    . PSU A 1 39 ? 14.915 12.899  19.497  1.00 10.00 ? 39  PSU A C6    1 
HETATM 851  O  O2    . PSU A 1 39 ? 15.696 16.121  18.173  1.00 10.00 ? 39  PSU A O2    1 
HETATM 852  O  O4    . PSU A 1 39 ? 17.333 12.037  17.074  1.00 10.00 ? 39  PSU A O4    1 
HETATM 853  C  "C1'" . PSU A 1 39 ? 15.811 10.663  18.888  1.00 10.00 ? 39  PSU A "C1'" 1 
HETATM 854  C  "C2'" . PSU A 1 39 ? 17.233 10.105  19.001  1.00 10.00 ? 39  PSU A "C2'" 1 
HETATM 855  O  "O2'" . PSU A 1 39 ? 17.234 8.845   18.348  1.00 10.00 ? 39  PSU A "O2'" 1 
HETATM 856  C  "C3'" . PSU A 1 39 ? 17.381 9.927   20.507  1.00 10.00 ? 39  PSU A "C3'" 1 
HETATM 857  C  "C4'" . PSU A 1 39 ? 15.986 9.480   20.914  1.00 10.00 ? 39  PSU A "C4'" 1 
HETATM 858  O  "O3'" . PSU A 1 39 ? 18.370 8.973   20.871  1.00 10.00 ? 39  PSU A "O3'" 1 
HETATM 859  O  "O4'" . PSU A 1 39 ? 15.135 10.318  20.098  1.00 10.00 ? 39  PSU A "O4'" 1 
HETATM 860  C  "C5'" . PSU A 1 39 ? 15.643 9.638   22.398  1.00 10.00 ? 39  PSU A "C5'" 1 
HETATM 861  O  "O5'" . PSU A 1 39 ? 15.846 10.977  22.857  1.00 10.00 ? 39  PSU A "O5'" 1 
HETATM 862  P  P     . PSU A 1 39 ? 14.758 11.650  23.813  1.00 10.00 ? 39  PSU A P     1 
HETATM 863  O  OP1   . PSU A 1 39 ? 15.091 11.382  25.234  1.00 10.00 ? 39  PSU A OP1   1 
HETATM 864  O  OP2   . PSU A 1 39 ? 14.606 13.083  23.449  1.00 10.00 ? 39  PSU A OP2   1 
HETATM 865  P  P     . 5MC A 1 40 ? 19.476 9.327   21.958  1.00 10.00 ? 40  5MC A P     1 
HETATM 866  O  OP1   . 5MC A 1 40 ? 19.747 8.123   22.786  1.00 10.00 ? 40  5MC A OP1   1 
HETATM 867  O  OP2   . 5MC A 1 40 ? 19.090 10.547  22.714  1.00 10.00 ? 40  5MC A OP2   1 
HETATM 868  O  "O5'" . 5MC A 1 40 ? 20.737 9.656   21.034  1.00 10.00 ? 40  5MC A "O5'" 1 
HETATM 869  C  "C5'" . 5MC A 1 40 ? 21.248 8.638   20.173  1.00 10.00 ? 40  5MC A "C5'" 1 
HETATM 870  C  "C4'" . 5MC A 1 40 ? 21.721 9.187   18.825  1.00 10.00 ? 40  5MC A "C4'" 1 
HETATM 871  O  "O4'" . 5MC A 1 40 ? 20.635 9.878   18.146  1.00 10.00 ? 40  5MC A "O4'" 1 
HETATM 872  C  "C3'" . 5MC A 1 40 ? 22.835 10.218  18.887  1.00 10.00 ? 40  5MC A "C3'" 1 
HETATM 873  O  "O3'" . 5MC A 1 40 ? 24.109 9.615   19.060  1.00 10.00 ? 40  5MC A "O3'" 1 
HETATM 874  C  "C2'" . 5MC A 1 40 ? 22.680 10.935  17.551  1.00 10.00 ? 40  5MC A "C2'" 1 
HETATM 875  O  "O2'" . 5MC A 1 40 ? 23.190 10.138  16.492  1.00 10.00 ? 40  5MC A "O2'" 1 
HETATM 876  C  "C1'" . 5MC A 1 40 ? 21.157 10.970  17.387  1.00 10.00 ? 40  5MC A "C1'" 1 
HETATM 877  N  N1    . 5MC A 1 40 ? 20.534 12.220  17.876  1.00 10.00 ? 40  5MC A N1    1 
HETATM 878  C  C2    . 5MC A 1 40 ? 20.797 13.395  17.182  1.00 10.00 ? 40  5MC A C2    1 
HETATM 879  O  O2    . 5MC A 1 40 ? 21.535 13.343  16.192  1.00 10.00 ? 40  5MC A O2    1 
HETATM 880  N  N3    . 5MC A 1 40 ? 20.231 14.558  17.608  1.00 10.00 ? 40  5MC A N3    1 
HETATM 881  C  C4    . 5MC A 1 40 ? 19.435 14.572  18.683  1.00 10.00 ? 40  5MC A C4    1 
HETATM 882  N  N4    . 5MC A 1 40 ? 18.904 15.721  19.058  1.00 10.00 ? 40  5MC A N4    1 
HETATM 883  C  C5    . 5MC A 1 40 ? 19.149 13.368  19.422  1.00 10.00 ? 40  5MC A C5    1 
HETATM 884  C  C6    . 5MC A 1 40 ? 19.720 12.225  18.978  1.00 10.00 ? 40  5MC A C6    1 
HETATM 885  C  CM5   . 5MC A 1 40 ? 18.268 13.306  20.635  1.00 10.00 ? 40  5MC A CM5   1 
ATOM   886  P  P     . U   A 1 41 ? 25.117 10.266  20.120  1.00 10.00 ? 41  U   A P     1 
ATOM   887  O  OP1   . U   A 1 41 ? 26.195 9.300   20.447  1.00 10.00 ? 41  U   A OP1   1 
ATOM   888  O  OP2   . U   A 1 41 ? 24.351 10.785  21.281  1.00 10.00 ? 41  U   A OP2   1 
ATOM   889  O  "O5'" . U   A 1 41 ? 25.712 11.493  19.288  1.00 10.00 ? 41  U   A "O5'" 1 
ATOM   890  C  "C5'" . U   A 1 41 ? 25.686 11.381  17.847  1.00 10.00 ? 41  U   A "C5'" 1 
ATOM   891  C  "C4'" . U   A 1 41 ? 26.360 12.605  17.222  1.00 10.00 ? 41  U   A "C4'" 1 
ATOM   892  O  "O4'" . U   A 1 41 ? 25.245 13.450  16.679  1.00 10.00 ? 41  U   A "O4'" 1 
ATOM   893  C  "C3'" . U   A 1 41 ? 27.041 13.553  18.194  1.00 10.00 ? 41  U   A "C3'" 1 
ATOM   894  O  "O3'" . U   A 1 41 ? 28.361 13.134  18.508  1.00 10.00 ? 41  U   A "O3'" 1 
ATOM   895  C  "C2'" . U   A 1 41 ? 26.986 14.878  17.440  1.00 10.00 ? 41  U   A "C2'" 1 
ATOM   896  O  "O2'" . U   A 1 41 ? 27.913 14.881  16.364  1.00 10.00 ? 41  U   A "O2'" 1 
ATOM   897  C  "C1'" . U   A 1 41 ? 25.587 14.829  16.822  1.00 10.00 ? 41  U   A "C1'" 1 
ATOM   898  N  N1    . U   A 1 41 ? 24.547 15.487  17.644  1.00 10.00 ? 41  U   A N1    1 
ATOM   899  C  C2    . U   A 1 41 ? 24.453 16.854  17.566  1.00 10.00 ? 41  U   A C2    1 
ATOM   900  O  O2    . U   A 1 41 ? 25.186 17.537  16.869  1.00 10.00 ? 41  U   A O2    1 
ATOM   901  N  N3    . U   A 1 41 ? 23.473 17.429  18.343  1.00 10.00 ? 41  U   A N3    1 
ATOM   902  C  C4    . U   A 1 41 ? 22.589 16.764  19.180  1.00 10.00 ? 41  U   A C4    1 
ATOM   903  O  O4    . U   A 1 41 ? 21.747 17.388  19.821  1.00 10.00 ? 41  U   A O4    1 
ATOM   904  C  C5    . U   A 1 41 ? 22.762 15.331  19.195  1.00 10.00 ? 41  U   A C5    1 
ATOM   905  C  C6    . U   A 1 41 ? 23.705 14.743  18.442  1.00 10.00 ? 41  U   A C6    1 
ATOM   906  P  P     . G   A 1 42 ? 28.883 13.667  19.940  1.00 10.00 ? 42  G   A P     1 
ATOM   907  O  OP1   . G   A 1 42 ? 30.178 13.039  20.298  1.00 10.00 ? 42  G   A OP1   1 
ATOM   908  O  OP2   . G   A 1 42 ? 27.792 13.494  20.931  1.00 10.00 ? 42  G   A OP2   1 
ATOM   909  O  "O5'" . G   A 1 42 ? 29.089 15.223  19.643  1.00 10.00 ? 42  G   A "O5'" 1 
ATOM   910  C  "C5'" . G   A 1 42 ? 30.057 15.580  18.632  1.00 10.00 ? 42  G   A "C5'" 1 
ATOM   911  C  "C4'" . G   A 1 42 ? 30.123 17.103  18.502  1.00 10.00 ? 42  G   A "C4'" 1 
ATOM   912  O  "O4'" . G   A 1 42 ? 28.783 17.586  18.166  1.00 10.00 ? 42  G   A "O4'" 1 
ATOM   913  C  "C3'" . G   A 1 42 ? 30.496 17.858  19.767  1.00 10.00 ? 42  G   A "C3'" 1 
ATOM   914  O  "O3'" . G   A 1 42 ? 31.903 17.925  19.950  1.00 10.00 ? 42  G   A "O3'" 1 
ATOM   915  C  "C2'" . G   A 1 42 ? 29.850 19.218  19.528  1.00 10.00 ? 42  G   A "C2'" 1 
ATOM   916  O  "O2'" . G   A 1 42 ? 30.605 19.975  18.593  1.00 10.00 ? 42  G   A "O2'" 1 
ATOM   917  C  "C1'" . G   A 1 42 ? 28.544 18.827  18.831  1.00 10.00 ? 42  G   A "C1'" 1 
ATOM   918  N  N9    . G   A 1 42 ? 27.403 18.650  19.757  1.00 10.00 ? 42  G   A N9    1 
ATOM   919  C  C8    . G   A 1 42 ? 26.902 17.491  20.315  1.00 10.00 ? 42  G   A C8    1 
ATOM   920  N  N7    . G   A 1 42 ? 25.869 17.676  21.100  1.00 10.00 ? 42  G   A N7    1 
ATOM   921  C  C5    . G   A 1 42 ? 25.666 19.057  21.062  1.00 10.00 ? 42  G   A C5    1 
ATOM   922  C  C6    . G   A 1 42 ? 24.695 19.851  21.716  1.00 10.00 ? 42  G   A C6    1 
ATOM   923  O  O6    . G   A 1 42 ? 23.787 19.502  22.472  1.00 10.00 ? 42  G   A O6    1 
ATOM   924  N  N1    . G   A 1 42 ? 24.852 21.212  21.399  1.00 10.00 ? 42  G   A N1    1 
ATOM   925  C  C2    . G   A 1 42 ? 25.825 21.724  20.553  1.00 10.00 ? 42  G   A C2    1 
ATOM   926  N  N2    . G   A 1 42 ? 25.798 23.048  20.389  1.00 10.00 ? 42  G   A N2    1 
ATOM   927  N  N3    . G   A 1 42 ? 26.736 20.980  19.948  1.00 10.00 ? 42  G   A N3    1 
ATOM   928  C  C4    . G   A 1 42 ? 26.592 19.659  20.247  1.00 10.00 ? 42  G   A C4    1 
ATOM   929  P  P     . G   A 1 43 ? 32.439 18.544  21.323  1.00 10.00 ? 43  G   A P     1 
ATOM   930  O  OP1   . G   A 1 43 ? 33.901 18.781  21.236  1.00 10.00 ? 43  G   A OP1   1 
ATOM   931  O  OP2   . G   A 1 43 ? 31.997 17.684  22.453  1.00 10.00 ? 43  G   A OP2   1 
ATOM   932  O  "O5'" . G   A 1 43 ? 31.656 19.935  21.378  1.00 10.00 ? 43  G   A "O5'" 1 
ATOM   933  C  "C5'" . G   A 1 43 ? 32.394 21.136  21.118  1.00 10.00 ? 43  G   A "C5'" 1 
ATOM   934  C  "C4'" . G   A 1 43 ? 31.562 22.409  21.273  1.00 10.00 ? 43  G   A "C4'" 1 
ATOM   935  O  "O4'" . G   A 1 43 ? 30.138 22.127  20.931  1.00 10.00 ? 43  G   A "O4'" 1 
ATOM   936  C  "C3'" . G   A 1 43 ? 31.476 22.978  22.678  1.00 10.00 ? 43  G   A "C3'" 1 
ATOM   937  O  "O3'" . G   A 1 43 ? 32.628 23.739  23.014  1.00 10.00 ? 43  G   A "O3'" 1 
ATOM   938  C  "C2'" . G   A 1 43 ? 30.200 23.807  22.612  1.00 10.00 ? 43  G   A "C2'" 1 
ATOM   939  O  "O2'" . G   A 1 43 ? 30.414 24.997  21.867  1.00 10.00 ? 43  G   A "O2'" 1 
ATOM   940  C  "C1'" . G   A 1 43 ? 29.288 22.913  21.766  1.00 10.00 ? 43  G   A "C1'" 1 
ATOM   941  N  N9    . G   A 1 43 ? 28.444 21.995  22.569  1.00 10.00 ? 43  G   A N9    1 
ATOM   942  C  C8    . G   A 1 43 ? 28.537 20.627  22.719  1.00 10.00 ? 43  G   A C8    1 
ATOM   943  N  N7    . G   A 1 43 ? 27.622 20.110  23.502  1.00 10.00 ? 43  G   A N7    1 
ATOM   944  C  C5    . G   A 1 43 ? 26.863 21.213  23.898  1.00 10.00 ? 43  G   A C5    1 
ATOM   945  C  C6    . G   A 1 43 ? 25.736 21.280  24.753  1.00 10.00 ? 43  G   A C6    1 
ATOM   946  O  O6    . G   A 1 43 ? 25.153 20.367  25.343  1.00 10.00 ? 43  G   A O6    1 
ATOM   947  N  N1    . G   A 1 43 ? 25.278 22.600  24.889  1.00 10.00 ? 43  G   A N1    1 
ATOM   948  C  C2    . G   A 1 43 ? 25.844 23.706  24.267  1.00 10.00 ? 43  G   A C2    1 
ATOM   949  N  N2    . G   A 1 43 ? 25.252 24.872  24.532  1.00 10.00 ? 43  G   A N2    1 
ATOM   950  N  N3    . G   A 1 43 ? 26.900 23.642  23.474  1.00 10.00 ? 43  G   A N3    1 
ATOM   951  C  C4    . G   A 1 43 ? 27.352 22.365  23.336  1.00 10.00 ? 43  G   A C4    1 
ATOM   952  P  P     . A   A 1 44 ? 33.351 23.381  24.409  1.00 10.00 ? 44  A   A P     1 
ATOM   953  O  OP1   . A   A 1 44 ? 34.824 23.434  24.236  1.00 10.00 ? 44  A   A OP1   1 
ATOM   954  O  OP2   . A   A 1 44 ? 32.814 22.097  24.930  1.00 10.00 ? 44  A   A OP2   1 
ATOM   955  O  "O5'" . A   A 1 44 ? 32.862 24.578  25.345  1.00 10.00 ? 44  A   A "O5'" 1 
ATOM   956  C  "C5'" . A   A 1 44 ? 32.779 25.900  24.761  1.00 10.00 ? 44  A   A "C5'" 1 
ATOM   957  C  "C4'" . A   A 1 44 ? 31.608 26.680  25.360  1.00 10.00 ? 44  A   A "C4'" 1 
ATOM   958  O  "O4'" . A   A 1 44 ? 30.362 25.983  25.013  1.00 10.00 ? 44  A   A "O4'" 1 
ATOM   959  C  "C3'" . A   A 1 44 ? 31.556 26.734  26.877  1.00 10.00 ? 44  A   A "C3'" 1 
ATOM   960  O  "O3'" . A   A 1 44 ? 32.422 27.730  27.403  1.00 10.00 ? 44  A   A "O3'" 1 
ATOM   961  C  "C2'" . A   A 1 44 ? 30.081 27.014  27.138  1.00 10.00 ? 44  A   A "C2'" 1 
ATOM   962  O  "O2'" . A   A 1 44 ? 29.769 28.369  26.849  1.00 10.00 ? 44  A   A "O2'" 1 
ATOM   963  C  "C1'" . A   A 1 44 ? 29.405 26.163  26.059  1.00 10.00 ? 44  A   A "C1'" 1 
ATOM   964  N  N9    . A   A 1 44 ? 28.974 24.828  26.535  1.00 10.00 ? 44  A   A N9    1 
ATOM   965  C  C8    . A   A 1 44 ? 29.555 23.617  26.290  1.00 10.00 ? 44  A   A C8    1 
ATOM   966  N  N7    . A   A 1 44 ? 28.933 22.618  26.843  1.00 10.00 ? 44  A   A N7    1 
ATOM   967  C  C5    . A   A 1 44 ? 27.868 23.210  27.500  1.00 10.00 ? 44  A   A C5    1 
ATOM   968  C  C6    . A   A 1 44 ? 26.822 22.692  28.286  1.00 10.00 ? 44  A   A C6    1 
ATOM   969  N  N6    . A   A 1 44 ? 26.685 21.379  28.554  1.00 10.00 ? 44  A   A N6    1 
ATOM   970  N  N1    . A   A 1 44 ? 25.931 23.561  28.785  1.00 10.00 ? 44  A   A N1    1 
ATOM   971  C  C2    . A   A 1 44 ? 26.078 24.864  28.523  1.00 10.00 ? 44  A   A C2    1 
ATOM   972  N  N3    . A   A 1 44 ? 27.009 25.468  27.801  1.00 10.00 ? 44  A   A N3    1 
ATOM   973  C  C4    . A   A 1 44 ? 27.875 24.565  27.319  1.00 10.00 ? 44  A   A C4    1 
ATOM   974  P  P     . G   A 1 45 ? 33.230 27.355  28.729  1.00 10.00 ? 45  G   A P     1 
ATOM   975  O  OP1   . G   A 1 45 ? 33.945 28.555  29.233  1.00 10.00 ? 45  G   A OP1   1 
ATOM   976  O  OP2   . G   A 1 45 ? 34.082 26.166  28.469  1.00 10.00 ? 45  G   A OP2   1 
ATOM   977  O  "O5'" . G   A 1 45 ? 32.054 26.952  29.732  1.00 10.00 ? 45  G   A "O5'" 1 
ATOM   978  C  "C5'" . G   A 1 45 ? 31.494 28.109  30.461  1.00 10.00 ? 45  G   A "C5'" 1 
ATOM   979  C  "C4'" . G   A 1 45 ? 30.384 27.552  31.352  1.00 10.00 ? 45  G   A "C4'" 1 
ATOM   980  O  "O4'" . G   A 1 45 ? 29.593 26.646  30.527  1.00 10.00 ? 45  G   A "O4'" 1 
ATOM   981  C  "C3'" . G   A 1 45 ? 30.841 26.676  32.508  1.00 10.00 ? 45  G   A "C3'" 1 
ATOM   982  O  "O3'" . G   A 1 45 ? 31.218 27.446  33.640  1.00 10.00 ? 45  G   A "O3'" 1 
ATOM   983  C  "C2'" . G   A 1 45 ? 29.617 25.800  32.750  1.00 10.00 ? 45  G   A "C2'" 1 
ATOM   984  O  "O2'" . G   A 1 45 ? 28.604 26.531  33.424  1.00 10.00 ? 45  G   A "O2'" 1 
ATOM   985  C  "C1'" . G   A 1 45 ? 29.117 25.559  31.321  1.00 10.00 ? 45  G   A "C1'" 1 
ATOM   986  N  N9    . G   A 1 45 ? 29.604 24.294  30.728  1.00 10.00 ? 45  G   A N9    1 
ATOM   987  C  C8    . G   A 1 45 ? 30.605 24.093  29.800  1.00 10.00 ? 45  G   A C8    1 
ATOM   988  N  N7    . G   A 1 45 ? 30.787 22.839  29.470  1.00 10.00 ? 45  G   A N7    1 
ATOM   989  C  C5    . G   A 1 45 ? 29.838 22.154  30.232  1.00 10.00 ? 45  G   A C5    1 
ATOM   990  C  C6    . G   A 1 45 ? 29.560 20.766  30.308  1.00 10.00 ? 45  G   A C6    1 
ATOM   991  O  O6    . G   A 1 45 ? 30.092 19.835  29.701  1.00 10.00 ? 45  G   A O6    1 
ATOM   992  N  N1    . G   A 1 45 ? 28.517 20.503  31.211  1.00 10.00 ? 45  G   A N1    1 
ATOM   993  C  C2    . G   A 1 45 ? 27.837 21.467  31.941  1.00 10.00 ? 45  G   A C2    1 
ATOM   994  N  N2    . G   A 1 45 ? 26.878 21.000  32.743  1.00 10.00 ? 45  G   A N2    1 
ATOM   995  N  N3    . G   A 1 45 ? 28.102 22.762  31.872  1.00 10.00 ? 45  G   A N3    1 
ATOM   996  C  C4    . G   A 1 45 ? 29.112 23.027  31.000  1.00 10.00 ? 45  G   A C4    1 
HETATM 997  P  P     . 7MG A 1 46 ? 32.752 27.805  33.862  1.00 10.00 ? 46  7MG A P     1 
HETATM 998  O  OP1   . 7MG A 1 46 ? 32.875 28.785  34.970  1.00 10.00 ? 46  7MG A OP1   1 
HETATM 999  O  OP2   . 7MG A 1 46 ? 33.365 28.216  32.573  1.00 10.00 ? 46  7MG A OP2   1 
HETATM 1000 O  "O5'" . 7MG A 1 46 ? 33.352 26.393  34.309  1.00 10.00 ? 46  7MG A "O5'" 1 
HETATM 1001 C  "C5'" . 7MG A 1 46 ? 34.123 26.405  35.532  1.00 10.00 ? 46  7MG A "C5'" 1 
HETATM 1002 C  "C4'" . 7MG A 1 46 ? 33.199 26.356  36.735  1.00 10.00 ? 46  7MG A "C4'" 1 
HETATM 1003 O  "O4'" . 7MG A 1 46 ? 32.753 24.941  36.796  1.00 10.00 ? 46  7MG A "O4'" 1 
HETATM 1004 C  "C3'" . 7MG A 1 46 ? 33.993 26.391  38.050  1.00 10.00 ? 46  7MG A "C3'" 1 
HETATM 1005 O  "O3'" . 7MG A 1 46 ? 33.139 26.475  39.200  1.00 10.00 ? 46  7MG A "O3'" 1 
HETATM 1006 C  "C2'" . 7MG A 1 46 ? 34.734 25.050  37.971  1.00 10.00 ? 46  7MG A "C2'" 1 
HETATM 1007 O  "O2'" . 7MG A 1 46 ? 35.395 24.632  39.159  1.00 10.00 ? 46  7MG A "O2'" 1 
HETATM 1008 C  "C1'" . 7MG A 1 46 ? 33.639 24.109  37.529  1.00 10.00 ? 46  7MG A "C1'" 1 
HETATM 1009 N  N9    . 7MG A 1 46 ? 34.061 22.975  36.678  1.00 10.00 ? 46  7MG A N9    1 
HETATM 1010 C  C8    . 7MG A 1 46 ? 35.050 22.927  35.727  1.00 10.00 ? 46  7MG A C8    1 
HETATM 1011 N  N7    . 7MG A 1 46 ? 35.177 21.752  35.161  1.00 10.00 ? 46  7MG A N7    1 
HETATM 1012 C  C5    . 7MG A 1 46 ? 34.207 20.971  35.789  1.00 10.00 ? 46  7MG A C5    1 
HETATM 1013 C  C6    . 7MG A 1 46 ? 33.874 19.607  35.602  1.00 10.00 ? 46  7MG A C6    1 
HETATM 1014 O  O6    . 7MG A 1 46 ? 34.361 18.791  34.817  1.00 10.00 ? 46  7MG A O6    1 
HETATM 1015 N  N1    . 7MG A 1 46 ? 32.827 19.216  36.452  1.00 10.00 ? 46  7MG A N1    1 
HETATM 1016 C  C2    . 7MG A 1 46 ? 32.193 20.046  37.365  1.00 10.00 ? 46  7MG A C2    1 
HETATM 1017 N  N2    . 7MG A 1 46 ? 31.223 19.470  38.078  1.00 10.00 ? 46  7MG A N2    1 
HETATM 1018 N  N3    . 7MG A 1 46 ? 32.512 21.317  37.545  1.00 10.00 ? 46  7MG A N3    1 
HETATM 1019 C  C4    . 7MG A 1 46 ? 33.524 21.708  36.723  1.00 10.00 ? 46  7MG A C4    1 
HETATM 1020 C  CM7   . 7MG A 1 46 ? 36.137 21.408  34.116  1.00 10.00 ? 46  7MG A CM7   1 
ATOM   1021 P  P     . U   A 1 47 ? 32.963 27.904  39.893  1.00 10.00 ? 47  U   A P     1 
ATOM   1022 O  OP1   . U   A 1 47 ? 31.663 27.948  40.607  1.00 10.00 ? 47  U   A OP1   1 
ATOM   1023 O  OP2   . U   A 1 47 ? 33.177 28.977  38.887  1.00 10.00 ? 47  U   A OP2   1 
ATOM   1024 O  "O5'" . U   A 1 47 ? 34.168 27.913  40.941  1.00 10.00 ? 47  U   A "O5'" 1 
ATOM   1025 C  "C5'" . U   A 1 47 ? 35.485 28.258  40.471  1.00 10.00 ? 47  U   A "C5'" 1 
ATOM   1026 C  "C4'" . U   A 1 47 ? 36.526 27.933  41.529  1.00 10.00 ? 47  U   A "C4'" 1 
ATOM   1027 O  "O4'" . U   A 1 47 ? 36.473 28.937  42.586  1.00 10.00 ? 47  U   A "O4'" 1 
ATOM   1028 C  "C3'" . U   A 1 47 ? 36.251 26.570  42.186  1.00 10.00 ? 47  U   A "C3'" 1 
ATOM   1029 O  "O3'" . U   A 1 47 ? 37.455 25.829  42.425  1.00 10.00 ? 47  U   A "O3'" 1 
ATOM   1030 C  "C2'" . U   A 1 47 ? 35.569 27.015  43.486  1.00 10.00 ? 47  U   A "C2'" 1 
ATOM   1031 O  "O2'" . U   A 1 47 ? 35.548 26.054  44.537  1.00 10.00 ? 47  U   A "O2'" 1 
ATOM   1032 C  "C1'" . U   A 1 47 ? 36.334 28.269  43.830  1.00 10.00 ? 47  U   A "C1'" 1 
ATOM   1033 N  N1    . U   A 1 47 ? 35.686 29.180  44.800  1.00 10.00 ? 47  U   A N1    1 
ATOM   1034 C  C2    . U   A 1 47 ? 36.489 29.719  45.764  1.00 10.00 ? 47  U   A C2    1 
ATOM   1035 O  O2    . U   A 1 47 ? 37.686 29.499  45.848  1.00 10.00 ? 47  U   A O2    1 
ATOM   1036 N  N3    . U   A 1 47 ? 35.853 30.550  46.659  1.00 10.00 ? 47  U   A N3    1 
ATOM   1037 C  C4    . U   A 1 47 ? 34.504 30.868  46.672  1.00 10.00 ? 47  U   A C4    1 
ATOM   1038 O  O4    . U   A 1 47 ? 34.052 31.633  47.520  1.00 10.00 ? 47  U   A O4    1 
ATOM   1039 C  C5    . U   A 1 47 ? 33.744 30.239  45.619  1.00 10.00 ? 47  U   A C5    1 
ATOM   1040 C  C6    . U   A 1 47 ? 34.340 29.429  44.729  1.00 10.00 ? 47  U   A C6    1 
ATOM   1041 P  P     . C   A 1 48 ? 37.552 24.290  42.046  1.00 10.00 ? 48  C   A P     1 
ATOM   1042 O  OP1   . C   A 1 48 ? 38.770 23.711  42.665  1.00 10.00 ? 48  C   A OP1   1 
ATOM   1043 O  OP2   . C   A 1 48 ? 37.449 24.132  40.574  1.00 10.00 ? 48  C   A OP2   1 
ATOM   1044 O  "O5'" . C   A 1 48 ? 36.244 23.684  42.735  1.00 10.00 ? 48  C   A "O5'" 1 
ATOM   1045 C  "C5'" . C   A 1 48 ? 36.432 22.878  43.917  1.00 10.00 ? 48  C   A "C5'" 1 
ATOM   1046 C  "C4'" . C   A 1 48 ? 35.508 21.673  43.894  1.00 10.00 ? 48  C   A "C4'" 1 
ATOM   1047 O  "O4'" . C   A 1 48 ? 35.754 20.890  42.697  1.00 10.00 ? 48  C   A "O4'" 1 
ATOM   1048 C  "C3'" . C   A 1 48 ? 35.779 20.739  45.084  1.00 10.00 ? 48  C   A "C3'" 1 
ATOM   1049 O  "O3'" . C   A 1 48 ? 34.579 20.136  45.590  1.00 10.00 ? 48  C   A "O3'" 1 
ATOM   1050 C  "C2'" . C   A 1 48 ? 36.717 19.714  44.433  1.00 10.00 ? 48  C   A "C2'" 1 
ATOM   1051 O  "O2'" . C   A 1 48 ? 36.868 18.481  45.125  1.00 10.00 ? 48  C   A "O2'" 1 
ATOM   1052 C  "C1'" . C   A 1 48 ? 36.115 19.565  43.059  1.00 10.00 ? 48  C   A "C1'" 1 
ATOM   1053 N  N1    . C   A 1 48 ? 37.004 19.003  42.018  1.00 10.00 ? 48  C   A N1    1 
ATOM   1054 C  C2    . C   A 1 48 ? 36.770 17.700  41.621  1.00 10.00 ? 48  C   A C2    1 
ATOM   1055 O  O2    . C   A 1 48 ? 35.825 17.080  42.125  1.00 10.00 ? 48  C   A O2    1 
ATOM   1056 N  N3    . C   A 1 48 ? 37.577 17.150  40.671  1.00 10.00 ? 48  C   A N3    1 
ATOM   1057 C  C4    . C   A 1 48 ? 38.587 17.855  40.151  1.00 10.00 ? 48  C   A C4    1 
ATOM   1058 N  N4    . C   A 1 48 ? 39.343 17.285  39.229  1.00 10.00 ? 48  C   A N4    1 
ATOM   1059 C  C5    . C   A 1 48 ? 38.854 19.209  40.564  1.00 10.00 ? 48  C   A C5    1 
ATOM   1060 C  C6    . C   A 1 48 ? 38.036 19.733  41.503  1.00 10.00 ? 48  C   A C6    1 
HETATM 1061 P  P     . 5MC A 1 49 ? 34.413 19.929  47.157  1.00 10.00 ? 49  5MC A P     1 
HETATM 1062 O  OP1   . 5MC A 1 49 ? 35.623 19.271  47.711  1.00 10.00 ? 49  5MC A OP1   1 
HETATM 1063 O  OP2   . 5MC A 1 49 ? 33.129 19.230  47.419  1.00 10.00 ? 49  5MC A OP2   1 
HETATM 1064 O  "O5'" . 5MC A 1 49 ? 34.314 21.434  47.684  1.00 10.00 ? 49  5MC A "O5'" 1 
HETATM 1065 C  "C5'" . 5MC A 1 49 ? 33.136 22.206  47.398  1.00 10.00 ? 49  5MC A "C5'" 1 
HETATM 1066 C  "C4'" . 5MC A 1 49 ? 33.175 23.497  48.217  1.00 10.00 ? 49  5MC A "C4'" 1 
HETATM 1067 O  "O4'" . 5MC A 1 49 ? 32.460 23.254  49.469  1.00 10.00 ? 49  5MC A "O4'" 1 
HETATM 1068 C  "C3'" . 5MC A 1 49 ? 34.556 23.976  48.630  1.00 10.00 ? 49  5MC A "C3'" 1 
HETATM 1069 O  "O3'" . 5MC A 1 49 ? 35.169 24.768  47.623  1.00 10.00 ? 49  5MC A "O3'" 1 
HETATM 1070 C  "C2'" . 5MC A 1 49 ? 34.257 24.747  49.909  1.00 10.00 ? 49  5MC A "C2'" 1 
HETATM 1071 O  "O2'" . 5MC A 1 49 ? 33.681 26.010  49.610  1.00 10.00 ? 49  5MC A "O2'" 1 
HETATM 1072 C  "C1'" . 5MC A 1 49 ? 33.153 23.892  50.542  1.00 10.00 ? 49  5MC A "C1'" 1 
HETATM 1073 N  N1    . 5MC A 1 49 ? 33.658 22.848  51.459  1.00 10.00 ? 49  5MC A N1    1 
HETATM 1074 C  C2    . 5MC A 1 49 ? 34.120 23.245  52.709  1.00 10.00 ? 49  5MC A C2    1 
HETATM 1075 O  O2    . 5MC A 1 49 ? 34.086 24.449  52.991  1.00 10.00 ? 49  5MC A O2    1 
HETATM 1076 N  N3    . 5MC A 1 49 ? 34.583 22.303  53.573  1.00 10.00 ? 49  5MC A N3    1 
HETATM 1077 C  C4    . 5MC A 1 49 ? 34.602 21.009  53.228  1.00 10.00 ? 49  5MC A C4    1 
HETATM 1078 N  N4    . 5MC A 1 49 ? 35.056 20.128  54.102  1.00 10.00 ? 49  5MC A N4    1 
HETATM 1079 C  C5    . 5MC A 1 49 ? 34.130 20.571  51.939  1.00 10.00 ? 49  5MC A C5    1 
HETATM 1080 C  C6    . 5MC A 1 49 ? 33.671 21.526  51.098  1.00 10.00 ? 49  5MC A C6    1 
HETATM 1081 C  CM5   . 5MC A 1 49 ? 34.117 19.143  51.483  1.00 10.00 ? 49  5MC A CM5   1 
ATOM   1082 P  P     . U   A 1 50 ? 36.746 24.998  47.688  1.00 10.00 ? 50  U   A P     1 
ATOM   1083 O  OP1   . U   A 1 50 ? 37.180 25.825  46.534  1.00 10.00 ? 50  U   A OP1   1 
ATOM   1084 O  OP2   . U   A 1 50 ? 37.431 23.687  47.830  1.00 10.00 ? 50  U   A OP2   1 
ATOM   1085 O  "O5'" . U   A 1 50 ? 36.903 25.825  49.046  1.00 10.00 ? 50  U   A "O5'" 1 
ATOM   1086 C  "C5'" . U   A 1 50 ? 37.891 26.863  49.097  1.00 10.00 ? 50  U   A "C5'" 1 
ATOM   1087 C  "C4'" . U   A 1 50 ? 37.807 27.626  50.419  1.00 10.00 ? 50  U   A "C4'" 1 
ATOM   1088 O  "O4'" . U   A 1 50 ? 36.799 27.036  51.261  1.00 10.00 ? 50  U   A "O4'" 1 
ATOM   1089 C  "C3'" . U   A 1 50 ? 39.086 27.668  51.240  1.00 10.00 ? 50  U   A "C3'" 1 
ATOM   1090 O  "O3'" . U   A 1 50 ? 39.940 28.730  50.836  1.00 10.00 ? 50  U   A "O3'" 1 
ATOM   1091 C  "C2'" . U   A 1 50 ? 38.552 27.825  52.659  1.00 10.00 ? 50  U   A "C2'" 1 
ATOM   1092 O  "O2'" . U   A 1 50 ? 38.157 29.168  52.898  1.00 10.00 ? 50  U   A "O2'" 1 
ATOM   1093 C  "C1'" . U   A 1 50 ? 37.270 26.988  52.607  1.00 10.00 ? 50  U   A "C1'" 1 
ATOM   1094 N  N1    . U   A 1 50 ? 37.468 25.569  52.984  1.00 10.00 ? 50  U   A N1    1 
ATOM   1095 C  C2    . U   A 1 50 ? 38.130 25.315  54.159  1.00 10.00 ? 50  U   A C2    1 
ATOM   1096 O  O2    . U   A 1 50 ? 38.562 26.195  54.886  1.00 10.00 ? 50  U   A O2    1 
ATOM   1097 N  N3    . U   A 1 50 ? 38.292 23.985  54.478  1.00 10.00 ? 50  U   A N3    1 
ATOM   1098 C  C4    . U   A 1 50 ? 37.855 22.901  53.731  1.00 10.00 ? 50  U   A C4    1 
ATOM   1099 O  O4    . U   A 1 50 ? 38.052 21.753  54.123  1.00 10.00 ? 50  U   A O4    1 
ATOM   1100 C  C5    . U   A 1 50 ? 37.170 23.265  52.516  1.00 10.00 ? 50  U   A C5    1 
ATOM   1101 C  C6    . U   A 1 50 ? 36.991 24.555  52.184  1.00 10.00 ? 50  U   A C6    1 
ATOM   1102 P  P     . G   A 1 51 ? 41.074 28.393  49.787  1.00 10.00 ? 51  G   A P     1 
ATOM   1103 O  OP1   . G   A 1 51 ? 41.070 29.390  48.687  1.00 10.00 ? 51  G   A OP1   1 
ATOM   1104 O  OP2   . G   A 1 51 ? 40.973 26.972  49.362  1.00 10.00 ? 51  G   A OP2   1 
ATOM   1105 O  "O5'" . G   A 1 51 ? 42.372 28.582  50.696  1.00 10.00 ? 51  G   A "O5'" 1 
ATOM   1106 C  "C5'" . G   A 1 51 ? 42.289 29.583  51.732  1.00 10.00 ? 51  G   A "C5'" 1 
ATOM   1107 C  "C4'" . G   A 1 51 ? 42.687 29.039  53.105  1.00 10.00 ? 51  G   A "C4'" 1 
ATOM   1108 O  "O4'" . G   A 1 51 ? 41.747 27.995  53.535  1.00 10.00 ? 51  G   A "O4'" 1 
ATOM   1109 C  "C3'" . G   A 1 51 ? 43.987 28.254  53.153  1.00 10.00 ? 51  G   A "C3'" 1 
ATOM   1110 O  "O3'" . G   A 1 51 ? 45.124 29.103  53.065  1.00 10.00 ? 51  G   A "O3'" 1 
ATOM   1111 C  "C2'" . G   A 1 51 ? 43.874 27.527  54.488  1.00 10.00 ? 51  G   A "C2'" 1 
ATOM   1112 O  "O2'" . G   A 1 51 ? 44.146 28.412  55.564  1.00 10.00 ? 51  G   A "O2'" 1 
ATOM   1113 C  "C1'" . G   A 1 51 ? 42.376 27.207  54.545  1.00 10.00 ? 51  G   A "C1'" 1 
ATOM   1114 N  N9    . G   A 1 51 ? 42.061 25.783  54.294  1.00 10.00 ? 51  G   A N9    1 
ATOM   1115 C  C8    . G   A 1 51 ? 41.404 25.208  53.226  1.00 10.00 ? 51  G   A C8    1 
ATOM   1116 N  N7    . G   A 1 51 ? 41.280 23.907  53.308  1.00 10.00 ? 51  G   A N7    1 
ATOM   1117 C  C5    . G   A 1 51 ? 41.898 23.590  54.520  1.00 10.00 ? 51  G   A C5    1 
ATOM   1118 C  C6    . G   A 1 51 ? 42.084 22.333  55.147  1.00 10.00 ? 51  G   A C6    1 
ATOM   1119 O  O6    . G   A 1 51 ? 41.727 21.216  54.768  1.00 10.00 ? 51  G   A O6    1 
ATOM   1120 N  N1    . G   A 1 51 ? 42.767 22.466  56.368  1.00 10.00 ? 51  G   A N1    1 
ATOM   1121 C  C2    . G   A 1 51 ? 43.207 23.668  56.901  1.00 10.00 ? 51  G   A C2    1 
ATOM   1122 N  N2    . G   A 1 51 ? 43.836 23.571  58.073  1.00 10.00 ? 51  G   A N2    1 
ATOM   1123 N  N3    . G   A 1 51 ? 43.039 24.841  56.311  1.00 10.00 ? 51  G   A N3    1 
ATOM   1124 C  C4    . G   A 1 51 ? 42.376 24.722  55.127  1.00 10.00 ? 51  G   A C4    1 
ATOM   1125 P  P     . U   A 1 52 ? 46.395 28.619  52.224  1.00 10.00 ? 52  U   A P     1 
ATOM   1126 O  OP1   . U   A 1 52 ? 47.318 29.760  51.992  1.00 10.00 ? 52  U   A OP1   1 
ATOM   1127 O  OP2   . U   A 1 52 ? 45.958 27.896  51.000  1.00 10.00 ? 52  U   A OP2   1 
ATOM   1128 O  "O5'" . U   A 1 52 ? 47.046 27.581  53.248  1.00 10.00 ? 52  U   A "O5'" 1 
ATOM   1129 C  "C5'" . U   A 1 52 ? 47.891 28.189  54.237  1.00 10.00 ? 52  U   A "C5'" 1 
ATOM   1130 C  "C4'" . U   A 1 52 ? 48.213 27.202  55.365  1.00 10.00 ? 52  U   A "C4'" 1 
ATOM   1131 O  "O4'" . U   A 1 52 ? 46.950 26.435  55.682  1.00 10.00 ? 52  U   A "O4'" 1 
ATOM   1132 C  "C3'" . U   A 1 52 ? 49.171 26.079  55.006  1.00 10.00 ? 52  U   A "C3'" 1 
ATOM   1133 O  "O3'" . U   A 1 52 ? 50.526 26.502  55.052  1.00 10.00 ? 52  U   A "O3'" 1 
ATOM   1134 C  "C2'" . U   A 1 52 ? 48.828 25.021  56.048  1.00 10.00 ? 52  U   A "C2'" 1 
ATOM   1135 O  "O2'" . U   A 1 52 ? 49.305 25.407  57.327  1.00 10.00 ? 52  U   A "O2'" 1 
ATOM   1136 C  "C1'" . U   A 1 52 ? 47.300 25.112  56.097  1.00 10.00 ? 52  U   A "C1'" 1 
ATOM   1137 N  N1    . U   A 1 52 ? 46.615 24.148  55.208  1.00 10.00 ? 52  U   A N1    1 
ATOM   1138 C  C2    . U   A 1 52 ? 46.682 22.819  55.548  1.00 10.00 ? 52  U   A C2    1 
ATOM   1139 O  O2    . U   A 1 52 ? 47.281 22.409  56.530  1.00 10.00 ? 52  U   A O2    1 
ATOM   1140 N  N3    . U   A 1 52 ? 46.032 21.952  54.700  1.00 10.00 ? 52  U   A N3    1 
ATOM   1141 C  C4    . U   A 1 52 ? 45.330 22.294  53.554  1.00 10.00 ? 52  U   A C4    1 
ATOM   1142 O  O4    . U   A 1 52 ? 44.781 21.427  52.878  1.00 10.00 ? 52  U   A O4    1 
ATOM   1143 C  C5    . U   A 1 52 ? 45.311 23.711  53.278  1.00 10.00 ? 52  U   A C5    1 
ATOM   1144 C  C6    . U   A 1 52 ? 45.933 24.579  54.095  1.00 10.00 ? 52  U   A C6    1 
ATOM   1145 P  P     . G   A 1 53 ? 51.364 26.123  53.722  1.00 10.00 ? 53  G   A P     1 
ATOM   1146 O  OP1   . G   A 1 53 ? 52.612 26.925  53.665  1.00 10.00 ? 53  G   A OP1   1 
ATOM   1147 O  OP2   . G   A 1 53 ? 50.493 26.209  52.524  1.00 10.00 ? 53  G   A OP2   1 
ATOM   1148 O  "O5'" . G   A 1 53 ? 51.709 24.590  54.019  1.00 10.00 ? 53  G   A "O5'" 1 
ATOM   1149 C  "C5'" . G   A 1 53 ? 52.516 24.279  55.156  1.00 10.00 ? 53  G   A "C5'" 1 
ATOM   1150 C  "C4'" . G   A 1 53 ? 52.144 22.907  55.725  1.00 10.00 ? 53  G   A "C4'" 1 
ATOM   1151 O  "O4'" . G   A 1 53 ? 50.689 22.720  55.584  1.00 10.00 ? 53  G   A "O4'" 1 
ATOM   1152 C  "C3'" . G   A 1 53 ? 52.676 21.708  54.959  1.00 10.00 ? 53  G   A "C3'" 1 
ATOM   1153 O  "O3'" . G   A 1 53 ? 54.043 21.454  55.251  1.00 10.00 ? 53  G   A "O3'" 1 
ATOM   1154 C  "C2'" . G   A 1 53 ? 51.742 20.594  55.416  1.00 10.00 ? 53  G   A "C2'" 1 
ATOM   1155 O  "O2'" . G   A 1 53 ? 52.062 20.182  56.738  1.00 10.00 ? 53  G   A "O2'" 1 
ATOM   1156 C  "C1'" . G   A 1 53 ? 50.398 21.325  55.493  1.00 10.00 ? 53  G   A "C1'" 1 
ATOM   1157 N  N9    . G   A 1 53 ? 49.531 21.105  54.313  1.00 10.00 ? 53  G   A N9    1 
ATOM   1158 C  C8    . G   A 1 53 ? 49.047 22.019  53.399  1.00 10.00 ? 53  G   A C8    1 
ATOM   1159 N  N7    . G   A 1 53 ? 48.294 21.495  52.468  1.00 10.00 ? 53  G   A N7    1 
ATOM   1160 C  C5    . G   A 1 53 ? 48.271 20.136  52.780  1.00 10.00 ? 53  G   A C5    1 
ATOM   1161 C  C6    . G   A 1 53 ? 47.622 19.062  52.123  1.00 10.00 ? 53  G   A C6    1 
ATOM   1162 O  O6    . G   A 1 53 ? 46.910 19.082  51.119  1.00 10.00 ? 53  G   A O6    1 
ATOM   1163 N  N1    . G   A 1 53 ? 47.868 17.840  52.780  1.00 10.00 ? 53  G   A N1    1 
ATOM   1164 C  C2    . G   A 1 53 ? 48.641 17.693  53.921  1.00 10.00 ? 53  G   A C2    1 
ATOM   1165 N  N2    . G   A 1 53 ? 48.745 16.444  54.380  1.00 10.00 ? 53  G   A N2    1 
ATOM   1166 N  N3    . G   A 1 53 ? 49.251 18.698  54.528  1.00 10.00 ? 53  G   A N3    1 
ATOM   1167 C  C4    . G   A 1 53 ? 49.020 19.885  53.903  1.00 10.00 ? 53  G   A C4    1 
HETATM 1168 N  N1    . 5MU A 1 54 ? 51.738 16.769  51.971  1.00 10.00 ? 54  5MU A N1    1 
HETATM 1169 C  C2    . 5MU A 1 54 ? 50.897 16.046  51.162  1.00 10.00 ? 54  5MU A C2    1 
HETATM 1170 N  N3    . 5MU A 1 54 ? 50.196 16.774  50.225  1.00 10.00 ? 54  5MU A N3    1 
HETATM 1171 C  C4    . 5MU A 1 54 ? 50.262 18.146  50.031  1.00 10.00 ? 54  5MU A C4    1 
HETATM 1172 C  C5    . 5MU A 1 54 ? 51.169 18.821  50.927  1.00 10.00 ? 54  5MU A C5    1 
HETATM 1173 C  C5M   . 5MU A 1 54 ? 51.402 20.303  50.893  1.00 10.00 ? 54  5MU A C5M   1 
HETATM 1174 C  C6    . 5MU A 1 54 ? 51.859 18.137  51.852  1.00 10.00 ? 54  5MU A C6    1 
HETATM 1175 O  O2    . 5MU A 1 54 ? 50.769 14.834  51.244  1.00 10.00 ? 54  5MU A O2    1 
HETATM 1176 O  O4    . 5MU A 1 54 ? 49.578 18.687  49.163  1.00 10.00 ? 54  5MU A O4    1 
HETATM 1177 C  "C1'" . 5MU A 1 54 ? 52.507 16.024  52.991  1.00 10.00 ? 54  5MU A "C1'" 1 
HETATM 1178 C  "C2'" . 5MU A 1 54 ? 53.870 15.529  52.498  1.00 10.00 ? 54  5MU A "C2'" 1 
HETATM 1179 O  "O2'" . 5MU A 1 54 ? 54.118 14.292  53.148  1.00 10.00 ? 54  5MU A "O2'" 1 
HETATM 1180 C  "C3'" . 5MU A 1 54 ? 54.804 16.612  53.022  1.00 10.00 ? 54  5MU A "C3'" 1 
HETATM 1181 C  "C4'" . 5MU A 1 54 ? 54.199 16.923  54.382  1.00 10.00 ? 54  5MU A "C4'" 1 
HETATM 1182 O  "O3'" . 5MU A 1 54 ? 56.156 16.188  53.130  1.00 10.00 ? 54  5MU A "O3'" 1 
HETATM 1183 O  "O4'" . 5MU A 1 54 ? 52.758 16.897  54.092  1.00 10.00 ? 54  5MU A "O4'" 1 
HETATM 1184 C  "C5'" . 5MU A 1 54 ? 54.540 18.296  54.962  1.00 10.00 ? 54  5MU A "C5'" 1 
HETATM 1185 O  "O5'" . 5MU A 1 54 ? 54.319 19.305  53.975  1.00 10.00 ? 54  5MU A "O5'" 1 
HETATM 1186 P  P     . 5MU A 1 54 ? 54.943 20.767  54.130  1.00 10.00 ? 54  5MU A P     1 
HETATM 1187 O  OP1   . 5MU A 1 54 ? 56.343 20.677  54.612  1.00 10.00 ? 54  5MU A OP1   1 
HETATM 1188 O  OP2   . 5MU A 1 54 ? 54.751 21.522  52.865  1.00 10.00 ? 54  5MU A OP2   1 
HETATM 1189 N  N1    . PSU A 1 55 ? 53.802 18.472  49.129  1.00 10.00 ? 55  PSU A N1    1 
HETATM 1190 C  C2    . PSU A 1 55 ? 52.908 19.131  48.208  1.00 10.00 ? 55  PSU A C2    1 
HETATM 1191 N  N3    . PSU A 1 55 ? 52.443 18.311  47.191  1.00 10.00 ? 55  PSU A N3    1 
HETATM 1192 C  C4    . PSU A 1 55 ? 52.759 16.983  47.004  1.00 10.00 ? 55  PSU A C4    1 
HETATM 1193 C  C5    . PSU A 1 55 ? 53.619 16.439  47.925  1.00 10.00 ? 55  PSU A C5    1 
HETATM 1194 C  C6    . PSU A 1 55 ? 54.122 17.176  48.973  1.00 10.00 ? 55  PSU A C6    1 
HETATM 1195 O  O2    . PSU A 1 55 ? 52.547 20.304  48.277  1.00 10.00 ? 55  PSU A O2    1 
HETATM 1196 O  O4    . PSU A 1 55 ? 52.298 16.353  46.066  1.00 10.00 ? 55  PSU A O4    1 
HETATM 1197 C  "C1'" . PSU A 1 55 ? 53.980 15.013  47.759  1.00 10.00 ? 55  PSU A "C1'" 1 
HETATM 1198 C  "C2'" . PSU A 1 55 ? 55.209 14.788  46.872  1.00 10.00 ? 55  PSU A "C2'" 1 
HETATM 1199 O  "O2'" . PSU A 1 55 ? 55.051 13.514  46.267  1.00 10.00 ? 55  PSU A "O2'" 1 
HETATM 1200 C  "C3'" . PSU A 1 55 ? 56.333 14.756  47.901  1.00 10.00 ? 55  PSU A "C3'" 1 
HETATM 1201 C  "C4'" . PSU A 1 55 ? 55.681 14.030  49.066  1.00 10.00 ? 55  PSU A "C4'" 1 
HETATM 1202 O  "O3'" . PSU A 1 55 ? 57.499 14.086  47.445  1.00 10.00 ? 55  PSU A "O3'" 1 
HETATM 1203 O  "O4'" . PSU A 1 55 ? 54.290 14.473  49.044  1.00 10.00 ? 55  PSU A "O4'" 1 
HETATM 1204 C  "C5'" . PSU A 1 55 ? 56.266 14.327  50.446  1.00 10.00 ? 55  PSU A "C5'" 1 
HETATM 1205 O  "O5'" . PSU A 1 55 ? 56.139 15.749  50.683  1.00 10.00 ? 55  PSU A "O5'" 1 
HETATM 1206 P  P     . PSU A 1 55 ? 57.061 16.378  51.825  1.00 10.00 ? 55  PSU A P     1 
HETATM 1207 O  OP1   . PSU A 1 55 ? 58.296 15.571  51.989  1.00 10.00 ? 55  PSU A OP1   1 
HETATM 1208 O  OP2   . PSU A 1 55 ? 57.274 17.822  51.546  1.00 10.00 ? 55  PSU A OP2   1 
ATOM   1209 P  P     . C   A 1 56 ? 58.772 14.941  47.024  1.00 10.00 ? 56  C   A P     1 
ATOM   1210 O  OP1   . C   A 1 56 ? 59.968 14.064  47.015  1.00 10.00 ? 56  C   A OP1   1 
ATOM   1211 O  OP2   . C   A 1 56 ? 58.878 16.159  47.866  1.00 10.00 ? 56  C   A OP2   1 
ATOM   1212 O  "O5'" . C   A 1 56 ? 58.388 15.363  45.532  1.00 10.00 ? 56  C   A "O5'" 1 
ATOM   1213 C  "C5'" . C   A 1 56 ? 58.603 16.730  45.192  1.00 10.00 ? 56  C   A "C5'" 1 
ATOM   1214 C  "C4'" . C   A 1 56 ? 58.312 16.957  43.707  1.00 10.00 ? 56  C   A "C4'" 1 
ATOM   1215 O  "O4'" . C   A 1 56 ? 58.623 15.725  42.971  1.00 10.00 ? 56  C   A "O4'" 1 
ATOM   1216 C  "C3'" . C   A 1 56 ? 56.858 17.214  43.354  1.00 10.00 ? 56  C   A "C3'" 1 
ATOM   1217 O  "O3'" . C   A 1 56 ? 56.486 18.566  43.584  1.00 10.00 ? 56  C   A "O3'" 1 
ATOM   1218 C  "C2'" . C   A 1 56 ? 56.812 16.817  41.883  1.00 10.00 ? 56  C   A "C2'" 1 
ATOM   1219 O  "O2'" . C   A 1 56 ? 57.425 17.810  41.075  1.00 10.00 ? 56  C   A "O2'" 1 
ATOM   1220 C  "C1'" . C   A 1 56 ? 57.736 15.594  41.861  1.00 10.00 ? 56  C   A "C1'" 1 
ATOM   1221 N  N1    . C   A 1 56 ? 57.021 14.303  41.984  1.00 10.00 ? 56  C   A N1    1 
ATOM   1222 C  C2    . C   A 1 56 ? 56.166 13.932  40.955  1.00 10.00 ? 56  C   A C2    1 
ATOM   1223 O  O2    . C   A 1 56 ? 56.043 14.691  39.986  1.00 10.00 ? 56  C   A O2    1 
ATOM   1224 N  N3    . C   A 1 56 ? 55.500 12.746  41.040  1.00 10.00 ? 56  C   A N3    1 
ATOM   1225 C  C4    . C   A 1 56 ? 55.662 11.952  42.106  1.00 10.00 ? 56  C   A C4    1 
ATOM   1226 N  N4    . C   A 1 56 ? 55.001 10.808  42.146  1.00 10.00 ? 56  C   A N4    1 
ATOM   1227 C  C5    . C   A 1 56 ? 56.541 12.314  43.187  1.00 10.00 ? 56  C   A C5    1 
ATOM   1228 C  C6    . C   A 1 56 ? 57.193 13.494  43.077  1.00 10.00 ? 56  C   A C6    1 
ATOM   1229 P  P     . G   A 1 57 ? 55.554 18.942  44.818  1.00 10.00 ? 57  G   A P     1 
ATOM   1230 O  OP1   . G   A 1 57 ? 55.757 20.364  45.195  1.00 10.00 ? 57  G   A OP1   1 
ATOM   1231 O  OP2   . G   A 1 57 ? 55.744 17.955  45.913  1.00 10.00 ? 57  G   A OP2   1 
ATOM   1232 O  "O5'" . G   A 1 57 ? 54.103 18.746  44.177  1.00 10.00 ? 57  G   A "O5'" 1 
ATOM   1233 C  "C5'" . G   A 1 57 ? 53.990 17.701  43.205  1.00 10.00 ? 57  G   A "C5'" 1 
ATOM   1234 C  "C4'" . G   A 1 57 ? 52.893 17.976  42.176  1.00 10.00 ? 57  G   A "C4'" 1 
ATOM   1235 O  "O4'" . G   A 1 57 ? 53.099 16.973  41.130  1.00 10.00 ? 57  G   A "O4'" 1 
ATOM   1236 C  "C3'" . G   A 1 57 ? 51.468 17.924  42.702  1.00 10.00 ? 57  G   A "C3'" 1 
ATOM   1237 O  "O3'" . G   A 1 57 ? 50.881 19.215  42.772  1.00 10.00 ? 57  G   A "O3'" 1 
ATOM   1238 C  "C2'" . G   A 1 57 ? 50.790 17.002  41.696  1.00 10.00 ? 57  G   A "C2'" 1 
ATOM   1239 O  "O2'" . G   A 1 57 ? 50.357 17.736  40.557  1.00 10.00 ? 57  G   A "O2'" 1 
ATOM   1240 C  "C1'" . G   A 1 57 ? 51.957 16.123  41.238  1.00 10.00 ? 57  G   A "C1'" 1 
ATOM   1241 N  N9    . G   A 1 57 ? 52.279 15.023  42.176  1.00 10.00 ? 57  G   A N9    1 
ATOM   1242 C  C8    . G   A 1 57 ? 53.205 14.987  43.197  1.00 10.00 ? 57  G   A C8    1 
ATOM   1243 N  N7    . G   A 1 57 ? 53.246 13.848  43.845  1.00 10.00 ? 57  G   A N7    1 
ATOM   1244 C  C5    . G   A 1 57 ? 52.280 13.068  43.209  1.00 10.00 ? 57  G   A C5    1 
ATOM   1245 C  C6    . G   A 1 57 ? 51.865 11.740  43.471  1.00 10.00 ? 57  G   A C6    1 
ATOM   1246 O  O6    . G   A 1 57 ? 52.277 10.953  44.327  1.00 10.00 ? 57  G   A O6    1 
ATOM   1247 N  N1    . G   A 1 57 ? 50.852 11.337  42.586  1.00 10.00 ? 57  G   A N1    1 
ATOM   1248 C  C2    . G   A 1 57 ? 50.318 12.128  41.579  1.00 10.00 ? 57  G   A C2    1 
ATOM   1249 N  N2    . G   A 1 57 ? 49.361 11.550  40.851  1.00 10.00 ? 57  G   A N2    1 
ATOM   1250 N  N3    . G   A 1 57 ? 50.701 13.372  41.340  1.00 10.00 ? 57  G   A N3    1 
ATOM   1251 C  C4    . G   A 1 57 ? 51.685 13.771  42.193  1.00 10.00 ? 57  G   A C4    1 
HETATM 1252 P  P     . 1MA A 1 58 ? 49.993 19.589  44.042  1.00 10.00 ? 58  1MA A P     1 
HETATM 1253 O  OP1   . 1MA A 1 58 ? 49.372 20.921  43.844  1.00 10.00 ? 58  1MA A OP1   1 
HETATM 1254 O  OP2   . 1MA A 1 58 ? 50.811 19.442  45.274  1.00 10.00 ? 58  1MA A OP2   1 
HETATM 1255 O  "O5'" . 1MA A 1 58 ? 48.874 18.448  44.017  1.00 10.00 ? 58  1MA A "O5'" 1 
HETATM 1256 C  "C5'" . 1MA A 1 58 ? 47.808 18.548  43.065  1.00 10.00 ? 58  1MA A "C5'" 1 
HETATM 1257 C  "C4'" . 1MA A 1 58 ? 46.616 17.701  43.471  1.00 10.00 ? 58  1MA A "C4'" 1 
HETATM 1258 O  "O4'" . 1MA A 1 58 ? 47.072 16.587  44.311  1.00 10.00 ? 58  1MA A "O4'" 1 
HETATM 1259 C  "C3'" . 1MA A 1 58 ? 45.614 18.511  44.308  1.00 10.00 ? 58  1MA A "C3'" 1 
HETATM 1260 O  "O3'" . 1MA A 1 58 ? 44.253 18.193  43.988  1.00 10.00 ? 58  1MA A "O3'" 1 
HETATM 1261 C  "C2'" . 1MA A 1 58 ? 46.001 18.061  45.724  1.00 10.00 ? 58  1MA A "C2'" 1 
HETATM 1262 O  "O2'" . 1MA A 1 58 ? 45.029 18.289  46.737  1.00 10.00 ? 58  1MA A "O2'" 1 
HETATM 1263 C  "C1'" . 1MA A 1 58 ? 46.324 16.601  45.516  1.00 10.00 ? 58  1MA A "C1'" 1 
HETATM 1264 N  N9    . 1MA A 1 58 ? 47.113 15.951  46.585  1.00 10.00 ? 58  1MA A N9    1 
HETATM 1265 C  C8    . 1MA A 1 58 ? 48.057 16.511  47.387  1.00 10.00 ? 58  1MA A C8    1 
HETATM 1266 N  N7    . 1MA A 1 58 ? 48.564 15.674  48.241  1.00 10.00 ? 58  1MA A N7    1 
HETATM 1267 C  C5    . 1MA A 1 58 ? 47.891 14.491  47.992  1.00 10.00 ? 58  1MA A C5    1 
HETATM 1268 C  C6    . 1MA A 1 58 ? 47.965 13.208  48.570  1.00 10.00 ? 58  1MA A C6    1 
HETATM 1269 N  N6    . 1MA A 1 58 ? 48.801 12.903  49.580  1.00 10.00 ? 58  1MA A N6    1 
HETATM 1270 N  N1    . 1MA A 1 58 ? 47.156 12.257  48.078  1.00 10.00 ? 58  1MA A N1    1 
HETATM 1271 C  CM1   . 1MA A 1 58 ? 47.186 10.864  48.634  1.00 10.00 ? 58  1MA A CM1   1 
HETATM 1272 C  C2    . 1MA A 1 58 ? 46.320 12.570  47.082  1.00 10.00 ? 58  1MA A C2    1 
HETATM 1273 N  N3    . 1MA A 1 58 ? 46.161 13.728  46.460  1.00 10.00 ? 58  1MA A N3    1 
HETATM 1274 C  C4    . 1MA A 1 58 ? 46.991 14.646  46.975  1.00 10.00 ? 58  1MA A C4    1 
ATOM   1275 P  P     . U   A 1 59 ? 43.501 18.981  42.834  1.00 10.00 ? 59  U   A P     1 
ATOM   1276 O  OP1   . U   A 1 59 ? 43.258 18.070  41.689  1.00 10.00 ? 59  U   A OP1   1 
ATOM   1277 O  OP2   . U   A 1 59 ? 44.234 20.232  42.515  1.00 10.00 ? 59  U   A OP2   1 
ATOM   1278 O  "O5'" . U   A 1 59 ? 42.120 19.346  43.550  1.00 10.00 ? 59  U   A "O5'" 1 
ATOM   1279 C  "C5'" . U   A 1 59 ? 40.956 18.607  43.177  1.00 10.00 ? 59  U   A "C5'" 1 
ATOM   1280 C  "C4'" . U   A 1 59 ? 40.183 18.101  44.397  1.00 10.00 ? 59  U   A "C4'" 1 
ATOM   1281 O  "O4'" . U   A 1 59 ? 38.942 17.544  43.890  1.00 10.00 ? 59  U   A "O4'" 1 
ATOM   1282 C  "C3'" . U   A 1 59 ? 40.898 17.065  45.251  1.00 10.00 ? 59  U   A "C3'" 1 
ATOM   1283 O  "O3'" . U   A 1 59 ? 41.501 17.647  46.398  1.00 10.00 ? 59  U   A "O3'" 1 
ATOM   1284 C  "C2'" . U   A 1 59 ? 39.773 16.092  45.586  1.00 10.00 ? 59  U   A "C2'" 1 
ATOM   1285 O  "O2'" . U   A 1 59 ? 38.993 16.581  46.665  1.00 10.00 ? 59  U   A "O2'" 1 
ATOM   1286 C  "C1'" . U   A 1 59 ? 38.897 16.185  44.330  1.00 10.00 ? 59  U   A "C1'" 1 
ATOM   1287 N  N1    . U   A 1 59 ? 39.354 15.320  43.220  1.00 10.00 ? 59  U   A N1    1 
ATOM   1288 C  C2    . U   A 1 59 ? 38.873 14.034  43.183  1.00 10.00 ? 59  U   A C2    1 
ATOM   1289 O  O2    . U   A 1 59 ? 38.105 13.582  44.018  1.00 10.00 ? 59  U   A O2    1 
ATOM   1290 N  N3    . U   A 1 59 ? 39.318 13.261  42.136  1.00 10.00 ? 59  U   A N3    1 
ATOM   1291 C  C4    . U   A 1 59 ? 40.192 13.657  41.133  1.00 10.00 ? 59  U   A C4    1 
ATOM   1292 O  O4    . U   A 1 59 ? 40.511 12.875  40.239  1.00 10.00 ? 59  U   A O4    1 
ATOM   1293 C  C5    . U   A 1 59 ? 40.643 15.022  41.254  1.00 10.00 ? 59  U   A C5    1 
ATOM   1294 C  C6    . U   A 1 59 ? 40.220 15.800  42.263  1.00 10.00 ? 59  U   A C6    1 
ATOM   1295 P  P     . C   A 1 60 ? 42.207 16.763  47.516  1.00 10.00 ? 60  C   A P     1 
ATOM   1296 O  OP1   . C   A 1 60 ? 42.296 17.559  48.767  1.00 10.00 ? 60  C   A OP1   1 
ATOM   1297 O  OP2   . C   A 1 60 ? 43.498 16.252  46.991  1.00 10.00 ? 60  C   A OP2   1 
ATOM   1298 O  "O5'" . C   A 1 60 ? 41.196 15.543  47.712  1.00 10.00 ? 60  C   A "O5'" 1 
ATOM   1299 C  "C5'" . C   A 1 60 ? 41.361 14.709  48.873  1.00 10.00 ? 60  C   A "C5'" 1 
ATOM   1300 C  "C4'" . C   A 1 60 ? 41.055 13.251  48.572  1.00 10.00 ? 60  C   A "C4'" 1 
ATOM   1301 O  "O4'" . C   A 1 60 ? 40.973 13.043  47.150  1.00 10.00 ? 60  C   A "O4'" 1 
ATOM   1302 C  "C3'" . C   A 1 60 ? 42.179 12.329  49.073  1.00 10.00 ? 60  C   A "C3'" 1 
ATOM   1303 O  "O3'" . C   A 1 60 ? 41.677 11.074  49.554  1.00 10.00 ? 60  C   A "O3'" 1 
ATOM   1304 C  "C2'" . C   A 1 60 ? 43.010 12.175  47.793  1.00 10.00 ? 60  C   A "C2'" 1 
ATOM   1305 O  "O2'" . C   A 1 60 ? 43.917 11.080  47.769  1.00 10.00 ? 60  C   A "O2'" 1 
ATOM   1306 C  "C1'" . C   A 1 60 ? 41.941 12.094  46.731  1.00 10.00 ? 60  C   A "C1'" 1 
ATOM   1307 N  N1    . C   A 1 60 ? 42.371 12.413  45.351  1.00 10.00 ? 60  C   A N1    1 
ATOM   1308 C  C2    . C   A 1 60 ? 42.209 11.430  44.395  1.00 10.00 ? 60  C   A C2    1 
ATOM   1309 O  O2    . C   A 1 60 ? 41.695 10.352  44.724  1.00 10.00 ? 60  C   A O2    1 
ATOM   1310 N  N3    . C   A 1 60 ? 42.604 11.689  43.116  1.00 10.00 ? 60  C   A N3    1 
ATOM   1311 C  C4    . C   A 1 60 ? 43.154 12.867  42.802  1.00 10.00 ? 60  C   A C4    1 
ATOM   1312 N  N4    . C   A 1 60 ? 43.519 13.078  41.550  1.00 10.00 ? 60  C   A N4    1 
ATOM   1313 C  C5    . C   A 1 60 ? 43.342 13.898  43.789  1.00 10.00 ? 60  C   A C5    1 
ATOM   1314 C  C6    . C   A 1 60 ? 42.939 13.618  45.050  1.00 10.00 ? 60  C   A C6    1 
ATOM   1315 P  P     . C   A 1 61 ? 41.132 10.999  51.052  1.00 10.00 ? 61  C   A P     1 
ATOM   1316 O  OP1   . C   A 1 61 ? 39.860 10.235  51.071  1.00 10.00 ? 61  C   A OP1   1 
ATOM   1317 O  OP2   . C   A 1 61 ? 41.060 12.374  51.614  1.00 10.00 ? 61  C   A OP2   1 
ATOM   1318 O  "O5'" . C   A 1 61 ? 42.277 10.181  51.805  1.00 10.00 ? 61  C   A "O5'" 1 
ATOM   1319 C  "C5'" . C   A 1 61 ? 43.557 10.020  51.208  1.00 10.00 ? 61  C   A "C5'" 1 
ATOM   1320 C  "C4'" . C   A 1 61 ? 44.691 10.162  52.226  1.00 10.00 ? 61  C   A "C4'" 1 
ATOM   1321 O  "O4'" . C   A 1 61 ? 45.786 10.756  51.475  1.00 10.00 ? 61  C   A "O4'" 1 
ATOM   1322 C  "C3'" . C   A 1 61 ? 44.419 11.096  53.392  1.00 10.00 ? 61  C   A "C3'" 1 
ATOM   1323 O  "O3'" . C   A 1 61 ? 43.860 10.410  54.502  1.00 10.00 ? 61  C   A "O3'" 1 
ATOM   1324 C  "C2'" . C   A 1 61 ? 45.802 11.674  53.667  1.00 10.00 ? 61  C   A "C2'" 1 
ATOM   1325 O  "O2'" . C   A 1 61 ? 46.607 10.734  54.364  1.00 10.00 ? 61  C   A "O2'" 1 
ATOM   1326 C  "C1'" . C   A 1 61 ? 46.381 11.795  52.253  1.00 10.00 ? 61  C   A "C1'" 1 
ATOM   1327 N  N1    . C   A 1 61 ? 46.096 13.092  51.600  1.00 10.00 ? 61  C   A N1    1 
ATOM   1328 C  C2    . C   A 1 61 ? 46.650 14.237  52.159  1.00 10.00 ? 61  C   A C2    1 
ATOM   1329 O  O2    . C   A 1 61 ? 47.352 14.121  53.169  1.00 10.00 ? 61  C   A O2    1 
ATOM   1330 N  N3    . C   A 1 61 ? 46.408 15.444  51.572  1.00 10.00 ? 61  C   A N3    1 
ATOM   1331 C  C4    . C   A 1 61 ? 45.644 15.526  50.479  1.00 10.00 ? 61  C   A C4    1 
ATOM   1332 N  N4    . C   A 1 61 ? 45.439 16.716  49.940  1.00 10.00 ? 61  C   A N4    1 
ATOM   1333 C  C5    . C   A 1 61 ? 45.057 14.354  49.881  1.00 10.00 ? 61  C   A C5    1 
ATOM   1334 C  C6    . C   A 1 61 ? 45.314 13.168  50.479  1.00 10.00 ? 61  C   A C6    1 
ATOM   1335 P  P     . A   A 1 62 ? 43.252 11.175  55.779  1.00 10.00 ? 62  A   A P     1 
ATOM   1336 O  OP1   . A   A 1 62 ? 42.757 10.173  56.754  1.00 10.00 ? 62  A   A OP1   1 
ATOM   1337 O  OP2   . A   A 1 62 ? 42.249 12.171  55.320  1.00 10.00 ? 62  A   A OP2   1 
ATOM   1338 O  "O5'" . A   A 1 62 ? 44.523 11.940  56.371  1.00 10.00 ? 62  A   A "O5'" 1 
ATOM   1339 C  "C5'" . A   A 1 62 ? 45.248 11.341  57.472  1.00 10.00 ? 62  A   A "C5'" 1 
ATOM   1340 C  "C4'" . A   A 1 62 ? 46.086 12.457  58.098  1.00 10.00 ? 62  A   A "C4'" 1 
ATOM   1341 O  "O4'" . A   A 1 62 ? 46.720 13.172  57.017  1.00 10.00 ? 62  A   A "O4'" 1 
ATOM   1342 C  "C3'" . A   A 1 62 ? 45.309 13.527  58.846  1.00 10.00 ? 62  A   A "C3'" 1 
ATOM   1343 O  "O3'" . A   A 1 62 ? 45.027 13.135  60.185  1.00 10.00 ? 62  A   A "O3'" 1 
ATOM   1344 C  "C2'" . A   A 1 62 ? 46.241 14.728  58.749  1.00 10.00 ? 62  A   A "C2'" 1 
ATOM   1345 O  "O2'" . A   A 1 62 ? 47.320 14.601  59.663  1.00 10.00 ? 62  A   A "O2'" 1 
ATOM   1346 C  "C1'" . A   A 1 62 ? 46.828 14.558  57.344  1.00 10.00 ? 62  A   A "C1'" 1 
ATOM   1347 N  N9    . A   A 1 62 ? 46.122 15.342  56.304  1.00 10.00 ? 62  A   A N9    1 
ATOM   1348 C  C8    . A   A 1 62 ? 45.290 14.884  55.324  1.00 10.00 ? 62  A   A C8    1 
ATOM   1349 N  N7    . A   A 1 62 ? 44.829 15.823  54.553  1.00 10.00 ? 62  A   A N7    1 
ATOM   1350 C  C5    . A   A 1 62 ? 45.391 16.982  55.058  1.00 10.00 ? 62  A   A C5    1 
ATOM   1351 C  C6    . A   A 1 62 ? 45.297 18.335  54.684  1.00 10.00 ? 62  A   A C6    1 
ATOM   1352 N  N6    . A   A 1 62 ? 44.547 18.760  53.653  1.00 10.00 ? 62  A   A N6    1 
ATOM   1353 N  N1    . A   A 1 62 ? 45.992 19.229  55.402  1.00 10.00 ? 62  A   A N1    1 
ATOM   1354 C  C2    . A   A 1 62 ? 46.727 18.801  56.435  1.00 10.00 ? 62  A   A C2    1 
ATOM   1355 N  N3    . A   A 1 62 ? 46.897 17.566  56.879  1.00 10.00 ? 62  A   A N3    1 
ATOM   1356 C  C4    . A   A 1 62 ? 46.192 16.705  56.132  1.00 10.00 ? 62  A   A C4    1 
ATOM   1357 P  P     . C   A 1 63 ? 43.624 13.530  60.788  1.00 10.00 ? 63  C   A P     1 
ATOM   1358 O  OP1   . C   A 1 63 ? 43.439 12.783  62.058  1.00 10.00 ? 63  C   A OP1   1 
ATOM   1359 O  OP2   . C   A 1 63 ? 42.547 13.354  59.779  1.00 10.00 ? 63  C   A OP2   1 
ATOM   1360 O  "O5'" . C   A 1 63 ? 43.815 15.088  61.088  1.00 10.00 ? 63  C   A "O5'" 1 
ATOM   1361 C  "C5'" . C   A 1 63 ? 44.839 15.432  62.055  1.00 10.00 ? 63  C   A "C5'" 1 
ATOM   1362 C  "C4'" . C   A 1 63 ? 44.963 16.957  62.106  1.00 10.00 ? 63  C   A "C4'" 1 
ATOM   1363 O  "O4'" . C   A 1 63 ? 45.329 17.409  60.747  1.00 10.00 ? 63  C   A "O4'" 1 
ATOM   1364 C  "C3'" . C   A 1 63 ? 43.670 17.718  62.346  1.00 10.00 ? 63  C   A "C3'" 1 
ATOM   1365 O  "O3'" . C   A 1 63 ? 43.321 17.749  63.723  1.00 10.00 ? 63  C   A "O3'" 1 
ATOM   1366 C  "C2'" . C   A 1 63 ? 43.995 19.091  61.769  1.00 10.00 ? 63  C   A "C2'" 1 
ATOM   1367 O  "O2'" . C   A 1 63 ? 44.857 19.808  62.639  1.00 10.00 ? 63  C   A "O2'" 1 
ATOM   1368 C  "C1'" . C   A 1 63 ? 44.819 18.726  60.531  1.00 10.00 ? 63  C   A "C1'" 1 
ATOM   1369 N  N1    . C   A 1 63 ? 44.037 18.724  59.273  1.00 10.00 ? 63  C   A N1    1 
ATOM   1370 C  C2    . C   A 1 63 ? 43.888 19.928  58.597  1.00 10.00 ? 63  C   A C2    1 
ATOM   1371 O  O2    . C   A 1 63 ? 44.415 20.941  59.071  1.00 10.00 ? 63  C   A O2    1 
ATOM   1372 N  N3    . C   A 1 63 ? 43.179 19.952  57.435  1.00 10.00 ? 63  C   A N3    1 
ATOM   1373 C  C4    . C   A 1 63 ? 42.626 18.833  56.954  1.00 10.00 ? 63  C   A C4    1 
ATOM   1374 N  N4    . C   A 1 63 ? 41.950 18.900  55.822  1.00 10.00 ? 63  C   A N4    1 
ATOM   1375 C  C5    . C   A 1 63 ? 42.764 17.571  57.638  1.00 10.00 ? 63  C   A C5    1 
ATOM   1376 C  C6    . C   A 1 63 ? 43.475 17.573  58.786  1.00 10.00 ? 63  C   A C6    1 
ATOM   1377 P  P     . A   A 1 64 ? 41.790 18.084  64.031  1.00 10.00 ? 64  A   A P     1 
ATOM   1378 O  OP1   . A   A 1 64 ? 41.564 18.114  65.499  1.00 10.00 ? 64  A   A OP1   1 
ATOM   1379 O  OP2   . A   A 1 64 ? 40.924 17.147  63.271  1.00 10.00 ? 64  A   A OP2   1 
ATOM   1380 O  "O5'" . A   A 1 64 ? 41.643 19.554  63.419  1.00 10.00 ? 64  A   A "O5'" 1 
ATOM   1381 C  "C5'" . A   A 1 64 ? 41.845 20.641  64.326  1.00 10.00 ? 64  A   A "C5'" 1 
ATOM   1382 C  "C4'" . A   A 1 64 ? 41.769 22.003  63.630  1.00 10.00 ? 64  A   A "C4'" 1 
ATOM   1383 O  "O4'" . A   A 1 64 ? 42.348 21.878  62.274  1.00 10.00 ? 64  A   A "O4'" 1 
ATOM   1384 C  "C3'" . A   A 1 64 ? 40.370 22.511  63.326  1.00 10.00 ? 64  A   A "C3'" 1 
ATOM   1385 O  "O3'" . A   A 1 64 ? 39.750 23.078  64.474  1.00 10.00 ? 64  A   A "O3'" 1 
ATOM   1386 C  "C2'" . A   A 1 64 ? 40.631 23.522  62.215  1.00 10.00 ? 64  A   A "C2'" 1 
ATOM   1387 O  "O2'" . A   A 1 64 ? 41.212 24.706  62.741  1.00 10.00 ? 64  A   A "O2'" 1 
ATOM   1388 C  "C1'" . A   A 1 64 ? 41.720 22.818  61.400  1.00 10.00 ? 64  A   A "C1'" 1 
ATOM   1389 N  N9    . A   A 1 64 ? 41.204 22.088  60.222  1.00 10.00 ? 64  A   A N9    1 
ATOM   1390 C  C8    . A   A 1 64 ? 41.248 20.746  59.974  1.00 10.00 ? 64  A   A C8    1 
ATOM   1391 N  N7    . A   A 1 64 ? 40.715 20.408  58.838  1.00 10.00 ? 64  A   A N7    1 
ATOM   1392 C  C5    . A   A 1 64 ? 40.284 21.609  58.300  1.00 10.00 ? 64  A   A C5    1 
ATOM   1393 C  C6    . A   A 1 64 ? 39.629 21.939  57.100  1.00 10.00 ? 64  A   A C6    1 
ATOM   1394 N  N6    . A   A 1 64 ? 39.273 21.021  56.181  1.00 10.00 ? 64  A   A N6    1 
ATOM   1395 N  N1    . A   A 1 64 ? 39.354 23.232  56.876  1.00 10.00 ? 64  A   A N1    1 
ATOM   1396 C  C2    . A   A 1 64 ? 39.700 24.138  57.795  1.00 10.00 ? 64  A   A C2    1 
ATOM   1397 N  N3    . A   A 1 64 ? 40.317 23.955  58.951  1.00 10.00 ? 64  A   A N3    1 
ATOM   1398 C  C4    . A   A 1 64 ? 40.580 22.651  59.131  1.00 10.00 ? 64  A   A C4    1 
ATOM   1399 P  P     . G   A 1 65 ? 38.204 22.696  64.677  1.00 10.00 ? 65  G   A P     1 
ATOM   1400 O  OP1   . G   A 1 65 ? 37.723 23.198  65.988  1.00 10.00 ? 65  G   A OP1   1 
ATOM   1401 O  OP2   . G   A 1 65 ? 38.019 21.240  64.445  1.00 10.00 ? 65  G   A OP2   1 
ATOM   1402 O  "O5'" . G   A 1 65 ? 37.518 23.515  63.488  1.00 10.00 ? 65  G   A "O5'" 1 
ATOM   1403 C  "C5'" . G   A 1 65 ? 37.044 24.835  63.780  1.00 10.00 ? 65  G   A "C5'" 1 
ATOM   1404 C  "C4'" . G   A 1 65 ? 36.903 25.683  62.515  1.00 10.00 ? 65  G   A "C4'" 1 
ATOM   1405 O  "O4'" . G   A 1 65 ? 37.747 25.146  61.440  1.00 10.00 ? 65  G   A "O4'" 1 
ATOM   1406 C  "C3'" . G   A 1 65 ? 35.517 25.718  61.890  1.00 10.00 ? 65  G   A "C3'" 1 
ATOM   1407 O  "O3'" . G   A 1 65 ? 34.653 26.620  62.570  1.00 10.00 ? 65  G   A "O3'" 1 
ATOM   1408 C  "C2'" . G   A 1 65 ? 35.820 26.132  60.457  1.00 10.00 ? 65  G   A "C2'" 1 
ATOM   1409 O  "O2'" . G   A 1 65 ? 36.134 27.516  60.390  1.00 10.00 ? 65  G   A "O2'" 1 
ATOM   1410 C  "C1'" . G   A 1 65 ? 37.119 25.370  60.177  1.00 10.00 ? 65  G   A "C1'" 1 
ATOM   1411 N  N9    . G   A 1 65 ? 36.911 24.059  59.522  1.00 10.00 ? 65  G   A N9    1 
ATOM   1412 C  C8    . G   A 1 65 ? 37.164 22.790  60.001  1.00 10.00 ? 65  G   A C8    1 
ATOM   1413 N  N7    . G   A 1 65 ? 36.871 21.830  59.159  1.00 10.00 ? 65  G   A N7    1 
ATOM   1414 C  C5    . G   A 1 65 ? 36.391 22.509  58.036  1.00 10.00 ? 65  G   A C5    1 
ATOM   1415 C  C6    . G   A 1 65 ? 35.915 22.002  56.804  1.00 10.00 ? 65  G   A C6    1 
ATOM   1416 O  O6    . G   A 1 65 ? 35.823 20.831  56.428  1.00 10.00 ? 65  G   A O6    1 
ATOM   1417 N  N1    . G   A 1 65 ? 35.520 23.042  55.943  1.00 10.00 ? 65  G   A N1    1 
ATOM   1418 C  C2    . G   A 1 65 ? 35.586 24.393  56.250  1.00 10.00 ? 65  G   A C2    1 
ATOM   1419 N  N2    . G   A 1 65 ? 35.160 25.215  55.288  1.00 10.00 ? 65  G   A N2    1 
ATOM   1420 N  N3    . G   A 1 65 ? 36.025 24.864  57.404  1.00 10.00 ? 65  G   A N3    1 
ATOM   1421 C  C4    . G   A 1 65 ? 36.411 23.864  58.245  1.00 10.00 ? 65  G   A C4    1 
ATOM   1422 P  P     . A   A 1 66 ? 33.267 26.005  63.093  1.00 10.00 ? 66  A   A P     1 
ATOM   1423 O  OP1   . A   A 1 66 ? 32.761 26.795  64.242  1.00 10.00 ? 66  A   A OP1   1 
ATOM   1424 O  OP2   . A   A 1 66 ? 33.423 24.548  63.337  1.00 10.00 ? 66  A   A OP2   1 
ATOM   1425 O  "O5'" . A   A 1 66 ? 32.333 26.229  61.818  1.00 10.00 ? 66  A   A "O5'" 1 
ATOM   1426 C  "C5'" . A   A 1 66 ? 32.323 27.563  61.278  1.00 10.00 ? 66  A   A "C5'" 1 
ATOM   1427 C  "C4'" . A   A 1 66 ? 32.006 27.569  59.781  1.00 10.00 ? 66  A   A "C4'" 1 
ATOM   1428 O  "O4'" . A   A 1 66 ? 33.008 26.736  59.086  1.00 10.00 ? 66  A   A "O4'" 1 
ATOM   1429 C  "C3'" . A   A 1 66 ? 30.703 26.898  59.382  1.00 10.00 ? 66  A   A "C3'" 1 
ATOM   1430 O  "O3'" . A   A 1 66 ? 29.582 27.745  59.596  1.00 10.00 ? 66  A   A "O3'" 1 
ATOM   1431 C  "C2'" . A   A 1 66 ? 30.947 26.578  57.911  1.00 10.00 ? 66  A   A "C2'" 1 
ATOM   1432 O  "O2'" . A   A 1 66 ? 30.865 27.755  57.121  1.00 10.00 ? 66  A   A "O2'" 1 
ATOM   1433 C  "C1'" . A   A 1 66 ? 32.419 26.154  57.923  1.00 10.00 ? 66  A   A "C1'" 1 
ATOM   1434 N  N9    . A   A 1 66 ? 32.617 24.687  57.984  1.00 10.00 ? 66  A   A N9    1 
ATOM   1435 C  C8    . A   A 1 66 ? 33.157 23.949  58.999  1.00 10.00 ? 66  A   A C8    1 
ATOM   1436 N  N7    . A   A 1 66 ? 33.204 22.675  58.748  1.00 10.00 ? 66  A   A N7    1 
ATOM   1437 C  C5    . A   A 1 66 ? 32.652 22.561  57.485  1.00 10.00 ? 66  A   A C5    1 
ATOM   1438 C  C6    . A   A 1 66 ? 32.410 21.461  56.642  1.00 10.00 ? 66  A   A C6    1 
ATOM   1439 N  N6    . A   A 1 66 ? 32.711 20.193  56.983  1.00 10.00 ? 66  A   A N6    1 
ATOM   1440 N  N1    . A   A 1 66 ? 31.852 21.704  55.447  1.00 10.00 ? 66  A   A N1    1 
ATOM   1441 C  C2    . A   A 1 66 ? 31.546 22.962  55.118  1.00 10.00 ? 66  A   A C2    1 
ATOM   1442 N  N3    . A   A 1 66 ? 31.726 24.074  55.815  1.00 10.00 ? 66  A   A N3    1 
ATOM   1443 C  C4    . A   A 1 66 ? 32.291 23.786  56.998  1.00 10.00 ? 66  A   A C4    1 
ATOM   1444 P  P     . A   A 1 67 ? 28.412 27.018  60.434  1.00 10.00 ? 67  A   A P     1 
ATOM   1445 O  OP1   . A   A 1 67 ? 27.595 28.044  61.128  1.00 10.00 ? 67  A   A OP1   1 
ATOM   1446 O  OP2   . A   A 1 67 ? 28.970 25.949  61.302  1.00 10.00 ? 67  A   A OP2   1 
ATOM   1447 O  "O5'" . A   A 1 67 ? 27.571 26.352  59.253  1.00 10.00 ? 67  A   A "O5'" 1 
ATOM   1448 C  "C5'" . A   A 1 67 ? 26.894 27.300  58.375  1.00 10.00 ? 67  A   A "C5'" 1 
ATOM   1449 C  "C4'" . A   A 1 67 ? 26.675 26.673  56.997  1.00 10.00 ? 67  A   A "C4'" 1 
ATOM   1450 O  "O4'" . A   A 1 67 ? 27.957 26.021  56.582  1.00 10.00 ? 67  A   A "O4'" 1 
ATOM   1451 C  "C3'" . A   A 1 67 ? 25.660 25.542  56.941  1.00 10.00 ? 67  A   A "C3'" 1 
ATOM   1452 O  "O3'" . A   A 1 67 ? 24.333 26.027  56.808  1.00 10.00 ? 67  A   A "O3'" 1 
ATOM   1453 C  "C2'" . A   A 1 67 ? 26.139 24.742  55.736  1.00 10.00 ? 67  A   A "C2'" 1 
ATOM   1454 O  "O2'" . A   A 1 67 ? 25.835 25.426  54.529  1.00 10.00 ? 67  A   A "O2'" 1 
ATOM   1455 C  "C1'" . A   A 1 67 ? 27.661 24.799  55.906  1.00 10.00 ? 67  A   A "C1'" 1 
ATOM   1456 N  N9    . A   A 1 67 ? 28.214 23.677  56.699  1.00 10.00 ? 67  A   A N9    1 
ATOM   1457 C  C8    . A   A 1 67 ? 28.779 23.721  57.940  1.00 10.00 ? 67  A   A C8    1 
ATOM   1458 N  N7    . A   A 1 67 ? 29.182 22.562  58.371  1.00 10.00 ? 67  A   A N7    1 
ATOM   1459 C  C5    . A   A 1 67 ? 28.856 21.691  57.347  1.00 10.00 ? 67  A   A C5    1 
ATOM   1460 C  C6    . A   A 1 67 ? 29.019 20.303  57.183  1.00 10.00 ? 67  A   A C6    1 
ATOM   1461 N  N6    . A   A 1 67 ? 29.582 19.513  58.116  1.00 10.00 ? 67  A   A N6    1 
ATOM   1462 N  N1    . A   A 1 67 ? 28.587 19.760  56.034  1.00 10.00 ? 67  A   A N1    1 
ATOM   1463 C  C2    . A   A 1 67 ? 28.018 20.546  55.116  1.00 10.00 ? 67  A   A C2    1 
ATOM   1464 N  N3    . A   A 1 67 ? 27.814 21.854  55.152  1.00 10.00 ? 67  A   A N3    1 
ATOM   1465 C  C4    . A   A 1 67 ? 28.266 22.359  56.310  1.00 10.00 ? 67  A   A C4    1 
ATOM   1466 P  P     . U   A 1 68 ? 23.362 25.599  58.033  1.00 10.00 ? 68  U   A P     1 
ATOM   1467 O  OP1   . U   A 1 68 ? 22.445 26.734  58.304  1.00 10.00 ? 68  U   A OP1   1 
ATOM   1468 O  OP2   . U   A 1 68 ? 24.145 25.117  59.199  1.00 10.00 ? 68  U   A OP2   1 
ATOM   1469 O  "O5'" . U   A 1 68 ? 22.552 24.377  57.400  1.00 10.00 ? 68  U   A "O5'" 1 
ATOM   1470 C  "C5'" . U   A 1 68 ? 22.296 24.418  55.973  1.00 10.00 ? 68  U   A "C5'" 1 
ATOM   1471 C  "C4'" . U   A 1 68 ? 22.218 22.989  55.433  1.00 10.00 ? 68  U   A "C4'" 1 
ATOM   1472 O  "O4'" . U   A 1 68 ? 23.614 22.417  55.493  1.00 10.00 ? 68  U   A "O4'" 1 
ATOM   1473 C  "C3'" . U   A 1 68 ? 21.502 21.984  56.320  1.00 10.00 ? 68  U   A "C3'" 1 
ATOM   1474 O  "O3'" . U   A 1 68 ? 20.089 22.096  56.216  1.00 10.00 ? 68  U   A "O3'" 1 
ATOM   1475 C  "C2'" . U   A 1 68 ? 22.044 20.657  55.803  1.00 10.00 ? 68  U   A "C2'" 1 
ATOM   1476 O  "O2'" . U   A 1 68 ? 21.481 20.345  54.537  1.00 10.00 ? 68  U   A "O2'" 1 
ATOM   1477 C  "C1'" . U   A 1 68 ? 23.519 20.993  55.563  1.00 10.00 ? 68  U   A "C1'" 1 
ATOM   1478 N  N1    . U   A 1 68 ? 24.421 20.515  56.633  1.00 10.00 ? 68  U   A N1    1 
ATOM   1479 C  C2    . U   A 1 68 ? 24.714 19.173  56.660  1.00 10.00 ? 68  U   A C2    1 
ATOM   1480 O  O2    . U   A 1 68 ? 24.259 18.375  55.856  1.00 10.00 ? 68  U   A O2    1 
ATOM   1481 N  N3    . U   A 1 68 ? 25.558 18.767  57.668  1.00 10.00 ? 68  U   A N3    1 
ATOM   1482 C  C4    . U   A 1 68 ? 26.128 19.575  58.639  1.00 10.00 ? 68  U   A C4    1 
ATOM   1483 O  O4    . U   A 1 68 ? 26.878 19.094  59.489  1.00 10.00 ? 68  U   A O4    1 
ATOM   1484 C  C5    . U   A 1 68 ? 25.766 20.968  58.530  1.00 10.00 ? 68  U   A C5    1 
ATOM   1485 C  C6    . U   A 1 68 ? 24.949 21.393  57.553  1.00 10.00 ? 68  U   A C6    1 
ATOM   1486 P  P     . U   A 1 69 ? 19.230 21.400  57.380  1.00 10.00 ? 69  U   A P     1 
ATOM   1487 O  OP1   . U   A 1 69 ? 17.799 21.352  56.989  1.00 10.00 ? 69  U   A OP1   1 
ATOM   1488 O  OP2   . U   A 1 69 ? 19.516 22.073  58.673  1.00 10.00 ? 69  U   A OP2   1 
ATOM   1489 O  "O5'" . U   A 1 69 ? 19.843 19.926  57.404  1.00 10.00 ? 69  U   A "O5'" 1 
ATOM   1490 C  "C5'" . U   A 1 69 ? 19.391 18.985  56.423  1.00 10.00 ? 69  U   A "C5'" 1 
ATOM   1491 C  "C4'" . U   A 1 69 ? 19.766 17.556  56.824  1.00 10.00 ? 69  U   A "C4'" 1 
ATOM   1492 O  "O4'" . U   A 1 69 ? 21.193 17.400  56.845  1.00 10.00 ? 69  U   A "O4'" 1 
ATOM   1493 C  "C3'" . U   A 1 69 ? 19.316 17.119  58.208  1.00 10.00 ? 69  U   A "C3'" 1 
ATOM   1494 O  "O3'" . U   A 1 69 ? 17.948 16.734  58.224  1.00 10.00 ? 69  U   A "O3'" 1 
ATOM   1495 C  "C2'" . U   A 1 69 ? 20.272 15.969  58.509  1.00 10.00 ? 69  U   A "C2'" 1 
ATOM   1496 O  "O2'" . U   A 1 69 ? 19.880 14.796  57.812  1.00 10.00 ? 69  U   A "O2'" 1 
ATOM   1497 C  "C1'" . U   A 1 69 ? 21.567 16.462  57.853  1.00 10.00 ? 69  U   A "C1'" 1 
ATOM   1498 N  N1    . U   A 1 69 ? 22.491 17.134  58.795  1.00 10.00 ? 69  U   A N1    1 
ATOM   1499 C  C2    . U   A 1 69 ? 23.322 16.333  59.543  1.00 10.00 ? 69  U   A C2    1 
ATOM   1500 O  O2    . U   A 1 69 ? 23.320 15.115  59.469  1.00 10.00 ? 69  U   A O2    1 
ATOM   1501 N  N3    . U   A 1 69 ? 24.168 16.995  60.402  1.00 10.00 ? 69  U   A N3    1 
ATOM   1502 C  C4    . U   A 1 69 ? 24.256 18.367  60.581  1.00 10.00 ? 69  U   A C4    1 
ATOM   1503 O  O4    . U   A 1 69 ? 25.061 18.842  61.377  1.00 10.00 ? 69  U   A O4    1 
ATOM   1504 C  C5    . U   A 1 69 ? 23.348 19.125  59.753  1.00 10.00 ? 69  U   A C5    1 
ATOM   1505 C  C6    . U   A 1 69 ? 22.516 18.506  58.900  1.00 10.00 ? 69  U   A C6    1 
ATOM   1506 P  P     . C   A 1 70 ? 17.211 16.055  59.444  1.00 10.00 ? 70  C   A P     1 
ATOM   1507 O  OP1   . C   A 1 70 ? 15.886 15.577  58.974  1.00 10.00 ? 70  C   A OP1   1 
ATOM   1508 O  OP2   . C   A 1 70 ? 17.180 16.989  60.599  1.00 10.00 ? 70  C   A OP2   1 
ATOM   1509 O  "O5'" . C   A 1 70 ? 18.153 14.814  59.792  1.00 10.00 ? 70  C   A "O5'" 1 
ATOM   1510 C  "C5'" . C   A 1 70 ? 17.517 13.521  59.849  1.00 10.00 ? 70  C   A "C5'" 1 
ATOM   1511 C  "C4'" . C   A 1 70 ? 18.420 12.451  60.465  1.00 10.00 ? 70  C   A "C4'" 1 
ATOM   1512 O  "O4'" . C   A 1 70 ? 19.827 12.802  60.240  1.00 10.00 ? 70  C   A "O4'" 1 
ATOM   1513 C  "C3'" . C   A 1 70 ? 18.337 12.306  61.973  1.00 10.00 ? 70  C   A "C3'" 1 
ATOM   1514 O  "O3'" . C   A 1 70 ? 17.202 11.550  62.374  1.00 10.00 ? 70  C   A "O3'" 1 
ATOM   1515 C  "C2'" . C   A 1 70 ? 19.662 11.628  62.304  1.00 10.00 ? 70  C   A "C2'" 1 
ATOM   1516 O  "O2'" . C   A 1 70 ? 19.626 10.255  61.942  1.00 10.00 ? 70  C   A "O2'" 1 
ATOM   1517 C  "C1'" . C   A 1 70 ? 20.619 12.321  61.326  1.00 10.00 ? 70  C   A "C1'" 1 
ATOM   1518 N  N1    . C   A 1 70 ? 21.347 13.466  61.916  1.00 10.00 ? 70  C   A N1    1 
ATOM   1519 C  C2    . C   A 1 70 ? 22.418 13.192  62.758  1.00 10.00 ? 70  C   A C2    1 
ATOM   1520 O  O2    . C   A 1 70 ? 22.715 12.011  62.973  1.00 10.00 ? 70  C   A O2    1 
ATOM   1521 N  N3    . C   A 1 70 ? 23.109 14.230  63.308  1.00 10.00 ? 70  C   A N3    1 
ATOM   1522 C  C4    . C   A 1 70 ? 22.759 15.494  63.049  1.00 10.00 ? 70  C   A C4    1 
ATOM   1523 N  N4    . C   A 1 70 ? 23.458 16.469  63.601  1.00 10.00 ? 70  C   A N4    1 
ATOM   1524 C  C5    . C   A 1 70 ? 21.651 15.804  62.183  1.00 10.00 ? 70  C   A C5    1 
ATOM   1525 C  C6    . C   A 1 70 ? 20.983 14.758  61.645  1.00 10.00 ? 70  C   A C6    1 
ATOM   1526 P  P     . G   A 1 71 ? 16.526 11.938  63.773  1.00 10.00 ? 71  G   A P     1 
ATOM   1527 O  OP1   . G   A 1 71 ? 15.191 11.296  63.881  1.00 10.00 ? 71  G   A OP1   1 
ATOM   1528 O  OP2   . G   A 1 71 ? 16.540 13.414  63.933  1.00 10.00 ? 71  G   A OP2   1 
ATOM   1529 O  "O5'" . G   A 1 71 ? 17.538 11.282  64.821  1.00 10.00 ? 71  G   A "O5'" 1 
ATOM   1530 C  "C5'" . G   A 1 71 ? 17.558 9.851   64.946  1.00 10.00 ? 71  G   A "C5'" 1 
ATOM   1531 C  "C4'" . G   A 1 71 ? 18.674 9.413   65.897  1.00 10.00 ? 71  G   A "C4'" 1 
ATOM   1532 O  "O4'" . G   A 1 71 ? 19.959 9.876   65.280  1.00 10.00 ? 71  G   A "O4'" 1 
ATOM   1533 C  "C3'" . G   A 1 71 ? 18.684 10.089  67.257  1.00 10.00 ? 71  G   A "C3'" 1 
ATOM   1534 O  "O3'" . G   A 1 71 ? 17.818 9.440   68.180  1.00 10.00 ? 71  G   A "O3'" 1 
ATOM   1535 C  "C2'" . G   A 1 71 ? 20.155 10.004  67.646  1.00 10.00 ? 71  G   A "C2'" 1 
ATOM   1536 O  "O2'" . G   A 1 71 ? 20.501 8.675   68.004  1.00 10.00 ? 71  G   A "O2'" 1 
ATOM   1537 C  "C1'" . G   A 1 71 ? 20.849 10.300  66.313  1.00 10.00 ? 71  G   A "C1'" 1 
ATOM   1538 N  N9    . G   A 1 71 ? 21.157 11.734  66.104  1.00 10.00 ? 71  G   A N9    1 
ATOM   1539 C  C8    . G   A 1 71 ? 20.579 12.638  65.235  1.00 10.00 ? 71  G   A C8    1 
ATOM   1540 N  N7    . G   A 1 71 ? 21.092 13.842  65.296  1.00 10.00 ? 71  G   A N7    1 
ATOM   1541 C  C5    . G   A 1 71 ? 22.083 13.733  66.271  1.00 10.00 ? 71  G   A C5    1 
ATOM   1542 C  C6    . G   A 1 71 ? 22.972 14.713  66.775  1.00 10.00 ? 71  G   A C6    1 
ATOM   1543 O  O6    . G   A 1 71 ? 23.085 15.898  66.457  1.00 10.00 ? 71  G   A O6    1 
ATOM   1544 N  N1    . G   A 1 71 ? 23.814 14.175  67.765  1.00 10.00 ? 71  G   A N1    1 
ATOM   1545 C  C2    . G   A 1 71 ? 23.789 12.857  68.199  1.00 10.00 ? 71  G   A C2    1 
ATOM   1546 N  N2    . G   A 1 71 ? 24.676 12.554  69.150  1.00 10.00 ? 71  G   A N2    1 
ATOM   1547 N  N3    . G   A 1 71 ? 22.952 11.946  67.730  1.00 10.00 ? 71  G   A N3    1 
ATOM   1548 C  C4    . G   A 1 71 ? 22.133 12.457  66.771  1.00 10.00 ? 71  G   A C4    1 
ATOM   1549 P  P     . C   A 1 72 ? 16.904 10.417  69.112  1.00 10.00 ? 72  C   A P     1 
ATOM   1550 O  OP1   . C   A 1 72 ? 15.748 9.662   69.656  1.00 10.00 ? 72  C   A OP1   1 
ATOM   1551 O  OP2   . C   A 1 72 ? 16.565 11.657  68.366  1.00 10.00 ? 72  C   A OP2   1 
ATOM   1552 O  "O5'" . C   A 1 72 ? 17.932 10.770  70.282  1.00 10.00 ? 72  C   A "O5'" 1 
ATOM   1553 C  "C5'" . C   A 1 72 ? 18.798 9.634   70.643  1.00 10.00 ? 72  C   A "C5'" 1 
ATOM   1554 C  "C4'" . C   A 1 72 ? 20.057 10.075  71.391  1.00 10.00 ? 72  C   A "C4'" 1 
ATOM   1555 O  "O4'" . C   A 1 72 ? 20.936 10.849  70.470  1.00 10.00 ? 72  C   A "O4'" 1 
ATOM   1556 C  "C3'" . C   A 1 72 ? 19.841 11.075  72.515  1.00 10.00 ? 72  C   A "C3'" 1 
ATOM   1557 O  "O3'" . C   A 1 72 ? 19.352 10.451  73.696  1.00 10.00 ? 72  C   A "O3'" 1 
ATOM   1558 C  "C2'" . C   A 1 72 ? 21.231 11.677  72.678  1.00 10.00 ? 72  C   A "C2'" 1 
ATOM   1559 O  "O2'" . C   A 1 72 ? 22.103 10.756  73.319  1.00 10.00 ? 72  C   A "O2'" 1 
ATOM   1560 C  "C1'" . C   A 1 72 ? 21.696 11.794  71.223  1.00 10.00 ? 72  C   A "C1'" 1 
ATOM   1561 N  N1    . C   A 1 72 ? 21.488 13.137  70.636  1.00 10.00 ? 72  C   A N1    1 
ATOM   1562 C  C2    . C   A 1 72 ? 22.369 14.149  70.997  1.00 10.00 ? 72  C   A C2    1 
ATOM   1563 O  O2    . C   A 1 72 ? 23.283 13.883  71.784  1.00 10.00 ? 72  C   A O2    1 
ATOM   1564 N  N3    . C   A 1 72 ? 22.204 15.393  70.464  1.00 10.00 ? 72  C   A N3    1 
ATOM   1565 C  C4    . C   A 1 72 ? 21.203 15.639  69.613  1.00 10.00 ? 72  C   A C4    1 
ATOM   1566 N  N4    . C   A 1 72 ? 21.083 16.858  69.116  1.00 10.00 ? 72  C   A N4    1 
ATOM   1567 C  C5    . C   A 1 72 ? 20.276 14.608  69.223  1.00 10.00 ? 72  C   A C5    1 
ATOM   1568 C  C6    . C   A 1 72 ? 20.462 13.381  69.761  1.00 10.00 ? 72  C   A C6    1 
ATOM   1569 P  P     . A   A 1 73 ? 18.340 11.300  74.611  1.00 10.00 ? 73  A   A P     1 
ATOM   1570 O  OP1   . A   A 1 73 ? 18.038 10.533  75.846  1.00 10.00 ? 73  A   A OP1   1 
ATOM   1571 O  OP2   . A   A 1 73 ? 17.160 11.718  73.813  1.00 10.00 ? 73  A   A OP2   1 
ATOM   1572 O  "O5'" . A   A 1 73 ? 19.221 12.585  74.962  1.00 10.00 ? 73  A   A "O5'" 1 
ATOM   1573 C  "C5'" . A   A 1 73 ? 20.350 12.379  75.841  1.00 10.00 ? 73  A   A "C5'" 1 
ATOM   1574 C  "C4'" . A   A 1 73 ? 20.978 13.730  76.186  1.00 10.00 ? 73  A   A "C4'" 1 
ATOM   1575 O  "O4'" . A   A 1 73 ? 21.630 14.250  74.989  1.00 10.00 ? 73  A   A "O4'" 1 
ATOM   1576 C  "C3'" . A   A 1 73 ? 20.004 14.828  76.581  1.00 10.00 ? 73  A   A "C3'" 1 
ATOM   1577 O  "O3'" . A   A 1 73 ? 19.639 14.745  77.953  1.00 10.00 ? 73  A   A "O3'" 1 
ATOM   1578 C  "C2'" . A   A 1 73 ? 20.787 16.089  76.239  1.00 10.00 ? 73  A   A "C2'" 1 
ATOM   1579 O  "O2'" . A   A 1 73 ? 21.791 16.337  77.209  1.00 10.00 ? 73  A   A "O2'" 1 
ATOM   1580 C  "C1'" . A   A 1 73 ? 21.507 15.672  74.952  1.00 10.00 ? 73  A   A "C1'" 1 
ATOM   1581 N  N9    . A   A 1 73 ? 20.786 16.046  73.715  1.00 10.00 ? 73  A   A N9    1 
ATOM   1582 C  C8    . A   A 1 73 ? 20.070 15.239  72.879  1.00 10.00 ? 73  A   A C8    1 
ATOM   1583 N  N7    . A   A 1 73 ? 19.557 15.864  71.863  1.00 10.00 ? 73  A   A N7    1 
ATOM   1584 C  C5    . A   A 1 73 ? 19.956 17.178  72.041  1.00 10.00 ? 73  A   A C5    1 
ATOM   1585 C  C6    . A   A 1 73 ? 19.736 18.354  71.300  1.00 10.00 ? 73  A   A C6    1 
ATOM   1586 N  N6    . A   A 1 73 ? 19.008 18.383  70.169  1.00 10.00 ? 73  A   A N6    1 
ATOM   1587 N  N1    . A   A 1 73 ? 20.282 19.490  71.759  1.00 10.00 ? 73  A   A N1    1 
ATOM   1588 C  C2    . A   A 1 73 ? 20.994 19.456  72.888  1.00 10.00 ? 73  A   A C2    1 
ATOM   1589 N  N3    . A   A 1 73 ? 21.273 18.421  73.667  1.00 10.00 ? 73  A   A N3    1 
ATOM   1590 C  C4    . A   A 1 73 ? 20.714 17.308  73.169  1.00 10.00 ? 73  A   A C4    1 
ATOM   1591 P  P     . C   A 1 74 ? 18.383 15.578  78.476  1.00 10.00 ? 74  C   A P     1 
ATOM   1592 O  OP1   . C   A 1 74 ? 18.336 15.494  79.956  1.00 10.00 ? 74  C   A OP1   1 
ATOM   1593 O  OP2   . C   A 1 74 ? 17.151 15.140  77.772  1.00 10.00 ? 74  C   A OP2   1 
ATOM   1594 O  "O5'" . C   A 1 74 ? 18.753 17.063  78.020  1.00 10.00 ? 74  C   A "O5'" 1 
ATOM   1595 C  "C5'" . C   A 1 74 ? 19.388 17.915  79.004  1.00 10.00 ? 74  C   A "C5'" 1 
ATOM   1596 C  "C4'" . C   A 1 74 ? 19.587 19.313  78.415  1.00 10.00 ? 74  C   A "C4'" 1 
ATOM   1597 O  "O4'" . C   A 1 74 ? 19.896 19.177  77.005  1.00 10.00 ? 74  C   A "O4'" 1 
ATOM   1598 C  "C3'" . C   A 1 74 ? 18.373 20.225  78.453  1.00 10.00 ? 74  C   A "C3'" 1 
ATOM   1599 O  "O3'" . C   A 1 74 ? 18.238 20.877  79.707  1.00 10.00 ? 74  C   A "O3'" 1 
ATOM   1600 C  "C2'" . C   A 1 74 ? 18.653 21.182  77.299  1.00 10.00 ? 74  C   A "C2'" 1 
ATOM   1601 O  "O2'" . C   A 1 74 ? 19.632 22.141  77.669  1.00 10.00 ? 74  C   A "O2'" 1 
ATOM   1602 C  "C1'" . C   A 1 74 ? 19.309 20.252  76.274  1.00 10.00 ? 74  C   A "C1'" 1 
ATOM   1603 N  N1    . C   A 1 74 ? 18.360 19.686  75.291  1.00 10.00 ? 74  C   A N1    1 
ATOM   1604 C  C2    . C   A 1 74 ? 17.805 20.545  74.351  1.00 10.00 ? 74  C   A C2    1 
ATOM   1605 O  O2    . C   A 1 74 ? 18.130 21.739  74.375  1.00 10.00 ? 74  C   A O2    1 
ATOM   1606 N  N3    . C   A 1 74 ? 16.933 20.048  73.429  1.00 10.00 ? 74  C   A N3    1 
ATOM   1607 C  C4    . C   A 1 74 ? 16.609 18.750  73.435  1.00 10.00 ? 74  C   A C4    1 
ATOM   1608 N  N4    . C   A 1 74 ? 15.763 18.308  72.521  1.00 10.00 ? 74  C   A N4    1 
ATOM   1609 C  C5    . C   A 1 74 ? 17.169 17.837  74.400  1.00 10.00 ? 74  C   A C5    1 
ATOM   1610 C  C6    . C   A 1 74 ? 18.033 18.355  75.299  1.00 10.00 ? 74  C   A C6    1 
ATOM   1611 P  P     . C   A 1 75 ? 17.091 20.406  80.706  1.00 10.00 ? 75  C   A P     1 
ATOM   1612 O  OP1   . C   A 1 75 ? 17.253 21.098  82.010  1.00 10.00 ? 75  C   A OP1   1 
ATOM   1613 O  OP2   . C   A 1 75 ? 17.055 18.923  80.772  1.00 10.00 ? 75  C   A OP2   1 
ATOM   1614 O  "O5'" . C   A 1 75 ? 15.780 20.934  79.963  1.00 10.00 ? 75  C   A "O5'" 1 
ATOM   1615 C  "C5'" . C   A 1 75 ? 15.294 22.231  80.318  1.00 10.00 ? 75  C   A "C5'" 1 
ATOM   1616 C  "C4'" . C   A 1 75 ? 14.587 22.922  79.167  1.00 10.00 ? 75  C   A "C4'" 1 
ATOM   1617 O  "O4'" . C   A 1 75 ? 15.092 22.494  77.888  1.00 10.00 ? 75  C   A "O4'" 1 
ATOM   1618 C  "C3'" . C   A 1 75 ? 13.112 22.501  79.083  1.00 10.00 ? 75  C   A "C3'" 1 
ATOM   1619 O  "O3'" . C   A 1 75 ? 12.275 23.270  79.958  1.00 10.00 ? 75  C   A "O3'" 1 
ATOM   1620 C  "C2'" . C   A 1 75 ? 12.821 22.778  77.602  1.00 10.00 ? 75  C   A "C2'" 1 
ATOM   1621 O  "O2'" . C   A 1 75 ? 12.522 24.129  77.270  1.00 10.00 ? 75  C   A "O2'" 1 
ATOM   1622 C  "C1'" . C   A 1 75 ? 14.068 22.256  76.934  1.00 10.00 ? 75  C   A "C1'" 1 
ATOM   1623 N  N1    . C   A 1 75 ? 14.061 20.818  76.578  1.00 10.00 ? 75  C   A N1    1 
ATOM   1624 C  C2    . C   A 1 75 ? 13.310 20.443  75.481  1.00 10.00 ? 75  C   A C2    1 
ATOM   1625 O  O2    . C   A 1 75 ? 12.710 21.312  74.839  1.00 10.00 ? 75  C   A O2    1 
ATOM   1626 N  N3    . C   A 1 75 ? 13.275 19.126  75.133  1.00 10.00 ? 75  C   A N3    1 
ATOM   1627 C  C4    . C   A 1 75 ? 13.940 18.215  75.855  1.00 10.00 ? 75  C   A C4    1 
ATOM   1628 N  N4    . C   A 1 75 ? 13.882 16.950  75.479  1.00 10.00 ? 75  C   A N4    1 
ATOM   1629 C  C5    . C   A 1 75 ? 14.715 18.589  77.010  1.00 10.00 ? 75  C   A C5    1 
ATOM   1630 C  C6    . C   A 1 75 ? 14.737 19.903  77.331  1.00 10.00 ? 75  C   A C6    1 
ATOM   1631 P  P     . A   A 1 76 ? 12.368 23.028  81.529  1.00 10.00 ? 76  A   A P     1 
ATOM   1632 O  OP1   . A   A 1 76 ? 13.105 21.766  81.796  1.00 10.00 ? 76  A   A OP1   1 
ATOM   1633 O  OP2   . A   A 1 76 ? 11.010 23.110  82.122  1.00 10.00 ? 76  A   A OP2   1 
ATOM   1634 O  "O5'" . A   A 1 76 ? 13.232 24.282  82.010  1.00 10.00 ? 76  A   A "O5'" 1 
ATOM   1635 C  "C5'" . A   A 1 76 ? 14.605 24.067  82.378  1.00 10.00 ? 76  A   A "C5'" 1 
ATOM   1636 C  "C4'" . A   A 1 76 ? 15.295 25.409  82.630  1.00 10.00 ? 76  A   A "C4'" 1 
ATOM   1637 O  "O4'" . A   A 1 76 ? 14.326 26.295  83.259  1.00 10.00 ? 76  A   A "O4'" 1 
ATOM   1638 C  "C3'" . A   A 1 76 ? 16.508 25.366  83.544  1.00 10.00 ? 76  A   A "C3'" 1 
ATOM   1639 O  "O3'" . A   A 1 76 ? 17.708 25.122  82.823  1.00 10.00 ? 76  A   A "O3'" 1 
ATOM   1640 C  "C2'" . A   A 1 76 ? 16.464 26.741  84.198  1.00 10.00 ? 76  A   A "C2'" 1 
ATOM   1641 O  "O2'" . A   A 1 76 ? 16.944 27.737  83.305  1.00 10.00 ? 76  A   A "O2'" 1 
ATOM   1642 C  "C1'" . A   A 1 76 ? 14.956 26.970  84.347  1.00 10.00 ? 76  A   A "C1'" 1 
ATOM   1643 N  N9    . A   A 1 76 ? 14.396 26.441  85.611  1.00 10.00 ? 76  A   A N9    1 
ATOM   1644 C  C8    . A   A 1 76 ? 14.709 26.805  86.889  1.00 10.00 ? 76  A   A C8    1 
ATOM   1645 N  N7    . A   A 1 76 ? 14.049 26.149  87.796  1.00 10.00 ? 76  A   A N7    1 
ATOM   1646 C  C5    . A   A 1 76 ? 13.240 25.294  87.068  1.00 10.00 ? 76  A   A C5    1 
ATOM   1647 C  C6    . A   A 1 76 ? 12.290 24.325  87.442  1.00 10.00 ? 76  A   A C6    1 
ATOM   1648 N  N6    . A   A 1 76 ? 11.982 24.054  88.723  1.00 10.00 ? 76  A   A N6    1 
ATOM   1649 N  N1    . A   A 1 76 ? 11.672 23.650  86.461  1.00 10.00 ? 76  A   A N1    1 
ATOM   1650 C  C2    . A   A 1 76 ? 11.974 23.931  85.191  1.00 10.00 ? 76  A   A C2    1 
ATOM   1651 N  N3    . A   A 1 76 ? 12.844 24.810  84.713  1.00 10.00 ? 76  A   A N3    1 
ATOM   1652 C  C4    . A   A 1 76 ? 13.444 25.456  85.726  1.00 10.00 ? 76  A   A C4    1 
HETATM 1653 MG MG    . MG  B 2 .  ? 43.002 9.395   38.752  1.00 10.00 ? 77  MG  A MG    1 
HETATM 1654 MG MG    . MG  C 2 .  ? 45.502 18.625  34.709  1.00 10.00 ? 78  MG  A MG    1 
HETATM 1655 MG MG    . MG  D 2 .  ? 24.852 20.464  44.245  1.00 10.00 ? 79  MG  A MG    1 
HETATM 1656 MG MG    . MG  E 2 .  ? 12.159 17.279  16.147  1.00 10.00 ? 80  MG  A MG    1 
HETATM 1657 O  O     . HOH F 3 .  ? 19.907 13.885  10.548  1.00 10.00 ? 81  HOH A O     1 
HETATM 1658 O  O     . HOH F 3 .  ? 46.380 21.528  48.617  1.00 10.00 ? 82  HOH A O     1 
HETATM 1659 O  O     . HOH F 3 .  ? 26.716 23.097  53.407  1.00 10.00 ? 83  HOH A O     1 
HETATM 1660 O  O     . HOH F 3 .  ? 34.346 8.999   61.939  1.00 10.00 ? 84  HOH A O     1 
HETATM 1661 O  O     . HOH F 3 .  ? 27.676 30.976  59.582  1.00 10.00 ? 85  HOH A O     1 
HETATM 1662 O  O     . HOH F 3 .  ? 35.946 14.377  36.486  1.00 10.00 ? 86  HOH A O     1 
HETATM 1663 O  O     . HOH F 3 .  ? 29.974 4.432   45.433  1.00 10.00 ? 87  HOH A O     1 
HETATM 1664 O  O     . HOH F 3 .  ? 23.131 15.651  24.859  1.00 10.00 ? 88  HOH A O     1 
HETATM 1665 O  O     . HOH F 3 .  ? 41.344 18.048  38.358  1.00 10.00 ? 89  HOH A O     1 
HETATM 1666 O  O     . HOH F 3 .  ? 35.272 29.255  57.407  1.00 10.00 ? 90  HOH A O     1 
HETATM 1667 O  O     . HOH F 3 .  ? 27.663 12.958  46.731  1.00 10.00 ? 91  HOH A O     1 
HETATM 1668 O  O     . HOH F 3 .  ? 21.037 13.926  27.962  1.00 10.00 ? 92  HOH A O     1 
HETATM 1669 O  O     . HOH F 3 .  ? 20.764 10.800  39.835  1.00 10.00 ? 93  HOH A O     1 
HETATM 1670 O  O     . HOH F 3 .  ? 33.772 16.803  45.225  1.00 10.00 ? 94  HOH A O     1 
HETATM 1671 O  O     . HOH F 3 .  ? 16.572 16.245  62.850  1.00 10.00 ? 95  HOH A O     1 
HETATM 1672 O  O     . HOH F 3 .  ? 21.067 13.392  50.462  1.00 10.00 ? 96  HOH A O     1 
HETATM 1673 O  O     . HOH F 3 .  ? 43.894 21.317  50.121  1.00 10.00 ? 97  HOH A O     1 
HETATM 1674 O  O     . HOH F 3 .  ? 33.201 18.863  30.676  1.00 10.00 ? 98  HOH A O     1 
HETATM 1675 O  O     . HOH F 3 .  ? 30.639 15.763  75.316  1.00 10.00 ? 99  HOH A O     1 
HETATM 1676 O  O     . HOH F 3 .  ? 34.561 21.351  62.304  1.00 10.00 ? 100 HOH A O     1 
HETATM 1677 O  O     . HOH F 3 .  ? 31.624 8.243   31.358  1.00 10.00 ? 101 HOH A O     1 
HETATM 1678 O  O     . HOH F 3 .  ? 31.766 27.139  35.517  1.00 10.00 ? 102 HOH A O     1 
HETATM 1679 O  O     . HOH F 3 .  ? 12.106 3.838   50.102  1.00 10.00 ? 103 HOH A O     1 
HETATM 1680 O  O     . HOH F 3 .  ? 25.991 17.814  25.026  1.00 10.00 ? 104 HOH A O     1 
HETATM 1681 O  O     . HOH F 3 .  ? 27.777 12.435  70.560  1.00 10.00 ? 105 HOH A O     1 
HETATM 1682 O  O     . HOH F 3 .  ? 46.855 -34.591 152.767 1.00 10.00 ? 106 HOH A O     1 
HETATM 1683 O  O     . HOH F 3 .  ? 22.318 11.853  58.297  1.00 10.00 ? 107 HOH A O     1 
HETATM 1684 O  O     . HOH F 3 .  ? 15.020 11.907  27.680  1.00 10.00 ? 108 HOH A O     1 
HETATM 1685 O  O     . HOH F 3 .  ? 23.931 8.170   46.651  1.00 10.00 ? 109 HOH A O     1 
HETATM 1686 O  O     . HOH F 3 .  ? 41.105 15.025  61.149  1.00 10.00 ? 110 HOH A O     1 
HETATM 1687 O  O     . HOH F 3 .  ? 15.468 11.661  74.042  1.00 10.00 ? 111 HOH A O     1 
HETATM 1688 O  O     . HOH F 3 .  ? 31.466 19.090  28.370  1.00 10.00 ? 112 HOH A O     1 
HETATM 1689 O  O     . HOH F 3 .  ? 21.299 22.636  71.021  1.00 10.00 ? 113 HOH A O     1 
HETATM 1690 O  O     . HOH F 3 .  ? 42.937 -41.201 151.289 1.00 10.00 ? 114 HOH A O     1 
HETATM 1691 O  O     . HOH F 3 .  ? 30.669 10.813  43.839  1.00 10.00 ? 115 HOH A O     1 
HETATM 1692 O  O     . HOH F 3 .  ? 31.744 30.047  38.013  1.00 10.00 ? 116 HOH A O     1 
HETATM 1693 O  O     . HOH F 3 .  ? 28.446 3.020   49.259  1.00 10.00 ? 117 HOH A O     1 
HETATM 1694 O  O     . HOH F 3 .  ? 24.511 14.067  49.402  1.00 10.00 ? 118 HOH A O     1 
HETATM 1695 O  O     . HOH F 3 .  ? 26.714 2.738   39.708  1.00 10.00 ? 119 HOH A O     1 
HETATM 1696 O  O     . HOH F 3 .  ? 11.514 8.825   48.574  1.00 10.00 ? 120 HOH A O     1 
HETATM 1697 O  O     . HOH F 3 .  ? 27.516 17.941  65.614  1.00 10.00 ? 121 HOH A O     1 
HETATM 1698 O  O     . HOH F 3 .  ? 35.072 20.713  66.173  1.00 10.00 ? 122 HOH A O     1 
HETATM 1699 O  O     . HOH F 3 .  ? 27.556 13.146  75.112  1.00 10.00 ? 123 HOH A O     1 
HETATM 1700 O  O     . HOH F 3 .  ? 16.345 -0.180  42.617  1.00 10.00 ? 124 HOH A O     1 
HETATM 1701 O  O     . HOH F 3 .  ? 32.318 29.528  6.635   1.00 10.00 ? 125 HOH A O     1 
HETATM 1702 O  O     . HOH F 3 .  ? 33.924 19.555  58.974  1.00 10.00 ? 126 HOH A O     1 
HETATM 1703 O  O     . HOH F 3 .  ? 14.895 9.473   28.218  1.00 10.00 ? 127 HOH A O     1 
HETATM 1704 O  O     . HOH F 3 .  ? 30.450 29.364  33.848  1.00 10.00 ? 128 HOH A O     1 
HETATM 1705 O  O     . HOH F 3 .  ? 20.983 15.964  44.635  1.00 10.00 ? 129 HOH A O     1 
HETATM 1706 O  O     . HOH F 3 .  ? 25.614 5.272   47.978  1.00 10.00 ? 130 HOH A O     1 
HETATM 1707 O  O     . HOH F 3 .  ? 25.276 27.804  72.655  1.00 10.00 ? 131 HOH A O     1 
HETATM 1708 O  O     . HOH F 3 .  ? 33.501 8.562   45.120  1.00 10.00 ? 132 HOH A O     1 
HETATM 1709 O  O     . HOH F 3 .  ? 25.233 23.091  42.695  1.00 10.00 ? 133 HOH A O     1 
HETATM 1710 O  O     . HOH F 3 .  ? 19.434 45.552  62.355  1.00 10.00 ? 134 HOH A O     1 
HETATM 1711 O  O     . HOH F 3 .  ? 25.633 2.874   52.727  1.00 10.00 ? 135 HOH A O     1 
HETATM 1712 O  O     . HOH F 3 .  ? 18.713 20.248  48.201  1.00 10.00 ? 136 HOH A O     1 
HETATM 1713 O  O     . HOH F 3 .  ? 15.845 18.452  65.181  1.00 10.00 ? 137 HOH A O     1 
HETATM 1714 O  O     . HOH F 3 .  ? -4.954 38.668  56.698  1.00 10.00 ? 138 HOH A O     1 
HETATM 1715 O  O     . HOH F 3 .  ? 39.271 8.891   42.395  1.00 10.00 ? 139 HOH A O     1 
HETATM 1716 O  O     . HOH F 3 .  ? 33.402 12.728  63.624  1.00 10.00 ? 140 HOH A O     1 
HETATM 1717 O  O     . HOH F 3 .  ? 31.321 19.054  24.159  1.00 10.00 ? 141 HOH A O     1 
HETATM 1718 O  O     . HOH F 3 .  ? 31.213 25.261  71.644  1.00 10.00 ? 142 HOH A O     1 
HETATM 1719 O  O     . HOH F 3 .  ? 19.909 7.721   15.031  1.00 10.00 ? 143 HOH A O     1 
HETATM 1720 O  O     . HOH F 3 .  ? 33.897 13.466  48.253  1.00 10.00 ? 144 HOH A O     1 
HETATM 1721 O  O     . HOH F 3 .  ? 42.072 8.598   40.333  1.00 10.00 ? 145 HOH A O     1 
HETATM 1722 O  O     . HOH F 3 .  ? 43.932 10.191  37.170  1.00 10.00 ? 146 HOH A O     1 
HETATM 1723 O  O     . HOH F 3 .  ? 42.239 11.187  39.203  1.00 10.00 ? 147 HOH A O     1 
HETATM 1724 O  O     . HOH F 3 .  ? 43.765 7.602   38.300  1.00 10.00 ? 148 HOH A O     1 
HETATM 1725 O  O     . HOH F 3 .  ? 41.404 9.002   37.615  1.00 10.00 ? 149 HOH A O     1 
HETATM 1726 O  O     . HOH F 3 .  ? 45.111 20.557  34.367  1.00 10.00 ? 150 HOH A O     1 
HETATM 1727 O  O     . HOH F 3 .  ? 44.024 18.563  36.055  1.00 10.00 ? 151 HOH A O     1 
HETATM 1728 O  O     . HOH F 3 .  ? 46.981 18.687  33.364  1.00 10.00 ? 152 HOH A O     1 
HETATM 1729 O  O     . HOH F 3 .  ? 46.791 19.141  36.148  1.00 10.00 ? 153 HOH A O     1 
HETATM 1730 O  O     . HOH F 3 .  ? 24.212 20.162  42.375  1.00 10.00 ? 154 HOH A O     1 
HETATM 1731 O  O     . HOH F 3 .  ? 25.493 20.766  46.115  1.00 10.00 ? 155 HOH A O     1 
HETATM 1732 O  O     . HOH F 3 .  ? 26.737 20.567  43.583  1.00 10.00 ? 156 HOH A O     1 
HETATM 1733 O  O     . HOH F 3 .  ? 22.968 20.361  44.907  1.00 10.00 ? 157 HOH A O     1 
HETATM 1734 O  O     . HOH F 3 .  ? 25.048 18.489  44.498  1.00 10.00 ? 158 HOH A O     1 
HETATM 1735 O  O     . HOH F 3 .  ? 24.657 22.439  43.993  1.00 10.00 ? 159 HOH A O     1 
HETATM 1736 O  O     . HOH F 3 .  ? 11.267 17.480  14.368  1.00 10.00 ? 160 HOH A O     1 
HETATM 1737 O  O     . HOH F 3 .  ? 13.049 17.078  17.925  1.00 10.00 ? 161 HOH A O     1 
HETATM 1738 O  O     . HOH F 3 .  ? 12.742 19.191  16.070  1.00 10.00 ? 162 HOH A O     1 
HETATM 1739 O  O     . HOH F 3 .  ? 11.575 15.367  16.225  1.00 10.00 ? 163 HOH A O     1 
HETATM 1740 O  O     . HOH F 3 .  ? 13.851 16.726  15.237  1.00 10.00 ? 164 HOH A O     1 
# 
loop_
_pdbx_poly_seq_scheme.asym_id 
_pdbx_poly_seq_scheme.entity_id 
_pdbx_poly_seq_scheme.seq_id 
_pdbx_poly_seq_scheme.mon_id 
_pdbx_poly_seq_scheme.ndb_seq_num 
_pdbx_poly_seq_scheme.pdb_seq_num 
_pdbx_poly_seq_scheme.auth_seq_num 
_pdbx_poly_seq_scheme.pdb_mon_id 
_pdbx_poly_seq_scheme.auth_mon_id 
_pdbx_poly_seq_scheme.pdb_strand_id 
_pdbx_poly_seq_scheme.pdb_ins_code 
_pdbx_poly_seq_scheme.hetero 
A 1 1  G   1  1  1  G   G   A . n 
A 1 2  C   2  2  2  C   C   A . n 
A 1 3  G   3  3  3  G   G   A . n 
A 1 4  G   4  4  4  G   G   A . n 
A 1 5  A   5  5  5  A   A   A . n 
A 1 6  U   6  6  6  U   U   A . n 
A 1 7  U   7  7  7  U   U   A . n 
A 1 8  U   8  8  8  U   U   A . n 
A 1 9  A   9  9  9  A   A   A . n 
A 1 10 2MG 10 10 10 2MG 2MG A . n 
A 1 11 C   11 11 11 C   C   A . n 
A 1 12 U   12 12 12 U   U   A . n 
A 1 13 C   13 13 13 C   C   A . n 
A 1 14 A   14 14 14 A   A   A . n 
A 1 15 G   15 15 15 G   G   A . n 
A 1 16 H2U 16 16 16 H2U H2U A . n 
A 1 17 H2U 17 17 17 H2U H2U A . n 
A 1 18 G   18 18 18 G   G   A . n 
A 1 19 G   19 19 19 G   G   A . n 
A 1 20 G   20 20 20 G   G   A . n 
A 1 21 A   21 21 21 A   A   A . n 
A 1 22 G   22 22 22 G   G   A . n 
A 1 23 A   23 23 23 A   A   A . n 
A 1 24 G   24 24 24 G   G   A . n 
A 1 25 C   25 25 25 C   C   A . n 
A 1 26 M2G 26 26 26 M2G M2G A . n 
A 1 27 C   27 27 27 C   C   A . n 
A 1 28 C   28 28 28 C   C   A . n 
A 1 29 A   29 29 29 A   A   A . n 
A 1 30 G   30 30 30 G   G   A . n 
A 1 31 A   31 31 31 A   A   A . n 
A 1 32 OMC 32 32 32 OMC OMC A . n 
A 1 33 U   33 33 33 U   U   A . n 
A 1 34 OMG 34 34 34 OMG OMG A . n 
A 1 35 A   35 35 35 A   A   A . n 
A 1 36 A   36 36 36 A   A   A . n 
A 1 37 YG  37 37 37 YG  YG  A . n 
A 1 38 A   38 38 38 A   A   A . n 
A 1 39 PSU 39 39 39 PSU PSU A . n 
A 1 40 5MC 40 40 40 5MC 5MC A . n 
A 1 41 U   41 41 41 U   U   A . n 
A 1 42 G   42 42 42 G   G   A . n 
A 1 43 G   43 43 43 G   G   A . n 
A 1 44 A   44 44 44 A   A   A . n 
A 1 45 G   45 45 45 G   G   A . n 
A 1 46 7MG 46 46 46 7MG 7MG A . n 
A 1 47 U   47 47 47 U   U   A . n 
A 1 48 C   48 48 48 C   C   A . n 
A 1 49 5MC 49 49 49 5MC 5MC A . n 
A 1 50 U   50 50 50 U   U   A . n 
A 1 51 G   51 51 51 G   G   A . n 
A 1 52 U   52 52 52 U   U   A . n 
A 1 53 G   53 53 53 G   G   A . n 
A 1 54 5MU 54 54 54 5MU 5MU A . n 
A 1 55 PSU 55 55 55 PSU PSU A . n 
A 1 56 C   56 56 56 C   C   A . n 
A 1 57 G   57 57 57 G   G   A . n 
A 1 58 1MA 58 58 58 1MA 1MA A . n 
A 1 59 U   59 59 59 U   U   A . n 
A 1 60 C   60 60 60 C   C   A . n 
A 1 61 C   61 61 61 C   C   A . n 
A 1 62 A   62 62 62 A   A   A . n 
A 1 63 C   63 63 63 C   C   A . n 
A 1 64 A   64 64 64 A   A   A . n 
A 1 65 G   65 65 65 G   G   A . n 
A 1 66 A   66 66 66 A   A   A . n 
A 1 67 A   67 67 67 A   A   A . n 
A 1 68 U   68 68 68 U   U   A . n 
A 1 69 U   69 69 69 U   U   A . n 
A 1 70 C   70 70 70 C   C   A . n 
A 1 71 G   71 71 71 G   G   A . n 
A 1 72 C   72 72 72 C   C   A . n 
A 1 73 A   73 73 73 A   A   A . n 
A 1 74 C   74 74 74 C   C   A . n 
A 1 75 C   75 75 75 C   C   A . n 
A 1 76 A   76 76 76 A   A   A . n 
# 
loop_
_pdbx_nonpoly_scheme.asym_id 
_pdbx_nonpoly_scheme.entity_id 
_pdbx_nonpoly_scheme.mon_id 
_pdbx_nonpoly_scheme.ndb_seq_num 
_pdbx_nonpoly_scheme.pdb_seq_num 
_pdbx_nonpoly_scheme.auth_seq_num 
_pdbx_nonpoly_scheme.pdb_mon_id 
_pdbx_nonpoly_scheme.auth_mon_id 
_pdbx_nonpoly_scheme.pdb_strand_id 
_pdbx_nonpoly_scheme.pdb_ins_code 
B 2 MG  1  77  77  MG  MO5 A . 
C 2 MG  1  78  78  MG  MO4 A . 
D 2 MG  1  79  79  MG  MO6 A . 
E 2 MG  1  80  80  MG  MO5 A . 
F 3 HOH 1  81  81  HOH HOH A . 
F 3 HOH 2  82  82  HOH HOH A . 
F 3 HOH 3  83  83  HOH HOH A . 
F 3 HOH 4  84  84  HOH HOH A . 
F 3 HOH 5  85  85  HOH HOH A . 
F 3 HOH 6  86  86  HOH HOH A . 
F 3 HOH 7  87  87  HOH HOH A . 
F 3 HOH 8  88  88  HOH HOH A . 
F 3 HOH 9  89  89  HOH HOH A . 
F 3 HOH 10 90  90  HOH HOH A . 
F 3 HOH 11 91  91  HOH HOH A . 
F 3 HOH 12 92  92  HOH HOH A . 
F 3 HOH 13 93  93  HOH HOH A . 
F 3 HOH 14 94  94  HOH HOH A . 
F 3 HOH 15 95  95  HOH HOH A . 
F 3 HOH 16 96  96  HOH HOH A . 
F 3 HOH 17 97  97  HOH HOH A . 
F 3 HOH 18 98  98  HOH HOH A . 
F 3 HOH 19 99  99  HOH HOH A . 
F 3 HOH 20 100 100 HOH HOH A . 
F 3 HOH 21 101 101 HOH HOH A . 
F 3 HOH 22 102 102 HOH HOH A . 
F 3 HOH 23 103 103 HOH HOH A . 
F 3 HOH 24 104 104 HOH HOH A . 
F 3 HOH 25 105 105 HOH HOH A . 
F 3 HOH 26 106 106 HOH HOH A . 
F 3 HOH 27 107 107 HOH HOH A . 
F 3 HOH 28 108 108 HOH HOH A . 
F 3 HOH 29 109 109 HOH HOH A . 
F 3 HOH 30 110 110 HOH HOH A . 
F 3 HOH 31 111 111 HOH HOH A . 
F 3 HOH 32 112 112 HOH HOH A . 
F 3 HOH 33 113 113 HOH HOH A . 
F 3 HOH 34 114 114 HOH HOH A . 
F 3 HOH 35 115 115 HOH HOH A . 
F 3 HOH 36 116 116 HOH HOH A . 
F 3 HOH 37 117 117 HOH HOH A . 
F 3 HOH 38 118 118 HOH HOH A . 
F 3 HOH 39 119 119 HOH HOH A . 
F 3 HOH 40 120 120 HOH HOH A . 
F 3 HOH 41 121 121 HOH HOH A . 
F 3 HOH 42 122 122 HOH HOH A . 
F 3 HOH 43 123 123 HOH HOH A . 
F 3 HOH 44 124 124 HOH HOH A . 
F 3 HOH 45 125 125 HOH HOH A . 
F 3 HOH 46 126 126 HOH HOH A . 
F 3 HOH 47 127 127 HOH HOH A . 
F 3 HOH 48 128 128 HOH HOH A . 
F 3 HOH 49 129 129 HOH HOH A . 
F 3 HOH 50 130 130 HOH HOH A . 
F 3 HOH 51 131 131 HOH HOH A . 
F 3 HOH 52 132 132 HOH HOH A . 
F 3 HOH 53 133 133 HOH HOH A . 
F 3 HOH 54 134 134 HOH HOH A . 
F 3 HOH 55 135 135 HOH HOH A . 
F 3 HOH 56 136 136 HOH HOH A . 
F 3 HOH 57 137 137 HOH HOH A . 
F 3 HOH 58 138 138 HOH HOH A . 
F 3 HOH 59 139 139 HOH HOH A . 
F 3 HOH 60 140 140 HOH HOH A . 
F 3 HOH 61 141 141 HOH HOH A . 
F 3 HOH 62 142 142 HOH HOH A . 
F 3 HOH 63 143 143 HOH HOH A . 
F 3 HOH 64 144 144 HOH HOH A . 
F 3 HOH 65 145 77  HOH MO5 A . 
F 3 HOH 66 146 77  HOH MO5 A . 
F 3 HOH 67 147 77  HOH MO5 A . 
F 3 HOH 68 148 77  HOH MO5 A . 
F 3 HOH 69 149 77  HOH MO5 A . 
F 3 HOH 70 150 78  HOH MO4 A . 
F 3 HOH 71 151 78  HOH MO4 A . 
F 3 HOH 72 152 78  HOH MO4 A . 
F 3 HOH 73 153 78  HOH MO4 A . 
F 3 HOH 74 154 79  HOH MO6 A . 
F 3 HOH 75 155 79  HOH MO6 A . 
F 3 HOH 76 156 79  HOH MO6 A . 
F 3 HOH 77 157 79  HOH MO6 A . 
F 3 HOH 78 158 79  HOH MO6 A . 
F 3 HOH 79 159 79  HOH MO6 A . 
F 3 HOH 80 160 80  HOH MO5 A . 
F 3 HOH 81 161 80  HOH MO5 A . 
F 3 HOH 82 162 80  HOH MO5 A . 
F 3 HOH 83 163 80  HOH MO5 A . 
F 3 HOH 84 164 80  HOH MO5 A . 
# 
loop_
_pdbx_struct_mod_residue.id 
_pdbx_struct_mod_residue.label_asym_id 
_pdbx_struct_mod_residue.label_comp_id 
_pdbx_struct_mod_residue.label_seq_id 
_pdbx_struct_mod_residue.auth_asym_id 
_pdbx_struct_mod_residue.auth_comp_id 
_pdbx_struct_mod_residue.auth_seq_id 
_pdbx_struct_mod_residue.PDB_ins_code 
_pdbx_struct_mod_residue.parent_comp_id 
_pdbx_struct_mod_residue.details 
1  A 2MG 10 A 2MG 10 ? G "2N-METHYLGUANOSINE-5'-MONOPHOSPHATE"   
2  A H2U 16 A H2U 16 ? U "5,6-DIHYDROURIDINE-5'-MONOPHOSPHATE"   
3  A H2U 17 A H2U 17 ? U "5,6-DIHYDROURIDINE-5'-MONOPHOSPHATE"   
4  A M2G 26 A M2G 26 ? G "N2-DIMETHYLGUANOSINE-5'-MONOPHOSPHATE" 
5  A OMC 32 A OMC 32 ? C "O2'-METHYLYCYTIDINE-5'-MONOPHOSPHATE"  
6  A OMG 34 A OMG 34 ? G "O2'-METHYLGUANOSINE-5'-MONOPHOSPHATE"  
7  A YG  37 A YG  37 ? G WYBUTOSINE                              
8  A PSU 39 A PSU 39 ? U "PSEUDOURIDINE-5'-MONOPHOSPHATE"        
9  A 5MC 40 A 5MC 40 ? C "5-METHYLCYTIDINE-5'-MONOPHOSPHATE"     
10 A 7MG 46 A 7MG 46 ? G ?                                       
11 A 5MC 49 A 5MC 49 ? C "5-METHYLCYTIDINE-5'-MONOPHOSPHATE"     
12 A 5MU 54 A 5MU 54 ? U 
;5-METHYLURIDINE 5'-MONOPHOSPHATE
;
13 A PSU 55 A PSU 55 ? U "PSEUDOURIDINE-5'-MONOPHOSPHATE"        
14 A 1MA 58 A 1MA 58 ? A ?                                       
# 
_pdbx_struct_assembly.id                   1 
_pdbx_struct_assembly.details              author_defined_assembly 
_pdbx_struct_assembly.method_details       ? 
_pdbx_struct_assembly.oligomeric_details   monomeric 
_pdbx_struct_assembly.oligomeric_count     1 
# 
_pdbx_struct_assembly_gen.assembly_id       1 
_pdbx_struct_assembly_gen.oper_expression   1 
_pdbx_struct_assembly_gen.asym_id_list      A,B,C,D,E,F 
# 
_pdbx_struct_oper_list.id                   1 
_pdbx_struct_oper_list.type                 'identity operation' 
_pdbx_struct_oper_list.name                 1_555 
_pdbx_struct_oper_list.symmetry_operation   x,y,z 
_pdbx_struct_oper_list.matrix[1][1]         1.0000000000 
_pdbx_struct_oper_list.matrix[1][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[1][3]         0.0000000000 
_pdbx_struct_oper_list.vector[1]            0.0000000000 
_pdbx_struct_oper_list.matrix[2][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[2][2]         1.0000000000 
_pdbx_struct_oper_list.matrix[2][3]         0.0000000000 
_pdbx_struct_oper_list.vector[2]            0.0000000000 
_pdbx_struct_oper_list.matrix[3][1]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][2]         0.0000000000 
_pdbx_struct_oper_list.matrix[3][3]         1.0000000000 
_pdbx_struct_oper_list.vector[3]            0.0000000000 
# 
loop_
_pdbx_struct_conn_angle.id 
_pdbx_struct_conn_angle.ptnr1_label_atom_id 
_pdbx_struct_conn_angle.ptnr1_label_alt_id 
_pdbx_struct_conn_angle.ptnr1_label_asym_id 
_pdbx_struct_conn_angle.ptnr1_label_comp_id 
_pdbx_struct_conn_angle.ptnr1_label_seq_id 
_pdbx_struct_conn_angle.ptnr1_auth_atom_id 
_pdbx_struct_conn_angle.ptnr1_auth_asym_id 
_pdbx_struct_conn_angle.ptnr1_auth_comp_id 
_pdbx_struct_conn_angle.ptnr1_auth_seq_id 
_pdbx_struct_conn_angle.ptnr1_PDB_ins_code 
_pdbx_struct_conn_angle.ptnr1_symmetry 
_pdbx_struct_conn_angle.ptnr2_label_atom_id 
_pdbx_struct_conn_angle.ptnr2_label_alt_id 
_pdbx_struct_conn_angle.ptnr2_label_asym_id 
_pdbx_struct_conn_angle.ptnr2_label_comp_id 
_pdbx_struct_conn_angle.ptnr2_label_seq_id 
_pdbx_struct_conn_angle.ptnr2_auth_atom_id 
_pdbx_struct_conn_angle.ptnr2_auth_asym_id 
_pdbx_struct_conn_angle.ptnr2_auth_comp_id 
_pdbx_struct_conn_angle.ptnr2_auth_seq_id 
_pdbx_struct_conn_angle.ptnr2_PDB_ins_code 
_pdbx_struct_conn_angle.ptnr2_symmetry 
_pdbx_struct_conn_angle.ptnr3_label_atom_id 
_pdbx_struct_conn_angle.ptnr3_label_alt_id 
_pdbx_struct_conn_angle.ptnr3_label_asym_id 
_pdbx_struct_conn_angle.ptnr3_label_comp_id 
_pdbx_struct_conn_angle.ptnr3_label_seq_id 
_pdbx_struct_conn_angle.ptnr3_auth_atom_id 
_pdbx_struct_conn_angle.ptnr3_auth_asym_id 
_pdbx_struct_conn_angle.ptnr3_auth_comp_id 
_pdbx_struct_conn_angle.ptnr3_auth_seq_id 
_pdbx_struct_conn_angle.ptnr3_PDB_ins_code 
_pdbx_struct_conn_angle.ptnr3_symmetry 
_pdbx_struct_conn_angle.value 
_pdbx_struct_conn_angle.value_esd 
1  O   ? F HOH .  ? A HOH 149 ? 1_555 MG ? B MG . ? A MG 77 ? 1_555 O   ? F HOH .  ? A HOH 146 ? 1_555 90.0  ? 
2  O   ? F HOH .  ? A HOH 149 ? 1_555 MG ? B MG . ? A MG 77 ? 1_555 O   ? F HOH .  ? A HOH 147 ? 1_555 90.0  ? 
3  O   ? F HOH .  ? A HOH 146 ? 1_555 MG ? B MG . ? A MG 77 ? 1_555 O   ? F HOH .  ? A HOH 147 ? 1_555 90.0  ? 
4  O   ? F HOH .  ? A HOH 149 ? 1_555 MG ? B MG . ? A MG 77 ? 1_555 O   ? F HOH .  ? A HOH 148 ? 1_555 90.0  ? 
5  O   ? F HOH .  ? A HOH 146 ? 1_555 MG ? B MG . ? A MG 77 ? 1_555 O   ? F HOH .  ? A HOH 148 ? 1_555 90.0  ? 
6  O   ? F HOH .  ? A HOH 147 ? 1_555 MG ? B MG . ? A MG 77 ? 1_555 O   ? F HOH .  ? A HOH 148 ? 1_555 180.0 ? 
7  O   ? F HOH .  ? A HOH 149 ? 1_555 MG ? B MG . ? A MG 77 ? 1_555 O   ? F HOH .  ? A HOH 145 ? 1_555 90.0  ? 
8  O   ? F HOH .  ? A HOH 146 ? 1_555 MG ? B MG . ? A MG 77 ? 1_555 O   ? F HOH .  ? A HOH 145 ? 1_555 180.0 ? 
9  O   ? F HOH .  ? A HOH 147 ? 1_555 MG ? B MG . ? A MG 77 ? 1_555 O   ? F HOH .  ? A HOH 145 ? 1_555 90.1  ? 
10 O   ? F HOH .  ? A HOH 148 ? 1_555 MG ? B MG . ? A MG 77 ? 1_555 O   ? F HOH .  ? A HOH 145 ? 1_555 89.9  ? 
11 O   ? F HOH .  ? A HOH 149 ? 1_555 MG ? B MG . ? A MG 77 ? 1_555 OP1 ? A G   19 ? A G   19  ? 1_555 175.8 ? 
12 O   ? F HOH .  ? A HOH 146 ? 1_555 MG ? B MG . ? A MG 77 ? 1_555 OP1 ? A G   19 ? A G   19  ? 1_555 91.1  ? 
13 O   ? F HOH .  ? A HOH 147 ? 1_555 MG ? B MG . ? A MG 77 ? 1_555 OP1 ? A G   19 ? A G   19  ? 1_555 86.0  ? 
14 O   ? F HOH .  ? A HOH 148 ? 1_555 MG ? B MG . ? A MG 77 ? 1_555 OP1 ? A G   19 ? A G   19  ? 1_555 94.1  ? 
15 O   ? F HOH .  ? A HOH 145 ? 1_555 MG ? B MG . ? A MG 77 ? 1_555 OP1 ? A G   19 ? A G   19  ? 1_555 89.0  ? 
16 O   ? F HOH .  ? A HOH 152 ? 1_555 MG ? C MG . ? A MG 78 ? 1_555 O   ? F HOH .  ? A HOH 151 ? 1_555 180.0 ? 
17 O   ? F HOH .  ? A HOH 152 ? 1_555 MG ? C MG . ? A MG 78 ? 1_555 O   ? F HOH .  ? A HOH 150 ? 1_555 90.0  ? 
18 O   ? F HOH .  ? A HOH 151 ? 1_555 MG ? C MG . ? A MG 78 ? 1_555 O   ? F HOH .  ? A HOH 150 ? 1_555 90.0  ? 
19 O   ? F HOH .  ? A HOH 152 ? 1_555 MG ? C MG . ? A MG 78 ? 1_555 O   ? F HOH .  ? A HOH 153 ? 1_555 90.0  ? 
20 O   ? F HOH .  ? A HOH 151 ? 1_555 MG ? C MG . ? A MG 78 ? 1_555 O   ? F HOH .  ? A HOH 153 ? 1_555 90.0  ? 
21 O   ? F HOH .  ? A HOH 150 ? 1_555 MG ? C MG . ? A MG 78 ? 1_555 O   ? F HOH .  ? A HOH 153 ? 1_555 90.0  ? 
22 O   ? F HOH .  ? A HOH 152 ? 1_555 MG ? C MG . ? A MG 78 ? 1_555 OP1 ? A G   20 ? A G   20  ? 1_555 91.5  ? 
23 O   ? F HOH .  ? A HOH 151 ? 1_555 MG ? C MG . ? A MG 78 ? 1_555 OP1 ? A G   20 ? A G   20  ? 1_555 88.5  ? 
24 O   ? F HOH .  ? A HOH 150 ? 1_555 MG ? C MG . ? A MG 78 ? 1_555 OP1 ? A G   20 ? A G   20  ? 1_555 174.6 ? 
25 O   ? F HOH .  ? A HOH 153 ? 1_555 MG ? C MG . ? A MG 78 ? 1_555 OP1 ? A G   20 ? A G   20  ? 1_555 84.8  ? 
26 O   ? F HOH .  ? A HOH 152 ? 1_555 MG ? C MG . ? A MG 78 ? 1_555 OP2 ? A A   21 ? A A   21  ? 1_555 85.6  ? 
27 O   ? F HOH .  ? A HOH 151 ? 1_555 MG ? C MG . ? A MG 78 ? 1_555 OP2 ? A A   21 ? A A   21  ? 1_555 94.4  ? 
28 O   ? F HOH .  ? A HOH 150 ? 1_555 MG ? C MG . ? A MG 78 ? 1_555 OP2 ? A A   21 ? A A   21  ? 1_555 97.9  ? 
29 O   ? F HOH .  ? A HOH 153 ? 1_555 MG ? C MG . ? A MG 78 ? 1_555 OP2 ? A A   21 ? A A   21  ? 1_555 170.9 ? 
30 OP1 ? A G   20 ? A G   20  ? 1_555 MG ? C MG . ? A MG 78 ? 1_555 OP2 ? A A   21 ? A A   21  ? 1_555 87.4  ? 
31 O   ? F HOH .  ? A HOH 154 ? 1_555 MG ? D MG . ? A MG 79 ? 1_555 O   ? F HOH .  ? A HOH 158 ? 1_555 90.0  ? 
32 O   ? F HOH .  ? A HOH 154 ? 1_555 MG ? D MG . ? A MG 79 ? 1_555 O   ? F HOH .  ? A HOH 156 ? 1_555 90.0  ? 
33 O   ? F HOH .  ? A HOH 158 ? 1_555 MG ? D MG . ? A MG 79 ? 1_555 O   ? F HOH .  ? A HOH 156 ? 1_555 90.0  ? 
34 O   ? F HOH .  ? A HOH 154 ? 1_555 MG ? D MG . ? A MG 79 ? 1_555 O   ? F HOH .  ? A HOH 157 ? 1_555 90.0  ? 
35 O   ? F HOH .  ? A HOH 158 ? 1_555 MG ? D MG . ? A MG 79 ? 1_555 O   ? F HOH .  ? A HOH 157 ? 1_555 90.0  ? 
36 O   ? F HOH .  ? A HOH 156 ? 1_555 MG ? D MG . ? A MG 79 ? 1_555 O   ? F HOH .  ? A HOH 157 ? 1_555 180.0 ? 
37 O   ? F HOH .  ? A HOH 154 ? 1_555 MG ? D MG . ? A MG 79 ? 1_555 O   ? F HOH .  ? A HOH 155 ? 1_555 180.0 ? 
38 O   ? F HOH .  ? A HOH 158 ? 1_555 MG ? D MG . ? A MG 79 ? 1_555 O   ? F HOH .  ? A HOH 155 ? 1_555 90.0  ? 
39 O   ? F HOH .  ? A HOH 156 ? 1_555 MG ? D MG . ? A MG 79 ? 1_555 O   ? F HOH .  ? A HOH 155 ? 1_555 90.0  ? 
40 O   ? F HOH .  ? A HOH 157 ? 1_555 MG ? D MG . ? A MG 79 ? 1_555 O   ? F HOH .  ? A HOH 155 ? 1_555 90.0  ? 
41 O   ? F HOH .  ? A HOH 154 ? 1_555 MG ? D MG . ? A MG 79 ? 1_555 O   ? F HOH .  ? A HOH 159 ? 1_555 90.0  ? 
42 O   ? F HOH .  ? A HOH 158 ? 1_555 MG ? D MG . ? A MG 79 ? 1_555 O   ? F HOH .  ? A HOH 159 ? 1_555 180.0 ? 
43 O   ? F HOH .  ? A HOH 156 ? 1_555 MG ? D MG . ? A MG 79 ? 1_555 O   ? F HOH .  ? A HOH 159 ? 1_555 90.0  ? 
44 O   ? F HOH .  ? A HOH 157 ? 1_555 MG ? D MG . ? A MG 79 ? 1_555 O   ? F HOH .  ? A HOH 159 ? 1_555 90.0  ? 
45 O   ? F HOH .  ? A HOH 155 ? 1_555 MG ? D MG . ? A MG 79 ? 1_555 O   ? F HOH .  ? A HOH 159 ? 1_555 90.0  ? 
46 O   ? F HOH .  ? A HOH 163 ? 1_555 MG ? E MG . ? A MG 80 ? 1_555 O   ? F HOH .  ? A HOH 164 ? 1_555 90.0  ? 
47 O   ? F HOH .  ? A HOH 163 ? 1_555 MG ? E MG . ? A MG 80 ? 1_555 O   ? F HOH .  ? A HOH 160 ? 1_555 90.0  ? 
48 O   ? F HOH .  ? A HOH 164 ? 1_555 MG ? E MG . ? A MG 80 ? 1_555 O   ? F HOH .  ? A HOH 160 ? 1_555 90.0  ? 
49 O   ? F HOH .  ? A HOH 163 ? 1_555 MG ? E MG . ? A MG 80 ? 1_555 O   ? F HOH .  ? A HOH 161 ? 1_555 90.0  ? 
50 O   ? F HOH .  ? A HOH 164 ? 1_555 MG ? E MG . ? A MG 80 ? 1_555 O   ? F HOH .  ? A HOH 161 ? 1_555 90.0  ? 
51 O   ? F HOH .  ? A HOH 160 ? 1_555 MG ? E MG . ? A MG 80 ? 1_555 O   ? F HOH .  ? A HOH 161 ? 1_555 180.0 ? 
52 O   ? F HOH .  ? A HOH 163 ? 1_555 MG ? E MG . ? A MG 80 ? 1_555 O   ? F HOH .  ? A HOH 162 ? 1_555 180.0 ? 
53 O   ? F HOH .  ? A HOH 164 ? 1_555 MG ? E MG . ? A MG 80 ? 1_555 O   ? F HOH .  ? A HOH 162 ? 1_555 90.0  ? 
54 O   ? F HOH .  ? A HOH 160 ? 1_555 MG ? E MG . ? A MG 80 ? 1_555 O   ? F HOH .  ? A HOH 162 ? 1_555 90.0  ? 
55 O   ? F HOH .  ? A HOH 161 ? 1_555 MG ? E MG . ? A MG 80 ? 1_555 O   ? F HOH .  ? A HOH 162 ? 1_555 90.0  ? 
56 O   ? F HOH .  ? A HOH 163 ? 1_555 MG ? E MG . ? A MG 80 ? 1_555 OP2 ? A YG  37 ? A YG  37  ? 1_555 110.3 ? 
57 O   ? F HOH .  ? A HOH 164 ? 1_555 MG ? E MG . ? A MG 80 ? 1_555 OP2 ? A YG  37 ? A YG  37  ? 1_555 149.1 ? 
58 O   ? F HOH .  ? A HOH 160 ? 1_555 MG ? E MG . ? A MG 80 ? 1_555 OP2 ? A YG  37 ? A YG  37  ? 1_555 112.2 ? 
59 O   ? F HOH .  ? A HOH 161 ? 1_555 MG ? E MG . ? A MG 80 ? 1_555 OP2 ? A YG  37 ? A YG  37  ? 1_555 67.8  ? 
60 O   ? F HOH .  ? A HOH 162 ? 1_555 MG ? E MG . ? A MG 80 ? 1_555 OP2 ? A YG  37 ? A YG  37  ? 1_555 69.7  ? 
# 
loop_
_pdbx_audit_revision_history.ordinal 
_pdbx_audit_revision_history.data_content_type 
_pdbx_audit_revision_history.major_revision 
_pdbx_audit_revision_history.minor_revision 
_pdbx_audit_revision_history.revision_date 
1 'Structure model' 1 0 1979-01-16 
2 'Structure model' 1 1 2008-05-22 
3 'Structure model' 1 2 2011-07-13 
# 
_pdbx_audit_revision_details.ordinal             1 
_pdbx_audit_revision_details.revision_ordinal    1 
_pdbx_audit_revision_details.data_content_type   'Structure model' 
_pdbx_audit_revision_details.provider            repository 
_pdbx_audit_revision_details.type                'Initial release' 
_pdbx_audit_revision_details.description         ? 
# 
loop_
_pdbx_audit_revision_group.ordinal 
_pdbx_audit_revision_group.revision_ordinal 
_pdbx_audit_revision_group.data_content_type 
_pdbx_audit_revision_group.group 
1 2 'Structure model' 'Version format compliance' 
2 3 'Structure model' Advisory                    
3 3 'Structure model' 'Version format compliance' 
# 
_software.name             CORELS 
_software.classification   refinement 
_software.version          . 
_software.citation_id      ? 
_software.pdbx_ordinal     1 
# 
_pdbx_database_remark.id     285 
_pdbx_database_remark.text   
;THE ENTRY COORDINATES
ARE NOT PRESENTED IN THE STANDARD CRYSTAL FRAME.
;
# 
loop_
_pdbx_validate_close_contact.id 
_pdbx_validate_close_contact.PDB_model_num 
_pdbx_validate_close_contact.auth_atom_id_1 
_pdbx_validate_close_contact.auth_asym_id_1 
_pdbx_validate_close_contact.auth_comp_id_1 
_pdbx_validate_close_contact.auth_seq_id_1 
_pdbx_validate_close_contact.PDB_ins_code_1 
_pdbx_validate_close_contact.label_alt_id_1 
_pdbx_validate_close_contact.auth_atom_id_2 
_pdbx_validate_close_contact.auth_asym_id_2 
_pdbx_validate_close_contact.auth_comp_id_2 
_pdbx_validate_close_contact.auth_seq_id_2 
_pdbx_validate_close_contact.PDB_ins_code_2 
_pdbx_validate_close_contact.label_alt_id_2 
_pdbx_validate_close_contact.dist 
1  1 OP2   A C   13  ? ? O A HOH 129 ? ? 1.54 
2  1 O     A HOH 133 ? ? O A HOH 159 ? ? 1.56 
3  1 OP2   A A   73  ? ? O A HOH 111 ? ? 1.71 
4  1 "O3'" A U   12  ? ? O A HOH 129 ? ? 1.83 
5  1 OP2   A U   12  ? ? O A HOH 157 ? ? 1.86 
6  1 "C3'" A U   12  ? ? O A HOH 129 ? ? 1.86 
7  1 P     A C   13  ? ? O A HOH 129 ? ? 1.90 
8  1 OP2   A G   4   ? ? O A HOH 140 ? ? 1.97 
9  1 "O3'" A G   45  ? ? O A HOH 102 ? ? 1.98 
10 1 OP2   A U   47  ? ? O A HOH 116 ? ? 1.99 
11 1 "O5'" A C   25  ? ? O A HOH 92  ? ? 2.00 
12 1 O2    A C   2   ? ? O A HOH 105 ? ? 2.02 
13 1 "C4'" A 7MG 46  ? ? O A HOH 102 ? ? 2.04 
14 1 P     A 7MG 46  ? ? O A HOH 102 ? ? 2.04 
15 1 O6    A G   45  ? ? O A HOH 112 ? ? 2.05 
16 1 OP1   A 7MG 46  ? ? O A HOH 102 ? ? 2.06 
17 1 "O3'" A G   45  ? ? O A HOH 128 ? ? 2.08 
18 1 OP2   A C   11  ? ? O A HOH 133 ? ? 2.09 
19 1 "O5'" A 7MG 46  ? ? O A HOH 102 ? ? 2.13 
20 1 OP2   A C   25  ? ? O A HOH 92  ? ? 2.14 
21 1 OP2   A H2U 16  ? ? O A HOH 139 ? ? 2.14 
# 
loop_
_pdbx_validate_symm_contact.id 
_pdbx_validate_symm_contact.PDB_model_num 
_pdbx_validate_symm_contact.auth_atom_id_1 
_pdbx_validate_symm_contact.auth_asym_id_1 
_pdbx_validate_symm_contact.auth_comp_id_1 
_pdbx_validate_symm_contact.auth_seq_id_1 
_pdbx_validate_symm_contact.PDB_ins_code_1 
_pdbx_validate_symm_contact.label_alt_id_1 
_pdbx_validate_symm_contact.site_symmetry_1 
_pdbx_validate_symm_contact.auth_atom_id_2 
_pdbx_validate_symm_contact.auth_asym_id_2 
_pdbx_validate_symm_contact.auth_comp_id_2 
_pdbx_validate_symm_contact.auth_seq_id_2 
_pdbx_validate_symm_contact.PDB_ins_code_2 
_pdbx_validate_symm_contact.label_alt_id_2 
_pdbx_validate_symm_contact.site_symmetry_2 
_pdbx_validate_symm_contact.dist 
1 1 OP1   A G   15 ? ? 1_555 O     A HOH 138 ? ? 3_565 1.75 
2 1 "O2'" A H2U 16 ? ? 1_555 O     A HOH 152 ? ? 3_455 2.11 
3 1 "O2'" A G   43 ? ? 1_555 "O2'" A C   75  ? ? 3_565 2.17 
# 
loop_
_pdbx_validate_rmsd_angle.id 
_pdbx_validate_rmsd_angle.PDB_model_num 
_pdbx_validate_rmsd_angle.auth_atom_id_1 
_pdbx_validate_rmsd_angle.auth_asym_id_1 
_pdbx_validate_rmsd_angle.auth_comp_id_1 
_pdbx_validate_rmsd_angle.auth_seq_id_1 
_pdbx_validate_rmsd_angle.PDB_ins_code_1 
_pdbx_validate_rmsd_angle.label_alt_id_1 
_pdbx_validate_rmsd_angle.auth_atom_id_2 
_pdbx_validate_rmsd_angle.auth_asym_id_2 
_pdbx_validate_rmsd_angle.auth_comp_id_2 
_pdbx_validate_rmsd_angle.auth_seq_id_2 
_pdbx_validate_rmsd_angle.PDB_ins_code_2 
_pdbx_validate_rmsd_angle.label_alt_id_2 
_pdbx_validate_rmsd_angle.auth_atom_id_3 
_pdbx_validate_rmsd_angle.auth_asym_id_3 
_pdbx_validate_rmsd_angle.auth_comp_id_3 
_pdbx_validate_rmsd_angle.auth_seq_id_3 
_pdbx_validate_rmsd_angle.PDB_ins_code_3 
_pdbx_validate_rmsd_angle.label_alt_id_3 
_pdbx_validate_rmsd_angle.angle_value 
_pdbx_validate_rmsd_angle.angle_target_value 
_pdbx_validate_rmsd_angle.angle_deviation 
_pdbx_validate_rmsd_angle.angle_standard_deviation 
_pdbx_validate_rmsd_angle.linker_flag 
1 1 "C3'" A G 18 ? ? "O3'" A G 18 ? ? P     A G   19 ? ? 128.56 119.70 8.86  1.20 Y 
2 1 "C3'" A A 29 ? ? "O3'" A A 29 ? ? P     A G   30 ? ? 112.23 119.70 -7.47 1.20 Y 
3 1 "C3'" A A 38 ? ? "O3'" A A 38 ? ? P     A PSU 39 ? ? 111.27 119.70 -8.43 1.20 Y 
4 1 "C1'" A G 57 ? ? "O4'" A G 57 ? ? "C4'" A G   57 ? ? 103.97 109.70 -5.73 0.70 N 
5 1 "C3'" A A 66 ? ? "O3'" A A 66 ? ? P     A A   67 ? ? 112.45 119.70 -7.25 1.20 Y 
# 
_pdbx_validate_chiral.id              1 
_pdbx_validate_chiral.PDB_model_num   1 
_pdbx_validate_chiral.auth_atom_id    C15 
_pdbx_validate_chiral.label_alt_id    ? 
_pdbx_validate_chiral.auth_asym_id    A 
_pdbx_validate_chiral.auth_comp_id    YG 
_pdbx_validate_chiral.auth_seq_id     37 
_pdbx_validate_chiral.PDB_ins_code    ? 
_pdbx_validate_chiral.details         'WRONG HAND' 
_pdbx_validate_chiral.omega           . 
# 
loop_
_ndb_struct_conf_na.entry_id 
_ndb_struct_conf_na.feature 
6TNA 'double helix'         
6TNA 'a-form double helix'  
6TNA 'parallel strands'     
6TNA 'hairpin loop'         
6TNA 'mismatched base pair' 
6TNA 'four-way junction'    
# 
loop_
_ndb_struct_na_base_pair.model_number 
_ndb_struct_na_base_pair.i_label_asym_id 
_ndb_struct_na_base_pair.i_label_comp_id 
_ndb_struct_na_base_pair.i_label_seq_id 
_ndb_struct_na_base_pair.i_symmetry 
_ndb_struct_na_base_pair.j_label_asym_id 
_ndb_struct_na_base_pair.j_label_comp_id 
_ndb_struct_na_base_pair.j_label_seq_id 
_ndb_struct_na_base_pair.j_symmetry 
_ndb_struct_na_base_pair.shear 
_ndb_struct_na_base_pair.stretch 
_ndb_struct_na_base_pair.stagger 
_ndb_struct_na_base_pair.buckle 
_ndb_struct_na_base_pair.propeller 
_ndb_struct_na_base_pair.opening 
_ndb_struct_na_base_pair.pair_number 
_ndb_struct_na_base_pair.pair_name 
_ndb_struct_na_base_pair.i_auth_asym_id 
_ndb_struct_na_base_pair.i_auth_seq_id 
_ndb_struct_na_base_pair.i_PDB_ins_code 
_ndb_struct_na_base_pair.j_auth_asym_id 
_ndb_struct_na_base_pair.j_auth_seq_id 
_ndb_struct_na_base_pair.j_PDB_ins_code 
_ndb_struct_na_base_pair.hbond_type_28 
_ndb_struct_na_base_pair.hbond_type_12 
1 A G   1  1_555 A C   72 1_555 0.026  -0.375 -0.049 2.492   -14.202 -3.329   1  A_G1:C72_A      A 1  ? A 72 ? 19 1 
1 A C   2  1_555 A G   71 1_555 -0.410 -0.216 -0.023 -2.514  5.358   -7.062   2  A_C2:G71_A      A 2  ? A 71 ? 19 1 
1 A G   3  1_555 A C   70 1_555 -0.062 -0.535 0.458  -0.226  -14.962 -5.130   3  A_G3:C70_A      A 3  ? A 70 ? 19 1 
1 A G   4  1_555 A U   69 1_555 -1.662 -0.607 0.318  5.506   -0.285  4.738    4  A_G4:U69_A      A 4  ? A 69 ? 28 1 
1 A A   5  1_555 A U   68 1_555 0.225  -0.219 0.437  0.060   -9.088  -3.722   5  A_A5:U68_A      A 5  ? A 68 ? 20 1 
1 A U   6  1_555 A A   67 1_555 -0.005 -0.134 0.330  -4.987  -19.913 -2.119   6  A_U6:A67_A      A 6  ? A 67 ? 20 1 
1 A U   7  1_555 A A   66 1_555 -0.449 -0.189 0.088  -3.873  3.658   -8.368   7  A_U7:A66_A      A 7  ? A 66 ? 20 1 
1 A 5MC 49 1_555 A G   65 1_555 0.048  -0.381 -0.007 0.265   -3.971  -2.745   8  A_5MC49:G65_A   A 49 ? A 65 ? 19 1 
1 A U   50 1_555 A A   64 1_555 -0.203 -0.284 0.191  0.235   7.634   -7.451   9  A_U50:A64_A     A 50 ? A 64 ? 20 1 
1 A G   51 1_555 A C   63 1_555 -0.308 -0.356 -0.180 -1.543  -5.215  -5.214   10 A_G51:C63_A     A 51 ? A 63 ? 19 1 
1 A U   52 1_555 A A   62 1_555 -0.078 -0.166 0.209  -0.814  -4.986  -3.100   11 A_U52:A62_A     A 52 ? A 62 ? 20 1 
1 A G   53 1_555 A C   61 1_555 -0.267 0.005  0.212  1.534   -0.824  -0.916   12 A_G53:C61_A     A 53 ? A 61 ? 19 1 
1 A 5MU 54 1_555 A 1MA 58 1_555 4.074  -1.555 0.020  2.007   7.656   -106.907 13 A_5MU54:1MA58_A A 54 ? A 58 ? 24 4 
1 A PSU 55 1_555 A G   18 1_555 0.637  -5.583 0.592  28.228  9.694   -85.761  14 A_PSU55:G18_A   A 55 ? A 18 ? ?  2 
1 A PSU 39 1_555 A A   31 1_555 -1.219 0.133  0.859  2.832   -2.037  -7.234   15 A_PSU39:A31_A   A 39 ? A 31 ? 21 1 
1 A 5MC 40 1_555 A G   30 1_555 -0.213 -0.426 0.028  6.111   -18.204 -2.625   16 A_5MC40:G30_A   A 40 ? A 30 ? 19 1 
1 A U   41 1_555 A A   29 1_555 -0.524 -0.128 -0.064 0.316   2.620   -4.096   17 A_U41:A29_A     A 41 ? A 29 ? 20 1 
1 A G   42 1_555 A C   28 1_555 -0.035 -0.211 -0.079 -2.330  -6.772  0.995    18 A_G42:C28_A     A 42 ? A 28 ? 19 1 
1 A G   43 1_555 A C   27 1_555 -0.662 -0.021 -0.008 -5.610  -14.632 -0.697   19 A_G43:C27_A     A 43 ? A 27 ? 19 1 
1 A A   44 1_555 A M2G 26 1_555 -1.344 1.628  0.065  -22.852 -22.358 -13.189  20 A_A44:M2G26_A   A 44 ? A 26 ? 8  1 
1 A 2MG 10 1_555 A C   25 1_555 -0.023 -0.149 -0.125 -1.193  -5.080  -2.890   21 A_2MG10:C25_A   A 10 ? A 25 ? 19 1 
1 A C   11 1_555 A G   24 1_555 0.120  -0.059 0.395  -3.830  7.523   -1.551   22 A_C11:G24_A     A 11 ? A 24 ? 19 1 
1 A U   12 1_555 A A   23 1_555 -0.045 0.032  0.101  -2.930  -5.508  -4.321   23 A_U12:A23_A     A 12 ? A 23 ? 20 1 
1 A C   13 1_555 A G   22 1_555 0.262  -0.016 0.144  1.635   -2.927  -2.651   24 A_C13:G22_A     A 13 ? A 22 ? 19 1 
1 A A   14 1_555 A U   8  1_555 -3.828 -1.705 1.047  0.925   13.796  -103.019 25 A_A14:U8_A      A 14 ? A 8  ? 24 4 
1 A G   15 1_555 A C   48 1_555 0.063  3.930  -0.097 -1.739  9.428   157.026  26 A_G15:C48_A     A 15 ? A 48 ? 22 2 
1 A G   19 1_555 A C   56 1_555 0.127  -0.342 0.166  -27.288 -25.860 -2.418   27 A_G19:C56_A     A 19 ? A 56 ? 19 1 
# 
loop_
_ndb_struct_na_base_pair_step.model_number 
_ndb_struct_na_base_pair_step.i_label_asym_id_1 
_ndb_struct_na_base_pair_step.i_label_comp_id_1 
_ndb_struct_na_base_pair_step.i_label_seq_id_1 
_ndb_struct_na_base_pair_step.i_symmetry_1 
_ndb_struct_na_base_pair_step.j_label_asym_id_1 
_ndb_struct_na_base_pair_step.j_label_comp_id_1 
_ndb_struct_na_base_pair_step.j_label_seq_id_1 
_ndb_struct_na_base_pair_step.j_symmetry_1 
_ndb_struct_na_base_pair_step.i_label_asym_id_2 
_ndb_struct_na_base_pair_step.i_label_comp_id_2 
_ndb_struct_na_base_pair_step.i_label_seq_id_2 
_ndb_struct_na_base_pair_step.i_symmetry_2 
_ndb_struct_na_base_pair_step.j_label_asym_id_2 
_ndb_struct_na_base_pair_step.j_label_comp_id_2 
_ndb_struct_na_base_pair_step.j_label_seq_id_2 
_ndb_struct_na_base_pair_step.j_symmetry_2 
_ndb_struct_na_base_pair_step.shift 
_ndb_struct_na_base_pair_step.slide 
_ndb_struct_na_base_pair_step.rise 
_ndb_struct_na_base_pair_step.tilt 
_ndb_struct_na_base_pair_step.roll 
_ndb_struct_na_base_pair_step.twist 
_ndb_struct_na_base_pair_step.x_displacement 
_ndb_struct_na_base_pair_step.y_displacement 
_ndb_struct_na_base_pair_step.helical_rise 
_ndb_struct_na_base_pair_step.inclination 
_ndb_struct_na_base_pair_step.tip 
_ndb_struct_na_base_pair_step.helical_twist 
_ndb_struct_na_base_pair_step.step_number 
_ndb_struct_na_base_pair_step.step_name 
_ndb_struct_na_base_pair_step.i_auth_asym_id_1 
_ndb_struct_na_base_pair_step.i_auth_seq_id_1 
_ndb_struct_na_base_pair_step.i_PDB_ins_code_1 
_ndb_struct_na_base_pair_step.j_auth_asym_id_1 
_ndb_struct_na_base_pair_step.j_auth_seq_id_1 
_ndb_struct_na_base_pair_step.j_PDB_ins_code_1 
_ndb_struct_na_base_pair_step.i_auth_asym_id_2 
_ndb_struct_na_base_pair_step.i_auth_seq_id_2 
_ndb_struct_na_base_pair_step.i_PDB_ins_code_2 
_ndb_struct_na_base_pair_step.j_auth_asym_id_2 
_ndb_struct_na_base_pair_step.j_auth_seq_id_2 
_ndb_struct_na_base_pair_step.j_PDB_ins_code_2 
1 A G   1  1_555 A C   72 1_555 A C   2  1_555 A G   71 1_555 -0.245 -2.120 3.259 -5.210 5.508  25.600  -5.941 -0.743 2.746 12.096 
11.442  26.681  1  AA_G1C2:G71C72_AA         A 1  ? A 72 ? A 2  ? A 71 ? 
1 A C   2  1_555 A G   71 1_555 A G   3  1_555 A C   70 1_555 0.515  -1.487 3.101 3.346  5.609  34.254  -3.266 -0.392 2.865 9.416 
-5.618  34.853  2  AA_C2G3:C70G71_AA         A 2  ? A 71 ? A 3  ? A 70 ? 
1 A G   3  1_555 A C   70 1_555 A G   4  1_555 A U   69 1_555 0.763  -1.847 2.686 -0.376 11.478 29.621  -4.896 -1.446 1.850 21.461 
0.703   31.723  3  AA_G3G4:U69C70_AA         A 3  ? A 70 ? A 4  ? A 69 ? 
1 A G   4  1_555 A U   69 1_555 A A   5  1_555 A U   68 1_555 -0.597 -1.563 3.193 -1.420 7.702  40.656  -2.985 0.702  2.881 10.962 
2.021   41.372  4  AA_G4A5:U68U69_AA         A 4  ? A 69 ? A 5  ? A 68 ? 
1 A A   5  1_555 A U   68 1_555 A U   6  1_555 A A   67 1_555 0.222  -1.946 3.313 0.801  6.228  29.894  -4.877 -0.269 2.863 11.909 
-1.531  30.532  5  AA_A5U6:A67U68_AA         A 5  ? A 68 ? A 6  ? A 67 ? 
1 A U   6  1_555 A A   67 1_555 A U   7  1_555 A A   66 1_555 -0.309 -1.635 3.232 0.934  12.110 32.058  -4.497 0.657  2.462 21.009 
-1.620  34.225  6  AA_U6U7:A66A67_AA         A 6  ? A 67 ? A 7  ? A 66 ? 
1 A U   7  1_555 A A   66 1_555 A 5MC 49 1_555 A G   65 1_555 -0.182 -1.877 3.176 2.232  0.248  36.412  -3.032 0.590  3.147 0.396 
-3.568  36.479  7  AA_U75MC49:G65A66_AA      A 7  ? A 66 ? A 49 ? A 65 ? 
1 A 5MC 49 1_555 A G   65 1_555 A U   50 1_555 A A   64 1_555 -0.701 -2.148 3.170 -6.082 2.271  29.738  -4.533 0.159  3.081 4.360 
11.676  30.422  8  AA_5MC49U50:A64G65_AA     A 49 ? A 65 ? A 50 ? A 64 ? 
1 A U   50 1_555 A A   64 1_555 A G   51 1_555 A C   63 1_555 0.073  -1.911 3.116 5.431  10.378 29.336  -5.175 0.734  2.301 19.539 
-10.225 31.541  9  AA_U50G51:C63A64_AA       A 50 ? A 64 ? A 51 ? A 63 ? 
1 A G   51 1_555 A C   63 1_555 A U   52 1_555 A A   62 1_555 -0.035 -1.600 3.536 -4.397 3.920  33.722  -3.372 -0.671 3.312 6.694 
7.509   34.218  10 AA_G51U52:A62C63_AA       A 51 ? A 63 ? A 52 ? A 62 ? 
1 A U   52 1_555 A A   62 1_555 A G   53 1_555 A C   61 1_555 1.098  -1.907 3.005 1.346  -0.489 30.041  -3.581 -1.860 3.080 -0.943 
-2.596  30.074  11 AA_U52G53:C61A62_AA       A 52 ? A 62 ? A 53 ? A 61 ? 
1 A G   53 1_555 A C   61 1_555 A 5MU 54 1_555 A 1MA 58 1_555 -2.404 -2.939 3.410 7.837  -1.425 92.062  -2.010 1.819  3.279 -0.989 
-5.437  92.329  12 AA_G535MU54:1MA58C61_AA   A 53 ? A 61 ? A 54 ? A 58 ? 
1 A 5MU 54 1_555 A 1MA 58 1_555 A PSU 55 1_555 A G   18 1_555 2.246  -2.425 3.424 5.352  11.802 44.655  -4.073 -2.399 2.963 15.158 
-6.874  46.405  13 AA_5MU54PSU55:G181MA58_AA A 54 ? A 58 ? A 55 ? A 18 ? 
1 A PSU 39 1_555 A A   31 1_555 A 5MC 40 1_555 A G   30 1_555 -0.888 -1.100 2.897 2.631  3.477  35.935  -2.191 1.747  2.712 5.611 
-4.245  36.190  14 AA_PSU395MC40:G30A31_AA   A 39 ? A 31 ? A 40 ? A 30 ? 
1 A 5MC 40 1_555 A G   30 1_555 A U   41 1_555 A A   29 1_555 -0.464 -2.586 3.397 -5.366 1.343  30.074  -5.181 -0.219 3.312 2.562 
10.232  30.567  15 AA_5MC40U41:A29G30_AA     A 40 ? A 30 ? A 41 ? A 29 ? 
1 A U   41 1_555 A A   29 1_555 A G   42 1_555 A C   28 1_555 0.221  -1.443 3.527 3.192  6.360  29.831  -4.031 0.235  3.165 12.138 
-6.092  30.649  16 AA_U41G42:C28A29_AA       A 41 ? A 29 ? A 42 ? A 28 ? 
1 A G   42 1_555 A C   28 1_555 A G   43 1_555 A C   27 1_555 0.461  -1.600 3.176 -0.155 4.472  32.388  -3.569 -0.845 2.932 7.969 
0.277   32.687  17 AA_G42G43:C27C28_AA       A 42 ? A 28 ? A 43 ? A 27 ? 
1 A G   43 1_555 A C   27 1_555 A A   44 1_555 A M2G 26 1_555 -0.341 -1.474 3.444 5.819  9.254  33.367  -3.818 1.428  2.849 15.604 
-9.813  35.064  18 AA_G43A44:M2G26C27_AA     A 43 ? A 27 ? A 44 ? A 26 ? 
1 A A   44 1_555 A M2G 26 1_555 A 2MG 10 1_555 A C   25 1_555 -2.861 -2.860 3.268 17.945 12.964 68.336  -2.821 2.964  2.057 11.247 
-15.568 71.416  19 AA_A442MG10:C25M2G26_AA   A 44 ? A 26 ? A 10 ? A 25 ? 
1 A 2MG 10 1_555 A C   25 1_555 A C   11 1_555 A G   24 1_555 -0.800 -1.695 3.070 -6.310 4.079  37.293  -3.086 0.480  2.966 6.300 
9.747   38.016  20 AA_2MG10C11:G24C25_AA     A 10 ? A 25 ? A 11 ? A 24 ? 
1 A C   11 1_555 A G   24 1_555 A U   12 1_555 A A   23 1_555 -0.168 -1.422 3.336 6.073  5.015  31.122  -3.460 1.376  2.991 9.164 
-11.097 32.079  21 AA_C11U12:A23G24_AA       A 11 ? A 24 ? A 12 ? A 23 ? 
1 A U   12 1_555 A A   23 1_555 A C   13 1_555 A G   22 1_555 1.618  -2.021 3.141 4.258  2.864  26.536  -5.030 -2.416 3.126 6.166 
-9.167  27.019  22 AA_U12C13:G22A23_AA       A 12 ? A 23 ? A 13 ? A 22 ? 
1 A C   13 1_555 A G   22 1_555 A A   14 1_555 A U   8  1_555 -2.280 -0.379 3.063 6.891  -9.937 59.863  0.060  2.548  2.835 -9.848 
-6.829  60.961  23 AA_C13A14:U8G22_AA        A 13 ? A 22 ? A 14 ? A 8  ? 
1 A A   14 1_555 A U   8  1_555 A G   15 1_555 A C   48 1_555 2.349  -3.283 3.245 -5.911 15.652 -65.412 2.276  1.861  4.026 
-14.242 -5.379  -67.287 24 AA_A14G15:C48U8_AA        A 14 ? A 8  ? A 15 ? A 48 ? 
# 
loop_
_pdbx_entity_nonpoly.entity_id 
_pdbx_entity_nonpoly.name 
_pdbx_entity_nonpoly.comp_id 
2 'MAGNESIUM ION' MG  
3 water           HOH 
#